U.S. patent application number 12/551901 was filed with the patent office on 2010-04-29 for method for the simultaneous determination of blood group and platelet antigen genotypes.
This patent application is currently assigned to CANADIAN BLOOD SERVICES. Invention is credited to Gregory A. Denomme.
Application Number | 20100105047 12/551901 |
Document ID | / |
Family ID | 34837528 |
Filed Date | 2010-04-29 |
United States Patent
Application |
20100105047 |
Kind Code |
A1 |
Denomme; Gregory A. |
April 29, 2010 |
Method for the Simultaneous Determination of Blood Group and
Platelet Antigen Genotypes
Abstract
RBC and platelet (Plt) alloimmunization requires antigen-matched
blood to avoid adverse transfusion reactions. Some blood collection
facilities use unregulated Abs to reduce the cost of mass
screening, and later confirm the phenotype with government approved
reagents. Alternatively, RBC and Plt antigens can be screened by
virtue of their associated single nucleotide polymorphisms (SNPs).
We developed a multiplex PCR-oligonucleotide extension assay using
the GenomeLab SNPStream platform to genotype blood for a plurality
of blood group antigen-associated SNPs, including but not limited
to: RhD (2), RhC/c, RhE/e, S/s, K/k, Kp.sup.a/b, Fya/b, FYO,
Jk.sup.a/b, Di.sup.a/b, and HPA-1a/b.
Inventors: |
Denomme; Gregory A.;
(Hamilton, CA) |
Correspondence
Address: |
DAVID S. RESNICK
NIXON PEABODY LLP, 100 SUMMER STREET
BOSTON
MA
02110-2131
US
|
Assignee: |
CANADIAN BLOOD SERVICES
Ottawa
CA
|
Family ID: |
34837528 |
Appl. No.: |
12/551901 |
Filed: |
September 1, 2009 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10588631 |
Nov 27, 2007 |
|
|
|
PCT/CA2005/000250 |
Feb 7, 2005 |
|
|
|
12551901 |
|
|
|
|
60541932 |
Feb 6, 2004 |
|
|
|
Current U.S.
Class: |
435/6.16 ;
435/91.2; 536/23.1; 536/24.3 |
Current CPC
Class: |
C07H 21/00 20130101;
C12Q 1/6881 20130101; C12Q 2600/156 20130101; C07H 21/04 20130101;
C12Q 2600/16 20130101 |
Class at
Publication: |
435/6 ; 536/23.1;
435/91.2; 536/24.3 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68; C07H 21/04 20060101 C07H021/04; C12P 19/34 20060101
C12P019/34 |
Claims
1. A nucleic acid sequence having a nucleotide sequence selected
from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO:
5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID
NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14,
SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID
NO: 19, SEQ ID NO:20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23
and SEQ ID NO: 24.
2. The nucleic acid sequence of claim 1 for use in a polymerase
chain reaction.
3. The nucleic acid sequence of claim 1 for use in a multiplex
polymerase chain reaction.
4. The nucleic acid sequence of claim 1 for use in the
determination of a blood group or platelet antigen.
5. The nucleic acid sequence of claim 4 for use in the
amplification of a fragment comprising a single nucleotide
polymorphism (SNP) associated with said blood group or platelet
antigen.
6. A pair of oligonucleotides being selected from the group
consisting of: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 5, SEQ ID NO:
6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID
NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15,
SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID
NO:20, SEQ ID NO: 21, SEQ ID NO: 22, and SEQ ID NO: 23 and SEQ ID
NO: 24.
7. The pair of oligonucleotides of claim 6 for use in a polymerase
chain reaction.
8. The pair of oligonucleotides of claim 6 for use in a multiplex
polymerase chain reaction.
9. The pair of oligonucleotides of claim 6 for use in the
determination of a blood group or platelet antigen.
10. The pair of oligonucleotides of claim 9 for use in the
amplification of a fragment comprising a single nucleotide
polymorphism (SNP) associated with said blood group or platelet
antigen.
11. A probe having a nucleotide sequence selected from the group
consisting of: SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID
NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33,
SEQ ID NO: 34, SEQ ID NO: 35 and SEQ ID NO: 36.
12. The probe of claim 11 for use as an extension probe for the
detection of a SNP selected from the group consisting of: RhD RHD
Exon 4 C/T; RhC/c RHCE Exon 2 T/C; RhE/e RHCE Exon 5 C/G; S/s GYPB
Exon 4 T/C; K/k KEL Exon 6 T/C; Kpa/Kpb KEL Exon 8 T/C; FY/FY0 FY
Promoter T/C; Fya/Fyb FY Exon 2 G/A; Jka/Jkb KIDD Exon 9 G/A;
Dia/Dib DIEGO Exon 19 T/C; and HPA-1a/b GP3A Exon 3 T/C.
13. A blood group/platelet antigen typing kit comprising a pair of
oligonucleotides and a probe, said kit comprising at least one of
the following combination of nucleotide sequences: SEQ ID NO: 1,
SEQ ID NO: 2, and SEQ ID NO: 25; SEQ ID NO: 5, SEQ ID NO: 6, and
SEQ ID NO: 27; SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 28; SEQ
ID NO: 9, SEQ ID NO: 10, and SEQ ID NO: 29; SEQ ID NO: 11, SEQ ID
NO: 12, and SEQ ID NO: 30; SEQ ID NO: 13, SEQ ID NO: 14, and SEQ ID
NO: 31; SEQ ID NO: 15, SEQ ID NO: 16, and SEQ ID NO: 32; SEQ ID NO:
17, SEQ ID NO: 18, and SEQ ID NO: 33; SEQ ID NO: 19, SEQ ID NO:20,
and SEQ ID NO: 34; SEQ ID NO: 21, SEQ ID NO: 22, and SEQ ID NO: 35;
and SEQ ID NO: 23 and SEQ ID NO: 24 and SEQ ID NO: 36.
14. A method of detecting a blood group or platelet antigen in a
sample, said method comprising: (a) providing genomic DNA from said
sample; (b) submitting the genomic DNA of step (a) to a PCR
amplification with at least one pair of oligonucleotides of claim 6
to obtain at least one amplification product; and (c) analyzing the
at least one amplification product to detect the blood group or
platelet antigen in the sample.
15. The method of claim 14, wherein the amplification product is
digested with a restriction enzyme.
16. The method of claim 15, wherein said restriction enzyme is
Exonuclease I or shrimp alkaline phosphatase.
17. The method of claim 14, wherein, in step (c), the probe of
claim 11 is used with the amplification product in a single-base
pair primer extension assay to generate an extension product.
18. The method of claim 15, wherein the extension production is
hybridized.
19. The method of claim 18, wherein said extension product is
hybridized to a tag-arrayed microplate.
20. A method of detecting a plurality of blood group or platelet
antigens in a sample, said method comprising: (a) providing genomic
DNA from said sample; (b) submitting the genomic DNA of step (a) to
a multiplex PCR amplification with at least two pairs of
oligonucleotides of claim 6 to obtain at least two amplification
products; and (c) analyzing the at least two amplification products
to detect the plurality of blood group or platelet antigens in the
sample.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] The present application is a Continuation of U.S. Utility
application Ser. No. 10/588,631, which is a 371 National Stage of
International Application No. PCT/CA2005/000250 filed on Feb. 7,
2005, which designated the U.S., and which claims benefit under 35
U.S.C. .sctn.119(e) of the U.S. provisional application Ser. No.
60/541,932, filed Feb. 6, 2004.
TECHNICAL FIELD
[0002] This invention relates to an ultra high throughput (UHT)
multiplex PCR genotyping method. More specifically, the present
invention relates to an automated method of determining a plurality
of blood group and platelet antigen, preferably human platelet
antigen (HPA), genotypes simultaneously from a single sample
through the detection of single nucleotide polymorphisms (SNPs) for
various blood group and platelet antigens.
BACKGROUND OF THE INVENTION
[0003] At present, there are 29 blood group systems and 6 HPA
systems recognized by the International Society of Blood
Transfusion (ISBT), wherein, with a few exceptions, a blood group
`system` may be defined by a single gene at a given locus of the
human genome (Daniels, G. L. et al. Vox Sang 2003; 84:244; Metcalfe
P. et al., Vox Sang. 2003; 85:240). Most people know their ABO and
Rh blood group. However, the ABO and Rh blood group systems
expressed on red cells simply represent antigens from only two of
the 29 blood group systems, and more systems are being discovered
each year. Some examples of blood group systems are the ABO, Rh (D,
C, c, E, e), P, Lutheran, Kell (K, k), Lewis, Duffy (Fy.sup.a,
Fy.sup.b), or Kidd (Jk.sup.a, Jk.sup.b). Moreover, there are over
250 blood group and 12 human platelet antigens assigned to one of
the blood group or HPA systems, respectively. A system is defined
by a gene or group of genes at a specific locus of the human
genome. The alleles or genotype of a person for each blood group or
HPA system represent the unique nucleotide gene sequences that
express specific blood group or platelet antigens (for a review see
Denomme, G. et al., Approaches to Blood Group Molecular Genotyping
and Its Applications: in Stowell, C. and Dzik W., editors; Emerging
Technologies in Transfusion Medicine, AABB 2003, Ch 4).
[0004] A blood group or HPA system maps to a specific region of the
human genome, termed a locus. Nearly all blood group or HPAs can be
identified by the presence of its unique nucleotide sequence,
termed an `allele`, at the locus of interest. Every person has two
alleles for any given autosomal gene. Some individuals are
homozygotes for a specific allele, i.e. they have two identical
alleles, while others are heterozygotes for a specific allele, i.e.
they have two different alleles. By definition, alleles that
represent different blood group or HPAs differ by at least one
nucleotide; sometimes they differ by several nucleotides. For
example, a deoxythymidine (T) or a deoxycytidine (C) nucleotide can
be found at cDNA position 196 of the glycoprotein Ma (GP3A) gene
that expresses the HPA-1 (Newman P. J. et al., J Clin Invest 1989;
83:1778). The allele containing the deoxthymidine nucleotide
expresses the HPA-1a antigen and the allele containing the
deoxycytidine nucleotide expresses the HPA-1b antigen. We refer to
the T/C nucleotide difference between the two alleles as a single
nucleotide polymorphism (SNP).
[0005] Blood group alleles for a given blood group system represent
genetic variations of the same gene. For example, the ABO blood
group system has 3 common alleles, that confer 6 genotypes within
this blood group system. Moreover, many alleles within a blood
group system express different blood group `antigens`, that is to
say, dependent on the allelic genotype the corresponding antigenic
phenotype is accordingly expressed. Alleles differ in their
nucleotide sequence, and the difference between one allele and
another, usually within a single blood group system, may be one
single nucleotide variation. Therefore, two alleles can differ by
one nucleotide, i.e. a SNP and represent a co-dominant bi-allelic
system. Alternatively, alleles can differ by a few to several
dispersed nucleotides, or by a stretch of nucleotides, any one of
which can be used to identify the alleles. Regardless of whether
the variations in the nucleotide are due to single or multiple
nucleotide differences, the phenotype associated with a specific
genotype (the specific nucleotide sequence) will result in the
expression of a specific blood group or platelet antigen on the red
cell or platelet surface, respectively.
[0006] Normally, all blood donations are blood grouped for ABO and
RhD. However, sometimes a previously transfused recipient will
require more blood that is antigen-matched with one of their own
antigens because they have made antibodies to a different blood
group or platelet antigen. The gold standard in the industry is to
`phenotype` blood for the presence of specific blood group and
platelet antigens using government regulated antisera (antibodies)
performed by single-test methods or by an automated platform, which
is a cost ineffective method for a blood collection facility that
routinely performs tests on a high volume basis.
[0007] Blood group phenotypes are presently determined using
commercially available government-regulated serological reagents
and human red cells. These known tests rely on the principle of
antibody binding and red cell agglutination to identify clinically
important blood group phenotypes. The presently known tests were
originally devised some 60 years ago and today require the use of
government regulated (for example, Health Canada) approved
serological reagents. Some of the tests being employed today have
been automated (for example, ABO and Rh typing) while some have
been semi-automated (for example, RhC/c and RhE/e). However, many
of the presently used tests are performed manually by
highly-trained laboratory technologists and are done on a
test-by-test basis. In other words, a technologist must perform
four separate tests to determine, for example, the Fy.sup.a,
Fy.sup.b, Jk.sup.a and Jk.sup.b phenotype of a single blood
donation. Essentially, the current tests which employ
government-approved reagents in a manual, single-test driven method
are a very cost ineffective method for a blood collection facility
that is often required to perform such tests on a high volume
basis.
[0008] In an effort to reduce costs, a blood collection facility
will often use non-regulated antisera to `screen` blood donations
for important blood group phenotypes and then confirm the phenotype
with the regulated antisera. However, since much of the blood is
sent to hospitals within 24-48 hours after collection, manual blood
group phenotyping cannot meet the short turn-around time required
to provide the end user with the information required before blood
must be shipped. Therefore, hospital blood banks must perform their
own tests on the blood that they have in their inventories. It
would be advantageous to provide a cost effective blood screening
method that would provide quick and reliable results relating to
the clinically important blood group phenotypes.
[0009] The prior art uses two basic techniques to detect SNPs;
polymerase chain reaction-restriction fragment length polymorphism
(PCR-RFLP) (Chaudhuri A., et al. 1995; 85:615), and sequence
specific primer (SSP)-PCR (McFarland J. G. et al., Blood 1991;
78:2276). For PCR-RFLP analysis, restriction enzymes are used to
digest PCR amplified genomic DNA fragments. In brief, DNA is
extracted from nucleated blood cells manually for each blood sample
to be analyzed. The PCR is set up manually; a separate PCR is
performed on each sample for each SNP of interest. The PCR
amplified fragments are digested with a specific restriction enzyme
and the digested products are separated on a gel. The pattern of
digested DNA fragments viewed from the gel predicts the presence or
absence of either nucleotide of a SNP of interest. In SSP-PCR, two
PCRs are set up in separate tubes for each SNP of interest. One
tube contains a universal primer and a primer with a sequence that
is specific to detect one nucleotide of a SNP. The other tube
contains the same universal primer and a primer specific for the
other nucleotide of a SNP. Prior art has used two pair or three
pair PCR to analyze a nucleotide for a given SNP, with at least one
pair acting as an internal control to ensure DNA is available for
PCR amplification. The prior art does not provide the use of
multiple DNA sequences as primer pairs that work simultaneously on
a single sample. Moreover, the prior art does not employ novel DNA
sequences to detect blood group SNPs in an automated
high-throughput fashion.
[0010] St-Louis M., et al. (Transfusion 2003; 43:11126-32) have
used allele-specific PCR-ELISA to detect blood group SNPs, wherein
some of the PCR primers were publicly known and all primers were
labeled with digoxigenin; SNPs were detected by oligonucleotide
hybridization using solid-phase microplate wells coated with
individual blood group-specific complementary oligonucleotides. An
abstract by Buffleir E. et al. (Transfusion 2003; 43:92A) outlines
a combined HPA-1 and HPA-5 genotyping method that uses biotin
labeled PCR-amplified targets and allele specific oligonucleotide
probes arrayed on the bottom of 96 well microplates. Specific
hybridization is detected with the use of an enzyme conjugate which
produces a specific colourimetric signal. An array of several
oligonucleotides reportedly can be used to detect HPA SNPs. The
publications, cited above, do not use multiplex PCR primers, nor do
they use extension probes, and rely on a less sensitive and more
error-prone allele-specific hybridization to detect the SNPs. There
are a few other publications that refer to the multiplex PCR
amplification of the RHD gene alone, or together with sex
determination, or with internal control primers designed to confirm
the presence of DNA in various blood group PCR applications. U.S.
Pat. No. 5,723,293 describes a diagnostic method and kit for
determining Rh blood group genotypes, wherein there is provided a
method for directly determining D and associated CcEe genotypes
using restriction fragment length polymorphisms (RFLPs) for
diagnosis. U.S. Pat. No. 5,804,379 describes a diagnostic method
and kit for determining Kell blood group genotype, wherein there is
provided a method for determining the K1/K2 genotype using RFLPs
for diagnosis. U.S. Pat. No. 5,780,229 provides polynucleotides for
determining the Pen polymorphism of human platelet membrane
glycoprotein IIIa, and generally describes diagnostic and
therapeutic uses relating to the "Pen" human platelet polymorphism
(HPA-4) and differs from the teachings of the present invention.
United States patent application 20020098528 describes methods and
apparatus for blood typing with optical bio-disc, and essentially
describes a method for determining the ABO blood cell type of an
individual with optical bio-discs and a disc-reading apparatus.
[0011] In the SSP-PCR application by St. Louis et al. (Transfusion
2003; 43:1126), two PCR primer pairs are set up, each in a separate
well, to detect the nucleotides of a SNP of interest. For example,
one primer pair containing a universal primer and a sequence
specific primer is set up in a tube to detect a nucleotide of a
SNP. Another primer pair containing the same universal and another
sequence specific primer is set up in another tube to detect the
alternate nucleotide for the same SNP. In addition, each tube
includes a primer pair that detects a universal sequence contained
in all human DNA. Contained in the PCR tube is digoxigenin-dUTP
that is incorporated into the amplified DNA fragment if the
sequence specific primer detects the appropriate nucleotide of an
SNP. For the detection phase, one of each primer pair contains the
chemical tag biotin, which is used to capture the DNA amplified
fragment in sets of microtitre wells containing streptavidin. An
optical colorimetric assay is used to detect the presence of
digoxigenin-dUTP in each of the wells; anti-digoxigenin peroxidase
conjugated antibody detects the presence of digoxigenin dUTP and
the peroxidase can convert a substrate added to the well into a
colored end product. Therefore, the presence of a nucleotide of a
SNP is detected by the presence of a color in the microtitre well.
Such assays are routinely designed in a 96-well microtitre plate
format to facilitate semi-automation. The colorimetric results are
evaluated by the operator to determine the presence or absence of
the nucleotides for a SNP. The deficiencies of these test systems
are the use of a single PCR reaction for each nucleotide of a given
nucleotide of each SNP, and the pooling of samples prior to the
detection phase and manual post-analyte data analysis.
[0012] No prior art has used a multiple, or 12, primer pair
multiplexed PCR that successfully works in a single tube, nor has
prior art employed novel DNA sequences as probes to detect both
nucleotides of a plurality of blood group and HPA genotypes
simultaneously, such as the detection of all 12 blood group and HPA
SNPs in these mixtures using an automated high-throughput
platform.
[0013] Accordingly, there is a need for a high-throughput automated
multiple blood-group associated SNP analysis of genomic DNA that is
capable of rapidly and accurately determining the genotypes and
associated phenotypes of a plurality of blood group systems in a
single test sample.
SUMMARY OF THE INVENTION
[0014] The present invention provides a method of detecting the
presence or absence of nucleotides relating to various SNPs for the
determination of a specific genotype and accordingly the inferred
phenotype. More specifically, the present invention allows for the
detection of the presence or absence of two nucleotides of a
plurality of different SNPs, and more preferably of the 12 SNPs in
a preferred embodiment of the present invention.
[0015] The present invention accordingly provides an automated, or
robotic, high-throughput `screening` tool for blood group and
platelet antigens by evaluating the alleles of the genes that
express these antigens on red cells and platelets, respectively.
This is done by identifying the unique nucleotides associated with
the specific alleles that occupy the gene locus using a testing
platform, which requires novel and specific compounds that we
designed. Our robotic high-throughput platform provides important
blood group and HPA genotype information within 24 hours from the
start of the test. We identified the alleles of blood group
antigens for; RhD, RhC, Rhc, RhE, Rhe, S, s, Duffy (Fy).sup.a,
Fy.sup.b, K, k, Kp.sup.a, Kp.sup.b, Diego (Di).sup.a, Di.sup.b,
Kidd (Jk).sup.a, Jk.sup.b, and the platelet antigens, Human
Platelet Antigen (HPA)-1a and HPA-1b, representing, but not limited
to 19 of the most clinically important antigens in red cell and
platelet transfusion. Additional genotyping tests for other
clinically important blood group and platelet antigens may be
developed, and are encompassed in the teachings of the present
invention. When performed on all blood donations for all clinically
important blood group and platelet antigens, our invention will
provide a comprehensive database to select and confirm the antigens
when required using government regulated antisera. The use of this
platform as a screening tool will lessen the number of costly
government regulated tests to be done by the collection facility
and end user (the hospital blood bank), and meet the demand of
antigen-matched blood for specific transfusion recipients.
[0016] The invention discloses a method for DNA-based blood group
genotyping for clinically important blood group and platelet
antigens. The technology uses an ultra high-throughput multiplex
PCR design to detect specific SNPs that represent clinically
important blood group antigens: RhD, RhC, Rhc, RhE, Rhe, S, s,
Duffy (Fy).sup.a, Fy.sup.b, K, k, Kp.sup.a, Kp.sup.b, Diego
(Di).sup.a, Di.sup.b, Kidd (Jk).sup.a, Jk.sup.b, and the platelet
antigens, Human Platelet Antigen (HPA)-1a and HPA-1b. It should be
noted however that the present invention is not limited to the
detection of SNPs for only the SNPs listed, but additionally
comprises the detection of SNPs for all blood group and platelet
antigens. The invention discloses novel DNA sequences of PCR
primers that are specifically designed to avoid inter-primer pair
cross-reactions and post-PCR probes that make multiple analyses
possible. The invention represents a novel approach to screening
multiple blood group and HPA genotypes at once and addresses a
clear need in the art for novel, rapid, cost-effective and reliable
genotyping. This additionally replaces the use of expensive and
difficult-to-obtain serological reagents, which can be reserved for
use to confirm only the donors identified by the screening
process.
[0017] More specifically, the present invention analyzes the HPA-1
GP3A mutation incorporated into our SNP assay, and the other blood
group antigen SNPs in a method according to the present
invention.
[0018] The invention addresses the need for an automated, accurate,
rapid and cost-effective approach to the identification of multiple
blood group antigens. The multiplex SNP assay design and automated
genotyping platform allows one trained research technician to
identify a plurality of blood group alleles, and more specifically,
19 blood group alleles, overnight on 372 to 2232 individual blood
samples. In one application of the present invention, the multiplex
PCR and SNP detection platform analyzed the nucleotides of 12 SNPs
overnight on 372 individual blood samples. The cost using current
standard blood group serology for 372 samples is estimated at CDN
$99,500, which reflects a reagent cost of CDN $54,000 (excluding
new capital equipment investments) and an operator cost of CDN
$45,500 to analyse each of the antigens by Gel Card technology
(n=5), immediate spin tube test (n=2), indirect antiglobulin tube
test (n=8), and platelet GTI.RTM. test (n=1). Approximate 10 to 15
fold cost savings are obtained in the simultaneous DNA-based
determination of these blood group alleles. It should be noted that
the present invention is not limited to the detection of only 12
SNPs, and may be optimally used for the detection a plurality of
SNPs for potentially all blood group and platelet alleles.
Accordingly, the products, methods, platform and teachings of the
present invention can detect all blood group and HPA SNP variations
on a great number of samples, such as 744 samples overnight, as
further described below.
[0019] The present invention overcomes the deficiencies of the
prior art because the entire test, i.e. all steps of the method of
the present invention, from PCR to computation analyses can be
automated and multiplexed so that the nucleotides of a plurality of
SNPs, and more preferably, the 12 SNPs of the present invention,
can be identified simultaneously. This automated multiplex high
throughput analysis can meet the demand of testing hundreds of
blood samples, and the turn-around time of less than 24 hours, to
provide valuable information to a blood collection facility before
blood is shipped to the end user. This platform has the advantage
over existing technology in that it reduces operator handling
error. In addition, there are significant cost reductions compared
with the current government-regulated serological analysis. It
should be noted that present prior art technologies relating to
PCR-RFLP and SSP-PCR for blood group and platelet antigens are not
routinely used since they are no more cost efficient than serology.
The present invention overcomes the deficiencies of the prior art
and fulfils an important need in the present art for the automated,
accurate, rapid and cost-effective identification of multiple blood
group and HPA SNPs.
[0020] The invention provides the opportunity to screen all blood
donors to obtain a daily or `live` repository of the genotypes or
combinations of genotypes currently available for specific
transfusion needs. Accordingly, the present invention fulfills a
need relating to the collection and antigen screening of blood and
blood products.
[0021] For convenience, some terms employed in the present
specification are noted below. Unless defined otherwise, all
technical and scientific terms used herein have the meanings
commonly understood by one of ordinary skill in the present
art.
[0022] The present invention provides a method or screening assay
for the determination of blood genotypes of the various blood group
and HPA systems through the ultra high throughput multiplex PCR
analysis of SNPs in an automated platform (Petrick J. Vox Sang
2001; 80:1). A platform, as referred to herein, refers to a system
of machine(s) and protocol(s) capable of analyzing multiplex PCR
amplified SNPs, wherein said platform is not limited to, but may
comprise the GenomeLab SNPStream (Beckman Coulter Inc., Fullerton,
Calif.), the SNPSTREAM.TM. UHT (Orchid BioSciences, Princeton,
N.J.), the SNPSTREAM.TM. 25K (Orchid BioSciences, Princeton, N.J.),
the MALDI-TOF/Mass-Spectrophotometer Spectro CHIP (Sequenom, San
Diego, Calif.), and the Gene Chip Microarray (Affymetrix, Inc.,
Santa Clara, Calif.), Nano Chip (Nanogen, San Diego, Calif.) and
the Random Ordered Bead Arrays (Illumina, Inc., San Diego, Calif.)
or any other system, machine or protocol capable of analyzing
multiplex PCR amplified SNPs. Accordingly, the present invention
provides a platform, or system and protocols, for the evaluation
and detection of SNPs, for the purpose of typing (determining the
genotype and corresponding phenotype) blood group and platelet,
preferably, human platelet antigen (HPA) SNP analysis. A preferred
platform that can be used in accordance with the present invention
is the Orchid SNP-IT system for HLA typing (Orchid Bioscience,
Princeton, N.J.), wherein a preferred embodiment of the present
invention comprises the use of the primer pairs of Table 1 for the
specific oligonucleotide primer extension of blood group and
platelet, preferably, human platelet antigen (HPA) SNPs, and the
probes of Table 2 for the specific hybridization thereof, and the
simultaneous analysis of the absence or presence of a plurality of
blood group and platelet, preferably, human platelet antigen (HPA)
SNPs using a platform as described herein, or using any SNP
analysis system capable of detecting multiplex PCR amplified
SNPs.
[0023] For the purposes of the present disclosure, SNPs, may refer
to any blood group and HPA SNPs, and more preferably refers to any
of the SNPs specified in Table 1, or any other known blood group or
HPA SNPs or single nucleotide changes including, but not limited
to, nucleotide substitutions, deletions, insertions or inversions,
that can be defined as a blood group or HPA SNP due to nucleotide
differences at the specified position in a gene sequence.
[0024] Ultra high throughput (UHT) refers to the implementation of
the platform in a rapid and optimized form, that is to say, through
the analysis of multiple SNPs. That is to say, UHT analysis refers
to the rapid and simultaneous evaluation of a plurality of samples
for a plurality of markers, in this case SNPs. For example, the
analysis of 12 SNPs (equivalent to 12 C and 12 T nucleotides) for
372 samples, would result in the generation of 8928 (i.e.
2.times.12.times.372) determinations that are analysed, an
evaluation that far exceeds the number of evaluation points
possible with manual or automated serological methods.
[0025] Phenotype in the context of red cell blood group and Human
Platelet Antigen (HPA) refers to the expressed moiety of an allele
for a given gene, and is also referred to in this document as
`antigen`. Genotype refers to the two alleles of an autosomal gene
that occupy a given locus or alternatively to either one or two
alleles of an X-linked gene that occupies a given locus.
[0026] Antigen refers to a red cell or platelet membrane
carbohydrate, protein or glycoprotein that is expressed as a
polymorphic structure among the human population, that is to say a
moiety that is immunogenic in another animal, or human, due
differences in its amino acid or carbohydrate composition. Blood
group or red cell, or HPA or platelet antigen refers to a moiety
expressed on red cells or platelets that has been assigned a blood
group or Human Platelet Antigen (HPA) designation, or provisional
or workshop designation. The present invention comprises a method
and for the determination of the antigen genotype and corresponding
phenotype of any blood group or red cell, or HPA or platelet
antigen using multiplex PCR SNP analysis. The following two tables
(Table A and Table B) list most of the known human blood group and
platelet antigens. Many of the antigens can be identified by their
unique nucleotide sequence.
TABLE-US-00001 TABLE A Human Red Cell Blood Group Systems Component
Associated ISBT Name Chromosome Gene Name Name Blood Group (ISBT
Number) Location ISGN (ISBT) (CD Number) Antigens ABO (001) 9q34.2
ABO (ABO) Carbohydrate A, B, A, B, A1 MNS (002) 4q28.2-q31.1 GYPA
(MNS) GPA (CD235a) M, N, Vw, GYPB (MNS) GPB (CD235b) S, s, U, He +
36 more P (003) 22q11.2-qter P1 (P1) Carbohydrate P1 Rh (004)
1p36.13-p34.3 RHD (RH) RhD D, G, Tar RHCE (RH) (CD240D) C, E, c, e,
V, RhCE Rh17 + (CD240CE) 39 more Lutheran (005) 19q13.2 LU (LU)
Lutheran Lu.sup.a, Lu.sup.b, Lu3, glycoprotein Lu4, Au.sup.a,
Au.sup.b + B-CAM 13 more (CD239) Kell (006) 7q33 KEL (KEL) Kell K,
k, Kp.sup.a, Kp.sup.b, glycoprotein Ku, Js.sup.a, Js.sup.b +
(CD258) 17 more Lewis (007) 19p13.3 FUT3 (LE) Carbohydrate
Le.sup.a, Le.sup.b, Le.sup.ab, Adsorbed form Le.sup.bh, ALe.sup.b,
plasma BLe.sup.b Duffy (008) 1q22-q23 DARC (FY) Fy Fy.sup.a,
Fy.sup.b, Fy3, glycoprotein Fy4, Fy5, Fy6 (CD234) Kidd (009)
18q11-q12 SLC14A1 (JK) Kidd Jk.sup.a, Jk.sup.b, Jk3 glycoprotein
Diego (010) 17q21-q22 SLC4A1 (DI) Band 3, AE1 Di.sup.a, Di.sup.b,
Wr.sup.a, (CD233) Wr.sup.b, Wd.sup.a, Rb.sup.a + 14 more Yt (011)
7q22 ACHE (YT) Acetyl- Yt.sup.a, Yt.sup.b cholinesterase Xg (012)
Xp22.32 XG (XG) Xg.sup.a Xg.sup.a MIC2 glycoprotein CD99 CD99
Scianna (013) 1p34 ERMAP (SC) ERMAP Sc1, Sc2, Sc3, Rd Dombrock
(014) 12p13.2-p12.1 DO (DO) Do Do.sup.a, Do.sup.b, Gy.sup.a,
glycoprotein; Hy, Jo.sup.a ART 4 Colton (015) 7p14 AQP1 (CO)
Channel- Co.sup.a, Co.sup.b, Co3 forming integral protein
Landsteiner- 19p13.3 LW (LW) LW LW.sup.a, LW.sup.ab, Wiener (016)
glycoprotein LW.sup.b (ICAM-4) (CD242) Chido/Rodgers 6p21.3 C4B,
C4A C4B, C4A CH1, CH2, (017) (CH/RG) Rg1 + 6 more Hh (018) 19q13.3
FUT1 (H) Carbohydrate H (CD173) Kx (019) Xp21.1 XK (XK) Xk Kx
glycoprotein Gerbich (020) 2q14-q21 GYPC (GE) GPC Ge3, Ge4, Wb, GPD
(CD236) Ls.sup.a, Dh.sup.a Ge2, Ge3, An.sup.a Cromer (021) 1q32 DAF
(CROM) DAF (CD55) Cr.sup.a, Tc.sup.a, Tc.sup.b, Tc.sup.c, Dr.sup.a,
Es.sup.a, IFC, WES.sup.a, WES.sup.b, UMC, GUTI Knops (022) 1q32 CR1
(KN) CR1 (CD35) Kn.sup.a, Kn.sup.b, McC.sup.a, Sl.sup.a, Yk.sup.a
Indian (023) 11p13 CD44 (IN) Hermes In.sup.a, In.sup.b antigen
(CD44) OK (024) 19pter-p13.2 CD147 (OK) Neurothelin, Ok.sup.a
basogin (CD147) RAPH (025) 11p15.5 MER2 (MER2) Not defined MER2 JMH
(026) 15q22.3-q23 SEMA-L H-Sema-L JMH (JMH) (CD108) I (027) 6p24
CGNT2 (IGNT) Carbohydrate I Globoside (028) 3q25
B3GALT3(.beta.GalNAcT1) Carbohydrate P (Gb.sub.4, globoside) GIL
(029) 9p13 AQP3 (GIL) AQP3 GIL ISGN = International Society for
Gene Nomenclature
TABLE-US-00002 TABLE B Human Platelet Antigen Systems Gene
Chromosome Associated System Name Location Component Name (CD)
Antigens HPA-1 GP3A 17q21.32 Integrin .beta.3 (CD61) Pl.sup.A1/2
HPA-2 GP1BA 17pter-p12 Glycoprotein Ib.alpha. Ko.sup.a/b (CD42b)
HPA-3 GP2B 17q21.32 Integrin .alpha.2b (CD41) Bak.sup.a/b HPA-4
GP3A 17q21.32 Integrin .beta.3 (CD61) Pen.sup.a/b HPA-5 GP1A
5q23-q31 Integrin .alpha.2 (CD49b) Br.sup.a/b HPA- GP3A 17q21.32
Integrin .beta.3 (CD61) Ca.sup.a/Tu.sup.a 6w HPA- GP3A 17q21.32
Integrin .beta.3 (CD61) MO.sup.a 7w HPA- GP3A 17q21.32 Integrin
.beta.3 (CD61) Sr.sup.a 8w HPA- GP2B 17q21.32 Integrin .alpha.2b
(CD41) Max.sup.a 9w HPA- GP3A 17q21.32 Integrin .beta.3 (CD61)
La.sup.a 10w HPA- GP3A 17q21.32 Integrin .beta.3 (CD61) Gro.sup.a
11w HPA- GP1BB 22q11.2 Glycoprotein Ib.beta. Ly.sup.a 12w (CD42c)
HPA- GP1A 5q23-q31 Integrin .alpha.2 (CD49b) Sit.sup.a 13w HPA-
GP3A 17q21.32 Integrin .beta.3 (CD61) Oe.sup.a 14w HPA-15 AF410459
6q13 GPI-linked GP (CD109) Gov.sup.a/b HPA- GP3A 17q21.32 Integrin
.beta.3 (CD61) Duv.sup.a 16w ? GPV ? Glycoprotein V Pl.sup.T ? GPIV
7q11.2 Glycoprotein IV (CD36) Vis.sup.a/Nak.sup.a Note: HPA numbers
on the left ending with a `w` represent ISBT workshop designations
and are tentative HPA systems.
[0027] A single nucleotide polymorphism (SNP) refers to any blood
group or HPA allele that defines a specific red cell or platelet
antigen by virtue of its unique nucleotide sequence as defined in
Garratty et al. Transfusion 2000; 40:477 and as updated from
time-to-time by the International Society of Blood Transfusion.
[0028] It is understood that the presently disclosed subject matter
is not limited to the particular methodology, protocols, cell
lines, vectors, and reagents described as these can vary. It is
also to be understood that the terminology used herein is for the
purpose of describing particular embodiments only, and is not
intended to limit the scope of the presently disclosed subject
matter.
[0029] Unless defined otherwise, all technical and scientific terms
used herein are intended to have their meanings as understood by
one skilled in the present art. Although any methods and materials
similar or equivalent to those described herein can be used in the
practice or testing of the presently disclosed subject matter, the
preferred embodiments, methods, devices and materials
described.
[0030] It is also understood that the articles `a` and `an` are
used herein to refer to one or to more than one (i.e. to at least
one) of the grammatical object of the article. Accordingly, `an
element` means one element or more than one element.
[0031] Our novel platform simultaneously performs automated
multiple blood group-associated SNP analyses using genomic DNA and
the Thermus aquaticus polymerase chain reaction (PCR) to infer the
presence of specific blood group genotypes. This automated
high-throughput platform has particular application in the blood
donation industry since it represents a novel screening tool for
the expression of blood group antigens or phenotypes.
[0032] Our platform provides important genotypic information within
24 hours of donation. When performed on all blood donations for all
important blood group phenotypes, our invention will provide a
comprehensive database to select and confirm blood group phenotypes
using government regulated antisera. The use of this platform as a
screening tool will lessen the number of regulated blood group
phenotype tests done by the collection facility and end user, and
meet the end user demand for antigen-matched blood for transfusion
recipients.
[0033] Unique to this invention is the assay design for the
simultaneous identification of a plurality of blood group or HPA
alleles. The present invention provides novel assay for the
simultaneous identification of a plurality of blood group or HPA
alleles, and more preferably of 19 blood group alleles using a
plurality of SNPs, and more preferably, 12 SNPs. In one embodiment,
the genotyping platform queries genetic variants using multiplexed
single nucleotide primer extension coupled with two-laser
fluorescence detection and software for automated genotype calling.
Each of the relevant gene regions are PCR amplified from purified
genomic DNA in a single reaction using the following
oligonucleotide primer designs:
TABLE-US-00003 Gene Primer Sequence (5'-3') RHD Exon 4 RHDe4S
AGACAAACTGGGTATCGTTGC (SEQ ID NO: 1) RHDe4A ATCTACGTGTTCGCAGCCT
(SEQ ID NO: 2) RHD Exon 9 RHDe9S CCAAACCTTTTAACATTAAATTATGC (SEQ ID
NO: 3) RHDe9A TTGGTCATCAAAATATTTAGCCTC (SEQ ID NO: 4) RHCE Exon 2
RHCEe2S TGTGCAGTGGGCAATCCT (SEQ ID NO: 5) RHCEe2A
CCACCATCCCAATACCTG (SEQ ID NO: 6) RHCE Exon 5 RHCEe5S
AACCACCCTCTCTGGCCC (SEQ ID NO: 7) RHCEe5A ATAGTAGGTGTTGAACATGGCAT
(SEQ ID NO: 8) GYPB Exon 4 GYPBe4S ACATGTCTTTCTTATTTGGACTTAC (SEQ
ID NO: 9) GYPBe4A TTTGTCAAATATTAACATACCTGGT AC (SEQ ID NO: 10) KEL
Exon 6 KELe6S TCTCTCTCCTTTAAAGCTTGGA (SEQ ID NO: 11) KELe6A
AGAGGCAGGATGAGGTCC (SEQ ID NO: 12) KEL Exon 8 KELe8S
AGCAAGGTGCAAGAACACT (SEQ ID NO: 13) KELe8A AGAGCTTGCCCTGTGCCC (SEQ
ID NO: 14) FY Promoter FYproS TGTCCCTGCCCAGAACCT (SEQ ID NO: 15)
FYproA AGACAGAAGGGCTGGGAC (SEQ ID NO: 16) FY Exon 2 FYe2S
AGTGCAGAGTCATCCAGCA (SEQ ID NO: 17) FYe2A TTCGAAGATGTATGGAATTCTTC
(SEQ ID NO: 18) JK Exon 9 JKe9S CATGAACATTCCTCCCATTG (SEQ ID NO:
19) JKe9A TTTAGTCCTGAGTTCTGACCCC (SEQ ID NO: 20) DI Exon 18 DIe19S
ATCCAGATCATCTGCCTGG (SEQ ID NO: 21) DIe19A CGGCACAGTGAGGATGAG (SEQ
ID NO: 22) GP3A GP3Ae3S ATTCTGGGGCACAGTTATCC (SEQ ID NO: 23)
GP3Ae3A ATAGTTCTGATTGCTGGACTTCTC (SEQ ID NO: 24)
[0034] The above primer pairs comprise the corresponding forward
and reverse primers, and may be referred to herein as SEQ ID NOs
1-24.
[0035] Multiplexed single nucleotide primer extension is performed
using the following 5' tagged extension primers:
TABLE-US-00004 RHD Exon 4 GTGATTCTGTACGTGTCGCCGTCTGATCTTTATCCTC
CGTTCCCT (SEQ ID NO: 25) RHD Exon 9
GCGGTAGGTTCCCGACATATTTTAAACAGGTTTGCTC CTAAATCT (SEQ ID NO: 26) RHCE
Exon 2 GGATGGCGTTCCGTCCTATTGGACGGCTTCCTGAGCC AGTTCCCT (SEQ ID NO:
27) RHCE Exon 5 CGACTGTAGGTGCGTAACTCGATGTTCTGGCCAAGTG TCAACTCT (SEQ
ID NO: 28) GYPB Exon 4 AGGGTCTCTACGCTGACGATTTGAAATTTTGCTTTAT
AGGAGAAA (SEQ ID NO: 29) KEL Exon 6
AGCGATCTGCGAGACCGTATTGGACTTCCTTAAACTT TAACCGAA (SEQ ID NO: 30) KEL
Exon 8 AGATAGAGTCGATGCCAGCTTTCCTTGTCAATCTCCA TCACTTCA (SEQ ID NO:
31) FY Promoter GACCTGGGTGTCGATACCTAGGCCCTCATTAGTCCTT GGCTCTTA (SEQ
ID NO: 32) FY Exon 2 ACGCACGTCCACGGTGATTTGGGGGCAGCTGCTTCCA GGTTGGCA
(SEQ ID NO: 33) JK Exon 9 CGTGCCGCTCGTGATAGAATAAACCCCAGAGTCCAAA
GTAGATGT (SEQ ID NO: 34) DI Exon 19
GGCTATGATTCGCAATGCTTGTGCTGTGGGTGGTGAA GTCCACGC (SEQ ID NO: 35) GP3A
Exon 3 AGAGCGAGTGACGCATACTTGGGCTCCTGTCTTACAX GCCCTGCCTC (SEQ ID NO:
36) GP3A Exon 3 GCCCTGCCTC (SEQ ID NO: 37)
[0036] The above probes may be referred to herein as SEQ ID NOs
25-37. The DNA bases are represented by their single letter
equivalents (A, C, G or T) and SEQ ID NOs: 36 and 37 are joined
together by a C3 (phosphoramidite) spacer between the two
sequences.
[0037] In this embodiment, the 12 bolded nucleotides in the 5'
region of the extension probes are hybridized to a complementary
DNA sequence that has been micro-arrayed onto microplates so that
specific blood group SNPs are individually identified and
reported.
[0038] Proof of principle experiments have been performed using 372
consent qualified samples (please refer to Appendix A). Collection
of serological data for samples has been constant and the success
rates based upon the expected allele frequencies have been
performed.
[0039] In the preceding example, one preferred embodiment has been
described. However, it should be obvious to one skilled in the art
that other methodologies and/or technologies for SNP identification
could be used, providing that the novel DNA sequences disclosed
above are also used.
[0040] The teachings and method of the present invention are
superior to the teachings of the prior art for a number of reasons,
one of which is that the complete method of the present invention,
from DNA extraction to result computation analyses can be automated
and multiplexed so that many SNPs can be determined simultaneously.
This automated multiplex high throughput analysis can meet the
demand (hundreds of blood donations can be tested) and the
turn-around time (<24 hours) to collate and provide valuable
information to the blood collection facility before blood is
shipped to the end user. This platform and method has the further
advantage over existing technology in that it reduces operator
handling error.
[0041] In addition, there are significant cost reductions compared
with the current technology. The invention addresses the need for
an automated, accurate, rapid and cost-effective approach to the
identification of multiple blood group SNPs. According to an
embodiment, a multiplex SNP assay of the present invention detected
12 SNPs overnight on 372 individual blood samples. In accordance
with the teachings of the present invention, the platform, products
and methods of the present invention can detect all SNP variations
for all blood group antigens, for example, as shown below on 744
samples.
BRIEF DESCRIPTION OF THE DRAWINGS
[0042] Further features and advantages of the present invention
will become apparent from the following detailed description, taken
in combination with the appended drawings, in which:
[0043] FIG. 1 A computer screen display of a typical UHT SNP
scatter plot to sort the fluorescence of a C/T SNP analysis of GP3A
Exon 3 for HPA-1a/b genotyping.
[0044] FIG. 2 Representative samples of GP3A Exon 3 HPA-1a/b)
genotyping by manual PCR-RFLP analysis using MspI restriction
enzyme analysis (A) and the tabulated comparative results with the
UHT SNP analysis (B).
[0045] FIG. 3 Representative samples JK genotyped by manual
PCR-RFLP analysis using MnlI (A) and the tabulated comparative
results with the UHT SNP analysis (B).
[0046] FIG. 4 A-L Computer screen displays of typical UHT SNP
scatter plots to sort the fluorescence of a C/T SNP for various
blood group and HPA genotypes.
[0047] Appendix A provides a tabulated summary of the multiplex SNP
assay detection of 12 possible SNPs on 372 individual blood
samples.
[0048] It will be noted that throughout the appended drawings, like
features are identified by like reference numerals.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENT
[0049] RBC and platelet (Plt) alloimmunization requires
antigen-matched blood to avoid adverse transfusion reactions. Some
blood collection facilities use unregulated Abs to reduce the cost
of mass screening, and later confirm the phenotype with government
approved reagents. Alternatively, RBC and Plt antigens can be
screened by virtue of their associated single nucleotide
polymorphisms (SNPs). The present invention provides a multiplex
PCR-oligonucleotide extension assay using the GenomeLab SNPStream
platform, or any other SNP analysis system, to genotype blood for a
plurality of common antigen-associated SNPs, including but not
limited to: RhD (2), RhC/c, RhE/e, S/s, K/k, Kp.sup.a/b, Fya/b,
FY0, Jk.sup.a/b, Di.sup.a/b, and HPA-1a/b. According to one example
of the present invention, a total of 372 samples were analysed for
12 SNPs overnight. Individual SNP pass rates varied from 98-100%
for 11 of 12 SNPs. Of the Rh-pos, 98.6% were correctly identified.
Six of 66 Rh-neg (9%) were typed as RHD-pos; 5 of 6 were
subsequently demonstrated to contain an non-RHD.psi. gene by
SSP-PCR. Eleven of 12 R1R1 and 1 of 1 r''r were correctly
identified. HPA-1b was identified in 4, which was confirmed by
PCR-RFLP (n=4) and serology (n=1). PCR-RFLP on selected samples
(n<20) for K/k, Fy.sup.a/b, and Jk.sup.a/b were 100% concordant.
Confirmation of some of the results is provided. The platform has
the capacity to genotype thousands of samples per day for all SNP
variations. The suite of SNPs can provide collection facilities
with real-time genotypic data for all donors at an annual cost
(excluding RhD) estimated to equal the current cost of phenotyping
5-10% of the donors.
Methods and Reagents
Methodology Specific to the Invention.
[0050] We have designed a novel blood group and HPA SNP and
detection system that employ the use of two sets of novel compounds
(reagents) that are specifically designed to work in a multiplex
format.
[0051] In brief, genomic DNA is harvested the salting out procedure
using the Qiagen (Qiagen Inc. Valencia, Calif.) Blood DNA Isolation
Kit. Our invention can use any good quality DNA harvested by any
one of a variety of methods. For the multiplex PCR, the DNA regions
containing all 12 SNPs of interest were PCR-amplified in a single
reaction well. Tables 1 and 2 outline the novel PCR primers and
extension probes, respectively, used in the assay. Note that the
concentration of the various reagents may be adjusted to optimize
DNA amplification, and is dependent on but is not limited to: the
concentration and quality of the genomic DNA, the concentration of
the PCR primers or the type of thermal cycler used for the PCR.
[0052] Our current genotyping technology identifies SNPs using
single base-pair primer extension using the novel products and
protocols of the present invention. In brief, the genomic region
surrounding the SNP of interest is PCR-amplified as described
above, preferably using one or more, or all of the primer pairs of
Table 1. Then, the amplified DNA fragments are used as a template
for DNA hybridization using one or more or all the corresponding
novel probes of Table 2, and single nucleotide extension
(synthesis) based on the nucleotide present at each of the specific
SNP sites. The PCR primers pairs in Table 1 represent sequences
complementary to DNA regions containing SNPs of interest; of which
the exact sequences of each primer pair and mixture of primer pairs
have been specifically optimized to amplify genomic DNA of interest
as a mixture of 12 primer pairs. Although noted above, Table 2
further summarizes 12 novel extension primers specifically used
together to detect the nucleotides of blood group and platelet
antigen or HPA SNPs, simultaneously. The extension primers
represent a group of 12 novel nucleotide sequences, of which each
are a combination of: 1) a unique 5' region necessary to direct
hybridization to a micro-arrayed tag located in a specific spot in
each microplate well, and 2) a 3' region complementary to and
adjacent to a SNP of a PCR-amplified DNA region containing the SNP
of interest.
TABLE-US-00005 TABLE 1 The PCR primers used in the 12-pair
multiplex PCR format for multiple SNP detection. Additional Blood
Group and Platelet Antigen SNPs for Clinically Relevant Antigens.
Product Size Antigen SNP Primer Name Sequence 5'-3' Target (bp)
RhD/RhCE C/T RHDe4S AGACAAACTGGGTATCGTTGC RHD 111 RHDe4A
ATCTACGTGTTCGCAGCCT Exon 4 RhD/RhCE A/G RHDe9S
CCAAACCTTTTAACATTAAATTATGC RHD 98 RHDe9A TTGGTCATCAAAATATTTAGCCTC
Exon 9 RhC/Rhc T/C RHCEe2S TGTGCAGTGGGCAATCCT RHCE 90 RHCEe2A
CCACCATCCCAATACCTG Exon 2 RhE/Rhe C/G RHCEe5S AACCACCCTCTCTGGCCC
RHCE 107 RHCEe5A ATAGTAGGTGTTGAACATGGCAT Exon 5 GYPBS/GYPBs T/C
GYPBe4S ACATGTCTTTCTTATTTGGACTTAC GPYB 103 GYPBe4A
TTTGTCAAATATTAACATACCTGGTAC Exon 4 K/k T/C KELe6S
TCTCTCTCCTTTAAAGCTTGGA KEL 142 KELe6A AGAGGCAGGATGAGGTCC Exon 6
Kp.sup.a/Kp.sup.b T/C KELe8S AGCAAGGTGCAAGAACACT KEL 100 KELe8A
AGAGCTTGCCCTGTGCCC Exon 8 Fy/Fy0 T/C FYproS TGTCCCTGCCCAGAACCT
Duffy 90 FYproA AGACAGAAGGGCTGGGAC Promoter Fy.sup.a/Fy.sup.b G/A
FYe2S AGTGCAGAGTCATCCAGCA Duffy 122 FYe2A TTCGAAGATGTATGGAATTCTTC
Exon 2 Jk.sup.a/Jk.sup.b G/A JKe9S CATGAACATTCCTCCCATTG Kidd 130
JKe9A TTTAGTCCTGAGTTCTGACCCC Exon 9 Di.sup.a/Di.sup.b T/C DIe19S
ATCCAGATCATCTGCCTGG Diego 90 Die19A CGGCACAGTGAGGATGAG Exon 19
HPA-1a/b T/C GP3Ae3S ATTCTGGGGCACAGTTATCC GP3A 114 GP3Ae3A
ATAGTTCTGATTGCTGGACTTCTC Exon 3 A/O G/T ABO GalNAc/Del Exon 6 A/B
C/G ABO (GalNAc/Gal) Exon 7 A/B G/A ABO (GalNAc/Gal) Exon 7 A/B C/A
ABO (GalNAc/Gal) Exon 7 A/B G/C ABO (GalNAc/Gal) Exon 7 M/N G/A MNS
Exon 2 M/N T/G MNS Exon 2 MNS/MiI C/T MNS Exon 3 RHD/Weak D T/G RHD
Type 1 Exon 6 RHD/Weak D G/C RHD Type 2 Exon 9 RHD/Weak D C/G RHD
Type 3 Exon 1 RHD/D nt602 C/G RHD Variants Exon 4 RHD/`DAR` T/C RHD
Variant Exon 7 RHD/Weak D C/A RHD Type 5 Exon 3 RHD/D.sub.e1 G/A
RHD IVS3 + 1 RHD/D.sub.e1 G/T RHD Exon 6 RHD/D.sub.e1 G/A RHD Exon
9 RHD/RHD.PSI. A/T RHD nt506 Exon 4 RHCE/RhC T/C RHCE IVS2+ 1722
RHCE/RhC C/T RHCE IVS2_1751 RHCE/VS C/G RHCE variant Exon 5
Lu.sup.aLu.sup.b A/G LU Exon 3 Au.sup.a/Au.sup.b A/G LU Exon 12
Js.sup.a/Js.sup.b C/T KEL Exon 17 Js/Js.sub.null G/T JK IVS7 + 1
FY/Fy.sup.x C/T FY Exon 2 FY/Fy.sup.x G/A FY Exon 2
Wr.sup.a/Wr.sup.b A/G DI Exon 16 Yt.sup.a/Yt.sup.b C/A YT Exon 2
Sc1/Sc2 G/A SC Exon 3 Do.sup.a/Do.sup.b C/T DO (nt 378) Exon 2
Do.sup.a/Do.sup.b T/C DO (nt 624) Exon 2 Do.sup.a/Do.sup.b A/G DO
(nt 793) Exon 2 Co.sup.aCo.sup.b C/T CO Exon 1 In.sup.a/In.sup.b
C/G IN Exon 2 Ok(a+)/Ok(a-) G/A OK Exon 4 GIL/GIL.sub.null G/A GIL
IVS5 HPA-2a/b C/T GP1BA Exon 2 HPA-3a/b T/G GP2B Exon 26 HPA-4a/b
G/A GP3A Exon 4 HPA-5a/b G/A GP1A Exon 13 Gov.sup.a/Gov.sup.b A/C
CD109 Exon 19 The above primers correspond to SEQ ID NOs 1-24,
respectively, as outlined herein above.
[0053] Each antigen listed on the left represents a blood group or
HPA genotype and the single nucleotide polymorphism (SNP). Some
genotypes are evaluated using more than one SNP because they differ
by more than one nucleotide. Each PCR primer pair consists of a
sense (Primer Name ending in S) and antisense (Primer Name ending
in A) oligonucleotide (Sequence 5'-3') designed to amplify the DNA
region containing the SNP for the antigen of interest. The target
region (Product Target) and the amplified fragment (Size (bp)) are
shown on the right. Note that 12 SNPs are evaluated for 19
different blood group and platelet antigens because some antigens
have more than one SNP. In some cases an A or G SNP is included
since the complementary DNA strand can be evaluated as it will
contain the T or C SNP of interest.
TABLE-US-00006 TABLE 2 Extension probes used to detect the
nucleotides of blood group and HPA SNPs. Name Sequence 5'-3' RHD
GTGATTCTGTACGTGTCGCCGTCTGATCTTTATCCTCCG Exon 4 TTCCCT RHD
GCGGTAGGTTCCCGACATATTTTAAACAGGTTTGCTCCT Exon 9 AAATCT RHCE
GGATGGCGTTCCGTCCTATTGGACGGCTTCCTGAGCCAG Exon 2 TTCCCT RHCE
CGACTGTAGGTGCGTAACTCGATGTTCTGGCCAAGTGTC Exon 5 AACTCT GYPB
AGGGTCTCTACGCTGACGATTTGAAATTTTGCTTTATAG Exon 4 GAGAAA KEL
AGCGATCTGCGAGACCGTATTGGACTTCCTTAAACTTTA Exon 6 ACCGAA KEL
AGATAGAGTCGATGCCAGCTTTCCTTGTCAATCTCCATC Exon 8 ACTTCA FY
GACCTGGGTGTCGATACCTAGGCCCTCATTAGTCCTTGG Promoter CTCTTA FY Exon 2
ACGCACGTCCACGGTGATTTGGGGGCAGCTGCTTCCAGG TTGGCA JK Exon 9
CGTGCCGCTCGTGATAGAATAAACCCCAGAGTCCAAAGT AGATGT Di Exon 19
GGCTATGATTCGCAATGCTTGTGCTGTGGGTGGTGAAGT CCACGC GP3A Exon 3
AGAGCGAGTGACGCATACTTGGGCTCCTGTCTTACAXGC CCTGCCTC The above probes
correspond to SEQ ID NOs 25-36, respectively, as identified herein
above. The DNA bases are represented by their single letter
equivalents (A, C, G or T) and the letter X represents a C3
(phosphoroamidite) spacer between the two adjacent DNA bases.
[0054] The present invention also provides novel hybrid probes,
wherein the preferred probes are listed in Table 2, but limited to
said listing. Each extension probe is designed in two parts: (1)
the 5' portion: the 5' nucleotides indicated in boldface of the
extension primer are complementary to unique and specific DNA
sequences which are micro-arrayed onto the bottom of microplates in
a specified location of each microplate well. Thus, the 5' portion
of the extension probes in table 2 represent, but are not limited
to, 12 unique complementary sequences used together to identify the
individual SNPs through hybridization to the micro-arrayed tags in
the microplate wells. The 12 unique 5' portions can be interchanged
with each of the 3' regions specified below, which contain DNA
sequences complementary to and adjacent to the SNPs of interest, or
they can be interchanged with other additional unique 5' portions
as specified by the micro-arrayed tags in the microplate wells
provided they are used to identify blood group or HPA SNPs; and (2)
the 3' portion: the 3' nucleotides are complementary to and
precisely adjacent to the SNP site of the PCR-amplified DNA, which
enables the detection of either or both nucleotides of the SNP.
Thus, the extension probe is a unique sequence that can hybridized
to a specific location and to the PCR-amplified DNA and be extended
by a single fluorescent-labeled dideoxy-nucleotide using PCR
thermal cyclers. The extension probe products are hybridized to the
complementary micro-arrayed DNA sequence on the microplate and the
incorporation of Bodipy- and Tamra-labeled dideoxy-nucleotides are
detected by laser-microplate fluorescence for each individual blood
group SNP. The presence of the nucleotides for a given SNP is
displayed by automated imaging and analysis software. In one
variation of the detection reaction, a dideoxyguanidine
tri-nucleotide labeled with the Bodipy-fluorochrome is added in the
extension reaction. If a deoxycytidine is present in the
PCR-amplified DNA fragment, then the nucleotide will be
incorporated into the nascent DNA fragment. In another variation of
the reaction, a dideoxyadenine nucleotide labeled with the
Tamra-fluorochrome is added to the extension assay. If the
PCR-amplified fragment contains a deoxythimidine, then an extension
will occur. In each case, the fluorochrome is detected after the
extension reaction has been completed. Again, these reactions
proceed in the same tube along with the other extension reactions.
The laser-detection apparatus can identify and evaluate each
specified extension due to the location of each micro-arrayed DNA
sequence.
[0055] Each extension primer has a region complementary to a tag
that is been bound to the surface of a microplate well (Bold
nucleotides) and a region (Italicized nucleotides) that is
complementary to the region and immediately adjacent to the SNP
site.
[0056] It should be noted that the teachings, products and methods
of the present invention are not limited to the above-specified
primer pairs and probes, but additionally comprise all primer pairs
and probes specific to the blood group and HPA SNPs, wherein said
primer pairs and probes are optimized for use in a multiplex PCR
reaction for the simultaneous identification of more than one, or
all, blood group or HPA genotypes and their corresponding
phenotypes.
EXAMPLES
[0057] Although the following examples may provide preferred
methods, products, platforms or protocols of the present invention,
it will be understood by one skilled in the art that the presently
provided examples are not limited to the specified parameters of
each example, and may be varied provided that the resulting outcome
of the methods or protocols are in accordance with the teachings of
the present invention, and the products are functionally equivalent
or relating to the teachings of the present invention.
Example 1
[0058] A preferred protocol for the multiplex blood group and HPA
SNP Genotyping is provided. Although the present example analyzes
12 SNP extension primers, the present invention is not limited to
the analysis of a maximum of 12 SNPs, but may include a plurality
of SNPs relating to more than one or all of the blood group or HPA
SNPs.
[0059] Additional blood group and platelet antigen SNPs for
clinically relevant antigens embodied by the present invention
appear in Table 1A. Primer pairs and probes, such as those
exemplified in Tables 1 and 2, corresponding to these SNPs of
clinical relevance, can be prepared according to the teachings of
the present invention. Target primers may be initially identified
from existing databases (e.g. autoprimer.com) based on information
corresponding to the SNP of interest and the corresponding flanking
regions, and subsequently optimized as herein disclosed for use in
accordance with the present invention.
TABLE-US-00007 Step Action I (a). PCR Primer Pooling 1 Dilute each
of 12 PCRS and PCRA primer (forward and reverse primers) pairs to
final concentration of 240 uM (only required upon arrival of new
primers) 2 Generate working primer pool by combining 5 ul of each
of the 24 individual PCR primers I (b). SNP Extension Primer
Pooling 1 Dilute each of 12 SNP extension primers to final
concentration of 120 uM (only required upon arrival of new primers)
2 Generate working SNP extension primer pool by combining 10 ul of
each of the 12 individual SNP extension primers
TABLE-US-00008 II. Multiplex PCR from purified DNA templates Step
Action 1 Prepare 10 ul multiplex PCR master mix for use with 96
well plates containing PCR primers (synthesized by Integrated DNA
Technologies, Coralville, IA, USA), dNTPs (MBI Fermentas, Hanover,
MD, USA), MgCl.sub.2, 10X PCR Buffer, and Amplitaq Gold (Applied
Biosystems, Branchburg, NJ, USA): Initial Final Volume Component
Concentration Concentration (ul/well) PCR primer pool 10 uM each 50
nM each 0.05 dNTPs 2.5 mM each 75 uM each 0.33 MgCl.sub.2 25 mM 5
mM 2.00 10x PCR Buffer 10x 1x 1.00 AmpliTaq Gold 5 U/ul 0.075 U/ul
0.15 dH.sub.2O 4.47 2 For each DNA Sample, transfer 2 ul of 4 ng/ul
stock DNA to each well of 96 well plates. Use Biomek FX (Beckman
Coulter Inc., Fullerton, CA, USA) Script `2ul96well Transfer`
automated program 3 Place Multiplex PCR Master Mix in Biomek FX
station 1. Place 96 well plates of DNA in Biomek FX station 5-8. 4
Transfer 8 ul Multiplex PCR master mix to DNA samples using Biomek
FX Script: `8 ul PCR Transfer` 5 After addition of master mix seal
tightly with MJ Microseal A film (MJ Research, Inc., Waltham, MA,
USA) 6 Spin down in centrifuge for 30 sec at 1500 rpm 7 Place in MJ
Tetrad Thermal cyclers (MJ Research, Inc., Waltham, MA, USA) and
run `UHT-MPX` CBS multiplex PCR program: Thermal cycle conditions
`UHT-MPX`: Denature 94.degree. C. 1:00 (min) 35 cycles of:
94.degree. C. 0:30 (min) 55.degree. C. 0:33 (min) 72.degree. C.
1:00 (min) Hold Temperature 4.degree. C. .infin.
TABLE-US-00009 III. Post PCR Cleanup Step Action 1 Prepare
ExonucleaseI (ExoI; USB Corporation, Cleveland, OH, USA) and Shrimp
Alkaline Phosphatase (SAP; USB Corporation, Cleveland, OH, USA)
master mix: Component Final concentration Volume per well (ul) ExoI
2U 0.4 SAP 1U 2.0 10x SAP buffer 1x 0.6 dH.sub.2O 3.0 2 Add Exo/SAP
master mix to grooved reservoir and place on Multimek (Beckman
Coulter Inc., Fullerton, CA, USA) Station 3 3 Add UHT (ultra
high-throughput) salt solution (provided) to grooved reservoir and
place on Multimek Station 4 4 Transfer 8 ul Exo/SAP master mix to
amplified PCR products using Multimek Script: EXO96-2.SCI (two 96
well plates, at Multimek stations 1 and 2 5 After Multimek addition
of Exo/SAP seal tightly with MJ Microseal A film 6 Spin down in
centrifuge for 30 sec at 1500 rpm 7 Place in MJ Tetrad Thermal
cyclers and run `UHTCLEAN` program: Thermal cycle conditions
`UHTCLEAN`: Temp Time (min) 37.degree. C. 30:00 100.degree. C.
10:00 4.degree. C. .infin.
TABLE-US-00010 IV. SNP-IT Assay using the GENOMELAB SNPSTREAM .TM.
(Beckman Coulter Inc. Fullerton, CA, USA) Step Action 1 Prepare
SNP-IT extension mix containing extension primers (synthesized by
Integrated DNA Technologies, Coralville, IA, USA), C/T ddNTPs,
Extension mix diluent, and DNA polymerase (Beckman Coulter Inc.,
Fullerton, CA, USA) Component Volume per well (ul) SNP Extension
primer pool 3.22 C/T ddNTP Extension mix 21.43 Extension mix
diluent 402.98 DNA polymerase 2.24 dH2O 318.22 2 Add SNP-IT mix to
grooved reservoir and place on Multimek Station 3 3 Add UHT salt
solution (provided) to grooved reservoir and place on Multimek
Station 4 4 Transfer 7 ul SNP-IT extension mix to UHT-CLEAN PCR
products using Multimek Script: 7UL96-2.SCI (two 96 well plates, at
Multimek stations 1 and 2 5 After Multimek addition of SNP-IT
extension mix seal tightly with MJ Microseal A film 6 Spin down in
centrifuge for 30 sec at 1500 rpm 7 Place in MJ Tetrad Thermal
cyclers and run `UHT-SNPIT` program: Thermal cycle conditions
`UHTSNPIT`: Temp Time (min) Denature 96.degree. C. 3:00 45 cycles
of: 94.degree. C. 0:20 40.degree. C. 0:11 Hold Temperature
4.degree. C. .infin.
TABLE-US-00011 V. Post-extension Transfer and Hybridization Step
Action 1 Preheat incubator to 42.degree. C. 2 Make sure there is
adequate 20x dilution of SNPWare UHT Wash Buffer in washer Carboy
B. If required dilute 20x stock solution with water and refill
Carboy B 3 Run SAMI/EL 405 Script `Prime B` 4 Place all Tag Array
plates in Row 1 of the Carousel, starting with Hotel 1, with
subsequent plates in Hotel 2, 3, etc., preferably with their
barcodes facing inwards. 5 Place all PCR plates directly below
their corresponding Tag Array Plates. PCR plates corresponding to
Quadrants 1-4 should be placed in Rows 2-5 of the proper Hotel,
respectively. For all PCR plates, the "ABC . . . " lettered edge of
the plates should face inwards on the Carousel. 6 Place grooved
reservoir with solubilized UHT Salt Solution in Multimek Station 4
7 Place grooved reservoir with Hybridization solution master mix in
Multimek Station 3 Hybridization Solution master mix: Component
Volume per Tag Array plate (ul) 2x Hybridiaztion Soluton 3500.00
Hybridization Additive 203.7 8 Run SAMI Script `Post-extension
Transfer_Hybridization 1x384.smt`: This automated program prepares
the tag array plate by washing it 3x with SNPWare UHT wash buffer;
adds 8.0ul of Hybridization solution master mix to each SNP
extension reaction and subsequently transfers 8.0ul of this mixture
to the prepared tag array plate. 9 Place Tag Array plates in
humidified 42.degree. C. incubator for 2 hours
TABLE-US-00012 VI. Post-Hybridization Wash Step Action 1 Make sure
there is adequate 64x dilution of SNPWare UHT Stringent Wash
Solution in washer Carboy C. If required dilute 64x stock solution
with water and refill Carboy C 2 Run SAMI/EL 405 Script `Prime C` 3
Run SAMI/EL 405 Script `Post-hyb 3x Wash` 4 Completely dry Tag
Array plates using vacuum/pipette tip 5 Run SAMI/EL405 script
`Prime A` several times to clean plate washer pins
TABLE-US-00013 VII. UHT (Ultra high through-put) Tag Array Plate
Reading Step Action 1 Turn on lasers, turning both keys 90 degrees
clockwise, and allow at least 30 minutes to warm up 2 Turn on
SNPScope Reader and Twister. 3 Activate lasers: Flip two switches
on laser box from `Standby` to `Operate`/`Laser` 4 Open UHT Run
Manager Software and `Initialize` SNPScope system 5 Stack Tag Array
plates in Twister carousel 1, with `Assay Test Plate` on top. Make
sure all barcodes are facing outwards, and plates are pushed
towards the reader 6 Select `SNPTEST_W_BC_run` from UHT RUN Manager
Software, enter the number of plates to be read (including the test
plate). 7 Select `RUN`
[0060] The SNPScope plate reader will excite and capture images of
Bodipy-fluorescein and Tamra-labeled ddNTPs separately. All
genotype calls are subsequently automatically generated using the
SNPStream Software Suite of MegaImage, UHTGetGenos and
QCReview.
[0061] It should be noted that the specific steps associated with
the protocol exemplified in Example 1 are not intended to limit the
teachings and methods of the present invention to the specific
above protocol. Example 1 is provided to specify a preferred method
in accordance with the present invention wherein a plurality of
blood group and HPA SNPs are simultaneously analysed in a ultra
high throughput multiplex automated system for the determination of
the specific genotypes and accordingly the phenotypes associated
therewith. Accordingly, it should be understood by one skilled in
the art that the steps of Example 1 may be varied provided that
such variations yield the preferred results of the present
invention.
Results
1. GP3A Exon 3 SNP Scatter Plots.
[0062] The robotic UHT platform produces laser-fluorescence values
for each sample which are represented in `scatter plots` for the
operator to review. A sample scatter plot is shown in FIG. 1 for
the SNP analysis GP3A Exon 3, which represents the HPA-1a and
HPA-1b antigens. As can been seen in FIG. 1 and FIG. 4, results are
graphed using logarithmic and XY scatter plots (upper right). Green
O, orange .quadrature. or blue O sample designations represent CC,
TC and TT SNP genotype calls, respectively, with corresponding
graphical summaries appearing in the respective legends of each
figure. No fluorescence represents an assay failure (FL) for that
sample.
[0063] Scatter plots (as shown in FIG. 1 and FIG. 4) are generated
preferably using SNPStream software suite and viewed through
QCReview. It should be additionally noted that the present analysis
is not limited to SNPstream or QCReview, and may be carried out
using any SNP analysis software. Individual TT, TC and CC genotype
calls are represented as dark blue, orange and green open circles,
respectively. Sample failures and water controls are represented by
yellow and light blue filled circles respectively. Logarithmic
(left) and XY scatter (upper right) plots are generated using the
relative fluorescence of the Bodipy-fluorescein and Tamra labels
obtained during SNPScope plate imaging and analysis.
2. SNP Data Manipulation and Analysis.
[0064] The SNP results of a scatter plot are electronically
exported to a spreadsheet and examined for total sample failure and
individual SNP failure rates. SNP results for 372 DNA samples are
summarized in Table 3 (provided in Appendix A). Accordingly, Table
3 provides the Pass and Failure Rates for 12 blood group and HPA
SNP analyses. 372 DNA samples were analyzed for several antigens,
including the blood group RhD (RHD Exon 4 and RHD Exon 9) and
platelet HPA-1a/b (GP3A Exon 3) genotypes. Sample success or pass
rates are indicated on the right and individual SNP success or pass
rates are shown at the bottom. Three hundred and fifty seven of 372
samples (96%) had results for at least one SNP. Individual SNP
results (i.e. minus the sample failures) ranged from 80-100%; only
two SNPs had success rates <98%. Individual SNP failures do not
affect the results of a sample for other SNPs that do not fail.
3. SNP Allele Result Compared to the Serological Result
[0065] RhD status was compared between the serological result and
the SNP analysis for RHD Exon 4 and RHD Exon 9. Table 4 summarizes
the comparison. 287 of 291 (98.6%) RhD positive units and 55 of 66
(83.3%) RhD negative units were identified correctly using the UHT
SNP platform. It is important to note that the 6 incorrect calls
suggesting the presence of the RHD gene in a serologically
RhD-negative sample may be due to one of the non-functional RHD
genes present in the random population (Singleton B. K. et al.,
Blood 2000; 95:12; Okuda H., et al., J Clin Invest 1997; 100:373;
Wagner F. F. et al., BMC Genet 2001; 2:10).
TABLE-US-00014 TABLE 4 A comparison of the SNP genotype result and
the serological result obtained with government-regulated antisera.
RHD RHD Assay Exon 4 Exon 9 No Percent D-positive: pos Pos 287
98.6% N = 291 neg Neg 4 1.4% Total 291 Assay RHD4 RHD9 No Percent
D- neg Neg 55 83.3% negative: neg FL 5 7.6% N = 66 pos Pos 6 9.1%
Total 66 NOTE: CBS laboratory regulations do not allow copies of
serological results of blood donors to be made from their
laboratory information system. Therefore, the results of the CBS
serological phenotypes were reviewed by research personnel and the
results tabulated and compared to the SNP data.
4. SNP Genotype Frequency Analysis.
[0066] The SNP results then were compared with published phenotype
frequencies for Caucasians and Blacks and are summarized in Table 5
below. The data clearly shows that the allele frequencies are
consistent with the accepted published frequencies for Caucasians
and Blacks. The data show that the SNP genotype frequencies match
the published population phenotype frequencies.
TABLE-US-00015 TABLE 5 A summary of the UHT SNP analysis of
genotype frequencies for several SNPs analyzed and compared to
published phenotype frequencies for Caucasians and Blacks. The
ethnicity of the samples analyzed is not known. UHT Genotyping
Analysis KEL Exon6 Phenotype Caucasians Blacks Observed (%) K-k+
91% 98% 326 91.3 K+k- 0.2% rare 0 0 K+k+ 8.8% 2% 28 7.8 Fails 3 0.8
No of FL 18 No. of Pass 354 Call Rate 95.2% FL = assay failure An
independent assay as described in Molecular Protocols in
Transfusion Medicine was performed using the UHT SNP Stream System.
Seven samples were tested (Four KEL 2/KEL 2, Three KEL1/KEL 2). All
samples showed a 100% correspondence with the UHT genotype results.
KEL Exon8 Phenotype Caucasians Blacks Observed (%) Kp(a+b-) Rare 0%
0 0 Kp(a-b+) 97.7% 100% 354 99.2 Kp(a+b+) 2.3% rare 1 0.3 Fails 2
0.6 No of FL 17 No. of Pass 355 Call Rate 95.4% DI Exon18 Phenotype
Caucasians Blacks Observed (%) Di(a+b-) <0.01% <0.01% 0 0
Di(a-b+) >99.9% >99.9% 353 98.9 Di(a+b+) <0.1% <0.1% 2
0.6 Fails 2 0.6 No of FL 17 No. of Pass 355 Call Rate 95.4% FY PRM
Phenotype Observed (%) wt/wt 348 97.5 wt/mut 7 20 mut/mut 2 0.5
Fails 0 0 No of FL 15 No. of Pass 357 Call Rate 96.0% An
independent assay as described in Molecular Protocols in
Transfusion Medicine was performed using the UHT SNP Stream System.
Thirteen samples were tested (six wt/wt, five wt/mut and two
mut/mut for the GATA site). All samples showed a 100%
correspondence with the UHT genotype results. FY Exon 2 Phenotype
Caucasians Blacks Observed (%) Fy(a+b-) 17% 9% 89 24.9 Fy(a-b+) 34%
22% 112 31.4 Fy(a+b+) 49% 1% 155 43.4 Fails 1 0.3 No of FL 16 No.
of Pass 356 Call Rate 95.7% An independent assay as described in
Molecular Protocols in Transfusion Medicine was performed using the
UHT SNP Stream System Eleven samples were tested (eight FY2/FY2,
three FY1/FY2 and one FY1/FY1). All samples showed a 100%
correspondence with the UHT genotype results. GP3A Exon 3 Phenotype
Caucasians Blacks Observed (%) HPA-1a/1a 80% 84% 263 73.7 HPA-1a/1b
18% 64% 89 24.9 HPA-1b/1b 2% 0% 4 1.1 Fails 1 0.3 No of FL 16 No.
of Pass 356 Call Rate 95.7% An independent assay as described in
Molecular Protocols in Transfusion Medicine was performed using the
UHT SNP Stream System. Eighteen samples were tested (Seven HPA-1a,
Seven HPA-1a/1b and Four HPA-1b). All samples showed a 100%
correspondence with the UHT genotype results. JK9 Phenotype
Caucasians Blacks Observed (%) Jk(a+b-) 26.3% 51.1% 90 25.2
Jk(a-b+) 23.4% 8.1% 87 24.4 Jk(a+b+) 50.3% 40.8% 178 49.4 Fails 2
0.5 No of FL 17 No. of Pass 355 Call Rate 95.4% An independent
assay as described in Molecular Protocols in Transfusion Medicine
was performed using the UHT SNP Stream System. Nineteen samples
were tested (Seven JK1, Seven JK1/JK2 and Five JK2). All samples
showed a 100% correspondence with the UHT genotype results.
5. HPA-1a/HPA-1b PCR-RFLP Analysis.
[0067] The GP3A Exon 3 SNP detection method for HPA-1a/b genotyping
(Appendix A) was compared to a subset of samples (n=18) using
conventional PCR-RFLP analysis performed independently (FIG. 2).
The results of the two assays were 100% concordant. In addition, a
217G nucleotide mutation 21 basepairs downstream of the GP3A SNP
was present in sample 8. This mutation does not affect HPA-1b
expression but is detected in the PCR-RFLP and is prone to
interpretation error in the conventional PCR-RFLP assay. However,
the sample was correctly genotyped as HPA-1b in our SNP assay.
Accordingly, the present invention eliminates or minimizes error in
HPA-1 results obtained since no confusing or confounding
information results from the gel readings of the present invention.
That is to say, the conventional RFLP detected the presence of an
additional DNA fragment at .about.180 bp which represents a
heterozygous HPA-1b/1b.sup.G217 allele and was correctly genotyped
as HPA-1b/b by the present invention.
Example 2
[0068] However, it should be obvious to one skilled in the art that
other methodologies and/or technologies for SNP identification
could be used, providing that the novel DNA sequences disclosed
above are also used. Other embodiments could include the following
but without limitation to micro-arrays on glass slides or silica
chips, the use of mass spectrometry, or oligo-ligation and
extension techniques to detect the SNPs of interest.
[0069] A preferred method of the present invention relates to a
method for the detection of blood group and HPA genotypes. The
present invention also provides novel DNA sequences that are used
as primers in a multiplex PCR format according to the present
invention to amplify the genomic regions of interest. The present
invention also provides novel combinations of DNA sequences that
are used in said multiplex PCR format, and for novel DNA sequences
that are used to detect blood group and platelet SNPs.
[0070] A preferred application of the present invention is in the
blood collection and blood banking industry without limitation to
red blood cell, platelet, and bone marrow donations. Canada has
over 850,000 blood donations yearly, many from repeat donors.
Eventually, after all repeat donors are tested (each donor is
tested once), the analyses will be performed only on the blood of
new donors. With over 29 blood group and 6 HPA systems encompassing
over 250 antigens, the platform will find wide application in this
industry.
[0071] The present invention additionally encompasses various
embodiments relating to the detection of various SNPs for the
determination of the various genotypes in a sample and for the
determination of the corresponding phenotype. In a preferred
embodiment, the present invention utilizes a platform to analyzes a
cytidine-to-thymidine (C.fwdarw.T) single nucleotide polymorphism.
The invention may also employ the multiplex detection of, but not
limited to, C.fwdarw.A, A.fwdarw.T, and G.fwdarw.C SNPs, or any
other nucleotide SNP related to blood group or platelet
antigens.
[0072] The present invention may additionally include methods and
products for the detection of clinically relevant blood group
antigens whereby an antigen of interest is characterized by a
genotypic identifier that exceeds a single nucleotide polymorphism.
Specifically, the present invention may extend to include
clinically relevant insertions or deletions or other nucleotide
changes that characterize a blood group antigen of interest, such a
multiple base pair insertion in an allele of interest. For example,
a genotypic identifier corresponding to a blood group antigen of
interest may be pre-characterized, suitable primers and probes for
detection thereof may be prepared and a blood sample screened
according to the teachings of the present invention.
[0073] The present invention provides DNA sequences corresponding
to the PCR primer pairs optimized for multiplex use to identify
blood group and platelet antigens simultaneously. Accordingly, the
present invention provides the novel primer pair sequences listed
in Table 1.
[0074] The present invention additionally provides novel DNA
sequences used to identify the single nucleotide polymorphisms
(SNPs) that represent underlying DNA blood group and platelet
antigens. Accordingly, the present invention provides the novel
extension probes listed in Table 2.
[0075] The present invention provides a method of a combined
analysis of blood group and HPA SNP analyses.
[0076] The present invention advantageously utilizes PCR, the
variant and unique SNPs for the variant alleles that infer blood
group phenotypes, and single base extension and detection chemistry
as a foundation for the novel products and methods of the present
invention. Accordingly, the present invention provides a high
throughput, multiplexed, DNA-based method of blood group genotyping
that replaces the current manual, semi-automated and automated
serological screening process used to determine blood group
phenotypes.
[0077] Accordingly, the present invention provides a method for the
identification of rare blood group genotypes due to the suite of
SNPs as described above, and in some instances replaces the current
state of the art in which most rare blood group genotypes are
identified serendipitously (propositus and their relatives) and
enabling significant advances over current serological
technologies. For example, by analyzing the SNP for the RhC allele
in Rh negative blood, we can identify RhC homozygotes and thereby,
the rare RhD-negative and Rhc-negative blood.
[0078] The present invention additionally provides a method of use
in tissue compatibility matching for the purposes, without
limitation, of organ transplantation, bone marrow transplantation
and blood transfusion related to blood group and platelet
antigens.
[0079] The present invention additionally provides novel components
and constituents that are beneficial for the analyses relating to
the present invention. More specifically, the group of currently
developed SNPs representing a `suite`, or the presently known set
of SNPs that relate to clinically important blood group and HPA
genotypes for red blood cell and platelet antigens, respectively
are provided. The present invention is not limited to the presently
listed SNPs, but is understood to comprise all blood group and
platelet antigen, and preferably HPA SNPs that may be analyzed in
accordance with the teachings of the present invention and using
the products, protocols and methods of the present invention.
[0080] The present invention also provides the DNA primer sequences
optimized for use in a multiplex PCR format.
[0081] The present invention also provides novel DNA probe
sequences used to detect the SNPs of interest.
[0082] The present invention provides a method for the simultaneous
detection of a plurality of blood group SNPs. More specifically,
the present invention provides a method for the simultaneous
detection of at least 19 blood group SNPs; RHD (2), RHC/c, RHE/e,
S/s, Duffy (a/b), Kidd (a/b), Diego (a/b), Kell K1/K2, Kell K3/K4,
and HPA-1a/b simultaneously. The method of the present invention
provides (1) DNA sequences corresponding to the PCR primer pairs
optimized for multiplex use to identify a plurality of blood group
and platelet antigens simultaneously; (2) Novel DNA sequences used
to identify the single nucleotide polymorphisms (SNPs) that
represent underlying DNA blood group and platelet antigens; and (3)
The combination of SNP analyses including blood group and platelet
antigens.
[0083] To support and validate the teachings of the present
invention various experimental tests have been completed and
analyzed. Numerous validating experimental data has been recorded,
however, for the purpose of simplicity the following example is
provided. Each step in the validating experiment is noted
below:
[0084] (1) Ultra high throughput (UHT) Multiplex SNP analyses on
372 unrelated blood donor specimens for RHD (2), RHC/c, RHE/e, S/s,
FY1/FY2 (2), JK1/JK2, DI1/DI2, KEL1/KEL2, KEL3/KEL4, and HPA-1A/B
genotypes and corresponding phenotypes was examined, and data was
recorded (please refer to Appendix A for the raw data accumulated,
and Table 5 for a Summary of the results obtained).
[0085] (2) Manual PCR-RFLP analyses was performed on some of the
372 specimens for some of the blood group SNPs to for comparison to
the results obtained in Step (1).
[0086] (3) Serological analyses was also performed on some of the
372 specimens for each of the blood group and HPA SNPs using Health
Canada regulated reagents performed by licensed medical
technologists in a provincially licensed laboratory.
[0087] (4) Serological analyses was also performed on some of the
372 specimens for each of the blood group and platelet antigens by
unlicensed research technologists using Health Canada regulated
reagents and methodologies in an unlicensed laboratory.
[0088] The results obtained from the above validating experimental
data is provided below by way of supportive Figures and Tables.
1. SNP Platform Data Generation.
[0089] The robotic platform produces fluorescence for each sample
which are presented in `scatter plots` (as illustrated in FIG. 1)
for the operator to review. Sample genotype results are shown for
each blood group SNP and are graphed using logarithmic and XY
scatter plots (upper right). Green, orange or blue sample
designations represent CC, TC and TT genotype calls respectively.
No fluorescence represents an assay failure (FL) for that
sample.
2. SNP Data Manipulation and Analysis.
[0090] The SNP results of a scatter plot are electronically
exported to a spreadsheet and examined for total sample failure and
individual SNP failure rates. Twelve SNP results for 372 DNA
samples are summarized in Table 3 with sample failure rates (shown
on the right) and individual SNP success rates (shown at the
bottom). Three hundred and fifty seven of 372 samples (96%) had
results for at least one SNP. Individual SNP results ranged from
80% to 100%; only one SNP result success rate was <98%.
Individual SNP failures do not affect the results of a sample for
other SNPs that do not fail.
3. SNP Allele Frequency Analysis.
[0091] The SNP results where then compared with published phenotype
frequencies for Caucasians and Blacks and are summarized in Table 5
above. The data shows that the allele frequencies are consistent
with the accepted published frequencies for Caucasians and
Blacks.
3.1 SNP Allele Result Compared to the Serological Result.
[0092] RhD status was compared between the serological result and
the SNP analysis for RHD exon 4, and 9 (RHD Exon 4, RHD Exon 9,
respectively). Table 4 summarizes the comparison. 287 of 291
(98.6%) RhD positive units and 55 of 66 (83.3%) RhD negative units
were identified correctly using the UHT SNP platform.
3.2 SNP Analysis Compared to Manual PCR-RFLP.
[0093] Some of the UHT SNP genotype results were compared with
manual PCR-RFLP analysis performed independently. The results show
100% concordance. A representative PCR-RFLP is shown in FIG. 3.
[0094] The genotyping technology provided in the present invention
queries and analyzes SNPs using single base-pair primer extension.
In brief, the genomic region surrounding the SNP of interest is
amplified and used as a template for the ensuing hybridization and
single nucleotide extension of the SNP specific extension primer.
The extension primer is designed to hybridize adjacent to the
polymorphic nucleotide(s) and enables us to query bi-allelic
polymorphisms, small insertions, deletions or inversions. The 5'
extension primer tags are hybridized to the complementary DNA
sequence on micro-arrayed plates and incorporation of Bidopy- and
Tamra-labeled ddNTPs are detected by laser-microplate fluorescence
for each individual blood group and HPA SNP. Individual sample
genotypes are generated through automated imaging and analysis
software as shown in the genotype scatter plots of FIG. 1.
[0095] The embodiment(s) of the invention described above is (are)
intended to be exemplary only. The scope of the invention is
therefore intended to be limited solely by the scope of the
appended claims.
Sequence CWU 1
1
37121DNAArtificial SequenceDescription of Artificial Sequence
oligonucleotide primer 1agacaaactg ggtatcgttg c 21219DNAArtificial
SequenceDescription of Artificial Sequence oligonucleotide primer
2atctacgtgt tcgcagcct 19326DNAArtificial SequenceDescription of
Artificial Sequence oligonucleotide primer 3ccaaaccttt taacattaaa
ttatgc 26424DNAArtificial SequenceDescription of Artificial
Sequence oligonucleotide primer 4ttggtcatca aaatatttag cctc
24518DNAArtificial SequenceDescription of Artificial Sequence
oligonucleotide primer 5tgtgcagtgg gcaatcct 18618DNAArtificial
SequenceDescription of Artificial Sequence oligonucleotide primer
6ccaccatccc aatacctg 18718DNAArtificial SequenceDescription of
Artificial Sequence ligonucleotide primer 7aaccaccctc tctggccc
18823DNAArtificial SequenceDescription of Artificial Sequence
oligonucleotide primer 8atagtaggtg ttgaacatgg cat
23925DNAArtificial SequenceDescription of Artificial Sequence
oligonucleotide primer 9acatgtcttt cttatttgga cttac
251027DNAArtificial SequenceDescription of Artificial Sequence
oligonucleotide primer 10tttgtcaaat attaacatac ctggtac
271122DNAArtificial SequenceDescription of Artificial Sequence
oligonucleotide primer 11tctctctcct ttaaagcttg ga
221218DNAArtificial SequenceDescription of Artificial Sequence
oligonucleotide primer 12agaggcagga tgaggtcc 181319DNAArtificial
SequenceDescription of Artificial Sequence oligonucleotide primer
13agcaaggtgc aagaacact 191418DNAArtificial SequenceDescription of
Artificial Sequence oligonucleotide primer 14agagcttgcc ctgtgccc
181518DNAArtificial SequenceDescription of Artificial Sequence
oligonucleotide primer 15tgtccctgcc cagaacct 181618DNAArtificial
SequenceDescription of Artificial Sequence oligonucleotide primer
16agacagaagg gctgggac 181719DNAArtificial SequenceDescription of
Artificial Sequence oligonucleotide primer 17agtgcagagt catccagca
191823DNAArtificial SequenceDescription of Artificial Sequence
oligonucleotide primer 18ttcgaagatg tatggaattc ttc
231920DNAArtificial SequenceDescription of Artificial Sequence
oligonucleotide primer 19catgaacatt cctcccattg 202022DNAArtificial
SequenceDescription of Artificial Sequence oligonucleotide primer
20tttagtcctg agttctgacc cc 222119DNAArtificial SequenceDescription
of Artificial Sequence oligonucleotide primer 21atccagatca
tctgcctgg 192218DNAArtificial SequenceDescription of Artificial
Sequence oligonucleotide primer 22cggcacagtg aggatgag
182320DNAArtificial SequenceDescription of Artificial Sequence
oligonucleotide primer 23attctggggc acagttatcc 202424DNAArtificial
SequenceDescription of Artificial Sequence oligonucleotide primer
24atagttctga ttgctggact tctc 242545DNAArtificial
SequenceDescription of Artificial Sequence 5' tagged extension
primer 25gtgattctgt acgtgtcgcc gtctgatctt tatcctccgt tccct
452645DNAArtificial SequenceDescription of Artificial Sequence 5'
tagged extension primer 26gcggtaggtt cccgacatat tttaaacagg
tttgctccta aatct 452745DNAArtificial SequenceDescription of
Artificial Sequence 5' tagged extension primer 27ggatggcgtt
ccgtcctatt ggacggcttc ctgagccagt tccct 452845DNAArtificial
SequenceDescription of Artificial Sequence 5' tagged extension
primer 28cgactgtagg tgcgtaactc gatgttctgg ccaagtgtca actct
452945DNAArtificial SequenceDescription of Artificial Sequence 5'
tagged extension primer 29agggtctcta cgctgacgat ttgaaatttt
gctttatagg agaaa 453045DNAArtificial SequenceDescription of
Artificial Sequence 5' tagged extension primer 30agcgatctgc
gagaccgtat tggacttcct taaactttaa ccgaa 453145DNAArtificial
SequenceDescription of Artificial Sequence 5' tagged extension
primer 31agatagagtc gatgccagct ttccttgtca atctccatca cttca
453245DNAArtificial SequenceDescription of Artificial Sequence 5'
tagged extension primer 32gacctgggtg tcgataccta ggccctcatt
agtccttggc tctta 453345DNAArtificial SequenceDescription of
Artificial Sequence 5' tagged extension primer 33acgcacgtcc
acggtgattt gggggcagct gcttccaggt tggca 453445DNAArtificial
SequenceDescription of Artificial Sequence 5' tagged extension
primer 34cgtgccgctc gtgatagaat aaaccccaga gtccaaagta gatgt
453545DNAArtificial SequenceDescription of Artificial Sequence 5'
tagged extension primer 35ggctatgatt cgcaatgctt gtgctgtggg
tggtgaagtc cacgc 453636DNAArtificial SequenceDescription of
Artificial Sequence 5' tagged extension primer 36agagcgagtg
acgcatactt gggctcctgt cttaca 363710DNAArtificial
SequenceDescription of Artificial Sequence 5' tagged extension
primer 37gccctgcctc 10
* * * * *