U.S. patent application number 12/281356 was filed with the patent office on 2010-04-29 for peptide and uses thereof.
This patent application is currently assigned to Fusion Antibodies Limited, a Corporation of Great Britian. Invention is credited to Richard Buick, Roberta Burden, Jim Johnston, Mark McCurley, Christopher Scott, Philip Snoddy.
Application Number | 20100104554 12/281356 |
Document ID | / |
Family ID | 36218985 |
Filed Date | 2010-04-29 |
United States Patent
Application |
20100104554 |
Kind Code |
A1 |
Scott; Christopher ; et
al. |
April 29, 2010 |
PEPTIDE AND USES THEREOF
Abstract
A method of inhibiting activity of a cathepsin L-like protease
in cells or tissue and the use of the method in the treatment of
disease such as cancer and inflammatory diseases is described. The
method comprises administration of a cathepsin propeptide or a
nucleic acid encoding a cathepsin propeptide. In particular
embodiments, the propeptide is a Cathepsin S propeptide. Further,
the use of propeptides having an Fc portion is described.
Inventors: |
Scott; Christopher;
(Belfast, GB) ; Burden; Roberta; (Belfast, GB)
; Johnston; Jim; (Belfast, GB) ; McCurley;
Mark; (Belfast, GB) ; Snoddy; Philip;
(Belfast, GB) ; Buick; Richard; (Belfast,
GB) |
Correspondence
Address: |
IP GROUP OF DLA PIPER LLP (US)
ONE LIBERTY PLACE, 1650 MARKET ST, SUITE 4900
PHILADELPHIA
PA
19103
US
|
Assignee: |
Fusion Antibodies Limited, a
Corporation of Great Britian
Belfast
GB
|
Family ID: |
36218985 |
Appl. No.: |
12/281356 |
Filed: |
March 2, 2007 |
PCT Filed: |
March 2, 2007 |
PCT NO: |
PCT/GB07/00744 |
371 Date: |
January 16, 2009 |
Current U.S.
Class: |
514/1.1 ;
424/94.63; 435/226; 435/69.1; 514/44R |
Current CPC
Class: |
A61P 29/00 20180101;
A61P 35/00 20180101; A61P 43/00 20180101; A61K 38/4873 20130101;
A61P 9/10 20180101; A61P 37/02 20180101; A61P 11/06 20180101; A61P
25/28 20180101 |
Class at
Publication: |
424/130.1 ;
424/94.63; 435/69.1; 435/226; 514/2; 514/44.R |
International
Class: |
A61K 39/395 20060101
A61K039/395; A61K 38/48 20060101 A61K038/48; C12P 21/06 20060101
C12P021/06; C12N 9/64 20060101 C12N009/64; A61K 38/00 20060101
A61K038/00; A61K 31/7088 20060101 A61K031/7088 |
Foreign Application Data
Date |
Code |
Application Number |
Mar 2, 2006 |
GB |
GB0604187.5 |
Claims
1. A method of inhibiting activity and/or overexpression of a
cathepsin L-like protease in cells or tissue, said method
comprising administration of a cathepsin propeptide or a nucleic
acid encoding a cathepsin propeptide to said cells or tissue.
2. (canceled)
3. A method of treating a condition associated with aberrant
activity and/or overexpression of a cathepsin L-like protease in a
patient in need of treatment thereof, said method comprising
administration of a cathepsin propeptide or a nucleic acid encoding
a cathepsin propeptide.
4. The method according to claim 3 wherein the condition associated
with aberrant activity and/or overexpression of a cathepsin L-like
protease is a neoplastic disease, an inflammatory disorder, a
neurodegenerative disorder, an autoimmune disorder, asthma, or
atherosclerosis.
5. The method according to claim 1, wherein the cathepsin
propeptide is a human cathepsin propeptide comprising amino acid
sequence corresponding to amino acid residues 17 to 113 of the
cathepsin S protease amino acid sequence shown in SEQ ID NO: 20. or
the amino acid sequence corresponding to amino acid residues 13 to
109 of the amino acid sequence shown in SEQ ID NO: 13.
6. The method according to claim 1, wherein the cathepsin
propeptide is a human cathepsin propeptide having the amino acid
sequence shown in SEQ ID NO: 13, or the amino acid sequence shown
in SEQ ID NO: 21.
7. The method according to claim 1, wherein the cathepsin
propeptide comprises an antibody Fc portion.
8. The method according to claim 1, wherein the cathepsin L-like
protease is cathepsin S.
9.-11. (canceled)
12. The method according to claim 3, wherein the cathepsin
propeptide is a human cathepsin propeptide comprising amino acid
sequence corresponding to amino acid residues 17 to 113 of the
cathepsin S protease amino acid sequence shown in SEQ ID NO: 20, or
the amino acid sequence corresponding to amino acid residues 13 to
109 of the amino acid sequence shown in SEQ ID NO: 13.
13. The method according to claim 3, wherein the cathepsin
propeptide is a human cathepsin propeptide having the amino acid
sequence shown in SEQ ID NO: 13, or the amino acid sequence shown
in SEQ ID NO: 21.
14. The method according to claim 3, wherein the cathepsin
propeptide comprises an antibody Fc portion.
15. The method according to claim 3, wherein the cathepsin L-like
protease is cathepsin S.
16.-21. (canceled)
22. A pharmaceutical composition comprising a cathepsin propeptide
or a nucleic acid encoding a cathepsin propeptide.
23. The pharmaceutical composition according to claim 22, wherein
the cathepsin propeptide is a human cathepsin propeptide comprising
amino acid sequence corresponding to amino acid residues 17 to 113
of the cathepsin S protease amino acid sequence shown in SEQ ID NO:
20, or the amino acid sequence corresponding to amino acid residues
13 to 109 of the amino acid sequence shown in SEQ ID NO: 13.
24. The pharmaceutical composition according to claim 22, wherein
the cathepsin propeptide is a human cathepsin propeptide having the
amino acid sequence shown in SEQ ID NO: 13, or the amino acid
sequence shown in SEQ ID NO: 21.
25. The pharmaceutical composition according to claim 22, wherein
the cathepsin propeptide comprises an antibody Fc portion.
26. The pharmaceutical composition according to claim 22, wherein
the cathepsin L-like protease is cathepsin S.
27. A method for the recombinant production of cathepsin
propeptides, said method comprising expressing a cathepsin
propeptide with an N-terminal polyhistidine tag and purifying the
expressed propeptide using metal ion affinity chromatography
(IMAC).
Description
FIELD OF THE INVENTION
[0001] This application relates to a peptide and its use in methods
of treatment. In particular, it relates to a cathepsin propeptide,
methods of its production and uses of the propeptide.
BACKGROUND TO THE INVENTION
[0002] Proteases are a large group of proteins that comprise
approximately 2% of all gene products (Rawlings and Barrett, 1999).
Proteases catalyse the hydrolysis of peptide bonds and are vital
for the proper functioning of all cells and organisms. Proteolytic
processing events are important in a wide range of cellular
processes including bone formation, wound healing, angiogenesis and
apoptosis.
[0003] The lysosomal cysteine proteases were initially thought to
be enzymes that were, responsible for non-selective degradation of
proteins in the lysosomes. Normally associated with localisation in
the lysosomes, these proteases were originally thought to be only
involved in the non-selective degradation of proteins in endosomal
compartments. However, they are now known to be accountable in a
number of specific cellular processes, having roles in antigen
presentation (Honey and Rudensky, 2003; Bryant & Ploegh, 2004)
apoptosis (Zheng et al, 2005; Broker et al, 2005), pro-hormone
processing (Hook et al, 2004) and extracellular matrix remodelling
(Chapman et al, 1994; Chapman et al, 1997).
[0004] Cathepsins are proteolytic enzymes. To date, eleven human
cathepsins have been identified, but the specific in vivo roles of
each are still to be determined (Katunuma et al, 2003). Cathepsins
B, L, H, F, O, X and C are expressed in most cells, suggesting a
possible role in regulating protein turnover, whereas cathepsins S,
K, W and V are restricted to particular cells and tissues,
indicating that they may have more specific roles (Kos et al, 2001;
Berdowska, 2004). Cathepsin L-like proteases (which include CatL, S
and K) are proteolytic enzymes which belong to the CA clan of
cysteine proteases. Each of these lysosomal proteases has been
implicated in the progression of various tumours. It is thought
that their abnormally high secretion from tumour cells leads to the
degradation of the extracellular matrix (ECM). This aberrant
breakdown of ECM components such as elastin and collagen
accelerates the penetration and invasion of these abnormal cells to
surrounding normal tissue.
[0005] Cathepsin L-like proteases are produced as inactive
precursors; containing an N terminal propeptide domain. This
propeptide has previously been shown to act as both as a chaperone
for the folding of the nascent protease and inhibitor of the active
species, binding to the active site of the protease in immature
lysosomes. Inhibition studies have shown that the CatS propeptide
(CatSPP) has a K.sub.i in the low nanomolar range towards activated
CatS and perhaps surprisingly, also has similar properties against
both CatK and CatL, although it has also been shown to have no
effect on the less homologous CatB, CatH or papain. Moreover, this
property of the CatSPP is unique in that the propeptides of K and L
dp not have the same uniform inhibition profile to each of its
cognate family members.
[0006] Cat S (Cathepsin S) was originally identified from bovine
lymph nodes and spleen and the human forth cloned from a human
macrophage cDNA library (Shi et al, 1992). The gene encoding Cat S
is located on human chromosome 1q21. The 996 base pair transcript
encoded by the Cat S gene is initially translated into an
unprocessed precursor protein with a molecular weight of 37.5 kDa.
The unprocessed protein is composed of 331 amino acids; a 15 amino
acid signal peptide, a 99 amino acid pro-peptide sequence and a 217
amino acid peptide. Cat S is initially expressed with a signal
peptide that is removed after it enters the lumen of the
endoplasmic reticulum. The propeptide sequence binds to the active
site of the protease, rendering it inactive until it has been
transported to the acidic endosomal compartments, after which the
propeptide sequence is removed and the protease is activated (Baker
et al, 2003).
[0007] CatS has been identified as a key enzyme in major
histocompatibility complex class II (MHC-II) mediated antigen
presentation, by cleavage of the invariant chain, prior to antigen
loading. Studies have shown that mice deficient in Cat S have an
impaired ability to present exogenous proteins by APC's (Nakagawa
et al, 1999). The specificity of Cat S in the processing of the
invariant chain Ii, allows for Cat S specific therapeutic targets
in the treatment of conditions such as asthma and autoimmune
disorders (Chapman et al, 1997).
[0008] Cathepsin L was originally isolated from the lysosomes of
rat liver before the human form was identified in 1988 (Gal and
Gottesman, 1988; Joseph et al, 1988). The gene encoding CatL was
mapped to human chromosome 9q21-22 (Fan et al., 1989; Chauhan et
al., 1993) and is composed of eight exons and seven introns. The
gene product is translated into a preproprotein with a molecular
weight of 39 kDa and is processed into two enzymatically active
isoforms; a single chain form of 31 kDa and a two-chain form
comprised of a 24 kDa heavy chain and a 5 kDa light chain (Mason et
al 1989). The processing of pro-CatL to the mature active enzyme
can occur via various mechanisms including autocatalytic activation
(Salminen & Gottesman, 1990) and by the action of CatD
(Nishimura et al., 1989; Wiederanders & Kirschke, 1989) or
metallo-endopeptidases (Hara et al., 1988).
[0009] CatL has endopeptidase activity, and preferentially cleaves
peptide bonds with hydrophobic amino acid residues in the P2 and P3
positions (Kargel et al., 1980, 1981). It has been shown to
hydrolyze several proteins with the same specific activity as
cathepsin S (Kirschke et al., 1989). However, it favours aromatic
residues in the P2 position, distinguishing itself from the closely
related cathepsins S and K (McGrath, 1999).
[0010] CatL has been proposed to have a major role in many
biological processes including lysosomal proteolysis and bone
resorption, as well as in several diseases such as arthritis and
malignancy (Rukamp and Powers, 2002). The role of lysosomal
cysteine proteases in antigen presentation has been extensively
researched within the past few years. CatL has been implicated in
this process through its ability to perform the final step of Ii
proteolysis in cortical thymic epithelial cells. Further evidence
has shown that the p41 isoform of the Ii chain has the ability to
interact with the mature CatL protein, inhibiting its activity and
stabilising it in neutral pH environments (Ogrinc et al, 1993;
Bevec et al, 1996). Studies on CatL-deficient mice were observed to
be incapable of the degradation of the invariant chain in cortical
epithelial cells of the thymus (Nakagawa et al, 1998) and exhibited
a distinct defect in CD4+ T cell selection (Roth et al, 2000). Mice
lacking cathepsin L also developed periodic hair loss and epidermal
hyperplasia due to alterations in hair follicle morphogenesis.
[0011] The role of CatL in tumour invasion and metastasis has also
been studied in great detail due to its ubiquitous expression and
its ability to degrade components of the extracellular matrix and
basement membrane. Elevated expression levels of CatL have been
associated with a wide range of malignancies including breast,
colon, prostate, kidney carcinomas and astrocytomas.
[0012] Recent evidence has also suggested that CatL may function as
a transcriptional activator. Alternative isoforms of CatL have
previously been reported (Rescheleit et al, 1996; Seth et al,
2003), however an isoform lacking the N-terminal signal peptide has
been shown to localise to the nucleus, suggesting a role for CatL
in the processing of the CDP/Cux transcription factor. This theory
was reinforced by studies on CatL-deficient fibroblasts, which
appeared to have a marked reduction in CDP/Cux processing (Goulet
et al, 2004).
[0013] Cathepsin K was first cloned from cDNA rabbit in 1994
(Tezuka et al, 1994), prior to the description of the human
ortholog the following year by several independent groups (Bromine
et al, 1995; Shi et al, 1995; Inaoka et al, 1995). The gene
encoding CatK is situated on human chromosome 1q21, the same locus
as CatS, suggesting that these two proteases may have a common
origin. The promoter structure of CatK is similar to that of CatS
with the absence of a TATA box but with the presence of two AP-1
sites; both common features of genes which show restricted
expression patterns. Human CatK expression has been shown to be
restricted and is found predominantly in osteoclasts and in the
ovary (Bromine et al, 1995; Drake et al, 1996).
[0014] The amino acid sequence of CatK shows high sequence
similarity with cathepsins S and L (52% and 46% respectively) and
together these three genes form a small subfamily within the
mammalian lysosomal cysteine proteases. CatK has been characterised
as one of the most potent elastinolytic enzymes, with greater
activity that pancreatic elastase at pH5.5 (Bromme et al, 1996;
Chapman et al, 1997). It also has the ability to catalyse the
hydrolysis of collagen type I, II and IV (Kafienah et al,
0.1998).
[0015] The physiological relevance of the collagenolytic activity
of CatK is illustrated through its association with the bone
disorder, pycnodysostosis (Gelb et al, 1996). Pycnodysostosis is ah
autosomal recessive condition characterised by osteosclerosis and
severe skeletal dysplasia. Osteoporosis occurs when the balance
between bone resorption and formation has been disrupted, favouring
resorption. Resorption is mediated by osteoclasts which generate an
acidic environment at their site of attachment where the
proteolytic degradation of the matrix occurs. CatK has been
implicated in this process due to the identification of nonsense,
missense and stop codon mutations in pycnodysostosis patients (Gelb
et al, 1996). CatK knockout mice also exhibit a decreased matrix
degrading activity in their osteoclasts, however the murine
phenotype is less severe than in the human condition (Saftig et al,
1998).
[0016] CatK expression appears to be upregulated at sites of
inflammation and by retinoic acid in osteoclastic cells lines
(Saneshige et al, 1995). Its expression has been detected in giant
cell tumours of the bone, prostate and breast carcinomas (Brubaker
et al, 2003; Littlewood-Evans et al, 1997) as well as in the
synovial fibroblasts of patients with rheumatoid arthritis (Hummel
et al, 1998).
[0017] Cathepsin V was first identified from a human brain cDNA
library as a cysteine protease with exceptionally high homology to
CatL (78%) (Santamaria et al., 1998). Moreover, the gene encoding
CatV has been mapped to human chromosome 9q21-22, adjacent to CatL.
The high homology and close proximity between the CatL and V genes
suggests that the two proteases may have evolved from a common
ancestral precursor (Itoh et al., 1999; Bromine et al., 1999).
However, the widespread expression pattern observed with CatL has
not been mimicked by CatV, with expression restricted to the
thymus, testis and corneal epithelium (Adachi et al, 1998, Bromme
et al, 1999, Tolosa et al, 2003). The restricted tissue expression
of this protease is indicative of specialised function and it is
thought that CatV is essential in MHC class II antigen presentation
in specific cell types (Shi et al., 1999; Tolosa et al., 2003).
Sequence alignment with other human cathepsins has placed CatV in
the same phylogenetic branch of human C1 peptidases as CatL, S and
K (Buhling et al., 2000).
Pathological Association of Cathepsins
[0018] The alterations in protease expression patterns underlie
many human pathological processes. The deregulated expression and
activity of cathepsins, has been linked to a range of conditions
including neurodegenerative disorders, autoimmune diseases and
tumourigenesis.
[0019] Cat S upregulation has been linked to several
neurodegenerative disorders. It is believed to have a role in the
production of the .beta. peptide (A.beta.) from the amyloid
precursor protein (APP) (Munger et al, 1995) and its expression has
been shown to be upregulated in both Alzheimer's Disease and Down's
Syndrome (Lemere et al, 1995). Cat S may also have a role in
Multiple Sclerosis and Creutzfeldt-Jakob disease through the
ability of Cat S to degrade myelin basic protein, a potential
autoantigen implicated in the pathogenesis of MS (Beck et al, 2001)
and in CJD patients, Cat S expression has been shown to increase
more than four fold (Baker et al, 2002).
[0020] Aberrant Cat S expression has also been associated with
atherosclerosis. Cat S expression is negligible in normal arteries,
yet human atheroma display strong immunoreactivity (Sukhova et al,
1998). Further studies using knockout mice, deficient in both Cat S
and the LDL-receptor, were shown to develop significantly less
atherosclerosis (Sukhova et al, 2003). Further research has linked
Cat S expression with inflammatory muscle disease and rheumatoid
arthritis. Muscle biopsy specimens from patients with inflammatory
myopathy had a 10 fold increase in Cat S expression compared to
control muscle sections (Wiendl et al, 2003), and levels of Cat S
expression were significantly higher in synovial fluid from
patients with rheumatoid arthritis compared to those with
osteoarthritis (Hashimoto et al, 2001).
[0021] The role of Cat S has also been investigated in specific
malignancies. The expression of Cat S was shown to be significantly
greater in lung tumour and prostate carcinomas sections in
comparison to normal tissue (Kos et al, 2001, Fernandez et al,
2001) and suggested that Cat S may have a role in tumour invasion
and disease progression.
[0022] Recent work in this laboratory on Cat S demonstrated the
significance of its expression in human astrocytomas (Flannery et
al, 2003; Flannery et al, 2006). Immunohistochemical analysis
showed the expression of Cat S in a panel of astrocytoma biopsy
specimens from WHO grades I to IV, but appeared absent from normal
astrocytes, neurones, oligodendrocytes and endothelial cells. Cat S
expression appeared highest in grade IV tumours and levels of
extracellular activity were greatest in cultures derived from grade
TV tumours.
[0023] Cat S has been shown to be active in the degradation of ECM
macromolecules such as laminin, collagens, elastin and chondroitin
sulphate proteoglycans (Liuzzo et al, 1999) and invasion assays
using the U251MG grade IV glioblastoma cell line showed up to 61%
reduction in invasion in the presence of a Cat S inhibitor LHVS29
(Flannery et al, 2003). This would suggest that Cat S may have an
important role in the process of tumour invasion in astrocytomas
and therefore may be a target for anti-invasive therapy.
[0024] CatL has also been found to have important roles in a range
of different pathological conditions including tumourigenesis. The
generation of CatL knockout mice revealed a critical role in
epidermal homeostasis, regulation of the hair cycle, and MHC class
II-mediated antigen presentation in cortical epithelial cells of
the thymus (Reinheckel et al, 2001).
[0025] Cat K expression has previously been correlated with a range
of different pathologies including osteoporosis and specific
malignancies. The rare skeletal condition, pycnodysostosis is
caused by a deficiency in CatK. CatK normally functions to degrade
type-1 collagen and other bone proteins (Motyckova and Fisher,
2002) The osteoclasts from patients with Pycnodysostosis are
dysfunctional due to mutations within the cathepsin K gene (Gelb et
al, 1996).
[0026] CatK expression is associated with lung adenocarcinomas yet
absent from the non-invasive bronchioalveolar carcinomas, acting as
a potential marker of the invasive growth of lung carcinomas (Rapa
et al, 2006). In addition, CatK has also been identified as the
principal protease in giant cell tumour of the bone (Lindeman et
al, 2004) and an association with breast carcinomas
(Littlewood-Evans et al, 1997) has been shown. Therefore, the
development of CatK inhibitors has great potential, particularly in
pathological conditions where excess osteoclast activation and bone
resorption occurs such as osteoporosis, bone metastasis and
multiple myeloma.
[0027] Cat V was originally identified in colorectal and breast
carcinomas, as well as certain ovarian and renal cell carcinomas as
a cysteine protease with exceptionally high homology to CatL (78%)
(Santamaria et al., 1998). Moreover, the gene for CatV has been
mapped to human chromosome 9q21-22, adjacent to CatL. The high
homology and close proximity of their encoding genes suggests that
the two proteases may have evolved from a common ancestral
precursor (Itoh et al., 1999; Bromme et al., 1999). However,
although CatL has widespread tissue expression, CatV is normally
restricted to the thymus, testis and corneal epithelium (Adachi et
al. 1998; Bromme et al. 1999). The restricted tissue expression of
this protease is indicative of specialised function and it is
thought that CatV is essential in MHC class II antigen presentation
in specific cell types (Shi et al. 1999; Tolosa et al., 2003).
[0028] The increase in expression and activity of the cathepsin
L-like proteases has been observed in a range of diseases and
implicated in their pathogenesis. Therefore, the generation of
inhibitors specifically targeting these proteases have the
potential as therapeutic agents.
Inhibition of Cathepsin L-Like Proteases
[0029] When proteases are over-expressed, therapeutic strategies
have focused on the development of inhibitors to block the activity
of these enzymes. The generation of specific small molecule
inhibitors to the cathepsins have proved difficult in the past, due
to problems with selectivity and specificity. The dipeptide
.alpha.-keto-.beta.-aldehydes developed as potent reversible
inhibitors to Cat S by Walker et al, had the ability to inhibit Cat
B and L, albeit with less efficiency (Walker et al, 2000) and the
Cat S inhibitor 4-Morpholineurea-Leu-HomoPhe-vinylsulphone (LHVS)
has also been shown to inhibit other cathepsins when used at higher
concentrations (Palmer et al, 1995).
[0030] The development of small molecule inhibitors for the
CatL-like proteases, both reversible and irreversible, is well
documented. The clinical application of such compounds is
questionable due to poor specificity, inhibition of the proteases
in normal tissues, and possible reactivity to bystander proteins
(Turk et al, 2004). Therefore alternative strategies that could
target only secreted proteolytic activities are attractive.
Furthermore, inhibitors that have high selectivity for this
sub-family of proteases, yet broad specificity within this group
may prove more useful, due to the overlap in function that has been
shown from gene knockout studies (Saftig et al, 1998; Nakagawa et
al, 1998; Nakagawa et al, 1999).
[0031] Of all the characterised propeptides, CatSPP has the most
interesting inhibitory kinetic profile, as it is an equally
effective inhibitor of both CatL and CatK in addition to CatS.
Maubach and co-workers showed in competitive enzyme binding assays
that CatSPP is an equipotent inhibitor of CatS (K.sub.i of 0.27 nM)
and CatL (K.sub.i of 0.36 nM) (Maubach et al., 1997), whereas more
recent work suggests that CatSPP is actually a more potent
inhibitor of CatL (K.sub.i of 0.46 nM) than it is of CatS (K.sub.i
of 7.6 nM) and has almost identical efficacy against CatK (K.sub.i
of 7.0 nM) (Guay et al, 2000).
[0032] As described above, on normal, activation of cathepsin, the
natural propeptide undergoes a conformational change and is
released. After release, the propeptide is presumed to be
redundant.
SUMMARY OF THE INVENTION
[0033] The present inventors have surprisingly shown that the
exogenously applied cathepsin S propeptide (CatSPP) has a potent
specific inhibitory action on the activity of cathepsin L-like
proteases in invasive cancer models. This result was particularly
unexpected given that it is thought that, once the cysteine
cathepsin protease is activated in vivo, the remnant propeptide
fragment is redundant and can no longer have, any effect on the
protease. It was assumed that, under the same conditions in vivo,
exogenously added propeptide would similarly have no effect.
Moreover, given that the propeptide is basic in nature,
trypsin-like activities present in and on the cell would be
expected to break down any exogenous propeptides.
[0034] These, results indicate that, contrary to expectations,
cathepsin propeptides may be used to attenuate the progression of
invasive or metastatic cancer cells and thus may be used in a
therapeutic context.
[0035] Accordingly, in a first aspect of the present invention,
there is provided a method of inhibiting activity of a cathepsin
L-like protease in cells or tissue, said method comprising
administration of a cathepsin propeptide or a nucleic acid
encodings cathepsin propeptide to said cells or tissue.
[0036] In one embodiment, the method is in vitro. In another the
method is in vivo.
[0037] Activity may be inhibited completely or partially. Thus the
method may be used to reduce aberrant activity to normal
activity.
[0038] In a second aspect of the present invention, there is
provided a method of inhibiting overexpression of a cathepsin
L-like protease; in cells or tissue, said method comprising
administration of a cathepsin propeptide or a nucleic acid encoding
a cathepsin propeptide to said cells or tissue.
[0039] In a further aspect, there is provided a method of treating
a condition, associated with overexpression and/or aberrant
activity of a cathepsin L-like protease in a patient in need of
treatment, thereof, said method comprising administration of a
cathepsin propeptide or a nucleic acid encoding a cathepsin
propeptide.
[0040] Further provided is a cathepsin propeptide or a nucleic acid
encoding a cathepsin propeptide for use in medicine.
[0041] The invention further provides a cathepsin propeptide or a
nucleic acid encoding a cathepsin propeptide for use in treatment
of a condition associated with overexpression and/or aberrant
activity of a cathepsin L-like protease.
[0042] Also provided is the use of cathepsin propeptide or a
nucleic acid encoding a cathepsin propeptide in the preparation of
a medicament for the treatment of a condition associated with
overexpression and/or aberrant activity of a cathepsin L-like
protease.
[0043] In a further aspect, the invention provides a pharmaceutical
composition comprising a cathepsin propeptide or a nucleic acid
encoding a cathepsin propeptide.
[0044] Cathepsin L-like proteases consist of cathepsin L protease,
cathepsin S protease, cathepsin K protease and cathepsin V
proteases.
[0045] Cathepsin propeptides for use in the invention may be a
cathepsin propeptide of any species. In one embodiment, the species
is a mammalian species, for example, mouse, rat, human etc. In one
embodiment, the cathepsin propeptide is a human cathepsin
propeptide, for example the human cathepsin propeptide having amino
acid sequence corresponding to amino acid residues 17 to 113 of the
cathepsin S protease as disclosed in accession no M90696,
(reproduced as amino acid residues 13 to 109 of the amino acid
sequence shown in FIG. 3).
[0046] In the context of the present invention, cathepsin
propeptides include cathepsin propeptides comprising the amino acid
sequence of a wild type mammalian cathepsin propeptide or a
fragment or derivative thereof. In one embodiment, the cathepsin
propeptide consists of the peptide having the amino acid sequence
of a wild type mammalian cathepsin propeptide.
[0047] In one embodiment, the cathepsin propeptide or derivative or
fragment thereof for use in the invention is a cathepsin S
propeptide, for example, consisting of amino acids 17 to 113 of the
cathepsin S protease as disclosed in accession no M90696
(reproduced as amino acid residues 13 to 109 of the amino acid
sequence shown in FIG. 3b).
[0048] The cathepsin propeptide may incorporate a tag, for example
a polyHis tag. In one embodiment, the cathepsin propeptide is the
cathepsin propeptide having a poly His tag as shown as the amino
acid sequence 1-118 of FIG. 3b.
[0049] As described in the Examples, a particularly potent
inhibition of tumour invasion was demonstrated in a tumour invasion
assay when using a cathepsin propeptide fused to an antibody Fc
portion. Given that by providing the cathepsin propeptide as a
fusion peptide with the Fc portion, the shape of the molecule would
be expected to change, it was particularly surprising that, not
only did the cathepsin propeptide retain its ability to inhibit the
invasion but that its inhibitory activity was significantly greater
than that of the cathepsin propeptide without the Fc portion.
[0050] Accordingly, in one embodiment of the invention, the
cathepsin propeptide comprises an antibody Fc portion. In one such
embodiment, the Fc portion is an IgG Type b Fc portion, for example
a murine IgG Type b Fc portion.
[0051] Cathepsin propeptides for use in the invention may be used
in the treatment of any condition with which aberrant expression of
a cathepsin L-like-protease is associated. For example, conditions
in which the invention may be used include, but are not limited to,
neoplastic disease, inflammatory disorders, neurodegenerative
disorders, autoimmune disorders, asthma, or atherosclerosis. In one
embodiment of the invention, the condition is a condition
associated with overexpression and/or aberrant activity of
cathepsin S.
[0052] Preferred features of each aspect of the invention are as
for each of the other aspects mutatis mutandis unless the context
demands otherwise.
DETAILED DESCRIPTION
[0053] As described above and demonstrated in the examples, the
present inventors have shown that, contrary to expectations,
cathepsin propeptides act in tumour invasion assays to potently
inhibit the activity of cathepsins L-type proteases, in particular
the activity of CatS, CatL, CatV and CatK, and have shown that
cathepsin propeptides potently block tumour invasion in breast,
colon, prostate and astrocytoma tumour models using a modified
Boyden chamber invasion assay. These results demonstrate the effect
that this molecule can have on tumorigenesis to attenuate the
progression of invasive or metastatic cancer cells.
Cathepsin Propeptides
[0054] Cathepsin propeptides for use in the invention may be a
cathepsin propeptide of any species, for example a mammalian
species. In one embodiment, the cathepsin propeptide is a human
cathepsin propeptide, for example a cathepsin propeptide comprising
amino acids having the sequence corresponding to that of amino acid
residues 17 to 113 of M90696 (reproduced as amino acid residues 13
to 109 of the amino acid sequence shown in FIG. 3).
[0055] In the context of the present invention, cathepsin
propeptides include cathepsin propeptides comprising the amino acid
sequence of a wild type mammalian cathepsin propeptide or a
fragment or derivative thereof. In one embodiment, the cathepsin
propeptide consists of the peptide having the amino acid sequence
of a wild type mammalian cathepsin propeptide.
[0056] In one embodiment, the cathepsin propeptide or derivative or
fragment thereof for use in the invention is a cathepsin L-type
protease propeptide. For example, the cathepsin propeptide or
derivative or fragment thereof for use in the invention may be a
cathepsin S propeptide.
[0057] A fragment of a cathepsin propeptide for use in the
invention generally means a stretch of amino acid residues; of at
least 10 contiguous amino acids, typically at least 20, for example
at least at least 30, such as at least 50 or more consecutive amino
acids of a wild-type cathepsin propeptide.
[0058] A "derivative" of cathepsin propeptide for use in the
invention typically means a polypeptide which, compared with a
wild-type cathepsin propeptide, is modified by varying the amino
acid sequence, e.g. by manipulation of the nucleic acid encoding
the protein or by altering the protein itself. Such derivatives may
involve insertion, addition, deletion and/or substitution of one or
more amino acids. In one embodiment, derivatives may involve the
insertion, addition, deletion and/or substitution of 25 or fewer
amino acids, for example 15 or fewer, typically 10 or fewer, such
as 5 or fewer for example of 1 or 2 amino acids only. Derivatives
of the cathepsin propeptide peptide may contain other amino acids
than the natural amino acids or substituted amino acids. For
example, derivatives can be obtained from peptidomimetics.
[0059] In one embodiment of the invention, the cathepsin propeptide
comprises an Fc portion.
[0060] Fragments or derivatives of cathepsin propeptides which may
be used in the invention preferably retain cathepsin propeptide
functional activity, said activity being the ability to inhibit
tumour invasion, for example, in a tumour model, for example using
a modified Boyden chamber invasion assay. In one embodiment, the
cathepsin propeptide fragments or derivatives retain at least 50%,
for example at least 75%, at least: 85%, or at least 90% of the
tumour invasion inhibition activity of the wild-type human
cathepsin propeptide.
[0061] Cathepsin propeptides, fragments and derivatives for use in
the invention may be produced using any method known in the
art.
[0062] However, the present inventors have developed a novel
simplified method for the simplified recombinant production of
cathepsin propeptide. As shown in the Examples, the inventors have
demonstrated that recombinant cathepsin propeptides may be
successfully expressed with an N-terminal hexahistidine tag and
purified using refold metal ion affinity chromatography (IMAC).
[0063] Accordingly, in one aspect of the invention, the cathepsin
propeptide is produced by a method involving a purification step
involving metal ion affinity chromatography (IMAC).
[0064] Indeed, in a further independent aspect of the invention,
there is provided a method for the recombinant production of
cathepsin propeptides, said method comprising expressing a
cathepsin propeptide with an N-terminal polyhistidine tag and
purifying the expressed propeptide using metal ion affinity
chromatography (MAG). In one embodiment, the propeptide is purified
in the presence of urea containing buffer.
[0065] The principles of IMAC are generally appreciated by those of
skill in the art. It is believed that adsorption is predicated on
the formation of a metal coordination complex between a metal ion,
immobilized by chelation on the adsorbent matrix, and accessible
electron donor amino acids on the surface of the protein to be
bound.
[0066] Similarly, the addition of poly-histidine tags to
recombinant proteins is well known in the art (for example, see
U.S. Pat. No. 4,569,794.
Nucleic Acid
[0067] Nucleic acid of and for use in the present invention may
comprise DNA or RNA. It may be produced recombinantly,
synthetically, or by any means available; to those in the art,
including cloning using standard techniques.
[0068] The nucleic acid may be inserted into any appropriate
vector. In one embodiment the vector is an expression vector and
the nucleic acid is operably linked to a control sequence which is
capable of providing expression of the nucelic acid in a host cell.
A variety of vectors may be used. For example, suitable vectors may
include viruses (e.g. vaccinia virus, adenovirus, baculovirus etc);
yeast vectors, phage, chromosomes, artificial chromosomes,
plasmids, or cosmid DNA.
[0069] The vectors may be used to introduce the nucleic acids into
a host cell. A wide variety of host cells may be used for
expression of the nucleic acid for use in the invention. Suitable
host cells for use in the invention may be prokaryotic or
eukaryotic. They include bacteria, e.g. E. coli, yeast, insect
cells and mammalian cells. Mammalian cell lines which may be used
include Chinese hamster ovary cells, baby hamster kidney cells, NSO
mouse melanoma cells, monkey and human cell lines and derivatives
thereof and many others.
[0070] A host cell strain that modulates the expression of,
modifies, and/or specifically processes the gene product may be
used. Such processing may involve glycosylation, ubiquination,
disulfide bond formation and general post-translational
modification.
[0071] For further details relating to known techniques and
protocols for manipulation of nucleic acid, for example, in
preparation of nucleic acid constructs, mutagenesis, sequencing,
introduction of DNA into cells and gene expression, and analysis of
proteins, see, for example, Current Protocols in Molecular Biology,
2nd ed., Ausubel et al. eds., John Wiley & Sons, 1992 and,
Molecular Cloning: a Laboratory Manual: 3.sup.rd edition Sambrook
et al., Cold Spring Harbor Laboratory Press, 2000.
Treatment
[0072] "Treatment" includes any regime that can benefit a human Or
non-human animal. The treatment may be in respect of an existing
condition or may be prophylactic (preventative treatment).
Treatment may include curative, alleviation or prophylactic
effects.
[0073] The cathepsin propeptides, nucleic acids and methods of and
for use in the invention may be used in the treatment of a number
of medical conditions. These include inflammatory disorders
neurodegenerative disorders, autoimmune diseases, cancer, asthma
and atherosclerosis. In particular, they may be used in the
treatment of conditions associated with overexpression (i.e.
greater than in similar comparable normal healthy cells) and/or
aberrant activity (eg greater than in similar comparable normal
healthy cells) of cathepsin proteases.
[0074] The propeptides, nucleic acids and methods of and for use in
the invention may be used in the treatment of cancers. "Treatment
of cancer" includes treatment of conditions caused by cancerous
growth and includes the treatment of neoplastic growths or tumours.
The invention may be particularly useful in the treatment of
existing cancer and in the prevention of the recurrence of cancer
after initial treatment or surgery.
[0075] Examples of tumours that can be treated using the invention
include, for instance, sarcomas, including osteogenic and soft
tissue sarcomas, carcinomas, e.g., breast-, lung-, bladder-,
thyroid-, prostate-, colon-, rectum-, pancreas, stomach-, liver-,
uterine-, prostate, cervical and ovarian carcinoma, lymphomas,
including Hodgkin and non-Hodgkin lymphomas, neuroblastoma,
melanoma, myeloma, Wilms tumor, and leukemias, including acute
lymphoblastic leukaemia and acute myeloblastic leukaemia,
astrocytomas, gliomas and retinoblastomas.
[0076] In one embodiment, the cancer is selected from breast
cancer, colon cancer, prostate cancer and astrocytomas.
[0077] Inflammatory and/or autoimmune disorders which may be
treated using the invention include multiple sclerosis, Grave's
Disease, inflammatory muscle disease and rheumatoid arthritis.
[0078] Neurodegenerative disorders which may be treated using the
binding members, nucleic acids and methods of the invention
include, but are not limited to, Alzheimer's Disease, Parkinson's
Disease, Multiple Sclerosis and Creutzfeldt-Jakob disease.
[0079] Other conditions which may be treated using the methods of
the invention include atherosclerosis and tuberculosis. Evidence
has been shown linking atherosclerosis and obesity with aberrant
CatS. Cathepsin L has been shown to process TB antigens in
infections, thus perhaps preventing their proper processing.
Pharmaceutical Compositions
[0080] The propeptides and nucleic acids of and for use in the
invention may be administered as a pharmaceutical composition.
Pharmaceutical compositions according to the present invention, and
for use in accordance with the present invention may comprise, in
addition to active ingredients, a pharmaceutically acceptable
excipient, a carrier, buffer stabiliser or other materials well
known to those skilled in the art (see, for example, Remington: The
Science and Practice of Pharmacy, 21st edition, Gennaro A R, et al,
eds., Lippincott Williams & Wilkins, 2005). Such materials may
include buffers such as acetate, Tris, phosphate, citrate, and
other organic acids; antioxidants; preservatives; proteins, such as
serum albumin, gelatin, or immunoglobulins; hydrophilic polymers
such aspolyvinylpyrrolidone; amino acids such as glycine,
glutamine, asparagine, histidine, arginine, or lysine;
carbohydrates; chelating agents; tonicifiers; or surfactants.
[0081] The composition may also contain one or more further active
compounds selected as necessary for the particular indication being
treated, preferably with complementary activities that do not
adversely affect the activity of the propeptide, nucleic acid or
composition of the invention. For example, in the treatment of
cancer, in addition to an a cathepsin propeptide, the formulation
may comprise an antibody which binds one or more cathepsin L-type
proteases, or an antibody to some other target such as a, growth
factor that e.g. affects the growth of the particular cancer,
and/or a chemotherapeutic agent.
[0082] The active ingredients (e.g. propeptides and/or
chemotherapeutic agents) may be administered via microspheres,
microcapsules liposomes, other microparticulate delivery systems.
For example, active ingredients may be entrapped within
microcapsules which may be prepared, for example, by coacervation
techniques of by interfacial polymerization, for example,
hydroxymethylcellulose or gelatinmicrocapsules and
poly-(methylmethacylate) microcapsules, respectively, in colloidal
drug delivery systems (for example, liposomes, albumin
microspheres, microemulsions, nano-particles and nanocapsules) or
in macroemulsions. For further details, see Remington: The Science
and Practice of Pharmacy, 21st edition, Gennaro A R, et al, eds,.
Lippincott Williams & Wilkins, 2005.
[0083] Sustained-release preparations may be used for delivery of
active agents. Suitable examples of sustained-release preparations
include semi-permeable matrices of solid hydrophobic polymers
containing the antibody, which matrices are in the form of shaped
articles, e.g. films, suppositories or microcapsules. Examples of
sustained-release matrices include, polyesters, hydrogels (for
example, poly(2-hydroxyethyl-methacrylate), or poly(vinylalcohol)),
polylactides (U.S. Pat. No. 3,773,919), copolymers of L-glutamic
acid and y ethyl-L glutamate, non-degradable ethylene-vinyl
acetate, degradable lactic acid-glycolic acid copolymers, and
poly-D-(-)-3-hydroxybutyric acid.
[0084] The propeptides described herein are intended, at least in
some embodiments, to be administered to a human or other mammal for
medical treatment.
[0085] Peptides are typically administered parenterally, and may be
readily metabolized by plasma proteases. Oral administration, which
is perhaps the most attractive route of administration, may be even
more problematic. In the stomach, acid degrades and enzymes break
down peptides. Those peptides that survive to enter the intestinal
intact are subjected to additional proteolysis as they are
continuously barraged by a variety of enzymes, including gastric
and pancreatic enzymes, exo- and endopeptidases, and brush border
peptidases. As a result, passage of peptides from the lumen of the
intestine into the bloodstream can be severely limited. However,
various prodrugs have been developed that enable parenteral and
oral administration of therapeutic peptides.
[0086] Peptides can be conjugated to various moieties, such as
polymeric moieties, to modify the physiochemical properties of the
peptide drugs, for example, to increase resistance to acidic and
enzymatic degradation and to enhance penetration of such drugs
across mucosal membranes. For example, Abuchowski and Davis have
described various methods for derivatizating enzymes to provide
water-soluble, non-immunogenic, in vivo stabilized products
("Soluble polymers-Enzyme adducts," Enzymes as Drugs, Eds.
Holcenberg and Roberts, J. Wiley and Sons, New York, N.Y. (1981)).
Abuchowski and Davis discuss various ways of conjugating enzymes
with polymeric materials, such as dextrans, polyvinyl pyrrolidones,
glycopeptides, polyethylene glycol and polyamino acids. The
resulting conjugated polypeptides retain their biological
activities and solubility in water for parenteral applications.
U.S. Pat. No. 4,179,337 teaches coupling peptides to polyethylene
glycol or polypropropylene glycol having a molecular weight of 500
to 20,000 Daltons to provide a physiologically active
non-immunogenic water soluble polypeptide composition. The
polyethylene glycol or polypropylene glycol protects the
polypeptide from loss of activity and the composition can be
injected into the mammalian circulatory system with substantially
no immunogenic response.
[0087] U.S. Pat. No. 5,681,811, U.S. Pat. No. 5,438,040 and U.S.
Pat. No. 5,359,030 disclose stabilized, conjugated polypeptide
complexes including a therapeutic agent coupled to an oligomer that
includes lipophilic and hydrophilic moieties. Garmen, et al.
describe a protein-PEG prodrug (Garman, A J., and Kalindjian, S.
B., FEBS Lett., 1987, 223, 361-365). A prodrug can be prepared
using this chemistry, by first preparing a maleic anhydride reagent
from polydispersed MPEG5000 and then conjugating this reagent to
the peptides disclosed herein. The reaction of amino acids with
maleic anhydrides is well known. The hydrolysis of the maleyl-amide
bond to reform the amine-containing drug is aided by the presence
of the neighboring free carboxyl group and the geometry of attack
set up by the double bond. The peptides can be released (by
hydrolysis of the prodrugs) under physiological conditions.
[0088] Such strategies may be employed to deliver the propeptides
for use in the present invention.
[0089] The peptides can also be coupled to polymers, such as
polydispersed PEG, via a degradable linkage, for example, the
degradable linkage shown (with respect to pegylated interferon
.alpha.-2b) in Roberts, M. J., et al., Adv. Drug Delivery Rev.,
2002, 54, 459-476.
[0090] The peptides can also be linked to polymers such as PEG
using 1, 6 or 1,4 benzyl elimination (BE) strategies (see, for
example, Lee, S., et al., Bioconjugate Chem., (2001), 12, 163-169;
Greenwald, R. B., et al., U.S. Pat. No. 6,180,095, 2001; Greenwald,
R. B., et al., J. Med. Chem., 1999, 42, 3657-3667.); the use of
trimethyl lock lactonization (TML) (Greenwald, R. B, et al., J.
Med. Chem., 2000, 43, 475-487); the coupling of PEG carboxylic acid
to a hydroxy-terminated carboxylic acid linker (Roberts; M. J., J.
Pharm. Sci., 1998, 87(11), 1440-1445), and PEG prodrugs involving
families of MPEG phenyl ethers and MPEG benzamides linked to an
amine-containing drug via m aryl carbamate (Roberts, M. L, et al.,
Adv. Drug Delivery Rev., 2002, 54, 459-476), including a prodrug
structure involving a meta relationship between the carbamate and
the PEG amide or ether (U.S. Pat. No. 6,413,507); and prodrugs
involving a reduction mechanism as opposed to a hydrolysis
mechanism (Zalipsky, S., et al., Bioconjugate Chem., 1999, 10(5),
703-707).
[0091] Some approaches involve using enzyme inhibitors to slow the
rate of degradation of proteins and peptides in the
gastrointestinal tract and may be used for the propeptides
described herein; manipulating pH to inactivate local digestive
enzymes; using permeation enhancers to improve the absorption of
peptides by increasing their paracellular and transcellular
transports; using nanoparticles as particulate carriers to
facilitate intact absorption by the intestinal epithelium,
especially, Peyer's patches, and to increase resistance to enzyme
degradation; liquid emulsions to protect the drug from chemical and
enzymatic breakdown in the intestinal lumen; and micelle
formulations for poorly water-solubulized drugs.
[0092] In some cases, the peptides can be provided in a suitable
capsule or tablet with an enteric coating, so that, the peptide is
not released in the stomach. Alternatively, of additionally, the
peptide can be provided as a prodrug. In one embodiment, the
peptides are present in these drug delivery devices as
prodrugs.
[0093] Free amino, hydroxyl, or carboxylic acid groups of the
peptides can be used to convert the peptides into prodrugs.
Prodrugs include compounds wherein an amino acid residue, or a
polypeptide chain of two or more (e.g., two, three or four) amino
acid residues which are covalently joined through peptide bonds to
free amino, hydroxy or carboxylic acid groups of various polymers,
for example, polyalkylene glycols such as polyethylene glycol.
Prodrugs also include compounds wherein carbonates, carbamates,
amides and alkyl esters are covalently bonded to the above peptides
through the C-terminal carboxylic acids.
[0094] Prodrugs comprising the peptides (propeptides) of the
invention or pro-drugs from which peptides of the invention
(including analogues and fragments) are released of are releasable
are considered to be derivatives of the invention.
Peptidomimetics
[0095] The present invention further encompasses the use of mimetic
propeptides which can be used as therapeutic peptides. Mimetic pro
peptides are short, peptides which mimic the biological, activity
of the cathepsin propeptides described herein. Such mimetic,
peptides can be obtained from methods known in the art such as, but
not limited to, phage display of combinatorial chemistry. For
example, the method disclosed by Wrighton, et al., Science
273:458-463 (1996) can be used to generate mimetic QUB 698.8
peptides.
[0096] As described above nucleic acids encoding cathepsin
propeptides may also be used in methods of treatment. Such nucleic
acids; may be delivered to cells of interest using any suitable
technique known in the art. Nucleic acid (optionally contained in a
Vector) may be delivered to a patient's cells using in vivo or ex
vivo techniques. For in vivo techniques, transfection with viral
vectors (such as adenovirus, Herpes simplex I virus, or
adeno-associated virus) and lipid-based systems (useful lipids for
lipid-mediated transfer of the gene are DOTMA, DOPE and DC-Choi,
for example) may be used (see for example, Anderson et al., Science
256:808-813 (1992). See also WO 93/25673).
[0097] In ex vivo techniques, the nucleic acid is introduced into
isolated cells of the patient with the modified cells being
administered to the patient either directly or, for example,
encapsulated within porous membranes which are implanted into the
patient (see, e.g. U.S. Pat. Nos. 4,892,538 and 5,283,187).
Techniques available for introducing nucleic acids into viable
cells may include the use of retroviral vectors, liposomes,
electroporation, microinjection, cell fusion, DEAE-dextran, the
calcium phosphate precipitation method, etc.
[0098] The propeptide, nucleic acid, agent, product or composition
may be administered in a localised manner to a tumour site or other
desired site or may be delivered in a manner in which it targets
tumour or other cells. Targeting therapies may be used, to deliver
the active agents more specifically to certain types of cell, by
the use of targeting systems such as antibody or cell specific
ligands. Targeting may be desirable for a variety of reasons, for
example if the agent is unacceptably toxic, or if it would
otherwise require too high a dosage, or if it would not otherwise
be able to enter the target cells.
Dose
[0099] The propeptides, nucleic acids or compositions of the
invention are preferably administered to an individual in a
"therapeutically effective amount", this being sufficient to show
benefit to the individual. The actual dosage regimen will depend on
a number of factors including the condition being treated, its
severity, the patient being treated, the agent being used, and will
be at the discretion of the physician.
[0100] The optimal dose can be determined by physicians based on a
number of parameters including, for example, age, sex, weight,
severity of the condition being treated, the active ingredient
being administered and the route of administration.
[0101] The invention will now be described further in the following
non-limiting examples. Reference is made to the accompanying
drawings in which:
[0102] FIG. 1 illustrates the amplification of CatSPP. The cDNA
sequence of the CatSPP was amplified from a human spleen cDNA
library. A single band of approximately 330 bp was produced,
equivalent in size to that expected for the CatSPP cDNA
sequence.
[0103] FIG. 2a illustrates the results of Colony PCR from CatS PP
cloning into pQE-30
[0104] FIG. 2b illustrates the DNA and protein sequence for the
complete reading frame of the rCatSPP is shown as a result of its
insertion into pQE30.
[0105] FIG. 3 illustrates Purification of the rCatSPP protein: a)
an elution profile of the rCatSPP b) shows SDS-PAGE analysis of
fractions from the second broad peak, as indicated by the arrow c)
Immunoblot of purification fractions using ah anti-polyhistidine
tag antibody.
[0106] FIG. 4 illustrates the inducibility of rCatSPP expression by
IPTG as demonstrated by SDS-PAGE and western blotting, a) Analysis
of bacterial lysates by SDS-PAGE and coomassie blue staining b)
Blotting with an anti-polyhistidine tag antibody. Molecular weight
markers are indicated at the left of each image (kDa).
[0107] FIG. 5 illustrates progress curves for the hydrolysis of
Cbz-Val-Val-Arg-AMC in the presence of rCatSPP. A control
(His)6-tagged protein, produced from the same vector and purified
in the same manner, was used as a control (500 nM) (inset).
[0108] FIG. 6 shows a graph of non-linear regression analysis
(Morrison and Walsh, 1988) allowing for the determination of the
inhibition constant (Ki).
[0109] FIG. 7: Inhibition of cathepsins K, V, L and B by the
rCatSPP protein using fluorometric assays.
[0110] FIG. 8 illustrates inhibition of CatS elastinolytic
activity. The fluorogenic substrate Elastin-DQ was used to monitor
the elastinolytic turnover of CatS in the presence of CatSPP
(50-500 nM) over a 60 minute incubation
[0111] FIG. 9 shows relative expression of CatL-like proteases in
malignant cell lines.
[0112] FIG. 10a shows the results of in vitro invasion assays in
four human malignant cell lines by; i-iv: HCT116, U251 mg,
MDA-MB-231 and PC3.
[0113] FIG. 10b shows the results of in vitro invasion assays in
MCF-7 cells.
[0114] FIG. 11 shows the results of an MTT assay assessing
cytotoxic or proliferative effects of the rCatSPP protein.
[0115] FIG. 12 illustrates Colony PCR analysis of CatSPP cloning
into pRSET A-Fc.
[0116] FIG. 13 shows the expression of the rCatSPP-Fc from the
pRSET A vector was induced by the addition of IPTG as resolved by
SDS-PAGE and western blotting performed using an anti-polyhistidine
tag antibody.
[0117] FIG. 14: Purification of rCatSPP-Fc. [0118] a) shows the
purification profile shows two distinct peaks, a sharp peak at
after approximately 200 mins and a second broader peak between 225
and 250 mins. [0119] b) shows the analysis of eluted fractions from
the purification. [0120] c) shows analysis of purification
fractions by western blotting using an anti-polyhistidine tag
monoclonal antibody.
[0121] FIG. 15 illustrates CatS inhibition by the rCatSPP-Fc using
a fluorometric assay.
[0122] FIG. 16 illustrates Western blots demonstrating the
stability of CatS PP versus CatS PP-Fc.
[0123] FIG. 17 illustrates a histogram showing quantitative summary
of the PC3 invasion assay in the presence of is CatSPP Fc
[0124] FIG. 18 illustrates histograms showing quantitative summary
of the HCT116 invasion assay in the presence of CatSPP and
CatSPP-Fc recombinant proteins.
[0125] FIG. 19 shows dose-response curves used to determine EC50
values for rCatS PP and rCatS PP-Fc in MDA-MB-231 tumour cells.
EXAMPLES
Materials and Methods
Cloning and Expression of CatSPP
[0126] The human CatSPP, residues 17-113, was amplified from a
human spleen cDNA library (Origene) using primers CATSPPF (5' TTT
TTTGGATCCCAGTTGCATAAAGATCCTAC) and CATSPPR (5'
TTTTTTGTCGACCCGATTAGGGTTTGA) containing BamHI and Sail restriction
sites respectively (as underlined). The expected band of 330 bp was
visualised by agarose electrophoresis. This band was gel purified
and cloned using BamHI and SalI into pQE30 (Qiagen), which
incorporated ah N terminal hexahistdine tag for downstream
manipulations; Positive clones were identified by colony PCR and
sequence aligned to accession number M90696. A single verified
clone was used in subsequent experiments.
Cloning and Expression of CatSPP-Fc
[0127] For cloning of the CatSPP into the pRSET-Fc vector, the DNA
sequence was amplified using primers CATSPPFCF (5'
TTTTTTGGATCCCAGTTGCATAAA GAT) and CATSPPFCR (5'
TTTTTTGTCGACTATCCGATTAGGGTT), again with BamHI and SalI restriction
enzyme sites respectively (as underlined). The amplified band was
gel excised and cloned into the pRSET bacterial expression vector
which had previously been engineered to contain an IgG.sub.2 Fc
domain. Positive clones were identified by colony PCR and sequence
aligned to accession number M90696. A single verified clone was
used in all subsequent experiments.
Protein Expression and Purification of CatSPP and CatSPP-Fc
[0128] For expression analysis, the CatSPP positive clone was
transformed into TOP10F' cells and cultured in shaker flasks (500
ml) until reaching mid log phase (A.sub.550 0.5, 37.degree. C.).
Expression analysis of the CatSPP-Fc positive clone was performed
by transformation using the BL21 (DE3) pLysS strain of E. coli.
Expression of both recombinant proteins was induced by the addition
of isopropyl-.beta.-D-thiogalactoside (PTG, 1 mM) to the bacterial
cultures and propagated for a further 4 hours prior to harvesting.
Cell pellets were resuspended and lysed in 50 mM NaH.sub.2PO.sub.4
pH 8.0, containing 8M urea, 300 mM NaCl and 10 mM imidazole. The
crude denatured lysate was clarified by centrifugation (10,000 g,
60 minutes at 4.degree. C.), prior to application to a MAC column
charged with Ni.sup.2+ ions (HiTrap 1 ml column, GE Healthcare).
Non-specifically bound material was washed from the column using 50
mM NaH.sub.2PO.sub.4 pH 8.0, containing 8 M urea, 300 mM NaCl and
20 mM imidazole, prior to on-column refolding by reduction of the
urea from 8 to 0 M over 200 column volumes. Refolded column bound
material was washed with a further 20 column volumes of 50 mM
NaH.sub.2PO.sub.4 pH 8.0, 300 mM NaCl and 20 mM imidazole, prior to
elution with 50 mM NaH.sub.2PO.sub.4 pH 8.0, 300 mM NaCl and 250 mM
imidazole. Protein fractions were collected, desalted into PBS and
analysed by SDS-PAGE and western blotting to determine purity and
integrity. Stocks of purified recombinant protein were stored at
-20.degree. C. prior to use.
Inhibition of Cysteine Cathepsins with rCatSPP
[0129] Enzymatic assays were used to ascertain the ability of the
rCatSPP to inhibit the peptidolytic activity of human cathepsins S,
L, K, V and B (Calbiochem). Assays were performed in triplicate in
96-well microtitre plates in the presence of 100 mM sodium acetate,
1 mM ethylenediaminetetraacetate (EDTA), 0.1% Brij and 1 mM:
dithiothreitol (DTT) at pH 5.5. CatS activity was monitored using
the fluorigenic substrate
carbobenzloxy-L-valinyl-L-vahnyl-L-arginylamido-4-methyl coumarin
(Z-Val-Val-Arg-AMC, 25 .mu.M), assays for cathepsins L, K and V
were performed using
carbobenzloxy-L-phenylalanyl-L-arginylamido-4-methyl coumarin
(Z-Phe-Arg-AMC, 25 .mu.M) and assays for CatB were performed using
carbobenzloxy-L-arginylamido -L-arginylamido-4-methyl coumarin
(Z-Arg-Arg-AMG, 25 .mu.M) as substrates. Purified rCatSPP was added
to assays as required at various concentrations (0-1000 nM). All
experiments were performed using a Cytofluor.RTM. 4000
spectrofluorimeter with excitation at 395 nm and emission at 460
nm. To confirm that the rCatSPP-Fc also had the ability to inhibit
the activity of CatS, flurometric assays were performed using CatS,
Z-Val-Val-Arg-AMC, 25 .mu.M) in the presence of the rCatSPP-Fc (0
nM-200 nM).
RT-PCR Analysis of Cysteine Cathepsin Expression
[0130] The relative expression levels of the cysteine cathepsins S,
L, K and V in a panel of human malignant: cell lines was determined
by RT-PCR analysis. RNA was extracted from U251 mg, MDA-MB-231,
HCT116 and PC3 cell lines using the Absolutely RNA.TM. RT-PCR
Miniprep kit, and quantified using, a spectrophotometer. RT-PCR was
performed using the One-Step RT-PCR kit under the following
conditions: 50.degree. C. for 30 min, 95.degree. C. for 15 min, and
35 cycles of 94.degree. C. for 1 min, 55.degree. C. for 1 min and
72.degree. C. for 1 min 30 sec, followed by 72.degree. C. for 10
min or as detailed in the text. Amplification of a series of
cysteine cathepsins; was performed using the primers detailed in
the table below. Amplification of the .beta.-actin gene was used as
an internal control to demonstrate equal loading. RT-PCR products
were analysed by agarose gel electrophoresis and images were taken
under UV light using Kodak ID 3.4 USB software and a digital
camera.
Gene RT-PCR Primer Sequence
TABLE-US-00001 [0131] CatS (F) GGG TAC CTC ATG TGA CAA G CatS (R)
TCA CTT CTT CAC TGG TCA TG CatL (F) ATG AAT CCT ACA CTC ATC CTT GC
CatL (R) TCA CAC AGT GGG GTA GCT GGC TGC TG CatK (F) ATG TGG GGG
CTC AAG GTT CTG C CatK (R) TCA CAT CTT GGG GAA GCT GGC C CatV (F)
ATG AAT CTT TCG CTC GTC CTG GC CatV (R) TCA CAC ATT GGG GTA GCT GGC
Actin (F) ATC TGG CAC CAC ACC TTC TAC AAT GAG CTG CG Actin (R) CGT
CAT ACT CCT GCT TGC TGA TCC ACA TCT GC
In-Vitro Invasion Assays
[0132] In-vitro invasion assays were performed using a modified
Boyden chamber with 12-.mu.m pore membranes (Costar Transwell
plates, Corning Costar Corp., Cambridge, Mass., USA). The membranes
were coated with Matrigel (100 .mu.g/cm.sup.2) (Becton Dickinson,
Oxford, UK) and allowed to dry overnight in a laminar flow hood.
Cells were added to each well in 500 .mu.l of serum-free medium in
the presence of predetermined concentrations of the rCatSPP. All
assays were carried out in triplicate and invasion plates were
incubated at 37.degree. C. and 5% CO.sub.2 for 24 hours after which
cells remaining on the upper surface of the membrane were removed
and invaded cells fixed in Carnoy's fixative for 15 minutes. After
drying, the nuclei of the invaded cells were stained with Hoechst
33258 (50 ng/ml) in PBS for 30 minutes at room temperature. The
chamber insert was washed twice in PBS, mounted in Citifluor and
invaded cells were viewed with a Nikon Eclipse TE300 fluorescent
microscope. Ten digital images of representative fields from each
of the triplicate membranes were taken using a Nikon DXM1200
digital camera at magnification of .times.20. The results were
analysed using Lucia GF 4.60 by Laboratory Imaging and were
expressed as a percentage of invaded cells.
Cell Viability Assay
[0133] Cytotoxic or proliferative effects of the rCatSPP was
determined by MTT assay using the HCT116 colorectal carcinoma cell
line. Cells were added at a concentration of 1.times.10.sup.4 cells
per 200 .mu.l to a 96-well plate; 200 nM rCatSPP, a control protein
generated from the same vector under identical conditions and a
vehicle only control were added to the cells and incubated for 24,
48 and 72 hrs at 37.degree. C. and 5% CO2. After this the medium
was carefully removed and 200 .mu.l of 0.5 mg/ml
3-4,5-dimethylthiazol-2,5 diphenyl tetrazolium bromide (MTT) was
added and incubated at 37.degree. C. for 2 hr. The MTT reagent was
removed and the insoluble formazan crystals were dissolved in 100
.mu.l of DMSO. Absorbance was measured at 570 nm and the results
were expressed as a percentage of cell viability or proliferation
relative to each vehicle-only control. All tests were performed in
quintuplicate.
Results and Discussion
[0134] Previously the purification of the CatSPP has been achieved
by a number of different approaches. Maubach and co-workers
produced CatSPP from an Escherichia coli expression system,
isolating the peptide, corresponding to residues 16-114, from
inclusion bodies by refolding against a GdnHCl concentration
gradient (Maubach et al., 1997). Guay and colleagues also produced
the PP (residues 17-114) in E. coli, using the alternative approach
of producing it as a glutathione S-transferase (GST) G-terminal
fusion. The recombinant protein was again produced in inclusion
bodies, which were subsequently refolded against a GdnHCl
concentration gradient, prior to affinity purification on a
GST-Sepharose column and the PP removed from the GST fusion by a
thrombin cleavage step (Guay et al., 2000). This latter procedure
has also been used for the production of the CatKPP and CatLPP.
Both these previous methods produced bioactive protein, but are
laborious and time consuming, particularly with the isolation and
refolding of inclusion bodies. In an effort to determine a more
rapid simplified method for the production of CatSPP, the inventors
expressed the peptide (residues 17-113) with an N terminal
hexahistidine tag and purified the protein by refold MAC.
[0135] Using the gene specific primers CATSPPF and CATSPPR
detailed, the open reading frame encoding the propeptide region
(residues 17-113) were amplified from a commercially available cDNA
library by polymerase chain reaction (PCR). When analysed by
agarose electrophoresis, a band of the expected size was visualised
(FIG. 1). Following gel extraction, the band was cloned into a
commercially available vector (pQE30). The analysis of 16 clones by
colony PCR reveals a band of approximately 650 bp amplified from
colony 10 (FIG. 2a. This would suggest that only colony 10 may
contain the CatSPP cDNA sequence cloned successfully into the
pQE-30 bacterial expression vector.
[0136] DNA sequenced for full validation (sequences aligned to
Accession number M90696) (see FIG. 2b). A selected clone was used
for all further propagation and fermentation, from which the
rCatSPP species was isolated for further study.
[0137] rCatSPP expression from the validated clone was then
analysed, firstly for over-expression of the protein and
verification that it contained an N terminal histag and was the
expected molecular weight of 16 kDa and that the expression of the
protein was under the control of the T5 promoter, inducible with
IPTG:
[0138] The rCatSPP was expressed from the pQE-30 bacterial
expression vector and purified using on-column refolding MAC. As
shown in FIG. 3a) The elution profile of the rCatSPP contains
several peaks; a sharp initial peak after 185 mins, followed by a
broad peak between 190 and 195 mins. Fractions from the second
broad peak, as indicated by the arrow in FIG. 3b, were resolved by
SDS-PAGE and revealed the presence of a single highly purified
band, with a molecular weight of approximately 16 kDa,
corresponding to that predicted for the (His)6-tagged rCatSPP. FIG.
3c) shows immunoblotting of purification fractions using an
anti-polyhistidine tag antibody confirm the presence of a
his-tagged species at approximately 16 kDa.
[0139] The inducibility of rCatSPP expression by IPTG was
demonstrated by SDS-PAGE and western blotting (FIG. 4). The
analysis of bacterial lysates by SDS-PAGE and coomassie blue
staining shows the presence of the rCatSPP at approximately 16 kDa
in lane b which has been induced but not in uninduced lane a. (FIG.
4a) The transfer of the bacterial lysates to nitrocellulose
membrane and blotting with an anti-polyhistidine tag antibody
confirms expression of the protein in the induced lane b only.
(FIG. 4b) Molecular weight markers are indicated at the left of
each image (kDa).
[0140] After final desalting into PBS, the propeptide was then
tested for its biological activity. The biological activity of the
rCatSPP protein was ascertained by fluorometric assay using CatS
and the fluorigenic substrate Cbz-Val-Val-Arg-AMC in the presence
of predetermined concentrations of rCatSPP (0 nM to 500 nM).
Progress curves for the hydrolysis of Cbz-Val-Val-Arg-AMC in the
presence of rCatSPP were plotted and the dose-dependent inhibition
of CatS activity was observed (FIG. 5) A control (His)6-tagged
protein, produced from the same vector and purified in the same
manner, was used as a control (500 nM) to confirm the perturbation
of CatS activity was due to the rCatSPP (inset). Assays were all
performed in triplicate.
[0141] The progress curves are indicative of the action of a
slow-binding reversible inhibitor. The apparent first order rate
order curves produced were then subjected to non-linear regression
analysis (Morrison and Walsh, 1988) where the production of
fluorescence [P] over time can be represented by the following
equation:
[P]=v.sub.st-(v.sub.s-v.sub.o)(1-exp(-k.sub.obst))/k.sub.obs+d
(1)
Using GraFit.RTM. software, the values for the progression curves
shown in FIG. 7a were fitted by non-linear regression analysis into
equation (1), producing a graph of v.sub.s against [I], from which
K.sub.i (observed) was determined. This was then corrected to
account for competing substrate, as shown in equation (2).
{K.sub.i=K.sub.i(observed)/(1+[S]/K.sub.m)} (2)
Using this analysis, K; values were calculated for inhibition of
CatS with rCatSPP. (FIG. 6).
[0142] Further to this, as shown in FIG. 7, Fluorometric assays
were performed using cathepsins K, V, L and B (a-d, respectively)
in the presence of predetermined concentrations of the rCatSPP.
Fluorescence was monitored for 30 mins and the RFU plotted over
time to generate fluorometric progress curves. The apparent first
order, rate, constants produced by the inhibition of the cathepsins
by the rCatSPP were subjected to non-linear regression analysis
(inset) enabling the determination of inhibition constants (Ki) as
17.6 nM (.+-.1.3), 4.8 nM (.+-.0.6), and 0.62 nM (.+-.0.14),
respectively. All fluorometric assays were performed in replicates
of three.
[0143] With establishment of anti-peptidolytic activity confirmed,
the inventors then used the rCatSPP to demonstrate its ability to
block the elastinolytic activity of CatS. The fluorogenic substrate
Elastin-DQ was used to monitor the elastinolytic turnover of CatS
in the presence of CatSPP (5.0-500 nM) over a 60 minute incubation
and the inventors were able to demonstrate inhibition of this
activity (FIG. 8).
[0144] The expression of CatS, L, K and V in four human malignant
cell lines was evaluated by RT-PCR. Each of the cathepsins appears
to be expressed in the four cell lines and amplification of Actin
was used as an internal control (FIG. 9).
[0145] Based on the full peptidolytic inhibition profile calculated
for the rCatSPP, and evidence that elastinolytic activity of at
least CatS could be shown, the inventors proceeded to analyse the
effectiveness of the peptide to block the activity of these
proteases in invasive cancer models. For these experiments the
inventors employed studies examining the invasion of tumour cells
through matrigel coated modified Boyden chambers, (Flannery et al.,
2003). These experiments were carried out on cell lines
representative; of common types of cancer. Specifically these were
PC3 (prostate cell line), HCT 116 (colorectal), U251MG
(astrocytoma) MDA-MB-231 (breast) and MCF7 (breast), and results
are shown in FIG. 10. FIG. 10 a illustrates the analysis of four
human malignant cell lines by in vitro invasion assay; a-d: HCT116,
U251 mg, MDA-MB-231 and PC3. Each cell line showed significant
reduction in tumour cell invasion in the presence of the CatSPP.
(*=p: .ltoreq.0.01, **=p: .ltoreq.0.001, ***= p: .ltoreq.0.0001).
All variables were performed in triplicate with ten digital images
captured and analysed for tumour cell invasion. The standard errors
were plotted as .+-.error of the mean. Statistical significance was
calculated using the students t-test. FIG. 10 b shows a histogram
illustrating significant reduction (63%) in MCF7 tumour cell
invasion in the presence of the CatSPP
[0146] An MTT assay was performed to assess the cytotoxic or
proliferative effects of the rCatSPP protein. The MTT assay was
performed using HCT116 colorectal carcinoma cells, incubated with
200 nM of the rCatSPP, control protein and vehicle-only control.
The results (FIG. 11) illustrate that the recombinant protein has
no significant effect on cell growth. All variables were repeated
in quintuplet.
[0147] The inventors proceeded to investigate the effect of
providing ah Fc portion on the cathepsin propeptide on the
inhibition of L-type cathepsin protease in invasive cancer
models.
[0148] A cathepsin S propeptide comprising a C-terminal Fc portion
(CatSPP Fc) was cloned and expressed using the methods as described
for CatSPP above. The cDNA sequence of the CatSPP was cloned into
the pRSET A-Fc vector. A selection of 8 colonies from the
positively transformed plate was subjected to colony PCR analysis
using vector specific primers. All 8 colonies appear positive due
to the amplification, of a band of approximately 1100 bp (FIG.
12)
[0149] The expression of the rCatSPP-Fc from the pRSET A vector was
induced by the addition of IPTG. The results are shown In FIG. 13.
Samples in lanes A, B, C and D contain uninduced and induced
(B=0.2, C=0.5 and D=0.7 OD (A550 nm) respectively); Samples were
resolved by SDS-PAGE and western blotting performed using an
anti-polyhistidine tag antibody. The His-tagged protein species
with a molecular weight of approximately 46 kDa was detected,
equivalent to the predicted size of rCatSPP-Fc. The induction of
expression in the culture with an OD of 0.2 appeared most optimal
for protein production.
[0150] The rCatSPP-Fc was purified using MAC by virtue Of its
N-terminal His-tag. The results are shown in FIG. 14 a) The
purification profile shows two distinct peaks, a sharp peak at
after approximately 200 mins and a second broader peak between 225
and 250 mins. b) The analysis of eluted fractions from the
purification suggests that the first peak represents elution of
non-specifically bound proteins from the column (fractions 1-5),
whereas the broad secondary peak shows elution of a species of
approximately 46 kDa, in agreement with the expected size of the
rCatSPP-Fc (fractions 6-15). c) Analysis of purification fractions
by western blotting using an anti-polyhistidine tag monoclonal
antibody shows the presence of a his-tagged species of
approximately 46 kDa as expected for the rCatSPP-Fc.
[0151] The inhibition of CatS peptidolytic activity using CatSPP Fc
was measured. The rCatSPP-Fc was assessed by fluorometric assay
using the fluorogenic substrate Z-VVR-AMC to determine if the
species had the ability to retain its inhibition of CatS after the
addition of the Fc-domain without any negative effects on the
kinetics. The results are shown in FIG. 15: a) Progress curves
demonstrate the imhibition of CatS activity in the presence of
increasing concentrations of the rCatSPP-Fc (0 nM to 200 nM). a,
inset) The Fc-control protein (200 nM) had no discernable effects
on CatS activity, b) Rates were extrapolated from the progress
curves and the kinetic of the inhibition were calculated as 8.9 nM
(.+-.2.5). Assays were repeated three times.
[0152] The stability of CatS PP versus CatS PP-Fc was assessed as
follows. The rCatSPP and rCatSPP-Fc proteins were incubated with
HGT116 colorectal carcinoma cells to assess the stability of the
recombinant proteins by addition of the antibody IgG.sub.2
Fc-domain. Samples of supernatant were assessed by western blotting
(FIG. 16) to determine stability within the cell supernatant. The
rCatSPP can only be detected at 0 hr whereas stability of the
rCatSPP-Fc appears improved, due to its detection after 24 hrs; As
controls, cell supernatants containing no added protein (-) were
also assessed and membranes were stained with Ponceau Red to
confirm equal loading of supernatants. Experiments were performed
in triplicate.
[0153] The effect of the CatSPP Fc on cathepsin S in an in vitro
invasion assay using prostate PC3 cells was then tested. The
results are shown in FIG. 17, The histogram shows a quantitative
summary of the PC3; invasion assay in the presence of CatSPP Fc
(0-32 nM); Each assay was performed in triplicate and ten fields
were counted in each assay.
[0154] The effect of the CatSPP Fc on cathepsin S in an in vitro
invasion assay using other tumour cell lines was then tested (FIG.
18) The rCatSPP and rCatSPP-Fc proteins were applied to in vitro
invasion assays using the HCT116 colorectal cell line. Assays were
performed in the presence of increasing concentrations of the
rCatSPP (0 nM to 250 nM) or rCatSPP-Fc (0 nM to 50 nM) and also
appropriate control proteins at the maximal concentration. Standard
deviations are plotted as error bars. Assays were repeated in
triplicate with ten images captured from each. The standard
deviation in mean tumour cell invasion is plotted as .+-.error
bars.
[0155] Similar results were found in an invasion assay conducted
using MDA-MB-231 cells. FIG. 19 illustrates relative EC50 values
for rCatS PP and rCatS PP-Fc. The relative rate of MDA-MB-231
tumour cell invasion in the presence of varying concentrations of
the rCatSPP or rCatSPP-Fc were subjected to non-linear regression
analysis and sigmoidal dose-response curves constructed. The
resultant EC50 values were found to be 78.0 nM and 8.3 nM for the
(a) rCatSPP and (b) rCatSPP-Fc respectively.
[0156] As can be seen, CatSPP Fc acted as a potent inhibitor of the
cathepsin S in the invasion assays, with the maximum inhibition
being significantly greater and the inhibitory concentration being
significantly less than that produced with CatSPP with no Fc
portion. Although, it may have been expected that the stability of
the CatSPP molecule would be enhanced to a small extent by the Fc
portion, it is nevertheless very surprising that the inclusion of
the Fc portion so significantly enhanced the inhibitory effect.
Thus, the results demonstrate that the inclusion of an Fc portion
with a cathepsin propeptide enhances the inhibition of the activity
of cathepsin L-type protease in tumour invasion models.
[0157] Other studies have been performed using broad spectrum small
molecule inhibitors of cathepsins in tumorigenesis models,
demonstrating similar effects. Joyce and colleagues employed the
use of JPM-OEt, an cell permeable analogue of the broad spectrum
cysteine cathepsin inhibitor E64, in studies oh transgenic RIP-Tag2
mice (Joyce et al, 2004). These mice develop pancreatic islet
tumours at 12-14 weeks due to the presence of the oncogenic SV40 T
antigen. They demonstrated that the administration of this broad
spectrum inhibitor to these mice could significantly inhibit
multiple stages of tumour development, including the development of
highly invasive carcinomas upon histological analysis of the
animals. In an another investigation, Flannery and co-workers
examined the use of 4-morpholineurea-Leu-homoPhe-vinylsulfone
(LHVS), in blocking astrocytoma invasion. Using the same invasion
model as the inventors have employed here, it was demonstrated that
LHVS, which potently inhibits CatS and to a lesser extent Cat could
block U251MG cells invading at up to 60% at a 50 nM concentration
(Flannery et al, 2003). Collectively, these previous studies
clearly demonstrate firstly the role that CatL-like proteases play
in invasion processes in these cell lines, and secondly their
potential as therapeutic targets for cancer therapeutics.
[0158] Despite considerable research efforts, the extent to the
role of each of these proteases in tumorigenesis is yet to be fully
appreciated. Clearly a substantial amount of evidence points
towards their role in the breakdown of elastin, collagen and other
components of the extracellular matrix, once they have been
secreted by the tumorigenic cells. However, the role these enzymes
play in the activation and control of each other and other, less
closely related proteases, such as the metalloproteases is now
emerging (Kobayashi et, al., 1993). Moreover, new evidence has come
to highlight the role of CatS in the breakdown of matrix-derived
anti-angiogenic factors, and production of pro-angiogenic factors
during tumour progression (Wang et al, 2005). This demonstrates
that these proteases could have more roles than simply the
digestion of surrounding ECM to allow progression and migration of
tumour.
CONCLUSIONS
[0159] Here the inventors have described a novel expression and
purification method for the production of cathepsin propeptides,
for example CatSPP. The inventors have demonstrated that, by
inhibition of cathepsin L-type proteases using cathespin
propeptides, for example rCatSPP, tumorigenesis may be attenuated.
Given the inhibition profiles that the inventors have seen in in
vitro invasion assays using a range of different tumour cell lines,
it is clear that the broad inhibition of the CatL-like proteases
has clear therapeutic benefit to the clinical treatment of cancer.
The ability to develop agents that can block the spread of tumours,
particularly to secondary sites in the body would be attractive to
the co-administration of cytotoxic agent regimes. The ability to
rapidly produce the rCatSPP from bacterial cultures and apply it
successfully in these tumour invasion models suggest that it could
represent a novel approach to the design of therapeutic protease
inhibitors.
[0160] All documents referred to in this specification are herein
incorporated by reference. Various modifications and variations to
the described embodiments of the inventions will be apparent to
those skilled in the art without departing from the scope and
Spirit of the invention. Although the invention has been described
in connection with specific preferred embodiments, it should be
understood that the invention as claimed should not be unduly
limited to such specific embodiments. Indeed, various modifications
of the described modes of carrying out the invention which are
obvious to those skilled iii the art are intended to be covered by
the present invention.
REFERENCES
[0161] Abrahamson et al, (2003) Biochem Soc Symp. 70, 179-99.
[0162] Adachi et al, 1998 September; 39(10):1789-96. [0163] Bevec
et al, J Exp Med. 1996 Apr. 1; 183(4):1331-8. [0164] Broker et al,
(2005). Cell death independent of caspases: a review. Clin Cancer
Res. 11, 3155-62. [0165] Bromme et al Biochemistry. 1999 Feb. 23;
38(8):2377-85. [0166] Bromme D, Kaleta J. (2002) Curr Pharm Des
8:1639-58. [0167] Bromme et al Biochem J. 1996 Apr. 1; 315 (Pt
1):85-9. [0168] Bromme D, Okamoto K. Biol Chem Hoppe Seyler. 1995
June; 376(6):379-84. [0169] Brubaker et al. 2003 February;
18(2):222-30. [0170] Bryant P; Ploegh H. (2004). Curr Opin Immunol.
16, 96-102. [0171] Buhling F, et al Adv Exp Med. Biol. 2000;
477:241-54. [0172] Carmona et al (1996). Biochemistry. 35, 8149-57.
[0173] Chapman et al (1994 Am J Respir Crit Care Med. 150:S155-9.
[0174] Chapman H A et al (1997). Annu Rev Physiol, 59, 63-88.
[0175] Chauhan et al J Biol. Chem. 1993 Jan. 15; 268(2):1039-45.
[0176] de Duve C. (1983). Eur J Biochem 137:391-7. [0177] Drake et
al J Biol. Chem. 1996 May 24; 271(21): 12511-6. [0178] Fehrenbacher
N, Jaattela M. (2005). Cancer Res 65, 2993-2995. [0179] Flannery T,
et al (2003). Am J Pathol. 163, 175-82. [0180] Folkman J, Ingber D.
(1992). Semin Cancer Biol. 3, 89-96. [0181] Fox, T et al (1992)
Biochemistry 31, 12571-12576. [0182] Gal S, Gottesman M M. Biochem
J. 1988 Jul. 1; 253(1):303-6. [0183] Gelb et al Biochem Mol. Med.
1996 December; 59(2):200-6. [0184] Gelb Science, 273, 1236-8.
[0185] Goulet et al Mol. Cell. 2004 Apr. 23; 14(2):207-19. [0186]
Guay J, et al (2000). Eur J. Biochem. 267:6311-8. [0187] Hara K, et
al FEBS Lett. 1988 Apr. 11; 231(1):229-31. [0188] Honey K, Rudensky
A Y. (2003). Nat Rev Immunol, 3, :472-82. [0189] Hook V et al Biol.
Chem. 385, 473-80. [0190] Hummel K M, et al J Rheumatol. 1998
October; 25(10): 1887-94. [0191] Inaoka T, et al Biochem Biophys
Res Commun. 1995 Jan. 5; 206(1):89-96. [0192] Itoh R, et al. DNA
Res. 1999 Apr. 30; 6(2):137-40. [0193] Joseph et al J Clin Invest.
1988 May; 81(5):1621-9. [0194] Joyce J A, et al (2004). Cancer
Cell. 5, 443-53. [0195] Kafienah et al Biochem J. 1998 May 1; 331
(Pt 3):727-32. [0196] Kargel H J et al Acta Biol Med. Ger. 1981,
40(9):1139-43. [0197] Kirschke H, et al Biochem J. 1989 Dec. 1;
264(2):467-73. [0198] Kobayashi et al (1993 Biochim Biophys Acta.
1178, 55-62 [0199] Koblinski J E et al (2000). Clin Chim Acta. 291,
113-35. [0200] Lah T T, Kos J. (1998). Biol. Chem. 379:125-30.
[0201] Littlewood-Evans A J, et al Cancer Res. 1997 Dec. 1;
57(23):5386-90. [0202] Mach et al (1994). J Biol. Chem. 269,
13036-40 [0203] Maubach C, et al (1997). Eur J. Biochem. 250,
745-50. [0204] McGrath M E. (1999. Annu Rev Biophys Biomol Struct.
28, 181-204. [0205] Morrison J F, Walsh C T. (1988). Adv Enzymol
Relat Areas Mol. Biol. 61, 201-301. [0206] Motyckova G and Fisher D
E. (2002). Curr Mol. Med. 2002 August; 2(5):407-21. [0207] Nakagawa
T Y, et al. (1999); Immunity. 10, 207-17. [0208] Nakagawa T, et al
(1998 Science. 280:450-3. [0209] Nishimura Y, et al Arch Biochem
Biophys. 1988 Feb. 15; 261(1):64-71. [0210] Ogrinc et al FEBS Lett.
1993 Dec. 28; 336(3):555-9. [0211] Premzl A, et al. (2003) Exp Cell
Res. 283, 206-14. [0212] Rao J S. (2003), Nat Rev Cancer. 3,
489-501. [0213] Rapa I, Volante M, Cappia S, Rosas R, Scagliotti G
V and Papotti M. (2006). Cathepsin K is selectively expressed in
the stroma of lung adenocarcinoma but not in bronchioloalveolar
carcinoma. A useful marker of invasive growth. [0214] Rawlings, et
al (2004) Nucleic Acids Res. 32 Database issue, D160-D164 [0215]
Reinheckel T, et al (2001). Biol Chem, 382, 735-41 [0216]
Rescheleit D K, et al FEBS Lett. 1996 Oct. 7; 394(3):345-8. [0217]
Roth W, et al FASEB J. 2000 October; 14(13):2075-86. [0218] Saftig
P, et al Proc Natl Acad Sci USA. 1998 Nov. 10; 95(23): 13453-8.
[0219] Salminen A, Gottesman M M. Biochem J. 1990 Nov. 15;
272(1):39-44. [0220] Saneshige S et al Biochem J. 1995 Aug. 1; 309
(Pt 3):721-4. [0221] Santamaria I, et al Cancer Res. 1998 Apr. 15;
58(8):1624-30. [0222] Seth P, et al Gene; 2003 Dec. 4; 321:83-91.
[0223] Shi G P, et al FEBS Lett. 1995 Jan. 3; 357(2):129-34. [0224]
Sinha D, et al (1994). Biotechniques. 17, 509-12, 514. [0225]
Sloane et al (1981) Science. 212, 1151-3. [0226] Sloane et al
(1994). J Cell Sci. 107, 373-84. [0227] Tao K, et al (1994). Arch
Biochem Biophys. 311, 19-27. [0228] Tolosa E, et al J Clin Invest.
2003 August; 112(4):517-26. [0229] Turk V et al (2004). Cancer
Cell. 5, 409-10. [0230] Wang et al (2005). J Biol. Chem. 2005 Dec.
19; [Epub ahead of print] [0231] Wiederanders B. (2000). Adv Exp
Med Biol 477:261-70. [0232] Wiederanders B, Kirschke H. 1989 Aug.
1; 272(2):516-21, [0233] Zheng T (2005). J. Immunol. 174:8106-15.
Sequence CWU 1
1
21127DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 1ttttttggat cccagttgca taaagat 27227DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
2ttttttgtcg actatccgat tagggtt 27319DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
3gggtacctca tgtgacaag 19420DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 4tcacttcttc actggtcatg
20523DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 5atgaatccta cactcatcct tgc 23626DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
6tcacacagtg gggtagctgg ctgctg 26722DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
7atgtgggggc tcaaggttct gc 22822DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 8tcacatcttg gggaagctgg cc
22923DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 9atgaatcttt cgctcgtcct ggc 231021DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
10tcacacattg gggtagctgg c 211132DNAArtificial SequenceDescription
of Artificial Sequence Synthetic primer 11atctggcacc acaccttcta
caatgagctg cg 321232DNAArtificial SequenceDescription of Artificial
Sequence Synthetic primer 12cgtcatactc ctgcttgctg atccacatct gc
3213118PRTHomo sapiens 13Met Arg Gly Ser His His His His His His
Gly Ser Gln Leu His Lys1 5 10 15Asp Pro Thr Leu Asp His His Trp His
Leu Trp Lys Lys Thr Tyr Gly 20 25 30Lys Gln Tyr Lys Glu Lys Asn Glu
Glu Ala Val Arg Arg Leu Ile Trp 35 40 45Glu Lys Asn Leu Lys Phe Val
Met Leu His Asn Leu Glu His Ser Met 50 55 60Gly Met His Ser Tyr Asp
Leu Gly Met Asn His Leu Gly Asp Met Thr65 70 75 80Ser Glu Glu Val
Met Ser Leu Thr Ser Ser Leu Arg Val Pro Ser Gln 85 90 95Trp Gln Arg
Asn Ile Thr Tyr Lys Ser Asn Pro Asn Arg Val Asp Leu 100 105 110Gln
Pro Ser Leu Ile Ser 11514357DNAHomo sapiensCDS(1)..(354) 14atg aga
gga tcg cat cac cat cac cat cac gga tcc cag ttg cat aaa 48Met Arg
Gly Ser His His His His His His Gly Ser Gln Leu His Lys1 5 10 15gat
cct acc ctg gat cac cac tgg cat ctc tgg aag aaa acc tat ggc 96Asp
Pro Thr Leu Asp His His Trp His Leu Trp Lys Lys Thr Tyr Gly 20 25
30aaa caa tac aag gaa aag aat gaa gaa gca gta cga cgt ctc atc tgg
144Lys Gln Tyr Lys Glu Lys Asn Glu Glu Ala Val Arg Arg Leu Ile Trp
35 40 45gaa aag aat cta aag ttt gtg atg ctt cac aac ctg gag cat tca
atg 192Glu Lys Asn Leu Lys Phe Val Met Leu His Asn Leu Glu His Ser
Met 50 55 60gga atg cac tca tac gat ctg ggc atg aac cac ctg gga gac
atg acc 240Gly Met His Ser Tyr Asp Leu Gly Met Asn His Leu Gly Asp
Met Thr65 70 75 80agt gaa gaa gtg atg tct ttg acg agt tcc ctg aga
gtt ccc agc cag 288Ser Glu Glu Val Met Ser Leu Thr Ser Ser Leu Arg
Val Pro Ser Gln 85 90 95tgg cag aga aat atc aca tat aag tca aac cct
aat cgg gtc gac ctg 336Trp Gln Arg Asn Ile Thr Tyr Lys Ser Asn Pro
Asn Arg Val Asp Leu 100 105 110cag cca agc tta att agc tga 357Gln
Pro Ser Leu Ile Ser 11515357DNAHomo sapiens 15tcagctaatt aagcttggct
gcaggtcgac ccgattaggg tttgacttat atgtgatatt 60tctctgccac tggctgggaa
ctctcaggga actcgtcaaa gacatcactt cttcactggt 120catgtctccc
aggtggttca tgcccagatc gtatgagtgc attcccattg aatgctccag
180gttgtgaagc atcacaaact ttagattctt ttcccagatg agacgtcgta
ctgcttcttc 240attcttttcc ttgtattgtt tgccataggt tttcttccag
agatgccagt ggtgatccag 300ggtaggatct ttatgcaact gggatccgtg
atggtgatgg tgatgcgatc ctctcat 3571632DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
16ttttttggat cccagttgca taaagatcct ac 321727DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
17ttttttgtcg acccgattag ggtttga 27186PRTArtificial
SequenceDescription of Artificial Sequence Synthetic 6xHis tag
18His His His His His His1 5191763DNAHomo sapiens 19ggggtacctc
atgtgacaag ttccaatttc ttttcaagtc aattgaactg aaatctcctt 60gttgctttga
aatcttagaa gagagcccac taattcaagg actcttactg taggagcaac
120tgctggttct atcacaatga aacggctggt ttgtgtgctc ttggtgtgct
cctctgcagt 180ggcacagttg cataaagatc ctaccctgga tcaccactgg
catctctgga agaaaaccta 240tggcaaacaa tacaaggaaa agaatgaaga
agcagtacga cgtctcatct gggaaaagaa 300tctaaagttt gtgatgcttc
acaacctgga gcattcaatg ggaatgcact catacgatct 360gggcatgaac
cacctgggag acatgaccag tgaagaagtg atgtctttga tgagttccct
420gagagttccc agccagtggc agagaaatat cacatataag tcaaacccta
atcggatatt 480gcctgattct gtggactgga gagagaaagg gtgtgttact
gaagtgaaat atcaaggttc 540ttgtggtgct tgctgggctt tcagtgctgt
gggggccctg gaagcacagc tgaagctgaa 600aacaggaaag ctggtgtctc
tcagtgccca gaacctggtg gattgctcaa ctgaaaaata 660tggaaacaaa
ggctgcaatg gtggcttcat gacaacggct ttccagtaca tcattgataa
720caagggcatc gactcagacg cttcctatcc ctacaaagcc atggatctga
aatgtcaata 780tgactcaaaa tatcgtgctg ccacatgttc aaagtacact
gaacttcctt atggcagaga 840agatgtcctg aaagaagctg tggccaataa
aggcccagtg tctgttggtg tagatgcgcg 900tcatccttct ttcttcctct
acagaagtgg tgtctactat gaaccatcct gtactcagaa 960tgtgaatcat
ggtgtacttg tggttggcta tggtgatctt aatgggaaag aatactggct
1020tgtgaaaaac agctggggcc acaactttgg tgaagaagga tatattcgga
tggcaagaaa 1080taaaggaaat cattgtggga ttgctagctt tccctcttac
ccagaaatct agaggatctc 1140tcctttttat aacaaatcaa tgaaatatga
agcactttct cttaacttaa tttttcctgc 1200tgtatccaga agaaataatt
gtgtcatgat taatgtgtat ttactgtact aattagaaaa 1260tatagtttga
ggccgggcac gtggctcacg cgtaatcccg ttacttggga ggccaaggca
1320ggcattatca atcttgaggc caggagttaa agagcagcct ggctaacatg
gtgaaacccc 1380atctctacta aaaatacaaa aaattagccg agcacggtgg
tgcatgcctg taatcccagc 1440tacttgggag gctgaggcac gagattcctt
gaacccaaga ggttgaggct atgttgagct 1500gagatcacac cactgtactc
cagcctggat gacagagtgg agactctgtt tcaaaaaaac 1560agaaaagaaa
atatagtttg attcttcatt tttttaaatt tgcaaatctc aggataaagt
1620ttgctaagta aattagtaat gtactataga tataactgta caaaaattgt
tcaacctaaa 1680acaatctgta attgcttatt gttttattgt cccgaattca
gttggtttaa tatattgtcc 1740tctgtaattt cgatccttct taa
176320331PRTHomo sapiens 20Met Lys Arg Leu Val Cys Val Leu Leu Val
Cys Ser Ser Ala Val Ala1 5 10 15Gln Leu His Lys Asp Pro Thr Leu Asp
His His Trp His Leu Trp Lys 20 25 30Lys Thr Tyr Gly Lys Gln Tyr Lys
Glu Lys Asn Glu Glu Ala Val Arg 35 40 45Arg Leu Ile Trp Glu Lys Asn
Leu Lys Phe Val Met Leu His Asn Leu 50 55 60Glu His Ser Met Gly Met
His Ser Tyr Asp Leu Gly Met Asn His Leu65 70 75 80Gly Asp Met Thr
Ser Glu Glu Val Met Ser Leu Met Ser Ser Leu Arg 85 90 95Val Pro Ser
Gln Trp Gln Arg Asn Ile Thr Tyr Lys Ser Asn Pro Asn 100 105 110Arg
Ile Leu Pro Asp Ser Val Asp Trp Arg Glu Lys Gly Cys Val Thr 115 120
125Glu Val Lys Tyr Gln Gly Ser Cys Gly Ala Cys Trp Ala Phe Ser Ala
130 135 140Val Gly Ala Leu Glu Ala Gln Leu Lys Leu Lys Thr Gly Lys
Leu Val145 150 155 160Ser Leu Ser Ala Gln Asn Leu Val Asp Cys Ser
Thr Glu Lys Tyr Gly 165 170 175Asn Lys Gly Cys Asn Gly Gly Phe Met
Thr Thr Ala Phe Gln Tyr Ile 180 185 190Ile Asp Asn Lys Gly Ile Asp
Ser Asp Ala Ser Tyr Pro Tyr Lys Ala 195 200 205Met Asp Leu Lys Cys
Gln Tyr Asp Ser Lys Tyr Arg Ala Ala Thr Cys 210 215 220Ser Lys Tyr
Thr Glu Leu Pro Tyr Gly Arg Glu Asp Val Leu Lys Glu225 230 235
240Ala Val Ala Asn Lys Gly Pro Val Ser Val Gly Val Asp Ala Arg His
245 250 255Pro Ser Phe Phe Leu Tyr Arg Ser Gly Val Tyr Tyr Glu Pro
Ser Cys 260 265 270Thr Gln Asn Val Asn His Gly Val Leu Val Val Gly
Tyr Gly Asp Leu 275 280 285Asn Gly Lys Glu Tyr Trp Leu Val Lys Asn
Ser Trp Gly His Asn Phe 290 295 300Gly Glu Glu Gly Tyr Ile Arg Met
Ala Arg Asn Lys Gly Asn His Cys305 310 315 320Gly Ile Ala Ser Phe
Pro Ser Tyr Pro Glu Ile 325 33021118PRTHomo sapiens 21Met Arg Gly
Ser His His His His His His Gly Ser Gln Leu His Lys1 5 10 15Asp Pro
Thr Leu Asp His His Trp His Leu Trp Lys Lys Thr Tyr Gly 20 25 30Lys
Gln Tyr Lys Glu Lys Asn Glu Glu Ala Val Arg Arg Leu Ile Trp 35 40
45Glu Lys Asn Leu Lys Phe Val Met Leu His Asn Leu Glu His Ser Met
50 55 60Gly Met His Ser Tyr Asp Leu Gly Met Asn His Leu Gly Asp Met
Thr65 70 75 80Ser Glu Glu Val Met Ser Leu Met Ser Ser Leu Arg Val
Pro Ser Gln 85 90 95Trp Gln Arg Asn Ile Thr Tyr Lys Ser Asn Pro Asn
Arg Val Asp Leu 100 105 110Gln Pro Ser Leu Ile Ser 115
* * * * *