U.S. patent application number 12/533235 was filed with the patent office on 2010-04-22 for preparation of organisms with faster growth and/or higher yield.
This patent application is currently assigned to Metanomics GmbH. Invention is credited to Agnes Chardonnens, Marcus Ebneth, Gunnar Plesch, Piotr Puzio, Oliver Schmitz, Xi-Qing Wang.
Application Number | 20100100982 12/533235 |
Document ID | / |
Family ID | 32912564 |
Filed Date | 2010-04-22 |
United States Patent
Application |
20100100982 |
Kind Code |
A1 |
Plesch; Gunnar ; et
al. |
April 22, 2010 |
Preparation of Organisms with Faster Growth and/Or Higher Yield
Abstract
A method for preparing a nonhuman organism with faster growth
and/or increased yield in comparison with a reference organism,
which method comprises increasing the activity of L450 in said
organism or in one or parts thereof in comparison with a reference
organism.
Inventors: |
Plesch; Gunnar; (Potsdam,
DE) ; Chardonnens; Agnes; (NH Enkhuizen, NL) ;
Schmitz; Oliver; (Dallgow-Doberitz, DE) ; Puzio;
Piotr; (Gent-Mariakerke, BE) ; Ebneth; Marcus;
(Berlin, DE) ; Wang; Xi-Qing; (Chapel Hill,
NC) |
Correspondence
Address: |
Connolly Bove Lodge & Hutz LLP
1007 North Orange Street, P. O. Box 2207
Wilmington
DE
19899-2207
US
|
Assignee: |
Metanomics GmbH
Berlin
DE
|
Family ID: |
32912564 |
Appl. No.: |
12/533235 |
Filed: |
July 31, 2009 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10544661 |
Apr 20, 2006 |
7589256 |
|
|
PCT/US04/04422 |
Feb 13, 2004 |
|
|
|
12533235 |
|
|
|
|
Current U.S.
Class: |
800/278 |
Current CPC
Class: |
C12N 15/8261 20130101;
Y02A 40/146 20180101; C07K 14/415 20130101; C12N 15/8271
20130101 |
Class at
Publication: |
800/278 |
International
Class: |
A01H 1/00 20060101
A01H001/00 |
Foreign Application Data
Date |
Code |
Application Number |
Feb 17, 2003 |
DE |
10306734.5 |
Apr 9, 2003 |
DE |
10316464.2 |
Dec 18, 2003 |
DE |
10359613.5 |
Claims
1.-29. (canceled)
30. A method for preparing a transgenic plant with faster growth
and/or increased yield, which method comprises transfecting a plant
with a transgenic nucleic acid construct and growing the plant,
wherein in the transgenic plant or in one or more parts thereof:
(a) the expression of L450 polypeptide is increased; (b) the
stability of L450 RNA or L450 polypeptide is increased; or (c) the
specific activity of L450 polypeptide is increased in comparison
with a reference plant of the same species that lacks the
transgenic nucleic acid construct; further wherein the L450
polypeptide is selected from the group consisting of (i) an L450
polypeptide comprising the amino acid sequence of SEQ ID NO: 46
wherein 0 of the amino acid positions indicated by a capital letter
are replaced by an x, 20 or less of the amino acid positions
indicated by a lower case letter are replaced by an x, and 20 or
less amino acids are inserted into the consensus sequence and (ii)
an L450 polypeptide at least 80% identical to the L450 polypeptide
of (i); and further wherein the method results in faster growth
and/or increased yield as compared to the reference plant.
31. The method of claim 30 wherein the L450 polypeptide is selected
from the group consisting of: (i) an L450 polypeptide comprising
the amino acid sequence of SEQ ID NO: 46 wherein 0 of the amino
acid positions indicated by a capital letter are replaced by an x,
20 or less of the amino acid positions indicated by a lower case
letter are replaced by an x, and 20 or less amino acids are
inserted into the consensus sequence and (ii) an L450 polypeptide
at least 90% identical to the L450 polypeptide of (i).
32. The method of claim 30 wherein the L450 polypeptide comprises
the amino acid sequence of SEQ ID NO: 46 wherein 0 of the amino
acid positions indicated by a capital letter are replaced by an x,
20 or less of the amino acid positions indicated by a lower case
letter are replaced by an x, and 20 or less amino acids are
inserted into the consensus sequence.
33. The method of claim 30 wherein the L450 polypeptide comprises
(i) the amino acid sequence of SEQ ID NO:47 wherein 0 of the amino
acid positions indicated by a capital letter are replaced with an x
and 10 or less of the lower case letters are replaced by an x and
(ii) the amino acid sequence of SEQ ID NO: 48 wherein 0 of the
amino acid positions indicated by a capital letter are replaced
with an x and 10 or less of the amino acid positions indicated by a
lower case letter are replaced by an x.
34. The method of claim 30 wherein the expression of the L450
polypeptide is increased.
35. The method of claim 30 wherein the yield is increased.
36. A method for increasing plant growth and/or yield comprising
growing a transgenic plant that comprises a transgenic nucleic acid
construct that when incorporated into the plant genome or when
expressed in the plant increases the activity of L450 by (a)
increasing the expression of L450 polypeptide; (b) increasing the
stability of L450 RNA or L450 polypeptide; or (c) increasing the
specific activity of L450 polypeptide in the transgenic plant or in
one or more parts thereof in comparison with a reference plant of
the same species that lacks the transgenic nucleic acid construct,
wherein the L450 polypeptide is selected from the group consisting
of: (i) an L450 polypeptide comprising the amino acid sequence of
SEQ ID NO: 46 wherein 0 of the amino acid positions indicated by a
capital letter are replaced by an x, 20 or less of the amino acid
positions indicated by a lower case letter are replaced by an x,
and 20 or less amino acids are inserted into the consensus
sequence; and (ii) an L450 polypeptide at least 80% identical to
the L450 polypeptide of (i); and further wherein the method results
in increased plant growth and/or yield as compared to the reference
plant.
37. The method of claim 36 wherein the L450 polypeptide is selected
from the group consisting of: (i) an L450 polypeptide comprising
the amino acid sequence of SEQ ID NO: 46 wherein 0 of the amino
acid positions indicated by a capital letter are replaced by an x,
20 or less of the amino acid positions indicated by a lower case
letter are replaced by an x, and 20 or less amino acids are
inserted into the consensus sequence and (ii) an L450 polypeptide
at least 90% identical to the L450 polypeptide of (i).
38. The method of claim 36 wherein the L450 polypeptide comprises
the amino acid sequence of SEQ ID NO: 46 wherein 0 of the amino
acid positions indicated by a capital letter are replaced by an x,
20 or less of the amino acid positions indicated by a lower case
letter are replaced by an x, and 20 or less amino acids are
inserted into the consensus sequence.
39. The method of claim 36 wherein the L450 polypeptide comprises
(i) the amino acid sequence of SEQ ID NO:47 wherein 0 of the amino
acid positions indicated by a capital letter are replaced with an x
and 10 or less of the lower case letters are replaced by an x and
(ii) the amino acid sequence of SEQ ID NO: 48 wherein 0 of the
amino acid positions indicated by a capital letter are replaced
with an x and 10 or less of the amino acid positions indicated by a
lower case letter are replaced by an x.
40. The method of claim 36 wherein the expression of the L450
polypeptide is increased.
41. The method of claim 36 wherein the yield is increased.
42. A method for preparing a transgenic plant with faster growth
and/or increased yield, which method comprises transfecting a plant
with a transgenic nucleic acid construct and growing the plant,
wherein in the transgenic plant or in one or more parts thereof (a)
the expression of L450 polypeptide is increased; (b) the stability
of L450 RNA or L450 polypeptide is increased; or (c) the specific
activity of L450 polypeptide is increased in comparison with a
reference plant of the same species that lacks the transgenic
nucleic acid construct; further wherein the L450 polypeptide
comprises (i) the amino acid sequence of SEQ ID NO:47 wherein 0 of
the amino acid positions indicated by a capital letter are replaced
with an x and 10 or less of the lower case letters are replaced by
an x and (ii) the amino acid sequence of SEQ ID NO: 48 wherein 0 of
the amino acid positions indicated by a capital letter are replaced
with an x and 10 or less of the amino acid positions indicated by a
lower case letter are replaced by an x; and further wherein the
method results in faster growth and/or increased yield as compared
to the reference plant.
43. The method of claim 42 wherein the expression of the L450
polypeptide is increased.
44. The method of claim 42 wherein the yield is increased.
45. A method for increasing plant growth and/or yield comprising
growing a transgenic plant that comprises a transgenic nucleic acid
construct that when incorporated into the plant genome or when
expressed in the plant increases the activity of L450 by (a)
increasing the expression of L450 polypeptide; (b) increasing the
stability of L450 RNA or L450 polypeptide; or (c) increasing the
specific activity of L450 polypeptide in the transgenic plant or in
one or more parts thereof in comparison with a reference plant of
the same species that lacks the transgenic nucleic acid construct,
wherein the L450 polypeptide comprises (i) the amino acid sequence
of SEQ ID NO:47 wherein 0 of the amino acid positions indicated by
a capital letter are replaced with an x and 10 or less of the lower
case letters are replaced by an x and (ii) the amino acid sequence
of SEQ ID NO: 48 wherein 0 of the amino acid positions indicated by
a capital letter are replaced with an x and 10 or less of the amino
acid positions indicated by a lower case letter are replaced by an
x, and further wherein the method results in increased plant growth
and/or yield as compared to the reference plant.
46. The method of claim 45 wherein the expression of the L450
polypeptide is increased.
47. The method of claim 45 wherein the yield is increased.
Description
[0001] This application is a continuation application of U.S.
patent application Ser. No. 10/544,661 filed Apr. 20, 2006, which
is hereby incorporated by reference herein in its entirety, which
is the national stage application (under 35 U.S.C. 371) of
PCT/US2004/004422 filed Feb. 13, 2004 which claims benefit to
German application 103 06 734.5 filed Feb. 17, 2003, German
application 103 16 464.2 filed Apr. 9, 2003, and German application
103 59 613.5 filed Dec. 18, 2003.
[0002] The present invention relates to a method for preparing a
nonhuman organism with faster growth and/or higher yield in
comparison with a reference organism, which method comprises
increasing in said nonhuman organism or in one or more parts
thereof the activity of L450 in comparison with said reference
organism, for example on the basis of increasing the amount of L450
RNA and/or L450 polypeptide, advantageously on the basis of
increased expression of L450. In further embodiments, the invention
relates to a method for preparing plants, microorganisms or useful
animals which grow faster or give higher yields, which method
comprises an increased L450 activity in said organisms, and to a
plant, a microorganism and useful animal whose L450 activity is
increased and to the yield or biomass thereof. Furthermore, the
invention also relates to an L450 polypeptide, to a polynucleotide
coding therefor and to cells, plants, microorganisms and useful
animals transformed therewith and to methods for preparing fine
chemicals by using said embodiments of the present invention.
[0003] Ever since useful plants were first cultivated, increasing
the crop yield has, in addition to improving resistance to abiotic
and biotic stress, been the most important aim when growing new
plant varieties. Means as diverse as tilling, fertilizing,
irrigation, cultivation or crop protection agents, to name but a
few, are used for improving yields. Thus, cultivation successes in
increasing the crop, for example by increasing the seed setting,
and those in reducing the loss of crop, for example owing to bad
weather, i.e. weather which is too dry, too wet, too hot or too
cold, or due to infestation with pests such as, for example,
insects, fungi or bacteria, complement one another.
[0004] In view of the rapidly growing world population, a
substantial increase in yield, without extending the economically
arable areas, is absolutely necessary in order to provide
sufficient food and, at the same time, protect other existing
natural spaces.
[0005] The methods of classical genetics and cultivation for
developing new varieties with better yields are increasingly
supplemented by genetic methods. Thus, genes have been identified
which are responsible for particular properties such as resistance
to abiotic or biotic stress or growth rate control. Interesting
genes or gene products thereof may be appropriately regulated in
the desired useful plants, for example by mutation,
(over)expression or reduction/inhibition of such genes or their
products, in order to achieve the desired increased yield or higher
tolerance to stress.
[0006] The same applies to microorganisms and useful animals, the
breeding of which is primarily and especially concerned with
likewise achieving a particular biomass or a particular weight more
rapidly, in addition to higher resistance to biotic or abiotic
stress.
[0007] One example of a strategy resulting in better or more rapid
plant growth is to increase the photosynthetic capability of plants
(U.S. Pat. No. 6,239,332 and DE 19940270). This approach, however,
is promising only if the photosynthetic performance of said plants
is growth-limiting. Another approach is to modulate regulation of
plant growth by influencing cell cycle control (WO 0131041, CA
2263067, WO 56905, WO 37645). However, a change in the plant's
architecture may be the undesired side effect of a massive
intervention in the control of plant growth (WO 0131041; CA
2263067).
[0008] Despite a few very promising approaches, there is
nevertheless still a great need of providing methods for preparing
organisms with faster growth and higher yield, in particular plants
and microorganisms, and of providing such organisms, in particular
plants and microorganisms.
[0009] It is an object of the present invention to provide a method
of this kind for increasing the yield and growth of organisms, in
particular of plants.
[0010] We have found that this object is achieved by the inventive
method described herein and the embodiments characterized in the
claims.
[0011] Consequently, the invention relates to a method for
preparing a nonhuman organism with increased growth rate, i.e. with
faster growth and/or increased yield in comparison with a reference
organism, which method comprises increasing in said nonhuman
organism or in one or more parts thereof the activity of L450 in
comparison with a reference organism, for example on the basis of
increasing the amount of L450 RNA and/or L450 polypeptide.
[0012] Increased expression of L450 in Arabidopsis thaliana has
been found to lead to accelerated growth of the plants and to an
increased final weight and an increased amount of seeds. L450 has
been described as ORF MOB24.15 on BAC MOB24 (GenBank Accession No.:
AB020746) and in US2002/0023281. An L450 function is mentioned
neither in the annotation of the ORF nor in the description of
US2002/0023281. However, a Blastp comparison of the L450 sequence
of Arabidopsis thaliana under standard conditions revealed a
significant homology to the yeast protein YLR251w (Accession
PIR:S59397) and to the peroximal mouse protein MVP17 and to the
human homolog thereof. Interestingly a homolog in Drosophila
(Accession AE 003492-22) was also found.
[0013] A particular surprise was the finding that expression of the
L450 homolog of the evolutionarily distant yeast Saccharomyces
cerevisiae increases growth in Arabidopsis thaliana. It may also be
assumed that L450 is a functionally conserved gene and that an
increase in the activity of MVP17, YLR251c or of their specific
homologs also leads to faster growth or increased yield in an
organism in the same manner as has been observed according to the
invention for L450 and YLR251c in Arabidopsis. Presumably,
therefore, transgenic expression of other distant L450 homologs in
an organism also result in the observed faster growth and higher
yield.
[0014] In a preferred embodiment, the invention relates to a method
for preparing an organism, a cell, a tissue, e.g. an animal, a
microorganism or a plant with increased growth rate, i.e. with
faster growth and/or increased yield, which method comprises
increasing in said plant or in one or more parts thereof the
activity of L450, for example on the basis of increasing the amount
of L450 RNA and/or L450 polypeptide.
[0015] "Organism" here means any organism which is not a human
being. Consequently, the term relates to prokaryotic and eukaryotic
cells, microorganisms, higher and lower plants, including mosses
and algae, and to nonhuman animals, or to cells. Consequently,
organisms of human origin are also included, as long as said
organism is not a human being. In one embodiment, the organism is
unicellular or multicellular.
[0016] "Increased growth", "faster growth" or "increased growth
rate" here means that the increase in weight, for example fresh
weight, or in biomass per time unit is greater than that of a
reference, in particular of the starting organism from which the
nonhuman organism of the invention is prepared. Faster growth
preferably results in a higher final weight of said nonhuman
organism. Thus, for example, faster growth makes it possible to
reach a particular developmental stage earlier or to prolong growth
in a particular developmental stage. Preference is given to
attaining a higher final weight.
[0017] The terms "wild type", "control" or "reference" are
exchangeable and can be a cell or a part of organisms such as an
organelle or a tissue, or an organism, in particular a
microorganism or a plant, which was not modified or treated
according to the herein described method according to the
invention. Accordingly, the cell or a part of organisms such as an
organelle or a tissue, or an organism, in particular a
microorganism or a plant used as wild type, control or reference
corresponds to the cell, organism or part thereof as much as
possible and is in any other property but in the result of the
method of the invention as identical to the subject matter of the
invention as possible. Thus, the wild type, control or reference is
treated identically or as identical as possible, saying that only
conditions or properties might be different which do not
additionally influence the quality of the tested property.
[0018] Preferably, any comparison is carried out under analogous
conditions. The term "analogous conditions" means that all
conditions such as, for example, culture or growing conditions,
assay conditions (such as buffer composition, temperature,
substrates, pathogen strain, concentrations and the like) are kept
identical between the experiments to be compared.
[0019] The "reference", "control", or "wild type" is preferably a
subject, e.g. an organelle, a cell, a tissue, an organism, in
particular a plant or a microorganism, which was not modified or
treated according to the herein described method of the invention
and is in any other property as similar to the subject matter of
the invention as possible. The reference, control or wild type is
in its genome, transcriptome, proteome or metabolome as similar as
possible to the subject of the present invention. Preferably, the
term "reference-" "control-" or "wild type-"-organelle, -cell,
-tissue or -organism, in particular plant or microorganism, relates
to an organelle, cell, tissue or organism, in particular plant or
micororganism, which is nearly genetically identical to the
organelle, cell, tissue or organism, in particular microorganism or
plant, of the present invention or a part thereof preferably 95%,
more preferred are 98%, even more preferred are 99.00%, in
particular 99.10%, 99.30%, 99.50%, 99.70%, 99.90%, 99.99%, 99, 999%
or more. Most preferable the "reference", "control", or "wild type"
is preferably a subject, e.g. an organelle, a cell, a tissue, an
organism, which is genetically identical to the organism, cell
organelle used according to the method of the invention except that
nucleic acid molecules or the gene product encoded by them are
changed according to the inventive method.
[0020] Preferably, the reference, control or wild type differs form
the subject of the present invention only in the cellular activity
of the polypeptide of the invention, e.g. as result of an increase
in the level of the nucleic acid molecule of the present invention
or an increase of the specific activity of the polypeptide of the
invention, e.g. by or in the expression level or activity of an
protein having an said activity and its biochemical or genetical
causes.
[0021] In case, a control, reference or wild type differing from
the subject of the present invention only by not being subject of
the method of the invention can not be provided, a control,
reference or wild type can be an organism in which the cause for
the modulation of an activity conferring the increase of the yield
or growth or expression of the nucleic acid molecule of the
invention as described herein has been switched back or off, e.g.
by knocking out the expression of the responsible gene product,
e.g. by antisense inhibition, by inactivation of an activator or
agonist, by activation of an inhibitor or antagonist, by inhibition
through adding inhibitory antibodies, by adding active compounds as
e.g. hormones, by introducing negative dominant mutants, etc. A
gene production can for example be knocked out by introducing
inactivating point mutations, which lead to an enzymatic activity
inhibition or a destabilization or an inhibition of the ability to
bind to cofactors etc.
[0022] Accordingly, preferred reference subject is the starting
subject of the present method of the invention. Preferably, the
reference and the subject matter of the invention are compared
after standardization and normalization, e.g. to the amount of
total RNA, DNA, or Protein or activity or expression of reference
genes, like housekeeping genes, such as ubiquitin.
[0023] A series of mechanisms exists via which a modification in
the polypeptide of the invention can directly or indirectly affect
the yield. For example, the molecule number or the specific
activity of the polypeptide of the invention or the nucleic acid
molecule of the invention may be increased. Larger amounts of the
desired product can be produced if the polypeptide or the number of
expression of the nucleic acid of the invention is expressed de
novo if the organism lacked the enzymatic activity, which had been
introduced. However, it is also possible to increase the expression
of the gene which is naturally present in the organisms, for
example by modifying the regulation of the gene, or by increasing
the stability of the mRNA or of the gene product encoded by the
nucleic acid molecule of the invention.
[0024] Accordingly, preferred reference subject is the starting
subject of the present inventive method. Preferably, the reference
and the inventive subject are compared after normalization, e.g. to
the amount of total RNA, DNA, or protein or activity or expression
of reference genes, like housekeeping genes or shown in the
examples.
[0025] The inventive increase, decrease or modulation can be
constitutive, e.g. due to a stable expression, or transient, e.g.
due to an transient transformation or temporary addition of a
modulator as a agonist or antagonist or inducible, e.g. after
transformation with a inducible construct carrying the inventive
sequences and adding the inducer.
[0026] The term "increase" or "decrease" of an activity in a cell,
tissue, organism, e.g. plant or microorganism, means that the
overall activity in said compartment is increased or decreased,
e.g. as result of an increased or decreased expression of the gene
product, the addition or reduction of an agonist or antagonist, the
inhibition or activation of an enzyme, or a modulation of the
specific activity of the gene product, for example as result of a
mutation. A mutation in the catalytic centre of an inventive enzyme
can modulate the turn over rate of the enzyme, e.g. a knock out of
an essential amino acid can lead to a reduced or completely knock
out activity of the enzyme. The specific activity of an enzyme of
the present invention can be increased such that the turn over rate
is increased or the binding of a co-factor is improved. Improving
the stability of the encoding mRNA or the protein can also increase
the activity of a gene product. The stimulation of the activity is
also under the scope of the term "increased activity". The specific
activity of an inventive protein or a protein encoded by an
inventive polynucleotide or expression cassette can be tested as
described in the examples. In particular, the expression of said
protein in a cell, e.g. a plant cell or a microorganism and the
detection of an increase in fresh weight, dry weight, seed number
and/or seed weight in comparison to a control is an easy test.
Accordingly, the term "increase" or "decrease" means that the
specific activity as well as the amount of a compound, e.g. of the
inventive protein, mRNA or DNA, can be increased or decreased.
[0027] The term "increase" also means, that a compound or an
activity is introduced into a cell de novo or that the compound or
the activity has not been detectable. Accordingly, in the
following, the term "increasing" also comprises the term
"generating" or "stimulating" In general, an activity of a gene
product in an organism, in particular in a plant cell, a plant, or
a plant tissue or a part thereof can be increased by increasing the
amount of the specific encoding mRNA or the corresponding protein
in said organism or part thereof. "Amount of protein or mRNA" is
understood as meaning the molecule number of inventive polypeptide
or mRNA molecules in an organism, a tissue, a cell or a cell
compartment. "Increase" in the amount of the inventive protein
means the quantitative increase of the molecule number of said
protein in an organism, a tissue, a cell or a cell compartment or
part thereof--for example by one of the methods described herein
below--in comparison to a wild type, control or reference.
[0028] The increase in molecule number amounts preferably to at
least 1%, preferably to more than 10%, more preferably to 30% or
more, especially preferably to 50%, 100% or more, very especially
preferably to 500%, most preferably to 1000% or more. However, a de
novo expression is also regarded as subject of the present
invention.
[0029] A modification, i.e. an increase or decrease, can be caused
by endogenous or exogenous factors. For example, an increase in
activity in an organism or a part thereof can be caused by adding a
gene product or a precursor or an activator or an agonist to the
media or nutrition or can be caused by introducing said subjects
into an organism, transient or stable.
[0030] Accordingly, in one embodiment, the method of the present
invention comprises one or more of the following steps [0031] a)
stabilizing the inventive protein; [0032] b) stabilizing the
inventive protein encoding mRNA; [0033] c) increasing the specific
activity of the inventive protein; [0034] d) expressing or
increasing the expression of a homologous or artificial
transcription factor for inventive protein expression; [0035] e)
stimulating the inventive protein activity through exogenous
inducing factors; [0036] f) expressing a transgenic inventive
protein encoding gene; and/or [0037] g) increasing the copy number
of the inventive protein encoding gene.
[0038] In general, the amount of mRNA or polypeptide in a cell or a
compartment of an organism correlates with the activity of the
encoded protein or enzyme in said volume. Said correlation is not
always linear, the activity in the volume is dependent on the
stability of the molecules or the presence of activating or
inhibiting co-factors. Further, product and educt inhibitions of
enzymes are well known. However, in one embodiment, the activity of
the inventive polypeptide is increased via increasing the
expression of the encoding gene, in particular of a nucleic acid
molecule comprising the sequence of the inventive polynucleotide,
leading regularly to an increase in amount of inventive
polypeptide.
[0039] In one embodiment the increase fresh weight, dry weight,
seed weight and/or seed amount is by increasing the endogenous
level of the inventive protein. The endogenous level of the
inventive protein can for example be increased by modifying the
transcriptional or translational regulation of the polypeptide.
Regulatory sequences are operatively linked to the coding region of
an endogenous protein and control its transcription and translation
or the stability or decay of the encoding mRNA or the expressed
protein. In order to modify and control the expression, promoter,
UTRs, splicing sites, processing signals, polyadenylation sites,
terminators, enhancers, post transcriptional or posttranslational
modification sites can be changed or amended. For example, the
expression level of the endogenous protein can be modulated by
replacing the endogenous promoter with a stronger transgenic
promoter or by replacing the endogenous 3'UTR with a 3'UTR which
provides more stability without amending the coding region.
Further, the transcriptional regulation can be modulated by
introduction of a artificial transcription factor as described in
the examples. Alternative promoters, terminators and UTR are
described below.
[0040] In one advantageous embodiment, in the method of the present
invention the activity of a polypeptide is increased comprising or
consisting of the following consensus sequence:
TABLE-US-00001 (Seq ID No.: 46)
MxrlwrwYqxcLaxhPvktqvissGxlwglGDixaQavthxsa[x]
35RvxitssfGfgFvGpvghxWYexLDrfixxxxxxxxxsxxfvaxKva
xDglxfgPldllxFfxyvGxxxgrsxxxqvkexvKrdxxpalxlx
gxiWPavQiaNFrxvPvryqllyvnlfclldsxfLSwxxqq
whereby 20 or less, preferably 15 or 10, preferably 9, 8, 7, or 6,
more preferred 5 or 4, even more preferred 3, even more preferred
2, even more preferred 1, most preferred 0 of the amino acids
positions indicated by a capital or lower letter can be replaced by
an x.
[0041] In one embodiment not more than 5, preferably 4, even more
preferred 3 or 2, most preferred one or non amino acid position
indicated by a capital letter are/is replaced by an x.
[0042] In one embodiment 20 or less, preferably 15 or 10,
preferably 9, 8, 7, or 6, more preferred 5 or 4, even more
preferred 3, even more preferred 2, even more preferred 1, most
preferred 0 amino acids are inserted into the consensus
sequence.
[0043] In one embodiment, the consensus sequence consists of only
the capital letters of above shown sequence or shown in FIG. 7. In
one embodiment, the consensus sequence consists of only the capital
letters and lower letters of above shown sequence or shown in FIG.
7.
[0044] In one embodiment, the activity of a polypeptide is
increased comprising or consisting of one of said consensus
sequences, e.g. comprising or consisting of a consensus sequence
characterized by the capital letters of above consensus sequence.
In one embodiment, the activity of a polypeptide is increased
comprising or consisting of a consensus sequence characterized by
the capital and lower letters of above consensus sequence (or FIG.
7).
[0045] The consensus sequence was derived from a multiple alignment
of the sequences of Arabidopsis thaliana, Canola, potato, soybean,
barley, wheat, rice, corn, human, mice, Drosophila melanogaster and
Saccharomyces cerevisae as shown in FIG. 7. The capital letters
indicate that the amino acids are conserved in all or near all
aligned proteins, and the small letters indicate that the amino
acids are conserved in some of the aligned proteins, forming some
kind of a subgroup. Presently, the capital letters indicate that in
less than 10% of all aligned sequences the amino acids in this
position are not identical with the shown consensus residue. The
lower letters indicate that in 10% to 60% of all aligned sequences
the amino acids in this position are not identical with the shown
consensus residue. Anyhow, x indicates any given amino acid. Core
consensus sequences are underlined and represent the essential part
of the consensus sequence:
TABLE-US-00002 lwrwYqxcLaxhPvktqvissGxlwglGD (Seq ID No.: 47)
whereby 10 or less, preferably 7, preferred 4 or 3, more preferred
2, even more preferred 1, most preferred 0 of the amino acids
positions indicated by a capital or lower letter can be replaced by
an x. Preferably, not more than one amino acid position indicated
by a capital letter is replaced by an x. and
TABLE-US-00003 (Seq ID No.: 48)
KrdxxpalxlxgxiWPavQiaNFrxvPvryqllyvnlfclldsxfLS
whereby 10 or less, preferably 7, preferred 4 or 3, more preferred
2, even more preferred 1, most preferred 0 of the amino acids
positions indicated by a capital or lower letter can be replaced by
an x. Preferably, not more than one amino acid position indicated
by a capital letter is replaced by an x.
[0046] Accordingly, in one embodiment, in the method of the present
invention the activity of a polypeptide comprising one or both said
core consensus sequence is increased whereby 10 or less, preferably
7, preferred 4 or 3, more preferred 2, even more preferred 1, most
preferred 0 of the amino acids positions indicated by a capital or
lower letter can be replaced by an x. Preferably, not more than one
amino acid position indicated by a capital letter is replaced by an
x.
[0047] The multiple alignment was performed with the Software
GenoMax Version 3.4, InforMax.TM., Invitrogen.TM. life science
software, U.S. Main Office, 7305 Executive Way, Frederick, Md.
21704, USA with the following settings: Gap opening penalty: 10.0;
Gap extension penalty: 0.05; Gap separation penalty range: 8; %
identity for alignment delay: 40; Residue substitution matrix:
blosum; Hydrophilic residues: G P S N D Q E K R; Transition
weighting: 0.5; Consensus calculation options: Residue fraction for
consensus: 0.5.
[0048] In one advantageous embodiment, the method of the present
invention comprises the increasing of a polypeptide comprising or
consisting of the following plant consensus sequence:
TABLE-US-00004 (Seq ID No.: 49)
MlrLWRWYQxcLxxhPVkTQViSSGilWglGDigAQavTHytA[x]35 r r v a s
RVgiTSsFGfaFVGPVGHfWYEgLDrfirrklryqPksfrFVAsKVAaDGliFGPlDLlvFF y y
k l l tYmGlaxGksteQVKedvKRDflPAlvLeGGiWPavQiANFRfiPVrYQLLYVNlFCLlD
s v r i g ScFLSWieQQ
whereby 20 or less, preferably 15 or 10, preferably 9, 8, 7, or 6,
more preferred 5 or 4, even more preferred 3, even more preferred
2, even more preferred 1, most preferred 0 of the amino acids
positions indicated by a capital or lower letter can be replaced by
an x.
[0049] In one embodiment not more than 5, preferably 4, even more
preferred 3 or 2, most preferred one or non amino acid position
indicated by a capital letter are/is replaced by an x.
[0050] In one embodiment 20 or less, preferably 15 or 10,
preferably 9, 8, 7, or 6, more preferred 5 or 4, even more
preferred 3, even more preferred 2, even more preferred 1, most
preferred 0 amino acids are inserted into the consensus
sequence.
[0051] In one embodiment, the consensus sequence consists of only
the capital letters of above shown sequence or shown in FIG. 8.
[0052] In one embodiment, the consensus sequence consists of the
capital letters and lower letters of above shown sequence or shown
in FIG. 8.
[0053] In one embodiment, the activity of a polypeptide is
increased comprising or consisting of one of said consensus
sequences, e.g. comprising or consisting of a consensus sequence
characterized by the capital letters of above consensus sequence.
In one embodiment, the activity of a polypeptide is increased
comprising or consisting of a consensus sequence characterized by
the capital and lower letters of above consensus sequence.
[0054] The consensus sequence was derived from a multiple alignment
of the plant sequences, i.e. of Arabidopsis thaliana, Canola,
potato, soybean, barley, wheat, rice and corn as shown in FIG. 8.
The capital letters indicate that the amino acids are conserved in
all or near all aligned proteins, and the small letters indicate
that the amino acids are conserved in some of the aligned proteins,
forming some kind of a subgroup. The indication of a further amino
acid residue represents that at this position two amino acid
residues are prominent. Said amino acids are conserved in subgroup
of the sequences aligned. Anyhow, x indicates any given amino acid.
Core consensus sequences are underlined and represent the essential
part of the consensus sequence.
TABLE-US-00005 LWRWYQxcLxxhPVkTQViSSGilWglGD (Seq ID No.: 50) r v
a
whereby 10 or less, preferably 7, preferred 4 or 3, more preferred
2, even more preferred 1, most preferred 0 of the amino acids
positions indicated by a capital or lower letter can be replaced by
a x. Preferably, not more than one amino acid position indicated by
a capital letter is replaced by an x.
[0055] In one embodiment, the positions indicated with two
preferred amino residues are replaced with an x. Preferred is,
however, a consensus sequence, in which the indicated amino acids
are met. and
TABLE-US-00006 (Seq ID No.: 51)
KRDflPAlvLeGGiWPavQiANFRfiPVrYQLLYVNlFCLlDScFLSW i g
whereby 10 or less, preferably 7, preferred 4 or 3, more preferred
2, even more preferred 1, most preferred 0 of the amino acids
positions indicated by a capital or lower letter can be replaced by
a x. Preferably, not more than one amino acid position indicated by
a capital letter is replaced by an x.
[0056] Accordingly, in one embodiment, in the method of the present
invention the activity of a polypeptide comprising one or both said
core consensus sequence is increased, whereby 10 or less,
preferably 7, preferred 4 or 3, more preferred 2, even more
preferred 1, most preferred 0 of the amino acids positions
indicated by a capital or lower letter can be replaced by a x.
Preferably, not more than one amino acid position indicated by a
capital letter is replaced by an x.
[0057] In the following, under term "consensus sequence" the above
consensus sequences, core sequences, plant consensus sequence,
plant core consensus sequence in all described variations will be
understood.
[0058] The multiple alignment was performed with the Software
GenoMax Version 3.4, InforMax.TM., Invitrogen.TM. life science
software, U.S. Main Office, 7305 Executive Way, Frederick, Md.
21704, USA with the following settings: Gap opening penalty: 10.0;
Gap extension penalty: 0.05; Gap separation penalty range: 8; %
identity for alignment delay: 40; Residue substitution matrix:
blosum; Hydrophilic residues: G P S N D Q E K R; Transition
weighting: 0.5; Consensus calculation options: Residue fraction for
consensus: 0.5.
[0059] Reference organism preferably means the starting organism
(wild type) prior to carrying out the method of the invention or a
control organism.
[0060] If the organism is a plant and a line of origin cannot be
determined as reference, the variety which has been approved by the
European or German plant variety office at the time of application
and which has the highest genetic homology to the plant to be
studied may be accepted as reference for determining an increased
L450 activity. Consequently, a plant variety which has already been
approved at the time of application is then likewise a suitable
reference or source for a reference organelle, a reference cell, a
reference tissue or a reference organ. The genetic homology may be
determined via methods which are well known to the skilled worker,
for example via fingerprint analyses, for example as described in
Roldan-Ruiz, Theor. Appl. Genet., 2001, 1138-1150. A plant or a
variety which has increased L450 activity and increased yield or
faster growth, compared to the, if possible, genetically identical
plant, as described herein, may consequently be regarded as plant
of the invention. Where appropriate, the specific L450 activity may
be replaced by the amount of L450 mRNA or L450 protein, as
described herein. Similar methods for determining the genetic
relationship of animals and microorganisms are sufficiently known
to the skilled worker, in particular to sytematists.
[0061] Where appropriate, the organisms and, in particular, the
strains mentioned in the examples serve as reference organisms. In
particular, the plant strains mentioned there serve as reference
organisms for the particular plant species in the rare cases, a
reference described above can not be provided.
[0062] The line of origin, which has been used for carrying out the
method of the invention is a preferred reference.
[0063] Various strains or varieties of a species may have different
amounts or activities of L450. The amounts or activities of L450 in
a cell compartment, cell organelle, cell, tissue, in organs or in
the whole plant may be found to differ between different strains or
varieties. However, owing to the observation on which the invention
is based, it may be assumed that the increase, in particular in a
total extract of the organism, preferably of the plant, in
comparison with the respective starting strain or the respective
starting variety or with the abovementioned reference, results in
faster growth and/or higher yield. However, it is also conceivable
that even the increased activity, for example due to
overexpression, in specific organs may cause the desired effect,
i.e. faster growth and higher yield.
[0064] In the following, the term "increasing" comprises the
generating as well as the stimulating of a property.
[0065] In order to determine the "increase in amount", "increase in
expression", "increase in activity" or "increase in mass", this
property is compared to that of a reference or starting organism,
but normalized to a defined size. For example, expression between
the transgenic nonhuman organism and the reference (wild type) is
compared, normalizing, for example, to the amount of total RNA,
total DNA or protein or to the activity or amount of mRNA of a
particular gene (or gene product), for example of a housekeeping
gene. Increasing the mass or yield likewise involves comparison of
the modified and starting organisms, but with normalization to the
individual plant or to the yield per hectare, etc.
[0066] The L450 activity is preferably at least 5%, more preferably
10%, even more preferably 20%, 30%, 50% or 100%, higher than that
of the reference organism. Most preferably, the activity is 200%,
500% or 1 000% or more, higher than in the reference organism.
[0067] Owing to the higher L450 activity, in particular owing to a
from 5% to 1 000% increase in L450 activity, preferably owing to a
from 10% to 100% increase, growth is preferably 5%, preferably 10%,
20% or 30%, faster. More preferably, growth is faster by 50%, 100%,
200% or 500% or more, in comparison with a reference organism.
Preference is also given to increasing the L450 activity by 10%,
20%, 30% or from 50% to 100% and to a faster growth of 10%, 20%,
30% or 50%.
[0068] Owing to the higher L450 activity, in particular owing to a
from 5% to 1 000% increase in L450 activity, preferably owing to a
from 10% to 100% increase, yield is preferably 5%, preferably 10%,
20% or 30%, higher. More preferably, yield is higher by 50%, 100%,
200% or 500% or more, in comparison with a reference organism.
Preference is also given to increasing the L450 activity by 10%,
20%, 30% or from 50% to 100% and to a higher yield of 10%, 20%, 30%
or 50%.
[0069] "Accelerated growth", "faster growth" or "increased growth
rate" in plants means faster "plant growth", i.e. that the increase
in fresh weight in the vegetative phase is greater than that of a
reference plant, in particular of the starting plant from which the
plant of the invention has been prepared. Preferably, the final
weight of said plant is also higher than that of the reference
plant.
[0070] For microorganisms or cells, faster growth refers to higher
production of biomass.
[0071] "Final weight" means a weight typically reached at the end
of a particular phase or the produced biomass of an organism. For
plants, "increased final weight" preferably means the higher fresh
weight reached at the end of vegetative phase, in comparison with
the fresh weight of a reference organism. More specifically, the
higher final weight may be due to a higher yield, as discussed
below. For microorganisms or cells, "increased final weight" means
the amount of biomass produced by said microorganisms or cells in
the exponential phase.
[0072] The term "yield" means according to the invention that the
biomass or biomaterial suitable for further processing has
increased. The term "further processing" refers both to industrial
processing and to instant usage for feeding.
[0073] If the method refers to a plant, this includes plant cells
and tissue, organs and parts of plants in all of their physical
forms such as seeds, leaves, fibers, roots, stems, embryos, calli,
harvest material, wood, or plant tissue, reproductive tissue and
cell cultures which are derived from the actual plant and/or may be
used for producing a plant of the invention.
[0074] Preference is given to any parts or organs of plants, such
as leaf, stalk, shoot, flower, root, tubers, fruits, bark, seed,
wood, etc. or the whole plant. Seeds comprise any seed parts such
as seed covers, epidermal and seed cells or embryonic tissue.
Particular preference is given to the agricultural or harvested
products, in particular fruits, seeds, tubers, fruits, roots, bark
or leaves or parts thereof.
[0075] Thus, Arabidopsis plants having increased L450 expression
not only reach a defined weight significantly earlier than the
reference plants but also attained a higher maximum fresh weight,
dry weight, seed weight and/or higher yield.
[0076] Thus, for example, the fresh weight of Arabidopsis thaliana
having increased L450 expression increased by from 17% to 31%, and
the number of leaves was increased by from 11 to 26%, compared to
the wild type. A difference in the average fresh weight of 346 mg
in the plant line of the invention, compared to 245 mg in the
wild-type plant grown under identical conditions, was found as
early as during the production experiment P1. Further comparisons
are illustrated in the examples.
[0077] Furthermore, a significantly higher seed yield is found in
Arabidopsis plants with increased L450 activity. Thus, Arabidopsis
plants with increased L450 activity yielded on average 97 mg of
seeds under greenhouse conditions, while an average of only 78 mg
of seeds was obtained from unmodified control plants. Thus a 24%
increase in yield is achieved.
[0078] If the method relates to a useful animal, "yield" means the
amount of biomass or biomaterial of a useful animal, which is
suitable for further processing, in particular meat, fat, bones,
organs, skin, fur, eggs or milk.
[0079] If the method of the invention relates to a microorganism,
the term "yield" means both the biomass produced by said
microorganism, for example the fermentation broth, and the cells
themselves. If said microorganism produces a particular product
suitable for further processing or for direct application, for
example the fine chemicals described below, the method of the
invention preferably increases production of said product per
microorganism or per unit time.
[0080] "Increasing the amount", "increasing expression",
"increasing the activity" or "increasing the mass" means in each
case increasing the particular property compared to the wild type
or to a reference, taking into account the same growth conditions.
The wild type or reference may be a cell compartment, a cell
organelle, a cell, a tissue, an organ or a nonhuman organism,
preferably a plant, which has not been subjected to the method of
the invention but which is otherwise incubated under as identical
conditions as possible and which is then compared to a product
prepared according to the invention, with respect to the features
mentioned herein.
[0081] An "increase" may also refer to a cell compartment, a cell
organelle, a cell, a tissue, an organ or a nonhuman organism,
preferably a plant, as reference which has been modified, altered
and/or manipulated in such a way that it is possible to measure in
it an increased absolute L450 activity (product of the amount of
L450 and the relative activity thereof) or amount of L450 (amount
per compartment, organelle, cell, tissue, organ and/or nonhuman
organism).
[0082] The increase may also be effected by endogenous or exogenous
factors, for example by adding L450 or a precursor or an activator
thereof to nutrients or animal feed. The increase may also be
carried out by increasing endogenous or transgenic expression of a
gene coding for L450 or for a precursor or activator or by
increasing the stability of the abovementioned factors. The
phenotypic action of a factor, in particular its L450 activity, may
be determined, for example in Arabidopsis, by constitutive
expression, as described in the examples. L450 activity here means
an activity as described below.
[0083] Preference is given to increasing the L450 activity in a
cell, and more preference is given to the activity having increased
in one or more tissues or one or more organs. Normally, the
increase in a nonhuman organism entails an increase in one or more
tissues or one or more organs, and this in turn often entails the
increase in a cell, unless a protein is secreted. A higher L450
activity in a cell may be caused, for example, by a higher activity
in one of the cellular compartments as listed below.
[0084] "Increasing the amount", "increasing expression",
"increasing the activity" or "increasing the mass" means in each
case increasing in a constitutive or inducible, stable or transient
manner. For example, the increase may also be increased in a cell
or a tissue only at a particular time, in comparison with the
reference, for example only in a particular developmental stage or
only in a particular phase of the cell cycle.
[0085] The term "increase" also refers to an increase due to
different amounts, which may be caused by the response to different
inducing reagents such as, for example, hormones or biotic or
abiotic signals. However, the activity may also be increased by
L450 interacting with exogenous or endogenous modulators which act
either in an inhibiting or activating manner.
[0086] "L450 activity" of a polypeptide here preferably means that
increased expression or activity of said polypeptide results in
higher fresh weight, dry weight, seed weight and/or yield, and this
particularly preferably results in a plurality of said features,
even more preferably in all of said features. Most preferably,
"L450 activity" of a polypeptide here means that said polypeptide
comprises the polypeptide consensus or consensus core sequence
defined above, e.g. preferably shown in anyone of SEQ ID No.: 46,
47, 48, 49, 50 and/or 51, whereby 20 or less, preferably 15 or 10,
preferably 9, 8, 7, or 6, more preferred 5 or 4, even more
preferred 3, even more preferred 2, even more preferred 1, most
preferred 0 of the amino acids positions indicated by a capital or
lower letter in FIG. 7 or 8 can be replaced by an x and/or not more
than 5, preferably 4, even more preferred 3 or 2, most preferred
one or non amino acid position indicated by a capital letter in
FIG. 7 or 8 are/is replaced by an x and/or 20 or less, preferably
15 or 10, preferably 9, 8, 7, or 6, more preferred 5 or 4, even
more preferred 3, even more preferred 2, even more preferred 1,
most preferred 0 amino acids are inserted into the consensus
sequence or is encoded by a nucleic acid molecule comprising a
nucleic acid molecule selected from the group consisting of: [0087]
(a) nucleic acid molecule encoding an L450 polypeptide or encoding,
preferably at least the mature form of the, polypeptide which is
depicted in Seq. ID No.: 2, 4, 6, 8, 10, 12, 14, 16, 25 27, 35, 37,
39, 41, 43, 45, 46, 47, 48, 49, 50, 51 or 5341, 43, 45, 46, 47, 48,
49, 50, 51 or 53; [0088] (b) nucleic acid molecule comprising,
preferably at least the mature, polynucleotide of the coding
sequence according to Seq. ID No: 1, 3, 5, 7, 9, 11, 13, 15, 24 26,
34, 36, 38, 40, 42, 44 or 52; [0089] (c) nucleic acid molecule
whose sequence is derivable from a polypeptide sequence encoded by
a nucleic acid molecule according to (a) or (b), due to the
degeneracy of the genetic code; [0090] (d) nucleic acid molecule
encoding an L450 polypeptide whose sequence is at least 20%,
preferably 35%, more preferably 45%, even more preferably 60%, even
more preferably 70%, 80%, 90%, 95%, 97%, 98% and 99%, identical to
the amino acid sequence of the polypeptide encoded by the nucleic
acid molecule according to (a) to (c); [0091] (e) nucleic acid
molecule encoding an L450 polypeptide that is derived from an L450
polypeptide encoded by a nucleic acid molecule according to (a) to
(d) by substitution, deletion and/or addition of one or more amino
acids of the amino acid sequence of the polypeptide encoded by the
nucleic acid molecules (a) to (d); [0092] (f) nucleic acid molecule
encoding a fragment or an epitope of the L450 polypeptide encoded
by any of the nucleic acid molecules according to (a) to (e);
[0093] (g) nucleic acid molecule comprising a polynucleotide which
comprises the sequence of a nucleic acid molecule obtained by
amplification of a preferably microbial or plant cDNA bank using
the primers in Seq. ID No.: 19 and 20 and/or 28 and 30 or a
combination thereof or of a preferably microbial or plant genomic
bank using the primers in Seq. ID No.: 21 and 22; [0094] (h)
nucleic acid molecule encoding an L450 polypeptide which has been
isolated with the aid of monoclonal antibodies against a
polypeptide encoded by any of the nucleic acid molecules according
to (a) to (g); and [0095] (i) nucleic acid molecule which is
obtainable by screening an appropriate library under stringent
conditions using a probe comprising any of the sequences according
to (a) to (h) or a fragment of at least 15 nt, preferably 20 nt, 30
nt, 50 nt, 100 nt, 200 nt or 500 nt, of the nucleic acid shown in
(a) to (h) and which encodes an L450 polypeptide; [0096] (j)
nucleic acid molecule encoding a L450 polypeptide comprising the
sequence shown in Seq. ID No: 46 or 49, whereby 20 or less,
preferably 15 or 10, of the amino acid positions indicated can be
replaced by an X and/or whereby 20 or less, preferably 15 or 10, of
the amino acid are inserted into the shown sequence or shown in Seq
ID No.: 47, 48, 50 or 51, whereby 10 or less, preferably 7, of the
amino acid positions indicated can be replaced by an X and/or
whereby 10 or less, preferably 7, of the amino acid are inserted
into the shown sequence; and that its increased activity in a
nonhuman organism, in comparison with a reference organism,
preferably in a plant, results in faster growth and/or increased
yield in comparison with a reference organism, as described above.
The polynucleotide is preferably of plant origin or originates from
a prokaryotic or eukaryotic microorganism, for example
Saccheromyces sp. The plant or the microorganism preferably grows
faster or stronger and/or has a higher yield, as defined below.
[0097] Increased expression of L450 preferably also changes the
oxidative state in the nonhuman organism, in particular in the cell
having higher L450 activity or in a microorganism of this kind. For
example, L450 activity may increase the amount of reactive oxygen
species in the cells and cause accelerated growth. The oxidative
state of a cell may be measured using methods known to the skilled
worker, for example via the state of oxidation of the SH groups
present in the cell, via measuring the hydrogen peroxide level in
the cell or via other known assay systems. Particularly preferably,
the change in the oxidative state results in increased tolerance to
biotic or abiotic stress. Consequently, one embodiment of the
invention also relates to a nonhuman organism with increased
tolerance to abiotic or biotic stress in comparison with a
reference organism of increased tolerance, wherein the L450
activity, where appropriate the amount of L450 RNA or protein, has
increased or the activity of the polypeptide of the invention or of
the polypeptide encoded by the polynucleotide of the invention has
increased.
[0098] In another embodiment, the invention also relates to a
method for preparing a nonhuman organism with increased tolerance
to stress in comparison with a reference organism, which method
comprises increasing the L450 activity in said organism or in one
or more parts thereof in comparison with a reference organism.
[0099] In another embodiment, the invention consequently also
relates to a nonhuman organism with a modulated, preferably
increased, production or amount of reactive oxygen species in the
cells.
[0100] "Increasing the L450 activity" in a cell compartment, a cell
organelle, a cell, a tissue, an organ or a nonhuman organism,
preferably a plant, preferably means "increasing the absolute L450
activity", i.e. independently of whether this is due to more
protein or more active protein in a cell compartment, a cell
organelle, a cell, a tissue, an organ or a nonhuman organism in a
cell compartment, a cell organelle, a cell, a tissue, an organ or a
nonhuman organism.
[0101] The specific activity may be increased, for example, by
mutating the polypeptide, the consequence of which is higher
turnover or better binding of cofactors, for example. Increasing
the stability of the polypeptide increases, for example, the
activity per unit, for example per volume or per cell, i.e. a loss
of activity with time, due to degradation of said polypeptide, is
prevented. An in-vitro assay for determining the specific activity
of L450 is not yet known to the skilled worker.
[0102] The specific activity of a polypeptide may be determined as
described in the examples below. For example, it is possible to
express a potential L450 gene in a model organism and to compare
the growth curve with that of a reference under identical
conditions. Preferably, an increase in growth can already be
detected at the cellular level, but it may be necessary to observe
a full vegetative period. Preference may be given here to using a
plant expression and assay system for this purpose. Thus it was
surprisingly found that constitutive expression of the yeast
protein YLR251w in plants also results in faster growth.
[0103] If L450 influences the oxidative state of the cell, it is
possible, for example, to (over)express a candidate protein in a
cell and to assay the oxidative state of this cell in comparison
with a reference.
[0104] The term "increasing" means both that a substance or an
activity, here L450 RNA or L450 DNA or L450 protein or L450
activity, for example, is introduced to a particular environment
for the first time or has previously not been detectable in said
environment, for example by expressing a transgenic L450 gene in an
L450-deficient nonhuman organism, and that the activity or the
amount of substance in a particular environment is increased in
comparison with the original state, for example by coexpression of
a transgenic L450 gene in an L450-expressing organism or by uptake
of L450 from the environment. The term "increasing" thus also
comprises de-novo expression.
[0105] According to the knowledge of the skilled worker, the amount
of RNA or polypeptide in a cell, a compartment, etc. regularly
correlates to the activity of a protein in a volume. This
correlation is not always linear, for example the activity also
depends on the stability of the molecules or on the presence of
activating or inhibiting cofactors. Likewise, product and reactant
inhibitions are known. The invention on which the present
application is based shows a dependence between the amount of L450
RNA and the increase in the amount of biomaterial, in particular
fresh weight, number of leaves and yield. Normally, increased
expression of a gene results in an increase of the amount of the
mRNA of said gene and of encoded polypeptide, as is also shown here
in the examples. Consequently, an increased activity within an
organelle, a cell, a tissue, an organ or a plant can be expected
when the amount of L450 is increased there. The same may also be
expected when the amount of L450 is increased in a different
way.
[0106] In one embodiment the amount of L450 mRNA or L450 protein in
the nonhuman organism or in the parts mentioned, for example organ,
cell, tissue or organelle, is therefore increased. The amount may
also be increased by, for example, de-novo or enhanced expression
in the cells of the nonhuman organisms, by increased stability,
reduced degradation or (increased) uptake from the outside.
[0107] In one embodiment, the method of the invention relates to
faster growth and/or higher yield of a plant. Consequently, in a
preferred embodiment, the method of the invention comprises
increasing the activity of an L450 polypeptide encoded by a
polynucleotide which comprises any of the abovementioned nucleic
acid molecules (a) to (i) in a plant. More preferably, the
polynucleotide encompasses any of the abovementioned nucleic acids
molecules (a) to (c). Even more preference is given to increasing
the activity of a polypeptide encoded by a polynucleotide which
comprises any of the sequences depicted in Seq. ID No. 1, 3, 5, 7,
9, 11, 13, 15, 24 26, 34, 36, 38, 40, 42, 44 or 52 or which
comprises a nucleic acid coding for a polypeptide depicted in Seq.
ID. No. 2, 4, 6, 8, 10, 12, 14, 16, 25 27, 35, 37, 39, 41, 43, 45,
46, 47, 48, 49, 50, 51 or 53 or for a homolog thereof.
[0108] Surprisingly, expression of the L450 homolog of yeast
YLR251w (PIR:S59397), which is depicted in Seq. ID No. 11 and 12,
also leads to faster growth in Arabidopsis and may lead to a higher
yield. Consequently, said polynucleotide comprises in one
embodiment Seq. ID No. 11 or a polynucleic acid coding for the
polypeptide according to Seq. ID No. 12 or for a homolog thereof.
Most preference is given to increasing the activity of a plant
homolog of L450 in a plant according to the method of the
invention. Plant homologs are depicted in Seq. ID No.: 1, 3, 5, 7,
9, 24, 26, 34, 36, 38, 40, 42 or 52 and Seq. ID No. 2, 4, 6, 8, 10,
25 27, 35, 37, 39, 41, 43 or 53. Preference is given to increasing
the activity of an L450 encoded by a polynucleotide which comprises
or encodes any of these sequences or a homolog thereof according to
features (b) to (g).
[0109] Preferred homologs are described below. Thus, a particularly
preferred homolog at the amino acid level is at least 20%,
preferably 40%, more preferably 50%, even more preferably 60%, even
more preferably 70%, even more preferably 80, even more preferably
90%, and most preferably 95%, 96%, 97%, 98% or 99%, identical to a
polypeptide encoded according to Seq. ID No.: 1, 3, 5, 7, 9, 11,
13, 15, 24 26, 34, 36, 38, 40, 42, 44 or 52 or depicted in Seq. ID
No.: 2, 4, 6, 8, 10, 12, 14, 16, 25 27, 35, 37, 39, 41, 43, 45, 46,
47, 48, 49, 50, 51 or 53, with preference again being given to a
homolog of an amino acid sequence encoded according to Seq. ID No.:
1, 3, 5, 7, 9, 11, 24 26, 34, 36, 38, 40, 42, 44 or 52 or an amino
acid sequence depicted in Seq. ID No.: 2, 4, 6, 8, 10, 12, 25 27,
35, 37, 39, 41, 43, 45, 46, 47, 48, 49, 50, 51 or 53. Even more
preference, however, is given to a homolog of a protein sequence
encoded by Seq. ID No.: 1, 3, 5, 7, 9, 24 26, 34, 36, 38, 40, 42,
44 or 5238, 40, 42, 44 or 52 or a sequence depicted according to
Seq. ID No.: 2, 4, 6, 8, 10, 25 27, 35, 37, 39, 41, 43, 45, 46, 47,
48, 49, 50, 51 or 53.
[0110] Interestingly an additional L450 variant has been identified
in Arabidopsis.
[0111] L450 from Arabidopsis thaliana has already been published as
MOB24.15 on BAC MOB24 (BAC Accession NO.: AB020746 in GenBank) and
in US 2002/0023281 (Seq. ID No. 1 and 2, respectively). As
mentioned above, a function of the polypeptide of the invention in
plants has not yet been described. The annotations of the ORF in
GenBank and US 2002/0023281 do not mention any function. A Blastp
comparison under standard conditions reveals significant homologies
of L450, inter alia to various peroxisomal membrane proteins from
different organisms. A homologue of said gene in Arabidopsis
thaliana was identified and is shown in Seq ID No.: 42 and 43.
[0112] A very high homology is found with a rice protein of
likewise unknown function (PO452F10.16 from Oryza sativa nipponbare
(GA3)) and oz1116c1058 (Seq. ID No.: 9 and 10 and, respectively, 3
and 4). The Arabidopsis protein and the rice proteins are 54%
identical. In particular, the N-terminal, central and C-terminal
regions are very highly identical and homologous. The Arabidopsis
protein likewise exhibits very high homology to a protein from
Glycine max (soybean) (Seq. ID No.: 7 and 8; 60% identical to Seq.
ID No.: 8 at the amino acid level). The Arabidopsis protein is
furthermore highly homologous to a protein from Hordeum vulgare
(barley) and Triticum aestivum (wheat) (Seq. ID No.: 34 and 35 and
also 36 and 37.). The highest homology was found with a protein
from Canola (Brassicus napus) (Seq. ID No.: 5 and 6 and also 38 and
39: said protein is 83% identical at the amino acid level to Seq.
ID No.: 5. (see also table 7). Further plant homologs were
identified in potato (S. tubrosum) and corn (Maize) (Zea mays) and
are shown in Seq. ID No. 40 and 41 or 52 and 53, resp.
[0113] FIG. 7 shows a multiple alignment of all sequences mentioned
herein, and the derived consensus sequence as well as the concerned
core sequences. FIG. 8 shows a multiple alignment of all plant
Sequences mentioned herein and the derived consensus and core
consensus sequences.
[0114] If the present invention relates to a plant or to a method
for increasing growth or yield in a plant, the L450 activity in the
plant is increased compared to the reference organism by 5% or
more, more preferably by 10%, even more preferably by 20%, 30%, 50%
or 100%. Most preferably, the activity is increased compared to the
reference organism by 200%, 500% or 1 000% or more.
[0115] Owing to the higher L450 activity, in particular owing to a
from 5% to 1 000% increase in L450 activity, preferably owing to a
from 10% to 100% increase, growth of the plant is preferably 5%,
preferably 10%, 20% or 30%, faster. More preferably, growth is
faster by 50%, 100%, 200% or 500% or more, in comparison with a
reference organism. Preference is also given to increasing the L450
activity by 10%, 20%, 30% or from 50% to 1 000% and to a faster
growth of 10%, 20%, 30% or from 50% to 200%.
[0116] Owing to the higher L450 activity, in particular owing to a
from 5% to 1 000% increase in L450 activity, preferably owing to a
from 10% to 100% increase, yield of the plant is preferably 5%,
preferably 10%, 20% or 30%, higher. More preferably, yield is
higher by 50%, 100%, 200% or 500% or more, in comparison with a
reference organism. Preference is also given to increasing the L450
activity by 10%, 20%, 30% or from 50% to 100% and to a higher yield
of 10%, 20%, 30% or 50%.
[0117] In another embodiment, the method of the invention relates
to faster growth and/or higher yield or a higher biomass in
microorganisms. Surprisingly, expression of the L450 homolog
YLR251w of the yeast Saccharomyces cerevisiae, which is depicted in
Seq. ID No. 11 and 12, also leads to faster growth in Arabidopsis
and may lead to a higher yield. Owing to the highly conserved
nature of L450, the increased activity of L450 in microorganisms or
animals can likewise be expected to result in faster growth, i.e.
in a higher rate of division or higher growth rate or due to larger
cells. Consequently, in a preferred embodiment, the method of the
invention comprises increasing in a microorganism, an animal or a
cell the activity of an L450 polypeptide encoded by a
polynucleotide which comprises any of the above-mentioned nucleic
acids (a) to (i). More preferably, the polynucleotide comprises any
of the abovementioned nucleic acids (a) to (c). Even more
preference is given to increasing the activity of a polypeptide
encoded by a polynucleotide which comprises the sequence depicted
in Seq. ID No. 11 or a polynucleic acid which codes for a
polypeptide depicted in Seq. ID No.: 12 or for any of said homologs
thereof.
[0118] Preferred homologs are described below. For example, a
particularly preferred homolog is at least 30%, preferably 40%,
more preferably 50%, even more preferably 60%, even more preferably
70%, even more preferably 80, even more preferably 90%, and most
preferably 95%, 96%, 97%, 98%, or 99%, identical at the amino acid
level to a polypeptide encoded according to Seq. ID No.: 1, 3, 5,
7, 9, 11, 13, 15, 24 26, 34, 36, 38, 40, 42, 44 or 5238, 40, 42, 44
or 52 or depicted in Seq. ID No.: 2, 4, 6, 8, 10, 12, 14, 16, 25
27, 35, 37, 39, 41, 43, 45, 46, 47, 48, 49, 50, 51 or 53, with
preference in turn being given to a homolog of an amino acid
sequence encoded according to Seq. ID No.: 11 or an amino acid
sequence depicted in Seq. ID No.: 12.
[0119] In one embodiment, the nucleic acid molecule encodes a L450
polypeptide comprising the sequence shown in Seq. ID No: 46 or 49,
whereby 20 or less, preferably 15 or 10, of the amino acid
positions indicated can be replaced by an X and/or whereby 20 or
less, preferably 15 or 10, of the amino acid are inserted into the
shown sequence or shown in Seq ID No.: 47, 48, 50 or 51, whereby 10
or less, preferably 7, of the amino acid positions indicated can be
replaced by an X and/or whereby 10 or less, preferably 7, of the
amino acid are inserted into the shown sequence;
[0120] In one embodiment, the nucleic acid molecule encodes a
polypeptide comprising or consisting of a polypeptide comprising
the consensus or consensus core sequence defined above, e.g. as
shown FIG. 7 or 8 or in SEQ ID No.: 46, 47, 48, 49, 50 and/or 51,
whereby 20 or less, preferably 15 or 10, preferably 9, 8, 7, or 6,
more preferred 5 or 4, even more preferred 3, even more preferred
2, even more preferred 1, most preferred 0 of the amino acids
positions indicated by a capital or lower letter in FIG. 7 or 8 can
be replaced by an x and/or not more than 5, preferably 4, even more
preferred 3 or 2, most preferred one or non amino acid position
indicated by a capital letter in FIG. 7 or 8 are/is replaced by an
x and/or 20 or less, preferably 15 or 10, preferably 9, 8, 7, or 6,
more preferred 5 or 4, even more preferred 3, even more preferred
2, even more preferred 1, most preferred 0 amino acids are inserted
into the consensus sequence
[0121] In one embodiment, the nucleic acid molecule encodes a
polypeptide comprising or consisting of a polypeptide shown in any
one of SEQ. ID No.: 46, 47, 48, 49, 50 or 51.
[0122] If the present invention relates to a microorganism or to a
method for increasing growth or yield in microorganisms, the L450
activity is preferably al least 5%, more preferably 10%, even more
preferably 20%, 30%, 50% or 100%, higher than that of the reference
organism. Most preferably, the activity is 200%, 500% or 1 000% or
more, higher than in the reference organism.
[0123] Owing to the higher L450 activity, in particular owing to a
from 5% to 1 000% increase in L450 activity, preferably owing to a
from 10% to 100% increase, growth of the microorganism is
preferably 5%, preferably 10%, 20% or 30%, faster. More preferably,
growth is faster by 50%, 100%, 200% or 500% or more, in comparison
with a reference organism. Preference is also given to increasing
the L450 activity by 10%, 20%, 30% or from 50% to 100% and to a
faster growth of 10%, 20%, 30% or 50%.
[0124] Owing to the higher L450 activity, in particular owing to a
from 5% to 1 000% increase in L450 activity, preferably owing to a
from 10% to 100% increase, yield, in particular the biomass, of the
microorganism is preferably 5%, preferably 10%, 20% or 30%, higher.
More preferably, yield is higher by 50%, 100%, 200% or 500% or
more, in comparison with a reference organism. Preference is also
given to increasing the L450 activity by 10%, 20%, 30% or from 50%
to 100% and to a higher yield of 10%, 20%, 30% or 50%.
[0125] In a further embodiment, the method of the invention relates
to faster growth and/or higher yield of a useful animal.
Consequently, in a preferred embodiment, the method of the
invention comprises increasing in a useful animal the activity of
an L450 polypeptide encoded by a polynucleotide which comprises any
of the abovementioned nucleic acids. More preferably, the
polynucleotide comprises any of the above-mentioned nucleic acids
(a) to (c). Even more preference is given to increasing the
activity of a polypeptide encoded by a polynucleotide which
comprises either of the sequences depicted in Seq. ID No. 13 or 15
or a polynucleic acid encoding a polypeptide depicted in Seq. ID
No. 14 or 16 or of a homolog thereof. Surprisingly, expression of
the L450 homolog YLR251w of the yeast Saccharomyces cerevisiae,
which is depicted in Seq. ID No. 11 and 12, also leads to faster
growth in Arabidopsis and may lead to a higher yield. From this, a
highly conserved nature of the L450 activity may be assumed.
Consequently, in one embodiment, the polynucleotide comprises Seq.
ID No. 11 or a nucleic acid which comprises a protein encoded in
Seq. ID No.: 12 or a homolog thereof. As the polypeptide of the
invention seems to be quite conserved the expression of insect
homologs may be advantageous. Thus in one embodiment an insect
homolog might be expressed in the organism, e.g. a Drosophila
homolog as shown in SEQ. ID No.: 44 and 45. More preference is
given, however, to increasing the activity of an animal homolog of
L450 in a useful animal according to the method of the invention.
Animal homologs, in this case human and murine homologs, are
depicted in Seq. ID No.: 13 and 15 and, respectively, Seq. ID No.:
14 and 16. Preference is given to increasing the activity of an
L450 encoded by a polynucleotide which comprises any of these
sequences or a homolog thereof according to features (b) to
(g).
[0126] Preferred homologs are described below. For example, a
particularly preferred homolog is at least 30%, preferably 40%,
more preferably 50%, even more preferably 60%, even more preferably
70%, even more preferably 80, even more preferably 90%, most
preferably 95%, 96%, 97%, 98% or 99%, identical at the amino acid
level to a polypeptide encoded according to Seq. ID No.: 1, 3, 5,
7, 9, 11, 13, 15, 24 26, 34, 36, 38, 40, 42, 44 or 5238, 40, 42, 44
or 52 or depicted in Seq. ID No.: 2, 4, 6, 8, 10, 12, 14, 16, 25
27, 35, 37, 39, 41, 43, 45, 46, 47, 48, 49, 50, 51 or 53, with
preference in turn being given to a homolog of an amino acid
sequence encoded according to Seq. ID No.: 13 or 15 or an amino
acid sequence depicted in Seq. ID No.: 14 or 16.
[0127] The L450 protein of Arabidopsis thaliana is 31% identical
and 43% homologous to the murine protein MPV17, with PMP20 of
Arabidopsis thaliana being 26% identical and 44% homologous. In
principle, it may be assumed that MVP17 and PMP20 can be combined
into a group, with L450 being slightly more identical to MVP17 than
PMP20, but homology to PMP20 being higher. Conspicuously, the
mentioned ORF from rice is distinctly more homologous to the ORF
L450 found in Arabidopsis than to PMP20. Presumably, L450 thus
forms together with PO452F10.16'' from Oryza sativa (japonica
cultivar-group) and further homologs which are described in the
examples a separate subgroup.
[0128] The literature on MVP17 defective mice describes the protein
as a peroxisomal protein involved in the metabolism of reactive
oxygen species. MPV17 (-/-) cells were found to contain increased
(mRNA- and enzyme-level) activity of gamma-glutamyl transpeptidase
and reduced activity of plasma glutathione peroxidase and
superoxide dismutase. An increased production of superoxide anions
was detected. A pathological change in MVP17 KO mice was remedied
by treatment with antioxidants, thereby establishing a causal link
between increased ROS production (ROS is "reactive oxygen species")
and the pathology. In contrast to this, another source (Zwacka,
EMBO J. 13, 1994, 5129-34) reports that the loss of MPV17 protein
does not impair peroxisome biogenesis but results in a reduced
ability to produce reactive oxygen species (ROS). Correspondingly,
overproduction of MPV17 in transfected cells causes a dramatically
increasing level of intracellular ROS, indicating direct
involvement of MPV17 in ROS production. Thus, a peroxisomal
location of the protein may be suspected, possibly as a function
within the ROS-producing or the protective system of a cell. ROS
production may be involved in establishing the defenses against
pathogens by programmed cell death in plants and mammalian cells.
On the other hand, excessive ROS production leads to cell damage,
to the formation of necroses and to retarded growth.
[0129] If the present invention relates to a useful animal or to a
method for increasing growth or yield of a useful animal in
comparison with a reference animal, the L450 activity is preferably
at least 5%, more preferably 10%, even more preferably 20%, 30%,
50% or 100%, higher than that of the reference organism. Most
preferably, the activity is 200%, 500% or 1 000% or more, higher
than in the reference organism.
[0130] Owing to the higher L450 activity, in particular owing to a
from 5% to 1 000% increase in L450 activity, preferably owing to a
from 10% to 100% increase, growth of the useful animal is
preferably 5%, preferably 10%, 20% or 30%, faster, by comparison.
More preferably, growth is faster by 50%, 100%, 200% or 500% or
more, in comparison with a reference organism. Preference is also
given to increasing the L450 activity by 10%, 20%, 30% or from 50%
to 100% and to a faster growth of 10%, 20%, 30% or 50%.
[0131] Owing to the higher L450 activity, in particular owing to a
from 5% to 1 000% increase in L450 activity, preferably owing to a
from 10% to 100% increase, yield of the useful animal is preferably
5%, preferably 10%, 20% or 30%, higher. More preferably, yield is
higher by 50%, 100%, 200% or 500% or more, in comparison with a
reference organism. Preference is also given to increasing the L450
activity by 10%, 20%, 30% or from 50% to 100% and to a higher yield
of 10%, 20%, 30% or 50%.
[0132] Consequently, the nucleic acid sequences and polypeptides
used in the method of the invention are nucleic acid sequences
coding for polypeptides whose activity is not exactly known yet.
Owing to the homology of said proteins to the murine MPV17 protein,
however, it may be assumed that it is a peroxisomal membrane
protein which is directly or indirectly involved in the metabolism
of reactive oxygen species. Thus it would be possible to determine
increased activity of the L450 protein in a cell, an organelle, a
compartment, a tissue, an organ or a nonhuman organism, in
particular a plant, by measuring said reactive oxygen species. The
reactive oxygen species may be measured as described, for example,
in O'Kane, D., Planta, 1996, 198(3), 371-377.
[0133] Apart from that, the L450 activity may be determined
indirectly via measuring the amount of L450 DNA, L450 RNA or L450
protein. Thus, a quantitative Northern blot or quantitative PCR of
the inventive polynucleotides described herein may determine the
amount of mRNA, for example in a cell or in a total extract, and a
Western blot may be used to compare the amount of the protein, for
example in a cell or a total extract, to that in a reference.
Methods of this kind are known to the skilled worker and have been
extensively described, for example also in Sambrook, Molecular
Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold
Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989 or
in Current Protocols, 1989 and updates, John Wiley & Sons,
N.Y., or in other sources cited below.
[0134] A suitable nonhuman organism (host organism) for preparation
in the method of the invention is in principle any nonhuman
organism for which faster growth is useful and desirable, such as,
for example, microorganisms such as yeasts, fungi or bacteria,
monocotyledonous or dicotyledonous plants, mosses, algae, and also
useful animals, as listed below. The term nonhuman organism, host
organism or useful animal also includes an organism of human
origin, for example human cell lines, but does not include a human
organism.
[0135] The term "plants", as used herein, may include higher
plants, lower plants, mosses and algae; however, in a preferred
embodiment of the method of the invention, the term "plants"
relates to higher plants.
[0136] Advantageously, the method of the invention uses plants
which belong to the useful plants, as listed below. Apart from
production of animal feed or food, the plants prepared according to
the invention may in particular also be used for the preparation of
fine chemicals.
[0137] In one embodiment of the present invention, the L450 protein
comprises the consensus sequence described above, e.g. shown in SEQ
ID No. 46, 47, 48, 49, 50 or 51, whereby 20 or less, preferably 15
or 10, preferably 9, 8, 7, or 6, more preferred 5 or 4, even more
preferred 3, even more preferred 2, even more preferred 1, most
preferred 0 of the amino acids positions indicated by a capital or
lower letter in FIG. 7 or 8 can be replaced by an x and/or not more
than 5, preferably 4, even more preferred 3 or 2, most preferred
one or non amino acid position indicated by a capital letter in
FIG. 7 or 8 are/is replaced by an x and/or 20 or less, preferably
15 or 10, preferably 9, 8, 7, or 6, more preferred 5 or 4, even
more preferred 3, even more preferred 2, even more preferred 1,
most preferred 0 amino acids are inserted into the consensus
sequence but not consisting of one of the public known sequences
mentioned herein. In one embodiment, the present invention relates
to an nucleic acid molecule encoding a protein having the consensus
sequence described above, e.g. as shown in SEQ ID No. 46, 47, 48,
49, 50 or 51, whereby 20 or less, preferably 15 or 10, preferably
9, 8, 7, or 6, more preferred 5 or 4, even more preferred 3, even
more preferred 2, even more preferred 1, most preferred 0 of the
amino acids positions indicated by a capital or lower letter in
FIG. 7 or 8 can be replaced by an x and/or not more than 5,
preferably 4, even more preferred 3 or 2, most preferred one or non
amino acid position indicated by a capital letter in FIG. 7 or 8
are/is replaced by an x and/or 20 or less, preferably 15 or 10,
preferably 9, 8, 7, or 6, more preferred 5 or 4, even more
preferred 3, even more preferred 2, even more preferred 1, most
preferred 0 amino acids are inserted into the consensus sequence
and which does not encode an polypeptide of the public known
sequences published herein and/or which does not consist of the
nucleic acid molecules known to the public as mentioned herein.
[0138] In one embodiment, the method of the invention comprises
increasing the activity of the L450 polypeptide by increasing the
activity of at least one polypeptide in said organism or in one or
more parts thereof, which is encoded by a nucleic acid molecule
comprising a nucleic acid molecule selected from the group
consisting of: [0139] (aa) nucleic acid molecule encoding an L450
polypeptide or encoding, preferably at least the mature, form of
the polypeptide which is depicted in Seq. ID No.: 2, 4, 6, 8, 10,
12, 14, 16, 25 27, 35, 37, 39, 41, 43, 45, 46, 47, 48, 49, 50, 51
or 53; [0140] (bb) nucleic acid molecule comprising, preferably at
least the mature, polynucleotide of the coding sequence according
to Seq. ID No: 1, 3, 5, 7, 9, 11, 13, 15, 24 26, 34, 36, 38, 40,
42, 44 or 5238, 40, 42, 44 or 52; [0141] (cc) nucleic acid molecule
whose sequence is derivable from a polypeptide sequence encoded by
a nucleic acid molecule according to (aa) or (bb), due to the
degeneracy of the genetic code; [0142] (dd) nucleic acid molecule
encoding a polypeptide whose sequence is at least 20%, preferably
35%, more preferably 45%, even more preferably 60%, even more
preferably 70%, 80%, 90%, 95%, 97%, 98% and 99%, identical to the
amino acid sequence of the polypeptide encoded by the nucleic acid
molecule according to (aa) to (cc); [0143] (ee) nucleic acid
molecule encoding a polypeptide which is derived from an L450
polypeptide encoded by a nucleic acid molecule according to (aa) to
(dd,) preferably (aa) to (cc), by substitution, deletion and/or
addition of one or more amino acids of the amino acid sequence of
the polypeptide encoded by the nucleic acid molecules (aa) to (dd),
preferably (aa) to (cc); [0144] (ff) nucleic acid molecule encoding
a fragment or an epitope of the L450 polypeptide encoded by any of
the nucleic acid molecules according to (aa) to (ee), preferably
(aa) to (cc); [0145] (gg) nucleic acid molecule comprising a
polynucleotide which comprises the sequence of a nucleic acid
molecule obtained by amplification of a preferably microbial or
plant cDNA bank using the primers in Seq. ID No.: 19 and 20 and/or
28 and 30 or a combination thereof or of a preferably microbial or
plant genomic bank using the primers in Seq. ID No.: 21 and 22;
[0146] (hh) nucleic acid molecule encoding an L450 polypeptide
which is isolated with the aid of monoclonal antibodies against a
polypeptide encoded by any of the nucleic acid molecules according
to (aa) to (gg), preferably (aa) to (cc) and [0147] (ii) nucleic
acid molecule which is obtainable by screening an appropriate
library under stringent conditions using a probe comprising any of
the sequences according to (aa) to (hh), preferably (aa) to (cc),
or a fragment of at least 15 nt, preferably 20 nt, 30 nt, 50 nt,
100 nt, 200 nt or 500 nt, of the nucleic acid characterized in (aa)
to (hh), preferably (aa) to (cc), and which encodes an L450
polypeptide; or [0148] (jj) nucleic acid molecule encoding a L450
polypeptide comprising the sequence shown in Seq. ID No: 46 or 49,
whereby 20 or less, preferably 15 or 10, of the amino acid
positions indicated can be replaced by an X and/or whereby 20 or
less, preferably 15 or 10, of the amino acid are inserted into the
shown sequence or shown in Seq ID No.: 47, 48, 50 or 51, whereby 10
or less, preferably 7, of the amino acid positions indicated can be
replaced by an X and/or whereby 10 or less, preferably 7, of the
amino acid are inserted into the shown sequence; [0149] or which
comprises a complementary sequence thereof.
[0150] In one embodiment, the activity of the L450 protein is
increased by [0151] (a) increasing the expression of a L450
polypeptide; [0152] (b) increasing the stability of L450 RNA or of
the L450 protein, preferably of a polypeptide or polynucleotide as
described in (a); [0153] (c) increasing the specific activity of
the L450 protein, preferably of a polypeptide as described in (a)
or encoded by a polynucleotide described in (a); [0154] (d)
expressing a homologous or artificial transcription factor capable
of increasing expression of an endogenous L450 gene function,
preferably comprising the sequence of a polynucleotide described in
(a); or [0155] (e) adding an exogenous factor which increases or
induces L450 activity or L450 expression to the food or the medium,
preferably of a polynucleotide or polynucleotide described in
(a).
[0156] In one embodiment, the method of the invention comprises
increasing the activity of L450 polypeptide by introducing a
polynucleotide into the organism, preferably into a plant, or into
one or more parts thereof, which polynucleotide codes for an L450
polypeptide encoded by a nucleic acid molecule comprising a nucleic
acid molecule selected from the group consisting of: [0157] (a)
nucleic acid molecule encoding an L450 polypeptide or encoding,
preferably at least the mature form of, the polypeptide that is
depicted in Seq. ID No.: 2, 4, 6, 8, 10, 12, 14, 16, 25 27, 35, 37,
39, 41, 43, 45, 46, 47, 48, 49, 50, 51 or 53; [0158] (b) nucleic
acid molecule comprising, preferably at least the mature,
polynucleotide of the coding sequence according to Seq. ID No: 1,
3, 5, 7, 9, 11, 13, 15, 24 26, 34, 36, 38, 40, 42, 44 or 52; [0159]
(c) nucleic acid molecule whose sequence is derivable from a
polypeptide sequence encoded by a nucleic acid molecule according
to (a) or (b), due to the degeneracy of the genetic code; [0160]
(d) nucleic acid molecule encoding a polypeptide whose sequence is
at least 20%, preferably 35%, more preferably 45%, even more
preferably 60%, even more preferably 70%, 80%, 90%, 95%, 97%, 98%
and 99%, identical to the amino acid sequence of the polypeptide
encoded by the nucleic acid molecule according to (a) to (c);
[0161] (e) nucleic acid molecule encoding a polypeptide that is
derived from an L450 polypeptide encoded by a nucleic acid molecule
according to (a) to (d) preferably (a) to (c) by substitution,
deletion and/or addition of one or more amino acids of the amino
acid sequence of the polypeptide encoded by the nucleic acid
molecules (a) to (d), preferably (a) to (c); [0162] (f) nucleic
acid molecule encoding a fragment or an epitope of the L450
polypeptide encoded by any of the nucleic acid molecules according
to (a) to (e), preferably (a) to (c); [0163] (g) nucleic acid
molecule comprising a polynucleotide which comprises the sequence
of a nucleic acid molecule obtained by amplification of preferably
microbial or a plant cDNA bank using the primers in Seq. ID No.: 19
and 20 and/or 28 and 30 or a combination thereof or of a preferably
microbial or plant genomic bank using the primers in Seq. ID No.:
21 and 22; [0164] (h) nucleic acid molecule encoding an L450
polypeptide which is isolated with the aid of monoclonal antibodies
against a polypeptide encoded by any of the nucleic acid molecules
according to (a) to (g), preferably (a) to (c); and [0165] (i)
nucleic acid molecule which is obtainable by screening an
appropriate library under stringent conditions using a probe
comprising any of the sequences according to (a) to (h) preferably
(a) to (c) or a fragment of at least 15 nt, preferably 20 nt, 30
nt, 50 nt, 100 nt, 200 nt or 500 nt, of the nucleic acid
characterized in (a) to (h), preferably (a) to (c) and which
encodes an L450 polypeptide; [0166] (j) nucleic acid molecule
encoding a L450 polypeptide comprising the sequence shown in Seq.
ID No: 46 or 49, whereby 20 or less, preferably 15 or 10, of the
amino acid positions indicated can be replaced by an X and/or
whereby 20 or less, preferably 15 or 10, of the amino acid are
inserted into the shown sequence or shown in Seq ID No.: 47, 48, 50
or 51, whereby 10 or less, preferably 7, of the amino acid
positions indicated can be replaced by an X and/or whereby 10 or
less, preferably 7, of the amino acid are inserted into the shown
sequence; or which comprises a complementary sequence thereof.
[0167] The organism is preferably a microorganism or, more
preferably a plant.
[0168] The term "coding" sequence or "to code" means according to
the invention both the codogenic sequence and the complementary
sequence or a reference to these, i.e. both DNA and RNA sequences
are regarded as coding. For example, a structural gene encodes an
mRNA via transcription and a protein via translation, and a coding
mRNA is translated into a protein. Both molecules contain the
information leading to the sequence of the coded polypeptide, i.e.
they encode the latter. Posttranscriptional and posttranslational
modifications of RNA and polypeptide are sufficiently known to the
skilled worker and are likewise included.
[0169] According to the invention, "organism or one or more parts
thereof" means a cell, a cell compartment, an organelle, a tissue
or an organ of an organism or a nonhuman organism.
[0170] According to the invention, "plant or one or more parts
thereof" means a cell, a cell compartment, an organelle, a tissue,
an organ or a plant.
[0171] The terms "nucleic acid", "nucleic acid molecule" and
"polynucleotide" and also "polypeptide" and "protein" are used
herein synonymously.
[0172] In the method of the invention, "nucleic acids" or
"polynucleotides" mean DNA or RNA sequences which may be single- or
double-stranded or may have, where appropriate, synthetic,
non-natural or modified nucleotide bases which can be incorporated
into DNA or RNA.
[0173] Consequently, the present invention also relates to a
polynucleotide, which comprises a nucleic acid molecule selected
from the group consisting of: [0174] (a) nucleic acid molecule
encoding, preferably at least the mature form of, the polypeptide
as depicted in Seq. ID No. 2, 4, 6, 8, 10, 12, 14, 16, 25 27, 35,
37, 39, 41, 43, 45, 46, 47, 48, 49, 50, 51 or 53 or comprising, at
least the mature form of, the polynucleotide depicted in Seq. ID
No. 1, 3, 5, 7, 9, 11, 13, 15, 24 26, 34, 36, 38, 40, 42, 44 or 52;
[0175] (b) nucleic acid molecule whose sequence is derivable from a
polypeptide sequence encoded by a nucleic acid molecule according
to (a) due to the degeneracy of the genetic code; [0176] (c)
nucleic acid molecule encoding an L450 polypeptide whose sequence
is at least 30%, preferably 35%, more preferably 45%, even more
preferably 60%, even more preferably 70%, 80%, 90%, 95%, 97%, 98%
and 99%, identical to the amino acid sequence of the polypeptide
encoded by the sequence depicted in Seq. ID No.: 4, 6, 8, 10, 12,
14, 16, 25 27, 35, 37, 39, 41, 43, 45, 46, 47, 48, 49, 50, 51 or 53
or comprising the sequence depicted in Seq. ID No. 3, 5, 7, 9, 11,
13, 15, 24 26, 34, 36, 38, 40, 42, 44 or 52; [0177] (d) nucleic
acid molecule encoding a polypeptide that is derived from an L450
polypeptide encoded by a polynucleotide according to (a) to (c) by
substitution, deletion and/or addition of one or more amino acids
of the amino acid sequence of the polypeptide encoded by the
nucleic acid molecules (a) to (c) and encoding L450; [0178] (e)
nucleic acid molecule encoding a fragment or an epitope of the L450
polypeptide encoded by any of the nucleic acid molecules according
to (a) to (d), preferably (a) to (c) and encoding L450; [0179] (f)
nucleic acid molecule comprising a polynucleotide which comprises
the sequence of a nucleic acid molecule obtained by amplification
of a plant cDNA bank using the primers in Seq. ID No.: 19 and 20
and/or 28 and 30 or a combination thereof or of a preferably
microbial or plant genomic bank using the primers in Seq. ID No.:
21 and 22; [0180] (g) nucleic acid molecule encoding an L450
polypeptide which has been isolated with the aid of monoclonal
antibodies against a polypeptide encoded by any of the nucleic acid
molecules according to (a) to (f), preferably (a) to (c) and
encoding L450; [0181] (h) nucleic acid molecule which is obtainable
by screening an appropriate library under stringent conditions
using a probe comprising any of the sequences according to (a) to
(g) or a fragment of at least 15 nt, preferably 20 nt, 30 nt, 50
nt, 100 nt, 200 nt or 500 nt, of the nucleic acid characterized in
(a) to (g), preferably (a) to (c) and which encodes an L450
polypeptide, [0182] (i) nucleic acid molecule encoding a L450
polypeptide comprising the sequence shown in Seq. ID No: 46 or 49,
whereby 20 or less, preferably 15 or 10, of the amino acid
positions indicated can be replaced by an X and/or whereby 20 or
less, preferably 15 or 10, of the amino acid are inserted into the
shown sequence or shown in Seq ID No.: 47, 48, 50 or 51, whereby 10
or less, preferably 7, of the amino acid positions indicated can be
replaced by an X and/or whereby 10 or less, preferably 7, of the
amino acid are inserted into the shown sequence; or the
complementary strand thereof, said polynucleotide or said nucleic
acid molecule according to (a) to (i) not comprising the sequence
depicted in Seq. ID No.: 1, 3, 9, 11, 13, 15, 23, 42 or 44 or the
sequence complementary thereto, where appropriate the one depicted
in Seq. ID No. 24. In one embodiment, a polypeptide is also not
encoded which comprises the sequence depicted in Seq. 2, 4, 10, 12,
14, 16, 43 or 45, where appropriate also Seq. ID No. 25, or which
is encoded by the sequence depicted in Seq. ID No. 23 or the
sequence complementary thereto.
[0183] Preferably, the polynucleotide of the present invention
differs from the herein shown previously published polypeptides by
at least one nucleotide, e.g. from SEQ ID No.: 1, 3, 9, 11, 13, 15,
23, 42 or 44. Preferably, the polypeptide encoded differs from the
previously published polypeptides by at least one amino acid, e.g.
from SEQ ID No.: 2, 4, 10, 12, 14, 16, 43 or 45.
[0184] Seq. ID No.: 1 and 2 describe the L450 polypeptide (Seq. ID
No.: 2) and the sequence it is based on (Seq. ID No.: 1) of
Arabidopsis thaliana, as disclosed under Accession AU 237476.
[0185] Seq. ID No.: 3 and 4 describe the L450 polypeptide (Seq. ID
No.: 4) and the sequence it is based on (Seq. ID No.: 3) of Oryza
sativa, as disclosed under Accession Q8W0A7.
[0186] Seq. ID No.: 5 and 6 describe the L450 polypeptide (Seq. ID
No.: 6) and the sequence it is based on (Seq. ID No.: 5) of
Brassica napus.
[0187] Seq. ID No.: 7 and 8 describe the L450 polypeptide (Seq. ID
No.: 8) and the sequence it is based on (Seq. ID No.: 7) of Glycine
max.
[0188] Seq. ID No.: 9 and 10 describe the L450 polypeptide (Seq. ID
No.: 10) and the sequence it is based on (Seq. ID No.: 9), of Oryza
sativa.
[0189] Seq. ID No.: 11 and 12 describe the L450 polypeptide (Seq.
ID No.: 12) and the sequence it is based on (Seq. ID No.: 11), of
Saccharomyces cerevisiae, as disclosed under Accession
PIR:S59397.
[0190] Seq. ID No.: 13 and 14 describe human MVP17 (Seq. ID No.:
14) and the sequence it is based on (Seq. ID No.: 13), as disclosed
under Accession PIR:S45343.
[0191] Seq. ID No.: 15 and 16 describe murine MVP17 (Seq. ID No.:
16) and the sequence it is based on (Seq. ID No.: 15), as disclosed
under Accession PIR:S29031.
[0192] Seq. ID No.: 23 corresponds to the sequence (ID No. 701)
published in US 2002/0023281. US 2002/0023281 describes 999
different sequences without indicating the function. The sequence
Seq. ID No. 701 is not depicted completely and does not display a
start codon. Moreover, the sequence Seq. ID No. 701 is depicted in
antisense orientation. The sequence depicted in Seq. ID No. 701 is,
over a sequence from nucleotide 66 to nucleotide 708 of the 828 nt
in total, 98% identical to the sequence depicted in Seq. ID No. 1
of the present application. FIG. 3 depicts the Blast comparison
between the sequence depicted in US 2002/0023281 and the sequence
depicted in Seq. ID No. 1.
[0193] Seq. ID No. 26, 24, 25 and 27 depict various L450 homologs
of ecotype C24 (Nottingham Arabidopsis Stock Centre, UK; NASC Stock
N906).
[0194] Seq. ID No.: 34 and 35 describe the L450 polypeptide (Seq.
ID No.: 35) and the sequence it is based on (Seq. ID No.: 34) of
Hordeum vulgare.
[0195] Seq. ID No.: 36 and 37 describe the L450 polypeptide (Seq.
ID No.: 37) and the sequence it is based on (Seq. ID No.: 36) of
Triticum aestivum.
[0196] Seq. ID No.: 38 and 39 describe the L450 polypeptide (Seq.
ID No.: 39) and the sequence it is based on (Seq. ID No.: 38) of
Brassica napus.
[0197] This was a sequencing check of the sequences depicted in
Seq. ID No. 5 (2+1 sequencing). The comparison of sequences 5 and
38 revealed the following alterations at the nucleotide (Nt)
level:
TABLE-US-00007 Nt Seq. ID No.: 5 Seq. ID No.: 38 330 A G 333 A T
351 T C 372 A T 411 G A 423 A G 441 A G 459 A T 462 G A 480 A C 507
T A 522 T C 525 T C 531 G A 636 G A 640 C T 645 G T 662 C --
[0198] This resulted in the following changes when the sequences of
Seq. ID No.: 6 and 39 (protein) were compared:
TABLE-US-00008 AA Seq. ID No.: 6 Seq. ID No.: 39 221 A G 222 H T
223 R G 224 W G 225 S V 226 M Stop
[0199] SEQ ID No.: 40 and 41 describe the L450 polypeptide (SEQ ID
No.: 41) and the encoding polynucleotide sequence (SEQ ID No.: 40)
of potato (S. tuberosum).
[0200] SEQ ID No.: 42 and 43 describe the L450 polypeptide (SEQ ID
No.: 43) and the encoding polynucleotide sequence (SEQ ID No.: 42)
of a further gene identified in Arabidopsis thaliana, suggesting a
gene family.
[0201] SEQ ID No.: 44 and 45 describe the L450 polypeptide (SEQ ID
No.: 45) and the encoding polynucleotide sequence (SEQ ID No.: 44)
of Drosophila.
[0202] The SEQ ID No.: 52 and 53 describe the L450 polypeptide (SEQ
ID No.: 53) and the encoding polynucleotide (Seq ID No.: 52 and 53)
of corn (Zea mays).
[0203] In one embodiment, the invention furthermore relates to a
polynucleotide encoding an L450 polypeptide, e.g. derived from
plants, which comprises a nucleic acid molecule encoding a
polypeptide comprising any one of SEQ ID No.: 46, 47, 48, 49, 50 or
51 or selected from the group consisting of: [0204] (a) nucleic
acid molecule encoding preferably at least the mature, form of the
polypeptide as depicted in Seq. ID No. 2, 4, 6, 8, 25, 27, 35, 37,
39, 41, 43, 46, 47, 48, 49, 50, 51 or 53 or comprising, preferably
at least the mature form of the polynucleotide depicted in Seq. ID
No. 1, 3, 5, 7, 24, 26, 34, 36 38, 40, 42 or 52; [0205] (b) nucleic
acid molecule whose sequence is derivable from a polypeptide
sequence encoded by a nucleic acid molecule according to (a) due to
the degeneracy of the genetic code; [0206] (c) nucleic acid
molecule encoding a polypeptide whose sequence is at least 55%,
preferably 60%, more preferably 70%, even more preferably 80%, even
more preferably 90%, most preferably 95%, 96%, 97%, 98% or 99%
identical to the amino acid sequence of the polypeptide encoded by
the sequence depicted in Seq. ID No.: 2 or 4 or comprising the
sequence depicted in Seq. ID No. 1 or 3; [0207] (d) nucleic acid
molecule encoding a polypeptide whose sequence is at least 90%,
preferably 95%, 96%, 97%, 98% or 99%, identical to the amino acid
sequence of the polypeptide encoded by the sequence depicted in
Seq. ID No.: 6 or comprising the sequence depicted in Seq. ID No.
5; [0208] (e) nucleic acid molecule encoding a polypeptide whose
sequence is at least 65%, more preferably 70%, even more preferably
80%, even more preferably 90%, most preferably 95%, 96%, 97%, 98%
or 99%, identical to the amino acid sequence of the polypeptide
encoded by the sequence depicted in Seq. ID No.: 8 or comprising
the sequence depicted in Seq. ID No. 7; [0209] (f) nucleic acid
molecule encoding a polypeptide whose sequence is at least 55%,
more preferably 70%, even more preferably 80%, even more preferably
90%, most preferably 95%, 96%, 97%, 98% or 99%, identical to the
amino acid sequence of the polypeptide encoded by the sequence
depicted in Seq. ID No.: 10 or comprising the sequence depicted in
Seq. ID No. 9; [0210] (g) nucleic acid molecule encoding a
polypeptide whose sequence is at least 35%, more preferably 50%,
60% or 70%, even more preferably 80%, even more preferably 90%,
most preferably 95%, 96%, 97%, 98% or 99%, identical to the amino
acid sequence of the polypeptide encoded by the sequence depicted
in Seq. ID No.: 12 or comprising the sequence depicted in Seq. ID
No. 11; [0211] (h) nucleic acid molecule encoding a polypeptide
whose sequence is at least 35%, more preferably 50%, 60% or 70%,
even more preferably 80%, even more preferably 90%, most preferably
95%, 96%, 97%, 98% or 99%, identical to the amino acid sequence of
the polypeptide encoded by the sequence depicted in Seq. ID No.: 14
or 45 or comprising the sequence depicted in Seq. ID No. 13 or 44;
[0212] (i) nucleic acid molecule encoding a polypeptide whose
sequence is at least 35%, more preferably 50%, 60% or 70%, even
more preferably 80%, even more preferably 90%, most preferably 95%,
96%, 97%, 98% or 99%, identical to the amino acid sequence of the
polypeptide encoded by the sequence depicted in Seq. ID No.: 16 or
comprising the sequence depicted in Seq. ID No. 15; [0213] (j)
nucleic acid molecule encoding a polypeptide whose sequence is at
least 55%, preferably 60%, more preferably 70%, even more
preferably 80%, even more preferably 90%, most preferably 95%, 96%,
97%, 98% or 99% identical to the amino acid sequence of the
polypeptide encoded by the sequence depicted in Seq. ID No.: 35 or
41 or comprising the sequence depicted in Seq. ID No. 34 or 42;
[0214] (k) nucleic acid molecule encoding a polypeptide whose
sequence is at least 55%, preferably 60%, more preferably 70%, even
more preferably 80%, even more preferably 90%, most preferably 95%,
96%, 97%, 98% or 99% identical to the amino acid sequence of the
polypeptide encoded by the sequence depicted in Seq. ID No.: 37 or
comprising the sequence depicted in Seq. ID No. 36; [0215] (l)
nucleic acid molecule encoding a polypeptide whose sequence is at
least 90%, preferably 95%, 96%, 97%, 98% or 99%, identical to the
amino acid sequence of the polypeptide encoded by the sequence
depicted in Seq. ID No.: 39 or comprising the sequence depicted in
Seq. ID No. 38; [0216] (m) nucleic acid molecule encoding a
polypeptide that is derived from an L450 polypeptide encoded by a
polynucleotide according to (a) to (l) by substitution, deletion
and/or addition of one or more amino acids of the amino acid
sequence of the polypeptide encoded by the nucleic acid molecules
(a) to (l); [0217] (n) nucleic acid molecule encoding a fragment or
an epitope of the L450 polypeptide encoded by any of the nucleic
acid molecules according to (a) to (m); [0218] (o) nucleic acid
molecule comprising a polynucleotide which comprises the sequence
of a nucleic acid molecule obtained by amplification of a
preferably microbial or plant cDNA bank using the primers in Seq.
ID No.: 19 and 20 and/or 28 and 30 or a combination thereof or of a
preferably microbial or plant genomic bank using the primers in
Seq. ID No.: 21 and 22; [0219] (p) nucleic acid molecule encoding
an L450 polypeptide which has been isolated with the aid of
monoclonal antibodies against a polypeptide encoded by any of the
nucleic acid molecules according to (a) to (o); [0220] (q) nucleic
acid molecule which is obtainable by screening an appropriate
library under stringent conditions using a probe comprising any of
the sequences according to (a) to (p) or a fragment of at least 15
nt, preferably 20 nt, 30 nt, 50 nt, 100 nt, 200 nt or 500 nt, of
the nucleic acid characterized in (a) to (p) and which encodes an
L450 polypeptide, [0221] (r) nucleic acid molecule encoding a L450
polypeptide comprising the sequence shown in Seq. ID No: 46 or 49,
whereby 20 or less, preferably 15 or 10, of the amino acid
positions indicated can be replaced by an X and/or whereby 20 or
less, preferably 15 or 10, of the amino acid are inserted into the
shown sequence or shown in Seq ID No.: 47, 48, 50 or 51, whereby 10
or less, preferably 7, of the amino acid positions indicated can be
replaced by an X and/or whereby 10 or less, preferably 7, of the
amino acid are inserted into the shown sequence; or the
complementary strand thereof, preferably said polynucleotide or
said nucleic acid molecule according to (a) to (r) not comprising
the sequence depicted in Seq. ID No.: 1, 3, 9, 11, 13, 15, 23, 42
or 44 or the sequence complementary thereto, where appropriate the
one depicted in Seq. ID No. 24. In one embodiment, a polypeptide be
also not encoded which consists of, preferably comprises the
sequence depicted in Seq. 2, 4, 10, 12, 14, 16, 43 or 45, where
appropriate also Seq. ID No. 25, or which is encoded by the
sequence depicted in Seq. ID No. 23 or the sequence complementary
thereto.
[0222] According to the invention, the polynucleotide may be DNA or
RNA.
[0223] In principle, any nucleic acids coding for polypeptides with
L450 activity may be used in the method of the invention.
Advantageously, said nucleic acids are from plants such as algae,
mosses or higher plants.
[0224] In the method of the invention, a nucleic acid sequence is
advantageously selected from the group consisting of the sequence
depicted in table 7 or the above-described derivatives or homologs
thereof coding for polypeptides which still have an L450 biological
activity. These sequences are cloned individually or in
combination, including with other genes, into expression
constructs.
[0225] Nucleic acid sequences of a particular donor organism, which
code for polypeptides with L450 activity, are usually generally
accessible. Particular mention must be made here of general gene
databases such as the EMBL database (Stoesser G. et al., Nucleic
Acids Res. 2001, Vol. 29, 17-21), the GenBank database (Benson D.
A. et al., Nucleic Acids Res. 2000, Vol. 28, 15-18), or the PIR
database (Barker W. C. et al., Nucleic Acids Res. 1999, Vol. 27,
39-43). It is furthermore possible to use organism-specific gene
databases such as, for example, advantageously the SGD database
(Cherry J. M. et al., Nucleic Acids Res. 1998, Vol. 26, 73-80) or
the MIPS database (Mewes H. W. et al., Nucleic Acids Res. 1999,
Vol. 27, 44-48) for yeast, the GenProtEC database
(http://web.bham.ac.uk/bcm4ght6/res.html) for E. coli, and the TAIR
database (Huala, E. et al., Nucleic Acids Res. 2001 Vol. 29(1),
102-5) or the MIPS database for Arabidopsis.
[0226] Advantageously, L450 used in the method of the invention and
the nonhuman organism employed are from the same origin or from an
origin which is genetically as close as possible, for example from
the same or a very closely related type or species. However, a
synthetic L450 may also be used in a nonhuman organism.
[0227] The term "gene" means in accordance with the invention a
nucleic acid sequence which comprises a codogenic gene section and
regulatory elements. "Codogenic gene sections" mean in accordance
with the invention a continuous nucleic acid sequence ("open
reading frame, abbreviated ORF). Said ORF may contain no, one or
more introns which are linked via suitable splice sites to the
exons present in the ORF. An ORF and its regulatory elements
encode, for example, structural genes which are translated into
enzymes, transporters, ion channels, etc., for example, or
non-structural genes such as regulatory genes such as the Rho or
Sigma protein, for example. However, genes may also be encoded
which are not translated into proteins. For expression in a
nonhuman organism, a codogenic gene section is expressed together
with particular regulatory elements such as promoter, terminator,
UTR, etc., for example. The regulatory elements may be of
homologous or heterologous origin. Gene, codogenic gene section
(ORFs), regulatory sequence are covered by the terms nucleic acid
and polynucleotide hereinbelow.
[0228] The term "expression" means transcription and/or translation
of a codogenic gene section or gene. The resulting product is
usually an mRNA or a protein. However, expressed products also
include RNAs such as, for example, regulatory RNAs or ribozymes.
Expression may be systemic or local, for example restricted to
particular cell types, tissues or organs. Expression includes
processes in the area of transcription which relate especially to
transcription of rRNA, tRNA and mRNA, to RNA transport and to
processing of the transcript. In the area of protein biosynthesis,
especially ribosome biogenesis, translation, translational control
and aminoacyl-tRNA synthetases are included. Functions in the area
of protein processing relate especially to folding and stabilizing,
to targeting, sorting and translocation and to protein
modification, assembly of protein complexes and proteolytic
degradation of proteins.
[0229] The expression products of the codogenic gene sections
(ORFs) and of their regulatory elements can be characterized by
their function. Examples of these functions are those in the areas
metabolism, energy, transcription, protein synthesis, protein
processing, cellular transport and transport mechanisms, cellular
communication and signal transduction, cell rescue, cellular
defense and cell virulence, regulation of the cellular environment
and interaction of the cell with its environment, cell fate,
transposable elements, viral proteins and plasmid proteins, control
of cellular organization, subcellular location, regulation of
protein activity, proteins with binding function or cofactor
requirement and facilitated transport. Genes with identical
functions are grouped together in "functional gene families".
According to the invention, expression of L450 results in an
increased growth rate.
[0230] A polynucleotide usually includes an untranslated sequence,
located at the 3' and 5' ends of the coding gene region, for
expression: for example, from 500 to 100 nucleotides of the
sequence upstream of the 5' end of the coding region and/or, for
example, from 200 to 20 nucleotides of the sequence downstream of
the 3' end of the coding gene region. An "isolated" nucleic acid
molecule is removed from other nucleic acid molecules present in
the natural source of the nucleic acid. An "isolated" nucleic acid
preferably has no sequences which naturally flank the nucleic acid
in the genomic DNA of the organism from which said nucleic acid
originates (e.g. sequences located at the 5' and 3' ends of said
nucleic acid). In various embodiments, the isolated L450 nucleic
acid molecule may contain, for example, 5 kb, 4 kb, 3 kb, 2 kb, 1
kb, 0.5 kb, 0.1 kb or 0 kb of nucleotide sequences which naturally
flank the nucleic acid molecule in the genomic DNA of the cell from
which the nucleic acid originates.
[0231] The nucleic acid molecules used in the present method, for
example a nucleic acid molecule having a nucleotide sequence of the
nucleic acid molecules used in the method of the invention or of a
part thereof, may be isolated using molecular-biological standard
techniques and the sequence information provided herein. It is also
possible to identify, for example, a homologous sequence or
homologous, conserved sequence regions at the DNA or amino acid
level with the aid of comparative algorithms. These sequence
regions may be used as hybridization probes by means of standard
hybridization techniques, as described, for example, in Sambrook,
Molecular Cloning: A Laboratory Manual, Cold Spring Harbor
Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, N.Y., 1989, to isolate further nucleic acid sequences
useful in the method. In addition, a nucleic acid molecule
comprising a complete sequence of SEQ. ID NO: 1, 3, 5, 7, 9, 11,
13, 15, 24 26, 34, 36, 38, 40, 42, 44 or 52 or of the other nucleic
acid molecules used in the method of the invention or a part
thereof can be isolated by polymerase chain reaction (PCR) and
prepared according to known methods. It is possible to amplify a
nucleic acid of the invention according to standard PCR
amplification techniques using cDNA prepared by means of reverse
transcription or, alternatively, genomic DNA as template and
suitable oligonucleotide primers. The nucleic acid amplified in
this way may be cloned into a suitable vector and characterized by
means of DNA sequence analysis.
[0232] Examples of homologs of the nucleic acid molecules used in
the method of the invention are allelic variants which are at least
30%, preferably 40%, more preferably 50%, 60%, 70%, 80% or 90% and
even more preferably 95%, 96%, 97%, 98%, 99% or more, identical to
any of the nucleotide sequences depicted in SEQ. ID NO: 1, 3, 5, 7,
9, 11, 13, 15, 24, 26, 34, 36, 38, 40, 42, 44 or 52. Allelic
variants include in particular functional variants which can be
obtained by deletion, insertion or substitution of nucleotides
from/into/in the sequence depicted in SEQ. ID NO: 1, 3, 5, 7, 9,
11, 13, 15, 24 26, 34, 36, 38, 40, 42, 44 or 52, but with the idea
of retaining or increasing the L450 activity of the synthesized
proteins derived therefrom. Proteins which still possess the
biological or enzymic activity of L450 also include those whose
activity is essentially not reduced, i.e. proteins having 5%,
preferably 20%, particularly preferably 30%, very particularly
preferably 40% or more of the original biological activity,
compared to the protein encoded by SEQ. ID NO: 1, 3, 5, 7, 9, 11,
13, 15, 24, 26, 34, 36, 38, 40, 42, 44 or 52. Preferably, however,
the homologous activity is increased compared to heterologous
expression of L450 in the particular nonhuman organism.
[0233] Homologs of SEQ. ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 24, 26,
34, 36, 38, 40, 42, 44 or 52 of the nucleic acid molecules used in
the method of the invention also mean, for example, prokaryotic or
eukaryotic, i.e. for example bacterial, animal, fungal and plant
homologs, truncated sequences, single-stranded DNA or RNA of the
coding and noncoding DNA sequence.
[0234] Homologs of SEQ. ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 24, 26,
34, 36, 38, 40, 42, 44 or 52 of the nucleic acid molecules used in
the method of the invention also include derivatives such as, for
example, variants of the coding sequence or of the regulatory
sequences, such as, for example, promoter, UTR, enhancer, splice
signals, processing signals, polyadenylation signals, etc. The
derivatives of the nucleotide sequences indicated may be modified
by one or more nucleotide substitutions, by insertion(s) and/or
deletion(s), without disturbing functionality or activity, however.
It is furthermore possible that the activity of the derivatives is
increased by modification of their sequence or that said
derivatives are completely replaced with more active elements, even
those from heterologous organisms.
[0235] In order to determine the percentage homology (=identity) of
two amino acid sequences (e.g. any of the sequences of SEQ. ID NO:
2, 4, 6, 8, 10, 12, 14, 16, 25, 27, 35, 37, 39, 41, 43, 45, 46, 47,
48, 49, 50, 51 or 53 or of two nucleic acids (e.g. any of the
sequences of SEQ. ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 24 26, 34, 36,
38, 40, 42, 44 or 52), the sequences are compared to one another,
for example by aligning said sequences or by analyzing both
sequences with the aid of computer programs. Gaps may be introduced
in the sequence of one protein or one nucleic acid to produce
optimal alignment with the other protein or the other nucleic acid.
The amino acid residues or nucleotides at the corresponding amino
acid positions or nucleotide positions are then compared. When a
position in one sequence is occupied by the same amino acid residue
or the same nucleotide as the corresponding position in the other
sequence, then the molecules are identical at this position (i.e.
amino acid or nucleic acid "homology", is used herein, is
equivalent to amino acid or nucleic acid "identity"). The
percentage homology between the two sequences is a function of the
number of identical positions shared by the sequences (i.e. %
homology=number of identical positions/total number of
positions.times.100). The terms homology and identity are thus used
synonymously herein.
[0236] "Identity" between two proteins or nucleic acid sequences
means identity over the entire length, in particular the identity
carried out as described in the examples.
[0237] The NCBI standard settings were used for the blastp
comparison of the amino acid sequences, i.e. using the following
parameters: "composition based statics" and "low complexity filter,
"Expect":10, "Word Size":3, "Matrix": Blosum62 and "Gap cost":
Existence :11 Extension: 1.
[0238] The identity of various amino acid sequences to the amino
acid sequence of Arabidopsis thaliana Accession AB020746 is
indicated below by way of example.
[0239] However, for the determination of the percentage homology
(=identity) of two or more amino acids or of two or more nucleotide
sequences several other computer software programs have been
developed. The homology of two or more sequences can be calculated
with for example the software fasta, which presently has been used
in the version fasta 3 (W. R. Pearson and D. J. Lipman (1988),
Improved Tools for Biological Sequence Comparison. PNAS
85:2444-2448; W. R. Pearson (1990) Rapid and Sensitive Sequence
Comparison with FASTP and FASTA, Methods in Enzymology 183:63-98;
W. R. Pearson and D. J. Lipman (1988) Improved Tools for Biological
Sequence Comparison. PNAS 85:2444-2448; W. R. Pearson (1990); Rapid
and Sensitive Sequence Comparison with FASTP and FASTAMethods in
Enzymology 183:63-98). Another useful program for the calculation
of homologies of different sequences is the standard blast program,
which is included in the Biomax pedant software (Biomax, Munich,
Federal Republic of Germany). This leads unfortunately sometimes to
suboptimal results since blast does not always include complete
sequences of the subject and the query. Nevertheless as this
program is very efficient it can be used for the comparison of a
huge number of sequences. The following settings are typically used
for such a comparisons of sequences:
-p Program Name [String]; -d Database [String]; default=nr; -i
Query File [File In]; default=stdin; -e Expectation value (E)
[Real]; default=10.0; -m alignment view options: 0=pairwise;
1=query-anchored showing identities; 2=query-anchored no
identities; 3=flat query-anchored, show identities; 4=flat
query-anchored, no identities; 5=query-anchored no identities and
blunt ends; 6=flat query-anchored, no identities and blunt ends;
7=XML Blast output; 8=tabular; 9 tabular with comment lines
[Integer]; default=0; -o BLAST report Output File [File Out]
Optional; default=stdout; -F Filter query sequence (DUST with
blastn, SEG with others) [String]; default=T; -G Cost to open a gap
(zero invokes default behavior) [Integer]; default=0; -E Cost to
extend a gap (zero invokes default behavior) [Integer]; default=0;
-X X dropoff value for gapped alignment (in bits) (zero invokes
default behavior); blastn 30, megablast 20, tblastx 0, all others
15 [Integer]; default=0; -I Show GI's in deflines [T/F]; default=F;
-q Penalty for a nucleotide mismatch (blastn only) [Integer];
default=-3; -r Reward for a nucleotide match (blastn only)
[Integer]; default=1; -v Number of database sequences to show
one-line descriptions for (V) [Integer]; default=500; -b Number of
database sequence to show alignments for (B) [Integer];
default=250; -f Threshold for extending hits, default if zero;
blastp 11, blastn 0, blastx 12, tblastn 13; tblastx 13, megablast 0
[Integer]; default=0; -g Perfom gapped alignment (not available
with tblastx) [T/F]; default=T; -Q Query Genetic code to use
[Integer]; default=1; -D DB Genetic code (for tblast[nx] only)
[Integer]; default=1; -a Number of processors to use [Integer];
default=1; -O SeqAlign file [File Out] Optional; -J Believe the
query defline [T/F]; default=F; -M Matrix [String];
default=BLOSUM62; -W Word size, default if zero (blastn 11,
megablast 28, all others 3) [Integer]; default=0; -z Effective
length of the database (use zero for the real size) [Real];
default=0; -K Number of best hits from a region to keep (off by
default, if used a value of 100 is recommended) [Integer];
default=0; -P 0 for multiple hit, 1 for single hit [Integer];
default=0; -Y Effective length of the search space (use zero for
the real size) [Real]; default=0; -S Query strands to search
against database (for blast[nx], and tblastx); 3 is both, 1 is top,
2 is bottom [Integer]; default=3; -T Produce HTML output [T/F];
default=F; -I Restrict search of database to list of GI's [String]
Optional; -U Use lower case filtering of FASTA sequence [T/F]
Optional; default=F; -y X dropoff value for ungapped extensions in
bits (0.0 invokes default behavior); blastn 20, megablast 10, all
others 7 [Real]; default=0.0; -Z X dropoff value for final gapped
alignment in bits (0.0 invokes default behavior); blastn/megablast
50, tblastx 0, all others 25 [Integer]; default=0; -R PSI-TBLASTN
checkpoint file [File In] Optional; -n MegaBlast search [T/F];
default=F; -L Location on query sequence [String] Optional; -A
Multiple Hits window size, default if zero (blastn/megablast 0, all
others 40 [Integer]; default=0; -w Frame shift penalty (OOF
algorithm for blastx) [Integer]; default=0; -t Length of the
largest intron allowed in tblastn for linking HSPs (0 disables
linking) [Integer]; default=0.
[0240] Results of high quality are reached by using the algorithm
of Needleman and Wunsch or Smith and Waterman. Therefore programs
based on said algorithms are preferred. Advantageously the
comparisons of sequences can be done with the program PileUp (J.
Mol. Evolution., 25, 351-360, 1987, Higgins et al., CABIOS, 5 1989:
151-153) or preferably with the programs Gap and BestFit, which are
respectively based on the algorithms of Needleman and Wunsch [J.
Mol. Biol. 48; 443-453 (1970)] and Smith and Waterman [Adv. Appl.
Math. 2; 482-489 (1981)]. Both programs are part of the GCG
software-package [Genetics Computer Group, 575 Science Drive,
Madison, Wis., USA 53711 (1991); Altschul et al. (1997) Nucleic
Acids Res. 25:3389 et seq.]. Therefore preferably
the calculations to determine the percentages of sequence homology
are done with the program Gap over the whole range of the
sequences. The following standard adjustments for the comparison of
nucleic acid sequences can be used: gap weight: 50, length weight:
3, average match: 10.000, average mismatch: 0.000.
[0241] Nucleic acid molecules advantageous to the method of the
invention may be isolated on the basis of their homology to the
nucleic acids disclosed herein and used in the method of the
invention by using the sequences or a part thereof as hybridization
probe according to standard hybridization techniques under
stringent hybridization conditions, as described also, for example,
in US 2002/0023281, which is hereby expressly incorporated by
reference. It is possible here to use, for example, isolated
nucleic acid molecules which are at least 10, preferably at least
15, nucleotides in length and hybridize under stringent conditions
with the nucleic acid molecules which comprise a nucleotide
sequence of SEQ. ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 24 26, 34, 36,
38, 40, 42, 44 or 52. The term "hybridizes under preferably
stringent conditions", as used herein, is intended to describe
hybridization and washing conditions under which nucleotide
sequences, which are at least 20% identical to one another
hybridize with one another. The term "hybridizes under stringed
conditions", as used herein, is intended to describe hybridization
and washing conditions under which nucleotide sequences which are
30%, but preferably 50% or more, identical to one another hybridize
with one another. Preferably, the conditions are such that
sequences which are 60%, more preferably 75% and even more
preferably at least approximately 85% or more, identical to one
another usually remain hybridized to one another. The identity of
two polynucleic acids or amino acids may be determined as described
herein. These stringent conditions are known to the skilled worker
and can be found in Current Protocols in Molecular Biology, John
Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6., or in Sambrook,
Molecular Cloning: A Laboratory Manual, Cold Spring Harbor
Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, N.Y., 1989. A preferred, nonlimiting example of stringent
hybridization conditions is hybridizations in 6.times. sodium
chloride/sodium citrate (SSC) at about 45.degree. C., followed by
one or more washing steps in 0.2.times.SSC, 0.1% SDS at from 50 to
65.degree. C. It is known to the skilled worker that these
hybridization conditions differ depending on the type of nucleic
acids, in particular according to the AT or GC content, or on the
presence of organic solvents, with respect to temperature, duration
of washing and salt concentration of the hybridization solutions
and the washing solution. Under "standard hybridization
conditions", for example, the temperature differs between
42.degree. C. and 58.degree. C. in aqueous buffer with a
concentration of from 0.1 to 5.times.SSC (pH 7.2), depending on the
type of nucleic acid. If an organic solvent is present in the
above-mentioned buffer, for example 50% formamide, the temperature
under standard conditions is about 42.degree. C. The hybridization
conditions for DNA:DNA hybrids, for example, are 0.1.times.SSC and
20.degree. C. to 45.degree. C., preferably between 30.degree. C.
and 45.degree. C. The hybridization conditions for DNA:RNA hybrids,
for example, are preferably 0.1.times.SSC and from 30.degree. C. to
55.degree. C., preferably between 45.degree. C. and 55.degree. C.
The hybridization temperatures mentioned above are determined, for
example, for a nucleic acid of about 100 by (=base pairs) in length
and with a G+C content of 50% in the absence of formamide. The
skilled worker knows how to determine the required hybridization
conditions on the basis of textbooks such as the one mentioned
above or the following textbooks: Sambrook, "Molecular Cloning",
Cold Spring Harbor Laboratory, 1989; Hames and Higgins (eds.) 1985,
"Nucleic Acids Hybridization: A Practical Approach", IRL Press at
Oxford University Press, Oxford; Brown (eds.) 1991, "Essential
Molecular Biology: A Practical Approach", IRL Press at Oxford
University Press, Oxford or "Current Protocols in Molecular
Biology", John Wiley & Sons, N.Y. (1989).
[0242] Some examples of conditions for DNA hybridization (Southern
blot assays) and wash step are shown hereinbelow: [0243] (1)
Hybridization conditions can be selected, for example, from the
following conditions: [0244] a) 4.times.SSC at 65.degree. C.,
[0245] b) 6.times.SSC at 45.degree. C., [0246] c) 6.times.SSC, 100
mg/ml denatured fragmented fish sperm DNA at 68.degree. C., [0247]
d) 6.times.SSC, 0.5% SDS, 100 mg/ml denatured salmon sperm DNA at
68.degree. C., [0248] e) 6.times.SSC, 0.5% SDS, 100 mg/ml denatured
fragmented salmon sperm DNA, 50% formamide at 42.degree. C., [0249]
f) 50% formamide, 4.times.SSC at 42.degree. C., [0250] g) 50%
(vol/vol) formamide, 0.1% bovine serum albumin, 0.1% Ficoll, 0.1%
polyvinylpyrrolidone, 50 mM sodium phosphate buffer pH 6.5, 750 mM
NaCl, 75 mM sodium citrate at 42.degree. C., [0251] h) 2.times. or
4.times.SSC at 50.degree. C. (low-stringency condition), or [0252]
i) 30 to 40% formamide, 2.times. or 4.times.SSC at 42.degree. C.
(low-stringency condition). [0253] (2) Wash steps can be selected,
for example, from the following conditions: [0254] a) 0.015 M
NaCl/0.0015 M sodium citrate/0.1% SDS at 50.degree. C. [0255] b)
0.1.times.SSC at 65.degree. C. [0256] c) 0.1.times.SSC, 0.5% SDS at
68.degree. C. [0257] d) 0.1.times.SSC, 0.5% SDS, 50% formamide at
42.degree. C. [0258] e) 0.2.times.SSC, 0.1% SDS at 42.degree. C.
[0259] f) 2.times.SSC at 65.degree. C. (low-stringency
condition).
[0260] Furthermore, it is possible to identify, by comparing
protein sequences of L450 genes or proteins of various organisms,
conserved regions from which then in turn degenerated primers can
be derived. These degenerated primers may then be used further by
means of PCR for amplification of fragments of new L450 genes from
other organisms. These fragments may then be used as hybridization
probes for isolating the complete gene sequence. Alternatively, the
missing 5' and 3' sequences may be isolated by means of RACE-PCR.
In this respect, reference is expressly made to the disclosures in
US 2002/0023281 and to the abovementioned literature on
molecular-biological methods, in particular Sambrook, "Molecular
Cloning" and "Current Protocols in Molecular Biology", John Wiley
& Sons.
[0261] An isolated nucleic acid molecule coding for a protein used
in the method of the invention, in particular L450, which protein
is homologous in particular to a protein sequence of SEQ. ID NO: 2,
4, 6, 8, 10, 12, 14, 16, 25, 27, 35, 37, 39, 41, 43, 45, 46, 47,
48, 49, 50, 51 or 53, may be generated, for example, by introducing
one or more nucleotide substitutions, additions or deletions into a
nucleotide sequence of SEQ. ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 24,
26, 34, 36, 38, 40, 42, 44 or 52 so that one or more amino acid
substitutions, additions or deletions are introduced into the
encoded protein. Mutations may be introduced in any of the
sequences of the nucleic acid molecules used in the method of the
invention by means of standard techniques such as site-specific
mutagenesis and PCR-mediated mutagenesis. Preference is given to
generating conservative amino acid substitutions on one or more of
the predicted nonessential amino acid residues. In a "conservative
amino acid substitution", the amino acid residue is replaced by an
amino acid residue having a similar side chain. Families of amino
acid residues with similar side chains have been defined in the
art. These families comprise amino acids with basic side chains
(e.g. lysine, arginine, histidine), acidic side chains (e.g.
aspartic acid, glutamic acid), uncharged polar side chains (e.g.
glycine, asparagine, glutamine, serine, threonine, tyrosine,
cysteine), nonpolar side chains (e.g. alanine, valine, leucine,
isoleucine, proline, phenylalanine, methionine, tryptophan),
beta-branched side chains (e.g. threonine, valine, isoleucine) and
aromatic side chains (e.g. tyrosine, phenylalanine, tryptophan,
histidine). A predicted nonessential amino acid residue is thus
preferably replaced by another amino acid residue from the same
side chain family. Preference is given to carrying out
"conservative" substitutions in which the replaced amino acid has a
property similar to that of the original amino acid, for example a
substitution of Asp for Glu, Asn for Gln, Ile for Val, Ile for Leu,
Thr for Ser.
[0262] In another embodiment, the mutations may alternatively be
introduced randomly across all or part of the coding sequence, for
example by saturation mutagenesis, and the resulting mutants may be
screened for the L450 activity described herein in order to
identify mutants which lead, for example, to plants with an
increased growth rate, preferably faster growth and/or higher
yield. After mutagenesis, the encoded protein may be recombinantly
expressed, and the activity of said protein may be determined using
the assays described herein, for example.
[0263] The nucleic acid molecules used in the method of the
invention code for proteins or parts thereof. Said proteins or the
individual protein or parts thereof preferably comprises one of the
consensus sequences or core consensus sequences shown above, e.g.
an amino acid sequence as shown in FIG. 7 or 8 SEQ ID No.:46, 47,
48, 49, 50 or 51, whereby 20 or less, preferably 15 or 10,
preferably 9, 8, 7, or 6, more preferred 5 or 4, even more
preferred 3, even more preferred 2, even more preferred 1, most
preferred 0 of the amino acids positions indicated by a capital or
lower letter in FIG. 7 or 8 can be replaced by an x and/or not more
than 5, preferably 4, even more preferred 3 or 2, most preferred
one or non amino acid position indicated by a capital letter in
FIG. 7 or 8 are/is replaced by an x and/or 20 or less, preferably
15 or 10, preferably 9, 8, 7, or 6, more preferred 5 or 4, even
more preferred 3, even more preferred 2, even more preferred 1,
most preferred 0 amino acids are inserted into the consensus
sequence or, which is sufficiently homologous to an amino acid
sequence of the sequence SEQ. ID NO: 2, 4, 6, 8, 10, 12, 14, 16,
25, 27, 35, 37, 39, 41, 43, 45, 46, 47, 48, 49, 50, 51 or 53, so
that said protein or said part thereof retains L450 activity. In
one embodiment, the said proteins or the individual protein or
parts thereof preferably are encoded by a nucleic acid molecule
encoding a L450 polypeptide comprising the sequence shown in Seq.
ID No: 46 or 49, whereby 20 or less, preferably 15 or 10, of the
amino acid positions indicated can be replaced by an X and/or
whereby 20 or less, preferably 15 or 10, of the amino acid are
inserted into the shown sequence or shown in Seq ID No.: 47, 48, 50
or 51, whereby 10 or less, preferably 7, of the amino acid
positions indicated can be replaced by an X and/or whereby 10 or
less, preferably 7, of the amino acid are inserted into the shown
sequence. Preferably, the nucleic acid molecule-encoded protein or
part thereof has its essential biological activity which causes,
inter alia, the target organism, preferably the target plant, to
exhibit a higher growth rate or faster growth and thus higher
biomass production and an increased yield. Conserved regions of a
protein may be determined by sequence comparisons of various
homologs or derivatives of a protein or of various members of a
protein family. Moreover, computer programs which predict the
structure of a protein, owing to its sequence and other properties,
are known to the skilled worker. Antibody binding studies and
studies on the sensitivity or hypersensitivity of protein domains
with regard to protease digestion may likewise be used to study the
structure of a polypeptide or its location in a particular
environment, for example in a cell. Further methods of this kind
for characterizing L450 are known to the skilled worker and are
disclosed in the literature described herein, for example also in
US 2002/0023281.
[0264] Preferably, the used part of a protein or a domain is highly
conserved among the sequences described herein, for example among
the plant sequences, or animal sequences, preferably among all
sequences.
[0265] Advantageously, the protein encoded by the nucleic acid
molecules is at least 20%, preferably 40% and more preferably 50%,
60%, 70%, 80% or 90% and most preferably 95%, 96%, 97%, 98%, 99% or
more, homologous to an amino acid sequence of the sequence SEQ. ID
NO: 2, 4, 6, 8, 10, 12, 14, 16, 25 27, 35, 37, 39, 41, 43, 45, 46,
47, 48, 49, 50, 51 or 53. Said protein is preferably a full-length
protein which is essentially in parts homologous to a total amino
acid sequence of SEQ. ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 25 27, 35,
37, 39, 41, 43, 45, 46, 47, 48, 49, 50, 51 or 53 and which is
preferably derived from the open reading frame depicted in SEQ. ID
NO: 1, 3, 5, 7, 9, 11, 13, 15, 24 26, 34, 36, 38, 40, 42, 44 or 52.
However, preferably, the core consensus sequences or the consensus
sequences as described above, e.g. as shown in FIGS. 7 and 8 or
depicted in SEQ ID No.: 46, 47, 48, 49, 50 or 51 are
maintained.
[0266] "Essential biological activity" of the proteins or
polypeptides used means, as discussed above, that said proteins or
polypeptides possess the biological activity of L450. The
"biological activity of L450" means that expression of the
polypeptide in a nonhuman organism results in accelerated growth or
in an increase of the yield by 5% or more, compared to a nonhuman
organism which does not express said polypeptide, or expresses it
to a lesser extent. More preference is given to an acceleration by
10%, even more preference to 20%, most preference to 50%, 100% or
200% or more. A test system for determining the biological activity
of a putative L450, which may be studied, is the phenotype of
expression in Arabidopsis thaliana or, where appropriate, also
(over)expression in the organism from which the putative L450 is
derived.
[0267] The cellular activity or function of L450 and its homologs
is, as described above, not yet known and, consequently, an
in-vitro assay system is likewise not available yet. Presumably,
however, it is possible for the skilled worker to measure a
specific L450 activity of a protein or polypeptide by
(over)expressing said protein or polypeptide in a cell, preferably
in a deficient cell, and comparing it with the phenotype of a
deficient cell. Advantageously, the tolerance of the cell to
abiotic or biotic stress increases. It is possible, for example, to
measure the oxidative state of the cell. Advantageously, the
concentration of reactive oxygen species in particular cells is
modulated. If (over)expression of a putative L450 causes a change
in the oxidative state of the cell, which is similar to that of a
cell, is (over)expressed into one of the sequences according to
Seq. ID No.: 2, 4, 6, 8, 10, 12, 14, 16, 25 27, 35, 37, 39, 41, 43,
45, 46, 47, 48, 49, 50, 51 or 53, then the corresponding
polypeptide has a similar activity, i.e. an L450 activity according
to the invention.
[0268] Proteins which may be used advantageously in the method are
derived from plant organisms such as algae or mosses or,
especially, from higher plants.
[0269] Advantageously, the increased activity of the protein
characterized in the method of the invention in a cell, an organ, a
tissue or a nonhuman organism, in particular in a microorganism,
particularly advantageously in a plant, also results in increased
tolerance to abiotic and biotic stress. The aforementioned nucleic
acids and protein molecules with L450 activity which are possibly
involved in the metabolism of reactive oxygen species are used for
increasing the growth, the yield or the amount produced of biomass,
but preferably also for increasing the tolerance of an organ, a
tissue or a nonhuman organism, in particular of a microorganism,
particularly advantageously in a plant, to abiotic or biotic
stress.
[0270] Consequently, one embodiment of the method of the invention
comprises introducing a polynucleotide into a nonhuman organism, in
particular a plant, a useful animal or a microorganism, or one or
more parts thereof, which polynucleotide codes for an L450
polypeptide. The polynucleotide preferably comprises a
polynucleotide characterized herein, in particular a polynucleotide
encoding a protein with the sequence according to Seq. ID No.: 2,
4, 6, 8, 10, 12, 14, 16, 25 27, 35, 37, 39, 41, 43, 45, 46, 47, 48,
49, 50, 51 or 53 or encoding a polypeptide encoded by a nucleic
acid molecule characterized herein, in particular according to SEQ.
ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 24 26, 34, 36, 38, 40, 42, 44 or
52 or comprising any of these sequences so that a transgenic plant
with faster growth, higher yield and/or higher tolerance to stress
is obtained. Preference is given to a plant expressing any of the
plant sequences mentioned herein or their plant homologs, to
animals expressing the animal sequences mentioned herein or their
animal homologs and to microorganisms expressing the microbial
sequences mentioned herein or their microbial homologs. As
mentioned, however, yeast L450 also exhibits L450 activity in
plants.
[0271] In one embodiment, the present invention relates to a
polypeptide encoded by the nucleic acid molecule according to the
present invention, preferably conferring above-mentioned
activity.
[0272] The present invention also relates to a method for the
production of a polypeptide according to the present invention, the
polypeptide being expressed in a host cell according to the
invention, preferably in a transgenic microorganism or a transgenic
plant cell.
[0273] In one embodiment, the nucleic acid molecule used in the
method for the production of the polypeptide is derived from a
microorganism, with an eukaryotic organism as host cell. In one
embodiment the polypeptide is produced in a plant cell or plant
with a nucleic acid molecule derived from a prokaryote or a fungus
or an alga or an other microorganisms but not from plant.
[0274] The skilled worker knows that protein and DNA expressed in
different organisms differ in many respects and properties, e.g.
methylation, degradation and post-translational modification as for
example glucosylation, phosphorylation, acetylation,
myristoylation, ADP-ribosylation, farnesylation, carboxylation,
sulfation, ubiquination, etc. though having the same coding
sequence. Preferably, the cellular expression control of the
corresponding protein differs accordingly in the control mechanisms
controlling the activity and expression of an endogenous protein or
another eukaryotic protein
[0275] The polypeptide of the present invention is preferably
produced by recombinant DNA techniques. For example, a nucleic acid
molecule encoding the protein is cloned into an vector (as
described above), the vector is introduced into a host cell (as
described above) and said polypeptide is expressed in the host
cell. Said polypeptide can then be isolated from the cells by an
appropriate purification scheme using standard protein purification
techniques. Alternative to recombinant expression, the polypeptide
or peptide of the present invention can be synthesized chemically
using standard peptide synthesis techniques. Moreover, native
polypeptide can be isolated from cells (e.g., endothelial cells),
for example using the antibody of the present invention as
described, which can be produced by standard techniques utilizing
the polypeptide of the present invention or fragment thereof, i.e.,
the polypeptide of this invention.
[0276] In one embodiment, the present invention relates to a L450
protein. In one embodiment, the present invention relates to a
polypeptide comprising or consisting of a polypeptide sequence
shown in SEQ ID No: 2, 4, 6, 8, 10, 12, 14, 16, 25, 27, 35, 39, 41,
43, 45, 46, 47, 48, 49, 50, 51 or 53, or a homolog thereof of 50%,
70%, 80%, 85%, 90%, 95%, 97%, 99% or 99.5% or more but not being,
preferably not consisting of the sequence shown in SEQ ID No.: 2,
4, 10, 12, 14, 16, 43 or 46.
[0277] In one embodiment, the protein of the present invention does
not comprise the sequence shown in Seq ID NO.: 2, 4, 10, 12, 14,
16, 43 or 46.
[0278] In one embodiment, the present invention relates to a
polypeptide having the amino acid sequence encoded by a nucleic
acid molecule of the invention or obtainable by a method of the
invention. Said polypeptide confers preferably the aforementioned
activity, in particular, the polypeptide confers the increase of
the yield or growth as described herein in a cell or an organism or
a part thereof after increasing the cellular activity, e.g. by
increasing the expression or the specific activity of the
polypeptide. In one embodiment, said polypeptide distinguishes over
the sequence depicted in SEQ ID No: 2, 4, 10, 12, 14, 16, 43 or 45
by one or more amino acids. In an other embodiment, said
polypeptide of the invention does not consist of the sequence shown
in SEQ ID NO: 2, 4, 10, 12, 14, 16, 43 or 45. In one embodiment,
said polypeptide does not consist of the sequence encoded by the
nucleic acid molecules shown in SEQ ID NO: 1, 3, 9, 11, 13, 15, 29,
42 or 44. In one embodiment, the polypeptide of the invention
originates from an non-plant cell, in particular from a
microorganism, and was expressed in a plant cell
[0279] The terms "protein" and "polypeptide" used in this
application are interchangeable. "Polypeptide" refers to a polymer
of amino acids (amino acid sequence) and does not refer to a
specific length of the molecule. Thus peptides and oligopeptides
are included within the definition of polypeptide. This term does
also refer to or include post-translational modifications of the
polypeptide, for example, glycosylations, acetylations,
phosphorylations and the like. Included within the definition are,
for example, polypeptides containing one or more analogs of an
amino acid (including, for example, unnatural amino acids, etc.),
polypeptides with substituted linkages, as well as other
modifications known in the art, both naturally occurring and
non-naturally occurring.
[0280] Preferably, the polypeptide is isolated. An "isolated" or
"purified" protein or polynucleotide or biologically active portion
thereof is substantially free of cellular material when produced by
recombinant DNA techniques or chemical precursors or other
chemicals when chemically synthesized.
[0281] The language "substantially free of cellular material"
includes preparations of the polypeptide of the invention in which
the protein is separated from cellular components of the cells in
which it is naturally or recombinantly produced. In one embodiment,
the language "substantially free of cellular material" includes
preparations having less than about 30% (by dry weight) of
"contaminating protein", more preferably less than about 20% of
"contaminating protein", still more preferably less than about 10%
of "contaminating protein", and most preferably less than about 5%
"contaminating protein". The term "Contaminating protein" relates
to polypeptides, which are not polypeptides of the present
invention. When the polypeptide of the present invention or
biologically active portion thereof is recombinantly produced, it
is also preferably substantially free of culture medium, i.e.,
culture medium represents less than about 20%, more preferably less
than about 10%, and most preferably less than about 5% of the
volume of the protein preparation. The language "substantially free
of chemical precursors or other chemicals" includes preparations in
which the polypeptide or of the present invention is separated from
chemical precursors or other chemicals which are involved in the
synthesis of the protein.
[0282] A polypeptide of the invention can participate in the method
of the present invention.
[0283] Further, the polypeptide can have an amino acid sequence
which is encoded by a nucleotide sequence which hybridizes,
preferably hybridizes under stringent conditions as described
above, to a nucleotide sequence of the polynucleotide of the
present invention. Accordingly, the polypeptide has an amino acid
sequence which is encoded by a nucleotide sequence that is at least
about 35%, 50%, or 60% preferably at least about 70%, more
preferably at least about 80%, 90%, 95%, and even more preferably
at least about 96%, 97%, 98%, 99% or more homologous to one of the
amino acid sequences of the polypeptide of the invention and shown
herein. The preferred polypeptide of the present invention
preferably possesses at least one of the activities according to
the invention and described herein. A preferred polypeptide of the
present invention includes an amino acid sequence encoded by a
nucleotide sequence which hybridizes, preferably hybridizes under
stringent conditions, as defined above.
[0284] The invention also provides chimeric or fusion proteins.
[0285] As used herein, an "chimeric protein" or "fusion protein"
comprises an polypeptide operatively linked to a polypeptide which
does not confer above-mentioned activity
[0286] Within the fusion protein, the term "operatively linked" is
intended to indicate that the polypeptide of the invention and a
non-invention polypeptide are fused to each other so that both
sequences fulfil the proposed function addicted to the sequence
used. The non-invention polypeptide can be fused to the N-terminus
or C-terminus of the polypeptide of the invention. For example, in
one embodiment the fusion protein is a GST-LMRP fusion protein in
which the sequences of the polypeptide of the invention are fused
to the C-terminus of the GST sequences. Such fusion proteins can
facilitate the purification of recombinant polypeptides of the
invention.
[0287] In another embodiment, the fusion protein is a polypeptide
of the invention containing a heterologous signal sequence at its
N-terminus. In certain host cells (e.g., mammalian host cells),
expression and/or secretion can be increased through use of a
heterologous signal sequence. Targeting sequences, are required for
targeting the gene product into specific cell compartment (for a
review, see Kermode, Crit. Rev. Plant Sci. 15, 4 (1996) 285-423 and
references cited therein), for example into the vacuole, the
nucleus, all types of plastids, such as amyloplasts, chloroplasts,
chromoplasts, the extracellular space, the mitochondria, the
endoplasmic reticulum, elaioplasts, peroxisomes, glycosomes, and
other compartments of cells or extracellular. Sequences, which must
be mentioned in this context are, in particular, the
signal-peptide- or transit-peptide-encoding sequences which are
known per se. For example, plastid-transit-peptide-encoding
sequences enable the targeting of the expression product into the
plastids of a plant cellTargeting sequences are also known for
eukaryotic and to a lower extent for prokaryotic organisms and can
advantageously be operable linked with the nucleic acid molecule of
the present invention to achieve an expression in one of said
compartments or extracellular.
[0288] Preferably, an chimeric or fusion protein of the invention
is produced by standard recombinant DNA techniques. For example,
DNA fragments coding for the different polypeptide sequences are
ligated together in-frame in accordance with conventional
techniques, for example by employing blunt-ended or stagger-ended
termini for ligation, restriction enzyme digestion to provide for
appropriate termini, filling-in of cohesive ends as appropriate,
alkaline phosphatase treatment to avoid undesirable joining, and
enzymatic ligation. The fusion gene can be synthesized by
conventional techniques including automated DNA synthesizers.
Alternatively, PCR amplification of gene fragments can be carried
out using anchor primers, which give rise to complementary
overhangs between two consecutive gene fragments which can
subsequently be annealed and reamplified to generate a chimeric
gene sequence (see, for example, Current Protocols in Molecular
Biology, eds. Ausubel et al. John Wiley & Sons: 1992).
Moreover, many expression vectors are commercially available that
already encode a fusion moiety (e.g., a GST polypeptide). The
polynucleotide of the invention can be cloned into such an
expression vector such that the fusion moiety is linked in-frame to
the encoded protein.
[0289] Furthermore, folding simulations and computer redesign of
structural motifs of the protein of the invention can be performed
using appropriate computer programs (Olszewski, Proteins 25 (1996),
286-299; Hoffman, Comput. Appl. Biosci. 11 (1995), 675-679).
Computer modeling of protein folding can be used for the
conformational and energetic analysis of detailed peptide and
protein models (Monge, J. Mol. Biol. 247 (1995), 995-1012; Renouf,
Adv. Exp. Med. Biol. 376 (1995), 37-45). The appropriate programs
can be used for the identification of interactive sites the
polypeptide of the invention and its substrates or binding factors
or other interacting proteins by computer assistant searches for
complementary peptide sequences (Fassina, Immunomethods (1994),
114-120). Further appropriate computer systems for the design of
protein and peptides are described in the prior art, for example in
Berry, Biochem. Soc. Trans. 22 (1994), 1033-1036; Wodak, Ann. N.Y.
Acad. Sci. 501 (1987), 1-13; Pabo, Biochemistry 25 (1986),
5987-5991. The results obtained from the above-described computer
analysis can be used for, e.g., the preparation of peptidomimetics
of the protein of the invention or fragments thereof. Such
pseudopeptide analogues of the, natural amino acid sequence of the
protein may very efficiently mimic the parent protein (Benkirane,
J. Biol. Chem. 271 (1996), 33218-33224). For example, incorporation
of easily available achiral Q-amino acid residues into a protein of
the invention or a fragment thereof results in the substitution of
amide bonds by polymethylene units of an aliphatic chain, thereby
providing a convenient strategy for constructing a peptidomimetic
(Banerjee, Biopolymers 39 (1996), 769-777).
[0290] Superactive peptidomimetic analogues of small peptide
hormones in other systems are described in the prior art (Zhang,
Biochem. Biophys. Res. Commun. 224 (1996), 327-331). Appropriate
peptidomimetics of the protein of the present invention can also be
identified by the synthesis of peptidomimetic combinatorial
libraries through successive amide alkylation and testing the
resulting compounds, e.g., for their binding and immunological
properties. Methods for the generation and use of peptidomimetic
combinatorial libraries are described in the prior art, for example
in Ostresh, Methods in Enzymology 267 (1996), 220-234 and Dorner,
Bioorg. Med. Chem. 4 (1996), 709-715.
[0291] Furthermore, a three-dimensional and/or crystallographic
structure of the protein of the invention can be used for the
design of peptidomimetic inhibitors of the biological activity of
the protein of the invention (Rose, Biochemistry 35 (1996),
12933-12944; Rutenber, Bioorg. Med. Chem. 4 (1996), 1545-1558).
[0292] Furthermore, a three-dimensional and/or crystallographic
structure of the protein of the invention and the identification of
interactive sites the polypeptide of the invention and its
substrates or binding factors can be used for design of mutants
with modulated binding or turn over activities. For example, the
active center of the polypeptide of the present invention can be
modelled and amino acid residues participating in the catalytic
reaction can be modulated to increase or decrease the binding of
the substrate to inactivate the polypeptide. The identification of
the active center and the amino acids involved in the catalytic
reaction facilitates the screening for mutants having an increased
activity. In particular, the information about the conservative
amino acids in the consensus sequences can help to modulate the
activity.
[0293] Where appropriate, however, expression of a polynucleotide
of a distant nonhuman organism, which encodes an L450, may,
according to the knowledge of the skilled worker, result in a
particularly strong effect of the invention, i.e. in a particularly
large increase in growth and/or yield, since the encoded
polypeptide is possibly not accessible to endogenous regulatory
influences.
[0294] "Transgenic" or "recombinant" means in accordance with the
invention, for example with regard to a nucleic acid sequence, to
an expression cassette (=gene construct) or to a vector comprising
the nucleic acid sequence of the invention or to a nonhuman
organism transformed with the nucleic acid molecule sequences,
expression cassette or vector of the invention, all those
constructions produced by genetic methods, in which [0295] a) the
nucleic acid sequence used in the method of the invention or [0296]
b) a genetic control or regulatory sequence functionally linked to
a nucleic acid sequence used in the method of the invention, for
example a promotor, or [0297] c) (a) and (b) are not present in
their natural, genetic environment or have been modified by genetic
methods, said modification possibly being, by way of example, a
substitution, addition, deletion, inversion or insertion of one or
more nucleotide residues. Natural genetic environment means the
natural genomic or chromosomal locus in the source organism or the
presence in a genomic library. In the case of a genomic library,
the natural, genetic environment of the nucleic acid sequence is
preferably at least partially still retained. The environment
flanks the nucleic acid sequence at least on one side and its
sequence is from 0 or more bp, preferably 50 bp, more preferably
from 100 to 500 bp, particularly preferably 1 000 by or more, in
length, although sequences of 5 000 by or more have also been
described. A naturally occurring expression cassette, for example
the naturally occurring combination of the natural promoter of the
L450 nucleic acid sequence, becomes a transgenic expression
cassette when altered by nonnatural, synthetic ("artificial")
methods such as, for example, mutagenesis. Corresponding methods
are described, for example, in U.S. Pat. No. 5,565,350 or WO
00/15815.
[0298] The regulatory functions of a natural as well as artificial
expression cassette may was altered indirectly or in trans by
changing factors which regulate said expression cassette. This
includes, in particular, homologous, heterologous and artificial
transcription factors influencing regulation.
[0299] Cloning vectors as described in detail in the prior art and
also herein may be used for transformation. Vectors and methods
suitable for transformation of plants have been published or cited
in, for example:
[0300] Plant Molecular Biology and Biotechnology (CRC Press, Boca
Raton, Fla.), chapter 6/7, pp. 71-119 (1993); F. F. White, Vectors
for Gene Transfer in Higher Plants; in: Transgenic Plants, vol. 1,
Engineering and Utilization, eds: Kung and R. Wu, Academic Press,
1993, 15-38; B. Jenes et al., Techniques for Gene Transfer, in:
Transgenic Plants, vol. 1, Engineering and Utilization, eds: Kung
and R. Wu, Academic Press (1993), 128-143; Potrykus, Annu. Rev.
Plant Physiol. Plant Molec. Biol. 42 (1991), 205-225)).
[0301] The transformation of microorganisms and higher eukaryotes
is described in numerous textbooks, for example in Sambrook,
Molecular Cloning, 1989, Cold Spring Harbor Laboratory and in
"Current Protocols in Molecular Biology", John Wiley & Sons,
N.Y. (1989).
[0302] It is possible to express homologous or heterologous nucleic
acids, i.e. the acceptor and donor organisms belong to the same
species, where appropriate to the same variety, or to different
species, where appropriate varieties. However, transgenic also
means that the nucleic acids of the invention are located at their
natural location in the genome of an organism but that the sequence
has been altered compared to the natural sequence and/or the
regulatory sequences of the natural sequences have been altered.
Transgenic preferably means expression of the nucleic acids of the
invention at a nonnatural site in the genome, i.e. homologous or,
preferably, heterologous expression of said nucleic acids
occurs.
[0303] The term "regulatory sequences" also includes those
sequences which control constitutive expression of a nucleotide
sequence in many host cell species and those which control direct
expression of the nucleotide sequence only in particular host cells
under particular conditions. The skilled worker appreciates that
the design of the expression vector may depend on factors such as
selection of the host cell to be transformed, degree of expression
of the desired protein, etc. Transcription may be increased, for
example, by using strong transcription signals such as promoter
and/or enhancer or mRNA stabilizers, for example by particular 5'
and/or 3'UTRs. Thus, for example, signals leading to a higher rate
of transcription or to a more stable mRNA may be substituted for
endogenous signals. In addition, however, it is also possible to
enhance translation by improving, for example, ribosome binding or
mRNA stability.
[0304] In principle, those promoters may be used which are able to
stimulate transcription of genes in organisms such as
microorganisms, plants or animals. Suitable promoters which are
functional in said organisms are well known. They may be
constitutive or inducible promoters. Suitable promoters may enable
development- and/or tissue-specific expression in multicellular
eukaryotes, and it is thus possible to use advantageously leaf-,
root-, flower-, seed-, guard cell- or fruit-specific promoters in
plants. Further regulatory sequences are described above and
below.
[0305] The term "transgenic", used according to the invention, also
refers to the progeny of a transgenic nonhuman organism, for
example a plant, for example the T.sub.1, T.sub.2, T.sub.3 and
subsequent plant generations or the BC.sub.1, BC.sub.2, BC.sub.3
and subsequent plant generations. Thus, the transgenic plants of
the invention may be grown and crossed with themselves or with
other individuals in order to obtain further transgenic plants of
the invention. It is also possible to obtain transgenic plants by
vegetative propagation of transgenic plant cells.
[0306] In a preferred embodiment, faster growth and/or a higher
yield are achieved by increasing endogenous L450 expression.
[0307] Thus it is possible to increase the amount of L450 in the
method of the invention by functionally linking an endogenous,
L450-encoding polynucleotide to regulatory sequences which lead to
an increased amount of said L450 polypeptide.
[0308] The amount of expression of a gene is regulated at the
transcriptional or translational level or with respect to the
stability and degradation of a gene product.
[0309] Regulatory sequences are usually arranged upstream (5'),
within and/or downstream (3') with respect to a particular nucleic
acid or a particular codogenic gene section. They control in
particular transcription and/or translation and also transcript
stability of the codogenic gene section, where appropriate in
cooperation with further functional systems intrinsic to the cell,
such as the protein biosynthesis apparatus of the cell. Thus it is
possible to influence promoter, UTR, splice sites, polyadenylation
signals, terminators, enhancers, processing signals,
posttranscriptional and/or posttranslational modifications, etc.
according to the knowledge of the skilled worker in order to
increase expression of an endogenous protein without influencing
the sequence of said protein itself. Consequently, the amount of
L450 may also be increased according to the invention when
manipulating the L450 regions flanking the coding sequence. Thus,
for example, an exogenous promoter mediating higher or more
specific expression may replace the endogenous L450 promoter and
thus result in higher expression of the protein. It is also
possible, for example, to increase the stability of the mRNA
product by replacing the endogenous 5' UTR or 3' UTR, without
influencing the endogenous sequence of the protein. Other methods
of this kind for increasing expression of a protein in an organism
are known to the skilled worker. Thus it is also possible, for
example, to increase the stability of L450 by deleting
degradation-controlling elements in the protein, thereby increasing
the amount and consequently the activity in the cell. Further
functional or regulatory sequences which are replaced with those
making possible a larger amount or, where appropriate, higher
activity are described herein.
[0310] The L450 activity may possibly also be regulated via the
redox equilibrium in the environment of the polypeptide. Redox
modulation is described, for example, for AGPase in Tiessen, Plant
Cell, 2002, 14, 2191-2213. It is possible, for example, to
modulate, the concentration of reactive oxygen species in
particular cells, resulting in accelerated growth.
[0311] Furthermore, transcriptional regulation may be specifically
altered by introducing an artificial transcription factor, as
described below and in the examples.
[0312] Regulatory sequences are disclosed, for example, in Goeddel:
Gene Expression Technology Methods in Enzymology 185, Academic
Press, San Diego, Calif. (1990), or in Gruber; Methods in Plant
Molecular Biology and Biotechnolgy, CRC Press, Boca Raton, Fla.,
eds.: Glick and Thompson, chapter 7, 89-108, including the
references therein.
[0313] It is also possible to identify positive and negative
regulators which have an inhibiting or activating influence on
expression or activity (allosteric effects) of L450 and which are
then switched off or enhanced. Such mechanisms are sufficiently
known to the skilled worker in a multiplicity of metabolic
pathways.
[0314] It is possible, for example, for abiotic or biotic stress
effects to play a substantial regulative part in the regulation of
expression or activity of L450 in a nonhuman organism. Thus,
increased or reduced oxidative stress of the cells might control
expression or activity of L450 as protein which is presumably
involved in ROS regulation. Infestation with parasites leads in
many cases also to alterations in the oxidative environment of a
cell or of a nonhuman organism. These observations may be utilized
for increasing the L450 activity and may, for example, be
artificially mimicked, for example by activating or inhibiting
particular regulators.
[0315] In one embodiment of the method of the invention, expression
of the L450 protein is increased by an increase in the amount of a
transcription factor increasing L450 transcription in the nonhuman
organism or in one or more parts thereof. Thus it is possible, for
example by means of promoter analyses, to identify endogenous
transcription factors involved in transcriptional regulation of an
endogenous L450 gene. Increased activity of positive regulators or
else reduced activity of negative regulators may increase
transcription of an endogenous L450 gene.
[0316] Furthermore, methods for altering expression of genes by
means of artificial transcription factors are known to the skilled
worker. Thus, for example, an alteration in expressing a gene, in
particular a gene expressing L450, may be achieved by modifying or
synthesizing particular specific DNA-binding factors such as, for
example, zinc-finger transcription factors. These factors bind to
particular genomic regions of an endogenous target gene, preferably
to the regulatory sequences, and may cause activation or repression
of said gene. The use of such a method make it possible to activate
or reduce expression of the endogenous gene, avoiding a recombinant
manipulation of the sequence of said gene. Corresponding methods
are described, for example, in Dreier B [(2001) J. Biol. Chem.
276(31): 29466-78 and (2000) J. Mol. Biol. 303(4): 489-502], Beerli
R R (1998) Proc. Natl. Acad. Sci. USA 95(25): 14628-14633; (2000)
Proc. Natl. Acad. Sci. USA 97(4): 1495-1500 and (2000) J. Biol.
Chem. 275(42): 32617-32627), Segal D J and Barbas C F (2000) Curr.
Opin. Chem. Biol. 4(1): 34-39, Kang J S and Kim J S (2000) J. Biol.
Chem. 275(12): 8742-8748, Kim J S, (1997) Proc. Natl. Acad. Sci.
USA 94(8): 3616-3620, Klug A (1999) J. Mol. Biol. 293(2): 215-218,
Tsai S Y, (1998) Adv. Drug Deliv. Rev. 30(1-3): 23-31], Mapp A K
(2000) Proc. Natl. Acad. Sci. USA 97(8): 3930-3935, Sharrocks A D
(1997) Int. J. Biochem. Cell Biol. 29(12): 1371-1387 and Zhang L
(2000) J. Biol. Chem. 275(43): 33850-33860.
[0317] Examples of applying the method for modification of gene
expression in plants are described, for example, in WO 01/52620,
Ordiz M I, (2002) Proc. Natl. Acad. Sci. USA, 99(20):13290-13295)
or Guan (2002) Proc. Natl. Acad. Sci. USA, 99(20): 13296-13301) and
in the examples mentioned below.
[0318] In one embodiment, the method of the invention comprises
increasing the gene copy number of the polynucleotide used in the
method of the invention and characterized herein in the plant.
[0319] Advantageously, the method described herein increases the
number and size of leaves, the number of fruits and/or the size of
fruits of a plant whose L450 activity is increased, fruit meaning
any harvested products of a plant, such as, for example, seeds,
tubers, leaves, flowers, bark, fruits and roots.
[0320] The plant prepared in the method of the invention preferably
has a fresh weight which is increased by 5%, more preferably by
10%, even more preferably by more than 15%, 20%, or 30%. Even more
preference is given to an increase in yield by 50% or more, for
example by 75%, 100% or 200% or more.
[0321] The yield of the plant prepared in the method of the
invention is preferably increased by at least 5%, more preferably
by more than 10%, even more preferably by more than 15%, 20%, or
30%. Even more preference is given to an increase in yield by more
than 50% or more, for example by 75%, 100% or 200% or more.
[0322] In a further embodiment, the plant prepared in the method of
the invention is more tolerant to abiotic or biotic stress.
[0323] In a preferred embodiment, the invention also relates to a
method for preparing fine chemicals. The method comprises providing
a cell, a tissue or an organism having increased L450 activity and
culturing said cell, said tissue or said organism under conditions
which allow production of the desired fine chemicals in said cell,
said tissue or said organism. Preference is given to providing in
the method a plant of the invention, a microorganism of the
invention or a useful animal of the invention.
[0324] As described above, increasing the activity of L450 in a
nonhuman organism, in particular in plants, results in an increase
in the yield and in faster growth. By now, however, many organisms
are used for producing fine chemicals. The production of fine
chemicals nowadays is unimaginable without microorganisms which
produce inexpensive and specific, even complex molecules whose
chemical synthesis comprises many process stages and purification
steps. Thus, fine chemicals such as vitamins and amino acids are
industrially produced on a large scale in the same way as complex
pharmaceutical active compounds such as, for example, growth
factors, antibodies, etc., and the term fine chemicals is intended
to also include these active compounds hereinbelow. Plants are
likewise already used for producing various fine chemicals such as,
for example, polymers, e.g. polyhydroxyalkanoids, vitamins, amino
acids, sugars, fatty acids, in particular polyunsaturated fatty
acids, etc. Even useful animals are already used for producing fine
chemicals. Thus, production of antibodies and other pharmaceutical
active compounds in the milk of goats or cows has already been
described.
[0325] In a particularly preferred embodiment, the method of the
invention consequently relates to a method in which the L450
activity in a nonhuman organism, preferably a plant or a
microorganism, is increased and one or more metabolic pathways are
modulated in such a way that the yield and/or efficiency of
production of one or more fine chemicals is increased.
[0326] The terms production or productivity are known to the
skilled worker and comprise increasing the concentration of desired
products (e.g. fatty acids, carotenoids, (poly)saccharides,
vitamins, isoprenoids, lipids, fatty acid (esters), and/or polymers
such as polyhydroxyalkanoids and/or their metabolic products or
other desired fine chemicals as described herein) within a
particular time and a particular volume (e.g.
kilogram/hour/liter).
[0327] The term "fine chemical" is known in the art and includes
molecules which are produced by a nonhuman organism and are used in
various branches of industry such as, for example, but not
restricted to, the pharmaceutical industry, the agricultural
industry and the cosmetics industry. These compounds comprise
organic acids such as tartaric acid, itaconic acid and
diaminopimelic acid, polymers or macromolecules such as, for
example, polypeptides, e.g. enzymes, antibodies, growth factors or
fragments thereof, nucleic acids, including polynucleic acids, both
proteinogenic and nonproteinogenic amino acids, purine and
pyrimidine bases, nucleosides and nucleotides (as described, for
example, in Kuninaka, A. (1996) Nucleotides and related compounds,
pp. 561-612, in Biotechnology vol. 6, Rehm et al., eds VCH:
Weinheim and the references therein), lipids, saturated and
unsaturated fatty acids (e.g. arachidonic acid), diols (e.g.
propanediol and butanediol), carbohydrates (e.g. pentoses, hexoses,
hyaluronic acid and trehalose), aromatic compounds (e.g. aromatic
amine, vanillin and indigo), isoprenoids, prostaglandins,
triacylglycerol, cholesterol, polyhydroxyalkanoids, vitamins and
cofactors (as described in Ullmann's Encyclopedia of Industrial
Chemistry, vol. A27, "Vitamins", pp. 443-613 (1996) VCH: Weinheim
and the references therein; and Ong, A. S., Niki, E. and Packer, L.
(1995) "Nutrition, Lipids, Health and Disease" Proceedings of the
UNESCO/Confederation of Scientific and Technological Associations
in Malaysia and the Society for Free Radical Research--Asia, held
on Sep. 1-3, 1994 in Penang, Malaysia, AOCS Press (1995)), enzymes
and all other chemicals described by Gutcho (1983) in Chemicals by
Fermentation, Noyes Data Corporation, ISBN: 0818805086 and the
references indicated therein. The term "fine chemicals", as used
herein, thus also includes pharmaceutical compounds which can be
produced in organisms, for example antibodies, growth factors, etc.
or fragments thereof.
[0328] The term "amino acid" is known in the art. Amino acids
comprise the fundamental structural units of all proteins and are
thus essential for normal cell functions. Proteinogenic amino
acids, of which there are 20 types, serve as structural units for
proteins in which they are linked together by peptide bonds,
whereas the nonproteinogenic amino acids (hundreds of which are
known) usually do not occur in proteins (see Ullmann's Encyclopedia
of Industrial Chemistry, vol. A2, pp. 57-97 VCH: Weinheim (1985)).
Amino acids can exist in the D or L configuration, although L-amino
acids are usually the only type found in naturally occurring
proteins. Biosynthetic and degradation pathways of each of the 20
proteinogenic amino acids are well characterized both in
prokaryotic and eukaryotic cells (see, for example, Stryer, L.
Biochemistry, 3rd edition, pp. 578-590 (1988)). Apart from their
function in protein biosynthesis, these amino acids are interesting
chemicals as such, and it has been found that many have various
applications in the human food, animal feed, chemical, cosmetic,
agricultural and pharmaceutical industries. Lysine is an important
amino acid not only for human nutrition but also for monogastric
animals such as poultry and pigs. Glutamate is most frequently used
as a flavor additive (monosodium glutamate, MSG) and elsewhere in
the food industry, as are aspartate, phenylalanine, glycine and
cysteine. Glycine, L-methionine and tryptophan are all used in the
pharmaceutical industry. Glutamine, valine, leucine, isoleucine,
histidine, arginine, proline, serine and alanine are used in the
pharmaceutical industry and the cosmetics industry. Threonine,
tryptophan and D-/L-methionine are widely used animal feed
additives (Leuchtenberger, W. (1996) Amino acids--technical
production and use, pp. 466-502 in Rehm et al., (eds) Biotechnology
vol. 6, chapter 14a, VCH: Weinheim). It has been found that these
amino acids are moreover suitable as precursors for synthesizing
synthetic amino acids and proteins, such as N-acetylcysteine,
S-carboxymethyl-L-cysteine, (S)-5-hydroxytryptophan and other
substances described in Ullmann's Encyclopedia of Industrial
Chemistry, vol. A2, pp. 57-97, VCH, Weinheim, 1985.
[0329] The term "vitamin" is known in the art and comprises
nutrients which are required for normal functioning of an organism
but cannot be synthesized by this organism itself. The group of
vitamins may include cofactors and nutraceutical compounds.
[0330] The term "cofactor" comprises nonproteinaceous compounds
necessary for the appearance of a normal enzymic activity. These
compounds may be organic or inorganic; the cofactor molecules of
the invention are preferably organic.
[0331] The term "nutraceutical" comprises food additives which are
health-promoting in plants and animals, especially humans. Examples
of such molecules are vitamins, antioxidants and likewise certain
lipids (e.g. polyunsaturated fatty acids).
[0332] Vitamins, cofactors and nutraceuticals consequently comprise
a group of molecules which cannot be synthesized by higher animals
which therefore have to take them in, although they are readily
synthesized by other organisms such as bacteria. These molecules
are either bioactive molecules per se or precursors of bioactive
substances which serve as electron carriers or intermediate
products in a number of metabolic pathways. Besides their
nutritional value, these compounds also have a substantial
industrial value as colorants, antioxidants and catalysts or other
processing auxiliaries. For an overview of the structure, activity
and industrial applications of these compounds, see, for example,
Ullmann's Encyclopedia of Industrial Chemistry, "Vitamins", vol.
A27, pp. 443-613, VCH: Weinheim, 1996. Polyunsaturated fatty acids
are described in particular in: Simopoulos 1999, Am. J. Clin.
Nutr., 70 (3 Suppl):560-569, Takahata et al., Biosc. Biotechnol.
Biochem, 1998, 62 (11):2079-2085, Willich and Winther, 1995,
Deutsche Medizinische Wochenschrift, 120 (7):229 ff and the
references therein.
[0333] The term "purine" or "pyrimidine" comprises
nitrogen-containing bases which form part of nucleic acids,
coenzymes and nucleotides. The term "nucleotide" comprises the
fundamental structural units of nucleic acid molecules, which
comprise a nitrogen-containing base, a pentose sugar (the sugar is
ribose in the case of RNA and D-deoxyribose in the case of DNA) and
phosphoric acid. The term "nucleoside" comprises molecules which
serve as precursors of nucleotides but have, in contrast to the
nucleotides, no phosphoric acid unit. It is possible to inhibit RNA
and DNA synthesis by inhibiting the biosynthesis of these molecules
or their mobilization to form nucleic acid molecules; targeted
inhibition of this activity in cancer cells allows the ability of
tumor cells to divide and replicate to be inhibited. Moreover,
there are nucleotides which do not form nucleic acid molecules but
serve as energy stores (i.e. AMP) or as coenzymes (i.e. FAD and
NAD). However, purine and pyrimidine bases, nucleosides and
nucleotides also have other possible uses: as intermediate products
in the biosynthesis of various fine chemicals (e.g. thiamine,
S-adenosylmethionine, folates or riboflavin), as energy carriers
for the cell (e.g. ATP or GTP) and for chemicals themselves; they
are ordinarily used as flavor enhancers (e.g. IMP or GMP) or for
many medical applications (see, for example, Kuninaka, A., (1996)
"Nucleotides and Related Compounds in Biotechnology" vol. 6, Rehm
et al., eds. VCH: Weinheim, pp. 561-612). Enzymes involved in
purine, pyrimidine, nucleoside or nucleotide metabolism are also
increasingly serving as targets against which chemicals are being
developed for crop protection, including fungicides, herbicides and
insecticides.
[0334] A cell contains different carbon sources which are also
included in the term "fine chemicals", for example sugars such as
glucose, fructose, mannose, galactose, ribose, sorbose, ribulose,
lactose, maltose, sucrose or raffinose, starch or cellulose,
alcohols (e.g. methanol or ethanol), alkanes, fatty acids, in
particular polyunsaturated fatty acids and organic acids such as
acetic acid or lactic acid. Sugars may be transported by a
multiplicity of mechanisms via the cell membrane into the cell. The
ability of cells to grow and to divide rapidly in culture depends
to a high degree on the extent of the ability of said cells to
absorb and utilize energy-rich molecules such as glucose and other
sugars. Trehalose consists of two glucose molecules linked together
by an .alpha.,.alpha.-1,1-linkage. It is ordinarily used in the
food industry as sweetener, as additive for dried or frozen foods
and in beverages. However, it is also used in the pharmaceutical
industry, the cosmetics industry and the biotechnology industry
(see, for example, Nishimoto et al., (1998) U.S. Pat. No.
5,759,610; Singer, M. A. and Lindquist, S. Trends Biotech. 16
(1998) 460-467; Paiva, C. L. A. and Panek, A. D. Biotech Ann. Rev.
2 (1996) 293-314; and Shiosaka, M. J. Japan 172 (1997) 97-102).
Trehalose is used by enzymes of many microorganisms and is
naturally released into the surrounding medium from which it can be
isolated by methods known in the art.
[0335] The biosynthesis of said molecules in organisms has been
comprehensively characterized, for example in Ullmann's
Encyclopedia of Industrial Chemistry, VCH: Weinheim, 1996, e.g.
chapter "Vitamins", vol. A27, pp. 443-613, Michal, G. (1999)
Biochemical Pathways: An Atlas of Biochemistry and Molecular
Biology, John Wiley & Sons; Ong, A. S., Niki, E. and Packer, L.
(1995) "Nutrition, Lipids, Health and Disease" Proceedings of the
UNESCO/Confederation of Scientific and Technological Associations
in Malaysia and the Society for free Radical Research--Asia, held
on Sep. 1-3, 1994 in Penang, Malaysia, AOCS Press, Champaign, IL X,
374 S).
[0336] Consequently, one embodiment of the present invention
relates to a method for increasing oil production of a plant.
[0337] Plants may be used advantageously, for example, for the
production of fatty acids. For example, storage lipids in the seeds
of higher plants are synthesized from fatty acids which mainly have
from 16 to 18 carbons. Said fatty acids are located in the seed
oils of various plant species. An increase in L450 activity in
Arabidopsis has already shown that seed production is increased by
approx. 30%. The production of said oils in plants may be
increased, for example, by expressing polynucleotides characterized
herein. Vegetable oils may then be used, for example, as fuel or as
material for various products such as, for example, plastics,
drugs, etc. Polyunsaturated fatty acids may be used particularly
advantageously in nutrition and feeding.
[0338] In one embodiment, said method of the invention comprises
preparing fine chemicals by transforming the nonhuman organism with
one or more further polynucleotides whose gene products are part of
one of the abovementioned metabolic pathways or whose gene products
are involved in the regulation of one of these metabolic pathways
so that the nonhuman organism produces the desired fine chemicals
or the production of a desired fine chemical is increased.
Advantageously, coexpression of the genes used in the method
together with the increase in L450 activity advantageously achieves
an increase in production of said fine chemicals. Genes which serve
the production of said fine chemicals are known to the skilled
worker and have been described in the literature in many different
ways.
[0339] The biosynthesis of said fine chemicals, for example of
fatty acids, carotenoids, (poly)saccharides, vitamins, isoprenoids,
lipids, fatty esters or polyhydroxyalkanoids and the abovementioned
metabolic products, in plants often takes place in special
metabolic pathways of particular cell organelles. Consequently,
polynucleotides whose gene products play a part in these
biosynthetic pathways and which are consequently located in said
special organelles include sequences which code for corresponding
signal peptides.
[0340] Further polynucleotides may be introduced into the host
cell, preferably into a plant cell, with the gene constructs,
expression cassettes, vectors, etc. described herein. Expression
cassettes, gene constructs, vectors, etc. of this. kind may be
introduced by simultaneous transformation of a plurality of
individual expression cassettes, gene constructs, vectors, etc. or,
preferably, by combining a plurality of genes, ORFs or expression
cassettes in one construct. It is also possible to use a plurality
of vectors with in each case a plurality of expression cassettes
for transformation and introduce them into the host cell.
[0341] Consequently, the gene constructs, expression cassettes,
vectors, etc. described above for the method of the invention may
mediate according to the invention also the increase or reduction
in further genes, in addition to the increase in L450
expression.
[0342] It is therefore advantageous to introduce into the host
organisms and express therein regulator genes such as genes for
inducers, repressors or enzymes which, due to their activity,
intervene in the regulation of one or more genes of a biosynthetic
pathway. These genes may be of heterologous or homologous origin.
Furthermore, it is possible additionally to introduce biosynthesis
genes for producing fine chemicals so that the production of said
fine chemicals is particularly effective due to the accelerated
growth.
[0343] For this purpose, the aforementioned nucleic acids may be
used for transformation of plants, for example with the aid of
Agrobacterium, after they have been cloned into expression
cassettes of the invention, for example in combination with nucleic
acid molecules encoding other polypeptides. The genes encoding
"other polypeptides" or "regulators" may also be introduced into
the desired nonhuman organisms in independent transformations. This
may take place before or after increasing the L450 activity in said
nonhuman organism.
[0344] Cotransformation with a second expression construct or
vector and subsequent selection for the appropriate marker is also
possible.
[0345] In one embodiment, the invention relates to a gene
construct, an expression cassette or a vector which comprises one
or more of the nucleic acid molecules or polynucleotides described
herein. Cassettes, constructs or vectors are preferably suitable
for use in the method of the invention and comprise, for example,
the abovementioned L450-encoding polynucleotides, preferably
functionally linked to one or more regulatory signals for mediating
or increasing gene expression in plants.
[0346] Said homologs, derivatives or analogs which are functionally
linked to one or more regulatory signals or regulatory sequences,
advantageously for increasing gene expression, are included.
[0347] The regulatory sequences are intended to make possible
targeted expression of the genes and synthesis of the encoded
proteins. The term "regulatory sequence" is defined above and
includes, for example, include the described terminator, processing
signals, post-transcriptional, posttranslational modifications,
promoter, enhancer, UTR, splice sites, polyadenylation signals and
other expression control elements known to the skilled worker and
mentioned herein.
[0348] Depending on the host organism, for example, this may mean
that the gene is expressed and/or overexpressed only after
induction or that it is expressed and/or overexpressed immediately.
Examples of these regulatory sequences are sequences to which
inducers or repressors bind and thus regulate expression of the
nucleic acid. In addition to these new regulatory sequences or
instead of these sequences, the natural regulation of said
sequences may still be present upstream of the actual structural
genes and, where appropriate, may have been genetically modified so
that natural regulation has been switched off and expression of the
genes has been increased. However, the expression cassette
(=expression construct=gene construct) may also have a simpler
structure, i.e. no additional regulatory signals are inserted
upstream of the nucleic acid sequence or derivatives thereof and
the natural promoter with its regulation is not deleted. Instead,
the natural regulatory sequence is mutated so that regulation no
longer takes place and/or gene expression is increased. These
modified promoters may also be put in the form of partial sequences
(=promoter with parts of the nucleic acid sequences of the
invention) alone upstream of the natural gene to increase the
activity. Moreover, the gene construct may advantageously also
comprise one or more "enhancer" sequences functionally linked to
the promoter, which make increased expression of the nucleic acid
sequence possible. Additional advantageous sequences such as
further regulatory elements or terminators may also be inserted at
the 3' end of the DNA sequences. The nucleic acid sequence(s) of
the invention coding preferably for an L450 activity may be present
in one or more copies in the expression cassette (=gene construct).
One or more copies of the genes may be present in the expression
cassette. This gene construct or the gene constructs may be
expressed together in the host organism. It is possible for the
gene construct or gene constructs to be inserted in one or more
vectors and be present in free form in the cell or else be inserted
in the genome. In the case of plants, integration into the plastid
genome or into the cell genome may have taken place.
[0349] Cloning vectors as are comprehensively described in the
prior art and here may be used for transformation.
[0350] Preference is given to introducing the nucleic acid
sequences used in the method into an expression cassette which
enables the nucleic acids to be expressed in a nonhuman organism,
preferably in a plant.
[0351] The expression cassettes may in principle be used directly
for introduction into the plant or else be introduced into a
vector.
[0352] In another embodiment, the invention also relates to the
complementary sequences of said polynucleotide of the invention and
to an antisense polynucleic acid.
[0353] An antisense nucleic acid molecule comprises, for example, a
nucleotide sequence which is complementary to the "sense" nucleic
acid molecule encoding a protein, for example complementary to the
coding strand of a double-stranded cDNA molecule or complementary
to an mRNA sequence. Consequently, an antisense nucleic acid
molecule is capable of forming hydrogen bonds with a sense nucleic
acid molecule. The antisense nucleic acid molecule may be
complementary to any of the coding strands depicted here or only to
a part thereof. An antisense oligonucleotide may, for example, be
5, 10, 15, 20, 25, 30, 35, 40, 45 or 50, nucleotides in length. An
antisense nucleic acid molecule may be prepared by chemical
synthesis and enzymic ligation according to methods known to the
skilled worker. An antisense nucleic acid molecule may be
chemically synthesized using naturally occurring nucleotides or
nucleotides modified in various ways so as to increase the
biological stability of the molecules or to enhance the physical
stability of the duplex forming between the antisense nucleic acid
and the sense nucleic acid; it is possible to use, for example,
phosphorothioate derivatives and acridine-substituted nucleotides.
Alternatively, it is possible to prepare antisense nucleic acid
molecules biologically by using expression vectors into which
polynucleotides have been cloned whose orientation is antisense.
The antisense nucleic acid molecule may also be an
".alpha.-anomeric" nucleic acid molecule. An ".alpha.-anomeric"
nucleic acid molecule forms specific double-stranded hybrids with
complementary RNAs, in which the strands run parallel to one
another, in contrast to ordinary .beta.-units. The antisense
nucleic acid molecule may comprise 2-O-methylribonucleotides or
chimeric RNA-DNA analogs. The antisense nucleic acid molecule may
also be a ribozyme. Ribozymes are catalytic RNA molecules having a
ribonuclease activity and are capable of cleaving single-stranded
nucleic acids to which they have a complementary region, such as
mRNA, for example.
[0354] In another preferred embodiment, the invention relates to
the polypeptide encoded by the polynucleotide of the invention and
to a polyclonal or monoclonal antibody, preferably a monoclonal
antibody, directed against said polypeptide.
[0355] "Antibodies" mean, for example, polyclonal, monoclonal,
human or humanized or recombinant antibodies or fragments thereof,
single-chain antibodies or else synthetic antibodies. Antibodies of
the invention or fragments thereof mean in principle all the
immunoglobulin classes such as IgM, IgG, IgD, IgE, IgA or their
subclasses such as the IgG subclasses, or mixtures thereof.
Preference is given to IgG and its subclasses such as, for example,
IgG1, IgG2, IgG2a, IgG2b, IgG3 and IgGM. Particular preference is
given to the IgG subtypes IgG1 and IgG2b. Fragments which may be
mentioned are any truncated or modified antibody fragments having
one or two binding sites complementary to the antigen, such as
antibody moieties having a binding site which corresponds to the
antibody and is composed of a light chain and a heavy chain, such
as Fv, Fab or F(ab').sub.2 fragments or single-strand fragments.
Preference is given to truncated double-strand fragments such as
Fv, Fab or F(ab').sub.2. These fragments may be obtained, for
example, either enzymatically, by cleaving off the Fc moiety of the
antibodies using enzymes such as papain or pepsin, by means of
chemical oxidation or by means of genetic manipulation of the
antibody genes. Genetically manipulated nontruncated fragments may
also be advantageously used. The antibodies or fragments may be
used alone or in mixtures. Antibodies may also be part of a fusion
protein.
[0356] In other embodiments, the present invention relates to a
method for preparing a vector, which comprises inserting the
polynucleotide of the invention or the expression cassette into a
vector, and to a vector comprising the polynucleotide of the
invention or prepared according to the invention.
[0357] In a preferred embodiment, the polynucleotide is
functionally linked to regulatory sequences which allow expression
in a prokaryotic or eukaryotic host.
[0358] The term "vector", as used herein, refers to a nucleic acid
molecule capable of transporting another nucleic acid to which it
is bound. An example of a type of vector is a "plasmid", i.e. a
circular double-stranded DNA loop. Another type of vector is a
viral vector, it being possible here to ligate additional DNA
segments into the viral genome. Particular vectors such as, for
example, vectors having an origin of replication may replicate
autonomously in a host cell into which they have been introduced.
Other preferred vectors are advantageously integrated into the
genome of a host cell into which they have been introduced and
thereby are replicated together with the host genome. Moreover,
particular vectors can control expression of genes to which they
are functionally linked. These vectors are referred to herein as
"expression vectors". As mentioned above, they may replicate
autonomously or be integrated into the host genome. Expression
vectors suitable for DNA recombination techniques are usually in
the form of plasmids. "Plasmid" and "vector" may be used
synonymously in the present description. Consequently, the
invention also comprises phages, viruses, for example SV40, CMV or
TMV, transposons, IS elements, phasmids, phagemids, cosmids, linear
or circular DNA and other expression vectors known to the skilled
worker.
[0359] The recombinant expression vectors used advantageously in
the method comprise the nucleic acids of the invention or the gene
construct of the invention in a form suitable for expression of the
nucleic acids used in a host cell, meaning that the recombinant
expression vectors comprise one or more regulatory sequences which
are selected on the basis of the host cells to be used for
expression and which is functionally linked to the nucleic acid
sequence to be expressed.
[0360] In a recombinant expression vector, "functionally linked"
means that the nucleotide sequence of interest is bound to the
regulatory sequence(s) in such a way that expression of said
nucleotide sequence is possible and that they are bound to one
another so that both sequences fulfill the predicted function
attributed to the sequence (e.g. in an in-vitro
transcription/translation system or in a host cell when introducing
the vector into said host cell).
[0361] The recombinant expression vectors used may be designed
especially for expression in prokaryotic and/or eukaryotic cells,
preferably in plants. For example, L450 genes may be expressed in
bacterial cells, insect cells, e.g. by using baculovirus expression
vectors, yeast cells and other fungal cells, e.g. according to
Romanos, (1992), Yeast 8:423-488; van den Hondel, C. A. M. J. J.,
(1991), in J. W. Bennet & L. L. Lasure, eds, pp. 396-428:
Academic Press: San Diego; and van den Hondel, C. A. M. J. J.,
(1991) in: Applied Molecular Genetics of Fungi, Peberdy, J. F, ed.,
pp. 1-28, Cambridge University Press: Cambridge, in algae, e.g.
according to Falciatore, 1999, Marine Biotechnology. 1, 3:239-251,
in ciliates, e.g. in Holotrichia, Peritrichia, Spirotrichia,
Suctoria, Tetrahymena, Paramecium, Colpidium, Glaucoma,
Platyophrya, Potomacus, Desaturaseudocohnilembus, Euplotes,
Engelmaniella, Stylonychia, or in the genus Stylonychia lemnae,
using vectors according to a transformation method as described in
WO 98/01572, and preferably in cells of multicellular plants [see
Schmidt, R., (1988) Plant Cell Rep.: 583-586; Plant Molecular
Biology and Biotechnology, C Press, Boca Raton, Fla., chapter 6/7,
pp. 71-119 (1993); F. F. White, B. Jenes, Transgenic Plants, vol.
1, Engineering and Utilization, eds: Kung and R. Wu, Academic Press
(1993), 128-43; Potrykus, Annu. Rev. Plant Physiol. Plant Molec.
Biol. 42 (1991), 205-225, and the references in the documents
mentioned here. Suitable host cells are also discussed in Goeddel,
Gene Expression Technology: Methods in Enzymology 185, Academic
Press, San Diego, Calif. (1990). Alternatively, the recombinant
expression vector may be transcribed and translated in vitro using,
for example, T7-promoter regulatory sequences and T7
polymerase.
[0362] A plant expression cassette or a corresponding vector
preferably comprises regulatory sequences which are capable of
controlling gene expression in plant cells and are functionally
linked to the ORF so that each sequence its function.
[0363] The expression cassette is preferably linked to a suitable
promoter which carries out gene expression at the right time and in
a cell- or tissue-specific manner.
[0364] Consequently, advantageous regulatory sequences for the
novel method are present in the plant promoters CaMV/35S [Franck,
Cell 21 (1980) 285-294, U.S. Pat. No. 5,352,605], PRP1 [Ward,
Plant. Mol. Biol. 22 (1993)], SSU, PGEL1, OCS [Leisner, (1988) Proc
Natl Acad Sci USA 85:2553], lib4, usp, mas [Comai (1990) Plant Mol
Biol 15:373], STLS1, ScBV [Schenk (1999) Plant Mol Biol 39:1221,
B33, SAD1 and SAD2 (flax promoter, [Jain, (1999) Crop Science,
39:1696) and nos [Shaw (1984) Nucleic Acids Res. 12:7831]. The
various ubiquitin promoters of Arabidopsis [Callis (1990) Biol Chem
265:12486; Holtorf (1995) Plant Mol Biol 29:637], Pinus, maize
[(Ubi1 and Ubi2), U.S. Pat. No. 5,510,474; U.S. Pat. No. 6,020,190
and U.S. Pat. No. 6,054,574] or parsley [Kawalleck (1993) Plant
Molecular Biology, 21:673] or phaseolin promoters may be used
advantageously. Inducible promoters such as the promoters described
in EP-A-0 388 186 (benzylsulfonamide-inducible), Gatz, (1992) Plant
J. 2:397 (tetracycline-inducible), EP-A-0 335 528 (abscisic
acid-inducible) or WO 93/21334 (ethanol- or cyclohexanol-inducible)
are likewise advantageous in this connection. Further suitable
plant promoters are the promoter of cytosolic FBPase or the potato
ST-LSI promoter (Stockhaus, 1989, EMBO J. 8, 2445), the Glycine max
phosphoribosyl-pyrophosphate amidotransferase promoter (GenBank
accession No. U87999) or the node-specific promoter described in
EP-A-0 249 676. Promoters which make expression possible in
specific tissues or show a preferential expression in certain
tissues may also be suitable. Also advantageous are seed-specific
promoters such as the USP promoter but also other promoters such as
the LeB4, DC3, SAD1, phaseolin or napin promoter. Leaf-specific
promoters as described in DE-A 19644478 or light-regulated
promoters such as, for example, the petE promoter are also
available for expression of genes in plants. Further advantageous
promoters are seed-specific promoters which may be used for
monocotyledonous or dicotyledonous plants and are described in U.S.
Pat. No. 5,608,152 (oil seed rape napin promoter), WO 98/45461
(Arabidopsis oleosin promoter), U.S. Pat. No. 5,504,200 (Phaseolus
vulgaris phaseolin promoter), WO 91/13980 (Brassica Bce4 promoter)
and von Baeumlein, 1992, Plant J., 2:233 (Legume LeB4 promoter),
these promoters being suitable for dicotyledons. Examples of
promoters suitable for monocotyledons are the following: barley
1pt-2- or 1pt-1 promoter (WO 95/15389 and WO 95/23230), barley
hordein promoter, the corn ubiquitin promoter and other suitable
promoters described in WO 99/16890.
[0365] In order to express heterologous sequences strongly in as
many tissues as possible, in particular also in leaves, preference
is given to using, in addition to various of the abovementioned and
promoters, plant promoters of actin or ubiquitin genes, such as,
for example, the rice actin1 promoter. Another example of
constitutive plant promoters are the sugar beet V-ATPase promoters
(WO 01/14572).
[0366] It is possible in principle to use all natural promoters
with their regulatory sequences, such as those mentioned above, for
the novel method. It is likewise possible and advantageous to use
synthetic promoters additionally or alone, particularly if they
mediate constitutive expression. Examples of synthetic constitutive
promoters are the Super promoter (WO 95/14098) and promoters
derived from G boxes (WO 94/12015).
[0367] Plant genes can also be expressed via a chemically inducible
promoter (see a review in Gatz 1997, Annu. Rev. Plant Physiol.
Plant Mol. Biol., 48:89-108). Chemically inducible promoters are
particularly suitable when it is desired to express genes in a
time-specific manner. Examples of such promoters are a salicylic
acid-inducible promoter (WO 95/19443), a tetracycline-inducible
promoter (Gatz et al. (1992) Plant J. 2, 397-404), an
ethanol-inducible promoter and EP-A 388186, EP-A 335528, WO
97/06268. Expression specifically in gymnosperms or angiosperms are
also possible in principle.
[0368] Promoters responding to biotic or abiotic stress conditions
are also suitable promoters, for example in plants the
pathogen-induced PRP1 gene promoter (Ward, Plant. Mol. Biol. 22
(1993) 361), the tomato heat-inducible hsp80 promoter (U.S. Pat.
No. 5,187,267), the potato cold-inducible alpha-amylase promoter
(WO 96/12814) or the wound-inducible pinII promoter (EP-A-0 375
091).
[0369] Preferred polyadenylation signals are sufficiently known to
the skilled worker, for example for plants those derived from
Agrobacterium tumefaciens t-DNA, such as gene 3, known as octopine
synthase (ocs gene) of the Ti plasmid pTiACH5 (Gielen, EMBO J. 3
(1984) 835), the nos gene or functional equivalents thereof. Other
known terminators which are functionally active in plants are also
suitable.
[0370] Further regulatory sequences which are expedient where
appropriate also include sequences which control transport and/or
location of the expression products (targeting). In this
connection, mention should be made particularly of the signal
peptide- or transit peptide-encoding sequences known per se. For
example, it is possible with the aid of plastid transit
peptide-encoding sequences to guide the expression product into the
plastids of a plant cell. Consequently, preference is given to
using for functional linkage in plant gene expression cassettes in
particular targeting sequences which are required for guiding the
gene product to its appropriate cell compartment (see a review in
Kermode, Crit. Rev. Plant Sci. 15, 4 (1996) 285 and references
therein), for example into the vacuole, the nucleus, any kind of
plastids such as amyloplasts, chloroplasts, chromoplasts, the
extracellular space, the mitochondria, the endoplasmic reticulum,
oil bodies, peroxisomes and other compartments of plant cells.
Thus, in particular peroxisome-targeting signals have been
described, for example in Olsen L J, Plant Mol Biol 1998,
38:163-189).
[0371] According to the invention, the gene construct, the vector,
the expression cassette, etc. are advantageously constructed in
such a way that a promoter is followed by a suitable cleavage site
for insertion of the nucleic acid to be expressed, for example in a
polylinker, and a terminator is then located, where appropriate,
downstream of the polylinker or the insert. This sequence may be
repeated several times, for example three, four or five times, so
that multiple genes are combined in one construct and can be
introduced in this way into the transgenic plant for expression.
Advantageously, each nucleic acid sequence has its own promoter
and, where appropriate, its own terminator. In the case of
microorganisms capable of processing a polycistronic RNA, it is
also possible to insert a plurality of nucleic acid sequences
downstream of a promoter and, where appropriate, upstream of a
terminator. It is advantageously possible to use in the expression
cassette different promoters. A different terminator sequence may
be used advantageously for each gene.
[0372] The plant expression cassette preferably contains further
functionally linked sequences such as translation enhancers, for
example the overdrive sequence comprising the 5'-untranslated
leader sequence of tobacco mosaic virus, which increases the
protein/RNA ratio (Gallie, 1987, Nucl. Acids Research 15:8693).
[0373] The vectors, cassettes, nucleic acid molecules, etc. to be
introduced can be introduced into prokaryotic or eukaryotic cells
via conventional transformation or transfection techniques.
[0374] The terms "transformation" and "transfection", conjugation
and transduction, as used herein, are intended to include a
multiplicity of methods known in the prior art for introducing
foreign nucleic acid (e.g. DNA) into a host cell, including calcium
phosphate or calcium chloride coprecipitation,
DEAE-dextran-mediated transfection, lipofection, natural
competence, chemically mediated transfer, electroporation or
particle bombardment. Methods suitable for transforming or
transfecting host cells, including plant cells, can be found in
Sambrook et al. (Molecular Cloning: A Laboratory Manual., 2nd
edition, Cold Spring Harbor Laboratory, Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y., 1989) and other
laboratory manuals such as Methods in Molecular Biology, 1995, vol.
44, Agrobacterium protocols, eds: Gartland and Davey, Humana Press,
Totowa, N.J.
[0375] Thus it is possible for the nucleic acids, gene constructs,
expression cassettes, vectors, etc. used in the method to be
integrated either in the plastid genome or preferably in the genome
of the host cell, after introduction into a plant cell or plant.
Integration into the genome may be random or may be carried out via
recombination in such a way that the introduced copy replaces the
native gene, thereby modulating production of the desired compound
by the cell, or by using a gene in trans so that said gene is
functionally linked to a functional expression unit which comprises
at least one sequence guaranteeing expression of a gene and at
least one sequence guaranteeing polyadenylation of a functionally
transcribed gene. Where appropriate, the nucleic acids are
transferred into the plants via multiexpression cassettes or
constructs for multiparallel expression of genes. In another
embodiment, the nucleic acid sequence is introduced into the plant
without further, different nucleic acid sequences.
[0376] As described above, the transfer of foreign genes into the
genome of a plant is referred to as transformation. In this case,
the methods described for transformation and regeneration of plants
from plant tissues or plant cells are utilized for transient or
stable transformation. Suitable methods are protoplast
transformation by polyethylene glycol-induced DNA uptake, the
biolistic method using the gene gun--the "particle bombardment"
method, electroporation, incubation of dry embryos in
DNA-containing solution, microinjection and Agrobacterium-mediated
gene transfer. Said methods are described, for example, in B.
Jenes, Techniques for Gene Transfer, in: Transgenic Plants, Vol. 1,
Engineering and Utilization, edited by S. D. Kung and R. Wu,
Academic Press (1993) 128-143 and in Potrykus Annu. Rev. Plant
Physiol. Plant Molec. Biol. 42 (1991) 205-225).
[0377] The construct to be expressed is preferably cloned into a
vector which is suitable for transforming Agrobacterium
tumefaciens, for example as described herein, for example pBin19
(Bevan, Nucl. Acids Res. 12 (1984) 8711). Agrobacteria transformed
with such a vector may then be used in the known manner for
transforming plants, in particular crop plants, such as, for
example, tobacco plants, by, for example, bathing wounded leaves or
pieces of leaf in a solution of agrobacteria and then cultivating
said leaves or pieces of leaf in suitable media. The transformation
of plants with Agrobacterium tumefaciens is described, for example,
by Hofgen, Nucl. Acid Res. (1988) 16, 9877 or is disclosed, inter
alia, in F. F. White, Vectors for Gene Transfer in Higher Plants;
in Transgenic Plants, Vol. 1, Engineering and Utilization, edited
by S.D. Kung and R. Wu, Academic Press, 1993, pp. 15-38.
[0378] The nucleic acids, gene constructs, expression cassettes,
vectors, etc. used in the method are checked, where appropriate,
and then used for transforming the plants. For this purpose, it may
be required first to obtain the constructs, plasmids, vectors, etc.
from an intermediate host. For example, the constructs can be
isolated as plasmids from bacterial hosts, following a conventional
plasmid isolation. Numerous methods for transforming plants are
known. Since stable integration of heterologous DNA into the genome
of plants is advantageous according to the invention,
T-DNA-mediated transformation, in particular, has proved to be
expedient and may be carried out in a manner known per se. For
example, the plasmid construct generated according to what has been
said above may be transformed into competent agrobacteria by means
of electroporation or heat shock. In principle, the distinction to
be made here is between the formation of cointegrated vectors on
the one hand and the transformation with binary vectors. In the
first alternative, the vector constructs comprising the codogenic
gene section do not contain any T-DNA sequences, rather the
cointegrated vectors are formed in the agrobacteria by homologous
recombination of the vector construct with T-DNA. T-DNA is present
in agrobacteria in the form of Ti or Ri plasmids in which the
oncogenes have conveniently been replaced by exogenous DNA. When
using binary vectors, these may be transferred by means of
bacterial conjugation or direct transfer to agrobacteria. Said
agrobacteria conveniently already comprise the vector carrying the
vir genes (frequently referred to as helper Ti(Ri) plasmid).
Expediently, one or more markers may be used, on the basis of which
the selection of transformed agrobacteria and transformed plant
cells is possible. A multiplicity of markers is known to the
skilled worker.
[0379] It is known about stable or transient integration of nucleic
acids that, depending on the expression vector used and
transfection technique used, only a small proportion of the cells
takes up the foreign DNA and, if desired, integrates it in their
genome. For identification and selection of these integrants,
usually a gene which encodes a selectable marker (e.g. antibiotic
resistance) is introduced together with the gene of interest into
the host cells.
[0380] Marker genes are advantageously used for selection for
successful introduction of the nucleic acids of the invention into
a host organism, in particular into a plant. These marker genes
make it possible to identify successful introduction of the nucleic
acids of the invention by a number of different principles, for
example by visual recognition with the aid of fluorescence,
luminescence or in the wavelength range of light which is visible
to humans, via a herbicide or antibiotic resistance, via
"nutritional" (auxotrophic) markers or antinutritional markers, by
enzyme assays or via phytohormones. Examples of such markers which
may be mentioned here are GFP (=Green fluorescent Protein); the
luciferin/luciferase system; .quadrature.-galactosidase with its
colored substrates, e.g. X-Gal; herbicide resistances to, for
example, imidazolinone, glyphosate, phosphothricin or sulfonylurea;
antibiotic resistances to, for example, bleomycin, hygromycin,
streptomycin, kanamycin, tetracycline, chloramphenicol, ampicillin,
gentamycin, geneticin (G418), spectinomycin or blasticidin, to
mention only a few; nutritional markers such as utilization of
mannose or xylose or antinutritional markers such as 2-deoxyglucose
resistance. This list represents a small section of possible
markers. Markers of this kind are well known to the skilled
worker.
[0381] Different markers are preferred, depending on organism and
selection method. Preferred selectable markers include in plants
those which confer resistance to a herbicide such as glyphosphate
or glufosinate. Further suitable markers are, for example, markers
which encode genes which are involved in biosynthetic pathways of,
for example, sugars or amino acids, such as .beta.-galactosidase,
ura3 or ilv2. Markers encoding genes such as luciferase, gfp or
other fluorescence genes are likewise suitable. These markers can
be used in mutants in which said genes are not functional because,
for example, they have been deleted by means of conventional
methods. Furthermore, markers may be introduced into a host cell on
the same vector as that coding for L450 or another of the inventive
nucleic acid molecules described herein, or they may be introduced
on a separate vector.
[0382] Since the marker genes, especially the antibiotic and
herbicide resistance gene, are normally no longer required or are
unwanted in the transgenic host cell after successful introduction
of the nucleic acids, techniques making it possible to delete these
marker genes are advantageously used in the method of the invention
for introducing the nucleic acids. One such method is
"cotransformation". Cotransformation involves using simultaneously
two vectors for transformation, one vector harboring the nucleic
acids of the invention and the second one harboring the marker
gene(s). A large proportion of the transformants acquires or
contains both vectors in the case of plants (up to 40% of the
transformants and more). It is then possible to remove the marker
genes from the transformed plant by crossing. A further method uses
marker genes integrated into a transposon for the transformation
together with the desired nucleic acids ("Ac/Ds technology). In
some cases (approx. 10%), after successful transformation, the
transposon jumps out of the genome of the host cell and is lost. In
a further number of cases, the transposon jumps into another site.
In these cases, it is necessary to outcross the marker gene again.
Microbiological techniques enabling or facilitating detection of
such events have been developed. A further advantageous method uses
"recombination systems" which have the advantage that it is
possible to dispense with outcrossing. The best-known system of
this kind is the "Cre/lox" system. Cre1 is a recombinase which
deletes the sequences located between the loxP sequence. If the
marker gene is integrated between the loxP sequence, it is deleted
by means of Cre1 recombinase after successful transformation.
Further recombinase systems are the HIN/HIX, FLP/FRT and the
REP/STB system (Tribble et al., J. Biol. Chem., 275, 2000:
22255-22267; Velmurugan et al., J. Cell Biol., 149, 2000: 553-566).
Targeted integration of the nucleic acid sequences of the invention
into the plant genome is also possible in principle, but less
preferred up until now because of the large amount of work
involved. These methods are, of course, also applicable to
microorganisms such as yeasts, fungi or bacteria.
[0383] Agrobacteria transformed with an expression vector of the
invention may likewise be used in a known manner for transforming
plants such as test plants such as Arabidopsis or crop plants such
as, for example, cereals, corn, oats, rye, barley, wheat, soybean,
rice, cotton, sugar beet, canola, sunflower, flax, hemp, potato,
tobacco, tomato, carrot, paprika, oilseed rape, tapioca, cassaya,
arrowroot, tagetes, alfalfa, lettuce and the various tree, nut and
grape species, oil-containing crop plants such as soybean, peanut,
castor oil plant, sunflower, corn, cotton, flax, oilseed rape,
coconut, oil palm, safflower (Carthamus tinctorius) or cocoa bean
or the other plants mentioned below, for example by bathing wounded
leaves or pieces of leaf in a solution of agrobacteria and then
cultivating said leaves or pieces of leaf in suitable media.
[0384] The genetically modified plant cells may be regenerated by
any methods known to the skilled worker. Appropriate methods can be
found in the abovementioned publications by S. D. Kung and R. Wu,
Potrykus or Hofgen and Willmitzer.
[0385] If desired, the plasmid constructs may be checked again with
regard to identity and/or integrity by means of PCR or Southern
blot analysis, prior to their transformation into agrobacteria. It
is normally desired that the codogenic gene sections with the
linked regulatory sequences in the plasmid constructs are flanked
on one or both sides by T-DNA. This is particularly useful when
bacteria of the species Agrobacterium tumefaciens or Agrobacterium
rhizogenes are used for transformation. The transformed
agrobacteria may be cultured in a manner known per se and are thus
available for convenient transformation of the plants. The plants
or parts of plants to be transformed are grown and provided in a
conventional manner. The agrobacteria may act on the plants or
parts of plants in different ways. Thus it is possible, for
example, to use a culture of morphogenic plant cells or tissues.
Following T-DNA transfer, the bacteria are usually eliminated by
antibiotics and regeneration of plant tissue is induced. For this
purpose, particular use is made of suitable plant hormones in order
to promote the formation of shoots, after initial callus formation.
According to the invention, preference is given to carrying out in
planta transformation. For this purpose, it is possible to expose
plant seeds, for example, to the agrobacteria or to inoculate plant
meristems with agrobacteria. It has proved particularly expedient
according to the invention to expose the whole plant or at least
the flower primordia to a suspension of transformed agrobacteria.
The former is then grown further until seeds of the treated plant
are obtained (Clough and Bent, Plant J. (1998) 16, 735). To select
transformed plants, the plant material obtained from the
transformation is usually subjected to selective conditions so that
transformed plants can be distinguished from untransformed plants.
For example, the seeds obtained in the manner described above can
be sown anew and, after growing, subjected to a suitable spray
selection. Another possibility is to grow the seeds, if necessary
after sterilization, on agar plates, using a suitable selecting
agent, in such a way that only the transformed seeds are able to
grow to plants.
[0386] The invention furthermore relates to a host cell which has
been stably or transiently transformed or transfected with the
vector of the invention or with the polynucleotide of the
invention. Consequently, the invention relates in one embodiment
also to microorganisms whose L450 activity is increased, for
example due to (over)expression of the polynucleic acids
characterized herein.
[0387] In one embodiment, the host cell or microorganism is a
bacterial cell or a eukaryotic cell, preferably a unicellular
microorganism or a plant cell.
[0388] In another embodiment, the invention also relates to an
animal cell or plant cell which contains the polynucleotide of the
invention or the vector of the invention. In a preferred
embodiment, the invention relates in particular to a plant tissue
or to a plant having an increased amount of L450 and/or containing
the plant cell of the invention. In one embodiment, the invention
also relates to a plant compartment, a plant organelle, a plant
cell, a plant tissue or a plant having an increased L450 activity
or an increased amount of P450.
[0389] Host cells which are suitable in principle for taking up the
nucleic acid of the invention, the gene product of the invention or
the vector of the invention are cells of any prokaryotic or
eukaryotic organisms. Organisms or host organisms suitable for the
nucleic acid of the invention, the expression cassette or the
vector are in principle any organisms for which faster growth and
higher yield are desirable, with preference being given, as
mentioned, to crop plants.
[0390] A further aspect of the invention therefore relates to
transgenic organisms transformed with at least one nucleic acid
sequence, expression cassette or vector of the invention and to
cells, cell cultures, tissues, parts or propagation material
derived from such organisms.
[0391] The terms "host organism", "host cell", "recombinant (host)
organism", "recombinant (host) cell", "transgenic (host) organism"
and "transgenic (host) cell" are used interchangeably herein. These
terms relate, of course, not only to the particular host organism
or to the particular target cell but also to the progeny or
potential progeny of said organisms or cells. Since certain
modifications may occur in subsequent generations, owing to
mutation or environmental effects, these progeny are not
necessarily identical to the parental cell but are still included
within the scope of the term as used herein.
[0392] Examples which should be mentioned here are microorganisms
such as fungi, for example the genus Mortierella, Saprolegnia or
Pythium, bacteria such as, for example, the genus Escherichia,
yeasts such as, for example, the genus Saccharomyces,
cyanobacteria, ciliates, algae or protozoa such as, for example,
dinoflagellates such as Crypthecodinium.
[0393] The increased growth rate of the microorganisms is
particularly advantageous in combination with the synthesis of
products of value, for example in the method of the invention for
preparing fine chemicals. An advantageous embodiment is thus, for
example, microorganisms which (naturally) synthesize relatively
large amounts of vitamins, sugars, polymers, oils, etc. Examples
which may be mentioned here are fungi such as, for example,
Mortierella alpina, Pythium insidiosum, yeasts such as, for
example, Saccharomyces cerevisiae and the microorganisms of the
genus Saccharomyces, cyanobacteria, ciliates, algae or protozoa
such as, for example, dinoflagellates such as Crypthecodinium.
[0394] Utilizable host cells are furthermore mentioned in: Goeddel,
Gene Expression Technology Methods in Enzymology 185, Academic
Press, San Diego, Calif. (1990). Usable expression strains, for
example those having relatively low protease activity, are
described in: Gottesman, S., Gene Expression Technology Methods in
Enzymology 185, Academic Press, San Diego, Calif. (1990)
119-128.
[0395] Proteins are usually expressed in prokaryotes by using
vectors which contain constitutive or inducible promoters
controlling expression of fusion or nonfusion proteins. Typical
fusion expression vectors are, inter alia, pGEX (Pharmacia Biotech
Inc; Smith, D. B., and Johnson, K. S. (1988) Gene 67:31-40), pMAL
(New England Biolabs, Beverly, Mass.) and pRIT5 (Pharmacia,
Piscataway, N.J.). Examples of suitable inducible nonfusion E. coli
expression vectors are inter alia, pTrc (Amann et al. (1988) Gene
69:301-315) and pET 11d [Studier, Gene Expression Technology:
Methods in Enzymology 185, Academic Press, San Diego, Calif. (1990)
60].
[0396] Other vectors suitable in prokaryotic organisms are known to
the skilled worker and are, for example, in E. coli pLG338,
pACYC184, the pBR series such as pBR322, the pUC series such as
pUC18 or pUC19, the M113 mp series, pKC30, pRep4, pHS1, pHS2,
pPLc236, pMBL24, pLG200, pUR290, pIN-III.sup.113-B1,
.quadrature.gt11 or pBdCI, in Streptomyces pIJ101, pIJ364, pIJ702
or pIJ361, in Bacillus pUB110, pC194 or pBD214, in Corynebacterium
pSA77 or pAJ667.
[0397] However, preference is given to eukaryotic expression
systems. In a further embodiment, the expression vector is a yeast
expression vector. Examples of vectors for expression in the yeast
S. cerevisiae include pYeDesaturasecl (Baldari (1987) Embo J.
6:229), pMFa (Kurjan (1982) Cell 30:933), pJRY88 (Schultz (1987)
Gene 54:113), 2.quadrature.M, pAG-1, YEp6, YEp13, pEMBLYe23 and
pYES2 (Invitrogen Corporation, San Diego, Calif.). Vectors and
methods for constructing vectors suitable for use in other fungi
such as filamentous fungi include those described in detail in: van
den Hondel, C. A. M. J. J. (1991) in: Applied Molecular Genetics of
fungi, J. F. Peberdy, ed., pp. 1-28, Cambridge University Press:
Cambridge; or in: J. W. Bennet, ed., p. 396: Academic Press: San
Diego]. Examples of vectors in fungi are pALS1, pIL2 or pBB116 or
in plants pLGV23, pGHlac.sup.+, pBIN19, pAK2004 or pDH51.
[0398] Alternatively, a product of value, for example the fine
chemicals mentioned, may be expressed in insect cells using
baculovirus expression vectors. Baculovirus vectors available for
expression of proteins in cultured insect cells (e.g. Sf9 cells)
include the pAc series (Smith (1983) Mol. Cell Biol. 3:2156) and
the pVL series (Lucklow (1989) Virology 170:31).
[0399] The abovementioned vectors offer only a small overview over
possible suitable vectors. Further plasmids are known to the
skilled worker and are described, for example, in: Cloning Vectors
(eds Pouwels, P. H., et al., Elsevier, Amsterdam-New York-Oxford,
1985, ISBN 0 444 904018). For further expression systems suitable
for prokaryotic and eukaryotic cells, see in chapters 16 and 17 of
Sambrook, Molecular Cloning: A Laboratory Manual, 2nd edition, Cold
Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989 or
Current Protocols in Molecular Biology, John Wiley & Sons, N.Y.
(1989).
[0400] The microorganism has preferably been transiently or stably
transformed with a polynucleotide which comprises a nucleic acid
molecule described above which is suitable for the method of the
invention.
[0401] In another advantageous embodiment of the invention, it is
possible to express, for example, a product of value or the fine
chemicals also in unicellular plant cells (such as algae), see
Falciatore, 1999, Marine Biotechnology 1 (3):239 and references
therein, and in plant cells of higher plants (e.g. spermatophytes
such as crops) so that said plants have higher L450 activity and,
consequently, a higher growth rate. Examples of plant expression
vectors include those described in detail above or those from
Becker, (1992), Plant Mol. Biol. 20:1195 and Bevan, (1984), Nucl.
Acids Res. 12:8711; Vectors for Gene Transfer in Higher Plants; in:
Transgenic Plants, vol. 1, Engineering and Utilization, eds: Kung
and R. Wu, Academic Press, 1993, p. 15. A relatively recent review
of Agrobacterium binary vectors can be found in Hellens, 2000,
Trends in Plant Science, Vol. 5, 446.
[0402] Host organisms which are advantageously used are bacteria,
fungi, yeasts or plants, preferably crop plants or parts thereof.
Preference is given to using fungi, yeasts or plants, particularly
preferably plants, and special mention may be made of agricultural
useful plants such as cereals and grasses, e.g. Triticum spp., Zea
mais, Hordeum vulgare, oats, Secale cereale, Oryza sativa,
Pennisetum glaucum, Sorghum bicolor, Triticale, Agrostis spp.,
Cenchrus ciliaris, Dactylis glomerata, Festuca arundinacea, Lolium
spp., Medicago spp., Alfalfa and Saccharum spp., legumes and oil
seed crops, e.g. Brassica juncea, Brassica napus, Brassica nigra,
Sinapes alba, Glycine max, Arachis hypogaea, canola, castor oil
plant, coconut, oil palm, cocoa bean, date palm, Gossypium
hirsutum, Cicer arietinum, Helianthus annuus, Lens culinaris, Linum
usitatissimum, Sinapis alba, Trifolium repens, Carthamus tinctorius
and Vicia narbonensis, hemp, vegetables, lettuce and fruits, e.g.
bananas, grapes, Lycopersicon esculentum, asparagus, cabbage,
watermelons, kiwis, Solanum tuberosum, Solanum lypersicum, carrots,
paprika, tapioca, manioc, Beta vulgaris, cassaya and chicory,
arrowroot, nut and grape species, trees, e.g. Coffea species,
Citrus spp., Eucalyptus spp., Picea spp., Pinus spp. and Populus
spp., tobacco, medicinal plants and trees and flowers, e.g.
Tagetes.
[0403] If plants are selected as danor organism, said plant may in
principle have any phylogenetic relationship to the receptor plant.
Thus danor plant and receptor plant may belong to the same family,
genus, species, variety or line, which results in increasing
homology between the nucleic acids to be integrated and
corresponding parts of the genome of the receptor plant.
[0404] According to a particular embodiment of the present
invention, the donor organism is a higher plant, preferably of the
genus Arabidapsis thaliana particularly preferred, are crop plants
as are mentioned herein.
[0405] Preferred receptor plants are particularly plants which can
be appropriately transformed. These include mono- and
dicotyledonous plants. In particular mention should be made of the
agricultural useful plants such as cereals and grasses, e.g.
Triticum spp., Zea mais, Hordeum vulgare, oats, Secale cereale,
Oryza sativa, Pennisetum glaucum, Sorghum bicolor, Triticale,
Agrostis spp., Cenchrus ciliaris, Dactylis glomerata, Festuca
arundinacea, Lolium spp., Medicago spp. and Saccharum spp., legumes
and oil seed crops, e.g. Brassica juncea, Brassica napus, Glycine
max, Arachis hypogaea, Gossypium hirsutum, Cicer arietinum,
Helianthus annuus, Lens culinaris, Linum usitatissimum, Sinapis
alba, Trifolium repens and Vicia narbonensis, vegetables and
fruits, e.g. bananas, grapes, Lycopersicon esculentum, asparagus,
cabbage, watermelons, kiwis, Solanum tuberosum, Beta vulgaris,
cassaya and chicory, trees, e.g. Coffea species, Citrus spp.,
Eucalyptus spp., Picea spp., Pinus spp. and Populus spp., medicinal
plants and trees, and flowers. According to a particular
embodiment, the present invention relates to transgenic plants of
the genus Arabidopsis, e.g. Arabidopsis thaliana and of the genus
Oryza.
[0406] After transformation, plants are first regenerated as
described above and then cultivated and grown as usual.
[0407] The plant compartments, plant organelles, plant cells, plant
tissues or plants of the invention is preferably produced according
to the method of the invention or contains the gene construct
described herein or the described vector.
[0408] In one embodiment, the invention relates to the yield or the
propagation material of a plant of the invention or of a useful
animal of the invention or to the biomass of a microorganism, i.e.
the biomaterial of a nonhuman organism prepared according to the
method of the invention.
[0409] The present invention also relates to transgenic plant
material derivable from an inventive population of transgenic
plants. Said material includes plant cells and certain tissues,
organs and parts of plants in any phenotypic forms thereof, such as
seeds, leaves, anthers, fibers, roots, root hairs, stalks, embryos,
kalli, cotyledons, petioles, harvested material, plant tissue,
reproductive tissue and cell cultures, which has been derived from
the actual transgenic plant and/or may be used for producing the
transgenic plant.
[0410] Preference is given to any plant parts or plant organs such
as leaf, stem, shoot, flower, root, tubers, fruits, bark, wood,
seeds, etc. or the entire plant. Seeds include in this connection
all seed parts such as seed covers, epidermal and seed cells,
endosperm or embryonic tissue. Particular preference is given to
harvested products, in particular fruits, seeds, tubers, fruits,
roots, bark or leaves or parts thereof.
[0411] In the method of the invention, transgenic plants also mean
plant cells, plant tissues or plant organs to be regarded as
agricultural product.
[0412] The biomaterial produced in the method, in particular of
plants which have been modified by the method of the invention, may
be marketed directly.
[0413] The invention likewise relates in one embodiment to
propagation material of a plant prepared according to the method of
the invention. Propagation material means any material which may
serve for seeding or growing plants, even if it may have, for
example, another function, e.g. as food.
[0414] "Growth" also means, for example, culturing the transgenic
plant cells, plant tissues or plant organs on a nutrient medium or
the whole plant on or in a substrate, for example in hydroculture
or on a field.
[0415] Use of the polynucleotide used in the method of the
invention and characterized herein, of the gene construct, of the
vector, of the plant cell or of the plant or of the plant tissue or
of the plant material for preparing a plant with increased
yield.
[0416] Suitable host organisms are in principle, in addition to the
aforementioned transgenic organisms, also transgenic nonhuman
useful animals, for example pigs, cattle, sheep, goats, chickens,
geese, ducks, turkeys, horses, donkeys, etc., which have preferably
been transiently or stably transformed with a polynucleotide which
comprises a nucleic acid molecule encoding an L450 polypeptide or a
nucleic acid molecule characterized herein as suitable for the
method of the invention.
[0417] In another preferred embodiment, the invention relates in
particular to a useful animal or animal organ having an increased
amount of L450 and/or containing the useful animal cell of the
invention.
[0418] The useful animals comprise an increased amount of L450, in
particular an increase in expression or activity, and consequently
an increased growth rate, i.e. faster growth and increased weight
or increased production of agricultural products as listed
above.
[0419] Preference is given to the useful animals being cattle,
pigs, sheep or goats.
[0420] In one embodiment, the invention relates to the use of an
L450 polypeptide or of the polynucleotide or polypeptide of the
invention for increasing the yield and/or increasing growth of a
nonhuman organism compared to a starting organism.
[0421] A further embodiment of the invention is the use of the
products obtained by means of said methods, for example
biomaterial, in particular plant materials as mentioned, in food
products, animal feed products, nutrients, cosmetics or
pharmaceuticals. It is also possible to isolate commercially
utilizable substances such as fine chemicals from the plants or
parts of plants obtained by means of the method of the
invention.
[0422] The examples and figures below which should not be regarded
as limiting further illustrate the present invention.
[0423] In a further embodiment, the present invention relates to a
method for the generation of a microorganism, comprising the
introduction, into the microorganism or parts thereof, of the
expression construct of the invention, or the vector of the
invention or the polynucleotide of the invention.
[0424] In another embodiment, the present invention relates also to
a transgenic microorganism comprising the polynucleotide of the
invention, the expression construct of the invention or the vector
as of the invention. Appropriate microorganisms have been described
herein before, preferred are in particular aforementioned strains
suitable for the production of fine chemicals.
[0425] The fine chemicals obtained in the method are suitable as
starting material for the synthesis of further products of value.
For example, they can be used in combination with each other or
alone for the production of pharmaceuticals, foodstuffs, animal
feeds or cosmetics. Accordingly, the present invention relates a
method for the production of a pharmaceuticals, food stuff, animal
feeds, nutrients or cosmetics comprising the steps of the method
according to the invention, including the isolation of the fine
chemicals, in particular amino acid composition produced e.g.
methionine produced if desired and formulating the product with a
pharmaceutical acceptable carrier or formulating the product in a
form acceptable for an application in agriculture. A further
embodiment according to the invention is the use of the fine
chemicals produced in the method or of the transgenic organisms in
animal feeds, foodstuffs, medicines, food supplements, cosmetics or
pharmaceuticals.
[0426] It is advantageous to use in the method of the invention
transgenic microorganisms such as fungi such as the genus Claviceps
or Aspergillus or Gram-positive bacteria such as the genera
Bacillus, Corynebacterium, Micrococcus, Brevibacterium,
Rhodococcus, Nocardia, Caseobacter or Arthrobacter or Gram-negative
bacteria such as the genera Escherichia, Flavobacterium or
Salmonella or yeasts such as the genera Rhodotorula, Hansenula or
Candida. Particularly advantageous organisms are selected from the
group of genera Corynebacterium, Brevibacterium, Escherichia,
Bacillus, Rhodotorula, Hansenula, Candida, Claviceps or
Flavobacterium. It is very particularly advantageous to use in the
method of the invention microorganisms selected from the group of
genera and species consisting of Hansenula anomala, Candida utilis,
Claviceps purpurea, Bacillus circulans, Bacillus subtilis, Bacillus
sp., Brevibacterium albidum, Brevibacterium album, Brevibacterium
cerinum, Brevibacterium flavum, Brevibacterium glutamigenes,
Brevibacterium iodinum, Brevibacterium ketoglutamicum,
Brevibacterium lactofermentum, Brevibacterium linens,
Brevibacterium roseum, Brevibacterium saccharolyticum,
Brevibacterium sp., Corynebacterium acetoacidophilum,
Corynebacterium acetoglutamicum, Corynebacterium ammoniagenes,
Corynebacterium glutamicum (=Micrococcus glutamicum),
Corynebacterium melassecola, Corynebacterium sp. or Escherichia
coli, specifically Escherichia coli K12 and its described
strains.
[0427] The method of the invention is, when the host organisms are
microorganisms, advantageously carried out at a temperature between
0.degree. C. and 95.degree. C., preferably between 10.degree. C.
and 85.degree. C., particularly preferably between 15.degree. C.
and 75.degree. C., very particularly preferably between 15.degree.
C. and 45.degree. C. The pH is advantageously kept at between pH 4
and 12, preferably between pH 6 and 9, particularly preferably
between pH 7 and 8, during this. The method of the invention can be
operated batchwise, semibatchwise or continuously. A summary of
known cultivation methods is to be found in the textbook by Chmiel
(Bioproze.beta.technik 1. Einfuhrung in die Bioverfahrenstechnik
(Gustav Fischer Verlag, Stuttgart, 1991)) or in the textbook by
Storhas (Bioreaktoren and periphere Einrichtungen (Vieweg Verlag,
Braunschweig/Wiesbaden, 1994)). The culture medium to be used must
meet the requirements of the respective strains in a suitable
manner. Descriptions of culture media for various microorganisms
are present in the handbook "Manual of Methods for General
Bacteriology" of the American Society for Bacteriology (Washington
D.C., USA, 1981). These media, which can be employed according to
the invention include, as described above, usually one or more
carbon sources, nitrogen sources, inorganic salts, vitamins and/or
trace elements. Preferred carbon sources are sugars such as mono-,
di- or polysaccharides. Examples of very good carbon sources are
glucose, fructose, mannose, galactose, ribose, sorbose, ribulose,
lactose, maltose, sucrose, raffinose, starch or cellulose. Sugars
can also be added to the media via complex compounds such as
molasses, or other byproducts of sugar refining. It may also be
advantageous to add mixtures of various carbon sources. Other
possible carbon sources are oils and fats such as, for example,
soybean oil, sunflower oil, peanut oil and/or coconut fat, fatty
acids such as, for example, palmitic acid, stearic acid and/or
linoleic acid, alcohols and/or polyalcohols such as, for example,
glycerol, methanol and/or ethanol and/or organic acids such as, for
example, acetic acid and/or lactic acid. Nitrogen sources are
usually organic or inorganic nitrogen compounds or materials, which
contain these compounds. Examples of nitrogen sources include
ammonia in liquid or gaseous form or ammonium salts such as
ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium
carbonate or ammonium nitrate, nitrates, urea, amino acids or
complex nitrogen sources such as corn steep liquor, soybean meal,
soybean protein, yeast extract, meat extract and others. The
nitrogen sources may be used singly or as a mixture. Inorganic salt
compounds, which may be present in the media include the chloride,
phosphorus or sulfate salts of calcium, magnesium, sodium, cobalt,
molybdenum, potassium, manganese, zinc, copper and iron. For
preparing sulfur-containing fine chemicals, in particular amino
acids, e.g. methionine, it is possible to use as sulfur source
inorganic sulfur-containing compounds such as, for example,
sulfates, sulfites, dithionites, tetrathionates, thiosulfates,
sulfides or else organic sulfur compounds such as mercaptans and
thiols. It is possible to use as phosphorus source phosphoric acid,
potassium dihydrogenphosphate or dipotassium hydrogenphosphate or
the corresponding sodium-containing salts. Chelating agents can be
added to the medium in order to keep the metal ions in solution.
Particularly suitable chelating agents include dihydroxyphenols
such as catechol or protocatechuate, or organic acids such as
citric acid. The fermentation media employed according to the
invention for cultivating microorganisms normally also contain
other growth factors such as vitamins or growth promoters, which
include, for example, biotin, riboflavin, thiamine, folic acid,
nicotinic acid, pantothenate and pyridoxine. Growth factors and
salts are often derived from complex media components such as yeast
extract, molasses, corn steep liquor and the like. Suitable
precursors can moreover be added to the culture medium. The exact
composition of the media compounds depends greatly on the
particular experiment and is chosen individually for each specific
case. Information about media optimization is obtainable from the
textbook "Applied Microbiol. Physiology, A Practical Approach"
(editors P. M. Rhodes, P. F. Stanbury, IRL Press (1997) pp. 53-73,
ISBN 0 19 963577 3). Growth media can also be purchased from
commercial suppliers such as Standard 1 (Merck) or BHI (Brain heart
infusion, DIFCO) and the like. All media components are sterilized
either by heat (1.5 bar and 121.degree. C. for 20 min) or by
sterilizing filtration. The components can be sterilized either
together or, if necessary, separately. All media components can be
present at the start of the cultivation or optionally be added
continuously or batchwise. The temperature of the culture is
normally between 15.degree. C. and 45.degree. C., preferably at
25.degree. C. to 40.degree. C., and can be kept constant or changed
during the experiment. The pH of the medium should be in the range
from 5 to 8.5, preferably around 7. The pH for the cultivation can
be controlled during the cultivation by adding basic compounds such
as sodium hydroxide, potassium hydroxide, ammonia or aqueous
ammonia or acidic compounds such as phosphoric acid or sulfuric
acid. Foaming can be controlled by employing antifoams such as, for
example, fatty acid polyglycol esters. The stability of plasmids
can be maintained by adding to the medium suitable substances
having a selective effect, for example antibiotics. Aerobic
conditions are maintained by introducing oxygen or
oxygen-containing gas mixtures such as, for example, ambient air
into the culture. The temperature of the culture is normally from
20.degree. C. to 45.degree. C. and preferably from 25.degree. C. to
40.degree. C.
[0428] The culture is continued until formation of the desired
product is at a maximum. This aim is normally achieved within 10
hours to 160 hours. The fermentation broths obtained in this way,
containing in particular fine chemicals, normally have a dry matter
content of from 7.5 to 25% by weight. Sugar-limited fermentation is
additionally advantageous, at least at the end, but especially over
at least 30% of the fermentation time. This means that the
concentration of utilizable sugar in the fermentation medium is
kept at, or reduced to, .gtoreq.0 to 3 g/l during this time. The
fermentation broth is then processed further. Depending on
requirements, the biomass can be removed entirely or partly by
separation methods, such as, for example, centrifugation,
filtration, decantation or a combination of these methods, from the
fermentation broth or left completely in it. The fermentation broth
can then be thickened or concentrated by known methods, such as,
for example, with the aid of a rotary evaporator, thin-film
evaporator, falling film evaporator, by reverse osmosis or by
nanofiltration. This concentrated fermentation broth can then be
worked up by freeze-drying, spray drying, spray granulation or by
other methods.
[0429] However, it is also possible to purify the fine chemicals
produced further. For this purpose, the product-containing
composition is subjected to a chromatography on a suitable resin,
in which case the desired product or the impurities are retained
wholly or partly on the chromatography resin. These chromatography
steps can be repeated if necessary, using the same or different
chromatography resins. The skilled worker is familiar with the
choice of suitable chromatography resins and their most effective
use. The purified product can be concentrated by filtration or
ultrafiltration and stored at a temperature at which the stability
of the product is a maximum.
[0430] The identity and purity of the isolated compound(s) can be
determined by prior art techniques. These include high performance
liquid chromatography (HPLC), spectroscopic methods, mass
spectrometry (MS), staining methods, thin-layer chromatography,
NIRS, enzyme assay or microbiological assays. These analytical
methods are summarized in: Patek et al. (1994) Appl. Environ.
Microbiol. 60:133-140; Malakhova et al. (1996) Biotekhnologiya 11
27-32; and Schmidt et al. (1998) Bioprocess Engineer. 19:67-70.
Ulmann's Encyclopedia of Industrial Chemistry (1996) Vol. A27, VCH:
Weinheim, pp. 89-90, pp. 521-540, pp. 540-547, pp. 559-566, 575-581
and pp. 581-587; Michal, G (1999) Biochemical Pathways: An Atlas of
Biochemistry and Molecular Biology, John Wiley and Sons; Fallon, A.
et al. (1987) Applications of HPLC in Biochemistry in: Laboratory
Techniques in Biochemistry and Molecular Biology, Vol. 17.
[0431] In yet another aspect, the invention also relates to
harvestable parts and to propagation material of the transgenic
plants according to the invention which either contain transgenic
plant cells expressing a nucleic acid molecule according to the
invention or which contains cells which show an increased cellular
activity of the polypeptide of the invention, e.g. an increased
expression level or higher activity of the described protein.
[0432] Harvestable parts can be in principle any useful parts of a
plant, for example, flowers, pollen, seedlings, tubers, leaves,
stems, fruit, seeds, roots etc. Propagation material includes, for
example, seeds, fruits, cuttings, seedlings, tubers, rootstocks
etc.
[0433] The invention furthermore relates to the use of the
transgenic organisms according to the invention and of the cells,
cell cultures, parts--such as, for example, roots, leaves and the
like as mentioned above in the case of transgenic plant
organisms--derived from them, and to transgenic propagation
material such as seeds or fruits and the like as mentioned above,
for the production of foodstuffs or feeding stuffs, pharmaceuticals
or fine chemicals.
[0434] Accordingly in another embodiment, the present invention
relates to the use of the polynucleotide, the organism, e.g. the
microorganism, the plant, plant cell or plant tissue, the vector,
or the polypeptide of the present invention for making fatty acids,
carotenoids, isoprenoids, vitamins, lipids, wax esters,
(poly)saccharides and/or polyhydroxyalkanoates, and/or its
metabolism products, in particular, steroid hormones, cholesterol,
prostaglandin, triacylglycerols, bile acids and/or ketone bodies
producing cells, tissues and/or plants.
[0435] There are a number of mechanisms by which the yield,
production, and/or efficiency of production of fatty acids,
carotenoids, isoprenoids, vitamins, wax esters, lipids,
(poly)saccharides and/or polyhydroxyalkanoates, and/or its
metabolism products, in particular, steroid hormones, cholesterol,
triacylglycerols, prostaglandin, bile acids and/or ketone bodies or
further of above defined fine chemicals incorporating such an
altered protein can be affected. In the case of plants, by e.g.
increasing the expression of acetyl-CoA which is the basis for many
products, e.g., fatty acids, carotenoids, isoprenoids, vitamines,
lipids, (poly)saccharides, wax esters, and/or
polyhydroxyalkanoates, and/or its metabolism products, in
particular, prostaglandin, steroid hormones, cholesterol,
triacylglycerols, bile acids and/or ketone bodies in a cell, it may
be possible to increase the amount of the produced said compounds
thus permitting greater ease of harvesting and purification or in
case of plants more efficient partitioning. Further, one or more of
said metabolism products, increased amounts of the cofactors,
precursor molecules, and intermediate compounds for the appropriate
biosynthetic pathways maybe required. Therefore, by increasing the
number and/or activity of transporter proteins involved in the
import of nutrients, such as carbon sources (i.e., sugars),
nitrogen sources (i.e., amino acids, ammonium salts), phosphate,
and sulfur, it may be possible to improve the production of acetyl
CoA and its metabolism products as mentioned above, due to the
removal of any nutrient supply limitations on the biosynthetic
process. In particular, it may be possible to increase the yield,
production, and/or efficiency of production of said compounds, e.g.
fatty acids, carotenoids, isoprenoids, vitamins, was esters,
lipids, (poly)saccharides, and/or polyhydroxyalkanoates, and/or its
metabolism products, in particular, steroid hormones, cholesterol,
prostaglandin, triacylglycerols, bile acids and/or ketone bodies
molecules etc. in plants.
[0436] Furthermore preferred is a method for the recombinant
production of pharmaceuticals or fine chemicals in host organisms,
wherein a host organism is transformed with one of the
above-described expression constructs comprising one or more
structural genes which encode the desired fine chemical or catalyze
the biosynthesis of the desired fine chemical, the transformed host
organism is cultured, and the desired fine chemical is isolated
from the culture medium. This method can be applied widely to fine
chemicals such as enzymes, vitamins, amino acids, sugars, fatty
acids, and natural and synthetic flavorings, aroma substances and
colorants or compositions comprising these. Especially preferred is
the additional production of amino acids, tocopherols and
tocotrienols and carotenoids or compositions comprising said
compounds. The transformed host organisms are cultured and the
products are recovered from the host organisms or the culture
medium by methods known to the skilled worker or the organism
itself servers as food or feed supplement. The production of
pharmaceuticals such as, for example, antibodies or vaccines, is
described by Hood E E, Jilka J M. Curr Opin Biotechnol. 1999
August; 10(4):382-6; Ma J K, Vine N D. Curr Top Microbiol Immunol.
1999; 236:275-92.
[0437] In one embodiment, the present invention relates to a method
for the identification of a gene product conferring an increase in
growth or yield in an organism, comprising the following steps:
contacting e.g. hybridising, the nucleic acid molecules of a
sample, e.g. cells, tissues, plants or microorganisms or a nucleic
acid library, which can contain a candidate gene encoding a gene
product conferring an in yield or growth as described above after
expression, with the polynucleotide of the present invention;
identifying the nucleic acid molecules, which hybridize under
relaxed stringent conditions with the polynucleotide of the present
invention and, optionally, isolating the full length cDNA clone or
complete genomic clone; introducing the candidate nucleic acid
molecules in host cells, preferably in a plant cell or a
microorganism; expressing the identified nucleic acid molecules in
the host cells; deriving, a transgenic organism and assaying the
growth rate or yield in the host cells; and identifying the nucleic
acid molecule and its gene product which expression confers an
increase after expression compared to the wild type.
[0438] Relaxed hybridisation conditions are: After standard
hybridisation procedures washing steps can be performed at low to
medium stringency conditions usually with washing conditions of
40.degree.-55.degree. C. and salt conditions between 2.times.SSC
and 0.2.times.SSC with 0.1% SDS in comparison to stringent washing
conditions as e.g. 60.degree.-68.degree. C. with 0.1.times.SSC and
0.1% SDS. Further examples can be found in the references listed
above for the stringend hybridization conditions. Usually washing
steps are repeated with increasing stringency and length until a
useful signal to noise ratio is detected and depend on many factors
as the target, e.g. its purity, GC-content, size etc, the probe,
e.g. its length, is it a RNA or a DNA probe, salt conditions,
washing or hybridisation temperature, washing or hybridisation time
etc.
[0439] In an other embodiment, the present invention relates to a
method for the identification of a gene product conferring an
increase in yield or growth in an organism, comprising the
following steps: [0440] a) identifying nucleic acid molecules of an
organism; which can contain a candidate gene encoding a gene
product conferring an increase in growth rate and/or yield after
expression, which are at least 20%, preferably 25%, more preferably
30%, even more preferred are 35%. 40% or 50%, even more preferred
are 60%, 70% or 80%, most preferred are 90% or 95% or more homology
to the nucleic acid molecule of the present invention, for example
via homology search in a data bank; [0441] b) introducing the
candidate nucleic acid molecules in host cells, preferably in a
plant cells or microorganisms, appropriate for producing feed or
food stuff or fine chemicals; [0442] c) expressing the identified
nucleic acid molecules in the host cells; [0443] d) deriving the
organism and assaying the yield or growth of the organism; [0444]
e) and identifying the nucleic acid molecule and its gene product
which expression confers an increase in the yield or growth of the
host cell after expression compared to the wild type.
[0445] The nucleic acid molecules identified can then be used in
the same way as the polynucleotide of the present invention.
[0446] Furthermore, in one embodiment, the present invention
relates to a method for the identification of a compound
stimulating growth or yield to said plant comprising: [0447] a)
contacting cells which express the polypeptide of the present
invention or its mRNA with a candidate compound under cell
cultivation conditions; [0448] b) assaying an increase in
expression of said polypeptide or said mRNA; comparing the
expression level to a standard response made in the absence of said
candidate compound; whereby, an increased expression over the
standard indicates that the compound is stimulating yield or
growth.
[0449] Furthermore, in one embodiment, the present invention
relates to a method for the screening for agonists of the activity
of the polypeptide of the present invention: [0450] a) contacting
cells, tissues , plants or microorganisms which express the
polypeptide according to the invention with a candidate compound or
a sample comprising a plurality of compounds under conditions which
permit the expression the polypeptide of the present invention;
[0451] b) assaying the growth, yield or the polypeptide expression
level in the cell, tissue, plant or microorganism or the media the
cell, tissue, plant or microorganisms is cultured or maintained in;
and [0452] c) identifying an agonist or antagonist by comparing the
measured growth or yield or polypeptide expression level with a
standard growth, yield or polypeptide expression level measured in
the absence of said candidate compound or a sample comprising said
plurality of compounds, whereby an increased level over the
standard indicates that the compound or the sample comprising said
plurality of compounds is an agonist and a decreased level over the
standard indicates that the compound or the sample comprising said
plurality of compounds is an antagonist.
[0453] Furthermore, in one embodiment, the present invention
relates to process for the identification of a compound conferring
increased growth and/or yield production in a plant or
microorganism, comprising the steps: [0454] a) culturing a cell or
tissue or microorganism or maintaining a plant expressing the
polypeptide according to the invention or a nucleic acid molecule
encoding said polypeptide and a readout system capable of
interacting [0455] with the polypeptide under suitable conditions
which permit the interaction of the polypeptide with said readout
system in the presence of a compound or a sample comprising a
plurality of compounds and capable of providing a' detectable
signal in response to the binding of a compound to said polypeptide
under conditions which permit the expression of said readout system
and the polypeptide of the present invention; and [0456] b)
identifying if the compound is an effective agonist by detecting
the presence or absence or increase of a signal produced by said
readout system.
[0457] Said compound may be chemically synthesized or
microbiologically produced and/or comprised in, for example,
samples, e.g., cell extracts from, e.g., plants, animals or
microorganisms, e.g. pathogens. Furthermore, said compound(s) may
be known in the art but hitherto not known to be capable of
suppressing or activating the polypeptide of the present invention.
The reaction mixture may be a cell free extract or may comprise a
cell or tissue culture. Suitable set ups for the method of the
invention are known to the person skilled in the art and are, for
example, generally described in Alberts et al., Molecular Biology
of the Cell, third edition (1994), in particular Chapter 17. The
compounds may be, e.g., added to the reaction mixture, culture
medium, injected into the cell or sprayed onto the plant.
[0458] If a sample containing a compound is identified in the
method of the invention, then it is either possible to isolate the
compound from the original sample identified as containing the
compound capable of activating or increasing, or one can further
subdivide the original sample, for example, if it consists of a
plurality of different compounds, so as to reduce the number of
different substances per sample and repeat the method with the
subdivisions of the original sample. Depending on the complexity of
the samples, the steps described above can be performed several
times, preferably until the sample identified according to the
method of the invention only comprises a limited number of or only
one substance(s). Preferably said sample comprises substances of
similar chemical and/or physical properties, and most preferably
said substances are identical. Preferably, the compound identified
according to the above described method or its derivative is
further formulated in a form suitable for the application in plant
breeding or plant cell and tissue culture.
[0459] The compounds which can be tested and identified according
to a method of the invention may be expression libraries, e.g.,
cDNA expression libraries, peptides, proteins, nucleic acids,
antibodies, small organic compounds, hormones, peptidomimetics,
PNAs or the like (Milner, Nature Medicine 1 (1995), 879-880; Hupp,
Cell 83 (1995), 237-245; Gibbs, Cell 79 (1994), 193-198 and
references cited supra). Said compounds can also be functional
derivatives or analogues of known inhibitors or activators. Methods
for the preparation of chemical derivatives and analogues are well
known to those skilled in the art and are described in, for
example, Beilstein, Handbook of Organic Chemistry, Springer edition
New York Inc., 175 Fifth Avenue, New York, N.Y. 10010 U.S.A. and
Organic Synthesis, Wiley, New York, USA. Furthermore, said
derivatives and analogues can be tested for their effects according
to methods known in the art. Furthermore, peptidomimetics and/or
computer aided design of appropriate derivatives and analogues can
be used, for example, according to the methods described above. The
cell or tissue that may be employed in the method of the invention
preferably is a host cell, plant cell or plant tissue of the
invention described in the embodiments hereinbefore.
[0460] Thus, in a further embodiment the invention relates to a
compound obtained or identified according to the method for
identifying an agonist of the invention said compound being an
agonist of the polypeptide of the present invention.
[0461] Accordingly, in one embodiment, the present invention
further relates to a compound identified by the method for
identifying a compound of the present invention.
[0462] Said compound is, for example, a homologous of the
polypeptide of the present invention. Homologues of the polypeptide
of the present invention can be generated by mutagenesis, e.g.,
discrete point mutation or truncation of the polypeptide of the
present invention. As used herein, the term "homologue" refers to a
variant form of the protein, which acts as an agonist of the
activity of the polypeptide of the present invention. An agonist of
said protein can retain substantially the same, or a subset, of the
biological activities of the polypeptide of the present invention.
In particular, said agonist confers the increase of the expression
level of the polypeptide of the present invention and/or the
expression of said agonist in an organisms or part thereof confers
the increase in growth and/or yield.
[0463] In one embodiment, the invention relates to an antibody
specifically recognizing the compound or agonist of the present
invention.
[0464] The invention also relates to a diagnostic composition
comprising at least one of the aforementioned polynucleotide,
nucleic acid molecules, vectors, proteins, antibodies or compounds
of the invention and optionally suitable means for detection.
[0465] The diagnostic composition of the present invention is
suitable for the isolation of mRNA from a cell and contacting the
mRNA so obtained with a probe comprising a nucleic acid probe as
described above under hybridizing conditions, detecting the
presence of mRNA hybridized to the probe, and thereby detecting the
expression of the protein in the cell. Further methods of detecting
the presence of a protein according to the present invention
comprise immunotechniques well known in the art, for example enzyme
linked immunosorbent assay.
[0466] Furthermore, it is useful to use the nucleic acid molecules
according to the invention as molecular markers or primer in
association mapping or plant breeding especially marker assisted
breeding. Suitable means for detection are well known to a person
skilled in the arm, e.g. buffers and solutions for hydridization
assays, e.g. the aforementioned solutions and buffers, further and
means for Southern-, Western-, Northern-etc.-blots, as e.g.
described in Sambrook et al. are known.
[0467] In another embodiment, the present invention relates to a
kit comprising the nucleic acid molecule, the vector, the host
cell, the polypeptide, the antisense nucleic acid, the antibody,
plant cell, the plant or plant tissue, the harvestable part, the
propagation material and/or the compound or agonist identified
according to the method of the invention.
[0468] The compounds of the kit of the present invention may be
packaged in containers such as vials, optionally with/in buffers
and/or solution. If appropriate, one or more of said components
might be packaged in one and the same container. Additionally or
alternatively, one or more of said components might be adsorbed to
a solid support as, e.g. a nitrocellulose filter, a glass plate, a
chip, or a nylon membrane or to the well of a micro titerplate. The
kit can be used for any of the herein described methods and
embodiments, e.g. for the production of the host cells, transgenic
plants, pharmaceutical compositions, detection of homologous
sequences, identification of antagonists or agonists, as food or
feed or as a supplement thereof, as supplement for the treating of
plants, etc.
[0469] Further, the kit can comprise instructions for the use of
the kit for any of said embodiments, in particular for the use for
producing organisms or part thereof.
[0470] In one embodiment said kit comprises further a nucleic acid
molecule encoding one or more of the aforementioned protein, and/or
an antibody, a vector, a host cell, an antisense nucleic acid, a
plant cell or plant tissue or a plant.
[0471] In a further embodiment, the present invention relates to a
method for the production of a agricultural composition providing
the nucleic acid molecule, the vector or the polypeptide of the
invention or comprising the steps of the method according to the
invention for the identification of said compound, agonist or
antagonist; and formulating the nucleic acid molecule, the vector
or the polypeptide of the invention or the agonist, or compound
identified according to the methods or processes of the present
invention or with use of the subject matters of the present
invention in a form applicable as plant agricultural
composition.
[0472] In another embodiment, the present invention relates to a
method for the production of an agricultural composition conferring
increased growth or yield of a plant comprising the steps of the
method for of the present invention; and formulating the compound
identified in a form acceptable as agricultural composition.
[0473] Under "acceptable as agricultural composition" is
understood, that such a composition is in agreement with the laws
regulating the content of fungicides, plant nutrients, herbizides,
etc. Preferably such a composition is without any harm for the
protected plants and the animals (humans included) fed
therewith.
[0474] The present invention also pertains to several embodiments
relating to further uses and methods. The polynucleotide,
polypeptide, protein homologues, fusion proteins, primers, vectors,
host cells, described herein can be used in one or more of the
following methods: identification of plants useful pro amino acid
production as mentioned and related organisms; mapping of genomes;
identification and localization of sequences of interest;
evolutionary studies; determination of regions required for
function; modulation of an activity.
[0475] Advantageously, inhibitor of the polypeptide of the present
invention, identified in an analogous way to the identification of
agonist, can be used as herbicides. The inhibition of the
polypeptide of the present invention can reduce the growth of
plants. For example, the application of the inhibitor on a field is
inhibiting the growth of plants not desired if useful plants which
are over-expressing the polypeptide of the invention can
survive.
[0476] Accordingly, the polynucleotide of the present invention
have a variety of uses. First, they may be used to identify an
organism or a close relative thereof. Also, they may be used to
identify the presence thereof or a relative thereof in a mixed
population of microorganisms or plants. By probing the extracted
genomic DNA of a culture of a unique or mixed population of plants
under stringent conditions with a probe spanning a region of the
gene of the present invention which is unique to this, one can
ascertain whether the present
[0477] Further, the polynucleotide of the invention may be
sufficiently homologous to the sequences of related species such
that these nucleic acid molecules may serve as markers for the
construction of a genomic map in related organism.
[0478] The polynucleotide of the invention are also useful for
evolutionary and protein structural studies. By comparing the
sequences of to those encoding similar enzymes from other
organisms, the evolutionary relatedness of the organisms can be
assessed. Similarly, such a comparison permits an assessment of
which regions of the sequence are conserved and which are not,
which may aid in determining those regions of the protein which are
essential for the functioning of the enzyme. This type of
determination is of value for protein engineering studies and may
give an indication of what the protein can tolerate in terms of
mutagenesis without losing function.
[0479] Further, the polynucleotide of the invention, the
polypeptide of the invention, the nucleic acid construct of the
invention, the organisms, the host cell, the microorgansims, the
plant, plant tissue, plant cell, or the part thereof of the
invention, the vector of the invention, the antagonist or the
agonist identified with the method of the invention, the antibody
of the present invention, the antisense molecule of the present
invention or the nucleic acid molecule identified with the method
of the present invention, can be used for the preparation of an
agricultural composition.
[0480] Furthermore, the polynucleotide of the invention, the
polypeptide of the invention, the nucleic acid construct of the
invention, the organisms, the host cell, the microorgansims, the
plant, plant tissue, plant cell, or the part thereof of the
invention, the vector of the invention, antagonist or the agonist
identified with the method of the invention, the antibody of the
present invention, the antisense molecule of the present invention
or the nucleic acid molecule identified with the method of the
present invention, can be used for the identification and
production of compounds capable of conferring a modulation of yield
or growth levels in an organism or parts thereof, preferably to
identify and produce compounds conferring an increase of growth and
yield levels or rates in an organism or parts thereof, if said
identified compound is applied to the organism or part thereof,
i.e. as part of its food, or in the growing or culture media.
[0481] These and other embodiments are disclosed and encompassed by
the description and examples of the present invention. Further
literature concerning any one of the methods, uses and compounds to
be employed in accordance with the present invention may be
retrieved from public libraries, using for example electronic
devices. For example the public database "Medline" may be utilized
which is available on the Internet, for example under
http://www.ncbi.nlm.nih.gov/PubMed/medline.html. Further databases
and addresses, such as http://www.ncbi.nlm.nih.gov/,
http://www.infobiogen.fr/,
http://www.fmi.ch/biology/research-tools.html,
http://www.tigr.org/, are known to the person skilled in the art
and can also be obtained using, e.g., http://www.lycos.com. An
overview of patent information in biotechnology and a survey of
relevant sources of patent information useful for retrospective
searching and for current awareness is given in Berks, TIBTECH 12
(1994), 352-364.
[0482] FIG. 1 depicts the Northern blot analysis of an
L450-overexpressing line (450B). Three plants of this line and two
wild-type plants were analyzed. The lower, strongly hybridizing
band corresponds to the L450 transcript.
[0483] FIG. 2 depicts the construct 1bx SuperColicMOB24.15.
[0484] FIG. 3 depicts the Blast comparison between the sequence
depicted in Seq. ID No. 1 and the sequence published under Seq. ID
No. 701 in US 2002/0023281 (Seq. ID No. 23).
[0485] FIG. 4 depicts the observed correlation of the expression
level of the transgenic At3g24570 gene as a function of the
increase in fresh weight.
[0486] FIG. 5 shows the increased biomass of Arabidopsis plants
after over expression of L450 (MOB 24.15) compared to wildtype.
[0487] FIG. 6 shows, that the 100-seeds weight of lines, over
expressing L450 (K0450 lines) is increased compared to the wildtype
C24.
[0488] FIG. 7 shows multiple alignment and consensus sequence of
plant, microorganism and animal derived sequences and the consensus
sequence of the shown sequences.
[0489] FIG. 8 shows multiple alignment and consensus sequence of
the plant derived sequences without Seq ID No. 43, and the
consensus sequence of the shown sequences.
[0490] FIGS. 7 and 8: Multiple alignment and consensus sequence,
consisting of capital and small letters. The capital letters
indicate that the amino acids are conserved in all or near all
aligned proteins, and the small letters indicate that amino acids
are conserved in some of the aligned proteins. Anyhow, x indicates
any given amino acid. Core Consensus Sequence (in bold) represents
the essential part of the Consensus Sequence.
[0491] The multiple alignment was performed with the Software
GenoMax Version 3.4, InforMax.TM., Invitrogen.TM. life science
software, U.S. Main Office, 7305 Executive Way, Frederick, Md.
21704,USA with the following settings: Gap opening penalty: 10.0;
Gap extension penalty: 0.05; Gap separation penalty range: 8; %
identity for alignment delay: 40; Residue substitution matrix:
blosum; Hydrophilic residues: G P S N D Q E K R; Transition
weighting: 0.5; Consensus calculation options: Residue fraction for
consensus: 0.5.
[0492] The contents of all references, patent applications, patents
and published patent applications cited in the present patent
application are hereby incorporated by reference.
EXAMPLES
Example 1
Amplification and Cloning of L450
[0493] Unless stated otherwise, standard methods according to
Sambrook et al., Molecular Cloning: A laboratory manual, Cold
Spring Harbor 1989, Cold Spring Harbor Laboratory Press, are used
in all examples. Leaf material of 3 week old Arabidopsis plants of
the C24 ecotype (Nottingham Arabidopsis Stock Centre, UK; NASC
Stock N906) was harvested and total RNA extracted using the
Nucleospin RNA Plant Kit (Macherey and Nagel) according to the
manufacturer's instructions. Said total RNA was photometrically
quantified and 1.5 .mu.g of said RNA were used for cDNA synthesis.
First-strand cDNA was prepared by means of oligo-dT starter
molecules and the SuperScript First-Strand Synthesis System
(Invitrogen) according to the manufacturer's instructions.
[0494] Oligonucleotides were derived from the sequence of the
annotated open reading frame MOB24.15 (Accession: AB020746) also
annotated as ORF At3g24570. The oligos were derived from the
sequence of base pairs 1-20 and 689-708. Recognition sequences of
restriction enzymes were attached to said oligonucleotides for
cloning and, in addition, a Kozak sequence was inserted upstream of
the start codon of the gene (Joshi, (1997) Plant Molecular Biology,
35(6):993). The sequences of said oligos were as follows
MOB24155Sma:
TABLE-US-00009 (Seq. ID NO.: 19) ATACCCGGGAAACAATGTTGAAGCTTTGGAGATG
and (Seq. ID NO.: 20) MOB24153Sac:
ATAGAGCTCTCATACTCCGCCTTGGCCAC
[0495] The oligos were adjusted to a concentration of 20 .mu.M and
used in a PCR.
[0496] The PCR mixture contained:
15 .mu.l of Ex Taq polymerase buffer (TAKARA) 12 .mu.l of dNTPs
(2.5 mM each) (TAKARA) 0.8 .mu.l of primer MOB24155Sma 0.8 .mu.l of
primer MOB24153Sac 0.75 .mu.l of Ex Taq polymerase (TAKARA) 3.0
.mu.l of cDNA 117 .mu.l of water
[0497] The PCR program (MJ-Cycler Tetrad, BioZym) was as follows: 3
min 94.degree. C., 1 min 94.degree. C., 1 min 52.degree. C., 1 min
72.degree. C. and 10 min 72.degree. C. The middle cycle was
repeated 30 times. To clone the PCR fragment, the PCR mixture was
purified using the Qiagen PCR purification kit according to the
manufacturer's instructions and then cloned into the PCR vector,
using the TA-Cloning Kit (Invitrogen) according to the
manufacturer's instructions, followed by a maxi preparation from a
correct clone (Machery and Nagel). The correct sequence of the
insert was checked by sequencing. Compared to the published
sequence of MOB24.15 (Seq. ID No. 1), a substitution was found in
two positions: base pair 329 T to C and base pair 361 G to T (Seq.
ID No.: 24). This results in an amino acid substitution of Pro for
Leu in position 110 and of Ser for Ala in position 121 of Seq. ID
No.: 2, in comparison with Seq. ID No.: 25. In another independent
clone (Seq. ID No.: 26), nucleotide substitutions were identified
in positions 159 (G for A), 170 (T for C), 187 (T for A), 189 (C
for T), 198 (C for G), 206 (G for A), 291 (T for C), 366 (C for A)
and 400 (A for G), compared to the published sequence of MOB24.15
(Seq. ID No.: 1). These nucleotide substitutions result in the
amino acid sequence (Seq. ID No.: 27) which contains five amino
acid substitutions (AA57:AV, AA63:IF, AA66:KN, AA69:QR, 134:VI),
compared to the published amino acid sequence. Since this sequence,
Seq. ID No.: 26, and therefore the amino acid sequence Seq. ID No.:
27 were independently confirmed several times, work for the
following clonings was continued using said sequence. This
construct was cleaved with restriction enzymes SmaI and SacI. The
L450 fragment obtained in the process was eluted from an agarose
gel by means of the Gel Extraction Kit (Qiagen) according to the
manufacturer's instructions. The isolated fragment was cloned into
a binary vector for plant transformation, which had previously been
cleaved likewise with restriction enzymes SmaI and SacI. Apart from
the resistance cassette for selection in plants, said vector
contained the superpromotor ((ocs.sub.3mas, Ni, et al., The Plant
Journal 1995, 7, 661-676) and the nos terminator sequence for
expression of the transgene. The construct 1bx SuperColicMOB24.15
was produced.
Example 2
Amplification and Cloning of the Yeast ORF YLR251w
[0498] Unless stated otherwise, standard methods according to
Sambrook et al., Molecular Cloning: A laboratory manual, Cold
Spring Harbor 1989, Cold Spring Harbor Laboratory Press, are used.
PCR amplification of YLR251w was carried out according to the
protocol of Pfu Turbo DNA polymerase (Stratagene). The composition
was as follows: 1.times.PCR buffer [20 mM Tris-HCl (pH 8.8), 2 mM
MgSO4, 10 mM KCl, 10 mM (NH4)SO4 , 0.1% Triton X-100, 0.1 mg/ml
BSA], 0.2 mM d-thio-dNTP and dNTP (1:125), 100 ng of genomic DNA of
Saccharomyces cerevisiae (strain S288C; Research Genetics, Inc.,
now Invitrogen), 50 pmol of forward primer, 50 pmol of reverse
primer, 2.5 u of Pfu Turbo DNA polymerase. The amplification cycles
were as follows:
1 cycle of 3 min at 95.degree. C., followed by 36 cycles of in each
case 1 min at 95.degree. C., 45 s at 50.degree. C. and 210 s at
72.degree. C., followed by 1 cycle of 8 min at 72.degree. C., then
4.degree. C.
[0499] The following primer sequences were chosen for amplification
of the Saccharomyces cerevisiae gene according to SEQ. ID: NO
11:
TABLE-US-00010 (SEQ. ID NO.: 17) forward primer for YLR251w:
5'-GGAATTCCAGCTGACCACCATGAAGTTATTGCATTTATATGA AGCG-3' (SEQ. ID NO.:
18) reverse primer for YLR251w:
5'-GATCCCCGGGAATTGCCATGTTATTCGACCACGGGTGGATAATG-3'
[0500] The amplicon was subsequently purified via QIAquick columns
according to a standard protocol (Qiagen).
[0501] Restriction of the vector DNA (30 ng) was carried out with
EcoRI and SmaI according to the standard protocol, the EcoRI
cleavage site was filled in according to the standard protocol
(MBI-Fermentas) and the reaction was stopped by adding high-salt
buffer. The cleaved vector fragments were purified via Nucleobond
columns according to standard protocol (Machery-Nagel). A binary
vector was used which contained a selection cassette (promoter,
selection marker, terminator) and an expression cassette comprising
a constitutive promoter such as the superpromoter ((ocs3mas)), Ni,
et al., The Plant Journal 1995, 7, 661-676), a cloning cassette and
a terminator sequence between the T-DNA border sequences. Other
than in the cloning cassette, the binary vector had no EcoRI and
SmaI cleavage sites. Binary vectors which may be used are known to
the skilled worker, and a review on binary vectors and their use
can be found in Hellens, R., Mullineaux, P. and Klee H., (2000) "A
guide to Agrobacterium binary vectors", Trends in Plant Science,
Vol. 5 No. 10, 446-451. Depending on the vector used, cloning may
advantageously also be carried out using other restriction enzymes.
Corresponding advantageous cleavage sites may be attached to the
ORF by using corresponding primers for PCR amplification.
[0502] Approx. 30 ng of prepared vector and a defined amount of
prepared amplicon were mixed and ligated by adding ligase.
[0503] The ligated vectors were transformed in the same reaction
vessel by adding competent E. coli cells (DH5alpha strain) and
incubating at 1.degree. C. for 20 min, followed by a heat shock at
42.degree. C. for 90 s and cooling to 4.degree. C. This was
followed by addition of complete medium (SOC) and incubation at
37.degree. C. for 45 min. The entire mixture was then plated out on
an agar plate containing antibiotics (selected depending on the
binary vector used) and incubated at 37.degree. C. overnight.
[0504] Successful cloning was checked by amplification with the aid
of primers which bind upstream and downstream of the restriction
cleavage site and thus make amplification of the insertion
possible. The amplification was carried out according to the Taq
DNA polymerase protocol (Gibco-BRL). The composition was as
follows: 1.times.PCR buffer [20 mM Tris-HCL (pH 8.4), 1.5 mM MgCl2,
50 mM KCl, 0.2 mM dNTP, 5 pmol of forward primer, 5 pmol of reverse
primer, 0.625 u of Taq DNA polymerase.
[0505] The amplification cycles were as follows: 1 cycle of 5 min
at 94.degree. C., followed by 35 cycles of in each case 15 s at
94.degree. C., 15 s at 66.degree. C. and 5 min at 72.degree. C.,
followed by 1 cycle of 10 min at 72.degree. C., then 4.degree. C.
Several colonies were checked, and only one colony for which a PCR
product of the expected size had been detected was used further.
One aliquot of this positive colony was transferred to a reaction
vessel filled with complete medium (LB) and incubated at 37.degree.
C. overnight. The LB medium contained an antibiotic for selection
of the clone, which was selected according to the binary vector
used and the resistance gene contained therein.
[0506] Plasmid preparation was carried out according to the
guidelines of the Qiaprep standard protocol (Qiagen).
Example 3
General Plant Transformation
[0507] Plant transformation via transfections with Agrobacterium
and regeneration of the plants may be carried out according to
standard methods, for example as described herein or in Gelvin,
Stanton B.; Schilperoort, Robert A, "Plant Molecular Biology
Manual", 2nd Ed.-Dordrecht: Kluwer Academic Publ., 1995.-in Sect.,
Ringbuc Zentrale Signatur: BT11-P ISBN 0-7923-2731-4; Glick,
Bernard R.; Thompson, John E., "Methods in Plant Molecular Biology
and Biotechnology", Boca Raton: CRC Press, 1993.-360 S., ISBN
0-8493-5164-2.
[0508] Oil seed rape may be transformed by means of cotyledon
transformation, for example according to Moloney et al., Plant cell
Report 8 (1989), 238-242; De Block et al., Plant Physiol. 91 (1989,
694-701).
[0509] Soybeans may be transformed, for example, according to the
methods described in EP 0424 047, U.S. Pat. No. 322,783 or in EP
0397 687, U.S. Pat. No. 5,376,543, U.S. Pat. No. 5,169,770.
[0510] Alternatively, DNA uptake may be achieved and a plant may be
transformed also by particle bombardment, polyethylene glycol
mediation or via the "silicon carbide fiber" technique, rather than
by Agrobacterium-mediated plant transformation, see, for example,
Freeling and Walbot "The maize handbook" (1993) ISBN 3-540-97826-7,
Springer Verlag New York).
Example 4
Preparation of Plants Overexpressing L450 or ORF YLR251w
[0511] The respective plasmid constructs were transformed by means
of electroporation into the agrobacterial strain pGV3101 containing
the pMP90 plasmid, and the colonies were plated out on TB medium
(QBiogen, Germany) containing the selection markers kanamycin,
gentamycin and rifampicin and incubated at 28.degree. C. for 2
days. The antibiotics or selection agents are to be selected
according to the plasmid used and to the compatible agrobacterial
strain. A review on binary plasmids and agrobacteria strains can be
found in Hellens, R., Mullineaux, P. and Klee H., (2000) "A guide
to Agrobacterium binary vectors", Trends in Plant Science, Vol 5
No. 10, 446-451.
[0512] A colony was picked from the agar plate with the aid of a
toothpick and taken up in 3 ml of TB medium containing the
above-mentioned antibiotics.
[0513] The preculture grew in a shaker incubator at 28.degree. C.
and 120 rpm for 48 h. 400 ml of LB medium containing the
appropriate antibiotics were used for the main culture. The
preculture was transferred into the main culture which grew at
28.degree. C. and 120 rpm for 18 h. After centrifugation at 4000
rpm, the pellet was resuspended in infiltration medium (M & S
medium with 10% sucrose). Dishes (Piki Saat 80, green, provided
with a screen bottom, 30.times.20 x 4.5 cm, from Wiesauplast,
Kunststofftechnik, Germany) were half-filled with a GS 90 substrate
(standard soil, Werkverband E. V., Germany). The dishes were
watered overnight with 0.05% Previcur solution (Previcur N, Aventis
CropScience).
[0514] Transformation of Arabidopsis was carried out following
Bechtold N. and Pelletier G. (1998) In planta
Agrobacterium-mediated transformation of adult Arabidopsis thaliana
plants by vacuum infiltration. Methods in Molecular Biology.
82:259-66 and Clough and Bent Clough, J C and Bent, A F. 1998
Floral dip: a simplified method for Agrobacterium-mediated
transformation of Arabidopsis thaliana, Plant J. 16:735-743).
Arabidopsis thaliana, C24 seeds (Nottingham Arabidopsis Stock
Centre, UK; NASC Stock N906) were scattered over the dish, approx.
1000 seeds per dish. The dishes were covered with a hood and placed
in the stratification facility (8 h 110 .mu.E, 5.degree. C.; 16 h
dark 6.degree. C.). After 5 days, the dishes were placed into the
short-day phytotron (8 h 130 .mu.E, 22.degree. C.; 16H dark
20.degree. C.), where they remained for 10 days, until the first
true leaves had formed.
[0515] The seedlings are transferred into pots containing the same
substrate (Teku pots, 10 cm o, LC series, manufactured by
Poppelmann GmbH&Co, Germany). Nine plants were pricked out into
each pot. The pots were then returned into the short-day phytotron
for the plants to continue growing.
[0516] After 10 days, the plants were transferred into a greenhouse
cabinet, 16 h 340 .mu.E 22.degree. C. and 8 h dark 20.degree. C.,
where they grew for a further 10 days.
[0517] Seven-week-old Arabidopsis plants which had just started
flowering were immersed for 10 sec into the above-described
agrobacterial suspension which had previously been treated with 10
.mu.l of Silwett L77 (Crompton S. A., Osi Specialties,
Switzerland). The method is described in Bechtold N. and Pelletier
G. (1998). The plants were subsequently placed into a humid chamber
for 18 h and the pots were subsequently returned to the greenhouse
for the plants to continue growing. The plants remained there for
another 10 weeks until the seeds were harvested.
[0518] Depending on the resistance marker used for selecting the
transformed plants, the harvested seeds were sown in a greenhouse
and subjected to spray selection or else, after sterilization,
cultivated on agar plates with the appropriate selecting agent.
After approx. 10-14 days, the transformed resistant plants differed
distinctly from the dead wild-type seedlings and could be pricked
out into 6-cm pots.
Example 5a
Analysis of Lines Overexpressing Endogenous L450: Determination of
Fresh Weight, Number of Leaves and Weight of Seeds
[0519] A line overexpressing MOB24.15 RNA was selected. For this
purpose, total RNA was extracted from three-week-old Arabidopsis
plants transgenic for MOB24.15. For hybridization, 20 .mu.g of RNA
were electrophoretically fractionated, blotted to Hybond N membrane
(Amersham Biosciences Europe GmbH, Freiburg, Germany) according to
the manufacturer's instructions and hybridized with an
MOB24.15-specific probe. Rothi-Hybri-Quick buffer (Roth, Karlsruhe,
Germany) was used for hybridization and the probe was labeled using
the Rediprime II DNA Labeling System (Amersham Biosciences Europe
GmbH Freiburg, Germany) according to the manufacturer's
instructions. The DNA fragment for this probe was prepared by means
of a standard PCR of Arabidopsis genomic DNA and the primers
MOB24.15fw:
TABLE-US-00011 5'-CGCCTTGGCCACCTCGTTCTTTT-3' (SEQ. ID NO.: 21) and
MOB24.15revno: 5'-GCTGCAAAAGTTGCAATGGATGGTC-3'. (SEQ. ID NO.:
22)
[0520] FIG. 1 depicts the Northern blot analysis of a line
overexpressing the L450 sequence (450B). Three plants of this line
and two wild-type plants were analyzed. The lower, strongly
hybridizing band corresponds to the L450 transcript.
[0521] For analysis, the plants were cultivated in a phytotron from
Swalof Weibull (Sweden) under the following conditions. After
stratification, the test plants were cultured in a 16 h light/8 h
dark rhythm at 20.degree. C., a humidity of 60% and a CO.sub.2
concentration of 400 ppm for 22-23 days. The light sources used
were Powerstar HQI-T 250 W/D Daylight lamps from Osram, which
generate light of a color spectrum similar to that of the sun with
a light intensity of 220 .mu.E/m.sup.2/s.sup.-1.
[0522] On days 21, 24 and 28 after sowing, which days correspond to
approximately days 14, 17 and 21, respectively, after germination,
in each case 14 to 15 randomly selected individual plants of both
the wild type (WT) and the L450-overexpressing line (450B) were
studied. The number of leaves was determined, not counting the
cotyledons. Subsequently, the shoot (the green part of the plants)
was cut off directly above the substrate. The fresh weight was
determined immediately thereafter, using a precision balance. The
differences between the results for the wild-type plants and the
plants of the transgenic line were tested for significance by means
of a T test for each harvest day.
[0523] The result is depicted in tables 1 and 2.
TABLE-US-00012 TABLE 1 Number of leaves and fresh shoot weight (mg)
of line 450b and wild-type plants. Average and standard deviation
of 14-15 replicons. Significant differences (p < 0.05) between
line 450b and WT on the particular day of harvest were be found, in
the case of the number of leaves, on all days of harvest and, in
the case of fresh weight, for the harvest after 17 and 24 days. The
significant differences are indicated by the different letters. The
significant differences in number of leaves and fresh weight
between the wild type and the transgenic lines were also reproduced
in comparable experiments under greenhouse conditions. Days after
sowing 14 17 21 Population 450B WT C24 450B WT C24 450B WT C24
Number of 14.5 .+-. 2.2.sup.a 12.9 .+-. 1.0.sup.b 19.3 .+-.
2.6.sup.a 17.3 .+-. 1.8.sup.b 41.2 .+-. 7.3.sup.a 32.7 .+-.
6.4.sup.b leaves Fresh weight 185 .+-. 56.sup.a 159 .+-. 33.sup.a
352 .+-. 55.sup.a 274 .+-. 66.sup.b 954 .+-. 249.sup.a 724 .+-.
162.sup.b (mg)
[0524] Furthermore, plants of the transgenic line 450B and
wild-type control plants were cultivated in parallel in a
greenhouse under identical conditions and the total weight of the
seeds obtained was analyzed. It was found that line 450B produces
more seeds than the wild type in a statistically significant
manner.
TABLE-US-00013 TABLE 2 Seed production of wild-type MC24
Arabidopsis plants and of plants of the transgenic line 450B, which
overexpresses L450, is shown. The data indicate the average for 50
and 51 plants, respectively, and the corresponding standard
deviation. The statistically significant difference between the
values is indicated by the different letters. C24 wild type
Transgenic line 450B Seed production (mg/plant) 77.9 .+-.
17.8.sup.a 97.5 .+-. 15.2.sup.b
[0525] The achieved increase in yield and biomass is further shown
in FIG. 5.
Example 5b
Analysis of Arabidopsis thaliana Plants Transformed with the
1bxSuperColicMOB24.15 Construct
[0526] Transformation with the 1bxSuperColicMOB24.15 construct
produced 7 independent lines.
[0527] 6 of these lines were first studied for the level of
transgene expression by means of qPCR using an ABI Prism7700
instrument. Total RNA was extracted from leaves of 3-week-old,
BASTA-selected T1 plants by means of the Invisorb plant kit
(Invitek, according to the manufacturer's instructions).
[0528] The reagents for cDNA synthesis and Q-PCR reaction were from
Eurogentec and were used according to the manufacturer's
instructions. The analysis was carried out by quantitative PCR
using TaqMan probes and the ABIPrism7000 (PE Applied Biosystems)
(Gibson et al., 1996; Lie and Petropulos 1998).
[0529] The following probe system was used for detecting At3g24570
mRNA:
Seq. ID No.: 28: Oligo1: 5' ccatctcataaataacgtcatgcattac 3' Seq. ID
No.: 29: probe: 5' tgataatcatcgcaagaccggcaacagt 3' Seq. ID No.: 30:
Oligo2: 5' aacatttggcaataaagtttcttaaga 3'
[0530] The probe was labeled with FAM, the quencher was TAMRA.
[0531] The amount of total RNA used was normalized by using a probe
system which detects mRNA of ubiquitin conjugating enzyme 18
(Ubi18):
Seq. ID No.: 31: Oligo1: 5' agttcacccgaaaagcaacg 3' Seq. ID No.:
32: probe: 5' cccactgataatgatcgatatgtgaagaactgc 3' Seq. ID No.: 33:
Oligo2: 5' tcgtcatggaaccaccacct 3'
[0532] The probe was VIC-labeled, the quencher was TAMRA.
[0533] The Ct value for Ubi18 mRNA was determined for each plant
and subtracted from the Ct value for the transgenic At3g24570 mRNA
which had been determined from the same reaction mixture. The delta
Ct value calculated therefrom is a relative value and a measure for
the amount of transgenic At3g24570 mRNA contained in a particular
amount of mRNA (table 3). The Q-PCR is monitored over 40 cycles.
Samples indicating a Ct value of 40 are negative, since they have
not developed any fluorescence above the background, even in the
40th cycle.
TABLE-US-00014 TABLE 3 delta Ct value of the At3g24570 gene in 6
independent lines In a further transgenic line (No. 1), expression
of the transgene was not studied. Sample Name FAM VIC delta Ct No.
12 - 1bxSuperColicMOB24.15 26.67 28.94 -2.27 No. 13 -
1bxSuperColicMOB24.15 29.03 29.85 -0.82 No. 14 -
1bxSuperColicMOB24.15 28.02 29.59 -1.57 No. 15 -
1bxSuperColicMOB24.15 27.08 29.89 -2.82 No. 16 -
1bxSuperColicMOB24.15 28.03 29.92 -1.89 No. 17 -
1bxSuperColicMOB24.15 28.11 30.20 -2.09
[0534] Determination of the fresh weight of Arabidopsis thaliana
plants transformed with the 1bxSuperColicMOB24.15 construct.
[0535] Between 93 and 100 siblings were cultivated of 7 independent
lines overexpressing the At3g24570 gene. 100 siblings were
cultivated as wild-type control from a transformant cultivated
containing an empty vector. The plants were sprayed with BASTA in
order to exclude nontransgenic plants. 3 weeks after sowing, the
fresh weight of the above-ground parts of the plants was
determined. As table 4 shows, the fresh weight of all lines is
increased in a statistically significant manner in comparison with
that of the transformant not overexpressing the At3g24570 gene.
TABLE-US-00015 TABLE 4 Fresh weight of Arabidopsis thaliana plants
transformed with the 1bxSuperColicMOB24.15 construct Fresh Standard
p (vs Construct Line weight deviation n control) Empty vector 24
183 66 100 1bxSupercolicMOB24.15 1-1 327 149 100 0 12 296 92 93 0
13 218 96 97 0.004 14 237 107 97 0 15 276 103 99 0 16 248 134 98 0
17 329 104 100 0
[0536] The increase in fresh weight can be correlated with the
level of expression.
[0537] FIG. 4 depicts the observed correlation of the level of
expression of the transgenic At3g24570 gene with the increase in
fresh weight.
[0538] Furthermore, the dry weight of the lines was determined.
Here too, an increase was found.
TABLE-US-00016 TABLE 5 Dry weight of Arabidopsis thaliana plants
transformed with the 1bxSuperColicMOB24.15 construct Dry Standard p
(vs Construct Line weight deviation n control) Empty vector 24
34.38 10.3 99 1bxSupercolicMOB24.15 1-1 51.11 20.2 99 0 12 44.56
12.7 93 0 13 39.04 14.9 97 0.009 14 41.44 18.9 97 0 15 45.41 14.9
99 0 16 39.14 21.8 98 0.015 17 53.98 16.3 100 0
Literature:
[0539] Gibson, (1996) A novel method for real time quantitative
RT-PCR. Genome Res. 6, 995-1001
[0540] Lie, (1998) Advances in quantitative PCR technology: 5'
nuclease assays
Example 5c
Increased 100 Seeds Weight after Over Expression of Endogenous
MOB24.15 (L450)
[0541] KO450 T-DNA-insertion lines, which show an increase in
MOB24.15 expression (over expression), show an increased
Arabidopsis seed weight. 100 seeds of the wild type (C24) and of
the KO450-line were collected under the same conditions and were
weightened.
[0542] The seeds of the MOB24.15 (L450) over expressing lines
(KO450-lines) had a weight of 2.35 mg/100 seeds, whereas the wild
type only shows a weight of 1.8 mg/100 seeds. FIG. 6 shows the
increased 100 seed weight of the KO450-line compared to the wild
type.
Example 6
Analysis of Lines Overexpressing the Yeast ORF YLR251w
[0543] Two transgenic Arabidopsis lines overexpressing the yeast
ORF YLR251w and corresponding wild-type C24 plants and, as control,
plants of the selected lines overexpressing the Arabidopsis L4500RF
(450B) were cultivated in a greenhouse under standard conditions.
The fresh weight was determined at the end of the vegetative phase,
with the floral shoot having a length of 4.5 cm. The two transgenic
lines 7 and 9 which express the yeast ORF showed a significantly
increased fresh weight compared to the control plants.
[0544] The result is depicted in table 6.
TABLE-US-00017 TABLE 6 Fresh weight of the various transgenic lines
and of the wild type at the end of the vegetative phase, with the
floral shoot being 4.5 cm in length. The line 450B overexpresses
the Arabidopsis ORF MOB24.15, actual annotated as ORF At3g24570 and
the lines yeast-7 and yeast-9 overexpress the yeast ORF YLR251w.
Indicated for each line are the average of the particular fresh
weight and the corresponding standard deviation and also the number
of plants analyzed of the particular lines. Significant differences
(p < 0.05) were found between the transgenic lines and the WT.
Said significant differences are marked by the different letters.
Average Standard Number of Significance of fresh deviation plants
deviation Line weight fresh weight analyzed compared to WT WT 925.6
204.4 25 a 450B 1184.4 268.4 25 b (MOB24.15) Yeast-7 1243.8 175 5 b
(YLR251w) Yeast-9 1279.4 155.4 5 b (YLR251w)
Example 7a
Overexpression of L450 in Tobacco and Canola
[0545] For transformation of canola (Brassica napus), cotyledonary
petioles and hypocotyls of seedlings at an age of from 5 to 6 days
were used as explants for the tissue culture and transformed as
described, inter alia, in Babic et al. (1998, Plant Cell Rep 17:
183-188). The commercial variety Westar is the standard variety for
transformation but other varieties may also be utilized. The
sequence encoding the L450 activity is cloned into the expression
cassette of a binary vector containing a selection cassette
according to molecular standard methods. Exemplary clonings are
described elsewhere in the examples and are known to the skilled
worker.
[0546] The agrobacterial strain Agrobacterium tumefaciens LBA4404
containing, which is transformed with the binary vector, is used
for transformation. A multiplicity of binary vectors for plant
transformation have already been described (inter alia, An, G. in
Agrobacterium Protocols. Methods in Molecular Biology vol. 44, pp.
47-62, Gartland KMA and Davey MR eds. Humana Press, Totowa, N.J.).
Many binary vectors derive from the binary vector pBIN19 which has
been described by Bevan (Nucleic Acid Research. 1984. 12:8711-8721)
and which comprises an expression cassette for plants which is
flanked by the left and right border of the Agrobacterium
tumefaciens Ti plasmid. A plant expression cassette comprises at
least two components, a selection marker gene and a suitable
promoter capable of regulating the transcription of cDNA or genomic
DNA in plant cells in the desired manner. A multiplicity of
selection marker genes such as antibiotic resistance or herbicide
resistance genes may be used, such as, for example, a mutated
Arabidopsis gene which encodes a mutated herbicide-resistant AHAS
enzyme (U.S. Pat. Nos. 57,673,666 and 6,225,105). Similarly, it is
also possible to use different promoters for expressing the gene
with L450 activity. For example, either constitutive expression as
is mediated by the 34S promoter (GenBank Accession No.: M59930 and
X16673) or else seed-specific expression may be desired.
[0547] Canola seeds are sterilized in 70% ethanol for two minutes
and then in 30% chlorox containing a drop of Tween-20 for 10
minutes, followed by three washing steps in sterile water.
[0548] The seeds are incubated in vitro on semi-concentrated MS
medium without hormones, containing 1% sucrose, 0.7% phytagar at
23.degree. C. and in a 16/8 h day/night rhythm for 5 days for
germination. The cotyledonary petiole explants were separated
together with the cotyledons from seedlings and inoculated with the
agrobacteria by dipping the site of the cutting into the bacterial
suspension. The explants were then incubated on MSBAP-3 medium
containing 3 mg/l BAP, 3% sucrose and 0.7% phytagar at 23.degree.
C. and 16 h of light for two days. After two days of cocultivation
with the agrobacteria, the explants are transferred to MSBAP-3
medium containing 3 mg/l BAP, cefotaxime, carbenicillin or timentin
(300 mg/l) for 7 days and then to MSBAP-3 medium containing
cefotaxime, carbenicillin or timentin and selecting agent until
shoot regeneration. When the shoots are 5-10 mm in length, they are
cut off and transferred to "shoot elongation medium" (MSBAP-0.5,
containing 0.5 mg/l BAP). Shoots of approx. 2 cm in length are then
transferred to root medium (MS0) for induction of roots.
[0549] Material of primary transgenic plants is studied by means of
PCR in order to verify incorporation of the T-DNA into the genome.
Positive results are then confirmed by means of Southern blot
analysis. Confirmed transgenic plants are then tested for faster
growth and higher yield.
Sterile Culture of Tobacco Plants
[0550] Tobacco plants cultivated under aseptic conditions are
propagated in vitro by placing stem pieces of approx. 1-2 cm in
length and with, in each case, one internodium on sterile medium.
(Murashige and Skoog medium containing 2% sucrose and 0.7%
agar-agar) (Murashige, T. and Skoog, F. (1962) Physiol. Plant.
15:473-497)
[0551] The plants grow at 23.degree. C., 200 .mu.E and with a 16
h/8 h light/dark rhythm.
[0552] After about 5-6 weeks of growth, leaves of said plants are
cut into approx. 1 cm.sup.2 pieces under sterile conditions.
Bacterial Culture
[0553] An agrobacterial colony transformed with the construct for
expressing an L-450 activity is picked from an agar plate is with
the aid of a sterile plastic tip which is then transferred into
approx. 20 ml of liquid YEB medium (Sambrook et al., Molecular
Cloning: A laboratory manual, Cold Spring Harbor 1989, Cold Spring
Harbor Laboratory Press) containing the relevant antibiotics. The
volume of said YEB medium is chosen as a function of the number of
transformants. Normally, 20 ml of bacterial culture are sufficient
in order to produce approx. 80 transgenic tobacco plants. The
bacterial culture is grown on a shaker at 200 rpm and 28.degree. C.
for 1 day.
[0554] On the following day, the bacterial culture is removed by
centrifugation at 4000 rpm and taken up in liquid Murashige and
Skoog medium.
Transformation
[0555] The leaf pieces are briefly dipped into the bacterial
suspension and cultured on Murashige and Skoog medium (2% sucrose
and 0.7% agar-agar) in the dark for 2 days. The explants are
transferred to MS medium containing antibiotics and corresponding
hormones, as described in the method of Rocha-Sosa (Rocha-Sosa, M.,
Sonnewald, U., Frommer, W., Stratmann, M., Schell, J. and
Willmitzer, L. 1998, EMBO J. 8: 23-29).
[0556] Transgenic lines can then be analyzed for expression of the
L450 transgene by means of Northern blot analysis. It is then
possible to determine the increase in fresh weight and in the yield
of seeds of selected lines in comparison with the wild type.
Example 8
Design and Expression of a Synthetic Transcription Factor Binding
Close to the Endogenous L450 Homolog and Activating the
Transcription Thereof
[0557] The endogenous ORF of L450 or a homologous ORF in other
plant species may also be activated by introducing a synthetic
specific activator. For this purpose, a gene for a chimeric zinc
finger protein which binds to a specific region in the regulatory
region of the L450 ORF or of its homologs in other plants is
constructed. The artificial zinc finger protein comprises a
specific DNA-binding domain and an activation domain such as, for
example, the Herpes simplex virus VP16 domain. Expression of this
chimeric activator in plants then results in specific expression of
the target gene, here, for example, MOB24.15, or of its homologs in
other plant species. The experimental details may be carried out as
described in WO 01/52620 or Ordiz MI, (Proc. Natl. Acad. Sci. USA,
2002, Vol. 99, Issue 20, 13290) or Guan, (Proc. Natl. Acad. Sci.
USA, 2002, Vol. 99, Issue 20, 13296).
Example 9
Identification of a Line in which a Strong Promoter is Integrated
Upstream of L450 and Thus Activates Expression
[0558] It is furthermore possible for strong ectopic expression of
the desired ORF to integrate a strong promoter upstream of said
ORF. For this purpose, a population of transgenic Arabidopsis
plants was generated into which a vector containing the
bidirectional mas promoter (Velten, 1984, EMBO J, 3, 2723) at the
left T-DNA border was integrated. Said promoter enabled, via its 2'
promoter, transcription from the T-DNA via the left border into the
adjacent genomic DNA. The genomic DNA was then isolated from the
individual plants and pooled according to a specific plan. The
method of this reverse screening for T-DNA integrations at a
particular locus has been described in detail by Krysan et al.,
(Krysan., 1999, The Plant Cell, Vol 11, 2283) and references
therein. A line in which the T-DNA had integrated upstream of the
MOB24.15 ORF was identified. Sequencing of the locus revealed that
integration had occurred approx. 30 by upstream of the start codon
in such a way that transcription of the ORF of L450, e.g. also
MOB24.15, via the 2' mas promoter could be expected. Enhanced
expression of the ORF of L450, e.g. also MOB24.15, in this line,
compared to the wild type, was detected by means of Northern blot
analysis.
Example 10
Identification of Homologous Genes in Other Plant Species
[0559] Homologous sequences of other plants were identified by
means of special database search tools such as, in particular, the
BLAST algorithm (Basic Local Alignment Search Tool, Altschul, 1990,
J. Mol. Biol., 215, 403 and Altschul, 1997, Nucl. Acid Res., 25,
3389). The blastn and blastp comparisons were carried out in the
standard manner using the BLOSUM-62 scoring matrix (Henikoff, 1992,
Proc. Natl. Acad. Sci. USA, 89, 10915). The NCBI GenBank database
as well as three libraries of expressed sequence tags (ESTs) of
Brassica napus cv. "AC Excel", "Quantum" and "Cresor" (canola) and
Oryza sativa cv. Nippon-Barre (Japonica rice) were studied. The
search identified sequences from various plant species, which are
highly homologous to the amino acid sequence of MOB24.15 at the
nucleotide level or in one of the six possible reading frames.
Table 7 lists those sequences which have significant identity at
the derived amino acid level.
TABLE-US-00018 TABLE 7 Homology comparison of MOB24.15 to
homologous genes from other species at the amino acid level. Seq. %
Plant species Accession ID identity Similarity Human PIR:S45343 13
28% 42% Mouse PIR:S29031 15 28% 40% Yeast PIR:S59397 11 28% 42%
Oryza sativa Q8W0A7, P0452F10.16 3 54% 74% Brassica napus
BN_asm:bn1106c9886 5 83% 88% Glycine max GM:c48958528gm021002 7 60%
72% Oryza sativa OS:oz1116c1058 9 54% 70%
Example 12
Determination of Expression of the Mutant Protein
[0560] The observations of the activity of a mutated protein in a
transformed host cell are based on the fact that the mutant protein
is expressed in a manner and amount similar to that of the
wild-type protein. A suitable method for determining the amount of
transcription of the mutant gene (an indication of the amount of
mRNA available for translation of the gene product) is to carry out
a Northern blot (see, for example, Ausubel, (1988) Current
Protocols in Molecular Biology, Wiley: New York), providing a
primer which is designed so as to bind to the gene of interest with
a detectable (usually radioactive or chemiluminescent) label so
that, when total RNA of a culture of the organism is extracted,
fractionated on a gel, transferred to a stable matrix and incubated
with this probe, binding and quantity of the binding of said probe
indicate the presence and also the amount of mRNA for said gene.
This information is evidence for the degree of transcription of the
mutant gene. Total cellular RNA can be isolated from
Corynebacterium glutamicum by various methods which are known in
the art, as described in Bormann, E. R. et al., (1992) Mol.
Microbiol. 6: 317-326.
[0561] The presence or relative amount of protein translated from
said mRNA can be determined using standard techniques such as
Western blot (see, for example, Ausubel et al. (1988) "Current
Protocols in Molecular Biology", Wiley, New York). This method
comprises extracting total cell proteins, separating them by gel
electrophoresis, transferring them to a matrix such as
nitrocellulose and incubating them with a probe such as an antibody
which binds specifically to the desired protein. Said probe is
usually provided with a chemiluminescent or colorimetric label
which can be readily detected. The presence and observed amount of
label indicate the presence and amount of the mutant protein of
interest in the cell.
Example 13
In-Vitro Analysis of the Function of Mutant Proteins
[0562] The determination of the activities and kinetic parameters
of enzymes is well known in the art. Experiments for determining
the activity of a particular modified enzyme must be adapted to the
specific activity of the wild-type enzyme and this is within the
abilities of the skilled worker. Overviews over enzymes in general
and also specific details concerning structure, kinetics,
principles, methods, applications and examples of determining a
multiplicity of enzyme activities may be found, for example, in the
following references: Dixon, M., and Webb, E. C: (1979) Enzymes,
Longmans, London; Fersht (1985) Enzyme Structure and Mechanism,
Freeman, New York; Walsh (1979) Enzymatic Reaction Mechanisms.
Freeman, San Francisco; Price, N.C., Stevens, L. (1982)
Fundamentals of Enzymology. Oxford Univ. Press: Oxford; Boyer, P.
D: ed. (1983) The Enzymes, 3rd edition Academic Press, New York;
Bisswanger, H. (1994) Enzymkinetik, 2nd edition VCH, Weinheim (ISBN
3527300325); Bergmeyer, H. U., Bergmeyer, J., Gra.beta.l, M. eds
(1983-1986) Methods of Enzymatic Analysis, 3rd edition vol. I-X11,
Verlag Chemie: Weinheim; and Ullmann's Encyclopedia of Industrial
Chemistry (1987) vol. A9, "Enzymes", VCH, Weinheim, pp.
352-363.
Example 14
Analysis of the Influence of Mutated Protein on Production of the
Desired Product
[0563] The effect of genetic modification in an organism, for
example a plant or a microorganisms, e.g. C. glutamicum, on the
production of a desired compound (such as an amino acid) can be
determined by growing the modified (micro)organisms under suitable
conditions (such as those described above for Arabidopsis thaliana
or below by way of example and for C. glutamicum) and studying the
medium and/or the cellular components for increased production of
the desired product (i.e. an amino acid, for example). Analytic
techniques of this kind are well known to the skilled worker and
comprise spectroscopy, thin layer chromatography, various types of
coloring methods, enzymic and microbiological methods and
analytical chromatography such as high performance liquid
chromatography (see, for example, Ullman, Encyclopedia of
Industrial Chemistry, vol. A2, pp. 89-90 and pp. 443-613, VCH:
Weinheim (1985); Fallon, A., et al., (1987) "Applications of HPLC
in Biochemistry" in: Laboratory Techniques in Biochemistry and
Molecular Biology, vol. 17; Rehm et al. (1993) Biotechnology, vol.
3, chapter III: "Product recovery and purification", pp 469-714,
VCH: Weinheim; Belter, P. A. et al. (1988) Bioseparations:
downstream processing for Biotechnology, John Wiley and Sons;
Kennedy, J. F. and Cabral, J. M. S. (1992) Recovery processes for
biological Materials, John Wiley and Sons; Shaeiwitz, J. A. and
Henry, J. D. (1988) Biochemical Separations, in Ullmann's
Encyclopedia of Industrial Chemistry, vol. B3; chapter 11, pp.
1-27, VCH: Weinheim; and Dechow, F. J. (1989) Separation and
purification techniques in biotechnology, Noyes Publications).
[0564] In addition to measuring the desired product, it is likewise
possible to analyze other components of the metabolic pathways
which are used for producing the desired compound, such as
intermediate and secondary products, in order to determine the
total productivity of the organism, the yield and/or the efficacy
of production of the compound. The analytical methods comprise
measurements of the amounts of nutrients in the medium (e.g.
sugars, carbohydrates, nitrogen sources, phosphate and other ions),
measurements of biomass composition and growth, analysis of
production of ordinary metabolites of biosynthetic pathways and
measurements of gases generated during fermentation. Standard
methods for said measurements are described in Applied Microbial
Physiology; A Practical Approach, P. M. Rhodes and P. F. Stanbury,
eds. IRL Press, pp. 103-129; 131-163 and 165-192 (ISBN: 0199635773)
and the references stated therein.
Example 15
Method for Producing Fine Chemicals in Microorganisms
[0565] The method of the invention may be used for increased
production of fine chemicals in microorganisms according to the
above-mentioned examples. A method of this kind is described here,
by way of example, for Corynebacterium glutamicum.
Example 15.1
In-Vivo Mutagenesis
[0566] In-vivo mutagenesis of Corynebacterium glutamicum may be
carried out by passing a plasmid (or other vector) DNA through E.
coli or other microorganisms (e.g. Bacillus spp. or yeasts such as
Saccharomyces cerevisiae) unable to maintain the integrity of their
genetic information. Common mutator strains have mutations in the
genes for the DNA repair system (e.g. mutHLS, mutD, mutT, etc., for
comparison, see Rupp, W. D. (1996) DNA repair mechanisms in
Escherichia coli and Salmonella, pp. 2277-2294, ASM: Washington).
These strains are known to the skilled worker. The use of these
strains is illustrated, for example, in Greener, A. and Callahan,
M. (1994) Strategies 7; 32-34.
Example 15.2
Growth of Genetically Modified Corynebacterium glutamicum--Media
and Cultivation Conditions
[0567] Corynebacteria, for example genetically modified
corynebacteria, are grown in synthetic or natural growth media. A
number of different growth media for corynebacteria are known and
easily obtainable (Lieb et al. (1989) Appl. Microbiol. Biotechnol.
32: 205-210; von der Osten et al. (1998) Biotechnology Letters 11:
11-16; Patent DE 4 120 867; Liebl (1992) "The Genus
Corynebacterium", in: The Procaryotes, vol. II, Balows, A., et al.,
eds Springer-Verlag). These media consist of one or more carbon
sources, nitrogen sources, inorganic salts, vitamins and trace
elements. Preferred carbon sources are sugars such as mono-, di- or
polysaccharides. Examples of very good carbon sources are glucose,
fructose, mannose, galactose, ribose, sorbose, ribulose, lactose,
maltose, sucrose, raffinose, starch and cellulose. Sugars may also
be added to the media via complex compounds such as molasses, or
other by-products of sugar refining. It may also be advantageous to
add mixtures of various carbon sources. Other possible carbon
sources are alcohols and organic acids, such as methanol, ethanol,
acetic acid or lactic acid. Nitrogen sources are usually organic or
inorganic nitrogen compounds or materials containing these
compounds. Examples of nitrogen sources include ammonia gas or
ammonium salts such as NH.sub.4Cl or (NH.sub.4).sub.2SO.sub.4,
NH.sub.4OH, nitrates, urea, amino acids or complex nitrogen sources
such as corn steep liquor, soybean meal, soybean protein, yeast
extracts, meat extracts and others.
[0568] Inorganic salt compounds which may be present in the media
include the chloride, phosphorus or sulfate salts of calcium,
magnesium, sodium, cobalt, molybdenum, potassium, manganese, zinc,
copper and iron. Chelating agents may be added to the medium in
order to keep the metal ions in solution. Particularly suitable
chelating agents include dihydroxyphenols such as catechol or
protocatechuate, or organic acids such as citric acid. The media
usually also contain other growth factors such as vitamins or
growth promoters, which include, for example, biotin, riboflavin,
thiamine, folic acid, nicotinic acid, panthothenate and pyridoxine.
Growth factors and salt are often derived from complex media
components such as yeast extract, molasses, corn steep liquor and
the like. The exact composition of the media compounds depends
greatly on the particular experiment and is decided for each case
individually. Information about media optimization is obtainable
from the textbook "Applied Microbiol. Physiology, A Practical
Approach" (eds P. M. Rhodes, P. F. Stanbury, IRL Press (1997) pp.
53-73, ISBN 0 19 963577 3). Growth media can also be purchased from
commercial suppliers, such as Standard 1 (Merck) or BHI (Brain
heart infusion, DIFCO) and the like.
[0569] All media components are sterilized either by heat (1.5 bar
and 121.degree. C. for 20 min) or by sterile filtration. The
components may be sterilized either together or, if necessary,
separately. All media components may be present at the start of the
cultivation or optionally be added continuously or batchwise.
[0570] The cultivation conditions are defined separately for each
experiment.
[0571] The temperature should be between 15.quadrature.C and 45
.quadrature.C and may be kept constant or changed during the
experiment. The pH of the medium should be in the range from 5 to
8.5, preferably around 7.0, and can be maintained by adding buffers
to the media. One example of a buffer for this purpose is a
potassium phosphate buffer. Synthetic buffers such as MOPS, HEPES;
ACES, etc. may be used alternatively or simultaneously. The
cultivation pH can be kept constant during the cultivation also by
adding NaOH or NH.sub.4OH, for example. If complex media components
such as yeast extract are used, the requirement for additional
buffers is reduced, since many complex compounds have a high buffer
capacity. If a fermenter is used for cultivating microorganisms,
the pH may also be controlled with gaseous ammonia.
[0572] The incubation time is usually in a range from several hours
up to several days. This time is selected so that the maximum
amount of product accumulates in the broth. The disclosed growth
experiments may be carried out in a large number of containers such
as microtiter plates, glass tubes, glass flasks or glass or metal
fermenters of various sizes. For screening a large number of
clones, the microorganisms should be grown in microtiter plates,
glass tubes or shaker flasks either with or without baffles.
Preference is given to using 100-ml shaker flasks charged with 10%
(based on volume) of the required growth medium. The flasks should
be shaken on an orbital shaker (amplitude 25 mm) with a speed in
the range from 100 to 300 U/min. Evaporation losses can be reduced
by maintaining a moist atmosphere; alternatively, a mathematical
correction should be carried out for said evaporation losses.
[0573] If genetically modified clones are studied, an unmodified
control clone or a control clone which contains the basic plasmid
without insert should also be tested. The medium is inoculated to
an OD.sub.600 of 0.5-1.5, using cells grown on agar plates such as
CM plates (10 g/l glucose, 2.5 g/l NaCl, 2 g/l urea, 10 g/l
polypeptone, 5g/l yeast extract, 5 g/l meat extract, 22 g/l agar pH
6.8 with 2 M NaOH) which have been incubated at 30 .quadrature.C.
The media are inoculated either by introducing a saline solution of
C. glutamicum cells from CM plates or by adding a liquid preculture
of this bacterium.
Example 15.3
Purification of the Desired Product from C. glutamicum Culture
[0574] The desired product can be obtained from C. glutamicum cells
or from the supernatant of the culture described above by various
methods known in the art. If the cells do not secrete the desired
product, they may be harvested from the culture by slow
centrifugation and may be lysed by standard techniques such as
mechanical force or sonication. The cell debris is removed by
centrifugation, and the supernatant fraction which contains the
soluble proteins is obtained for further purification of the
desired compound. If the C. glutamicum cells do secrete the
product, they are removed from the culture by slow centrifugation,
and the supernatant fraction is retained for further
purification.
[0575] The supernatant fraction from both purification methods is
subjected to a chromatography using a suitable resin, with the
desired molecule either being retained on the chromatography resin,
but many impurities in the sample not, or with the impurities
remaining on the resin, but the sample not. These chromatography
steps may be repeated, if necessary, using the same or different
chromatography resins. The skilled worker is familiar with the
selection of suitable chromatography resins and the most effective
application to a particular molecule to be purified. The purified
product may be concentrated by filtration or ultrafiltration and
stored at a temperature at which the stability of the product is at
a maximum.
[0576] Many purification methods are known in the art which are not
confined to the foregoing purification method and which are
described, for example, in Bailey, J. E. & Ollis, D. F.
Biochemical Engineering Fundamentals, McGraw-Hill: New York
(1986).
[0577] The identity and purity of the isolated compounds may be
determined by standard techniques of the art. These include high
performance liquid chromatography (HPLC), spectroscopic methods,
coloring methods, thin layer chromatography, NIRS, enzyme assay or
microbiological assays. These analytical methods are summarized in:
Patek et al. (1994) Appl. Environ. Microbiol. 60: 133-140;
Malakhova et al. (1996) Biotekhnologiya 11: 27-32; and Schmidt et
al. (1998) Bioprocess Engineer. 19: 67-70. Ulmann's Encyclopedia of
Industrial Chemistry (1996) vol. A27, VCH: Weinheim, pp. 89-90, pp.
521-540, pp. 540-547, pp. 559-566, 575-581 and pp. 581-587; Michal,
G (1999) Biochemical Pathways: An Atlas of Biochemistry and
Molecular Biology, John Wiley and Sons; Fallon, A. et al. (1987)
Applications of HPLC in Biochemistry in: Laboratory Techniques in
Biochemistry and Molecular Biology, vol. 17.
Example 16a
Engineering Ryegrass Plants
[0578] Seeds of several different ryegrass varieties can be used as
explant sources for transformation, including the commercial
variety Gunne available from Svalof Weibull seed company or the
variety Affinity. Seeds are surface-sterilized sequentially with 1%
Tween-20 for 1 minute, 100% bleach for 60 minutes, 3 rinses with 5
minutes each with de-ionized and distilled H.sub.2O, and then
germinated for 3-4 days on moist, sterile filter paper in the dark.
Seedlings are further sterilized for 1 minute with 1%
[0579] Tween-20, 5 minutes with 75% bleach, and rinsed 3 times with
ddH2O, 5 min each.
[0580] Surface-sterilized seeds are placed on the callus induction
medium containing Murashige and Skoog basal salts and vitamins, 20
g/l sucrose, 150 mg/l asparagine, 500 mg/l casein hydrolysate, 3
g/l Phytagel, 10 mg/l BAP, and 5 mg/l dicamba. Plates are incubated
in the dark at 25.degree. C. for 4 weeks for seed germination and
embryogenic callus induction.
[0581] After 4 weeks on the callus induction medium, the shoots and
roots of the seedlings are trimmed away, the callus is transferred
to fresh media, is maintained in culture for another 4 weeks, and
is then transferred to MSO medium in light for 2 weeks. Several
pieces of callus (11-17 weeks old) are either strained through a 10
mesh sieve and put onto callus induction medium, or are cultured in
100 ml of liquid ryegrass callus induction media (same medium as
for callus induction with agar) in a 250 ml flask. The flask is
wrapped in foil and shaken at 175 rpm in the dark at 23.degree. C.
for 1 week. Sieving the liquid culture with a 40-mesh sieve is
collected the cells. The fraction collected on the sieve is plated
and is cultured on solid ryegrass callus induction medium for 1
week in the dark at 25.degree. C. The callus is then transferred to
and is cultured on MS medium containing 1% sucrose for 2 weeks.
[0582] Transformation can be accomplished with either Agrobacterium
or with particle bombardment methods. An expression vector is
created containing a constitutive plant promoter and the cDNA of
the gene in a pUC vector. The plasmid DNA is prepared from E. coli
cells using with Qiagen kit according to manufacturer's
instruction. Approximately 2 g of embryogenic callus is spread in
the center of a sterile filter paper in a Petri dish. An aliquot of
liquid MSO with 10 g/l sucrose is added to the filter paper. Gold
particles (1.0 .mu.m in size) are coated with plasmid DNA according
to method of Sanford et al., 1993 and are delivered to the
embryogenic callus with the following parameters: 500 .mu.g
particles and 2 .mu.g DNA per shot, 1300 psi and a target distance
of 8.5 cm from stopping plate to plate of callus and 1 shot per
plate of callus.
[0583] After the bombardment, calli are transferred back to the
fresh callus development medium and maintained in the dark at room
temperature for a 1-week period. The callus is then transferred to
growth conditions in the light at 25.degree. C. to initiate embryo
differentiation with the appropriate selection agent, e.g. 250 nM
Arsenal, 5 mg/l PPT or 50 mg/L Kanamycin. Shoots resistant to the
selection agent are appearing and once rooted are transferred to
soil.
[0584] Samples of the primary transgenic plants (T0) are analyzed
by PCR to confirm the presence of T-DNA. These results are
confirmed by Southern hybridization in which DNA is electrophoresed
on a 1% agarose gel and transferred to a positively charged nylon
membrane (Roche Diagnostics). The PCR DIG Probe Synthesis Kit
(Roche Diagnostics) is used to prepare a digoxigenin-labelled probe
by PCR, and used as recommended by the manufacturer.
[0585] Transgenic TO ryegrass plants are propagated vegetatively by
excising tillers. The transplanted tillers are maintained in the
greenhouse for 2 months until well established. The shoots are
defoliated and allowed to grow for 2 weeks.
Example 16b
Engineering Soybean Plants
[0586] Soybean can be transformed according to the following
modification of the method described in the Texas A&M patent
U.S. Pat. No. 5,164,310. Several commercial soybean varieties are
amenable to transformation by this method. The cultivar Jack
(available from the Illinois Seed Foundation) is commonly used for
transformation. Seeds are sterilized by immersion in 70% (v/v)
ethanol for 6 min and in 25% commercial bleach (NaOCl) supplemented
with 0.1% (v/v) Tween for 20 min, followed by rinsing 4 times with
sterile double distilled water. Removing the radicle, hypocotyl and
one cotyledon from each seedling propagates seven-day seedlings.
Then, the epicotyl with one cotyledon is transferred to fresh
germination media in petri dishes and incubated at 25.degree. C.
under a 16-hr photoperiod (approx. 100 .mu.E-m-2s-1) for three
weeks. Axillary nodes (approx. 4 mm in length) are cut from 3-4
week-old plants. Axillary nodes are excised and incubated in
Agrobacterium LBA4404 culture.
[0587] Many different binary vector systems have been described for
plant transformation (e.g. An, G. in Agrobacterium Protocols.
Methods in Molecular Biology vol 44, pp 47-62, Gartland K M A and M
R Davey eds. Humana Press, Totowa, N.J.). Many are based on the
vector pBIN19 described by Bevan (Nucleic Acid Research. 1984.
12:8711-8721) that includes a plant gene expression cassette
flanked by the left and right border sequences from the Ti plasmid
of Agrobacterium tumefaciens. A plant gene expression cassette
consists of at least two genes--a selection marker gene and a plant
promoter regulating the transcription of the cDNA or genomic DNA of
the trait gene. Various selection marker genes can be used as
described above, including the Arabidopsis gene encoding a mutated
acetohydroxy acid synthase (AHAS) enzyme (U.S. Pat. Nos. 57,673,666
and 6,225,105). Similarly, various promoters can be used to
regulate the trait gene to provide constitutive, developmental,
tissue or environmental regulation of gene transcription as
described above. In this example, the 34S promoter (GenBank
Accession numbers M59930 and X16673) is used to provide
constitutive expression of the trait gene.
[0588] After the co-cultivation treatment, the explants are washed
and transferred to selection media supplemented with 500 mg/L
timentin. Shoots are excised and placed on a shoot elongation
medium. Shoots longer than 1 cm are placed on rooting medium for
two to four weeks prior to transplanting to soil.
[0589] The primary transgenic plants (TO) are analyzed by PCR to
confirm the presence of T-DNA. These results are confirmed by
Southern hybridization in which DNA is electrophoresed on a 1%
agarose gel and transferred to a positively charged nylon membrane
(Roche Diagnostics). The PCR DIG Probe Synthesis Kit (Roche
Diagnostics) is used to prepare a digoxigenin-labelled probe by
PCR, and is used as recommended by the manufacturer.
Example 16c
Engineering Corn Plants
[0590] Transformation of maize (Zea Mays L.) is performed with a
modification of the method described by Ishida et al. (1996. Nature
Biotech 14745-50). Transformation is genotype-dependent in corn and
only specific genotypes are amenable to transformation and
regeneration. The inbred line A188 (University of Minnesota) or
hybrids with A188 as a parent are good sources of donor material
for transformation (Fromm et al. 1990 Biotech 8:833-839), but other
genotypes can be used successfully as well. Ears are harvested from
corn plants at approximately 11 days after pollination (DAP) when
the length of immature embryos is about 1 to 1.2 mm. Immature
embryos are co-cultivated with Agrobacterium tumefaciens that carry
"super binary" vectors and transgenic plants are recovered through
organogenesis. The super binary vector system of Japan Tobacco is
described in WO patents WO94/00977 and WO95/06722. Vectors can be
constructed as described. Various selection marker genes can be
used including the maize gene encoding a mutated acetohydroxy acid
synthase (AHAS) enzyme (U.S. Pat. No. 6,025,541). Similarly,
various promoters can be used to regulate the trait gene to provide
constitutive, developmental, tissue or environmental regulation of
gene transcription. In this example, the 34S promoter (GenBank
Accession numbers M59930 and X16673) is used to provide
constitutive expression of the trait gene.
[0591] Excised embryos are grown on callus induction medium, then
maize regeneration medium, containing imidazolinone as a selection
agent. The Petri plates are incubated in the light at 25.degree. C.
for 2-3 weeks, or until shoots develop. The green shoots are
transferred from each embryo to maize rooting medium and incubated
at 25.degree. C. for 2-3 weeks, until roots develop. The rooted
shoots are transplanted to soil in the greenhouse. T1 seeds are
produced from plants that exhibit tolerance to the imidazolinone
herbicides and which are PCR positive for the transgenes.
[0592] The T1 generation of single locus insertions of the T-DNA
can segregate for the transgene in a 3:1 ratio. Those progeny
containing one or two copies of the transgene are tolerant of the
imidazolinone herbicide. Homozygous T2 plants can exhibited similar
phenotypes as the T1 plants. Hybrid plants (F1 progeny) of
homozygous transgenic plants and non-transgenic plants can also
exhibited increased similar phenotypes.
Example 16d
Engineering Wheat Plants
[0593] Transformation of wheat is performed with the method
described by Ishida et al. (1996 Nature Biotech. 14745-50). The
cultivar Bobwhite (available from CYMMIT, Mexico) is commonly used
in transformation. Immature embryos are co-cultivated with
Agrobacterium tumefaciens that carry "super binary" vectors, and
transgenic plants are recovered through organogenesis. The super
binary vector system of Japan Tobacco is described in WO patents
WO94/00977 and WO95/06722. Vectors were constructed as described.
Various selection marker genes can be used including the maize gene
encoding a mutated acetohydroxy acid synthase (AHAS) enzyme (U.S.
Pat. No. 6,025,541). Similarly, various promoters can be used to
regulate the trait gene to provide constitutive, developmental,
tissue or environmental regulation of gene transcription. In this
example, the 34S promoter (GenBank Accession numbers M59930 and
X16673) can be used to provide constitutive expression of the trait
gene.
[0594] After incubation with Agrobacterium, the embryos are grown
on callus induction medium, then regeneration medium, containing
imidazolinone as a selection agent. The Petri plates are incubated
in the light at 25.degree. C. for 2-3 weeks, or until shoots
develop. The green shoots are transferred from each embryo to
rooting medium and incubated at 25.degree. C. for 2-3 weeks, until
roots develop. The rooted shoots are transplanted to soil in the
greenhouse. T1 seeds are produced from plants that exhibit
tolerance to the imidazolinone herbicides and which are PCR
positive for the transgenes.
[0595] The T1 generation of single locus insertions of the T-DNA
can segregate for the transgene in a 3:1 ratio. Those progeny
containing one or two copies of the transgene are tolerant of the
imidazolinone herbicide. Homozygous T2 plants exhibited similar
phenotypes.
Example 16e
Engineering Rapeseed/Canola Plants
[0596] Cotyledonary petioles and hypocotyls of 5-6 day-old young
seedlings are used as explants for tissue culture and transformed
according to Babic et al.(1998, Plant Cell Rep 17: 183-188). The
commercial cultivar Westar (Agriculture Canada) is the standard
variety used for transformation, but other varieties can be
used.
[0597] Agrobacterium tumefaciens LBA4404 containing a binary vector
are used for canola transformation. Many different binary vector
systems have been described for plant transformation (e.g. An, G.
in Agrobacterium Protocols. Methods in Molecular Biology vol 44, pp
47-62, Gartland K M A and M R Davey eds. Humana Press, Totowa,
N.J.). Many are based on the vector pBIN19 described by Bevan
(Nucleic Acid Research. 1984. 12:8711-8721) that includes a plant
gene expression cassette flanked by the left and right border
sequences from the Ti plasmid of Agrobacterium tumefaciens. A plant
gene expression cassette consists of at least two genes--a
selection marker gene and a plant promoter regulating the
transcription of the cDNA or genomic DNA of the trait gene. Various
selection marker genes can be used including the Arabidopsis gene
encoding a mutated acetohydroxy acid synthase (AHAS) enzyme (U.S.
Pat. Nos. 57,673,666 and 6,225,105). Similarly, various promoters
can be used to regulate the trait gene to provide constitutive,
developmental, tissue or environmental regulation of gene
transcription. In this example, the 34S promoter (GenBank Accession
numbers M59930 and X16673) can be used to provide constitutive
expression of the trait gene.
[0598] Canola seeds are surface-sterilized in 70% ethanol for 2
min., and then in 30% Clorox with a drop of Tween-20 for 10 min,
followed by three rinses with sterilized distilled water. Seeds are
then germinated in vitro 5 days on half strength MS medium without
hormones, 1% sucrose, 0.7% Phytagar at 23.degree. C., 16 hr. light.
The cotyledon petiole explants with the cotyledon attached are
excised from the in vitro seedlings, and are inoculated with
Agrobacterium by dipping the cut end of the petiole explant into
the bacterial suspension. The explants are then cultured for 2 days
on MSBAP-3 medium containing 3 mg/l BAP, 3% sucrose, 0.7% Phytagar
at 23.degree. C., 16 hr light. After two days of co-cultivation
with Agrobacterium, the petiole explants are transferred to MSBAP-3
medium containing 3 mg/l BAP, cefotaxime, carbenicillin, or
timentin (300 mg/l) for 7 days, and then cultured on MSBAP-3 medium
with cefotaxime, carbenicillin, or timentin and selection agent
until shoot regeneration. When the shoots are 5-10 mm in length,
they are cut and transferred to shoot elongation medium (MSBAP-0.5,
containing 0.5 mg/l BAP). Shoots of about 2 cm in length are
transferred to the rooting medium (MS0) for root induction.
[0599] Samples of the primary transgenic plants (T0) are analyzed
by PCR to confirm the presence of T-DNA. These results are
confirmed by Southern hybridization in which DNA is electrophoresed
on a 1% agarose gel and are transferred to a positively charged
nylon membrane (Roche Diagnostics). The PCR DIG Probe Synthesis Kit
(Roche Diagnostics) is used to prepare a digoxigenin-labelled probe
by PCR, and used as recommended by the manufacturer.
Example 16f
Engineering Alfalfa Plants
[0600] A regenerating clone of alfalfa (Medicago sativa) is
transformed using the method of (McKersie et al., 1999 Plant
Physiol 119: 839-847). Regeneration and transformation of alfalfa
is genotype dependent and therefore a regenerating plant is
required. Methods to obtain regenerating plants have been
described. For example, these can be selected from the cultivar
Rangelander (Agriculture Canada) or any other commercial alfalfa
variety as described by Brown D C W and A Atanassov (1985. Plant
Cell Tissue Organ Culture 4: 111-112). Alternatively, the RA3
variety (University of Wisconsin) has been selected for use in
tissue culture (Walker et al., 1978 .mu.m J Bot 65:654-659).
[0601] Petiole explants are cocultivated with an overnight culture
of Agrobacterium tumefaciens C58C1 pMP90 (McKersie et al., 1999
Plant Physiol 119: 839-847) or LBA4404 containing a binary vector.
Many different binary vector systems have been described for plant
transformation (e.g. An, G. in Agrobacterium Protocols. Methods in
Molecular Biology vol 44, pp 47-62, Gartland K M A and M R Davey
eds. Humana Press, Totowa, N.J.). Many are based on the vector
pBIN19 described by Bevan (Nucleic Acid Research. 1984.
12:8711-8721) that includes a plant gene expression cassette
flanked by the left and right border sequences from the Ti plasmid
of Agrobacterium tumefaciens. A plant gene expression cassette
consists of at least two genes--a selection marker gene and a plant
promoter regulating the transcription of the cDNA or genomic DNA of
the trait gene. Various selection marker genes can be used
including the Arabidopsis gene encoding a mutated acetohydroxy acid
synthase (AHAS) enzyme (U.S. Pat. Nos. 57,673,666 and 6,225,105).
Similarly, various promoters can be used to regulate the trait gene
that provides constitutive, developmental, tissue or environmental
regulation of gene transcription. In this example, the 34S promoter
(GenBank Accession numbers M59930 and X16673) can be used to
provide constitutive expression of the trait gene.
[0602] The explants are cocultivated for 3 d in the dark on SH
induction medium containing 288 mg/L Pro, 53 mg/L thioproline, 4.35
g/L K2SO4, and 100 .mu.m acetosyringinone. The explants are washed
in half-strength Murashige-Skoog medium (Murashige and Skoog, 1962)
and plated on the same SH induction medium without acetosyringinone
but with a suitable selection agent and suitable antibiotic to
inhibit Agrobacterium growth. After several weeks, somatic embryos
are transferred to BOi2Y development medium containing no growth
regulators, no antibiotics, and 50 g/L sucrose. Somatic embryos are
subsequently germinated on half-strength Murashige-Skoog medium.
Rooted seedlings are transplanted into pots and grown in a
greenhouse.
[0603] The T0 transgenic plants are propagated by node cuttings and
rooted in Turface growth medium. The plants are defoliated and
grown to a height of about 10 cm (approximately 2 weeks after
defoliation).
EQUIVALENTS
[0604] The skilled worker knows, or can identify by using simply
routine methods, a large number of equivalents of the specific
embodiments of the invention. These equivalents are intended to be
included in the patent claims below.
Sequence CWU 1
1
531708DNAArabidopsis thalianaCDS(1)..(708) 1atg ttg aag ctt tgg aga
tgg tac cag cga tgc ctg acg gtt cat cct 48Met Leu Lys Leu Trp Arg
Trp Tyr Gln Arg Cys Leu Thr Val His Pro1 5 10 15gtg aaa act cag gtc
atc agt tct gga ttt ctt tgg gga ttt ggc gat 96Val Lys Thr Gln Val
Ile Ser Ser Gly Phe Leu Trp Gly Phe Gly Asp 20 25 30gtc acc gct caa
tac atc act cat tcc act gcg aaa cgt cgt ctt ctt 144Val Thr Ala Gln
Tyr Ile Thr His Ser Thr Ala Lys Arg Arg Leu Leu 35 40 45cgt ctc acc
gaa aca aat aaa gat gct gac gca gat gca gaa att aag 192Arg Leu Thr
Glu Thr Asn Lys Asp Ala Asp Ala Asp Ala Glu Ile Lys 50 55 60gtc aag
tgg aag caa gat gca gaa ttc aaa gtc aac tgg aag cga gta 240Val Lys
Trp Lys Gln Asp Ala Glu Phe Lys Val Asn Trp Lys Arg Val65 70 75
80gct atc acg agc atg ttt gga ttt ggt ttt gtc gga cct gtt ggc cac
288Ala Ile Thr Ser Met Phe Gly Phe Gly Phe Val Gly Pro Val Gly His
85 90 95ttc tgg tac gaa ggc ttg gat aaa ttc ata aaa ctg aag ctt cga
tat 336Phe Trp Tyr Glu Gly Leu Asp Lys Phe Ile Lys Leu Lys Leu Arg
Tyr 100 105 110gta cca aag tca aca cgt ttt gta gct gca aaa gtt gca
atg gat ggt 384Val Pro Lys Ser Thr Arg Phe Val Ala Ala Lys Val Ala
Met Asp Gly 115 120 125ctt atc ttt gga cct gta gat cta ctg gtg ttc
ttc aca tac atg gga 432Leu Ile Phe Gly Pro Val Asp Leu Leu Val Phe
Phe Thr Tyr Met Gly 130 135 140ttc gcc aca gga aag aac aca gct gaa
gtg aaa gaa gga ctc aag aga 480Phe Ala Thr Gly Lys Asn Thr Ala Glu
Val Lys Glu Gly Leu Lys Arg145 150 155 160gat ttt ctt ccg gct cta
gct ctt gaa ggc gga gca tgg cca ctt ctt 528Asp Phe Leu Pro Ala Leu
Ala Leu Glu Gly Gly Ala Trp Pro Leu Leu 165 170 175cag att gca aac
ttc aga tat gtt ccc gtg caa tac cag ttg ctt tac 576Gln Ile Ala Asn
Phe Arg Tyr Val Pro Val Gln Tyr Gln Leu Leu Tyr 180 185 190gtc aac
atc ttt tgc cta gta gac agt gcc ttc ctc tca tgg gtc gag 624Val Asn
Ile Phe Cys Leu Val Asp Ser Ala Phe Leu Ser Trp Val Glu 195 200
205caa cag aag gac gca gct tgg aag caa tgg ttt act tca tca ttt caa
672Gln Gln Lys Asp Ala Ala Trp Lys Gln Trp Phe Thr Ser Ser Phe Gln
210 215 220cca tta aaa gaa cga ggt ggc caa ggc gga gta tga 708Pro
Leu Lys Glu Arg Gly Gly Gln Gly Gly Val225 230
2352235PRTArabidopsis thaliana 2Met Leu Lys Leu Trp Arg Trp Tyr Gln
Arg Cys Leu Thr Val His Pro1 5 10 15Val Lys Thr Gln Val Ile Ser Ser
Gly Phe Leu Trp Gly Phe Gly Asp 20 25 30Val Thr Ala Gln Tyr Ile Thr
His Ser Thr Ala Lys Arg Arg Leu Leu 35 40 45Arg Leu Thr Glu Thr Asn
Lys Asp Ala Asp Ala Asp Ala Glu Ile Lys 50 55 60Val Lys Trp Lys Gln
Asp Ala Glu Phe Lys Val Asn Trp Lys Arg Val65 70 75 80Ala Ile Thr
Ser Met Phe Gly Phe Gly Phe Val Gly Pro Val Gly His 85 90 95Phe Trp
Tyr Glu Gly Leu Asp Lys Phe Ile Lys Leu Lys Leu Arg Tyr 100 105
110Val Pro Lys Ser Thr Arg Phe Val Ala Ala Lys Val Ala Met Asp Gly
115 120 125Leu Ile Phe Gly Pro Val Asp Leu Leu Val Phe Phe Thr Tyr
Met Gly 130 135 140Phe Ala Thr Gly Lys Asn Thr Ala Glu Val Lys Glu
Gly Leu Lys Arg145 150 155 160Asp Phe Leu Pro Ala Leu Ala Leu Glu
Gly Gly Ala Trp Pro Leu Leu 165 170 175Gln Ile Ala Asn Phe Arg Tyr
Val Pro Val Gln Tyr Gln Leu Leu Tyr 180 185 190Val Asn Ile Phe Cys
Leu Val Asp Ser Ala Phe Leu Ser Trp Val Glu 195 200 205Gln Gln Lys
Asp Ala Ala Trp Lys Gln Trp Phe Thr Ser Ser Phe Gln 210 215 220Pro
Leu Lys Glu Arg Gly Gly Gln Gly Gly Val225 230 2353669DNAOryza
sativaCDS(1)..(669) 3atg cgg cgg cta tgg cgg tgg tac cag cag tgc
ctg gcc acc cac ccc 48Met Arg Arg Leu Trp Arg Trp Tyr Gln Gln Cys
Leu Ala Thr His Pro1 5 10 15gtg cgc acg cag gtg gtc agc tcc ggc atc
ctc tgg ggc ctc ggc gac 96Val Arg Thr Gln Val Val Ser Ser Gly Ile
Leu Trp Gly Leu Gly Asp 20 25 30atc ggc gcc cag gcc gtc acc cac tac
tcc gcc ccc gga cgc ccc cgc 144Ile Gly Ala Gln Ala Val Thr His Tyr
Ser Ala Pro Gly Arg Pro Arg 35 40 45cac cac cag cac cac gcc aag aat
cct ccc gag gat aaa gat aaa gag 192His His Gln His His Ala Lys Asn
Pro Pro Glu Asp Lys Asp Lys Glu 50 55 60ttc aaa att gat tgg aag agg
gtg ggc atc aca agc tca ttt gga ttt 240Phe Lys Ile Asp Trp Lys Arg
Val Gly Ile Thr Ser Ser Phe Gly Phe65 70 75 80gct ttt gtt gga cca
gtt gga cat tac tgg tat gaa tac ttg gat cgc 288Ala Phe Val Gly Pro
Val Gly His Tyr Trp Tyr Glu Tyr Leu Asp Arg 85 90 95ttc atc ctg agg
aga tac cag cct aag acc ttc aaa ttt gtt gcg tca 336Phe Ile Leu Arg
Arg Tyr Gln Pro Lys Thr Phe Lys Phe Val Ala Ser 100 105 110aaa gtt
gct gcg gat ggt ctc cta ttt gga cca gta gat ctt ctc ttg 384Lys Val
Ala Ala Asp Gly Leu Leu Phe Gly Pro Val Asp Leu Leu Leu 115 120
125ttc ttc tca tat gtt ggt ctt gca tca gga agg agt gta gag cag gtg
432Phe Phe Ser Tyr Val Gly Leu Ala Ser Gly Arg Ser Val Glu Gln Val
130 135 140aag gat gat gtg aag agg gac ttc att cct gct cta gtt cta
ggg gga 480Lys Asp Asp Val Lys Arg Asp Phe Ile Pro Ala Leu Val Leu
Gly Gly145 150 155 160acc atc tgg cca gcc gtg caa atc gca aat ttc
cgc ttc att cct gtg 528Thr Ile Trp Pro Ala Val Gln Ile Ala Asn Phe
Arg Phe Ile Pro Val 165 170 175cga tat cag ctc ctt tac gtg aac ctg
ttc tgc ctc tta gac agt tgc 576Arg Tyr Gln Leu Leu Tyr Val Asn Leu
Phe Cys Leu Leu Asp Ser Cys 180 185 190ttc ttg tcg tgg atc gat caa
caa gga gat gca cct tgg aag caa tgg 624Phe Leu Ser Trp Ile Asp Gln
Gln Gly Asp Ala Pro Trp Lys Gln Trp 195 200 205ttc aca tca ttc cag
aaa atc gaa ggc cag aag ggc aag gtt tga 669Phe Thr Ser Phe Gln Lys
Ile Glu Gly Gln Lys Gly Lys Val 210 215 2204222PRTOryza sativa 4Met
Arg Arg Leu Trp Arg Trp Tyr Gln Gln Cys Leu Ala Thr His Pro1 5 10
15Val Arg Thr Gln Val Val Ser Ser Gly Ile Leu Trp Gly Leu Gly Asp
20 25 30Ile Gly Ala Gln Ala Val Thr His Tyr Ser Ala Pro Gly Arg Pro
Arg 35 40 45His His Gln His His Ala Lys Asn Pro Pro Glu Asp Lys Asp
Lys Glu 50 55 60Phe Lys Ile Asp Trp Lys Arg Val Gly Ile Thr Ser Ser
Phe Gly Phe65 70 75 80Ala Phe Val Gly Pro Val Gly His Tyr Trp Tyr
Glu Tyr Leu Asp Arg 85 90 95Phe Ile Leu Arg Arg Tyr Gln Pro Lys Thr
Phe Lys Phe Val Ala Ser 100 105 110Lys Val Ala Ala Asp Gly Leu Leu
Phe Gly Pro Val Asp Leu Leu Leu 115 120 125Phe Phe Ser Tyr Val Gly
Leu Ala Ser Gly Arg Ser Val Glu Gln Val 130 135 140Lys Asp Asp Val
Lys Arg Asp Phe Ile Pro Ala Leu Val Leu Gly Gly145 150 155 160Thr
Ile Trp Pro Ala Val Gln Ile Ala Asn Phe Arg Phe Ile Pro Val 165 170
175Arg Tyr Gln Leu Leu Tyr Val Asn Leu Phe Cys Leu Leu Asp Ser Cys
180 185 190Phe Leu Ser Trp Ile Asp Gln Gln Gly Asp Ala Pro Trp Lys
Gln Trp 195 200 205Phe Thr Ser Phe Gln Lys Ile Glu Gly Gln Lys Gly
Lys Val 210 215 2205717DNABrassica napusCDS(1)..(717) 5atg ttg aag
gtg tgg aga tgg tac cag cga tgc ctg agc gtt cat ccg 48Met Leu Lys
Val Trp Arg Trp Tyr Gln Arg Cys Leu Ser Val His Pro1 5 10 15gtg aaa
act cag gtc ata agc tcg ggc ttt ctt tgg gga ttc ggg gac 96Val Lys
Thr Gln Val Ile Ser Ser Gly Phe Leu Trp Gly Phe Gly Asp 20 25 30gtc
acc gct caa tac atc act cat tca act gcg aaa cct cct ctt ctc 144Val
Thr Ala Gln Tyr Ile Thr His Ser Thr Ala Lys Pro Pro Leu Leu 35 40
45cgt ctc acc gac aca aat aaa gat gca gac gct gat tca gaa ttt aag
192Arg Leu Thr Asp Thr Asn Lys Asp Ala Asp Ala Asp Ser Glu Phe Lys
50 55 60ctc aac tgg aag cga gta gct atc act agc atg ttt gga ctt ggt
ttt 240Leu Asn Trp Lys Arg Val Ala Ile Thr Ser Met Phe Gly Leu Gly
Phe65 70 75 80gtc ggt cct gtt ggc cac ttc tgg tac gaa ggc ctt gat
aaa ttc ata 288Val Gly Pro Val Gly His Phe Trp Tyr Glu Gly Leu Asp
Lys Phe Ile 85 90 95aaa ctg aag ctt cga tac gta cca aag tca acg cgt
ttt gta gca gcc 336Lys Leu Lys Leu Arg Tyr Val Pro Lys Ser Thr Arg
Phe Val Ala Ala 100 105 110aaa gtt gca atg gat ggt ctt atc ttc ggc
ccc ata gat cta ctc gtg 384Lys Val Ala Met Asp Gly Leu Ile Phe Gly
Pro Ile Asp Leu Leu Val 115 120 125ttc ttc acg tac atg gga tac gcc
acg ggc aag aac aca tct caa gtg 432Phe Phe Thr Tyr Met Gly Tyr Ala
Thr Gly Lys Asn Thr Ser Gln Val 130 135 140aaa gaa gga ctc aag aga
gac ttt cta ccg gct cta gct ctt gaa gga 480Lys Glu Gly Leu Lys Arg
Asp Phe Leu Pro Ala Leu Ala Leu Glu Gly145 150 155 160gga gca tgg
ccg ctt ctt cag atc gct aac ttc aga tac gtt cct gtg 528Gly Ala Trp
Pro Leu Leu Gln Ile Ala Asn Phe Arg Tyr Val Pro Val 165 170 175cag
tac cag ctg ctt tac gtc aac atc ttt tgc ctt ata gac agc gct 576Gln
Tyr Gln Leu Leu Tyr Val Asn Ile Phe Cys Leu Ile Asp Ser Ala 180 185
190ttt ctc tcg tgg gtg gat caa cag aag gat gca gct tgg aag cag tgg
624Phe Leu Ser Trp Val Asp Gln Gln Lys Asp Ala Ala Trp Lys Gln Trp
195 200 205ttt act act ccg ttt cta acg ctt aaa gaa cga ggt gcg cac
agg tgg 672Phe Thr Thr Pro Phe Leu Thr Leu Lys Glu Arg Gly Ala His
Arg Trp 210 215 220agt atg att cat ttc gtt ttt ctc aca tgt cat aaa
aac ttt gaa 717Ser Met Ile His Phe Val Phe Leu Thr Cys His Lys Asn
Phe Glu225 230 2356239PRTBrassica napus 6Met Leu Lys Val Trp Arg
Trp Tyr Gln Arg Cys Leu Ser Val His Pro1 5 10 15Val Lys Thr Gln Val
Ile Ser Ser Gly Phe Leu Trp Gly Phe Gly Asp 20 25 30Val Thr Ala Gln
Tyr Ile Thr His Ser Thr Ala Lys Pro Pro Leu Leu 35 40 45Arg Leu Thr
Asp Thr Asn Lys Asp Ala Asp Ala Asp Ser Glu Phe Lys 50 55 60Leu Asn
Trp Lys Arg Val Ala Ile Thr Ser Met Phe Gly Leu Gly Phe65 70 75
80Val Gly Pro Val Gly His Phe Trp Tyr Glu Gly Leu Asp Lys Phe Ile
85 90 95Lys Leu Lys Leu Arg Tyr Val Pro Lys Ser Thr Arg Phe Val Ala
Ala 100 105 110Lys Val Ala Met Asp Gly Leu Ile Phe Gly Pro Ile Asp
Leu Leu Val 115 120 125Phe Phe Thr Tyr Met Gly Tyr Ala Thr Gly Lys
Asn Thr Ser Gln Val 130 135 140Lys Glu Gly Leu Lys Arg Asp Phe Leu
Pro Ala Leu Ala Leu Glu Gly145 150 155 160Gly Ala Trp Pro Leu Leu
Gln Ile Ala Asn Phe Arg Tyr Val Pro Val 165 170 175Gln Tyr Gln Leu
Leu Tyr Val Asn Ile Phe Cys Leu Ile Asp Ser Ala 180 185 190Phe Leu
Ser Trp Val Asp Gln Gln Lys Asp Ala Ala Trp Lys Gln Trp 195 200
205Phe Thr Thr Pro Phe Leu Thr Leu Lys Glu Arg Gly Ala His Arg Trp
210 215 220Ser Met Ile His Phe Val Phe Leu Thr Cys His Lys Asn Phe
Glu225 230 2357630DNAGlycine maxCDS(1)..(630) 7atg ctg agg ttg tgg
aaa tgg tac cag aat tgc ttg gcg gtt cac cct 48Met Leu Arg Leu Trp
Lys Trp Tyr Gln Asn Cys Leu Ala Val His Pro1 5 10 15gtt aag aca cag
gtc atc agc tct ggc ttg att tgg ggt gct ggt gac 96Val Lys Thr Gln
Val Ile Ser Ser Gly Leu Ile Trp Gly Ala Gly Asp 20 25 30ata gct gct
cag gca gtt acc cac tac act gcc aag aaa cgt gtc act 144Ile Ala Ala
Gln Ala Val Thr His Tyr Thr Ala Lys Lys Arg Val Thr 35 40 45ttt gat
gcg gat gac act aaa gaa ttc aag atc aac tgg aga cgg gtg 192Phe Asp
Ala Asp Asp Thr Lys Glu Phe Lys Ile Asn Trp Arg Arg Val 50 55 60tct
acg acc agc ttg ttt ggg tta gga ttt gtt ggc cct gtt ggc cac 240Ser
Thr Thr Ser Leu Phe Gly Leu Gly Phe Val Gly Pro Val Gly His65 70 75
80ttc tgg tac gaa ggt ttg gat cgg ttt ata aga ctg aaa ctc atg ctt
288Phe Trp Tyr Glu Gly Leu Asp Arg Phe Ile Arg Leu Lys Leu Met Leu
85 90 95aaa ccg aat tcc ttc cgc ttt gtt gcc act aaa gtt gcc gtt gat
ggg 336Lys Pro Asn Ser Phe Arg Phe Val Ala Thr Lys Val Ala Val Asp
Gly 100 105 110ttt atc ttt gga cca ttg gat tta ctt gtg ttt ttc act
tat atg ggt 384Phe Ile Phe Gly Pro Leu Asp Leu Leu Val Phe Phe Thr
Tyr Met Gly 115 120 125ttt tct gct gga aag agt gtt cct caa gta aaa
gaa gat gtg aag aga 432Phe Ser Ala Gly Lys Ser Val Pro Gln Val Lys
Glu Asp Val Lys Arg 130 135 140gat ttt ctc cca gcc ttt gtt tta gaa
ggg ggc ata tgg cca att gtt 480Asp Phe Leu Pro Ala Phe Val Leu Glu
Gly Gly Ile Trp Pro Ile Val145 150 155 160cag gtt gcg aac ttt cgg
ttt ata cct gtg agg tat caa ctc ctt tat 528Gln Val Ala Asn Phe Arg
Phe Ile Pro Val Arg Tyr Gln Leu Leu Tyr 165 170 175gtc aac ttc ttc
tgc ttg ttg gat agc tgt ttc ttg tct tgg gtt gag 576Val Asn Phe Phe
Cys Leu Leu Asp Ser Cys Phe Leu Ser Trp Val Glu 180 185 190caa caa
cag gat gct cca tgg aaa caa tgg ttg aaa tca ttt cta cct 624Gln Gln
Gln Asp Ala Pro Trp Lys Gln Trp Leu Lys Ser Phe Leu Pro 195 200
205atg aag 630Met Lys 2108210PRTGlycine max 8Met Leu Arg Leu Trp
Lys Trp Tyr Gln Asn Cys Leu Ala Val His Pro1 5 10 15Val Lys Thr Gln
Val Ile Ser Ser Gly Leu Ile Trp Gly Ala Gly Asp 20 25 30Ile Ala Ala
Gln Ala Val Thr His Tyr Thr Ala Lys Lys Arg Val Thr 35 40 45Phe Asp
Ala Asp Asp Thr Lys Glu Phe Lys Ile Asn Trp Arg Arg Val 50 55 60Ser
Thr Thr Ser Leu Phe Gly Leu Gly Phe Val Gly Pro Val Gly His65 70 75
80Phe Trp Tyr Glu Gly Leu Asp Arg Phe Ile Arg Leu Lys Leu Met Leu
85 90 95Lys Pro Asn Ser Phe Arg Phe Val Ala Thr Lys Val Ala Val Asp
Gly 100 105 110Phe Ile Phe Gly Pro Leu Asp Leu Leu Val Phe Phe Thr
Tyr Met Gly 115 120 125Phe Ser Ala Gly Lys Ser Val Pro Gln Val Lys
Glu Asp Val Lys Arg 130 135 140Asp Phe Leu Pro Ala Phe Val Leu Glu
Gly Gly Ile Trp Pro Ile Val145 150 155 160Gln Val Ala Asn Phe Arg
Phe Ile Pro Val Arg Tyr Gln Leu Leu Tyr 165 170 175Val Asn Phe Phe
Cys Leu Leu Asp Ser Cys Phe Leu Ser Trp Val Glu 180 185 190Gln Gln
Gln Asp Ala Pro Trp Lys Gln Trp Leu Lys Ser Phe Leu Pro 195 200
205Met Lys 2109666DNAOryza sativaCDS(1)..(666) 9atg cgg cgg cta tgg
cgg tgg tac cag cag tgc ctg gcc acc cac ccc 48Met Arg Arg Leu Trp
Arg Trp Tyr Gln Gln Cys Leu Ala Thr His Pro1 5 10 15gtg cgc acg cag
gtg gtc agc tcc ggc atc ctc tgg ggc ctc ggc gac 96Val Arg Thr Gln
Val Val Ser Ser Gly Ile Leu Trp Gly Leu Gly Asp 20 25 30atc ggc gcc
cag gcc gtc acc cac tac tcc gcc ccc gga cgc ccc cgc 144Ile Gly Ala
Gln
Ala Val Thr His Tyr Ser Ala Pro Gly Arg Pro Arg 35 40 45cac cac cag
cac cac gcc aag aat cct ccc gag gat aaa gat aaa gag 192His His Gln
His His Ala Lys Asn Pro Pro Glu Asp Lys Asp Lys Glu 50 55 60ttc aaa
att gat tgg aag agg gtg ggc atc aca agc tca ttt gga ttt 240Phe Lys
Ile Asp Trp Lys Arg Val Gly Ile Thr Ser Ser Phe Gly Phe65 70 75
80gct ttt gtt gga cca gtt gga cat tac tgg tat gaa tac ttg gat cgc
288Ala Phe Val Gly Pro Val Gly His Tyr Trp Tyr Glu Tyr Leu Asp Arg
85 90 95ttc atc ctg agg aga tac cag cct aag acc ttc aaa ttt gtt gcg
tca 336Phe Ile Leu Arg Arg Tyr Gln Pro Lys Thr Phe Lys Phe Val Ala
Ser 100 105 110aaa gtt gct gcg gat ggt ctc cta ttt gga cca gta gat
ctt ctc ttg 384Lys Val Ala Ala Asp Gly Leu Leu Phe Gly Pro Val Asp
Leu Leu Leu 115 120 125ttc ttc tca tat gtt ggt ctt gca tca gga agg
agt gta gag cag gtg 432Phe Phe Ser Tyr Val Gly Leu Ala Ser Gly Arg
Ser Val Glu Gln Val 130 135 140aag gat gat gtg aag agg gac ttc att
cct gct cta gtt cta ggg gga 480Lys Asp Asp Val Lys Arg Asp Phe Ile
Pro Ala Leu Val Leu Gly Gly145 150 155 160acc atc tgg cca gcc gtg
caa atc gca aat ttc cgc ttc att cct gtg 528Thr Ile Trp Pro Ala Val
Gln Ile Ala Asn Phe Arg Phe Ile Pro Val 165 170 175cga tat cag ctc
ctt tac gtg aac ctg ttc tgc ctc tta gac agt tgc 576Arg Tyr Gln Leu
Leu Tyr Val Asn Leu Phe Cys Leu Leu Asp Ser Cys 180 185 190ttc ttg
tcg tgg atc gat caa caa gga gat gca cct tgg aag caa tgg 624Phe Leu
Ser Trp Ile Asp Gln Gln Gly Asp Ala Pro Trp Lys Gln Trp 195 200
205ttc aca tca ttc cag aaa atc gaa ggc cag aag ggc aag gtt 666Phe
Thr Ser Phe Gln Lys Ile Glu Gly Gln Lys Gly Lys Val 210 215
22010222PRTOryza sativa 10Met Arg Arg Leu Trp Arg Trp Tyr Gln Gln
Cys Leu Ala Thr His Pro1 5 10 15Val Arg Thr Gln Val Val Ser Ser Gly
Ile Leu Trp Gly Leu Gly Asp 20 25 30Ile Gly Ala Gln Ala Val Thr His
Tyr Ser Ala Pro Gly Arg Pro Arg 35 40 45His His Gln His His Ala Lys
Asn Pro Pro Glu Asp Lys Asp Lys Glu 50 55 60Phe Lys Ile Asp Trp Lys
Arg Val Gly Ile Thr Ser Ser Phe Gly Phe65 70 75 80Ala Phe Val Gly
Pro Val Gly His Tyr Trp Tyr Glu Tyr Leu Asp Arg 85 90 95Phe Ile Leu
Arg Arg Tyr Gln Pro Lys Thr Phe Lys Phe Val Ala Ser 100 105 110Lys
Val Ala Ala Asp Gly Leu Leu Phe Gly Pro Val Asp Leu Leu Leu 115 120
125Phe Phe Ser Tyr Val Gly Leu Ala Ser Gly Arg Ser Val Glu Gln Val
130 135 140Lys Asp Asp Val Lys Arg Asp Phe Ile Pro Ala Leu Val Leu
Gly Gly145 150 155 160Thr Ile Trp Pro Ala Val Gln Ile Ala Asn Phe
Arg Phe Ile Pro Val 165 170 175Arg Tyr Gln Leu Leu Tyr Val Asn Leu
Phe Cys Leu Leu Asp Ser Cys 180 185 190Phe Leu Ser Trp Ile Asp Gln
Gln Gly Asp Ala Pro Trp Lys Gln Trp 195 200 205Phe Thr Ser Phe Gln
Lys Ile Glu Gly Gln Lys Gly Lys Val 210 215
22011594DNASaccharomyces cerevisiaeCDS(1)..(594) 11atg aag tta ttg
cat tta tat gaa gcg agc ttg aag aga agg ccc aaa 48Met Lys Leu Leu
His Leu Tyr Glu Ala Ser Leu Lys Arg Arg Pro Lys1 5 10 15act acg aat
gcg ata atg aca ggt gcg cta ttt gga att ggt gat gtt 96Thr Thr Asn
Ala Ile Met Thr Gly Ala Leu Phe Gly Ile Gly Asp Val 20 25 30tct gct
caa ttg ttg ttt cca aca tcc aaa gta aac aag ggt tat gat 144Ser Ala
Gln Leu Leu Phe Pro Thr Ser Lys Val Asn Lys Gly Tyr Asp 35 40 45tat
aaa agg aca gct agg gct gtc atc tat ggt tct tta att ttc tcc 192Tyr
Lys Arg Thr Ala Arg Ala Val Ile Tyr Gly Ser Leu Ile Phe Ser 50 55
60ttt ata ggt gac aag tgg tac aag atc ttg aac aac aag att tat atg
240Phe Ile Gly Asp Lys Trp Tyr Lys Ile Leu Asn Asn Lys Ile Tyr
Met65 70 75 80cgt aac aga cct cag tac cac tgg tct aat atg gtt tta
cgg gta gct 288Arg Asn Arg Pro Gln Tyr His Trp Ser Asn Met Val Leu
Arg Val Ala 85 90 95gtc gat caa ttg gcg ttt gcg ccg cta ggt ttg cca
ttt tat ttc acc 336Val Asp Gln Leu Ala Phe Ala Pro Leu Gly Leu Pro
Phe Tyr Phe Thr 100 105 110tgt atg tcc atc atg gaa ggt aga tca ttt
gac gta gct aag ttg aaa 384Cys Met Ser Ile Met Glu Gly Arg Ser Phe
Asp Val Ala Lys Leu Lys 115 120 125ata aaa gag caa tgg tgg cct aca
ctt ttg act aat tgg gca gtt tgg 432Ile Lys Glu Gln Trp Trp Pro Thr
Leu Leu Thr Asn Trp Ala Val Trp 130 135 140cca ctt ttc caa gcg att
aac ttt tct gtt gtt cct tta caa cat agg 480Pro Leu Phe Gln Ala Ile
Asn Phe Ser Val Val Pro Leu Gln His Arg145 150 155 160tta cta gct
gtt aat gtc gtt gca ata ttt tgg aac act tac tta tct 528Leu Leu Ala
Val Asn Val Val Ala Ile Phe Trp Asn Thr Tyr Leu Ser 165 170 175tat
aaa aac tca aag gtt atg gag aaa gac aag gta cct gtt cat tat 576Tyr
Lys Asn Ser Lys Val Met Glu Lys Asp Lys Val Pro Val His Tyr 180 185
190cca ccc gtg gtc gaa taa 594Pro Pro Val Val Glu
19512197PRTSaccharomyces cerevisiae 12Met Lys Leu Leu His Leu Tyr
Glu Ala Ser Leu Lys Arg Arg Pro Lys1 5 10 15Thr Thr Asn Ala Ile Met
Thr Gly Ala Leu Phe Gly Ile Gly Asp Val 20 25 30Ser Ala Gln Leu Leu
Phe Pro Thr Ser Lys Val Asn Lys Gly Tyr Asp 35 40 45Tyr Lys Arg Thr
Ala Arg Ala Val Ile Tyr Gly Ser Leu Ile Phe Ser 50 55 60Phe Ile Gly
Asp Lys Trp Tyr Lys Ile Leu Asn Asn Lys Ile Tyr Met65 70 75 80Arg
Asn Arg Pro Gln Tyr His Trp Ser Asn Met Val Leu Arg Val Ala 85 90
95Val Asp Gln Leu Ala Phe Ala Pro Leu Gly Leu Pro Phe Tyr Phe Thr
100 105 110Cys Met Ser Ile Met Glu Gly Arg Ser Phe Asp Val Ala Lys
Leu Lys 115 120 125Ile Lys Glu Gln Trp Trp Pro Thr Leu Leu Thr Asn
Trp Ala Val Trp 130 135 140Pro Leu Phe Gln Ala Ile Asn Phe Ser Val
Val Pro Leu Gln His Arg145 150 155 160Leu Leu Ala Val Asn Val Val
Ala Ile Phe Trp Asn Thr Tyr Leu Ser 165 170 175Tyr Lys Asn Ser Lys
Val Met Glu Lys Asp Lys Val Pro Val His Tyr 180 185 190Pro Pro Val
Val Glu 19513531DNAHumanCDS(1)..(531) 13atg gca ctc tgg cgg gca tac
cag cgg gcc ctg gcc gct cac ccg tgg 48Met Ala Leu Trp Arg Ala Tyr
Gln Arg Ala Leu Ala Ala His Pro Trp1 5 10 15aaa gta cag gtc ctg aca
gct ggg tcc ctg atg ggc ctg ggt gac att 96Lys Val Gln Val Leu Thr
Ala Gly Ser Leu Met Gly Leu Gly Asp Ile 20 25 30atc tca cag cag ctg
gtg gag agg cgg ggt ctg cag gaa cac cag aga 144Ile Ser Gln Gln Leu
Val Glu Arg Arg Gly Leu Gln Glu His Gln Arg 35 40 45ggc cgg act ctg
acc atg gtg tcc ctg ggc tgt ggc ttt gtg ggc cct 192Gly Arg Thr Leu
Thr Met Val Ser Leu Gly Cys Gly Phe Val Gly Pro 50 55 60gtg gta gga
ggc tgg tac aag gtt ttg gat cgg ttc atc cct ggc acc 240Val Val Gly
Gly Trp Tyr Lys Val Leu Asp Arg Phe Ile Pro Gly Thr65 70 75 80acc
aaa gtg gat gca ctg aag aag atg ttg ttg gat cag ggg ggc ttt 288Thr
Lys Val Asp Ala Leu Lys Lys Met Leu Leu Asp Gln Gly Gly Phe 85 90
95gcc ccg tgt ttt cta ggc tgc ttt ctc cca ctg gta ggg gca ctt aat
336Ala Pro Cys Phe Leu Gly Cys Phe Leu Pro Leu Val Gly Ala Leu Asn
100 105 110gga ctg tca gcc cag gac aac tgg gcc aaa cta cag cgg gat
tat cct 384Gly Leu Ser Ala Gln Asp Asn Trp Ala Lys Leu Gln Arg Asp
Tyr Pro 115 120 125gat gcc ctt atc acc aac tac tat cta tgg cct gct
gtg cag tta gcc 432Asp Ala Leu Ile Thr Asn Tyr Tyr Leu Trp Pro Ala
Val Gln Leu Ala 130 135 140aac ttc tac ctg gtc ccc ctt cat tac agg
ttg gcc gtt gtc caa tgt 480Asn Phe Tyr Leu Val Pro Leu His Tyr Arg
Leu Ala Val Val Gln Cys145 150 155 160gtt gct gtt atc tgg aac tcc
tac ctg tcc tgg aag gca cat cgg ctc 528Val Ala Val Ile Trp Asn Ser
Tyr Leu Ser Trp Lys Ala His Arg Leu 165 170 175taa 53114176PRTHuman
14Met Ala Leu Trp Arg Ala Tyr Gln Arg Ala Leu Ala Ala His Pro Trp1
5 10 15Lys Val Gln Val Leu Thr Ala Gly Ser Leu Met Gly Leu Gly Asp
Ile 20 25 30Ile Ser Gln Gln Leu Val Glu Arg Arg Gly Leu Gln Glu His
Gln Arg 35 40 45Gly Arg Thr Leu Thr Met Val Ser Leu Gly Cys Gly Phe
Val Gly Pro 50 55 60Val Val Gly Gly Trp Tyr Lys Val Leu Asp Arg Phe
Ile Pro Gly Thr65 70 75 80Thr Lys Val Asp Ala Leu Lys Lys Met Leu
Leu Asp Gln Gly Gly Phe 85 90 95Ala Pro Cys Phe Leu Gly Cys Phe Leu
Pro Leu Val Gly Ala Leu Asn 100 105 110Gly Leu Ser Ala Gln Asp Asn
Trp Ala Lys Leu Gln Arg Asp Tyr Pro 115 120 125Asp Ala Leu Ile Thr
Asn Tyr Tyr Leu Trp Pro Ala Val Gln Leu Ala 130 135 140Asn Phe Tyr
Leu Val Pro Leu His Tyr Arg Leu Ala Val Val Gln Cys145 150 155
160Val Ala Val Ile Trp Asn Ser Tyr Leu Ser Trp Lys Ala His Arg Leu
165 170 17515531DNAMus musculus;CDS(1)..(531) 15atg gca ctc tgg cga
gca tac cag aga gcc ctg gca gca cat ccg tgg 48Met Ala Leu Trp Arg
Ala Tyr Gln Arg Ala Leu Ala Ala His Pro Trp1 5 10 15aaa gtc cag gtt
ctg aca gct gga tca ctg atg ggc gta ggt gac atg 96Lys Val Gln Val
Leu Thr Ala Gly Ser Leu Met Gly Val Gly Asp Met 20 25 30atc tca cag
cag ctg gtg gag agg cgg ggt ctc cag caa cac cag gca 144Ile Ser Gln
Gln Leu Val Glu Arg Arg Gly Leu Gln Gln His Gln Ala 35 40 45ggc cgc
act ctg acc atg gta tcc ctg ggc tgt ggc ttt gtg ggc cct 192Gly Arg
Thr Leu Thr Met Val Ser Leu Gly Cys Gly Phe Val Gly Pro 50 55 60gtc
gtc gga ggc tgg tac aaa gtt tta gac cac tta atc ccg ggc acc 240Val
Val Gly Gly Trp Tyr Lys Val Leu Asp His Leu Ile Pro Gly Thr65 70 75
80acg aag gtg cat gca ctg aag aag atg ttg tta gat cag ggg ggc ttt
288Thr Lys Val His Ala Leu Lys Lys Met Leu Leu Asp Gln Gly Gly Phe
85 90 95gcc cca tgt ttc cta ggc tgc ttt ctc cca ctg gtc ggg ata ctc
aat 336Ala Pro Cys Phe Leu Gly Cys Phe Leu Pro Leu Val Gly Ile Leu
Asn 100 105 110gga atg tca gcc cag gac aat tgg gcc aaa ctg aag cgg
gac tac cct 384Gly Met Ser Ala Gln Asp Asn Trp Ala Lys Leu Lys Arg
Asp Tyr Pro 115 120 125gat gcc ctc atc acc aac tac tat ctc tgg cct
gct gtg cag tta gcc 432Asp Ala Leu Ile Thr Asn Tyr Tyr Leu Trp Pro
Ala Val Gln Leu Ala 130 135 140aac ttc tac ctg gtc ccc ctg cat tac
agg ttg gct gtt gtc cag tgt 480Asn Phe Tyr Leu Val Pro Leu His Tyr
Arg Leu Ala Val Val Gln Cys145 150 155 160gtt gct att gtc tgg aac
tcc tac cta tcc tgg aag gca cat cag ttc 528Val Ala Ile Val Trp Asn
Ser Tyr Leu Ser Trp Lys Ala His Gln Phe 165 170 175taa
53116176PRTMus musculus 16Met Ala Leu Trp Arg Ala Tyr Gln Arg Ala
Leu Ala Ala His Pro Trp1 5 10 15Lys Val Gln Val Leu Thr Ala Gly Ser
Leu Met Gly Val Gly Asp Met 20 25 30Ile Ser Gln Gln Leu Val Glu Arg
Arg Gly Leu Gln Gln His Gln Ala 35 40 45Gly Arg Thr Leu Thr Met Val
Ser Leu Gly Cys Gly Phe Val Gly Pro 50 55 60Val Val Gly Gly Trp Tyr
Lys Val Leu Asp His Leu Ile Pro Gly Thr65 70 75 80Thr Lys Val His
Ala Leu Lys Lys Met Leu Leu Asp Gln Gly Gly Phe 85 90 95Ala Pro Cys
Phe Leu Gly Cys Phe Leu Pro Leu Val Gly Ile Leu Asn 100 105 110Gly
Met Ser Ala Gln Asp Asn Trp Ala Lys Leu Lys Arg Asp Tyr Pro 115 120
125Asp Ala Leu Ile Thr Asn Tyr Tyr Leu Trp Pro Ala Val Gln Leu Ala
130 135 140Asn Phe Tyr Leu Val Pro Leu His Tyr Arg Leu Ala Val Val
Gln Cys145 150 155 160Val Ala Ile Val Trp Asn Ser Tyr Leu Ser Trp
Lys Ala His Gln Phe 165 170 1751746DNASaccharomyces
cerevisiaemisc_feature(1)..(46)PCR primer 17ggaattccag ctgaccacca
tgaagttatt gcatttatat gaagcg 461844DNASaccharomyces
cerevisiaemisc_feature(1)..(44)PCR primer 18gatccccggg aattgccatg
ttattcgacc acgggtggat aatg 441934DNAArabidopsis
thalianamisc_feature(1)..(34)PCR primer 19atacccggga aacaatgttg
aagctttgga gatg 342029DNAArabidopsis
thalianamisc_feature(1)..(29)PCR primer 20atagagctct catactccgc
cttggccac 292123DNAArabidopsis thalianamisc_feature(1)..(23)PCR
primer 21cgccttggcc acctcgttct ttt 232225DNAArabidopsis
thalianamisc_feature(1)..(23)PCR primer 22gctgcaaaag ttgcaatgga
tggtc 2523828DNAArabidopsis thaliana 23tttttttttt tttttttttt
ttaattctaa cagacattta ttcacttgta ctgaattctc 60gtgaaacgaa ataatatttg
atcaagaatc tgtatcctag gcaactttcg ttgttgaaaa 120tcgccaatta
cactcgtttt tgttttcatt caaagtttat gacagggaaa acgatcatac
180tccgccttgg cctcctcgtt cttttaatgg ttgaaatgat gaagtaaacc
attgcttcca 240agctgcgtcc ttctgttgct cgacccatga gaggaaggca
ctgtctacta ggcaaaagat 300gttgacgtaa agcaactggt attgcacggg
aacatatctg aagtttgcaa tctgaagaag 360tggccatgct ccgccttcaa
gagctagagc cggaagaaaa tctctcttga gtccttcttt 420cacttcagct
gtgttctttc ctgtggcgaa tcccatgtat gtgaagaaca ccagtagatc
480tacaggtcca aagataagac catccattgc aacttttgca gctacaaaac
gtgttgactt 540tggtacatat cgaagcttca gttttatgaa tttatccaag
ccttcgtacc aaaagtggcc 600aacaggtccg acaaaaccaa atccaaacat
gctcgtgata gctactcgct tccagttgac 660tttgaattct gcatctcgct
tccagttgac cttgaattct gcatctgcgt caacatcttt 720attcgtttcg
gtgagacgaa gaagacgacg tttcgcagtg gaatgagtga tgtattgagc
780ggtgacatcg ccaaatcccc aaagaaatcc agaactgcgg acgcgtgg
82824708DNAArabidopsis thalianaCDS(1)..(708) 24atg ttg aag ctt tgg
aga tgg tac cag cga tgc ctg acg gtt cat cct 48Met Leu Lys Leu Trp
Arg Trp Tyr Gln Arg Cys Leu Thr Val His Pro1 5 10 15gtg aaa act cag
gtc atc agt tct gga ttt ctt tgg gga ttt ggc gat 96Val Lys Thr Gln
Val Ile Ser Ser Gly Phe Leu Trp Gly Phe Gly Asp 20 25 30gtc acc gct
caa tac atc act cat tcc act gcg aaa cgt cgt ctt ctt 144Val Thr Ala
Gln Tyr Ile Thr His Ser Thr Ala Lys Arg Arg Leu Leu 35 40 45cgt ctc
acc gaa aca aat aaa gat gct gac gca gat gca gaa att aag 192Arg Leu
Thr Glu Thr Asn Lys Asp Ala Asp Ala Asp Ala Glu Ile Lys 50 55 60gtc
aag tgg aag caa gat gca gaa ttc aaa gtc aac tgg aag cga gta 240Val
Lys Trp Lys Gln Asp Ala Glu Phe Lys Val Asn Trp Lys Arg Val65 70 75
80gct atc acg agc atg ttt gga ttt ggt ttt gtc gga cct gtt ggc cac
288Ala Ile Thr Ser Met Phe Gly Phe Gly Phe Val Gly Pro Val Gly His
85 90 95ttc tgg tac gaa ggc ttg gat aaa ttc ata aaa ctg aag cct cga
tat 336Phe Trp Tyr Glu Gly Leu Asp Lys Phe Ile Lys Leu Lys Pro Arg
Tyr 100 105 110gta cca aag tca aca cgt ttt gta tct gca aaa gtt gca
atg gat ggt 384Val Pro Lys Ser Thr Arg Phe Val Ser Ala Lys Val Ala
Met Asp Gly
115 120 125ctt atc ttt gga cct gta gat cta ctg gtg ttc ttc aca tac
atg gga 432Leu Ile Phe Gly Pro Val Asp Leu Leu Val Phe Phe Thr Tyr
Met Gly 130 135 140ttc gcc aca gga aag aac aca gct gaa gtg aaa gaa
gga ctc aag aga 480Phe Ala Thr Gly Lys Asn Thr Ala Glu Val Lys Glu
Gly Leu Lys Arg145 150 155 160gat ttt ctt ccg gct cta gct ctt gaa
ggc gga gca tgg cca ctt ctt 528Asp Phe Leu Pro Ala Leu Ala Leu Glu
Gly Gly Ala Trp Pro Leu Leu 165 170 175cag att gca aac ttc aga tat
gtt ccc gtg caa tac cag ttg ctt tac 576Gln Ile Ala Asn Phe Arg Tyr
Val Pro Val Gln Tyr Gln Leu Leu Tyr 180 185 190gtc aac atc ttt tgc
cta gta gac agt gcc ttc ctc tca tgg gtc gag 624Val Asn Ile Phe Cys
Leu Val Asp Ser Ala Phe Leu Ser Trp Val Glu 195 200 205caa cag aag
gac gca gct tgg aag caa tgg ttt act tca tca ttt caa 672Gln Gln Lys
Asp Ala Ala Trp Lys Gln Trp Phe Thr Ser Ser Phe Gln 210 215 220cca
tta aaa gaa cga ggt ggc caa ggc gga gta tga 708Pro Leu Lys Glu Arg
Gly Gly Gln Gly Gly Val225 230 23525235PRTArabidopsis thaliana
25Met Leu Lys Leu Trp Arg Trp Tyr Gln Arg Cys Leu Thr Val His Pro1
5 10 15Val Lys Thr Gln Val Ile Ser Ser Gly Phe Leu Trp Gly Phe Gly
Asp 20 25 30Val Thr Ala Gln Tyr Ile Thr His Ser Thr Ala Lys Arg Arg
Leu Leu 35 40 45Arg Leu Thr Glu Thr Asn Lys Asp Ala Asp Ala Asp Ala
Glu Ile Lys 50 55 60Val Lys Trp Lys Gln Asp Ala Glu Phe Lys Val Asn
Trp Lys Arg Val65 70 75 80Ala Ile Thr Ser Met Phe Gly Phe Gly Phe
Val Gly Pro Val Gly His 85 90 95Phe Trp Tyr Glu Gly Leu Asp Lys Phe
Ile Lys Leu Lys Pro Arg Tyr 100 105 110Val Pro Lys Ser Thr Arg Phe
Val Ser Ala Lys Val Ala Met Asp Gly 115 120 125Leu Ile Phe Gly Pro
Val Asp Leu Leu Val Phe Phe Thr Tyr Met Gly 130 135 140Phe Ala Thr
Gly Lys Asn Thr Ala Glu Val Lys Glu Gly Leu Lys Arg145 150 155
160Asp Phe Leu Pro Ala Leu Ala Leu Glu Gly Gly Ala Trp Pro Leu Leu
165 170 175Gln Ile Ala Asn Phe Arg Tyr Val Pro Val Gln Tyr Gln Leu
Leu Tyr 180 185 190Val Asn Ile Phe Cys Leu Val Asp Ser Ala Phe Leu
Ser Trp Val Glu 195 200 205Gln Gln Lys Asp Ala Ala Trp Lys Gln Trp
Phe Thr Ser Ser Phe Gln 210 215 220Pro Leu Lys Glu Arg Gly Gly Gln
Gly Gly Val225 230 23526708DNAArabidopsis thalianaCDS(1)..(708)
26atg ttg aag ctt tgg aga tgg tac cag cga tgc ctg acg gtt cat cct
48Met Leu Lys Leu Trp Arg Trp Tyr Gln Arg Cys Leu Thr Val His Pro1
5 10 15gtg aaa act cag gtc atc agt tct gga ttt ctt tgg gga ttt ggc
gat 96Val Lys Thr Gln Val Ile Ser Ser Gly Phe Leu Trp Gly Phe Gly
Asp 20 25 30gtc acc gct caa tac atc act cat tcc act gcg aaa cgt cgt
ctt ctt 144Val Thr Ala Gln Tyr Ile Thr His Ser Thr Ala Lys Arg Arg
Leu Leu 35 40 45cgt ctc acc gaa acg aat aaa gat gtt gac gca gat gca
gaa ttc aag 192Arg Leu Thr Glu Thr Asn Lys Asp Val Asp Ala Asp Ala
Glu Phe Lys 50 55 60gtc aac tgg aag cga gat gca gaa ttc aaa gtc aac
tgg aag cga gta 240Val Asn Trp Lys Arg Asp Ala Glu Phe Lys Val Asn
Trp Lys Arg Val65 70 75 80gct atc acg agc atg ttt gga ttt ggt ttt
gtc gga cct gtt ggc cac 288Ala Ile Thr Ser Met Phe Gly Phe Gly Phe
Val Gly Pro Val Gly His 85 90 95ttt tgg tac gaa ggc ttg gat aaa ttc
ata aaa ctg aag ctt cga tat 336Phe Trp Tyr Glu Gly Leu Asp Lys Phe
Ile Lys Leu Lys Leu Arg Tyr 100 105 110gta cca aag tca aca cgt ttt
gta gct gcc aaa gtt gca atg gat ggt 384Val Pro Lys Ser Thr Arg Phe
Val Ala Ala Lys Val Ala Met Asp Gly 115 120 125ctt atc ttt gga cct
ata gat cta ctg gtg ttc ttc aca tac atg gga 432Leu Ile Phe Gly Pro
Ile Asp Leu Leu Val Phe Phe Thr Tyr Met Gly 130 135 140ttc gcc aca
gga aag aac aca gct gaa gtg aaa gaa gga ctc aag aga 480Phe Ala Thr
Gly Lys Asn Thr Ala Glu Val Lys Glu Gly Leu Lys Arg145 150 155
160gat ttt ctt ccg gct cta gct ctt gaa ggc gga gca tgg cca ctt ctt
528Asp Phe Leu Pro Ala Leu Ala Leu Glu Gly Gly Ala Trp Pro Leu Leu
165 170 175cag att gca aac ttc aga tat gtt ccc gtg caa tac cag ttg
ctt tac 576Gln Ile Ala Asn Phe Arg Tyr Val Pro Val Gln Tyr Gln Leu
Leu Tyr 180 185 190gtc aac atc ttt tgc cta gta gac agt gcc ttc ctc
tca tgg gtc gag 624Val Asn Ile Phe Cys Leu Val Asp Ser Ala Phe Leu
Ser Trp Val Glu 195 200 205caa cag aag gac gca gct tgg aag caa tgg
ttt act tca tca ttt caa 672Gln Gln Lys Asp Ala Ala Trp Lys Gln Trp
Phe Thr Ser Ser Phe Gln 210 215 220cca tta aaa gaa cga ggt ggc caa
ggc gga gta tga 708Pro Leu Lys Glu Arg Gly Gly Gln Gly Gly Val225
230 23527235PRTArabidopsis thaliana 27Met Leu Lys Leu Trp Arg Trp
Tyr Gln Arg Cys Leu Thr Val His Pro1 5 10 15Val Lys Thr Gln Val Ile
Ser Ser Gly Phe Leu Trp Gly Phe Gly Asp 20 25 30Val Thr Ala Gln Tyr
Ile Thr His Ser Thr Ala Lys Arg Arg Leu Leu 35 40 45Arg Leu Thr Glu
Thr Asn Lys Asp Val Asp Ala Asp Ala Glu Phe Lys 50 55 60Val Asn Trp
Lys Arg Asp Ala Glu Phe Lys Val Asn Trp Lys Arg Val65 70 75 80Ala
Ile Thr Ser Met Phe Gly Phe Gly Phe Val Gly Pro Val Gly His 85 90
95Phe Trp Tyr Glu Gly Leu Asp Lys Phe Ile Lys Leu Lys Leu Arg Tyr
100 105 110Val Pro Lys Ser Thr Arg Phe Val Ala Ala Lys Val Ala Met
Asp Gly 115 120 125Leu Ile Phe Gly Pro Ile Asp Leu Leu Val Phe Phe
Thr Tyr Met Gly 130 135 140Phe Ala Thr Gly Lys Asn Thr Ala Glu Val
Lys Glu Gly Leu Lys Arg145 150 155 160Asp Phe Leu Pro Ala Leu Ala
Leu Glu Gly Gly Ala Trp Pro Leu Leu 165 170 175Gln Ile Ala Asn Phe
Arg Tyr Val Pro Val Gln Tyr Gln Leu Leu Tyr 180 185 190Val Asn Ile
Phe Cys Leu Val Asp Ser Ala Phe Leu Ser Trp Val Glu 195 200 205Gln
Gln Lys Asp Ala Ala Trp Lys Gln Trp Phe Thr Ser Ser Phe Gln 210 215
220Pro Leu Lys Glu Arg Gly Gly Gln Gly Gly Val225 230
2352828DNAArabidopsis thaliana 28ccatctcata aataacgtca tgcattac
282928DNAUnknownmisc_feature(1)..(28)Probe 29tgataatcat cgcaagaccg
gcaacagt 283027DNAArabidopsis thaliana 30aacatttggc aataaagttt
cttaaga 273120DNAArabidopsis thaliana 31agttcacccg aaaagcaacg
203233DNAUnknownmisc_feature(1)..(33)Probe 32cccactgata atgatcgata
tgtgaagaac tgc 333320DNAArabidopsis thaliana 33tcgtcatgga
accaccacct 2034657DNAHordeum vulgareCDS(1)..(657) 34atg cgg agg cta
tgg cga tgg tac cag cag tcc ctg tcc tcc tac ccc 48Met Arg Arg Leu
Trp Arg Trp Tyr Gln Gln Ser Leu Ser Ser Tyr Pro1 5 10 15gtg cgg acg
cag gtc gtc agc tcc ggc atc ctc tgg gcc ctc ggc gac 96Val Arg Thr
Gln Val Val Ser Ser Gly Ile Leu Trp Ala Leu Gly Asp 20 25 30atc ggc
gcg cag gcc gtc acc cac aaa tcc gcc agc tcc cac cac cac 144Ile Gly
Ala Gln Ala Val Thr His Lys Ser Ala Ser Ser His His His 35 40 45cac
gcc aac aac ccc gag gat aaa gat aaa gag ttc aaa att gat tgg 192His
Ala Asn Asn Pro Glu Asp Lys Asp Lys Glu Phe Lys Ile Asp Trp 50 55
60aag agg gtc ggc atc aca agt tca ttt gga ttt gct ttt gtt gga cct
240Lys Arg Val Gly Ile Thr Ser Ser Phe Gly Phe Ala Phe Val Gly
Pro65 70 75 80gtg gga cat tac tgg tat gat tac ttg gat tgt ttg gtc
cga cga aga 288Val Gly His Tyr Trp Tyr Asp Tyr Leu Asp Cys Leu Val
Arg Arg Arg 85 90 95tac cag cct ggt tcg ttc aaa ttt gta gcc tca aag
gtt gca gca gat 336Tyr Gln Pro Gly Ser Phe Lys Phe Val Ala Ser Lys
Val Ala Ala Asp 100 105 110ggt ctc ctc ttc gga ccg cta gat ctg ggg
ctg ttc ttc tct tat gtg 384Gly Leu Leu Phe Gly Pro Leu Asp Leu Gly
Leu Phe Phe Ser Tyr Val 115 120 125ggc ctt gct tca gga agg agt ctg
gag cag gtg aag gaa gat gtg aag 432Gly Leu Ala Ser Gly Arg Ser Leu
Glu Gln Val Lys Glu Asp Val Lys 130 135 140agg gat atc att cct gct
cta gtt tta ggg gga gcc atc tgg ccg gct 480Arg Asp Ile Ile Pro Ala
Leu Val Leu Gly Gly Ala Ile Trp Pro Ala145 150 155 160gtg cag atc
gca aac ttc cgc ttc att ccc gtg cga tat caa ctg ctt 528Val Gln Ile
Ala Asn Phe Arg Phe Ile Pro Val Arg Tyr Gln Leu Leu 165 170 175tac
gtg aac ttg ttc tgc ctg tta gac agt tgt ttc ttg tct tgg atc 576Tyr
Val Asn Leu Phe Cys Leu Leu Asp Ser Cys Phe Leu Ser Trp Ile 180 185
190gag cag caa gga gat gcg gct tgg aag caa tgg ttc cca tcg ttc cag
624Glu Gln Gln Gly Asp Ala Ala Trp Lys Gln Trp Phe Pro Ser Phe Gln
195 200 205aag aaa att gaa gac cag aag agc aac gcc tga 657Lys Lys
Ile Glu Asp Gln Lys Ser Asn Ala 210 21535218PRTHordeum vulgare
35Met Arg Arg Leu Trp Arg Trp Tyr Gln Gln Ser Leu Ser Ser Tyr Pro1
5 10 15Val Arg Thr Gln Val Val Ser Ser Gly Ile Leu Trp Ala Leu Gly
Asp 20 25 30Ile Gly Ala Gln Ala Val Thr His Lys Ser Ala Ser Ser His
His His 35 40 45His Ala Asn Asn Pro Glu Asp Lys Asp Lys Glu Phe Lys
Ile Asp Trp 50 55 60Lys Arg Val Gly Ile Thr Ser Ser Phe Gly Phe Ala
Phe Val Gly Pro65 70 75 80Val Gly His Tyr Trp Tyr Asp Tyr Leu Asp
Cys Leu Val Arg Arg Arg 85 90 95Tyr Gln Pro Gly Ser Phe Lys Phe Val
Ala Ser Lys Val Ala Ala Asp 100 105 110Gly Leu Leu Phe Gly Pro Leu
Asp Leu Gly Leu Phe Phe Ser Tyr Val 115 120 125Gly Leu Ala Ser Gly
Arg Ser Leu Glu Gln Val Lys Glu Asp Val Lys 130 135 140Arg Asp Ile
Ile Pro Ala Leu Val Leu Gly Gly Ala Ile Trp Pro Ala145 150 155
160Val Gln Ile Ala Asn Phe Arg Phe Ile Pro Val Arg Tyr Gln Leu Leu
165 170 175Tyr Val Asn Leu Phe Cys Leu Leu Asp Ser Cys Phe Leu Ser
Trp Ile 180 185 190Glu Gln Gln Gly Asp Ala Ala Trp Lys Gln Trp Phe
Pro Ser Phe Gln 195 200 205Lys Lys Ile Glu Asp Gln Lys Ser Asn Ala
210 21536657DNATriticum aestivumCDS(1)..(657) 36atg cgg cgg cta tgg
cga tgg tac cag cag tcc ctg tcc tcc tac ccc 48Met Arg Arg Leu Trp
Arg Trp Tyr Gln Gln Ser Leu Ser Ser Tyr Pro1 5 10 15gtg cgg acg cag
gtc gtc agc tcc ggc atc ctc tgg gcc ctc ggc gac 96Val Arg Thr Gln
Val Val Ser Ser Gly Ile Leu Trp Ala Leu Gly Asp 20 25 30atc ggc gcc
cag gcc gtc acc cac aaa tcc gcc agc tcc cac cac cac 144Ile Gly Ala
Gln Ala Val Thr His Lys Ser Ala Ser Ser His His His 35 40 45cac gcc
aag aac ccc gag gat aaa gat aaa gag ttc aaa att gat tgg 192His Ala
Lys Asn Pro Glu Asp Lys Asp Lys Glu Phe Lys Ile Asp Trp 50 55 60aag
agg gtc ggc atc aca agt tca ttt gga ttt gct ttt gtt gga cct 240Lys
Arg Val Gly Ile Thr Ser Ser Phe Gly Phe Ala Phe Val Gly Pro65 70 75
80gtg gga cat tac tgg tac gaa tac ttg gat cgt atg gtc cga cga aga
288Val Gly His Tyr Trp Tyr Glu Tyr Leu Asp Arg Met Val Arg Arg Arg
85 90 95tac ctg cct ggt tcg ttc aaa ttt gta gcc tca aag gtt gca gcg
gat 336Tyr Leu Pro Gly Ser Phe Lys Phe Val Ala Ser Lys Val Ala Ala
Asp 100 105 110ggt ctc ctc ttt ggg cca cta gat ctg ggg ctg ttc ttc
tct tat gtg 384Gly Leu Leu Phe Gly Pro Leu Asp Leu Gly Leu Phe Phe
Ser Tyr Val 115 120 125ggc ctt gct tca gga agg agt ctg gag cag gtg
aag gat gat gtg aag 432Gly Leu Ala Ser Gly Arg Ser Leu Glu Gln Val
Lys Asp Asp Val Lys 130 135 140agg gat atc att cct gct ctg gtt tta
ggg gga gcc atc tgg ccg gct 480Arg Asp Ile Ile Pro Ala Leu Val Leu
Gly Gly Ala Ile Trp Pro Ala145 150 155 160gtg cag atc gca aac ttt
cgc ttc att ccc gtg cga tat caa ctg ctg 528Val Gln Ile Ala Asn Phe
Arg Phe Ile Pro Val Arg Tyr Gln Leu Leu 165 170 175tac gtg aac ttg
ttc tgc ctg tta gac agc tgt ttc ttg tct tgg atc 576Tyr Val Asn Leu
Phe Cys Leu Leu Asp Ser Cys Phe Leu Ser Trp Ile 180 185 190gag caa
caa gga gac gcg gct tgg aag caa tgg ttc aca tcg ttc cag 624Glu Gln
Gln Gly Asp Ala Ala Trp Lys Gln Trp Phe Thr Ser Phe Gln 195 200
205aag aaa atc gaa gac cag aag agc aac gct tga 657Lys Lys Ile Glu
Asp Gln Lys Ser Asn Ala 210 21537218PRTTriticum aestivum 37Met Arg
Arg Leu Trp Arg Trp Tyr Gln Gln Ser Leu Ser Ser Tyr Pro1 5 10 15Val
Arg Thr Gln Val Val Ser Ser Gly Ile Leu Trp Ala Leu Gly Asp 20 25
30Ile Gly Ala Gln Ala Val Thr His Lys Ser Ala Ser Ser His His His
35 40 45His Ala Lys Asn Pro Glu Asp Lys Asp Lys Glu Phe Lys Ile Asp
Trp 50 55 60Lys Arg Val Gly Ile Thr Ser Ser Phe Gly Phe Ala Phe Val
Gly Pro65 70 75 80Val Gly His Tyr Trp Tyr Glu Tyr Leu Asp Arg Met
Val Arg Arg Arg 85 90 95Tyr Leu Pro Gly Ser Phe Lys Phe Val Ala Ser
Lys Val Ala Ala Asp 100 105 110Gly Leu Leu Phe Gly Pro Leu Asp Leu
Gly Leu Phe Phe Ser Tyr Val 115 120 125Gly Leu Ala Ser Gly Arg Ser
Leu Glu Gln Val Lys Asp Asp Val Lys 130 135 140Arg Asp Ile Ile Pro
Ala Leu Val Leu Gly Gly Ala Ile Trp Pro Ala145 150 155 160Val Gln
Ile Ala Asn Phe Arg Phe Ile Pro Val Arg Tyr Gln Leu Leu 165 170
175Tyr Val Asn Leu Phe Cys Leu Leu Asp Ser Cys Phe Leu Ser Trp Ile
180 185 190Glu Gln Gln Gly Asp Ala Ala Trp Lys Gln Trp Phe Thr Ser
Phe Gln 195 200 205Lys Lys Ile Glu Asp Gln Lys Ser Asn Ala 210
21538678DNABrassica napusCDS(1)..(678) 38atg ttg aag gtg tgg aga
tgg tac cag cga tgc ctg agc gtt cat ccg 48Met Leu Lys Val Trp Arg
Trp Tyr Gln Arg Cys Leu Ser Val His Pro1 5 10 15gtg aaa act cag gtc
ata agc tcg ggc ttt ctt tgg gga ttc ggg gac 96Val Lys Thr Gln Val
Ile Ser Ser Gly Phe Leu Trp Gly Phe Gly Asp 20 25 30gtc acc gct caa
tac atc act cat tca act gcg aaa cct cct ctt ctc 144Val Thr Ala Gln
Tyr Ile Thr His Ser Thr Ala Lys Pro Pro Leu Leu 35 40 45cgt ctc acc
gac aca aat aaa gat gca gac gct gat tca gaa ttt aag 192Arg Leu Thr
Asp Thr Asn Lys Asp Ala Asp Ala Asp Ser Glu Phe Lys 50 55 60ctc aac
tgg aag cga gta gct atc act agc atg ttt gga ctt ggt ttt 240Leu Asn
Trp Lys Arg Val Ala Ile Thr Ser Met Phe Gly Leu Gly Phe65 70 75
80gtc ggt cct gtt ggc cac ttc tgg tac gaa ggc ctt gat aaa ttc ata
288Val Gly Pro Val Gly His Phe Trp Tyr Glu Gly Leu Asp Lys Phe Ile
85 90 95aaa ctg aag ctt cga tac gta cca aag tca acg cgt ttt
gtg gct gcc 336Lys Leu Lys Leu Arg Tyr Val Pro Lys Ser Thr Arg Phe
Val Ala Ala 100 105 110aaa gtt gca atg gac ggt ctt atc ttc ggc ccc
att gat cta ctc gtg 384Lys Val Ala Met Asp Gly Leu Ile Phe Gly Pro
Ile Asp Leu Leu Val 115 120 125ttc ttc acg tac atg gga tac gcc aca
ggc aag aac acg tct caa gtg 432Phe Phe Thr Tyr Met Gly Tyr Ala Thr
Gly Lys Asn Thr Ser Gln Val 130 135 140aaa gaa ggg ctc aag aga gac
ttt ctt cca gct cta gct ctt gaa ggc 480Lys Glu Gly Leu Lys Arg Asp
Phe Leu Pro Ala Leu Ala Leu Glu Gly145 150 155 160gga gca tgg ccg
ctt ctt cag atc gca aac ttc aga tac gtc ccc gtg 528Gly Ala Trp Pro
Leu Leu Gln Ile Ala Asn Phe Arg Tyr Val Pro Val 165 170 175caa tac
cag ctg ctt tac gtc aac atc ttt tgc ctt ata gac agc gct 576Gln Tyr
Gln Leu Leu Tyr Val Asn Ile Phe Cys Leu Ile Asp Ser Ala 180 185
190ttt ctc tcg tgg gtg gat caa cag aag gat gca gct tgg aag cag tgg
624Phe Leu Ser Trp Val Asp Gln Gln Lys Asp Ala Ala Trp Lys Gln Trp
195 200 205ttt act act cca ttt tta act ctt aaa gaa cga ggt ggc aca
ggt gga 672Phe Thr Thr Pro Phe Leu Thr Leu Lys Glu Arg Gly Gly Thr
Gly Gly 210 215 220gta tga 678Val22539225PRTBrassica napus 39Met
Leu Lys Val Trp Arg Trp Tyr Gln Arg Cys Leu Ser Val His Pro1 5 10
15Val Lys Thr Gln Val Ile Ser Ser Gly Phe Leu Trp Gly Phe Gly Asp
20 25 30Val Thr Ala Gln Tyr Ile Thr His Ser Thr Ala Lys Pro Pro Leu
Leu 35 40 45Arg Leu Thr Asp Thr Asn Lys Asp Ala Asp Ala Asp Ser Glu
Phe Lys 50 55 60Leu Asn Trp Lys Arg Val Ala Ile Thr Ser Met Phe Gly
Leu Gly Phe65 70 75 80Val Gly Pro Val Gly His Phe Trp Tyr Glu Gly
Leu Asp Lys Phe Ile 85 90 95Lys Leu Lys Leu Arg Tyr Val Pro Lys Ser
Thr Arg Phe Val Ala Ala 100 105 110Lys Val Ala Met Asp Gly Leu Ile
Phe Gly Pro Ile Asp Leu Leu Val 115 120 125Phe Phe Thr Tyr Met Gly
Tyr Ala Thr Gly Lys Asn Thr Ser Gln Val 130 135 140Lys Glu Gly Leu
Lys Arg Asp Phe Leu Pro Ala Leu Ala Leu Glu Gly145 150 155 160Gly
Ala Trp Pro Leu Leu Gln Ile Ala Asn Phe Arg Tyr Val Pro Val 165 170
175Gln Tyr Gln Leu Leu Tyr Val Asn Ile Phe Cys Leu Ile Asp Ser Ala
180 185 190Phe Leu Ser Trp Val Asp Gln Gln Lys Asp Ala Ala Trp Lys
Gln Trp 195 200 205Phe Thr Thr Pro Phe Leu Thr Leu Lys Glu Arg Gly
Gly Thr Gly Gly 210 215 220Val22540516DNASolanum
tuberosumCDS(1)..(516) 40atg ttg cgg ttg tgg aaa tgg tac caa aat
tgc ttg gct tta cat ccg 48Met Leu Arg Leu Trp Lys Trp Tyr Gln Asn
Cys Leu Ala Leu His Pro1 5 10 15gtg aag act cag gtc atc agc tcc ggt
ctt att tgg ggt ctc ggc gac 96Val Lys Thr Gln Val Ile Ser Ser Gly
Leu Ile Trp Gly Leu Gly Asp 20 25 30gta tct gct caa gcc gtc act cat
tat act gca aag aaa cac cat cat 144Val Ser Ala Gln Ala Val Thr His
Tyr Thr Ala Lys Lys His His His 35 40 45ctt cat cct gat gaa gat aaa
gaa ttt gca atc aac tgg aga cga gtt 192Leu His Pro Asp Glu Asp Lys
Glu Phe Ala Ile Asn Trp Arg Arg Val 50 55 60gcc aca acg agc ttg ttc
ggc ttt gca ttt gtt gga cct gtt ggc cac 240Ala Thr Thr Ser Leu Phe
Gly Phe Ala Phe Val Gly Pro Val Gly His65 70 75 80ttc tgg tat gaa
ggg ttg gat cgc gtc ata aga cac aga ttt caa atg 288Phe Trp Tyr Glu
Gly Leu Asp Arg Val Ile Arg His Arg Phe Gln Met 85 90 95caa cct aaa
tcc ctg cgg ttt gtt gct aca aaa gta gca ctt gat ggt 336Gln Pro Lys
Ser Leu Arg Phe Val Ala Thr Lys Val Ala Leu Asp Gly 100 105 110ata
atc ttt ggg ccc ctg gat tta ctt gtc ttt ttc aca tat atg ggt 384Ile
Ile Phe Gly Pro Leu Asp Leu Leu Val Phe Phe Thr Tyr Met Gly 115 120
125tac tcc act ggc aaa aat act gct caa gtt gtt gaa ggt gtg aag aga
432Tyr Ser Thr Gly Lys Asn Thr Ala Gln Val Val Glu Gly Val Lys Arg
130 135 140gac tat ctt ccg gct tta ata cta gaa cga ggt ata tgg cct
att gtc 480Asp Tyr Leu Pro Ala Leu Ile Leu Glu Arg Gly Ile Trp Pro
Ile Val145 150 155 160cag gtg gcc aac ttt cgc tat ata cca gtt agg
tat 516Gln Val Ala Asn Phe Arg Tyr Ile Pro Val Arg Tyr 165
17041172PRTSolanum tuberosum 41Met Leu Arg Leu Trp Lys Trp Tyr Gln
Asn Cys Leu Ala Leu His Pro1 5 10 15Val Lys Thr Gln Val Ile Ser Ser
Gly Leu Ile Trp Gly Leu Gly Asp 20 25 30Val Ser Ala Gln Ala Val Thr
His Tyr Thr Ala Lys Lys His His His 35 40 45Leu His Pro Asp Glu Asp
Lys Glu Phe Ala Ile Asn Trp Arg Arg Val 50 55 60Ala Thr Thr Ser Leu
Phe Gly Phe Ala Phe Val Gly Pro Val Gly His65 70 75 80Phe Trp Tyr
Glu Gly Leu Asp Arg Val Ile Arg His Arg Phe Gln Met 85 90 95Gln Pro
Lys Ser Leu Arg Phe Val Ala Thr Lys Val Ala Leu Asp Gly 100 105
110Ile Ile Phe Gly Pro Leu Asp Leu Leu Val Phe Phe Thr Tyr Met Gly
115 120 125Tyr Ser Thr Gly Lys Asn Thr Ala Gln Val Val Glu Gly Val
Lys Arg 130 135 140Asp Tyr Leu Pro Ala Leu Ile Leu Glu Arg Gly Ile
Trp Pro Ile Val145 150 155 160Gln Val Ala Asn Phe Arg Tyr Ile Pro
Val Arg Tyr 165 17042573DNAArabidopsis thalianaCDS(1)..(573) 42atg
gga tct tca cca ccg aag aag acg act ctg caa cgg tac ttg tca 48Met
Gly Ser Ser Pro Pro Lys Lys Thr Thr Leu Gln Arg Tyr Leu Ser1 5 10
15cag ctt caa caa cat cct tta aga aca aag gca ata act gct gga gtt
96Gln Leu Gln Gln His Pro Leu Arg Thr Lys Ala Ile Thr Ala Gly Val
20 25 30ttg tct ggt gtt agc gat gtt gta tca cag aag ctc tct ggc ata
cag 144Leu Ser Gly Val Ser Asp Val Val Ser Gln Lys Leu Ser Gly Ile
Gln 35 40 45aag att cag ctg aga agg gtt ctt ctc aaa gtg ata ttt gct
ggt ggg 192Lys Ile Gln Leu Arg Arg Val Leu Leu Lys Val Ile Phe Ala
Gly Gly 50 55 60ttt ctt gga cca gca ggg cat ttc ttt cat aca tat tta
gat aag ttt 240Phe Leu Gly Pro Ala Gly His Phe Phe His Thr Tyr Leu
Asp Lys Phe65 70 75 80ttt aaa ggg aag aag gat aca cag act gtt gca
aag aag gta att ctg 288Phe Lys Gly Lys Lys Asp Thr Gln Thr Val Ala
Lys Lys Val Ile Leu 85 90 95gag caa ttg aca ttg tca cca ttg aac cat
ttg ctt ttc atg atc tat 336Glu Gln Leu Thr Leu Ser Pro Leu Asn His
Leu Leu Phe Met Ile Tyr 100 105 110tat gga gta gtc ata gaa aga act
ccc tgg acc ctt gtt aga gaa agg 384Tyr Gly Val Val Ile Glu Arg Thr
Pro Trp Thr Leu Val Arg Glu Arg 115 120 125atc aag aag act tat cca
acg gtc cag ctt act gca tgg acg ttt ttc 432Ile Lys Lys Thr Tyr Pro
Thr Val Gln Leu Thr Ala Trp Thr Phe Phe 130 135 140ccg gtg gtg gga
tgg att aac tac aag tat gtg cca ctg cac ttc cgg 480Pro Val Val Gly
Trp Ile Asn Tyr Lys Tyr Val Pro Leu His Phe Arg145 150 155 160gtc
atc ttg cac agc ctg gtc gca ttc ttt tgg gga att ttc cta acc 528Val
Ile Leu His Ser Leu Val Ala Phe Phe Trp Gly Ile Phe Leu Thr 165 170
175ctg cga gcg agg tca atg aca cta gct ttg gca aag gct aag tga
573Leu Arg Ala Arg Ser Met Thr Leu Ala Leu Ala Lys Ala Lys 180 185
19043190PRTArabidopsis thaliana 43Met Gly Ser Ser Pro Pro Lys Lys
Thr Thr Leu Gln Arg Tyr Leu Ser1 5 10 15Gln Leu Gln Gln His Pro Leu
Arg Thr Lys Ala Ile Thr Ala Gly Val 20 25 30Leu Ser Gly Val Ser Asp
Val Val Ser Gln Lys Leu Ser Gly Ile Gln 35 40 45Lys Ile Gln Leu Arg
Arg Val Leu Leu Lys Val Ile Phe Ala Gly Gly 50 55 60Phe Leu Gly Pro
Ala Gly His Phe Phe His Thr Tyr Leu Asp Lys Phe65 70 75 80Phe Lys
Gly Lys Lys Asp Thr Gln Thr Val Ala Lys Lys Val Ile Leu 85 90 95Glu
Gln Leu Thr Leu Ser Pro Leu Asn His Leu Leu Phe Met Ile Tyr 100 105
110Tyr Gly Val Val Ile Glu Arg Thr Pro Trp Thr Leu Val Arg Glu Arg
115 120 125Ile Lys Lys Thr Tyr Pro Thr Val Gln Leu Thr Ala Trp Thr
Phe Phe 130 135 140Pro Val Val Gly Trp Ile Asn Tyr Lys Tyr Val Pro
Leu His Phe Arg145 150 155 160Val Ile Leu His Ser Leu Val Ala Phe
Phe Trp Gly Ile Phe Leu Thr 165 170 175Leu Arg Ala Arg Ser Met Thr
Leu Ala Leu Ala Lys Ala Lys 180 185 19044738DNADrosophila
melanogasterCDS(1)..(738) 44atg caa tcc ttg cgt ggc tgc ccg gcc cgt
ggc cta atc ctg tcc aga 48Met Gln Ser Leu Arg Gly Cys Pro Ala Arg
Gly Leu Ile Leu Ser Arg1 5 10 15gcc att cgc ggc cag cgc agc ctg cga
atg agt tgg cca cgg aac agc 96Ala Ile Arg Gly Gln Arg Ser Leu Arg
Met Ser Trp Pro Arg Asn Ser 20 25 30agc gcg act gga gga gcc gga gga
gct gcg ccc ggt gga ggc agc agc 144Ser Ala Thr Gly Gly Ala Gly Gly
Ala Ala Pro Gly Gly Gly Ser Ser 35 40 45acc acc acc agc acc atc ggc
ttt gga gcg ctt cag aag ctg cgg gaa 192Thr Thr Thr Ser Thr Ile Gly
Phe Gly Ala Leu Gln Lys Leu Arg Glu 50 55 60tgg cat gcg agt gca ttc
agt agc cgc ttc ctc ctc ttc acc aac gtg 240Trp His Ala Ser Ala Phe
Ser Ser Arg Phe Leu Leu Phe Thr Asn Val65 70 75 80ggc atc tcg ctg
acc ctg agc tgt gtg ggt gac gtc cta gaa cag cac 288Gly Ile Ser Leu
Thr Leu Ser Cys Val Gly Asp Val Leu Glu Gln His 85 90 95ctg gaa atc
tat tgc ggc gaa atc gag cgc ttc gaa tcc acg cgc act 336Leu Glu Ile
Tyr Cys Gly Glu Ile Glu Arg Phe Glu Ser Thr Arg Thr 100 105 110gcc
cac atg gcc atc agt ggt gtg acg gtg ggc gtc atc tgt cac tac 384Ala
His Met Ala Ile Ser Gly Val Thr Val Gly Val Ile Cys His Tyr 115 120
125tgg tac aag atg ctg gac aaa cgg atg cct gga cgc act atg cgc gtg
432Trp Tyr Lys Met Leu Asp Lys Arg Met Pro Gly Arg Thr Met Arg Val
130 135 140gtg gcc aag aag atc gtg ctc gat cag cta atc tgc tcg ccc
atc tac 480Val Ala Lys Lys Ile Val Leu Asp Gln Leu Ile Cys Ser Pro
Ile Tyr145 150 155 160atc agt gcc ttc ttc gtc acg ctg ggt ctg ctg
gag caa aag acc aag 528Ile Ser Ala Phe Phe Val Thr Leu Gly Leu Leu
Glu Gln Lys Thr Lys 165 170 175cac gaa gtg tgg gag gag atc aag gag
aag gcc tgg aag ctg tac gcc 576His Glu Val Trp Glu Glu Ile Lys Glu
Lys Ala Trp Lys Leu Tyr Ala 180 185 190gcc gag tgg act gtg tgg ccg
gtg gcg cag ttc gtc aac ttc tac tgg 624Ala Glu Trp Thr Val Trp Pro
Val Ala Gln Phe Val Asn Phe Tyr Trp 195 200 205atc ccc acc cat tac
cgc atc ttc tac gac aac atc atc agc ctg ggc 672Ile Pro Thr His Tyr
Arg Ile Phe Tyr Asp Asn Ile Ile Ser Leu Gly 210 215 220tac gat gtg
ctg acc tcg aag gtt aag cac aaa cag tcg cat tcg cat 720Tyr Asp Val
Leu Thr Ser Lys Val Lys His Lys Gln Ser His Ser His225 230 235
240ctg aag aag att ccc taa 738Leu Lys Lys Ile Pro
24545245PRTDrosophila melanogaster 45Met Gln Ser Leu Arg Gly Cys
Pro Ala Arg Gly Leu Ile Leu Ser Arg1 5 10 15Ala Ile Arg Gly Gln Arg
Ser Leu Arg Met Ser Trp Pro Arg Asn Ser 20 25 30Ser Ala Thr Gly Gly
Ala Gly Gly Ala Ala Pro Gly Gly Gly Ser Ser 35 40 45Thr Thr Thr Ser
Thr Ile Gly Phe Gly Ala Leu Gln Lys Leu Arg Glu 50 55 60Trp His Ala
Ser Ala Phe Ser Ser Arg Phe Leu Leu Phe Thr Asn Val65 70 75 80Gly
Ile Ser Leu Thr Leu Ser Cys Val Gly Asp Val Leu Glu Gln His 85 90
95Leu Glu Ile Tyr Cys Gly Glu Ile Glu Arg Phe Glu Ser Thr Arg Thr
100 105 110Ala His Met Ala Ile Ser Gly Val Thr Val Gly Val Ile Cys
His Tyr 115 120 125Trp Tyr Lys Met Leu Asp Lys Arg Met Pro Gly Arg
Thr Met Arg Val 130 135 140Val Ala Lys Lys Ile Val Leu Asp Gln Leu
Ile Cys Ser Pro Ile Tyr145 150 155 160Ile Ser Ala Phe Phe Val Thr
Leu Gly Leu Leu Glu Gln Lys Thr Lys 165 170 175His Glu Val Trp Glu
Glu Ile Lys Glu Lys Ala Trp Lys Leu Tyr Ala 180 185 190Ala Glu Trp
Thr Val Trp Pro Val Ala Gln Phe Val Asn Phe Tyr Trp 195 200 205Ile
Pro Thr His Tyr Arg Ile Phe Tyr Asp Asn Ile Ile Ser Leu Gly 210 215
220Tyr Asp Val Leu Thr Ser Lys Val Lys His Lys Gln Ser His Ser
His225 230 235 240Leu Lys Lys Ile Pro
24546211PRTConsensusVARIANT(2)..(2)no consensus amino acid 46Met
Xaa Arg Leu Trp Arg Trp Tyr Gln Xaa Cys Leu Ala Xaa His Pro1 5 10
15Val Lys Thr Gln Val Ile Ser Ser Gly Xaa Leu Trp Gly Leu Gly Asp
20 25 30Ile Xaa Ala Gln Ala Val Thr His Xaa Ser Ala Xaa Xaa Xaa Xaa
Xaa 35 40 45Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa 50 55 60Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Arg Val65 70 75 80Xaa Ile Thr Ser Ser Phe Gly Phe Gly Phe Val
Gly Pro Val Gly His 85 90 95Xaa Trp Tyr Glu Xaa Leu Asp Arg Phe Ile
Xaa Xaa Xaa Xaa Xaa Xaa 100 105 110Xaa Xaa Xaa Ser Xaa Xaa Phe Val
Ala Xaa Lys Val Ala Xaa Asp Gly 115 120 125Leu Xaa Phe Gly Pro Leu
Asp Leu Leu Xaa Phe Phe Xaa Tyr Val Gly 130 135 140Xaa Xaa Xaa Gly
Arg Ser Xaa Xaa Xaa Gln Val Lys Glu Xaa Val Lys145 150 155 160Arg
Asp Xaa Xaa Pro Ala Leu Xaa Leu Xaa Gly Xaa Ile Trp Pro Ala 165 170
175Val Gln Ile Ala Asn Phe Arg Xaa Val Pro Val Arg Tyr Gln Leu Leu
180 185 190Tyr Val Asn Leu Phe Cys Leu Leu Asp Ser Xaa Phe Leu Ser
Trp Xaa 195 200 205Xaa Gln Gln
2104729PRTConsensusVARIANT(11)..(11)no consensus amino acid 47Leu
Trp Arg Trp Tyr Gln Xaa Cys Leu Ala Xaa His Pro Val Lys Thr1 5 10
15Gln Val Ile Ser Ser Gly Xaa Leu Trp Gly Leu Gly Asp 20
254847PRTConsensusVARIANT(4)..(4)no consensus amino acid 48Lys Arg
Asp Xaa Xaa Pro Ala Leu Xaa Leu Xaa Gly Xaa Ile Trp Pro1 5 10 15Ala
Val Gln Ile Ala Asn Phe Arg Xaa Val Pro Val Arg Tyr Gln Leu 20 25
30Leu Tyr Val Asn Leu Phe Cys Leu Leu Asp Ser Xaa Phe Leu Ser 35 40
4549210PRTConsensusVARIANT(10)..(10)no consensus amino acid 49Met
Leu Arg Leu Trp Arg Trp Tyr Gln Xaa Cys Leu Xaa Xaa His Pro1 5 10
15Val Lys Thr Gln Val Ile Ser Ser Gly Ile Leu Trp Gly Leu Gly Asp
20 25 30Ile Gly Ala Gln Ala Val Thr His Tyr Thr Ala Xaa Xaa Xaa Xaa
Xaa 35 40 45Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa 50 55 60Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Arg Val65 70 75 80Gly Ile Thr Ser
Ser Phe Gly Phe Ala Phe Val Gly Pro Val Gly His 85 90 95Phe Trp Tyr
Glu Gly Leu Asp Arg Phe Ile Arg Arg Lys Leu Arg Tyr 100 105 110Gln
Pro Lys Ser Phe Arg Phe Val Ala Ser Lys Val Ala Ala Asp Gly 115 120
125Leu Ile Phe Gly Pro Leu Asp Leu Leu Val Phe Phe Thr Tyr Met Gly
130 135 140Leu Ala Xaa Gly Lys Ser Thr Glu Gln Val Lys Glu Asp Val
Lys Arg145 150 155 160Asp Phe Leu Pro Ala Leu Val Leu Glu Gly Gly
Ile Trp Pro Ala Val 165 170 175Gln Ile Ala Asn Phe Arg Phe Ile Pro
Val Arg Tyr Gln Leu Leu Tyr 180 185 190Val Asn Leu Phe Cys Leu Leu
Asp Ser Cys Phe Leu Ser Trp Ile Glu 195 200 205Gln Gln
2105029PRTConsensusVARIANT(7)..(7)no consensus amino acid 50Leu Trp
Arg Trp Tyr Gln Xaa Cys Leu Xaa Xaa His Pro Val Lys Thr1 5 10 15Gln
Val Ile Ser Ser Gly Ile Leu Trp Gly Leu Gly Asp 20
255148PRTConsensusMISC_FEATURE(5)..(5)l or i 51Lys Arg Asp Phe Leu
Pro Ala Leu Val Leu Glu Gly Gly Ile Trp Pro1 5 10 15Ala Val Gln Ile
Ala Asn Phe Arg Phe Ile Pro Val Arg Tyr Gln Leu 20 25 30Leu Tyr Val
Asn Leu Phe Cys Leu Leu Asp Ser Cys Phe Leu Ser Trp 35 40
4552678DNAZea maysCDS(1)..(678) 52atg cgg cgg cta tgg cgg tgg tac
cag cag tgc ctg gcc gcg cac ccg 48Met Arg Arg Leu Trp Arg Trp Tyr
Gln Gln Cys Leu Ala Ala His Pro1 5 10 15gtg cgc acg cag gtc gtc agc
tcc ggc atc ctc tgg ggc ctc ggc gac 96Val Arg Thr Gln Val Val Ser
Ser Gly Ile Leu Trp Gly Leu Gly Asp 20 25 30atc ggc gcc cag acc gtc
acc tac tac tcc gct cgc ccc gac cgt cgc 144Ile Gly Ala Gln Thr Val
Thr Tyr Tyr Ser Ala Arg Pro Asp Arg Arg 35 40 45ggc cac gac agc agc
cct ccc gac ccc gag gat aaa gat aat aaa gac 192Gly His Asp Ser Ser
Pro Pro Asp Pro Glu Asp Lys Asp Asn Lys Asp 50 55 60aat aaa gag ttt
aaa gtt gat tgg aag agg gtg ggc atc aca agc tcc 240Asn Lys Glu Phe
Lys Val Asp Trp Lys Arg Val Gly Ile Thr Ser Ser65 70 75 80ttc gga
ttt gct ttt gtt ggt cca gtt ggg cat tac tgg tat gaa tac 288Phe Gly
Phe Ala Phe Val Gly Pro Val Gly His Tyr Trp Tyr Glu Tyr 85 90 95ctg
gat cgc atc atc cgg cgg agg ttt cag cct aac acg ttc aaa ttc 336Leu
Asp Arg Ile Ile Arg Arg Arg Phe Gln Pro Asn Thr Phe Lys Phe 100 105
110gtc gcc tca aaa gtt gcc gcg gat gga ttc ctc ttc gga cca cta gac
384Val Ala Ser Lys Val Ala Ala Asp Gly Phe Leu Phe Gly Pro Leu Asp
115 120 125ctc ctc ctg ttc ttc tca tat gtt ggt ctg ggt caa gga agg
agc ata 432Leu Leu Leu Phe Phe Ser Tyr Val Gly Leu Gly Gln Gly Arg
Ser Ile 130 135 140gag cag gtg aag gag gac gtg aag agg gac ttc att
ccg gct ctg gtg 480Glu Gln Val Lys Glu Asp Val Lys Arg Asp Phe Ile
Pro Ala Leu Val145 150 155 160tta ggc gga acc atc tgg cct gct gtg
cag atc gcg aac ttc cgc ttc 528Leu Gly Gly Thr Ile Trp Pro Ala Val
Gln Ile Ala Asn Phe Arg Phe 165 170 175gtt ccc gtg cgg tac cag ctc
ctg tat gtg aac ttg ttc tgc ctc ctg 576Val Pro Val Arg Tyr Gln Leu
Leu Tyr Val Asn Leu Phe Cys Leu Leu 180 185 190gac agc tgc ttc ctg
tcg tgg att gag cag cag ggt gac gcc tcc tgg 624Asp Ser Cys Phe Leu
Ser Trp Ile Glu Gln Gln Gly Asp Ala Ser Trp 195 200 205aag cgg tgg
ttc act tcg ttc cag aaa atc gaa gac cag aag ggt aag 672Lys Arg Trp
Phe Thr Ser Phe Gln Lys Ile Glu Asp Gln Lys Gly Lys 210 215 220gtt
taa 678Val22553225PRTZea mays 53Met Arg Arg Leu Trp Arg Trp Tyr Gln
Gln Cys Leu Ala Ala His Pro1 5 10 15Val Arg Thr Gln Val Val Ser Ser
Gly Ile Leu Trp Gly Leu Gly Asp 20 25 30Ile Gly Ala Gln Thr Val Thr
Tyr Tyr Ser Ala Arg Pro Asp Arg Arg 35 40 45Gly His Asp Ser Ser Pro
Pro Asp Pro Glu Asp Lys Asp Asn Lys Asp 50 55 60Asn Lys Glu Phe Lys
Val Asp Trp Lys Arg Val Gly Ile Thr Ser Ser65 70 75 80Phe Gly Phe
Ala Phe Val Gly Pro Val Gly His Tyr Trp Tyr Glu Tyr 85 90 95Leu Asp
Arg Ile Ile Arg Arg Arg Phe Gln Pro Asn Thr Phe Lys Phe 100 105
110Val Ala Ser Lys Val Ala Ala Asp Gly Phe Leu Phe Gly Pro Leu Asp
115 120 125Leu Leu Leu Phe Phe Ser Tyr Val Gly Leu Gly Gln Gly Arg
Ser Ile 130 135 140Glu Gln Val Lys Glu Asp Val Lys Arg Asp Phe Ile
Pro Ala Leu Val145 150 155 160Leu Gly Gly Thr Ile Trp Pro Ala Val
Gln Ile Ala Asn Phe Arg Phe 165 170 175Val Pro Val Arg Tyr Gln Leu
Leu Tyr Val Asn Leu Phe Cys Leu Leu 180 185 190Asp Ser Cys Phe Leu
Ser Trp Ile Glu Gln Gln Gly Asp Ala Ser Trp 195 200 205Lys Arg Trp
Phe Thr Ser Phe Gln Lys Ile Glu Asp Gln Lys Gly Lys 210 215
220Val225
* * * * *
References