U.S. patent application number 12/145324 was filed with the patent office on 2010-06-10 for in vivo production and delivery of erythropoietin or insulinotropin for gene therapy.
This patent application is currently assigned to Shire Human Genetic Therapies, Inc.. Invention is credited to Michael W. Heartlein, Richard F. Selden, Douglas Treco.
Application Number | 20100143314 12/145324 |
Document ID | / |
Family ID | 27419842 |
Filed Date | 2010-06-10 |
United States Patent
Application |
20100143314 |
Kind Code |
A1 |
Selden; Richard F. ; et
al. |
June 10, 2010 |
In Vivo Production and Delivery of Erythropoietin or Insulinotropin
for Gene Therapy
Abstract
The present invention relates to transfected primary and
secondary somatic cells of vertebrate origin, particularly
mammalian origin, transfected with exogenous genetic material (DNA)
which encodes erythropoietin or an insulinotropin [e.g.,
derivatives of glucagon-like peptide 1 (GLP-1)], methods by which
primary and secondary cells are transfected to include exogenous
genetic material encoding erythropoietin or an insulinotropin,
methods of producing clonal cell strains or heterogenous cell
strains which express erythropoietin or an insulinotropin, methods
of gene therapy in which the transfected primary or secondary cells
are used, and methods of producing antibodies using the transfected
primary or secondary cells. The present invention also includes
primary and secondary somatic cells, such as fibroblasts,
keratinocytes, epithelial cells, endothelial cells, glial cells,
neural cells, formed elements of the blood, muscle cells, other
somatic cells, which can be cultured and somatic cell precursors,
which have been transfected with exogenous DNA encoding EPO or an
insulinotropin, which is stably integrated into their genomes or is
expressed in the cells episomally.
Inventors: |
Selden; Richard F.;
(Wellesley, MA) ; Treco; Douglas; (Arlington,
MA) ; Heartlein; Michael W.; (Boxborough,
MA) |
Correspondence
Address: |
CLARK & ELBING LLP
101 FEDERAL STREET
BOSTON
MA
02110
US
|
Assignee: |
Shire Human Genetic Therapies,
Inc.
Cambridge
MA
|
Family ID: |
27419842 |
Appl. No.: |
12/145324 |
Filed: |
June 24, 2008 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10885899 |
Jul 7, 2004 |
7410799 |
|
|
12145324 |
|
|
|
|
09328130 |
Jun 8, 1999 |
6846676 |
|
|
10885899 |
|
|
|
|
08334455 |
Nov 4, 1994 |
5994127 |
|
|
09328130 |
|
|
|
|
07911533 |
Jul 10, 1992 |
|
|
|
08334455 |
|
|
|
|
07787840 |
Nov 5, 1991 |
|
|
|
07911533 |
|
|
|
|
07789188 |
Nov 5, 1991 |
|
|
|
07787840 |
|
|
|
|
Current U.S.
Class: |
424/93.21 ;
435/325; 435/446; 435/455; 514/44R |
Current CPC
Class: |
C07K 14/605 20130101;
A61P 39/06 20180101; C07K 14/505 20130101; C12N 15/85 20130101;
C12N 15/907 20130101; C07K 2319/02 20130101; C12N 2840/20 20130101;
A61P 37/00 20180101; A61P 5/18 20180101; C12N 2510/02 20130101;
C12N 2800/108 20130101; C12N 2840/44 20130101; A61K 48/00 20130101;
A61P 5/06 20180101; A61K 47/6901 20170801; A61P 43/00 20180101;
A61P 37/02 20180101; A61P 3/06 20180101; A61P 7/04 20180101; A61P
7/02 20180101; C12N 2830/002 20130101; C07K 14/61 20130101; A61P
3/10 20180101; C12N 2830/85 20130101 |
Class at
Publication: |
424/93.21 ;
435/325; 435/455; 435/446; 514/44.R |
International
Class: |
A61K 35/12 20060101
A61K035/12; C12N 5/10 20060101 C12N005/10; C12N 15/63 20060101
C12N015/63; C12N 15/01 20060101 C12N015/01; A61K 31/7088 20060101
A61K031/7088 |
Claims
1. A transfected primary or secondary cell of vertebrate origin
having stably integrated into its genome: a) exogenous DNA which
encodes erythropoietin and b) DNA sequences, sufficient for
expression of the exogenous DNA in the transfected primary or
secondary cell, the primary or secondary cell capable of expressing
erythropoietin.
2-9. (canceled)
10. A primary or secondary cell of vertebrate origin transfected
with: a) exogenous DNA which encodes erythropoietin; and b) DNA
sequences, sufficient for expression of the exogenous DNA in the
primary or secondary cell, the sequences of (a) and (b) present in
the cell in an episome.
11-13. (canceled)
14. A clonal cell strain of transfected secondary cells of
vertebrate origin which express exogenous DNA encoding
erythropoietin incorporated therein.
15-19. (canceled)
20. A heterogenous cell strain of transfected secondary cells of
vertebrate origin having stably incorporated into their genomes: a)
exogenous DNA encoding erythropoietin and b) DNA sequences
sufficient for expression of the exogenous DNA in the transfected
primary or secondary cell, the heterogenous cell strain capable of
expressing erythropoietin.
21-23. (canceled)
24. A mixture of cells consisting essentially of transfected
primary or secondary cells of claim 1 and untransfected primary or
secondary cells.
25. (canceled)
26. A method of producing a clonal cell strain of transfected
secondary cells of vertebrate origin which express exogenous DNA
encoding erythropoietin incorporated therein, comprising the steps
of: a) producing a mixture of cells of vertebrate origin containing
primary cells; b) transfecting primary cells produced in (a) with a
DNA construct comprising exogenous DNA encoding erythropoietin and
additional DNA sequences sufficient for expression of the exogenous
DNA in the primary cells, thereby producing transfected primary
cells which express the exogenous DNA encoding erythropoietin; c)
culturing a transfected primary cell which expresses the exogenous
DNA encoding erythropoietin produced in (b), under conditions
appropriate for propagating the transfected primary cell which
expresses the exogenous DNA encoding erythropoietin, thereby
producing a clonal cell strain of transfected secondary cells from
the transfected primary cell.
27-33. (canceled)
34. A method of producing a clonal cell strain of transfected
secondary cells of vertebrate origin which express exogenous DNA
encoding erythropoietin incorporated therein, comprising the steps
of: a) providing a mixture of cells of vertebrate origin containing
primary cells; b) producing a population of secondary cells from
the primary cells provided in (a); c) transfecting secondary cells
produced in (b) with a DNA construct comprising exogenous DNA
encoding erythropoietin and additional DNA sequences sufficient for
expression of the exogenous DNA in the secondary cells, thereby
producing transfected secondary cells which express the exogenous
DNA encoding erythropoietin; and d) culturing a transfected
secondary cell which expresses the DNA encoding erythropoietin,
produced in (c), under conditions appropriate for propagating the
transfected secondary cell which expresses the exogenous DNA
encoding erythropoietin, thereby producing a clonal cell strain of
transfected secondary cells from the transfected secondary cell of
(d).
35-47. (canceled)
48. A method of producing a heterogenous cell strain of transfected
secondary cells of vertebrate origin which express exogenous DNA
encoding erythropoietin stably incorporated into the genome of said
secondary cells, comprising the steps of: a) producing a mixture of
cells of vertebrate origin containing primary cells; b)
transfecting primary cells produced in (a) with exogenous DNA
encoding erythropoietin and operatively linked to DNA sequences of
nonretroviral origin sufficient for expression of the exogenous DNA
in transfected secondary cells, thereby producing a mixture of
primary cells which includes transfected primary cells which
express the exogenous DNA encoding erythropoietin; c) culturing the
product of (b) under conditions appropriate for propagation of
transfected primary cells which express the exogenous DNA encoding
erythropoietin, thereby producing a heterogenous cell strain of
transfected secondary cells of vertebrate origin which express the
exogenous DNA encoding erythropoietin.
49-55. (canceled)
56. A method of producing a heterogenous cell strain of transfected
secondary cells of vertebrate origin which express exogenous DNA
encoding erythropoietin stably incorporated into the genome of said
secondary cells, comprising the steps of a) providing a mixture of
cells of vertebrate origin containing primary cells; b) producing a
population of secondary cells from the primary cells provided in
(a); c) transfecting secondary cells produced in (b) with exogenous
DNA encoding erythropoietin and operatively linked to DNA sequences
of nonretroviral origin sufficient for expression of the exogenous
DNA in transfected secondary cells, thereby producing a mixture of
secondary cells which includes transfected secondary cells which
express the exogenous DNA encoding erythropoietin; d) culturing the
product of (c) under conditions appropriate for propagation of
transfected secondary cells which express the exogenous DNA
encoding a therapeutic product, thereby producing a heterogenous
cell strain of transfected secondary cells of vertebrate origin
which express the exogenous DNA encoding erythropoietin.
57-64. (canceled)
65. A method of producing a clonal cell strain of secondary
fibroblasts of mammalian origin which express exogenous DNA
encoding erythropoietin upon introduction into a mammal, comprising
the steps of: a) providing primary fibroblasts of mammalian origin;
b) producing a population of secondary fibroblasts from the primary
fibroblasts provided in (a); c) combining the secondary fibroblasts
of mammalian origin with a DNA construct comprising: i) exogenous
DNA encoding erythropoietin to be expressed in the fibroblasts; and
ii) additional DNA sequences of non-retroviral origin sufficient
for expression of the exogenous DNA in the fibroblasts; d)
subjecting the combination produced in (c) to electroporation under
conditions which result in transfection of the vector into the
secondary fibroblasts of mammalian origin, thereby producing a
mixture of transfected secondary fibroblasts of mammalian origin
and nontransfected secondary fibroblasts of mammalian origin; e)
isolating a transfected secondary fibroblast of mammalian origin
produced in (d); and f) culturing the transfected secondary
fibroblast of mammalian origin isolated in (e) under conditions
appropriate for production of a clonal population consisting
essentially of transfected secondary fibroblasts of mammalian
origin which express the exogenous DNA encoding erythropoietin.
66-67. (canceled)
68. A method of providing erythropoietin in an effective amount to
a mammal, comprising the steps of: a) obtaining a source of primary
cells from the mammal; b) transfecting primary cells obtained in
(a) with DNA construct comprising exogenous DNA encoding
erythropoietin and additional DNA sequences sufficient for
expression of the exogenous DNA in the primary cells, thereby
producing transfected primary cells which express the exogenous DNA
encoding the therapeutic product; c) culturing a transfected
primary cell which expresses the exogenous DNA encoding
erythropoietin produced in (b), under conditions appropriate for
propagating the transfected primary cell which expresses the
exogenous DNA encoding erythropoietin, thereby producing a clonal
cell strain of transfected secondary cells from the transfected
primary cell; d) culturing the clonal cell strain of transfected
secondary cells produced in (c) under conditions appropriate for
and sufficient time for the clonal cell strain of transfected
secondary cells to undergo a sufficient number of doublings to
provide a sufficient number of transfected secondary cells to
produce an effective amount of erythropoietin; and e) introducing
transfected secondary cells produced in (d) into the mammal in
sufficient number to produce an effective amount of erythropoietin
in the mammal.
69. (canceled)
70. A method of providing erythropoietin in an effective amount to
a mammal, comprising the steps of: a) obtaining a source of primary
cells from the mammal; b) producing a population of secondary cells
from the primary cells provided in (a); c) transfecting secondary
cells produced in (b) with a DNA construct comprising exogenous DNA
encoding erythropoietin and additional DNA sequences sufficient for
expression of the exogenous DNA in the primary cells, thereby
producing transfected secondary cells which express the exogenous
DNA encoding erythropoietin; d) culturing a transfected secondary
cell which expresses the exogenous DNA encoding erythropoietin
produced in (c), under conditions appropriate for propagating the
transfected secondary cell which expresses the exogenous DNA
encoding erythropoietin, thereby producing a clonal cell strain of
transfected secondary cells from the transfected secondary cell; e)
culturing the clonal cell strain of transfected secondary cells
produced in (d) under conditions appropriate for and sufficient
time for the clonal cell strain of transfected secondary cells to
undergo a sufficient number of doublings to provide a sufficient
number of transfected secondary cells to produce an effective
amount of erythropoietin; and f) introducing transfected secondary
cells produced in (e) into the mammal in sufficient number to
produce an effective amount of erythropoietin.
71. (canceled)
72. A method of producing erythropoietin in an effective amount to
a mammal, comprising the steps of: a) obtaining a source of primary
cells from the mammal; b) transfecting primary cells obtained in
(a) with exogenous DNA encoding erythropoietin and operatively
linked to DNA sequences of nonretroviral origin sufficient for
expression of the exogenous DNA in transfected secondary cells,
thereby producing a mixture of primary cells which includes
transfected primary cells which express the exogenous DNA encoding
erythropoietin; c) culturing the product of (b) under conditions
appropriate for propagation of transfected primary cells which
express the exogenous DNA encoding erythropoietin, thereby
producing a heterogenous cell strain of transfected secondary cells
of vertebrate origin which express the exogenous DNA encoding
erythropoietin; and d) introducing transfected secondary cells
produced in (c) into the mammal in sufficient number to produce an
effective amount of erythropoietin in the mammal.
73. (canceled)
74. A method of providing erythropoietin in an effective amount to
a mammal, comprising the steps of: a) obtaining a source of primary
cells from the mammal, b) producing a population of secondary cells
from the primary cells provided in (a); c) transfecting secondary
cells produced in (b) with exogenous DNA encoding erythropoietin
and operatively linked to DNA sequences of nonretroviral origin
sufficient for expression of the exogenous DNA in transfected
secondary cells, thereby producing a mixture of secondary cells
which includes transfected secondary cells which express the
exogenous DNA encoding erythropoietin; d) culturing the product of
(c) under conditions appropriate for propagation of transfected
secondary cells which express the exogenous DNA encoding
erythropoietin, thereby producing a heterogenous cell strain of
transfected secondary cells of vertebrate origin which express the
exogenous DNA encoding erythropoietin; and e) introducing
transfected secondary cells produced in (c) into the mammal in
sufficient number to produce an effective amount of erythropoietin
in the mammal.
75. (canceled)
76. A method of providing erythropoietin to a mammal at
biologically significant levels, comprising administering to the
mammal transfected primary or secondary cells of mammalian origin
which express erythropoietin in sufficient quantity to produce
physiologically relevant levels in the mammal.
77. (canceled)
78. A transfected primary or secondary cell of vertebrate origin
having stably integrated into its genome: a) exogenous DNA which
encodes a glucagon-like peptide 1 related peptide with
insulinotropin activity, and b) DNA sequences, sufficient for
expression of the exogenous DNA in the transfected primary or
secondary cell, the primary or secondary cell capable of expressing
the glucagon-like peptide 1 related peptide.
79-85. (canceled)
86. A primary or secondary cell of vertebrate origin transfected
with: a) exogenous DNA which encodes a glucagon-like peptide 1
related peptide with insulinotropin activity; and b) DNA sequences,
sufficient for expression of the exogenous DNA in the primary or
secondary cell, the sequences of (a) and (b) present in the cell in
an episome.
87. A clonal cell strain of transfected secondary cells of
vertebrate origin which express exogenous DNA encoding a
glucagon-like peptide 1 related peptide incorporated therein.
88. (canceled)
89. A heterogenous cell strain of transfected secondary cells of
vertebrate origin having stably incorporated into their genomes: a)
exogenous DNA encoding a glucagon-like peptide 1 related peptide
with insulinotropin activity, and b) DNA sequences sufficient for
expression of the exogenous DNA in the transfected primary or
secondary cell, the heterogenous cell strain capable of expressing
a glucagon-like peptide 1 related peptide.
90. (canceled)
91. A method of producing a clonal cell strain of transfected
secondary cells of vertebrate origin which express exogenous DNA
encoding a glucagon-like peptide 1 related peptide incorporated
therein, comprising the steps of: a) producing a mixture of cells
of vertebrate origin containing primary cells; b) transfecting
primary cells produced in (a) with a DNA construct comprising
exogenous DNA encoding a glucagon-like peptide 1 related peptide
and additional DNA sequences sufficient for expression of the
exogenous DNA in the primary cells, thereby producing transfected
primary cells which express the exogenous DNA, encoding a
glucagon-like peptide 1 related peptide; and c) culturing a
transfected primary cell which expresses the exogenous DNA encoding
a glucagon-like peptide 1 related peptide produced in (b), under
conditions appropriate for propagating the transfected primary cell
which expresses the exogenous DNA encoding a glucagon-like peptide
1 related peptide, thereby producing a clonal cell strain of
transfected secondary cells from the transfected primary cell.
92. A method of producing a clonal cell strain of transfected
secondary cells of vertebrate origin which express exogenous DNA
encoding a glucagon-like peptide 1 related peptide incorporated
therein, comprising the steps of: a) providing a mixture of cells
of vertebrate origin containing primary cells; b) producing a
population of secondary cells from the primary cells provided in
(a); c) transfecting secondary cells produced in (b) with a DNA
construct comprising exogenous DNA encoding a glucagon-like peptide
1 related peptide and additional DNA sequences sufficient for
expression of the exogenous DNA in the secondary cells, thereby
producing transfected secondary cells which express the exogenous
DNA encoding a glucagon-like peptide 1 related peptide; and d)
culturing a transfected secondary cell which expresses the DNA
encoding a glucagon-like peptide 1 related peptide produced in (c),
under conditions appropriate for propagating the transfected
secondary cell which expresses the exogenous DNA encoding a
glucagon-like peptide 1 related peptide, thereby producing a clonal
cell strain of transfected secondary cells from the transfected
secondary cell of (d).
93. A method of producing a heterogenous cell strain of transfected
secondary cells of vertebrate origin which express exogenous DNA
encoding a glucagon-like peptide 1 related peptide stably
incorporated into the genome of said secondary cells, comprising
the steps of: a) producing a mixture of cells of vertebrate origin
containing primary cells; b) transfecting primary cells produced in
(a) with exogenous DNA encoding a glucagon-like peptide 1 related
peptide and operatively linked to DNA sequences of non-retroviral
origin sufficient for expression of the exogenous DNA in
transfected secondary cells, thereby producing a mixture of primary
cells which includes transfected primary cells which express the
exogenous DNA encoding a glucagon-like peptide 1 related peptide;
c) culturing the product of (b) under conditions appropriate for
propagation of transfected primary cells which express the
exogenous DNA encoding a glucagon-like peptide 1 related peptide,
thereby producing a heterogenous cell strain of transfected
secondary cells of vertebrate origin which express the exogenous
DNA encoding a glucagonlike peptide 1 related peptide.
94. A method of producing a clonal cell strain of secondary
fibroblasts of mammalian origin which express exogenous DNA
encoding a glucagon-like peptide 1 related peptide upon
incorporation into the genome of the secondary fibroblast,
comprising the steps of: a) providing primary fibroblasts of
mammalian origin; b) producing a population of secondary
fibroblasts from the primary fibroblasts provided in (a); c)
combining the secondary fibroblasts of mammalian origin with a DNA
construct comprising: i) exogenous DNA encoding a glucagon-like
peptide 1 related peptide to be expressed in the fibroblasts; and
ii) additional DNA sequences of non-retroviral origin sufficient
for expression of the exogenous DNA in the fibroblasts; d)
subjecting the combination produced in (c) to electroporation under
conditions which result in transfection of the vector into the
secondary fibroblasts of mammalian origin, thereby producing a
mixture of transfected secondary fibroblasts of mammalian origin
and nontransfected secondary fibroblasts of mammalian origin; e)
isolating a transfected secondary fibroblast of mammalian origin
produced in (d); and f) culturing the transfected secondary
fibroblast of mammalian origin isolated in (e) under conditions
appropriate for production of a clonal population consisting
essentially of transfected secondary fibroblasts of mammalian
origin which express the exogenous DNA encoding a glucagon-like
peptide 1 related peptide.
95. (canceled)
96. A method of providing a glucagon-like peptide 1 related peptide
in an effective amount to a mammal, comprising the steps of: a)
obtaining a source of primary cells from the mammal; b)
transfecting primary cells obtained in (a) with a DNA construct
comprising exogenous DNA encoding a glucagon-like peptide 1 related
peptide and additional DNA sequences sufficient for expression of
the exogenous DNA in the primary cells, thereby producing
transfected primary cells which express the exogenous DNA encoding
a glucagon-like peptide 1 related peptide; c) culturing a
transfected primary cell which expresses the exogenous DNA encoding
a glucagon-like peptide 1 related peptide produced in (b), under
conditions appropriate for propagating the transfected primary cell
which expresses the exogenous DNA encoding a glucagon-like peptide
1 related peptide, thereby producing a clonal cell strain of
transfected secondary cells from the transfected primary cell; d)
culturing the clonal cell strain of transfected secondary cells
produced in (c) under conditions appropriate for and sufficient
time for the clonal cell strain of transfected secondary cells to
undergo a sufficient number of doublings to provide a sufficient
number of transfected secondary cells to produce an effective
amount of a glucagon-like peptide 1 related peptide; and e)
introducing transfected secondary cells produced in (d) into the
mammal in sufficient number to produce an effective amount of a
glucagon-like peptide 1 related peptide in the mammal.
97-98. (canceled)
99. A method of providing a glucagon-like peptide 1 related peptide
in an effective amount to a mammal, comprising the steps of: a)
obtaining a source of primary cells from the mammal; b) producing a
population of secondary cells from the primary cells provided in
(a); c) transfecting secondary cells produced in (b) with a DNA
construct comprising exogenous DNA encoding a glucagon-like peptide
1 related peptide and additional DNA sequences sufficient for
expression of the exogenous DNA in the primary cells, thereby
producing transfected secondary cells which express the exogenous
DNA encoding glucagon-like peptide; d) culturing a transfected
secondary cell which expresses the exogenous DNA encoding
glucagon-like peptide produced in (c), under conditions appropriate
for propagating the transfected secondary cell which expresses the
exogenous DNA encoding a glucagon-like peptide 1 related peptide,
thereby producing a clonal cell strain of transfected secondary
cells from the transfected secondary cell; e) culturing the clonal
cell strain of transfected secondary cells produced in (c) under
conditions appropriate for and sufficient time for the clonal cell
strain of transfected secondary cells to undergo a sufficient
number of doublings to provide a sufficient number of transfected
secondary cells to produce an effective amount of a glucagon-like
peptide 1 related peptide; and f) introducing transfected secondary
cells produced in (e) into the mammal in sufficient number to
produce an effective amount of a glucagon-like peptide 1 related
peptide.
100. (canceled)
101. A method of producing a glucagon-like peptide 1 related
peptide in an effective amount to a mammal, comprising the steps
of: a) obtaining a source of primary cells from the mammal; b)
transfecting primary cells obtained in (a) with exogenous DNA
encoding a glucagon-like peptide 1 related peptide and operatively
linked to DNA sequences of non-retroviral origin sufficient for
expression of the exogenous DNA in transfected secondary cells,
thereby producing a mixture of primary cells which includes
transfected primary cells which express the exogenous DNA encoding
a glucagon-like peptide 1 related peptide; c) culturing the product
of (b) under conditions appropriate for propagation of transfected
primary cells which express the exogenous DNA encoding a
glucagon-like peptide 1 related peptide, thereby producing a
heterogenous cell strain of transfected secondary cells of
vertebrate origin which express the exogenous DNA encoding a
glucagon-like peptide 1 related peptide; and d) introducing
transfected secondary cells produced in (c) into the mammal in
sufficient number to produce an effective amount of a glucagon-like
peptide 1 related peptide in the mammal.
102. (canceled)
103. A method of providing a glucagon-like peptide 1 related
peptide in an effective amount to a mammal, comprising the steps
of: a) obtaining a source of primary cells from the mammal; b)
producing a population of secondary cells from the primary cells
provided in (a); c) transfecting secondary cells produced in (b)
with exogenous DNA encoding a glucagon-like peptide 1 related
peptide and operatively linked to DNA sequences of non-retroviral
origin sufficient for expression of the exogenous DNA in
transfected secondary cells, thereby producing a mixture of
secondary cells which includes transfected secondary cells which
express the exogenous DNA encoding a glucagon-like peptide 1
related peptide; d) culturing the product of (c) under conditions
appropriate for propagation of transfected secondary cells which
express the exogenous DNA encoding a glucagon-like peptide 1
related peptide, thereby producing a heterogenous cell strain of
transfected secondary cells of vertebrate origin which express the
exogenous DNA encoding glucagon-like peptide; and e) introducing
transfected secondary cells produced in (c) into the mammal in
sufficient number to produce an effective amount of a glucagon-like
peptide 1 related peptide in the mammal.
104. (canceled)
105. A method of providing erythropoietin in an effective amount to
a mammal, comprising introducing into the mammal a barrier device
containing: a) transfected primary cells expressing exogenous DNA
encoding erythropoietin, b) transfected secondary cells expressing
exogenous DNA encoding erythropoietin, c) or both a) and b),
wherein the barrier device is made of a material which permits
passage of erythropoietin into the circulation or tissues of the
mammal and prevents contact between the immune system of the mammal
and the transfected cells contained within the barrier device to a
sufficient extent to prevent a deleterious immune response by the
mammal.
106. A method of providing erythropoietin in an effective amount to
a mammal, comprising introducing into the mammal a DNA construct
comprising exogenous DNA encoding erythropoietin and regulatory
sequences sufficient for expression of erythropoietin in cells of
the mammal, wherein the DNA construct is taken up by cells of the
mammal and is expressed therein.
107. (canceled)
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of U.S. Ser. No.
10/885,899, filed, Jul. 7, 2004, which is a continuation of U.S.
Ser. No. 09/328,130, filed Jun. 8, 1999 (U.S. Pat. No. 6,846,676),
which is a continuation of U.S. Ser. No. 08/334,455, filed Nov. 4,
1994 (U.S. Pat. No. 5,994,127), which is a continuation of U.S.
Ser. No. 07/911,533, filed Jul. 10, 1992 (abandoned), which is a
continuation-in-part of U.S. Ser. No. 07/787,840, filed Nov. 5,
1991 (abandoned) and of U.S. Ser. No. 07/789,188, filed Nov. 5,
1991 (abandoned). The teachings of each of these prior applications
are incorporated herein by reference.
BACKGROUND OF THE INVENTION
[0002] A variety of congenital, acquired, or induced syndromes are
associated with insufficient numbers of erythrocytes (red blood
cells or RBCs). The clinical consequence of such syndromes,
collectively known as the anemias, is a decreased oxygen-carrying
potential of the blood, resulting in fatigue, weakness, and
failure-to-thrive. Erythropoietin (EPO), a glycoprotein of
molecular mass 34,000 daltons, is synthesized and released into the
systemic circulation in response to reduced oxygen tension in the
blood. EPO, primarily synthesized in the kidney and, to a lesser
extent, in the liver, acts on erythroid precursor cells [Colony
Forming Units-Erythroid (CFU-E) and Burst-Forming Units-Erythroid
(BFU-E)] to promote differentiation into reticulocytes and,
ultimately, mature erythrocytes.
[0003] The kidney is the major site of EPO production and, thus,
renal failure or nephrectomy can lead to decreased EPO synthesis,
reduced RBC numbers, and, ultimately, severe anemia as observed in
predialysis and dialysis patients. Subnormal RBC counts may also
result from the toxic effects of chemotherapeutic agents or
azidothymidine (AZT) (used in the treatment of cancers and AIDS,
respectively) on erythroid precursor cells. In addition, a variety
of acquired and congenital syndromes, such as aplastic anemia,
myeloproliferative syndrome, malignant lymphomas, multiple myeloma,
neonatal prematurity, sickle-cell anemia, porphyria cutanea tarda,
and Gaucher's disease, include anemia as one clinical manifestation
of the syndrome.
[0004] Purified human EPO or recombinant human EPO may be
administered to patients in order to alleviate anemia by increasing
erythrocyte production. Typically, the protein is administered by
regular intravenous injections. The administration of EPO by
injection is an imperfect treatment. Normal individuals maintain a
relatively constant level of EPO, which is in the range of 6-30
mU/ml, depending on the assay used. After typical treatment
regimens, serum EPO levels may reach 3,000-5,000 mU/Ml following a
single injection, with levels falling over time as the protein is
cleared from the blood.
[0005] If a relatively constant level of EPO is to be provided in
the blood (i.e., to mimic the normal physiology of the protein), a
delivery system that is capable of releasing a continuous,
precisely dosed quantity of EPO into the blood is necessary.
SUMMARY OF THE INVENTION
[0006] The present invention relates to transfected primary and
secondary somatic cells of vertebrate origin, particularly
mammalian origin, transfected with exogenous genetic material (DNA
or RNA), which encodes a clinically useful product, such as,
erythropoietin (EPO) or insulinotropin [e.g., derivatives of
glucagon-like peptide 1 (GLP-1) such as GLP (7-37), GLP (7-36),
GLP-1 (7-35) and GLP-1 (7-34) as well as their carboxyl-terminal
amidated derivatives produced by in vivo amidating enzymes and
derivatives which have amino acid alterations or other alterations
which result in substantially the same biological activity or
stability in the blood as that of a truncated GLP-1 or enhanced
biological activity or stability], methods by which primary and
secondary cells are transfected to include exogenous genetic
material encoding EPO or insulinotropin, methods of producing
clonal cell strains or heterogenous cell strains which express
exogenous genetic material encoding EPO or insulinotropin, methods
of providing EPO or insulinotropin in physiologically useful
quantities to an individual in need thereof, through the use of
transfected cells of the present invention or by direct injection
of DNA encoding EPO into an individual; and methods of producing
antibodies against the encoded product using the transfected
primary or secondary cells. Transfected cells containing
EPO-encoding exogenous genetic material express EPO and, thus, are
useful for preventing or treating conditions in which EPO
production and/or utilization are inadequate or compromised, such
as in any condition or disease in which there is anemia. Similarly,
transfected cells containing insulinotropin-encoding exogenous
genetic material express insulinotropin and, thus, are useful for
treating individuals in whom insulin secretion, sensitivity, or
function is compromised (e.g., individuals with insulin-dependent
or non-insulin dependent diabetes).
[0007] The present invention includes primary and secondary somatic
cells, such as fibroblasts, keratinocytes, epithelial cells,
endothelial cells, glial cells, neural cells, formed elements of
the blood, muscle cells, and other somatic cells which can be
cultured and somatic cell precursors, which have been transfected
with exogenous DNA encoding EPO or exogenous DNA encoding
insulinotropin. The exogenous DNA is stably integrated into the
cell genome or is expressed in the cells episomally. The exogenous
DNA encoding EPO is introduced into cells operatively linked with
additional DNA sequences sufficient for expression of EPO in
transfected cells. The exogenous DNA encoding EPO is preferably DNA
encoding human EPO but, in some instances, can be DNA encoding
mammalian EPO of non-human origin. EPO produced by the cells is
secreted from the cells and, thus, made available for preventing or
treating a condition or disease (e.g., anemia) in which EPO
production and/or utilization is less than normal or inadequate for
maintaining a suitable level of RBCs. Cells produced by the present
method can be introduced into an animal, such as a human, in need
of EPO and EPO produced in the cells is secreted into the systemic
circulation. As a result, EPO is made available for prevention or
treatment of a condition in which EPO production and/or utilization
is less than normal or inadequate to maintain a suitable level of
RBCs in the individual. Similarly, exogenous DNA encoding
insulinotropin is introduced into cells operatively linked with
additional DNA sequences sufficient for expression of
insulinotropin in transfected cells. The encoded insulinotropin is
made available to prevent or treat a condition in which insulin
production or function is compromised or glucagon release from the
pancreas is to be inhibited.
[0008] Primary and secondary cells transfected by the subject
method can be seen to fall into three types or categories: 1) cells
which do not, as obtained, produce and/or secrete the encoded
protein (e.g., EPO or insulinotropin; 2) cells which produce and/or
secrete the encoded protein (e.g., EPO or insulinotropin) but in
lower quantities than normal (in quantities less than the
physiologically normal lower level) or in defective form, and 3)
cells which make the encoded protein (e.g., EPO or insulinotropin)
at physiologically normal levels, but are to be augmented or
enhanced in their production and/or secretion of the encoded
protein.
[0009] Exogenous DNA encoding EPO is introduced into primary or
secondary cells by a variety of techniques. For example, a
construct which includes exogenous DNA encoding EPO and additional
DNA sequences necessary for expression of EPO in recipient cells is
introduced into primary or secondary cells by electroporation,
microinjection, or other means (e.g., calcium phosphate
precipitation, modified calcium phosphate precipitation, polybrene
precipitation, microprojectile bombardment, liposome fusion,
receptor-mediated DNA delivery). Alternatively, a vector, such as a
retroviral vector, which includes exogenous DNA encoding EPO can be
used, and cells can be genetically modified as a result of
infection with the vector. Similarly, exogenous DNA encoding
insulinotropin is introduced into primary or secondary cells using
one of a variety of methods.
[0010] In addition to exogenous DNA encoding EPO or insulinotropin,
transfected primary and secondary cells may optionally contain DNA
encoding a selectable marker, which is expressed and confers upon
recipient cells a selectable phenotype, such as antibiotic
resistance, resistance to a cytotoxic agent, nutritional
prototrophy or expression of a surface protein. Its presence makes
it possible to identify and select cells containing the exogenous
DNA. A variety of selectable marker genes can be used, such as neo,
gpt, dhfr, ada, pac, hyg, mdr, and hisD.
[0011] Transfected cells of the present invention are useful, as
populations of transfected primary cells, transfected clonal cell
strains, transfected heterogenous cell strains, and as cell
mixtures in which at least one representative cell of one of the
three preceding categories of transfected cells is present, as a
delivery system for treating an individual with a condition or
disease which responds to delivery of EPO (e.g., anemia) or for
preventing the development of such a condition or disease. In the
methods of the present invention of providing EPO, transfected
primary cells, clonal cell strains, or heterogenous cell strains
are administered to an individual in need of EPO, in sufficient
quantity and by an appropriate route, to deliver EPO to the
systemic circulation at a physiologically relevant level. In a
similar manner, transfected cells of the present invention
providing insulinotropin are useful as populations of transfected
primary cells, transfected clonal cell strains, transfected
heterogenous cell strains, and as cell mixtures, as a delivery
system for treating an individual in whom insulin production,
secretion, or function is compromised or for inhibiting (totally or
partially) glucagon secretion from the pancreas. A physiologically
relevant level is one which either approximates the level at which
the product is normally produced in the body or results in
improvement of an abnormal or undesirable condition.
[0012] Clonal cell strains of transfected secondary cells (referred
to as transfected clonal cell strains) expressing exogenous DNA
encoding EPO (and, optionally, including a selectable marker gene)
are produced by the method of the present invention. The present
method includes the steps of: 1) providing a population of primary
cells, obtained from the individual to whom the transfected primary
cells will be administered or from another source; 2) introducing
into the primary cells or into secondary cells derived from primary
cells a DNA construct which includes exogenous DNA encoding EPO and
additional DNA sequences necessary for expression of EPO, thus
producing transfected primary or secondary cells; 3) maintaining
transfected primary or secondary cells under conditions appropriate
for their propagation; 4) identifying a transfected primary or
secondary cell; and 5) producing a colony from the transfected
primary or secondary cell identified in (4) by maintaining it under
appropriate culture conditions and for sufficient time for its
propagation, thereby producing a cell strain derived from the
(founder) cell identified in (4). In one embodiment of the method,
exogenous DNA encoding EPO is introduced into genomic DNA by
homologous recombination between DNA sequences present in the DNA
construct used to transfect the recipient cells and the recipient
cell's genomic DNA. Clonal cell strains of transfected secondary
cells expressing exogenous DNA encoding insulinotropin (and,
optionally, including a selectable marker gene) are also produced
by the present method.
[0013] In one embodiment of the present method of producing a
clonal population of transfected secondary cells, a cell suspension
containing primary or secondary cells is combined with exogenous
DNA encoding EPO and DNA encoding a selectable marker, such as the
bacterial neo gene. The two DNA sequences are present on the same
DNA construct or on two separate DNA constructs. The resulting
combination is subjected to electroporation, generally at 250-300
volts with a capacitance of 960 .mu.Farads and an appropriate time
constant (e.g., 14 to 20 msec) for cells to take up the DNA
construct. In an alternative embodiment, microinjection is used to
introduce the DNA construct containing EPO-encoding DNA into
primary or secondary cells. In either embodiment, introduction of
the exogenous DNA results in production of transfected primary or
secondary cells. Using the same approach, electroporation or
microinjection is used to produce a clonal population of
transfected secondary cells containing exogenous DNA encoding
insulinotropin alone, or insulinotropin and a selectable
marker.
[0014] In the methods of producing heterogenous cell strains of the
present invention, the same steps are carried out as described for
production of a clonal cell strain, except that a single
transfected primary or secondary cell is not isolated and used as
the founder cell. Instead, two or more transfected primary or
secondary cells are cultured to produce a heterogenous cell
strain.
[0015] The subject invention also relates to methods of producing
antibodies specific for EPO. In these methods, transfected primary
or secondary cells expressing EPO are introduced into an animal
recipient (e.g., rabbit, mouse, pig, dog, cat, goat, guinea pig,
sheep, and non-human primate). The animal recipient produces
antibodies against the EPO expressed, which may be the entire EPO
protein antigen or a peptide encoded by a fragment of the intact
EPO gene. Polyclonal sera is obtained from the animals. It is also
possible to produce monoclonal antibodies through the use of
transfected primary or secondary cells. Splenocytes are removed
from an animal recipient of transfected primary or secondary cells
expressing EPO. The splenocytes are fused with myeloma cells, using
known methods, such as that of Koprowski et al. (U.S. Pat. No.
4,172,124) or Kohler et al. (Nature 256:495-497, 1975) to produce
hybridoma cells which produce the desired anti-EPO monoclonal
antibody. The polyclonal antisera and monoclonal antibodies
produced can be used for the same purposes (e.g., diagnostic,
preventive, or therapeutic purposes) as antibodies produced by
other methods. Similarly, antibodies specific for insulinotropin
can be produced by the methods of the present invention.
[0016] The present invention is particularly advantageous in
treating anemia and other conditions in which EPO production,
utilization, or both is compromised in that it: 1) makes it
possible for one gene therapy treatment, when necessary, to last a
patient's lifetime; 2) allows precise dosing (the patient's cells
continuously determine and deliver the optimal dose of EPO based on
physiologic demands, and the stably transfected cell strains can be
characterized extensively in vitro prior to implantation, leading
to accurate predictions of long term function in vivo); 3) is
simple to apply in treating patients; 4) eliminates issues
concerning patient compliance (periodic administration of EPO is no
longer necessary); and 5) reduces treatment costs (since the
therapeutic protein is synthesized by the patient's own cells,
investment in costly protein production and purification facilities
is unnecessary).
BRIEF DESCRIPTION OF THE DRAWINGS
[0017] FIG. 1 is a schematic representation of plasmid pXEPO1. The
solid black arc represents the pUC12 backbone and the arrow denotes
the direction of transcription of the ampicillin resistance gene.
The stippled arc represents the mouse metallothionein promoter
(pmMT1). The unfilled arc interrupted by black boxes represents the
human erythropoietin EPO gene (the black boxes denote exons and the
arrow indicates the direction hEPO transcription). The relative
positions of restriction endonuclease recognition sites are
indicated.
[0018] FIG. 2 is a schematic representation of plasmid pcDNEO. This
plasmid has the neo gene from plasmid pSV2neo (a BamHI-BglII
fragment) inserted into the BamHI site of plasmid pcD; the amp and
pBR322ori sequences are from pBR322; the polyA, 19S splice
junction, and early promoter sequences are from SV40.
[0019] FIG. 3 is a schematic representation of plasmid pXGH301.
This plasmid contains both the human growth hormone (hGH) and neo
resistance genes. Arrows indicate the directions of transcription
of the various genes. The positions of restriction endonuclease
recognition sites, the mouse metallothionein promoter (pMMT1), the
amp resistance gene, and the SV40 early promoter (pSV40 early) are
indicated.
[0020] FIG. 4 is a schematic representation of plasmid pE3neoEPO.
The positions of the human erythropoietin gene and the neo and amp
resistance genes are indicated. Arrows indicate the directions of
transcription of the various genes. pmMT1 denotes the mouse
metallothionein promoter (driving hEPO expression) and pTK denotes
the Herpes Simplex Virus thymidine kinase promoter (driving neo
expression). The dotted regions of the map mark the positions of
human HGPRT sequences. The relative positions of restriction
endonuclease recognition sites are indicated.
[0021] FIG. 5A shows results of Western blot analysis of hEPO
secreted by normal human fibroblasts cotransfected with pXEPO1 and
pcDNEO. The left panel shows the Western analysis and the right
panel shows a photograph of the Coomassie blue stained gel. Lanes
C, E, and M signify Control sample (supernatant from untransfected
human fibroblasts), Experimental sample (supernatant from a clonal
strain of human fibroblasts expressing hEPO), and marker lanes,
respectively.
[0022] FIG. 5B shows results of Western blot analysis of hEPO
secreted by normal human fibroblasts cotransfected with pXEPO1 and
pcDNEO. Supernatant from a clonal strain of human fibroblasts
expressing hEPO (lane 1) was further analyzed for glycosylation by
treatment with endoglycosidase-F (lane 2), neuraminidase (lane 3),
and O-glycanase (lane 4).
[0023] FIG. 6A shows results of an assay to detect hEPO in the
serum of mice implanted with transfected rabbit fibroblasts
expressing hEPO.
[0024] FIG. 6B shows hematocrit (HCT) levels in control mice and
mice implanted with transfected rabbit fibroblasts expressing
hEPO.
DETAILED DESCRIPTION OF THE INVENTION
[0025] The present invention relates to the use of genetically
engineered cells to deliver a clinically useful or otherwise
desirable substance to an individual in whom production of the
substance is desired (e.g., to prevent or treat a disease or
condition in which the product is produced or functions at an
unacceptable level). In particular, it relates to the use of
genetically engineered cells to deliver EPO to the systemic
circulation of an individual in need of EPO, resulting in an
increase in mature red blood cell numbers, an increase in the
oxygen-carrying potential of the blood, and an alleviation of the
symptoms of anemia. The present invention provides a means of
delivering EPO at physiologically relevant levels and on a
continuous basis to an individual. It further particularly relates
to the use of genetically engineered cells to deliver
insulinotropin to an individual in need of insulinotropin to
stimulate insulin release, to increase insulin sensitivity in
peripheral tissues, or to inhibit glucagon secretion from the
pancreas.
[0026] As used herein, the term primary cell includes cells present
in a suspension of cells isolated from a vertebrate tissue source
(prior to their being plated, i.e., attached to a tissue culture
substrate such as a dish or flask), cells present in an explant
derived from tissue, both of the previous types of cells plated for
the first time, and cell suspensions derived from these plated
cells. The term secondary cell or cell strain refers to cells at
all subsequent steps in culturing. That is, the first time a plated
primary cell is removed from the culture substrate and replated
(passaged), it is referred to herein as a secondary cell, as are
all cells in subsequent passages. Secondary cells are cell strains
which consist of secondary cells which have been passaged one or
more times. A cell strain consists of secondary cells that: 1) have
been passaged one or more times; 2) exhibit a finite number of mean
population doublings in culture; 3) exhibit the properties of
contact-inhibited, anchorage dependent growth (anchorage-dependence
does not apply to cells that are propagated in suspension culture);
and 4) are not immortalized. A "clonal cell strain" is defined as a
cell strain that is derived from a single founder cell. A
"heterogenous cell strain" is defined as a cell strain that is
derived from two or more founder cells.
[0027] As described herein, primary or secondary cells of
vertebrate, particularly mammalian, origin have been transfected
with exogenous DNA encoding EPO and shown to produce the encoded
EPO reproducibly, both in vitro and in vivo, over extended periods
of time. In addition, the transfected primary and secondary cells
have been shown to express EPO in vivo at physiologically relevant
levels. The EPO expressed has been shown to have the glycosylation
pattern typical of EPO purified from human urine or recombinant
human EPO. This demonstration is in sharp contrast to what one of
skill in the art would predict, since, for example, even experts in
the field see the finite life span of normal somatic cells and the
inability to isolate or grow the relevant transplantable cells as
precluding their use for gene therapy unless the cells are
genetically modified using retroviruses (Miller, Blood, 76:271-278
(1990)). However, the transplantation of retrovirally treated
fibroblasts has been shown to provide, at best, only transient
metabolic improvements, and is seen to have serious limitations as
a therapeutic system. In addition, until Applicants' work, this had
not been done for EPO. Normal (nonimmortal) fibroblasts are
characterized as being "much more difficult to transfect than
continuous cell lines by using calcium phosphate precipitation
techniques." (Miller, A. D., Blood, 76:271-278 (1990)).
Furthermore, in considering non-retroviral techniques for gene
therapy, it is typical of experts in the field to believe " . . .
the efficiency of gene delivery is dismal. . . . A physician would
have to obtain an impossible number of cells from patients to
guarantee the appropriate alteration of the millions required for
therapy." (Verma, I. M., Scient. Amer., November 1990, pages
68-84).
[0028] Surprisingly, Applicants have been able to produce
transfected primary and secondary cells which include exogenous DNA
encoding EPO and express the exogenous DNA.
[0029] The transfected primary or secondary cells may also include
DNA encoding a selectable marker which confers a selectable
phenotype upon them, facilitating their identification and
isolation. Applicants have also developed methods for producing
transfected primary or secondary cells which stably express
exogenous DNA encoding EPO, clonal cell strains and heterogenous
cell strains of such transfected cells, methods of producing the
clonal and heterogenous cell strains, and methods of using
transfected cells expressing EPO to deliver the encoded product to
an individual mammal at physiologically relevant levels. The
constructs and methods are useful, for example, for treating an
individual (human) whose EPO production and/or function is in need
of being increased or enhanced [e.g., is compromised or less than
normal, or normal but the individual would benefit from
enhancement, at least temporarily, of red blood cell production
(e.g., during predialysis or dialysis therapy, during treatment of
AIDS with AZT, after surgery, or during chemotherapy)].
[0030] As also described herein, it is possible to transfect
primary or secondary cells of vertebrate, particularly mammalian,
origin with exogenous DNA encoding insulinotropin and to use them
to provide insulinotropin to an individual in whom insulin
production, function and/or sensitivity is compromised.
Transfected Cells
[0031] Primary and secondary cells to be transfected in order to
produce EPO or insulinotropin can be obtained from a variety of
tissues and include all cell types which can be maintained and
propagated in culture. For example, primary and secondary cells
which can be transfected by the present method include fibroblasts,
keratinocytes, epithelial cells (e.g., mammary epithelial cells,
intestinal epithelial cells), endothelial cells, glial cells,
neural cells, formed elements of the blood (e.g., lymphocytes, bone
marrow cells), muscle cells, other somatic cells which can be
cultured, and precursors of these somatic cell types. Primary cells
are preferably obtained from the individual to whom the transfected
primary or secondary cells are administered. However, primary cells
may be obtained from a donor (other than the recipient) of the same
species or another species (e.g., mouse, rat, rabbit, cat, dog,
pig, cow, bird, sheep, goat, or horse).
[0032] Transfected primary and secondary cells can be produced,
with or without phenotypic selection, as described herein, and
shown to express exogenous DNA encoding EPO or exogenous DNA
encoding insulinotropin.
Exogenous DNA
[0033] Exogenous DNA incorporated into primary or secondary cells
by the present method is DNA encoding the desired product (e.g.,
EPO or insulinotropin), a functional or active portion, or a
functional equivalent of EPO or insulinotropin (a protein which has
a different amino acid sequence from that of EPO but has
substantially the same biological function as EPO, or a protein
which has a different amino acid sequence from that of GLP-1
related peptides but functions biologically as insulinotropin). The
DNA can be obtained from a source in which it occurs in nature or
can be produced, using genetic engineering techniques or synthetic
processes. The DNA encoding EPO or insulinotropin will generally be
DNA encoding the human product (i.e., human EPO or human
insulinotropin). In some cases, however, the DNA can be DNA
encoding EPO or insulinotropin of non-human origin (i.e., DNA
obtained from a non-human source or DNA, produced recombinantly or
by synthetic methods, which encodes a non-human EPO or
insulinotropin).
[0034] The DNA transfected into primary or secondary cells can
encode EPO alone or EPO and another product, such as a selectable
marker to facilitate selection and identification of transfected
cells. Alternatively, the transfected DNA can encode insulinotropin
alone or insulinotropin and another product, such as a selectable
marker. After transfection into primary or secondary cells, the
exogenous DNA is stably incorporated into the recipient cell's
genome (along with the additional sequences present in the DNA
construct used), from which it is expressed or otherwise functions.
Alternatively, the exogenous DNA may exist episomally within the
transfected primary or secondary cells. DNA encoding the desired
product can be introduced into cells under the control of an
inducible promoter, with the result that cells produced or as
introduced into an individual do not express the product but can be
induced to do so (i.e., production is induced after the transfected
cells are produced but before implantation or after implantation).
DNA encoding the desired product can, of course, be introduced into
cells in such a manner that it is expressed upon introduction
(i.e., without induction).
Selectable Markers
[0035] A variety of selectable markers can be incorporated into
primary or secondary cells. For example, a selectable marker which
confers a selectable phenotype such as drug resistance, nutritional
auxotrophy, resistance to a cytotoxic agent or expression of a
surface protein, can be used. Selectable marker genes which can be
used include neo, gpt, dhfr, ada, pac, hyg, and hisD. The
selectable phenotype conferred makes it possible to identify and
isolate recipient primary or secondary cells.
DNA Constructs
[0036] DNA constructs, which include exogenous DNA encoding the
desired product (e.g., EPO, insulinotropin) and, optionally, DNA
encoding a selectable marker, along with additional sequences
necessary for expression of the exogenous DNA in recipient primary
or secondary cells, are used to transfect primary or secondary
cells in which the protein (e.g., EPO, insulinotropin) is to be
produced. Alternatively, infectious vectors, such as retroviral,
herpes, adenovirus, adenovirus-associated, mumps, and poliovirus
vectors, can be used for this purpose.
[0037] A DNA construct which includes the exogenous DNA encoding
EPO and additional sequences, such as sequences necessary for
expression of EPO, can be used (e.g., plasmid pXEPO1; see FIG. 1).
A DNA construct can include an inducible promoter which controls
expression of the exogenous DNA, making inducible expression
possible. Optionally, the DNA construct may include a bacterial
origin of replication and bacterial antibiotic resistance markers,
which allow for large-scale plasmid propagation in bacteria. A. DNA
construct which includes DNA encoding a selectable marker, along
with additional sequences, such as a promoter, polyadenylation
site, and splice junctions, can be used to confer a selectable
phenotype upon transfected primary or secondary cells (e.g.,
plasmid pcDNEO). The two DNA constructs are cotransfected into
primary or secondary cells, using methods described herein.
Alternatively, one DNA construct which includes exogenous DNA
encoding EPO, a selectable marker gene and additional sequences
(e.g., those necessary for expression of the exogenous DNA and for
expression of the selectable marker gene) can be used. Such a DNA
construct (pE3neoEPO) is described in FIG. 4; it includes the EPO
gene and the neo gene. Similar constructs, which include exogenous
DNA encoding insulinotropin and additional sequences (e.g.,
sequences necessary for insulinotropin expression) can be produced
(e.g., plasmid pXGLP1; see Example 11). These constructs can also
include DNA encoding a selectable marker, as well as other
sequences, such as a promoter, a polyadenylation site, and splice
junctions.
[0038] In those instances in which DNA is injected directly into an
individual, such as by injection into muscles, the DNA construct
includes the exogenous DNA and regulatory sequences necessary and
sufficient for expression of the encoded product (e.g., EPO) upon
entry of the DNA construct into recipient cells.
Transfection of Primary or Secondary Cells and Production of Clonal
or Heterogenous Cell Strains
[0039] Transfection of cells by the present method is carried out
as follows: vertebrate tissue is first obtained; this is carried
out using known procedures, such as punch biopsy or other surgical
methods of obtaining a tissue source of the primary cell type of
interest. For example, punch biopsy is used to obtain skin as a
source of fibroblasts or keratinocytes. A mixture of primary cells
is obtained from the tissue, using known methods, such as enzymatic
digestion or explantation. If enzymatic digestion is used, enzymes
such as collagenase, hyaluronidase, dispase, pronase, trypsin,
elastase, and chymotrypsin can be used.
[0040] The resulting primary cell mixture can be transfected
directly, or it can be cultured first, removed from the culture
plate, and resuspended before transfection is carried out. Primary
cells or secondary cells are combined with exogenous DNA encoding
EPO, to be stably integrated into their genomes and, optionally,
DNA encoding a selectable marker, and treated in order to
accomplish transfection. The exogenous DNA and selectable
marker-encoding DNA can each be present on a separate construct
(e.g., pXEPO1 and pcDNEO, see FIGS. 1 and 2) or on a single
construct (e.g., pE3neoEPO, see FIG. 4). An appropriate quantity of
DNA to ensure that at least one stably transfected cell containing
and appropriately expressing exogenous DNA is produced. In general,
0.1 to 500 .mu.g DNA is used.
[0041] In one embodiment of the present method of producing
transfected primary or secondary cells, transfection is effected by
electroporation, as described in the Examples. Electroporation is
carried out at appropriate voltage and capacitance (and
corresponding time constant) to result in entry of the DNA
construct(s) into the primary or secondary cells. Electroporation
can be carried out over a wide range of voltages (e.g., 50 to 2000
volts) and corresponding capacitance. As described herein,
electroporation is very efficient if carried out at an
electroporation voltage in the range of 250-300 volts and a
capacitance of 960 .mu.Farads (see Examples 4, 5, 7, and 8). Total
DNA of approximately 0.1 to 500 .mu.g is generally used. As
described in the Examples, total DNA of 60 .mu.g and voltage of
250-300 volts with capacitance of 960 .mu.Farads for a time
constant 14-20 of msec has been used and shown to be efficient.
[0042] In another embodiment of the present method, primary or
secondary cells are transfected using microinjection. See, for
instance, Examples 4 and 9. Alternatively, known methods such as
calcium phosphate precipitation, modified calcium phosphate
precipitation, polybrene precipitation, liposome fusion, and
receptor-mediated gene delivery can be used to transfect cells. A
stably, transfected cell is isolated and cultured and
subcultivated, under culturing conditions and for sufficient time,
to propagate the stably transfected secondary cells and produce a
clonal cell strain of transfected secondary cells. Alternatively,
more than one transfected cell is cultured and subculturated,
resulting in production of a heterogenous cell strain.
[0043] Transfected primary or secondary cells undergo a sufficient
number of doublings to produce either a clonal cell strain or a
heterogenous cell strain of sufficient size to provide EPO to an
individual in effective amounts. In general, for example, 0.1
cm.sup.2 of skin is biopsied and assumed to contain 100,000 cells;
one cell is used to produce a clonal cell strain and undergoes
approximately 27 doublings to produce 100 million transfected
secondary cells. If a heterogenous cell strain is to be produced
from an original transfected population of approximately 100,000
cells, only 10 doublings are needed to produce 100 million
transfected cells.
[0044] The number of required cells in a transfected clonal or
heterogenous cell strain is variable and depends on a variety of
factors, which include but are not limited to, the use of the
transfected cells, the functional level of the exogenous DNA in the
transfected cells, the site of implantation of the transfected
cells (for example, the number of cells that can be used is limited
by the anatomical site of implantation), and the age, surface area,
and clinical condition of the patient. To put these factors in
perspective, to deliver therapeutic levels of EPO in an otherwise
healthy 60 kg patient with anemia, the number of cells needed is
approximately the volume of cells present on the very tip of the
patient's thumb.
Episomal Expression of Exogenous DNA
[0045] DNA sequences that are present within the cell, yet do not
integrate into the genome, are referred to as episomes. Recombinant
episomes may be useful in at least three settings: 1) if a given
cell type is incapable of stably integrating the exogenous DNA; 2)
if a given cell type is adversely affected by the integration of
DNA; and 3) if a given cell type is capable of improved therapeutic
function with an episomal rather than integrated DNA.
[0046] Using the transfection and culturing approaches to gene
therapy described in Examples 1 and 2, exogenous DNA encoding EPO,
in the form of episomes can be introduced into vertebrate primary
and secondary cells. Plasmid pE3neoEPO can be converted into such
an episome by the addition of DNA sequences for the Epstein-Barr
virus origin of replication and nuclear antigen [Yates, J. L.,
Nature 319:780-7883 (1985)]. Alternatively, vertebrate autonomously
replicating sequences can be introduced into the construct (Weidle,
U. H., Gene 73(2):427-437 (1988). These and other episomally
derived sequences can also be included in DNA constructs without
selectable markers, such as pXEPO1. The episomal exogenous DNA is
then introduced into primary or secondary vertebrate cells as
described in this application (if a selective marker is included in
the episome, a selective agent is used to treat the transfected
cells). Similarly, episomal expression of DNA encoding
insulinotropin can be accomplished in vertebrate primary or
secondary cells, using the same approach described above with
reference to EPO.
Implantation of Clonal Cell Strain or Heterogenous Cell Strain of
Transfected Secondary Cells
[0047] The transfected cells produced as described above are
introduced into an individual to whom EPO is to be delivered, using
known methods. The clonal cell strain or heterogenous cell strain
is introduced into an individual, using known methods, using
various routes of administration and at various sites (e.g., renal
subcapsular, subcutaneous, central nervous system (including
intrathecal), intravascular, intrahepatic, intrasplanchnic,
intraperitoneal (including intraomental), or intramuscular
implantation)]. Once implanted in the individual, the transfected
cells produce EPO encoded by the exogenous DNA. For example, an
individual who has been diagnosed as anemic is a candidate for a
gene therapy cure. The patient has a small skin biopsy performed;
this is a simple procedure which can be performed on an out-patient
basis. The piece of skin, approximately 0.1 cm.sup.2, is taken, for
example, from under the arm and requires about one minute to
remove. The sample is processed, resulting in isolation of the
patient's cells (in this case, fibroblasts) and genetically
engineered to produce EPO. Based on the age, weight, and clinical
condition of the patient, the required number of cells is grown in
large-scale culture. The entire process usually requires 4-6 weeks
and, at the end of that time, the appropriate number of
genetically-engineered cells is introduced into the individual
(e.g., by injecting them back under the patient's skin). The
patient is now capable of producing his or her own EPO or
additional EPO.
[0048] Transfected cells, produced as described above, which
contain insulinotropin-encoding DNA are delivered into an
individual in whom insulin production, secretion, function, and/or
sensitivity is compromised. They are introduced into the individual
by known methods and at various sites of administration (e.g.,
renal, subcapsular, subcutaneous, central nervous system (including
intrathecal), intravascular, intrahepatic, intrasplanchnic,
intraperitoneal (including intraomental) or intramuscular
implantation). Once implanted in the individual, the transfected
cells produce insulinotropin encoded by the exogenous DNA. For
example, an individual in whom insulin production, secretion or
sensitivity is impaired can receive therapy or preventive treatment
through the implantation of transfected cells expressing exogenous
DNA encoding insulinotropin produced as described herein. The cells
to be genetically engineered are obtained as described above for
EPO, processed in a similar manner to produce sufficient numbers of
cells, and introduced back into the individual.
[0049] As this example suggests, the cells used will generally be
patient-specific, genetically-engineered cells. It is possible,
however, to obtain cells from another individual of the same
species or from a different species. Use of such cells might
require administration of an immunosuppressant, alteration of
histocompatibility antigens, or use of a barrier device to prevent
rejection of the implanted cells.
[0050] In one embodiment, a barrier device is used to prevent
rejection of implanted cells obtained from a source other than the
recipient (e.g., from another human or from a non-human mammal such
as a cow, dog, pig, goat, sheep, or rodent). In this embodiment,
transfected cells of the present invention are placed within the
barrier device, which is made of a material (e.g., a membrane such
as Amicon XM-50) which permits the product encoded by the exogenous
DNA to pass into the recipient's circulation or tissues but
prevents contact between the cells and the recipient's immune
system and thus prevents an immune response to (and possible
rejection of) the cells by the recipient. Alternatively, DNA
encoding EPO or insulinotropin can be introduced into an individual
by direct injection, such as into muscle or other appropriate site.
In this embodiment, the DNA construct includes exogenous DNA
encoding the therapeutic product (e.g., EPO, insulinotropin) and
sufficient regulatory sequences for expression of the exogenous DNA
in recipient cells. After injection into the individual, the DNA
construct is taken up by some of the recipient cells. The DNA can
be injected alone or in a formulation which includes a
physiologically compatible carrier (e.g., a physiological buffer)
and, optionally, other components, such as agents which allow more
efficient entry of the DNA construct into cells, stabilize the DNA
or protect the DNA from degradation.
Uses of Transfected Primary and Secondary Cells and Cell
Strains
[0051] Transfected primary or secondary cells or cell strains have
wide applicability as a vehicle or delivery system for EPO. The
transfected primary or secondary cells of the present invention can
be used to administer EPO, which is presently administered by
intravenous injection. When transfected primary or secondary cells
are used, there is no need for extensive purification of the
polypeptide before it is administered to an individual, as is
generally necessary with an isolated polypeptide. In addition,
transfected primary or secondary cells of the present invention
produce the therapeutic product as it would normally be
produced.
[0052] An advantage to the use of transfected primary or secondary
cells of the present invention is that by controlling the number of
cells introduced into an individual, one can control the amount of
EPO. In addition, in some cases, it is possible to remove the
transfected cells if there is no longer a need for the product. A
further advantage of treatment by use of transfected primary or
secondary cells of the present invention is that production can be
regulated, such as through the administration of zinc, steroids, or
an agent which affects transcription of the EPO-encoding DNA.
[0053] Glucagon-like peptide 1 (GLP-1) and glucagon-like peptide 1
derivatives (GLP-1 derivatives) are additional molecules that can
be delivered therapeutically using the in vivo protein production
and delivery system described the present invention. GLP-1
derivatives include truncated derivatives GLP-1 (7-37), GLP-1
(7-36), GLP-1 (7-35), GLP-1 (7-34) and other truncated
carboxyl-terminal amidated derivatives and derivatives of GLP-1
which have amino acid substitutions, deletions, additions, or other
alterations (e.g., addition of a non-amino acid component) which
result in biological activity or stability in the blood which is
substantially the same as that of a truncated GLP-1 derivative or
enhanced biological activity or stability in the blood (greater
than that of a truncated GLP-1 derivative). As used herein, the
term GLP-1 derivative includes all of the above-described
molecules. The term GLP-1 related peptide, as used herein, includes
GLP-1 and GLP-1 derivatives. GLP-1 derivatives, also known as
insulinotropins or incretins, are normally secreted into the
circulation by cells in the gastrointestinal tract. In vivo studies
have demonstrated that these peptides function to stimulate insulin
secretion and inhibit glucagon secretion from the endocrine
pancreas, as well as increase insulin sensitivity in peripheral
tissues [Goke, R. et al. (1991) Eur. J. Clin. Inv. 21:135-144;
Gutniak, M. et al. (1992) New Engl. J. Med. 326:1316-1322].
Patients with non-insulin dependent diabetes mellitus (NIDDM) are
often treated with high levels of insulin to compensate for their
decreased insulin sensitivity. Thus, the stimulation of insulin
release and the increase in insulin sensitivity by GLP-1
derivatives would be beneficial for NIDDM patients. Of particular
importance is the fact that the insulinotropin-induced stimulation
of insulin secretion is strongly dependent on glucose levels,
suggesting that these peptides act in response to increases in
blood glucose in vivo to potentiate insulin release and,
ultimately, lower blood glucose.
[0054] The present invention will now be illustrated by the
following examples, which are not intended to be limiting in any
way.
EXAMPLES
Example 1
Isolation of Fibroblasts
[0055] a. Source of Fibroblasts
[0056] Human fibroblasts can be obtained from a variety of tissues,
including biopsy specimens derived from liver, kidney, lung and
skin. The procedures presented here are optimized for the isolation
of skin fibroblasts, which are readily obtained from individuals of
any age with minimal discomfort and risk (embryonic and fetal
fibroblasts may be isolated using this protocol as well). Minor
modifications to the protocol can be made if the isolation of
fibroblasts from other tissues is desired.
[0057] Human skin is obtained following circumcision or punch
biopsy. The specimen consists of three major components: the
epidermal and dermal layers of the skin itself, and a fascial layer
that adheres to the dermal layer. Fibroblasts can be isolated from
either the dermal or fascial layers.
[0058] b. Isolation of Human Fascial Fibroblasts
[0059] Approximately 3 cm.sup.2 tissue is placed into approximately
10 ml of wash solution (Hank's Balanced Salt Solution containing
100 units/ml penicillin G, 100 .mu.g/ml streptomycin sulfate, and
0.5 .mu.g/ml Fungisone) and subjected to gentle agitation for a
total of three 10-minute washes at room temperature. The tissue is
then transferred to a 100 mm tissue culture dish containing 10 ml
digestion solution (wash solution containing 0.1 units/ml
collagenase A, 2.4 units/ml grade II Dispase).
[0060] Under a dissecting microscope, the skin is adjusted such
that the epidermis is facing down. The fascial tissue is separated
from the dermal and epidermal tissue by blunt dissection. The
fascial tissue is then cut into small fragments (less than 1
mm.sup.2) and incubated on a rotating platform for 30 minutes at
37.degree. C. The enzyme/cell suspension is removed and saved, an
additional 10 cc of digestion solution is added to the remaining
fragments of tissue, and the tissue is reincubated for 30 minutes
at 37.degree. C. The enzyme/cell suspensions are pooled, passed
through a 15-gauge needle several times, and passed through a
Cellector Sieve (Sigma) fitted with a 150-mesh screen. The cell
suspension is centrifuged at 1100 rpm for 15 minutes at room
temperature. The supernatant is aspirated and the disaggregated
cells resuspended in 10 ml of nutrient medium (see below).
Fibroblast cultures are initiated on tissue culture treated flasks
(Corning) at a density of approximately 40,000 cells/cm.sup.2.
[0061] c. Isolation of Human Dermal Fibroblasts
[0062] Fascia is removed from skin biopsy or circumcision specimen
as described above and the skin is cut into small fragments less
than 0.5 cm.sup.2. The tissue is incubated with 0.25% trypsin for
60 minutes at 37.degree. C. (alternatively, the tissue can be
incubated in trypsin for 18 hours at 4.degree. C.). Under the
dissecting microscope, the dermis and epidermis are separated.
Dermal fibroblasts are then isolated as described above for fascial
fibroblasts.
[0063] d. Isolation of Rabbit Fibroblasts
[0064] The procedure is essentially as described above. Skin should
be removed from areas that have been shaved and washed with a
germicidial solution and surgically prepared using accepted
procedures.
Example 2
Culturing of Fibroblasts
[0065] a. Culturing of Human Fibroblasts
[0066] When confluent, the primary culture is trypsinized using
standard methods and seeded at approximately 10,000 cells/cm.sup.2.
The cells are cultured at 37.degree. C. in humidified air
containing 5% CO.sub.2. Human fibroblast nutrient medium
(containing DMEM, high glucose with sodium pyruvate, 10-15% calf
serum, 20 mM HEPES, 20 mM L-glutamine, 50 units/ml penicillin G,
and 10 .mu.g/ml streptomycin sulfate) is changed twice weekly.
[0067] b. Culturing of Rabbit Fibroblasts
[0068] The cells are trypsinized and cultured as described for
human fibroblasts. Rabbit fibroblast nutrient medium consists of a
1:1 solution of MCDB-110 (Sigma) with 20% calf serum and
conditioned medium. Conditioned medium is essentially human
fibroblast nutrient medium (with 15% calf serum) removed from
rabbit fibroblasts grown in mass culture for 2-3 days.
Example 3
Construction of a Plasmid (pXEPO1) Containing the Human
Erythropoietin Gene Under the Control of the Mouse Metallothionein
Promoter
[0069] The expression plasmid pXEPO1 has the hEPO gene under the
transcriptional control of the mouse metallothionein (mMT)
promoter. pXEPO1 is constructed as follows: Plasmid pUC19 (ATCC
#37254) is digested with KpnI and BamHI and ligated to a 0.7 kb
KpnI-BglII fragment containing the mouse metallothionein promoter
[Hamer, D. H. and Walling, M., J. Mol. Appl. Gen., 1:273-288
(1982). This fragment can also be isolated by known methods from
mouse genomic DNA using PCR primers designed from analysis of mMT
sequences available from Genbank; i.e. MUSMTI, MUSMTIP, MUSMTIPRM].
The resulting clone is designated pXQM2.
[0070] The hEPO gene was isolated by from a bacteriophage lambda
clone containing the entire hEPO gene. This bacteriophage was
isolated by screening a human Sau3Apartial genomic DNA library
(Stratagene) constructed in the lambda vector LAMBDA DASH with 0.77
kb fragment of the human gene. This 0.77 kb fragment was amplified
from human genomic DNA using the primers shown below in the
polymerase chain reaction (PCR).
Human EPO PCR Primers:
TABLE-US-00001 [0071] Oligo hEPO-1: (SEQ ID NO: 1)
5'GTTTGCTCAGCTTGGTGCTTG (positions 2214-2234 in the Genbank HUMERPA
sequence) Oligo hEPO-2: (SEQ ID NO: 2) 5'TCAAGTTGGCCCTGTGACAT
(positions 2986-2967 in the Genbank HUMERPA sequence)
[0072] The amplified fragment, encompassing exons 4 and 5 of the
human EPO gene, was radiolabelled and used to screen the human
genomic DNA library. Phage with a 5.4 kb HindIII-BamHI fragment
containing the entire human EPO gene were assumed to contain the
entire gene, based on published DNA sequence and restriction enzyme
mapping data [Lin, F-K., et al., Proc. Natl. Acad. Sci. USA,
82:7580-7584 (1985)].
[0073] A 4.8 kb BstEII-BamHI fragment (BstEII site is at position
580 in Genbank HUMERPA sequence; the BamHI site is 4.8 kb 3' of
this site, outside of the sequenced region) was isolated from the
bacteriophage clone. The purified fragment is made blunt-ended by
treatment with the Klenow fragment of E. coli DNA polymerase and
ligated to HincII digested pXQM2, which cuts in the pUC19-derived
polylinker adjacent to the 3' side of the subcloned mMT promoter.
One orientation, in which the ablated BstEII site is proximal to
the mMT promoter, was identified by restriction mapping and
designated pXEPO1 (FIG. 1).
Example 4
Transfection of Primary and Secondary Fibroblasts with Exogenous
DNA and a Selectable Marker Gene by Electroporation and
Microinjection
[0074] To prepare cells for electroporation, exponentially growing
or early stationary phase fibroblasts are trypsinized and rinsed
from the plastic surface with nutrient medium. An aliquot of the
cell suspension is removed for counting, and the remaining cells
are subjected to centrifugation as described above. The supernatant
is aspirated and the pellet is resuspended in 5 ml of
electroporation buffer (20 mM HEPES pH 7.3, 137 mM NaCl, 5 mM KCl,
0.7 mM Na.sub.2HPO.sub.4, 6 mM dextrose). The cells are
recentrifuged, the supernatant aspirated, and the cells resuspended
in electroporation buffer containing 1 mg/ml acetylated bovine
serum albumin. The final cell suspension contains approximately
3.times.10.sup.6 cells/ml. Electroporation should be performed
immediately following resuspension.
[0075] Supercoiled plasmid DNA is added to a sterile cuvette with a
0.4 cm electrode gap (Bio-Rad). The final DNA concentration is
generally at least 120 .mu.g/ml. 0.5 ml of the cell suspension
(containing approximately 1.5.times.10.sup.6 cells) is then added
to the cuvette, and the cell suspension and DNA solutions are
gently mixed. Electroporation is performed with a Gene-Pulser
apparatus (Bio-Rad). Capacitance and voltage are set at 960 .mu.F
and 250-300 V, respectively. As voltage increases, cell survival
decreases, but the percentage of surviving cells that stably
incorporate the introduced DNA into their genome increases
dramatically. Given these parameters, a pulse time of approximately
14-20 msec should be observed.
[0076] Electroporated cells are maintained at room temperature for
approximately 5 minutes, and the contents of the cuvette are then
gently removed with a sterile transfer pipette. The cells are added
directly to 10 ml of prewarmed nutrient media (as above with 15%
calf serum) in a 10 cm dish and incubated as described above. The
following day, the media is aspirated and replaced with 10 ml of
fresh media and incubated for a further 16-24 hours. Subculture of
cells to determine cloning efficiency and to select for
G418-resistant colonies is performed the following day. Cells are
trypsinized, counted and plated; typically, fibroblasts are plated
at 10.sup.3 cells/10 cm dish for the determination of cloning
efficiency and at 1-2.times.10.sup.4 cells/10 cm dish for G418
selection.
[0077] Human fibroblasts are selected for G418 resistance in medium
consisting of 300-400 .mu.g/ml G418 (Geneticin, disulfate salt with
a potency of approximately 50%; Gibco) in fibroblasts nutrient
media (with 15% calf serum). Cloning efficiency is determined in
the absence of G418. The plated cells are incubated for 12-14 days,
at which time colonies are fixed with formalin, stained with
crystal violet and counted (for cloning efficiency plates) or
isolated using cloning cylinders (for G418 plates). Electroporation
and selection of rabbit fibroblasts is performed essentially as
described for human fibroblasts, with the exception of the nutrient
media used. Rabbit fibroblasts are selected for G418 resistance in
medium containing 1 mg/ml G418.
[0078] Fibroblasts were isolated from freshly excised human
foreskins. Cultures were seeded at 50,000 cells/cm.sup.2 in
DMEM+10% calf serum. When cultures became confluent fibroblasts
were harvested by trypsinization and transfected by
electroporation. Electroporation conditions were evaluated by
transfection with the plasmid pcDNEO. A representative
electroporation experiment using near optimal conditions (60 .mu.g
of plasmid pcDNEO at an electroporation voltage of 250 volts and a
capacitance setting of 960 .mu.Farads) resulted in one G418.sup.r
colony per 588 treated cells (0.17% of all cells treated), or one
G418.sup.r colony per 71 clonable cells (1.4%).
[0079] When nine separate electroporation experiments at near
optimal conditions (60 .mu.g of plasmid pcDNEO at an
electroporation voltage of 300 volts and a capacitance setting of
960 .mu.Farads) were performed, an average of one G418.sup.r colony
per 1,899 treated cells (0.05%) was observed, with a range of 1/882
to 1/7,500 treated cells. This corresponds to an average of one
G418.sup.R colony per 38 clonable cells (2.6%).
[0080] Low passage primary human fibroblasts were converted to hGH
expressing cells by co-transfection with plasmids pcDNEO and pXGH5
[Selden, R. F. et al., Mol. Cell. Biol., 6:3173-3179 (1986)].
Typically, 60 .mu.g of an equimolar mixture of the two plasmids
were transfected at near optimal conditions (electroporation
voltage of 300 volts and a capacitance setting of 960 .mu.Farads).
The results of such an experiment resulted in one G418.sup.r colony
per 14,705 treated cells.
[0081] hGH expression data for these and other cells isolated under
identical transfection conditions are summarized below. Ultimately,
98% of all G418.sup.r colonies could be expanded to generate mass
cultures.
TABLE-US-00002 Number of G418.sup.r Clones 154 Analyzed Number of
G418.sup.r/hGH 65 Expressing Clones Average hGH Expression Level
2.3 .mu.g hGH/10.sup.6 Cells/24 hours Maximum hGH Expression Level
23.0 .mu.g hGH/10.sup.6 Cells/24 hours
[0082] Stable transfectants also have been generated by
electroporation of primary or secondary human fibroblasts with
pXGH301, a DNA construct in which the neo and hGH genes are present
on the same plasmid molecule (Example 3). For example,
1.5.times.10.sup.6 cells were electroporated with 60 .mu.g pXGH301
at 300 volts and 960 .mu.Farads. G418 resistant colonies were
isolated from transfected secondary fibroblasts at a frequency of
652 G418 resistant colonies per 1.5.times.10.sup.6 treated cells (1
per 2299 treated cells). Approximately 59% of these colonies
express hGH.
[0083] Primary and secondary human fibroblasts can also be
transfected by direct injection of DNA into cell nuclei. The
ability of primary and secondary human foreskin fibroblasts to be
stably transfected by this method has not been previously reported.
The 8 kb HindIII fragment from plasmid RV6.9h (Zheng, H. et al.,
Proc. Natl. Acad. Sci. USA 88:18 8067-8071 (1991)) was purified by
gel electrophoresis and passage through an anion exchange column
(QIAGEN Inc.). DNA at (10 .mu.g/ml) was injected into primary or
secondary human foreskin fibroblasts using 0.1 .mu.m outer diameter
glass needles. 41 G418.sup.r clones were isolated after injection
of 2,000 cells (1 in 49 starting cells).
[0084] hGH expressing clones were also generated by microinjection.
Plasmid pXGH301 (FIG. 3) was linearized by ScaI digestion (which
cuts once within the amp.sup.r gene in the pUC12 backbone),
purified by passage through an anion exchange column (QIAGEN Inc.),
and injected into secondary human foreskin fibroblasts using 0.1
.mu.m outer diameter glass needles. Several DNA concentrations were
used, ranging from 2.5-20 .mu.g pXGH301/ml. Twenty G418 resistant
clones were isolated after microinjection into 2,100 cells (1 in
10.sup.5 starting cells). The fraction of G418.sup.r cells, is
approximately 1% of all cells treated. Nine of 10 clones analyzed
were expressing hGH, with average hGH expression being 0.6
.mu.g/10.sup.6 cells/24 hours for clones isolated in this
experiment, and 3 clones were expanded for studying long-term
expression of hGH. All 3 were expressing hGH stably, with hGH still
being produced through 33, 44, and 73 mpd for the 3 strains,
respectively.
Example 5
In Vitro hEPO Production by Transfected Secondary Human and Rabbit
Skin Fibroblasts
[0085] 1. Human Skin Fibroblasts
[0086] Fibroblasts were isolated from freshly excised human skin
fibroblasts and cultured in DMEM+15% calf serum. Electroporation
(250 volts, 960 .mu.Farads) with 60 .mu.g of an equimolar mixture
of pcDNEO and pXEPO1 was performed on passage 1 cells and treated
cells were selected in G418-containing medium (300 .mu.g/ml G418).
Colonies were isolated and expanded using standard methods. Data
derived from an analysis of fifty-six individual clones is shown in
Table 1 below. Cells were maintained in G418 (300 .mu.g/ml G418) in
DMEM+15% calf serum and subcultured at a seeding density of 10,000
cells/cm.sup.2. Culture medium was changed 24 hours prior to
harvesting the cells for passaging. At the time of passage, an
aliquot of the culture medium was removed for hEPO assay and the
cells were then harvested, counted, and reseeded. hEPO
concentration in the medium was determined using a commercially
available ELISA (R & D Systems). hEPO levels are expressed as
mU/10.sup.6 cells/24 hours, and expression levels ranged from 69 to
55,591 mU/10.sup.6 cells/24 hours 19% of all G418-resistant
colonies expressed detectable levels of hEPO.
TABLE-US-00003 TABLE 1 hEPO EXPRESSION IN FIFTY-SIX INDEPENDENT
SECONDARY HUMAN FIBROBLAST CLONES ISOLATED BY CO-TRANSFECTION WITH
pcDNEO AND pXEPO1 HEPO Expression Level (mU/10.sup.6 cells/24
hours) Number of Clones <1,000 10 1,000-10,000 28 10,000-50,000
17 >50,000 1
[0087] Clonally derived human fibroblasts isolated by
co-transfection with pcDneo and pXEPO1 were analyzed for the
glycosylation state of secreted hEPO. Media was collected from hEPO
producing cells and immunoprecipitated with a mouse monoclonal
antibody (Genzyme Corporation) specific for human erythropoietin.
The immunoprecipitated material was subject to electrophoresis on a
12.5% polyacrylamide gel and transferred to a PVDF membrane
(Millipore). The membrane was probed with the same anti-hEPO
monoclonal antibody used for immunoprecipitation and was
subsequently treated with an HRP-conjugated sheep anti-mouse IgG
antisera (Cappel), followed by luminescent detection (ECL Western
blotting detection kit; Amersham) to visualize hEPO through the
production of a fluorescent product.
[0088] As shown in FIG. 5A, a molecule with a molecular mass of
approximately 34 kd reacts with an antibody specific for human
erythropoietin. This is the expected size for naturally occurring,
fully glycosylated human erythropoietin.
[0089] hEPO produced by transfected human fibroblast clones was
further analyzed to determine if the secreted material had both N-
and O-linked glycosylation characteristic of natural human
erythropoietin isolated from urine or recombinant hEPO produced by
chinese hamster ovary cells. FIG. 5B shows a Western blot of the
untreated cell supernatant (lane 1), the supernatant treated with
endoglycosidase-F [(New England Nuclear); lane 2], the supernatant
treated with neuraminidase [Genzyme); (lane 3)], and the
supernatant treated with O-glycanase [(Genzyme); (lane 4)].
Treatment with endoglycosidase-F results in a shift in molecular
weight from 34 kd to approximately 27 kd. Treatment with
neuraminidase results in a barely detectable shift in band
position, while treatment with O-glycanase further shifts the size
of the immunoreactive band down to approximately 18.5 kd. These
results are indistinguishable from those obtained with natural
human erythropoietin isolated from urine or recombinant hEPO
produced by Chinese hamster ovary cells (Browne, J. K. et al., Cold
Spring Harbor Symp. Quant. Biol. 51:693-702 (1986)).
[0090] 2. Rabbit Fibroblasts
[0091] Fibroblasts were isolated from freshly excised rabbit skin
and cultured in DMEM 10% calf serum. Electroporation (250 volts,
960 .mu.Farads) with 60 .mu.g of an equimolar mixture of pcDNEO and
pXEPO1 was performed and treated cells were selected in
G418-containing rabbit fibroblast growth medium (1 mg/ml G418;
Example 2). Colonies were isolated and expanded using standard
methods, and the resulting secondary cell strains were analyzed for
hEPO expression. Data derived from forty-nine independent rabbit
fibroblast clones is shown in Table 2, below. Expression levels in
these clones ranged from 43 to 2,900,000 mU/10.sup.6 cells/24
hours, and 72% of all G418-resistant clones expressed detectable
levels of hEPO.
TABLE-US-00004 TABLE 2 hEPO EXPRESSION IN FORTY-NINE INDEPENDENT
SECONDARY RABBIT FIBROBLAST CLONES ISOLATED BY CO-TRANSFECTION WITH
pcDNEO AND pEEPO HEPO Expression Level (mU/10.sup.6 cells/24 hours)
Number of Clones <1,000 1 1,000-10,000 3 10,000-50,000 7
50,000-500,000 19 >500,000 19
Example 6
Construction of a Plasmid Containing Both the Human EPO Gene and
the Neomycin Resistance Gene
[0092] A 6.9 kb HindIII fragment extending from positions
11,960-18,869 in the HPRT sequence [Genbank entry HUMHPRTB;
Edwards, A. et al., Genomics, 6:593-608 (1990)] and including exons
2 and 3 of the HPRT gene, is subcloned into the HindIII site of
pUC12. The resulting clone is cleaved at the unique Xho1 site in
exon 3 of the HPRT gene fragment and the 1.1 kb SaII-XhoI fragment
containing the neo gene from pMC1NEO (Stratagene) is inserted,
disrupting the coding sequence of exon 3. One orientation, with the
direction of neo transcription opposite that of HPRT transcription
was chosen and designated pE3Neo. pE3neo has a unique XhoI site at
the junction of HPRT sequences and the 5' side of the neogene.
pE3neo is cut with XhoI and made blunt-ended by treatment with the
Klenow fragment of E. coli DNA polymerase.
[0093] To insert the hEPO gene into the neo selection plasmid
pE3Neo, a 5.1 kb EcoRI-HindIII fragment was isolated from plasmid
pXEPO1 (Example 3; FIG. 1). The EcoRI site is located adjacent to
the 5' side of the mMT promoter, and the HindIII site is located
5.1 kb away, 3' to the hEPO coding region. The purified Fragment is
made blunt-ended by treatment with Klenow fragment of E. coli DNA
polymerase and ligated to the XhoI digested and blunt-ended pE3neo
fragment described above. After transformation into E. coli, a
plasmid with one copy of the mMT-hEPO fragment inserted into pE3neo
was identified by restriction enzyme analysis in which the hEPO
gene is transcribed in the same orientation as the adjacent
neogene. This plasmid was designated pE3neoEPO. In addition to
allowing direct selection of hEPO expressing G418.sup.r clones,
this fragment may also be used in gene targeting to direct the
integration of the hEPO gene to the human HPRT locus.
Example 7
Isolation of Human Fibroblast Clones Expressing hEPO Gene and a
Selectable Marker (pE3neoEPO)
[0094] Fibroblasts were isolated from freshly excised human skin
fibroblasts and cultured in DMEM+15% calf serum. Electroporation
(250 volts, 960 .mu.Farads) with 60 .mu.g of supercoiled pE3neoEPO
was performed on passage 1 cells and treated cells were selected in
G418-containing medium (300 .mu.g/ml G418). Colonies were isolated
and expanded using standard methods. Data derived from an analysis
of twenty-six individual clones is shown in Table 3, below. Cells
were maintained in G418 (300 .mu.g/ml G418) in DMEM+15% calf serum
and subcultured at a seeding density of 10,000 cells/cm.sup.2.
Culture medium was changed 24 hours prior to harvesting the cells
for passaging. At the time of passage an aliquot of the culture
medium was removed for hEPO assay and the cells were then
harvested, counted, and reseeded. hEPO concentration in the medium
was determined using a commercially available ELISA (R and D
Systems). hEPO levels are expressed as mU hEPO/10.sup.6 cells/24
hours, and expression levels ranged from 240 to 961,620 mU/10.sup.6
cells/24 hours 89% of all G418-resistant clones expressed
detectable levels of hEPO.
TABLE-US-00005 TABLE 3 hEPO EXPRESSION IN TWENTY-SIX INDEPENDENT
SECONDARY HUMAN FIBROBLAST CLONES ISOLATED BY CO-TRANSFECTION WITH
pE3neo-EPO HEPO Expression Level (mU/10.sup.6 cells/24 hours)
Number of Clones <1,000 2 1,000-10,000 2 10,000-50,000 9
50,000-500,000 12 >500,000 1
[0095] hEPO expressing human fibroblast clones are also isolated by
electroporation with 60 .mu.g of HindIII digested pE3neoEPO. hEPO
expressing rabbit fibroblast clones are isolated using plasmid
pE3neoEPO under identical transfection conditions, with the
exception that rabbit fibroblast clones are selected in rabbit
fibroblast growth medium (Example 2) containing 1 mg/ml G418.
Example 8
Isolation of Transfectants in the Absence of Selection
[0096] The high frequency of transfection in human fibroblasts
(greater than 1% stable transfectant per clonable cell; Example 4)
indicates that it should be possible to isolate cell clones that
have stably incorporated exogenous DNA without the use of a
selective agent. Stable transfection of primary fibroblasts with
the plasmid pXEPO1 should render recipient fibroblasts capable of
secreting human erythropoietin into the surrounding medium.
Therefore, an ELISA for hEPO (or for any expressed protein of
therapeutic interest) can be used as a simple and rapid screen for
transfectants. Alternatively, it should be possible to determine
the true frequency of stable integration of exogenous DNA using a
screening method such as PCR which does not necessarily rely on
expression of transfected DNA.
[0097] 1. Primary Human Fibroblasts
[0098] Approximately 2.0.times.10.sup.6 human cells that were
freshly dissociated from tissue are electroporated with 60 .mu.g of
pXEPO1 at 300 volts, 960 .mu.Farads. Cells are plated immediately
in a 100 mm tissue culture dish containing 10 ml of prewarmed
medium and incubated at 37.degree. C. in a humidified 5% CO.sub.2
atmosphere. Two days following transfection, 5.times.10.sup.3 cells
are subcultured into a 24 well cloning plate (Bellco Glass Co.).
Each well of the 24 well plate contained 16 smaller wells (384
wells/plate). Eight days after plating into the 24 large wells,
media is screened for hEPO expression via ELISA. A second,
confirming assay, is done in which media from wells exhibiting hEPO
expression is aspirated out, replaced with fresh media and assayed
for hEPO 24 hours later. Colony counts at this stage should reveal
approximately 10 colonies per large well.
[0099] Individual colonies in each of the 16 small wells within one
of the hEPO-positive larger wells are trypsinized and transferred
to wells of a 96 well plate. Three days later each of those wells
are assayed for hEPO expression. Cells from hEPO positive cells are
expanded for further study. This experiment may also be performed
using secondary human foreskin fibroblasts.
[0100] 2. Primary Rabbit Fibroblasts
[0101] Passage 1 rabbit skin cells were transfected with pXEPO1.
The electroporation conditions were identical to the human tissue
electroporation described above. 1.times.10.sup.3 cells are
subcultured into a 384 well plate. Seven days later hGH assays are
performed on media from each of the 24 large wells. Cells in each
of the small wells in hEPO-positive large wells are trypsinized and
transferred to wells of a 96 well plate. Three days later each of
these wells are assayed for hEPO expression. Cells from hEPO
positive cells are expanded for further study. This experiment may
also be performed using secondary rabbit skin fibroblasts.
Example 9
Stable Transfection of Primary Human Fibroblasts by
Microinjection
[0102] Direct injection of DNA into cell nuclei is another method
for stably transfecting cells. The ability of primary and secondary
human foreskin fibroblasts to be stably transfected by this method
is described in Example 4, but has not been previously reported in
the literature. The 13.1 kb HindIII fragment from plasmid pE3neoEPO
is purified by gel electrophoresis and passed through an anion
exchange column (QIAGEN Inc.). This fragment contains the human EPO
and bacterial neo genes, flanked on both sides with human HPRT
sequences. DNA at (10 .mu.g/ml) is injected into primary or
secondary human foreskin fibroblasts using 0.1 .mu.m diameter glass
needles. G418.sup.r clones are isolated approximately 12-14 days
after injection. Alternatively, the total HindIII digest of
pE3neoEPO, as well as linearized or supercoiled pE3neoEPO may be
injected to isolate hEPO expressing cells.
Example 10
Expression of Biologically Active Human Erythropoietin in Mice
[0103] The mouse provides a valuable system to study implants of
genetically engineered cells for their ability to deliver
therapeutically useful proteins to an animal's general circulation.
The relative immunoincompetence of nude mice allow xenogeneic
implants to retain biologic function and may allow certain primary
and secondary rabbit fibroblasts to survive in vivo for extended
periods.
[0104] For implantation of cells into the subrenal capsule, mice
are given intraperitoneal injection of Avertin at a dose of 0.0175
ml/g body weight. The kidney (generally the left kidney) is
approached through an 8-10 mm incision made approximately 3 mm
below the rib cage. The skin, abdominal musculature, peritoneum,
and peri-renal fascia are retracted to expose the kidney. A small
forcept is used to pull the kidney out of the abdominal cavity. A
27-gauge hypodermic needle is used to make a small opening in the
renal capsule. Using a 20-gauge I.V. catheter, cells to be
implanted (typically 3 million cells in a volume of 5-10 .mu.l) are
withdrawn into a 1 ml syringe and slowly ejected under the renal
capsule. Care is taken to ensure that the cells are released distal
to the opening in the renal capsule. The incision is closed with
one staple through the musculature and the skin. Blood is collected
after placing the mouse in a large beaker containing methoxyflurane
until light anesthesia is achieved. The tip of a Pasteur pipette is
placed between the eye and the periorbital space to collect blood
from the orbital sinus. Serum hEPO levels are determined using a
commercially available kit (R and D Systems). An aliquot of blood
is also drawn into EDTA coated capillary tubes (Statspin, Norwood,
Mass.) for determination of hematocrit levels.
[0105] A clonal strain of rabbit skin fibroblasts was isolated by
the methods described in Example 5. One clone, designated RF115-D4,
was determined to be stably transfected with the human EPO gene and
expressed approximately 786,000 mU hEPO/10.sup.6 cells/24 hours.
Three million cells were implanted into the subrenal capsule in
each of six nude mice. Approximately 400 .mu.l of blood was drawn
on days 1 and 7 after implantation and on every other day
thereafter until day 21. During this time an equal volume of saline
solution was injected after bleeding to prevent hypotonic shock.
Blood was drawn weekly there after until day 63. An identical
bleeding schedule was used on ten mice that had no cells implanted.
FIG. 6A shows the effect of these treatments on blood hematocrit
(HCT), a commonly used indicator of red blood cell number, in
implanted and control animals. In control animals, HCT drops
dramatically by day 7, followed by a return to approximately normal
levels by day 15. In contrast, animals receiving implants of the
hEPO expressing cells showed elevated HCT levels by day 7. HCT
remained elevated through day 63, reaching a peak of 64%, or 1.4
times higher than the day 1 level of 45%, on day 35 after
implantation. As shown in FIG. 6B, immunoreactive hEPO was readily
detectable in the blood of implanted animals (the sensitivity of
the hEPO ELISA has been determined to be 2 mU/ml by the kit's
manufacturer (R and D Systems) and endogenous mouse EPO shows no
cross-reactivity with the antibodies used in the ELISA kit). hEPO
levels in the implanted animals dropped gradually, from 29 to 9
mU/ml, from days 7 to 63 postimplantation.
[0106] This Example clearly demonstrates that normal skin
fibroblasts that have been genetically engineered to express and
secrete hEPO can: 1) survive in vivo to deliver hEPO to an animals
systemic circulation for up to 2 months, and 2) the hEPO produced
is biologically functional, serving to prevent the drop in
hematocrit observed in the frequently bled control animals, and
resulting in a net increase in HCT even when animals were
challenged with a bleeding schedule that produces an anemic
response in control animals.
Example 11
Expression of GLP-1 (7-37) from Secondary Human Skin Fibroblasts
Strains after Transfection with a GLP-1 (7-37) Expression
Plasmid
[0107] The portion of GLP-1 from amino acid residues 7 to 37 [GLP-1
(7-37); encoded by base pairs 7214 to 7306 in Genbank sequence
HUMGLUCG2] has been demonstrated to have insulinotropin activity in
vivo. Plasmid pXGLP1 is constructed such that the GLP-1 (7-37)
moiety is fused at its N-terminus to a 26 amino acid signal peptide
derived from human growth hormone for efficient transport through
the endoplasmic reticulum. The fusion protein is cleaved
immediately C-terminal to residue 26 prior to secretion, such that
the secreted product consists solely of residues 7-37 of GLP-1.
Expression of the signal peptide: GLP-1 (1-37) fusion protein is
controlled by the mouse metallothionein promoter.
[0108] Plasmid pXGLP1 is constructed as follows: Plasmid PXGH5
[Selden, R. F. et al., Mol. Cell. Biol. 6:3173-3179 (1986)] is
digested with SmaI and ligated to a double-stranded oligonucleotide
containing a BglII site (BglII linkers; New England Biolabs). The
ligated product is digested with BglII and EcoRI and the 0.32 kb
fragment corresponding to the 3'-untranslated region of the human
growth hormone gene is isolated (with a BglII linker attached to
the SmaI site lying at position 6698 in Genbank entry HUMGHCSA).
The hGH fragment can also be isolated by known methods from human
genomic DNA using PCR primers designed to amplify the sequence
between positions 6698 to 7321 in Genbank entry HUMGHCSA. A 1.45
EcoRI-BglII fragment containing the mouse metallothionein (mMT)
promoter [Hamer, D. H. and Walling, M., J. Mol. Appl. Gen.,
1:273-288 (1982)] is next isolated. The mouse metallothionein
promoter may be isolated by known methods from mouse genomic DNA
using PCR primers designed from analysis of mMT sequences available
from Genbank (i.e. Genbank entries MUSMTI, MUSMTIP, and MUSMTIPRM).
Plasmid pUClg (ATCC #37254) is digested with EcoRI and treated with
bacterial alkaline phosphatase. The treated plasmid is ligated with
the hGH and mMT fragments described above. The resulting plasmid
has a single copy of each the mouse metallothionein promoter and
the 3' untranslated region of hGH joined at a BglII site. This
plasmid, designated pX1 is digested with BglII and the full-length
linear product is purified by gel electrophoresis.
[0109] Oligonucleotides 11.1 and 11.2 are used to amplify a DNA
sequence encoding amino acids 7-37 of GLP-1 from human genomic DNA
by PCR. The amplified product (104 bp) is purified and mixed with
pXGH5 and oligonucleotides 11.2, 11.3, 11.4, and 11.5 and subject
to PCR. Oligonucleotides 11.3 and 11.4 are complementary and
correspond to the desired junction between the hGH signal peptide
and GLP-1 amino acid residue 7. The 500 base pair amplification
product contains 5'-untranslated, exon 1, intron 1, and part of
exon 2 sequences from hGH (nucleotides 5168 to 5562 in Genbank
entry HUMGHCSA) fused to a sequence encoding GLP-1 residues 7-37
followed by a stop codon. The fragment, by design, is flanked on
both ends by BamHI sites. The fragment is cleaved with BamHI and
ligated to the BglII digest of pX1 described above. Ligation
products are analyzed to identify those with one copy of the
hGH-GLP-1 (7-37) fusion product inserted at the BglII site
separating the mMT promoter and the 3'-untranslated hGH sequence in
pX1, such that GLP-1 residue 37 is distal to the mMT promoter.
TABLE-US-00006 OLIGONUCLEOTIDES FOR AMPLIFICATION OF hGH-GLP-1
(7-37) FUSION GENE 11.1 5'CATGCTGAAG GGACCTTTAC CAGT (SEQ ID NO: 3)
11.2 5'TTGGATCCTT ATCCTCGGCC TTTCACCAGC CA (SEQ ID NO: 4) BamHI
11.3 5'GGCTTCAAGA GGGCAGTGCC CATGCTGAAG GGACCTTTAC CAGT (SEQ ID NO:
5) 11.4 5'ACTGGTAAAG GTCCCTTCAG CATGGGCACT GCCCTCTTGA AGCC (SEQ ID
NO: 6) 11.5 5'AAGGATCCCA AGGCCCAACT CCCCGAAC (SEQ ID NO: 7) BamHI
11.6 5'TTGGATCCTT ATCGGCC TTTCACCAGC CA (SEQ ID NO: 8) BamHI
[0110] Alternatively, the small sizes of the signal peptide and
GLP-1 moieties needed allow complete fusion genes to be prepared
synthetically. DNA encoding the signal peptides of the LDL receptor
(amino acid residues 1-21), preproglucagon (amino acid residues
1-20), or human growth hormone (amino acid residues 1-26) may be
synthesized by known methods and ligated in vitro to similarly
synthesized DNA encoding amino acids 7-37 or 7-36 of GLP-1
(followed immediately by a stop codon). The sequences necessary to
design and synthesize these molecules are readily available in
Genbank entries HUMLDLRO1 (human LDL receptor), HUMGLUCG2 (human
GLP-1 and glucagon sequences) and HUMGHCSA (human growth hormone).
The ligated product may be inserted into a suitable mammalian
expression vector for use in human fibroblasts. Plasmid pMSG
(Pharmacia LKB Biotechnology, Piscataway, N.J.) is suitable for
this purpose, having 5' and 3' untranslated sequences, a splice
site, a polyA addition site, and an enhancer and promoter for use
in human skin fibroblasts. Alternatively, the ligated product may
be synthesized with an appropriate 5'-untranslated sequence and
inserted into plasmid pX1 described above.
[0111] A second insulinotropic GLP-1 derivative, GLP-1 (7-36), can
be expressed by substituting oligonucleotide 11.6 for
oligonucleotide 11.2 described above. All subsequent cloning
operations described above for construction of pXGLP1 are followed,
such that the final product is lacking the C-terminal glycine
residue characteristic of GLP-1 (7-37). Alternatively, this
terminal glycine residue may be removed in vivo by the activity of
a peptidyl-glycine alpha-amidating enzyme to produce the
insulinotropin GLP-1 (7-36) amide.
[0112] Plasmid pXGLP1 is co-transfected into primary human skin
fibroblasts with plasmid pcDNEO exactly as described for pXEPO1 and
pcDNEO in Example 5. Clones are selected in G418-containing medium,
transferred to 96-well plates, and assayed for GLP-1 (7-37)
activity or immunoreactivity in cell supernatants. GLP-1 (7-37)
activity is determined by incubation of cell supernatants with rat
insulinoma RINm5F cells and measuring the ability of the
supernatants to induce insulin secretion from these cells using a
commercially available insulin radioimmunoassay (Coat-a-Count
Insulin, DPC, Los Angeles, Calif.). GLP-1 (7-37) antigen is
determined using a commercially available antisera against GLP-1
(Peninsula Laboratories, Belmont, Calif.). GLP-1 (7-37) positive
clones are expanded for implantation into nude mice as described in
Example 10 and blood samples are taken to monitor serum human GLP-1
(7-37) levels.
[0113] In vivo activity is monitored in fasting animals by
determining the insulinogenic index after intraperitoneal injection
of glucose (1 mg glucose per gram of body weight). Typically,
implanted and non-implanted groups of 32 mice are fasted overnight,
and 28 are injected with glucose. After injection, the 28 mice are
arbitrarily assigned to seven groups of four, and blood sampling
(for serum glucose and insulin) is performed on each group at 5,
10, 20, 30, 45, 60, or 90 minutes post-injection, with the
non-glucose injected group serving as a fasting control. Increases
in the postinjection insulinogenic index (the ration of insulin to
glucose in the blood) in animals receiving GLP-1 (7-37) expressing
cells over non-implanted animals provides in vivo support for the
insulinotropic activity of the expressed peptide.
EQUIVALENTS
[0114] Those skilled in the art will recognize, or be able to
ascertain using not more than routine experimentation, many
equivalents to the specific embodiments of the invention described
herein. Such equivalents are intended to be encompassed by the
following claims.
Sequence CWU 1
1
8131DNAHomo sapiens 1cccatattac gtttgctcag cttggtgctt g
31230DNAHomo sapiens 2cccatattac tcaagttggc cctgtgacat 30334DNAHomo
sapiens 3cccatattac catgctgaag ggacctttac cagt 34442DNAHomo sapiens
4cccatattac ttggatcctt atcctcggcc tttcaccagc ca 42554DNAHomo
sapiens 5cccatattac ggcttcaaga gggcagtgcc catgctgaag ggacctttac
cagt 54654DNAHomo sapiens 6cccatattac actggtaaag gtcccttcag
catgggcact gccctcttga agcc 54738DNAHomo sapiens 7cccatattac
aaggatccca aggcccaact ccccgaac 38839DNAHomo sapiens 8cccatattac
ttggatcctt atcggccttt caccagcca 39
* * * * *