U.S. patent application number 11/632141 was filed with the patent office on 2010-05-27 for methods and materials for determining pain sensitivity and predicting and treating related disorders.
Invention is credited to Luda B. Diatchenko, William Maixner, Andrea Gail Neeley, Gary Slade.
Application Number | 20100132058 11/632141 |
Document ID | / |
Family ID | 37595553 |
Filed Date | 2010-05-27 |
United States Patent
Application |
20100132058 |
Kind Code |
A1 |
Diatchenko; Luda B. ; et
al. |
May 27, 2010 |
Methods and materials for determining pain sensitivity and
predicting and treating related disorders
Abstract
Methods of treating somatosensory disorders and modulating
production of proinflammatory cytokines by administering to a
subject an effective amount of a COMT modulator, ADRB2 modulator,
ADRB3 modulator or combinations thereof are provided. Methods of
predicting effective pharmacological therapies for a subject
afflicted with a somatosensory disorder by determining a genotype
of the subject with regard to a gene selected from the group
consisting of COMT, ADRB2, ADRB3, and combinations thereof are
further provided. Methods of determining pain responses or pain
perception and predicting susceptibility of a subject to develop
related disorders, such as somatosensory disorders and
somatization, by determining a genotype of the subject with regard
to a gene selected from the group consisting of COMT, ADRB2, ADRB3,
and combinations thereof are further provided.
Inventors: |
Diatchenko; Luda B.; (Chapel
Hill, NC) ; Maixner; William; (Chapel Hill, NC)
; Slade; Gary; (South Australia, AU) ; Neeley;
Andrea Gail; (Durham, NC) |
Correspondence
Address: |
JENKINS, WILSON, TAYLOR & HUNT, P. A.
Suite 1200 UNIVERSITY TOWER, 3100 TOWER BLVD.,
DURHAM
NC
27707
US
|
Family ID: |
37595553 |
Appl. No.: |
11/632141 |
Filed: |
July 25, 2005 |
PCT Filed: |
July 25, 2005 |
PCT NO: |
PCT/US05/26201 |
371 Date: |
July 2, 2009 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60590792 |
Jul 23, 2004 |
|
|
|
60671855 |
Apr 15, 2005 |
|
|
|
Current U.S.
Class: |
800/9 ; 435/6.11;
514/278; 514/401; 514/651 |
Current CPC
Class: |
C12N 2310/14 20130101;
C12N 15/1138 20130101; C12Q 2600/158 20130101; C12Q 1/6881
20130101; G16B 20/00 20190201; C12Q 2600/156 20130101; Y02A 90/24
20180101; Y02A 90/10 20180101; C12Q 2600/106 20130101; C12Q
2600/172 20130101; C12Y 201/01006 20130101; Y02A 90/26 20180101;
C12N 15/1137 20130101; C12Q 1/6883 20130101 |
Class at
Publication: |
800/9 ; 435/6;
514/401; 514/651; 514/278 |
International
Class: |
A01K 67/00 20060101
A01K067/00; C12Q 1/68 20060101 C12Q001/68; A61K 31/415 20060101
A61K031/415; A61K 31/135 20060101 A61K031/135; A61K 31/438 20060101
A61K031/438 |
Goverment Interests
GOVERNMENT INTEREST
[0002] This invention was made with Government support under Grant
No. DE07509, DE16558, and NS045688.sub.-- awarded by the National
Institutes of Health. The Government has certain rights in the
invention.
Claims
1. A method of treating a somatosensory disorder in a subject,
comprising administering to the subject an effective amount of a
COMT modulator, an ADRB2 modulator, an ADRB3 modulator, or
combinations thereof.
2. The method of claim 1, wherein the somatosensory disorder is
selected from the group consisting of chronic pain conditions,
fibromyalgia syndrome, tension headache, migraine headache, phantom
limb sensations, irritable bowel syndrome, chronic lower back pain,
chronic fatigue, multiple chemical sensitivities, temporomandibular
joint disorder, post-traumatic stress disorder, chronic idiopathic
pelvic pain, Gulf War Syndrome, vulvar vestibulitis,
osteoarthritis, rheumatoid arthritis, and angina pectoris.
3. The method of claim 1, wherein the ADRB2 modulator is an ADRB2
antagonist, the ADRB3 modulator is an ADRB3 antagonist, and the
COMT modulator is a COMT activator.
4. The method of claim 3, wherein both the ADRB2 antagonist and the
ADRB3 antagonist are administered to the subject.
5. The method of claim 1, further comprising determining a genotype
of the subject with respect to a gene selected from the group
consisting of ADRB2, ADRB3, COMT, and combinations thereof and
administering to the subject the effective amount of the COMT
modulator, the ADRB2 modulator, the ADRB3 modulator, or
combinations thereof based on determined genotype of the
subject.
6. The method of claim 5, wherein determining the genotype of the
subject comprises: (i) identifying at least one haplotype of ADRB2,
ADRB3, COMT or combinations thereof; (ii) identifying at least one
polymorphism unique to at least one haplotype of ADRB2, ADRB3,
COMT, or combinations thereof; (iii) identifying at least one
polymorphism exhibiting high linkage disequilibrium to at least one
polymorphism unique to the at least one ADRB2 haplotype, ADRB3
haplotype, COMT haplotype, or combinations thereof; or (iv)
identifying at least one polymorphism exhibiting high linkage
disequilibrium to at least one ADRB2 haplotype, ADRB3 haplotype,
COMT haplotype, or combinations thereof.
7. The method of claim 5, wherein the ADRB2 genotype is selected
from the group consisting of Haplotype 1, Haplotype 2, Haplotype 3,
and Uncommon; the ADRB3 genotype is selected from the group
consisting of Haplotype 1, Haplotype 2, Haplotype 3, and Uncommon;
and the COMT genotype is selected from the group consisting of low
pain sensitive haplotype (LPS), average pain sensitive haplotype
(APS), and high pain sensitive haplotype (HPS).
8. The method of claim 7, wherein the determined genotype of the
subject with respect to ADRB2 is selected from the group consisting
of two copies of Haplotype 2, two copies of Haplotype 3, one copy
of both Haplotype 2 and Haplotype 3, and at least one copy of
Uncommon and the somatosensory disorder is treated by administering
the ADRB2 modulator, the COMT modulator, or combinations thereof to
the subject.
9. The method of claim 7, wherein the determined genotype of the
subject with respect to ADRB3 is selected from the group consisting
of two copies of Haplotype 1, and at least one copy of Uncommon and
the somatosensory disorder is treated by administering the ADRB3
modulator, the COMT modulator, or combinations thereof to the
subject.
10. The method of claim 7, wherein the determined genotype of the
subject with respect to COMT is selected from the group consisting
of two copies of APS, two copies of HPS, and one copy of both APS
and HPS and the somatosensory disorder is treated by administering
the COMT modulator, the ADRB2 modulator, the ADRB3 modulator, or
combinations thereof to the subject.
11. A method of predicting susceptibility of a subject to develop a
somatosensory disorder, comprising: (a) determining a genotype of
the subject with respect to a gene selected from the group
consisting of ADRB2, ADRB3, COMT, and combinations thereof; and (b)
comparing the genotype of the subject with at least one reference
genotype associated with susceptibility to develop the
somatosensory disorder, wherein the reference genotype is selected
from the group consisting of an ADRB2 genotype, an ADRB3 genotype,
a COMT genotype, and combinations thereof, whereby susceptibility
of the subject to develop the somatosensory disorder is
predicted.
12. The method of claim 11, wherein determining the genotype of the
subject comprises: (i) identifying at least one haplotype of ADRB2,
ADRB3, COMT or combinations thereof; (ii) identifying at least one
polymorphism unique to at least one haplotype of ADRB2, ADRB3,
COMT, or combinations thereof; (iii) identifying at least one
polymorphism exhibiting high linkage disequilibrium to at least one
polymorphism unique to at least one ADRB2 haplotype, ADRB3
haplotype, COMT haplotype, or combinations thereof; or (iv)
identifying at least one polymorphism exhibiting high linkage
disequilibrium to at least one ADRB2 haplotype, ADRB3 haplotype,
COMT haplotype, or combinations thereof.
13. The method of claim 11, wherein the ADRB2 genotype of the
reference genotype is selected from the group consisting of
Haplotype 1, Haplotype 2, Haplotype 3, and Uncommon; the ADRB3
genotype of the reference genotype is selected from the group
consisting of Haplotype 1, Haplotype 2, Haplotype 3, and Uncommon;
and the COMT genotype of the reference genotype is selected from
the group consisting of low pain sensitive haplotype (LPS), average
pain sensitive haplotype (APS), and high pain sensitive haplotype
(HPS).
14. The method of claim 13, wherein the determined genotype of the
subject with respect to ADRB2 is selected from the group consisting
of two copies of Haplotype 1, two copies of Haplotype 2, two copies
of Haplotype 3, one copy of both Haplotype 2 and Haplotype 3, and
at least one copy of Uncommon and the subject is predicted to be
susceptible to develop the somatosensory disorder.
15. The method of claim 13, wherein the determined genotype of the
subject with respect to ADRB3 is selected from the group consisting
of two copies of Haplotype 1, and at least one copy of Uncommon and
the subject is predicted to be susceptible to develop the
somatosensory disorder.
16. The method of claim 13, wherein the determined genotype of the
subject with respect to COMT is selected from the group consisting
of two copies of APS, two copies of HPS, and one copy of both APS
and HPS and the subject is predicted to be susceptible to develop
the somatosensory disorder.
17. The method of claim 17, wherein the somatosensory disorder is
selected from the group consisting of chronic pain conditions,
fibromyalgia syndrome, tension headache, migraine headache, phantom
limb sensations, irritable bowel syndrome, chronic lower back pain,
chronic fatigue, multiple chemical sensitivities, temporomandibular
joint disorder, post-traumatic stress disorder, chronic idiopathic
pelvic pain, Gulf War Syndrome, vulvar vestibulitis,
osteoarthritis, rheumatoid arthritis, and angina pectoris.
18. A method of predicting a pain response in a subject,
comprising: (a) determining a genotype of the subject with respect
to a gene selected from the group consisting of ADRB2, ADRB3, COMT,
and combinations thereof; and (b) comparing the genotype of the
subject with at least one reference genotype associated with pain
response variability, wherein the reference genotype is selected
from the group consisting of an ADRB2 genotype, an ADRB3 genotype,
a COMT genotype, and combinations thereof, whereby pain response in
the subject is predicted.
19. The method of claim 18, wherein determining the genotype of the
subject comprises: (i) identifying at least one haplotype of ADRB2,
ADRB3, COMT or combinations thereof; (ii) identifying at least one
polymorphism unique to at least one haplotype of ADRB2, ADRB3,
COMT, or combinations thereof; (iii) identifying at least one
polymorphism exhibiting high linkage disequilibrium to at least one
polymorphism unique to at least one ADRB2 haplotype, ADRB3
haplotype, COMT haplotype, or combinations thereof; or (iv)
identifying at least one polymorphism exhibiting high linkage
disequilibrium to at least one ADRB2 haplotype, ADRB3 haplotype,
COMT haplotype, or combinations thereof.
20. The method of claim 18, wherein the ADRB2 genotype of the
reference genotype is selected from the group consisting of
Haplotype 1, Haplotype 2, and Haplotype 3; the ADRB3 genotype of
the reference genotype is selected from the group consisting of
Haplotype 1, Haplotype 2, and Haplotype 3; and the COMT genotype of
the reference genotype is selected from the group consisting of low
pain sensitive haplotype (LPS), average pain sensitive haplotype
(APS), and high pain sensitive haplotype (HPS).
21. The method of claim 20, wherein the determined genotype of the
subject with respect to ADRB2 is only one copy of Haplotype 1, and
the subject is predicted to have a decreased sensitivity to pain as
compared to a population norm.
22. The method of claim 20, wherein the determined genotype of the
subject with respect to ADRB3 is selected from the group consisting
of at least one copy of Haplotype 2 and at least one copy of
Haplotype 3 and the subject is predicted to have decreased
sensitivity to pain as compared to a population norm.
23. The method of claim 20, wherein the determined genotype of the
subject with respect to COMT is selected from the group consisting
of two copies of APS, two copies of HPS, and one copy of both APS
and HPS and the subject is predicted to have an increased
sensitivity to pain as compared to a population norm.
24. A method of predicting somatization in a subject, comprising:
(a) determining a genotype of the subject with respect to a gene
selected from the group consisting of ADRB2, ADRB3, COMT, and
combinations thereof; and (b) comparing the genotype of the subject
with at least one reference genotype associated with somatization,
wherein the reference genotype is selected from the group
consisting of an ADRB2 genotype, an ADRB3 genotype, a COMT
genotype, and combinations thereof.
25. The method of claim 24, wherein determining the genotype of the
subject comprises: (i) identifying at least one haplotype of ADRB2,
ADRB3, COMT or combinations thereof; (ii) identifying at least one
polymorphism unique to at least one haplotype of ADRB2, ADRB3,
COMT, or combinations thereof; (iii) identifying at least one
polymorphism exhibiting high linkage disequilibrium to at least one
polymorphism unique to at least one ADRB2 haplotype, ADRB3
haplotype, COMT haplotype, or combinations thereof; or (iv)
identifying at least one polymorphism exhibiting high linkage
disequilibrium to at least one ADRB2 haplotype, ADRB3 haplotype,
COMT haplotype, or combinations thereof.
26. The method of claim 24, wherein the ADRB2 genotype of the
reference genotype is selected from the group consisting of
Haplotype 1, Haplotype 2, Haplotype 3; the ADRB3 genotype of the
reference genotype is selected from the group consisting of
Haplotype 1, Haplotype 2, Haplotype 3; and the COMT genotype of the
reference genotype is selected from the group consisting of low
pain sensitive haplotype (LPS), average pain sensitive haplotype
(APS), and high pain sensitive haplotype (HPS).
27. The method of claim 26, wherein the determined genotype of the
subject with respect to ADRB2 is two copies of Haplotype 2, and the
subject is predicted to have increased somatization as compared to
a population norm.
28. The method of claim 26, wherein the determined genotype of the
subject with respect to ADRB3 is at least one copy of Haplotype 3,
and the subject is predicted to have a decreased somatization as
compared to a population norm.
29. The method of claim 26, wherein the determined genotype of the
subject with respect to COMT is selected from the group consisting
of two copies of APS, two copies of HPS, and one copy of both APS
and HPS and the subject is predicted to have an increased
somatization as compared to a population norm.
30. A method of selecting a therapy for a subject having a
somatosensory disorder, comprising: (a) determining a genotype of
the subject with respect to a gene selected from the group
consisting of ADRB2, ADRB3, COMT, and combinations thereof; and (b)
selecting a therapy based on the determined genotype of the
subject.
31. The method of claim 30, wherein determining the genotype of the
subject comprises: (i) identifying at least one haplotype of ADRB2,
ADRB3, COMT or combinations thereof; (ii) identifying at least one
polymorphism unique to at least one haplotype of ADRB2, ADRB3,
COMT, or combinations thereof; (iii) identifying at least one
polymorphism exhibiting high linkage disequilibrium to at least one
polymorphism unique to at least one ADRB2 haplotype, ADRB3
haplotype, COMT haplotype, or combinations thereof; or (iv)
identifying at least one polymorphism exhibiting high linkage
disequilibrium to at least one ADRB2 haplotype, ADRB3 haplotype,
COMT haplotype, or combinations thereof.
32. The method of claim 30, wherein the ADRB2 genotype of the
reference genotype is selected from the group consisting of
Haplotype 1, Haplotype 2, Haplotype 3, and Uncommon; the ADRB3
genotype of the reference genotype is selected from the group
consisting of Haplotype 1, Haplotype 2, Haplotype 3, and Uncommon;
and the COMT genotype of the reference genotype is selected from
the group consisting of low pain sensitive haplotype (LPS), average
pain sensitive haplotype (APS), and high pain sensitive haplotype
(HPS).
33. The method of claim 32, wherein the therapy is selected from
the group consisting of a pharmacological therapy, a behavioral
therapy, a psychotherapy, a surgical therapy, and combinations
thereof.
34. The method of claim 33, wherein the therapy is a
pharmacological therapy comprising administering to the subject an
effective amount of an ADRB2 modulator, an ADRB3 modulator, a COMT
modulator, or combinations thereof.
35. The method of claim 34, wherein the determined genotype of the
subject with respect to ADRB2 is selected from the group consisting
of two copies of Haplotype 2, two copies of Haplotype 3, one copy
of both Haplotype 2 and Haplotype 3, and an effective amount of an
ADRB2 modulator, a COMT modulator, or combinations thereof is
selected as a therapy.
36. The method of claim 34, wherein the determined genotype of the
subject with respect to ADRB3 is two copies of Haplotype 1, and an
effective amount of an ADRB2 modulator, a COMT modulator, or
combinations thereof is selected as a therapy.
37. The method of claim 34, wherein the determined genotype of the
subject with respect to COMT is selected from the group consisting
of two copies of APS, two copies of HPS, and one copy of both APS
and HPS and an effective amount of an ADRB2 modulator, an ADRB3
modulator, a COMT modulator, or combinations thereof is selected as
a therapy.
38. The method of claim 34, wherein the ADRB2 modulator is an ADRB2
antagonist, the ADRB3 modulator is an ADRB3 antagonist, and the
COMT modulator is a COMT activator.
39. The method of claim 38, wherein both the ADRB2 antagonist and
the ADRB3 antagonist are selected.
40. The method of claim 30, wherein the somatosensory disorder is
selected from the group consisting of chronic pain conditions,
fibromyalgia syndrome, tension headache, migraine headache, phantom
limb sensations, irritable bowel syndrome, chronic lower back pain,
chronic fatigue, multiple chemical sensitivities, temporomandibular
joint disorder, post-traumatic stress disorder, chronic idiopathic
pelvic pain, Gulf War Syndrome, vulvar vestibulitis,
osteoarthritis, rheumatoid arthritis, and angina pectoris.
41. A method of classifying a somatosensory disorder afflicting a
subject, comprising: (a) determining a genotype of the subject with
respect to a gene selected from the group consisting of ADRB2,
ADRB3, COMT, and combinations thereof; and (b) classifying the
somatosensory disorder into a genetic subclass somatosensory
disorder based on the determined genotype of the subject.
42. The method of claim 41, wherein determining the genotype of the
subject comprises: (i) identifying at least one haplotype of ADRB2,
ADRB3, COMT or combinations thereof; (ii) identifying at least one
polymorphism unique to at least one haplotype of ADRB2, ADRB3,
COMT, or combinations thereof; (iii) identifying at least one
polymorphism exhibiting high linkage disequilibrium to at least one
polymorphism unique to at least one ADRB2 haplotype, ADRB3
haplotype, COMT haplotype, or combinations thereof; or (iv)
identifying at least one polymorphism exhibiting high linkage
disequilibrium to at least one ADRB2 haplotype, ADRB3 haplotype,
COMT haplotype, or combinations thereof.
43. The method of claim 41, wherein the ADRB2 genotype is selected
from the group consisting of Haplotype 1, Haplotype 2, Haplotype 3,
and Uncommon; the ADRB3 genotype is selected from the group
consisting of Haplotype 1, Haplotype 2, Haplotype 3, and Uncommon;
and the COMT genotype is selected from the group consisting of low
pain sensitive haplotype (LPS), average pain sensitive haplotype
(APS), and high pain sensitive haplotype (HPS).
44. The method of claim 41, wherein classifying the somatosensory
disorder into the genetic subclass somatosensory disorder is
utilized to select an effective therapy for use in treating the
genetic subclass somatosensory disorder.
45. A method of modulating production of proinflammatory cytokines
in a subject, comprising administering to the subject an effective
amount of a COMT modulator, an ADRB2 modulator, an ADRB3 modulator,
or combinations thereof.
46. The method of claim 45, wherein the proinflammatory cytokines
are selected from the group consisting of IL-6, IL-1.alpha.,
IL-1.beta., TNF-.alpha., and combinations thereof.
47. The method of claim 45, wherein modulating production of
proinflammatory cytokines comprises inhibiting production of
proinflammatory cytokines.
48. The method of claim 45, wherein the ADRB2 modulator is an ADRB2
antagonist, the ADRB3 modulator is an ADRB3 antagonist, and the
COMT modulator is a COMT activator.
49. The method of claim 48, wherein both the ADRB2 antagonist and
the ADRB3 antagonist are administered to the subject.
50. The method of claim 45, further comprising determining a
genotype of the subject with respect to a gene selected from the
group consisting of ADRB2, ADRB3, COMT, and combinations thereof
and administering to the subject the effective amount of the COMT
modulator, the ADRB2 modulator, the ADRB3 modulator, or
combinations thereof based on the determined genotype of the
subject.
51. The method of claim 50, wherein determining the genotype of the
subject comprises: (i) identifying at least one haplotype of ADRB2,
ADRB3, COMT or combinations thereof; (ii) identifying at least one
polymorphism unique to at least one haplotype of ADRB2, ADRB3,
COMT, or combinations thereof; (iii) identifying at least one
polymorphism exhibiting high linkage disequilibrium to at least one
polymorphism unique to at least one ADRB2 haplotype, ADRB3
haplotype, COMT haplotype, or combinations thereof; or (iv)
identifying at least one polymorphism exhibiting high linkage
disequilibrium to at least one ADRB2 haplotype, ADRB3 haplotype,
COMT haplotype, or combinations thereof.
52. The method of claim 50, wherein the ADRB2 genotype of the
reference genotype is selected from the group consisting of
Haplotype 1, Haplotype 2, Haplotype 3, and Uncommon; the ADRB3
genotype of the reference genotype is selected from the group
consisting of Haplotype 1, Haplotype 2, Haplotype 3, and Uncommon;
and the COMT genotype of the reference genotype is selected from
the group consisting of low pain sensitive haplotype (LPS), average
pain sensitive haplotype (APS), and high pain sensitive haplotype
(HPS).
53. The method of claim 52, wherein the determined genotype of the
subject with respect to ADRB2 is selected from the group consisting
of two copies of Haplotype 2, two copies of Haplotype 3, one copy
of both Haplotype 2 and Haplotype 3, and the production of
proinflammatory cytokines in the subject is modulated by
administering the ADRB2 modulator, the COMT modulator, or
combinations thereof to the subject.
54. The method of claim 52, wherein the determined genotype of the
subject with respect to ADRB3 is selected from the group consisting
of two copies of Haplotype 1, and the production of proinflammatory
cytokines in the subject is modulated by administering the ADRB3
modulator, the COMT modulator, or combinations thereof to the
subject.
55. The method of claim 52, wherein the determined genotype of the
subject with respect to COMT is selected from the group consisting
of two copies of APS, two copies of HPS, and one copy of both APS
and HPS and the production of proinflammatory cytokines in the
subject is modulated by administering the COMT modulator, the ADRB2
modulator, the ADRB3 modulator, or combinations thereof to the
subject.
56. A method of producing a non-human animal model of a human
somatosensory disorder, comprising modulating COMT activity, ADRB2
activity, ADRB3 activity, or combinations thereof in the non-human
animal model to produce the non-human animal model of the human
somatosensory disorder.
57. The method of claim 56, wherein the non-human animal model is a
rodent.
58. The method of claim 56, wherein modulating COMT activity in the
non-human animal model comprises inhibiting COMT activity in the
non-human animal model.
59. The method of claim 58, wherein inhibiting COMT activity
comprises administering a COMT inhibitor to the non-human animal
model.
60. The method of claim 56, wherein the non-human animal model
exhibits an increase in production of proinflammatory
cytokines.
61. The method of claim 60, wherein the proinflammatory cytokines
are selected from the group consisting of IL-6, IL-1.beta.,
TNF-.alpha., IL-1.alpha. and combinations thereof.
62. The method of claim 56, wherein the somatosensory disorder is
selected from the group consisting of chronic pain disorders,
fibromyalgia syndrome, tension headache, migraine headache, phantom
limb sensations, irritable bowel syndrome, chronic lower back pain,
chronic fatigue, multiple chemical sensitivities, temporomandibular
joint disorder, post-traumatic stress disorder, chronic idiopathic
pelvic pain, Gulf War Syndrome, vulvar vestibulitis,
osteoarthritis, rheumatoid arthritis, and angina pectoris.
63. A non-human animal possessing modulated COMT activity,
modulated ADRB2 activity, modulated ADRB3, or combinations thereof,
wherein the non-human animal exhibits characteristics of a
somatosensory disorder.
64. The non-human animal of claim 63, wherein the non-human animal
is a genetically modified animal.
65. The method of claim 64, wherein the non-human animal is a
transgenic non-human animal that overexpresses ADRB2, ADRB3, or
both ADRB2 and ADRB3.
66. The non-human animal of claim 64, wherein the non-human animal
is a COMT knockout or knockdown animal.
67. A method of predicting COMT activity, ADRB2 activity, ADRB3
activity or combinations thereof in a subject, comprising: (a)
determining a genotype of the subject with respect to a gene
selected from the group consisting of ADRB2, ADRB3, COMT, and
combinations thereof; and (b) comparing the genotype of the subject
with at least one reference genotype associated with activity of
ADRB2, ADRB3, COMT, and combinations thereof, wherein the reference
genotype is selected from the group consisting of an ADRB2
genotype, an ADRB3 genotype, a COMT genotype, and combinations
thereof, whereby activity of COMT activity, ADRB2 activity, ADRB3
activity or combinations thereof is predicted.
68. The method of claim 68, wherein determining the genotype of the
subject comprises: (i) identifying at least one haplotype of COMT,
ADRB2, ADRB3, or combinations thereof; (ii) identifying at least
one polymorphism unique to the at least one haplotype of COMT,
ADRB2, ADRB3, or combinations thereof; (iii) identifying at least
one polymorphism exhibiting high linkage disequilibrium to at least
one polymorphism unique to the at least one COMT haplotype, ADRB2
haplotype, ADRB3 haplotype, or combinations thereof; or (iv)
identifying at least one polymorphism exhibiting high linkage
disequilibrium to at least one COMT haplotype, ADRB2 haplotype,
ADRB3 haplotype, or combinations thereof.
69. The method of claim 68, wherein the COMT genotype of the
reference genotype is selected from the group consisting of low
pain sensitive haplotype (LPS), average pain sensitive haplotype
(APS), and high pain sensitive haplotype (HPS); the ADRB2 genotype
of the reference genotype is selected from the group consisting of
Haplotype 1, Haplotype 2, Haplotype 3, and Uncommon; and the ADRB3
genotype of the reference genotype is selected from the group
consisting of Haplotype 1, Haplotype 2, Haplotype 3, and
Uncommon.
70. The method of claim 69, wherein the determined genotype of the
subject with respect to COMT is selected from the group consisting
of two copies of APS, two copies of HPS, and one copy of both APS
and HPS and the subject is predicted to have low COMT activity.
71. The method of claim 69, wherein the determined genotype of the
subject with respect to ADRB2 is selected from the group consisting
of two copies of Haplotype 1 and the subject is predicted to have
low ADRB2 activity.
72. The method of claim 69, wherein the determined genotype of the
subject with respect to ADRB2 is selected from the group consisting
of two copies of Haplotype 2, two copies of Haplotype 3, and one
copy of both Haplotype 2 and Haplotype 3, and the subject is
predicted to have high ADRB2 activity.
73. The method of claim 69, wherein the determined genotype of the
subject with respect to ADRB2 is selected from the group consisting
of two copies of Haplotype 3, and the subject is predicted to have
high ADRB2 activity in the resting stage and low ADRB2 activity in
response to an agonist
74. The method of claim 73, wherein the agonist is epinephrine.
75. The method of claim 69, wherein the determined genotype of the
subject with respect to ADRB3 is selected from the group consisting
of at least one copy of Haplotype 2, at least one copy of Haplotype
3 and the subject is predicted to have low ADRB3 activity.
76. The method of claim 71, wherein an effective dosage of a
therapeutic compound metabolized by COMT is determined for the
subject on the basis of the determined COMT genotype.
77. The method in claim 76 where the therapeutic compound is
selected from the group consisting of estrogen, tolcapone,
methylphenidate, L-DOPA, antidepressants, clonidine, mirtazapine,
and antipsychotics.
78. The method of claim 71, wherein an adverse biological side
effect to the subject by a compound metabolized by COMT can be
predicted on the basis of the determined COMT genotype.
Description
RELATED APPLICATIONS
[0001] This application claims the benefit of U.S. Provisional
Patent Application Ser. No. 60/590,792, filed Jul. 23, 2004, and
U.S. Provisional Patent Application Ser. No. 60/671,855 filed Apr.
15, 2005; the disclosures of which are incorporated herein by
reference in their entireties.
TECHNICAL FIELD
[0003] The presently disclosed subject matter relates to selecting
and administering effective therapies for treatment of
somatosensory and related disorders to a subject. Further, the
presently disclosed subject matter provides for selecting the
effective therapy for treating a somatosensory disorder based upon
the determined genotype of the subject. In particular, the
presently disclosed subject matter relates to selecting the
effective therapy for treating a somatosensory disorder of a
subject based upon the determination of COMT, ADRB2, or ADRB3
genotypes or combinations thereof of the subject. The presently
disclosed subject matter further relates in some embodiments to
predicting the susceptibility of a subject to develop somatosensory
and related disorders based upon determined genotypes of the
subject.
BACKGROUND
[0004] An individual's sensitivity to pain is influenced by a
variety of environmental and genetic factors (Mogil (1999)).
Although the relative importance of genetic versus environmental
factors in human pain sensitivity remains unclear, reported
heritability for nociceptive and analgesic sensitivity in mice is
estimated to range from 28% to 76% (Mogil (1999)). Even though
animal studies have provided a list of candidate "pain genes," only
a few genes have been identified that are associated with the
perception of pain in humans.
[0005] An understanding of the underlying neurobiogial and
psychological processes that contribute to enhanced pain
sensitivity and the risk of developing somatosensory disorders are
beginning to emerge (FIG. 1). The ability of central nociceptive
pathways to show enhanced responses to peripheral input depends not
only on the activity of peripheral primary afferents, but also on
the activity of central pain regulatory systems. The interplay
between peripheral afferent input and central nervous system
regulatory systems modulates the activity of central neural
networks and produces dynamic, time-dependent alterations in the
excitability and response characteristics of spinal and supraspinal
neural and glia cells that respond to noxious stimuli. Thus,
aberrant neural processing of noxious stimuli and psychological
dysfunction can result in enhanced pain sensitivity and increase
the risk of developing somatosensory disorders that result from
multiple etiologies and which are difficult to clinically
categorize and treat effectively (FIG. 1).
[0006] The biological and psychological determinants of pain
sensitivity and somatosensory disorders are influenced by both
genetic factors, including heritable genetic variation, and
environmental circumstances that determine an individual's
biological and psychological profiles or phenotypes. As such, a
better understanding of the underlying genetic factors is needed in
order to provide effective treatments. In particular, there is an
unmet need for a better understanding of genetic variation on
molecular pathways that mediate variations in pain sensitivity.
Such understanding would provide valuable insights useful for
diagnosing and treating disorders involving pain perception.
SUMMARY
[0007] In one embodiment of the presently disclosed subject matter,
methods of treating a somatosensory disorder in a subject are
provided. In some embodiments, the method comprises administering
to the subject an effective amount of a COMT modulator, an ADRB2
modulator, an ADRB3 modulator, or combinations thereof.
[0008] In some embodiments, both the ADRB2 antagonist and the ADRB3
antagonist are administered to the subject.
[0009] In some embodiments, the methods further comprise
determining a genotype of the subject with respect to a gene
selected from the group consisting of ADRB2, ADRB3, COMT, and
combinations thereof and administering to the subject the effective
amount of the COMT modulator, the ADRB2 modulator, the ADRB3
modulator, or combinations thereof based on determined genotype of
the subject.
[0010] In some embodiments, the determined genotype of the subject
with respect to ADRB2 is selected from the group consisting of two
copies of Haplotype 2, two copies of Haplotype 3, one copy of both
Haplotype 2 and Haplotype 3, and at least one copy of Uncommon and
the somatosensory disorder is treated by administering the ADRB2
modulator, the COMT modulator, or combinations thereof to the
subject.
[0011] In some embodiments, the determined genotype of the subject
with respect to ADRB3 is selected from the group consisting of two
copies of Haplotype 1, and at least one copy of Uncommon and the
somatosensory disorder is treated by administering the ADRB3
modulator, the COMT modulator, or combinations thereof to the
subject.
[0012] In some embodiments, the determined genotype of the subject
with respect to COMT is selected from the group consisting of two
copies of APS, two copies of HPS, and one copy of both APS and HPS
and the somatosensory disorder is treated by administering the COMT
modulator, the ADRB2 modulator, the ADRB3 modulator, or
combinations thereof to the subject.
[0013] In another embodiment, a method of predicting susceptibility
of a subject to develop a somatosensory disorder is provided. In
some embodiments, the method comprises determining a genotype of
the subject with respect to a gene selected from the group
consisting of ADRB2, ADRB3, COMT, and combinations thereof; and
comparing the genotype of the subject with at least one reference
genotype associated with the susceptibility to develop the
somatosensory disorder, wherein the reference genotype is selected
from the group consisting of an ADRB2 genotype, an ADRB3 genotype,
a COMT genotype, and combinations thereof, whereby susceptibility
of the subject to develop the somatosensory disorder is
predicted.
[0014] In some embodiments, the determined genotype of the subject
with respect to ADRB2 is selected from the group consisting of two
copies of Haplotype 1, two copies of Haplotype 2, two copies of
Haplotype 3, one copy of both Haplotype 2 and Haplotype 3, and at
least one copy of Uncommon and the subject is predicted to be
susceptible to develop the somatosensory disorder.
[0015] In some embodiments, the determined genotype of the subject
with respect to ADRB3 is selected from the group consisting of two
copies of Haplotype 1, and at least one copy of Uncommon and the
subject is predicted to be susceptible to develop the somatosensory
disorder.
[0016] In some embodiments, the determined genotype of the subject
with respect to COMT is selected from the group consisting of two
copies of APS, two copies of HPS, and one copy of both APS and HPS
and the subject is predicted to be susceptible to develop the
somatosensory disorder.
[0017] In one embodiment, methods of predicting a pain response in
a subject are provided. In some embodiments, the method comprises
determining a genotype of the subject with respect to a gene
selected from the group consisting of ADRB2, ADRB3, COMT, and
combinations thereof; and comparing the genotype of the subject
with at least one reference genotype associated with pain response
variability, wherein the reference genotype is selected from the
group consisting of an ADRB2 genotype, an ADRB3 genotype, a COMT
genotype, and combinations thereof, whereby pain response in the
subject is predicted.
[0018] In some embodiments, the determined genotype of the subject
with respect to ADRB2 is only one copy of Haplotype 1, and the
subject is predicted to have a decreased sensitivity to pain as
compared to a population norm.
[0019] In some embodiments, the determined genotype of the subject
with respect to ADRB3 is selected from the group consisting of at
least one copy of Haplotype 2 and at least one copy of Haplotype 3
and the subject is predicted to have decreased sensitivity to pain
as compared to a population norm.
[0020] In some embodiments, the determined genotype of the subject
with respect to COMT is selected from the group consisting of two
copies of APS, two copies of HPS, and one copy of both APS and HPS
and the subject is predicted to have an increased sensitivity to
pain as compared to a population norm.
[0021] In one embodiment, methods of predicting somatization in a
subject are provided. In some embodiments, the method comprises
determining a genotype of the subject with respect to a gene
selected from the group consisting of ADRB2, ADRB3, COMT, and
combinations thereof; and comparing the genotype of the subject
with at least one reference genotype associated with somatization,
wherein the reference genotype is selected from the group
consisting of an ADRB2 genotype, an ADRB3 genotype, a COMT
genotype, and combinations thereof.
[0022] In some embodiments, the determined genotype of the subject
with respect to ADRB2 is two copies of Haplotype 2, and the subject
is predicted to have increased somatization as compared to a
population norm.
[0023] In some embodiments, the determined genotype of the subject
with respect to ADRB3 is at least one copy of Haplotype 3, and the
subject is predicted to have a decreased somatization as compared
to a population norm.
[0024] In some embodiments, the determined genotype of the subject
with respect to COMT is selected from the group consisting of two
copies of APS, two copies of HPS, and one copy of both APS and HPS
and the subject is predicted to have an increased somatization as
compared to a population norm.
[0025] In one embodiment, methods of selecting a therapy for a
subject having a somatosensory disorder are provided. In some
embodiments, the method comprises determining a genotype of the
subject with respect to a gene selected from the group consisting
of ADRB2, ADRB3, COMT, and combinations thereof; and selecting a
therapy based on the determined genotype of the subject.
[0026] In some embodiments, the therapy is selected from the group
consisting of a pharmacological therapy, a behavioral therapy, a
psychotherapy, a surgical therapy, and combinations thereof.
[0027] In some embodiments, the therapy is a pharmacological
therapy comprising administering to the subject an effective amount
of an ADRB2 modulator, an ADRB3 modulator, a COMT modulator, or
combinations thereof.
[0028] In some embodiments, the determined genotype of the subject
with respect to ADRB2 is selected from the group consisting of two
copies of Haplotype 2, two copies of Haplotype 3, one copy of both
Haplotype 2 and Haplotype 3, and an effective amount of an ADRB2
modulator, a COMT modulator, or combinations thereof is selected as
a therapy.
[0029] In some embodiments, the determined genotype of the subject
with respect to ADRB3 is two copies of Haplotype 1, and an
effective amount of an ADRB2 modulator, a COMT modulator, or
combinations thereof is selected as a therapy.
[0030] In some embodiments, the determined genotype of the subject
with respect to COMT is selected from the group consisting of two
copies of APS, two copies of HPS, and one copy of both APS and HPS
and an effective amount of an ADRB2 modulator, an ADRB3 modulator,
a COMT modulator, or combinations thereof is selected as a
therapy.
[0031] In some embodiments, both the ADRB2 antagonist and the ADRB3
antagonist are selected.
[0032] In one embodiment, methods of classifying a somatosensory
disorder afflicting a subject are provided. In some embodiments,
the method comprises determining a genotype of the subject with
respect to a gene selected from the group consisting of ADRB2,
ADRB3, COMT, and combinations thereof; and classifying the
somatosensory disorder into a genetic subclass somatosensory
disorder based on the determined genotype of the subject.
[0033] In some embodiments, classifying the somatosensory disorder
into the genetic subclass somatosensory disorder is utilized to
select an effective therapy for use in treating the genetic
subclass somatosensory disorder.
[0034] In one embodiment, methods of modulating production of
proinflammatory cytokines in a subject are provided. In some
embodiments, the method comprises administering to the subject an
effective amount of a COMT modulator, an ADRB2 modulator, an ADRB3
modulator, or combinations thereof. In some embodiments, the
proinflammatory cytokines are selected from the group consisting of
IL-6, IL-1.alpha., IL-1.beta., TNF-.alpha., and combinations
thereof. In some embodiments, modulating production of
proinflammatory cytokines comprises inhibiting production of
proinflammatory cytokines.
[0035] In some embodiments, both the ADRB2 antagonist and the ADRB3
antagonist are administered to the subject.
[0036] In some embodiments, determining a genotype of the subject
with respect to a gene selected from the group consisting of ADRB2,
ADRB3, COMT, and combinations thereof and administering to the
subject the effective amount of the COMT modulator, the ADRB2
modulator, the ADRB3 modulator, or combinations thereof based on
the determined genotype of the subject.
[0037] In some embodiments, the determined genotype of the subject
with respect to ADRB2 is selected from the group consisting of two
copies of Haplotype 2, two copies of Haplotype 3, one copy of both
Haplotype 2 and Haplotype 3, and the production of proinflammatory
cytokines in the subject is modulated by administering the ADRB2
modulator, the COMT modulator, or combinations thereof to the
subject.
[0038] In some embodiments, the determined genotype of the subject
with respect to ADRB3 is selected from the group consisting of two
copies of Haplotype 1, and the production of proinflammatory
cytokines in the subject is modulated by administering the ADRB3
modulator, the COMT modulator, or combinations thereof to the
subject.
[0039] In some embodiments, the determined genotype of the subject
with respect to COMT is selected from the group consisting of two
copies of APS, two copies of HPS, and one copy of both APS and HPS
and the production of proinflammatory cytokines in the subject is
modulated by administering the COMT modulator, the ADRB2 modulator,
the ADRB3 modulator, or combinations thereof to the subject.
[0040] In one embodiment, methods of producing non-human animal
models of a human somatosensory disorder are provided. In some
embodiments, the method comprises modulating COMT activity, ADRB2
activity, ADRB3 activity, or combinations thereof in the non-human
animal model to produce the non-human animal model of the human
somatosensory disorder.
[0041] In some embodiments, the non-human animal model is a
rodent.
[0042] In some embodiments, modulating COMT activity in the
non-human animal model comprises inhibiting COMT activity in the
non-human animal model.
[0043] In some embodiments, inhibiting COMT activity comprises
administering a COMT inhibitor to the non-human animal model.
[0044] In some embodiments, the non-human animal model exhibits an
increase in production of proinflammatory cytokines.
[0045] In some embodiments, the proinflammatory cytokines are
selected from the group consisting of IL-6, IL-1.beta.,
TNF-.alpha., IL-1.alpha. and combinations thereof.
[0046] In one embodiment, a non-human animal possessing modulated
COMT activity, modulated ADRB2 activity, modulated ADRB3 activity,
or combinations thereof, wherein the non-human animal exhibits
characteristics of a somatosensory disorder is provided.
[0047] In some embodiments, the non-human animal is a genetically
modified animal.
[0048] In some embodiments, the non-human animal transgenic animal
overexpresses ADRB2, ADRB3, or both ADRB2 and ADRB3.
[0049] In some embodiments, the non-human animal is a COMT knockout
or knockdown animal.
[0050] In one embodiment, methods of predicting COMT activity,
ADRB2 activity, ADRB3 activity, or combinations thereof in a
subject are provided. In some embodiments, the method comprises
determining a genotype of the subject with respect to a gene
selected from the group consisting of ADRB2, ADRB3, COMT, and
combinations thereof; and comparing the genotype of the subject
with at least one reference genotype associated with activity of
ADRB2, ADRB3, COMT, and combinations thereof, wherein the reference
genotype is selected from the group consisting of an ADRB2
genotype, an ADRB3 genotype, a COMT genotype, and combinations
thereof, whereby activity of COMT activity, ADRB2 activity, ADRB3
activity, or combinations thereof is predicted.
[0051] In some embodiments, the COMT genotype of the reference
genotype is selected from the group consisting of low pain
sensitive haplotype (LPS), average pain sensitive haplotype (APS),
and high pain sensitive haplotype (HPS); the ADRB2 genotype of the
reference genotype is selected from the group consisting of
Haplotype 1, Haplotype 2, Haplotype 3, and Uncommon; and the ADRB3
genotype of the reference genotype is selected from the group
consisting of Haplotype 1, Haplotype 2, Haplotype 3, and
Uncommon.
[0052] In some embodiments, the determined genotype of the subject
with respect to COMT is selected from the group consisting of two
copies of APS, two copies of HPS, and one copy of both APS and HPS
and the subject is predicted to have low COMT activity.
[0053] In some embodiments, the determined genotype of the subject
with respect to ADRB2 is selected from the group consisting of two
copies of Haplotype 1 and the subject is predicted to have low
ADRB2 activity.
[0054] In some embodiments, the determined genotype of the subject
with respect to ADRB2 is selected from the group consisting of two
copies of Haplotype 2, two copies of Haplotype 3, and one copy of
both Haplotype 2 and Haplotype 3, and the subject is predicted to
have high ADRB2 activity.
[0055] In some embodiments, the determined genotype of the subject
with respect to ADRB2 is selected from the group consisting of two
copies of Haplotype 3, and the subject is predicted to have high
ADRB2 activity in the resting stage and low ADRB2 activity in
response to agonist, including but not restricted to
epinephrine.
[0056] In some embodiments, the determined genotype of the subject
with respect to ADRB3 is selected from the group consisting of at
least one copy of Haplotype 2, at least one copy of Haplotype 3 and
the subject is predicted to have low ADRB3 activity.
[0057] In some embodiments, an effective dosage of a therapeutic
compound metabolized by COMT is determined for the subject on the
basis of the determined COMT genotype.
[0058] In some embodiments, example drugs include, but are not
limited to: Steroid sex hormones such as estrogen; Drugs that
inhibit COMT enzyme such as tolcapone; Drugs that influence the
bioavailability of norepinephrine and dopamine such as
methylphenidate and L-DOPA; Drugs that influence the reuptake of
norepinephrine such as antidepressants; drugs that influence
.alpha.-adrenergic receptors such as clonidine and mirtazapine;
drugs that influence dopamine receptors such as antipsychotics.
[0059] In some embodiments, an adverse biological side effect to
the subject by a compound metabolized by COMT can be predicted on
the basis of the determined COMT genotype.
[0060] In some embodiments, the somatosensory disorder is selected
from the group consisting of chronic pain conditions, fibromyalgia
syndrome, tension headache, migraine headache, irritable bowel
syndrome, chronic lower back pain, chronic fatigue, multiple
chemical sensitivities, temporomandibular joint disorder,
post-traumatic stress disorder, chronic idiopathic pelvic pain,
Gulf War Syndrome, vulvar vestibulitis, osteoarthritis, rheumatoid
arthritis, and angina pectoris.
[0061] In some embodiments the ADRB2 modulator is an ADRB2
antagonist, the ADRB3 modulator is an ADRB3 antagonist, and the
COMT modulator is a COMT activator.
[0062] In some embodiments, determining the genotype of the subject
comprises identifying at least one haplotype of ADRB2, ADRB3, COMT,
or combinations thereof; identifying at least one polymorphism
unique to at least one haplotype of ADRB2, ADRB3, COMT, or
combinations thereof; identifying at least one polymorphism
exhibiting high linkage disequilibrium to at least one polymorphism
unique to the at least one ADRB2 haplotype, ADRB3 haplotype, COMT
haplotype, or combinations thereof; or identifying at least one
polymorphism exhibiting high linkage disequilibrium to at least one
ADRB2 haplotype, ADRB3 haplotype, COMT haplotype, or combinations
thereof.
[0063] In some embodiments, the ADRB2 genotype is selected from the
group consisting of Haplotype 1, Haplotype 2, Haplotype 3, and
Uncommon; the ADRB3 genotype is selected from the group consisting
of Haplotype 1, Haplotype 2, Haplotype 3, and Uncommon; and the
COMT genotype is selected from the group consisting of low pain
sensitive haplotype (LPS), average pain sensitive haplotype (APS),
and high pain sensitive haplotype (HPS).
[0064] Accordingly, it is an object of the presently disclosed
subject matter to provide novel methods and materials for
predicting and treating somatosensory disorders. This and other
objects are achieved in whole or in part by the presently disclosed
subject matter.
[0065] An object of the presently disclosed subject matter having
been stated hereinabove, other aspects and objects will become
evident as the description proceeds when taken in connection with
the accompanying Drawings and Examples as best described herein
below.
BRIEF DESCRIPTION OF THE DRAWINGS
[0066] FIG. 1 shows a model of somatosensory disorder risk factors.
The model displays likely biological and psychological determinants
that contribute to the risk of somatosensory disorder onset and
persistence.
[0067] FIGS. 2A-2C are a series of graphs showing the effect of
ADRB2 haplotypes on psychological scores and resting arterial blood
pressure. The major effects of the number of copies of haplotype 1
(A), haplotype 2 (B) or haplotype 3 (C) are presented. The
following haplotype dose-effects are shown: no corresponding
haplotype (O), one copy (1) or two copies (2) of the corresponding
haplotype. Each value represents the mean of each variable with
associated SEM. Greater positive values for BDI, PILL, BSI and
Trait Anxiety scores reflect more negative psychological
characteristics. The greater values for measured obtained from the
POMS scale reflect more positive psychological characteristics:
agreeable or composed, different from the indicated groups. BDI,
PILL, STAI and POMS scores were measured in relative unites, blood
pressure was measured in mm of mercury (mmHg), BSI depression and
somatization presented as percent of subjects that show trait
(subjects, scored at 30 and corresponded to individuals that
answered all questions negatively, were treated as a group that
showed no sings of depression or somatization). ***P<0.01,
**P<0.05 and *P<0.1.
[0068] FIGS. 3A and 3B show a model of proposed functional variants
of ADRB2 corresponding to the three major haplotypes (H1, H2, and
H3). Putative haplotype-specific expression of ADRB2 on the
postsynaptic membrane of CNS neurons at (A) resting state and (B)
following stimulation with an agonist. In the periphery,
epinephrine is released from adrenal glands and binds ADRB2
expressed on smooth muscle.
[0069] FIG. 4A is a schematic diagram of ADRB2 genomic
organization, SNP positions and distribution percentages. The human
ADRB2 is an intronless gene that spans .about.5,500 kb on
chromosome 5q31-32. ADRB2 transcript codes for two independent
peptides showed as break blocks: .beta..sub.2 adrenergic receptor
protein (ADRB2) and .beta..sub.2 adrenergic receptors upstream
protein (BUP) that inhibits receptor translation.
[0070] FIG. 4B shows estimated frequencies of the main ADRB2
haplotypes. The sequence of alleles in each haplotype reflects the
order of occurrence from 5' to 3' in the ADRB2 gene locus (SNPs:
G-7127A, rs11958940, rs1432622, rs1432623, rs2400707, rs1042713,
rs1042714 and rs1042717, respectively).
[0071] FIG. 5 is a graph showing the effect of ADRB3 haplotypes on
PILL somatization score. The major effects of Haplotype 3 are
presented. Each value represents the mean of PILL somatization
score with associated SEM. Greater positive values reflect more
negative psychological characteristics. *Student T-test,
P<0.05.
[0072] FIG. 6A is a schematic diagram of COMT genomic organization
and SNP positions and percentage distribution. COMT gene locus
(chromosome 22, band q11.21) spans for 27,221 bases.
[0073] FIG. 6B is a schematic diagram of linkage disequilibrium
between six SNP markers. Four SNPs, rs6269, rs4633, rs4818 and
rs4680 (val.sup.158met), which occur within the central region of
the COMT gene, were found to exhibit strong LDs with the strongest
associations found between SNPs rs6269 and rs4818 (D'=0.94,
R.sup.2=0.88) and between SNPs rs4633 and rs4680 (D'=0.96,
R.sup.2=0.91). In contrast, SNP rs2097903, located in the 5'
promoter region, and rs165599, located in the 3'UTR, did not show
strong LDs. Thus, LD analysis demonstrated that the COMT locus
covers 3 haploblocks. SNP rs2097903 is situated on the first
haploblock, SNPs rs6269, rs4633, rs4818 and rs4680 are situated on
the second haploblock and SNP rs165599 is situated on the third
haploblock.
[0074] FIG. 6C shows the estimated frequencies of the COMT
haplotypes. The sequence of alleles in each haplotype for
haploblock 2 reflects the order of occurrence from 5' to 3' in the
COMT gene (SNPs: rs6269, rs4633, rs4818 and rs4680 respectively).
Seven haplotypes out of possible 16 were detected for these 4 SNPs
with the most frequent haplotype (48.7%) composed of the most
frequent alleles for all 4 markers (A_T_C_A for SNPs rs6269,
rs4633, rs4818 and rs4680, respectively). The second major
haplotype (36.5%) was composed of the least frequent alleles for
all 4 markers (G_C_G_G). The third haplotype (10.5%) was composed
of a combination of the most frequent alleles for SNPs rs4633 and
rs4680 and the least frequent alleles for SNPs rs6269 and rs4818
(A_C_C_G). These three haplotypes accounted for 95.9% of all
detected haplotypes. These findings are consistent with previously
reported LD analysis of COMT SNPs that each haploblock within human
genomic DNA is usually represented by three to five major
haplotypes.
[0075] FIG. 7A is a schematic diagram of ADRB3 genomic
organization, SNP positions and distribution percentages. The human
ADRB3 consists of 2 exons and spans .about.5 kb on chromosome 6p12.
The protein coding region is shown as break blocks.
[0076] FIG. 7B shows estimated frequencies of the ADRB3 haplotypes.
The sequence of alleles in each haplotype reflects the order of
occurrence from 5' to 3' in the ADRB3 gene locus (SNPs: rs4994,
rs4994, rs4997, rs2071493, rs4998, rs4999 and rs9694197,
respectively). Minor alleles are shown in bold.
[0077] FIG. 8 is a schematic diagram showing interactions of COMT,
ADRB2 (.beta..sub.2AR), and ADRB3 (.beta..sub.3AR) affecting pain
sensitivity and inflammation via modulation of proinflammatory
cytokine production.
[0078] FIG. 9 is a graph showing distribution of a summary measure
of pain sensitivity. A summary measure of pain sensitivity was
derived from 16 individual pain measures, each standardized to unit
normal deviates (z-scores) with a mean of zero and standard
deviation of one. The 16 pain measures were: thermal pain threshold
conveyed by A.delta. afferents and both threshold and tolerance
conveyed by C-fiber afferents, all measured in .degree. C. at each
of three anatomical sites (arm, cheek and foot); tolerance to
temporal summation of C-fiber mediated pain (as reported on 0-100
visual analog scale); right arm ischemic pain onset and tolerance
(seconds); and mechanical pain thresholds (kg) assessed over the
temporalis and masseter muscles, the temporomandibular joint and
the ventral surfaces of wrists. Individuals represented at the
extreme left-side of the figure are resistant to pain evoking
procedures while individuals represented at the extreme right-side
of the figure are most sensitive to pain evoking pain
procedures.
[0079] FIG. 10 is a series of graphs showing variations in pain
tolerance associated with individual SNPs. The first presented
allele in each plot is associated with the least pain sensitivity.
Differences among all three allele combinations were assessed by
analysis of variance (ANOVA) using z-score as the dependent
variable. The significance of the difference in the mean z-scores
associated with each homozygous genotype was determined via the
Students t-test. Each value represents the mean z-score with
associated s.e.m.
[0080] FIG. 11 is a graph showing pain responsiveness categorized
by three major COMT haplotype combinations. LPS--haplotype G_C_G_G,
APS--haplotype A_T_C_A, HPS--haplotype A_C_C_G. The greater values
reflect greater pain sensitivity. Each value represents the mean
z-score with associated s.e.m.
[0081] FIGS. 12A and 12B are graphs showing the effect of haplotype
on COMT activity in transfected HEK 293 cells. HEK 293 cells were
transiently transfected with 6 full-length COMT cDNA clones that
corresponded to the three major haplotypes (LPS, APS, HPS). The
expression of COMT protein was assessed by measurement COMT
enzymatic activity (FIG. 12A) in the lysate from transfected cells.
COMT activity was assessed from 2 independent clones for each
haplotype. Two independent ELISAs for each of the 2 independent
transfections were performed for each clone. The graph shows the
average values for the 8 measurements for each haplotype. The COMT
activity was calculated as ng of normetanephrine (NMN), synthesized
during 1 hour at 37.degree. C. under described enzymatic condition
per 10.sup.5 transfected cells. The highest COMT activity was
observed for LPS haplotypes ([NMN]=34.3.+-.3.0 ng per 10.sup.5
cells; FIG. 12A), the lower activity was observed for APS haplotype
([NMN]=7.2.+-.1.53 ng per 10.sup.5 cells) while HPS haplotypes
produced the lowest activity ([NMN]=3.0.+-.2.20 ng per 10.sup.5
cells; FIG. 12A). The relative abundance of COMT RNA (FIG. 12B) was
assessed by real-time PCR. Each value represents the mean value
with associated s.e.m.
[0082] FIGS. 13A-13C are a series of graphs showing the effect of
COMT inhibition on rat pain behavior. Baseline sensitivity to
mechanical stimuli was estimated by measuring both threshold (FIG.
13A) and frequency (FIG. 13B) of paw withdrawal. Sensitivity to
thermal stimuli was estimated by measuring latency of paw
withdrawal (FIG. 13C). After establishing baseline sensitivity,
animals received the COMT inhibitor OR486 (30 mg/kg i.p.) or
vehicle one hour prior to testing. Data are expressed as
Mean.+-.SEM. ***P<0.001, **P<0.01, * P<0.05 different from
control conditions by ANOVA and Bonferroni post hoc tests. N=8 rats
per group.
[0083] FIGS. 14A and 14B are graphs showing pain sensitivity and
TMD incidence by haplotype groupings. All subjects were subdivided
to two groups: LPS and HPS/APS. Subjects were assigned to the LPS
group if they carried at least one LPS haplotype. Subjects were
assigned to the HPS/APS group if they carried only APS and HPS
haplotypes. FIG. 14A shows that subjects from the LPS group
demonstrated significantly lower pain responsiveness than those
from the HPS/APS group (P=0.02, t-test). FIG. 14B shows the number
of incidence case per 100 person years as a function of haplotype
group.
[0084] FIGS. 15a-15i are a series of graphs demonstrating that COMT
inhibition increases pain sensitivity and proinflammatory cytokine
production. Separate groups of rats received i.p. injections of the
COMT inhibitor OR486 (30 mg/kg) or vehicle 30 min prior to i.pl.
saline (N=8 per group). The comparison group received i.p.
injections of vehicle 30 min prior to i.pl. 3% carrageenan (N=8).
Baseline responsiveness to von Frey monofilaments and radiant heat
did not differ between groups prior to pharmacological
manipulations. Administration of carrageenan or OR486 (FIG. 15a),
decreased paw withdrawal threshold to mechanical stimuli
(F.sub.2,6=244.0, P<0.0001; P<0.001 per comparison) (FIG.
15b), increased paw withdrawal frequency to repeated presentation
of a 25 g monofilament (F.sub.2,6=20.26, P<0.003; P<0.01 and
P<0.05, respectively), and (FIG. 15c) decreased paw withdrawal
latency to thermal stimuli (F.sub.2,21=48.07, P<0.0001;
P<0.001 per comparison) relative to vehicle. Rats receiving
carrageenan or OR486 had elevated levels of (FIG. 15d) TNF.alpha.
(F.sub.2,9=8.213, P<0.01) (FIG. 15e) IL-1.beta. (F.sub.2,8=7.15,
P<0.02) (FIG. 15f) and IL-6 (F.sub.2,9=7.15, P<0.02). A
second COMT inhibitor was then employed. Separate groups of rats
received i.p. injections of OR486 (30 mg/kg), RO41-0960 (30 mg/kg),
or vehicle (N=8 per group). Administration of RO41-0960 (FIG. 15g)
decreased paw withdrawal threshold to mechanical stimuli
(F.sub.2,6=253.6, P<0.0001; P<0.001 per comparison), (FIG.
15h) increased paw withdrawal frequency to mechanical stimuli
(F.sub.2,6=120.1, P<0.0001; P<0.001 and P<0.01,
respectively), and (FIG. 15i) decreased paw withdrawal latency to
thermal stimuli (F.sub.2,21=33.14, P<0.0001; P<0.001 and
P<0.01, respectively) relative to vehicle. Data are Mean.+-.SEM.
***P<0.001, **P<0.01, *P.ltoreq.0.05 different from
vehicle+saline (a-f) or vehicle (g-i).
[0085] FIGS. 16A-16C are graphs showing COMT inhibition increases
pain sensitivity in the non-inflamed paw. Separate groups of rats
received i.p. injections of the COMT inhibitor OR486 (30 mg/kg) or
vehicle 30 min prior to i.pl. administration of saline (N=8 per
group). The comparison group received i.p. injections of vehicle 30
min prior to i.pl. administration of 3% carrageenan in the right
hindpaw (N=8). Administration of OR486 (FIG. 16a) decreased paw
withdrawal threshold to mechanical stimuli (F.sub.2,6=436.6,
P<0.0001; P<0.001 per comparison), (FIG. 16b) increased paw
withdrawal frequency to repeated presentation of a 25 g
monofilament (F.sub.2,6=30.31, P<0.0008; P<0.01 per
comparison), and (FIG. 16c) decreased paw withdrawal latency to
thermal stimuli (F.sub.2,21=27.81, P<0.0001; P<0.001 per
comparison) relative to administration of vehicle or carrageenan in
the contralateral non-inflamed paw. Data are expressed as
Mean.+-.SEM. ***P<0.001, **P<0.01, *P<0.05 different from
all comparison groups.
[0086] FIGS. 17a-17c are graphs showing that the COMT inhibitor
RO41-0960 increases plasma proinflammatory cytokine levels.
Separate groups of rats received RO41-0960 (30 mg/kg i.p.) or
vehicle (N=8 per group). Rats receiving RO41-0960 exhibited (FIG.
17a) elevated plasma levels of TNF.alpha. (t.sub.13=2.44,
P<0.05). FIG. 17b shows animals receiving RO41-0960 also
exhibited a 4.5 fold increase in plasma levels of IL-1.beta.,
however statistical analysis was not conducted because of
inadequate sample size due to sample loss. FIG. 17c shows a trend
towards elevated levels of IL-6 (P<0.06) was apparent. Data are
expressed as Mean.+-.SEM. *P<0.05 different from vehicle.
[0087] FIGS. 18a-18f are graphs showing that administration of the
nonselective .beta.AR antagonist propranolol completely blocks
OR486-induced pain sensitivity and proinflammatory cytokine
production. Separate groups of rats received i.p. injections of the
.alpha.AR antagonist phentolamine (3 mg/kg), the .beta.AR
antagonist propranolol (3 mg/kg), the D.sub.1-like dopamine
antagonist SCH23390 (0.2 mg/kg), the D.sub.2-like dopamine
antagonist spiperone (0.2 mg/kg), or vehicle 10 minutes prior to
i.p. administration of OR486 (N=8 per group). Baseline
responsiveness to mechanical and thermal stimuli did not differ
between groups prior to pharmacological manipulations.
Administration of propranolol prior to OR486 normalized (FIG. 18a)
paw withdrawal threshold to mechanical stimuli (F.sub.5,15=305.9,
P<0.0001; P<0.001 per comparison), (FIG. 18b) paw withdrawal
frequency to mechanical stimuli (F.sub.5,15=93.96, P<0.0001;
P<0.001 per comparison), and (FIG. 18c) paw withdrawal latency
to radiant heat (F.sub.5,42=24.47, P<0.0001; P<0.01 per
comparison) relative to animals receiving phentolamine, SCH23390,
spiperone, or vehicle prior to OR486. Preemptive administration of
propranolol also decreased plasma levels of (FIG. 18d) TNF.alpha.
(F.sub.2,21=17.08, P<0.0001), (FIG. 18e) IL-1.beta.
(F.sub.2,20=17.78, P<0.001), and (FIG. 18f) IL-6
(F.sub.2,20=3.65, P<0.05) relative to administration of vehicle
prior to OR486. Data are expressed as Mean.+-.SEM. ***P<0.001,
**P<0.01 different from vehicle+OR486, phentolamine+OR486,
SCH23390+OR486, and spiperone+OR486. .sup.+P<0.05 different from
vehicle+OR486. .sup.###P<0.001 different from vehicle+vehicle
and propranolol+OR486. .sup.$P<0.05 different from
propranolol+OR486.
[0088] FIGS. 19a-19c are graphs showing adrenergic and dopaminergic
antagonists administered in the absence of OR486 do not alter pain
sensitivity. Separate groups of rats received the
.alpha.-adrenergic antagonist phentolamine (3 mg/kg), the
.beta.-adrenergic antagonist propranolol (3 mg/kg), the
D.sub.1-like dopamine antagonist SCH23390 (0.2 mg/kg), the
D.sub.2-like dopamine antagonist spiperone (0.2 mg/kg), or vehicle
10 min prior to i.p. administration of vehicle (N=8 per group).
Administration of phentolamine, propranolol, SCH23390, or spiperone
failed to affect (FIG. 19a) paw withdrawal threshold to mechanical
stimuli, (FIG. 19b) paw withdrawal frequency to mechanical stimuli,
or (FIG. 19c) paw withdrawal latency to radiant heat relative to
vehicle. Data are expressed as Mean.+-.SEM.
[0089] FIGS. 20a-20l are graphs showing that administration of
selective antagonists for .beta..sub.2- or .beta..sub.3ARs reduces
OR486-induced pain sensitivity and proinflammatory cytokine
production. Separate groups of rats received i.p. injections of the
.beta..sub.1 antagonist betaxolol (0.1, 1.0, and 10 mg/kg), the
.beta..sub.2 antagonist ICI118,551 (0.05, 0.5, and 5 mg/kg), the
.beta..sub.3 antagonist SR59230A (0.5, 5, and 50 mg/kg), or vehicle
10 min prior to i.p. administration of OR486 (N=6 per group).
Baseline responsiveness to mechanical and thermal stimuli did not
differ between groups prior to pharmacological manipulations.
Administration of the middle (0.5 mg/kg) or high (5.0 mg/kg) dose
of ICI118,551 prior to OR486 (FIG. 20a) increased paw withdrawal
threshold (F.sub.4,12=281.2, P<0.0001; P<0.001 per
comparison) and (FIG. 20b) decreased paw withdrawal frequency
(F.sub.4,12=87.61, P<0.0001; P<0.05 per comparison) to
mechanical stimuli relative to animals receiving vehicle or the low
(0.05 mg/kg) dose of ICI118,551 prior to OR486. (FIG. 20c)
Administration of the high (5.0 mg/kg) dose of ICI118,551 increased
paw withdrawal latency to radiant heat relative to animals
receiving vehicle prior to OR486 (F.sub.4,25=9.87, P<0.0001;
P<0.01). Administration of the middle (5 mg/kg) or high (50
mg/kg) dose of SR59230A prior to OR486 (FIG. 20d) increased paw
withdrawal threshold to mechanical stimuli (F.sub.4,12=151.4,
P<0.0001; P<0.001 per comparison), (FIG. 20e) decreased paw
withdrawal frequency (F.sub.4,12=104.6, P<0.0001; P<0.001 per
comparison) to mechanical stimuli, and (FIG. 20f) increased paw
withdrawal latency to thermal stimuli (F.sub.4,25=10.65,
P<0.0001; P<0.05 per comparison) relative to animals
receiving vehicle prior to OR486. Animals receiving selective
.beta..sub.2- or .beta..sub.3AR antagonists prior to OR486 also
exhibited decreased levels of (FIG. 20g) TNF.alpha.
(F.sub.3,38=5.94, P<0.003), (FIG. 20h) IL-1.beta.
(F.sub.3,43=20.02, P<0.001), and (FIG. 20i) IL-6
(F.sub.3,44=9.17, P<0.0001) relative to those receiving vehicle
prior to OR486. Cytokine data for animals receiving the low,
middle, and high dose of ICI118,551 or SR59230A were pooled as they
did not differ. Administration of the .beta..sub.1AR antagonist
betaxolol prior to OR486 failed to alter (FIG. 20j) paw withdrawal
threshold to mechanical stimuli, (FIG. 20k) paw withdrawal
frequency to mechanical stimuli, or (FIG. 20l) paw withdrawal
latency to radiant heat relative to animals receiving vehicle prior
to OR486. Data are expressed as Mean.+-.SEM. .sup.+++P<0.001,
.sup.++P<0.01, .sup.+P<0.05 different from vehicle+OR486.
***P<0.001, **P<0.01, *P<0.05 different from
vehicle+vehicle. .sup.###P<0.001, .sup.##P<0.01 different
from vehicle+vehicle, ICI118,551+OR486, or ICI118,551+OR486.
.sup.$$$P<0.001, .sup.$P<0.05 different from vehicle+OR486,
betaxolol (0.1 mg/kg)+OR486, betaxolol (1.0 mg/kg)+OR486, and
betaxolol (10 mg/kg)+OR486.
[0090] FIGS. 21a-21c are graphs showing that selective .beta.AR
antagonists administered in the absence of OR486 do not alter pain
sensitivity. Separate groups of animals received i.p. injections of
the .beta..sub.1 antagonist betaxolol (1.0 mg/kg), the .beta..sub.2
antagonist ICI118,551 (0.5 mg/kg), the .beta..sub.3 antagonist
SR59230A (5 mg/kg), or vehicle 10 min prior to i.p. administration
of vehicle (N=6 per group). Administration of betaxolol,
ICI118,551, or SR59230A failed to affect (FIG. 21a) paw withdrawal
threshold to mechanical stimuli, (FIG. 21b) paw withdrawal
frequency to mechanical stimuli, or (FIG. 21c) paw withdrawal
latency to radiant heat relative to vehicle. Data are expressed as
Mean.+-.SEM.
[0091] FIGS. 22a-22f are graphs showing that coadministration of
selective antagonists for .beta..sub.2- and .beta..sub.3ARs
completely blocks OR486-induced pain sensitivity and
proinflammatory cytokine production. Separate groups of rats
received i.p. injections of ICI118,551 (0.5 mg/kg)+SR59230A (5.0
mg/kg) or vehicle prior to i.p. administration of OR486 (N=8 per
group). Baseline responsiveness to mechanical and thermal stimuli
did not differ between groups prior to pharmacological
manipulations. Concurrent administration of ICI118,551 and SR59230A
prior to OR486 completely normalized OR486-induced (FIG. 22a)
mechanical allodynia (t.sub.3=23.69, P<0.0003), (FIG. 22b)
mechanical hyperalgesia (t.sub.3=42.77, P<0.0001), and (FIG.
22c) thermal hyperalgesia (t.sub.7=10.60, P<0.0001). Rats
receiving concurrent administration of .beta..sub.2- and
.beta..sub.3AR antagonists prior to OR486 also had decreased plasma
levels of (FIG. 22d) TNF.alpha. (t.sub.13=2.45, P<0.03), (FIG.
22e) IL-1.beta. (t.sub.14=2.63, P<0.02), and (FIG. 22f) IL-6
(t.sub.14=1.75, P=0.05) relative to rats receiving vehicle prior to
OR486. Data are expressed as Mean.+-.SEM. ***P<0.001,
**P<0.01, *P.ltoreq.0.05 different from vehicle.
[0092] FIGS. 23a-23e are graphs showing that stimulation of
.beta..sub.2- and .beta..sub.3ARs in vitro leads to increased
transcription of proinflammatory cytokines. Drug doses within one
log unite of the ED50 or ID50 were selected based on a dose
response curve (data are not shown). Cells were pretreated with the
.beta..sub.1 antagonist betaxolol (0.3 .mu.M), the .beta..sub.2
antagonist ICI118,551 (0.3 .mu.M), the .beta..sub.3 antagonist
SR59230A (0.1 .mu.M), or vehicle 30 min prior to 1 hr treatment
with the .beta..sub.2 agonist salmeterol (0.5 .mu.M) or the
.beta..sub.3 agonist CL316243 (0.3 .mu.M). In macrophages,
stimulation of .beta.'.sub.2ARs by salmeterol produced a (FIG. 23a)
38-fold increase in IL-1.beta. (F.sub.4,15=1068, P<0.0001) and
(FIG. 23b) a 6.5-fold increase in IL-6 (F.sub.4,15=462.6,
P<0.0001) mRNA levels. In adipocytes, stimulation of
.beta..sub.2ARs by salmeterol produced a (FIG. 23c) 6-fold increase
in TNF.alpha. (F.sub.4,15=579.2, P<0.0001) and (FIG. 23d) an
8-fold increase in IL-6 (F.sub.4,15=333.2, P<0.0001) mRNA
levels. The salmeterol-induced increase in macrophage IL-1.beta.
and IL-6 transcript levels and adipocyte TNF.alpha. and IL-6
transcript levels was completely blocked by ICI118,551, but not by
betaxolol or SR59230A. (FIG. 23e) Similarly, stimulation of
.beta..sub.3ARs in adipocytes by CL316243 produced a 28-fold
increase in IL-6 mRNA levels (F.sub.4,15=897.9, P<0.0001). The
CL316243-induced increase in adipocyte IL-6 transcript levels was
completely blocked by SR59230A, but not by betaxolol or ICI118,551.
Data are expressed as Mean.+-.SEM. ***P<0.001 different from
untreated and ICI118,551+salmeterol. .sup.###P<0.001 different
from untreated and SR59230A+CL316243.
[0093] FIGS. 24a-d are graphs showing that selective .beta.AR
antagonists administered in the absence of .beta..sub.2AR
stimulation by salmeterol or .beta..sub.3AR stimulation by CL316243
do not meaningfully alter proinflammatory cytokine transcription.
Macrophages and adipocytes received betaxolol (0.3 .mu.M),
ICI118,551 (0.3 .mu.M), SR59230A (0.1 .mu.M), or no treatment.
Relative to untreated macrophages, administration of betaxolol,
ICI118,551, or SR59230A resulted in a (FIG. 24a) 0.91-1.16 fold
induction of IL-1.beta. mRNA and (FIG. 24b) 0.81-0.96 fold
induction of IL-6 mRNA. Relative to untreated adipocytes,
administration of betaxolol, ICI118,551, or SR59230A resulted in a
(FIG. 24c) 0.84-1.47 fold induction of TNF.alpha. mRNA and (FIG.
24d) 0.91-1.22 fold induction of IL-6 mRNA. Data are expressed as
Mean.+-.SEM.
DETAILED DESCRIPTION
[0094] Somatosensory disorders are comprised of several chronic
clinical conditions that are characterized by the perception of
persistent pain, unpleasantness or discomfort in various tissues
and regions of the body. As one example, temporomandibular disorder
(TMD), a prototypic somatosensory disorder, is associated with a
state of pain amplification as well as psychological distress,
which is characterized by high levels of somatization, depression,
anxiety and perceived stress (FIG. 1). TMD alone impacts 5-15% of
the population and has been estimated to incur approximately $1
billion in healthcare costs. A common feature of somatosensory
disorders is that a given somatosensory disorder is often
associated with other comorbid somatosensory conditions. It is
generally accepted that impairments in CNS regulatory processes
contribute to the pain amplification and psychological dysfunction
associated with somatosensory disorders. However, details as to the
specific molecular pathways resulting in the CNS regulatory process
impairments and the exact role individual genetic variation play in
the process are heretofore undetermined. Furthermore, a host of
biological, psychological, and environmental factors also impact
pain sensitivity and the risk of developing a somatosensory
disorder. As shown in FIG. 1, a multitude of known factors can
compound or interact to increase pain sensitivity and the risk of
developing a somatosensory disorder. Thus, an individual with
enhanced pain processing and/or psychological dysfunction (e.g.,
somatization), due to for example genetic variability affecting
protein activity, as compared to a population norm, would be
predicted to have a greater pain sensitivity and risk of developing
a somatosensory disorder.
[0095] The presently disclosed subject matter provides new insights
into the molecular pathways involved in the development of
somatosensory disorders and further reveals genotypes, which can
include specific genetic polymorphisms present in subjects that,
when coupled with environmental factors such as physical or
emotional stress, can produce a clinical phenotype that is
vulnerable to the development of a somatosensory disorder. The
genotypes (which can include specific genetic polymorphisms)
identified herein are useful for predicting the susceptibility of a
subject to develop a somatosensory disorder, or related condition,
including for example increased pain sensitivity and predilection
toward somatization.
[0096] The presently disclosed subject matter also provides methods
for using the using the knowledge of the genotype (which can
include the presence of specific polymorphisms) of a particular
subject suffering from a somatosensory or related disorder to
subclassify the disorder, thereby allowing for development of
optimal treatments for treating the disorder based on the
determination that subjects exhibiting a particular genotype (which
can include the presence of particular polymorphisms, as disclosed
herein) respond well or poorly to particular pharmacologic,
behavioral, and surgical treatments.
[0097] In particular, the presently disclosed subject matter
provides that the enzyme catecholamine-O-methyltransferase (COMT),
which functions in part to metabolize catecholamines such as
epinephrine and norepinephrine, the .beta.2-adrenergic receptor
(ADRB2) and the .beta.3-adrenergic receptor (ADRB3), which are
receptors for catecholamines, are components of a molecular pathway
that plays a role in somatosensory disorders. The presently
disclosed subject matter discloses pharmacotherapies that correct
or improve the impairments in this pathway. Further, the presently
disclosed subject matter provides insights into particular
polymorphism patterns more prevalentin subjects suffering from
somatosensory and related disorders.
[0098] Therefore, determining a subject's genotype for COMT, ADRB2,
and/or ADRB3 can be used to predict the susceptibility of the
subject to develop a somatosensory or related disorder, as
disclosed herein. Further, determining a subject's genotype can be
used to develop and/or provide an effective therapy for the
subject, as it has been determined by the present co-inventors and
is disclosed herein for the first time that particular genotypes of
the COMT, ADRB2, and/or ADRB3 genes, result in gene products with
different activities that make a subject more or less responsive to
particular pharmacologic therapies. Thus, a subject's determined
genotype with respect to COMT, ADRB2, and/or ADRB3 can be used to
subclassify the particular somatosensory or related disorder and
thereby direct treatment strategies.
I. DEFINITIONS
[0099] While the following terms are believed to be well understood
by one of ordinary skill in the art, the following definitions are
set forth to facilitate explanation of the presently disclosed
subject matter.
[0100] Unless defined otherwise, all technical and scientific terms
used herein have the same meaning as commonly understood to one of
ordinary skill in the art to which the presently disclosed subject
matter belongs. Although any methods, devices, and materials
similar or equivalent to those described herein can be used in the
practice or testing of the presently disclosed subject matter,
representative methods, devices, and materials are now
described.
[0101] Following long-standing patent law convention, the terms
"a", "an", and "the" refer to "one or more" when used in this
application, including the claims. Thus, for example, reference to
"a cell" includes a plurality of such cells, and so forth.
[0102] Unless otherwise indicated, all numbers expressing
quantities of ingredients, reaction conditions, and so forth used
in the specification and claims are to be understood as being
modified in all instances by the term "about". Accordingly, unless
indicated to the contrary, the numerical parameters set forth in
this specification and attached claims are approximations that can
vary depending upon the desired properties sought to be obtained by
the presently disclosed subject matter.
[0103] As used herein, the term "about," when referring to a value
or to an amount of mass, weight, time, volume, concentration or
percentage is meant to encompass variations of in some embodiments
.+-.20%, in some embodiments .+-.10%, in some embodiments .+-.5%,
in some embodiments .+-.1%, in some embodiments .+-.0.5%, and in
some embodiments .+-.0.1% from the specified amount, as such
variations are appropriate to perform the disclosed method.
[0104] ".beta.2-adrenergic receptor" (ADRB2) and
".beta.3-adrenergic receptor (ADRB3)" as used herein refer to
cellular macromolecular complexes that when stimulated by
catecholamines such as epinephrine (ADRB2) and norepinephrine
(ADRB3) produce biological or physiological effects. The core
component of both ADRB2 and ADRB3 is a seven transmembrane domain
protein that comprise several functional sites. These proteins are
comprised of a ligand-binding domain, as well as an effector domain
that permits the receptor to associate with other cellular
proteins, such as G proteins and .beta.-arrestin. Together, these
molecules interact as a receptor unit to produce a biological
response. These receptors are widely distributed on multiple
tissues throughout the body. ADRB2 can be found on neuronal and
glial tissues in the central nervous system and on smooth muscle,
bone, cartilage, connective tissue, the intestines, lungs,
bronchial glands, liver. ADRB2 receptors are present on macrophages
and when stimulated produce proinflammatory and pro-pain producing
cytokines such as IL1.beta., IL6, and TNF.alpha.. ADRB3 are present
on smooth muscle, white and brown adipose tissue and in several
regions of the central nervous system including the hypothalamus,
cortex, and hippocampus. ADRB3 receptors are highly enriched on
adipocytes and when stimulated produce proinflammatory and pro-pain
producing cytokines such as IL1.beta., IL6, and TNF.alpha..
[0105] "Catecholamine-O-methyltransferase" (COMT) as used herein
refers to an enzyme that functions in part to metabolize catechols
and catecholamines, such as epinephrine and norepinephrine by
covalently attaching to the catecholamine one or more methyl
moieties. The enzyme is widely distributed throughout the body,
including the brain. The highest concentrations of COMT are found
in the liver and kidney. Most of norepinephrine and epinephrine
that is released from the adrenal medulla or by exocytosis from
adrenergic fibers is methylated by COMT to metanephrine or
normetanephrine, respectively.
[0106] As used herein, the term "expression" generally refers to
the cellular processes by which an RNA is produced by RNA
polymerase (RNA expression) or a polypeptide is produced from RNA
(protein expression).
[0107] The term "gene" is used broadly to refer to any segment of
DNA associated with a biological function. Thus, genes include, but
are not limited to, coding sequences and/or the regulatory
sequences required for their expression. Genes can also include
non-expressed DNA segments that, for example, form recognition
sequences for a polypeptide. Genes can be obtained from a variety
of sources, including cloning from a source of interest or
synthesizing from known or predicted sequence information, and can
include sequences designed to have desired parameters.
[0108] "ADRB2 gene" and "ADRB3 gene" are used to refer to gene loci
related to the corresponding seven transmembrane domain proteins,
which are the core component of the receptor complex.
[0109] As used herein, the term "DNA segment" means a DNA molecule
that has been isolated free of total genomic DNA of a particular
species. Included within the term "DNA segment" are DNA segments
and smaller fragments of such segments, and also recombinant
vectors, including, for example, plasmids, cosmids, phages,
viruses, and the like.
[0110] As used herein, the term "genotype" means the genetic makeup
of an organism. Expression of a genotype can give rise to an
organism's phenotype, i.e. an organism's physical traits. The term
"phenotype" each refers to any observable property of an organism,
produced by the interaction of the genotype of the organism and the
environment. A phenotype can encompass variable expressivity and
penetrance of the phenotype. Exemplary phenotypes include but are
not limited to a visible phenotype, a physiological phenotype, a
susceptibility phenotype, a cellular phenotype, a molecular
phenotype, and combinations thereof. Preferably, the phenotype is
related to a pain response variability, including phenotypes
related to somatosensory disorders and/or predictions of
susceptibility to somatosensory disorders, or related pain
sensitivity conditions. As such, a subject's genotype when compared
to a reference genotype or the genotype of one or more other
subjects can provide valuable information related to current or
predictive phenotype.
[0111] "Determining the genotype" of a subject, as used herein, can
refer to determining at least a portion of the genetic makeup of an
organism and particularly can refer to determining a genetic
variability in the subject that can be used as an indicator or
predictor of phenotype. The genotype determined can be the entire
genome of a subject, but far less sequence is usually required. The
genotype determined can be as minimal as the determination of a
single base pair, as in determining one or more polymorphisms in
the subject. Further, determining a genotype can comprise
determining one or more haplotypes. Still further, determining a
genotype of a subject can comprise determining one or more
polymorphisms exhibiting high linkage disequilibrium to at least
one polymorphism or haplotype having genotypic value.
[0112] As used herein, the term "polymorphism" refers to the
occurrence of two or more genetically determined alternative
variant sequences (i.e., alleles) in a population. A polymorphic
marker is the locus at which divergence occurs. Preferred markers
have at least two alleles, each occurring at frequency of greater
than 1%. A polymorphic locus may be as small as one base pair.
[0113] As used herein, "haplotype" means the collective
characteristic or characteristics of a number of closely linked
loci with a particular gene or group of genes, which can be
inherited as a unit. For example, in some embodiments, a haplotype
can comprise a group of closely related polymorphisms (e.g., single
nucleotide polymorphisms (SNPs)). In some embodiments, the
determined genotype of a subject can be particular haplotypes for
COMT, ADRB2, and ADRB3, such as for example: with regard to the
ADRB2 genotype, Haplotype 1, Haplotype 2, Haplotype 3, and
Uncommon; with regard to the ADRB3 genotype, Haplotype 1, Haplotype
2, Haplotype 3, and Uncommon; and with regard to the COMT genotype,
low pain sensitive haplotype (LPS), average pain sensitive
haplotype (APS), and high pain sensitive haplotype (HPS). Each of
these haplotypes is defined by specific SNP patterns, as disclosed
in detail herein.
[0114] As used herein, "linkage disequilibrium" means a derived
statistical measure of the strength of the association or
co-occurrence of two independent genetic markers. Various
statistical methods can be used to summarize LD between two markers
but in practice only two, termed D' and r2, are widely used.
[0115] In some embodiments, determining the genotype of a subject
can comprise identifying at least one haplotype of a gene, such as
for example ADRB2, ADRB3, COMT or combinations thereof. In some
embodiments, determining the genotype of a subject can comprise
identifying at least one polymorphism unique to at least one
haplotype of a gene, such as for example ADRB2, ADRB3, COMT, or
combinations thereof. In some embodiments, determining the genotype
of a subject can comprise identifying at least one polymorphism
exhibiting high linkage disequilibrium to at least one polymorphism
unique to at least one haplotype, such as for example ADRB2
haplotype, ADRB3 haplotype, COMT haplotype, or combinations
thereof. In some embodiments, determining the genotype of a subject
can comprise identifying at least one polymorphism exhibiting high
linkage disequilibrium to at least one haplotype, such as for
example ADRB2 haplotype, ADRB3 haplotype, COMT haplotype, or
combinations thereof.
[0116] As used herein, the term "modulate" means an increase,
decrease, or other alteration of any, or all, chemical and
biological activities or properties of a wild-type or mutant
polypeptide, such as for example COMT, ADRB2, ABRB3 or combinations
thereof. A peptide can be modulated at either the level of
expression, e.g., modulation of gene expression (for example,
anti-sense therapy, siRNA or other similar approach, gene therapy,
including exposing the subject to a gene therapy vector encoding a
gene of interest or encoding a nucleotide sequence that influences
expression of a gene of interest), or at the level of protein
activity, e.g., administering to a subject an agonist or antagonist
of a receptor macromolecule, such as ADRB2 and/or ADRB3, or an
activator or inactivator of an enzyme polypeptide, such as for
example COMT. The term "modulation" as used herein refers to both
upregulation (i.e., activation or stimulation) and downregulation
(i.e. inhibition or suppression) of a response.
[0117] As used herein, the term "mutation" carries its traditional
connotation and means a change, inherited, naturally occurring or
introduced, in a nucleic acid or polypeptide sequence, and is used
in its sense as generally known to those of skill in the art.
[0118] As used herein, the term "polypeptide" means any polymer
comprising any of the 20 protein amino acids, regardless of its
size. Although "protein" is often used in reference to relatively
large polypeptides, and "peptide" is often used in reference to
small polypeptides, usage of these terms in the art overlaps and
varies. The term "polypeptide" as used herein refers to peptides,
polypeptides and proteins, unless otherwise noted. As used herein,
the terms "protein", "polypeptide" and "peptide" are used
interchangeably herein when referring to a gene product.
[0119] "Somatization" as used herein refers to an individual's
report of distress arising from the perception of bodily
dysfunction. Complaints typically focus on cardiovascular,
gastrointestinal, respiratory and other systems with strong
autonomic mediation. Aches and pain, and discomfort are frequently
present and localized in the gross musculatures of the body.
[0120] "Somatosensory disorder" as used herein refers to clinical
conditions characterized by the perception of persistent pain,
discomfort or unpleasantness in various regions of the body. These
conditions are generally, but not always, associated with enhanced
sensitivity to pain. On occasion, these conditions are observed
without currently known measures of tissue pathology. Exemplary
somatosensory disorders include, but are not limited to chronic
pain conditions, idiopathic pain conditions, fibromyalgia syndrome,
myofascial pain disorders, tension headache, migraine headache,
phantom limb sensations, irritable bowel syndrome, chronic lower
back pain, chronic fatigue syndrome, multiple chemical
sensitivities, temporomandibular joint disorder, post-traumatic
stress disorder, chronic idiopathic pelvic pain, Gulf War Syndrome,
vulvar vestibulitis, osteoarthritis, rheumatoid arthritis, and
angina pectoris. A general characteristic of a specific
somatosensory disorder is that it can be associated with at least
one additional or multiple co-morbid somatosensory disorders.
[0121] "Treatment" as used herein refers to any treatment of a
somatosensory disorder and includes: (i) preventing the disorder
from occurring in a subject which may be predisposed to the
disorder, but has not yet been diagnosed as having it; (ii)
inhibiting the disorder, i.e., arresting its development; or (iii)
relieving the disorder, i.e., causing regression of clinical
symptoms of the disorder.
II. METHODS OF PREDICTING ENHANCED PAIN SENSITIVITY AND RISK OF
DEVELOPING SOMATOSENSORY DISORDERS
[0122] The presently disclosed subject matter provides for
determining a genotype of a subject with respect to particular
genes having a role in determining pain sensitivity in the subject.
Thus, determining the genotype of the subject can elucidate pain
processing and psychological phenotypes in the subject, which in
turn can be used to predict a subject's pain sensitivity and risk
for develop a somatosensory disorder (FIG. 1). The present subject
matter discloses for the first time that the COMT, ADRB2, and ADRB3
genes encode for proteins that each, and in combination with one
another, play an important role in pain perception or sensitivity.
Thus, genotyping one or more of these genes can provide valuable
information related to pain sensitivity useful for predicting
responses to pain, susceptibility to develop pain disorders and
even insights into effective therapies to treat sensory disorders
and related conditions.
[0123] II.A. COMT Genotypes
[0124] As disclosed herein, COMT genotype is highly associated with
human pain perception. As further discussed in the Examples herein
below, there are three major COMT haplotypes (low pain sensitivity
(LPS), average pain sensitivity (APS) and high pain sensitivity
(HPS)) that determine COMT enzymatic activity, encompassing
.about.96% of the examined genotypes. As indicated by the
nomenclature, the LPS haplotype is associated with low pain
sensitivity, APS is associated with higher pain sensitivity, and
HPS with the highest sensitivity to pain. Collectively, these three
haplotypes account for about .about.11% of the variability in pain
perception. Given the inevitably polygenic nature of pain
perception, the magnitude of the effect of COMT haplotypes on pain
sensitivity is substantial. Indeed, quantitative trait locus (QTL)
mapping studies for related traits in mice have shown that each
single QTL usually accounts for 5 to 25% of the overall variance in
nociceptive sensitivity (Mogil et al. (2003); Abiola et al.
(2003)).
[0125] The combination of synonymous and nonsynonymous SNPs within
COMT haplotypes can produce effects on protein function that exceed
the effects of individual SNPs. The presently disclosed subject
matter provides evidence to show that genomic variations in the
COMT gene do not alter the amount of COMT mRNA, suggesting that the
differences in enzymatic activity result from differences in
protein translation. The fact that expressed cDNA constructs, which
differed in only three SNPs rs4633, rs4818, and rs4680
(val.sup.158met), showed more than an 11-fold difference in
expressed enzyme activity, confirms that the observed association
between haplotypes and pain sensitivity can be caused by
combinations of these three SNPs and not necessarily by other SNPs
in the haploblock situated in the 5' or intronic region of the COMT
gene that can affect RNA transcription. Without desiring to be
limited by theory, interactions between SNPs can possibly have
profound effects on the secondary mRNA structure, which controls
the efficacy of protein translation. The identification of new
functional haplotypes disclosed herein suggests that haplotype
reconstruction can provide important insights into relationship
between COMT polymorphism, human pain sensitivity, and
somatosensory disorders.
[0126] Furthermore, COMT inhibition in rodents results in a robust
increase in pain sensitivity. The presently disclosed subject
matter provides evidence that COMT activity regulates pain
sensitivity and strongly suggests that the observed association
between COMT genotype and pain perception in humans is not
epiphenomenal.
[0127] The presently disclosed subject matter represents the first
demonstration of an association between a genetic polymorphism that
impacts pain sensitivity and the risk for myogenous
temporomandibular disorder (TMD), which is a highly prevalent
musculoskeletal pain condition (i.e, somatosensory disorder). The
presence of even a single high COMT activity (LPS) haplotype
diminishes by as much as 2.3 times, the risk of developing TMD. The
risk ratio of 2.3 is of a magnitude comparable to genetic risk
factors for other multifactorial conditions such as schizophrenia
and is similar to other predictors of TMD, such as a history of
chronic pain at other body sites. The clinical relevance of this
novel finding is best quantified by the measure of population
attributable risk for having HPS and/or APS, which was 29% in the
particular cohort of women subjects studied in the Example
presented belows, indicating that nearly one third of new TMD cases
can be attributed to this COMT genotype.
[0128] Without desiring to be limited by theory, a possible
mechanism by which diminished COMT activity influences pain
perception and the development of somatosensory disorders is that
reduced COMT activity results in elevated levels of catecholamines
such as epinephrine, which promote the production of persistent
pain states via the stimulation of ADRB2 and ADRB3 in the
peripheral and central nervous system. The data disclosed herein
supports this proposed mechanism. The novel clinical, animal and
molecular data presented herein are in complete agreement with the
conclusion that COMT activity substantially influences pain
sensitivity, and that the three major haplotypes determine COMT
activity in humans in a fashion that inversely correlates with pain
sensitivity and the risk of developing somatosensory disorders,
including for example TMD. Thus, determination of a genotype of
COMT in a subject can be used to identify a pain sensitivity
phenotype in the subject, which in turn can be utilized to predict
pain sensitivity and/or susceptibility of the subject to develop a
condition related to hypersensitivity to pain, such as for example
a somatosensory disorder.
[0129] The novel insights disclosed herein with regard to
determining and predicting pain sensitivity and risk of development
of somatosensory disorders is not limited to COMT genotypes, but
further extends to ADRB2 and ADRB3, individually and in combination
with each other.
[0130] II.B. ADRB2 Genotypes
[0131] The presently disclosed subject matter provides that common
genetic variants of ADRB2, comparable to COMT, also influence human
psychological traits such as somatization, anxiety, and depression
that influence pain sensitivity and the risk of developing a
somatosensory disorder (FIG. 1). The presently disclosed subject
matter provides in some embodiments three major ADRB2 haplotypes
(H1, H2, H3) that determine ADRB2 expression and activity, as well
as other rare haplotypes, referred to collectively herein as
"Uncommon".
[0132] In the cohort studied and disclosed in the Examples herein
below, H1 homozygotes had the highest BDI depression and trait
anxiety scores (FIG. 2A-B and Table 8). Previously published animal
studies, which have examined the physiology of ADRB2, provide
evidence that low levels of the receptor can lead to depression and
anxiety and that direct stimulation of central ADRB2 produces
antidepressant-like effects in rats (Zhang et al. (2003)).
Furthermore, reductions in the density of ADRB in humans is
associated with depression and panic-anxiety (Magliozzi et al.
(1989)). Based on these results, related association studies and
analysis of the EST databases, it can be stated that H1 codes for
low levels of receptor (Lo expressers), at least in the CNS, as
depicted in FIG. 3.
[0133] The H2 haplotype showed a strong association with
somatization (see BSI and PILL scores in the Examples herein below
and FIG. 2B) and H2 homozygotes showed significantly higher
somatization score (Table 8). This observation is in agreement with
the EST expression analysis data suggesting that H2 codes for high,
levels of receptor (Hi expressers--FIG. 3). In human studies,
stimulation of ADRB2 was shown to be associated with enhanced
epinephrine-mediated physiological arousal and increased somatic
awareness across multiple systems (e.g., gastrointestinal,
cardiorespiratory, etc.) (Kopin, I. J. (1984); Easton et al.
(1976); Lader, M. (1988)). In the data disclosed herein in the
Examples, H2 demonstrated a protective role against elevated trait
anxiety because subjects without H2 reported the highest trait
anxiety scores (FIG. 2B and Table 8).
[0134] Haplotype H3 was associated with the highest state- and
mood-dependent anxiety and hostility scores (Table 8). These
observations suggest a rapid stress-evoked reduction in the amount
of functionally available ADRB2 in H3 homozygotes (FIG. 3). These
results are in agreement with the presence of the G allele at SNP
rs1042713 (Arg.sup.16Gly) that codes for Gly16 (FIG. 4), which is
responsible for agonist-dependent internalization of the receptor
and is consistent with the EST expression analysis data disclosed
in the Examples, which indicates that H3 codes for high basal
levels of receptor (Hi expressers). Furthermore, H3 homozygotes
report the lowest level of depression (BSI), which is in agreement
with the high psychological reactivity observed in these
subjects.
[0135] Resting arterial diastolic blood pressure is associated with
the number of copies of H2 (FIG. 2A). H2 homozygotes (high
expression/slow internalization) had the lowest resting diastolic
pressure and subjects without a H2 haplotype (subjects with
combinations of H1 and H3, rapid receptor internalization) had the
greatest resting diastolic pressures (Table 8, FIG. 2A). An even
stronger effect was observed for H1 (Table 8, FIG. 2A). Subjects
with no H1 (subjects with combinations of H2 and H3, high receptor
expression) had the lowest systolic and diastolic blood pressure
(FIG. 2A, Table 8). Although homozygotes for H1 had higher resting
arterial blood pressure, the highest resting arterial systolic and
diastolic blood pressures were seen with H1-H2 and H1-H3
heterozygotes (Table 9), suggesting a H1 overdominance. It is
noteworthy that these same subjects were less likely to develop TMD
(Table 11), which is consistent with the substantial literature
that pain sensitivity and the risk of developing chronic
musculoskeletal conditions is inversely related to resting arterial
blood pressure (Maixner et al. (1997); Bruehl et al. (2004);
Fillingim et al. (1998); Pfleeger et al. (1997); Maixner, W.
(1991); Randich et al. (1984); Sheps et al. (1992); Hagen et al.
(2005)).
[0136] The analysis of EST databases disclosed herein suggests that
H1 codes for a lower amount of RNA expression compared to H2 and
H3. The outcomes of the association study, and known effects of
genetic variations in ADRB2 on various physiological functions such
as blood pressure (Bray et al. (2000)) and airway resistance
(Tattersfield et al. (2004)), support this conclusion. Two cell
biology-based studies, which sought to determine the relationship
between ADRB2 expression and common polymorphisms, did not reach
consistent conclusions on this subject (Drysdale et al. (2000);
McGaw et al. (1998)), which may be due to tissue specific effects
on haplotype expression. Although cell culture studies can be
designed for an accurate assessment of haplotype-specific
expression in different tissue-specific cell lines and under
different conditions of transcription stimulation, it is believed
that the data and analysis provided in the Examples herein below
that H1 codes for a lower level of expression of the receptor
compared to H2 and H3, particularly in the CNS.
[0137] While it is not desired to be bound by any particular theory
of operation, based on the data and analysis provided in the
Examples below, the analysis of EST frequencies, and known data
related to ADRB2 cell biology, a model that explains how different
haplotypes produce different psychological phenotypes (FIG. 3) is
provided herein. In the resting physiological state, H1 homozygotes
express several times fewer receptors than either H2 or H3
homozygous (FIG. 3A). Chronically diminished ADRB2 function in the
CNS, as proposed for H1 homozygotes, would produce psychological
traits such as depression and anxiety, which has been observed in
some patients treated with non-selective ADRB receptor blockers
(Thiessen et al. (1990). In contrast, chronically enhanced ADRB2
function, as proposed for H2 homozygotes, would display
psychological characteristics of physiological arousal and enhanced
awareness of bodily functions (i.e., somatization) evoked by
stimulation of central ADRB2 and a reduction in arterial blood
pressure by ADRB2 stimulation on peripheral blood vessels.
[0138] Epinephrine released from the adrenal glands in response to
a stressful situation should lead to a rapid internalization of
receptor variants H1 and H3. For the H3 homozygotes, but not H1
homozygotes, this would lead to a significant reduction in receptor
density producing a stress-evoked state-dependent anxiety (FIG.
3B). Based on this model, and without wishing to be limited by
theory, it is proposed that the relative rank order of ADRB2
receptor function in response to agonist stimulation is the
following: H2 (high expression/low down regulation) similar to H3
(high expression/high down regulation), both of which are greater
than H1 (low expression/high down regulation).
[0139] The presently disclosed subject matter can thus provide and
advantage in considering haplotypes rather than single SNPs. Each
haplotype of ADRB2 codes for two basic receptor properties--the
level of expression and the internalization responses produced by
agonist stimulation. Both of these properties influence
physiological responses and phenotypes associated with ADRB2.
[0140] An overdominance of H1 over H2 and H3 is another feature of
ADRB2 genetics that can complicate the interpretation of
association studies. Individuals heterozygous for H1-H2 and H1-H3
show the highest level of resting arterial blood pressure and
lowest BDI depression score (FIG. 2A). Although the H1-H2 and H1-H3
heterozygotes represented almost half of the initially tested
cohort, only one TMD case was observed in this group, yielding
significantly elevated risk of developing TMD for both "Lo" and
"Hi" homozygotes and suggests that the presence of one H1 haplotype
is protective against TMD onset. An overdominance was further
confirmed by linear models that investigated the interactions
between haplotypes. The best-fit model for resting blood pressure
revealed interactions between the H1 haplotype and H2 and H3, but
only the H1-H3 interaction revealed a significant overdominance,
which was probably due to the limited sample size. The H1-H3
interaction also showed overdominance when associated with BSI
depression phenotype (Table 9): H1-H3 heterozygotes showed the
highest BSI depression score while H3 homozygotes showed the lowest
BSI depression score (Table 8). Importantly, H1-H3 heterozygotes
showed the highest score for both mood phenotypes (POMS
agreeable-hostile, POMS composed-anxious; Table 8), which probably
reflects the low psychological reactivity, associated with the
H1-H3 heterozygotes.
[0141] The data provided herein with regard to ADRB2 genotypes are
of considerable clinical significance and are the first to
demonstrate an association between a genetic polymorphism that
correlates with psychological traits, resting blood pressure, and
pain sensitivity determination, which in turn is associated with
the susceptibility of developing a somatosensory disorder or
somatization or predicting a subject's pain sensitivity. For
example, the observed genetic risk for developing TMD associated
with ADRB2 polymorphism is substantially greater than that reported
for other putative risk factors such as estrogen exposure or
history of chronic pain at other body sites (John et al. (2003);
Von Korff et al. (1993)). The clinical relevance of these findings
are best quantified by the measure of population attributable risk
for being homozygous for either high or low expression of ADRB2,
which was 82% in the cohort of women subjects (see Examples),
indicating that more than eight in ten of the myogenous TMD cases
can be attributed to the ADRB2 haplotypes disclosed herein.
[0142] Individuals with relatively high ADRB2 function (H2 and H3)
had a high likelihood of developing TMD (Table 11). H2 homozygotes
showed the highest TMD incidence rate (0.200). H2-H3 heterozygotes
and H3 homozygotes, where ADRB2 function should be slightly
diminished, showed TMD incidence rates of 0.125 and 0.100
respectively, which was still higher than the average TMD incidence
rate of 0.083. Surprisingly, very low ADRB2 function appears to
increase the risk for TMD development. An elevated TMD incidence
rate of 0.105 for H1 homozygotes was observed. H1 heterozygotes,
those who had one haplotype that coded for high ADRB2 expression
(H2 or H3) and one haplotype that coded for low ADRB2 expression of
low activity (H1), were protected from the development of TMD. Only
one subject who was H1 heterozygote developed TMD, even though
almost half of all the variants observed in the cohort were H1
heterozygotes (Table 11). Thus, the data disclosed herein (see
Examples herein below) suggest that either positive or negative
imbalances in ADRB2 function can increase the vulnerability to TMD.
Collectively, 14 of 15 TMD (93%) patients were associated with a
relative hyperfunction (10/15) or hypofunction of (4/15) of ADRB2
(Table 11).
[0143] The findings disclosed herein have important treatment
implications. If ADRB2 hyperfunction contributes to somatosensory
disorders, such as for example TMD, then a relatively high
percentage of these patients (.about.60-70%) should respond to
treatment with an ADRB2 antagonist, such as for example
propranolol. In contrast, approximately 25 to 30% of some
somatosensory disorders, such as for example TMD, should have a
hypofunction of ADRB2 (H1/H1) and should not respond to treatment
with an ADRB2 antagonist. In fact, treatment of this group with
such an agent might actually worsen their signs and symptoms. Thus,
the presently disclosed subject matter provides for predicting
treatment outcomes to ADRB2 blockade by determining the specific
haplotype profile for patients with somatosensory disorders,
including, for example, TMD.
[0144] II.C. ADRB3 Genotypes
[0145] The presently disclosed subject matter also provides that
common genetic variants of ADRB3, comparable to COMT and ADRB2, can
also influence human psychological traits that influence pain
sensitivity and the risk of developing a sensory disorder.
Particularly, there are three major ADRB3 haplotypes (H1, H2, H3)
that determine ADRB2 expression and activity, as well as other rare
haplotypes, referred to collectively herein as "Uncommon".
[0146] By way of elaboration, the data presented herein based on
the determined association analysis of ADRB3 haplotypes with pain
responsiveness and somatization score, demonstrates that subjects
bearing H2 or H3 haplotypes of ADRB3 can be predicted to have lower
risk for developing somatosensory disorders, including TMD.
[0147] Further, with regard to predicting somatization in a subject
based on genotyping of the subject with regard to ADRB3 haplotype,
subjects bearing a H3 haplotype have a lower PILL somatization
score than those who do not carry a H3 allele (see FIG. 5).
Consistent with this observation, H1/H3 heterozygotes also have low
pain responsiveness (see Table 12).
[0148] The data presented in the Examples further indicates
ADRB3H1/H2 subjects (i.e., the subject possesses one copy of both
Haplotype 1 and Haplotype 2 for ADRB3) or H2/H2 subjects (i.e., the
subject possesses two copies of Haplotype 2 for ADRB3), who exhibit
the lowest pain sensitivity, and ADRB3H1/H3 subjects (i.e., the
subject possesses one copy of both Haplotype 1 and Haplotype 3 for
ADRB3), who have low pain sensitivity and the lowest somatization
scores, each have lower risk of developing pain-related conditions,
such as for example somatosensory disorders.
[0149] II.D. Methods of Predicting Susceptibility to Develop
Somatosensory Disorders
[0150] On the basis of the data disclosed herein and the discussion
preceding regarding determining pain perception-related genotypes,
the presently disclosed subject matter provides methods of
predicting susceptibility of a subject, i.e. the predisposition of
or risk of the subject, to develop a somatosensory disorder. In
some embodiments, the method comprises determining a genotype of
the subject with respect to a gene selected from the group
consisting of ADRB2, ADRB3, COMT, and combinations thereof; and
comparing the genotype of the subject with at least one reference
genotype associated with susceptibility to develop the
somatosensory disorder, wherein the reference genotype is selected
from the group consisting of an ADRB2 genotype, an ADRB3 genotype,
a COMT genotype, and combinations thereof, whereby susceptibility
of the subject to develop the somatosensory disorder is
predicted.
[0151] "Reference genotype" as used herein refers to a previously
determined pattern of unique genetic variation associated with a
particular phenotype, such as for example pain perception or
sensitivity. The reference genotype can be as minimal as the
determination of a single base pair, as in determining one or more
polymorphisms in the subject. Further, the reference genotype can
comprise one or more haplotypes. Still further, the reference
genotype can comprise one or more polymorphisms exhibiting high
linkage disequilibrium to at least one polymorphism or haplotype.
In some particular embodiments, the reference genotype comprises
one or more haplotypes of COMT, ADRB2, ADRB3, or combinations
thereof determined to be associated with pain perception, including
for example pain response prediction, susceptibility to a
somatoform disorder, and/or somatization. In some embodiments, the
haplotypes represent a particular collection of specific single
nucleotide polymorphisms. For example, FIG. 6 shows haplotype
sequences of COMT based on polymorphism patterns which determine
haplotypes LPS, APS, and HPS, and when inherited in particular
combinations (as described herein) are associated with differences
in pain sensitivity. These combinations are reference genotypes for
predicting susceptibility to somatosensory disorders and related
conditions based on matching determined genotypes of a subject to
the reference genotypes.
[0152] In particular embodiments, SNPs rs6269G/A
(GCATTTCTGAACCTTGCCCCTCTGC[G/A]AACACAAGGGGGCGATGGTGG CACT (SEQ ID
NO: 29)); rs4633C/T
(CCAAGGAGCAGCGCATCCTGAACCA[C/T]GTGCTGCAGCATGCGGAGCCC GGGA (SEQ ID
NO: 30)); rs4818G/C
(GCCTGCTGTCACCAGGGGCGAGGCT[G/C]ATCACCATCGAGATCAACCCC GACT (SEQ ID
NO: 31)); and rs4680G/A
(CCAGCGGATGGTGGATTTCGCTGGC[G/A]TGAAGGACAAGGTGTGCATGC CTGA (SEQ ID
NO: 32)) are used to determine the COMT haplotypes. Using the
convention order rs6269_rs4633_rs4818_rs4680, haplotype G_C_G_G is
referred to herein as LPS, haplotype A_T_C_A is referred to herein
as APS, and haplotype A_C_C_G is referred to herein as HPS.
[0153] Likewise, FIG. 4B shows haplotypes H1, H2, and H3 of ADRB2
based on specific polymorphisms as shown in FIG. 4A and FIG. 7
shows haplotypes H1, H2, and H3 of ADRB3 based on specific
polymorphisms.
[0154] In some embodiments, for ADRB2, SNPs G-7127AG/A
(CAAGTTGTTGTGTAGGATATTGGCAATTTTTGCTTGTCAGCTCCATGGTAC
TTCTTCCGAATCA[G/A]AAATTTATCTCCTCAGTGGCCCTCAAAGCACTTTCT
TCCCACTATAGGCTTGTTCAGTTTAGAGTAGACAG (SEQ ID NO: 267));
rs11958940T/A; (ACTCTCTAAGGTCATGTGAACAGTAWGCAGTGCTACTCGAACTCCTCTGC
T (SEQ ID NO:268);
rs1432622GC/T(GAAAACTATGTGAATATAATAGATC[C/T]TTAATTCATATTT
GTGGATTTTATG) (SEQ ID NO:269)); rs1432623C/T
(TTATGTAAACTTCGCTTACAAACTA[C/T]ACTTGTGTGACACTTATATGAGC AA (SEQ ID
NO:270)); rs2400707A/G
(CCAGATGGTGGCAATTTCACATGGC[A/G]CAACCCGAAAGATTAACAAACT ATC (SEQ ID
NO:271)); rs1042713G/A
(CAGCGCCTTCTTGCTGGCACCCAAT[G/A]GAAGCCATGCGCCGGACCACG ACGT (SEQ ID
NO:272)); rs1042714G/C
(TGCGCCGGACCACGACGTCACGCAG[G/C]AAAGGGACGAGGTGTGGGTG GTGGG (SEQ ID
NO:273); and rs1042717G/A
(CCTGTGCTGATCTGGTCATGGGCCT[G/A]GCAGTGGTGCCCTTTGGGGCC GCCC (SEQ ID
NO: 274)) are used to determine the ADRB2 haplotypes. Using the
convention order G-7127A.sub.-- rs11958940_rs14326222_
rs14326223_rs2400707_rs1042713_rs1042714_rs1042717G/A haplotype
G_A_A_A_G_G_G_G is referred to herein as Haplotype 1 (H1),
haplotype A_T_G_G_A_A_C_G is referred to herein as Haplotype 2
(H2), and haplotype G_T_G_G_A_G_C_A is referred to herein as
Haplotype 3 (H3).
[0155] In some embodiments, for ADRB3, rs4994T/C
(CCTGCTGGTCATCGTGGCCATCGCC[T/C]GGACTCCGAGACTCCAGACCA TGAC (SEQ ID
NO: 302)); rs4997C/A
(ACGGCTCGACGGGTAGGTAACCGGG[C/A]CAGAGGGACCGGCGGCTCAG GGTCG (SEQ ID
NO: 303)); rs2071493A/G
(GTGCCCTGGCGTTTTTGTGTAACTA[A/G]ATATGCGTTCCAGGGTCTCTGA TCT (SEQ ID
NO: 304)); rs4998G/C
(CTCCTCCCTCAGTGGTAGTGTCCAG[G/C]TGCCGTGGAGCAGCAGGCTGG CTTT (SEQ ID
NO: 305)); and rs9694197G/A
(CCAAGAAATCTTGCACACCTCAGAC[G/A]CCAGAGATCTCACCCTGCCCTG GTT (SEQ ID
NO: 306)) are used to determine the ADRB3 haplotypes. Using the
convention order rs4994_rs4997_rs2071493_rs4998_rs9694197 haplotype
T_C_T_G_G is referred to herein as Haplotype 1 (H1), haplotype
T_A_T_G_G is referred to herein as Haplotype 2 (H2), and haplotype
C_A_C_C_A is referred to herein as Haplotype 3 (H3).
[0156] In the Sequence Listing, the polymorphic nucleotide site of
each sequence is represented by a one letter symbol as set forth in
WIPO Standard ST.25 (1998), Appendix 2, Table 2, herein
incorporated by reference. For example, "R" represents G or A
([G/A]) at the sequence site, "Y" represents C or T at the sequence
site ([C/T]), etc.
[0157] In some embodiments of the methods of predicting
susceptibility of a subject to develop a somatosensory disorder
disclosed herein, determining the genotype of the subject comprises
one or more of: [0158] (i) identifying at least one haplotype of
ADRB2, ADRB3, COMT or combinations thereof; [0159] (ii) identifying
at least one polymorphism unique to at least one haplotype of
ADRB2, ADRB3, COMT, or combinations thereof; [0160] (iii)
identifying at least one polymorphism exhibiting high linkage
disequilibrium to at least one polymorphism unique to at least one
ADRB2 haplotype, ADRB3 haplotype, COMT haplotype, or combinations
thereof; or [0161] (iv) identifying at least one polymorphism
exhibiting high linkage disequilibrium to at least one ADRB2
haplotype, ADRB3 haplotype, COMT haplotype, or combinations
thereof. The determined genotype of the subject is then compared to
one or more reference genotypes associated with susceptibility to
develop a somatosensory disorder and if the determined genotype
matches the reference genotype, the subject is predicted to be
susceptible to a particular degree (as compared to a population
norm) to develop a somatosensory disorder.
[0162] As indicated above, the determined genotype need not
necessarily be determined based on a need to compare the determined
genotype to the reference genotype in particular, but rather can be
for example one or more polymorphisms exhibiting high linkage
disequilibrium to a COMT, ADRB2, ADRB3 polymorphism or haplotype or
combinations thereof, which can be equally predictive of
susceptibility to develop a somatosensory disorder. For example,
SEQ ID NOs: 29-266 are known SNPs for COMT. It is then determined,
by art recognized techniques, if one or more of the known SNPs of
COMT exhibit high linkage disequilibrium to one or more of the SNPs
used to determine the reference haplotypes of COMT predictive of
susceptibility to develop a somatosensory disorder. Thus, after a
review of the guidance provided herein, one of ordinary skill would
appreciate that any one or more polymorphisms exhibiting high
linkage disequilibrium to a polymorphism or haplotype of the
determined genotype with regard to COMT could likewise be effective
as a substitute or additional component of or as a substitute for
the determined genotype. Similarly, SEQ ID NOs: 267-301 and SEQ ID
NOs: 302-330 are known SNPs for ADRB2 and ADRB3, respectively, and
those SNPs exhibiting high linkage disequilibrium to one or more
polymorphisms or haplotypes of the determined genotype with regard
to ADRB2 or ADRB3 can also be used as a substitute or additional
component of the determined genotype. Likewise, polymorphisms
exhibiting high linkage disequilibrium to COMT, ADRB2, or ADRB3
(i.e. haplotypes and/or polymorphisms) could be used to supplement
or replace components of the reference genotype.
[0163] In some embodiments of the presently disclosed methods, the
ADRB2 genotype of the reference genotype is selected from the group
consisting of H1, H2, H3, and Uncommon; the ADRB3 genotype of the
reference genotype is selected from the group consisting of H1, H2,
H3, and Uncommon; and the COMT genotype of the reference genotype
is selected from the group consisting of LPS, APS, and HPS.
Further, in some embodiments, the determined genotype of the
subject with respect to ADRB2 is selected from the group consisting
of two copies of H1 (i.e., homozygous for H1), two copies of H2
(i.e., homozygous for H2), two copies of H3 (i.e., homozygous for
H3), one copy of both H2 and H3 (i.e., heterozygous for H2/H3), and
at least one copy of Uncommon (i.e., homozygous or heterozygous for
Uncommon) and the subject is then predicted to be susceptible to
develop the somatosensory disorder. Still further, in some
embodiments, the determined genotype of the subject with respect to
ADRB3 is selected from the group consisting of two copies of H1,
and at least one copy of Uncommon and the subject is predicted to
be susceptible to develop the somatosensory disorder. Even further,
in some embodiments, the determined genotype of the subject with
respect to COMT is selected from the group consisting of two copies
of APS, two copies of HPS, and one copy of both APS and HPS and the
subject is predicted to be susceptible to develop the somatosensory
disorder.
[0164] In some embodiments, the presently disclosed subject matter
provides methods of classifying a somatosensory disorder afflicting
a subject. The methods comprise in some embodiments determining a
genotype of the subject with respect to a gene selected from the
group consisting of ADRB2, ADRB3, COMT, and combinations thereof
and classifying the somatosensory disorder into a genetic subclass
somatosensory disorder based on the determined genotype of the
subject. Classifying the somatosensory disorder into a genetic
subclass somatosensory disorder can be utilized to select an
effective therapy for use in treating the genetic subclass
somatosensory disorder.
[0165] In some embodiments of the methods, determining the genotype
of the subject comprises one or more of: [0166] i. identifying at
least one haplotype of ADRB2, ADRB3, COMT or combinations thereof;
[0167] ii. identifying at least one polymorphism unique to at least
one haplotype of ADRB2, ADRB3, COMT, or combinations thereof;
[0168] iii. identifying at least one polymorphism exhibiting high
linkage disequilibrium to at least one polymorphism unique to at
least one ADRB2 haplotype, ADRB3 haplotype, COMT haplotype, or
combinations thereof; or [0169] iv. identifying at least one
polymorphism exhibiting high linkage disequilibrium to at least one
ADRB2 haplotype, ADRB3 haplotype, COMT haplotype, or combinations
thereof.
[0170] In some embodiments of the methods, the ADRB2 genotype is
selected from the group consisting of Haplotype 1, Haplotype 2,
Haplotype 3, and Uncommon; the ADRB3 genotype is selected from the
group consisting of Haplotype 1, Haplotype 2, Haplotype 3, and
Uncommon; and the COMT genotype is selected from the group
consisting of low pain sensitive haplotype (LPS), average pain
sensitive haplotype (APS), and high pain sensitive haplotype
(HPS).
[0171] The presently disclosed subject matter further provides that
pain sensitivity-related haplotypes, such as for example ADRB2 and
COMT, can be used to guide pharmacological treatment decisions
regarding the treatment of persistent or chronic pain and
inflammatory conditions, such as for example somatosensory
disorders. Specifically, subjects with low COMT activity (HPS/APS
group) can be predicted to benefit from pharmacological therapy
with ADRB2 antagonists or procedures that block or reduce ADRB2
function, with the best therapeutic effect observed for individuals
who are either H2 or H3 homozygous. In contrast, subjects with high
COMT activity (LPS group) can be predicted to be poor responders to
ADRB2-antagonist therapy, except for subjects carrying H3/H3 and
H2/H3 diplotypes.
[0172] As such, the presently disclosed subject matter provides in
some embodiments methods for selecting a therapy for a subject
having a somatosensory disorder. In some embodiments, the methods
comprise determining a genotype of the subject with respect to a
gene selected from the group consisting of ADRB2, ADRB3, COMT, and
combinations thereof and selecting a therapy based on the
determined genotype of the subject.
[0173] In some embodiments of the methods, determining the genotype
of the subject comprises one or more of: [0174] (i) identifying at
least one haplotype of ADRB2, ADRB3, COMT or combinations thereof;
[0175] (ii) identifying at least one polymorphism unique to at
least one haplotype of ADRB2, ADRB3, COMT, or combinations thereof;
[0176] (iii) identifying at least one polymorphism exhibiting high
linkage disequilibrium to at least one polymorphism unique to at
least one ADRB2 haplotype, ADRB3 haplotype, COMT haplotype, or
combinations thereof; or [0177] (iv) identifying at least one
polymorphism exhibiting high linkage disequilibrium to at least one
ADRB2 haplotype, ADRB3 haplotype, COMT haplotype, or combinations
thereof.
[0178] In some embodiments, the therapy is selected from the group
consisting of a pharmacological therapy, a behavioral therapy, a
psychotherapy, a surgical therapy, and combinations thereof. In
some embodiments the therapy is a pharmacological therapy
comprising administering to the subject an effective amount of an
ADRB2 modulator, an ADRB3 modulator, a COMT modulator, or
combinations thereof. In some embodiments, the therapy is a
behavioral therapy comprising treating the subject with biofeedback
therapy and/or relaxation therapy. In some embodiments, the therapy
is a surgical therapy, such as for example a back surgery, medical
Implant procedures (e.g., CNS stimulators for pain relief), joint
implant procedures, dental implant procedures (e.g., tooth
implants), or cosmetic/plastic surgery.
[0179] In some embodiments of the method, the ADRB2 genotype is
selected from the group consisting of Haplotype 1, Haplotype 2,
Haplotype 3, and Uncommon; the ADRB3 genotype is selected from the
group consisting of Haplotype 1, Haplotype 2, Haplotype 3, and
Uncommon; and the COMT genotype is selected from the group
consisting of low pain sensitive haplotype (LPS), average pain
sensitive haplotype (APS), and high pain sensitive haplotype (HPS).
Further, in some embodiments, the determined genotype of the
subject with respect to ADRB2 is selected from the group consisting
of two copies of H2, two copies of H3, and one copy of both H2 and
H3 and an effective amount an effective amount of an ADRB2
modulator, a COMT modulator, or combinations thereof is selected as
a therapy. Still further, in some embodiments, the determined
genotype of the subject with respect to ADRB3 is selected from the
group consisting of two copies of H1 and an effective amount of an
ADRB3 modulator, a COMT modulator, or combinations thereof is
selected as a therapy. Even further, in some embodiments, the
determined genotype of the subject with respect to COMT is selected
from the group consisting of two copies of APS, two copies of HPS,
and one copy of both APS and HPS and an effective amount of an
ADRB2 modulator, an ADRB3 modulator, a COMT modulator, or
combinations thereof is selected as a therapy. In some embodiments,
the ADRB2 modulator can be an ADRB2 antagonist. Further, in some
embodiments, the ADRB3 modulator is an ADRB3 antagonist. The ADRB2
and ADRB3 antagonists can be selective or non-selective for ADRB2
and ADRB3, respectively and can be selected for administration
either alone or in combination. Still further, in some embodiments,
the COMT modulator is a COMT activator. Examples of non-selective
ADRB2 antagonist include, but are not limited to: propranolol,
sotalol, timolol, carteolol, carvedilol, nadolol, penbutolol,
labetalol, and pindolol. Examples of relatively selective ADRB2
antagonists include, but are not limited to: butoxamine
[DL-erythro-.alpha.-(2,5-dimethoxyphenyl)-.beta.-t-butyl
aminopropanol hydrochloride], ICI 118,551
[(-)-1-(2,3-[dihydro-7-methyl-1H-inden-4-yl]oxy)-3-([1-methyl]ethyl]-amin-
o)-2-butanol], and H35/25 [1-(4'-methylphenyl)-b
2,2-l-isopropylaminopropanol. Examples of relatively selective
ADRB3 antagonists include, but are not limited to: L 748337
[(S)--N-[4-[2-[[3-[3-(acetamidomethyl)phenoxy]-2-hydroxypropyl]
amino] ethyl] phenyl] benzenesulfonamide], CL 316234 [disodium
(R,R)-5-(2-[{2-(3-chlorophenyl)-2-hydroxyethyl}-amino]propyl)-1,3-benzodi-
oxole-2,2,dicarboxylate], SR 59230A
[(1-(2-ethylphenoxy)-3-[[(1S)-1,2,3,4-tetrahydro-1-naphthalenyl]amino]-(2-
S)-2-propanol)]. A further example of a ADRB2 antagonist is
estrogen, and its associated metabolites, which impair ADRB2
receptor transduction and signaling in response to agonist
stimulation. An example of a COMT activator is, but is not limited
to, progesterone, which induces the expression of COMT.
[0180] II.E. Methods of Predicting a Pain Response
[0181] The presently disclosed subject matter provides methods of
predicting a pain response in a subject. In some embodiments, the
methods comprise determining a genotype of the subject with respect
to a gene selected from the group consisting of ADRB2, ADRB3, COMT,
and combinations thereof and comparing the genotype of the subject
with at least one reference genotype associated with pain response
variability, wherein the reference genotype is selected from the
group consisting of an ADRB2 genotype, an ADRB3 genotype, a COMT
genotype, and combinations thereof, whereby pain response in the
subject is predicted.
[0182] In some embodiments of the methods, determining the genotype
of the subject comprises one or more of: (i) identifying at least
one haplotype of ADRB2, ADRB3, COMT or combinations thereof; (ii)
identifying at least one polymorphism unique to at least one
haplotype of ADRB2, ADRB3, COMT, or combinations thereof; (iii)
identifying at least one polymorphism exhibiting high linkage
disequilibrium to at least one polymorphism unique to at least one
ADRB2 haplotype, ADRB3 haplotype, COMT haplotype, or combinations
thereof; or (iv) identifying at least one polymorphism exhibiting
high linkage disequilibrium to at least one ADRB2 haplotype, ADRB3
haplotype, COMT haplotype, or combinations thereof.
[0183] In some embodiments, the ADRB2 genotype of the reference
genotype is selected from the group consisting of H1, H2, and H3;
the ADRB3 genotype of the reference genotype is selected from the
group consisting of H1, H2, and H3; and the COMT genotype of the
reference genotype is selected from the group consisting of LPS,
APS, and HPS. Further, in some embodiments, the determined genotype
of the subject with respect to ADRB2 is only one copy of Haplotype
1, and the subject is predicted to have a decreased sensitivity to
pain as compared to a population norm. Still further, in some
embodiments, the determined genotype of the subject with respect to
ADRB3 is selected from the group consisting of at least one copy of
H2 and at least one copy of H3 and the subject is predicted to have
decreased sensitivity to pain as compared to a population norm.
Even further, in some embodiments of the methods, the determined
genotype of the subject with respect to COMT is selected from the
group consisting of two copies of APS, two copies of HPS, and one
copy of both APS and HPS and the subject is predicted to have an
increased sensitivity to pain as compared to a population norm.
[0184] II.F. Methods of Predicting Somatization
[0185] The presently disclosed subject matter provides methods of
predicting somatization in a subject. In some embodiments, the
methods comprise determining a genotype of the subject with respect
to a gene selected from the group consisting of ADRB2, ADRB3, COMT,
and combinations thereof and comparing the genotype of the subject
with at least one reference genotype associated with pain response
variability, wherein the reference genotype is selected from the
group consisting of an ADRB2 genotype, an ADRB3 genotype, a COMT
genotype, and combinations thereof, whereby somatization in the
subject is predicted.
[0186] In some embodiments of the methods, determining the genotype
of the subject comprises one or more of: [0187] (i) identifying at
least one haplotype of ADRB2, ADRB3, COMT or combinations thereof;
[0188] (ii) identifying at least one polymorphism unique to at
least one haplotype of ADRB2, ADRB3, COMT, or combinations thereof;
[0189] (iii) identifying at least one polymorphism exhibiting high
linkage disequilibrium to at least one polymorphism unique to at
least one ADRB2 haplotype, ADRB3 haplotype, COMT haplotype, or
combinations thereof; or [0190] (iv) identifying at least one
polymorphism exhibiting high linkage disequilibrium to at least one
ADRB2 haplotype, ADRB3 haplotype, COMT haplotype, or combinations
thereof.
[0191] In some embodiments, the ADRB2 genotype of the reference
genotype is selected from the group consisting of H1, H2, and H3;
the ADRB3 genotype of the reference genotype is selected from the
group consisting of H1, H2, and H3; and the COMT genotype of the
reference genotype is selected from the group consisting of LPS,
APS, and HPS. Further, in some embodiments, the determined genotype
of the subject with respect to ADRB2 is two copies of H2 and the
subject is predicted to have increased somatization as compared to
a population norm. Still further, in some embodiments, the
determined genotype of the subject with respect to ADRB3 is at
least one copy of H3 and the subject is predicted to have decreased
somatization as compared to a population norm. Even further, in
some embodiments of the methods, the determined genotype of the
subject with respect to COMT is selected from the group consisting
of two copies of APS, two copies of HPS, and one copy of both APS
and HPS and the subject is predicted to have increased somatization
as compared to a population norm.
[0192] II.G. Methods of Predicting Biological Activity of ADRB2,
COMT and ADRB3
[0193] The presently disclosed subject matter provides methods of
predicting biological activity of ADRB2, ADRB3, and COMT in a
subject. In some embodiments, the methods comprise determining a
genotype of the subject with respect to a gene selected from the
group consisting of ADRB2, ADRB3, COMT, and combinations thereof
and comparing the genotype of the subject with at least one
reference genotype associated with variability in biological
activity, wherein the reference genotype is selected from the group
consisting of an ADRB2 genotype, an ADRB3 genotype, a COMT
genotype, and combinations thereof, whereby biological activity of
the proteins in the subject is predicted.
[0194] In some embodiments of the methods, determining the genotype
of the subject comprises one or more of: [0195] (i) identifying at
least one haplotype of ADRB2, ADRB3, COMT or combinations thereof;
[0196] (ii) identifying at least one polymorphism unique to at
least one haplotype of ADRB2, ADRB3, COMT, or combinations thereof;
[0197] (iii) identifying at least one polymorphism exhibiting high
linkage disequilibrium to at least one polymorphism unique to at
least one ADRB2 haplotype, ADRB3 haplotype, COMT haplotype, or
combinations thereof; or [0198] (iv) identifying at least one
polymorphism exhibiting high linkage disequilibrium to at least one
ADRB2 haplotype, ADRB3 haplotype, COMT haplotype, or combinations
thereof.
[0199] In some embodiments, the ADRB2 genotype of the reference
genotype is selected from the group consisting of H1, H2, and H3;
the ADRB3 genotype of the reference genotype is selected from the
group consisting of H1, H2, and H3; and the COMT genotype of the
reference genotype is selected from the group consisting of LPS,
APS, and HPS. Further, in some embodiments, the determined genotype
of the subject with respect to ADRB2 is two copies of H1 and the
subject is predicted to have low biological activity of ADRB2 as
compared to a population norm. In some embodiments, the determined
genotype of the subject with respect to ADRB2 is two copies of H2,
two copies of H3, and one copy of each H2 and H3 and the subject is
predicted to have high biological activity of a ADRB2 receptor as
compared to a population norm. In some embodiments, the determined
genotype of the subject with respect to ADRB2 is two copies of H3
and the subject is predicted to have high biological activity of a
ADRB2 receptor as compared to a population norm in a resting state
and low biological activity of a ADRB2 receptor as compared to a
population norm in response to an agonist, including but not
limited to epinephrine. Further, in some embodiments, the
determined genotype of the subject with respect to ADRB3 is at
least one copy of H2 or H3 and the subject is predicted to have low
biological activity of ADRB3 as compared to a population norm. Even
further, in some embodiments of the methods, the determined
genotype of the subject with respect to COMT is selected from the
group consisting of two copies of APS, two copies of HPS, and one
copy of both APS and HPS and the subject is predicted to have low
enzymatic activity of COMT as compared to a population norm.
[0200] Further, in some embodiments of the methods, the determined
genotype of the subject with respect to COMT is selected from the
group consisting of two copies of APS, two copies of HPS, and one
copy of both APS and HPS and the subject is predicted to need a low
effective dosage of a therapeutic compound metabolized by COMT and
high adverse biological side effect to the subject by a compound
metabolized by COMT, as compared to a population norm. Examples of
the compounds include, but are not limited to: Steroid sex hormones
such as estrogen; Drugs that inhibit COMT enzyme such as tolcapone;
Drugs that influence the bioavailability of norepinephrine and
dopamine such as methylphenidate and L-DOPA; Drugs that influence
the reuptake of norepinephrine such as antidepressants; drugs that
influence .alpha.-adrenergic receptors such as clonidine and
mirtazapine; drugs that influence dopamine receptors such as
antipsychotics
III. METHODS OF TREATMENT
[0201] As disclosed herein, stimulation of ADRB2 and ADRB3 in vitro
leads to increased transcription of proinflammatory cytokines (see
Examples). In macrophages, the selective ADRB2 agonist salmeterol
produces a 38-fold increase in IL-1.beta. and a 6.5-fold increase
in IL-6 mRNA levels. In adipocytes, salmeterol produces a 6-fold
increase in TNF.alpha. and an 8-fold increase in IL-6 mRNA levels.
The increased transcription of proinflammatory cytokines produced
by salmeterol was completely blocked by the selective ADRB2
antagonist ICI 118,551, but not by the ADRB1 antagonist betaxolol
or the ADRB3 antagonist SR59230A. The selective ADRB3 agonist
CL316243 produced a 28-fold increase in adipocyte IL-6 mRNA levels.
The CL316243-induced increase in IL-6 transcription was completely
blocked by the ADRB3 antagonist, but not by ADRB1 or ADRB2
antagonists. Further, COMT regulates activity of catecholamines,
such as for example epinephrine and norepinephrine, and therefore
decreased COMT activity can lead to elevated levels of epinephrine
and norepinephrine. Increased activity in these catecholamines can
further activate ADRB2 and/or ADRB3. As shown in FIG. 8, COMT,
ADRB2 and ADRB3 act in concert and increased or decreased activity
of each can result in increased or decreased levels of
proinflammatory cytokines, which in turn can manifest as an
increase in pain sensitivity and/or possibly result in
inflammation.
[0202] Thus, taken together, these data demonstrate that
stimulation of ADRB2 and ADRB3 located for example on macrophages
and adipocytes can result in elevated levels of prototypical
proinflammatory cytokines that are known to activate peripheral and
central neural pathways that evoke the sensation of pain.
Furthermore, reduction or blockade of ADRB2 and ADRB3 function
(e.g., specific and/or non-specific antagonists), or the activation
of COMT, can be used to treat persistent pain and associated
inflammatory conditions by blocking pro-pain and proinflammatory
cytokine production.
[0203] III.A. Methods of Treating a Somatosensory Disorder
[0204] The presently disclosed subject matter provides methods of
treating a somatosensory disorder in a subject. In some
embodiments, the methods comprise administering to the subject an
effective amount of a COMT modulator, an ADRB2 modulator, an ADRB3
modulator, or combinations thereof.
[0205] In some embodiments, the ADRB2 modulator can be an ADRB2
antagonist. In some embodiments the ADRB3 modulator can be an ADRB3
antagonist. In some embodiments, the COMT modulator is a COMT
activator. The ADRB2 and ADRB3 antagonists can be specific or
non-specific for ADRB2 and ADRB3, respectively and can be
administered either alone or in combination. Examples of
non-selective ADRB2 antagonist include, but are not limited to:
propranolol, sotalol, timolol, carteolol, carvedilol, nadolol,
penbutolol, labetalol, and pindolol. Examples of relatively
selective ADRB2 antagonists include, but are not limited to:
butoxamine [DL-erythro-.alpha.-(2,5-dimethoxyphenyl)-.beta.-t-butyl
aminopropanol hydrochloride], ICI 118,551
[(-)-1-(2,3-[dihydro-7-methyl-1H-inden-4-yl]oxy)-3-([1-methylethyl]-amino-
)-2-butanol], and H35/25 [1-(4'-methylphenyl)-b
2,2-l-isopropylaminopropanol. Examples of relatively selective
ADRB3 antagonists include, but are not limited to: L 748337
[(S)--N-[4-[2-[[3-[3-(acetamidomethyl)phenoxy]-2-hydroxypropyl]
amino] ethyl] phenyl] benzenesulfonamide], CL 316234 [disodium
(R,R)-5-(2-[{2-(3-chlorophenyl)-2-hydroxyethyl}-amino]propyl)-1,3-benzodi-
oxole-2,2,dicarboxylate], SR 59230A
[(1-(2-ethylphenoxy)-3-[[(1S)-1,2,3,4-tetrahydro-1-naphthalenyl]amino]-(2-
S)-2-propanol)]. A further example of a ADRB2 antagonist is
estrogen, and its associated metabolites, which impair ADRB2
receptor transduction and signaling in response to agonist
stimulation. An example of a COMT activator is, but is not limited
to, progesterone, which induces the expression of COMT.
[0206] The genotyping methods for predicting or determining pain
sensitivity disclosed herein are applicable as well to the present
methods of treating a somatosensory disorder. Determining a
genotype of a subject with regard to pain perception or pain
sensitivity genotypes, such as for example ADRB2, ADRB3, COMT
genotypes and combinations thereof can be useful in selecting a
particular therapy for use in treating the subject, for example as
discussed herein above in particular with regard to ADRB2 and ADRB3
antagonist therapies.
[0207] As such, in some embodiments of the methods for treating a
somatosensory disorder, the methods further comprise determining a
genotype of the subject with respect to a gene selected from the
group consisting of ADRB2, ADRB3, COMT, and combinations thereof
and administering to the subject the effective amount of the COMT
modulator, the ADRB2 modulator, the ADRB3 modulator, or
combinations thereof based on the determined genotype of the
subject.
[0208] In some embodiments of the methods, determining the genotype
of the subject comprises one or more of: [0209] (i) identifying at
least one haplotype of ADRB2, ADRB3, COMT or combinations thereof;
[0210] (ii) identifying at least one polymorphism unique to at
least one haplotype of ADRB2, ADRB3, COMT, or combinations thereof;
[0211] (iii) identifying at least one polymorphism exhibiting high
linkage disequilibrium to at least one polymorphism unique to at
least one ADRB2 haplotype, ADRB3 haplotype, COMT haplotype, or
combinations thereof; or [0212] (iv) identifying at least one
polymorphism exhibiting high linkage disequilibrium to at least one
ADRB2 haplotype, ADRB3 haplotype, COMT haplotype, or combinations
thereof.
[0213] In some embodiments of the methods, the ADRB2 genotype is
selected from the group consisting of Haplotype 1, Haplotype 2,
Haplotype 3, and Uncommon; the ADRB3 genotype is selected from the
group consisting of Haplotype 1, Haplotype 2, Haplotype 3, and
Uncommon; and the COMT genotype is selected from the group
consisting of low pain sensitive haplotype (LPS), average pain
sensitive haplotype (APS), and high pain sensitive haplotype (HPS).
Still further, in some embodiments, the determined genotype of the
subject with respect to ADRB2 is selected from the group consisting
of two copies of H2, two copies of H3, one copy of both H2 and H3,
and at least one copy of Uncommon and the somatosensory disorder is
treated by administering the ADRB2 modulator, the COMT modulator,
or combinations thereof to the subject. Still Further, in some
embodiments, the determined genotype of the subject with respect to
ADRB3 is selected from the group consisting of two copies of H1 and
at least one copy of Uncommon and the somatosensory disorder is
treated by administering the ADRB2 modulator, the COMT modulator,
or combinations thereof to the subject. Even further, in some
embodiments, the determined genotype of the subject with respect to
COMT is selected from the group consisting of two copies of APS,
two copies of HPS, and one copy of both APS and HPS and the
somatosensory disorder is treated by administering the ADRB2
modulator, the COMT modulator, or combinations thereof to the
subject.
[0214] III.B. Methods of Modulating Production of Proinflammatory
Cytokines
[0215] The presently disclosed subject matter further provides
methods of modulating production of proinflammatory cytokines in a
subject see FIG. 8). In some embodiments, the methods comprise
administering to the subject an effective amount of a COMT
modulator, an ADRB2 modulator, an ADRB3 modulator, or combinations
thereof to thereby modulate production of proinflammatory
cytokines.
[0216] Proinflammatory cytokines are cytokines that can induce,
increase or maintain inflammation in vitro or in vivo in a subject.
Exemplary proinflammatory cytokines include, but are not limited to
of IL-6, IL-1.alpha., IL-1.beta., TNF-.alpha., and combinations
thereof.
[0217] In some embodiments of the methods, modulating production of
proinflammatory cytokines comprises inhibiting production of
proinflammatory cytokines. As such, the ADRB2 modulator can be an
ADRB2 antagonist, the ADRB3 modulator can be an ADRB3 antagonist,
and the COMT modulator can be a COMT activator, as each of which
can cause downregulation or inhibition of proinflammatory cytokines
(see FIG. 8). In some embodiments, both the ADRB2 antagonist and
the ADRB3 antagonist can be administered to the subject. In some
embodiments, the COMT activator, the ADRB2 antagonist and the ADRB3
antagonist can be administered to the subject.
[0218] Chemical small molecular weight compounds can be used as
ADRB2 and ADRB3 antagonists. However, any chemical or biological
compound that inhibits function of the receptors can be used, such
as antisense DNA, RNA or oligonucleotides, siRNA, inhibitory
peptide or dominant-negative mutant. Furthermore, any chemical or
biological compound that activates COMT can be used as COMT
activator, for example, introduction of plasmid or viral DNA
expressing COMT protein into a subject.
[0219] In some embodiments of the methods for modulating production
of proinflammatory cytokines, the methods further comprise
determining a genotype of the subject with respect to a gene
selected from the group consisting of ADRB2, ADRB3, COMT, and
combinations thereof and administering to the subject the effective
amount of the COMT modulator, the ADRB2 modulator, the ADRB3
modulator, or combinations thereof based on the determined genotype
of the subject.
[0220] In some embodiments of the methods, determining the genotype
of the subject comprises: [0221] (i) identifying at least one
haplotype of ADRB2, ADRB3, COMT or combinations thereof; [0222]
(ii) identifying at least one polymorphism unique to at least one
haplotype of ADRB2, ADRB3, COMT, or combinations thereof; [0223]
(iii) identifying at least one polymorphism exhibiting high linkage
disequilibrium to at least one polymorphism unique to at least one
ADRB2 haplotype, ADRB3 haplotype, COMT haplotype, or combinations
thereof; or [0224] (iv) identifying at least one polymorphism
exhibiting high linkage disequilibrium to at least one ADRB2
haplotype, ADRB3 haplotype, COMT haplotype, or combinations
thereof.
[0225] In some embodiments of the methods, the ADRB2 genotype is
selected from the group consisting of Haplotype 1, Haplotype 2,
Haplotype 3, and Uncommon; the ADRB3 genotype is selected from the
group consisting of Haplotype 1, Haplotype 2, Haplotype 3, and
Uncommon; and the COMT genotype is selected from the group
consisting of low pain sensitive haplotype (LPS), average pain
sensitive haplotype (APS), and high pain sensitive haplotype (HPS).
Further, in some embodiments, the determined genotype of the
subject with respect to ADRB2 is selected from the group consisting
of two copies of H2, two copies of H3, and one copy of both H2 and
H3 and the production of proinflammatory cytokines in the subject
is modulated by administering the ADRB2 modulator, the COMT
modulator, or combinations thereof to the subject. Still further,
in some embodiments, the determined genotype of the subject with
respect to ADRB3 is selected from the group consisting of two
copies of Haplotype 1, and the production of proinflammatory
cytokines in the subject is modulated by administering the ADRB3
modulator, the COMT modulator, or combinations thereof to the
subject. Even further, in some embodiments, the determined genotype
of the subject with respect to COMT is selected from the group
consisting of two copies of APS, two copies of HPS, and one copy of
both APS and HPS and the production of proinflammatory cytokines in
the subject is modulated by administering the COMT modulator, the
ADRB2 modulator, the ADRB3 modulator, or combinations thereof to
the subject.
[0226] III.C. Representative Therapeutic Approaches
[0227] As noted herein above, the term "modulate" can refer to an
increase, decrease, or other alteration of any, or all, chemical
and biological activities or properties of a wild-type or mutant
polypeptide, such as for example COMT, ADRB2, ABRB3 or combinations
thereof. A peptide can be modulated at either the level of
expression, e.g., modulation of gene expression (for example,
anti-sense therapy, siRNA or other similar approach, gene therapy,
including exposing the subject to a gene therapy vector encoding a
gene of interest or encoding a nucleotide sequence that influences
expression of a gene of interest), or at the level of the expressed
protein, e.g., administering to a subject an agonist or antagonist
of a receptor macromolecule, such as ADRB2 and/or ADRB3, or an
activator or inactivator of an enzyme polypeptide, such as for
example COMT. The term "modulation" as used herein refers to both
upregulation (i.e., activation or stimulation) and downregulation
(i.e. inhibition or suppression) of a response.
[0228] III.C.1. Gene Therapy
[0229] Thus, the presently disclosed subject matter also provides
for gene therapy compositions, methods, systems and approaches.
Exemplary gene therapy methods, including liposomal transfection of
nucleic acids into host cells, are described in U.S. Pat. Nos.
5,279,833; 5,286,634; 5,399,346; 5,646,008; 5,651,964; 5,641,484;
and 5,643,567, the contents of each of which are herein
incorporated by reference.
[0230] Briefly, gene therapy directed toward modulation of
polypeptide levels, to thereby affect or modulate the biological
activity of, for example, COMT, ADRB2, ABRB3 or combinations
thereof in a target cell is provided. In one embodiment, a
therapeutic method of the present invention provides a process for
modulation of polypeptide levels comprising: (a) delivering to the
cell an effective amount of a DNA molecule comprising a
polynucleotide that encodes a polypeptide; and (b) maintaining the
cell under conditions sufficient for expression of said
polypeptide.
[0231] A vehicle can be a cell transformed or transfected with the
DNA molecule or a transfected cell derived from such a transformed
or transfected cell. Approaches for transforming or transfecting a
cell with a DNA molecule are disclosed herein and are known in the
art.
[0232] Nonviral DNA delivery vehicles include polyamines and
neutral polymers (synthetic or nonsynthetic, such as gelatin)
capable of condensing DNA to nanoparticles with radii of 20-100 nm.
Nanoparticles have great potential in providing sustained gene
expression in cells and in providing simple and reproducible
production, allowing for future up-scaling and commercial
production. Thus, nanoparticles are suitable for use in combination
with the nucleic acids of the presently disclosed subject matter.
See generally Vijayanathan V, Thomas T, Thomas T J (2002) DNA
Nanoparticles and Development of DNA Delivery Vehicles for Gene
Therapy. Biochemistry 41(48):14085-94; Brannon-Peppas L &
Blanchette J O (2004) Nanoparticle and Targeted Systems for Cancer
Therapy. Adv Drug Deliv Rev 56(11):1649-59.
[0233] Nonviral DNA delivery vehicles also include liposomes.
Modern drug encapsulation methods allow efficient packing of
therapeutic substances inside liposomes, thereby reducing the
systemic toxicity of the drugs. Specific targeting can enhance the
therapeutic effect of the drugs through their accumulation at the
diseased site. Thus, liposomes are suitable for use in combination
with the nucleic acids of the presently disclosed subject matter,
and can serve to enhance the cancer-killing selectivity of the
presently disclosed subject matter. See Felnerova D, Viret J F,
Gluck R, Moser C (2004) Liposomes and Virosomes as Delivery Systems
for Antigens, Nucleic Acids and Drugs. Curr Opin Biotechnol
15(6):518-29.
[0234] III.C.2. Viral Vectors
[0235] The vehicle can comprise a virus or an antibody that
specifically infects or immunoreacts with an antigen of the target
tissue or tumor. An advantage of a viral infection system is that
it allows for a very high level of infection into the appropriate
recipient cell. Also, antibodies have been used to target and
deliver DNA molecules.
[0236] It is also envisioned that this embodiment of the present
invention can be practiced using alternative viral or phage
vectors, including retroviral vectors and vaccinia viruses whose
genome has been manipulated in alternative ways so as to render the
virus non-pathogenic. Methods for creating such a viral mutation
are set forth in detail in U.S. Pat. No. 4,769,331, incorporated
herein by reference.
[0237] Indeed, viral vectors have been widely used as systems for
delivering nucleic acid sequences of interest to cells. Retrovirus,
lentivirus, herpes virus, and parvovirus vectors have all been
used, and each system has its advantages. Retroviruses have the
advantage that they efficiently insert themselves into a host
chromosome, ensuring long-term expression. "Pseudotyped" variants
of retrovirus are available that will insert themselves into all
cells or only into specific cells. However, the efficient insertion
of retroviruses into host chromosomes is also a disadvantage, as
random insertions can create mutations that are deleterious. Also,
some retroviruses require that the host cell be in a state of
replication before they can integrate into the host genome.
[0238] Lentiviruses, including human immunodeficiency virus (HIV),
are a group of related retroviruses. Like other retrovirus vectors,
lentivirus vectors can accommodate transgenes up to about 8 kb in
length, and can be prevented from replicating by eliminating
essential viral genes. Unlike other retrovirus vectors, lentivirus
vectors are able to infect nondividing cells.
[0239] Herpes simplex virus is a double-stranded DNA virus with a
152-kb genome. Its relatively large size means that it could be
used for manipulation of larger transgenes and even multiple
transgenes. Herpes simplex virus can infect a wide variety of cell
types in both the dividing and the nondividing state.
[0240] Retrovirus, lentivirus, and herpes virus vectors are
suitable for use in the methods, systems, and kits of the presently
disclosed subject matter, and these vectors are particularly useful
in the field of gene therapy, as reviewed in Lundstrom, K (2004)
Gene Therapy Applications of Viral Vectors. Technol Cancer Res
Treat 3(5):467-77.
[0241] Parvoviruses, including adenoviruses, are small,
single-stranded, non-enveloped DNA viruses between twenty to thirty
nanometers in diameter. The genomes of parvoviruses are
approximately 5000 nucleotides long, containing two open reading
frames. The left-hand open reading frame encodes the proteins
responsible for replication (Rep), while the right-hand open
reading frame encodes the structural proteins of the capsid (Cap).
All parvoviruses have virions with icoshedral symmetry composed of
a major Cap protein, usually the smallest of the Cap proteins, and
one or two minor Cap proteins. The Cap proteins are generated from
a single gene that initiates translation from different start
codons. These proteins have identical C-termini, but possess unique
N-termini due to different initiation codons.
[0242] Most parvoviruses have narrow host ranges; the tropism of
B19 is for human erythroid cells (Munshi et al., (1993) J. Virology
67:562), while canine parvovirus has a tropism for lymphocytes in
adult dogs (Parrish et al., (1988) Virology 166:293; Chang et al.,
(1992) J. Virology 66:6858). Adeno-associated virus (AAV), on the
other hand, can replicate well in canine, mouse, chicken, bovine,
monkey cells, as well as numerous human cells and cell lines, when
the appropriate helper virus is present. In the absence of helper
virus, AAV will infect and establish latency in all of these cell
types, suggesting that the AAV receptor is common and conserved
among species. Several serotypes of AAV have been identified,
including serotypes 1, 2, 3, 4, 5 and 6.
[0243] Adeno-associated virus (AAV) is a dependent parvovirus
twenty nanometers in size that requires co-infection with another
virus (either adenovirus or certain members of the herpes virus
group) to undergo a productive infection in cells. In the absence
of co-infection with helper virus, the AAV virion binds to a
cellular receptor and enters the cell, migrates to the nucleus, and
delivers a single-stranded DNA genome that can establish latency by
integration into the host chromosome. The interest in AAV as a
vector has centered around the biology of this virus. In addition
to its unique life cycle, AAV has a broad host range for
infectivity (human, mouse, monkey, dog, etc.), is ubiquitous in
humans, and is completely nonpathogenic.
[0244] The finite packaging capacity of this virus (4.5 kb) has
restricted the use of this vector in the past to small genes or
cDNAs. To advance the prospects of AAV gene delivery, vectors
sufficient to carry larger genes must be developed. In addition,
virions that specifically and efficiently target defined cell types
without transducing others are beneficial for clinical
applications.
[0245] Parvovirus and AAV vectors are suitable for use in the
methods, systems, and kits of the presently disclosed subject
matter, and these vectors are particularly useful in the field of
gene therapy. Representative vectors that can be employed in the
methods, systems, and kits of the presently disclosed subject
matter are described in U.S. Pat. No. 6,458,587; U.S. Pat. No.
6,489,162; U.S. Pat. No. 6,491,907; and U.S. Pat. No. 6,548,286,
the contents of which are incorporated in their entireties by
reference.
[0246] In some embodiments, an adenovirus vector of the presently
disclosed subject matter is conditionally replication competent.
That is, it contains one or more functional genes required for its
replication placed under the transcriptional control of an
inducible promoter. This inhibits uncontrolled replication in vivo
and reduces undesirable side effects of viral infection.
Replication competent self-limiting or self-destructing viral
vectors can also be used, as can replication deficient viral
vectors.
[0247] Incorporation of a nucleic acid construct into a viral
genome can be optionally performed by ligating the construct into
an appropriate restriction site in the genome of the virus. Viral
genomes can then be packaged into viral coats or capsids by any
suitable procedure. In particular, any suitable packaging cell line
can be used to generate viral vectors of the presently disclosed
subject matter. These packaging lines complement the conditionally
replication deficient viral genomes of the presently disclosed
subject matter, as they include, typically incorporated into their
genomes, the genes which have been put under an inducible promoter
deleted in the conditionally replication competent vectors. Thus,
the use of packaging lines allows viral vectors of the presently
disclosed subject matter to be generated in culture.
[0248] In some embodiments, the nucleic acids of the presently
disclosed subject matter are packaged in a viral vector. For local
administration of viral vectors, previous clinical studies have
demonstrated that up to 10.sup.13 plaque forming units (pfu) of
virus can be injected with minimal toxicity. In human patients,
1.times.10.sup.9-1.times.10.sup.13 pfu are routinely used (see
Habib N A, Hodgson H J, Lemoine N & Pignatelli M (1999) A Phase
I/Ii Study of Hepatic Artery Infusion with wtp53-CMV-Ad in
Metastatic Malignant Liver Tumours. Hum Gene Ther 10:2019-2034). To
determine an appropriate dose within this range, preliminary
treatments can begin with 1.times.10.sup.9 pfu, and the dose level
can be escalated in the absence of dose-limiting toxicity. Toxicity
can be assessed using criteria set forth by the National Cancer
Institute and is reasonably defined as any grade 4 toxicity or any
grade 3 toxicity persisting more than 1 week. Dose is also modified
to maximize analgesic activity. With replicative virus vectors, a
dosage of about 1.times.10.sup.7 to 1.times.10.sup.8 pfu can be
used in some instances.
[0249] III.C.3. Transcriptional Modulation
[0250] A method for transcriptionally modulating in a multicellular
organism the expression of a gene encoding a target polypeptide to
modulate polypeptide levels, to thereby affect or modulate the
biological activity of, for example, COMT, ADRB2, ABRB3 or
combinations thereof in a warm-blooded vertebrate subject is also
contemplated in accordance with the present invention. This method
comprises administering to the warm-blooded vertebrate subject a
compound at a concentration effective to transcriptionally modulate
expression of, for example, COMT, ADRB2, ABRB3 or combinations
thereof.
[0251] In accordance with the presently disclosed subject matter,
the compound can optionally comprise an antibody or polypeptide
described above and which transcriptionally modulates expression
of, for example, COMT, ADRB2, ABRB3 or combinations thereof.
Optionally, the antibody or polypeptide directly binds to DNA or
RNA, or directly binds to a protein involved in transcription.
[0252] Representative chemical entities (e.g., small molecule
mimetics) for use in accordance with the presently disclosed
subject matter do not naturally occur in any cell, whether of a
multicellular or a unicellular organism. In some embodiments the
chemical entity is not a naturally occurring molecule, e.g., it is
a chemically synthesized entity. Optionally, the compound can bind
a modulatable transcription sequence of the gene. For example, the
compound can bind a promoter region upstream of a nucleic acid
sequence encoding, for example, COMT, ADRB2, ABRB3 or combinations
thereof.
[0253] In the methods above, modulation of transcription results in
either upregulation or downregulation of expression of the gene
encoding the protein of interest, depending on the identity of the
molecule that contacts the cell.
[0254] III.C.4. Antisense Oligonucleotide Therapy
[0255] Expression can also be modulated in a subject through the
administration of an antisense oligonucleotide derived from a
nucleic acid molecule encoding, for example, COMT, ADRB2, ABRB3 or
combinations thereof. Therapeutic methods utilizing antisense
oligonucleotides have been described in the art, for example, in
U.S. Pat. Nos. 5,627,158 and 5,734,033, the contents of each of
which are herein incorporated by reference.
[0256] III.C.5. RNA Interference
[0257] The term "modulate" can also refer to a change in the
expression level of a gene, or a level of RNA molecule or
equivalent RNA molecules encoding one or more proteins or protein
subunits, or activity of one or more proteins or protein subunits
is up regulated or down regulated, such that expression, level, or
activity is greater than or less than that observed in the absence
of the modulator. For example, the term "modulate" can mean
"inhibit" or "suppress", but the use of the word "modulate" is not
limited to this definition.
[0258] The term "RNA" refers to a molecule comprising at least one
ribonucleotide residue. By "ribonucleotide" is meant a nucleotide
with a hydroxyl group at the 2' position of a .beta.-D-ribofuranose
moiety. The terms encompass double stranded RNA, single stranded
RNA, RNAs with both double stranded and single stranded regions,
isolated RNA such as partially purified RNA, essentially pure RNA,
synthetic RNA, recombinantly produced RNA, as well as altered RNA,
or analog RNA, that differs from naturally occurring RNA by the
addition, deletion, substitution, and/or alteration of one or more
nucleotides. Such alterations can include addition of
non-nucleotide material, such as to the end(s) of an siRNA or
internally, for example at one or more nucleotides of the RNA.
Nucleotides in the RNA molecules of the presently disclosed subject
matter can also comprise non-standard nucleotides, such as
non-naturally occurring nucleotides or chemically synthesized
nucleotides or deoxynucleotides. These altered RNAs can be referred
to as analogs or analogs of a naturally occurring RNA.
[0259] The terms "small interfering RNA", "short interfering RNA",
"small hairpin RNA", "siRNA", and shRNA are used interchangeably
and refer to any nucleic acid molecule capable of mediating RNA
interference (RNAi) or gene silencing. See e.g., Bass, Nature
411:428-429, 2001; Elbashir et al., Nature 411:494-498, 2001a; and
PCT International Publication Nos. WO 00/44895, WO 01/36646, WO
99/32619, WO 00/01846, WO 01/29058, WO 99/07409, and WO 00/44914.
In one embodiment, the siRNA comprises a double stranded
polynucleotide molecule comprising complementary sense and
antisense regions, wherein the antisense region comprises a
sequence complementary to a region of a target nucleic acid
molecule (for example, a nucleic acid molecule encoding COMT,
ADRB2, or ABRB3). In another embodiment, the siRNA comprises a
single stranded polynucleotide having self-complementary sense and
antisense regions, wherein the antisense region comprises a
sequence complementary to a region of a target nucleic acid
molecule. In another embodiment, the siRNA comprises a single
stranded polynucleotide having one or more loop structures and a
stem comprising self complementary sense and antisense regions,
wherein the antisense region comprises a sequence complementary to
a region of a target nucleic acid molecule, and wherein the
polynucleotide can be processed either in vivo or in vitro to
generate an active siRNA capable of mediating RNAi. As used herein,
siRNA molecules need not be limited to those molecules containing
only RNA, but further encompass chemically modified nucleotides and
non-nucleotides.
[0260] The presently disclosed subject matter takes advantage of
the ability of short, double stranded RNA molecules to cause the
down regulation of cellular genes, a process referred to as RNA
interference. As used herein, "RNA interference" (RNAi) refers to a
process of sequence-specific post-transcriptional gene silencing
mediated by a small interfering RNA (siRNA). See generally Fire et
al., Nature 391:806-811, 1998. The process of post-transcriptional
gene silencing is thought to be an evolutionarily conserved
cellular defense mechanism that has evolved to prevent the
expression of foreign genes (Fire, Trends Genet 15:358-363,
1999).
[0261] RNAi might have evolved to protect cells and organisms
against the production of double stranded RNA (dsRNA) molecules
resulting from infection by certain viruses (particularly the
double stranded RNA viruses or those viruses for which the life
cycle includes a double stranded RNA intermediate) or the random
integration of transposon elements into the host genome via a
mechanism that specifically degrades single stranded RNA or viral
genomic RNA homologous to the double stranded RNA species.
[0262] The presence of long dsRNAs in cells stimulates the activity
of the enzyme Dicer, a ribonuclease III. Dicer catalyzes the
degradation of dsRNA into short stretches of dsRNA referred to as
small interfering RNAs (siRNA) (Bernstein et al., Nature
409:363-366, 2001). The small interfering RNAs that result from
Dicer-mediated degradation are typically about 21-23 nucleotides in
length and contain about 19 base pair duplexes. After degradation,
the siRNA is incorporated into an endonuclease complex referred to
as an RNA-induced silencing complex (RISC). The RISC is capable of
mediating cleavage of single stranded RNA present within the cell
that is complementary to the antisense strand of the siRNA duplex.
According to Elbashir et al., cleavage of the target RNA occurs
near the middle of the region of the single stranded RNA that is
complementary to the antisense strand of the siRNA duplex (Elbashir
et al., Genes Dev 15:188-200, 2001b).
[0263] RNAi has been described in several cell type and organisms.
Fire et al., 1998 described RNAi in C. elegans. Wianny &
Zernicka-Goetz, Nature Cell Biol 2:70-75, 1999 disclose RNAi
mediated by dsRNA in mouse embryos. Hammond et al., Nature
404:293-296, 2000 were able to induce RNAi in Drosophila cells by
transfecting dsRNA into these cells. Elbashir et al. Nature
411:494-498, 2001a demonstrated the presence of RNAi in cultured
mammalian cells including human embryonic kidney and HeLa cells by
the introduction of duplexes of synthetic 21 nucleotide RNAs.
[0264] Other studies have indicated that a 5'-phosphate on the
target-complementary strand of a siRNA duplex facilitate siRNA
activity and that ATP is utilized to maintain the 5'-phosphate
moiety on the siRNA (Nykanen et al., Cell 107:309-321, 2001). Other
modifications that might be tolerated when introduced into an siRNA
molecule include modifications of the sugar-phosphate backbone or
the substitution of the nucleoside with at least one of a nitrogen
or sulfur heteroatom (PCT International Publication Nos. WO
00/44914 and WO 01/68836) and certain nucleotide modifications that
might inhibit the activation of double stranded RNA-dependent
protein kinase (PKR), specifically 2'-amino or 2'-O-methyl
nucleotides, and nucleotides containing a 2'-O or 4'-C methylene
bridge (Canadian Patent Application No. 2,359,180).
[0265] Other references disclosing the use of dsRNA and RNAi
include PCT International Publication Nos. WO 01/75164 (in vitro
RNAi system using cells from Drosophila and the use of specific
siRNA molecules for certain functional genomic and certain
therapeutic applications); WO 01/36646 (methods for inhibiting the
expression of particular genes in mammalian cells using dsRNA
molecules); WO 99/32619 (methods for introducing dsRNA molecules
into cells for use in inhibiting gene expression); WO 01/92513
(methods for mediating gene suppression by using factors that
enhance RNAi); WO 02/44321 (synthetic siRNA constructs); WO
00/63364 and WO 01/04313 (methods and compositions for inhibiting
the function of polynucleotide sequences); and WO 02/055692 and WO
02/055693 (methods for inhibiting gene expression using RNAi).
[0266] In some embodiments, the presently disclosed subject matter
utilizes RNAi to at least partially inhibit expression of one or
more proteins of interest, for example, COMT, ADRB2, or ABRB3, or
combinations thereof. Inhibition is preferably at least about 10%
of normal expression amounts. In some embodiments, the method
comprises introducing an RNA to a target cell in an amount
sufficient to inhibit expression of, for example, COMT, ADRB2, or
ABRB3, or combinations thereof, wherein the RNA comprises a
ribonucleotide sequence which corresponds to a coding strand of a
gene of interest. In some embodiments, the target cell is present
in a subject, and the RNA is introduced into the subject.
[0267] The RNA can have a double-stranded region comprising a first
strand comprising a ribonucleotide sequence that corresponds to the
coding strand of the gene encoding the target protein (for example,
COMT, ADRB2, or ABRB3) and a second strand comprising a
ribonucleotide sequence that is complementary to the first strand.
The first strand and the second strand hybridize to each other to
form the double-stranded molecule. The double stranded region can
be at least 15 basepairs in length, and in some embodiments,
between 15 and 50 basepairs in length, and in some embodiments the
double stranded region is between 15 and 30 basepairs in
length.
[0268] In some embodiments, the RNA comprises one strand that forms
a double-stranded region by intramolecular self-hybridization,
which is preferably complementary over at least 19 bases. In some
embodiments, the RNA comprises two separate strands that form a
double-stranded region by intermolecular hybridization that is
complementary over at least 19 bases.
[0269] One skilled in the art will recognize that any number of
suitable common techniques can be used to introduce the RNAs into a
target cell. In some embodiments, a vector encoding the RNA is
introduced to the target cell. For example, the vector encoding the
RNA can be transfected into the target cell and the RNA is then
transcribed by cellular polymerases.
[0270] In some embodiments, a recombinant virus comprising nucleic
acid encoding the RNA can be produced. Introducing the RNA into a
target cell then comprises infecting the target cell with the
recombinant adenovirus. Cellular polymerases transcribe the RNA
resulting in expression of the RNA within the target cell.
Engineering recombinant viruses is well known to those having
ordinary skill in the art. One of skill would readily appreciate
the multiple factors involved in selecting the appropriate virus
and vector components needed to optimize recombinant virus
production for use with the presently disclosed subject matter
without the necessity of further detailed discussion herein. As one
non-limiting example, a recombinant adenovirus can be engineered
comprising DNA encoding an siRNA. The virus can be engineered to be
replication deficient such that hepatocytes can be infected by the
recombinant adenovirus, the siRNA transcribed, and transiently
expressed in the infected target cell. Details of recombinant virus
production and use can be found in published PCT Patent Application
No. PCT/US02/22010, herein incorporated by reference in their
entireties. Alternatively, a commercial kit for producing
recombinant viruses can be used, such as for example, the pSILENCER
ADENO 1.0-CMV SYSTEM.TM. (Ambion, Austin, Tex., USA).
[0271] The presently disclosed subject matter further comprises an
isolated siRNA molecule, which inhibits expression of a target
protein, for example COMT, ADRB2, or ABRB3.
[0272] The siRNA molecule can comprise a sense region and an
antisense region, wherein the antisense region comprises a nucleic
acid sequence complementary to an RNA sequence encoding the target
protein and the sense region comprises a nucleic acid sequence
complementary to the antisense region. The siRNA molecule is
assembled from the sense region and the antisense region of the
siRNA molecule. In a representative embodiment, the sense region
comprises a contiguous 19-30 nucleotide sequence and the antisense
region comprises the reverse-complement of the sense region. The
sense region and the antisense region can further comprise a
3'-terminal overhang, which is preferably 2 to 8 nucleotides in
length. The 3'-terminal nucleotide overhang can further contain one
or more chemically modified nucleotides.
[0273] In some embodiments, the sense region and the antisense
region are covalently connected via a linker molecule. In some
embodiments, the linker molecule is a polynucleotide linker, for
example, a polynucleotide linker of from 5 to 9 nucleotides. In
some embodiments, the linker molecule is a non-nucleotide linker. A
carrier comprising an siRNA is also provided. Representative
carriers include, for example, water, saline, dextrose, glycerol,
ethanol or the like, and combinations thereof. The carrier can
further include auxiliary substances such as wetting or emulsifying
agents, pH buffering agents and the like.
[0274] III.D. Formulations
[0275] A therapeutic composition as described herein preferably
comprises a composition that includes a pharmaceutically acceptable
carrier. Suitable formulations include aqueous and non-aqueous
sterile injection solutions that can contain antioxidants, buffers,
bacteriostats, bactericidal antibiotics and solutes that render the
formulation isotonic with the bodily fluids of the intended
recipient; and aqueous and non-aqueous sterile suspensions, which
can include suspending agents and thickening agents.
[0276] The compositions used in the methods can take such forms as
suspensions, solutions or emulsions in oily or aqueous vehicles,
and can contain formulatory agents such as suspending, stabilizing
and/or dispersing agents. Alternatively, the active ingredient can
be in powder form for constitution with a suitable vehicle, e.g.,
sterile pyrogen-free water, before use.
[0277] The formulations can be presented in unit-dose or multi-dose
containers, for example sealed ampoules and vials, and can be
stored in a frozen or freeze-dried (lyophilized) condition
requiring only the addition of sterile liquid carrier immediately
prior to use.
[0278] For oral administration, the compositions can take the form
of, for example, tablets or capsules prepared by a conventional
technique with pharmaceutically acceptable excipients such as
binding agents (e.g., pregelatinized maize starch,
polyvinylpyrrolidone or hydroxypropyl methylcellulose); fillers
(e.g., lactose, microcrystalline cellulose or calcium hydrogen
phosphate); lubricants (e.g., magnesium stearate, talc or silica);
disintegrants (e.g., potato starch or sodium starch glycollate); or
wetting agents (e.g., sodium lauryl sulphate). The tablets can be
coated by methods known in the art.
[0279] Liquid preparations for oral administration can take the
form of, for example, solutions, syrups or suspensions, or they can
be presented as a dry product for constitution with water or other
suitable vehicle before use. Such liquid preparations can be
prepared by conventional techniques with pharmaceutically
acceptable additives such as suspending agents (e.g., sorbitol
syrup, cellulose derivatives or hydrogenated edible fats);
emulsifying agents (e.g. lecithin or acacia); non-aqueous vehicles
(e.g., almond oil, oily esters, ethyl alcohol or fractionated
vegetable oils); and preservatives (e.g., methyl or
propyl-p-hydroxybenzoates or sorbic acid). The preparations can
also contain buffer salts, flavoring, coloring and sweetening
agents as appropriate. Preparations for oral administration can be
suitably formulated to give controlled release of the active
compound. For buccal administration the compositions can take the
form of tablets or lozenges formulated in conventional manner.
[0280] The compounds can also be formulated as a preparation for
implantation or injection. Thus, for example, the compounds can be
formulated with suitable polymeric or hydrophobic materials (e.g.,
as an emulsion in an acceptable oil) or ion exchange resins, or as
sparingly soluble derivatives (e.g., as a sparingly soluble
salt).
[0281] The compounds can also be formulated in rectal compositions
(e.g., suppositories or retention enemas containing conventional
suppository bases such as cocoa butter or other glycerides), creams
or lotions, or transdermal patches.
[0282] III.E. Doses
[0283] The term "effective amount" is used herein to refer to an
amount of the therapeutic composition (e.g., a composition
comprising an ADRB2, ADRB3, and/or COMT modulator) sufficient to
produce a measurable biological response (e.g., a modulation in a
biological activity of an ADRB2, ADRB3, and/or COMT polypeptide).
Actual dosage levels of active ingredients in a therapeutic
composition of the presently disclosed subject matter can be varied
so as to administer an amount of the active compound(s) that is
effective to achieve the desired therapeutic response for a
particular subject and/or application. The selected dosage level
will depend upon a variety of factors including the activity of the
therapeutic composition, formulation, the route of administration,
combination with other drugs or treatments, severity of the
condition being treated, and the physical condition and prior
medical history of the subject being treated. Preferably, a minimal
dose is administered, and dose is escalated in the absence of
dose-limiting toxicity to a minimally effective amount.
Determination and adjustment of a therapeutically effective dose,
as well as evaluation of when and how to make such adjustments, are
known to those of ordinary skill in the art of medicine.
[0284] For administration of a therapeutic composition as disclosed
herein, conventional methods of extrapolating human dosage based on
doses administered to a murine animal model can be carried out
using the conversion factor for converting the mouse dosage to
human dosage: Dose Human per kg=Dose Mouse per kg.times.12
(Freireich et al., (1966)). Drug doses can also be given in
milligrams per square meter of body surface area because this
method rather than body weight achieves a good correlation to
certain metabolic and excretionary functions. Moreover, body
surface area can be used as a common denominator for drug dosage in
adults and children as well as in different animal species as
described by Freireich et al. (Freireich et al., (1966)). Briefly,
to express a mg/kg dose in any given species as the equivalent
mg/sq m dose, multiply the dose by the appropriate km factor. In an
adult human, 100 mg/kg is equivalent to 100 mg/kg.times.37 kg/sq
m=3700 mg/m.sup.2.
[0285] For oral administration, a satisfactory result can be
obtained employing the therapeutic compound in an amount ranging
from about 0.01 mg/kg to about 100 mg/kg and preferably from about
0.1 mg/kg to about 30 mg/kg. A preferred oral dosage form, such as
tablets or capsules, will contain an active ingredient in an amount
ranging from about 0.1 to about 500 mg, preferably from about 2 to
about 50 mg, and more preferably from about 10 to about 25 mg.
[0286] For parenteral administration, the therapeutic composition
can be employed in an amount ranging from about 0.005 mg/kg to
about 100 mg/kg, preferably about 10 to 50 or 10 to 70 mg/kg, and
more preferably from about 10 mg/kg to about 30 mg/kg.
[0287] For additional guidance regarding formulation and dose, see
U.S. Pat. Nos. 5,326,902; 5,234,933; PCT International Publication
No. WO 93/25521; Berkow et al. (1997); Goodman et al. (1996); Ebadi
(1998); Katzung (2001); Remington et al. (1975); Speight et al.
(1997); and Duch et al. (1998).
[0288] III.F. Routes of Administration
[0289] Suitable methods for administering to a subject a compound
in accordance with the methods of the presently disclosed subject
matter include but are not limited to systemic administration,
parenteral administration (including intravascular, intramuscular,
intraarterial administration), oral delivery, buccal delivery,
subcutaneous administration, inhalation, intratracheal
installation, surgical implantation, transdermal delivery, local
injection, and hyper-velocity injection/bombardment. Where
applicable, continuous infusion can enhance drug accumulation at a
target site (see, e.g., U.S. Pat. No. 6,180,082).
[0290] The particular mode of drug administration used in
accordance with the methods of the presently disclosed subject
matter depends on various factors, including but not limited to the
vector and/or drug carrier employed, the severity of the condition
to be treated, and mechanisms for metabolism or removal of the drug
following administration.
IV. SUBJECTS
[0291] A "subject" as the term is used herein generally refers to
an animal. In some embodiments, a preferred animal subject is a
vertebrate subject. Further, in some embodiments, a preferred
vertebrate is warm-blooded and a preferred warm-blooded vertebrate
is a mammal. A preferred mammal is most preferably a human.
However, as used herein, the term "subject" includes both human and
animal subjects. Thus, veterinary therapeutic uses are provided in
accordance with the presently disclosed subject matter.
[0292] As such, the presently disclosed subject matter provides for
the analysis and treatment of mammals such as humans, as well as
those mammals of importance due to being endangered, such as
Siberian tigers; of economical importance, such as animals raised
on farms for consumption by humans; and/or animals of social
importance to humans, such as animals kept as pets or in zoos.
Examples of such animals include but are not limited to: carnivores
such as cats and dogs; swine, including pigs, hogs, and wild boars;
ruminants and/or ungulates such as cattle, oxen, sheep, giraffes,
deer, goats, bison, and camels; and horses. A "subject" as the term
is used herein can further include birds, such as for example those
kinds of birds that are endangered and/or kept in zoos, as well as
fowl, and more particularly domesticated fowl, i.e., poultry, such
as turkeys, chickens, ducks, geese, guinea fowl, and the like, as
they are also of economical importance to humans. Thus, "subject"
further includes livestock, including, but not limited to,
domesticated swine, ruminants, ungulates, horses (including race
horses), poultry, and the like.
V. ANIMAL MODELS
[0293] It is within the scope of the presently disclosed subject
matter to provide a non-human animal possessing modulated protein
activity levels and methods of producing the non-human animal. In
some embodiments, the non-human animal possesses modulated COMT
activity, modulated ADRB2 activity, modulated ADRB3 activity, or
combinations thereof. In embodiments where the non-human animal
possesses modulated activity of one or more of these proteins, the
animal exhibits characteristics of a somatosensory disorder. That
is, the animal manifests a measurable biological or psychological
characteristic that is comparable to one or more characteristics
observed in human subjects suffering from a somatosensory disorder.
A characteristic can, but need not necessarily be, a symptom of a
somatosensory disorder, such as for example increased sensitivity
to painful stimulation, fever, psychological disturbances,
measurable electrical and chemical changes in the neurochemistry of
the brain, and changes in blood chemistry. As such, the animal can
serve as a model of a human somatosensory disorder, either as a
complete model of a somatosensory disorder, or as a model of one
aspect of a somatosensory disorder.
[0294] The presently disclosed subject matter further provides
methods of producing a non-human animal model of a human
somatosensory disorder. In some embodiments, the method comprises
modulating COMT activity, ADRB2 activity, ADRB3 activity, or
combinations thereof in the non-human animal model to produce the
non-human animal model of the human somatosensory disorder. In some
embodiments, COMT activity in the animal is inhibited by
administering a COMT inhibitor to the animal. In some embodiments,
the non-human animal model exhibits an increase in production of
proinflammatory, pro-pain producing cytokines, such as for example
IL-6, IL-1.beta., TNF-.alpha., IL-1.alpha. and combinations
thereof, as a result of modification of a protein activity, such as
for example inhibition of COMT activity in the animal. The
presently disclosed subject matter provides for modulating protein
activity in the non-human animal not only pharmacologically, but
also through genetic modification techniques.
[0295] In some embodiments, the non-human animal is a genetically
modified animal. The genetically modified animal can be a rodent,
such as for example a mouse. Further, in some embodiments, the
genetically modified animal is a transgenic animal that
overexpresses a protein, such as for example ADRB2 and/or ADRB3. In
some embodiments, the genetically modified animal is a knockout
animal. That is, the genetically modified animal has had a targeted
disruption of one or more genes such that substantially no
functional gene product is produced from the one or more genes. In
some embodiments, the knockout animal is a COMT knockout. In some
embodiments, the genetically modified animal is a knockdown animal.
That is, the genetically modified animal has had a targeted
disruption of one or more genes such that substantially less
functional gene product is produced from the one or more genes. In
some embodiments, the knockdown animal is a COMT knockdown.
[0296] Techniques for the preparation of transgenic animals,
including knockout animals, are known in the art. Exemplary
techniques are described in U.S. Pat. No. 5,489,742 (transgenic
rats); U.S. Pat. Nos. 4,736,866; 5,550,316; 5,614,396; 5,625,125;
and 5,648,061 (transgenic mice); U.S. Pat. Nos. 5,573,933
(transgenic pigs); 5,162,215 (transgenic avian species) and U.S.
Pat. No. 5,741,957 (transgenic bovine species), the entire contents
of each of which are herein incorporated by reference.
[0297] With respect to a representative method for the preparation
of a transgenic mouse, cloned recombinant or synthetic DNA
sequences or DNA segments encoding a polypeptide gene product from
a different species are injected into fertilized mouse eggs. The
injected eggs are implanted in pseudo pregnant females and are
grown to term to provide transgenic mice whose cells express the
foreign polypeptide.
EXAMPLES
Materials and Methods for Examples 1-6
Study Population
[0298] Subjects for the baseline analysis were 202 healthy
pain-free females aged 18-34 years who provided a blood sample and
consent for genotyping from among a larger cohort of 244 females
who volunteered for a research project. Volunteers were recruited
between April 1998 and March 2000 using advertisements placed in
local newspapers in the Raleigh-Durham-Chapel Hill area of central
North Carolina, U.S.A. (Table 1). The advertisements explained that
healthy females were sought for an ongoing prospective study
designed to examine and identify factors that influence sensory
perception. No treatment was offered.
[0299] Females who responded to advertisements completed a
comprehensive medical history to rule out any previous or current
history of pain-related disorder or other medical related
conditions that might alter their pain perception. Participants
completed a series of pain perception assessments and underwent a
physical examination at the University of North Carolina School of
Dentistry. All subjects underwent pain perception assessments as
described herein.
[0300] The study was conducted with both written and verbal
informed consent using protocols reviewed and approved by the UNC
School of Dentistry's Committee on Investigations Involving Human
Subjects. Subjects were paid up to $300 for their participation on
a sliding scale depending on the number of visits they
completed.
TABLE-US-00001 TABLE 1 Baseline characteristics of the cohort and
percentage genotyped No. in No. % Group cohort* genotyped*
genotyped P-value.sup..dagger. Age: 18-22 yrs 129 109 84.5 0.46
23-34 yrs 115 93 80.9 Race: White 205 171 83.4 0.55 Other 39 31
79.5 Highest level High 50 41 82.0 0.48 of education school College
134 114 85.1 Post-grad 89 46 78.0 Marital Single 198 164 82.8 0.97
status Other 46 38 82.6 Baseline <-4.5 81 73 90.1 0.07 pain
-4.5-3.0 82 63 76.8 z-score >3.0 81 66 81.5 Total 244 202 82.8
*Numbers that do not add to total have missing values for
socio-demographic variables .sup..dagger.Chi-square test
Baseline Characteristics of Subjects and Consent for Genotyping
[0301] At baseline, 244 females volunteered to take part in the
study and completed baseline assessments. 202 (83%) of them also
provided a blood sample and written consent for genotyping. The
percentage genotyped did not differ among sociodemographic
subgroups of age, race, education or marital status (Table 1).
There were marginal differences (P=0.07) in the percent genotyped
among tertiles of baseline summary pain z-score (see below),
although the trend was uniform: those who were least pain
responsive were most likely to be genotyped (90% of subjects in the
lowest quartile) followed by the most pain responsive (81% of
subject in the highest quartile) while those with the mid-tertile
of pain responsiveness were least likely to be genotyped (77%).
Pain Sensitivity Assessments
[0302] All pain measurements, with the exception of pressure pain
measures, were performed during the follicular phase of the
subject's menstrual cycle between days 3-10 where day 0 represents
the onset of menstruation. The reason for this was to control for
the modest effects of menstrual cycle on pain sensitivity. Pressure
pain thresholds were taken at a separate session approximately 1
week prior to thermal and ischemic pain assessments. All subjects
were asked to refrain from consuming over-the-counter pain
relieving medications for at least 48 hours before visiting the
laboratory and all subjects were free of prescription pain
medications for at least two weeks prior to sensory testing.
Pressure Pain Thresholds
[0303] Pressure pain thresholds were assessed over the right and
left temporalis muscles, masseter muscles, temporomandibular
joints, and ventral surfaces of the wrists with a hand-held
pressure algometer (Pain Diagnosis and Treatment, Great Neck, N.Y.,
U.S.A.) using methods similar to those described by Jaeger and
Reeves (1986). The algometer's tip consisted of a flat 10 mm
diameter rubber pad. Pressure stimuli were delivered at an
approximate rate of 1 kg/sec. Participants were instructed to
signal either verbally or by a hand movement when the pressure
sensation first became painful. When this occurred, the stimulus
was removed. The pressure pain threshold was defined as the amount
of pressure (kg) at which the subjects first perceived to be
painful. The pressure application was not allowed to exceed 6 kg
for the wrists and 4 kg for other sites. When those values were
attained, the trials were terminated and these values were entered
into the calculation for the subject's pressure pain thresholds.
One pre-trial assessment was performed at each site followed by two
additional assessments. The two values from the right and left
sides were then averaged to obtain one pressure pain threshold
value per test site, yielding a total of four measures.
Assessment of Thermal Pain Thresholds and Tolerances
[0304] A modified "Marstock" procedure (Fagius & Wahren (1981);
Fruhstorfer et al. (1976)) was used to measure thermal pain
thresholds and tolerances with a 10 mm diameter computer (486
DOS-based PC) controlled contact thermal stimulator. Thermal
stimuli were applied to the skin overlying the right masseter
muscle, the skin overlying the right hairy forearm, and the skin
overlying the dorsal surface of the right foot. Thermal pain
threshold was defined as the temperature (.degree. C.) at which the
subjects perceived the thermal stimuli as painful, whereas thermal
pain tolerance was defined as the temperature (.degree. C.) at
which the subjects can no longer tolerate the thermal stimulus.
[0305] Two separate procedures were used to assess thermal pain
thresholds and a third procedure assessed thermal pain tolerance,
each at three anatomical sites. The first set of thermal stimuli
was delivered from a neutral adapting temperature of 32.degree. C.
at a rate of 3.degree. C./sec which has been proposed to produce a
relatively selective activation of A.delta.-fibers. During this
procedure, subjects were instructed to depress a mouse key when
they first perceived thermal pain. This caused the thermode to
return to the baseline temperature and the reversal temperature was
defined as the M mediated thermal pain threshold temperature. This
procedure was repeated six times and the values from these six
trials were averaged to obtain the temperature value of A.delta.
mediated thermal pain threshold. The same procedure was repeated
with a second set of thermal stimuli delivered at a rate of
0.5.degree. C./sec. This procedure has been proposed to produce a
relatively selective activation of C-fibers. Finally, C-fiber
thermal pain tolerance was determined by using a third set of
thermal stimuli delivered at the rate of 0.5.degree. C./sec.
Subjects were instructed to depress the mouse key when the probe
temperature achieved a level that they could no longer tolerate.
The probe temperature was not allowed to exceed 53.degree. C. When
value approximating 53.degree. C. was attained, the trial was
terminated and this value was entered into the calculation for the
subject's tolerance value. The values obtained from six repeated
thermal trials were averaged to obtain a subject's C-fiber thermal
pain tolerance value. This yielded nine measures: two threshold
measures and one tolerance measure, each at three anatomical
sites.
Assessment of Temporal Summation of C Fiber Mediated Thermal
Pain
[0306] A procedure similar to that described in Price et al. (1977)
was used to examine the temporal summation of C fiber mediated
thermal pain. A total of fifteen 53.degree. C. heat pulses were
applied to skin overlying the thenar region of the right hand. Each
heat pulse was 1.5 sec in duration and was delivered at a rate of
10.degree. C./sec from a 40.degree. C. base temperature with an
inter-trial interval of 1.5 sec. In effect, this produced a
transient 53.degree. C. heat pulse with a peak-to-peak inter-pulse
interval of 3 seconds. Subjects were instructed to verbally rate
the intensity of each thermal pulse using a 0 to 100 numerical
scale with `0` representing `no sensation`, `20` representing `just
painful`, and `100` representing `the most intense pain
imaginable`. Subjects were informed that the procedure would be
terminated when they reported a value of `100` or when 15 trials
had elapsed. For subjects who terminated the procedure prior to the
completion of 15 trials, a value of 100 was assigned to the
subsequent missing trials. Each subject's ability to summate
C-fiber pain was quantified by adding values of all 15 verbal
responses. This value was used as a single measurement of the
temporal summation of C fiber mediated thermal pain.
Assessment of Ischemic Pain Threshold and Tolerance
[0307] A modified submaximal effort tourniquet procedure (Maixner
et al. (1990)) was used to evoke ischemic pain. The subject's right
arm was elevated and supported in a vertical position for 30 sec to
promote venous drainage. Then, a blood pressure arm cuff positioned
above the elbow was inflated to 220 mmHg to abolish arterial blood
supply and to render the arm hypoxic. A stopwatch was started at
the time of cuff inflation and the subject's arm was then lowered
to a horizontal position. Immediately afterwards, the subject
started squeezing a handgrip dynamometer at 30% of maximum force of
grip for 20 repetitions. Prior to the procedure, the subject's
maximum grip strength was determined by having each subject squeeze
the dynamometer with `as much force as possible`. The onset,
duration, and magnitude of each handgrip squeeze were signaled by
computer-controlled signal lights to ensure standardized
compression and relaxation periods. Ischemic pain threshold was
determined by recording the time (seconds) when subjects first
reported hand or forearm discomfort. Ischemic pain tolerance was
determined by recording the time (seconds) when subjects could no
longer endure their ischemic arm pain. The tourniquet remained in
place for 25 minutes or until pain tolerance had been achieved.
This procedure yielded two measures: ischemic pain threshold and
ischemic pain tolerance.
Summary Measure of Sensitivity to Experimental Pain
[0308] A single measure of pain sensitivity was computed for each
subject from the sixteen experimental pain procedures. The
inventors first reversed the direction of measurement (by
subtracting from zero) fifteen of the measures that quantified
threshold or tolerance to experimental pain: four measures of
pressure pain threshold, nine measures of thermal
threshold/tolerance, and two measures of ischemic
threshold/tolerance. The sixteenth measure of temporal summation of
C fiber mediated thermal pain was retained in its original value.
All sixteen measures were standardized to unit normal deviates
(z-scores) by subtracting the sample mean, then dividing by the
sample standard deviation. Three of the 202 genotyped subjects had
a single missing pain measure, one subject had two missing pain
measure and one subject had 10 missing pain measures, and we
imputed the mean value of zero in each instance. Each subject's
summary z-score was then computed by adding together all sixteen
unit normal deviates. This yielded an approximately normal
distribution (FIG. 9), which satisfied assumptions for homogeneity
of variance in all subsequent t-tests and ANOVA models.
Genotyping
[0309] Genomic DNA was purified from 202 subjects using QIAAMP.TM.
96 DNA Blood Kit (Qiagen, Valencia, Calif., U.S.A.) and used for
either 5' exonuclease or duplex-specific nuclease assays.
5' Exonuclease Assay
[0310] Five COMT SNPs (rs2097903, rs6269, rs4633; rs4818; rs4680
(val158met) were genotyped using the 5' exonuclease assay. Probes
and primers were chosen using PROBEITY.TM. (Celadon Laboratories,
College Park, Md., U.S.A.) (Table 2) and were synthesized by
Applied Biosystems (Foster City, Calif., U.S.A.). The PCR reaction
mixture consisted of 2.5 .mu.l PCR Master Mix (Applied Biosystems),
100 nM detection probe for each allele, 900 nM forward and 900 nM
reverse amplification primers, and 20 ng genomic DNA in a total
reaction volume of 25 .mu.l. Amplification and detection were
performed with an ABI PRISM.RTM. 7700 Sequence Detection System
(Applied Biosystems). General conditions for TAQMAN.RTM. (Applied
Biosystems) PCR were as described in Shi et al. (1999). The
optimized temperatures varied from 60.degree. C. to 63.5.degree. C.
The primers and detection probes for each locus are listed in Table
2. Genotype determination was conducted manually using the ABI
PRISM.RTM. 7700 Sequence Detection System (Applied Biosystems). A
verification plate consisting of 17% of the AN probands and control
group samples was genotyped in order to assess the reproducibility
of the assay. Genotyping error rate was directly determined and was
<0.005. Genotype completion rate was 95%.
TABLE-US-00002 TABLE 2 Sequences for the primer and probes used in
5'exonuclease and DSN assays SEQ ID SNP sequence NO rs2097903 gcc
gtg tct gga ctg tga gt 1 ggg ttc aga atc acg gat gtg 2 aac aga cag
aaa agT ttc ccc ttc cca 3 cag aca gaa aag Ctt ccc ctt ccc ata 4
rs6269 agg cac aag gct ggc att t 5 cca cac gcc cct ttg ct 6 tgc ccc
tct gcG aac aca agg 7 acc ttg ccc ctc tgc Aaa cac aag 8 rs4633 tgc
tca tgg gtg aca cca a 9 gcc tcc agc acg ctc tgt 10 atc ctg aac caT
gtg ctg cag cat 11 atc ctg aac caC gtg ctg cag c 12 rs4818 ggg ggc
cta ctg tgg cta ct 13 tca ggc atg cac acc ttg tc 14 cga ggc tCa tca
cca tcg aga tca 15 cga ggc tGa tca cca tcg aga tca 16 rs4680 tcg
aga tca acc ccg act gt 17 (val158met) aac ggg tca ggc atg ca 18 cct
tgt cct tca Cgc cag cga 19 acc ttg tcc ttc aTg cca gcg aaa 20
rs165599 cagccacagtggtgcagag 21 gtccacctgtccccagcg 22 tgccAgcctg 23
tgccGgcctg 24
Duplex-Specific Nuclease (DSN) Assay
[0311] SNP rs165599 was genotyped using the DSN technique of Shagin
et al. (2002). PCR was carry out in 96 well plates using a HYBAID
thermocycler. PCR reactions were performed with the ADVANTAGE.TM. 2
PCR Kit (Clontech, Palo Alto, Calif., U.S.A.). Each PCR reaction
(25 .mu.l) contained 1.times. ADVANTAGE.TM. 2 Polymerize mix
(Clontech), 1.times. reaction buffer, 200 .mu.M dNTPs, 0.3 .mu.M
each gene-specific primer (Table 2) and 10 ng of genomic DNA. The
following PCR conditions and gene-specific primers were employed:
30 PCR cycles (95.degree. C. for 7 s; 65.degree. C. for 20 s;
72.degree. C. for 30 s). A 7 .mu.l aliquot of PCR products
containing about 150 ng DNA was mixed with 1.5 .mu.l 10.times.DSN
buffer (500 mM Tris-HCl, pH8.0, 50 mM MgCl2, 10 mM DTT), probes (to
a final concentration of 0.3 .mu.M) (Table 2), 0.75 Kunitz unit DSN
nuclease, and milliQ water (to a final volume of 15 .mu.l), and
incubated for 20 min at 65.degree. C., 40 min 35.degree. C.
Normalized emission spectra of these samples were obtained on a
photofluorometer FFM-01 (Kortek, Moscow, Russia) at 538 nm for
green fluorescence, FAM (with excitation at 482 nm) and 607 nm for
red fluorescence, TAMRA (with excitation at 546 nm). Genotyping
results for rs165599 were confirmed by restriction analysis.
Restriction analysis was carried out on the 500 ng of PCR products
using 10 units of Nae I restriction enzyme (New England Biolabs,
Beverly, Mass., U.S.A.). The restricted products were analyzed on
2.5% agarose/ethydium bromide get. One DNA fragment (150 bp) was
observed for the homozygous for the alleles A, two DNA fragments
(76 and 74 bp)--for the homozygous for allele G and all three
fragments for the heterozygous.
Assessment of COMT Activity in Different Haplotypes
[0312] A. Transient Transfection of COMT cDNA Clones
[0313] Full-length S-COMT cDNA clones corresponding to HPS, APS and
LPS haplotypes were obtained from the IMAGE.TM. clone collection
(Open Biosystems, Huntsville, Ala., USA). Clones BG290167 and
BG818517 represented LPS haplotype; clones BI821094 and F037202
represented APS haplotype; and clones BI759217 and BF035214
represented HPS haplotype. All clones contained the first ATG codon
and were available in the mammalian expression vector pCMV-SPORT6.
Plasmid DNA was purified using the ENDOFREE.TM. Plasmid Maxi
purification kit (Qiagen, Germantown, Md., U.S.A.). Once plasmids
were isolated, DNA sequences were confirmed by double sequencing at
the UNC Core Sequencing Facility.
[0314] Human embryonic kidney cells (HEK 293) were transiently
transfected into six-well plates using SUPERFECT.TM. Reagent
(Qiagen) in accordance with the manufacture's recommendations. The
amount of IMAGE clones was kept at 2 .mu.g/well and to control for
the efficiency of transfection pSV-.beta.Galactosidase vector
(Promega, Madison, Wis., U.S.A.) was kept at 0.1 .mu.g.
Transfection with a vector with no insert was done for each
experiment. Cells lysates were collected approximately 24 hours
post-transfection. After removing the media, cells were washed
twice with 0.9% saline solution (1 ml/35 mm well) and then covered
with deionized water containing 10 mM CDTA (500 .mu.l/35 mm well).
The wells were frozen at -80.degree. C. overnight. In order to
complete the lysing process, HEK 293 cells were pulled into a
syringe and passed through a 30 .sup.1/2 gauge needle into 1.5 ml
tubes. The tubes were centrifuged at 2000 g for 10 min and filtrate
removed.
[0315] B. Enzymatic Assay
[0316] The enzymatic COMT assay was based on the method described
by Masuda et al. (2002). Purified lysates (8 .mu.l) were incubated
with 200 .mu.M S-adenosyl-L-methionine (SAME.TM.; ICN Chemicals
(Aurora, Ohio, U.S.A.)), 7.5 mM L-norepinephrine (Sigma Chemical
Co. (St. Louis, Mo., U.S.A.) and 2 mM MgCl.sub.2 in 50 mM phosphate
buffered saline for 60 min in the final volume of 22 .mu.l. The
reaction was terminated using 20 .mu.l of 0.4 M hydrochloric acid
and 1 .mu.l of 330 mM EDTA. The same reaction in the presence of 15
mM EDTA was carried out in parallel for each lysate to bind
Mg.sup.+2 ions that are required for COMT activity. COMT activity
was measured with a Normetanephrine (NMN) ELISA kit (IBL, Hamburg,
Germany; distributed by IBL-America, Minneapolis, Minn., U.S.A.) in
accordance with the manufacture's recommendations using 10 .mu.l of
the above reaction mixture. COMT activity was determined after
subtracting the amount of NMN produced by endogenous enzymatic
activity (transfection with empty vector) as well as the amount of
NMN in transfected cells produced by exogenous COMT activity
(enzymatic reaction in the presence of EDTA). COMT activity was
then normalized for transfection efficiency by measuring the
.beta.-galactosidase activity for each lysate. .beta.-galactosidase
activity was determined using a .beta.-galactosidase enzyme systems
(Promega), according to the supplier's protocol.
[0317] C. RT-PCR
[0318] Total RNA was isolated using TRIZOL.RTM. reagent
(Invitrogen, Carlsbad, Calif., U.S.A.). The isolated RNA was
treated with RNase free-DNase I (Promega) and reverse transcribed
by M-MLV reverse transcriptase (Invitrogen). As a control for
transfection efficiency, 200 ng of pSEAP-control plasmid (Clontech)
was co-transfected with each COMT clones. The cDNA was amplified
with DYNAMA.TM.-SYBRGreen qPCR kit (MJ Research, Reno, Nev.,
U.S.A.) using forward and reverse PCR primers, specific for COMT
cDNA (TGAACGTGGGCGACAAGAAAGGCAAGAT (SEQ ID NO: 25) and
TGACCTTGTCCTTCACGCCAGCGAAAT (SEQ ID NO:26, respectively) or for
SEAP cDNA (GCCGACCACTCCCACGTCTT and CCCGCTCTCGCTCTCGGTAA,
respectively).
[0319] OPTICON-2.TM. Real Time Fluorescence Detection System (MJ
Research) was used for measuring fluorescence.
Animal Behavior
[0320] A. Subjects
[0321] Sixteen adult male Sprague-Dawley rats (285-325 g; Charles
River Laboratories, Wilmington, Mass., U.S.A.) were used in these
experiments. All procedures were approved by the University of
North Carolina Animal Care and Use Committee and followed the
guidelines for the treatment of animals of the International
Association for the Study of Pain.
[0322] B. Drugs and Chemicals
[0323] OR486, a potent peripheral and central COMT inhibitor, and
lambda carrageenan were obtained from Sigma Aldrich (St. Louis,
Mo.). OR486 was dissolved in dimethylsulfoxide and saline (3:2
ratio) for systemic administration. Carrageenan (3%) was dissolved
in saline and administered in a volume of 100 .mu.l.
[0324] C. Assessment of Responsiveness to Mechanical and Thermal
Stimulation
[0325] Rats were placed in plexiglass cages positioned over an
elevated perforated stainless steel platform and habituated to the
environment for 15-25 min prior to testing. Paw withdrawal
threshold to punctuate mechanical stimulation was assessed using
the up-down method of Chaplan et al. (1994). A series of nine
calibrated filaments (with bending forces of 0.40, 0.68, 1.1, 2.1,
3.4, 5.7, 8.4, 13.2, and 25.0 g; Sammons Preston Rolyan,
Bolingbrook, Ill., U.S.A.) with approximately equal logarithmic
spacing between stimuli (Mean.+-.SEM: 0.232.+-.0.04 units) were
presented to the hind paw in successive order, whether ascending or
descending. Filaments were positioned in contact with the hindpaw
for a duration of 3 s or until a withdrawal response occurred.
Testing was initiated with the middle hair of the series (3.4 g).
In the absence of a paw withdrawal response, an incrementally
stronger filament was presented and in the event of a paw
withdrawal, an incrementally weaker filament was presented. After
the initial response threshold was crossed, this procedure was
repeated four times in order to obtain a total of six responses in
the immediate vicinity of the threshold. The presence of paw
withdrawal (X) and absence of withdrawal (O) was noted together
with the terminal filament used in the series of six responses. The
50% g threshold=(10.sup.[Xf+k.delta.])/10,000, where X.sub.f=value
(in log units) of the final von Frey hair used; k=tabular value of
pattern of positive (X) and negative (O) responses, and
.delta.=mean difference (in log units) between stimuli.
[0326] Immediately following determination of the response
threshold, paw withdrawal frequency (%) to punctuate mechanical
stimulation was assessed. A von Frey monofilament with a calibrated
bending force of 25 g was presented to the hind paw 10 times for a
duration of 1 s with an interstimulus interval of approximately 1
s. Mechanical hyperalgesia was defined as an increase in the
percentage frequency ([# of paw withdrawals/10].times.100) of paw
withdrawal evoked by stimulation with von Frey monofilaments.
[0327] Thermal hyperalgesia was evaluated using the radiant heat
method of Hargreaves et al. (1988) in the same animals evaluated
for responsiveness to von Frey monofilaments. Radiant heat was
presented through the floor of a finely perforated stainless steel
platform to the midplantar region of the hind paw. Stimulation was
terminated upon paw withdrawal or after 20 s if the rat failed to
withdraw from the stimulus.
[0328] D. Assessment of Effect of COMT Inhibitors
[0329] After establishing stable baseline responsiveness to
mechanical and thermal stimuli, separate groups of rats received
intraperitoneal injections of OR486 (30 mg/kg i.p.; N=8) or vehicle
(N=8) one hour prior to behavioral testing. Responsiveness to von
Frey filaments was reassessed at 30 min intervals for 2 hours. Paw
withdrawal latencies to radiant heat were subsequently assessed at
2.5 hours into the testing procedure. Twenty-four hours later,
baseline responsiveness to mechanical and thermal stimuli was
reestablished. Animals received OR486 (30 mg/kg i.p.) or vehicle
(consistent with the previous day). Thirty minutes following
administration of drug or vehicle, separate groups of rats received
intraplantar carrageenan (N=4 per group) or saline (N=4 per group).
Responsiveness to von Frey filaments was reassessed at 30 min
intervals for 2 hours following the induction of inflammation. Paw
withdrawal latencies to radiant heat were subsequently assessed at
2.5 hours post carrageenan.
Statistical Evaluation of Associations Between SNPs, Haplotypes and
Pain Responsiveness
[0330] Statistical evaluation began with analysis of variance
(ANOVA) models for each of six SNPs and Student's t-test to
contrast homozygotes (FIG. 10). The independent effects of SNPs
were then evaluated in a multivariable generalized linear model in
which each SNP was entered as a separate pair of dummy variables
(with two degrees of freedom). SNPs were entered in the following
sequence of steps: first, rs4680 (met.sup.158val), second rs4818
rs4633 and rs6269, and third rs2097903 and rs165599. This sequence
was nominated on the following theoretical grounds: first the
inventors controlled for the one SNP in the coding region that
caused a synonymous change in COMT amino acid sequence; second the
inventors examined the effects of SNPs that are associated with a
non-synonymous change in the amino acid sequence; and third the
inventors evaluated any additional effects of SNPs in the promoter
and untranslated regions. SNPs entered in the third step
contributed less than one percent each to the total variation
(R-squared) of the model. In addition, eight subjects had missing
values for the two SNPs in this third block, so those SNPs were
eliminated from further analysis. The four SNPs from the coding
region accounted for 10.6 percent of R-squared (Table 3).
TABLE-US-00003 TABLE 3 Generalized linear model of effects of four
SNPs on pain sensitivity* Degrees of Sum of Sequential SNP locus
freedom squares R-squared F P-value rs4680 (val/met) 2 383.5 0.017
1.8 0.17 rs4818 2 1535.1 0.068 7.3 <0.01 rs4633 2 466.4 0.021
2.2 0.11 rs6269 2 18.5 <0.001 0.1 0.91 Error 193 20324.5 *Model
uses data from n = 202 subjects who were genotyped. For full model
F.sub.8,193 = 2.8, P < 0.01, R-squared = 0.106
[0331] Associations between haplotypes and pain responsiveness were
assessed first by classifying the 186 subjects whose two COMT
haplotypes were among the three most prevalent haplotypes: GCGG
(which were labeled as low pain sensitive--LPS), ATCA (which were
labeled as average pain sensitive--APS), ACCG (which were labeled
as high pain sensitive --HPS). This yielded five possible
combinations that were evaluated in a factorial analysis of
variance model (Table 4). The F-tests were used for each term in
this model to first determine that each haplotype in the subjects'
pairs had independent effects. Least squares means were then
computed to test three hypotheses about haplotypes (using Dunnett's
post-hoc adjustment): For the first haplotype, APS had higher
adjusted mean summary z-score than LPS subjects (P=0.01, adjusting
for the other haplotype--Table 4).
[0332] For the second haplotype, HPS had higher adjusted mean
summary z-score than APS subjects (P=0.04, adjusting for the other
haplotype) and HPS had higher adjusted mean summary z-score than
LPS (P<0.01--adjusting for the other haplotype--Table 4).
TABLE-US-00004 TABLE 4 Factorial ANOVA model of effects of three
major haplotypes on pain sensitivity Degrees of Sum of Sequential
Source freedom squares R-squared F P-value Haplotype 1 (LPS, HPS) 1
466.1 0.022 4.5 0.04 Haplotype 2 (LPS, APS, 2 1730.5 0.082 8.3
<0.01 HPS) Error 182 18900.5 *Model uses data from n = 186
subjects who were genotyped. For full model F.sub.3,182 = 7.05, P
< 0.01, R-squared = 0.104
Summary Z-Score Least Squares Means from Model:
TABLE-US-00005 mean (se) P-value Haplotype 1: LPS -2.1 (1.7) 0.01
APS 2.8 (1.0) (reference) Haplotype 2: LPS -3.5 (1.1) <0.01 APS
-0.7 (1.7) 0.04 HPS 5.3 (1.9) (reference)
Stratification by Race
[0333] There were too-few non-white subjects (n=31) genotyped from
this volunteer sample to permit meaningful statistical analyses of
them as separate strata. However, the percentage of subjects
classified as HPS/APS was virtually identical between whites (35%)
and non-whites (36%--Chi-square test, P=0.89) and the two race
groups did not differ significantly in mean values of experimental
pain z-scores (t-test, P=0.30). Furthermore, when the preceding
factorial analyses of COMT haplotypes were restricted to whites,
the results remained virtually identical. Specifically, P-values
for the effect of each haplotype were significant (P<0.03), and
the pairwise effects were significant for ATCA vs GCGG (P=0.03) and
for ACCG vs. GCGG (P<0.001).
Linkage Disequilibrium (LD) Analysis
[0334] LD between SNPs was estimated with SAS Proc Allele software
or PHASE software using default parameters.
Incidence of Newly-Diagnosed TMD
[0335] Among the 186 subjects who had the five major haplotype
combinations, 170 completed one or more follow-up evaluations when
fifteen new cases of TMD were diagnosed (cumulative
incidence=8.8%). New cases were diagnosed at periods ranging from
nine months to three years, and the duration of follow-up for all
subjects ranged from seven months to 43 months. Because of this
variation in follow-up periods, we computed the average incidence
rate for TMD and contrasted the rates for two subgroups of
haplotypes, the first comprising subjects with APS/HPS haplotype
(n=58 people with A_C_C_G/A_T_C_A or A_T_C_A/A_T_C_A) and the
second comprising subjects with at least one LPS haplotype (n=112
people with A_T_C_A/G_C_G_G, A_C_C_G/G_C_G_G or G_C_G_G/G_C_G_G).
Life-table methodology was used to compute incidence rates. The
numerator for the incidence rate was the number of subjects who
developed TMD and the denominator was TMD-free-time-in-study,
expressed in years. For subjects who developed TMD, their
TMD-free-time-in-study was computed as the period from recruitment
to the halfway point between their penultimate three monthly
screening interviews and their diagnosis examination. For subjects
who did not develop TMD but who withdrew from the study before the
final annual assessment, their TMD-free-time-in-study was computed
as the period from recruitment to the halfway point between their
penultimate three monthly screening interview and date of
withdrawal. For all remaining subjects, their
TMD-free-time-in-study was computed at as the period from
recruitment to the final examination. Results were expressed as the
rate of new TMD diagnoses per 100-person-years of follow-up,
equivalent to the average number of new TMD cases that would be
expected in an initially TMD-free cohort of female volunteers who
were followed each for one year.
[0336] For the complete cohort of n=170 subjects, cumulative
incidence was 8.8 percent and the incidence rate was 3.5 cases per
100-person-years (Table 4). Cumulative incidence was compared
between the HPS/APS group and the LPS group using the
Mantel-Haenszel test, yielding a relative risk of 2.2 (95%
confidence interval [95% CI]=0.8-5.8--Table 4). Differences in
incidence rates between the same two groups were determined in a
Poisson regression model in which the numerator was number of TMD
cases and the offset was the log of person-years of follow-up,
yielding an incidence density ratio of 2.3 (95% CI=1.1-4.8).
Analysis of Rat Behavioral Data
[0337] Behavioral data were analyzed by ANOVA for repeated measures
and post hoc comparisons were performed using the Bonferroni test.
P<0.05 was considered to be statistically significant.
Example 1
Measuring Variations in Pain Sensitivity in a Population of
Subjects
[0338] Data for this study were collected from 202 healthy female
volunteers. The subjects participated in a three-year prospective
cohort study that was designed to identify risk factors for a
particular exemplary somatosensory disorder, TMD. Only females were
included in this study as they exhibit a higher prevalence for the
condition relative to males (Carlsson & Le Resche, (1995)).
During an initial screening exam, the sensitivity of subjects to
experimental noxious stimuli was assessed, and peripheral blood
samples were collected for genetic analyses. Subjects were
subsequently followed for up to three years, by both trimonthly
interviews and annual physical examinations, to identify newly
developed cases of TMD.
[0339] In order to evaluate each participant's pain sensitivity, a
unique approach was used to derive a unitary measure of pain
sensitivity for both cutaneous and deep muscle pain, which are
transmitted and modulated by different neural mechanisms (Yu et al.
(1991); Mense (1993)). To accomplish this, each of 16 measures of
pain sensitivity was normalized to a mean of zero and standard
deviation of one, producing a unit normal deviate (z-score) for
each test procedure. A sum of these 16 scores produced a normalized
single score of pain sensitivity (integral z-score) for each
individual. As shown in FIG. 9, measures of individual pain
sensitivity (integral z-scores) were distributed approximately
normally (skewness=0.3 and kurtosis=-0.1), ranging from -22.4
(least responsive to painful stimuli) to 28.0 (most responsive to
painful stimuli); although the majority of individuals display
average pain sensitivity, the individual variability in pain
sensitivity between people is substantial and spans a range greater
than that produced by therapeutic doses of morphine.
Example 2
Genotyping the COMT Locus
[0340] Genomic DNA from peripheral blood samples was genotyped for
SNPs within the COMT gene locus. Six SNPs were chosen that display
high polymorphism frequency in the human population (>40%
prevalence). FIG. 6A shows the positions of the SNPs within the
COMT locus that codes for two major forms of COMT enzyme: membrane
bound (MB-COMT) and soluble (S-COMT). The first SNP (rs2097903) is
located at position-1217 in the estrogen sensitive portion of the
MB-COMT promoter region (Xie et al. (1999); DeMille et at (2002)),
while the second SNP (rs6269) is located in the promoter region of
S-COMT (Xie et al. (1999); Shifman et al. (2002)). The next three
SNPs (rs4633, rs4818 and rs4680 (val.sup.158met) are located within
the coding region for both S- and MB-COMT (Li et al. (2000); NCBI
genome database). Variations in SNP rs4633 and rs4818 are
synonymous (i.e., do not produce a change in amino acid
composition). In contrast, SNP rs4680 is non-synonymous and codes
for a substitution of valine (val) to methionine (met) at codon
158. The last SNP (rs165599) is situated in the very end of the
3'UTR of the gene and its G allele has been reported to be
associated with schizophrenia (Shifman et al. (2002)). Importantly,
the COMT SNP map has been thoroughly constructed (see NCBI
database). In the coding region of the gene, there are no other
SNPs with frequencies greater than 0.15. This was further confirmed
by comparing over 300 COMT EST sequences from the NCBI database
using the CLUSTALW program for multiple sequence alignments. As
disclosed in Risch (2000), alleles with polymorphic frequencies
<0.15 are very unlikely to have significant impact on common
population-based diseases/disorders such as TMD.
[0341] Statistically significant associations were found between
the summed z-score and two SNPs (Table 5 and FIG. 10). The SNP
rs6269 accounted for 6% of variation in pain sensitivity as
determined by analysis of variance (ANOVA, P<0.01), while rs4818
SNP accounted for 7% of the variation (ANOVA, P<0.01). For both
SNPs, the homozygous genotypes were associated with significant
differences in mean pain sensitivity (t-test, P<0.01). The
val.sup.158met SNP (rs4680) showed a marginal, but not
statistically significant, relationship with pain sensitivity,
accounting for 2% of the variation in the summary pain measure
(ANOVA, P=0.18). Individuals homozygous for met/met tended to be
more pain responsive than those homozygous for val/val, but again
the association was marginal (t-test, P=0.06). SNPs A-rs2097903,
rs4633 and rs16559 were not significantly associated with pain
sensitivity (see Table 5 and FIG. 10). Multivariate analysis
revealed that all possible combinations of the four SNPs in the
coding region accounted for 10.6% of variation in the summary
measure of pain sensitivity. In this model, we first controlled for
rs4680 (accounting for 2% of variance) then rs4818 (7% of
variance); the remaining SNPs did not individually contribute
significantly (P>0.10) to the variance in pain sensitivity (see
Table 3).
TABLE-US-00006 TABLE 5 Variation in pain sensitivity (summed
z-score) among tested SNPs and diplotypes of COMT gene
t-test.dagger. No. of genotypes Mean (sd) ANOVA* P- SNP Genotype
subjects frequencies z-score R.sup.2 P-value value rs2097903 A/A 68
0.340 -1.4 (10.1) 0.012 0.3 0.1 A/G 104 0.520 0.2 (11.4) G/G 28
0.140 2.2 (8.0) rs6269 G/G 31 0.153 -4.7 (9.1) 0.061 0.002 0.0006
A/G 97 0.480 -0.7 (10.5) A/A 74 0.366 3.0 (10.7) rs4633 C/C 52
0.257 -2.0 (10.5) 0.013 0.26 0.09 C/T 98 0.485 0.4 (10.9) T/T 52
0.257 1.3 (10.2) rs4818 G/G 28 0.139 -5.2 (8.0) 0.07 0.0007 0.0003
G/C 100 0.495 -0.9 (10.5) C/C 74 0.366 3.2 (10.7) rs4680 G/G 51
0.252 -2.1 (10.3) 0.017 0.18 0.056 A/G 102 0.505 0.2 (10.9) A/A 49
0.243 1.7 (10.3) rs165599 G/G 27 0.138 -2.4 (8.5) 0.008 0.48 0.27
A/G 87 0.446 0.4 (11.4) A/A 81 0.415 -0.2 (10.3) Haplotype
ATCA_ACCG 15 0.081 8.9 (11.4) 0.107 0.0004 combination ATCA_ATCA 49
0.263 1.7 (10.3) ATCA_GCGG 80 0.430 -1.3 (10.2) GCGG_ACCG 14 0.075
1.5 (12.3) GCGG_GCGG 28 0.151 -5.2 (8.0) *ANOVA = Analysis of
variance testing null hypothesis of equality of means among three
alleles; .dagger.t-test for SNPs is Student's t-test testing null
hypothesis of equality of means between homozygotes.
Example 3
COMT Haplotypes Determine Sensitivity to Pain
[0342] It was next determined which combinations of alleles
(haplotypes) were formed by the 6 COMT SNPs. It has been shown that
alleles form associations (haploblocks) of variable length with the
average span of 18 kb in populations of European descent and only a
few common haplotypes are observed Gabriel et al. (2002). Three
haploblocks were determined in the study sample by linkage
disequilibrium (LD) analysis (Table 6). Because the association
with pain sensitivity was observed only for SNPs rs6269, rs4818,
located in the central COMT locus haploblock (see Table 5 and FIG.
6), analysis was focused on this haploblock.
TABLE-US-00007 TABLE 6 Linkaqe disequilibrium between paired SNP
markers Marker 1 Marker 2 R.sup.2 D' rs2097903 rs6269 0.05 0.35
rs4633 0.08 0.34 rs4818 0.03 0.28 rs4680 0.08 0.34 rs165599 0.00
0.00 rs6269 rs4633 0.59 0.99 rs4818 0.88 0.94 rs4680 0.59 1.00
rs165599 0.00 0.11 rs4633 rs4818 0.59 0.99 rs4680 0.91 0.96
rs165599 0.01 0.14 rs4818 rs4680 0.60 1.00 rs165599 0.00 0.04
Met/val rs165599 0.00 0.10
[0343] With reference to Table 6, data were analyzed for
significance using the PHASE 2.0 program. D' is the normalized
linkage disequilibrium statistic, which lies in the range from 0 to
1 with greater values indicating stronger linkage. Four SNPs,
rs6269, rs4633, rs4818 and rs4680 (val.sup.158met), which occur
within the coding region of the COMT gene, were found to exhibit
strong LDs. This means that these SNPs are forming one haploblock
within the COMT gene locus. In contrast, SNPs rs2097903, which is
located in the 5' promoter region, and rs165599, which is a 3' UTR
SNP, did not show strong LDs. These SNPs are within two haploblocks
adjusted to the first one.
[0344] Whether there are additional SNPs that modulate COMT
enzymatic activity is of importance. There are several dozen
identified SNPs within the COMT gene locus in the NCBI and CELERA
databases. Importantly, all of the known common SNPs located in the
central haploblock of the COMT gene were tested. There are several
common SNPs located in the 5' and 3' parts of the gene locus that
may influence COMT activity. These SNPs also form haploblocks but
the observation that the 5' SNP rs2097903 and 3' SNP rs165599 do
not significantly correlate with pain sensitivity (FIG. 10)
suggests that these regions are unlikely to contain other
frequently found SNPs that impact pain sensitivity.
[0345] Seven haplotypes with a frequency greater than 0.5% were
detected, three of them representing 95.9% of all haplotypes
observed in this study (FIG. 6C). Five combinations of these three
haplotypes were present in 92% of subjects and were associated with
marked gradients in pain responsiveness (FIG. 11). Subjects
homozygous for the G_C_G_G haplotype had the lowest pain
responsiveness (mean summed z-score=-5.23.+-.1.5; FIG. 11 and Table
1); thus, G_C_C_G is designated as the "low pain sensitivity" (LPS)
haplotype. Intermediate pain responsiveness was observed for
individuals homozygous for A_T_C_A, which we refer to as the
"average pain sensitivity" (APS) haplotype (mean summed
z-score=1.75.+-.1.47; FIG. 11 and Table 1). The greatest pain
responsiveness was observed for individuals heterozygous for
A_T_C_A (APS) and A_C_C_G haplotypes (mean summed
z-score=8.9.+-.2.9; FIG. 11 and Table 1). The A_C_C_G haplotype is
referred to herein as the "high pain sensitivity" (HPS) haplotype.
Differences among the five combinations of haplotypes were
significant (Table 5, overall ANOVA, P=0.0004) and factorial
analysis demonstrated that each haplotype had independent effects
on pain sensitivity (Table 2, factorial ANOVA model,
P.ltoreq.0.01). These haplotypes accounted for 10.4% of the
variation (P<0.01) in pain sensitivity, representing virtually
all of the variation (10.6%) explained by combinations of the four
individual SNPs in the central haploblock.
Example 4
COMT Haplotypes Determine Enzyme Activity
[0346] Functional polymorphism in the COMT gene has been described
only for SNP rs4680 (val.sup.158met) (Zubieta et al. (2003);
Mannisto et al. (1999); Lotta et al. (1995)), which codes for a
substitution of val to met. The met substitution produces a COMT
enzyme with lower thermostability, resulting in decreased enzyme
activity (Lotta et al. (1995).
[0347] While it appears that the val.sup.158met amino acid
substitution in COMT can explain the greater pain responsiveness
observed for individuals with the APS haplotype compared to the LPS
haplotype, because the APS haplotype codes for the less stable met
variant, it cannot explain the greater pain responsiveness found
and disclosed herein for subjects with the HPS haplotype compared
to the LPS haplotype. This is because both the HPS and LPS
haplotypes possess the G allele that codes for the more stable val
variant (FIG. 6C). Thus, the val.sup.158met SNP alone can not
account for the observed variations in pain perception.
Furthermore, even though polymorphism in SNPs rs6269 and rs4818 are
significantly associated with pain z-scores, both pain sensitive
haplotypes HPS and APS contain the A allele of rs6269 and the C
allele of rs4818. Consequently, variations in these SNPs can not
explain why the HPS and APS haplotypes are associated with
different levels of pain sensitivity. Instead, the interaction of
the val.sup.158met SNP with other SNPs determines the functional
outcomes. The other SNPs are either synonymous (i.e., code for the
same amino acid), or are located in the promoter region of S-COMT.
A haplotype-dependent regulation of mRNA expression is also
unlikely because SNP rs6269, which is located in the promoter
region of S-COMT, does not independently contribute to pain
sensitivity (Table 3). Therefore, haplotype-specific secondary
structures of mRNA can possibly affect COMT mRNA stability and/or
efficiency of protein translation (Duan et al. (2003)).
[0348] To test these possibilities, HEK 293 cells were transiently
transfected with full-length COMT cDNA clones that corresponded to
the three major haplotypes. The expression of COMT protein was
assessed by measuring COMT enzymatic activity in the lysate of
transfected cells. FIG. 12A shows that the LPS haplotype provides
4.8 times higher COMT activity compared to the APS haplotype
(P<0.01). However, the finding disclosed herein showing the HPS
haplotype provides 11.4 times lower COMT activity compared to LPS
(P<0.01) can be attributed to the lower amount of protein
produced by the HPS haplotype since these two haplotypes code for
COMT protein with exactly the same amino acid composition. No
differences in COMT RNA abundance were detected in the transfected
cells as measured by real-time PCR (FIG. 12B); therefore, the three
major haplotypes affect the efficiency of protein synthesis, but
not RNA stability.
Example 5
Inhibition of COMT Enhances Sensitivity to Noxious Stimuli
[0349] The Examples above strongly suggest that reductions in COMT
enzymatic activity enhances pain sensitivity. To directly test
whether decreased COMT activity enhances pain sensitivity, the COMT
inhibitor OR486 was administered to naive rats. OR486 decreased paw
withdrawal thresholds to mechanical and thermal stimuli
(P<0.0001 and P<0.0007, respectively) and increased paw
withdrawal frequency to noxious punctuate mechanical stimuli
(P<0.0001) (FIG. 13). The degree of mechanical and thermal
hyperalgesia produced by OR486 was comparable to that produced by
carrageenan-induced inflammation in the hindpaw.
Example 6
High Activity COMT Haplotype (LPS) Protects from Developing TMD
[0350] To determine the clinical relevance of these findings, the
inventors examined whether COMT polymorphism is related to the
incidence of TMD onset among 170 subjects with the five most common
haplotype combinations who completed one or more follow-up visits.
Fifty-eight of the participants had only "low COMT activity"
haplotypes (HPS and/or APS) and the remaining 112 subjects had at
least one "high activity" haplotype (LPS). It was first confirmed
that HPS and/or APS subjects were more sensitive to experimental
pain at their baseline assessment compared with LPS subjects
(P=0.02; FIG. 14A). During the three-year observational period, 15
new cases of TMD were diagnosed at varying time periods ranging
from nine months to three years after recruitment, yielding an
average incidence rate of 3.5 cases per 100 person-years of
follow-up. The incidence rate was more than twice as high among
individuals having only HPS and/or APS haplotypes (5.6 cases per
100 person-years) compared with individuals with at least one LPS
haplotype (2.5 cases per 100 person-years--FIG. 14B). The derived
incidence density ratio of 2.3 was significant (95% confidence
interval=1.1-4.8), suggesting that the HPS and/or APS haplotypes
represent significant risk factors for TMD onset.
Materials and Methods for Examples 7-12
Subject Recruitment
[0351] Data for these Examples were collected from 210 healthy
female Caucasian volunteers. Enrollees participated in a three-year
prospective cohort study that was designed to identify risk factors
for TMD onset. Only females were included in this study as they
exhibit a higher prevalence for the condition relative to males
(Carlsson et al. (1995)). Enrollees completed a baseline assessment
comprised of psychological questionnaires (described herein below),
resting arterial blood pressure assessment, and a clinical
examination of the head and neck. Subjects were subsequently
followed for up to three years, by both quarterly interviews and
annual physical examinations, to identify newly developed cases of
the somatosensory disorder TMD.
[0352] Psychological Questionnaires
[0353] Five psychological questionnaires, which assessed a broad
range of psychological characteristics, including affective
factors, perceived stress, and somatization/hypervigilance were
administered. The questionnaires do not provide diagnoses of any
psychiatric conditions, and endeavors to make such diagnoses were
not made. The Profile of Mood States-Bi-Polar (POMS-Bi) consists of
72 mood-related items assessing both positive and negative
affective dimensions (Lorr & McNair (1988)). The Brief Symptom
Inventory (BSI), a short form of the Symptom Checklist 90 Revised,
consists of 53 items designed to assess nine aspects of
psychological function (Derogatis (1983)). The State-Trait Anxiety
Inventory (STAI) contains 20 statements evaluating levels state and
trait anxiety (Spielberger et al. (1983)). The Perceived Stress
Scale (PSS) provides a global assessment of major sources of life
stress such as overall stress, financial stress, occupational
stress, significant other stress, parental stress, and stress
within friendships (Cohen et al. (1983)). The Beck Depression
Inventory (BDI) is a 21-item instrument that assesses both
cognitive/affective and vegetative signs of depression (Beck et al.
(1961)). The BDI has demonstrated adequate reliability and validity
and has been used widely in a variety of clinical populations,
including patients with chronic pain. Each of these instruments is
widely used in clinical research and has good psychometric
properties.
[0354] Blood Pressure Measurements
[0355] Resting systolic and diastolic blood pressures were assessed
on the right arm with an automatic blood pressure monitor. Five
measures obtained at 2 minute intervals after a 15 minute rest
period were averaged.
[0356] Genotyping
[0357] Genomic DNA was purified from 198 subjects using QIAAMP.TM.
96 DNA Blood Kit (Qiagen, Valencia, Calif., U.S.A.) and used for a
5' exonuclease assay as disclosed in Shi et al. (1999). The primer
and probes were used as described in Belfer et al. (2004).
Genotyping error rate was directly determined and was <0.005.
Genotype completion rate was 95%.
[0358] Searching of EST Database
[0359] Computer analysis of all SNP combinations in the human EST
database dbEST (release 030405, 6,053,112--human entries) was
performed using the BLAST program. The complete nucleotide sequence
of ADRB2 gene was analyzed (length--2015 nucleotides, accession
number--NM.sub.--000024). A combination of the C programming
language and the Bash shell scripting language was used to perform
the statistical analysis of the BLAST program output files. The
program produces a complete list of nucleotide variation (SNPs) and
their combinations for analyzed gene in the EST database as an
output file (*.csv) in Excel format. The inventors then restricted
out analysis of nucleotide variations to reported common SNPs with
the frequency >10%. Only hits with >95% of similarity to the
original sequence were considered. A Chi-test was used for
statistical analysis of ESTs distribution (Excel, Microsoft, Inc.,
Redmond, Wash., U.S.A.).
[0360] Statistical Analyses
[0361] Distributions of phenotype scores in the sample were
evaluated to assess normality. All examined variables appeared to
be approximately normal with the exception of the BDI, BSI
depression, and BSI somatization scores. The distribution of the
BDI variable was noticeably skewed, so a transformed version of
this variable was analyzed. Data were transformed using the
equation log (BDI+.lamda.). In accordance with the recommendations
by Box and Cox (Box & Cox (1964)), .lamda., was set at 1.53
because this value yielded the maximum profile likelihood for the
full linear model that contained all interactions between
haplotypes. Once this transformation had been made, the BDI
variable appeared to be approximately normal.
[0362] The distributions of the BSI variables were bimodal. For
both BSI variables, approximately one third of the individuals in
the study answered every question in the negative and hence
received a score of 30. The remaining individuals had scores that
seemed to be approximately normally distributed between the values
of 49 and 75. In order to analyze the BSI data, each of the BSI
variables were reduced to a binary form and recorded whether or not
each individual had a score above 30.
[0363] For all normally distributed variables (including the
transformed BDI scores) a one-way ANOVA was used to analyze the
dosage effects of each haplotype on the psychological variable. The
question addressed in these analyses was whether the mean trait
value varied significantly between individuals with 0, 1, or 2
copies of a given haplotype. In these analyses, the number of
copies of each haplotype was treated as a factor and a separate
analysis was performed for each haplotype. Our protocol was to
first perform the overall F-test for each haplotype-phenotype
combination, then, if the F-test was significant, we used Tukey's
Honestly Significant Difference post hoc test to determine which
pairs of haplotype dosages yielded significantly different mean
trait values. To adjust for the fact that each phenotype was tested
for the dosage of each of the three haplotypes, we also assessed
significance using Simes' test ((Simes (1986)).
[0364] An analogous analysis of the binary BSI variables was
performed using simple logistic regression. In this case, instead
of using an F-test to evaluate the fit of the model, we used a
likelihood ratio test. Pairwise differences between different
haplotype dosages were also investigated using likelihood ratio
tests, with significance assessed using a Bonferroni
correction.
[0365] In addition to looking at dosage effects, in which it was
examined how the number of copies of each haplotype contributed to
the trait value without reference to the identities of the other
haplotypes, also investigated was how the various haplotypes
interacted with each other. To assess, for example, the
relationship between haplotype H1 and each of the other haplotypes,
a linear model based on the number of copies of each haplotype an
individual carried was considered. t.sub.ij was defined to be the
number of copies of haplotype i possessed by individual j. So, for
example, if individual j was heterozygous with haplotypes H1 and
H2, we would have t.sub.1j=1, t.sub.2j=1, and t.sub.3j=0.
Similarly, if individual j was homozygous for haplotype H1, we
would have t.sub.1j=2, t.sub.2j=0, and t.sub.3j=0.
[0366] The linear model was parameterized as follows:
y.sub.j=.gamma..sub.1+.gamma..sub.2t.sub.2j+.gamma..sub.3t.sub.3j+.gamma-
..sub.12t.sub.1jt.sub.2j+.gamma..sub.13t.sub.1jt.sub.3j+.gamma..sub.23t.su-
b.2jt.sub.3j+.epsilon..sub.j, (1)
where, for the normal phenotypes, y.sub.j is the trait value for
individual j. For BDI depression, y.sub.j is the transformed trait
value log(BDIj+1.53). For the binary BSI variables, these analyses
were performed according to the analogous logistic model.
[0367] The mean trait values for each diplotype, using the
parameterization in Equation 1 are given in Table 7. Of note is
that haplotype H1 plays a different role in this parameterization
than the other two haplotypes. The mean trait value for H1/H1
individuals is given by a single parameter, .gamma..sub.1, which
serves as a baseline value in this parameterization of the model.
This parameterization was chosen because it permits interactions
(additivity, dominance, etc.) between H1 and the other haplotypes
to be easily tested (see below). A second aspect of this model is
that departures from additivity between the haplotypes are captured
in the interaction parameters .gamma..sub.12, .gamma..sub.13, and
.gamma..sub.23. When these are all zero, a strictly additive model
in which the mean heterozygous trait values fall exactly midway
between the mean homozygous trait values is achieved.
TABLE-US-00008 TABLE 7 Haplotypes interactions: Mean trait values
Diplotype Mean trait value H1/H1 .gamma..sub.1 H1/H2 .gamma..sub.1
+ .gamma..sub.2 + .gamma..sub.12 H1/H3 .gamma..sub.1 +
.gamma..sub.3 + .gamma..sub.13 H2/H2 .gamma..sub.1 + 2.gamma..sub.2
H2/H3 .gamma..sub.1 + .gamma..sub.2 + .gamma..sub.3 +
.gamma..sub.23 H3/H3 .gamma..sub.1 + 2.gamma..sub.3
[0368] It was assumed in the analyses that the default model should
be an additive model, so interactions were first tested for using
an F-test (likelihood ratio test for the BSI variables) in which
the fit of the full model given in Equation 1 was compared to the
additive model in which .gamma..sub.12, .gamma..sub.13, and
.gamma..sub.23 were constrained to be equal to zero. If this test
showed insufficient evidence for non-additivity, that is, if the
full model did not show a significantly better fit to the data than
the additive model, analysis was halted at this point.
[0369] For the variables that showed evidence of non-additivity,
the analyses continued. The Akaike Information Criterion (Akaike
(1974)) was used to find the best fitting model of the form shown
in Equation 1. The form of this "best-fit" model depended upon the
trait being examined, but generally looked like Equation 1 with one
or more of the y.sub.ij parameters set to zero.
[0370] Once the "best-fit" model had been obtained, the
relationship between those pairs of variables that had an
interaction term that was significantly different than zero was
investigated. The parameterization shown in Equation 1 is well
suited for this type of testing. For example, interactions between
haplotypes H1 and H2 are captured in the parameter .gamma..sub.12,
as can be seen by comparing the mean trait values for H1/H1, H1/H2,
and H2/H2 in Table 7. When .gamma..sub.12=0, the relationship
between H1 and H2 is additive. When .gamma..sub.12=-.gamma..sub.2,
H1 is dominant to H2. When .gamma..sub.12=.gamma..sub.2, H1 is
recessive to H2. Overdominance and underdominance occur when
|.gamma..sub.12|>|.gamma..sub.2|. Thus, with this
parameterization, relationships such as additivity, dominance,
recessiveness, and over/underdominance are hypotheses that can be
expressed in terms of the model's parameters and hence can be
easily tested. The relationship that was of particular interest was
that of over/underdominance and this type of relationship was
tested for using a likelihood ratio test in which the maximum
obtainable likelihood under the best-fit model was compared with
that under the constraint that
|.gamma..sub.12|.ltoreq.|.gamma..sub.2|.
[0371] Investigations of the relationship between haplotypes H1 and
H3 proceeded with this model analogously to the procedure for
testing relationships between H1 and H2. Interactions between H2
and H3 are less neatly summarized by the parameters in Equation 1.
For those comparisons, the model was reparameterized, exchanging
the roles of H1 and H2 so that H2/H2 individuals served as the
baseline.
[0372] In order to investigate the molecular mechanisms by which
the three ADRB2 haplotypes affect psychological and blood pressure,
omnibus statistical tests using analysis of variance (ANOVA) to
determine associations between ADRB2 haplotype variants and
phenotype scores (i.e., psychological scales and average blood
pressure measurements) were first conducted. There was more concern
for controlling Type II than Type I error. Therefore, follow-up
contrasts between specific haplotypes were conducted if the omnibus
test was significant at p.ltoreq.0.10.
[0373] TMD Incidence Cases
[0374] From the initial 202 enrolled subjects that were genotyped,
181 completed 3 years observation period and 15 of those developed
TMD. The incidence of how TMD in the study varied between
individuals with different diplotypes by calculating relative risks
was studied. Specifically, under the hypothesis that haplotype 1
(H1) coded for lower levels of RNA expression (see EST data
analysis in the Examples below) and that the other haplotypes (H2
and H3) coded for higher levels of expression, individuals were
grouped into three categories based on the number of low-expressing
haplotypes (0, 1, or 2 copies of H1) each subject possessed.
Because individuals with 1 copy of H1 showed the lowest level of
TMD incidence, relative risks of TMD for the other groups compared
to this group were computed. Since the sample sizes were small
compared to the TMD incidence levels, confidence intervals were
calculated for relative risks using Koopman's method (Koopman
(1984)).
Example 7
Analysis of Haplotypes of ADRB2
[0375] Genomic DNA from peripheral blood samples was genotyped for
SNPs within the ADRB2 gene locus. Eight SNPs were chosen that
display a high frequency of polymorphism in the human population
(>20% prevalence), and form one haploblock (Belfer et al.
(2004)). See FIG. 4. The first five examined SNPs (G-7127A,
rs11958940, rs1432622, rs1432623 and rs2400707) are located in the
promoter region of the gene. The next three SNPs (rs1042713,
rs1042714 and rs1042717) are located within the coding region for
gene. Variations Arg.sup.16Gly (rs1042713) and Gln.sup.27Glu
(rs1042714) are known nonsynonymous polymorphisms. SNP
Leu.sup.84Leu (rs1042714) is a synonymous polymorphism. The known
functional SNP Thr.sup.164Ile was also assessed, however none of
the examined subjects possessed the minor allele. The PHASE program
(Stephens et al. (2001); Stephens et al. (2003)) was used for
haplotypes reconstruction. Three major haplotypes were determined,
representing 97.4% of all haplotypes observed in this study (FIG.
4B). Only five subjects carried haplotypes that were different from
the three major ones. Each of these five haplotypes was different
from one of the major haplotypes at only one or two SNP positions
and was considered in subsequent analyses as one of the major
corresponding haplotypes.
Example 8
ADRB2 Polymorphism and Psychological Traits
[0376] Descriptive statistics for phenotype variables that differed
significantly in omnibus testing among haplotypes are presented in
FIG. 2. Subjects bearing two copies of haplotype 1 (H1) had higher
BDI depression scores than those who had only one copy of H1 (FIG.
2A). Consistent with this observation, H1 homozygotes displayed the
highest BDI depression score compared to the other diplotypes.
Subjects who were heterozygotes for H1 with either haplotype 2 (H2)
or haplotype 3 (H3) displayed the lowest BDI depression scores
(Table 8). Subjects bearing two copies of H2 had significantly
higher levels of somatization (both PILL and BSI scores) than
subjects possessing only one or no copies of H2 (FIG. 2B). H2
homozygotes displayed the highest somatization score among all
diplotypes (Table 8). H2 also had a significant effect on Trait
Anxiety: subjects with no H2 reported higher trait anxiety levels
than those bearing one copy of H2 (FIG. 2B). Consistent with this,
homozygotes for H1 and homozygotes for H3 had the highest trait
anxiety scores while H2 heterozygotes had the lowest scores (Table
8). H3 was strongly associated with mood (POMS agreeable-hostile
and composed-anxious; lower scores correspond to more negative
characteristics) and depression (BSI). H3 homozygotes had
significantly higher state-dependent anxiety (POMS
composed-anxious) and hostility (POMS agreeable-hostile) and lower
BSI depression scores (Table 8).
TABLE-US-00009 TABLE 8 Estimated means of psychological scores and
blood pressure by diplotypes haplotypeX Trait.sup.1 H1 H2 H3
haplotypeY Depression (BDI) 4.75(4.09-5.51) (n = 38)
3.01(2.58-3.48) (n = 50) 3.51(2.86-4.26) (n = 24) H1 (lower bound-
4.06(3.32-4.91) (n = 24) 3.17(2.63-3.79) (n = 32) H2 upper bound)
4.31(3.15-5.75) (n = 10) H3 Systolic blood 108.2 .+-. 1.26 (n = 38)
109.8 .+-. 1.08 (n = 51) 111.6 .+-. 1.55 (n = 25) H1 pressure (mm
Hg .+-. 106.2 .+-. 1.58 (n = 24) 104.9 .+-. 1.78 (n = 32) H2 SEM)
108.4 .+-. 2.45 (n = 10) H3 Diastolic blood 59.7 .+-. 1.03 (n = 38)
60.0 .+-. 0.89 (n = 51) 63.2 .+-. 1.27 (n = 25) H1 pressure (mm Hg
.+-. 56.7 .+-. 1.3 (n = 24) 58.1 .+-. 1.12 (n = 33) H2 SEM) 59.0
.+-. 2.01 (n = 10) H3 Somatization (pill) 104.9 .+-. 3.2 (n = 37)
103.1 .+-. 2.78 (n = 49) 103.8 .+-. 3.9 (n = 25) H1 (score .+-.
SEM) 116.7 .+-. 3.9 (n = 25) 101.7 .+-. 3.45 (n = 32) H2 102.7 .+-.
6.16 (n = 10) H3 Somatization (BSI) 57.9 (49.8-65.6) (n = 38) 68.0
(61.1-74.2) (n = 50) 76.0 (66.5-83.5) (n = 25) H1 (% (lower bound-
92.0 (84.6-96.0) (n = 25) 68.8 (60.0-76.3) (n = 32) H2 upper bound)
66.7 (47.7-80.2) (n = 9) H3 Trait anxiety (stai) 38.6 .+-. 1.37 (n
= 38) 34.9 .+-. 1.2 (n = 50) 36.2 .+-. 1.69 (n = 25) H1 (score .+-.
SEM) 37.4 .+-. 1.73 (n = 24) 34.0 .+-. 1.5 (n = 32) H2 37.9 .+-.
2.68 (n = 10) H3 POMS Agreeable- 30.6 .+-. 0.69 (n = 38) 30.8 .+-.
0.59 (n = 51) 31.8 .+-. 0.85 (n = 25) H1 hostile (score .+-. 30.6
.+-. 0.85 (n = 25) 31.2 .+-. 0.75 (n = 32) H2 SEM) 26.4 .+-. 1.34
(n = 10) H3 POMS composed- 28.6 .+-. 0.95 (n = 38) 29.2 .+-. 0.82
(n = 51) 29.0 .+-. 1.17 (n = 25) H1 anxious (score .+-. 28.4 .+-.
1.17 (n = 25) 28.8 .+-. 1.04 (n = 32) H2 SEM) 23.1 .+-. 1.86 (n =
10) H3 Depression (BSI) 76.3 (68.8-82.5) (n = 38) 72.0 (65.2-77.9)
(n = 50) 92.0 (84.6-96.0) (n = 25) H1 (% (lower bound- 83.3
(74.3-89.6) (n = 24) 68.8 (60.0-76.3) (n = 32) H2 upper bound) 40.0
(25.9-55.97) (n = 10) H3
[0377] Regarding Table 8, each value represents the estimated mean
of the variable with associated SEM for one of six diplotype groups
(combination of haplotype X and haplotype Y, where X and Y are H1
or H2 or H3). Greater positive values for BDI, PILL, BSI and Trait
Anxiety scores reflect more negative psychological characteristics.
The greater values for measures obtained from the POMS scale
reflect more positive psychological characteristics: agreeable or
composed. BDI, PILL, STAI and POMS scores were measured in relative
units, blood pressure was measured in mm of mercury (mm HG), BSI
depression and somatization are presented as the percent of
subjects that show the trait. The values in this table came from
one-way ANOVAs on the variables, with the exceptions of the BDI and
BSI variables. For the BDI variables we performed the ANOVA
analysis on a log-translated version of the variable and the
results were then translated back into the original units. For the
BSI variables, the results are displayed as a logistic
regression.
Example 9
Analysis of ADRB2 Polymorphism and Blood Pressure
[0378] An association of H1 with both resting systolic and
diastolic blood pressure and an effect of H2 on resting diastolic
blood pressure was found (FIG. 2A). Subjects who carried no copies
of H1 had significantly lower resting blood pressure than those who
had one copy (Table 8, FIG. 2A). Consistent with this observation,
subjects who carried two copies of H2 showed significantly lower
resting diastolic blood pressure than those who carried no H1
(Table 8; FIG. 2A). H1 heterozygotes, with either H2 or H3,
displayed the highest systolic and diastolic blood pressure, while
H2 homozygotes and H2/H3 heterozygotes had the lowest diastolic
blood pressure (Table 8). Thus, H1 heterozygotes showed a
significant overdominance: subjects with one copy of H1 had higher
systolic and diastolic blood pressure than subjects homozygous for
either haplotype (FIG. 2A and Table 8), while H2 showed codominant
relationships between gene dosage and diastolic blood pressure
(FIG. 2A).
Example 10
Haplotype Interactions
[0379] Table 9 summarizes findings from assessments of interactions
between haplotypes. For systolic blood pressure and diastolic blood
pressure, BSI depression, POMS agreeable-hostile, a comparison
between the additive model and the full model (which included all
possible interactions) indicated that the model with interactions
provided a better fit to the data. There was some indication that
this is also the case for somatization PILL (P=0.1042), and POMS
composed-anxious (P=0.1133).
[0380] Systolic and diastolic blood pressure variables had a
best-fit to the model that included significant interactions
between H1 and H2 and between H1 and H3. Further analyses did not
support the hypothesis that H1 and H2 showed over/underdominance
(P=0.341, P=0.862) for either of the blood pressure phenotypes.
However, the interaction between haplotypes H1 and H3 was
significant (P=0.0316) for diastolic blood pressure and tend to
support an overdominance effect for systolic blood measure
(P=0.082).
[0381] For BSI depression, the best-fit model included a
significant interaction between H1 and H3. A likelihood ratio test
for over/underdominance in the relationship between H1 and H3 gave
a p-value of 0.044, supporting an overdominant relationship. The
POMS agreeable-hostile variable had a best-fit that included
significant interactions between H1 and H2 and between H2 and H3.
Neither of these haplotype pairs showed evidence for
over/underdominance (P=0.250 and P=0.645, respectively).
TABLE-US-00010 TABLE 9 Haplotypes interactions: linear model
analysis Best-fit model Model Parameter Standard Pval Trait FMP*
FAP** Pval Parameter Estimate Error (H.sub.0: = 0) Pval**** Log
(Depression (BDI) + 1.53) 0.315 Systolic blood pressure 0.016 0.022
0.013 .gamma..sub.1 108.22 1.26 0 .gamma..sub.2 -1.39 0.960 0.150
.gamma..sub.3 -0.81 1.15 0.484 .gamma..sub.12 2.95 1.44 0.043 0.341
.gamma..sub.13 4.24 1.93 0.030 0.082 Diastolic blood pressure 0.012
0.066 0.005 .gamma..sub.1 59.73 1.027 0 .gamma..sub.2 -1.49 0.785
0.062 .gamma..sub.3 -0.28 0.943 0.768 .gamma..sub.12 1.71 1.18
0.151 0.862 .gamma..sub.13 3.75 1.58 0.019 0.032 Somatization
(PILL) 0.064 0.104 0.033 .gamma..sub.1 104.94 3.04 0 .gamma..sub.2
5.89 2.47 0.018 .gamma..sub.3 -1.13 3.20 0.725 .gamma..sub.12 -7.73
3.71 0.039 .gamma..sub.13 -8.046 4.66 0.087 Somatization (BSI)
logistic 0.065 0.196 Trait Anxiety (STAI) 0.213 Agreeable-hostile
(POMS) 0.030 0.012 0.015 .gamma..sub.1 30.65 0.620 0 .gamma..sub.2
0.049 0.539 0.928 .gamma..sub.3 -2.12 0.736 0.004 .gamma..sub.12
3.31 1.12 0.004 0.250 .gamma..sub.13 2.65 1.064 0.014 0.645
Composed-anxious (POMS) 0.100 0.113 0.064 .gamma..sub.1 28.83 0.860
0 .gamma..sub.2 -0.045 0.748 0.95259 .gamma..sub.3 -2.86 1.02
0.00562 .gamma..sub.12 3.076 1.55 0.0495 .gamma..sub.13 2.86 1.48
0.05429 Depression (BSI) logistic 0.032 0.016 0.054 .gamma..sub.1
-1.00 0.333 0.0028 .gamma..sub.2 -0.212 0.289 0.46354 .gamma..sub.3
0.582 0.292 0.0461 .gamma..sub.13 -2.029 0.802 0.01144 0.044 *full
model Pvalue **Pvalue for the full model vs additive model
comparison ***for testing over/underdominance
Example 11
ADRB2 Polymorphism and RNA Expression
[0382] Many published studies that have examined ADRB2 polymorphism
describe associations with the nonsynonymous Arg.sup.16Gly
(rs1042713) and Gln.sup.27Glu (rs1042714) SNPs. It has been
consistently observed that Arg.sup.16Gly polymorphism is associated
with agonist-induced internalization of the receptor (Small et al.
(2003)). Although several phenotypes have been associated with
Gln.sup.27Glu polymorphism, the functional effects of this SNP
remain unclear (Small et al. (2003)). Without being bound by
theory, it is hypothesized that since Gln.sup.27Glu polymorphism is
in strong linkage disequilibrium (LD) with SNPs in the promoter
region (rs11958940, rs14326222, rs14326223, rs2400707; FIG. 4), a
set of these SNPs may define the efficiency of RNA transcription.
The allelic combination of H1 in the promoter region of the gene
and Gln.sup.27Glu SNPs is opposite to the allelic combination
associated with H2 and H3 (haplotype AAAGG versus TGGAC for
rs11958940, rs14326222, rs14326223, and rs2400707, Gln.sup.27Glu,
respectively; FIG. 4). Based on the outcomes of the association
studies disclosed herein, and the known physiology of ADRB2, it is
possible that H1 codes for a lower efficiency of transcription
while H2 and H3 code for high efficiency of transcription.
[0383] In order to examine if there is a significant difference in
the expression of ADRB2 mRNA driven by allelic combinations at the
promoter region of three haplotypes, existing expressed sequence
tag (EST) databases were analysed. Since sequencing of each EST
clone is a random non-selective process and there are substantial
numbers of EST sequences in the NCBI EST database, the frequency of
gene-specific ESTs is correlated to the RNA expression level
(Bortoluzzi & Danieli (1999)). This approach has been used
previously to estimate the relative abundance of specific RNA
transcripts, as well as its tissue or stage-specific levels. It has
also been shown that the relative RNA expression values between
SAGE, EST and microarray databases are comparable (Comeron
(2004)).
[0384] The relative expression level of ADRB2 mRNAs were estimated
on the basis of the relative abundance of ESTs in a manner
described by Castilo-Davis and co-workers (2002). Each EST in
available EST libraries was assigned to one of the three identified
haplotypes based on their EST sequence (Table 10). If each
haplotype codes at similar transcription efficiencies, it is
expected that the haplotype-specific ESTs would appear in the
databases in proportion to the population haplotype frequencies,
whereas, if transcription efficiencies vary between the different
haplotypes, it is expected those haplotypes that produce more
transcript would be over-represented.
[0385] Fifty-three ADRB2 ESTs were found. Twenty-four of these had
a sequence in the 5' region of the gene that permitted the
identification of the corresponding haplotype. Five ESTs
corresponded to H1, 8 ESTs corresponded to H2, and 11 ESTs
corresponded to H3 haplotypes (Table 10). Haplotype-specific EST
frequencies were compared with the haplotypes frequencies in the
cohort (FIG. 4), as well as haplotype frequencies reported by
others (Belfer et al. (2004)). The distribution of EST frequencies
was statistically different from the distribution of haplotype
frequencies in both cohorts (.chi.2 analysis; P' s<0.05). After
normalization to haplotype frequencies, the amount of H2- and
H3-specific ESTs relative to H1 were 1.8 and 4.4 respectively
(Table 10), which supports the hypothesis that H1 codes for a lower
efficiency of transcription compared to H2 and H3.
TABLE-US-00011 TABLE 10 Relative EST abundance. ##STR00001## *Blast
search was performed using RefSeq sequence of ADRB2 NM_000024.3
**This number reflects the ratio between the amount of observed
EST's and the amount expected if expression levels were equal
between the three haplotypes.
Example 12
ADRB2 Haplotypes and Risk of TMD
[0386] The clinical significance of ADRB2 genetic variants was
determined by examining whether ADRB2 polymorphism is related to
the incidence of TMD onset. Genotypes associated with decreased
levels of somatization, depression, trait anxiety, and negative
mood or high blood pressure level, should be protective against TMD
development. Taken together, the preceding ANOVA analysis of
phenotypic associations, analysis of haplotypes interactions and
EST analysis of RNA expression provided the basis for grouping
subjects based on the level of ADRB2 expression. Based on this
model, subjects homozygous for H1 are predicted to have the lowest
ADRB2 function (low ADRB2 expression, "Lo"), while people with only
H2 and H3 (i.e., H2/H2, H2/H3 or H3/H3 haplotypes, high ADRB2
expression, "Hi") are predicted to have the highest ADRB2 function.
Subjects caring one copy of haplotype H1 (i.e. heterozygous for
H1-H2 or H1-H3, "Hi/Lo" group) display evidences for overdominance
effect of H1, when coupled with either H2 or H3 haplotypes, show
positive psychological characteristic, have higher resting blood
pressure, and are predicted to have the lowest TMD incidence.
[0387] Of 181 subjects followed for three years, 15 were diagnosed
with first-onset TMD at some point during follow-up, yielding an
overall incidence of 8.3%. TMD incidence was highest among the
25H2/H2 homozygotes (5/25=20% (0.200), Table 11). Although the
"Hi/Lo" reference group of H1 heterozygotes represented almost half
of the initially tested cohort (n=76) only one TMD case was
observed in this group, yielding a TMD incidence of 1.3%.
[0388] Compared with the reference group of "Hi/Lo" H1
heterozygotes, there was a significantly elevated risk of
developing TMD for "Lo" homozygotes (relative risk [RR]=8.0, 95%
confidence interval [CI]=2.0-67.9) and a significantly elevated
risk for the "Hi" homozygotes (RR=11.3, 95% CI=2.0-67.9). If the
"Lo/Lo" and "Hi/Hi" homozygotes were combined into one group, the
risk of TMD development was 9.02 higher in this group compared to
the reference "Hi/Lo" H1 heterozygotes group ([CI]=1.2-66.9). These
results confirmed the pattern of overdominance in genetic
influences on this clinical condition, with "Hi" homozygotes and
"Lo" homozygotes showing a significantly greater risk for TMD
development than the heterozygous groups.
TABLE-US-00012 TABLE 11 Relative risk of TMD development among
different ADRB2 diplotype groups Groups Group 95% 95% Haplotype TMD
TMD Estimated lower upper Combination Incidence Groups* Incidence
RR bound bound H1/H1 4/38 (0.105) Lo/Lo 4/38 8.0 1.2 52.2 (0.105)
H2/H2 5/25 (0.200) 10/67 11.3 2.0 67.9 H3/H3 1/10 (0.100) {close
oversize brace} Hi/Hi (0.149) H2/H3 4/32 (0.125) H1/H2 1/51 (0.020)
1/76 1 NA NA {close oversize brace} Hi/Lo H1/H3 0/25 (0.000)
(0.013) (reference) All subjects 15/181 (0.083) *H1 was considered
to code for low levels of RNA expression (Lo) and H2 and H3 to code
for high levels of RNA expression (Hi).
Materials and Methods for Example 13
Mechanical and Thermal Pain Testing
[0389] Rats were handled and habituated to the testing environment
2-3 days prior to establishing baseline responsiveness. On test
days, rats were placed in plexiglass cages positioned over an
elevated perforated stainless steel platform and habituated to the
environment for 15-20 minutes prior to testing. Paw withdrawal
threshold to punctuate mechanical stimulation was assessed using
the up-down method of Chaplan (Chaplan et al. (1994)). A series of
nine calibrated filaments (with bending forces of 0.40, 0.68, 1.1,
2.1, 3.4, 5.7, 8.4, 13.2, and 25.0 g; Stoelting) with approximately
equal logarithmic spacing between stimuli (Mean.+-.SEM:
0.232.+-.0.04 units) were presented to the hind paw in successive
order, whether ascending or descending. Filaments were positioned
in contact with the hindpaw for a duration of 3 seconds or until a
withdrawal response occurred. Testing was initiated with the middle
hair of the series (3.4 g). In the absence of a paw withdrawal
response, an incrementally stronger filament was presented and in
the event of a paw withdrawal, an incrementally weaker filament was
presented. After the initial response threshold was crossed, this
procedure was repeated in order to obtain a total of six responses
in the immediate vicinity of the threshold. The pattern of
withdrawals (X) and absence of withdrawals (O) was noted together
with the terminal filament used in the series of six responses. The
50% g threshold=(10.sup.[Xf+k.delta.])/10,000, where X.sub.f=value
(in log units) of the final von Frey hair used; k=tabular value of
pattern of positive (X) and negative (O) responses, and
.delta.=mean difference (in log units) between stimuli.
[0390] Immediately following determination of the response
threshold, paw withdrawal frequency (%) to punctuate mechanical
stimulation was assessed. A von Frey monofilament with a calibrated
bending force of 25 g was presented to the hind paw ten times for a
duration of 1 s with an interstimulus interval of approximately 1
second. Mechanical hyperalgesia was defined as an increase in the
percentage frequency ([# of paw withdrawals/10].times.100) of paw
withdrawal evoked by stimulation with von Frey monofilaments.
Responsiveness to von Frey filaments was reassessed at 30 min
intervals for 2 h post-OR486.
[0391] Thermal hyperalgesia was evaluated using the radiant heat
method (Hargreaves et al. (1988)) in the same animals evaluated for
responsiveness to von Frey monofilaments. Radiant heat was
presented through the floor of the stainless steel platform to the
midplantar region of the hind paw. Stimulation was terminated upon
paw withdrawal or after 20 seconds if the rat failed to withdraw
from the stimulus. Paw withdrawal latencies to the thermal stimulus
were recorded prior to experimental manipulations and reassessed in
triplicate at 2.25 hours following OR486.
[0392] In Vitro Cytokine Measurement
[0393] Cell Maintenance: Cell growth media consisted of Dulbecco's
modified Eagle's medium supplemented with 10% heat-inactivated
fetal bovine serum (Sigma, St. Louis, Mo., U.S.A.) and 1.times.
penicillin-streptomycin (Gibco, Carlsbad, Calif., U.S.A.). Cells
were maintained in a humidified atmosphere of 95% air and 5%
CO.sub.2.
[0394] Differentiation of 3T3-L1: Two days after reaching
confluence in growth media, adipogenesis was induced by incubating
cells in growth media containing 0.25 .mu.M dexamethasone (Sigma),
0.5 mM IBMX (Sigma), and 1 .mu.M insulin (Sigma). After an
additional 2 days in growth media containing 1 .mu.M insulin, cells
were grown for 6-8 days in normal growth media.
[0395] RNA extraction and cDNA Synthesis: Total RNA was isolated
using the RNeasy Mini Kit (Qiagen, Valencia, Calif., U.S.A.). RNA
was then treated with 2 units of DNase I (Ambion, Austin, Tex.,
U.S.A.) at 37.degree. C. for 30 min. Reverse transcription was
performed according to the manufacturer's instructions. Briefly,
the reverse transcription reaction mixture consisted of 1 .mu.g
DNase I-treated RNA, 500 ng oligo-dT.sub.12-18, 10 mM dNTP, 40
units RNasin (Promega, Madison, Wis., U.S.A.), and 200 units of
reverse transcriptase SUPERSCRIPT III.TM. (Invitrogen, Carlsbad,
Calif., U.S.A.). cDNA synthesis was carried out at 50.degree. C.
for 1 hr followed by inactivation of reverse transcriptase at
70.degree. C. for 15 min.
[0396] Subjects
[0397] Two-hundred and twenty-eight adult male Sprague-Dawley rats
(250-320 g; Charles River Laboratories, Raleigh, N.C., USA) were
used in these experiments. All procedures were approved by the
University of North Carolina Animal Care and Use Committee.
[0398] Drugs and Chemicals
[0399] In Vivo: OR486 and RO41-0960 were dissolved in
dimethylsulfoxide (DMSO) and diluted in 0.9% saline pH 7.5 (3:2).
Phentolamine, propranolol, SCH23390, and spiperone were dissolved
in ethanol and diluted in 0.9% saline pH 3.5 (1:4). Betaxolol,
ICI118,551, and SR59230A were dissolved in DMSO and diluted in 0.9%
saline (1:4). Lambda carrageenan (3%) was dissolved in 0.9% saline
and administered in a volume of 100 .mu.l. In Vitro: Betaxolol,
ICI118,551, SR59230A, salmeterol, and CL316243 were dissolved in
water. OR486, RO41-0960, phentolamine, propranolol, and carrageenan
were obtained from Sigma Aldrich (St. Louis, Mo., U.S.A.), while
SCH23390, betaxolol, ICI118,551, SR59230A, salmeterol, and CL316243
were purchased from Tocris (Ellisville, Mo., U.S.A.).
[0400] Mechanical and Thermal Pain Behavior Testing
[0401] 50% paw withdrawal threshold to punctuate mechanical
stimulation was assessed using the method of limits. Immediately
following determination of the response threshold, paw withdrawal
frequency (%) to punctuate mechanical stimulation was assessed.
Responsiveness to von Frey filaments was measured prior to
experimental manipulations and reassessed at 30 minute intervals
for 2 hours following administration of a COMT inhibitor or
vehicle. Thermal hyperalgesia was evaluated using the radiant heat
method in the same animals evaluated for responsiveness to von Frey
monofilaments. Paw withdrawal latencies to the thermal stimulus
were recorded prior to experimental manipulations and reassessed in
triplicate at 2.25 hours following OR486. A further description is
described herein below.
[0402] In Vivo Plasma Cytokine Measurement
[0403] Upon termination of behavioral experiments, rats were
euthanized and blood drawn from the inferior vena cava into
heparinized syringes. Blood was centrifuged and plasma separated
from red blood cells. Plasma IL-6 was measured in duplicate using
enzyme-linked immunosorbant assay (ELISA) kits from R&D systems
(Minneapolis, Minn., U.S.A.). Plasma TNF.alpha. and IL-1.beta. were
measured in duplicate by the University of North Carolina
Proteomics/Immunotechnologies Core using ELISA kits from Biosource
(Camarillo, Calif., U.S.A.) and the National Institute for
Biological Standards and Control (UK), respectively.
[0404] In Vitro Cytokine Measurement
[0405] Mouse macrophages (RAW 264.7) and human preadipocytes
(3T3-L1) were obtained from the University of North Carolina Tissue
Culture Facility. Cell maintenance and 3T3-L1 preadipocyte
differentiation is described herein below. For pharmacological
experiments, cells were seeded at a density of 5.times.10.sup.5
cells/well in a 12-well plate (Corning). Total RNA was isolated and
reverse transcribed as described in the supplementary materials.
TNF.alpha., IL-1.beta., and IL-6 transcripts were quantitated in
quadruplicate by real time polymerase chain reaction using
TAQMAN.RTM. Gene Expression Assays (Applied Biosystems, Foster
City, Calif., U.S.A.) in an ABI PRISM 7000 Sequence Detection
System. TNF.alpha., IL-1.beta., and IL-6 transcript levels were
normalized to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH).
[0406] Statistical Analysis
[0407] When comparing more than two groups, mechanical behavioral
data were analyzed by analysis of variance (ANOVA) for repeated
measures, while thermal behavioral data and cytokine data were
analyzed by ANOVA. Post hoc comparisons were performed using the
Bonferroni's test. When comparing two groups, behavioral and
cytokine data were analyzed by paired and unpaired t-tests,
respectively. P.ltoreq.0.05 was considered to be statistically
significant.
Example 13
COMT Modulation of Pain Sensitivity and Cytokine Production Via
ADRB2 and ADRB3 Adrenergic Mechanisms
[0408] The purpose of the present Example was to determine the
mechanisms whereby elevated catecholamine levels, resulting from
low COMT activity, lead to increased pain sensitivity. In order to
evaluate the degree of pain sensitivity produced by depressed
levels of COMT, the COMT inhibitor OR486 was administered to rats
and its effects on pain behavior were compared to those produced in
the carrageenan model of inflammation. OR486 administration
significantly decreased paw withdrawal threshold to mechanical
stimuli (FIG. 15a) and increased paw withdrawal frequency to a
noxious punctuate stimuli (FIG. 15b). OR486 administration also
decreased paw withdrawal latency to thermal stimuli (FIG. 15c). The
degree of mechanical and thermal hyperalgesia produced by OR486 was
remarkable as it was comparable to that produced by
carrageenan-induced inflammation of the hindpaw (see FIG. 16 for
comparisons in contralateral non-injected paws). Levels of the
prototypical proinflammatory and pro-pain cytokines TNF.alpha.,
IL-1.beta., and IL-6 (Cunha, et al. (2005); Kress, et al. (2004))
were evaluated in animals receiving OR486 or carrageenan. Similar
to carrageenan, administration of OR486 elevated plasma levels of
TNF.alpha., IL-1.beta., and IL-6 (FIG. 15d-f). To verify that the
effects of OR486 on the development of enhanced pain sensitivity
and cytokine production were specific to COMT inhibition, a second
COMT inhibitor with a different chemical structure was employed.
Similar to OR486, administration of the COMT inhibitor RO41-0960
decreased mechanical and thermal pain sensitivity (FIG. 15g-i) and
increased cytokine production (FIG. 17), suggesting that pain
sensitivity is COMT-dependent.
[0409] COMT acts peripherally and centrally to metabolize
epinephrine, norepinephrine, and dopamine. Thus, pharmacological
methods were used to establish which receptor class mediates the
COMT-dependent increases in pain behavior and cytokine production.
OR486-induced hyperalgesia was completely blocked by the
.beta.-adrenergic antagonist propranolol, which normalized paw
withdrawal threshold (FIG. 18a) and paw withdrawal frequency (FIG.
18b) to mechanical stimuli and paw withdrawal latency to thermal
stimuli (FIG. 18c). Propranolol also normalized plasma levels of
TNF.alpha., IL-1.beta., and IL-6 (FIG. 18d-f). The
.alpha.-adrenergic antagonist phentolamine, the D1-like
dopaminergic antagonist SCH23390, and the D2-like dopaminergic
antagonist spiperone failed to block the hyperalgesic effects of
OR486. Antagonists administered in the absence of OR486 did not
alter pain sensitivity (FIG. 19).
[0410] Propranolol is a nonselective ADRB antagonist. Doses similar
to that used in the present Example block activity of ADRB1s and
ADRB2s (O'Donnell et al. (1994)) and reduce the activity of ADRB3s
(Tsujii et al. (1998)). Thus additional studies were conducted in
order to identify the ADRB subtype(s) that mediate the development
of OR486-induced elevations in pain sensitivity and cytokine
production. Administration of the ADRB2 antagonist ICI118,551 or
the ADRB3 antagonist SR59230A, but not the ADRB1 antagonist
betaxolol, partially blocked the heightened pain sensitivity
produced by OR486 in a dose-dependent fashion (FIG. 20). Selective
ADRB antagonists administered in the absence of OR486 did not alter
pain sensitivity (FIG. 21). ADRB2 and ADRB3 antagonists also
blocked the development of the OR486-induced increase in plasma
levels of TNF.alpha., IL-1.beta., and IL-6 (FIG. 20g-l).
[0411] Administration of ADRB2 or ADRB3 antagonists reduced the
development of increased pain sensitivity and cytokine production
produced by COMT inhibition; however, only a partial blockade of
OR486-induced mechanical pain sensitivity was achieved. These
results suggest that the combined activation of ADRB2s and ADRB3s
can produce the maximum degree of COMT-dependent pain sensitivity.
To test this hypothesis, ICI118,551 and SR59230A were administered
together prior to administration of OR486. Coadministration of
ADRB2 and ADRB3 antagonists completely normalized paw withdrawal
threshold (FIG. 22a) and paw withdrawal frequency (FIG. 22b) to
mechanical stimuli and paw withdrawal latency to thermal stimuli
(FIG. 22c). Additionally, coadministration of ICI118,551 and
SR59230A prior to OR486 decreased plasma levels of TNF.alpha.,
IL-1.beta., and IL-6 (FIG. 22d-f) relative to animals receiving
vehicle prior to OR486. Thus, COMT-dependent pain sensitivity is
mediated exclusively through coincident ADRB2 and ADRB3 adrenergic
signaling processes.
[0412] The blockade of COMT-dependent increases in TNF.alpha.,
IL-1.beta., and IL-6 by .beta..sub.2/3AR antagonists further
suggests that proinflammatory cytokine production is regulated by
ADRB2s and ADRB3s. To determine if proinflammatory cytokine
production results from the direct stimulation of
.beta..sub.2/3ARs, a series of in vitro cell culture studies was
performed.
[0413] Macrophages, rich in ADRB2s, and adipocytes, rich in ADRB2s
and ADRB3s, were chosen as they are the primary producers of
TNF.alpha. and IL-1.beta. (Kiefer et al. (2001)) and TNF.alpha. and
IL-6 (Coppack, S. W. (2001)), respectively. Activation of ADRB2s on
macrophages and ADRB3s on adipocytes has been shown to increase
cAMP production (Liggett, et al. (1989), Strosberg, A. D. (1997))
and cAMP-dependent IL-6 transcription (Elenkov et al. (2000), Zhang
et al. (1988)). A functional cAMP response element has been mapped
within the promoter region of TNF.alpha. (Roach et al. (2005)) and
IL-1.beta. (Chandra et al. (1995)), however there is no direct
evidence, to date, that activation of ADRB2s and ADRB3s stimulates
TNF.alpha. or IL-1.beta. transcription. Non-primed macrophage-like
cells line RAW 264.7 and 3T3-L1 adipoctyes were treated with ADRB2
or ADRB3 agonists and cytokine mRNA level was measured. The
dose-response curves were established first and drug doses within
one log unit of the ED50 or ID50 were selected. In macrophages,
stimulation of ADRB2s by the specific ADRB2 agonist salmeterol
produced a 38-fold increase in IL-1.beta. (FIG. 23a) and a 6.5-fold
increase in IL-6 (FIG. 23b) mRNA levels. In adipocytes, stimulation
of ADRB2s by salmeterol produced a 6-fold increase in TNF.alpha.
(FIG. 23c) and an 8-fold increase in IL-6 (FIG. 23d) mRNA levels.
The salmeterol-induced increase in macrophage IL-1.beta. and IL-6
transcript levels and adipocyte TNF.alpha. and IL-6 transcript
levels was completely blocked by ICI118, 551, but not by betaxolol
or SR59230A. Stimulation of ADRB3s in adipocytes by the specific
ADRB3 agonist CL316243 produced a 28-fold increase in IL-6 mRNA
levels (FIG. 23e) that was completely blocked by SR59230A, but not
by betaxolol or ICI118,551. Remarkably, for the high doses of
agonists the stimulation of transcription of IL-1.beta. on
macrophages and IL-6 on adipocytes reached 150 fold. The immediate
(45 minute) response produced by ADRB2 and ADRB3 activation
suggests direct stimulation of cytokine transcription occurs.
Treatment of cells with antagonists alone failed to produce
meaningful changes in cytokine mRNA level (FIG. 24). These findings
are in line with the view that activation of ADRB2s and ADRB3s
located on adipocytes as well as ADRB2s located on macrophages
increases the production of proinflammatory cytokines, which
enhance pain sensitivity (Cunha et al. (2005); Kress et al.
(2004)). Together, these data provide evidence that COMT inhibition
can result in proinflammatory cytokine production and increased
pain sensitivity comparable to that produced by carrageenan, via
ADRB2 and ADRB3 adrenergic mechanisms.
[0414] Previous studies have shown that activation of ADRB2s
located on nociceptors increases pain sensitivity via protein
kinase A-, protein kinase C-, or mitogen activated kinase-dependent
pathways (Khasar et al. (1999); Aley et al. (2001)). Norepinephrine
and epinephrine can also modulate pain through the activation of
ADRBs located on immune cells (Elenkov et al. (2000)) and other
cells (e.g., adipocytes) that release proinflammatory cytokines.
Elevated levels of TNF.alpha., IL-1.beta., and IL-6 are associated
with increased pain behavior in animal models (Cunha et al. (2005);
Kress et al. (2004)) and painful inflammatory and musculoskeletal
disorders in humans (Kress et al. (2004)). Proinflammatory
cytokines can modulate pain via direct receptor-mediated actions or
through the recruitment of additional mediators (Sommer et al.
(2004)). IL-1.beta. and IL-6 can act directly on sensory neurons to
produce mechanical and thermal hyperalgesia via a PKC-dependent
mechanism. Additionally, IL-6 can elicit the release of CGRP from
nociceptors. TNF.alpha. can act directly or through p38 MAPK to
sensitize nociceptors.
[0415] Cytokines are able to induce their own production and that
of other cytokines. For example, TNF.alpha. and IL-1.beta. activate
NF-kB, which in turn stimulates the transcription of TNF.alpha.,
IL-1.beta., and IL-6 (Kress et al. (2004)). This cascade ultimately
results in norepinephrine and epinephrine release from sympathetic
efferents. Thus, a great deal of redundancy exists in the cytokine
network as it relates to adrenergic signaling. A cycle forms, in
which the production and release of catecholamines and cytokines is
potentiated.
[0416] Disclosed herein is the first demonstration that ADRB2 and
ADBR3 activation stimulates TNF.alpha. and IL-1.beta. production as
well as that of IL-6. Moreover, this is the first study to depict a
critical role for ADRB3s and adipocytes in pain transmission. Until
now, ADRB3s, which are expressed primarily on adipocytes, have
almost exclusively been implicated in energy exchange and lipid
metabolism (Strosberg, A. D. (1997)).
[0417] The present results suggest that in noninflammatory pain
states, activation of ADRB2s stimulates proinflammatory cytokine
production via a cAMP-dependent mechanism. These findings are in
contrast to those of previous studies showing that ADRB2s have
anti-inflammatory actions in models of inflammation by inhibiting
NF-kB-dependent transcription of proinflammatory cytokines (Elenkov
et al. (2000)). Thus, ADRB2s may play a different role in
noninflammatory versus inflammatory pain states. Furthermore, the
present results suggest that the same set of cytokines modulate
pain evoked in the absence and the presence of peripheral
inflammation, likely through different transduction mechanisms.
Thus, different therapeutic interventions may be required for pain
occurring in the absence versus the presence of inflammation.
Specifically, persistent pain conditions or somatosensory
disorders, which are frequently associated with enhanced pain
sensitivity in the absence of other signs of inflammation (e.g.
idiopathic pain conditions, TMD, fibromyalgia syndrome, myofascial
pain conditions, chronic pelvic pain, and irritable bowel
syndrome), can be treated with novel pharmacological agents that
block the function of ADRB2s and ADRB3s.
[0418] Further elucidating the factors that impact pain sensitivity
will advance understanding of the mechanisms that underlie
persistent pain states and somatosensory disorders. This will
promote the development of novel pharmacotherapies and behavioral
therapies. As disclosed herein above, the presently disclosed
subject matter identifies polymorphisms in the COMT gene that are
associated with low COMT enzymatic activity and somatosensory
disorders and elucidates the mechanism whereby low levels of COMT
lead to exacerbated pain states, which can lead to one or more
somatosensory disorders. Elevated levels of norepinephrine and
epinephrine, resulting from depressed COMT activity, activate
ADBR2s and ADBR3s to produce proinflammatory cytokine production
and heightened pain sensitivity (FIG. 8????). Combined application
of antagonists for ADRB2s and ADRB3s, should alleviate selective
clinical pain states and somatosensory disorders by reducing
catecholamine activity and the subsequent release of cytokines that
sensitize nociceptors. Taken together, these results indicate that
.beta..sub.2/3 antagonist therapy can benefit patients suffering
from somatosensory disorders resulting from low COMT activity
and/or elevated catecholamine levels. These findings also suggest
that therapies targeted towards activation of COMT will also
benefit patients suffering from somatosensory disorders associated
with low COMT activity.
Example 14
Effects of ADRB3 Polymorphism on Pain Perception
[0419] Common Haplotypes of ADRB3
[0420] Genomic DNA from peripheral blood samples of 210 healthy
female Caucasian volunteers was genotyped for SNPs within the ADRB3
gene locus. Nine SNPs were chosen that were evenly spaced among the
locus and potentially form one haploblock (Belfer et al. (2004))
(FIG. 7). The first two examined SNPs (rs13258937 and rs802162) are
located in the promoter region of the gene. The next two SNPs
(rs4993 and rs4994) are located within the first exon: rs4993 is in
the 5' untranslated region (UTR) and rs4994 is in the coding
region. SNP rs4994 codes for the nonsynonomous change Trp64Arg. The
next two SNPs (rs4997 and rs2071493) are located in the intron of
the gene. SNPs rs4998 and rs4999 are in the 3'UTR of the gene and
rs9694197 is the 3' intragenec region. The first three examined
SNPs (rs13258937, rs802162 and rs4993) were found to be monomorphic
in the study population and were not considered in further
analyses. The minor allele of SNP rs4999 also displayed low
frequency. Only 6 subjects carried one copy of this minor allele,
and thus this SNP was not included in further analyses. The PHASE
program (Stephens et al. (2001); Stephens & Donnelly (2003))
was used for haplotype reconstruction from the remaining five SNPs
that were present in the test population with a frequency of at
least 10% for the minor allele. Three major haplotypes were found,
representing 97.3% of all haplotypes observed in this study (FIG.
7) and one haplotype was found to be the most abundant in the
population with a frequency of 78.5%. Only 10 subjects carried at
least one haplotype that was different from the three major
ones.
[0421] ADRB3 Polymorphism and Pain Responsiveness
[0422] Based on the animal experiments results disclosed in the
Examples herein above, it was hypothesized that ADRB3 genotypes are
also associated with individual variations in pain sensitivity,
risk of development of somatosensory disorders, and are predictive
of the responsiveness or efficacy of pharmacological treatments for
pain conditions. It is further hypothesized that there is
interaction between specific COMT and ADRB3 genotypes and
identification of both COMT and ADRB3 genotypes can be a better
predictor of pain states than that predicted by assessing either
COMT or ADRB3 genotypes alone. The association between pain
responsiveness and ADRB3 genotypes, as well as pain responsiveness
and COMT and ADRB2 genotypes combined were further studied.
TABLE-US-00013 TABLE 12 Summed z-scores for Caucasian subjects with
COMT-ADRB3 combinations comt_diplotype HPS/APS LPS All gdssumz
gdssumz gdssumz ADRB3_diplotype N Mean Std N Mean Std N Mean Std
H1/H1 38 4.9 (09.0) 72 -0.8 (08.0) 110 1.1 (08.7) H1/H2 14 -2.1
(09.9) 19 -2.6 (07.9) 33 -2.4 (08.7) H1/H3 5 4.5 (11.1) 11 -3.5
(08.5) 16 -1.0 (09.7) H2/H2 1 1.2 -- 5 -5.4 (11.9) 6 -4.3 (11.0)
Other 2 3.7 (15.6) 5 -5.5 (11.9) 7 -2.9 (12.5) All 60 3.1 (09.7)
112 -1.8 (08.4) 172 -0.1 (09.1)
[0423] Table 12 presents the summed z-scores for Caucasian subjects
grouped according to COMT haplotypes and all possible ADRB3
diplotypes. Data include the number of subjects, mean and standard
deviation of the summed z-score, which aggregates responses from 16
experimental pain procedures (for details see Material and Methods
disclosed in the Examples herein above). Higher mean z-scores
denote individuals who show relatively greater pain responsiveness
(i.e., greater sensitivity), while lower mean z-score denote
individuals who show relatively lower pain responsiveness (i.e.
less sensitivity). In Table 12, diplotypes of COMT have been
dichotomized to contrast subjects with only HPS/APS haplotypes
(labeled HPS/APS group) versus subjects with at least one LPS
haplotypes (labeled LPS group). COMT haplotypes are based on four
SNPs: rs6269 rs4633 rs4818 rs4680. Subjects with COMT haplotypes
other than HPS, APS or LPS are excluded from the table.
[0424] The results demonstrate generally independent effects of
COMT and ADRB3 haplotypes. Specifically, the two less frequent
genetic variants of ADRB3 both were associated with relatively
lower responsiveness to experimental pain (mean z-scores =-2.4 for
H1/H2 and -1.0 for H1/H3) compared to the more frequent variant of
ADRB3. The observed effects of COMT haplotype groups (HPS/APS vs
LPS) are consistent across each ADRB3 haplotype, with higher levels
of pain responsiveness observed for the HPS/APS groups compared to
the LPS groups. These results suggest that COMT and ADRB3
haplotypes exerted independent effects on pain responsiveness, with
an apparent dominant effect of the H2 haplotype of ADRB3 when
coupled with H1.
TABLE-US-00014 TABLE 13 Summed z-scores for Caucasian subjects with
aggregated COMT-ADRB3 combinations COMT Haplotype Groups HPS/APS
LPS All Pain z-score Pain z-score Pain z-score ABRB3_diplotype N
Mean Std N Mean Std N Mean Std H1/H1 38 4.9 (09.0) 72 -0.8 (08.0)
110 1.1 (08.7) H1/H2 or H2/H2 15 -1.9 (09.6) 24 -3.2 (08.7) 39 -2.7
(08.9) H1/H3 5 4.5 (11.1) 11 -3.5 (08.5) 16 -1.0 (09.7) All 58 3.1
(09.6) 107 -1.6 (08.2) 165 0.0 (09.0)
[0425] The results shown in Table 12 were further evaluated by
regrouping to produce three categories of ADRB3 diplotypes, as
shown in Table 13. This regrouping excluded the rare diplotypes,
which occurred in only one or two subjects. Statistical evaluation
was undertaken using a factorial least squares regression model, in
which the summed z-score was the dependent variable. COMT diplotype
(1 degree of freedom) formed one first-order independent variable,
and ADRB3 haplotype (2 degrees of freedom) formed the other
first-order independent variable. An interaction (2 degrees of
freedom) was also included. The overall model was statistically
significant (F(5,159)=3.9, P=0.0021). There was a statistically
significant effect for COMT haplotype group, F(1,59)=11.2, P=0.001
and ADRB3 haplotype groups F(2,159)=3.15, P=0.046. The interaction
term was not statistically significant [F(2,159)=1.1, P=0.33]
demonstrating that the effects of each diplotype were independent.
Importantly, pain responsiveness of the subjects carrying H1/H2
diplotype was low in both LPS and APS/HPS COMT groups.
[0426] These data demonstrate that predictions of treatment
responses to chronic pain states based on ADRB3 genotype can be
made. For example, subjects carrying H2 or H3 ADRB3 haplotypes will
be poor responders to therapies that block or reduce ADRB3
function, especially when they also carry high COMT activity
diplotypes (e.g., LPS group).
[0427] ADRB3 Polymorphism and Somatization
[0428] Somatization, which is a measure of one's ability to
perceive bodily sensations, is elevated and highly associated with
several somatosensory disorders. As shown in FIG. 5, a derived
measure of somatization (PILL somatization score; see Diatchenko et
al. (2005) and Examples herein above) is statistically associated
with ADRB3 diplotypes. Subjects bearing an H3 haplotype have a
lower PILL somatization score than those who do not carry an H3
allele (FIG. 5). Consistent with this observation, H1/H3
heterozygous also have low pain responsiveness (Table 12).
[0429] ADRB3 Polymorphism and Risk of TMD Onset
[0430] Based on the determined association analysis of ADRB3
haplotypes with pain responsiveness and somatization score, it is
evident that subjects bearing H2 or H3 haplotypes of ADRB3 can be
predicted to have lower risk for developing somatosensory
disorders, including TMD.
TABLE-US-00015 TABLE 14 Cumulative incidence of TMD among ADRB3
diplotype groups for Caucasians tmdcase(TMD case status] Cases n
Non case n % % Total H1/H1 9 87 96 9.38 90.63 H1/H2 or H2/H2 2 35
37 5.41 94.59 H1/H3 1 14 15 6.67 93.33 Other 3 6 9 3.33 66.67 Total
15 142 157
[0431] Table 14 presents the number and percentage of subjects who,
during a three-years prospective cohort study (for details see
Examples herein above and Diatchenko et al. (2005)) were diagnosed
clinically with temporomandibular disorder (TMD). Subjects are
classified according to their ADRB3 diplotype and subjects who
developed TMD during the 3-year observational period were labeled
as `cases`. Among the 96 subjects who had the most prevalent H1/H1
diplotype, 9 became cases, with a 3-year cumulative incidence of
9.38%. Incidence was lowest for H1/H2 and H1/H3 subjects (5.41% and
6.67%, respectively). The 9 subjects with other, infrequent (also
referred to herein as "Uncommon" haplotypes/diplotypes), diplotypes
of ADRB3 had a strikingly high incidence rate of 33.33%. These data
are consistent with the results shown in Tables 12 and 13 and
suggest that H1/H2 or H2/H2 subjects (who have the lowest pain
sensitivity in Table 12) and H1/H3 subjects (who have low pain
sensitivity in Table 12 and the lowest somatization scores in FIG.
5) have a very low risk of developing a somatosensory disorder.
Example 15
Uncommon Haplotypes of ADRB2 and ADRB3 and Risk of TMD
Development
[0432] The genomic structure of adrenergic receptors ADRB2 and
ADRB3 has several striking features. These are rather short genes,
each comprising less than 5 kb on genomic DNA, however, the density
of SNPs common in the human population is higher than one for each
1 kb. Furthermore, in spite of the high density of common SNPs
there are only three common haplotypes (H1, H2, H3) that can be
reconstructed for each gene. Among 212 Caucasian subjects in the
tested cohort (see Examples herein above), only 5 subjects carried
one ADRB2 haplotype that was one or two SNPs different from one of
the three common haplotypes for ADRB2, and only 10 subjects carried
at least one ADRB3 haplotype that was one SNP different from one of
three common haplotypes for ADRB3. It is hypothesized that allelic
combinations in adrenergic receptors have gone through evolutionary
selection, resulting in haplotypes that possess strong
self-compensatory, self-balanced features. It is proposed that
allelic combinations that are different from common allelic
combinations ("Uncommon" haplotypes) produce phenotypic
disadvantages for carriers and increase the risk for the
development of maladaptive conditions such as somatosensory
disorders.
[0433] ADRB2 Polymorphism and Risk of Development of TMD
[0434] Tables 15 and 16 present the number and percentage of
subjects who, during 3-years of follow-up, were diagnosed
clinically with TMD. Subjects are classified according to their
ADRB2 (Table 15) or ADRB3 (Table 16) diplotypes. Subjects who were
diagnosed with TMD are labeled as `cases`.
TABLE-US-00016 TABLE 15 Cumulative incidence of TMD among ADRB2
diplotype groups for Caucasians tmdcase(TMD case status) Cases n
Non case n % % Total H1/H1 3 27 30 10.00 90.00 H1/H2 1 46 47 2.13
97.87 H1/H3 0 18 18 0.00 100.00 H2/H2 4 15 19 21.05 78.95 H2/H3 4
26 30 13.33 86.67 H3/H3 1 8 9 11.11 88.89 Other 2 2 4 (Uncommon)
50.00 50.00 Total 15 142 157
TABLE-US-00017 TABLE 16 Cumulative incidence of TMD among ADRB3
diplotype aroups for Caucasians tmdcase(TMD case status) Cases n
Non case n % % Total H1/H1 9 87 96 9.38 90.63 H1/H2 or H2/H2 2 35
37 5.41 94.59 H1/H3 1 14 15 6.67 93.33 Other 3 6 9 (uncommon) 33.33
66.67 Total 15 142 157
[0435] Among the numerically largest group of subjects with the
H1/H2 diplotype of ABDRB2, there was only one case of TMD onset,
hence representing a 3-year cumulative incidence of 2.13%. TMD
incidence was lowest (0%) for the 18 subjects with the H1/H3
diplotype. The highest TMD incidence was observed among subjects
who carried at least one of the rare haplotypes (i.e., a haplotype
different than one of the three common haplotypes, and referred to
herein collectively as "Uncommon" haplotype) for ADRB2 haplotype
(50.0%).
[0436] Among the 109 subjects who had the most prevalent H1/H1
diplotype of ADRB3 (Table 16), 9 were cases, hence representing a
3-year cumulative incidence of 9.38%. The highest TMD incidence was
observed among subjects carried at least one Uncommon ADRB3
haplotype (33.3%).
[0437] The results strongly suggest that subjects carrying Uncommon
haplotypes of ADRB2 or ADRB3 are under higher risk of developing
somatosensory disorders.
Example 16
Analysis of COMT/ADRB2 Genotype Combinations as a Predictor of Pain
Sensitivity and Risk for Developing Somatosensory Disorders
[0438] Based on the experimental animal subject results disclosed
herein in the above Examples and the clinical studies that have
shown associations between ADRB2 haplotypes (H1, H2, H3) and
psychological variables, ADRB2 genotypes are predictive of human
pain sensitivity, risk of developing somatosensory disorders, and
responses to pharmacological treatments for somatosensory
disorders.
[0439] Based on the knowledge that COMT and ADRB2 are part of the
same biological pathway (e.g.,
COMT.fwdarw.Epinephrine.fwdarw.ADRB2) that influences pain
sensitivity and proinflammatory cytokine responses in animals (see
Khasar, et al. (2003) and data disclosed herein in the Examples)
and humans (see data disclosed in Examples herein above) it is
hypothesized that specific combinations of COMT and ADRB2 genotypes
interact to influence pain sensitivity, psychological variables
associated with pain perception, and the risk of developing chronic
pain conditions. As such, the presently disclosed subject matter
discloses that specific combinations of COMT and ADRB2 genotypes
can better predict human pain sensitivity, risk of developing
somatosensory disorders, and responses to pharmacological
treatments for somatosensory disorders than either COMT or ADRB2
genotype alone.
[0440] The associations between specific combinations of COMT and
ADRB2 genotypes on human pain sensitivity (Table 17) have been
examined. The results on association between ADRB2 haplotypes,
psychological profile and blood pressure noted significant
overdominance effect of H1 haplotype when combined with H2 or H3
haplotypes (see Examples herein above). Because of this
observation, the association of the number of copies of H1
haplotype with pain z-score (a measure of human pain sensitivity)
was examined.
TABLE-US-00018 TABLE 17 Summed z-scores for Caucasian subjects with
COMT diplotypes and differing numbers of ADRB2 haplotypes
comt_haplotype groups HPS/APS LPS All pain z-score pain z-score
pain z-score ADRB2diplotype N Mean Std N Mean Std N Mean Std 2
copies of H1 14 4.0 (09.2) 19 -1.9 (09.5) 33 0.6 (09.7) 1 copy of
H1* 24 2.3 (10.6) 47 -3.6 (07.5) 71 -1.6 (09.0) 0 copies of
H1.dagger. 20 3.9 (09.4) 43 0.1 (08.7) 63 1.3 (09.1) All 58 3.3
(09.7) 109 -1.9 (08.5) 167 -0.1 (09.2) *Subjects with H1/H2 or
H1/H3 diplotypes .dagger.Subjects with H2/H2, H2/H3 or H3/H3
diplotypes
[0441] Table 17 presents summed z-scores for subjects grouped
according to COMT diplotype group and number of copies of ADRB2
haplotype H1. The analysis has been restricted by only Caucasian
subjects to increase genetic homogeneity of analyzed cohort and
eliminate the possibility of false associations due to population
stratification. Data include number of subjects, mean and standard
deviation of the summed z-score, which aggregates responses from 16
experimental pain procedures. Higher mean z-scores represent groups
with relatively greater responsiveness (i.e. greater sensitivity)
to experimental pain, while lower mean z-scores represent
relatively lower pain responsiveness (i.e. less sensitivity).
Diplotypes of COMT have been dichotomized to contrast subjects with
only HPS and APS haplotypes (labeled HPS/APS group) versus subjects
with at least one LPS haplotype (labeled LPS) (See Examples herein
above). COMT haplotypes are based on four SNPs: rs6269 rs4633
rs4818 rs4680. Diplotypes of ADRB2 represent all possible
combinations of three major haplotypes (H1, H2, H3) formed by eight
SNPS: G-7127A, rs11958940, rs1432622, rs1432623, rs2400707,
rs1042713, rs1042714 and rs1042717 (for details see data of
Examples herein above). Subjects with other, infrequent COMT or
ADRB2 haplotypes that differ from the ones shown here are excluded
from the table.
[0442] The results in Table 17 show a consistent pattern of
diminished pain response among subjects with only one copy of the
H1 haplotype compared with subjects who have either two copies or
no copies of the H1 haplotype. This effect was observed for all
subjects of the study described herein and separately for subjects
with the HPS/APS COMT haplotype and with the LPS COMT haplotype.
This pattern, in which pain responsiveness is similar for subjects
with no copies of the H1 haplotypes and with two copies of a
haplotype, is consistent with the concept of overdominance, in
which homozygous subjects have similar phenotypes, while
heterozygotes have a markedly different phenotype.
[0443] The independent effects of COMT and ADRB2 receptor genotype
on human pain sensitivity was evaluated statistically in a
factorial least squares regression model, in which the summed
z-score was the dependent variable. Explanatory variables were COMT
diplotype groups (1 degree of freedom) and two categories of ADRB2:
a single copy of the H1 haplotype, versus zero or two copies of the
H1 haplotype. Again, subjects with rare haplotypes were excluded
from the analysis. The overall model was statistically significant
(F(2,165)=7.8, P=0.0006) and there were independent effects of both
COMT (F1,165)=11.8, P=0.0007) and ADRB2 (F1,165)=3.4, P=0.066).
Their independent effects were confirmed by a lack of significance
of the interaction term in the model (P=0.69).
[0444] The association between summed z-scores for subjects grouped
according to COMT diplotype and all possible ADRB2 diplotypes
(Table 18) was next analyzed.
TABLE-US-00019 TABLE 18 Summed z-scores for subjects with
COMT-ADRB2 combinations comt_haplotypes group HPS/APS LPS All Pain
Z-score Pain Z-score Pain Z-score ABRB2_diplotype N Mean Std N Mean
Std N Mean Std H1/H1 13 2.6 (08.0) 18 -1.6 (09.8) 31 0.1 (09.2)
H1/H2 17 3.6 (10.1) 26 -4.1 (07.7) 43 -1.0 (09.4) H1/H3 6 0.1
(12.6) 11 -2.7 (08.1) 17 -1.7 (09.6) H2/H2 6 4.2 (10.0) 13 -3.5
(08.8) 19 -1.1 (09.6) H3/H2 10 3.3 (09.5) 18 3.3 (09.2) 28 3.3
(09.1) H3/H3 3 4.2 (13.6) 6 2.4 (07.2) 9 3.0 (08.9) All 57 2.9
(09.5) 95 -1.4 (08.7) 152 0.2 (09.2)
[0445] The results demonstrate that subjects who carry only HPS/APS
diplotypes of COMT have higher pain sensitivity (mean z-score=2.9)
than subjects with LPS diplotypes (mean z-score=-1.4). The net
difference of 4.3 z-score units between APS/HPS and LPS is repeated
within most groupings of ADRB2 diplotype. However, there is some
indication that the difference between APS/HPS and LPS is dependent
upon ADRB2 diplotype. Specifically, subjects with H2/H2 diplotypes
of ADRB2 have a much larger difference of 7.7 z-score units when
HPS/APS (mean=4.2) and LPS (mean=-3.5) are contrasted. In contrast,
among subjects with H3/H3 or H3/H2 diplotypes, z-scores do not
differ between HPS/APS and LPS groups and have a much smaller
difference of 1.2 z-score units for H3/H3 and no difference of
z-score units for H2/H3, making diplotypes H3/H3 and H2/H3
associated with higher pain responsiveness regardless of COMT
genotype. In summary, among subjects within HPS/APS COMT haplotype
group, the H3/H3 and H2/H2 homozygotes for ADRB2 are associated
with highest pain responsiveness; and among subjects within LPS
COMT group, the H3/H3 and H2/H3 carriers are associated with
highest pain responsiveness.
[0446] The data strongly suggest that the effect of COMT haplotypes
on pain perception can be modulated by specific ADRB2 haplotypes
but not by others (Table 18). This observation is consistent with
the known cell biology of ADRB2. Epinephrine, an agonist of ADRB2,
regulates activity of ADRB2 at several levels (Small et al.
(2003)). First, ADRB2 is internalized inside the cell in response
to agonist (e.g., epinephrine) stimulation. Second
epinephrine-dependent stimulation of ADRB2 leads to an activation
of its own transcription through a functional cAMP-response element
in the promoter region of ADRB2 (Gaiddon et al. (2003)). Since the
concentration of epinephrine in the human body is influenced by the
COMT activity, ADRB2 density on the cell surface should be
substantially influenced by COMT haplotypes. Given this
understanding of the cell biology, an interaction between specific
ADRB2 and COMT haplotypes on ADRB2 mediated biological responses
(i.e., pain sensitivity, psychological state and trait, and
inflammatory state) can be expected. Since ADRB2 coded by different
ADRB2 haplotypes can be regulated by epinephrine differently, it is
very likely that there are specific interactions between ADRB2
haplotypes and COMT haplotypes, which is supported by the results
presented in Table 17.
[0447] Based on the data presented herein the presently disclosed
subject matter provide that ADRB2 and COMT haplotypes can be used
to guide pharmacological treatment decisions regarding the
treatment of somatosensory disorders, persistent pain conditions,
and inflammatory conditions. Specifically, subjects with low COMT
activity (HPS/APS group) can be predicted to benefit from
pharmacological therapy with ADRB2 antagonists or procedures that
block or reduce ADRB2 function, with the best therapeutic effect
observed for individuals who are either H2 or H3 homozygous. In
contrast, subjects with high COMT activity (LPS group) can be
predicted to be poor responders to ADRB2-antagonist therapy, except
for subjects carrying H3/H3 and H2/H3 diplotypes.
REFERENCES
[0448] All references cited herein and those provided in the list
below are herein incorporated by reference in their entireties.
[0449] Abiola, O., Angel, J. M., Avner, P., Bachmanov, A. A.,
Belknap, J. K., Bennett, B., Blankenhorn, E. P., Blizard, D. A.,
Bolivar, V., Brockmann, G. A., Buck, K. J., Bureau, J. F., Casley,
W. L., Chesler, E. J., Cheverud, J. M., Churchill, G. A., Cook, M.,
Crabbe, J. C., Crusio, W. E., Darvasi, A., de Haan, G., Dermant,
P., Doerge, R. W., Elliot, R. W., Farber, C. R., Flaherty, L.,
Flint, J., Gershenfeld, H., Gibson, J. P., Gu, J., Gu, W.,
Himmelbauer, H., Hitzemann, R., Hsu, H. C., Hunter, K., Iraqi, F.
F., Jansen, R. C., Johnson, T. E., Jones, B. C., Kempermann, G.,
Lammert, F., Lu, L., Manly, K. F., Matthews, D. B., Medrano, J. F.,
Mehrabian, M., Mittlemann, G., Mock, B. A., Mogil, J. S.,
Montagutelli, X., Morahan, G., Mountz, J. D., Nagase, H.,
Nowakowski, R. S., O'Hara, B. F., Osadchuk, A. V., Paigen, B.,
Palmer, A. A., Peirce, J. L., Pomp, D., Rosemann, M., Rosen, G. D.,
Schalkwyk, L. C., Seltzer, Z., Settle, S., Shimomura, K., Shou, S.,
Sikela, J. M., Siracusa, L. D., Spearow, J. L., Teuscher, C.,
Threadgill, D. W., Toth, L. A., Toye, A. A., Vadasz, C., Van Zant,
G., Wakeland, E., Williams, R. W., Zhang, H. G., and Zou, F. (2003)
The nature and identification of quantitative trait loci: a
community's view. Nat. Rev. Genet., 4, 911-916. [0450] Akaike, H.,
(1974) A new look at statistical model identification. IEEE Trans.
Biomed. Engin., AU-19, 716-722. [0451] Aley, K. O. et al.
Nociceptor sensitization by extracellular signal-regulated kinases.
J Neurosci 21, 6933-9 (2001). [0452] Aston-Jones, G., Rajkowski,
J., and Cohen, J. (1999) Role of locus coeruleus in attention and
behavioral flexibility. Biol. Psychiatry, 46, 1309-1320. [0453]
Beck, A. T., Ward, C. H., Mendelson, M., Mock, J. E., and Erbaugh,
J. (1961) An inventory for measuring depression. Arch. Gen.
Psychiatry, 4, 561-571. [0454] Belfer, I., Buzas, B., Evans, C.,
Hipp, H., Phillips, G., Taubman, J., Lorincz, I., Lipsky, R. H.,
Enoch, M. A., Max, M. B., and Goldman, D. (2004) Haplotype
structure of the beta adrenergic receptor genes in US Caucasians
and African Americans. Eur. J. Hum. Genet. [0455] Berkow et al.,
(1997) The Merck Manual of Medical Information, Home ed. Merck
Research Laboratories, Whitehouse Station, N.J. [0456] Bortoluzzi,
S., Danieli, G. A. (1999) Towards an in silico analysis of
transcription patterns. Trends Genet., 15, 118-119. [0457] Box, J.
E. P., Cox, D. R. (1964) An analysis of transformations. Journal of
the Royal Statistical Society, 26, 211-252. [0458] Bray, M. S.,
Krushkal, J., Li, L., Ferrell, R., Kardia, S., Sing, C. F., Turner,
S. T., and Boerwinkle, E. (2000) Positional genomic analysis
identifies the beta(2)-adrenergic receptor gene as a susceptibility
locus for human hypertension. Circulation, 101, 2877-2882. [0459]
Brodde, O. E., Michel, M. C. (1992) Adrenergic receptors and their
signal transduction mechanisms in hypertension. J. Hypertens.
Suppl, 10, S133-S145. [0460] Bruehl, S., Chung, O. Y. (2004)
Interactions between the cardiovascular and pain regulatory
systems: an updated review of mechanisms and possible alterations
in chronic pain. Neurosci. Biobehav. Rev., 28, 395-414. [0461]
Busjahn, A., Freier, K., Faulhaber, H. D., Li, G. H., Rosenthal,
M., Jordan, J., Hoehe, M. R., Timmermann, B., and Luft, F. C.
(2002) Beta-2 adrenergic receptor gene variations and coping styles
in twins. Biol. Psychol., 61, 97-109. [0462] Carlsson, G. E., Le
Resche, L. (1995) In Sessle, B. J., Bryant, P. S., and Dionne, R.
A. (eds), Temporomandibular Disorders and Related Pain Conditions.
IASP Press, Seattle, Vol. 4, pp. 211-226. [0463] Chandra, G. et al.
Cyclic AMP signaling pathways are important in IL-1 beta
transcriptional regulation. J Immunol 155, 4535-43 (1995). [0464]
Chaplan, S. R., Bach, F. W., Pogrel, J. W., Chung, J. M. &
Yaksh, T. L. Quantitative assessment of tactile allodynia in the
rat paw. J Neurosci Methods 53, 55-63 (1994). [0465] Chaplan, S.
R., Pogrel, J. W., and Yaksh, T. L. (1994) Role of
voltage-dependent calcium channel subtypes in experimental tactile
allodynia. J. Pharmacol. Exp. Ther., 269, 1117-1123. [0466] Cohen,
S., Kamarck, T., and Mermelstein, R. (1983) A global measure of
perceived stress. J Health Soc. Behav., 24, 385-396. [0467]
Coppack, S. W. Pro-inflammatory cytokines and adipose tissue. Proc
Nutr Soc 60, 349-56 (2001). [0468] Comeron, J. M. (2004) Selective
and mutational patterns associated with gene expression in humans:
influences on synonymous composition and intron presence. Genetics,
167, 1293-1304. [0469] Cunha, T. M. et al. A cascade of cytokines
mediates mechanical inflammatory hypernociception in mice. Proc
Natl Acad Sci USA 102, 1755-60 (2005). [0470] DeMille, M. M., Kidd,
J. R., Ruggeri, V., Palmatier, M. A., Goldman, D., Odunsi, A.,
Okonofua, F., Grigorenko, E., Schulz, L. O., Bonne-Tamir, B., Lu,
R. B., Parnas, J., Pakstis, A. J., and Kidd, K. K. (2002)
Population variation in linkage disequilibrium across the COMT gene
considering promoter region and coding region variation. Hum.
Genet., 111, 521-537. [0471] Derogatis, L. R., Melisaratos, N.
(1983) The Brief Symptom Inventory: an introductory report.
Psychol. Med., 13, 595-605. [0472] Diatchenko, L. et al. Genetic
basis for individual variations in pain perception and the
development of a chronic pain condition. Hum Mol Genet 14, 135-43
(2005). [0473] Drysdale, C. M., McGraw, D. W., Stack, C. B.,
Stephens, J. C., Judson, R. S., Nandabalan, K., Arnold, K., Ruano,
G., and Liggett, S. B. (2000) Complex promoter and coding region
beta 2-adrenergic receptor haplotypes alter receptor expression and
predict in vivo responsiveness. Proc. Natl. Acad. Sci. U.S.A., 97,
10483-10488. [0474] Duan, J., Wainwright, M. S., Comeron, J. M.,
Saitou, N., Sanders, A. R., Gelernter, J., and Gejman, P. V. (2003)
Synonymous mutations in the human dopamine receptor D2 (DRD2)
affect mRNA stability and synthesis of the receptor. Hum. Mol.
Genet., 12, 205-216. [0475] Duch et al., (1998) Toxicol. Lett.
100-101:255-263. [0476] Easton, J. D., Sherman, D. G. (1976)
Somatic anxiety attacks and propranolol. Arch. Neurol., 33,
689-691. [0477] Ebadi, (1998) CRC Desk Reference of Clinical
Pharmacology. CRC Press, Boca Raton, Fla. [0478] Elenkov, I. J.,
Wilder, R. L., Chrousos, G. P. & Vizi, E. S. The sympathetic
nerve--an integrative interface between two supersystems: the brain
and the immune system. Pharmacol Rev 52, 595-638 (2000). [0479]
Fagius, A. N., Wahren, L. K. (1981) Variability of sensory
threshold determination in clinical use. J. Neural. Sci., 51,
11-27. [0480] Fillingim, R. B., Maixner, W. (1996) The influence of
resting blood pressure and gender on pain responses. Psychosomatic
Med., 58, 326-332. [0481] Fillingim, R. B., Maixner, W., Bunting,
S., and Silva, S. (1998) Resting blood pressure and thermal pain
responses among females: effects on pain unpleasantness but not
pain intensity. International Journal of Psychophysiology, 30,
313-318. [0482] Freireich et al., (1966) Cancer Chemother Rep.
50:219-244 [0483] Fruhstorfer, H., Lindblom, U., and Schmidt, W. G.
(1976) Method for quantitative estimation of thermal thresholds in
patients. J. Neurol., Neurosurg., & Psych., 39, 1071-1075.
[0484] Gabriel, S. B., Schaffner, S. F., Nguyen, H., Moore, J. M.,
Roy, J., Blumenstiel, B., Higgins, J., DeFelice, M., Lochner, A.,
Faggart, M., Liu-Cordero, S. N., Rotimi, C., Adeyemo, A., Cooper,
R., Ward, R., Lander, E. S., Daly, M. J., and Altshuler, D. (2002)
The structure of haplotype blocks in the human genome. Science,
296, 2225-2229. [0485] Gaiddon, C., Larmet, Y., Trinh, E.,
Boutillier, A. L., Sommer, B., and Loeffler, J. P. (1999)
Brain-derived neurotrophic factor exerts opposing effects on
beta2-adrenergic receptor according to depolarization status of
cerebellar neurons. J. Neurochem., 73, 1467-1476. [0486] Goodman et
al., (1996) Goodman & Gilman's the Pharmacological Basis of
Therapeutics, 9th ed. McGraw-Hill Health Professions Division, New
York. [0487] Gratze, G., Fortin, J., Labugger, R., Binder, A.,
Kotanko, P., Timmermann, B., Luft, F. C., Hoehe, M. R., and
Skrabal, F. (1999) beta-2 Adrenergic receptor variants affect
resting blood pressure and agonist-induced vasodilation in young
adult Caucasians. Hypertension, 33, 1425-1430. [0488] Hagen, K.,
Zwart, J. A., Holmen, J., Svebak, S., Bovim, G., and Stovner, L. J.
(2005) Does hypertension protect against chronic musculoskeletal
complaints? The Nord-Trondelag Health Study. Arch. Intern. Med.,
165, 916-922. [0489] Hargreaves, K., Dubner, R., Brown, F., Flores,
C., and Joris, J. (1988) A new and sensitive method for measuring
thermal nociception in cutaneous hyperalgesia. Pain, 32, 77-88.
[0490] Hoit, B. D., Suresh, D. P., Craft, L., Walsh, R. A., and
Liggett, S. B. (2000) beta2-adrenergic receptor polymorphisms at
amino acid 16 differentially influence agonist-stimulated blood
pressure and peripheral blood flow in normal individuals. Am. Heart
J., 139, 537-542. [0491] Iaccarino, G., Cipolletta, E., Fiorillo,
A., Annecchiarico, M., Ciccarelli, M., Cimini, V., Koch, W. J., and
Trimarco, B. (2002) Beta(2)-adrenergic receptor gene delivery to
the endothelium corrects impaired adrenergic vasorelaxation in
hypertension. Circulation, 106, 349-355. [0492] Jaeger, B., Reeves,
J. L. (1986) Quantification of changes in myofascial trigger point
sensitivity with the pressure algometer following passive stretch.
Pain, 27, 203-210. [0493] John, M. T., Miglioretti, D. L.,
LeResche, L., Von Korff, M., and Critchlow, C. W. (2003) Widespread
pain as a risk factor for dysfunctional temporomandibular disorder
pain. Pain, 102, 257-263. [0494] Katzung, (2001) Basic &
Clinical Pharmacology, 8th ed. Lange Medical Books/McGraw-Hill
Medical Pub. Division, New York. [0495] Khasar, S. G., McCarter, G.
& Levine, J. D. Epinephrine produces a beta-adrenergic
receptor-mediated mechanical hyperalgesia and in vitro
sensitization of rat nociceptors. J Neurophysiol 81, 1104-12
(1999). [0496] Khasar, S. G., Green, P. G., Miao, F. J., and
Levine, J. D. (2003) Vagal modulation of nociception is mediated by
adrenomedullary epinephrine in the rat. Eur. J. Neurosci., 17,
909-915. [0497] Kiefer, R., Kieseier, B. C., Stoll, G. &
Hartung, H. P. The role of macrophages in immune-mediated damage to
the peripheral nervous system. Prog Neurobiol 64, 109-27 (2001).
[0498] Koopman, P. A. R. (1984) Confidence intervals for the ratio
of two binomial proportions. Biometrics, 40, 513-517. [0499] Kopin,
I. J. (1984) Avenues of investigation for the role of
catecholamines in anxiety. Psychopathology, 17 Suppl 1, 83-97.
[0500] Kotanko, P., Binder, A., Tasker, J., DeFreitas, P., Kamdar,
S., Clark, A. J., Skrabal, F., and Caulfield, M. (1997) Essential
hypertension in African Caribbeans associates with a variant of the
beta2-adrenoceptor. Hypertension, 30, 773-776. [0501] Kress, M. a.
S., C. Neuroimmunology and Pain: Peripheral Effects of
Proinflammatory Cytokines. in Hyperalgesia: Molecular Mechanisms
and Clinical Implications, Progress in Pain Research Management,
Vol. 30 (ed. Brune, K. a. H., H. O.) 57-65 (IASP Press, Seattle,
2004). [0502] Lader, M. (1988) Beta-adrenoceptor antagonists in
neuropsychiatry: an update. J. Clin. Psychiatry, 49, 213-223.
[0503] Li, T., Ball, D., Zhao, J., Murray, R. M., Liu, X., Sham, P.
C., and Collier, D. A. (2000) Family-based linkage disequilibrium
mapping using SNP marker haplotypes: application to a potential
locus for schizophrenia at chromosome 22q11. Mol. Psychiatry, 5,
452. [0504] Liggett, S. B. Identification and characterization of a
homogeneous population of beta 2-adrenergic receptors on human
alveolar macrophages. Am Rev Respir Dis 139, 552-5 (1989). [0505]
Lorr, M., McNair, D. M. (1988) Profile of Mood States: Bipolar
Form. Educational and Industrial Testing Service, San Diego, Calif.
[0506] Lotta, T., Vidgren, J., Tilgmann, C., Ulmanen, I., Melen,
K., Julkunen, I., and Taskinen, J. (1995) Kinetics of human soluble
and membrane-bound catechol O-methyltransferase: a revised
mechanism and description of the thermolabile variant of the
enzyme. Biochem., 34, 4202-4210. [0507] Magliozzi, J. R., Gietzen,
D., Maddock, R. J., Haack, D., Doran, A. R., Goodman, T., and
Weiler, P. G. (1989) Lymphocyte beta-adrenoreceptor density in
patients with unipolar depression and normal controls. Biol.
Psychiatry, 26, 15-25. [0508] Maixner, W., Gracety, R. H., Zuniga,
J. R., Humphrey, C. B., and Bloodworth, G. R. (1990) Cardiovascular
and sensory responses to forearm ischemia and dynamic hand
exercise. Am J Physiol, 259, R1156-R1163. [0509] Maixner, W. (1991)
Interactions between cardiovascular and pain modulatory systems:
physiological and pathophysiological implications. J. Cardiovas.
Electrophysiol., (Supplement) 2, S2-S12. [0510] Maixner, W.,
Fillingim, R. B., Kincaid, S., Sigurdsson, A., and Harris, M. B.
(1997) Relationship between pain sensitivity and resting arterial
blood pressure in patients with painful temporomandibular
disorders. Psychosomatic Med., 59, 503-511. [0511] Mannisto, P. T.,
Kaakkola, S. (1999) Catechol-O-methyltransferase (COMT):
biochemistry, molecular biology, pharmacology, and clinical
efficacy of the new selective COMT inhibitors. Pharmacol. Rev., 51,
593-628. [0512] Masuda, M., Tsunoda, M., Yusa, Y., Yamada, S., and
Imai, K. (2002) Assay of catechol-O-methyltransferase activity in
human erythrocytes using norepinephrine as a natural substrate.
Ann. Clin. Biochem., 39, 589-594. [0513] McGraw, D. W., Forbes, S.
L., Kramer, L. A., and Liggett, S. B. (1998) Polymorphisms of the
5' leader cistron of the human beta2-adrenergic receptor regulate
receptor expression. J. Clin. Invest, 102, 1927-1932. [0514] Mense,
S. (1993) Nociception from skeletal muscle in relation to clinical
muscle pain. Pain, 54, 241-289. [0515] Mogil, J. S. The genetic
mediation of individual differences in sensitivity to pain and its
inhibition. Proc. Natl. Acad. Sci. 96, 7744-7751. 1999. [0516]
Mogil, J. S., Wilson, S. G., Chesler, E. J., Rankin, A. L.,
Nemmani, K. V., Lariviere, W. R., Groce, M. K., Wallace, M. R.,
Kaplan, L., Staud, R., Ness, T. J., Glover, T. L., Stankova, M.,
Mayorov, A., Hruby, V. J., Grisel, J. E., and Fillingim, R. B.
(2003) The melanocortin-1 receptor gene mediates female-specific
mechanisms of analgesia in mice and humans. Proc. Natl. Acad. Sci.
U.S.A., 100, 4867-4872. [0517] O'Donnell, J. M., Frith, S. &
Wilkins, J. Involvement of beta-1 and beta-2 adrenergic receptors
in the antidepressant-like effects of centrally administered
isoproterenol. J Pharmacol Exp Ther 271, 246-54 (1994). [0518] PCT
International Publication No. WO 93/25521. [0519] Pfleeger, M.,
Straneva, P., Fillingim, R. B., Maixner, W., and Girdler, S. S.
(1997) Menstrual cycle, blood pressure and ischemic pain
sensitivity in women. Int. J. Beh. Med., Submitted. [0520] Price,
D. D., Hu, J. W., Dubner, R., and Gracety, R. H. (1977) Peripheral
suppression of first pain and central summation of second pain
evoked by noxious heat pulses.
Pain, 3, 57-68. [0521] Randich, A., Maixner, W. (1984) Interactions
between cardiovascular and pain regulatory systems. Neurosci.
Biobehav. Rev., 8, 343-367. [0522] Remington et al., (1975)
Remington's Pharmaceutical Sciences, 15th ed. Mack Pub. Co.,
Easton, Pa. [0523] Risch, N. J. (2000) Searching for genetic
determinants in the new millennium. Nature, 405, 847-856. [0524]
Roach, S. K., Lee, S. B. & Schorey, J. S. Differential
activation of the transcription factor cyclic AMP response element
binding protein (CREB) in macrophages following infection with
pathogenic and nonpathogenic mycobacteria and role for CREB in
tumor necrosis factor alpha production. Infect Immun 73, 514-22
(2005). [0525] Rockman, M. V., Wray, G. A. (2002) Abundant raw
material for cis-regulatory evolution in humans. Mol. Biol. Evol.,
19, 1991-2004. [0526] Routledge, C., Marsden, C. A. (1987)
Adrenaline in the CNS: in vivo evidence for a functional pathway
innervating the hypothalamus. Neuropharmacology, 26, 823-830.
[0527] Shagin, D. A., Rebrikov, D. V., Kozhemyako, V. B.,
Altshuler, I. M., Shcheglov, A. S., Bogdanova, E. A., Staroverov,
D. B., Rasskazov, V. A., and Lukyanov, S. (2002) A novel method for
SNP detection using a new duplex-specific nuclease from crab
hepatopancreas. Genome Res., 12, 1935-1942. [0528] Sheps, D. S.,
Bragdon, E. E., Gray, T. F., Ballenger, M., Usedom, J. E., and
Maixner, W. (1992) Relationship between systemic hypertension and
pain perception. Am. J. Cardiol., 70, 3F-5F. [0529] Shi, M. M.,
Bleavins, M. R., and de la iglesia, F. A. (1999) Technologies for
detecting genetic polymorphisms in pharmacogenomics. Mol. Diagn.,
4, 343-351. [0530] Shifman, S., Bronstein, M., Sternfeld, M.,
Pisante-Shalom, A., Lev-Lehman, E., Weizman, A., Reznik, I.,
Spivak, B., Grisaru, N., Karp, L., Schiffer, R., Kotler, M.,
Strous, R. D., Swartz-Vanetik, M., Knobler, H. Y., Shinar, E.,
Beckmann, J. S., Yakir, B., Risch, N., Zak, N. B., and Darvasi, A.
(2002) A highly significant association between a COMT haplotype
and schizophrenia. Am. J Hum. Genet., 71, 1296-1302. [0531] Speight
et al., (1997) Avery's Drug Treatment: A Guide to the Properties,
Choice, Therapeutic Use and Economic Value of Drugs in Disease
Management, 4th ed. Adis International, Auckland/Philadelphia.
[0532] Simes, R. J. (1986) An improved Bonferroni procedure for
multiple tests of signi_cance. Biometrika, 73, 751-754. [0533]
Small, K. M., McGraw, D. W., and Liggett, S. B. (2003) Pharmacology
and physiology of human adrenergic receptor polymorphisms. Annu.
Rev. Pharmacol. Toxicol., 43, 381-411. [0534] Snapir, A.,
Koskenvuo, J., Toikka, J., Orho-Melander, M., Hinkka, S., Saraste,
M., Hartiala, J., and Scheinin, M. (2003) Effects of common
polymorphisms in the alpha1A-, alpha2B-, beta1- and
beta2-adrenoreceptors on haemodynamic responses to adrenaline.
Clin. Sci. (Lond), 104, 509-520. [0535] Spielberger, C. D.,
Gorusch, R. L., Lushene, R., Vagg, P. R., and Jacobs, G. A. (1983)
Manual for the State-Trait Anxiety Inventory (Form Y1). Consulting
Psychologists Press, Palo Alto, Calif. [0536] Stephens, M., Smith,
N. J., and Donnelly, P. (2001) A new statistical method for
haplotype reconstruction from population data. Am. J. Hum. Genet.,
68, 978-989. [0537] Stephens, M., Donnelly, P. (2003) A comparison
of bayesian methods for haplotype reconstruction from population
genotype data. Am. J. Hum. Genet., 73, 1162-1169. [0538] Strosberg,
A. D. Structure and function of the beta 3-adrenergic receptor.
Annu Rev Pharmacol Toxicol 37, 421-50 (1997). [0539] Sommer, C.
& Kress, M. Recent findings on how proinflammatory cytokines
cause pain: peripheral mechanisms in inflammatory and neuropathic
hyperalgesia. Neurosci Lett 361, 184-7 (2004). [0540] Syed, N. H.,
Chen, Z. J. (2004) Molecular marker genotypes, heterozygosity and
genetic interactions explain heterosis in Arabidopsis thaliana.
Heredity. [0541] Tattersfield, A. E., Hall, I. P. (2004) Are
beta2-adrenoceptor polymorphisms important in asthma--an unraveling
story. Lancet, 364, 1464-1466. [0542] Thiessen, B. Q., Wallace, S.
M., Blackburn, J. L., Wilson, T. W., and Bergman, U. (1990)
Increased prescribing of antidepressants subsequent to beta-blocker
therapy. Arch. Intern. Med., 150, 2286-2290. [0543] Tsujii, S.
& Bray, G. A. A beta-3 adrenergic agonist (BRL-37,344)
decreases food intake. Physiol Behav 63, 723-8 (1998). [0544] Von
Korff, M., Le Resche, L., and Dworkin, S. F. (1993) First onset of
common pain symptoms: a prospective study of depression as a risk
factor. Pain, 55, 251-258. [0545] U.S. Pat. No. 4,736,866. [0546]
U.S. Pat. No. 5,162,215. [0547] U.S. Pat. No. 5,234,933. [0548]
U.S. Pat. No. 5,326,902. [0549] U.S. Pat. No. 5,489,742. [0550]
U.S. Pat. No. 5,550,316. [0551] U.S. Pat. No. 5,573,933. [0552]
U.S. Pat. No. 5,614,396. [0553] U.S. Pat. No. 5,625,125. [0554]
U.S. Pat. No. 5,648,061. [0555] U.S. Pat. No. 5,741,957. [0556]
U.S. Pat. No. 6,180,082. [0557] Ward-Routledge, C., Marshall, P.,
and Marsden, C. A. (1988) Involvement of central alpha- and
beta-adrenoceptors in the pressor response to electrical
stimulation of the rostral ventrolateral medulla in rats. Br. J.
Pharmacol., 94, 609-619. [0558] Xie, T., Ho, S. L., and Ramsden, D.
(1999) Characterization and implications of estrogenic
down-regulation of human catechol-.beta.-methyltransferase gene
transcription. Mol. Pharmacol., 56, 31-38. [0559] Yu, X.-M., Hua,
M., and Mense, S. (1991) The effects of intracerebroventricular
injection of naloxone, phentolamine, methysergide on the
transmission of nociceptive signals in the rat dorsal horn neurones
with convergent cutaneous-deep input. Neuroscience, 715-723. [0560]
Zhang, H. T., Huang, Y., and O'Donnell, J. M. (2003) Antagonism of
the antidepressant-like effects of clenbuterol by central
administration of beta-adrenergic antagonists in rats.
Psychopharmacology (Berl), 170, 102-107. [0561] Zhang, Y., Lin, J.
X. & Vilcek, J. Synthesis of interleukin 6 (interferon-beta 2/B
cell stimulatory factor 2) in human fibroblasts is triggered by an
increase in intracellular cyclic AMP. J Biol Chem 263, 6177-82
(1988). [0562] Zubieta, J. K., Heitzeg, M. M., Smith, Y. R.,
Bueller, J. A., Xu, K., Xu, Y., Koeppe, R. A., Stohler, C. S., and
Goldman, D. (2003) COMT val158met genotype affects mu-opioid
neurotransmitter responses to a pain stressor. Science, 299,
1240-1243.
[0563] It will be understood that various details of the subject
matter disclosed herein can be changed without departing from the
scope of the presently disclosed subject matter. Furthermore, the
foregoing description is for the purpose of illustration only, and
not for the purpose of limitation, as the presently disclosed
subject matter is defined by the claims as set forth hereinafter.
Sequence CWU 1
1
330120DNAHomo sapiens 1gccgtgtctg gactgtgagt 20221DNAHomo sapiens
2gggttcagaa tcacggatgt g 21327DNAHomo sapiens 3aacagacaga
aaagtttccc cttccca 27427DNAHomo sapiens 4cagacagaaa agcttcccct
tcccata 27519DNAHomo sapiens 5aggcacaagg ctggcattt 19617DNAHomo
sapiens 6ccacacgccc ctttgct 17721DNAHomo sapiens 7tgcccctctg
cgaacacaag g 21824DNAHomo sapiens 8accttgcccc tctgcaaaca caag
24919DNAHomo sapiens 9tgctcatggg tgacaccaa 191018DNAHomo sapiens
10gcctccagca cgctctgt 181124DNAHomo sapiens 11atcctgaacc atgtgctgca
gcat 241222DNAHomo sapiens 12atcctgaacc acgtgctgca gc 221320DNAHomo
sapiens 13gggggcctac tgtggctact 201420DNAHomo sapiens 14tcaggcatgc
acaccttgtc 201524DNAHomo sapiens 15cgaggctcat caccatcgag atca
241624DNAHomo sapiens 16cgaggctgat caccatcgag atca 241720DNAHomo
sapiens 17tcgagatcaa ccccgactgt 201817DNAHomo sapiens 18aacgggtcag
gcatgca 171921DNAHomo sapiens 19ccttgtcctt cacgccagcg a
212024DNAHomo sapiens 20accttgtcct tcatgccagc gaaa 242119DNAHomo
sapiens 21cagccacagt ggtgcagag 192218DNAHomo sapiens 22gtccacctgt
ccccagcg 182310DNAHomo sapiens 23tgccagcctg 102410DNAHomo sapiens
24tgccggcctg 102528DNAHomo sapiens 25tgaacgtggg cgacaagaaa ggcaagat
282627DNAHomo sapiens 26tgaccttgtc cttcacgcca gcgaaat 272720DNAHomo
sapiens 27gccgaccact cccacgtctt 202820DNAHomo sapiens 28cccgctctcg
ctctcggtaa 202951DNAHomo sapiens 29gcatttctga accttgcccc tctgcraaca
caagggggcg atggtggcac t 513051DNAHomo sapiens 30ccaaggagca
gcgcatcctg aaccaygtgc tgcagcatgc ggagcccggg a 513151DNAHomo sapiens
31gcctgctgtc accaggggcg aggctbatca ccatcgagat caaccccgac t
513251DNAHomo sapiens 32ccagcggatg gtggatttcg ctggcrtgaa ggacaaggtg
tgcatgcctg a 513351DNAHomo sapiens 33tggactgtga gtatgggaag
gggaarcttt tctgtctgtt gtccccacta c 513451DNAHomo sapiens
34tgttagcccc atggggacga ctgccrgcct gggaaacgaa gaggagtcag c
513551DNAHomo sapiens 35aaaggagcaa ggtggaaagt tctggmtgct tcaggtctgc
atggtccctc t 513651DNAHomo sapiens 36acgggggtct catgagcttg
cgagcygatg gccaggcagc cggtgcagaa g 513751DNAHomo sapiens
37cgagcagaag gagtgggcca tgaacrtggg cgacaagaaa ggtggggtcc g
513851DNAHomo sapiens 38cctagcaggg cgagggcagt gcttcrcctt tccggcctca
gaagagacag c 513951DNAHomo sapiens 39gaccactgga aggaccggta
cctgcyggac acgcttctct tggaggtgag c 514051DNAHomo sapiens
40agacaaggca cccagcccca gtttcyccac ctgggaaggg ggctacttgt g
514151DNAHomo sapiens 41cacgctgggc agaaagtgga aacctrgccc caggggctag
gcacaggcgt g 514251DNAHomo sapiens 42tggccccagg ggctaggcac
aggcgyggtg ccgtggccta gtgaggagca c 514351DNAHomo sapiens
43tggccaggat ggtcttgagc tctctytttt tttttttttt ttttttttga g
514451DNAHomo sapiens 44tcccccttaa aaaaaaaaaa aaaaaragaa aaagacagag
tcttgctctg t 514551DNAHomo sapiens 45ctgccctgca gagcccagtg
agacamtagt taatgcagaa aaaacagatt t 514651DNAHomo sapiens
46ttttgtgtcc tgttgctttt tattgwttaa agtgaccctc caagcctgag g
514751DNAHomo sapiens 47cacaactcac tagtttatat aagagytagt tctcactttt
ttttttactc t 514851DNAHomo sapiens 48ctcctgagta gctgggacta
acaggkgctt gccaccaagc ctggctaatt t 514951DNAHomo sapiens
49gcaacctctg cctcccaggt tcaggstatt ctcctgcctc agcctcctga g
515051DNAHomo sapiens 50ggcctccgga taactgtggg caaacytgac actccacaag
aggtggttga g 515151DNAHomo sapiens 51ggcagatgcc tgtagtccca
gctacycggg aggctgaggc aggagaatgg c 515251DNAHomo sapiens
52tggcagatgc ctgtagtccc agctamtcgg gaggctgagg caggagaatg g
515351DNAHomo sapiens 53ttgagcccag gagtttgaga ccagcytgag aaacatgctg
aggccctgtc t 515451DNAHomo sapiens 54tctcgagaca gtctctcgct
ctgtcrccca ggctggagtg cagtggcgcg a 515551DNAHomo sapiens
55gggagcggtg gctcacgcct gtaatyccag cactttggga ggccgaggcg g
515651DNAHomo sapiens 56ggctgaggca ggagaatggt gtgaayccgg gaggtggagc
ttgcaatgag c 515751DNAHomo sapiens 57tttggccttg agcacttccc
catccyccat ggctcttggc cgttggggcc c 515851DNAHomo sapiens
58tcccccatgg ctcttggccg ttgggsccca gttggccgca gagcctttgg c
515951DNAHomo sapiens 59tccccatccc ccatggctct tggccrttgg ggcccagttg
gccgcagagc c 516051DNAHomo sapiens 60ttctcaacca gtggagatcc
tggctyagtg cagtcatgtg atctcaaagt t 516151DNAHomo sapiens
61aaactaatga ttaacaatat tcatayataa tcatatctat gatctatatc t
516251DNAHomo sapiens 62tggccggagt gtgatggggg agtctytgtc caggctgctg
ccacggtggg c 516351DNAHomo sapiens 63gtggcatggg cctatagttc
cagctrcttg ggaggctgag gtgaaaagat c 516451DNAHomo sapiens
64tttcttttct tttttttttt tttttytttt tctgtagaga caaggtcttg c
516551DNAHomo sapiens 65ttttcttttc ttttcttttc tttttytttt tttttttttt
ttctgtagag a 516651DNAHomo sapiens 66atctggaatc cttatattaa
catttmccaa tatgcatgta actcaaggaa g 516751DNAHomo sapiens
67ctgtgggcag ggagggcatg cgcackttgt cctccccacc aggtgttcac a
516851DNAHomo sapiens 68gaagaagttt ccttgtgtcc ttcccrtttt agggtctgtg
acctgaaccc c 516951DNAHomo sapiens 69ccccacgagg tacactgttg
tgggcrgcag ggctggcctt tctcatctgg g 517051DNAHomo sapiens
70ggttcccagg ctacctgcct ggaggrtcac accaggagga tttcaaacag g
517151DNAHomo sapiens 71cccctgggtg tcctctaagc cagctsggag acaacagcct
gagtccgtgt c 517251DNAHomo sapiens 72tccgtgtctg cttctgtatt
ttgtgyggtt ttagaggatc cctgggctgc c 517351DNAHomo sapiens
73cacagaaata acatctgctt tgctgscgag ctcagaggag accccagacc c
517451DNAHomo sapiens 74ttcaggagca ccagccctcc gtgctsctgg agctgggggc
ctactgtggc t 517551DNAHomo sapiens 75agaagtcatg attgagtctt
aaaaargaac aatccagtgt tgcagttcag a 517651DNAHomo
sapiensmisc_feature(26)..(26)this c may be missing 76ggatggatac
tcctgagatg gataccagga gttgatgaga gaaaggtccc t 517751DNAHomo
sapiensmisc_feature(26)..(26)this t may be missing 77gtcttgagct
ctcttttttt tttttttttt tttttttgag acggagtctc g 517851DNAHomo sapiens
78ggagtctttg tccaggctgc tgccayggtg ggcctcagga ctcatggcct g
517951DNAHomo sapiens 79aaaacacaac tcactagttt atatargagc tagttctcac
tttttttttt a 518051DNAHomo sapiens 80tttctttctt ttttttcttt
ttttcytttt tttttttttt tttttttttt g 518151DNAHomo sapiens
81gctgggatta caggtgtgag ccaccwccca gccctatttt atatttttat c
518251DNAHomo sapiens 82gcctttggcc ttgagcactt ccccakcccc catggctctt
ggccattgga c 518351DNAHomo sapiens 83cttttctttt tttttttttt
tttttkttct gtagagacaa ggtcttgctg t 518451DNAHomo sapiens
84aaaaaaaatt taggctgggt gcagcrgctc acgcctataa tcccagcatt t
518551DNAHomo sapiens 85ctccccgtgt gcagagatga gagatygtag aaataaagac
acaagacaaa g 518651DNAHomo sapiens 86aaggccaggc aggtgcggtg
gctcaygcct gtaatcccag cactttggga g 518751DNAHomo sapiens
87gggggccctt ccctgtttgg cagccraggc ggacagcgag aggagacagc t
518851DNAHomo sapiens 88tgaggcagga gaatggcgtg aacccrggag gcggagcttg
cagtgagctg a 518951DNAHomo sapiens 89gcccatgagt gaggatgcag
tgctgktttc tgtccaccta cacctagagc t 519051DNAHomo sapiens
90taagaatcta aatatttaga tataastcga cttagtacat ccttctcaac t
519151DNAHomo sapiens 91cctgacatgc taacctctct gaactrcaac actggattgt
tcttttttaa g 519251DNAHomo sapiens 92cccatgttct gaaggtggca
cccaastctt gtacagtcct ttcctgcagg a 519351DNAHomo sapiens
93aacccctctc cttgggtgcc tctccytcat aggcctgagt tcctggcact g
519451DNAHomo sapiens 94cagctgcaag ccctgtggga ctctcsaggc ccatcccaga
ggcatgtggg g 519551DNAHomo sapiens 95ccctgacctc actgaccttg
cagccrtgtg gtgtccatac tgtcacatga a 519651DNAHomo sapiens
96tgtcacctgc tcctctgaca ctgtcscttc tccatggcat tagattttca g
519751DNAHomo sapiens 97ggagtacagg tgtgtgcttg gtctgmggct ccaacttttt
gttgttgttt c 519851DNAHomo sapiensmisc_feature(26)..(26)this t may
be missing 98agctaggact aaaggcatgc accactacac ctggctaatt taaaaatttt
t 519951DNAHomo sapiens 99ccacctcagc ctcctgagta gctagsacta
aaggcatgca ccactacacc t 5110051DNAHomo sapiens 100ggctgctttg
aggaggcctc tccacygggc tgctgtagtc accaagtcca g 5110151DNAHomo
sapiens 101agcaaagtca tgaagtggga agtcaygaat tgggaatggg tgtccttgtt a
5110251DNAHomo sapiens 102caggccaaga cagggtagct ggaggrgggc
tcacccctga caaaggagca t 5110351DNAHomo sapiens 103ggtagggccg
ctggaccctg gacacrgatt ggaaggaacc agcactagca g 5110451DNAHomo
sapiens 104ctaagggacc atgggagctc caagcrcgct cacagtgggg accaggtcct g
5110551DNAHomo sapiens 105gcacaggatg tgttaccggg ctcackgagt
gactcaggga actagtgccg c 5110651DNAHomo sapiens 106acaggttctc
ctgggcccgc ctcccrcttg aacttcagcc tggggcacag g 5110751DNAHomo
sapiens 107cactgttgtg ggcggcaggg ctggcmtttc tcatctggga catgccacgt t
5110851DNAHomo sapiens 108tgggtgtgcc tttctaaaat ggagcrtcca
gcagagagtg ggatctccta t 5110951DNAHomo sapiens 109ccccctaggg
cggagcctct gcttcyctgt tctcttctgc tctgtcctct g 5111051DNAHomo
sapiens 110aaatccccta gaagcctggt gtccgyatga cctcccccta gggcggagcc t
5111151DNAHomo sapiens 111ccagggtggg tacagattcc ggcccrgtgc
atgggcacag gtctgctgag c 5111251DNAHomo sapiens 112aacggaagcc
ggggcagtgc cagggygggt acagattccg gcccggtgca t 5111351DNAHomo
sapiens 113gcacaacctg aggtctcctg agcttkctgt gcagcccagt ctttctctcc g
5111451DNAHomo sapiens 114atttcagagc acaacctgag gtctcytgag
cttgctgtgc agcccagtct t 5111551DNAHomo sapiens 115cgcatgttgg
ccctctgtgg agaacrgagg atgcacagcc atttcagagc a 5111651DNAHomo
sapiens 116cctttccgag ggtcactgca gccgcrtgtt ggccctctgt ggagaacgga g
5111752DNAHomo sapiensmisc_feature(26)..(27)these two nucleotides
(ca) may be missing 117ccaagccaca gtggctctca gtgtgcatgc agggtgctgt
tagcattggt tc 5211852DNAHomo sapiensmisc_feature(26)..(27)these two
nucleotides (gt) may be missing 118cacgtccaag ccacagtggc tctcagtgtg
catgcagggt gctgttagca tt 5211951DNAHomo sapiens 119gcaggatgag
gcacgtccaa gccacrgtgg ctctcagtgt gcatgcaggg t 5112051DNAHomo
sapiens 120cctgtgtgcc gagcagagct gccccrtgtg taaacgctta gaactggcct c
5112151DNAHomo sapiens 121ccaaagggca gggcttcttg cagcarttcc
agcctttgct gggggtttcc a 5112251DNAHomo sapiens 122gaatcctggt
ccccctttat cacacyggat cagccccaaa gggcagggct t 5112351DNAHomo
sapiens 123gacagtggca ggagggggac actccyagag tgctgccaga aagaggcgag g
5112451DNAHomo sapiens 124ggtcaggctg ttcttgaact cctgamctca
ggtgatccac ccgcctcagc c 5112551DNAHomo sapiens 125ttttaataga
gactggggtt tcaccdtgtt ggtcaggctg ttcttgaact c 5112651DNAHomo
sapiens 126ggctggagtg taatggcacc atctcrgctc actgcaacct ccacctcccg a
5112751DNAHomo sapiens 127cactgtatgg cctggtttct cctagrttat
aattgtagag cgaagattat t 5112851DNAHomo
sapiensmisc_feature(26)..(26)this nucleotide may be missing
128cacttctcac cgtgtccctt cagcttctta tcactgtatg gcctggtttc t
5112951DNAHomo sapiens 129tattggatac aagacaaggg ggcagrgtaa
ggagtgtgag ccatctccag t 5113051DNAHomo sapiens 130ccagcctggg
caacacagtg agactscatc tcaaaaaaag aaataaggaa a 5113151DNAHomo
sapiens 131gcagacgcct gtaatcccaa ctactyggga ggctgaagtg ggagaatcgc t
5113251DNAHomo sapiens 132caccattctc ctgcctcagc ctcccragta
gctgggacta caggtgcctg c 5113351DNAHomo sapiens 133agctcactgc
aagctccgcc tcctgrgttt acaccattct cctgcctcag c 5113451DNAHomo
sapiens 134gtgatctcag ctcactgcaa gctcckcctc ctgggtttac accattctcc t
5113551DNAHomo sapiens 135aaactgggaa gggagggttg gccccygtga
aaccaactga tctgggtttg c 5113651DNAHomo sapiens 136ctgacaacat
gagaaaaagc tggctycatg ctgatttgtc tagatgtgcc t 5113751DNAHomo
sapiens 137ctccttttga tgccgaatcc cctttyatgg gactccgcca gcacgggtgc a
5113851DNAHomo sapiens 138agataagggc attatccccc taagtytcgt
atgatattcc ccattctgag t 5113951DNAHomo sapiens 139tttgttcttt
cccttaaaat aggaarataa gggcattatc cccctaagtc t 5114051DNAHomo
sapiens 140gcccatccca gaggcatgtg gggtcrgata ccagtgtttc aaggcacctg c
5114151DNAHomo sapiens 141gtattccagc tttcaaaaca acaaamaaca
acaaaaactt ttctggaaag a 5114251DNAHomo sapiens 142gggcccagga
ctccccaggg tcgggsggat gtgtggtgtg caggaccacg t 5114351DNAHomo
sapiens 143aaggggccca ggactcccca gggtckgggg gatgtgtggt gtgcaggacc a
5114451DNAHomo sapiens 144tgctccacca ggaaggggcc caggastccc
cagggtcggg gggatgtgtg g 5114551DNAHomo sapiens 145agtctcgtat
gatattcccc attctragtc cagaatacct agaaatttgg a 5114651DNAHomo
sapiens 146ccatcgagat caaccccgac tgtgcygcca tcacccagcg gatggtggat t
5114751DNAHomo sapiens 147ttcaataact atattgccat gaaaakagaa
tactcaataa tagtttctga t 5114851DNAHomo sapiens 148atctttcttt
cttttttttc tttttytctt tttttttttt tttttttttt t 5114951DNAHomo
sapiens 149caggtcctgg gggctgggga caccasggag gtgaaatacc cctccagcgg g
5115051DNAHomo sapiens 150ctttctttct tttttttctt tttttytttt
tttttttttt tttttttttt t 5115151DNAHomo
sapiensmisc_feature(26)..(26)y may be c or t, or may be missing
151ctagttatct ttctttcttt tttttytttt tttctttttt tttttttttt t
5115251DNAHomo sapiens 152taaaaataca aaacattagc cgggcrtggt
ggtgcactca ggaggctgag g 5115351DNAHomo sapiens 153gtagctgcag
ctataggcac accacsatgc ctggctcaat gggtattttg t 5115451DNAHomo
sapiens 154gctgaggcgg gataatcgct tgaacyggga ggtggggggc tgcagtaagc c
5115551DNAHomo sapiens 155gggaggccga ggtgggcaaa tcaccygagt
ccagaagttc gagaccagcc t 5115651DNAHomo sapiens 156gtaagcaaac
ccttttctga tagcakagat aggcaagcat cctatgaggt t 5115751DNAHomo
sapiens 157ctcctgacct cgtgatctgc ccgccycggc ctcccaaagt gctgggatta c
5115851DNAHomo sapiens 158aagttagccg ggcgtgctgg cgggckcctg
tagtcccagc tactgggagg c 5115951DNAHomo sapiens 159tttttctttt
cttttctttt cttttytttt tttttttttt tttctgtaga g 5116051DNAHomo
sapiens 160gttgaaagtt actgaaaaca tcttgkaagc ttttttaggc caatatatta t
5116151DNAHomo sapiens 161aaagttacgc ttaataatga atgttkcagc
actttcttct cttcaggtat t 5116251DNAHomo sapiens 162taaaaataca
aaaattagct gggcgyggtg ccatgtgcct gtggtcccag c 5116351DNAHomo
sapiens 163agaccagtag tggccccgaa tgccargctg cgctgttatt tattggatac a
5116451DNAHomo sapiens 164cactgtgtta gcaaggatgg tctcgmtctc
cagacctcgt gatccacccg c 5116551DNAHomo sapiens 165agcccctggg
tccagagatg agcgcrgggc ctggctgcag cctgtggggt c 5116651DNAHomo
sapiens 166tgccatggtc ggatgagagc agccayggac aatgtctgtg caattgtgcg t
5116751DNAHomo sapiens 167aaaaaagcct tcccctgagc ctgggkgcct
ggccccactg aggataccag g 5116851DNAHomo
sapiensmisc_feature(26)..(26)this nucleotide may be missing
168gtggcatgca ggagctggag ggggggtctt cctgggcggc ctgtgtagca g
5116951DNAHomo sapiensmisc_feature(26)..(26)this nucleotide may be
missing 169gagcatgtgg catgcaggag ctggaggggg ggtcttcctg ggcggcctgt g
5117051DNAHomo sapiensmisc_feature(26)..(26)this nucleotide may be
missing 170agcctgaggg accgtaggag ctgccctgca gagcccagtg agacactagt t
5117151DNAHomo sapiens 171aacatctgct ttgctgccga gctcakagga
gaccccagac ccctcccgca g 5117251DNAHomo sapiens 172tacaggtgcc
tgccaccacg cccggmtaat tttttgtgtt tttagtagag a 5117351DNAHomo
sapiens 173gatgccctga actcacgagg aggcaytgaa ccctggccgt ggagagggag g
5117451DNAHomo sapiens 174ccctttatca caccggatca gccccraagg
gcagggcttc ttgcagcagt t 5117551DNAHomo sapiens 175accctgcaca
ggcaagatcg tggacrccgt gattcaggag caccagccct c 5117651DNAHomo
sapiens 176accatcgaga tcaaccccga ctgtgycgcc atcacccagc ggatggtgga t
5117751DNAHomo sapiens 177actggaaggc agccgccctg ctcaargcct
aggccattgt cctcctcccg g 5117851DNAHomo sapiens 178caaggagatg
gggtggggaa gggccrctct gggcccagcc tgctctcccc c 5117951DNAHomo
sapiens 179cccagaccag acaccagggc agaaayggca caggaccaag gagatggggt g
5118051DNAHomo sapiens 180ttcagtcagc ctcagcctct ccaaasagcc
aggcattcca gtagagccct g 5118151DNAHomo sapiens 181ggctcctgct
ctttgggaga ggtggkgggc cgtgcctggg gatccaagtt c 5118251DNAHomo
sapiens 182ggaggggctc ctgctctttg ggagargtgg ggggccgtgc ctggggatcc a
5118351DNAHomo sapiens 183tggtttgtgt atgttcttgg taaacyagcc
cttggtctta cacatcattt c
5118451DNAHomo sapiens 184aggcacccag ccccagtttc cccacytggg
aagggggcta cttgtggcta g 5118551DNAHomo sapiens 185ttcttcaggg
gctccaggag gacgartgtg tatcctccca ttgctctgtg c 5118656DNAHomo
sapiensmisc_feature(26)..(31)this group of 6 a nucleotides may be
missing 186aggtattgag tcaaaaaaaa aaaaaaaaaa agccttcccc tgagcctggg
ggcctg 5618751DNAHomo sapiensmisc_feature(26)..(26)this nucleotide
may be missing 187gaagcagggc cctgactgcc ccccccggcc cccctctcgg
gctctctcac c 5118851DNAHomo sapiens 188caggtctggc ccatggaagg
gagggraggg ggccccggcg gggccacagt a 5118951DNAHomo sapiens
189cccatggccc ggagttgggg gtagtsacgg gtggccaaag gagaggctgt a
5119051DNAHomo sapiens 190tctccaacag gctccctgtt ggaggmcttg
gggtacccca gggcctttcc c 5119151DNAHomo sapiens 191gagggccttg
gtgacttctc caacargctc cctgttggag gccttggggt a 5119251DNAHomo
sapiens 192gtgaagtgat ctgacgttgg gtgggrgtct ccggacttgg ggtggggaat c
5119351DNAHomo sapiens 193cgtgggcgac aagaaaggtg gggtcygggc
cagcaggtgc tcagctctgg g 5119451DNAHomo sapiens 194cctccactcc
tttactgtgg ccccgycggg gccccctccc ctcccttcca t 5119552DNAHomo
sapiensmisc_feature(26)..(27)this group of 2 a nucleotides may be
missing 195ttccttaaaa aaaaaaaaaa aaaaaaagcc agctgggcac ggtggctcat
gc 5219653DNAHomo sapiensmisc_feature(26)..(28)this group of 3 t
nucleotides may be missing 196agcatgttta attttttttt ttttttttga
gacggggtct tgctctgttg ccc 5319752DNAHomo
sapiensmisc_feature(26)..(27)one or both of these 2 a nucleotides
may be missing 197tgtctcaaaa aaaaaaaaaa aaaaaaagcc tgggactctt
agcgcctcag ag 5219851DNAHomo sapiens 198cagactagga gcacgagggg
cacagscccc atgcctggct aggtagggcc g 5119951DNAHomo sapiens
199ttacaggaga agctgttatc accccrtttc cagggggctg ggaaccctgg g
5120051DNAHomo sapiens 200ctggggagaa gttgggaagt ctggcyagtg
gggccggtgc ctggtgacct c 5120151DNAHomo sapiens 201ccaggctttt
tttttttttt tttttkgaga cagagtcttg ctctgtcgcc c 5120251DNAHomo
sapiens 202caccgccatt gccgccatcg tcgtgsggct tctggggcag ctagggctgc c
5120351DNAHomo sapiens 203tctttcaaag cttcttggct gcatgygtca
ggtgggcaag ctcagaagtt a 5120451DNAHomo sapiens 204gagacaaatt
agaaatgtca gtctgragag agtggtaggt agccagatac t 5120551DNAHomo
sapiens 205tgcaattcaa aatcaagggc tgcttygagg aggcctctcc accgggctgc t
5120651DNAHomo sapiens 206aagggagggr agggggcccc grcggrgcca
cagtaaagga gtggaggggc c 5120751DNAHomo sapiens 207gtggttactt
tctggagaga gcatgyggca tgcaggagct ggaggggggg t 5120851DNAHomo
sapiens 208gagagcccct atctttaaaa aaaaawaata ataataaaat aaaaaaataa a
5120951DNAHomo sapiens 209gaaaagatcg tttgagcctg ggaggyggag
gctgccatga gccatgatct t 5121051DNAHomo sapiens 210accactggaa
ggaccggtac ctgccrgaca cgcttctctt ggaggtgagc c 5121151DNAHomo
sapiens 211tggcccgcct gctgtcacca ggggcraggc tcatcaccat cgagatcaac c
5121251DNAHomo sapiens 212tgtgaggcac tgaggatgcc ctcacrcgtg
catctgcatg tggcgtgcat g 5121351DNAHomo sapiens 213agcatgcgga
gcccgggaac gcacaragcg tgctggaggc cattgacacc t 5121451DNAHomo
sapiens 214aacacagagc tgccctctct gaatcmccga accgcccacc ttggggccct g
5121551DNAHomo sapiens 215tgggaaccac catccgatca accctyggat
gcaacaaccg gagcacacag t 5121651DNAHomo sapiens 216caggacacaa
aaatccctgg ctggaraaat ccaaaaagca ggtctgttag c 5121751DNAHomo
sapiens 217aataaaaagc aacaggacac aaaaayccct ggctggaaaa atccaaaaag c
5121851DNAHomo sapiens 218ctcctacggt ccctcaggct tggagrgtca
ctttaaacaa taaaaagcaa c 5121951DNAHomo
sapiensmisc_feature(26)..(26)this nucleotide may be missing
219aaagctgctg ctgcttcatt ttatttattt atttatttat ttatttattt a
5122051DNAHomo sapiensmisc_feature(26)..(26)this nucleotide may be
missing 220gagcccgaga ggggggccgg ggggggcagt cagggccctg cttcgctgcc t
5122152DNAHomo sapiensmisc_feature(26)..(27)one or both of these t
nucleotides may be missing 221tctttttctt tttttttttt tttttttaag
ggggaactca ttcctcttcc tt 5222252DNAHomo
sapiensmisc_feature(26)..(27)these 2 a nucleotides may be missing
222gaccccgtct caaaaaaaaa aaaaaaatta aacatgctat gcacccacaa at
5222351DNAHomo sapiensmisc_feature(26)..(26)this nucleotide may be
missing 223tcaggggaag gctttttttt ttttttgact caatacctaa tagctaaagg g
5122451DNAHomo sapiensmisc_feature(26)..(26)this nucleotide may be
missing 224gctggctttt tttttttttt ttttttaagg aaaataacaa gtgttagcaa g
5122551DNAHomo sapiensmisc_feature(26)..(26)this nucleotide may be
missing 225ccagcttttt tttttttttt ttttttggta gagatggagt ggaggtgggg t
5122651DNAHomo sapiens 226ctcctctgac actgtcgctt ctccayggca
ttagattttc agtcctgctc a 5122751DNAHomo sapiens 227ttctcgagac
agtctctcgc tctgtygccc aggctggagt gcagtggcgc g 5122851DNAHomo
sapiens 228gggttctgtg agcatcggag gcacgrgggg tgaggggctc aggagcaggt t
5122951DNAHomo sapiens 229ctgcgtccgg ccgtattcca gctttyaaaa
caacaaaaaa caacaaaaac t 5123051DNAHomo sapiens 230gggacaggcg
ggcactgggt gcctcyttgc accagccagg cccagcctgc a 51231119DNAHomo
sapiensmisc_feature(26)..(92)n can be a, c, g, or t 231gcctttggcc
ttgagcactt ccccannnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 60nnnnnnnnnn
nnnnnnnnnn nnnnnnnnnn nngtccccca tggctcttgg ccattggac
11923251DNAHomo sapiens 232cttggccatt ggaccccagt tggccrcaga
gcctttggcc ttgagcactt c 5123351DNAHomo sapiens 233aacacaaaaa
agttagccgg gcgtgstggc gggcgcctgt agtcccagct a 5123451DNAHomo
sapiens 234ggagtttaag accagcctgg gcaacrtagc aagacgctgt ctctacaaaa a
5123551DNAHomo sapiens 235ctgggagaca ggggccccat cttcargtgt
tggccagaac acaggaaatt c 5123651DNAHomo sapiens 236aagggagggt
tagccttggg aaaccratct gggtttgcca cgggggctta c 5123751DNAHomo
sapiens 237ctgggcgaca gagcaagact ctgtcycaaa aaaaaaaaaa aaaaaagcct g
5123851DNAHomo sapiens 238acggagcttg caatgagccg agattrtgcc
actgcactcc agcctgggcg a 5123951DNAHomo sapiens 239atcctggcta
acacggtgaa accccwtctc tactaaaaat acaaaaaatt a 5124051DNAHomo
sapiens 240ggctggccaa catggcaaaa ccccayctgt actaaaaata caaaaattag c
5124151DNAHomo sapiens 241aggccctgtc tctacaaaac aaaaarttga
aaaattagct gggcatggtg g 5124251DNAHomo sapiens 242actttgggag
tccgaggagg gaggaytcct tgagcccagg agtttgagac c 5124351DNAHomo
sapiens 243gattattata atattggaat aaagaktaat tgctacaaac taatgattaa c
5124451DNAHomo sapiens 244ttaggcctcc ggataactgt gggcaracct
gacactccac aagaggtggt t 5124551DNAHomo sapiens 245agggggcagg
gtaaggagtg tgagcyatct ccagtgacag gtaaggtcac a 5124651DNAHomo
sapiens 246tgcagagatg agagatcgta gaaatraaga cacaagacaa agagatagaa g
5124751DNAHomo sapiens 247gtatttttag tagagatggg gtttcrccac
actggccagg ctggtcttga a 5124851DNAHomo sapiens 248tttttttttt
ttgagacaga gtcccrctgt gttgctcagg ctggagtgca g 5124951DNAHomo
sapiens 249agcattaaaa aaaatttttt tttagktttt tttttttttt ttttttttga g
5125051DNAHomo sapiens 250gaaatgctgt cagaagccta ccccayggta
cctgtcatgg gccttttcat t 5125151DNAHomo sapiens 251gactccatct
caaaaaaaga aataargaaa tgctgtcaga agcctacccc a 5125251DNAHomo
sapiens 252taatcccaac actttgggag gccaasgtgg ctatatcact tgaagtcagg a
5125351DNAHomo sapiens 253ttttgtagtt tagtagagat ggggtytcac
cacattggcc aggatggtct c 5125451DNAHomo sapiens 254gctcattttt
tgcattttta gtggaracag agtttcacca tgttggccag g 5125551DNAHomo
sapiens 255aaactggaca ctgctgttag cagccrgact aggagcacga ggggcacagc c
5125651DNAHomo sapiens 256gtgatctcgg ctcactgcaa gctccrcctc
tggggttcac gccattctcc t 5125751DNAHomo sapiens 257ttgggacacc
caccctcacg gcctcyccac ctggtgctcg ctcacctgca g 5125851DNAHomo
sapiens 258agtgaggatg cagtgctggt ttctgyccac ctacacctag agctgtcccc a
5125951DNAHomo sapiens 259cttccctgtt ctcttctgct ctgtcytctg
gtgccctgag gctggcctcc a 5126051DNAHomo sapiens 260cagtgccagg
gtgggtacag attccsgccc ggtgcatggg cacaggtctg c 5126151DNAHomo
sapiens 261accggtacct gccggacacg cttctyttgg aggtgagccc caaccaggat g
5126251DNAHomo sapiens 262ctctgaactg caacactgga ttgttytttt
ttaagactca atcatgactt c 5126351DNAHomo sapiens 263cccggccccc
ctctcgggct ctctcwccca gcctggtact gaaggtgcca g 5126451DNAHomo
sapiens 264ctgaggcact ggggctggrg cctgtscctt atcggctgga acgagttcat c
5126551DNAHomo sapiens 265gcaccagagg gcacgagaag gctggytccc
tggcgctgac acgtcaggca a 5126651DNAHomo sapiens 266gctgcagcat
gcggagcccg ggaackcaca gagcgtgctg gaggccattg a 51267136DNAHomo
sapiens 267caagttgttg tgtaggatat tggcaatttt tgcttgtcag ctccatggta
cttcttccga 60atcaraaatt tatctcctca gtggccctca aagcactttc ttcccactat
aggcttgttc 120agtttagagt agacag 13626851DNAHomo sapiens
268actctctaag gtcatgtgaa cagtawgcag tgctactcga actcctctgc t
5126951DNAHomo sapiens 269gaaaactatg tgaatataat agatcyttaa
ttcatatttg tggattttat g 5127051DNAHomo sapiens 270ttatgtaaac
ttcgcttaca aactayactt gtgtgacact tatatgagca a 5127151DNAHomo
sapiens 271ccagatggtg gcaatttcac atggcrcaac ccgaaagatt aacaaactat c
5127251DNAHomo sapiens 272cagcgccttc ttgctggcac ccaatrgaag
ccatgcgccg gaccacgacg t 5127351DNAHomo sapiens 273tgcgccggac
cacgacgtca cgcagsaaag ggacgaggtg tgggtggtgg g 5127451DNAHomo
sapiens 274cctgtgctga tctggtcatg ggcctrgcag tggtgccctt tggggccgcc c
5127551DNAHomo sapiens 275caaagacacc actaatacat gggaawtcaa
accctgaaaa ttaatttcac t 5127651DNAHomo sapiens 276tcccgagtag
ctgggactac aggtaygtgc caccacacct ggctaatttt t 5127751DNAHomo
sapiens 277ttctatagct tcaaaatgtt cttaawgtta agacattctt aatactctga a
5127851DNAHomo sapiens 278tgacagcgag tgtgctgagg aaatcrgcag
ctgttgaagt cacctcctgt g 5127951DNAHomo sapiens 279cctccaagcc
agcgtgtgtt tacttkctgt gtgtgtcacc atgtctttgt g 5128051DNAHomo
sapiens 280tatggctgtg gttcggtata agtctragca tgtctgccag ggtgtatttg t
5128151DNAHomo sapiens 281aaaagctccc gggttggctg gtaagsacac
cacctccagc tttagccctc t 5128251DNAHomo sapiens 282cagttgggcc
ccgcccgggc cagccycagg agaaggaggg cgaggggagg g 5128351DNAHomo
sapiens 283cgcagagccc cgccgtgggt ccgccygctg aggcgccccc agccagtgcg c
5128451DNAHomo sapiens 284ctgaggcgcc cccagccagt gcgctyacct
gccagactgc gcgccatggg g 5128551DNAHomo sapiens 285atggtgtgga
ttgtgtcagg ccttayctcc ttcttgccca ttcagatgca c 5128651DNAHomo
sapiens 286cttgcccatt cagatgcact ggtacmgggc cacccaccag gaagccatca a
5128751DNAHomo sapiens 287ctggtgatca tggtcttcgt ctactscagg
gtctttcagg aggccaaaag g 5128851DNAHomo sapiens 288gcaggtcttc
tttgaaggcc tatggsaatg gctactccag caacggcaac a 5128951DNAHomo
sapiens 289caggcacgga agactttgtg ggccaycaag gtactgtgcc tagcgataac a
5129051DNAHomo sapiens 290aagactttgt gggccatcaa ggtacygtgc
ctagcgataa cattgattca c 5129151DNAHomo sapiens 291attgtagtac
aaatgactca ctgctdtaaa gcagtttttc tacttttaaa g 5129251DNAHomo
sapiens 292tttttctact tttaaagacc cccccsccca acagaacact aaacagacta t
5129352DNAHomo sapiensmisc_feature(26)..(26)r is a or g or absent
293tttctacttt taaagacccc cccccrccca acagaacact aaacagacta tt
5229451DNAHomo sapiensmisc_feature(26)..(26)this nucleotide may be
missing 294ggtaataaac ttagaataaa attgtaaaaa ttgtatagag atatgcagaa g
5129551DNAHomo sapiens 295tattttttta agctgtaaaa agagaraaaa
cttatttgag tgattatttg t 5129651DNAHomo sapiens 296tatctgaagg
agattttcct tcctamaccc ttggacttga ggattttgag t 5129751DNAHomo
sapiens 297ctgaaggaga ttttccttcc tacacycttg gacttgagga ttttgagtat c
5129851DNAHomo sapiens 298ccccactcct cttatttgct cacacrgggt
attttaggca gggatttgag g 5129951DNAHomo
sapiensmisc_feature(26)..(26)this nucleotide may be missing
299agcttcagtt gttttcccga gcaaaggtct aaagtttaca gtaaataaaa t
5130051DNAHomo sapiens 300aagtctaaag tttacagtaa ataaawtgtt
tgaccatgcc ttcattgcac c 5130151DNAHomo sapiens 301aggtctaaag
tttacagtaa ataaawtgtt tgaccatgaa aaaaaaaaaa a 5130251DNAHomo
sapiens 302cctgctggtc atcgtggcca tcgccyggac tccgagactc cagaccatga c
5130351DNAHomo sapiens 303acggctcgac gggtaggtaa ccgggkcaga
gggaccggcg gctcagggtc g 5130451DNAHomo sapiens 304gtgccctggc
gtttttgtgt aactaratat gcgttccagg gtctctgatc t 5130551DNAHomo
sapiens 305ctcctccctc agtggtagtg tccagstgcc gtggagcagc aggctggctt t
5130651DNAHomo sapiens 306ccaagaaatc ttgcacacct cagacrccag
agatctcacc ctgccctggt t 5130751DNAHomo sapiens 307ctcagtgcat
tcagaggccc acagaygctg cctgcttcca agggcacaga a 5130851DNAHomo
sapiens 308gagagctccc ctggttccat tccttytgcc acccaaaccc tgatgagacc t
5130951DNAHomo sapiens 309gagacgaggc tggttctttt tccttsggga
taattttagg ttctgaattc c 5131051DNAHomo sapiens 310ctttaagcgt
cgctactcct cccccragag cggtggcacc gagggagttg g 5131151DNAHomo
sapiens 311taagaggata atacagattt ttgtasctgg ggaaggtgag tgggaaggta g
5131252DNAHomo sapiensmisc_feature(26)..(27)this ca dinucleotide
may be missing 312acacacacgc acacacacac acacacacca tgtaaggcac
cactggatta ta 5231351DNAHomo sapiens 313ttcatcctcg gccccctttc
cctccrtttg ttttcttttc ataatccact t 5131451DNAHomo sapiens
314tttcacccca gggtctatta tctccrcttt ttttcccagg gcttcttggg g
5131551DNAHomo sapiens 315gtgcagatgt gtgccctccc gctccmtggg
ctgggttgga gtagggatgg g 5131652DNAHomo
sapiensmisc_feature(26)..(27)this gg dinucleotide may be missing
316gacctggctc ggacttgaag ggcagggnct agtgcccccc cnacccgccc cc
5231751DNAHomo sapiens 317tgtcgcccac gcgggaatgc agtggygcga
tctcagctca ctgcagtctt g 5131850DNAHomo
sapiensmisc_feature(26)..(26)this nucleotide may be missing
318cagagacgaa accctgtctc tatttaaaaa aaaaaaaaat ccctaaagcc
5031951DNAHomo sapiens 319gggacaccgc agcgctttcc ggtggmgcac
cttgggtcct tgggtgagga a 5132051DNAHomo sapiens 320ctccggagcc
ctgcgccgcc gcccgyccgg ccctcttccc ctcgggcgtt c 5132151DNAHomo
sapiens 321ccggccccgg tggggacgtg cgctcygccc gaaggggtgc ccgcctgcgg c
5132251DNAHomo sapiens 322tctctggccc cggccccggt ggggaygtgc
gctccgcccg aaggggtgcc c 5132351DNAHomo sapiens 323cgccggcgcc
gtcgcgctct ctggcyccgg ccccggtggg gacgtgcgct c 5132451DNAHomo
sapiens 324gccagagagc gcgacggcgc cggcgkagac tcctcgggcg gaaagcggcc c
5132551DNAHomo sapiens 325cctcgggcgg aaagcggccc agctcyccgc
gcagcaagcg cagctggcgc g 5132651DNAHomo sapiens 326cgcagccgac
ctggtgatgg gactcytggt ggtgccgccg gcggccacct t 5132751DNAHomo
sapiens 327agctgcccct ttaagcgtcg ctactyctcc cccaagagcg gtggcaccga g
5132851DNAHomo sapiens 328gtctttttct ttttcttttt cttttycttt
tctttttttt tttttttttg a 5132954DNAHomo
sapiensmisc_feature(26)..(29)this tetranucleotide (cttt) may be
missing 329ttctttttct ttttcttttt cttttctttt tttttttttt ttttttgaga
cggc 5433051DNAHomo sapiens 330ggctaatttt tttttttttt ttttgkattt
ttagtagaga cagggtttct c 51
* * * * *