U.S. patent application number 12/611183 was filed with the patent office on 2010-06-03 for n protein muants of porcine reproductive and respiratory syndrome virus.
This patent application is currently assigned to Pfizer Inc.. Invention is credited to Jay Gregory Calvert, Changhee Lee, Siao-Kun Welch, Dongwan Yoo.
Application Number | 20100136051 12/611183 |
Document ID | / |
Family ID | 36218763 |
Filed Date | 2010-06-03 |
United States Patent
Application |
20100136051 |
Kind Code |
A1 |
Yoo; Dongwan ; et
al. |
June 3, 2010 |
N Protein Muants of Porcine Reproductive and Respiratory Syndrome
Virus
Abstract
The present invention provides a genetically modified PRRS
virus, methods to make it and related polypeptides, polynucleotides
and various components. Vaccines comprising the genetically
modified virus and polynucleotides are also provided.
Inventors: |
Yoo; Dongwan; (Guelph,
CA) ; Lee; Changhee; (Guelph, CA) ; Calvert;
Jay Gregory; (Otsego, MI) ; Welch; Siao-Kun;
(Kalamazoo, MI) |
Correspondence
Address: |
PFIZER INC;Mary J Hosley
150 EAST 42ND STREET, MS: 150/02/E112
NEW YORK
NY
10017-5612
US
|
Assignee: |
Pfizer Inc.
|
Family ID: |
36218763 |
Appl. No.: |
12/611183 |
Filed: |
November 3, 2009 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12383937 |
Mar 30, 2009 |
|
|
|
12611183 |
|
|
|
|
11359334 |
Feb 22, 2006 |
7544362 |
|
|
12383937 |
|
|
|
|
60730663 |
Oct 27, 2005 |
|
|
|
60656523 |
Feb 25, 2005 |
|
|
|
Current U.S.
Class: |
424/204.1 ;
435/235.1; 435/236; 536/23.72 |
Current CPC
Class: |
C07K 14/005 20130101;
A61K 2039/5254 20130101; C12N 7/00 20130101; C12N 2770/10022
20130101; C12N 2770/10034 20130101; A61P 31/12 20180101; A61K
2039/53 20130101; C12N 2770/10062 20130101; A61K 39/12 20130101;
A61K 2039/552 20130101 |
Class at
Publication: |
424/204.1 ;
435/235.1; 536/23.72; 435/236 |
International
Class: |
A61K 39/12 20060101
A61K039/12; C12N 7/01 20060101 C12N007/01; C07H 21/02 20060101
C07H021/02; C12N 7/04 20060101 C12N007/04; A61P 31/12 20060101
A61P031/12 |
Claims
1. A composition comprising a PRRS infectious agent selected from
the group consisting of: a.) a genetically modified PRRS virus
comprising an N protein which has been modified in at least one
conserved region selected from the group consisting of the NLS-2
region, NoLS region and the NES region such that the conserved
region has been eliminated, and wherein the genetically modified
PRRS virus is attenuated; b.) an infectious RNA molecule encoding
the genetically modified PRRS virus of a.); and c.) an isolated
polynucleotide molecule comprising a DNA sequence encoding the
infectious RNA molecule of b.).
2. The composition of claim 1 which has been further modified to
result in the elimination of the conserved NLS-1 region.
3. The composition of claim 1 wherein the conserved region has been
eliminated by the introduction of a non-conservative amino acid
substitution.
4. The composition of claim 1 or 2 wherein the conserved region has
been at least partially deleted.
5. The composition of claim 1 wherein the conserved region is the
NoLS region.
6. The composition of claim 1 wherein the conserved region is the
NLS-2 region.
7. The composition of claim 1 wherein the conserved region is the
NES region.
8. The composition of claim 1 wherein the PRRS virus is a North
American PRRS virus.
9. The composition of claim 1 wherein the PRRS virus is a European
PRRS virus.
10. The composition of claim 8 wherein the conserved region is the
NLS-2 region.
11. The composition of claim 10 wherein residues 42 and 43 of the N
protein are glycines.
12. The composition of claim 10 wherein residues 42 and 43 of the N
protein are glycine and residue 44 is an asparagine.
13. The composition of claim 10 wherein the NLS-2 region has been
at least partially deleted.
14. The composition of claim 13 wherein at least one of residues 43
through 48 of the N protein have been deleted.
15. The composition of claim 14 wherein both residues 43 and 44 of
the N protein have been deleted.
16. The composition of claim 14 wherein residues 43, 44, and 46 of
the N protein have been deleted. The composition of claim 14
wherein residues 44, 46, and 47 of the N protein have been
deleted.
17. The composition of claim 14 wherein residues 46, 47, and 48 of
the N protein have been deleted.
18. The composition of claim 1 that contains additional nucleotide
mutation, substitutions and/or deletions, designed to minimize the
probability of reversion.
19. A vaccine for protecting a porcine animal from infection by a
PRRS virus comprising the composition of claims 1 in an amount
effective to produce immunoprotection against infection by a PRRS
virus; and a carrier acceptable for veterinary use.
20. A method for protecting a porcine animal from infection by a
PRRS virus, which comprises vaccinating the animal with an amount
of the vaccine of claim 19 that is effective to produce
immunoprotection against infection by a PRRS virus.
21. A transfected host cell comprising a composition according to
claim 1.
22. A method for making a genetically modified and attenuated PRRS
virus, which method comprises: a.) mutating a DNA sequence encoding
an infectious RNA molecule which encodes a PRRS virus, to produce a
genetically modified PRRS virus comprising an N protein which has
been modified in an at least one conserved region selected from the
group consisting of the NLS-2 region, NoLS region and the NES
region such that the conserved region has been eliminated; b.)
introducing the genetically modified PRRS virus into a host cell
capable of supporting PRRS replication.
23. A method of claim 22 wherein the genetically modified PRRS
virus is a North American PRRS virus.
24. A method of claim 22 wherein the genetically modified PRRS
virus is a European PRRS virus.
25. The method of claim 22 wherein the host cell capable of
supporting PRRS replication is a MARC-145 cell.
26. The method of claim 22 wherein the host cell capable of
supporting PRRS replication is comprised within a live porcine
animal.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] The present application is a continuation of U.S.
application Ser. No. 12/383,937 filed Mar. 30, 2009 which is a
continuation of U.S. application Ser. No. 11/359,334 filed Feb. 22,
2006, now U.S. Pat. No. 7,544,362, and claims the benefit of U.S.
Provisional Patent Applications No. 60/656,523 and No. 60/730,663
filed on Feb. 25, 2005 and Oct. 27, 2005, respectively. The
complete text and disclosure of the Ser. No. 12/383,937 application
is incorporated by reference herein, as if fully set forth.
FIELD OF THE INVENTION
[0002] The present invention provides a genetically modified PRRS
virus and polynucleotides that encode it. Vaccines comprising the
genetically modified virus and polynucleotides are also
provided.
BACKGROUND OF THE INVENTION
[0003] Porcine reproductive and respiratory syndrome (PRRS) is
characterized by abortions, stillbirths, and other reproductive
problems in sows and gilts, as well as respiratory disease in young
pigs. The causative agent is the PRRS virus, a member of the family
Arteriviridae and the order Nidovirales. Two distinct genotypes of
the virus emerged nearly simultaneously in North America and in
Europe in the late 1980's. PRRS virus is now endemic in nearly all
swine producing countries, and is considered one of the most
economically important diseases affecting the global pork
industry.
[0004] Currently, commercial vaccines against PRRS include modified
live and killed (inactivated) vaccines. Killed vaccines have been
criticized for failing to induce robust immunity against
heterologous strains of PRRS virus. Modified live vaccines are
attenuated by serial passage in cell culture until virulence is
lost. Modified live vaccines elicit broader protection than killed
vaccines, but can suffer from a number of safety concerns including
residual virulence, spread to non-vaccinated pigs, and genetic
reversion to virulence. Because of antigenic changes that take
place during the attenuation process, such vaccines can also lose
some ability to protect against virulent field strains of PRRS
virus. There is a pressing need therefore for new and improved
modified live vaccines to protect against PRRS.
BRIEF DESCRIPTION OF THE DRAWINGS
[0005] FIG. 1. (A) Drawing showing position and sequence of the NLS
mutation within the P129 nucleocapsid protein. (B) Photomicrographs
of mock infected, P129 infected, and P129-GG infected MARK-145
cells. Upper row shows typical plaques using phase contrast
microscopy, while lower row shows fluorescent antibody staining of
infected foci using FITC-conjugated monoclonal antibody SDOW17.
Note the absence of nucleocapsid staining in the nuclei and
nucleoli of cells infected with P129-GG.
[0006] FIG. 2. (A) Number of pigs viremic on days 0 through 28 post
infection by treatment groups (7 pigs per group). (B) Mean viral
titer in the sera of pigs at days 0 through 28 post infection, by
treatment group. (C) Mean ELISA antibody levels (S/P ratios) in the
sera of pigs at days 0 through 28 post infection, by treatment
group (D) a re-titration of the sera shown in FIG. 2C all samples
were diluted 1:5 prior to assay in order to better distinguish
differences in samples with high titers. (E) Mean serum
neutralization titers in infected pigs during the four-week
study
BRIEF DESCRIPTION OF THE SEQUENCES
[0007] SEQ ID NO: 1 N protein residues 41-47 of the North American
PRRSV isolate VR2332
[0008] SEQ ID NO: 2 VR2332 NoLS region sequence
[0009] SEQ ID NO: 3 Lelystad NoLS region sequence
[0010] SEQ ID NO: 4 The NES region of the VR2332 isolate
[0011] SEQ ID NO: 5 The NES region of the Lelystad isolate
[0012] SEQ ID NO: 6 Amino acid sequence of N protein from P129
isolate
[0013] SEQ ID NO: 7 Nucleotide sequence of ORF 7 (encodes the N
protein) from P129 isolate
[0014] SEQ ID NO: 8 Primer P SHUTTLE FWD
[0015] SEQ ID NO: 9 Primer P-SHUTTLE-REV
[0016] SEQ ID NO: 10 Mutagenic primer KK43/44GG-Fwd
[0017] SEQ ID NO: 11 Mutagenic primer KK43/44GG-REV
[0018] SEQ ID NO: 12 Table 8 deletion mutants. Amino acid sequence
of NLS2 region of wt P129:
[0019] SEQ ID NO: 13 Table 8 deletion mutants. Nucleotide sequence
of NLS2 region of wt P129
[0020] SEQ ID NO: 14 Table 8 deletion mutants. Amino acid sequence
of NLS2 region of P129-GG:
[0021] SEQ ID NO: 15 Table 8 deletion mutants. Nucleotide sequence
of NLS2 region of P129-GG:
[0022] SEQ ID NO: 16 Table 8 deletion mutants. Amino acid sequence
of NLS2 region of P129-d43/44:
[0023] SEQ ID NO: 17 Table 8 deletion mutants. Nucleotide sequence
of NLS2 region of P129-d43/44:
[0024] SEQ ID NO: 18 Table 8 deletion mutants. Amino acid sequence
of NLS2 region of P129-d43/44/46:
[0025] SEQ ID NO: 19 Table 8 deletion mutants. Nucleotide sequence
of NLS2 region of P129-d43/44/46:
[0026] SEQ ID NO: 20 Table 8 deletion mutants. Amino acid sequence
of NLS2 region of P129-d44/46/47:
[0027] SEQ ID NO: 21 Table 8 deletion mutants. Nucleotide sequence
of NLS2 region of P129-d44/46/47:
[0028] SEQ ID NO: 22 Table 8 deletion mutants. Amino acid sequence
of NLS2 region of P129-d46/47/48:
[0029] SEQ ID NO: 23 Table 8 deletion mutants. Nucleotide sequence
of NLS2 region of P129-d46/47/48
[0030] SEQ ID NO: 24 P129-d43/44F
[0031] SEQ ID NO: 25 P129-d43/44/46F
[0032] SEQ ID NO: 26 P129-d44/46/47F
[0033] SEQ ID NO: 27 P129-d46/47/48F
[0034] SEQ ID NO: 28 P129-d43/44R
[0035] SEQ ID NO: 29 P129-d43/44/46R
[0036] SEQ ID NO: 30 P129-d44/46/47R
[0037] SEQ ID NO: 31 P129-d46/47/48R
REFERENCES CITED
[0038] Doan, D. N. P., and Dokland, T. (2003). Structure of the
nucleocapsid protein of porcine reproductive and respiratory
syndrome virus. Structure 11(11), 1445-1451. Lee, C., Calvert, J.
G., Welch, S.-K. W., and Yoo, D. (2005). A DNA-launched reverse
genetics system for porcine reproductive and respiratory syndrome
virus reveals that homodimerization of the nucleocapsid protein is
essential for virus infectivity. Virology 331, 47-62.
[0039] Rowland, R. R., Kervin, R., Kuckleburg, C., Sperlich, A.,
and Benfield, D. A. (1999). The localization of porcine
reproductive and respiratory syndrome virus nucleocapsid protein to
the nucleolus of infected cells and identification of a potential
nucleolar localization signal sequence. Virus Research 64(1),
1-12.
[0040] Rowland, R. R. R., Schneider, P., Fang, Y., Wootton, S.,
Yoo, D., and Benfield, D. A. (2003). Peptide domains involved in
the localization of the porcine reproductive and respiratory
syndrome virus nucleocapsid protein to the nucleolus. Virology
316(1), 135-145.
[0041] Rowland, R. R. R., and Yoo, D. (2003). Nucleolar-cytoplasmic
shuttling of PRRSV nucleocapsid protein: a simple case of molecular
mimicry or the complex regulation by nuclear import, nucleolar
localization and nuclear export signal sequences. Virus Research
95(1-2), 23-33.
[0042] Wootton, S. K., Rowland, R. R. R., and Yoo, D. (2002).
Phosphorylation of the porcine reproductive and respiratory
syndrome virus nucleocapsid protein. Journal of Virology 76(20),
10569-10576.
[0043] Wootton, S. K., and Yoo, D. (2003). Homo-oligomerization of
the porcine reproductive and respiratory syndrome virus
nucleocapsid protein and the role of disulfide linkages. Journal of
Virology 77(8), 4546-4557.
[0044] Yoo, D., Wootton, S. K., Li, G., Song, C., and Rowland, R.
R. (2003). Colocalization and interaction of the porcine
arterivirus nucleocapsid protein with the small nucleolar
RNA-associated protein fibrillarin. Journal of Virology 77(22),
12173-12183.
[0045] Yoo, D., Welch, S.-K. W., Lee, C., and Calvert, J. G.
(2004). Infectious clones of porcine reproductive and respiratory
syndrome virus and their potential as vaccine vectors. Veterinary
Immunology and Immunopathology 102, 143-154.
SUMMARY OF THE INVENTION
[0046] The invention provides a genetically modified PRRS virus
which has been modified within the NLS-2 region, NoLS region,
and/or the NES region of the nucleocapsid (N) protein such that the
resultant PRRS virus is attenuated. The subject invention further
provides an infectious RNA molecule encoding the genetically
modified virus and an isolated polynucleotide molecule comprising a
DNA sequence encoding the infectious RNA molecule recited
above.
[0047] The invention also provides a biologically pure culture of
the viruses recited (i.e substantially free of other viruses) and
it describes a viral vector comprising a DNA sequence encoding an
infectious RNA molecule encoding a genetically modified PRRS virus
as recited above.
[0048] The subject invention further provides a transfected host
cell comprising any of the forgoing viruses, infectious RNA
molecules, isolated polynucleotides or viral vectors recited
above.
[0049] The subject invention further provides a vaccine for
protecting a porcine animal from infection by a PRRS virus, which
vaccine comprises a genetically modified PRRS virus as recited
above; an infectious RNA molecule as recited above encoding the
genetically modified PRRS virus; an isolated polynucleotide
molecule recited above, (optionally in the form of a plasmid),
encoding the genetically modified PRRS virus; or the above-recited
viral vector encoding the genetically modified PRRS virus; in an
amount effective to produce immunoprotection against infection by a
PRRS virus; and a carrier acceptable for veterinary use.
[0050] The invention further provides for reversion-resistant
mutations of NLS-2. Preferred embodiments of the invention,
especially for vaccine purposes, will contain additional nucleotide
substitutions and/or deletions, designed to minimize the
probability of reversion, and to minimize the probability of other
flanking residues mutating to basic residues such as lysine and
arginine and thereby restoring a functional NLS motif in the
region.
[0051] The subject invention further provides a method for
protecting a porcine animal from infection by a PRRS virus, which
comprises vaccinating the animal with an amount of the
above-recited vaccine that is effective to produce immunoprotection
against infection by a PRRS virus.
[0052] The invention provides a method for making a genetically
modified PRRS virus, which method comprises mutating the DNA
sequence encoding an infectious RNA molecule which encodes the PRRS
virus as described above, and expressing the genetically modified
PRRS virus using a suitable expression system.
[0053] A PRRS virus, either wild-type or genetically modified, can
be expressed from an isolated polynucleotide molecule using
suitable expression systems generally known in the art, examples of
which are described in this application. For example, the isolated
polynucleotide molecule can be in the form of a plasmid capable of
expressing the encoded virus in a suitable host cell in vitro, as
is described in further detail below.
[0054] Other features of the invention will be evident upon
review.
DETAILED DESCRIPTION OF THE INVENTION
[0055] We disclose herein a method of attenuating a virulent PRRS
virus by mutating or deleting the NLS-2 region, NoLS region, or the
NES region in the nucleocapsid or N protein (encoded by ORF7) of
the virus, an immunogenic composition comprising said attenuated
virus, and a method of protecting swine from PRRS by vaccination
with said immunogenic compositions. PRRS viruses that have been
attenuated by this method should retain the antigenic
characteristics of the virulent field strain and therefore afford
more potent protection than vaccines based on cell culture
attenuated viruses.
[0056] The nucleocapsid protein (N) of PRRSV, which is encoded by
ORF7, is a small basic protein that is phosphorylated (Wootton,
Rowland, and Yoo, 2002) and forms homodimers (Wootton and Yoo,
2003). The crystal structure has recently been determined (Doan and
Dokland, 2003). The N protein appears to have multiple functions in
the infected cell. In addition to forming a spherical capsid
structure into which genomic RNA is packaged, a process that takes
place in the cytoplasm, a portion of N protein is transported into
the nucleus and specifically to the nucleolus of the infected cell.
The amino acid sequence of N protein contains two nuclear
localization signals (NLS), a nucleolar localization signal (NoLS),
and a nuclear export signal (NES) that facilitate transport into
the nucleus and nucleolus, and export from the nucleus,
respectively (Rowland et al., 1999; Rowland et al., 2003; Rowland
and Yoo, 2003). While in the nucleolus, the N protein interacts
with the small nucleolar RNA-associated protein fibrillarin and may
regulate rRNA processing and ribosome biogenesis in the infected
cell in order to favor virus replication (Yoo et al., 2003). In the
current invention, we show that mutations and deletions within the
NLS, NoLS, and NES motifs of the N protein can result in viable
viruses with aberrant nuclear trafficking, and that viruses
containing such mutations are useful as vaccines against PRRS.
[0057] Viral mutations of this type are valuable, either alone or
in combination with other attenuating mutations, for designing
novel PRRS vaccines.
Definitions
[0058] "An effective immunoprotective response",
"immunoprotection", and like terms, for purposes of the present
invention, mean an immune response that is directed against one or
more antigenic epitopes of a pathogen so as to protect against
infection by the pathogen in a vaccinated animal. For purposes of
the present invention, protection against infection by a pathogen
includes not only the absolute prevention of infection, but also
any detectable reduction in the degree or rate of infection by a
pathogen, or any detectable reduction in the severity of the
disease or any symptom or condition resulting from infection by the
pathogen in the vaccinated animal as compared to an unvaccinated
infected animal. An effective immunoprotective response can be
induced in animals that have not previously been infected with the
pathogen and/or are not infected with the pathogen at the time of
vaccination. An effective immunoprotective response can also be
induced in an animal already infected with the pathogen at the time
of vaccination.
[0059] A genetically modified PRRS virus is "attenuated" if it is
less virulent than its unmodified parental strain. A strain is
"less virulent" if it shows a statistically significant decrease in
one or more parameters determining disease severity. Such
parameters may include level of viremia, fever, severity of
respiratory distress, severity of reproductive symptoms, or number
or severity of lung lesions, etc.
[0060] "European PRRS virus" refers to any strain of PRRS virus
having the genetic characteristics associated with the PRRS virus
that was first isolated in Europe around 1991 (see, e.g.,
Wensvoort, G., et al., 1991, Vet. Q. 13:121-130). "European PRRS
virus" is also sometimes referred to in the art as "Lelystad
virus".
[0061] "Genetically modified", as used herein and unless otherwise
indicated, means genetically mutated by human intervention,
"mutated" means the replacement of an amino acid for another or the
replacement of the coding nucleotide by another (e.g. C for a T),
i.e., a so-called "substitution", preferably in a way that the
encoded amino acid is changed, or any other mutation such as
"deletion" or "insertion". The mutation is always carried out in
the coding nucleotide sequence.
[0062] "Host cell capable of supporting PRRS virus replication"
means a cell line which is capable of generating infectious PRRS
when infected with a virus of the invention. Such cells include
porcine alveolar macrophage cells and derivatives of porcine
alveolar macrophage cells, MA-104 cells and derivatives of MA-104
cells, MARC-145 cells and derivatives of MARC-145 cells, and cells
transfected with a receptor for the PRRS virus. Especially
preferred for the demonstrating the small plaque phenotype of the
invention are MARC-145 cells. The term "host cell capable of
supporting PRRS virus replication" may also include cells within a
live pig.
[0063] "Immune response" for purposes of this invention means the
production of antibodies and/or cells (such as T lymphocytes) that
are directed against, or assist in the decomposition or inhibition
of, a particular antigenic epitope or particular antigenic
epitopes.
[0064] "North American PRRS virus" means any PRRS virus having
genetic characteristics associated with a North American PRRS virus
isolate, such as, but not limited to the PRRS virus that was first
isolated in the United States around the early 1990's (see, e.g.,
Collins, J. E., et al., 1992, J. Vet. Diagn. Invest. 4:117-126);
North American PRRS virus isolate MN-1b (Kwang, J. et al., 1994, J.
Vet. Diagn. Invest. 6:293-296); the Quebec IAF-exp91 strain of PRRS
(Mardassi, H. et al., 1995, Arch. Virol. 140:1405-1418); and North
American PRRS virus isolate VR 2385 (Meng, X.-J et al., 1994, J.
Gen. Virol. 75:1795-1801). Genetic characteristics refer to genomic
nucleotide sequence similarity and amino acid sequence similarity
shared by North American PRRS virus strains.
[0065] "Open reading frame", or "ORF", as used herein, means the
minimal nucleotide sequence required to encode a particular PRRS
virus protein without an intervening stop codon.
[0066] "Porcine" and "swine" are used interchangeably herein and
refer to any animal that is a member of the family Suidae such as,
for example, a pig. The term "PRRS virus", as used herein, unless
otherwise indicated, means any strain of either the North American
or European PRRS viruses.
[0067] "PRRS" encompasses disease symptoms in swine caused by a
PRRS virus infection. Examples of such symptoms include, but are
not limited to, fever, abortion in pregnant females, respiratory
distress, lung lesions, loss of appetite, and mortality in young
pigs. As used herein, a PRRS virus that is "unable to produce PRRS"
refers to a virus that can infect a pig, but which does not produce
any disease symptoms normally associated with a PRRS infection in
the pig.
[0068] PRRSV "N protein" or "ORF7" as used herein is defined as a
polypeptide that is encoded by ORF7 of both the European and North
American genotypes of PRRS virus. Examples of specific isotypes of
N protein which are currently known are the 123 amino acid
polypeptide of the North American PRRS prototype isolate VR2322
reported in Genbank by Accession numbers PRU87392, and the 128
residue N protein of European prototype PRRS isolate Lelystad
reported in Genbank Accession number A26843.
[0069] "PRRSV N protein NLS-1 region" or "PRRSV ORF7 NLS-1 region"
refers to a "pat4" or "nuc1" nuclear localization signal (Nakai
& Kanehisa, 1992; Rowland & Yoo, 2003) containing four
continuous basic amino acids (lysine or arginine), or three basic
residues and a histidine or proline, located within about the first
15 N-terminal residues of the mature N protein. By way of example
the VR2332 NLS-1 region sequence is KRKK and is located at residues
9-12, while the Lelystad isolate sequence is KKKK and is located at
residues 10-13 of the N protein.
[0070] "PRRSV N protein NLS-2 region" or "PRRSV ORF7 NLS-2 region"
refers to a second nuclear localization signal within the N protein
that can take one of two forms. In North American PRRS viruses
NLS-2 has a pattern which we have designated as the "pat8" motif,
which begins with a proline followed within three residues by a
five residue sequence containing at least three basic residues (K
or R) out of five (a slight modification of the "pat7" or "nuc2"
motif described by Nakai & Kanehisa, 1992; Rowland & Yoo,
2003). By way of example such a sequence is located at N protein
residues 41-47 of the North American PRRSV isolate VR2332, and is
represented by the sequence PGKKNKKK (SEQ ID NO: 1). In European
PRRS viruses NLS-2 has a "pat4" or "nuc1" motif, which is a
continuous stretch of four basic amino acids or three basic
residues associated with histidine or proline (Nakai &
Kanehisa, 1992; Rowland & Yoo, 2003). The NLS-2 of the European
PRRSV isolate Lelystad is located at residues 47-50 and is
represented by the sequence KKKK.
[0071] "PRRSV N protein NoLS region" or "PRRSV ORF7 NoLS region"
refers to a nucleolar localization signal having a total length of
about 32 amino acids and incorporating the NLS-2 region near its
amino terminus. By way of example the VR2332 NoLS region sequence
is located at residues 41-72 and is represented by the sequence
PGKKNKKKNPEKPHFPLATEDDVRHHFTPSER (SEQ ID NO: 2) (Rowland & Yoo,
2003) and the corresponding Lelystad isolate sequence is located at
residues 42-73 and is represented by the sequence
TABLE-US-00001 PRGGQAKKKKPEKPHFPLAAEDDIRHHLTQTER. (SEQ ID NO:
3)
[0072] "PRRSV N protein NES region" or "PRRSV ORF7 NES region"
refers to a nuclear export signal containing an LXL motif located
near the carboxy terminal end of the N protein. The NES motif is
X-R(2-5)-X-R2-X-R-Y where X is either leucine, isoleucine, or
valine, Y either leucine, isoleucine, valine or alanine and R is
any amino acid. As shown below the prototype North American and
European isolates conform to this scheme with both having a
5-residue spacer.
[0073] "Transfected host cell" means practically any host cell
which as described in U.S. Pat. No. 5,600,662 when transfected with
PRRS virus RNA can produce a first round of PRRS virions. If
further productive infection is desired a "host cell capable of
supporting PRRS virus replication" as defined below would be
used.
[0074] Polynucleotide molecules can be genetically mutated using
recombinant techniques known to those of ordinary skill in the art,
including by site-directed mutagenesis, or by random mutagenesis
such as by exposure to chemical mutagens or to radiation, as known
in the art." Said mutations may be carried out by standard methods
known in the art, e. g. site directed mutagenesis (see e.g.
Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual, 2
(nd)ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor,
N.Y.) of an infectious copy as described (e.g. Meulenberg et al.,
Adv. Exp. Med. Biol, 1998, 440:199-206).
[0075] Accordingly, the subject invention further provides a method
for making a genetically modified North American PRRS virus, which
method comprises mutating the DNA sequence encoding an infectious
RNA molecule which encodes the PRRS virus as described above, and
expressing the genetically modified PRRS virus using a suitable
expression system. A genetically modified PRRS virus can be
expressed from an isolated polynucleotide molecule using suitable
expression systems generally known in the art, examples of which
are described in this application. For example, the isolated
polynucleotide molecule can be in the form of a plasmid capable of
expressing the encoded virus in a suitable host cell in vitro, as
is described in further detail below.
[0076] The North American PRRSV N protein sequences are highly
conserved and the reported sequences have about 93-100% identity
with each other. The North American and European PRRSV N proteins
are about 57-59% identical and share common structural motifs.
[0077] By way of example the VR2332 NES region sequence is located
at residues 106-117 and is represented by the sequence LPTHHTVRLIRV
(SEQ ID NO: 4) (Rowland & Yoo, 2003) and the Lelystad isolate
sequence is located at residues 107-118 and is represented by the
sequence LPVAHTVRLIRV (SEQ ID NO: 5).
[0078] In the consensus below, which includes all sequences in
North American PRRSV sequences in Genbank, the positions with a (*)
are completely conserved. Alternative amino acids are shown under
each position.
TABLE-US-00002 LPTHHTVRLIRV (SEQ ID NO: 4) **VAQ******A Q V G
[0079] The numbering of amino acids referenced above is according
to the database entries mentioned. In all other PRRS isolates,
which might be numbered differently, identification of the proper
regions are readily achieved by identifying preserved
characteristic amino acids in a PRRS strain of interest and
aligning it with a reference strain. It is an object of the present
invention to modify a PRRS virus or its encoding nucleic acids such
that one or more conserved regions are eliminated either by
substitution, deletion, or insertion such that it results in an
attenuated phenotype.
[0080] Deletions, insertions, or substitutions which eliminate the
conserved NLS-2 motif, the NoLS region, or the NES motif are
introduced by modification of polynucleotides in the encoding
viruses of the invention. In a preferred embodiment, a deletion or
insertion comprising 1,2,3,4 or 5 amino acids results in the
elimination of a conserved motif and results in an attenuated
virus
Amino Acids can be Classified According to Physical Properties and
Contribution to Secondary and Tertiary Protein Structure. A
Conservative Substitution is Recognized in the Art as a
Substitution of One Amino Acid for Another Amino Acid that has
Similar Properties. Exemplary Conservative Substitutions are Set
Out in Table 1 (from WO 97/09433, Page 10, Published Mar. 13, 1997
(PCT/GB96/02197, Filed Sep. 6, 1996)), Immediately Below. Table 1
Conservative Substitutions I
TABLE-US-00003 [0081] SIDE CHAIN CHARACTERISTIC AMINO ACID
Aliphatic G A P Non-polar I L V Polar - uncharged C S T M N Q Polar
- charged D E K R Aromatic H F W Y Other N Q D E
[0082] Alternatively, conservative amino acids can be grouped as
described in Lehninger, [Biochemistry, Second Edition; Worth
Publishers, Inc. NY: N.Y. (1975), pp. 71-77] as set out in Table 2,
immediately below
TABLE-US-00004 TABLE 2 Conservative Substitutions II SIDE CHAIN
CHARACTERISTIC AMINO ACID Non-polar (hydrophobic) A. Aliphatic: A L
I V P B. Aromatic: F W C. Sulfur-containing: M D. Borderline: G
Uncharged-polar A. Hydroxyl: S T Y B. Amides: N Q C. Sulfhydryl: C
D. Borderline: G Positively Charged (Basic): K R H Negatively
Charged (Acidic): DE
[0083] As still an another alternative, exemplary conservative
substitutions are set out in Table 3, immediately below.
TABLE-US-00005 TABLE 3 Conservative Substitutions III Original
Residue Exemplary Substitution Ala (A) Val, Leu, Ile Arg (R) Lys,
Gln, Asn Asn (N) Gln, His, Lys, Arg Asp (D) Glu Cys (C) Ser Gln (Q)
Asn Glu (E) Asp His (H) Asn, Gln, Lys, Arg Ile (I) Leu, Val, Met,
Ala, Phe, Leu (L) Ile, Val, Met, Ala, Phe Lys (K) Arg, Gln, Asn Met
(M) Leu, Phe, Ile Phe (F) Leu, Val, Ile, Ala Pro (P) Gly Ser (S)
Thr Thr (T) Ser Trp (W) Tyr Tyr (Y) Trp, Phe, Thr, Ser Val (V) Ile,
Leu, Met, Phe, Ala
Preparation of Genetically Modified PRRS Virus
[0084] Recombinant DNA technology comprises extremely varied and
powerful molecular biology techniques aimed at modifying nucleic
acids at the DNA level and makes it possible to analyze and modify
genomes at the molecular level. In this respect, viruses such as
the PRRS virus because of the small size of its genome is
particularly amenable to such manipulations. However, recombinant
DNA technology is not immediately applicable to nonretroviral RNA
viruses because these viruses do not encompass a DNA intermediate
step in their replication. For such viruses infectious cDNA clones
have to be developed before recombinant DNA technology can be
applied to their genome to generate modified virus. Infectious
clones can be derived through the construction of full-length
(genomic length) cDNA (here used in the broad sense of a DNA copy
of RNA and not only in the strict sense of a DNA copy of mRNA) of
the virus under study after which an infectious transcript is
synthesized in vivo in cells transfected with the full-length cDNA,
but infectious transcripts can also be obtained by in vitro
transcription from in vitro ligated partial-length cDNA fragments
that comprise the full viral genome. In all cases, the transcribed
RNA carries all the modifications that have been introduced to the
cDNA and can be used to further passage the thus modified
virus.
[0085] The preparation of an infectious clone of a European PRRS
virus isolate or Lelystad virus is described in U.S. Pat. No.
6,268,199 which is hereby fully incorporated by reference. The
preparation of an infectious cDNA clone of a North American PRRS
virus isolate designated P129 (Lee et al., 2005; Yoo et al., 2004)
is described in U.S. Pat. No. 6,500,662 which is hereby
incorporated fully by reference. The sequence of P129 cDNA is
disclosed in Genbank Accession Number AF494042 and in U.S. Pat. No.
6,500,662. Our work below makes use of such an infectious clone
which in the context of a plasmid is expressed by the CMV immediate
early promoter and has been designated pCMV-S-P129 and is also
disclosed within U.S. Pat. No. 6,500,662. As described in U.S. Pat.
No. 6,500,662 there are other plasmids and promoters suitable for
use here.
[0086] Given the complete sequence of any open reading frame of
interest and the location of an amino acid residue of interest, one
of ordinary skill need merely consult a codon table to design
changes at the particular position desired.
[0087] A table of amino acids and their representative
abbreviations, symbols and codons is set forth below in the
following Table 4.
TABLE-US-00006 TABLE 4 Sym- Amino acid Abbrev. bol Codon(s) Alanine
Ala A GCA GCC GCG GCU Cysteine Cys C UGC UGU Aspartic Asp D GAC GAU
acid Glutamic Glu E GAA GAG acid Phenyl- Phe F UUC UUU alanine
Glycine Gly G GGA GGC GGG GGU Histidine His H CAC CAU Isoleucine
Ile I AUA AUC AUU Lysine Lys K AAA AAG Leucine Leu L UUA UUG CUA
CUC CUG CUU Methionine Met M AUG Asparagine Asn N AAC AAU Proline
Pro P CCA CCC CCG CCU Glutamine Gln Q CAA CAG Arginine Arg R AGA
AGG CGA CGC CGG CGU Serine Ser S AGC AGU UCA UCC UCG UCU Threonine
Thr T ACA ACC ACG ACU Valine Val V GUA GUC GUG GUU Tryptophan Trp W
UGG Tyrosine Tyr Y UAC UAU
[0088] Codons constitute triplet sequences of nucleotides in mRNA
and their corresponding cDNA molecules. Codons are characterized by
the base uracil (U) when present in a mRNA molecule but are
characterized by base thymidine (T) when present in DNA. A simple
change in a codon for the same amino acid residue within a
polynucleotide will not change the sequence or structure of the
encoded polypeptide. It is apparent that when a phrase stating that
a particular 3 nucleotide sequence "encode(s)" any particular amino
acid, the ordinarily skilled artisan would recognize that the table
above provides a means of identifying the particular nucleotides at
issue. By way of example, if a particular three nucleotide sequence
encodes lysine, the table above discloses that the two possible
triplet sequences are AAA and AAG. Glycine is encoded by GGA, GGC,
GGT (GGU if in RNA) and GGG. To change a lysine to glycine residue
in an encoded protein one might replace a AAA or AAG triplet with
any of by GGA and GGC, GGT or GGG in the encoding nucleic acid. The
coding sequence of the N or ORF7 protein from the P129 isolate is
exemplified below.
TABLE-US-00007 TABLE 5 Coding Sequence from N protein of P129
isolate ##STR00001##
[0089] The construction of a mutant protein N polynucleotide
sequence modified in the NLS-2 regions is demonstrated by way of
illustrative example in Example 2.
[0090] It will be appreciated that mutations in the NLS-1, NoLS or
NES regions can be accomplished with similar techniques and similar
results.
Demonstration that a Genetically Modified PRRS Virus is
Attenuated
[0091] To demonstrate that a particular genetically modified strain
is attenuated an experiment as described below might be used.
[0092] At least 10 gilts per group are included in each trial,
which are derived from a PRRSV-free farm. Animals are tested free
of PRRS virus specific serum antibodies and negative for PRRSV. All
animals included in the trial are of the same source and breed. The
allocation of the animals to the groups is randomized.
[0093] Challenge is performed at day 90 of pregnancy with
intranasal application of 1 ml PRRSV with 10.sup.5 TCID.sub.50 per
nostril. There are at least three groups for each test setup: One
group for P129 challenge; one test group for challenge with the
possibly attenuated virus; and one strict control group.
[0094] The study is deemed valid when the strict controls stay
PRRSV-negative over the time course of the study and at least 25%
less live healthy piglets are born in the P129 challenged group
compared to the strict controls.
[0095] Attenuation, in other words less virulence, is defined as
the statistical significant change of one or more parameters
determining reproductive performance or other symptomology:
[0096] Significant reduction in at least one of the following
parameters for the test group (possibly attenuated virus) compared
to the un-modified parental strain infected group would be an
indication of attenuation: [0097] a) frequency of stillborns [0098]
b) abortion at or before day 112 of pregnancy [0099] c) number of
mummified piglets [0100] d) number of less lively and weak piglets
[0101] e) preweaning mortality
[0102] Furthermore a significant increase in one of the following
parameters for the test group compared the unmodified parental
strain infected group is preferred: [0103] f) number of piglets
weaned per sow [0104] g) number of live healthy piglets born per
sow
[0105] In the alternative, respiratory symptoms and other symptoms
of PRRSV infection could be examined to establish attenuation as
described in Example 3 below
Vaccines
[0106] An attenuated strain is valuable for the formulation of
vaccines.
[0107] The present vaccine is effective if it protects a pig
against infection by a PRRS virus. A vaccine protects a pig against
infection by a PRRS virus if, after administration of the vaccine
to one or more unaffected pigs, a subsequent challenge with a
biologically pure virus isolate (e.g., VR 2385, VR 2386, P129 etc.)
results in a lessened severity of any gross or histopathological
changes (e.g., lesions in the lung) and/or of symptoms of the
disease, as compared to those changes or symptoms typically caused
by the isolate in similar pigs which are unprotected (i.e.,
relative to an appropriate control). More particularly, the present
vaccine may be shown to be effective by administering the vaccine
to one or more suitable pigs in need thereof, then after an
appropriate length of time (e.g., 3 weeks), challenging with a
large sample (10.sup.(3-7) TCID.sub.(50)) of a biologically pure
PRRSV isolate. A blood sample is then drawn from the challenged pig
after about one week, and an attempt to isolate the virus from the
blood sample is then performed (e.g., see the virus isolation
procedure exemplified in Experiment VIII below). Isolation of a
large amount of the virus is an indication that the vaccine may not
be effective, while isolation of reduced amounts of the virus (or
no virus) is an indication that the vaccine may be effective.
[0108] Thus, the effectiveness of the present vaccine may be
evaluated quantitatively (i.e., a decrease in the percentage of
consolidated lung tissue as compared to an appropriate control
group) or qualitatively (e.g., isolation of PRRSV from blood,
detection of PRRSV antigen in a lung, tonsil or lymph node tissue
sample by an immunoassay). The symptoms of the porcine reproductive
and respiratory disease may be evaluated quantitatively (e.g.,
temperature/fever), semi-quantitatively (e.g., severity of
respiratory distress [explained in detail below], or qualitatively
(e.g., the presence or absence of one or more symptoms or a
reduction in severity of one or more symptoms, such as cyanosis,
pneumonia, lung lesions etc.).
[0109] An unaffected pig is a pig which has either not been exposed
to a porcine reproductive and respiratory disease infectious agent,
or which has been exposed to a porcine reproductive and respiratory
disease infectious agent but is not showing symptoms of the
disease. An affected pig is one which shows symptoms of PRRS or
from which PRRSV can be isolated.
[0110] Vaccines of the present invention can be formulated
following accepted convention to include acceptable carriers for
animals, including humans (if applicable), such as standard
buffers, stabilizers, diluents, preservatives, and/or solubilizers,
and can also be formulated to facilitate sustained release.
Diluents include water, saline, dextrose, ethanol, glycerol, and
the like. Additives for isotonicity include sodium chloride,
dextrose, mannitol, sorbitol, and lactose, among others.
Stabilizers include albumin, among others. Other suitable vaccine
vehicles and additives, including those that are particularly
useful in formulating modified live vaccines, are known or will be
apparent to those skilled in the art. See, e.g., Remington's
Pharmaceutical Science, 18th ed., 1990, Mack Publishing, which is
incorporated herein by reference.
[0111] Vaccines of the present invention can further comprise one
or more additional immunomodulatory components such as, e.g., an
adjuvant or cytokine, among others. Non-limiting examples of
adjuvants that can be used in the vaccine of the present invention
include the RIBI adjuvant system (Ribi Inc., Hamilton, Mont.),
alum, mineral gels such as aluminum hydroxide gel, oil-in-water
emulsions, water-in-oil emulsions such as, e. g., Freund's complete
and incomplete adjuvants, Block copolymer (CytRx, Atlanta Ga.),
QS-21 (Cambridge Biotech Inc., Cambridge Mass.), SAF-M (Chiron,
Emeryville Calif.), AMPHIGEN.RTM. adjuvant, saponin, Quil A or
other saponin fraction, monophosphoryl lipid A, and Avridine
lipid-amine adjuvant. Non-limiting examples of oil-in-water
emulsions useful in the vaccine of the invention include modified
SEAM62 and SEAM 1/2 formulations. Modified SEAM62 is an
oil-in-water emulsion containing 5% (v/v) squalene (Sigma), 1%
(v/v) SPAN.RTM. 85 detergent (ICI Surfactants), 0.7% (v/v)
TWEEN.RTM. 80 detergent (ICI Surfactants), 2.5% (v/v) ethanol, 200
pg/ml Quil A, 100 [mgr]g/ml cholesterol, and 0.5% (v/v) lecithin.
Modified SEAM 1/2 is an oil-in-water emulsion comprising 5% (v/v)
squalene, 1% (v/v) SPAN.RTM. 85 detergent, 0.7% (v/v) Tween 80
detergent, 2.5% (v/v) ethanol, 100 .mu.g/ml Quil A, and 50 .mu.g/ml
cholesterol. Other immunomodulatory agents that can be included in
the vaccine include, e.g., one or more interleukins, interferons,
or other known cytokines.
[0112] Vaccines of the present invention can optionally be
formulated for sustained release of the virus, infectious RNA
molecule, plasmid, or viral vector of the present invention.
Examples of such sustained release formulations include virus,
infectious RNA molecule, plasmid, or viral vector in combination
with composites of biocompatible polymers, such as, e.g.,
poly(lactic acid), poly(lactic-co-glycolic acid), methylcellulose,
hyaluronic acid, collagen and the like. The structure, selection
and use of degradable polymers in drug delivery vehicles have been
reviewed in several publications, including A. Domb et al., 1992,
Polymers for Advanced Technologies 3: 279-292, which is
incorporated herein by reference. Additional guidance in selecting
and using polymers in pharmaceutical formulations can be found in
texts known in the art, for example M. Chasin and R. Langer (eds),
1990, "Biodegradable Polymers as Drug Delivery Systems" in: Drugs
and the Pharmaceutical Sciences, Vol. 45, M. Dekker, N.Y., which is
also incorporated herein by reference. Alternatively, or
additionally, the virus, plasmid, or viral vector can be
microencapsulated to improve administration and efficacy. Methods
for microencapsulating antigens are well-known in the art, and
include techniques described, e.g., in U.S. Pat. No. 3,137,631;
U.S. Pat. No. 3,959,457; U.S. Pat. No. 4,205,060; U.S. Pat. No.
4,606,940; U.S. Pat. No. 4,744,933; U.S. Pat. No. 5,132,117; and
International Patent Publication WO 95/28227, all of which are
incorporated herein by reference.
[0113] Liposomes can also be used to provide for the sustained
release of virus, plasmid, or viral vector. Details concerning how
to make and use liposomal formulations can be found in, among other
places, U.S. Pat. No. 4,016,100; U.S. Pat. No. 4,452,747; U.S. Pat.
No. 4,921,706; U.S. Pat. No. 4,927,637; U.S. Pat. No. 4,944,948;
U.S. Pat. No. 5,008,050; and U.S. Pat. No. 5,009,956, all of which
are incorporated herein by reference.
[0114] An effective amount of any of the above-described vaccines
can be determined by conventional means, starting with a low dose
of virus, plasmid or viral vector, and then increasing the dosage
while monitoring the effects. An effective amount may be obtained
after a single administration of a vaccine or after multiple
administrations of a vaccine. Known factors can be taken into
consideration when determining an optimal dose per animal. These
include the species, size, age and general condition of the animal,
the presence of other drugs in the animal, and the like. The actual
dosage is preferably chosen after consideration of the results from
other animal studies.
[0115] One method of detecting whether an adequate immune response
has been achieved is to determine seroconversion and antibody titer
in the animal after vaccination. The timing of vaccination and the
number of boosters, if any, will preferably be determined by a
doctor or veterinarian based on analysis of all relevant factors,
some of which are described above.
[0116] The effective dose amount of virus, infectious RNA molecule,
plasmid, or viral vector, of the present invention can be
determined using known techniques, taking into account factors that
can be determined by one of ordinary skill in the art such as the
weight of the animal to be vaccinated. The dose amount of virus of
the present invention in a vaccine of the present invention
preferably ranges from about 10.sup.1 to about 10.sup.9 pfu (plaque
forming units), more preferably from about 10.sup.2 to about
10.sup.8 pfu, and most preferably from about 10.sup.3 to about
10.sup.7 pfu. The dose amount of a plasmid of the present invention
in a vaccine of the present invention preferably ranges from about
0.1 .mu.g to about 100 mg, more preferably from about 1 .mu.g to
about 10 mg, even more preferably from about 10 .mu.g to about 1
mg. The dose amount of an infectious RNA molecule of the present
invention in a vaccine of the present invention preferably ranges
from about 0.1 to about 100 mg, more preferably from about 1 .mu.g
to about 10 mg, even more preferably from about 10 .mu.g to about 1
mg. The dose amount of a viral vector of the present invention in a
vaccine of the present invention preferably ranges from about
10.sup.1 pfu to about 10.sup.9 pfu, more preferably from about
10.sup.2 pfu to about 10.sup.8 pfu, and even more preferably from
about 10.sup.3 to about 10.sup.7 pfu. A suitable dosage size ranges
from about 0.5 ml to about 10 ml, and more preferably from about 1
ml to about 5 ml.
[0117] By way of example, vaccines may be delivered orally,
parenterally, intradermally, subcutaneously, intramuscularly,
intranasally or intravenously. Oral delivery may encompass, for
example, adding the compositions to the feed or drink of the
animals. Factors bearing on the vaccine dosage include, for
example, the weight and age of the pig.
[0118] The present invention further provides a method of preparing
a vaccine comprising a PRRS virus, infectious RNA molecule,
plasmid, or viral vector described herein, which method comprises
combining an effective amount of one of the PRRS virus, infectious
RNA molecule, plasmid, or viral vector of the present invention,
with a carrier acceptable for pharmaceutical or veterinary use.
[0119] In addition the live attenuated vaccine of the present
invention can be modified as described in U.S. Pat. No. 6,500,662
to encode a heterologous antigenic epitope which is inserted into
the PRRS viral genome using known recombinant techniques. Antigenic
epitopes useful as heterologous antigenic epitopes for the present
invention include antigenic epitopes from a swine pathogen other
than PRRS virus which include, but are not limited to, an antigenic
epitope from a swine pathogen selected from the group consisting of
porcine parvovirus, porcine circovirus, a porcine rotavirus, swine
influenza, pseudorabies virus, transmissible gastroenteritis virus,
porcine respiratory coronavirus, classical swine fever virus,
African swine fever virus, encephalomyocarditis virus, porcine
paramyxovirus, Actinobacillus pleuropneumoniae, Actinobacillus
suis, Bacillus anthraci, Bordetella bronchiseptica, Clostridium
haemolyticum, Clostridium perfringens, Clostridium tetani,
Escherichia coli, Erysipelothdix rhusiopathiae, Haemophilus
parasuis, Leptospira spp., Mycoplasma hyopneumoniae, Mycoplasma
hyorhinis, Mycoplasma hyosynovia, Pasteurella multocida, Salmonella
choleraesuis, Salmonella typhimurium, Streptococcus equismilis, and
Streptococcus suis. Nucleotide sequences encoding antigenic
epitopes from the aforementioned swine pathogens are known in the
art and can be obtained from public gene databases such as GenBank
(http://www.ncbi.nlm.nih.gov/Web/Genbank/index.html) provided by
NCBI.
[0120] Additional features and variations of the invention will be
apparent to those skilled in the art from the entirety of this
application, including the detailed description, and all such
features are intended as aspects of the invention. Likewise,
features of the invention described herein can be re-combined into
additional embodiments that also are intended as aspects of the
invention, irrespective of whether the combination of features is
specifically mentioned above as an aspect or embodiment of the
invention. Also, only such limitations which are described herein
as critical to the invention should be viewed as such; variations
of the invention lacking limitations which have not been described
herein as critical are intended as aspects of the invention. It
will be clear that the invention may be practiced otherwise than as
particularly described in the foregoing description and
examples.
[0121] Numerous modifications and variations of the present
invention are possible in light of the above teachings and,
therefore, are within the scope of the invention.
[0122] The present invention is further illustrated by, but not
limited to, the following examples
Example 1
Construction of Shuttle Plasmid pTB-Shuttle-PRRSV-3997
[0123] A shuttle plasmid was constructed in order to facilitate the
introduction of specific modifications to a full-length PRRS virus
genomic cDNA clone. A 3,997 bp fragment, representing the extreme
3' end of the viral genome (nucleotide positions 11,504 to 15,416,
including a 21 residue polyadenosine tail) and 84 bp of downstream
vector sequences, was PCR-amplified. The PCR reaction included 5 ng
of pCMV-S-P129 plasmid DNA (U.S. Pat. No. 6,500,662 B1), 300 ng of
forward primer P-shuttle-Fwd (5'-ACTCAGTCTAAGTGCTGGAAAGTTATG-3')
(SEQ ID NO: 8): positions 11,504 to 11,530), 300 ng of reverse
primer P-shuttle-Rev primers (5'-ATCTTATCATGTCTGGATCCCCGCGGC-3')
(SEQ ID NO: 9): positions 15,500 to 15,475), 1 mM each of dCTP,
dGTP, dATP, and dTTP, 1.times. PCR buffer [10 mM KCl, 10 mM
(NH.sub.4).sub.2SO.sub.4, 20 mM Tris-HCl (pH 8.8), 2 mM MgSO.sub.4,
0.1% Triton X-100], and 2.5 U of Pfu DNA polymerase (Stratagene)
using the GeneAmp PCR system 2400 (Perkin Elmer). The reaction was
heated up for 5 min at 95.degree. C. and subjected to 35 cycles of
amplification under the following conditions; denaturation at
95.degree. C. for 30 sec, primer annealing at 55.degree. C. for 1
min, and extension at 72.degree. C. for 3 min. The PCR product was
cloned into the pTrueBlue vector using the TrueBlue
MicroCartridge.TM. PCR Cloning Kit XL (Genomics One; Buffalo, N.Y.)
to create pTB-shuttle-PRRSV-3997.
Example 2
Modification of the NLS-2 Sequence to Generate P129-GG Virus
[0124] PCR-based site-directed mutagenesis was used to modify the
nuclear localization signal 2 (NLS-2) motif located at amino acid
positions 41 to 47 of the nucleocapsid (N) protein. Among North
American genotype PRRS viruses, this NLS motif is generally PGKKNKK
(as in the prototype isolate VR-2332 or the Canadian isolate PA-8),
or a derivative thereof, such as PGKKSKK (found in isolates P129
and 93-47324). The presence of multiple positively charged lysine
(K) or arginine (R) residues is believed to be important for a
fully functional NLS signal. The lysine residues at positions 43
and 44 of N (nucleotide positions 14,999-15,004 of the P129 genome)
were replaced by glycine residues using the shuttle plasmid and the
mutagenic primer pair KK43/44GG-Fwd
(5'-GGCAAGGGACCGGGAGGGGGAAATAAGAAGAAAAAC-3') (SEQ ID NO: 10)-:
genome positions 14,984 to 15,019) and KK43/44GG-Rev
(5'-GTTTTTCTTCTTATTTCCCCCTCCCGGTCCCTTGCC-3') (SEQ ID NO: 11)-:
genome positions 14,984 to 15,019), where underlines indicate codon
changes for amino acid substitutions from KKS to GGN. PCR
amplifications were carried out using 5 ng of
pTB-shuttle-PRRSV-3997 plasmid DNA, 300 ng each of the forward and
reverse primers; 1 mM concentrations each of dCTP, dGTP, dATP, and
dTTP, 1.times. PCR buffer [10 mM KCl, 10 mM
(NH.sub.4).sub.2SO.sub.4, 20 mM Tris-HCl (pH 8.8), 2 mM MgSO.sub.4,
0.1% Triton X-100]; and 2.5 U of Pfu DNA polymerase (Stratagene).
The samples were subjected to 16 cycles of amplification under the
following conditions: denaturation at 94.degree. C. for 30 s,
primer annealing at 55.degree. C. for 1 min, and primer extension
at 68.degree. C. for 12 min 30 sec. Following PCR cycling, the
PCR-product was digested with 10 U of DpnI to remove the methylated
plasmid DNA template. E. coli XL1-Blue cells were transformed by
heat shock with 4 .mu.l of the PCR-Dpn I digested reaction
containing the mutated plasmids and plated on an LB agar plate
containing ampicillin. Colonies were randomly picked and cultivated
overnight. Plasmid DNA was prepared using a QIAprep spin miniprep
kit (Qiagen). The presence of the desired mutation (PGGGNKK) was
verified by nucleotide sequencing and the resulting plasmid was
named pTB-shuttle-N-GG.
[0125] The shuttle plasmid carrying the GG mutation
(pTB-shuttle-N-GG) and the wild type full-length genomic clone
(pCMV-S-P129) each contain unique BsrG I and Spe I sites (at
positions 1,192 and 3,963, and positions 12,692 and 15,463,
respectively). After digestion with these two enzymes, the 2,772 by
BsrG I-Spe I fragment was gel-purified from pTB-shuttle-N-GG, and
the 16,120 by BsrG I-Spe I fragment was gel-purified from
pCMV-S-P129. These two fragments were ligated using T4 DNA ligase
(Invitrogen) to construct a GGN-modified full-length genomic cDNA
clone. E. coli strain DH5-.alpha. was transformed with 10 .mu.l of
the ligation reaction. Bacterial colonies were selected from LB
plates containing ampicillin and plasmid DNAs were prepared. Based
on Xma I digestion patterns, full-length clones were selected. The
selected clones were sequenced to confirm the presence of the GGN
modification in the full-length genomic cDNA clone. One of the
resulting plasmids was designated pCMV-S-P129-GG.
[0126] MARC-145 cells were grown in Dulbecco's modified Eagle
medium (DMEM) supplemented with 8% fetal bovine serum (FBS; Gibco
BRL), penicillin (100 U/ml), and streptomycin (50 .mu.g/ml) at
37.degree. C. with 5% CO.sub.2. Cells were seeded in 35 mm-diameter
dishes and grown to 70% confluency. The cells were transfected for
24 h with 2 .mu.g of pCMV-S-P129-GG plasmid DNA using Lipofectin
(Invitrogen). The transfected cells were incubated at 37.degree. C.
in DMEM supplemented with 8% FBS for 5 days. PRRSV-specific
cytopathic effect (CPE) was observed from 3 days post-transfection
and further spread to neighboring cells was seen by 5 days
post-transfection. The specificity of CPE was confirmed by
immunofluorescence cell staining using a rabbit antiserum for
nonstructural proteins nsp2 and nsp3, and the N-specific MAb SDOW17
(see FIG. 1). The culture supernatants from transfected cells were
harvested at 5 days post-transfection and designated `P129-GG
passage 1` (P1). The passage-1 virus was used to inoculate fresh
Marc-145 cells and the 5-day harvest was designated `passage-2`
(P2). `Passage-3` (P3) virus was prepared in the same way as P2.
Each viral passage was stored in 1 ml aliquots at -80.degree. C.
until use. Each passage of P129-GG virus was titrated by plaque
assay, and the titers were determined to be 1.times.10.sup.2,
5.times.10.sup.2, and 5.times.10.sup.3 pfu/ml for passages 1, 2,
and 3, respectively. Wild type P129 virus was generated from
pCMV-S-P129 and titrated in parallel, yielding titers of
1.times.10.sup.3, 1.times.10.sup.4, and 5.times.10.sup.5 pfu/ml for
passages 1, 2, and 3 respectively.
Example 3
Infection of Pigs with P129-GG Virus and Parental P129 Virus
(Demonstration that the P129-GG virus is Attenuated)
[0127] Twenty-one healthy, crossbred pigs without a history of
disease caused by or vaccination against PRRSV and Mycoplasma
hyopneumoniae were randomly assigned to 3 treatment groups of 7
pigs each. At approximately 6 weeks of age, T01 pigs received a
placebo while T02 and T03 pigs received an intranasal challenge
with 2.0 ml of virus stock diluted to 2.5.times.10.sup.4 pfu/ml
(5.0.times.10.sup.4 pfu/dose) of the genetically modified P129-GG
virus (generated from plasmid pCMV-S-P129-GG) or parental P129 PRRS
virus (generated from plasmid pCMV-S-P129), respectively. All pigs
were observed daily for clinical signs including general condition,
depression, loss of appetite, sneezing, coughing, and respiratory
distress. Rectal temperatures and body weights were recorded. Blood
samples were taken on Days 0, 4, 7, 10, 14, 21, and 28 for PRRSV
isolation and serology. Necropsies were performed on Days 14 (2
pigs/group) and 28 (5 pigs/group), and tissue samples (lung and
tonsil) were collected. Estimates of lung lesion severity and
percent consolidation of each lung lobe were made. Pigs in groups
T02 and T03 developed signs of a mild PRRS virus infection, shed
virus in the serum, and seroconverted. Uninfected control pigs
(T01) remained negative for serum viremia and negative for antibody
to the PRRS virus.
[0128] Compared to pigs infected with P129 parental virus (T03),
pigs infected with the P129-GG virus (T02) shed less virus in their
serum (FIGS. 2a and 2b) and produced higher levels of anti-PRRS
ELISA antibody (FIGS. 2C and 2D), and neutralizing antibody (FIG.
2e).
TABLE-US-00008 TABLE 6 ELISA Antibody Levels (S/P) day 0 day 4 day
7 day 10 day 14 day 21 day 28 P129-wt pig 28 0.000 0.000 0.061
0.283 0.527 0.689 1.025 pig 30 0.006 0.000 0.044 0.178 0.527 0.731
0.672 pig 35 0.000 0.000 0.000 0.027 0.157 0.241 0.197 pig 40 0.004
0.021 0.030 0.208 0.575 0.723 0.890 pig 43 0.000 0.000 0.049 0.354
0.419 1.760 2.006 mean 0.002 0.004 0.037 0.210 0.441 0.829 0.958
P129-GG pig 33 0.000 0.000 0.000 0.356 0.873 1.377 1.705 pig 36
0.000 0.000 0.019 0.383 1.038 1.536 1.604 pig 38 0.000 0.000 0.034
0.248 0.383 0.723 1.398 pig 45 0.004 0.000 0.090 0.288 0.416 0.371
0.386 pig 46 0.000 0.000 0.066 0.627 1.154 1.438 1.676 mean 0.001
0.000 0.042 0.380 0.773 1.089 1.354 Means 0 4 7 10 14 21 28 P129-wt
0.002 0.004 0.037 0.210 0.441 0.829 0.958 P129-GG 0.001 0.000 0.042
0.380 0.773 1.089 1.354
[0129] Serum neutralization titers were determined in both the T02
and T03 groups at 7, 14, 21 and 28 days post infection. The
neutralizing titers were determined by TCID50 in 96 well plates in
duplicate. In each well 200 pfu of wild type P129 virus in a volume
of 100 .mu.l was combined with 100 .mu.l of a serial 2-fold
dilution of sera (previously heat inactivated for 30 min at
56.degree. C.). The mixture was incubated for 1 hr at 37 C,
followed by infection of cells. The infected cells were incubated
for 5 days and CPEs were determined. The data is presented below
and shows that pigs infected with the mutant virus developed higher
mean neutralizing titers than those infected with the wild type
parent virus.
TABLE-US-00009 TABLE 7 Neutralizing Titers During Four Weeks of
Infection (duplicate values) Day 7 Day 14 Day 21 Day 28 P129-wt Pig
28 <2, <2 <2, <2 4, 4 3.5 Pig 30 <2, <2 2, 8 2, 2
4 Pig 35 <2, <2 4, 4 8, 4 7.5 Pig 40 <2, <2 4, 4 2, 8 8
Pig 43 <2, <2 2, 4 <2, 8 3.5 Mean <2 3.2 4.2 5.3
P129-GG Pig 33 <2, <2 4, 8 8, 16 16 Pig 36 <2, <2 2, 2
16, 16 16 Pig 38 <2, <2 8, 4 8, 4 36 Pig 45 <2, <2 2, 2
4, 4 6 Pig 46 <2, <2 8, 8 16, 16 48 Mean <2 4.8 10.8
24.4
[0130] One of the hallmarks in PRRSV infection is the persistence
of virus in tonsils. Therefore, tonsils were collected from all
infected pigs and two mock-infected control pigs at the termination
of the study (4 weeks post-infection) and examined for viral
persistence by RT-PCR. The N gene was detectable by RT-PCR in all
pigs infected with either GG virus or P129 virus, while tonsils
from mock-infected pigs remained negative. This indicates that all
infected pigs shed the virus at 4 weeks post-infection. To examine
possible mutations in NLS of the N gene, PCR products from tonsils
were sequenced.
[0131] In all five pigs, GG virus persisting in the tonsils was
found to be mutated in the NLS-2 sequence by the introduction of an
arginine at either position 43 or 44. Wild-type P129 virus from
tonsils did not mutate and retained the wild-type NLS-2
sequence.
Example 4
Reversion-Resistant Mutations of NLS-2
[0132] The P129-GG mutation described in Example 2 was created by
changing six nucleotides. As seen in Example 3, this virus is
capable of partial or full reversion and can regain the parental
NLS-negative phenotype at a relatively high frequency due to random
mutation and natural selection. Preferred embodiments of the
invention, especially for vaccine purposes, would contain
additional nucleotide substitutions and/or deletions, designed to
minimize the probability of reversion, and to minimize the
probability of other flanking residues mutating to basic residues
such as lysine and arginine and thereby restoring a functional NLS
motif in the region. Codons that require two or three separate
nucleotide changes in order to mutate to codons encoding a basic
residue are preferred over those that require only one change.
Deletion mutations are very unlikely to revert, since a portion of
the region has been removed. Alternative codons can be chosen for
flanking amino acids, in order to reduce the chances of reacquiring
a pat7, pat4, or other NLS motif by mutation. Examples of such
"reversion resistant" mutations are shown in Table 6, and are
intended to be representative rather than limiting. Given this
information, other examples of reversion resistant mutations may be
envisioned by one of ordinary skill in the art.
[0133] In Table 8, mutant virus P129-d43/44 is a deletion of amino
acids 43 and 44. In addition, the serine codon at position 45 is
changed from AGT to TCT to reduce the probability of it mutating to
a lysine or arginine codon. Also, the asparagine codon at position
49 (AAC) is changed to a serine codon (TCC) for the same reason.
Serine is found at position 49 in some naturally occurring field
isolates, so should be well tolerated. A minimal pat 7 NLS motif
(PGSKKKS) remains in this mutant, and may have partial NLS
activity. Viruses with partial NLS activity are predicted to have
phenotypes that are intermediate between wild type (parental) virus
and complete NLS knockout mutants. Such viruses may be especially
useful as vaccines.
TABLE-US-00010 TABLE 8 Contemplated Deletion Mutants T I Q D M Q N
N I N N K K G V R K R R N R R R S S D 38 39 40 41 42 43 44 45 46 47
48 49 50 51 52 53 G K G P G K K S K K K N P E K P wtP129 (SEQ ID
NO: 12) GGC AAG GGA CCG GGC AAG AAA AGT AAG AAG AAA AAC CCG GAG AAG
CCC (SEQ ID NO: 13) 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53
G K G P G G G N K K K N P E K P P129-GG SEQ ID NO: 14) GGC AAG GGA
CCG GGA GGG GGA AAT AAG AAG AAA AAC CCG GAG AAG CCC (SEQ ID NO: 15)
38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 G K G P G - - S K K
K S P E K P P129-d43/44 (SEQ ID NO: 16) GGC AAG GGA CCG GGC --- ---
TCT AAG AAG AAA TCC CCG GAG AAG CCC (SEQ ID NO: 17) 38 39 40 41 42
43 44 45 46 47 48 49 50 51 52 53 G K G P G - - S - K K S P E K P
P129-d43/44/46 (SEQ ID NO: 18) GGC AAG GGA CCG GGC --- --- TCT ---
AAG AAA TCC CCG GAG AAG CCC (SEQ ID NO: 19) 38 39 40 41 42 43 44 45
46 47 48 49 50 51 52 53 G K G P G K - S - - K S P E K P
P129-d44/46/47 (SEQ ID NO: 20) GGC AAG GGA CCG GGC AAG --- TCT ---
--- AAA TCC CCG GAG AAG CCC (SEQ ID NO: 21) 38 39 40 41 42 43 44 45
46 47 48 49 50 51 52 53 G K G P G K K S - - - S P E K P
P129-d46/47/48 (SEQ ID NO: 22) GGC AAG GGA CCG GGC AAG AAA TCT ---
--- --- TCC CCG GAG AAG CCC (SEQ ID NO: 23) The letters in bold at
the top above are alternative residues that are found in at least
one NA PRRS virus. The two underlined segments form a 5-base stem
that may be important for negative strand synthesis. 4 and 5
residue deletions are also contemplated
[0134] The other three mutants shown in Table 8 (P129-d43/44/46,
P129-d44/46/47, and P129-d46/47/48) are deletions of three amino
acids, and also have the codon changes at positions 45 and 49
discussed above. These mutations lack an NLS motif and are
predicted to have a complete knockout of NLS activity. These
viruses are anticipated to be attenuated in pigs and especially
useful as vaccines.
[0135] The forward and reverse primers for the mutations described
in Table 8 are as follows:
TABLE-US-00011 Forward Primers (5' - 3') P129-d43/44 F (SEQ ID NO:
24) GTCCAGAGGCAAGGGACCGGGATCTAAGAAGAAATCCCCGGAG P129-d43/44/46F
(SEQ ID NO: 25) GTCCAGAGGCAAGGGACCGGGATCTAAGAAATCCCCGGAG
P129-d44/46/47F (SEQ ID NO: 26)
GCAAGGGACCGGGAAAGTCTAAATCCCCGGAGAAGCCCC P129-d46/47/48F (SEQ ID NO:
27) GCAAGGGACCGGGAAAGAAATCTTCCCCGGAGAAGCCCC Reverse Primers (5' -
3') P129-d43/44 R (SEQ ID NO: 28)
CTCCGGGGATTTCTTCTTAGATCCCGGTCCCTTGCCTCTGGAC P129-d43/44/46R (SEQ ID
NO: 29) CTCCGGGGATTTCTTAGATCCCGGTCCCTTGCCTCTGGAC P129-d44/46/47R
(SEQ ID NO: 30) GGGGCTTCTCCGGGGATTTAGACTTTCCCGGTCCCTTGC
P129-d46/47/48R (SEQ ID NO: 31)
GGGGCTTCTCCGGGGAAGATTTCTTTCCCGGTCCCTTGC
[0136] The descriptions and examples above demonstrate that the
NLS-2 regions is not required for virus multiplication but is an
important virulence factor for PRRSV, as demonstrated by the fact
that the only virus persisting in tonsils has mutated. We also
demonstrate that the NLS in the PRRSV N protein is positively
correlated with higher neutralizing antibodies and higher ELISA
titers. We thus have established that mutations eliminating the
NLS-2 sequence motif result in an attenuated strain of PRRSV.
Numbered Description of the Invention
[0137] 1. A composition comprising a PRRS infectious agent selected
from the group consisting of: a.) a genetically modified PRRS virus
comprising an N protein which has been modified in at least one
conserved region selected from the group consisting of the NLS-2
region, NoLS region and the NES region such that the conserved
region has been eliminated, and wherein the genetically modified
PRRS virus is attenuated; b.) an infectious RNA molecule encoding
the genetically modified PRRS virus of a.); and c.) an isolated
polynucleotide molecule comprising a DNA sequence encoding the
infectious RNA molecule of b.). 2. The composition of claim 1 which
has been further modified to result in the elimination of the
conserved NLS-1 region. 3. The composition of claim 1 wherein the
conserved region has been eliminated by the introduction of a
non-conservative amino acid substitution. 4. The composition of
claim 1 or 2 wherein the conserved region has been at least
partially deleted. 5. The composition of claim 1 wherein the
conserved region is the NoLS region. 6. The composition of claim 1
wherein the conserved region is the NLS-2 region. 7. The
composition of claim 1 wherein the conserved region is the NES
region. 8. The composition of claim 1 wherein the PRRS virus is a
North American PRRS virus. 9. The composition of claim 1 wherein
the PRRS virus is a European PRRS virus. 10. The composition of
claim 8 wherein the conserved region is the NLS-2 region. 11. The
composition of claim 10 wherein residues 42 and 43 of the N protein
are glycines. 12. The composition of claim 10 wherein residues 42
and 43 of the N protein are glycine and residue 44 is an
asparagine. 13. The composition of claim 10 wherein the NLS-2
region has been at least partially deleted. 14. The composition of
claim 13 wherein at least one of residues 43 through 48 of the N
protein have been deleted. 15. The composition of claim 14 wherein
both residues 43 and 44 of the N protein have been deleted. 16. The
composition of claim 14 wherein residues 43, 44, and 46 of the N
protein have been deleted. The composition of claim 14 wherein
residues 44, 46, and 47 of the N protein have been deleted. 17. The
composition of claim 14 wherein residues 46, 47, and 48 of the N
protein have been deleted. 18. The composition of claims 1 that
contain additional nucleotide mutation, substitutions and/or
deletions, designed to minimize the probability of reversion.
[0138] 19. A vaccine for protecting a porcine animal from infection
by a PRRS virus comprising the composition of any of claim 1 in an
amount effective to produce immunoprotection against infection by a
PRRS virus; and a carrier acceptable for veterinary use. 20. A
method for protecting a porcine animal from infection by a PRRS
virus, which comprises vaccinating the animal with an amount of the
vaccine of claim 19 that is effective to produce immunoprotection
against infection by a PRRS virus. 21. A transfected host cell
comprising a composition according to any of claim 1.
[0139] 22. A method for making a genetically modified and
attenuated PRRS virus, which method comprises: a.) mutating a DNA
sequence encoding an infectious RNA molecule which encodes a PRRS
virus, to produce a genetically modified PRRS virus comprising an N
protein which has been modified in an at least one conserved region
selected from the group consisting of the NLS-2 region, NoLS region
and the NES region such that the conserved region has been
eliminated; b.) introducing the genetically modified PRRS virus
into a host cell capable of supporting PRRS replication. 23. A
method of claim 22 wherein the genetically modified PRRS virus is a
North American PRRS virus. 24. A method of claim 22 wherein the
genetically modified PRRS virus is a European PRRS virus. 25. The
method of claim 22 wherein the host cell capable of supporting PRRS
replication is a MARC-145 cell. 26. The method of claim 22 wherein
the host cell capable of supporting PRRS replication is comprised
within a live porcine animal.
Sequence CWU 1
1
3118PRTPorcine reproductive and respiratory syndrome virus 1Pro Gly
Lys Lys Asn Lys Lys Lys1 5232PRTPorcine reproductive and
respiratory syndrome virus 2Pro Gly Lys Lys Asn Lys Lys Lys Asn Pro
Glu Lys Pro His Phe Pro1 5 10 15Leu Ala Thr Glu Asp Asp Val Arg His
His Phe Thr Pro Ser Glu Arg 20 25 30333PRTPorcine reproductive and
respiratory syndrome virus 3Pro Arg Gly Gly Gln Ala Lys Lys Lys Lys
Pro Glu Lys Pro His Phe1 5 10 15Pro Leu Ala Ala Glu Asp Asp Ile Arg
His His Leu Thr Gln Thr Glu 20 25 30Arg412PRTPorcine reproductive
and respiratory syndrome virus 4Leu Pro Thr His His Thr Val Arg Leu
Ile Arg Val1 5 10512PRTPorcine reproductive and respiratory
syndrome virus 5Leu Pro Val Ala His Thr Val Arg Leu Ile Arg Val1 5
106123PRTPorcine reproductive and respiratory syndrome virus 6Met
Pro Asn Asn Asn Gly Lys Gln Gln Lys Lys Lys Lys Gly Asn Gly1 5 10
15Gln Pro Val Asn Gln Leu Cys Gln Met Leu Gly Lys Ile Ile Ala Gln
20 25 30Gln Asn Gln Ser Arg Gly Lys Gly Pro Gly Lys Lys Ser Lys Lys
Lys 35 40 45Asn Pro Glu Lys Pro His Phe Pro Leu Ala Thr Glu Asp Asp
Val Arg 50 55 60His His Phe Thr Pro Gly Glu Arg Gln Leu Cys Leu Ser
Ser Ile Gln65 70 75 80Thr Ala Phe Asn Gln Gly Ala Gly Thr Cys Thr
Leu Ser Asp Ser Gly 85 90 95Arg Ile Ser Tyr Thr Val Glu Phe Ser Leu
Pro Thr His His Thr Val 100 105 110Arg Leu Ile Arg Val Thr Ala Ser
Pro Ser Ala 115 1207369DNAPorcine reproductive and respiratory
syndrome virus 7atgccaaata acaacggcaa gcagcaaaag aaaaagaagg
ggaatggcca gccagtcaat 60cagctgtgcc agatgctggg taaaatcatc gcccagcaaa
accagtccag aggcaaggga 120ccgggcaaga aaagtaagaa gaaaaacccg
gagaagcccc attttcctct agcgaccgaa 180gatgacgtca ggcatcactt
cacccctggt gagcggcaat tgtgtctgtc gtcgatccag 240actgccttta
accagggcgc tggaacttgt accctgtcag attcagggag gataagttac
300actgtggagt ttagtttgcc gacgcatcat actgtgcgcc tgatccgcgt
cacagcatca 360ccctcagca 369827DNAPorcine reproductive and
respiratory syndrome virus 8actcagtcta agtgctggaa agttatg
27927DNAPorcine reproductive and respiratory syndrome virus
9atcttatcat gtctggatcc ccgcggc 271036DNAPorcine reproductive and
respiratory syndrome virus 10ggcaagggac cgggaggggg aaataagaag
aaaaac 361136DNAPorcine reproductive and respiratory syndrome virus
11gtttttcttc ttatttcccc ctcccggtcc cttgcc 361216PRTPorcine
reproductive and respiratory syndrome virus 12Gly Lys Gly Pro Gly
Lys Lys Ser Lys Lys Lys Asn Pro Glu Lys Pro1 5 10 151348DNAPorcine
reproductive and respiratory syndrome virus 13ggcaagggac cgggcaagaa
aagtaagaag aaaaacccgg agaagccc 481416PRTPorcine reproductive and
respiratory syndrome virus 14Gly Lys Gly Pro Gly Gly Gly Asn Lys
Lys Lys Asn Pro Glu Lys Pro1 5 10 151548DNAPorcine reproductive and
respiratory syndrome virus 15ggcaagggac cgggaggggg aaataagaag
aaaaacccgg agaagccc 481614PRTPorcine reproductive and respiratory
syndrome virus 16Gly Lys Gly Pro Gly Ser Lys Lys Lys Ser Pro Glu
Lys Pro1 5 101742DNAPorcine reproductive and respiratory syndrome
virus 17ggcaagggac cgggctctaa gaagaaatcc ccggagaagc cc
421813PRTPorcine reproductive and respiratory syndrome virus 18Gly
Lys Gly Pro Gly Ser Lys Lys Ser Pro Glu Lys Pro1 5 101939DNAPorcine
reproductive and respiratory syndrome virus 19ggcaagggac cgggctctaa
gaaatccccg gagaagccc 392013PRTPorcine reproductive and respiratory
syndrome virus 20Gly Lys Gly Pro Gly Lys Ser Lys Ser Pro Glu Lys
Pro1 5 102139DNAPorcine reproductive and respiratory syndrome virus
21ggcaagggac cgggcaagtc taaatccccg gagaagccc 392213PRTPorcine
reproductive and respiratory syndrome virus 22Gly Lys Gly Pro Gly
Lys Lys Ser Ser Pro Glu Lys Pro1 5 102339DNAPorcine reproductive
and respiratory syndrome virus 23ggcaagggac cgggcaagaa atcttccccg
gagaagccc 392443DNAPorcine reproductive and respiratory syndrome
virus 24gtccagaggc aagggaccgg gatctaagaa gaaatccccg gag
432540DNAPorcine reproductive and respiratory syndrome virus
25gtccagaggc aagggaccgg gatctaagaa atccccggag 402639DNAPorcine
reproductive and respiratory syndrome virus 26gcaagggacc gggaaagtct
aaatccccgg agaagcccc 392739DNAPorcine reproductive and respiratory
syndrome virus 27gcaagggacc gggaaagaaa tcttccccgg agaagcccc
392843DNAPorcine reproductive and respiratory syndrome virus
28ctccggggat ttcttcttag atcccggtcc cttgcctctg gac 432940DNAPorcine
reproductive and respiratory syndrome virus 29ctccggggat ttcttagatc
ccggtccctt gcctctggac 403039DNAPorcine reproductive and respiratory
syndrome virus 30ggggcttctc cggggattta gactttcccg gtcccttgc
393139DNAPorcine reproductive and respiratory syndrome virus
31ggggcttctc cggggaagat ttctttcccg gtcccttgc 39
* * * * *
References