U.S. patent application number 12/598266 was filed with the patent office on 2010-06-10 for polymorphisms in genes affecting dopamine transporter disorders and uses thereof.
This patent application is currently assigned to THE OHIO STATE UNIVERSITY RESEARCH FOUNDATION. Invention is credited to Audrey C. Papp, Julia Pinsonneault, Wolfgang Sadee.
Application Number | 20100143921 12/598266 |
Document ID | / |
Family ID | 39943820 |
Filed Date | 2010-06-10 |
United States Patent
Application |
20100143921 |
Kind Code |
A1 |
Sadee; Wolfgang ; et
al. |
June 10, 2010 |
Polymorphisms in Genes Affecting Dopamine Transporter Disorders and
Uses Thereof
Abstract
A method for predicting a subject's risk factors for dopamine
transporter or SLC6A3-related disorders. The method includes
detecting the allelic status of one or more polymorphisms in a
nucleic acid sample of the subject. The present invention also
provides a related kit, comprising an assay for detecting the
allelic status of one or more polymorphisms in a nucleic acid
sample of a subject.
Inventors: |
Sadee; Wolfgang; (Upper
Arlington, OH) ; Papp; Audrey C.; (Columbus, OH)
; Pinsonneault; Julia; (Columbus, OH) |
Correspondence
Address: |
MACMILLAN SOBANSKI & TODD, LLC
ONE MARITIME PLAZA FIFTH FLOOR, 720 WATER STREET
TOLEDO
OH
43604-1619
US
|
Assignee: |
THE OHIO STATE UNIVERSITY RESEARCH
FOUNDATION
Columbus
OH
|
Family ID: |
39943820 |
Appl. No.: |
12/598266 |
Filed: |
April 30, 2008 |
PCT Filed: |
April 30, 2008 |
PCT NO: |
PCT/US08/05556 |
371 Date: |
February 6, 2010 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60926932 |
Apr 30, 2007 |
|
|
|
Current U.S.
Class: |
435/6.11 ;
435/287.2; 435/6.14; 506/16; 536/23.1; 536/24.3 |
Current CPC
Class: |
C12Q 2600/156 20130101;
C12Q 2600/16 20130101; C12Q 2600/158 20130101; C12Q 2600/154
20130101; C12Q 1/6883 20130101; C12Q 2600/172 20130101; C12Q
2535/131 20130101; C12Q 2600/106 20130101; C12Q 1/6883
20130101 |
Class at
Publication: |
435/6 ; 506/16;
435/287.2; 536/23.1; 536/24.3 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68; C40B 40/06 20060101 C40B040/06; C12M 1/34 20060101
C12M001/34; C07H 21/00 20060101 C07H021/00 |
Goverment Interests
GOVERNMENT SUPPORT
[0002] The invention was made with government support from the
National Institutes of Health research grants HL 74730, HL 69758
and RR017568. The government may have certain rights in the
invention.
Claims
1. A method for predicting a subject's risk factors for an
SLC6A3-related disorder, the method comprising detecting the
allelic status of one or more polymorphisms in a nucleic acid
sample of the subject, wherein the polymorphism is one or more of:
(i) SLC6A3-associated SNPs rs6347, rs27072 or combinations thereof;
or, (ii) a SNP in linkage disequilibrium with one or more SNPs
listed in (i), wherein the allelic status of the polymorphism in
the subject is predictive of the subject's risk for having or
developing the SLC6A3-related disorder.
2. A method of screening a subject for a prognostic biomarker of an
SLC6A3-related disorder, comprising detecting the allelic status of
one or more polymorphisms in a nucleic acid sample of the subject,
wherein the polymorphism is one or more of: (i) SLC6A3-associated
SNPs rs6347, rs27072 or combinations thereof; or, (ii) a SNP in
linkage disequilibrium with one or more SNPs listed in (i), wherein
the allelic status of the polymorphism in the subject is predictive
of the prognostic outcome of the SLC6A3-related disorder.
3. The method of claim 1, further comprising the step of
correlating the allelic status of the polymorphism in the subject
with the allelic status of the polymorphism in a reference
population to predict the subject's risk for having or developing
the SLC6A3-related disorder.
4. The method of claim 1, further comprising the step of
correlating the allelic status of the polymorphism in the subject
with the allelic status of the polymorphism in a reference
population to predict whether the subject has a more or less severe
phenotype of the SLC6A3-related disorder.
5. The method of claim 1, further comprising the step of
correlating the allelic status of the polymorphism in the subject
with the allelic status of the polymorphism in a reference
population to predict the prognostic outcome of the disorder in the
subject.
6. The method of claim 1, claims, further comprising the step of
correlating the allelic status of the polymorphism in the subject
with the allelic status of the polymorphism in a reference
population to predict the subject's response to treatment.
7. The method of claim 1, wherein the SLC6A3-related disorder
comprises a dopamine-related disorder.
8. The method of claim 1, wherein the SLC6A3-related disorder
comprises one or more of alcoholism, attention deficit
hyperactivity disorder, bipolar disorder, clinical depression, drug
abuse, Parkinson disease, Tourette syndrome and Schizophrenia.
9. The method of claim 1, wherein the therapeutic agent comprises
one or more stimulant medications, such as those used to treat
ADHD, and drugs of abuse such as amphetamine bind to SLC6A3 and
inhibit reuptake of dopamine.
10. The method of claim 1, wherein the therapeutic agent comprises
one or more of: SLC6A3 inhibitors or SLC6A3 enhancers.
11. The method of claim 1, wherein the polymorphism comprises a
SLC6A3-associated 2 SNP haplotype comprising SNPs rs6347,
rs27072.
12. The method of claim 1, wherein the polymorphism comprises an
SLC6A3-associated SNP haplotype comprising SNP rs6347.
13. The method of claim 1, wherein the polymorphism comprises
rs6347, rs27072 or combinations thereof, wherein the presence of
the polymorphism in a subject is predictive of an increased risk
for a SLC6A3-related disorder.
14. The method of claim 1, wherein the presence of a minor allele
of the polymorphism is predictive of lower levels of SLC6A3 in
target tissue and is associated with a decreased SLC6A3 mRNA
expression.
15. A kit comprising an assay for detecting the allelic status of
one or more polymorphisms in a nucleic acid sample of a subject,
wherein the polymorphism is one or more of: (i) SLC6A3-associated
SNPs rs6347, rs27072 or combinations thereof; or, (ii) a SNP in
linkage disequilibrium with one or more SNPs listed in (i).
16. The kit of claim 15, further comprising instructions for
correlating the assay results with the subject's risk for having or
developing a SLC6A3-related disorder.
17. The kit of claim 15, further comprising instructions for
correlating the assay results with the subject's prognostic outcome
for the disorder.
18. The kit of claim 15, further comprising instructions for
correlating the assay results with the probability of success or
failure of a particular drug treatment in the subject.
19-25. (canceled)
26. A method for identifying susceptibility to an SLC6A3-related
disorder in a subject, comprising: obtaining a sample from a human
subject; and determining if the sample contains a risk allele of
SLC6A3-associated SNPs rs6347, rs27072 or combinations thereof.
27. A method of screening a subject for susceptibility to an
SLC6A3-related disorder, comprising: obtaining a sample from a
human subject; detecting a risk allele of the; and providing an
indication of susceptibility to the disorder based on the detection
of the risk allele.
28. A microarray comprising oligonucleotide probes capable of
hybridizing under stringent conditions to one or more nucleic acid
molecules having a polymorphic variant sequence at the site
encoding SLC6A3-associated SNPs rs6347, rs27072 or combinations
thereof.
29. A system for identifying a phenotype for an organism or
biological sample derived therefrom, the system comprising: a) a
set of marker probes or primers configured to detect at least one
allelic status associated with the phenotype, wherein the allele
SLC6A3-associated SNPs rs6347, rs27072 or combinations thereof; b)
a detector that is configured to detect one or more signal outputs
from the set of marker probes or primers, or an amplicon produced
from the set of marker probes or primers, thereby identifying the
presence or absence of the allele; and, c) system instructions that
correlate the presence or absence of the allele with the predicted
phenotype, thereby identifying the phenotype for the organism or
biological sample derived therefrom.
30. The system of claim 29, wherein the phenotype comprises a
diagnosis of or predisposition to an SLC6A3-related disorder.
31. A subset of SNPs comprising the SLC6A3-associated SNPs rs6347,
rs27072.
32. The subset of SNPs of claim 31, wherein the subset of SNPs are
use in predicting a phenotype of a subject.
33. A composition comprising a set of probes that hybridize to at
least the SLC6A3-associated SNPs rs6347, rs27072 or combinations
thereof.
Description
RELATED APPLICATIONS
[0001] This application claims priority to U.S. Provisional Patent
Application 60/926,932 filed Apr. 30, 2007, the disclosure of which
is incorporated herein by reference, in its entirety.
BACKGROUND
[0003] Single nucleotide polymorphisms (SNPs) are useful as
biomarkers for predicting disease susceptibility or progression, or
as a guide for individualized therapy, including drug therapy.
[0004] ACE--
[0005] Angiotensin I-converting enzyme (ACE) plays a key role in
cardiovascular biology. Its functions include formation of
angiotensin II and inactivation of bradykinin, resulting in
vasoconstriction and increased blood pressure. ACE inhibitors are
recommended as first-line treatment of hypertension and heart
failure. Expressed in many tissues, ACE further affects a broad
spectrum of physiological processes. As a result, the ACE gene has
been implicated in susceptibility to hypertension, myocardial
infarction, renal pathophysiology, diabetes, and Alzheimer's
disease.
[0006] In particular, angiotensin I-converting enzyme (ACE1) is
expressed with a wide tissue distribution including plasma,
endothelial cells, kidney, heart and lungs. This enzyme hydrolyzes
a number of substrates, including conversion of angiotensin I to
angiotensin II (as part of the renin-angiotensin system).
Angiotensin II (AngII) is a potent vasoconstrictor and
pro-hypertrophic factor. Ang II induces production of superoxide
free radicals (O.sub.2.sup.-) that scavenge available nitric oxide
and reduce endothelial vasodilatation. ACE1 has even greater
affinity for bradykinin, thus hydrolyzing and inactivating a potent
vasodilator. Through these pathways, ACE1 exerts potent
physiological influence over salt balance, blood volume and blood
pressure levels with significant implications for cardiovascular
disease in particular.
[0007] Targeted reduction of ACE1 via the blockbuster drug class of
ACE inhibitors that directly bind the active site of the ACE
protein is a first line anti-hypertensive treatment for heart
disease. ACE inhibitors decrease the release of aldosterone and
retention of salt and water, significantly lowering blood pressure.
Drugs in this class have been shown to reduce mortality in many
large clinical trials. These drugs are often administered
immediately following myocardial infarction. They currently
represent a major pharmaceutical class with millions of
prescriptions worldwide, with additional indications in
hypertension or renal crisis in relation to scleroderma, and
prevention of kidney damage in some diabetics. Furthermore, recent
literature indicates that ACE1 may play a role in the degradation
of Alzheimer's plaques making it a possible disease factor
(26,39).
[0008] It has been determined that there is variability in patient
responses to ACE inhibitor treatment. Family-based studies over the
last two decades indicate that ACE1 levels as a quantitative
phenotype are strongly influenced by a genetic component that maps
to the ACE1 locus; however, well-supported functional variants
remain to be identified (40,1,11). Nonetheless, this has been
considered one of the most compelling examples in human genetics of
a single gene contributing to variability in a complex human trait.
Intolerance for ACE inhibitors is as high as 20%, with the most
common side effect being a severe cough, especially in Asian
patients (41).
[0009] Moreover, studies in African-American patients on ACE
inhibitors indicated they received less benefit (16) and increased
risk of side effects (4-5 fold) (18) and mortality from angioedema
(42-45), suggesting a possible pharmacogenetic influence on drug
response. An intron 16 ALU insertion-deletion polymorphism of 287
by has been extensively studied, because it revealed significant
associations in a number of studies. However, several research
groups have shown that this polymorphism is unlikely to have any
direct functional role (5,4) and, instead, is likely in linkage to
one or more true, and as yet undetermined, functional variants.
Studies employing diverse populations and public data from the
HapMap project indicate the ALU polymorphism alone is an inadequate
proxy for the genetic diversity at this gene locus. However, there
are thousands of studies genotyping solely the ALU polymorphism in
a variety of clinical populations. These demonstrate both positive
and negative associations, as reflected in metanalyses of this
variant (3). Since these previous studies rely on the assumption
that the ALU polymorphism is completely or highly linked to true
functional variants, they may be missing critical information if
this assumption is incorrect or only partially correct. For
example, one study of outcomes in 38,000 individuals receiving ACE
inhibitor treatment genotyped only the ALU polymorphism and found
no significant association (2):
[0010] The suggestion of a heritable component to serum ACE
activity (1) led to extensive phenotype-genotype studies with
ACE-related pathophysiology and response to ACE inhibitors (2).
Numerous studies have focused on an insertion/deletion (I/D)
polymorphism in intron 15. However, meta-analyses of phenotypic
associations largely failed to confirm a role for I/D (3), and in
vitro experiments did not reveal any effect on transcription (4) or
splicing (5). Therefore, genetic factors contributing to
differential ACE expression remain uncertain.
[0011] What are lacking are tools for predicting the likelihood
that a particular patient will be responsive to a therapeutic ACE,
and in particular, identifying agents to which the ACE will be
sensitive or resistant. Also lacking are tools for profiling
genetic factors influencing sensitivity and resistance of patients
to ACE therapeutic agents. Such tools, and the resulting gene
expression profiles, would be predictive of treatment response of a
patient to a particular drug, and would allow for increased
predictability regarding chemosensitivity or chemoresistance of
such patients to enable the design of optimal treatment regimens
for patients.
[0012] SOD2--
[0013] Oxidative stress and damage play a role in the pathogenesis
of a number of diseases. In particular, mitochondrial-derived
oxidants play an important role in the pathogenesis of many human
disorders.
[0014] SOD2 is an antioxidant, the mitochondrial form of SOD and an
important defense against oxidative damage. The SOD2 gene is a
member of the iron/manganese superoxide dismutase family. The
mitochondrial superoxide dismutase protein (SOD2) serves a critical
cellular role in protecting from harmful reactive species by
reducing these species to hydrogen peroxide (H.sub.2O.sub.2) which
is then processed to hydroxide (OH) and then water (H.sub.2O). This
is a normal cellular process that is critical to life and protects
the integrity of cellular genomes. Under conditions of stress
including disease and environmental conditions (e.g., toxins)
reactive species can accumulate to a degree that overwhelms the
capacity of endogenous protectors including SOD2. Thus, if common
alleles exist that affect SOD2 production these alleles may
contribute to many diseases, but may only be important under
conditions of accumulated oxidative stress.
[0015] What are lacking are tools for predicting the likelihood
that a particular patient will be responsive to a therapeutic SOD2
agent, and in particular, identifying agents to which the SOD2
agent will be sensitive or resistant.
[0016] Also lacking are tools for profiling genetic factors
influencing sensitivity and resistance of patients to SOD2-caused
oxidative damage.
[0017] SLC6A3--
[0018] Dopamine active transporter (SLC6A3, formerly) is a
membrane-spanning protein that binds the neurotransmitter dopamine.
SLC6A3 provides the primary mechanism through which dopamine is
cleared from synapses. SLC6A3 works by transporting dopamine from
the synapse into a neuron. SLC6A3 is present in the peri-synaptic
area of dopaminergic neurons in areas of the brain where dopamine
signaling is common. SLC6A3 terminates the dopamine signal and is
implicated in a number of dopamine-related disorders, including
alcoholism, attention deficit hyperactivity disorder, bipolar
disorder, clinical depression, drug abuse, Parkinson disease,
Tourette syndrome and Schizophrenia. Stimulant medications, such as
those used to treat ADHD, and drugs of abuse such as amphetamine
bind to SLC6A3 and inhibit reuptake of dopamine. Genetic variants
of SLC6A3 may influence levels of gene expression and/or ability of
drugs to bind to SLC6A3 protein. The gene that encodes the SLC6A3
protein is located on human chromosome 5, consists of 45 coding
exons, and is roughly 64 kpb long. It is believed that the
associations between SLC6A3 and dopamine related disorders has come
from a genetic polymorphism in the SLC6A3 gene, which influences
the amount of protein expressed.
[0019] What are lacking are tools for predicting the likelihood
that a particular patient will be responsive to a therapeutic
SLC6A3 agent, and in particular, identifying agents to which the
SLC6A3 therapeutic agent will be sensitive or resistant.
[0020] CYP2C9--
[0021] CYP2C9 (encoding cytochrome P450 2C9) is a liver drug
metabolizing enzyme, involved in metabolism of .about.20% of
pharmaceuticals. CYP2C9 is a member of the cytochrome P450
mixed-function oxidase system and is involved in the metabolism of
xenobiotics in the body. CYP2C9 is involved in the metabolism of
several groups of drugs, such as, for example, non-steroidal
anti-inflammatory drugs (NSAIDs). Genetic polymorphism exists for
CYP2C9 expression and there is a belief that approximately 1-3% of
Caucasian populations are poor metabolizers with no CYP2C9
function.
[0022] What are lacking are tools for predicting the likelihood
that a particular patient will be responsive to a therapeutic
CYP2C9 agent, and in particular, identifying agents to which the
CYP2C9 agent will be sensitive or resistant.
[0023] Such tools would likewise enable the identification of new
drugs that modulate expression of genes that affect
chemosensitivity, particularly new agents that alter expression of
these genes to overcome drug resistance or enhance
chemosensitivity.
[0024] Additional advantages, objects, and features of the
invention will be set forth in part in the description which
follows and in part will become apparent to those having ordinary
skill in the art upon examination of the following or may be
learned from practice of the invention. The objects and advantages
of the invention may be realized and attained as particularly
pointed out in the appended claims.
SUMMARY
[0025] In a very broad aspect, the disclosure provides for a method
for predicting a subject's risk factors for an ACE-related
disorder, such as, but not limited to cardiovascular diseases
and/or a subject's responsiveness to a therapeutic agent targeting
the subject's renin-angiotension system (for example, ACE
inhibitors angiotension receptor blockers (ARBS) and the like). The
method includes detecting the allelic status of one or more
polymorphisms in a nucleic acid sample of the subject, wherein the
polymorphism is selected from the group of (i) ACE-associated SNPs
rs4290, rs7214530, rs7213516, rs4309, rs4343 or combinations
thereof; or, (ii) a SNP in linkage disequilibrium with one or more
SNPs listed in (i). In such a method, the allelic status of the
polymorphism in the subject is predictive of the subject's risk
factors for an ACE-related disorder.
[0026] In one embodiment, the method further includes the step of
correlating the allelic status of the polymorphism in the subject
with the allelic status of the polymorphism in a reference
population to predict the subject's risk factors for an ACE-related
disorder.
[0027] In another embodiment, the method further includes the step
of correlating the allelic status of the polymorphism in the
subject with the allelic status of the polymorphism in a reference
population to predict whether the subject has risk factors for an
ACE-related disorder.
[0028] In a particular embodiment, the disclosure provides for a
method of screening a subject for a prognostic biomarker,
comprising detecting the allelic status of one or more
polymorphisms in a nucleic acid sample of the subject, wherein the
polymorphism is one or more of: [0029] (i) ACE-associated SNPs
rs4290, rs7214530, rs7213516 or combinations thereof; or, [0030]
(ii) a SNP in linkage disequilibrium with one or more SNPs listed
in (i). In this method, the allelic status of the polymorphism in
the subject is predictive of the prognostic outcome of the
subject.
[0031] In a particular embodiment, the disclosure provides for a
method of screening a subject for a prognostic biomarker,
comprising detecting the allelic status of one or more
polymorphisms in a nucleic acid sample of the subject, wherein the
polymorphism is one or more of: [0032] (i) SOD2-associated SNPs
rs4880, rs5746092 or combinations thereof; or, [0033] (ii) a SNP in
linkage disequilibrium with one or more SNPs listed in (i), wherein
the allelic status of the polymorphism in the subject is predictive
of the subject's risk for having or developing the SOD2-related
disorder.
[0034] In a particular embodiment, the disclosure provides for a
method of screening a subject for a prognostic biomarker,
comprising detecting the allelic status of one or more
polymorphisms in a nucleic acid sample of the subject wherein the
polymorphism is one or more of: [0035] (i) SLC6A3-associated
rs27072, rs6347 or combinations thereof; or, [0036] (ii) a SNP in
linkage disequilibrium with one or more SNPs listed in (i), wherein
the allelic status of the polymorphism in the subject is predictive
of the subject's risk for having or developing the SLC6A3-related
disorder.
[0037] In a particular embodiment, the disclosure provides for a
method of screening a subject for a prognostic biomarker,
comprising detecting the allelic status of one or more
polymorphisms in a nucleic acid sample of the subject, wherein the
polymorphism is one or more of [0038] (i) CYP2C9-associated
rs1057911, rs9332242, rs2017319 or combinations thereof; or, [0039]
(ii) a SNP in linkage disequilibrium with one or more SNPs listed
in (i), wherein the allelic status of the polymorphism in the
subject is predictive of the subject's risk for having or
developing the CYP2C9-related disorder.
[0040] In one embodiment, the method further includes the step of
correlating the allelic status of the polymorphism in the subject
with the allelic status of the polymorphism in a reference
population to predict the prognostic outcome of the subject.
[0041] In another embodiment, the method further includes the step
of correlating the allelic status of the polymorphism in the
subject with the allelic status of the polymorphism in a reference
population to predict whether the subject has a greater or lesser
risk factors for an ACE-related disorder.
[0042] In another embodiment, the method further includes the step
of correlating the allelic status of the polymorphism in the
subject with the allelic status of the polymorphism in a reference
population to predict the subject's response to treatment.
[0043] In one embodiment, the disorders for which a therapeutic ACE
inhibitor may be indicated includes, but is not limited to, one or
more of the following: hypertensive treatment for heart disease,
lowering blood pressure, myocardial infarction, hypertension or
renal crisis in relation to scleroderma, prevention of kidney
damage in diabetics, and Alzheimer's disease.
[0044] The SNPs identified herein can be used in combination with
additional predictive tests including, but not limited to,
additional SNPs, mutations, and clinical tests.
[0045] The disclosure also provides for a method for finding a
functional polymorphism in a target gene implicated a in subject's
risk factors for an ACE-related disorder, comprising: (i) providing
a sample of a target tissue expressing the target gene; (ii)
measuring the target gene's allelic mRNA expression imbalance (AEI)
by quantitatively measuring the relative amounts of mRNA generated
from each of two alleles in a transcribed region of the target gene
and comparing the mRNA expression of one allele against the other
allele to obtain an AEI ratio; and (iii) using the AEI ratio as a
phenotype to scan the target gene for regions containing
polymorphisms. Accordingly, a significant association between the
AEI ratio and the polymorphism indicates that the polymorphism is a
functional polymorphism that can serve as a biomarker for assessing
a subject's risk factors for an ACE-related disorder.
[0046] The present disclosure also relates to a kit comprising
useful components for practicing the present method. A useful kit
can contain oligonucleotide probes specific for ACE alleles. The
kit can also include instructions for correlating the assay results
with the subject's responsiveness to a therapeutic agent, the
subject's prognostic outcome, or the probability of success or
failure of a particular drug treatment in the subject.
BRIEF DESCRIPTION OF THE DRAWINGS
[0047] The patent or application file contains at least one drawing
executed in color. Copies of this patent or patent application
publication with color drawing(s) will be provided by the Office
upon request and payment of the necessary fee.
[0048] The invention can be more fully understood from the
following detailed description, the drawings and the Sequence
Descriptions that form a part of this application. The sequence
descriptions and Sequence Listing attached hereto comply with the
rules governing nucleotide and/or amino acid sequence disclosures
in patent applications as set forth in 37 CFR
.sctn..sctn.1.821-1.825. The Sequence Descriptions contain the
three letter codes for amino acids as defined in 37 CFR
.sctn..sctn.1.821-1.825, which are incorporated herein by
reference.
[0049] FIGS. 1a and 1b. ACE Allelic mRNA expression in left
ventricular heart tissues from African-Americans (FIG. 1a) and
Caucasian-Americans (FIG. 1b). Allelic mRNA expression ratios
(major/minor allele for marker SNPs rs4309 (C/T), rs4343 (A/G)) are
averages of results using both markers. AEI was prevalent in
African-American (FIG. 1a) but not Caucasian-American (FIG. 1b)
heart tissues. Genotypes for the promoter SNPs are indicated above
the African-American samples. Data are mean.+-.SD, ***P<0.001
versus pooled DNA ratios.
[0050] FIGS. 2a and 2b. Total mRNA expression levels of ACE in 65
heart tissues. The boxplots display the median plus or minus one
quartile. Results are grouped by genotype of I/D (rs13447447)
(P=0.93) (FIG. 2a) and carriers of the promoter rs4290 T allele
(FIG. 2b). ACE mRNA levels are relative to .beta.-actin. *P<0.05
versus CC genotype (t-test for mean differences).
[0051] FIGS. 3a and 3b. Luciferase reporter gene assay of the ACE
promoter in bovine aortic endothelial cells (BAEC) FIG. 3a) and
HEK293 cells (FIG. 3b). An ACE promoter DNA fragment spanning from
-4,335 to +1 was cloned into the pGL3-Basic vector, containing
various combinations of the promoter SNPs rs7213516 (GM), rs7214530
(T/G) and rs4290 (C/7).
[0052] The reference haplotype is G-T-C, while the variant
constructs contain 1-3 minor alleles (G-T-T, G-G-C, G-G-T, A-G-C,
A-G-T). In BAEC, 0.8 .mu.g plasmids were co-transfected with 40 ng
Renilla luciferase plasmid using either Lipofectamine or Fugen
reagent, and activity was measured by Dual-Glo luciferase assay kit
(Promega). Luciferase activities from fused-pGL3 vector were
normalized using Renilla luciferase activity as an internal
control. *P<0.05; **P<0.001 compared to reference haplotype
G-T-C. In HEK293 cells, various amounts of plasmid were transfected
using Lipofectamine, with no differences observed between all
conditions.
[0053] FIG. 4. Odds ratios of three polymorphisms for primary
outcome in the overall population and within each race/ethnicity
group. The three polymorphisms are promoter SNPs rs7213516 and
rs4290, and intron 15 SNP rs13447447 (I/D). Odds ratios were
adjusted for age, sex, race/ethnicity, BMI, smoking, INVEST
treatment strategy, previous myocardial infarction, previous
stroke, heart failure, diabetes, renal insufficiency, baseline SBP,
diuretic use, and ACE inhibitor use.
[0054] FIG. 5. ACE gene structure (UCSC genome browser) and
location of polymorphisms tested in this study. The boxes indicate
the exons coding for the two peptidase domains in the full length
ACE isoform. Overviews of HapMap LD in the gene region for
individuals from Utah of Northern-European ancestry (CEU) and from
Yoruba, Nigeria (YR1) are shown at bottom (Haploview).
[0055] FIGS. 6a and 6b. Schematics of the allelic expression
imbalance (AEI) assay used to uncover cis-acting functional
alleles. Shown here, marker SNP rs4309 (C/T) is used in the
SNaPshot reaction for both gDNA and mRNA. Peak area ratios
represent allelic ratios in gDNA and mRNA (after conversion to
cDNA).
[0056] FIG. 7. LD structure of polymorphisms in the INVEST-GENES
clinical genetic association study. Values for D' and r.sup.2 are
provided and color coded; the light blue boxes indicate very low
allele abundance preventing calculation of D'.
[0057] FIG. 8. Promoter sequence alignments and TF binding sites.
The three promoter SNPs rs7213516 (GM), rs7214530 (T/G) and rs4290
(C/7) are located -2883, -2828 and -2306 by upstream of the
transcription start site (+1). The predicted MEF2A transcription
factor binding sites based on the JASPAR database position-weight
matrices are shown in detail. Sequence alignments (CLUSTALW) are
based on genomic matches identified by BLAST of the human promoter
region (* indicates a 1 by insert in rhesus, dog, elephant, and
armadillo sequences; .dagger. indicates a 9 by insert in dog and
armadillo sequences). Human [SEQ ID NOS 70, 34 and 278,
respectively, in order of appearance], Chimp [SEQ ID NOS 71, 270
and 279, respectively, in order of appearance], Rhesus [SEQ ID NOS
72, 271 and 280, respectively, in order of appearance], Bushbaby
[SEQ ID NOS 76, 272 and 281, respectively, in order of appearance],
Shrew [SEQ ID NOS 73, 273 and 282, respectively, in order of
appearance], Dog [SEQ ID NOS 74, 274 and 283, respectively, in
order of appearance], Elephant [SEQ ID NOS 75, 275 and 284,
respectively, in order of appearance], Squirrel [SEQ ID NOS 77, 276
and 285, respectively, in order of appearance], Armadillo [SEQ ID
NOS 78, 277 and 286, respectively, in order of appearance].
[0058] FIG. 9. Schematic illustration of ACE gene structure and
relevant genetic polyporphism (chromosome 17q.23.3) (not to
scale).
[0059] FIG. 10. Table 1. Unadjusted and adjusted odds ratios and
95% confidence intervals for secondary outcomes by genotype
[0060] FIGS. 11a and 11b. Tables 2A and 2B. Polymorphisms analyzed
in this study, and minor allele frequencies observed in the 65
heart tissues (Table 2A, FIG. 11a) and in the INVEST-GENES cohort
(Table 2B, FIG. 11b), sorted by race/ethnicity. The P values
indicate the level of significance for interethnic differences in
minor allele frequencies.
[0061] FIG. 12. Table 3. Baseline characteristics for the
INVEST-GENES case and control patients.
[0062] FIG. 13. Table 4. Oligonucleotide sequences used in
genotyping and allelic expression imbalance (AEI) assays for ACE
that employed primer extension technology. Underlined nucleotides
were intentionally mismatched against the reference sequence.
[0063] FIG. 14. Table 5. Oligonucleotide sequences employed in
genotyping ACE SNPs by the GC-clamp method described in Papp et
al.
[0064] FIG. 15. Table 6. Oligonucleotides sequences employed in ACE
Pyrosequencing genotyping.
[0065] FIG. 16. Table 7. Oligonucleotide primers used in the
amplification and direct sequencing of the ACE upstream gene region
and cDNA.
[0066] FIG. 17. Table 8. FAM-labeled oligos and related oligos used
in genotyping ACE polymorphisms.
[0067] FIG. 18. Table 9. Oligonucleotides used in the measurement
of ACE expression by RT-PCR, including one that spans cDNA
exons.
[0068] FIG. 19. Table 10. Oligonucleotide sequences used in
genotyping and allelic expression imbalance (AEI) assays for SOD2
that employed primer extension technology.
[0069] FIG. 20. Table 11. A list of SNPs used in the SLC6A3 example
herein.
[0070] FIG. 21. Table 12. A list of SNPs used in the CYP2C9 example
herein.
[0071] FIG. 22--Results of AEI analysis for ACE, SOD2, NOS3 and
CCL2, in heart left ventricular tissues. Each peak represents a
distinct allele measured in genomic DNA or cDNA from a single
heterozygous individual. The selected samples (columns, left to
right) represent the typical genomic DNA ratio observed, a cDNA
showing insignificant deviation from the expected ratio and a cDNA
sample showing highly significant deviation from unity.
Normalization to the average genomic DNA is used in the calculation
of AEI values (cDNA values listed as major:minor allele on a log 2
scale) and accounts for differences in fluorescent
dideoxynucleotide incorporation efficiencies and fluorescence
yields. See FIG. 26--Table 13, for a list of genes reported here
and FIG. 27--Table 14 for marker SNPs and genes showing significant
AEI results.
[0072] FIG. 23. Allelic mRNA expression ratios (major allele over
minor allele, normalized to the mean allelic ratio in genomic DNA)
measured in heart failure samples for 12 cardiovascular candidate
genes. Results for individual samples are displayed with the
magnitude and direction of AEI indicated on a log 2 scale (y-axis).
Potential AEI in individual samples is indicated by ratios
>(+0.3) log 2 or <(-0.3) log 2, a cutoff arrived at by
analysis of the extent of variation in genomic DNA ratios. For the
present survey study we considered ratios >(+0.5) log 2 or
<(-0.5) log 2 to represent significant AEI.
[0073] FIG. 24. Lack of correlation between SOD2 allelic mRNA
expression ratios and allelic CpG methylation ratios in 34 heart
tissue samples. Allelic methylation ratios were determined from
triplicate assays using Hpa II digestion of the genomic DNA region
containing rs4880 (only non-methylated DNA is cut), followed by
SNaPshot analysis of the allelic ratios for uncut genomic DNA.
[0074] FIG. 25. Computed changes of mRNA folding (minimum free
energy conformations) induced by all transitions (SNP generated by
CT and GA substitutions) in the transcribed exonic domains of OPRM1
mRNA. The arrow indicates the location of the functional SNP A118G,
affecting mRNA levels in human brain (18). The x-axis denotes the
nucleotide position in the mature OPRM1 mRNA (cDNA), while the
y-axis represent a scale of the extent by which predicted mRNA
folding is affected by any given transition. Conformations were
calculated for wild-type and mutant sequences using Mfold, and then
the sum of the differences in the Mfold single-strandedness count
measure at each nucleotide was computed both globally (across the
full mRNA structure, each point shown here) and in more regional
sliding windows of different sizes. Sliding windows and analysis of
both types of transversions at each position (pyrimidinepurine), as
well as A>G transitions alone all gave very similar results
(data not shown).
[0075] FIG. 26. Table 13. A list of candidate genes tested for the
presence of AEI in Example II herein.
[0076] FIG. 27. Table 14. Gene showing significant allelic mRNA
expression ratios (at least one sample showing minimally
.+-.0.2.sup.0.5, or .about.40% AEI in either direction.
[0077] FIG. 28. Table 15. Genotyping of suspected functional
polymorphisms compared with AEI data.
[0078] FIG. 29. Table 16. List of candidate genes analyzed in
Example II, grouped by indication (disease or pharmacology). List
of candidate genes analyzed in this study, grouped by indication
(disease or pharmacology). Marker SNPs are all located in
transcribed regions of the mature mRNA, or a splice variant. For
some genes more than one marker SNP and tissue were used.
[0079] FIG. 30. Table 17. List of oligonucleotide primers used for
PCT amplification and SNaPshot primer extension reactions.
[0080] FIG. 31. mRNA sequence of the ACE gene [SEQ ID NO: 261 (DNA)
and SEQ ID NO: 287 (protein)].
[0081] FIG. 32. mRNA sequence of the SOD2 gene[SEQ ID NO: 262 (DNA)
and SEQ ID NO: 288 (protein)].
[0082] FIG. 33. mRNA sequence of the SLC6A3 gene[SEQ ID NO: 263
(DNA) and SEQ ID NO: 289 (protein)].
[0083] FIG. 34. mRNA sequence of the CYP2C9 gene [SEQ ID NO: 264
(DNA) and SEQ ID NO: 290 (protein)].
DETAILED DESCRIPTION OF THE INVENTION
[0084] The present invention will now be described with occasional
reference to the specific embodiments of the invention. This
invention may, however, be embodied in different forms and should
not be construed as limited to the embodiments set forth herein.
Rather, these embodiments are provided so that this disclosure will
be thorough and complete, and will fully convey the scope of the
invention to those skilled in the art.
[0085] All publications, patent applications, patents, and other
references mentioned herein are incorporated by reference in their
entirety. The disclosure of all patents, patent applications (and
any patents that issue thereon, as well as any corresponding
published foreign patent applications), GenBank and other accession
numbers and associated data, and publications mentioned throughout
this description are hereby incorporated by reference herein. It is
expressly not admitted, however, that any of the documents
incorporated by reference herein teach or disclose the present
invention.
[0086] The present invention may be understood more readily by
reference to the following detailed description of the embodiments
of the invention and the Examples included herein. However, before
the present methods, compounds and compositions are disclosed and
described, it is to be understood that this invention is not
limited to specific methods, specific cell types, specific host
cells or specific conditions, etc., as such may, of course, vary,
and the numerous modifications and variations therein will be
apparent to those skilled in the art. It is also to be understood
that the terminology used herein is for the purpose of describing
specific embodiments only and is not intended to be limiting.
[0087] Accordingly, the disclosure provides diagnostic and
prognostic methods, compositions, assays, and kits useful for
predicting the phenotype of a subject's risk factors for
cardiovascular diseases and/or a subject's responsiveness to
therapeutic ACE inhibitors. The methods also include predicting the
prognostic outcome of the subject, as well as the subject's
responsiveness to drug treatments. The methods and kits include
determining the allelic status of polymorphisms in the ACE
genes.
[0088] The disclosure also provides methods for identifying
functional polymorphisms using an allele-specific mRNA expression
imbalance (AEI) assay combined with SNP scanning of a target gene
locus with allelic mRNA ratios as a quantitative phenotype,
together with in vitro molecular genetic analysis to identify the
functional polymorphisms. Also provided are a number of functional
single nucleotide polymorphisms (SNPs) in the ACE gene.
[0089] AEI Assay
[0090] The question of how genetic processes interact to regulate
gene expression can be addressed by measuring allelic expression
imbalance (AEI). Measuring allelic mRNA expression compares one
allele against the other in a relevant target tissue of the same
individual. The assay quantitatively measures the relative amounts
of mRNA generated from each of two alleles in physiologically
relevant target tissues (e.g., specific cardiac regions) from
subjects that are heterozygous for a marker SNP in the transcribed
region of the gene in question. AEI indicates the presence of
cis-acting factors in gene regulation and/or mRNA processing. AEI
results provide a quantitative measure of the allelic differences
in each individual, one allele serving as the control for the
other, while canceling out any trans-acting factors. The allelic
expression ratios are then used as the phenotype to scan a gene
locus for regions containing functional polymorphisms. If
cis-acting polymorphisms contribute to the measured AEI ratios,
significant correlations should be detectable. For this analysis it
is helpful to know the phasing of each SNP with the marker SNPs. As
disclosed in the Examples, the inventors conducted a single locus
association test between SNP genotype and allelic expression
phenotype. The AEI phenotype can be represented either as
present/absent; or absent/present low/present high, or as a
continuous quantitative trait. Significant associations indicate
that a SNP, or one closely linked, contributes to AEI, by affecting
mRNA expression levels. These candidate polymorphisms, or
haplotypes, are then cloned into expression vectors to determine
the molecular mechanisms underlying the genetic changes where this
is possible. A goal of this assay is to identify the polymorphisms
that most closely account for any genetically based phenotypic
differences between individuals.
[0091] Polymorphisms Linked to Function (AEI)
[0092] Using the above method, we were able to designate specific
polymorphisms as biological biomarkers, used either alone or in
combination with each other or with already established biomarkers.
For each polymorphism in the candidate genes, we have established a
link with allelic expression in human biopsy cardiac tissues as the
phenotype. Obtained by scanning the entire gene in a number of
individuals for polymorphisms that correlate with AEI, these
polymorphisms are either directly responsible for altering mRNA
expression, or they are in linkage disequilibrium or strong linkage
disequilibrium with a functional SNP or SNPs. The listed
polymorphisms are frequent (>5%), and have already shown
statistically significant associations with clinical phenotypes.
These polymorphisms therefore represent biallelic biomarkers
associated with functional variants of key genes conveying
susceptibility to CNS disorders and treatment outcome.
[0093] We disclose the use of AEI analysis to screen the ACE gene
for functional polymorphisms. We have discovered several AEI across
a number of individuals, indicating the presence of previously
unknown and yet frequent functional polymorphisms.
[0094] By scanning each gene in a number of individuals we have
identified polymorphisms (SNPs) most closely related to the
functional variation. Because these SNPs are linked to functional
defects, and occur frequently in key candidate genes implicated in
cardiovascular disorders, they represent strong biomarkers for
predicting individual risk and response to ACE inhibitor therapy.
Because their functional significance is established, one can also
analyze combinations of gene variants as risk factors, without
greatly increasing the required statistical stringency for multiple
comparisons.
DEFINITIONS
[0095] Unless defined otherwise, all technical and scientific terms
used herein have the same meaning as commonly understood to one of
ordinary skill in the art to which this disclosure belongs.
[0096] As used herein and in the appended claims, the singular
forms "a," "and," an "the" include plural referents unless the
context clearly dictates otherwise. Thus, for example, reference to
"a polynucleotide" includes a plurality of such polynucleotides and
reference to "the SNP" includes reference to one or more SNPs known
to those skilled in the art, and so forth.
[0097] Unless otherwise indicated, all numbers expressing
quantities of ingredients, properties such as molecular weight,
reaction conditions, and so forth as used in the specification and
claims are to be understood as being modified in all instances by
the term "about." Accordingly, unless otherwise indicated, the
numerical properties set forth in the following specification and
claims are approximations that may vary depending on the desired
properties sought to be obtained in embodiments of the present
invention. Notwithstanding that the numerical ranges and parameters
setting forth the broad scope of the invention are approximations,
the numerical values set forth in the specific examples are
reported as precisely as possible. Any numerical values, however,
inherently contain certain errors necessarily resulting from error
found in their respective measurements.
[0098] The term "allele" is used herein to refer to variants of a
nucleotide sequence. Alleles are identified with respect to one or
more polymorphic positions, with the rest of the gene sequence
unspecified. For example, an allele may be defined by the
nucleotide present at a single SNP; or by the nucleotides present
at a plurality of SNPs, also termed haplotypes. A biallelic
polymorphism has two forms. Diploid organisms may be homozygous or
heterozygous for an allelic form.
[0099] For convenience, the allele present at the higher or highest
frequency in the population will be referred to as the "main" or
"wild-type" allele; less frequent allele(s) will be referred to as
"minor" or "variant" allele(s).
[0100] Assessing the "allelic status" of a polymorphism refers to
determining whether a subject is heterozygous (has one minor allele
and one main allele), homozygous for the minor allele or homozygous
for the main allele.
[0101] A "gene" refers to a segment of genomic DNA that contains
the coding sequence for a protein, wherein the segment may include
promoters, exons, introns, and other untranslated regions that
control expression.
[0102] A "genotype" is an unphased 5' to 3' sequence of nucleotide
pair(s) found at a set of one or more polymorphic sites in a locus
on a pair of homologous chromosomes in a subject.
[0103] The term "genotyping" a sample or a subject for a
polymorphism involves determining the specific allele or the
specific nucleotide(s) carried by an individual at a biallelic
marker.
[0104] The term "haplotype" refers to a combination of alleles
present in an individual or a sample on a single chromosome. In the
context of the present disclosure, a haplotype refers to a
combination of biallelic marker alleles found in a given individual
and which may be associated with a phenotype.
[0105] "Haplotyping" is the process for determining one or more
haplotypes in a subject and includes use of family pedigrees,
molecular techniques and/or statistical inference.
[0106] The term "polymorphism" as used herein refers to the
occurrence of two or more alternative genomic sequences or alleles
between or among different genomes or individuals. "Polymorphic"
refers to the condition in which two or more variants of a specific
genomic sequence can be found in a population. A "polymorphic site"
is the locus at which the variation occurs. A polymorphism may
comprise a substitution, deletion or insertion of one or more
nucleotides. A single nucleotide polymorphism (SNP) is a single
base pair change. Typically, a single nucleotide polymorphism is
the replacement of one nucleotide by another nucleotide at the
polymorphic site. Deletion of a single nucleotide or insertion of a
single nucleotide, also give rise to single nucleotide
polymorphisms. In the context of the present disclosure, "single
nucleotide polymorphism" refers to a single nucleotide
substitution. Typically, between different genomes or between
different individuals, the polymorphic site may be occupied by two
different nucleotides.
[0107] The term "biallelic polymorphism," "bialleleic marker," or
"biomarker" are used interchangeably and refer to a polymorphism
having two alleles at a fairly high frequency in the population,
sometimes a single nucleotide polymorphism. Typically, the
frequency of the less common allele of the biallelic polymorphism
of the present disclosure has been validated to be greater than 1%,
sometimes the frequency is greater than 10%, 20% (i.e.
heterozygosity rate of at least 0.32), or 30% (i.e. heterozygosity
rate of at least 0.42).
[0108] The term "mutation" refers to a difference in DNA sequence
between or among different genomes or individuals that causes a
functional change and which can have a frequency below 1%. Sequence
variants describe any alteration in DNA sequence regardless of
function or frequency.
[0109] "Linkage Disequilibrium" ("LD") refers to alleles at
different loci that are not associated at random, i.e., not
associated in proportion to their frequencies. If the alleles are
in positive linkage disequilibrium, then the alleles occur together
more often than expected assuming statistical independence.
Conversely, if the alleles are in negative linkage disequilibrium,
then the alleles occur together less often than expected assuming
statistical independence. As used herein, "strong linkage
disequilibrium" is defined by D' of >0.8.
[0110] As used interchangeably herein, the terms
"oligonucleotides", and "polynucleotides" include RNA, DNA, or
RNA/DNA hybrid sequences of more than one nucleotide in either
single chain or duplex form. The term "nucleotide" as used herein
as an adjective to describe molecules comprising RNA, DNA, or
RNA/DNA hybrid sequences of any length in single-stranded or duplex
form. The term "nucleotide" is also used herein as a noun to refer
to individual nucleotides or varieties of nucleotides, meaning a
molecule, or individual unit in a larger nucleic acid molecule,
comprising a purine or pyrimidine, a ribose or deoxyribose sugar
moiety, and a phosphate group, or phosphodiester linkage in the
case of nucleotides within an oligonucleotide or
polynucleotide.
[0111] The term "purified" is used herein to describe a
polynucleotide or polynucleotide vector of the disclosure which has
been separated from other compounds including, but not limited to
other nucleic acids, carbohydrates, lipids and proteins (such as
the enzymes used in the synthesis of the polynucleotide), or the
separation of covalently closed polynucleotides from linear
polynucleotides.
[0112] The term "isolated" requires that the material be removed
from its original environment (e.g., the natural environment if it
is naturally occurring). For example, a naturally-occurring
polynucleotide or polypeptide present in a living animal is not
isolated, but the same polynucleotide or DNA or polypeptide,
separated from some or all of the coexisting materials in the
natural system, is isolated. Such polynucleotide could be part of a
vector and/or such polynucleotide or polypeptide could be part of a
composition, and still be isolated in that the vector or
composition is not part of its natural environment.
[0113] The term "heterozygosity rate" is used herein to refer to
the incidence of individuals in a population, which are
heterozygous at a particular allele. In a biallelic system, the
heterozygosity rate is on average equal to 2 Pa(1-Pa), where Pa is
the frequency of the least common allele. In order to be useful in
genetic studies, a genetic biomarker should have an adequate level
of heterozygosity to allow a reasonable probability that a randomly
selected person will be heterozygous.
[0114] The term "upstream" refers to a location which, is toward
the 5' end of the polynucleotide from a specific reference point.
The term "downstream" refers to a location which is toward the 3'
end of the polynucleotide from a specific reference point.
[0115] The terms "base paired" and "Watson & Crick base paired"
are used interchangeably herein to refer to nucleotides which can
be hydrogen bonded to one another be virtue of their sequence
identities in a manner like that found in double-helical DNA with
thymine or uracil residues linked to adenine residues by two
hydrogen bonds and cytosine and guanine residues linked by three
hydrogen bonds (See Stryer, L., Biochemistry, 4th edition, 1995;
incorporated herein by reference).
[0116] The terms "complementary" or "complement thereof" are used
herein to refer to the sequences of polynucleotides which are
capable of forming Watson & Crick base pairing with another
specified polynucleotide throughout the entirety of the
complementary region. This term is applied to pairs of
polynucleotides based solely upon their sequences and not any
particular set of conditions under which the two polynucleotides
would actually bind.
[0117] The term "primer" denotes a specific oligonucleotide
sequence which is complementary to a target nucleotide sequence and
used to hybridize to the target nucleotide sequence. A primer
serves as an initiation point for nucleotide polymerization
catalyzed by either DNA polymerase, RNA polymerase or reverse
transcriptase, or in a single nucleotide extension reaction for the
measurement of AEI.
[0118] The term "probe" denotes a defined nucleic acid segment (or
nucleotide analog segment, e.g., polynucleotide as defined herein)
which can be used to identify a specific polynucleotide sequence
present in samples, said nucleic acid segment comprising a
nucleotide sequence complementary of the specific polynucleotide
sequence to be identified.
[0119] The primers and probes can be prepared by any suitable
method, including, for example, cloning and restriction of
appropriate sequences and direct chemical synthesis. The probes and
primers can comprise nucleic acid analogs such as, for example,
peptide nucleic acids, locked nucleic acid (LNA) analogs, and
morpholino analogs. The 3' end of the probe can be functionalized
with a capture or detectable label to assist in detection of a
polymorphism.
[0120] Any of the oligonucleotides or nucleic acid of the
disclosure can be labeled by incorporating a detectable label
measurable by spectroscopic, photochemical, biochemical,
immunochemical, or chemical means. For example, such labels can
comprise radioactive substances (.sup.32P, .sup.35S, .sup.3H,
.sup.125I) fluorescent dyes (5-bromodesoxyuridin, fluorescein,
acetylaminofluorene, digoxigenin), biotin, nanoparticles, and the
like. Such oligonucleotides are typically labeled at their 3' and
5' ends.
[0121] Probes'can be used to detectably distinguish between target
molecules differing in structure. Detection can be accomplished in
a variety of different ways depending on the type of probe used and
the type of target molecule. Thus, for example, detection may be
based on discrimination of activity levels of the target molecule,
but typically is based on detection of specific binding. Examples
of such specific binding include antibody binding and nucleic acid
probe hybridization. Thus, for example, probes can include enzyme
substrates, antibodies and antibody fragments, and nucleic acid
hybridization probes. Thus, in one embodiment, the detection of the
presence or absence of the at least one variance involves
contacting a target polymorphic site with a probe, typically an
oligonucleotide probe, where the probe hybridizes with a form of
the target nucleic acid containing a complementary base at the
variance site as compared to hybridization to a form of the target
nucleic acid having a non-complementary base at the variance site,
where the hybridization is carried out under selective
hybridization conditions. Such an oligonucleotide probe may span
two or more variance sites. Unless otherwise specified, an
oligonucleotide probe can include one or more nucleic acid analogs,
labels or other substituents or moieties so long as the
base-pairing function is retained.
[0122] A "control population" refers to a group of subjects or
individuals who are predicted to be representative of the genetic
variation found in the general population.
[0123] A "subject" comprises an individual (e.g., a mammalian
subject or human) whose genotypes or haplotypes or response to
treatment or disease state are to be determined.
[0124] A "nucleic acid sample" includes blood, serum, plasma,
cerebrospinal fluid, urine, saliva, and tissue samples.
[0125] The term "phenotype" refers to any biochemically,
anatomically, and clinically distinguishable, detectable or
otherwise measurable property of an organism such as symptoms of,
or susceptibility to a disease for example. Typically, the term
"phenotype" is used herein to refer to symptoms of, or
susceptibility to a cardiovascular disorder; or to refer to an
individual's response to a therapeutic agent; or to refer to
symptoms of, or susceptibility to side effects to a therapeutic
agent. A "less severe phenotype" is defined as a less severe form
of a cardiovascular disorder, or a form of the cardiovascular
disorder that is more responsive to treatment, displays less side
effects with treatment, has better prognosis, is not recurrent, or
has a combination of these characteristics. A "more severe
phenotype" is defined as a more severe form of a cardiovascular
disorder, or a form of the disorder that is less responsive to
treatment, displays more side effects with treatment, has worse
prognosis, is recurrent, or has a combination of these
characteristics. In general, the more severe phenotype is a disease
state with profound consequences to the patient's life quality and
requires more aggressive therapy.
[0126] A subject who is at risk for "having or developing a
cardiovascular disorder" includes a subject with no clinical signs
or symptoms of a cardiovascular disorder but with a strong family
history of such disorders, a subject who exhibits clinical signs or
symptoms associated with a cardiovascular disorder, or a subject
who has been clinically diagnosed as having a cardiovascular
disorder.
[0127] The term "prognosis" as used herein refers to predicting the
course or outcome of a condition in a subject. This does not refer
to the ability to predict the course or outcome of a condition with
100% accuracy, or even that a given course or outcome is
predictably more or less likely to occur based on the pattern of
biomarkers. Instead, the skilled artisan will understand that the
term "prognosis" refers to an increased probability that a certain
course or outcome will occur.
[0128] A "diagnostic" biomarker is a biallelic polymorphism, the
allelic status of which is indicative of whether or not a subject
has, or is at risk for developing, a cardiovascular disorder.
[0129] A "prognostic" biomarker is a biallelic polymorphism, the
allelic status of which is predictive of the severity or prognosis
of a cardiovascular disorder.
[0130] When one or more prognostic biomarkers exhibit a certain
pattern in samples obtained from a subject, the pattern may signal
that the subject is at an increased probability for experiencing a
future event in comparison to a similar subject exhibiting a
different pattern. For example, a certain pattern of prognostic
biomarkers can predict an increased predisposition to an adverse
outcome, or the chance of a person responding or not responding to
a certain drug.
[0131] In some embodiments, a "prognostic biomarker" can predict
the presence of a "prognostic indicator." For example, the presence
of a minor allele of a SNP (prognostic biomarker) is indicative of
a lower mRNA expression (prognostic indicator) in a target
tissue.
[0132] The term "ACE-related disorder" as used herein refers to any
ACE-related disorder comprising one or more of the following:
cardiovascular diseases, hypertension, myocardial infarction,
angioedema, altered kidney function, Alzheimer's, and/or
responsiveness to a therapeutic targeting the subject's
renin-angiotensin system, including, but not limited to ACE
inhibitors, beta blockers, angiotensin receptor blockers
(ARBs).
[0133] The term "cardiovascular disorder" as used herein refers to
any disorder in which an increase or decrease in ACE levels, which
can lead to hypertension, heart disease, heart failure, myocardial
infarction, renal pathophysiology, diabetes, and related
pathologies.
[0134] All the above disorders have their usual meaning in the art,
or are defined according to "The Merck Manual of Diagnosis and
Therapy" Seventeenth Edition, 1999, Ed. Keryn A. G. Lane, pp.
1503-1598, incorporated herein by reference.
[0135] "Treatment" as used herein means the medical management of a
subject, e.g., a human patient, with the intent to cure,
ameliorate, stabilize, or prevent a disease, pathological
condition, or disorder. This term includes active treatment, that
is, treatment directed specifically toward the improvement or
associated with the cure of a disease, pathological condition, or
disorder, and also includes causal treatment, that is, treatment
directed toward removal of the cause of the associated disease,
pathological condition, or disorder. In addition, this term
includes palliative treatment, that is, treatment designed for the
relief of symptoms rather than the curing of the disease,
pathological condition, or disorder; preventative treatment, that
is, treatment directed to minimizing or partially or completely
inhibiting the development of the associated disease, pathological
condition, or disorder; and supportive treatment, that is,
treatment employed to supplement another specific therapy directed
toward the improvement of the associated disease, pathological
condition, or disorder. "Treatment" also includes symptomatic
treatment, that is, treatment directed toward constitutional
symptoms of the associated disease, pathological condition, or
disorder. "Treatment" also includes the act of not giving a subject
a contra-indicated therapeutic agent.
[0136] The terms "correlating" as used herein refers to comparing
the allelic status of a polymorphism in a subject to the allelic
status of the polymorphism in a reference population. The reference
population may be persons known to be free of a given condition,
i.e., "normal individuals," or may be persons known to suffer from,
or to be at risk of developing, a given mental disorder, persons
known to have a form of the mental disorder with better or worse
outcome, or persons known to respond to or be resistant to a
certain treatment. For example, a SNP pattern in a patient sample
can be compared to a SNP pattern known to be associated with
response to a certain depression medication. By correlating the
sample's biomarker pattern with the reference pattern, the skilled
artisan can predict whether the patient will respond to a certain
medication, and prescribe accordingly.
[0137] In this method, the allelic status of the polymorphism in
the subject is predictive of the prognostic outcome.
[0138] In one embodiment, the method further includes the step of
correlating the allelic status of the polymorphism in the subject
with the allelic status of the polymorphism in a reference
population to predict the prognostic outcome of the subject.
[0139] In another embodiment, the method further includes the step
of correlating the allelic status of the polymorphism in the
subject with the allelic status of the polymorphism in a reference
population to predict whether the subject has a greater or less
severe risk factors for cardiovascular diseases and/or
responsiveness to therapeutic agents.
[0140] In another embodiment, the method further includes the step
of correlating the allelic status of the polymorphism in the
subject with the allelic status of the polymorphism in a reference
population to predict the subject's response to treatment.
[0141] The SNPs identified herein can be used in combination with
additional predictive tests including, but not limited to,
additional SNPs, mutations, and clinical tests. The SNPs can be
those provided herein, and discussed in detail in the Examples. The
SNPs can also be SNPs in positive linkage disequilibrium with any
of the SNPs provided herein.
[0142] The present invention is further defined in the following
Examples, in which parts and percentages are by weight and degrees
are Celsius, unless otherwise stated. Techniques in molecular
biology were typically performed as described in Ausubel, F. M. et
al., In Current Protocols in Molecular Biology; John Wiley and
Sons: New York, 1990 or Sambrook, J. et al., In Molecular Cloning:
A Laboratory Manual; 2ed.; Cold Spring Harbor Laboratory Press:
Cold Spring Harbor, N.Y., 1989). It should be understood that these
Examples, while indicating preferred embodiments of the invention,
are given by way of illustration only.
[0143] From the discussion and the Examples herein, one skilled in
the art can ascertain the essential characteristics of this
invention, and without departing from the spirit and scope thereof,
can make various changes and modifications of the invention to
adapt it to various usages and conditions. Thus, various
modifications of the invention in addition to those shown and
described herein, will be apparent to those skilled in the art from
the foregoing description. Such modifications are also intended to
fall within the scope of the appended claims. All publications,
including patents and non-patent literature, referred to in this
specification are expressly incorporated by reference herein.
Example 1
ACE
[0144] Accordingly, the disclosure provides for a method for
predicting a subject's risk factors for cardiovascular diseases
and/or a subject's responsiveness to therapeutic ACE
inhibitors.
[0145] The method includes detecting the allelic status of one or
more polymorphisms in a nucleic acid sample of the subject, wherein
the polymorphism is selected from the group: (i) ACE-associated
SNPs rs4290, rs7214530, rs7213516 or combinations thereof; or, (ii)
a SNP in linkage disequilibrium with one or more SNPs listed in
(i). In this method, the allelic status of the polymorphism in the
subject is predictive of the prognostic outcome of the subject.
[0146] In such a method, the allelic status of the polymorphism in
the subject is predictive of the subject's risk factors for
cardiovascular diseases and/or a subject's responsiveness to
therapeutic ACE inhibitors.
[0147] In one embodiment, the method further includes the step of
correlating the allelic status of the polymorphism in the subject
with the allelic status of the polymorphism in a reference
population to predict the subject's risk factors for cardiovascular
diseases and/or a subject's responsiveness to therapeutic ACE
inhibitors.
[0148] In another embodiment, the method further includes the step
of correlating the allelic status of the polymorphism in the
subject with the allelic status of the polymorphism in a reference
population to predict whether the subject has a more or less severe
phenotype for cardiovascular diseases and/or responsiveness to
therapeutic ACE inhibitors.
[0149] In another aspect, the disclosure provides for a method of
screening a subject for a prognostic biomarker for determining a
subject's risk factors for cardiovascular diseases and/or a
subject's responsiveness to therapeutic ACE inhibitors, comprising
detecting the allelic status of one or more polymorphisms in a
nucleic acid sample of the subject, wherein the polymorphism is one
or more of: (i) ACE-associated SNPs rs4290, rs7214530, rs7213516 or
combinations thereof; or, (ii) a SNP in linkage disequilibrium with
one or more SNPs listed in (i). In this method, the allelic status
of the polymorphism in the subject is predictive of the prognostic
outcome of the subject.
[0150] Allelic mRNA Expression Imbalance (AEI) is Useful for
Finding Functional Polymorphisms.
[0151] How genetic processes interact to regulate gene expression
can be addressed by measuring allelic expression imbalance (AEI).
Measuring allelic mRNA expression compares one allele against the
other in a relevant target tissue of the same individual. The
relative amounts of mRNA generated from each of two alleles in
subjects heterozygous for a marker SNP in the transcribed region of
the gene in question are quantitatively measured. AEI indicates the
presence of cis-acting factors in gene regulation and/or mRNA
processing. AEI results provide a quantitative measure of the
allelic differences in each individual, one allele serving as the
control for the other, while canceling out any trans-acting
factors. The allelic expression ratios are used as the phenotype to
scan a gene locus for regions containing functional polymorphisms.
If cis-acting polymorphisms contribute to the measured AEI ratios,
significant correlations should be detectable. Also, a single locus
association test between SNP genotype and allelic expression
phenotype can be conducted. The AEI phenotype is represented either
as present/absent; or absent/present low/present high. Significant
associations indicate that a SNP, or one closely linked,
contributes to AEI, by affecting mRNA expression levels.
[0152] ACE1 Polymorphisms are Linked to Differences in ACE
Expression
[0153] FIG. 31 contains the mRNA sequence for the ACE gene [SEQ ID
NO: 261]. The ACE gene consists of 25 exons spanning .about.25 kb
and encoding a soluble or a membrane-bound protein variant with two
peptidase domains (FIG. 5). Also, FIG. 9 shows a schematic
illustration of ACE gene structure and relevant genetic
polymorphism (chromosome 17q.23.3) (not to scale).
[0154] ACE harbors a number of polymorphisms; however, frequent
nonsynonymous SNPs that affect the protein sequence are lacking,
suggesting that yet to be discovered regulatory polymorphisms may
contribute to genetic susceptibility in cardiovascular diseases
involving ACE. To search for regulatory polymorphisms, we measured
allelic mRNA expression of ACE in human cardiac tissues. In
contrast to total mRNA levels, allelic mRNA ratios cancel out
trans-acting factors, so that any detectable allelic expression
imbalance (AEI) is a strong indicator of cis-acting regulatory
factors (6-10). We can then exploit the allelic mRNA ratios as the
most proximate and accurate phenotype for SNP scanning in search of
regulatory polymorphism(s), followed by molecular genetic studies
to address underlying mechanisms (6,7,10).
[0155] Genetic family studies map the heritable contribution to ACE
activity and blood pressure to the region of the ACE gene,
particularly in subjects of African ancestry (11,12). Moreover,
allele frequencies at the ACE locus vary greatly between
African-Americans and European-Americans (13). African-Americans
are at higher risk of hypertension (14) and its target organ
sequelae (15), and less responsive to ACE inhibitors (16,17) while
more likely to experience adverse drug effects (18). To test
whether genetic variation in ACE accounts for differences among
population groups, we measured allelic ACE mRNA expression in heart
tissues from both Caucasians and African-Americans.
[0156] Here we report regulatory alleles affecting ACE expression
that are common among African-Americans, discovered in a screen of
human myocardial tissues. To assess the clinical relevance of these
alleles, we conducted a clinical genetic association study in the
INternational VErapamil SR Trandolapril STudy GENEtic Substudy
(INVEST-GENES) (19).
[0157] Results
[0158] Allelic mRNA Expression of ACE and Association with Promoter
SNPs in Heart Tissues
[0159] We selected two marker SNPs (rs4309, rs4343) located in exon
8 and exon 16 of ACE FIG. 5) to measure allelic ratios of genomic
DNA (gDNA) and mRNA in heart tissues using SNaPshot (Applied
Biosciences) (FIG. 6).
[0160] Standard curves performed with mixtures of DNA alleles were
linear over the observed range (r.sup.2=0.996-0.999). Since gDNA
ratios varied within a small range (<.+-.2SD), no variable copy
number polymorphisms were detectable (although the SNaPshot method
used would have missed hemizygous subjects). Therefore, the mean
allelic gDNA ratios were normalized to 1. Allelic ACE mRNA
expression in heart tissues varied up to four-fold compared to gDNA
ratios, indicating the presence of strong cis-acting regulatory
factors (see FIG. 1; using a log.sub.2 scale).
[0161] Allelic expression ratios obtained with the two marker SNPs
in compound heterozygotes (n=20), indicating that the results are
reproducible. Allelic mRNA ratios deviated significantly from unity
in five of 33 subjects. Strikingly, each of the five tissues
showing strong AEI was obtained from African-American subjects even
though only eight African-Americans were heterozygous for a marker
SNP. In contrast, none of the Caucasian-Americans displayed
significant AEI (FIG. 1), showing a significant difference between
ethnic groups.
[0162] To ascertain the responsible regulatory polymorphisms, we
sequenced the ACE locus in genomic DNA from the eight
African-American subjects. No polymorphisms within the transcribed
mRNA region (UTRs or protein-coding regions) matched the pattern of
allelic expression. On the other hand, three polymorphisms
(rs7213516, rs7214530, rs4290) (FIG. 11a--Table 2A) in a region 2-3
kb upstream of the ACE transcription start site were strongly
associated with allelic mRNA expression imbalance in
African-Americans (P<10.sup.-7). Moreover, these three SNPs were
absent in Caucasian-American cardiac tissues that also failed to
show detectable AEI (FIG. 1b).
[0163] In the cardiac tissues surveyed, rs7213516, rs7214530 and
rs4290 were in extensive but incomplete LD, so that we cannot
exclude any of the 3 SNPs from contributing to the AEI ratios. In
the HapMap data for the Yuruba population in Ibadan, Nigeria,
rs4290 was in complete LD with rs7214530 (D'=1.0, r.sup.2=1.0) but
not with rs7213516 (D'=1.0, r.sup.2=0.55) (FIG. 5).
[0164] The incomplete LD in HapMap between rs4290 and rs7213516
motivated later selection of these two markers for the clinical
association study.
[0165] We next genotyped additional ACE (rs4291, rs4292, rs4357,
rs4363, rs13447447, rs4366) for all samples with allelic mRNA data
(FIG. 11a--Table 2A). The only additional SNP showing significant
association with AEI, rs4357 (P<10.sup.-7) located in intron 21
(FIG. 5), was in partial linkage disequilibrium (LD) with the
upstream SNPs (with rs4290: D'=1.0, r.sup.2=0.77; with rs7213516:
D'=0.71, r.sup.2=0.38). Since several subjects with AEI were
homozygous for rs4357, this argues against a functional role. The
commonly studied I/D variant (rs13447447) had a p-value of 0.09 for
association with AEI, again owing to LD with the promoter SNPs, but
it can also be ruled out as many I/D heterozygotes failed to show
AEI.
[0166] The value of allelic mRNA ratios below 1 in the five
African-American subjects showing AEI indicated that the less
frequent allele had reduced mRNA expression (considering the
inferred phasing between the marker SNP alleles and those of the
promoter SNPs). To test this further we measured overall ACE mRNA
levels by RT-PCR. Whereas no association with mRNA levels was
observed with the I/D variant (FIG. 2a), carrying the minor allele
of the promoter SNPs was associated with decreased ACE mRNA
expression (rs4290 T; P<0.02 (FIG. 2b), rs7213516 A; P<0.04).
This result indicates that the minor alleles of the promoter SNPs
reduce expression.
[0167] Reporter Gene Analysis of Three ACE Promoter SNPs
[0168] To determine whether the promoter SNPs, rs7213516,
rs7214530, and rs4290, affect transcription, we compared activities
of a 4.3 kb fragment from the ACE promoter region, containing
either the reference sequence (G-T-C) or different combinations of
the three SNPs, using a reporter gene assay in HEK293 and bovine
aortic endothelial cells (BAEC).
[0169] Shown in FIG. 3a, the expression constructs containing any
of the minor alleles of the three promoter SNPs significantly
reduced reporter gene expression in BAEC, using two different
transfection reagents. While there were differences in the degree
of reduction between the various constructs, no single SNP alone
could account for all results. To test for cell context-dependent
effects, we also measured promoter activity in HEK293 cells. In
contrast to the results with BAEC, none of the SNPs had an effect
on promoter activity in HEK293 cells regardless of plasmid amounts
used for transfection (FIG. 3b).
[0170] As the experiments in BAEC and HEK293 cells were done
side-by-side with the same plasmid preparations, the negative
results in HEK293 cells further indicate that the plasmid
preparations had similar transfection efficiencies, which can be a
source of error if not controlled for. Taken together with the mRNA
analysis in heart tissues (FIGS. 1, 2), we conclude that each of
the three promoter SNPs appears to reduce ACE gene expression,
although any effects are tissue-dependent.
[0171] Genetic Association of ACE with Adverse Cardiovascular
Outcomes in INVEST-GENES
[0172] We genotyped rs7213516 and rs4290 and three additional
polymorphisms (FIG. 11b--Table 2B) in 258 subjects experiencing a
primary outcome event (first occurrence of all cause death,
nonfatal myocardial infarction (MI), or nonfatal stroke) and 774
hypertensive controls lacking primary outcome events in the genetic
substudy (INVEST-GENES) of the randomized controlled clinical trial
INVEST. All genotype frequencies were in Hardy-Weinberg equilibrium
in all three race/ethnicity groups and displayed substantial
differences between ethnic groups.
[0173] Linkage disequilibrium is shown in FIG. 7, illustrating the
relationships between the genotyped SNPs. For the five
polymorphisms tested in the INVEST-GENES, allele frequencies in
Hispanics were intermediate between Caucasians and
African-Americans. Minor allele frequencies of both rs7213516 and
rs4290 differed significantly between African-Americans (16%),
Hispanics (4%) and Caucasians (<1%). Genotyping quality control
checks showed >99.5% concordance between different assays for
the same polymorphisms.
[0174] Consistent with our finding that the rs7213516 A allele and
rs4290 T allele are associated with ACE expression differences,
these alleles were also robustly associated in the INVEST-GENES
cohort with increased risk of a primary outcome event (FIG. 4).
[0175] The main effect was strongest in African-Americans for both
SNPs, with similar trends in Hispanics and Caucasians, despite
limited power in these latter groups, because of low allele
frequency. In African-Americans, rs7213516 A and rs4290 T carriers
had 4 times higher odds of experiencing a primary outcome event
(odds ratio (OR): 4.13, 95% confidence interval (CI): 1.52-11.21
(P=0.0054), and OR 3.91, 95% CI: 1.54-9.90 (P=0.0041)),
respectively.
[0176] In secondary outcomes analysis, rs7213516 conferred highest
risk for nonfatal myocardial infarction, OR 6.16, 95% CI:
2.43-15.60 (P=0.0001), whereas there was no significantly higher
risk for all-cause mortality (P=0.92) or nonfatal stroke (P=0.19)
(FIG. 10--Table 1).
[0177] Similarly, the association with rs4290 is also largely
driven by nonfatal myocardial infarction (OR 2.34); however, it
only reached marginal significance.
[0178] The ACE I/D polymorphism (rs13447447) was inconsistently
associated with outcomes (FIG. 4). Associations were not
directionally similar in the different racial/ethnic groups, nor
was there a linear trend between I/D heterozygotes and I/I
homozygotes. Finally, the I/D was, not associated with any of the
individual components of the composite outcome (FIG. 10--Table 1).
While not wishing to be bound by theory, the inventors herein now
believe that there is no meaningful association with clinical
outcomes analyzed here, consistent with a lack of effects on ACE
mRNA level in heart tissue (FIG. 2). There was also no evidence for
association of the primary outcome with polymorphisms rs4291 and
rs4366.
[0179] Discussion
[0180] This study employed allelic mRNA expression analysis of ACE
in human heart tissues, followed by SNP scanning, to identify
regulatory polymorphisms in the ACE locus, long suspected of
conferring genetic risk for cardiovascular disease. This approach
revealed strong effects on ACE mRNA expression attributable to
three promoter SNPs, rs7213516, rs7214530, and rs4290, located in
conserved regions 2-3 kb upstream of the transcription start site.
The excellent congruence between AEI ratios and clearly
identifiable polymorphisms, and a significant association between
genotypes and total ACE mRNA expression in human heart tissues,
support the notion that these promoter SNPs reduce ACE mRNA
expression. This conclusion is further buttressed by results from
reporter genes assays. The three ACE promoter SNPs are common in
individuals of African-American ancestry (FIGS. 11a, 11b--Tables
2A, 2B), but rare in Caucasians, and intermediate in Hispanics.
Consistent with our gene expression results, a clinical association
study revealed a robust genetic effect on outcomes in hypertensive
patients.
[0181] Three Promoter SNPs Linked to ACE Expression
[0182] Allelic mRNA expression ratios were strongly linked with the
three promoter SNPs (P=<0.0001), but because of the extensive
linkage disequilibrium among them, did not permit a conclusion on
which polymorphism is functional. All three SNPs reside in
conserved regions.
[0183] FIG. 8 shows the promoter sequence alignments and TF binding
sites. The three promoter SNPs rs7213516 (G/A), rs7214530 (T/G) and
rs4290 (C/7) are located -2883, -2828 and -2306 by upstream of the
transcription start site (+1). The predicted MEF2A transcription
factor binding sites based on the JASPAR database position-weight
matrices are shown in detail. Sequence alignments (CLUSTALW) are
based on genomic matches identified by BLAST of the human promoter
region (* indicates a 1 by insert in rhesus, dog, elephant, and
armadillo sequences; .dagger. indicates a 9 by insert in dog and
armadillo sequences). Human [SEQ ID NOS 70, 34 and 278,
respectively, in order of appearance], Chimp [SEQ ID NOS 71, 270
and 279, respectively, in order of appearance], Rhesus [SEQ ID NOS
72, 271 and 280, respectively, in order of appearance], Bushbaby
[SEQ ID NOS 76, 272 and 281, respectively, in order of appearance],
Shrew [SEQ ID NOS 73, 273 and 282, respectively, in order of
appearance], Dog [SEQ ID NOS 74, 274 and 283, respectively, in
order of appearance], Elephant [SEQ ID NOS 75, 275 and 284,
respectively, in order of appearance], Squirrel [SEQ ID NOS 77, 276
and 285, respectively, in order of appearance], Armadillo [SEQ ID
NOS 78, 277 and 286, respectively, in order of appearance].
[0184] Moreover, rs7214530 is part of a predicted recognition site
for MEF2, a cardiac transcription factor previously implicated in
cardiovascular disease and myocardial infarction (20-22). It is
therefore possible that all three SNPs have co-evolved as part of a
haplotype block prevalent in subjects of African origin, each
contributing to gene regulation, possibly to different extents in
different tissues. Reporter genes assays with an ACE promoter
fragment, containing various combinations of the three suspected
SNPs demonstrated decreased promoter activity for each combination
of variant alleles, compared to the reference sequence in
endothelial cells (BAEC), but not in HEK293 cells, indicating that
these effects can be tissue specific. It is therefore likely that
these ACE promoter polymorphisms have different effects in
different target tissues, and therefore, could be associated with
different pathophysiologies.
[0185] Other Polymorphisms in ACE
[0186] We found no evidence for a functional effect of the ACE I/D
polymorphism in intron 15 on mRNA expression in human heart tissue,
consistent with previous negative in vitro studies (4-5).
Additionally, our clinical association data did not support an
effect of I/D on outcomes across the various ethnic populations,
despite an allele frequency and power that was substantially higher
than for the promoter SNPs. Yet, countless genetic association
studies are based on the I/D polymorphism even though evidence for
a physiological function is lacking, and clinical associations are
borderline at best (3).
[0187] Association of ACE Promoter SNPs with Clinical Outcomes
[0188] We tested several ACE polymorphisms for association with
clinical outcomes in hypertensive patients with coronary artery
disease (INVEST-GENES). The promoter SNPs identified in our
mechanism-based screen (rs7213516 and rs4290; rs7214530 was not
genotyped because of strong LD with rs4290) were highly associated
with cardiovascular disease outcomes (P<0.001) (FIG. 4), and in
particular, with myocardial infarction (FIG. 10--Table 1). The odds
ratios ranging from 4-6 suggest an unexpectedly strong genetic
effect.
[0189] We also assessed relative risk of primary outcome as a
function of drug treatment, showing a strong association in
individuals receiving ACE inhibitor and/or beta-blocker therapy
(data not shown). However, the INVEST-GENES design was not optimal
for assessing the effects of genetic factors on drug treatment
outcomes. Nevertheless, this association may have a biological
basis given that trandolopril and atenolol target overlapping
systems of blood pressure control where ACE is a critical
component. Results from the Val-HeFT trial raise the possibility
that excessive neurohormonal inhibition may contribute to adverse
outcomes in heart failure treatment (23). Since the promoter
alleles identified here are associated with decreased ACE
expression we hypothesize that they may potentiate pharmacological
ACE inhibition plus beta-blockade, resulting in higher event rates
via excessive neurohormonal inhibition.
[0190] Since the promoter alleles are common in African-Americans,
they may partially account for phenotypic variation in ACE levels,
blood pressure (e.g., 11) and response to ACE inhibitors (16-18) in
individuals of African ancestry. Excessive ACE inhibition in
African-Americans carrying the minor alleles of these promoter SNPs
could have accounted for the increased susceptibility to angioedema
as a main adverse effect of ACE inhibitors (18). While these
alleles were found at lower frequency in Hispanics and Caucasians,
they could be clinically relevant in the population at large,
although we had limited statistical power to address this question.
While not wishing to be bound by theory, the inventors herein now
believe that these alleles have clinical utility as biomarkers in
the selection of therapeutic options for individual patients. The
use of race in guiding treatment is controversial but does play a
role in clinical practice (24). Ultimately, therapy may be best
optimized for individual patients with tests for functional
biomarkers instead of relying on assumptions related to apparent,
or self-identified, race or ethnicity (25).
[0191] Physiological roles for ACE include blood pressure
regulation, kidney function, processing of kinins and other
peptides, and degradation of amyloid-beta protein (26,27),
suggesting the new ACE promoter alleles may be relevant in other
human pathologies. Among the heart tissues from 12 African-American
heart transplant patients only 8 were eligible for AEI analysis.
Among the twelve samples the minor allele frequency of rs7213516
and rs4290 (25-27%) were higher than expected (16.0% in
INVEST-GENES), with one patient homozygous for the minor alleles,
arguing for conducting a larger study of heart failure
patients.
[0192] Thus, the discovery of regulatory alleles in key genes
through allelic mRNA expression analysis, followed by clinical
association studies, has broad potential for leading to viable
biomarkers guiding an individual's therapy (28).
[0193] Materials and Methods
[0194] Analysis of ACE mRNA Expression in Heart Tissues
[0195] Approval for use of human subjects was obtained from the OSU
IRB. Left ventricle tissue from 65 heart transplant patients was
obtained through The Cooperative Human Tissue Network: Midwestern
Division at OSU and stored at -80.degree. C. until extraction.
Genomic DNA and RNA were isolated, and cDNA was prepared from 1.0
ug RNA in three independent preparations, using oligo dT and
gene-specific primers close to the two marker SNPs to minimize the
effects of mRNA decay in post-extract tissues.
[0196] Total mRNA Expression Levels
[0197] Overall ACE mRNA expression was measured by RT-PCR for each
sample. Gene expression results by genotype were analyzed with SPSS
14.
[0198] Measurement of Allelic ACE mRNA Expression
[0199] We measured allelic mRNA expression, as described previously
(6-10), amplifying short regions of gDNA and cDNA around ACE exonic
marker SNPs from heart tissues of heterozygous individuals (rs4309,
located in exon 8, n=28; rs4343, located in exon 16, n=24). Primer
extension with fluorescent dideoxynucleotides by SNaPshot (Applied
Biosciences) allowed quantitation of relative amounts of each
allele by capillary electrophoresis on an ABI3730 (Applied
Biosciences). Corrected allelic mRNA expression ratios for
individual cDNAs were calculated by normalizing to the mean ratio
of gDNA peaks (SD for gDNA: rs4309.+-.12.4%, rs4343.+-.8.6%).
[0200] Examples for assay results are shown in FIG. 6. Each sample
was assayed from three independent cDNA syntheses, each performed
at least in duplicate.
[0201] Scanning the ACE Locus for Functional Polymorphisms
[0202] To link SNPs to allelic mRNA expression ratios, we genotyped
SNPs selected to represent the major haplotype blocks (FIGS. 11a,
11b--Tables 2A, 2B) in all 65 heart tissues. SNPs were genotyped as
described herein. In addition, we sequenced full length cDNAs and
the 5'-upstream region over 3 kb in eight African-Americans
detecting five SNPs in the upstream region (FIG. 11a--Table
2A).
[0203] The presence of AEI was set at allelic mRNA ratios >1.5
or <1/1.5 as cutoff. Association between genotype status
(heterozygous or homozygous) with AEI was determined using
HelixTree (Golden Helix, Inc.). Linkage disequilibrium between SNPs
(expressed as D') and haplotypes were calculated using HelixTree
(Golden Helix, Inc.).
[0204] ACE Reporter Gene Assay
[0205] A promoter fragment ranging from -4,335 to +1 (the major
transcription start site) in PGL3 basic vector (Promega) was
provided by Dr. Melanie Eyries (29). Various combinations of
rs7213516/rs7214530/rs4290 haplotypes were obtained via
site-directed mutagenesis or restriction digest of amplified
genomic DNA with MscI and BstEII and subsequent cloning. All
inserts were fully sequenced to verify the intended sequence. The
constructs were transfected into HEK-293 and BAEC, cultured in
DMEM/F12 media containing 10% fetal bovine serum, penicillin (10
units/ml), and streptomycin (10 .mu.g/ml), at 37.degree. C. with 5%
CO.sub.2. Twenty four hours before transfection, 1-2.times.10.sup.5
cells were plated into 24-well plates and transiently transfected
with FuGENE HD Transfection Reagent (Roche Applied Science) or
Lipofectamine (Invitrogen) in serum free medium for 5 hours. As a
control, Renilla luciferase constructs were cotransfected with PGL3
basic fused constructs at a 1:20 ratio. Cells were harvested after
48 hours and transferred to 96-well plates, and luciferase activity
was detected with Dual-Glo luciferase assays (Promega) on a
fluorescence plate reader (PerkinElmer). Two independent
transfections and triplicate luciferase assays were performed for
each construct and cell line. Results were analyzed with Prism
(GraphPad).
[0206] Clinical Genetic Association Study INVEST and
INVEST-GENES
[0207] The INternational VErapamil SR Trandolapril STudy (INVEST)
evaluated cardiovascular adverse outcomes in patients randomized to
atenolol or verapamil SR hypertension treatment strategy in 22,576
patients with documented coronary artery disease (CAD) and
hypertension (19). The primary outcome was the first occurrence of
death (all cause), nonfatal MI, or nonfatal stroke. These events
were taken separately as secondary outcomes. In the genetic
substudy (INVEST-GENES), genomic DNA was collected from 5,979
patients using buccal cells from mouthwash samples (30). All
patients provided written informed consent, as approved by the UF
IRB. The present case-control study focused on the 258 INVEST-GENES
patients who experienced a primary outcome event during study
follow-up (cases), frequency matched 3:1 to cases for age, sex, and
race/ethnicity with 774 individuals who were event-free during
study follow-up (controls).
[0208] The patients had a mean age of 71 years, half were female,
25% were of Hispanic ethnicity, and 13% were African-Americans.
Previous analyses showed that case-control analysis in this group
match findings from the entire INVEST cohort, the inclusion of
which increases only the number of controls (31).
[0209] We genotyped promoter SNPs rs7213516 and rs4290, and the
tagging markers (rs4291, rs13447447, rs4366) (genotyping details
below), to sample major haplotype blocks. Quality control
procedures included blind duplicate genotyping of 5% of samples via
the same or an alternative method, assessment of Hardy-Weinberg
equilibrium, and assay validation using Coriell samples previously
genotyped as part of HapMap. To address potential population
stratification, we genotyped 87 autosomal ancestry informative
markers (AIMs) interspaced with large interlocus distances across
the genome in order to give independent association with the
disease and genetic background (see detailed analysis below)
(32,33).
[0210] Statistical Analysis of Clinical Genetic Associations
[0211] Baseline characteristics between case and controls in
INVEST-GENES were compared using t-test for continuous and
Chi-squared test for categorical variables, respectively.
Hardy-Weinberg equilibrium (HWE) of genotype frequencies within
each race/ethnic group was tested with Chi-squared test with one
degree of freedom. Because of the low minor allele frequency for
rs7213516 and rs4290 in the entire INVEST cohort, we decided a
priori to combine heterozygous patients with those homozygous for
the variant alleles for all analyses. Logistic regression was
performed to assess the association of genotypes/haplotypes with
the primary and secondary outcomes after adjusting for ancestry and
pre-specified confounding factors, namely age (by decades), gender,
race/ethnicity, and history of MI and heart failure, and drug
treatments.
[0212] Detailed Analysis
[0213] Tissue Preparation and ACE Allelic Expression Analysis
[0214] Sixty-five heart failure tissue explants from left
ventricles were isolated and frozen for later research under an OSU
IRB approved protocol. The demographic breakdown of these samples
was as follows: Caucasian male (n=42), African-American male (n=4),
Caucasian female (n=13), African-American female (n=6). DNA was
prepared by a standard salting-out method from heart tissue (34).
For RNA isolation, .about.100 mg tissue was pulverized over dry ice
and suspended in Trizol reagent, followed by phenol-chloroform
extraction, and filtration through an RNAeasy column (Qiagen) after
treatment with DNAse I. RNA quantity and quality was confirmed by
UV spectrophotometry and nanodrop analysis (Bioanalyzer, Agilent
Biotechnologies). cDNA was synthesized following the manufacturer's
protocol (Superscript RTII, Invitrogen) from 1.0 ug RNA in three
independent preparations using oligo dT and ACE gene-specific
reverse primers to increase specific yield. Negative controls
(lacking RTII) and positive expression signals for ACE were
confirmed by RT-PCR on an ABI7000 cycler followed by gel
electrophoresis to confirm correctly sized products. The primers
used for RT-PCR verification were the outer primers for the
SNaPshot assay.
[0215] Marker SNPs (rs4309, rs4343) were genotyped at the Ohio
State University Pharmacogenomics Core Laboratory in 65 heart
failure samples by a melting curve dissociation approach on an
ABI7000 real-time PCR instrument in order to determine
heterozygotes for allelic expression assays (35). Allelic
expression assays in genomic DNA and cDNA for each heterozygote
were carried out in triplicate, and analyzed as previously
described (6-10). For the rs4343 assay, due to the SNP location
near an exon border, separate DNA and cDNA forward primers were
used. Outside amplification primers for the assay were as follows
(see FIG. 13--Table 4):
TABLE-US-00001 rs4309 forward primer: TGAGATGGGCCATATACAGTACTAC;
[SEQ ID NO: 1] reverse primer: CCCGACGCAGGGAGAC), [SEQ ID NO: 2]
and rs4343 DNA forward primer: CCCTTACAAGCAGAGGTGAGCTAA; [SEQ ID
NO: 3] cDNA forward primer: ACCACCTACAGCGTGGCC; [SEQ ID NO: 4]
common reverse primer: CATGCCCATAACAGGTCTTCATATT. [SEQ ID NO:
5]
[0216] The extension primers for ACE allelic expression assay were
as follows:
TABLE-US-00002 for rs4309, CTGCAGTACAAGGATCTGCC; [SEQ ID NO: 6] for
rs4343, GACGAATGTGATGGCCAC. [SEQ ID NO: 7]
[0217] Measurement of Overall mRNA ACE Expression
[0218] Total ACE mRNA expression levels were measured in all heart
tissues on two cDNA preparations by RT-PCR with cDNA specific
primers that span the ACE exon 9/10 border (see FIG. 18--Table
9):
TABLE-US-00003 forward-primer: CCCCTTCCCGCTACAACTT; [SEQ ID NO: 8]
reverse-primer: TCCCCTGATACTTGGTTCGAA. [SEQ ID NO: 9]
[0219] RT-PCR was done with SYBR Green on an ABI7000 (30 cycles, 2
steps: 95.degree. C., 60.degree. C.); values were normalized to
.beta.-actin expression levels. The correct size products were
verified by gel electrophoresis.
[0220] Generation of ACE Promoter Region Constructs for Reporter
Gene Assays
[0221] An ACE upstream region construct (-4335 to the transcription
start site) driving expression of a firefly Luciferase reporter
gene (pGL3.Basic, Promega) was kindly provided by M. Eyries (29).
Sequencing indicated this construct contained the major allele at
all polymorphic sites in the region compared to the reference
genome sequence, thus it was labeled (G-T-C). Site-directed
mutagenesis (Stratagene) was employed to generate altered
constructs with SNP combinations; for
TABLE-US-00004 rs4290 (G-T-T) sense primer: [SEQ ID NO: 10]
CTCTGCACCCTTCCTTTGATGAGGTTTTGCCCT; antisense primer: [SEQ ID NO:
11] AGGGCAAAACCTCATCAAAGGAAGGGTGCAGAG, rs7214530 (G-G-C) sense
primer: [SEQ ID NO: 12] GAGCATATTTTTAAGGGCTGGTTTTCTCTCCTGTGGTAACT;
antisense primer: [SEQ ID NO: 13]
AGTTACCACAGGAGAGAAAACCAGCCCTTAAAAATATGCTC), and rs4290 and
rs7214530 (G-G-T).
[0222] A fifth construct containing the three minor alleles for
rs7213516, rs7214530 and rs4290, (A-G-T), was isolated by PCR of an
individual genomic DNA
TABLE-US-00005 (forward primer, GAGACGGAGTTTTGCTCTTGTTG; [SEQ ID
NO: 14] reverse primer, CAGAGACCTGACCCACGTGAG), [SEQ ID NO: 15]
[0223] restriction digest with MscI and BstEII and ligation with
digested plasmid that contained the rs4290 T variant. (See FIG.
17--Table 8). All plasmid insert sequences were fully sequenced
confirming the absence of additional genetic differences.
[0224] Genotyping
[0225] Genomic DNA isolation and genotyping for rs4290, rs4291 and
rs7213516 in INVEST-GENES was performed at the University of
Florida Center for Pharmacogenomics. Genomic DNA was isolated from
buccal genetic samples using commercially available kits (PureGene,
Gentra Systems Inc.) and adjusted to 20 ng/.mu.l. Genotyping for
rs4290 was performed by polymerase chain reaction (PCR) followed by
pyrosequencing using a PSQ HS96A SNP reagent kit according to the
manufacturer's protocol (Biotage AB) (36). SNPs rs7213516 and
rs4291 were genotyped by Taqman assay. The PCR and sequencing
primers used for ACE SNP rs4290 were as follows (see FIG. 15--Table
6):
TABLE-US-00006 forward biotinylated PCR primer,
5'-GAGTGTGGGTCATTTCCTCTTT-3'; [SEQ ID NO: 16] reverse PCR primer,
5'-AGTTTAGCATGGTGCCTAGCA-3'; [SEQ ID NO: 17] and reverse sequencing
primer, 5'-GGGCAAAACCTCATC-3'. [SEQ ID NO: 18]
[0226] The PCR conditions were as follows: 95.degree. C. for 15
min, 40 cycles consisting of denaturation at 94.degree. C. for 30
s, annealing at 59.degree. C. for 30 s, and extension at 72.degree.
C. for 1 min, followed by final extension at 72.degree. C. for 7
min. The Applied Biosystems 7900 HT SNP genotyping platform was
used for the Taqman assays. The SNP genotyping probes (Applied
Biosystems IDs: C.sub.--32160109.sub.--10 and
C.sub.--11942507.sub.--10) were used for ACE rs7213516 G>A and
rs4291 A>T, respectively. Five .mu.L reactions in 384-well
plates were prepared, and the assays were performed and analyzed
according to the manufacturer's recommendations.
[0227] The 287 bp insertion/deletion polymorphism (rs13447447) was
genotyped at the Ohio State University Pharmacogenomics Core
Laboratory by PCR with
[0228] FAM-labeled reverse primer (FAM-GTGGCCATCACATTCGTCAG), [SEQ
ID NO: 19], and two unlabeled forward primers, one of which was
insertion-specific
[0229] both alleles forward primer, CCCATCCTTTCTCCCATTTCT [SEQ ID
NO: 20];
[0230] insertion-specific forward primer, GACCTCGTGATCCGCCC [SEQ ID
NO: 21],
and run on an ABI3730 capillary electrophoresis instrument to
distinguish size products (insert peaks 191 by and 462 bp, deletion
175 bp).
[0231] The CT.sub.2/3 repeat polymorphism (rs4366) was similarly
genotyped by PCR with a FAM-labeled forward primer
[0232] (FAM-TGGCTCCTGCCTGTACCAG) [SEQ ID NO: 22] and
[0233] reverse primer (CCAAGGCTGTTCACCCGA) [SEQ ID NO: 23],
[0234] and capillary electrophoresis. (See FIG. 17--Table 8).
[0235] The SNPs rs4291 and rs4292 were genotyped by multiplexed
SNaPshot primer extension assay within one amplicon. Extension
primers were:
[0236] rs4291 (TGGCTAGAAAGGGCCTCCTCTCTTT) [SEQ ID NO: 24] and
[0237] rs4292 (TTGAGGCGCCGCTGAGGACT) [SEQ ID NO: 25]. (see FIG.
14--Table 4)
An intentional mismatch was introduced into the rs4292 primer at
the 6.sup.th position from the 3' terminus to interrupt the poly G
strng.
[0238] FIG. 13--Table 4 presenting the oligonucleotide sequences
used in genotyping and allelic expression imbalance (AEI) assays
for ACE that employed primer extension technology, showing [SEQ ID
NOs: 1-7, 24, 25, 32-33]. Underlined nucleotides were intentionally
mismatched against the reference sequence. The original primer
sequences [SEQ ID NOs: 1-7, 24, 25, 32-33] are validated assays. In
addition, a multiplex assay was developed using the primers [SEQ ID
NOs: 265-269].
[0239] The SNPs rs4357 and rs4363 were genotyped by a melting curve
dissociation approach as previously described (2) with the
following primers:
TABLE-US-00007 rs4363 forward primer [SEQ ID NO: 26]
CTGCCCCGCACCCTTG; rs4363 reverse primer G allele [SEQ ID NO: 27]
CCTTCTGAGCGAGCTGTGC; rs4363 reverse primer A allele wih GC clamp
[SEQ ID NO: 28] GGCGGCCGGCCCGCCCCGCCTTCTGAGCGAGCTGCGT; rs4357
reverse primer [SEQ ID NO: 29] TGACTTGAGGGAGGGTCCCT; rs4357 forward
primer C allele [SEQ ID NO: 30] GCAGGAGAATGGGGTTCC; rs4357 reverse
primer T allele with GC clamp [SEQ ID NO: 31]
CGGGCCGCCGGGCCGCGGCAGGAGAATGGGGTACT.
[0240] INVEST and INVEST-GENE Cohort
[0241] The INternational VErapamil SR Trandolapril STudy (INVEST)
evaluated blood pressure and cardiovascular adverse outcomes
occurring with either an atenolol or verapamil SR hypertension
treatment strategy in 22,576 patients with documented coronary
artery disease (CAD) and hypertension (19). Race/ethnicity was
based on patient self-report and interaction with the site
investigator, choosing all that were applicable among: Caucasian,
African-American, Asian, Hispanic, and "other". Hispanic patients
were defined as those who chose only `Hispanic`. Patients were seen
every six weeks for six months and every six months thereafter
until two years after the last patient was enrolled. Addition of
trandolapril and hydrochlorothiazide were allowed in both arms, and
were added as needed to meet JNC VI BP goals (37,38). The primary
outcome was the first occurrence of one of three secondary
outcomes: death (all cause), nonfatal MI, or nonfatal stroke. All
events were adjudicated by an independent committee. Clinical Trial
Registration Identifier: NCT00133692 L:
clinicaltrials.gov/ct/gui/show/NCT00133692?order=5.
[0242] Controlling for Population Stratification in
INVEST-GENES
[0243] To control for potential population stratification in our
racially and ethnically diverse population, we used a panel of 87
autosomal ancestry informative markers (AIMs) that show large
allele frequency differences across three parental populations
(West Africans, Indigenous Americans, and Europeans) (32). The AIMs
were selected to be distributed across the genome and to be
distantly interspaced to give independent association with the
disease and genetic background. These 87 AIMs were genotyped using
either allele-specific PCR with universal energy transfer labeled
primers or competitive allele specific PCR at Prevention Genetics
(Marshfield, Wis.) (33). Results from this analysis were used in
the adjusted genetic association analysis.
[0244] FIG. 12 shows Table 3 presenting the baseline
characteristics for the INVEST-GENES case and control patients.
[0245] FIG. 14 shows Table 5 presenting the oligonucleotide
sequences employed in genotyping ACE SNPs by the GC-clamp method
described in Papp et al, showing [SEQ ID NOs: 35-43].
[0246] FIG. 15 shows Table 6 presenting the oligonucleotides
sequences employed in ACE Pyrosequencing genotyping, showing [SEQ
ID NOs: 16-18].
[0247] FIG. 16 shows Table 7 presenting the oligonucleotide primers
used in the amplification and direct sequencing of the ACE upstream
gene region and cDNA, showing [SEQ ID NOs: 45-69].
[0248] FIG. 17 shows Table 8 presenting the FAM-labeled oligos and
related oligos used in genotyping ACE polymorphisms, \ showing [SEQ
ID NOs: 15-16, 20-23, 44].
[0249] FIG. 18 shows Table 9 presenting the oligonucleotides used
in the measurement of ACE expression by RT-PCR, including one that
spans cDNA exons, showing [SEQ ID NOs: 8-9].
[0250] In summary, described herein are novel insights into the
molecular genetics and function of the ACE1 gene, uncovered using
the AEI approach described. We have characterized three SNPs that
define a subpopulation of samples that exhibit differences in the
mRNA expression of ACE1. We further determined that these SNPs are
found in high frequency within an African-American demographic. Due
to the relatively high frequency of these SNPs are believed to be
useful as predictive or diagnostic biomarkers. Lower frequency
biomarkers (<5%) may be less likely to reach a threshold in
terms of market size that makes them economically feasible to use
in clinical testing. Due to the physiological importance of ACE1
and the considerable body of literature supporting ACE1 genetic
variability as an influence on medically relevant traits, there is
potential for these SNPs to eventually be used as biomarkers to
assess disease risks (e.g., heart failure, Alzheimer's disease) or
predict adverse responses to current and future therapeutics
targeting the renin-angiotensin system (e.g., ACE inhibitors,
angiotensin receptor blockers (ARBs)).
Example II
SOD2
[0251] Genetic, epigenetic, and environmental factors determine
phenotypic variability, including susceptibility to disease or
treatment outcome. Polymorphisms that change the amino acid
sequences in coding regions (cSNPs) are readily detectable.
However, regulatory polymorphisms (rSNPs) appear to be more
prevalent than functional nonsynonymous cSNPs [1-5]. Genome-wide
surveys and SNP association analysis with mRNA expression trait
mapping [5,6] indicate regulatory polymorphisms as major factors in
human phenotypic evolution and variability [5,7]. A third type of
functional polymorphism affects mRNA processing (splicing,
maturation, stability, transport) and translation [8]. We refer to
this class of polymorphisms as `structural RNA polymorphisms`
(srSNPs). However, the overall role of rSNPs and srSNP still
requires systematic evaluation.
[0252] Whereas mRNA levels are subject to both cis- and
trans-acting factors, measuring the relative allelic mRNA
expression selectively detects only cis-acting factors. Allelic
expression imbalance (AEI), i.e., a different number or type of
mRNAs generated between alleles, is a robust and quantitative
phenotype directly linked to cis-acting polymorphisms [3,5,8-21]
and epigenetic regulation, including X-inactivation, imprinting,
and gene silencing [4,22,23].
[0253] Genome-wide association studies continue to increase the
number of candidate genes, while knowledge of the functional
genetic variants is lagging. AEI analysis is a powerful tool for
finding regulatory polymorphisms, but technical difficulties hamper
broad usage.
[0254] Earlier AEI methods mostly targeted monoallelic expression,
while polymorphisms resulting in relatively small changes, although
potentially physiologically relevant, are more difficult to
measure. Array- and RT-PCR-based methods with limited precision or
sensitivity have been applied to detect partial regulatory changes,
but have mostly been applied to small sets of candidate genes in
lymphocytes. Results from these studies suggest that 20-50% of
genes show detectable AEI [2,3,24-26]. Yet, because the impact of
rSNPs and srSNPs strongly depends on the tissue context, AEI
analysis should be performed in physiologically relevant tissues
[27,28]. Systematic and accurate surveys of AEI in many genes
applied to a variety of human target tissues are lacking. Yet,
autopsy tissues present additional difficulties because of partial
mRNA degradation.
[0255] Also disclosed herein is a method for the rapid detection of
regulatory polymorphisms in multiple genes. The method described
herein is a robust and fast methodology that is especially
applicable to human autopsy tissues. The method described herein
fills an important gap between large-scale candidate gene discovery
and resolution of the functional variants.
[0256] In the examples described herein, is a study which surveyed
AEI for 42 genes in human autopsy tissues, including brain, heart,
liver, intestines, and kidney, as well as peripheral mononuclear
cells, revealing frequent AEI in a large fraction of genes.
[0257] In one embodiment, in cardiovascular genes where regulatory
polymorphisms had been reported previously, we tested whether the
observed AEI ratios were compatible with any effects of these
polymorphisms on allelic expression in relevant tissues. We also
addressed the question of how srSNPs affect mRNA folding, and point
to a number of genes where frequent srSNPs affect mRNA expression.
The results provide insight into the prevalence of rSNPs and
srSNPs.
Results
[0258] Methodology for AEI Analysis of Multiple Genes in Human
Autopsy Tissues
[0259] We developed a rapid methodology for measuring allelic
ratios in genomic DNA and mRNA (as cDNA) (AEI analysis) in human
autopsy target tissues.
[0260] The assay relies on PCR/RT-PCR amplification, followed by a
primer extension step with fluorescently labeled
dideoxynucleotides, and analysis by capillary electrophoresis.
Details of the assays applied to single genes have been published
previously by us for several genes included in the present survey
[9-16].
[0261] To facilitate application to multiple genes in human autopsy
tissues, the method described herein includes several steps for
obtaining reproducible allelic gDNA and mRNA ratios, including use
of multiple gene-specific primers to maximize cDNA yields for the
target genes. Assay throughput is .about.150 samples/hour, or
higher with multiplexing, with an error rate in the order of 5%
(gDNA) and 10-15% (mRNA).
[0262] Application of AEI Analysis to Candidate Genes
[0263] AEI analysis was applied to 42 candidate genes in a variety
of human tissues (FIG. 26--Table 13), divided into genes for
cardiovascular and CNS disorders, and drug metabolism and
transport.
[0264] This selection provides information on the frequency of
cis-acting factors but was not designed to cover the much larger
number of possible candidate genes. We first determined (by RT-PCR)
all 42 genes were well expressed in the target tissues examined and
then determined >4,200 individual genotypes for mRNA marker SNPs
in the candidate genes. The 1,008 heterozygous samples suitable for
use in AEI assays yielded relative allelic expression for an
average of 23 subjects or 46 individual chromosomes per gene
(average marker SNP heterozygosity .about.24%). Results for four
genes (ACE, SOD2, NOS3, CCL2) are shown in FIG. 22.
[0265] This example was well-powered to detect frequent functional
polymorphisms (>5% minor allele frequency), similar to previous
AEI studies [2,25,26]. Details on tissue source, number of samples,
marker SNPs, and allele frequency are found in FIG. 27--Table
14.
[0266] As a conservative detection threshold for the presence of
mRNA AEI ratios (major:minor allele), we used .+-.log 2 0.5 (1:1.4
or 1.4:1) corresponding to 3 SD or more relative to DNA ratios,
similar to previous studies [24,25].
[0267] FIG. 27--Table 14 contains results for genes meeting the
detection threshold in at least one sample, along with information
on the marker SNPs, number of replicate analyses, frequency,
magnitude and direction of AEI. If a suspected functional
polymorphism is in near complete linkage disequilibrium with the
marker SNP, most or all AEI ratios are unidirectional (either <1
or >1), as observed with SOD2 in heart tissues (FIG. 26).
[0268] In contrast, functional polymorphisms unlinked to the marker
SNP are revealed by random distribution of ratios <1 and >1
(FIG. 26, FIG. 27--Table 14), indicating these are located in other
haplotype blocks. Lesser AEI ratios may also be of physiological
relevance but should be subject to more extensive analytical
validation to exclude artifacts. The results reveal AEI above our
threshold in 67% of the candidate genes, with AEI in two or more
subjects in 55% of genes. Where genes lack significant AEI this
argues against the presence of cis-acting factors in the tissues
analyzed.
[0269] Several well-studied genes, such as ACE and SOD2, displayed
substantial AEI that was unexpected from previous genetic analyses
(FIG. 27--Table 14).
[0270] In some cases, the AEI data confirm previous studies, for
example, the modest AEI ratios observed for COMT [17], and a
similar frequency and extent of AEI for NQO2 in white blood cells
[26] and DTNBP1 in the pons region [29]. We also failed to observe
significant AEI in 5HT2A, as reported [30]; however, another study
suggests the presence of AEI [31] but lacks rigorous validation of
the results.
[0271] It is possible that AEI may be detectable only in certain
ethnogeographic populations where regulatory alleles are
sufficiently frequent (see ACE below), or in specific tissues,
environmental conditions, and diseases. For example, AEI was
observed for VKORC1 only in the liver but was undetectable in heart
tissues and B-lymphoblasts (CEPH samples) (FIG. 27--Table 14).
[0272] Relationship Between AEI and mRNA Levels
[0273] We tested whether the presence of AEI is correlated with
total mRNA levels, measured by RT-PCR, in a subset of genes (SOD2,
CCL2, NOS3, FLT1, HIF1A, LPL, PTGDS, and MAOA). Borderline
significant correlations between AEI and mRNA levels were observed
for HIF1A (r=-0.45, p<0.06) and PTGDS (r=0.38, p<0.04). These
moderate correlations reflect the greater variability of overall
mRNA levels compared to allelic ratios.
[0274] Cardiovascular Disease Candidate Genes
[0275] AEI analysis was applied to 18 cardiovascular candidate
genes that serve as drug targets and have roles in inflammation,
coagulation, lipid metabolism, vasomotor tone, and heart
contractility (FIG. 26--Table 13).
[0276] Target tissues included 65 heart failure explants from
transplant recipients, livers, ex vivo monocytes, and peripheral
blood monocyte-derived macrophages. AEI was detectable for 15
cardiovascular genes at a 20% imbalance threshold (FIG. 26--Table
13), while 9 genes displayed AEI when we set our more stringent
threshold based on the typical error rates (.+-.log 2 0.5). AEI
ratios for genes surveyed in heart tissues are shown in FIG.
27--Table 14.
[0277] Allelic mRNA expression of ACE, CCL2, SOD2, CACNA1C, and
KCNMB1 was validated using a second marker SNP, with cDNA derived
from a different primer (FIG. 27--Table 14).
[0278] CCL2, PTGDS, and KCNMB1 showed allelic ratios below and
above 1, suggesting multiple functional polymorphisms and/or
incomplete linkage disequilibrium between the marker SNPs and
functional alleles (FIG. 23).
[0279] In contrast, ACE displayed large unidirectional AEI ratios
only in African-Americans, suggesting the presence of a cis-acting
factor enriched in this population. AEI results for ACE were
confirmed with use of a second marker SNP (r2=0.98 in compound
heterozygotes). Standard curves were linear, obtained with
homozygous DNA representing both alleles (r2=0.99).
[0280] Both SOD2 and NOS3 showed AEI largely in a single
direction--suggestive of a functional polymorphism in a shared
haplotype with the marker SNP, or that the marker SNP itself is
functional. The results on the frequency and extent of NOS3 AEI are
consistent with published AEI results in brain tissues [27].
[0281] A number of genes did not show any AEI, for example, the
L-type channel CACNA1C--a gene featuring >55 exons across
.about.250 kW Subsequent use of several marker SNPs and AEI
analysis of splice variants failed to reveal any cis-acting factor
that could have caused highly variable splicing observed for
CACNA1C in human heart [15].
[0282] Relationship Between AEI and Previously Suggested Regulatory
Polymorphisms
[0283] The frequency and directionality of AEI ratios enables us to
investigate whether previously proposed regulatory polymorphisms in
NOS3 (rs2070744), CCL2 (rs1024611), SOD2 (rs5746091), PTGDS
(rs6926), and ACE (intron 16 I/D) contribute to this phenotype.
[0284] We genotyped the proposed regulatory polymorphisms and
tested for association between genotype and AEI ratios. We analyzed
AEI ratios with two discrete thresholds, and also as a continuous
variable.
[0285] The results in FIG. 26--Table 13 indicate that the putative
regulatory polymorphisms cannot account for or are only marginally
associated with AEI. For example, a proposed promoter SNP
(rs1024611) [32] in CCL2 was incompatible with AEI observed in two
subjects, or for the absence of AEI in many samples where this SNP
is heterozygous, in both heart tissues and macrophages (FIG.
26--Table 13).
[0286] Similarly, a putative regulatory SNP, T-786C (rs2070744)
upstream of NOS3, and rs6296 in PTGDS, were not significantly
associated with the AEI observed in human target tissues (FIG.
26--Table 13).
[0287] A marginal association between the intensely studied ACE
intron 16 I/D was detectable when AEI was analyzed as a continuous
variable, but there was no association with the large AEI ratios
shown in FIG. 23.
[0288] Detailed Analysis of AEI Observed for SOD2
[0289] FIG. 32 contains the mRNA sequence for the SOD2 gene[SEQ ID
NO: 262]. Allelic mRNA ratios for SOD2 were .about.1.5-fold in 83%
of heart tissues heterozygous for marker rs4880, indicating that
the `major allele` has .about.50% greater expression (however,
since allele frequency is close to 50% assignment of the minor
allele is arbitrary).
[0290] A second marker, rs5746092 in the 5'UTR in modest LD with
rs4880, gave similar results (r2=0.73, in 16 compound
heterozygotes), supporting the accuracy of the assay. FIG.
19--Table 10 shows the forward PCR primer, the reverse PCR primer
and the extension primer for rs4880 and rs5746092, showing [SEQ ID
NOs: 79-84].
[0291] Neither rs5746092 (37% heterozygosity) nor rs4880 (52%
heterozygosity) were completely associated with AEI, as several
homozygotes or heterozygotes displayed significant or no AEI,
respectively.
[0292] The results suggest one or more regulatory factors within a
common haplotype block. Testing a proposed functional promoter SNP,
rs5746091 [33] in 10 subjects, we found that 3 homozygous carriers
had no AEI and 3 heterozygous carriers did show AEI (allelic
ratio>1.4), but 4 homozygous carriers displayed significant AEI,
indicating that rs5746091 could not have played a sole role in
allelic expression.
[0293] Because the AEI ratios are substantiated for each individual
by multiple replicates, each subject showing discrepancy between
AEI and SNP heterozygosity is informative and, thus fails to
support a putative functional role for that SNP.
[0294] Since epigenetic factors could affect allelic expression,
methylation of a CpG island close to rs4880 was measured. Distant
CpG islands outside this haplotype block were not expected to
preferentially affect alleles marked by rs4880. To test
allele-selective methylation, we digested DNA at a Hpa II
methylation-sensitive restriction site near rs4880 and measured the
DNA allelic ratios, in comparison to a standard curve from mixed
ratios of digested and undigested reference DNA. CpG methylation
differed detectably between alleles, but allele-specific
methylation did not correlate with corresponding allele-specific
mRNA expression ratios (Pearson r2=0.03) (FIG. 24), arguing against
an effect on allelic mRNA expression.
[0295] Effect of srSNPs on Predicted mRNA Folding Structures
[0296] To assess the potential of SNP-induced changes in mRNA
folding, we estimated changes in folding energies for all possible
transitions (CU, GA) and transversions (CG, CA, GU, AU) in the mRNA
coding regions of the .mu., .kappa. and .delta. opioid receptors
(OPRM1, OPRK1, OPRD1), using Mfold.
[0297] We calculated both the minimum free energy structures (MFE)
and the ensembles of suboptimal structures in varying sized windows
around all nucleotide positions. A majority of SNPs showed the
potential to alter mRNA folding, often predicting more profound
changes than the known functional A118G SNP in OPRM1 [17] (see
arrow in FIG. 25).
[0298] Approximately 60% of single nucleotide substitutions
affected MFE structures, and .about.90% altered the ensemble of
suboptimal structures, with the potential to affect mRNA functions
[34].
[0299] Because SOD2 allelic expression was consistently in a single
direction in such a high proportion (>80%) of samples, the
inventors now believe that the SOD2 marker SNPs might have a
direct, functional effect on expression. Thus, the inventors
further analyzed the predicted allelic effects on mRNA folding for
the marker SNPs in SOD2 (rs4880, rs5646092).
[0300] Both SNPs are in regions that display highly stable
structures, with rs5646092 positioned within an 18 bp helix near
the transcription and translation initiation sites. These results
suggest that one or more of these alleles could affect gene
expression through a change in mRNA structure.
[0301] Discussion
[0302] Robust Assay of Allelic Ratios in Genomic DNA and mRNA
[0303] Described herein is a broadly applicable methodology for
rapid and robust assays of allelic gene expression (AEI) in human
autopsy tissues. Measuring allelic ratios circumvents at least in
part problems arising from post-mortem mRNA degradation.
[0304] The AEI analysis can be scaled up to address multiple genes
at a time, and thus, represents an intermediate tool for
discovering functional polymorphisms affecting gene regulation
(rSNPs) and RNA processing (srSNPs) in candidate genes. The effect
of rSNPs and srSNPs is expected to vary with the cellular
environment, so that studies on human genes in physiologically
relevant target tissues are of critical importance, for example the
pontine brainstem for SERT and TPH2 mRNA [11,13].
[0305] Factors other than rSNPs and srSNPs could contribute to AEI,
including variable copy number (CNV) in germline DNA or more
frequently as somatic mutations in cancer [35]. We observed
deviations of the DNA ratios from unity only with TPH2 in two
subjects [13], indicating that gene duplications are rare among the
42 genes studied. On the other hand, complete loss of one allele in
germline DNA at the marker SNP locus cannot be assessed with the
SNaPshot method as presented because hemizygous carriers would
appear as homozygotes, unless the gene dosage is quantitated.
[0306] Another possible source of AEI, allele-selective epigenetic
regulation of gene expression must be considered where SNP scanning
fails to reveal regulatory polymorphisms. The relatively high
precision by which the AEI ratios can be measured, facilitated the
dissection of genetic and epigenetic regulation of the X-linked
MAOA, with both processes contributing to AEI [12].
[0307] Prevalence of AEI in the Candidate Genes
[0308] The method described herein permits an estimation of the
prevalence of cis-acting polymorphisms in multiple (in the example
herein, 42) candidate genes in human target tissues, a larger, more
diverse sampling than previous studies.
[0309] FIG. 27--Table 14 provides information on the magnitude,
direction, and frequency of AEI, as guides for more detailed
studies. Substantial AEI (>log 2 0.5) in more than one subject
was observed for 55% of the surveyed genes (FIG. 27--Table 14),
similar to previous studies [2,3,25]; however, the frequency is
higher than estimates from other studies performed with a random
selection of genes in cell lines and blood cells [24,26]. These
differences may be attributable to the selection of strong
candidate genes, or differences in methodology, tissue specificity,
number of subjects, and stringency of AEI thresholds. The presence
of frequent AEI was unexpected for some of the candidate genes that
had already been intensely studied for genetic polymorphisms (e.g.,
SOD2, ACE, TPH2 [13], DRD2 [16]).
[0310] Differential post-mortem decay for alleles could represent a
confounding factor that can be overcome by molecular genetic
studies of the functional polymorphisms. Polymorphisms affecting
alternative splicing may not be detectable if the splice isoforms
have similar turnover rates. To address this issue, allelic mRNA
expression can be performed after specific amplification of each
splice variant, as we have demonstrated for DRD2 (intron 5 and 6
SNPs alter formation of D2S and D2L) [16].
[0311] Scanning for Regulatory Polymorphisms Using Allelic mRNA
Expression Profiles
[0312] AEI patterns provide a means of determining the location of
the functional polymorphism by SNP scanning or sequencing the gene
locus, followed by molecular genetic analysis of the rSNP or
srSNPs, as shown for OPRM1, MDR1, MAOA, SERT, TPH2, and DRD2
[9-13,16].
[0313] Reporter gene assays in heterologous tissues are commonly
used to characterize regulatory polymorphisms. If these
polymorphisms are functional in vivo, one expects corresponding
changes in the AEI ratios. However, for the five genes tested (FIG.
26--Table 13) we have failed to detect significant linkage between
the observed AEI ratios and the putative regulatory SNPs.
Similarly, our genotype scanning with AEI did not support a role
for a putative SERT promoter polymorphism (SERT-LPR), although we
cannot rule out that this promoter polymorphism might be active in
development, or under stress [11]. Previously suggested regulatory
polymorphisms in DRD2 also failed to correlate with AEI ratios
[16]. A separate study of 4 genes (MAOA, NOS3, PDYN, NPY) using AEI
analysis again yielded results incompatible with reporter gene
assays [27], corroborating our results for MAOA and NOS3.
Similarly, the AEI observed with CCL2 (MCPJ) was not associated
with the putative promoter SNP rs1024611 [32]. Therefore, reporter
gene assays are not always reliable indicators of regulatory
polymorphisms. Combined use of AEI analysis and reporter gene
assays can yield more definitive results regarding regulatory
polymorphisms [16].
[0314] Relevance of Structural RNA SNPs (srSNPs)
[0315] For OPRM1, MDR1, TPH2, and DRD2, we have linked the AEI
ratios to SNPs in the transcribed region of the gene, likely
involved in mRNA processing, turnover, and splicing [9,10,13,16].
srSNPs have been shown to affect mRNA stability [9,36] and
alternative splicing [16,37]. Our AEI analysis of marker SNPs in
SOD2 and NQO2 indicates they (or SNPs in tight LD with them) may
also affect RNA structures. Taken together, these results support
the notion that srSNPs can be at least as prevalent as rSNPs.
[0316] srSNPs could alter mRNA Function Through Changed Folding
Dynamics [15,16,34]. Using Mfold to predict mRNA structural changes
resulting from systematic nucleotide exchanges in opioid receptor
mRNAs (FIG. 25), we find that most SNPs affect the likely ensemble
of structural conformations. Consistent with this, SNPs can be
detected by a physical method based on `single-strand
conformational polymorphisms`, with a 95% discovery rate.
[0317] srSNPs can further affect translation, as suggested for the
OPRM1 SNP A118G [16], and COMT haplotypes with altered mRNA folding
[38]. Measuring AEI ratios at the protein level with use of
nonsynonymous marker SNPs can allow for the determination of
quantitative effects of polymorphisms on translation and protein
turnover.
[0318] Cardiovascular Disease Candidate Genes
[0319] Half of the 18 cardiovascular genes studied displayed AEI at
a conservative cutoff, with ACE and SOD2 conspicuous examples. An
intron 16 I/D polymorphism of ACE had been extensively tested in
clinical association studies, but its functional role remained
unclear [39]. Our results suggest strong cis-acting factors
unrelated to the I/D variant in heart tissues, with high frequency
in African-Americans.
[0320] SOD2 (mitochondrial manganese superoxide dismutase) is a key
factor involved in metabolizing superoxide molecules and may have a
role in failing human hearts [40]. Previous association studies of
two variants in SOD2 with cardiomyopathy [41,42], cancers (e.g.,
[43], and other disorders have yielded inconsistent results. The
nonsynonymous marker SNP used here lies in a leader sequence
(rs4880, -9A>V) and was suggested to affect mitochondrial uptake
of the mature protein [41], while a promoter region SNP (rs5746091)
disrupts binding of AP-2 [33].
[0321] Common AEI observed here in failed heart tissues (FIG. 23),
with allelic mRNA ratios consistently >1, indicates presence of
a frequent functional variant(s) in a haplotype block containing
the marker SNPs. Limited genotype scanning of the SOD2 locus
indicated that the two marker SNPs (rs4880, rs5746092) each taken
alone cannot account for the observed AEI, but may interact with
each other or merely represent tags for a functional srSNP in this
region.
[0322] The promoter SNP rs5746091 did not appear to play a main
role. Previous studies have implicated structural elements in SOD2
expression, including a GC-rich 5' region upstream of the
transcription start site that also extends into the 5' end of the
transcript [44] and regions in the 3'UTR of the mRNA [45]. Highly
favorable RNA structures exist in the region of rs5746092 and
rs4880 suggesting multiple structural states in SOD2 mRNA could
affect functions. Alternatively, epigenetic regulation of SOD2
expression by CpG methylation [46] could have contributed to AEI,
but our initial results argue against this possibility.
[0323] The measured AEI ratios clearly demonstrate functional
variation of SOD2 mRNA expression.
[0324] FLT1, HIF1A, HMOX1, and LPL did not display common and large
AEI. However, because the studied candidate genes all have
important physiological roles, even relatively small AEI ratios, as
observed for CCL2, NOS3, FLT1, HIF1A, HMOX1, HMGCR, and LPL, may be
of clinical importance [35]. Even a small activity change of a
critical gene such as HMGCR could affect cholesterol production
over an individual's lifetime. Moreover, pravastatin response was
associated with two intronic SNPs in HMGCR, with frequency >5%
in the population [47], and a genome-wide association study for LDL
cholesterol also revealed an association with an intronic HMGCR SNP
[48].
[0325] Thus, as described herein, the inventors have applied mRNA
AEI analysis to the detection of cis-acting variation for many
candidate genes, revealing many instances of yet unrecognized
functional polymorphisms or other cis-acting factors. The AEI
methodology can be applied on a fairly large scale while
maintaining high accuracy.
[0326] Materials and Methods
[0327] Human Tissue Selection and Sources
[0328] We obtained autopsy or biopsy tissue samples from liver,
kidney, intestines, peripheral white blood cells, and various brain
regions (prefrontal cortex, hippocampus, ventral tegmental area
(VTA), amygdala, and nucleus accumbens, and pontine nuclei of the
brain stem (for SERT and TPH2)). Specimens from up to .about.100
subjects for each cell or tissue were obtained from various sources
and tissue banks (OSU tissue procurement division, NIH Cooperative
Human Tissue Network, 105 brain sections from the Stanley
Foundation, Red Cross blood samples, and tissue banks at the
University of Maryland and the National Disease Research
Interchange). Left ventricular pieces were collected from the
failed hearts of transplant recipients under an IRB-approved
protocol at The Ohio State University. Ninety EBV-transformed
B-lymphoblast cell lines were obtained from the Coriell cell
repository, consisting of 30 Caucasian family trios. A majority of
the tissues are from normal subjects, while some tissues included
subjects diagnosed with schizophrenia, bipolar disorder,
Alzheimer's disease, and cancer. Ethnic distributions varied
between tissues repositories; no attempt was made to cover ethnic
groups evenly. The objective of this study was to detect functional
polymorphisms with allele frequencies of 5% or more.
[0329] Sample Preparation
[0330] Genomic DNA and RNA were prepared from peripheral
lymphocytes, or B-lymphocyte pellets, and frozen tissue samples
(brain, liver, etc) as described previously [9-16]. Monocytes and
monocyte-derived macrophages were cultured as described [49]. For
whole blood extractions, the buffy coat was harvested, then red
cells were either lysed using ammonium chloride to yield a
leukocyte pellet for RNA extraction, or red and white cells were
lysed with a sucrose Triton solution, providing a nuclear pellet
for DNA purification. Frozen tissue samples were pulverized under
liquid nitrogen and portioned into aliquots for DNA and RNA
extractions. DNA was prepared by digestion of the pellet or frozen
powder with SDS and proteinase K followed by NaCl salting out of
proteins. DNA was recovered by ethanol precipitation, and RNA was
extracted in Trizol.TM., chloroform extracted, and recovered by
precipitation with isopropanol. RNA precipitates were dissolved in
RNase-free water or Qiagen buffer, and then extracted using Qiagen
RNeasy columns.
[0331] Analysis of Allelic mRNA Expression Ratios for Detection of
Allelic Expression Imbalance (AEI)
[0332] Assay Design
[0333] Allelic ratios of genomic DNA and mRNA were measured with
SNaPshot as reported [9-16]. Briefly, DNA or mRNA (after conversion
to cDNA) regions containing a marker SNP (FIG. 29--Table 16) were
PCR amplified, followed by SNaPshot primer extension analysis of
each allele (FIG. 29--Table 16).
[0334] The procedure differs from earlier studies (e.g., [2]) by
combining multiple gene-specific primers close to the marker SNP
region for cDNA synthesis to compensate for mRNA degradation.
Accurate AEI analysis requires robust expression (RT-PCR cycle
threshold 27 or less). Selection criteria for a marker SNP were as
follows: 1) location in the transcribed region, coding or
non-coding, 2) high minor allele frequency (0.15-0.50), 3) position
of marker SNPs preferably more than 20 by from exon boundaries so
that the same set of primers for PCR amplification can be used in
both DNA and RNA.
[0335] Complementary DNA Synthesis
[0336] cDNA was generated from total RNA (1 ug) by Superscript II
reverse transcriptase (Invitrogen). Because oligo-dT priming often
fails in autopsy tissues, we used both oligo-dT and gene-specific
oligonucleotide primers targeting a region immediately 3' of the
marker SNP (same oligonucleotide used for PCR). We have multiplexed
up to 30 primers to permit 30 different AEI assays per cDNA
preparation. Comparisons between single and multiple primers showed
no significant differences where tested. cDNA was successfully
extracted from autopsy tissues to yield reproducible results
between independent cDNA preparations [9-16].
[0337] Quantitative PCR-Based mRNA Analysis
[0338] We determined the mRNA levels for each candidate gene in
each tissue or cell line, using RT-PCR, to assure that expression
is sufficient for accurate AEI analysis (cycle thresholds equal to
or below 27 cycles). Primers used for RT-PCR were the same as those
selected for the AEI analysis, with PCR conditions optimized for
each primer pair on an ABI7000 cycler with SYBR-Green. Results were
normalized to an internal standard (.beta.-actin or GAPDH).
[0339] Computational Analysis of mRNA Folding
[0340] We used Mfold version 3.0 to estimate the effect of SNPs on
mRNA folding [50]. Wild-type Refseq mRNA sequences of OPRM1, OPRD1
and OPRK1 were obtained without untranslated regions. A custom Unix
program created every possible variant at each base position and
fed sequences to Mfold for structure prediction, and subsequent
automated analysis. Changes in minimum free energy, as well as
pairwise comparisons in structural interactions (paired vs.
unpaired) were calculated relative to the wild-type structure using
sliding windows around the induced variants, and across the
complete mRNA structure.
Example III
SLC6A3
[0341] Polymorphisms in Genes Affecting Biogenic Amines as
Biomarkers in CNS Disorders
[0342] SLC6A3 (encoding the dopamine transporter) (newly added
gene) is associated with multiple mental disorders such as drug
abuse, attention deficit disorder (ADHD/ADD), Parkinson disease,
Tourette syndrome and Schizophrenia. FIG. 33 contains the mRNA
sequence for the SLC6A3 gene [SEQ ID NO: 263]. Stimulant
medications, such as those used to treat ADHD, and drugs of abuse
such as amphetamine bind to SLC6A3 and inhibit reuptake of
dopamine. Genetic variants of SLC6A3 may influence levels of gene
expression and/or ability of drugs to bind to SLC6A3 protein.
[0343] Described herein is the determination that a synonymous SNP
in Exon (rs6347) is associated with higher mRNA expression in both
brain tissue and in a heterologous cell culture system. This is the
first functional SNP occurring at high frequency in this key
gene.
[0344] Polymorphisms in SLC6A3 are now believed by the inventors
herein to be useful as biomarkers in numerous diseases and
treatment outcomes including but not restricted to mental disorders
and specifically drug addiction.
[0345] Role of SLC6A3 in Mental Disorders
[0346] Dopamine transporter is associated with multiple mental
disorders such as drug abuse, attention deficit disorder
(ADHD/ADD), Parkinson disease, Tourette syndrome and Schizophrenia
(for review: see Bannon, 2005 and Sotnikova et al, 2006). Stimulant
medications, such as those used to treat ADHD, and drugs of abuse
such as amphetamine bind to SLC6A3 and inhibit reuptake of
dopamine. Genetic variants of SLC6A3 may influence levels of gene
expression and/or ability of drugs to bind to SLC6A3 protein. One
SNP (rs27072) has been found to be significantly associated with
inattention and hyperactivity/impulsivity in children with
ADHD.
[0347] Polymorphisms Linked to AEI:
[0348] SLC6A3: SNP rs27072 located in the 3'UTR is associated with
AEI in brain tissue. An additional synonymous SNP in Exon 9 rs6347
(not linked to rs27072) is associated with AEI in both brain tissue
and cell culture. See FIG. 20 Table 11 which shows the sequences
for rs27072 and rs6347, showing [SEQ ID NOs: 85-85].
[0349] FIG. 30--Table 17 shows the forward primer, the reverse
primer and the extension primer for rs6437 [SEQ ID NOs: 87-89].
[0350] The rs6347 biomarker is based on molecular genetics and
function. Also the frequency and penetrance are measurable by AEI.
In addition, the combined use of two frequent functional
polymorphisms can be used to assess disease risk and response to
therapy (e.g., SSRIs).
Example IV
CYP2C9
[0351] CYP2C9 (encoding cytochrome P450 2C9) is a liver drug
metabolizing enzyme, involved in metabolism of .about.20% of
pharmaceuticals. FIG. 34 contains the mRNA sequence for the CYP2C9
gene [SEQ ID NO: 264].
[0352] The most common functional SNPs are CYP2C9*2 (430 C>T)
and *3 (1075 A>C). These are non-synonymous SNPs with reduced
enzyme activity (*2 50% and *3 25% of wild-type allele).
[0353] Described herein is a novel functional SNP, 1425 A>T,
which is associated with 20-50% increased in mRNA level in human
liver tissues, suggesting a "gain of function". The frequency of
SNP 1425 A>T is .about.4% but may vary significantly in
different populations. Because it represents a gain of function
(dominant effect), a 4% frequency is pharmacologically relevant.
SNP 1425 A>T is in partial linkage disequilibrium with *3 (and
hence may affect 8# activity), but is never to link to *2 in
>liver tissues.
[0354] Polymorphisms in CYP2C9 can be useful as biomarkers in
optimizing drug treatment for personalized medicine. It is noted
that CYP2C9*2 and *3 already comprise a drug biomarker test, FDA
approved and commercialized. See FIG. 21 Table 12 which shows the
sequence for sr1057911 [SEQ ID NO: 90].
[0355] FIG. 30--Table 17 shows the forward primer, the reverse
primer and the extension primer for rs9332242 and rs2017319 [SEQ ID
NOs: 91-96].
[0356] While the invention has been described with reference to
various and preferred embodiments, it should be understood by those
skilled in the art that various changes may be made and equivalents
may be substituted for elements thereof without departing from the
essential scope of the invention. In addition, many modifications
may be made to adapt a particular situation or material to the
teachings of the invention without departing from the essential
scope thereof. Therefore, it is intended that the invention not be
limited to the particular embodiment disclosed herein contemplated
for carrying out this invention, but that the invention will
include all embodiments falling within the scope of the claims.
[0357] The citation of any reference herein is not an admission
that such reference is available as prior art to the instant
invention. Any publications mentioned in this specification are
herein incorporated by reference. Any discussion of documents,
acts, materials, devices, articles or the like which has been
included in the present specification is solely for the purpose of
providing a context for the present invention. It is not to be
taken as an admission that any or all of these matters form part of
the prior art base or were common general knowledge in the field
relevant to the present invention as it existed before the priority
date of each claim of this application.
REFERENCES FOR EXAMPLE I
[0358] 1. Cambien F et al. (1988) Familial resemblance of plasma
angiotensin-converting enzyme level: the Nancy study. Am J Hum
Genet. 43:774-780. [0359] 2. Arnett D K et al. (2005)
Pharmacogenetic association of the angiotensin-converting enzyme
insertion/deletion polymorphism on blood pressure and
cardiovascular risk in relation to antihypertensive treatment: the
Genetics of Hypertension-Associated Treatment (GenHAT) study.
Circulation 111:3374-3383. [0360] 3. Sayed-Tabatabaei F A, Oostra B
A, Isaacs A, van Duijn C M, Witteman J C M (2006) ACE polymorphism.
Circ Res 98:1123-1133. [0361] 4. Rosatto N, Pontremoli R, de
Ferrari G, Ravazzolo R (1999) Intron 16 insertion of the
angiotensin converting enzyme gene and transcriptional regulation.
Nephrol Dial Transplant 14:868-871. [0362] 5. Lei H, Day I N M,
Vorechocsky I (2005) Exonization of AluYa5 in the human ACE gene
requires mutations in both 3' and 5' splice sites and is
facilitated by a conserved splicing enhancer. Nucl Acids Res
33:3897-3906. [0363] 6. Wang D et al. (2005) Multidrug resistance
polypeptide 1 (MDR1, ABCB1) variant 3435C>T affects mRNA
stability. Pharmacogen Gen 15:693-704. [0364] 7. Zhang Y, Wang D,
Johnson A D, Papp A C, Sadee W (2005) Allelic expression imbalance
of human mu opioid receptor (OPRM1) caused by variant A118G. J Biol
Chem 280:32618-32624. [0365] 8. Lim J E, Pinsonneault J, Sadee W,
Saffen D (2007) Tryptophan hydroxylase 2 (TPH2) haplotypes predict
levels of TPH2 mRNA expression in human pons. Mol Psychiatry
12:491-501. [0366] 9. Pinsonneault J K, Papp A C, Sadee W (2006)
Allelic mRNA expression of X-linked monoamine oxidase A (MAOA) in
human brain: Dissection of epigenetic and genetic factors. Hum Mol
Genet. 15:2636-2649. [0367] 10. Zhang Y et al. (2007) Novel
polymorphisms in the human dopamine D2 receptor gene affect gene
expression, splicing, and neuronal activity. PNAS in press. [0368]
11. Zhu X et al. (2001) Linkage and association analysis of
angiotensin I-converting enzyme (ACE)-gene polymorphisms with ACE
concentration and blood pressure. Am J Hum Genet. 68:1139-1148.
[0369] 12. Bouzekri N et al. (2004) Angiotensin I-converting enzyme
polymorphisms, ACE level and blood pressure among Nigerians,
Jamaicans and African-Americans. Eur J Hum Gen 12:460-468. [0370]
13. Rieder M J, Taylor S L, Clark A G, Nickerson D A (1999)
Sequence variation in the human angiotensin converting enzyme. Nat
Gen 22:59-62. [0371] 14. Hajjar I, Kotchen T A (2003) Trends in
prevalence, awareness, treatment, and control of hypertension in
the United States, 1998-2000. JAMA 290:199-206. [0372] 15. Rosamond
W et al. (2007) Heart disease and stroke statistics--2007 update: a
report from the American Heart Association statistics committee and
stroke statistics subcommittee. Circulation 115:e69-e171. [0373]
16. Exner D V, Dries D L, Domanski M J, Cohn J N (2001) Lesser
response to angiotensin-converting-enzyme inhibitor therapy in
black as compared with white patients with left ventricular
dysfunction. N Engl J Med 344:1351-1357. [0374] 17. Sehgal A R
(2004) Overlap between whites and blacks in response to
antihypertensive drugs. Hypertension 43:566-572. [0375] 18.
McDowell S E, Coleman J J, Ferner R E (2006) Systematic review and
meta-analysis of ethnic differences in risks of adverse reactions
to drugs used in cardiovascular medicine. Br Med J 332:1177-1181.
[0376] 19. Pepine C J et al. (2003) A calcium antagonist versus a
non-calcium antagonist hypertension treatment strategy for patients
with coronary heart disease--The International
Verapamil-Trandolopril Study (INVEST): a randomized control trial.
JAMA 290:2805-2816. [0377] 20. Naya F J et al. (2002)
Mitochrondrial deficiency and cardiac sudden death in mice lacking
the MEF2A transcription factor. Nat Med 8(11):1303-1309. [0378] 21.
Wang L, Fan C, Topol S E, Topol E J, Wang Q (2003) Mutation of
MEF2A in an inherited disorder with features of coronary artery
disease. Science 302(5650):1578-1581. [0379] 22. van Oort R J et
al. (2006) MEF2 activates a genetic program promoting chamber
dilation and contractile dysfunction in calcineurin-induced heart
failure. Circulation 114(4):298-308. [0380] 23. Cohn J N, Tognoni G
for the Valsartan Heart Failure Trial Investigators (2001) A
randomized trial of the angiotensin-receptor blocker valsartan in
chronic heart failure. N Engl J Med 345:1667-1675. [0381] 24.
Taylor A L et al. (2004) Combination of isosorbide dinitrate and
hydralazine in blacks with heart failure. N Engl J Med
351:2049-2057. [Erratum, N Engl J Med (2005) 352:1276-b]. [0382]
25. Bamshed M (2005) Genetic influences on health. Does race
matter? JAMA 294:937-946. [Erratum, JAMA (2005) 294:1620]. [0383]
26. Hemming M L, Selkoe D J (2005) Amyloid beta-protein is degraded
by cellular angiotensin-converting enzyme (ACE) and elevated by an
ACE inhibitor. J Biol Chem 280(45):37644-37650. [0384] 27. Meng Y
et al. (2006) Association of polymorphisms in the
angiotensin-converting enzyme gene with Alzheimer disease in an
Israeli Arab community. Am J Hum Gen 78:871-877. [0385] 28. Johnson
A D, Wang D, Sadee W (2005) Polymorphisms affecting gene regulation
and mRNA processing: broad implications for pharmacogenetics. Pharm
Ther 106:19-38. [0386] 29. Eyries M, Agrapart M, Alonso A, Soubrier
F (2002) Phorbol ester induction of angiotensin-converting enzyme
transcription is mediated by Egr-1 and AP-1 in human endothelial
cells via ERK1/2 pathway. Circ Res 91:899-906. [0387] 30. Andrisin
T E, Humma L M, Johnson J A (2002) Collection of genomic DNA by the
noninvasive mouthwash method for use in pharmacogenetic studies.
Pharmacotherapy 22:954-960. [0388] 31. Beitelshees A L et al.
(2007) KCNMB1 genotype influences response to verapamil and adverse
outcomes in the INternational VErapamil SR/Trandolapril STudy
(INVEST). Pharmacogen Gen 17:719-729. [0389] 32. Shriver M D et al.
(2005) Large-scale SNP analysis reveals clustered and continuous
patterns of human genetic variation. Hum Genomics 2(2):81-89.
[0390] 33. Myakishev M V, Khripin Y, Hu S, Hamer D H (2001)
High-throughput SNP genotyping by allele-specific PCR with
universal energy-transfer-labeled primers. Genome Res
11(1):163-169. [0391] 34. Miller S A, Dykes D D, Polesky H F (1988)
A simple salting out procedure for extracting DNA from human
nucleated cells. Nucl Acids Res 16:1215. [0392] 35. Papp A C,
Pinsonneault J K, Cooke G, Sadee W (2003) Single nucleotide
polymorphism genotyping using allele-specific PCR and fluorescence
melting curves. Biotechniques 34(5):1068-1072. [0393] 36. Langaee
T, Ronaghi M. (2005) Genetic variation analyses by Pyrosequencing.
Mutat Res 573(1-2):96-102. [0394] 37. Beitelshees A L et al. (2005)
Variable blood pressure response to verapamil by KCNMB1 genotype.
Clin Pharmacol Ther 77:P97. [0395] 38. The sixth report of the
Joint National Committee on prevention, detection, evaluation, and
treatment of high blood pressure. (1997) Arch Intern Med
157:2413-2446. [0396] 39. Lehmann, D. J., Cortina-Borj a, M.,
Warden, D. R., Smith, A. D., Sleegers, K., et al. (2005). Large
meta-analysis establishes the ACE insertion-deletion polymorphism
as a marker of Alzheimer's disease. Am J Epidem 162(4), 305-317.
[0397] 40. Okabe, T., Fujisawa, M., Yotsumoto, H., Takaku, F.,
Lanzillo, J. J., et al. (1985). Familial elevation of serum
angiotensin converting enzyme. Q J Med 55(216), 55-61. [0398] 41.
Morimoto, T., Gandhi, T. K., Fiskio, J. M., Seger, A. C., So, J.
W., et al. (2004). An evaluation of risk factors for adverse drug
events associated with angiotensin-converting enzyme inhibitors. J
Eval Clin Pract 10(4), 499-509. [0399] 42. Brown, N. J., Ray, W.
A., Snowden, M. and Griffin, M. R. (1996). Black Americans have an
increased rate of angiotensin converting enzyme
inhibitor-associated angioedema. Clin Pharmacol Ther 60(1), 8-13.
[0400] 43. Brown, N. J., Snowden, M. and Griffin, M. R. (1997).
Recurrent angiotensin-converting enzyme inhibitor-associated
angioedema. Jama 278(3), 232-3. [0401] 44. Kostis, J. B., Kim, H.
J., Rusnak, J., Casale, T., Kaplan, A., et al. (2005). Incidence
and characteristics of angioedema associated with enalapril. Arch
Intern Med 165(14), 1637-42. [0402] 45. Morimoto, T., Gandhi, T.
K., Fiskio, J. M., Seger, A. C., So, J. W., et al. (2004). An
evaluation of risk factors for adverse drug events associated with
angiotensin-converting enzyme inhibitors. J Eval Clin Pract 10(4),
499-509.
REFERENCE FOR EXAMPLES II-IV
[0402] [0403] 1. Rodman, M. V. and Wray, G. A. (2002) Abundant raw
material for cis-regulatory evolution in humans. Mol Biol Evol, 19,
1991-2004. [0404] 2. Bray, N. J., Buckland, P. R., Owen, M. J. and
O'Donovan, M. C. (2003) Cis-acting variation in the expression of a
high proportion of genes in human brain. Hum Genet, 113, 149-53.
[0405] 3. Yan, H., Yuan, W., Velculescu, V. E., Vogelstein, B. and
Kinzler, K. W. (2002) Allelic variation in human gene expression.
Science, 297, 1143. [0406] 4. Yan, H. and Zhou, W. (2004) Allelic
variations in gene expression. Curr Opin Oncol, 16, 39-43. [0407]
5. Pastinen, T., Ge, B. and Hudson, T. J. (2006) Influence of human
genome polymorphism on gene expression. Hum Mol Genet, 15 Spec No
1, R9-16. [0408] 6. Cheung, V. G., Conlin, L. K., Weber, T. M.,
Arcaro, M., Jen, K. Y., Morley, M. and Spielman, R. S. (2003)
Natural variation in human gene expression assessed in
lymphoblastoid cells. Nat Genet, 33, 422-5. [0409] 7. Rodman, M.
V., Hahn, M. W., Soranzo, N., Zimprich, F., Goldstein, D. B. and
Wray, G. A. (2005) Ancient and recent positive selection
transformed opioid cis-regulation in humans. PLoS Biol, 3, e387.
[0410] 8. Johnson, A. D., Wang, D. and Sadee, W. (2005)
Polymorphisms affecting gene regulation and mRNA processing: broad
implications for pharmacogenetics. Pharmacol Ther, 106, 19-38.
[0411] 9. Wang, D., Johnson, A. D., Papp, A. C., Kroetz, D. L. and
Sadee, W. (2005) Multidrug resistance polypeptide 1 (MDR1, ABCB1)
variant 3435C>T affects mRNA stability. Pharmacogenet Genomics,
15, 693-704. [0412] 10. Zhang, Y., Wang, D., Johnson, A. D., Papp,
A. C. and Sadee, W. (2005) Allelic expression imbalance of human mu
opioid receptor (OPRM1) caused by variant A118G. J Biol Chem, 280,
32618-24. [0413] 11. Lim, J. E., Papp, A., Pinsonneault, J., Sadee,
W. and Saffen, D. (2006) Allelic expression of serotonin
transporter (SERT) mRNA in human pons: lack of correlation with the
polymorphism SERTLPR. Mol Psychiatry, 11, 649-62. [0414] 12.
Pinsonneault, J. K., Papp, A. C. and Sadee, W. (2006) Allelic mRNA
expression of X-linked monoamine oxidase a (MAOA) in human brain:
dissection of epigenetic and genetic factors. Hum Mol Genet, 15,
2636-49. [0415] 13. Lim, J. E., Pinsonneault, J., Sadee, W. and
Saffen, D. (2007) Tryptophan hydroxylase 2 (TPH2) haplotypes
predict levels of TPH2 mRNA expression in human pons. Mol
Psychiatry, 12, 491501. [0416] 14. Pinsonneault, J., Nielsen, C. U.
and Sadee, W. (2004) Genetic Variants of the Human H+/Dipeptide
Transporter PEPT2: Analysis of Haplotype Functions. J Pharmacol Exp
Ther, 311, 1088-96. [0417] 15. Wang, D., Papp, A. C., Binkley, P.
F., Johnson, J. A. and Sadee, W. (2006) Highly variable mRNA
expression and splicing of L-type voltage-dependent calcium channel
alpha subunit 1C in human heart tissues. Pharmacogenet Genomics,
16, 735-45. [0418] 16. Zhang, Y., Bertolino, A., Fazio, L., Blasi,
G., Rampino, A., Romano, R., Lee, M. L. T., Xiao, T., Papp, A.,
Wang, D. et al. (2007) Novel polymorphisms in the human dopamine D2
receptor gene affect gene expression, splicing, and neuronal
activity. PNAS, 104, 20552-57. [0419] 17. Bray, N. J., Buckland, P.
R., Williams, N. M., Williams, H. J., Norton, N., Owen, M. J. and
O'Donovan, M. C. (2003) A haplotype implicated in schizophrenia
susceptibility is associated with reduced COMT expression in human
brain. Am J Hum Genet, 73, 152-61. [0420] 18. Knight, J. C.,
Keating, B. J., Rockett, K. A. and Kwiatkowski, D. P. (2003) In
vivo characterization of regulatory polymorphisms by
allele-specific quantification of RNA polymerase loading. Nat
Genet, 33, 469-75. [0421] 19. Ge, B., Gurd, S., Gaudin, T., Dore,
C., Lepage, P., Harmsen, E., Hudson, T. J. and Pastinen, T. (2005)
Survey of allelic expression using EST mining. Genome Res, 15,
1584-91. [0422] 20. Lin, W., Yang, H. H. and Lee, M. P. (2005)
Allelic variation in gene expression identified through
computational analysis of the dbEST database. Genomics, 86, 518-27.
[0423] 21. Cowles, C. R., Hirschhorn, J. N., Altshuler, D. and
Lander, E. S. (2002) Detection of regulatory variation in mouse
genes. Nat Genet, 32, 432-7. [0424] 22. Liu, J., Chen, M., Deng,
C., Bourchis, D., Nealon, J. G., Erlichman, B., Bestor, T. H. and
Weinstein, L. S. (2005) Identification of the control region for
tissue-specific imprinting of the stimulatory G protein
alpha-subunit. Proc Natl Acad Sci USA, 102, 5513-8. [0425] 23.
Singer-Sam, J., Chapman, V., LeBon, J. M. and Riggs, A. D. (1992)
Parental imprinting studied by allele-specific primer extension
after PCR: paternal X chromosome-linked genes are transcribed prior
to preferential paternal X chromosome inactivation. Proc Natl Acad
Sci USA, 89, 10469-73. [0426] 24. Pastinen, T., Sladek, R., Gurd,
S., Sammak, A., Ge, B., Lepage, P., Layergne, K., Villeneuve, A.,
Gaudin, T., Brandstrom, H. et al. (2004) A survey of genetic and
epigenetic variation affecting human gene expression. Physiol
Genomics, 16, 184-93. [0427] 25. He, H., Olesnanik, K., Nagy, R.,
Liyanarachchi, S., Prasad, M. L., Stratakis, C. A., Kloos, R. T.
and de la Chapelle, A. (2005) Allelic variation in gene expression
in thyroid tissue. Thyroid, 15, 660-7. [0428] 26. Pant, P. V., Tao,
H., Beilharz, E. J., Ballinger, D. G., Cox, D. R. and Frazer, K. A.
(2006) Analysis of allelic differential expression in human white
blood cells. Genome Res, 16, 331-9. [0429] 27. Cirulli, E. T. and
Goldstein, D. B. (2007) In vitro assays fail to predict in vivo
effects of regulatory polymorphisms. Hum Mol Genet, 16, 1931-9.
[0430] 28. Wilkins, J. M., Southam, L., Price, A. J., Mustafa, Z.,
Carr, A. and Loughlin, J. (2007) Extreme context specificity in
differential allelic expression. Hum Mol Genet, 16, 537-46. [0431]
29. Bray, N. J., Preece, A., Williams, N. M., Moskvina, V.,
Buckland, P. R., Owen, M. J. and O'Donovan, M. C. (2005) Haplotypes
at the dystrobrevin binding protein 1 (DTNBP1) gene locus mediates
risk for schizophrenia through reduced DTNBP1 expression. Hum Mol
Genet, 14, 1947-54. [0432] 30. Bray, N. J., Buckland, P. R., Hall,
H., Owen, M. J. and O'Donovan, M. C. (2004) The serotonin-2A
receptor gene locus does not contain common polymorphism affecting
mRNA levels in adult brain. Mol Psychiatry, 9, 109-14. [0433] 31.
Fukuda, Y., Koga, M., Arai, M., Noguchi, E., Ohtsuki, T., Horiuchi,
Y., Ishiguro, H., Niizato, K., Iritani, S., Itokawa, M. et al.
(2006) Monoallelic and unequal allelic expression of the HTR2A gene
in human brain and peripheral lymphocytes. Biol Psychiatry, 60,
1331-5. [0434] 32. Rovin, B. H., Lu, L. and Saxena, R. (1999) A
novel polymorphism in the MCP-1 gene regulatory region that
influences MCP-1 expression. Biochem Biophys Res Commun, 259,
344-8. [0435] 33. Xu, Y., Porntadavity, S, and St Clair, D. K.
(2002) Transcriptional regulation of the human manganese superoxide
dismutase gene: the role of specificity protein 1 (Sp1) and
activating protein-2 (AP-2). Biochem J, 362, 401-12. [0436] 34.
Miklos, I., Meyer, I. M. and Nagy, B. (2005) Moments of the
Boltzmann distribution for RNA secondary structures. Bull Math
Biol, 67, 1031-47. [0437] 35. Lengauer, C., Kinzler, K. W. and
Vogelstein, B. (1998) Genetic instabilities in human cancers.
Nature, 396, 643-9. [0438] 36. Duan, J., Wainwright, M. S.,
Comeron, J. M., Saitou, N., Sanders, A. R., Gelemter, J. and
Gejman, P. V. (2003) Synonymous mutations in the human dopamine
receptor D2 (DRD2) affect mRNA stability and synthesis of the
receptor. Hum Mol Genet, 12, 205-16. [0439] 37. Howe, D. and Lynas,
C. (2001) The cyclin D1 alternative transcripts [a] and [b] are
expressed in normal and malignant lymphocytes and their relative
levels are influenced by the polymorphism at codon 241.
Haematologica, 86, 563-9. [0440] 38. Nackley, A. G., Shabalina, S.
A., Tchivileva, I. E., Satterfield, K., Korchynskyi, O., Makarov,
S. S., Maixner, W. and Diatchenko, L. (2006) Human
catechol-O-methyltransferase haplotypes modulate protein expression
by altering mRNA secondary structure. Science, 314, 1930-3. [0441]
39. Sayed-Tabatabaei, F. A., Oostra, B. A., Isaacs, A., van Duijn,
C. M. and Witteman, J. C. (2006) ACE polymorphisms. Circ Res, 98,
1123-33. [0442] 40. Sam, F., Kerstetter, D. L., Pimental, D. R.,
Mulukutla, S., Tabaee, A., Bristow, M. R., Colucci, W. S, and
Sawyer, D. B. (2005) Increased reactive oxygen species production
and functional alterations in antioxidant enzymes in human failing
myocardium. J Card Fail, 11, 473-80. [0443] 41. Hiroi, S., Harada,
H., Nishi, H., Satoh, M., Nagai, R. and Kimura, A. (1999)
Polymorphisms in the SOD2 and HLA-DRB1 genes are associated with
nonfamilial idiopathic dilated cardiomyopathy in Japanese. Biochem
Biophys Res Commun, 261, 332-9. [0444] 42. Valenti, L., Conte, D.,
Piperno, A., Dongiovanni, P., Fracanzani, A. L., Fraquelli, M.,
Vergani, A., Gianni, C., Carmagnola, L. and Fargion, S. (2004) The
mitochondrial superoxide dismutase A16V polymorphism in the
cardiomyopathy associated with hereditary haemochromatosis. J Med
Genet, 41, 946-50. [0445] 43. Hung, R. J., Boffetta, P., Brennan,
P., Malaveille, C., Gelatti, U., Placidi, D., Carta, A.,
Hautefeuille, A. and Porru, S. (2004) Genetic polymorphisms of MPO,
COMT, MnSOD, NQO1, interactions with environmental exposures and
bladder cancer risk. Carcinogenesis, 25, 973-8. [0446] 44. Xu, Y.,
Fang, F., Dhar, S. K., St Clair, W. H., Kasarskis, E. J. and St
Clair, D. K. (2007) The role of a single-stranded nucleotide loop
in transcriptional regulation of the human sod2 gene. J Biol Chem,
282, 15981-94. [0447] 45. Ginsberg, M. D., Feliciello, A., Jones,
J. K., Avvedimento, E. V. and Gottesman, M. E. (2003) PKA-dependent
binding of mRNA to the mitochondrial AKAP121 protein. J Mol Biol,
327, 885-97. [0448] 46. Huang, Y., He, T. and Domann, F. E. (1999)
Decreased expression of manganese superoxide dismutase in
transformed cells is associated with increased cytosine methylation
of the SOD2 gene. DNA Cell Biol, 18, 643-52. [0449] 47. Chasman, D.
I., Posada, D., Subrahmanyan, L., Cook, N. R., Stanton, V. P., Jr.
and Ridker, P. M. (2004) Pharmacogenetic study of statin therapy
and cholesterol reduction. Jama, 291, 2821-7. [0450] 48.
Kathiresan, S., Melander, O., Guiducci, C., Surti, A., Burtt, N.
P., Rieder, M. J., Cooper, G. M., Roos, C., Voight, B. F.,
Havulinna, A. S. et al. (2008) Six new loci associated with blood
low-density lipoprotein cholesterol, high-density lipoprotein
cholesterol or triglycerides in humans. Nat Gen, 40, 189-97. [0451]
49. Eubank, T. D., Galloway, M., Montague, C. M., Waldman, W. J.
and Marsh, C. B. (2003) M-CSF induces vascular endothelial growth
factor production and angiogenic activity from human monocytes. J
Immunol, 171, 2637-43. [0452] 50. Zuker, M. (2003) Mfold web server
for nucleic acid folding and hybridization prediction. Nucleic
Acids Res, 31, 3406-15. [0453] 51. Nakayama, M., Yasue, H.,
Yoshimura, M., Shimasaki, Y., Kugiyama, K., Ogawa, H., Motoyama,
T., Saito, Y., Ogawa, Y., Miyamoto, Y. et al. (1999) T-786->C
mutation in the 5'-flanking region of the endothelial nitric oxide
synthase gene is associated with coronary spasm. Circulation, 99,
2864-70.
Sequence CWU 1
1
290125DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 1tgagatgggc catatacagt actac 25216DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
2cccgacgcag ggagac 16324DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 3cccttacaag cagaggtgag ctaa
24418DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 4accacctaca gcgtggcc 18525DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
5catgcccata acaggtcttc atatt 25620DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 6ctgcagtaca aggatctgcc
20718DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 7gacgaatgtg atggccac 18819DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
8ccccttcccg ctacaactt 19921DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 9tcccctgata cttggttcga a
211033DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 10ctctgcaccc ttcctttgat gaggttttgc cct
331133DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 11agggcaaaac ctcatcaaag gaagggtgca gag
331241DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 12gagcatattt ttaagggctg gttttctctc ctgtggtaac t
411341DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 13agttaccaca ggagagaaaa ccagccctta aaaatatgct c
411423DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 14gagacggagt tttgctcttg ttg 231521DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
15cagagacctg acccacgtga g 211622DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 16gagtgtgggt catttcctct tt
221721DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 17agtttagcat ggtgcctagc a 211815DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
18gggcaaaacc tcatc 151920DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 19gtggccatca cattcgtcag
202021DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 20cccatccttt ctcccatttc t 212117DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
21gacctcgtga tccgccc 172219DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 22tggctcctgc ctgtaccag
192318DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 23ccaaggctgt tcacccga 182425DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
24tggctagaaa gggcctcctc tcttt 252520DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
25ttgaggcgcc gctgaggact 202616DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 26ctgccccgca cccttg
162719DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 27ccttctgagc gagctgtgc 192837DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
28ggcggccggc ccgccccgcc ttctgagcga gctgcgt 372920DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
29tgacttgagg gagggtccct 203018DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 30gcaggagaat ggggttcc
183135DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 31cgggccgccg ggccgcggca ggagaatggg gtact
353217DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 32aggcgctcca aagctcc 173322DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
33gtgatgttgg tgtcgtgcgc cc 223430DNAHomo sapiens 34ttgagcatat
ttttaagggc tgtttttctc 303520DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 35cacagggcaa
aacctcaacg 203635DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 36ggcgcgccgc gggcccacag
ggcaaaacct cacca 353723DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 37gtcatttcct
ctttcctctg cac 233819DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 38gacgaatgtg
atggcctcg 193932DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 39gggccggccg cgcgacgaat
gtgatggccg ca 324025DNAArtificial SequenceDescription of Artificial
Sequence Synthetic oligonucleotide 40catgcccata acaggtcttc atatt
254120DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 41tgcagtacaa ggatctgacc
204235DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 42cgccgggccg gccggtgcag tacaaggatc tggct
354317DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 43tccccaatgg cctcatg 174420DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
44gccccagcac catttgttaa 204522DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 45cagccccaaa ttttgtatat gg
224620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 46gttactggag ggcagggatg 204720DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
47ttctcctttg ttgtgacggc 204820DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 48tctgtgtgca aatgagctgc
204922DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 49tgtcctctgg tatccactgg ct 225021DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
50gaccttaggt gtcttgcagg c 215121DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 51tcctgtgaga tgcacctcca g
215217DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 52aggcgctcca aagctcc 175319DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
53gtgatgttgg tgtcgtgcg 195417DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 54ctgcagcccg gcaactt
175521DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 55gtatctgtct ccgtatcggc g 215622DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
56aaccgctgta cgaggatttc ac 225722DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 57cgattttgtg cagatgttca gg
225825DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 58tgagatgggc catatacagt actac 255920DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
59ccctccgggt agttgtcagg 206022DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 60ctgaaggaca tggtcggctt ag
226121DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 61ccacgagtcc cctgcatcta c 216220DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
62tggaaaccac ctacagcgtg 206321DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 63ccctcaaggc cacaggtaag t
216420DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 64cttacctgtg gccttgaggg 206520DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
65cttctgagcg agcggagttc 206626DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 66aagcatcacc aaggagaact ataacc
266727DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 67tgtattcaca gagagacttg gagaggt
276821DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 68gaacacttgc cattttgagc c 216925DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
69aggatggagg aacaaaccta gtaac 257017DNAHomo sapiens 70tgtatgggtt
catttct 177117DNAPan sp. 71tgtacgggtt catttct 177217DNAMacaca sp.
72tgtacaggtt catttct 177316DNAUnknown OrganismDescription of
Unknown Organism Shrew oligonucleotide 73gtaagggttt gtttct
167417DNACanis sp. 74tataagagtt tatttat 177517DNAUnknown
OrganismDescription of Unknown Organism Elephant oligonucleotide
75tgtaagggtt tatttgt 177616DNAGalago sp. 76tggcgcctta gccgct
167717DNAUnknown OrganismDescription of Unknown Organism Squirrel
oligonucleotide 77tgtaagggtt taattct 177817DNAUnknown
OrganismDescription of Unknown Organism Armadillo oligonucleotide
78tgtaagggtt tatttct 177918DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 79ggttgttcac gtaggccg
188016DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 80cagcaggcag ctggct 168118DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
81gagcccagat accccaaa 188215DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 82ttgcggcgca gctgg
158317DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 83ctgaagccgc tgccgaa 178417DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
84gggccttaag aaagcgc 178546DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 85agtgcccctg
gggcagcctc agagcyggga gcagggagca gggagg 468646DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 86ccatcgccac gctccctctg tcctcrgcct gggccgtggt
cttctt 468721DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 87ttcatcatct acccggaagc c
218819DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 88gaagaagacc acggcccag 198917DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
89acgctccctc tgtcctc 179052DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 90cttgacacca
ctccagttgt caatggwttt gcctctgtgc cgcccttcta cc 529120DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
91ggatttgtgt gggagaagcc 209224DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 92tagtgaaaga tggataatgc ccca
249324DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 93aatgcctttt ctcacctgtc atct 249420DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
94ggatttgtgt gggagaagcc 209524DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 95tagtgaaaga tggataatgc ccca
249623DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 96aggaataaaa acagctccat gcc 239720DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
97atgcaatcaa tgccccagtc 209820DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 98gcgagcctct gcactgagat
209925DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 99agatcttcct attggtgaag ttata 2510022DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
100caacccaaga atctgcagct aa 2210125DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
101ggcataatgt ttcacatcaa caaac 2510218DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
102tagctttccc cagacacc 1810323DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 103gtcctgtctc tctgaacttt ggg
2310421DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 104gagctgtatg caatgcttgc c 2110522DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
105attgtagacc agagggagca ct 2210621DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
106taaagcagca catagcactg g 2110721DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 107gcagatagcc acaatgacct t
2110823DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 108cctttccaat atgtacaagc tcc 2310926DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
109gcaaatataa gctgggaaaa aagttt 2611030DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
110aattaactac aaaatcagga gtttcatcag 3011122DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
111aaatccattt tcaactggca gg 2211222DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
112ttcctctcag catcttctcc ac 2211320DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
113gggcagatgg atggtctgtc 2011421DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 114gccggcagat gtaactggta c
2111517DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 115gggctgaagc tgggatc 1711620DNAArtificial
SequenceDescription of
Artificial Sequence Synthetic primer 116ctgacttgct tccggagttt
2011715DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 117ctccccgcca aagca 1511823DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
118cattcctttt tttggacact ggt 2311924DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
119caagtttgtg cagtattgta gcca 2412032DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
120atgtagaaaa tataaataga ctgctttagg ta 3212119DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
121gaaacggtcg cttcgacgt 1912221DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 122ggcagaagga agagttctgg g
2112335DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 123agtaaccttg gaaccttggt gcaggcccca gatga
3512423DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 124aatactccgt aagaccacac gtc 2312522DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
125actcgacttc ctctgaaatg ga 2212627DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
126gctgtagatt ttgtcaaaga tagattc 2712728DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
127gaacgagtgg aatatctctt tctcataa 2812818DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
128gcggaggtag gcattggg 1812921DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 129cataattttt acggtggaag c
2113021DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 130ccagagctgc ctgttcaaaa t 2113123DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
131atgagcttca ggatcatctc cac 2313219DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
132tgctcttcac tggcctctt 1913320DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 133ttccaggagc ttctgtgcct
2013418DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 134gccgttgctg gagtagcc 1813520DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
135tcttctttga aggcctatgg 2013619DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 136caggaatcca agtgccacc
1913718DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 137ccacaggcat ggtactgg 1813820DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
138ccaacatcag ggaccaggag 2013922DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 139aagtagagcc atccatccat gc
2214020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 140gattggactg gaagagtggg 2014117DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
141ctgctcccca cttgcag 1714219DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 142ttttcctaac tcgcccgct
1914321DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 143tgggtgtaaa aaagagcgag c 2114418DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
144cctcctcctg ccataccc 1814518DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 145gagtggcctc ggaagctg
1814619DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 146ggaaacactg ggctgaggg 1914717DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
147ggtgtcctac tgccccc 1714819DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 148tcaccatggg catttgatt
1914920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 149ccacagcggt gatcattgac 2015019DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
150tgagagcagc tccgagtcc 1915120DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 151ggaggtttga gacagctgcc
2015219DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 152ctgcagcaga gcctggaag 1915319DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
153ctgcagcaga gcctggaag 1915420DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 154cctatggaga caacagccgg
2015520DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 155ggcatgtatg ttggcctcct 2015618DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
156ctcctttgct gccctcac 1815725DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 157tttctcactc gtcctggtag atctt
2515819DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 158actgtttcca accagggcc 1915920DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
159ctctgcacct tcaggttcag 2016025DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 160ttgttgaaat gaaaatgttg
tctgg 2516128DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 161caatcatatt tagtttgact caccttcc
2816226DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 162tgaaagataa gaaagaacta gaaggt
2616322DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 163aagtagagcc atccatccat gc 2216420DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
164gattggactg gaagagtggg 2016519DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 165gcaggtggag aaggcattg
1916619DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 166tgtgtccaga ggagcccat 1916719DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
167ggctcaccag gaaagcaaa 1916821DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 168accgcccgcc tgtgcccatc a
2116919DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 169tgtgtccaga ggagcccat 1917019DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
170ggctcaccag gaaagcaaa 1917121DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 171cgagcagagg cgcttctccg t
2117219DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 172tgtgtccaga ggagcccat 1917319DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
173ggctcaccag gaaagcaaa 1917421DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 174agcttcaatg atgagaacct g
2117515DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 175ggcccagcca ccatg 1517622DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
176gcacagcaca aagctcatag gg 2217721DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
177gtgtctttgc tttcctggtg a 2117823DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 178acatttcttc tcctggatca
cca 2317921DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 179acactagaag cgtgtggcgt t 2118019DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
180ctggatcacc agtcactgc 1918121DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 181ctgcttgaag tcgtcagtta c
2118224DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 182aggaaaatgg ctgttggtat gatc 2418318DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
183cgcaactgca aatgccag 1818420DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 184gctgttggta tgatcctagc
2018516DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 185gaaatggccc cagccc 1618625DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
186catctgccag attcaagact tgtag 2518717DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
187aacctcctgg ggacctg 1718819DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 188ccagctgact ctccccgac
1918920DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 189gcatgcccat tcttctctgg 2019044DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
190cgatcacatg tcgtgaactg actgactggt ttggcggggc tgtc
4419119DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 191ccagctgact ctccccgac 1919220DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
192gcatgcccat tcttctctgg 2019317DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 193ggagtgctgt ggagacc
1719417DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 194agcctgagtc agggccc 1719515DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
195accgcctgct ccacg 1519619DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 196cccagaggct gagttttct
1919717DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 197tgaacatgca cagccgc 1719820DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
198cgaaggcata ggtgatgtcc 2019917DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 199ttgtaggtgc ccacggc
1720020DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 200cacatgcaag aaggagccct 2020121DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
201ggtggtctgc aatgtactgg a 2120215DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 202ccgcagcacc aaagc
1520321DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 203ccctctccta gcgaagcaga t 2120419DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
204ggtccttgag cctctcggg 1920520DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 205ctagcgaagc agattggagc
2020620DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 206ccgtcagtac catggacagc 2020720DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
207gagtacgcca aggcatcagt 2020828DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 208actgatcgac ttgtcccact
tagatggc 2820930DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 209actgactgac tgaccatggg tcggacaggt
3021027DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 210gacaccaggc tctacagtaa tgacttt
2721125DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 211tgtccagtta aatgcatcag aagtg
2521245DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 212actgactgac tggaaccttg actcatcaga agtgttagct
tctcc 4521321DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 213gcttgacatc attggctgac a
2121421DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 214ctggtcctca tccaacagct c 2121526DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
215aaccttggaa ccttggggct gacact 2621624DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
216tatctgtttg cttctaaagg tttc 2421724DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
217tggacacact atttttcatt ttag 2421828DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
218ggttctagta gattccagca ataaaatt 2821922DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
219acgagacttt ctggcaggac tg 2222024DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
220ttaattctcc aatggaggaa agga 2422117DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
221gatcccctct acacccc 1722222DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 222acgagacttt ctggcaggac tg
2222324DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 223ttaattctcc aatggaggaa agga 2422419DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
224aaaggagtcc tgctccata 1922521DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 225atgggaggca tggaggctgt c
2122625DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 226cgagaaggaa agtgctgaag gtgac
2522720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 227ggcatggagg ctgtcatcac
2022820DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 228atccagtttt ggctgtatgc 2022925DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
229ctgttcttta agtttctcac acatt 2523027DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
230tgttttatag aggttcttga tttttac 2723123DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
231ctgctgccac tactgctgct gct 2323220DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
232cacctttccc tcgatcacca 2023316DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 233tagcacaccg aggccc
1623426DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 234ccacgtcctc ggtcacctct attaac
2623526DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 235cacaataaag gctcccaaaa tgatcc
2623626DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 236tcgaaatccg gatctcctgt gtatgt
2623720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 237aaatggtctc gggaaggtga 2023824DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
238tttgattcag gttcttgtac ccag 2423919DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
239ggaaggtgac cgagaaaga 1924022DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 240acttcagacc agagcttcca gc
2224122DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 241atgcacttaa tgacagctcc ca 2224221DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
242gagaaaccag ttaattcagc g 2124321DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 243tctgccccac aggtgtagtt c
2124419DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 244ggcatctctg agccagctg 1924519DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
245atctctgagc cagctgagt 1924621DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 246tggtgttgca tttagccctg g
2124720DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 247agccacaaca atcctgcaca 2024820DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
248ggcatggagc tgaacagtac 2024919DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 249gtgacaccaa ggagcagcg
1925019DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 250tgtcaatggc ctccagcac 1925116DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
251agcgcatcct gaacca 1625221DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 252gacgggactg ataacagcag c
2125321DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 253cacaagcatc cattcatcca a 2125420DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
254catccaagtc tcccaacact 2025524DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 255ggcagtcact tttgatgaaa
caga 2425626DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 256gagtattgaa ttccccgaga tgttag
2625724DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 257caatcagata ccaaaatatt caaa 2425820DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
258gctgcaccgt cacagtgtct 2025923DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 259tgatatcttt gtctgtggcc
ctc 2326022DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 260gtctgatttg tatgccatga ac 222614020DNAHomo
sapiens 261gccgagcacc gcgcaccgcg tcatgggggc cgcctcgggc cgccgggggc
cggggctgct 60gctgccgctg ccgctgctgt tgctgctgcc gccgcagccc gccctggcgt
tggaccccgg 120gctgcagccc ggcaactttt ctgctgacga ggccggggcg
cagctcttcg cgcagagcta 180caactccagc gccgaacagg tgctgttcca
gagcgtggcc gccagctggg cgcacgacac 240caacatcacc gcggagaatg
caaggcgcca ggaggaagca gccctgctca gccaggagtt 300tgcggaggcc
tggggccaga aggccaagga gctgtatgaa ccgatctggc agaacttcac
360ggacccgcag ctgcgcagga tcatcggagc tgtgcgaacc ctgggctctg
ccaacctgcc 420cctggctaag cggcagcagt acaacgccct gctaagcaac
atgagcagga tctactccac 480cgccaaggtc tgcctcccca acaagactgc
cacctgctgg tccctggacc cagatctcac 540caacatcctg gcttcctcgc
gaagctacgc catgctcctg tttgcctggg agggctggca 600caacgctgcg
ggcatcccgc tgaaaccgct gtacgaggat ttcactgccc tcagcaatga
660agcctacaag caggacggct tcacagacac gggggcctac tggcgctcct
ggtacaactc 720ccccaccttc gaggacgatc tggaacacct ctaccaacag
ctagagcccc tctacctgaa 780cctccatgcc ttcgtccgcc gcgcactgca
tcgccgatac ggagacagat acatcaacct 840caggggaccc atccctgctc
atctgctggg agacatgtgg gcccagagct gggaaaacat 900ctacgacatg
gtggtgcctt tcccagacaa gcccaacctc gatgtcacca gtactatgct
960gcagcagggc tggaacgcca cgcacatgtt ccgggtggca gaggagttct
tcacctccct 1020ggagctctcc cccatgcctc ccgagttctg ggaagggtcg
atgctggaga agccggccga 1080cgggcgggaa gtggtgtgcc acgcctcggc
ttgggacttc tacaacagga aagacttcag 1140gatcaagcag tgcacacggg
tcacgatgga ccagctctcc acagtgcacc atgagatggg 1200ccatatacag
tactacctgc agtacaagga tctgcccgtc tccctgcgtc ggggggccaa
1260ccccggcttc catgaggcca ttggggacgt gctggcgctc tcggtctcca
ctcctgaaca 1320tctgcacaaa atcggcctgc tggaccgtgt caccaatgac
acggaaagtg acatcaatta 1380cttgctaaaa atggcactgg aaaaaattgc
cttcctgccc tttggctact tggtggacca 1440gtggcgctgg ggggtcttta
gtgggcgtac ccccccttcc cgctacaact tcgactggtg 1500gtatcttcga
accaagtatc aggggatctg tcctcctgtt acccgaaacg aaacccactt
1560tgatgctgga gctaagtttc atgttccaaa tgtgacacca tacatcaggt
actttgtgag 1620ttttgtcctg cagttccagt tccatgaagc cctgtgcaag
gaggcaggct atgagggccc 1680actgcaccag tgtgacatct accggtccac
caaggcaggg gccaagctcc ggaaggtgct 1740gcaggctggc tcctccaggc
cctggcagga ggtgctgaag gacatggtcg gcttagatgc 1800cctggatgcc
cagccgctgc tcaagtactt ccagccagtc acccagtggc tgcaggagca
1860gaaccagcag aacggcgagg tcctgggctg gcccgagtac cagtggcacc
cgccgttgcc 1920tgacaactac ccggagggca tagacctggt gactgatgag
gctgaggcca gcaagtttgt 1980ggaggaatat gaccggacat cccaggtggt
gtggaacgag tatgccgagg ccaactggaa 2040ctacaacacc aacatcacca
cagagaccag caagattctg ctgcagaaga acatgcaaat 2100agccaaccac
accctgaagt acggcaccca ggccaggaag tttgatgtga accagttgca
2160gaacaccact atcaagcgga tcataaagaa ggttcaggac ctagaacggg
cagcgctgcc 2220tgcccaggag ctggaggagt acaacaagat cctgttggat
atggaaacca cctacagcgt 2280ggccactgtg tgccacccga atggcagctg
cctgcagctc gagccagatc tgacgaatgt 2340gatggccaca tcccggaaat
atgaagacct gttatgggca tgggagggct ggcgagacaa 2400ggcggggaga
gccatcctcc agttttaccc gaaatacgtg gaactcatca accaggctgc
2460ccggctcaat ggctatgtag atgcagggga ctcgtggagg tctatgtacg
agacaccatc 2520cctggagcaa gacctggagc ggctcttcca ggagctgcag
ccactctacc tcaacctgca 2580tgcctacgtg cgccgggccc tgcaccgtca
ctacggggcc cagcacatca acctggaggg 2640gcccattcct gctcacctgc
tggggaacat gtgggcgcag acctggtcca acatctatga 2700cttggtggtg
cccttccctt cagccccctc gatggacacc acagaggcta tgctaaagca
2760gggctggacg cccaggagga tgtttaagga ggctgatgat ttcttcacct
ccctggggct 2820gctgcccgtg cctcctgagt tctggaacaa gtcgatgctg
gagaagccaa ccgacgggcg 2880ggaggtggtc tgccacgcct cggcctggga
cttctacaac ggcaaggact tccggatcaa 2940gcagtgcacc accgtgaact
tggaggacct ggtggtggcc caccacgaaa tgggccacat 3000ccagtatttc
atgcagtaca aagacttacc tgtggccttg agggagggtg ccaaccccgg
3060cttccatgag gccattgggg acgtgctagc cctctcagtg tctacgccca
agcacctgca 3120cagtctcaac ctgctgagca gtgagggtgg cagcgacgag
catgacatca actttctgat 3180gaagatggcc cttgacaaga tcgcctttat
ccccttcagc tacctcgtcg atcagtggcg 3240ctggagggta tttgatggaa
gcatcaccaa ggagaactat aaccaggagt ggtggagcct 3300caggctgaag
taccagggcc tctgcccccc agtgcccagg actcaaggtg actttgaccc
3360aggggccaag ttccacattc cttctagcgt gccttacatc aggtactttg
tcagcttcat 3420catccagttc cagttccacg aggcactgtg ccaggcagct
ggccacacgg gccccctgca 3480caagtgtgac atctaccagt ccaaggaggc
cgggcagcgc ctggcgaccg ccatgaagct 3540gggcttcagt aggccgtggc
cggaagccat gcagctgatc acgggccagc ccaacatgag 3600cgcctcggcc
atgttgagct acttcaagcc gctgctggac tggctccgca cggagaacga
3660gctgcatggg gagaagctgg gctggccgca gtacaactgg acgccgaact
ccgctcgctc 3720agaagggccc ctcccagaca gcggccgcgt cagcttcctg
ggcctggacc tggatgcgca 3780gcaggcccgc gtgggccagt ggctgctgct
cttcctgggc atcgccctgc tggtagccac 3840cctgggcctc agccagcggc
tcttcagcat ccgccaccgc agcctccacc ggcactccca 3900cgggccccag
ttcggctccg aggtggagct gagacactcc tgaggtgacc cggctgggtc
3960ggccctgccc aagggcctcc caccagagac tgggatggga acactggtgg
gcagctgagg 40202621593DNAHomo sapiens 262gcggtgccct tgcggcgcag
ctggggtcgc ggccctgctc cccgcgcttt cttaaggccc 60gcgggcggcg caggagcggc
actcgtggct gtggtggctt cggcagcggc ttcagcagat 120cggcggcatc
agcggtagca ccagcactag cagcatgttg agccgggcag tgtgcggcac
180cagcaggcag ctggctccgg ttttggggta tctgggctcc aggcagaagc
acagcctccc 240cgacctgccc tacgactacg gcgccctgga acctcacatc
aacgcgcaga tcatgcagct 300gcaccacagc aagcaccacg cggcctacgt
gaacaacctg aacgtcaccg aggagaagta 360ccaggaggcg ttggccaagg
gagatgttac agcccagata gctcttcagc ctgcactgaa 420gttcaatggt
ggtggtcata tcaatcatag cattttctgg acaaacctca gccctaacgg
480tggtggagaa cccaaagggg agttgctgga agccatcaaa cgtgactttg
gttcctttga 540caagtttaag gagaagctga cggctgcatc tgttggtgtc
caaggctcag gttggggttg 600gcttggtttc aataaggaac ggggacactt
acaaattgct gcttgtccaa atcaggatcc 660actgcaagga acaacaggcc
ttattccact gctggggatt gatgtgtggg agcacgctta 720ctaccttcag
tataaaaatg tcaggcctga ttatctaaaa gctatttgga atgtaatcaa
780ctgggagaat gtaactgaaa gatacatggc ttgcaaaaag taaaccacga
tcgttatgct 840gagtatgtta agctctttat gactgttttt gtagtggtat
agagtactgc agaatacagt 900aagctgctct attgtagcat ttcttgatgt
tgcttagtca cttatttcat aaacaactta 960atgttctgaa taatttctta
ctaaacattt tgttattggg caagtgattg aaaatagtaa 1020atgctttgtg
tgattgaatc tgattggaca ttttcttcag agagctaaat tacaattgtc
1080atttataaaa ccatcaaaaa tattccatcc atatactttg gggacttgta
gggatgcctt 1140tctagtccta ttctattgca gttatagaaa atctagtctt
ttgccccagt tacttaaaaa 1200taaaatatta acactttccc aagggaaaca
ctcggctttc tatagaaaat tgcacttttt 1260gtcgagtaat cctctgcagt
gatacttctg gtagatgtca cccagtggtt tttgttaggt 1320caaatgttcc
tgtatagttt ttgcaaatag agctgtatac tgtttaaatg tagcaggtga
1380actgaactgg ggtttgctca cctgcacagt aaaggcaaac ttcaacagca
aaactgcaaa 1440aaggtggttt ttgcagtagg agaaaggagg atgtttattt
gcagggcgcc aagcaaggag 1500aattgggcag ctcatgcttg agacccaatc
tccatgatga cctacaagct agagtattta 1560aaggcagtgg taaatttcag
gaaagcagaa gtt 15932633925DNAHomo sapiens 263cggagcggga ggggaggctt
cgcggaacgc tctcggcgcc aggactcgcg tgcaaagccc 60aggcccgggc ggccagacca
agagggaaga agcacagaat tcctcaactc ccagtgtgcc 120catgagtaag
agcaaatgct ccgtgggact catgtcttcc gtggtggccc cggctaagga
180gcccaatgcc gtgggcccga aggaggtgga gctcatcctt gtcaaggagc
agaacggagt 240gcagctcacc agctccaccc tcaccaaccc gcggcagagc
cccgtggagg cccaggatcg 300ggagacctgg ggcaagaaga tcgactttct
cctgtccgtc attggctttg ctgtggacct 360ggccaacgtc tggcggttcc
cctacctgtg ctacaaaaat ggtggcggtg ccttcctggt 420cccctacctg
ctcttcatgg tcattgctgg gatgccactt ttctacatgg agctggccct
480cggccagttc aacagggaag gggccgctgg tgtctggaag atctgcccca
tactgaaagg 540tgtgggcttc acggtcatcc tcatctcact gtatgtcggc
ttcttctaca acgtcatcat 600cgcctgggcg ctgcactatc tcttctcctc
cttcaccacg gagctcccct ggatccactg 660caacaactcc tggaacagcc
ccaactgctc ggatgcccat cctggtgact ccagtggaga 720cagctcgggc
ctcaacgaca cttttgggac cacacctgct gccgagtact ttgaacgtgg
780cgtgctgcac ctccaccaga gccatggcat cgacgacctg gggcctccgc
ggtggcagct 840cacagcctgc ctggtgctgg tcatcgtgct gctctacttc
agcctctgga agggcgtgaa 900gacctcaggg aaggtggtat ggatcacagc
caccatgcca tacgtggtcc tcactgccct 960gctcctgcgt ggggtcaccc
tccctggagc catagacggc atcagagcat acctgagcgt 1020tgacttctac
cggctctgcg aggcgtctgt ttggattgac gcggccaccc aggtgtgctt
1080ctccctgggc gtggggttcg gggtgctgat cgccttctcc agctacaaca
agttcaccaa 1140caactgctac agggacgcga ttgtcaccac ctccatcaac
tccctgacga gcttctcctc 1200cggcttcgtc gtcttctcct tcctggggta
catggcacag aagcacagtg tgcccatcgg 1260ggacgtggcc aaggacgggc
cagggctgat cttcatcatc tacccggaag ccatcgccac 1320gctccctctg
tcctcagcct gggccgtggt cttcttcatc atgctgctca ccctgggtat
1380cgacagcgcc atgggtggta tggagtcagt gatcaccggg ctcatcgatg
agttccagct 1440gctgcacaga caccgtgagc tcttcacgct cttcatcgtc
ctggcgacct tcctcctgtc 1500cctgttctgc gtcaccaacg gtggcatcta
cgtcttcacg ctcctggacc attttgcagc 1560cggcacgtcc atcctctttg
gagtgctcat cgaagccatc ggagtggcct ggttctatgg 1620tgttgggcag
ttcagcgacg acatccagca gatgaccggg cagcggccca gcctgtactg
1680gcggctgtgc tggaagctgg tcagcccctg ctttctcctg ttcgtggtcg
tggtcagcat 1740tgtgaccttc agaccccccc actacggagc ctacatcttc
cccgactggg ccaacgcgct 1800gggctgggtc atcgccacat cctccatggc
catggtgccc atctatgcgg cctacaagtt 1860ctgcagcctg cctgggtcct
ttcgagagaa actggcctac gccattgcac ccgagaagga 1920ccgtgagctg
gtggacagag gggaggtgcg ccagttcacg ctccgccact ggctcaaggt
1980gtagagggag cagagacgaa gaccccagga agtcatcctg caatgggaga
gacacgaaca 2040aaccaaggaa atctaagttt cgagagaaag gagggcaact
tctactcttc aacctctact 2100gaaaacacaa acaacaaagc agaagactcc
tctcttctga ctgtttacac ctttccgtgc 2160cgggagcgca cctcgccgtg
tcttgtgttg ctgtaataac gacgtagatc tgtgcagcga 2220ggtccacccc
gttgttgtcc ctgcagggca gaaaaacgtc taacttcatg ctgtctgtgt
2280gaggctccct ccctccctgc tccctgctcc cggctctgag gctgccccag
gggcactgtg 2340ttctcaggcg gggatcacga tccttgtaga cgcacctgct
gagaatcccc gtgctcacag 2400tagcttccta gaccatttac tttgcccata
ttaaaaagcc aagtgtcctg cttggtttag 2460ctgtgcagaa ggtgaaatgg
aggaaaccac aaattcatgc aaagtccttt cccgatgcgt 2520ggctcccagc
agaggccgta aattgagcgt tcagttgaca cattgcacac acagtctgtt
2580cagaggcatt ggaggatggg ggtcctggta tgtctcacca ggaaattctg
tttatgttct 2640tgcagcagag agaaataaaa ctccttgaaa ccagctcagg
ctactgccac tcaggcagcc 2700tgtgggtcct tgcggtgtag ggaacggcct
gagaggagcg tgtcctatcc ccggacgcat 2760gcagggcccc cacaggagcg
tgtcctatcc ccggacgcat gcagggcccc cacaggagca 2820tgtcctatcc
ctggacgcat gcagggcccc cacaggagcg tgtactaccc cagaacgcat
2880gcagggcccc cacaggagcg tgtactaccc caggacgcat gcagggcccc
cactggagcg 2940tgtactaccc caggacgcat gcagggcccc cacaggagcg
tgtcctatcc ccggaccgga 3000cgcatgcagg gcccccacag gagcgtgtac
taccccagga cgcatgcagg gcccccacag 3060gagcgtgtac taccccagga
tgcatgcagg gcccccacag gagcgtgtac taccccagga 3120cgcatgcagg
gcccccatgc aggcagcctg cagaccacac tctgcctggc cttgagccgt
3180gacctccagg aagggacccc actggaattt tatttctctc aggtgcgtgc
cacatcaata 3240acaacagttt ttatgtttgc gaatggcttt ttaaaatcat
atttacctgt gaatcaaaac 3300aaattcaaga atgcagtatc cgcgagcctg
cttgctgata ttgcagtttt tgtttacaag 3360aataattagc aatactgagt
gaaggatgtt ggccaaaagc tgctttccat ggcacactgc 3420cctctgccac
tgacaggaaa gtggatgcca tagtttgaat tcatgcctca agtcggtggg
3480cctgcctacg tgctgcccga gggcaggggc cgtgcagggc cagtcatggc
tgtcccctgc 3540aagtggacgt gggctccagg gactggagtg taatgctcgg
tgggagccgt cagcctgtga 3600actgccaggc agctgcagtt agcacagagg
atggcttccc cattgccttc tggggaggga 3660cacagaggac ggcttcccca
tcgccttctg gccgctgcag tcagcacaga gagcggcttc 3720cccattgcct
tctggggagg gacacagagg acagcttccc catcgccttc tggctgctgc
3780agtcagcaca gagagcggct tccccatcgc cttctgggga ggggctccgt
gtagcaaccc 3840aggtgttgtc cgtgtctgtt gaccaatctc tattcagcat
cgtgtgggtc cctaagcaca 3900ataaaagaca tccacaatgg aaaaa
39252641835DNAHomo sapiens 264atggattctc ttgtggtcct tgtgctctgt
ctctcatgtt tgcttctcct ttcactctgg 60agacagagct ctgggagagg aaaactccct
cctggcccca ctcctctccc agtgattgga 120aatatcctac agataggtat
taaggacatc agcaaatcct taaccaatct ctcaaaggtc 180tatggcccgg
tgttcactct gtattttggc ctgaaaccca tagtggtgct gcatggatat
240gaagcagtga aggaagccct gattgatctt ggagaggagt tttctggaag
aggcattttc 300ccactggctg aaagagctaa cagaggattt ggaattgttt
tcagcaatgg aaagaaatgg 360aaggagatcc ggcgtttctc cctcatgacg
ctgcggaatt ttgggatggg gaagaggagc 420attgaggacc gtgttcaaga
ggaagcccgc tgccttgtgg aggagttgag aaaaaccaag 480gcctcaccct
gtgatcccac tttcatcctg ggctgtgctc cctgcaatgt gatctgctcc
540attattttcc ataaacgttt tgattataaa gatcagcaat ttcttaactt
aatggaaaag 600ttgaatgaaa acatcaagat tttgagcagc ccctggatcc
agatctgcaa taatttttct 660cctatcattg attacttccc gggaactcac
aacaaattac ttaaaaacgt tgcttttatg 720aaaagttata ttttggaaaa
agtaaaagaa caccaagaat caatggacat gaacaaccct 780caggacttta
ttgattgctt cctgatgaaa atggagaagg aaaagcacaa ccaaccatct
840gaatttacta ttgaaagctt ggaaaacact gcagttgact tgtttggagc
tgggacagag
900acgacaagca caaccctgag atatgctctc cttctcctgc tgaagcaccc
agaggtcaca 960gctaaagtcc aggaagagat tgaacgtgtg attggcagaa
accggagccc ctgcatgcaa 1020gacaggagcc acatgcccta cacagatgct
gtggtgcacg aggtccagag atacattgac 1080cttctcccca ccagcctgcc
ccatgcagtg acctgtgaca ttaaattcag aaactatctc 1140attcccaagg
gcacaaccat attaatttcc ctgacttctg tgctacatga caacaaagaa
1200tttcccaacc cagagatgtt tgaccctcat cactttctgg atgaaggtgg
caattttaag 1260aaaagtaaat acttcatgcc tttctcagca ggaaaacgga
tttgtgtggg agaagccctg 1320gccggcatgg agctgttttt attcctgacc
tccattttac agaactttaa cctgaaatct 1380ctggttgacc caaagaacct
tgacaccact ccagttgtca atggatttgc ctctgtgccg 1440cccttctacc
agctgtgctt cattcctgtc tgaagaagag cagatggcct ggctgctgct
1500gtgcagtccc tgcagctctc tttcctctgg ggcattatcc atctttgcac
tatctgtaat 1560gccttttctc acctgtcatc tcacattttc ccttccctga
agatctagtg aacattcgac 1620ctccattacg gagagtttcc tatgtttcac
tgtgcaaata tatctgctat tctccatact 1680ctgtaacagt tgcattgact
gtcacataat gctcatactt atctaatgta gagtattaat 1740atgttattat
taaatagaga aatatgattt gtgtattata attcaaaggc atttcttttc
1800tgcatgatct aaataaaaag cattattatt tgctg 183526525DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
265ttgccccagc accatttgtt aaaaa 2526626DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
266ttgtatgtta ctggagggca gggatg 2626724DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
267cctagcacag ggcaaaacct catc 2426828DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
268aggtcaccag ttaccacagg agagaaaa 2826933DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
269acaatggaat agaattgaga gtccagaaat gaa 3327030DNAPan sp.
270ttgagcatat ttttaagggc tgtttttctc 3027130DNAMacaca sp.
271ttgagcatat ttttaagggc tgtttttctc 3027229DNAGalago sp.
272ttggcatatt cttgagggct gtttttctt 2927330DNAUnknown
OrganismDescription of Unknown Organism Shrew oligonucleotide
273ttgggcatat atttaaaggc tgatttcctc 3027430DNACanis sp.
274tggggcatat tttcaaggtt ttttttcctc 3027530DNAUnknown
OrganismDescription of Unknown Organism Elephant oligonucleotide
275ctggtcatat atttaagggc tatttctctc 3027630DNAUnknown
OrganismDescription of Unknown Organism Squirrel oligonucleotide
276ttggccatat ttttaaggac tgtttttctc 3027730DNAUnknown
OrganismDescription of Unknown Organism Armadillo oligonucleotide
277ttgggtattt tttttaactg aattactttc 3027812DNAHomo sapiens
278ccttcgatga gg 1227912DNAPan sp. 279ccttcgatga gg
1228012DNAMacaca sp. 280ccttggatga gg 1228112DNAGalago sp.
281ctttgaatga ag 1228212DNAUnknown OrganismDescription of Unknown
Organism Shrew oligonucleotide 282ccttaaatga gg 1228312DNACanis sp.
283ccttaaatga gg 1228412DNAUnknown OrganismDescription of Unknown
Organism Elephant oligonucleotide 284catgaatcag gg
1228512DNAUnknown OrganismDescription of Unknown Organism Squirrel
oligonucleotide 285ccttgaatga gg 1228611DNAUnknown
OrganismDescription of Unknown Organism Armadillo oligonucleotide
286tcgtgaagat g 112871306PRTHomo sapiens 287Met Gly Ala Ala Ser Gly
Arg Arg Gly Pro Gly Leu Leu Leu Pro Leu1 5 10 15Pro Leu Leu Leu Leu
Leu Pro Pro Gln Pro Ala Leu Ala Leu Asp Pro 20 25 30Gly Leu Gln Pro
Gly Asn Phe Ser Ala Asp Glu Ala Gly Ala Gln Leu 35 40 45Phe Ala Gln
Ser Tyr Asn Ser Ser Ala Glu Gln Val Leu Phe Gln Ser 50 55 60Val Ala
Ala Ser Trp Ala His Asp Thr Asn Ile Thr Ala Glu Asn Ala65 70 75
80Arg Arg Gln Glu Glu Ala Ala Leu Leu Ser Gln Glu Phe Ala Glu Ala
85 90 95Trp Gly Gln Lys Ala Lys Glu Leu Tyr Glu Pro Ile Trp Gln Asn
Phe 100 105 110Thr Asp Pro Gln Leu Arg Arg Ile Ile Gly Ala Val Arg
Thr Leu Gly 115 120 125Ser Ala Asn Leu Pro Leu Ala Lys Arg Gln Gln
Tyr Asn Ala Leu Leu 130 135 140Ser Asn Met Ser Arg Ile Tyr Ser Thr
Ala Lys Val Cys Leu Pro Asn145 150 155 160Lys Thr Ala Thr Cys Trp
Ser Leu Asp Pro Asp Leu Thr Asn Ile Leu 165 170 175Ala Ser Ser Arg
Ser Tyr Ala Met Leu Leu Phe Ala Trp Glu Gly Trp 180 185 190His Asn
Ala Ala Gly Ile Pro Leu Lys Pro Leu Tyr Glu Asp Phe Thr 195 200
205Ala Leu Ser Asn Glu Ala Tyr Lys Gln Asp Gly Phe Thr Asp Thr Gly
210 215 220Ala Tyr Trp Arg Ser Trp Tyr Asn Ser Pro Thr Phe Glu Asp
Asp Leu225 230 235 240Glu His Leu Tyr Gln Gln Leu Glu Pro Leu Tyr
Leu Asn Leu His Ala 245 250 255Phe Val Arg Arg Ala Leu His Arg Arg
Tyr Gly Asp Arg Tyr Ile Asn 260 265 270Leu Arg Gly Pro Ile Pro Ala
His Leu Leu Gly Asp Met Trp Ala Gln 275 280 285Ser Trp Glu Asn Ile
Tyr Asp Met Val Val Pro Phe Pro Asp Lys Pro 290 295 300Asn Leu Asp
Val Thr Ser Thr Met Leu Gln Gln Gly Trp Asn Ala Thr305 310 315
320His Met Phe Arg Val Ala Glu Glu Phe Phe Thr Ser Leu Glu Leu Ser
325 330 335Pro Met Pro Pro Glu Phe Trp Glu Gly Ser Met Leu Glu Lys
Pro Ala 340 345 350Asp Gly Arg Glu Val Val Cys His Ala Ser Ala Trp
Asp Phe Tyr Asn 355 360 365Arg Lys Asp Phe Arg Ile Lys Gln Cys Thr
Arg Val Thr Met Asp Gln 370 375 380Leu Ser Thr Val His His Glu Met
Gly His Ile Gln Tyr Tyr Leu Gln385 390 395 400Tyr Lys Asp Leu Pro
Val Ser Leu Arg Arg Gly Ala Asn Pro Gly Phe 405 410 415His Glu Ala
Ile Gly Asp Val Leu Ala Leu Ser Val Ser Thr Pro Glu 420 425 430His
Leu His Lys Ile Gly Leu Leu Asp Arg Val Thr Asn Asp Thr Glu 435 440
445Ser Asp Ile Asn Tyr Leu Leu Lys Met Ala Leu Glu Lys Ile Ala Phe
450 455 460Leu Pro Phe Gly Tyr Leu Val Asp Gln Trp Arg Trp Gly Val
Phe Ser465 470 475 480Gly Arg Thr Pro Pro Ser Arg Tyr Asn Phe Asp
Trp Trp Tyr Leu Arg 485 490 495Thr Lys Tyr Gln Gly Ile Cys Pro Pro
Val Thr Arg Asn Glu Thr His 500 505 510Phe Asp Ala Gly Ala Lys Phe
His Val Pro Asn Val Thr Pro Tyr Ile 515 520 525Arg Tyr Phe Val Ser
Phe Val Leu Gln Phe Gln Phe His Glu Ala Leu 530 535 540Cys Lys Glu
Ala Gly Tyr Glu Gly Pro Leu His Gln Cys Asp Ile Tyr545 550 555
560Arg Ser Thr Lys Ala Gly Ala Lys Leu Arg Lys Val Leu Gln Ala Gly
565 570 575Ser Ser Arg Pro Trp Gln Glu Val Leu Lys Asp Met Val Gly
Leu Asp 580 585 590Ala Leu Asp Ala Gln Pro Leu Leu Lys Tyr Phe Gln
Pro Val Thr Gln 595 600 605Trp Leu Gln Glu Gln Asn Gln Gln Asn Gly
Glu Val Leu Gly Trp Pro 610 615 620Glu Tyr Gln Trp His Pro Pro Leu
Pro Asp Asn Tyr Pro Glu Gly Ile625 630 635 640Asp Leu Val Thr Asp
Glu Ala Glu Ala Ser Lys Phe Val Glu Glu Tyr 645 650 655Asp Arg Thr
Ser Gln Val Val Trp Asn Glu Tyr Ala Glu Ala Asn Trp 660 665 670Asn
Tyr Asn Thr Asn Ile Thr Thr Glu Thr Ser Lys Ile Leu Leu Gln 675 680
685Lys Asn Met Gln Ile Ala Asn His Thr Leu Lys Tyr Gly Thr Gln Ala
690 695 700Arg Lys Phe Asp Val Asn Gln Leu Gln Asn Thr Thr Ile Lys
Arg Ile705 710 715 720Ile Lys Lys Val Gln Asp Leu Glu Arg Ala Ala
Leu Pro Ala Gln Glu 725 730 735Leu Glu Glu Tyr Asn Lys Ile Leu Leu
Asp Met Glu Thr Thr Tyr Ser 740 745 750Val Ala Thr Val Cys His Pro
Asn Gly Ser Cys Leu Gln Leu Glu Pro 755 760 765Asp Leu Thr Asn Val
Met Ala Thr Ser Arg Lys Tyr Glu Asp Leu Leu 770 775 780Trp Ala Trp
Glu Gly Trp Arg Asp Lys Ala Gly Arg Ala Ile Leu Gln785 790 795
800Phe Tyr Pro Lys Tyr Val Glu Leu Ile Asn Gln Ala Ala Arg Leu Asn
805 810 815Gly Tyr Val Asp Ala Gly Asp Ser Trp Arg Ser Met Tyr Glu
Thr Pro 820 825 830Ser Leu Glu Gln Asp Leu Glu Arg Leu Phe Gln Glu
Leu Gln Pro Leu 835 840 845Tyr Leu Asn Leu His Ala Tyr Val Arg Arg
Ala Leu His Arg His Tyr 850 855 860Gly Ala Gln His Ile Asn Leu Glu
Gly Pro Ile Pro Ala His Leu Leu865 870 875 880Gly Asn Met Trp Ala
Gln Thr Trp Ser Asn Ile Tyr Asp Leu Val Val 885 890 895Pro Phe Pro
Ser Ala Pro Ser Met Asp Thr Thr Glu Ala Met Leu Lys 900 905 910Gln
Gly Trp Thr Pro Arg Arg Met Phe Lys Glu Ala Asp Asp Phe Phe 915 920
925Thr Ser Leu Gly Leu Leu Pro Val Pro Pro Glu Phe Trp Asn Lys Ser
930 935 940Met Leu Glu Lys Pro Thr Asp Gly Arg Glu Val Val Cys His
Ala Ser945 950 955 960Ala Trp Asp Phe Tyr Asn Gly Lys Asp Phe Arg
Ile Lys Gln Cys Thr 965 970 975Thr Val Asn Leu Glu Asp Leu Val Val
Ala His His Glu Met Gly His 980 985 990Ile Gln Tyr Phe Met Gln Tyr
Lys Asp Leu Pro Val Ala Leu Arg Glu 995 1000 1005Gly Ala Asn Pro
Gly Phe His Glu Ala Ile Gly Asp Val Leu Ala 1010 1015 1020Leu Ser
Val Ser Thr Pro Lys His Leu His Ser Leu Asn Leu Leu 1025 1030
1035Ser Ser Glu Gly Gly Ser Asp Glu His Asp Ile Asn Phe Leu Met
1040 1045 1050Lys Met Ala Leu Asp Lys Ile Ala Phe Ile Pro Phe Ser
Tyr Leu 1055 1060 1065 Val Asp Gln Trp Arg Trp Arg Val Phe Asp Gly
Ser Ile Thr Lys 1070 1075 1080Glu Asn Tyr Asn Gln Glu Trp Trp Ser
Leu Arg Leu Lys Tyr Gln 1085 1090 1095Gly Leu Cys Pro Pro Val Pro
Arg Thr Gln Gly Asp Phe Asp Pro 1100 1105 1110Gly Ala Lys Phe His
Ile Pro Ser Ser Val Pro Tyr Ile Arg Tyr 1115 1120 1125Phe Val Ser
Phe Ile Ile Gln Phe Gln Phe His Glu Ala Leu Cys 1130 1135 1140Gln
Ala Ala Gly His Thr Gly Pro Leu His Lys Cys Asp Ile Tyr 1145 1150
1155Gln Ser Lys Glu Ala Gly Gln Arg Leu Ala Thr Ala Met Lys Leu
1160 1165 1170Gly Phe Ser Arg Pro Trp Pro Glu Ala Met Gln Leu Ile
Thr Gly 1175 1180 1185Gln Pro Asn Met Ser Ala Ser Ala Met Leu Ser
Tyr Phe Lys Pro 1190 1195 1200Leu Leu Asp Trp Leu Arg Thr Glu Asn
Glu Leu His Gly Glu Lys 1205 1210 1215Leu Gly Trp Pro Gln Tyr Asn
Trp Thr Pro Asn Ser Ala Arg Ser 1220 1225 1230Glu Gly Pro Leu Pro
Asp Ser Gly Arg Val Ser Phe Leu Gly Leu 1235 1240 1245Asp Leu Asp
Ala Gln Gln Ala Arg Val Gly Gln Trp Leu Leu Leu 1250 1255 1260Phe
Leu Gly Ile Ala Leu Leu Val Ala Thr Leu Gly Leu Ser Gln 1265 1270
1275Arg Leu Phe Ser Ile Arg His Arg Ser Leu His Arg His Ser His
1280 1285 1290Gly Pro Gln Phe Gly Ser Glu Val Glu Leu Arg His Ser
1295 1300 1305288222PRTHomo sapiens 288Met Leu Ser Arg Ala Val Cys
Gly Thr Ser Arg Gln Leu Ala Pro Val1 5 10 15Leu Gly Tyr Leu Gly Ser
Arg Gln Lys His Ser Leu Pro Asp Leu Pro 20 25 30Tyr Asp Tyr Gly Ala
Leu Glu Pro His Ile Asn Ala Gln Ile Met Gln 35 40 45Leu His His Ser
Lys His His Ala Ala Tyr Val Asn Asn Leu Asn Val 50 55 60Thr Glu Glu
Lys Tyr Gln Glu Ala Leu Ala Lys Gly Asp Val Thr Ala65 70 75 80Gln
Ile Ala Leu Gln Pro Ala Leu Lys Phe Asn Gly Gly Gly His Ile 85 90
95Asn His Ser Ile Phe Trp Thr Asn Leu Ser Pro Asn Gly Gly Gly Glu
100 105 110Pro Lys Gly Glu Leu Leu Glu Ala Ile Lys Arg Asp Phe Gly
Ser Phe 115 120 125Asp Lys Phe Lys Glu Lys Leu Thr Ala Ala Ser Val
Gly Val Gln Gly 130 135 140Ser Gly Trp Gly Trp Leu Gly Phe Asn Lys
Glu Arg Gly His Leu Gln145 150 155 160Ile Ala Ala Cys Pro Asn Gln
Asp Pro Leu Gln Gly Thr Thr Gly Leu 165 170 175Ile Pro Leu Leu Gly
Ile Asp Val Trp Glu His Ala Tyr Tyr Leu Gln 180 185 190Tyr Lys Asn
Val Arg Pro Asp Tyr Leu Lys Ala Ile Trp Asn Val Ile 195 200 205Asn
Trp Glu Asn Val Thr Glu Arg Tyr Met Ala Cys Lys Lys 210 215
220289620PRTHomo sapiens 289Met Ser Lys Ser Lys Cys Ser Val Gly Leu
Met Ser Ser Val Val Ala1 5 10 15Pro Ala Lys Glu Pro Asn Ala Val Gly
Pro Lys Glu Val Glu Leu Ile 20 25 30Leu Val Lys Glu Gln Asn Gly Val
Gln Leu Thr Ser Ser Thr Leu Thr 35 40 45Asn Pro Arg Gln Ser Pro Val
Glu Ala Gln Asp Arg Glu Thr Trp Gly 50 55 60Lys Lys Ile Asp Phe Leu
Leu Ser Val Ile Gly Phe Ala Val Asp Leu65 70 75 80Ala Asn Val Trp
Arg Phe Pro Tyr Leu Cys Tyr Lys Asn Gly Gly Gly 85 90 95Ala Phe Leu
Val Pro Tyr Leu Leu Phe Met Val Ile Ala Gly Met Pro 100 105 110Leu
Phe Tyr Met Glu Leu Ala Leu Gly Gln Phe Asn Arg Glu Gly Ala 115 120
125Ala Gly Val Trp Lys Ile Cys Pro Ile Leu Lys Gly Val Gly Phe Thr
130 135 140Val Ile Leu Ile Ser Leu Tyr Val Gly Phe Phe Tyr Asn Val
Ile Ile145 150 155 160Ala Trp Ala Leu His Tyr Leu Phe Ser Ser Phe
Thr Thr Glu Leu Pro 165 170 175Trp Ile His Cys Asn Asn Ser Trp Asn
Ser Pro Asn Cys Ser Asp Ala 180 185 190His Pro Gly Asp Ser Ser Gly
Asp Ser Ser Gly Leu Asn Asp Thr Phe 195 200 205Gly Thr Thr Pro Ala
Ala Glu Tyr Phe Glu Arg Gly Val Leu His Leu 210 215 220His Gln Ser
His Gly Ile Asp Asp Leu Gly Pro Pro Arg Trp Gln Leu225 230 235
240Thr Ala Cys Leu Val Leu Val Ile Val Leu Leu Tyr Phe Ser Leu Trp
245 250 255Lys Gly Val Lys Thr Ser Gly Lys Val Val Trp Ile Thr Ala
Thr Met 260 265 270Pro Tyr Val Val Leu Thr Ala Leu Leu Leu Arg Gly
Val Thr Leu Pro 275 280 285Gly Ala Ile Asp Gly Ile Arg Ala Tyr Leu
Ser Val Asp Phe Tyr Arg 290 295 300Leu Cys Glu Ala Ser Val Trp Ile
Asp Ala Ala Thr Gln Val Cys Phe305 310 315 320Ser Leu Gly Val Gly
Phe Gly Val Leu Ile Ala Phe Ser Ser Tyr Asn 325 330 335Lys Phe Thr
Asn Asn Cys Tyr Arg Asp Ala Ile Val Thr Thr Ser Ile 340 345 350Asn
Ser Leu Thr Ser Phe Ser Ser Gly Phe Val Val Phe Ser Phe Leu 355
360
365Gly Tyr Met Ala Gln Lys His Ser Val Pro Ile Gly Asp Val Ala Lys
370 375 380Asp Gly Pro Gly Leu Ile Phe Ile Ile Tyr Pro Glu Ala Ile
Ala Thr385 390 395 400Leu Pro Leu Ser Ser Ala Trp Ala Val Val Phe
Phe Ile Met Leu Leu 405 410 415Thr Leu Gly Ile Asp Ser Ala Met Gly
Gly Met Glu Ser Val Ile Thr 420 425 430Gly Leu Ile Asp Glu Phe Gln
Leu Leu His Arg His Arg Glu Leu Phe 435 440 445Thr Leu Phe Ile Val
Leu Ala Thr Phe Leu Leu Ser Leu Phe Cys Val 450 455 460Thr Asn Gly
Gly Ile Tyr Val Phe Thr Leu Leu Asp His Phe Ala Ala465 470 475
480Gly Thr Ser Ile Leu Phe Gly Val Leu Ile Glu Ala Ile Gly Val Ala
485 490 495Trp Phe Tyr Gly Val Gly Gln Phe Ser Asp Asp Ile Gln Gln
Met Thr 500 505 510Gly Gln Arg Pro Ser Leu Tyr Trp Arg Leu Cys Trp
Lys Leu Val Ser 515 520 525Pro Cys Phe Leu Leu Phe Val Val Val Val
Ser Ile Val Thr Phe Arg 530 535 540Pro Pro His Tyr Gly Ala Tyr Ile
Phe Pro Asp Trp Ala Asn Ala Leu545 550 555 560Gly Trp Val Ile Ala
Thr Ser Ser Met Ala Met Val Pro Ile Tyr Ala 565 570 575Ala Tyr Lys
Phe Cys Ser Leu Pro Gly Ser Phe Arg Glu Lys Leu Ala 580 585 590Tyr
Ala Ile Ala Pro Glu Lys Asp Arg Glu Leu Val Asp Arg Gly Glu 595 600
605Val Arg Gln Phe Thr Leu Arg His Trp Leu Lys Val 610 615
620290490PRTHomo sapiens 290Met Asp Ser Leu Val Val Leu Val Leu Cys
Leu Ser Cys Leu Leu Leu1 5 10 15Leu Ser Leu Trp Arg Gln Ser Ser Gly
Arg Gly Lys Leu Pro Pro Gly 20 25 30Pro Thr Pro Leu Pro Val Ile Gly
Asn Ile Leu Gln Ile Gly Ile Lys 35 40 45Asp Ile Ser Lys Ser Leu Thr
Asn Leu Ser Lys Val Tyr Gly Pro Val 50 55 60Phe Thr Leu Tyr Phe Gly
Leu Lys Pro Ile Val Val Leu His Gly Tyr65 70 75 80Glu Ala Val Lys
Glu Ala Leu Ile Asp Leu Gly Glu Glu Phe Ser Gly 85 90 95Arg Gly Ile
Phe Pro Leu Ala Glu Arg Ala Asn Arg Gly Phe Gly Ile 100 105 110Val
Phe Ser Asn Gly Lys Lys Trp Lys Glu Ile Arg Arg Phe Ser Leu 115 120
125Met Thr Leu Arg Asn Phe Gly Met Gly Lys Arg Ser Ile Glu Asp Arg
130 135 140Val Gln Glu Glu Ala Arg Cys Leu Val Glu Glu Leu Arg Lys
Thr Lys145 150 155 160Ala Ser Pro Cys Asp Pro Thr Phe Ile Leu Gly
Cys Ala Pro Cys Asn 165 170 175Val Ile Cys Ser Ile Ile Phe His Lys
Arg Phe Asp Tyr Lys Asp Gln 180 185 190Gln Phe Leu Asn Leu Met Glu
Lys Leu Asn Glu Asn Ile Lys Ile Leu 195 200 205Ser Ser Pro Trp Ile
Gln Ile Cys Asn Asn Phe Ser Pro Ile Ile Asp 210 215 220Tyr Phe Pro
Gly Thr His Asn Lys Leu Leu Lys Asn Val Ala Phe Met225 230 235
240Lys Ser Tyr Ile Leu Glu Lys Val Lys Glu His Gln Glu Ser Met Asp
245 250 255Met Asn Asn Pro Gln Asp Phe Ile Asp Cys Phe Leu Met Lys
Met Glu 260 265 270Lys Glu Lys His Asn Gln Pro Ser Glu Phe Thr Ile
Glu Ser Leu Glu 275 280 285Asn Thr Ala Val Asp Leu Phe Gly Ala Gly
Thr Glu Thr Thr Ser Thr 290 295 300Thr Leu Arg Tyr Ala Leu Leu Leu
Leu Leu Lys His Pro Glu Val Thr305 310 315 320Ala Lys Val Gln Glu
Glu Ile Glu Arg Val Ile Gly Arg Asn Arg Ser 325 330 335Pro Cys Met
Gln Asp Arg Ser His Met Pro Tyr Thr Asp Ala Val Val 340 345 350His
Glu Val Gln Arg Tyr Ile Asp Leu Leu Pro Thr Ser Leu Pro His 355 360
365Ala Val Thr Cys Asp Ile Lys Phe Arg Asn Tyr Leu Ile Pro Lys Gly
370 375 380Thr Thr Ile Leu Ile Ser Leu Thr Ser Val Leu His Asp Asn
Lys Glu385 390 395 400Phe Pro Asn Pro Glu Met Phe Asp Pro His His
Phe Leu Asp Glu Gly 405 410 415Gly Asn Phe Lys Lys Ser Lys Tyr Phe
Met Pro Phe Ser Ala Gly Lys 420 425 430Arg Ile Cys Val Gly Glu Ala
Leu Ala Gly Met Glu Leu Phe Leu Phe 435 440 445Leu Thr Ser Ile Leu
Gln Asn Phe Asn Leu Lys Ser Leu Val Asp Pro 450 455 460Lys Asn Leu
Asp Thr Thr Pro Val Val Asn Gly Phe Ala Ser Val Pro465 470 475
480Pro Phe Tyr Gln Leu Cys Phe Ile Pro Val 485 490
* * * * *