Modulation of NR2F6 and methods and uses thereof

Abstract

The disclosure provides methods of modulating NR2F6 in a cell or animal in need thereof by administering an effective amount of a NR2F6 modulator.

Description

RELATED APPLICATIONS

[0001] This application claims the benefit under 35 USC .sctn.119(e) of U.S. provisional application No. 61/114,764 filed Nov. 14, 2008, which is incorporated herein in its entirety.

FIELD

[0002] The present disclosure relates to methods and compositions for modulating NR2F6 for therapeutic applications. In particular, the disclosure relates to methods and compositions comprising modulators of NR2F6 for modulating stem cell growth, proliferation and differentiation and for treating associated conditions and diseases.

BACKGROUND

[0003] Primary cancer cells exhibit heterogeneity in clonogenicity, the capacity to proliferate and form colonies in vitro. The cancer stem cell (CSC) model accounts for this heterogeneity by proposing that each cancer consists of a small population of cells capable of unlimited growth and self-renewal, known as CSCs, and a much larger population of cells, descendants of the CSCs, that have lost self-renewal capacity and are undergoing terminal differentiation. Evidence supporting this model has been reported for several malignancies including acute myelogenous leukemia, brain cancer and breast cancer. The CSC model has important implications for cancer therapy; eradication of CSCs, the cells responsible for maintenance of the neoplasm, would be necessary and sufficient to achieve cure.

[0004] Myelodysplastic syndrome (MDS) is a clonal disorder of haematopoietic tissue, characterized by peripheral blood cytopenias, apoptosis of bone marrow haematopoietic progenitors, abnormal blood cell morphology (dysplasia) and a marked propensity to evolve into acute leukemia. The central paradox of MDS biology resides in the observation that the MDS clone, which is characterized by reduced numbers of mature progeny and by maturing progenitors that exhibit impaired clonogenicity and a high rate of apoptosis, nonetheless comes to dominate the bone marrow at the expense of residual normal haematopoiesis and thereby causes disease. The cancer stem cell model suggests a resolution to this paradox, namely that the MDS clone, despite the defects seen in its differentiating members, out-competes normal haematopoiesis because of a selective advantage at the stem cell level. It is hypothesized that this competitive advantage consists in an increased capacity of MDS stem cells for self-renewal.

[0005] The natural history of MDS is highly heterogenous, with some cases causing chronic cytopenias and others rapidly progressing to acute leukemia. Patients diagnosed with MDS have a life expectancy of 6 months to 5 years, and despite the recent development of some promising new therapies that offer hope for a small subset of patients with MDS, the mainstay of treatment for this disease remains supportive for palliative care with blood transfusion. Thus, most patients diagnosed with MDS face the prospect of a shortened life expectancy, impaired quality of life because of dependency on transfusions, and dread and uncertainty regarding the onset of acute leukemia.

[0006] Acute leukemia (AL) is an aggressive cancer of the blood forming cells in the bone marrow. It may arise secondary to preexisting hematopoietic conditions such as MDS, or de novo. Despite the many advances made in the understanding of leukemia biology over the past three decades, therapy for AML remains, in most cases, debilitating and ineffective. Further progress in improving the efficacy of anti-leukemia therapy hinges upon the identification of methods that allow for the targeting of the leukemia stem cell. Leukemia is a disease characterised by impairment of differentiation. Leukemia stem cells are the culprit of the disease. These rare cells (<1% of the population) are the only leukemia cells that are immortal. These cells are responsible for the initiation and maintenance of the leukemia. Eradication of the leukemia stem cell therefore, would be necessary and sufficient for cure. The rest of the leukemia cells in an AML patient are non-stem leukemia cells, these comprise the vast majority of the patient's leukemia cell burden. Non-stem leukemia cells are "benign" cells that either have a finite ability to divide or have lost the ability to divide altogether. Non-stem leukemia cells arise from the differentiation of leukemia stem cells. In contrast to current therapies that target both leukemia stem and non-stem cells, differentiation therapy aims at inhibiting the ability of leukemia stem cells to self-renew and inducing the differentiation of leukemia stem cells into non-stem leukemia cells. Differentiation therapy promises to be much more effective, selective and less toxic than chemotherapy.

[0007] NR2F6, known also as EAR-2, is an orphan nuclear receptor and a member of the chicken ovalbumin upstream promoter (COUP) family of nuclear receptors. The nuclear receptors (NRs) comprise a very large family of ligand activated transcription factors. Multiple lines of evidence suggest a role for NR signalling in the transcriptional regulation of haematopoiesis. Acute promyelocytic leukemia is invariably associated with gene fusions involving the retinoic acid receptor .alpha. (RAR.alpha.) and one of five different partners, PML, PLZF, NPM, NuMA, and STAT5b. Patients with this disease respond to treatment with the RAR.alpha. ligand, all trans retinoic acid (ATRA). Dominant negative mutants of RAR.alpha. enhance mast cell development and reduce granulocyte and macrophage development in multipotential haematopoietic cell lines, and also block myeloid development in transduced murine bone marrow. Although targeted disruption of RAR.alpha. in the mouse has little effect on haematopoiesis, in vitro studies revealed an increased proportion of morphologically immature granulocytes in RAR.alpha.1/RAR.gamma. double mutants. In addition to this, in vitro studies suggest a role for the thyroid hormone receptor in erythropoiesis and for the PPAR.gamma. in monocyte/macrophage development. A role for the vitamin D receptor in myeloid differentiation is suggested by 1,25-dihydroxyvitamin D3-induced terminal differentiation and cell cycle arrest of a variety of leukaemic cell lines. Although little is known of the downstream genes regulated by NRs in haematopoiesis, evidence suggests that the cdk inhibitor p21 and the transcription factor C/EBP.epsilon. may be targets of RAR.alpha. in myelopoiesis.

[0008] NR2F6, known also as EAR-2, is an orphan nuclear receptor that was cloned in a search for homologues of the retroviral oncogene v-erbA using low stringency hybridization (see Miyajima, N., et al., (Identification of two novel members of erbA superfamily by molecular cloning: the gene products of the two are highly related to each other. Nucleic Acids Res, 16(23): p. 11057-74. 1988)). EAR-2 is a member of the chicken ovalbumin upstream promoter (COUP) family of nuclear receptors. The COUPs function in vitro as transcriptional repressors, antagonizing the activation ability of a wide range of nuclear receptors that play prominent roles in differentiation. Accordingly, aberrant expression of COUP-TFI inhibits retinoid-induced epithelial and neuronal differentiation in vitro (Please see Kyakumoto, S., M. Ota, and N. Sato (Inhibition of retinoic acid-inducible transcription by COUP-TFI in human salivary gland adenocarcinoma cell line HSG. Biochem Cell Biol, 77(6): p. 515-26. 1999), Neuman, K., et al., (Orphan receptor COUP-TF I antagonizes retinoic acid-induced neuronal differentiation. J Neurosci Res, 41(1): p. 39-48. 1995) and Adam, F., et al., (COUP-TFI (chicken ovalbumin upstream promoter-transcription factor I) regulates cell migration and axogenesis in differentiating P19 embryonal carcinoma cells. Mol Endocrinol, 14(12): p. 1918-33. 2000)). The roles of COUP-TFI and COUP-TFII in mammalian development have been studied by targeted deletion in the mouse. COUP-TFI deficient mice exhibit numerous defects in axonal development, including failure of development of the nucleus of the 9th cranial nerve. COUP-TFII deletion causes widespread defects in angiogenesis and cardiac development, leading to embryonic lethality in mid-gestation. Seven-up (svp), the Drosophila COUP family homologue, is also important in embryonic development; with null mutations of seven-up being embryonic lethal. svp is involved in decisions of cell fate determination during the development of the photoreceptors in the ommatidium of the eye and regulates proliferation during the development of the malpighian tubules by regulating the expression of cell cycle regulators.

[0009] In contrast to the related proteins COUP-TFI and COUP-TFII, the function of EAR-2 has not been well characterized. EAR-2 functions as a transcriptional repressor in vitro, inhibiting the transactivating ability of numerous genes including the thyroid hormone receptor (See Zhu, X. G. et al. (The orphan nuclear receptor Ear-2 is a negative coregulator for thyroid hormone nuclear receptor function. Mol Cell Biol 20, 2604-18. 2000)). Like many nuclear receptors, EAR-2 heterodimerizes with the retinoid X receptor-.alpha. (RXR-.alpha.), although the relevance of this interaction in EAR-2 function is unclear (See Ladias, (J. A. Convergence of multiple nuclear receptor signaling pathways onto the long terminal repeat of human immunodeficiency virus-1. J Biol Chem 269, 5944-51 1994)).

[0010] The role for EAR-2 in haematopoiesis has not been studied in vivo. A previous study has shown interaction of NR2F6 with the key haematopoietic transcription factor RUNX1 (also known as AML1) (See Ahn et al. (Negative regulation of granulocytic differentiation in the myeloid precursor cell line 32Dcl3 by ear-2, a mammalian homolog of Drosophila seven-up, and a chimeric leukemogenic gene, AML1/ETO. Proc Natl Acad Sci USA 95, 1812-7. 1998)). Targeted deletion of RUNX1, a component of the core binding factor complex, results in abrogation of definitive haematopoiesis and embryonic lethality and RUNX1 rearrangements result from several commonly seen chromosome translocations in acute leukemia. EAR-2 interacts physically with RUNX1 and represses its transcriptional activating ability in the murine myeloblast cell line 32Dcl3. The effect of NR2F6 in primary mouse or human bone marrow, let alone in vivo is unclear. EAR-2 is down regulated in 32Dcl3 cells induced to mature with G-CSF, and forced expression of the EAR-2 protein blocks 32Dc13 differentiation.

[0011] The function of NR2F6 has not been well characterized. NR2F6 functions as a transcriptional repressor in vitro, inhibiting the transactivating ability of numerous proteins including the thyroid hormone receptor. Like many nuclear receptors, NR2F6 heterodimerizes with the retinoid X receptor-.alpha. (RXR-.alpha.), although the relevance of this interaction in NR2F6 function is unclear (See Ladias, J. A. (Convergence of multiple nuclear receptor signaling pathways onto the long terminal repeat of human immunodeficiency virus-1. J Biol Chem 269, 5944-51 1994)). A recent report describes the initial characterization of an NR2F6 deficient mouse generated by targeted disruption of the NR2F6 locus (See Warnecke, M et al. (Abnormal development of the locus coeruleus in Ear2(Nr2f6)-deficient mice impairs the functionality of the forebrain clock and affects nociception. Genes Dev 19, 614-25 2005)). NR2F6 deficient mice are viable and fertile, but show agenesis of the locus coeruleus, a midbrain nucleus that regulates circadian behaviour and nociception. In situ mRNA hybridization in NR2F6-/- animals places NR2F6 downstream of Mash1 and upstream of Phox2a and Phox2b in the specification of the locus coeruleus. Although NR2F6 expression is seen outside the central nervous system, this report contains no description of any phenotypic analysis outside the nervous system.

SUMMARY

[0012] The present inventors have found that the orphan nuclear receptor NR2F6 is a regulator of blood stem cell self-renewal and differentiation, and the maturation of healthy progenitor cells. NR2F6 regulates self-renewal, differentiation and maturation in states of pathology. This makes the modulation of NR2F6 an ideal target for influencing the function of leukemia stem and progenitor cells and myelodysplastic syndrome stem and progenitor cells.

[0013] Accordingly, in one aspect, the present disclosure provides a method of modulating stem cell growth, proliferation and/or differentiation comprising administering an effective amount of a NR2F6 modulator to a cell or animal in need thereof.

[0014] In one embodiment, the NR2F6 modulator is a NR2F6 inhibitor. Accordingly, in an embodiment, the present disclosure provides a method of inhibiting self-renewal of stem cells and/or inducing terminal differentiation of stem cells comprising administering an effective amount of a NR2F6 inhibitor to a cell or animal in need thereof.

[0015] In one embodiment, the inhibitor is an antisense nucleic acid sequence of the gene encoding NR2F6 as shown in SEQ ID NO:1 or 4 or variants thereof. In another embodiment, the inhibitor is a blocking antibody that binds the NR2F6 amino acid sequence as shown in SEQ ID NO:2 or SEQ ID NO:3. In yet another embodiment, the inhibitor is a shRNA molecule that inhibits expression of NR2F6, optionally as shown in SEQ ID NO:5 or 6.

[0016] The stem cells may be cancer stem cells, leukemia stem cells or myelodysplastic stem cells.

[0017] In one embodiment, the method is for treating or preventing a hematologic condition. In an embodiment, treating a hematologic condition comprises preventing the progression of the hematologic condition.

[0018] In another embodiment, the hematologic condition is acute leukemia, chronic leukemia or myelodysplastic syndrome.

[0019] In yet another embodiment, the method is for inducing differentiation of granulocytic, erythroid or megakaryocytic lineages.

[0020] In a further embodiment, the method is for reducing the number of progenitor cells. In one embodiment, the method is for treating conditions associated with leukocytosis.

[0021] In yet another embodiment, the method is for potentiating retinoic acid signaling.

[0022] In yet a further embodiment, the method is for treating disorders characterized by excessive or hyperactive mast cells.

[0023] In another aspect, the NR2F6 modulator is a NR2F6 activator.

[0024] Accordingly, in one embodiment, there is provided a method of stem cell expansion comprising administering an effective amount of a NR2F6 activator to a cell or animal in need thereof. In an embodiment, the stem cells are hematopoietic stem cells. In another embodiment, the stem cells are derived from peripheral blood, bone marrow, umbilical cord blood, embryonic stem cells or menstrual blood. In yet another embodiment, the method is used for bone marrow transplantation or cell therapies.

[0025] In another embodiment, the method is for repressing retinoic acid signaling.

[0026] In yet a further embodiment, the method is for treating dermatitis.

[0027] In another aspect, the disclosure provides a shRNA molecule comprising the sequence as shown in SEQ ID NO:5 or 6. In another embodiment, the disclosure provides a shRNA molecule consisting of the sequence as shown in SEQ ID NO:5 or 6.

[0028] Also provided are uses, pharmaceutical compositions and diagnostic methods.

[0029] Other features and advantages of the present disclosure will become apparent from the following detailed description. It should be understood, however, that the detailed description and the specific examples while indicating preferred embodiments of the disclosure are given by way of illustration only, since various changes and modifications within the spirit and scope of the disclosure will become apparent to those skilled in the art from this detailed description.

BRIEF DESCRIPTION OF THE DRAWINGS

[0030] The disclosure will now be described in relation to the drawings in which:

[0031] FIG. 1 shows that NR2F6 is highly expressed in both long and short term haematopoietic stem cells and that expression of NR2F6 in bone marrow from patients with acute myelogenous leukemia (AML), chronic myelomonocytic leukemia (CMML) and myelodysplastic syndrome (MDS) is greater compared to control. * denotes p<0.05 and ** denotes p<0.01 relative to normal (ANOVA & Tukey post-hoc test).

[0032] FIG. 2 shows NR2F6 mRNA is expressed highly in immature U937 human leukemia cell line.

[0033] FIG. 3 shows overexpression of NR2F6 is able to override the growth arrest associated with differentiation and maturation, in particular maturation and differentiation induced by all-trans retinoic acid.

[0034] FIG. 4 shows over-expression of NR2F6 enables the survival and proliferation of mouse embryonic fibroblasts (MEFs) in low serum (0.2% serum).

[0035] FIG. 5 shows over-expression of NR2F6 is able to inhibit the differentiation and maturation of U937 human leukemia cells.

[0036] FIG. 6 shows over-expression of NR2F6 is able to inhibit the differentiation and maturation of U937 human leukemia cells.

[0037] FIG. 7 shows NR2F6 over-expression inhibits the maturation of healthy bone marrow.

[0038] FIG. 8 shows NR2F6 over-expression inhibits the maturation of healthy bone marrow toward the myeloid lineage.

[0039] FIG. 9 shows NR2F6 over-expression in vivo increases bone marrow cellularity, even when only a portion of the cells over-express NR2F6.

[0040] FIG. 10 shows NR2F6 over-expression causes bone marrow dysplasia.

[0041] FIG. 11 shows NR2F6 over-expression causes abnormal localization of immature precursors (ALIP).

[0042] FIG. 12 shows NR2F6 over-expression inhibits myeloid differentiation and maturation in vivo.

[0043] FIG. 13 shows NR2F6 over-expression inhibits blood cell differentiation and maturation in vivo.

[0044] FIG. 14 shows NR2F6 over-expression produces an excess of megakaryoctes.

[0045] FIG. 15 shows NR2F6 over-expression, even in a small subset of bone marrow cells, eventually results in the generation of leukemia.

[0046] FIG. 16 shows NR2F6 over-expression, even in a small subset of bone marrow cells, results in the production of excessive immature blast cells.

[0047] FIG. 17 shows NR2F6 over-expression, even in a small subset of bone marrow cells, eventually results in the generation of leukemia with infiltration of leukemia cells in the spleen and liver.

[0048] FIG. 18 shows over-expression of NR2F6 in the bone marrow of healthy animals resulted in a fatal hematological condition that resembles human myelodysplastic syndrome and acute leukemia.

[0049] FIG. 19 shows that over-expression of NR2F6 in vivo causes expansion of immature bone marrow blast cells.

[0050] FIG. 20 shows that over-expression of NR2F6 in vivo causes expansion of bone marrow cells that express c-kit.

[0051] FIG. 21 shows that over-expression of NR2F6 in vivo causes expansion of bone marrow cells that lack expression of antigens associated with lineage commitment.

[0052] FIG. 22 shows that over-expression of NR2F6 in vivo causes expansion of bone marrow cells with the stem cell phenotype c-kit+, sca-1+, lineage-.

[0053] FIG. 23 shows over-expression of NR2F6 in the bone marrow of healthy animals results in expansion of their hematopoietic stem cell.

[0054] FIG. 24 shows that over-expression of NR2F6 enhances the in vitro maintenance of bone marrow cells with the stem cell phenotype c-kit+, sca-1+, lineage-.

[0055] FIG. 25 shows over-expression of NR2F6 in the bone marrow of healthy animals enhances self-renewal in vivo.

[0056] FIG. 26 shows knock down of NR2F6 using short-hairpin RNAs induces differentiation and maturation of 32Dcl3 mouse hematopoietic cells.

[0057] FIG. 27 shows knock down of NR2F6 using short-hairpin RNAs induces terminal differentiation, blood cell maturation death of U937 human leukemia cells.

[0058] FIG. 28 shows that knock down of NR2F6 using short-hairpin RNAs induces rapid depletion of immature bone marrow cells in ex vivo culture.

[0059] FIG. 29 shows that knock down of NR2F6 using short-hairpin RNAs induces rapid depletion of bone marrow cells with the stem cell phenotype c-kit+, sca-1+, lineage- in ex vivo culture.

[0060] FIG. 30 shows that knock down of NR2F6 using short-hairpin RNAs induces rapid differentiation of immature bone marrow cells.

[0061] FIG. 31 shows morphologically that knock down of NR2F6 expression using short hairpin RNA (shNR2F6) reduces the number of immature bone marrow cells (blast cells) and promotes differentiation into mature cells in ex vivo suspension culture.

[0062] FIG. 32 shows that NR2F6 can be modulated using histone deacetylase inhibitors.

DETAILED DESCRIPTION

[0063] The term "NR2F6" as used herein refers to nuclear receptor subfamily2, group F, member 6 and is also referred to as v-erbA-related gene or ear-2 and includes, without limitation, the protein encoded by the gene having the sequence as shown in SEQ ID NO:1 (human) or SEQ ID NO:4 (mouse) or variants thereof and the protein having the amino acid sequence as shown in SEQ ID NO:2 (human) or SEQ ID NO:3 (mouse) or variants thereof.

[0064] The term "a cell" as used herein includes a plurality of cells and refers to all types of cells including hematopoietic and cancer cells. Administering a compound to a cell includes in vivo, ex vivo and in vitro treatment.

[0065] The term "stem cell" as used herein refers to a cell that has the ability for self-renewal and can give rise to specialized cells.

[0066] The term "effective amount" as used herein means a quantity sufficient to, when administered to an animal, effect beneficial or desired results, including clinical results, and as such, an "effective amount" depends upon the context in which it is being applied. For example, in the context of inhibiting self-renewal of stem cells, it is the amount of the NR2F6 inhibitor sufficient to achieve such an inhibition as compared to the response obtained without administration of the NR2F6 inhibitor.

[0067] The term "nucleic acid molecule" is intended to include unmodified DNA or RNA or modified DNA or RNA. For example, the nucleic acid molecules or polynucleotides of the disclosure can be composed of single- and double stranded DNA, DNA that is a mixture of single- and double-stranded regions, single- and double-stranded RNA, and RNA that is a mixture of single- and double-stranded regions, hybrid molecules comprising DNA and RNA that may be single-stranded or, more typically double-stranded or a mixture of single- and double-stranded regions. In addition, the nucleic acid molecules can be composed of triple-stranded regions comprising RNA or DNA or both RNA and DNA. The nucleic acid molecules of the disclosure may also contain one or more modified bases or DNA or RNA backbones modified for stability or for other reasons. "Modified" bases include, for example, tritiated bases and unusual bases such as inosine. A variety of modifications can be made to DNA and RNA; thus "nucleic acid molecule" embraces chemically, enzymatically, or metabolically modified forms. The term "polynucleotide" shall have a corresponding meaning.

[0068] The term "animal" as used herein includes all members of the animal kingdom, optionally mammal. The term "mammal" as used herein is meant to encompass, without limitation, humans, domestic animals such as dogs, cats, horses, cattle, swine, sheep, goats, and the like, as well as wild animals. In an embodiment, the mammal is human.

Methods and Uses

[0069] The present inventors have found that NR2F6 is a regulator of blood stem cell self-renewal and differentiation, and of the maturation of healthy progenitor cells.

[0070] Accordingly, the present disclosure provides a method of modulating stem cell growth, proliferation and/or differentiation comprising administering an effective amount of a NR2F6 modulator to a cell or animal in need thereof.

[0071] In one aspect, the NR2F6 modulator is a NR2F6 inhibitor. In another aspect, the NR2F6 modulator is a NR2F6 activator.

[0072] Accordingly, the present disclosure provides a method of inhibiting self-renewal of stem cells comprising administering an effective amount of an inhibitor of NR2F6 to a cell or animal in need thereof. The present disclosure also provides the use of a NR2F6 inhibitor for inhibiting self-renewal of stem cells in a cell or animal in need thereof. The present disclosure further provides the use of a NR2F6 inhibitor in the preparation of a medicament for inhibiting self-renewal of stem cells in a cell or animal in need thereof. The present disclosure also provides a NR2F6 inhibitor for use in inhibiting self-renewal of stem cells in a cell or animal in need thereof.

[0073] In another embodiment, the present disclosure provides a method of inducing terminal differentiation of stem cells comprising administering an effective amount of an inhibitor of NR2F6 to a cell or animal in need thereof. The present disclosure also provides the use of a NR2F6 inhibitor for inducing terminal differentiation of stem cells in a cell or animal in need thereof. The present disclosure further provides the use of a NR2F6 inhibitor in the preparation of a medicament for inducing terminal differentiation of stem cells in a cell or animal in need thereof. The present disclosure also provides a NR2F6 inhibitor for use in inducing terminal differentiation of stem cells in a cell or animal in need thereof.

[0074] In one embodiment, the stem cells are cancer stem cells, leukemia stem cells or myelodysplastic stem cells.

[0075] The term "inhibiting self renewal of stem cells" as used herein includes but is not limited to preventing or decreasing the clonal longevity, clonogenicity, serial replating ability, clonogenic growth and/or transplantability of the stem cells.

[0076] The present inventors have also found that over-expression of NR2F6 in the bone marrow of animals greatly enhanced self-renewal ability of hematopoietic stem cells and resulted in stem cell expansion. Accordingly, the present disclosure also provides a method of stem cell expansion comprising administering an effective amount of an activator of NR2F6 to a cell or animal in need thereof. The present disclosure also provides the use of a NR2F6 activator for stem cell expansion in a cell or animal in need thereof. The present disclosure further provides the use of a NR2F6 activator in the preparation of a medicament for stem cell expansion in a cell or animal in need thereof. The present disclosure also provides a NR2F6 activator for use in activating stem cell expansion in a cell or animal in need thereof.

[0077] The term "stem cell expansion" as used herein means the maintenance, survival and/or proliferation of cells in an undifferentiated state or inhibiting differentiation and includes both ex vivo, in vitro and in vivo stem cell expansion. In one embodiment, stem cell expansion is useful for bone marrow transplantation and/or immunotherapy. In another embodiment, the stem cells are hematopoietic stem cells, optionally from the peripheral blood, bone marrow, umbilical cord blood, embryonic stem cells or menstrual blood. Stem cell expansion is particularly useful for bone marrow transplantation and/or cellular therapies, including but not limited to generation of sufficient numbers of leukocytes for the purposes of immunotherapy, transfusion post-chemotherapy, treatment of HIV and AIDS. Stem cell expansion is also useful for the expansion of autologous, allogeneic, cord blood, peripheral blood or menstrual blood stem cells for the transplantation following chemotherapy for the treatment of leukemia, solid tumours and/or non-malignant disease including but not limited to b-thalassaemia and sickle cell anemia. Expansion of stem cells is optionally in combination with soluble factors including but not limited to c-kit, IL-3, IL-11, flt-3 ligand, IL-6, and/or TPO.

[0078] In one embodiment, a NR2F6 activator is administered to suitable mammalian hematopoietic stem cells for maintaining the stem cells in an undifferentiated state while stimulating their expansion. Examples of suitable stem cells include haematopoietic stem cells from the peripheral blood, bone marrow, umbilical cord blood, embryonic stem cells or menstrual blood.

[0079] In another embodiment, a NR2F6 activator is administered to suitable mammalian hematopoietic stem cells for maintaining the stem cells in an undifferentiated state while stimulating their expansion for the purposes of cellular therapies, including but not limited to generation of sufficient numbers of leukocytes for the purposes of immunotherapy, transfusion post-chemotherapy, and/or treatment of HIV and AIDS.

[0080] In yet another embodiment, a NR2F6 activator is administered to suitable mammalian hematopoietic stem cells for maintaining the stem cells in an undifferentiated state while stimulating the expansion of either autologous, allogeneic, cord blood, peripheral blood, or menstrual blood stem cells for the transplantation following chemotherapy for the treatment of leukemia.

[0081] In a further embodiment, a NR2F6 activator is administered to suitable mammalian hematopoietic stem cells for maintaining the stem cells in an undifferentiated state while stimulating the expansion of either autologous, allogeneic, cord blood, peripheral blood, or menstrual blood stem cells for the transplantation following chemotherapy for the treatment of solid tumours.

[0082] In even yet another embodiment, a NR2F6 activator is administered to suitable mammalian hematopoietic stem cells for maintaining the stem cells in an undifferentiated state while stimulating the expansion of either autologous, allogeneic, cord blood, peripheral blood, or menstrual blood stem cells for the transplantation following treatment of non-malignant diseases including but not limited to beta-thalassaemia and sickle cell anemia.

[0083] The present inventors have shown that over-expression of NR2F6 in a portion of mouse bone marrow cells recapitulates a group of hematological conditions termed myelodysplastic syndromes. Further, over-expression of NR2F6 in bone marrow cells results in bone marrow failure and a rapidly fatal acute leukemia. Accordingly, in another aspect, the present disclosure provides a method of treating or preventing a hematologic condition comprising administering an effective amount of a modulator of NR2F6, such as a NR2F6 inhibitor or activator, to a cell or animal in need thereof. The present disclosure also provides the use of a NR2F6 modulator for treating or preventing a hematologic condition in a cell or animal in need thereof. The present disclosure further provides the use of a NR2F6 modulator in the preparation of a medicament for treating or preventing a hematologic condition in a cell or animal in need thereof. The present disclosure also provides a NR2F6 modulator for use in treating or preventing a hematologic condition in a cell or animal in need thereof.

[0084] The term "hematologic condition" as used herein refers generally to diseases of impaired blood cell self-renewal, quiescence, proliferation, differentiation, and/or maturation. These include, but are not limited to, acute leukemia, chronic leukemia, pre-leukemic conditions, myeloproliferative disorders, chronic myelomonocytic leukemia, myelodysplastic syndrome and other dysplasias, bone marrow failure disorders, anemia, idiopathic or secondary aplastic anemia, bone marrow aplasia, neutropenia, thrombocytopenia, leukocytosis, and pancytopenia.

[0085] In one embodiment, the hematologic condition is acute leukemia, chronic leukemia or myelodysplastic syndrome (MDS).

[0086] In an embodiment, the NR2F6 modulator is an inhibitor that restores the ability of bone marrow to develop into fully mature, non-dysplastic blood cells. In another embodiment, the NR2F6 inhibitor induces the functional maturation of myelodysplastic syndrome cells. In yet another embodiment, the NR2F6 inhibitor is used to treat or prevent conditions that produce insufficient quantities of blood cells including anemia and bone marrow aplasia, idiopathic or secondary aplastic anemia, thrombocytopenia, neutropenia and pancytopenia.

[0087] In another embodiment, the NR2F6 inhibitor is used to treat or prevent splenomegaly and hepatomegaly secondary to a proliferative or dysplastic disease of the bone marrow.

[0088] In yet another embodiment, the NR2F6 inhibitor is used to treat or prevent diseases of aberrant cellular proliferation or aberrant cellular differentiation.

[0089] The term "treating or preventing" as used herein refers to improving the condition, such as reducing or alleviating symptoms associated with the condition or improving the prognosis or survival of the subject.

[0090] Conventional treatment may also be used in combination with the methods and uses of the disclosure. The currently used agents used for treatment of hematopoietic conditions include, without limitation, lenalidomide, thalidomide, 5-azacitidine (Vidaza), lenalidomide (Revlimid), erythropoietin, gm-csf, g-csf, IL-3, ATG, ALG, methylprednisolone and cyclosporine, daunorubicin (Cerubidine.RTM.), doxorubicin (Adriamycin.RTM.), cytarabine (ara-C; Cytosar-U.RTM.), 6-thioguanine (Tabloid.RTM.), idarubicin (Idamycin.RTM.), mitoxantrone (Novantrone.RTM.), etoposide (VePesid.RTM.), amsacrine (AMSA), cytarabine (ara-C; Cytosar-U.RTM.), and 6-thioguanine (Tabloid.RTM.), all-trans retinoic acid (ATRA), hydroxyurea (Hydrea.RTM.), busulfan (Myleran.RTM.), prednisone, vincristine sulfate (Oncovin.RTM.), Interferon alpha, vincristine (Oncovin.RTM.), L-asparaginase (Elspar.RTM.), Cyclophosphamide (Neosar.RTM.), 6-thioguanine (Tabloid.RTM.), 6-mercaptopurine (6-MP; Purinethol.RTM.).

[0091] The present inventors have also shown that NR2F6 functions to inhibit leukemia cell differentiation. The present inventors have shown direct evidence that knocking down expression of NR2F6 induces the spontaneous differentiation, maturation and death of human leukemia cells. Accordingly, in another aspect, the present disclosure provides a method of inducing cell differentiation comprising administering an effective amount of an inhibitor of NR2F6 to a cell or animal in need thereof. The present disclosure also provides the use of a NR2F6 inhibitor for inducing cell differentiation in a cell or animal in need thereof. The present disclosure further provides the use of a NR2F6 inhibitor in the preparation of a medicament for inducing cell differentiation in a cell or animal in need thereof. The present disclosure also provides a NR2F6 inhibitor for use in inducing cell differentiation in a cell or animal in need thereof.

[0092] The term "inducing cell differentiation" as used herein means inducing the cell to differentiate or mature from a stem cell or progenitor to later lineage cell stages and includes, without limitation, hematopoietic differentiation, myelodysplastic syndrome stem and progenitor cell differentiation, maturation of myelodysplastic syndrome cells, granulocytic differentiation, erythroid differentiation, and megakaryocytic differentiation. In one embodiment, terminal differentiation is induced. In another embodiment, inducing cell differentiation comprises increasing the sensitivity of the cells to undergo terminal or morphological differentiation.

[0093] In an embodiment, the method induces differentiation of the granulocytic, erythroid, or megakaryocytic lineages for the treatment of cytopenia.

[0094] In another embodiment, the present disclosure provides a method of reducing the number of progenitors comprising administering an effective amount of an inhibitor of NR2F6 to a cell or animal in need thereof. The present disclosure also provides the use of a NR2F6 inhibitor for reducing the number of progenitors in a cell or animal in need thereof. The present disclosure further provides the use of a NR2F6 inhibitor in the preparation of a medicament for reducing the number of progenitors in a cell or animal in need thereof. The present disclosure also provides a NR2F6 inhibitor for use in reducing the number of progenitors in a cell or animal in need thereof.

[0095] Reduction of the number of progenitors is useful for the treatment of conditions characterized by leukocytosis. In one embodiment, the progenitors are immature granulocyte progenitors, immature erythroid progenitors or immature megakaryocyte progenitors.

[0096] In another aspect, the present disclosure provides a method of preventing the progression of a hematologic condition comprising administering an effective amount of an inhibitor of NR2F6 to a cell or animal in need thereof. The present disclosure also provides the use of a NR2F6 inhibitor for preventing the progression of a hematologic condition in a cell or animal in need thereof. The present disclosure further provides the use of a NR2F6 inhibitor in the preparation of a medicament for preventing the progression of a hematologic condition in a cell or animal in need thereof. The present disclosure also provides a NR2F6 inhibitor for use in preventing the progression of a hematologic condition in a cell or animal in need thereof.

[0097] The term "preventing the progression of a hematologic condition" means blocking or delaying the progression of the condition and includes, without limitation, the transformation of preleukemic states, chronic leukemic states and MDS into acute leukemia.

[0098] The present inventors have found that NR2F6 functions to repress retinoic acid signaling. Accordingly, in another embodiment, the present disclosure provides a method of potentiating retinoic acid signaling comprising administering an effective amount of an inhibitor of NR2F6 to a cell or animal in need thereof. The present disclosure also provides the use of a NR2F6 inhibitor for potentiating retinoic acid signaling in a cell or animal in need thereof. The present disclosure further provides the use of a NR2F6 inhibitor in the preparation of a medicament for potentiating retinoic acid signaling in a cell or animal in need thereof. The present disclosure also provides a NR2F6 inhibitor for use in potentiating retinoic acid signaling in a cell or animal in need thereof.

[0099] The phrase "potentiating retinoic acid signaling" as used herein means potentiating the actions of natural or synthetic retinoids. Potentiating retinoic acid signaling is useful for treating or preventing conditions, including but not limited to, leukemia, in particular, acute promyelocytic leukemia, cutaneous T-cell lymphoma, nevoid basal carcinoma syndrome, non-small cell lung cancer as well as for treating or preventing dermatological conditions, including but not limited to, acne vulgaris, psoriasis, symmetrical progressive erythrokeratomderma, pityriasis rubra pilaris, kid syndrome, palmo-plantar keratoderma, epidermolytic hyperkeratosis, xeroderma pigmentosum, epidermodysplasia verruciformis, Darier's disease, skin discolouration, flat warts, ichthyosis, and other disorders of keratinisation as well as for cosmetic applications, including but not limited to, treating or preventing premature aging of the skin caused by overexposure to the sun (photodamage) including but not limited to sunspots.

[0100] In an embodiment, a NR2F6 inhibitor is formulated for topical administration in combination with natural or synthetic retinoid compounds for use in cosmetic applications including but not limited to improving premature aging of the skin caused by overexposure to the sun (photodamage) including but not limited to sunspots.

[0101] In another embodiment, a NR2F6 inhibitor is formulated for oral, intravenous, or subcutaneous administration in combination with natural or synthetic retinoid compounds for the treatment of cutaneous T-cell lymphoma, nevoid basal cell carcinoma, non-small cell lung cancer, and acute promyeolcytic leukemia.

[0102] In another embodiment, the present disclosure provides a method of repressing retinoic acid signaling comprising administering an effective amount of an activator of NR2F6 to a cell or animal in need thereof. The present disclosure also provides the use of a NR2F6 activator for repressing retinoic acid signaling in a cell or animal in need thereof. The present disclosure further provides the use of a NR2F6 activator in the preparation of a medicament for repressing retinoic acid signaling in a cell or animal in need thereof. The present disclosure also provides a NR2F6 activator for use in repressing retinoic acid signaling in a cell or animal in need thereof.

[0103] Repression of retinoic acid signaling is useful in treating psychological disorders, including but not limited to Vitamin A or synthetic retinoid induced neurotoxicity, psychosis, depression or suicidal ideation. Repression of retinoic acid signaling induced by Vitamin A or synthetic retinoids is also useful for stimulating neurogenesis, improving serotonin signaling and/or for treating or preventing acute toxicity induced by vitamin A or synthetic retinoids.

[0104] In another aspect, the present disclosure provides a method of treating disorders characterized by excessive or hyperactive mast cells comprising administering an effective amount of an inhibitor of NR2F6 to a cell or animal in need thereof. The present disclosure also provides the use of a NR2F6 inhibitor for treating disorders characterized by excessive or hyperactive mast cells in a cell or animal in need thereof. The present disclosure further provides the use of a NR2F6 inhibitor in the preparation of a medicament for treating disorders characterized by excessive or hyperactive mast cells in a cell or animal in need thereof. The present disclosure also provides a NR2F6 inhibitor for use in for treating disorders characterized by excessive or hyperactive mast cells in a cell or animal in need thereof. In one embodiment, the disorders characterized by excessive or hyperactive mast cells are mastocytosis, allergy or asthma.

[0105] The NR2F6 modulator can be a NR2F6 activator or a NR2F6 inhibitor.

[0106] The term "NR2F6 activator" as used herein includes all substances that can increase expression or activity of NR2F6 and includes, without limitation, additional NR2F6 nucleic acid or protein or fragments thereof, small molecule activators, antibodies (and fragments thereof), and other substances that can activate NR2F6 expression or activity.

[0107] The term "NR2F6 inhibitor" as used herein includes any substance that is capable of inhibiting the expression or activity of NR2F6 and includes, without limitation, antisense nucleic acid molecules, siRNAs or shRNAs, proteins, antibodies (and fragments thereof), small molecule inhibitors and other substances directed at NR2F6 expression or activity. In an embodiment, the NR2F6 inhibitor is a protein kinase, phosphatase or inhibitor of protein kinase.

[0108] In one embodiment, inhibition of NR2F6 is through the use of histone deacetylase inhibitor drugs. Examples of these drugs include depsipeptide, butyrate derivatives, valproic acid, and suberoylanilide hydroxamic acid. Furthermore, it is apparent to one skilled in the art that natural or synthetic ligands that antagonistically modulate NR2F6 would have an additive effect with histone deacetylase inhibitor drugs.

[0109] In an embodiment, the NR2F6 inhibitor is an antisense nucleic acid molecule that inhibits expression of NR2F6. In another embodiment, the inhibitor is an antisense nucleic acid sequence of the gene encoding human NR2F6 as shown in SEQ ID NO:1 or of the gene encoding mouse NR2F6 as shown in SEQ ID NO:4 or variants thereof. In yet another embodiment, the NR2F6 inhibitor is a siRNA molecule or shRNA molecule that inhibits expression of NR2F6. In one embodiment, the NR2F6 inhibitor is an shRNA as shown in SEQ ID NO:5 or SEQ ID NO:6 or variants thereof. In yet a further embodiment, the NR2F6 inhibitor is an aptamer that binds and inhibits NR2F6 activity. Also provided herein are shRNA molecules comprising the sequence as shown in SEQ ID NO:5 or 6 or variants thereof. In another embodiment the shRNA molecule consists of the sequence as shown in SEQ ID NO:5 or 6.

[0110] The term "antisense nucleic acid" as used herein means a nucleotide sequence that is complementary to its target e.g. a NR2F6 transcription product. The nucleic acid can comprise DNA, RNA or a chemical analog, that binds to the messenger RNA produced by the target gene. Binding of the antisense nucleic acid prevents translation and thereby inhibits or reduces target protein expression. Antisense nucleic acid molecules may be chemically synthesized using naturally occurring nucleotides or variously modified nucleotides designed to increase the biological stability of the molecules or to increase the physical stability of the duplex formed with mRNA or the native gene e.g. phosphorothioate derivatives and acridine substituted nucleotides. The antisense sequences may be produced biologically using an expression vector introduced into cells in the form of a recombinant plasmid, phagemid or attenuated virus in which antisense sequences are produced under the control of a high efficiency regulatory region, the activity of which may be determined by the cell type into which the vector is introduced.

[0111] The term "siRNA" refers to a short inhibitory RNA that can be used to silence gene expression of a specific gene. The siRNA can be a short RNA hairpin (e.g. shRNA) that activates a cellular degradation pathway directed at mRNAs corresponding to the siRNA. Methods of designing specific siRNA molecules or shRNA molecules and administering them are known to a person skilled in the art. It is known in the art that efficient silencing is obtained with siRNA duplex complexes paired to have a two nucleotide 3' overhang. Adding two thymidine nucleotides is thought to add nuclease resistance. A person skilled in the art will recognize that other nucleotides can also be added.

[0112] Aptamers are short strands of nucleic acids that can adopt highly specific 3-dimensional conformations. Aptamers can exhibit high binding affinity and specificity to a target molecule. These properties allow such molecules to specifically inhibit the functional activity of proteins and are included as agents that inhibit NR2F6.

[0113] In another embodiment, the NR2F6 modulator is an antibody specific to NR2F6. In one embodiment, the inhibitor is a blocking antibody that binds the NR2F6 amino acid sequence as shown in SEQ ID NO:2 or SEQ ID NO:3 or a variant thereof. In another embodiment, the activator is an antibody that binds the NR2F6 amino acid sequences as shown in SEQ ID NO:2 or 3 or a variant thereof and activates NR2F6.

[0114] The term "antibody" as used herein is intended to include monoclonal antibodies, polyclonal antibodies, and chimeric antibodies. The antibody may be from recombinant sources and/or produced in transgenic animals. The term "antibody fragment" as used herein is intended to include without limitations Fab, Fab', F(ab').sub.2, scFv, dsFv, ds-scFv, dimers, minibodies, diabodies, and multimers thereof, multispecific antibody fragments and Domain Antibodies. Antibodies can be fragmented using conventional techniques. For example, F(ab').sub.2 fragments can be generated by treating the antibody with pepsin. The resulting F(ab').sub.2 fragment can be treated to reduce disulfide bridges to produce Fab' fragments. Papain digestion can lead to the formation of Fab fragments. Fab, Fab' and F(ab').sub.2, scFv, dsFv, ds-scFv, dimers, minibodies, diabodies, bispecific antibody fragments and other fragments can also be synthesized by recombinant techniques.

[0115] Antibodies to such proteins may be prepared using techniques known in the art such as those described by Kohler and Milstein, Nature 256, 495 (1975) and in U.S. Pat. Nos. RE 32,011; 4,902,614; 4,543,439; and 4,411,993, which are incorporated herein by reference. (See also Monoclonal Antibodies, Hybridomas: A New Dimension in Biological Analyses, Plenum Press, Kennett, McKearn, and Bechtol (eds.), 1980, and Antibodies: A Laboratory Manual, Harlow and Lane (eds.), Cold Spring Harbor Laboratory Press, 1988, which are also incorporated herein by reference). Within the context of the present disclosure, antibodies are understood to include monoclonal antibodies, polyclonal antibodies, antibody fragments (e.g., Fab, and F(ab').sub.2) and recombinantly produced binding partners.

[0116] For producing polyclonal antibodies a host, such as a rabbit or goat, is immunized with the immunogen or immunogen fragment, generally with an adjuvant and, if necessary, coupled to a carrier; antibodies to the immunogen are collected from the sera. Further, the polyclonal antibody can be absorbed such that it is monospecific. That is, the sera can be absorbed against related immunogens so that no cross-reactive antibodies remain in the sera rendering it monospecific.

[0117] To produce monoclonal antibodies, antibody producing cells (lymphocytes) can be harvested from an immunized animal and fused with myeloma cells by standard somatic cell fusion procedures thus immortalizing these cells and yielding hybridoma cells. Such techniques are well known in the art, (e.g., the hybridoma technique originally developed by Kohler and Milstein (Continuous cultures of fused cells secreting antibody of predefined specificity. Nature 256:495-497, 1975) as well as other techniques such as the human B-cell hybridoma technique (Kozbor, D, and Roder, J: The production of monoclonal antibodies from human lymphocytes. Immunology Today 4:3 72-79, 1983), the EBV-hybridoma technique to produce human monoclonal antibodies (Cole et al. Monoclonal Antibodies in Cancer Therapy (1985) Allen R. Bliss, Inc., pages 77-96) and screening of combinatorial antibody libraries (Huse, W, Sastry, L, Iverson, S, Kang, A, Alting-Mees, M, Burton, D, Benkovic, S, and Lerner, R: Generation of a large combinatorial library of the immunoglobulin repertoire in phage lambda. Science 246:4935 1275-1282, 1989). Hybridoma cells can be screened immunochemically for production of antibodies specifically reactive with the protein or fragment thereof and the monoclonal antibodies can be isolated. Therefore, the disclosure also contemplates hybridoma cells secreting monoclonal antibodies with specificity for NR2F6 or a fragment thereof.

[0118] For producing recombinant antibodies (see generally Huston et al, 1991; Johnson and Bird, 1991; Mernaugh and Mernaugh, 1995), messenger RNAs from antibody producing B-lymphocytes of animals, or hybridoma are reverse-transcribed to obtain complementary DNAs (cDNAs). Antibody cDNA, which can be full or partial length, is amplified and cloned into a phage or a plasmid. The cDNA can be a partial length of heavy and light chain cDNA, separated or connected by a linker. The antibody, or antibody fragment, is expressed using a suitable expression system to obtain recombinant antibody. Antibody cDNA can also be obtained by screening pertinent expression libraries.

[0119] Chimeric antibody derivatives, i.e., antibody molecules that combine a non-human animal variable region and a human constant region are also contemplated within the scope of the disclosure. Chimeric antibody molecules can include, for example, the antigen binding domain from an antibody of a mouse, rat, or other species, with human constant regions. Conventional methods may be used to make chimeric antibodies containing the immunoglobulin variable region which recognizes NR2F6 or a fragment thereof (See, for example, Morrison et al. (Chimeric Human Antibody Molecules: Mouse Antigen-Binding Domains with Human Constant Region Domains. PNAS 81:21 6851-6855, 1984), and Takeda et al. (Construction of chimaeric processed immunoglobulin genes containing mouse variable and human constant region sequences. Nature 314:452-454), and the patents of Cabilly et al., U.S. Pat. No. 4,816,567; Boss et al., U.S. Pat. No. 4,816,397; Tanaguchi et al., European Patent Publication EP171496; European Patent Publication 0173494, United Kingdom patent GB 2177096B).

[0120] Monoclonal or chimeric antibodies specifically reactive with NR2F6 or a fragment thereof as described herein can be further humanized by producing human constant region chimeras, in which parts of the variable regions, particularly the conserved framework regions of the antigen-binding domain, are of human origin and only the hypervariable regions are of non-human origin. Such immunoglobulin molecules may be made by techniques known in the art, (e.g., Teng et al. (Construction and Testing of Mouse--Human Heteromyelomas for Human Monoclonal Antibody Production. PNAS 80:12 7308-7312, 1983), Kozbor et al., supra; Olsson et al. (Methods in Enzymol, 92:3-16 1982) and PCT Publication WO92/06193 or EP 0239400). Humanized antibodies can also be commercially produced (Scotgen Limited, 2 Holly Road, Twickenham, Middlesex, Great Britain.)

[0121] Specific antibodies, or antibody fragments, reactive against NR2F6 or a fragment thereof may also be generated by screening expression libraries encoding immunoglobulin genes, or portions thereof, expressed in bacteria with peptides produced from the nucleic acid molecules encoding NR2F6 or a fragment thereof. For example, complete Fab fragments, VH regions and FV regions can be expressed in bacteria using phage expression libraries (See for example Ward et al. (Binding activities of a repertoire of single immunoglobulin variable domains secreted from Escherichia coli. Nature 348:544-546, 1989), Huse et al., supra and McCafferty et al (Phage antibodies: filamentous phage displaying antibody variable domains. Nature 348:552-555, 1989)).

[0122] Antibodies may also be prepared using DNA immunization. For example, an expression vector containing a nucleic acid encoding NR2F6 or a fragment thereof may be injected into a suitable animal such as mouse. The protein will therefore be expressed in vivo and antibodies will be induced. The antibodies can be isolated and prepared as described above for protein immunization.

[0123] The term "variant" as used herein includes modifications, substitutions, additions, derivatives, analogs, fragments or chemical equivalents of the NR2F6 nucleic acid or amino acid sequences disclosed herein that perform substantially the same function in substantially the same way. For instance, the variants of the NR2F6 peptides would have the same function, for example, of inhibiting cell differentiation or potentiating retinoic acid signaling or for enhancing stem cell expansion or repressing retinoic acid signaling. Variants of NR2F6 peptide inhibitors would have the same function as being useful to inhibit NR2F6. Variants of NR2F6 peptide activators would have the same function as being useful to activate NR2F6.

[0124] Variants also include peptides with amino acid sequences that are substantially or essentially identical to the amino acid sequences of SEQ ID NO:2 or 3 or nucleic acid molecules with nucleic acid sequence that are substantially or essentially identical to the nucleic acid sequence of SEQ ID NO:1 or 4.

[0125] The term "substantially identical" or "essentially identical" as used herein means an amino acid sequence that, when optimally aligned, for example using the methods described herein, share at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with a second amino acid sequence.

[0126] The term "sequence identity" as used herein refers to the percentage of sequence identity between two polypeptide and/or nucleotide sequences.

[0127] To determine the percent identity of two amino acid sequences, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in the sequence of a first amino acid or nucleic acid sequence for optimal alignment with a second amino acid or nucleic acid sequence). The amino acid residues at corresponding amino acid positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences (i.e., % identity=number of identical overlapping positions/total number of positions.times.100%). In one embodiment, the two sequences are the same length. The determination of percent identity between two sequences can also be accomplished using a mathematical algorithm. A preferred, non-limiting example of a mathematical algorithm utilized for the comparison of two sequences is the algorithm of Karlin and Altschul, 1990, Proc. Natl. Acad. Sci. U.S.A. 87:2264-2268, modified as in Karlin and Altschul, 1993, Proc. Natl. Acad. Sci. U.S.A. 90:5873-5877. Such an algorithm is incorporated into the NBLAST and XBLAST programs of Altschul et al., 1990, J. Mol. Biol. 215:403. BLAST nucleotide searches can be performed with the NBLAST nucleotide program parameters set, e.g., for score=100, wordlength=12 to obtain nucleotide sequences homologous to a nucleic acid molecule of the present disclosure. BLAST protein searches can be performed with the XBLAST program parameters set, e.g., to score-50, wordlength=3 to obtain amino acid sequences homologous to a protein molecule of the present disclosure. To obtain gapped alignments for comparison purposes, Gapped BLAST can be utilized as described in Altschul et al., 1997, Nucleic Acids Res. 25:3389-3402. Alternatively, PSI-BLAST can be used to perform an iterated search which detects distant relationships between molecules (Id.). When utilizing BLAST, Gapped BLAST, and PSI-Blast programs, the default parameters of the respective programs (e.g., of XBLAST and NBLAST) can be used (see, e.g., the NCBI website). Another preferred, non-limiting example of a mathematical algorithm utilized for the comparison of sequences is the algorithm of Myers and Miller, 1988, CABIOS 4:11-17. Such an algorithm is incorporated in the ALIGN program (version 2.0) which is part of the GCG sequence alignment software package. When utilizing the ALIGN program for comparing amino acid sequences, a PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4 can be used. The percent identity between two sequences can be determined using techniques similar to those described above, with or without allowing gaps. In calculating percent identity, typically only exact matches are counted.

[0128] The percentage of identity between two polypeptide sequences, the amino acid sequences of such two sequences are aligned, for example using the Clustal W algorithm (Thompson, J D, Higgins D G, Gibson T J, 1994, Nucleic Acids Res. 22(22): 4673-4680.), together with BLOSUM 62 scoring matrix (Henikoff S, and Henikoff J. G., 1992, Proc. Natl. Acad. Sci. USA 89: 10915-10919.) and a gap opening penalty of 10 and gap extension penalty of 0.1, so that the highest order match is obtained between two sequences wherein at least 50% of the total length of one of the sequences is involved in the alignment.

[0129] Other methods that may be used to align sequences are the alignment method of Needleman and Wunsch (Needleman and Wunsch. J. Mol. Biol., 1970, 48:443), as revised by Smith and Waterman (Smith and Waterman. Adv. Appl. Math. 1981, 2:482) so that the highest order match is obtained between the two sequences and the number of identical amino acids is determined between the two sequences. Other methods to calculate the percentage identity between two amino acid sequences are generally art recognized and include, for example, those described by Carillo and Lipton (Carillo and Lipton SIAM J. Applied Math. 1988, 48:1073) and those described in Computational Molecular Biology (Computational Molecular Biology, Lesk, e.d. Oxford University Press, New York, 1988, Biocomputing: Informatics and Genomics Projects). Generally, computer programs will be employed for such calculations.

[0130] The disclosure further encompasses nucleic acid molecules that differ from any of the nucleic acid molecules disclosed herein in codon sequences due to the degeneracy of the genetic code.

[0131] The NR2F6 inhibitors or activators described herein may also contain or be used to obtain or design "peptide mimetics". For example, a peptide mimetic may be made to mimic the function of a NR2F6 activator or inhibitor. "Peptide mimetics" are structures which serve as substitutes for peptides in interactions between molecules (See Morgan et al (1989), Ann. Reports Med. Chem. 24:243-252 for a review). Peptide mimetics include synthetic structures which may or may not contain amino acids and/or peptide bonds but retain the structural and functional features. Peptide mimetics also include molecules incorporating peptides into larger molecules with other functional elements (e.g., as described in WO 99/25044). Peptide mimetics also include peptoids, oligopeptoids (Simon et al (1972) Proc. Natl. Acad, Sci USA 89:9367) and peptide libraries containing peptides of a designed length representing all possible sequences of amino acids corresponding to a NR2F6 inhibitor peptide.

[0132] Peptide mimetics may be designed based on information obtained by systematic replacement of L-amino acids by D-amino acids, replacement of side chains with groups having different electronic properties, and by systematic replacement of peptide bonds with amide bond replacements. Local conformational constraints can also be introduced to determine conformational requirements for activity of a candidate peptide mimetic. The mimetics may include isosteric amide bonds, or D-amino acids to stabilize or promote reverse turn conformations and to help stabilize the molecule. Cyclic amino acid analogues may be used to constrain amino acid residues to particular conformational states. The mimetics can also include mimics of the secondary structures of the proteins described herein. These structures can model the 3-dimensional orientation of amino acid residues into the known secondary conformations of proteins. Peptoids may also be used which are oligomers of N-substituted amino acids and can be used as motifs for the generation of chemically diverse libraries of novel molecules.

[0133] The nucleic acid molecules disclosed herein may be incorporated in a known manner into an appropriate expression vector which ensures good expression of the polypeptides. Various constructs can be used to deliver nucleic acid molecules described herein. For example retroviral constructs such as lentiviral constructs are useful for expressing physiological levels of protein. Possible expression vectors include but are not limited to cosmids, plasmids, or modified viruses (e.g. replication defective retroviruses, adenoviruses and adeno-associated viruses), so long as the vector is compatible with the host cell used. The expression vectors are "suitable for transformation of a host cell", which means that the expression vectors contain a nucleic acid molecule and regulatory sequences selected on the basis of the host cells to be used for expression, which is operatively linked to the nucleic acid molecule. Operatively linked is intended to mean that the nucleic acid is linked to regulatory sequences in a manner which allows expression of the nucleic acid.

[0134] The disclosure therefore includes a recombinant expression vector containing a nucleic acid molecule disclosed herein, or a fragment thereof, and the necessary regulatory sequences for the transcription and translation of the inserted protein-sequence.

[0135] Suitable regulatory sequences may be derived from a variety of sources, including bacterial, fungal, viral, mammalian, or insect genes (For example, see the regulatory sequences described in Goeddel, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, Calif. (1990)). Selection of appropriate regulatory sequences is dependent on the host cell chosen as discussed below, and may be readily accomplished by one of ordinary skill in the art. Examples of such regulatory sequences include: a transcriptional promoter and enhancer or RNA polymerase binding sequence, a ribosomal binding sequence, including a translation initiation signal. Additionally, depending on the host cell chosen and the vector employed, other sequences, such as an origin of replication, additional DNA restriction sites, enhancers, and sequences conferring inducibility of transcription may be incorporated into the expression vector.

[0136] The recombinant expression vectors may also contain a selectable marker gene which facilitates the selection of host cells transformed or transfected with a recombinant molecule disclosed herein. Examples of selectable marker genes are genes encoding a protein such as G418 and hygromycin which confer resistance to certain drugs, .beta.-galactosidase, chloramphenicol acetyltransferase, firefly luciferase, or an immunoglobulin or portion thereof such as the Fc portion of an immunoglobulin preferably IgG. Transcription of the selectable marker gene is monitored by changes in the concentration of the selectable marker protein such as .beta.-galactosidase, chloramphenicol acetyltransferase, or firefly luciferase. If the selectable marker gene encodes a protein conferring antibiotic resistance such as neomycin resistance transformant cells can be selected with G418. Cells that have incorporated the selectable marker gene will survive, while the other cells die. This makes it possible to visualize and assay for expression of the recombinant expression vectors disclosed herein and in particular to determine the effect of a mutation on expression and phenotype. It will be appreciated that selectable markers can be introduced on a separate vector from the nucleic acid of interest.

[0137] Suitable host cells include a wide variety of prokaryotic and eukaryotic host cells. For example, the proteins of the disclosure may be expressed in bacterial cells such as E. coli, insect cells (using baculovirus), yeast cells or mammalian cells. Other suitable host cells can be found in Goeddel (Goeddel, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, Calif. 1990).

Pharmaceutical Compositions

[0138] Another aspect of the present disclosure is a pharmaceutical composition comprising a NR2F6 modulator, such as a NR2F6 inhibitor or NR2F6 activator, for use in the methods described herein. Accordingly, the disclosure provides a pharmaceutical composition comprising an effective amount of a NR2F6 inhibitor or NR2F6 activator in admixture with a pharmaceutically acceptable carrier or diluent. In one embodiment, the pharmaceutical composition is used to inhibit NR2F6. In another embodiment, the pharmaceutical composition is used to activate NR2F6. In another embodiment, the pharmaceutical composition is used to treat hematopoietic conditions as described herein.

[0139] The term "pharmaceutically acceptable" as used herein means compatible with the treatment of animals, including, humans.

[0140] The present disclosure also provides a composition comprising a NR2F6 inhibitor in combination with a natural or synthetic vitamin A analogue.

[0141] The NR2F6 inhibitors or NR2F6 activators may be formulated into pharmaceutical compositions for administration to subjects in a biologically compatible form suitable for administration in vivo. By "biologically compatible form suitable for administration in vivo" is meant a form of the substance to be administered in which any toxic effects are outweighed by the therapeutic effects. The substances may be administered to living organisms including humans, and animals. Administration of a therapeutically active amount of the pharmaceutical compositions of the present disclosure is defined as an amount effective, at dosages and for periods of time necessary to achieve the desired result. For example, a therapeutically active amount of a substance may vary according to factors such as the disease state, age, sex, and weight of the individual, and the ability of inhibitor to elicit a desired response in the individual. Dosage regime may be adjusted to provide the optimum therapeutic response. For example, several divided doses may be administered daily or the dose may be proportionally reduced as indicated by the exigencies of the therapeutic situation.

[0142] The active substance may be administered in a convenient manner such as by injection (subcutaneous, intravenous, intramuscular, etc.), oral administration, inhalation, intranasal, transdermal administration (such as topical cream or ointment, etc.), or suppository applications. In one embodiment, the active substance is administered by inhalation or intranasally. In another embodiment, the active substance is administered topically. Depending on the route of administration, the active substance may be coated in a material to protect the compound from the action of enzymes, acids and other natural conditions which may inactivate the compound. The active substance may be formulated into delayed release formulations such that NR2F6 can be inhibited or activated for longer periods of time than a conventional formulation.

[0143] The compositions described herein can be prepared by per se known methods for the preparation of pharmaceutically acceptable compositions which can be administered to subjects, such that an effective quantity of the active substance is combined in a mixture with a pharmaceutically acceptable vehicle. Suitable vehicles are described, for example, in Remington's Pharmaceutical Sciences (Remington's Pharmaceutical Sciences (2000-20th edition) Mack Publishing Company). On this basis, the compositions include, albeit not exclusively, solutions of the substances in association with one or more pharmaceutically acceptable vehicles or diluents, and contained in buffered solutions with a suitable pH and iso-osmotic with the physiological fluids.

Diagnostic Methods

[0144] The present inventors have found that NR2F6 is over-expressed in patients with acute leukemia, chronic myelomonocytic leukemia and myelodysplastic syndromes. Accordingly, in another aspect, the disclosure provides a method of monitoring or assessing a hematological condition comprising (a) determining the level of NR2F6 expression in a sample from a subject; and (b) comparing the level of expression of NR2F6 from the sample with a control; wherein an increase in expression of NR2F6 in the sample from the subject as compared to the control is indicative of a hematological condition.

[0145] The term "monitoring or assessing" as used herein includes, monitoring the occurrence, development, treatment and/or progression of the hematological condition. In an embodiment, the hematological condition is MDS or leukemia.

[0146] The term "sample" as used herein refers to any fluid, cell or tissue sample from a subject. In one embodiment, the sample is blood.

[0147] The term "subject" as used herein refers to any member of the animal kingdom, optionally, a human.

[0148] The term "control" as used herein refers to a sample from a subject or a group of subjects who are either known as having a particular condition or trait or as not having a particular condition or trait. The control can vary depending on what is being monitored, assessed or diagnosed. The term "control" as used herein can also refer to a predetermined standard or reference range of values.

[0149] The term "difference in expression of NR2F6 in the sample from the subject as compared to the control" means that NR2F6 is differentially expressed in the sample from the subject as compared to the control.

[0150] The term "differentially expressed" or "differential expression" as used herein refers to a difference in the level of expression of NR2F6. The term "difference in the level of expression" refers to an increase or decrease in the measurable expression level of NR2F6 as compared with the measurable expression level of NR2F6 in a second sample or control. The term can also refer to an increase or decrease in the measurable expression level of NR2F6 in a population of samples as compared with the measurable expression level of NR2F6 in a second population of samples. In one embodiment, the differential expression can be compared using the ratio of the level of expression of NR2F6 as compared with the expression level of the NR2F6 of a control, wherein the ratio is not equal to 1.0. For example, a protein is differentially expressed if the ratio of the level of expression in a first sample as compared with a second sample is greater than or less than 1.0. For example, a ratio of greater than 1, 1.2, 1.5, 1.7, 2, 3, 5, 10, 15, 20 or more, or a ratio less than 1, 0.8, 0.6, 0.4, 0.2, 0.1, 0.05, 0.001 or less. In another embodiment the differential expression is measured using p-value. For instance, when using p-value, NR2F6 is identified as being differentially expressed as between a first and second population when the p-value is less than 0.1, preferably less than 0.05, more preferably less than 0.01, even more preferably less than 0.005, the most preferably less than 0.001.

[0151] "Determining the expression of NR2F6" can be readily accomplished by a person skilled in the art. In one embodiment, a probe that hybridizes to the mRNA sequence of the NR2F6 nucleic acid sequence as shown in SEQ ID NOs:1 or 4 or variants thereof can be used to detect and quantify the amount of NR2F6 mRNA in the sample.

[0152] A nucleotide probe may be labelled with a detectable marker such as a radioactive label which provides for an adequate signal and has sufficient half life such as 32P, 3H, 14C or the like. Other detectable markers which may be used include antigens that are recognized by a specific labelled antibody, fluorescent compounds, enzymes, antibodies specific for a labelled antigen, and chemiluminescent compounds. An appropriate label may be selected having regard to the rate of hybridization and binding of the probe to the nucleotide to be detected and the amount of nucleotide available for hybridization.

[0153] Hybridization conditions which may be used in methods of the disclosure are known in the art and are described for example in Sambrook J, Fritch E F, Maniatis T. In: Molecular Cloning, A Laboratory Manual, 1989. (Nolan C, Ed.), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. The hybridization product may be assayed using techniques known in the art. The nucleotide probe may be labelled with a detectable marker as described herein and the hybridization product may be assayed by detecting the detectable marker.

[0154] In another embodiment, primers that are able to amplify the NR2F6 sequence can be used in a quantitative PCR assay to determine the expression level of NR2F6. In one embodiment, forward and reverse primers used for amplifying NR2F6 are 5'-TCTCCCAGCTGTTCTTCATGC-3' (SEQ ID NO:7) and 5'-CCAGTTGAAGGTACTCCCCG-3' (SEQ ID NO:8).

[0155] The length and bases of primers for use in a PCR are selected so that they will hybridize to different strands of the desired sequence and at relative positions along the sequence such that an extension product synthesized from one primer when it is separated from its template can serve as a template for extension of the other primer into a nucleic acid of defined length. Primers which may be used in the disclosure are oligonucleotides, i.e., molecules containing two or more deoxyribonucleotides of the nucleic acid molecules of the disclosure which occur naturally as in a purified restriction endonuclease digest or are produced synthetically using techniques known in the art such as for example phosphotriester and phosphodiester methods (See Good et al. Nucl. Acid Res 4:2157, 1977) or automated techniques (See for example, Conolly, B. A. Nucleic Acids Res. 15:15(7): 3131, 1987). The primers are capable of acting as a point of initiation of synthesis when placed under conditions which permit the synthesis of a primer extension product which is complementary to a DNA sequence of the disclosure, i.e., in the presence of nucleotide substrates, an agent for polymerization such as DNA polymerase and at suitable temperature and pH. Preferably, the primers are sequences that do not form secondary structures by base pairing with other copies of the primer or sequences that form a hairpin configuration. The primer optionally comprises between about 7 and 25 nucleotides.

[0156] The primers may be labelled with detectable markers which allow for detection of the amplified products. Suitable detectable markers are radioactive markers such as P-32, S-35, I-125, and H-3, luminescent markers such as chemiluminescent markers, preferably luminol, and fluorescent markers, preferably dansyl chloride, fluorcein-5-isothiocyanate, and 4-fluor-7-nitrobenz-2-axa-1,3 diazole, enzyme markers such as horseradish peroxidase, alkaline phosphatase, .beta.-galactosidase, acetylcholinesterase, or biotin.

[0157] It will be appreciated that the primers may contain non-complementary sequences provided that a sufficient amount of the primer contains a sequence which is complementary to a nucleic acid molecule of the disclosure or oligonucleotide fragment thereof, which is to be amplified. Restriction site linkers may also be incorporated into the primers allowing for digestion of the amplified products with the appropriate restriction enzymes facilitating cloning and sequencing of the amplified product.

[0158] In yet another embodiment, antibodies that bind NR2F6 as shown in SEQ ID NO:2 or 3 or variants or homologs thereof can be used to detect NR2F6 protein levels.

[0159] The antibodies may be labelled with a detectable marker including various enzymes, fluorescent materials, luminescent materials and radioactive materials. Examples of suitable enzymes include horseradish peroxidase, alkaline phosphatase, .beta.-galactosidase, or acetylcholinesterase; examples of suitable fluorescent materials include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride or phycoerythrin; an example of a luminescent material includes luminol; and examples of suitable radioactive material include S-35, Cu-64, Ga-67, Zr-89, Ru-97, Tc-99m, Rh-105, Pd-109, In-111, I-123, I-125, I-131, Re-186, Au-198, Au-199, Pb-203, At-211, Pb-212 and Bi-212. The antibodies may also be labelled or conjugated to one partner of a ligand binding pair. Representative examples include avidin-biotin and riboflavin-riboflavin binding protein. Methods for conjugating or labelling the antibodies discussed above with the representative labels set forth above may be readily accomplished using conventional techniques.

[0160] Antibodies reactive against NR2F6 protein may be used to detect NR2F6 in various samples, for example they may be used in any known immunoassays which rely on the binding interaction between an antigenic determinant of a protein of the disclosure and the antibodies. Examples of such assays are radioimmunoassays, western immunoblotting, enzyme immunoassays (e.g., ELISA), immunofluorescence, immunoprecipitation, latex agglutination, hemagglutination, and histochemical tests. Thus, the antibodies may be used to identify or quantify the amount of a protein in a sample.

Model Organisms

[0161] In another aspect, overexpression of NR2F6 in an animal may provide a model for diseases such as myelodysplastic syndrome. Progress in understanding MDS has been hampered by the lack of suitable cell lines or animal models for this disease. A mouse model that accurately recapitulates the essential qualities of MDS--stem cell competitive advantage, dysplastic haematopoiesis, peripheral blood cytopenias, and progression to acute leukemia--would be tremendously valuable for investigations of the pathological mechanisms of these qualities and for preclinical testing of new MDS therapies. In this embodiment over-expression of NR2F6 in a chimerical mouse model provides an animal model for the study of MDS. Specific transplantation of murine haematopoietic cells engineered to overexpress NR2F6 causes myelodysplastic syndrome and promotes the development of acute myelogenous leukemia. This model, recapitulates the morphological abnormalities of MDS haematopoiesis as well as the transition of MDS to acute leukemia. This model is based on unregulated expression of the orphan nuclear receptor NR2F6 in murine haematopoietic stem and progenitor cells (HSCs).

[0162] Accordingly, in one embodiment, the present disclosure provides a cell transformed with a NR2F6 gene operatively linked to a promoter that drives overexpression of the gene. In another embodiment, the present disclosure provides a transgenic animal comprising the cell having the NR2F6 gene operatively linked to a promoter that drives overexpression of the gene. In an embodiment, the animal is a rodent, optionally, a mouse.

[0163] "Operatively linked" is intended to mean that the nucleic acid is linked to regulatory sequences in a manner which allows expression of the nucleic acid.

[0164] The above disclosure generally describes the present disclosure. A more complete understanding can be obtained by reference to the following specific examples. These examples are described solely for the purpose of illustration and are not intended to limit the scope of the disclosure. Changes in form and substitution of equivalents are contemplated as circumstances might suggest or render expedient. Although specific terms have been employed herein, such terms are intended in a descriptive sense and not for purposes of limitation.

[0165] The following non-limiting examples are illustrative of the present disclosure:

EXAMPLES

Materials & Methods

Cell Lines

[0166] U937 cells were purchased from ATCC and grown in RPMI supplemented with 10% FBS. 32Dcl3 cells were purchased from ATCC and grown in RPMI with 1 ng/mL of rmlL-3. The 293GPG retroviral packaging cell line (a gift of Richard Mulligan, Harvard University) was grown in DMEM medium supplemented with 10% FBS, tetracycline (1 mg/mL), G418 (0.3 mg/mL) and puromycin (2 mg/mL).

Generation of Retroviruses

[0167] NR2F6 cDNA (a kind gift from John Ladias, Harvard University) was subcloned into the pcDNA3.1V5/HIS vector (Invitrogen). V5-tagged NR2F6 was subsequently subcloned into the MMP retrovector such that it lay upstream of an IRES (internal ribosome entry sequence)-GFP cassette. VSV-G pseudotyped retroviral particles were generated by transient transfection of 293GPG cells with 25 ug of plasmid in lipofectamine 2000. Viral supernatant was collected for seven days from cultures of these cells in media containing high glucose DMEM with 10% FBS that contained no tetracycline, G418 or puromycin. Viral stocks were concentrated by centrifugation at 16,500 RPM for 90 minutes. In some experiments producer cell lines that stably express the MMP-NR2F6 or MMP-GFP retroviral construct were generated for the production of viral stock. Virus was produced from these cell lines by culturing in high glucose DMEM that contained no tetracycline, G418 or puromycin. Following 7 days of culture viral stock was concentrated by centrifugation at 16,500 RPM for 90 minutes. For U937 and 32D infections, cells were infected at a multiplicity of infection (MOI) of 2. GFP positive cells were harvested by FACS 48 h after infection.

Patient Material

[0168] Leukemia and healthy BM cells, collected with informed consent and with institutional ethics board approval and stored in our tissue bank, were used to assess expression of NR2F6. The French-American British classification of the AML samples consisted of 6 AML-M4, 7 AML-M4eo, 1 AML-M3 and 1 AML-M1.

Real-Time PCR

[0169] RNA was isolated from 1.times.10.sup.6 cells using Trizol reagent (Invitrogen) and first strand cDNA was synthesized using SuperScript reverse transcriptase (Qiagen) according to manufacturer's instructions. Real time PCR was performed according to manufacturer's instructions using SYBR Green Master Mix (Applied Biosystems, Foster City, Calif.) and analysed using the delta-delta CT method. The forward and reverse primers used for NR2F6 are 5'-TCTCCCAGCTGTTCTTCATGC-3' (SEQ ID NO:7) and 5'-CCAGTTGAAGGTACTCCCCG-3' (SEQ ID NO:8), respectively, and for GAPDH 5'-GGCCTCCAAGGAGTAAGACC-3' (SEQ ID NO:9) and 5'-AGGGGTCTACATGGCAACTG-3' (SEQ ID NO:10). Threshold cycle (C.sub.T) values were calculated in each sample for NR2F6 and normalized to the C.sub.T for the housekeeping gene GAPDH (delta-C.sub.T). The relative quantity of NR2F6 expression in samples relative to control was be determined as the delta-C.sub.T of the sample subtracted from the delta-C.sub.T of control, to the exponent 2(delta-delta-C.sub.T). For analysis of NR2F6 expression in patient samples the mean delta-C.sub.T of all normal samples was used to calculate delta-delta-C.sub.T values.

Differentiation Assessment and Induction

[0170] Differentiation was induced in the U937 cell line by treatment with 10 nM TPA (Sigma), 1 uM ATRA (Sigma), or 1.25% v/v DMSO (Sigma) respectively. Immunostaining for the maturation marker CD11b (eBioscience) was performed for twenty minutes in the dark according to manufacturer's instructions and cells were analysed by flow cytometry. Nitroblue tetrazolium (NBT) reduction test (Sigma) was performed according to the manufacturer's instructions, with a minimum of 300 cells scored per slide in three different fields of view. Each experimental timepoint was conducted in triplicate.

Bone Marrow Transduction

[0171] Using the retroviral constructs described above, expression of NR2F6 was forced in primary murine BM cells and monitor the effects on differentiation using colony assays. Donor 12-week old C57BI/6 mice were given 5 fluorouracil, 150 .mu.g/g body mass, by intraperitoneal injection and humanely killed ninety-six hours later. Bone marrow was collected from femurs and tibiae and cultured in Iscove's Modified Dulbecco's Medium supplemented with foetal bovine serum (5%), c-Kit ligand conditioned medium (3%), Flt-3 (30 ng/mL), and TPO (30 ng/mL), conditions that minimize differentiation but initiate cycling of long-term repopulating cells. After 24 hours of culture, the cells were infected with MMP-GFP or MMP-NR2F6 retroviral supernatant at a multiplicity of infection (MOI) of 100. Forty-eight hours after retroviral infection GFP-positive cells were collected by fluorescence activated cell sorting (FACS).

Methylcellulose Colonies

[0172] Following bone marrow transduction with MMP-GFP or MMP-NR2F6 GFP positive cells were collected by FACS and plated in methylcellulose medium supplemented with cytokines (c-Kit ligand, IL-3, IL-6, and erythropoietin) that favour multi-lineage terminal differentiation (Methocult GF 3434, Stem Cell Technologies). Colony formation was evaluated after 12-14 days; clusters containing more than 30 cells will be scored as a colony. Accuracy of colony identification and morphological maturity of colony cells was confirmed by spreading and staining individual colonies on glass slides. Cultures were evaluated for their number of colonies, colony lineage (granulocyte-monocyte, erythroid, or mixed) and morphology. GFP expression was confirmed by fluorescence microscopy. Differences in colony numbers between NR2F6 and controls will be tested for statistical significance with Student's t-test. Secondary colony formation was tested by harvesting an entire primary colony cultures, washing the cells two times with PBS, and plating 10,000 cells in methylcellulose a second time. Secondary colonies were enumerated 12-14 days following a secondary plating.

Ex vivo Suspension Culture

[0173] Following transduction of mouse bone marrow with MMP-GFP or MMP-NR2F6, cells were placed unsorted into cultured in IMDM with 5% FBS, 10% v/v IL-3 conditioned medium from WEHI cells, 1 ng/mL IL-6 and 3% v/v c-kit ligand conditioned medium. Following ten days of culture the cells were washed twice with PBS, stained with either fluorescently labelled c-kit or with fluorescently labelled CD11b and GR-1, and analysed by flow cytometry.

Hematopoietic Stem Cell transplants

[0174] Bone marrow transplant recipients were generated that received either chimerical NR2F6 or GFP transduced grafts or grafts that contained 100% sorted bone marrow cells.

[0175] To generate recipients transplanted with bone marrow grafts containing a chimera of transduced and wild-type cells 5FU-primed C57BI/6 bone marrow cells were transduced with either MMP-GFP or MMP-NR2F6 as described above. Cells were then sorted by FACS. Transduced (GFP or NR2F6) and untransduced donor cells were mixed at a ratio of between 10:90 to 30:70 (transduced:untransduced), maintaining a constant total graft size of between 4.times.10.sup.4 to 1.times.10.sup.5 cells per recipient. All recipients of a given cohort received the same graft size. Primary chimerical transplants were performed as described. In some experiments chimerical transplant recipients were harvest at 4-6 weeks post transplant for analysis, and bone marrow was transplanted into another lethally irradiated mouse by tail-vein injection. Secondary recipients of chimerical bone marrow were harvested at either early time points 4-6 weeks or at late time points 12-16 weeks.

[0176] To generate recipients transplanted with bone marrow grafts containing 100% transduced bone marrow cells 5FU-primed C57BI/6 bone marrow cells were transduced with either MMP-GFP or MMP-NR2F6 as described above. Cells were then sorted by FACS and introduced into recipient mice by tail vein injection at a dosage of between 4.times.10.sup.4 and 1.times.10.sup.5 cells per recipient. All recipients of a given cohort received the same graft size. Recipient C57BI/6 mice were treated with 900 cGy prior to transplantation--it was previously determined that this radiation dose is the lowest reliably lethal dose for this strain.

[0177] For the competitive transplant experiment (FIG. 25) animals were prepared as described in the generation of recipients transplanted with bone marrow grafts containing a chimera of transduced and wild-type cells. The percentage of marked cells was determined based on expression of GFP using flow cytometry.

Histological Sections and Cytospins

[0178] Immediately following sacrifice of animals tissues were rinsed in PBS and fixed for 24 hours in buffered formalin before being given off to the Sunnybrook Research Institute Histology facility for paraffin embedding, slicing and staining with hematoxylin and eosin. Bone tissues were decalcified following fixation before further processing. Cytospins were prepared by centrifuging single celled suspensions onto glass slides using a Shandon cytocentrifuge. Cytospins were air dried, and fixed in methanol before staining with May-Gruwald and Giemsa stains. Cytospins were coverslipped following treatment with a toluene-based synthetic resin mounting medium.

Peripheral Blood Counts:

[0179] Bone marrow transplant recipients that received grafts containing 100% transduced bone marrow cells were bleed at 4 weeks post-transplant from the Saphenous vein. Alternatively, moribund animals were bled by cardiac puncture just prior to death. To give matched data, a GFP control animal was analysed with every NR2F6 moribund animal analysed. Blood was collected using a heparinized capillary tube and taken to the Toronto Centre for Phenogenomics for acquisition of haematological parameters on a Hemavet analyser.

Analysis of Hematopoietic Stem Cell Subsets:

[0180] Bone marrow transplant recipients that received grafts containing 100% transduced bone marrow cells were humanely sacrificed at four weeks post-transplant. Red blood cells were lysed and bone marrow washed two times with PBS. Bone marrow cells were then stained with biotin CD3, biotin CD45R/B220 (RA3-6B2), biotin CD11b (M1/70), biotin erythroid marker (TER-119), biotin Ly-6G (RB6-8C5), c-kit APC, sca-1 PE-Cy7 and either CD34 PE or CD49b PE (all eBioscience) in the dark. Bone marrow was washed once and incubated with streptavidin PE-Cy5 for 20 minutes in the dark. Bone marrow was washed twice and analysed using flow cytometry on a Becton Dickinson LSR II. All samples analysed were gated based on FSC/SSC and GFP+ cells. The population of lineage.sup.- Sca-1.sup.+ c-kit.sup.+ (LSK) is highly enriched for hematopoietic stem cell activity. This population was analysed and further subdivided based on the expression of the CD34 and CD49b antigen. Whereas the CD34.sup.-/low and the CD49b.sup.-/low population of LSK cells are enriched for long-term hematopoietic stem cells, the CD34.sup.+ and CD49b+population of LSK cells are composed of short term hematopoietic stem cells.

Results

[0181] To assess the pattern of expression of NR2F6 in normal hematopoiesis, Q-PCR was used to measure expression of NR2F6 transcripts in a graded series of pluripotent, multipotent, oligopotent, and unipotent murine haematopoietic cells (cDNAs were a kind gift from Dr. Norman Iscove). NR2F6 transcripts were most abundant in long-term hematopoietic stem cells and became progressively less abundant with differentiation, with the exception of committed megakaryocyte progenitors, in which expression was high (FIG. 1A). These observations are consistent with NR2F6 having a role in the maintenance of the undifferentiated state of primitive hematopoietic cells. Expression of NR2F6 mRNA is shown relative to GAPDH. Long-term repopulating HSCs (LT-HSC), short-term repopulating HSCs (ST-HSC), pentapotent progenitor (Penta), committed non-lymphoid progenitor (E Meg Mac), erythroid/megakaryocyte progenitor (E Meg), committed megakaryocyte progenitor (Meg Pro), BFU-E, CFU-E, megakaryocyte (Meg). All expression levels are relative to expression of NR2F6 in E Meg Mac.

[0182] Bone marrow from patients with acute myelogenous leukemia (AML), chronic myelomonocytic leukemia (CMML) and myelodysplastic syndrome (MDS) have greater expression of NR2F6 mRNA than bone marrow from healthy human controls (FIG. 1B). These data support the notion that NR2F6 may be used as a biomarker for the diagnosis and/or prognosis of patients with leukemia, CMML and MDS.

[0183] NR2F6 mRNA is expressed highly in immature U937 human leukemia cell line (FIG. 2). The high expression of NR2F6 is associated with maintenance of the undifferentiated state of these cells. Induction of U937 leukemia cells to differentiate and to acquire characteristics of mature blood cells was associated with a sharp decrement in the expression of NR2F6 mRNA. The rapid decrease in NR2F6 mRNA expression is a general response to the induction of differentiation and maturation since this decrease occurred irrespective of the agent used to induce differentiation and maturation.

[0184] Overexpression of NR2F6 is able to override the growth arrest associated with differentiation and maturation, in particular maturation and differentiation induced by all-trans retinoic acid (FIG. 3). This suggests that NR2F6 can act to antagonize the initiation of the downstream pathways that are activated by all-trans retinoic acid (atRA). Growth of U937 cells expressing either GFP of NR2F6-IRES-GFP was monitored by counting using trypan blue following treatment of cells with atRA (FIG. 3A). U937 cells expressing either GFP of NR2F6-IRES-GFP were treated with atRA. DNA content was assessed using propidium iodide in order to determine which phase of the cell cycle the cells in each respective population resided in (FIG. 3B). Control U937 GFP cells showed a drastic decrease in the number of cells in S/G2/M phases of the cell cycle following treatment with atRA, however U937 cells that over-expressed NR2F6 did not show any decrease in the number of cells in S/G2/M phases of the cell cycle following treatment with atRA. These data suggest the NR2F6 over-expression promotes proliferation by affecting the cell cycle.

[0185] Over-expression of NR2F6 enables the survival and proliferation of mouse embryonic fibroblasts (MEFs) in low serum (0.2% serum) (FIG. 4). MEFs were stably transduced using a retroviral construct containing either GFP of NR2F6-IRES-GFP. MEFs transduced with NR2F6 were sorted into high transgene expressers or low transgene expressers based on GFP intensity. Cells were initially plated at 1.times.10.sup.5 cells and enumerated after several days.

[0186] Over-expression of NR2F6 is able to inhibit the differentiation and maturation of U937 human leukemia cells (FIG. 5). U937 cells expressing either GFP of NR2F6-IRES-GFP were treated with atRA and assessed for maturation. Following induction of differentiation with atRA expression of the myeloid maturation marker CD11b was assessed using flow cytometry. These data suggest that aberrant expression of NR2F6 inhibits the maturation of leukemia cells, in particular toward the myeloid cell lineage.

[0187] Over-expression of NR2F6 is able to inhibit the differentiation and maturation of U937 human leukemia cells (FIG. 6). U937 cells expressing either GFP of NR2F6-IRES-GFP were treated with atRA and assessed for maturation. Following induction of differentiation with atRA cells were stained for nitroblue tetrazolium (NBT). The percentage of NBT+ cells were enumerated in three separate fields of view in which more than 100 individual cells were evaluated (FIG. 6A). A microphotograph of representative U937-NR2F6 and U937-GFP cells is shown in FIG. 6B. These data suggest that aberrant expression of NR2F6 inhibits the maturation of leukemia cells, in particular toward the myeloid cell lineage.

[0188] NR2F6 over-expression inhibits the maturation of healthy bone marrow (FIG. 7). Bone marrow from 5-FU treated C57BI/6 mice was transduced using a retrovirus containing either GFP of NR2F6-IRES-GFP. Transduced cells (GFP+) were sorted and plated in methylcellulose culture containing growth factors that would support multi-lineage differentiation. Colonies were enumerated after 12-14 days (FIG. 7A). These data are consistent with the over-expression of NR2F6 inhibiting maturation. After the enumeration of these primary colonies methycellulose cultures were harvested, washed with PBS and 10,000 of said cells were plated in another methycellulose culture to determine the ability of these cells to form colonies a second time, (FIG. 7B), and then repeated yet a third time (FIG. 7C). These secondary and tertiary cultures were enumerated after another 12-14 days of culture. The ability of bone marrow that over-expresses NR2F6 to form a far greater number of secondary and tertiary colonies compared to control bone marrow demonstrates that over-expression of NR2F6 inhibits terminal differentiation of hematopoietic cells.

[0189] NR2F6 over-expression inhibits the maturation of healthy bone marrow toward the myeloid lineage (FIG. 8). Bone marrow from 5-FU treated C57BI/6 mice was transduced using a retrovirus containing either GFP of NR2F6-IRES-GFP and cells were plated in IMDM liquid medium containing growth factors that support multi-lineage differentiation. The percentage of myeloid cells following ten days of culture was assessed by flow cytometry using the cell surface markers Mac1/CD11b and Gr-1 (FIG. 8A). The graphs in the panel have been gated on the transduced cells (GFP+). The percentage of mast cells was also determined following ten days of culture using flow cytometry for the cell surface marker c-kit (FIG. 8B). The graphs in the panel have not been gated a priori on the transduced cells (GFP+).

[0190] NR2F6 over-expression in vivo increases bone marrow cellularity, even when only a portion of the cells over-express NR2F6 (FIG. 9). Chimerical mice that overexpressed NR2F6 in only a portion of their bone marrow cells were generated by transducing bone marrow from 5-FU treated C57BI/6 using a retrovirus containing either GFP of NR2F6-IRES-GFP. Cells were then sorted and admixed with a fixed ratio of wild-type bone marrow before transplantation into lethally irradiated C57BI/6 hosts. Animals were harvested to monitor short-term (4 week) as well as long-term (12 week) hematopoietic effects. Over-expression of NR2F6 in the bone marrow of animals resulted in hypercellular bone marrow as determined by counting cells with trypan blue after flushing two femurs and one tibia (FIG. 9A). Furthermore, NR2F6-transduced cells from BMT recipients had a striking increase in replating ability relative to GFP-transduced cells (FIG. 9B) Histological sections that were stained with hematoxylin and eosin, stain demonstrate that over-expression of NR2F6 causes bone marrow to become hypercellular (FIG. 9C). Mice also had splenomegaly, this is consistent with histological sections that show alterations in the splenic architecture, consistent with an expansion of the proliferative centers of the white pulp.

[0191] NR2F6 over-expression causes bone marrow dysplasia (FIG. 10). Chimerical mice that overexpressed NR2F6 in only a portion of their bone marrow cells were generated by transducing bone marrow from 5-FU treated C57BI/6 using a retrovirus containing either GFP of NR2F6-IRES-GFP. Cells were then sorted and admixed with a fixed ratio of wild-type bone marrow before transplantation into lethally irradiated C57BI/6 hosts. Examination of bone marrow cytospins from these animals shows dysplastic characteristics, especially in the erythroid lineage. This dysplasia resemble morphologically the dysplasia observed in human patients with myelodysplastic syndrome, suggesting that modulation of NR2F6 could provide a therapeutic benefit to these patients.

[0192] NR2F6 over-expression causes abnormal localization of immature precursors (ALIP) (FIG. 11). Chimerical mice that overexpressed NR2F6 in only a portion of their bone marrow cells were generated by transducing bone marrow from 5-FU treated C57BI/6 using a retrovirus containing either GFP of NR2F6-IRES-GFP. Cells were then sorted and admixed with a fixed ratio of wild-type bone marrow before transplantation into lethally irradiated C57BI/6 hosts. Examination of bone marrow histological sections from these cohorts of animals shows that over-expression of NR2F6 results in the phenomenon of abnormal localization of immature precursors (ALIP). This resembles the condition ALIP which is observed in human patients with high risk myelodysplastic syndrome, again suggesting that modulation of NR2F6 could provide a therapeutic benefit to these patients.

[0193] NR2F6 over-expression inhibits myeloid differentiation and maturation in vivo (FIG. 12). Chimerical mice that over-expressed NR2F6 in only a portion of their bone marrow cells were generated by transducing bone marrow from 5-FU treated C57BI/6 using a retrovirus containing either GFP of NR2F6-IRES-GFP. Cells were then sorted and admixed with a fixed ratio of wild-type bone marrow before transplantation into lethally irradiated C57BI/6 hosts. Analysis of the bone marrow of these mice by flow cytometry showed that over-expression of NR2F6 prevents the differentiation and maturation of progenitor cells into neutrophils (Mac1+/Gr-1+). This data suggests that modulation of NR2F6 could provide a therapeutic benefit to patients suffering from disorders associated with abnormal myeloid maturation.

[0194] NR2F6 over-expression inhibits blood cell differentiation and maturation in vivo (FIG. 13). Mice that over-expressed NR2F6 in all of their bone marrow cells were generated by transducing bone marrow from 5-FU treated C57BI/6 using a retrovirus containing either GFP of NR2F6-IRES-GFP. Cells were then sorted and transplantation into lethally irradiated C57BI/6 hosts. Analysis of the peripheral blood of these animals shows major defects in their ability to produce mature blood cells. At four weeks of age these animals are suffering from a condition similar to the human bone marrow failure syndromes. The test animals but not the controls are pancytopenic: they suffer from anemia, thrombocytopenia, and neutropenia. This data suggests that modulation of NR2F6 could provide a therapeutic benefit to patients suffering from disorders associated with abnormal blood cell differentiation and maturation.

[0195] NR2F6 over-expression produces an excess of megakaryoctes (FIG. 14). Mice that over-expressed NR2F6 in all of their bone marrow cells were generated by transducing bone marrow from 5-FU treated C57BI/6 using a retrovirus containing either GFP of NR2F6-IRES-GFP. Cells were then sorted and transplantation into lethally irradiated C57BI/6 hosts. Despite the lower amounts of platelets observed at short term time points, analysis of the bone marrow of these animals revealed an excess of megakaryoctes. This suggests that modulation of NR2F6 at specific stages of blood cell development could provide a therapeutic benefit to patients suffering from thrombotic disorders, or disorders of megakaryocytic differentiation and maturation.

[0196] NR2F6 over-expression, even in a small subset of bone marrow cells, eventually results in the generation of leukemia (FIG. 15). Herein, a mouse model was used in which the phenotype was accelerated by conducting secondary transplants. Bone marrow from animals with NR2F6+ leukemia has a packed bone marrow cellularity. Animals with NR2F6+ leukemia also had immature blast cells in their peripheral blood. These are characteristics of high risk human leukemias and suggests that modulation of NR2F6 could provide a therapeutic benefit to patients suffering from leukemia or for preventing the development of leukemia in MDS patients.

[0197] NR2F6 over-expression, even in a small subset of bone marrow cells, results in the production of excessive immature blast cells (FIG. 16). Manual cell counts conducted on the cytospins of bone marrow from NR2F6 transplant chimera revealed an excess of blast cells and promyelocytic cells. Chimerical mice that over-expressed NR2F6 in only a portion of their bone marrow cells were generated by transducing bone marrow from 5-FU treated C57BI/6 using a retrovirus containing either GFP of NR2F6-IRES-GFP. Cells were then sorted and admixed with a fixed ratio of wild-type bone marrow before transplantation into lethally irradiated C57BI/6 hosts. An excess of immature blast cells is a characteristic of human leukemia. These data suggest that modulation of NR2F6 could provide a therapeutic benefit to patients suffering from leukemia or for preventing the development of leukemia in MDS patients.

[0198] NR2F6 over-expression, even in a small subset of bone marrow cells, eventually results in the generation of leukemia (FIG. 17). Bone marrow from animals with NR2F6+ leukemia has a packed bone marrow cellularity. Histology from animals with NR2F6+ leukemia showed an utter obliteration of their splenic architecture. Leukemia cells also infiltrated the liver. Infiltration of organs is a characteristic of high risk human leukemia. These data suggest that modulation of NR2F6 could provide a therapeutic benefit to patients suffering from leukemia or for preventing the development of leukemia in MDS patients.

[0199] Over-expression of NR2F6 in the bone marrow of healthy animals resulted in a fatal hematological condition that resembles human myelodysplastic syndrome and acute leukemia (FIG. 18). NR2F6 over-expression in a small subset of bone marrow cells results in a prolonged hematological condition that eventually leads to death in a subset of its patients (FIG. 18A), while NR2F6 over-expression in all of one's bone marrow cells resulted in a rapidly fatal hematological condition (FIG. 18B). These data suggest that modulation of NR2F6 could provide a survival benefit to patients suffering from leukemia, MDS, or other hematological condition characterized by effacement of haematopoiesis.

[0200] Flow cytometry on BM and spleen cells confirmed that the NR2F6-transduced graft contributed to trilineage haematopoiesis but also revealed the presence of an abnormal lineage-negative (lineage-) population that expressed moderate cKit antigen (FIGS. 19, 20 and 21). Fascinatingly, the size of the ckit+Sca-1+lineage- (KSL) population was markedly increased in NR2F6 recipients (FIG. 22). Thus, NR2F6-transduced HSCs show impaired differentiation, a propensity to accumulate, and a high rate of malignant transformation.

[0201] Over-expression of NR2F6 in the bone marrow of healthy animals results in expansion of their hematopoietic stem cell (FIG. 23). Mice that over-expressed NR2F6 in all of their bone marrow cells were generated by transducing bone marrow from 5-FU treated C57BI/6 using a retrovirus containing either GFP of NR2F6-IRES-GFP. Cells were then sorted and transplantation into lethally irradiated C57BI/6 hosts. Four weeks post transplant the bone marrow of these animals was analyzed by multicolour flow cytometry (FIG. 23A). There was a striking accumulation of stem cells in the bone marrow of animals that over-expressed NR2F6 (cells with the lineage.sup.-, c-kit.sup.+, sca-1.sup.+ immunopheonotype). Interestingly, there was an increase in the number of long-term stem cells found in the bone marrow of animals that over-expressed NR2F6 (cells with the lineage.sup.-, c-kit.sup.+, sca-1.sup.+, CD49b.sup.-immunophenotype and cells with the lineage.sup.-, c-kit.sup.+, sca-1.sup.+, CD34.sup.- immunophenotype) (FIG. 23B). The accumulation of hematopoietic stem cells in the bone marrow of NR2F6+ animals suggests that NR2F6 increases hematopoietic stem cell self-renewal. Furthermore, these data support the fact that NR2F6 is able to act upon the most primitive hematopoietic stem cell compartments and regulate their proliferation as well as the self-renewal of long-term hematopoietic stem cells. These data support the modulation of NR2F6 as a method of expanding stem cells ex vivo. These data also support the modulation of NR2F6 for the treatment of diseases associated with aberrant self-renewal, for example targeting of the cancer stem cell. NR2F6 overexpressing bone marrow was cultured in conditions that preserve stem cell maintenance (c-kit ligand; thrombopoietin; and Flt3 ligand in OP9 conditioned medium). Following three days in culture the proportion of stem cells with the immunophenotype ckit+Sca-1+lineage- (KSL) was determined by flow cytometry. It was observed that bone marrow that over-expressed NR2F6 contained more KSL cells than GFP control cultures (FIG. 24) suggesting that modulation of NR2F6 can be used to maintain and/or expand hematopoietic stem cells in culture.

[0202] Over-expression of NR2F6 in the bone marrow of healthy animals enhances self-renewal in vivo (FIG. 25). Competitive bone marrow transplant experiments shows that over-expression of NR2F6 results in increased engraftment which evidences that over-expression of NR2F6 increases self-renewal (FIG. 25A). The self-renewal ability of bone marrow attained from animal that over-express either NR2F6-IRES-GFP or GFP was compared by assessing the bone marrow's secondary colony forming ability After the enumeration of primary methycellulose colonies cultures were harvested, washed with PBS and 10,000 of said cells were plated in another methycellulose culture to determine the ability of these cells to form colonies a second time (FIG. 25B). These secondary cultures were enumerated after another 12-14 days of culture. The ability of bone marrow that over-expresses NR2F6 to form a far greater number of secondary colonies compared to control bone marrow demonstrates that over-expression of NR2F6 increases hematopoietic cell self-renewal and inhibits the terminal differentiation of hematopoietic cells.

[0203] Knock down of NR2F6 using short-hairpin RNAs induces differentiation and maturation of 32Dcl3 mouse hematopoietic cells (FIG. 26). Cytospins of cells transduced with either the pSiren universal negative control retroviral plasmid, or an shRNA retroviral plasmid that targets mouse NR2F6 induces the differentiation and maturation of 32Dcl3 cells demonstrate the knock down of NR2F6 induces spontaneous myeloid cell differentiation (FIG. 26A). Flow cytometry on 32Dcl3 mouse hematopoietic cells transduced with either the pSiren universal negative control retroviral plasmid or an shRNA retroviral plasmid that targets the mouse NR2F6, confirms that knockdown of NR2F6 induces spontaneous myeloid cell differentiation (FIG. 26B).

[0204] Knock down of NR2F6 using short-hairpin RNAs induces terminal differentiation, blood cell maturation death of U937 human leukemia cells (FIG. 27). Cytospins of cells transduced with either the pSiren universal negative control retroviral plasmid, or an shRNA retroviral plasmid that targets human NR2F6 induces the differentiation and maturation of U937 cells demonstrate the knock down of NR2F6 induces spontaneous myeloid cell differentiation (FIG. 27A). Flow cytometry on U937 human myelomonocytic leukemia cells transduced with either the pSiren universal negative control retroviral plasmid or an shRNA retroviral plasmid that targets the human NR2F6, confirms that knockdown of NR2F6 induces spontaneous myeloid cell differentiation (FIG. 27B).

[0205] Knock down of NR2F6 expression using short hairpin RNA (shNR2F6) was then shown to promote the differentiation of immature bone marrow cells in suspension culture when compared to the scrambled shRNA control (scrm) (FIGS. 28 and 29). Murine bone marrow cells were cultured in conditions that preserved stem cell maintenance (c-kit ligand; thrombopoietin; and Flt3 ligand in OP9 conditioned medium) and transduced with either an shRNA targeting NR2F6 or a scrambled control shRNA. Following seven days in culture cells were analysed by flow cytometry. Knocking down the expression of NR2F6 dramatically reduced the number of immature cells, i.e. cells devoid of markers of lineage commitment (FIG. 28), and of stem cells (ckit+Sca-1+lineage-, KSL cells) (FIG. 29). Rather, knock down of NR2F6 promoted the differentiation and maturation of bone marrow cells into neutrophils, as shown by flow cytometry (FIG. 30) and morphology (FIG. 31).

[0206] It has been reported that NR2F6 exerts its regulatory effects primarily as a transcriptional repressor (Liu, X., Huang, X., and Sigmund, C.D. (2003). Identification of a nuclear orphan receptor (Ear2) as a negative regulator of renin gene transcription. Circ Res 92, 1033-1040). The repressor activity of nuclear receptors is mediated by recruitment of corepressors with histone deacetylase (HDAC) activity; we therefore evaluated the importance of this mechanism in the effects of NR2F6 on haematopoiesis and evaluated weather the activity of NR2F6 can be modulated with an HDAC inhibitor. 32Dcl3-NR2F6 cells were incubated with the non-specific histone deacetylase inhibitor sodium butyrate prior to treatment with G-CSF. Whereas non-treated 32Dcl3-NR2F6 cells failed to differentiate in response to GCSF, sodium butyrate pretreated cells showed recovery of G-CSF induced differentiation as indicated by cell surface CD11b expression (FIG. 32). Thus, HDAC-mediated transcriptional repression likely accounts for at least part of the mechanism by which NR2F6 impairs hematopoietic differentiation; and hence the activity of NR2F6 can be modulated using HDAC inhibitors.

[0207] While the present disclosure has been described with reference to what are presently considered to be the preferred examples, it is to be understood that the disclosure is not limited to the disclosed examples. To the contrary, the disclosure is intended to cover various modifications and equivalent arrangements included within the spirit and scope of the appended claims.

[0208] All publications, patents and patent applications are herein incorporated by reference in their entirety to the same extent as if each individual publication, patent or patent application was specifically and individually indicated to be incorporated by reference in its entirety.

TABLE-US-00001 TABLE 1 Nucleotide and Amino Acid sequence of NR2F6 mRNA sequence of human NR2F6 Genbank ID BC063018: (SEQ ID NO: 1) cgagaggggt gcccggaggg aagagcgcgg tgggggcgcc ccggccccgc tgccctgggg ctatggccat ggtgaccggc ggctggggcg gccccggcgg cgacacgaac ggcgtggaca aggcgggcgg ctacccgcgc gcggccgagg acgactcggc ctcgcccccc ggtgccgcca gcgacgccga gccgggcgac gaggagcggc cggggctgca ggtggactgc gtggtgtgcg gggacaagtc gagcggcaag cattacggtg tcttcacctg cgagggctgc aagagctttt tcaagcgaag catccgccgc aacctcagct acacctgccg gtccaaccgt gactgccaga tcgaccagca ccaccggaat cagtgccagt actgccgtct caagaagtgc ttccgggtgg gcatgaggaa ggaggcggtg cagcgcggcc gcatcccgca ctcgctgcct ggtgccgtgg ccgcctcctc gggcagcccc ccgggctcgg cgctggcggc agtggcgagc ggcggagacc tcttcccggg gcagccggtg tccgaactga tcgcgcagct gctgcgcgct gagccctacc ctgcggcggc cggacgcttc ggcgcagggg gcggcgcggc gggcgcagtg ctgggcatcg acaacgtgtg cgagctggcg gcgcggctgc tcttcagcac cgtggagtgg gcgcgccacg cgcccttctt ccccgagctg ccggtggccg accaggtggc gctgctgcgc ctgagctgga gcgagctctt cgtgctgaac gcggcgcagg cggcgctgcc cctgcacacg gcgccgctac tggccgccgc cggcctccac gccgcgccta tggccgccga gcgcgccgtg gctttcatgg accaggtgcg cgccttccag gagcaggtgg acaagctggg ccgcctgcag gtcgactcgg ccgagtatgg ctgcctcaag gccatcgcgc tcttcacgcc cgacgcctgt ggcctctcag acccggccca cgttgagagc ctgcaggaga aggcgcaggt ggccctcacc gagtatgtgc gggcgcagta cccgtcccag ccccagcgct tcgggcgcct gctgctgcgg ctccccgccc tgcgcgcggt ccctgcctcc ctcatctccc agctgttctt catgcgcctg gtggggaaga cgcccattga gacactgatc agagacatgc tgctgtcggg gagtaccttc aactggccCt acggctcggg ccagtgacca tgacggggcc acgtgtgctg tggccaggcc tgcagacaga cctcaaggga cagggaatgc tgaggcctcg aggggcctcc cggggcccag gactctggct tctctcctca gacttctatt ttttaaagac tgtgaaatgt ttgtcttttc tgttttttaa atgatcatga aaccaaaaag agactgatca tccaggcctc agcctcatcc tccccaggac ccctgtccag gatggagggt ccaatcctag gacagccttg ttcctcagca cccctagcat gaacttgtgg gatggtgggg ttggcttccc tggcatgatg gacaaaggcc tggcgtcggc cagaggggct gctccagtgg gcaggggtag ctagcgtgtg ccaggcagat cctctggaca cgtaacctat gtcagacact acatgatgac tcaaggccaa taataaagac atttcctacc tgcacaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaa mRNA sequence of mouse NR2F6 Genbank ID BC008138.1: (SEQ ID NO:4) cggacgcgtg ggcgggggcg cccgcgcgcg ctcggatggt gagccactaa gttggcctgg gcggcggggc cgggccatgg cccccgcgac gctaccgggt ccccaggact ccggaccacg ggacctgggc gccccagact cgcgcctcta gcgcgccccc gtcgaccgcg ggcacgcgtg ggaaagttgg cctggaaccg gcccgaccag ttcctgcctg gcgcgcggac cggccgcagg aagttgccgc aaaacttttt tcaggggggt gtgcgaccgg agccccccga gagcgcgggc tgcatgcgcc cggggtagcc gggtccctct cgggtcgcca ggcgtgccca gaggggacgg actcgtcccg gggcgtcccg gccccgctgt ctccggggct atggccatgg tgaccggtgg ctggggcgac cccggaggcg acacgaacgg cgtggacaag gctggtggga gctacccacg cgcgaccgag gacgattcgg cgtcacctcc cggggcgacc agcgacgcgg agccgggcga cgaggagcgt ccggggttgc aggtggactg cgtggtgtgc ggggacaagt ccagtggaaa gcattacggc gtgttcacct gcgagggctg caagagtttc ttcaagcgca gcatccgccg caatctcagc tacacctgcc ggtccaaccg tgactgtcag attgatcagc accaccggaa ccagtgtcag tactgtcggc tcaagaagtg cttccgggtg ggcatgcgca aggaggccgt gcagcgaggc cgcatcccgc atgcgctccc cggtccagcg gcctgcagtc ccccgggcgc gacgggcgtc gaacctttca cggggccgcc agtgtccgag ctgattgcgc agctgctgcg tgctgagccc taccccgcgg ccggacgctt tggtggcggc ggcgctgtac tgggcatcga caacgtgtgc gagttggcgg cacgcctgct gttcagcacg gtcgagtggg cccgccacgc gcccttcttc cccgagctgc cggccgccga ccaggtggcg ctgctgcggc tcagctggag tgagctcttc gtgctgaacg cggcgcaggc ggcgctgccg ctgcatacgg caccgctgct ggccgccgcg gggttgcatg ccgcgcccat ggcagccgag cgggccgtgg ccttcatgga ccaggtgcgt gccttccagg agcaggtgga caagctgggc cgcctgcagg tggatgctgc ggagtacggc tgcctcaagg ccatcgcgct cttcacgcct gatgcctgtg gcctttctga cccagcccat gtggagagcc tgcaggagaa ggcacaggtg gccctcaccg agtatgtgcg tgcccagtac ccatcgcagc cccagcgctt tgggcgtctg ctgctgcggc tgccagccct gcgtgctgtg cccgcatccc tcatctccca gctcttcttc atgcgcctgg tgggcaagaC acccatcgag accctcatcc gggacatgct tctgtcaggg agcaccttta actggcccta tggctcgggc tagtgatagt caccttccag gacacacatg gaaactgggg ccttgtgggg accctgggga tcagggcccc agcttctctt ttgagactga tttctttttt taaagactgt gaaatgtttg ttttgtttta ttttttaaat aatcatgaaa ccaaaaagat ttggatctcc caggccctag ccttgtcctg gcagaccttc aacagtctgg agccagcatg ctggtgcctc tggtgtcatg ggtatctgga aaggccactg cagctaggca ggagtactat gggccaggag gatcccctgg atacatggtc cacggagggc accatgggat gatgaaaacc tggccaataa taaaggtatt cccttaaaaa aaaaaaaaaa aaaaaaaaa Protein sequence of human NR2F6 (SEQ ID NO: 2) mamvtggwgg pggdtngvdk aggypraaed dsasppgaas daepgdeerp glqvdcvvcg dkssgkhygv ftcegcksff krsirrnlsy tcrsnrdcqi dqhhrnqcqy crlkkcfrvg mrkeavqrgr iphslpgava assgsppgsa laavasggdl fpgqpvseli aqllraepyp aaagrfgagg gaagavlgid nvcelaarll fstvewarha pffpelpvad qvallrlsws elfvlnaaqa alplhtapll aaaglhaapm aaeravafmd qvrafqeqvd klgrlqvdsa eygclkaial ftpdacglsd pahveslqek aqvalteyvr aqypsqpqrf grlllrlpal ravpaslisq lffmrlvgkt pietlirdml lsgstfnwpy gsgq Protein sequence of mouse NR2F6 (SEQ ID NO: 3) mamvtggwgd pggdtngvdk aggsyprate ddsasppgat sdaepgdeer pglqvdcvvc gdkssgkhyg vftcegcksf fkrsirrnls ytcrsnrdcq idqhhrnqcq ycrlkkcfrv gmrkeavqrg riphalpgpa acsppgatgv epftgppvse liaqllraep ypaagrfggg gavlgidnvc elaarllfst vewarhapff pelpaadqva llrlswself vlnaaqaalp lhtapllaaa glhaapmaae ravafmdqvr afqeqvdklg rlqvdaaeyq clkaialftp dacglsdpah veslqekaqv alteyvraqy psqpqrfgrl llrlpalrav paslisqlff mrlvgktpie tlirdmllsg stfnwpygsg Mus shNR2F6 sequence (SEQ ID NO: 5) GATCCGCATTACGGCGTGTTCACCTTCAAGAGAGGTGAACACGCCGTAAT GCTTTTTTCTAGAG Human shNR2F6 sequence (SEQ ID NO: 6) GATCCGCATTACGGTGTCTTCACCTTCAAGAGAGGTGAAGACACCGTAAT GCTTTTTTCTAGAG

Sequence CWU 1

1

1011783DNAHomo sapiens 1cgagaggggt gcccggaggg aagagcgcgg tgggggcgcc ccggccccgc tgccctgggg 60ctatggccat ggtgaccggc ggctggggcg gccccggcgg cgacacgaac ggcgtggaca 120aggcgggcgg ctacccgcgc gcggccgagg acgactcggc ctcgcccccc ggtgccgcca 180gcgacgccga gccgggcgac gaggagcggc cggggctgca ggtggactgc gtggtgtgcg 240gggacaagtc gagcggcaag cattacggtg tcttcacctg cgagggctgc aagagctttt 300tcaagcgaag catccgccgc aacctcagct acacctgccg gtccaaccgt gactgccaga 360tcgaccagca ccaccggaat cagtgccagt actgccgtct caagaagtgc ttccgggtgg 420gcatgaggaa ggaggcggtg cagcgcggcc gcatcccgca ctcgctgcct ggtgccgtgg 480ccgcctcctc gggcagcccc ccgggctcgg cgctggcggc agtggcgagc ggcggagacc 540tcttcccggg gcagccggtg tccgaactga tcgcgcagct gctgcgcgct gagccctacc 600ctgcggcggc cggacgcttc ggcgcagggg gcggcgcggc gggcgcagtg ctgggcatcg 660acaacgtgtg cgagctggcg gcgcggctgc tcttcagcac cgtggagtgg gcgcgccacg 720cgcccttctt ccccgagctg ccggtggccg accaggtggc gctgctgcgc ctgagctgga 780gcgagctctt cgtgctgaac gcggcgcagg cggcgctgcc cctgcacacg gcgccgctac 840tggccgccgc cggcctccac gccgcgccta tggccgccga gcgcgccgtg gctttcatgg 900accaggtgcg cgccttccag gagcaggtgg acaagctggg ccgcctgcag gtcgactcgg 960ccgagtatgg ctgcctcaag gccatcgcgc tcttcacgcc cgacgcctgt ggcctctcag 1020acccggccca cgttgagagc ctgcaggaga aggcgcaggt ggccctcacc gagtatgtgc 1080gggcgcagta cccgtcccag ccccagcgct tcgggcgcct gctgctgcgg ctccccgccc 1140tgcgcgcggt ccctgcctcc ctcatctccc agctgttctt catgcgcctg gtggggaaga 1200cgcccattga gacactgatc agagacatgc tgctgtcggg gagtaccttc aactggccct 1260acggctcggg ccagtgacca tgacggggcc acgtgtgctg tggccaggcc tgcagacaga 1320cctcaaggga cagggaatgc tgaggcctcg aggggcctcc cggggcccag gactctggct 1380tctctcctca gacttctatt ttttaaagac tgtgaaatgt ttgtcttttc tgttttttaa 1440atgatcatga aaccaaaaag agactgatca tccaggcctc agcctcatcc tccccaggac 1500ccctgtccag gatggagggt ccaatcctag gacagccttg ttcctcagca cccctagcat 1560gaacttgtgg gatggtgggg ttggcttccc tggcatgatg gacaaaggcc tggcgtcggc 1620cagaggggct gctccagtgg gcaggggtag ctagcgtgtg ccaggcagat cctctggaca 1680cgtaacctat gtcagacact acatgatgac tcaaggccaa taataaagac atttcctacc 1740tgcacaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaa 17832404PRTHomo sapiens 2Met Ala Met Val Thr Gly Gly Trp Gly Gly Pro Gly Gly Asp Thr Asn1 5 10 15Gly Val Asp Lys Ala Gly Gly Tyr Pro Arg Ala Ala Glu Asp Asp Ser 20 25 30Ala Ser Pro Pro Gly Ala Ala Ser Asp Ala Glu Pro Gly Asp Glu Glu 35 40 45Arg Pro Gly Leu Gln Val Asp Cys Val Val Cys Gly Asp Lys Ser Ser 50 55 60Gly Lys His Tyr Gly Val Phe Thr Cys Glu Gly Cys Lys Ser Phe Phe65 70 75 80Lys Arg Ser Ile Arg Arg Asn Leu Ser Tyr Thr Cys Arg Ser Asn Arg 85 90 95Asp Cys Gln Ile Asp Gln His His Arg Asn Gln Cys Gln Tyr Cys Arg 100 105 110Leu Lys Lys Cys Phe Arg Val Gly Met Arg Lys Glu Ala Val Gln Arg 115 120 125Gly Arg Ile Pro His Ser Leu Pro Gly Ala Val Ala Ala Ser Ser Gly 130 135 140Ser Pro Pro Gly Ser Ala Leu Ala Ala Val Ala Ser Gly Gly Asp Leu145 150 155 160Phe Pro Gly Gln Pro Val Ser Glu Leu Ile Ala Gln Leu Leu Arg Ala 165 170 175Glu Pro Tyr Pro Ala Ala Ala Gly Arg Phe Gly Ala Gly Gly Gly Ala 180 185 190Ala Gly Ala Val Leu Gly Ile Asp Asn Val Cys Glu Leu Ala Ala Arg 195 200 205Leu Leu Phe Ser Thr Val Glu Trp Ala Arg His Ala Pro Phe Phe Pro 210 215 220Glu Leu Pro Val Ala Asp Gln Val Ala Leu Leu Arg Leu Ser Trp Ser225 230 235 240Glu Leu Phe Val Leu Asn Ala Ala Gln Ala Ala Leu Pro Leu His Thr 245 250 255Ala Pro Leu Leu Ala Ala Ala Gly Leu His Ala Ala Pro Met Ala Ala 260 265 270Glu Arg Ala Val Ala Phe Met Asp Gln Val Arg Ala Phe Gln Glu Gln 275 280 285Val Asp Lys Leu Gly Arg Leu Gln Val Asp Ser Ala Glu Tyr Gly Cys 290 295 300Leu Lys Ala Ile Ala Leu Phe Thr Pro Asp Ala Cys Gly Leu Ser Asp305 310 315 320Pro Ala His Val Glu Ser Leu Gln Glu Lys Ala Gln Val Ala Leu Thr 325 330 335Glu Tyr Val Arg Ala Gln Tyr Pro Ser Gln Pro Gln Arg Phe Gly Arg 340 345 350Leu Leu Leu Arg Leu Pro Ala Leu Arg Ala Val Pro Ala Ser Leu Ile 355 360 365Ser Gln Leu Phe Phe Met Arg Leu Val Gly Lys Thr Pro Ile Glu Thr 370 375 380Leu Ile Arg Asp Met Leu Leu Ser Gly Ser Thr Phe Asn Trp Pro Tyr385 390 395 400Gly Ser Gly Gln3390PRTMus musculus 3Met Ala Met Val Thr Gly Gly Trp Gly Asp Pro Gly Gly Asp Thr Asn1 5 10 15Gly Val Asp Lys Ala Gly Gly Ser Tyr Pro Arg Ala Thr Glu Asp Asp 20 25 30Ser Ala Ser Pro Pro Gly Ala Thr Ser Asp Ala Glu Pro Gly Asp Glu 35 40 45Glu Arg Pro Gly Leu Gln Val Asp Cys Val Val Cys Gly Asp Lys Ser 50 55 60Ser Gly Lys His Tyr Gly Val Phe Thr Cys Glu Gly Cys Lys Ser Phe65 70 75 80Phe Lys Arg Ser Ile Arg Arg Asn Leu Ser Tyr Thr Cys Arg Ser Asn 85 90 95Arg Asp Cys Gln Ile Asp Gln His His Arg Asn Gln Cys Gln Tyr Cys 100 105 110Arg Leu Lys Lys Cys Phe Arg Val Gly Met Arg Lys Glu Ala Val Gln 115 120 125Arg Gly Arg Ile Pro His Ala Leu Pro Gly Pro Ala Ala Cys Ser Pro 130 135 140Pro Gly Ala Thr Gly Val Glu Pro Phe Thr Gly Pro Pro Val Ser Glu145 150 155 160Leu Ile Ala Gln Leu Leu Arg Ala Glu Pro Tyr Pro Ala Ala Gly Arg 165 170 175Phe Gly Gly Gly Gly Ala Val Leu Gly Ile Asp Asn Val Cys Glu Leu 180 185 190Ala Ala Arg Leu Leu Phe Ser Thr Val Glu Trp Ala Arg His Ala Pro 195 200 205Phe Phe Pro Glu Leu Pro Ala Ala Asp Gln Val Ala Leu Leu Arg Leu 210 215 220Ser Trp Ser Glu Leu Phe Val Leu Asn Ala Ala Gln Ala Ala Leu Pro225 230 235 240Leu His Thr Ala Pro Leu Leu Ala Ala Ala Gly Leu His Ala Ala Pro 245 250 255Met Ala Ala Glu Arg Ala Val Ala Phe Met Asp Gln Val Arg Ala Phe 260 265 270Gln Glu Gln Val Asp Lys Leu Gly Arg Leu Gln Val Asp Ala Ala Glu 275 280 285Tyr Gly Cys Leu Lys Ala Ile Ala Leu Phe Thr Pro Asp Ala Cys Gly 290 295 300Leu Ser Asp Pro Ala His Val Glu Ser Leu Gln Glu Lys Ala Gln Val305 310 315 320Ala Leu Thr Glu Tyr Val Arg Ala Gln Tyr Pro Ser Gln Pro Gln Arg 325 330 335Phe Gly Arg Leu Leu Leu Arg Leu Pro Ala Leu Arg Ala Val Pro Ala 340 345 350Ser Leu Ile Ser Gln Leu Phe Phe Met Arg Leu Val Gly Lys Thr Pro 355 360 365Ile Glu Thr Leu Ile Arg Asp Met Leu Leu Ser Gly Ser Thr Phe Asn 370 375 380Trp Pro Tyr Gly Ser Gly385 39041959DNAMus musculus 4cggacgcgtg ggcgggggcg cccgcgcgcg ctcggatggt gagccactaa gttggcctgg 60gcggcggggc cgggccatgg cccccgcgac gctaccgggt ccccaggact ccggaccacg 120ggacctgggc gccccagact cgcgcctcta gcgcgccccc gtcgaccgcg ggcacgcgtg 180ggaaagttgg cctggaaccg gcccgaccag ttcctgcctg gcgcgcggac cggccgcagg 240aagttgccgc aaaacttttt tcaggggggt gtgcgaccgg agccccccga gagcgcgggc 300tgcatgcgcc cggggtagcc gggtccctct cgggtcgcca ggcgtgccca gaggggacgg 360actcgtcccg gggcgtcccg gccccgctgt ctccggggct atggccatgg tgaccggtgg 420ctggggcgac cccggaggcg acacgaacgg cgtggacaag gctggtggga gctacccacg 480cgcgaccgag gacgattcgg cgtcacctcc cggggcgacc agcgacgcgg agccgggcga 540cgaggagcgt ccggggttgc aggtggactg cgtggtgtgc ggggacaagt ccagtggaaa 600gcattacggc gtgttcacct gcgagggctg caagagtttc ttcaagcgca gcatccgccg 660caatctcagc tacacctgcc ggtccaaccg tgactgtcag attgatcagc accaccggaa 720ccagtgtcag tactgtcggc tcaagaagtg cttccgggtg ggcatgcgca aggaggccgt 780gcagcgaggc cgcatcccgc atgcgctccc cggtccagcg gcctgcagtc ccccgggcgc 840gacgggcgtc gaacctttca cggggccgcc agtgtccgag ctgattgcgc agctgctgcg 900tgctgagccc taccccgcgg ccggacgctt tggtggcggc ggcgctgtac tgggcatcga 960caacgtgtgc gagttggcgg cacgcctgct gttcagcacg gtcgagtggg cccgccacgc 1020gcccttcttc cccgagctgc cggccgccga ccaggtggcg ctgctgcggc tcagctggag 1080tgagctcttc gtgctgaacg cggcgcaggc ggcgctgccg ctgcatacgg caccgctgct 1140ggccgccgcg gggttgcatg ccgcgcccat ggcagccgag cgggccgtgg ccttcatgga 1200ccaggtgcgt gccttccagg agcaggtgga caagctgggc cgcctgcagg tggatgctgc 1260ggagtacggc tgcctcaagg ccatcgcgct cttcacgcct gatgcctgtg gcctttctga 1320cccagcccat gtggagagcc tgcaggagaa ggcacaggtg gccctcaccg agtatgtgcg 1380tgcccagtac ccatcgcagc cccagcgctt tgggcgtctg ctgctgcggc tgccagccct 1440gcgtgctgtg cccgcatccc tcatctccca gctcttcttc atgcgcctgg tgggcaagac 1500acccatcgag accctcatcc gggacatgct tctgtcaggg agcaccttta actggcccta 1560tggctcgggc tagtgatagt caccttccag gacacacatg gaaactgggg ccttgtgggg 1620accctgggga tcagggcccc agcttctctt ttgagactga tttctttttt taaagactgt 1680gaaatgtttg ttttgtttta ttttttaaat aatcatgaaa ccaaaaagat ttggatctcc 1740caggccctag ccttgtcctg gcagaccttc aacagtctgg agccagcatg ctggtgcctc 1800tggtgtcatg ggtatctgga aaggccactg cagctaggca ggagtactat gggccaggag 1860gatcccctgg atacatggtc cacggagggc accatgggat gatgaaaacc tggccaataa 1920taaaggtatt cccttaaaaa aaaaaaaaaa aaaaaaaaa 1959564DNAArtificial SequenceMus shNR2F6 sequence 5gatccgcatt acggcgtgtt caccttcaag agaggtgaac acgccgtaat gcttttttct 60agag 64664DNAArtificial SequenceHuman shNR2F6 sequence 6gatccgcatt acggtgtctt caccttcaag agaggtgaag acaccgtaat gcttttttct 60agag 64721DNAArtificial SequencePrimer 7tctcccagct gttcttcatg c 21820DNAArtificial SequencePrimer 8ccagttgaag gtactccccg 20920DNAArtificial SequencePrimer 9ggcctccaag gagtaagacc 201020DNAArtificial SequencePrimer 10aggggtctac atggcaactg 20

Claims

1. A method of modulating stem cell growth, proliferation and differentiation comprising administering an effective amount of a NR2F6 modulator to a cell or animal in need thereof.

2. The method of claim 1, wherein the NR2F6 modulator comprises a NR2F6 inhibitor.

3. The method of claim 2, for inhibiting self-renewal of stem cells or for inducing terminal differentiation of stem cells.

4. The method of claim 3, wherein the stem cells are cancer stem cells, leukemia stem cells or myelodysplastic stem cells.

5. The method of claim 2 for treating or preventing a hematologic condition or the progression of a hematological condition.

6. The method of claim 5, wherein the hematologic condition is acute leukemia, chronic leukemia or myelodysplastic syndrome.

7. The method of claim 2 for inducing differentiation of granulocytic, erythroid or megakaryocytic lineages for the treatment of cytopenia.

8. The method of claim 2 for reducing the number of progenitor cells for treating conditions associated with leukocytosis.

9. The method of claim 2 for potentiating retinoic acid signaling.

10. The method of claim 2 for treating disorders characterized by excessive or hyperactive mast cells.

11. The method of claim 2, wherein the NR2F6 inhibitor is an antisense nucleic acid sequence of the gene encoding NR2F6 as shown in SEQ ID NO: 1 or 4 or variants thereof.

12. The method of claim 2, wherein the NR2F6 inhibitor is a blocking antibody that binds the NR2F6 amino acid sequence as shown in SEQ ID NO:2 or SEQ ID NO:3.

13. The method of claim 2, wherein the NR2F6 inhibitor is a shRNA molecule that inhibits expression of NR2F6.

14. The method of claim 13, wherein the shRNA molecule comprises the nucleic acid sequence as shown in SEQ ID NO:5 or 6.

15. The method of claim 1, wherein the NR2F6 modulator comprises a NR2F6 activator.

16. The method of claim 15 for stem cell expansion.

17. The method of claim 16, wherein the stem cells are hematopoietic stem cells.

18. The method of claim 17, wherein the stem cells are derived from peripheral blood, bone marrow, umbilical cord blood, embryonic stem cells or menstrual blood.

19. The method of claim 16 for bone marrow transplantation or cell therapies.

20. The method of claim 15, for repressing retinoic acid signaling.

21. The method of claim 1, wherein the animal is a mammal.

22. The method of claim 21, wherein the mammal is human.

23. A pharmaceutical composition comprising a NR2F6 modulator and a pharmaceutically acceptable carrier or diluent.

24. A method of monitoring a hematological condition comprising: a) determining the level of NR2F6 expression in a sample from a subject; and b) comparing the level of expression of NR2F6 in the sample with a control; wherein an increase in expression of NR2F6 in the sample from the subject as compared to the control is indicative of a hematological condition.

25. A shRNA molecule comprising the sequence as shown in SEQ ID NO:5 or 6.