U.S. patent application number 12/571196 was filed with the patent office on 2010-06-24 for paramyxovirus vector encoding angiogenesis gene and use thereof.
This patent application is currently assigned to DNAVEC RESEARCH INC.. Invention is credited to Masayuki Fukumura, Mamoru Hasegawa, Xiaogang Hou, Hidenori Matsusaka, Katsuo Sueishi, Hiroyuki Tsutsui, Yoshikazu YONEMITSU.
Application Number | 20100158867 12/571196 |
Document ID | / |
Family ID | 18831146 |
Filed Date | 2010-06-24 |
United States Patent
Application |
20100158867 |
Kind Code |
A1 |
YONEMITSU; Yoshikazu ; et
al. |
June 24, 2010 |
PARAMYXOVIRUS VECTOR ENCODING ANGIOGENESIS GENE AND USE THEREOF
Abstract
The present invention provides Paramyxovirus vectors encoding
angiogenic genes and use of the same. The use of Paramyxovirus
vectors enables effective transfer of angiogenic genes into
individual tissues. FGF2 gene transferred into ischemic tissues in
vivo induces expression of angiogenic genes without causing edema,
and prevents necrosis due to ischemia. The vectors of the present
invention are suitable for gene therapy targeted to ischemic
tissues.
Inventors: |
YONEMITSU; Yoshikazu;
(Fukuoka, JP) ; Sueishi; Katsuo; (Fukuoka, JP)
; Fukumura; Masayuki; (Osaka, JP) ; Hou;
Xiaogang; (Alhambra, CA) ; Hasegawa; Mamoru;
(Ibaraki, JP) ; Matsusaka; Hidenori; (Fukuoka,
JP) ; Tsutsui; Hiroyuki; (Fukuoka, JP) |
Correspondence
Address: |
CLARK & ELBING LLP
101 FEDERAL STREET
BOSTON
MA
02110
US
|
Assignee: |
DNAVEC RESEARCH INC.
Tsukuba-shi
JP
|
Family ID: |
18831146 |
Appl. No.: |
12/571196 |
Filed: |
September 30, 2009 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10444661 |
May 23, 2003 |
|
|
|
12571196 |
|
|
|
|
PCT/JP01/10323 |
Nov 27, 2001 |
|
|
|
10444661 |
|
|
|
|
Current U.S.
Class: |
424/93.2 ;
435/320.1; 514/44R |
Current CPC
Class: |
A61K 48/00 20130101;
C12N 15/86 20130101; C07K 14/50 20130101; C12N 2800/30 20130101;
C12N 2760/18843 20130101 |
Class at
Publication: |
424/93.2 ;
514/44.R; 435/320.1 |
International
Class: |
A61K 35/00 20060101
A61K035/00; A61K 31/7088 20060101 A61K031/7088; A61P 9/00 20060101
A61P009/00; A61P 9/10 20060101 A61P009/10; C12N 15/63 20060101
C12N015/63 |
Foreign Application Data
Date |
Code |
Application Number |
Nov 27, 2000 |
JP |
2000-359374 |
Claims
1. A Paramyxovirus vector encoding an angiogenic gene capable of
being expressed.
2. The Paramyxovirus vector of claim 1, wherein the angiogenic gene
is fibroblast growth factor 2 (FGF2).
3. The Paramyxovirus vector of claim 1, wherein the Paramyxovirus
is Sendai virus.
4. The Paramyxovirus vector of claim 1, wherein said vector lacks
the F gene.
5. An angiogenic composition comprising the Paramyxovirus vector of
claim 1 or a cell containing the vector, and a pharmaceutically
acceptable carrier.
6. An angiogenic composition comprising the Paramyxovirus vector of
claim 2 or a cell containing the vector, and a pharmaceutically
acceptable carrier.
7. An angiogenic composition comprising the Paramyxovirus vector of
claim 3 or a cell containing the vector, and a pharmaceutically
acceptable carrier.
8. An angiogenic composition comprising the Paramyxovirus vector of
claim 4 or a cell containing the vector, and a pharmaceutically
acceptable carrier.
9. A method for inducing angiogenesis, wherein said method
comprises the step of administering the angiogenic composition of
claim 5 to a subject in need of angiogenesis.
10. A method for inducing angiogenesis, wherein said method
comprises the step of administering the angiogenic composition of
claim 6 to a subject in need of angiogenesis.
11. A method for inducing angiogenesis, wherein said method
comprises the step of administering the angiogenic composition of
claim 7 to a subject in need of angiogenesis.
12. A method for inducing angiogenesis, wherein said method
comprises the step of administering the angiogenic composition of
claim 8 to a subject in need of angiogenesis.
13. The method of claim 9, wherein the angiogenic composition is
intramuscularly injected.
14. A method of treating ischemic tissues, wherein said method
comprises the step of administering the angiogenic composition of
claim 5 to a subject in need of angiogenesis, thereby inducing
angiogenesis.
15. A method of treating ischemic tissues, wherein said method
comprises the step of administering the angiogenic composition of
claim 6 to a subject in need of angiogenesis.
16. A method of treating ischemic tissues, wherein said method
comprises the step of administering the angiogenic composition of
claim 7 to a subject in need of angiogenesis.
17. A method of treating ischemic tissues, wherein said method
comprises the step of administering the angiogenic composition of
claim 8 to a subject in need of angiogenesis.
18. The method of claim 14, wherein the angiogenic composition is
intramuscularly injected.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of U.S. application Ser.
No. 10/444,661, filed May 23, 2003, which is a continuation-in-part
of International Application No. PCT/JP01/10323, filed Nov. 27,
2001, which, in turn, claims the benefit of Japanese Patent
Application No. 2000-359374, filed Nov. 27, 2000, the disclosures
of which are hereby incorporated by reference.
FIELD OF THE INVENTION
[0002] The present invention relates to Paramyxovirus vectors
encoding angiogenesis genes and use thereof.
BACKGROUND OF THE INVENTION
[0003] Recent research for treatment of ischemic diseases has been
performed using growth factors that induce angiogenesis. For
example, the therapeutic effect of fibroblast growth factor 2
(FGF2) (Baffour, R. et al., J. Vasc. Surg. 16 (2): 181-91, 1992)
and endothelial cell growth factor (ECGF) (Pu, L. Q. et al., J.
Surg, Res. 54 (6): 575-83, 1993) on patients with cardiac
infarction and acute limb ischemia has been examined. A recent
study has revealed that vascular endothelial growth factor
(VEGF)/vascular permeability factor (VPF) promotes vasculogenesis
in animal models with myocardial ischemia and limb ischemia
(Takeshita, S. et al., Circulation 90 (5 Pt 2): II228-34, 1994;
Takeshita, S. et al., J. Clin, Invest. 93 (2): 662-70, 1994).
[0004] Clinical trials of human gene therapy using angiogenic
growth factors have been undertaken recently. Human gene therapy
has been clinically applied to therapeutic angiogenesis in, order
to treat critical ischemic limb. Vascular endothelial growth
factor/vascular permeability factor (VEGF/VPF), an endothelial
cell-specific mitogen, is a potent therapeutic gene for this
purpose, and it has demonstrated relatively promising results by
means of plasmid-based gene transfer involving human subjects
(Baumgartner, I., et al., Circulation 97, 1114-1123 (1998); Isner,
J. M., et al., J. Vasc. Surg. 28, 964-973 (1998)). However, the
related adverse effects and toxicity levels of intramuscular gene
transfer of VEGF have been less documented at present because
efficiency of plasmid-mediated intramuscular gene transfer and
expression are not very high. Since recent reports indicate that
transgenic (Thurston, G., et al., Science 286, 2511-2514 (1999)) or
adenoviral (Thurston, G., et al., Nature Med. 6, 460-463 (2000))
overexpression of VEGF result in abnormal vasculogenesis in
transgene-introduced animals, and that plasmid-based intramuscular
VEGF gene transfer showed transient edema in human subjects with
ischemic limb (Baumgartner, I., et al., Circulation 97, 1114-1123
(1998); Isner, J. M., et al., J. Vasc. Surg. 28, 964-973 (1998)),
detailed mechanisms to cause these pathologies remain to be
clarified. Other potential unfavorable effects of VEGF over
expression are likely to be the formation of "angioma-like" fragile
capillary vessels, possibly due to the imbalance of angiogenic
signals (Carmeliet, P., Nature Med. 6, 1102-1103 (2000)). VEGF gene
transfer to vessel wall in vivo may cause angiomatousid endothelial
proliferation in the severe neointimal formation associating
extravasation of red blood cells (Yonemitsu, Y., et al., Lab.
Invest. 75, 313-323 (1996)). Similar pathological findings were
demonstrated in retrovirus-mediated constitutive overexpression of
VEGF in myocardium (Lee, R. J., et al., Circulation 102, 898-901
(2000)). Furthermore, another important issue to be addressed in
clinical setting is the level of leakage of locally expressed these
angiogenic factors to systemic circulation. Such leakage may cause
unexpected angiogenic complications associated with diabetic
retinopathy or growth of neoplasm.
[0005] Acute critical limb ischemia, which results from acute
obstruction of the major arteries, is caused mainly by thrombotic
obstruction and is an important target of therapeutic angiogenesis.
Acute critical limb ischemia is treated quite unsuccessfully in
late interventions, often resulting in limb amputation. Moreover,
the long-term prognosis of patients with limb amputation is poor
and one-year survival rates of patients after surgery is only 50%.
Plasmid-based gene expression levels are low and the efficacy of
plasmid-based therapy for acute severe artery occlusion is still
unknown.
SUMMARY OF THE INVENTION
[0006] An objective of the present invention is to provide
Paramyxovirus vectors encoding angiogenic genes and use thereof.
More specifically, the present invention provides Paramyxovirus
vectors encoding angiogenic genes, angiogenic compositions
including the vectors, and methods for promoting angiogenesis in
ischemic tissues using the vectors.
[0007] Preliminary studies by the present inventors indicated
unsuccessful results wherein limb salvage was achieved by means of
plasmid-based human VEGF165 gene transfer in mouse model of acute
critical limb ischemia (data not shown). To test whether higher
expression of transgene may show a better result, the present
inventors used recombinant Sendai virus (SeV)-mediated gene
transfer, a technique that shows highly efficient gene transfer
into various organs. As shown in Examples of this application, the
present inventors used two recombinant SeV vectors as therapeutic
tools for limb ischemia: one expressing human VEGF165 and the other
expressing murine fibroblast growth factor 2 (FGF2). FGF2 (often
referred to as bFGF) protein is a growth factor that shows
angiogenic effect when administrated (Baffour, R. et al., J. Vasc.
Surg. 16: 181-191 (1992)).
[0008] Using these vectors, the present inventors analyzed 1) the
transgene expression level and kinetics of SeV-mediated
intramuscular gene transfer; 2) whether higher expression of
angiogenic factors may prevent limb necrosis caused by acute
critical limb ischemia or any adverse effects; and 3) whether the
higher expression of angiogenic proteins in muscles leads to their
leakage into the systemic circulation.
[0009] The inventors used ischemic mouse models including BALB/c
nu/nu lower limb amputation models (auto-amputation model), in
which the entire external iliac artery and vein and femoral artery
and vein above the knee were excised (critical ischemia model), and
C57BL/6 limb salvage models, which do not lose their lower limbs
due to physiological angiogenesis after the same surgical
procedures as above. Vectors expressing human VEGF165, mouse FGF2,
or luciferase (SeV-hVEGF165, SeV-mFGF2, or SeV-luciferase,
respectively) were constructed and administered to thigh and calf
muscles two days before ischemia surgery. Lower limbs were observed
up to 10 days after surgery.
[0010] In the case of luciferase gene transfer into mouse lower
limb skeletal muscle, SeV showed 5- to 120-fold higher gene
expression levels compared to control plasmid vectors that were
administered in an amount of 100 .mu.g (200 mg/60 kg human body
weight: corresponding to 25 to 50 fold of the clinical dose). In
various cell cultures, both SeV-hVEGF165 and SeV-mFGF2 showed high
protein secretion level (50 to 500 ng/10.sup.5 cells/24 hours).
FGF2 level was increased by 5 to 100 fold by intramuscular
administration of SeV-mFGF2 compared with non-administered control
(base line). In contrast, the administration of SeV-hVEGF165 caused
only limited expression of VEGF in muscle (at most 2 fold above
base line) and significantly increased the expression of endogenous
VEGF. Widespread necrosis was observed in muscle tissues where
SeV-hVEGF165 was administered 2 days after administration and
promoted the amputation of lower limbs. On the other hand,
SeV-mFGF2 administration showed significant therapeutic effect of
limb salvage with an increase in endogenous VEGF expression. In
both cases, no significant leakage of vector-derived proteins into
the serum was observed (<5 .mu.g/ml). All of the limbs were
saved in the non-administered, SeV-luciferase, and SeV-mFGF2
groups, however, one third or more of the SeV-hVEGF group mice in
the limb salvage model lost their lower limbs. In the
auto-amputation model, only the FGF2 group showed a high limb
salvage effect, however, the lower limbs of most of the mice in
other groups was auto-amputated.
[0011] The present invention revealed that intramuscular
administration of recombinant Sendai virus vectors significantly
increased transgene expression. Recombinant Sendai virus vectors
showed 10- to 100-fold higher expression than plasmid vectors.
However, it was found that in vitro administration of recombinant
Sendai virus vectors expressing VEGF165 promoted limb amputation in
the acute severe ischemia mouse model. Administration of
SeV-hVEGF165 induced edema (Example 4, FIG. 8), prevented blood
perfusion after ischemic surgery (Example 5, FIGS. 11 and 12), and
significantly increased the ratio of limb amputation by ischemia
(Example 5, FIGS. 9 and 10). These pathologies would be partly due
to strong vascular permeability increasing activity of VEGF. In
contrast, administration of Sendai virus expressing FGF2
consistently showed high therapeutic effect. In both models, the
fact that no recombinant proteins were detected in the systemic
circulatory system, suggests that SeV-mediated FGF2 therapy has
little effects to other organs and broad safety regions. These
results also indicate that attention must be paid to undesirable
effects caused by VEGF in certain limb conditions in human clinical
applications. Thus, FGF2 gene therapy, which shows a broad range of
safety and therapeutic effect, would be a safe gene therapy system.
Furthermore, the present invention demonstrated the effect of SeV
vector, which is a potent tool for introducing therapeutic genes in
vivo, and enables its use in clinical therapy for acute severe
ischemic limb. Moreover, the present inventors performed gene
therapy on cardiac infarction model animals using a Sendai virus
vector expressing FGF2. Animals were allowed to develop cardiac
infraction due to ligature of coronary artery and FGF2-SeV was
injected to their myocardium, resulting in an increase in the
survival rate compared to individuals to which the control vector
was injected. Thus, Paramyxovirus vectors encoding angiogenic genes
were confirmed to be effective as gene transfer vectors for
ischemic diseases including limb ischemia and myocardiac
infarction.
[0012] The present invention relates to Paramyxovirus vectors
encoding angiogenic genes and use thereof. More specifically, the
present invention relates to:
[0013] (1) a Paramyxovirus vector encoding an angiogenic gene
capable of being expressed;
[0014] (2) the Paramyxovirus vector of (1), wherein the angiogenic
gene is fibroblast growth factor 2 (FGF2);
[0015] (3) the Paramyxovirus vector of (1), wherein the
Paramyxovirus is Sendai virus;
[0016] (4) the Paramyxovirus vector of (1), wherein said vector
lacks the F gene;
[0017] (5) an angiogenic composition comprising the Paramyxovirus
vector of (1) or a cell containing the vector, and a
pharmaceutically acceptable carrier;
[0018] (6) an angiogenic composition comprising the Paramyxovirus
vector of (2) or a cell containing the vector, and a
pharmaceutically acceptable carrier;
[0019] (7) an angiogenic composition comprising the Paramyxovirus
vector of (3) or a cell containing the vector, and a
pharmaceutically acceptable carrier;
[0020] (8) an angiogenic composition comprising the Paramyxovirus
vector of (4) or a cell containing the vector, and a
pharmaceutically acceptable carrier;
[0021] (9) a method for inducing angiogenesis, wherein said method
comprises the step of administering the angiogenic composition of
(5) to a subject in need of angiogenesis;
[0022] (10) a method for inducing angiogenesis, wherein said method
comprises the step of administering the angiogenic composition of
(6) to a subject in need of angiogenesis;
[0023] (11) a method for inducing angiogenesis, wherein said method
comprises the step of administering the angiogenic composition of
(7) to a subject in need of angiogenesis;
[0024] (12) a method for inducing angiogenesis, wherein said method
comprises the step of administering the angiogenic composition of
(8) to a subject in need of angiogenesis;
[0025] (13) the method of (9), wherein the angiogenic composition
is intramuscularly injected;
[0026] (14) a method of treating ischemic tissues, wherein said
method comprises the step of administering the angiogenic
composition of (5) to a subject in need of angiogenesis, thereby
inducing angiogenesis;
[0027] (15) a method of treating ischemic tissues, wherein said
method comprises the step of administering the angiogenic
composition of (6) to a subject in need of angiogenesis;
[0028] (16) a method of treating ischemic tissues, wherein said
method comprises the step of administering the angiogenic
composition of (7) to a subject in need of angiogenesis;
[0029] (17) a method of treating ischemic tissues, wherein said
method comprises the step of administering the angiogenic
composition of (8) to a subject in need of angiogenesis; and
[0030] (18) the method of (14), wherein the angiogenic composition
is intramuscularly injected.
[0031] Using recombinant SeV as a powerful tool for boosting
therapeutic genes in muscles, the present inventors characterized
in vivo effect of angiogenic factors, VEGF165 and FGF2, for acute
severe limb ischemia. Key aspects obtained in this study were; 1)
limb ischemia-induced endogenous VEGF rather diffused to systemic
circulation than concentrated in muscles and the expression of
VEGF165 mediated by the vector of the present invention does not
leak significantly to systemic circulation; 2) exogenous FGF2
expression 5- to 100-fold higher than endogenous one did not result
in significant systemic diffusion; 3) this level of FGF2 expression
also induces endogenous VEGF expression and showed significant limb
salvaging effect associating significantly increased limb blood
perfusion; and 4) overexpression of VEGF165 apparently induced the
limb damage in contrast to that of FGF2. These findings suggest the
clinical feasibility of FGF2 with broader safety range as a
therapeutic angiogenic factor to treat acute critical limb
ischemia. Furthermore, the present inventors are the first to
reveal severe adverse effect of VEGF165 gene transfer for limb
ischemia.
[0032] Interestingly, the present inventors found that limb
ischemia-induced endogenous VEGF rather diffused to systemic
circulation than concentrated in muscle itself. Although ischemic
operation-induced endogenous VEGF expression in muscles and
endothelial cells (ECs) was already addressed (Florkiewicz, R. Z.
et al., J. Cell. Physiol. 162, 388-399 (1995)), the present
inventors are the first to demonstrate that endogenous VEGF seems
responsible for the induction of systemic, but not for local,
angiogenic response. Asahara et al. showed that systemic
administration of VEGF mobilizes endothelial progenitor cells
(EPCs) (Asahara, T. et al., EMBO J. 18, 3964-3972 (1999)),
suggesting that physiological response to limb ischemia forming
collateral vessels is appeared to depend on, to some extent,
EPC-mediated "vasculogenesis-like" neovascularization rather than
on local angiogenesis by proliferating ECs sprouting from
preexisting vessels (Isner J. M., J. Clin. Invest. 106, 615-619
(2000)). Since boosted VEGF in ischemic limb via gene transfer
resulted in lack of significant blood perfusion and in limb
amputation as demonstrated here, in this case, VEGF may dominantly
act as "vascular permeability factor" rather than "angiogenic
factor". This may be also supported by the histology of muscles,
apparently indicating more extensive intermuscular edema in VEGF165
group.
[0033] Secondary, the present inventors showed that FGF2 gene
therapy solely is effective to treat ischemic limb, and involves
endogenous VEGF function in vivo. Even if the total protein
concentration of VEGF in muscle via FGF2 gene transfer was similar
to that of VEGF gene transfer, FGF2 gene therapy itself, but not
VEGF, was sufficiently effective. These findings suggest that not
only VEGF but also FGF2 may be necessary to form mature blood
vessels for therapeutically perfusing blood to ischemic limbs and
to prevent vascular leakage. Furthermore, angiopoietin-1, an
angiogenic factor that prevents vascular leakage of VEGF-induced
immature vessels, may contribute to this.
[0034] The reason why injection of SeV-VEGF165 could not show
comparable expression to SeV-FGF2 or SeV-luciferase in muscle in
vivo is not still fully addressed because SeV-VEGF165 works in
vitro sufficiently to secrete gene product similar to SeV-FGF2.
Similar to histological study, laser Doppler perfusion imaging
(LDPI) showed extensively damaged muscular tissue with lack of
blood perfusion. Thus, it may be possible that cellular machinery
of SeV-mediated transcription including tubulin (Moyer, S. A., et
al., Proc. Natl. Acad. Sci. USA 83, 5405-5409 (1986)) and
phosphoglycerate kinase (Ogino, T., et al., J. Biol. Chem. 274,
35999-36008 (1999)), may be disturbed or altered due to edema
caused by VEGF165-induced tissue damage. Inversely, relatively low
level of exogenous VEGF165 gene expression markedly enhanced
endogenous VEGF (approximately 200 pg/g muscle) in severely
ischemic muscles (1,400 pg/g muscle), resulting in accelerated limb
amputation. These results strongly suggest that enhanced
concentration of VEGF in muscle, even if it is relatively low and
around 2-hold higher than the baseline, can lead limbs to critical
limb ischemia.
[0035] Angiogenesis is considered as a well-harmonized process and
a lot of factors may be involved. Among these factors, the
biological function of VEGF is highly dose-dependent, resulting in
fatal defect even with single loss of allele (Carmeliet, P. et al.,
Nature 380, 435-439 (1996)). Constitutive VEGF expression is
necessary during entire process of vascular integrity and
maturation, because transient VEGF expression only induces
short-lived angiogenic responses (Pettersson, A. et al., Lab.
Invest. 80, 99-115 (2000)), and further, VEGF-induced
capillary-like structure rarely makes connections to preexisting
blood vessels (Springer, M. L., et al., Mol. Cell. 2, 549-558
(1998)). Thus, the present invention suggests that more than 2-fold
higher concentration of VEGF in muscle without sufficient FGF2 is
likely to be seriously toxic. Considering these, more careful
attention than ever should be paid in use of VEGF for therapeutic
angiogenesis, although VEGF still holds great clinical potential.
Furthermore, intramuscular FGF2 gene transfer was demonstrated to
be safe and significantly therapeutically effective for limb
salvage in acute severe limb ischemia cases.
[0036] Herein, a "Paramyxovirus vector" is defined as a vector (or
carrier) that is derived from the Paramyxovirus and that is used
for gene transfer to host cells. The Paramyxovirus vector of the
present invention may be ribonucleoprotein (RNP) or a virus
particle having infectivity. Herein, the term "infectivity" is
defined as an ability of the recombinant Paramyxovirus vector to
transfer, through its cell adhesion and membrane fusion abilities,
a gene contained in the vector to cells to which the vector is
adhered. The Paramyxovirus vector of the present invention may have
replication ability, or may be a defective vector without the
replication ability. Herein, "replication ability" is defined as
the ability of virus vectors to replicate and produce infective
virus particles in host cells infected with the virus vectors. The
replication ability can be determined using, for example, monkey
kidney-derived cell line, LLC-MK2 or CV-1.
[0037] Herein, a "recombinant" Paramyxovirus vector is defined as a
Paramyxovirus vector constructed by gene engineering or its
amplified products. For instance, recombinant Paramyxovirus vectors
can be generated by reconstitution of a recombinant Paramyxovirus
cDNA.
[0038] Herein, a Paramyxovirus is defined as a virus of the
Paramyxoviridae family or a derivative thereof. Paramyxoviruses
used in the present invention include, for example, viruses
belonging to the Paramyxoviridae such as Sendai virus, Newcastle
disease virus, Mumps virus, Measles virus, Respiratory syncytial
virus, rinderpest virus, distemper virus, simian parainfluenza
virus (SV5), and type I, II, and III human parainfluenza virus. The
virus of the present invention may be preferably a virus of the
genus Paramyxovirus or a derivative thereof. Paramyxovirus that can
be used in the present invention includes, for example, type I
human parainfluenza virus (HPIV-1), type III human parainfluenza
virus (HPIV-3), type III bovine parainfluenza virus (BPIV-3),
Sendai virus (also referred to as "type I mouse parainfluenza
virus"), type X simian parainfluenza virus (SPIV-10), etc. Most
preferable Paramyxovirus of the invention is Sendai virus. These
viruses may be naturally occurring, wild-type, mutant,
laboratory-passaged, artificially constructed strains, etc.
Incomplete viruses such as the DI particle (Willenbrink W. and
Neubert W. J., J. Virol., 1994, 68, 8413-8417) and synthesized
oligonucleotides may also be utilized as a material for generating
the virus vector of the present invention.
[0039] Genes encoding proteins of a Paramyxovirus include NP, P, M,
F, HN, and L genes. Herein, the "NP, P, M, F, HN, and L genes"
represent those encoding the nucleocapsid protein, phosphoprotein,
matrix protein, fusion protein, hemagglutinin-neuraminidase, and
large protein, respectively. Genes of each virus of the subfamily
Paramyxovirus are described generally as follows. In general, NP
gene may also be indicated as "N gene".
TABLE-US-00001 Paramyxovirus NP P/C/V M F HN -- L Rublavirus NP P/V
M F HN (SH) L Morbillivirus NP P/C/V M F H -- L
[0040] For instance, the accession numbers of each gene of the
Sendai virus classified as a Respirovirus of Paramyxoviridae in the
nucleotide sequence database, are M29343, M30202, M30203, M30204,
M51331, M55565, M69046, and X17218 for NP gene; M30202, M30203,
M30204, M55565, M69046, X00583, X17007, and X17008 for P gene;
D11446, K02742, M30202, M30203, M30204, M69046, U31956, X00584, and
X53056 for M gene; D00152, D11446, D17334, D17335, M30202, M30203,
M30204, M69046, X00152, and X02131 for F gene; D26475, M12397,
M30202, M30203, M30204, M69046, X00586, X02808, and X56131 for HN
gene; and D00053, M30202, M30203, M30204, M69040, X00587, and
X58886 for L gene.
[0041] As used herein, the term "gene" refers to a genetic
substance, including nucleic acids such as RNA and DNA, which may
or may not encode a protein. A gene may encode a functional RNA
such as ribozyme or antisense RNA. It can be a naturally occurring
sequence or an artificially designed sequence. Furthermore, as used
herein, the term "DNA" includes a single-stranded DNA and a
double-stranded DNA.
[0042] The present invention provides a Paramyxovirus vector
encoding angiogenic gene and use of the same. The present inventors
showed that transgene expression was increased at the administered
sites where a Paramyxovirus vector encoding an angiogenic gene was
administrated intramuscularly in vivo. The present inventors
revealed that necrosis in ischemic tissues could be prevented by
the administration of a recombinant Paramyxovirus vector encoding
an angiogic gene (FGF2) and loss of the hind limb could be
prevented in a limb salvage experiment using mice with ischemic
hind limbs. Moreover, the Paramyxovirus vector is effective in gene
therapy for ischemic heart. Vectors of this invention are useful in
effectively inducing angiogenesis in ischemic tissues and in
preventing necrosis, and can thus be preferably used for gene
therapy for ischemic diseases.
[0043] Moreover, the present inventors revealed that genes
administered intramusculary using recombinant Paramyxovirus vectors
could be continuously expressed for 1 to 2 weeks. This result
indicates that gene therapy with angiogenic factors using
recombinant Paramyxovirus vectors can achieve continuous
therapeutic effects. Moreover, angiogenic factors expressed from
recombinant Paramyxovirus vectors administered intramuscularly
could not be detected in the systemic circulatory system and, thus,
would not cause undesirable effects outside of the target tissues.
Therefore, the findings of the present invention that Paramyxovirus
vectors have various benefits in angiogenic gene transfer suggest
possible great improvement in gene therapy by specifically
targeting ischemic tissues.
[0044] Since Paramyxovirus vectors are not pathogenic in humans,
they can be suggested to be preferably utilized in clinical trials
of human gene therapy in view of safety. It is a major obstacle in
high efficient gene transfer that, in most cases, introduced DNA
must be transported into the nucleus or nuclear membrane must be
eliminated for the expression of an exogenous gene via plasmid DNA
or such. In the case of Sendai virus, however, expression of an
exogenous gene is driven by both cellular tubulin and its RNA
polymerase (L protein) in the cytoplasm when viruses replicate.
This suggests that the Sendai virus does not interact with
chromosomes of host cells, which avoids risks such as cancerization
and immortalization of cells. Furthermore, the Sendai virus is
known to be pathogenic in rodents causing pneumonia, but not in
humans, which is supported by studies showing that the intranasal
administration of the wild type Sendai virus does not do harm in
nonhuman primates (Hurwitz J. L. et al., Vaccine, 1997, 15,
533-540). These features suggest that Sendai virus vector can be
utilized in human therapy, and further, support the notion that
Sendai virus vectors can be one of the promising tools in gene
therapy with angiogenic genes.
[0045] Angiogenic genes used herein indicate genes encoding
factors, which have activities to promote angiogenesis and/or
vasculogenesis directly or indirectly. The factors can be proteins
or peptides, or can be nucleic acids such as functional RNAs
(ribozymes or antisense RNAs). Angiogenic proteins include, for
example, acidic fibroblast growth factor (aFGF), fibroblast growth
factor 2 (FGF2) (also called basic fibroblast growth factor
(bFGF)), vascular endothelial growth factor (VEGF), angiopoietins
(Ang) (including Ang-1 and Ang-2), epidermal growth factor (EGF),
transforming growth factor-.alpha. (TGF-.alpha.), TGF-.beta.,
platelet-derived endothelial cell growth factor (PD-ECGF),
platelet-derived growth factor (PDGF), tumor necrosis
factor-.alpha. (TNF-.alpha.), hepatocyte growth factor (HGF),
insulin-like growth factor (IGF), erythropoietin (EPO),
colony-stimulating factor (CSF), macrophage colony-stimulating
factor (M-CSF), granulocyte-macrophage colony-stimulating factor
(GM-CSF), interleukin (IL)-8, and nitric oxide synthetase (NOS)
(Klagsbrun, M. and D'Amore, P., A. Annu. Rev. Physiol. 53: 217-39,
1991; Folkman, J. and Shing, Y., J. Biol. Chem. 267 (16): 10931-4,
1992; Symes, J. F. and Sniderman, A. D., Curr. Opin. Lipidol. 5
(4): 305-12, 1994).
[0046] The preferred angiogenic proteins in the present invention
include, for example, aFGF, FGF2, Ang-1, Ang-2, EGF, TGF-.alpha.,
TGF-.beta., PD-ECGF, PDGF, TNF-.alpha., HGF, IGF, EPO, CSF, M-CSF,
GM-CSF, IL-8, and NOS, and the vectors can be constructed using
genes encoding the proteins selected from the list above.
[0047] Proteins especially preferred among angiogenic proteins used
in the present invention are not those which induce premature
angiogenesis by VEGF, but those which achieve angiogenesis in which
blood vessel is surrounded by parietal cells that are
differentiated from the newly generated endothelial cells attached
to mesenchymal cells. It is known that vascularization consists of
three steps, vasculogenesis, angiogenesis, and vascular maturation.
Observations of various transcription factor-knockout studies
revealed that maturation in vascularization involves multiple
genes. Specifically, transcription factor SCL/tal-1 is mainly
involved in vascular formation, and HIF-1, Id, ETS-1, HOXD.sub.3,
COUP-TFII, and MEF2C are involved in angiogenesis. Furthermore, it
is known that lung kruppel-like factor (LKLF) or dHAND gene knock
out causes embryonic death due to undeveloped parietal cells.
[0048] Therefore, angiogenic genes used in the present invention
are, more preferably, those that induce transcription factors,
including LKLF and dHAND, involved in parietal cell maturation in
premature mesenchymal cells. It is predicted that FGF2 stimulation
is directly involved in the induction of these transcription
factors or promotes proliferation and differentiation of
mesenchymal cells through other growth factors such as angiopoietin
and HGF.
[0049] Angiogenic proteins preferably contain secretion signal
sequences that allow the secretion of the angiogenic proteins.
However, proteins, such as FGF2 can be secreted outside of cells
without a native and typical secretion signal sequence (see
Example). These proteins do not necessarily require secretion
signal sequences. The genes encoding these angiogenic proteins, for
example, can be obtained by known methods, such as PCR using
primers, which are designed, based on the nucleotide sequence
information. An example of the most preferred angiogenic factor
used in the present invention is FGF2, which shows a stable
therapeutic effect in a wide range of expression levels. (Abraham,
J. A. et al., 1986, EMBO J. 5: 2523-2528; Moscatelli, D. A. et al.,
U.S. Pat. No. 4,994,559; Baird, A. et al., U.S. Pat. No. 5,155,214;
Isner, J. M. U.S. Pat. No. 6,121,246; WO 97/14307).
[0050] Angiogenic genes used for vector construction can be
heterologous or homologous to, preferably homologous to, the target
individuals for gene transfer in order to achieve a desired effect.
Furthermore, angiogenic genes used for vector construction are
preferably mammalian angiogenic genes, preferably human genes for
application to human.
[0051] Paramyxovirus vectors encoding angiogenic genes of the
present invention is especially effective for the treatment of
ischemic tissues. Namely, gene transfer of angiogenic genes using
the vectors of the present invention can promote angiogenesis and
prevent necrosis due to ischemia. The ischemic tissues used for the
present invention are not limited so long as the tissues show
ischemia or are developing ischemia. For example, such tissues
include muscle, brain, kidney, and lung. The ischemic diseases
treated by administering vectors of the present invention include
cerebrovascular ischemia, kidney ischemia, lung ischemia, limb
ischemia, ischemic cardiomyopathy, and myocardial ischemia.
Treatment of ischemic tissues in the present invention includes
therapy of ischemic tissues or prevention of ischemic obstruction,
specifically, for example, prevention of necrosis in ischemic
tissues, sustaining ischemic tissues, promotion of angiogenesis in
ischemic tissues, tissue regeneration, and preventing and
decreasing obstruction caused by ischemia.
[0052] The present invention provides methods for inducing
angiogenesis, which comprises the step of administering
Paramyxovirus vectors encoding angiogenic genes. Moreover, the
present invention provides methods for treating ischemic tissues,
which comprises the step of administering Paramyxovirus vector
encoding angiogenic gene. There is no limitation to, the target
individuals and, for example, a desirable mammal including a human
can be used. In particular, non-human mammals, such as primates
including monkeys such as prosimian, platyrrhine monkeys, and
catarrhine monkeys, apes of anthropoid, rodents such as mice, rats,
and guinea pigs, as well as cows, dogs, cats, horses, sheep, and
rabbits can be targets for administration. It is possible to treat
ischemia in the animals using vectors of the present invention and
also possible to use the animals as ischemia therapy models for
humans (Morinaga, K. et al., 1987, J. Vasc. Surg. 5: 719-730; Itoh,
H. et al., 1994, Atherosclerosis 110: 259-270).
[0053] Specific methods for inducing angiogenesis according to the
present invention include the following methods: a] a method for
inducing angiogenesis, which comprises the step of administering a
Paramyxovirus vector encoding an angiogenic gene or a cell
containing the vector;
[b] the method of [a], in which the angiogenic gene is fibroblast
growth factor 2 (FGF2); [c] the method of [a] or [b], in which the
gene is administered intramuscularly; and [d] the method of any one
of [a] to [c], in which the Paramyxovirus is Sendai virus.
[0054] Examples of the methods for treating the ischemic tissues in
the present invention include the following methods:
[a] a method for treating the ischemic tissues, which comprises the
step of administering a Paramyxovirus vector encoding an angiogenic
gene or a cell containing the vector; [b] the method of [a], in
which the angiogenic gene is fibroblast growth factor 2 (FGF2); [c]
the method of [a] or [b], in which the gene is administered
intramuscularly; and [d] the method of any one of [a] to [c], in
which the Paramyxovirus is Sendai virus.
[0055] Administration can be carried out either in vivo or ex vivo.
For in vivo administration, Paramyxovirus vectors encoding
angiogenic genes can be injected via administration routes well
known to those skilled in the art such as intramuscular injection,
subcutaneous injection, and catheter administration. For ex vivo
administration, the vectors are used to pre-transfect cells in
vitro. The cells containing the vectors are then injected in vivo
by methods such as intramuscular injection, subcutaneous injection,
and catheter administration. The cells for transferring vectors in
ex vivo administration can be either heterologous or homologous to
the target individuals, but are preferably homologous thereto.
Cells derived from the target individual are more preferable.
Moreover, the cells are most preferably derived from bone marrow or
blood, including cells which can form vascular endothelial cells or
which can be differentiated into vascular endothelial cells, that
is, vascular endothelial progenitor cells. Angiogenesis can be
induced in target tissues into which a pharmaceutically effective
dose of a vector of the present invention is administered.
Therefore, it is possible to perform treatment for preventing
tissue necrosis and limb amputation in, for example, ischemic
brains, hearts, kidneys, lungs, and limbs.
[0056] Furthermore, the present invention provides Paramyxovirus
vectors encoding angiogenic genes to treat ischemic tissues.
Specifically, the present invention provides:
[a] a Paramyxovirus vector encoding an angiogenic gene for treating
an ischemic tissue; [b] the vector of [a], in which the angiogenic
gene is fibroblast growth factor 2 (FGF2); [c] the vector of [a] or
[b], in which the vector is used for intramuscular administration;
and [d] the vector of any one of [a] to [c], in which Paramyxovirus
is Sendai virus.
[0057] Moreover, the present invention provides compositions,
comprising Paramyxovirus vectors for treating ischemic tissues. The
compositions can include pharmaceutically acceptable carriers in
addition to Paramyxovirus vectors. For example, the vectors of the
present invention can be formulated into injections with
physiological solutions or into implants with solid or semisolid
(gel) materials.
[0058] Paramyxovirus vectors used for angiogenic gene transfer
according to the present invention is not particularly limited. For
instance, preferable Paramyxovirus vectors include vectors that are
able to replicate and autonomously proliferate. In general, for
example, the genome of wild type Paramyxoviruses contain a short 3'
leader region followed by six genes encoding nucleocapsid (N),
phospho (P), matrix (M), fusion (F), hemagglutinin-neuraminidase
(HN), and large (L) proteins, and has a short 5' trailer region on
the other terminus. Vectors of the present invention that are able
to replicate autonomously can be obtained by designing a genome
having a similar structure to that as described above. In addition,
a vector for expressing an exogenous gene can be obtained by
inserting an exogenous gene to the genome of the above vector.
Paramyxovirus vectors of the invention may have an altered
alignment of virus genes, compared with wild type viruses.
[0059] Paramyxovirus vectors of the present invention may have any
deletion of the genes that are contained in the wild-type
Paramyxovirus. For instance, when Sendai virus vectors are
reconstituted, proteins encoded by NP, P/C, and L genes are thought
to be required in trans, but the genes themselves may not be a
component of virus vectors of the present invention. For example,
an expression vector carrying genes encoding the proteins may be
co-transfected into host cells with another expression vector
encoding the vector genome to reconstitute a vector. Alternatively,
an expression vector encoding the virus genome is introduced into
host cells carrying genes encoding the proteins, and then the
vector can be reconstituted by using the proteins derived from the
host cell. The amino acid sequence of these proteins may not be
identical to those derived from the original virus as long as it
has an equivalent or higher activity in nucleic acid transfer, and
may be mutated or replaced with that of a homologous gene of
another virus.
[0060] Proteins encoded by M, F, and HN genes are thought to be
essential for cell-to-cell propagation of a Paramyxovirus vector.
However, these proteins are not required when a Paramyxovirus
vector is prepared as RNP. If genes M, F, and HN are components of
the genome contained in RNP, products of these genes are produced
when introduced into host cells, and virus particles having
infectivity are generated. RNP vectors that produce an infective
virus include, for example, a viral genomic RNA encoding N, P, M,
F, HN, and L genes and N, P, and L proteins. When such RNP is
introduced into cells, virus genome is expressed and replicated
through functions of N, P, and L proteins, and thus infective virus
vectors are amplified.
[0061] RNP can be introduced into cells as a complex with, for
example, lipofectamine and polycationic liposome. Specifically, a
variety of transfection reagents can be used, for instance, DOTMA
(Boehringer), Superfect (QIAGEN #301305), DOTAP, DOPE, and DOSPER
(Boehringer #1811169). Chloroquine may be added to prevent
degradation in the endosome (Calos M. P., Proc. Natl. Acad. Sci.
USA, 1983, 80, 3015). For replicative viruses, the produced viruses
can be amplified or passaged by re-infecting into cultured cells,
chicken eggs, or animals (e.g. mammalian such as mice).
[0062] Paramyxovirus vectors lacking the M, F, and/or HN genes are
also used preferably as Paramyxovirus vectors of the present
invention. These virus vectors can be reconstituted by providing
deleted gene products exogenously. Such vectors can still adhere to
host cells and induce cell fusion like the wild-type virus.
However, daughter virus particles do not have the same infectivity
as the parent ones because the vector genome introduced into cells
lacks one or more of these genes. Therefore, these vectors can be
useful as safe virus vectors that are capable of only a single gene
transfer. Specifically, genes deleted from the genome may be F
and/or HN genes. "Gene-deficient" is defined as substantial loss of
gene function, and, when a deficient gene encodes a protein, the
gene-deficient mutant does not express any protein having a
function equivalent to the wild type protein. For example, being
deficient in one or more genes can be achieved by no transcription
of the gene(s), loss-of-function mutants, and deletin of the genes.
Gene-deficient means that, preferably, at least a part of the
coding region, more preferably, the entire coding region of the
gene is deficient. For example, F gene-deficient vectors are
vectors deficient in, preferably, a part of the F protein-coding
region, more preferably, the entire F protein-coding region. Still
more preferably, F gene-deficient vectors of the present invention
lack the start signal sequence in the 3' flanking site of the F
gene, which is deficient in the negative chain in the genome.
Therefore, unnecessary polypeptides expression from the deficient
area can be suppressed. When the open reading frame (ORF) encoding
unnecessary polypeptides exist in the deficient region, it is
desirable to remove the ORF by methods such as site-directed
mutagenesis (described later).
[0063] For preparing F gene-deficient vectors, virus vectors can be
reconstituted by co-transfection of an expression plasmid encoding
the genome of a recombinant Paramyxovirus lacking the F gene, with
an expression vector for the F protein, and that for NP, P/C, and L
proteins into host cells (International Publication numbers WO
00/70055 and WO 00/70070). Alternatively, host cells in which the F
gene is integrated into the chromosome may be used. The amino acid
sequence of these proteins provided exogenously may not be
identical to those of the wild type and may be mutated or replaced
by a homologous protein of another virus as long as they provide
equivalent or higher gene transfer activity.
[0064] The envelope protein of Paramyxovirus vectors of the
invention may contain another protein than the envelope protein of
the original vector genome. There is no limitation on such
proteins. These include envelope proteins of other viruses such as
the G protein (VSV-G) of the vesicular stomatitis virus (VSV).
Thus, Paramyxovirus vectors of the invention include a pseudo-type
virus vector that has an envelope protein derived from a virus
different from the original virus.
[0065] Paramyxoviral vectors of the present invention may also
comprise, for example, on the viral envelop surface, proteins
capable of adhering to particular cells, such as adhesion factors,
ligands and receptors or chimeric proteins comprising a protein
described above on the outer surface and viral envelop-derived
polypeptides inside the virus. It enables the production of a
vector targeting a particular tissue. These proteins may be encoded
by the virus genome itself, or supplied at the time of virus
reconstitution through expression of genes other than virus genome
(for example, genes derived from another expression vector or host
cell chromosome).
[0066] The virus genes contained in the vector of the present
invention may be altered, for example, to reduce antigenicity or
enhance RNA transcription efficiency or replication efficiency.
Specifically, it is possible to alter at least one of the NP, P/C,
and L genes, which are genes of replication factors, to enhance
transcription or replication. It is also possible to alter the HN
protein, a structural protein having hemagglutinin activity and
neuraminidase activity, to enhance the virus stability in blood by
weakening the former activity and to regulate infectivity by
altering the latter activity. It is also possible to alter the F
protein, which is implicated in membrane fusion, to regulate its
fusion ability. Furthermore, it is possible to analyze the antigen
presenting epitopes and such of possible antigenic molecules on the
cell surface such as the F protein and HN protein and use them to
generate a Paramyxovirus vector that is engineered to have weak
antigen presenting ability.
[0067] Paramyxovirus vectors of the present invention may also lack
accessory genes. For example, the disruption of the V gene, one of
the accessory genes of SeV, results in reduction of pathogenicity
of SeV toward hosts such as mouse without affecting gene expression
and replication in cultured cells (Kato, A. et al. 1997. J. Virol.
71:7266-7272; Kato, A. et al. 1997. EMBO J. 16:578-587; Curran, J.
et al., WO 01/04272, EP 1067179). Such attenuated vectors are
particularly suitable as in vivo or ex vivo gene transfer
vectors.
[0068] Viral vectors of the present invention encode angiogenic
genes in its genomic RNA. Recombinant Paramyxovirus vector
comprising exogenous genes can be prepared by inserting exogenous
genes into the above-mentioned Paramyxovirus vector genome. An
exogenous gene can be a desired angiogenic gene to be expressed in
target tissues, such as ischemic tissues, for vector transfer. The
exogenous gene may encode a naturally occurring protein, or a
modified protein prepared by modifying the original protein by
deletion, substitution, or insertion, as long as the modified
protein is functionally equivalent to the naturally occurring
protein. For instance, for the purpose of gene therapy and such, a
gene used to treat a target disease may be inserted into the DNA
(virus vector DNA) encoding the genome of the virus vector. In the
case of inserting an exogenous gene into virus vector DNA, such as
Sendai virus vector DNA, a sequence comprising nucleotides of
multiples of six is desirably inserted between the transcription
end sequence (E) and the transcription start sequence (S) (Calain
P. and Roux L., J. Virol., 1993, 67(8), 4822-4830). An exogenous
gene can be inserted upstream and/or downstream of each of the
virus genes (NP, P, M, F, HN, and L genes). In order not to
interfere with the expression of upstream and downstream genes, an
E-1-S sequence (transcription end sequence-intervening
sequence-transcription start sequence) or a portion of it may be
suitably placed upstream or downstream of an exogenous gene so that
E-1-S sequence is located between each gene. Alternatively, an
exogenous gene can be inserted via IRES sequence.
[0069] Expression level of inserted exogenous genes can be
regulated by the type of transcription start sequence that is
attached to the upstream of the genes (WO 01/18223). It also can be
regulated by the position of insertion and the sequence surrounding
the gene. In the Sendai virus, for instance, the closer to the
3'-terminus of the negative strand RNA of the virus genome (the
closer to NP gene in the gene arrangement on the wild type virus
genome) the insertion position is, the higher the expression level
of the inserted gene will be. To achieve a high expression of an
exogenous gene, it is preferably inserted into the upstream region
of the negative stranded genome such as the upstream of the NP gene
(3' flanking sequence on the negative strand), or between NP and P
genes. Conversely, the closer to the 5'-terminus of the negative
strand RNA (the closer to L gene in the gene arrangement on the
wild type virus genome) the insertion position is, the lower the
expression level of the inserted gene will be. To reduce the
expression of an exogenous gene, it may be inserted into the most
5' position on the negative strand, that is, downstream of the L
gene in the wild type virus genome (5' flanking region of the L
gene on the negative strand) or upstream of the L gene (3' flanking
region of L gene on the negative strand). Thus, the insertion
position of an exogenous gene can be properly adjusted to obtain a
desired expression level of the gene or optimize the combination of
the insert with the virus genes surrounding it. For instance, if
the overexpression of an angiogenic gene introduced by a high-titer
virus vector may cause toxicity, it is possible not only to control
the titer of viruses to be administered but also to reduce the
expression level of individual virus vectors by designing the
insertion position of the angiogenic gene closer to the 5'-terminus
of the negative strand, or replacing the transcription start
sequence with one having lower efficiency so as to obtain an
appropriate effect.
[0070] To help the easy insertion of an exogenous gene, a cloning
site may be designed at the position of insertion. For example, the
cloning site may be the recognition sequence of restriction
enzymes. The restriction sites in the vector DNA encoding viral
genome can be used to insert an exogenous gene. The cloning site
may be a multicloning site that contains recognition sequences for
multiple restriction enzymes. The vector of the present invention
may have other exogenous genes at positions other than that used
for above insertion. Such exogenous gene may be, without
limitation, an angiogenic gene or another gene.
[0071] Construction of a recombinant Sendai virus vector having an
exogenous gene can be performed as follows, for example, according
to the method described in Hasan, M. K. et al., J. Gen. Virol.,
1997, 78: 2813-2820, Kato A. et al., EMBO J., 1997, 16: 578-587,
and Yu D. et al., Genes Cells, 1997, 2: 457-466.
[0072] First, a DNA sample containing a cDNA nucleotide sequence
encoding a desired exogenous gene is prepared. It is preferable
that the concentration of the DNA sample is 25 ng/.mu.l or higher
and that it can be detected as a single plasmid by electrophoresis.
The following description is an example where an exogenous gene is
inserted into the NotI site of virus genomic DNA. If the target
cDNA sequence contains a NotI recognition site, the site is
desirably removed in advance by altering the nucleotide sequence
using the known method such as site-directed mutagenesis while
maintaining the encoded amino acid sequence. A desired DNA fragment
is amplified by PCR from the DNA sample. In order to obtain a
fragment having NotI sites at both ends and to add a single copy of
the transcription end sequence (E), intervening sequence (I), and
transcription start sequence (S) of the Sendai virus (EIS sequence)
to one end, synthesized DNA sequences (primer pair), namely, a pair
of a forward primer (sense strand) comprising a part of the desired
gene, and a reverse primer (antisense) comprising a NotI
recognition site, E, I, and S sequences, and part of the desired
gene, is prepared.
[0073] For example, the forward synthetic DNA sequence contains two
or more nucleotides at the 5'-terminus to ensure digestion with
NotI (preferably 4 nucleotides not containing a sequence derived
from the NotI recognition site, such as GCG and GCC; more
preferably ACTT). To the 3'-terminus of the sequence, the NotI
recognition sequence GCGGCCGC is added. Furthermore, to the
3'-terminus, as a spacer, any 9 nucleotides or those of 9 plus
multiples of 6 are added. Furthermore, to the 3'-terminus, a
sequence of approximately 25 nucleotides corresponding to the ORF
of the desired cDNA starting from the initiation codon ATG is
added. The 3'-terminus of the forward synthetic oligo DNA
containing approximately 25 nucleotides of the desired cDNA is
preferably selected so that the last nucleotide is G or C.
[0074] The reverse synthetic DNA sequence contains two or more
nucleotides at the 5'-terminus (preferably 4 nucleotides not
containing a sequence derived from the NotI recognition site, such
as GCG and GCC; more preferably ACTT). To the 3'-terminus of the
sequence, the NotI recognition sequence GCGGCCGC is added.
Furthermore, to the 3'-terminus, a spacer oligo DNA is added to
adjust the length of the primer. The length of the oligo DNA is
designed so that it is a multiple of 6 nucleotides including the
NotI recognition sequence GCGGCCGC, the sequence complementary to
the cDNA, and the EIS sequence derived from the Sendai virus genome
as described below (so-called "rule of six"; Kolakofski D. et al.,
J. Virol., 1998, 72, 891-899; Calain P. and Roux L., J. Virol.,
1993, 67, 4822-4830). Furthermore, to the 3'-terminus of the added
sequence, complementary sequences to the S sequence of the Sendai
virus, preferably 5'-CTTTCACCCT-3' (SEQ ID NO: 1), to the I
sequence, preferably 5'-AAG-3', and to the E sequence, preferably
5'-TTTTTCTTACTACGG-3' (SEQ ID NO: 2) are added. Finally, to the
3'-terminus, a sequence, which is selected so that the last
nucleotide of the complementary sequence of the desired cDNA
becomes G or C, is added, where the last nucleotide is
approximately 25 nucleotides upstream from the termination codon.
Thus, the 3'-terminus of the reverse synthetic oligo DNA is
prepared.
[0075] PCR can be performed by a common method using, for example,
ExTaq polymerase (TaKaRa). Vent polymerase (NEB) may be used
preferably, and the amplified fragment is digested with NotI, and
inserted into the NotI site of the plasmid vector pBluescript. The
nucleotide sequence of the obtained PCR product is checked with an
automated DNA sequencer, and a plasmid having the correct sequence
is selected. The insert is excised from the plasmid by NotI
digestion, and subcloned into the NotI site of the plasmid
comprising Paramyxovirus genomic cDNA. Alternatively, the PCR
products may be directly cloned into the NotI site without using
pBluescript plasmid vector to obtain recombinant Sendai virus
cDNA.
[0076] For example, recombinant Sendai virus genomic cDNA can be
constructed according to the methods described in literatures
(Kato, A. et al., EMBO J. 16: 578-598, 1997; Hasan, M. K. et al.,
J. Gen. Virol., 78: 2813-2820, 1997; Yu, D. et al., Genes Cells,
1997, 2, 457-466; and Li, H. O. et al., J. Virology 74, 6564-6569,
2000). For example, a 18-bp spacer sequence containing the NotI
site (5'-(G)-CGGCCGCAGATCTTCACG-3'; SEQ ID NO: 3) is inserted into
an adjacent gene locus of a cloned Sendai virus genomic cDNA
(pSeV(+)) between the leader sequence and the 5'-terminus of a
sequence encoding the N protein, and the plasmid pSeV18.sup.+b(+)
containing a self-cleavable ribozyme site derived from the
antigenomic strand of the hepatitis delta virus is obtained (Hasan
M. K. et al., J. General Virol., 1997, 78, 2813-2820) . An
exogenous gene fragment is inserted into the NotI site of
pSeV18.sup.+b(+) to obtain a recombinant Sendai virus cDNA into
which a desired exogenous gene has been inserted.
[0077] The recombinant Paramyxovirus vector prepared as described
above is transcribed in vitro or intracellularly, and RNP is
reconstituted in the presence of viral L, P, and NP proteins to
produce a viral vector comprising the RNP. The present invention
provides a method for producing a Paramyxovirus vector encoding an
angiogenic gene, the method comprising the steps of transcribing
DNA encoding the Paramyxovirus vector genome intracellulary, in the
presence of proteins that allow for transcription and replication
of the genome, and recovering Paramyxovirus vector products. The
proteins that allow for transcription and replication of
Paramyxovirus vector genome include, for example, N, L, and P
proteins. The present invention also provides DNA for producing a
Paramyxovirus vector of the present invention, wherein said DNA
comprises the above-mentioned DNA encoding the vector genome. The
present invention also relates to the use of DNA encoding the
vector genome, for producing Paramyxovirus vectors of the present
invention. Reconstitution of a virus from virus vector DNA can be
performed according to the known methods (WO 97/16539; WO 97/16538;
Durbin A. P. et al., Virol., 1997, 235, 323-332; Whelan S. P. et
al., Proc. Natl. Acad. Sci. USA, 1995, 92, 8388-8392; Schnell M. J.
et al., EMBO J., 1994, 13, 4195-4203; Radecke F. et al., EMBO J.,
1995, 14, 5773-5784; Lawson N. D. et al., Proc. Natl. Acad. Sci.
USA, 1995, 92, 4477-4481; Garcin D. et al., EMBO J. 1995, 14,
6087-6094; Kato A. et al., Genes Cells, 1996, 1, 569-579; Baron M.
D. and Barrett T., J. Virology, 1997, 71, 1265-1271; Bridgen A. and
Elliott R. M., Proc. Natl. Acad. Sci. USA, 1996, 93, 15400-15404).
These methods enable the reconstitution of desirable Paramyxovirus
vectors including the parainfluenza virus, vesicular stomatitis
virus, rabies virus, measles virus, rinderpest virus, and Sendai
virus vectors from DNA. If the F, HN, and/or M genes are deleted
from the virus vector DNA, infective virus particles will not be
formed. However, it is possible to generate infective virus
particles by introducing these deleted genes and/or genes encoding
an envelope protein from another virus into the host cells and
expressing them.
[0078] Methods for introducing vector DNA into cells may include
(1) a method for forming DNA precipitates that can be incorporated
into desired cells, (2) a method for making a complex that
comprises positively charged DNA, that is suitable for being
incorporated into desired cells and that has low cytotoxicity, and
(3) a method for instantaneously opening a pore large enough for
DNA to pass through in the desired plasma membrane using an
electrical pulse.
[0079] A variety of transfection reagents can be used in (2), for
instance, including DOTMA (Boehringer), Superfect (QIAGEN #301305),
DOTAP, DOPE, and DOSPER (Boehringer #1811169). For (1),
transfection using calcium phosphate can be used. In this method,
DNA incorporated by cells is taken up into phagocytic vesicles, but
it is known that a sufficient amount of DNA is also taken up into
the nucleus (Graham F. L. and van Der Eb J., Virology, 1973, 52,
456; Wigler M. and Silverstein S., Cell, 1977, 11, 223). Chen and
Okayama studied the optimization of the transfer technology and
reported (1) that maximal efficiency is obtained when cells and
precipitates are incubated under 2% to 4% CO.sub.2 at 35.degree. C.
for 15 hr to 24 hr, (2) that circular DNA has higher activity than
linear DNA, and (3) that the optimal precipitates are formed when
the DNA concentration in the mixed solution is 20 .mu.g/ml to 30
.mu.g/ml (Chen C. and Okayama H., Mol. Cell. Biol., 1987, 7, 2745).
The method of (2) is suitable for transient transfection. More
classically, a transfection method in which DEAE-dextran (Sigma
#D-9885 M. W. 5.times.10.sup.5) is mixed with DNA at a desired
concentration ratio is known. Because most complexes are degraded
in the endosome, chloroquine may be added to enhance the
transfection efficiency (Calos M. P., Proc. Natl. Acad. Sci. USA,
1983, 80, 3015). The method of (3), called electroporation, may be
more broadly applied than the methods of (1) and (2) because it can
be used for any kind of cells. The transfection efficiency can be
maximized by optimizing the duration of pulse currents, the form of
pulse, the strength of the electrical field (gap between
electrodes; and voltage), conductivity of buffer, DNA
concentration, and cell density.
[0080] In the present invention, transfection reagents are suitably
used because, among the above three methods, the method of (2) is
easy to perform and enables the testing of a large number of
samples using a large amount of cells. Preferable transfection
reagents include, the Superfect Transfection Reagent (QIAGEN, Cat
No. 301305) and the DOSPER Liposomal Transfection Reagent
(Boehringer Mannheim, Cat No. 1811169), but are not limited
thereto.
[0081] Specifically, the reconstitution from cDNA is performed as
follows.
[0082] LLC-MK2, a cell line derived from a monkey kidney, is
cultured in a 24-well to 6-well plastic plate or in a 100-mm petri
dish in minimum essential medium (MEM) containing 10% fetal calf
serum (FCS) and an antibiotic (100 units/ml penicillin G and 100
.mu.g/ml streptomycin) to be 70% to 80% confluent. Cells are then
infected, for instance, at 2 pfu/cell with recombinant vaccinia
virus vTF7-3 that expresses T7 polymerase, which has been
inactivated by a 20-minute UV exposure in the presence of 1
.mu.g/ml psoralen (Fuerst T. R. et al., Proc. Natl. Acad. Sci. USA,
1986, 83, 8122-8126; and Kato. A. et al., Genes Cells, 1996, 1,
569-579). The amount of psoralen and the duration of UV exposure
can be optimized. One hour after infection, cells are transfected
by, for example, lipofection using Superfect (QIAGEN) with 2 .mu.g
to 60 .mu.g of, or more preferably 3 .mu.g to 5 .mu.g of the above
recombinant Sendai virus cDNA together with expression plasmids for
virus proteins (24-0.5 .mu.g pGEM-N, 12-0.25 .mu.g pGEM-P, and
24-0.5 .mu.g pGEM-L, or more preferably 1 .mu.g pGEM-N, 0.5 .mu.g
pGEM-P, and 1 .mu.g pGEM-L) (Kato. A. et al., Genes Cells, 1996, 1,
569-579) that function in trans and are required for producing a
full-length Sendai virus genome. The transfected cells are cultured
in serum-free MEM containing, if desired, 100 .mu.g/ml rifampicin
(Sigma) and cytosine arabinoside (AraC) (Sigma), more preferably 40
.mu.g/ml arabinoside alone, so that the drug concentration is
adjusted to be optimal to minimize the cytotoxicity of the vaccinia
virus and maximize the recovery of virus (Kato. A. et al., Genes
Cells, 1996, 1, 569-579). Cells are cultured for 48 hr to 72 hr
after transfection, then collected and lysed through three cycles
of freeze-thawing. The cell lysates are transfected into LLC-MK2
cells, and after a 3-day to 7-day culture, the culture medium is
collected. To reconstitute a virus vector lacking a gene encoding
an envelope protein that is incapable of replication, the vector
may be transfected into LLC-MK2 cells expressing an envelope
protein, or co-transfected with expression plasmid for the envelope
protein. Alternatively, transfected cells can be overlaid and
cultured on LLC-MK2 cells expressing envelope protein to propagate
a deletion virus vector (see International Publication Numbers WO
00/70055 and WO 00/70070). The virus titer of the culture medium
can be determined by measuring hemagglutinin activity (HA). The HA
may be determined by "endo-point dilution" (Kato. A. et al., Genes
Cells, 1996, 1, 569-579; Yonemitsu Y. and Kaneda Y.,
Hemagglutinating virus of Japan-liposome-mediated gene delivery to
vascular cells., Molecular Biology of Vascular Diseases. Methods in
Molecular Medicine, Ed. by Baker A. H., Humana Press, 1999,
295-306). To eliminate the possible contamination of vaccinia virus
vTF7-3, the obtained allantoic fluid sample may be diluted
appropriately (10.sup.6 times for instance) and re-amplified in
chicken eggs. Re-amplification may be repeated, for example, three
times or more. The obtained virus stock can be stored at
-80.degree. C.
[0083] Host cells for viral reconstitution are not limited to any
special types of cells as long as the virus vector can be
reconstituted in the cells. Host cells may include monkey
kidney-derived cells such as LLC-MK2 cells and CV-1 cells, cultured
cell lines such as BHK cells derived from a hamster kidney, and
human-derived cells. Furthermore, to obtain a large quantity of the
Sendai virus vector, embryonated chicken eggs may be infected with
virus vectors obtained from the above host cells and the vectors
can be amplified. The method of producing virus vectors using
chicken eggs has been established (Advanced protocols in
neuroscience study III, Molecular physiology in neuroscience., Ed.
by Nakanishi et al., Kouseisha, Osaka, 1993, 153-172).
Specifically, for example, fertilized eggs are incubated for 9 days
to 12 days at 37.degree. C. to 38.degree. C. in an incubator to
grow the embryos. Virus vectors are inoculated into the allantoic
cavity, and eggs are further incubated for several days to
propagate the vectors. Conditions such as the duration of
incubation may vary depending on the type of recombinant Sendai
virus used. Then, the allantoic fluids containing viruses are
recovered. Sendai virus vector is separated and purified from the
allantoic fluid sample according to the standard method (Tashiro
M., Protocols in virus experiments., Ed. by Nagai and Ishihama,
MEDICAL VIEW, 1995, 68-73). Moreover, trypsin resistant cells (for
example, cells such as LLC-MK2) are preferred for the mass
production of F gene-deficient Sendai virus.
[0084] The construction and the preparation of Sendai virus vectors
deficient in F gene can be performed, for example, as follows (see
WO00/70055 and WO00/70070).
1. Construction of cDNA Encoding F Gene-Deficient Sendai Virus
Genome for Cloning Endogenous Genes.
[0085] Full-length Sendai virus (SeV) genomic cDNA,
pSeV18.sup.+b(+) (Hasan, M. K. et al., J. Gen. Virol. 78,
2813-2820, 1997) ("pSeV18.sup.+b(+)" is also referred to as
"pSeV18.sup.+"), is digested with SphI/KpnI and the digested
fragment (14673 bp) is recovered. The fragment is subcloned into
pUC18 to obtain the plasmid pUC18/KS. Construction of F
gene-deficient region is performed using pUC18/KS with a
combination of PCR and ligation techniques. F gene-deficient SeV
genomic cDNA (pSeV18.sup.+/.DELTA.F) is constructed by removing the
F gene ORF (ATG-TGA=1698 bp) and filling in the gap with
atgcatgccggcagatga (SEQ ID NO: 4). In PCR, primer pairs consisting
of forward: 5'-gttgagtactgcaagagc (SEQ ID NO: 5) and reverse:
5'-tttgccggcatgcatgtttcccaaggggagagttttgcaacc (SEQ ID NO: 6) are
used in the upstream of F gene, and primer pairs consisting of
forward: 5'-atgcatgccggcagatga (SEQ ID NO: 7) and reverse:
5'-tgggtgaatgagagaatcagc (SEQ ID NO: 8) are used in the downstream
of F gene. The PCR products are then ligated to the EcoT22I site.
The thus-obtained plasmid is digested with SacI and SalI and the
fragment (4931 bp) which contains the F gene-deficient region is
subcloned into pUC18 to give pUC18/dFSS. This pUC18/dFSS is
digested with DraIII and the digested fragment is recovered. The
fragment is replaced with a F gene-containing DraIII fragment of
pSeV18.sup.+ to construct plasmid pSeV18.sup.+/.DELTA.F.
[0086] The EIS sequence (SeV specific sequence, E, end; I,
intergenic; S, start) of the F gene remains in the construct and
the construct may express polypeptides consisting of 5 amino acids
derived from the primer used to connect the gap even though the
downstream ORF of the F gene is removed.
[0087] The insertion of exogenous genes into the F gene-deficient
region can be achieved using NsiI and NgoMIV restriction enzyme
sites that are located at the F gene-deficient region in
pUC18/dFSS. In order to clone exogenous genes into the region, for
example, exogenous gene fragments can be amplified using an
Neil-tailed primer and an NgoMIV-tailed primer.
[0088] For example, EGFP gene is amplified first by PCR to
construct a cDNA containing the EGFP gene
(pSeV18.sup.+/.DELTA.F-GFP). In order to adjust the number of
nucleotides of the EGFP gene fragment to contain a multiple of 6
(Hausmann, S. et al., RNA 2, 1033-1045, 1996), PCR is performed
using NsiI-tailed primer (5'-atgcatatggtgatgcggttttggcagtac/SEQ ID
NO: 9) as the 5' end primer and NgoMIV-tailed primer
(5'-tgccggctattattacttgtacagctcgtc/SEQ ID NO: 10) as the 3' end
primer. The PCR product is digested with restriction enzymes Nail
and NgoMIV and the fragment is recovered from a gel. The fragment
is subcloned into the F gene-deficient region in pUC18/dFSS using
NsiI and NgoMIV restriction enzyme sites and the sequence is
confirmed. The DraIII fragment containing the EGFP gene is then
recovered, replaced with the F gene-containing DraIII fragment of
pSeV18.sup.+, and ligated to obtain pSeV18.sup.+/.DELTA.F-GFP.
[0089] The insertion of exogenous genes into the upstream of the NP
gene is achieved using the restriction enzyme NotI recognition site
located in pSeV18.sup.+/.DELTA.F or pSeV18.sup.+/.DELTA.F-GFP.
However, pSeV18.sup.//.DELTA.F has a sequence that may express a
5-amino acid peptide derived from the primer used to connect to the
F gene-deficient region. Moreover, GFP is co-expressed by
pSeV18.sup.+/.DELTA.F-GFP. Therefore, the gene constructs are
prepared as follows so that the peptides or GFP are not expressed,
if it is necessary.
[0090] The fragment (6288 bp) which contains the F gene-deficient
region is recovered by digesting pSeV18.sup.+/.DELTA.F-GFP with
SalI and NheI and subcloned into Litmus 38 (New England Biolabs,
Beverly, Mass.) to obtain LitmusSalINheIfrg/.DELTA.F-GFP. Deletion
of the EGFP gene containing the EIS sequence upstream of the F
gene, which has been deleted, is conducted by the inverse PCR
method. PCR is performed using a reverse primer
(5'-gtttaccaggtggagagttttgcaaccaagcac/SEQ ID NO: 11) which is
designed to contain the restriction enzyme SexAI recognition
sequence upstream of the GFP gene and a forward primer
(5'-ctttcacctggtacaagcacagatcatggatgg/SEQ ID NO: 12) which is
designed to contain the restriction enzyme SexAI recognition
sequence downstream of the GFP gene. The preferable sized fragment
(10855 bp) is excised and ligated to delete the EGFP gene
containing the EIS sequence upstream of the F gene, which has been
deleted.
[0091] The resulting construct has an extra 15-bp sequence between
the two SexAI sites due to the primer design. Therefore, the
plasmid is used to transform E. coli SCS110 strain
(dcm.sup.-/dam.sup.- SCS110 strain is used because SexAI is
methylated and cannot be digested with it). The plasmid is digested
with restriction enzyme SexAI and two gene fragments, 1628 by and
9219 bp, are recovered and ligated to remove the extra 15-bp
fragment contained in LitmusSalINheIfrg/.DELTA.F (.DELTA.5aa), in
which the EGFP gene containing the EIS sequence upstream of the F
gene and having the multiple of 6 numbers of nucleotides is
deleted. The plasmid is digested with SalI and NheI and the
fragment is recovered, replaced with SalI/NheI fragment, which
contains the F gene from pSeV18.sup.+, and ligated to obtain
plasmid pSeV18.sup.+/.DELTA.F (.DELTA.5aa).
[0092] Insertion of an exogenous gene into the plasmid is
performed, for example, using the recognition sequence of
restriction enzyme NotI located upstream of the NP gene.
2. Construction of cDNA Encoding F Gene-Deficient Sendai Virus
Genome Containing hFGF2 Gene
[0093] Various methods are known for obtaining human FGF2 (hFGF2)
cDNA. For example, RT-PCR is performed to isolate cDNA using
vascular smooth muscle cells obtained from the human great
saphenous vein with a patient's consent. The hGFG2 cDNA is then
prepared by subcloning the amplified product into pBluescriptSK+
(Stratagene, La Jolla, Calif.) at HindIII (5' end) and EcoRI (3'
end). The hFGF2 cDNA sequence can be confirmed by comparing with
that in the report by Abraham et al. (Abraham, J. A. et al., EMBO
J. 5 (10), 2523-2528, 1986).
[0094] In order to insert the hFGF2 gene at the restriction enzyme
NotI site located upstream of the NP gene, the hFGF2 gene fragment
can contain the SeV specific sequence (EIS sequence) at its 3' end,
and NotI recognition sequences at its both ends. Specifically, PCR
is performed using the hFGF2 cDNA as a template and N-terminus
primer
(5'-atccgcggccgccaaagttcacttatggcagccgggagcatcaccacgctgcccgccttgcccg
aggatggcggcagcggcgcc/SEQ ID NO: 13) containing a start codon and
C-terminus primer
(5'-atccgcggccgcgatgaactttcaccctaagtttttcttactacggtcagctcttagcagacat
tggaagaaaaagtatagc/SEQ ID NO: 14) containing a stop codon region
and the EIS sequence. The amplified fragment is digested with NotI
and then subcloned into pBluescriptSK+ (Stratagene, La Jolla,
Calif.) to obtain pBS-hFGF2. The nucleotide sequence is confirmed
and, in case the gene contains mutations, mutations are corrected
using, for example, QuickChange.TM. Site-directed Mutagenesis Kit
(Stratagene, La Jolla, Calif.) according to the attached protocol.
The fragment containing hFGF2 cDNA is obtained by digesting
pBS-hFGF2 with NotI and inserted into pSeV18.sup.+/.DELTA.F
(.DELTA.5aa) at the NotI site located upstream of the NP gene to
construct F gene-deficient Sendai virus genomic cDNA containing
hFGF2 gene, pSeV18.sup.+ hFGF2/.DELTA.F (.DELTA.5aa). Hereafter,
pSeV18.sup.+hFGF2/.DELTA.F (.DELTA.5aa) is also indicated as
pSeV18.sup.+hFGF2/.DELTA.F.
3. Construction of F Expression Plasmid
[0095] Plasmid pCALNdLw (Cre/loxP inducible expression plasmid;
Arai, T. et al., J. Virol. 72 (2), 1115-1121, 1998), which is
designed to induce the expression of gene products by Cre DNA
recombinase, can be used to express the Sendai virus F gene
(SeV-F). The fragment (1783 bp) containing the SeV-F gene is
isolated by digesting pUC18/KS with StyI and BstUI, blunt ended,
and inserted into pCALNdLw at a unique SwaI site to construct the F
expression plasmid pCALNdLw/F.
4. Preparation of Helper Cell Line, which Inducibly Expresses SeV-F
Protein
[0096] A helper cell line, which expresses SeV-F protein, is
established to recover infectious virus particles from the F
gene-deficient genome. For example, cells can be obtained from
LLC-MK2 cells, monkey kidney-derived cell line, which is often used
for SeV propagation. LLC-MK2 cells are cultured in MEM containing
10% heat inactivated fetal bovine serum (FBS), 50 U/ml Sodium
Penicillin G and 50 .mu.g/ml Streptomycin in an atmosphere
containing 5% CO.sub.2 at 37.degree. C. The plasmid, pCALNdLw/F,
which is designed to induce the expression of the F gene product by
Cre DNA recombinase, is transferred into LLC-MK2 cells using the
Calcium Phosphate method with Mammalian Transfection Kit
(Stratagene, La Jolla, Calif.) according to protocols known to
those skilled in the art.
[0097] Specifically, 10 .mu.g of plasmid pCALNdLw/F is transferred
into LLC-MK2 cells which are propagated to 40% confluence in a
10-cm dish and then the cells are cultured in 10 ml MEM medium
containing 10% FBS in an incubator with an atmosphere of 5%
CO.sub.2 at 37.degree. C. for 24 hours. Cells are scraped from the
dish after 24 hours, suspended in 10 ml medium, and aliquoted to
five 10-ml dishes so that, for example, 1 dish contains 5 ml, 2
dishes contain 2 ml, and 2 dishes contain 0.2 ml of cell
suspension. Each cell is cultured in 10 ml MEM medium containing
1,200 .mu.g/ml G418 (Gibco-BRL, Rockville, Md.) and 10% FBS for 14
days with a medium change every 2 days and stably-transfected cell
lines are selected. For example, 30 strains of G418 resistant
cells, grown in the medium, are recovered using a cloning ring.
Each clone is propagated until it becomes confluent in a 10-cm
dish.
[0098] Selection of stably-transfected cell lines with F gene is
carried out as follows. Specifically, the expression level of F
protein can be analyzed semi-quantitatively by Western blotting.
The cells are cultured to confluence in 6-cm dishes and then
infected with Adenovirus AxCANCre at moi=3 by the method by Saito
et al. (Saito et al., Nucl. Acids Res. 23, 3816-3821, 1995; Arai,
T. et al., J. Virol. 72 (2), 1115-1121, 1998) to induce expression
of F protein in each clone. Three days after infection, the culture
medium was removed from the dish, and then cells were washed twice
with PBS buffer, scraped with a scraper, centrifuged at
1500.times.g for 5 min, and collected. The cells are stored at
-80.degree. C. and resuspended in 150 .mu.l PBS buffer after
thawing. An equal amount of 2.times. Tris-SDS-BME sample loading
buffer (0.625 M Tris (pH 6.8), 5% SDS, 25% 2-ME, 50% glycerol, and
0.025% BPB, Owl Separation Systems) is added thereto. The mixture
is heat-treated at 98.degree. C. for 3 min and then subjected to
electrophoresis. The samples (1.times.10.sup.5 cells per lane) are
then subjected to SDS-polyacrylamide gel electrophoresis followed
by Western blotting according to known protocols. SeV-F expression
level is semi-quantitatively measured by Western blotting using
1:1000 dilution of anti-SeV-F antibody (f236) as the primary
antibody.
[0099] By the method as described above, the establishment of
LLC-MK2 cells in which SeV-F gene product can be inducibly
expressed, is confirmed. Hereafter, these cells before the
induction of SeV-F gene expression are described as LLC-MK2/F and
the cells after the induction are described as LLC-MK2/F/Ad.
5. Reconstitution and Amplification of F Gene-Deficient SeV
[0100] F gene-deficient Sendai virus genomic cDNA containing
angiogenic gene (s) can be reconstituted by transfecting helper
cells expressing F gene with it. For example, F gene-deficient
Sendai virus genomic cDNA containing the hFGF2 gene
(pSeV18.sup.+hFGF2/.DELTA.F) as described above is used to
transfect LLC-MK2 cells as follows. LLC-MK2 cells are seeded onto
10-cm petri dishes at a density of 5.times.10.sup.6 cells/dish,
incubated for 24 hours, and transfected (at moi=2 to 3, preferably
2) for 1 hour at room temperature with recombinant Vaccinia virus
expressing T7 RNA polymerase (Fuerst, T. R. et al., Proc. Natl.
Acad. Sci. USA 83, 8122-8126, 1986) which has been treated with
long wave UV (365 nm) and Solaren for 20 min. For UV exposure of
the Vaccinia virus, for example, UV Stratalinker 2400 (Catalog No.
400676 (100 V), Stratagene, La Jolla, Calif., USA) which is
equipped with five 15-watt bulbs is used. Cells are washed twice
and the plasmids pSeV18.sup.+hFGF2/.DELTA.F, pGEM/NP, pGEM/P,
pGEM/L (Kato, A., et al., Genes Cells 1, 569-579, 1996), and
pGEM/F-HN (WO 00/70070) are resuspended in OptiMEM (GIBCO) at
ratios of 12 .mu.g, 4 .mu.g, 2 .mu.g, 4 .mu.g, and 4 .mu.g/dish,
respectively, and mixed with SuperFect transfection reagent (1
.mu.g DNA/5 .mu.l of Superfect, QIAGEN). Mixtures are left standing
at room temperature for 15 min and then added to 3 ml OptiMEM
containing 3% FBS. The resulting mixture is added to the cells and
incubated for 3 to 5 hours. Cells are then washed twice with
serum-free MEM and incubated in serum-free MEM containing 40
.mu.g/ml of cytosine 13-D-Arabinofuranoside (AraC, Sigma) and 7.5
.mu.g/ml trypsin (GIBCO) for 24 hours.
[0101] The culture medium is removed from the cell culture and
helper cell expressing F gene, LLC-MK2/F/Ad cells, which have been
constructed as described above, are layered on the cells.
Specifically, LLC-MK2/F/Ad cells are resuspended in serum-free MEM
(containing 40 .mu.g/ml AraC and 7.5 .mu.g/ml trypsin), layered on
the cells without culture medium, and then incubated for 48 hours.
Cells are collected using a scraper and pellets are resuspended in
OptiMEM (10.sup.7 cells/ml) and freeze-thawed three times. The
lysates are added (200 .mu.l/well) to the LLC-MK2/F/Ad cells
(4.times.10.sup.6 cells/well in 12-well-plate) and additional 300
.mu.l/well of serum-free MEM (containing 40 .mu.g/ml AraC, 7.5
.mu.g/ml trypsin) is added to each well and then incubated for 15
hours to 24 hours. The culture medium is removed, and cells are
washed with serum-free MEM, and replaced with fresh serum-free MEM
(containing 40 .mu.g/ml AraC and 7.5 .mu.g/ml trypsin). Cells are
incubated for 5 days to 9 days and the culture medium is collected.
The collected medium contains reconstituted F gene-deficient SeV
particles. The F gene-deficient SeV particles can be amplified by
infecting into LLC-MK2/F/Ad cells and culturing (or repeating the
process) the cells in serum-free MEM (containing 40 .mu.g/ml AraC
and 7.5 .mu.g/ml trypsin).
[0102] At this time, contamination of the recombinant Vaccinia
virus which is used to express. T7 RNA polymerase during
reconstitution, is mostly prevented by filtering the culture medium
containing F gene-deficient SeV particles twice with a 0.22 .mu.m
filter. Specifically, the culture (post-P2 samples) amplified twice
or more in serum-free MEM containing AraC (containing 40 .mu.g/ml
AraC and 7.5 .mu.g/ml trypsin) are filtered twice with 0.22 .mu.m
filter and the culture is further amplified once in serum-free MEM
containing AraC (containing 40 .mu.g/ml AraC and 7.5 .mu.g/ml
trypsin) to obtain amplified F gene-deficient SeV which can serve
as SeV free from recombinant Vaccinia virus contamination.
[0103] In preparing deletion virus vectors, two different virus
vectors having deletion of a different envelope gene in the genome
may be transfected into the same cell. In this case, each deleted
envelope protein is supplied through expression from the other
vector, and this mutual complementation permits the generation of
infective virus particles, which can replicate and propagate. Thus,
two or more of the virus vectors' of the present invention may be
simultaneously inoculated in a combination that complement each
other, thereby producing a mixture of each envelope deletion virus
vector at a low cost and in a large scale. Because these viruses
lacking an envelope gene have a smaller genome, they can allow the
insertion of a long exogenous gene. In addition, it is difficult
for these viruses, which are intrinsically non-infective, to keep
the status of co-infection after being diluted outside cells, and
thus they are sterilized and less harmful to the environment.
[0104] Once a viral vector is prepared using, as the exogenous
gene, a gene for the treatment of a disease, then the vector can be
administered to perform gene therapy. When the viral vector of the
present invention is used in gene therapy, an exogenous gene that
ensures desired therapeutic effects or an endogenous gene whose
expression is impaired in the body of a patient can be expressed
either by a method of direct administration or by a method of
indirect (ex vivo) administration for gene expression. There is no
limitation on the type of exogenous gene as long as it is an
angiogenic gene or promotes angiogenesis, including not only a
nucleic acid encoding a protein but also a nucleic acid encoding no
protein, for example, ribozyme or antisense nucleic acid of a gene
supressing angiogenesis.
[0105] The collected Paramyxovirus can be purified to be
substantially pure. Purification can be carried out by a known
purification/separation method such as filtration, centrifugation,
and column purification, or the combination thereof. The term
"substantially pure" means that a virus comprises the major portion
in a sample where it is present as a component. Typically, a
substantially pure virus vector in a sample can be confirmed when
protein derived from the virus vector occupies 50% or more,
preferably 70% or more, more preferably 80% or more, yet more
preferably 90% or more, of the total proteins in the sample.
Exemplary purification methods specific for Paramyxovirus include
methods using cellulose sulfuric ester or cross-linked
polysaccharide sulfuric ester (Examined Published Japanese Patent
Application No. (JP-B) Sho 62-30752; JP-B Sho 62-33879; and JP-B
Sho 62-30753), and methods which comprise allowing polysaccharide
comprising fucose sulphuric acid and/or its degradation product (WO
97/32010).
[0106] The Paramyxovirus vector of the present invention can be
made as a composition together with a desired, pharmaceutically
acceptable carrier or medium. A "pharmaceutically acceptable
carrier," as defined herein, refers to those materials that can be
administered with a vector and do not significantly inhibit gene
transfer achieved by the vector. For instance, the Paramyxovirus
vector of the present invention may be appropriately diluted with a
medium such as saline and phosphate buffered saline (PBS), to
prepare a composition. If the Paramyxovirus vector of the invention
is propagated in chicken eggs, the composition may contain
allantoic fluids. In addition, the composition may contain media
such as deionized water or a 5% dextrose aqueous solution. It may
further contain stabilizers, antibiotics, and such. The present
invention provides a method for producing angiogenic compositions
in the present invention, which comprises the step of mixing the
vector of the present invention with the pharmaceutically
acceptable carriers. The present invention also relates to the
usage of the vectors of the present invention for producing the
angiogenic compositions in the present invention. The compositions
in the present invention are also useful as pharmaceutical
compositions. The present invention relates to ischemia therapeutic
formulations including the vectors in the present invention and
pharmaceutically acceptable carriers. The present invention also
relates to the use of the vectors and the compositions of the
present invention as pharmaceuticals.
[0107] Angiogenic genes carried by Paramyxovirus vectors can be
transferred by administering Paramyxovirus vectors constructed as
described above or the compositions containing the vectors. The
present invention provides the method for inducing angiogenesis
which comprises the step of administering Paramyxovirus vectors of
the present invention or angiogenic compositions of the present
invention. The method is especially useful to treat ischemic
tissues. Although there is no limitation to the sites of
administration, local administration of the transgene directly into
ischemic tissues or their surrounding areas is preferable so that
expression products are concentrated in ischemic tissues and are
prevented from leaking into the circulatory system. Alternatively,
it is preferable to express the transgenelocally in the target
tissue areas using proper gene delivery systems. For example, gene
delivery can be achieved by administering Paramyxovirus
vector-containing compositions of the present invention from inside
or outside of ischemic tissues in vivo in order to express
exogenous genes in the ischemic tissues. In addition, it may be
achieved by ex vivo administration. For example, cells transfected
with Paramyxovirus vectors encoding angiogenic genes can be
injected into ischemic tissue areas or infused into arteries, which
flow through the ischemic tissues.
[0108] Furthermore, local administration using a catheter can be
selected. For example, vectors of the present invention can be
administered by the double balloon catheter method, in which the
vector compositions are infused into the area where the blood
vessel is separated by two balloons, or by the administration
method using a porous balloon (Jorgensen, B. et al., Lancet 1
(8647): 1106-8, 1989; Wolinsky, H. and Thung, S, N., J. Am. Coll.
Cardiol. 15 (2): 475-81, 1990; WO 93/00051; WO 93/00052).
Hydrogel-coated balloons can also be used as described above
(Takeshita, S. et al., Lab. Invest. 75 (4): 487-501, 1996).
[0109] For example, the vector compositions of the present
invention can be directly infused into myocardium through the
ventrical cavity using a catheter to treat, for example, cardiac
infarction, angina, or other ischemic cardiac diseases. Moreover,
angiogenesis and development of collateral circulation in the area
of stenosis in the coronary artery can be promoted by local
infusion of the vectors of the present invention using a
catheter.
[0110] However, the use of a catheter to administer the vectors
requires a relatively long period of incubation and may cause
vascular injury by the balloon. Moreover, it is often difficult to
insert a catheter into diffuse blood vessels in ischemic tissues.
Intramuscular (IM) administration of the vectors is especially
preferred for the treatment of ischemic tissues in the present
invention. Intramuscular administration is easier than
administration using a catheter and the risk of damaging a blood
vessel is low. The vectors of the present invention are
administered into, for example, ischemic tissues or striated
muscles surrounding the ischemic tissues. Striated muscles include
skeletal and cardiac muscles. Bupivacaine, which is known to
promote the expression of transgenes by inducing regeneration of
muscles, can be administered before the administration of the virus
vectors. Moreover, intradermal (ID) administration can also be
selected. The vectors can be transferred into muscles, for example,
subcutaneously or directly through a skin incision. It is necessary
to be careful not to damage fascia during the vector transfer. For
example, administration can be conducted using needles and
syringes, or a bioinjector, which does not require the use of
needles. Administration can be carried out either at a single place
or multiple places. Moreover, administration can be carried out
either once or multiple times.
[0111] The vectors of the present invention can be effectively
administered in the form of a matrix. An exemplary method can be
performed by dispersing virus vectors in aterocollagen matrix and
solidifying the resulting mixture by freeze-drying, thereby
allowing the matrix to gradually degrade. The use of this method
has been reported to be useful for lasting effects of Adenovirus
vectors known for their transient gene expression and of naked DNA
(Ochida, T. et al., Nature Medicine 5, 707-710, 1999). The virus
vectors of the present invention can be formulated with these
auxiliary agents and can be freeze-dried. Moreover, a lipid cation
can be added to increase the expression effect.
[0112] It is known that even a small administrative matrix can
gradually release proteins such as growth factors over a long
period of time through needles of approximate size of 18 gauge. For
example, in the case of protein formulations are administered, the
effectiveness of formulations such as a growth hormone last longer,
for example, 7 days or more, than when formulations such as a
growth hormone are administered alone. There is a report that the
effectiveness can usually last 10 days or more (Unexamined
Published Japanese Patent Application No. (JP-A) Hei 10-001440).
This method thus enables to significantly reduce the number of
administrations and amount of pain suffered by patients. The
formulations can be used as, for example, solid injections (such as
implants), which are administered subcutaneously and
intramuscularly and mucous membrane absorbents such as
suppositories. The shapes of the solid formulations for injection
are often particle- or rod-shaped, which can be administered by
injection needles. Particle shapes such as sphere shape, and rod
shapes such as square and cylindrical shapes, are preferred shapes
for formulation.
[0113] The size of the parenteral formulation of the present
invention can be chosen depending on the type of administration and
any size is suitable as long as it does not cause excess pain to
patients. When the injection consists of a rod-shaped matrix of,
for example, 3 mm or less (for example, 0.1 mm to 3 mm) in diameter
and 30 mm or less (for example, 0.5 mm to 30 mm) in length,
preferably 1.3 mm or less (for example, 0.1 mm to 1.2 mm) in
diameter and 20 mm or less (for example, 0.5 mm to 20 mm) in
length, which can be administered with an injection needle 14 gauge
or smaller, and more preferably that of 0.1 mm to 1 mm in diameter
and about 1 mm to 20 mm in length. The matrix is preferably
cylindrical. Moreover, when the injection contains a
particle-shaped matrix, the maximum diameter must be 1 mm or less
(for example, about 0.1 .mu.m to 1 mm), preferably, 150 .mu.m or
less (for example, about 0.5 .mu.m to 100 .mu.m), more preferably,
about 1 .mu.m to 100 .mu.m. Moreover, the weight of the matrix can
be chosen depending on the shape of the formulation and for
injection, the weights are often 40 mg or less, preferably, 1 mg to
25 mg.
[0114] The genes transferred by the Paramyxovirus vector of the
present invention are not limited as long as they promote
angiogenesis and/or vascularization. For example, genes encoding
aFGF, FGF2 (bFGF), VEGF, Ang (including Ang-1 and Ang-2), EGF,
TGF-.alpha., TGF-.beta., PD-ECGF, PDGF, TNF-.alpha., HGF, IGF, EPO,
CSF, M-CSF, GM-CSF, IL-8, and NOS, as described above, are used.
These proteins include each member and isoform belonging to each
family. One example especially suitable as an angiogenic gene,
which is transferred by the Paramyxovirus vector of the present
invention, is the gene encoding FGF2. FGF2 is, for example,
anticipated to be applicable for acute ischemia therapy. For
example, a significant therapeutic effect for acute critical
ischemic limbs can be expected. Moreover, FGF2 shows a therapeutic
effect for cardiac infarction (Yanagisawa-Miwa, A. et al., Science
257 (5075): 1401-3, 1992). Proteins can be a secretory protein, a
membrane protein, a cytoplasmic protein, or a nuclear protein.
Preferably, a secretory protein is used. Moreover, proteins may be
artificially synthesized. Examples of artificially synthesized
proteins are fusion proteins with other proteins, dominant negative
proteins (including soluble molecules of receptors or
membrane-binding dominant negative receptors), deficient forms of
cell adhesion molecules, and cell surface molecules. Moreover,
proteins attached to secretory signals, membrane localization
signals, nuclear import signals, and such can be used. The
transgenes can be endogenously induced to be expressed in ischemic
tissues. It is also possible that their expressions are not induced
but can be expressed at different sites. Moreover, the function of
the undesired genes expressed in ischemic tissues can be suppressed
by expression of antisense RNA molecules or RNA cleaving
ribozymes.
[0115] The vectors of the present invention are expected to be
applicable for gene therapy to treat various ischemic diseases as
well as diseases that are treatable by angiogenesis. Such gene
therapy includes, for example, the treatment for ischemia caused by
vascular sever, infarction, and hemostatis due to vascular
dissociation. The ischemic diseases treatable by the vectors of the
present invention are, for example, cerebrovascular ischemia,
kidney ischemia, lung ischemia, limb ischemia, ischemic
cardiomyopathy, and myocardial ischemia. Tissues that are
applicable for gene therapy are not specifically limited and, for
example, muscles, brains, kidneys, and lungs can be used. Moreover,
it is effective for promoting angiogenesis in transplants.
Furthermore, it is useful for constructing various disease models
and for developing or evaluating treatment methods in disease
models.
[0116] Accelerated angiogenesis by vector administration can be
confirmed by, for example, measuring the density and analyzing the
number of capillary vessels in biopsy samples, and images by
angiography. Moreover, it can also be confirmed by blood flow
analysis using Doppler perfusion image analysis. The treatment
effect on ischemic tissues is confirmed by macroscopic observation
of tissue necrosis or tissue amputation or the microscopic
observation of tissue samples.
[0117] Paramyxovirus vectors of the present invention are
administered into target tissues at pharmaceutically effective
doses and, thus, the vectors are transferred into the cells of the
target tissues. "Pharmaceutically effective dose" means an amount
of genes to be introduced into the cells of the target tissues,
which achieves the preferable treatment effect or disease
prevention effect at least partially. Angiogenic factors are
produced from the cells, to which the vectors are transferred, by
administering an effective dose of Paramyxovirus vectors of the
present invention containing the desired angiogenic genes.
Preferably, significant levels of angiogenic factors are detected
in the tissues where the effective dose of the vectors of the
present invention containing the desired angiogenic genes are
administered. The phrase "significant level" indicates that the
amount of expression (amount of transcription and translation
products) of the genes transferred by the vectors of the present
invention is detectable. For example, it indicates that the maximum
expression level of the transferred gene is significantly enhanced
as compared to the expression level of the endogenous gene when an
endogenous gene corresponding to the transgene exists. Preferably,
the expression level of the angiogenic genes at the site of
administration is 1.2 times or more greater than the expression
level of the endogenous gene, preferably 1.5 times or more, more
preferably 2 times or more, even more preferably 10 times or more,
and most preferably 20 times or more. However, the expression level
of the transgene should be decided by considering the effective
expression dose and toxic levels.
[0118] The expression level of the transgenes in the cells can be
assayed by methods well known to those in the art. The
transcriptional products of the genes can be detected and
quantified by the methods such as, Northern hybridization, RT-PCR,
and RNA protection assay. In situ detection can be performed by
methods such as Northern hybridization and RT-PCR. Western
blotting, Immuno precipitation, RIA, ELISA, Pull-down assays, and
such, using antibodies, can be performed to detect translational
products. Moreover, to make the detection of expression products of
the transgene easier, tags can be attached to the expressed protein
or reporter genes can be inserted such that the reporter genes are
expressed. Examples of reporter genes include, without limitation,
3-galactosidase, chloramphenicol acetyl transferase (CAT), alkaline
phosphatase, and green fluorescence protein (GFP) genes.
[0119] A dose of the vector may vary depending on the disease, the
body weight, age, sex, symptom, the purpose of administration, the
transgene, and such, but it can be appropriately determined by
those skilled in the art. The dose of the vector may be preferably
within the range of about 10.sup.5 cell-infectious units (CIU)/ml
to about 10.sup.11 CIU/ml, and more preferably about 10.sup.7
CIU/ml to about 10.sup.9 CIU/ml, but most preferably about
1.times.10.sup.8 CIU/ml to about 5.times.10.sup.8 CIU/ml, with
pharmaceutically acceptable carriers. The composition of the
present invention comprising the virus may be administered into
subjects including all mammalian animals including humans, monkeys,
mice, rats, rabbits, sheep, cattle, and dogs.
[0120] The dose for humans is preferably within the range of
2.times.10.sup.8 CIU to 2.times.10.sup.10 CIU in general for each
administration site, more preferably, a dose of around
2.times.10.sup.9 CIU, for example, within the range of
5.times.10.sup.8 CIU to 1.times.10.sup.10 CIU. The frequency of
administration is once or more times within the range of clinically
acceptable side effects. The frequency of the administration per
day is the same. For non-human animals, for example, administration
can be done by increasing or decreasing the number of
administration sites or by calculating the doses based on the
weight ratio of human to the target animals or the weight ratio or
volume ratio of target sites (such as ischemic tissues).
[0121] The references cited throughout this description are
incorporated herein by reference.
BRIEF DESCRIPTION OF THE DRAWINGS
[0122] FIG. 1 is a schematic representation of operative procedures
for moderate (left panel) and severe (right panel) acute hind limb
ischemia of mice. Branched lines indicate arteries and veins in
hind limb. Short thick lines indicate excisional sites of
vessels.
[0123] FIG. 2 is graphs showing hind limb ischemia-related
expression of endogenous VEGF (solid) and FGF2 (hollow) in muscle
(left graph) and serum (right graph). Moderate and severe ischemia
models of C57BL/6 mice were used. Two days after operation, all
thigh and calf muscles (n=6) and serum (n=6) were obtained, and
subjected to enzyme-linked immunosorbent assays (ELISA). Values
were standardized by total extracted protein of muscle or volume,
respectively, and expressed with mean.+-.S.D. Values of muscle
contains both data of thigh and calf (i.e., n=12 in each group).
Mean values are shown in the graph. *P<0.01, #P<0.05
(analyzed by one-way ANOVA).
[0124] FIG. 3 is a photograph showing the result of RT-PCR for
detecting induction of VEGF expression due to ischemia.
[0125] FIG. 4 graphs showing expression level (left) and its time
course change (right) of SeV-mediated firefly luciferase gene
transferred into muscles. Luciferase activities are examined in the
untreated group, the pCMV-luc (100 .mu.g)-administered group, and
the SeV-luc (10.sup.7 pfu or 10.sup.8 pfu)-administered group,
using moderate ischemia model of C57BL/6 mice (left). The right
panel shows the time course changes of the expression level of
luciferase gene transferred in the moderate ischemic model. White
circles indicate the of pCMV-luc (100 .mu.g)-administered C57BL/6
mouse group. Black circles indicate the SeV-luc (10.sup.8
pfu)-administered C57BL/6 mouse group. Shaded circles indicate the
SeV-luc (10.sup.8 pfu)-administered BALB/c nu/nu mouse group. Thick
line indicates the cut off-values, above which the expression of
the transgene becomes significant. The level of gene expression in
each graph is represented in the same log scale.
[0126] FIG. 5 is a graph showing the secretion level of angiogenic
protein in human umbilical vein endothelial cells (HUVEC), COS7
cells, bovine vascular smooth muscle cells (BSMC), and
cardiomyoblast cells (H9C2). "Basal release" indicates the
production amount of each factor without the vectors. "Cut-off
value" indicates the level above which the expression of the
transgene becomes significant.
[0127] FIG. 6 is graphs showing in vivo expression of exogenously
transferred FGF2 (a) and VEGF (b) gene in muscle (left two graphs)
and serum (right two graphs) of moderate ischemic limb of C57BL/6
mice. Soon after the operative procedure, 50 .mu.l of each vector
solution was injected to thigh and calf muscles. Two days after
operation, all thigh and calf muscles (n=6, each) and serum (n=6)
were obtained, and subjected to ELISA for murine FGF2 (a) and,
murine and human VEGF (b), respectively. Values were standardized
by total extracted protein or total volume of muscle and expressed
with mean.+-.S.D. Mean values are shown in the figure. Note that
the scales are in log scale.
[0128] FIG. 7 is graphs showing gene transfer-mediated enhancement
of endogenous murine. VEGF expression in limb muscles of C57BL/6
mice without operation (left), with moderate ischemia (middle), and
severe ischemia (right). Soon after the operative procedure, 50
.mu.l of each vector solution was injected to thigh and calf
muscles. Two days after operation, all thigh and calf muscles and
serum (n=6 each, total n=12) were obtained, and subjected to ELISA
for murine VEGF. Values were standardized by total extracted
protein of muscle, and expressed with mean.+-.S.D. Mean values are
shown in the figure. *P<0.01, #P<0.05 (analyzed by one-way
ANOVA).
[0129] FIG. 8 is photographs showing tissue images of
gene-transferred mouse limb muscles. Histological observation was
carried out 2 days after severe ischemia operation for C57BL/6
mice, which were then treated as described in the description of
FIG. 7. Apparent inflammatory infiltrate and stromal edema can be
seen in mock transfected (SeV-luciferase; mock) thigh muscle (upper
right), compared to untreated animal (upper left; no ischemia).
Severe damage of muscle fibers, intracellular edema, and
inflammatory infiltrate can be seen in VEGF165-treated animals
(bottom left; VEGF165). These damages are inhibited by FGF2 gene
transfer (bottom right; FGF2). Each group contains 6 animals and
shows similar results. Hematoxylin-eosin staining. Original
magnification x200.
[0130] FIG. 9 is photographs showing therapeutic or adverse effects
of exogenously transferred angiogenic factor genes in muscles of
severe limb ischemia mice 10 days after operation for left hind
limbs. Each photograph simultaneously shows limb salvage score
(LSS). Upper panels show typical adverse effect in severe ischemia
model of C57BL/6 mice (limb salvage model). VEGF165-transferred
mouse demonstrated complete limb amputation (upper middle panel),
while control mouse with luciferase (upper left panel) and
FGF2-treated mouse (upper right panel) indicated salvaged limbs.
Lower panels show typical therapeutic effect in severe ischemia
model of BALB/c nu/nu mice (auto-amputation model). FGF2-treated
mouse demonstrated limb salvage (bottom right panel), while control
mouse with luciferase (bottom left panel) and VEGF165-treated mouse
(bottom middle panel) indicated almost complete loss of hind
limbs.
[0131] FIG. 10 is graphs showing limb prognosis curve in
vector-administered limb salvage and auto-amputation models. The
graphs show the rate (limb salvage rate) of vector-administered
animals retaining limb. As a result of intramuscular transfer of
angiogenic genes, A shows adverse effects of VEGF165 in severe
ischemia model of C57BL/6 mice (limb salvage model) and B shows
therapeutic effects of FGF2 in severe ischemia model of BALB/c
nu/nu mice (auto-amputation model). Each group was subjected to 3
separate experiments (n=10). Curve was described by Kaplen-Mayer's
method, and data was analyzed with log-rank test. *P<0.0001.
[0132] FIG. 11 is photographs showing in vivo angiogenic effect in
C57BL/6 mice with severe hind limb ischemia (limb salvage model)
measured with a laser Dopplar perfusion image analyzer. Recovery of
blood perfusion was observed in the mice treated with
SeV-luciferase, SeV-VEGF165, and SeV-FGF2 at 10.sup.7 pfu. Each
group shows the time course of same animal. Upper panels show
typical results of time course of blood flow recovery in mouse
treated with SeV-luciferase (mock transfection). Blood reperfusion
of thigh muscle was recognized around 4 days after intervention,
and was apparent at day 7. At day 10, however, no clear perfusion
at calf level was hard to be detected, resulting in limb atrophy
with a sign of toe necrosis (rightmost panel). Middle panels show
typical time course of mouse with SeV-VEGF165. No apparent and
significant reperfusion was recognized in thigh and calf during
observation, resulting autoamputation of the limb (rightmost
panel). Lower panels show typical time course of mouse-treated with
SeV-FGF2. Apparent reperfusion at the thigh level was clearly seen
until day 4, and significant blood flow was recognized in whole
limb until day 10, resulting in complete limb salvage (rightmost
panel).
[0133] FIG. 12 is a graph showing the recovery of blood perfusion
by angiogenic gene therapy in C57BL/6 mice with severe ischemia
(limb salvage model). The average blood perfusion in the ischemic
limb and control limb treated as in the description of FIG. 11 was
calculated to give the blood perfusion value ratio, of left limb
(ischemic)/right limb (control). *P<0.001 (compared with all
other groups), #p<0.05 (compared with all other groups),
##p<0.05 [compared with non-administered (mock) group].
[0134] FIG. 13 is a graph showing time course change in limb
salvage ratios in mouse severe ischemia models (auto-amputation
model) to which the F gene-deficient SeV vector containing the
hFGF2 gene or replicative SeV vector containing the hFGF2 gene. In
the figure, the number of subjects (n) and the dose of vectors are
shown.
[0135] FIG. 14 shows the therapeutic effect of SeV vector
containing FGF2 gene in mice (cardiac infarction model) whose
coronary artery is ligated.
DETAILED DESCRIPTION OF THE INVENTION
[0136] The present invention is specifically illustrated below with
reference to Examples, but it is not to be construed as being
limited thereto.
[0137] Recombinant SeV was prepared as described previously (Yu, D.
et al., Genes Cells 2(7): 457-66, 1997; Yonemitsu, Y., et al.,
Nature Biotech. 18, 970-973 (2000); Kato, A., et al., Genes Cells
1, 569-579 (1996); Hasan, M. K., et al., J. Gen. Virol. 78,
2813-2820 (1997)).
[0138] Virus titer was determined by hemagglutination assay using
chicken red blood cells, and high titer stock (10.sup.9 pfu/ml) was
kept at -80.degree. C. until use. Human VEGF165 cDNA was isolated
by RT-PCR as described previously (Yonemitsu, Y., et al., Lab.
Invest. 75, 313-323 (1996)). Full-length mouse FGF2 cDNA as
described in Imamura, T., et al., Science 249, 1567-1570 (1990) was
prepared by PCR. Specifically, the full-length cDNA was amplified
using a partial mouse FGF2 cDNA fragment (a fragment of position 7
to 435 nucleotide of Accession Number M30644), which is missing the
start and stop codon regions as a template, and N-terminus primer
(5'-ACGTGCGGCCGCCAAAGTTCATCCACCATGGCTGCCAGCGGCATCACCTCGCTTCCC-3'/SEQ
ID NO: 15) containing the start codon of mouse FGF2 cDNA and
C-terminus primer
(5'-ACGTGCGGCCGCGATGAACTTTCACCCTAAGTTTTTCTTACTACGCGGATCAGCTCTTAGCA-
GA CATTGGAAGAAACAGTATGGCCTTCTGTCCAGGTCCCGT-3'/SEQ ID NO: 16)
containing the stop codon and SeV specific sequence. The human
VEGF165 and mouse FGF2 cDNAs, prepared as described above, were
cloned into pSeV18.sup.+b(+) (Hasan, M. K. et al., 1997, J. General
Virology 78: 2813-2820) at a NotI site after each nucleotide
sequence was confirmed. Sendai virus vectors, which express human
VEGF165 or mouse FGF2, were referred to as SeV-VEGF165 or SeV-FGF2,
respectively. SeV-luciferase (Hasan, M. K. et al., J. Gen. Virol.
78 (Pt 11): 2813-2820, 1997; Yonemitsu, Y. et al., Nature
Biotechnol. 18: 970-973, 2000) and pCMV-luciferase (Yonemitsu, Y.
et al., Nature Biotechnol. 18: 970-973, 2000) were prepared as
described above.
[0139] All data of Examples of the present invention were
represented as mean.+-.S.D. in statistical analysis. The data
except that of limb salvage were analyzed by one-way ANOVA with
Scheffe's adjustment. For limb salvage, rate expressed by limb
salvage score (LSS) was analyzed by Kaplen-Mayer's method. The
statistical significance of the limb salvage experiments was
determined using the log-rank test and p<0.05 was considered as
significant in all statistical analyses.
[0140] The present invention provides the basic technology for gene
therapy that targets ischemic tissues. Angiogenesis in the ischemic
tissues can be effectively induced and necrosis can be prevented by
using the gene transfer of the present invention.
Example 1
[0141] Ischemia-Induced Endogenous VEGF Expression Does Not
Contribute to Local Proteinaccumulation in Hind Limb Muscle
[0142] To assess the therapeutic and adverse effects of angiogenic
factors, the present inventors established following 3 models of
limb ischemia by 2 different operations (FIG. 1): (1) moderate limb
ischemia model of C57BL/6 mice in which whole femoral artery and
vein, and saphenous arteries and vein have been excised (FIG. 1
left panel) (Couffinhal, T., et al., Am. J. Pathol. 152, 1667-1679
(1998); Kalka, C., et al., Proc. Natl. Acad. Sci. USA 97, 3422-3427
(2000)); (2) severe ischemia model of C57BL/6 mice in which whole
external iliac artery and vein, femoral artery and vein, and all
related branches have been excised (FIG. 1 right panel); and (3)
immune deficient BALB/c nu/nu mice subjected to same surgical
procedures as (2) (i.e., severe ischemia model of BALB/c nu/nu
mice).
[0143] Adult male C57BL/6, BALB/c, and BALB/c nu/nu mice (6-8 weeks
old, Charles River Grade) were purchased from KBT Oriental Co. Ltd.
(Tosu, Saga, Japan). Animal experiments were performed using
approved protocols and in accordance with recommendations for the
proper care and use of laboratory animals by the Committee for
Animals', Recombinant DNA, and Infectious Pathogens' Experiments at
Kyushu University and were done according to the law (No. 105) and
Notification (No. 6) of the Japanese Government and "Principles of
Laboratory Animal Care" and "Guide for the Care and Use of
Laboratory Animals" by National Institute of Health of USA
(publication No. NIH 80-23, revised 1985).
[0144] Under sufficient anesthesia using intraperitoneal injection
of pentobarbital, mice were subjected to skin incision. For the
moderate ischemia model, whole superficial femoral artery and vein
and saphenous artery and vein (from just below of deep femoral
arteries to popliteal artery and vein) was ligated, cut, and
removed (FIG. 1, left panel) (Couffinhal, T., et al., Am. J.
Pathol. 152, 1667-1679 (1998); Kalka, C., et al., Proc. Natl. Acad.
Sci. USA 97, 3422-3427 (2000)). For the severe ischemia model,
additional excision of external iliac artery and vein with deep
femoral artery were also made (FIG. 1, right panel).
Reproducibility of limb prognosis of these models were confirmed by
the 3 to 5 separate experiments using 10 or more animals/model by
same operator (I. M.). Each limb salvage experiments contained
animals subjected to 4 individually separate experiments.
[0145] The model (1) as described above never lost their limbs,
occasionally showing only a sign of toe necrosis. Further, the
model (2) (severe ischemia model of C57BL/6 mice) did not show limb
necrosis (called "limb salvage model") and all animals of the model
(3) (severe ischemia model of BALB/c nu/nu mice) resulted in nearly
total limb amputation within 10 days after operation (called
"auto-amputation model"). The severe ischemia model of
immunocompetent BALB/c mice also showed similar degree of limb
necrosis to BALB/c nu/nu mice (data not shown). Together with a
previous report indicating that BALB/c mice are more susceptible to
angiogenesis against growth factors than C57BL/6 mice (Rohan, M. R.
et al., FASEB J. 14, 871-876 (2000)), these results suggests that
limb salvage in C57BL/6 mice seems to be depend rather on better
collateral limb circulation than on susceptibility to
angiogenesis.
[0146] The present inventors assessed the endogenous expression of
VEGF and FGF2 in the ischemic muscle and serum of the moderate and
severe ischemia model as described above. Two days after operation,
each limb muscle (whole thigh and calf muscle) and serum of C57BL/6
mice were collected, and their tissues are homogenized or lysated,
and then subjected to enzyme-linked immunosorbent assay (ELISA).
Recombinant proteins were synthesized using Quantikine Immunoassay
systems (R & D Systems Inc., Minneapolis, Minn.) for human VEGF
or mouse FGF2, and then quantified according to its instruction.
The concentrations of total proteins were determined by Bradford
method using protein assay system (Bio-Rad Laboratories,
Hertfordshire, UK) and standardized (Yonemitsu, Y., et al., Nature
Biotech. 18, 970-973 (2000)).
[0147] Since there were no significant differences in protein
concentration between thigh and calf muscles, both were included in
each group. Interestingly, ischemic operation significantly
enhanced FGF2 protein content in both hind limb ischemia model mice
(the moderate model, 847.5.+-.187.7 pg/g muscle; the severe model,
895.4.+-.209.5 pg/g muscle; each n=12), compared to baseline
(489.7.+-.108.6 pg/g muscle; n=12) for untreated mice (P<0.001)
(FIG. 2). On the other hand, ischemia-related enhancement of VEGF
expression was seen in the severe ischemic group, but not
significant in the muscles (Untreated, 174.7.+-.43.1; Moderate,
119.2.+-.53.4; and Severe, 242.5.+-.244.3, n=12). These seemed
paradoxical results because VEGF is a well-known mitogen strongly
induced by tissue ischemia (Shweiki, D. et al., Nature 359, 843-845
(1992); Forsythe, J. A., et al., Mol. Cell. Biol. 16, 4604-4613
(1996)). The present inventors measured VEGF level in serum since
VEGF may leaked to systemic circulation. As expected,
severity-dependent increase of VEGF protein level in serum was
observed, while FGF2 level in serum could not be detected (FIG. 2,
right panel).
[0148] The present inventors hypothesized that limb ischemia may
induce rather smaller isoforms of VEGF which is well-known less to
interact to heparin sulfate than medium- or larger-sized VEGF
(Cohen, T., et al., J. Biol. Chem. 270, 11322-11326 (1995)). To
assess this hypothesis, the present inventors analyzed expression
of VEGF isoforms in thigh muscle of C57BL/6 male mice a day after
operation. The analysis was performed by RT-PCR using primer sets
which can differentiate murine VEGF splicing isoforms including
VEGF188, 164, 144, and 120 (Burchardt, M., et al., Biol. Reproduct.
60, 398-404 (1999)). Primer sets were previously reported
(Burchardt, M., et al., Biol. Reproduct. 60, 398-404 (1999)) for
rat VEGF on exon 1 and exon 8: forward primer (5'-TGC ACC CAC GAC
AGA AGG GGA-3'/SEQ ID NO: 17) and reverse primer (5'-TCA CCG CCT
TGG CTT GTC ACA T-3'/SEQ ID NO: 18), which correspond to sequences
of murine VEGF isoforms. For detecting smallest isoform of murine
VEGF (VEGF115), same forward primer as above and VEGF115-specific
reverse primer (5'-CTA CCA AAA GTT TCC CAG GCA G-3'/SEQ ID NO: 19)
were used (Sugihara, T. et al., J. Biol. Chem. 273, 3033-3038
(1998)). RT-PCR was performed under conditions according to
literatures (Burchardt, M., et al., Biol. Reproduct. 60, 398-404
(1999); Sugihara, T. et al., J. Biol. Chem. 273, 3033-3038
(1998)).
[0149] As a result, ischemia-related endogenous VEGF expression was
seen only in 164 isoform, while no apparent other isoforms'
expression was detected (FIG. 3). Additional RT-PCR analysis cannot
detect the expression of a known smallest isoform, VEGF115
(Sugihara, T. et al., J. Biol. Chem. 273, 3033-3038 (1998)).
Example 2
Kinetics of Recombinant Sendai Virus-Mediated Intramuscular Gene
Transfer to Mouse Hind Limb
[0150] For the kinetic study, the present inventors assessed levels
and time course of transgene expression using firefly luciferase.
Luciferase assay was carried out using a luminometer (Model LB
9507, EG&G Berthold, Germany) according to literature
(Yonemitsu, Y., et al., Nature Biotech. 18, 970-973 (2000)). The
data are represented as relative light units (RLU)/mg protein. The
concentrations of total proteins were determined by Bradford method
using a protein assay system (Bio-Rad Laboratories, Hertfordshire,
UK) and were used for standardizing the value obtained by
luciferase assay. Since limb muscle of severe limb ischemia model
was apparently damaged, suggesting reduced transgene expression,
moderate ischemia model (FIG. 1, left panel) were used for
analysis. The gene (25 .mu.l) was transferred to two sites, thigh
and lower thigh muscles at the time of operation. Doses described
herein below are the sum of the doses at two sites. Mice (C57BL/6
mice) that received 100 .mu.g of pCMV-luciferase (about 50 times
higher than clinical dose) (Baumgartner, I., et al., Circulation
97, 1114-1123 (1998); Isner, J. M. et al., J. Vasc. Surg. 28,
964-973 (1998)) showed relatively high luciferase activity
(mean.+-.S.D.=5.1.+-.3.9.times.10.sup.6 RLU/mg protein, n=6) 2 days
after gene transfer, while approximately 5-times (2.4
3.8.times.10.sup.7 RLU/mg protein, n=12) and 120-times
(7.3.+-.4.7.times.10.sup.8 RLU/mg protein, n=6) higher expressions
were observed in mice that received SeV-luciferase at 10.sup.7
Plaque forming units (pfu) and SeV at 10.sup.8 pfu, respectively.
Further, time course of transgene expression was analyzed using
moderate ischemia model of C57BL/6 mice that received luciferase
expression plasmid (pCMV-luc) or SeV-luc in the same manner as
described above. The moderate ischemia model of C57BL/6 mice that
received intramuscular injection of 10.sup.8 pfu of SeV-luciferase
also showed decline of the expression in time-dependent manner (day
2: 7.3.+-.4.3.times.10.sup.8 RLU/mg protein, n=12; day 7:
3.4.+-.4.7.times.10.sup.7 RLU/mg protein, n=12; and day 14:
2.6.+-.1.2.times.10.sup.4 RLU/mg protein, n=12) (FIG. 4, right
panel). Although time course of luciferase activity in the moderate
ischemia model of immuno-deficient BALB/c nu/nu mice, to which
10.sup.8 pfu of SeV-luciferase were intramusculary administered,
was similar to those of the C57BL/6 mice until day 7, the mice kept
its expression level later (day 2: 9.4.+-.3.7.times.10.sup.8 RLU/mg
protein, n=12; day 7: 1.3.+-.1.9.times.10.sup.7 RLU/mg protein,
n=12; and day 14: 0.9.+-.1.3.times.10.sup.7 RLU/mg protein,
n=12).
[0151] Next, the present inventors assessed secretion of angiogenic
proteins in vitro using various culture cells including not only
muscular cells such as primary bovine smooth muscle cells (BSMCs)
and cardiomyoblasts (H9C2), but also primary human umbilical vein
endothelial cells (HUVECs), and COS7 cells. FGF2 vector (SeV-FGF2)
which contains no classical signal sequences for secreting proteins
ws used in the present invention because previous studies by the
present inventors and others demonstrated that FGF2 without
secreting sequences could be expressed extracellularly (Piotrowicz,
R. S. et al., J. Biol. Chem. 272, 7042-7047 (1997); Qu, Z., et al.,
J. Histochem. Cytochem. 46, 1119-1128 (1998); Florkiewicz, R. Z. et
al., J. Cell. Physiol. 162, 388-399 (1995)). As expected, the
effective secretion of FGF2 protein into the culture medium could
be detected as similar levels of VEGF165 in dose-dependent manner
(for example, at MOI=100: VEGF165 vs FGF2=4,354.+-.2,794 vs
3,682.+-.1,063 in HUVEC, 275.+-.58 vs 398.+-.154 in BSMC,
16,987.+-.4,748 vs 5,976.+-.381 in H9C2, and 38,648.+-.4,913 vs
1,547,237.+-.176,502 in COS7 cells, pg/10.sup.8 cells/24 hours,
n=3, respectively) (FIG. 5).
Example 3
[0152] Kinetics of SeV-Mediated Intramuscular Expression of
Angiogenic Factors In Vivo
[0153] The present inventors' examined the expression level of
angiogenic factors in muscle after in vivo intramuscular
administration of SeV-VEGF165 and SeV-FGF2 into moderate ischemia
model of C57BL/6 mice. Each 25 .mu.l administration was performed
once into the thigh and calf muscles, during operation, using a
26-gauge needle.
[0154] Interesting results were obtained for in vivo expression of
angiogenic factors compared to their in vitro expression and in
vivo expression of the reporter gene. As shown in FIG. 6,
SeV-FGF2-mediated protein synthesis increased in dose-dependent
manner reaching 100-fold greater than endogenous gene expression at
highest titer (basal line, 429.+-.79, ischemia, 974.+-.150,
10.sup.6 pfu, 4,913.+-.313, 10.sup.7 pfu, 13,469.+-.12,611, and
10.sup.8 pfu, 46,703.+-.12,092 pg/g muscle, n=6 each in thigh
muscle; basal line, 550.+-.104, ischemia, 720.+-.128, 10.sup.6 pfu,
1,376.+-.158, 10.sup.7 pfu, 8,252.+-.8,190, and 10.sup.8 pfu,
59,704.+-.35,297 pg/g muscle, n=6 each in calf muscle). Significant
serum FGF2 could not be detected even at highest titer in all
animals received SeV-FGF2. On the other hand, dose-dependent
increase of VEGF165 was far less than that of FGF2 and did not
reach to 2-fold of it at 10.sup.7 pfu, and inversely, expression of
SeV-derived human VEGF165 protein was almost undetectable at
10.sup.8 pfu (basal line, 176.+-.44, ischemia, 143.+-.64, 10.sup.6
pfu, 159.+-.67, 10.sup.7 pfu, 224.+-.216, and 10.sup.8 pfu, <5
pg/g muscle, n=6 each in thigh muscle; basal line, 173.+-.45,
ischemia, 95.+-.28, 10.sup.6 pfu, 186.+-.30, 10.sup.7 pfu,
172.+-.101, and 10.sup.8 pfu, <5 pg/g muscle, n=6 each in calf
muscle). Although serum level of endogenous murine VEGF was
significantly increased by moderate limb ischemia (37.7.+-.15.4
.mu.g/ml, n=6), vector-derived human VEGF165 could not be
significantly detected, suggesting that intramuscularly expressed
VEGF165 did not diffuse to the systemic circulation.
Example 4
Ischemia-Induced Endogenous VEGF Expression is Markedly Enhanced by
Angiogenic Gene Transfer
[0155] The present inventors hypothesized that incomparable
expression pattern between VEGF165 and FGF2 is due to endogenous
VEGF expression. Overexpression of endogenous VEGF165 may
exacerbate tissue ischemia via too much stronger permeability
action, and may downregulate the SeV-dependent transcription.
Further, a previous report indicated that the angiogenic activity
of FGF2 was partly due to enhanced endogenous VEGF expression in
vitro and in vivo (Asahara, T., et al., Circulation 92, 365-371
(1995)). Thus, the present inventors assessed modulation of
endogenous murine VEGF protein synthesis in muscles via exogenously
transduced angiogenic factor genes using murine-VEGF specific ELISA
system. As shown in FIG. 7, transfer of FGF2 gene, but not VEGF165
gene, significantly enhanced endogenous murine VEGF levels in
muscles in both limb conditions such as normal circulation (no
operation) and moderate ischemia. In case of severe limb ischemia,
gene transfer of both angiogenic factors, dramatically enhanced
endogenous murine VEGF expression, and in particular, VEGF165
resulted in around 7-hold higher than that of ischemia itself
(Mock).
[0156] To assess these further, the present inventors
histologically observed effects of gene transfer of angiogenic
factors in C57BL/6 severe ischemia model (FIG. 8). Ischemic
operation followed by mock transfection (Mock) demonstrated
diffusely picnotic muscle fibers associating intracellular edema
and inflammatory infiltrate 2 days later. These findings were
markedly enhanced by VEGF165 gene transfer, while apparently
inhibited by FGF2 gene transfer (FIG. 8).
Example 5
Exogenously Transduced VEGF165 Acts as a Limb Damaging Factor
Rather Than Limb Salvaging Factor in Acute Severe Limb Ischemia
[0157] Based on findings as described above, the present inventors
tested therapeutic effects of in vivo gene transfer of angiogenic
factors using both moderate and severe ischemic limb models. The
present inventors used viruses at 10.sup.7 pfu for observing in
vivo therapeutic effect, because VEGF165 at highest dose of
10.sup.8 pfu could not produce transgene products as shown above.
The present inventors categorized the degree of limb necrosis for 4
salvage scores (Limb Salvage Score: LSS): LSS=4, complete limb
salvage; LSS=3, limb necrosis below heel; LSS=2, limb necrosis
below knee; LSS=1, limb necrosis above knee; and LSS=0, total limb
amputation around the inguinal ligament. According to this
classification, the present inventors firstly tested the toxicity
of SeV-mediated expression of angiogenic factors using limb salvage
model of C57BL/6 mice under severe limb ischemia. The angiogenic
genes were transferred in the same manner as in Example 2.
[0158] Mice of all groups completely maintained their limbs when
vectors were injected thereto two days before ischemia operation.
Mice of all groups including FGF2-administered group, except
VEGF165-administered group, showed complete limb salvage (%
LLS=100%) when vector was injected at the period of operation. As
shown in FIGS. 9 and 10, however, some mice that received VEGF165
lost their limbs (5/10 mice lost their limbs, % LLS=52.5%,
p<0.0001 compared to other groups) (FIG. 10A). These results
suggest limb-damaging effect of VEGF165 gene transfer. Next, the
effect of gene therapy with angiogenic genes was analyzed using
severe ischemia model (auto-amputation model) of BALB/c nu/nu mice.
As a result, administration of SeV-VEGF165 could not improve hind
limb prognosis (8/10 lost limbs, % LLS=15.0%) similar to that of
luciferase-expressing SeV (5/6 lost limbs, % LLS=16.7%), while
administration of SeV-FGF2 significantly inhibited limb amputation
in nu/nu mice (2/10 lost limbs, % LLS=77.5%) (FIG. 10B). This
indicates apparent limb salvage effect of FGF2 gene transfer.
[0159] Subsequently, the present inventors determined the effect of
intramuscular gene transfer of the recovery of blood perfusion in
left limbs subjected to severe ischemia operations, by laser
Doppler perfusion image analysis (Couffinhal, T., et al., Am. J.
Pathol. 152, 1667-1679 (1998); Murohara, T., et al., J. Clin.
Invest. 105, 1527-1536 (2000)). Severe ischemia model (limb salvage
model) of C57BL/6 mice were subjected to gene transfer under the
same conditions as in the description of FIG. 10A (limb salvage
model). Measurements of the ischemic (left)/normal (right) limb
blood flow ratio using a laser Doppler perfusion image (LDPI)
analyzer (Moor Instruments, Devon, UK) were performed as described
previously (Couffinhal, T., et al., Am. J. Pathol. 152, 1667-1679
(1998); Murohara, T., et al., J. Clin. Invest. 105, 1527-1536
(2000)). Specifically, mice were placed on a heating plate kept at
37.degree. C. to minimize data variations due to body temperature
before initiating laser scanning. At predetermined time points
(before operation and on postoperative days 2, 4, 7, and 10), two
consecutive scans were performed over the same region of interest
(legs and feet) in each animal (FIG. 11). No essential difference
between the two scans was found. After laser scanning, the stored
images were subjected to computer-assisted quantification of blood
flow, and the average flow of the ischemic and non-ischemic feet
were calculated. To minimize data variables due to ambient light
and temperature, the LDPI index was expressed as the ratio of left
(ischemic) to right (non-ischemic) limb blood flow.
[0160] In both mice with SeV-luciferase (Mock) and SeV-FGF2,
apparently blood perfusion was detected around upper thigh at day
4, and particularly, significant perfusion into the calf muscle was
seen in the FGF-administered group at day 4, 7, and 10, compared to
limited perfusion in the thigh muscle in luciferase-administered
group at the same time points (FIG. 11). As representative results,
some of luciferase-injected mice showed moderate atrophic limbs,
while FGF2-injected mice largely showed undamaged limbs. In
contrast, mice received VEGF165 revealed very low blood perfusion
in thigh muscle, resulting limb amputation (FIG. 11). All mice
received SeV-VEGF165 had lost their limbs at least knee level. The
observation results of limb blood perfusion in each administration
group are described below.
1. SeV-Luciferase-Administered Individuals
[0161] Blood perfusion in the left lower limb was hardly observed
immediately after operation. Blood perfusion was gradually
recovered and by 4 days after operation it was recovered up to
approximately the middle of the femoral region. However, blood
perfusion into the lower thigh had not recovered by 10 days after
operation. As a result, the lower limb did not have necrosis but
showed atrophy to some extent as shown in the rightmost panel. The
same result was observed in one third of the individuals. Some
individuals showed better recovery than other individuals did as
described above.
2. SeV-VEGF165-Administered Individuals
[0162] As described above, most of the blood perfusion was
diminished right after operation. Further periodical observation
could hardly find the recovery of blood perfusion in the femoral
region. As a result, the lower limb from middle of the femoral
region was auto-amputated as shown in the rightmost panel. All 10
individuals showed completely the same result.
3. SeV-FGF2-Administered Individuals
[0163] As described above, most of the blood perfusion in the left
lower limb was diminished right after operation. The region where
blood perfusion was diminished was about the same as the
SeV-luciferase-administered individual. Strong blood perfusion
(indicated by red spots) was observed in the femoral region at
about day 4 and weak blood perfusion in the lower limb was already
observed at day 7. Slight but significant blood perfusion
(indicated in blue) throughout the left lower limb was observed at
day 10. As a result, the lower limb was maintained as it was normal
in appearance as shown in the rightmost panel.
[0164] The present inventors statistically compared Dopplar
image-based blood flow in thigh muscle of each groups. As shown in
FIG. 12, mice received SeV-FGF2 showed significantly higher blood
perfusion than those received SeV-luciferase with physiological
recovery of limb circulation. In contrast, blood flow in thigh
muscle of mice treated with SeV-VEGF165 remained low, and after 7
days post operation many of them lost their limbs at least knee
level.
Example 6
Therapy of Acute Ischemic Limb Using Replication Ability-Deficient
Sendai Virus Vector
[0165] 1. Construction of F Gene-Deficient Sendai Virus Genome cDNA
Containing Angiogenic Genes
[0166] First, amplification of the EGFP gene was performed by PCR
to construct the plasmid (pSeV18.sup.+/.DELTA.F-GFP) containing the
EGFP gene at the F gene-deficient site in the plasmid
pSeV18.sup.+AF (see WO00/70055 and WO00/70070), which was prepared
by deleting the F gene of the plasmid pSeV18.sup.+b(+) (Hasan, M.
K. et al., J. Gen. Virol. 78, 2813-2820, 1997) containing
full-length Sendai virus (SeV) genomic cDNA. PCR was performed
using NisI-tailed primer (5'-atgcatatggtgatgcggttttggcagtac/SEQ ID
NO: 9) for 5' end and NgoMIV-tailed primer
(5'-tgccggctattattacttgtacagctcgtc/SEQ ID NO: 10) for 3' end to
adjust the number of nucleotides of the EGFP gene fragment to be a
multiple of 6 (Hausmann, S. et al., RNA 2, 1033-1045, 1996). The
PCR product was digested with restriction enzymes NsiI and NgoMIV
and a fragment was recovered from a gel and subcloned into the F
gene-deficient region in pUC18/dFSS between NsiI and NgoMIV and
sequencing was performed for confirmation. The EGFP gene-containing
DraIII fragment isolated from this vector was replaced with the
DraIII fragment of pSeV18.sup.+containing the F gene, and ligated
to construct pSeV18.sup.+/.DELTA.F-GFP. However, even though the
downstream ORF of the F gene is removed from pSeV18.sup.+/.DELTA.F,
the EIS sequence (SeV specific sequence, E: end, I: intergenic, S:
start) of the F gene remains causing the possible expression of a 5
amino acid peptide derived from the primer which is used to connect
the fragment into the vector. Moreover, since GFP is coexpressed in
pSeV18.sup.+/.DELTA.F-GFP, a vector which did not coexpress GFP and
the 5-amino-acid peptide was constructed. The recombination was
performed to construct the vector as follows.
[0167] The fragment (6288 bp) containing the F gene-deficient
region was recovered by digesting pSeV18.sup.+/.DELTA.F-GFP with
SalI and NheI and cloned into Litmus38 (New England Biolabs,
Beverly, Mass.) to construct LitmusSalINheIfrg/.DELTA.F-GFP. The
deletion of the EGFP gene containing the EIS sequence located
upstream of the F gene-deficient region was performed by Inverse
PCR. Specifically, PCR was performed using a reverse primer
(5'-gtttaccaggtggagagttttgcaaccaagcac/SEQ ID NO: 11) which was
designed to contain a restriction enzyme SexAI recognition sequence
in upstream of GFP gene and a forward primer
(5'-ctttcacctggtacaagcacagatcatggatgg/SEQ ID NO: 12) which was
designed to contain the restriction enzyme SexAI recognition
sequence in downstream of GFP gene. The desired sized fragment
(10855 bp) was isolated and ligated to delete the EGFP gene
containing the EIS sequence located upstream of the F
gene-deficient region.
[0168] In this construct, the extra 15-bp sequence is inserted
between SexAI sites due to the design of the primers. Therefore,
the plasmid was prepared by transforming into E. coli SCS110 strain
(dcm.sup.-/dam.sup.- SCS110 strain was used because SexAI was
methylated and could not be digested). Two DNA fragments, 1628 by
and 9219 bp, were recovered after digesting with SexAI, and ligated
to remove the extra 15-bp fragment. Finally,
LitmusSalINheIfrg/.DELTA.F (.DELTA.5aa) was constructed, in which
the EGFP gene containing the EIS sequence located upstream of the F
gene and consisting of a multiple-of-6 number of nucleotides was
deleted. After the plasmid was digested with SalI and NheI, the
resulting fragment was recovered, replaced with a SalI/NheI
fragment which contained the F gene of pSeV 18.sup.+, and ligated
to construct plasmid pSeV18.sup.+/.DELTA.F (.DELTA.5aa). Insertion
of the angiogenic gene (for example, human FGF2 gene) into the
plasmid was performed as follows using the restriction enzyme NotI
recognition sequence located upstream of the NP gene.
2. Construction of F Gene-Deficient Sendai Virus Genome cDNA
Encoding hFGF2
[0169] Human FGF2 (hFGF2) cDNA was obtained by RT-PCR from vascular
smooth muscle cells isolated from human great saphenous artery with
the consent of the subject and thereby subcloning the PCR product
into pBluescriptSK+ (Stratagene, La Jolla, Calif.) at HindIII (5'
end) and EcoRI (3' end) sites. At the same time, the hFGF2 cDNA
sequence was confirmed to be identical to the reported sequence by
Abraham et al. (Abraham, J. A. et al., EMBO J. 5 (10), 2523-2528,
1986).
[0170] In order to insert the hFGF2 gene at the restriction enzyme
NotI site located upstream of the NP gene in pSeV18.sup.+/.DELTA.F
(.DELTA.5aa), a SeV specific sequence (EIS sequence) was added at
the 3' end of the hFGF2 gene and the fragment containing a NotI
recognition sequence at both ends was prepared. Specifically, PCR
was performed using the hFGF2 cDNA described above as a template
and using N-terminus primer
(5'-atccgcggccgccaaagttcacttatggcagccgggagcatcaccacgctgcccgccttgcccg
aggatggcggcagcggcgcc/SEQ ID NO: 13) containing a start codon and
C-terminus primer
(5'-atccgcggccgcgatgaactttcaccctaagtttttcttactacggtcagctcttagcagacat
tggaagaaaaagtatagc/SEQ ID NO: 14) containing a stop codon and the
EIS sequence. The PCR product was digested with NotI and then
subcloned into pBluescriptSK+ (Stratagene, La Jolla, Calif.) at a
NotI site to obtain pBS-hFGF2. The nucleotide sequence of pBS-hFGF2
was confirmed.
The fragment containing hFGF2 cDNA was obtained by digesting
pBS-hFGF2 with NotI and subcloned into pSeV18.sup.4/.DELTA.F
(.DELTA.5aa) at a NotI site located upstream of the NP gene to
construct F gene-deficient Sendai virus genomic cDNA containing the
hFGF2 gene, pSeV15.sup.+hFGF2/.DELTA.F (.DELTA.5aa)
(pSeV18.sup.+FGF2/.DELTA.F (.DELTA.5aa) is also indicated as
pSeV18.sup.+hFGF2/.DELTA.F). Moreover, NotI fragment containing
hFGF2 cDNA was inserted at NotI site in pSeV18.sup.+b(+) encoding
virus cDNA with replication ability to construct pSeV18.sup.+hFGF2.
Replicative SeV vector expressing human FGF2 was prepared from
pSeV18.sup.+hFGF2 by the known method (Hasan, M. K. et al., J. Gen.
Virol. 78: 2813-2820, 1997; Kato, A. et al., 1997, EMBO J. 16:
578-587; Yu, D. et al., 1997, Genes Cells 2: 457-466) to construct
SeV-hFGF2.
3. Reconstruction and Amplification of F Gene-Deficient SeV
[0171] Reconstruction of F gene-deficient SeV vector using
F-expressing helper cells (LLC-MK2/F; see WO00/70055 and
WO00/70070) which inducibly expressed the Sendai virus F gene
(SeV-F) by Cre DNA recombinase was performed (the cells before the
induction of SeV-F gene expression are referred to as LLC-MK2/F and
the cells after that as LLC-MK2/F/Ad). LLC-MK2 cells were seeded
onto 10-cm Petri dish in diameter at 5.times.10.sup.6 cells/dish,
incubated for 24 hours, and then transfected for 1 hour (moi=2)
with T7 RNA polymerase-expressing recombinant Vaccinia virus
(Fuerst, T. R. et al., Proc. Natl. Acad. Sci. USA 83, 8122-8126,
1986) which were treated with solaren and long wave ultra violet
light (365 mm) for 20 min. UV Stratalinker 2400 (Catalog Number
400676 (100 V), Stratagene, La Jolla, Calif., USA) equipped with
five 15-watt bulbs was used for UV exposure to Vaccinia virus.
Cells were then washed twice. Plasmids pSeV18.sup.+hFGF2/.DELTA.F,
pGEM/NP, pGEM/P, pGEM/L (Kato, A. et al., Genes Cells 1, 569-579,
1996), and pGEM/F-HN (WO00/70070) were resuspended in OptiMEM
(GIBCO) at concentration of 12 .mu.g, 4 .mu.g, 2 .mu.g, 4 .mu.g,
and 4 .mu.g per dish, respectively, and then mixed with SuperFect
transfection reagent (1 .mu.g DNA/5 .mu.l of SuperFect, QIAGEN).
The mixtures were left at room temperature for 15 min, mixed with 3
ml OptiMEM containing 3% FBS, and then added to the cells. The
cells were incubated for 3 to 5 hours, washed with serum-free MEM
twice, and further incubated in serum-free MEM containing 40
.mu.g/ml cytosine .beta.-D-arabinofuranoside (AraC, Sigma) and 7.5
.mu.g/ml trypsin (GIBCO) for 24 hours.
[0172] The culture medium was removed from the cell cultures and
the F-expressing helper cell LLC-MK2/F/Ad cells cloned as described
above were layered on top of the cells. Specifically, LLC-MK2/F/Ad
cells suspended in serum-free MEM (containing 40 .mu.g/ml AraC and
7.5 .mu.g/ml trypsin) were layered on top of the cells in which the
culture medium had been removed, and then the cells were incubated
for 48 more hours. The cells were recovered by scraper and pellets
were resuspended in OptiMEM (10.sup.7 cells/ml) and freeze-thawed 3
times. This lysates (200 .mu.l/well) were layered on top of
LLC-MK2/F/Ad cells (4.times.10.sup.6 cells/well of 12-well plate),
300 .mu.l/well of serum-free MEM (containing 40 .mu.g/ml AraC and
7.5 .mu.g/ml trypsin) was added thereto, and the cells were
incubated for 15 to 24 hours. The culture medium was removed and
cells were washed with serum-free MEM. A fresh serum-free MEM
(containing 40 .mu.g/ml AraC and 7.5 .mu.g/ml trypsin) was added to
the cells and then incubated for 5 to 9 days, and culture medium
was collected. The collected culture medium was used to infect
LLC-MK2/F/Ad cells and the cells were incubated as described above
in serum-free MEM (containing 40 .mu.g/ml AraC and 7.5 .mu.g/ml
trypsin) to amplify F gene-deficient SeV.
[0173] At the same time, the culture medium containing F
gene-deficient SeV particles was passed twice through a 0.22 .mu.m
filter to remove contaminating recombinant Vaccinia virus used for
T7 RNA polymerase expression during the reconstruction.
Specifically, the culture medium (sample after P2) amplified at
least twice with serum-free MEM containing AraC (containing 40
.mu.g/ml AraC and 7.5 .mu.g/ml trypsin) was passed twice through a
0.22 .mu.m filter. Furthermore, the culture medium amplified once
with serum-free. MEM containing AraC (containing 40 .mu.g/ml AraC
and 7.5 .mu.g/ml trypsin) was recovered to obtain F gene-deficient
SeV (SeV-hFGF2/.DELTA.F) which was amplified without contamination
of recombinant Vaccinia virus.
4. Gene Therapy for Ischemic Limb Using Replicative and
Non-Replicative Human FGF2 Expression SeV Vector
[0174] The present inventors assessed the treatment effect by
administration of replicative and non-replicative human FGF2
expression SeV vector using severe ischemia model of BALB/c nu/nu
mice (auto-amputation model) described in Example 1. Angiogenic
gene transfer was carried out in the same manner as in Example 2.
The vectors were injected during operation. Limb amputation after
operation was observed and the limb salvage ratio (ratio of the
number of individuals which kept limbs to the total number of
animals) at each period was calculated (FIG. 13).
[0175] Control mice that received luciferase expression SeV
(SeV-luciferase) showed a high limb amputation ratio, similar to
the non-administered mice. In contrast, limb amputation was
significantly suppressed in mice that received human FGF2
expression vector (SeV-hFGF2 and SeV-hFGF2/.DELTA.F). This
experiment revealed that human FGF2-expressing Paramyxovirus vector
is highly effective as an angiogenic gene transfer vector to treat
ischemic diseases, and that non-replicative Paramyxovirus vector is
effective for ischemia treatment.
Example 7
Therapeutic Effect of SeV-FGF2 Gene Transfer for Cardiac Infarction
Mice
[0176] FGF2 gene transfer with SeV-FGF2 following coronary artery
ligation was conducted as follows. Mice (C57BL/6J, male, 8 w to 10
w, and 22 g to 26 g (average 23.5 g)) were maintained by artificial
respiration after endotracheal intubation under anesthesia by i.p.
administration of Pentobarbital. Thoracotomy was performed through
the left 4.sup.th intercostal after skin incision at the left
precordium. The left coronary artery was ligated at two sites of
the left auricular level using 8-0 silk thread. The vectors
(SeV-FGF2 or SeV-LacZ) were directly injected at a total of 10
sites including the left ventricle infarction areas (2 sites),
borderline areas (5 sites), and non-infarction areas (3 sites)
using an injection needle having approximately 0.15 mm in outer
circumference and about 0.5 mm in length. 5 .mu.l of the vector,
which was diluted 50 fold with PBS, was injected at each site,
namely a total of 50 .mu.l (1.times.10.sup.6 pfu) of the vector was
injected. The chest was closed by suturing the intercostal,
followed by skin suture. Extubation was done after consciousness
and the respiratory condition were stabilized. The mice were
maintained in a warm environment after operation. The time duration
from intratracheal intubation to skin suture was 50 min. Fatality
was approximately 15% to 20% on the day of operation (including
fatality during operation). As shown in FIG. 14, a significant
therapeutic effect was observed in individuals that received Sendai
virus vectors expressing FGF2 compared with the individuals that
received with Sendai virus expressing lacZ.
Sequence CWU 1
1
19110DNAArtificial SequenceDescription of Artificial Sequence
Artificially Synthesized Sequence 1ctttcaccct 10215DNAArtificial
SequenceDescription of Artificial Sequence Artificially Synthesized
Sequence 2tttttcttac tacgg 15318DNAArtificial SequenceDescription
of Artificial Sequence Artificially Synthesized Sequence
3cggccgcaga tcttcacg 18418DNAArtificial SequenceDescription of
Artificial Sequence Artificially Synthesized Sequence 4atgcatgccg
gcagatga 18518DNAArtificial SequenceDescription of Artificial
Sequence Artificially Synthesized Primer Sequence 5gttgagtact
gcaagagc 18642DNAArtificial SequenceDescription of Artificial
Sequence Artificially Synthesized Primer Sequence 6tttgccggca
tgcatgtttc ccaaggggag agttttgcaa cc 42718DNAArtificial
SequenceDescription of Artificial Sequence Artificially Synthesized
Primer Sequence 7atgcatgccg gcagatga 18821DNAArtificial
SequenceDescription of Artificial Sequence Artificially Synthesized
Primer Sequence 8tgggtgaatg agagaatcag c 21930DNAArtificial
SequenceDescription of Artificial Sequence artificially synthesized
sequence 9atgcatatgg tgatgcggtt ttggcagtac 301030DNAArtificial
SequenceDescription of Artificial Sequence artificially synthesized
sequence 10tgccggctat tattacttgt acagctcgtc 301133DNAArtificial
SequenceDescription of Artificial Sequence artificially synthesized
sequence 11gtttaccagg tggagagttt tgcaaccaag cac 331233DNAArtificial
SequenceDescription of Artificial Sequence artificially synthesized
sequence 12ctttcacctg gtacaagcac agatcatgga tgg 331384DNAArtificial
SequenceDescription of Artificial Sequence artificially synthesized
sequence 13atccgcggcc gccaaagttc acttatggca gccgggagca tcaccacgct
gcccgccttg 60cccgaggatg gcggcagcgg cgcc 841482DNAArtificial
SequenceDescription of Artificial Sequence artificially synthesized
sequence 14atccgcggcc gcgatgaact ttcaccctaa gtttttctta ctacggtcag
ctcttagcag 60acattggaag aaaaagtata gc 821557DNAArtificial
SequenceDescription of Artificial Sequence Artificially Synthesized
Primer Sequence 15acgtgcggcc gccaaagttc atccaccatg gctgccagcg
gcatcacctc gcttccc 5716103DNAArtificial SequenceDescription of
Artificial Sequence Artificially Synthesized Primer Sequence
16acgtgcggcc gcgatgaact ttcaccctaa gtttttctta ctacgcggat cagctcttag
60cagacattgg aagaaacagt atggccttct gtccaggtcc cgt
1031721DNAArtificial SequenceDescription of Artificial Sequence
Artificially Synthesized Primer Sequence 17tgcacccacg acagaagggg a
211822DNAArtificial SequenceDescription of Artificial Sequence
Artificially Synthesized Primer Sequence 18tcaccgcctt ggcttgtcac at
221922DNAArtificial SequenceDescription of Artificial Sequence
Artificially Synthesized Primer Sequence 19ctaccaaaag tttcccaggc ag
22
* * * * *