U.S. patent application number 12/302691 was filed with the patent office on 2010-04-29 for detecting and treating dementia.
Invention is credited to Matthew Colin Baker, Marc Cruts, Jason Eriksen, Howard Feldman, Jennifer Mae Gass, Michael L. Hutton, Samir Kumar-Singh, Ian Reid Alexander Mackenzie, Stuart M. Pickering-Brown, Rosa Rademakers, Christine Van Broeckhoven.
Application Number | 20100105034 12/302691 |
Document ID | / |
Family ID | 39033541 |
Filed Date | 2010-04-29 |
United States Patent
Application |
20100105034 |
Kind Code |
A1 |
Hutton; Michael L. ; et
al. |
April 29, 2010 |
DETECTING AND TREATING DEMENTIA
Abstract
This document relates to methods and materials for detecting
mutations that can be linked to dementia. For example, methods and
materials for detecting one or more mutations within PGRN nucleic
acid are provided. This document also provides methods and
materials for detecting the level of progranulin expression. In
addition, this document relates to methods and materials for
treating mammals having a neurodegenerative disorder (e.g.,
dementia). For example, methods and materials for increasing PGRN
polypeptide levels in mammals are provided, as are methods and
materials for identifying agents that can be used to increase PGRN
polypeptide levels in mammals.
Inventors: |
Hutton; Michael L.; (Newton,
MA) ; Baker; Matthew Colin; (Jacksonville, FL)
; Gass; Jennifer Mae; (Atlantic Beach, FL) ;
Rademakers; Rosa; (Ponte Vedra, FL) ; Eriksen;
Jason; (Houston, TX) ; Pickering-Brown; Stuart
M.; (Derbyshire, GB) ; Mackenzie; Ian Reid
Alexander; (Vancouver, CA) ; Feldman; Howard;
(Vancouver, CA) ; Kumar-Singh; Samir; (Edegem,
BE) ; Van Broeckhoven; Christine; (Edegem, BE)
; Cruts; Marc; (Antwerpen, BE) |
Correspondence
Address: |
FISH & RICHARDSON P.C.
PO BOX 1022
MINNEAPOLIS
MN
55440-1022
US
|
Family ID: |
39033541 |
Appl. No.: |
12/302691 |
Filed: |
May 30, 2007 |
PCT Filed: |
May 30, 2007 |
PCT NO: |
PCT/US07/70008 |
371 Date: |
December 15, 2009 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60809904 |
May 30, 2006 |
|
|
|
60818000 |
Jun 29, 2006 |
|
|
|
60818601 |
Jul 5, 2006 |
|
|
|
60818604 |
Jul 5, 2006 |
|
|
|
60848711 |
Oct 2, 2006 |
|
|
|
Current U.S.
Class: |
435/6.16 ;
436/86 |
Current CPC
Class: |
C07K 14/435 20130101;
C12Q 1/6883 20130101; C12Q 2600/172 20130101; A61P 25/28 20180101;
C12Q 2600/16 20130101; C12Q 1/6809 20130101; C12Q 2600/158
20130101; C12Q 2600/156 20130101; A61P 25/00 20180101; C12Q
2600/118 20130101; C12Q 2600/136 20130101; A61P 43/00 20180101;
A61P 25/14 20180101; A61K 48/005 20130101 |
Class at
Publication: |
435/6 ;
436/86 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68; G01N 33/68 20060101 G01N033/68 |
Goverment Interests
STATEMENT AS TO FEDERALLY SPONSORED RESEARCH
[0001] This invention was made with government support under grant
AG016574 awarded by National Institutes of Health. The government
has certain rights in the invention.
Foreign Application Data
Date |
Code |
Application Number |
Jul 4, 2006 |
EP |
06116589.0 |
Jul 4, 2006 |
EP |
06116591.6 |
Claims
1-97. (canceled)
98. A method for diagnosing dementia in a mammal suspected of
having dementia, wherein said method comprises (a) determining
whether or not said mammal comprises PGRN nucleic acid containing a
mutation or a reduced level of a PGRN polypeptide, wherein the
presence of said PGRN nucleic acid or said reduced level indicates
that said mammal has dementia, and (b) diagnosing said mammal as
having dementia if said mammal comprises said PGRN nucleic acid or
said reduced level and diagnosing said mammal as not having
dementia involving PGRN if said mammal lacks said PGRN nucleic acid
or said reduced level.
99. The method of claim 98, wherein said mammal is a human.
100. The method of claim 98, wherein said dementia is
frontotemporal dementia.
101. The method of claim 98, wherein said method comprises
determining whether or not said mammal comprises said PGRN nucleic
acid.
102. The method of claim 101, wherein said PGRN nucleic acid
encodes a sequence of a PGRN polypeptide.
103. The method of claim 101, wherein said PGRN nucleic acid is a
cis-acting regulatory element that regulates expression of a PGRN
polypeptide.
104. The method of claim 101, wherein said mutation is a nucleotide
addition.
105. The method of claim 101, wherein said mutation is a nucleotide
deletion.
106. The method of claim 101, wherein said mutation is a nucleotide
substitution.
107. The method of claim 101, wherein said method comprises using
an immunological method to determine whether or not said mammal
comprises said PGRN nucleic acid.
108. The method of claim 101, wherein said mammal is a human, and
wherein said mutation causes expression of a PGRN polypeptide
having the amino acid sequence set forth in SEQ ID NO:1 while
containing at least one mutation in said amino acid sequence.
109. The method of claim 108, wherein said PGRN polypeptide is
shorter than 593 amino acid residues in length.
110. The method of claim 98, wherein said method comprises
determining whether or not said mammal comprises a reduced level of
a PGRN polypeptide.
111. The method of claim 110, wherein said mammal is a human, and
wherein said PGRN polypeptide comprises the amino acid sequence set
forth in SEQ ID NO:1.
112. The method of claim 98, wherein said method comprises
providing a medical professional information about the presence or
absence of said PGRN nucleic acid or said reduced level.
113. The method of claim 112, wherein said method comprises placing
said information on a computer database accessible to said medical
professional.
114. A method for classifying a mammal as being at risk of
developing dementia, wherein said method comprises (a) determining
whether or not a mammal comprises PGRN nucleic acid containing a
mutation or a reduced level of a PGRN polypeptide, wherein the
presence of said PGRN nucleic acid or said reduced level indicates
that said mammal is at risk of developing dementia, and (b)
classifying said mammal as being at risk of developing dementia if
said mammal comprises said PGRN nucleic acid or said reduced level
and diagnosing said mammal as not being at risk of developing
dementia involving PGRN if said mammal lacks said PGRN nucleic acid
or said reduced level.
115. The method of claim 114, wherein said mammal is a human.
116. The method of claim 114, wherein said dementia is
frontotemporal dementia.
117. The method of claim 114, wherein said method comprises
determining whether or not said mammal comprises said PGRN nucleic
acid.
118. The method of claim 117, wherein said PGRN nucleic acid
encodes a sequence of a PGRN polypeptide.
119. The method of claim 117, wherein said PGRN nucleic acid is a
cis-acting regulatory element that regulates expression of a PGRN
polypeptide.
120. The method of claim 117, wherein said mutation is a nucleotide
addition.
121. The method of claim 117, wherein said mutation is a nucleotide
deletion.
122. The method of claim 117, wherein said mutation is a nucleotide
substitution.
123. The method of claim 117, wherein said method comprises using
an immunological method to determine whether or not said mammal
comprises said PGRN nucleic acid.
124. The method of claim 117, wherein said mammal is a human, and
wherein said mutation causes expression of a PGRN polypeptide
having the amino acid sequence set forth in SEQ ID NO:1 while
containing at least one mutation in said amino acid sequence.
125. The method of claim 124, wherein said PGRN polypeptide is
shorter than 593 amino acid residues in length.
126. The method of claim 114, wherein said method comprises
determining whether or not said mammal comprises a reduced level of
a PGRN polypeptide.
127. The method of claim 126, wherein said mammal is a human, and
wherein said PGRN polypeptide comprises the amino acid sequence set
forth in SEQ ID NO:1.
128. The method of claim 114, wherein said method comprises
providing a medical professional information about the presence or
absence of said PGRN nucleic acid or said reduced level.
129. The method of claim 128, wherein said method comprises placing
said information on a computer database accessible to said medical
professional.
Description
BACKGROUND
[0002] 1. Technical Field
[0003] This document relates to methods and materials involved in
detecting mutations linked to dementia (e.g., frontotemporal
dementia) as well as methods and materials involved in detecting
reduced progranulin expression. This document also relates to
methods and materials involved in treating mammals having or being
susceptible to developing neurodegenerative disorders (e.g.,
frontotemporal dementia). For example, this document relates to
methods and materials involved in using a nucleic acid encoding a
progranulin polypeptide or an agent that increases progranulin
polypeptide levels to treat a mammal (e.g., human) having a
neurodegenerative disorder.
[0004] 2. Background Information
[0005] Frontotemporal dementia (FTD) is the second most common
cause of dementia in people under 65 years (Clinical and
neuropathological criteria for frontotemporal dementia. The Lund
and Manchester Groups. J. Neurol. Neurosurg. Psychiatry, 57:416-8
(1994)). A large proportion of FTD patients (35-50%) have a family
history of dementia consistent with a strong genetic component to
the disease (Chow et al., Arch. Neurol., 56:817-22 (1999); Stevens
et al., Neurology, 50:1541-5 (1998); and Mann, Brain Pathol.,
8:325-38 (1998)). Mutations in the gene encoding the microtubule
associated protein tau (MAPT) were shown to cause familial FTD with
Parkinsonism linked to chromosome 17q21 (FTDP-17; Hutton et al.,
Nature, 393:702-5 (1998)). The neuropathology of patients with
defined MAPT mutations is characterized by the presence of
cytoplasmic neurofibrillary inclusions composed of
hyperphosphorylated tau (Hutton et al., Nature, 393:702-5 (1998)
and Ghetti et al., Brain Res. Bull., 50:471-2 (1999)).
[0006] In an increasing number of FTD families with significant
evidence for linkage to the same region on chromosome 17q21
(D17S1787-D17S806), the disease can not be explained by mutations
in MAPT, and patients also consistently lack tau-immunoreactive
inclusion pathology (Rademakers et al., Mol. Psychiatry, 7:1064-74
(2002); Rosso et al., Brain, 124:1948-57 (2001); Lendon et al.,
Neurology, 50:1546-55 (1998); Kertesz et al., Neurology, 54:818-27
(2000); Froelich et al., Am. J. Med. Genet., 74:380-5 (1997); Bird
et al., Neurology, 48:949-54 (1997); and Rademakers et al., (ed.
Cummings, J. L. e.) 119-139 (Springer-Verlag, Berlin, 2005)). In
contrast, tau-negative FTD-17 patients have
ubiquitin-immunoreactive (ub-ir) neuronal cytoplasmic inclusions
(NCI) and characteristically lentiform ub-ir neuronal intranuclear
inclusions (NII; Rademakers et al., (ed. Cummings, J. L. e.)
119-139 (Springer-Verlag, Berlin, 2005)).
SUMMARY
[0007] This document relates to methods and materials for detecting
mutations that are linked to dementia. The methods and materials
provided herein are based, in part, on the discovery that mutations
within progranulin (PGRN) nucleic acid are linked to dementia
(e.g., FTD). The human PGRN gene is located at chromosome 17q21,
and its coding sequence is available at GenBank.RTM. Accession
Number M75161 (GI:183612). The PGRN gene is also known as epithelin
precursor, proepithelin, PEPI, acrogranin, and granulin. A PGRN
gene can have 12 exons that together can encode a polypeptide with
a molecular weight of 68.5 kDa. Granulins form a family of
cysteine-rich polypeptides, some of which have growth modulatory
activity. The widespread occurrence of PGRN mRNA in cells from the
hematopoietic system and in epithelia implies functions in these
tissues. At least four different human granulin polypeptides can be
processed from a single PGRN precursor which can contain 7.5
repeats that each contain 12 conserved cysteine residues. Both the
PGRN precursor and processed PGRN polypeptides can have biological
activity. The term "PGRN polypeptide" as used herein includes,
without limitation, human PGRN polypeptides (e.g., human PGRN
polypeptides set forth in GenBank.RTM. under GI numbers 183612,
450-4151, and 77416865), mouse PGRN polypeptides (e.g., the mouse
PGRN polypeptide set forth in GenBank.RTM. under GI number
6680107), zebrafish PGRN polypeptides (e.g., zebrafish PGRN
polypeptides set forth in GenBank.RTM. under GI numbers 66472848,
77797837, 47086569, and 47086537), and fish PGRN polypeptides
(e.g., Mozambique tilapia PGRN polypeptides set forth in
GenBank.RTM. under GI numbers 113171578 and 73665551), as well as
fragments thereof that are at least 40 amino acids in length such
as granulin A, granulin B, granulin C, granulin D, granulin E,
granulin F, granulin G, and granulin P. A human progranulin
polypeptide can be a 593-amino acid glycosylated polypeptide having
a consensus sequence that is repeated seven and a half times.
[0008] This document provides methods and materials for detecting
PGRN nucleic acid containing one or more mutations that can be
linked to dementia. For example, standard PCR techniques can be
used to amplify a fragment of a patient's PGRN nucleic acid. The
amplified fragment can be sequenced or probed using standard
techniques to determine whether or not the fragment contains one or
more mutations such as a truncation mutation. Detecting such
mutations can allow clinicians to assess patients for disease risk
and plan treatment options for the patient.
[0009] This document also provides methods and materials for
detecting the level of PGRN expression. As described herein, a
mammal having reduced levels of PGRN mRNA or PGRN polypeptide
expression can be identified as having or as being likely to
develop dementia.
[0010] This document also relates to methods and materials for
treating a mammal having or being likely to develop a
neurodegenerative disorder (e.g., dementia). For example, this
document relates to methods and materials for treating a
neurodegenerative disorder in a mammal by administering a nucleic
acid encoding a PGRN polypeptide to the mammal such that the level
of a PGRN polypeptide is increased in the mammal This document also
relates to methods and materials for treating a neurodegenerative
disorder in a mammal using an agent such as a non-steroidal
anti-inflammatory drug (NSAID) or a PPAR agonist or a combination
of such agents. While not being limited to any particular mode of
action, administering an agent such as an NSAID or a PPAR agonist
to a mammal can treat neurodegeneration, as described herein, by
producing an increased level of a progranulin (PGRN) polypeptide in
the mammal Having the ability to treat neurodegenerative disorders
can help clinicians reduce the considerable morbidity and mortality
associated with such disorders, and can also reduce health care
expenditures. Methods and materials for identifying agents that can
be used to treat neurodegenerative disorders as well as non-human
models of dementia also are provided herein.
[0011] In general, one aspect of this document features a method
for diagnosing dementia in a mammal suspected of having dementia.
The method comprises, or consists essentially of, determining
whether or not the mammal comprises PGRN nucleic acid containing a
mutation, where the presence of the PGRN nucleic acid containing a
mutation indicates that the mammal has dementia. The mammal can be
a human. The dementia can be frontotemporal lobar degeneration. The
dementia can be frontotemporal dementia. The PGRN nucleic acid can
encode a sequence of a PGRN polypeptide. The PGRN nucleic acid can
be a cis-acting regulatory element that regulates expression of a
PGRN polypeptide. The mutation can be a nucleotide addition. The
mutation can be a nucleotide deletion. The mutation can be a
nucleotide substitution. The mutation can cause reduced expression
of a PGRN polypeptide in the mammal The mammal can be a human, and
the mutation can cause expression of a PGRN polypeptide having the
amino acid sequence set forth in SEQ ID NO:1 while containing at
least one mutation in the amino acid sequence. The PGRN polypeptide
can be shorter than 593 amino acid residues in length. The mutation
can cause expression of a truncated PGRN polypeptide in the
mammal.
[0012] In another aspect, this document features a method for
classifying a mammal as being at risk of developing dementia. The
method comprises, or consists essentially of, determining whether
or not a mammal comprises PGRN nucleic acid containing a mutation,
where the presence of the PGRN nucleic acid containing a mutation
indicates that the mammal is at risk of developing dementia. The
mammal can be a human. The dementia can be frontotemporal lobar
degeneration. The dementia can be frontotemporal dementia. The PGRN
nucleic acid can encode a sequence of a PGRN polypeptide. The PGRN
nucleic acid can be a cis-acting regulatory element that regulates
expression of a PGRN polypeptide. The mutation can be a nucleotide
addition. The mutation can be a nucleotide deletion. The mutation
can be a nucleotide substitution. The mutation can cause reduced
expression of a PGRN polypeptide in the mammal The mammal can be a
human, and the mutation can cause expression of a PGRN polypeptide
having the amino acid sequence set forth in SEQ ID NO:1 while
containing at least one mutation in the amino acid sequence. The
PGRN polypeptide can be shorter than 593 amino acid residues in
length. The mutation can cause expression of a truncated PGRN
polypeptide in the mammal.
[0013] In another aspect, this document features a method for
diagnosing dementia in a mammal suspected of having dementia. The
method comprises, or consists essentially of, determining whether
or not the mammal comprises a reduced level of a PGRN polypeptide
or a PGRN mRNA, where the presence of the reduced level indicates
that the mammal has dementia. The mammal can be a human. The
dementia can be frontotemporal lobar degeneration. The dementia can
be frontotemporal dementia. The mammal can be a human, and the PGRN
polypeptide can comprise the amino acid sequence set forth in SEQ
ID NO:1. The method can comprise determining whether or not the
mammal comprises a reduced level of a PGRN polypeptide. The method
can comprise determining whether or not the mammal comprises a
reduced level of a PGRN mRNA.
[0014] In another aspect, this document features a method for
classifying a mammal as being at risk of developing dementia. The
method comprises, or consists essentially of, determining whether
or not a mammal comprises a reduced level of a PGRN polypeptide or
a PGRN mRNA, where the presence of the reduced level indicates that
the mammal is at risk of developing dementia. The mammal can be a
human. The dementia can be frontotemporal lobar degeneration. The
dementia can be frontotemporal dementia. The mammal can be a human,
and the PGRN polypeptide can comprise the amino acid sequence set
forth in SEQ ID NO:1. The method can comprise determining whether
or not the mammal comprises a reduced level of a PGRN polypeptide.
The method can comprise determining whether or not the mammal
comprises a reduced level of a PGRN mRNA.
[0015] In another aspect, this document features an isolated
nucleic acid molecule. The isolated nucleic acid molecule
comprises, or consists essentially of, a nucleic acid sequence that
encodes at least ten contiguous amino acids set forth in SEQ ID
NO:1 provided that the at least ten contiguous amino acids contains
at least one mutation with respect to the sequence set forth in SEQ
ID NO:1, where the isolated nucleic acid molecule is at least 30
nucleotides in length. The isolated nucleic acid molecule can
result from a polymerase chain reaction. The isolated nucleic acid
molecule can be DNA. The nucleic acid sequence can encode at least
20 contiguous amino acids set forth in SEQ ID NO:1 provided that
the at least 20 contiguous amino acids contains at least one
mutation with respect to the sequence set forth in SEQ ID NO:1. The
nucleic acid sequence can encode at least 40 contiguous amino acids
set forth in SEQ ID NO:1 provided that the at least 40 contiguous
amino acids contains at least one mutation with respect to the
sequence set forth in SEQ ID NO:1. The isolated nucleic acid
molecule can be at least 50 nucleotides in length. The isolated
nucleic acid molecule can be at least 100 nucleotides in length.
The mutation can be an amino acid substitution.
[0016] In another aspect, this document features an isolated
nucleic acid molecule. The isolated nucleic acid molecule
comprises, or consists essentially of, a nucleic acid sequence
having at least 15 contiguous nucleotides set forth in SEQ ID NO:2
provided that the at least 15 contiguous nucleotides contains at
least one mutation with respect to the sequence set forth in SEQ ID
NO:2. The isolated nucleic acid molecule can result from a
polymerase chain reaction. The isolated nucleic acid molecule can
be DNA. The nucleic acid sequence can comprise at least 25
contiguous nucleotides set forth in SEQ ID NO:2 provided that the
at least 25 contiguous nucleotides contains at least one mutation
with respect to the sequence set forth in SEQ ID NO:2. The nucleic
acid sequence can comprise at least 50 contiguous nucleotides set
forth in SEQ ID NO:2 provided that the at least 50 contiguous
nucleotides contains at least one mutation with respect to the
sequence set forth in SEQ ID NO:2. The isolated nucleic acid
molecule can be at least 50 nucleotides in length. The isolated
nucleic acid molecule can be at least 100 nucleotides in length.
The mutation can be a nucleotide addition. The mutation can be a
nucleotide deletion. The mutation can be a nucleotide substitution.
The mutation, when present within an endogenous PGRN nucleic acid
within a mammal, can cause reduced expression of a PGRN polypeptide
in the mammal. The mutation, when present within an endogenous PGRN
nucleic acid within a human, can cause expression of a PGRN
polypeptide having the amino acid sequence set forth in SEQ ID NO:1
while containing at least one mutation in the amino acid
sequence.
[0017] In another aspect, this document features a method for
treating a mammal having a neurodegenerative disorder or suspected
to develop the neurodegenerative disorder. The method comprises, or
consists essentially of, administering, to the mammal, a PGRN
polypeptide or a nucleic acid comprising a nucleic acid sequence
that encodes the PGRN polypeptide. The mammal can be a human. The
mammal can have a neurodegenerative disorder. The PGRN polypeptide
or the nucleic acid can be administered to the mammal under
conditions where a symptom of the neurodegenerative disorder
improves. The symptom can improve by at least 25 percent. The
mammal can be suspected to develop the neurodegenerative disorder.
The PGRN polypeptide or the nucleic acid can be administered to the
mammal under conditions where the onset of symptoms of the
neurodegenerative disorder is delayed. The onset can be delayed at
least five years. The neurodegenerative disorder can be selected
from the group consisting of frontotemporal dementia, Alzheimer's
disease, and motor neuron disease. The method can comprise
administering the PGRN polypeptide to the mammal. The PGRN
polypeptide can comprise the amino acid sequence set forth in SEQ
ID NO:1. The method can comprise administering the nucleic acid to
the mammal. The nucleic acid can comprise the nucleotide sequence
set forth in SEQ ID NO:2. The PGRN polypeptide can comprise the
amino acid sequence set forth in SEQ ID NO:1. The nucleic acid can
be administered using a viral vector. The viral vector can be
selected from the group consisting of an adeno-associated virus
vector, a lentivirus vector, and an adenovirus vector.
[0018] In another aspect, this document features a method for
treating a mammal having a neurodegenerative disorder or suspected
to develop the neurodegenerative disorder. The method comprises, or
consists essentially of, (a) obtaining a mammal comprising (i) PGRN
nucleic acid containing a mutation or (ii) a reduced level of a
PGRN polypeptide or a PGRN mRNA, and (b) administering, to the
mammal, an agent that increases the level of a PGRN polypeptide in
the mammal. The mammal can be a human. The mammal can have a
neurodegenerative disorder. The agent can be administered to the
mammal under conditions where a symptom of the neurodegenerative
disorder improves. The symptom can improve by at least 25 percent.
The mammal can be suspected to develop the neurodegenerative
disorder. The agent can be administered to the mammal under
conditions where the onset of symptoms of the neurodegenerative
disorder is delayed. The onset can be delayed at least five years.
The neurodegenerative disorder can be selected from the group
consisting of frontotemporal dementia, Alzheimer's disease, and
motor neuron disease. The agent can be selected from the group
consisting of 17.beta.-estradiol, endothelin, testosterone
propionate, lysophosphatidic acid, cAMP, and ethinyl estradiol. The
agent can be a non-steroidal anti-inflammatory drug. The
non-steroidal anti-inflammatory drug can be selected from the group
consisting of ibuprofen, indomethacin, diclofenac, naproxen, and
aspirin. The agent can be a PPAR agonist. The PPAR agonist can be
selected from the group consisting of gemfibrozil, fenofibrate,
clofibrate, rosiglitazone, pioglitazone, troglitazone, ciglitazone,
and L165,041.
[0019] In another aspect, this document features a method for
identifying an agent for treating a neurodegenerative disorder in a
mammal. The method comprises, or consists essentially of, (a)
administering a test agent to a non-human mammal comprising somatic
and germ cells that are heterozygous or homozygous for a disrupted
PGRN sequence, and (b) determining whether or not (i) a symptom of
a neurodegenerative disorder improves in the non-human mammal or
(ii) the level of PGRN polypeptide or PGRN mRNA expression is
increased in the non-human mammal, where the presence of the
improvement or the increased level indicates that the test agent is
the agent for treating a neurodegenerative disorder. The non-human
mammal can be a mouse. The non-human mammal can comprise exogenous
nucleic acid encoding a polypeptide selected from the group
consisting of microtubule associated protein tau, TAR DNA binding
protein 43, and amyloid precursor protein. The non-human mammal can
be a transgenic mouse whose somatic and germ cells comprise the
exogenous nucleic acid. The non-human mammal can comprise exogenous
nucleic acid encoding a polypeptide having the amino acid sequence
set forth in SEQ ID NO:1 while containing at least one mutation in
the amino acid sequence. The non-human mammal can be a transgenic
mouse whose somatic and germ cells comprise the exogenous nucleic
acid. The non-human mammal can comprise somatic and germ cells that
are homozygous for the disrupted PGRN sequence.
[0020] Unless otherwise defined, all technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art to which this invention pertains.
Although methods and materials similar or equivalent to those
described herein can be used to practice the invention, suitable
methods and materials are described below. All publications, patent
applications, patents, and other references mentioned herein are
incorporated by reference in their entirety. In case of conflict,
the present specification, including definitions, will control. In
addition, the materials, methods, and examples are illustrative
only and not intended to be limiting.
[0021] The details of one or more embodiments of the invention are
set forth in the accompanying drawings and the description below.
Other features, objects, and advantages of the invention will be
apparent from the description and drawings, and from the
claims.
DESCRIPTION OF THE DRAWINGS
[0022] FIG. 1A is a schematic representation of chromosome 17. PGRN
is located 1.7 Mb from MAPT, which is mutated in FTDP-17. FIG. 1B
is a schematic representation of a PGRN gene and mRNA encoding a
PGRN polypeptide with positions of tau-negative FTD-17 mutations
indicated. Lettered boxes refer to individual granulin cysteinyl
repeats. FIG. 1C is a graphic representation of the locations of
premature termination codons created by this group of mutations in
PGRN RNA. The truncated RNAs can be subjected to nonsense mediated
decay resulting in null alleles, thereby representing at least one
pathogenic mechanism for PGRN mutations. The IVS8+1G>A mutation
(*) is predicted to cause skipping of exon 8 and a frameshift (V279
GfsX4); however, RNA was not available to confirm the effect of
this mutation.
[0023] FIG. 2A is a bar graph plotting PGRN mRNA levels for
lymphoblastoid cells from unaffected individuals or individuals
carrying the C31LfsX34 (UBC17) or R418X (UBC15) mutations. PGRN RNA
levels are shown as a percentage of levels in cells from unaffected
individuals. FIG. 2B is a graph plotting PGRN mRNA levels for the
indicated cells treated with the NMD inhibitor cycloheximide (CHX;
500 .mu.M) for the indicated number of hours. Treatment of
C31LfsX34 cells with CHX for 2 hours and 8 hours resulted in a
progressive increase in total PGRN RNA. FIG. 2C contains traces of
an RT-PCR fragment analysis in lymphoblastoid cells (1-5) and brain
(6) from patients with the C31LfsX34 mutation, revealing that the
mutant RNA (196 bp) is virtually absent. Treatment with CHX results
in the selective increase in C31LfsX34 mutant RNA levels, but has
no effect on PGRN RNA from control (unaffected) lymphoblasts. FIG.
2D contains several photographs and a bar graph for an analysis of
polypeptide extracts from lymphoblasts. Wild-type PGRN polypeptide
levels are reduced in lymphoblasts from mutation (C31LfsX34 and
R418X) carriers relative to unaffected relatives (mean reduction
34%, p=0.01, t-test). The C31LfsX34 (UBC17) and R418X (UBC15)
mutant polypeptides are not detected. Arrows indicate the wild-type
PGRN and the expected position of the R418X mutant polypeptide.
R418X PGRN generated from an intronless cDNA construct (not subject
to nonsense-mediated decay) expressed in HeLa cells (left hand
panel) is included to demonstrate that the mutant polypeptide (if
made) is stable.
[0024] FIG. 3 contains family pedigrees revealing the segregation
of PGRN mutations C31LfsX34 and Q125X with disease in the UBC17 (A)
and 1083 (B) families, respectively. Affected individuals are
indicated by filled or partially filled diamonds. Presence (+) or
absence (-) of the mutation is shown for each individual with
available DNA. Only affected members of the youngest generation are
shown to protect the identity of the families.
[0025] FIG. 4 is a schematic representation of a PGRN gene and mRNA
encoding a PGRN polypeptide, showing identified PGRN mutations.
Lettered boxes in the PGRN mRNA refer to individual granulin
repeats. Mutations are numbered relative to the largest PGRN
transcript (GenBank.RTM. accession number NM.sub.--002087.2;
GI:60498993).
[0026] FIG. 5 contains family pedigrees revealing segregation of
PGRN mutations with disease in eight FTLD families. To protect each
patient's identity, all individuals are depicted as diamonds. The
numbers within the diamonds represent the number of individual
family members. Open symbols represent unaffected individuals,
black symbols denote patients with clinical or pathological
diagnosis of FTLD and grey symbols denote PD patients. The first
number below the patient's symbol denotes age at onset (in years),
followed by age at death (in years). The arrow indicates the
proband. For patients, the presence of a PGRN mutation is shown
with "+" right above the symbol.
[0027] FIG. 6 is a liability curve for PGRN mutation carriers. The
distribution of the age-related penetrance in PGRN mutation
carriers is shown. The disease penetrance was calculated in age
groups of 5 years starting at 30 years and ending at 85 years. A
total of 69 affected and 16 non-affected PGRN mutation carriers
were included in the analyses.
[0028] FIG. 7 contains images of agarose gels after electrophoresis
of PGRN PCR amplicons obtained from first-strand cDNA prepared from
frontal cortex of patients NAOS-064 (c.138+1G>A; lane 2) and
UBC14-9 (c.463-1G>A; lane 4). The analysis of a control
individual is included to show the expected transcript lengths for
PGRN cDNA exons 0-2 (413 bp, lane 1) and PGRN cDNA exons 4-8 (587
bp, lane 3). For each PGRN splice-site mutation, a schematic
presentation of the predicted splicing of the mutant PGRN
transcript is shown. The positions of the mutations and the
locations of the PCR primers (arrows) are indicated.
[0029] FIG. 8 is a schematic diagram depicting a targeting nucleic
acid construct to create conditional PGRN knockout animals.
[0030] FIG. 9 is a schematic diagram depicting a targeting nucleic
acid construct to create PGRN knockout animals.
[0031] FIG. 10 contains an amino acid sequence (SEQ ID NO:1) of a
human PGRN polypeptide and a nucleic acid sequence (SEQ ID NO:2)
that encodes a human PGRN polypeptide.
[0032] FIG. 11A is an alignment of the amino acid sequences of
individual granulin domains of a PGRN polypeptide: N-terminal (SEQ
ID NO:76), Paragranulin (SEQ ID NO:77), Granulin G (SEQ ID NO:78),
Granulin F (SEQ ID NO:79), Granulin B (SEQ ID NO:80), Granulin A
(SEQ ID NO:81), Granulin C (SEQ ID NO:82), Granulin D (SEQ ID
NO:83), and Granulin E (SEQ ID NO:84). Conserved Cys residues are
darkly shaded, and other conserved amino acids are lightly shaded.
PGRN missense mutations are indicated with shaded circles. FIG. 11B
is a molecular model of granulin domains. The complete structure of
a granulin domain was reconstructed based on the crystal structure
of the N-terminal module of Granulin A (PDB 1g26; Tolkatchev et
al., Biochemistry, 39:2878-2886 (2000)), and the inherent symmetry
of the disulfide-dominated structure. The structure comprises six
disulfide bonds and can be split into three self-similar
overlapping modules. The two missense mutations located in a
granulin domain were mapped on the reconstructed model.
[0033] FIG. 12 contains a pedigree of the DR8 founder family
showing ten different branches. Generations H-I and H-II are
hypothetical generations. Black boxes represent patients, grey
colored boxes are individuals for whom the affection status is
unclear. Individuals for which DNA is available are indicated with
asterisks. Patients represented with a DR number are those for
which clinical and/or pathological information are available (Table
21). The index patient of each branch of the pedigree is indicated
with an arrowhead.
[0034] FIG. 13 is a pedigree diagram showing segregation of the DR8
founder haplotype in family DR25. The proband is indicated with an
arrowhead. Filled symbols represent individuals with AD (grey) or
FTLD (black). Allele lengths are shown in base pairs.
[0035] FIG. 14 is a graph plotting the -log 10 of the global
p-value of a score statistic examining the association between
subsequent 2-SNP haplotypes and age at onset for all common PGRN
variants with minor allele frequency >0.05. The y-axis denotes
the -log 10 p-value, and the x-axis depicts the common variants in
order of location.
[0036] FIG. 15 is a graph plotting survival after disease onset by
IVS2+21G>A genotype. A survival function is given for patients
homozygous for the wild type GG (dotted line) and carriers of the A
allele (dashed line). The y-axis denotes cumulative survival, and
the x-axis denotes survival time in months after disease onset
(t=0). Patients still alive at last examination were censored.
[0037] FIG. 16A contains MAQ results of patients DR184.1 (left) and
DR15.1 (right) generated by the MAQs program. The upper panel
contains chromatograms comparing samples from a patient and control
individuals. Test (amp) and reference amplicons (contr) are
indicated above the peaks. The x-axis shows the length of the
amplicons in base pairs, and the y-axis indicates the peak heights.
The lower panel contains dosage plots showing DQ values for
reference (left side) and test amplicons (right side). Test
amplicons with a DQ value below 0.75 are indicated with a black
bar. The grey area represents normal variation (DQ=0.8-1.2). In
patient DR184.1, the peak areas of all test amplicons are clearly
reduced compared to the control individuals, resulting in DQ values
below 0.75 for all test amplicons. Patient DR15.1 shows reduced DQs
only for test amplicons 3 to 6. FIG. 16B is a schematic
representation of the PGRN gene and flanking regions with MAQ test
amplicons indicated. PGRN coding regions are shown in dark grey,
non-coding regions in light grey. FIG. 16C is a graph of qPCR SYBR
Green results of all 13 PGRN exons for patients DR184.1, DR15.1,
and DR188.1. The plot shows the DQ values with standard error for
each PGRN exon, indicated on the x-axis. Each DQ value represents
the mean of DQs obtained for housekeeping genes hB2M and hUBC,
measured in duplicate. In DR184.1, all PGRN exons show a DQ lower
than 0.75, while in patients DR15.1 and DR188.1, only exons 1 to 12
are deleted, although exon 0 of DR188.1 is only slightly
increased.
[0038] FIG. 17, upper panel is a schematic representation of PGRN
with PstI restriction sites indicated with dotted vertical lines.
The PGRN probe, hybridizing to a restriction fragment of 1.4 kb,
contains part of PGRN 3' UTR and downstream sequence. The lower
panel is a Southern blot of samples from patient DR184.1 and two
control individuals hybridized with a PGRN probe and a reference
probe. Bands resulting from the PGRN probe and the reference probe
are indicated. The signal intensity of the PGRN fragment (1.4 kb)
is lower than that of the reference fragment (1.9 kb) in the
patient compared to the two control individuals. No bands of other
sizes can be observed.
[0039] FIG. 18 contains an agarose gel showing co-amplification of
a series of selected test fragments in and flanking PGRN with a
reference fragment in patient DR184.1 and a control individual. The
resulting bands were quantified on a Kodak Imaging Station 440. The
graph in the lower panel shows the DQ value obtained for each
fragment, indicated on the x-axis. DQ values below 0.75 indicate a
deletion. A genomic segment of chromosome 17q21 is shown below the
graph with the position of the amplified test fragments indicated
with vertical bars. Two regions with lowered DQs can be observed: a
PGRN-containing deletion and a deletion more upstream of PGRN,
assumed to be a CNV. Minimal deleted regions are indicated with a
grey line, and breakpoint regions are indicated with a black line.
Marker D1751860 is shown since it was used to further reduce the
centromeric breakpoint region of the PGRN-containing deletion.
[0040] FIG. 19 contains a map of the 17q21 genomic region
containing the identified deletions showing gene annotation, STR
markers, SNPs, PstI restriction sites in PGRN, location of BAC
RP11-756H11, and location of MAQ amplicons and fragments used in
the multiplex mapping panel. For each of the patients, the minimal
deleted regions are shown in dark grey and the breakpoint regions
are indicated in light grey. The PGRN coding sequence is indicated
with a light grey horizontal bar showing that it is included in
each of the three minimal deleted regions. Dotted bars in patients
DR15.1 and DR188.1 indicate that the telomeric breakpoint regions
in these patients are not defined.
[0041] FIG. 20 is a graph plotting intracellular and secreted PGRN
polypeptide levels in clofibrate treated M17 cell cultures relative
to DMSO treated cells. Intracellular=intracellular PGRN polypeptide
levels, and Secreted=PGRN polypeptide levels detected in serum free
media. The results presented are averages of two or three
experiments performed in duplicate.
[0042] FIG. 21 is a graph plotting intracellular and secreted PGRN
polypeptide levels in clofibrate treated lymphoblast cell cultures
relative to DMSO treated cells. Intracellular=intracellular PGRN
polypeptide levels, and Secreted=PGRN polypeptide levels detected
in serum free media. The results presented are averages of two or
three experiments performed in duplicate.
[0043] FIG. 22, left panel, is a graph plotting PGRN polypeptide
levels in cell lysates (Intracellular) and culture supernatants
(Secreted) from M17 cells that were treated with the indicated
concentrations of ciglitazone. The PGRN polypeptide levels are
plotted as a percent of control levels in cell lysates or culture
supernatants from M17 cells treated with DMSO. FIG. 22, right
panel, contains Western blots analyzing PGRN polypeptide expression
in cell lysates (LYS) and culture supernatants (SFM) from M17 cells
treated with the indicated concentrations of ciglitazone (upper two
rows). FIG. 22, right panel, also contains a Western blot analyzing
GAPDH (GAP) polypeptide expression in cell lysates from M17 cells
treated with the indicated concentrations of ciglitazone (bottom
row).
[0044] FIG. 23 is a graph plotting intracellular and secreted PGRN
polypeptide levels in ciglitazone treated human lymphoblast cell
cultures relative to DMSO treated cells.
Intracellular=intracellular PGRN polypeptide levels, and
Secreted=PGRN polypeptide levels detected in serum free media. The
results presented are averages of two or three experiments
performed in duplicate.
[0045] FIG. 24, left panel, is a graph plotting PGRN polypeptide
levels in cell lysates (Intracellular) and culture supernatants
(Secreted) from human lymphoblast cells that were treated with the
indicated concentrations of L165,041. The PGRN polypeptide levels
are plotted as a percent of control levels in cell lysates or
culture supernatants from human lymphoblast cells treated with
DMSO. FIG. 24, right panel, contains Western blots analyzing PGRN
polypeptide expression in cell lysates (LYS) and culture
supernatants (SFM) from human lymphoblast cells treated with the
indicated concentrations of L165,041 (upper two rows). FIG. 24,
right panel, also contains a Western blot analyzing GAPDH (GAP)
polypeptide expression in cell lysates from human lymphoblast cells
treated with the indicated concentrations of L165,041 (bottom
row).
[0046] FIG. 25 is a graph plotting intracellular and secreted PGRN
polypeptide levels in L165,041 treated M17 cell cultures relative
to DMSO treated cells. Intracellular=intracellular PGRN polypeptide
levels, and Secreted=PGRN polypeptide levels detected in serum free
media. The results presented are averages of two or three
experiments performed in duplicate.
[0047] FIG. 26 is a graph plotting PGRN polypeptide levels in cell
lysates (Intracellular) and culture supernatants (Secreted) from
HeLa cells that were treated with the indicated concentrations of
ibuprofen. The PGRN polypeptide levels are plotted as a percent of
control levels in cell lysates or culture supernatants from HeLa
cells treated with DMSO. The averages of the results from four
experiments are plotted.
[0048] FIG. 27 is a graph plotting PGRN polypeptide levels in cell
lysates and culture supernatants from HeLa cells that were treated
with the indicated concentrations of indomethacin. The PGRN
polypeptide levels are plotted as a percent of control levels in
cell lysates or culture supernatants from HeLa cells treated with
DMSO. Intracellular=intracellular PGRN polypeptide levels, and
Secreted=PGRN polypeptide levels detected in serum free media.
[0049] FIG. 28 is a graph plotting PGRN polypeptide levels in cell
lysates and culture supernatants from HeLa cells that were treated
with the indicated concentrations of naproxen. The PGRN polypeptide
levels are plotted as a percent of control levels in cell lysates
or culture supernatants from HeLa cells treated with DMSO.
Intracellular=intracellular PGRN polypeptide levels, and
Secreted=PGRN polypeptide levels detected in serum free media.
[0050] FIG. 29 is a graph plotting PGRN polypeptide levels in cell
lysates and culture supernatants from HeLa cells that were treated
with the indicated concentrations of meclofenamic acid. The PGRN
polypeptide levels are plotted as a percent of control levels in
cell lysates or culture supernatants from HeLa cells treated with
DMSO. Intracellular=intracellular PGRN polypeptide levels, and
Secreted=PGRN polypeptide levels detected in serum free media.
[0051] FIG. 30 is a graph plotting PGRN polypeptide levels in cell
lysates and culture supernatants from HeLa cells that were treated
with the indicated concentrations of acetylsalicyclic acid. The
PGRN polypeptide levels are plotted as a percent of control levels
in cell lysates or culture supernatants from HeLa cells treated
with DMSO. Intracellular=intracellular PGRN polypeptide levels, and
Secreted=PGRN polypeptide levels detected in serum free media.
[0052] FIG. 31 is a graph plotting PGRN polypeptide levels in cell
lysates and culture supernatants from M17 cells that were treated
with the indicated concentrations of resveratrol. The PGRN
polypeptide levels are plotted as a percent of control levels in
corresponding cell lysates or culture supernatants from M17 cells
treated with DMSO. Intracellular=intracellular PGRN polypeptide
levels, and Secreted=PGRN polypeptide levels detected in serum free
media.
[0053] FIG. 32 is a graph plotting PGRN polypeptide levels in cell
lysates and culture supernatants from M17 cells that were treated
with the indicated concentrations of curcumin. The PGRN polypeptide
levels are plotted as a percent of control levels in corresponding
cell lysates or culture supernatants from M17 cells treated with
DMSO. Intracellular=intracellular PGRN polypeptide levels, and
Secreted=PGRN polypeptide levels detected in serum free media.
[0054] FIG. 33 is a graph plotting levels of PGRN polypeptide
secreted by M17 and N2A cells at the indicated time points. The
graph indicates that secreted PGRN polypeptide accumulates linearly
over 22 hours in both cell lines.
DETAILED DESCRIPTION
[0055] This description provides methods and materials related to
detecting one or more mutations in PGRN nucleic acid. For example,
this description provides methods and materials for determining
whether or not a mammal contains PGRN nucleic acid having a
mutation such as a mutation that results in premature termination
of the coding sequence. This document also provides methods and
materials for detecting the level of PGRN expression. For example,
this description provides methods and materials for determining
whether or not a mammal contains a reduced level of PGRN mRNA or
PGRN polypeptide expression. As described herein, a mammal having
reduced PGRN mRNA or PGRN polypeptide expression can be identified
as having or as being likely to develop dementia.
[0056] The mammal can be any type of mammal including, without
limitation, a mouse, rat, dog, cat, horse, sheep, goat, cow, pig,
monkey, or human. The term "PGRN nucleic acid" as used herein
refers to a nucleic acid that extends from 5 kb upstream of the
transcription start site of PGRN mRNA to 5 kb downstream of the
transcription termination site of PGRN mRNA. In some cases, a PGRN
nucleic acid can be (1) any nucleic acid that encodes a PGRN
polypeptide, (2) any fragment of a nucleic acid that encodes a PGRN
polypeptide, (3) any intronic sequences located between exon
sequences that encode a portion of a PGRN polypeptide, (4) any 5'
flanking sequence within 5 kb of the transcription start site of
PGRN mRNA, (5) any 3' flanking sequence within 5 kb of the
transcription termination site of PGRN mRNA, (6) any sequence
located between the transcription start site of PGRN mRNA and the
first exon that encodes a portion of a PGRN polypeptide, (7) any
sequence located between the last exon that encodes a portion of a
PGRN polypeptide and the transcription termination site of PGRN
mRNA, or (8) any cis-acting regulatory sequence of PGRN mRNA. A
PGRN nucleic acid that encodes a PGRN polypeptide can be, for
example, a PGRN mRNA or a PGRN cDNA. In some cases, a PGRN nucleic
acid can be exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7,
exon 8, exon 9, exon 10, exon 11, or exon 12 of PGRN. In some
cases, a PGRN nucleic acid can include a PGRN exon, a PGRN intron,
a PGRN 5' UTR, a PGRN 3' UTR, and a PGRN promoter sequence as well
as sequences encompassing 4 kb, 3 kb, 2 kb, 1 kb, 0.8 kb, 0.5 kb,
0.3 kb, or 0.1 kb upstream of the transcription start site for PGRN
mRNA expression and 4 kb, 3 kb, 2 kb, 1 kb, 0.8 kb, 0.5 kb, 0.3 kb,
or 0.1 kb downstream of the transcription termination site for PGRN
mRNA expression. Examples of PGRN nucleic acid include, without
limitation, the nucleic acid sequence set forth in SEQ ID NO:2 and
the nucleic acid sequence set forth in GenBank.RTM. Accession
Number M75161 (GI:183612).
[0057] The methods and materials provided herein can be used to
determine whether or not a PGRN nucleic acid of a mammal (e.g.,
human) contains a mutation or combination of mutations (e.g., one
or more mutations identified herein). In some cases, the methods
and materials provided herein can be used to determine whether both
alleles containing PGRN nucleic acid of a mammal contain one or
more mutations in PGRN nucleic acid (e.g., either the same
mutation(s) in both alleles, or separate mutations in each allele),
or whether only a single allele containing PGRN nucleic acid of the
mammal contains one or more PGRN mutations. The identification of
one or more PGRN mutations (e.g., one or more mutations listed in
Table 1) in an allele can be used to diagnose dementia in a mammal,
typically when known clinical symptoms of a neurological disorder
also are present. The identification of a PGRN mutation in only one
allele can indicate that the mammal is a carrier.
[0058] A mutant PGRN nucleic acid is any PGRN nucleic acid
containing a mutation as compared to a wild type PGRN nucleic acid
for a particular species. For example, a mutant human PGRN nucleic
acid can be a nucleic acid having the nucleotide sequence set forth
in SEQ ID NO:2 provided that the sequence contains at least one
mutation. The term "mutation" as used herein with respect to
nucleic acid includes insertions of one or more nucleotides,
deletions of one or more nucleotides, nucleotide substitutions, and
combinations thereof, including mutations that occur in coding and
non-coding regions (e.g., exons, introns, untranslated sequences,
sequences upstream of the transcription start site of PGRN mRNA,
and sequences downstream of the transcription termination site of
PGRN mRNA). For example, a mutation in a PGRN nucleic acid can
cause decreased PGRN expression (e.g., due to nonsense-mediated
PGRN mRNA decay). In some cases, a mutation in a PGRN nucleic acid
can result in premature termination of the coding sequence through
the introduction of a stop codon. In some cases, a mutation can be
a frame-shift mutation. For example, a nucleic acid can contain a
mutation (e.g., an insertion or deletion) that shifts the reading
frame such that the encoded polypeptide starts with the amino acid
sequence of a PGRN polypeptide and then switches to an amino acid
sequence that is different from that found in a PGRN polypeptide.
In some cases, a mutation in a PGRN nucleic acid can cause
mis-folding or aberrant processing of the encoded polypeptide.
Examples of mutations in PGRN nucleic acid include, without
limitation, the mutations listed in Table 1. Nucleotides are
referred to herein by the standard one-letter designation (A, C, G,
or T). Other mutations in PGRN nucleic acid can be identified as
described herein. In some cases, a mutation in a non-coding region
of a PGRN nucleic acid that may not cause dementia, be linked to
dementia, or be responsible for reduced PGRN polypeptide levels can
co-segregate with one or more mutations that do cause dementia,
that are linked to dementia, or that result in reduced PGRN
polypeptide levels. It will be appreciated that such co-segregating
mutations can be used as markers for one or more mutations that do
cause dementia, that are linked to dementia, or that result in
reduced PGRN polypeptide levels.
[0059] A mutant PGRN polypeptide is any PGRN polypeptide containing
a mutation as compared to a wild type PGRN polypeptide for a
particular species. For example, a mutant human PGRN polypeptide
can be a polypeptide having the amino acid sequence set forth in
SEQ ID NO:1 provided that the sequence contains at least one
mutation. In some cases, a mutant PGRN polypeptide can be a
polypeptide that contains fewer amino acids than a wild type PGRN
polypeptide for a particular species (e.g., a truncated PGRN
polypeptide), or a polypeptide that contains at least one amino
acid that differs from a wild type PGRN polypeptide for a
particular species.
TABLE-US-00001 TABLE 1 PGRN mutations linked to dementia, FTLD, AD,
PD, and ALS Mutation Mutation Mutation (cDNA).sup.1 (genomic
DNA).sup.2 (Polypeptide).sup.3 c.-8 + 3A > T (IVS0 + 3A > T)
g.-3828A > T p.0 c.-8 + 5G > C (IVS0 + 5G > C) g.-3826G
> C p.0 c.2T > C g.2T > C p.0 c.3G > A g.3G > A p.0
c.26C > A g.26C > A p.A9D c.63_64insC g.63_64insC p.Asp22fs
c.90_91insCTGC g.90_91insCTGC p.Cys31fs c.102delC g.102delC
p.Gly35fs c.138 + 1G > A (IVS1 + 1G > A) g.139G > A p.0
c.154delA g.277delA p.Thr52fs c.234_235delAG g.357_358delAG
p.Gly79fs c.347C > A g.585C > A p.Ser116X c.361delG
g.1075delG p.Val121fs C.373C > T g.1087C > T p.Gln125X
c.380_381delCT g.1094_1095delCT p.Pro127fs c.384_387delTAGT
g.1098_1101delTAGT p.Gln130fs c.388_391delCAGT g.1102_1105delCAGT
p.Gln130fs c.415T > C g.1129T > C p.Cys139Arg c.463 - 1G >
A (IVS4 - 1G > A) g.1277G > A p.Ala155fs c.468_474delCTGCTGT
g.1283_1289delCTGCTGT p.Cys157fs c.472_496dup g.1287_1311dup
p.Pro166fs c.675_676delCA g.1603_1604delCA p.Ser226fs c.708 + 1G
> C (IVS6 + 1G > C) g.1637G > C p.Val200fs c.708 + 6_708 +
9delTGAG g.1642_1645delTGAG p.Val200fs (predicted) (IVS6 + 6_ +
9delTGAG) c.743C > T g.1907C > T p.Pro248Leu c.759_760delTG
g.1923_1924delTG p.Cys253X c.835_835 + 1insCTGA g.1999_2000insCTGA
p.Ala237fs c.836 - 1G > C (IVS7 - 1G > C) g.2198G > C
p.Val279fs c.911G > A g.2274G > A p.Trp304X c.910_911insTG
g.2273_2274insTG p.Trp304fs c.933 + 1G > A (IVS8 + 1G > A)
g.2297G > A p.Val279fs c.942C > A g.2394C > A p.Cys314X
c.998delG g.2450delG p.Gly333fs c.1095_1096delCT g.2547_2548delCT
p.Cys366fs c.1145delC g.2597delC p.Thr382fs c.1157G > A g.2609G
> A p.Trp386X c.1201C > T g.2872C > T p.Gln401X
c.1232_1233insGT g.2903_2904insGT p.Ala412fs c.1243C > T g.2914C
> T p.Gln415X c.1252C > T g.2923C > T p.Arg418X c.1294C
> T g.2965C > T p.Arg432Cys c.1354delG g.3025delG p.Val452fs
c.1395_1396insC g.3066_3067insC p.Cys466fs c.1402C > T g.3073C
> T p.Gln468fs c.1414 - 2A > G g.3175A > G
p.Ala472_491Lysdel (IVS10 - 2 A > G) c.1477C > T g.3240C >
T p.Arg493X c.1414 - 15_1590del g.3162_3354del p.Ala472_Gln548del
(IVS10 - 15_EX11 + 177del; .DELTA.11) Control Predicted Predicted
Patients individuals Clinical Pathological Genome.sup.4 RNA.sup.5
polypeptide.sup.6 N N (%) diagnosis diagnosis PGRN null mutations
in FTLD g.96241G > C -- p.0 1 0 FTD FTLD-U g.96241G > C --
p.0 1 0 FTD FTLD-U g.96241G > C -- p.0 1 0 FTLD (FTD) FTLD-U
g.96241G > C -- p.0 1 0 PPA/FTLD (FTD) g.96241G > C -- p.0 1
0 FTD FTLD-U g.96241G > C -- p.0 1 0 FTD FTLD-U g.96241G > C
-- p.0 1 0 FTLD (PPA) FTLD-U g.96241G > C -- p.0 1 0 FTD:PNFA
g.100069G > A c.3G > A p.Met1? 1 0 FTLD (FTD) g.101160_101
c.380_381 p.Pro127Arg 1 0 FTD:PNFA 161delCT delCT fsX2 g.102065_102
c.709_835 p.Ala237Trp 1 0 FTD FTLD-U 066insCTGA del fsX4 PGRN
missense mutations in FTLD g.103031C > T c.1294C > T
p.Arg432Cys 1 0 FTLD (FTD) PGRN 5' regulatory region variations in
FTLD g.96172G > T -- -- 1 0 FTD FTLD-U g.96282G > T -- -- 1 0
FTLD (possible FTD) g.96425C > T -- -- 1 0 FTLD (FTD) PGRN null
mutations in AD g.96241G > C -- p.0 2 0 probable AD g.103432C
> T c.1690C > T p.Arg535X 1 0 probable AD PGRN missense
mutations in AD g.100165C > A c.99C > A p.Asp33Glu 1 0
probable AD g.101195T > C c.415T > C p.Cys139Arg 1 0 probable
AD g.102488G > A c.970G > A p.Ala324Thr 1 0 probable AD
g.103089C > T c.1352C > T p.Pro451Leu 1 0 probable AD
g.103369G > A c.1540G > A p.Val514Met 1 0 probable AD
g.103373G > C c.1544G > C p.Gly515Ala 2 0 probable AD
g.103608C > T c.1690 > T p.Arg564Cys 1 0 probable AD PGRN
regulatory region variations in AD g.95991C > T -- -- 1 0
probable AD g.96135C > T -- -- 1 0 probable AD g.96188T > G
-- -- 1 0 probable AD g.96282G > T -- -- 1 0 probable AD
g.96385G > A -- -- 1 0 probable AD g.96425C > T -- -- 1 0
probable AD g.96906A > C -- -- 1 0 probable AD g.103941delT
c.2023delT -- 1 0 possible AD g.103976G > A c.2058G > A -- 1
0 probable AD PGRN null mutations in PD g.96241G > C -- p.0 1 0
PD/FTD FTLD-U/ diffuse LBD PGRN missense mutations in PD g.100165C
> A c.99C > A p.Asp33Glu 1 0 PD g.102488G > A c.970G >
A p.Ala324Thr 1 0 PD g.103369G > A c.1540G > A p.Val514Met 1
0 PD PGRN 5' regulatory region variations in PD g.96282G > T --
-- 2 0 PD g.96707G > A -- -- 1 ? PD PGRN missense mutations in
ALS g.100633G > A c.329G > A p.Arg110Gln 1 0 ALS g.101151T
> C c.371T > C p.Ile124Thr 1 0 ALS g.102488G > A c.970G
> A p.Ala324Thr 2 0 ALS g.102990G > A c.1253G > A
p.Arg418Gln 1 0 ALS PGRN 5' regulatory region variations in ALS
g.96061A > G -- -- 1 0 ALS .sup.1Numbering relative to GenBank
.RTM. accession number NM_02087.2 (GI: 60498993) and starting at
the translation initiation codon, which is nucleotide position 220.
.sup.2Numbering according to the reverse complement of GenBank
.RTM. accession number AC003043.1 (GI: 117414200) with 1 as
nucleotide 100067. .sup.3Numbering according to GenPept .RTM.
accession number NP_002078.1 (GI: 4504151). Exon numbering starts
with non-coding first exon EX 0; .sup.4Numbering relative to the
reverse complement of GenBank .RTM. Accession Number AC003043 and
starting at nt 1; .sup.5Numbering according to the largest PGRN
transcript (GenBank .RTM. Accession Number NM_002087.2) and
starting at the translation initiation codon; .sup.6Numbering
according to the largest PGRN isoform (GenPept .RTM. accession
Number NP_002078.1). FTLD: frontotemporal lobar degeneration; FTD:
frontotemporal dementia; PPA: primary progressive aphasia; PNFA:
progressive non-fluent aphasia; FTLD-U frontotemporal lobar
degeneration with ubiquitin positive inclusions; AD: Alzheimer's
Disease; MCI: mild cognitive impairment; PD: Parkinson's Disease;
DLB: dementia with Lewy bodies; LBD: Lewy body disease
[0060] Any appropriate method can be used to detect a mutation in
PGRN nucleic acid. For example, mutations can be detected by
sequencing cDNA, exons, introns, or untranslated sequences,
denaturing high performance liquid chromatography (DHPLC; Underhill
et al., Genome Res., 7:996-1005 (1997)), allele-specific
hybridization (Stoneking et al., Am. J. Hum. Genet., 48:370-382
(1991); and Prince et al., Genome Res., 11(1):152-162 (2001)),
allele-specific restriction digests, mutation specific polymerase
chain reactions, single-stranded conformational polymorphism
detection (Schafer et al., Nat. Biotechnol., 15:33-39 (1998)),
infrared matrix-assisted laser desorption/ionization mass
spectrometry (WO 99/57318), and combinations of such methods.
[0061] In some cases, genomic DNA can be used to detect one or more
mutations in PGRN nucleic acid. Genomic DNA typically is extracted
from a biological sample such as a peripheral blood sample, but can
be extracted from other biological samples, including tissues
(e.g., mucosal scrapings of the lining of the mouth or from renal
or hepatic tissue). Any appropriate method can be used to extract
genomic DNA from a blood or tissue sample, including, for example,
phenol extraction. In some cases, genomic DNA can be extracted with
kits such as the QIAamp.RTM. Tissue Kit (Qiagen, Chatsworth,
Calif.), the Wizard.RTM. Genomic DNA purification kit (Promega,
Madison, Wis.), the Puregene DNA Isolation System (Gentra Systems,
Minneapolis, Minn.), or the A.S.A.P.3 Genomic DNA isolation kit
(Boehringer Mannheim, Indianapolis, Ind.).
[0062] An amplification step can be performed before proceeding
with the detection method. For example, exons or introns of a PGRN
nucleic acid can be amplified and then directly sequenced. Dye
primer sequencing can be used to increase the accuracy of detecting
heterozygous samples.
[0063] Mutations in PGRN nucleic acid can be detected by, for
example, DHPLC analysis of PGRN nucleic acid. Genomic DNA can be
isolated from a mammal (e.g., a human), and sequences from one or
more regions of a PGRN nucleic acid can be amplified (e.g., by PCR)
using pairs of oligonucleotide primers. The primer pairs listed in
Table 2, for example, can be used to amplify sequences of human
PGRN nucleic acid. After amplification, PCR products can be
denatured and reannealed, such that an allele containing a mutation
can reanneal with a wild-type allele to form a heteroduplex (i.e.,
a double-stranded nucleic acid with a mismatch at one or more
positions). The reannealed products then can be subjected to DHPLC,
which detects heteroduplexes based on their altered melting
temperatures, as compared to homoduplexes that do not contain
mismatches. Samples containing heteroduplexes can be sequenced by
standard methods to identify mutant nucleotides. Examples of
specific PGRN mutations are provided in Table 1.
[0064] Allele specific hybridization also can be used to detect
mutations in PGRN nucleic acid, including complete haplotypes of a
mammal. For example, samples of DNA or RNA from one or more mammals
can be amplified using pairs of primers, and the resulting
amplification products can be immobilized on a substrate (e.g., in
discrete regions). Hybridization conditions can be selected such
that a nucleic acid probe specifically binds to the sequence of
interest, e.g., a PGRN nucleic acid containing a particular
mutation. Such hybridizations typically are performed under high
stringency, as some nucleotide mutations include only a single
nucleotide difference. High stringency conditions can include the
use of low ionic strength solutions and high temperatures for
washing. For example, nucleic acid molecules can be hybridized at
42.degree. C. in 2.times.SSC (0.3 M NaCl/0.03 M sodium citrate/0.1%
sodium dodecyl sulfate (SDS)) and washed in 0.1.times.SSC (0.015 M
NaCl/0.0015 M sodium citrate) with 0.1% SDS at 65.degree. C.
Hybridization conditions can be adjusted to account for unique
features of the nucleic acid molecule, including length and
sequence composition. Probes can be labeled (e.g., fluorescently)
to facilitate detection. In some cases, one of the primers used in
the amplification reaction can be biotinylated (e.g., 5' end of
reverse primer), and the resulting biotinylated amplification
product can be immobilized on an avidin or streptavidin coated
substrate.
[0065] Allele-specific restriction digests can be performed in the
following manner. For mutations that introduce a restriction site
into PGRN nucleic acid, a restriction digest with the particular
restriction enzyme can differentiate alleles. Other methods also
can be used to detect PGRN mutations. For example, conventional and
field-inversion electrophoresis can be used to visualize base pair
changes. In addition, Southern blotting and hybridization can be
used to detect larger rearrangements such as large deletions (e.g.,
74.3 kb, 69.1 kb, 62.9 kb, 29.6 kb, 11.5 kb, or 3.6 kb) and
insertions. In some cases, quantitative PCR analysis of the genomic
copy number for PGRN exons (e.g., all PGRN exons) can be used to
detect deletion or duplication mutations in PGRN nucleic acid.
[0066] A mutation in PGRN nucleic acid of a mammal also can be
detected by analyzing a PGRN polypeptide in a sample from a mammal
Any appropriate method can be used to analyze PGRN polypeptides
including, without limitation, immunological methods,
chromatographic methods, and spectroscopic methods. For example, a
mutation in PGRN nucleic acid that results in expression of a
mutant PGRN polypeptide can be detected in a sample from a mammal
using an antibody that recognizes the mutant PGRN polypeptide but
not wild-type PGRN polypeptide. Such an antibody can, for example,
recognize a truncated PGRN polypeptide, or a mutant PGRN
polypeptide, that differs from a wild-type PGRN polypeptide by one
or more amino acid residues, without recognizing a wild-type PGRN
polypeptide. A mutation in PGRN nucleic acid that results in
expression of a truncated PGRN polypeptide also can be detected
using an antibody that recognizes the truncated PGRN polypeptide as
well as wild-type PGRN polypeptide. For example, such an antibody
can be used to analyze PGRN polypeptides in a sample from a mammal
by Western blotting, which can allow truncated and wild-type PGRN
polypeptides to be distinguished by size. Any appropriate sample
from a mammal can be used to analyze a PGRN polypeptide including,
without limitation, a sample of peripheral blood lymphocytes.
[0067] As described herein, the presence of PGRN nucleic acid
containing one or more mutations (e.g., one or more mutations
listed in Table 1) in a mammal (e.g., human) can indicate that that
mammal has dementia. In some cases, the presence of PGRN nucleic
acid containing one or more mutations in a human can indicate that
that human has dementia, especially when that human is between the
ages of 35 and 75, has a family history of dementia, and/or
presents symptoms of dementia. Symptoms of dementia can include
changes in behavior such as changes that result in impulsive,
repetitive, compulsive, or even criminal behavior. For example,
changes in dietary habits and personal hygiene can be symptoms of
dementia. Symptoms of dementia also can include language
dysfunction, which can present as problems in expression of
language, such as problems using the correct words, naming objects,
or expressing oneself. Difficulties reading and writing can also
develop. In some cases, the presence of PGRN nucleic acid
containing one or more mutations in a mammal, together with
positive results of other diagnostic tests, can indicate that the
mammal has dementia. For example, the presence of a mutation in
PGRN nucleic acid together with results from a neurological exam,
neurophysical testing, cognitive testing, and/or brain imaging can
indicate that a mammal has dementia. Other diagnostic tests can
include, without limitation, tests for mutations in MAPT and/or
apolipoprotein E (APOE) nucleic acid. In some cases, the presence
of PGRN nucleic acid containing one or more mutations in a mammal
can indicate that the mammal has neuropathy (e.g., ub-ir lentiform
neuronal intranuclear inclusions (NII) in the neocortex and
striatum, moderate to severe superficial laminar spongiosis in the
neocortex, chronic degenerative changes in the neocortex, ub-ir
neurites in the neocortex, well-defined ub-ir neuronal cytoplasmic
inclusions (NCI) in the neocortex, numerous ub-ir neurites in the
striatum, NCI in the hippocampus with a granular appearance, or any
combination thereof; Mackenzie et al., Brain, 129(Pt 11):3081-90
(2006)).
[0068] In some cases, any mammal containing a mutation in PGRN
nucleic acid can be classified as having an elevated risk of
developing dementia. For example, a human having one or more than
one mutation in PGRN nucleic acid (e.g., one or more than one
mutation set forth in Table 1) can be classified as having an
elevated risk of developing dementia when the human is any age
(e.g., less than 65, 60, 55, 50, 45, 40, or 35 years old), does or
does not appear to have symptoms of dementia, or has or has not had
a positive or negative diagnostic test for dementia. In some cases,
a human having one or more mutations in PGRN nucleic acid can be
classified as having an elevated risk of developing dementia when
the human also has one or more mutations in MAPT or APOE nucleic
acid and is less than, for example, 35 years old or does not appear
to have symptoms of dementia.
[0069] In addition to providing methods and materials for
identifying mammals as having dementia, or as having an elevated
risk of developing dementia, by analyzing a PGRN nucleic acid or a
PGRN polypeptide for mutations, this document provides methods and
materials for identifying mammals as having dementia, or as having
an elevated risk of developing dementia, by measuring a level of
PGRN expression (e.g., a level of PGRN RNA or PGRN polypeptide).
For example, a mammal identified as having a reduced level of PGRN
expression can be identified as having dementia or can be
identified as having an elevated risk of developing dementia. The
level of PGRN expression in a sample (e.g., blood sample, plasma
sample, cerebral spinal fluid sample, or tissue biopsy sample such
as a skin biopsy) from a mammal can be determined by measuring the
level of a wild-type PGRN polypeptide, a mutant PGRN polypeptide,
or any fragment of a wild type or mutant PGRN polypeptide. Examples
of wild-type PGRN polypeptides include, without limitation, a human
PGRN polypeptide having the amino acid sequence set forth in SEQ ID
NO:1. In some cases, the level of PGRN expression can be determined
by measuring the level of RNA encoding a wild-type PGRN
polypeptide, a mutant PGRN polypeptide, or a fragment of a wild
type or mutant PGRN polypeptide.
[0070] A level of PGRN expression (e.g., a level of wild-type PGRN
RNA or polypeptide) can be reduced due to a mutation in a PGRN
nucleic acid that results in little or no expression of PGRN RNA or
PGRN polypeptide. In some cases, a level of PGRN expression can be
reduced due to a mutation in a PGRN nucleic acid that results in
expression of a mutant PGRN mRNA that is susceptible to nonsense
mediated decay. In some cases, a level of wild-type PGRN
polypeptide expression can be reduced due to a mutation in a PGRN
nucleic acid that results in expression of a mutant PGRN
polypeptide. The presence of such a mutation in only one PGRN
allele can result in a level of wild-type PGRN polypeptide that is
intermediate between the level of wild-type PGRN polypeptide
typically observed when both PGRN alleles are wild-type and the
level typically observed when both alleles contain the
mutation.
[0071] The term "reduced level" as used herein with respect to a
level of PGRN expression is any level of PGRN expression that is
less than a median level of wild-type PGRN polypeptide or PGRN RNA
expression in a random population of mammals (e.g., a random
population of 10, 20, 30, 40, 50, 100, 500, 1000 or more mammals)
having homozygous wild-type PGRN alleles. In some cases, a "reduced
level" of PGRN expression can be any level of wild-type PGRN
polypeptide or PGRN RNA expression that is less than a median level
of wild-type PGRN polypeptide or RNA expression, respectively, in a
random population of mammals (e.g., a random population of 10, 20,
30, 40, 50, 100, 500, 1000 or more mammals) not having been
diagnosed with dementia. In some cases, a reduced level of PGRN
expression can be a level of wild-type PGRN expression that is at
least one (e.g., at least 1.0, 1.2, 1.4, 1.6, 1.8, 2.0, or 2.2)
standard deviation less than a mean level of wild-type PGRN
expression in a random population of mammals (e.g., having
homozygous wild-type PGRN alleles and/or not having been diagnosed
with dementia).
[0072] In some cases, a reduced level of PGRN expression can be a
level of wild-type PGRN expression that is less than a median level
of wild-type PGRN expression in a random population of mammals
(e.g., a random population of 10, 20, 30, 40, 50, 100, 500, 1000 or
more mammals) that are age-matched and/or, in the case of humans,
who are race-matched to the mammal being evaluated. Mammals that
are age-matched can be the same age or can be in the same age range
(e.g., 15 to 35 years of age, 35 to 75 years of age, 75 to 100
years of age, 35 to 45 years of age, 60 to 80 years of age, 20 to
35 years of age, or 40 to 50 years of age). In some case, a reduced
level of PGRN expression can be a level of wild-type PGRN
expression that is less than a median level of wild-type PGRN
expression in a random population of mammals (e.g., a random
population of 10, 20, 30, 40, 50, 100, 500, 1000 or more mammals)
having homozygous wild-type PGRN alleles that are age-matched
and/or, in the case of humans, who are race-matched to the mammal
being evaluated. In some cases, a reduced level of PGRN expression
can be little or no detectable wild-type PGRN expression.
[0073] It will be appreciated that PGRN expression levels from
comparable samples (e.g., blood samples) are used when determining
whether or not a particular PGRN expression level is a reduced
level. For example, an mRNA level of PGRN expression in a skin
biopsy from a particular species of mammal is compared to the
median mRNA level of PGRN expression in skin biopsies from a random
population of mammals (e.g., having homozygous wild-type PGRN
alleles and/or not having been diagnosed with dementia) of the same
species. In addition, PGRN expression levels are compared to a
median PGRN expression level measured using the same or a
comparable method.
[0074] Any appropriate method can be used to determine a PGRN
expression level. For example, Northern blotting, RT-PCR, or
quantitative PCR can be used to determine a level of RNA molecules
encoding a wild-type PGRN polypeptide. In some cases, mass
spectrometry can be used to determine a level of a wild-type PGRN
polypeptide. In some cases, a level of PGRN polypeptide can be
detected using a method that relies on an anti-PGRN polypeptide
antibody. Such methods include, without limitation, FACS, Western
blotting, ELISA, immunohistochemistry, and immunoprecipitation.
Antibody based assays (e.g., sandwich enzyme-linked immunosorbent
assays) can include using combinations of antibodies that bind to
one or more sites of the amino-terminal, central, and
carboxy-terminal portions of a PGRN polypeptide or a fragment
thereof. An anti-PGRN polypeptide antibody can be labeled for
detection. For example, an anti-PGRN polypeptide antibody can be
labeled with a radioactive molecule, a fluorescent molecule, or a
bioluminescent molecule. PGRN polypeptides can also be detected
indirectly using a labeled antibody that binds to an anti-PGRN
polypeptide antibody that binds to a PGRN polypeptide.
[0075] An antibody can be, without limitation, a polyclonal,
monoclonal, human, humanized, chimeric, or single-chain antibody,
or an antibody fragment having binding activity, such as a Fab
fragment, F(ab') fragment, Fd fragment, fragment produced by a Fab
expression library, fragment comprising a VL or VH domain, or
epitope binding fragment of any of the above. An antibody can be of
any type (e.g., IgG, IgM, IgD, IgA or IgY), class (e.g., IgG1,
IgG4, or IgA2), or subclass. In addition, an antibody can be from
any animal including birds and mammals. For example, an antibody
can be a human, rabbit, sheep, or goat antibody. An antibody can be
naturally occurring, recombinant, or synthetic. Antibodies can be
generated and purified using any suitable methods known in the art.
For example, monoclonal antibodies can be prepared using hybridoma,
recombinant, or phage display technology, or a combination of such
techniques. In some cases, antibody fragments can be produced
synthetically or recombinantly from a gene encoding the partial
antibody sequence. An anti-PGRN polypeptide antibody can bind to a
PGRN polypeptide at an affinity of at least 10.sup.4 mol.sup.-1
(e.g., at least 10.sup.5, 10.sup.6, 10.sup.7, 10.sup.8, 10.sup.9,
10.sup.10, 10.sup.11 or 10.sup.12 mol.sup.-1).
[0076] An anti-PGRN polypeptide antibody provided herein can be
prepared using any appropriate method. For example, any
substantially pure PGRN polypeptide, or fragment thereof (e.g., a
truncated PGRN polypeptide encoded by a PGRN nucleic acid
containing a mutation), can be used as an immunogen to elicit an
immune response in an animal such that specific antibodies are
produced. Thus, a human PGRN polypeptide or a fragment thereof can
be used as an immunizing antigen. In addition, the immunogen used
to immunize an animal can be chemically synthesized or derived from
translated cDNA. Further, the immunogen can be conjugated to a
carrier polypeptide, if desired. Commonly used carriers that are
chemically coupled to an immunizing polypeptide include, without
limitation, keyhole limpet hemocyanin (KLH), thyroglobulin, bovine
serum albumin (BSA), and tetanus toxoid.
[0077] The preparation of polyclonal antibodies is well-known to
those skilled in the art. See, e.g., Green et al., Production of
Polyclonal Antisera, in IMMUNOCHEMICAL PROTOCOLS (Manson, ed.),
pages 1-5 (Humana Press 1992) and Coligan et al., Production of
Polyclonal Antisera in Rabbits, Rats, Mice and Hamsters, in CURRENT
PROTOCOLS IN IMMUNOLOGY, section 2.4.1 (1992). In addition, those
of skill in the art will know of various techniques common in the
immunology arts for purification and concentration of polyclonal
antibodies, as well as monoclonal antibodies (Coligan, et al., Unit
9, CURRENT PROTOCOLS IN IMMUNOLOGY, Wiley Interscience, 1994).
[0078] The preparation of monoclonal antibodies also is well-known
to those skilled in the art. See, e.g., Kohler & Milstein,
Nature 256:495 (1975); Coligan et al., sections 2.5.1 2.6.7; and
Harlow et al., ANTIBODIES: A LABORATORY MANUAL, page 726 (Cold
Spring Harbor Pub. 1988). Briefly, monoclonal antibodies can be
obtained by injecting mice with a composition comprising an
antigen, verifying the presence of antibody production by analyzing
a serum sample, removing the spleen to obtain B lymphocytes, fusing
the B lymphocytes with myeloma cells to produce hybridomas, cloning
the hybridomas, selecting positive clones that produce antibodies
to the antigen, and isolating the antibodies from the hybridoma
cultures. Monoclonal antibodies can be isolated and purified from
hybridoma cultures by a variety of well established techniques.
Such isolation techniques include affinity chromatography with
Protein A Sepharose, size exclusion chromatography, and ion
exchange chromatography. See, e.g., Coligan et al., sections 2.7.1
2.7.12 and sections 2.9.1 2.9.3; Barnes et al., Purification of
Immunoglobulin G (IgG), in METHODS IN MOLECULAR BIOLOGY, Vol. 10,
pages 79-104 (Humana Press 1992).
[0079] Once hybridoma clones that produce antibodies to an antigen
of interest (e.g., a PGRN polypeptide containing a mutation) have
been selected, further selection can be performed for clones that
produce antibodies having a particular specificity. For example,
clones can be selected that produce antibodies that preferentially
bind to a PGRN polypeptide that is truncated versus a PGRN
polypeptide that is a full-length, wild type polypeptide. Such
antibodies can recognize epitopes that are exposed in the truncated
region of the PGRN polypeptide, for example, but that are not
accessible in the full-length, wild type polypeptide. In some
cases, a hybridoma clone can be selected that produces antibodies
that bind to a PGRN polypeptide differing from a corresponding
wild-type PGRN polypeptide by one or more amino acids with a higher
affinity than the affinity of binding to a wild-type PGRN
polypeptide.
[0080] The antibodies provided herein can be substantially pure.
The term "substantially pure" as used herein with reference to an
antibody means the antibody is substantially free of other
polypeptides, lipids, carbohydrates, and nucleic acid with which it
is naturally associated in nature. Thus, a substantially pure
antibody is any antibody that is removed from its natural
environment and is at least 60 percent pure. A substantially pure
antibody can be at least about 65, 70, 75, 80, 85, 90, 95, or 99
percent pure.
[0081] This document also provides kits that can be used to perform
a method provided herein (e.g., to determine whether or not a PGRN
nucleic acid contains a mutation). Such kits can include nucleic
acid molecules (e.g., primer pairs or probes), antibodies (e.g.,
anti-PGRN polypeptide antibodies), secondary antibodies, control
nucleic acid molecules (e.g., PGRN nucleic acids that do or do not
contain a mutation), control polypeptides (e.g., wild type or
mutant PGRN polypeptides), DNA aptamers, microarrays, ELISA plates,
or data analysis software optionally together with any other
appropriate reagent, tool, or instruction for performing the
methods described herein. Appropriate informational material can be
descriptive, instructional, marketing or other material that
relates to the methods described herein and/or the use of the
reagents for the methods described herein. For example, the
informational material can relate to performing a genetic analysis
on a human and subsequently diagnosing the human as being at risk
(or not) for dementia, and/or delivering a prognosis of the human
relating to survival time, likelihood of responding to therapy, or
quality of life. In addition, or in an alternative, the
informational material of a kit can be contact information, e.g., a
physical address, email address, website, or telephone number,
where a user of the kit can obtain substantive information about
performing a genetic analysis and interpreting the results,
particularly as they apply to a human's likelihood of developing
dementia and a subsequent prognosis.
[0082] The informational material of the kits can be in any form.
In many cases, the informational material, e.g., instructions, can
be provided in printed matter, e.g., a printed text, drawing,
and/or photograph, e.g., a label or printed sheet. Informational
material can be provided in other formats, such as Braille,
computer readable material, video recording, or audio recording.
Informational material can also be provided in any combination of
formats.
[0083] The kit can include one or more containers for the reagents
for performing a genetic analysis, such as reagents for performing
PCR, FISH, CGH, or any other method described herein. The kit can
contain separate containers, dividers, or compartments for the
reagents and informational material. A container can be labeled for
use for the diagnosis and/or prognosis of a human relating to the
development and treatment of dementia.
[0084] This document also provides methods and materials to assist
medical or research professionals in determining whether or not a
mammal has a mutation in a PGRN nucleic acid. Medical professionals
can be, for example, doctors, nurses, medical laboratory
technologists, and pharmacists. Research professionals can be, for
example, principle investigators, research technicians,
postdoctoral trainees, and graduate students. A professional can be
assisted by (1) determining the presence or absence of a mutation
in a PGRN nucleic acid in a sample, and (2) communicating
information about the presence or absence of that mutation to that
professional.
[0085] Any appropriate method can be used to communicate
information to another person (e.g., a professional). For example,
information can be given directly or indirectly to a professional.
In addition, any type of communication can be used to communicate
the information. For example, mail, e-mail, telephone, and
face-to-face interactions can be used. The information also can be
communicated to a professional by making that information
electronically available to the professional. For example, the
information can be communicated to a professional by placing the
information on a computer database such that the professional can
access the information. In addition, the information can be
communicated to a hospital, clinic, or research facility serving as
an agent for the professional.
[0086] This document also provides isolated nucleic acids having a
nucleotide sequence of at least about 20 contiguous nucleotides
(e.g., at least about 20, 25, 30, 40, 50, 75, 100, 150, 300, 500,
or more nucleotides) from a PGRN nucleic acid (e.g., a PGRN nucleic
acid having the nucleic acid sequence set forth in SEQ ID NO:2). In
some cases, an isolated nucleic acid provided herein can have a
nucleotide sequence of at least about 20 contiguous nucleotides
(e.g., at least about 20, 25, 30, 40, 50, 75, 100, 150, 300, 500,
or more nucleotides) from a PGRN nucleic acid having the nucleic
acid sequence set forth in SEQ ID NO:2 while having one or more
(e.g., two, three, four, five, six, seven, eight, nine, ten, or
more) mutations as compared to the nucleic acid sequence set forth
in SEQ ID NO:2. Such mutations can be as set forth in Table 1. For
example, an isolated nucleic acid can contain 30 nucleotides of
human PGRN nucleic acid with one of the mutations set forth in
Table 1. In some cases, a PGRN nucleic acid provided herein can
contain a mutation that results in expression of a truncated
polypeptide. In some cases, a PGRN nucleic acid provided herein can
contain a mutation that prevents splicing out of the first intron
of a PGRN nucleic acid, intron 0, causing nuclear retention and
degradation of the mutant transcript. In some cases, a PGRN nucleic
acid provided herein can contain a mutation that prevents or
reduces transcription of PGRN nucleic acid.
[0087] The term "isolated" as used herein with reference to nucleic
acid refers to a naturally-occurring nucleic acid that is not
immediately contiguous with both of the sequences with which it is
immediately contiguous (one on the 5' end and one on the 3' end) in
the naturally-occurring genome of the organism from which it is
derived. For example, an isolated nucleic acid can be, without
limitation, a recombinant DNA molecule of any length, provided one
of the nucleic acid sequences normally found immediately flanking
that recombinant DNA molecule in a naturally-occurring genome is
removed or absent. Thus, an isolated nucleic acid includes, without
limitation, a recombinant DNA that exists as a separate molecule
(e.g., a cDNA or a genomic DNA fragment produced by PCR or
restriction endonuclease treatment) independent of other sequences
as well as recombinant DNA that is incorporated into a vector, an
autonomously replicating plasmid, a virus (e.g., a retrovirus,
adenovirus, or herpes virus), or into the genomic DNA of a
prokaryote or eukaryote. In addition, an isolated nucleic acid can
include a recombinant DNA molecule that is part of a hybrid or
fusion nucleic acid sequence.
[0088] The term "isolated" as used herein with reference to nucleic
acid also includes any non-naturally-occurring nucleic acid since
non-naturally-occurring nucleic acid sequences are not found in
nature and do not have immediately contiguous sequences in a
naturally-occurring genome. For example, non-naturally-occurring
nucleic acid such as an engineered nucleic acid is considered to be
isolated nucleic acid. Engineered nucleic acid can be made using
common molecular cloning or chemical nucleic acid synthesis
techniques. Isolated non-naturally-occurring nucleic acid can be
independent of other sequences, or incorporated into a vector, an
autonomously replicating plasmid, a virus (e.g., a retrovirus,
adenovirus, or herpes virus), or the genomic DNA of a prokaryote or
eukaryote. In addition, a non-naturally-occurring nucleic acid can
include a nucleic acid molecule that is part of a hybrid or fusion
nucleic acid sequence.
[0089] It will be apparent to those of skill in the art that a
nucleic acid existing among hundreds to millions of other nucleic
acid molecules within, for example, cDNA or genomic libraries, or
gel slices containing a genomic DNA restriction digest is not to be
considered an isolated nucleic acid.
[0090] Typically, isolated nucleic acids provided herein are at
least about 20 nucleotides in length. For example, a nucleic acid
can be about 20-30 (e.g., 20, 21, 22, 23, 24, 25, 26, 27, 28, 29,
or 30 nucleotides in length), 20-50, 50-100, or greater than 100
nucleotides in length (e.g., greater than 150, 200, 250, 300, 350,
400, 450, 500, 750, or 1000 nucleotides in length). Isolated
nucleic acids provided herein can be in a sense or antisense
orientation, can be single-stranded or double-stranded, can be
complementary to a PGRN nucleic acid sequence (e.g., SEQ ID NO:2),
and can be DNA, RNA, or nucleic acid analogs. Nucleic acid analogs
can be modified at the base moiety, sugar moiety, or phosphate
backbone to improve, for example, stability, hybridization, or
solubility of the nucleic acid.
[0091] Isolated nucleic acids can be produced by standard
techniques, including, without limitation, common molecular cloning
and chemical nucleic acid synthesis techniques. For example,
polymerase chain reaction techniques can be used to obtain an
isolated nucleic acid containing a fragment of PGRN nucleic acid
with one or more mutations.
[0092] Isolated nucleic acids provided herein can be used for
diagnostic purposes. For example, an isolated nucleic acid
comprising a portion of a PGRN nucleic acid (e.g., a PCR amplicon
comprising one or more than one mutation provided herein) can be
used in DHPLC or allele specific hybridization analyses. An
isolated nucleic acid containing a mutation also can be used in the
form of a PCR primer that is about 20 nucleotides in length to
amplify a region of a PGRN nucleic acid containing the mutation. In
addition, an isolated nucleic acid containing a mutation can be
labeled (e.g., with a fluorescent label) and used to detect a PGRN
nucleic acid containing the mutation.
[0093] An isolated nucleic acid provided herein also can be used to
produce an immunogen to elicit an immune response in an animal such
that specific antibodies are produced. For example, a PGRN nucleic
acid containing a mutation that results in expression of a
truncated PGRN polypeptide can be cloned into an expression vector,
and the vector can be transfected into cells (e.g., insect cells or
bacterial cells) to express the truncated polypeptide. The
truncated polypeptide can then be purified from cell extracts and
used to immunize animals such as rabbits. Serum from the animals
can then be screened for polyclonal antibodies, and monoclonal
antibodies can be obtained as described herein.
[0094] This document also provides methods and materials related to
treating mammals (e.g., humans) having or being likely to develop
(e.g., having an elevated risk of developing) a neurodegenerative
disorder such as dementia. A mammal can be identified as having or
being likely to develop a neurodegenerative disorder (e.g.,
frontotemporal dementia) if it is determined that the mammal
contains a PGRN nucleic acid having one or more mutations such as
the mutations described herein. A neurodegenerative disorder can be
any condition in which neurons are damaged. Examples of
neurodegenerative disorders include, without limitation,
Alzheimer's disease, dementia, frontotemporal dementia (FTD),
frontotemporal lobar degeneration (FTLD), Parkinson's disease,
Huntington's disease, stroke, and motor neuron disease.
[0095] As described herein, a mammal identified as having or being
susceptible to developing a neurodegenerative disorder can be
treated by administering a nucleic acid encoding a PGRN polypeptide
to the mammal such that the level of a PGRN polypeptide in the
mammal is increased. In addition, a mammal identified as having or
being susceptible to developing a neurodegenerative disorder can be
treated using an agent that increases a PGRN polypeptide level in
the mammal, a combination of agents that increase the level of a
PGRN polypeptide, or a combination of nucleic acid encoding a PGRN
polypeptide and one or more agents that increase the level of a
PGRN polypeptide.
[0096] The level of a PGRN polypeptide can be increased in a mammal
having or being susceptible to developing a neurodegenerative
disorder by administering a nucleic acid encoding a PGRN
polypeptide to the mammal Such a nucleic acid can encode a
full-length PGRN polypeptide such as a human PGRN polypeptide
having the amino acid sequence set forth in SEQ ID NO:1, or a
biologically active fragment of a PGRN polypeptide (e.g., granulin
A (SEQ ID NO:81), granulin B (SEQ ID NO:80), granulin C (SEQ ID
NO:82), granulin D (SEQ ID NO:83), granulin E (SEQ ID NO:84),
granulin F (SEQ ID NO:79), granulin G (SEQ ID NO:78), or granulin P
(SEQ ID NO:77)). A nucleic acid encoding a PGRN polypeptide can be
administered to a mammal using any appropriate method. For example,
a nucleic acid can be administered to a mammal using a vector such
as a viral vector.
[0097] Vectors for administering nucleic acids (e.g., a nucleic
acid encoding a PGRN polypeptide) to a mammal are known in the art
and can be prepared using standard materials (e.g., packaging cell
lines, helper viruses, and vector constructs). See, for example,
Gene Therapy Protocols (Methods in Molecular Medicine), edited by
Jeffrey R. Morgan, Humana Press, Totowa, N.J. (2002) and Viral
Vectors for Gene Therapy: Methods and Protocols, edited by Curtis
A. Machida, Humana Press, Totowa, N.J. (2003). Virus-based nucleic
acid delivery vectors are typically derived from animal viruses,
such as adenoviruses, adeno-associated viruses, retroviruses,
lentiviruses, vaccinia viruses, herpes viruses, and papilloma
viruses.
[0098] Lentiviruses are a genus of retroviruses that can be used to
infect neuronal cells and non-dividing cells. Adenoviruses contain
a linear double-stranded DNA genome that can be engineered to
inactivate the ability of the virus to replicate in the normal
lytic life cycle. Adenoviruses can be used to infect dividing and
non-dividing cells. Adenoviral vectors can be introduced and
efficiently expressed in cerebrospinal fluid and in brain.
Adeno-associated viruses also can be used to infect non-dividing
cells. Muscle cells and neurons can be efficient targets for
nucleic acid delivery by adeno-associated viruses. Additional
examples of viruses that can be used as viral vectors include
herpes simplex virus type 1 (HSV-1). HSV-1 can be used as a
neuronal gene delivery vector to establish a lifelong latent
infection in neurons. HSV-1 can package large amounts of foreign
DNA (up to about 30-40 kb). The HSV latency-associated promoter can
be used to allow high levels of expression of nucleic acids during
periods of viral latency.
[0099] Vectors for nucleic acid delivery can be genetically
modified such that the pathogenicity of the virus is altered or
removed. The genome of a virus can be modified to increase
infectivity and/or to accommodate packaging of a nucleic acid, such
as a nucleic acid encoding a PGRN polypeptide. A viral vector can
be replication-competent or replication-defective, and can contain
fewer viral genes than a corresponding wild-type virus or no viral
genes at all.
[0100] In addition to nucleic acid encoding a PGRN polypeptide, a
viral vector can contain regulatory elements operably linked to a
nucleic acid encoding a PGRN polypeptide. Such regulatory elements
can include promoter sequences, enhancer sequences, response
elements, signal peptides, internal ribosome entry sequences,
polyadenylation signals, terminators, or inducible elements that
modulate expression (e.g., transcription or translation) of a
nucleic acid. The choice of element(s) that may be included in a
viral vector depends on several factors, including, without
limitation, inducibility, targeting, and the level of expression
desired. For example, a promoter can be included in a viral vector
to facilitate transcription of a nucleic acid encoding a PGRN
polypeptide. A promoter can be constitutive or inducible (e.g., in
the presence of tetracycline), and can affect the expression of a
nucleic acid encoding a PGRN polypeptide in a general or
tissue-specific manner. Tissue-specific promoters include, without
limitation, enolase promoter, prion protein (PrP) promoter, and
tyrosine hydroxylase promoter.
[0101] As used herein, "operably linked" refers to positioning of a
regulatory element in a vector relative to a nucleic acid in such a
way as to permit or facilitate expression of the encoded
polypeptide. For example, a viral vector can contain a
neuronal-specific enolase promoter and a nucleic acid encoding a
PGRN polypeptide. In this case, the enolase promoter is operably
linked to a nucleic acid encoding a PGRN polypeptide such that it
drives transcription in neuronal tissues.
[0102] A nucleic acid encoding a PGRN polypeptide also can be
administered to a mammal using non-viral vectors. Methods of using
non-viral vectors for nucleic acid delivery are known to those of
ordinary skill in the art. See, for example, Gene Therapy Protocols
(Methods in Molecular Medicine), edited by Jeffrey R. Morgan,
Humana Press, Totowa, N.J. (2002). For example, a nucleic acid
encoding a PGRN polypeptide can be administered to a mammal by
direct injection of nucleic acid molecules (e.g., plasmids)
comprising nucleic acid encoding a PGRN polypeptide, or by
administering nucleic acid molecules complexed with lipids,
polymers, or nanospheres.
[0103] A nucleic acid encoding a PGRN polypeptide can be produced
by standard techniques, including, without limitation, common
molecular cloning, polymerase chain reaction (PCR), chemical
nucleic acid synthesis techniques, and combinations of such
techniques. For example PCR or RT-PCR can be used with
oligonucleotide primers designed to amplify nucleic acid (e.g.,
genomic DNA or RNA) encoding a PGRN polypeptide.
[0104] In some cases, a nucleic acid encoding a PGRN polypeptide
can be isolated from a healthy mammal, a mammal having a
neurodegenerative disorder, or a mammal being susceptible to
developing a neurodegenerative disorder. For example, a nucleic
acid that encodes a wild type PGRN polypeptide such as a PGRN
polypeptide having the amino acid sequence set forth in SEQ ID NO:1
can be isolated from a mammal that is homozygous or heterozygous
for such a nucleic acid. The isolated nucleic acid can then be used
to generate a viral vector, for example, which can be administered
to a mammal so that the level of a PGRN polypeptide in the mammal
is increased. In some cases, a nucleic acid encoding a PGRN
polypeptide containing one or more mutations can be isolated from a
mammal, and the one or more mutations can be altered by
site-directed mutagenesis to remove the mutations prior to
administering the nucleic acid to a mammal.
[0105] This document also provides methods and materials for
treating a mammal having or being susceptible to developing a
neurodegenerative disorder using an agent that increases the level
of a PGRN polypeptide. Any appropriate agent that increases the
level of any PGRN polypeptide can be used to treat a mammal having
or being likely to develop a neurodegenerative disorder. Suitable
agents include chemical compounds, mixtures of chemical compounds,
polypeptides, lipids, carbohydrates, amino acid analogs, nucleic
acid analogs, and extracts isolated from bacterial, plant, fungal,
or animal matter. Examples of agents that can increase PGRN
polypeptide levels in mammals include estrogen, 17.beta.-estradiol
(E2), ethinyl estradiol, androgen, testosterone propionate,
endothelin (ET-1), lysophosphatidic acid (LPA), and cAMP (Lu and
Serrero, Proc Natl Acad Sci USA, 97(8):3993-8 (2000); Lu and
Serrero, Biochem Biophys Res Commun, 256(1):204-7 (1999); Jones et
al., J Soc Gynecol Investig, 13(4):304-11 (2006); Lee et al., J
Reprod Dev (2006); Ong et al., Am J Physiol Regul Integr Comp
Physiol, 291(6):R1602-12 (2006); Lu and Serrero, Proc Natl Acad Sci
USA, 98(1):142-7 (2001); Suzuki et al., Physiol Behav, 68(5):707-13
(2000); Suzuki and Nishiahara, Mol Genet Metab, 75(1):31-7 (2002);
Suzuki et al., Neurosci Lett, 297(3):199-202 (2001); Suzuki et al.,
Neurosci Lett, 242(3):127-30 (1998); Wang et al., Clin Cancer Res,
12(1):49-56 (2006); Kamrava et al., Oncogene, 24(47):7084-93
(2005)). In some cases, an agent that can increase PGRN polypeptide
levels in mammals can be an agent that can increase the activity of
the Golgi apparatus in mammalian cells.
[0106] Agents that can increase PGRN polypeptide levels in mammals
also include non-steroidal anti-inflammatory drugs (NSAID), NSAID
derivatives, and NSAID analogs that target (e.g., inhibit)
cyclooxygenase enzymes. For example, agents that can increase PGRN
polypeptide levels in mammals include aryl propionic acid
derivatives, aryl acetic acid derivatives, and amino carboxylic
acid derivatives. In some cases, an agent that can increase PGRN
polypeptide levels can be ibuprofen, flufenamic acid, indomethacin,
diclofenac, naproxen, or a salicylate such as aspirin.
[0107] An agent that can increase PGRN polypeptide levels can be an
agent that activates a PPAR.alpha., PPAR.beta.(also called
PPAR.delta.), and/or a PPAR.gamma. receptor (Heneka et al., Brain,
128:1442-1453 (2005)). A variety of PPAR agonists that are specific
for PPAR.alpha., PPAR.beta., and PPAR.gamma. receptor subtypes have
been reported. Examples of such agents include, without limitation,
PPAR.alpha. fibrate compounds (e.g., gemfibrozil, clofibrate,
fenofibrate, and GW7647), PPAR.gamma. compounds such as
thiazolidinediones (e.g., rosiglitazone, pioglitazone,
troglitazone, ciglitazone, and GW1929), PPAR.delta. agonists such
as L-165,041 and GW501516, and pan-PPAR agonists such as
LY171883.
[0108] Agents that can increase PGRN polypeptide levels can be
natural or synthesized molecules that can alter the activity of
cellular components in the PPAR receptor pathway. Such agents can,
for example, increase activation of PPAR receptors, either directly
or indirectly through PPAR agonists. In some cases, agents can
increase PGRN polypeptide levels by increasing a level of one or
more PPAR receptor subtypes. In some cases, agents can increase
PGRN polypeptide levels by serving as a PPAR receptor co-factor, or
by altering the activity of a PPAR receptor co-factor. Examples of
agents that can affect PPAR activity include compounds such as
retinoic acid and vitamin A (a retinoic acid precursor), and
polypeptide co-factors such as PPAR.gamma. co-activator 1 alpha
(PCG-1.alpha.) and PPAR.gamma. co-activator 1.beta. (PCG-1.beta.;
Finck and Kelly, J Clin Invest, 116:615-622 (2006)). Without being
bound by any particular mechanism of action, agents such as
retinoic acid and vitamin A can potentiate PPAR activity by binding
to and activating retinoic-acid activated receptors (e.g., RAR and
RXR), which can heterodimerize with PPAR receptors to promote their
activity. In some cases, expression of PCG-1.alpha. or PCG-1.beta.
can be increased to enhance expression of PPAR targets such as a
PGRN polypeptide. Co-factor activity can be upregulated by
administering a pharmacological agent or a nucleic acid. For
example, a viral vector, such as an adeno-associated virus or a
lentivirus vector described herein, containing a sequence encoding
a PPAR receptor or PPAR receptor co-activator, can be used to
overexpress the receptor or co-activator by administering (e.g.,
through injection) recombinant viral particles to a mammal. In some
cases, PGRN polypeptide levels can be increased in mammals by
direct administration of PGRN polypeptides (e.g., one or more
biologically active PGRN polypeptide fragments or synthetic PGRN
polypeptides). For example, a mammal (e.g., a human) having a
neurodegenerative disorder or having an elevated risk for
developing a neurodegenerative disorder can be treated with PGRN
polypeptides or a cocktail of different PGRN polypeptides. Such a
cocktail can include two or more of the following: a PGRN
polypeptide having the amino acid sequence set forth in SEQ ID
NO:1, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, SEQ ID NO:80, SEQ
ID NO:81, SEQ ID NO:82, SEQ ID NO:83, or SEQ ID NO:84.
[0109] Agents that can increase PGRN polypeptide levels can be
natural products or can be derived or synthesized from existing
compounds. For example, agents that can increase PGRN polypeptide
levels can be derived from natural or synthetic product libraries
where compounds from these products are known to have activity
against peroxisome proliferation activating receptor pathways.
These products may activate PPAR receptors, or may increase the
expression of one or more PPAR receptors. Examples of natural
products that can activate PPAR receptors or increase their
expression include curcuminoids and sesquiterpenoids in turmeric,
omega-3 fatty acids, resveratrol and anthocyanins in grape extract,
ginsenoside from ginseng, extract of Salacia oblonga root, extracts
of Alisma plantago aquatica (ze xie/european waterplantain),
extract of Catharanthus roseus (madagascar periwinkle), extract of
Acorns calamus (sweet calamus), extract of Euphorbia balsamifera
(balsam spurge), extract of Jatropha curcas (barbados nut), extract
of Origanum majorana (marjoram), extract of Zea mays (corn silk),
extract of Capsicum frutescens (chili), extract of Australian
Clematis species (Ranunculaceae), and extract of Urtica dioica
(stinging nettle). See, for example, Rau et al., Pharmazie,
61:952-956 (2006); Lee et al., Biochem Biophys Res Commun,
339:196-203 (2006); Li et al., J Ethnopharmacol, 104:138-143
(2006); Nishiyama et al., J Agric Food Chem, 53:959-963 (2005);
Huang et al., Toxicol Appl Pharmacol, 210:78-85 (2006); Xia et al.,
J Biol Chem, 280:36792-36801 (2005); Ulrich et al., Cancer Res,
66:7348-7354 (2006).
[0110] Agents that can increase PGRN polypeptide levels can be
obtained from any appropriate commercial source. For example,
agents such as PPAR activators, NSAIDs, NSAID derivatives, NSAID
analogues, 17.beta.-estradiol (E2), lysophosphatidic acid, ET-1,
cAMP, and various analogues thereof can be obtained from
Sigma-Aldrich (Saint Louis, Mo.), Calbiochem (San Diego, Calif.),
Biomol (Plymouth Meeting, Pa.), Cayman Chemical (Ann Arbor, Mich.),
MP Biomedicals (Solon, Ohio), or through the Chemnavigator website.
Agents that can increase PGRN polypeptide levels also can be
chemically synthesized using methods that are known to those of
skill in the art. For example, NSAIDs, NSAID derivatives, and NSAID
analogues can be chemically synthesized using standard methods.
Agents that can increase PGRN polypeptide levels also can be
designed using in silico models and the chemical structures of
other agents that increase PGRN polypeptide levels. Agents
identified as having the ability to increase the level of PGRN
polypeptide in cells can be optimized for properties such as
potency, selectivity, and pharmacokinetic properties, e.g., by
synthesizing variations of the agents using methods known to those
of skill in the art. For example, NSAIDs, NSAID derivatives, and
NSAID analogues having altered potency for COX-1 and COX-2
receptors can be synthesized.
[0111] Agents that can increase the level of a PGRN polypeptide in
cells can be identified by screening candidate agents (e.g., from
synthetic compound libraries and/or natural product libraries).
Candidate agents can be obtained from any commercial source and can
be chemically synthesized using methods that are known to those of
skill in the art. Candidate agents can be screened and
characterized using in vitro cell-based assays, cell free assays,
and/or in vivo animal models.
[0112] For example, cell cultures can be contacted with various
amounts of a candidate agent (e.g., a synthetic or natural agent,
an extract containing a natural agent, or an active fraction of
such an extract). Prior to contacting cells with a candidate agent,
the candidate agent can be dissolved in a suitable vehicle for in
vitro cell culture studies such as water, dimethyl sulfoxide,
ethanol, or ethyl acetate. The level of a PGRN polypeptide, which
can be the level of a PGRN polypeptide having the amino acid
sequence set forth in SEQ ID NO:1 or a fragment thereof (or any
combination thereof), in the cells or secreted from the cells can
be monitored to determine whether or not treatment with the
candidate agent causes an increase in the level of a PGRN
polypeptide. For example, the level of PGRN polypeptide in cultured
cells treated with a candidate agent can be compared with the level
of PGRN polypeptide in untreated cells or cells treated with
vehicle alone, and comparisons can be made at different time
points. The effective concentration(s) of the candidate agent also
can be determined. An effective concentration of agent can be a
concentration that increases the level of PGRN polypeptide in or
secreted from a cell by at least 10% (e.g., at least 20%, 25%, 30%,
40%, 50%, 60%, 70%, 80%, or 90%) compared to the corresponding
level in or secreted from a cell not treated with the agent.
[0113] PGRN polypeptide levels can be detected using any standard
antibody based assays such as immunoprecipitation, western
hybridization, and sandwich enzyme-linked immunosorbent assays
(ELISA). Antibody based assays can utilize combinations of
antibodies that bind to one or more sites of the amino-terminal,
central, and carboxy-terminal portions of PGRN polypeptides or
fragments thereof. Different PGRN polypeptide forms also can be
detected by mass spectrometry. The level of a PGRN polypeptide also
can be determined by measuring PGRN RNA using any appropriate
method such as northern blotting, quantitative RT-PCR, microarray
analysis, or in situ hybridization.
[0114] In some cases, candidate agents for increasing the level of
a PGRN polypeptide can be identified and/or characterized using
cells such as lymphoblasts from a mammal having or being likely to
develop a neurodegenerative disorder. In some cases, cells in which
a nucleic acid encoding a PGRN polypeptide is expressed (e.g.,
overexpressed) or in which a nucleic acid encoding a PGRN
polypeptide is underexpressed can be used to identify or
characterize agents that can increase a PGRN polypeptide level. For
example, a vector containing a nucleic acid encoding a PGRN
polypeptide (e.g., a human PGRN polypeptide having the amino acid
sequence set forth in SEQ ID NO:1 with or without a mutation) can
be used to stably or transiently express the polypeptides in cells
(e.g., human cells or non-human mammalian cells that do or do not
normally express a PGRN polypeptide), and the cells can then be
used to identify and characterize agents that can increase the
level of a PGRN polypeptide. In some cases, a vector containing a
nucleic acid encoding an interfering RNA targeted to a nucleic acid
encoding a PGRN polypeptide, or to a regulatory region of a nucleic
acid encoding a PGRN polypeptide, can be used to decrease the level
of expression of a nucleic acid encoding a PGRN polypeptide in
cells. Cells in which a PGRN polypeptide is underexpressed can be
used to identify and characterize agents that can increase the
level of a PGRN polypeptide.
[0115] Any appropriate cell type can be used to identify or
characterize agents that can increase the level of a PGRN
polypeptide. For example, mammalian cells such as Chinese hamster
ovary (CHO) cells, fibroblast cells, neuronal cells, lymphoblast
cells, or neuroglioma cells can be used. A mammalian cell can be
one that does or that does not naturally produce, process, or
catabolize a PGRN polypeptide.
[0116] Examples of vectors that can be used to express or inhibit
expression of a nucleic acid encoding a PGRN polypeptide in cells
include, without limitation, non-viral vectors and viral vectors
such as adeno-associated virus and lentivirus vectors. For example,
a nucleic acid encoding a mouse PGRN polypeptide having the amino
acid sequence set forth in GenBank.RTM. under GI number 6680107 can
be cloned into the multiple cloning site (MCS) of the pAAV NEW
vector. A helper AAV system, of any described serotype, can be used
to package the pAAV vector, and a sufficient titer of infectious
particles can be used to transduce cells with the nucleic acid
encoding the PGRN polypeptide. In some cases, a biological tag that
does not interfere with the biological activity of a PGRN
polypeptide can be added to the amino- or carboxy-terminus of the
polypeptide to monitor expression of the transgene. Examples of
commonly used tags include myc, polyhistidine, FLAG, and GFP.
[0117] An agent that can increase the level of a PGRN polypeptide
can exert an effect at any of a number of steps along the PGRN
pathway. The level of PGRN polypeptide can depend not only on its
production, but also on the mechanisms responsible for its removal.
Without being bound by a particular mechanism, increases in the
level of PGRN polypeptide can be due to the activity of binding
polypeptides that sequester a PGRN polypeptide, or to other
cellular mechanisms such as increased transcription, increased
translation, increased secretion, or decreased catabolism of a PGRN
polypeptide. By way of example, the level of a PGRN polypeptide can
involve both intracellular (e.g., acting at the site of PGRN
polypeptide generation and/or within the secretory pathway) and
extracellular (e.g., cell-surface, secreted, endosomal and/or
lysosomal) protease mediated degradation.
[0118] An agent that can increase the level of a PGRN polypeptide
also can be identified and characterized using a cell free assay.
For example, a cell free assay can be used to identify and
characterize agents that can alter PGRN polypeptide processing
(e.g., processing of a PGRN polypeptide into various forms, such as
a biologically active fragment) or catabolism. Such a cell free
assay can be performed using a purified or partially purified
enzyme preparation or a lysate from cells able to catabolize PGRN
polypeptides or process PGRN polypeptides into fragments. Cell
lysates can be prepared using known methods such as, for example,
sonication or detergent-based lysis. The cell-free biological
sample (e.g., enzyme preparation or cell lysate) having an activity
that can catabolize a PGRN polypeptide or process a PGRN
polypeptide can be incubated with substrate PGRN polypeptide under
conditions in which the substrate PGRN polypeptide is catabolized
or processed. To determine whether a candidate agent for increasing
the level of PGRN polypeptide has an effect on processing or
catabolism of a PGRN polypeptide, two reactions can be compared. In
one reaction, the candidate agent can be included in the processing
or catabolic reaction, while in a second reaction, the candidate
agent can be excluded from the processing or catabolic reaction.
Levels of polypeptides in the reaction containing the candidate
agent can be compared with the levels in the reaction that does not
contain the agent to determine if the level of a PGRN polypeptide
is increased.
[0119] Agents that can increase the level of a PGRN polypeptide
also can be identified by screening candidate agents (e.g., from
compound libraries) in non-human mammals (e.g., PGRN transgenic or
PGRN knockout non-human mammals). For example, PGRN polypeptide
levels can be assessed in a first group of such non-human mammals
in the presence of an agent, and compared with PGRN polypeptide
levels in a corresponding control group in the absence of the agent
to determine whether or not administration of the agent results in
an increase in the level of a PGRN polypeptide.
[0120] Non-human mammals include, for example, rodents such as
rats, guinea pigs, and mice, and farm animals such as pigs, sheep,
goats, horses, and cattle. Non-human mammals can be designed to
contain exogenous nucleic acid that encodes a human PGRN
polypeptide having the amino acid sequence set forth in SEQ ID NO:1
with or without a mutation. Non-human mammals also can be designed
to lack endogenous nucleic acid encoding a PGRN polypeptide or to
contain truncated or disrupted endogenous PGRN nucleic acid (e.g.,
knockout animals).
[0121] To create non-human mammals having a particular gene (e.g.,
a PGRN gene) inactivated in all cells, a knockout construct can be
introduced into the germ cells (sperm or eggs, i.e., the "germ
line") of the desired species. Nucleic acid constructs used for
producing knockout non-human mammals can include a region of an
endogenous nucleic acid that is being targeted and can also include
a nucleic acid sequence encoding a selectable marker, which is
generally used to interrupt a targeted exon site by homologous
recombination. Typically, the selectable marker is flanked by
sequences homologous to the sequences flanking the desired
insertion site. It is not necessary for the flanking sequences to
be immediately adjacent to the desired insertion site. Suitable
markers for positive drug selection include, for example, the
aminoglycoside 3N phosphotransferase gene that imparts resistance
to geneticin (G418, an aminoglycoside antibiotic), and other
antibiotic resistance markers, such as the
hygromycin-B-phosphotransferase gene that imparts hygromycin
resistance. Other selection systems include negative-selection
markers such as the thymidine kinase (TK) gene from herpes simplex
virus. Constructs utilizing both positive and negative drug
selection also can be used. For example, a construct can contain
the aminoglycoside phosphotransferase gene and the TK gene. In this
system, cells are selected that are resistant to G418 and sensitive
to gancyclovir.
[0122] An example of a targeting construct that can be used to
generate PGRN knockout animals is a construct containing a 4.8 kb
fragment of 5' homology and a 1.9 kb fragment of 3' homology
flanking a floxed neomycin resistance (NEO) gene in reverse
orientation (FIG. 9). The targeting vector can be linearized with a
Pvu I restriction digest. Homology is placed such that exons 1-3
are removed in the initial targeting and replaced with the floxed
NEO (FIG. 9). The loxP sites are placed such that the NEO cassette
can be removed, following Cre expression, if its inclusion affects
nearby genes (FIG. 9).
[0123] An example of a targeting construct that can be used to
generate conditional PGRN knockout animals is a construct
containing a floxed cassette containing 0.8 kb of coding sequence
(exons 1-3) and a neomycin resistance (NEO) gene flanked by a 4.8
kb fragment of 5' homology and a 1.9 kb fragment of 3' homology
(FIG. 8). The NEO gene can be placed in reverse orientation in the
intron downstream of Exon 3. This specific orientation can reduce
the possibility that the NEO gene within the floxed chromosome may
interfere with normal gene function or result in aberrant
transcripts that originate from the NEO start site. The location
can be desirable due to the relatively large size of the chosen
intron. The targeting vector can be linearized with a Pvu I
restriction digest. The PGRN polypeptides produced from a floxed
chromosome can be designed to be of normal composition and
functionality. The floxed exons 1-3 and neomycin cassette can be
removed following Cre-mediate recombination of the loxP sites,
leaving a partial PGRN gene which lacks a start site and is
predicted to be non-functional (FIG. 8).
[0124] Nucleic acid constructs for producing knockout non-human
mammals can be introduced into the pronuclei of fertilized eggs by
microinjection. Following pronuclear fusion, the developing embryo
may carry the introduced nucleic acid in all its somatic and germ
cells because the zygote is the mitotic progenitor of all cells in
the embryo. Since targeted insertion of a knockout construct is a
relatively rare event, it is desirable to generate and screen a
large number of animals when employing such an approach. Because of
this, it can be advantageous to work with large cell populations
and selection criteria that are characteristic of cultured cell
systems. For production of knockout animals from an initial
population of cultured cells, it is necessary that a cultured cell
containing the desired knockout construct be capable of generating
a whole animal. This is generally accomplished by placing the cell
into a developing embryo environment.
[0125] Cells capable of giving rise to at least several
differentiated cell types are "pluripotent." Pluripotent cells
capable of giving rise to all cell types of an embryo, including
germ cells, are hereinafter termed "totipotent" cells. Totipotent
murine cell lines (embryonic stem or "ES" cells) have been isolated
by culture of cells derived from very young embryos (blastocysts).
Such cells are capable, upon incorporation into an embryo, of
differentiating into all cell types, including germ cells, and can
be employed to generate animals lacking an endogenous PGRN nucleic
acid or containing a partial PGRN nucleic acid. That is, cultured
ES cells can be transformed with a knockout construct and cells can
be selected in which a PGRN nucleic acid is inactivated.
[0126] Nucleic acid constructs can be introduced into ES cells, for
example, by electroporation or other standard technique. Selected
cells can be screened for gene targeting events. For example, the
polymerase chain reaction (PCR) can be used to confirm the presence
of the transgene.
[0127] The ES cells further can be characterized to determine the
number of targeting events. For example, genomic DNA can be
harvested from ES cells and used for Southern analysis. See, for
example, Section 9.37-9.52 of Sambrook et al., Molecular Cloning, A
Laboratory Manual, second edition, Cold Spring Harbor Press,
Plainview, N.Y. (1989).
[0128] To generate a knockout animal, ES cells having at least one
inactivated PGRN allele are incorporated into a developing embryo.
This can be accomplished through injection into the blastocyst
cavity of a murine blastocyst-stage embryo, by injection into a
morula-stage embryo, by co-culture of ES cells with a morula-stage
embryo, or through fusion of the ES cell with an enucleated zygote.
The resulting embryo can be raised to sexual maturity and bred in
order to obtain animals whose cells (including germ cells) carry
the inactivated PGRN allele. If the original ES cell was
heterozygous for the inactivated PGRN allele, several of these
animals can be bred with each other to generate animals homozygous
for the inactivated allele.
[0129] Direct microinjection of DNA into eggs can be used to avoid
the manipulations required to turn a cultured cell into an animal.
Fertilized eggs are totipotent, i.e., capable of developing into an
adult without further substantive manipulation other than
implantation into a surrogate mother. To enhance the probability of
homologous recombination when eggs are directly injected with
knockout constructs, it is useful to incorporate at least about 6
kb of homologous DNA into the targeting construct. It is also
useful to prepare the knockout constructs from isogenic DNA.
[0130] Embryos derived from microinjected eggs can be screened for
homologous recombination events in several ways. For example, if a
targeted nucleic acid is interrupted by a coding region that
produces a detectable (e.g., fluorescent) gene product, then the
injected eggs can be cultured to the blastocyst stage and analyzed
for presence of the indicator polypeptide. Embryos with fluorescing
cells, for example, can then be implanted into a surrogate mother
and allowed to develop to term. Injected eggs also can be allowed
to develop, and DNA from the resulting pups can be analyzed by PCR
or RT-PCR for evidence of homologous recombination.
[0131] Nuclear transplantation also can be used to generate
non-human mammals. For example, fetal fibroblasts can be
genetically modified such that they contain an inactivated
endogenous PGRN nucleic acid, and then fused with enucleated
oocytes. After activation of the oocytes, the eggs can be cultured
to the blastocyst stage, and implanted into a recipient. See,
Cibelli et al., Science, (1998) 280:1256-1258. Adult somatic cells,
including, for example, cumulus cells and mammary cells, can be
used to produce animals such as mice and sheep, respectively. See,
for example, Wakayama et al., Nature, (1998) 394(6691):369-374; and
Wilmut et al., Nature, (1997) 385(6619):810-813. Nuclei can be
removed from genetically modified adult somatic cells, and
transplanted into enucleated oocytes. After activation, the eggs
can be cultured to the 2-8 cell stage, or to the blastocyst stage,
and implanted into a suitable recipient. Wakayama et al. 1998,
supra.
[0132] Agents that can increase the level of a PGRN polypeptide can
be identified or characterized using a non-human mammal that is the
product of a cross between any non-human mammal described herein
and any other non-human mammal of the same species. For example,
any transgenic non-human mammal can be crossed with any of the
knockout non-human mammals provided herein to create non-human
mammals that can be used to identify or characterize agents that
can increase the level of a PGRN polypeptide. A non-human mammal
obtained by crossing a transgenic non-human mammal with a knockout
non-human mammal provided herein also can be used to examine the
effects of PGRN depletion on brain function and the impact of PGRN
depletion on different neurodegenerative disease states.
[0133] In some cases, a backcross of tau transgenic (e.g., JNPL3)
mice with PGRN knockout (.sup.-/-) mice can be performed to
generate (JNPL3)(PGRN.sup.+/-) and (JNPL3)(PGRN.sup.-/-) mice for
use in determining the impact of depleting PGRN on the development
of neurodegeneration linked to tau pathology, or for use in
identifying or characterizing agents that can increase the level of
a PGRN polypeptide. The mice can be maintained on the same
background strain (e.g., C57BL/6) to minimize genetic differences.
In a first round of breeding, hemizygous JNPL mice can be bred with
PGRN null mice, resulting in 50% hemizygous (JNPL3)(PGRN.sup.+/-)
mice and 50% PGRN.sup.+/- mice. Hemizygous offspring
(JNPL3)(PGRN.sup.+/-) can be backcrossed to the PGRN.sup.-/- line,
generating 25% (JNPL3)(PGRN.sup.-/-), 25% (JNPL3)(PGRN.sup.+/-),
25% PGRN.sup.-/-, and 25% PGRN.sup.+/- mice. JNPL3 mice can also be
crossed with PGRN.sup.+/+ mice to generate (JNPL3)(PGRN.sup.+/+)
mice. Agents that can increase a PGRN polypeptide level can be
identified or characterized by administering a candidate agent or
vehicle alone to (JNPL3)(PGRN.sup.+/-) mice, (JNPL3)(PGRN.sup.-/-)
mice, and/or (JNPL3)(PGRN.sup.+/+) mice, measuring the level of a
PGRN polypeptide in each mouse, and comparing the levels to
determine whether or not administration of the candidate agent
results in an increase in a level of a PGRN polypeptide.
[0134] In some cases, PGRN.sup.-/- non-human mammals can be crossed
with transgenic non-human mammals expressing TAR DNA binding
protein 43 (TDP-43) polypeptide to generate non-human mammals
useful for studying the interaction between PGRN depletion and the
formation of neuronal polypeptide inclusions containing TDP-43
polypeptide, as observed in patients with PGRN mutations and in
patients with FTLD or ALS. Non-human mammals obtained by crossing
PGRN.sup.-/- non-human mammals with transgenic non-human mammals
expressing TDP-43 polypeptide also can be used to identify or
characterize agents that can increase PGRN polypeptide levels. In
some cases, PGRN.sup.-/- non-human mammals can be crossed with
transgenic non-human mammals expressing amyloid precursor protein
(APP; see, U.S. Pat. No. 5,877,399) to generate non-human mammals
useful for studying the impact of PGRN depletion on amyloid
deposition or for identifying or characterizing agents that can
increase the level of a PGRN polypeptide in a mammal.
[0135] In some cases, agents that can increase the level of a PGRN
polypeptide can be identified or characterized using a non-human
mammal in which expression of a nucleic acid encoding a PGRN
polypeptide is decreased using a vector such as a viral vector
described herein. For example, a viral vector containing nucleic
acid encoding an antisense or interfering RNA targeted to an
endogenous nucleic acid encoding a PGRN polypeptide or a regulatory
region of the endogenous nucleic acid can be administered to a
non-human mammal to decrease expression of a PGRN polypeptide
(e.g., by injecting a sufficient titer of recombinant viral
particles into a mammal). The non-human mammals having a decreased
level of expression of a PGRN polypeptide can be administered a
candidate agent or vehicle alone and analyzed to determine if
administration of the candidate agent results in an increase in the
level of a PGRN polypeptide. In some cases, agents that can
increase the level of a PGRN polypeptide can be identified or
characterized using a non-human mammal in which a nucleic acid
encoding a PGRN polypeptide with or without a mutation is expressed
(e.g., overexpressed). A nucleic acid encoding a PGRN polypeptide
with or without a mutation can be a transgene (e.g., in a
transgenic non-human mammal), or can be delivered to a non-human
mammal using a vector such as a viral vector described herein. For
example, a viral vector containing a nucleotide sequence encoding a
PGRN polypeptide can be used to express PGRN polypeptides (e.g., a
human PGRN polypeptide having the amino acid sequence set forth in
SEQ ID NO:1) in non-human mammals, and the non-human mammals can be
used to identify or characterize agents that can increase the level
of a PGRN polypeptide.
[0136] This document also provides non-mammalian PGRN knockout
animals. Such animals can include C. elegans and zebrafish having
at least one inactivated PGRN allele. Non-mammalian PGRN knockout
animals can be used to examine the biological effects of PGRN
depletion or to identify or characterize agents that can increase
the level of a PGRN polypeptide.
[0137] A nucleic acid encoding a PGRN polypeptide, an agent having
the ability to increase the level of a PGRN polypeptide in a
mammal, a PGRN polypeptide (e.g., a biologically active PGRN
polypeptide), or any combination thereof can be administered to a
mammal identified as having a neurodegenerative disorder in order
to reduce the severity of a symptom of the disorder or to reduce
progression of the disorder. Additional examples of treatments for
dementia that can be used in combination with the methods and
materials provided herein include, without limitation,
antipsychotics (e.g., drugs that can block the effects of
dopamine), tranquilizers, and speech therapy to adjust to language
difficulties and learn alternate ways of communicating.
[0138] A mammal that has been identified as having an elevated risk
of developing dementia can be monitored for symptoms of dementia
and can be assessed regularly for dementia using any appropriate
diagnostic method such as a method provided herein, or any
combination of methods provided herein. In addition, plans can be
made for the care of a mammal having an elevated risk of developing
dementia prior to the mammal developing dementia. A human
identified as having an elevated risk of developing dementia also
can receive counseling and can be educated about dementia. Once a
mammal having an elevated risk of developing dementia develops
symptoms of dementia, the mammal can be treated, e.g., to manage
the symptoms. In some cases, a mammal being likely to develop
dementia can be treated prophylactically, e.g., using one or more
of the treatment methods provided herein. For example, a nucleic
acid encoding a PGRN polypeptide, an agent having the ability to
increase the level of a PGRN polypeptide in a mammal, a PGRN
polypeptide (e.g., a biologically active PGRN polypeptide), or any
combination thereof can be administered to a mammal identified as
being susceptible to developing a neurodegenerative disorder in
order to prevent or delay the onset of a neurodegenerative disorder
or one or more symptoms thereof.
[0139] In some cases, a PPAR agonist, a NSAID, or any combination
thereof can be administered to a mammal having or being susceptible
to developing a neurodegenerative disorder. In some cases, a
nucleic acid encoding a PGRN polypeptide can be administered to a
mammal having a neurodegenerative disorder, or being susceptible to
developing a neurodegenerative disorder, using a viral vector. In
some cases, a nucleic acid encoding a PGRN polypeptide can be
administered to a mammal in need of treatment along with one or
more than one agent that can increase the level of a PGRN
polypeptide in mammals (e.g., a PPAR agonist and/or a NSAID). In
some cases, one or more than one agent having the ability to
increase the level of a PGRN polypeptide can be administered along
with a PGRN polypeptide to a mammal in need of treatment. In some
cases, a PGRN polypeptide (e.g., a biologically active PGRN
polypeptide) can be administered to a mammal having or being
susceptible to developing a neurodegenerative disorder.
[0140] A nucleic acid encoding a PGRN polypeptide, an agent having
the ability to increase the level of a PGRN polypeptide in a
mammal, or a PGRN polypeptide (e.g., a biologically active PGRN
polypeptide) can be administered to a mammal individually or in
combination. For example, a composition containing a combination of
agents, each of which can increase a PGRN polypeptide level, can be
administered to a mammal in need of treatment for a
neurodegenerative disorder. Such a composition can contain, without
limitation, a NSAID and a PPAR agonist. A composition containing a
combination of agents can contain additional ingredients including,
without limitation, pharmaceutically acceptable vehicles. A
pharmaceutically acceptable vehicle can be, for example, saline,
water, lactic acid, or mannitol.
[0141] Nucleic acids, agents, and PGRN polypeptides (e.g.,
biologically active PGRN polypeptides) can be administered to
mammals by any appropriate route, such as enterally (e.g., orally),
parenterally (e.g., subcutaneously, intravenously, intradermally,
intramuscularly, or intraperitoneally), intracerebrally (e.g.,
intraventricularly, intrathecally, or intracisternally) or
intranasally (e.g., by intranasal inhalation). While direct
administration into the brain of a mammal is one route of
administration, a viral vector, an agent, or a PGRN polypeptide
also can be administered, for example, intravenously, and targeted
to the brain or engineered to cross the blood-brain barrier.
[0142] Any appropriate method can be used to target a viral vector
to the brain. For example, a fiber knob of an adenovirus or an
envelope protein of a lentivirus can be modified by attaching a
ligand (e.g., an antibody or antibody fragment) that recognizes a
brain-specific or neuron-specific receptor. Methods of enhancing
transport of molecules across the blood-brain barrier can be used
and can take advantage of passive diffusion (e.g., using sodium
caprate) or receptor-mediated endocytosis (e.g., attachment of the
virus particle to, for example, an anti-transferrin antibody or to
putrescine). Expression of a viral vector carrying a nucleic acid
encoding a PGRN polypeptide also can be targeted to the brain using
a brain-specific or neuron-specific promoter and/or transcriptional
regulatory elements (see, for example, U.S. Pat. No. 5,976,872 or
U.S. Pat. No. 6,066,726). An example of a promoter that is useful
for neuronal-specific expression of a nucleic acid encoding a PGRN
polypeptide is a prion promoter.
[0143] Recombinant viruses and PGRN polypeptides can be
administered in the presence or absence of agents that stabilize
biological activity. For example, a recombinant virus or a PGRN
polypeptide can be pegylated, acetylated, or both. In some cases, a
PGRN polypeptide can be covalently attached to oligomers, such as
short, amphiphilic oligomers that enable oral administration or
improve the pharmacokinetic or pharmacodynamic profile of the
conjugated polypeptide. The oligomers can include water soluble
polyethylene glycol (PEG) and lipid soluble alkyls (short chain
fatty acid polymers). See, for example, International Patent
Application Publication No. WO 2004/047871.
[0144] A composition including a viral vector (e.g., containing a
nucleic acid encoding a PGRN polypeptide), an agent (e.g., a
candidate agent or an agent having the ability to increase the
level of a PGRN polypeptide), a PGRN polypeptide (e.g., a
biologically active PGRN polypeptide), or any combination thereof
can be prepared for parenteral or intracerebral administration in
liquid form (e.g., solutions, solvents, suspensions, and emulsions)
including sterile aqueous or non-aqueous carriers. Aqueous carriers
include, without limitation, water, alcohol, saline, and buffered
solutions. Examples of non-aqueous carriers include, without
limitation, propylene glycol, polyethylene glycol, vegetable oils,
and injectable organic esters. Preservatives and other additives
such as, for example, antimicrobials, anti-oxidants, chelating
agents, inert gases, and the like may also be present.
Pharmaceutically acceptable carriers for intravenous administration
include solutions containing pharmaceutically acceptable salts or
sugars. Agents, nucleic acids, and polypeptides also can be
prepared in solid (e.g., lyophilized) form for parenteral or
intracerebral administration following addition of any appropriate
diluent, such as a saline diluent (e.g., 0.4% or 0.9% sodium
chloride, pH 7.4).
[0145] Suitable formulations for oral administration can include
tablets or capsules prepared by conventional means with
pharmaceutically acceptable excipients such as binding agents
(e.g., pregelatinized maize starch, polyvinylpyrrolidone or
hydroxypropyl methylcellulose), fillers (e.g., lactose,
microcrystalline cellulose or calcium hydrogen phosphate),
lubricants (e.g., magnesium stearate, talc or silica),
disintegrants (e.g., potato starch or sodium starch glycolate), or
wetting agents (e.g., sodium lauryl sulfate). Tablets can be coated
by methods known in the art. Preparations for oral administration
can also be formulated to give controlled release of the agent.
[0146] Intranasal preparations can be presented in a liquid form
(e.g., nasal drops or aerosols) or as a dry product (e.g., a
powder). Both liquid and dry nasal preparations can be administered
using a suitable inhalation device. Nebulized aqueous suspensions
or solutions can also be prepared with or without a suitable pH
and/or tonicity adjustment.
[0147] A nucleic acid encoding a PGRN polypeptide, an agent having
the ability to increase the level of a PGRN polypeptide in a
mammal, a PGRN polypeptide, or any combination thereof can be
administered to a mammal in any amount, at any frequency, and for
any duration effective to achieve a desired outcome (e.g., to
reduce a symptom of a neurodegenerative disorder). In some cases, a
nucleic acid encoding a PGRN polypeptide, an agent having the
ability to increase the level of a PGRN polypeptide in a mammal, a
PGRN polypeptide, or any combination thereof can be administered to
a mammal to reduce a symptom of a neurodegenerative disorder by 5,
10, 25, 50, 75, 100, or more percent. Any appropriate method can be
used to determine whether or not a symptom of a neurodegenerative
disorder is reduced. For example, a test for cognitive impairment
(e.g., the abbreviated mental test score (AMTS) or the mini mental
state examination (MMSE)) can be used to determine whether or not a
symptom of a neurodegenerative disorder (e.g., dementia) is
reduced. In some cases, a nucleic acid encoding a PGRN polypeptide,
an agent having the ability to increase the level of a PGRN
polypeptide in a mammal, a PGRN polypeptide, or any combination
thereof can be administered to a mammal to prevent or delay the
onset of a neurodegenerative disorder. Any appropriate method can
be used to determine whether or not the onset of a
neurodegenerative disorder is prevented or delayed. For example,
the age of onset of a neurodegenerative disorder, if onset occurs
at all, can be compared to the median age of onset in mammals of
the same species and same PGRN genotype or phenotype to determine
whether or not the onset is delayed. In some cases, the age of
onset can be compared to the median age of onset in mammals of the
same species, sex, PGRN genotype, PGRN phenotype, and, in the case
of humans, race, who did not receive any treatment for a
neurodegenerative disorder prior to the onset of neurodegenerative
symptoms.
[0148] An effective amount of a nucleic acid encoding a PGRN
polypeptide, an agent having the ability to increase the level of a
PGRN polypeptide, a PGRN polypeptide (e.g., a biologically active
PGRN polypeptide), or any combination thereof can be any amount
that reduces or prevents a symptom of a neurodegenerative disorder
without producing significant toxicity to a mammal.
[0149] Typically, an effective amount of an agent can be any amount
greater than or equal to about 50 .mu.g provided that that amount
does not induce significant toxicity to the mammal upon
administration. In some cases, the effective amount of an agent or
a PGRN polypeptide can be between 100 and 500 .mu.g, between 1 mg
and 10 mg, between 5 mg and 20 mg, between 10 mg and 30 mg, between
50 mg and 100 mg, between 200 and 500 mg, between 200 and 800 mg,
or between 150 and 900 mg. In some cases, an effective amount of a
nucleic acid encoding a PGRN polypeptide can be from about 10.sup.3
to 10.sup.12 (e.g., about 10.sup.8) recombinant viral particles or
plaque forming units (pfu) containing the nucleic acid. If a
particular mammal fails to respond to a particular amount, then the
amount can be increased by, for example, two fold. After receiving
this higher concentration, the mammal can be monitored for both
responsiveness to the treatment and toxicity symptoms, and
adjustments made accordingly. The effective amount can remain
constant or can be adjusted as a sliding scale or variable dose
depending on the mammal's response to treatment (e.g., the mammal's
level of PGRN polypeptides or the mammal's cognitive state).
[0150] Various factors can influence the actual effective amount
used for a particular application. For example, the frequency of
administration, duration of treatment, use of multiple treatment
agents, route of administration, and severity of the disorder may
require an increase or decrease in the actual effective amount
administered.
[0151] The frequency of administration of a nucleic acid encoding a
PGRN polypeptide, an agent having the ability to increase the level
of a PGRN polypeptide, a PGRN polypeptide, or any combination
thereof can be any frequency that reduces or prevents a symptom of
a neurodegenerative disorder without producing significant toxicity
to the mammal. For example, the frequency of administration can be
from about three times a day to about twice a month, or from about
once a week to about once a month, or from about once every other
day to about once a week, or from about once a month to twice a
year, or from about four times a year to once every five years, or
from about once a year to once in a lifetime. The frequency of
administration can remain constant or can be variable during the
duration of treatment. For example, an agent that modulates a PGRN
polypeptide level can be administered daily, twice a day, five days
a week, or three days a week. An agent can be administered for five
days, 10 days, three weeks, four weeks, eight weeks, 48 weeks, one
year, 18 months, two years, three years, or five years. In some
cases, a viral vector can be administered as needed. A course of
treatment can include rest periods. For example, an agent can be
administered for five days followed by a nine-day rest period, and
such a regimen can be repeated multiple times. As with the
effective amount, various factors can influence the actual
frequency of administration used for a particular application. For
example, the effective amount, duration of treatment, use of
multiple treatment agents, route of administration, and severity of
disorder may require an increase or decrease in administration
frequency.
[0152] An effective duration for administering an agent provided
herein can be any duration that reduces or prevents a symptom of a
neurodegenerative disorder or achieves a particular level of PGRN
polypeptide expression without producing significant toxicity to
the mammal. Thus, the effective duration can vary from several days
to several weeks, months, or years. In general, the effective
duration for the treatment of a disorder can range in duration from
several days to several months. In some cases, an effective
duration can be for as long as an individual mammal is alive.
Multiple factors can influence the actual effective duration used
for a particular treatment. For example, an effective duration can
vary with the frequency of administration, effective amount, use of
multiple treatment agents, route of administration, and severity of
the disorder.
[0153] Before administering a nucleic acid encoding a PGRN
polypeptide, an agent having the ability to increase the level of a
PGRN polypeptide, a PGRN polypeptide, or any combination thereof to
a mammal, the mammal can be assessed to determine whether or not
the mammal has or is susceptible to developing a neurodegenerative
disorder. For example, a mammal can be assessed as described herein
to determine whether or not the mammal has a mutation (e.g., a
mutation provided herein) in a PGRN nucleic acid, or to determine
whether or not the mammal has a reduced level of PGRN RNA or
polypeptide expression. Assays described herein for detecting PGRN
RNA and polypeptide levels can be used to screen and identify
individuals that have reduced levels of PGRN expression and are at
risk for developing frontotemporal dementia or other
neurodegenerative disorders. For example, lymphoblasts of patients
with family members with frontotemporal dementia can be screened
for PGRN polypeptide levels using a single assay, such as an ELISA,
or a battery of biological assays, such as an ELISA, RT-PCR, and
western blotting. Other genetic tests also can be used to assess
mammals for neurodegenerative disorders, such as tests for
determining the presence or absence of nucleic acid encoding ApoE4
in the mammal (see, for example, U.S. Pat. No. 5,508,167).
Additional examples of diagnostic tests that can be used to assess
mammals for neurodegenerative disorders include, without
limitation, neurological exams, neurophysical testing, cognitive
testing, and brain imaging. Any appropriate combination of
diagnostic tests, such as a combination of tests described herein,
also can be used to assess a mammal for a neurodegenerative
disorder.
[0154] After administering a nucleic acid encoding a PGRN
polypeptide, an agent having the ability to increase the level of a
PGRN polypeptide, a PGRN polypeptide, or any combination thereof to
a mammal having a neurodegenerative disorder, the mammal can be
monitored to determine whether or not the disorder was treated. For
example, a mammal having a neurodegenerative disorder can be
assessed before and after treatment to determine whether or not a
symptom (e.g., cognitive impairment) of the disorder was reduced
(e.g., stopped). As described herein, any appropriate method can be
used to assess symptoms of a neurodegenerative disorder. For
example, cognitive testing can be performed before and after
treatment to determine if cognitive function increased, decreased,
or stayed the same with treatment. Imaging (e.g., MRI) also can be
performed before and after treatment to determine if the treatment
reduced progression of structural brain damage, for example. MRI
brain scans taken before and after treatment also can be used to
monitor the progression of a neurodegenerative disorder by mapping
brain volume changes. Thought, memory, daily functioning, social
conduct, social inhibitions, and/or personality of a mammal can be
observed before, during, and after treatment to determine whether
or not a symptom of a neurodegenerative order has improved or
whether progression of a symptom has been reduced.
[0155] The effectiveness of a treatment for a neurodegenerative
disorder provided herein (e.g., administration of an agent or a
nucleic acid to increase a PGRN polypeptide level) also can be
assessed by determining whether or not treatment of a mammal having
a neurodegenerative disorder resulted in an increase in a PGRN
polypeptide level in the mammal A PGRN polypeptide level can be
measured in a mammal using any appropriate method, such as a method
described herein. For example, a level of a PGRN polypeptide can be
measured in a sample of peripheral blood lymphocytes or cerebral
spinal fluid from a mammal before and after treatment for a
neurodegenerative disorder (e.g., treatment with an agent described
herein) using an ELISA assay to determine if the level increased
with treatment. Methods of monitoring the location or amount of a
viral vector in a mammal are known and can include, for example,
imaging a marker (e.g., a fluorophore), the product of a reporter
gene (e.g., GFP), or a radioisotope (e.g., .sup.99Tc) using methods
known in the art, such as PET, nuclear, MR, or optical imaging.
Levels of PGRN RNA or polypeptide can be measured in a mammal to
monitor the level of expression of a viral vector delivering
nucleic acid encoding a PGRN polypeptide.
[0156] In some cases, a mammal likely to develop a
neurodegenerative disorder can be assessed during or after
treatment with a nucleic acid encoding a PGRN polypeptide, an agent
having the ability to increase the level of a PGRN polypeptide, a
PGRN polypeptide (e.g., a biologically active PGRN polypeptide), or
any combination thereof to determine whether or not the onset of a
symptom of a neurodegenerative disorder is delayed, e.g., relative
to the mean age of onset in mammals of the same species and, for
example, the same PGRN genotype or phenotype that were not treated
prior to manifestation of a symptom of the disorder. A mammal
likely to develop a neurodegenerative disorder also can be assessed
before and after treatment to determine whether or not a level of a
PGRN polypeptide has increased in the mammal This document also
provides methods and materials for identifying agents that can be
used to treat a mammal having or being likely to develop a
neurodegenerative disorder by increasing the level of a PGRN
polypeptide in the mammal. For example, an animal model for
dementia provided herein can be used to identify agents capable of
increasing PGRN polypeptide levels. In some cases, animals
generated by crossing PGRN.sup.-/- or PGRN.sup.+/- mice with JNPL3
or rTg4510 transgenic mice (Santacruz et al., Science,
309(5733):476-81 (2005); Lewis et al., Nat Genet, 25(4):402-5
(2000)) can be used. In some cases, animals produced by crossing
PGRN.sup.-/- or PGRN.sup.+/- mice with SOD1 mice (Hall et al., J
Neurosci Res, 53(1):66-77 (1998)) can be used. In some case,
animals generated by crossing PGRN.sup.-/- or PGRN.sup.+/- mice
with triple-transgenic mice containing transgenes encoding PS1
(M146V), APP (Swe), and tau (P301L) polypeptides (Oddo et al.,
Neuron, 39(3):409-21 (2003)) can be used. Agents useful for
treating neurodegenerative disorders also can be identified using
any of the other non-human mammals described herein, or any mammals
obtained by mating and propagating such mammals. For example,
PGRN.sup.-/-, PGRN.sup.+/-, (JNPL3)(PGRN.sup.-/-), and/or
(JNPL3)(PGRN.sup.+/-) non-human mammals can be used.
[0157] Typically, non-human mammals are treated with a candidate
agent for increasing the level of a PGRN polypeptide after the
mammals have developed one or more symptoms of a neurological
disorder. Candidate agents for increasing the level of a PGRN
polypeptide can be dissolved in a suitable vehicle prior to being
administered to a non-human mammal A vehicle can be an inert
solvent in which an agent can be dissolved for administration. It
is recognized that for any given agent, a vehicle suitable for
non-human mammals may not be the same as the vehicle used for human
treatment. Some examples of suitable vehicles include water,
dimethyl sulfoxide, ethanol, and ethyl acetate. The concentration
of agent to be tested can be determined based on the type of agent
and in vitro data.
[0158] As described herein, a candidate agent can be administered
to mammals in various ways. For example, a candidate agent can be
dissolved in a suitable vehicle and administered directly using a
medicine dropper or by injection. A candidate agent also can be
administered as a component of drinking water or feed.
[0159] After treating non-human mammals with a candidate agent, one
or more symptoms of a neurodegenerative disorder manifested in the
mammals can be compared between treated and untreated mammals to
determine whether or not the agent is effective for treating a
neurodegenerative disorder (e.g., whether or not the agent reduces
the severity of a symptom of a neurodegenerative disorder). For
example, cognitive tests such as a water maze or object recognition
test can be used to compare treated and untreated non-human mammals
to determine whether or not the cognitive function of treated
mammals is improved relative to that of the untreated mammals.
[0160] The efficacy of a candidate agent also can be assessed by
comparing levels of PGRN polypeptides in plasma, CSF, and/or brain
of treated and untreated mammals. Levels of PGRN polypeptides in
plasma, cerebral spinal fluid (CSF), lymphocytes, and brain can be
determined using any appropriate method such as those described
herein. For example, levels of PGRN polypeptides can be determined
using a sandwich ELISA or mass spectrometry in combination with
internal standards or a calibration curve. Plasma and CSF can be
obtained from mammals using standard methods. For example,
lymphocytes and plasma can be obtained from blood by
centrifugation, CSF can be collected by tapping the cisterna magna,
and brain tissue can be obtained from sacrificed animals.
[0161] The invention will be further described in the following
examples, which do not limit the scope of the invention described
in the claims.
EXAMPLES
Example 1
Mutations in PGRN Cause Tau-Negative Frontotemporal Dementia Linked
to Chromosome 17
Methods
[0162] PGRN gene sequencing: Genomic DNA from members of each
studied family was isolated from whole blood or brain tissue using
standard protocols. All coding exons of the PGRN gene were
amplified by PCR using primers designed to flanking intronic
sequences (Table 2). Reactions contained each primer at a final
concentration of 0.8 .mu.M and 10% Q-solution (Qiagen, Valencia,
Calif.), and were cycled using a 58-48.degree. C. touchdown
protocol. The resulting PCR products were purified with Multiscreen
plates (Millipore, Billerica, Mass.), and sequenced in both
directions on an ABI 3730 instrument using the relevant PCR primers
and Big Dye chemistry following manufacturer's protocols (Applied
Biosystems, Foster City, Calif.).
TABLE-US-00002 TABLE 2 PGRN sequencing and PCR primer sequences SEQ
Product ID size Name Sequence NO (bp) GRN 1 F GGGCTAGGGTACTGAGTGAC
3 368 GRN 1 R AGTGTTGTGGGCCATTTG 4 GRN 2 F TGCCCAGATGGTCAGTTC 5 537
GRN 2 R GCTGCACCTGATCTTTGG 6 GRN 3 F GGCCACTCCTGCATCTTTAC 7 369 GRN
3 R TGAATGAGGGCACAAGGG 8 GRN 4&5 F TTAGTGTCACCCTCAAACC 9 587
GRN 4&5 R ACTGGAAGAGGAGCAAAC 10 GRN 6 F GGGCCTCATTGACTCCAAGTGTA
11 401 GRN 6 R GGTCTTTGTCACTTCCAGGCTCA 12 GRN 7 F
TCCCTGTGTGCTACTGAG 13 373 GRN 7 R AAGCAGAGAGGACAGGTC 14 GRN 8 F
TACCCTCCATCTTCAACAC 15 309 GRN 8 R TCACAGCACACAGCCTAG 16 GRN 9 F
ATACCTGCTGCCGTCTAC 17 457 GRN 9 R GAGGGCAGAAAGCAATAG 18 GRN 10 F
TGTCCAATCCCAGAGGTATATG 19 616 GRN 10 R ACGTTGCAGGTGTAGCCAG 20 GRN
11 F TGGACTGGAGAAGATGCC 21 574 GRN 11 R CGATCAGCACAACAGACG 22 GRN
12 F CATGATAACCAGACCTGC 23 387 GRN 12 R AGGGAGAATTTGGTTAGG 24 RNA
analysis (C31LfsX34 and R418X mutations) GRN c1F AGACCATGTGGACCCTGG
25 539 GRN c1R GTGATGCAGCGGGTGTGAACCA 26 GG GRN c10F
ATACCTGCTGCCGTCTAC 27 GRN cl0R ACGTTGCAGGTGTAGCCAG 28 589
[0163] Mutation validation and control screening: The C31LfsX34 4
by insert mutation was validated with a PCR/Genescan assay using
the FAM-labeled forward primer 5'-GGGCTAGGGTACTGAGTGA-3' (SEQ ID
NO:29), and the unlabeled reverse primer 5'-AGTGTTGTGGGCCATTTG-3'
(SEQ ID NO:30). Products run against the 400HD Rox standard
(Applied Biosystems, Foster City, Calif.) exhibited two peaks, at
368 by (wt allele) and 372 by (mutant). All available samples of
the UBC17 family and 550 North American control individuals were
then screened with the same assay. Segregation analysis in the
remaining families was carried out by sequencing of the relevant
exon in each family, in order to check occurrence of the mutations
with the disease. Sequence analysis of all PGRN coding exons was
also used to screen 200 aged North American control individuals for
all remaining mutations. Sequence analysis was also used to screen
150 Dutch and 95 UK control individuals for the Q125X (Dutch family
1083) and the Q468X (UK family F53) mutations, respectively.
[0164] Immunohistochemical methods. Immunohistochemistry was
performed on formalin fixed, paraffin-embedded tissue sections of
frontal cortex and hippocampus from two cases of familial FTD with
proven PGRN mutations (UBC-17 and UBC-15), one case of Alzheimer's
disease, and one age-matched neurologically normal control
individual. Sections (5 .mu.m) were deparaffinized and microwaved
for antigen retrieval in citrate buffer, pH 6.0. Ubiquitin
immunohistochemistry was performed using the Ventana ES automated
staining system (Ventana, Tucson, Ariz.) with an ubiquitin primary
antibody (anti-ubiquitin; DAKO, Glostrup, Denmark; 1:500) and
developed using aminoethylcarbazole. For PGRN immunohistochemistry,
sections were blocked with 2.5% horse serum (10 minutes), and
incubated for one hour at room temperature with primary antibody
(N-terminus, acrogranin N19; Santa Cruz Biotechnology, Santa Cruz,
Calif.; 1:100; C-terminus acrogranin, 5-15; Santa Cruz
Biotechnology; 1:100; anti-PCDGF; Zymed, South San Francisco,
Calif.; 1:100; entire human PGRN polypeptide, anti-human
Progranulin; R&D Systems, Minneapolis, Minn.; 1:500) diluted in
2.5% blocking serum. Sections were then incubated with 5%
biotinylated universal secondary antibody (Vector Laboratories,
Burlingame, Calif.; 10 minutes), followed by incubation with
streptavidin/peroxidase complex working solution (5 minutes), and
were developed using diaminobenzidine (5 minutes). All sections
were counterstained with Hematoxylin.
[0165] Analysis of PGRN polypeptide in lymphoblastoid cell lines:
Lymphoblastoid cells from patients and unaffected relatives were
harvested by centrifugation at 5K g for 5 minutes. Pellets were
resuspended in co-immunoprecipitation buffer (50 mM Tris-HCl pH
7.5, 100 mM NaCl, 15 mM EDTA, 0.1% Triton X-100, 1% SDS, and
protease and phosphatase inhibitors), boiled at 100.degree. C. for
5 minutes and sonicated for 15 seconds. For western blot analysis,
equal amounts of total protein (40 .mu.g) were resolved on 10%
Tris-Glycine SDS-PAGE gels (Invitrogen, Carlsbad, Calif.) and
transferred onto 0.45 .mu.m PVDF membranes. Blots were blocked in
5% non-fat milk in TBS-T, hybridized with primary antibodies to
human PGRN(N-terminus, acrogranin N-19; Santa Cruz Biotechnology;
1:200) followed by anti-goat HRP conjugated secondary antibody, and
were visualized by Western Chemiluminescent ECL reagent (Pierce,
Rockford, Ill.). PGRN levels were normalized to GAPDH (GAPDH
monoclonal; Biodesign International, Saco, Me.; 1:3000). Band
density from film exposed within linear range was measured using
the Scion Image software package (Scion Corporation, Frederick,
Md.).
[0166] Generation of R418X mutant polypeptide: Site-directed
mutagenesis was performed on a wild-type PGRN cDNA (intronless)
construct (MGC clone id 2821810; Invitrogen) using the QuikChange
Site-Directed Mutagenesis Kit (Stratagene; Agilent Technologies,
Santa Clara, Calif.) according to the supplier's instructions. The
wild-type and mutant PGRN cDNA constructs were transfected into
HeLa cells using Lipofectamine 2000 Reagent (Invitrogen). After 24
hours, cells were harvested, and protein extracts were generated as
described for the lymphoblast cells.
[0167] Analysis of PGRN RNA: RNA was isolated from lymphoblastoid
cells and brain (cerebellum) samples and analyzed by qRT-PCR using
SYBR green as described elsewhere (Oosthuyse et al., Nat. Genet.,
28:131-8 (2001)). Cerebellum was used since this region is
unaffected in FTD-17, making it less likely for neuronal loss and
microgliosis to influence PGRN RNA levels. To ensure that DNA
contamination could not contribute to the detected signal, primers
for PGRN were designed to span intron 1 (5'-GATGGTCAGTTCTGCCCTGT-3'
(forward; SEQ ID NO:31) and 5'-CCCTGAGACGGTAAAGATGC-3' (reverse;
SEQ ID NO:32); amplicon size=174 bp). Mass values for PGRN mRNA
were normalized to 28S ribosomal RNA mass values and then divided
by GAPDH mRNA to determine fold-change in expression. Values were
expressed as a percentage of control individuals. RT-PCR fragment
analysis was used to determine relative levels of mutant and
wild-type PGRN RNA in C31LfsX34 (UBC17) lymphoblasts and brain
tissue. RT-PCR was performed with 5' FAM-labeled
5'-GTGAGCTGGGTGGCCTTAAC-3' (forward; SEQ ID NO:33) and
5'-GCAGAGCAGTGGGCATCAAC-3' (reverse; SEQ ID NO:34) primers.
Amplicon sizes were analyzed on an ABI3100 (Applied Biosystems,
Foster City, Calif.). The mutant C31LfsX34 RNA generated a product
(196 bp) that was 4 by longer than wild-type RNA. Sequence analysis
of RT-PCR products (primers in Table 2) was further used to analyze
levels of C31LfsX34 and R418X mutant RNAs compared to wild-type in
relevant family brain tissues and lymphoblasts. PGRN RNA levels in
lymphoblasts from the C31LfsX34 (UBC17) and the R418X (UBC15)
families were analyzed with and without cycloheximide treatment
(500 .mu.M, 2-8 hours), a nonsense mediated decay (NMD)
inhibitor.
[0168] Isolation of detergent and formic acid soluble and insoluble
protein fractions from FTD-17 and normal brain tissue: To study the
presence and solubility of PGRN species in frozen frontal cortices
and cerebellum of patients with the R418X (UBC15) and C31LfsX34
(UBC17) mutations, brain tissue was homogenized in 1 mL/250 mg TNE
buffer (10 mM Tris-HCl pH 7.5, 150 mM NaCl, 5 mM EDTA) containing
1:100 dilutions of Protease Inhibitor Cocktail, PMSF and
Phosphatase Inhibitor Cocktails I and II (all obtained from Sigma,
Saint Louis, Mo.). Brain homogenates from an unaffected control
individual, an AD patient, and a PSP patient were included as
controls. A portion of the homogenized extracts was solubilized by
addition of 1% SDS and 15 second sonication, and was used as total
SDS-soluble proteins. The remaining homogenate was centrifuged at
100K g for 30 minutes at 4.degree. C. to obtain buffer soluble
proteins. The pellet was re-homogenized in TNE containing 0.5% NP40
and centrifuged at 100K g for 30 minutes at 4.degree. C. to obtain
detergent soluble supernatant and insoluble pellet fractions. The
pellet was further solubilized in TNE buffer containing 1% SDS and
centrifuged at 100K g for 30 minutes at 4.degree. C. Insoluble SDS
pellet was resuspended in laemmli loading buffer. Frozen frontal
cortices of patients were homogenized in 1 mL/150 mg RIPA buffer
(50 mM Tris-HCl, 150 mM NaCl, 1% Triton X-100, 0.5% deoxycholate,
and 0.1% SDS) containing protease and phosphatase inhibitors and
centrifuged at 100K g for 60 minutes at 4.degree. C. to generate
RIPA-soluble fractions. The RIPA insoluble pellets were
re-extracted with 70% formic acid, sonicated, and centrifuged at
100K g for 60 minutes at 4.degree. C. The aqueous layer was
collected, speedvaced to powder form, and resuspended in 1.times.
laemmli loading buffer. Total, detergent and formic acid (soluble
and insoluble) fractions were subsequently analyzed by western
blotting as described for lymphoblastoid cell lines.
Results
[0169] Candidate genes within the 3.53 cM (6.19 Mb) critical region
defined by haplotype analysis in reported families
(D1751787-D175806) were examined The coding exons of candidate
genes were first sequenced in affected and unaffected members of
UBC17 (Table 3), a large Canadian tau-negative FTD-17 family with
highly significant evidence for linkage to chromosome 17q21
(2-point LOD 3.65). Analysis of over 80 genes (out of .about.165 in
the region) failed to identify a pathogenic mutation. However, when
progranulin (PGRN) was sequenced, a 4 by insertion mutation was
detected in exon 1 (c.90.sub.--91insCTGC), causing a frameshift at
codon 31 that is predicted to result in truncation of the encoded
polypeptide after a read through of 34 residues (C31LfsX34). PGRN
is a 593 amino acid (68.5 kDa) multifunctional growth factor that
is composed of seven and a half tandem repeats of a 12-cysteine
granulin motif. In contrast, the mutant (C31LfsX34) PGRN
polypeptide is predicted to be only 65 residues in length,
including the signal peptide (amino acids 1-17), and is predicted
not to contain a single intact cysteinyl repeat (FIG. 1). The
C31LfsX34 mutation segregated with disease in the UBC17 family
(Table 3, FIG. 3) and was absent in 550 North American control
individuals. These results indicated that this mutation was
probably pathogenic.
TABLE-US-00003 TABLE 3 Families with premature termination
mutations in PGRN Mean Mutation Mutation Family Origin
Affecteds{circumflex over ( )} age onset nucleotide polypeptide
UBC17# Canada 17 (4) 58 c.90_91insCTGC p.C31LfsX34 1083#
Netherlands 19 (1) 65 c.373C > T p.Q125X UBC11 Canada 6 (1) 68
c.388_391delCAGT p.Gln130fsX125 F53 UK 3 (1) 60 c.388_391delCAGT
p.Gln130fsX125 UBC19 Canada 9 (1) 61 c.IVS8 + 1G > A
p.V279GfsX4* FTD129 USA 3 (2) 54 c.1145delC p.T382SfsX29 UBC4
Canada 7 (1) 65 c.1157G > A p.W386X UBC15 Canada 10 (4) 60
c.1252C > T p.R418X F337 UK 5 (1) 59 c.1402C > T p.Q468X
#families with previously published linkage to chr17. {circumflex
over ( )}NII pathology confirmed in brackets. *predicted effect of
IVS8 + 1G > A mutation.
[0170] PGRN was sequenced in affected individuals from an
additional 41 families with clinical and pathological features
consistent with tau-negative FTD. Families were ascertained in
Canada (7 families), the USA (8 families), the UK (17 families),
the Netherlands (1 family), and Scandinavia (8 families). This
analysis identified an additional seven PGRN mutations, in 8 of the
41 families (Table 3), each of which is predicted to cause
premature termination of the coding sequence (FIG. 1). These
mutations include four nonsense mutations (Q125X, W386X, R418X and
Q468X), two frameshift mutations (Q130SfsX124 and T382SfsX29), and
a mutation in the 5' splice site of exon 8 (IVS8+1G>A). The exon
8 splice site mutation (UBC19) is likely to lead to skipping of
exon 8 from PGRN mRNA, resulting in a frameshift (V279 GfsX4). The
Q130SfsX124 mutation was found in two FTD families ascertained
independently in Canada (UBC11) and the UK (F53). All seven
mutations segregated with disease in the relevant families (Table
3, FIG. 3) and were absent in 200 North American control
individuals. In addition, the Q125X mutation (Dutch family 1083)
was absent in 150 control individuals from the Netherlands, and the
Q468X mutation (UK family F337) was absent in 95 UK controls.
[0171] The two FTD families with previously reported evidence for
linkage to chromosome 17q21 (UBC17, and 1083) were both found to
have mutations that cause premature termination in PGRN (FIG. 1).
Significantly, all nine families with PGRN mutations also had
neuropathological findings that included ub-ir NII.
[0172] To investigate the pathogenic mechanism of the mutations,
immunohistochemistry was used to determine if PGRN accumulates in
the ub-ir inclusions (NCI and NII) in the brains of FTD patients
with PGRN mutations. Ubiquitin immunohistochemistry demonstrated
neurites and neuronal cytoplasmic inclusions (NCI) in layer II of
frontal neocortex, NCI in dentate granule cells of the hippocampus,
and neuronal intranuclear inclusions (NII) in superficial
neocortex. PGRN immunoreactivity was observed in a subset of
cortical neurons in patients from multiple FTD families with PGRN
mutations (UBC17, UBC15 and FTD129) as well as in aged control
subjects. PGRN immunohistochemistry was positive in some
neocortical neurons but did not stain NCI or NII in layer II
cortex. Activated microglia exhibited strong PGRN expression in
affected areas of FTD and around senile plaques in a control
patient with Alzheimer's disease. Despite using a panel of
antibodies that recognize all regions of the PGRN polypeptide, the
ub-ir NCI and NII in the FTD-17 cases were negative for PGRN.
Moreover, the truncated mutant PGRN species R418X (UBC15) and
C31LfsX34 (UBC17) were not detected in total protein extracts of
brain and lymphoblastoid cells from FTD-17 patients (FIG. 2C).
There was also no evidence that insoluble PGRN species were
accumulating in detergent or formic acid extractable fractions from
patient brain tissue. Taken together these results suggest that the
mutations are unlikely to cause aggregation of mutant or wild-type
PGRN polypeptides.
[0173] Experiments were performed to determine whether premature
termination of the PGRN coding sequence resulted in nonsense
mediated decay (NMD) of the mutant RNAs since the location of the
premature termination codon (PTC) created by each mutation was
expected to trigger NMD. Quantitative-PCR analysis of RNA extracted
from patient lymphoblasts carrying the R418X (UBC15) and C31LfsX34
(UBC17) mutations revealed that both were associated with about a
50% reduction in total PGRN RNA relative to lymphoblasts from
unaffected individuals (FIG. 2A). In addition, PGRN RNA from both
families consisted almost entirely of wild-type RNA with little of
the mutant RNAs detected (FIG. 2B). Treatment of patient
lymphoblasts with cycloheximide, a known inhibitor of NMD, resulted
in an increase in levels of total PGRN RNA (FIG. 2A) that was
associated with a selective increase in the R418X and C31LfsX34
mutant RNAs (FIG. 2B).
[0174] Similar results were obtained by sequence analysis of PGRN
RNA from lymphoblasts containing the C31LfsX34 (UBC17) and R418X
(UBC15) mutations. Sequence analysis of RT-PCR products from the
lymphoblasts revealed single peaks over the mutation sites,
indicating that the RNA consisted largely of wild-type species.
After treating the lymphoblasts with cycloheximide (500 .mu.M for
eight hours), additional sequence peaks corresponding to increased
levels of the two mutant RNA species were clearly visible,
indicating that the mutant RNAs (C31LfsX34 and R418X) are normally
subject to nonsense mediated decay. Furthermore, western blot
analysis revealed that wild-type PGRN polypeptide was reduced in
extracts from R418X and C31LfsX34 lymphoblasts (mean reduction 34%,
p=0.01, t-test) relative to extracts from unaffected relatives
(FIG. 2C). These results suggest that the observed premature
termination mutations in PGRN cause tau-negative FTD-17 by creating
null alleles, with the mutant RNAs likely being degraded by NMD.
This results in loss of functional PGRN (haploinsufficiency) and
can explain a lack of correlation between the location of the
mutations and the clinical phenotype since each of the mutations
has a similar effect, creation of a null allele.
[0175] Two additional mutations, Q415X and V452WfsX38, were
identified in PGRN genes as described above. Both mutations are
located in exon 10 of the PGRN gene, and both were found in cases
of FTLD from the UK.
[0176] Results provided herein suggest that PGRN is essential for
neuronal survival and that even partial loss of PGRN can lead to
neurodegeneration. The identification of mutations in PGRN resolves
a ten-year-old conundrum, namely the genetic basis for FTD linked
to chromosome 17, and explains why multiple families linked to this
region lack MAPT mutations. The fact that PGRN is located within 2
Mb of MAPT and yet mutations in both genes independently yield
indistinguishable clinical phenotypes is presumably an
extraordinary coincidence.
[0177] In patients with MND, probable loss-of-function mutations
were found to affect another secreted factor, angiogenin (ANG).
Tau-negative FTD and MND are closely related conditions. Up to 30%
of MND patients develop frontal lobe deficits and a similar
proportion of newly diagnosed FTD patients have findings diagnostic
or suggestive of MND. The two diseases often coexist in the same
family and both conditions have similar ub-ir pathology.
Furthermore, PGRN and ANG are both potent inducers of angiogenesis
and are linked with tumorigenesis. It appears that reduced levels
of these functionally related growth factors represent a common
mechanism of neurodegeneration in major subgroups of these two
diseases. Moreover, the results provided herein indicate that
replacement of these factors can be used as a novel therapeutic
strategy in both devastating conditions.
Example 2
Mutations in PGRN are a Cause of Ubiquitin-Positive Frontotemporal
Lobar Degeneration
Patients and Methods
[0178] FTLD patients and control series for PGRN mutation
screening: The Mayo Clinic FTLD series had 378 patients, 210
clinically diagnosed FTLD patients and 168 pathologically confirmed
FTLD patients. The mean onset age of dementia was 60.+-.11 years
(range 32-83). Among the 168 deceased patients, their mean age at
death was 70.+-.12 years (range 39-97). The main syndromic clinical
diagnoses were FTD and PPA with rare occurrences of SD, CBS and
FTD-MND. Among autopsied patients, FTLD-U was the major
neuropathological subtype (N=105, 62.5%). The overall Mayo Clinic
FTLD series had three patient subgroups: 15 FTLD patients from the
Olmsted County community-based dementia series, 167 FTLD patients
referred to NIH funded Alzheimer's disease Research Centers
(ADRC-FTLD referral series), and 196 patients ascertained from
multiple tertiary referral centers.
[0179] The Olmsted County community-based dementia series: This
series included 15 FTLD patients (7 clinical; 8 pathological) among
649 patients with clinical dementia collected in Olmsted County,
Minn., USA. This series also contained 536 patients with possible
or probable AD, 10 patients with vascular dementia, 36 patients
with Lewy-body dementia (LBD) and 52 patients with other
neurodegenerative forms of dementia. All FTLD patients (13 FTD and
2 PPA) were included in the mutation screening. The mean age at
onset in the FTLD patients was 65.+-.11 years (range 50 to 81),
mean age at death was 79.+-.12 years (range 54 to 96) and 67%
(10/15) had a family history of dementia. The diagnoses were based
on clinical findings and imaging.
[0180] The ADRC-FTLD patient referral series: This series had 167
FTLD patients ascertained by referral to five NIH ADRC-funded
centers. The mean age at onset of dementia in this series was
59.+-.10 years (range 32 to 83), and 38% had a positive family
history of dementia. Primary clinical diagnoses included FTD, PPA,
AD, CBS, FTD-MND, posterior cortical atrophy, and unspecified
dementia. Pathological examination was performed in 28 of the 167
patients and the mean age at death in this group was 71.+-.9 years
(range 39-84). The FTLD-U pathological subtype was observed in 21
patients (75%). In addition, three patients were subsequently
pathologically diagnosed with CBS, two with AD and one with
atypical progressive supranuclear palsy (PSP)/LBD. All 167 patients
included in the PGRN mutation screening received a clinical
diagnosis of FTLD.
[0181] The tertiary referral series: A total of 196 FTLD (64
clinical, 132 pathological) patients were ascertained by multiple
tertiary referral centers. The majority (N=112) of patients were
obtained through nine brain banks within the U.S. The remaining 84
FTLD patients were ascertained internationally.
[0182] Control individuals: A total of 200 control individuals
(mean age 76.+-.10 years) were ascertained through the Mayo Clinics
in Jacksonville, Fla. and Scottsdale, Ariz.
[0183] ALS patient series for PGRN mutation screening: The ALS
patient series comprised 48 patients, of which 27 were
pathologically confirmed. ALS patients were recruited through the
Neuromuscular Clinic, Mayo Clinic Jacksonville (N=17) and
internationally (N=4). Pathologically confirmed ALS patients were
obtained from the Neuropathological Core, Mayo Clinic Jacksonville
(N=17), the Harvard Brain Bank (N=6), Northwestern University
Feinberg School of Medicine (N=1) and Sun Health Research Institute
(N=3). The mean age at onset of ALS was 57 years (range 30-75) and
a family history of ALS was present in 40% of the patients.
[0184] PGRN gene sequencing: The 12 coding exons of PGRN were
amplified by PCR using primers and a protocol described elsewhere
(Baker et al., Nature, 442:916-919 (2006)). In addition, PGRN PCR
and sequencing primers were designed to amplify up to three PGRN
exons in a single fragment, allowing for higher throughput analyses
(Table 4). PCR primers flanking the non-coding exon 0 and the 3'
UTR of PGRN were also generated (Table 4). Standard 25 .mu.L PCR
reactions were performed using Qiagen PCR products with addition of
Q-solution for PGRN exons 1-3 and 7-9 (Qiagen, Valencia, Calif.)
and primers at a final concentration of 0.8 .mu.M each. The
annealing temperature for PGRN exons 1-3 and 7-9 was 66.degree. C.,
and for PGRN exons 4-6 and 10-12 was 64.degree. C. The PGRN exon 0
and 3' UTR fragments were cycled using touchdown protocols of
70-55.degree. C. and 58-48.degree. C., respectively. PCR products
were purified with Multiscreen plates (Millipore, Billerica, Mass.)
and sequenced in both directions on an ABI 3730 instrument with the
Big Dye chemistry following the manufacturer's protocol (Applied
Biosystems, Foster City, Calif.).
TABLE-US-00004 TABLE 4 PGRN sequencing and PCR primers SEQ Product
ID size Name Sequence NO (bp) GRN1-3F GATTTCTGCCTGCCTGGACAGG 35 864
GRN1-3R GATGCCACATGAATGAGGGCAC 36 GRN4-6F GTCACCCTCAAACCCCAGTAGC 37
822 GRN4-6R CATGAACCCTGCATCAGCCAGG 38 GRN7-9F
TTGCTGGGAGCCTGGCTGATGC 39 1033 GRN7-9R CTCCTGCTTACAGCACCTCCAG 40
GRN10-12F CTGACAGATTCGTCCCCAGCTG 41 1040 GRN10-12R
ACCTCCCATGGTGATGGGGAGC 42 GRNseq2-3F GGTCATCTTGGATTGGCCAGAG 43
GRNseq1-2R TCTGCAGGTGGTAGAGTGCAGG 44 GRNseq5-6F
AGGGGGTGAAGACGGAGTCAGG 45 GRNseq4-5R GAGGAGCAAACGTGAGGGGCAG 46
GRNseq8-9F TGATACCCCTGAGGGTCCCCAG 47 GRNseq7-8R
GAAGAAGGGCAGGTGGGCACTG 48 GRNseq11- GCTAAGCCCAGTGAGGGGACAG 49 12F
GRNseq10- GCCATACCCAGCCCCAGGATGG 50 11R GRN 0F
CGCCTGCAGGATGGGTTAAGG 51 507 GRN 0R GCGTCACTGCAATTACTGCTTCC 52 GRN
3'UTR AGCCAGGGGTACCAAGTGTTTG 53 558 F GRN 3'UTR
GGGGTAATGTGATACAGCCGATG 54 R
[0185] Genomic characterization of PGRN: The presence of internal
PGRN genomic insertions/deletions or rearrangements was analyzed by
long-range PCR of the complete 4 kb PGRN coding sequence in a
single fragment using the Expand Long Template PCR System kit
(Roche, Indianapolis, Ind.) and alternatively, by PCR of three
overlapping 2 kb PGRN coding sequence fragments. Long-range PCR
reactions were performed with primers GRN1-3F and GRN10-12R (Table
4) using the standard PCR protocol (buffer 1) and cycling
conditions recommended by the manufacturer of the Expand Long
Template PCR kit. A PvuII restriction enzyme digest was performed
on the 4 kb PCR product resulting in nine fragments (1463, 608,
474, 445, 275, 271, 182, 142, and 63 bp) that could be readily
sized. The smaller 2 kb PGRN coding sequence fragments that spanned
exons 1-6, exons 4-9 and exons 7-12 were amplified using the GRN
PCR primers developed for high throughput sequencing
(GRN1-3F/GRN4-6R; GRN7-9F/GRN10-12R; GRN4-6F/GRN7-9R; Table 4).
Standard 25 .mu.L PCR reactions were performed using Qiagen PCR
products with Q-solution and a 66-61.degree. C. touchdown protocol
for all primer sets and subsequent restriction enzyme digestion
with RsaI (exons 1-6: 727, 588, 467, 79, and 66 bp; exons 4-9: 823,
316, 233, 207, 153, and 90 bp; exons 7-12: 1108, 266, 207, 153,
124, 90, and 83 bp). Agarose gel electrophoresis was performed on
PvuII and RsaI digested fragments (2% gel) as well as on the
undigested (1% gel) PCR products to detect aberrant banding
patterns that might indicate the presence of a genomic abnormality.
If an aberrant pattern was detected, the PCR reaction was repeated
for confirmation, and sequencing analyses with internal PGRN
primers were performed as described above.
[0186] PGRN copy-number analyses: To detect duplication or deletion
mutations affecting the 5' or 3' end of the PGRN gene or the entire
PGRN gene, semi-quantitative assessment of genomic copy number for
exons 1 and 12 of PGRN was made relative to two endogenous genes;
glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and
.beta.-2-microglobulin (.beta.2M). Multiplexed PCR reactions
contained fluorescently labeled primers (Table 5) designed to
amplify the four products in a single reaction. This allowed
relative peak heights to be measured in a linear phase PCR.
Comparisons of peak heights of the two endogenous amplicons to each
other served as a quality control, while ratios of exons 1 and 12
to both GAPDH and .beta.2M were used to determine the relative
copy-number of PGRN. PCR reactions were performed using 50 ng of
DNA in 25 .mu.L for 25 cycles at an annealing temperature of
65.degree. C. Qiagen reagents (Qiagen, Valencia, Calif.) were used
with Q-solution and a final primer concentration of 0.4 .mu.M. Each
sample was independently assessed in two separate PCR reactions,
one using a 30 second extension time per cycle, the other using 2
minutes per cycle. Fluorescent amplicons were analyzed twice, on an
ABI 3100 and an ABI3730 genetic analyzer, using GENEMAPPER and
GENESCAN/GENOTYPER software (Applied Biosystems).
TABLE-US-00005 TABLE 5 Primers for PGRN copy-number analyses SEQ
Product ID size Name Sequence NO (bp) GRNe1i- FAM- 55 291 bp 65'F
TGGCGTGGGCTTAAGCAGTTGCCAG GRNe1i-R AACCACAGACTTGTGCCTGGCGTCC 56
GRNe12i- FAM- 57 305 bp 66'F TGCTGTCCCTACCGCCAGGTCAG GRNe12i-R
TGAGCAGAGGGCACCCTCCGAGTGG 58 GAPDHi- FAM- 59 263 bp 65'F
GTCGGGACAAAGTTTAGGGCGTC GAPDHi-R GGCGCCTAGACGAAGTCCACAGC 60
B2Mi-65'F FAM- 61 328 bp GCTTGGAGACAGGTGACGGTCCCTG B2Mi-R
ATCCAGCCCTGGACTAGCCCCACG 62
[0187] Haplotype sharing studies: Seven different PGRN mutations
(c.26C>A (p.Ala9Asp); c.102delC (p.Gly35GlufsX19); c.154delA
(p.Thr52HisfsX2); c.234.sub.--235delAG (p.Gly79AspfsX39);
c.675.sub.--676delCA (p.Ser226TrpfsX28); c.1252C>T (p.Arg418X)
and c.1477C>T (p.Arg493X)) were identified in multiple
independently ascertained patients. To examine if the FTLD patients
with the same PGRN mutation could have shared a common founder,
seven STR markers spanning a region of 7.5 Mb flanking the PGRN
gene at chromosome 17q21 were typed. All markers were amplified
with one fluorescently labeled primer and PCR fragments were
analyzed on an automated ABI3100 DNA-analyzer. Alleles were scored
using the GENOTYPER software (Applied Biosystems). For six markers
(D17S1814, D17S1299, D17S951, D17S934, D17S950 and D17S806), CEPH
allele frequencies were used to estimate the allele frequency of
the shared alleles in control individuals (CEPH genotype database;
World Wide Web at cephb.fr/cephdb/). The marker TAUPROM was PCR
amplified using TAUPROM-F: FAM-ACCGCGGCCAGCCATAACTCT (SEQ ID NO:63)
and TAUPROM-R: ATCAAGGCACCTCAACATAATAAT (SEQ ID NO:64), and allele
frequencies were estimated in a population of 180 unrelated control
individuals.
[0188] APOE and MAPT genotyping in PGRN mutation carriers: PGRN
mutation carriers were genotyped for the extended H1 and H2 MAPT
haplotypes based on the H2 variant rs1052553 using a Taqman SNP
genotyping assay on the 7900HT Fast Real Time PCR system
(Rademakers et al., Hum. Mol. Genet., 14:3281-3292 (2005)).
Genotype calls were made using the SDS v2.2 software (Applied
Biosystems). APOE alleles were determined as described elsewhere
(Henderson et al., Neurosci. Lett., 324:77-79 (2002)).
[0189] RT-PCR analysis of PGRN RNA. To determine if specific novel
mutations in PGRN caused loss of the mutant RNA by NMD or a similar
mechanism, PGRN RNA was analyzed where frozen brain tissue was
available. Frontal brain tissue from patients NAOS-064
(c.138+1G>A; IVS1+1G>A), NA99-175 (c.26C>A; p.Ala9Asp),
UBC14-9 (c.463-1G>A; IVS4-1G>A), and A02-83 (c.708C>T;
p.Asn236Asn) was homogenized and total RNA was isolated using
Trizol Reagent (Invitrogen, Carlsbad, Calif.). First-strand cDNA
was synthesized starting from total RNA with random hexamers and
oligo-dT primers using the Superscript II First-Strand Synthesis
System for RT-PCR kit (Invitrogen). PCR was performed on brain cDNA
using primers spanning exon 1 in patients carrying mutations
c.138+1G>A (IVS1+1G>A) and c.26C>A (p.Ala9Asp). The
following primers were used: 5'-CAGGGAGGAGAGTGATTTG-3' (cEX0F; SEQ
ID NO:65) and 5'-GCAGAGCAGTGGGCATCAAC-3' (cEX2R; SEQ ID NO:66),
along with primers spanning exon 6 in patient A02-83 carrying the
silent c.708C>T (p.Asn236Asn) mutation
(5'-TGCTGTGTTATGGTCGATG-3' (cEX4F; SEQ ID NO:67) and
5'-GTACCCTTCTGCGTGTCAC-3' (cEX8R; SEQ ID NO:68)). The same cEX4F
and cEX8R primers were used for cDNA analysis of patient UBC14-9,
carrying the c.463-1G>A (IVS4-1G>A) mutation in intron 4. In
addition, PCR was performed on brain cDNA of patient UBC14-9 with
primers spanning exon 10 to determine the number of transcribed
alleles based on the presence of the c.1297C>T (p.Arg433Trp)
missense mutation (5'-ATACCTGCTGCCGTCTAC-3' (cEX8F; SEQ ID NO:69)
and 5'-ACGTTGCAGGTGTAGCCAG-3' (cEX11R; SEQ ID NO:70). RT-PCR
products were analyzed on a 2% agarose gel and sequenced to
determine the relative amounts of wild type and mutant mRNA.
Results
[0190] PGRN sequencing analyses in FTLD and ALS patient series:
Systematic screening of PGRN was performed in the FTLD and
amyotrophic lateral sclerosis (ALS) patient series by direct
sequencing of all 12 coding exons, the non-coding exon 0, the core
promoter, and the complete 3' untranslated region (UTR). In the
overall Mayo Clinic FTLD series (N=378), a total of 23 different
pathogenic mutations were identified, defined as mutations that
would clearly lead to loss of functional PGRN polypeptide
consistent with mutations described elsewhere (Neary et al.,
Neurology, 51:1546-1554 (1998) and Ratnavalli et al., Neurology,
58:1615-1621 (2002)). Eighteen pathogenic mutations were found
within the PGRN coding sequence, and five intronic mutations were
predicted to destroy exonic splice-sites (Table 6). In addition, 13
coding sequence variants (7 missense and 6 silent mutations) were
identified that likely represent non-disease related polymorphisms
(Table 7). No pathogenic mutations were observed in ALS patients.
An additional 8 non-pathogenic intronic sequence variants were
identified (Table 8).
TABLE-US-00006 TABLE 6 Clinicopathological findings in FTLD
families with pathogenic PGRN mutations Disease presentation.sup.b
Fam- Age at Age at Pathological ily Mutation onset death diagnosis
his- Predicted Loca- Patient Origin.sup.a (years) (years)
[clinical] tory Genomic.sup.c Predicted cDNA.sup.d
polypeptide.sup.e tion F161-1 USA 55 66 FTLD-U (NII) ND g.100068T
> C c.2T > C p.Met? EX1 11696 USA.sup..dagger. 56 N/A [PPA] Y
g.100092C > A c.26C > A p.Ala9Asp EX1 NA99-175 USA 48 56
FTLD-U (NII) N g.100092C > A c.26C > A p.Ala9Asp EX1 NA03-140
USA 63 65 FTLD-U (NII) ND g.100092C > A c.26C > A p.Ala9Asp
EX1 8536 USA 65 N/A [FTD] Y g.100129insC c.63insC p.Asp22ArgfsX43
EX1 UBC17-68 Canada 57 61 FTLD-U (NII) Y g.100156_100157insCTGC
c.90_91insCTGC p.Cys31LeufsX35 EX1 F159-1 USA.sup..dagger. 83 N/A
[PPA] Y g.100168delC c.102delC p.Gly35GlufsX19 EX1 0179-90 Sweden
ND ND FTLD.sup.f ND g.100168delC c.102delC p.Gly35GlufsX19 EX1
F149-1 USA.sup..dagger. 56 63 FTLD-U (NII) Y g.100205G > A c.138
+ 1G > A p.Met? IVS1 (IVS1 + 1G > A) F142-1 USA.sup..dagger.
69 76 FTLD-U (NII) Y g.100343delA c.154delA p.Thr52HisfsX2 EX2
367180 USA.sup..dagger..dagger. 80 87 FTLD-U (NII) Y g.100343delA
c.154delA p.Thr52HisfsX2 EX2 114209 USA.sup..dagger..dagger. 61 N/A
[PPA] Y g.100343delA c.154delA p.Thr52HisfsX2 EX2 4504 USA 51 66
FTLD-U (NII) ND g.100423_100424delAG c.234_235delAG p.Gly79AspfsX39
EX2 B3485 USA 61 68 FTLD.sup.f Y g.100423_100424delAG
c.234_235delAG p.Gly79AspfsX39 EX2 UBC11-1 Canada 66 N/A [FTD] Y
g.101168_101171delCAGT c.388_391delCAGT p.Gln130SerfsX125 EX4
UBC14-9 Canada 55 60 FTLD-U (NII) Y g.101343G > A c.463 - 1G
> A p.Ala155TrpfsX56 IVS4 (IVS4 - 1G > A) A03-52 USA 56 61
FTLD-U (NII) N g.101669_101670delCA c.675_676delCA p.Ser226TrpfsX28
EX6 B4301 USA 66 72 FTLD.sup.f Y g.101669_101670delCA
c.675_676delCA p.Ser226TrpfsX28 EX6 97-35 USA 51 53 FTLD-U (NII) ND
g.101669_101670delCA c.675_676delCA p.Ser226TrpfsX28 EX6 B3802 USA
55 61 FTLD.sup.f Y g.101703G > C c.708 + 1G > C
p.Val200GlyfsX18 IVS6 (IVS6 + 1G > C) NP19870 USA 58 65 FTLD-U Y
g.101983_101984delTG c.753_754delTG p.Cys253X EX7 12743 USA 56 N/A
[CBS] Y g.102264G > C c.836 - 1G > C p.Val279GlyfsX5 IVS7
(IVS7 - 1G > C) F147-47 USA.sup..dagger. 60 68 FTLD-U (NII) Y
g.102339_102340insTG c.910_911insTG p.Trp304LeufsX58 EX8 4713 USA
56 65 FTLD-U (NII) Y g.102340G > A c.911G > A p.Trp304X EX8
UBC19-1 Canada 55 61 FTLD-U (NII) Y g.102363G > A c.933 + 1G
> A p.Val279GlyfsX5 IVS8 (IVS8 + 1G > A) PPA1-1
USA.sup..dagger. 65 73 FTLD-U (NII) Y g.102516delG c.998delG
p.Gly333ValfsX28 EX9 F129-2 USA.sup..dagger. 56 63 FTLD-U (NII) Y
g.102663delC c.1145delC p.Thr382SerfsX30 EX9 UBC4-1 Canada 62 71
FTLD-U (NII) Y g.102675G > A c.1157G > A p.Trp386X EX9 01-01
USA 49 54 FTLD-U (NII) Y g.102989C > T c.1252C > T p.Arg418X
EX10 UBC15-16 Canada 60 77 FTLD-U (NII) Y g.102989C > T c.1252C
> T p.Arg418X EX10 F153-1 USA.sup..dagger..dagger. 52 56 FTLD-U
(NII) Y g.103132_103133insC c.1395_1396insC p.Cys466LeufsX46 EX10
NA01-249 USA 66 75 FTLD-U (NII) Y g.103306C > T c.1477C > T
p.Arg493X EX11 PPA3-1 USA 65 N/A [PPA] Y g.103306C > T c.1477C
> T p.Arg493X EX11 NA02-297 USA 56 59 FTLD-U (NII) Y g.103306C
> T c.1477C > T p.Arg493X EX11 F144-1 USA.sup..dagger. 54 N/A
[FTD] Y g.103306C > T c.1477C > T p.Arg493X EX11 9118 USA 48
N/A [FTD] Y g.103306C > T c.1477C > T p.Arg493X EX11 A02-43
USA 57 61 FTLD-U (NII) Y g.103306C > T c.1477C > T p.Arg493X
EX11 05-44 USA 53 56 FTLD-U (NII) Y g.103306C > T c.1477C > T
p.Arg493X EX11 NP12900 USA 69 72 FTLD-U (NII) Y g.103306C > T
c.1477C > T p.Arg493X EX11 .sup.a.dagger.= FTLD-ADRC referral
series; .sup..dagger..dagger.= Olmsted-County community-based
dementia series .sup.bFTLDU (NII) = Frontotemporal lobar
degeneration with ubiquitin-positive intranuclear inclusions; ND =
Not documented; N/A = Not applicable .sup.cNumbering relative to
the reverse complement of GenBank .RTM. accession number AC003043.1
and starting at nucleotide 1 .sup.dNumbering according to GenBank
.RTM. accession number NM_002087.2 starting at the translation
initiation codon .sup.eNumbering according to GenPept .RTM.
accession number NP_002078.1 .sup.fUbiquitin staining was not
performed
TABLE-US-00007 TABLE 7 PGRN coding sequence variants with unknown
significance Mutation Frequency Predicted Predicted rs Patients
Controls Genomic.sup.a cDNA polypeptide Location number N (%) N (%)
Notes g.100121C > T c.55C > T p.Arg19Trp EX1 1 (0.3) --
g.100165C > T` c.99C > T p.Asp33Asp EX1 3 (0.8) 1 (0.4)
p.Gly79AspfsX39 in 1 patient g.100453G > A c.264G > A
p.Glu88Glu EX2 1 (0.3) -- g.100617T > C c.313T > C
p.Cys105Arg EX3 1 (0.3) -- Not segregating with disease g.101164T
> C c.384T > C p.Asp128Asp EX4 rs25646 17 (4.5) 5 (2.2)
g.101702C > T c.708C > T p.Asn236Asn EX6 1 (0.3) -- Mutant
RNA not subject to NMD g.102290G > C c.861G > C p.Glu287Asp
EX8 1 (0.3) -- g.102332G > A c.903G > A p.Ser301Ser EX8 1
(0.3) -- g.102488G > A c.970G > A p.Ala324Thr EX9 1 (0.3) --
g.102990G > A c.1253G > A p.Arg418Gln EX10 1 (0.3) 1 (0.4)
g.103034C > T c.1297C > T p.Arg433Trp EX10 5 (1.3) --
p.Ala155TrpfsX56 in 1 patient g.103251C > T c.1422C > T
p.Cys474Cys EX11 1 (0.3) -- g.103373G > C c.1544G > C
p.Gly515Ala EX11 rs25647 3 (0.8) 1 (0.4) p.Met1? in 1 patient
.sup.aNumbering relative to the reverse complement of GenBank .RTM.
accession number AC003043.1 and starting at nucleotide 1
.sup.bNumbering according to GenBank .RTM. accession number
NM_002087.2 starting at the translation initiation codon
.sup.cNumbering according to GenPept .RTM. accession number
NP_002078.1
TABLE-US-00008 TABLE 8 List of intronic PGRN sequence variants
identified in FTLD patients and control individuals Genomic
mutation.sup.a Predicted cDNA mutation.sup.b Location rs number
g.96164G > T c.-80G > T EX0 g.96281G > T c.-8 + 45G > T
(IVS0 + 45G > T) IVS0 g.100460G > A c.264 + 7G > A (IVS2 +
7G > A) IVS2 g.100474G > A c.264 + 21G > A (IVS2 + 21G
> A) IVS2 rs9897526 g.101082_101083insGTCA c.350 - 48insAGTC
(IVS3 - 48insAGTC) IVS3 g.101266G > A c.462 + 24G > A (IVS4 +
24G > A) IVS4 rs850713 g.102072G > A c.835 + 7G > A (IVS7
+ 7G > A) IVS7 g.103778C > T c.*78C > T (3'UTR + 78C >
T) 3'UTR rs5848 .sup.aNumbering relative to the reverse complement
of GenBank.sup. .RTM. accession number AC003043.1 and starting at
nucleotide 1. .sup.bNumbering according to GenBank .RTM. accession
number NM_002087.2 starting at the translation initiation
codon.
[0191] The 23 pathogenic mutations included a total of 20 mutations
that are predicted to result in premature termination of the PGRN
coding sequence. This group of mutations included nonsense (N=4),
frameshift (N=12), and splice-site (N=4) mutations. The truncating
mutations were identified scattered over the PGRN gene in 9
different exons, but not in the 3' end of exon 11 or in exon 12
(FIG. 4). Three additional mutations, two located in exon 1 and one
located at the 5' splice-site of exon 1, were identified that do
not cause a simple truncation of the coding sequence, but are
nonetheless almost certainly pathogenic. Mutation c.138+1G>A
(IVS1+1G>A) is predicted to lead to the splicing out of exon 1,
thereby removing the Met1 codon and all associated Kozac sequence,
whereas c.2T>C (p.Met?) directly destroys the normal Kozac
sequence by mutating the Met1 codon. The third mutation
(c.26C>A; p.Ala9Asp) affects the hydrophobic core of the signal
peptide sequence. None of the 23 pathogenic coding and splice-site
mutations was observed by sequence analysis in 200 unrelated
control individuals. Segregation analysis for eight different
mutations was performed in FTLD families with at least one other
affected family member available for genetic testing. This analysis
showed segregation of the PGRN mutations with disease in all
analyzed families (FIG. 5). Although all FTLD patients in these
families carried the relevant PGRN mutation, five individuals from
three different families carried a pathogenic PGRN mutation but had
not developed disease by the age of 60, including one individual
without symptoms at the age of 73.
[0192] In contrast to the pathogenic mutations, four of the 13
coding variants with unknown disease significance were observed in
control individuals, including the silent mutation c.384T>C
(p.Asp128Asp; rs25646) in exon 4 and the missense mutation
c.1544G>C (p.Gly515Ala; rs25647) in exon 11, both reported in
the NCBI dbSNP database (World Wide Web at ncbi.nih.gov/SNP; Table
7). Moreover, three variants were detected in patients already
affected by another pathogenic PGRN mutation (Table 7). The
missense mutation c.313T>C (p.Cys105Arg) was identified in the
proband of FTLD family UBC20; however, sequence analyses of four
affected and six unaffected relatives excluded segregation of this
mutation with the FTLD phenotype in this family indicating that it
is likely a rare benign variant.
[0193] Detection of genomic rearrangements in PGRN region: To
assess the possible contribution of large genomic
insertion/deletion mutations to the overall PGRN mutation frequency
in FTLD, 100 patients from the ADRC-FTLD referral series and all
FTLD patients (N=15) from the Olmsted County community-based
dementia series were studied. In these patients long-range PCR
analyses covering the complete PGRN coding region in either a
single 4 kb fragment or in three 2 kb overlapping PCR fragments
were performed to detect large internal PGRN mutations. No evidence
for large internal genomic rearrangements in the PGRN gene was
found in either patient series.
[0194] In addition, semi-quantitative PCR-based assays of exons 1
and 12 were performed in the complete FTLD population. These
analyses have shown no evidence of PGRN copy-number alterations
consistent with genomic deletions or multiplications affecting the
5' or 3' end of the PGRN gene or the entire gene.
[0195] Frequency of PGRN mutations in the FTLD patient series:
Pathogenic mutations in the PGRN gene were detected in 39 patients
or 10.5% of the Mayo Clinic FTLD series (N=378; Table 9). Within
the subgroup of FTLD patients with a positive family history of a
similar dementing disorder (N=144), the PGRN mutation frequency was
considerably higher (Table 9). More than one fifth of the familial
patients from the Mayo FTLD series (32 out of 144 analyzed patients
or 22.2%) could be explained by mutations in the PGRN gene. Family
history was not documented for five PGRN mutation carriers, while
the FTD phenotype was considered sporadic in two patients (Table
6). Patient NA99-175 carrying mutation c.26C>A (p.Ala9Asp) in
the signal peptide showed first symptoms of dementia at the early
age of 48 years, while his parents died at the ages of 66 and 70
years without signs of dementia. For patient A03-52
(c.675.sub.--676delCA; p.Ser226TrpfsX28) with an onset age of 56
years, one parent died at the age of 56 years from an unrelated
illness, which may explain the lack of a positive family history. A
pathological confirmation of the FTLD diagnosis was available for
30 PGRN mutation carriers. In all mutation carriers with
immunohistochemical data available (N=26), neuropathological
findings were consistent with FTLD-U with NII, leading to an
overall PGRN mutation frequency of 24.7% in the subpopulation of
FTLD-U patients.
TABLE-US-00009 TABLE 9 Type and frequency of PGRN mutations in Mayo
FTLD patient series FTLD Community Total FTLD population based
dementia series FTLD-ADRC series All Ub+ All Ub+ Mutation type (N =
378) FH+ (N = 144) (N = 105) (N = 15) FH+ (N = 10) Ub+ (N = 5) All
(N = 167) FH+ (N = 64) (N = 21) Frameshift 18 14 11 3 3 2 5 5 4
Nonsense 12 12 9 -- -- -- 1 1 -- Splice-site 5 5 3 -- -- -- 1 1 1
Missense 3 1 2 -- -- -- 1 1 -- Kozac 1 -- 1 -- -- -- -- -- -- Total
39 (10.3%) 32 (22.2%) 26 (24.7%) 3 (20.0%) 3 (30.0%) 2 (40.0%) 8
(4.8%) 8 (12.5%) 5 (23.8%) FH+ = Positive family history of
dementia Ub+ = Pathological diagnosis of frontotemporal lobar
degeneration with ubiquitin-positive inclusions
[0196] In the 15 FTLD patients derived from the community-based
dementia population collected in Olmsted County (Minn., USA) two
different PGRN mutations were detected in a total of three FTLD
patients. The two patients carrying the same c.154delA
(p.Thr52HisfsX2) mutation were independently ascertained; however,
genealogical studies revealed that they were second-degree
relatives from the large F142 family (FIG. 5). The data obtained in
this small FTLD subgroup from Olmsted County can be extrapolated to
the entire community-based dementia series of 649 patients,
resulting in a PGRN mutation frequency of .about.0.5% in all types
of dementia. In the ADRC-FTLD series, mutations were identified in
eight FTLD patients (4.8% of 167), each carrying a different
mutation (Table 9). Importantly, patients were not selected on the
basis of family history or neuropathological subtype in this
ADRC-FTLD series.
[0197] Founder effects of PGRN mutations: A total of 23 different
pathogenic mutations were identified in 39 independently
ascertained patients from the Mayo Clinic FTLD series. The most
frequently observed mutation was c.1477C>T (p.Arg493X) located
in exon 11, which was identified in eight independently ascertained
FTLD patients. Five other mutations were observed more than once:
mutations c.26C>A (p.Ala9Asp), c.154delA (p.Thr52HisfsX2), and
c.675.sub.--676delCA (p.Ser226TrpfsX28) were identified in three
patients, and mutations c.102delC (p.Gly35GlufsX19),
c.234.sub.--235delAG (p.Gly79AspfsX39), and c.1252C>T
(p.Arg418.times.) were identified in two patients each (Table 6).
To determine if patients carrying the same mutation could have had
a common founder, haplotype analyses were performed with seven STR
markers spanning a 7.5 Mb region around the PGRN gene. The common
c.1477C>T (p.Arg493X) mutation was identified in family PPA3,
for which DNA of one additional affected and one unaffected
individual was available, resulting in the unambiguous
reconstruction of a disease haplotype in this family. When this
haplotype was compared with individual genotype data of the seven
additional patients carrying the c.1477C>T (p.Arg493X) mutation,
shared alleles were observed between all patients for five
consecutive STR markers spanning a 5.1 Mb region between D1751299
and TAUPROM (Table 10). Shared haplotype analyses also supported a
common genetic origin for each of the other six PGRN mutations that
were observed in multiple independently ascertained FTLD
patients.
TABLE-US-00010 TABLE 10 Shared haplotype analyses for PGRN
p.Arg493X mutation in 8 FTLD families PGRN p.Arg493X FTLD families
Marker Position (Mb) Frequency (%) PPA-3 NA01-249 NA02-297 6144472
9118 A02-43 NP12900 05-44 D17S1814 35.70 21.4 162 161-161 161-161
150-162 166-162 154-162 164-162 155-161 D17S1299 36.20 19.3 200
196-200 200-200 208-200 196-200 200-200 196-200 196-200 D17S951
39.18 25.0 180 172-180 170-180 172-180 170-180 172-180 170-180
172-180 c.1477C > T 39.78 T C-T C-T C-T C-T C-T C-T C-T D17S934
40.41 16.1 180 180-180 174-180 180-180 184-180 182-180 176-180
174-180 D17S950 40.62 11.1 190 190-190 184-190 190-190 180-190
192-190 178-190 188-190 TAUPROM 41.33 1.0 363 359-363 359-363
377-363 345-363 359-363 361-363 377-363 D17S806 43.17 1.9 181
169-181 163-181 173-181 181-181 173-181 181-181 173-175 ND = Not
determined
[0198] Phenotype of PGRN mutation carriers: In the FTLD patients
with pathogenic mutations in PGRN, the mean age at onset of
dementia was 59.+-.7 years (N=38) with a mean age at death of
65.+-.8 years (N=29; Table 6). The clinical presentation was
similar in the population of patients without PGRN mutations,
although the age at death (70.+-.12 years) was slightly later in
non-carriers. As expected from the autosomal dominant FTLD-U
families linked to chromosome 17 (Mackenzie et al., Brain,
129:853-867 (2006); Rademakers et al., Mol. Psychiatry, 7:1064-1074
(2002); and van der Zee et al., Brain, 129:841-852 (2006)), a broad
age range was observed for both the onset of dementia (48 to 83
years) and the age at death (53 to 87 years). No obvious
correlation was noted between the onset of the first clinical
symptoms and the location of each mutation in PGRN. In fact,
variable onset ages were also observed for patients carrying
identical PGRN mutations, with onset ages ranging from 48 to 69
years for carriers of the c.1477C>T (p.Arg493X) mutation, and
ranging from 48 to 63 years for the c.26C>A (p.Ala9Asp)
mutation. Using information on 68 affected and 16 asymptomatic PGRN
mutation carriers, a liability curve emphasizing the age-related
disease penetrance for PGRN mutations was generated and showed that
only 50% of mutation carriers were affected by the age of 60, while
more than 90% of carriers were affected at 70 years of age (FIG.
6). Clinically, FTD (N=17) and PPA (N=7) were the most frequently
observed diagnoses, and language dysfunction was a prominent
presenting symptom in 24% of the mutation carriers, compared to
only 12% of the patients not carrying PGRN mutations. Notably, one
patient (who was alive) was clinically diagnosed with corticobasal
syndrome (CBS). Two patients received a clinical diagnosis of
Alzheimer's disease (AD) with seizures, and seven patients had a
movement disorder (Parkinson disease (PD), parkinsonism, or
FTD-MND); however, neuropathological autopsy findings for these
nine patients were consistent with FTLD-U. Pathological
confirmation of the clinical FTLD diagnoses was available for the
majority of the mutation carriers (30/39, 77%), showing FTLD-U
pathology with both cytoplasmic and intranuclear inclusions in
patients for which immunohistochemical data were available (26/30,
87%).
[0199] The variable onset age of dementia observed for many PGRN
mutations and the potential incomplete penetrance associated with
the PGRN IVS0+5G>C mutation, reported in a Belgian FTD
population (Cruts et al., Nature, 442:920-924 (2006)), emphasized
the potential impact of modifying factors on the clinical
presentation of FTLD in PGRN mutation carriers. Therefore, the
effect of the genotypes of the Apolipoprotein E (APOE) gene and the
extended H1 and H2 haplotypes of MAPT on the clinical presentation
of FTLD was analyzed in all mutation carriers identified in this
study. No obvious effect on age of onset or age at death could be
observed for the MAPT haplotypes, either within extended FTLD
families or when all FTLD patients with null mutations in PGRN were
included in the analysis (mean age at onset for H1/H1 carriers was
59.+-.8 years, and for H1/H2 carriers was 59.+-.7 years).
Unexpectedly, patients carrying at least one APOE.epsilon.4 allele
showed a significantly later disease onset (63.+-.7 years; N=10)
compared to APOE.epsilon.383 carriers (57.+-.7 years; N=29; p=0.01,
unpaired t-test).
[0200] Mechanistic analyses of novel PGRN mutations: Mutations
affecting the splice-sites of PGRN were identified in five FTLD
patients. These mutations are expected to lead to skipping of the
affected exons, resulting in a frameshift and premature termination
of the coding sequence. For the mutations affecting the 5'
splice-site of exon 1 (c.138+1G>A; IVS1+1G>A) and the 3'
splice-site of exon 5 (c.463-1G>A; IVS4-1G>A) frontal
cortices of patients were available as a source of mRNA to study
the effect of these mutations. RT-PCR transcript analyses in
NAOS-064 carrying the c.138+1G>A mutation showed evidence for an
aberrant product corresponding to the skipping of exon 1 (268 bp)
in addition to the wild-type transcript (413 bp; FIG. 7). The
exclusion of exon 1 containing the start methionine codon from the
PGRN mRNA is expected to block PGRN polypeptide from being
generated, creating a functional null allele. In contrast, no
aberrant transcript was identified for patient UBC14-9 carrying
c.463-1G>A (IVS4-1G>A; FIG. 7). This mutation is likely to
lead to skipping of exon 5 from the PGRN mRNA, resulting in a
frameshift and a premature termination codon (PTC) in exon 6
(p.Ala155TrpfsX56; FIG. 7). To determine if the lack of an aberrant
transcript for this mutation resulted from the specific degradation
of mutant RNA (e.g., by NMD) it was determined whether the brain
RNA in this patient was derived from both PGRN alleles. Brain mRNA
from patient UBC14-9 was examined for the presence of the sequence
variant c.1297C>T (p.Arg433Trp) in exon 10 that occurred on the
opposite chromosome. Genomic DNA from patient UBC14-9 was
heterozygous for this mutation with the C-allele segregating on the
disease haplotype. Comparison of sequence traces of PGRN exon 10 in
genomic DNA and mRNA prepared from frontal cortex of patient UBC
14-9 confirmed the absence of mutant RNA (C-allele). The three
additional splice-site mutations identified in this study are all
predicted to cause frameshifts and premature termination of the
coding sequence, and are therefore also likely to create null
alleles through the degradation of the mutant RNAs. In this group
of splice-site mutations, c.708+1G>C (IVS6+1G>C) is expected
to result in skipping of exon 6, resulting in a frameshift and a
PTC in exon 7 (Val200GlyfsX18), while mutations c.836-1G>C
(IVS7-1G>C) and c.933+1G>A (IVS8+1G>A) are both predicted
to lead to skipping of exon 8, resulting in a frameshift and
premature termination of translation in exon 9 (Val279GlyfsX5).
[0201] The missense mutation c.26C>A (p.Ala9Asp) was identified
in three independently ascertained FTLD patients and is located in
the hydrophobic core of the PGRN signal peptide. To determine if
the mutated PGRN signal peptide sequence resulted in a functional
null allele, genomic DNA and brain cDNA sequence traces of PGRN
exon 1 of patient NA99-175 carrying p.Ala9Asp were compared.
Surprisingly, a substantial reduction in the amount of mutant RNA
(A-allele) compared to wild-type RNA (C-allele) was detected.
Example 3
Mutations in PGRN are a Cause of Ubiquitin-Positive Frontotemporal
Dementia Linked to Chromosome 17q21
Patients and Methods
[0202] Patients: Belgian patients had pure FTD and were diagnosed
using a standard protocol and established clinical criteria (Neary
et al., Neurology, 51:1546-4554 (1998); Engelborghs et al.,
Psychiatry, 74:1148-1151 (2003)). In the series of 103 patients, 10
patients had a definite diagnosis of FTDU, two of dementia lacking
distinctive histopathology (DLDH), and one of Pick's disease.
Mutation analyses identified a MAPT mutation in three patients,
Gly273Arg, Ser305Ser, and Arg406Trp, and one presenilin 1 (PSEN1)
mutation, Gly183Val, in the patient with Pick's pathology (Dermaut
et al., Ann. Neurol., 55:617-626 (2004)). In the whole sample, mean
onset age was 63.8.+-.9.1 years (range 40-90 years). There were 50
females and 53 males, and 43 patients had a positive family history
with at least one first-degree relative affected. The FTD series
included eight probands sharing the same haplotype at 17q21,
indicative of a common founder (van der Zee et al., Brain,
129:841-852 (2006)).
[0203] PGRN gene sequencing: The sequence of non-coding exon 0 and
coding exons 1-12 was determined in the 103 Belgian FTD patients
and 190 neurologically healthy control individuals (mean age
52.4.+-.13.3 years, range 37-85 years). For the PGRN exon 0
fragment containing the IVS0+5G>C mutation, 246 additional
control individuals (mean age 67.0.+-.12.8 years, range 40-92
years) were sequenced. Total genomic DNA was prepared from
peripheral blood according to standard procedures. Standard 200
.mu.L polymerase chain reaction (PCR) amplifications on genomic DNA
were performed to amplify exons including exon-intron boundaries
with primers designed using Primer 3 (Rozen and Skaletsky, Methods
Mol. Biol., 132:365-386 (2000); Cruts et al., Nature, 442:920-924
(2006)). Amplification products were purified with 1 U Antarctic
phosphatase (New England Biolabs, Ipswich, Mass.) and 1 U
exonuclease I (New England Biolabs) and sequenced in both
directions using the Big Dye Terminator Cycle Sequencing kit v3.1
(Applied Biosystems) on an ABI3730 automated sequencer (Applied
Biosystems). Sequences were analyzed with the Software Package
NovoSNP (Weckx et al., Genome Res., 15:436-442 (2005)).
[0204] PGRN mRNA and polypeptide analyses: Epstein-Barr virus (EBV)
transformed lymphoblasts were cultured and mRNA was isolated using
the Chemagic mRNA Direct Kit (Chemagen, Baesweiler, Germany).
Frontal brain tissue from the patients was homogenized and total
RNA was extracted using the RiboPure Kit (Ambion, Austin, Tex.).
First strand cDNA was synthesized starting from mRNA or total RNA
with random hexamer primers using the SuperScript III First-Strand
Synthesis System for RT-PCR kit (Invitrogen). PCR was performed on
both lymphoblast and brain cDNA using primers amplifying the
complete coding region of the PGRN transcript and primers
amplifying part of the transcript encoding exon 5-6 to the 3'
untranslated sequence (UTS). Primer sequences are provided
elsewhere (Cruts et al., Nature, 442:920-924 (2006)). The resulting
PCR products were sequenced to detect aberrant transcripts and to
determine the number of transcribed alleles based on the presence
of SNP rs5848.
[0205] Lymphoblasts were collected by centrifugation at 250 g and
lysed in homogenization buffer. Samples were sonicated and cleared
at 20,000 g. Protein aliquots (40 .mu.g) were separated on a 4-12%
Bis-Tris Nupage gel (Invitrogen) and were electroblotted to Hybond
P polyvinylidene difluoride membrane (Amersham Biosciences,
Piscataway, N.J.). Membranes were immunoblotted with anti-PGRN
antibodies (acrogranin N-19 and S-15) and detected with secondary
antibody and the ECL plus chemiluminescent detection system
(Amersham Biosciences, Piscataway, N.J.) with bands quantified on
Kodak Imaging Station 440 (Eastman Kodak, Rochester, N.Y.).
Quantitative data were normalized to the signal obtained for
.beta.-actin (clone AC-15; Sigma).
Results
[0206] In patients of the Belgian FTDU-17 founder family DR8, a
G-to-C transversion was identified in intron 0 of PGRN at position
+5 relative to the first non-coding exon 0 (IVS0+5G>C; Table 11,
where IVS indicates intervening sequence), which segregated with
disease (Cruts et al., Nature, 442:920-924 (2006)). The Belgian
founder family was identified based on conclusive 17q21 linkage in
one family (DR8; LOD score 3.49 at D175931; van der Zee et al.,
Brain, 129:841-852 (2006)) and subsequent haplotype sharing in
seven apparently unrelated familial FTD patients (Cruts et al.,
Nature, 442:920-924 (2006)), indicative of a distant common
ancestor (van der Zee, Brain, 129:841-852 (2006)). Mutation
analysis of PGRN in 103 Belgian FTD patients identified the
IVS0+5G>C mutation in the eight probands belonging to the
different branches of the Belgian founder family and not in 436
control individuals. In both families, 1083 and DR8, the pathology
showed the characteristic ubiquitin-immunoreactive neuronal
cytoplasmic and nuclear inclusions in the temporal and frontal
cortices (Rademakers et al., Mol. Psychiatry, 7:1064-1074 (2002);
van der Zee et al., Brain, 129:841-852 (2006); Cruts et al.,
Nature, 442:920-924 (2006)). Rarely, inclusions also involved glia
cells, but none of the inclusions was shown to have an appreciable
presence for any polypeptide from almost 30 possible polypeptides
tested (Pirici et al., J. Neuropathol. Exp. Neurol., 65:289-301
(2006)). Patients of both families met the clinical criteria of FTD
(Forman et al., Ann. Neurol., 59:952-962 (2006); McKann et al.,
Arch. Neurol., 58:1803-1809 (2001)), without associated signs of
motor neuron disease (Rademakers et al., Mol. Psychiatry,
7:1064-1074 (2002); van der Zee et al., Brain, 129:841-852
(2006)).
TABLE-US-00011 TABLE 11 PGRN mutations identified in Belgian FTD
patients Mutation* Onset age in Predicted Patient/family
Pathology.dagger. years Genome.dagger-dbl. Predicted RNA.sctn.
polypeptide|| Location DR8 FTDU 63.8 (n = 5) g.96241G > C (IVS0
+ 5G > C) -- p.0 IVS 0 DR2 Alive 66.3 (n = 4) g.96241G > C
(IVS0 + 5G > C) -- p.0 IVS 0 DR25 FTDU 69.5 (n = 2) g.96241G
> C (IVS0 + 5G > C) -- p.0 IVS 0 DR26 Alive 65 g.96241G >
C (IVS0 + 5G > C) -- p.0 IVS 0 DR27 FTDU 58 g.96241G > C
(IVS0 + 5G > C) -- p.0 IVS 0 DR28 FTDU 57 g.96241G > C (IVS0
+ 5G > C) -- p.0 IVS 0 SR31 FTDU 66 g.96241G > C (IVS0 + 5G
> C) -- p.0 IVS 0 DR119 Alive 45 g.96241G > C (IVS0 + 5G >
C) -- p.0 IVS 0 DR118 Died without autopsy 62 g.100069G > A c.3G
> A p.Met1? FX 1 DR120 Alive 56 g.101160_101161delCT
c.380_381delCT p.Pro127ArgfsX2 FX 4 DR91 Alive 67
g.102065_102066insCTGA c.709_835del p.Ala237TrpfsX4 IVS 7
*Sequencing all 13 exons of PGRN in 190 control individuals did not
identify these or other nonsense or frameshift mutations.
Sequencing of exon 0 in 246 additional control individuals showed
that the IVS0 + 5G > C mutation was absent. .dagger.FTDU is an
autopsied brain pathology diagnosis. .dagger-dbl.Numbering relative
to the reverse complement of GenBank .RTM. accession number
AC003043 and starting at nucleotide 1. .sctn.Numbering according to
the largest PGRN transcript (GenBank .RTM. accession number
NM_002087.2) and starting at the translation initiation codon.
||Numbering according to the largest PGRN isoform (GenPept .RTM.
accession number NP_002078.1). Mutation in Met1 translation
initiation codon.
[0207] The IVS0+5G>C mutation is located in the splice donor
site of the first PGRN intron (intron 0) following the non-coding
exon 0 (Table 11 and FIG. 4). In silico analysis predicted a marked
drop in binding efficiency of the U1 snRNP complex. Furthermore,
analysis of full-length PGRN complementary DNA in lymphoblasts and
brain of probands DR8 (III-28) and DR27 (III-4) did not identify
aberrant transcripts. However, DR8 III-28 and DR27 III-4, who were
heterozygous C/T for single-nucleotide polymorphism (SNP) rs5848
located in the 3' untranslated sequence (UTS), with the C allele
segregating on the disease haplotype, showed only the T allele when
their lymphoblast and/or brain PGRN cDNA was sequenced (Cruts et
al., Nature, 442:920-924 (2006)). In contrast, an unaffected
relative was heterozygous for rs5848 in both genomic and cDNA
sequences. These data support an absence of mutant PGRN mRNA
transcript, most likely due to read-through of intron 0. Nuclear
retention signals remaining on the unspliced transcript can prevent
the transcript from leaving the nucleus, marking it for nuclear
degradation (Vinciguerra and Stutz, Curr. Opin. Cell Biol.,
16:285-292 (2004)). Western blot analysis of lymphoblast cell
protein extracts from probands DR8 III-28 and DR27 III-4 supported
these data and demonstrated a reduction of PGRN polypeptide levels
(Cruts et al., Nature, 442:920-924 (2006)). Together, these data
demonstrate that the DR8 founder haplotype carries a PGRN null
allele that does not produce polypeptide. Robust PGRN
immunoreactivity was observed in a subset of cortical neurons in
patient DR8 III-28 (Cruts et al., Nature, 442:920-924 (2006)).
However, despite using a panel of antibodies that recognize all
regions of the PGRN polypeptide, the neuronal inclusions were
negative for PGRN.
[0208] In addition to the IVS0+5G>C mutation in the eight
probands of the Belgian FTDU-17 founder family, three other PGRN
mutations were identified in three familial patients of the Belgian
FTD series by genomic sequencing of all 13 exons and flanking
intronic regions of PGRN (Table 11). In one FTD patient with an
onset age of 62 years and a sister suffering from dementia who died
at 64, a G>A transition was identified in exon 1 that destroyed
the native Kozak sequence surrounding the Met1 translation
initiation codon (c.3G>A). A U.S. patient who carried a
different Met1 mutation (c.2T>C described above) showed a
substantial reduction in expression level of the mutant transcript
allele (Baker et al., Nature, 442:916-919 (2006)). In the two other
familial patients, different frameshift mutations predicted
carboxy-terminal-truncated polypeptides, Pro127ArgfsX2 and
Ala237TrpfsX4, resulting from a dinucleotide deletion in exon 4 and
a four nucleotide insertion affecting the intron 7 splice donor
site and predicting exon 7 skipping (Table 11). As described above,
PGRN frameshift mutations also produce null alleles through
nonsense-mediated decay of mutant mRNA transcripts, lowering PGRN
polypeptide levels (Baker et al., Nature, 442:916-919 (2006)).
Together, the PGRN mutation data explained 10.7% (11 out of 103) of
the genetic etiology of FTD and 25.6% (11 out of 43) of familial
FTD in the Belgian patient series. In the same group, MAPT mutation
frequencies were 2.9% (3 out of 103) overall and 7% (3 out of 43)
in familial FTD, indicating that PGRN mutations are an
approximately 3.5 times more frequent cause of FTD in Belgian
patients.
[0209] In the Belgian founder family, the 16 patients carrying the
IVS0+5G>C mutation had onset ages varying between 45 and 70
years (mean onset age 63.4.+-.6.8 years; mean age at death
68.3.+-.4.4 years). There were also four obligate carriers in
generation II of family DR8 who died without symptoms of dementia.
One died at a young age (II-1, 41 years), two at ages within the
onset range (II-8 at 44 years and II-9 at 54 years), and one at 81
years (II-3; van der Zee, Brain, 129:841-852 (2006)). These highly
variable onset ages and potential incomplete penetrance of the
disease indicated that modifying factors are modulating onset age
and as such contribute to a more complex genetic etiology for
FTDU-17. Analysis of the apolipoprotein E gene (APOE) indicated
that the APOE genotype has no effect on onset age.
[0210] Interestingly, many of the FTDU-17 patients in the Belgian
founder family had symptoms of non-fluent aphasia as a prominent
feature of their disease (Cruts, Nature, 442:920-924 (2006); van
der Zee, Brain, 129:841-852 (2006)).
[0211] The mutation data for PGRN explained linkage of FTDU-17 in
Dutch family 1083 (Rademakers et al., Mol. Psychiatry, 7:1064-1074
(2002)) and the Belgian founder family DR8 (van der Zee et al.,
Brain, 129:841-852 (2006)). Although studies of nonsense and
frameshift mutant transcripts indicated that they were probably
degraded by nonsense-mediated mRNA decay (Baker et al., Nature,
942:916-919 (2006)), it could not be fully excluded that undetected
low amounts of truncated polypeptides exerted their pathogenic
effect through a dominant-negative or gain-of-function mechanism.
Identification of a loss-of-allele mutation in intron 0
(IVS0+5G>C) provided convincing evidence that the pathogenic
mechanism in FTDU-17 is indeed a loss of functional PGRN
(haploinsufficiency). The IVS0+5G>C mutation may prevent
splicing out of the first intron, intron 0, causing nuclear
retention and degradation of the mutant transcript, or the mutant
allele may not be transcribed. In either case, the mutant allele is
nonfunctional and the result is a reduction in PGRN
polypeptide.
Example 4
Mutations Other than Null Mutations Producing a Pathogenic Loss of
Progranulin in Frontotemporal Dementia
[0212] Experiments were performed to investigate the pathogenic
nature of PGRN missense mutations and sequence variations in the 5'
regulatory region identified in two studies, a Belgian (N=136) and
a French (N=196) FTD patient series (Cruts et al., Nature,
442:920-924 (2006); Le Ber et al., Human Mutat, PMID: 17436289
(2007)), using in silico conservation and structural analyses to
assess their effect on PGRN expression levels and the biological
function of PGRN.
[0213] Subjects: The Belgian patient sample consisted of 136 FTD
patients who were diagnosed using a standard protocol and
established clinical criteria as described elsewhere (Engelborghs
et al., J Neurol Neurosurg Psychiatry, 74:1148-1151 (2003); Neary
et al., Neurology, 51:1546-1554 (1998); Cruts et al., Nature,
442:920-924 (2006). For the French series, DNA samples from 196
index patients with FTD were collected through a French research
network of neurologists (Le Ber et al., Brain, 129:3051-3065
(2006)). The diagnosis of FTD was based on the Lund and Manchester
criteria as described elsewhere (The Lund and Manchester Groups, J
Neurol Neurosurg Psychiatry, 57:416-418 (1994); Le Ber et al.,
Human Mutat, PMID: 17436289 (2007)). Mutation analyses identified a
MAPT mutation in three Belgian and six French FTD patients, and a
presenilin 1 (PSEN1; MIM#104311) mutation in one Belgian patient
(van der Zee et al., Brain, 129:841-852 (2006); Dermaut et al., Ann
Neurol, 55:617-626 (2004); Le Ber et al., Human Mutat, PMID:
17436289 (2007)). In addition to patients, 459 unrelated
neurologically healthy Belgian and 187 French control individuals
were analyzed for PGRN variations. Descriptives of the Belgian and
French study populations are summarized in Table 12.
TABLE-US-00012 TABLE 12 Descriptions of Belgian and French study
samples Belgian FTD French FTD patients N = 136 patients N = 196
Mean AAO (range).sup.1 63.5 .+-. 9.2 (40 - 90) 60.6 .+-. 7.9 (30 -
82) Male/Female 73/63 104/92 Familial FTD.sup.2 54 (40%) 53 (27%)
FTD with MND 9 (7%) 37 (19%) Pathological 13 2 Diagnosis FTDU 10 2
tauopathy 1 0 DLDH 2 0 Belgian control French control individuals N
= 459 individuals N = 187 Mean AAI (range).sup.3 58.6 .+-. 16.0 (19
- 92) 67.0 .+-. 11.4 (43 - 91 ) Male/Female 207/252 83/104
.sup.1AAO: age at onset in years .+-. the standard deviation;
.sup.2Positive family history was defined as having at least one
first degree relative with dementia or FTD; .sup.3AAI: age at
inclusion in years .+-. the standard deviation.
[0214] PGRN sequencing analysis: PGRN mutation analysis was
performed in 136 Belgian patients and 190 French patients without
MAPT mutations as well as in the French and Belgian control
individuals as described elsewhere (Cruts et al., Nature,
442:920-924 (2006); Le Ber et al., Human Mutat, PMID: 17436289
(2007)). All PGRN exons and intron-exon boundaries were sequenced,
including the non-coding exon 0 and a conserved region in intron 0
(g.96237-g.96983; numbering is relative to the reverse complement
of GenBank.RTM. Accession Number AC003043 and starting at nt 1).
Total genomic DNA was prepared from peripheral blood according to
standard procedures. The exons and part of intron 0 were PCR
amplified on genomic DNA (20 ng) using primers described elsewhere
(Cruts et al., Nature, 442:920-924 (2006)) and an additional primer
set for intron 0 (IVS0-F 5'-GGCCATGTG AGCTTGAGGTT-3' (SEQ ID
NO:85), IVS0-R 5'-GAGGGAGTATAGTGTATGCTTC TACTGAATA-3' (SEQ ID
NO:86)). Amplification products were purified with 1 U antarctic
phosphatase (New England Biolabs, Ipswich, Mass., USA) and 1 U
exonuclease I (New England Biolabs) and sequenced in both
directions using the BigDye Terminator Cycle Sequencing kit v3.1
(Applied Biosystems, Foster City, Calif., USA) on an ABI3730
automated sequencer (Applied Biosystems). Sequences were analyzed
using the Software Package novoSNP (Weckx et al., Genome Res,
15:436-442 (2005)).
[0215] Mutation nomenclature: Genomic DNA (gDNA) mutation numbering
is relative to the reverse complement of GenBank.RTM. Accession
Number AC003043.2 and starting at nt 1. Complementary DNA (cDNA)
mutation numbering is relative to the largest PGRN transcript
(GenBank.RTM. Accession Number NM.sub.--002087.2) and starting at
translation initiation site +1. The polypeptide mutation numbering
is according to the largest PGRN isoform (GenPept.RTM. Accession
Number NP 002078.1).
[0216] Microsatellite genotyping: In Belgian patient DR121.1 and
French patient F98/001, who both carried the PGRN c. 1294C>T,
p.Arg432Cys mutation, 14 microsatellite (STR) markers spanning an 8
cM region around PGRN were genotyped for allele sharing analysis,
as described elsewhere (van der Zee et al., Brain, 129:841-852
(2006)). Twenty ng genomic DNA was amplified in multiplex PCRs, at
annealing temperature of 58.degree. C., with fluorescently labeled
primers. PCR products were sized on an ABI 3730 automated sequencer
(Applied Biosystems), and genotypes were assigned using custom
genotyping software.
[0217] In silico analyses: Evolutionary conservation analysis was
performed using the Sorting Intolerant From Tolerant (SIFT v.2)
program (Ng and Henikoff, Nucleic Acids Res, 31:3812-3814 (2003))
to estimate the severity of amino acid mutations caused by single
nucleotide polymorphisms (SNPs) by comparison to the evolutionary
available pool and variability of amino acids at the mutated
positions in an alignment of homologous sequences. Different inputs
of selected homologues and their alignment were used: 61 unaligned
sequences from BLink (Wheeler et al., Nucleic Acids Res, 32
Database issue: D35-D40 (2004)), SIFT aligns, remove 100%
identical; ClustalX (Jeanmougin et al., Trends Biochem Sci,
23:403-405 (1998)) alignment of 61 sequences from BLink, remove
100% identical; Query sequence, SIFT finds homologues and aligns,
remove 100% identical. Scores <0.05 are predicted to affect
polypeptide function, scores >0.05 are predicted to be tolerated
(Table 13).
TABLE-US-00013 TABLE 13 PGRN missense mutations in FTD patients
Variation Patients Predicted Predicted Family Onset SIFT.sup.6
Alias.sup.1 Genome.sup.2 RNA.sup.3 polypeptide.sup.4 Origin
history.sup.5 (years) A B C EX7 + 35C > T g.101973C > T
c.743C > T p.Pro248Leu French - 71 0.02 0 0 EX7 + 65G > A
g.102003G > A c.773G > A p.Ser258Asn French - 53 0.14 0.24
0.03 EX10 + 115C > T g.103031C > T c.1294C > T p.Arg432Cys
French +* 65 0.19 0.02 0.19 Belgian - 66 Missense mutations were
absent in 646 control individuals. .sup.1EX: exon, exon numbering
starts with noncoding first exon EX0. .sup.2Numbering relative to
the reverse complement of GenBank .RTM. Accession Number AC003043.2
and starting at nt 1. .sup.3Numbering according to the largest PGRN
transcript (GenBank .RTM. Accession Number NM_002087.2) and
starting at translation initiation codon. .sup.4Numbering according
to the largest PGRN isoform (GenPept .RTM. Accession Number
NP_002078.1). .sup.5A negative family history indicates that no
first degree relatives were reported with dementia or FTD.
.sup.6SIFT consensus predictions (Ng and Henikoff, Nucleic Acids
Res, 31: 3812-3814 (2003)): A) 61 unaligned sequences from BLink
(Wheeler et al., Nucleic Acids Res, 32 Database issue: D35-D40
(2004)), SIFT aligns, remove 100% identical. B) ClustalX
(Jeanmougin et al., Trends Biochem Sci, 23: 403-405 (1998))
alignment of 61 sequences from BLink, remove 100% identical. C)
Query sequence, SIFT finds homologues and aligns, remove 100%
identical. Scores <0.05 are predicted to affect polypeptide
function (in bold), scores .gtoreq.0.05 are predicted to be
tolerated. *PGRN c.1294C > T, p.Arg432Cys was also detected in
an affected cousin of the index patient.
[0218] To assess the effects of mutations on structure and
stability of granulin domains, the full structures of individual
granulin domains were modeled based on the repetitive occurrence of
the disulfide connected beta-hairpin stack motif (crystal structure
PDB 1g26 (Tolkatchev et al., Biochemistry, 39:2878-2886 (2000))
using SwissPDB-Viewer (Guex and Peitsch, Electrophoresis,
18:2714-2723 (1997)), Modeller (Fiser and SalI, Methods Enzymol,
374:461-491 (2003)), ProQ (Wallner and Elofsson, Protein Sci,
12:1073-1086 (2003)), and FoldX (Schymkowitz et al., Nucleic Acids
Res, 33:W382-W388 (2005); FIG. 2). Differences in free energy
resulting from the mutations were estimated using FoldX analogous
to the SNPeffect method (Reumers et al., Bioinformatics,
22:2183-2185 (2006)), with the exception of an additional penalty
for forming or breaking disulfide bonds (Czaplewski et al., Protein
Eng Des Sel, 17:29-36 (2004)).
[0219] To estimate the effect of 5' regulatory region variations on
putative transcription factor binding sites we performed a
MatInspector analysis (World Wide Web at genomatix.de; Cartharius
et al., Bioinformatics, 21:2933-2942 (2005)). A core similarity
cut-off value of 1 and an optimized matrix similarity -0.05 were
used (Table 14).
TABLE-US-00014 TABLE 14 PGRN 5' regulatory variations in FTD
patients Effect on TFB sites Patients (optimized threshold/matrix
Variation Family Onset similarity).sup.4 Alias.sup.1 Genome.sup.2
Origin history.sup.3 (years) loss gain EX0 + 148G > T g.96172G
> T Belgian + 51* CDE (0.87/0.87) CDP (0.81/0.80) IVS0 + 46G
> T g.96282G > T Belgian - 49 -- Sp2 (0.80/0.85) IVS0 + 189C
> T g.96425C > T Belgian + 75 EGR1 (0.86/0.82) PAX5
(0.73/0.71) Promoter mutations were absent in 646 control
individuals. .sup.1EX: exon, IVS: intron, exon numbering starts
with noncoding first exon EX 0; .sup.2Numbering relative to the
reverse complement of GenBank .RTM. Accession Number AC003043.2 and
starting at nt 1; .sup.3A negative family history indicates that no
first degree relatives were reported with dementia or FTD,
.sup.4MatInspector analysis (Cartharius et al., Bioinformatics, 21:
2933-2942 (2005)), a core similarity cut-off value of 1 and an
optimized matrix similarity -0.05 were used. *Neuropathological
diagnosis at autopsy was conforming to FTDU.
Results
[0220] Apart from 13 reported null mutations (Cruts et al., Nature,
442:920-924 (2006); Le Ber et al., Human Mutat, PMID: 17436289
(2007)), extensive mutation analysis of PGRN in 332 FTD patients
identified 11 exonic and five intronic variants, as well as ten
variants in the 5' and two in the 3' regulatory regions of PGRN.
Three missense mutations (Table 13, FIG. 11) and three sequence
variations in the 5' regulatory region (Table 14) were detected
only in patients and were absent in 1292 control chromosomes. Also,
three silent mutations were unique to patients (Table 15). The
remaining 19 variants were present in patients as well as control
individuals and consisted of 11 rare (Table 16) and eight frequent
polymorphisms (Table 17).
TABLE-US-00015 TABLE 15 PGRN silent mutations in FTD patients
Variation Predicted Predicted Alias.sup.1 Genome.sup.2 RNA.sup.3
polypeptide.sup.4 EX1 + 109C > T g.100168C > T c.102C > T
p.Pro34 EX11 + 72C > T g.103314C > T c.1485C > T p.Cys495
EX12 + 51C > T g.103613C > T c.1695C > T p.Cys565 Silent
mutations were absent in 646 control individuals. .sup.1EX: exon,
exon numbering starts with noncoding first exon EX 0.
.sup.2Numbering relative to the reverse complement of GenBank .RTM.
Accession Number AC003043.2 and starting at nt 1. .sup.3Numbering
according to the largest PGRN transcript (GenBank .RTM. Accession
Number NM_002087.2) and starting at translation initiation codon.
.sup.4Numbering according to the largest PGRN isoform (GenPept
.RTM. Accession Number NP_002078.1).
TABLE-US-00016 TABLE 16 Rare PGRN polymorphisms Variation Predicted
rs FTD patients Controls Alias.sup.1 Genome.sup.2 Predicted
RNA.sup.3 protein.sup.4 number N = 332 (%) N = 646 (%) EX0 + 175C
> G g.96199C > G c.-3868C > G -- -- 0.30 0.46 IVS0 + 192G
> A g.96428G > A c.-3639G > A -- -- 0.90 0.15 IVS0 + 236G
> A g.96472G > A c.-3595G > A -- -- 2.41 1.39 IVS0 + 485A
> G g.96721A > G c.-3346A > G -- -- 0.60 1.24 IVS0 +
583_584insG g.96819_96820insG c.-3248_-3247insG -- -- 1.81 0.77 EX1
+ 106C > T g.100165C > T c.99C > T p.Asp33 -- 1.81 1.08
IVS2 + 7G > A g.100460G > A c.264 + 7G > A -- -- 0.30 0.77
EX3 + 15G > A g.100583G > A c.279G > A p.Gly93 -- 0.30
0.15 EX8 + 68G > A g.102332G > A c.903G > A p.Ser301 --
0.30 0.62 EX11 + 131G > C g.103373G > C c.1544G > C
p.Gly515Ala rs25647 0.30 0.15 3' + 21G > A g.104025G > A --
-- -- 0.30 0.15 .sup.1EX: exon, IVS: intron, UTR: untranslated
region, exon numbering starts with noncoding first exon EX 0.
.sup.2Numbering relative to the reverse complement of GenBank .RTM.
Accession Number AC003043.2 and starting at nt 1. .sup.3Numbering
according to the largest PGRN transcript (GenBank .RTM. Accession
Number NM_002087.2) and starting at translation initiation codon.
.sup.4Numbering according to the largest PGRN isoform (GenPept
.RTM. Accession Number NP_002078.1).
TABLE-US-00017 TABLE 17 Frequent PGRN polymorphisms Variation
Predicted Controls Alias.sup.1 Genome.sup.2 Predicted RNA.sup.3
Protein.sup.4 rs number N = 646 (%) 5'-111delC g.95914delC -- --
rs17523519 25.93 IVS0 + 561C > T g.96797C > T c.-3270C > T
-- rs3859268 26.32 IVS2 + 21 G > A g. 100474G > A c.264 + 21G
> A -- rs9897526 10.99 IVS3-47_-46insGTCA g.101083_101084insGTCA
c.350-47_350-46insGTCA -- -- 22.41 EX4 + 35T > C g.101164T >
C c.384T > C p.Asp128 rs25646 3.26 IVS4 + 24G > A g.101266G
> A c.462 + 24G > A -- rs850713 22.72 IVS7 + 7G > A
g.102011C > A c.835 + 7G > A -- -- 7.59 3'UTR + 78C > T
g.103778C > T c.1860C > T -- rs5848 27.19 .sup.1EX: exon,
IVS: intron, UTR: untranslated region, exon numbering starts with
noncoding first exon EX 0. .sup.2Numbering relative to the reverse
complement of GenBank .RTM. Accession Number AC003043.2 and
starting at nt 1. .sup.3Numbering according to the largest PGRN
transcript (GenBank .RTM. Accession Number NM_002087.2) and
starting at translation initiation codon. .sup.4Numbering according
to the largest PGRN isoform (GenPept .RTM. Accession Number
NP_002078.1).
[0221] PGRN missense mutations: The effect of c.743C>T,
p.Pro248Leu; c.773G>A, p.Ser258Asn; and c.1294C>T,
p.Arg432Cys on PGRN polypeptide sequence conservation and structure
was investigated in silico (FIG. 11, Table 13). Two missense
mutations, p.Pro248Leu and p.Arg432Cys, were predicted to be
pathogenic. SIFT analysis predicted that Pro248Leu would
dramatically perturb polypeptide function (p=0.00), which was in
accordance with the structural modeling that revealed a significant
destabilizing effect of 6.22 .+-.0.54 kcal/mol on the granulin
domain. In the granulin domain structure, Pro248 is located in a
loop connecting two .beta.-hairpins where it is most likely
essential to constrain a sharp and rigid turn (FIG. 11B). Moreover,
Pro248 is adjacent to two Cys residues of the granulin B domain at
a position which is 100% conserved between the seven granulin
domains. Arg432Cys is located between granulin domains C and D
(FIG. 11A). Depending on the parameters used, SIFT analysis
predicted that this mutation perturbed the biological function of
PGRN (p=0.02; Table 13). In addition, no Cys residues are normally
observed between the granulin domains. Arg432Cys was detected in
one Belgian (DR121.1, onset age 66 years) and one French FTD
patient (F98/001, onset age 65 years). Allele sharing analysis
using markers located in and around PGRN demonstrated that six
consecutive STR markers in a region of 5.36 Mb centromeric of PGRN
were shared as well as all intragenic PGRN SNPs. In 102 control
individuals, EM estimation could not reveal this shared haplotype,
neither was this allele combination observed.
[0222] Ser258Asn, located in granulin domain B, affects an amino
acid residue that is conserved across orthologs but not between the
granulin domains (FIG. 11A). SIFT analysis predicted a moderately
significant effect for this mutation on polypeptide function
(p=0.03; Table 13); however, structural modeling failed to show a
destabilizing effect on the granulin domain.
[0223] PGRN sequence variations in 5' regulatory region: The three
promoter variants were analyzed using MatInspector to assess
whether they potentially altered transcription factor binding (TFB)
specificities (Table 14). MatInspector analysis predicted gain
and/or loss of TFB sites for all three variations. One promoter
mutation, g.96172G>T (EX0+148G>T) was predicted to create a
CDP site and loss of a CDE site. CDP (CCAAT displacement protein)
is a transcription factor for many diverse cellular genes that are
involved in most cellular processes, including differentiation,
development, and proliferation (Nishio and Walsh, Proc Natl Acad
Sci USA, 101:11257-11262 (2004)), and CDE is able to regulate gene
transcription in a cell cycle-dependent manner (Lange-zu et al.,
FEBS Lett, 484:77-81 (2000)). g.96282G>T (IVS0+46G>T)
predicted gain of one Sp2 domain. Sp/XKLF proteins are shown to
regulate transcription of genes involved in cell cycle control,
oncogenesis, and differentiation (Moorefield et al., J Biol Chem,
279:13911-13924 (2004)). Finally, g.96425C>T (IVS0+189C>T)
predicted loss of one EGR1 site and gain of one PAXS site. EGR1
belongs to the early growth response family of zinc finger
transcription factors and is involved in many processes related to
growth, differentiation, and injury repair (McKee et al., Brain
Res, 1088:1-11 (2006)). The PAXS transcription factor has an
important role in development of both B-lymphocytes and brain
(Steinbach et al., Int J Cancer, 93:459-467 (2001)).
[0224] As described herein, three missense mutations, c.743C>T,
p.Pro248Leu; c.773G>A, p.Ser258Asn; and c.1294C>T,
p.Arg432Cys were identified in four patients (4/332 or 1.2%), and
were absent in 1292 control chromosomes. In silico predictions
based on evolutionary conservation and structure indicated that at
least two mutations, p.Pro248Leu and p.Arg432Cys, are likely to be
pathogenic since they significantly affect polypeptide structure
and stability. Pro248, located in granulin domain B, is
evolutionary conserved across PGRN orthologs including rodents and
between all granulin domains. Further, molecular modeling indicated
that Pro248 is located in a loop of the .beta.-hairpin stack of
granulin B.
[0225] p.Arg432Cys was observed in two independently ascertained
FTD patients of Belgian (DR121.1) and French (F98/001) ancestry.
These patients shared a common haplotype across the PGRN locus and
flanking centromeric region of at least 5.36 Mb at 17q21,
indicative of a common founder effect. Combined with the reported
minimal candidate region for FTDU-17, this reduced the FTDU-17
locus to 3.18 Mb centromeric of PGRN and excluding MAPT. F98/001
had a positive family history of dementia and p.Arg432Cys was
detected in another affected cousin, further supporting the
pathogenic nature of the mutation. No familial anamnesis was
reported for patient DR121.1. However, this patient was an only
child which can explain why FTD presented as sporadic in this
family.
[0226] Three patient-specific sequence variations of highly
conserved nucleotides (3/332 or 0.9%) were observed in the 5'
regulatory region of the PGRN gene. MatInspector analysis estimated
changes in TFB sites for all three variants. g.96172G>T
(EX0+148G>T) was identified in a Belgian patient diagnosed with
familial FTD and onset age of 51 years. This patient died at the
age of 55 years, and brain autopsy confirmed the diagnosis of FTD
with ub-ir neuronal inclusions (FTDU). These data suggested that
changes in PGRN transcriptional activities could be involved in
risk for FTD.
[0227] In addition to patients, mutation analysis of PGRN in 646
control individuals revealed 25 sequence variations that were
present only in control individuals (Table 18). Rare PGRN variants
were detected in 11.3% (73/646) of control individuals versus 12.4%
(41/332) of patients. This observation indicated the natural
genetic variability of PGRN and that the pathogenic nature of a
variation may depend on the impact of the variation on polypeptide
structure and stability. A c.473G>A, p.Cys158Tyr mutation was
found in an 82 year old control person. This variation may be
either insufficient to cause disease or an example of
non-penetrance. Non-penetrance of PGRN null mutations has been
reported in the Belgian founder family DR8 segregating PGRN
mutation g.96241G>C, IVS0+5G>C as well as in other American
FTD families (Gass et al., Hum Mol Genet, 15:2988-3001 (2006)).
TABLE-US-00018 TABLE 18 Rare PGRN variants in control individuals
Variation Predicted Controls Alias.sup.1 Genome.sup.2 Predicted
RNA.sup.3 protein.sup.4 N = 646 (%) EX0 + 17G > C g.96041G >
C c.-4026G > C -- 0.15 EX0 + 17G > A g.96041G > A c.-4026G
> A -- 0.15 IVS0 + 401C > T g.96637C > T c.-3430C > T
-- 0.15 IVS0 + 484T > C g.96720T > C c.-3347T > C -- 0.15
IVS0 + 516C > T g.96752C > T c.-3315C > T -- 0.15 IVS1 +
51G > A g.100255G > A c.138 + 51G > A -- 0.15 IVS2 - 43G
> C g.100526G > C c.265 - 43G > C -- 0.15 EX3 + 53G > A
g.100621G > A c.317G > A p.Ser106Asn 0.15 IVS3 + 11G > C
g.100664G > C c.349 + 11G > C -- 0.15 IVS3 + 52_ + 53delTG
g.100705_100706delTG c.349 + 52_349 + 53delTG -- 0.15 EX5 + 11G
> A g.101354G > A c.473G > A p.Cys158Tyr 0.15 EX6 + 37G
> A g.101629G > A c.635G > A p.Arg212Gln 0.15 EX6 + 60A
> T g.101652A > T c.658A > T p.Thr220Ser 0.15 IVS6 + 57A
> G g.101759A > G c.708 + 57A > G -- 0.15 EX7 + 73C > A
g.102011C > A c.781C > A p.Leu261Ile 0.15 EX7 + 96G > A
g.102034G > A c.804G > A p.Thr268 0.15 EX9 + 63G > A
g.102514G > A c.996G > A p.Lys332 0.15 IVS9 - 56G > A
g.102861G > A c.1180 - 56G > A -- 0.15 IVS9 - 4C > A
g.102916C > A c.1180 - 4C > A -- 0.15 EX10 + 74G > A
g.102990G > A c.1253G > A p.Arg418Gln 0.15 EX10 + 118C > T
g.103034C > T c.1297C > T p.Arg433Trp 0.46 EX10 + 230C > T
g.103146C > T c.1409C > T p.Pro470Leu 0.15 EX11 + 12C > T
g.103254C > T c.1425C > T p.Cys475 0.15 EX12 + 4G > A
g.103566G > A c.1648G > A p.Val550Ile 0.31 3'UTR + 268G >
T g.103968G > T c.2050G > T -- 0.15 .sup.1EX: exon, IVS:
intron, UTR: untranslated region, exon numbering starts with
noncoding first exon EX 0. .sup.2Numbering relative to the reverse
complement of GenBank .RTM. Accession Number AC003043.2 and
starting at nt 1. .sup.3Numbering according to the largest PGRN
transcript (GenBank .RTM. Accession Number NM_002087.2) and
starting at translation initiation codon. .sup.4Numbering according
to the largest PGRN isoform (GenPept .RTM. Accession Number
NP_002078.1).
[0228] PGRN mutations (nonsense, frameshift, missense, and promoter
mutations) can account for 8.43% of FTD patients (28/332) and
18.69% of patients with a positive family history of FTD (20/107).
In the group of patients with pathologically confirmed FTD, the
PGRN mutation frequency would be 53.33% (8/15) and rise to 66.67%
of patients with a FTDU diagnosis (8/12). These PGRN mutations most
likely exert their pathogenic effect through reduced PGRN
polypeptide levels by loss of transcript or reduced transcription
(nonsense or frameshift transcripts and promoter mutations), loss
of translation (Met1 mutations) or loss of polypeptide function
(missense mutations).
Example 5
Progranulin Null Mutation Carriers Present with High Clinical
Heterogeneity in an Extended Belgian Founder Family
[0229] A mutation analysis of PGRN was performed in a large, well
characterized Belgian Alzheimer's disease (AD) patient group and
two independently ascertained Belgian Parkinson's disease (PD)
populations. The AD patient group consisted of 666 AD patients
(mean onset age 74.6.+-.8.8 years, 65.5% female) derived from a
large prospective study of neurodegenerative and vascular dementia
in Flanders, Belgium (Engelborghs et al., J Neurol Neurosurg
Psychiatry, 74:1148-51 (2003); Engelborghs et al., Neurobiol Aging,
27:285-92 (2006)). Each patient underwent a diagnostic
neuropsychological examination, including a Mini Mental State
Examination (MMSE; Folstein et al., J Psychiatr Res, 12:189-98
(1975)), structural neuroimaging consisting of brain computerized
tomography (CT), and/or magnetic resonance imaging (MRI) and
functional neuroimaging (single photon emission computed tomography
(SPECT). Consensus diagnosis of possible or probable AD was given
by at least two neurologists based on the National Institute of
Neurological and Communicative Disorders and Stroke/Alzheimer
Disease and Related Disorders Association (NINCDS/ADRDA) criteria
(McKhann et al., Neurology, 34:939-44 (1984)). Most patients met
the criteria for probable AD (N=627), whereas a small number of
patients (N=39) were diagnosed as possible AD. In 48 probable AD
patients who underwent autopsy, clinical diagnosis was confirmed
neuropathologically. In 26.0% of patients, the disease was
considered familial based on the occurrence of at least one
first-degree relative suffering from dementia. Cerebrospinal fluid
(CSF) was sampled in a subset of patients (N=365), and CSF levels
of amyloid-.beta. peptide (A.beta..sub.1-42), total tau (T-tau),
and tau phosphorylated at threonine 181 (P-tau.sub.181P) were
determined in duplicate by technicians who were blind to the
clinical data using commercially available single parameter ELISA
kits (Innogenetics, Gent, Belgium; Engelborghs et al., Neurobiol
Aging, PMID: 17428581 (2007)).
[0230] Belgian PD patients (N=255, mean age at onset 59.4.+-.10.9
years, 43.1% female) were derived from two independent studies.
Eighty-two patients were selected from the same prospective study
as the AD patients (Engelborghs et al., J Neurol Neurosurg
Psychiatry, 74:1148-51 (2003)). A set of 173 PD patients was
selected from a retrospective epidemiological study which was
ascertained to assess the effect of environmental risk factors in
PD (Pals et al., Eur J Epidemiol, 18:1133-42 (2003)). In both
studies, a diagnosis of PD required three out of four of the
following features to be present: (1) bradykinesia, (2) rigidity,
(3) tremor, and (4) asymmetrical onset. Response to levodopa also
was required to be present. Individuals had a positive family
history of PD if at least one first degree relative presented with
parkinsonism (3.5%).
[0231] The control group consisted of 459 unrelated, healthy,
Dutch-speaking Belgian individuals (mean age at inclusion
58.6.+-.16.0 years, 54.9% female). The control group included
subjects (N=275) without neurological or psychiatric antecedents,
or with neurological complaints without organic disease involving
the central nervous system, and subjects (N=184) selected among
married-in individuals in families with neurological diseases
collected for genetic linkage studies.
[0232] After informed consent, blood samples of each proband were
collected for genetic studies. For mutation carriers, additional
relatives were collected for haplotype phase determination and
segregation studies.
[0233] PGRN sequencing: Patients and control individuals were
analyzed for mutations in coding exons 1 to 12 (Cruts et al.,
Nature, 442:920-4 (2006)) and non-coding exon 0. Primers were
designed using Primer3 software (Rozen and Skaletsky, Methods Mol
Biol, 132:365-86 (2000)). Twenty ng of genomic DNA were PCR
amplified using individually optimized reaction conditions.
Amplification products were purified using 1 U of antarctic
phosphatase (New England Biolabs, Ipswich, Mass.) and 1 U of
exonuclease I (New England Biolabs). Purified PCR products were
sequenced in both directions using PCR primers or internal
sequencing primers, and the Big Dye.RTM. Terminator v3.1 Cycle
Sequencing kit (Applied Biosystems, Foster City, Calif.) according
to manufacturer's protocol. Labeled products were separated on an
Applied Biosystems 3730x1 DNA Analyzer (Applied Biosystems) and
analyzed using NovoSNP (Weckx et al., Genome Res, 15:436-42
(2005)).
[0234] PGRN transcript analysis: Lymphocytes were isolated from
total blood using Ficoll density gradient centrifugation (Greiner
Bio-One, Wemmel, Belgium), and mRNA was isolated from lymphocytes
using the Chemagic mRNA Direct Kit (Chemagen, Baesweiler, Germany).
First-strand cDNA was synthesized using the SuperScript III
First-Strand Synthesis System for RT-PCR kit and random hexamer
primers. After PCR amplification of part of the transcript (exon
5-6 to 3' UTR), genotypes at the mutated position were generated by
direct sequencing as described elsewhere Cruts et al., Nature,
442:920-4 (2006)).
[0235] STR genotyping: In patients carrying IVS0+5G>C and
additional family members, 12 STR markers located in the 8 cM
ancestral PGRN haplotype observed in the Belgian DR8 founder family
were genotyped (van der Zee et al., Brain, 129:841-52 (2006)).
Twenty ng of genomic DNA were PCR amplified in four multiplex
reactions (van der Zee et al., Brain, 129:841-52 (2006)).
Fluorescently labeled products were resolved on an Applied
Biosystems 3730x1 DNA Analyzer (Applied Biosystems). Genotypes were
assigned using custom genotyping software. Allele frequencies for
each STR marker were estimated in 102 unrelated Belgian control
individuals (van der Zee et al., Brain, 129:841-52 (2006)).
[0236] Neuropathology: A brain autopsy was performed on patient
DR205.1. Brain hemispheres were fixed in buffered formalin, and
tissues from the right and left frontal and parietal cortices,
hippocampus, basal ganglia, midbrain, pons, medulla oblongata, and
cerebellum were further processed for paraffin embedding. Ten .mu.m
thick sections were sliced and stained with hematoxylin and eosin,
cresyl violet, Bodian and Gallyas. Five .mu.m thick sections were
also sliced from all brain regions and immunohistochemistry was
performed with the following antibodies: 4G8 (anti-A.beta.;
Senetek, Napa, Calif.), AT8 (directed against abnormally
phosphorylated PHF-tau; Innogenetics, Ghent, Belgium), ubiquitin
(Dako, Glostrup, Denmark), .alpha.-synuclein (Dako), anti-glial
fibrillary acidic protein (GFAP; Dako), and rabbit TAR DNA-binding
protein-43 antisera (TDP-43; Proteintech Group, Chicago, Ill.).
Antigen retrieval for A.beta. immunohistochemistry was performed by
treating sections with 98% formic acid for five minutes at room
temperature for 4G8, .alpha.-synuclein, and TDP-43, and by boiling
in citrate buffer (pH 6) for GFAP and ubiquitin. All dilutions were
made in 0.1 M PBS with 0.1% bovine serum albumin. Staining was
performed with appropriate secondary antibodies and
streptavidin-biotin-horse-radish peroxidase (ABC/HRP) using
chromogen 3'3' diaminobenzidine (DAB; Roche, Mannheim, Germany), as
described elsewhere (Pirici et al., J Neuropathol Exp Neurol,
65:289-301 (2006)).
Results
[0237] PGRN mutations in AD and PD groups: Direct genomic
sequencing of PGRN in 666 AD patients, 255 PD patients, and 459
control individuals identified a nonsense mutation, p.Arg535X, in
one AD patient and a null mutation, IVS0+5G>C, in two AD
patients and one PD patient (Table 19).
TABLE-US-00019 TABLE 19 PGRN null mutations identified in Belgian
AD and PD patients Mutation Onset age Family Predicted Predicted
Patient ID Presentation (years) History.sup.1 Location.sup.2 Alias
Genomic.sup.3 RNA.sup.4 polypeptide DR142.1 AD 66 ? IVS 0 IVS0 + 5G
> C g.96241G > C -- p.0 DR25.14 AD 76 + IVS 0 IVS0 + 5G >
C g.96241G > C -- p.0 DR205.1 PD 54 + IVS 0 IVS0 + 5G > C
g.96241G > C -- p.0 DR181.1 AD 72 ? EX 11 EX11 + 190C > T
g.103432C > T c.1690C > T p.Arg535X Note: .sup.1+: family
history of dementia positive in first degree, ?: family history of
dementia unknown; .sup.2EX: exon, IVS: intron, exon numbering
starts with non-coding first exon EX 0; .sup.3Numbering relative to
the reverse complement of GenBank .RTM. Accession Number AC003043
and starting at nt 1; .sup.4Numbering according to the largest PGRN
transcript (GenBank .RTM. Accession Number NM_002087.2) and
starting at the translation initiation codon; .sup.5Numbering
according to the largest PGRN isoform (GenPept .RTM. Accession
Number NP_002078.1).
[0238] The p.Arg535X nonsense mutation resulted in the formation of
a premature termination codon (PTC) at position 535 (Table 19). To
determine whether a transcript encoded by nucleic acid containing
this mutation is degraded by the nonsense mediated decay (NMD)
machinery, sequence analysis was performed on cDNA prepared from
the patient's lymphocytes, and the results were compared to
sequences obtained from the patient's genomic DNA (gDNA). The
mutated allele was present in both gDNA and cDNA sequences,
indicating that the mutant transcript is not degraded and
suggesting that the mutant transcript is translated into a
truncated polypeptide missing 59 C-terminal amino acids.
[0239] PGRN IVS0+5G>C mutation carriers in AD and PD groups: An
intron 0 splice donor site mutation, IVS0+5G>C, was detected in
two AD patients (DR25.14 and DR142.1) and one PD patient (DR205.1;
Table 19). The IVS0+5G>C mutation was identified in eight
probands of a large Belgian FTDU-17 founder family DR8 (Cruts et
al., Nature, 442:920-4 (2006); van der Zee et al., Brain,
129:841-52 (2006)).
[0240] The three patients, DR25.14, DR142.1, and DR205.1, carried
at least a part of the DR8 linked disease haplotype (Table 20),
reducing the 8.0 cM founder haplotype to 1.61 cM (4.37 Mb) and
excluding the gene encoding microtubule associated protein tau
(MAPT). Genealogical examination indicated that there were no
living affected (first or second degree) relatives available to
demonstrate segregation of the mutation with dementia for mutation
carriers DR142.1 and DR205.1 (FIG. 12). DR25.14 had a positive
family history of dementia, with a mother and two maternal aunts
suffering from late-onset dementia. Genealogical examination
revealed that this patient is closely related to a branch, family
DR25, of the Belgian DR8 founder family (FIGS. 12 and 13), e.g.,
the proband DR25.1 and her sibling DR25.5 being first cousins of
DR25.14. Segregation of the disease haplotype in the extended
pedigree of DR25 is shown in FIG. 13.
TABLE-US-00020 TABLE 20 Haplotype sharing of STR markers in IVS0 +
5G > C mutation carriers Genetic Physical Frequency location
location Linked linked Marker (cM) (Mb) allele.sup.a allele
(%).sup.b DR142.1 DR25.14 DR205.1 D17S1818 60.40 34.42 -- -- 446
430 430 D17S1814 61.48 35.37 465 19 465 465 465 D17S800 62.01 36.31
367 10 361 367 367 D17S1787 62.01 36.98 181 35 181 181 181 minimal
D17S1793 63.09 37.61 392 81 392 392 392 founder D17S951 63.62 39.18
143 23 143 143 143 haplotype PGRN -- 39.78 -- -- -- -- -- (1.61 cM)
D17S1861 63.62 40.16 278 6 278 278 278 D17S934 63.62 40.41 359 27
359 359 359 Chr17-16 -- 40.68 401 22 401 401 399 D17S810 63.62
40.84 186 30 186 186 186 MAPT -- 41.33 -- -- -- -- -- D17S920 64.16
42.17 326 64 326 326 326-332 D17S931 66.85 42.36 277 9 277 277 265
Chr17-43 -- 42.68 233 47 233 233 239 D17S1795 68.44 45.28 -- -- 399
397 391 Linked alleles are represented in bold; .sup.aancestral
haplotype identified in the DR8 founder family (van der Zee et al.,
Brain, 129: 841-52 (2006)); .sup.ballele frequencies were
calculated in 92 control chromosomes. Genetic locations of the STR
markers were obtained from the Marshfield gender-averaged map.
Physical locations relative to NCBI genome build 35.
[0241] Clinical characteristics of the IVS0+5G>C carriers are
summarized in Table 21. Both AD patients (DR25.14 and DR142.1)
presented with complaints and symptoms of forgetfulness. In
addition to severe impairment of recent memory, which first became
apparent at age 76 years, patient DR25.14 had deficits of long-term
memory. She had become apathetic, displaying a lack of initiative.
Further, reduced verbal fluency was noted, but naming was
unaffected. The patient was disoriented in both time and space, and
displayed impaired problem solving. The CSF biomarker profile was
typical for AD, with a decreased level of A.beta..sub.1-42 and
increased levels of total tau and P-tau.sub.181P. In patient
DR142.1, the early symptoms were first noted by members of her
choir, who reported repetitive phone calls and repetition of
stories and questions when patient DR142.1 was 66 years old.
[0242] Disorientation in space caused her to get lost on several
occasions. Towards the late stages of the disease, a loss of
decorum became obvious. A year before death, communication through
spontaneous speech was no longer possible, and she displayed verbal
and motor stereotypes. The age at onset of AD varied considerably
between both mutation carriers (66 and 76 years), which is in
accordance with the wide range in onset ages seen in family DR8
(Cruts et al., Nature, 442:920-4 (2006); van der Zee et al., Brain,
129:841-5 (2006); Table 21). Both AD patients had a Middelheim
Frontality Score (MFS) of 4 (De Deyn et al., Int J Geriatr
Psychiatry, 20:70-9 (2005)).
TABLE-US-00021 TABLE 21 Overview of clinical and pathological
characteristics of PGRN IVS0 + 5G > C carriers in the DR8
founder family Age at death (.dagger.)/ Clinical Age at current
Presenting Patient Gender diagnosis onset age impairments
Additional features DR2.1 M FTD 66 71.sup..dagger. .dwnarw.memory,
disinhibition, .dwnarw.verbal .dwnarw.concentration fluency DR2.3 F
PNFA 63 72.sup..dagger. PNFA, apathy DR2.17 M FTD 69 71
.dwnarw.spontaneous speech, perseveration, dysarthria, apathy DR8.1
F FTD 62 69.sup..dagger. .dwnarw.word-finding, apathy,
disinhibition, .dwnarw.memory DR8 III.18 F FTD 51 55.sup..dagger.
.dwnarw.spontaneous speech, .dwnarw.memory, control of echolalia,
apathy, emotions, loss of .DELTA.behavior decorum DR8.15 F PPA 63
64 aphasia, verbal apraxia DR25.1 F FTD 69 75.sup..dagger.
.dwnarw.spontaneous speech, repetitive movement .dwnarw.initiative,
of the hands hyperorality DR25.5 M FTD 70 74.sup..dagger. aphasia,
apathy, .DELTA.behavior, .DELTA.personality DR25.14 F AD 76
78.sup..dagger. .dwnarw.memory, .dwnarw.verbal CSF biomarker
expression, apathy profile typical for AD DR26.1 M PNFA 65
68.sup..dagger. progressive apraxia of speech DR27.1 F FTD 58
64.sup..dagger. .DELTA.behavior (decorum, .dwnarw. verbal fluency,
aggression) extrapyramidal rigidity DR28.1 M PNFA 57
62.sup..dagger. PNFA parkinsonism (tremor, rigidity) DR31.1 M PNFA
66 70.sup..dagger. PNFA DR119.1 F PNFA 45 47 .dwnarw.word-finding,
.dwnarw.verbal expression DR142.1 F AD 66 76.sup..dagger.
.dwnarw.memory .dwnarw.spontaneous speech, loss of decorum DR205.1
M PD + frontal 56 61.sup..dagger. resting tremor, rigidity, mutism,
echolalia, dysfunction bradykinesia loss of judgment, disinhibition
Structural neuroimaging Functional neuroimaging Patient (CT/MRI)
(SPECT/PET) Pathology DR2.1 Global mainly NA NA subcortical atrophy
(CT) DR2.3 Global cortico- Relative bilateral frontal, FTLD-U + AD
subcortical atrophy parietal and temporal HP, (Braak A-II (NFT R
> L; PWML R > L (SPECT) max 20/mm.sup.2; (MRI) frequent SP))
DR2.17 Global moderate Relative frontal and NA cortical and
frontoparietal HP, L > R. subcortical atrophy Relative HP of
left thalamus. (MRI) Diastasis of frontal cortical activity (SPECT)
DR8.1 Frontotemporoparietal Relative bilateral frontal HP, FTLD-U +
marked cortical and L > R (SPECT) neuronal loss ZC SN,
subcortical atrophy rare lewy bodies L > R (MRI) DR8 III.18
Global cortical and Severe relative bifrontal HP, NA subcortical
atrophy L > R (SPECT) (CT) DR8.15 Postcontusional NA bilateral
frontal and R temporal (MRI) DR25.1 Cortical and Severe relative
bilateral FTLD-U + marked subcortical frontal frontal, parietal and
temporal neuronal loss ZC SN + atrophy; HP. Scintigraphic few NFT
(max periventricular indications of subcortical 10/mm.sup.2) in
white matter lesions loss (SPECT). hippocampus (CT) DR25.5 Cortical
and Bilateral frontal, parietal and FTLD-U subcortical atrophy,
temporal HP L > R; right maximal frontally, cerebellar HP (PET)
L > R; PWML (MRI) DR25.14 Cortico-subcortical Relative
frontoparietal HP NA atrophy. PWML. extending into both anterior
Lacunar infarctions temporal lobes. Preserved in the basal ganglia
sensori-motor cortex activity bilaterally (CT) (SPECT) DR26.1
Global subcortical Relative frontal, temporal NA and cortical
atrophy and parietal HP P > R, maximal frontally relative HP of
basal ganglia and temporally, and lentiform nucleus. R L > R
(MRI) cerebellar HP(SPECT) DR27.1 Corticosubcortical Bilateral
frontal, temporal FTLD-U atrophy, maximal and parietal HP R > L.
Right frontotemporally HP at parieto-occipital R > L; PWML
transition. Left cerebellar HP (MRI) (PET) DR28.1 NA Relative
frontal, temporal FTLD-U + mild and parietal HP L > R neuronal
loss ZC SN + (SPECT) few SP (max 40/mm.sup.2), NFT DR31.1 Global
cortical and Marked relative bilateral FTLD-U + neuronal minor
subcortical frontal and temporal HP loss ZC SN + rare temporal
atrophy L > R, diastasis of frontal perivascular Abeta L > R
(MRI) cortical activity (SPECT) deposits, NFT max 7/mm.sup.2
DR119.1 Anterior temporal PET NA atrophy L > R (MRI) DR142.1
Slightly asymmetric Relative frontal, temporal NA (right > left)
and parietal HP, R > L. subcortical and Diastasis of frontal
cortical cortical atrophy. activity. Preserved sensori- PWML (CT)
motor cortex activity (SPECT) DR205.1 NA NA FTLD-U + PD + DCP CT:
computerized tomography; MRI: magnetic resonance imaging; SPECT:
single photon emission computerized tomography; PET: positron
emission tomography; PNFA: progressive non-fluent aphasia; R:
right; L: left; PWML: periventricular white matter lesions; HP:
hypoperfusion; NFT: neurofibrillary tangle; SP: senile plaques; ZN:
zona compacta; SN: substantia nigra; NA: not available.
[0243] PD patient DR205.1 was diagnosed with PD at age 56 years,
one year after onset of symptoms. Symptoms included global and
cogwheel rigidity, hypomimia, bradykinesia, shuffling gait,
postural instability, and a discrete resting tremor. The patient
responded well to levodopa treatment. Because of reported loss of
concentration, a neuropsychological examination was performed one
year after onset, which revealed no abnormalities. Three years
after disease onset, progressive memory problems were noted, which
were accompanied by apathy, hypophonia, and reduced verbal
expression. Behavioral observation and neuropsychological testing
then revealed loss of insight and judgment, changes in sexual
behavior, impaired control of emotions, mutism, and echolalia, with
comparatively spared memory and spatial abilities. These findings
were compatible with pronounced frontal dysfunction in light of PD,
or with frontotemporal dementia. DR205.1 had an MFS score of 6. Of
interest, DR205.1 had a mother and two maternal aunts with
late-onset dementia according to family informants, but no
relatives with parkinsonism. At age 61, the patient died, and
autopsy was performed.
Pathological characteristics: Pathological confirmation of the
clinical diagnosis of both AD patients carrying IVS0+5G>C could
not be obtained since both carriers died without autopsy; however,
the proband of family DR25 (DR25.1) and her sibling (DR25.5) had
pathologically confirmed FTLD-U (Cruts et al., Nature, 442:920-4
(2006); Table 21).
[0244] For DR205.1, who was clinically diagnosed with PD, autopsy
was performed. On gross examination, a severe cortical atrophy,
especially of the frontal lobe, was remarkable. The caudate nucleus
was also atrophied and substantia nigra and locus coeruleus were
severely depigmented. Histochemistry and immunohistochemical data
showed a severe neuronal loss and gliosis in all neocortical
regions analyzed, with many of the surviving neurons containing
lipofuscin. Anti-ubiquitin immunoreactivity showed a huge burden of
thread-like inclusions in layers II and III, as well as in deeper
cortical layers and the white matter Infrequent Lewy body
inclusions were observed in brain stem, caudate nucleus, and
occasionally in cortical regions. These inclusions were stained
with ubiquitin and .alpha.-synuclein antibodies, but not with tau
antibodies. In neocortical regions and basal ganglion,
ubiquitin-positive and tau- and .alpha.-synuclein-negative
inclusions were observed. Lenticular, cat-eye type of inclusions
were especially abundant in the basal ganglion. Staining for the
FTLD-U inclusion polypeptide TAR DNA-binding protein 43 (TDP-43;
Neumann et al., Science, 314:130-3 (2006)) showed that the
ubiquitin-positive inclusions (NII's and neuronal cytoplasmic
inclusion (NCI's)) contained TDP-43. Normal nuclear staining was
observed in unaffected neurons. Based on these findings, the
patient was diagnosed as having a mixed pathology of diffuse Lewy
body disease and FTLD-U. Interestingly, numerous A.beta.-stained
dense-core plaques were also observed in cortical and hippocampal
regions.
[0245] The DR8Founder Family: Including the three mutation
carriers, DR25.14, DR142.1, and DR205.1, the DR8 founder family
comprises ten different branches extending over at least seven
generations, and consists of at least 250 individuals. Genealogical
information is available for 237 of the 250 individuals (FIG. 12).
Of the 237 individuals, 44 are affected. The onset age is known for
39 patients, and the mean age of onset is 64.4 years, ranging from
45-78 years. Thirty five % of patients are male. In those patients
(n=16) for whom detailed medical information was available,
diagnosis was probable AD in two patients, PD with frontal
dysfunction or frontotemporal dementia in one patient, and
frontotemporal lobar degeneration in 13 patients, 11 of which were
reported elsewhere, with a presenting diagnosis of progressive
non-fluent aphasia (PNFA; 4/11) or FTD (7/11; van der Zee et al.,
Brain, 129:841-52 (2006); Table 21). Prominent presenting symptoms
in these patients included language impairment (PNFA, reduced
spontaneous speech) and behavioral and personality changes, of
which apathy was most frequently noted (5/11). A first cousin of
DR8.1 (DR8.15) carrying the IVS0+5G>C mutation developed a
primary progressive aphasia at age 63 years. With unimpaired memory
and activities of daily living, her language impairment was
characterized by aphasia with reduced fluency, excessive
phonological paraphasia of spoken and written language, verbal
apraxia, and perseverations. One year after disease onset, the
patient started displaying behavioral changes such as disinhibited
laughter and stereotypic involuntary movements of tongue and
jaw.
[0246] Through mutation analysis of PGRN in a sample of FTD
patients, an additional IVS0+5G>C carrier was identified
(DR119.1; Cruts et al., Nature, 442: 920-4 (2006)), defining a
separate branch of the founder family. This patient presented with
word finding difficulties and social withdrawal at age 45 years.
Memory was preserved. Her speech was characterized by shortening
and simplification of sentences and phonemic paraphasia, which led
to a diagnosis of PNFA. The patient's father died at age 65 years
after a 5-year period of progressive language impairment and
behavioral changes.
[0247] In three out of 13 patients diagnosed with FTLD, impairment
of memory was an early symptom. Parkinsonism was observed in one
patient with a diagnosis of primary progressive aphasia (PPA,
DR28.1), attributed to use of anti-psychotic medication. Several
siblings were reported to have had parkinsonian symptoms according
to family informants.
[0248] Autopsy was performed in a total of eight patients, and
confirmed the diagnosis of FTLD-U with ubiquitin-immunoreactive
NII's in all cases, with a concurrent diagnosis of PD in DR205.1
and a concurrent diagnosis of early AD (Braak stage A-II) in DR2.3
(presenting symptoms: PNFA and behavioral changes). In three other
brains, rare amyloid deposits or neurofibrillary tangles were
observed, which were limited to hippocampal areas in DR31.1 and
25.1. In four patients other than DR205.1, mild to marked neuronal
loss of the zona compacta of the substantia nigra was found, with
melanin in astrocytic cytoplasm in three patients. Rare Lewy bodies
were observed only in one patient.
[0249] In addition to null mutations, a number of mutations
affecting the sequence of PGRN polypeptide were identified (Table
22). The majority of the missense mutations that were found in
patients only (5/7) are located in domains encoding granulin
polypeptides, suggesting that these mutations could interfere with
the function of the granulin polypeptides in brain. Missense
mutations also were identified in patients diagnosed with FTLD (van
der Zee et al., Hum Mutat, 28:416 (2007)), of which two out of
three (p.Pro248Leu and p.Arg432Cys) were predicted to have a
substantial effect on PGRN polypeptide stability. Three of the
missense mutations, p.Pro451Leu, p.Cys139Arg, and p.Arg564Cys, can
have a similar effect on polypeptide structure, p.Pro451Leu
abrogating a highly conserved Pro-residue, and p.Cys139Arg and
p.Arg564Cys creating or destroying Cys-residues (Table 22).
TABLE-US-00022 TABLE 22 Mutations affecting PGRN polypeptide
sequence Mutation Number (%) Predicted Predicted Control Alias
Genome.sup.1 RNA.sup.2 polypeptide.sup.3 Location.sup.4 Patients
individuals EX1 + 106C > A g.100165C > A c.99C > A
p.Asp33Glu EX 1 2 (0.22) -- EX4 + 66T > C g.101195T > C
c.415T > C p.Cys139Arg EX 4 1 (0.11) -- EX6 + 37G > A
g.101629G > A c.635G > A p.Arg212Gln EX 6 -- 1 (0.22) EX7 +
73C > T g.102072C > T c.781C > T p.Leu261Ile EX 7 1 (0.11)
1 (0.22) EX9 + 37G > A g.102488G > A c.970G > A
p.Ala324Thr EX 9 2 (0.22) -- EX10 + 118C > T g.103034C > T
c.1297C > T p.Arg433Trp EX 10 5 (0.54) 1 (0.22) EX10 + 173C >
T g.103089C > T c.1352C > T p.Pro451Leu EX 10 1 (0.11) --
EX11 + 127G > A g.103369G > A c.1540G > A p.Val514Met EX
11 2 (0.22) -- EX11 + 131G > C g.103373G > C c.1544G > C
p.Gly515Ala EX 11 2 (0.22) -- EX12 + 46C > T g.103608C > T
c.1690C > T p.Arg564Cys EX12 1 (0.11) -- .sup.1Numbering
relative to the reverse complement of GenBank .RTM. Accession
Number AC003043 and starting at nt 1; .sup.2Numbering according to
the largest PGRN transcript (GenBank .RTM. Accession Number
NM_002087.2) and starting at the translation initiation codon;
.sup.3Numbering according to the largest PGRN isoform (GenPept
.RTM. Accession Number NP_002078.1); .sup.4EX: exon, IVS: intron,
exon numbering starts with non-coding first exon EX 0.
[0250] Additional mutations identified in PGRN nucleic acid are
listed in Table 23. Polymorphisms identified in PGRN nucleic acid
are listed in Table 24.
TABLE-US-00023 TABLE 23 Additional PGRN mutations Mutation Patient
Onset age Family Predicted Predicted ID Presentation (years)
History Alias Genome.sup.1 RNA.sup.2 polypeptide.sup.3
Location.sup.4 d1397 AD 79 - 5'-34C > T g.95991C > T -- -- 5'
Upstream d2721 PD 55 - EX0 + 17G > C g.96041G > C -- -- EX 0
d1343 AD 72 - EX0 + 111C > T g.96135C > T c.1-109C > T --
EX 0 d4796 AD 85 - EX0 + 164T > G g;96188T > G c.1-56T > G
-- EX 0 d1399 AD 79 + IVS0 + 46G > T g.96282G > T -- -- IVS 0
d2555 PD 52 - IVS 0 d2654 PD 43 + IVS0 DR148.1 AD 81 + EX1 + 106C
> A g.100165C > A c.99C > A p.Asp33Glu EX 1 d2631 PD 56 -
EX 1 DR197.1 AD 80 - EX4 + 66T > C g.101195T > C c.415T >
C p.Cys139Arg EX 4 d7675 AD ? + IVS4 + 15G > T g.101257G > T
-- -- IVS4 d2634 PD 57 - IVS8 + 16G > A g.102378G > A -- --
IVS8 d5181 AD 72 + IVS8-40C > T g.102115C > T -- -- IVS 8
DR196.1 AD 86 - EX9 + 37G > A g.102488G > A c.970G > A
p.Ala324Thr EX 9 d2657 PD 64 - EX 9 d4504 AD 85 - IVS9 + 108G >
A g.102805G > A -- -- IVS 9 d1461 AD 69 + EX10 + 162C > T
g.103078C > T c.1341C > T p.His447 EX 10 DR152.1 AD 74 - EX10
+ 173C > T g.103089C > T c.1352C > T p.Pro451Leu EX 10
d5016 AD 84 - EX11 + 72C > T g.103314C > T c.1485C > T
c.Cys495 EX 11 DR165.1 AD 73 + EX11 + 127G > A g.103369G > A
c.1540G > A p.Val514Met EX 11 d5765 PD 70 - EX 11 DR200.1 AD 74
- EX11 + 131G > C g.103373G > C c.1544G > C p.Gly515Ala EX
11 DR201.1 AD 89 - EX 11 d2597 PD 46 - EX11 + 141C > T g.103383C
> T c. 1554C > T c.Asp518 EX 11 DR144.1 AD 70 + EX12 + 46C
> T g.103608C > T c.1690C > T p.Arg564Cys EX12
.sup.1Numbering relative to the reverse complement of GenBank .RTM.
Accession Number AC003043 and starting at nt 1; .sup.2Numbering
according to the largest PGRN transcript (GenBank .RTM. Accession
Number NM_002087.2) and starting at the translation initiation
codon; .sup.3Numbering according to the largest PGRN isoform
(GenPept .RTM. Accession Number NP_002078.1); .sup.4EX: exon, IVS:
intron, UTR: untranslated region, exon numbering starts with
non-coding first exon EX 0.
TABLE-US-00024 TABLE 24 PGRN polymorphisms in patients and/or
control individuals Mutation Number (%) Predicted Predicted Control
Alias Genome.sup.1 RNA.sup.2 polypeptide.sup.3 Location.sup.4
Patients individuals EX0 + 175C > G g.96199C > G c.1-45C >
G -- EX 0 1 (0.11) 2 (0.44) EX1 + 106C > T g.100165C > T
c.99C > T p.Asp33 EX 1 11 (1.19) 4 (0.87) IVS2 + 7G > A
g.100460G > A -- -- IVS 2 12 (1.30) 3 (0.63) IVS3 + 11G > C
g.100664G > C -- -- IVS 3 0 (0.00) 1 (0.22) EX3 + 15G > A
g.100583G > A c.279G > A p.Gly93 EX 3 8 (0.87) 1 (0.22) EX4 +
35T > C g.101164T > C c.384T > C p.Asp128 EX 4 43 (4.67)
27 (5.88) EX6 + 37G > A g.101629G > A c.635G > A
p.Arg212Gln EX 6 0 (0.00) 1 (0.22) EX7 + 73C > T g.102072C >
T c.781C > T p.Leu261Ile EX 7 1 (0.11) 1 (0.22) EX7 + 96G > A
g.102034G > A c.804G > A p.Thr268 EX7 0 (0.00) 1 (0.22) EX8 +
68G > A g.102332G > A c.903G > A p.Ser301 EX 8 3 (0.33) 1
(0.22) EX10 + 118C > T g.103034C > T c.1297C > T
p.Arg433Trp EX 10 5 (0.54) 1 (0.22) EX11 + 12C > T g.103254C
> T c.1425C > T p.Cys475 EX11 0 (0.00) 1 (0.22)
.sup.1Numbering relative to the reverse complement of GenBank .RTM.
Accession Number AC003043 and starting at nt 1; .sup.2Numbering
according to the largest PGRN transcript (GenBank .RTM. Accession
Number NM_002087.2) and starting at the translation initiation
codon; .sup.3Numbering according to the largest PGRN isoform
(GenPept .RTM. Accession Number NP_002078.1); .sup.4EX: exon, IVS:
intron, exon numbering starts with non-coding first exon EX 0.
Example 6
Progranulin Modifies Onset Age and Survival in Amyotrophic Lateral
Sclerosis
[0251] Study Groups: A total of 230 sporadic ALS patients were
recruited at the university hospitals of Leuven and Antwerpen,
Belgium, with a diagnosis of definite, probable, or laboratory
supported probable ALS (according to E1 Escorial criteria,
available at on the World Wide Web at wfnals.org). The mean age of
onset was 57.6.+-.12.3 years and 146 (63%) of the patients were
men. Of 219 patients, information on spinal or bulbar onset was
available for 167 and 52 patients, respectively. Mean survival
after first symptoms was 35.+-.23 months (N=183). None of the
patients carried a SOD1 mutation. The control group consisted of
436 community control persons, 192 men and 244 women, that were
neurologically healthy and of Belgian descent. Mean age at
examination of the control individuals was 58.7.+-.15.8 years. The
presence of population substructure was excluded based on 27
randomly selected microsatellite markers in Structure 2.1
(Pritchard et al., Genetics, 155(2):945-959 (2000)). DNA was
obtained from 308 Dutch ALS patients who were diagnosed according
to E1 Escorial criteria. The mean age at onset was 57.9.+-.11.6
years, and 60.3% were male. Mean survival after first symptoms was
32.5.+-.27.4 months (N=130). A Dutch control sample consisted of
345 individuals, of whom 45.8% were men, with a mean age at
inclusion of 60.+-.11.7 years.
[0252] PGRN sequencing: PGRN non-coding exon 0, coding exons 1 to
12, and a conserved 5' regulatory region in intron 0 were PCR
amplified from 20 ng of genomic DNA using primers described
elsewhere (Cruts et al., Nature, 442(7105):920-924 (2006)). Primers
were designed using Primer3 software (Rozen and Skaletsky, Methods
Mol Biol, 132:365-386 (2000)). Amplification products were purified
using 1 U of antarctic phosphatase (New England Biolabs, Ipswich,
Mass.) and 1 U of exonuclease I (New England Biolabs). Purified PCR
products were sequenced in both directions using PCR primers or, if
necessary, internal sequencing primers and the Big Dye.RTM.
Terminator v3.1 Cycle Sequencing kit (Applied Biosystems, Foster
City, Calif.) according to manufacturer's protocol. Labeled
products were separated on an Applied Biosystems 3730x1 DNA
Analyzer (Applied Biosystems).
[0253] PGRN SNP genotyping: Single nucleotide polymorphisms (SNPs;
minor allele frequency >5%) except IVS4+24G>A (r.sup.2=0.989
with IVS3-47-46insGTCA) were genotyped in a replication set in two
MassARRAY iPlex assays, followed by Matrix-Assisted Laser
Desorption/Ionization Time-Of-Flight (MALDI-TOF) mass spectrometry.
PCR and extension primers were designed using Assay Design 3.1
software (Sequenom, Hamburg, Germany). Briefly, 20 ng of genomic
DNA was PCR amplified using Titanium Taq DNA Polymerase (Clontech,
Mountain View, Calif.) under standard conditions. PCR products were
treated with shrimp alkaline phosphatase (SAP) for 20 minutes to
remove unincorporated dNTPs. ThermoSequenase (Sequenom) was used
for the base extension reactions. Primer extension products were
cleaned and spotted onto chips that were subsequently scanned using
a mass spectrometry workstation (MassARRAY Nanodispenser and
MassARRAY compact analyzer; Sequenom). Spectrum analysis and
genotype scoring was performed using Typer 3.3 software
(Sequenom).
[0254] Allele sharing analysis: Fourteen microsatellite markers
spanning an 8 cM region around PGRN were genotyped in two ALS
patients and one patient with Alzheimer dementia carrying the
p.Ala324Thr mutation. Twenty ng of genomic DNA were PCR amplified
in four multiplex reactions, as described elsewhere (van der Zee et
al., Brain, 129(Pt 4):841-852 (2006)). Fluorescently labeled
products were resolved on an Applied Biosystems 3730x1 DNA Analyzer
(Applied Biosystems). Genotypes were assigned using custom
genotyping software.
[0255] In silico prediction of pathogenicity: The effect of
missense mutations on polypeptide function was estimated in silico
using the Sorting Intolerant From Tolerant (SIFT v.2) program (Ng
and Henikoff, Genome Res, 12(3):436-446 (2002)) based on sequence
homology and physical properties of amino acids. Three different
input methods were tested: (1) using both the automated SIFT
homologue retrieval (from the SWISS-PROT 48.7 and TREMBL 31.7
databases) and alignment procedure, (2) applying the SIFT pruning
and alignment protocol to 61 unaligned homologues sequences from
NCBI's BLink database (Wheeler et al., Nucleic Acids Res,
34(Database issue):D173-D180 (2006)), and (3) providing a curated
ClustalX (Jeanmougin et al., Trends Biochem Sci, 23(10):403-405
(1998)) alignment of the 61 BLink sequences. For each input
sequences 100% or 90% identical to the query were removed. An
average score over the resulting six tests <0.05 was considered
indicative of an effect on polypeptide function.
[0256] For structural modeling of mutations located in granulin
domains, the full structure of a granulin domain was reconstructed
based on the crystal structure of the N-terminal module of human
granulin A (PDB 1g26; Tolkatchev et al., Biochemistry,
39(11):2878-2886 (2000)) using SwissPDB-Viewer (Guex and Peitsch,
Electrophoresis, 18(15):2714-2723 (1997)), Modeller (Fiser and
Sali, Methods Enzymol, 374:461-491 (2003)), ProQ (Wallner and
Elofsson, Protein Sci, 12(5):1073-1086 (2003)), and FoldX
(Schymkowitz et al., Nucleic Acids Res, 33(Web Server
issue):W382-W388 (2005)). The effect of mutations on stability of
granulin domains was evaluated using FoldX, introducing a penalty
for forming or breaking disulfide bonds (Czaplewski et al., Protein
Eng Des Sel, 17(1):29-36 (2004)). MatInspector analysis (Cartharius
et al., Bioinformatics, 21(13):2933-2942 (2005)) was performed to
estimate the effect of 5' regulatory variants on putative
transcription factor binding sites. A core similarity cut off of 1
was used.
[0257] Statistical analysis: Deviations from Hardy-Weinberg
equilibrium (HWE) were excluded using the HWE program for both
Belgian and Dutch samples (Terwilliger and Ott, Handbook of Human
Genetic Linkage, Johns Hopkins University Press, Baltimore, Md.
(1994)). For SNPs with a minor allele frequency >5%, chi-square
statistics and logistic regression analysis adjusted for age and
gender were performed in SPPS 12.0 to examine the contribution of
each detected common variant to the susceptibility to ALS. To study
genotype-phenotype correlations, additional analyses were performed
for patients with a spinal or bulbar onset of ALS. The effect of
the polymorphisms on age at onset in patients was assessed in a
univariate analysis of variance, adjusted for gender and site of
onset. The effect of the polymorphisms on survival after onset of
the first symptoms was tested with a Cox proportional hazards
model. Hazard ratios (HR) were calculated with their 95% confidence
intervals (95% CI) adjusted for gender, site of first symptoms, and
age at first symptoms. Pairwise LD, computed in Haploview (Barrett
et al., Bioinformatics, 21(2):263-265 (2005)) revealed two blocks
of increased LD, one spanning the 5' regulatory region, the second
covering intron 2 through to the 3' untranslated region. Haplotype
frequencies were estimated in these LD blocks using a progressive
EM insertion algorithm computing both maximum likelihood estimates
of haplotype probabilities and posterior probabilities of pairs of
haplotypes for each subject. Haplotype associations, based on these
haplotype probabilities, were investigated with score statistics. A
sliding window analysis was performed with 2-SNP windows. Both
haplotype estimation and analysis were performed in Haplo Stats
version 1.2.2. (Schaid et al., Am J Hum Genet, 70(2):425-434
(2002)). Simulation P-values were calculated based on 1000 random
permutations of patient and control labels to control the type I
error rate.
Results
[0258] PGRN sequencing: A systematic mutation analysis of PGRN was
performed by direct sequencing of all coding exons, including
exon-intron boundaries, and 5' and 3' regulatory regions in a
series of 230 Belgian patients diagnosed with ALS, and in 436
control individuals. Seventeen rare variants (minor allele
frequency <5%) were identified in 29 patients (9 exonic
variants, 4 intronic variants, 3 variants in the 5' regulatory
region, and 1 variant in the 3' regulatory region). Of these rare
variants, 11 were absent from 872 control chromosomes (Tables 25,
26, and 27).
TABLE-US-00025 TABLE 25 PGRN missense mutations in ALS Variation
Predicted Predicted SIFT Alias Genome.sup.1 RNA.sup.2
polypeptide.sup.3 Location.sup.4 Patients.sup.5 score.sup.6 EX3 +
65G > A g.100633G > A c.329G > A p.Arg110Gln EX 3 1/230
0.39 EX4 + 22T > C g.101151T > C c.371T > C p.Ile124Thr EX
4 1/230 0.16 EX9 + 37G > A g.102488G > A c.970G > A
p.Ala324Thr EX 9 2/230 0.44 EX10 + 74G > A g.102990G > A
c.1253G > A p.Arg418Gln EX 10 1/230 0.27 .sup.1Numbering
relative to the reverse complement of GenBank .RTM. Accession
Number AC003043 and starting at nt 1; .sup.2Numbering according to
the largest PGRN transcript (GenBank .RTM. Accession Number
NM_002087.2) and starting at the translation initiation codon;
.sup.3Numbering according to the largest PGRN isoform (GenPept
.RTM. Accession Number NP_002078.1); .sup.4EX: exon, exon numbering
starts with non-coding first exon EX 0. .sup.5Frequency of
mutations in patients; absent from 436 healthy individuals.
.sup.6Average SIFT scores <0.05 are predicted to affect
polypeptide function.
TABLE-US-00026 TABLE 26 Genetic variants in the PGRN 5' regulatory
region Variation Patients Controls TFBS alterations.sup.3 Alias
Genome.sup.1 Location.sup.2 (%; n = 230) (%; n = 436) (core/matrix
similarity) EX0 + 37A > G g.96061A > G EX 0 0.4 0 -EVI1
(1/0.833) -PAX2 (1/0.798) -ISRE (1/0.819) +NFAT (1/0.96) IVS0 +
236G > A g.96472G > A IVS 0 1.3 0.7 +ELK1 (1/0.824) +ALM3
(1/0.936) IVS0 + 485A > G g.96721A > G IVS 0 1.3 0.7 No major
changes .sup.1Numbering relative to the reverse complement of
GenBank .RTM. Accession Number AC003043 and starting at nt 1;
.sup.2EX: exon, IVS: intron, exon numbering starts with non-coding
first exon EX 0. .sup.3TFBS: transcription factor binding site;
MatInspector prediction.
TABLE-US-00027 TABLE 27 Rare PGRN silent and intronic variations
Variation Predicted Patients Control Alias Genome.sup.1 Predicted
RNA.sup.2 polypeptide.sup.3 Location.sup.4 (%; n = 230) (%; n =
436) EX1 + 106C > T g.100165C > T c.99C > T p.Asp33 EX 1
1.7 0.9 IVS2 + 7G > A g.100460G > A -- -- IVS2 1.3 0.7 EX4 +
35T > C g.101164T > C c.384T > C p.Asp128 EX4 5.6 6 EX4 +
65G > A g.101194G > A c.414G > A p.Thr138 EX 4 0.4 0 IVS6
+ 57A > G g.101759A > G -- -- IVS 6 0.4 0 EX7 + 96G > A
g.102034G > A c.804G > A p.Thr268 EX 7 0.4 0.2 EX8 + 68G >
A g.102332G > A c.903G > A p.Ser301 EX 8 0.4 0.2 IVS8 - 40C
> T g.102412C > T -- -- IVS 8 0.4 0 IVS9 + 101C > T
g.102798C > T -- -- IVS 9 0.4 0 EX10 + 162C > T g.103078C
> T c.1341C > T p.His447 EX 10 0.9 0 3' + 21G > A
g.104025G > A -- -- 3' Downstream 0.9 0 .sup.1 Numbering
relative to the reverse complement of GenBank .RTM. Accession
Number AC003043 and starting at nt 1; .sup.2Numbering according to
the largest PGRN transcript (GenBank .RTM. Accession Number
NM_002087.2) and starting at the translation initiation codon;
.sup.3Numbering according to the largest PGRN isoform (GenPept
.RTM. Accession Number NP_002078.1); .sup.4EX: exon, IVS: intron;
exon numbering starts with non-coding first exon EX 0.
[0259] Missense mutations: The nine exonic sequence variants
included four missense mutations that were absent from Belgian
control individuals (Table 25): c.329G>A (Arg110Gln),
c.371T>C (Ile124Thr), c.970G>A (Ala324Thr), and c.1253G>A
(Arg418Gln). All four missense mutations were located in or at the
border of a granulin domain. Arg110Gln is located in the C-terminal
end of the granulin G domain, but the wild type residue is not
conserved between granulin domains. SIFT analysis predicted that
Arg110Gln is unlikely to affect polypeptide function (average SIFT
score 0.39), based on evolutionary conservation of homologous
sequences. Arg418Gln is located at the C-terminal border of
granulin C. SIFT analysis predicted that Arg418Gln might be
tolerated in polypeptide function (average SIFT score 0.27).
Ile124Thr is located at the N-terminal border of the granulin F
domain, at a position that is conserved between granulin domains,
containing either an Ile or a Val residue. SIFT analysis predicted
that Ile124Thr would affect polypeptide function in four out of six
tests, but directly providing a ClustalX alignment of 61 homologous
sequences from BLink to SIFT predicted that Ile124Thr would be
tolerated. Limiting the SIFT analysis to 13 sequences specifically
validated for human PGRN revealed a SIFT score of 0.01, predicting
an intolerant change. Ile124Thr was estimated to have an average
effect of -0.35.+-.0.03 kcal/mol on the stability of the granulin
domain, being weakly stabilizing. Ala324Thr is located in the
granulin A domain, at a non-conserved position. SIFT analysis
predicted that Ala324Thr would be tolerated, and structural
modeling of the mutation revealed a weakly destabilizing effect of
0.36 .+-.0.01 kcal/mol on the granulin domain. Interestingly,
Ala324Thr was also detected in one Belgian patient with Alzheimer
dementia. Allele sharing revealed that both ALS patients share
alleles of microsatellite markers flanking PGRN, spanning a shared
region of maximum 2.8 Mb. One ALS patient shared alleles at seven
consecutive markers with the Alzheimer patient, spanning about 6 Mb
(Table 28).
TABLE-US-00028 TABLE 28 Allele sharing analysis in p.Ala324Thr
mutation carriers Physical Frequency Alz- position of shared ALS
ALS heimer Marker (Mb) allele (%).sup.1 ALS165.01 ALS236.01 d4833
D17S1818 34.42 20 438-442 438-442 436-438 D17S1814 35.37 18.9
457-463 455-457 459-463 D17S800 36.31 46.1 359-361 361-361 361-361
D17S1787 36.98 23.8 177-181 179-181 171-177 D17S1793 37.61 78.8
392-392 394-394 392-394 D17S951 39.18 40.2 135-145 135-135 135-137
p.Ala324Thr 39.78 G-A G-A G-A D17S1861 40.16 9.0 262-264 262-280
262-262 D17S934 40.41 4.5 359-361 367-373 373-377 Shared alleles
are represented in bold; .sup.1frequency of shared allele based on
102 Belgian control individuals.
[0260] Regulatory variants: Three variants were detected in the 5'
regulatory region, of which one in non-coding exon 0 was absent
from control chromosomes (Table 26). MatInspector analysis
predicted that this variant (g.96061A>G) is likely to abolish
EVIL, PAX2 and ISRE transcription factor binding sites, and create
a NFAT binding site. No major changes in transcription factor
binding sites were predicted for g.96721A>G, whereas
g.96472G>A may create an ELK1 or ALM3 binding site. The latter
two variants were present in three patients (1.3%) and three
control individuals each (0.7%), and thus their frequency did not
differ significantly between patients and control individuals (OR
1.9 (95% CI 0.4-9.5; p-value 0.4)).
[0261] Clinical phenotype: Of the five mutations identified only in
patients and affecting polypeptide function or expression, four
were identified in five women, and one (Ile124Thr) was identified
in a man. All women had a spinal onset of the disease, whereas the
male patient had a bulbar onset. The onset ages varied between
patients, ranging from 53 years (Ala324Thr) to 74 years
(Arg110Gln). Likewise, disease duration varied from 16 months
(Ile124Thr) to >88 months (Ala324Thr). Even between the two
patients carrying Ala324Thr, onset age and disease duration varied
widely. One patient showed first symptoms at age 62 years and died
after 28 months. The other patient had first symptoms at age 53
years and was still alive after 88 months. The two patients share a
2.8 Mb haplotype with a man who was diagnosed with probable
Alzheimer dementia at 86 years, suggesting a distant common
ancestor.
[0262] Common PGRN polymorphisms: Genotype data of eight frequent
SNPs (minor allele frequency >5%) were extracted from the
sequencing data obtained in both Belgian patients and Belgian
control individuals for genetic association analyses (Table 29).
Genotype frequencies did not differ between patients and control
individuals for any of the individual SNPs, neither in crude nor in
age or gender adjusted logistic regression analyses (Table 29).
Haplotype based association analysis was performed in the two
distinct blocks of PGRN with high LD. No statistically significant
global or haplotype-specific differences were observed between ALS
patients and control individuals in either LD block (global p-value
0.34 and 0.63, respectively).
TABLE-US-00029 TABLE 29 Genotype frequencies of PGRN SNPs in ALS
patients and control individuals Variation ALS Control Alias
Genome.sup.1 rs number Location.sup.2 Genotype (%) (%) p-value OR
(95% CI) 5'-111delC g.95914delC rs17523519 5'upstream wt/wt 54.4
54.0 0.8 Ref del/wt 36.8 38.6 0.9 (0.6-1.3) del/del 8.8 7.4 1.1
(0.6-2.1) IVS0 + 561C > T g.96797C > T rs3859268 IVS 0 CC
52.6 51.0 0.6 Ref CT 38.2 41.5 0.8 (0.6-1.2) TT 9.2 7.6 1.2
(0.6-2.1) IVS2 + 21G > A g.100474G > A rs9897526 IVS 2 GG
85.6 80.3 0.2 Ref GA 14.0 18.5 0.7 (0.5-1.1) AA 0.4 1.2 0.3
(0.04-2.8) IVS3-47- g.101083_101084 rs34424835 IVS 3 wt/wt 62.4
59.5 0.6 Ref 46insGTCA insGTCA ins/wt 33.6 35.0 0.9 (0.6-1.3)
ins/ins 4.0 5.5 0.7 (0.3-1.6) EX4 + 35 T > C g.101164T > C
rs25646 EX 4 TT 94.7 93.4 0.5 Ref TC 5.3 6.6 0.8 (0.4-1.6) CC 0 0
-- IVS4 + 24 G > A g.101266G > A rs850713 IVS 4 GG 62.6 58.7
0.5 Ref AG 33.5 35.6 0.9 (0.6-1.2) AA 4.0 5.7 0.7 (0.3-1.5) IVS7 +
7 G > A g.102072G > A -- IVS 7 GG 85.5 86.6 0.8 Ref GA 14.0
13.2 1.0 (0.6-1.6) AA 0.5 0.2 3.2 (0.2-51.9) 3'UTR + 78 C > T
g.103778C > T rs5848 3' UTR CC 57.3 50.9 0.3 Ref CT 36.6 42.1
0.8 (0.6-1.1) TT 6.2 6.9 0.8 (0.4-1.6) .sup.1Numbering relative to
the reverse complement of GenBank .RTM. Accession Number AC003043
and starting at nt 1; .sup.2EX: exon, IVS: intron, UTR:
untranslated region; exon numbering starts with non-coding first
exon EX 0.
[0263] Genotype-phenotype correlation: Given the clinical
heterogeneity of ALS, the effect of PGRN SNPs on site of onset
(bulbar or spinal), age at onset, and survival was evaluated. No
association was observed between a single SNP or haplotype and site
of onset. However, age at onset was significantly reduced in
carriers of the rare allele IVS2+21G>A (mean difference: 7.7
years (95% CI: 3.2-12.1 years; p=0.001)), and to a lesser extent in
carriers of the rare allele IVS3-47-46insGTCA and IVS4+24G>A
(pairwise r.sup.2=0.989; mean difference: 4.1 years (95% CI:
0.9-7.4 years; p=0.013). In a haplotype based setting, sliding
window analysis indicated that a 2-SNP window of IVS2+21G>A and
IVS3-47-46insGTCA was significantly associated with age at onset
(p=0.005; FIG. 14). Moreover, carriers of the rare allele of
IVS2+21G>A had a significantly shorter survival after onset of
ALS (HR 1.70 (95% CI 1.10-2.64; p=0.017); FIG. 15). Although
non-significant, an HR of similar magnitude was observed for
carriers of the rare allele of IVS3-47-46insGTCA and IVS4+24G>A
(HR 1.82 (95% CI 0.84-3.95; p=0.1)). To confirm these findings, we
replicated the association analysis in a Dutch sample of ALS
patients and controls. As in the Belgian sample, no statistically
significant association was observed between single SNPs or
haplotypes and disease status or site of onset, but patients
homozygous for the rare allele at IVS3-47-46insGTCA had a
significantly shorter survival after onset of ALS (HR 2.29 (95% CI
1.15-4.55; p=0.018)).
Example 7
Genomic Progranulin Deletions are a Frequent Cause of
Frontotemporal Dementia
[0264] The contribution of genomic PGRN deletions to the etiology
of FTD was assessed in a series of 103 unrelated Belgian patients
with pure FTD (Cruts et al., Nature, 442:920-924 (2006)). Four PGRN
null mutations were identified in 11 of the 103 patients, as
described elsewhere (Cruts et al., Nature, 442:920-924 (2006)).
[0265] To detect PGRN copy number changes, the FTD series was
screened with Multiplex Amplicon Quantification (MAQ; Suls et al.,
Hum Mutat, 27:914-920 (2006)). The MAQ technique involves
quantification of a number of fluorescently labeled test and
reference amplicons obtained in one multiplex PCR reaction. The
PGRN MAQ assay contained six test amplicons located in and around
PGRN and seven reference amplicons located at randomly selected
genomic positions (FIG. 16B). These 13 fragments were
simultaneously amplified using 20 ng of genomic DNA in one PCR
reaction with optimized reaction conditions. Peak areas of the test
amplicons were normalized to those of the reference amplicons.
Comparison of normalized peak areas of test amplicons between a
patient and control individuals resulted in a dosage quotient (DQ)
for each test amplicon, calculated by the MAQ software (MAQs)
package (on the World Wide Web at
vibgeneticservicefacility.be/MAQ.htm). DQ values below 0.75
indicated a deletion. MAQ analysis of 103 FTD patients revealed the
presence of two deletions of more than one test amplicon in two FTD
patients (FIG. 16A). In patient DR184.1, DQs of all test amplicons
were reduced below 0.75, indicating a genomic deletion of PGRN
including 5' and 3' flanking regions. In patient DR15.1, only test
amplicons 3 to 6 showed DQs below 0.75, suggesting a partial
deletion of the gene not including exon 0 and only telomerically
extending beyond PGRN (FIGS. 16A and 16B). Deletions were excluded
in 267 neurologically healthy Belgian control individuals (mean age
58.4.+-.16.0 years, range 25-92 years) using the MAQ assay.
[0266] Real time PCR allele quantification (qPCR) was performed to
quantify the copy number of PGRN using SYBR.RTM. Green I assays on
the ABI Prism 7900HT Sequence Detection System (Applied Biosystems,
Foster City, Calif.). Primers for one amplicon in each PGRN exon
and for one amplicon in human ubiquitin C (hUBC) and human
.beta.2-microglobulin (hB2M) were designed with PrimerExpress
software (Applied Biosystems). The primer sequences are listed in
Table 30. Twenty ng of genomic DNA from patients and control
individuals were amplified in duplicate using the universal
amplification protocol (Applied Biosystems) as described elsewhere
(Sleegers et al, Brain, 129:2977-2983 (2006)). DQs were calculated
by comparing normalized quantities between patient and control
individuals. qPCR of the amplicon in PGRN exon 11 was compared to
hUBC and hB2M in the whole FTD sample, and 33 patients were
identified with a DQ below 0.75, including DR184.1 and DR15.1.
These patients were further analyzed for the 12 remaining PGRN
exons, resulting in identification of three patients with a large
PGRN deletion. In DR184.1, DQs of all PGRN exons were below 0.75,
and in DR15.1, DQs of PGRN exons 1 to 12 were below 0.75 (FIG.
16C). These results were in agreement with the MAQ results. One
additional patient (DR188.1) was observed to carry a deletion of a
region including all PGRN exons other than exon 0, similar to the
deletion in DR15.1 (FIG. 16C). qPCR data were further confirmed
using a TaqMan assay designed to amplify a region in PGRN exon 11.
The probe sequence is listed in Table 30.
TABLE-US-00030 TABLE 30 Primers and probe sequences for PGRN qPCR
Amplicon Gene/ Primers size in Region Name Sequence bp PGRN exon 0
ex0F GAGTAGAAAAGAAACACAGCAT 69 TCCA ex0R CCGCTCCCATTGGCTACTTA exon
1 ex1F GCCAGACGTTCCTTGGTACTTT 79 ex1R CCACCAGCCCTGCTGTTAAG exon 2
ex2F CAAATGGCCCACAACACTGA 64 ex2R AGAGCAGTGGGCATCAACCT exon 3 ex3F
ATGCAGGTTTCTCTGTGTTCCA 121 ex3R CCCAGCTGCACCTGATCTTT exon 4 ex4F
TCCCTGAGTGGGCTGGTAGT 62 ex4R GCACCCACGGAGTTGTTACCT exon 5 ex5F
GAAGACGGAGTCAGGACCATTT 61 ex5R AGCAGTGCACCCTGTCTTCA exon 6 ex6F
TGTCCAGCTCGGTCATGTGT 111 ex6R CACTCACGTTGGGCATTGG exon 7 ex7F
CACCTGCTGCTCCGATCAC 58 ex7R GATCAGGTCACACACAGTGTCTTG exon 8 ex8F
TCCTCTCTGCTTCCCTCACAGT 85 ex8R TGTAGACGGCAGCAGGTATAGC exon 9 ex9F
GCCTGCCAGACCCACAAG 65 ex9R GGAGGGACAGCTGCTGACAT exon 10 ex10F
CTGCCAGTTGCCCCATGT 82 ex10R CATTATGTTCCTGTCCCCTCACT exon 11 ex11F
GCTGGCTACACCTGCAACGT 58 ex11R GGGCAGAGACCACTTCCTTCT probe
AGGCTCGATCCTGC exon 12 exl2F CTGGGACGCCCCTTTGA 73 ex12R
GGGCTGCAGAGTCTTCAGTACTG Housekeeping Genes hB2M exon 3 ex3F
TTACTGAAGAATGGAGAGAGA 68 ATTGAAA ex3R GACCAGTCCTTGCTGAAAGACA hUBC
hUBC-F GGGTCAATATGTAATTTTCAGT 80 GTTAG hUBC-R
TTGTCTAACAAAAAAGCCAAAAACG
[0267] Restriction mapping was performed using DNA from patient
DR184.1 to validate the MAQ and qPCR results and to further map the
deleted region. Ten .mu.g of DNA from DR184.1 and two control
individuals was digested with 30 U of PstI and separated on a 0.7%
agarose gel together with a 1 kb plus DNA ladder as a size standard
(Invitrogen, Carlsbad, Calif.). After Southern blotting, a fragment
containing part of PGRN 3' UTR and downstream sequence in
combination with a reference fragment for normalization, were
hybridized as described elsewhere (Cruts et al, Hum Mol Genet,
14:1753-1762 (2005)). The signal intensity of the 1.4 kb PstI
restriction fragment hybridized with the PGRN probe was lower than
the 1.9 kb PstI restriction fragment hybridized with the reference
probe in the patient compared to the control individuals (FIG. 17).
Bands were quantified using the Kodak Imaging Station 440 (Eastman
Kodak, Rochester, N.Y.) and comparison of normalized band
intensities between samples from the patient and the control
individuals confirmed the loss of one PGRN allele (FIG. 17). No
differently sized bands were observed, suggesting the absence of
junction fragments in this region and preventing further mapping of
the deletion with this technique. To delineate the size of the
deletion in patient DR184.1, a mapping panel was generated which
consisted of more than one hundred semi-quantitative multiplex PCRs
of selected fragments in and flanking PGRN co-amplified with an
arbitrarily chosen reference fragment. The primers are listed in
Table 31. The resulting bands were quantified on the Kodak Imaging
Station 440 (Eastman Kodak), and DQs were calculated as the ratio
of the normalized band intensities in the patient to a control
individual. This analysis resulted in delineation of the
PGRN-containing deletion spanning a maximal region of 74.3 kb and
in the finemapping of the breakpoint regions, centromerically to
19.4 kb between fragments cen 14 and cen 15 and telomerically to
about 1 kb between fragments tel 2 and tel 3 (FIGS. 18 and 19).
Between fragments cen 14 and cen 15, a heterozygous STR marker
D17S1860 was located, further finemapping the centromeric
breakpoint region to 14.3 kb and resulting in a final maximal
deleted region of 69.1 kb that could not be further reduced (FIGS.
18 and 19). In addition to PGRN, this region comprises two other
known genes: RPIP8 and SLC25A39 (NCBI Build 35; on the World Wide
Web at genome.ucsc.edu/cgi-bin/hgGateway?org=Human&db=hg17;
FIGS. 18 and 19) of which 50% may be sufficient to execute normal
function since the patient showed no symptoms other than
characteristic FTD features. Moreover, each of these two genes
belongs to a gene family suggesting that, if necessary, gene loss
may be compensated by other family members. The mapping panel also
revealed a second deleted region in DR184.1, about 77 kb upstream
of the PGRN deletion (FIGS. 18 and 19). The second deleted region
was mapped to a maximal size of 62.9 kb containing RefSeq gene
HDAC5 and part of G6PC3 with a centromeric breakpoint region of
about 0.5 kb between fragments cen 3 and cen 4 and a telomeric
breakpoint region of 20.7 kb between fragments cen 8 and cen 9
(FIGS. 18 and 19). The deletion most likely represents the copy
number variation (CNV) identified by BAC array-CGH in 8 of 95
unrelated healthy individuals (Wong et al, Am J Hum Genet,
80:91-104 (2007); database of genomic variants on the World Wide
Web at projects.tcag.ca/variation/), implying loss of BAC
RP11-756H11 (FIG. 19) although these individuals only have a
deleted region of 29.6 kb in common. This can be explained by the
resolution of BAC array-CGH, which is too low to exactly map CNV
boundaries, or by the occurrence of several CNVs with different
sizes in this region. Neither of these two deletions was identified
in an unaffected sibling of DR184.1. In addition, genotyping STR
markers at 17q21 showed that the two siblings shared one haplotype.
These two observations demonstrated that the two deleted regions in
DR184.1 were located in cis.
TABLE-US-00031 TABLE 31 Primer sequences for the semi-quantitative
multiplex PCR mapping panel Amplicon Primers size in Name Sequence
bp cen 1F GTCATGTCTGTTCCTTCACTGCC 301 cen 1R
TCATGGGTCTGAAGAGTCTCCAG cen 2F AGGTAGAATTTGCTTCAATCTCCAG 301 cen 2R
ATTGCTGAGCCCAGGTGAGT cen 3F CCCATAATGACGGCCCTGT 301 cen 3R
CAACCGCCAAAAGGAAGGT cen 4F ATTCTCTTGCCAAGCTGCAC 294 cen 4R
CTAGGTGCAGGCGAGATAGG cen 5F CAGAGTGCGTGAGGACACGTAGAG 374 cen 5R
AAGCACAGGGGAGGGTATTGAGTG cen 6F CGGAACAAGGAGAAGAGCAAAGAG 402 cen 6R
GAATGAGGAAATAAACCAGGGATGG cen 7F ACCACCTTCCCTTCGGTCTGCT 341 cen 7R
CCAGCCCTGTGTATTCTCAACAAAA cen 8F GGTCTCCTTCGACTCTCAGATTCCT 351 cen
8R CCTGGAAGGGAAACCCACACAG cen 9F ATGACTCACATGCCACTGGA 261 cen 9R
GCAGTGAATCAGCCTGACAA cen 10F CAACCAAAGGGTATCGGCAG 281 cen 10R
GGAAGGTCTCTCTTGCCATGG cen 11F GTAGTATACCCCCATCTTATAACGGG 281 cen
11R TGGTCTTGAGCCAAACAGCC cen 12F GATCTGCAGCTGCTGTGTGT 325 cen 12R
TGCTTACCCTCATCCTGGTC cen 13F AAGAGAATGAAGTGGTCAGGGAAG 301 cen 13R
TGACTTGGTCATTTTGAACCCC cen 14F ATACCACTCCCTGCCACCCT 301 cen 14R
CCCATTAGACGTGGCCATTAAT cen 15F ACCAAGGTTGAGGTCCCAGA 301 cen 15R
CCCTTAGGAACATCCCTCCC cen 16F AGGTCAGGCAGCACTAGCAT 296 cen 16R
TTGCTTAACTGCCAGGCTCT PGRN ex 0F CTGTCAATGCCCCAGACACG 499 PGRN ex 0R
CCCCCAAGGAGTTTCAGTAAGC PGRN ex 1F TTGAGAAGGCTCAGGCAGTC 400 PGRN ex
1R GGCCATTTGTCCTAGAAAGACAGG PGRN ex 12F TGGGACGCCCCTTTGAGG 274 PGRN
ex 12R CACAGGGTCCACTGAAACG tel 1F GGGCTTAGCGTTCAGGTGTA 340 tel 1R
TGGAGATTTGACCCCAAGAG tel 2F TCTAGTGGGGGTTGGGTATG 283 tel 2R
AGGAGCAGAGAGCGAGAGTG tel 3F TCGAAGCCTGACATTCCATATAGTAT 302 tel 3R
GAGCAAGACCCTGACAACACATC tel 4F CACCTACCACCCCAACTCTG 256 tel 4R
CATTGGGTCCTCTTGGTGTC tel 5F GACACATTGAGGCTGAGCAC 312 tel 5R
ACCACCCTGAACCTGGATCT reference F GGCTCAGCACCAACCTTCCC 183 reference
R GCCTGGTTCCACTCTCCCTCTG
[0268] Five known SNPs in intron 0 (rs3859268, rs2879096,
rs3785817, rs4792938, and rs4792939) were genotyped since MAQ
and/or qPCR data suggested that PGRN exon 0 was excluded from the
deleted region. Only the most 3' SNP rs4792939 was homozygous in
DR15.1, enabling further delimitation of the deletion at the
centromeric end to a breakpoint region of 1.5 kb between rs4792938
in intron 0 and MAQ amplicon 3 (FIG. 19). In contrast, the
centromeric breakpoint region of the deletion in DR188.1 remained
about 4 kb, defined by qPCR amplicons of exon 0 and exon 1 (FIG.
19). The telomeric breakpoint regions were not identified in either
of these two patients; therefore, only the minimal size of the
deletions could be estimated: about 11.5 kb in DR15.1 from MAQ
amplicon 3 to MAQ amplicon 6, and about 3.6 kb in DR188.1 from qPCR
exon 1 to qPCR exon 12 (FIG. 19). Based on the estimated minimal
sizes, the deletions did not contain genes other than PGRN. It is,
however, possible that the extent of the deletion in DR188.1 is
greater than estimated since the DQ of qPCR exon 0 was only
slightly above 0.75, suggesting that the centromeric breakpoint in
DR188.1 may be located more upstream of PGRN as in DR184.1.
[0269] The three patients carrying a genomic PGRN deletion
presented with typical FTD symptoms including language impairment.
They had a late onset of disease and disease duration of more than
ten years, except for patient DR184.1 who died after four years of
disease, suggesting that a deletion of a larger region may result
in a more severe disease course. A positive family history of
dementia was recorded for patient DR15.1, whose father was
affected. No affected relatives of any of the three patients were
available to perform segregation analyses.
[0270] Genomic deletions explain at least 2.9% of the genetic
etiology of FTD and at least 2.3% of familial FTD in the Belgian
sample. Together with the null mutations identified in 11 patients
as described elsewhere (Cruts et al., Nature, 442:920-924 (2006)),
PGRN mutations account for about 13.6% of all FTD patients and
about 27.9% of FTD patients with a positive family history, rising
to about 17.4% and 32.6%, respectively, when potential missense and
promoter mutations also are considered (van der Zee et al., Hum
Mutat, 28:416 (2007)).
Example 8
Identifying Agents that can Alter PGRN Polypeptide Levels
[0271] All-trans-retinoic acid and inflammatory events were
observed to be major regulators of PGRN expression (He and Bateman,
J Mol Med, 81:600-612 (2003); He et al., Cancer Res, 62:5590-5596
(2002), Ong et al., Am J Physiol Regul Integr Comp Physiol,
291:R1602-1612 (2006)). These data suggested that certain classes
of agents (e.g., NSAIDs and PPAR compounds) related to these
biochemical pathways may influence PGRN production. Studies were
performed using a variety of cell lines and several compounds in
the NSAID and PPAR compound families to examine the ability of
these agents to modulate PGRN polypeptide production in cell
culture systems.
Materials and Methods
[0272] Cell cultures were maintained in standard cell culture media
supplemented with 5% fetal bovine serum and 100 U/mL
penicillin/streptomycin (Life Technologies, Karlsruhe, Germany).
Cell cultures consisted of Chinese hamster ovary (CHO) cells; human
HeLa cells (HeLa); BE(2)-M17, human neuroblastoma (M17); N2A, mouse
neuroblastoma; and human lymphoblasts.
[0273] The following NSAIDs were dissolved in the vehicle DMSO:
ibuprofen (Biomol, Plymouth Meeting, Pa.), indomethacin (Biomol),
diclofenac (Cayman Chemical, Ann Arbor, Mich.), naproxen (Cayman
Chemical), and aspirin (ICN Biomedicals, Irvine, Calif.). Cells
were cultured in serum-containing media and treated for 24 hours in
serum-free media with a specific NSAID. NSAID toxicity was examined
using a standard MTT-assay
(3-(4,5-Dimethyl-2-thiazolyl)-1)-2,5-diphenyl-2H-tetrazolium
Bromide). For cell toxicity studies, cells were treated with NSAIDS
at concentrations up to 100 micromolar.
[0274] The following PPAR activators were dissolved in DMSO:
ciglitazone (Calbiochem, San Diego, Calif.), fenofibrate
(Sigma-Aldrich, Saint Louis, Mo.), clofibrate (Calbiochem), and
L165041 (Calbiochem). Cells were cultured in serum-containing media
and treated for 24 hours in serum-free media with a specific PPAR
agonist.
[0275] Curcumin (Sigma-Aldrich) and resveratrol (Sigma-Aldrich)
were dissolved in DMSO. Cells were cultured in serum-containing
media and treated for 24 hours in serum-free media with curcumin or
resveratrol.
[0276] Antibodies that were used included a monoclonal human
progranulin antibody (Zymed, South San Francisco, Calif.) directed
against full length progranulin polypeptide, a mouse progranulin
antibody (R&D Systems, Minneapolis, Minn.) directed against
full length progranulin polypeptide, and an anti-GAPDH antibody
(Sigma-Aldrich).
Results
[0277] PPAR.alpha. activators increase intracellular and secreted
PGRN polypeptide levels: Cell cultures were treated with increasing
concentrations of the PPAR.alpha. activator clofibrate or with
DMSO. Levels of PGRN polypeptide in culture supernatants and in
cell lysates were analyzed using Western blotting. The levels of
intracellular and secreted forms of PGRN polypeptide were compared
in clofibrate treated M17 cell cultures and DMSO treated M17 cell
cultures (FIG. 20). Treatment with clofibrate caused an initial
increase and then a decrease in the levels of both intracellular
and secreted forms of PGRN polypeptide after 24 hours. Cell
cultures treated with 5 micromolar clofibrate showed a 140%
increase in the level of secreted PGRN polypeptide. No significant
effect on GAPDH polypeptide expression was observed. These results
indicate that treatment of M17 cells with clofibrate selectively
elevated secreted PGRN polypeptide levels.
[0278] The levels of intracellular and secreted forms of PGRN
polypeptide also were compared in clofibrate treated human
lymphoblast cell cultures and DMSO treated lymphoblast cell
cultures (FIG. 21). Cell cultures treated with 110 micromolar
clofibrate showed a 700% increase in the level of secreted PGRN
polypeptide. No significant effect on GAPDH polypeptide expression
was observed. These results indicate that treatment of human
lymphoblasts with clofibrate selectively elevated secreted and
intracellular PGRN polypeptide levels in a dose-dependent manner.
No cell toxicity was observed with clofibrate treatment.
[0279] PPAR.gamma. activators increase intracellular and secreted
PGRN polypeptide levels: Cell cultures were treated with increasing
concentrations of the PPAR.gamma. activator ciglitazone. Levels of
PGRN polypeptide in culture supernatants and in cell lysates were
analyzed using Western blotting. The levels of PGRN polypeptide in
supernatants and in cell lysates of M17 cells treated with
ciglitazone were compared to the corresponding levels in
supernatants and cell lysates, respectively, of M17 cells treated
with DMSO (FIG. 22). Cell cultures treated with 1.5 to 24
micromolar ciglitazone showed a 200% to 350% increase in the level
of secreted PGRN polypeptide and an approximately 110% to 170%
increase in the level of intracellular PGRN polypeptide. No
significant effect on GAPDH polypeptide expression was observed.
These results indicated that treatment of M17 cells with
ciglitazone selectively elevated intracellular PGRN polypeptide and
secreted PGRN polypeptide levels in a dose-dependent manner.
[0280] The levels of PGRN polypeptide in supernatants and in cell
lysates of human lymphoblast cells treated with ciglitazone also
were compared to the corresponding levels in supernatants and cell
lysates, respectively, of human lymphoblast cells treated with DMSO
(FIG. 23). Cell cultures treated with 12 micromolar ciglitazone
showed an approximately 500% increase in the level of secreted PGRN
polypeptide. No significant effect on GAPDH polypeptide expression
was observed. These results indicated that treatment of human
lymphoblasts with clofibrate selectively elevated secreted and
intracellular PGRN polypeptide levels. No cell toxicity was
observed with clofibrate treatment.
PPAR.delta. activators increase intracellular and secreted PGRN
polypeptide levels: Cell cultures were treated with various
concentrations of the PPAR.delta. activator L165,041. Levels of
PGRN in culture supernatants and in cell lysates were analyzed
using Western blotting. Intracellular and secreted PGRN polypeptide
levels in human lymphoblasts treated with various concentrations of
L165,041 were compared to the corresponding levels in human
lymphoblasts treated with DMSO (FIG. 24). Substantial increases in
both intracellular and secreted forms of PGRN polypeptide were
observed 24 hours after treating human lymphoblasts with 3 to 12 nM
L165,041. Cell cultures treated with 12 to 48 nM of L165,041 showed
an approximately 600% increase in the level of secreted PGRN
polypeptide and an approximately 200% increase in the level of
intracellular PGRN polypeptide. No significant effect on GAPDH
polypeptide expression was observed. These results indicate that
treatment of human lymphoblasts with L165,041 selectively elevated
intracellular and secreted PGRN polypeptide levels in a
dose-dependent manner.
[0281] Levels of PGRN polypeptide in cell culture supernatants and
cell lysates of M17 cells treated with various concentrations of
L165,041 also were compared to corresponding PGRN polypeptide
levels in M17 cells treated with DMSO (FIG. 25). Treatment of M17
cells with 3 to 24 nM L165,041 significantly increased both
intracellular and secreted PGRN polypeptide levels after 24 hours.
No cell toxicity was observed following treatment with L165,041 at
concentrations up to 48 nM.
[0282] The PPAR.delta. agonist, GW501516, also was observed to
elevate PGRN polypeptide levels in M17 and N2A cell lines.
[0283] NSAIDs modulate intracellular and secreted PGRN polypeptide
levels: HeLa cell cultures (N=4 for all studies) were treated with
various concentrations of NSAIDs, including ibuprofen, naproxen,
indomethacin, meclofenamic acid, and acetylsalicylic acid for 24
hours in serum free media. Levels of PGRN polypeptide in culture
supernatants and in cell lysates were analyzed using Western
blotting.
[0284] Treated and untreated HeLa cells were analyzed for PGRN
polypeptide expression using immunohistochemistry. Perinuclear
expression of PGRN polypeptide was observed in untreated cells.
Treatment with ibuprofen (2.5 .mu.M for 24 hours) increased PGRN
polypeptide expression in the Golgi of HeLa cells. Levels of PGRN
polypeptide in cell culture supernatants and cell lysates of HeLa
cells treated with various concentrations of ibuprofen were
compared to corresponding PGRN polypeptide levels in HeLa cells
treated with DMSO (FIG. 26). Cell cultures treated with 1.25 to 20
micromolar ibuprofen showed an approximately 150% to 200% increase
in the level of secreted PGRN polypeptide and an approximately 150%
increase in the level of intracellular PGRN polypeptide. No
significant effect on GAPDH polypeptide expression was observed.
These results indicate that treatment of HeLa cells with ibuprofen
selectively elevated intracellular and secreted PGRN polypeptide
levels in a dose-dependent manner.
[0285] Dose-response studies of other NSAIDs, including
indomethacin, naproxen, meclofenamic acid, and acetylsalicylic acid
(FIGS. 27-30) showed that these agents similarly elevate
intracellular and/or secreted PGRN polypeptide levels. In
particular, treatment with indomethacin increased intracellular and
secreted PGRN polypeptide levels in HeLa cells (FIG. 27). Treatment
with naproxen also increased intracellular and secreted PGRN
polypeptide levels in HeLa cells (FIG. 28), as did treatment with
meclofenamic acid (FIG. 29). The highest concentration of
meclofenamic acid tested (10 .mu.M) caused a significant decrease
in the level of secreted PGRN polypeptide (FIG. 29). Treatment with
acetylsalicyclic acid was observed to increase secreted PGRN
polypeptide levels in HeLa cells (FIG. 30).
[0286] Other cell lines, including M17 and N2A, treated with
ibuprofen show similar responses to those observed in HeLa cells,
with increases in PGRN polypeptide expression up to 600% following
treatment with ibuprofen at concentrations ranging from 1 to 5
.mu.M.
[0287] Curcumin and resveratrol modulate intracellular and secreted
PGRN polypeptide levels: M17 cell cultures (N=4) were treated with
various concentrations of curcumin and resveratrol for 24 hours in
serum free media. Levels of PGRN polypeptide in culture
supernatants and cell lysates were analyzed using Western blotting.
Levels of PGRN polypeptide in cell culture supernatants and cell
lysates of M17 cells treated with various concentrations of
resveratrol were compared to corresponding PGRN polypeptide levels
in M17 cells treated with DMSO (FIG. 31). Cell cultures treated
with 3.125 to 50 micromolar resveratrol showed an approximately
150% to 450% increase in the level of intracellular PGRN
polypeptide and no increase in the level of secreted PGRN
polypeptide. No significant effect on GAPDH polypeptide expression
was observed.
[0288] Levels of PGRN polypeptide in cell culture supernatants and
cell lysates of M17 cells treated with various concentrations of
curcumin also were compared to corresponding PGRN polypeptide
levels in M17 cells treated with DMSO (FIG. 32). Cell cultures
treated with 0.1 micromolar curcumin showed an approximately 150%
increase in the level of secreted PGRN polypeptide. No significant
effect on GAPDH polypeptide expression was observed.
Example 9
Characterizing the Distribution of PGRN Polypeptide Expression
[0289] A number of studies were performed to assess the extent of
the distribution of PGRN polypeptide in human and mouse brain. PGRN
polypeptide was ubiquitously expressed in all regions throughout
human as well as mouse CNS tissue. Double immunofluorescence
studies showed that PGRN expression is restricted to neurons and
microglia. Double immunofluorescence micrographs were taken of
hippocampus endplate in mouse brain. PGRN polypeptide was strongly
expressed in neurons, but not in astrocytes stained for GFAP. There
was a lack of colocalization between oligodendrocytes and PGRN
polypeptide. PGRN polypeptide strongly colocalized with the
microglial marker IBA-1.
[0290] The subcellular distribution of PGRN polypeptide was
evaluated using cell culture models. Double immunofluorescence
studies using Be(2)-M17 (human neuroblastoma) and N2A (mouse
neuroblastoma) cell lines showed that PGRN polypeptide was
distributed throughout the cell, but was substantially concentrated
within the perinuclear compartment. Studies using a battery of
antibodies demonstrated that PGRN polypeptide was predominately
colocalized with Golgi (anti-58K). Double immunofluorescence
micrographs were taken of Be(2)-M17 (human) and N2A (mouse)
neuroblastoma cell lines stained with anti-PGRN polypeptide
antibodies and anti-58K (a marker for Golgi). A high degree of
colocalization was observed between PGRN polypeptide and 58K in
Be(2)-M17 cells at a magnification of 40.times.. A significant
overlap also was observed between PGRN polypeptide and 58K in N2A
cells. Double immunofluorescence studies failed to find an
association between PGRN polypeptide and peroxisomes (anti-PMP-70),
lysosomes (anti-LAMP1; anti-LAMP2) or secretory vesicles
(anti-synaptobrevin 2).
[0291] The expression of PGRN polypeptide was examined in both
human and transgenic mouse models that develop the hallmark
pathology described in Alzheimer's disease and frontotemporal
dementia. Tissues also were stained for NFTs using a CP13 antibody
to detect hyperphosphorylated tau, and nuclei were stained blue
using DAPI. PGRN polypeptide was enriched around amyloid plaques in
both human tissue and transgenic models. However, in contrast to
the significant overlap between PGRN polypeptide and amyloid
plaques, a significant dissociation between the accumulation of
neurofibrillary tangles and the accumulation of PGRN polypeptide
was observed in both human Alzheimer's disease and transgenic mouse
tissue. PGRN polypeptide did not directly co-localize with
neurofibrillary tangles, but was strongly upregulated with the
onset of tau pathology. These results indicate that in human and
mouse models of Alzheimer's disease, PGRN polypeptide is strongly
upregulated in dystrophic neurons and reactive microglia that
surround plaques, but PGRN polypeptide expression did not appear to
be elevated in neurons with neurofibrillary tangle pathology. These
results also indicate that changes in PGRN polypeptide expression
are dramatic with the onset of pathology in both humans and
mice.
[0292] PGRN polypeptide expression was examined in the JNPL3 mouse
line. A series of photomicrographs were taken of tissues from
non-transgenic JNPL3 siblings showing that PGRN polypeptide
expression increases from 2-10 months of age. Tissue from spinal
cord with omit of the primary antibody served as a control.
Photomicrographs of tissues from a two month old mouse showed light
PGRN polypeptide positive staining Relatively little staining was
observed in the ramified microglia, although there appeared to be
light immunoreactivity. By ten months of age, there was a
significant increase in neuropil immunoreactivity. Both neurons and
microglia had detectable PGRN polypeptide immunoreactivity. Results
of these experiments indicate that PGRN polypeptide levels
gradually increase with age in both microglial and neuronal
populations in the absence of pathology.
[0293] Studies of JNPL3 mice indicated that there was an increase
in PGRN polypeptide staining that strongly correlated with
increasing motor impairment and increasing tau pathology. A series
of photomicrographs were taken demonstrating that PGRN polypeptide
expression increases according to pathological stage.
Photomicrographs of tissue from an unaffected 2 month old JNPL3
mouse indicated that there was slightly more PGRN polypeptide
immunoreactivity than was seen in 10-month old non-transgenic mice.
Photomicrographs of tissue from an 8 month old mouse having mild
motor impairment showed increased neuropil staining and an increase
in the number of PGRN polypeptide positive microglia.
Photomicrographs of tissue from a 14 month old mouse having
moderate motor impairment indicated significant microglial
activation and an increase in neuropil staining Photomicrographs of
tissue from 10 month old mouse having late/end stage pathology
showed a significant increase in the number of PGRN
polypeptide-positive activated microglia and increased neuropil
staining Results of these studies indicate that PGRN polypeptide
expression is upregulated significantly at the onset of
neurodegenerative phenotypes in the JNPL3 mouse model of tauopathy,
consisting of increased microglial and neuronal PGRN polypeptide
expression.
Example 10
Characterizing the Biochemical Pathways that Elevate PGRN
Polypeptide Expression
[0294] Experiments are performed to determine how PPAR agonists and
NSAIDs regulate PGRN polypeptide expression. The hypothesis of this
study is that PGRN polypeptide expression depends on activity and
co-factors within the PPAR nuclear receptor pathways, and that PPAR
agonists and NSAIDs target the same pathways. In addition to
studies demonstrating that PPAR agonists can regulate PGRN
polypeptide expression, studies of the promoter region of the PGRN
gene suggested the presence of putative PPAR binding sites and PPAR
response elements (Bhandari et al., Endocrinology, 133:2682-2689
(1993); Bhandari et al., Biochem J, 319 (Pt 2):441-447 (1996)).
Experimental work with myeloid cells showed that all trans-retinoic
acid, which associates with retinoic acid receptors and
significantly enhances PPAR receptor activity, results in an
upregulation of PGRN mRNA (Ong et al., Am J Physiol Regul Integr
Comp Physiol, 291:R1602-1612 (2006)). NSAIDs may also function as
PPAR agonists (Jaradat et al., Biochem Pharmacol, 62:1587-1595
((2001); Lehmann et al., J Biol Chem, 272:3406-3410 (1997)). Kojo
et al. (J Pharmacol Sci, 93:347-355 (2003)) showed that ibuprofen
and other NSAIDS may selectively activate PPAR receptor activity at
1.times.10e.sup.-9 M and higher concentrations in in vitro
assays.
[0295] It is hypothesized that increased PGRN polypeptide
expression is caused by the activation of PPAR receptors by both
PPAR compounds and by NSAIDs, such as ibuprofen, indomethacin, and
diclofenac, that are thought to activate PPAR.delta. and
PPAR.gamma., but not PPAR.alpha., receptors (Kojo et al., J
Pharmacol Sci, 93:347-355 (2003)). Activated receptors bind to a
PPAR responsive element (PPRE) within the PGRN promoter, resulting
in increased mRNA transcription and translation. The hypothesis is
tested using two studies. In one study, dose-response assays for
PGRN polypeptide are performed using a combination of
pharmacological manipulation and RNA-interference. In another
study, the functional peroxisome-proliferator responsive element is
identified in human GRN.
[0296] Studies to address the regulation of PGRN mRNA and
polypeptide by pharmacological manipulation of PPAR receptors are
initially addressed use a series of agonist-antagonist
dose-response studies. Highly selective PPAR.alpha. (GW7647),
PPAR.delta. (L165,041), and PPAR.gamma. (GW1929) agonists that are
active in the low nM range are obtained from commercial vendors,
such as Calbiochem. PPAR antagonists, including compounds that are
selective for the PPAR.gamma. receptor subtype with an IC.sub.50 in
the low nM range, also are obtained. In addition, compounds such as
GW9662 (2-Chloro-5-nitro-N-phenylbenzamide), are obtained. Such
compounds can block PPAR.alpha. receptors in the low nM range and
PPAR.delta. receptors in the low micromolar range and can be used
as pan-PPAR inhibitors at higher concentrations (Leesnitzer et al.,
Biochemistry, 41:6640-6650 (2002)).
[0297] Pharmacological studies are performed with both PPAR
agonists and NSAIDs, including ibuprofen, indomethacin, and
diclofenac, to elevate PGRN production. GW9662 is used as a
pan-PPAR inhibitor to show that both PPAR agonists and NSAIDs exert
functional activity on PGRN expression through the PPAR nuclear
transcription pathway. Northern blot analysis and real-time RT-PCR
are used to quantitate mRNA levels of PGRN. Western blotting is
used to quantitate intracellular and secreted PGRN polypeptide
levels. To validate the assays, PPAR transcription factor activity
induced by NSAIDs and PPAR agonists is determined in these
experiments through the use of the PPAR.alpha., .delta., .gamma.
Complete Transcription Factor Assay Kit (Cayman Chemical). This kit
allows for quantitative detection of PPAR-DNA binding. Follow up
studies in BE(2)-M17 human neuroblastoma cell lines employ a siRNA
approach. These studies use siRNA to selectively downregulate
PPAR.alpha., PPAR.gamma., and PPAR.delta. receptors, which allows
for a careful dissection of each pathway in the regulation of PGRN
expression. Validated siRNA sequences against PPAR.alpha.,
PPAR.gamma., and PPAR.delta. receptors are available from
Invitrogen.
[0298] To investigate the hypothesis that the PGRN promoter
contains a functional PPRE, protocols described elsewhere are used
(Chen et al., Biochem Biophys Res Commun, 347:821-826 (2006)).
Briefly, PCR amplification is used to perform serial deletions of
the 5' flanking region of the human GRN promoter sequence. Serial
deleted promoter sequences are subcloned into a luciferase
expression vector (Promega), and the promoter-reporter sequences
are confirmed by DNA sequencing. One hour prior to transfection,
Be(2)-M17 cells are pretreated with PPAR.alpha., PPAR.gamma., or
PPAR.delta. agonists at an appropriate EC.sub.50 concentration. M17
cells lines are transiently transfected with promoter-reporter
vectors, and monitored for luciferase expression with treatment. As
a positive control, p-RL (Renilla luciferase expression vector)
plasmid is co-transfected as a transfection efficiency control.
Forty-eight hours after transfection, both the Firefly and Renilla
luciferase activities are quantified using a Dual-Luciferase
reporter assay system (Promega, Madison, Wis.). To confirm that the
promoter-reporter is activated by PPAR receptors on positive hits,
an active promoter-reporter sequence is transiently co-transfected
with PPAR.gamma. and RXR.alpha. expression vectors to show
activation of luciferase expression in the presence or absence of
PPAR agonists. Electrophoretic mobility shift assays are used to
determine whether specific polypeptide-DNA complexes are formed
when cells that have been transiently transfected with
promoter-reporter vectors are treated with PPAR agonists. In this
analysis, nuclear extracts of transiently transfected and treated
cells are prepared with a Nuclear Extract Kit (Active Motif,
Carlsbad, Calif.). Consensus PPRE and PPRE-like sequence
double-stranded oligonucleotides that are used in EMSA competition
assays are labeled with .gamma.-.sup.32P-ATP by polynucleotide
kinase enzyme (Promega) and purified using a Sephadex G-25 spin
column (Amersham, Piscataway, N.J.). The oligonucleotide probes
used in this experiment correspond to a PPRE-like probe (which is
obtained from an active promoter-reporter vector) and a competitive
consensus PPRE probe that is common to all PPRE elements
(Schachtrup et al., Biochem J, 382:239-245 (2004)):
5'-CAAAACTAGGTCAAAGGTCA-3' (SEQ ID NO:71). Unlabeled probes are
used in 100-fold excess concentration for competition experiments.
In some experiments, a LightShift Chemiluminescent EMSA kit
(Pierce) is used to perform the EMSA assays.
[0299] To perform Western blot analysis of PGRN polypeptide
expression, cells are lysed in a mild detergent buffer containing
protease inhibitor, sonicated, and centrifuged to remove cellular
debris. Progranulin levels are assessed in brain tissue by probing
blots using an anti-mouse PGRN antibody (R&D Systems), followed
by a sheep anti-mouse secondary antibody (Sigma-Aldrich). GAPDH
polypeptide expression is used as a marker to normalize polypeptide
levels.
[0300] The Transcription Factor Assay Kit (Cayman Chemical) is used
to detect PPAR-DNA binding. Briefly, nuclear lysates prepared from
treated cells are added to a 96-well plate coated with a dsDNA
sequence containing PPREs. PPAR bind to the PPRE elements, plates
are washed, and PPAR.alpha., PPAR.gamma., and PPAR.delta. receptors
are detected using primary and secondary antibodies.
[0301] A quantitative real-time PCR assay is used to measure GRN
expression. Total RNA is extracted from M17 cells using Trizol
Reagent (GIBCO-BRL/Life Technologies, Invitrogen). RNA is treated
with RQ1 DNase (Promega) and then reverse transcribed using moloney
murine leukemia virus RT (GIBCO-BRL/Life Technologies). Expression
values are normalized to .beta.-actin expression. The primer pairs
used for the GRN transcript are 5'-GGACAGTACTGAAGACTCTG-3' (forward
primer; SEQ ID NO:72) and 5'-GGATGGCAGCTTGTAATGTG-3' (reverse
primer; SEQ ID NO:73); the primers for .beta.-actin are
5'-GAAGTGTGACGTGGACATCC-3' (forward primer; SEQ ID NO:74) and
5'-CCGATCCACACGGAGTACTT-3' (reverse primer; SEQ ID NO:75;
GIBCO-BRL/Life Technologies). Amplification reaction mixtures are
prepared according to the LightCycler FastStart DNA Master SYBR
Green I kit instructions (Roche Applied Science, Penzberg, Germany)
with a final primer concentration of 0.5 .mu.M for each reaction.
The amplifications are performed in duplicates using the following
conditions: hot start step (denaturation) at 95.degree. C. for 10
minutes, followed by 45 cycles of 95.degree. C. for 10 seconds,
66.degree. C. for 10 seconds, and 72.degree. C. for 10 seconds.
[0302] To perform Northern blotting, total RNA is isolated from
10.sup.7 cells using TriZol Reagent. RNA samples, 10 or 15 .mu.g,
are denatured with glyoxal at 50.degree. C. for 1 hour and
subjected to electrophoresis using a 1% agarose gel in 10 mM
NaH.sub.2PO.sub.4, pH 7. RNA is transferred to a nylon blotting
membrane (Bio-Rad, Hercules, Calif.) and fixed by baking. Membranes
are hybridized at 65.degree. C. in 0.5 M NaH.sub.2PO.sub.4 for 24
hours using a radiolabeled complementary sequence to the 5' end of
PGRN, and then stringently washed. Autoradiograms are obtained by
exposing these blots to X-Omat film with intensifying screens.
Densitometry is performed using ImageJ software (NIH, Bethesda,
Md.) and normalized to the 28S ribosomal RNA bands. Statistical
analyses are performed with ANOVA.
Example 11
Determining if PGRN Polypeptide Alters Neurodegeneration In
Vivo
[0303] Studies are performed to determine how alterations in the
level of PGRN polypeptide can modulate neurodegeneration in the
JNPL3 mouse line, a tauopathy model. Two different animal models
(JNPL3 and PGRN.sup.-/- mice) are used to test whether different
levels of PGRN polypeptide can modulate a neurodegenerative
phenotype. PGRN polypeptide expression was observed to correlate
positively with neuropathology in the JNPL3 line, but it is not
known whether this is a primary or secondary response. Given the
modulatory role of PGRN polypeptide on inflammatory processes in
peripheral tissues, experiments are performed to determine if JNPL3
mice lacking PGRN have an accelerated neurodegenerative phenotype.
Studies also are performed to determine whether elevated PGRN
levels can slow the neurodegenerative phenotype in JNPL3 mice.
[0304] Compared with a relatively modest age-related increase in
PGRN expression in non-transgenic siblings, there is a significant
upregulation of PGRN expression in both white and gray matter in
JNPL3 mice. Although there is only modest evidence for pathology in
young PGRN.sup.-/- mice (below), a 50% reduction in PGRN expression
leads to full-blown FTD in human patients (Baker et al., Nature,
442:916-919 (2006); Cruts et al., Nature, 442:920-924 (2006)). In
addition, PGRN is an important factor in wound healing (He and
Bateman, J Mol Med, 81:600-612 (2003); He et al., Nat Med,
9:225-229 (2003); He et al., Cancer Res, 62:5590-5596 (2002)). The
loss of PGRN may impair healing processes and promote inflammation,
leading to an acceleration of tauopathy, advanced synaptic
degeneration, increased microglial activation and gliosis, and a
shortened life span in the JNPL3 model.
[0305] A backcross of JNPL3 mice with PGRN.sup.-/- mice is
performed to generate (JNPL3)(PGRN.sup.+/-), and
(JNPL3)(PGRN.sup.-/-) mice. (JNPL3)(PGRN.sup.+/+) mice also are
generated for comparison studies. Thirty mice of each line are
allowed to age until reaching a "severe" motor deficit stage, as
assessed by formal motor tests given on a weekly basis. Mice are
sacrificed upon reaching this threshold. A Kaplan-Meier survival
curve and median survival time are developed from this data and
compared across groups. Brains and spinal cord are harvested from
euthanized mice and evaluated for alterations in levels of
hyperphosphorylated tau, PGRN, microglial activation, gliosis and
inflammatory markers, and numbers of neurons, glial and
oligodendrocytes. Since PGRN is expressed in neurons and is likely
to be an important survival factor that can affect synaptic
function, the synaptic architecture is characterized by evaluating
the anterior horn cells from the mice. JNPL3 mice show an altered
synaptic number with the onset of tau pathology (Katsuse et al.,
Neurosci Lett, 409:95-99 (2006)). Synaptic number is evaluated
using double immunofluorescence staining for pre- and post-synaptic
densities. Dendritic spine number is characterized by visualizing
neurons with DiOlistic labeling (ballistic delivery of lipophilic
dye), followed by quantification of dendrites and spines with the
Metamorph imaging system. These data indicate whether PGRN helps to
maintain functional neuronal connects in the presence of ongoing
neuropathology.
[0306] JNPL3 transgenic mice are on the C57BL/6 background strain.
These animals are hemizygous for the 0N4R tau isoform with the
P301L mutation in exon 10, driven by the MoPrP promoter (Lewis et
al., Nat Genet, 25:402-405 (2000)). Expression in hemizygotes is
almost equivalent to that of endogenous mouse tau, and these mice
develop neurofibrillary tangles, neuronal loss, and motor deficits
as early as 6 months of age, with up to a fifty-percent neuronal
loss in the spinal cord. Onset of severe neuropathology typically
begins from 12-14 months of age. In these mice, neurofibrillary
tangles in neuronal cell bodies are composed mainly of straight tau
filaments, and are concentrated in the spinal cord, brain stem, and
some regions of the midbrain of the P301L animals. Pre-tangles in
the mice have a much wider distribution. Neurofibrillary tangles,
similar to those found in human tauopathies, are positive for
thioflavin S, Congo red, and Gallyas, Bielschowsky, and Bodian
silver stains, and can be stained with numerous antibodies for tau
hyperphosphorylation.
[0307] A colony of PGRN knockout mice on the C57BL/6 background
strain (The Jackson Laboratory, Bar Harbor, Me.) was established
(Charles River Laboratories, Wilmington, Mass.). A targeted
disruption of the genomic region of PGRN from exon 2 to exon 13 was
performed by replacement with a PGK-Neo-pA cassette. The targeted
disruption knocks out 3.7 kb of the PGRN genomic locus and results
in complete deletion of PGRN. Both hemizygous (.sup.+/-) and
homozygous (.sup.-/-) mice were viable.
[0308] An initial characterization of PGRN wild-type (.sup.+/+),
heterozygous (.sup.+/-) and homozygote (.sup.-/-) knockout mice at
1 and 8 months of age has been performed. PGRN expression was
detected in the wild-type (WT) mice, was observed to a lesser
extent in the PGRN.sup.-/- mice, and was completely absent in the
null mice. In wild-type mice, PGRN immunoreactivity was most
pronounced in the hippocampus. Expression was also high in the
cortex and in Purkinje cells of the cerebellum. It was noted that
GFAP immunoreactivity, a marker for astrocytes and astrogliosis,
was significantly greater in the 8-month PGRN.sup.-/- mice compared
with all other groups. These results suggest that the mice have a
subtle form of pathology.
[0309] To generate a null PGRN background in the JNPL3 line, JNPL3
mice are backcrossed onto the PGRN.sup.-/- background over two
rounds of breeding. All mice are maintained on a C57BL/6 background
strain (The Jackson Laboratory) to minimize genetic differences
between groups. In the first round, hemizygous JNPL are bred with
PGRN null mice (JNPL3)(PGRN.sup.-/-), resulting in 50% hemizygous
(JNPL3)(PGRN.sup.+/-) and 50% PGRN.sup.+/-. Hemizygous offspring
(JNPL3)(PGRN.sup.+/-) are backcrossed to the PGRN.sup.-/- line,
generating 25% (JNPL3)(PGRN.sup.-/-), 25% (JNPL3)(PGRN.sup.+/-),
25% PGRN.sup.-/-, and 25% PGRN.sup.+/- mice. JNPL3 mice on a
wild-type PGRN background are used for comparison.
[0310] Synapses and dendritic Spine Number are evaluated. Changes
in presynaptic vesicles associated with tauopathy are examined
using an antibody to synaptophysin (STN clone SY38, Chemicon).
Additionally, changes in the active zone of synapses are examined
by dual fluorescent labeling of the pre-synaptic protein (Bassoon)
and post-synaptic protein (SAP-102; Christopherson et al., Cell,
120:421-433 (2005); Dresbach et al., Mol Cell Neurosci, 23:279-291
(2003)). "DiOlistic" labeling, or particle-mediated ballistic
delivery of lipophilic dyes (Gan et al., Neuron, 27:219-225
(2000)), is used to rapidly and differentially label brain cells in
transgenic mice to examine neuronal architecture. Tungsten
particles coated with DiI
(1,1-dioctadecyl-3,3,3',3'-tetramethyl-indocarbocyanine
perchlorate) are shot into fixed brain sections (200 .mu.m) using a
gene gun (Bio-Rad, Hercules, Calif.) and allowed to diffuse into
cells. Labeled dendritic arbors and axons are typically visible
over several hundred microns. For example, an image of a neuron was
acquired following DiOlistic labeling. The image represented a
collapsed view of 100 confocal planes covering 50 .mu.m of depth. A
high magnification image of an apical dendrite after DiOlistic
labeling showed dendritic spines. These results indicate that clear
labeling of dendritic spines is possible using this method. For
each neuron, the number of spines along five random stretches of
apical dendrite at least 10 .mu.m in length is counted using
Metamorph automated quantitation software (Molecular Devices,
Sunnyvale, Calif.). The density of spines is calculated by
normalizing the value for the number of spines for a 10 .mu.m
segment length. For each experimental group, a minimum of 2,000
spines per animal are analyzed with the investigators blind to
genotype.
[0311] Immunohistochemistry is used to assess tauopathy phenotype.
Standard tau antibodies used in this study include AT8 and PHF-1
for abnormal tau phosphorylation and MC1 for abnormal tau
conformation (Lewis et al., Nat. Genet., 25:402-405 (2000)).
Additionally, the following antibodies are used to detect neurons
(NeuN; Chemicon, Millipore, Billerica, Mass.), oligodendrocytes
(CAII; Ghandour), microglia (CD11B; Serotec/CD45 Serotec, Raleigh,
N.C.), astrocytes (GFAP, Astrazenica), and progranulin (R&D
Systems). Neuronal number is quantitated in spinal cord using an
unbiased stereological approach (the single section dissector
method; Moller et al., J Microsc, 159 (Pt 1):61-71 (1990)).
[0312] Biochemistry is applied to characterize the tau species
present in different treatment groups. Regional dissections of
spinal cord, cortex and cerebellum are sequentially extracted
through a typical tau sarkosyl fractionation protocol that
separates soluble and insoluble tau species in treatment groups
(Ramsden et al., J Neurosci, 25:10637-10647 (2005)). Brain tissue
is homogenized in 10 volumes (g/mL) of TBS containing protease and
phosphatase inhibitors and spun at 100,000 g for one hour. The TBS
supernatant is analyzed for soluble tau. The pellet is re-extracted
with TBS containing 10% sucrose and 0.8 M sodium chloride. The
sucrose supernatant is adjusted to 1% sarkosyl and incubated at
37.degree. C. for one hour. The sarkosyl pellet is collected by
spinning the sucrose supernatant at 100,000 for two hours. The
pellet is then solubilized in Laemmli buffer. The protein is
electrophoresed and western blotted by standard protocol.
Polypeptide loading on western blots is determined by polypeptide
quantification for the soluble fraction (S1) and by initial tissue
input for the insoluble fraction (P3). The western blots of soluble
and insoluble tau are probed with antibodies that recognize human
tau (E1), mouse and human tau (WKS46), and phosphorylated tau.
Screening is carried out for numerous tau phosphoepitopes (e.g.,
phospho-202/205, phospho-231/235, and phospho-396/404). Western
blots are probed with tau antibodies sensitive to phosphorylation
and conformationally dependent epitopes, as well as with an
anti-mouse PGRN antibody (R&D Systems).
[0313] Motor performance is evaluated in transgenic mice. A basic
SHIRPA protocol, consisting of primary and secondary screens, is
used to comprehensively evaluate mouse motor behavior (Rogers et
al., Mamm Genome, 8:711-713 (1997)). This battery of simple tests
begins with procedures that are most sensitive to physical
manipulation. Additional screens include the assessment of
sensorimotor deficits using rota-rod, wire hang testing, and gait
analysis. Motor function is monitored twice a week by wire hang,
beam walk, and flight reflex tests. Animals are monitored daily
when signs of motor impairments become evident. Based on
performance, animals are categorized as "unaffected," "initial,"
"moderate," and "severe" motor phenotype. Animals failing at least
two consecutive motor tests for two consecutive days and scored as
a severe phenotype are sacrificed. The statistical significance
between groups is assessed by a one-way ANOVA followed by a
Fisher's post-hoc test.
[0314] In some experiments, established tau transgenic lines, such
as tau mice, are used.
Example 12
Determining if Agents that Elevate PGRN Polypeptide Expression are
Neuroprotective In Vivo
[0315] Two studies are performed to (1) identify agents that can
elevate PGRN polypeptide levels using cell-based and cortical slice
screens, and (2) to validate the neuroprotective effects of the
best candidate agents in vivo using the (JNPL3)(PGRN) mouse cross.
Screening is performed using agents that are closely related to the
anti-inflammatory and PPAR drugs identified in vitro as PPAR
elevating compounds. Agents that elicit robust increases in PGRN
polypeptide in cortical slice cultures are tested in transgenic
mice.
[0316] Agents are screened to identify prospective candidates that
can elevate production of PGRN polypeptide in vivo (FIG. 33).
Agents that are screened include (a) non-steroidal
anti-inflammatory drugs (30 compounds, including COX-1 and COX-2
inhibitors), (b) PPAR agonists (10 compounds), (c) HMG-CoA
reductase inhibitors (8 compounds), (d) anti-histamines (5
compounds), (e) and a limited collection of 20 natural products and
derivatives of natural products, including curcumin, ginseng,
ginkgo biloba, resveratrol, green tea extracts (epigallocatechin
gallate, epigallocatechin, epicatechin gallate, epicatechin and
gallic acid) and anthocyanins. Agents that are screened include
drugs that are reported to have protective effects in Alzheimer's
disease (Vardy et al., Expert Rev Neurother, 6:695-704 (2006)).
Compounds are purchased from commercial sources, including
Calbiochem and Sigma-Aldrich. A screening system for PGRN
polypeptide was developed to test the agents. The screening system
yielded highly reproducible results and was used to identify drug
candidates. Agents are screened in BE(2)-M17 (human neuroblastoma)
and N2A (mouse neuroblastoma) cells over a 6-log order
concentration (1.times.10e.sup.-9-1.times.10e.sup.-5) in four
replicates. Media and lysates are collected and analyzed by Western
blot for alterations in PGRN polypeptide levels. Agents also are
screening using a standard MTT assay to eliminate non-specific
effects from toxicity.
[0317] Agents exhibiting activity in cell-culture based screens are
tested in (JNPL3)(PGRN.sup.+/+) organotypic cortical slices to
evaluate PGRN polypeptide elevating activity in an ex vivo system
that contains a relatively intact neuronal architecture with
neurons and microglia before performing in vivo studies. Slices are
prepared from brains of mice in the fourth week of postnatal
development and are maintained for periods of a month or more
(Gahwiler et al., Trends Neurosci, 20:471-477 (1997)). The slices
have preserved adult-like characteristics. The slices also retain
much of the connective organization found in vivo as well as the
potential for synaptic plasticity (long term potentiation) and
responsiveness to pathological insults. Long-term organotypic slice
cultures are well suited for studying changes in brain physiology
and pathology associated with tau expression and drug treatments.
The organotypic slices are accessible to a variety of experimental
manipulations that are independent of the blood brain barrier, and
consequently represent a good model system to screen potential
agents for regulation of PGRN polypeptide expression. Cortical
slices are primarily used in these studies to validate the cell
culture effects of short term agent treatment on both intracellular
and secreted PGRN polypeptide levels using dose-response
curves.
[0318] Two lead agents that are confirmed to elevate PGRN
polypeptides levels in cortical slices are further evaluated for an
effect on neurodegenerative processes and survival. As an initial
in vivo screen, up to six potential candidate agents are selected
for long-term treatment by performing pilot studies with an initial
escalating dose-response trial design in order to select the most
promising agent for long-term treatment. Groups of one month old
(JNPL3)(PGRN.sup.+/-) mice are treated via the oral administration
route in short-term (one week) studies using a dose-escalating
study design. Actual doses used for each agent are based on
dose-responses seen in the cortical slice system. Up to five
different agents are tested in this design. Brain and spinal cord
tissue are analyzed for PGRN polypeptide levels by Western
blotting. Two agents that show the greatest increase are selected
for long-term studies.
[0319] Mice are chronically treated using a dietary strategy that
assumes an average daily consumption of food (and incorporated
agents). Agents are homogenously incorporated into kibble. JNPL3
mice are backcrossed onto the PGRN.sup.-/- lines to generate three
groups of 30 mice with each of the following genotypes:
(JNPL3)(PGRN.sup.+/-), (JNPL3)(PGRN.sup.-/-) and
(JNPL3)(PGRN.sup.+/+), for comparison studies. Mice are placed on
the diet immediately after weaning and are allowed to age until
reaching a "severe" motor deficit stage, as assessed by formal
motor tests given on a weekly basis. Mice are sacrificed upon
reaching this threshold in order to generate a Kaplan-Meier
survival curve and median survival time. Brains and spinal cord are
harvested from euthanized mice and evaluated by immunohistochemical
and biochemical means for alterations in hyperphosphorylated tau,
endogenous PGRN levels, microglial activation, inflammatory markers
and neuronal cell number. A PGRN knockout background on the JNPL3
line allows a specific PGRN-protective response to be distinguished
from a response that occurs because of a general neuroprotective
effect.
[0320] Organotypic slice cultures are prepared using a modified
protocol described elsewhere (Xiang et al., J Neurosci Methods,
98:145-154 (2000)). Brains from transgenic mice 25-30 days
postnatal are aseptically removed and sagittally hemisected. Each
hemi brain is sliced into 400-.mu.m-thick sections using a
McIllwain tissue chopper (Brinkman Instruments, Westbury, N.Y.).
Sections are allowed to rest for one hour in a highly oxygenated,
balanced salt solution. Sections are then plated onto membrane
inserts (Millipore) in six-well plates (three slices/well).
Cultures are maintained in one mL of elevated potassium slice
culture media (25% horse serum (GIBCO-Life Technologies), 50% Basal
Essential Media-Eagles, 25% Earle's balanced salt solution (EBSS),
25 mM NaHEPES, 1 mM glutamine, 28 mM glucose, pH 7.2) and incubated
at 32.degree. C. in a 5% CO.sub.2 atmosphere. After three days,
culture media is switched to a physiological concentration of
potassium (25% horse serum, 50% Basal Essential Media-Eagles, and
EBSS modified so that the potassium concentration is 2.66 mM).
After five days in vitro, cultures are maintained in physiological
potassium slice culture medium containing a reduced serum level
(5%), and the temperature is raised to 35.degree. C. Slices are fed
from the bottom of the culture every three days. Experimental
agents are either added to the culture media, or added dropwise to
the surface of the culture.
[0321] Mice are weighed and evaluated for weekly food consumption.
Based on quantity of kibble consumed (typically 10-14% body weight
per day), candidate agents that elevate PGRN polypeptide levels are
homogenously incorporated into Harlan Teklad 7102 kibble diet by
Research Diets (New Brunswick, N.J.) at a concentration shown to
elevate the level of PGRN polypeptide in brain. Chronic drug dosing
is performed, and consumption of kibble and body weight are
monitored on a weekly basis.
[0322] Animal breeding, biochemistry, immunohistochemistry, motor
evaluation, and statistical analysis are performed as described
herein to evaluate the effects of drug treatment on the development
of neurodegenerative phenotype.
Other Embodiments
[0323] It is to be understood that while the invention has been
described in conjunction with the detailed description thereof, the
foregoing description is intended to illustrate and not limit the
scope of the invention, which is defined by the scope of the
appended claims. Other aspects, advantages, and modifications are
within the scope of the following claims.
Sequence CWU 1
1
861593PRTHomo sapiens 1Met Trp Thr Leu Val Ser Trp Val Ala Leu Thr
Ala Gly Leu Val Ala1 5 10 15Gly Thr Arg Cys Pro Asp Gly Gln Phe Cys
Pro Val Ala Cys Cys Leu 20 25 30Asp Pro Gly Gly Ala Ser Tyr Ser Cys
Cys Arg Pro Leu Leu Asp Lys 35 40 45Trp Pro Thr Thr Leu Ser Arg His
Leu Gly Gly Pro Cys Gln Val Asp 50 55 60Ala His Cys Ser Ala Gly His
Ser Cys Ile Phe Thr Val Ser Gly Thr65 70 75 80Ser Ser Cys Cys Pro
Phe Pro Glu Ala Val Ala Cys Gly Asp Gly His 85 90 95His Cys Cys Pro
Arg Gly Phe His Cys Ser Ala Asp Gly Arg Ser Cys 100 105 110Phe Gln
Arg Ser Gly Asn Asn Ser Val Gly Ala Ile Gln Cys Pro Asp 115 120
125Ser Gln Phe Glu Cys Pro Asp Phe Ser Thr Cys Cys Val Met Val Asp
130 135 140Gly Ser Trp Gly Cys Cys Pro Met Pro Gln Ala Ser Cys Cys
Glu Asp145 150 155 160Arg Val His Cys Cys Pro His Gly Ala Phe Cys
Asp Leu Val His Thr 165 170 175Arg Cys Ile Thr Pro Thr Gly Thr His
Pro Leu Ala Lys Lys Leu Pro 180 185 190Ala Gln Arg Thr Asn Arg Ala
Val Ala Leu Ser Ser Ser Val Met Cys 195 200 205Pro Asp Ala Arg Ser
Arg Cys Pro Asp Gly Ser Thr Cys Cys Glu Leu 210 215 220Pro Ser Gly
Lys Tyr Gly Cys Cys Pro Met Pro Asn Ala Thr Cys Cys225 230 235
240Ser Asp His Leu His Cys Cys Pro Gln Asp Thr Val Cys Asp Leu Ile
245 250 255Gln Ser Lys Cys Leu Ser Lys Glu Asn Ala Thr Thr Asp Leu
Leu Thr 260 265 270Lys Leu Pro Ala His Thr Val Gly Asp Val Lys Cys
Asp Met Glu Val 275 280 285Ser Cys Pro Asp Gly Tyr Thr Cys Cys Arg
Leu Gln Ser Gly Ala Trp 290 295 300Gly Cys Cys Pro Phe Thr Gln Ala
Val Cys Cys Glu Asp His Ile His305 310 315 320Cys Cys Pro Ala Gly
Phe Thr Cys Asp Thr Gln Lys Gly Thr Cys Glu 325 330 335Gln Gly Pro
His Gln Val Pro Trp Met Glu Lys Ala Pro Ala His Leu 340 345 350Ser
Leu Pro Asp Pro Gln Ala Leu Lys Arg Asp Val Pro Cys Asp Asn 355 360
365Val Ser Ser Cys Pro Ser Ser Asp Thr Cys Cys Gln Leu Thr Ser Gly
370 375 380Glu Trp Gly Cys Cys Pro Ile Pro Glu Ala Val Cys Cys Ser
Asp His385 390 395 400Gln His Cys Cys Pro Gln Arg Tyr Thr Cys Val
Ala Glu Gly Gln Cys 405 410 415Gln Arg Gly Ser Glu Ile Val Ala Gly
Leu Glu Lys Met Pro Ala Arg 420 425 430Arg Gly Ser Leu Ser His Pro
Arg Asp Ile Gly Cys Asp Gln His Thr 435 440 445Ser Cys Pro Val Gly
Gly Thr Cys Cys Pro Ser Gln Gly Gly Ser Trp 450 455 460Ala Cys Cys
Gln Leu Pro His Ala Val Cys Cys Glu Asp Arg Gln His465 470 475
480Cys Cys Pro Ala Gly Tyr Thr Cys Asn Val Lys Ala Arg Ser Cys Glu
485 490 495Lys Glu Val Val Ser Ala Gln Pro Ala Thr Phe Leu Ala Arg
Ser Pro 500 505 510His Val Gly Val Lys Asp Val Glu Cys Gly Glu Gly
His Phe Cys His 515 520 525Asp Asn Gln Thr Cys Cys Arg Asp Asn Arg
Gln Gly Trp Ala Cys Cys 530 535 540Pro Tyr Ala Gln Gly Val Cys Cys
Ala Asp Arg Arg His Cys Cys Pro545 550 555 560Ala Gly Phe Arg Cys
Ala Arg Arg Gly Thr Lys Cys Leu Arg Arg Glu 565 570 575Ala Pro Arg
Trp Asp Ala Pro Leu Arg Asp Pro Ala Leu Arg Gln Leu 580 585 590Leu
22095DNAHomo sapiens 2cgcaggcaga ccatgtggac cctggtgagc tgggtggcct
taacagcagg gctggtggct 60ggaacgcggt gcccagatgg tcagttctgc cctgtggcct
gctgcctgga ccccggagga 120gccagctaca gctgctgccg tccccttctg
gacaaatggc ccacaacact gagcaggcat 180ctgggtggcc cctgccaggt
tgatgcccac tgctctgccg gccactcctg catctttacc 240gtctcaggga
cttccagttg ctgccccttc ccagaggccg tggcatgcgg ggatggccat
300cactgctgcc cacggggctt ccactgcagt gcagacgggc gatcctgctt
ccaaagatca 360ggtaacaact ccgtgggtgc catccagtgc cctgatagtc
agttcgaatg cccggacttc 420tccacgtgct gtgttatggt cgatggctcc
tgggggtgct gccccatgcc ccaggcttcc 480tgctgtgaag acagggtgca
ctgctgtccg cacggtgcct tctgcgacct ggttcacacc 540cgctgcatca
cacccacggg cacccacccc ctggcaaaga agctccctgc ccagaggact
600aacagggcag tggccttgtc cagctcggtc atgtgtccgg acgcacggtc
ccggtgccct 660gatggttcta cctgctgtga gctgcccagt gggaagtatg
gctgctgccc aatgcccaac 720gccacctgct gctccgatca cctgcactgc
tgcccccaag acactgtgtg tgacctgatc 780cagagtaagt gcctctccaa
ggagaacgct accacggacc tcctcactaa gctgcctgcg 840cacacagtgg
gcgatgtgaa atgtgacatg gaggtgagct gcccagatgg ctatacctgc
900tgccgtctac agtcgggggc ctggggctgc tgccctttta cccaggctgt
gtgctgtgag 960gaccacatac actgctgtcc cgcggggttt acgtgtgaca
cgcagaaggg tacctgtgaa 1020caggggcccc accaggtgcc ctggatggag
aaggccccag ctcacctcag cctgccagac 1080ccacaagcct tgaagagaga
tgtcccctgt gataatgtca gcagctgtcc ctcctccgat 1140acctgctgcc
aactcacgtc tggggagtgg ggctgctgtc caatcccaga ggctgtctgc
1200tgctcggacc accagcactg ctgcccccag cgatacacgt gtgtagctga
ggggcagtgt 1260cagcgaggaa gcgagatcgt ggctggactg gagaagatgc
ctgcccgccg cggttcctta 1320tcccacccca gagacatcgg ctgtgaccag
cacaccagct gcccggtggg cggaacctgc 1380tgcccgagcc agggtgggag
ctgggcctgc tgccagttgc cccatgctgt gtgctgcgag 1440gatcgccagc
actgctgccc ggctggctac acctgcaacg tgaaggctcg atcctgcgag
1500aaggaagtgg tctctgccca gcctgccacc ttcctggccc gtagccctca
cgtgggtgtg 1560aaggacgtgg agtgtgggga aggacacttc tgccatgata
accagacctg ctgccgagac 1620aaccgacagg gctgggcctg ctgtccctac
gcccagggcg tctgttgtgc tgatcggcgc 1680cactgctgtc ctgctggctt
ccgctgcgca cgcaggggta ccaagtgttt gcgcagggag 1740gccccgcgct
gggacgcccc tttgagggac ccagccttga gacagctgct gtgagggaca
1800gtactgaaga ctctgcagcc ctcgggaccc cactcggagg gtgccctctg
ctcaggcctc 1860cctagcacct ccccctaacc aaattctccc tggaccccat
tctgagctcc ccatcaccat 1920gggaggtggg gcctcaatct aaggcccttc
cctgtcagaa gggggttgag gcaaaagccc 1980attacaagct gccatcccct
ccccgtttca gtggaccctg tggccaggtg cttttcccta 2040tccacagggg
tgtttgtgtg ttgggtgtgc tttcaataaa gtttgtcact ttctt
2095320DNAArtificial Sequenceoligonucleotide 3gggctagggt actgagtgac
20418DNAArtificial Sequenceoligonucleotide 4agtgttgtgg gccatttg
18518DNAArtificial Sequenceoligonucleotide 5tgcccagatg gtcagttc
18618DNAArtificial Sequenceoligonucleotide 6gctgcacctg atctttgg
18720DNAArtificial Sequenceoligonucleotide 7ggccactcct gcatctttac
20818DNAArtificial Sequenceoligonucleotide 8tgaatgaggg cacaaggg
18919DNAArtificial Sequenceoligonucleotide 9ttagtgtcac cctcaaacc
191018DNAArtificial Sequenceoligonucleotide 10actggaagag gagcaaac
181123DNAArtificial Sequenceoligonucleotide 11gggcctcatt gactccaagt
gta 231223DNAArtificial Sequenceoligonucleotide 12ggtctttgtc
acttccaggc tca 231318DNAArtificial Sequenceoligonucleotide
13tccctgtgtg ctactgag 181418DNAArtificial Sequenceoligonucleotide
14aagcagagag gacaggtc 181519DNAArtificial Sequenceoligonucleotide
15taccctccat cttcaacac 191618DNAArtificial Sequenceoligonucleotide
16tcacagcaca cagcctag 181718DNAArtificial Sequenceoligonucleotide
17atacctgctg ccgtctac 181818DNAArtificial Sequenceoligonucleotide
18gagggcagaa agcaatag 181922DNAArtificial Sequenceoligonucleotide
19tgtccaatcc cagaggtata tg 222019DNAArtificial
Sequenceoligonucleotide 20acgttgcagg tgtagccag 192118DNAArtificial
Sequenceoligonucleotide 21tggactggag aagatgcc 182218DNAArtificial
Sequenceoligonucleotide 22cgatcagcac aacagacg 182318DNAArtificial
Sequenceoligonucleotide 23catgataacc agacctgc 182418DNAArtificial
Sequenceoligonucleotide 24agggagaatt tggttagg 182518DNAArtificial
Sequenceoligonucleotide 25agaccatgtg gaccctgg 182624DNAArtificial
Sequenceoligonucleotide 26gtgatgcagc gggtgtgaac cagg
242718DNAArtificial Sequenceoligonucleotide 27atacctgctg ccgtctac
182819DNAArtificial Sequenceoligonucleotide 28acgttgcagg tgtagccag
192919DNAArtificial Sequenceoligonucleotide 29gggctagggt actgagtga
193018DNAArtificial Sequenceoligonucleotide 30agtgttgtgg gccatttg
183120DNAArtificial Sequenceoligonucleotide 31gatggtcagt tctgccctgt
203220DNAArtificial Sequenceoligonucleotide 32ccctgagacg gtaaagatgc
203320DNAArtificial Sequenceoligonucleotide 33gtgagctggg tggccttaac
203420DNAArtificial Sequenceoligonucleotide 34gcagagcagt gggcatcaac
203522DNAArtificial Sequenceoligonucleotide 35gatttctgcc tgcctggaca
gg 223622DNAArtificial Sequenceoligonucleotide 36gatgccacat
gaatgagggc ac 223722DNAArtificial Sequenceoligonucleotide
37gtcaccctca aaccccagta gc 223822DNAArtificial
Sequenceoligonucleotide 38catgaaccct gcatcagcca gg
223922DNAArtificial Sequenceoligonucleotide 39ttgctgggag cctggctgat
gc 224022DNAArtificial Sequenceoligonucleotide 40ctcctgctta
cagcacctcc ag 224122DNAArtificial Sequenceoligonucleotide
41ctgacagatt cgtccccagc tg 224222DNAArtificial
Sequenceoligonucleotide 42acctcccatg gtgatgggga gc
224322DNAArtificial Sequenceoligonucleotide 43ggtcatcttg gattggccag
ag 224422DNAArtificial Sequenceoligonucleotide 44tctgcaggtg
gtagagtgca gg 224522DNAArtificial Sequenceoligonucleotide
45agggggtgaa gacggagtca gg 224622DNAArtificial
Sequenceoligonucleotide 46gaggagcaaa cgtgaggggc ag
224722DNAArtificial Sequenceoligonucleotide 47tgatacccct gagggtcccc
ag 224822DNAArtificial Sequenceoligonucleotide 48gaagaagggc
aggtgggcac tg 224922DNAArtificial Sequenceoligonucleotide
49gctaagccca gtgaggggac ag 225022DNAArtificial
Sequenceoligonucleotide 50gccataccca gccccaggat gg
225121DNAArtificial Sequenceoligonucleotide 51cgcctgcagg atgggttaag
g 215223DNAArtificial Sequenceoligonucleotide 52gcgtcactgc
aattactgct tcc 235322DNAArtificial Sequenceoligonucleotide
53agccaggggt accaagtgtt tg 225423DNAArtificial
Sequenceoligonucleotide 54ggggtaatgt gatacagccg atg
235525DNAArtificial Sequenceoligonucleotide 55tggcgtgggc ttaagcagtt
gccag 255625DNAArtificial Sequenceoligonucleotide 56aaccacagac
ttgtgcctgg cgtcc 255723DNAArtificial Sequenceoligonucleotide
57tgctgtccct accgccaggt cag 235825DNAArtificial
Sequenceoligonucleotide 58tgagcagagg gcaccctccg agtgg
255923DNAArtificial Sequenceoligonucleotide 59gtcgggacaa agtttagggc
gtc 236023DNAArtificial Sequenceoligonucleotide 60ggcgcctaga
cgaagtccac agc 236125DNAArtificial Sequenceoligonucleotide
61gcttggagac aggtgacggt ccctg 256224DNAArtificial
Sequenceoligonucleotide 62atccagccct ggactagccc cacg
246321DNAArtificial Sequenceoligonucleotide 63accgcggcca gccataactc
t 216424DNAArtificial Sequenceoligonucleotide 64atcaaggcac
ctcaacataa taat 246519DNAArtificial Sequenceoligonucleotide
65cagggaggag agtgatttg 196620DNAArtificial Sequenceoligonucleotide
66gcagagcagt gggcatcaac 206719DNAArtificial Sequenceoligonucleotide
67tgctgtgtta tggtcgatg 196819DNAArtificial Sequenceoligonucleotide
68gtacccttct gcgtgtcac 196918DNAArtificial Sequenceoligonucleotide
69atacctgctg ccgtctac 187019DNAArtificial Sequenceoligonucleotide
70acgttgcagg tgtagccag 197120DNAArtificial Sequenceoligonucleotide
71caaaactagg tcaaaggtca 207220DNAArtificial Sequenceoligonucleotide
72ggacagtact gaagactctg 207320DNAArtificial Sequenceoligonucleotide
73ggatggcagc ttgtaatgtg 207420DNAArtificial Sequenceoligonucleotide
74gaagtgtgac gtggacatcc 207520DNAArtificial Sequenceoligonucleotide
75ccgatccaca cggagtactt 207617PRTHomo sapiens 76Met Trp Thr Leu Val
Ser Trp Val Ala Leu Thr Ala Gly Leu Val Ala1 5 10 15Gly7741PRTHomo
sapiens 77Thr Arg Cys Pro Asp Gly Gln Phe Cys Pro Val Ala Cys Cys
Leu Asp1 5 10 15Pro Gly Gly Ala Ser Tyr Ser Cys Cys Arg Pro Leu Leu
Asp Lys Trp 20 25 30Pro Thr Thr Leu Ser Arg His Leu Gly 35
407865PRTHomo sapiens 78Gly Pro Cys Gln Val Asp Ala His Cys Ser Ala
Gly His Ser Cys Ile1 5 10 15Phe Thr Val Ser Gly Thr Ser Ser Cys Cys
Pro Phe Pro Glu Ala Val 20 25 30Ala Cys Gly Asp Gly His His Cys Cys
Pro Arg Gly Phe His Cys Ser 35 40 45Ala Asp Gly Arg Ser Cys Phe Gln
Arg Ser Gly Asn Asn Ser Val Gly 50 55 60Ala657981PRTHomo sapiens
79Ile Gln Cys Pro Asp Ser Gln Phe Glu Cys Pro Asp Phe Ser Thr Cys1
5 10 15Cys Val Met Asp Gly Ser Trp Gly Cys Cys Pro Met Pro Gln Ala
Ser 20 25 30Cys Cys Glu Asp Arg Val His Cys Cys Pro His Gly Ala Phe
Cys Asp 35 40 45Leu Val His Thr Arg Cys Ile Thr Pro Thr Gly Thr His
Pro Leu Ala 50 55 60Lys Lys Leu Pro Ala Gln Arg Thr Asn Arg Ala Val
Ala Leu Ser Ser65 70 75 80Ser8076PRTHomo sapiens 80Val Met Cys Pro
Asp Ala Arg Ser Arg Cys Pro Asp Gly Ser Thr Cys1 5 10 15Cys Glu Leu
Pro Ser Gly Lys Tyr Gly Cys Cys Pro Met Pro Asn Ala 20 25 30Thr Cys
Cys Ser Asp His Leu His Cys Cys Pro Gln Asp Thr Val Cys 35 40 45Asp
Leu Ile Gln Ser Lys Cys Leu Ser Lys Glu Asn Ala Thr Thr Asp 50 55
60Leu Leu Thr Lys Leu Pro Ala His Thr Val Gly Asp65 70
758182PRTHomo sapiens 81Val Lys Cys Asp Met Glu Val Ser Cys Pro Asp
Gly Tyr Thr Cys Cys1 5 10 15Arg Leu Gln Ser Gly Ala Trp Gly Cys Cys
Pro Phe Thr Gln Ala Val 20 25 30Cys Cys Glu Asp His Ile His
Cys Cys Pro Ala Gly Phe Thr Cys Asp 35 40 45Thr Gln Lys Gly Thr Cys
Glu Gln Gly Pro His Gln Val Pro Trp Met 50 55 60Glu Lys Ala Pro Ala
His Leu Ser Leu Pro Asp Pro Gln Ala Leu Lys65 70 75 80Arg
Asp8278PRTHomo sapiens 82Val Pro Cys Asp Asn Val Ser Ser Cys Pro
Ser Ser Asp Thr Cys Cys1 5 10 15Gln Leu Thr Ser Gly Glu Trp Gly Cys
Cys Pro Ile Pro Glu Ala Val 20 25 30Cys Cys Ser Asp His Gln His Cys
Cys Pro Gln Arg Tyr Thr Cys Val 35 40 45Ala Glu Gly Gln Cys Gln Arg
Gly Ser Glu Ile Val Ala Gly Leu Glu 50 55 60Lys Met Pro Ala Arg Arg
Ala Ser Leu Ser His Pro Arg Asp65 70 758377PRTHomo sapiens 83Ile
Gly Cys Asp Gln His Thr Ser Cys Pro Val Gly Gln Thr Cys Cys1 5 10
15Pro Ser Leu Gly Gly Ser Trp Ala Cys Cys Gln Leu Pro His Ala Val
20 25 30Cys Cys Glu Asp Arg Gln His Cys Cys Pro Ala Gly Tyr Thr Cys
Asn 35 40 45Val Lys Ala Arg Ser Cys Glu Lys Glu Val Val Ser Ala Gln
Pro Ala 50 55 60Thr Phe Leu Ala Arg Ser Pro His Val Gly Val Lys
Asp65 70 758475PRTHomo sapiens 84Val Glu Cys Gly Glu Gly His Phe
Cys His Asp Asn Gln Thr Cys Cys1 5 10 15Arg Asp Asn Arg Gln Gly Trp
Ala Cys Cys Pro Tyr Arg Gln Gly Val 20 25 30Cys Cys Ala Asp Arg Arg
His Cys Cys Pro Ala Gly Phe Arg Cys Ala 35 40 45Ala Arg Gly Thr Lys
Cys Leu Arg Arg Glu Ala Pro Arg Trp Asp Ala 50 55 60Pro Leu Arg Asp
Pro Ala Leu Arg Gln Leu Leu65 70 758520DNAArtificial
Sequenceoligonucleotide 85ggccatgtga gcttgaggtt 208631DNAArtificial
Sequenceoligonucleotide 86gagggagtat agtgtatgct tctactgaat a 31
* * * * *