U.S. patent application number 12/619290 was filed with the patent office on 2010-06-03 for modulation of nr2f6 and methods and uses thereof.
Invention is credited to Christine Victoria Ichim, Richard Alexander Wells.
Application Number | 20100135990 12/619290 |
Document ID | / |
Family ID | 42223022 |
Filed Date | 2010-06-03 |
United States Patent
Application |
20100135990 |
Kind Code |
A1 |
Ichim; Christine Victoria ;
et al. |
June 3, 2010 |
Modulation of NR2F6 and methods and uses thereof
Abstract
The disclosure provides methods of modulating NR2F6 in a cell or
animal in need thereof by administering an effective amount of a
NR2F6 modulator.
Inventors: |
Ichim; Christine Victoria;
(Kitchener, CA) ; Wells; Richard Alexander;
(Toronto, CA) |
Correspondence
Address: |
BERESKIN AND PARR LLP/S.E.N.C.R.L., s.r.l.
40 KING STREET WEST, BOX 401
TORONTO
ON
M5H 3Y2
CA
|
Family ID: |
42223022 |
Appl. No.: |
12/619290 |
Filed: |
November 16, 2009 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
61114764 |
Nov 14, 2008 |
|
|
|
Current U.S.
Class: |
424/130.1 ;
435/29; 435/375; 435/377; 514/44A; 514/44R; 536/23.1 |
Current CPC
Class: |
G01N 2333/70567
20130101; G01N 2800/22 20130101; G01N 33/6875 20130101; G01N
33/6872 20130101; G01N 33/57426 20130101; A61K 31/7088 20130101;
A61K 31/00 20130101 |
Class at
Publication: |
424/130.1 ;
435/377; 435/375; 514/44.R; 514/44.A; 435/29; 536/23.1 |
International
Class: |
A61K 39/395 20060101
A61K039/395; C12N 5/02 20060101 C12N005/02; A61K 31/7088 20060101
A61K031/7088; C12Q 1/02 20060101 C12Q001/02; C07H 21/02 20060101
C07H021/02 |
Claims
1. A method of modulating stem cell growth, proliferation and
differentiation comprising administering an effective amount of a
NR2F6 modulator to a cell or animal in need thereof.
2. The method of claim 1, wherein the NR2F6 modulator comprises a
NR2F6 inhibitor.
3. The method of claim 2, for inhibiting self-renewal of stem cells
or for inducing terminal differentiation of stem cells.
4. The method of claim 3, wherein the stem cells are cancer stem
cells, leukemia stem cells or myelodysplastic stem cells.
5. The method of claim 2 for treating or preventing a hematologic
condition or the progression of a hematological condition.
6. The method of claim 5, wherein the hematologic condition is
acute leukemia, chronic leukemia or myelodysplastic syndrome.
7. The method of claim 2 for inducing differentiation of
granulocytic, erythroid or megakaryocytic lineages for the
treatment of cytopenia.
8. The method of claim 2 for reducing the number of progenitor
cells for treating conditions associated with leukocytosis.
9. The method of claim 2 for potentiating retinoic acid
signaling.
10. The method of claim 2 for treating disorders characterized by
excessive or hyperactive mast cells.
11. The method of claim 2, wherein the NR2F6 inhibitor is an
antisense nucleic acid sequence of the gene encoding NR2F6 as shown
in SEQ ID NO: 1 or 4 or variants thereof.
12. The method of claim 2, wherein the NR2F6 inhibitor is a
blocking antibody that binds the NR2F6 amino acid sequence as shown
in SEQ ID NO:2 or SEQ ID NO:3.
13. The method of claim 2, wherein the NR2F6 inhibitor is a shRNA
molecule that inhibits expression of NR2F6.
14. The method of claim 13, wherein the shRNA molecule comprises
the nucleic acid sequence as shown in SEQ ID NO:5 or 6.
15. The method of claim 1, wherein the NR2F6 modulator comprises a
NR2F6 activator.
16. The method of claim 15 for stem cell expansion.
17. The method of claim 16, wherein the stem cells are
hematopoietic stem cells.
18. The method of claim 17, wherein the stem cells are derived from
peripheral blood, bone marrow, umbilical cord blood, embryonic stem
cells or menstrual blood.
19. The method of claim 16 for bone marrow transplantation or cell
therapies.
20. The method of claim 15, for repressing retinoic acid
signaling.
21. The method of claim 1, wherein the animal is a mammal.
22. The method of claim 21, wherein the mammal is human.
23. A pharmaceutical composition comprising a NR2F6 modulator and a
pharmaceutically acceptable carrier or diluent.
24. A method of monitoring a hematological condition comprising: a)
determining the level of NR2F6 expression in a sample from a
subject; and b) comparing the level of expression of NR2F6 in the
sample with a control; wherein an increase in expression of NR2F6
in the sample from the subject as compared to the control is
indicative of a hematological condition.
25. A shRNA molecule comprising the sequence as shown in SEQ ID
NO:5 or 6.
Description
RELATED APPLICATIONS
[0001] This application claims the benefit under 35 USC
.sctn.119(e) of U.S. provisional application No. 61/114,764 filed
Nov. 14, 2008, which is incorporated herein in its entirety.
FIELD
[0002] The present disclosure relates to methods and compositions
for modulating NR2F6 for therapeutic applications. In particular,
the disclosure relates to methods and compositions comprising
modulators of NR2F6 for modulating stem cell growth, proliferation
and differentiation and for treating associated conditions and
diseases.
BACKGROUND
[0003] Primary cancer cells exhibit heterogeneity in clonogenicity,
the capacity to proliferate and form colonies in vitro. The cancer
stem cell (CSC) model accounts for this heterogeneity by proposing
that each cancer consists of a small population of cells capable of
unlimited growth and self-renewal, known as CSCs, and a much larger
population of cells, descendants of the CSCs, that have lost
self-renewal capacity and are undergoing terminal differentiation.
Evidence supporting this model has been reported for several
malignancies including acute myelogenous leukemia, brain cancer and
breast cancer. The CSC model has important implications for cancer
therapy; eradication of CSCs, the cells responsible for maintenance
of the neoplasm, would be necessary and sufficient to achieve
cure.
[0004] Myelodysplastic syndrome (MDS) is a clonal disorder of
haematopoietic tissue, characterized by peripheral blood
cytopenias, apoptosis of bone marrow haematopoietic progenitors,
abnormal blood cell morphology (dysplasia) and a marked propensity
to evolve into acute leukemia. The central paradox of MDS biology
resides in the observation that the MDS clone, which is
characterized by reduced numbers of mature progeny and by maturing
progenitors that exhibit impaired clonogenicity and a high rate of
apoptosis, nonetheless comes to dominate the bone marrow at the
expense of residual normal haematopoiesis and thereby causes
disease. The cancer stem cell model suggests a resolution to this
paradox, namely that the MDS clone, despite the defects seen in its
differentiating members, out-competes normal haematopoiesis because
of a selective advantage at the stem cell level. It is hypothesized
that this competitive advantage consists in an increased capacity
of MDS stem cells for self-renewal.
[0005] The natural history of MDS is highly heterogenous, with some
cases causing chronic cytopenias and others rapidly progressing to
acute leukemia. Patients diagnosed with MDS have a life expectancy
of 6 months to 5 years, and despite the recent development of some
promising new therapies that offer hope for a small subset of
patients with MDS, the mainstay of treatment for this disease
remains supportive for palliative care with blood transfusion.
Thus, most patients diagnosed with MDS face the prospect of a
shortened life expectancy, impaired quality of life because of
dependency on transfusions, and dread and uncertainty regarding the
onset of acute leukemia.
[0006] Acute leukemia (AL) is an aggressive cancer of the blood
forming cells in the bone marrow. It may arise secondary to
preexisting hematopoietic conditions such as MDS, or de novo.
Despite the many advances made in the understanding of leukemia
biology over the past three decades, therapy for AML remains, in
most cases, debilitating and ineffective. Further progress in
improving the efficacy of anti-leukemia therapy hinges upon the
identification of methods that allow for the targeting of the
leukemia stem cell. Leukemia is a disease characterised by
impairment of differentiation. Leukemia stem cells are the culprit
of the disease. These rare cells (<1% of the population) are the
only leukemia cells that are immortal. These cells are responsible
for the initiation and maintenance of the leukemia. Eradication of
the leukemia stem cell therefore, would be necessary and sufficient
for cure. The rest of the leukemia cells in an AML patient are
non-stem leukemia cells, these comprise the vast majority of the
patient's leukemia cell burden. Non-stem leukemia cells are
"benign" cells that either have a finite ability to divide or have
lost the ability to divide altogether. Non-stem leukemia cells
arise from the differentiation of leukemia stem cells. In contrast
to current therapies that target both leukemia stem and non-stem
cells, differentiation therapy aims at inhibiting the ability of
leukemia stem cells to self-renew and inducing the differentiation
of leukemia stem cells into non-stem leukemia cells.
Differentiation therapy promises to be much more effective,
selective and less toxic than chemotherapy.
[0007] NR2F6, known also as EAR-2, is an orphan nuclear receptor
and a member of the chicken ovalbumin upstream promoter (COUP)
family of nuclear receptors. The nuclear receptors (NRs) comprise a
very large family of ligand activated transcription factors.
Multiple lines of evidence suggest a role for NR signalling in the
transcriptional regulation of haematopoiesis. Acute promyelocytic
leukemia is invariably associated with gene fusions involving the
retinoic acid receptor .alpha. (RAR.alpha.) and one of five
different partners, PML, PLZF, NPM, NuMA, and STAT5b. Patients with
this disease respond to treatment with the RAR.alpha. ligand, all
trans retinoic acid (ATRA). Dominant negative mutants of RAR.alpha.
enhance mast cell development and reduce granulocyte and macrophage
development in multipotential haematopoietic cell lines, and also
block myeloid development in transduced murine bone marrow.
Although targeted disruption of RAR.alpha. in the mouse has little
effect on haematopoiesis, in vitro studies revealed an increased
proportion of morphologically immature granulocytes in
RAR.alpha.1/RAR.gamma. double mutants. In addition to this, in
vitro studies suggest a role for the thyroid hormone receptor in
erythropoiesis and for the PPAR.gamma. in monocyte/macrophage
development. A role for the vitamin D receptor in myeloid
differentiation is suggested by 1,25-dihydroxyvitamin D3-induced
terminal differentiation and cell cycle arrest of a variety of
leukaemic cell lines. Although little is known of the downstream
genes regulated by NRs in haematopoiesis, evidence suggests that
the cdk inhibitor p21 and the transcription factor C/EBP.epsilon.
may be targets of RAR.alpha. in myelopoiesis.
[0008] NR2F6, known also as EAR-2, is an orphan nuclear receptor
that was cloned in a search for homologues of the retroviral
oncogene v-erbA using low stringency hybridization (see Miyajima,
N., et al., (Identification of two novel members of erbA
superfamily by molecular cloning: the gene products of the two are
highly related to each other. Nucleic Acids Res, 16(23): p.
11057-74. 1988)). EAR-2 is a member of the chicken ovalbumin
upstream promoter (COUP) family of nuclear receptors. The COUPs
function in vitro as transcriptional repressors, antagonizing the
activation ability of a wide range of nuclear receptors that play
prominent roles in differentiation. Accordingly, aberrant
expression of COUP-TFI inhibits retinoid-induced epithelial and
neuronal differentiation in vitro (Please see Kyakumoto, S., M.
Ota, and N. Sato (Inhibition of retinoic acid-inducible
transcription by COUP-TFI in human salivary gland adenocarcinoma
cell line HSG. Biochem Cell Biol, 77(6): p. 515-26. 1999), Neuman,
K., et al., (Orphan receptor COUP-TF I antagonizes retinoic
acid-induced neuronal differentiation. J Neurosci Res, 41(1): p.
39-48. 1995) and Adam, F., et al., (COUP-TFI (chicken ovalbumin
upstream promoter-transcription factor I) regulates cell migration
and axogenesis in differentiating P19 embryonal carcinoma cells.
Mol Endocrinol, 14(12): p. 1918-33. 2000)). The roles of COUP-TFI
and COUP-TFII in mammalian development have been studied by
targeted deletion in the mouse. COUP-TFI deficient mice exhibit
numerous defects in axonal development, including failure of
development of the nucleus of the 9th cranial nerve. COUP-TFII
deletion causes widespread defects in angiogenesis and cardiac
development, leading to embryonic lethality in mid-gestation.
Seven-up (svp), the Drosophila COUP family homologue, is also
important in embryonic development; with null mutations of seven-up
being embryonic lethal. svp is involved in decisions of cell fate
determination during the development of the photoreceptors in the
ommatidium of the eye and regulates proliferation during the
development of the malpighian tubules by regulating the expression
of cell cycle regulators.
[0009] In contrast to the related proteins COUP-TFI and COUP-TFII,
the function of EAR-2 has not been well characterized. EAR-2
functions as a transcriptional repressor in vitro, inhibiting the
transactivating ability of numerous genes including the thyroid
hormone receptor (See Zhu, X. G. et al. (The orphan nuclear
receptor Ear-2 is a negative coregulator for thyroid hormone
nuclear receptor function. Mol Cell Biol 20, 2604-18. 2000)). Like
many nuclear receptors, EAR-2 heterodimerizes with the retinoid X
receptor-.alpha. (RXR-.alpha.), although the relevance of this
interaction in EAR-2 function is unclear (See Ladias, (J. A.
Convergence of multiple nuclear receptor signaling pathways onto
the long terminal repeat of human immunodeficiency virus-1. J Biol
Chem 269, 5944-51 1994)).
[0010] The role for EAR-2 in haematopoiesis has not been studied in
vivo. A previous study has shown interaction of NR2F6 with the key
haematopoietic transcription factor RUNX1 (also known as AML1) (See
Ahn et al. (Negative regulation of granulocytic differentiation in
the myeloid precursor cell line 32Dcl3 by ear-2, a mammalian
homolog of Drosophila seven-up, and a chimeric leukemogenic gene,
AML1/ETO. Proc Natl Acad Sci USA 95, 1812-7. 1998)). Targeted
deletion of RUNX1, a component of the core binding factor complex,
results in abrogation of definitive haematopoiesis and embryonic
lethality and RUNX1 rearrangements result from several commonly
seen chromosome translocations in acute leukemia. EAR-2 interacts
physically with RUNX1 and represses its transcriptional activating
ability in the murine myeloblast cell line 32Dcl3. The effect of
NR2F6 in primary mouse or human bone marrow, let alone in vivo is
unclear. EAR-2 is down regulated in 32Dcl3 cells induced to mature
with G-CSF, and forced expression of the EAR-2 protein blocks
32Dc13 differentiation.
[0011] The function of NR2F6 has not been well characterized. NR2F6
functions as a transcriptional repressor in vitro, inhibiting the
transactivating ability of numerous proteins including the thyroid
hormone receptor. Like many nuclear receptors, NR2F6
heterodimerizes with the retinoid X receptor-.alpha. (RXR-.alpha.),
although the relevance of this interaction in NR2F6 function is
unclear (See Ladias, J. A. (Convergence of multiple nuclear
receptor signaling pathways onto the long terminal repeat of human
immunodeficiency virus-1. J Biol Chem 269, 5944-51 1994)). A recent
report describes the initial characterization of an NR2F6 deficient
mouse generated by targeted disruption of the NR2F6 locus (See
Warnecke, M et al. (Abnormal development of the locus coeruleus in
Ear2(Nr2f6)-deficient mice impairs the functionality of the
forebrain clock and affects nociception. Genes Dev 19, 614-25
2005)). NR2F6 deficient mice are viable and fertile, but show
agenesis of the locus coeruleus, a midbrain nucleus that regulates
circadian behaviour and nociception. In situ mRNA hybridization in
NR2F6-/- animals places NR2F6 downstream of Mash1 and upstream of
Phox2a and Phox2b in the specification of the locus coeruleus.
Although NR2F6 expression is seen outside the central nervous
system, this report contains no description of any phenotypic
analysis outside the nervous system.
SUMMARY
[0012] The present inventors have found that the orphan nuclear
receptor NR2F6 is a regulator of blood stem cell self-renewal and
differentiation, and the maturation of healthy progenitor cells.
NR2F6 regulates self-renewal, differentiation and maturation in
states of pathology. This makes the modulation of NR2F6 an ideal
target for influencing the function of leukemia stem and progenitor
cells and myelodysplastic syndrome stem and progenitor cells.
[0013] Accordingly, in one aspect, the present disclosure provides
a method of modulating stem cell growth, proliferation and/or
differentiation comprising administering an effective amount of a
NR2F6 modulator to a cell or animal in need thereof.
[0014] In one embodiment, the NR2F6 modulator is a NR2F6 inhibitor.
Accordingly, in an embodiment, the present disclosure provides a
method of inhibiting self-renewal of stem cells and/or inducing
terminal differentiation of stem cells comprising administering an
effective amount of a NR2F6 inhibitor to a cell or animal in need
thereof.
[0015] In one embodiment, the inhibitor is an antisense nucleic
acid sequence of the gene encoding NR2F6 as shown in SEQ ID NO:1 or
4 or variants thereof. In another embodiment, the inhibitor is a
blocking antibody that binds the NR2F6 amino acid sequence as shown
in SEQ ID NO:2 or SEQ ID NO:3. In yet another embodiment, the
inhibitor is a shRNA molecule that inhibits expression of NR2F6,
optionally as shown in SEQ ID NO:5 or 6.
[0016] The stem cells may be cancer stem cells, leukemia stem cells
or myelodysplastic stem cells.
[0017] In one embodiment, the method is for treating or preventing
a hematologic condition. In an embodiment, treating a hematologic
condition comprises preventing the progression of the hematologic
condition.
[0018] In another embodiment, the hematologic condition is acute
leukemia, chronic leukemia or myelodysplastic syndrome.
[0019] In yet another embodiment, the method is for inducing
differentiation of granulocytic, erythroid or megakaryocytic
lineages.
[0020] In a further embodiment, the method is for reducing the
number of progenitor cells. In one embodiment, the method is for
treating conditions associated with leukocytosis.
[0021] In yet another embodiment, the method is for potentiating
retinoic acid signaling.
[0022] In yet a further embodiment, the method is for treating
disorders characterized by excessive or hyperactive mast cells.
[0023] In another aspect, the NR2F6 modulator is a NR2F6
activator.
[0024] Accordingly, in one embodiment, there is provided a method
of stem cell expansion comprising administering an effective amount
of a NR2F6 activator to a cell or animal in need thereof. In an
embodiment, the stem cells are hematopoietic stem cells. In another
embodiment, the stem cells are derived from peripheral blood, bone
marrow, umbilical cord blood, embryonic stem cells or menstrual
blood. In yet another embodiment, the method is used for bone
marrow transplantation or cell therapies.
[0025] In another embodiment, the method is for repressing retinoic
acid signaling.
[0026] In yet a further embodiment, the method is for treating
dermatitis.
[0027] In another aspect, the disclosure provides a shRNA molecule
comprising the sequence as shown in SEQ ID NO:5 or 6. In another
embodiment, the disclosure provides a shRNA molecule consisting of
the sequence as shown in SEQ ID NO:5 or 6.
[0028] Also provided are uses, pharmaceutical compositions and
diagnostic methods.
[0029] Other features and advantages of the present disclosure will
become apparent from the following detailed description. It should
be understood, however, that the detailed description and the
specific examples while indicating preferred embodiments of the
disclosure are given by way of illustration only, since various
changes and modifications within the spirit and scope of the
disclosure will become apparent to those skilled in the art from
this detailed description.
BRIEF DESCRIPTION OF THE DRAWINGS
[0030] The disclosure will now be described in relation to the
drawings in which:
[0031] FIG. 1 shows that NR2F6 is highly expressed in both long and
short term haematopoietic stem cells and that expression of NR2F6
in bone marrow from patients with acute myelogenous leukemia (AML),
chronic myelomonocytic leukemia (CMML) and myelodysplastic syndrome
(MDS) is greater compared to control. * denotes p<0.05 and **
denotes p<0.01 relative to normal (ANOVA & Tukey post-hoc
test).
[0032] FIG. 2 shows NR2F6 mRNA is expressed highly in immature U937
human leukemia cell line.
[0033] FIG. 3 shows overexpression of NR2F6 is able to override the
growth arrest associated with differentiation and maturation, in
particular maturation and differentiation induced by all-trans
retinoic acid.
[0034] FIG. 4 shows over-expression of NR2F6 enables the survival
and proliferation of mouse embryonic fibroblasts (MEFs) in low
serum (0.2% serum).
[0035] FIG. 5 shows over-expression of NR2F6 is able to inhibit the
differentiation and maturation of U937 human leukemia cells.
[0036] FIG. 6 shows over-expression of NR2F6 is able to inhibit the
differentiation and maturation of U937 human leukemia cells.
[0037] FIG. 7 shows NR2F6 over-expression inhibits the maturation
of healthy bone marrow.
[0038] FIG. 8 shows NR2F6 over-expression inhibits the maturation
of healthy bone marrow toward the myeloid lineage.
[0039] FIG. 9 shows NR2F6 over-expression in vivo increases bone
marrow cellularity, even when only a portion of the cells
over-express NR2F6.
[0040] FIG. 10 shows NR2F6 over-expression causes bone marrow
dysplasia.
[0041] FIG. 11 shows NR2F6 over-expression causes abnormal
localization of immature precursors (ALIP).
[0042] FIG. 12 shows NR2F6 over-expression inhibits myeloid
differentiation and maturation in vivo.
[0043] FIG. 13 shows NR2F6 over-expression inhibits blood cell
differentiation and maturation in vivo.
[0044] FIG. 14 shows NR2F6 over-expression produces an excess of
megakaryoctes.
[0045] FIG. 15 shows NR2F6 over-expression, even in a small subset
of bone marrow cells, eventually results in the generation of
leukemia.
[0046] FIG. 16 shows NR2F6 over-expression, even in a small subset
of bone marrow cells, results in the production of excessive
immature blast cells.
[0047] FIG. 17 shows NR2F6 over-expression, even in a small subset
of bone marrow cells, eventually results in the generation of
leukemia with infiltration of leukemia cells in the spleen and
liver.
[0048] FIG. 18 shows over-expression of NR2F6 in the bone marrow of
healthy animals resulted in a fatal hematological condition that
resembles human myelodysplastic syndrome and acute leukemia.
[0049] FIG. 19 shows that over-expression of NR2F6 in vivo causes
expansion of immature bone marrow blast cells.
[0050] FIG. 20 shows that over-expression of NR2F6 in vivo causes
expansion of bone marrow cells that express c-kit.
[0051] FIG. 21 shows that over-expression of NR2F6 in vivo causes
expansion of bone marrow cells that lack expression of antigens
associated with lineage commitment.
[0052] FIG. 22 shows that over-expression of NR2F6 in vivo causes
expansion of bone marrow cells with the stem cell phenotype c-kit+,
sca-1+, lineage-.
[0053] FIG. 23 shows over-expression of NR2F6 in the bone marrow of
healthy animals results in expansion of their hematopoietic stem
cell.
[0054] FIG. 24 shows that over-expression of NR2F6 enhances the in
vitro maintenance of bone marrow cells with the stem cell phenotype
c-kit+, sca-1+, lineage-.
[0055] FIG. 25 shows over-expression of NR2F6 in the bone marrow of
healthy animals enhances self-renewal in vivo.
[0056] FIG. 26 shows knock down of NR2F6 using short-hairpin RNAs
induces differentiation and maturation of 32Dcl3 mouse
hematopoietic cells.
[0057] FIG. 27 shows knock down of NR2F6 using short-hairpin RNAs
induces terminal differentiation, blood cell maturation death of
U937 human leukemia cells.
[0058] FIG. 28 shows that knock down of NR2F6 using short-hairpin
RNAs induces rapid depletion of immature bone marrow cells in ex
vivo culture.
[0059] FIG. 29 shows that knock down of NR2F6 using short-hairpin
RNAs induces rapid depletion of bone marrow cells with the stem
cell phenotype c-kit+, sca-1+, lineage- in ex vivo culture.
[0060] FIG. 30 shows that knock down of NR2F6 using short-hairpin
RNAs induces rapid differentiation of immature bone marrow
cells.
[0061] FIG. 31 shows morphologically that knock down of NR2F6
expression using short hairpin RNA (shNR2F6) reduces the number of
immature bone marrow cells (blast cells) and promotes
differentiation into mature cells in ex vivo suspension
culture.
[0062] FIG. 32 shows that NR2F6 can be modulated using histone
deacetylase inhibitors.
DETAILED DESCRIPTION
[0063] The term "NR2F6" as used herein refers to nuclear receptor
subfamily2, group F, member 6 and is also referred to as
v-erbA-related gene or ear-2 and includes, without limitation, the
protein encoded by the gene having the sequence as shown in SEQ ID
NO:1 (human) or SEQ ID NO:4 (mouse) or variants thereof and the
protein having the amino acid sequence as shown in SEQ ID NO:2
(human) or SEQ ID NO:3 (mouse) or variants thereof.
[0064] The term "a cell" as used herein includes a plurality of
cells and refers to all types of cells including hematopoietic and
cancer cells. Administering a compound to a cell includes in vivo,
ex vivo and in vitro treatment.
[0065] The term "stem cell" as used herein refers to a cell that
has the ability for self-renewal and can give rise to specialized
cells.
[0066] The term "effective amount" as used herein means a quantity
sufficient to, when administered to an animal, effect beneficial or
desired results, including clinical results, and as such, an
"effective amount" depends upon the context in which it is being
applied. For example, in the context of inhibiting self-renewal of
stem cells, it is the amount of the NR2F6 inhibitor sufficient to
achieve such an inhibition as compared to the response obtained
without administration of the NR2F6 inhibitor.
[0067] The term "nucleic acid molecule" is intended to include
unmodified DNA or RNA or modified DNA or RNA. For example, the
nucleic acid molecules or polynucleotides of the disclosure can be
composed of single- and double stranded DNA, DNA that is a mixture
of single- and double-stranded regions, single- and double-stranded
RNA, and RNA that is a mixture of single- and double-stranded
regions, hybrid molecules comprising DNA and RNA that may be
single-stranded or, more typically double-stranded or a mixture of
single- and double-stranded regions. In addition, the nucleic acid
molecules can be composed of triple-stranded regions comprising RNA
or DNA or both RNA and DNA. The nucleic acid molecules of the
disclosure may also contain one or more modified bases or DNA or
RNA backbones modified for stability or for other reasons.
"Modified" bases include, for example, tritiated bases and unusual
bases such as inosine. A variety of modifications can be made to
DNA and RNA; thus "nucleic acid molecule" embraces chemically,
enzymatically, or metabolically modified forms. The term
"polynucleotide" shall have a corresponding meaning.
[0068] The term "animal" as used herein includes all members of the
animal kingdom, optionally mammal. The term "mammal" as used herein
is meant to encompass, without limitation, humans, domestic animals
such as dogs, cats, horses, cattle, swine, sheep, goats, and the
like, as well as wild animals. In an embodiment, the mammal is
human.
Methods and Uses
[0069] The present inventors have found that NR2F6 is a regulator
of blood stem cell self-renewal and differentiation, and of the
maturation of healthy progenitor cells.
[0070] Accordingly, the present disclosure provides a method of
modulating stem cell growth, proliferation and/or differentiation
comprising administering an effective amount of a NR2F6 modulator
to a cell or animal in need thereof.
[0071] In one aspect, the NR2F6 modulator is a NR2F6 inhibitor. In
another aspect, the NR2F6 modulator is a NR2F6 activator.
[0072] Accordingly, the present disclosure provides a method of
inhibiting self-renewal of stem cells comprising administering an
effective amount of an inhibitor of NR2F6 to a cell or animal in
need thereof. The present disclosure also provides the use of a
NR2F6 inhibitor for inhibiting self-renewal of stem cells in a cell
or animal in need thereof. The present disclosure further provides
the use of a NR2F6 inhibitor in the preparation of a medicament for
inhibiting self-renewal of stem cells in a cell or animal in need
thereof. The present disclosure also provides a NR2F6 inhibitor for
use in inhibiting self-renewal of stem cells in a cell or animal in
need thereof.
[0073] In another embodiment, the present disclosure provides a
method of inducing terminal differentiation of stem cells
comprising administering an effective amount of an inhibitor of
NR2F6 to a cell or animal in need thereof. The present disclosure
also provides the use of a NR2F6 inhibitor for inducing terminal
differentiation of stem cells in a cell or animal in need thereof.
The present disclosure further provides the use of a NR2F6
inhibitor in the preparation of a medicament for inducing terminal
differentiation of stem cells in a cell or animal in need thereof.
The present disclosure also provides a NR2F6 inhibitor for use in
inducing terminal differentiation of stem cells in a cell or animal
in need thereof.
[0074] In one embodiment, the stem cells are cancer stem cells,
leukemia stem cells or myelodysplastic stem cells.
[0075] The term "inhibiting self renewal of stem cells" as used
herein includes but is not limited to preventing or decreasing the
clonal longevity, clonogenicity, serial replating ability,
clonogenic growth and/or transplantability of the stem cells.
[0076] The present inventors have also found that over-expression
of NR2F6 in the bone marrow of animals greatly enhanced
self-renewal ability of hematopoietic stem cells and resulted in
stem cell expansion. Accordingly, the present disclosure also
provides a method of stem cell expansion comprising administering
an effective amount of an activator of NR2F6 to a cell or animal in
need thereof. The present disclosure also provides the use of a
NR2F6 activator for stem cell expansion in a cell or animal in need
thereof. The present disclosure further provides the use of a NR2F6
activator in the preparation of a medicament for stem cell
expansion in a cell or animal in need thereof. The present
disclosure also provides a NR2F6 activator for use in activating
stem cell expansion in a cell or animal in need thereof.
[0077] The term "stem cell expansion" as used herein means the
maintenance, survival and/or proliferation of cells in an
undifferentiated state or inhibiting differentiation and includes
both ex vivo, in vitro and in vivo stem cell expansion. In one
embodiment, stem cell expansion is useful for bone marrow
transplantation and/or immunotherapy. In another embodiment, the
stem cells are hematopoietic stem cells, optionally from the
peripheral blood, bone marrow, umbilical cord blood, embryonic stem
cells or menstrual blood. Stem cell expansion is particularly
useful for bone marrow transplantation and/or cellular therapies,
including but not limited to generation of sufficient numbers of
leukocytes for the purposes of immunotherapy, transfusion
post-chemotherapy, treatment of HIV and AIDS. Stem cell expansion
is also useful for the expansion of autologous, allogeneic, cord
blood, peripheral blood or menstrual blood stem cells for the
transplantation following chemotherapy for the treatment of
leukemia, solid tumours and/or non-malignant disease including but
not limited to b-thalassaemia and sickle cell anemia. Expansion of
stem cells is optionally in combination with soluble factors
including but not limited to c-kit, IL-3, IL-11, flt-3 ligand,
IL-6, and/or TPO.
[0078] In one embodiment, a NR2F6 activator is administered to
suitable mammalian hematopoietic stem cells for maintaining the
stem cells in an undifferentiated state while stimulating their
expansion. Examples of suitable stem cells include haematopoietic
stem cells from the peripheral blood, bone marrow, umbilical cord
blood, embryonic stem cells or menstrual blood.
[0079] In another embodiment, a NR2F6 activator is administered to
suitable mammalian hematopoietic stem cells for maintaining the
stem cells in an undifferentiated state while stimulating their
expansion for the purposes of cellular therapies, including but not
limited to generation of sufficient numbers of leukocytes for the
purposes of immunotherapy, transfusion post-chemotherapy, and/or
treatment of HIV and AIDS.
[0080] In yet another embodiment, a NR2F6 activator is administered
to suitable mammalian hematopoietic stem cells for maintaining the
stem cells in an undifferentiated state while stimulating the
expansion of either autologous, allogeneic, cord blood, peripheral
blood, or menstrual blood stem cells for the transplantation
following chemotherapy for the treatment of leukemia.
[0081] In a further embodiment, a NR2F6 activator is administered
to suitable mammalian hematopoietic stem cells for maintaining the
stem cells in an undifferentiated state while stimulating the
expansion of either autologous, allogeneic, cord blood, peripheral
blood, or menstrual blood stem cells for the transplantation
following chemotherapy for the treatment of solid tumours.
[0082] In even yet another embodiment, a NR2F6 activator is
administered to suitable mammalian hematopoietic stem cells for
maintaining the stem cells in an undifferentiated state while
stimulating the expansion of either autologous, allogeneic, cord
blood, peripheral blood, or menstrual blood stem cells for the
transplantation following treatment of non-malignant diseases
including but not limited to beta-thalassaemia and sickle cell
anemia.
[0083] The present inventors have shown that over-expression of
NR2F6 in a portion of mouse bone marrow cells recapitulates a group
of hematological conditions termed myelodysplastic syndromes.
Further, over-expression of NR2F6 in bone marrow cells results in
bone marrow failure and a rapidly fatal acute leukemia.
Accordingly, in another aspect, the present disclosure provides a
method of treating or preventing a hematologic condition comprising
administering an effective amount of a modulator of NR2F6, such as
a NR2F6 inhibitor or activator, to a cell or animal in need
thereof. The present disclosure also provides the use of a NR2F6
modulator for treating or preventing a hematologic condition in a
cell or animal in need thereof. The present disclosure further
provides the use of a NR2F6 modulator in the preparation of a
medicament for treating or preventing a hematologic condition in a
cell or animal in need thereof. The present disclosure also
provides a NR2F6 modulator for use in treating or preventing a
hematologic condition in a cell or animal in need thereof.
[0084] The term "hematologic condition" as used herein refers
generally to diseases of impaired blood cell self-renewal,
quiescence, proliferation, differentiation, and/or maturation.
These include, but are not limited to, acute leukemia, chronic
leukemia, pre-leukemic conditions, myeloproliferative disorders,
chronic myelomonocytic leukemia, myelodysplastic syndrome and other
dysplasias, bone marrow failure disorders, anemia, idiopathic or
secondary aplastic anemia, bone marrow aplasia, neutropenia,
thrombocytopenia, leukocytosis, and pancytopenia.
[0085] In one embodiment, the hematologic condition is acute
leukemia, chronic leukemia or myelodysplastic syndrome (MDS).
[0086] In an embodiment, the NR2F6 modulator is an inhibitor that
restores the ability of bone marrow to develop into fully mature,
non-dysplastic blood cells. In another embodiment, the NR2F6
inhibitor induces the functional maturation of myelodysplastic
syndrome cells. In yet another embodiment, the NR2F6 inhibitor is
used to treat or prevent conditions that produce insufficient
quantities of blood cells including anemia and bone marrow aplasia,
idiopathic or secondary aplastic anemia, thrombocytopenia,
neutropenia and pancytopenia.
[0087] In another embodiment, the NR2F6 inhibitor is used to treat
or prevent splenomegaly and hepatomegaly secondary to a
proliferative or dysplastic disease of the bone marrow.
[0088] In yet another embodiment, the NR2F6 inhibitor is used to
treat or prevent diseases of aberrant cellular proliferation or
aberrant cellular differentiation.
[0089] The term "treating or preventing" as used herein refers to
improving the condition, such as reducing or alleviating symptoms
associated with the condition or improving the prognosis or
survival of the subject.
[0090] Conventional treatment may also be used in combination with
the methods and uses of the disclosure. The currently used agents
used for treatment of hematopoietic conditions include, without
limitation, lenalidomide, thalidomide, 5-azacitidine (Vidaza),
lenalidomide (Revlimid), erythropoietin, gm-csf, g-csf, IL-3, ATG,
ALG, methylprednisolone and cyclosporine, daunorubicin
(Cerubidine.RTM.), doxorubicin (Adriamycin.RTM.), cytarabine
(ara-C; Cytosar-U.RTM.), 6-thioguanine (Tabloid.RTM.), idarubicin
(Idamycin.RTM.), mitoxantrone (Novantrone.RTM.), etoposide
(VePesid.RTM.), amsacrine (AMSA), cytarabine (ara-C;
Cytosar-U.RTM.), and 6-thioguanine (Tabloid.RTM.), all-trans
retinoic acid (ATRA), hydroxyurea (Hydrea.RTM.), busulfan
(Myleran.RTM.), prednisone, vincristine sulfate (Oncovin.RTM.),
Interferon alpha, vincristine (Oncovin.RTM.), L-asparaginase
(Elspar.RTM.), Cyclophosphamide (Neosar.RTM.), 6-thioguanine
(Tabloid.RTM.), 6-mercaptopurine (6-MP; Purinethol.RTM.).
[0091] The present inventors have also shown that NR2F6 functions
to inhibit leukemia cell differentiation. The present inventors
have shown direct evidence that knocking down expression of NR2F6
induces the spontaneous differentiation, maturation and death of
human leukemia cells. Accordingly, in another aspect, the present
disclosure provides a method of inducing cell differentiation
comprising administering an effective amount of an inhibitor of
NR2F6 to a cell or animal in need thereof. The present disclosure
also provides the use of a NR2F6 inhibitor for inducing cell
differentiation in a cell or animal in need thereof. The present
disclosure further provides the use of a NR2F6 inhibitor in the
preparation of a medicament for inducing cell differentiation in a
cell or animal in need thereof. The present disclosure also
provides a NR2F6 inhibitor for use in inducing cell differentiation
in a cell or animal in need thereof.
[0092] The term "inducing cell differentiation" as used herein
means inducing the cell to differentiate or mature from a stem cell
or progenitor to later lineage cell stages and includes, without
limitation, hematopoietic differentiation, myelodysplastic syndrome
stem and progenitor cell differentiation, maturation of
myelodysplastic syndrome cells, granulocytic differentiation,
erythroid differentiation, and megakaryocytic differentiation. In
one embodiment, terminal differentiation is induced. In another
embodiment, inducing cell differentiation comprises increasing the
sensitivity of the cells to undergo terminal or morphological
differentiation.
[0093] In an embodiment, the method induces differentiation of the
granulocytic, erythroid, or megakaryocytic lineages for the
treatment of cytopenia.
[0094] In another embodiment, the present disclosure provides a
method of reducing the number of progenitors comprising
administering an effective amount of an inhibitor of NR2F6 to a
cell or animal in need thereof. The present disclosure also
provides the use of a NR2F6 inhibitor for reducing the number of
progenitors in a cell or animal in need thereof. The present
disclosure further provides the use of a NR2F6 inhibitor in the
preparation of a medicament for reducing the number of progenitors
in a cell or animal in need thereof. The present disclosure also
provides a NR2F6 inhibitor for use in reducing the number of
progenitors in a cell or animal in need thereof.
[0095] Reduction of the number of progenitors is useful for the
treatment of conditions characterized by leukocytosis. In one
embodiment, the progenitors are immature granulocyte progenitors,
immature erythroid progenitors or immature megakaryocyte
progenitors.
[0096] In another aspect, the present disclosure provides a method
of preventing the progression of a hematologic condition comprising
administering an effective amount of an inhibitor of NR2F6 to a
cell or animal in need thereof. The present disclosure also
provides the use of a NR2F6 inhibitor for preventing the
progression of a hematologic condition in a cell or animal in need
thereof. The present disclosure further provides the use of a NR2F6
inhibitor in the preparation of a medicament for preventing the
progression of a hematologic condition in a cell or animal in need
thereof. The present disclosure also provides a NR2F6 inhibitor for
use in preventing the progression of a hematologic condition in a
cell or animal in need thereof.
[0097] The term "preventing the progression of a hematologic
condition" means blocking or delaying the progression of the
condition and includes, without limitation, the transformation of
preleukemic states, chronic leukemic states and MDS into acute
leukemia.
[0098] The present inventors have found that NR2F6 functions to
repress retinoic acid signaling. Accordingly, in another
embodiment, the present disclosure provides a method of
potentiating retinoic acid signaling comprising administering an
effective amount of an inhibitor of NR2F6 to a cell or animal in
need thereof. The present disclosure also provides the use of a
NR2F6 inhibitor for potentiating retinoic acid signaling in a cell
or animal in need thereof. The present disclosure further provides
the use of a NR2F6 inhibitor in the preparation of a medicament for
potentiating retinoic acid signaling in a cell or animal in need
thereof. The present disclosure also provides a NR2F6 inhibitor for
use in potentiating retinoic acid signaling in a cell or animal in
need thereof.
[0099] The phrase "potentiating retinoic acid signaling" as used
herein means potentiating the actions of natural or synthetic
retinoids. Potentiating retinoic acid signaling is useful for
treating or preventing conditions, including but not limited to,
leukemia, in particular, acute promyelocytic leukemia, cutaneous
T-cell lymphoma, nevoid basal carcinoma syndrome, non-small cell
lung cancer as well as for treating or preventing dermatological
conditions, including but not limited to, acne vulgaris, psoriasis,
symmetrical progressive erythrokeratomderma, pityriasis rubra
pilaris, kid syndrome, palmo-plantar keratoderma, epidermolytic
hyperkeratosis, xeroderma pigmentosum, epidermodysplasia
verruciformis, Darier's disease, skin discolouration, flat warts,
ichthyosis, and other disorders of keratinisation as well as for
cosmetic applications, including but not limited to, treating or
preventing premature aging of the skin caused by overexposure to
the sun (photodamage) including but not limited to sunspots.
[0100] In an embodiment, a NR2F6 inhibitor is formulated for
topical administration in combination with natural or synthetic
retinoid compounds for use in cosmetic applications including but
not limited to improving premature aging of the skin caused by
overexposure to the sun (photodamage) including but not limited to
sunspots.
[0101] In another embodiment, a NR2F6 inhibitor is formulated for
oral, intravenous, or subcutaneous administration in combination
with natural or synthetic retinoid compounds for the treatment of
cutaneous T-cell lymphoma, nevoid basal cell carcinoma, non-small
cell lung cancer, and acute promyeolcytic leukemia.
[0102] In another embodiment, the present disclosure provides a
method of repressing retinoic acid signaling comprising
administering an effective amount of an activator of NR2F6 to a
cell or animal in need thereof. The present disclosure also
provides the use of a NR2F6 activator for repressing retinoic acid
signaling in a cell or animal in need thereof. The present
disclosure further provides the use of a NR2F6 activator in the
preparation of a medicament for repressing retinoic acid signaling
in a cell or animal in need thereof. The present disclosure also
provides a NR2F6 activator for use in repressing retinoic acid
signaling in a cell or animal in need thereof.
[0103] Repression of retinoic acid signaling is useful in treating
psychological disorders, including but not limited to Vitamin A or
synthetic retinoid induced neurotoxicity, psychosis, depression or
suicidal ideation. Repression of retinoic acid signaling induced by
Vitamin A or synthetic retinoids is also useful for stimulating
neurogenesis, improving serotonin signaling and/or for treating or
preventing acute toxicity induced by vitamin A or synthetic
retinoids.
[0104] In another aspect, the present disclosure provides a method
of treating disorders characterized by excessive or hyperactive
mast cells comprising administering an effective amount of an
inhibitor of NR2F6 to a cell or animal in need thereof. The present
disclosure also provides the use of a NR2F6 inhibitor for treating
disorders characterized by excessive or hyperactive mast cells in a
cell or animal in need thereof. The present disclosure further
provides the use of a NR2F6 inhibitor in the preparation of a
medicament for treating disorders characterized by excessive or
hyperactive mast cells in a cell or animal in need thereof. The
present disclosure also provides a NR2F6 inhibitor for use in for
treating disorders characterized by excessive or hyperactive mast
cells in a cell or animal in need thereof. In one embodiment, the
disorders characterized by excessive or hyperactive mast cells are
mastocytosis, allergy or asthma.
[0105] The NR2F6 modulator can be a NR2F6 activator or a NR2F6
inhibitor.
[0106] The term "NR2F6 activator" as used herein includes all
substances that can increase expression or activity of NR2F6 and
includes, without limitation, additional NR2F6 nucleic acid or
protein or fragments thereof, small molecule activators, antibodies
(and fragments thereof), and other substances that can activate
NR2F6 expression or activity.
[0107] The term "NR2F6 inhibitor" as used herein includes any
substance that is capable of inhibiting the expression or activity
of NR2F6 and includes, without limitation, antisense nucleic acid
molecules, siRNAs or shRNAs, proteins, antibodies (and fragments
thereof), small molecule inhibitors and other substances directed
at NR2F6 expression or activity. In an embodiment, the NR2F6
inhibitor is a protein kinase, phosphatase or inhibitor of protein
kinase.
[0108] In one embodiment, inhibition of NR2F6 is through the use of
histone deacetylase inhibitor drugs. Examples of these drugs
include depsipeptide, butyrate derivatives, valproic acid, and
suberoylanilide hydroxamic acid. Furthermore, it is apparent to one
skilled in the art that natural or synthetic ligands that
antagonistically modulate NR2F6 would have an additive effect with
histone deacetylase inhibitor drugs.
[0109] In an embodiment, the NR2F6 inhibitor is an antisense
nucleic acid molecule that inhibits expression of NR2F6. In another
embodiment, the inhibitor is an antisense nucleic acid sequence of
the gene encoding human NR2F6 as shown in SEQ ID NO:1 or of the
gene encoding mouse NR2F6 as shown in SEQ ID NO:4 or variants
thereof. In yet another embodiment, the NR2F6 inhibitor is a siRNA
molecule or shRNA molecule that inhibits expression of NR2F6. In
one embodiment, the NR2F6 inhibitor is an shRNA as shown in SEQ ID
NO:5 or SEQ ID NO:6 or variants thereof. In yet a further
embodiment, the NR2F6 inhibitor is an aptamer that binds and
inhibits NR2F6 activity. Also provided herein are shRNA molecules
comprising the sequence as shown in SEQ ID NO:5 or 6 or variants
thereof. In another embodiment the shRNA molecule consists of the
sequence as shown in SEQ ID NO:5 or 6.
[0110] The term "antisense nucleic acid" as used herein means a
nucleotide sequence that is complementary to its target e.g. a
NR2F6 transcription product. The nucleic acid can comprise DNA, RNA
or a chemical analog, that binds to the messenger RNA produced by
the target gene. Binding of the antisense nucleic acid prevents
translation and thereby inhibits or reduces target protein
expression. Antisense nucleic acid molecules may be chemically
synthesized using naturally occurring nucleotides or variously
modified nucleotides designed to increase the biological stability
of the molecules or to increase the physical stability of the
duplex formed with mRNA or the native gene e.g. phosphorothioate
derivatives and acridine substituted nucleotides. The antisense
sequences may be produced biologically using an expression vector
introduced into cells in the form of a recombinant plasmid,
phagemid or attenuated virus in which antisense sequences are
produced under the control of a high efficiency regulatory region,
the activity of which may be determined by the cell type into which
the vector is introduced.
[0111] The term "siRNA" refers to a short inhibitory RNA that can
be used to silence gene expression of a specific gene. The siRNA
can be a short RNA hairpin (e.g. shRNA) that activates a cellular
degradation pathway directed at mRNAs corresponding to the siRNA.
Methods of designing specific siRNA molecules or shRNA molecules
and administering them are known to a person skilled in the art. It
is known in the art that efficient silencing is obtained with siRNA
duplex complexes paired to have a two nucleotide 3' overhang.
Adding two thymidine nucleotides is thought to add nuclease
resistance. A person skilled in the art will recognize that other
nucleotides can also be added.
[0112] Aptamers are short strands of nucleic acids that can adopt
highly specific 3-dimensional conformations. Aptamers can exhibit
high binding affinity and specificity to a target molecule. These
properties allow such molecules to specifically inhibit the
functional activity of proteins and are included as agents that
inhibit NR2F6.
[0113] In another embodiment, the NR2F6 modulator is an antibody
specific to NR2F6. In one embodiment, the inhibitor is a blocking
antibody that binds the NR2F6 amino acid sequence as shown in SEQ
ID NO:2 or SEQ ID NO:3 or a variant thereof. In another embodiment,
the activator is an antibody that binds the NR2F6 amino acid
sequences as shown in SEQ ID NO:2 or 3 or a variant thereof and
activates NR2F6.
[0114] The term "antibody" as used herein is intended to include
monoclonal antibodies, polyclonal antibodies, and chimeric
antibodies. The antibody may be from recombinant sources and/or
produced in transgenic animals. The term "antibody fragment" as
used herein is intended to include without limitations Fab, Fab',
F(ab').sub.2, scFv, dsFv, ds-scFv, dimers, minibodies, diabodies,
and multimers thereof, multispecific antibody fragments and Domain
Antibodies. Antibodies can be fragmented using conventional
techniques. For example, F(ab').sub.2 fragments can be generated by
treating the antibody with pepsin. The resulting F(ab').sub.2
fragment can be treated to reduce disulfide bridges to produce Fab'
fragments. Papain digestion can lead to the formation of Fab
fragments. Fab, Fab' and F(ab').sub.2, scFv, dsFv, ds-scFv, dimers,
minibodies, diabodies, bispecific antibody fragments and other
fragments can also be synthesized by recombinant techniques.
[0115] Antibodies to such proteins may be prepared using techniques
known in the art such as those described by Kohler and Milstein,
Nature 256, 495 (1975) and in U.S. Pat. Nos. RE 32,011; 4,902,614;
4,543,439; and 4,411,993, which are incorporated herein by
reference. (See also Monoclonal Antibodies, Hybridomas: A New
Dimension in Biological Analyses, Plenum Press, Kennett, McKearn,
and Bechtol (eds.), 1980, and Antibodies: A Laboratory Manual,
Harlow and Lane (eds.), Cold Spring Harbor Laboratory Press, 1988,
which are also incorporated herein by reference). Within the
context of the present disclosure, antibodies are understood to
include monoclonal antibodies, polyclonal antibodies, antibody
fragments (e.g., Fab, and F(ab').sub.2) and recombinantly produced
binding partners.
[0116] For producing polyclonal antibodies a host, such as a rabbit
or goat, is immunized with the immunogen or immunogen fragment,
generally with an adjuvant and, if necessary, coupled to a carrier;
antibodies to the immunogen are collected from the sera. Further,
the polyclonal antibody can be absorbed such that it is
monospecific. That is, the sera can be absorbed against related
immunogens so that no cross-reactive antibodies remain in the sera
rendering it monospecific.
[0117] To produce monoclonal antibodies, antibody producing cells
(lymphocytes) can be harvested from an immunized animal and fused
with myeloma cells by standard somatic cell fusion procedures thus
immortalizing these cells and yielding hybridoma cells. Such
techniques are well known in the art, (e.g., the hybridoma
technique originally developed by Kohler and Milstein (Continuous
cultures of fused cells secreting antibody of predefined
specificity. Nature 256:495-497, 1975) as well as other techniques
such as the human B-cell hybridoma technique (Kozbor, D, and Roder,
J: The production of monoclonal antibodies from human lymphocytes.
Immunology Today 4:3 72-79, 1983), the EBV-hybridoma technique to
produce human monoclonal antibodies (Cole et al. Monoclonal
Antibodies in Cancer Therapy (1985) Allen R. Bliss, Inc., pages
77-96) and screening of combinatorial antibody libraries (Huse, W,
Sastry, L, Iverson, S, Kang, A, Alting-Mees, M, Burton, D,
Benkovic, S, and Lerner, R: Generation of a large combinatorial
library of the immunoglobulin repertoire in phage lambda. Science
246:4935 1275-1282, 1989). Hybridoma cells can be screened
immunochemically for production of antibodies specifically reactive
with the protein or fragment thereof and the monoclonal antibodies
can be isolated. Therefore, the disclosure also contemplates
hybridoma cells secreting monoclonal antibodies with specificity
for NR2F6 or a fragment thereof.
[0118] For producing recombinant antibodies (see generally Huston
et al, 1991; Johnson and Bird, 1991; Mernaugh and Mernaugh, 1995),
messenger RNAs from antibody producing B-lymphocytes of animals, or
hybridoma are reverse-transcribed to obtain complementary DNAs
(cDNAs). Antibody cDNA, which can be full or partial length, is
amplified and cloned into a phage or a plasmid. The cDNA can be a
partial length of heavy and light chain cDNA, separated or
connected by a linker. The antibody, or antibody fragment, is
expressed using a suitable expression system to obtain recombinant
antibody. Antibody cDNA can also be obtained by screening pertinent
expression libraries.
[0119] Chimeric antibody derivatives, i.e., antibody molecules that
combine a non-human animal variable region and a human constant
region are also contemplated within the scope of the disclosure.
Chimeric antibody molecules can include, for example, the antigen
binding domain from an antibody of a mouse, rat, or other species,
with human constant regions. Conventional methods may be used to
make chimeric antibodies containing the immunoglobulin variable
region which recognizes NR2F6 or a fragment thereof (See, for
example, Morrison et al. (Chimeric Human Antibody Molecules: Mouse
Antigen-Binding Domains with Human Constant Region Domains. PNAS
81:21 6851-6855, 1984), and Takeda et al. (Construction of
chimaeric processed immunoglobulin genes containing mouse variable
and human constant region sequences. Nature 314:452-454), and the
patents of Cabilly et al., U.S. Pat. No. 4,816,567; Boss et al.,
U.S. Pat. No. 4,816,397; Tanaguchi et al., European Patent
Publication EP171496; European Patent Publication 0173494, United
Kingdom patent GB 2177096B).
[0120] Monoclonal or chimeric antibodies specifically reactive with
NR2F6 or a fragment thereof as described herein can be further
humanized by producing human constant region chimeras, in which
parts of the variable regions, particularly the conserved framework
regions of the antigen-binding domain, are of human origin and only
the hypervariable regions are of non-human origin. Such
immunoglobulin molecules may be made by techniques known in the
art, (e.g., Teng et al. (Construction and Testing of Mouse--Human
Heteromyelomas for Human Monoclonal Antibody Production. PNAS 80:12
7308-7312, 1983), Kozbor et al., supra; Olsson et al. (Methods in
Enzymol, 92:3-16 1982) and PCT Publication WO92/06193 or EP
0239400). Humanized antibodies can also be commercially produced
(Scotgen Limited, 2 Holly Road, Twickenham, Middlesex, Great
Britain.)
[0121] Specific antibodies, or antibody fragments, reactive against
NR2F6 or a fragment thereof may also be generated by screening
expression libraries encoding immunoglobulin genes, or portions
thereof, expressed in bacteria with peptides produced from the
nucleic acid molecules encoding NR2F6 or a fragment thereof. For
example, complete Fab fragments, VH regions and FV regions can be
expressed in bacteria using phage expression libraries (See for
example Ward et al. (Binding activities of a repertoire of single
immunoglobulin variable domains secreted from Escherichia coli.
Nature 348:544-546, 1989), Huse et al., supra and McCafferty et al
(Phage antibodies: filamentous phage displaying antibody variable
domains. Nature 348:552-555, 1989)).
[0122] Antibodies may also be prepared using DNA immunization. For
example, an expression vector containing a nucleic acid encoding
NR2F6 or a fragment thereof may be injected into a suitable animal
such as mouse. The protein will therefore be expressed in vivo and
antibodies will be induced. The antibodies can be isolated and
prepared as described above for protein immunization.
[0123] The term "variant" as used herein includes modifications,
substitutions, additions, derivatives, analogs, fragments or
chemical equivalents of the NR2F6 nucleic acid or amino acid
sequences disclosed herein that perform substantially the same
function in substantially the same way. For instance, the variants
of the NR2F6 peptides would have the same function, for example, of
inhibiting cell differentiation or potentiating retinoic acid
signaling or for enhancing stem cell expansion or repressing
retinoic acid signaling. Variants of NR2F6 peptide inhibitors would
have the same function as being useful to inhibit NR2F6. Variants
of NR2F6 peptide activators would have the same function as being
useful to activate NR2F6.
[0124] Variants also include peptides with amino acid sequences
that are substantially or essentially identical to the amino acid
sequences of SEQ ID NO:2 or 3 or nucleic acid molecules with
nucleic acid sequence that are substantially or essentially
identical to the nucleic acid sequence of SEQ ID NO:1 or 4.
[0125] The term "substantially identical" or "essentially
identical" as used herein means an amino acid sequence that, when
optimally aligned, for example using the methods described herein,
share at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%
sequence identity with a second amino acid sequence.
[0126] The term "sequence identity" as used herein refers to the
percentage of sequence identity between two polypeptide and/or
nucleotide sequences.
[0127] To determine the percent identity of two amino acid
sequences, the sequences are aligned for optimal comparison
purposes (e.g., gaps can be introduced in the sequence of a first
amino acid or nucleic acid sequence for optimal alignment with a
second amino acid or nucleic acid sequence). The amino acid
residues at corresponding amino acid positions are then compared.
When a position in the first sequence is occupied by the same amino
acid residue or nucleotide as the corresponding position in the
second sequence, then the molecules are identical at that position.
The percent identity between the two sequences is a function of the
number of identical positions shared by the sequences (i.e., %
identity=number of identical overlapping positions/total number of
positions.times.100%). In one embodiment, the two sequences are the
same length. The determination of percent identity between two
sequences can also be accomplished using a mathematical algorithm.
A preferred, non-limiting example of a mathematical algorithm
utilized for the comparison of two sequences is the algorithm of
Karlin and Altschul, 1990, Proc. Natl. Acad. Sci. U.S.A.
87:2264-2268, modified as in Karlin and Altschul, 1993, Proc. Natl.
Acad. Sci. U.S.A. 90:5873-5877. Such an algorithm is incorporated
into the NBLAST and XBLAST programs of Altschul et al., 1990, J.
Mol. Biol. 215:403. BLAST nucleotide searches can be performed with
the NBLAST nucleotide program parameters set, e.g., for score=100,
wordlength=12 to obtain nucleotide sequences homologous to a
nucleic acid molecule of the present disclosure. BLAST protein
searches can be performed with the XBLAST program parameters set,
e.g., to score-50, wordlength=3 to obtain amino acid sequences
homologous to a protein molecule of the present disclosure. To
obtain gapped alignments for comparison purposes, Gapped BLAST can
be utilized as described in Altschul et al., 1997, Nucleic Acids
Res. 25:3389-3402. Alternatively, PSI-BLAST can be used to perform
an iterated search which detects distant relationships between
molecules (Id.). When utilizing BLAST, Gapped BLAST, and PSI-Blast
programs, the default parameters of the respective programs (e.g.,
of XBLAST and NBLAST) can be used (see, e.g., the NCBI website).
Another preferred, non-limiting example of a mathematical algorithm
utilized for the comparison of sequences is the algorithm of Myers
and Miller, 1988, CABIOS 4:11-17. Such an algorithm is incorporated
in the ALIGN program (version 2.0) which is part of the GCG
sequence alignment software package. When utilizing the ALIGN
program for comparing amino acid sequences, a PAM120 weight residue
table, a gap length penalty of 12, and a gap penalty of 4 can be
used. The percent identity between two sequences can be determined
using techniques similar to those described above, with or without
allowing gaps. In calculating percent identity, typically only
exact matches are counted.
[0128] The percentage of identity between two polypeptide
sequences, the amino acid sequences of such two sequences are
aligned, for example using the Clustal W algorithm (Thompson, J D,
Higgins D G, Gibson T J, 1994, Nucleic Acids Res. 22(22):
4673-4680.), together with BLOSUM 62 scoring matrix (Henikoff S,
and Henikoff J. G., 1992, Proc. Natl. Acad. Sci. USA 89:
10915-10919.) and a gap opening penalty of 10 and gap extension
penalty of 0.1, so that the highest order match is obtained between
two sequences wherein at least 50% of the total length of one of
the sequences is involved in the alignment.
[0129] Other methods that may be used to align sequences are the
alignment method of Needleman and Wunsch (Needleman and Wunsch. J.
Mol. Biol., 1970, 48:443), as revised by Smith and Waterman (Smith
and Waterman. Adv. Appl. Math. 1981, 2:482) so that the highest
order match is obtained between the two sequences and the number of
identical amino acids is determined between the two sequences.
Other methods to calculate the percentage identity between two
amino acid sequences are generally art recognized and include, for
example, those described by Carillo and Lipton (Carillo and Lipton
SIAM J. Applied Math. 1988, 48:1073) and those described in
Computational Molecular Biology (Computational Molecular Biology,
Lesk, e.d. Oxford University Press, New York, 1988, Biocomputing:
Informatics and Genomics Projects). Generally, computer programs
will be employed for such calculations.
[0130] The disclosure further encompasses nucleic acid molecules
that differ from any of the nucleic acid molecules disclosed herein
in codon sequences due to the degeneracy of the genetic code.
[0131] The NR2F6 inhibitors or activators described herein may also
contain or be used to obtain or design "peptide mimetics". For
example, a peptide mimetic may be made to mimic the function of a
NR2F6 activator or inhibitor. "Peptide mimetics" are structures
which serve as substitutes for peptides in interactions between
molecules (See Morgan et al (1989), Ann. Reports Med. Chem.
24:243-252 for a review). Peptide mimetics include synthetic
structures which may or may not contain amino acids and/or peptide
bonds but retain the structural and functional features. Peptide
mimetics also include molecules incorporating peptides into larger
molecules with other functional elements (e.g., as described in WO
99/25044). Peptide mimetics also include peptoids, oligopeptoids
(Simon et al (1972) Proc. Natl. Acad, Sci USA 89:9367) and peptide
libraries containing peptides of a designed length representing all
possible sequences of amino acids corresponding to a NR2F6
inhibitor peptide.
[0132] Peptide mimetics may be designed based on information
obtained by systematic replacement of L-amino acids by D-amino
acids, replacement of side chains with groups having different
electronic properties, and by systematic replacement of peptide
bonds with amide bond replacements. Local conformational
constraints can also be introduced to determine conformational
requirements for activity of a candidate peptide mimetic. The
mimetics may include isosteric amide bonds, or D-amino acids to
stabilize or promote reverse turn conformations and to help
stabilize the molecule. Cyclic amino acid analogues may be used to
constrain amino acid residues to particular conformational states.
The mimetics can also include mimics of the secondary structures of
the proteins described herein. These structures can model the
3-dimensional orientation of amino acid residues into the known
secondary conformations of proteins. Peptoids may also be used
which are oligomers of N-substituted amino acids and can be used as
motifs for the generation of chemically diverse libraries of novel
molecules.
[0133] The nucleic acid molecules disclosed herein may be
incorporated in a known manner into an appropriate expression
vector which ensures good expression of the polypeptides. Various
constructs can be used to deliver nucleic acid molecules described
herein. For example retroviral constructs such as lentiviral
constructs are useful for expressing physiological levels of
protein. Possible expression vectors include but are not limited to
cosmids, plasmids, or modified viruses (e.g. replication defective
retroviruses, adenoviruses and adeno-associated viruses), so long
as the vector is compatible with the host cell used. The expression
vectors are "suitable for transformation of a host cell", which
means that the expression vectors contain a nucleic acid molecule
and regulatory sequences selected on the basis of the host cells to
be used for expression, which is operatively linked to the nucleic
acid molecule. Operatively linked is intended to mean that the
nucleic acid is linked to regulatory sequences in a manner which
allows expression of the nucleic acid.
[0134] The disclosure therefore includes a recombinant expression
vector containing a nucleic acid molecule disclosed herein, or a
fragment thereof, and the necessary regulatory sequences for the
transcription and translation of the inserted protein-sequence.
[0135] Suitable regulatory sequences may be derived from a variety
of sources, including bacterial, fungal, viral, mammalian, or
insect genes (For example, see the regulatory sequences described
in Goeddel, Gene Expression Technology: Methods in Enzymology 185,
Academic Press, San Diego, Calif. (1990)). Selection of appropriate
regulatory sequences is dependent on the host cell chosen as
discussed below, and may be readily accomplished by one of ordinary
skill in the art. Examples of such regulatory sequences include: a
transcriptional promoter and enhancer or RNA polymerase binding
sequence, a ribosomal binding sequence, including a translation
initiation signal. Additionally, depending on the host cell chosen
and the vector employed, other sequences, such as an origin of
replication, additional DNA restriction sites, enhancers, and
sequences conferring inducibility of transcription may be
incorporated into the expression vector.
[0136] The recombinant expression vectors may also contain a
selectable marker gene which facilitates the selection of host
cells transformed or transfected with a recombinant molecule
disclosed herein. Examples of selectable marker genes are genes
encoding a protein such as G418 and hygromycin which confer
resistance to certain drugs, .beta.-galactosidase, chloramphenicol
acetyltransferase, firefly luciferase, or an immunoglobulin or
portion thereof such as the Fc portion of an immunoglobulin
preferably IgG. Transcription of the selectable marker gene is
monitored by changes in the concentration of the selectable marker
protein such as .beta.-galactosidase, chloramphenicol
acetyltransferase, or firefly luciferase. If the selectable marker
gene encodes a protein conferring antibiotic resistance such as
neomycin resistance transformant cells can be selected with G418.
Cells that have incorporated the selectable marker gene will
survive, while the other cells die. This makes it possible to
visualize and assay for expression of the recombinant expression
vectors disclosed herein and in particular to determine the effect
of a mutation on expression and phenotype. It will be appreciated
that selectable markers can be introduced on a separate vector from
the nucleic acid of interest.
[0137] Suitable host cells include a wide variety of prokaryotic
and eukaryotic host cells. For example, the proteins of the
disclosure may be expressed in bacterial cells such as E. coli,
insect cells (using baculovirus), yeast cells or mammalian cells.
Other suitable host cells can be found in Goeddel (Goeddel, Gene
Expression Technology: Methods in Enzymology 185, Academic Press,
San Diego, Calif. 1990).
Pharmaceutical Compositions
[0138] Another aspect of the present disclosure is a pharmaceutical
composition comprising a NR2F6 modulator, such as a NR2F6 inhibitor
or NR2F6 activator, for use in the methods described herein.
Accordingly, the disclosure provides a pharmaceutical composition
comprising an effective amount of a NR2F6 inhibitor or NR2F6
activator in admixture with a pharmaceutically acceptable carrier
or diluent. In one embodiment, the pharmaceutical composition is
used to inhibit NR2F6. In another embodiment, the pharmaceutical
composition is used to activate NR2F6. In another embodiment, the
pharmaceutical composition is used to treat hematopoietic
conditions as described herein.
[0139] The term "pharmaceutically acceptable" as used herein means
compatible with the treatment of animals, including, humans.
[0140] The present disclosure also provides a composition
comprising a NR2F6 inhibitor in combination with a natural or
synthetic vitamin A analogue.
[0141] The NR2F6 inhibitors or NR2F6 activators may be formulated
into pharmaceutical compositions for administration to subjects in
a biologically compatible form suitable for administration in vivo.
By "biologically compatible form suitable for administration in
vivo" is meant a form of the substance to be administered in which
any toxic effects are outweighed by the therapeutic effects. The
substances may be administered to living organisms including
humans, and animals. Administration of a therapeutically active
amount of the pharmaceutical compositions of the present disclosure
is defined as an amount effective, at dosages and for periods of
time necessary to achieve the desired result. For example, a
therapeutically active amount of a substance may vary according to
factors such as the disease state, age, sex, and weight of the
individual, and the ability of inhibitor to elicit a desired
response in the individual. Dosage regime may be adjusted to
provide the optimum therapeutic response. For example, several
divided doses may be administered daily or the dose may be
proportionally reduced as indicated by the exigencies of the
therapeutic situation.
[0142] The active substance may be administered in a convenient
manner such as by injection (subcutaneous, intravenous,
intramuscular, etc.), oral administration, inhalation, intranasal,
transdermal administration (such as topical cream or ointment,
etc.), or suppository applications. In one embodiment, the active
substance is administered by inhalation or intranasally. In another
embodiment, the active substance is administered topically.
Depending on the route of administration, the active substance may
be coated in a material to protect the compound from the action of
enzymes, acids and other natural conditions which may inactivate
the compound. The active substance may be formulated into delayed
release formulations such that NR2F6 can be inhibited or activated
for longer periods of time than a conventional formulation.
[0143] The compositions described herein can be prepared by per se
known methods for the preparation of pharmaceutically acceptable
compositions which can be administered to subjects, such that an
effective quantity of the active substance is combined in a mixture
with a pharmaceutically acceptable vehicle. Suitable vehicles are
described, for example, in Remington's Pharmaceutical Sciences
(Remington's Pharmaceutical Sciences (2000-20th edition) Mack
Publishing Company). On this basis, the compositions include,
albeit not exclusively, solutions of the substances in association
with one or more pharmaceutically acceptable vehicles or diluents,
and contained in buffered solutions with a suitable pH and
iso-osmotic with the physiological fluids.
Diagnostic Methods
[0144] The present inventors have found that NR2F6 is
over-expressed in patients with acute leukemia, chronic
myelomonocytic leukemia and myelodysplastic syndromes. Accordingly,
in another aspect, the disclosure provides a method of monitoring
or assessing a hematological condition comprising (a) determining
the level of NR2F6 expression in a sample from a subject; and (b)
comparing the level of expression of NR2F6 from the sample with a
control; wherein an increase in expression of NR2F6 in the sample
from the subject as compared to the control is indicative of a
hematological condition.
[0145] The term "monitoring or assessing" as used herein includes,
monitoring the occurrence, development, treatment and/or
progression of the hematological condition. In an embodiment, the
hematological condition is MDS or leukemia.
[0146] The term "sample" as used herein refers to any fluid, cell
or tissue sample from a subject. In one embodiment, the sample is
blood.
[0147] The term "subject" as used herein refers to any member of
the animal kingdom, optionally, a human.
[0148] The term "control" as used herein refers to a sample from a
subject or a group of subjects who are either known as having a
particular condition or trait or as not having a particular
condition or trait. The control can vary depending on what is being
monitored, assessed or diagnosed. The term "control" as used herein
can also refer to a predetermined standard or reference range of
values.
[0149] The term "difference in expression of NR2F6 in the sample
from the subject as compared to the control" means that NR2F6 is
differentially expressed in the sample from the subject as compared
to the control.
[0150] The term "differentially expressed" or "differential
expression" as used herein refers to a difference in the level of
expression of NR2F6. The term "difference in the level of
expression" refers to an increase or decrease in the measurable
expression level of NR2F6 as compared with the measurable
expression level of NR2F6 in a second sample or control. The term
can also refer to an increase or decrease in the measurable
expression level of NR2F6 in a population of samples as compared
with the measurable expression level of NR2F6 in a second
population of samples. In one embodiment, the differential
expression can be compared using the ratio of the level of
expression of NR2F6 as compared with the expression level of the
NR2F6 of a control, wherein the ratio is not equal to 1.0. For
example, a protein is differentially expressed if the ratio of the
level of expression in a first sample as compared with a second
sample is greater than or less than 1.0. For example, a ratio of
greater than 1, 1.2, 1.5, 1.7, 2, 3, 5, 10, 15, 20 or more, or a
ratio less than 1, 0.8, 0.6, 0.4, 0.2, 0.1, 0.05, 0.001 or less. In
another embodiment the differential expression is measured using
p-value. For instance, when using p-value, NR2F6 is identified as
being differentially expressed as between a first and second
population when the p-value is less than 0.1, preferably less than
0.05, more preferably less than 0.01, even more preferably less
than 0.005, the most preferably less than 0.001.
[0151] "Determining the expression of NR2F6" can be readily
accomplished by a person skilled in the art. In one embodiment, a
probe that hybridizes to the mRNA sequence of the NR2F6 nucleic
acid sequence as shown in SEQ ID NOs:1 or 4 or variants thereof can
be used to detect and quantify the amount of NR2F6 mRNA in the
sample.
[0152] A nucleotide probe may be labelled with a detectable marker
such as a radioactive label which provides for an adequate signal
and has sufficient half life such as 32P, 3H, 14C or the like.
Other detectable markers which may be used include antigens that
are recognized by a specific labelled antibody, fluorescent
compounds, enzymes, antibodies specific for a labelled antigen, and
chemiluminescent compounds. An appropriate label may be selected
having regard to the rate of hybridization and binding of the probe
to the nucleotide to be detected and the amount of nucleotide
available for hybridization.
[0153] Hybridization conditions which may be used in methods of the
disclosure are known in the art and are described for example in
Sambrook J, Fritch E F, Maniatis T. In: Molecular Cloning, A
Laboratory Manual, 1989. (Nolan C, Ed.), Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y. The hybridization
product may be assayed using techniques known in the art. The
nucleotide probe may be labelled with a detectable marker as
described herein and the hybridization product may be assayed by
detecting the detectable marker.
[0154] In another embodiment, primers that are able to amplify the
NR2F6 sequence can be used in a quantitative PCR assay to determine
the expression level of NR2F6. In one embodiment, forward and
reverse primers used for amplifying NR2F6 are
5'-TCTCCCAGCTGTTCTTCATGC-3' (SEQ ID NO:7) and
5'-CCAGTTGAAGGTACTCCCCG-3' (SEQ ID NO:8).
[0155] The length and bases of primers for use in a PCR are
selected so that they will hybridize to different strands of the
desired sequence and at relative positions along the sequence such
that an extension product synthesized from one primer when it is
separated from its template can serve as a template for extension
of the other primer into a nucleic acid of defined length. Primers
which may be used in the disclosure are oligonucleotides, i.e.,
molecules containing two or more deoxyribonucleotides of the
nucleic acid molecules of the disclosure which occur naturally as
in a purified restriction endonuclease digest or are produced
synthetically using techniques known in the art such as for example
phosphotriester and phosphodiester methods (See Good et al. Nucl.
Acid Res 4:2157, 1977) or automated techniques (See for example,
Conolly, B. A. Nucleic Acids Res. 15:15(7): 3131, 1987). The
primers are capable of acting as a point of initiation of synthesis
when placed under conditions which permit the synthesis of a primer
extension product which is complementary to a DNA sequence of the
disclosure, i.e., in the presence of nucleotide substrates, an
agent for polymerization such as DNA polymerase and at suitable
temperature and pH. Preferably, the primers are sequences that do
not form secondary structures by base pairing with other copies of
the primer or sequences that form a hairpin configuration. The
primer optionally comprises between about 7 and 25 nucleotides.
[0156] The primers may be labelled with detectable markers which
allow for detection of the amplified products. Suitable detectable
markers are radioactive markers such as P-32, S-35, I-125, and H-3,
luminescent markers such as chemiluminescent markers, preferably
luminol, and fluorescent markers, preferably dansyl chloride,
fluorcein-5-isothiocyanate, and 4-fluor-7-nitrobenz-2-axa-1,3
diazole, enzyme markers such as horseradish peroxidase, alkaline
phosphatase, .beta.-galactosidase, acetylcholinesterase, or
biotin.
[0157] It will be appreciated that the primers may contain
non-complementary sequences provided that a sufficient amount of
the primer contains a sequence which is complementary to a nucleic
acid molecule of the disclosure or oligonucleotide fragment
thereof, which is to be amplified. Restriction site linkers may
also be incorporated into the primers allowing for digestion of the
amplified products with the appropriate restriction enzymes
facilitating cloning and sequencing of the amplified product.
[0158] In yet another embodiment, antibodies that bind NR2F6 as
shown in SEQ ID NO:2 or 3 or variants or homologs thereof can be
used to detect NR2F6 protein levels.
[0159] The antibodies may be labelled with a detectable marker
including various enzymes, fluorescent materials, luminescent
materials and radioactive materials. Examples of suitable enzymes
include horseradish peroxidase, alkaline phosphatase,
.beta.-galactosidase, or acetylcholinesterase; examples of suitable
fluorescent materials include umbelliferone, fluorescein,
fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine
fluorescein, dansyl chloride or phycoerythrin; an example of a
luminescent material includes luminol; and examples of suitable
radioactive material include S-35, Cu-64, Ga-67, Zr-89, Ru-97,
Tc-99m, Rh-105, Pd-109, In-111, I-123, I-125, I-131, Re-186,
Au-198, Au-199, Pb-203, At-211, Pb-212 and Bi-212. The antibodies
may also be labelled or conjugated to one partner of a ligand
binding pair. Representative examples include avidin-biotin and
riboflavin-riboflavin binding protein. Methods for conjugating or
labelling the antibodies discussed above with the representative
labels set forth above may be readily accomplished using
conventional techniques.
[0160] Antibodies reactive against NR2F6 protein may be used to
detect NR2F6 in various samples, for example they may be used in
any known immunoassays which rely on the binding interaction
between an antigenic determinant of a protein of the disclosure and
the antibodies. Examples of such assays are radioimmunoassays,
western immunoblotting, enzyme immunoassays (e.g., ELISA),
immunofluorescence, immunoprecipitation, latex agglutination,
hemagglutination, and histochemical tests. Thus, the antibodies may
be used to identify or quantify the amount of a protein in a
sample.
Model Organisms
[0161] In another aspect, overexpression of NR2F6 in an animal may
provide a model for diseases such as myelodysplastic syndrome.
Progress in understanding MDS has been hampered by the lack of
suitable cell lines or animal models for this disease. A mouse
model that accurately recapitulates the essential qualities of
MDS--stem cell competitive advantage, dysplastic haematopoiesis,
peripheral blood cytopenias, and progression to acute
leukemia--would be tremendously valuable for investigations of the
pathological mechanisms of these qualities and for preclinical
testing of new MDS therapies. In this embodiment over-expression of
NR2F6 in a chimerical mouse model provides an animal model for the
study of MDS. Specific transplantation of murine haematopoietic
cells engineered to overexpress NR2F6 causes myelodysplastic
syndrome and promotes the development of acute myelogenous
leukemia. This model, recapitulates the morphological abnormalities
of MDS haematopoiesis as well as the transition of MDS to acute
leukemia. This model is based on unregulated expression of the
orphan nuclear receptor NR2F6 in murine haematopoietic stem and
progenitor cells (HSCs).
[0162] Accordingly, in one embodiment, the present disclosure
provides a cell transformed with a NR2F6 gene operatively linked to
a promoter that drives overexpression of the gene. In another
embodiment, the present disclosure provides a transgenic animal
comprising the cell having the NR2F6 gene operatively linked to a
promoter that drives overexpression of the gene. In an embodiment,
the animal is a rodent, optionally, a mouse.
[0163] "Operatively linked" is intended to mean that the nucleic
acid is linked to regulatory sequences in a manner which allows
expression of the nucleic acid.
[0164] The above disclosure generally describes the present
disclosure. A more complete understanding can be obtained by
reference to the following specific examples. These examples are
described solely for the purpose of illustration and are not
intended to limit the scope of the disclosure. Changes in form and
substitution of equivalents are contemplated as circumstances might
suggest or render expedient. Although specific terms have been
employed herein, such terms are intended in a descriptive sense and
not for purposes of limitation.
[0165] The following non-limiting examples are illustrative of the
present disclosure:
EXAMPLES
Materials & Methods
Cell Lines
[0166] U937 cells were purchased from ATCC and grown in RPMI
supplemented with 10% FBS. 32Dcl3 cells were purchased from ATCC
and grown in RPMI with 1 ng/mL of rmlL-3. The 293GPG retroviral
packaging cell line (a gift of Richard Mulligan, Harvard
University) was grown in DMEM medium supplemented with 10% FBS,
tetracycline (1 mg/mL), G418 (0.3 mg/mL) and puromycin (2
mg/mL).
Generation of Retroviruses
[0167] NR2F6 cDNA (a kind gift from John Ladias, Harvard
University) was subcloned into the pcDNA3.1V5/HIS vector
(Invitrogen). V5-tagged NR2F6 was subsequently subcloned into the
MMP retrovector such that it lay upstream of an IRES (internal
ribosome entry sequence)-GFP cassette. VSV-G pseudotyped retroviral
particles were generated by transient transfection of 293GPG cells
with 25 ug of plasmid in lipofectamine 2000. Viral supernatant was
collected for seven days from cultures of these cells in media
containing high glucose DMEM with 10% FBS that contained no
tetracycline, G418 or puromycin. Viral stocks were concentrated by
centrifugation at 16,500 RPM for 90 minutes. In some experiments
producer cell lines that stably express the MMP-NR2F6 or MMP-GFP
retroviral construct were generated for the production of viral
stock. Virus was produced from these cell lines by culturing in
high glucose DMEM that contained no tetracycline, G418 or
puromycin. Following 7 days of culture viral stock was concentrated
by centrifugation at 16,500 RPM for 90 minutes. For U937 and 32D
infections, cells were infected at a multiplicity of infection
(MOI) of 2. GFP positive cells were harvested by FACS 48 h after
infection.
Patient Material
[0168] Leukemia and healthy BM cells, collected with informed
consent and with institutional ethics board approval and stored in
our tissue bank, were used to assess expression of NR2F6. The
French-American British classification of the AML samples consisted
of 6 AML-M4, 7 AML-M4eo, 1 AML-M3 and 1 AML-M1.
Real-Time PCR
[0169] RNA was isolated from 1.times.10.sup.6 cells using Trizol
reagent (Invitrogen) and first strand cDNA was synthesized using
SuperScript reverse transcriptase (Qiagen) according to
manufacturer's instructions. Real time PCR was performed according
to manufacturer's instructions using SYBR Green Master Mix (Applied
Biosystems, Foster City, Calif.) and analysed using the delta-delta
CT method. The forward and reverse primers used for NR2F6 are
5'-TCTCCCAGCTGTTCTTCATGC-3' (SEQ ID NO:7) and
5'-CCAGTTGAAGGTACTCCCCG-3' (SEQ ID NO:8), respectively, and for
GAPDH 5'-GGCCTCCAAGGAGTAAGACC-3' (SEQ ID NO:9) and
5'-AGGGGTCTACATGGCAACTG-3' (SEQ ID NO:10). Threshold cycle
(C.sub.T) values were calculated in each sample for NR2F6 and
normalized to the C.sub.T for the housekeeping gene GAPDH
(delta-C.sub.T). The relative quantity of NR2F6 expression in
samples relative to control was be determined as the delta-C.sub.T
of the sample subtracted from the delta-C.sub.T of control, to the
exponent 2(delta-delta-C.sub.T). For analysis of NR2F6 expression
in patient samples the mean delta-C.sub.T of all normal samples was
used to calculate delta-delta-C.sub.T values.
Differentiation Assessment and Induction
[0170] Differentiation was induced in the U937 cell line by
treatment with 10 nM TPA (Sigma), 1 uM ATRA (Sigma), or 1.25% v/v
DMSO (Sigma) respectively. Immunostaining for the maturation marker
CD11b (eBioscience) was performed for twenty minutes in the dark
according to manufacturer's instructions and cells were analysed by
flow cytometry. Nitroblue tetrazolium (NBT) reduction test (Sigma)
was performed according to the manufacturer's instructions, with a
minimum of 300 cells scored per slide in three different fields of
view. Each experimental timepoint was conducted in triplicate.
Bone Marrow Transduction
[0171] Using the retroviral constructs described above, expression
of NR2F6 was forced in primary murine BM cells and monitor the
effects on differentiation using colony assays. Donor 12-week old
C57BI/6 mice were given 5 fluorouracil, 150 .mu.g/g body mass, by
intraperitoneal injection and humanely killed ninety-six hours
later. Bone marrow was collected from femurs and tibiae and
cultured in Iscove's Modified Dulbecco's Medium supplemented with
foetal bovine serum (5%), c-Kit ligand conditioned medium (3%),
Flt-3 (30 ng/mL), and TPO (30 ng/mL), conditions that minimize
differentiation but initiate cycling of long-term repopulating
cells. After 24 hours of culture, the cells were infected with
MMP-GFP or MMP-NR2F6 retroviral supernatant at a multiplicity of
infection (MOI) of 100. Forty-eight hours after retroviral
infection GFP-positive cells were collected by fluorescence
activated cell sorting (FACS).
Methylcellulose Colonies
[0172] Following bone marrow transduction with MMP-GFP or MMP-NR2F6
GFP positive cells were collected by FACS and plated in
methylcellulose medium supplemented with cytokines (c-Kit ligand,
IL-3, IL-6, and erythropoietin) that favour multi-lineage terminal
differentiation (Methocult GF 3434, Stem Cell Technologies). Colony
formation was evaluated after 12-14 days; clusters containing more
than 30 cells will be scored as a colony. Accuracy of colony
identification and morphological maturity of colony cells was
confirmed by spreading and staining individual colonies on glass
slides. Cultures were evaluated for their number of colonies,
colony lineage (granulocyte-monocyte, erythroid, or mixed) and
morphology. GFP expression was confirmed by fluorescence
microscopy. Differences in colony numbers between NR2F6 and
controls will be tested for statistical significance with Student's
t-test. Secondary colony formation was tested by harvesting an
entire primary colony cultures, washing the cells two times with
PBS, and plating 10,000 cells in methylcellulose a second time.
Secondary colonies were enumerated 12-14 days following a secondary
plating.
Ex vivo Suspension Culture
[0173] Following transduction of mouse bone marrow with MMP-GFP or
MMP-NR2F6, cells were placed unsorted into cultured in IMDM with 5%
FBS, 10% v/v IL-3 conditioned medium from WEHI cells, 1 ng/mL IL-6
and 3% v/v c-kit ligand conditioned medium. Following ten days of
culture the cells were washed twice with PBS, stained with either
fluorescently labelled c-kit or with fluorescently labelled CD11b
and GR-1, and analysed by flow cytometry.
Hematopoietic Stem Cell transplants
[0174] Bone marrow transplant recipients were generated that
received either chimerical NR2F6 or GFP transduced grafts or grafts
that contained 100% sorted bone marrow cells.
[0175] To generate recipients transplanted with bone marrow grafts
containing a chimera of transduced and wild-type cells 5FU-primed
C57BI/6 bone marrow cells were transduced with either MMP-GFP or
MMP-NR2F6 as described above. Cells were then sorted by FACS.
Transduced (GFP or NR2F6) and untransduced donor cells were mixed
at a ratio of between 10:90 to 30:70 (transduced:untransduced),
maintaining a constant total graft size of between 4.times.10.sup.4
to 1.times.10.sup.5 cells per recipient. All recipients of a given
cohort received the same graft size. Primary chimerical transplants
were performed as described. In some experiments chimerical
transplant recipients were harvest at 4-6 weeks post transplant for
analysis, and bone marrow was transplanted into another lethally
irradiated mouse by tail-vein injection. Secondary recipients of
chimerical bone marrow were harvested at either early time points
4-6 weeks or at late time points 12-16 weeks.
[0176] To generate recipients transplanted with bone marrow grafts
containing 100% transduced bone marrow cells 5FU-primed C57BI/6
bone marrow cells were transduced with either MMP-GFP or MMP-NR2F6
as described above. Cells were then sorted by FACS and introduced
into recipient mice by tail vein injection at a dosage of between
4.times.10.sup.4 and 1.times.10.sup.5 cells per recipient. All
recipients of a given cohort received the same graft size.
Recipient C57BI/6 mice were treated with 900 cGy prior to
transplantation--it was previously determined that this radiation
dose is the lowest reliably lethal dose for this strain.
[0177] For the competitive transplant experiment (FIG. 25) animals
were prepared as described in the generation of recipients
transplanted with bone marrow grafts containing a chimera of
transduced and wild-type cells. The percentage of marked cells was
determined based on expression of GFP using flow cytometry.
Histological Sections and Cytospins
[0178] Immediately following sacrifice of animals tissues were
rinsed in PBS and fixed for 24 hours in buffered formalin before
being given off to the Sunnybrook Research Institute Histology
facility for paraffin embedding, slicing and staining with
hematoxylin and eosin. Bone tissues were decalcified following
fixation before further processing. Cytospins were prepared by
centrifuging single celled suspensions onto glass slides using a
Shandon cytocentrifuge. Cytospins were air dried, and fixed in
methanol before staining with May-Gruwald and Giemsa stains.
Cytospins were coverslipped following treatment with a
toluene-based synthetic resin mounting medium.
Peripheral Blood Counts:
[0179] Bone marrow transplant recipients that received grafts
containing 100% transduced bone marrow cells were bleed at 4 weeks
post-transplant from the Saphenous vein. Alternatively, moribund
animals were bled by cardiac puncture just prior to death. To give
matched data, a GFP control animal was analysed with every NR2F6
moribund animal analysed. Blood was collected using a heparinized
capillary tube and taken to the Toronto Centre for Phenogenomics
for acquisition of haematological parameters on a Hemavet
analyser.
Analysis of Hematopoietic Stem Cell Subsets:
[0180] Bone marrow transplant recipients that received grafts
containing 100% transduced bone marrow cells were humanely
sacrificed at four weeks post-transplant. Red blood cells were
lysed and bone marrow washed two times with PBS. Bone marrow cells
were then stained with biotin CD3, biotin CD45R/B220 (RA3-6B2),
biotin CD11b (M1/70), biotin erythroid marker (TER-119), biotin
Ly-6G (RB6-8C5), c-kit APC, sca-1 PE-Cy7 and either CD34 PE or
CD49b PE (all eBioscience) in the dark. Bone marrow was washed once
and incubated with streptavidin PE-Cy5 for 20 minutes in the dark.
Bone marrow was washed twice and analysed using flow cytometry on a
Becton Dickinson LSR II. All samples analysed were gated based on
FSC/SSC and GFP+ cells. The population of lineage.sup.- Sca-1.sup.+
c-kit.sup.+ (LSK) is highly enriched for hematopoietic stem cell
activity. This population was analysed and further subdivided based
on the expression of the CD34 and CD49b antigen. Whereas the
CD34.sup.-/low and the CD49b.sup.-/low population of LSK cells are
enriched for long-term hematopoietic stem cells, the CD34.sup.+ and
CD49b+population of LSK cells are composed of short term
hematopoietic stem cells.
Results
[0181] To assess the pattern of expression of NR2F6 in normal
hematopoiesis, Q-PCR was used to measure expression of NR2F6
transcripts in a graded series of pluripotent, multipotent,
oligopotent, and unipotent murine haematopoietic cells (cDNAs were
a kind gift from Dr. Norman Iscove). NR2F6 transcripts were most
abundant in long-term hematopoietic stem cells and became
progressively less abundant with differentiation, with the
exception of committed megakaryocyte progenitors, in which
expression was high (FIG. 1A). These observations are consistent
with NR2F6 having a role in the maintenance of the undifferentiated
state of primitive hematopoietic cells. Expression of NR2F6 mRNA is
shown relative to GAPDH. Long-term repopulating HSCs (LT-HSC),
short-term repopulating HSCs (ST-HSC), pentapotent progenitor
(Penta), committed non-lymphoid progenitor (E Meg Mac),
erythroid/megakaryocyte progenitor (E Meg), committed megakaryocyte
progenitor (Meg Pro), BFU-E, CFU-E, megakaryocyte (Meg). All
expression levels are relative to expression of NR2F6 in E Meg
Mac.
[0182] Bone marrow from patients with acute myelogenous leukemia
(AML), chronic myelomonocytic leukemia (CMML) and myelodysplastic
syndrome (MDS) have greater expression of NR2F6 mRNA than bone
marrow from healthy human controls (FIG. 1B). These data support
the notion that NR2F6 may be used as a biomarker for the diagnosis
and/or prognosis of patients with leukemia, CMML and MDS.
[0183] NR2F6 mRNA is expressed highly in immature U937 human
leukemia cell line (FIG. 2). The high expression of NR2F6 is
associated with maintenance of the undifferentiated state of these
cells. Induction of U937 leukemia cells to differentiate and to
acquire characteristics of mature blood cells was associated with a
sharp decrement in the expression of NR2F6 mRNA. The rapid decrease
in NR2F6 mRNA expression is a general response to the induction of
differentiation and maturation since this decrease occurred
irrespective of the agent used to induce differentiation and
maturation.
[0184] Overexpression of NR2F6 is able to override the growth
arrest associated with differentiation and maturation, in
particular maturation and differentiation induced by all-trans
retinoic acid (FIG. 3). This suggests that NR2F6 can act to
antagonize the initiation of the downstream pathways that are
activated by all-trans retinoic acid (atRA). Growth of U937 cells
expressing either GFP of NR2F6-IRES-GFP was monitored by counting
using trypan blue following treatment of cells with atRA (FIG. 3A).
U937 cells expressing either GFP of NR2F6-IRES-GFP were treated
with atRA. DNA content was assessed using propidium iodide in order
to determine which phase of the cell cycle the cells in each
respective population resided in (FIG. 3B). Control U937 GFP cells
showed a drastic decrease in the number of cells in S/G2/M phases
of the cell cycle following treatment with atRA, however U937 cells
that over-expressed NR2F6 did not show any decrease in the number
of cells in S/G2/M phases of the cell cycle following treatment
with atRA. These data suggest the NR2F6 over-expression promotes
proliferation by affecting the cell cycle.
[0185] Over-expression of NR2F6 enables the survival and
proliferation of mouse embryonic fibroblasts (MEFs) in low serum
(0.2% serum) (FIG. 4). MEFs were stably transduced using a
retroviral construct containing either GFP of NR2F6-IRES-GFP. MEFs
transduced with NR2F6 were sorted into high transgene expressers or
low transgene expressers based on GFP intensity. Cells were
initially plated at 1.times.10.sup.5 cells and enumerated after
several days.
[0186] Over-expression of NR2F6 is able to inhibit the
differentiation and maturation of U937 human leukemia cells (FIG.
5). U937 cells expressing either GFP of NR2F6-IRES-GFP were treated
with atRA and assessed for maturation. Following induction of
differentiation with atRA expression of the myeloid maturation
marker CD11b was assessed using flow cytometry. These data suggest
that aberrant expression of NR2F6 inhibits the maturation of
leukemia cells, in particular toward the myeloid cell lineage.
[0187] Over-expression of NR2F6 is able to inhibit the
differentiation and maturation of U937 human leukemia cells (FIG.
6). U937 cells expressing either GFP of NR2F6-IRES-GFP were treated
with atRA and assessed for maturation. Following induction of
differentiation with atRA cells were stained for nitroblue
tetrazolium (NBT). The percentage of NBT+ cells were enumerated in
three separate fields of view in which more than 100 individual
cells were evaluated (FIG. 6A). A microphotograph of representative
U937-NR2F6 and U937-GFP cells is shown in FIG. 6B. These data
suggest that aberrant expression of NR2F6 inhibits the maturation
of leukemia cells, in particular toward the myeloid cell
lineage.
[0188] NR2F6 over-expression inhibits the maturation of healthy
bone marrow (FIG. 7). Bone marrow from 5-FU treated C57BI/6 mice
was transduced using a retrovirus containing either GFP of
NR2F6-IRES-GFP. Transduced cells (GFP+) were sorted and plated in
methylcellulose culture containing growth factors that would
support multi-lineage differentiation. Colonies were enumerated
after 12-14 days (FIG. 7A). These data are consistent with the
over-expression of NR2F6 inhibiting maturation. After the
enumeration of these primary colonies methycellulose cultures were
harvested, washed with PBS and 10,000 of said cells were plated in
another methycellulose culture to determine the ability of these
cells to form colonies a second time, (FIG. 7B), and then repeated
yet a third time (FIG. 7C). These secondary and tertiary cultures
were enumerated after another 12-14 days of culture. The ability of
bone marrow that over-expresses NR2F6 to form a far greater number
of secondary and tertiary colonies compared to control bone marrow
demonstrates that over-expression of NR2F6 inhibits terminal
differentiation of hematopoietic cells.
[0189] NR2F6 over-expression inhibits the maturation of healthy
bone marrow toward the myeloid lineage (FIG. 8). Bone marrow from
5-FU treated C57BI/6 mice was transduced using a retrovirus
containing either GFP of NR2F6-IRES-GFP and cells were plated in
IMDM liquid medium containing growth factors that support
multi-lineage differentiation. The percentage of myeloid cells
following ten days of culture was assessed by flow cytometry using
the cell surface markers Mac1/CD11b and Gr-1 (FIG. 8A). The graphs
in the panel have been gated on the transduced cells (GFP+). The
percentage of mast cells was also determined following ten days of
culture using flow cytometry for the cell surface marker c-kit
(FIG. 8B). The graphs in the panel have not been gated a priori on
the transduced cells (GFP+).
[0190] NR2F6 over-expression in vivo increases bone marrow
cellularity, even when only a portion of the cells over-express
NR2F6 (FIG. 9). Chimerical mice that overexpressed NR2F6 in only a
portion of their bone marrow cells were generated by transducing
bone marrow from 5-FU treated C57BI/6 using a retrovirus containing
either GFP of NR2F6-IRES-GFP. Cells were then sorted and admixed
with a fixed ratio of wild-type bone marrow before transplantation
into lethally irradiated C57BI/6 hosts. Animals were harvested to
monitor short-term (4 week) as well as long-term (12 week)
hematopoietic effects. Over-expression of NR2F6 in the bone marrow
of animals resulted in hypercellular bone marrow as determined by
counting cells with trypan blue after flushing two femurs and one
tibia (FIG. 9A). Furthermore, NR2F6-transduced cells from BMT
recipients had a striking increase in replating ability relative to
GFP-transduced cells (FIG. 9B) Histological sections that were
stained with hematoxylin and eosin, stain demonstrate that
over-expression of NR2F6 causes bone marrow to become hypercellular
(FIG. 9C). Mice also had splenomegaly, this is consistent with
histological sections that show alterations in the splenic
architecture, consistent with an expansion of the proliferative
centers of the white pulp.
[0191] NR2F6 over-expression causes bone marrow dysplasia (FIG.
10). Chimerical mice that overexpressed NR2F6 in only a portion of
their bone marrow cells were generated by transducing bone marrow
from 5-FU treated C57BI/6 using a retrovirus containing either GFP
of NR2F6-IRES-GFP. Cells were then sorted and admixed with a fixed
ratio of wild-type bone marrow before transplantation into lethally
irradiated C57BI/6 hosts. Examination of bone marrow cytospins from
these animals shows dysplastic characteristics, especially in the
erythroid lineage. This dysplasia resemble morphologically the
dysplasia observed in human patients with myelodysplastic syndrome,
suggesting that modulation of NR2F6 could provide a therapeutic
benefit to these patients.
[0192] NR2F6 over-expression causes abnormal localization of
immature precursors (ALIP) (FIG. 11). Chimerical mice that
overexpressed NR2F6 in only a portion of their bone marrow cells
were generated by transducing bone marrow from 5-FU treated C57BI/6
using a retrovirus containing either GFP of NR2F6-IRES-GFP. Cells
were then sorted and admixed with a fixed ratio of wild-type bone
marrow before transplantation into lethally irradiated C57BI/6
hosts. Examination of bone marrow histological sections from these
cohorts of animals shows that over-expression of NR2F6 results in
the phenomenon of abnormal localization of immature precursors
(ALIP). This resembles the condition ALIP which is observed in
human patients with high risk myelodysplastic syndrome, again
suggesting that modulation of NR2F6 could provide a therapeutic
benefit to these patients.
[0193] NR2F6 over-expression inhibits myeloid differentiation and
maturation in vivo (FIG. 12). Chimerical mice that over-expressed
NR2F6 in only a portion of their bone marrow cells were generated
by transducing bone marrow from 5-FU treated C57BI/6 using a
retrovirus containing either GFP of NR2F6-IRES-GFP. Cells were then
sorted and admixed with a fixed ratio of wild-type bone marrow
before transplantation into lethally irradiated C57BI/6 hosts.
Analysis of the bone marrow of these mice by flow cytometry showed
that over-expression of NR2F6 prevents the differentiation and
maturation of progenitor cells into neutrophils (Mac1+/Gr-1+). This
data suggests that modulation of NR2F6 could provide a therapeutic
benefit to patients suffering from disorders associated with
abnormal myeloid maturation.
[0194] NR2F6 over-expression inhibits blood cell differentiation
and maturation in vivo (FIG. 13). Mice that over-expressed NR2F6 in
all of their bone marrow cells were generated by transducing bone
marrow from 5-FU treated C57BI/6 using a retrovirus containing
either GFP of NR2F6-IRES-GFP. Cells were then sorted and
transplantation into lethally irradiated C57BI/6 hosts. Analysis of
the peripheral blood of these animals shows major defects in their
ability to produce mature blood cells. At four weeks of age these
animals are suffering from a condition similar to the human bone
marrow failure syndromes. The test animals but not the controls are
pancytopenic: they suffer from anemia, thrombocytopenia, and
neutropenia. This data suggests that modulation of NR2F6 could
provide a therapeutic benefit to patients suffering from disorders
associated with abnormal blood cell differentiation and
maturation.
[0195] NR2F6 over-expression produces an excess of megakaryoctes
(FIG. 14). Mice that over-expressed NR2F6 in all of their bone
marrow cells were generated by transducing bone marrow from 5-FU
treated C57BI/6 using a retrovirus containing either GFP of
NR2F6-IRES-GFP. Cells were then sorted and transplantation into
lethally irradiated C57BI/6 hosts. Despite the lower amounts of
platelets observed at short term time points, analysis of the bone
marrow of these animals revealed an excess of megakaryoctes. This
suggests that modulation of NR2F6 at specific stages of blood cell
development could provide a therapeutic benefit to patients
suffering from thrombotic disorders, or disorders of megakaryocytic
differentiation and maturation.
[0196] NR2F6 over-expression, even in a small subset of bone marrow
cells, eventually results in the generation of leukemia (FIG. 15).
Herein, a mouse model was used in which the phenotype was
accelerated by conducting secondary transplants. Bone marrow from
animals with NR2F6+ leukemia has a packed bone marrow cellularity.
Animals with NR2F6+ leukemia also had immature blast cells in their
peripheral blood. These are characteristics of high risk human
leukemias and suggests that modulation of NR2F6 could provide a
therapeutic benefit to patients suffering from leukemia or for
preventing the development of leukemia in MDS patients.
[0197] NR2F6 over-expression, even in a small subset of bone marrow
cells, results in the production of excessive immature blast cells
(FIG. 16). Manual cell counts conducted on the cytospins of bone
marrow from NR2F6 transplant chimera revealed an excess of blast
cells and promyelocytic cells. Chimerical mice that over-expressed
NR2F6 in only a portion of their bone marrow cells were generated
by transducing bone marrow from 5-FU treated C57BI/6 using a
retrovirus containing either GFP of NR2F6-IRES-GFP. Cells were then
sorted and admixed with a fixed ratio of wild-type bone marrow
before transplantation into lethally irradiated C57BI/6 hosts. An
excess of immature blast cells is a characteristic of human
leukemia. These data suggest that modulation of NR2F6 could provide
a therapeutic benefit to patients suffering from leukemia or for
preventing the development of leukemia in MDS patients.
[0198] NR2F6 over-expression, even in a small subset of bone marrow
cells, eventually results in the generation of leukemia (FIG. 17).
Bone marrow from animals with NR2F6+ leukemia has a packed bone
marrow cellularity. Histology from animals with NR2F6+ leukemia
showed an utter obliteration of their splenic architecture.
Leukemia cells also infiltrated the liver. Infiltration of organs
is a characteristic of high risk human leukemia. These data suggest
that modulation of NR2F6 could provide a therapeutic benefit to
patients suffering from leukemia or for preventing the development
of leukemia in MDS patients.
[0199] Over-expression of NR2F6 in the bone marrow of healthy
animals resulted in a fatal hematological condition that resembles
human myelodysplastic syndrome and acute leukemia (FIG. 18). NR2F6
over-expression in a small subset of bone marrow cells results in a
prolonged hematological condition that eventually leads to death in
a subset of its patients (FIG. 18A), while NR2F6 over-expression in
all of one's bone marrow cells resulted in a rapidly fatal
hematological condition (FIG. 18B). These data suggest that
modulation of NR2F6 could provide a survival benefit to patients
suffering from leukemia, MDS, or other hematological condition
characterized by effacement of haematopoiesis.
[0200] Flow cytometry on BM and spleen cells confirmed that the
NR2F6-transduced graft contributed to trilineage haematopoiesis but
also revealed the presence of an abnormal lineage-negative
(lineage-) population that expressed moderate cKit antigen (FIGS.
19, 20 and 21). Fascinatingly, the size of the ckit+Sca-1+lineage-
(KSL) population was markedly increased in NR2F6 recipients (FIG.
22). Thus, NR2F6-transduced HSCs show impaired differentiation, a
propensity to accumulate, and a high rate of malignant
transformation.
[0201] Over-expression of NR2F6 in the bone marrow of healthy
animals results in expansion of their hematopoietic stem cell (FIG.
23). Mice that over-expressed NR2F6 in all of their bone marrow
cells were generated by transducing bone marrow from 5-FU treated
C57BI/6 using a retrovirus containing either GFP of NR2F6-IRES-GFP.
Cells were then sorted and transplantation into lethally irradiated
C57BI/6 hosts. Four weeks post transplant the bone marrow of these
animals was analyzed by multicolour flow cytometry (FIG. 23A).
There was a striking accumulation of stem cells in the bone marrow
of animals that over-expressed NR2F6 (cells with the lineage.sup.-,
c-kit.sup.+, sca-1.sup.+ immunopheonotype). Interestingly, there
was an increase in the number of long-term stem cells found in the
bone marrow of animals that over-expressed NR2F6 (cells with the
lineage.sup.-, c-kit.sup.+, sca-1.sup.+, CD49b.sup.-immunophenotype
and cells with the lineage.sup.-, c-kit.sup.+, sca-1.sup.+,
CD34.sup.- immunophenotype) (FIG. 23B). The accumulation of
hematopoietic stem cells in the bone marrow of NR2F6+ animals
suggests that NR2F6 increases hematopoietic stem cell self-renewal.
Furthermore, these data support the fact that NR2F6 is able to act
upon the most primitive hematopoietic stem cell compartments and
regulate their proliferation as well as the self-renewal of
long-term hematopoietic stem cells. These data support the
modulation of NR2F6 as a method of expanding stem cells ex vivo.
These data also support the modulation of NR2F6 for the treatment
of diseases associated with aberrant self-renewal, for example
targeting of the cancer stem cell. NR2F6 overexpressing bone marrow
was cultured in conditions that preserve stem cell maintenance
(c-kit ligand; thrombopoietin; and Flt3 ligand in OP9 conditioned
medium). Following three days in culture the proportion of stem
cells with the immunophenotype ckit+Sca-1+lineage- (KSL) was
determined by flow cytometry. It was observed that bone marrow that
over-expressed NR2F6 contained more KSL cells than GFP control
cultures (FIG. 24) suggesting that modulation of NR2F6 can be used
to maintain and/or expand hematopoietic stem cells in culture.
[0202] Over-expression of NR2F6 in the bone marrow of healthy
animals enhances self-renewal in vivo (FIG. 25). Competitive bone
marrow transplant experiments shows that over-expression of NR2F6
results in increased engraftment which evidences that
over-expression of NR2F6 increases self-renewal (FIG. 25A). The
self-renewal ability of bone marrow attained from animal that
over-express either NR2F6-IRES-GFP or GFP was compared by assessing
the bone marrow's secondary colony forming ability After the
enumeration of primary methycellulose colonies cultures were
harvested, washed with PBS and 10,000 of said cells were plated in
another methycellulose culture to determine the ability of these
cells to form colonies a second time (FIG. 25B). These secondary
cultures were enumerated after another 12-14 days of culture. The
ability of bone marrow that over-expresses NR2F6 to form a far
greater number of secondary colonies compared to control bone
marrow demonstrates that over-expression of NR2F6 increases
hematopoietic cell self-renewal and inhibits the terminal
differentiation of hematopoietic cells.
[0203] Knock down of NR2F6 using short-hairpin RNAs induces
differentiation and maturation of 32Dcl3 mouse hematopoietic cells
(FIG. 26). Cytospins of cells transduced with either the pSiren
universal negative control retroviral plasmid, or an shRNA
retroviral plasmid that targets mouse NR2F6 induces the
differentiation and maturation of 32Dcl3 cells demonstrate the
knock down of NR2F6 induces spontaneous myeloid cell
differentiation (FIG. 26A). Flow cytometry on 32Dcl3 mouse
hematopoietic cells transduced with either the pSiren universal
negative control retroviral plasmid or an shRNA retroviral plasmid
that targets the mouse NR2F6, confirms that knockdown of NR2F6
induces spontaneous myeloid cell differentiation (FIG. 26B).
[0204] Knock down of NR2F6 using short-hairpin RNAs induces
terminal differentiation, blood cell maturation death of U937 human
leukemia cells (FIG. 27). Cytospins of cells transduced with either
the pSiren universal negative control retroviral plasmid, or an
shRNA retroviral plasmid that targets human NR2F6 induces the
differentiation and maturation of U937 cells demonstrate the knock
down of NR2F6 induces spontaneous myeloid cell differentiation
(FIG. 27A). Flow cytometry on U937 human myelomonocytic leukemia
cells transduced with either the pSiren universal negative control
retroviral plasmid or an shRNA retroviral plasmid that targets the
human NR2F6, confirms that knockdown of NR2F6 induces spontaneous
myeloid cell differentiation (FIG. 27B).
[0205] Knock down of NR2F6 expression using short hairpin RNA
(shNR2F6) was then shown to promote the differentiation of immature
bone marrow cells in suspension culture when compared to the
scrambled shRNA control (scrm) (FIGS. 28 and 29). Murine bone
marrow cells were cultured in conditions that preserved stem cell
maintenance (c-kit ligand; thrombopoietin; and Flt3 ligand in OP9
conditioned medium) and transduced with either an shRNA targeting
NR2F6 or a scrambled control shRNA. Following seven days in culture
cells were analysed by flow cytometry. Knocking down the expression
of NR2F6 dramatically reduced the number of immature cells, i.e.
cells devoid of markers of lineage commitment (FIG. 28), and of
stem cells (ckit+Sca-1+lineage-, KSL cells) (FIG. 29). Rather,
knock down of NR2F6 promoted the differentiation and maturation of
bone marrow cells into neutrophils, as shown by flow cytometry
(FIG. 30) and morphology (FIG. 31).
[0206] It has been reported that NR2F6 exerts its regulatory
effects primarily as a transcriptional repressor (Liu, X., Huang,
X., and Sigmund, C.D. (2003). Identification of a nuclear orphan
receptor (Ear2) as a negative regulator of renin gene
transcription. Circ Res 92, 1033-1040). The repressor activity of
nuclear receptors is mediated by recruitment of corepressors with
histone deacetylase (HDAC) activity; we therefore evaluated the
importance of this mechanism in the effects of NR2F6 on
haematopoiesis and evaluated weather the activity of NR2F6 can be
modulated with an HDAC inhibitor. 32Dcl3-NR2F6 cells were incubated
with the non-specific histone deacetylase inhibitor sodium butyrate
prior to treatment with G-CSF. Whereas non-treated 32Dcl3-NR2F6
cells failed to differentiate in response to GCSF, sodium butyrate
pretreated cells showed recovery of G-CSF induced differentiation
as indicated by cell surface CD11b expression (FIG. 32). Thus,
HDAC-mediated transcriptional repression likely accounts for at
least part of the mechanism by which NR2F6 impairs hematopoietic
differentiation; and hence the activity of NR2F6 can be modulated
using HDAC inhibitors.
[0207] While the present disclosure has been described with
reference to what are presently considered to be the preferred
examples, it is to be understood that the disclosure is not limited
to the disclosed examples. To the contrary, the disclosure is
intended to cover various modifications and equivalent arrangements
included within the spirit and scope of the appended claims.
[0208] All publications, patents and patent applications are herein
incorporated by reference in their entirety to the same extent as
if each individual publication, patent or patent application was
specifically and individually indicated to be incorporated by
reference in its entirety.
TABLE-US-00001 TABLE 1 Nucleotide and Amino Acid sequence of NR2F6
mRNA sequence of human NR2F6 Genbank ID BC063018: (SEQ ID NO: 1)
cgagaggggt gcccggaggg aagagcgcgg tgggggcgcc ccggccccgc tgccctgggg
ctatggccat ggtgaccggc ggctggggcg gccccggcgg cgacacgaac ggcgtggaca
aggcgggcgg ctacccgcgc gcggccgagg acgactcggc ctcgcccccc ggtgccgcca
gcgacgccga gccgggcgac gaggagcggc cggggctgca ggtggactgc gtggtgtgcg
gggacaagtc gagcggcaag cattacggtg tcttcacctg cgagggctgc aagagctttt
tcaagcgaag catccgccgc aacctcagct acacctgccg gtccaaccgt gactgccaga
tcgaccagca ccaccggaat cagtgccagt actgccgtct caagaagtgc ttccgggtgg
gcatgaggaa ggaggcggtg cagcgcggcc gcatcccgca ctcgctgcct ggtgccgtgg
ccgcctcctc gggcagcccc ccgggctcgg cgctggcggc agtggcgagc ggcggagacc
tcttcccggg gcagccggtg tccgaactga tcgcgcagct gctgcgcgct gagccctacc
ctgcggcggc cggacgcttc ggcgcagggg gcggcgcggc gggcgcagtg ctgggcatcg
acaacgtgtg cgagctggcg gcgcggctgc tcttcagcac cgtggagtgg gcgcgccacg
cgcccttctt ccccgagctg ccggtggccg accaggtggc gctgctgcgc ctgagctgga
gcgagctctt cgtgctgaac gcggcgcagg cggcgctgcc cctgcacacg gcgccgctac
tggccgccgc cggcctccac gccgcgccta tggccgccga gcgcgccgtg gctttcatgg
accaggtgcg cgccttccag gagcaggtgg acaagctggg ccgcctgcag gtcgactcgg
ccgagtatgg ctgcctcaag gccatcgcgc tcttcacgcc cgacgcctgt ggcctctcag
acccggccca cgttgagagc ctgcaggaga aggcgcaggt ggccctcacc gagtatgtgc
gggcgcagta cccgtcccag ccccagcgct tcgggcgcct gctgctgcgg ctccccgccc
tgcgcgcggt ccctgcctcc ctcatctccc agctgttctt catgcgcctg gtggggaaga
cgcccattga gacactgatc agagacatgc tgctgtcggg gagtaccttc aactggccCt
acggctcggg ccagtgacca tgacggggcc acgtgtgctg tggccaggcc tgcagacaga
cctcaaggga cagggaatgc tgaggcctcg aggggcctcc cggggcccag gactctggct
tctctcctca gacttctatt ttttaaagac tgtgaaatgt ttgtcttttc tgttttttaa
atgatcatga aaccaaaaag agactgatca tccaggcctc agcctcatcc tccccaggac
ccctgtccag gatggagggt ccaatcctag gacagccttg ttcctcagca cccctagcat
gaacttgtgg gatggtgggg ttggcttccc tggcatgatg gacaaaggcc tggcgtcggc
cagaggggct gctccagtgg gcaggggtag ctagcgtgtg ccaggcagat cctctggaca
cgtaacctat gtcagacact acatgatgac tcaaggccaa taataaagac atttcctacc
tgcacaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaa mRNA sequence of
mouse NR2F6 Genbank ID BC008138.1: (SEQ ID NO:4) cggacgcgtg
ggcgggggcg cccgcgcgcg ctcggatggt gagccactaa gttggcctgg gcggcggggc
cgggccatgg cccccgcgac gctaccgggt ccccaggact ccggaccacg ggacctgggc
gccccagact cgcgcctcta gcgcgccccc gtcgaccgcg ggcacgcgtg ggaaagttgg
cctggaaccg gcccgaccag ttcctgcctg gcgcgcggac cggccgcagg aagttgccgc
aaaacttttt tcaggggggt gtgcgaccgg agccccccga gagcgcgggc tgcatgcgcc
cggggtagcc gggtccctct cgggtcgcca ggcgtgccca gaggggacgg actcgtcccg
gggcgtcccg gccccgctgt ctccggggct atggccatgg tgaccggtgg ctggggcgac
cccggaggcg acacgaacgg cgtggacaag gctggtggga gctacccacg cgcgaccgag
gacgattcgg cgtcacctcc cggggcgacc agcgacgcgg agccgggcga cgaggagcgt
ccggggttgc aggtggactg cgtggtgtgc ggggacaagt ccagtggaaa gcattacggc
gtgttcacct gcgagggctg caagagtttc ttcaagcgca gcatccgccg caatctcagc
tacacctgcc ggtccaaccg tgactgtcag attgatcagc accaccggaa ccagtgtcag
tactgtcggc tcaagaagtg cttccgggtg ggcatgcgca aggaggccgt gcagcgaggc
cgcatcccgc atgcgctccc cggtccagcg gcctgcagtc ccccgggcgc gacgggcgtc
gaacctttca cggggccgcc agtgtccgag ctgattgcgc agctgctgcg tgctgagccc
taccccgcgg ccggacgctt tggtggcggc ggcgctgtac tgggcatcga caacgtgtgc
gagttggcgg cacgcctgct gttcagcacg gtcgagtggg cccgccacgc gcccttcttc
cccgagctgc cggccgccga ccaggtggcg ctgctgcggc tcagctggag tgagctcttc
gtgctgaacg cggcgcaggc ggcgctgccg ctgcatacgg caccgctgct ggccgccgcg
gggttgcatg ccgcgcccat ggcagccgag cgggccgtgg ccttcatgga ccaggtgcgt
gccttccagg agcaggtgga caagctgggc cgcctgcagg tggatgctgc ggagtacggc
tgcctcaagg ccatcgcgct cttcacgcct gatgcctgtg gcctttctga cccagcccat
gtggagagcc tgcaggagaa ggcacaggtg gccctcaccg agtatgtgcg tgcccagtac
ccatcgcagc cccagcgctt tgggcgtctg ctgctgcggc tgccagccct gcgtgctgtg
cccgcatccc tcatctccca gctcttcttc atgcgcctgg tgggcaagaC acccatcgag
accctcatcc gggacatgct tctgtcaggg agcaccttta actggcccta tggctcgggc
tagtgatagt caccttccag gacacacatg gaaactgggg ccttgtgggg accctgggga
tcagggcccc agcttctctt ttgagactga tttctttttt taaagactgt gaaatgtttg
ttttgtttta ttttttaaat aatcatgaaa ccaaaaagat ttggatctcc caggccctag
ccttgtcctg gcagaccttc aacagtctgg agccagcatg ctggtgcctc tggtgtcatg
ggtatctgga aaggccactg cagctaggca ggagtactat gggccaggag gatcccctgg
atacatggtc cacggagggc accatgggat gatgaaaacc tggccaataa taaaggtatt
cccttaaaaa aaaaaaaaaa aaaaaaaaa Protein sequence of human NR2F6
(SEQ ID NO: 2) mamvtggwgg pggdtngvdk aggypraaed dsasppgaas
daepgdeerp glqvdcvvcg dkssgkhygv ftcegcksff krsirrnlsy tcrsnrdcqi
dqhhrnqcqy crlkkcfrvg mrkeavqrgr iphslpgava assgsppgsa laavasggdl
fpgqpvseli aqllraepyp aaagrfgagg gaagavlgid nvcelaarll fstvewarha
pffpelpvad qvallrlsws elfvlnaaqa alplhtapll aaaglhaapm aaeravafmd
qvrafqeqvd klgrlqvdsa eygclkaial ftpdacglsd pahveslqek aqvalteyvr
aqypsqpqrf grlllrlpal ravpaslisq lffmrlvgkt pietlirdml lsgstfnwpy
gsgq Protein sequence of mouse NR2F6 (SEQ ID NO: 3) mamvtggwgd
pggdtngvdk aggsyprate ddsasppgat sdaepgdeer pglqvdcvvc gdkssgkhyg
vftcegcksf fkrsirrnls ytcrsnrdcq idqhhrnqcq ycrlkkcfrv gmrkeavqrg
riphalpgpa acsppgatgv epftgppvse liaqllraep ypaagrfggg gavlgidnvc
elaarllfst vewarhapff pelpaadqva llrlswself vlnaaqaalp lhtapllaaa
glhaapmaae ravafmdqvr afqeqvdklg rlqvdaaeyq clkaialftp dacglsdpah
veslqekaqv alteyvraqy psqpqrfgrl llrlpalrav paslisqlff mrlvgktpie
tlirdmllsg stfnwpygsg Mus shNR2F6 sequence (SEQ ID NO: 5)
GATCCGCATTACGGCGTGTTCACCTTCAAGAGAGGTGAACACGCCGTAAT GCTTTTTTCTAGAG
Human shNR2F6 sequence (SEQ ID NO: 6)
GATCCGCATTACGGTGTCTTCACCTTCAAGAGAGGTGAAGACACCGTAAT GCTTTTTTCTAGAG
Sequence CWU 1
1
1011783DNAHomo sapiens 1cgagaggggt gcccggaggg aagagcgcgg tgggggcgcc
ccggccccgc tgccctgggg 60ctatggccat ggtgaccggc ggctggggcg gccccggcgg
cgacacgaac ggcgtggaca 120aggcgggcgg ctacccgcgc gcggccgagg
acgactcggc ctcgcccccc ggtgccgcca 180gcgacgccga gccgggcgac
gaggagcggc cggggctgca ggtggactgc gtggtgtgcg 240gggacaagtc
gagcggcaag cattacggtg tcttcacctg cgagggctgc aagagctttt
300tcaagcgaag catccgccgc aacctcagct acacctgccg gtccaaccgt
gactgccaga 360tcgaccagca ccaccggaat cagtgccagt actgccgtct
caagaagtgc ttccgggtgg 420gcatgaggaa ggaggcggtg cagcgcggcc
gcatcccgca ctcgctgcct ggtgccgtgg 480ccgcctcctc gggcagcccc
ccgggctcgg cgctggcggc agtggcgagc ggcggagacc 540tcttcccggg
gcagccggtg tccgaactga tcgcgcagct gctgcgcgct gagccctacc
600ctgcggcggc cggacgcttc ggcgcagggg gcggcgcggc gggcgcagtg
ctgggcatcg 660acaacgtgtg cgagctggcg gcgcggctgc tcttcagcac
cgtggagtgg gcgcgccacg 720cgcccttctt ccccgagctg ccggtggccg
accaggtggc gctgctgcgc ctgagctgga 780gcgagctctt cgtgctgaac
gcggcgcagg cggcgctgcc cctgcacacg gcgccgctac 840tggccgccgc
cggcctccac gccgcgccta tggccgccga gcgcgccgtg gctttcatgg
900accaggtgcg cgccttccag gagcaggtgg acaagctggg ccgcctgcag
gtcgactcgg 960ccgagtatgg ctgcctcaag gccatcgcgc tcttcacgcc
cgacgcctgt ggcctctcag 1020acccggccca cgttgagagc ctgcaggaga
aggcgcaggt ggccctcacc gagtatgtgc 1080gggcgcagta cccgtcccag
ccccagcgct tcgggcgcct gctgctgcgg ctccccgccc 1140tgcgcgcggt
ccctgcctcc ctcatctccc agctgttctt catgcgcctg gtggggaaga
1200cgcccattga gacactgatc agagacatgc tgctgtcggg gagtaccttc
aactggccct 1260acggctcggg ccagtgacca tgacggggcc acgtgtgctg
tggccaggcc tgcagacaga 1320cctcaaggga cagggaatgc tgaggcctcg
aggggcctcc cggggcccag gactctggct 1380tctctcctca gacttctatt
ttttaaagac tgtgaaatgt ttgtcttttc tgttttttaa 1440atgatcatga
aaccaaaaag agactgatca tccaggcctc agcctcatcc tccccaggac
1500ccctgtccag gatggagggt ccaatcctag gacagccttg ttcctcagca
cccctagcat 1560gaacttgtgg gatggtgggg ttggcttccc tggcatgatg
gacaaaggcc tggcgtcggc 1620cagaggggct gctccagtgg gcaggggtag
ctagcgtgtg ccaggcagat cctctggaca 1680cgtaacctat gtcagacact
acatgatgac tcaaggccaa taataaagac atttcctacc 1740tgcacaaaaa
aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaa 17832404PRTHomo sapiens 2Met
Ala Met Val Thr Gly Gly Trp Gly Gly Pro Gly Gly Asp Thr Asn1 5 10
15Gly Val Asp Lys Ala Gly Gly Tyr Pro Arg Ala Ala Glu Asp Asp Ser
20 25 30Ala Ser Pro Pro Gly Ala Ala Ser Asp Ala Glu Pro Gly Asp Glu
Glu 35 40 45Arg Pro Gly Leu Gln Val Asp Cys Val Val Cys Gly Asp Lys
Ser Ser 50 55 60Gly Lys His Tyr Gly Val Phe Thr Cys Glu Gly Cys Lys
Ser Phe Phe65 70 75 80Lys Arg Ser Ile Arg Arg Asn Leu Ser Tyr Thr
Cys Arg Ser Asn Arg 85 90 95Asp Cys Gln Ile Asp Gln His His Arg Asn
Gln Cys Gln Tyr Cys Arg 100 105 110Leu Lys Lys Cys Phe Arg Val Gly
Met Arg Lys Glu Ala Val Gln Arg 115 120 125Gly Arg Ile Pro His Ser
Leu Pro Gly Ala Val Ala Ala Ser Ser Gly 130 135 140Ser Pro Pro Gly
Ser Ala Leu Ala Ala Val Ala Ser Gly Gly Asp Leu145 150 155 160Phe
Pro Gly Gln Pro Val Ser Glu Leu Ile Ala Gln Leu Leu Arg Ala 165 170
175Glu Pro Tyr Pro Ala Ala Ala Gly Arg Phe Gly Ala Gly Gly Gly Ala
180 185 190Ala Gly Ala Val Leu Gly Ile Asp Asn Val Cys Glu Leu Ala
Ala Arg 195 200 205Leu Leu Phe Ser Thr Val Glu Trp Ala Arg His Ala
Pro Phe Phe Pro 210 215 220Glu Leu Pro Val Ala Asp Gln Val Ala Leu
Leu Arg Leu Ser Trp Ser225 230 235 240Glu Leu Phe Val Leu Asn Ala
Ala Gln Ala Ala Leu Pro Leu His Thr 245 250 255Ala Pro Leu Leu Ala
Ala Ala Gly Leu His Ala Ala Pro Met Ala Ala 260 265 270Glu Arg Ala
Val Ala Phe Met Asp Gln Val Arg Ala Phe Gln Glu Gln 275 280 285Val
Asp Lys Leu Gly Arg Leu Gln Val Asp Ser Ala Glu Tyr Gly Cys 290 295
300Leu Lys Ala Ile Ala Leu Phe Thr Pro Asp Ala Cys Gly Leu Ser
Asp305 310 315 320Pro Ala His Val Glu Ser Leu Gln Glu Lys Ala Gln
Val Ala Leu Thr 325 330 335Glu Tyr Val Arg Ala Gln Tyr Pro Ser Gln
Pro Gln Arg Phe Gly Arg 340 345 350Leu Leu Leu Arg Leu Pro Ala Leu
Arg Ala Val Pro Ala Ser Leu Ile 355 360 365Ser Gln Leu Phe Phe Met
Arg Leu Val Gly Lys Thr Pro Ile Glu Thr 370 375 380Leu Ile Arg Asp
Met Leu Leu Ser Gly Ser Thr Phe Asn Trp Pro Tyr385 390 395 400Gly
Ser Gly Gln3390PRTMus musculus 3Met Ala Met Val Thr Gly Gly Trp Gly
Asp Pro Gly Gly Asp Thr Asn1 5 10 15Gly Val Asp Lys Ala Gly Gly Ser
Tyr Pro Arg Ala Thr Glu Asp Asp 20 25 30Ser Ala Ser Pro Pro Gly Ala
Thr Ser Asp Ala Glu Pro Gly Asp Glu 35 40 45Glu Arg Pro Gly Leu Gln
Val Asp Cys Val Val Cys Gly Asp Lys Ser 50 55 60Ser Gly Lys His Tyr
Gly Val Phe Thr Cys Glu Gly Cys Lys Ser Phe65 70 75 80Phe Lys Arg
Ser Ile Arg Arg Asn Leu Ser Tyr Thr Cys Arg Ser Asn 85 90 95Arg Asp
Cys Gln Ile Asp Gln His His Arg Asn Gln Cys Gln Tyr Cys 100 105
110Arg Leu Lys Lys Cys Phe Arg Val Gly Met Arg Lys Glu Ala Val Gln
115 120 125Arg Gly Arg Ile Pro His Ala Leu Pro Gly Pro Ala Ala Cys
Ser Pro 130 135 140Pro Gly Ala Thr Gly Val Glu Pro Phe Thr Gly Pro
Pro Val Ser Glu145 150 155 160Leu Ile Ala Gln Leu Leu Arg Ala Glu
Pro Tyr Pro Ala Ala Gly Arg 165 170 175Phe Gly Gly Gly Gly Ala Val
Leu Gly Ile Asp Asn Val Cys Glu Leu 180 185 190Ala Ala Arg Leu Leu
Phe Ser Thr Val Glu Trp Ala Arg His Ala Pro 195 200 205Phe Phe Pro
Glu Leu Pro Ala Ala Asp Gln Val Ala Leu Leu Arg Leu 210 215 220Ser
Trp Ser Glu Leu Phe Val Leu Asn Ala Ala Gln Ala Ala Leu Pro225 230
235 240Leu His Thr Ala Pro Leu Leu Ala Ala Ala Gly Leu His Ala Ala
Pro 245 250 255Met Ala Ala Glu Arg Ala Val Ala Phe Met Asp Gln Val
Arg Ala Phe 260 265 270Gln Glu Gln Val Asp Lys Leu Gly Arg Leu Gln
Val Asp Ala Ala Glu 275 280 285Tyr Gly Cys Leu Lys Ala Ile Ala Leu
Phe Thr Pro Asp Ala Cys Gly 290 295 300Leu Ser Asp Pro Ala His Val
Glu Ser Leu Gln Glu Lys Ala Gln Val305 310 315 320Ala Leu Thr Glu
Tyr Val Arg Ala Gln Tyr Pro Ser Gln Pro Gln Arg 325 330 335Phe Gly
Arg Leu Leu Leu Arg Leu Pro Ala Leu Arg Ala Val Pro Ala 340 345
350Ser Leu Ile Ser Gln Leu Phe Phe Met Arg Leu Val Gly Lys Thr Pro
355 360 365Ile Glu Thr Leu Ile Arg Asp Met Leu Leu Ser Gly Ser Thr
Phe Asn 370 375 380Trp Pro Tyr Gly Ser Gly385 39041959DNAMus
musculus 4cggacgcgtg ggcgggggcg cccgcgcgcg ctcggatggt gagccactaa
gttggcctgg 60gcggcggggc cgggccatgg cccccgcgac gctaccgggt ccccaggact
ccggaccacg 120ggacctgggc gccccagact cgcgcctcta gcgcgccccc
gtcgaccgcg ggcacgcgtg 180ggaaagttgg cctggaaccg gcccgaccag
ttcctgcctg gcgcgcggac cggccgcagg 240aagttgccgc aaaacttttt
tcaggggggt gtgcgaccgg agccccccga gagcgcgggc 300tgcatgcgcc
cggggtagcc gggtccctct cgggtcgcca ggcgtgccca gaggggacgg
360actcgtcccg gggcgtcccg gccccgctgt ctccggggct atggccatgg
tgaccggtgg 420ctggggcgac cccggaggcg acacgaacgg cgtggacaag
gctggtggga gctacccacg 480cgcgaccgag gacgattcgg cgtcacctcc
cggggcgacc agcgacgcgg agccgggcga 540cgaggagcgt ccggggttgc
aggtggactg cgtggtgtgc ggggacaagt ccagtggaaa 600gcattacggc
gtgttcacct gcgagggctg caagagtttc ttcaagcgca gcatccgccg
660caatctcagc tacacctgcc ggtccaaccg tgactgtcag attgatcagc
accaccggaa 720ccagtgtcag tactgtcggc tcaagaagtg cttccgggtg
ggcatgcgca aggaggccgt 780gcagcgaggc cgcatcccgc atgcgctccc
cggtccagcg gcctgcagtc ccccgggcgc 840gacgggcgtc gaacctttca
cggggccgcc agtgtccgag ctgattgcgc agctgctgcg 900tgctgagccc
taccccgcgg ccggacgctt tggtggcggc ggcgctgtac tgggcatcga
960caacgtgtgc gagttggcgg cacgcctgct gttcagcacg gtcgagtggg
cccgccacgc 1020gcccttcttc cccgagctgc cggccgccga ccaggtggcg
ctgctgcggc tcagctggag 1080tgagctcttc gtgctgaacg cggcgcaggc
ggcgctgccg ctgcatacgg caccgctgct 1140ggccgccgcg gggttgcatg
ccgcgcccat ggcagccgag cgggccgtgg ccttcatgga 1200ccaggtgcgt
gccttccagg agcaggtgga caagctgggc cgcctgcagg tggatgctgc
1260ggagtacggc tgcctcaagg ccatcgcgct cttcacgcct gatgcctgtg
gcctttctga 1320cccagcccat gtggagagcc tgcaggagaa ggcacaggtg
gccctcaccg agtatgtgcg 1380tgcccagtac ccatcgcagc cccagcgctt
tgggcgtctg ctgctgcggc tgccagccct 1440gcgtgctgtg cccgcatccc
tcatctccca gctcttcttc atgcgcctgg tgggcaagac 1500acccatcgag
accctcatcc gggacatgct tctgtcaggg agcaccttta actggcccta
1560tggctcgggc tagtgatagt caccttccag gacacacatg gaaactgggg
ccttgtgggg 1620accctgggga tcagggcccc agcttctctt ttgagactga
tttctttttt taaagactgt 1680gaaatgtttg ttttgtttta ttttttaaat
aatcatgaaa ccaaaaagat ttggatctcc 1740caggccctag ccttgtcctg
gcagaccttc aacagtctgg agccagcatg ctggtgcctc 1800tggtgtcatg
ggtatctgga aaggccactg cagctaggca ggagtactat gggccaggag
1860gatcccctgg atacatggtc cacggagggc accatgggat gatgaaaacc
tggccaataa 1920taaaggtatt cccttaaaaa aaaaaaaaaa aaaaaaaaa
1959564DNAArtificial SequenceMus shNR2F6 sequence 5gatccgcatt
acggcgtgtt caccttcaag agaggtgaac acgccgtaat gcttttttct 60agag
64664DNAArtificial SequenceHuman shNR2F6 sequence 6gatccgcatt
acggtgtctt caccttcaag agaggtgaag acaccgtaat gcttttttct 60agag
64721DNAArtificial SequencePrimer 7tctcccagct gttcttcatg c
21820DNAArtificial SequencePrimer 8ccagttgaag gtactccccg
20920DNAArtificial SequencePrimer 9ggcctccaag gagtaagacc
201020DNAArtificial SequencePrimer 10aggggtctac atggcaactg 20
* * * * *