U.S. patent application number 12/529958 was filed with the patent office on 2010-06-17 for pig model.
This patent application is currently assigned to AARHUS UNIVERSITET. Invention is credited to Lars Axel Bolund, Jannik Ejnar Jakobsen, Arne Lund Jorgensen, Peter Michael Kragh, Jacob Giehm Mikkelsen, Brian Moldt, Anders Lade Nielsen.
Application Number | 20100154069 12/529958 |
Document ID | / |
Family ID | 39590906 |
Filed Date | 2010-06-17 |
United States Patent
Application |
20100154069 |
Kind Code |
A1 |
Mikkelsen; Jacob Giehm ; et
al. |
June 17, 2010 |
PIG MODEL
Abstract
The present invention relates to a genetically modified pig
comprising at least one site for integration of at least one
transgene. The invention also pertains to a porcine embryo,
blastocyst, foetus, donor cell and/or cell nucleus, derived from
said genetically modified pig. In another aspect, the invention
relates to any genetically modified porcine blastocyst, wherein the
genetically modified genome comprises at least one site for
integration of at least one transgene.
Inventors: |
Mikkelsen; Jacob Giehm;
(Silkeborg, DK) ; Moldt; Brian; (Arhus C, DK)
; Nielsen; Anders Lade; (Abyhoj, DK) ; Bolund;
Lars Axel; (Skodstrup, DK) ; Kragh; Peter
Michael; (Risskov, DK) ; Jakobsen; Jannik Ejnar;
(Arhus C, DK) ; Jorgensen; Arne Lund; (Hojbjerg,
DK) |
Correspondence
Address: |
WEINGARTEN, SCHURGIN, GAGNEBIN & LEBOVICI LLP
TEN POST OFFICE SQUARE
BOSTON
MA
02109
US
|
Assignee: |
AARHUS UNIVERSITET
Aarhus C
DK
|
Family ID: |
39590906 |
Appl. No.: |
12/529958 |
Filed: |
March 7, 2008 |
PCT Filed: |
March 7, 2008 |
PCT NO: |
PCT/DK2008/050058 |
371 Date: |
January 7, 2010 |
Current U.S.
Class: |
800/9 ;
435/320.1; 435/325; 435/455; 800/17; 800/24; 800/25 |
Current CPC
Class: |
A01K 67/0275 20130101;
C12N 15/8778 20130101; A01K 2227/108 20130101; C12N 15/8509
20130101; A01K 2267/035 20130101; A01K 67/0273 20130101; C12N
2840/203 20130101; C12N 2800/90 20130101; A01K 2217/05 20130101;
C12N 2800/30 20130101 |
Class at
Publication: |
800/9 ; 800/17;
435/325; 435/320.1; 435/455; 800/25; 800/24 |
International
Class: |
A01K 67/027 20060101
A01K067/027; C12N 5/10 20060101 C12N005/10; C12N 15/85 20060101
C12N015/85; C12N 15/09 20060101 C12N015/09; A01K 67/02 20060101
A01K067/02 |
Foreign Application Data
Date |
Code |
Application Number |
Mar 7, 2007 |
DK |
PA 2007 00349 |
May 1, 2007 |
DK |
PA 2007 00659 |
Jul 13, 2007 |
DK |
PA 2007 01039 |
Claims
1. A genetically modified pig, porcine blastocyst, embryo, fetus,
donor cell and/or cell nucleus, wherein the genetically modified
genome thereof comprises at least one site for integration of at
least one transgene, and/or a genetically modified porcine
blastocyst, embryo, fetus, donor cell and/or cell nucleus derived
from said genetically modified pig.
2.-5. (canceled)
6. The genetically modified pig, porcine embryo, blastocyst, fetus,
donor cell and/or cell nucleus according to claim 1, wherein said
at least one site for integration of at least one transgene is a
heterologous recombination site.
7. The genetically modified pig, porcine embryo, blastocyst, fetus
and/or donor cell, according to claim 1, wherein the pig, porcine
embryo, blastocyst, fetus, donor cell and/or cell nucleus is a
mini-pig or is obtained from a mini-pig.
8.-13. (canceled)
14. The genetically modified pig, porcine embryo, blastocyst,
fetus, donor cell and/or cell nucleus according to claim 1, wherein
the genetically modified genome comprises at least one
recombination site for site-specific gene insertion.
15.-20. (canceled)
21. The genetically modified pig, porcine embryo, blastocyst, fetus
and/or donor cell, according to claim 1, wherein said pig, porcine
embryo, blastocyst, fetus and/or donor cell, comprises a transposon
tagged genome prepared by use of the system of claim 43.
22. The genetically modified pig, porcine embryo, blastocyst, fetus
and/or donor cell, according to claim 1, further comprising at
least one transgene.
23. (canceled)
24. The genetically modified pig, porcine embryo, blastocyst, fetus
and/or donor cell, according to claim 22, displaying a phenotype
associated with disease.
25. A genetically modified pig, porcine embryo, blastocyst, fetus
and/or donor cell, according to claim 1, wherein the genetically
modified genome comprises at least one gene of interest obtained by
recombination into the at least one site for integration.
26. (canceled)
27. A recombinant target vector comprising a DNA-transposon-based
construct comprising a bicistronic gene cassette comprising (i) at
least one recombination site and (ii) an IRES-driven selection
gene.
28.-42. (canceled)
43. A bi-phase system comprising a recombinant target vector of
claim 27 and a recombination substrate.
44. (canceled)
45. (canceled)
46. A mammalian cell comprising a DNA transposon tagged genome
containing at least one recombination target site for site-specific
gene integration of at least one gene of interest.
47. A mammalian cell comprising at least one gene of interest,
obtained by the use of the system of claim 43.
48.-55. (canceled)
56. A method for producing a mammalian cell comprising a DNA
transposon tagged genome comprising at least one recombination
target site for site-specific gene insertion, the method comprising
the steps of a) providing a mammalian cell, b) transfecting the
cell of a) with a plasmid expressing a transposase and a
recombinant vector comprising a DNA transposon-based construct
carrying a bicistronic gene cassette comprising (i) a recombination
site and ii) an IRES-driven selection gene, and c) selecting DNA
transposon tagged cells.
57.-63. (canceled)
64. A method for obtaining the genetically modified pig, porcine
embryo, blastocyst, fetus and/or donor cell according to claim 1
comprising the steps of i) providing a donor cell ii) genetically
modifying the donor cell of i) by inserting into the genome of said
donor cell a recombinant target vector comprising a
DNA-transposon-based construct comprising a bicistronic gene
cassette comprising (i) at least one recombination site and (ii) an
IRES-driven selection gene, iii) transferring the modified genome
of the donor cell obtained in ii) into a host cell iv) obtaining a
reconstructed embryo and forming an embryo v) culturing said
embryo; and vii) transferring said cultured embryo to a host mammal
such that the embryo develops into a genetically modified fetus,
wherein said genetically modified embryo is obtainable by nuclear
transfer comprising steps i) to v) and optionally vi), wherein said
genetically modified blastocyst is obtainable by nuclear transfer
comprising steps i) to vi) and optionally vii), and wherein said
genetically modified fetus is obtainable by nuclear transfer
comprising steps i) to vii).
65.-69. (canceled)
70. The genetically modified pig, porcine embryo, blastocyst, fetus
and/or donor cell according to claim 1 obtainable by nuclear
transfer comprising the steps of i) establishing at least one
oocyte having at least a part of a modified zona pellucida, ii)
separating the oocyte into at least two parts whereby an oocyte
having a nucleus and at least one cytoplast is obtained, iii)
establishing a donor cell or membrane surrounded cell nucleus with
desired genetic properties, iv) fusing said at least one cytoplast
with the donor cell or membrane surrounded cell nucleus, v)
obtaining a reconstructed embryo, vi) activating the reconstructed
embryo to form an embryo and culturing said embryo; and vii)
transferring said cultured embryo to a host mammal such that the
embryo develops into a genetically modified fetus, wherein said
genetically modified embryo is obtainable by nuclear transfer
comprising steps i) to v) and optionally vi), wherein said
genetically modified blastocyst is obtainable by nuclear transfer
comprising steps i) to vi) and optionally vii), and wherein said
genetically modified fetus is obtainable by nuclear transfer
comprising steps i) to vii).
71. A method for producing a genetically modified pig, porcine
embryo, blastocyst, fetus and/or donor cell, comprising at least
one recombination site comprising: i) establishing at least one
oocyte, ii) separating the oocyte into at least three parts whereby
at least one cytoplast is obtained, iii) establishing a donor cell
or membrane surrounded cell nucleus having desired genetic
properties, iv) fusing said at least one cytoplast with the donor
cell or membrane surrounded cell nucleus, v) obtaining a
reconstructed embryo, vi) activating the reconstructed embryo to
form an embryo and culturing said embryo, and vii) transferring
said cultured embryo to a host mammal such that the embryo develops
into a genetically modified fetus, wherein said genetically
modified embryo is obtainable by nuclear transfer comprising steps
i) to v) and optionally vi, wherein said genetically modified
blastocyst is obtainable by nuclear transfer comprising steps i) to
vi) and optionally vii), and wherein said genetically modified
fetus is obtainable by nuclear transfer comprising steps i) to
vii).
72. A method for producing a genetically modified pig, porcine
embryo, blastocyst, fetus and/or donor cell comprising: i)
establishing at least one oocyte, ii) separating the oocyte into at
least three parts whereby at least one cytoplast is obtained, iii)
establishing a donor cell or membrane surrounded cell nucleus
having desired genetic properties, wherein the donor cell is
established from a genetically modified pig carrying in its genome
at least one site for integration of at least one transgene, iv)
providing a transgene and integrating said transgene into the donor
cell of iii), v) fusing said at least one cytoplast with the donor
cell or membrane surrounded cell nucleus, vi) obtaining a
reconstructed embryo, vii) activating the reconstructed embryo to
form an embryo; viii) culturing said embryo; and ix) transferring
said cultured embryo to a host mammal such that the embryo develops
into a genetically modified fetus, wherein said genetically
modified embryo is obtainable by nuclear transfer steps i) to vi)
and optionally vii), wherein said genetically modified blastocyst
is obtainable by nuclear transfer comprising steps i) to vii) and
optionally viii), and wherein said genetically modified fetus
obtainable by nuclear transfer comprises steps i) to ix).
73. The genetically modified pig model, porcine embryo, blastocyst,
fetus and/or donor cell according to claim 1 obtainable by nuclear
transfer comprising the steps of i) establishing at least one
oocyte having at least a part of a modified zona pellucida, ii)
separating the oocyte into at least two parts whereby an oocyte
having a nucleus and at least one cytoplast is obtained, iii)
establishing a donor cell or membrane surrounded cell nucleus with
desired genetic properties, wherein the donor cell is established
from a genetically modified pig carrying in its genome at least one
site for integration of at least one transgene, iv) providing a
transgene and integrating said transgene into the donor cell of
iii), v) fusing said at least one cytoplast with the donor cell or
membrane surrounded cell nucleus, vi) obtaining a reconstructed
embryo, vii) activating the reconstructed embryo to form an embryo
and culturing said embryo; and viii) transferring said cultured
embryo to a host mammal such that the embryo develops into a
genetically modified fetus, wherein said genetically modified
embryo is obtainable by nuclear transfer comprising steps i) to vi)
and optionally vii), wherein said genetically modified blastocyst
is obtainable by nuclear transfer comprising steps i) to vi),
optionally vii), and optionally viii), wherein said genetically
modified fetus is obtainable by nuclear transfer comprising steps
i) to viii).
74.-86. (canceled)
87. A method of modifying the genome of a mammalian cell, the
method comprising inserting the vector of claim 27 into the genome
of the cell.
Description
FIELD OF INVENTION
[0001] The present invention relates to a genetically modified pig
comprising at least one site for integration of at least one
transgene. The invention also pertains to a recombinant target
vector and uses thereof. Methods are disclosed for the production
of genetically modified pigs.
BACKGROUND OF INVENTION
[0002] Transgenic, non-human animals can be used to understand the
action of a single gene or genes in the context of the whole animal
and the interrelated phenomena of gene activation, expression, and
interaction. The technology has also led to the production of
models for various diseases in humans and other animals which
contributes significantly to an increased understanding of genetic
mechanisms and of genes associated with specific diseases.
[0003] Traditionally, smaller animals such as mice have been used
as disease models for human diseases and have been found to be
suitable as models for certain diseases. However, their value as
animal models for many human diseases is quite limited due to
differences in mice compared to humans. Larger transgenic animals
are much more suitable than mice for the study of many of the
effects and treatments of most human diseases because of their
greater similarity to humans in many aspects. Particularly, pigs
are believed to be valuable as disease models for human
diseases.
[0004] Integration of foreign DNA plays a pivotal role in both
genetic manipulation of cell lines and technologies related to
therapeutic gene transfer. Current integrations strategies, based
upon for example retroviral, lentiviral or DNA transposon-based
vector systems allow efficient gene insertion, but all suffer from
the fact that gene insertion is not controllable and cannot be
directed to predetermined positions in the genomic DNA. The yeast
Flp recombinase, in contrast, facilitates sequence-specific
integration (1), but the Flp recombination target sequence (FRT)
does not exist in mammalian genomes. The site of integration is of
great importance for the gene expression profile of the inserted
gene. Hence, in some positions the gene will be stably expressed,
whereas other positions are unable to support long-term expression
due to strong influences from the flanking DNA leading to
transcriptional silencing. Such actions upon the transgene may lead
to reduced expression or complete shut-down of expression depending
on cell type or tissue. For several purposes it is therefore of
great importance to direct insertion towards `stably` expressing
loci. This may have particular importance in genetically
manipulated animal models in which continued gene expression in the
tissue of interest is essential for genetic studies. As another
important example, cell therapies in which genetically altered
effector cells are administered to patients (as in some cancer
immunotherapy protocols) rely on stable transgene expression from
loci that are not silenced over time.
[0005] The tyrosine recombinases Flp (2) and Cre, derived from
yeast and E. coli phages, respectively, and the serine recombinase
.phi.C31 from S. lividans phages are cherished for their
site-specific integrating properties. .phi.C31 has been found to
facilitate plasmid DNA recombination into pseudo recognition sites
in the human genome and therefore has been extensively explored as
a tool in gene therapy (3). In case of Flp and Cre, however, the
human genome does not contain recombination target sites and these
sites need to be introduced in the genome prior to successful gene
insertion (1). Although Cre-based recombination has been heavily
studied and appears to be a bit more effectful than Flp in human
cells, a now widely used Flp-based integration system has been
commercialized by Invitrogen (cat. no. K6010-01). This system is
based on a FRT sequence contained within a lacZ-Zeocin fusion gene.
This FRT-tagged gene is inserted into cells by nonhomologous
recombination, an uncontrolled recombination process which is
believed often to involve concatamer formation, leading to
insertion of more than one copies of the foreign DNA. Characterized
cell lines containing this FRT-lacZzeo insert are currently offered
by Invitrogen, allowing researchers to insert plasmid DNA
containing their gene of interest into the FRT-tagged locus on
offer in the particular cell line. This plasmid contains not only
the transgene but also a FRT-hygro cassette that does not contain a
start codon. By recombination between the two FRT sites (one in the
genome and one on the plasmid) the start codon of the lacZzeo
fusion is fused to the FRT-hygro cassette, allowing for expression
of the hygro gene and subsequent selection for hygromycin B
resistance. This technology facilitates insertion of the entire
plasmid including the bacterial backbone which is believed to have
a negative impact on gene expression in mammalian cells potentially
be inducing posttranscriptional silencing.
[0006] Transcriptional silencing of foreign genetic material is a
fundamental problem in gene transfer and genetic engineering of
cells and animals. Due to epigenetic modifications transgenic
animal models therefore often suffer from reduced gene expression,
or the lack of gene activity in tissues in which transcription is
required to develop a desired phenotype. The choice of promoter
influences the overall transgene expression profile in a transgenic
animal and to a certain degree the level of gene silencing.
However, positional effects and spreading of heterochromatin from
flanking genomic regions are major contributors to gene silencing,
and the site of integration of a transgene is crucial, therefore,
for the fate of a foreign gene. In rodents, well-characterized loci
supporting long-term gene expression have been identified. Based on
these findings transgenic animal models have been generated by
inserting genes by homologous recombination into such preferred
sites.
[0007] The establishment of cloned pig models of genetic disease,
is challenged by problems in identifying genomic loci that support
ubiquitous or, for some models, tissue-specific expression of an
inserted transgene. At present, the information that allows the
insertion of genes into well-suited and predefined loci of porcine
cells is not available. Moreover, by inserting disease genes at
random positions we risk to target genomic sites that are
eventually silenced during pig development and growth. Therefore, a
need exists for a genetically modified pig harbouring an insertion
site that allows for the integration of a transgene at a position
in the genome wherein the transgene is stably expressed.
SUMMARY OF INVENTION
[0008] The present invention concerns a genetically modified pig
which allows for integration of transgenes for example
disease-causing genes that will allow the study of said diseases.
The genetically modified pig harbours a site for integration of a
transgene in a stably expressing locus.
[0009] The present invention discloses a novel DNA transposon based
approach for tagging the chromosomal DNA of cells of interest by
introducing one or more recombination sites for site specific
recombinases. Genes of interest for example genetic determinants of
disease can subsequently be inserted into the genome of the cell by
the use of substrates for recombination carrying the gene of
interest.
[0010] Thus, one aspect of the present invention relates to a
genetically modified pig, wherein the genetically modified genome
comprises at least one site for integration of at least one
transgene.
[0011] A second aspect of the present invention pertains to a
genetically modified porcine blastocyst derived from the
genetically modified pig model, wherein the genetically modified
genome comprises at least one site for integration of at least one
transgene, and/or a genetically modified porcine blastocyst,
wherein the genetically modified genome comprises at least one site
for integration of at least one transgene.
[0012] Similarly, a third aspect relates to a genetically modified
porcine embryo derived from the genetically modified pig model,
wherein the genetically modified genome comprises at least one site
for integration of at least one transgene, and/or a genetically
modified porcine embryo, wherein the genetically modified genome
comprises at least one site for integration of at least one
transgene.
[0013] Furthermore, a fourth aspect relates to a genetically
modified porcine fetus derived from the genetically modified pig
model, wherein the genetically modified genome comprises at least
one site for integration of at least one transgene, and/or a
genetically modified porcine fetus, wherein the genetically
modified genome comprises at least one site for integration of at
least one transgene.
[0014] A fifth aspect of the present invention pertains to a
genetically modified porcine donor cell and/or cell nucleus derived
from the genetically modified pig model, wherein the genetically
modified genome comprises at least one site for integration of at
least one transgene, and/or a genetically modified porcine donor
cell and/or cell nucleus, wherein the genetically modified genome
comprises at least one site for integration of at least one
transgene.
[0015] It is appreciated that in a preferred embodiment of the
present invention the at least one site for integration of at least
one transgene is a heterologous recombination site.
[0016] Embodiments for the present invention comprises mini-pigs
for example selected from the group consisting of Goettingen,
Yucatan, Bama Xiang Zhu, Wuzhishan and Xi Shuang Banna, including
any combination thereof. In a preferred embodiment the pig, embryo,
blastocyst, fetus and/or cells thereof is a Goettingen minipig.
However, another embodiment relates to pigs that are not a
mini-pig, such as the species of Sus domesticus, for example where
the pig is selected from the group consisting of Landrace,
Yorkshire, Hampshire, Duroc, Chinese Meishan, Berkshire and Pi
train, including any combination thereof.
[0017] Embodiments of the present invention comprises the
genetically modified pig, porcine embryo, blastocyst, fetus and/or
cells thereof, wherein the genetically modified genome comprises at
least one recombination site for site-specific gene insertion, for
example at least one recombination site for Flp and/or Cre
recombinase, or at least one recombination site is a recombination
site for Flp. Thus the genetically modified pig comprises a
transposon tagged genome by a recombinant vector as disclosed
herein. The genetically modified pig may further comprise at least
one transgene, displaying a phenotype associated with disease.
[0018] A sixth aspect of the invention pertains to a genetically
modified pig, porcine embryo, blastocyst, fetus and/or donor cell,
wherein the genetically modified genome comprises at least one gene
of interest obtained by recombination into the at least one site
for integration. Such a genetically modified pig, porcine embryo,
blastocyst, fetus and/or donor cell is for example obtainable by
use of the recombinant vector as disclosed elsewhere herein and/or
by the system described elsewhere herein.
[0019] A seventh aspect of the invention pertains to a recombinant
target vector comprising a DNA transposon construct comprising a
bicistronic gene cassette comprising (i) at least one recombination
site and ii) an IRES-driven selection gene. Within the scope of the
present invention is for example the recombinant vector, wherein
said DNA transposon is the Sleeping Beauty (SB) DNA transposon. The
DNA transposon is for example selected from the group consisting of
the Sleeping Beauty (SB) transposon, Frog Prince (FP) transposon,
Piggybac transposon, Tol2 transposon, Himar 1 transposon and
passport transposon. In a particular embodiment the DNA transposon
is the Sleeping Beauty transposon. The recombinant target vector in
one embodiment comprises at least one FRT, attB/P and/or LoxP
recombination site. In a preferred embodiment the recombinant
target vector comprises at least one recombination site in the form
of a FRT and/or LoxP recombination site, more preferably a FRT
recombination site. The recombination site is in one embodiment
embedded in the coding sequence of a reporter gene and/or selection
gene, for example the eGFP gene, for example the FRT recombination
site is embedded in a SV40 promoter driven fusion variant of eGFP.
Another embodiment of the present invention relates to the genes
driven by the IRES, wherein said gene is a gene conferring
resistance to a drug, for example a puromycin resistance gene. The
recombinant vector further comprises in another embodiment at least
one recognition site for a Cre recombinase, for example wherein
said at least one recognition site for Cre recombinase is located
between the upper inverted repeat of the vector and the SV40
promoter, for example wherein said at least one recognition site
for Cre recombinase is located between the poly A sequence and the
lower inverted repeat of the vector.
[0020] A further aspect of the present invention relates to a
bi-phase system comprising a recombinant target vector as disclosed
herein and a recombination substrate. A recombination substrate
comprises a fusion of at least one recognition site for a
recombinase and a gene of interest. In one embodiment of this
aspect the recombination substrate is present in a plasmid, an in
vitro generated plasmid-derived minicircle and/or a lentiviral
circle.
[0021] Yet a further aspect of the present invention relates to a
mammalian cell comprising a DNA transposon tagged genome containing
a recombination target site for site-specific gene integration. In
one embodiment of the invention the recombination target site is a
heterologous target site not ordinarily found in the genome of the
mammalian cell. In one embodiment the cell comprises a DNA
transposon tagged genome by a recombinant vector as defined herein.
In another embodiment the genome of the cell further contains at
least one recognition site for Cre-recombinase. The mammalian cell
is a somatic cell, for example of porcine origin, for example a
fibroblast, such as a primary somatic cell, for example a porcine
primary fibroblast, or a porcine neonatal fibroblast.
[0022] An additional aspect of the present invention pertains to a
method for producing a mammalian cell comprising a DNA transposon
tagged genome comprising at least one recombination target site for
site-specific gene insertion comprising the steps of a) providing a
mammalian cell, b) transfecting the cell of a) with a plasmid
expressing a transposase and a recombinant vector comprising a DNA
transposon construct and a bicistronic gene cassette comprising (i)
a recombination site and ii) an IRES-driven selection gene, c)
selecting DNA transposon tagged cells. In one embodiment the method
further comprises a step of recombination using the recombination
substrate as disclosed herein. The cell of the method is a somatic
cell, for example of porcine origin, for example a fibroblast, such
as a primary somatic cell, for example a porcine primary
fibroblast.
[0023] A further aspect of the present invention relates to a
method for obtaining the genetically modified pig, porcine embryo,
blastocyst, fetus and/or donor cell, wherein the genetically
modified genome comprises at least one site for integration of at
least one transgene comprising the steps of i) providing a donor
cell, ii) genetically modifying the donor cell of i) by inserting
the recombinant vector as defined herein into the genome of said
donor cell, iii) transferring the modified genome of the donor cell
obtained in ii) into a host cell, iv) obtaining a reconstructed
embryo forming an embryo, v) culturing said embryo; and vii)
transferring said cultured embryo to a host mammal such that the
embryo develops into a genetically modified fetus, wherein said
genetically modified embryo obtainable by nuclear transfer
comprises steps i) to v) and/or vi), wherein said genetically
modified blastocyst obtainable by nuclear transfer comprises steps
i) to vi) and/or vii), wherein said genetically modified fetus
obtainable by nuclear transfer comprises steps i) to vii)
[0024] Yet a further aspect of the present invention concerns a
genetically modified pig model, porcine embryo, blastocyst, fetus
and/or donor cell, wherein the genetically modified genome
comprises at least one site for integration of at least one
transgene obtainable by nuclear transfer comprising the steps of i)
establishing at least one oocyte having at least a part of a
modified zona pellucida, ii) separating the oocyte into at least
two parts obtaining an oocyte having a nucleus and at least one
cytoplast, iii) establishing a donor cell or cell nucleus with
desired genetic properties, iv) fusing at least one cytoplast with
the donor cell or membrane surrounded cell nucleus, v) obtaining a
reconstructed embryo, vi) activating the reconstructed embryo to
form an embryo; culturing said embryo; and vii) transferring said
cultured embryo to a host mammal such that the embryo develops into
a genetically modified fetus, wherein said genetically modified
embryo obtainable by nuclear transfer comprises steps i) to v)
and/or vi), wherein said genetically modified blastocyst obtainable
by nuclear transfer comprises steps i) to vi) and/or vii), wherein
said genetically modified fetus obtainable by nuclear transfer
comprises steps i) to vii)
[0025] An additional aspect of the present invention pertains to a
method for producing a genetically modified pig, porcine embryo,
blastocyst, fetus and/or donor cell, comprising at least one
recombination site comprising: i) establishing at least one oocyte,
ii) separating the oocyte into at least three parts obtaining at
least one cytoplast, iii) establishing a donor cell or cell nucleus
having desired genetic properties, such as at least one
heterologous recombination site iv) fusing at least one cytoplast
with the donor cell or membrane surrounded cell nucleus, v)
obtaining a reconstructed embryo, vi) activating the reconstructed
embryo to form an embryo; culturing said embryo; and vii)
transferring said cultured embryo to a host mammal such that the
embryo develops into a genetically modified fetus, wherein said
genetically modified embryo obtainable by nuclear transfer
comprises steps i) to v) and/or vi), wherein said genetically
modified blastocyst obtainable by nuclear transfer comprises steps
i) to vi) and/or vii), wherein said genetically modified fetus
obtainable by nuclear transfer comprises steps i) to vii)
[0026] Yet a further aspect relates to a method for producing a
genetically modified pig, porcine embryo, blastocyst, fetus and/or
donor cell comprising: [0027] i) establishing at least one oocyte
[0028] ii) separating the oocyte into at least three parts
obtaining at least one cytoplast, [0029] iii) establishing a donor
cell or cell nucleus having desired genetic properties, wherein the
donor cell is established from a genetically modified pig carrying
in its genome at least one site for integration of at least one
transgene [0030] iv) providing a transgene and integrating said
transgene into the donor cell of iii) [0031] v) fusing at least one
cytoplast with the donor cell or membrane surrounded cell nucleus,
[0032] vi) obtaining a reconstructed embryo, [0033] vii) activating
the reconstructed embryo to form an embryo; [0034] viii) culturing
said embryo; and [0035] ix) transferring said cultured embryo to a
host mammal such that the embryo develops into a genetically
modified fetus, wherein said genetically modified embryo obtainable
by nuclear transfer comprises steps i) to v) and/or vi), [0036]
wherein said genetically modified blastocyst obtainable by nuclear
transfer comprises steps i) to vi) and/or vii), wherein said
genetically modified fetus obtainable by nuclear transfer comprises
steps i) to vii)
[0037] A further aspect relates to the genetically modified pig
model, porcine embryo, blastocyst, fetus and/or donor cell of the
present invention obtainable by nuclear transfer comprising the
steps of [0038] i) establishing at least one oocyte having at least
a part of a modified zona pellucida, [0039] ii) separating the
oocyte into at least two parts obtaining an oocyte having a nucleus
and at least one cytoplast, [0040] iii) establishing a donor cell
or cell nucleus with desired genetic properties, wherein the donor
cell is established from a genetically modified pig carrying in its
genome at least one site for integration of at least one transgene
[0041] iv) providing a transgene and integrating said transgene
into the donor cell of iii) [0042] v) fusing at least one cytoplast
with the donor cell or membrane surrounded cell nucleus, [0043] vi)
obtaining a reconstructed embryo, [0044] vii) activating the
reconstructed embryo to form an embryo; culturing said embryo; and
[0045] viii) transferring said cultured embryo to a host mammal
such that the embryo develops into a genetically modified fetus,
wherein said genetically modified embryo obtainable by nuclear
transfer comprises steps i) to v) and/or vi), wherein said
genetically modified blastocyst obtainable by nuclear transfer
comprises steps i) to vi) and/or vii), wherein said genetically
modified fetus obtainable by nuclear transfer comprises steps i) to
vii).
[0046] Embodiments of the aspects comprise one or more of the
features as defined herein, wherein the method for activation of
the reconstructed embryo is selected from the group of methods
consisting of electric pulse, chemically induced shock, increasing
intracellular levels of divalent cations and reducing
phosphorylation. Further embodiments of the second and third
aspects comprise one or more of the features as defined above,
wherein steps d) and f) are performed sequentially or
simultaneously, and embodiments comprising one or more of the
features, wherein the embryo is cultured in vitro. Such embryo may
be cultured in sequential culture. The embryo, for example at the
blastocyst stage, is cryopreserved prior to transfer to a host
mammal. For the methods of the present invention embodiments cover
pigs, mini-pigs for example selected from the group consisting of
Goettingen, Yucatan, Bama Xiang Zhu, Wuzhishan and Xi Shuang Banna,
including any combination thereof. However, another embodiment
relates to pigs that are not a mini-pig, such as the species of Sus
domesticus, for example where the pig is selected from the group
consisting of Landrace, Yorkshire, Hampshire, Duroc, Chinese
Meishan, Berkshire and Pi train, including any combination
thereof.
[0047] In a final aspect of the present invention the recombinant
vector described herein is used for the production of genetically
modified mammalian cells, comprising at least one site for
integration of a transgene.
DESCRIPTION OF DRAWINGS
[0048] FIG. 1 shows the bi-phased technology of the present
invention in which an integrating SB vector, carrying a reporter
gene and a selective marker gene, serves as a reporter for
continuous gene expression and hence as a target for gene
insertion. In a second modification step this vector may serve as a
target for insertion of one or more gene expression cassettes in a
well-characterized locus.
[0049] FIG. 2 shows a Sleeping Beauty docking vector system for
controlled porcine transgenesis by Flp-directed gene insertion. A)
Schematic description of the SB transposon plasmid used in the
first step of transgenesis. The pSBT/SV40-FGIP plasmid includes a
gene cassette flanked by LIR and RIR elements which enable
transposition of the gene insert in the presence of SB transposase.
The gene cassette includes the SV40 promoter driving the expression
of a transcript encoding eGFP and the puromycin resistance gene.
Co-expression of the proteins is achieved by the presence of an
internal ribosomal entry site (IRES) after the eGFP coding region.
In the 5'-region of the eGFP gene (immediately flanking the start
codon) is inserted an FRT site that allows Flp-mediated
recombination. After transposase-mediated integration into the host
genome, the gene cassette represents an acceptor locus for further
transgenesis. The FRT site is located just 3' of the start codon of
eGFP and thus enable a controlled recombination event that
separates this start codon from the rest of the eGFP gene and,
accordingly, abolishes eGFP translation. B) Schematic
representation of the Flp donor plasmid, used in the second step of
transgenesis, and the result of Flp-directed transgenesis. The Flp
donor plasmid contains the CMV promoter which controls the
expression of a transcript encoding the DsRed protein which is used
as a marker. In addition, the donor plasmid includes a
promoter-free gene cassette including the hygromycin B resistance
gene and a polyadenylation signal. The 5''-region of the hygromycin
resistance gene is modified to include a FRT recombination site and
to lack a translational start codon. The lower part of the figure
illustrates Flp-mediated recombination for insertion of the donor
sequence into the acceptor locus.
[0050] FIG. 3 shows the transposition efficiency of pSBT/RSV-GFIP
by co-transfecting with pCMV-SB and pCMV-mSB, respectively, in
HEK-293 cells. As expected the GFIP transposon was efficiently
transposed into the genomic DNA thereby conferring resistance to
puromycin. FIG. 3, insert, shows an example of a
puromycin-resistant colony generated with two-plasmid
transfections, stable eGFP expression was verified by fluorescence
microscopy.
[0051] FIG. 4 shows Sleeping Beauty transposition in porcine
fibroblasts. A) Schematic description of the pSBT/PGK-puro plasmid
used to examine the potential of SB transposons for transgenesis in
neonatal pig fibroblasts (NPFs). A puromycin resistance gene driven
by the PGK promoter is flanked by LIR and RIR sequences. B) NPFs
support SB transgenesis. 2.6.times.10.sup.4 NPFs were
co-transfected with pSBT/PGK-puro and with plasmid DNA encoding one
of the following three variants of SB transposase: mSB which
represents an inactive transposase variant, SB10 which is the
original SB transposase, and HSB3 which is a hyperactive
transposase variant. The experiments were carried out in
triplicates and the number of cell colonies was counted after 9
days of puromycin selection.
[0052] FIG. 5 shows that transgenesis by SBT/SV40-FGIP
transposition is dependent of a functional transposase. The
pSBT/SV40-FGIP plasmid was transfected together the plasmid DNA
encoding mSB, SB10, or HSB3. The number of puromycin-resistant
colonies was counted after 9 days of puromycin selection.
Representative colonies were analyzed by phase contrast and
epi-fluorescence microscopy to determine homogeneity in eGFP
expression. The cell lines analyzed were in A) HEK-293, B) NIH-3T3,
and C) NPFs.
[0053] FIG. 6 shows substitution of transgenes by Flp-mediated
recombination. A) and B). Flp-based gene insertion into integrated
SB docking vector. NIH3T3 and HEK293 cell lines derived from
pSBT/SV40-FGIP-mediated transgenesis (seeded at 8.times.10.sup.5
cells/dish) were re-transfected with the FRT donor plasmid in the
presence (+) or absence (-) of plasmid DNA encoding the Flp
recombinase. The number of hygromycin B-resistant colonies was
counted. The cell clones used were in A) derived from NIH-3T3 cells
and in B) from HEK293 cells. C) Flp-mediated recombination is
possible in NPFs. To identify Flp-mediated recombination event in
NPFs, cellular DNA was purified from cells co-transfected with the
FRT donor plasmid and the Flp expression vector and from control
cells with the donor plasmid but lacking Flp expression. A PCR
amplification was performed with a forward primer located
downstream of LIR in pSBT/SV40-FGIP transposon and a reverse primer
at the beginning of the hygromycin B gene located in the donor
plasmid. Molecular weight markers are shown to the left. D)
Fluorescence analysis of Flp-mediated gene shifting. Cells from
HEK-293 clone 4 containing the SBT/SV40-FGIP transposon were
re-transfected with the FRT donor plasmid and the Flp expression
vector. After the indicated number of days the presence of green
fluorescence and red fluorescence was determined by epifluorescence
analysis of cell clones obtained under hygromycin B selection. The
upper two panels (labelled `-Flp`) show the HEK-293 cell clone used
in the analysis. In the bottom part, puromycin selection was
re-introduced resulting in cellular death. E) Fluorescence analysis
of Flp-mediated gene shifting in NPFs. Experimental conditions were
as described in D).
[0054] FIG. 7 shows that transgenic NPFs give rise to viable
porcine blastocysts. A) Fluorescence analysis of the NPF colony
used for nuclear transfer. The cell clone was derived from NPFs
co-transfected with the pSBT/SV40-FGIP vector and the
pCMV-HSB3.Topo plasmid coding for the hyperactive SB transposase.
After selecting with puromycin for 9 days the cell clone was
analyzed by microscopy and the cells subsequently propagated. B)
SBT/SV40-FGIP-transgenic NPF cells give rise to viable blastocysts.
A representative blastocyst derived by nuclear transfer from the
cells shown in A) was analyzed by fluorescence microscopy. The
green fluorescent colour is evident in the inner cell mass (ICM)
and in the trophoblast (TB) layer in particular.
[0055] FIG. 8 To facilitate Flp-based gene insertion into
integrated SB vectors HEK-GFIP1, HEK-GFIP2, and HEK-GFIP3 were
co-transfected with pcDNA/FRT (containing the FRT-hygro fusion
gene) and pCMV-Flpx9. Upon subsequent hygromycin B selection 312,
53, and 1800 drug-resistant colonies appeared in the three cell
lines shown in FIG. 3.
[0056] FIG. 9 shows a schematic representation of circular DNA
intermediates that are generated during lentivirus infection and
which are often considered dead-end reverse-transcribed products of
infection. 2-LTR DNA circles are generated by DNA repair and
ligation of the full-length linear viral DNA (FIG. 4, left),
whereas 1-LTR DNA circles are generated by homologous recombination
between the two LTRs of the episomal and linear viral DNA (FIG. 4,
right). We hypothesized that these circles, generated during
lentiviral vector transduction, may support Flp-based
recombination, allowing site-specific integration of DNA circles
devoid of bacterial sequences (FIG. 4, bottom)
[0057] FIG. 10 To maximize circle formation and accumulation we
generated integration-defective lentiviral vectors (ID-LVs) which
contained a mutated inactive integrase protein. We generated a
lentiviral vector, pLV/FRT-hygro.PGK-puro, that contains the
FRT-hygro recombination sequence and found in transduction titer
assays that this vector was only slightly less efficiently
transferred in comparison to the original vector
[0058] FIG. 11 shows HEK-GFIP3 cells were transfected with
pCMV-Flpx9 and on the following day transduced transfected cells
with ID-LV/FRT-hygro.PGK-puro at a MOI.about.100. Based on
transfection and transduction of about 10.sup.7 cells, we obtained
in triplicate assays on average approximately 20 hygromycin
B-resistant colonies (FIG. 6A). Background activity was not
registered in cells transfected with pUC19 prior to
ID-LV/FRT-hygro.PGK-puro-transduction. PCR amplifications using as
template genomic DNA from 10 of the hygromycin B-resistant colonies
verified that DNA circles had been inserted site-specifically into
SB-tagged loci (FIG. 6B). PCR across the FRT integration site
resulted in band sizes indicative of specific gene insertion,
whereas primers that amplified sequences containing the LTR
region(s) of the integrated circles resulted in amplicons with
either one or two LTRs (FIG. 6B)
[0059] FIG. 12 shows triplicate assays using the indicated
substrates.
[0060] FIG. 13 ID-LV co-transduction results in site-specific
lentiviral DNA circle insertion.
[0061] FIG. 14 shows a schematic representation of
pSBT/RSV-GFIP.
[0062] FIG. 15 shows transposition of SB vectors in porcine
fibroblasts. A standard transposon encoding a puromycin resistance
gene (SBT/PGK-puro) was employed and varying levels of
transposition were detected, resulting in about 75 drug-resistant
colonies in cultures of fibroblasts co-transfected with
pSBT/PGK-puro and pCMV-SB, less than 3 colonies appeared after
transfection with pSBT/PGK-puro and pCMV-mSB, the latter which
encodes an inactive version of the transposase. Interestingly, a
mean of almost 140 colonies was obtained using the hyperactive
transposase variant HSB3, indicating that HSB3 also in porcine
cells mediates higher levels of transposition compared to the
original SB transposase.
[0063] FIG. 16 shows efficient insertion of a FRT-tagged SB vector
in pig fibroblasts SB-tagged cell clones containing a Flp
recombination target site for site-specific gene insertion were
co-transfected the pSBT/IoxP.SV40-lopP257 plasmid with pCMV-mSB,
pCMV-SB, and pCMV-HSB3, respectively. HSB3 again showed the highest
activity, resulting in about 30 drug-resistant colonies after
transfection of 3 H 10.sup.4 fibroblasts.
[0064] FIG. 17 shows clone analysis by fluorescence microscopy of
isolated and expanded puromycin-resistant colonies demonstrates
efficient FRTeGFP expression
[0065] FIG. 18 shows a gene shift with the help of the Sleeping
Beauty (SB) DNA transposon technology and Flpe recombination is
presented in this example. We inserted into HEK 293 cells a SB
transposon containing an eGFP gene and an frt site. The frt site
enables gene shifting with a donor plasmid containing the RFP gene
as well as an frt site.
[0066] FIG. 20 shows a gene shift in HEK293 cells derived from
clone 4. The eGFP gene linked to a puromycin resistant gene is
shiftet with a RFP gene linked to a hygromycin gene.
[0067] FIG. 21 top shows the transposase efficiency in fibroblast
cells of a mini pig, using a PGK (phosphoglycerate kinase)
promoter--puromycin transposon; lower diagram shows the transposase
efficiency in fibroblast cells of a mini pig, using a modified GFIP
transposon.
[0068] FIG. 22 shows viable cells and blastocysts comprising a
transposon tagged genome carrying an eGFP gene.
[0069] FIG. 23. (a) Oocytes trisection; (b) couplets of
fibroblast-oocyte fragment for the first fusion; (c) embryos
reconstructed with triplets (note elongation under the AC
currency); (d) triplets fusion. Scale bar=50 .mu.m.
[0070] FIG. 24 (a) In vitro matured oocytes after partial zona
digestion. (b) Delipated oocytes after centrifugation. (c)
Bisection of delipated oocytes. (d) Couplets of fibroblast-oocyte
fragment for the first fusion. (e) Four-cell stage reconstructed
embryos developed from delipated oocytes. (f) Four-cell stage
reconstructed embryos developed from intact oocytes. (g)
Re-expanded blastocysts from delipated embryos after warming. (h)
Hoechst staining and UV illumination of re-expanded blastocysts
from delipated embryos after warming. Bar represents 100 .mu.m.
[0071] FIG. 25. Bisection at chemically assisted enucleation. Note
the extrusion cone or polar body connected to the smaller part
(putative karyoplast). Stereomicroscopic picture. Bar represents 50
.mu.m.
[0072] FIG. 26. Hoechst staining and UV illumination of the absence
and presence of chromatin. UV light, inverted fluorescent
microscopic picture. Bar represents 50 .mu.m. (a) The absence of
chromatin in putative cytoplasts (b) The presence of chromatin in
putative karyoplasts.
[0073] FIG. 27. Stereomicroscopic picture of Day 7 blastocysts
produced with chemically assisted handmade enucleation (CAHE). Bar
represents 50 .mu.m.
[0074] FIG. 28. Hoechst staining and UV illumination of blastocyst
developed after chemically assisted handmade enucleation (CAHE).
Bar represents 50 .mu.m.
DETAILED DESCRIPTION OF THE INVENTION
[0075] In the description that follows, a number of terms used in
molecular biology are utilized. In order to provide a clear and
consistent understanding of the specification and claims, including
the scope to be given such terms, the following definitions are
provided.
[0076] The terms `transgenic` pig and `genetically modified` pig
are used in identical meaning herein.
[0077] The terms `transgene` and `gene of interest` are used herein
in identical meaning herein.
[0078] The term `recombination substrate` is herein also referred
to as `donor plasmid`.
[0079] The term `DNA transposon tagged genome` refers to a genome
in which a DNA transposon based DNA vector construct has been
introduced. The introduced DNA transposon-based vector construct is
also referred to as the integrated docking vector, for example the
integrated SB docking vector (puro+, eGFP+).
[0080] IRES is short for internal ribosome entry site, which is a
nucleotide sequence that allows for translation initiation in the
middle of a messenger RNA (mRNA) sequence as part of the greater
process of protein synthesis. Usually, in eukaryotes, translation
can only be initiated at the 5' end of the mRNA molecule, since 5'
cap recognition is required for the assembly of the initiation
complex. IRES mimics the 5' cap structure, and is recognized by the
40S pre-initiation complex. When an IRES segment is located between
two reporter open reading frames in a eukaryotic mRNA molecule (a
bicistronic mRNA), it can drive translation of the downstream
protein coding region independently of the 5'-cap structure bound
to the 5' end of the mRNA molecule. In such a setup both proteins
are produced in the cell. The first reporter protein located in the
first cistron is synthesized by the cap-dependent initiation
approach while translation initiation of the second protein is
directed by the IRES segment located in the intercistronic spacer
region between the two reporter protein coding regions.
[0081] Transposons are mobile genetic elements. Transposons are
structurally variable, being described as simple or compound, but
typically encode a transposition catalyzing enzyme, termed a
transposase, flanked by DNA sequences organized in inverted
orientations. For a more thorough discussion of the characteristics
of transposons, one may consult Mobile Genetic Elements, D. J.
Sherratt, Ed., Oxford University Press (1995) and Mobile DNA, D. E.
Berg and M. M. Howe, Eds., American Society for Microbiology
(1989), Washington, D.C. both of which are specifically
incorporated herein by reference.
Recombination Sites
[0082] A key feature of the recombination reactions mediated by the
above-noted recombination proteins are recognition sequences, often
termed "recombination sites," on the DNA molecules participating in
the recombination reactions. These recombination sites are discrete
sections or segments of DNA on the participating nucleic acid
molecules that are recognized and bound by the recombination
proteins during recombination. For example, the recombination site
for Cre recombinase is IoxP which is a 34 base pair sequence
comprised of two 13 base pair inverted repeats (serving as the
recombinase binding sites) flanking an 8 base pair core sequence.
See FIG. 1 of Sauer, B. Curr. Opin. Biotech. 5:521-527 (1994).
Other examples of recognition sequences include the attB and attP
sequences which are recognized by the recombination protein 1 Int.
attB is an approximately 25 base pair sequence containing two 9
base pair core-type Int binding sites and a 7 base pair overlap
region, while attP is an approximately 240 base pair sequence
containing core-type Int binding sites and arm-type Int binding
sites as well as sites for auxiliary proteins integration host
factor (IHF), FIS and excisionase (Xis). See Landy, Curr. Opin.
Biotech. 3:699-707 (1993).
[0083] The term "genetic determinant" is used herein to refer to a
single-stranded or double-stranded "polynucleotide molecule" or
"nucleic acid" comprising a structural gene of interest. The
"genetic determinant" encodes a protein not ordinarily made in
appreciable amounts in the target cells. Thus, "genetic
determinants" include nucleic acids which are not ordinarily found
in the genome of the target cell. "Genetic determinants" also
include nucleic acids which are ordinarily found within the genome
of the target cell, but is in a form which allows for the
expression of proteins which are not ordinarily expressed in the
target cells in appreciable amounts. Alternatively, "genetic
determinants" may encode a variant or mutant form of a
naturally-occurring protein.
[0084] The terms "polynucleotide" and "nucleic acid" are used
interchangeably, and, when used in singular or plural, generally
refers to any polyribonucleotide or polydeoxyribonucleotide, which
may be unmodified RNA or DNA or modified RNA or DNA. Thus, for
instance, polynucleotides as defined herein include, without
limitation, single- and double-stranded DNA, DNA including single-
and double-stranded regions, single- and double-stranded RNA, and
RNA including single- and double-stranded regions, hybrid molecules
comprising DNA and RNA that may be single-stranded or, more
typically, double-stranded or include single- and double-stranded
regions. In addition, the term "polynucleotide" as used herein
refers to triple-stranded regions comprising RNA or DNA or both RNA
and DNA. The strands in such regions may be from the same molecule
or from different molecules. The regions may include all of one or
more of the molecules, but more typically involve only a region of
some of the molecules. One of the molecules of a triple-helical
region often is an oligonucleotide. The term "polynucleotide"
specifically includes cDNAs. The term includes DNAs (including
cDNAs) and RNAs that contain one or more modified bases. Thus, DNAs
or RNAs with backbones modified for stability or for other reasons
are "polynucleotides" as that term is intended herein. Moreover,
DNAs or RNAs comprising unusual bases, such as inosine, or modified
bases, such as tritiated bases, are included within the term
"polynucleotides" as defined herein. In general, the term
"polynucleotide" embraces all chemically, enzymatically and/or
metabolically modified forms of unmodified polynucleotides, as well
as the chemical forms of DNA and RNA characteristic of viruses and
cells, including simple and complex cells.
[0085] As used herein, a nucleotide is a base-sugar-phosphate
combination. Nucleotides are monomeric units of a nucleic acid
molecule (DNA and RNA). The term nucleotide includes ribonucleoside
triphosphates ATP, UTP, CTG, GTP and deoxyribonucleoside
triphosphates such as DATP, dCTP, dITP, dUTP, dGTP, dTTP, or
derivatives thereof. Such derivatives include, for example,
[.alpha.S]dATP, 7-deaza-dGTP and 7-deaza-dATP. The term nucleotide
as used herein also refers to dideoxyribonucleoside triphosphates
(ddNTPs) and their derivatives. Illustrated examples of
dideoxyribonucleoside triphosphates include, but are not limited
to, ddATP, ddCTP, ddGTP, ddITP, and ddTTP.
[0086] As used herein, a promoter is an example of a
transcriptional regulatory sequence, and is specifically a DNA
sequence generally described as the 5'-region of a gene located
proximal to the start codon. The transcription of an adjacent DNA
segment is initiated at the promoter region.
[0087] The term `recombination site` is a recognition sequence on a
nucleic acid molecule participating in an integration/recombination
reaction by recombination proteins. Recombination sites are
discrete sections or segments of nucleic acid on the participating
nucleic acid molecules that are recognized and bound by a
site-specific recombination protein during the initial stages of
integration or recombination. For example, the recombination site
for Cre recombinase is IoxP which is a 34 base pair sequence
comprised of two 13 base pair inverted repeats (serving as the
recombinase binding sites) flanking an 8 base paircore sequence.
See FIG. 1 of Sauer, B. Curr. Opin. Biotech. 5:521-527 (1994).
Other examples of recognition sequences include the attB, attP,
attL, and attR sequences described herein, and mutants, fragments,
variants and derivatives thereof, which are recognized by the
recombination protein 1 Int and by the auxiliary proteins
integration host factor (IHF), FIS and excisionase (Xis). See
Landy, Curr. Opin. Biotech. 3:699-707 (1993).
[0088] As used herein, a vector is a nucleic acid molecule
(preferably DNA) that provides a useful biological or biochemical
property to an Insert. Examples include plasmids, phages,
autonomously replicating sequences (ARS), centromeres, and other
sequences which are able to replicate or be replicated in vitro or
in a host cell, or to convey a desired nucleic acid segment to a
desired location within a host cell. A vector can have one or more
restriction endonuclease recognition sites at which the sequences
can be cut in a determinable fashion without loss of an essential
biological function of the vector, and into which a nucleic acid
fragment can be spliced in order to bring about its replication and
cloning. Vectors can further provide primer sites, e.g., for PCR,
transcriptional and/or translational initiation and/or regulation
sites, recombinational signals, replicons, selectable markers (ie.
selection genes).
Genetic Modification
[0089] The present invention pertains to a genetically modified
pig, porcine embryo, blastocyst, fetus and/or donor cell wherein
the genetically modified genome comprises at least one site for
integration of at least one transgene.
[0090] It will be appreciated that the invention does not comprise
processes for modifying the genetic identity of pigs which are
likely to cause them suffering without any substantial medical
benefit to man or animal, or animals resulting from such
processes.
[0091] The present invention also relates to modified pig embryos,
blastocysts, donor cells and/or fetuses obtainable by the methods
described herein.
[0092] The methods for producing the pig model described herein do
not encompass a surgical step performed on the pig.
[0093] The present invention relates to a genetically modified pig,
wherein the genetically modified genome comprises at least one site
for integration of at least one transgene. However, the present
invention also relates to porcine blastocysts, embryos, fetuses
and/or cells (for example cells to be used as donor cells in
nuclear transfer) derived from the genetically modified pig the
genome of which comprises at least one site for integration of at
least one transgene.
[0094] Within the scope of the present invention are also
genetically modified porcine blastocysts, embryos, fetuses and/or
cells, wherein the genetically modified genome comprises at least
one site for integration of at least one transgene. Such
genetically modified porcine blastocysts, embryos, fetuses and/or
cells may be obtained by use of the recombinant target vector,
and/or system of the present invention, followed by nuclear
transfer as described elsewhere herein.
[0095] It is appreciated that the genetically modified pig, porcine
blastocysts, embryos, fetuses and/or cells (donor cells and/or cell
nucleus) in the genome comprise more than one site for integration
of at least one transgene. Thus, the genome comprises two, 3, 4, 5,
6, 7, 8, 9, 10, 15, 20 sites for integration of at least one
transgene.
[0096] The at least one site for integration of at least one
transgene is in a preferred embodiment a recombination site. The at
least one site for integration is a heterologous recombination site
(nucleic acids), which is not ordinarily found in the genome of the
pig, porcine blastocysts, embryos, fetuses and/or cells (donor
cells and/or cell nucleus). The present invention takes advantage
of the Cre-Lox recombination technology involving the recombination
of sequences between Iox P sites by the Cre recombinase protein. In
another embodiment the vector comprises sequences of site directed
recombination technology, namely the involving the recombination of
sequences between FRT sites by the Flp (and enhanced Flp, Flpe)
recombination enzyme derived from Saccharomyces cerevisiae. In yet
another embodiment the vector of the present invention takes
advantage of the attB/P-.phi.C31 recombination technology, wherein
the vector comprises attB/P recognition sequences for the .phi.C31
recombinase. Thus, the recombination technology used in the present
invention may be selected from the group consisting of the
Cre-LoxP, Flp-FRT, Flpe-FRT and attB/P-.phi.C31 systems.
[0097] Accordingly, the at least one site for integration of at
least one transgene present in the genome of the pig, porcine
blastocysts, embryos, fetuses and/or cells (donor cells and/or cell
nucleus) is a recombination site for a recombinase. Non-limiting
examples of recombination sites are recombination sites for Flp,
Flpe, Flpx9, .phi.C32 and/or Cre recombinase. Thus, in one
embodiment the at least one site for integration of at least one
transgene present in the genome of the pig, porcine blastocysts,
embryos, fetuses and/or cells (donor cells and/or cell nucleus) is
a recombination site for recombinases selected from the group
consisting of Flp, Flpe, Flpx9 and Cre recombinase. In another
embodiment the recombination site for recombinases is selected from
the group consisting of Flp, Flpe and attB/P. In preferred
embodiment the recombination site is for the Flp recombinase.
However, in another preferred embodiment the at least one
recombination site is for Flpe or Flpx9 recombinase.
[0098] Non-limiting examples of the at least one site for
integration of at least one transgene present in the genome of the
pig, porcine blastocysts, embryos, fetuses and/or cells (donor
cells and/or cell nucleus) are FRT, attB, attP, attB/P and Lox P
recombination sites. Thus, the at least one site for integration
present in the genome of the pig, porcine blastocysts, embryos,
fetuses and/or cells (donor cells and/or cell nucleus) is selected
from the group consisting of FRT, attB/P and Lox P. It is within
the scope of the present invention that the at least one site for
integration is any of FRT, attB, attP, attB/P or Lox P, in separate
embodiments or in any combination. In a preferred embodiment the at
least one site for integration is a FRT site (SEQ ID NO.: 1). In
another preferred embodiment the at least one site for integration
is a Lox P site for example the wtLoxP (SEQ ID NO.: 2), or the core
thereof (SEQ ID NO.: 3), or for example the LoxP257 (SEQ ID NO.:
4), or the core thereof (SEQ ID NO.: 5). In yet another preferred
embodiment the at least one site for integration is a full length
attB site (SEQ ID NO.: 6, or an attB core site (SEQ ID NO.: 7), or
for example an attP site (SEQ ID NO.: 8).
[0099] In one embodiment the genome of the genetically modified
pig, porcine blastocysts, embryos, fetuses and/or cells (donor
cells and/or cell nucleus) comprise at least one selection gene
and/or reporter gene. The selection gene is any gene conferring
resistance to a drug as described elsewhere herein. In a preferred
embodiment the gene is a puromycin resistance gene (SEQ ID NO.: 9).
Alternatively, the selection gene is the eGFP gene (SEQ ID NO.:
10).
[0100] In another embodiment the genome of the genetically modified
pig, porcine blastocysts, embryos, fetuses and/or cells (donor
cells and/or cell nucleus) comprise at least one IRES element, for
example the IRES element of SEQ ID NO:11.
[0101] Furthermore, the genome of the genetically modified pig,
porcine blastocysts, embryos, fetuses and/or cells (donor cells
and/or cell nucleus) comprises in another embodiment promoter
sequences. A number of suitable promoters are listed elsewhere
herein. In one preferred embodiment the promoter is a Rous sarcoma
virus (RSV) promoter (SEQ ID NO:12), simian virus 40 (SV40)
promoter (SEQ ID NO:13), and/or the promoter of ubiquitin (Ubi)
(SEQ ID NO:14).
[0102] However, in another embodiment the genome of the genetically
modified pig, porcine blastocysts, embryos, fetuses and/or cells
(donor cells and/or cell nucleus) comprise left inverted repeat
and/or right inverted repeat originating from the SB transposon
(SEQ ID NO:15).
[0103] The pig, porcine blastocysts, embryos, fetuses and/or cells
(donor cells and/or cell nucleus) of the present invention further
comprise elements of the recombinant target vector as described
elsewhere herein. When the recombinant target vector of the present
invention is integrated into the genome of the pig, porcine
blastocysts, embryos, fetuses and/or cells (donor cells and/or cell
nucleus) the recombinant target vector is referred to as the
integrated SB docking vector and the genome is referred to as the
transposon-tagged genome obtained by integration of the recombinant
target vector pSBT/SV40-GFIP.IoxP (SEQ ID NO:16) or part thereof,
transcriptional product or part thereof and/or translational
product or part thereof, or the pSBT/RSV-GFIP (SEQ ID NO:17) or
part thereof, transcriptional product or part thereof and/or
translational product or part thereof, or pSBT/SV40-GFIP (SEQ ID
NO:18) or part thereof, transcriptional product or part thereof
and/or translational product or part thereof, or
pSBT/SV40-GFIP.IoxP (SEQ ID NO:19) or part thereof, transcriptional
product or part thereof and/or translational product or part
thereof.
[0104] In one preferred embodiment the at least one site for
integration is a recombination site for site-specific transgene
insertion. Transposons are sequences of DNA that can move around to
different positions within the genome of a single cell and
transposons are therefore often referred to as mobile genetic
elements. A DNA transposon acts by cut and paste, using a
transposase enzyme which binds to single-stranded DNA and
incorporates it into genomic DNA. Different types of transposase
work in different ways. Some can bind to any part of the DNA
molecule, and the target site can therefore be anywhere, while
others bind to specific sequences. Transposase makes a staggered
cut at the target site producing sticky ends, cuts out the
transposon and ligates it into the target site. A DNA polymerase
fills in the resulting gaps from the sticky ends and DNA ligase
closes the sugar-phosphate backbone. This results in target site
duplication and the insertion sites of DNA transposons may be
identified by short direct repeats (a staggered cut in the target
DNA filled by DNA polymerase) followed by inverted repeats (which
are important for the transposon excision by transposase). Thus, in
the present context site-specific transgene insertion is
characterised by the site in which the transposase has inserted the
transposon. The site in which the transposon is inserted may be at
a position in the genome which is partially or fully silenced due
to for example epigenetic modifications of the heterochromatin of
the host. In a preferred embodiment of the present invention the at
least one site for integration is a recombination site for
site-specific transgene insertion, wherein the at least one site
for integration is positioned in the genome such that the transgene
is expressed.
[0105] The present invention also relates to genetically modified
pigs porcine blastocysts, embryos, fetuses and/or cells (donor
cells and/or cell nucleus) comprising at least one site for
integration and further comprising at least one transgene.
Preferably, the at least one transgene is inserted into the at
least one site for integration that is into the at least one
recombination site.
[0106] The transgene of the present invention may be any transgene.
In one embodiment the transgenes are disease-causing genes and/or
genes which modifiy genes present in the pig, embryo, blastocyst,
fetus and/or cell thereof, causing the expression of the endogenous
genes to be altered. Such modifications give rise to animal models
for studying a number of phenotypes of disease.
[0107] To identify loci that support stable ubiquitous expression
and facilitate site-specific transgene insertion into such sites, a
novel two-step gene insertion protocol for modification of primary
porcine fibroblasts and generation of cloned transgenic pigs is
presented here.
[0108] The insertion protocol is based on a recombinant target
vector comprising a DNA transposon-based construct comprising a
bicistronic gene cassette comprising (i) a recombination site and
(ii) an IRES-driven selection gene.
Recombinant Target Vector
[0109] One aspect the present invention relates to a recombinant
target vector comprising a DNA transposon based construct
comprising a bicistronic gene cassette comprising (i) at least one
recombination site and ii) an IRES-driven selection gene or part
thereof. The recombinant target vector can be integrated into the
genome of a pig, embryo, blastocyst, fetus and/or cells thereof and
serve as a target for the insertion of a transgene positioned on a
donor plasmid.
[0110] The DNA transposon-based construct may be any construct in
which any DNA transposon or part thereof is present. This allows
the precise manipulation of an organism's DNA under controlled
conditions in vivo. The DNA transposon of the present invention is
selected from the group consisting of the Sleeping Beauty (SB)
transposon, Frog Prince (FP) transposon, Piggybac transposon, Tol2
transposon, Himar 1 transposon. In another embodiment the DNA
transposon is selected from the group constisting of the SB
transposon, the FP transposon and Piggybac transposon, or from the
group consisting of the FP transposon, the Piggybac transposon, the
Tol2 transposon and the Himar 1 transposon. However, the DNA
transposon may be selected from any of the SB transposson, the FP
transposon and Piggybac transposon, or from the group consisting of
the FP transposon, the Piggybac transposon, the Tol2 transposon and
the Himar 1 transposon. In the present invention in one embodiment
the DNA transposon of the DNA transposon-based construct is the DNA
transposon construct known as the Sleeping Beauty (SB) DNA
transposon vector.
[0111] The vector of the present invention employs a site-specific
recombination technology, which involves recombination sequences
between binding sites for recombinases. When cells comprise
site-specific integration sites (or recombination sites) for
recombinases, a reciprocal recombination event occurs in the
presence of a recombinase between the integration sites. The double
stranded DNA is cut at both recombination sites and then
subsequently ligated. The consequences of recombination depend on
the orientation of the site-specific recombination sites. When two
recombination sites are present on one segment of DNA (eg. on one
chromosome arm), inverted recombination sites will cause an
inversion, while a direct repeat of recombination sites will result
in a deletion event. In the case where the two recombination sites
are present on two different segments of DNA, a translocation event
takes place.
[0112] In one embodiment the vector takes advantage of the Cre-Lox
recombination technology involving the recombination of sequences
between Iox P sites by the Cre recombinase protein. In another
embodiment the vector comprises sequences of site directed
recombination technology, namely the involving the recombination of
sequences between FRT sites by the Flp recombination enzyme derived
from Saccharomyces cerevisiae. In yet another embodiment the vector
of the present invention takes advantage of the attB/P-.phi.C31
recombination technology, wherein the vector comprises attB/P
recognition sequences for the .phi.C31 recombinase. Thus, the
recombination technology used in the present invention may be
selected from the group consisting of the Cre-LoxP, Flp-FRT,
Flpe-FRT and attB/P/.phi.C31 systems. Accordingly, the vector of
the present invention harbors the recognition sequence selected
from the group consisting of LoxP, FRT and attB/P.
[0113] However, the examples of recombination systems and
recognition sequences listed above are non-limiting examples, as
any recombination system functioning as disclosed herein may be
used. In one preferred embodiment the vector harbors Lox P
recombination sites for Cre, or even more preferred the vector
harbors FRT recognition sites for Flp.
Selection and Reporter Genes
[0114] The selection gene present in the recombinant target vector
and/or the genome of the pig, porcine blastocysts, embryos, fetuses
and/or cells (donor cells and/or cell nucleus) of the present
invention is not limited to any particular selection gene. In the
present context the term `selection gene` thus comprises reporter
genes such as any reporter genes that can be used to evaluate
whether transposition has occurred. For example the reporter gene
is selected from the group consisting of the enhanced green
fluorescent protein (eGFP), lac Z, dsRed, enhanced yellow
fluorescent protein (eYFP), enhanced cyan fluorescent protein
(eCFP), enhanced blue fluorescent protein (eBFP) and the human
alpha-1-antitrypsin (hAAT).
[0115] The selection gene may be any gene suitable for selecting
cells harbouring the constructs of the present invention. Typically
the selection gene is a gene that confers resistance to antibiotics
or drugs. Examples of such selection genes is the puromycin
resistance gene (Puro), the tetracycline resistance gene, the
streptomycin resistance gene, the hygromycin B resistance gene
(Hygro), the zeocin resistance gene (zeo), the neomycin resistance
gene (neo), and the blasticidin resistance gene (Bst). Therefore,
the selection gene of the present invention is selected from the
group consisting of puromycin resistance gene (Puro), the
tetracycline resistance gene, the streptomycin resistance gene, the
hygromycin B resistance gene (Hygro), the zeocin resistance gene
(zeo), the neomycin resistance gene (neo) and the blasticidin
resistance gene (Bst). In a preferred embodiment the selection gene
is selected from the group consisting of puromycin resistance gene
(Puro), the hygromycin B resistance gene (Hygro), the zeocin
resistance gene (zeo), the neomycin resistance gene (neo) and the
blasticidin resistance gene (Bst). It is appreciated that the
resistance gene is selected from any of puromycin resistance gene
(Puro), the tetracycline resistance gene, the streptomycin
resistance gene, the hygromycin B resistance gene (Hygro), the
zeocin resistance gene (zeo), the neomycin resistance gene (neo) or
the blasticidin resistance gene (Bst).
[0116] The selection gene is in one embodiment driven by an IRES
element.
[0117] In a preferred embodiment the IRES-driven selection gene of
the recombinant target vector and/or the genome of the pig, porcine
blastocysts, embryos, fetuses and/or cells (donor cells and/or cell
nucleus) of the present invention confers resistance to a drug,
preferably puromycin.
Position of Selection Genes
[0118] The recombination site of the recombinant target vector
and/or the genome of the pig, porcine blastocysts, embryos, fetuses
and/or cells (donor cells and/or cell nucleus) of the present
invention may be embedded in the coding sequence of a selection
gene which allows for detecting whether a transposition has
occurred. According to the present invention the recombination site
present in the vector is embedded in the coding sequence of any
suitable reporter gene. The FRT, LoxP and/or attB/P recognition
sites may thus be embedded in any of non-limiting examples of
reporter genes listed herein.
[0119] For example, the FRT is embedded in the coding sequence of
eGFP, lac Z, dsRed, eYFP, eCFP, eBFP or hAAT. Similarly, the LoxP
is embedded in the coding sequence of eGFP, lac Z, dsRed, eYFP,
eCFP, eBFP or hAAT. Moreover, the attB/P is embedded in the coding
sequence of eGFP, lac Z, dsRed, eYFP, eCFP, eBFP or hAAT. In a
preferred embodiment the recombination site is embedded in the
coding sequence of eGFP.
[0120] The recombination site may thus be embedded in a promoter
driven fusion variant of the selection gene. Thus, in one
embodiment the recombination site is embedded in a SV40 promoter
driven fusion variant of the selection gene. In one preferred
embodiment the FRT site is embedded in a SV40 promoter driven
fusion variant of eGFP. In another preferred embodiment wherein
said FRT recombination site is embedded in a ubiquitin promoter
driven fusion variant of eGFP. In yet a preferred embodiment the
FRT site is embedded in a RSV promoter driven fusion variant of
eGFP. However, any promoter suitable for conferring expression of a
selection gene may be used according to the present invention.
Non-limiting examples of such promoters are the promoter of Rous
sarcoma virus (RSV), promoter of cytomegalo virus (CMV), the
promoter of simian virus 40 (SV40), the ubquitin promoter (Ubi),
the promoter of the human elongation factor 1.alpha. (EF1 .alpha.),
the promoter of the human phosphoglycerate kinase (PGK) or the
promoter of the inducible CMV Tet On/Off. Thus, the promoter is
selected from the group consisting of the promoter of Rous sarcoma
virus (RSV), promoter of cytomegalo virus (CMV), the promoter of
simian virus 40 (SV40), the promoter of the human elongation factor
1.alpha. (EF1 .alpha.), the promoter of the human phosphoglycerate
kinase (PGK) and the promoter of the inducible CMV TetOn/Off. In
one preferred embodiment the promoter is selected from the group
consisting of the SV40, CMV and PGK promoter.
[0121] However, according to the present invention, the promoter
may be selected from any of the promoter of Rous sarcoma virus
(RSV), promoter of the cytomegalo virus (CMV), the promoter of
simian virus 40 (SV40), the promoter of the human elongation factor
1.alpha. (EF1 .alpha.), the promoter of the human phosphoglycerate
kinase (PGK) or the promoter of the inducible CMV Tet On/Off. In a
preferred embodiment the promoter is the RSV promoter. In another
preferred embodiment the promoter is the Ubi promoter. In yet
another preferred embodiment the promoter is the SV40 promoter.
IRES
[0122] An internal ribosome entry site, abbreviated IRES, is a
nucleotide sequence that allows for translation initiation in the
middle of a messenger RNA (mRNA) sequence as part of the greater
process of protein synthesis. Usually, in eukaryotes, translation
can only be initiated at the 5' end of the mRNA molecule, since 5'
cap recognition is required for the assembly of the initiation
complex. IRES mimics the 5' cap structure, and is recognized by the
40S pre-initiation complex. When an IRES segment is located between
two reporter open reading frames in a eukaryotic mRNA molecule (a
bicistronic mRNA), it can drive translation of the downstream
protein coding region independently of the 5'-cap structure bound
to the 5' end of the mRNA molecule. In such a setup both proteins
are produced in the cell. The first reporter protein located in the
first cistron is synthesized by the cap-dependent initiation
approach while translation initiation of the second protein is
directed by the IRES segment located in the intercistronic spacer
region between the two reporter protein coding regions.
[0123] The IRES of the present invention is any IRES capable of
driving the expression of a selection gene independently of the 5'
cap structure bound to the 5' end of the mRNA molecule.
Non-limiting examples of IRES elements are IRES from poliovirus,
rhinovirus, encephalomyocarditis virus (EMCV), Hepatitis A virus,
hepatitis C virus, Friend murine leukaemia virus, Moloney murine
leukaemia virus, Rous sarcoma virus and human immunodeficiency
virus. In a preferred embodiment the IRES of the present invention
originates from EMCV.
[0124] The internal ribosome entry site, IRES, -driven selection
gene is similarly not limited to any particular selection gene. In
preferred embodiments the selection gene are genes conferring
resistance to antibiotics or drugs, such as puromycin,
tetracycline, streptomycin or hygromycin resistance genes, or the
enhanced green fluorescent protein (eGFP) gene, red fluorescent
protein genes or the like.
[0125] The recombinant vector construct may also comprise at least
one recombination site for Cre recombinase and/or .phi.C31
recombinase. The at least one site for Cre recombinase may be
located as disclosed in the examples herein. In a preferred
embodiment the recognition site for Cre recombinase is located
between the poly A sequence and the lower inverted repeat of the
vector.
[0126] Embodiments of the present invention are vectors such as a
Sleeping Beauty DNA transposon-based vector which in its integrated
form as a integrated SB docking vector serves as a target for Flp
recombinase-based gene insertion, a Cre recombinase-based gene
insertion or a .phi.C31 recombinase-based gene insertion.
[0127] In a first step, the vector of the present invention is
transferred by cut-and-paste transposition into the genome of a
mammalian cell, for example a somatic cell and therefore is not
flanked by bacteria-derived plasmid sequences. By determining the
vector-derived reporter gene expression in the target cell such as
a mammalian cell, embryos or animals created by for example
hand-made cloning, microinjection or other cloning techniques, it
is possible to characterize individual animals with a desired
expression profile. In a second step, target cells having desired
expression profiles are propagated, and/or for example primary
fibroblasts are isolated from animals as described above. The
target site for the recombinase, such as for Flp, Cre and/or
.phi.C31 recombinase located within the integrated vector of the
present invention, is subsequently utilized for site-specific gene
insertion, producing a cell in which a gene of interest is inserted
into a location in the target cell for which the expression profile
is known. Subsequently, such cells harbouring the at least one gene
of interest may form the basis for propagation of a cell line. In
addition, the described cell may be used for a second round of
cloning, such as for the production of an animal with a desired
phenotype employing said cell in a second round of hand-made
cloning, microinjection or other cloning techniques.
[0128] The vector of the present invention may further comprise at
least one insulator element. The insulator element serves to
stabilise the gene expression of the gene of interest when
integrated into the genome of a target cell, and thus avoid
potential epigenetic silencing. In one embodiment of the present
invention the at least one insulator element is 1.2 kb of the cHS4
(chicken DNase hypersensitive site 4-derived insulator element).
The at least one insulator element is flanking the
promoter-selection gene fusion. In one preferred embodiment two
insulator elements are present in the vector.
[0129] The present invention pertains to a mammalian cell
comprising a transposon tagged genome containing at least one
recombination target site for site-specific gene integration of at
least one gene of interest. In one preferred embodiment the at
least one recombination site is the Flp recombination target site
for site-specific gene insertion or integration.
[0130] In yet a further aspect the present invention relates to a
mammalian cell comprising at least one gene of interest obtained by
use of the bi-phased system of the present invention.
[0131] The mammalian cell comprises a DNA transposon tagged genome
using the recombinant target vector of the present invention and/or
using the bi-phased system of the present invention.
[0132] The mammalian cell as referred to herein is not confined to
any particular cell type. The mammalian cell may thus be immune
cells such as T-cells, epithelial cells, endothelial cells,
fibroblast cells, cells from lung, heart, liver or neuronal cells.
The mammalian cell may be of human, porcine, murine, canine or
feline origin. In particular embodiments of the present invention
the mammalian cell is immortal antitumorigenic cytotoxic T cells of
human origin. In a preferred embodiment, the mammalian cell is a
somatic cell, preferably of porcine origin. In a preferred
embodiment the somatic cell is a porcine fibroblast cell, for
example a primary somatic cell, or a porcine neonatal fibroblast
cell.
[0133] The gene of interest is prior to recombination into the
integrated vector (integrated docking vector) of the present
invention located on a substrate for the recombinases. The
substrates are characterised by the presence of a fusion between at
least one recognition site and a gene of interest for example a
selection gene and/or a gene conferring the establishment of a
desired phenotype or genotype of the cell. In one preferred
embodiment the substrate comprises a promoter driving the
expression of a gene of interest followed by a polydenylation
signal, at least one recombination site and a selection gene
without a functional ATG start codon followed by a polyadenylation
sequence. One example is the Flpe donor plasmid shown in FIG. 2.
The selection gene may be selected from the group of selection
genes listed above and similarly the recognition site may be
selected from the recognition sites as described elsewhere herein.
The fusion of the at least one recognition site and selection gene
may be present in a DNA construct, such as a plasmid, an in
vitro-generated plasmid-derived minicircle and/or lentiviral DNA
circles. Non-limiting examples of such DNA constructs are for
example plasmids containing FRT-hygro fusion cassette (SEQ ID
NO:20), or in-vitro generated plasmid-derived minicircles
containing a FRT-hygro cassette, or lentiviral DNA circles
containing a FRT-hygro cassette.
[0134] Lentiviral DNA circles are unintegrated lentiviral DNA in
the form of so-called 2 LTR circles or 1 LTR circles. In the
present invention the lentiviral DNA circles result from
integration defective lentiviral vectors. In one embodiment of the
present invention the lentiviral DNA originates from lentiviruses
such as human immunodeficiency virus 1 or simian immunodeficiency
virus 1.
[0135] The introduced gene or transgene, transcriptional and/or
translational product or part thereof may originate from any
species, including bacteria, pig, human, mouse, rat, yeast,
invertebrates, or plants. Regulatory sequences of the transgene may
drive ubiquitous or inducible or tissue- and/or time-specific
expression and may also originate from any species including pig,
human, mouse, rat, yeast, invertebrates, or plants.
[0136] Thus, a further aspect of the present invention relates to a
bi-phase system for site-directed integration of genes of interest.
The system comprises the recombinant target vector of the present
invention and a recombination substrate. The recombination
substrate comprises a fusion of at least one recognition site
(recombination site) for a recombinase and a gene of interest. The
recombination substrate is present in a plasmid, an in vitro
generated plasmid-derived minicircle and/or a lentiviral circle as
described elsewhere herein.
[0137] In a preferred embodiment for producing genetically modified
pigs the mammalian cell is a porcine primary fibroblast.
[0138] Primary fibroblasts are fibroblasts derived directly from
excised skin as explants.
[0139] It will be appreciated that the invention does not comprise
processes for modifying the genetic identity of pigs which are
likely to cause them suffering without any substantial medical
benefit to man or animal, or animals resulting from such
processes.
[0140] The present invention also relates to genetically modified
pig embryos obtainable by the methods described herein.
[0141] The methods for producing the pig model described herein do
not encompass a surgical step performed on the pig.
Sequence Identity
[0142] Functional equivalents and variants are used interchangeably
herein. In one preferred embodiment of the invention there is also
provided variants of the genes listed herein, the recombination
sites, selection genes, transposons, recombinases, promoters as
listed herein. When being polypeptides, variants are determined on
the basis of their degree of identity or their homology with a
predetermined amino acid sequence of the present invention, or,
when the variant is a fragment, a fragment of any of the
aforementioned amino acid sequences, respectively.
[0143] Accordingly, variants preferably have at least 91% sequence
identity, for example at least 91% sequence identity, such as at
least 92% sequence identity, for example at least 93% sequence
identity, such as at least 94% sequence identity, for example at
least 95% sequence identity, such as at least 96% sequence
identity, for example at least 97% sequence identity, such as at
least 98% sequence identity, for example 99% sequence identity with
the predetermined sequence.
[0144] The following terms are used to describe the sequence
relationships between two or more polynucleotides: "predetermined
sequence", "comparison window", "sequence identity", "percentage of
sequence identity", and "substantial identity".
[0145] A "predetermined sequence" is a defined sequence used as a
basis for a sequence comparision; a predetermined sequence may be a
subset of a larger sequence, for example, as a segment of a
full-length DNA or gene sequence given in a sequence listing, or
may comprise a complete DNA or gene sequence. Generally, a
predetermined sequence is at least 20 nucleotides in length,
frequently at least 25 nucleotides in length, and often at least 50
nucleotides in length.
[0146] Since two polynucleotides may each (1) comprise a sequence
(i.e., a portion of the complete polynucleotide sequence) that is
similar between the two polynucleotides, and (2) may further
comprise a sequence that is divergent between the two
polynucleotides, sequence comparisons between two (or more)
polynucleotides are typically performed by comparing sequences of
the two polynucleotides over a "comparison window" to identify and
compare local regions of sequence similarity. A "comparison
window", as used herein, refers to a conceptual segment of at least
20 contiguous nucleotide positions wherein a polynucleotide
sequence may be compared to a predetermined sequence of at least 20
contiguous nucleotides and wherein the portion of the
polynucleotide sequence in the comparison window may comprise
additions or deletions (i.e., gaps) of 20 percent or less as
compared to the predetermined sequence (which does not comprise
additions or deletions) for optimal alignment of the two
sequences.
[0147] Optimal alignment of sequences for aligning a comparison
window may be conducted by the local homology algorithm of Smith
and Waterman (1981) Adv. Appl. Math. 2: 482, by the homology
alignment algorithm of Needleman and Wunsch (1970) J. Mol. Biol.
48: 443, by the search for similarity method of Pearson and Lipman
(1988) Proc. Natl. Acad. Sci. (U.S.A.) 85: 2444, by computerized
implementations of these algorithms (GAP, BESTFIT, FASTA, and
TFASTA in the Wisconsin Genetics Software Package Release 7.0,
Genetics Computer Group, 575 Science Dr., Madison, Wis.), or by
inspection, and the best alignment (i.e., resulting in the highest
percentage of homology over the comparison window) generated by the
various methods is selected.
[0148] The term "sequence identity" means that two polynucleotide
sequences are identical (i.e., on a nucleotide-by-nucleotide basis)
over the window of comparison. The term "percentage of sequence
identity" is calculated by comparing two optimally aligned
sequences over the window of comparison, determining the number of
positions at which the identical nucleic acid base (e.g., A, T, C,
G, U, or I) occurs in both sequences to yield the number of matched
positions, dividing the number of matched positions by the total
number of positions in the window of comparison (i.e., the window
size), and multiplying the result by 100 to yield the percentage of
sequence identity. The terms "substantial identity" as used herein
denotes a characteristic of a polynucleotide sequence, wherein the
polynucleotide comprises a sequence that has at least 85 percent
sequence identity, preferably at least 90 to 95 percent sequence
identity, more usually at least 99 percent sequence identity as
compared to a predetermined sequence over a comparison window of at
least 20 nucleotide positions, frequently over a window of at least
25-50 nucleotides, wherein the percentage of sequence identity is
calculated by comparing the predetermined sequence to the
polynucleotide sequence which may include deletions or additions
which total 20 percent or less of the predetermined sequence over
the window of comparison. The predetermined sequence may be a
subset of a larger sequence, for example, as a segment of the
full-length modified porcine or human Ps1 sequence, or porcine or
human APP sequence polynucleotide sequence illustrated herein.
[0149] Sequence identity is determined in one embodiment by
utilising fragments of peptides comprising at least 25 contiguous
amino acids and having an amino acid sequence which is at least
80%, such as 85%, for example 90%, such as 95%, for example 96%,
such as 97%, for example 98%, such as 99% identical to the amino
acid sequence of for example the products of selection genes,
wherein the percent identity is determined with the algorithm GAP,
BESTFIT, or FASTA in the Wisconsin Genetics Software Package
Release 7.0, using default gap weights.
[0150] Conservative Amino Acid Substitutions:
[0151] Substitutions within the groups of amino acids, shown below,
are considered conservative amino acid substitutions. Substitutions
between the different groups of amino acids are considered
non-conservative amino acid substitutions.
P, A, G, S, T (neutral, weakly hydrophobic) Q, N, E, D, B, Z
(hydrophilic, acid amine) H, K, R (hydrophilic, basic) F, Y, W
(hydrophobic, aromatic) L, I, V, M (hydrophobic) C (cross-link
forming)
[0152] By the term "transcriptional or translational products" is
meant herein products of gene transcription, such as a RNA
transcript, for example an unspliced RNA transcript, a mRNA
transcript and said mRNA transcript splicing products, and products
of gene translation, such as polypeptide(s) translated from any of
the gene mRNA transcripts and various products of
post-translational processing of said polypeptides, such as the
products of post-translational proteolytic processing of the
polypeptide(s) or products of various post-translational
modifications of said polypeptide(s).
[0153] As used herein, the term "transcriptional product of the
gene" refers to a pre-messenger RNA molecule, pre-mRNA, that
contains the same sequence information (albeit that U nucleotides
replace T nucleotides) as the gene, or mature messenger RNA
molecule, mRNA, which was produced due to splicing of the pre-mRNA,
and is a template for translation of genetic information of the
gene into a protein.
Pigs
[0154] The present invention relates to a genetically modified pig,
wherein the genetically modified genome comprises at least one site
for integration of at least one transgene. The pig of the present
invention may be any pig.
[0155] In one embodiment of the present invention the pig or
porcine cells originate from a wild pig. In another embodiment the
pig is the domestic pig, Sus scrofa, such as S. domesticus. In yet
another embodiment the invention relates to mini pigs, as well as
to inbred pigs. The pig can be selected e.g. from the group
consisting of Landrace, Yorkshire, Hampshire, Duroc, Chinese
Meishan, Berkshire and Pi train, such as the group consisting of
Landrace, Yorkshire, Hampshire and Duroc, for example the group
consisting of Landrace, Duroc and Chinese Meishan, such as the
group consisting of Berkshire, Pi train, Landrace and Chinese
Meishan, for example the group consisting of Landrace and Chinese
Meishan. In one embodiment, the pig is not a mini-pig.
[0156] In another embodiment of the present invention the pig is a
mini-pig and the mini-pig is preferably selected from the group
consisting of Goettingen, Yucatan, Bama Xiang Zhu, Wuzhishan and Xi
Shuang Banna. Thus, the present invention relates to any of
Goettingen, Yucatan, Bama Xiang Zhu, Wuzhishan and Xi Shuang Banna
separately or in any combination.
[0157] Due to its size and weight of about 200 kg the domestic pig
is not easily handled in a laboratory setting. A preferred
alternative to the domestic pig is the Goettingen (Gottingen)
mini-pig that weighs about 30 kg. Therefore, a preferred embodiment
the pig of the present invention is the Goettingen mini pig.
Methods for Producing the Mammalian Cell of the Present
Invention
[0158] The present invention also relates to a method for producing
a mammalian cell comprising a SB tagged genome containing a Flp or
Flpe recombination target site for site-specific gene insertion.
The method for producing a mammalian cell comprises a DNA
transposon tagged genome comprising a recombination target site for
site-specific gene insertion comprises the steps of a) providing a
mammalian cell, b) transfecting the cell of a) with a plasmid
expressing a transposase and a recombinant vector comprising a DNA
transposon-based construct carrying a bicistronic gene cassette
comprising (i) a recombination site and ii) an IRES-driven
selection gene, c) selecting DNA transposon tagged cells. The
recombinant vector may comprise any DNA-transposon as described
elsewhere herein. In one embodiment the recombinant target vector
comprises a DNA transposon in the form of a Sleeping Beauty
transposon. In one embodiment the recombinant target vector
comprising a DNA transposon construct and a bicistronic gene
cassette comprising (i) a FRT recombination site and ii) an
IRES-driven selection gene, such as for example a puromycin
resistance gene. Thus, the method comprises a) providing a
mammalian cell, b) transfecting the cell of a) with a plasmid
expressing a transposase and a recombinant target vector comprising
a DNA transposon construct and a bicistronic gene cassette
comprising (i) a FRT recombination site and ii) an IRES-driven
selection gene, c) selecting SB tagged cells.
[0159] The transposon tagged cells, for example Sleeping Beauty
tagged cells are selected by antibiotics or any agent allowing for
the selection of transposon tagged cells. A number of selection
agents are described elsewhere herein. A person skilled in the art
will appreciate which antibiotic to use given that a specific
antibiotic resistance gene is present in the transposon tagged
cells. One example is the use of puromycin as selection agent,
given that the puromycin resistance gene is present in the
transposon tagged cell.
[0160] As described elsewhere herein the mammalian cell may be any
cell. In one embodiment in which the mammalian cell is subsequently
to be used for producing a genetically modified pig by nuclear
transfer according to the hand-made protocol as described herein,
the mammalian cell is preferably a porcine cell, a fibroblast and
most preferred a porcine primary fibroblast or a neonatal porcine
fibroblast.
[0161] It is appreciated that a desired transgene may be integrated
directly into the at least one site for integration present in the
genome of the cell. However, the cell in which the genome carries
the at least one site for integration is in another embodiment used
as a donor cell for the production of a genetically modified pig by
for example microinjection of the donor cell or nucleus thereof
into a oocyte or by for example somatic nuclear transfer. In a
preferred embodiment the donor cell or the nucleus thereof is used
for the production of a genetically modified pig by somatic nuclear
transfer using the procedure as described elsewhere herein.
[0162] The transgene or gene of interest to be integrated in the
targeted cells of the present invention is not limited to any
particular gene. In one embodiment the gene to be integrated is a
disease-causing gene which results in the formation of a
genetically modified pig, embryo, blastocyst, fetus and/or donor
cell displaying a phenotype of interest.
[0163] The integration of the transgene into the at least one site
for integration present in the genome of the cell is employed by
transfection into the cell of plasmid DNA containing the gene of
interest and also a FRT sites, and a plasmid expressing the
Flp-recombinase used to support integration at the FRT sites. In
another preferred embodiment the integration of the transgene into
the at least one site for integration present in the genome of the
cell is employed by transfection into the cell of plasmid DNA
containing the gene of interest and also a FRT sites, and a plasmid
expressing the Flpe-recombinase used to support integration at the
FRT sites.
[0164] Methods for Producing the Genetically Modified Pig of the
Present Invention
[0165] The genetically modified pig, porcine embryo, blastocyst,
fetus and/or donor cell of the present invention may be produced
using any technique in which modified genetic material is
transferred from at donor cell to a host cell, such as an
enucleated oocyte. A number of techniques exist such as introducing
genetic material from a genetically modified somatic cell into an
enucleated oocyte by for example microinjection or by nuclear
transfer. The present invention provides improved procedures for
cloning pigs by nuclear transfer which refers to the introduction
of a full complement of nuclear DNA from one cell to an enucleated
cell.
[0166] In cloning, the transfer of the nucleus of a somatic (body)
cell or somatic cell into an egg cell (oocyte) which has had its
own nucleus removed (denucleated or enucleated) is called somatic
cell nuclear transfer. The new individual will develop from this
reconstructed embryo and be genetically identical to the donor of
the somatic cell. In the present invention a genetically modified
pig, porcine embryo, blastocyst, fetus and/or donor cell is
obtainable by somatic cell nuclear transfer comprising the steps of
a) establishing at least one oocyte having at least a part of a
modified zona pellucida, b) separating the oocyte into at least two
parts obtaining an oocyte and at least one cytoplast, c)
establishing a donor cell or cell nucleus having desired genetic
properties, d) fusing at least one cytoplast with the donor cell or
membrane surrounded cell nucleus, e) obtaining a reconstructed
embryo f) activating the reconstructed embryo to form an embryo;
culturing said embryo; and g) transferring said genetically
modified embryo to a host mammal such that the embryo develops into
a genetically modified fetus, wherein said genetically modified
embryo obtainable by nuclear transfer comprises steps a) to g) or
f); wherein said genetically modified blastocyst obtainable by
nuclear transfer comprises steps a) to f) or g); wherein said
genetically modified fetus obtainable by nuclear transfer comprises
steps a) to g.
[0167] However, the present invention also relates to a method for
producing a transgenic pig, porcine embryo, blastocyst, fetus
and/or donor cell comprising the steps of a) establishing at least
one oocyte, b) separating the oocyte into at least three parts
obtaining at least two cytoplasts, c) establishing a donor cell or
cell nucleus having desired genetic properties, d) fusing at least
one cytoplast with the donor cell or membrane surrounded cell
nucleus, e) obtaining a reconstructed embryo, f) activating the
reconstructed embryo to form an embryo; culturing said embryo; and
g) transferring said genetically modified embryo to a host mammal
such that the embryo develops into a genetically modified fetus,
wherein said genetically modified embryo obtainable by nuclear
transfer comprises steps a) to g) or f); wherein said genetically
modified blastocyst obtainable by nuclear transfer comprises steps
a) to f) or g); wherein said genetically modified fetus obtainable
by nuclear transfer comprises steps a) to g.
[0168] Furthermore, the present invention relates to a method for
producing a transgenic pig, porcine embryo, blastocyst, fetus
and/or donor cell comprising the steps of a) establishing at least
one oocyte, b) separating the oocyte into at least three parts
obtaining at least two cytoplasts, c) establishing a donor cell or
cell nucleus having desired genetic properties, wherein the donor
cell or cell nucleus is established from a genetically modified
pig, porcine embryo, blastocyst, fetus and/or donor cell carrying
in its genome at least one site for integration of at least one
transgene, d) providing a transgene and integrating said transgene
into the donor cell of c), d) fusing at least one cytoplast with
the donor cell or membrane surrounded cell nucleus, e) obtaining a
reconstructed embryo, f) activating the reconstructed embryo to
form an embryo; culturing said embryo; and g) transferring said
genetically modified embryo to a host mammal such that the embryo
develops into a genetically modified fetus, wherein said
genetically modified embryo obtainable by nuclear transfer
comprises steps a) to g) or f); wherein said genetically modified
blastocyst obtainable by nuclear transfer comprises steps a) to f)
or g); wherein said genetically modified fetus obtainable by
nuclear transfer comprises steps a) to g.
[0169] It is appreciated that the genetic determinant in one
embodiment is the at least one heterologous site for integration of
at least one transgene. Preferably the heterologous step for
integration is a recombination site for a recombinase as described
in detail elsewhere herein.
[0170] The various parameters are described in detail below.
Oocyte
[0171] The term `oocyte` according to the present invention means
an immature female reproductive cell, one that has not completed
the maturing process to form an ovum (gamete). In the present
invention an enucleated oocyte is the recipient cell in the nuclear
transfer process.
[0172] The oocytes according to the present invention are isolated
from oviducts and/or ovaries of a mammal. Normally, oocytes are
retrieved from deceased pigs, although they may be isolated also
from either oviducts and/or ovaries of live pigs. In one embodiment
the oocytes are isolated by oviductal recovery procedures or
transvaginal recovery methods. In a preferred embodiment the
oocytes are isolated by aspiration. Oocytes are typically matured
in a variety of media known to a person skilled in the art prior to
enucleation. The oocytes can also be isolated from the ovaries of a
recently sacrificed animal or when the ovary has been frozen and/or
thawed. Preferably, the oocytes are freshly isolated from the
oviducts.
[0173] Oocytes or cytoplasts may also be cryopreserved before use.
While it will be appreciated by those skilled in the art that
freshly isolated and matured oocytes are preferred, it will also be
appreciated that it is possible to cryopreserve the oocytes after
harvesting or after maturation. If cryopreserved oocytes are
utilised then these must be initially thawed before placing the
oocytes in maturation medium. Methods of thawing cryopreserved
materials such that they are active after the thawing process are
well-known to those of ordinary skill in the art. However, in
general, cryopreservation of oocytes and cytoplasts is a very
demanding procedure, and it is especially difficult in pigs,
because of the above mentioned general fragility of pig oocytes and
cytoplasts, and because of the high lipid content that makes them
very sensitive to chilling injury (i.e. injury that occurs between
+15 and +5.degree. C. during the cooling and warming
procedure).
[0174] In another embodiment, mature (metaphase II) oocytes that
have been matured in vivo, may be harvested and used in the nuclear
transfer methods disclosed herein. Essentially, mature metaphase II
oocytes are collected surgically from either nonsuperovulated or
superovulated pigs 35 to 48 hours past the onset of estrus or past
the injection of human chorionic gonadotropin (hCG) or similar
hormone.
[0175] Where oocytes have been cultured in vitro, cumulus cells
that are surrounding the oocytes in vivo may have accumulated may
be removed to provide oocytes that are at a more suitable stage of
maturation for enucleation. Cumulus cells may be removed by
pipetting or vortexing, for example, in the presence of in the
range of 0.1 to 5% hyaluronidase, such as in the range of 0.2 to 5%
hyaluronidase, for example in the range of 0.5 to 5% hyaluronidase,
such as in the range of 0.2 to 3% hyaluronidase, for example in the
range of 0.5 to 3% hyaluronidase, such as in the range of 0.5 to 2%
hyaluronidase, for example in the range of 0.5 to 1% hyaluronidase,
such as 0.5% hyaluronidase.
[0176] The first step in the preferred methods involves the
isolation of a recipient oocyte from a suitable pig. In this
regard, the oocyte may be obtained from any pig source and at any
stage of maturation.
[0177] The stage of maturation of the oocyte at enucleation and
nuclear transfer has been reported to be of significance for the
success of nuclear transfer methods. Immature (prophase I) oocytes
from pig ovaries are often harvested by aspiration. In order to
employ techniques such as genetic engineering, nuclear transfer and
cloning, such harvested oocytes are preferably matured in vitro
before the oocyte cells may be used as recipient cells for nuclear
transfer.
[0178] Preferably, successful pig embryo cloning uses the metaphase
II stage oocyte as the recipient oocyte because it is believed that
at this stage of maturation the oocyte can be or is sufficiently
activated to treat the introduced nucleus as if it were a
fertilising sperm. However, the present invention relates to any
maturation stage of the oocyte which is suitable for carrying out
somatic cell nuclear transfer, embryos, blastocysts, and/or
transgenic pigs obtainable by the method of somatic cell nuclear
transfer of the present invention.
[0179] The in vitro maturation of oocytes usually takes place in a
maturation medium until the oocyte has reached the metaphase II
stage or has extruded the first polar body. The time it takes for
an immature oocyte to reach maturation is called the maturation
period.
[0180] In a preferred embodiment of the present invention the
oocyte is from sow or gilt, preferably from a sow.
[0181] The donor (somatic cell or nucleus of somatic cell) and
recipient (cytoplast) involved in the cell nuclear transfer method
according to the present invention is a pig. Likewise,
reconstructed embryos may be implanted in a pig according to the
present invention. The different pigs suitable as donor, recipient
or foster mother are described elsewhere herein.
[0182] The donor pig according to the present invention may be
female, or male. The age of the pig can be any age such as an
adult, or for example a fetus.
Embryo
[0183] According to the present invention a reconstructed embryo
(i.e. single cell embryo) contains the genetic material of the
donor cell. Subsequently, the reconstructed embryo divides
progressively into a multi-cell embryo after the onset of mitosis.
In vitro the onset of mitosis is typically induced by activation as
described herein.
[0184] In the present invention the term `embryo` also refers to
reconstructed embryos which are embryos formed after the process of
nuclear transfer after the onset of mitosis by activation.
Reconstructed embryos are cultured in vitro.
[0185] When the embryo contains about 12-16 cells, it is called a
"morula". Subsequently, the embryo divides further and many cells
are formed, and a fluid-filled cystic cavity within its center,
blastocoele cavity. At this stage, the embryo is called a
"blastocyst". The developmental stage of the "fertilized" oocyte at
the time it is ready to implant; formed from the morula and
consists of an inner cell mass, an internal cavity, and an outer
layer of cells called trophectodermal cells.
[0186] The blastocyst according to the present invention may be
implanted into the uterus of a host mammal, in particular a pig,
preferably a Goettingen minipig and continues to grow into a fetus
and then an animal.
[0187] In the methods provided herein for producing genetically
modified or transgenic non-human mammal, for cloning a non-human
mammal, for culturing a reconstructed embryo, and/or for
cryopreservation of a pig embryo, the embryo may be cultured in
vitro. The embryo may for example be cultured in sequential
culture. It will be appreciated that the embryo may be a normal
embryo, or a reconstructed embryo as defined elsewhere herein.
[0188] The present invention thus relates to a modified porcine
embryo, blastocyst and/or fetus derived from the genetically
modified pig model as disclosed herein and/or the modified porcine
embryo, wherein the genetically modified genome comprises at least
one site for integration of at least one transgene.
Cytoplast
[0189] An oocyte or a part of an oocyte from which the nucleus has
been removed.
Donor Cell
[0190] By the term `donor cell` of the present invention is meant
somatic cell and/or cells derived from the germ line.
[0191] By the term `somatic cell` of the present invention is meant
any (body) cell from an animal at any stage of development. For
example somatic cells may originate from fetal, neonatal or adult
tissue. Especially preferred somatic cells are those of foetal or
neonatal origin. However, cells from a germ line may also be used.
According to the present invention a donor cell is a somatic cell.
In another embodiment of the present invention the donor cell is a
cell derived from a germ cell line.
[0192] In a preferred embodiment of the present invention the donor
cell harbours desired genetic properties. However, the donor cell
may harbour desired genetic properties which have been gained by
genetic manipulation as described elsewhere herein. The present
invention thus relates to a modified porcine donor cell (or cell
nucleus), derived from the genetically modified pig model as
disclosed herein and/or the modified porcine donor cell or cell
nucleus, wherein the genetically modified genome comprises at least
one site for integration of at least one transgene.
[0193] Somatic cells are selected from the group consisting of
epithelial cells, neural cells, epidermal cells, keratinocytes,
hematopoietic cells, melanocytes, chondrocytes, lymphocytes (B and
T lymphocytes), erythrocytes, macrophages, monocytes, mononuclear
cells, fibroblasts, cardiac muscle cells, and other muscle
cells.
[0194] These may be obtained from different organs, e.g., skin,
lung, pancreas, liver, stomach, intestine, heart, reproductive
organs, bladder, kidney, urethra and other urinary organs.
[0195] The pigs from which the somatic cells may be derived are
described elsewhere herein. A preferred embodiment of the invention
is the use of somatic cells originating from the same species as
the recipient oocyte (cytoplast).
[0196] Preferably, the somatic cells are fibroblast cells as the
can be obtained from both developing fetuses and adult animals in
large quantities. Fibroblasts may furthermore be easily propagated
in vitro. Most preferably, the somatic cells are in vitro cultured
fibroblasts of foetal origin.
[0197] In a preferred embodiment the somatic cells are genetically
modified. In yet a further preferred embodiment of the present
invention the somatic cells are preferably of foetal origin, or for
example from adults.
[0198] The donor cell or nucleus of the present invention harbours
desired genetic properties. The donor cell or nucleus carries a SB
tagged genome containing a Flp recombination target site for site
specific gene insertion or integration. The SB tagged genome result
from the integration of a recombinant target vector comprising a
DNA transposon construct and a bicistronic gene cassette comprising
(i) a FRT recombination site and (ii) an IRES-driven selection
gene. The DNA transposon construct may be any construct in which
any DNA transposon is present. In the present invention the DNA
transposon construct is the Sleeping Beauty (SB) DNA transposon
vector. The FRT recombination site may be embedded in the coding
sequence of a selection gene which allows for detecting whether a
transposition has occurred. The selection gene of the present
invention is not limited to any particular selection gene. In
preferred embodiments the selection gene are genes conferring
resistance to antibiotics or drugs, such as puromycin,
tetracycline, streptomycin or hygromycin resistance genes, or the
enhanced green fluorescent protein (eGFP) gene, red fluorescent
protein genes or the like.
[0199] The FRT recombination site may thus be embedded in a SV40
promoter driven fusion variant of the selection gene. However, any
promoter suitable for conferring expression of a selection gene may
be used according to the present invention. Non-limiting examples
of such promoters are CMV (cytomegalovirus) or PGK promoter.
[0200] The IRES-driven selection gene is similarly not limited to
any particular selection gene. In preferred embodiments the
selection gene are genes conferring resistance to antibiotics or
drugs, such as puromycin, tetracycline, streptomycin or hygromycin
resistance genes, or the enhanced green fluorescent protein (eGFP)
gene, red fluorescent protein genes or the like.
[0201] The recombinant vector construct may also comprise at least
one site for Cre recombinase. The at least one site for Cre
recombinase may be located as disclosed in the examples herein.
[0202] The donor cell or nucleus may also originate from a
genetically modified pig comprising at least one site for
integration of at least one transgene. A preferred embodiment is a
donor cell or nucleus in the form of a fibrobast, such as a primary
fibroblast.
Enucleation
[0203] The method of enucleation of an oocyte may be selected from
the group of methods consisting of aspiration, physical removal,
use of DNA-specific fluorochromes, exposure to ultraviolet light
and/or chemically assisted enucleation. In one embodiment the
present invention relates to the use of DNA-specific fluorochromes.
Enucleation may, however, be performed by exposure with ultraviolet
light. In a particular embodiment enucleation is chemically
assisted prior to physical removal of the nucleus. Chemically
assisted enucleation using for example antineoplastic agents, such
as demecolcine (N-deacetyl-N-methyl 1 colchicine), and/or for
example etoposide or related agents may be performed prior to
enzymatic modification of zona pellucida. Chemically assisted
enucleation comprises culturing matured COCs in maturation medium
as described elsewhere herein supplemented with demecolcine for a
particular period of time. In the range of 0.1 .mu.g/ml to 10
.mu.g/ml demecolcine, such as 0.2 .mu.g/ml to 10 .mu.g/ml, for
example 0.3 .mu.g/ml to 10 .mu.g/ml, such as 0.25 .mu.g/ml to 5
.mu.g/ml, for example 0.3 .mu.g/ml to 1 .mu.g/ml, such as 0.25
.mu.g/ml to 0.5 .mu.g/ml, for example 0.4 .mu.g/ml demecolcin may
be supplemented to the maturation medium. Similarly, maturation
medium may be supplemented with etoposide for example in the range
of 0.1 .mu.g/ml to 10 .mu.g/ml etoposide, such as 0.2 .mu.g/ml to
10 .mu.g/ml, for example 0.3 .mu.g/ml to 10 .mu.g/ml, such as 0.25
.mu.g/ml to 5 .mu.g/ml, for example 0.3 .mu.g/ml to 1 .mu.g/ml,
such as 0.25 .mu.g/ml to 0.5 .mu.g/ml, for example 0.4 .mu.g/ml
etoposide may be supplemented to the maturation medium. The time
for culturing the COCs in the presence of antineoplastic agents
ranges from 10 min to 5 hrs, such as 30 minutes to 5 hrs, for
example 10 minutes to 2 hrs, such as 30 min to 2 hrs, for example
10 min to 1.5 hrs, such as 20 min to 3 hrs, for example 10 min to 3
hrs, such as 30 min to 1.5 hrs, for example 45 min.
[0204] In a particular embodiment chemically assisted enucleation
is performed using 0.45 .mu.g/ml demecolcine and/or etoposide added
to the maturation medium for 45 min.
[0205] In a particular embodiment it is preferred that the
enucleation is by physical removal of the nucleus. The physical
removal may be by separation for example by bisection of the oocyte
into two halves (two parts), one which contains the nucleus and the
enucleated oocyte half, known as the cytoplast, removing the
nucleated half of the oocyte and selecting the resulting cytoplast
for further procedures of the invention. Alternatively the
separation is by trisection, resulting in three parts of which two
parts are cytoplasts. In another embodiment the oocyte may be
separated into four parts, resulting in the production of three
cytoplasts. The oocyte may even be separated into five parts by
physical removal, resulting in four cytoplasts. Similarly, the
oocyte may be separated into six parts, for example seven parts,
such as eight parts, for example nine parts, such as ten or more
parts.
[0206] The physical separation of the oocyte and subsequent removal
of the nucleus-bearing part of the oocyte may be achieved by the
use of a microsurgical blade.
[0207] The oocytes may be screened to identify which oocytes have
been successfully enucleated. Oocyte parts that harbour nuclear DNA
may be identified by staining with Hoechst fluorochrome, the
staining procedure of which is known to a person skilled in the
art. Oocyte parts harbouring nuclear DNA are discarded and the
enucleated oocytes (cytoplasts) are selected for further
procedures.
Zona Pellucida
[0208] Zona pellucida is a thick, transparent, noncellular layer or
envelope of uniform thickness surrounding an oocyte
[0209] Generally, an intact zona pellucida is considered to be
important in cell nuclear transfer due to a number of parameters.
One parameter is to keep the polar body close to the metaphase
plate of the oocyte in order to indicate the appropriate site for
enucleation. Another parameter relates to the keeping of the donor
cell close to the oocyte cytoplast before and during fusion. The
zona is also believed to confer protection for the donor cell and
cytoplast during fusion. Finally, embryo development after
reconstitution and activation is believed to be supported by the
zona pellucida.
[0210] Modification of at least a part of the zona pellucida can be
performed by a number of methods. For example physical manipulation
can be used to modify the zona. But also chemical treatment with
agents such as acidic solutions (acidic Tyrode) can be employed.
One example of chemical agents that can be employed in the present
invention is acidic solutions, for example Tyrode. In a particular
embodiment of the invention the zona pellucida is modified by
enzymatic digestion. Such enzymatic digestion may be performed by
enzymes comprising for example trypsin. Alternatively a specific
protease may be used, such as pronase.
[0211] In a preferred embodiment the enzymatic digestion results in
at least a partial digestion of a part of zona pellucida which in a
preferred embodiment of the present invention means that at least a
part of the zona pellucida is being removed, or that the zona
pellucida is partly removed. In the present context the zona
pellucida is not completely removed.
[0212] According to an especially preferred embodiment of the
present invention the partially digested part of zona pellucida is
characterized by the zona pellucida still being visible and by the
fact that the oocyte has not become misshaped.
[0213] The partial digestion may be achieved by exposure to a
protease. In another embodiment of the present invention the
partial digestion may be accomplished by the use of a pronase. In
yet another embodiment the partial digestion may be achieved by a
combination of a protease and pronase.
[0214] In a preferred embodiment the concentration of pronase is in
the range of 0.1 mg/ml to 10 mg/ml, such as 0.5 mg/ml to 10 mg/ml,
for example 1 mg/ml to 10 mg/ml, such as 1.5 mg/ml to 10 mg/ml, for
example 2 mg/ml to 10 mg/ml, such as 2.5 mg/ml to 10 mg/ml, for
example 2.75 mg/ml to 10 mg/ml, such as 3 mg/ml to 10 mg/ml, for
example 3.25 mg/ml to 10 mg/ml, such as 3.3 mg/ml to 10 mg/ml, for
example 3.5 mg/ml to 10 mg/ml.
[0215] A preferred embodiment is a pronase concentration in the
range of 2 mg/ml to 5 mg/ml, such as 2.25 mg/ml to 5 mg/ml, for
example 2.5 mg/ml to 5 mg/ml, such as 2.75 mg/ml to 5 mg/ml, for
example 2.8 mg/ml to 5 mg/ml, such as 2.9 mg/ml to 5 mg/ml, for
example 3 mg/ml to 5 mg/ml, such as 3.1 mg/ml to 5 mg/ml, for
example 3.2 mg/ml to 5 mg/ml, such as 3.3 mg/ml to 5 mg/ml.
[0216] A particular embodiment of the present invention is a
pronase concentration in the range of 1 mg/ml to 4 mg/ml, for
example 1 mg/ml to 3.9 mg/ml, such as 1 mg/ml to 3.8 mg/ml, for
example 1 mg/ml to 3.7 mg/ml, such as 1 mg/ml to 3.6 mg/ml, for
example 1 mg/ml to 3.5 mg/ml such as 1 mg/ml to 3.4 mg/ml, for
example 1 mg/ml to 3.3 mg/ml.
[0217] In a preferred embodiment the pronase concentration is in
the range of 2.5 mg/ml to 3.5 mg/ml, such as 2.75 mg/ml to 3.5
mg/ml, for example 3 mg/ml to 3.5 mg/ml. In a special embodiment
the pronase concentration is 3.3 mg/ml.
[0218] It is clear to the skilled person that the pronase should be
dissolved in an appropriate medium, one preferred medium according
to the present invention is T33 (Hepes buffered TCM 199 medium
containing 33% cattle serum (as described earlier--Vajta, et al.,
2003).
[0219] The time of incubation of the oocyte in the pronase solution
is in the range of 1 second to 30 seconds, such as 2 seconds to 30
seconds, for example 3 seconds to 30 seconds, such as 4 seconds to
30 seconds, such as 5 seconds to 30 seconds.
[0220] In another embodiment of the present invention the
incubation time is in the range of 2 seconds to 15 seconds, such as
2 seconds to 14 seconds, for example 2 seconds to 13 seconds, such
as 2 seconds to 12 seconds, for example 2 seconds to 11 seconds,
such as 2 seconds to 10 seconds, for example 2 seconds to 9
seconds, such as 2 seconds to 8 seconds, for example 2 seconds to 7
seconds, such as 2 seconds to 6 seconds, for example 2 seconds to 5
seconds.
[0221] In a particular embodiment of the present invention the
incubation time is in the range of 3 seconds to 10 seconds, such as
3 seconds to 9 seconds, for example 4 seconds to 10 seconds, such
as 3 seconds to 8 seconds, for example 4 seconds to 9 seconds, such
as 3 seconds to 7 seconds, for example 4 seconds to 8 seconds, such
as 3 seconds to 6 seconds, for example 4 seconds to 7 seconds, such
as 3 seconds to 5 seconds, for example 4 seconds to 6 seconds, such
as 4 seconds to 5 seconds. An especially preferred incubation time
is 5 seconds.
[0222] In a preferred embodiment of the present invention the
oocyte is treated for 5 seconds in a 3.3 mg/ml pronase solution at
39.degree. C.
Reconstructed Embryo
[0223] By the term `reconstructed embryo` is meant the cell which
is formed by insertion of the donor cell or nucleus of the donor
cell into the enucleated oocyte which corresponds to a zygote
(during normal fertilisation). However, the term `reconstructed
embryo` is also referred to as the `reconstituted cell`. In the
present invention the donor cell is a somatic cell. However, the
donor cell may also be derived from a germ line cell.
Fusion
[0224] The transfer of a donor cell or a membrane surrounded
nucleus from a donor cell to at least cytoplast is according to the
present invention performed by fusion. In the scenarios described
below the term `donor cell` also refers to a membrane surrounded
nucleus from a donor cell. Fusion may be achieved by a number of
methods.
[0225] Fusion may be between a donor cell and at least one
cytoplast, such as between a donor cell and at least two
cytoplasts, for example between a donor cell and at least two
cytoplasts, such as between a donor cell and at least three
cytoplasts, such as between a donor cell and at least four
cytoplasts, for example between a donor cell and at least five
cytoplasts, such as between a donor cell and at least six
cytoplasts, for example between a donor cell and at least seven
cytoplasts, such as between a donor cell and at least eight
cytoplasts.
[0226] Fusion may be performed according to the listed combinations
above simultaneously or sequentially. In one embodiment of the
present invention the fusion is performed simultaneously. In
another embodiment fusion of the at least one cytoplast and a donor
cell is performed sequentially.
[0227] For example fusion may be achieved by chemical fusion,
wherein a donor cell and the at least one cytoplast are exposed to
fusion promoting agents such as for example proteins,
glycoproteins, or carbohydrates, or a combination thereof. A
variety of fusion-promoting agents are known for example,
polyethylene glycol (PEG), trypsin, dimethylsulfoxide (DMSO),
lectins, agglutinin, viruses, and Sendai virus. Preferably
phytohemaglutinin (PHA) is used. However mannitol and, or
polyvinylalcohol may be used.
[0228] Alternatively, fusion may be accomplished by induction with
a direct current (DC) across the fusion plane. Often an alternating
current (AC) is employed to align the donor and recipient cell.
Electrofusion produces a sufficiently high pulse of electricity
which is transiently able to break down the membranes of the
cytoplast and the donor cell and to reform the membranes
subsequently. As a result small channels will open between the
donor cell and the recipient cell. In cases where the membranes of
the donor cell and the recipient cell connect the small channels
will gradually increase and eventually the two cells will fuse to
one cell.
[0229] Alignment of the at least one cytoplast and the donor cell
may be performed using alternating current in the range of 0.06 to
0.5 KV/cm, such as 0.1 to 0.4 KV/cm, for example 0.15 to 0.3 KV/cm.
In a preferred embodiment alignment of the at least one cytoplast
and the donor cell may be performed using alternating current at
0.2 KV/cm. Fusion may be induced by the application of direct
current across the fusion plane of the at least one cytoplast and
the donor cell. Direct current in the range of 0.5 to 5 KV/cm, such
as 0.75 to 5 KV/cm, for example 1 to 5 KV/cm, such as 1.5 to 5
KV/cm, for example 2 to 5 KV/cm. Another preferred embodiment of
the present invention is the application of direct current in the
range of 0.5 to 2 KV/cm. In a further preferred embodiment the
direct current may be 2 KV/cm.
[0230] The direct current may preferably be applied for in the
range of 1-15 micro seconds, such as 5 to 15 micro seconds, for
example 5 to 10 micro seconds. A particular embodiment may be 9
micro seconds.
[0231] In an especially preferred embodiment fusion with direct
current may be using a direct current of 2 KV/cm for 9 micro
seconds.
[0232] Electrofusion and chemical fusion may however be also be
combined.
[0233] Typically electrofusion is performed in fusion chambers as
known to the skilled person.
[0234] Fusion may be performed in at least one step, such as in two
steps, for example three steps, such as in four steps, for example
in five steps, such as six steps, for example seven steps, such as
in eight steps.
[0235] Fusion may be performed in for example a first step wherein
the at least one cytoplast is fused to the donor cell. A second
step of fusion may comprise fusion of the fused pair
(cytoplast-donor cell, reconstructed embryo) with at least one
cytoplast, such as at least two cytoplasts, for example three
cytoplasts, such as four cytoplasts, for example five cytoplasts,
such as six cytoplasts, for example seven cytoplasts, such as eight
cytoplasts. The second step of fusion with fusion of at least one
cytoplast and the fused pair may be performed sequentially or
simultaneously. In one embodiment the at least two cytoplasts are
fused to the fused pair simultaneously. In another embodiment the
at least two cytoplasts are fused to the fused pair
sequentially.
[0236] In one embodiment of the invention the second step of fusion
may also be an activation step wherein the reconstructed embryo is
activated to enter mitosis. As described elsewhere herein.
Activation
[0237] In a preferred embodiment the reconstructed embryo may be
allowed to rest prior to activation for a period of time in order
to allow for the nucleus of the donor cell to reset its genome and
gain toti potency in the novel surroundings of the enucleated
cytoplast. The reconstructed embryo may for example rest for one
hour prior to activation.
[0238] Preferably, the reconstructed embryo may be activated in
order to induce mitosis. Methods for activation may preferably be
selected from the group of consisting of electric pulse, chemically
induced shock, increasing intracellular levels of divalent cations
or reducing phosphorylation. A combination of methods may be
preferred for activation.
[0239] In one particular embodiment of the invention the activation
and the second step of fusion may be performed simultaneously.
However, the activation of the reconstituted embryo and the at
least one additional step of fusion between the reconstructed
embryo and the at least one cytoplast may be performed
sequentially.
[0240] Reducing the phosphorylation of cellular proteins in the
reconstructed embryo by known methods such as for example by the
addition of kinase inhibitors may activate the reconstituted
embryo. A preferred embodiment may involve the use of agents that
inhibit protein synthesis, for example cycloheximide. A further
preferred embodiment may be using agents that inhibit spindle body
formation, for example cytochalasin B.
[0241] In one embodiment of the invention the intracellular levels
of divalent cations may be increased. Divalent cations such as for
example calcium may be in comprised in the activation medium.
Preferably, the cations may enter the reconstructed embryo,
particularly upon subjecting the reconstructed embryo to an
electric pulse. In a preferred embodiment the electric pulse may
cause entering of calcium into the reconstructed embryo.
[0242] The application of an electrical pulse using direct current
may be an activation step. However, in a preferred embodiment the
electrical pulse applied for activation may also serve as an
additional fusion step.
[0243] Prior to applying an electrical pulse using direct current
the at least one cytoplast and the at least one reconstructed
embryo may be aligned by the application of alternating current.
The alternating current may be in the range of the range of 0.06 to
0.5 KV/cm, such as 0.1 to 0.4 KV/cm, for example 0.15 to 0.3 KV/cm.
In a preferred embodiment alignment of the at least one cytoplast
and the donor cell may be performed using alternating current at
0.2 KV/cm.
[0244] Activation may be induced by the application of direct
current across the fusion plane of the at least one cytoplast and
the donor cell. Direct current in the range of 0.2 to 5 KV/cm, such
as 0.4 to 5 KV/cm, for example 0.5 to 5 KV/cm. Another preferred
embodiment of the present invention is the application of direct
current in the range of 0.5 to 2 KV/cm. In a further preferred
embodiment the direct current may be 0.7 KV/cm.
[0245] The direct current may preferably be applied for in the
range of 10 to 200 micro seconds, such as 25 to 150 micro seconds,
for example 50 to 100 micro seconds. A particular embodiment may be
80 micro seconds.
[0246] In an especially preferred embodiment fusion with direct
current may be using a direct current of 0.7 KV/cm for 80 micro
seconds.
[0247] An especially preferred embodiment of activation according
to the present invention may be use of an electrical pulse in
combination with subjecting the reconstructed embryo to agents that
inhibit protein synthesis, spindle body formation, and divalent
cations.
[0248] Activation may be performed by any combination of the
methods described above.
In Vitro Culture of Embryos
[0249] One aspect of the invention relates to a method of in vitro
culturing embryos, whereby the blastocyst rate increased to 25.3%.
Thus, a method of culturing a reconstructed embryo is within the
scope of the present invention, comprising the steps of a)
establishing at least one oocyte having at least a part of zona
pellucida, b) separating the oocyte into at least two parts
obtaining an oocyte having a nucleus and at least one cytoplast, c)
establishing a donor cell or cell nucleus having desired genetic
properties, d) fusing at least one cytoplast with the donor cell or
membrane surrounded cell nucleus, e) obtaining the reconstructed
embryo, f) activating the reconstructed embryo to form an embryo,
and e) culturing said embryo.
[0250] Another aspect of the invention relates to a method of cell
nuclear transfer in which a step of culturing the embryo is
included.
[0251] In a preferred embodiment in relation to the methods
described herein embryos are cultured in a sequential set of media.
Preferably the blastocysts are grown in traditional medium such as
for example NCSU37 or equivalent medium as known to a person
skilled in the art, wherein glucose is removed and substituted by
other agents. One agent may be pyruvate. Another agent may be
lactate. The agents may also be combined and replace glucose in the
traditional medium.
[0252] The embryos may be cultured in the substituted media as
described above from Day 0 to Day 3, such as from Day 0 to Day
2.
[0253] The pyruvate concentration may range from 0.05 to 1 mM, such
as 0.1 to 1 mM, for example 0.125 to 1 mM, such as 0.15 to 1 mM.
However the concentration of sodium pyruvate may also range from
0.05 mM to 0.9 mM, such as 0.05 to 0.8 mM, for example 0.05 to 0.7
mM, such as 0.05 to 0.6 mM, for example 0.05 to 0.5 mM, such as
0.05 to 0.4 mM, for example 0.05 to 0.3 mM, such as 0.05 to 0.2 mM.
Preferably the concentration ranges between 0.05 to 0.17 mM. A
preferred concentration of sodium pyruvate is 0.17 mM.
[0254] The lactate concentration may range from 0.5 to 10 mM, such
as 0.75 to 10 mM, for example 1 to 10 mM, such as 1.5 to 10 mM,
such as 1.75 to 10 mM, for example 2 to 10 mM, such as 2.5 to 10
mM. However the concentration of sodium lactate may also range from
0.5 mM to 9 mM, such as 0.5 to 8 mM, for example 0.5 to 7 mM, such
as 0.5 to 6 mM, for example 0.5 to 5 mM, such as 0.5 to 4 mM, for
example 0.5 to 03 mM. Preferably the concentration ranges between 1
to 5 mM, such as 2 to 4 mM, for example 2 to 3 mM. A preferred
concentration of sodium lactate is 2.73 mM.
[0255] After the initial glucose-free incubation medium glucose is
again replacing the pyruvate and lactate. The embryos may be
cultured in the glucose containing medium from Day 4 to Day 3,
preferably from Day 3 to Day 7. The glucose concentration may range
from 1 to 10 mM, such as 2 to 10 mM, for example 3 to 10 mM, such
as 4 to 10 mM, for example 5 to 10 mM. However, the glucose
concentration may also range from 1 to 9 mM, such as 2 to 8 mM, for
example 3 to 7 mM, such as 4-6 mM. A preferred concentration of
glucose according to the present invention is 5.5 mM of
glucose.
Organ or Tissue Donation
[0256] In one embodiment, the animals of the invention may be used
as a source for organ or tissue donation for humans or other
animals, either animals of the same species or animal of other
species. Transfer between species is usually termed
xenotransplantation. Entire organs that may be transplanted include
the heart, kidney, liver, pancreas or lung. Alternatively, parts of
organs, such as specific organ tissues may be transplanted or
transferred to humans or other animals. In a yet further
embodiment, an individual cell or a population of individual cells
from an animal of the invention may be transferred to a human being
or another animal for therapeutic purposes.
Cryopreservation
[0257] The term `cryopreserving` as used herein can refer to
vitrification of an oocyte, cytoplast, a cell, embryo, or pig of
the invention. The temperatures employed for cryopreservation is
preferably lower than -80 degree C., and more preferably at
temperatures lower than -196 degree C. Oocytes, cells and embryos
of the invention can be cryopreserved for an indefinite amount of
time. It is known that biological materials can be cryopreserved
for more than fifty years.
[0258] It is within the scope of the present invention that embryos
may be cryopreserved prior to transfer to a host pig when employing
methods for producing a genetically engineered or transgenic
non-human mammal. Such cryopreservation prior to transfer may be at
the blastocyst stage the of embryo development. Vitrification is a
form of cryopreservation where living cells are rapidly cooled so
that the fluid of the cell does not form into ice. Thus,
vitrification relates to the process of cooling where cells or
whole tissues are preserved by cooling to low sub-zero
temperatures, such as (typically) -80 C or -196 C
[0259] In particular the invention relates to the vitrification of
an oocyte, however, the invention also relates to the vitrification
of embryos, preferably embryos at the blastocyst stage. In one
embodiment, the embryo is cultured to blastocyst stage prior to
vitrification.
[0260] Especially pig embryos are covered by the present invention.
Also vitrified cytoplasts are covered by the present invention, as
are cells.
[0261] Yet another aspect of the invention relates to the
cryopreservation of a pig embryo derived by a method for cell
nuclear transfer as described herein comprising a step of
vitrifying a pig embryo. A further aspect of the invention relates
to pig embryos obtained, or obtainable by the methods provided
herein.
Mitochondria
[0262] Cells of the tissue of the genetically modified non-human
mammals and/or non-human embryos obtainable by the present
invention may harbour mitochondria of different maternal sources.
In a preferred embodiment the non-human mammals and/or non-human
embryos may harbour mitochondria from only one maternal source,
However, in another preferred embodiment the non-human mammals
and/or non-human embryos may harbour mitochondria from at least two
maternal sources, such as three maternal sources, for example four
maternal sources, such as five maternal sources, for example six
maternal sources, such as seven maternal sources, for example eight
maternal sources, such as nine maternal sources, for example ten
maternal sources. The probability of having a specific number of
maternal sources can be calculated based on the observed types of
mitochondria.
EXAMPLES
[0263] Based on the well-described mechanisms of SB transposition
(4-8) and Flp recombination (9, 10), the present invention
discloses a new target vector for site-specific integration into
the genome. This vector carries within the context of a SB
transposon vector a bicistronic gene cassette containing (i) the
FRT recombination site embedded in the coding sequence of eGFP and
(ii) an IRES-driven puromycin resistance gene. We demonstrate
efficient selective plasmid insertion into SB-tagged genomic loci.
In an attempt to further improve the performance of these vectors,
we have analyzed the effect of insulator elements, believed to
protect inserted foreign genes against transcriptional silencing,
within the context of SB vectors. Our investigations indicate that
insulators flanking the FRT gene expression cassette may serve to
maintain and stabilize gene expression of Flp-inserted
transgenes.
[0264] Two nonviral integration technologies are employed in the
present invention, the SB transposon system and the Flp
recombinase, in a combined effort to achieve active locus
detection, mediated by SB, and site-directed insertion at an
attractive site, mediated by Flp. A bi-phased technology is
disclosed in which an integrating SB vector, carrying a reporter
gene and a selective marker gene, may first serve as a reporter for
continuous gene expression and hence as a target for gene insertion
(FIG. 1). By using an actively integrated vector as opposed to
plasmid DNA that is randomly recombined into the genome we certify
(i) that only a single copy, and not concatemers, of the vector are
inserted and, moreover, (ii) that the reporter cassette is not
flanked by sequences derived from the bacterial plasmid backbone
which may have a detrimental effect on the locus activity over
time. In a second modification step this vector may serve as a
target for insertion of one or more gene expression cassettes in a
well-characterized locus.
DNA Transposon-Based Genomic Insertion of Recombinase Recognition
Sites
[0265] Epigenetic modifications leading to transcriptional
silencing of inserted foreign DNA are major challenges in
strategies for genetic manipulation of cell lines and transgenic
animals. Hence, both the identification of active genomic loci
which support continuous, undisturbed gene expression and
development of genetic tools to insert genes of interest
site-specifically at these preferred loci are key aims in genetic
engineering. We use in this study two nonviral integration
technologies, the SB transposon system and the Flp recombinase, in
a combined effort to achieve active locus detection, mediated by
SB, and site-directed insertion at an attractive site, mediated by
Flp. We describe a bi-phased technology in which an integrating SB
vector, carrying a reporter gene and a selective marker gene, may
first serve as a reporter for continuous gene expression and hence
as a target for gene insertion (FIG. 1). By using an actively
integrated vector as opposed to plasmid DNA that is randomly
recombined into the genome we certify (i) that only a single copy,
and not concatemers, of the vector are inserted and, moreover, (ii)
that the reporter cassette is not flanked by sequences derived from
the bacterial plasmid backbone which may have a detrimental effect
on the locus activity over time.
[0266] In a second modification step this vector may serve as a
target for insertion of one or more gene expression cassettes in a
well-characterized locus (FIG. 1B).
The Transgenic Model System
[0267] To circumvent the problems existing for random transgenesis
in terms of copy numbers and variable insertion position we
examined the possibility to perform controlled transgenesis for the
future generation of cloned transgenic pigs by SCNT. The strategy
was to insert a model gene-cassette into the porcine genome by use
of a SB transposon-derived vector and subsequently use the Flp
recombinase recognition site within the cassette to introduce a
transgene and selection marker through a specific recombination
event.
[0268] A transposon, pSBT/SV40-FGIP, was constructed for the use in
porcine transgenesis. For a schematic description of the construct
see FIG. 2A. The enhanced green fluorescent protein (eGFP) gene was
linked to a puromycin resistance gene through an internal ribosome
entry site (IRES). This bicistronic gene cassette was placed under
control of the SV40 promoter. The original start codon of the eGFP
gene was replaced by a start codon located upstream of an inserted
FRT site. We have previously shown that this fusion variant of the
eGFP gene encodes fluorescent protein [28]. The FRT site is
positioned immediately after the SV40 promoter and should enable
Flp-mediated recombination. If such a recombination event is
successful the eGFP and puromycin resistance genes will be removed
from the promoter context and rendered inactive. The plasmid DNA
inserted at the FRT site thus can be constructed such that the
expression of a novel selection marker, the hygromycin B resistance
gene (hygro.sup.R), is dependent of the ATG start codon already
present upstream from the FRT site located in the transposon (FIG.
2B). This selection marker exchange will allow selecting for only
correct and site-directed recombination events. By including a gene
of interest, here the DsRed marker gene under control of the
cytomegalovirus (CMV) promoter, as a new transgenic unit on the
plasmid carrying the FRT-hygro fusion gene, a colour shift from
green to red can be monitored as a result of successful
recombination.
[0269] The pSBT/RSV-GFIP Vector was Constructed as Follows:
[0270] The pSBT/RSV-GFIP vector contains the terminal inverted of
the SB DNA transposon flanking a FRT-GFP.IRES.puro bicistronic gene
cassette driven by a promotor derived from Rous sarcoma virus
(RSV). The eGFP sequence was amplified from peGFP.N1 (Clontech)
using a forward primer containing the 48-bp FRT sequence. To
analyze FRT-GFP functionality, the FRT-eGFP fusion was inserted
into an expression vector containing the SV40 promoter. The
PCR-fragment containing FRT-tagged eGFP fusion gene was digested
with MluI and XmaI and inserted into MluI/XmaI-digested
pSBT/RSV-hAAT (pT/hAAT in ref. (8), obtained from Mark Kay,
Stanford University, USA), generating a transposon vector with
RSV-driven eGFP expression (pSBT/RSV-eGFP). An IRES-puro cassette
was PCR-amplified from pecoenv-IRES-puro (provided by Finn Skou
Pedersen, University of Aarhus, Denmark), digested with XmaI, and
inserted into XmaI-digested pSBT/RSV-eGFP, generating pSBT/RSV-GFIP
(see sequence listing). Alternative versions of this vector
containing the SV40 promoter (pSBT/SV40-GFIP) and the promoter
derived from the human ubiquitin gene (pSBT/Ubi-GFIP), were
generated. In addition, by inserting a Cre recombination target
site (IoxP) into the MluI site located between the left inverted
repeat of the transposon and the SV40 promoter of pSBT/SV40-GFIP,
the vector pSBT/SV40-GFIP.IoxP was created. The donor plasmid
pcDNA5/FRT, containing a FRT-hygro fusion gene without a start
codon, was obtained from Invitrogen. The Flp-encoding plasmid,
pCMV-Flp was obtained from A. Francis Stewart, University of
California San Francisco, USA). This plasmid encodes the enhanced
Flp variant designated Flpx9 (11). A SB-vector containing two
copies of the 1.2-kb chicken DNase hypersensitive site 4
(cHS4)-derived insulator element (12, 13) was generated by
inserting PCR-amplified cHS4 sequences and an intervening linker
into NotI/SpeI-digested pSBT/PGK-puro (obtained from Mark Kay,
Stanford University, USA). The PGK-puro cassette was cloned back
into construct by using restriction sites located in the linker,
generating pSBT/cHS4.PGK-puro.cHS4. All self-inactivating (SIN)
lentiviral vector constructs were derived from
pCCL.WPS.PGK-eGFP.WHV obtained from Dr. Aebischer, Swiss Federal
Institute of Technology, EPFL, Lausanne, Switzerland. The puromycin
resistance gene was amplified by PCR and inserted in
pCCL.WPS.PGK-eGFP.WHV downstream from the promoter, generating
pCCL.WPS.PGK-puro.WHV The FRT-hygro fusion gene was PCR-amplified
from pcDNA5/FRT and inserted into the HpaI site (located between 4)
and cPPT cis elements) of pCCL.WPS.PGK-puro.WHV, generating
pLV/FRT-hygro.PGK-puro. To generate pLV/PGK-Flp the Flp gene was
PCR-amplified from pCMV-Flp, digested with BamHI/XhoI, and inserted
into BamHI/XhoI-digested pCCL.WPS.PGK-puro.WHV.
Transposition of FRT-Tagged SB Vectors
[0271] To be able to easily follow the activity of SB-tagged loci
in modified cells, we constructed SB transposon vectors
(pSBT/SV40-GFIP, pSBT/SV40-GFIP.IoxP, pSBT/RSV-GFIP) containing a
bicistronic gene expression cassette encoding eGFP and the
puromycin resistance gene. We inserted the 48-bp Flp recombination
target sequence (FRT) immediately downstream from the eGFP start
codon, generating a fusion gene encoding FRT-tagged eGFP. Transient
expression studies demonstrated comparable levels of activity of
the eGFP and FRT-eGFP proteins (data not shown). We tested first
the transposition efficiency of pSBT/RSV-GFIP by co-transfecting
with pCMV-SB and pCMV-mSB, respectively, in HEK-293 cells. As
expected the GFIP transposon was efficiently transposed into the
genomic DNA thereby conferring resistance to puromycin (FIG. 3). As
an alternative strategy, optimized for use in hard-to-transfect
cell lines, we generated a helper-independent
transposon-transposase (HITT) vector (the concept first
demonstrated by Mikkelsen et al. in (6)) in which the
GFIP-containing transposon and the SB expression cassette were
located on a single plasmid. Transposition assays using this HITT
configuration showed high levels of transposition in HeLa cells
(data not shown). By analysis of puromycin-resistant colonies
generated with two-plasmid transfections, stable eGFP expression
was verified by fluorescence microscopy (FIG. 3, insert),
demonstrating functionality of both vector genes. Three
puromycin-resistant clones, HEK-GFIP1, HEK-GFIP2, and HEK-GFIP3,
obtained by insertion of SBT/SV40-GFIP.IoxP, SBT/SV40-GFIP, and
SBT/RSV-GFIP transposons, respectively, were isolated and expanded
for further analysis.
[0272] The target transposon SBT/RSV-GFIP was inserted into the
genome of HEK-293 cells by co-transfecting (using Fugene-6 from
Roche) 1.5 .mu.g pSBT/RSV-GFIP with 1.5 .mu.g pCMV-SB (or 1.5 .mu.g
pCMV-mSB as a negative control). pCMV-SB, obtained from Perry
Hackett, University of Minnesota, Minnesota, USA, encodes the
Sleeping Beauty transposase reconstructed from fossil DNA
transposable elements of salmoid fish. SB-tagged cell clones were
generated by selecting transfected cells with puromycin (1
.mu.g/ml). Clones were isolated and expanded and utilized as target
clones for Flp-mediated gene insertion. To demonstrate
site-specific insertion of transfected plasmid DNA 12 .mu.g
pCMV-Flp was co-transfected (by CaPO.sub.4) with either (i) 3 .mu.g
pcDNA5/FRT or (ii) 3 .mu.g pLV/FRT-hygro.PGK-puro into
SBT/RSV-GFIP-tagged HEK-293 cells. To select for site-specific
insertions cells were grown in medium containing hygromycin B (200
.mu.g/ml).
Cloning of Constructs
[0273] Vectors expressing different variants of the SB transposase
were generated by inserting PCR-amplified transposase sequences
into the pcDNA3.1D/V5.His.Topo vector (Invitrogen, Carlsbad,
Calif.). SB sequences utilized to generate pCMV-mSB.Topo,
pCMV-SB.Topo or the pCMV-HSB3.Topo mSB, SB10, and HSB3 sequences
were derived from pCMV-mSB (Yant S R, Meuse L, Chiu W, Ivics Z,
Izsvak Z, Kay M A: Somatic integration and long-term transgene
expression in normal and haemophilic mice using a DNA transposon
system. Nat Genet. 2000, 25(1):35-41), pCMV-SB (Yant S R, Meuse L,
Chiu W, Ivics Z, Izsvak Z, Kay M A: Somatic integration and
long-term transgene expression in normal and haemophilic mice using
a DNA transposon system. Nat Genet. 2000, 25(1):35-41), and
pCMV-HSB3 (Yant S R, Park J, Huang Y, Mikkelsen J G, Kay M A:
Mutational analysis of the N-terminal DNA-binding domain of
sleeping beauty transposase: critical residues for DNA binding and
hyperactivity in mammalian cells. Mol Cell Biol 2004,
24(20):9239-9247), respectively. The SB-based docking vector,
pSBT/SV40-FGIP, was generated from pSBT/RSV-FGIP (Moldt B,
Staunstrup N H, Jakobsen M, Yanez-Munoz R J, Mikkelsen J G:
Site-directed genomic insertion of lentiviral DNA circles,
Submitted for publication) by replacing the RSV promoter with a
PCR-amplified SV40 promoter. pSBT/PGK puro has been described
previously (Yant S R, Meuse L, Chiu W, Ivics Z, Izsvak Z, Kay M A:
Somatic integration and long-term transgene expression in normal
and haemophilic mice using a DNA transposon system. Nat Genet.
2000, 25(1):35-41). To generate the transgene donor plasmid,
designated pFRT/hygro.CMV-DsRed, the red fluorescence protein gene
(RFP) was derived from pDS-red-N1 by cleavage with HindIII and NotI
restriction enzymes. The RFP gene was inserted into the pcDNA5/FRT
vector (Invitrogen, Carlsbad, Calif.).
Transposition Assays and Flp Recombination
[0274] 2.6.times.10.sup.4 NPFs, HEK293 cells, or NIH3T3 cells,
seeded in 6-well dishes, were co-transfected with 0.5 .mu.g plasmid
DNA carrying the transposon (SBT/PGK-puro or SBT/SV40-FGIP) and 0.5
.mu.g of pCMV-mSB.Topo, pCMV-wt-SB.Topo, or pCMV-HSB3.Topo.
Transfections were performed with Fugene-6 (Roche, Basel,
Switzerland) according to the manufacturer's instructions.
Transgenic NPF colonies harboring SBT/SV40-FGIP were harvested
after 9 days of puromycin selection. Solitary colonies were scraped
off with a glass pasteur pipette and transferred to 96-well dishes.
The cells were expanded and used for studies of Flp recombination
or handmade cloning. All transposition experiments were carried out
in triplicates and cell colonies were counted after staining the
colonies in methylene blue after 9 days of puromycin selection. Flp
recombination was carried out as follows: for neonatal pig
fibroblasts (NPFs), pools of clones containing the SBT/SV40-FGIP
transposon were co-transfected with 5.5 ug of the FLP recombinase
expression vector (pOG44; Invitrogen, Carlsbad, Calif.) and 0.5
.mu.g donor plasmid using Fugene-6 as transfection reagent. On the
following the day, cells were washed with PBS and starting from day
two after transfection the cells were grown in medium containing
400 ug/.mu.l hygromycin B for 11 days. Selection was carried out
for 11 days prior to harvesting of the cells and DNA purification.
PCR using genomic DNA from pooled NPFs as template was performed to
verify Flp recombination. A forward primer located downstream from
LIR and a reverse primer located at the beginning of the
hygro.sup.R gene was used to amplify the fragment of interest. The
presence of a precise junction between the SV40 promoter and the
hygro.sup.R gene was confirmed by sequencing of the PCR fragment.
For studies in HEK293 and NIH3T3 cells, 8.times.10.sup.5 cells
seeded in 10-cm dishes were co-transfected with 1 ug of donor
plasmid and 9 ug of pOG44 by treating the cells with calcium
phosphate. The transfection mixture was left on the cells overnight
and 1.times.10.sup.5 cells were subsequently seeded in 70 cm.sup.2
bottles and subjected to hygromycin B (200 ug/.mu.l) selection for
11 days. Cell colonies were stained with methylene blue prior to
counting of the colonies.
Sleeping Beauty (SB) Transposition in Neonatal Porcine Fibroblasts
(NPFs)
[0275] The applicability of SB transposition in pig fibroblasts was
tested in NPFs derived from a skin biopsy from a male Gottingen
minipig (Ellegaard Gottingen Minipigs ApS) using a 2-kb long SB
transposon designated SBT/PGK-puro (FIG. 4A). In pSBT/PGK-puro, the
SB inverted repeats (IRs) flank an expression cassette consisting
of the puromycin resistance gene driven by the phosphoglycerate
kinase (PGK) promoter. pSBT/PGK-puro was co-transfected into NPFs
with plasmid encoding either of three different SB transposase
variants including a mutated inactive form (mSB), the original
SB10, and the hyperactive version HSB3 encoded by pCMV-mSB.Topo,
pCMV-SB10.Topo, and pCMV-HSB3.Topo, respectively. After 9 days of
puromycin selection fibroblast colonies were stained with methylene
blue. The formation of colonies was highly enhanced by
co-transfection with a functional transposase (FIG. 4B), and the
hyperactive transposase generated two-fold more colonies than SB10
(FIG. 4B). We therefore conclude that SB mobilization and
transposase-dependent transgenesis is highly efficient in NPFs.
[0276] SB transposition is strongly influenced by the transposon
length (Izsvak Z, Ivics Z, Plasterk R H: Sleeping Beauty, a wide
host-range transposon vector for genetic transformation in
vertebrates. J Mol Biol 2000, 302(1):93-102). To test if the 3.3 kb
long SBT/SV40-FGIP transposon (FIG. 2A) was efficiently inserted
into the genome of NPFs primary cells were co-transfected with
pSBT/SV40-FGIP and plasmid DNA encoding mSB, SB10, and HSB3,
respectively. In this experiment we also included the murine
fibroblast cell line NIH3T3 and the human kidney cell line HEK-293,
as these two cell lines represent well-described cell types in
which transposase-dependent gene insertion already has been
described. Moreover, as NPFs are primary cells and have a short
division potential, analyses that require long term growth in
culture are not possible. The colony formation assay in HEK-293
cells showed a transposase-dependent increase in the number of
puromycin-resistant colonies. The colony number was further
increased by the hyperactive transposase (FIG. 5A). Similar results
were obtained in NIH3T3 cells (FIG. 5B). Fluorescence microscopy
analyses confirmed that colonies resulting from SBT/SV40-FGIP
transposition expressed eGFP (FIG. 5, right panels and data not
shown).
[0277] In NPFs, we again observed transposase-dependent formation
of colonies. Compared to the shorter pSBT/PGK-Puro transposon, we
consistently measured a decrease in colony forming efficiency for
pSBT/SV40-FGIP (FIG. 4B versus FIG. 5C). This result is in
accordance with previous findings showing that the efficiency of
transposase-mediated transgenesis depends on the length of the
insert between the IRs. Fluorescence microscopy of
puromycin-resistant NPF colonies confirmed that all cells expressed
eGFP (FIG. 5C, right). By comparing the extent of colony formation
in the presence of active versus inactive transposase, our data
suggest that the transposition efficiency in NPFs is comparable to
the efficiencies measured in the NIH3T3 and HEK293 cell lines. We
therefore conclude that the pSBT/SV40-FGIP vector is suitable for
gene transfer in pig primary cells.
Transgene Substitution by Flp Recombination
[0278] Next, we wanted to examine the possibility of using the FRT
site to substitute transgenes within porcine cells. For this
purpose cells from clones containing the pSBT/SV40-FGIP transposon
were re-transfected with an expression vector for Flp recombinase
and the donor vector, pFRT/hygro.CMV-DsRed, which carries a new set
of transgenes including the gene encoding DsRed driven by a CMV
promoter and a promoter-less hygromycin gene lacking a start codon
and flanked upstream by an FRT site (FIG. 1B). Flp-mediated
recombination is expected to activate the expression of the
hygromycin B resistance gene by inserting the ATG-less hygro gene
downstream from the SV40 promoter and the ATG-FRT cassette located
in the SBT/SV40-FGIP transposon (FIG. 2B).
[0279] At first, we examined for the occurrence of hygromycin
B-resistant clones after selection for recombination. To test the
functionality of the recombination system we addressed the
recombination in NIH3T3 and HEK293 cells which are
well-characterized for Flp-mediated recombination. Cells derived
from three different NIH3T3 clones containing the SBT/SV40-FGIP
transposon were analyzed. For all three cell lines a Flp-dependent
occurrence of hygromycin B-resistant colonies was observed,
indicting that the correct recombination event was possible in the
context of the inserted transposon (FIG. 6A). A similar experiment
in HEK293 cells also showed a Flp-dependent appearance of
hygromycin B-resistant colonies (FIG. 6B). Thus,
recombinase-mediated insertion of the hygromycin B resistance gene
is possible in the context of the vectors used. Coupled to
insertion of the hygro.sup.R gene is the removal of the puromycin
resistance gene from the promoter sequence and the flanking
ATG-start codon. Thus, Flp-mediated recombination should result in
sensitivity towards puromycin selection of the cells. Indeed, in
HEK-293 cells we observed that the cells became sensitive to
puromycin after Flp-mediated recombination (data not shown). To
substantiate the data concerning Flp recombination we identified
the transposon insertion site in one of clones by ligation-mediated
PCR. Using primers flanking the borders of the inserted FRT/hygro
plasmid, we could verify precise insertion into the FRT site of the
inserted SB transposon (data not shown).
[0280] In NPFs, we were unable to detect the formation of
hygromycin B-resistant colonies in a colony-forming assay. However,
we note that this cannot be attributed to the lack of the correct
recombination but is a consequence of the lack of sufficient cell
passage potential of these primary cells, which already had been
through one round of selection. As an alternative approach, we
performed a PCR analysis on genomic DNA of transfected NPFs to
screen for the presence of insertions at an early stage before
colony formation. The PCR analysis was performed on isolated
genomic NPF DNA with a forward primer within the left IR of the
SBT/SV40-FGIP transposon and a reverse primer in the hygro.sup.R
gene. This primer combination should amplify a 700-bp fragment only
if the recombination event has happened. Indeed such a fragment
could be amplified from transgenic NPF cells co-transfected with
the donor plasmid and the vector expressing Flp (FIG. 6C). In cells
which were transfected with FRT-donor plasmid only, we could not
detect 700-bp band, indicating that this band is indeed a result of
the specific Flp-directed recombination event. Sequencing of this
fragment confirmed that precise insertions mediated by Flp in NPFs
had occurred with the expected sequence specificity within the FRT
site. Thus, we conclude that NPFs can support Flp-mediated
recombination with resulting alterations in transgene expression
profiles.
[0281] In addition to selection marker exchange a Flp recombination
event within the docking vector should result in a shift of
expression from eGFP to DsRed. To monitor the presence of such a
colour exchange, we examined a HEK-293-derived cell clone (clone 4)
by epifluorescence analysis. Prior to transfection with the
DsRed-encoding donor plasmid and the Flp expression vector, HEK-293
cells containing the integrated SBT/SV40-FGIP transposon showed a
clear green fluorescent signal (FIG. 6D). Two days after
transfection the cells expressed both DsRed and eGFP as a result of
transient presence of the DsRed expression vector after
transfection. Cells were grown under hygromycin B selection and at
6 and 11 days after transfection the eGFP signal had disappered and
only DsRed expression could be monitored, supporting the notion
that expression of the eGFP and DsRed transgenes had been shifted
within the integrated transposon of clone 4 (FIG. 6D, panel 1
through 5). Similarly, stable DsRed expression could be monitored
in transfected transposon-tagged NPFs only when Flp had been
present (FIG. 6E), although these cells could not form hygromycin
B-resistant colonies due to their limitated passaging
potential.
Transgenic NPFs Give Rise to Viable Porcine Blastocysts
[0282] Due to the limited lifespan of the NPF cells, the porcine
master cell line transgenic for the SBT/SV40-FGIP transposon could
not be used for insertion of other transgenes in a second round of
selection, and thus prevented us from demonstrating transgene
insertion at a defined position in the NPF genome. Formal proof
would therefore require generation of cloned `master pigs` carrying
the SBT/SV40-FGIP insertion and studies of gene insertion in
primary cells derived from these pigs. We therefore examined the
possibility of generating SBT/SV40-FGIP-transgenic animals from
which cells with regained growth potential can be derived and used
for Flp-mediated recombination and a subsequent second round of
cloning. To this end we here addressed the question if transgenic
NPFs have potential to generate transgenic blastocysts by the use
of HMC-directed SCNT. After SB transposition using the
pSBT/SV40-FGIP vector and selecting with puromycin for 9 days, NPF
clones were isolated, expanded to about 1.times.10.sup.5 cells and
stored at -135.degree. C. All clones expressed eGFP (FIG. 7A).
Batches of cells were thawed and used for handmade cloning. Viable
blastocysts were obtained. Fluorescent analysis showed that the
blastocysts expressed eGFP in all cells (FIG. 7B). Thus,
SBT/SV40-FGIP-transgenic NPFs are applicable for cloning by SCNT
and expression of the transgene is maintained in both the inner
cell mass and the trophoblast layer at the blastocyst stage of
development.
Handmade Cloning (HMC) and Establishment of Pregnancies
[0283] Handmade cloning was performed as described herein. Briefly,
oocytes with partially digested zona pellucida were enucleated by
oriented bisection according to the position of the polar body. The
part of the oocytes without chromatin, i.e. the cytoplasts, was
collected and electrofused with transgenic NPFs. Another cytoplast
was electrofused with each cytoplast-fibroblast pair during a
second round of fusion which also activated the reconstructed
embryos and transgenic blastocysts developed after 7 days of in
vitro culture.
[0284] For the cloning and delivery of transgenic piglets,
transgenic donor cells as described herein were used in HMC. Except
where otherwise indicated all chemicals were obtained from Sigma
Chemical Co. (St Louis, Mo., USA).
Oocyte Collection and In Vitro Maturation (IVM)
[0285] Cumulus-oocyte complexes (COCs) are aspirated from 2 to 6 mm
follicles from slaughterhouse-derived sow ovaries and matured in
groups of 50 in 400 .mu.l IVM medium consisting of
bicarbonate-buffered TCM-199 (GIBCO BRL) supplemented with 10%
(v/v) cattle serum (CS), 10% (v/v) pig follicular fluid, 10 IU/ml
eCG, 5 IU/ml hCG (Suigonan Vet; Skovlunde, Denmark) at 38.5.degree.
C. in 5% CO.sub.2 in humidified air in the Submarine Incubation
System (SIS; Vajta et al., 1997) for 41-44 h.
[0286] HMC is performed by a procedure based on partial digestion
of the zona pellucida, as described earlier (Du et al., 2005 and
2007). Matured COCs was freed from cumulum cells in 1 mg/ml
hyaluronidase in Hepes-buffered TCM-199. From this point (except
where otherwise indicated) all manipulations are performed on a
heated stage adjusted to 39.degree. C., and all drops used for
handling oocytes were of 20 .mu.l covered with mineral oil. Zonae
pellucidae of are partially digested with 3.3 mg/ml pronase
solution dissolved in T33 (T for Hepes-buffered TCM 199 medium; the
number means percentage (v:v) of CS supplement, here 33%) for 20 s,
then oocytes are washed quickly in T2 and T20 drops. Oocytes with
distended and softened zonae pellucidae are lined up in T20 drops
supplemented with 2.5 .mu.g/ml cytochalasin B. With a finely drawn
glass pipette, oocytes are rotated to locate the polar body on the
surface. By oriented bisection with an Ultra Sharp Splitting Blade
(AB Technology, Pullman, Wash., USA) less than half of the
cytoplasm close to the polar body is removed manually from the
remaining putative cytoplast.
[0287] Transgenic donor fibroblasts grown to a confluent monolayer
in DMEM supplemented with 10% FCS are trypsinized and kept in T20
(Kragh et al., 2004). Fusion is performed in two steps. For the
first step, 50% of the available cytoplasts were transferred into 1
mg/ml of phytohemagglutinin (PHA; ICN Pharmaceuticals, Australia)
dissolved in T0 for 3 s, then each one is quickly dropped over a
single APPsw transgenic fibroblast. After attachment,
cytoplast-fibroblast cell pairs are equilibrated in fusion medium
(0.3 M mannitol and 0.01% PVA) for 10 s and transferred to the
fusion chamber (BTX microslide 0.5 mm fusion chamber, model 450;
BTX, SanDiego, Calif., USA). Using an alternating current (AC) of
0.6 kV/cm and 700 kHz, pairs are aligned to the wire of a fusion
chamber with the somatic cells farthest from the wire, then is
fused with a direct current of 2.0 kV/cm for 9 .mu.s. After the
electrical pulse, cell pairs are incubated in T10 drops to observe
whether fusion has occurred.
[0288] Approximately 1 h after the first fusion, each pair is fused
with another cytoplast and activated simultaneously in activation
medium (0.3 M mannitol, 0.1 mM MgSO.sub.4, 0.1 mM CaCl.sub.2 and
0.01% PVA). By using an AC of 0.6 kV/cm and 700 kHz, one fused pair
and one cytoplast is aligned to one wire of the fusion chamber,
with fused pairs contacting the wire, followed by a single DC pulse
of 0.85 kV/cm for 80 .mu.s. When fusion is observed in T10 drops,
reconstructed embryos are transferred into porcine zygote medium 3
(PZM-3; Yoshioka et al., 2002) supplemented with 5 .mu.g/ml
cytochalasin B and 10 .mu.g/ml cycloheximide. After a 4 h
incubation at 38.5.degree. C. in 5% CO.sub.2, 5% O.sub.2 and 90%
N.sub.2 with maximum humidity, embryos are washed three times in
PZM-3 medium before culture
Embryo Culture and Transfer
[0289] Embryos are cultured at 38.5.degree. C. in 5% CO.sub.2, 5%
O.sub.2 and 90% N.sub.2 with maximum humidity in PZM-3 medium in
the well of well system (WOWs; Vajta et al., 2000). Day 5 and 6
blastocysts with clearly visible inner cell mass are surgically
transferred to Danish landrace sows on day 4 or 5 after weaning.
Pregnancies are diagnosed by ultrasonography on day 21 and
confirmed every second week. Piglets are delivered by Caesarean
section on day 114, 24 h after treatment with prostaglandin F2.
Flp-Based Plasmid Insertion into Integrated SB Vectors
[0290] To facilitate Flp-based gene insertion into integrated SB
vectors HEK-GFIP1, HEK-GFIP2, and HEK-GFIP3 were co-transfected
with pcDNA/FRT (containing the FRT-hygro fusion gene) and
pCMV-Flpx9. Upon subsequent hygromycin B selection 312, 53, and
1800 drug-resistant colonies appeared in the three cell lines.
(FIG. 8). Notably, for each of the three cell lines co-transfection
with pUC19 instead of pCMV-Flpx9 did not result in colony
formation, indicating that there was no background of false
positives in the system. Subsequent PCR and sequence analysis
confirmed correct Flp-based gene insertion (data not shown). We are
currently investigating whether the variable number of hygromycin
B-resistant colonies obtained is a result of different properties
of the transposons used or perhaps variable SB copy numbers in the
three cell lines.
[0291] Vector construction and procedure: The target transposon
SBT/RSV-GFIP was inserted into the genome of HEK-293 cells by
co-transfecting (using Fugene-6 from Roche) 1.5 .mu.g pSBT/RSV-GFIP
with 1.5 .mu.g pCMV-SB (or 1.5 .mu.g pCMV-mSB as a negative
control). pCMV-SB, obtained from Perry Hackett, University of
Minnesota, Minnesota, USA, encodes the Sleeping Beauty transposase
reconstructed from fossil DNA transposable elements of salmoid
fish. SB-tagged cell clones were generated by selecting transfected
cells with puromycin (1 .mu.g/ml). Clones were isolated and
expanded and utilized as target clones for Flp-mediated gene
insertion. To demonstrate site-specific insertion of transfected
plasmid DNA 12 .mu.g pCMV-Flp was co-transfected (by CaPO.sub.4)
with either (i) 3 .mu.g pcDNA5/FRT or (ii) 3 .mu.g
pLV/FRT-hygro.PGK-puro into SBT/RSV-GFIP-tagged HEK-293 cells. To
select for site-specific insertions cells were grown in medium
containing hygromycin B (200 .mu.g/ml).
Gene-Flanking Insulators Stabilize Gene Expression from Integrated
Transposons.
[0292] In ongoing work we have demonstrated that expression from
integrated SB-vectors, depending on the site of integration, can be
transcriptionally silenced over time. Such silenced vectors can be
re-activated by treating vector-containing cells with 5-azacytidine
or trichostatin A indicating that epigenetic changes at the
targeted locus are responsible for silencing. Based on these
findings we flanked the gene expression cassette of these vectors
with cHS4 insulators and monitored the effect on gene expression
stability. Interestingly, we found in transposition assays, carried
out in F9 embryonal carcinomal cells, that insulation of the
PGK-puro cassette inside these transposons resulted in a dramatic
5-fold increase in the number of puromycin-resistant colonies
compared to numbers achieved with un-insulated vectors (data not
shown). These data strongly indicate that insulators stabilize gene
expression from transposed SB vectors and therefore insulators are
included in a novel generations of FRT-tagged SBT/GFIP vectors.
[0293] Strategies for Flp-based insertion of circular virus-derived
substrates. As long as genetically engineered cells are easy to
transfect supercoiled plasmid DNA is an efficient subtrate for
Flp-based gene insertion into the genome. To facilitate
site-specific gene insertion in hard-to-transfect cell lines or
tissues that are not easily transfected in vivo we wanted to
explore alternative substrates for site-specific recombination. We
focused on circular DNA intermediates that are generated during
lentivirus infection and which are often considered dead-end
reverse-transcribed products of infection. 2-LTR DNA circles are
generated by DNA repair and ligation of the full-length linear
viral DNA (FIG. 9, left), whereas 1-LTR DNA circles are generated
by homologous recombination between the two LTRs of the episomal
and linear viral DNA (FIG. 4, right). We hypothesized that these
circles, generated during lentiviral vector transduction, may
support Flp-based recombination, allowing site-specific integration
of DNA circles devoid of bacterial sequences (FIG. 9, bottom).
[0294] 1- and 2-LTR lentiviral DNA circles are efficient substrates
for site-specific gene insertion. To maximize circle formation and
accumulation we generated integration-defective lentiviral vectors
(ID-LVs) which contained a mutated inactive integrase protein. We
generated a lentiviral vector, pLV/FRT-hygro.PGK-puro, that
contains the FRT-hygro recombination sequence and found in
transduction titer assays that this vector was only slightly less
efficiently transferred in comparison to the original vector (FIG.
10). We then transfected HEK-GFIP3 cells with pCMV-Flpx9 and on the
following day transduced transfected cells with
ID-LV/FRT-hygro.PGK-puro at a MOI.about.100. Based on transfection
and transduction of about 10.sup.7 cells, we obtained in triplicate
assays on average approximately 20 hygromycin B-resistant colonies
(FIG. 11A). Background activity was not registered in cells
transfected with pUC19 prior to ID-LV/FRT-hygro.PG
K-puro-transduction.
[0295] PCR amplifications using as template genomic DNA from 10 of
the hygromycin B-resistant colonies verified that DNA circles had
been inserted site-specifically into SB-tagged loci (FIG. 11B). PCR
across the FRT integration site resulted in band sizes indicative
of specific gene insertion, whereas primers that amplified
sequences containing the LTR region(s) of the integrated circles
resulted in amplicons with either one or two LTRs (FIG. 11B).
Hence, 1-LTR and 2-LTR integrations each were detected in 5
separate clones. We conclude that lentiviral DNA circles can act as
substrates for Flp-based site-specific recombination.
[0296] ID-LV-encoded Flp supports Flp-based gene insertion. Based
on this finding we set out to test whether Flp likewise could be
delivered by ID-LVs. We therefore generated a lentiviral vector,
pLV/PGK-Flp containing a PGK-driven Flp gene and transduced
HEK-GFIP3 cells with ID-LV/PGK-puro at a MOI.about.100. Twenty four
hours post-transduction cells were transfected with a FRT-tagged
plasmid substrate (pcDNA5/FRT) and then treated with hygromycin B.
Again, we detected in triplicate experiments about 20
drug-resistant colonies (FIG. 12). In comparison, transfection with
pCMV-Flpx9 resulted in about 100 colonies, whereas transduction
with a Flp-less vector, ID-LV/PGK-eGFP, did not result in colony
formation. Flp-dependent colony formation in this assay indicates
that Flp, generated from ID-LVs, is sufficient to confer substrate
recombination and site-specific gene insertion.
[0297] ID-LV Co-Transduction Results In Site-Specific Lentiviral
DNA Circle Insertion.
[0298] We finally combined the actions of ID-LV/FRT-hygro and
ID-LV/PGK-Flpx9 vectors in one experiment by co-transducing
HEK-GFIP3 cells and selecting transduced cells for hygromycin B
resistance. In this setup we obtained on average 8 colonies per
transduction (FIG. 13), demonstrating that Flp encoded by an
integrating-defective vector facilitates insertion of lentiviral
DNA circles carrying the Flp recognition sequence. This finding
demonstrates for the first time site-specific insertion of
lentiviral vectors and confirm that DNA circles generated during
lentiviral transduction may serve as substrate for genomic
integration. By integrating viral circles rather than plasmid DNA,
we obtain insertions that are not potentially harnessed by
bacterial sequences derived from the plasmid backbone and,
moreover, pave the way for Flp-based gene insertions in
hard-to-transfect cell lines or tissues.
[0299] Transduction of Cells with Integration-Proficient and
-Deficient Lentiviral Vectors.
[0300] VSV-G-pseudotyped lentiviral vectors were generated by
co-transduction of 293T cells with 13 .mu.g pMDGPLg/RRE, 3 .mu.g
pRSV-Rev, 3.75 .mu.g pMD2G, and 13 .mu.g lentiviral vector plasmid.
Vector production plasmid were obtained from Dr. Aebischer, Swiss
Federal Institute of Technology, EPFL, Lausanne, Switzerland.
Integration-defective lentiviral vectors (ID-LV) were generated by
replacing pMDGPLg/RRE with pMDLg/pRREintD64V (obtained from Rafael
Yanez-Munoz, University College London, UK) in the transfection
mixture. pMDLg/pRREintD64V contains a point mutation in the
integrase coding sequence rendering the encoded integrase inactive
(14). Transduction titers of integration-proficient lentiviral
vectors carrying the PGK-puro cassette were determined by
transferring serially diluted supernatant from transfected 293T
cells to HEK-293 target cells prior to puromycin selection. Maximal
levels of lentiviral DNA circles were obtained by transducing
SB-tagged target clones with ID-LVs at estimated MOIs of 100-500.
In experiments involving transfected pCMV-Flp the cells were
transfected one day prior to transduction with
ID-LV/FRT-hygro.PGK-puro to ensure the presence of Flp at the time
of circle formation. In the reciprocal experiment in which Flp was
provided by lentiviral circles and plasmid DNA served as a
substrate for recombination the cells were transduced with
ID-LV/PGK-Flp one day prior to transfection. In
ID-LV/FRT-hygro.PGK-puro+ID-LV/PGK-Flp co-transduction experiments
the cells were simultaneously transduced with ID-LV/PGK-Flp and
ID-LV/FRT-hygro.PGK-puro. After transfection/transduction of
SBT/RSV-GFIP-tagged clones, cells were grown in medium containing
hygromycin B. In selected experiments hygromycin B-resistant
colonies were counted, isolated, expanded, and analyzed by
insert-specific PCRs. PCRs included (i) selective amplification of
sequences at the integration site and (ii) amplification of
inserted 1- and 2-LTR sequences generated during lentiviral DNA
circularization.
Construction of Alternative Vector and Transfer to Porcine
Fibroblasts
[0301] The SB transposon-based vector used in this study was
derived from the pSBT/SV40-GFIP.IoxP vector. This vector contains,
within the context of a SB transposon, a bicistronic
FRTeGFP-IRES-puro (GFIP) cassette flanked upstream by an ATG start
codon and downstream by a poly A sequence. Moreover, the vector
contains a recognition site for the Cre recombinase (IoxP) located
between the upper inverted repeat of the vector and the SV40
promoter driving expression of the FRTeGFP-IRES-puro cassette.
Construction of pSBT/SV40-GFIP.IoxP Vector
[0302] The pSBT/RSV-GFIP vector contains the terminal inverted of
the SB DNA transposon flanking a FRT-GFP.IRES.puro bicistronic gene
cassette driven by a promotor derived from Rous sarcoma virus
(RSV). The eGFP sequence was amplified from peGFP.N1 (Clontech)
using a forward primer containing the 48-bp FRT sequence. To
analyze FRT-GFP functionality, the FRT-eGFP fusion was inserted
into an expression vector containing the SV40 promoter. The
PCR-fragment containing FRT-tagged eGFP fusion gene was digested
with MluI and XmaI and inserted into MluI/XmaI-digested
pSBT/RSV-hAAT (pT/hAAT in ref. (8), obtained from Mark Kay,
Stanford University, USA), generating a transposon vector with
RSV-driven eGFP expression (pSBT/RSV-eGFP). An IRES-puro cassette
was PCR-amplified from pecoenv-IRES-puro (provided by Finn Skou
Pedersen, University of Aarhus, Denmark), digested with XmaI, and
inserted into XmaI-digested pSBT/RSV-eGFP, generating pSBT/RSV-GFIP
(see FIG. 14). Alternative versions of this vector containing the
SV40 promoter (pSBT/SV40-GFIP) and the promoter derived from the
human ubiquitin gene (pSBT/Ubi-GFIP), were generated. In addition,
by inserting a Cre recombination target site (IoxP) into the MluI
site located between the left inverted repeat of the transposon and
the SV40 promoter of pSBT/SV40-GFIP, the vector pSBT/SV40-GFIP.IoxP
was created. The donor plasmid pcDNA5/FRT, containing a FRT-hygro
fusion gene without a start codon, was obtained from Invitrogen.
The Flp-encoding plasmid, pCMV-Flp was obtained from A. Francis
Stewart, University of California San Francisco, USA). This plasmid
encodes the enhanced Flp variant designated Flpx9 (11). A SB-vector
containing two copies of the 1.2-kb chicken DNase hypersensitive
site 4 (cHS4)-derived insulator element (12, 13) was generated by
inserting PCR-amplified cHS4 sequences and an intervening linker
into NotI/SpeI-digested pSBT/PGK-puro (obtained from Mark Kay,
Stanford University, USA). The PGK-puro cassette was cloned back
into construct by using restriction sites located in the linker,
generating pSBT/cHS4.PGK-puro.cHS4
[0303] For further use in pigs an alternative Cre recognition site
(IoxP-257) was inserted into a unique AscI site that was created by
mutagenesis at a position located between the poly A sequence and
the lower inverted repeat of the vector. This vector was designated
pSBT/IoxP.SV40-GFIP.IoxP257. The presence of two Cre recombination
sites allows Cre recombinase-mediated cassette exchange after
Flp-based plasmid insertion, thereby facilitating, if needed,
removal of plasmid sequences and selection genes.
[0304] SB Transposition in Primary Pig Fibroblasts
[0305] The SB transposon vectors, either SBT/PGK-puro or the target
transposon SBT/IoxP.RSV-GFIP.IoxP257, were inserted into the genome
of pig fibroblast by co-transfecting (using Fugene-6 from Roche)
1.5 .mu.g pSBT/Iox.RSV-GFIP.IoxP257 (or pSBT/PGK-puro) with 1.5
.mu.g pCMV-SB (or 1.5 .mu.g pCMV-mSB as a negative control).
pCMV-SB (rights held by Perry Hackett, University of Minnesota,
Minnesota, USA) encodes the Sleeping Beauty transposase
reconstructed from fossil DNA transposable elements of salmoid
fish. pCMV-SB, pCMV-mSB, and the hyperactive variant pCMV-HSB3 were
obtained from Mark Kay, Stanford University, USA. SB-tagged cell
clones appeared as a result of selecting transfected cells with
puromycin (0.5 .mu.g/ml). Colonies were fixed and stained in
methylene blue in methanol and subsequently counted.
Solid SB Transposition in Primary Pig Fibroblasts
[0306] SB transposes efficiently in most mammal cells but with
higher efficacy in human cells than in murine cells. Transposition
of SB vectors has never been analyzed in porcine cells, and we
therefore initially tested activity in primary pig fibroblasts. We
utilized a standard transposon encoding a puromycin resistance gene
(SBT/PGK-puro) and found decent levels of transposition, resulting
in about 75 drug-resistant colonies in cultures of fibroblasts
co-transfected with pSBT/PGK-puro and pCMV-SB (FIG. 15). Less than
3 colonies appeared after transfection with pSBT/PGK-puro and
pCMV-mSB, the latter which encodes an inactive version of the
transposase. Interestingly, a mean of almost 140 colonies was
obtained using the hyperactive transposase variant HSB3, indicating
that HSB3 also in porcine cells mediates higher levels of
transposition compared to the original SB transposase.
Efficient Insertion of a FRT-Tagged SB Vector in Pig
Fibroblasts
[0307] To generate SB-tagged cell clones containing a Flp
recombination target site for site-specific gene insertion, we
co-transfected the pSBT/IoxP.SV40-lopP257 plasmid with pCMV-mSB,
pCMV-SB, and pCMV-HSB3, respectively. HSB3 again showed the highest
activity, resulting in about 30 drug-resistant colonies after
transfection of 3H 10.sup.4 fibroblasts (FIG. 16).
[0308] Puromycin-resistant colonies were isolated and expanded.
Clone analysis by fluorescence microscopy demonstrated efficient
FRTeGFP expression (FIG. 17), demonstrating vector functionality
and easy FRTeGFP detection in pig fibroblasts. These fluorescent
cell clones carrying the Flp FRT recombination sequence are
currently being used for creation of cloned transgenic animals by
hand-made cloning. Verification of SBT/IoxP.SV40-GFIP.IoxP257 as
target for Flp recombination Due to limitations of long-term growth
of primary pig fibroblasts in tissue culture we were not able to
demonstrate Flp-based gene insertion into FRT-tagged SB vectors in
pig fibroblasts. We therefore chose to test functionality of the
FRT-containing vector by a standard set of recombination
experiments carried out in HEK-293 cells. We generated clones of
HEK-293 cells containing the transposed SBT/IoxP.SV40-GFIP.IoxP257
vector. By co-transfection of such clones with (i) a
pcDNA5/FRT-derived substrate plasmid containing a FRT-hygro fusion
gene and a red fluorescent protein (RFP) expression cassette and
(ii) a plasmid encoding the Flp recombinase (pCMV-Flpx9), we
subsequently identified hygromycin B resistant colonies. By
fluorescence microscopy we observed that site-specifically
engineered clones, as expected, turned-off eGFP expression and
turned-on RFP expression (data not shown). This `green-to-red`
phenotypic change indicates that the integrated SB-derived target
vector serves as acceptor site for Flp-based recombination.
Controlled Integration of Transgenes by Gene-Shifting
[0309] A gene shift with the help of the Sleeping Beauty (SB) DNA
transposon technology and Flpe recombination is presented in this
example. We inserted into HEK 293 cells a SB transposon containing
an eGFP gene and an frt site. The frt site enables gene shifting
with a donor plasmid containing the RFP gene as well as an frt site
(see FIG. 18). Cells which underwent complete gene shifting,
changed colour from green to red fluorescence and also changed
antibiotic resistance, as the eGFP is linked to a puromycin
resistance gene, and the RFP to a hygromycine B resistance gene.
One clone with such characteristics was examined by LM-PCR and the
location of the transposon, including the eGFP and frt site was
found on chromosome 10. The insertion site showed typical signs of
SB integration in the form of TA duplication flanked by distinctive
consensus sequences. The transposon was sequenced before and after
gene shifting, which confirmed that the transposon was intact,
initially without the RFP gene, and with RFP after gene shifting
(FIGS. 19 and 20).
[0310] These findings imply that gene shifting can be controlled at
a precise place in the genome. The potential of SB and the
transposon was investigated in minipig cells. The results showed
that primary pig fibroblasts also support SB insertion thus
creating a platform for gene shifting in pig cells (see FIG. 21).
We prepared minipig cells for SB-mediated gene shifting, and by
hand made cloning (HMC) we show that such cells give rise to viable
blastocysts expressing the transgene (see FIG. 22).
[0311] In conclusion, the Sleeping Beauty DNA transposon-based
vector of the present invention serves in its integrated form as a
target for recombinase-based gene insertion. The SB vector is
efficiently transferred by cut-and-paste transposition into the
genome of primary porcine fibroblasts and therefore is not flanked
by plasmid-derived bacterial sequences. Use of these genetically
engineered primary cells in for example microinjection and
hand-made cloning allows subsequent detailed analyses of SB
vector-derived eGFP expression in cloned pigs and identification of
animals with attractive expression profiles (e.g. ubiquitous,
tissue-specific). Primary fibroblasts from such `master pigs` is
further modified by Flp-based recombination, allowing site-directed
gene insertion in a SB vector-tagged locus which is not silenced in
the tissue of interest. Cloned pigs harboring a site-specifically
inserted disease gene of interest or a shRNA expression cassette
for downregulation of endogenous genes can be generated by a second
round of animal cloning.
[0312] Except where otherwise indicated all chemicals for the
nuclear transfer procedure were obtained from Sigma Chemical Co.
(St Louis, Mo., USA).
Oocyte Collection and In Vitro Maturation (IVM)
[0313] Cumulus-oocyte complexes (COCs) were aspirated from 2-6 mm
follicles from slaughterhouse-derived sow or gilt ovaries. COCs
were matured in groups of 50 in 400 .mu.l bicarbonate-buffered
TCM-199 (GIBCO BRL) supplemented with 10% (v/v) cattle serum (CS),
10% (v/v) pig follicular fluid, 10 IU/ml eCG, 5 IU/ml hCG (Suigonan
Vet; Skovlunde, Denmark) at 38.5.degree. C. in the "Submarine
Incubation System" (SIS; Vajta, et al. 1997) in 5% CO.sub.2 in
humidified air for 41-44 hours.
In Vitro Fertilization (IVF)
[0314] IVF experiments were performed with in vitro matured oocytes
in 3 identical replicates. After maturation, COCs were washed twice
with mTBM containing 2 mM caffeine (mTBM.sub.fert) and transferred
in groups of 50 to 400 .mu.l mTBM.sub.fert. Freshly ejaculated
semen was treated as described previously (Booth, et al., in
press). After 2 h capacitation at 38.5.degree. C. and in 5%
CO.sub.2 in humidified air, sperm was added to the oocytes with the
adjusted final concentration of 1.times.10.sup.5 sperm/ml.
Fertilization was performed at 38.5.degree. C. and in 5% CO.sub.2
in humidified air in the SIS for 3 h. After the insemination, the
presumptive zygotes were vortexed in mTBM.sub.fert to remove
cumulus cells before washing in IVC medium and placing in culture
dishes (see Embryo culture and evaluation).
Handmade Cloning (HMC)
[0315] The applied HMC method was based on our previous work in
cattle and pig (Kragh, et al., 2004; Peura and Vajta, 2003; Vajta,
et al., 2003), but with significant modifications. Briefly, at 41 h
after the start of maturation, the cumulus investment of the COCs
was removed by repeated pipetting in 1 mg/ml hyaluronidase in
Hepes-buffered TCM199. From this point (except where otherwise
indicated), all manipulations were performed on a heated stage
adjusted to 39.degree. C., and all drops used for handling oocytes
were of 20 .mu.l volume covered with mineral oil. Oocytes were
briefly incubated in 3.3 mg/ml pronase dissolved in T33 (T for
Hepes-buffered TCM 199 medium; the number means percentage (v/v) of
CS supplement, here 33%) for 5 s. Before the oocytes started to
become misshaped in pronase solution, they were picked out and
washed quickly in T2 and T20 drops. Oocytes with partially digested
but still visible zona were lined up in drops of T2 supplemented
with 3 mg/ml polyvinyl alcohol (TPVA) and 2.5 .mu.g/ml cytochalasin
B. Trisection instead of bisection was performed manually under
stereomicroscopic control with Ultra Sharp Splitting Blades (AB
Technology, Pullman, Wash., USA; FIG. 23a). Fragments of trisected
oocytes were collected and stained with 5 .mu.g/ml Hoechst 33342
fluorochrome in TPVA drops for 5 min, then placed into 1 .mu.l
drops of the TPVA medium on the bottom of a 60 mm Falcon Petri dish
covered with oil (3-4 fragments per drop). Using an inverted
microscope and UV light, positions of fragments without chromatin
staining (cytoplasts) were registered and later collected under a
stereomicroscope in T10 drops until the start of the fusion.
[0316] Fetal fibroblast cells were prepared as described previously
(Kragh, et al., in press). Fusion was performed in two steps where
the second one included the initiation of activation, as well. For
the first step, one third of the selected cytoplasts (preferably
the smaller parts) were used. With a finely drawn and fire-polished
glass pipette, 10 cytoplasts were transferred as a group to 1 mg/ml
of phytohaemagglutinin (PHA; ICN Pharmaceuticals, Australia) for 3
s, then quickly dropped onto one of the few fibroblast cells
individually that were sedimented in a T2 drop. After attachment,
10 cytoplast-fibroblast cell pairs were equilibrated in fusion
medium (0.3 M mannitol and 0.01% PVA) for 10 s. Using an
alternative current (AC) of 0.6 KV/cm and 700 KHz, cell pairs were
aligned to the wire of a fusion chamber (BTX microslide 0.5 mm
fusion chamber, model 450; BTX, SanDiego, Calif., USA) with the
donor cells farthest from the wire (FIG. 23b), then fused with a
direct current (DC) of 2.0 KV/cm for 9 .mu.s. After the electrical
pulse, cell pairs were removed carefully from the wire, transferred
to T10 drops and incubated to observe whether fusion had
occurred.
[0317] Approximately 1 hour after the first fusion, fused pairs
together with the remaining two thirds of cytoplasts were
equilibrated in activation medium drops separately (0.3 M mannitol,
0.1 mM MgSO.sub.4, 0.1 mM CaCl.sub.2 and 0.01% polyvinylalcohol
(PVA)). Under a 0.6 KV/cm AC, cytoplast--fused pair--cytoplast
triplets were aligned sequentially to the wire in groups of 10,
with fused pairs located in the middle (FIG. 23c). A single DC
pulse of 0.7 KV/cm for 80 .mu.s was used for the second fusion and
initiation of activation. The triplets were then removed from the
wire and transferred carefully to T10 drops to check the fusion
(FIG. 23d). Reconstructed embryos were incubated in culture medium
(see Embryo culture and evaluation) supplemented with 5 .mu.g/ml
cytochalasin B and 10 .mu.g/ml cycloheximide for 4 h at
38.5.degree. C. in 5% CO.sub.2, 5% O.sub.2 and 90% N.sub.2 with
maximum humidity, then washed thoroughly for 3 times in IVC medium
before culture.
Parthenogenetic Activation (PA)
[0318] Parthenogenetically activated oocytes were produced either
separately or in parallel with HMC. Oocytes were denuded in the
same way as above except that a longer incubation in pronase was
used to get the zona pellucida completely removed. Zona free (ZF)
oocytes were then equilibrated for 10 s in activation medium (0.3 M
mannitol, 0.1 mM MgSO.sub.4, 0.1 mM CaCl.sub.2 and 0.01% PVA) and
transferred to the fusion chamber (BTX microslide 0.5 mm fusion
chamber, model 450; BTX, SanDiego, Calif., USA). A single DC pulse
of 0.85 KV/cm for 80 .mu.s was generated with a BLS CF-150/B cell
fusion machine (BLS, Budapest, Hungary) and applied to ZF oocytes.
For zona intact (ZI) oocytes, a single DC pulse of 1.25 KV/cm for
80 .mu.s was used (according to our unpublished preliminary
experiments, these parameters resulted in the highest activation
and subsequent in vitro development for ZI and ZF oocytes,
respectively). The procedure after the electrical pulse was the
same as for HMC reconstructed embryos.
Embryo Culture and Evaluation
[0319] All porcine embryos produced by the above treatments were
cultured in a modified NCSU37 medium (Kikuchi, et al., 2002)
containing 4 mg/ml BSA at 38.5.degree. C. in 5% O.sub.2, 5%
CO.sub.2 and 90% N.sub.2 with maximum humidity. The culture medium
was supplied with 0.17 mm sodium pyruvate and 2.73 mm sodium
lactate from Day 0 (the day for fertilization and activation) to
Day 2, then sodium lactate and sodium pyruvate was replaced with
5.5 mm glucose from Day 2 to Day 7. All ZF embryos were cultured in
the WOW system (Vajta, et al., 2000) in the same culture medium and
gas mixture as used above, with careful medium change on Day 2
without removing the embryos from the WOWs. The blastocyst rate was
registered on Day 7. To determine total cell numbers, blastocysts
were fixed and mounted to a glass microscopic slide in glycerol
containing 20 .mu.g/.mu.l Hoechst 33342 fluorochrome. After
staining for 24 h, embryos were observed under a Diaphot 200
inverted microscope with epifluorescent attachment and UV-2A filter
(Nikon, Tokyo, Japan).
Example 1
[0320] Differences in developmental competence between sow (2.5
years, 170 Kg in weight) derived oocytes and gilt (5.5.about.6
months, 75 Kg in weight) derived oocytes were investigated through
ZF and ZI PA after 44 h in vitro maturation. Four combined groups
were investigated in 3 identical replicates: (1) ZF oocytes from
sows (2) ZI oocytes from sows (3) ZF oocytes from gilts (4) ZI
oocytes from gilts. For ZF activation, a single DC pulse of 0.85
KV/cm for 80 .mu.s was applied, while a single 1.25 KV/cm pulse was
used to activate ZI oocytes. Following 7 days culture as described
above, the percentage of blastocysts per activated embryo was
determined.
[0321] The in vitro developmental competence of parthenogenetically
activated oocytes derived from either sows or gilts was
investigated. As shown in Table 1, the blastocyst rates of
parthenogenetically activated oocytes from sows were significantly
higher than those from gilts, either after ZF or ZI PA.
TABLE-US-00001 TABLE 1 Blastocyst development of Day 7
parthenogenetically activated sow and gilt oocytes Zona Free Zona
Intact No. of No. of No. of No. of activated blastocysts activated
blastocysts oocytes (%)* oocytes (%)* sow 103 43(42 .+-. 4).sup.a
110 61(55 .+-. 6).sup.c gilt 85 17(20 .+-. 2).sup.b 137 36(26 .+-.
5).sup.d .sup.a,bDifferent superscripts mean significant
differences (p < 0.05). .sup.c.dDifferent superscripts mean
significant differences (p < 0.05). *Percentage (Mean .+-.
S.E.M) of embryos developed to blastocysts.
[0322] The difference in oocytes developmental competence between
sows and gilts has been examined in in vitro production (IVP) and
somatic cell nuclear transfer (SCNT) embryos separately, resulting
in a similar conclusion as in the earlier publication of other
research groups (Sherrer, et al., 2004; Hyun, et al., 2003), i.e.
that embryos from sow-derived oocytes are superior to those from
gilt-derived oocytes in supporting blastocyst development. Although
gilts used in our study were at the borderline of maturity, the
difference between Day 7 blastocyst rates after PA was significant,
proving the superior developmental competence of sow oocytes.
Example 2
[0323] The feasibility of modified porcine HMC was investigated in
6 identical replicates, with IVF and in parallel ZF PA as controls.
The more competent sow oocytes (according to Example 1) were used
in Example 2. Seven days after reconstruction and/or activation,
the number of blastocysts per reconstructed embryo and total cell
numbers of randomly selected blastocysts were determined.
[0324] More than 90% of oocyte fragments derived from
morphologically intact oocytes could be recovered for HMC after the
trisection. In average, 37 embryos could be reconstructed out of
100 matured oocytes. The developmental competence of all sources of
porcine embryos is shown in Table 2. On Day 7, the development of
reconstructed embryos to the blastocyst stage was 17.+-.4% with
mean cell number of 46.+-.5, while the blastocyst rates for IVF,
and ZF PA were 30.+-.6% and 47.+-.4% (n=243, 170, 97)
respectively.
TABLE-US-00002 TABLE 2 In vitro development of embryos produced by
HMC, IVF and ZF PA No. of blastocyst Mean cell Embryo
embryos/oocytes No. of rates (Mean .+-. number of origins in
culture blastocysts S.E.M). blastocysts HMC 243 41 17 .+-. 4.sup.a
46 .+-. 5.sup.d IVF 170 52 30 .+-. 6.sup.b 74 .+-. 6.sup.e ZF PA 97
46 47 .+-. 4.sup.c 53 .+-. 7.sup.d .sup.a,b,cDifferent superscripts
mean significant differences (p < 0.05). .sup.d,eDifferent
superscripts mean significant differences (p < 0.05).
[0325] Although the theoretical maximum efficiency was still not
approached, the integration of zona partial digestion and oocyte
trisection almost doubled the number of reconstructed embryos
compared to our earlier system (Kragh, et al., 2004 Reprod. Fertil.
Dev 16, 315-318). This increase in reconstruction efficiency may
have special benefits in porcine cloning since oocyte recovery
after aspiration is more demanding and time-consuming than in
cattle. An even more important point is the high embryo number
required for establishment of pregnancies following porcine nuclear
transfer. IVC in pigs is also regarded as a demanding and
inefficient procedure (Reed, et al., 1992 Theriogeneology 37,
95-109). A disadvantage of ZF systems is that the embryos have to
reach at least the compacted morula or early blastocyst stage in
vitro to avoid disintegration in the oviduct without the protective
layer of the zona pellucida. On the other hand, once in the
blastocyst stage, zona free embryos can be transferred successfully
as proved by calves born after either embryonic or somatic cell
nuclear transfer (Peura et al., 1998; Tecirlioglu et al., 2004;
Oback et al., 2003; Vajta, et al., 2004) and also by the piglets
born after zona-free IVP of oocytes (Wu, et al., 2004). NCSU37
medium has been the most widely and successfully used medium for
the culture of pig embryos. However, despite the improved embryo
development compared with other media, the viability of IVP porcine
embryos is still compromised after IVC. Some reports suggested that
glucose is not metabolized readily by early porcine embryos before
the eight-cell stage but used in higher amounts in embryos between
the compacted morula and blastocysts stages (Flood, et al., 1988).
The replacement of glucose with pyruvate and lactate in NCSU37 for
the first 2 days culture resulted in a blastocyst rate of 25.3% for
IVP porcine embryos in Kikuchi's study (Kukuchi, et al., 2002),
which was further corroborated by our present studies with an IVP
blastocysts rate of 30% in average. Moreover, the first evaluation
of this sequential culture system on porcine HMC and ZF PA embryos
has resulted in blastocyst rates of 17% and 47% respectively.
Sometimes, the blastocyst rate of ZI PA could even reach levels as
high as 90% (Du, unpublished)
Statistical Analysis
[0326] ANOVA analysis was performed using SPSS 11.0. A probability
of P<0.05 was considered to be statistically significant.
Example 3
[0327] Vitrification of hand-made cloned porcine blastocysts
produced from delipated in vitro matured oocytes.
[0328] Recently a noninvasive procedure was published for
delipation of porcine embryos with centrifugation but without
subsequent micromanipulation (Esaki et al. 2004 Biol Reprod. 71,
432-6).
[0329] Cryopreservation of embryos/blastocysts was carried out by
vitrification using Cryotop (Kitazato Supply Co, Fujinomiya Japan)
as described previously (Kuwayama et al. 2005a; 2005b). At the time
of vitrification, embryos/blastocysts were transferred into
equilibration solution (ES) consisting of 7.5% (V/V) ethylene
glycol (EG) and 7.5% dimethylsulfoxide (DMSO) in TCM199
supplemented with 20% synthetic serum substitute (SSS) at
39.degree. C. for 5 to 15 min. After an initial shrinkage, embryos
regained their original volume. 4.about.6 embryos/blastocysts were
transferred into 20 ul drop of vitrification solution (VS)
consisting of 15% (V/V) EG and 15% (DMSO) and 0.5M sucrose
dissolved in TCM199 supplemented with 20% SSS. After incubation for
20 s, embryos were loaded on Cryotop and plunged into liquid
nitrogen. The process from exposure in VS to plunging was completed
with 1 min.
[0330] Embryos/blastocysts were thawed by immersing Cryotop
directly into thawing solution (TS) consisting of 1.0M sucrose in
TCM199 plus 20% SSS for 1 min, then transferred to dilution
solution (DS) consisting of 0.5 M sucrose in TCM199 plus 20% SSS
for 3 min. To remove cryoprotectant, embryos/blastocysts were kept
twice in a washing solution (WS; TCM199 plus 20% SSS), 5 min for
each time. Survival of vitrified blastocysts was determined
according to reexpansion rates after 24 h recovery in culture
medium supplemented with 10% calf serum (CS).
[0331] The non-invasive delipation method was applied to in vitro
matured porcine oocytes and further development of delipated
oocytes after parthenogenetic activation was investigated in 4
identical replicates. Oocytes were randomly separated into
delipation and control groups.
[0332] For delipation, oocytes were digested with 1 mg/ml pronase
in the presence of 50% cattle serum (CS) for 3 min, and washed in
Hepes-buffered TCM-199 medium supplemented with 20% CS which
results in partial zona pellucida digestion (FIG. 24a).
Subsequently 40-50 oocytes were centrifuged (12000.times.g, 20 min)
at room temperature in Hepes-buffered TCM-199 medium supplemented
with 2% CS, 3 mg/ml PVA and 7.5 .mu.g/ml cytochalasin B (CB) (FIG.
24b). Zonae pellucidea of both centrifuged and intact oocytes were
removed completely with further digestion in 2 mg/ml pronase
solution. For activation, a single direct current of 85 Kv/cm for
80 us was applied to both groups, followed by 4 h treatment with 5
.mu.g/ml CB and 10 .mu.g/ml cycloheximide (CHX). All embryos were
then cultured in the modified NCSU37 medium. Day 7 blastocysts were
vitrified and warmed by using the Cryotop technique (Kuwayama et
al., RBM Online, in press) at 38.5.degree. C. Survival of vitrified
blastocysts was determined according to reexpansion rates after 24
h recovery in culture medium supplemented with 10% CS. Cell numbers
of reexpanded blastocysts from both groups were determined after
Hoechst staining. Results were compared by ANOVA analysis. Partial
zona digestion and centrifugation resulted in successful delipation
in 173/192 (90%) of oocytes. The development to blastocysts was not
different between delipated and intact oocytes (28.+-.7% vs.
28.+-.5% respectively; P>0.05). However, survival rates of
blastocysts derived from delipated oocytes were significantly
higher than those developed from intact oocytes (85.+-.6% vs.
32.+-.7% respectively; P<0.01). There is no difference in
average cell number of reexpanded blastocysts derived from either
delipated or intact oocytes (36.+-.7 vs. 38.+-.9, respectively;
P>0.05). The results demonstrate that the simple delipation
technique does not hamper the in vitro development competence of
activated porcine oocytes, and improves the cryosurvival of the
derived blastocysts without significant loss in cell number.
[0333] After delipation, zona pellucida of oocytes from both groups
was removed completely. The same parameters as described above for
electrical activation were applied to both groups. Seven days after
activation, blastocyst rates and blastocyst cell numbers were
determined.
[0334] The feasibility of applying a non-invasive delipation
technique to in vitro matured porcine oocytes was investigated. 90%
(173/192) oocytes can be delipated successfully. As shown in table
3, the development to blastocysts was not different between
delipated and intact oocytes (28.+-.7% vs. 28.+-.5% respectively;
P>0.05). However, survival rates of blastocysts derived from
delipated oocytes were significantly higher than those developed
from intact oocytes (85.+-.6% vs. 32.+-.7% respectively;
P<0.01). There is no difference in average cell number of
reexpanded blastocysts derived from either delipated or intact
oocytes (36.+-.7 vs. 38.+-.9, respectively; P>0.05).
TABLE-US-00003 TABLE 3 Developmental competence and cryosurvival of
vitrified-thawed embryos from delipated and intact activated
oocytes. Reexpanded Mean cell number Oocyte Activated Blastocyst
blastocyst after of reexpanded treatment oocyte rate (%) warming
(%) blastocysts Delipated 173 28 .+-. 7 85 .+-. 6 36 .+-. 7 Intact
156 28 .+-. 5 32 .+-. 7 39 .+-. 9
Handmade Cloning of Delipated Oocytes
[0335] Delipated oocytes were used for HMC in 5 replicates. Four
identical replicates of non-delipated oocytes for HMC were used as
a control system. Seven days after reconstruction, blastocysts
produced from both groups were vitrified with Cryotop. Survival
rates and cell numbers of re-expanded blastocysts were determined
as described for the blastocysts produced by PA.
[0336] Except where otherwise indicated, all manipulations were
performed on a heated stage adjusted to 39.degree. C., and all
drops used for handling oocytes were of 20 .mu.l volume covered
with mineral oil. For somatic cell nuclear transfer, the handmade
cloning (HMC) described in our previous work (Du, et al., 2005) was
applied with a single modification: for enucleation of both
delipated and control oocytes, bisection instead of trisection was
applied.
[0337] Briefly, after the removal of cumulus investment, control
oocytes were incubated in 3.3 mg/ml pronase dissolved in T33 for 10
s. Before the oocytes started to become misshaped in pronase
solution, they were picked out and washed quickly in T2 and T20
drops. Delipated oocytes after centrifugation were digested in the
3.3 mg/ml pronase solution for an additional 5 s.
[0338] Both control and delipated oocytes with partially digested,
distended and softened zonae pellucidae were lined up in T2 drops
supplemented with 2.5 .mu.g/ml cytochalasin B. Bisection was
performed manually under stereomicroscopic control (FIG. 24c) with
Ultra Sharp Splitting Blades (AB Technology, Pullman, Wash., USA).
Halves were collected and stained with 5 .mu.g/ml Hoechst 33342
fluorochrome in T2 drops for 5 min, and then placed into 1 .mu.l
drops of T2 medium on the bottom of a 60 mm Falcon Petri dish
covered with oil (3-4 halves per drop). Using an inverted
microscope and UV light, positions of halves without chromatin
staining (cytoplasts) were registered. Cytoplasts were later
collected under a stereomicroscope and stored in T10 drops.
[0339] Porcine foetal fibroblast cells were prepared with trypsin
digestion from monolayers as described previously (Kragh, et al.,
2005). Fusion was performed in two steps where the second one
included the initiation of activation, as well. For the first step,
50% of the available cytoplasts were transferred into 1 mg/ml of
phytohaemagglutinin (PHA; ICN Pharmaceuticals, Australia) dissolved
in TO for 3 s, then quickly dropped over single fibroblast cells.
After attachment, cytoplast-fibroblast cell pairs were equilibrated
in fusion medium (0.3 M mannitol and 0.01% PVA) for 10 s and
transferred to the fusion chamber. Using an alternating current
(AC) of 0.6 KV/cm and 700 KHz, pairs were aligned to the wire of a
fusion chamber with the somatic cells farthest from the wire (FIG.
24d), then fused with a direct current of 2.0 KV/cm for 9 .mu.s.
After the electrical pulse, cell pairs were removed carefully from
the wire, transferred to T10 drops and incubated to observe whether
fusion had occurred.
[0340] Approximately 1 hour after the first fusion, each pair was
fused with another cytoplast in activation medium. AC current and a
single DC pulse of 0.7 KV/cm for 80 .mu.s were applied as described
above. Fusion was detected in T10 drops, then reconstructed embryos
were transferred into IVC0-2 medium (see Embryo culture and
evaluation) supplemented with 5 .mu.g/ml cytochalasin B and 10
.mu.g/ml cycloheximide. After a 4 h incubation at 38.5.degree. C.
in 5% CO.sub.2, 5% O.sub.2 and 90% N.sub.2 with maximum humidity,
embryos were washed 3 times in IVC0-2 medium before culture.
TABLE-US-00004 TABLE 4 Developmental competence and cryosurvival of
vitrified-thawed embryos of SCNT porcine embryos derived from
delipated and intact oocytes. Mean cell No. of Reexpanded number of
HMC reconstructed Blastocyst blastocyst after reexpanded group
embryos rate (%)* warming (%)* blastocysts* Delipated 240 21 .+-.
6.sup.a 79 .+-. 6.sup.b 41 .+-. 7.sup.d Intact 150 23 .+-. 6.sup.a
32 .+-. 8.sup.c 39 .+-. 5.sup.d Different superscripts mean
significant differences (p < 0.05). *mean .+-. S.E.M.
[0341] In vitro developmental competence was observed in HMC with
delipated oocytes when Day 7 blastocyst rates were compared with
control HMC group (21.+-.6% vs. 23.+-.6% respectively; P>0.05;
Table 4). Cryosurvival rate after vitrification of cloned
blastocysts derived from delipated oocytes was significantly higher
than those developed from intact oocytes (79.+-.6% vs. 32.+-.8,
respectively; P<0.01).
Example 4
Chemically Assisted Handmade Enucleation (CAHE) and Comparison to
Existing Methods
[0342] After 41-42 h maturation in vitro, COCs were further
cultured for 45 min in the same solution supplemented by 0.4
.mu.g/ml demecolcine. Cumulus cells were then removed by pipetting
in 1 mg/ml hyaluronidase dissolved in Hepes-buffered TCM-199. From
this point (except where otherwise indicated), all manipulations
were performed on a heated stage adjusted to 39.degree. C. All
drops used for handling oocytes were of 20 .mu.l in volume, and
were covered with mineral oil.
[0343] Basic steps of the HMC procedure have been described
elsewhere herein. Briefly, oocytes without cumulus cells were
incubated in 3.3 mg/ml pronase dissolved in T33 (T for
Hepes-buffered TCM 199 medium; the number means percentage [v/v] of
CS supplement, here 33%) for 20 s. When partial lyses of zonae
pellucidae and slight deformation of oocytes occurred, they were
picked up and washed quickly in T2 and T20 drops. Nine oocytes were
lined up in one T2 drop supplemented with 2.5 .mu.g/ml cytochalasin
B (CB). By using a finely drawn and fire-polished glass pipette,
oocytes were rotated to find a light extrusion cone and/or strongly
attached polar body on the surface, and oriented bisection was
performed manually under stereomicroscopic control with a
microblade (AB Technology, Pullman, Wash., USA). Less than half of
the cytoplasm (close to the extrusion or PB) was separated from the
remaining part (FIG. 25). After bisection of all 9 oocytes in the
drop, larger parts and smaller parts (with the extrusion or
attached PB) were collected and placed into separate drops of T2,
respectively.
Oriented Handmade Enucleation without Demecolcine Treatment
(OHE)
[0344] All steps were similar to the previously described
procedure, but demecolcine preincubation was not applied.
[0345] Random Handmade Bisection for Enucleation (RHE)
[0346] Demecolcine preincubation was omitted from the pretreatment
of this group, as well. After removal of cumulus cells, zonae
pellucidae were partially digested by pronase as described above.
Random handmade equal bisection was applied in drops of T2
supplemented with 2.5 .mu.g/ml CB. All demi-oocytes were selected
and stained with 10 .mu.g/ml Hoechst 33342 in T2 drops for 10 min,
then placed into 1 .mu.l drops of T2 medium covered with mineral
oil (three demi-oocytes into each drop). Using an inverted
microscope and UV light, the positions of chromatin free
demi-oocytes, i.e. cytoplasts were registered. These cytoplasts
were later collected under a stereomicroscope and stored in T2
drops before further manipulations.
Fusion and Initiation of Activation
[0347] Porcine fetal fibroblast cells were prepared as described
previously (Kragh, et al., 2005, Du, et al., 2005). Fusion was
performed in two steps, where the second one included the
initiation of activation as well. For the first step, with a finely
drawn and fire-polished glass pipette, approximately 100 somatic
cells were placed into a T2 drop, and 20-30 cytoplasts were placed
into a T10 drop. After a short equilibration, groups of 3
cytoplasts were transferred to 1 mg/ml of phytohaemagglutinin (PHA)
for 2-3 sec, then each was quickly dropped over a single somatic
cell. Following attachment, cytoplast-somatic cell pairs were
picked up again and transferred to a fusion medium (0.3 M mannitol
supplemented with 0.01% [w/v] PVA). By using an alternative current
(AC) of 0.6 KV/cm and 700 KHz, equilibrated pairs were aligned to
one wire of a fusion chamber (BTX microslide 0.5 mm fusion chamber,
model 450; BTX, San Diego, Calif.) with the somatic cells farthest
from the wire, then fused with a single direct current (DC) impulse
of 2.0 KV/cm for 9 .mu.sec. Pairs were then removed carefully from
the wire to a T10 drop, and incubated further to observe whether
fusion had occurred.
[0348] Approximately 1 h after the fusion, fused pairs and the
remaining cytoplasts were separately equilibrated in activation
medium (0.3 M mannitol, 0.1 mM MgSO.sub.4, 0.1 mM CaCl.sub.2,
supplemented with 0.01% [w/v] PVA). By using a 0.6 KV/cm AC, one
pair and one cytoplast was aligned to one wire of the fusion
chamber, with fused pairs contacting the wire. A single DC pulse of
0.86 KV/cm for 80 .mu.sec was used for the second fusion and
initiation of activation. Fusion was checked in after incubation in
T10 drops.
Traditional Cloning (TC)
[0349] Micromanipulation was conducted with a Diaphot 200 inverted
microscope (Nikon, Tokyo, Japan), as described before (Chen et al.,
1999; Zhang et al., 2005). Briefly, after 42-44 h in vitro
maturation, the cumulus cells were removed as described above. All
manipulations were performed on a heated stage adjusted to
39.degree. C. A single 50 .mu.L micromanipulation solution drop was
made in the central area on a lid of 60 mm culture dish and covered
with mineral oil. Groups of 20-30 oocytes and fetal fibroblast
cells were placed in the same drop. After incubation for 15-30 min,
the oocyte was secured with a holding pipette (inner diameter=25-35
.mu.m and outer diameter=80-100 .mu.m). After being placed at the
position of 5-6 o' clock, the first polar body and the adjacent
cytoplasm (approx. 10% of the total volume of the oocyte)
presumptively containing metaphase plate were aspirated and removed
with a beveled injection pipette (inner diameter=20 .mu.m). A fetal
fibroblast cell was then injected into the space through the same
slit. After nuclear transfer (NT), reconstructed couplets were
transferred into drops of media covered with mineral oil for
recovery for 1-1.5 h until fusion and activation was conducted. The
recovery medium was NCSU-23 supplemented with 4 mg/mL BSA and 7.5
.mu.g/mL CB. Reconstructed couplets were incubated in fusion medium
for 4 min. Couplets were aligned manually using a finely pulled and
polished glass capillary to make the contact plane parallel to
electrodes. A single, 30 .mu.sec, direct current pulse of 2.0 kV/cm
was then applied. After culture in drops of IVC0-2 (specified in
"Embryo culture and evaluation") supplemented with 7.5 .mu.g/mL CB
for 30-60 min, fusion results were examined under a
stereomicroscope. Fused couplets were subjected to a second pulse
in activation solution. After 30 min incubation in T10 they were
transferred to IVC0-2 to evaluate in vitro development.
Further Steps of Activation
[0350] After the activation impulse, all reconstructed embryos were
incubated in IVC0-2 supplemented with 5 .mu.g/ml CB and 10 .mu.g/ml
cycloheximide at 38.5.degree. C. in 5% CO.sub.2, 5% O.sub.2, and
90% N.sub.2, with maximum humidity.
Embryo Culture and Evaluation
[0351] 4 h later, all reconstructed and activated embryos were
washed and cultured in Nunc four-well dishes in 400 .mu.l IVC0-2
covered by mineral oil at 38.5.degree. C. in 5% CO.sub.2, 5%
O.sub.2, and 90% N.sub.2, with maximum humidity. IVC0-2 was a
modified NCSU37 medium (Kikuchi, et al., 1999), containing 4 mg/ml
BSA, 0.17 mM sodium pyruvate, and 2.73 mM sodium lactate from Day 0
(the day for activation) to Day 2. Sodium pyruvate and sodium
lactate were replaced with 5.5 mM glucose from Day 2 to Day 7
(IVC2-7). All zonae free embryos were cultured in the Well of the
Well (WOW) system (Vajta et al., 2000) in the same culture medium
and gas mixture as used above, with careful medium change on Day 2
without removing the embryos from the WOWs. TC embryos were
cultured in groups of 15 to 30 in wells of four-well dishes by
using the same medium amount and composition. Cleavage and
blastocyst rates were registered on Day 2 and Day 7, respectively.
To determine total cell numbers, blastocysts were fixed and mounted
to a glass microscope slide in a small amount (<2 .mu.l) of
glycerol containing 10 .mu.g/ml Hoechst 33342. After staining for
several hours at room temperature, embryos were observed under a
Diaphot 200 inverted microscope with epifluorescent attachment and
UV-2A filter (Nikon, Tokyo, Japan).
Comparison of Efficiency of CAHE Vs. OHE
[0352] The efficiency and reliability of CAHE was tested in 12
identical replicates by using a total of 620 oocytes. After 41-42 h
maturation, oocytes were subjected to demecolcine incubation.
Oriented bisection was performed in oocytes where an extrusion cone
and/or a strongly attached PB was detected after partial pronase
digestion. Percentages of bisected vs. total oocytes and surviving
vs. bisected oocytes were registered. Subsequently both putative
cytoplasts and karyoplasts were collected separately and stained
with Hoechst 33342 (10 .mu.g/ml in T2 for 10 min). The presence or
absence of chromatin was detected under an inverted fluorescent
microscope (FIG. 26).
[0353] The efficiency and reliability of OHE was investigated in 9
identical replicates using a total of 414 oocytes. After 42-43 h in
vitro maturation, oriented bisection was performed in matured
oocytes where an extrusion cone and/or a PB was detected after
partial pronase digestion. Results were evaluated as described in
the previous paragraph.
[0354] The results are shown in Table 5.
TABLE-US-00005 TABLE 5 The efficiency of chemically assisted
handmade enucleation (CAHE) and oriented handmade enucleation (OHE)
No. of Bisected/ Cytoplast/ treated total Cytoplast/ total Groups
oocytes oocytes (%)* bisection (%)* oocyte (%)* CAHE 620 96 .+-.
1.sup.a 94 .+-. 2.sup.b 90 .+-. 3.sup.c OHE 414 92 .+-. 2.sup.a 88
.+-. 3.sup.b 81 .+-. 4.sup.d *mean .+-. A.D. (absolute deviations)
Different superscripts mean difference (P < 0.05)
[0355] No differences between groups regarding extrusion cones
and/or attached polar bodies allowing oriented bisection or in the
lysis rates were detected, and the successful enucleation per
bisected oocyte ratio was also similar. However the overall
efficiency of the procedure measured by the cytoplast per total
oocyte number was higher in the CAHE than in the OHE group.
[0356] Comparison of in vitro development of embryos produced with
CAHE, RHE and TC
[0357] In 8 replicates, a total of 468 in vitro matured oocytes
were randomly distributed and subjected to three of the enucleation
procedures described above. Fusion rates between cytoplast and
donor fibroblasts were registered. Reconstructed embryos were
activated and cultured as described earlier. Cleavage and
blastocyst rates were determined on Day 2 and Day 7, respectively.
Stereomicroscopic characteristics of the developed blastocysts were
compared between groups.
TABLE-US-00006 TABLE 6 Developmental competence of embryos derived
from chemically assisted handmade enucleation (CAHE), random
handmade enucleation (RHE) and traditional, micromanipulator based
cloning (TC). No. of Cell no. of reconstructed Fusion Cleavage
Blastocyst blastocysts Groups embryos rate (%)* rate (%)* rate (%)*
(Day 7) CAHE 150 87 .+-. 7.sup.a 97 .+-. 6.sup.b 28 .+-. 9.sup.d 57
.+-. 6.sup.e RHE 86 81 .+-. 4.sup.a 87 .+-. 8.sup.b 21 .+-. 9.sup.d
49 .+-. 7.sup.e TC 178 81 .+-. 10.sup.a 69 .+-. 9.sup.c 21 .+-.
6.sup.d 53 .+-. 6.sup.e *mean .+-. A.D. (absolute deviations)
Different superscripts mean difference (P < 0.05).
[0358] Fusion rates after enucleation were similar between CAHE,
RHE and TC, respectively. The second fusion and activation resulted
in negligible (<1%) losses in the first two groups. Although TC
resulted in lower cleavage per reconstructed embryo rates than the
other two groups, this difference was not present in the blastocyst
per reconstructed embryo rates.
[0359] Stereomicroscopic characteristics (size; estimated
proportion and outlines of the inner cell mass) did not differ
between groups. Cell numbers (57.+-.6 vs. 49.+-.7 vs. 53.+-.6) of
the produced blastocysts from CAHE, RHE and TC are shown in Table
6, FIG. 27 and FIG. 28.
Statistical Analysis
[0360] AVEDEV was performed by Microsoft XP Excel software and
ANOVA was performed by SAS system. A probability of P<0.05 was
considered to be statistically significant.
Example 5
Production of Piglets
Handmade Cloning (HMC)
[0361] Forty one hrs after the start of in vitro maturation, the
cumulus investment of the COCs was removed by repeated pipetting in
1 mg/ml hyaluronidase in Hepes-buffered TCM199. From this point
(except where otherwise indicated) all manipulations were performed
on a heated stage adjusted to 39.degree. C., and all drops used for
handling oocytes were of 20 .mu.l volume covered with mineral oil.
Oocytes were briefly incubated in 3.3 mg/ml pronase dissolved in
T33 (T for Hepes-buffered TCM 199 medium; the number means
percentage (v/v) of calf serum (CS) supplement, here 33%) for 20
sec and then quickly washed in T2 and T20 drops. Oocytes with
partially digested but still visible zona were lined up in drops of
T2 supplemented with 2.5 .mu.g/ml cytochalasin B (CB). With a
finely drawn and fire-polished glass pipette, oocytes were rotated
to find the polar body (PB) on the surface, and oriented bisection
was performed manually under stereomicroscopic control with a
microblade (AB Technology, Pullman, Wash., USA). Thus, less than
half of the oocyte cytoplasm (close to the extrusion or PB) was
removed from the remaining putative cytoplast. Cytoplasts were
washed twice in T2 drops and collected in a T10 drop.
[0362] Fetal fibroblast cells were prepared as described previously
(Kragh, P. M. et al. Theriogenology 64, 1536-1545 (2005).
[0363] Fusion was performed in two steps where the second one
included the initiation of activation, as well. For the first step,
halves of putative cytoplasts were used. With a finely drawn and
fire-polished glass pipette, 10 cytoplasts were transferred as a
group to 1 mg/ml of phytohaemagglutinin (PHA; ICN Pharmaceuticals,
Australia) for 3 sec, then quickly dropped individually onto one of
the few fibroblast cells that were sedimented in a T2 drop. After
attachment, 10 cytoplast-fibroblast cell pairs were equilibrated in
fusion medium (0.3 M mannitol and 0.01% PVA) for 10 sec. Using an
alternative current (AC) of 0.6 KV/cm and 700 KHz, cell pairs were
aligned to the wire of a fusion chamber (BTX microslide 0.5 mm
fusion chamber, model 450; BTX, San Diego, Calif., USA) with the
somatic cells farthest from the wire, then fused with a direct
current (DC) of 2.0 KV/cm for 9 .mu.sec. After the electrical
pulse, cell pairs were removed carefully from the wire, transferred
to T10 drops and incubated to observe whether fusion had
occurred.
[0364] Approximately 1 hr after the first fusion, fused pairs
together with the remaining cytoplasts were equilibrated in
activation medium drops separately (0.3 M mannitol, 0.1 mM
MgSO.sub.4, 0.1 mM CaCl.sub.2 and 0.01% PVA). Under a 0.6 KV/cm AC,
cytoplast--fused pair were aligned sequentially to the wire in
groups of 10, with fused pairs far from the wire. A single DC pulse
of 0.7 KV/cm for 80 .mu.sec was used for the second fusion and
initiation of activation. The pairs were then removed from the wire
and transferred carefully to T10 drops to check the fusion.
Reconstructed embryos were incubated in PZM-3 medium supplemented
with 5 .mu.g/ml CB and 10 .mu.g/ml cycloheximide for 4 hr at
38.5.degree. C. in 5% CO.sub.2, 5% O.sub.2 and 90% N.sub.2 with
maximum humidity, then washed thoroughly before culture.
[0365] Traditional Cloning (TC)
[0366] Micromanipulation was conducted with a Diaphot 200 inverted
microscope (Nikon, Tokyo, Japan). Cumulus cells were removed as
described above after 42 to 44 hr maturation. All manipulations
were performed on a heated stage adjusted to 39. A single 50 .mu.L
drop of micromanipulation solution (NCSU-23 supplemented with 4
mg/mL BSA and 7.5 .mu.g/mL CB) was made in the central area on a
lid of 60 mm culture dish and covered with mineral oil. Groups of
20 to 30 oocytes and fetal fibroblast cells were placed in the same
drop. After incubation for 15 to 30 min, one oocyte was secured
with a holding pipette (inner diameter=25-35 .mu.m and outer
diameter=80-100 .mu.m). After being placed at the position of 5-6
o'clock, the first polar body and the adjacent cytoplasm (approx.
10% of the total volume of the oocyte) presumptively containing
metaphase plate were aspirated and removed with a beveled injection
pipette (inner diameter=20 .mu.m). A fetal fibroblast cell was then
injected into the space through the same slot. After nuclear
transfer (NT), reconstructed couplets were transferred into drops
of media covered with mineral oil for recovery for 1 to 1.5 hrs
until fusion and activation was conducted. Reconstructed couplets
were incubated in fusion medium for 4 min. Couplets were aligned
manually using a finely pulled and polished glass capillary to make
the contact plane parallel to electrodes. A single, 30 .mu.sec,
direct current pulse of 2.0 kV/cm was then applied. After culture
in drops of PZM-3 medium supplemented with 7.5 .mu.g/mL CB for
30-60 min, fusion results were examined under a stereomicroscope.
Fused couplets were subjected to a second pulse in activation
solution. After 30 min incubation in T10 they were transferred to
PZM-3 medium to evaluate in vitro development.
Embryo Culture and Transfer
[0367] Reconstructed embryos were cultured in PZM-3 medium
(Dobrinsky, J. T. et al. Biol Reprod 55, 1069-1074 (1996)
supplemented with 4 mg/ml BSA. Zona-free embryos produced from HMC
were cultured in the modified WOWs system (Feltrin, C. Et al.
Reprod Fertil Dev 18, 126 (2006). Two different cell lines (LW1-2
for HMC, LW2 for TC) were used as nuclear donor cells for HMC and
TC to allow the identification of the offspring from the two
procedures. LW1-2 and LW2 originate from fetuses from a cross (with
Duroc) and pure Danish landrace, respectively.
[0368] The average blastocyst per reconstructed embryo rate after
in vitro culture for 7 days was 50.1.+-.2.8% (mean.+-.S.E.M), which
is significantly higher (p<0.01) for HMC than that of TC
performed in parallel in our laboratory (Table 7) and also the
highest one that has ever been reported in pig cloning.
TABLE-US-00007 TABLE 7 In vitro development of embryos produced
from handmade cloning and traditional cloning No. of Somatic cell
reconstructed Cleavage Blastocyst Group donor embryos rate (%) rate
(%) HMC LW1-2 643 83.7 .+-. 4.90.sup.a 50.06 .+-. 2.80.sup.a TC LW2
831 74.86 .+-. 13.16.sup.b 28.98 .+-. 2.84.sup.b .sup.a,bValues of
different superscripts within columns are significantly different
(p < 0.05). *mean .+-. S.E.M.
[0369] Mixed blastocysts produced from both HMC and TC were
surgically transferred to 11 naturally synchronized sows on Day 4
or 5 of estrous cycle. Six (55%) recipients were diagnosed pregnant
by ultrasonography, 2 aborted and by the time of writing 2 have
delivered 3 and 10 piglets, respectively. A litter size of 10
cloned piglets is, according to our knowledge, the largest litter
size so far achieved in pig cloning. All of them are healthy and
behave normally except one showed rigid flexure of distal joint of
one foreleg. %).
[0370] Preliminary results suggest that when embryos of similar
stages were transferred, recipients on Day 4 of the estrous cycle
supported pregnancy establishment better than those of Day 5 (Table
8).
TABLE-US-00008 TABLE 8 In vivo development of cloned porcine
embryos Embryos No. of piglets born transferred Embryo Recipient
piglets No. Gestation Recipient HMC TC stage cycle Pregnancy from
piglets length number embryo embryo (Day) (Day) status HMC from TC
(Day) 1327 22 10 D 5, 6, 7 4 Y 2 1 116 1539 36 10 D 7 4 Y 8 2 115
1309 30 28 D 5, 6 4 Y 1553 45 44 D 5, 6 4 Y 1668 48 18 D 5, 6 5 Y,
aborted 1428 78 22 D 5, 6 5 Y, aborted 1725 44 4 D 5, 6, 7 5 N --
-- -- 1643 22 11 D 5, 6, 7 4 N -- -- -- 1520 30 26 D 5, 6 4 N -- --
-- 1363 37 7 D 6, 7 5 N -- -- -- 1560 99 42 D 5, 6, 7 5 N -- --
--
Microsatellite Analysis
[0371] Parental analysis using 10 different porcine microsatellite
markers confirmed the identical genotype of cloned piglets and
donor cells used for nuclear transfer. Identification was done by
microsatellite analysis of genomic DNA from each of the newborn
piglets, the surrogate sow, and the donor skin fibroblasts LW1-2
and LW2 originating from two fetuses that represent Danish landrace
and Duroc, respectively. Ten polymorphic microsatellite loci
(SW886, SW58, SW2116, SW1989, SW152, SW378, KS139, SO167, SW1987,
SW957) located on different porcine chromosomes were amplified by
3-color multiplex PCR and the products analyzed on the Genetic
Analyzer 3130.times.1 (Applied Biosystems) using the program Gene
Mapper 3.7.
[0372] For the second recipient, the offspring per embryo rate
(22%) was the highest one ever reported so far in pig cloning
(Walker, S. C. et al. Cloning Stem Cells 7, 105-112 (2005);
Hoshino, Y. et al. Cloning Stem Cells 7, 17-26 (2005)). Comparable
live birth/transferred embryo efficiencies were obtained in HMC
(17%) and TC (15%).
Statistical Analysis
[0373] Differences between the experimental groups were evaluated
using independent-samples t-test by SPSS 11.5. P<0.05 was
considered significant.
REFERENCES
[0374] 1. S. O'Gorman, D. T. Fox, G. M. Wahl, Science 251, 1351
(Mar. 15, 1991). [0375] 2. J. R. Broach, J. B. Hicks, Cell 21, 501
(September, 1980). [0376] 3. B. Thyagarajan, E. C. Olivares, R. P.
Hollis, D. S. Ginsburg, M. P. Calos, Mol Cell Biol 21, 3926 (June,
2001). [0377] 4. A. M. Geurts et al., Nucleic Acids Res 34, 2803
(2006). [0378] 5. Z. Ivics, P. B. Hackett, R. H. Plasterk, Z.
Izsvak, Cell 91, 501 (Nov. 14, 1997). [0379] 6. J. G. Mikkelsen et
al., Mol Ther 8, 654 (October, 2003). [0380] 7. T. J. Vigdal, C. D.
Kaufman, Z. Izsvak, D. F. Voytas, Z. Ivics, J Mol Biol 323, 441
(Oct. 25, 2002). [0381] 8. S. R. Yant et al., Nat Genet. 25, 35
(May, 2000). [0382] 9. C. S. Branda, S. M. Dymecki, Dev Cell 6, 7
(January, 2004). [0383] 10. A. L. Garcia-Otin, F. Guillou, Front
Biosci 11, 1108 (2006). [0384] 11. F. Buchholz, P. O. Angrand, A.
F. Stewart, Nat Biotechnol 16, 657 (July, 1998). [0385] 12. J. H.
Chung, M. Whiteley, G. Felsenfeld, Cell 74, 505 (Aug. 13, 1993).
[0386] 13. T. M. Yusufzai, G. Felsenfeld, Proc Natl Acad Sci USA
101, 8620 (Jun. 8, 2004). [0387] 14. R. J. Yanez-Munoz et al., Nat
Med 12, 348 (March, 2006). [0388] 8. Onishi A, Iwamoto M, Akita T,
Mikawa S, Takeda K, Awata T, Hanada H, Perry A C: Pig cloning by
microinjection of fetal fibroblast nuclei. Science (New York, N.Y.
2000, 289(5482):1188-1190. [0389] 9. Polejaeva I A, Chen S H,
Vaught T D, Page R L, Mullins J, Ball S, Dai Y, Boone J, Walker S,
Ayares D L et al: Cloned pigs produced by nuclear transfer from
adult somatic cells. Nature 2000, 407(6800):86-90. [0390] 10. Kragh
P M, Vajta G, Corydon T J, Purup S, Bolund L, Callesen H:
Production of transgenic porcine blastocysts by hand-made cloning.
Reprod Fertil Dev 2004, 16(3):315-318. [0391] 11. Kragh P M, Du Y,
Corydon T J, Purup S, Bolund L, Vajta G: Efficient in vitro
production of porcine blastocysts by handmade cloning with a
combined electrical and chemical activation. Theriogenology 2005,
64(7):1536-1545. [0392] 12. Du Y, Kragh P M, Zhang Y, Li J, Schmidt
M, Bogh I B, Zhang X, Purup S, Jorgensen A L, Pedersen A M et al:
Piglets born from handmade cloning, an innovative cloning method
without micromanipulation. Theriogenology 2007, 68(8):1104-1110.
[0393] 13. Dorer D R, Henikoff S: Expansions of transgene repeats
cause heterochromatin formation and gene silencing in Drosophila.
Cell 1994, 77(7):993-1002. [0394] 14. Garrick D, Fiering S, Martin
D I, Whitelaw E: Repeat-induced gene silencing in mammals. Nature
genetics 1998, 18(1):56-59. [0395] 15. Ivics Z, Hackett P B,
Plasterk R H, Izsvak Z: Molecular reconstruction of Sleeping
Beauty, a Tc1-like transposon from fish, and its transposition in
human cells. Cell 1997, 91(4):501-510. [0396] 16. Yant S R, Wu X,
Huang Y, Garrison B, Burgess S M, Kay M A: High-resolution
genome-wide mapping of transposon integration in mammals. Mol Cell
Biol 2005, 25(6):2085-2094. [0397] 17. Liu G, Geurts A M, Yae K,
Srinivasan A R, Fahrenkrug S C, Largaespada D A, Takeda J, Horie K,
Olson W K, Hackett P B: Target-site preferences of Sleeping Beauty
transposons. J Mol Biol 2005, 346(1):161-173. [0398] 18. Dupuy A J,
Clark K, Carlson C M, Fritz S, Davidson A E, Markley K M, Finley K,
Fletcher C F, Ekker S C, Hackett P B et al: Mammalian germ-line
transgenesis by transposition. Proc Nat/Acad Sci USA 2002,
99(7):4495-4499. [0399] 19. Fischer S E, Wienholds E, Plasterk R H:
Regulated transposition of a fish transposon in the mouse germ
line. Proc Natl Acad Sci USA 2001, 98(12):6759-6764. [0400] 20.
Horie K, Kuroiwa A, Ikawa M, Okabe M, Kondoh G, Matsuda Y, Takeda
J: Efficient chromosomal transposition of a Tc1/mariner-like
transposon Sleeping Beauty in mice. Proc Natl Acad Sci USA 2001,
98(16):9191-9196. [0401] 21. Luo G, Ivics Z, Izsvak Z, Bradley A:
Chromosomal transposition of a Tc1/mariner-like element in mouse
embryonic stem cells. Proc Natl Acad Sci USA 1998,
95(18):10769-10773. [0402] 22. Wilber A, Linehan J L, Tian X, Woll
P S, Morris J K, Belur L R, McIvor R S, Kaufman D S: Efficient and
stable transgene expression in human embryonic stem cells using
transposon-mediated gene transfer. Stem Cells 2007,
25(11):2919-2927. [0403] 23. Mikkelsen J G, Yant S R, Meuse L,
Huang Z, Xu H, Kay M A: Helper-Independent Sleeping Beauty
transposon-transposase vectors for efficient nonviral gene delivery
and persistent gene expression in vivo. Mol Ther 2003,
8(4):654-665. [0404] 24. Yant S R, Meuse L, Chiu W, Ivics Z, Izsvak
Z, Kay M A: Somatic integration and long-term transgene expression
in normal and haemophilic mice using a DNA transposon system. Nat
Genet. 2000, 25(1):35-41. [0405] 25. Collier L S, Carlson C M,
Ravimohan S, Dupuy A J, Largaespada D A: Cancer gene discovery in
solid tumours using transposon-based somatic mutagenesis in the
mouse. Nature 2005, 436(7048):272-276. [0406] 26. Dupuy A J, Akagi
K, Largaespada D A, Copeland N G, Jenkins N A: Mammalian
mutagenesis using a highly mobile somatic Sleeping Beauty
transposon system. Nature 2005, 436(7048):221-226. [0407] 27. Clark
K J, Carlson D F, Foster L K, Kong B W, Foster D N, Fahrenkrug S C:
Enzymatic engineering of the porcine genome with transposons and
recombinases. BMC Biotechnol 2007, 7:42. [0408] 28. Moldt B,
Staunstrup N H, Jakobsen M, Yanez-Munoz R J, Mikkelsen J G:
Site-directed genomic insertion of lentiviral DNA circles.
Submitted for publication. [0409] 29. Izsvak Z, Ivics Z, Plasterk R
H: Sleeping Beauty, a wide host-range transposon vector for genetic
transformation in vertebrates. J Mol Biol 2000, 302(1):93-102.
[0410] 30. Manuelidis L: Heterochromatic features of an 11-megabase
transgene in brain cells. Proceedings of the National Academy of
Sciences of the United States of America 1991, 88(3):1049-1053.
[0411] 31. Henikoff S: Conspiracy of silence among repeated
transgenes. Bioessays 1998, 20(7):532-535. [0412] 32. Robertson G,
Garrick D, Wilson M, Martin D I, Whitelaw E: Age-dependent
silencing of globin transgenes in the mouse. Nucleic acids research
1996, 24(8):1465-1471. [0413] 33. Schroder A R, Shinn P, Chen H,
Berry C, Ecker J R, Bushman F: HIV-1 integration in the human
genome favors active genes and local hotspots. Cell 2002,
110(4):521-529. [0414] 34. Wu X, Li Y, Crise B, Burgess S M:
Transcription start regions in the human genome are favored targets
for MLV integration. Science (New York, N.Y. 2003,
300(5626):1749-1751. [0415] 35. Wilson M H, Coates C J, George A L,
Jr.: PiggyBac Transposon-mediated Gene Transfer in Human Cells. Mol
Ther 2007, 15(1):139-145. [0416] 36. Ivics Z, Katzer A, Stuwe E E,
Fiedler D, Knespel S, Izsvak Z: Targeted Sleeping Beauty
transposition in human cells. Mol Ther 2007, 15(6):1137-1144.
[0417] 37. Yant S R, Huang Y, Akache B, Kay M A: Site-directed
transposon integration in human cells. Nucleic Acids Res 2007,
35(7):e50. [0418] 38. Yant S R, Park J, Huang Y, Mikkelsen J G, Kay
M A: Mutational analysis of the N-terminal DNA-binding domain of
sleeping beauty transposase: critical residues for DNA binding and
hyperactivity in mammalian cells. Mol Cell Biol 2004,
24(20):9239-9247. [0419] 39. Chen Z Y, He C Y, Ehrhardt A, Kay M A:
Minicircle DNA vectors devoid of bacterial DNA result in persistent
and high-level transgene expression in vivo. Mol Ther 2003,
8(3):495-500. [0420] 40. Riu E, Chen Z Y, Xu H, He C Y, Kay M A:
Histone Modifications are Associated with the Persistence or
Silencing of Vector-mediated Transgene Expression In Vivo. Mol Ther
2007, 15(7):1348-1355. [0421] 41. Chen Z Y, He C Y, Kay M A:
Improved production and purification of minicircle DNA vector free
of plasmid bacterial sequences and capable of persistent transgene
expression in vivo. Hum Gene Ther 2005, 16(1):126-131.
TABLE-US-00009 [0421] Sequences SEQ ID NO: 1 FRT site
(recombination ie. recognition sequence)
Gaagttactattccgaagttcctattctctagaaagtataggaacttc SEQ ID NO: 2 Wt
loxP ggaaagtccccaggctccccaggcaggcagaagtatgcaaagcatcgagg
atgtacgggccagatatacgcgataacttcgtataatgtatgctatacga
agttatacgcgtgaggttttcaccgtcatcaccgaaacgcgcgaggcagc
tgtggaatgtgtgtcagttagggtgtggaaagtccccaggctccccagca SEQ ID NO: 3 Wt
loxP core Ataacttcgtataatgtatgctatacgaagttat SEQ ID NO: 4 LoxP 257
ttctattctggggggtggggtggggcaggacagcaagggggaggattggg
aagacaatagcaggcatgctggggatgcggtgggctctatggaaccagct
ggggcgcgccattaacttcgtataaagtctcctatacgaagttatattct
agttgtggtttgtccaaactcatcaatgtatcttatcatgtctggatccc SEQ ID NO: 5
LoxP 257 core attaacttcgtataaagtctcctatacgaagttatatt SEQ ID NO: 6
attB full-length gtcgacatgcccgccgtgaccgtcgagaacccgctgacgctgccccgcgt
atccgcacccgccgacgccgtcgcacgtcccgtgctcaccgtgaccaccg
cgcccagcggtttcgagggcgagggcttcccggtgcgccgcgcgttcgcc
gggatcaactaccgccacctcgacccgttcatcatgatggaccagatggg
tgaggtggagtacgcgcccggggagcccaagggcacgccctggcacccgc
accgcggcttcgagaccgtgacctacatcgtcgacggtacctg SEQ ID NO: 7 attB core
gtgccagggcgtgcccttgggctccccgggcgcg SEQ ID NO: 8 attP core
cccccaactgagagaactcaaaggttaccccagttgggg SEQ ID NO: 9 puromycin
resistance gene atgaccgagtacaagcccacggtgcgcctcgccacccgcgacgacgtccc
ccgggccgtacgcaccctcgccgccgcgttcgccgactaccccgccacgc
gccacaccgtcgatccggaccgccacatcgagcgggtcaccgagctgcaa
gaactcttcctcacgcgcgtcgggctcgacatcggcaaggtgtgggtcgc
ggacgacggcgccgcggtggcggtctggaccacgccggagagcgtcgaag
cgggggcggtgttcgccgagatcggcccgcgcatggccgagttgagcggt
tcccggctggccgcgcagcaacagatggaaggcctcctggcgccgcaccg
gcccaaggagcccgcgtggttcctggccaccgtcggcgtctcgcccgacc
accagggcaagggtctgggcagcgccgtcgtgctccccggagtggaggcg
gccgagcgcgccggggtgcccgccttcctggagacctccgcgccccgcaa
cctccccttctacgagcggctcggcttcaccgtcaccgccgacgtcgagg
tgcccgaaggaccgcgcacctggtgcatgacccgcaagcccggtgcctga SEQ ID NO: 10
eGFP gene, coding sequence
gtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcga
gctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcg
agggcgatgccacctacggcaagctgaccctgaagttcatctgcaccacc
ggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacgg
cgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttct
tcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttc
aaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcga
caccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacg
gcaacatcctggggcacaagctggagtacaactacaacagccacaacgtc
tatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagat
ccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagc
agaacacccccatcggcgacggccccgtgctgctgcccgacaaccactac
ctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatca
catggtcctgctggagttcgtgaccgccgccgggatcactctcggcatgg
acgagctgtacaagtaa SEQ ID NO: 11 Sequence of IRES from ECMV
ccccctaacgttactggccgaagccgcttggaataaggccggtgtgcgtt
tgtctatatgttattttccaccatattgccgtcttttggcaatgtgaggg
cccggaaacctggccctgtcttcttgacgagcattcctaggggtctttcc
cctctcgccaaaggaatgcaaggtctgttgaatgtcgtgaaggaagcagt
tcctctggaagcttcttgaagacaaacaacgtctgtagcgaccctttgca
ggcagcggaaccccccacctggcgacaggtgcctctgcggccaaaagcca
cgtgtataagatacacctgcaaaggcggcacaaccccagtgccacgttgt
gagttggatagttgtggaaagagtcaaatggctctcctcaagcgtattca
acaaggggctgaaggatgcccagaaggtaccccattgtatgggatctgat
ctggggcctcggtgcacatgctttacatgtgtttagtcgaggttaaaaaa
cgtctaggccccccgaaccacggggacgtggttttcctttgaaaaacacg at SEQ ID NO: 12
RSV promoter ggatgtacgggccagatatacgcgtatctgaggggactagggtgtgttta
ggcgaaaagcggggcttcggttgtacgcggttaggagtcccctcaggata
tagtagtttcgcttttgcatagggagggggaaatgtagtcttatgcaata
cacttgtagtcttgcaacatggtaacgatgagttagcaacatgccttaca
aggagagaaaaagcaccgtgcatgccgattggtggaagtaaggtggtacg
atcgtgccttattaggaaggcaacagacaggtctgacatggattggacga
accactgaattccgcattgcagagataattgtatttaagtgcctagctcg
atacaataaacgccatttgaccattcaccacattggtgtgcacctcc SEQ ID NO: 13 SV40
promoter Cagctgtggaatgtgtgtcagttagggtgtggaaagtccccaggctcccc
agcaggcagaagtatgcaaagcatgcatctcaattagtcagcaaccaggt
gtggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcat
ctcaattagtcagcaaccatagtcccgcccctaactccgcccatcccgcc
cctaactccgcccagttccgcccattctccgccccatggctgactaattt
tttttatttatgcagaggccgaggccgcctcggcctctgagctattccag
aagtagtgaggaggcttttttggaggc SEQ ID NO: 14 Sequence of ubiquitin
promoter tctgccgagtcattgtccttgtcccgcggccccgggagccccccgcgacc
ggcctgggaggctcagggaggttgaagggggctgagcaaaggaagccccg
tcattacctcaaatgtgacccaaaaataaagacccgtccatctcgcaggg
tgggccagggcgggtcaggagggaggggagggagaccccgactctgcaga
aggcgctcgctgcgtgccccacgtccgccgaacgcggggttcgcgacccg
aggggaccgcgggggctgaggggaggggccgcggagccgcggctaaggaa
cgcgggccgcccacccgctccgggtgcagcggcctccgcgccgggttttg
gcgcctcccgcgggcgcccccctcctcacggcgagcgctgccacgtcaga
cgaagggcgcagcgagcgtcctgatccttccgcccggacgctcaggacag
cggcccgctgctcataagactcggccttagaaccccagtatcagcagaag
gacattttaggacgggacttgggtgactctagggcactggttttctttcc
agagagcggaacaggcgaggaaaagtagtcccttctcggcgattctgcgg
agggatctccgtggggcggtgaacgccgatgattatataaggacgcgccg
ggtgtggcacagctagttccgtcgcagccgggatttgggtcgcggttctt
gtttgtggatcgctgtgatcgtcacttggtgagtagcgggctgctgggct
ggccggggctttcgtggccgccgggccgctcggtgggacggaagcgtgtg
gagagaccgccaagggctgtagtctgggtccgcgagcaaggttgccctga
actgggggttggggggagcgcagcaaaatggcggctgttcccgagtcttg
aatggaagacgcttgtgaggcgggctgtgaggtcgttgaaacaaggtggg
gggcatggtgggcggcaagaacccaaggtcttgaggccttcgctaatgcg
ggaaagctcttattcgggtgagatgggctggggcaccatctggggaccct
gacgtgaagtttgtcactgactggagaactcggtttgtcgtctgttgcgg
gggcggcagttatggcggtgccgttgggcagtgcacccgtacctttggga
gcgcgcgccctcgtcgtgtcgtgacgtcacccgttctgttggcttataat
gcagggtggggccacctgccggtaggtgtgcggtaggcttttctccgtcg
caggacgcagggttcgggcctagggtaggctctcctgaatcgacaggcgc
cggacctctggtgaggggagggataagtgaggcgtcagtttctttggtcg
gttttatgtacctatcttcttaagtagctgaagctccggttttgaactat
gcgctcggggttggcgagtgtgttttgtgaagttttttaggcaccttttg
aaatgtaatcatttgggtcaatatgtaattttcagtgttagactagtaaa
ttgtccgctaaattctggccgtttttggcttttttgttagacg SEQ ID NO: 15 SB
inverted repeats Tacagttgaagtcggaagtttacatacacttaagttggagtcattaaaac
tcgtttttcaactactccacaaatttcttgttaacaaacaatagttttgg
caagtcagttaggacatctactttgtgcatgacacaagtcatttttccaa
caattgtttacagacagattatttcacttataattcactgtatcacaatt
ccagtgggtcagaagtttacatacact AND
Gtatgttaacttctgacccactgggaatgtgatgaaagaaataaaagctg
aaatgaatcattctctctactattattctgatatttcacattcttaaaat
aaagtggtgatcctaactgaccttaagacagggaatctttactcggatta
aatgtcaggaattgtgaaaaagtgagtttaaatgtatttggctaaggtgt
atgtaaacttccgacttcaactgta SEQ ID NO: 16 pSBT/SV40-GFIP.loxP,
sequence SB inverted repeats SV40 promoter Start codon FRT site
eGFP Puro tcgcgcgtttcggtgatgacggtgaaaacctctgacacatgcagctcccg
gagacggtcacagcttgtctgtaagcggatgccgggagcagacaagcccg
tcagggcgcgtcagcgggtgttggcgggtgtcggggctggcttaactatg
cggcatcagagcagattgtactgagagtgcaccatatgcggtgtgaaata
ccgcacagatgcgtaaggagaaaataccgcatcaggcgccattcgccatt
caggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctat
tacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgggta
acgccagggttttcccagtcacgacgttgtaaaacgacggccagtgaatt
cgagctcggtaccctacagttgaagtcggaagtttacatacacttaagtt
ggagtcattaaaactcgtttttcaactactccacaaatttcttgttaaca
aacaatagttttggcaagtcagttaggacatctactttgtgcatgacaca
agtcatttttccaacaattgtttacagacagattatttcacttataattc
actgtatcacaattccagtgggtcagaagtttacatacactaagttgact
gtgcctttaaacagcttggaaaattccagaaaatgatgtcatggctttag
aagcttctgatagactaattgacatcatttgagtcaattggaggtgtacc
tgtggatgtatttcaagggaattctgtggaatgtgtgtcagttagggtgt
ggaaagtccccaggctccccaggcaggcagaagtatgcaaagcatcgagg
atgtacgggccagatatacgcgataacttcgtataatgtatgctatacga
agttatcgcgtgaggttttcaccgtcatcaccgaaacgcgcgaggcagct
gtggaatgtgtgtcagttagggtgtggaaagtccccaggctccccagcag
gcagaagtatgcaaagcatgcatctcaattagtcagcaaccaggtgtgga
aagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaa
ttagtcagcaaccatagtcccgcccctaactccgcccatcccgcccctaa
ctccgcccagttccgcccattctccgccccatggctgactaatttttttt
atttatgcagaggccgaggccgcctcggcctctgagctattccagaagta
gtgaggaggcttttttggaggctaccatggagaagttactattccgaagt
tcctattctctagaaagtataggaacttcaagcttggcactggtgagcaa
gggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacg
gcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgat
gccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagct
gcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagt
gcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtcc
gccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacga
cggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctgg
tgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatc
ctggggcacaagctggagtacaactacaacagccacaacgtctatatcat
ggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccaca
acatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacc
cccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcac
ccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcc
tgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctg
tacaagtaaagcggccgcggccaattgggccaccggtgctagccccctaa
cgttactggccgaagccgcttggaataaggccggtgtgcgtttgtctata
tgttattttccaccatattgccgtcttttggcaatgtgagggcccggaaa
cctggccctgtcttcttgacgagcattcctaggggtctttcccctctcgc
caaaggaatgcaaggtctgttgaatgtcgtgaaggaagcagttcctctgg
aagcttcttgaagacaaacaacgtctgtagcgaccctttgcaggcagcgg
aaccccccacctggcgacaggtgcctctgcggccaaaagccacgtgtata
agatacacctgcaaaggcggcacaaccccagtgccacgttgtgagttgga
tagttgtggaaagagtcaaatggctctcctcaagcgtattcaacaagggg
ctgaaggatgcccagaaggtaccccattgtatgggatctgatctggggcc
tcggtgcacatgctttacatgtgtttagtcgaggttaaaaaacgtctagg
ccccccgaaccacggggacgtggttttcctttgaaaaacacgataatacc
atgaccgagtacaagcccacggtgcgcctcgccacccgcgacgacgtccc
ccgggccgtacgcaccctcgccgccgcgttcgccgactaccccgccacgc
gccacaccgtcgatccggaccgccacatcgagcgggtcaccgagctgcaa
gaactcttcctcacgcgcgtcgggctcgacatcggcaaggtgtgggtcgc
ggacgacggcgccgcggtggcggtctggaccacgccggagagcgtcgaag
cgggggcggtgttcgccgagatcggcccgcgcatggccgagttgagcggt
tcccggctggccgcgcagcaacagatggaaggcctcctggcgccgcaccg
gcccaaggagcccgcgtggttcctggccaccgtcggcgtctcgcccgacc
accagggcaagggtctgggcagcgccgtcgtgctccccggagtggaggcg
gccgagcgcgccggggtgcccgccttcctggagacctccgcgccccgcaa
cctccccttctacgagcggctcggcttcaccgtcaccgccgacgtcgagg
tgcccgaaggaccgcgcacctggtgcatgacccgcaagcccggtgcctga
cgcccgcccacaagacccgcagcgcccgaccgaaaggagcgcacgacccc
atgcatcgaatcgatatcgcggccgcgactctagatcataatcagcccgg
gggtgatcagcctcgactgtgccttctagttgccagccatctgttgtttg
cccctcccccgtgccttccttgaccctggaaggtgccactcccactgtcc
tttcctaataaaatgaggaaattgcatcgcattgtctgagtaggtgtcat
tctattctggggggtggggtggggcaggacagcaagggggaggattggga
agacaatagcaggcatgctggggatgcggtgggctctatggaaccagctg
gggctcgacattctagttgtggtttgtccaaactcatcaatgtatcttat
catgtctggatcccatcacaaagctctgacctcaatcctatagaaaggag
gaatgagccaaaattcacccaacttattgtgggaagcttgtggaaggcta
ctcgaaatgtttgacccaagttaaacaatttaaaggcaatgctaccaaat
actaattgagtgtatgttaacttctgacccactgggaatgtgatgaaaga
aataaaagctgaaatgaatcattctctctactattattctgatatttcac
attcttaaaataaagtggtgatcctaactgaccttaagacagggaatctt
tactcggattaaatgtcaggaattgtgaaaaagtgagtttaaatgtattt
ggctaaggtgtatgtaaacttccgacttcaactgtagggatcctctagag
tcgacctgcaggcatgcaagcttggcgtaatcatggtcatagctgtttcc
tgtgtgaaattgttatccgctcacaattccacacaacatacgagccggaa
gcataaagtgtaaagcctggggtgcctaatgagtgagctaactcacatta
attgcgttgcgctcactgcccgctttccagtcgggaaacctgtcgtgcca
gctgcattaatgaatcggccaacgcgcggggagaggcggtttgcgtattg
ggcgctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcgg
ctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccac
agaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaa
aggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctc
cgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcg
aaacccgacaggactataaagataccaggcgtttccccctggaagctccc
tcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcc
tttctcccttcgggaagcgtggcgctttctcaatgctcacgctgtaggta
tctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaac
cccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgag
tccaacccggtaagacacgacttatcgccactggcagcagccactggtaa
caggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagt
ggtggcctaactacggctacactagaaggacagtatttggtatctgcgct
ctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccgg
caaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcaga
ttacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacg
gggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcat
gagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaa
gttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttac
caatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttc
atccatagttgcctgactccccgtcgtgtagataactacgatacgggagg
gcttaccatctggccccagtgctgcaatgataccgcgagacccacgctca
ccggctccagatttatcagcaataaaccagccagccggaagggccgagcg
cagaagtggtcctgcaactttatccgcctccatccagtctattaattgtt
gccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgtt
gttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggc
ttcattcagctccggttcccaacgatcaaggcgagttacatgatccccca
tgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcaga
agtaagttggccgcagtgttatcactcatggttatggcagcactgcataa
ttctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagt
actcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctct
tgcccggcgtcaatacgggataataccgcgccacatagcagaactttaaa
agtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatct
taccgctgttgagatccagttcgatgtaacccactcgtgcacccaactga
tcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacagg
aaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaa
tactcatactcttcctttttcaatattattgaagcatttatcagggttat
tgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaat
aggggttccgcgcacatttccccgaaaagtgccacctgacgtctaagaaa
ccattattatcatgacattaacctataaaaataggcgtatcacgaggccc tttcgtc SEQ ID
NO: 17 pSBT/RSV-GFIP, sequence SB inverted repeats RSV promoter
Start codon FRT site eGFP Puro
tcgcgcgtttcggtgatgacggtgaaaacctctgacacatgcagctcccg
gagacggtcacagcttgtctgtaagcggatgccgggagcagacaagcccg
tcagggcgcgtcagcgggtgttggcgggtgtcggggctggcttaactatg
cggcatcagagcagattgtactgagagtgcaccatatgcggtgtgaaata
ccgcacagatgcgtaaggagaaaataccgcatcaggcgccattcgccatt
caggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctat
tacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgggta
acgccagggttttcccagtcacgacgttgtaaaacgacggccagtgaatt
cgagctcggtaccctacagttgaagtcggaagtttacatacacttaagtt
ggagtcattaaaactcgtttttcaactactccacaaatttcttgttaaca
aacaatagttttggcaagtcagttaggacatctactttgtgcatgacaca
agtcatttttccaacaattgtttacagacagattatttcacttataattc
actgtatcacaattccagtgggtcagaagtttacatacactaagttgact
gtgcctttaaacagcttggaaaattccagaaaatgatgtcatggctttag
aagcttctgatagactaattgacatcatttgagtcaattggaggtgtacc
tgtggatgtatttcaagggaattctgtggaatgtgtgtcagttagggtgt
ggaaagtccccaggctccccaggcaggcagaagtatgcaaagcatcgagg
atgtacgggccagatatacgcgtatctgaggggactagggtgtgtttagg
cgaaaagcggggcttcggttgtacgcggttaggagtcccctcaggatata
gtagtttcgcttttgcatagggagggggaaatgtagtcttatgcaataca
cttgtagtcttgcaacatggtaacgatgagttagcaacatgccttacaag
gagagaaaaagcaccgtgcatgccgattggtggaagtaaggtggtacgat
cgtgccttattaggaaggcaacagacaggtctgacatggattggacgaac
cactgaattccgcattgcagagataattgtatttaagtgcctagctcgat
acaataaacgccatttgaccattcaccacattggtgtgcacctccaaagc
ttgatatctaccatggagaagttactattccgaagttcctattctctaga
aagtataggaacttcaagcttggcactggtgagcaagggcgaggagctgt
tcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggc
cacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaa
gctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggc
ccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctac
cccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaagg
ctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaaga
cccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgag
ctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagct
ggagtacaactacaacagccacaacgtctatatcatggccgacaagcaga
agaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggc
agcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacgg
ccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctga
gcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtg
accgccgccgggatcactctcggcatggacgagctgtacaagtaaagcat
agcggccgtaaattccgcccctctctccctcccccccccctaacgttact
ggccgaagccgcttggaataaggccggtgtgcgtttgtctatatgttatt
ttccaccatattgccgtcttttggcaatgtgagggcccggaaacctggcc
ctgtcttcttgacgagcattcctaggggtctttcccctctcgccaaagga
atgcaaggtctgttgaatgtcgtgaaggaagcagttcctctggaagcttc
ttgaagacaaacaacgtctgtagcgaccctttgcaggcagcggaaccccc
cacctggcgacaggtgcctctgcggccaaaagccacgtgtataagataca
cctgcaaaggcggcacaaccccagtgccacgttgtgagttggatagttgt
ggaaagagtcaaatggctctcctcaagcgtattcaacaaggggctgaagg
atgcccagaaggtaccccattgtatgggatctgatctggggcctcggtgc
acatgctttacatgtgtttagtcgaggttaaaaaacgtctaggccccccg
aaccacggggacgtggttttcctttgaaaaacacgatgataagcttgcca
caaccatgaccgagtacaagcccacggtgcgcctcgccacccgcgacgac
gtcccccgggccgtacgcaccctcgccgccgcgttcgccgactaccccgc
cacgcgccacaccgtcgatccggaccgccacatcgagcgggtcaccgagc
tgcaagaactcttcctcacgcgcgtcgggctcgacatcggcaaggtgtgg
gtcgcggacgacggcgccgcggtggcggtctggaccacgccggagagcgt
cgaagcgggggcggtgttcgccgagatcggcccgcgcatggccgagttga
gcggttcccggctggccgcgcagcaacagatggaaggcctcctggcgccg
caccggcccaaggagcccgcgtggttcctggccaccgtcggcgtctcgcc
cgaccaccagggcaagggtctgggcagcgccgtcgtgctccccggagtgg
aggcggccgagcgcgccggggtgcccgccttcctggagacctccgcgccc
cgcaacctccccttctacgagcggctcggcttcaccgtcaccgccgacgt
cgaggtgcccgaaggaccgcgcacctggtgcatgacccgcaagcccggtg
cctgaagatcccccgggggatcagcctcgactgtgccttctagttgccag
ccatctgttgtttgcccctcccccgtgccttccttgaccctggaaggtgc
cactcccactgtcctttcctaataaaatgaggaaattgcatcgcattgtc
tgagtaggtgtcattctattctggggggtggggtggggcaggacagcaag
ggggaggattgggaagacaatagcaggcatgctggggatgcggtgggctc
tatggaaccagctggggctcgacattctagttgtggtttgtccaaactca
tcaatgtatcttatcatgtctggatcccatcacaaagctctgacctcaat
cctatagaaaggaggaatgagccaaaattcacccaacttattgtgggaag
cttgtggaaggctactcgaaatgtttgacccaagttaaacaatttaaagg
caatgctaccaaatactaattgagtgtatgttaacttctgacccactggg
aatgtgatgaaagaaataaaagctgaaatgaatcattctctctactatta
ttctgatatttcacattcttaaaataaagtggtgatcctaactgacctta
agacagggaatctttactcggattaaatgtcaggaattgtgaaaaagtga
gtttaaatgtatttggctaaggtgtatgtaaacttccgacttcaactgta
gggatcctctagagtcgacctgcaggcatgcaagcttggcgtaatcatgg
tcatagctgtttcctgtgtgaaattgttatccgctcacaattccacacaa
catacgagccggaagcataaagtgtaaagcctggggtgcctaatgagtga
gctaactcacattaattgcgttgcgctcactgcccgctttccagtcggga
aacctgtcgtgccagctgcattaatgaatcggccaacgcgcggggagagg
cggtttgcgtattgggcgctcttccgcttcctcgctcactgactcgctgc
gctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggta
atacggttatccacagaatcaggggataacgcaggaaagaacatgtgagc
aaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgt
ttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctca
agtcagaggtggcgaaacccgacaggactataaagataccaggcgtttcc
ccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccg
gatacctgtccgcctttctcccttcgggaagcgtggcgctttctcaatgc
tcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctggg
ctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggta
actatcgtcttgagtccaacccggtaagacacgacttatcgccactggca
gcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctac
agagttcttgaagtggtggcctaactacggctacactagaaggacagtat
ttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggt
agctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgt
ttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctt
tgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaa
gggattttggtcatgagattatcaaaaaggatcttcacctagatcctttt
aaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaactt
ggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatc
tgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataac
tacgatacgggagggcttaccatctggccccagtgctgcaatgataccgc
gagacccacgctcaccggctccagatttatcagcaataaaccagccagcc
ggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatcca
gtctattaattgttgccgggaagctagagtaagtagttcgccagttaata
gtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcg
tcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagt
tacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctc
cgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatg
gcagcactgcataattctcttactgtcatgccatccgtaagatgcttttc
tgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggc
gaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacat
agcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaa
actctcaaggatcttaccgctgttgagatccagttcgatgtaacccactc
gtgcacccaactgatcttcagcatcttttactttcaccagcgtttctggg
tgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgac
acggaaatgttgaatactcatactcttcctttttcaatattattgaagca
tttatcagggttattgtctcatgagcggatacatatttgaatgtatttag
aaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacc
tgacgtctaagaaaccattattatcatgacattaacctataaaaataggc
gtatcacgaggccctttcgtc SEQ ID NO: 18 pSBT/SV40-GFIP, sequence SB
inverted repeats SV40 promoter Start codon FRT site eGFP Puro
tcgcgcgtttcggtgatgacggtgaaaacctctgacacatgcagctcccg
gagacggtcacagcttgtctgtaagcggatgccgggagcagacaagcccg
tcagggcgcgtcagcgggtgttggcgggtgtcggggctggcttaactatg
cggcatcagagcagattgtactgagagtgcaccatatgcggtgtgaaata
ccgcacagatgcgtaaggagaaaataccgcatcaggcgccattcgccatt
caggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctat
tacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgggta
acgccagggttttcccagtcacgacgttgtaaaacgacggccagtgaatt
cgagctcggtaccctacagttgaagtcggaagtttacatacacttaagtt
ggagtcattaaaactcgtttttcaactactccacaaatttcttgttaaca
aacaatagttttggcaagtcagttaggacatctactttgtgcatgacaca
agtcatttttccaacaattgtttacagacagattatttcacttataattc
actgtatcacaattccagtgggtcagaagtttacatacactaagttgact
gtgcctttaaacagcttggaaaattccagaaaatgatgtcatggctttag
aagcttctgatagactaattgacatcatttgagtcaattggaggtgtacc
tgtggatgtatttcaagggaattctgtggaatgtgtgtcagttagggtgt
ggaaagtccccaggctccccaggcaggcagaagtatgcaaagcatcgagg
atgtacgggccagatatacgcgtgaggttttcaccgtcatcaccgaaacg
cgcgaggcagctgtggaatgtgtgtcagttagggtgtggaaagtccccag
gctccccagcaggcagaagtatgcaaagcatgcatctcaattagtcagca
accaggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaag
catgcatctcaattagtcagcaaccatagtcccgcccctaactccgccca
tcccgcccctaactccgcccagttccgcccattctccgccccatggctga
ctaattttttttatttatgcagaggccgaggccgcctcggcctctgagct
attccagaagtagtgaggaggcttttttggaggctaccatggagaagtta
ctattccgaagttcctattctctagaaagtataggaacttcaagcttggc
actggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctgg
tcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgag
ggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcac
caccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacct
acggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgac
ttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatctt
cttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagg
gcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggag
gacggcaacatcctggggcacaagctggagtacaactacaacagccacaa
cgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttca
agatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactac
cagcagaacacccccatcggcgacggccccgtgctgctgcccgacaacca
ctacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcg
atcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggc
atggacgagctgtacaagtaaagcggccgcggccaattgggccaccggtg
ctagccccctaacgttactggccgaagccgcttggaataaggccggtgtg
cgtttgtctatatgttattttccaccatattgccgtcttttggcaatgtg
agggcccggaaacctggccctgtcttcttgacgagcattcctaggggtct
ttcccctctcgccaaaggaatgcaaggtctgttgaatgtcgtgaaggaag
cagttcctctggaagcttcttgaagacaaacaacgtctgtagcgaccctt
tgcaggcagcggaaccccccacctggcgacaggtgcctctgcggccaaaa
gccacgtgtataagatacacctgcaaaggcggcacaaccccagtgccacg
ttgtgagttggatagttgtggaaagagtcaaatggctctcctcaagcgta
ttcaacaaggggctgaaggatgcccagaaggtaccccattgtatgggatc
tgatctggggcctcggtgcacatgctttacatgtgtttagtcgaggttaa
aaaacgtctaggccccccgaaccacggggacgtggttttcctttgaaaaa
cacgataataccatgaccgagtacaagcccacggtgcgcctcgccacccg
cgacgacgtcccccgggccgtacgcaccctcgccgccgcgttcgccgact
accccgccacgcgccacaccgtcgatccggaccgccacatcgagcgggtc
accgagctgcaagaactcttcctcacgcgcgtcgggctcgacatcggcaa
ggtgtgggtcgcggacgacggcgccgcggtggcggtctggaccacgccgg
agagcgtcgaagcgggggcggtgttcgccgagatcggcccgcgcatggcc
gagttgagcggttcccggctggccgcgcagcaacagatggaaggcctcct
ggcgccgcaccggcccaaggagcccgcgtggttcctggccaccgtcggcg
tctcgcccgaccaccagggcaagggtctgggcagcgccgtcgtgctcccc
ggagtggaggcggccgagcgcgccggggtgcccgccttcctggagacctc
cgcgccccgcaacctccccttctacgagcggctcggcttcaccgtcaccg
ccgacgtcgaggtgcccgaaggaccgcgcacctggtgcatgacccgcaag
cccggtgcctgacgcccgcccacaagacccgcagcgcccgaccgaaagga
gcgcacgaccccatgcatcgaatcgatatcgcggccgcgactctagatca
taatcagcccgggggtgatcagcctcgactgtgccttctagttgccagcc
atctgttgtttgcccctcccccgtgccttccttgaccctggaaggtgcca
ctcccactgtcctttcctaataaaatgaggaaattgcatcgcattgtctg
agtaggtgtcattctattctggggggtggggtggggcaggacagcaaggg
ggaggattgggaagacaatagcaggcatgctggggatgcggtgggctcta
tggaaccagctggggctcgacattctagttgtggtttgtccaaactcatc
aatgtatcttatcatgtctggatcccatcacaaagctctgacctcaatcc
tatagaaaggaggaatgagccaaaattcacccaacttattgtgggaagct
tgtggaaggctactcgaaatgtttgacccaagttaaacaatttaaaggca
atgctaccaaatactaattgagtgtatgttaacttctgacccactgggaa
tgtgatgaaagaaataaaagctgaaatgaatcattctctctactattatt
ctgatatttcacattcttaaaataaagtggtgatcctaactgaccttaag
acagggaatctttactcggattaaatgtcaggaattgtgaaaaagtgagt
ttaaatgtatttggctaaggtgtatgtaaacttccgacttcaactgtagg
gatcctctagagtcgacctgcaggcatgcaagcttggcgtaatcatggtc
atagctgtttcctgtgtgaaattgttatccgctcacaattccacacaaca
tacgagccggaagcataaagtgtaaagcctggggtgcctaatgagtgagc
taactcacattaattgcgttgcgctcactgcccgctttccagtcgggaaa
cctgtcgtgccagctgcattaatgaatcggccaacgcgcggggagaggcg
gtttgcgtattgggcgctcttccgcttcctcgctcactgactcgctgcgc
tcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaat
acggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaa
aaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgttt
ttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaag
tcagaggtggcgaaacccgacaggactataaagataccaggcgtttcccc
ctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccgga
tacctgtccgcctttctcccttcgggaagcgtggcgctttctcaatgctc
acgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggct
gtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaac
tatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagc
agccactggtaacaggattagcagagcgaggtatgtaggcggtgctacag
agttcttgaagtggtggcctaactacggctacactagaaggacagtattt
ggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtag
ctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgttt
gcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttg
atcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagg
gattttggtcatgagattatcaaaaaggatcttcacctagatccttttaa
attaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttgg
tctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctg
tctatttcgttcatccatagttgcctgactccccgtcgtgtagataacta
cgatacgggagggcttaccatctggccccagtgctgcaatgataccgcga
gacccacgctcaccggctccagatttatcagcaataaaccagccagccgg
aagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagt
ctattaattgttgccgggaagctagagtaagtagttcgccagttaatagt
ttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtc
gtttggtatggcttcattcagctccggttcccaacgatcaaggcgagtta
catgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccg
atcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggc
agcactgcataattctcttactgtcatgccatccgtaagatgcttttctg
tgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcga
ccgagttgctcttgcccggcgtcaatacgggataataccgcgccacatag
cagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaac
tctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgt
gcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtg
agcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacac
ggaaatgttgaatactcatactcttcctttttcaatattattgaagcatt
tatcagggttattgtctcatgagcggatacatatttgaatgtatttagaa
aaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctg
acgtctaagaaaccattattatcatgacattaacctataaaaataggcgt
atcacgaggccctttcgtc SEQ ID NO: 19 pSBT/SV40-GFIP.loxP, sequence SB
inverted repeats SV40 promoter Start codon FRT site eGFP Puro
tcgcgcgtttcggtgatgacggtgaaaacctctgacacatgcagctcccg
gagacggtcacagcttgtctgtaagcggatgccgggagcagacaagcccg
tcagggcgcgtcagcgggtgttggcgggtgtcggggctggcttaactatg
cggcatcagagcagattgtactgagagtgcaccatatgcggtgtgaaata
ccgcacagatgcgtaaggagaaaataccgcatcaggcgccattcgccatt
caggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctat
tacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgggta
acgccagggttttcccagtcacgacgttgtaaaacgacggccagtgaatt
cgagctcggtaccctacagttgaagtcggaagtttacatacacttaagtt
ggagtcattaaaactcgtttttcaactactccacaaatttcttgttaaca
aacaatagttttggcaagtcagttaggacatctactttgtgcatgacaca
agtcatttttccaacaattgtttacagacagattatttcacttataattc
actgtatcacaattccagtgggtcagaagtttacatacactaagttgact
gtgcctttaaacagcttggaaaattccagaaaatgatgtcatggctttag
aagcttctgatagactaattgacatcatttgagtcaattggaggtgtacc
tgtggatgtatttcaagggaattctgtggaatgtgtgtcagttagggtgt
ggaaagtccccaggctccccaggcaggcagaagtatgcaaagcatcgagg
atgtacgggccagatatacgcgataacttcgtataatgtatgctatacga
agttatcgcgtgaggttttcaccgtcatcaccgaaacgcgcgaggcagct
gtggaatgtgtgtcagttagggtgtggaaagtccccaggctccccagcag
gcagaagtatgcaaagcatgcatctcaattagtcagcaaccaggtgtgga
aagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaa
ttagtcagcaaccatagtcccgcccctaactccgcccatcccgcccctaa
ctccgcccagttccgcccattctccgccccatggctgactaatttttttt
atttatgcagaggccgaggccgcctcggcctctgagctattccagaagta
gtgaggaggcttttttggaggctaccatggagaagttactattccgaagt
tcctattctctagaaagtataggaacttcaagcttggcactggtgagcaa
gggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacg
gcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgat
gccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagct
gcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagt
gcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtcc
gccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacga
cggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctgg
tgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatc
ctggggcacaagctggagtacaactacaacagccacaacgtctatatcat
ggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccaca
acatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacc
cccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcac
ccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcc
tgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctg
tacaagtaaagcggccgcggccaattgggccaccggtgctagccccctaa
cgttactggccgaagccgcttggaataaggccggtgtgcgtttgtctata
tgttattttccaccatattgccgtcttttggcaatgtgagggcccggaaa
cctggccctgtcttcttgacgagcattcctaggggtctttcccctctcgc
caaaggaatgcaaggtctgttgaatgtcgtgaaggaagcagttcctctgg
aagcttcttgaagacaaacaacgtctgtagcgaccctttgcaggcagcgg
aaccccccacctggcgacaggtgcctctgcggccaaaagccacgtgtata
agatacacctgcaaaggcggcacaaccccagtgccacgttgtgagttgga
tagttgtggaaagagtcaaatggctctcctcaagcgtattcaacaagggg
ctgaaggatgcccagaaggtaccccattgtatgggatctgatctggggcc
tcggtgcacatgctttacatgtgtttagtcgaggttaaaaaacgtctagg
ccccccgaaccacggggacgtggttttcctttgaaaaacacgataatacc
atgaccgagtacaagcccacggtgcgcctcgccacccgcgacgacgtccc
ccgggccgtacgcaccctcgccgccgcgttcgccgactaccccgccacgc
gccacaccgtcgatccggaccgccacatcgagcgggtcaccgagctgcaa
gaactcttcctcacgcgcgtcgggctcgacatcggcaaggtgtgggtcgc
ggacgacggcgccgcggtggcggtctggaccacgccggagagcgtcgaag
cgggggcggtgttcgccgagatcggcccgcgcatggccgagttgagcggt
tcccggctggccgcgcagcaacagatggaaggcctcctggcgccgcaccg
gcccaaggagcccgcgtggttcctggccaccgtcggcgtctcgcccgacc
accagggcaagggtctgggcagcgccgtcgtgctccccggagtggaggcg
gccgagcgcgccggggtgcccgccttcctggagacctccgcgccccgcaa
cctccccttctacgagcggctcggcttcaccgtcaccgccgacgtcgagg
tgcccgaaggaccgcgcacctggtgcatgacccgcaagcccggtgcctga
cgcccgcccacaagacccgcagcgcccgaccgaaaggagcgcacgacccc
atgcatcgaatcgatatcgcggccgcgactctagatcataatcagcccgg
gggtgatcagcctcgactgtgccttctagttgccagccatctgttgtttg
cccctcccccgtgccttccttgaccctggaaggtgccactcccactgtcc
tttcctaataaaatgaggaaattgcatcgcattgtctgagtaggtgtcat
tctattctggggggtggggtggggcaggacagcaagggggaggattggga
agacaatagcaggcatgctggggatgcggtgggctctatggaaccagctg
gggcgcgattaacttcgtataaagtctcctatacgaagttatcgcgccat
tctagttgtggtttgtccaaactcatcaatgtatcttatcatgtctggat
cccatcacaaagctctgacctcaatcctatagaaaggaggaatgagccaa
aattcacccaacttattgtgggaagcttgtggaaggctactcgaaatgtt
tgacccaagttaaacaatttaaaggcaatgctaccaaatactaattgagt
gtatgttaacttctgacccactgggaatgtgatgaaagaaataaaagctg
aaatgaatcattctctctactattattctgatatttcacattcttaaaat
aaagtggtgatcctaactgaccttaagacagggaatctttactcggatta
aatgtcaggaattgtgaaaaagtgagtttaaatgtatttggctaaggtgt
atgtaaacttccgacttcaactgtagggatcctctagagtcgacctgcag
gcatgcaagcttggcgtaatcatggtcatagctgtttcctgtgtgaaatt
gttatccgctcacaattccacacaacatacgagccggaagcataaagtgt
aaagcctggggtgcctaatgagtgagctaactcacattaattgcgttgcg
ctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaat
gaatcggccaacgcgcggggagaggcggtttgcgtattgggcgctcttcc
gcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagc
ggtatcagctcactcaaaggcggtaatacggttatccacagaatcagggg
ataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaac
cgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctga
cgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacag
gactataaagataccaggcgtttccccctggaagctccctcgtgcgctct
cctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttc
gggaagcgtggcgctttctcaatgctcacgctgtaggtatctcagttcgg
tgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcag
cccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggt
aagacacgacttatcgccactggcagcagccactggtaacaggattagca
gagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaac
tacggctacactagaaggacagtatttggtatctgcgctctgctgaagcc
agttaccttcggaaaaagagttggtagctcttgatccggcaaacaaacca
ccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcaga
aaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgc
tcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaa
aaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatca
atctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaat
cagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttg
cctgactccccgtcgtgtagataactacgatacgggagggcttaccatct
ggccccagtgctgcaatgataccgcgagacccacgctcaccggctccaga
tttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtc
ctgcaactttatccgcctccatccagtctattaattgttgccgggaagct
agagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgc
tacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagct
ccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaa
aaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggc
cgcagtgttatcactcatggttatggcagcactgcataattctcttactg
tcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaag
tcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtc
aatacgggataataccgcgccacatagcagaactttaaaagtgctcatca
ttggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttg
agatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatc
ttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatg
ccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactc
ttcctttttcaatattattgaagcatttatcagggttattgtctcatgag
cggatacatatttgaatgtatttagaaaaataaacaaataggggttccgc
gcacatttccccgaaaagtgccacctgacgtctaagaaaccattattatc
atgacattaacctataaaaataggcgtatcacgaggccctttcgtc SEQ ID NO: 20
FRThygro cassette
CTATTCCTTTGCCCTCGGACGAGTGCTGGGGCGTCGGTTTCCACTATCGG
CGAGTACTTCTACACAGCCATCGGTCCAGACGGCCGCGCTTCTGCGGGCG
ATTTGTGTACGCCCGACAGTCCCGGCTCCGGATCGGACGATTGCGTCGCA
TCGACCCTGCGCCCAAGCTGCATCATCGAAATTGCCGTCAACCAAGCTCT
GATAGAGTTGGTCAAGACCAATGCGGAGCATATACGCCCGGAGCCGCGGC
GATCCTGCAAGCTCCGGATGCCTCCGCTCGAAGTAGCGCGTCTGCTGCTC
CATACAAGCCAACCACGGCCTCCAGAAGAAGATGTTGGCGACCTCGTATT
GGGAATCCCCGAACATCGCCTCGCTCCAGTCAATGACCGCTGTTATGCGG
CCATTGTCCGTCAGGACATTGTTGGAGCCGAAATCCGCGTGCACGAGGTG
CCGGACTTCGGGGCAGTCCTCGGCCCAAAGCATCAGCTCATCGAGAGCCT
GCGCGACGGACGCACTGACGGTGTCGTCCATCACAGTTTGCCAGTGATAC
ACATGGGGATCAGCAATCGCGCATATGAAATCACGCCATGTAGTGTATTG
ACCGATTCCTTGCGGTCCGAATGGGCCGAACCCGCTCGTCTGGCTAAGAT
CGGCCGCAGCGATCGCATCCATGGCCTCCGCGACCGGCTGCAGAACAGCG
GGCAGTTCGGTTTCAGGCAGGTCTTGCAACGTGACACCCTGTGCACGGCG
GGAGATGCAATAGGTCAGGCTCTCGCTGAATTCCCCAATGTCAAGCACTT
CCGGAATCGGGAGCGCGGCCGATGCAAAGTGCCGATAAACATAACGATCT
TTGTAGAAACCATCGGCGCAGCTATTTACCCGCAGGACATATCCACGCCC
TCCTACATCGAAGCTGAAAGCACGAGATTCTTCGCCCTCCGAGAGCTGCA
TCAGGTCGGAGACGCTGTCGAACTTTTCGATCAGAAACTTCTCGACAGAC
GTCGCGGTGAGTTCAGGCTTTTT SEQ ID NO: 21 Sequence of
pLV/FRThygro.PGKpurc (ERThygro cassette indicated in green)
AAGCTTGGCCATTGCATACGTTGTATCCATATCATAATATGTACATTTAT
ATTGGCTCATGTCCAACATTACCGCCATGTTGACATTGATTATTGACTAG
TTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGG
AGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCC
AACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAAC
GCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAA
CTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCT
ATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACAT
GACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCG
CTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAG
CGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGG
GAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACA
ACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTC
TATATAAGCAGAGCTCGTTTAGTGAACCGGGGTCTCTCTGGTTAGACCAG
ATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGCC
TCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGTTGT
GTGACTCTGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAA
ATCTCTAGCAGTGGCGCCCGAACAGGGACCTGAAAGCGAAAGGGAAACCA
GAGCTCTCTCGACGCAGGACTCGGCTTGCTGAAGCGCGCACGGCAAGAGG
CGAGGGGCGGCGACTGGTGAGTACGCCAAAAATTTTGACTAGCGGAGGCT
AGAAGGAGAGAGATGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAGAATT
AGATCGCGATGGGAAAAAATTCGGTTAAGGCCAGGGGGAAAGAAAAAATA
TAAATTAAAACATATAGTATGGGCAAGCAGGGAGCTAGAACGATTCGCAG
TTAATCCTGGCCTGTTAGAAACATCAGAAGGCTGTAGACAAATACTGGGA
CAGCTACAACCATCCCTTCAGACAGGATCAGAAGAACTTAGATCATTATA
TAATACAGTAGCAACCCTCTATTGTGTGCATCAAAGGATAGAGATAAAAG
ACACCAAGGAAGCTTTAGACAAGATAGAGGAAGAGCAAAACAAAAGTAAG
ACCACCGCACAGCAAGCGGCCGCTGATCTTCAGACCTGGAGGAGGAGATA
TGAGGGACAATTGGAGAAGTGAATTATATAAATATAAAGTAGTAAAAATT
GAACCATTAGGAGTAGCACCCACCAAGGCAAAGAGAAGAGTGGTGCAGAG
AGAAAAAAGAGCAGTGGGAATAGGAGCTTTGTTCCTTGGGTTCTTGGGAG
CAGCAGGAAGCACTATGGGCGCAGCCTCAATGACGCTGACGGTACAGGCC
AGACAATTATTGTCTGGTATAGTGCAGCAGCAGAACAATTTGCTGAGGGC
TATTGAGGCGCAACAGCATCTGTTGCAACTCACAGTCTGGGGCATCAAGC
AGCTCCAGGCAAGAATCCTGGCTGTGGAAAGATACCTAAAGGATCAACAG
CTCCTGGGGATTTGGGGTTGCTCTGGAAAACTCATTTGCACCACTGCTGT
GCCTTGGAATGCTAGTTGGAGTAATAAATCTCTGGAACAGATTGGAATCA
CACGACCTGGATGGAGTGGGACAGAGAAATTAACAATTACACAAGCTTAA
TACACTCCTTAATTGAAGAATCGCAAAACCAGCAAGAAAAGAATGAACAA
GAATTATTGGAATTAGATAAATGGGCAAGTTTGTGGAATTGGTTTAACAT
AACAAATTGGCTGTGGTATATAAAATTATTCATAATGATAGTAGGAGGCT
TGGTAGGTTTAAGAATAGTTTTTGCTGTACTTTCTATAGTGAATAGAGTT
AGGCAGGGATATTCACCATTATCGTTTCAGACCCACCTCCCAACCCCGAG
GGGACCCGACAGGCCCGAAGGAATAGAAGAAGAAGGTGGAGAGAGAGACA
GAGACAGATCCATTCGATTAGTGAACGGATCTCGACGGTATCGGTTCTGG
CACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAA
TGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTC
CGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGA
AACAGCTATGACCATGATTACGCCAAGCTCTAGCTAGAGGTCGACGGTAT
ACAGACATGATAAGATACATTGATGAGTTTGGACAAACCACAACTAGAAT
GCAGTGAAAAAAATGCTTTATTTGTGAAATTTGTGATGCTATTGCTTTAT
TTGTAACCATTATAAGCTGCAATAAACAAGTTGGGGTGGGCGAAGAACTC
CAGCATGAGATCCCCGCGCTGGAGGATCATCCAGCCGGCGTCCCGGAAAA
CGATTCCGAAGCCCAACCTTTCATAGAAGGCGGCGGTGGAATCGAAATCT
CGTAGTACGTGCTATTCCTTTGCCCTCGGACGAGTGCTGGGGCGTCGGTT
TCCACTATCGGCGAGTACTTCTACACAGCCATCGGTCCAGACGGCCGCGC
TTCTGCGGGCGATTTGTGTACGCCCGACAGTCCCGGCTCCGGATCGGACG
ATTGCGTCGCATCGACCCTGCGCCCAAGCTGCATCATCGAAATTGCCGTC
AACCAAGCTCTGATAGAGTTGGTCAAGACCAATGCGGAGCATATACGCCC
GGAGCCGCGGCGATCCTGCAAGCTCCGGATGCCTCCGCTCGAAGTAGCGC
GTCTGCTGCTCCATACAAGCCAACCACGGCCTCCAGAAGAAGATGTTGGC
GACCTCGTATTGGGAATCCCCGAACATCGCCTCGCTCCAGTCAATGACCG
CTGTTATGCGGCCATTGTCCGTCAGGACATTGTTGGAGCCGAAATCCGCG
TGCACGAGGTGCCGGACTTCGGGGCAGTCCTCGGCCCAAAGCATCAGCTC
ATCGAGAGCCTGCGCGACGGACGCACTGACGGTGTCGTCCATCACAGTTT
GCCAGTGATACACATGGGGATCAGCAATCGCGCATATGAAATCACGCCAT
GTAGTGTATTGACCGATTCCTTGCGGTCCGAATGGGCCGAACCCGCTCGT
CTGGCTAAGATCGGCCGCAGCGATCGCATCCATGGCCTCCGCGACCGGCT
GCAGAACAGCGGGCAGTTCGGTTTCAGGCAGGTCTTGCAACGTGACACCC
TGTGCACGGCGGGAGATGCAATAGGTCAGGCTCTCGCTGAATTCCCCAAT
GTCAAGCACTTCCGGAATCGGGAGCGCGGCCGATGCAAAGTGCCGATAAA
CATAACGATCTTTGTAGAAACCATCGGCGCAGCTATTTACCCGCAGGACA
TATCCACGCCCTCCTACATCGAAGCTGAAAGCACGAGATTCTTCGCCCTC
CGAGAGCTGCATCAGGTCGGAGACGCTGTCGAACTTTTCGATCAGAAACT
TCTCGACAGACGTCGCGGTGAGTTCAGGCTTTTTGGCCAAGGAAGTTCCT
ATACTTTCTAGAGAATAGGAACTTCGGAATAGGAACTTCTAGGTACGTGA
ACCATCACCCTAATCAAGTTTTTTGGGGTCGAGGTGCCGTAAAGCACTAA
ATCGGAACCCTAAAGGGACCCCCGATTTAGAGCTTGACGGGGAAAGCCGG
CGAACGTGGCGAGAAAGGAAGGGAAGAAAGCGAAAGGAGCGGGCGCTAGG
GCGCTGGCAAGTGTAGCGGTCACGCTGCGCGTAACCACCACACCCGCCGC
GCTTAATGCGCCGCTACAGGGCGCGTGGGGATACCCCCTAGAGCCCCAGA
ACTTTTAAAAGAAAAGGGGGGATTGGGGGGTACAGTGCAGGGGAAAGAAT
AGTAGACATAATAGCAACAGACATACAAACTAAAGAATTACAAAAACAAA
TTACAAAAATTCAAAATTTTATCGATCACGAGACTAGCCTCGACGATGGT
CGAGTACCGGGTAGGGGAGGCGCTTTTCCCAAGGCAGTCTGGAGCATGCG
CTTTAGCAGCCCCGCTGGGCACTTGGCGCTACACAAGTGGCCTCTGGCCT
CGCACACATTCCACATCCACCGGTAGGCGCCAACCGGCTCCGTTCTTTGG
TGGCCCCTTCGCGCCACCTTCTACTCCTCCCCTAGTCAGGAAGTTCCCCC
CCGCCCCGCAGCTCGCGTCGTGCAGGACGTGACAAATGGAAGTAGCACGT
CTCACTAGTCTCGTGCAGATGGACAGCACCGCTGAGCAATGGAAGCGGGT
AGGCCTTTGGGGCAGCGGCCAATAGCAGCTTTGCTCCTTCGCTTTCTGGG
CTCAGAGGCTGGGAAGGGGTGGGTCCGGGGGCGGGCTCAGGGGCGGGCTC
AGGGGCGGGGCGGGCGCCCGAAGGTCCTCCGGAGGCCCGGCATTCTGCAC
GCTTCAAAAGCGCACGTCTGCCGCGCTGTTCTCCTCTTCCTCATCTCCGG
GCCTTTCGACCTCTAGCGGGATCCAAGCTTACCATGACCGAGTACAAGCC
CACGGTGCGCCTCGCCACCCGCGACGACGTCCCCCGGGCCGTACGCACCC
TCGCCGCCGCGTTCGCCGACTACCCCGCCACGCGCCACACCGTCGACCCG
GACCGCCACATCGAGCGGGTCACCGAGCTGCAAGAACTCTTCCTCACGCG
CGTCGGGCTCGACATCGGCAAGGTGTGGGTCGCGGACGACGGCGCCGCGG
TGGCGGTCTGGACCACGCCGGAGAGCGTCGAAGCGGGGGCGGTGTTCGCC
GAGATCGGCCCGCGCATGGCCGAGTTGAGCGGTTCCCGGCTGGCCGCGCA
GCAACAGATGGAAGGCCTCCTGGCGCCGCACCGGCCCAAGGAGCCCGCGT
GGTTCCTGGCCACCGTCGGCGTCTCGCCCGACCACCAGGGCAAGGGTCTG
GGCAGCGCCGTCGTGCTCCCCGGAGTGGAGGCGGCCGAGCGCGCCGGGGT
GCCCGCCTTCCTGGAGACCTCCGCGCCCCGCAACCTCCCCTTCTACGAGC
GGCTCGGCTTCACCGTCACCGCCGACGTCGAGGTGCCCGAAGGACCGCGC
ACCTGGTGCATGACCCGCAAGCCCGGTGCCTGACTCGAGGGAATTCCGAT
AATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAA
CTATGTTGCTCCTTTTACGCTATGTGGATACGCTGCTTTAATGCCTTTGT
ATCATGCTATTGCTTCCCGTATGGCTTTCATTTTCTCCTCCTTGTATAAA
TCCTGGTTGCTGTCTCTTTATGAGGAGTTGTGGCCCGTTGTCAGGCAACG
TGGCGTGGTGTGCACTGTGTTTGCTGACGCAACCCCCACTGGTTGGGGCA
TTGCCACCACCTGTCAGCTCCTTTCCGGGACTTTCGCTTTCCCCCTCCCT
ATTGCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCGCTGCTGGACAGG
GGCTCGGCTGTTGGGCACTGACAATTCCGTGGTGTTGTCGGGGAAGCTGA
CGTCCTTTCCATGGCTGCTCGCCTGTGTTGCCACCTGGATTCTGCGCGGG
ACGTCCTTCTGCTACGTCCCTTCGGCCCTCAATCCAGCGGACCTTCCTTC
CCGCGGCCTGCTGCCGGCTCTGCGGCCTCTTCCGCGTCTTCGCCTTCGCC
CTCAGACGAGTCGGATCTCCCTTTGGGCCGCCTCCCCGCATCGGGAATTC
GAGCTCGGTACCTTTAAGACCAATGACTTACAAGGCAGCTGTAGATCTTA
GCCACTTTTTAAAAGAAAAGGGGGGACTGGAAGGGCTAATTCACTCCCAA
CGAAGACAAGATCTGCTTTTTGCTTGTACTGGGTCTCTCTGGTTAGACCA
GATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGC
CTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGTTG
TGTGACTCTGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAA
AATCTCTAGCAGCATCTAGCTAGAATTAATTCCGTGTATTCTATAGTGTC
ACCTAAATCGTATGTGTATGATACATAAGGTTATGTATTAATTGTAGCCG
CGTTCTAACGACAATATGTACAAGCCTAATTGTGTAGCATCTGGCTTACT
GAAGCAGACCCTATCATCTCTCTCGTAAACTGCCGTCAGAGTCGGTTTGG
TTGGACGAACCTTCTGAGTTTCTGGTAACGCCGTCCCGCACCCGGAAATG
GTCAGCGAACCAATCAGCAGGGTCATCGCTAGCCTAGGCTTTTGCGTCGA
GACGTACCCAATTCGCCCTATAGTGAGTCGTATTACGCGCGCTCACTGGC
CGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTA
ATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAG
GCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATG
GCGCGACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTA
CGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTC
GCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGC
TCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACC
TCGACCCCAAAAAACTTGATTAGGGTGATGGTTCACGTAGTGGGCCATCG
CCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAA
TAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGTCT
ATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAA
AATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAATATTAAC
GTTTACAATTTCCCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCC
TATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGAC
AATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGT
ATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCT
TCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAG
ATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGT
AAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCAC
TTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTATTGACGCCGGGC
AAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAG
TACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGA
ATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTAC
TTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAAC
ATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGA
AGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAA
CAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGG
CAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCT
GCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCG
GTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAG
CCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGA
TGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATT
GGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAA
CTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCT
CATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACC
CCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTA
ATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTT
GCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCA
GAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCAC
CACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCT
GTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGG
ACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGG
GGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAG
ATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAA
AGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACG
AGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTT
TCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGC
GGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCC
TTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTC
TGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCA
GCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGC
CCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAG
CTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAA
TTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATG
CTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACAC
AGGAAACAGCTATGACCATGATTACGCCAAGCGCGCAATTAACCCTCACT
AAAGGGAACAAAAGCTGGAGCTGC
* * * * *