U.S. patent application number 12/352133 was filed with the patent office on 2010-06-03 for methods and materials for the production of d-lactic acid in yeast.
Invention is credited to Catherine Asleson Dundon, Ben Hause, Stacey Olson, Vineet Rajgarhia, Pirkko Suominen.
Application Number | 20100137551 12/352133 |
Document ID | / |
Family ID | 29712012 |
Filed Date | 2010-06-03 |
United States Patent
Application |
20100137551 |
Kind Code |
A1 |
Rajgarhia; Vineet ; et
al. |
June 3, 2010 |
Methods and materials for the production of D-lactic acid in
yeast
Abstract
The present invention relates to biocatalysts that are cells,
optimally of the Crabtree-negative phenotype, comprising expression
vectors encoding genes heterologous to the cell that enable
increased production of organic products. More specifically, the
invention relates to genetically modified Kluyveromyces cells,
methods for making the Kluyveromyces cells, and their use in
production of organic products, particularly D-lactic acid.
Inventors: |
Rajgarhia; Vineet;
(Minnetonka, MN) ; Dundon; Catherine Asleson;
(Minneapolis, MN) ; Olson; Stacey; (St.
Bonifacius, MN) ; Suominen; Pirkko; (Maple Grove,
MN) ; Hause; Ben; (Jordan, MN) |
Correspondence
Address: |
Gary C. Cohn, PLLC
215 E. 96TH ST., #19L
New York
NY
10128
US
|
Family ID: |
29712012 |
Appl. No.: |
12/352133 |
Filed: |
January 12, 2009 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10449978 |
May 30, 2003 |
|
|
|
12352133 |
|
|
|
|
60384333 |
May 30, 2002 |
|
|
|
Current U.S.
Class: |
528/272 ;
435/139; 549/274 |
Current CPC
Class: |
G01N 2333/39 20130101;
C12Q 1/02 20130101; C12N 15/815 20130101; C12N 1/16 20130101; Y02P
20/52 20151101; Y02E 50/10 20130101; C12P 7/56 20130101; C12P 7/625
20130101; C12N 9/0006 20130101 |
Class at
Publication: |
528/272 ;
435/139; 549/274 |
International
Class: |
C12P 7/56 20060101
C12P007/56; C07D 319/12 20060101 C07D319/12; C08G 63/08 20060101
C08G063/08 |
Goverment Interests
[0002] This invention was made with Government support under
Contract No. DE-FC36-00GO10598 awarded by the Department of Energy.
The government has certain rights in this invention
Claims
1. A recombinant yeast cell of a species that does not naturally
accumulate pyruvate, comprising at least one exogenous D-lactate
dehydrogenase gene integrated into its genome, wherein the
D-lactate dehydrogenase gene is operatively linked to functional
promoter and terminator sequences.
2. The recombinant yeast cell of claim 1, which is of the genera
Candida or Kluyveromyces.
3. The recombinant yeast cell of claim 2, wherein the cell is of
the species C. sonorensis or K. marxianus.
4. The recombinant yeast cell of claim 1, wherein the promoter
sequence is at least 90% homologous to a promoter that is native to
the yeast species.
5. The recombinant yeast cell of claim 4, wherein the terminator
sequence is at least 90% homologous to a terminator that is native
to the yeast species.
6. The recombinant yeast cell of claim 4, wherein the yeast species
contains a native PDC gene having a native PDC promoter, and the
promoter sequence is at least 90% homologous to the native PDC
promoter.
7. The recombinant yeast cell of claim 6, wherein the native PDC
gene has a native PDC terminator, and the terminator sequence is at
least 90% homologous to the native PDC terminator.
8. The recombinant yeast cell of claim 7, wherein the native PDC
gene is deleted.
9. The recombinant yeast cell of claim 1, wherein the yeast species
contains a native PDC gene, and the native PDC gene is deleted.
10. The recombinant yeast cell of claim 1, wherein the nucleotide
sequence encodes a D-lactate dehydrogenase protein from
Lactobacillus helveticus, Lactobacillus johnsonii, Lactobacillus
bulgaricus, Lactobacillus delbrueckii, lactobacillus plantarum and
Lactobacillus pentosus.
11. The recombinant yeast cell of claim 10, wherein the promoter is
from a yeast species from the genera Kluyveromyces or
Saccharomyces.
12. The recombinant yeast cell of claim 11, wherein the promoter is
from Kluyveromyces marxianus.
13. The recombinant yeast cell of claim 11, wherein the promoter is
from Saccharomyces cerevisiae.
14. The recombinant yeast cell of claim 1 which exhibits reduced
PDC activity.
15. The recombinant yeast cell of claim 8 wherein the D-LDH gene is
integrated at the locus of the deleted PDC gene.
16. A method for fermenting a carbohydrate to lactic acid
comprising culturing the cell of claim 1 under fermentation
conditions in a medium containing a carbohydrate that is
fermentable by the cell.
17. A method for fermenting a carbohydrate to lactic acid
comprising culturing the cell of claim 8 under fermentation
conditions in a medium containing a carbohydrate that is
fermentable by the cell.
18. A method for fermenting a carbohydrate to lactic acid
comprising culturing the cell of claim 9 under fermentation
conditions in a medium containing a carbohydrate that is
fermentable by the cell.
19. A method for fermenting a carbohydrate to lactic acid
comprising culturing the cell of claim 14 under fermentation
conditions in a medium containing a carbohydrate that is
fermentable by the cell.
20. A method according to the method of claims 16, 17, 18, or 19,
further comprising the step of converting at least a portion of the
lactic acid to lactide.
21. The method of claim 20, further comprising the step of
polymerizing the lactide to form a polylactide polymer or
copolymer.
22. A method for producing lactic acid comprising culturing the
cell of claim 1 under fermentation conditions in a medium
containing a sugar that is fermentable by the cell.
23. A method for producing lactic acid comprising culturing the
cell of claim 8 under fermentation conditions in a medium
containing a sugar that is fermentable by the cell.
24. A method for producing lactic acid comprising culturing the
cell of claim 9 under fermentation conditions in a medium
containing a sugar that is fermentable by the cell.
25. A method for producing lactic acid comprising culturing the
cell of claim 14 under fermentation conditions in a medium
containing a sugar that is fermentable by the cell.
26. A method according to claim 22, 23, 24, or 25, further
comprising the step of converting at least a portion of the lactic
acid to lactide
27. The method of claim 26, further comprising the step of
polymerizing the lactide to form a polylactide polymer or
copolymer.
Description
[0001] This application claims priority to U.S. Provisional Patent
Application Ser. No. 60/384,333, filed May 30, 2002.
BACKGROUND OF THE INVENTION
[0003] Lactic acid is an organic molecule that can be produced
either by chemical synthesis or by fermentation processes in
microorganisms (biosynthesis). Advantages that a biosynthetic
approach may have over a chemical synthetic approach for
manufacturing an organic product include more efficient yield of
product, faster production, isomeric purity, and lower cost.
[0004] D-(or R-)lactic acid is a building block in the manufacture
of biologically active materials, including herbicides and
pharmaceuticals. However, new processes that lower the cost of
D-lactic acid could enable its penetration and widespread use in
larger chemical markets including, for example, plastics. D-lactic
acid can be converted to D-lactide, a cyclic condensate of D-lactic
acid, which has many potential applications, including the
manufacture of films, fibers, and other polymer applications.
D-lactide can be polymerized to poly(D-lactide) (D-PLA), a polymer
that has properties similar to poly(L-lactide) (L-PLA), which is
used for various polymer applications. Highly crystalline PLA as
currently produced by Cargill Dow predominately contains the
L-stereoisomer. This high L-isomer resin is most commonly used in
the PLA fibers market because of its ability to increase fiber
tenacity, resist shrinkage, and increase its useable temperature
above the L-PLA glass transition temperature, when high stresses
are applied to it. A polymer similarly high in D-isomer would be
expected to have similar properties. Further, a high D-isomer
polymer can be blended with a high L-isomer polymer to form a
stereo-complex that has a significantly higher melting temperature
(up to approximately 230.degree. C.). This higher melting
temperature allows PLA to be used in applications where better heat
resistance is needed. An example of such an application is in
certain apparel applications, where an increased melting
temperature is needed to produce ironable fabrics.
[0005] D-lactic acid is also a useful industrial chemical
intermediate that is used in herbicide and pharmaceutical
applications. For example, D-lactic acid is an intermediate in the
manufacture of phenoxypropionic and aryloxyphenoxypropionic
herbicides.
[0006] Known biosynthetic processes for producing lactic have
certain limitations. For example, natural lactic acid producing
organisms such as Lactobacilli can produce large quantities of
L-lactic acid under fermentation conditions. However, these
organisms require a complex fermentation medium in order to produce
efficiently. The complexity of the fermentation medium increases
raw material costs and makes it more difficult and expensive to
separate the lactic acid from the medium. Further, fermentation
processes using these organisms are prone to infection from other,
non-lactic acid producing species. There is no economical method to
selectively eliminate the unwanted strains.
[0007] It is necessary to maintain the pH in the fermentation broth
when these organisms are used, as low pH environments both within
the bacteria itself and in the broth can inhibit proliferation of
the bacteria or cause cell death. This is accomplished by adding
neutralizing agents such as calcium carbonate to the fermentation
broth to form calcium lactate. In order to recover lactic acid, it
is necessary to treat the calcium lactate with a strong acid such
as sulfuric acid, which reacts with calcium lactate to form lactic
acid and gypsum (calcium sulfate). The inability of these organisms
to function at low pH therefore leads to additional expenses for
raw materials and for disposal of unwanted by-products
(gypsum).
[0008] In Japanese Kokai No. 2002-136293A there is disclosed a
genetically engineered yeast which is said to produce D-lactic
acid. The yeast host is of a special type that "accumulates"
pyruvate, i.e., produces significant quantities of pyruvate that
are not further metabolized.
[0009] Thus, there remains a need in the art for biosynthetic
processes for preparing D-lactic acid with an organism that: 1)
permits D-lactic acid to be made at good yields and productivities;
2) preferably requires only a simplified fermentation medium, and
3) preferably allows for a low pH and/or a high temperature
fermentation medium that can eliminate contamination from unwanted
microorganism strains.
SUMMARY OF THE INVENTION
[0010] In one aspect, this invention provides recombinant yeast
cells of a species that does not naturally accumulate pyruvate,
comprising at least one exogenous D-lactate dehydrogenase gene
integrated into its genome, wherein the D-lactate dehydrogenase
gene is operatively linked to functional promoter and terminator
sequences.
[0011] The invention also provides recombinant nucleic acids
encoding a D-lactate dehydrogenase gene operatively linked to
functional promoter and terminator sequences. The recombinant
nucleic acids of the invention permit expression of the D-lactate
dehydrogenase gene in a recombinant yeast cell.
[0012] In another aspect, the invention provides a method for
producing D-lactic acid comprising fermenting cells of the
invention under conditions that allow for the biosynthesis of
D-lactic acid.
[0013] The transformed yeast cells are capable of producing
D-lactic acid at commercially-significant yields. The cells can
tolerate the presence of D-lactic acid well and can continue to
produce efficiently when the fermentation broth contains
significant concentration of D-lactic acid. This effect is
unexpected, as both L-lactic and D-lactic acid tend to be
inhibitory to the growth and survival of certain microorganisms
(see Lett. Appl. Microbiol. 2002; 35(3):176-80; Susceptibility of
Escherichia coli 0157 and non-0157 isolates to lactate. McWilliam
Leitch E C, Stewart C S. Appl. Environ. Microbiol. 2002 September;
68(9):4676-8.). In some cases eukaryotic and bacterial cells have
been shown to respond differently to D-lactic acid than to L-lactic
acid (see Uribarri J, Oh M S, Carroll H J, Medicine (Baltimore)
1998 March; 77(2):73-82, "D-lactic acidosis: a review of clinical
presentation, biochemical features, and pathophysiologic
mechanisms;" cf. Leitch et al, supra).
[0014] Specific preferred embodiments of the present invention will
become evident from the following more detailed description of
certain preferred embodiments and the claims.
BRIEF DESCRIPTION OF THE DRAWINGS
[0015] FIG. 1 is a plasmid map of pNC2, comprising the PGK promoter
and GAL10 terminator, both from S. cerevisiae.
[0016] FIG. 2 is a plasmid map of pNC4, comprising the PDC1
promoter and GAL10 terminator, both from S. cerevisiae.
[0017] FIG. 3A is a map of a NotI restriction fragment of a 1.235
kb sequence derived from PCR amplified S. cerevisiae chromosomal
DNA, that comprises the PGK promoter and GAL10 terminator (S.
cerevisiae), and a multiple cloning site between the promoter and
terminator.
[0018] FIG. 3B is a map of a NotI restriction fragment of a 1.235
kb sequence derived from PCR amplified S. cerevisiae chromosomal
DNA, that comprises the PDC1 promoter and GAL10 terminator (S.
cerevisiae), and a multiple cloning site between the promoter and
terminator.
[0019] FIG. 4 is a plasmid map of pVR24, comprising the B.
megaterium L-LDH functionally linked to the PGK promoter and GAL10
terminator from S. cerevisiae.
[0020] FIG. 5 is a plasmid map of pVR22, comprising the G418
resistance marker functionally linked to the PGK promoter and GAL10
terminator from S. cerevisiae.
[0021] FIG. 6 is a plasmid map of pNC7, comprising the LDH gene
from B. megaterium functionally linked to the PGK promoter and
GAL10 terminator from S. cerevisiae.
[0022] FIG. 7 is a plasmid map of pSO21, comprising PDC1 from K.
marxianus.
[0023] FIG. 8 is a plasmid map of pSO28, comprising a deletion in
the PDC1 coding region contained in pSO21, and the G418 resistance
gene functionally linked to the PGK promoter and the GAL10
terminator from S. cerevisiae.
[0024] FIG. 9 is a plasmid map of pSO29, comprising a deletion in
the PDC1 coding region contained in pSO21, and the zeocin
resistance gene functionally linked to the TEF1 promoter and the
Tcyc1 terminator from S. cerevisiae (from pTEF1/Zeo:
Invitrogen).
[0025] FIG. 10 is a plasmid map of pPS1, comprising the hygromycin
resistance gene (hph) from E. coli functionally linked to the PDC1
promoter and GAL10 terminator from S. cerevisiae.
[0026] FIG. 11a is a plasmid map of pVR43, comprising the D-LDH
gene from L. helveticus.
[0027] FIG. 11b is a plasmid map of pVR44, comprising the D-LDH
gene from L. helveticus with the XbaI and BamHI sites at the 5' and
3' end of the gene respectively.
[0028] FIG. 12 is a plasmid map of pVR47, comprising the D-LDH gene
from L. helveticus functionally linked to the PGK promoter and
GAL10 terminator from S. cerevisiae.
[0029] FIG. 13 is a plasmid map of pVR48, comprising the D-LDH gene
from L. helveticus functionally linked to the PGK promoter and
GAL10 terminator from S. cerevisiae, and the hph resistance gene
functionally linked to the PDC1 promoter and the GAL10 terminator
from S. cerevisiae.
[0030] FIG. 14 is a plasmid map of pCA50, comprising an expression
cassette inserted between 3' and 5' flanking regions of the PDC1
locus (K marxianus), containing the D-LDH gene from L. helveticus
functionally linked to the PGK promoter and GAL10 terminator from
S. cerevisiae, and the hph resistance gene functionally linked to
the PDC1 promoter and GAL10 terminator from S. cerevisiae.
[0031] FIG. 15 is a plasmid map of pVR29, comprising the G418
resistance marker functionally linked to the PGK promoter and GAL10
terminator from S. cerevisiae.
[0032] FIG. 16a is a plasmid map of pBH5a, comprising a 5' flank of
the PDC1 locus (K. marxianus) and separately, the G418 resistance
gene functionally linked to the PDC1 promoter and GAL10 terminator
from S. cerevisiae.
[0033] FIG. 16b is a plasmid map of pBH5b, comprising 5' and 3'
flanking regions of the PDC1 locus (K. marxianus) and separately,
the G418 resistance gene functionally linked to the PDC1 promoter
and GAL10 terminator from S. cerevisiae.
[0034] FIG. 16C is a plasmid map of pBH5c, comprising the PDC1
locus from K marxianus.
[0035] FIG. 17 is a plasmid map of pBH6, comprising the D-LDH gene
from L. helveticus located between 5' and 3' flanking regions of
the PDC1 locus (K. marxianus), and separately the G418 resistance
gene functionally linked to the PDC1 promoter and the GAL10
terminator from S. cerevisiae.
DETAILED DESCRIPTION OF THE INVENTION
[0036] The yeast cells of the invention are provided from a species
that, prior to recombination as described herein, does not
accumulate pyruvate. By "does not accumulate" pyruvate, it is meant
that the species does not produce at least 10 g/L of pyruvic acid
when cultured in accordance with the method set forth in Embodiment
5 of Japanese Kokai 2000-78996. Generally, a yeast cell will not
accumulate pyruvate when it naturally contains an active metabolic
pathway that metabolizes the pyruvate to various metabolites such
as ethanol or acetate or biomass. Such yeast cells metabolize the
pyruvate rapidly enough that little pyruvate exists within the cell
at any one time and little pyruvate is secreted by the cell.
Preferred yeast cells naturally have one or more active pyruvate
decarboxylase (PDC) genes that produce pyruvate decarboxylase
protein, which converts pyruvate to ethanol. Even more preferred
yeast cells are those that exhibit the Crabtree negative phenotype,
in which the cell's aerobic metabolic pathway (respiration and TCA
cycle) is not inhibited by the present of a high concentration of
glucose. Examples of suitable yeast cells include those from the
genera Candida, Saccharomyces, Kluyveromyces, Pichia, Hansenula.
Cells from the genera Candida and Kluyveromyces are particularly
preferred. Especially preferred cells are C. sonorensis, K. lactis,
K. theromotolerans and K. marxianus. Most preferred cells are C.
sonorensis and K. marxianus.
[0037] The recombinant yeast cells of the invention contain at
least one exogenous D-LDH gene integrated into its genome.
Lactobacillus helveticus, Lactobacillus johnsonii, Lactobacillus
bulgaricus, Lactobacillus delbrueckii, lactobacillus plantarum and
Lactobacillus pentosus are strains that have suitable D-lactate
dehydrogenases that can be obtained by, inter alia, recombinant
genetic techniques for use herein. A preferred D-lactate
dehydrogenase gene is L. helveticus D-lactate dehydrogenase. The
cell may contain multiple exogenous LDH genes, i.e., at least two
such genes, preferably about 2-10 of such genes, more preferably
2-5 of such genes. The inserted LDH genes may be all the same gene,
or may be comprised of two or more different types of LDH gene.
[0038] A gene, promoter or terminator is considered to be
"exogenous" for purposes of this invention if it (1) is not found
within the genome of the unmodified cell, and (2) is not homologous
to genetic material present in the genome of the unmodified cell.
As used herein, a gene, terminator or promoter is "native" to the
yeast species if it is found (apart from individual-to-individual
mutations which do not effect its function) within the genome of
the unmodified cells of that species of yeast.
[0039] The exogenous D-LDH gene is operatively linked to functional
promoter and terminator sequences. By "operatively linked" it is
meant, within the context of this invention, that the promoter or
terminator, as the case may be, functions after integration in the
yeast genome to control the start and end, respectively, of
transcription of the D-LDH gene.
[0040] As used herein, the term "promoter" refers to an
untranscribed sequence located upstream (i.e., 5') to the
translation start codon of a structural gene (generally within
about 1 to 1000 bp, preferably 1-500 bp, especially 1-100 bp) and
which controls the start of transcription of a structural gene. The
promoter may be native to the host cell or exogenous. The promoters
can be those that control the expression of genes that are involved
in central carbon metabolism, e.g., glycolytic promoters or TCA
cycle gene promoters. Suitable promoters include the non-limiting
examples of promoters from yeast genes phosphoglycerate kinase
(PGK), glyceraldehyde-3-phosphate dehydrogenase (TDH), pyruvate
decarboxylase (PDC1), triose phosphate isomerase (TPI),
Transcription enhancer factor-1 (TEF-1), purine-cytosine permease
(PCPL3), and alcohol dehydrogenase (ADH). Preferred promoters of
the invention include the TEF-1 (S. cerevisiae), PGK (S.
cerevisiae), and PDC1 (S. cerevisiae, K. marxianus) promoters.
[0041] In embodiments where it is desired to integrate the D-LDH
gene(s) at a targeted locus of the yeast cell's genome, the
promoter sequence is homologous to the promoter sequence of the
gene where insertion is targeted. The targeted gene is preferably a
pyruvate decarboxylase (PDC) gene. Additional advantageous target
genes include alcohol dehydrogenase (ADH), orotidine-5'-phosphate
decarboxylase (ura3), and 3-isopropylmalate dehydrogenase
(ieu2).
[0042] Similarly, the term "terminator" refers to an untranscribed
sequence located downstream (i.e., 3') to the translation finish
codon of a structural gene (generally within about 1 to 1000 bp,
more typically 1-500 base pairs and especially 1-100 base pairs)
and which controls the end of transcription of the structural gene.
The terminator can be exogenous or native to the yeast species.
Suitable exogenous terminators include the GAL10 and CYC-1
terminators from S. cerevisiae or other yeast species.
[0043] As with the promoters, in certain embodiments, the
terminator sequence is homologous to a terminator sequence of the
targeted gene.
[0044] A gene, promoter, terminator or other genomic material is
considered to be "homologous" to other genetic material if it is
identical, i.e. has at least 75%, 80%, 85%, 90%, 91%, 92%, 93%,
94%, 95%, 96%, 97%, 98%, or about 99% identity in nucleotide
sequence to the other genetic material or if not identical, is
sufficiently similar to it that it retains its function. Therefore,
genetic material is considered to be "homologous" even if contains
differences due to, e.g., point mutations, deletions or additions
of base pairs, provided that those mutations, deletions or
additions that do not affect the function of the genetic material.
In the case of flanking sequences, homology is established if the
sequence is similar enough to a flanking sequence of the native
gene that the flanking sequence can each engage in a single
crossover event with the flanking sequence of the native gene.
[0045] The term "identity," as known in the art, refers to a
relationship between the sequences of two or more polypeptide
molecules or two or more nucleic acid molecules, as determined by
comparing the sequences thereof. In the art, "identity" also means
the degree of sequence relatedness between nucleic acid molecules
or polypeptides, as the case may be, as determined by the match
between strings of two or more nucleotide or two or more amino acid
sequences. "Identity" measures the percent of identical matches
between the smaller of two or more sequences with gap alignments
(if any) addressed by a particular mathematical model or computer
program (i.e., "algorithms").
[0046] The term "similarity" is used in the art with regard to a
related concept, but in contrast to "identity," "similarity" refers
to a measure of relatedness, which includes both identical matches
and conservative substitution matches. If two polypeptide sequences
have, for example, 10/20 identical amino acids, and the remainder
are all non-conservative substitutions, then the percent identity
and similarity would both be 50%. If in the same example, there are
five more positions where there are conservative substitutions,
then the percent identity remains 50%, but the percent similarity
would be 75% (15/20). Therefore, in cases where there are
conservative substitutions, the percent similarity between two
polypeptides will be higher than the percent identity between those
two polypeptides.
[0047] Identity and similarity of related nucleic acids and
polypeptides can be readily calculated by known methods. Such
methods include, but are not limited to, those described in
COMPUTATIONAL MOLECULAR BIOLOGY, (Lesk, A. M., ed.), 1988, Oxford
University Press, New York; BIOCOMPUTING: INFORMATICS AND GENOME
PROJECTS, (Smith, D. W., ed.), 1993, Academic Press, New York;
COMPUTER ANALYSIS OF SEQUENCE DATA, Part 1, (Griffin, A. M., and
Griffin, H. G., eds.), 1994, Humana Press, New Jersey; von Heinje,
G., SEQUENCE ANALYSIS IN MOLECULAR BIOLOGY, 1987, Academic Press;
SEQUENCE ANALYSIS PRIMER, (Gribskov, M. and Devereux, J., eds.),
1991, M. Stockton Press, New York; Carillo et al., 1988, SIAM J.
Applied Math., 48:1073; and Durbin et al., 1998, BIOLOGICAL
SEQUENCE ANALYSIS, Cambridge University Press.
[0048] Preferred methods to determine identity are designed to give
the largest match between the sequences tested. Methods to
determine identity are described in publicly available computer
programs. Preferred computer program methods to determine identity
between two sequences include, but are not limited to, the GCG
program package, including GAP (Devereux et al., 1984, Nucl. Acid.
Res., 12:387; Genetics Computer Group, University of Wisconsin,
Madison, Wis.), BLASTP, BLASTN, and FASTA (Altschul et al., 1990,
J. Mol. Biol., 215:403-410). The BLASTX program is publicly
available from the National Center for Biotechnology Information
(NCBI) and other sources (BLAST Manual, Altschul et al. NCB/NLM/NIH
Bethesda, Md. 20894; Altschul et al., 1990, supra). The well-known
Smith Waterman algorithm may also be used to determine
identity.
[0049] Certain alignment schemes for aligning two amino acid or
polynucleotide sequences may result in matching of only a short
region of the two sequences, and this small aligned region may have
very high sequence identity even though there is no significant
relationship between the two full-length sequences. Accordingly, in
certain embodiments, the selected alignment method (GAP program)
will result in an alignment that spans at least 50 contiguous amino
acids of the target polypeptide. In some embodiments, the alignment
can comprise at least 60, 70, 80, 90, 100, 110, or 120 amino acids
of the target polypeptide. If polynucleotides are aligned using
GAP, the alignment can span at least about 100, 150, or 200
nucleotides, which can be contiguous.
[0050] For example, using the computer algorithm GAP (Genetics
Computer Group, University of Wisconsin, Madison, Wis.), two
polypeptides for which the percent sequence identity is to be
determined are aligned for optimal matching of their respective
amino acids (the "matched span", as determined by the algorithm).
In certain embodiments, a gap opening penalty (which is calculated
as three-times the average diagonal; where the "average diagonal"
is the average of the diagonal of the comparison matrix being used;
the "diagonal" is the score or number assigned to each perfect
amino acid match by the particular comparison matrix) and a gap
extension penalty (which is usually one-tenth of the gap opening
penalty), as well as a comparison matrix such as PAM250 or BLOSUM
62 are used in conjunction with the algorithm. In certain
embodiments, a standard comparison matrix (see Dayhoff et al.,
1978, Atlas of Protein Sequence and Structure, 5:345-352 for the
PAM 250 comparison matrix; Henikoff et al., 1992, Proc. Natl. Acad.
Sci USA, 89:10915-10919 for the BLOSUM 62 comparison matrix) is
also used by the algorithm.
[0051] In certain embodiments, the parameters for a polypeptide
sequence comparison include the following:
[0052] Algorithm: Needleman et al., 1970, J. Mol. Biol.,
48:443-453;
[0053] Comparison matrix: BLOSUM 62 from Henikoff et al., 1992,
supra;
[0054] Gap Penalty: 12
[0055] Gap Length Penalty: 4
[0056] Threshold of Similarity: 0
The GAP program may be useful with the above parameters. For
nucleotide sequences, parameters can include a gap penalty of 50
and a gap length penalty of 3, which is a penalty of 3 for each
symbol in each gap. In certain embodiments, the aforementioned
parameters are the default parameters for polypeptide comparisons
(along with no penalty for end gaps) using the GAP algorithm.
[0057] The yeast cell may have various other modifications to its
natural genome. For example, the yeast cell may contain various
selection marker genes, as described more below, together with
associated promoter and/or terminator sequences. The yeast cell may
further have a deleted PDC gene or a disruption in a PDC gene. A
method of deleting the PDC together with the insertion of the D-LDH
gene at the locus of the PDC gene is described more fully below.
Other methods of deleting or disrupting PDC activity are described
in Porro, "Development of metabolically engineered Saccharomyces
cerevisiae cells for the production of lactic acid", Biotechnol.
Prog. 1995 May-June; 11(3): 294-8; Porro et al., "Replacement of a
metabolic pathway for large-scale production of lactic acid from
engineered yeasts", App. Environ. Microbiol. 1999 September:
65(9):4211-5; Bianchi et al., "Efficient homolactic fermentation by
Kluyveromyces lactis strains defective in pyruvate utilization and
transformed with the heterologous LDH gene", App. Environ.
Microbiol. 2001 December; 67(12)5621-5; and WO 99/14335.
[0058] The recombinant yeast cells of the invention can be prepared
by insertion of a nucleic acid fragment containing the D-LDH gene
operatively linked to a promoter sequence. The fragment typically
forms a part of a recombinant nucleic acid which can and preferably
does contain other elements as well, including (a) a terminator
sequence; (b) one or more selection marker gene(s) (including an
associated promoter and terminator); (c) one or more homologous
flanking sequences for inserting the fragment at a particular locus
in the genome of the host cell; (d) one or more restriction sites
which enable it to be cut to form a linear fragment containing the
LDH gene, its promoters and flanking sequences, marker genes and
associated promoters and terminators, etc., for insertion into the
genome of the yeast cell; and/or (e) a backbone portion. The term
"recombinant nucleic acid" is used herein to refer to any molecule
(e.g., nucleic acid, plasmid or virus) used to transfer
protein-coding information to the host cell. Methods of
transforming cells are well known in the art, and can include such
non-limiting examples as electroporation, calcium chloride-, or
lithium acetate-based methods. The DNA used in the transformations
can either be cut with particular restriction enzymes or uncut.
[0059] As used herein, the term "selection marker genes" refer to
genetic material that encodes a protein necessary for the survival
and/or growth of a host cell grown in a selective culture medium.
Typical selection marker genes encode proteins that (a) confer
resistance to antibiotics or other toxins, e.g., zeocin (sh ble
gene from Streptoalloteichus hindustanus), G418
(kanamycin-resistance gene of Tn903), hygromycin (aminoglycoside
antibiotic resistance gene from E. coli), ampicillin, tetracycline,
or kanamycin for host cells; (b) complement auxotrophic
deficiencies of the cell and/or supply critical nutrients not
available from simple media, such as amino acid leucine deficiency
(K. marxianus Leu2 gene); or a K. marxianus ura3 gene that gives
uracil to orotidine-5'-phosphate decarboxylase negative cells.
Preferred selectable markers include the non-limiting examples of
zeocin resistance gene, G418 resistance gene, and the hygromycin
resistance gene.
[0060] Backbone portions are conveniently obtained from
commercially available yeast vectors.
[0061] Suitable methods of transforming yeast cells to insert an
exogenous LDH gene are described in WO 00/71738A1 and WO
02/42471A1. The methods described there are generally applicable to
make the recombinant yeast cells of this invention, with the
substitution of a D-LDH gene for the L-LDH genes described
there.
[0062] The terms "transforming" and "transformation" as used herein
refers to a change in a cell's genetic characteristics, and a cell
has been transformed when it has been modified to contain a new
nucleic acid. Thus, a cell is transformed where it is genetically
modified from its native state. For example, following
transfection, transforming DNA preferably recombines with cellular
genomic DNA by physically integrating into a chromosome of the
cell. Alternatively, at least transiently (i.e., within 48-96 hrs
of cellular transformation), the nucleic acid can be maintained
transiently as an episomal element without being replicated, or may
replicate independently as a plasmid. A cell is considered to have
been stably transformed when the DNA is integrated into the
chromosome and is replicated with the division of the cell.
[0063] The term "transfection" is used to refer to the uptake of
foreign or exogenous DNA by a cell, and a cell has been
"transfected" when the exogenous DNA has been introduced inside the
cell membrane. A number of transfection techniques are well known
in the art. See, e.g., Graham et al., 1973, Virology 52:456;
Sambrook et al., 2001, MOLECULAR CLONING, A LABORATORY MANUAL, Cold
Spring Harbor Laboratories; Davis et al., 1986, BASIC METHODS IN
MOLECULAR BIOLOGY, Elsevier; and Chu et al., 1981, Gene 13:197.
Such techniques can be used to introduce one or more exogenous DNA
species into suitable host cells.
[0064] Multiple D-LDH genes can be integrated by multiple
transformations. However, it is possible to construct a recombinant
nucleic acid containing multiple D-LDH genes, thus enabling
multiple LDH genes to be inserted in a single step.
[0065] A transformation method of particular interest targets the
insertion of the D-LDH gene at the locus of a naturally-occurring
target gene. A target gene is any gene that is desired to be
replaced with the LDH gene. A preferred target gene is a pyruvate
decarboxylase gene, as replacing this gene disrupts a competing
pathway that produces ethanol. In addition, the pyruvate gene tends
to be a active in yeast species, so insertion of the LDH gene into
the genome under control of the PDC promoters and terminators tends
to produce a mutant that expresses LDH well. Additional preferred
target genes are ADH, Leu2 and Ura3.
[0066] Preferably, the yeast cells of the invention are transformed
with recombinant nucleic acids of the invention and selected by
growth in a selective medium in which the selectable marker in the
recombinant nucleic acid permits preferential growth of
transformants. The transformed cells are preferably grown after
selection under non-selective conditions. Under these conditions,
recombinant yeast cells are obtained having the exogenous D-LDH
gene comprising the recombinant nucleic acid integrated into the
genetic locus of the target gene in the yeast chromosome. As
obtained according to the methods of this invention, these cells
have deleted the target gene, and the integrated, exogenous D-LDH
gene is inserted into the target gene locus so that it is operably
linked and under the transcriptional control of the expression
control sequences (such as the promoter and terminator sequences)
of the target gene. When the target gene is a PDC gene, cells in
which the PDC deletion occurs do not grow well under anaerobic
conditions. Thus, colonies of the identified and selected cells can
be selected by exposing them to anaerobic conditions. Colonies that
do not grow are identified as those in which the PDC deletion has
occurred. Similarly, targeted integration into any other target
gene can be identified by the phenotype associated with deletion of
each of the target genes.
[0067] The resulting yeast cell is missing the target gene, and
contains an exogenous D-LDH gene integrated into the yeast cell
genome at the locus of the target gene. The LDH gene is under the
transcriptional control of a promoter sequence and a terminator
sequence that is homologous to promoter and terminator sequences of
the target gene.
[0068] The D-LDH promoter and terminator sequences may be those
which were present in flanking sequences contained in the
recombinant nucleic acid that was used to transform the cell, or
may be those which were originally present in the cell's genome at
the site of integration. It is also possible that the target gene
terminator is retained with deletion of the terminator sequence
that was present in the integration vector.
[0069] The flanking sequence may be immediately adjacent to the
D-LDH gene, or separated from the gene by an intermediate sequence
of base pairs, such as from 1-1000, preferably 1-100 base pairs.
The flanking sequences used in the recombinant nucleic acids of
this invention are preferanbly homologous to corresponding flanking
sequences of the targeted gene. Typical flanking sequences lengths
are from about 50 to about 4000 base pairs, preferably about 100 to
about 2000 base pairs, especially up to about 1200 base pairs. The
flanking sequences preferably contain a promoter (terminator in the
case of a downstream flanking sequence) sequence each homologous to
those the target gene. In preferred embodiments, the flanking
sequences are homologous to and comprise promoter and terminator
sequences, respectively, for native yeast Most preferably,
integration of the recombinant nucleic acid into the target gene
locus in the chromosomal DNA of the yeast genome results in the
exogenous D-LDH gene encoded thereby to fall under the
transcription control of the native gene expression regulatory
sequences comprising said flanking sequences.
[0070] Suitable flanking sequences can be obtained by identifying
the intended site of integration in the yeast cell genome, cloning
the sequences that flank that site (using any convenient method)
and attaching those sequences into the desired position in the
recombinant nucleic acid.
[0071] The recombinant nucleic acid further preferably includes one
or more selection marker genes, which are more preferably under the
transcriptional control of their own promoter and terminator
sequences. In this embodiment, promoter and terminator sequences
for marker genes are preferably not promoter and terminator
sequences for the target gene. The selection marker gene(s) and
their respective promoters and terminators preferably do not
interrupt the sequence of upstream flanking sequence-LDH
gene-downstream flanking sequence of the recombinant nucleic acid.
The selection marker gene(s) and respective promoters and
terminators are preferentially positioned on the recombinant
nucleic acid upstream (5') to the upstream flanking sequence.
[0072] A target gene is any gene that is desired to be replaced
with the LDH gene. A preferred target gene is a pyruvate
decarboxylase gene, as replacing this gene disrupts a competing
pathway that produces ethanol. In addition, the pyruvate gene tends
to be a active in yeast species, so insertion of the LDH gene into
the genome under control of the PDC promoters and terminators tends
to produce a mutant that expresses LDH well. Additional preferred
target genes include alcohol dehydrogenase (ADH),
orotidine-5'-phosphate decarboxylase (ura3), and 3-isopropylmalate
dehydrogenase (leu2).
[0073] The resulting yeast cell is missing the target gene, and
contains an exogenous D-LDH gene integrated into the yeast cell
genome at the locus of the target gene. The D-LDH gene is under the
transcriptional control of a promoter sequence and a terminator
sequence that are each homologous to promoter and terminator
sequences, respectively, of the target gene.
[0074] In this embodiment, the LDH promoter and terminator
sequences may be those which were present in the recombinant
nucleic acid that was used to transform the cell, or may be those
which were originally present in the cell's genome at the site of
integration. After the first crossover event, the inserted D-LDH
gene is operatively linked to promoters and terminator sequences
that were present in the integration vector. After the second
crossover event, either or both of those promoter and terminator
sequences may be replaced with the native PDC promoter and/or
terminator. For example, the native PDC promoter may be retained
with deletion of the promoter sequence is that supplied with the
integration vector. It is also possible that the native PDC
terminator is retained with deletion of the terminator sequence
that was present in the integration vector.
[0075] The transformed yeast cell of the invention is useful for
producing D-lactic acid from sugars in a fermentation process. The
cell preferably contains no functioning L-LDH gene, or if it does
contain a functioning L-LDH gene, its activity is such that at
least 90%, preferably at least 95%, more preferably at least 99.0%,
even more preferably at least 99.5% of the lactic acid produced by
the cell is the D-isomer.
[0076] The fermentation can be conducted using any convenient
fermentation method. Typically the cell is provided with a
carbohydrate that it is capable of metabolizing to pyruvate, and
exposed to conditions under which fermentation occurs. The
fermentation medium also contains nutrients (such as sources of
nitrogen, phosphorus, sulfur, trace minerals, etc.) that promote
the viability of the cells.
[0077] The particular carbohydrates that can be used depend on the
particular host cell, and whether the host cell has been engineered
to metabolize any particular carbohydrate to pyruvate. Hexose
sugars such as glucose and fructose, oligomers of glucose such as
maltose, isomaltose, maltotriose, starch, and sucrose,
maltodextrins and xylose (a pentose sugar) are preferred. Less
preferred carbohydrates include galactose, mannose and
arabinose.
[0078] The temperature during fermentation can be from about room
temperature, more preferably from about 30.degree. C., more
preferably from about 35.degree. C., to about 55.degree. C., more
preferably to about 50.degree. C., even more preferably to about
45.degree. C. The maximum temperature will depend somewhat on the
particular host cell. When the host cell is K. marxianus, for
example, the recombinant cell can tolerate relatively high
temperatures (such as above 40.degree. C. and up to 50.degree. C.,
especially up to 45.degree. C.). Another preferred host species, C.
sonorensis, can tolerate temperatures up to about 40.degree. C.
This high temperature tolerance provides for the possibility of
conducting the fermentation at such higher temperatures (thereby
reducing cooling costs) without a significant loss of productivity.
Another advantage provided by the good high temperature tolerance
is that if the fermentation becomes contaminated with an undesired
microorganism, in many cases the undesired microorganism can be
selectively killed off by heating the fermentation medium to
40.degree. C. or more, especially 45.degree. C. or more, without
significantly harming the desired cells of the invention.
[0079] During fermentation, the concentration of cells in the
fermentation medium is typically in the range of about 1-150,
preferably about 3-10, even more preferably about 3-6 g dry
cells/liter of fermentation medium.
[0080] During the production phase of the fermentation, in some
instances it may be preferred to operate microaerobically rather
than strictly anaerobically. Optimum aeration conditions can be
established for each microorganism by measuring specific oxygen
uptake rates (OUR) and correlating those rates with yield,
substrate consumption rates and the rate at which the desired
fermentation product is produced. In many cases, yield and rates
are optimized within a particular range of OUR. For yeast having a
PDC disruption, optimum OUR values tend to be within the range of
about 0.8 to about 3.5 mmol O.sub.2/dry weight cells/hr. OUR refers
to the rate at which oxygen is consumed by the cells during
fermentation, and is expressed in units (mmoles or grams) of oxygen
per dry weight of cells per unit time, such as mmol O.sub.2/dry
weight cells/hour. Oxygen consumption is conveniently determined by
measuring oxygen introduced into the fermentation and oxygen
removed from the fermentation. OUR measurements can be used as a
basis to control aeration conditions (notably rate of gas
introduction, agitation, proportion of oxygen in the aerating gas,
etc.) during the production phase of a fermentation in order to
maintain OUR within the range that is optimum for the particular
organism. The concentration of dissolved oxygen in the broth is
simultaneously maintained at less than 1% of saturation,
particularly less than 10 micromol O.sub.2/L. In a particularly
preferred process, a growth phase of the fermentation is conducted
such that the concentration of dissolved oxygen in the broth is
reduced to less than 1% of saturation, particularly less than 10
micromol O.sub.2/L, for a period of time, such as about 15-90
minutes, prior to the start of the production phase (i.e.,
switching from aerobic conditions in the growth phase to
microaerobic conditions in the production phase.
[0081] As D-lactic acid is produced, the pH of the fermentation
medium tends to drop unless a base is added to neutralize all or
part of the acid as it forms. In one embodiment of the fermentation
process, a neutralizing agent such as calcium carbonate, calcium
hydroxide, sodium carbonate, sodium hydroxide, ammonia, ammonium
hydroxide, and the like is added to the fermentation broth to
maintain the pH within a desired range, typically from about 5.0 to
about 8.0, especially from about 5.5 to about 7.5. When such a base
is added, the corresponding lactate salt is formed. Recovery of the
lactic acid therefore involves regenerating the free lactic acid.
This is typically done by separating the cells and acidulating the
fermentation broth with a strong acid such as sulfuric acid. A salt
by-product is formed (gypsum in the case where a calcium salt is
the neutralizing agent and sulfuric acid is the acidulating agent),
which is separated from the lactic acid. The lactic acid is then
recovered through techniques such as liquid-liquid extraction,
distillation, absorption, etc., such as are described in T. B.
Vickroy, Vol. 3, Chapter 38 of Comprehensive Biotechnology, (ed. M.
Moo-Young), Pergamon, Oxford, 1985; R. Datta, et al., FEMS
Microbiol. Rev., 1995; 16:221-231; U.S. Pat. Nos. 4,275,234,
4,771,001, 5,132,456, 5,420,304, 5,510,526, 5,641,406, and
5,831,122, and International Patent Application No: WO
93/00440.
[0082] Alternatively, the pH of the fermentation may be permitted
to drop as lactic acid is produced by the cells. Thus, the pH of
the fermentation broth may come within the range of about 1.5 to
about 5.0, preferably from about 1.5 to about 4.2, more preferably
from about 1.5 to about 3.86 (the pKa of lactic acid), especially
from about 2.0 to below 3.86 due to the production of lactic acid.
Conducting the fermentation in this manner can provide several
benefits, if acceptable productivity and yields are achieved. Costs
for neutralizing agents are reduced or eliminated. If the
fermentation pH (at the end of the fermentation) is below the pKa
of lactic acid, the lactic acid will exist mainly in the acid form.
This allows the acidulation step to be eliminated, saving
additional process steps, acidulation costs, and disposal costs for
salt by-products. Thus, an especially preferred process includes
continuing the fermentation until the pH of the fermentation broth
falls below 3.86. Lactic acid can be separated from the resulting
fermentation broth using methods such as those disclosed in WO
99/19290.
[0083] The ability of the cell to withstand a low pH environment
provides another mechanism by which contamination from unwanted
microorganisms can be eliminated. The culture containing the cell
of the invention may be subjected to reduced pH conditions, such as
a pH of from about 1.5-4.2, preferably from about 2.0 to 3.86, for
a time sufficient to kill off contaminating microorganisms that are
not acid-tolerant.
[0084] To be commercially useful, the recombinant yeast of the
invention should exhibit several characteristics. The yeast should
convert a significant proportion of the carbohydrate to lactic acid
(i.e., produce a high yield of product). It should exhibit a high
specific productivity, i.e., product a high amount of lactic acid
per weight of cell per unit time. It preferably is tolerant to a
fermentation pH below about 5.0, preferably from about 1.5 to 4.2,
especially from 2.0 to 3.86, while providing good yields and
productivities under those conditions. The cell is preferably also
tolerant to high concentrations of D-lactic acid and/or D-lactic
acid salts, at pH values of 5.0-8.0 and preferably at pH values
from 1.5 to 5.0, preferably from 1.5 to 4.2 and especially from 2.0
to 3.86. This last property allows the fermentation process to use
high concentrations of the starting carbohydrate.
[0085] In general, it is desirable that the fermentation process
employing the recombinant cell of the invention provides some or
all of the following features:
A. A yield of at least 30, preferably at least 40, more preferably
at least 60, even more preferably at least 75 grams of lactic acid
per gram of carbohydrate. The theoretical desired yield is 100%,
but practical limits on yields are about 98% (g/g)B. A specific
productivity of at least 0.1, preferably at least 0.3, more
preferably at least about 0.4, especially at least about 0.5 grams
of D-lactic acid/gram of cells/hour. Specific productivities are
desirably as high as possible. C. A titer (maximum concentration of
D-lactic acid) of at least 15 grams/liter of fermentation medium,
preferably at least 20 g/L, more preferably at least 40 g/L, even
more preferably at least 80 g/L, up to 150 g/L, preferably up to
about 120 g/L. The temperature of the fermentation medium affects
the high end of readily achievable titers somewhat, as highly
concentrated lactic acid solutions (i.e., above about 150 g/liter)
tend to become very viscous or gel at temperatures below about
35.degree. C. Using a higher fermentation temperature, such as from
about 35-50.degree. C., permits higher titers without gelling or
undue viscosity build-up.
[0086] Recombinant cells of the invention have been found to
provide yields as high as 92-98% %, volumetric productivities of
1.5-2.2 g/L/hr and titers of 81-90 g/L when used in a neutral (pH
5.0-8.0) fermentation on glucose. At low pH fermentations, in which
the pH is allowed to drop to about 3.0, cells of the invention have
been found to provide yields of 80% or more and titers of 1.2-3.3
g/L. In all cases these results have been obtained without
optimization of fermentation conditions.
[0087] In addition, the fermentation process of the invention
preferably achieves a high volume productivity. Volume productivity
is expressed as amount of product produced per unit volume of
fermentation medium per unit time, typically gram of product/liter
medium/hr of time. Volume productivities of at least 1.5 g/L/hr,
preferably at least 2.0 g/L/hr, more preferably at least 2.5 g/L/hr
are desirable. At preferred cell densities of up to 3-6 g
cells/liter of fermentation medium, maximum productivities tend to
up to about 5.0 g/L/hr, and more typically up to about 4.0 g/L/hr.
It is highly preferred to conduct the fermentation so that these
volume productivities are achieved when the medium pH, temperature,
or both are within the ranges described in the preceding
paragraph.
[0088] Lactic acid produced according to the invention is useful to
produce lactide, a cyclic anhydride of two lactic acid molecules.
Depending on the stereoisomer of the lactic acid, the lactide may
be D-lactide (made from two D-lactic acid molecules), L-lactide
(made from two L-lactic acid molecules) or D-L-lactide (made from
one of each L-lactic acid and D-lactic acid molecules). A
convenient method of producing lactide from lactic acid is via a
polymerization/depolymerization method as described in U.S. Pat.
No. 5,142,023 to Gruber et al.
[0089] Lactide, in turn, is particularly useful as a monomer for
the production of polylactide polymers (PLA) and copolymers.
Processes for preparing these are also described in U.S. Pat. No.
5,142,023 to Gruber et al. Preferred PLA products are melt-stable
polymers as described in U.S. Pat. No. 5,338,822 to Gruber et al.
The PLA may be semi-crystalline or amorphous.
[0090] The following examples serve to illustrate certain
embodiments of the invention and do not limit it in scope or
spirit.
EXAMPLES
Example 1A
Construction of Expression Plasmids pNC2, Based on S. cerevisiae
PGK Promoter, and pNC4, Based on S. cerevisiae PDC1 Promoter
[0091] Expression plasmid pNC2 (FIG. 1.) was generated by combining
the S. cerevisiae PGK1 promoter and the S. cerevisiae GAL10
terminator on the pGEM5Z(+) (Promega, Wis.) backbone vector. The S.
cerevisiae PGK1 promoter and the GAL10 terminator were separated by
a poly-linker region with the restriction sites XbaI, EcoRI and
BamHI for inserting particular genes to be expressed between the
yeast promoter and terminator.
[0092] A S. cerevisiae PGK1 promoter having the following sequences
was used:
TABLE-US-00001 (SEQ ID No. 1) 5'-GCGGCCGCGG ATCGCTCTTC CGCTATCGAT
TAATTTTTTT TTCTTTCCTC TTTTTATTAA CCTTAATTTT TATTTTAGAT TCCTGACTTC
AACTCAAGAC GCACAGATAT TATAACATCT GCACAATAGG CATTTGCAAG AATTACTCGT
GAGTAAGGAA AGAGTGAGGA ACTATCGCAT ACCTGCATTT AAAGATGCCG ATTTGGGCGC
GAATCCTTTA TTTTGGCTTC ACCCTCATAC TATTATCAGG GCCAGAAAAA GGAAGTGTTT
CCCTCCTTCT TGAATTGATG TTACCCTCAT AAAGCACGTG GCCTCTTATC GAGAAAGAAA
TTACCGTCGC TCGTGATTTG TTTGCAAAAA GAACAAAACT GAAAAAACCC AGACACGCTC
GACTTCCTGT CTTCCTATTG ATTGCAGCTT CCAATTTCGT CACACAACAA GGTCCTAGCG
ACGGCTCACA GGTTTTGTAA CAAGCAATCG AAGGTTCTGG AATGGCGGGA AAGGGTTTAG
TACCACATGC TATGATGCCC ACTGTGATCT CCAGAGCAAA GTTCGTTCGA TCGTACTGTT
ACTCTCTCTC TTTCAAACAG AATTGTCCGA ATCGTGTGAC AACAACAGCC TGTTCTCACA
CACTCTTTTC TTCTAACCAA GGGGGTGGTT TAGTTTAGTA GAACCTCGTG AAACTTACAT
TTACATATAT ATAAACTTGC ATAAATTGGT CAATGCAAGA AATACATATT TGGTCTTTTC
TAATTCGTAG TTTTTCAAGT TCTTAGATGC TTTCTTTTTC TCTTTTTTAC AGATCATCAA
GGAAGTAATT ATCTACTTTT TACAACAAAT CTAGAATT-3'
It was obtained as a restriction fragment from plasmid pBFY004.
Alternatively, it can be obtained by PCR amplification using S.
cerevisiae chromosomal DNA as template and primers designed based
on the sequence:
[0093] The S. cerevisiae GAL10 terminator used has the following
sequence
TABLE-US-00002 (SEQ ID No. 2) 5'-GTAGATACAT TGATGCTATC AATCCAGAGA
ACTGGAAAGA TTGTGTAGCC TTGAAAAACG GTGAAACTTA CGGGTCCAAG ATTGTCTACA
GATTTTCCTG ATTTGCCAGC TTACTATCCT TCTTGAAAAT ATGCACTCTA TATCTTTTAG
TTCTTAATTG CAACACATAG ATTTGCTGTA TAACGAATTT TATGCTATTT TTTAAATTTG
GAGTTCAGTG ATAAAAGTGT CACAGCGAAT TTCCTCACAT GTAGGGACCG AATTGTTTAC
AAGTTCTCTG TACCACCATG GAGACATCAA AAATTGAAAA TCTATGGAAA GATATGGACG
GTAGCAACAA GAATATAGCA CGAGCCGCGG ATTTATTTCG TTACGC-3'
This sequence was obtained as a restriction fragment from plasmid
pBFY004. Alternatively, it can be obtained by PCR amplification
using S. cerevisiae chromosomal DNA as template and primers
designed based on the sequence:
[0094] The plasmid pNC4 containing expression cassette based on S.
cerevisiae PDC1 promoter and GAL10 terminator was constructed and
used as a general expression vector. Many of the marker genes have
been expressed under this promoter. The pNC4 plasmid is shown in
FIG. 2.
[0095] The plasmid backbone of pNC4 is pGEM5Z(+) (Promega
Corporation; Madison, Wis.). The S. cerevisiae PDC1 promoter was
PCR amplified using the primers PSPDCS1 (5'-CCA TCG ATA ACA AGC TCA
TGC AAA GAG-3'; SEQ ID No:3) and PSPDCAS2 (5'-GCT CTA GAT TTG ACT
GTG TTA TTT TGCG-3'; SEQ ID No:4) and using chromosomal DNA from S.
cerevisiae strain GY5098 as the template. Thermocycling was
performed by 30 cycles of 1 min at 94.degree. C., 1 min. at
56.degree. C., 1 min. at 72.degree. C., followed by a final
incubation of 7 min. at 72.degree. C. using PfuTurbo DNA polymerase
(Stratagene).
[0096] The S. cerevisiae GAL10 terminator was obtained as described
above. FIG. 3A SEQ ID NO 41 and 3B SEQ ID NO 42 depict the fragment
comprising the PGK1 promoter and GAL10 terminator with
multi-cloning sites, and the PDC1 promoter and GAL10 terminator
with multi-cloning sites.
Example 1B
Construction of pVR24 Containing B. megaterium L-LDH Under the
Control of the S. cerevisiae PGK1 Promoter
[0097] B. megaterium DNA encoding the L-LDH gene was isolated as
follows. B. megaterium was obtained from the American Type Culture
Collection (ATCC Accession #6458) and grown under standard
conditions. Genomic DNA was purified from these cells using an
Invitrogen "Easy-DNA" kit according to the manufacturer's protocol.
Primers were designed on the basis of the available sequence in
Genbank for the L-LDH from B. megaterium (Genbank accession
#M22305). PCR amplification reactions were performed using Perkin
Elmer buffer II (1.5 mM MgCl.sub.2) and AmpliTaq Gold polymerase.
Each reaction contained B. megaterium genomic DNA at a
concentration of 6 ng/.mu.L, each of 4 dNTPs at a concentration of
0.2 mM, and each of two amplification primers BM1270 and BM179 at a
concentration of 1 .mu.M, where these primers have the
sequence:
TABLE-US-00003 BM1270: SEQ ID No: 5 5'-CCT GAG TCC ACG TCA TTA
TTC-3'; and BM179: SEQ ID No: 6 5'-TGA AGC TAT TTA TTC TTG
TTAC-3';
[0098] Reactions were performed according to the following
thermocycling conditions: initial incubation for 10 min. at
95.degree. C., followed by 35 cycles of 30 sec. at 95.degree. C.,
30 sec. at 50.degree. C., and 60 sec at 72.degree. C. A strong
product fragment (1100 bp) was purified and isolated using agarose
gel electrophoresis, cloned, and sequenced. The resulting sequence
could be translated into a polypeptide that exhibited excellent
homology to known L-LDH-encoding genes (e.g., Genbank accession
#M22305).
[0099] The coding sequence for the B. megaterium LDH-encoding gene
was operatively linked to a promoter from the phosphoglycerate
kinase (PGK) gene and a transcriptional terminator from the GAL10
gene, both from the yeast S. cerevisiae. Two oligonucleotide
primers, Bmeg5' and Bmeg3', were designed based on this sequence to
introduce restriction sites at the ends of the coding sequence of
the gene:
TABLE-US-00004 Bmeg5': SEQ ID No: 7 5'-GCT CTA GAT GAA AAC ACA ATT
TAC ACC-3; and Bmeg3': SEQ ID No: 8 5'-ATGG ATC CTT ACA CAA AAG CTC
TGT CGC-3';
[0100] This amplification reaction was performed using dNTP and
primer concentrations described above using Pfu Turbo polymerase
(Stratagene) in the manufacturer's supplied buffer. Thermocycling
was done with an initial incubation for 3 min. at 95.degree. C.,
followed by 20 cycles of 30 sec. at 95.degree. C., 30 sec. at
50.degree. C., and 60 sec. at 72.degree. C., followed by a final
incubation for 9 min at 72.degree. C. The product was digested with
restriction enzymes XbaI and BamHI and ligated into the XbaI and
BamHI sites of plasmid pNC2. This ligation resulted in the PGK
promoter and GAL10 terminator becoming operably linked to the B.
megaterium LDH coding sequence, identified as pVR24. (FIG. 4)
Example 1C
Construction of pVR22 Harboring the G418 Resistance Cassette
Operably Linked to the PDC1 Promoter and GAL10 Terminator (S.
cerevisiae)
[0101] The G418 resistance marker was cloned under S. cerevisiae
PDC1 promoter and the constructs were designated as pVR22 (shown in
FIG. 5). The S. cerevisiae GAL10 terminator was used in this
plasmid as the terminator for G418 resistance gene. The G418
resistance gene was amplified by PCR using Pfu Turbo Polymerase
(Stratagene) with primers 5'-GCT CTA GAT GAG CCA TAT TCA ACG GGA
AAC (5' G fragment; SEQ ID No:9) and 5'-ATG GAT CCT TAG AAA AAC TCA
TCG AGC ATC (3' G fragment; SEQ ID No:10) and the plasmid, pPIC9K
(Invitrogen, Carlsbad, Calif.), as the template. Thermocycling was
done by initially incubating the reaction mixture for 5 min at
95.degree. C., then by 35 cycles of 30 sec at 95.degree. C., 30 sec
at 49.degree. C., 2 min at 72.degree. C., followed by a final
incubation for 10 min at 72.degree. C. The PCR product was digested
with BamHI and XbaI and an 821 by fragment was isolated and ligated
to the 4303 by BamHI-XbaI fragment of pNC2. The resultant plasmid
has the PGK promoter and GAL10 terminator functionally linked to
the G418 resistance gene was named pVR22, and is shown
schematically in FIG. 5.
Example 1D
Construction of the Plasmid pNC7 for Expression of Bacillus
megaterium L-LDH Gene on Replicating Plasmid, pKD1
[0102] Plasmid pNC7 (FIG. 6) was constructed as follows. The
expression cassette containing B. megaterium-LDH gene under
transcriptional control of the PGK promoter and GAL10 terminator
(S. cerevisiae) was isolated from pVR24 as a NotI fragment, and
ligated into plasmid pNC3 cut with NotI, to give pNC7. pNC3 was
constructed by ligating the entire pKD1 plasmid (see,
Wesolowski-Louvel et al., Nonconventional Yeasts in Biotechnology;
"Kluyveromyces lactis", pp. 139-201; K. Wolf ed.; Springer-Verlag,
Berlin, 1996) linearized with SphI into the unique SphI site of
pTEF1/Zeo (Invitrogen).
Example 1E
Construction of Kluyveromyces marxianus Strain NC39
[0103] Plasmid pNC7 was transformed into wild-type K marxianus
(strain CD21) using standard methods to give a recombinant strain
NC39 that had the B. megaterium L-LDH gene on a multi-copy pKD1
plasmid.
Example 1F
Construction of Plasmids pSO28 and pSO29 for Disruption of PDC1
Disruption Vectors
[0104] The plasmid pSO21 was constructed using the primers SO-M2
5'-CTT CCA GTC CAG CAG GTC GAC CAG-3', SEQ. ID No:11, and SO-M1
5'-GTC CAG CAT GTC GAC CAG-3'; SEQ. ID. No: 12. Genomic DNA from K.
marxianus (strain CD21) was used as the template and the primers
described above using conventional PCR methodologies a 5.5 kb
fragment was obtained that consisted of the K. marxianus PDC1 gene
along with its promoter, terminator and large region upstream and
downstream of the gene. The 5.5 kb fragment was cloned into the
pCRII (Invitrogen) plasmid to give plasmid pSO21 (FIG. 7). The
plasmid pSO27 was synthesized by PCR amplification of the 3.3 kb
PDC1 fragment (PDC1 gene, promoter) from pSO21 using the primers
SO-M4 5'-GAA CGA AAC GAA CTT CTC TC-3'; SEQ ID No: 13, and SO-M5
5'-CTT GGA ACT TCT TGT CAG TG-3'; SEQ ID No: 14, using conventional
PCR methodologies. The resulting fragment was purified and isolated
by gel electrophoresis, and subsequently ligated into pCRII
(Invitrogen) to give pSO27.
[0105] pSO28 (FIG. 8) was constructed by digesting pSO27, harboring
PDC1, with BbsI to delete 417 by from the PDC1 coding region. The
resulting nucleotide overhangs were filled in with Pfu DNA
polymerase (Stratagene). This fragment (ca. 2.9 kb) was ligated
into a Pfu-blunt-ended NotI fragment from pVR22 (Example 1C) that
contains the S. cerevisiae PGK promoter and the G418 resistance
gene followed by the S. cerevisiae GAL10 terminator.
[0106] Similarly, pSO29 (FIG. 9) was constructed by digesting pSO27
with BbsI to delete 417 by from the PDC1 coding region. The
nucleotide overhangs were filled in with Pfu DNA polymerase
(Stratagene). This fragment was ligated to a Pfu-blunted XhoI/XbaI
fragment from pTEFI/Zeo (Invitrogen) that contains the S.
cerevisiae TEF1 promoter and the zeocin resistance gene followed by
a S. cerevisiae CYCI terminator.
[0107] These constructs were made in order to design various
integration cassettes useful for creating K. marxianus strains
having a pdc1 null genotype, with various integrated selection
genes. The transformants are first screened to verify the insertion
of the construct at the PDC1 locus, and then screened for an
inability to produce ethanol and inability to grow anaerobically.
The preferred recombination event is a double cross over at PDC1 on
the genome. However, a single or a double recombination event can
occur, or a DNA insertional mutagenesis event can occur.
Example 1G
Transformation and Selection of K. marxianus for pdc1 Null Genotype
using Pdc-phenotype: Construction of Strains CD181, CD186, CD214,
CD215, CD216, CD217, CD218, CD219, CD220, and CD221
[0108] Strain NC39 was chosen as a transformation host because it
contains plasmid pNC7 in the host as a replicating plasmid
containing the L-LDH on the pKD1 backbone the presence of which can
increase the probability of a deletion at PDC1 (see, Chen X J, et
al., Curr. Genet., 1989 August; 16(2):95-8).
[0109] NC39 was grown overnight in YPD with 100 .mu.g/mL zeocin
(Invitrogen) selection in order to retain the pNC7 plasmid, and the
transformation was carried out according to the following yeast
chemical transformation protocol. Cells were grown overnight in 5
mL YPD medium at 30.degree. C., with shaking at 250 rpm. The
culture was diluted with 50 mL of YPD, to a starting OD.sub.600 of
about 0.2. The culture was then grown at 30.degree. C., with 250
rpm until the OD.sub.600 was about 3.0. The cells were then
harvested by centrifugation at 2500 rpm for 5 min, and resuspended
in 50 mL sterile water. The cells were harvested by centrifugation
at 2500 rpm for 5 min. The resuspension centrifugation was repeated
once. Following that step, the cell pellet was resuspended in 1.0
mL of 10 mM Tris, pH 7.5, 1 mM EDTA, 20 mM lithium acetate, pH 7.5.
Into a microfuge tube was added: 4.0 .mu.g of linear pSO28 DNA
fragment cut with. SadI/ApaI containing the G418 selection marker
and the flanking PDC1 region, 25 .mu.L of carrier DNA (Colette-10
mg/mL sand solicited), and 500 .mu.L of the prepared NC39 cells
were added and mixed by vortex. To this was added 3 mL of 40% PEG,
10 mM Tris, pH7.5, 1 mM EDTA, 20 mM lithium acetate, pH 7.5 and
mixed by vortex. This mixture was then incubated for 30 min at
30.degree. C., with shaking at 250 rpm. After the incubation
period, 350 .mu.L DMSO was added and mixed by inversion of tubes.
The cells were then heat shocked at 42.degree. C. for 15 minutes,
followed by fast cooling on ice for about 3 min. The cells were
pelleted by a 10-second spin at 14,000 rpm, and the supernatant
removed. The cells were resuspended in 1 mL YPD. The cells were
allowed to recover by incubation for 4 hrs at 30.degree. C., with
shaking at 250 rpm. After the recovery period, the cells were
pelleted and the supernatant removed. At this point the cells were
resuspended in a final volume of about 500 .mu.L of YPD. An aliquot
(20 .mu.L) of the cell suspension was plated on one selection plate
and aliquots of 100 .mu.L were plated on 6 other selection plates.
The plated cells were allowed to incubate at 30.degree. C. until
colony growth was observed.
[0110] The plates used for this transformation contained 300
.mu.g/mL of selection agent (G418). Transformants that grew on
these primary plates were then patch-plated to secondary plates
with the same concentration of selection agent. Colonies growing on
these secondary plates were screened by PCR, using conventional
methods, for integration events at PDC1 using a 3' primer
downstream and outside of the integration fragment (SO4549 5'-CCA
TCC GAA GAA GTC GAT CTC-3'; SEQ ID No:15) and the 5' primer lying
within the G418 resistance gene (SO285 5'-CTT GCC ATC CTA TGG AAC
TGC-3'; SEQ ID No:16). By this PCR analysis only 1 of 200 colonies
was positive. Additional PCR analysis using conventional PCR
methods and PDC1 primers targeted to the deleted BbsI fragment from
pSO27 (-SO2740 5'-GAA GGC TGG GAA TTG AGT GA-3'; SEQ ID No:17 and
-SO2444 5'-GCT CCA TCT GAA ATC GAC AG-3'; SEQ ID No:18) was used to
confirm the presence of intact wild-type PDC1.
[0111] The single positive transformant was isolated as a single
colony, used to produce a glycerol stock, and identified as CD181.
The strain was then cured of the pNC7 plasmid by culturing without
selection pressure, followed with plating the cultured cells on YPD
agar plates comprising G418 (300 .mu.g/mL). Four colonies were
picked and tested for zeocin sensitivity and lack of L-lactic acid
production. All four colonies exhibited zeocin sensitivity and had
lost the ability to produce L-lactic acid. A single colony was
chosen and used to produce a glycerol stock, and identified as
CD186.
[0112] In order create a K. marxianus strain with a PDC-phenotype,
(no ethanol production and no growth under anaerobic conditions),
another transformation of CD186 was necessary. CD186 was
transformed, according to the above protocol, with 6.8 .mu.g of
linearized pSO29 DNA fragment, cut with NheI/NotI, containing the
zeocin selection marker and the deletion in the PDC1 region.
[0113] The resulting transformants were plated on YPD agar plates
comprising 300 .mu.g/mL zeocin. Transformants growing on these
primary plates were patch-plated onto secondary plates with 300
.mu.g/mL G418 and 300 .mu.g/mL zeocin. Colonies growing on these
secondary plates were screened for integration at the PDC1 locus by
PCR, that tested for the absence of the wild-type PDC1, using
primers that are present on the deleted BbsI fragment from pSO27,
-SO2740 5'-GAA GGC TGG GAA TTG AGT GA-3'; SEQ ID No:17, and SO2444
5'-GCT CCA TCT GAA ATC GAC AG-3'; SEQ ID No:18.
[0114] Eight colonies were found to have deletions in PDC1. This
was verified by PCR analysis that showed the expected deletion from
the wild-type PDC1, and the PDC-phenotype (no ethanol production or
anaerobic growth). Single colonies from these eight transformants
were isolated, and entered into the Cargill Dow Culture collection.
These eight K. marxianus pdc1 null strains were named CD214, CD215,
CD216, CD217, CD218, CD219, CD220, and CD221. CD215 was tested for
production of ethanol by inoculating a colony into 50 mL YPD medium
in a 250 shake-flask. The culture was incubated at 30.degree. C.
with shaking at 70 rpm and HPLC analysis of the samples did not
detect any ethanol.
Example 1H
Construction of Plasmid pPS1, Functionally Linking the Hygromycin
Resistance Gene to the PDC1 Promoter and GAL10 Terminator of S.
cerevisiae
[0115] A recombinant nucleic acid conferring hygromycin resistance
to transformed yeast cells, permitting selection of yeast cell
transformants comprising a recombinant nucleic acid construct
encoding a protein useful for synthesis of an organic product, was
prepared as follows. The hygromycin resistance marker (E. coli hph)
was cloned under the transcriptional control of Saccharomyces
cerevisiae PDC1 promoter.
[0116] The E. coli hph gene that confers resistance to hygromycin B
was PCR amplified using the primers 5'HYGXBA1 (5'-AAG CTC TAG ATG
AAA AAG CCT GAA CTC AC-3'; SEQ ID No:19) and 3'HYGBAMH1 (5'-CGC GGA
TCC CTA TTC CTT TGC CCT CGG AC-3'; SEQ ID No:20) and the plasmid
pRLMex30 (see, e.g., Mach et al. 1994, Curr. Genet. 25, 567-570;
Rajgarhia et al., U.S. patent application Ser. No. 10/154,460,
filed May 23, 2002, incorporated by reference in its entirety) as
the template. The hph gene can also be obtained by using the same
primers with E. coli chromosomal DNA serving as template.
Thermocycling was performed by 30 cycles of 1 min at 94.degree. C.,
1 min at 56.degree. C., 3 min at 72.degree. C., followed by a final
incubation of 7 min at 72.degree. C. using Pfu Turbo DNA polymerase
(Stratagene). The PCR product was electrophoretically separated and
on a 0.8% agarose gel and the 1026 by product isolated. The PCR
product was digested with XbaI and BamHI and ligated into the XbaI
and BamHI cut plasmid pNC4 to give the plasmid pPS1 (see FIG.
10).
Example 1I
Construction of pVR43 Containing L. helveticus D-LDH
[0117] D-LDH was isolated from Lactobacillus helveticus as follows.
Lactobacillus helveticus cells were obtained from the American Type
Culture Collection (ATCC Accession #10797) and grown under standard
conditions. Genomic DNA was purified from these cells using the
following protocol: [0118] 1. A single colony or 5 .mu.L from a
glycerol stock of lactic acid bacteria was used to inoculate
2.times.50 mL sterile MRS broth in 250 mL sterile flasks. The
culture was grown with agitation at 37.degree. C. for 48 hours at
170 rpm. [0119] 2. The culture was transferred to 50 mL sterile
blue-capped tubes and centrifuged at 3000 rpm for 10 mins. The cell
pellet was resuspended in 50 mL of 12.5% w/v sucrose solution and
centrifuged again at 3000 rpm for 10 mins. The pellets were
resuspended and combined in 5 mL of 12.5% w/v sucrose in a 50 mL
sterile blue-capped tubes from Falcon (Cat. No. 29050). To the cell
suspension was added 5 mL of TES solution (TES is: 10 mM Tris (pH
8.0), 50 mM EDTA (pH 8.0), 50 mM NaCl, sterile filtered). Another 5
mL of 25% w/v sucrose solution was added and then mixed. Lysozyme
powder (300 mg) was added to the suspension and vortexed to mix.
Once thoroughly mixed, 25 .mu.L of mutanolysin solution (stock
conc. 2.2 mg/mL) was added to the mixture. The suspension was
incubated overnight (.about.10-12 hrs.) at 37.degree. C. [0120] 3.
Following the overnight incubation, 2.5 mL of a 20% SDS solution
and 168 .mu.L of a Proteinase K solution (stock conc. 28 mg/1.4 mL)
were added. The tube was mixed by inversion, but not shaken. The
tube was incubated at 50.degree. C. for 1 hour. At this point the
cell membrane matter appeared broken up and solution became
translucent. Enough NaCl was added to obtain a 0.15 M concentration
in the solution. The solution was mixed thoroughly by inversion.
[0121] 4. The mixture was transferred to a 50 mL Oakridge tube
(Beckman Instruments Inc., Palo Alto, Calif.) or split between two
tubes and treated with an equal volume of phenol:chloroform:isoamyl
alcohol (25:24:1) solution. The mixture was agitated and
centrifuged at 10,000 rpm for 10 min. [0122] 5. The aqueous
supernatant was removed to a clean Oakridge tube, and an equal
volume of chloroform was added. The solution was mixed by shaking
and centrifuged at 5000 rpm for 10 min. [0123] 6. The supernatant
was siphoned off and put into a fresh tube. To the supernatant was
added 25 .mu.L of RNAse (stock conc. 100 mg/mL), which was mixed by
inversion. The tube was incubated at 37.degree. C. for 15 min. The
DNAse free RNAse is added in excess to quickly degrade the RNA.
[0124] 7. Lastly, 2.5 volumes of EtOH was added to the mixture by
careful dispensing along the sides of the tube. The EtOH layer was
not mixed. The DNA that forms at the liquid interface was spooled
using a glass pipette and washed in 70% EtOH. The DNA was air dried
and resuspended in 10 mM Tris-HCl, pH 8.5 (elution buffer in most
Qiagen kits) in a microfuge tube. The tube was incubated at
50.degree. C. until the DNA went into solution.
[0125] Primers were designed based on the available sequence in
Genbank for D-LDH from L. helveticus (Genbank accession #U07604 or
#X66723 (SEQ ID No. 43)). PCR amplification reactions were
performed using Pfu Turbo polymerase (Stratagene, Wis., USA). Each
reaction contained L. helveticus genomic DNA at a concentration of
500 ng, each of 4 dNTPs at a concentration of 0.2 mM, and each of
the amplification primers VR150 5'-GGT TGG ATT TAT GAC AAA GGT TTT
GCTT-3'; SEQ ID No. 21) and VR153 5'-AAT TAA AAC TTG TTC TTG TTC
AAA GCA ACT-3'; SEQ ID No. 22) at 1 .mu.M. Reactions were performed
according to the following cycling conditions: an initial
incubation for 10 min at 95.degree. C., followed by 35 cycles of 30
sec at 95.degree. C., 30 sec at 51.degree. C., and 60 sec at
72.degree. C. A strong product fragment of 1027 by was gel purified
using conventional procedures and TA cloned into the PCR-BluntII
topo cloning vector (Invitrogen, Carlsbad, Calif.). The resulting
plasmid was sequenced and named pVR43 (shown in FIG. 11a). The
resulting sequence could be translated into a polypeptide that
exhibited excellent homology to known L. helveticus D-LDH-encoding
gene sequences in Genbank (Accession # U07604 or #X66723).
Example 1J
Construction of pVR47, Containing L. helveticus D-LDH Under the
Control of the S. cerevisiae PGK1 Promoter and GAL10 Terminator
[0126] Primers were designed to introduce XbaI and BamHI sites at
the 5' and 3' end of the D-LDH gene for cloning into pNC2. PCR
amplification reactions were performed using Pfu Turbo polymerase
(Stratagene, Wis., USA). Each reaction contained pVR43 (harboring
L. helveticus D-LDH) (5 ng), each of 4 dNTPs at a concentration of
0.2 mM, and each of the amplification primers VR165 5'-CGT CTA GAT
TTA TGA CAA AGG TTT TGCT-3'; SEQ ID No. 23 and VR166 5'-GCG GAT CCT
TAA AAC TTG TTC TTG TTC AA-3'; SEQ ID No. 24 at 1 .mu.M. Reactions
were performed according to the following cycling conditions: an
initial incubation for 10 min at 95.degree. C., followed by 35
cycles of 30 sec at 95.degree. C., 30 sec at 55.degree. C., and 60
sec at 72.degree. C. A strong product fragment of 1035 by was gel
purified using conventional procedures and TA cloned using the
PCR-BluntII topo cloning vector (Invitrogen, Carlsbad, Calif.). The
resulting plasmid was sequenced and named pVR44 (see FIG. 11b).
This sequence could be translated into a polypeptide that exhibited
excellent homology to known L. helveticus D-LDH-encoding gene and
had the XbaI and BamHI sites at the 5' and 3' end of the D-LDH
gene.
[0127] Plasmid pNC2 was digested with XbaI and BamHI. The
5'-phosphate ends of the linearized pNC2 was dephosphorylated using
shrimp alkaline phosphatase (Roche Diagnostics, USA) following the
manufacturers protocol. pVR44 was also digested with XbaI and BamHI
and the 1027 by L. helveticus D-LDH gene was isolated by gel
electrophoresis (0.8% agarose gel). The two fragments were ligated
and the resultant plasmid, named pVR47 (see FIG. 4), was sequenced.
The pVR47 plasmid has the S. cerevisiae PGK promoter and GAL10
terminator functionally linked (i.e., transcriptionally-active in a
yeast cell) to the L. helveticus D-LDH gene, as shown in FIG. 12
(SEQ ID NO 43).
Sequence of D-LDH Gene
TABLE-US-00005 [0128]
5'-ATGACAAAGGTTTTTGCTTACGCTATTCGAAAAGACGAAGAACCATT
CTTGAATGAATGGAAGGAAGCTCACAAGGATATCGATGTTGATTACACTG
ATAAACTTTTGACTCCTGAAACTGCTAAGCTAGCTAAGGGTGCTGACGGT
GTTGTTGTTTACCAACAATTAGACTACACTGCAGATACTCTTCAAGCTTT
AGCAGACGCTGGCGTAACTAAGATGTCATTACGTAACGTTGGTGTTGACA
ACATTGATATGGACAAGGCTAAGGAATTAGGTTTCCAAATTACCAATGTT
CCTGTTTACTCACCAAACGCTATTGCTGAACATGCTGCTATTCAGGCTGC
ACGTGTATTACGTCAAGACAAGCGCATGGACGAAAAGATGGCTAAACGTG
ACTTACGTTGGGCACCAACTATCGGCCGTGAAGTTCGTGACCAAGTTGTC
GGTGTTGTTGGTACTGGTCACATTGGTCAAGTATTTATGCGTATTATGGA
AGGTTTCGGTGCAAAGGTTATTGCTTACGATATCTTCAAGAACCCAGAAC
TTGAAAAGAAGGGTTACTACGTTGACTCACTTGACGACTTGTACAAGCAA
GCTGATGTAATTTCACTTCACGTACCAGATGTTCCAGCTAACGTTCACAT
GATCAACGACAAGTCAATCGCTGAAATGAAAGACGGCGTTGTAATTGTAA
ACTGCTCACGTGGTCGACTTGTTGACACTGACGCTGTAATCCGTGGTTTG
GACTCAGGCAAGATCTTCGGCTTCGTTATGGATACTTACGAAGACGAAGT
TGGTGTATTTAACAAGGATTGGGAAGGTAAAGAATTCCCAGACAAGCGTT
TGGCAGACTTAATTGATCGTCCAAACGTATTGGTAACTCCACACACCGCC
TTCTACACTACTCACGCTGTACGTAACATGGTTGTTAAGGCATTCAACAA
CAACTTGAAGTTAATCAACGGCGAAAAGCCAGATTCTCCAGTTGCTTTGA
ACAAGAACAAGTTTTAA-3'
Example 1K
Construction of pVR48, Containing L. helveticus D-LDH Gene and the
Hygromycin Resistance Marker Adjacent to Each Other
[0129] pPS1 was digested with SphI and the 2.259 kbp fragment
containing the hygromycin resistance gene expressed under the
control of the S. cerevisiae PDC1 promoter and GAL10 terminator was
isolated electrophoretically using a 0.8% agarose gel. pVR47 was
digested with SphI and the 5'-phosphate ends of the linearized
plasmid was dephosphorylated using shrimp alkaline phosphatase
(Roche Diagnostics, USA) following the manufacturer's protocol. The
two fragments were ligated and the resultant plasmid was sequenced
and named pVR48 (shown in FIG. 13). The plasmid contains the L.
helveticus D-LDH gene and the hygromycin resistance marker
cassettes adjacent to each other.
Example 1L
Introduction of DNA Encoding the L. helveticus D-LDH Gene Via
Random Integration into the K. marxianus Genome
[0130] A 4.54 kbp fragment containing the L. helveticus D-LDH:HPH
resistance gene cassette was isolated from pVR48 by digesting the
plasmid with SstI and ApaI. The fragment was isolated by gel
electrophoresis on a 0.8% agarose gel. This fragment was used to
transform pdc1 null mutant Kluyveromyces marxianus (CD215; see
Examples 1F, 1G) using an electroporation protocol, described
below:
[0131] A single colony of K. marxianus was used to inoculate 50 mL
of YPD (comprising 10 g/L yeast extract, 20 g/L peptone, 20 g/L
glucose and 2% agar) in a 250 mL baffled shake flask to an
OD.sub.600 of 0.1. The culture was grown 16 hrs at 30.degree. C.
with 250 rpm to a final OD.sub.600 of 10. The cells from 10 mL of
culture were collected by centrifugation and washed one time with
electroporation buffer (EB; 10 mM Tris-C1, 270 mM sucrose, 1 mM
MgCl.sub.2, pH 7.5). The cells were resuspended in incubation
buffer (IB; YPD+25 mM DTT, 20 mM HEPES, pH 8.0) and incubated at
30.degree. C. with 250 rpm for 30 min. The cells were then
harvested by centrifugation and washed one time with EB. The cells
were resuspended in 1 mL EB, and 400 .mu.L of these cells were
transferred to a 0.4 cm electroporation cuvette (BioRad; Hercules,
Calif.).
[0132] 2 .mu.g of the 4.54 kbp SstI/ApaI fragment from pVR48 was
added to the cuvette and the cells were electroporated at 1.8 kV,
1000.OMEGA., 25 .mu.F. The cells were transferred to 1 mL YPD in a
50 mL screw cap Falcon tube and incubated at 30.degree. C. with 250
rpm for 4 hrs before selective plating on YPD containing 200
.mu.g/mL hygromycin. The transformants were grown at 37.degree. C.
for 3 days. The transformants that were resistant to hygromycin
were restreaked onto fresh selective plates containing 200 .mu.g/mL
hygromycin.
PCR Analysis:
[0133] Verification of integration of the fragment into the genome
of K. marxianus CD21 was made using two sets of PCR primers: [0134]
1. One set of primers was designed to be homologous to the L.
helveticus D-LDH gene and a reverse primer homologous to the
hygromycin resistance gene. The primers VR161 5'-AGT TGG TGT ATT
TAA CAA GG-3'; SEQ ID No. 25 and VR142 5'-GTG ACA CCC TGT GCA CGG
CGG GAG ATG-3'; SEQ ID No. 26 were designed to amplify a 1.748 kb
product between L. helveticus D-LDH and the hygromycin resistance
gene in strains that have the cassette and should not amplify any
fragment in strains that do not have the cassette. Thermocycling
was performed on transformant colonies using Taq DNA polymerase
(Qiagen, USA) by initially incubating the reaction mixture for 2
min. at 94.degree. C., followed by 35 cycles of 30 sec at
94.degree. C., 30 sec at 43.degree. C., 3 min at 72.degree. C.,
followed by a final incubation of 7 min at 72.degree. C. [0135] 2.
A second set of primers was designed to be homologous to the PGK
promoter region and a reverse primer homologous to the L.
helveticus D-LDH. The primers VR173 5'-GCG ACG GCT CAC AGG TTT
TG-3'; SEQ ID No. 27, and VR170 5'-CTT GTC TTG ACG TAA TAC ACG TGC
AGC-3'; SEQ ID No. 28, were designed to amplify a 0.75 kb product
between PGK promoter and the L. helveticus D-LDH gene in strains
that have the cassette and should not amplify any fragment in
strains that do not have the cassette. Thermocycling was performed
on transformant colonies using Taq DNA polymerase (Qiagen, USA) by
initially incubating the reaction mixture for 2 min at 94.degree.
C., followed by 35 cycles of 30 sec at 94.degree. C., 30 sec at
55.degree. C., 1 min at 72.degree. C., followed by a final
incubation of 7 min at 72.degree. C. Of the analyzed transformants,
nineteen yielded the expected PCR products.
Enzymatic and GC Verification of D-lactic Acid:
[0136] The optical purity of the D-lactic acid produced by the
transformants was determined using the D-lactic acid detection kit
from Boehringer Mannheim (Roche Diagnostics, USA). The
manufacturer's protocol was followed and indicated that six of the
nineteen transformants produced 0% L-lactic acid.
[0137] Gas chromatographic (GC) analysis of the supernatant from
the transformants indicated that the strains produced greater than
99% D-lactic acid.
[0138] GC Analysis Method
[0139] The separation and quantification of "D" and "L" enantiomers
of lactic acid is accomplished using a chiral gas chromatography
method. The established method involves the base-catalyzed
hydrolysis of samples in methanol, followed by acidification with
sulfuric acid to catalyze esterification and subsequent extraction
of methyl lactate enantiomers into methylene chloride. The organic
layer is then analyzed by gas chromatography (GC) using a flame
ionization detector (FID) [Hewlett Packard 6890 with
split/splittless injector set in split mode, auto injection, and a
FID detector]. Separation of the methyl lactate enantiomers is
achieved using a chiral capillary column [30 meter.times.0.25 mm
i.d. .beta.-Dex 325 capillary column (0.25 .mu.m film thickness),
Supelco.(#24308)]. The normalized relative percentages of "D" and
"L" lactic acid are obtained from this method.
[0140] Samples for GC analysis are prepared by weighing an amount
of sample (1.000 g) into a 20 mL glass vial, to which is added 4 mL
of methanol. The vial is capped and 150 .mu.L of concentrated
sulfuric acid is added slowly. The vial is placed at 65.degree. C.
in Reati-therm heater/stirrer for 10 minutes. Deionized water is
then added (5 mL) to the vial, followed by addition of 10 mL of
methylene chloride. The vial is capped and vigorously shaken. Using
a disposable plastic syringe fitted with tube-tipped filter, a
portion of the bottom organic layer is removed and the remaining
bottom organic layer is transferred to a 2 mL GC vial for injection
into the GC.
Example 1M
Production of D-Lactic Acid in YPD Plus Glucose Medium in
Shake-Flask Cultures by K. marxianus Harboring L. helveticus D-LDH
Gene Integrated into the Genome Under Buffered Conditions
[0141] The six transformants that produced optically pure D-lactic
acid were named CD554, CD555, CD556, CD557, CD558 and CD559. These
strains were cultivated in 250 mL baffled shake flasks containing
50 mL YPD, supplemented with 100 g/L glucose, and were inoculated
from YPD agar plates. The cultures were grown for 16 hours at
30.degree. C. with 250 rpm shaking to an OD.sub.600 of 0.1. After
determining that residual glucose remained in each flask and that
the cells were in exponential growth phase, 4 g/L cell dry weight
equivalents were harvested by centrifugation and resuspended in 250
mL baffled shake flasks containing 50 mL YPD supplemented with
approximately 100 g/L glucose and 55 g/L CaCO.sub.3. The cultures
were placed at 30.degree. C. with 70 rpm. Samples were withdrawn at
various time intervals and the cells were removed by filtration.
Culture supernatant was analyzed for glucose, D-lactate, pyruvate
and ethanol by HPLC (described below).
HPLC Analysis Method
[0142] The HPLC methods utilized in the following experiments
employ a Bio-Rad Fast Acid Analysis Column combined with a Rezex
Fast Fruit Analysis Column, each containing styrenedivinyl benzene
resin in the hydrogen form. The organic components are quantified
with a Refractive Index detector combined with a UV detector at 220
nm, using isobutyric acid as an internal standard. Samples are
prepared by weighing out a known amount of sample and diluting it
in the presence of an internal standard. The resulting solution is
injected into a HPLC system and quantified using known
standards.
[0143] Under these culture conditions, CD554, CD555, CD556, CD557,
CD558, CD559 strains produced greater than 99% D-lactic acid, with
a 92-98% yield based on glucose, a D-lactic acid titer ranging from
82-90 g/L, and a volumetric productivity greater than 2.2 g/L/hr at
30.degree. C.
Example 2A
Construction of Strains with Deletions of the PDC1 Coding Sequence
and the L. Helveticus D-LDH Gene Integrated at the PDC1 Locus Using
a One-Step Replacement Method
[0144] The plasmid pCA50 was constructed by ligating the 4.7 kb
NgoMIV/PsiI fragment from plasmid pVR48 (Example 1K) into the
backbone of plasmid pBH5c (described in Example 3B; FIG. 16c) cut
with MscI and SgrAI. The pVR48 fragment contained the L. helveticus
D-LDH gene driven by the S. cerevisiae PGK promoter, followed by
the S. cerevisiae GAL10 transcription termination sequence. This
expression cassette is adjacent to the hygromycin resistance gene
(hph), driven by the S. cerevisiae PDC1 promoter, followed by the
GAL10 terminator (S. cerevisiae). The pVR48 fragment was ligated
into the pBH5c backbone, generating the plasmid pCA50, wherein the
D-LDH:hph construct is flanked by the sequences immediately
upstream and downstream of the K. marxianus PDC1 locus (FIG.
14).
[0145] The plasmid pCA50 was digested with SbfI and BseRI to
generate a 6272 bp fragment. 2.5 .mu.g of this fragment was
isolated and purified by gel electrophoresis to be used for
transformation. Wild-type K. marxianus (CD21) was transformed with
the purified fragment using the electroporation protocol disclosed
in Example 1M. Transformed cells were plated on YPD selection
plates containing 150 .mu.g/mL hygromycin to select for cells that
contain either a random integration of the pCA50 fragment into the
genome, or a homologous replacement of the wild-type PDC1 locus by
the fragment. Colonies were isolated after 3 days growth at
30.degree. C. and streaked onto fresh YPD with 150 .mu.g/mL
hygromycin to confirm the phenotype.
[0146] The colonies were assayed by PCR in order to identify those
that contained the homologous replacement of the wild-type PDC1
locus by the pCA50 fragment. Cells were resuspended in the PCR
reaction in order to provide template DNA. The 5' primer oCA85
5'-GGA CCG ATG GCT GTG TAG AA-3'; SEQ ID No. 29, was designed to
amplify the 3' end of the hph gene. The 3' primer oCA80 5'-TCG CTT
ACC TCG GTA CAG AA-3'; SEQ ID No. 30, was designed to amplify the
sequence downstream of the K. marxianus PDC1 locus, which is not
contained in the pCA50 construct. The amplification assay used as a
probe for the target sequence employed Taq polymerase (Qiagen) and
the following PCR reaction conditions: initial melting step at
95.degree. C. for 10 min, followed by 40 amplification cycles of 30
sec at 95.degree. C., 30 sec at 55.degree. C., and 3 min at
72.degree. C., followed by 10 min at 72.degree. C.
[0147] Transformed cells having a homologous replacement event
generated a 2.5 kb PCR product. Random integration events will not
generate a PCR product with the oCA85 and oCA80 primers. Strains
CD597 through CD601 were positive for this 2.5 kb PCR product.
Example 2B
Production of D-Lactic Acid in Complex CaCO.sub.3 Buffered Media in
Microaerobic Shake Flask Cultures of K. marxianus with a Single
Copy of D-LDH Integrated into the PDC1 Locus Using a One-Step
Replacement Method
[0148] The pdc1.DELTA.::Lh-D-LDH strain CD587 (from Example 3E)
which is the result of a two-step replacement event was compared to
the pdc1.DELTA.::Lh-D-LDH strains CD597, CD599, and CD600,
generated by a one-step replacement event (from Example 2A) to
determine if these strains produced similar lactic acid titers
independent of the method of generation.
[0149] Biomass was generated in baffled shake flasks by growth
overnight at 37.degree. C. at 225 rpm agitation in YPD+100 g/L
glucose and +50 g/L CaCO.sub.3. Production flasks were inoculated
with 2 g/L cell dry weight from the overnight biomass shake flasks.
Production conditions were YPD media +100 g/L glucose and +50 g/L
CaCO.sub.3 with shaking at 70 rpm in baffled shake flasks at
35.degree. C. Samples were taking at various time points: biomass
and CaCO.sub.3 were removed by filtration and filtrates were
analyzed for glucose, lactate, EtOH and pyruvate by HPLC (Example
1M)
[0150] After 54 hours, CD587, CD589, and CD590 had consumed 85-88
g/L glucose, producing 81 g/L lactate and 2.5 g/L pyruvate. These
lactate titers represent a 92-95% lactate yield on glucose and a
volumetric productivity greater than 1.5 g/L hr during the
microaerobic. These results show that the D-LDH transformants can
produce D-lactic acid. Enzymatic analysis of the lactic acid
produced by these strains showed that the lactic acid in greater
than 99% enantiomerically pure D-lactic acid.
[0151] These results show that the D-LDH transformants generated
using a one-step gene replacement strategy (CD597, CD599 and CD600)
can produce D-lactic acid similarly to the two-step replacement
strain, CD587.
Example 3A
Construction of the pVR29 Plasmid having the G418 Resistance Gene
Functionally Linked to the S. cerevisiae PGK Promoter and GAL10
Terminator (pVR29)
[0152] The G418 resistance marker (pVR22; Example 1C) was cloned
into pNC2 (Example 1A) and the construct was designated pVR29 (FIG.
15). The S. cerevisiae PGK promoter and the S. cerevisiae GAL10
terminator was used to express the G418 resistance gene. The G418
resistance gene was amplified by PCR using the Pfu Polymerase
(Stratagene, Madison, Wis.) with primers 5'-GCT CTA GAT GAG CCA TAT
TCA ACG GGA AAC (5'G fragment; SEQ. ID NO. 9) and 5'-ATG GAT CCT
TAG AAA AAC TCA TCG AGC ATC (3' G fragment; SEQ. ID NO. 10) and the
plasmid pVR22 (Example 10) as the template. Alternately plasmid
pPIC9K (Invitrogen, Carlsbad, Calif.) can also be used as a
template. Thermocycling was performed by initially incubating the
reaction mixture for 5 min at 95.degree. C., followed by 35 cycles
of 30 sec at 95.degree. C., 30 sec at 49.degree. C., and 2 min at
72.degree. C., followed by a final incubation for 10 min at
72.degree. C. The PCR product was digested with BamHI and XbaI and
a 821 by fragment was isolated and ligated to the 4303 by
BamHI-XbaI fragment of pNC2. The resulting plasmid, pVR29 (FIG. 15)
contained the PGK promoter and GAL10 terminator operably linked
(i.e., transcriptionally-active in a yeast cell) to the G418
resistance gene.
Example 3B
Plasmid for the Targeted Integration of DNA into the PDC1 Locus of
K. marxianus
[0153] The DNA sequence flanking the PDC1 gene of K. marxianus was
cloned into the plasmid pVR29 (Example 3A, FIG. 15) to generate a
recombinant nucleic acid for directed DNA integration at the PDC1
locus. The resulting construct was designated pBH5a FIG. 16a) pBH5a
comprises an SbfI restriction site that allows cloned genes to be
operatively linked to the PDC1 promoter.
[0154] A 1254 by fragment of DNA immediately upstream of PDC1 was
amplified by PCR with the primers 5'-CAA GAA GGT ACC CCT CTC TAA
ACT TGA ACA-3' (5'-Flank 5'; SEQ ID No. 31) and 5'-GTA ATT CCT GCA
GGT GCA ATT ATT TGG TTT GG-3' (5'-Flank 3'; SEQ ID No. 32) and the
plasmid pSO21 (FIG. 7B, Example 1F) as the template. Thermocycling
was done by initially incubating the reaction mixture for 2 min at
94.degree. C., then by 35 cycles of 30 sec at 94.degree. C., 30 sec
at 55.degree. C., and 1.5 min at 72.degree. C., followed by a final
incubation of 7 min at 72.degree. C. The 1254 by PCR product was
electrophoretically separated on a 0.8% agarose gel and isolated.
The PCR product and pVR29 (FIG. 15a) were both digested with KpnI
and SbfI. The digested PCR product was ligated to the 5067 by pVR29
to give the 6315 by pBH5a (see FIG. 11A). The resulting plasmid
contains a G418 resistance gene operatively linked to the S.
cerevisiae PDC1 promoter and GAL10 terminator and a 1240 by
fragment of DNA homologous to DNA immediately upstream of the PDC1
gene.
[0155] A 535 by fragment of DNA immediately downstream of PDC1 was
PCR amplified with primers 5'-CCA AGC CCT GCA GGA GAG GGA GAG GAT
AAA GA-3' (3'-Flank 5'; SEQ ID No. 33) and 5'-CTC GTA ACG CGT GTA
CAA GTT GTG GAA CAA-3' (3'-Flank 3': SEQ ID No. 34) using the
plasmid pSO21 (FIG. 7A) as the template. Thermocycling was done by
initially incubating the reaction mixture for 2 min. at 94.degree.
C., then amplified by 35 cycles of 30 sec at 94.degree. C., 30 sec
at 55.degree. C., and 45 sec at 72.degree. C., followed by a final
incubation of 4 min at 72.degree. C. The PCR product was separated
electrophoretically on a 0.8% agarose gel and the 535 by product
isolated. The PCR product was digested with SbfI and MluI. The 529
by fragment was ligated with the SbfI-MluI fragment of pBH5a to
give the plasmid pBH5b. pBH5b contains 1.2 kb of DNA immediately
upstream, and 0.5 kb of DNA immediately downstream, of PDC1 with a
unique SbfI site located between the flanking pdc1 sequences, also
including a selectable G418 resistance marker operatively linked to
the S. cerevisiae PDC1 promoter and GAL10 terminator, and is shown
schematically in FIG. 16b.
[0156] A portion of the PDC1 (K. marxianus) locus was also
subcloned into the commercial plasmid pUC19 (Invitrogen) to
generate pBH5c, as follows. Plasmid pSO21 was digested with Nhe I
and Nde I and the 3339 by DNA fragment containing 486 by of DNA
immediately upstream of PDC1, the complete sequence of PDC1, and
1157 by of DNA immediately downstream of PDC1 was isolated
following electrophoretic separation on a 0.8% agarose gel. pUC19
was digested with XbaI and NdeI and the 2452 by DNA fragment was
isolated following electrophoretic separation on a 0.8% agarose
gel. The digested pUC19 and the PDC1 locus were ligated together to
give the 5791 by pBH5c, and shown schematically in FIG. 16c.
Example 3C
Plasmid for the Targeted Integration of the L. helveticus D-LDH
Gene into the PDC1 Locus of K. marxianus
[0157] The D-LDH gene from pVR48 (Example 1K) was cloned into the
SbfI site of pBH5b to create a recombinant nucleic acid capable of
integrating the D-LDH into the K marxianus PDC1 locus and
expressing D-LDH under control of the endogenous PDC1 promoter and
terminator.
[0158] The D-LDH gene was PCR amplified using the primers 5'-TTT
TTA CCT GCA GGC TAG ATT TAT GAC AAA GG-3' (Lh-D-LDH 5'; SEQ ID No.
35) and 5'-TCT ACC CCT GCA GGA AAA CTT GTT CTT GTT CA-3' (Lh-D-LDH
3'; SEQ ID No. 36) using pVR47 (Example 1J) as a template.
Thermocycling was performed by 30 cycles of 30 sec at 94.degree.
C., 30 sec at 55.degree. C., 1.5 min at 72.degree. C., followed by
a final incubation for 4 min at 72.degree. C. using the Failsafe
PCR System (Epicentre, Madison, Wis.). The PCR product was
electrophoretically separated on a 0.8% agarose gel and the 1028 by
product was isolated. The PCR product was digested with SbfI and
ligated to the 6844 by SbfI-digested pBH5b to give the 7872 by
plasmid pBH6. pBH6 contains the D-LDH gene operatively linked to
the PDC1 promoter and terminator, along with a G418 resistance
marker operatively linked to the S. cerevisiae PDC1 promoter and
GAL10 terminator, shown schematically in FIG. 17.
Example 3D
Integration of pBH6 into the PDC1 Locus, Creating the K. marxianus
Strain CD588
[0159] The integration plasmid pBH6, containing D-LDII was
transformed into wild type K. marxianus (CD21). The entire plasmid
was integrated into the PDC1 locus via an initial single homologous
recombination between the flanking PDC1 DNA immediately upstream of
the D-LDH gene of pBH6 and the DNA immediately upstream of the PDC1
gene on the chromosome. The resulting strain contains the wild type
copy of PDC1 as well as a single copy pBH6 integrated at the PDC1
locus.
[0160] CD21 was used to inoculate 50 mL of YPD, supplemented with
100 g/L glucose in a 250 mL baffled shake flask to an OD.sub.600 of
0.1. The culture was grown for 16 hrs at 30.degree. C. with 250 rpm
to a final OD.sub.600 of 12. The cells from 10 mL of culture were
collected by centrifugation and washed once with electroporation
buffer (EB; 10 mM Tris-Cl, 270 mM sucrose, 1 mM MgCl.sub.2, pH
7.5). The cells were resuspended in incubation buffer (YPD+25 mM
DTT, 20 mM HEPES, pH 8.0) and incubated at 30.degree. C. with 250
rpm for 30 min. The cells were harvested by centrifugation and
washed once with EB. The cells were resuspended in 1 mL EB, and 400
.mu.L of this suspension was transferred to a 0.4 cm
electroporation cuvette. 12 .mu.g of uncut pBH6 in a total volume
of 50 .mu.L was added to the cuvette and the cells were
electroporated at 1.8 kV, 1000.OMEGA., 25 .mu.F. The cells were
transferred into 1 mL YPD in a 50 mL screw cap Falcon tube and
incubated at 30.degree. C. with 250 rpm shaking for 4 hrs before
selective plating on YPD containing 300 .mu.g/mL G418. The
transformants were grown at 37.degree. C. for 2 days. Transformants
that grew were streaked onto fresh selection plates.
[0161] Verification of proper integration of pBH6 into the PDC1
locus via a single homologous recombination between the flanking
PDC1 DNA immediately upstream of the D-LDH gene of pBH6 and the DNA
immediately upstream of the PDC1 gene on the K. marxianus
chromosome was evaluated using primers 5'-AAG CAC CAA GGC CTT CAA
CAG-3' (PDC1 Chromosome 5'; SEQ ID No. 37) and GTC TTG ACG TAA TAC
ACG TGC AGC-3' (D-LDH 3'; SEQ ID No. 38) designed to amplify a 2.7
kb product between chromosomal DNA upstream of the PDC1 gene and
outside of the homology incorporated in pBH6, and the D-LDH gene.
Thermocycling was performed by incubating the reaction mixture for
2 min at 94.degree. C., followed by 35 cycles of 30 sec at
94.degree. C., 30 sec at 55.degree. C., and 3 min at 72.degree. C.,
followed by a final incubation of 7 min at 72.degree. C. Seven of
the ten transformants analyzed gave the expected 2.7 kb PCR
product. Two products resulted from PCR analysis, using primers
designed to amplify the PDC1 locus 5'-CGC AAA GAA AAG CTC CAC
ACC-3' (PDC1 5'; SEQ ID No. 39) and 5'-CCC ATA CGC TTA TAA TCC
CCC-3' (PDC1 3'; SEQ ID No. 40), a 1.7 kb band corresponding to
PDC1, and a 1.0 kb band corresponding to D-LDH. Thermocycling was
performed by incubating the reaction mixture for 2 min. at
94.degree. C., followed by 35 amplification cycles of 30 sec at
94.degree. C., 30 sec. at 55.degree. C., 2 min. at 72.degree. C.,
and by a final incubation of 5 min at 72.degree. C. Southern blot
analysis using a probe designed to detect the G418 resistance gene
was used for further verification of single copy integration event.
One of the seven transformants analyzed showed the proper banding
pattern consistent with the integration of one copy of pBH6. The
strain with one copy of pBH6 located at PDC1 locus, as verified by
PCR and Southern analysis, was designated CD588.
[0162] These results demonstrate that targeted integration of the
transformed pBH6 DNA into the PDC1 locus of wild-type K. marxianus
CD21 has occurred through a single homologous recombination between
the PDC1 promoter sequences. These results also confirm that pBH6
is present as a single copy in strain CD588.
Example 3E
Loss of pBH6 Plasmid Backbone and the PDC1 Gene from CD588,
Generating K. marxianus Strains CD587, CD589 and CD590
[0163] CD588 was propagated on non-selective media for several
rounds of growth to encourage a second homologous recombination
between the PDC1 terminator sequences of the integrated pBH6 and
the native PDC1 terminator. A second homologous recombination event
in the terminator sequences resulted in a strain where the PDC1
gene was replaced by the D-LDH gene. This strain is free of the
G418 resistance marker gene due to loss of the G418 gene, along
with the PDC1 gene, occurring as a result of the second
recombination event. The resultant strain wherein PDC1 is replaced
by D-LDH exhibited a G418-sensitive phenotype along with a lack of
anaerobic growth.
[0164] CD588 was plated on YPD agar plates and grown overnight at
37.degree. C. A swab of colonies was transferred to fresh YPD agar
plates. This was repeated four times. Following the fifth round of
non-selective growth on YPD agar plates, 6.times.250 mL baffled
shake flasks containing 50 mL YPD supplemented with 100 g/L glucose
and 42 g/L CaCO.sub.3 were inoculated to an OD.sub.600 of 0.1 with
CD588 cells from the fifth round of non-selective plating. The
shake flasks were grown at 30.degree. C. with 250 rpm for 16 hrs.
The cultures were then diluted and used to plate for single
colonies on YPD agar plates. In addition, a swab of colonies from
the fifth round of non-selective growth plates was suspended in 1
mL PBS (phosphate-buffered saline) and subsequently diluted and
used to plate for single colonies on YPD agar plates. Single
colonies resulting from this round of plating, were plated on YPD
agar and placed in an anaerobic chamber. Following growth for 2
days at 37.degree. C., the anaerobic chamber was opened and
colonies that grew anaerobically were marked. The plates were
incubated an additional day at 37.degree. C. Colonies that grew
aerobically but not anaerobically were transferred to triplicate
plates for screening. The plates used for these screening
conditions were YPD plates (aerobic), YPD plates (anaerobic), and
YPD plates supplemented with 300 .mu.g/mL G418. Three transformants
were identified with the desired phenotype having G418 sensitivity
and a lack of anaerobic growth. These transformants were designated
CD587, CD589, and CD590.
[0165] Confirmation of the replacement of PDC1 with D-LDH was
performed using primers 5'-CGC AAA GAA AAG CTC CAC ACC-3' (PDC1 5';
SEQ ID No. 39) and 5'-CCC ATA CGC TTA TAA TCC CCC-3' (PDC1 3'; SEQ
ID No. 40), designed to amplify the PDC1 locus, using chromosomal
DNA from CD587, CD589, and CD590 as templates. Thermocycling was
performed by initially incubating the reaction mixture for 2 min at
94.degree. C., followed by 35 cycles of 30 sec at 94.degree. C., 30
sec at 55.degree. C., 2 min at 72.degree. C., and by a final
incubation of 5 min at 72.degree. C. Chromosomal DNA from all three
strains yielded a single 1.0 kb PCR product corresponding to D-LDH.
Southern blot analysis using a probe designed to hybridize to the
G418 gene indicated the absence of the G418 gene. Further, Southern
analysis with a probe for the PDC1 coding region did not show any
bands. Probes designed to hybridize to regions immediately upstream
and downstream of PDC1 gave bands with sizes consistent with the
replacement of PDC1 with D-LDH.
[0166] These results demonstrate that the PDC1 gene, along with the
pBH6 plasmid backbone containing the G418 resistance marker
operatively linked to the S. cerevisiae PDC1 promoter and GAL10
terminator, were lost from the chromosome of CD588 through a second
homologous recombination event that occurred between the two pdc1
terminators present at the PDC1 locus of CD588. This second
recombination event provides a strain where the PDC1 gene has been
exactly replaced by the D-LDH gene flanked by SbfI sites.
Example 3F
Production of D-Lactic Acid in Complex CaCO.sub.3 Buffered Media in
Microaerobic Shake Flask Cultures of K. marxianus with a Single
Copy of D-LDH Integrated into the PDC1 Locus
[0167] The Pdc+ Lh-D-LDH strain CD588 and the Pdc-Lh-D-LDH strains
CD587, CD589, and CD590 were cultivated in 250 mL baffled shake
flasks containing 50 mL YPD supplemented with 100 g/L glucose and
50 g/L CaCO.sub.3, following inoculation to an OD.sub.600 of 0.1
from YPD agar plates, for 16 hours at 30.degree. C. with 250 rpm.
After ensuring that residual glucose remained in each flask and
that the cells were in exponential growth phase, 4 g/L cell dry
weight equivalents were harvested by centrifugation and resuspended
in 250 mL baffled shake flasks containing 50 mL YPD supplemented
with 100 g/L glucose and 50 g/L CaCO.sub.3. The cultures were
placed at 30.degree. C. with 70 rpm. Samples were withdrawn at
various time intervals and the cells were removed by filtration.
Culture supernatant was analyzed for glucose, lactate, pyruvate and
ethanol by HPLC (described above Example 1M).
[0168] After 23 hours, the Pdc+Lh-D-LDH strain CD588 had consumed
127 g/L glucose, and produced 33 g/L lactate, 37 g/L ethanol, and
0.2 g/L pyruvate. The Pdc-Lh-D-LDH strains CD587, CD589, and CD590
had consumed 40-43 g/L glucose, producing 36-39 g/L lactate and
1.0-1.3 g/L pyruvate.
[0169] After 54 hours, CD587, CD589, and CD590 had consumed 85-88
g/L glucose, and produced 81 g/L lactate and 2.5 g/L pyruvate.
These lactate titers represent a 92-95% lactate yield on glucose
and a volumetric productivity greater than 1.5 g/L/hr during the
microaerobic production phase. After 54 hours, an insoluble calcium
lactate precipitate formed ("caked") due to the high levels of
D-lactate produced in the cultures, preventing further analysis.
Enzymatic and GC analysis, according to Example 1L, showed that
more than 99% of the lactate produced was D-lactate. No ethanol was
detected in cultures of CD587, CD589, and CD590, consistent with
the replacement of PDC1 by LDH.
[0170] These results show that the D-LDH transformants can produce
D-lactic acid. Lactic acid production with a functional PDC1
resulted in the approximate equal production of lactic acid and
ethanol, demonstrating that the D-LDH can compete with the native
PDC1 for pyruvate. By replacing the PDC1 with D-LDH from L.
helveticus, the lactic acid titer increased two-fold, resulting in
high titers and yields that approach the theoretical maximum.
Further, these strains did not produce ethanol, demonstrating the
replacement of PDC1 with D-LDH. Enzymatic analysis of the lactic
acid produced by these strains showed that the lactic acid in
greater than 99% enantiomerically pure D-lactic acid.
Example 3G
Production of D-Lactic Acid at High Temperatures in Complex
CaCO.sub.3 Buffered Media in Microaerobic Shake Flask Cultures of
K. marxianus Strains
[0171] Wild type K. marxianus CD21, the PDC+Lh-D-LDH strain CD588,
and the Pdc-Lh-D-LDH strains CD558 and CD587 were inoculated to an
OD.sub.600 of 0.1 from YPD agar plates and were grown for 16 hours
at 33.degree. C. with 250 rpm, in 250 mL baffled shake flasks
containing 50 mL YPD supplemented with 100 g/L glucose and 50 g/L
CaCO.sub.3. After determining that residual glucose remained in
each flask and that the cells were consequently in exponential
growth phase, 4 g/L cell dry weight equivalents were harvested by
centrifugation and resuspended in 250 mL baffled shake flasks
containing 50 mL YPD supplemented with 100 g/L glucose and 50 g/L
CaCO.sub.3. The cultures were grown at 37.degree. C., 42.degree.
C., or 50.degree. C. with 70 rpm. Samples were withdrawn at various
time intervals and the cells were removed by filtration. Culture
supernatant was analyzed for glucose, lactate, pyruvate, acetate,
glycerol and ethanol by HPLC methods (From Example 1M).
[0172] After 23 hours, the PDC+Lh-D-LDH strain CD588, fermenting at
37.degree. C., had consumed 115.5 g/L glucose and produced 16.2 g/L
lactate, 37.6 g/L ethanol, 7.6 g/L glycerol, 2.6 g/L acetate, and
0.2 g/L pyruvate. After 47 hours at 37.degree. C., the PDC-Lh-D-LDH
strains CD558 and CD587 had consumed 99-105 g/L glucose and
produced 90-99 g/L lactate, 2.7-3.5 g/L pyruvate and 1.2-1.4 g/L
acetate. In contrast, wild-type strain CD21 consumed 115.5 g/L
glucose and produced principally ethanol (43.5 g/L) and a small
amount of lactate (1.7 g/L).
[0173] After 23 hours, the PDC+Lh-D-LDH strain CD588, fermenting at
42.degree. C., had consumed 115.5 g/L glucose and produced 12.8 g/L
lactate, 34.7 g/L ethanol, 6.9 g/L glycerol, 3.0 g/L acetate and
0.3 g/L pyruvate. After 47 hours at 42.degree. C., the PDC-Lh-D-LDH
strains CD558 and CD587 had consumed 80 g/L glucose and produced 75
g/L lactate, 2.5 g/L ethanol and 1.5 g/L acetate. In contrast,
wild-type strain CD21 consumed 115.5 g/L glucose, and produced
principally ethanol (39.7 g/L) and a small amount of lactate (1.0
g/L).
[0174] After 47 hours, the PDC+Lh-D-LDH strain CD588 fermenting at
50.degree. C. had consumed 49.6 g/L glucose and produced 6.8 g/L
lactate, 9.5 g/L ethanol, 4.5 g/L glycerol, and 1.8 g/L acetate.
After 47 hours at 50.degree. C., the PDC-Lh-D-LDH strains CD558 and
CD587 had consumed 15 g/L glucose and produced 10 g/L lactate,
1.2-1.4 g/L pyruvate, and 1.6-1.7 g/L acetate. In contrast,
wild-type strain CD21 consumed 70.5 g/L glucose and produced
principally ethanol (13.6 g/L) and a small amount of lactate (0.5
g/L).
[0175] These results demonstrate that the D-Ldh+ transformants can
produce D-lactic acid at temperatures as high as 50.degree. C. The
lactic acid produced by these strains is greater than 99%
enantiomerically pure D-lactic acid, as determined by enzymatic
analysis. Although the overall glucose consumption and lactate
production rates decrease with increasing temperature, the yield of
lactate from glucose remains between 88-100% for the PDC-Lh-D-LDH
strains CD558 and CD587.
Example 3H
Production of D-lactic acid in unbuffered complex media in
microaerobic shake flask cultures of K. marxianus with a single
copy of L. helveticus D-LDH integrated into the chromosome,
strains
[0176] Wild-type K. marxianus strain CD21, the PDC+Lh-D-LDH strain
CD588, and the PDC-Lh-D-LDH strains CD558 and CD587 were inoculated
to an OD.sub.600 of 0.1 from YPD agar plates and grown for 16 hours
at 30.degree. C. with shaking at 250 rpm, in 250 mL baffled shake
flasks containing 50 mL YPD supplemented with an additional 100 g/L
glucose. After determining that residual glucose remained in each
flask and that the cells were consequently in exponential growth
phase, 4 g/L cell dry weight equivalents were harvested by
centrifugation and resuspended in 250 mL baffled shake flasks
containing 50 mL YPD supplemented with 40 g/L glucose, in
duplicate. The cultures were placed at 37.degree. C. with 70 rpm.
Samples were withdrawn at various time intervals and the cells were
removed by filtration. Culture supernatants were analyzed for
glucose, lactate, pyruvate, acetate, glycerol and ethanol by
HPLC.
[0177] After 23 hours, the PDC+Lh-D-LDH strain CD588 had consumed
58.9 g/L glucose, and produced 0.9 g/L lactate, 0.2 g/L pyruvate,
2.6 g/L glycerol, and 0.6 g/L acetate. The final culture pH was
measured as 4.6. Ethanol was the main product from this
fermentation, at 24-24.7 g/L. After 23 hours, PDC-Lh-D-LDH strains
CD558 and CD587 had consumed 4.1 g/L glucose and produced between
2.5 g/L lactate, 1.0 g/L pyruvate, 0.8 g/L glycerol, and 0.4 g/L
acetate. The final culture pH for the CD587 and CD558 strains
ranged from 3.31-3.65. Lactate was the main product of the
fermentation, at a level ranging from 1.2-3.3 g/L. Wild-type strain
CD21 consumed 58.9 g/L glucose in 23 hours and produced mostly
ethanol (12.8-20.4 g/L) and a small amount of lactate (1.2-1.3
g/L), with a final pH of 4.65.
[0178] These results show that the D-Ldh+ transformants produce
D-lactic acid at pH values as low as 3.31. Enzymatic analysis of
the lactic acid produced by these strains showed that the lactic
acid in greater than 99% enantiomerically pure D-lactic acid.
Example 3I
D-Lactic Acid Production from D-Xylose in Strains
[0179] Three engineered K. marxianus strains were analyzed for
D-lactic acid production from D-xylose relative to CD21
(wild-type), including CD558 (PDC1 null containing randomly
integrated L. helveticus D-LDH), CD587 (PDC1::Lh-D-LDH), and CD588
(containing L. helveticus D-LDH). The following results demonstrate
that the engineered strains can produce D-lactic acid from a
non-glucose substrate.
[0180] Cells of strains CD21, CD558, CD587, and CD588 were grown on
YPD+20 g/L D-xylose agar plates and used to inoculate baffled shake
flasks containing 100 mL of culture medium that contained 20 g/L
yeast extract, 10 g/L peptone, 17 g/L CaCO.sub.3, and 50 g/L
D-xylose. The inoculated shake flasks were incubated at 35.degree.
C. and shaken at 250 rpm. Samples were taken from the flasks and
the OD.sub.600nm measured in order to monitor culture growth and
sugar utilization. After about 36 hours, the cells were collected
by centrifugation, and cell dry weight (CDW) of each culture was
determined. Into duplicate baffled shake flasks containing 20 g/L
yeast extract, 10 g/L peptone, and 50 g/L D-xylose was added 3.0
g/L CDW of cells from each strain. The flasks were incubated at
35.degree. C. with shaking at 70 rpm. Samples were taken at various
time points for HPLC analysis and quantification of the medium
components, including xylose, D-lactate, xylitol, and ethanol.
[0181] The main organic component produced by strains CD558 and
CD587 was D-lactic acid, which reached an average highest titer of
13.7 g/kg. This results in a D-lactic acid yield from D-xylose of
about 33%. The main organic component produced by strain CD21 is
xylitol, which reached an average highest titer of 25.0 g/kg. This
results in a xylitol yield from D-xylose of about 50%. The main
organic component produced by strain CD588 was xylitol, which
reached an average highest titer of 19.6 g/kg. This results in an
average xylitol yield from D-xylose of about 44%. HPLC analysis did
not detect any glycerol, citric, pyruvate, succinic, or acetate
production in any of the strains.
Example 4
Plasmids for Expression of the B. megaterium D-LDH and for Targeted
Integration of the Transformed DNA into the PDC1 Locus
[0182] Plasmids comprising a B. megaterium D-LDH gene for targeted
integration into the C. sonorensis PDC1 gene locus are prepared as
follows:
[0183] Plasmid pMI257 (Candida application) is linearized with NcoI
and the 5' overhangs were partially filled in with DNA polymerase
I, Klenow fragment, and a mixture of dATP, dCTP, and dTTP, omitting
dGTP from the reaction. This is followed by removal of the single
stranded extensions by treatment with mung bean nuclease. The DNA
is then digested with BamHI and the 9200 by fragment isolated from
a 0.8% agarose gel after electrophoretic separation. Plasmid pVR47
(Ex. 1J) containing B. megaterium D-LDH is generated from B.
megaterium genomic DNA, and is shown in FIG. 12. The 1023 by
fragment containing the B. megaterium LDH is excised from pVR47 by
XbaI and digestion followed by fill-in of the 5' overhangs by DNA
polymerase I, Klenow fragment and each of the 4 dNTPs, and
digestion by BamHI. The 9200 by NcoI (blunt)-BamHI fragment from
pMI257 and the 976 by XbaI(blunt)-BamHI fragment from pVR47 are
ligated and the resulting plasmid is designated as pMIXXX, shown in
FIG. 18. pMI1000 contains, in order, the C. sonorensis PDC1
promoter, the C. sonorensis PGK1 promoter operatively linked to the
S. cerevisiae MEL5 gene, the C. sonorensis PGK1 promoter
operatively linked to the B. megaterium D-LDH and the C. sonorensis
PDC1 terminator. PMI1000 is digested with NotI to excise the 7300
by fragment that consists of the MEL5 and LDH expression cassettes
flanked by the PDC1 5' and 3' regions. This 7500 by fragment is
used to transform C. sonorensis (Candida filing) and the
transformants are screened on YPD plates supplemented with
X-.alpha.-gal at a concentration of 40 .mu.g/mL. The transformants
are grown on YPD agar plates supplemented with X-.alpha.-gal (40
.mu.g/mL).
[0184] It should be understood that the foregoing disclosure
emphasizes certain specific embodiments of the invention and that
all modifications or alternatives equivalent thereto are within the
spirit and scope of the invention as set forth in the appended
claims. All references cited herein are incorporated by reference
in their entirety.
Sequence CWU 1
1
431848DNASaccaromyces cerevisiae; 1gcggccgcgg atcgctcttc cgctatcgat
taattttttt ttctttcctc tttttattaa 60ccttaatttt tattttagat tcctgacttc
aactcaagac gcacagatat tataacatct 120gcacaatagg catttgcaag
aattactcgt gagtaaggaa agagtgagga actatcgcat 180acctgcattt
aaagatgccg atttgggcgc gaatccttta ttttggcttc accctcatac
240tattatcagg gccagaaaaa ggaagtgttt ccctccttct tgaattgatg
ttaccctcat 300aaagcacgtg gcctcttatc gagaaagaaa ttaccgtcgc
tcgtgatttg tttgcaaaaa 360gaacaaaact gaaaaaaccc agacacgctc
gacttcctgt cttcctattg attgcagctt 420ccaatttcgt cacacaacaa
ggtcctagcg acggctcaca ggttttgtaa caagcaatcg 480aaggttctgg
aatggcggga aagggtttag taccacatgc tatgatgccc actgtgatct
540ccagagcaaa gttcgttcga tcgtactgtt actctctctc tttcaaacag
aattgtccga 600atcgtgtgac aacaacagcc tgttctcaca cactcttttc
ttctaaccaa gggggtggtt 660tagtttagta gaacctcgtg aaacttacat
ttacatatat ataaacttgc ataaattggt 720caatgcaaga aatacatatt
tggtcttttc taattcgtag tttttcaagt tcttagatgc 780tttctttttc
tcttttttac agatcatcaa ggaagtaatt atctactttt tacaacaaat 840ctagaatt
8482376DNASaccaromyces cerevisiae; 2gtagatacat tgatgctatc
aatccagaga actggaaaga ttgtgtagcc ttgaaaaacg 60gtgaaactta cgggtccaag
attgtctaca gattttcctg atttgccagc ttactatcct 120tcttgaaaat
atgcactcta tatcttttag ttcttaattg caacacatag atttgctgta
180taacgaattt tatgctattt tttaaatttg gagttcagtg ataaaagtgt
cacagcgaat 240ttcctcacat gtagggaccg aattgtttac aagttctctg
taccaccatg gagacatcaa 300aaattgaaaa tctatggaaa gatatggacg
gtagcaacaa gaatatagca cgagccgcgg 360atttatttcg ttacgc
376327DNAArtificial Sequence;PSPDCS1 primer 3ccatcgataa caagctcatg
caaagag 27428DNAArtificial Sequence;PSPDCAS2 primer 4gctctagatt
tgactgtgtt attttgcg 28521DNAArtificial Sequence;BM1270 primer
5cctgagtcca cgtcattatt c 21622DNAArtificial Sequence;BM179 primer
6tgaagctatt tattcttgtt ac 22727DNAArtificial Sequence;Bmeg5' primer
7gctctagatg aaaacacaat ttacacc 27828DNAArtificial Sequence;Bmeg3'
primer 8atggatcctt acacaaaagc tctgtcgc 28930DNAArtificial
Sequence;5' G fragment primer 9gctctagatg agccatattc aacgggaaac
301030DNAArtificial Sequence;3' G fragment primer 10atggatcctt
agaaaaactc atcgagcatc 301124DNAArtificial Sequence;SO-M2 primer
11cttccagtcc agcaggtcga ccag 241218DNAArtificial Sequence;SO-M1
primer 12gtccagcatg tcgaccag 181320DNAArtificial Sequence;SO-M4
primer 13gaacgaaacg aacttctctc 201420DNAArtificial Sequence;SO-M5
primer 14cttggaactt cttgtcagtg 201521DNAArtificial Sequence;SO4549
primer 15ccatccgaag aagtcgatct c 211621DNAArtificial Sequence;SO285
primer 16cttgccatcc tatggaactg c 211720DNAArtificial
Sequence;-SO2740 primer 17gaaggctggg aattgagtga 201820DNAArtificial
Sequence;SO2444 primer 18gctccatctg aaatcgacag 201929DNAArtificial
Sequence;5'HYGXBA1 primer 19aagctctaga tgaaaaagcc tgaactcac
292029DNAArtificial Sequence;3'HYGBAMH1 primer 20cgcggatccc
tattcctttg ccctcggac 292128DNAArtificial Sequence;VR150 primer
21ggttggattt atgacaaagg ttttgctt 282230DNAArtificial Sequence;VR153
primer 22aattaaaact tgttcttgtt caaagcaact 302328DNAArtificial
Sequence;VR165 primer 23cgtctagatt tatgacaaag gttttgct
282429DNAArtificial Sequence;VR166 primer 24gcggatcctt aaaacttgtt
cttgttcaa 292520DNAArtificial Sequence;VR161 primer 25agttggtgta
tttaacaagg 202627DNAArtificial Sequence;VR142 primer 26gtgacaccct
gtgcacggcg ggagatg 272720DNAArtificial Sequence;VR173 primer
27gcgacggctc acaggttttg 202827DNAArtificial Sequence;VR170 primer
28cttgtcttga cgtaatacac gtgcagc 272920DNAArtificial Sequence;oCA85
primer 29ggaccgatgg ctgtgtagaa 203020DNAArtificial Sequence;oCA80
primer 30tcgcttacct cggtacagaa 203130DNAArtificial
Sequence;5'-Flank 5' primer 31caagaaggta cccctctcta aacttgaaca
303232DNAArtificial Sequence;5'-Flank 3' primer 32gtaattcctg
caggtgcaat tatttggttt gg 323332DNAArtificial Sequence;3'-Flank 5'
primer 33ccaagccctg caggagaggg agaggataaa ga 323430DNAArtificial
Sequence;3'-Flank 3' primer 34ctcgtaacgc gtgtacaagt tgtggaacaa
303532DNAArtificial Sequence;Lh-D-LDH 5' primer 35tttttacctg
caggctagat ttatgacaaa gg 323632DNAArtificial Sequence;Lh-D-LDH 3'
primer 36tctacccctg caggaaaact tgttcttgtt ca 323721DNAArtificial
Sequence;PDC1 Chromosome 5' primer 37aagcaccaag gccttcaaca g
213827DNAArtificial Sequence;D-LDH 3' primer 38cttgtcttga
cgtaatacac gtgcagc 273921DNAArtificial Sequence;PDC1 5' primer
39cgcaaagaaa agctccacac c 214021DNAArtificial Sequence;PDC1 3'
primer 40cccatacgct tataatcccc c 21411235DNASaccaromyces
cerevisiae; 41ggccgcggat cgctcttccg ctatcgatta attttttttt
ctttcctctt tttattaacc 60ttaattttta ttttagattc ctgacttcaa ctcaagacgc
acagatatta taacatctgc 120acaataggca tttgcaagaa ttactcgtga
gtaaggaaag agtgaggaac tatcgcatac 180ctgcatttaa agatgccgat
ttgggcgcga atcctttatt ttggcttcac cctcatacta 240ttatcagggc
cagaaaaagg aagtgtttcc ctccttcttg aattgatgtt accctcataa
300agcacgtggc ctcttatcga gaaagaaatt accgtcgctc gtgatttgtt
tgcaaaaaga 360acaaaactga aaaaacccag acacgctcga cttcctgtct
tcctattgat tgcagcttcc 420aatttcgtca cacaacaagg tcctagcgac
ggctcacagg ttttgtaaca agcaatcgaa 480ggttctggaa tggcgggaaa
gggtttagta ccacatgcta tgatgcccac tgtgatctcc 540agagcaaagt
tcgttcgatc gtactgttac tctctctctt tcaaacagaa ttgtccgaat
600cgtgtgacaa caacagcctg ttctcacaca ctcttttctt ctaaccaagg
gggtggttta 660gtttagtaga acctcgtgaa acttacattt acatatatat
aaacttgcat aaattggtca 720atgcaagaaa tacatatttg gtcttttcta
attcgtagtt tttcaagttc ttagatgctt 780tctttttctc ttttttacag
atcatcaagg aagtaattat ctacttttta caacaaatct 840agaattcgga
tccggtagat acattgatgc tatcaatcaa gagaactgga aagattgtgt
900aaccttgaaa aacggtgaaa cttacgggtc caagaccctc tacagatttt
cctgatttgc 960cagcttacta tccttcttga aaatatgcac tctatatctt
ttagttctta attgcaacac 1020atagatttgc tgtataacga attttatgct
attttttaaa tttggagttc agtgataaaa 1080gtgtcacagc gaatttcctc
acatgtagga ccgaattgtt tacaagttct ctgtaccacc 1140atggagacat
caaagattga aaatctatgg aaagatatgg acggtagcaa caagaatata
1200gcacgagccg cggatttatt tcgttacgca tgcgc
1235421314DNASaccaromyces cerevisiae; 42ggccgcggat cgctcttccg
ctatcgataa caagctcatg caaagaggtg gtacccgcac 60gccgaaatgc atgcaagtaa
cctattcaaa gtaatatctc atacatgttt catgagggta 120acaacatgcg
actgggtgag catatgttcc gctgatgtga tgtgcaagat aaacaagcaa
180ggcagaaact aacttcttct tcatgtaata aacacacccc gcgtttattt
acctatctct 240aaacttcaac accttatatc ataactaata tttcttgaga
taagcacact gcacccatac 300cttccttaaa aacgtagctt ccagtttttg
gtggttccgg cttccttccc gattccgccc 360gctaaacgca tatttttgtt
gcctggtggc atttgcaaaa tgcataacct atgcatttaa 420aagattatgt
atgctcttct gacttttcgt gtgatgaggc tcgtggaaaa aatgaataat
480ttatgaattt gagaacaatt ttgtgttgtt acggtatttt actatggaat
aatcaatcaa 540ttgaggattt tatgcaaata tcgtttgaat atttttccga
ccctttgagt acttttcttc 600ataattgcat aatattgtcc gctgcccctt
tttctgttag acggtgtctt gatctacttg 660ctatcgttca acaccacctt
attttctaac tatttttttt ttagctcatt tgaatcagct 720tatggtgatg
gcacattttt gcataaacct agctgtcctc gttgaacata ggaaaaaaaa
780atatataaac aaggctcttt cactctcctt gcaatcagat ttgggtttgt
tccctttatt 840ttcatatttc ttgtcatatt cctttctcaa ttattatttt
ctactcataa cctcacgcaa 900aataacacag tcaaatctag aattcggatc
cggtagatac attgatgcta tcaatccaga 960gaactggaaa gattgtgtag
ccttgaaaaa cggtgaaact tacgggtcca agattgtcta 1020cagattttcc
tgatttgcca gcttactatc cttcttgaaa atatgcactc tatatctttt
1080agttcttaat tgcaacacat agatttgctg tataacgaat tttatgctat
tttttaaatt 1140tggagttcag tgataaaagt gtcacagcga atttcctcac
atgtagggac cgaattgttt 1200acaagttctc tgtaccacca tggagacatc
aaaaattgaa aatctatgga aagatatgga 1260cggtagcaac aagaatatag
cacgagccgc ggatttattt cgttacgcat gcgc 1314431014DNALactobacillus
helveticus; 43atgacaaagg tttttgctta cgctattcga aaagacgaag
aaccattctt gaatgaatgg 60aaggaagctc acaaggatat cgatgttgat tacactgata
aacttttgac tcctgaaact 120gctaagctag ctaagggtgc tgacggtgtt
gttgtttacc aacaattaga ctacactgca 180gatactcttc aagctttagc
agacgctggc gtaactaaga tgtcattacg taacgttggt 240gttgacaaca
ttgatatgga caaggctaag gaattaggtt tccaaattac caatgttcct
300gtttactcac caaacgctat tgctgaacat gctgctattc aggctgcacg
tgtattacgt 360caagacaagc gcatggacga aaagatggct aaacgtgact
tacgttgggc accaactatc 420ggccgtgaag ttcgtgacca agttgtcggt
gttgttggta ctggtcacat tggtcaagta 480tttatgcgta ttatggaagg
tttcggtgca aaggttattg cttacgatat cttcaagaac 540ccagaacttg
aaaagaaggg ttactacgtt gactcacttg acgacttgta caagcaagct
600gatgtaattt cacttcacgt accagatgtt ccagctaacg ttcacatgat
caacgacaag 660tcaatcgctg aaatgaaaga cggcgttgta attgtaaact
gctcacgtgg tcgacttgtt 720gacactgacg ctgtaatccg tggtttggac
tcaggcaaga tcttcggctt cgttatggat 780acttacgaag acgaagttgg
tgtatttaac aaggattggg aaggtaaaga attcccagac 840aagcgtttgg
cagacttaat tgatcgtcca aacgtattgg taactccaca caccgccttc
900tacactactc acgctgtacg taacatggtt gttaaggcat tcaacaacaa
cttgaagtta 960atcaacggcg aaaagccaga ttctccagtt gctttgaaca
agaacaagtt ttaa 1014
* * * * *