U.S. patent application number 12/580722 was filed with the patent office on 2010-05-06 for compositions and methods for treatement of cancer.
This patent application is currently assigned to Yissum Research Development Company of the Hebrew University of Jerusalem. Invention is credited to Arnold I. Freeman, Eithan Galun, Evgeniya Greenbaum, Charles S. Irving, Amos Panet, Linda Rasooly, Zichria Zakay-Rones.
Application Number | 20100113335 12/580722 |
Document ID | / |
Family ID | 11075779 |
Filed Date | 2010-05-06 |
United States Patent
Application |
20100113335 |
Kind Code |
A1 |
Zakay-Rones; Zichria ; et
al. |
May 6, 2010 |
COMPOSITIONS AND METHODS FOR TREATEMENT OF CANCER
Abstract
The present invention discloses lentogenic viral strains useful
in the treatment of cancer. A preferred viral strain of Newcastle
disease Virus (NDV) is specifically characterized in terms of
biological activities. The present invention further discloses
treatment of cancer by application of a clonal NDV strain to
tumors. According to an alternative preferred embodiment the use of
at least one isolated viral protein or subunit or analog thereof,
or an isolated polynucleotide encoding same, is used in the
treatment of cancer.
Inventors: |
Zakay-Rones; Zichria;
(Jerusalem, IL) ; Panet; Amos; (Mevaseret Zion,
IL) ; Greenbaum; Evgeniya; (Jerusalem, IL) ;
Galun; Eithan; (Har Adar, IL) ; Freeman; Arnold
I.; (Modi'in Ilit, IL) ; Rasooly; Linda;
(Jerusalem, IL) ; Irving; Charles S.; (Caesarea,
IL) |
Correspondence
Address: |
WINSTON & STRAWN LLP;PATENT DEPARTMENT
1700 K STREET, N.W.
WASHINGTON
DC
20006
US
|
Assignee: |
Yissum Research Development Company
of the Hebrew University of Jerusalem
and Theravir Management L.P.
|
Family ID: |
11075779 |
Appl. No.: |
12/580722 |
Filed: |
October 16, 2009 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11561510 |
Nov 20, 2006 |
7615209 |
|
|
12580722 |
|
|
|
|
10800256 |
Mar 11, 2004 |
7223389 |
|
|
11561510 |
|
|
|
|
PCT/IL02/00765 |
Sep 12, 2002 |
|
|
|
10800256 |
|
|
|
|
Current U.S.
Class: |
514/7.7 |
Current CPC
Class: |
C12N 2760/18122
20130101; C12N 2760/18132 20130101; A61P 35/00 20180101; C12N 7/00
20130101; A61K 35/768 20130101; C12N 2760/18164 20130101; C07K
14/005 20130101; A61K 48/00 20130101 |
Class at
Publication: |
514/8 |
International
Class: |
A61K 38/16 20060101
A61K038/16; A61P 35/04 20060101 A61P035/04 |
Foreign Application Data
Date |
Code |
Application Number |
Sep 12, 2001 |
IL |
145397 |
Claims
1. A composition for the treatment of cancer comprising at least
one isolated viral glycoprotein or a subunit or analog thereof
having oncolytic activity and a suitable carrier.
2. The composition according to claim 1 wherein the at least one
viral glycoprotein is from Newcastle Disease Virus (NDV).
3. The composition according to claim 2 wherein the at least one
viral glycoprotein is the F glycoprotein of NDV.
4. The composition according to claim 2 wherein the at least one
viral glycoprotein is the HN glycoprotein of NDV.
5. The composition according to claim 2 comprising the F
glycoprotein and HN glycoprotein of NDV.
6. The composition according to claim 2 wherein the viral
glycoprotein is from a velogenic strain of NDV.
7. The composition according to claim 2 wherein the viral
glycoprotein is from a mesogenic strain of NDV.
8. The composition according to claim 2 wherein the viral
glycoprotein is from a lentogenic strain of NDV.
9. The composition according to claim 8 wherein the lentogenic
strain of NDV is the HUJ.
10. A method for treating cancer in a patient comprising
administering to the patient a therapeutically effective amount of
a pharmaceutical composition according to claim 1.
11. The method of claim 10 wherein the step of administering is
selected from intravenous, oral, buccal, intranasal, inhalation,
topical application to a mucosal membrane or injection, including
intradermal, intrathecal, intracisternal, and intralesional
injection.
12. The method according to claim 10 wherein the step of
administering comprises locally administering the composition to a
tumor or in its vicinity.
13. A method of making the composition of claim 1 for treatment of
cancer which comprises incorporating in the composition an isolated
viral glycoprotein or a subunit or an analog thereof having
oncolytic activity or of an isolated polynucleotide encoding same.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a division of application Ser. No.
11/561,510 filed Nov. 20, 2006, which is a continuation-in-part of
application Ser. No. 10/800,256 filed Mar. 11, 2004, now U.S. Pat.
No. 7,223,389, which is a continuation of international application
no. PCT/IL02/00765 filed Sep. 12, 2002. The content of each prior
reference is expressly incorporated herein by reference
thereto.
FIELD OF THE INVENTION
[0002] The present invention relates to lentogenic strains of
Newcastle Disease virus that have oncolytic activities, and the use
of such viruses and/or isolated proteins derived from all strains
of the NDV virus in the treatment of cancer.
BACKGROUND OF THE INVENTION
[0003] Viruses are known to exert an oncolytic effect on malignant
cells and the use of oncolytic viruses as therapeutic agents has
been reported (Csatary et al. Cancer Detect Prev (1993)
17(6):619-27; Csatary et al. Anticancer Research (1999)
19(1B):635-8 and for review see Sinkovics J. of Clinical Virology
(2000) 16: 1-15).
[0004] Oncolytic viruses, for example the avian virus Newcastle
Disease Virus (NDV), have been shown to be cytolytic to tumor cells
in vivo and in vitro (Reichard et al. J. Surg Res (1992)
52(5):448-53; Bar Eli et al. J. Cancer Res Clin Oncol (1996) 122:
1-7 and Tsadok-David et al. (1995) J. Cancer Research Clinical
Oncology 121:169-174).
[0005] The Newcastle disease virus is an avian RNA paramyxovirus
that causes Newcastle disease in different avian species (dependent
on the virulence of the virus strain and on the age of the
individual bird), but that is considered minimally pathogenic in
humans. NDV is an enveloped virus containing a linear,
non-segmented, single-strand, negative sense RNA genome. The virion
consists of a coiled nucleocapsid containing single stranded RNA
and 6 structural polypeptides (M.W. 20,000-80,000). The
nucleocapsids are coated with protein and lipid envelopes. The
matrix protein (M), located in the inner surface of the viral
envelope, is involved in viral assembly and interacts with both the
viral membrane and the nucleocapsid proteins. On the outer surface
of the viral envelope are two viral glycoproteins: the
hemagglutinin-neuraminidase (HN) and the fusion glycoprotein (F).
The HN glycoprotein is involved in the binding of the virus to
cellular receptors. Monoclonal antibodies raised against this
protein were shown to neutralize NDV infectivity. The F protein,
which is first expressed as an inactive precursor (F0) and then
cleaved post-translationally to produce two disulfide linked
polypeptides (F1 and F2), is involved in penetration of NDV into
host cells by facilitating fusion of the viral envelope with the
host plasma cell membrane. Antisera to the F protein inhibited
hemolysis and virus-induced cell fusion. Since the F and HN
glycoproteins play a crucial role in NDV infectivity, much effort
has been done to clone NDV genes. EP Patent 227414 to Bingham et
al., discloses the cDNA sequence encoding the F and HN polypeptides
of NDV Beaudette C strain and envisages the use of this nucleotide
sequence for the preparation of labelled probes, which will be
utilized for diagnosis of NDV in poultry as well as for the
preparation of the F and HN polypeptides.
[0006] The state of proteolytic cleavage of the surface
glycoproteins F and HN is responsible for the virulence of the
different NDV strains. F0 of virulent strains is cleaved to F1 and
F2 in a wide range of host cells, whereas F0 of avirulent strains
is cleaved only in few host cells. Accordingly, these differences
are expressed in the classification of the different strains of NDV
as velogenic (highly pathogenic), mesogenic (intermediate in
pathogenicity) and lentogenic (apathogenic) strains.
[0007] In addition to their role in infectivity, the HN and F
surface glycoproteins of NDV have also been postulated to be
involved in the oncolytic capabilities of NDV (MSc thesis by Alissa
Waldman-Kegnovitch (1999) Dept. of Virology, Haddasa Medical School
of the Hebrew University of Jerusalem).
[0008] The effect of oncolytic viruses on neoplastic cells is
attributed by some to the enhancement of the sensitivity of the
neoplastic cells to the cytolytic activity of tumor necrosis
factors and to the immune stimulatory properties of these viruses.
NDV in animals induces locally chemokines and cytokines such as
tumor necrosis factor alpha that affect T cell recruitment and
activation (Schirrmacher et al. (1998) Semin Oncol 25(6):677-96 and
Schirrmacher et al. (1999) Int J. Oncol 14(2):205-15). There are
other reports that attribute the killing effect of an attenuated
strain of NDV (73-T) on neuroblastoma cells to direct cytolysis
following replication of infectious virus (Lorence et al. J. Nat.
Cancer Inst. (1994) 86(16) 1228-1233). The killing effect of a
mesogenic strain of NDV (RO) on Daudi lymphoma cells and the effect
of NDV Ulster strain on metastatic Esb lymphoma and B16-F10
melanoma was found to be unrelated to viral replication since UV
inactivated viruses were found to be as effective as infectious
viruses in killing these tumor cells (Tsadok-David et al. (1995) J.
Cancer Research Clinical Oncology 121:169-174 and Schirrmacher et
al. (1997) Clin Cancer Res 3(7):1135-48).
[0009] Present efforts at cancer therapy using viruses involve the
use of live pathogenic viruses as cytolytic agents (see Csatary et
al. above and U.S. Pat. No. 5,602,023 to Csatary). WO 00/62735 of
Pro-Virus discloses the use of any interferon sensitive strain of
virus for killing neoplastic cells that are deficient in the
interferon response. The Pro-Virus disclosure supplies a catalog of
viral strains including three mesogenic strains of NDV (MK107, NJ
Roakin, and Connecticut-70726) shown to be useful for treatment of
human tumor xenografts in athymic mice. NDV administration to these
mice caused tumor regression, which was attributed to more
efficient and selective replication of NDV in tumor cells versus
normal cells. The differential sensitivity of tumor cells to
killing by NDV was disclosed to be correlated to an inability of
the cells to manifest interferon-mediated antiviral response. The
above patent application claims methods of infecting neoplasms or
tumors and methods of treating neoplasms or tumors by
interferon-sensitive, replication competent RNA or DNA viruses.
[0010] Alternative methods are mostly directed at developing
vaccines for anti tumor immunization. For example, NDV is used in
the preparation of an autologous tumor cell vaccine for humans
(reviewed in Schirrmacher et al. (1998) Semin Oncol
25(6):677-96).
[0011] Nowhere in the background art is it taught or suggested that
lentogenic strains of NDV are used for cancer therapy, or that
surface glycoproteins derived from different strains of NDV,
namely, velogenic, mesogenic or lentogenic strains, may have
oncolytic properties and be useful in the treatment of cancer.
SUMMARY OF THE INVENTION
[0012] The compositions and methods of the invention utilize
oncolytic properties of viruses and/or of viral proteins for the
killing of neoplastic cells. The present invention provides
compositions and methods for treatment of cancer that avoid
contacting a patient with pathogenic strains of viruses.
[0013] The present invention provides a clonal lentogenic oncolytic
strain of NDV, denoted herein HUJ, useful in treating cancer.
[0014] The present invention provides a pharmaceutical composition
comprising at least one lentogenic oncolytic strain of NDV for
treatment of cancer. The present invention further provides a
pharmaceutical composition comprising at least one lentogenic
oncolytic strain of NDV further comprising a suitable carrier.
[0015] Preferably, the HUJ strain of NDV (which is further
described below) is utilized in the treatment of cancer. More
preferably, the composition comprises 10.sup.6-10.sup.12 egg
infectious dose 50% (EID.sub.50) per each treatment dose of the HUJ
NDV strain. Alternatively and preferably the treatment with the HUJ
NDV will fall within the range of 20 EID.sub.50/cell to 2000
EID.sub.50/cell treated.
[0016] In an alternative embodiment the composition of the
invention contains at least one isolated viral glycoprotein or a
subunit or analog thereof having oncolytic activity. In a further
embodiment, the viral glycoprotein is derived from NDV. According
to another embodiment of the invention the composition comprises at
least the F glycoprotein of NDV. The term F protein as used herein
includes both F and F0. In a further embodiment the composition
comprises the F glycoprotein and the hemagglutinin activity
containing subunit of the HN glycoprotein of NDV. In yet a further
embodiment the composition comprises the F glycoprotein and the HN
glycoprotein of NDV. The term HN protein as used herein includes
both HN and its precursor HN0, which is cleaved at its C-terminus
to yield active HN. The viral glycoproteins utilized in this
embodiment are non-infectious and can, therefore, be the product of
any suitable strain of NDV. Preferably and alternatively, velogenic
strains of NDV are used, alternatively and preferably, mesogenic
strains, alternatively and preferably lentogenic strains. Further,
the composition may comprise any combination of viral proteins or
subunits or analogs thereof having oncolytic activity or a
combination of whole lentogenic oncolytic NDV viruses and viral
proteins or subunits or analogs thereof having oncolytic
activity.
[0017] The present invention further provides methods for treatment
of cancer utilizing the pharmaceutical compositions described
above.
[0018] According to a further embodiment of the invention the
treatment for cancer utilizes at least one isolated polynucleotide
encoding at least one viral polypeptide or an analog or subunit
thereof having oncolytic activity. In a further embodiment of the
invention the treatment for cancer utilizes isolated polynucleotide
encoding the F protein of NDV. In alternative embodiment, the
isolated polynucleotide encoding for the HN protein of NDV is
utilized. In a further embodiment a combination of the isolated
polynucleotides encoding the F and HN glycoproteins are used.
[0019] It is known that the proteins F and HN are glycoproteins.
The polynucleotides of the invention encode the polypeptide portion
thereof, i.e., that portion which is subsequently glycosylated in
vivo.
[0020] The F polypeptide is also processed in vivo by cleavage into
the two shorter polypeptides F1 and F2. Accordingly, the invention
encompasses a polynucleotide encoding F1 and F2 polypeptides as
separate molecules or as a single disulfide bridged molecule or
their bioprecursor F0 polypeptide.
[0021] It is explicitly to be understood that any fragment of the
polypeptides that retains the oncolytic activity of the intact
protein is within the scope of the present invention. Accordingly,
the polynucleotides encoding any such fragment are within the scope
of the invention
[0022] According to the important aspect of the invention, there is
provided an isolated polynucleotide encoding an F and/or HN
polypeptide of NDV RNA, a bioprecursor of a said polypeptide or any
active fragment of said polypeptide or an artificial polynucleotide
complementary to the polynucleotide encoding an F and/or HN
polypeptide of NDV RNA.
[0023] The invention further includes a host cell transfected or
infected with recombinant polynucleotides as defined above.
[0024] The polynucleotides of the invention may be used as
intermediates in the production of polypeptides by recombinant DNA
technology. It is contemplated, therefore, that an expression
vector of the invention containing an appropriate promoter and the
polynucleotides of the invention, expressed for example in yeast or
bacteria will give rise to the appropriate encoded polypeptides.
Alternatively and preferably the vector may be a viral vector.
[0025] According to a further aspect of the invention a lentogenic
strain of NDV, preferably the HUJ strain, is used in the
preparation of a composition for the treatment of cancer. In
another embodiment of the invention a viral glycoprotein or a
subunit or analog thereof is used in the preparation of a
composition for cancer treatment. Preferably, the NDV coat
glycoproteins, more preferably the F glycoprotein and/or the HN
glycoprotein, are used.
[0026] The method of the invention for treatment of cancer,
according to an embodiment of the invention, includes the step of
administering to a patient a therapeutically effective amount of a
composition comprising as an active ingredient a lentogenic
oncolytic strain of NDV, preferably the HUJ strain, and/or at least
one isolated viral protein as described above. The composition may
be administered to the patient through any suitable route. One
particularly preferred embodiment utilizes injection of the
composition directly into a tumor or adjacent to the tumor.
[0027] Thus, the compositions and methods of the invention provide
a treatment for cancer that does not share the risks that may be
involved in the use of live velogenic (highly pathogenic) or even
mesogenic (intermediate in pathogenicity) strains of viruses.
BRIEF DESCRIPTION OF THE DRAWINGS
[0028] The present invention will be understood and appreciated
more fully from the following detailed description taken in
conjunction with the drawings in which:
[0029] FIG. 1 is a graph showing the results of a representative
experiment of the cytotoxic effect of two NDV strains (HUJ and MTH)
on Daudi cells in culture;
[0030] FIG. 2 is a graph showing apoptosis of Daudi cells in
culture following interaction with two NDV strains (HUJ and
MTH);
[0031] FIGS. 3A and 3B depict graphs showing thermostability of
hemagglutinin activity at 56.degree. C., for two NDV strains (HUJ
and MTH) in two experiments;
[0032] FIG. 4 is a picture of an SDS Polyacrylamide gel after
electrophoresis of NDV virion proteins (strains HUJ and MTH);
[0033] FIGS. 5A and 5B show graphs of viability and mortality of
Daudi cells after incubation with NDV strains (Roakin and B-1) or
with surface glycoproteins (RHN and BHN) extracted from these
strains;
[0034] FIG. 6 depicts a graph showing the inhibition of cellular
DNA synthesis in Daudi cells (D-2) in response to their incubation
in the presence of NDV strains (Roakin and B-1) or in the presence
of the surface glycoproteins (RHN and BHN) extracted from these
strains;
[0035] FIG. 7 depicts the Cr.sup.51 release from NDV infected
cells;
[0036] FIGS. 8A, B and C depict graphs showing the effect of NDV
propagated in tissue culture or in embryonated eggs on Daudi cells:
the effect on the total number of cells (FIG. 8A), percentage of
dead cells following infection (FIG. 8B) and the effect of
treatment with trypsin on the cytotoxic activity of the NDV (FIG.
8C); and
[0037] FIG. 9 shows a histogram of the F glycoprotein activity as
indicated by hemolysis of erythrocytes.
[0038] FIG. 10 shows the predicted amino acid sequence of the F and
HN polypeptides.
DETAILED DESCRIPTION OF THE INVENTION
[0039] Viruses are known to exert oncolytic effect on tumor cells
and the use of oncolytic viruses as therapeutic agents has been
reported. As described above, some effort has been done to use
non-human viruses exhibiting medium to high pathogenicity for
treatment of cancer. However, the use of apathogenic (lentogenic)
non-human viruses or isolated viral proteins having oncolytic
activity for treatment of cancer has not been reported in prior
art. Thus, the present invention discloses compositions and methods
for treatment of cancer that utilize the oncolytic properties of
certain viruses and isolated viral components. The disclosed
compositions and methods provide, for the first time, safe,
effective and reliable means to treat cancer in an individual in
need thereof. These methods overcome the drawbacks of using
pathogenic strains of viruses for human therapy.
[0040] The present invention thus provides compositions and methods
for treatment of cancer using lentogenic oncolytic strain of
non-human virus, the Newcastle Disease virus (NDV). It further
provides methods for treatment of cancer comprising isolated viral
proteins or subunits or analogs thereof having oncolytic activity
as well as isolated polynucleotides or constructs containing same,
which encode for the viral proteins. The polynucleotides or
constructs containing same may include any vector polynucleotide,
including viral vector polynucleotide. The present invention
provides host cells containing the polynucleotides, constructs
containing same, and the vector polynucleotides as described above,
which will also be used for treatment of cancer. The present
invention further provides treatment of cancer using combination of
any of the above.
[0041] A modified lentogenic NDV strain denoted herein as HUJ is
disclosed below. It is desirable to obtain a clonal virus to ensure
or increase its homogeneity. Clonal virus can be produced according
to any method available to the skilled artisan, for example by
limiting dilution or by plaque purification. According to an
embodiment of the invention, a clonal HUJ strain prepared by
limiting dilution is used in the preparation of a composition for
the treatment of cancer, with or without an appropriate carrier
such as human serum albumin (HSA) or any suitable adjuvant. All
types of cancers may be included in the scope of the present
invention. As a non limiting example, the following cancers can be
treated according to the present invention: glioblastoma, lung
carcinoma, breast cancer, prostate, melanoma, leukemia and
sarcomas.
[0042] The present invention provides compositions and methods for
treatment of cancer utilizing at least one isolated viral proteins
having oncolytic activity, preferably the F and HN glycoproteins of
NDV. The F and HN glycoproteins were shown to play an important
role in viral infectivity. However, nowhere in the prior art is it
suggested that isolated F and HN proteins have oncolytic
activities. The present invention provides, for the first time,
direct evidence of the oncolytic effect of isolated viral proteins.
According to the invention, viral proteins, preferably, the F
and/or HN glycoproteins of NDV or analogs or subunits of these
glycoproteins or mixtures thereof, are used in the preparation of a
composition for the treatment of cancer.
[0043] The term "oncolytic activity" as used herein includes
cytotoxic effect in vitro and/or in vivo to tumor cells without any
effect to normal cells. The cytotoxic effect under in vitro
conditions is detected by various means as known in prior art, for
example, by staining with a selective stain for dead cells, by
inhibition of DNA synthesis or by apoptosis.
[0044] It should be appreciated by persons skilled in the art that
the term "protein analog" includes peptides or polypeptides having
the functionality of viral counterparts (i.e. fusion,
hemagglutinin, and neuraminidase proteins, etc.) and not
necessarily having the same sequence, secondary or tertiary
structure as the viral counterparts. Thus, truncated or altered
proteins displaying the oncolytic activity as the natural viral
proteins, may be used in the composition and method of the present
invention.
[0045] The fusion, hemagglutination and neuraminidase activities of
the F and HN glycoproteins of NDV may be responsible for the
oncolytic effect of the isolated proteins. However, the present
invention encompasses other viral proteins exhibiting other
activities that may be responsible for the oncolytic effect of
isolated viruses.
[0046] The proteins can be used in a composition with an adjuvant
such as alum hydroxide, emulsions or submicron emulsions (for
example, U.S. Pat. No. 5,576,016, 5,662,932, 5,716,637, 5,961,970)
or other known pharmaceutical carriers such as human serum albumin.
Also, genetically engineered viral proteins having oncolytic
activity, preferably the viral fusion, hemagglutination and
neuraminidase proteins are included in the scope of this
invention.
[0047] The present invention provides compositions and methods for
treatment of cancer comprising isolated polynucleotides and
constructs containing same encoding the F and HN proteins of the
HUJ strain of NDV. The nucleotide sequence encoding the F protein
of HUJ was found to be almost identical (3 nucleotide difference)
to the LaSota strain. Therefore, the present invention encompasses
the use of isolated polynucleotide sequences encoding the F protein
of other lentogenic strains.
[0048] The surface glycoproteins may be obtained from any naturally
occurring strain of NDV. Preferably, the glycoproteins are obtained
from a velogenic or a mesogenic NDV strain, such as the Roakin/46
VR 109 (RO) strain from the American type collection. Alternatively
and preferably the glycoproteins from HUJ or other lentogenic
strain are used. Also, the glycoproteins may be obtained from
genetically or otherwise engineered virus strains. Furthermore, the
glycoproteins may be obtained from an expression system exemplified
by, but not limited to, a mammalian expression system, an insect
expression system or a bacterial expression system. Alternatively,
synthetic proteins or recombinant viral proteins, such as HN or F,
may be used in the present invention.
[0049] The composition may be in any form suitable for
administration to a patient, such as a suspension, an emulsion, a
spray, a solution or any other formulation according to principles
well known in the art. The compositions of the invention may be
adapted for any suitable route of administration, including but not
limited to intravenous, oral, buccal, intranasal, inhalation,
topical application to a mucosal membrane or injection, including
intradermal, intrathecal, intracisternal, intralesional or any
other type of injection.
[0050] The method of the invention for treatment of cancer,
according to an embodiment of the invention, includes the step of
administering to a patient a therapeutically effective amount of
HUJ NDV. The HUJ NDV may be administered to the patient through any
suitable route, as described above. One particularly preferred
embodiment utilizes injection of the HUJ strain or a composition
comprising the HUJ strain and/or at least one viral glycoprotein as
described above directly into a tumor or adjacent to the tumor.
[0051] According to another embodiment of the invention the method
of the invention for treatment of cancer, includes the step of
administering to a patient (through any suitable route, as
described above) a therapeutically effective amount of at least one
viral glycoprotein of NDV or a subunit or analog thereof having
oncolytic activity. The viral glycoprotein may include at least the
F glycoprotein of NDV, the HN glycoprotein of NDV or the F
glycoprotein and the HN glycoprotein of NDV.
[0052] Treatment of patients with cancer, in accordance with
embodiments of the present invention, can be systemic, where the
above compositions or even isolated whole viruses and/or isolated
proteins are administered to the patient. The form of
administration may be intravenous, oral, buccal, intranasal,
inhalation, topical application to a mucosal membrane, or
injection, including intradermal, intrathecal, intracisternal,
intralesional or any other type of injection. Preferably,
lentogenic NDV viruses (such as the HUJ strain), or viral proteins
as described above or compositions according to the invention, are
administered locally and directly to a tumor or to its vicinity.
Typically, the form of local administration is by injection, for
example, intralesional injection.
[0053] The isolated polynucleotides of the present invention are
used in the production of at least one viral polypeptide or an
analog or subunit thereof having oncolytic activity by recombinant
DNA technology in cells transfected with these polynucleotides.
Preferably, the polynucleotides used in the production of the F
and/or HN polypeptides of NDV HUJ. The polynucleotides may also
consist of an expression vector, for example a viral vector, to
achieve the polypeptide expression. The methods for expression of
viral NDV proteins are disclosed in EP 227414 to Bingham and are
fully incorporated herein.
[0054] The term "polynucleotide" includes single-stranded and
double-stranded DNA, RNA and chemically or biosynthesized
nucleotide polymers of varying lengths from 16 nucleotides
upwards.
[0055] The term "artificial" as used herein signifies the
intervention of man, by any means, in the production of the
polynucleotide. In addition to artificial polynucleotides per se,
the invention includes recombinant molecules. These can be broadly
defined as consisting of vector polynucleotides and polynucleotide
foreign thereto, the foreign polynucleotide consisting of or
including a polynucleotide of the invention as defined above.
Normally, the polynucleotide is DNA and the invention includes
particularly DNA wherein the vector is a cloning vector or an
expression vector. The expression vector can be, for example, a
prokaryotic cell expression vector or eukaryotic cell expression
vector. The term "vector" herein also includes shuttle vectors.
Where expression is required, the polynucleotide will additionally
contain a signal sequence of the kind effective for translation and
other processing of the mRNA into the desired viral proteins.
[0056] The present invention provides the isolated polynucleotides
encoding viral proteins having oncolytic activity, preferably, the
F and HN glycoproteins, which are introduced into host cells as to
be expressed by the cells and/or their progeny, and the recombinant
cells are then administered in vivo for therapeutic effect.
[0057] To introduce these genes into cells, it is desired to
improve membrane permeability for the oligonucleotides. To improve
membrane permeability various means are known in the art. For
instance, the oligonucleotide molecule may be linked to a group,
which includes partially unsaturated aliphatic hydrocarbon chain
and one or more polar or charged groups such as carboxylic acid
groups, ester groups, and alcohol groups. Alternatively,
oligonucleotides may be linked to peptide structures, which are
preferably membranotropic peptides. Such modified oligonucleotides
penetrate membranes more easily, which is critical for their
function and may, therefore, significantly enhance their
activity.
[0058] To enhance uptake of oligonucleotides across cell membranes
additives may be selected. Such agents are generally agents that
will enhance cellular uptake of double-stranded DNA molecules. For
instance, certain lipid molecules have been developed for this
purpose, including the transfection reagents DOTAP (Boehringer
Mannheim), Lipofectin, Lipofectam, and Transfectam, which are
available commercially.
[0059] Another way of enhancing membrane permeability is by
conjugating oligonucleotides to molecules that are known to bind to
cell surface receptors. Examples of suitable groups for forming
conjugates are sugars, vitamins, hormones, cytokines, transferrin,
asialoglycoprotein, and the like molecules. For example, Low et al
U.S. Pat. No. 5,108,921 describes the use of these molecules for
the purpose of enhancing membrane permeability of peptides,
proteins and oligonucleotides, and the preparation of said
conjugates.
[0060] Having now generally described the invention, the same will
be more readily understood through reference to the following
examples, which are provided by way of illustration and are not
intended to be limiting of the present invention.
Examples
HUJ Strain of NDV
[0061] A sample of NDV HUJ (Master Virus Bank) has been deposited
in the International Reference Laboratory for Newcastle Disease
Virus Veterinary Laboratory Agency New Haw Addlestone Surrey
KT153NB UK and was assigned reference number, AV 997/02. A sample
of the virus was passaged in hen's eggs and was shown to be
viable.
[0062] The virus was derived from naturally lentogenic B1 strain of
NDV obtained as ATCC V188. The virus was passaged four times in
hen's eggs to prepare a research stock. The infected allantoic
fluid from the fourth passage (E4 stock) was stored at -70.degree.
C. The infected allantoic fluid from the E4 stock underwent 50
regular passages in 10-11 day old embryonated eggs. The allantoic
fluid was labeled "NDV lento" and was divided into vials stored at
-80.degree. C. The "NDV lento" was cloned in 10-11 days old
embryonated eggs by limiting dilution. Allantoic fluid from the egg
infected with the highest dilution was labeled "NDV lento (cloned)"
and was stored at -70.degree. C. Studies of the cytotoxicity of the
"NDV lento (cloned)" strain were carried out in Daudi cells and
normal human cells. The strain was shown to be oncolytic and was
renamed "NDV HUJ". The intracerebral pathogenicity index (ICPI) of
the "NDV HUJ " strain was tested in 1 day old chicks and was shown
to be 0.0, indicating that the virus can be classified as
lentogenic, non-virulent, non-pathogenic.
[0063] The HUJ strain was compared to MTH-68/H strain of NDV, which
is an attenuated strain obtained by serial passages through eggs
(allantoic fluid), manufactured in Hungary by Phylaxia-Sanofi
(Csatary et al. Anticancer Research (1999) 19(1B):635-8). Allantoic
fluid containing virus and virus purified on sucrose gradients,
were compared.
[0064] Preparation of the HUJ strain for in vitro studies: Serial
passages were carried out at limiting dilutions in 10-11 day old
chicken embryonated eggs. Allantoic fluid from the highest dilution
(in which only 1/6 eggs is virus positive) was collected and
further passaged in serial dilutions. Cultivation, concentration
and purification were carried out using routine methods
(Tzadok-David et al, and Slosaris M., Levy B., Katz E., Levy R.,
Zakay-Rones Z. (1989) Avian Dis. 33:248-253).
[0065] From 750 incubated eggs about 640 embryonated eggs (10-11
days) were inoculated into the allantoic cavity with
10.sup.5-10.sup.6 embryo infectious dose 50% (EID.sub.50)/egg.
Embryos dying within the first 24 hr were discarded. After 72 hr,
eggs with live embryos only were chilled at 4.degree. for 16-18 hr.
The allantoic fluid (.about.3 liters) was collected and centrifuged
for 20 min at 2,000 rpm to remove debris and the supernatant with
hemagglutination titer (HA) of 640-1280/ml was saved.
[0066] The virus was concentrated by centrifugation from infected
allantoic fluid at 18,000 rpm in a Sorvall (RC-5) centrifuge using
a SS-34 rotor, for 60 min at 4.degree. C. The concentrated virus
(100 ml--containing 32,000 HA units) was then purified by
centrifugation for 90 min at 24000 rpm through a sucrose gradient
(10-60%) with an ultra centrifuge in a SW-27 rotor. The bands
containing virus were collected, pelleted in an SW-27 rotor for 60
min at 24,000 rpm, resuspended, and the purified virus suspension
was passed through Millipore filters, aliquoted in 0.5 ml and kept
at -70.degree. C. until use.
[0067] It will be appreciated by persons skilled in the art that
other methods of virus concentration and purification may be used
for obtaining the results above.
[0068] Preparation of virus for clinical studies: The HUJ strain
also referred to as "NDV lento (clone)" was further cloned twice by
limiting dilution in 10-11 day old embryonated SPF (specific
pathogens free) eggs (obtained from ALPES (Ayes Libres de Patogenos
Especificos S.A. de C.V), Pueblo, Mexico, a subsidiary of SPAFAS
Charles River Lab.) to produce a Virus Master Seed Bank consisting
of 220 tubes. The tubes are stored at -80.degree. C. and contain
the harvested allantoic fluid frozen without any further
purification. One tube from the Master seed bank is expanded into a
Virus Working Seed Bank consisting of 300 tubes following the same
procedure as used in the production of the master bank. The working
bank tubes are stored at -80.degree. C. The tubes contain the
harvested allantoic fluid frozen without any further
purification.
[0069] The starting material for the virus production is a vial of
the NDV HUJ Working Bank and 10-11 day old embryonated SPF
eggs.
[0070] One production run using approximately 3000 eggs would
produce the amount of material needed for the clinical study. The
production was divided into several harvests (.about.500 eggs). For
each harvest, a vial of working bank was thawed and the virus
suspension was diluted in Gibco PBS (10.sup.5EID.sub.50/egg). A
small hole was manually punched in the top of the egg and an
aliquot of the virus suspension was injected into the
amino-allantoic cavity of the egg. The hole in each egg was sealed
with sterile acrylic cement and the eggs were incubated for 72 hrs.
The eggs were checked for viability. Eggs which appeared upon
candling to have died within the last 12-24 hrs were set aside for
harvesting and eggs which had appeared to have died earlier were
discarded. If the percent of all eggs that had died since the time
of inoculation exceeded 25%, then all viable eggs were harvested
along with the newly dead eggs. If the percent egg death was less
than 25%, viable eggs were incubated for a further 24 hours and
after which the newly dead and viable eggs were harvested.
Harvesting consisted of removing the top of the egg, inspecting the
embryo and allantoic fluid and pippeting the allantoic fluid into
50 ml bottles. If the allantoic fluid taken up into the pipette was
not clear it was rejected. The harvested allantoic fluid was
clarified by low speed centrifugation and stored at 4-7.degree. C.
Aliquots of the collected infected allantoic were tested for
sterility and titer (EID.sub.50 and hemagglutination).
[0071] The total amount of virus obtained from a particular harvest
was determined by the number of eggs harvested, the volume of the
allantoic fluid harvested and the titer. Starting with about 450
eggs, 150-300 eggs were harvested. The yield of harvested fluids
was about 8-10 ml per egg and the volumes of collected fluids from
individual harvests varied from 1000 to 3280 ml. Titers ranged from
10.sup.93/ml to 10.sup.10.2/ml EID.sub.50 and the total amount of
virus in crude bulk harvests ranged from 6.4.times.10.sup.12 to
1.6.times.10.sup.13 EID.sub.50. The total amount of virus in the
five crude bulk harvests was 5.8x10.sup.13 EID.sub.50 at the time
of harvesting. The virus was then concentrated by high speed
centrifugation and purified in sucrose gradients as follows:
[0072] Clarified crude bulk virus after having been stored at
4-7.degree. C. for between 1-6 weeks was re-clarified by low speed
centrifugation (3000 rpm 30 min). Aliquots of re-clarified bulk
from each harvest were taken and stored at -80.degree. C. for
further testing and additional aliquots were taken for in-process
sterility testing. The re-clarified bulk was then centrifuged at
high speed 12,500 rpm for 1.5 hrs at 4.degree. C. and the pelleted
virus was re-suspended in Gibco Dulbeco PBS. Titers were determined
to obtain total recovery. A total of 12,260 ml of reclarified bulk
fluids from five harvests were concentrated to a total of 100 ml of
resuspended pelleted virus with a 50% average yield based on
EID.sub.50 titers, ranging from 29% to 82% yields for individual
harvests. Sterility was tested on aliquots from each tube of
re-suspended concentrated virus. All samples of the concentrated
virus passed sterility testing.
[0073] For purification, the concentrated virus was centrifuged at
ultra-high speed in a 20/40/60% sucrose gradient at 22,000 rpm for
2.5 hrs at 4.degree. C. In a typical ultracentrifuge tube,
approximately 8 ml of concentrated virus is layered on top of 24 ml
of sucrose gradient. The purified virus is recovered as a band of
approximately 4.7 ml. The band of concentrated virus is suspended
in approximately 10 ml of sterile saline, whose pH had been
adjusted to 7.6-7.8 by addition of autoclaved solution of disodium
phosphate prepared in water for infusion. Sucrose solutions were
prepared by dissolving endotoxin-free sucrose in Gibco Dulbeco PBS
and autoclaving. Clinical dosages were prepared from combined
harvests of purified virus by diluting the viral suspension with
sterile saline to achieve a concentration of approximately
1.times.10.sup.10 EID.sub.50 /ml.
[0074] PCR and Sequencing of the F and HN genes: The nucleotide
sequences determined for the F and HN genes of NDV HUJ-master bank
and purified virus can be compared to related nucleotide sequence
of the LaSota strain of Newcastle disease virus, which consists of
15186 base pairs of linear RNA. Viral RNA was extracted from the
Newcastle disease virus HUJ master seed using the QIAGEN QIAamp
viral RNA kit according to the manufacturer's instructions. A
single stranded DNA copy of the viral RNA template was prepared
using a standard protocol for production of cDNA from RNA template
using reverse transcriptase. Briefly, two reaction mixtures were
prepared. One mixture comprised 6.5 .mu.l of dH.sub.2O and 1 .mu.l
of the primer MSF1 (see below). The other mixture comprised 4.0
.mu.l of 5.times. RT buffer (reverse transcriptase buffer), 4.0
.mu.l dH.sub.2O, 1.0 .mu.l 40 mM NTPs (nucleotide triphosphates),
0.5 .mu.l MMLV-RT (enzyme) and 0.5 .mu.l RNAsin (RNAse inhibitor).
A volume of 2.5 .mu.l of RNA was added to the 7.5 .mu.l of mix one,
centrifuged briefly, heated at 95 .degree. C. for two minutes and
placed on ice. A volume of 10 .mu.l of mix two was added to the
RNA/primer solution and incubated at 37.degree. C. for 1 hour. The
cDNA produced was used to prepare three overlapping PCR DNA
fragments for each gene. The sequences of these primers in the
viral genome are given below. Each PCR reaction mixture comprised
25 .mu.l PCR Ready mix .times.2 (AB gene Corp.), 18 .mu.l
DH.sub.2O, and 1 .mu.l of 1 .mu.l of forward primer and 1 .mu.l of
reverse primer. The components were mixed, spun briefly and 5 .mu.l
appropriate cDNA added before thermal cycling. Cycling parameters
were 94.degree. C. for 10 minutes (one cycle), 94.degree. C. (1
minute), 50.degree. C. (1 minute) and 72.degree. C. (3 minutes) for
29 cycles and 72.degree. C. for 5 minutes. After the PCR, reaction
mixtures were electrophoresed on an agarose gel and visualized
using a UV transilluminator. DNA fragments size was estimated by
comparing with marker DNA and fragments were purified. DNA
fragments were excised from the gel and purified using the Qiaquick
gel extraction kit (Qiagen cat no. 28706).
[0075] For DNA sequencing, a reaction mix was prepared comprising
terminator ready reaction mix (4.mu.l; Applied Biosystems Corp),
the PCR product (2-4 .mu.l depending on its concentration),
sequencing primer (1.6 .mu.l) and deionised water to bring the
total volume to 10 .mu.l. The mixture was then incubated in a PCR
machine using the program `BIGD`. The sequenced products were
precipitated by adding 1 .mu.l of 25 mM glycogen and 52 .mu.l of 2M
sodium acetate pH 4.5. The mix was vortexed, left for 10 minutes
and then centrifuged at 13,000 rpm for 30 minutes. The liquid was
aspirated off leaving behind a pellet, which was rinsed by the
addition of 150 .mu.l of 80% ethanol. Following centrifugation at
13,000 for 10 minutes, the alcohol was removed and the sample
centrifuged again before removing any remaining alcohol with a 10
pipette. The pellet was dried by heating on a block at 95.degree.
C. for 2 minutes, resuspended in 15 .mu.l TSR, vortexed and then
centrifuged (pulse) before heating again at 95.degree. C. for 2
minutes and chilling on ice. Following an additional vortex and
spin, samples were transferred to ABI tubes and then into the
genetic analyzer (ABI PRISM.TM. 310 genetic analyzer). Data from
the automated sequencer was edited using DNASTAR/SeqMan to obtain a
consensus sequence. Sequences were aligned with the published
sequence of a similar virus, for example B1 or LaSota,
The PCR and sequencing primers were the following: PCR primers for
the F gene:
TABLE-US-00001 Reference Sequence Position MSF1
TGACCACGAGGTTACCTCTAC (1057 matrix protein, forward) 2FOV
TCCAAGTAGGTGGCACGCATA (957, reverse) 3FOV AATTGACTACAGTATTCGGACC
(693, forward) 4FOV TGTTGACATTCCCAAGCTCAG (1460, reverse) 5FOV
GCTCAGTCATCGCTAACTGC (1209, forward) 6FOV CGG AAT ATC AAG CGC CAT
GTA (168 of HN gene, reverse)
Sequencing primers for F Gene:
TABLE-US-00002 1FOV TTAGAAAAAACACGGGTAGAA (0, forward) 7FOV
ACAGGACATTGACCACTTTGC (300, forward) 8FOV CAGGTAACTCTACCTTCAGTCG
(902, forward) 9FOV CAACTCGATCAGTAATGCTTTGA (1459, forward) 10FOV
CCTAGATCAGATGAGAGCCACTACA (1675, forward) 11FOV
CTGCTGCATCTTCCCAACTG (598, reverse) 12FOV GACTCTTGTATCCTACGGATAGA
(360, reverse) 13FOV GTACATACAGGCCGATGTATTGC (1162, reverse) 14FOV
AAGGTCTTTTGTTGCGCCTTTTG (1653, reverse)
PCR primers for the HN gene:
TABLE-US-00003 1HNOV CGTTAGCCAAGTTGCGTTAGAG (103, forward) 2HNOV
CCGTCGAACCCTAACCTCC (927, reverse) 3HNOV GTCTTGCAGTGTGAGTGCAAC
(799, forward) 4HNOV CCTCGCAAGGTGTGGTTTCTA (1548, reverse) 5HNOV
GCCACTCTTCATAGTCCTTATACA (1397, forward) 6HNOV
CCATGAGCTGTTTTGCCTTGTATCT (intergenic HN/L, reverse) (6HNOV)
Sequencing primers for HN gene
TABLE-US-00004 7HNOV GCACCTATCCATGACCCAGATT (464, forward) 8HNOV
CGATACAATGACACATGCCCAGA (1106, forward) 9HNOV
GACCTATTGTCTCAGCATTGCTGA (1708, forward) 10HNOV
GGAACCAAGTGTAGATGTAATCT (319, reverse) 11HNOV
GAGGGTATTCGAGTGCAACCTGA (621, reverse) 12HNOV GGTCTTCGCCTAAGGATGTTG
(1247, reverse) 13HNOV CTGAATTCTCCGAAGAGAGTAT (1761, reverse)
14HNOV TGATCGCATGAGCACTGGCTG (1964, reverse)
[0076] Biological assay: The hemagglutination and infectivity
titers of the HUJ virus were determined by the routinely used
methods (Sever J L. 1962 J. Immunol. 80:320-329 for
hemagglutination). Infectivity was determined by inoculation of
serial dilutions into the allantoic sac of embryonated eggs and
checking the fluids for hemagglutination 72 hrs post inoculation.
The virus titer, defined as 50% endpoint egg infectious dose
(EID.sub.50) was calculated by the method of Reed and Muench (Reed
L J Muench H A 1938, Amer. J Hyg 27:493-497). Stocks were prepared
and stored at -70.degree. C.
[0077] Sterility tests: The HUJ viral suspension was tested for
bacterial and mycoplasma presence and was found to be sterile.
[0078] Nucleotide and amino acid sequences of the F and HN genes of
HUJ: The 3358 nucleotide sequence, corresponding to 4498 to 7855 of
the LaSota complete genome and covering all of the F gene, the
intergene and most of the HN gene of HUJ is given below (SEQ ID
NO:1):
TABLE-US-00005 1 ACGGGTAGAA GATTCTGGAT CCCGGTTGGC GCCCTCCAGG
TGCAAGATGG 51 GCTCCAGACC TTCTACCAAG AACCCAGCAC CTATGATGCT
GACTATCCGG 101 GTTGCGCTGG CACTGAGTTG CATCTGTCCG GCAAACTCCA
TTGATGGCAG 151 GCCTCTTGCA GCTGCAGGAA TTGTGGTTAC AGGAGACAAA
GCCGTCAACA 201 TATACACCTC ATCCCAGACA GGATCAATCA TAGTTAAGCT
CCTCCCGAAT 251 CTGCCCAAGG ATAAGGAGGC ATGTGCGAAA GCCCCCTTGG
ATGCATACAA 301 CAGGACATTG ACCACTTTGC TCACCCCCCT TGGTGACTCT
ATCCGTAGGA 351 TACAAGAGTC TGTGACTACA TCTGGAGGGG GGAGACAGGG
GCGCCTTATA 401 GGCGCCATTA TTGGCGGTGT GGCTCTTGGG GTTGCAACTG
CCGCACAAAT 451 AACAGCGGCC GCAGCTCTGA TACAAGCCAA ACAAAATGCT
GCCAACATCC 501 TCCGACTTAA AGAGAGCATT GCCGCAACCA ATGAGGCTGT
GCATGAGGTC 551 ACTGACGGAT TATCGCAACT AGCAGTGGCA GTTGGGAAGA
TGCAGCAGTT 601 TGTTAATGAC CAATTTAATA AAACAGCTCA GGAATTAGAC
TGCATCAAAA 651 TTGCACAGCA AGTTGGTGTA GAGCTCAACC TGTACCTAAC
CGAATTGACT 701 ACAGTATTCG GACCACAAAT CACTTCACCT GCTTTAAACA
AGCTGACTAT 751 TCAGGCACTT TACAATCTAG CTGGTGGAAA TATGGATTAC
TTATTGACTA 801 AGTTAGGTGT AGGGAACAAT CAACTCAGCT CATTAATCGG
TAGCGGCTTA 851 ATCACCGGTA ACCCTATTCT ATACGACTCA CAGACTCAAC
TCTTGGGTAT 901 ACAGGTAACT CTACCTTCAG TCGGGAACCT AAATAATATG
CGTGCCACCT 951 ACTTGGAAAC CTTATCCGTA AGCACAACCA GGGGATTTGC
CTCGGCACTT 1001 GTCCCAAAAG TGGTGACACA GGTCGGTTCT GTGATAGAAG
AACTTGACAC 1051 CTCATACTGT ATAGAAACTG ACTTAGATTT ATATTGTACA
AGAATAGTAA 1101 CGTTCCCTAT GTCCCCTGGT ATTTATTCCT GCTTGAGCGG
CAATACGTCG 1151 GCCTGTATGT ACTCAAAGAC CGAAGGCGCA CTTACTACAC
CATACATGAC 1201 TATCAAAGGT TCAGTCATCG CCAACTGCAA GATGACAACA
TGTAGATGTG 1251 TAAACCCCCC GGGTATCATA TCGCAAAACT ATGGAGAAGC
CGTGTCTCTA 1301 ATAGATAAAC AATCATGCAA TGTTTTATCC TTAGGCGGGA
TAACTTTAAG 1351 GCTCAGTGGG GAATTCGATG TAACTTATCA GAAGAATATC
TCAATACAAG 1401 ATTCTCAAGT AATAATAACA GGCAATCTTG ATATCTCAAC
TGAGCTTGGG 1451 AATGTCAACA ACTCGATCAG TAATGCTTTG AATAAGTTAG
AGGAAAGCAA 1501 CAGAAAACTA GACAAAGTCA ATGTCAAACT GACTAGCACA
TCTGCTCTCA 1551 TTACCTATAT CGTTTTGACT ATCATATCTC TTGTTTTTGG
TATACTTAGC 1601 CTGATTCTAG CATGCTACCT AATGTACAAG CAAAAGGCGC
AACAAAAAAC 1651 CTTATTATGG CTTGGGAATA ATACTCTAGA TCAGATGAGA
GCCACTACAA 1701 AAATGTGAAC ACAGATGAGG AACGAAGGTT TCCCTAATAG
TAATTTGTGT 1751 GAAAGTTCTG GTAGTCTGTC AGTTCAGAGA GTTAAGAAAA
AACTACCGGT 1801 TGTAGATGAC CAAAGGACGA TATACGGGTA GAACGGTAAG
AGAGGCCGCC 1851 CCTCAATTGC GAGCCAGGCT TCACAACCTC CGTTCTACCG
CTTCACCGAC 1901 AACAGTCCTC AATCATGGAC CGCGCCGTTA GCCAAGTTGC
GTTAGAGAAT 1951 GATGAAAGAG AGGCAAAAAA TACATGGCGC TTGATATTCC
GGATTGCAAT 2001 CTTATTCTTA ACAGTAGTGA CCTTGGCTAT ATCTGTAGCC
TCCCTTTTAT 2051 ATAGCATGGG GGCTAGCACA CCTAGCGATC TTGTAGGCAT
ACCGACTAGG 2101 ATTTCCAGGG CAGAAGAAAA GATTACATCT ACACTTGGTT
CCAATCAAGA 2151 TGTAGTAGAT AGGATATATA AGCAAGTGGC CCTTGAGTCT
CCGTTGGCAT 2201 TGTTAAATAC TGAGACCACA ATTATGAACG CAATAACATC
TCTCTCTTAT 2251 CAGATTAATG GAGCTGCAAA CAACAGTGGG TGGGGGGCAC
CTATCCATGA 2301 CCCAGATTAT ATAGGGGGGA TAGGCAAAGA ACTCATTGTA
GATGATGCTA 2351 GTGATGTCAC ATCATTCTAT CCCTCTGCAT TTCAAGAACA
TCTGAATTTT 2401 ATCCCGGCGC CTACTACAGG ATCAGGTTGC ACTCGAATAC
CCTCATTTGA 2451 CATGAGTGCT ACCCATTACT GCTACACCCA TAATGTAATA
TTGTCTGGAT 2501 GCAGAGATCA CTCACATTCA TATCAGTATT TAGCACTTGG
TGTGCTCCGG 2551 ACATCTGCAA CAGGGAGGGT ATTCTTTTCT ACTCTGCGTT
CCATCAACCT 2601 GGACGACACC CAAAATCGGA AGTCTTGCAG TGTGAGTGCA
ACTCCCCTGG 2651 GTTGTGATAT GCTGTGCTCG AAAGTCACGG AGACAGAGGA
AGAAGATTAT 2701 AACTCAGCTG TCCCTACGCG GATGGTACAT GGGAGGTTAG
GGTTCGACGG 2751 CCAGTACCAC GAAAAGGACC TAGATGTCAC AACATTATTC
GGGGACTGGG 2801 TGGCCAACTA CCCAGGAGTA GGGGGTGGAT CTTTTATTGA
CAGCCGCGTA 2851 TGGTTCTCAG TCTACGGAGG GTTAAAACCC AATTCACCCA
GTGACACTGT 2901 ACAGGAAGGG AAATATGTGA TATACAAGCG ATACAATGAC
ACATGCCCAG 2951 ATGAGCAAGA CTACCAGATT CGAATGGCCA AGTCTTCGTA
TAAGCCTGGA 3001 CGGTTTGGTG GGAAACGCAT ACAGCAGGCT ATCTTATCTA
TCAAGGTGTC 3051 AACATCCTTA GGCGAAGACC CGGTACTGAC TGTACCGCCC
AACACAGTCA 3101 CACTCATGGG GGCCGAAGGC AGAATTCTCA CAGTAGGGAC
ATCTCATTTC 3151 TTGTATCAAC GAGGGTCATC ATACTTCTCT CCCGCGTTAT
TATATCCTAT 3201 GACAGTCAGC AACAAAACAG CCACTCTTCA TAGTCCTTAT
ACATTCAATG 3251 CCTTCACTCG GCCAGGTAGT ATCCCTTGCC AGGCTTCAGC
AAGATGCCCC 3301 AACTCGTGTG TTACTGGAGT CTATACAGAT CCATATCCCC
TAATCTTCTA 3351 TAGAAACC
[0079] The amino acid sequence derived from the above nucleotide
sequence is given in FIG. 10 (SEQ ID NO:2). It will be noted that
asterisks in this sequence mark stop codons. Thus the F protein
will terminate at residue number 553.
[0080] The amino acid sequence has the fusion protein cleavage site
motif from amino acid #109 to #119 of SGGGRQGRLIG inferred from the
nucleotides sequence starting at nucleotide 370, which is
characteristic of lentogenicity.
[0081] The 3358 nucleotides of the virus from the Master Virus Bank
matched those of the La Sota strain of NDV (gi:3386504), except for
nucleotide positions 111, 1006 and 1648 in the F gene.
[0082] Sequence of the F Gene of the Virus after virus Purification
on a Sucrose Gradient:
[0083] The nucleotide sequence of virus from production batch,
obtained after purification of the virus on a sucrose gradient, as
described above, was determined as follows:
[0084] Viral RNA was extracted from the Newcastle disease virus HUJ
using the SV Total Isolation kit (Promega) according to the
manufacturer's instructions. The RNA was subjected to RT-PCR
amplification with 4 different oligonucleotide primers. (Using
Access Quick RT-PCR System, Promega). The sequences of these
primers and their location in the viral genome are given below.
[0085] Each reaction mixture comprised of 25 .mu.l RT-PCR Ready mix
.times.2, 8 .mu.l RNA, 5 .mu.l of each forward and reverse
sequencing primer and 7 .mu.l DDH20. The components were well mixed
and spun briefly prior to subjection to the RT-PCR reaction
(48.degree. C. for 45 minutes for the RT reaction). Cycling
parameters for the PCR were 94.degree. C. for 2 minutes (one
cycle), 94.degree. C. (30 seconds), 60.degree. C. (1 minute) and
68.degree. C. (2 minutes) for 40 cycles and 68.degree. C. for 7
minutes. The PCR reaction mixes were loaded on 1% agarose gel and
visualized using a UV Tran illuminator. Band size was estimated by
comparing with DNA marker. DNA fragments were excised from the gel
and purified using the Mini-elute Gel extraction kit (Qiagen). Each
fragment was resuspended in ddH20. The DNAs were subjected to
Sequencing analysis.
The RT-PCR and sequencing primers were
TABLE-US-00006 NDV-1 TT G C A G C T G C A G G A A T T G T (4653
forward) NDV-2 C T A T A C A G T A T G A G G T G T C A A G (5540
reverse) NDV-4 G A A T T G A C T A C A G T A T T C G G (5189
FORWARD) NDV-5 G C G C G G T C C A T G A T T G A (6406 reverse)
The 1504 nucleotide sequence of the purified virus, corresponding
to 178 to 1680 of the HUJ virus from the Master Virus Bank, that
covers most of the F gene was found to be identical to the
nucleotide sequence of the HUJ virus from the Master Virus Bank.
This indicated that the identity of the virus had not changed in
this region during the production process. It also provides
confirmatory evidence for the relevant sequence.
Biological Characterization (MTH Compared with HUJ)
[0086] 1) Hemagglutination and Neuraminidase Activities
TABLE-US-00007 TABLE 1 Allantoic fluid Purified NDV NDV strain HA*
NA* HA* NA* MTH 1024 100 16,000 1,400 1024 384 HUJ 1024 300
32-64,000 <2,400 1024 <1000 *reciprocal titer of the dilution
of hemagglutination (HA) and Neuraminidase (NA) activities.
Neuraminidase is determined according to Aymard-Henry M et al 1973
Bull Wld Org 48: 199-202 and Warren LJ J Biol Chem 1959 234:
1971-1975. This assay measures the free sialic acid liberated by
the viral enzyme neuraminidase from a substrate (fetuine).
TABLE-US-00008 TABLE 2 Comparison of neuraminidase activities of
two NDV strains Virus dilution MTH HUJ 1:50 0.55* 1.2 1:100 0.37
0.55 1:200 0.15 0.41 *OD at A 450 nm is correlated with
neuraminidase enzyme activity.
These results (Tables 1 and 2) indicate that neuraminidase activity
is higher in the HUJ strain compared to the MTH strain.
[0087] 2) Fusion Activity
[0088] Fusion activity was determined by chicken erythrocyte
hemolysis as described in the literature (Nishikawa K et al 1986 J.
Viral 60: 987-993). The results indicated that virus dilutions of
1:32-1:64 caused hemolysis, suggesting that fusion activity was
similar for the two NDV strains.
[0089] 3) Cytotoxic (Oncolytic) Effect
Cytotoxic Effect of NDV on Daudi Cells in Culture
[0090] Virus (20-200 EID.sub.50 /cell) was incubated with Daudi
cells for different time intervals. At the end of the incubation,
samples were checked for viability by staining with erythrosine B,
a selective stain for dead cells (Hanks J H and Wallace J 1958 Proc
Expel Biol Med 98 188). A graphic presentation of the results is
shown in FIG. 1.
The results indicate that the HUJ strain of NDV is similarly
efficient in killing Daudi cells as the MTH strain. Apoptosis of
Daudi Cells following Treatment by NDV
[0091] Daudi cells were incubated in the presence of either MTH or
HUJ strains (100 EID.sub.50/cell) for the indicated time periods.
Apoptosis was determined by a colorimetric assay using MTT
tetrazolium (Mosmann T 1983, J of immunol. Methods 65: 55-63). MTT
is a color reaction expressed by OD indicating apoptosis of cells.
The intensity of OD measured at 570 nm correlate directly with cell
viability. Higher OD indicates higher viability and lower % of dead
cells.
[0092] A graphic presentation is shown in FIG. 2.
[0093] The effect of MTH strain on cytotoxicity (FIG. 1) and
apoptosis (FIG. 2) is more rapid than that observed with the HUJ
strain. However, after 96 hours of incubation both strains exhibit
identical effect. Both viruses were also found to arrest cell
replication. Previously, BarEli et al., showed the preferential
effect of NDV on lymphoma cells when compared to non cancerous
cells. It was also found that the NDV was not cytotoxic to normal
human embryo fibroblasts.
[0094] The effectiveness of the HUJ strain in killing cells in
culture was tested in the range of 20 EID.sub.50/cell to 2000
EID.sub.50/cell and was found to be effective in this range. Thus,
treatment that includes locally administering HUJ NDV to a tumor
(alone or as an active component in a composition) would preferably
consist of estimating the number of cells in the tumor or
estimating the size of a tumor and administering HUJ NDV strain in
the range of 20 EID.sub.50/cell to 2000 EID.sub.50/cell, or an
equivalent amount of surface glycoproteins, according to the
invention. Systemic treatment of a patient would preferably consist
of administering at least one dose of 10.sup.6-10.sup.12EID .sub.50
of HUJ NDV strain, or an equivalent amount of surface
glycoproteins, according to the invention.
[0095] 4) Thermostability of Hemagglutinin Activity at 56.degree.
C.
The hemagglutinin thermostability of the MTH and HUJ strains was
determined at 56.degree. C. using chicken erythrocytes according to
the method of F. M. Burnet as described in "The affinity of
Newcastle disease virus to the influenza virus group. Aust. J. Exp.
Biol. Med. 1942, 20, 320-328. The results are presented in FIGS. 3A
and 3B and in Tables 3A and 3B.
TABLE-US-00009 TABLE 3A Time lapse HA titer allantoic fluid HA
titer purified fluid (minutes) MTH HUJ MTH HUJ 0 1024 1024 1024
2048 2 256 8 256 0 5 128 0 32 0 10 32 0 8 0 15 8 0 0 0 20 0 0 0 0
25 0 0 0 0 30 0 0 0 0
TABLE-US-00010 TABLE 3B Time lapse HA titer allantoic fluid HA
titer purified fluid (minutes) MTH HUJ MTH HUJ 0 512 512 1024 2048
2 512 128 512 0 5 512 0 16 0 10 512 0 8 0 15 64 0 0 0 20 8 0 0
0
[0096] The results indicate that the hemagglutinin activity of the
MTH strain is more thermostable since it is maintained for about 10
min at 56.degree. C., while that of the HUJ strain is more labile
since no activity is observed already after 2 min in both allantoic
fluid and purified virus.
[0097] 5) Sensitivity to Thermolabile 13 Inhibitors in Sera
[0098] NDV strains are known to be sensitive to the .beta.
inhibitors non-specific inhibitors in normal sera. Assays with
horse sera that contain .sub.13 inhibitors indicated that the HUJ
strain is less sensitive to inhibitors than the MTH strain.
TABLE-US-00011 TABLE 4 Titer of inhibitors* HUJ MTH Non- Non-
treated 58.degree. RDE** treated 58.degree. RDE Horse sera 10* 10
10 160 ND ND 1 10 10 10 320 160 40 2 10 10 10 80 ND ND 3 2560 2560
1280 1280 2560 1280 Rabbit immune *reciprocal titer **RDE means
receptor destroying enzyme
[0099] Pathogenicity of NDV Strains
[0100] 6) Mean Death Time
[0101] The mean death time (MDT) of embryos indicates the virulence
of the virus. The MDT was determined by the inoculation of SPF
chicken eggs with serial dilutions of the cloned viruses using the
method described in Manual of Standards for Diagnostic Tests and
Vaccines, 4.sup.th edition, 2000. Death of embryos was determined
in the different dilutions and the MDT (the mean death time of
embryos infected with the highest dilution causing 100% death) was
determined. The MDT of the original Hungarian MTH strain was shown
to be less than 65 hours. The MDT of HUJ was >96 h, which is
typical for lentogenic viruses. The MDT of chick embryos infected
with virus from the virus working seed bank derived from the virus
master seed bank was greater than 100 hrs. These results indicate
that the original MTH strain is mesogenic, while the HUJ of the
present invention is lentogenic.
[0102] 7) Replication of Virus in Chicken Embryo Fibroblast
Cultures (CEF) with and without Trypsin (Try)
TABLE-US-00012 TABLE 5 MTH Titer (TCID.sub.50) HUJ Titer
(TCID.sub.50) -Try +Try -Try +Try CPE HA CPE HA CPE HA CPE HA
10.sup.7.5 10.sup.8.5 10.sup.8.5 10.sup.8.5 10.sup.2.6 10.sup.2.5
10.sup.8.5 10.sup.5 10.sup.8.5 10.sup.5.5 10.sup.8.5 10.sup.8.0
10.sup.9.5 10.sup.9.5 10.sup.3.0 10.sup.3.0 10.sup.8.5 10.sup.6
[0103] Cloned virus with the same HA titer (1:200) was inoculated
in serial dilutions into CEF monolayer cultures. Replication was
followed by observation of CPE (cytopathic effect) and
hemagglutination (HA) assay in the medium, and the titer tissue
culture infectious dose 50% (TCID.sub.50) was determined by the
Reed and Muench method.
[0104] Replication of the virus without trypsin indicates elevated
virulence. It may indicate that the amino acid residues at the
trypsin cleavage sites of the surface glycoproteins are multi basic
(arginine or lysine).
[0105] The MTH strain replicates to similar titers with or without
trypsin, unlike the HUJ strain that replicates to a much higher
level in the presence of trypsin
(10.sup.3.0.fwdarw.10.sup.8.5.sub.TCID50). This would clearly
indicate that the MTH strain is more pathogenic than the HUJ virus,
which probably has one basic amino acid residue at the cleavage
site.
[0106] 8) Serology
[0107] Most of the NDV strains are similar serologically. When
using polyclonal rabbit anti NDV hyperimmune sera to the Israel
mesogenic strain previously isolated by the inventors, both strains
were similarly inhibited (HI titer 1:1280) (see Table 6). However,
human sera obtained from MTH-treated cancer patients had higher
antibody titers to the homologous MTH strain than to the HUJ strain
as shown in Table 6 rows I,II,III in the inhibition of hemolysis,
hemagglutination and neuraminidase. Also, an immune rabbit serum
that had similar HI antibody titer to both NDV strains,
demonstrated different antibody titers to other viral activities
(hemolysis and neuraminidase).
TABLE-US-00013 TABLE 6 Inhibition of biological activities Serum
MTH HUJ Inhibition of hemolysis* I Treated patients 1 40-80* 5-10 2
20-40 5-10 Rabbit 160 20 (Hyper immune serum) Hemagglutination
inhibition*(HI) II Treated patients 1 2560 1280 2 2560 640 3 320 20
4 Rabbit (Hyper 1280 1280 immune serum) Neuraminidase inhibition*
III Treated patients 1 1280 640 2 2560 320 3 320 80 *reciprocal
titers
The assays were conducted according to Sever Aymard-Henry and
Nishikawa.
[0108] 9) Neutralization in Eggs
[0109] Sera from cancer patients treated with MTH was interacted
with 100 EID.sub.50 of each of the two NDV strains. The mixture was
then inoculated into 10-11-day-old embryos. 48 hours later,
neutralization of the virus was determined by hemagglutination
assay. Also neutralizing antibody level was higher against the
homologous strain (in this case the MTH) Neutralizing serum titer
was 1:320 against MTH and only 1:20 against HUJ (serum 1).
Neutralizing serum titer was 1:320 to MTH and only 1:80 for HUJ
(serum 2).
Analysis of NDV HUJ Strain Proteins
[0110] In order to compare proteins of the two NDV strains MTH and
HUJ, purified virion preparations (See NDV Preparation and
Purification, above) were treated with SDS and the denatured
proteins were analyzed by electrophoresis in a 10% SDS
Polyacrylamide gel. A picture of the SDS Polyacrylamide gel
analysis of NDV virion proteins is shown in FIG. 4. Electrophoresis
in Polyacrylamide gel (10%) of the MTH and HUJ proteins was carried
out with 2 .mu.g and 5 .mu.g viral proteins and the gel was
subsequently stained with Coommassie blue (Millar NS et al.,
(1988). J. Gen. Virol. 69 (3), 613-20).
[0111] As observed in FIG. 4, six major proteins were resolved in
the gel. These six proteins correspond to the known major
structural proteins of NDV, P-69 kD; HN-74 kD; F0-62kD; F-56kD;
NP-60kD and M-38kD (Hightower, L. E., Morrison, T. B. and Bratt M.
A. (1975) J. Virol. 16, 1599-1607). No differences in the apparent
molecular weights of the major virion proteins of strains MTH and
HUJ could be observed by this method.
NDV Surface Glycoproteins
[0112] Cytotoxicity of NDV Surface Glycoproteins
[0113] Adsorption of Newcastle Disease Virus surface glycoproteins
to Daudi cells, without subsequent penetration, caused a rapid
inhibition in cellular DNA synthesis, arrest in cell multiplication
and eventually killing of the cells. Surface glycoproteins obtained
from a mesogenic strain (Roakin) were more effective than those
originating from a lentogenic strain (B-1).
[0114] Thus, it appeared that adsorbed glycoproteins distorted the
integrity of the cell membrane, increasing its permeability, as was
indicated by the elevation in .sup.51Cr release. The killing of the
cells may presumably be linked to a specific cytopathic effect
through signal transduction, mediated by the exogenous viral
glycoproteins.
[0115] The strains used in these experiments are the lentogenic B-1
strain (B1) and the mesogenic Roakin/46 V NJ strain (RO) obtained
from the American type collection 1971.
[0116] Production of Viral Surface Glycoproteins:
[0117] For the solubilization of hydrophobic membrane proteins,
purified virus preparations were treated with a non-ionic detergent
NP-40 (Sigma), 0.2% for 30 min at 4.degree. C. The detergent was
extracted five times with a 1:1 volume of analytical ether (May and
Baker Ltd., England). The ether was then evaporated by nitrogen.
Viral core was removed by high-speed centrifugation (L-2 rotor
Ti50) at 20,000 rpm for 45 min at 4.degree. C. The surface
glycoproteins in the supernatant were kept at -70.degree. C. A
buffer solution was subjected to an identical treatment and served
for control purposes to assure that any effect would not be due to
residual detergent.
[0118] It will be appreciated by persons skilled in the art that
surface glycoproteins can be obtained by several other known
methods and using other detergents.
[0119] Biological Activities of NDV Surface Glycoproteins
[0120] The fraction obtained by treatment with NP-40 contained the
surface glycoproteins Hemagglutinin-Neuraminidase (HN) and Fusion
(F). In Table 7 (below) the biological properties of the
glycoprotein fractions originating from a mesogenic (RHN) and a
lentogenic (BHN) strain, are depicted. The infectivity of the two
purified virus preparations from which the surface glycoproteins
were extracted was 10.sup.93 EID.sub.50/0.2 ml. No infectivity was
recorded in the soluble fraction containing the surface
glycoproteins obtained from Roakin or B-1 strains, RHN and BHN,
respectively. Protein concentration (.quadrature.g/ml) was similar
in the two virus suspensions before extraction. After extraction,
similar protein concentration, although lower as expected, was
obtained in the two surface glycoprotein fractions of the two
strains.
[0121] Hemagglutination activity of the surface glycoproteins
fraction was similar to the original whole virus preparation.
Neuraminidase activity, however, declined to 33 and 50% of the full
value of intact virus suspension in Roakin and B-1 glycoproteins
fractions, respectively. Hemolytic activity was high in the intact
virus preparations while only a small portion of this activity (6%)
was retained in the isolated surface glycoprotein fractions.
TABLE-US-00014 TABLE 7 Activities of intact virus and surface
glycoprotein preparations. Infectivity* HA** .times. Proteins#
Preparation EID50/0.2 ml 10.sup.3 NA+ Hemolysis++ .mu.g/ml RO
10.sup.9.3 30 480 1.73 480 RHN <1 29 160 0.09 165 B-1 10.sup.9.3
39 640 1.81 470 BHN <1 32 320 0.12 158 *Viral infectivity,
calculated as median egg-infective dose/0.2 ml according to Reed
and Muench. **The reciprocal of the highest dilution that
agglutinate CRBC +The reciprocal of the highest dilution with
enzyme activity (OD 540 nm) ++Absorbency of the supernatant of CRBC
treated with water (100% hemolysis) was measured at OD 540 nm.
#Determined by the Lowry method.
Cytotoxic Effect of NDV Surface Glycoproteins on Daudi Cells
[0122] Adsorption of RHN and B-HN virus to Daudi cells was
monitored by an indirect immunofluorescence using diluted virus
specific antiserum (chicken or rabbit) and fluorescein-conjugated
goat anti chicken or anti rabbit IgG. Over 90% of the cells
demonstrated intensive staining 60 minutes after virus interaction.
The number of the viable and dead Daudi cells after incubation with
the different viral preparations was determined at different
periods of time (in hours FIGS. 5A and 5B).
[0123] Cell multiplication as measured by the total number of
viable cells was completely inhibited, and after 72 hr all the
cells were dead following interaction with whole virus preparations
(RO, B-1), which were used as control and reference for the
destructive capability of the surface glycoproteins. In another
experiment, RHN fraction inhibited cell multiplication at a slower
rate and over 70% of the cells were damaged and destroyed.
[0124] BHN fraction, on the other hand, displayed different levels
of activity on individual isolates of target cancer cells. Thus the
BHN fraction was comparatively ineffective on Daudi D-1 cell
isolate and the percentage of death was similar to control cells.
However, when an additional isolate of Daudi cells was used (D-2)
it exhibited a very high sensitivity, 100% of cells were killed by
RHN fraction and 74% by the BHN fraction within 72 h (FIGS. 5A and
5B). The subsequent experiments were carried out with the D-2
line.
[0125] DNA Synthesis
[0126] A rapid inhibition of DNA synthesis (90-95%) was observed
after 1 h of interaction of cells with NDV strains and fractions
RO, RHN, B-1 and BHN. This inhibition was maintained throughout the
experiment and reached 99% inhibition at 48 h (the results are
shown in FIG. 6 and in Table 7 below).
TABLE-US-00015 TABLE 8 Inhibition of cellular DNA synthesis % DNA
inhibition Incubation (D-2) NDV strain/fraction (hours) RO RHN B-1
BHN 1 95 94.9 92.9 94 4 95.9 94.7 95.2 96.2 24 98.3 96.2 98.9 97.9
48 98.6 99 98.9 99
[0127] The inhibitory effect is NDV virus specific, as pretreatment
of viral preparations (intact virus or isolated surface
glycoproteins) with specific antiserum abolished cytotoxicity.
[0128] Elevation in Cell Membrane Permeability
[0129] Cells were labeled with .sup.51Cr and interacted with the
different NDV preparations. Following different time intervals
radioactive leakage was determined in comparison with spontaneous
release from uninfected control Daudi cells. As shown in FIG. 8, a
significant .sup.51Cr release was already observed 90 minutes
following interaction with NDV RO (59%) and B-1 (79%), while only a
low percentage of release was caused by RHN (12%) and BHN (6%).
[0130] The release was elevated further to 60, 85, 23, and 18% at 4
h post interaction with RO, B-1, RHN and BHN, respectively. At 24 h
a total release (100%) resulted from the interaction with the
intact virions, 65% release was recorded as a result of interaction
with RHN and only 36% release was found in cells interacted with
BHN. In cells interacting with control fluids, or in uninfected
cells, no elevation in membrane permeability and no cell damages
were observed.
Tissue Culture
[0131] Effect of Virus Cultivated in Cultured Primary Chicken
Fibroblasts (CF)
[0132] The cytotoxic effect of NDV strains on Burkitt lymphoma
Daudi cells was studied. Interaction of cells with mesogenic
(Roakin), as well as of active attenuated lentogenic strain (B-1)
cultivated in the allantoic sac of embryonated eggs, lead to cell
death (90%). However, lentogenic strains cultivated in chicken
fibroblasts (CF) exhibited a very low activity with only 10% cell
death (FIGS. 8A-C). The activity was found to be dependent on the
cleavage of the viral surface glycoproteins (Hemagglutinin
Neuraminidase (HN) and Fusion (F)).
[0133] While the glycoproteins of both the mesogenic and the
lentogenic strains undergo cleavage by the proteases in the
embryonated eggs, the lentogenic strain that has one glutamine
residue in the cleavage site of F0 and of HN0, is insensitive to
the proteases of the CF. Cultivation of the virus in CF, in the
presence of trypsin (CFT), or treatment of the purified virus
preparation with trypsin (NDVT) restored virus activity as detected
by cell death (66% and 93% cell death, respectively). Neuraminidase
and hemagglutinin activities are similar in treated and non-treated
virus preparation as demonstrated by a hemagglutination test, viral
adsorption on cells using fluorescent staining and a neuraminidase
assay.
[0134] The fusion glycoprotein of the CF grown virus is almost
completely inactive, as indicated by lack of hemolysis of red blood
cells (in 1:2 dilution only 31% hemolysis was recorded in
comparison to 71% hemolysis in 1:32 dilution of egg grown virus).
Trypsin elevated activity to 58% and 64% hemolysis in 1:16 dilution
of CFT and NDVT, respectively (Tables 9, and 4 and FIG. 9).
[0135] It seems, therefore, that the fusion glycoprotein which is
responsible for the fusion of cell virus membranes plays a crucial
role in the cytotoxic effect of the virus.
TABLE-US-00016 TABLE 9 Activity of F glycoproteins (virus) % % %
titer hemolysis titer hemolysis titer hemolysis Purified egg (1:2)
95.4 (1:8) 89.4 (1:16) 71 CF (1:2) 0.3 CF + trypsin (1:2) 80 (1:16)
58 In vitro Cultivated in (1:2) 88.8 (1:16) 64 CF + trypsin
[0136] It will be appreciated by persons skilled in the art that
the present invention is not limited by what has been particularly
shown and described herein above. Rather the scope of the invention
is defined by the claims which follow.
Sequence CWU 1
1
3513358DNANewcastle disease virus 1acgggtagaa gattctggat cccggttggc
gccctccagg tgcaagatgg gctccagacc 60ttctaccaag aacccagcac ctatgatgct
gactatccgg gttgcgctgg cactgagttg 120catctgtccg gcaaactcca
ttgatggcag gcctcttgca gctgcaggaa ttgtggttac 180aggagacaaa
gccgtcaaca tatacacctc atcccagaca ggatcaatca tagttaagct
240cctcccgaat ctgcccaagg ataaggaggc atgtgcgaaa gcccccttgg
atgcatacaa 300caggacattg accactttgc tcacccccct tggtgactct
atccgtagga tacaagagtc 360tgtgactaca tctggagggg ggagacaggg
gcgccttata ggcgccatta ttggcggtgt 420ggctcttggg gttgcaactg
ccgcacaaat aacagcggcc gcagctctga tacaagccaa 480acaaaatgct
gccaacatcc tccgacttaa agagagcatt gccgcaacca atgaggctgt
540gcatgaggtc actgacggat tatcgcaact agcagtggca gttgggaaga
tgcagcagtt 600tgttaatgac caatttaata aaacagctca ggaattagac
tgcatcaaaa ttgcacagca 660agttggtgta gagctcaacc tgtacctaac
cgaattgact acagtattcg gaccacaaat 720cacttcacct gctttaaaca
agctgactat tcaggcactt tacaatctag ctggtggaaa 780tatggattac
ttattgacta agttaggtgt agggaacaat caactcagct cattaatcgg
840tagcggctta atcaccggta accctattct atacgactca cagactcaac
tcttgggtat 900acaggtaact ctaccttcag tcgggaacct aaataatatg
cgtgccacct acttggaaac 960cttatccgta agcacaacca ggggatttgc
ctcggcactt gtcccaaaag tggtgacaca 1020ggtcggttct gtgatagaag
aacttgacac ctcatactgt atagaaactg acttagattt 1080atattgtaca
agaatagtaa cgttccctat gtcccctggt atttattcct gcttgagcgg
1140caatacgtcg gcctgtatgt actcaaagac cgaaggcgca cttactacac
catacatgac 1200tatcaaaggt tcagtcatcg ccaactgcaa gatgacaaca
tgtagatgtg taaacccccc 1260gggtatcata tcgcaaaact atggagaagc
cgtgtctcta atagataaac aatcatgcaa 1320tgttttatcc ttaggcggga
taactttaag gctcagtggg gaattcgatg taacttatca 1380gaagaatatc
tcaatacaag attctcaagt aataataaca ggcaatcttg atatctcaac
1440tgagcttggg aatgtcaaca actcgatcag taatgctttg aataagttag
aggaaagcaa 1500cagaaaacta gacaaagtca atgtcaaact gactagcaca
tctgctctca ttacctatat 1560cgttttgact atcatatctc ttgtttttgg
tatacttagc ctgattctag catgctacct 1620aatgtacaag caaaaggcgc
aacaaaaaac cttattatgg cttgggaata atactctaga 1680tcagatgaga
gccactacaa aaatgtgaac acagatgagg aacgaaggtt tccctaatag
1740taatttgtgt gaaagttctg gtagtctgtc agttcagaga gttaagaaaa
aactaccggt 1800tgtagatgac caaaggacga tatacgggta gaacggtaag
agaggccgcc cctcaattgc 1860gagccaggct tcacaacctc cgttctaccg
cttcaccgac aacagtcctc aatcatggac 1920cgcgccgtta gccaagttgc
gttagagaat gatgaaagag aggcaaaaaa tacatggcgc 1980ttgatattcc
ggattgcaat cttattctta acagtagtga ccttggctat atctgtagcc
2040tcccttttat atagcatggg ggctagcaca cctagcgatc ttgtaggcat
accgactagg 2100atttccaggg cagaagaaaa gattacatct acacttggtt
ccaatcaaga tgtagtagat 2160aggatatata agcaagtggc ccttgagtct
ccgttggcat tgttaaatac tgagaccaca 2220attatgaacg caataacatc
tctctcttat cagattaatg gagctgcaaa caacagtggg 2280tggggggcac
ctatccatga cccagattat atagggggga taggcaaaga actcattgta
2340gatgatgcta gtgatgtcac atcattctat ccctctgcat ttcaagaaca
tctgaatttt 2400atcccggcgc ctactacagg atcaggttgc actcgaatac
cctcatttga catgagtgct 2460acccattact gctacaccca taatgtaata
ttgtctggat gcagagatca ctcacattca 2520tatcagtatt tagcacttgg
tgtgctccgg acatctgcaa cagggagggt attcttttct 2580actctgcgtt
ccatcaacct ggacgacacc caaaatcgga agtcttgcag tgtgagtgca
2640actcccctgg gttgtgatat gctgtgctcg aaagtcacgg agacagagga
agaagattat 2700aactcagctg tccctacgcg gatggtacat gggaggttag
ggttcgacgg ccagtaccac 2760gaaaaggacc tagatgtcac aacattattc
ggggactggg tggccaacta cccaggagta 2820gggggtggat cttttattga
cagccgcgta tggttctcag tctacggagg gttaaaaccc 2880aattcaccca
gtgacactgt acaggaaggg aaatatgtga tatacaagcg atacaatgac
2940acatgcccag atgagcaaga ctaccagatt cgaatggcca agtcttcgta
taagcctgga 3000cggtttggtg ggaaacgcat acagcaggct atcttatcta
tcaaggtgtc aacatcctta 3060ggcgaagacc cggtactgac tgtaccgccc
aacacagtca cactcatggg ggccgaaggc 3120agaattctca cagtagggac
atctcatttc ttgtatcaac gagggtcatc atacttctct 3180cccgcgttat
tatatcctat gacagtcagc aacaaaacag ccactcttca tagtccttat
3240acattcaatg ccttcactcg gccaggtagt atcccttgcc aggcttcagc
aagatgcccc 3300aactcgtgtg ttactggagt ctatacagat ccatatcccc
taatcttcta tagaaacc 33582553PRTNewcastle disease virus 2Met Gly Ser
Arg Pro Ser Thr Lys Asn Pro Ala Pro Met Met Leu Thr1 5 10 15Ile Arg
Val Ala Leu Ala Leu Ser Cys Ile Cys Pro Ala Asn Ser Ile 20 25 30Asp
Gly Arg Pro Leu Ala Ala Ala Gly Ile Val Val Thr Gly Asp Lys 35 40
45Ala Val Asn Ile Tyr Thr Ser Ser Gln Thr Gly Ser Ile Ile Val Lys
50 55 60Leu Leu Pro Asn Leu Pro Lys Asp Lys Glu Ala Cys Ala Lys Ala
Pro65 70 75 80Leu Asp Ala Tyr Asn Arg Thr Leu Thr Thr Leu Leu Thr
Pro Leu Gly 85 90 95Asp Ser Ile Arg Arg Ile Gln Glu Ser Val Thr Thr
Ser Gly Gly Gly 100 105 110Arg Gln Gly Arg Leu Ile Gly Ala Ile Ile
Gly Gly Val Ala Leu Gly 115 120 125Val Ala Thr Ala Ala Gln Ile Thr
Ala Ala Ala Ala Leu Ile Gln Ala 130 135 140Lys Gln Asn Ala Ala Asn
Ile Leu Arg Leu Lys Glu Ser Ile Ala Ala145 150 155 160Thr Asn Glu
Ala Val His Glu Val Thr Asp Gly Leu Ser Gln Leu Ala 165 170 175Val
Ala Val Gly Lys Met Gln Gln Phe Val Asn Asp Gln Phe Asn Lys 180 185
190Thr Ala Gln Glu Leu Asp Cys Ile Lys Ile Ala Gln Gln Val Gly Val
195 200 205Glu Leu Asn Leu Tyr Leu Thr Glu Leu Thr Thr Val Phe Gly
Pro Gln 210 215 220Ile Thr Ser Pro Ala Leu Asn Lys Leu Thr Ile Gln
Ala Leu Tyr Asn225 230 235 240Leu Ala Gly Gly Asn Met Asp Tyr Leu
Leu Thr Lys Leu Gly Val Gly 245 250 255Asn Asn Gln Leu Ser Ser Leu
Ile Gly Ser Gly Leu Ile Thr Gly Asn 260 265 270Pro Ile Leu Tyr Asp
Ser Gln Thr Gln Leu Leu Gly Ile Gln Val Thr 275 280 285Leu Pro Ser
Val Gly Asn Leu Asn Asn Met Arg Ala Thr Tyr Leu Glu 290 295 300Thr
Leu Ser Val Ser Thr Thr Arg Gly Phe Ala Ser Ala Leu Val Pro305 310
315 320Lys Val Val Thr Gln Val Gly Ser Val Ile Glu Glu Leu Asp Thr
Ser 325 330 335Tyr Cys Ile Glu Thr Asp Leu Asp Leu Tyr Cys Thr Arg
Ile Val Thr 340 345 350Phe Pro Met Ser Pro Gly Ile Tyr Ser Cys Leu
Ser Gly Asn Thr Ser 355 360 365Ala Cys Met Tyr Ser Lys Thr Glu Gly
Ala Leu Thr Thr Pro Tyr Met 370 375 380Thr Ile Lys Gly Ser Val Ile
Ala Asn Cys Lys Met Thr Thr Cys Arg385 390 395 400Cys Val Asn Pro
Pro Gly Ile Ile Ser Gln Asn Tyr Gly Glu Ala Val 405 410 415Ser Leu
Ile Asp Lys Gln Ser Cys Asn Val Leu Ser Leu Gly Gly Ile 420 425
430Thr Leu Arg Leu Ser Gly Glu Phe Asp Val Thr Tyr Gln Lys Asn Ile
435 440 445Ser Ile Gln Asp Ser Gln Val Ile Ile Thr Gly Asn Leu Asp
Ile Ser 450 455 460Thr Glu Leu Gly Asn Val Asn Asn Ser Ile Ser Asn
Ala Leu Asn Lys465 470 475 480Leu Glu Glu Ser Asn Arg Lys Leu Asp
Lys Val Asn Val Lys Leu Thr 485 490 495Ser Thr Ser Ala Leu Ile Thr
Tyr Ile Val Leu Thr Ile Ile Ser Leu 500 505 510Val Phe Gly Ile Leu
Ser Leu Ile Leu Ala Cys Tyr Leu Met Tyr Lys 515 520 525Gln Lys Ala
Gln Gln Lys Thr Leu Leu Trp Leu Gly Asn Asn Thr Leu 530 535 540Asp
Gln Met Arg Ala Thr Thr Lys Met545 550321DNANewcastle disease virus
3tgaccacgag gttacctcta c 21421DNANewcastle disease virus
4tccaagtagg tggcacgcat a 21522DNANewcastle disease virus
5aattgactac agtattcgga cc 22621DNANewcastle disease virus
6tgttgacatt cccaagctca g 21720DNANewcastle disease virus
7gctcagtcat cgctaactgc 20821DNANewcastle disease virus 8cggaatatca
agcgccatgt a 21921DNANewcastle disease virus 9ttagaaaaaa cacgggtaga
a 211021DNANewcastle disease virus 10acaggacatt gaccactttg c
211122DNANewcastle disease virus 11caggtaactc taccttcagt cg
221223DNANewcastle disease virus 12caactcgatc agtaatgctt tga
231325DNANewcastle disease virus 13cctagatcag atgagagcca ctaca
251420DNANewcastle disease virus 14ctgctgcatc ttcccaactg
201523DNANewcastle disease virus 15gactcttgta tcctacggat aga
231623DNANewcastle disease virus 16gtacatacag gccgatgtat tgc
231723DNANewcastle disease virus 17aaggtctttt gttgcgcctt ttg
231822DNANewcastle disease virus 18cgttagccaa gttgcgttag ag
221919DNANewcastle disease virus 19ccgtcgaacc ctaacctcc
192021DNANewcastle disease virus 20gtcttgcagt gtgagtgcaa c
212121DNANewcastle disease virus 21cctcgcaagg tgtggtttct a
212224DNANewcastle disease virus 22gccactcttc atagtcctta taca
242325DNANewcastle disease virus 23ccatgagctg ttttgccttg tatct
252422DNANewcastle disease virus 24gcacctatcc atgacccaga tt
222523DNANewcastle disease virus 25cgatacaatg acacatgccc aga
232624DNANewcastle disease virus 26gacctattgt ctcagcattg ctga
242723DNANewcastle disease virus 27ggaaccaagt gtagatgtaa tct
232823DNANewcastle disease virus 28gagggtattc gagtgcaacc tga
232921DNANewcastle disease virus 29ggtcttcgcc taaggatgtt g
213022DNANewcastle disease virus 30ctgaattctc cgaagagagt at
223121DNANewcastle disease virus 31tgatcgcatg agcactggct g
213219DNANewcastle disease virus 32ttgcagctgc aggaattgt
193322DNANewcastle disease virus 33ctatacagta tgaggtgtca ag
223420DNANewcastle disease virus 34gaattgacta cagtattcgg
203517DNANewcastle disease virus 35gcgcggtcca tgattga 17
* * * * *