U.S. patent application number 12/643927 was filed with the patent office on 2010-04-22 for antibodies against a protein entitled 161p2f10b.
Invention is credited to Pia M. CHALLITA-EID, Mary Faris, Rene S. Hubert, Aya Jakobovits, Karen Jane Meyrick Morrison, Arthur B. Raitano.
Application Number | 20100099111 12/643927 |
Document ID | / |
Family ID | 26674410 |
Filed Date | 2010-04-22 |
United States Patent
Application |
20100099111 |
Kind Code |
A1 |
CHALLITA-EID; Pia M. ; et
al. |
April 22, 2010 |
ANTIBODIES AGAINST A PROTEIN ENTITLED 161P2F10B
Abstract
Antibodies and methods of using same against products of the
gene designated 161P2F10B and its encoded protein are described
wherein 161P2F10B exhibits tissue specific expression in normal
adult tissue, it is aberrantly expressed in the cancers listed in
Table I. Consequently, 161P2F10B provides a diagnostic, prognostic,
prophylactic and/or therapeutic target for cancer. The 161P2F10B
gene or fragment thereof, or its encoded protein or a fragment
thereof, can be used to elicit a humoral or cellular immune
response.
Inventors: |
CHALLITA-EID; Pia M.;
(Encino, CA) ; Raitano; Arthur B.; (Los Angeles,
CA) ; Faris; Mary; (Los Angeles, CA) ; Hubert;
Rene S.; (Los Angeles, CA) ; Morrison; Karen Jane
Meyrick; (Santa Monica, CA) ; Jakobovits; Aya;
(Beverly Hills, CA) |
Correspondence
Address: |
AGENSYS C/O MORRISON & FOERSTER LLP
12531 HIGH BLUFF DRIVE, SUITE 100
SAN DIEGO
CA
92130-2040
US
|
Family ID: |
26674410 |
Appl. No.: |
12/643927 |
Filed: |
December 21, 2009 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11097912 |
Apr 1, 2005 |
7655234 |
|
|
12643927 |
|
|
|
|
10062109 |
Jan 31, 2002 |
7067130 |
|
|
11097912 |
|
|
|
|
10005480 |
Nov 7, 2001 |
|
|
|
10062109 |
|
|
|
|
Current U.S.
Class: |
435/6.14 ;
435/320.1; 435/331; 435/375; 436/501; 530/387.3; 530/387.9;
530/391.3; 530/391.7; 800/13 |
Current CPC
Class: |
C07K 16/18 20130101;
Y02A 50/466 20180101; C07K 2317/77 20130101; C07K 14/47 20130101;
C07K 16/3023 20130101; A61K 51/1045 20130101; C07K 2317/33
20130101; C07K 2317/54 20130101; Y02A 50/30 20180101; C07K 2317/55
20130101; A61P 13/10 20180101; C07K 16/3061 20130101; G01N 33/57492
20130101; C07K 16/40 20130101; C07K 2317/76 20130101; C12Q 1/6886
20130101; C07K 2317/20 20130101; C07K 16/30 20130101; A61P 35/00
20180101; A61P 13/08 20180101; C07K 2319/30 20130101; C12Q 2600/158
20130101; A61P 37/04 20180101; C07K 2317/73 20130101; C07K 2317/34
20130101; C12N 9/16 20130101; A61K 2039/505 20130101; A61K 31/7088
20130101; C07K 16/303 20130101; C07K 16/3069 20130101; A61K 39/00
20130101; C07K 16/3046 20130101; C07K 16/3038 20130101 |
Class at
Publication: |
435/6 ;
530/387.9; 530/387.3; 530/391.3; 530/391.7; 800/13; 435/331;
435/320.1; 435/375; 436/501 |
International
Class: |
C07K 16/30 20060101
C07K016/30; C07K 16/46 20060101 C07K016/46; A01K 67/027 20060101
A01K067/027; C12N 5/16 20060101 C12N005/16; C12N 15/85 20060101
C12N015/85; C12N 5/00 20060101 C12N005/00; G01N 33/53 20060101
G01N033/53; C12Q 1/68 20060101 C12Q001/68 |
Claims
1. An antibody or fragment thereof that specifically binds to a
protein comprising the amino acid sequence of SEQ ID NO: 745.
2. The antibody or fragment thereof of claim 1, which is a
monoclonal antibody.
3. The antibody or fragment thereof of claim 1, wherein the
monoclonal antibody is a single chain monoclonal antibody.
4. The antibody or fragment thereof of claim 1, wherein the
fragment thereof is selected from the group consisting of Fab,
F(ab')2, Fv and sFv fragment.
5. The antibody or fragment thereof of claim 1, wherein the
antibody is a human antibody, a humanized antibody, or a chimeric
antibody.
6. The antibody or fragment thereof of claim 1 which is labeled
with an agent.
7. The antibody or fragment thereof of claim 6, wherein the agent
is a diagnostic agent or a cytotoxic agent.
8. The antibody or fragment thereof of claim 7, wherein the
cytotoxic agent is selected from the group consisting of
radioactive isotopes, chemotherapeutic agents and toxins.
9. The antibody or fragment thereof of claim 8, wherein the
radioactive isotope is selected from the group consisting of
At.sup.211, I.sup.131, I.sup.125, Y.sup.90, Re.sup.186, Re.sup.188,
Sm.sup.153, Bi.sup.212, P.sup.32 and radioactive isotopes of
Lu.
10. The antibody or fragment thereof of claim 8, wherein the
chemotherapeutic agent is selected from the group consisting of
taxol, actinomycin, mitomycin, etoposide, tenoposide, vincristine,
vinblastine, colchicine, gelonin, and calicheamicin.
11. The antibody or fragment thereof of claim 8, wherein the toxin
is selected from the group consisting of diphtheria toxin,
enomycin, phenomycin, Pseudomonas exotoxin (PE) A, PE40, abrin,
abrin A chain, mitogellin, modeccin A chain, and alpha-sarcin.
12. A non-human transgenic animal that produces an antibody that
specifically binds to a protein comprising the amino acid sequence
of SEQ ID NO: 745.
13. A hybridoma that produces the monoclonal antibody of claim
2.
14. A vector comprising a polynucleotide that encodes a single
chain monoclonal antibody that specifically binds to a protein
comprising the amino acid sequence of SEQ ID NO: 745.
15. A method of delivering an agent to a cell that expresses
161P2F10B, comprising: providing the agent conjugated to an
antibody or fragment thereof that specifically binds to a protein
comprising the amino acid sequence of SEQ ID NO: 745; and, exposing
the cell to the antibody-agent or fragment-agent conjugate.
16. The method of claim 15, which is labeled with an agent.
17. The method of claim 15, wherein the agent is a diagnostic agent
or a cytotoxic agent.
18. The method of claim 17, wherein the cytotoxic agent is selected
from the group consisting of radioactive isotopes, chemotherapeutic
agents and toxins.
19. The method of claim 18, wherein the radioactive isotope is
selected from the group consisting of At.sup.211, I.sup.131,
I.sup.125, Y.sup.90, Re.sup.186, Re.sup.188, Sm.sup.153,
Bi.sup.212, P.sup.32 and radioactive isotopes of Lu.
20. The method of claim 18, wherein the chemotherapeutic agent is
selected from the group consisting of taxol, actinomycin,
mitomycin, etoposide, tenoposide, vincristine, vinblastine,
colchicine, gelonin, and calicheamicin.
21. The method of claim 18, wherein the toxin is selected from the
group consisting of diphtheria toxin, enomycin, phenomycin,
Pseudomonas exotoxin (PE) A, PE40, abrin, abrin A chain,
mitogellin, modeccin A chain, and alpha-sarcin.
22. A method of generating a mammalian immune response, comprising:
exposing cells of the mammal's immune system to an immunogenic
portion of a) a protein comprising the amino acid sequence of SEQ
ID NO: 745 or b) a nucleotide sequence that encodes said protein;
whereby an immune response is generated to the protein.
23. The method of claim 22, wherein the protein comprising the
amino acid sequence of SEQ ID NO: 745, wherein the protein
comprises at least one T cell or at least one B cell epitope.
24. The method of claim 23 wherein the immune response comprises an
induced B cell that generates antibodies that specifically bind the
protein comprising the amino acid sequence of SEQ ID NO: 745.
25. The method of claim 23 wherein the immune response comprises
activation of a cytotoxic T cell (CTL), whereby the activated CTL
kills an autologous cell that expresses the protein comprising the
amino acid sequence of SEQ ID NO: 745.
26. The method of claim 25 wherein the immune response comprises a
helper T cell (HTL), whereby the activated HTL secretes cytokines
that facilitate the cytotoxic activity of a cytotoxic T cell (CTL)
or the antibody producing activity of a B cell.
27. An assay for detecting the presence of a protein comprising the
amino acid sequence of SEQ ID NO: 745 in a biological sample and a
normal sample obtained from a patient who has or who is suspected
of having cancer, comprising: contacting the biological sample and
the normal sample with an antibody or fragment thereof that
specifically binds to the protein comprising the amino acid
sequence of SEQ ID NO: 745; and, determining if the antibody binds
to the biological sample or the normal sample, whereby binding
indicates the presence of the protein.
28. A method for detecting expression levels of a 161P2F10B gene
product in a biological sample and a normal sample obtained from a
patient who has or who is suspected of having cancer, comprising:
determining expression levels of the 161P2F10B gene product in the
biological sample and the normal sample obtained from the patient;
and comparing the expression levels of the 161P2F10B gene product
detected in the biological sample and the normal sample obtained
from the patient, wherein the 161P2F10B gene product is selected
from the group consisting of 161P2F10B mRNA or a protein comprising
the amino acid sequence of SEQ ID NO: 745.
29. The method of claim 28, whereby the presence of elevated gene
products 161P2F10B mRNA or 161P2F10B protein in the biological
sample relative to the normal sample indicates the presence of a
cancer in the biological sample.
30. The method of claim 28 wherein the cancer occurs in a tissue
selected from the group consisting of breast, colon, kidney, lung,
ovary, pancreas, and prostate.
Description
RELATED APPLICATION
[0001] This application is a divisional of U.S. patent application
Ser. No. 11/097,912, filed Apr. 1, 2005, now allowed, which is a
continuation of U.S. patent application Ser. No. 10/062,109, filed
Jan. 31, 2002, now U.S. Pat. No. 7,067,130, issued on Jun. 27,
2006, which is a continuation of United States Patent application
Ser. No. 10/005,480, filed Nov. 7, 2001, now abandoned. The
contents of these applications are hereby incorporated by reference
herein in their entirety.
[0002] REFERENCE TO SEQUENCE LISTING SUBMITTED VIA EFS-WEB
[0003] The entire content of the following electronic submission of
the sequence listing via the USPTO EFS-WEB server, as authorized
and set forth in MPEP .sctn.1730 II.B.2(a)(C), is incorporated
herein by reference in its entirety for all purposes. The sequence
listing is identified on the electronically filed text file as
follows:
TABLE-US-00001 File Name Date of Creation Size (bytes)
511582006213seqlist.txt Dec. 21, 2009 170,155 bytes
FIELD OF THE INVENTION
[0004] The invention described herein relates to a gene and its
encoded protein, termed 161P2F10B, expressed in certain cancers,
and to diagnostic and therapeutic methods and compositions useful
in the management of cancers that express 161P2F10B.
BACKGROUND OF THE INVENTION
[0005] Cancer is the second leading cause of human death next to
coronary disease. Worldwide, millions of people die from cancer
every year. In the United States alone, as reported by the American
Cancer Society, cancer causes the death of well over a half-million
people annually, with over 1.2 million new cases diagnosed per
year. While deaths from heart disease have been declining
significantly, those resulting from cancer generally are on the
rise. In the early part of the next century, cancer is predicted to
become the leading cause of death.
[0006] Worldwide, several cancers stand out as the leading killers.
In particular, carcinomas of the lung, prostate, breast, colon,
pancreas, and ovary represent the primary causes of cancer death.
These and virtually all other carcinomas share a common lethal
feature. With very few exceptions, metastatic disease from a
carcinoma is fatal. Moreover, even for those cancer patients who
initially survive their primary cancers, common experience has
shown that their lives are dramatically altered. Many cancer
patients experience strong anxieties driven by the awareness of the
potential for recurrence or treatment failure. Many cancer patients
experience physical debilitations following treatment. Furthermore,
many cancer patients experience a recurrence.
[0007] Worldwide, prostate cancer is the fourth most prevalent
cancer in men. In North America and Northern Europe, it is by far
the most common cancer in males and is the second leading cause of
cancer death in men. In the United States alone, well over 30,000
men die annually of this disease--second only to lung cancer.
Despite the magnitude of these figures, there is still no effective
treatment for metastatic prostate cancer. Surgical prostatectomy,
radiation therapy, hormone ablation therapy, surgical castration
and chemotherapy continue to be the main treatment modalities.
Unfortunately, these treatments are ineffective for many and are
often associated with undesirable consequences.
[0008] On the diagnostic front, the lack of a prostate tumor marker
that can accurately detect early-stage, localized tumors remains a
significant limitation in the diagnosis and management of this
disease. Although the serum prostate specific antigen (PSA) assay
has been a very useful tool, however its specificity and general
utility is widely regarded as lacking in several important
respects.
[0009] Progress in identifying additional specific markers for
prostate cancer has been improved by the generation of prostate
cancer xenografts that can recapitulate different stages of the
disease in mice. The LAPC (Los Angeles Prostate Cancer) xenografts
are prostate cancer xenografts that have survived passage in severe
combined immune deficient (SCID) mice and have exhibited the
capacity to mimic the transition from androgen dependence to
androgen independence (Klein et al., 1997, Nat. Med. 3:402). More
recently identified prostate cancer markers include PCTA-1 (Su et
al., 1996, Proc. Natl. Acad. Sci. USA 93: 7252), prostate-specific
membrane (PSM) antigen (Pinto et al., Clin Cancer Res 1996 Sep. 2
(9): 1445-51), STEAP (Hubert, et al., Proc Natl Acad Sci USA. 1999
Dec. 7; 96(25): 14523-8) and prostate stem cell antigen (PSCA)
(Reiter et al., 1998, Proc. Natl. Acad. Sci. USA 95: 1735).
[0010] While previously identified markers such as PSA, PSM, PCTA
and PSCA have facilitated efforts to diagnose and treat prostate
cancer, there is need for the identification of additional markers
and therapeutic targets for prostate and related cancers in order
to further improve diagnosis and therapy.
[0011] Renal cell carcinoma (RCC) accounts for approximately 3
percent of adult malignancies. Once adenomas reach a diameter of 2
to 3 cm, malignant potential exists. In the adult, the two
principal malignant renal tumors are renal cell adenocarcinoma and
transitional cell carcinoma of the renal pelvis or ureter. The
incidence of renal cell adenocarcinoma is estimated at more than
29,000 cases in the United States, and more than 11,600 patients
died of this disease in 1998. Transitional cell carcinoma is less
frequent, with an incidence of approximately 500 cases per year in
the United States.
[0012] Surgery has been the primary therapy for renal cell
adenocarcinoma for many decades. Until recently, metastatic disease
has been refractory to any systemic therapy. With recent
developments in systemic therapies, particularly immunotherapies,
metastatic renal cell carcinoma may be approached aggressively in
appropriate patients with a possibility of durable responses.
Nevertheless, there is a remaining need for effective therapies for
these patients.
[0013] Of all new cases of cancer in the United States, bladder
cancer represents approximately 5 percent in men (fifth most common
neoplasm) and 3 percent in women (eighth most common neoplasm). The
incidence is increasing slowly, concurrent with an increasing older
population. In 1998, there was an estimated 54,500 cases, including
39,500 in men and 15,000 in women. The age-adjusted incidence in
the United States is 32 per 100,000 for men and 8 per 100,000 in
women. The historic male/female ratio of 3:1 may be decreasing
related to smoking patterns in women. There were an estimated
11,000 deaths from bladder cancer in 1998 (7,800 in men and 3,900
in women). Bladder cancer incidence and mortality strongly increase
with age and will be an increasing problem as the population
becomes more elderly.
[0014] Most bladder cancers recur in the bladder. Bladder cancer is
managed with a combination of transurethral resection of the
bladder (TUR) and intravesical chemotherapy or immunotherapy. The
multifocal and recurrent nature of bladder cancer points out the
limitations of TUR. Most muscle-invasive cancers are not cured by
TUR alone. Radical cystectomy and urinary diversion is the most
effective means to eliminate the cancer but carry an undeniable
impact on urinary and sexual function. There continues to be a
significant need for treatment modalities that are beneficial for
bladder cancer patients.
[0015] An estimated 130,200 cases of colorectal cancer occurred in
2000 in the United States, including 93,800 cases of colon cancer
and 36,400 of rectal cancer. Colorectal cancers are the third most
common cancers in men and women. Incidence rates declined
significantly during 1992-1996 (-2.1% per year). Research suggests
that these declines have been due to increased screening and polyp
removal, preventing progression of polyps to invasive cancers.
There were an estimated 56,300 deaths (47,700 from colon cancer,
8,600 from rectal cancer) in 2000, accounting for about 11% of all
U.S. cancer deaths.
[0016] At present, surgery is the most common form of therapy for
colorectal cancer, and for cancers that have not spread, it is
frequently curative. Chemotherapy, or chemotherapy plus radiation,
is given before or after surgery to most patients whose cancer has
deeply perforated the bowel wall or has spread to the lymph nodes.
A permanent colostomy (creation of an abdominal opening for
elimination of body wastes) is occasionally needed for colon cancer
and is infrequently required for rectal cancer. There continues to
be a need for effective diagnostic and treatment modalities for
colorectal cancer.
[0017] There were an estimated 164,100 new cases of lung and
bronchial cancer in 2000, accounting for 14% of all U.S. cancer
diagnoses. The incidence rate of lung and bronchial cancer is
declining significantly in men, from a high of 86.5 per 100,000 in
1984 to 70.0 in 1996. In the 1990s, the rate of increase among
women began to slow. In 1996, the incidence rate in women was 42.3
per 100,000.
[0018] Lung and bronchial cancer caused an estimated 156,900 deaths
in 2000, accounting for 28% of all cancer deaths. During 1992-1996,
mortality from lung cancer declined significantly among men (-1.7%
per year) while rates for women were still significantly increasing
(0.9% per year). Since 1987, more women have died each year of lung
cancer than breast cancer, which, for over 40 years, was the major
cause of cancer death in women. Decreasing lung cancer incidence
and mortality rates most likely resulted from decreased smoking
rates over the previous 30 years; however, decreasing smoking
patterns among women lag behind those of men. Of concern, although
the declines in adult tobacco use have slowed, tobacco use in youth
is increasing again.
[0019] Treatment options for lung and bronchial cancer are
determined by the type and stage of the cancer and include surgery,
radiation therapy, and chemotherapy. For many localized cancers,
surgery is usually the treatment of choice. Because the disease has
usually spread by the time it is discovered, radiation therapy and
chemotherapy are often needed in combination with surgery.
Chemotherapy alone or combined with radiation is the treatment of
choice for small cell lung cancer; on this regimen, a large
percentage of patients experience remission, which in some cases is
long lasting. There is however, an ongoing need for effective
treatment and diagnostic approaches for lung and bronchial
cancers.
[0020] An estimated 182,800 new invasive cases of breast cancer
were expected to occur among women in the United States during
2000. Additionally, about 1,400 new cases of breast cancer were
expected to be diagnosed in men in 2000. After increasing about 4%
per year in the 1980s, breast cancer incidence rates in women have
leveled off in the 1990s to about 110.6 cases per 100,000.
[0021] In the U.S. alone, there were an estimated 41,200 deaths
(40,800 women, 400 men) in 2000 due to breast cancer. Breast cancer
ranks second among cancer deaths in women. According to the most
recent data, mortality rates declined significantly during
1992-1996 with the largest decreases in younger women, both white
and black. These decreases were probably the result of earlier
detection and improved treatment.
[0022] Taking into account the medical circumstances and the
patient's preferences, treatment of breast cancer may involve
lumpectomy (local removal of the tumor) and removal of the lymph
nodes under the arm; mastectomy (surgical removal of the breast)
and removal of the lymph nodes under the arm; radiation therapy;
chemotherapy; or hormone therapy. Often, two or more methods are
used in combination. Numerous studies have shown that, for early
stage disease, long-term survival rates after lumpectomy plus
radiotherapy are similar to survival rates after modified radical
mastectomy. Significant advances in reconstruction techniques
provide several options for breast reconstruction after mastectomy.
Recently, such reconstruction has been done at the same time as the
mastectomy.
[0023] Local excision of ductal carcinoma in situ (DCIS) with
adequate amounts of surrounding normal breast tissue may prevent
the local recurrence of the DCIS. Radiation to the breast and/or
tamoxifen may reduce the chance of DCIS occurring in the remaining
breast tissue. This is important because DCIS, if left untreated,
may develop into invasive breast cancer. Nevertheless, there are
serious side effects or sequelae to these treatments. There is,
therefore, a need for efficacious breast cancer treatments.
[0024] There were an estimated 23,100 new cases of ovarian cancer
in the United States in 2000. It accounts for 4% of all cancers
among women and ranks second among gynecologic cancers. During
1992-1996, ovarian cancer incidence rates were significantly
declining Consequent to ovarian cancer, there were an estimated
14,000 deaths in 2000. Ovarian cancer causes more deaths than any
other cancer of the female reproductive system.
[0025] Surgery, radiation therapy, and chemotherapy are treatment
options for ovarian cancer. Surgery usually includes the removal of
one or both ovaries, the fallopian tubes (salpingo-oophorectomy),
and the uterus (hysterectomy). In some very early tumors, only the
involved ovary will be removed, especially in young women who wish
to have children. In advanced disease, an attempt is made to remove
all intra-abdominal disease to enhance the effect of chemotherapy.
There continues to be an important need for effective treatment
options for ovarian cancer.
[0026] There were an estimated 28,300 new cases of pancreatic
cancer in the United States in 2000. Over the past 20 years, rates
of pancreatic cancer have declined in men. Rates among women have
remained approximately constant but may be beginning to decline.
Pancreatic cancer caused an estimated 28,200 deaths in 2000 in the
United States. Over the past 20 years, there has been a slight but
significant decrease in mortality rates among men (about -0.9% per
year) while rates have increased slightly among women.
[0027] Surgery, radiation therapy, and chemotherapy are treatment
options for pancreatic cancer. These treatment options can extend
survival and/or relieve symptoms in many patients but are not
likely to produce a cure for most. There is a significant need for
additional therapeutic and diagnostic options for pancreatic
cancer.
[0028] As will be discussed in detail below, the gene and
corresponding protein referred to as 161P2F10B is identical to
ENPP3 phosphodiesterase (also called CD203c or PD-1 beta). ENPP3 is
an ecto-enzyme belonging to a family of ectonucleotide
phosphodiesterases and pyrophosphatases. ENPP3 is a
phosphodiesterase I ecto-enzyme. It is expressed in normal prostate
and uterus, as well as on basophils and mast cells. Expression on
the hematopoietic cells is upregulated in presence of allergen or
by cross-linking with IgE (Buring et al., 1999, Blood 94: 2343).
Members of the ENPP family possess ATPase and ATP pyrophosphatase
activities. They hydrolyze extracellular nucleotides, nucleoside
phosphates, and NAD. They are involved in extracellular nucleotide
metabolism, nucleotide signaling, and recycling of extracellular
nucleotides. They are also involved in cell-cell and cell-matrix
interactions. ENPP enzymes differ in their substrate specificity
and tissue distribution. ENPP enzymes also play a role in recycling
extracellular nucleotides. It has been demonstrated that ENNP1
allows activated T-cells to use NAD+ from dying cells as a source
of adenosine. ENPP3 expressed in the intestine may also be involved
in the hydrolysis of nucleotides derived from food (Byrd et al
1985, Scott et al. 1997).
SUMMARY OF THE INVENTION
[0029] The present invention relates to a gene, designated
161P2F10B, that has now been found to be over-expressed in the
cancer(s) listed in Table I. Northern blot expression analysis of
161P2F10B gene expression in normal tissues shows a restricted
expression pattern in adult tissues. The nucleotide (FIG. 2) and
amino acid (FIG. 2, and FIG. 3) sequences of 161P2F10B are
provided. The tissue-related profile of 161P2F10B in normal adult
tissues, combined with the over-expression observed in the tumors
listed in Table I, shows that 161P2F10B is aberrantly
over-expressed in at least some cancers, and thus serves as a
useful diagnostic, prophylactic, prognostic, and/or therapeutic
target for cancers of the tissue(s) such as those listed in Table
I.
[0030] The invention provides polynucleotides corresponding or
complementary to all or part of the 161P2F10B genes, mRNAs, and/or
coding sequences, preferably in isolated form, including
polynucleotides encoding 161P2F10B-related proteins and fragments
of 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20,
21, 22, 23, 24, 25, or more than 25 contiguous amino acids; at
least 30, 35, 40, 45, 50, 55, 60, 65, 70, 80, 85, 90, 95, 100 or
more than 100 contiguous amino acids of a 161P2F10B-related
protein, as well as the peptides/proteins themselves; DNA, RNA,
DNA/RNA hybrids, and related molecules, polynucleotides or
oligonucleotides complementary or having at least a 90% homology to
the 161P2F10B genes or mRNA sequences or parts thereof, and
polynucleotides or oligonucleotides that hybridize to the 161P2F10B
genes, mRNAs, or to 161P2F10B-encoding polynucleotides. Also
provided are means for isolating cDNAs and the genes encoding
161P2F10B. Recombinant DNA molecules containing 161P2F10B
polynucleotides, cells transformed or transduced with such
molecules, and host-vector systems for the expression of 161P2F10B
gene products are also provided. The invention further provides
antibodies that bind to 161P2F10B proteins and polypeptide
fragments thereof, including polyclonal and monoclonal antibodies,
murine and other mammalian antibodies, chimeric antibodies,
humanized and fully human antibodies, and antibodies labeled with a
detectable marker or therapeutic agent. In certain embodiments
there is a proviso that the entire nucleic acid sequence of FIG. 2
is not encoded and/or the entire amino acid sequence of FIG. 2 is
not prepared. In certain embodiments, the entire nucleic acid
sequence of FIG. 2 is encoded and/or the entire amino acid sequence
of FIG. 2 is prepared, either of which are in respective human unit
dose forms.
[0031] The invention further provides methods for detecting the
presence and status of 161P2F10B polynucleotides and proteins in
various biological samples, as well as methods for identifying
cells that express 161P2F10B. A typical embodiment of this
invention provides methods for monitoring 161P2F10B gene products
in a tissue or hematology sample having or suspected of having some
form of growth dysregulation such as cancer.
[0032] The invention further provides various immunogenic or
therapeutic compositions and strategies for treating cancers that
express 161P2F10B such as cancers of tissues listed in Table I,
including therapies aimed at inhibiting the transcription,
translation, processing or function of 161P2F10B as well as cancer
vaccines. In one aspect, the invention provides compositions, and
methods comprising them, for treating a cancer that expresses
161P2F10B in a human subject wherein the composition comprises a
carrier suitable for human use and a human unit dose of one or more
than one agent that inhibits the production or function of
161P2F10B. Preferably, the carrier is a uniquely human carrier. In
another aspect of the invention, the agent is a moiety that is
immunoreactive with 161P2F10B protein. Non-limiting examples of
such moieties include, but are not limited to, antibodies (such as
single chain, monoclonal, polyclonal, humanized, chimeric, or human
antibodies), functional equivalents thereof (whether naturally
occurring or synthetic), and combinations thereof. The antibodies
can be conjugated to a diagnostic or therapeutic moiety. In another
aspect, the agent is a small molecule as defined herein.
[0033] In another aspect, the agent comprises one or more than one
peptide which comprises a cytotoxic T lymphocyte (CTL) epitope that
binds an HLA class I molecule in a human to elicit a CTL response
to 161P2F10B and/or one or more than one peptide which comprises a
helper T lymphocyte (HTL) epitope which binds an HLA class II
molecule in a human to elicit an HTL response. The peptides of the
invention may be on the same or on one or more separate polypeptide
molecules. In a further aspect of the invention, the agent
comprises one or more than one nucleic acid molecule that expresses
one or more than one of the CTL or HTL response stimulating
peptides as described above. In yet another aspect of the
invention, the one or more than one nucleic acid molecule may
express a moiety that is immunologically reactive with 161P2F10B as
described above. The one or more than one nucleic acid molecule may
also be, or encodes, a molecule that inhibits production of
161P2F10B. Non-limiting examples of such molecules include, but are
not limited to, those complementary to a nucleotide sequence
essential for production of 161P2F10B (e.g. antisense sequences or
molecules that form a triple helix with a nucleotide double helix
essential for 161P2F10B production) or a ribozyme effective to lyse
161P2F10B mRNA.
BRIEF DESCRIPTION OF THE FIGURES
[0034] FIG. 1. The 161P2F10B SSH sequence.
[0035] FIG. 2. The cDNA and amino acid sequence of 161P2F10B (FIG.
2A), and the nucleic acid and amino acid sequence of 161P2F10B
variant 1 (FIG. 2B). The codon for the start methionine is
underlined. The open reading frame for each extends from nucleic
acid 44 to 2671 including the stop codon
[0036] FIG. 3. Amino acid sequence of 161P2F10B (FIG. 3A) and the
amino acid sequence of 161P2F10B variant 1 (FIG. 3B). Each protein
has 875 amino acids.
[0037] FIG. 4. FIG. 4A provides the amino acid alignment of
161P2F10B with ENPP3; FIG. 4B provides an amino acid alignment of
161P2F10B with 161P2F10B variant 1; FIG. 4C provides the Alignment
of 161P2F10B and SNP variant 2 carrying a T to P mutation at
position 874. The consensus sequence is the same as SEQ ID NO: 750,
from residues 1 to 383.
[0038] FIG. 5. Hydrophilicity amino acid profile of 161P2F10B
determined by computer algorithm sequence analysis using the method
of Hopp and Woods (Hopp T. P., Woods K. R., 1981. Proc. Natl. Acad.
Sci. U.S.A. 78:3824-3828) accessed on the Protscale website through
the ExPasy molecular biology server.
[0039] FIG. 6. Hydropathicity amino acid profile of 161P2F10B
determined by computer algorithm sequence analysis using the method
of Kyte and Doolittle (Kyte J., Doolittle R. F., 1982. J. Mol.
Biol. 157:105-132) accessed on the ProtScale website through the
ExPasy molecular biology server.
[0040] FIG. 7. Percent accessible residues amino acid profile of
161P2F10B determined by computer algorithm sequence analysis using
the method of Janin (Janin J., 1979 Nature 277:491-492) accessed on
the ProtScale website through the ExPasy molecular biology
server.
[0041] FIG. 8. Average flexibility amino acid profile of 161P2F10B
determined by computer algorithm sequence analysis using the method
of Bhaskaran and Ponnuswamy (Bhaskaran R., and Ponnuswamy P. K.,
1988. Int. J. Pept. Protein Res. 32:242-255) accessed on the
ProtScale website through the ExPasy molecular biology server.
[0042] FIG. 9. Beta-turn amino acid profile of 161P2F10B determined
by computer algorithm sequence analysis using the method of Deleage
and Roux (Deleage, G., Roux B. 1987 Protein Engineering 1:289-294)
accessed on the ProtScale website through the ExPasy molecular
biology server.
[0043] FIG. 10. Expression of 161P2F10B by RT-PCR. First strand
cDNA was prepared from vital pool 1 (VP1: liver, lung and kidney),
vital pool 2 (VP2, pancreas, colon and stomach), prostate xenograft
pool (LAPC-4AD, LAPC-4AI, LAPC-9AD, LAPC-9AI), normal thymus,
prostate cancer pool, kidney cancer pool, colon cancer pool, lung
cancer pool, ovary cancer pool, breast cancer pool, metastasis
cancer pool, pancreas cancer pool, and prostate cancer metastasis
to lymph node from two different patients. Normalization was
performed by PCR using primers to actin and GAPDH.
Semi-quantitative PCR, using primers to 161P2F10B, was performed at
26 and 30 cycles of amplification. Strong expression of 161P2F10B
was observed in kidney cancer pool. Expression was also detected in
VP1, prostate cancer xenograft pool, prostate cancer pool and colon
cancer pool. Low expression was observed in VP2, lung cancer pool,
ovary cancer pool, breast cancer pool, metastasis pool, pancreas
cancer pool, and in the two different prostate cancer metastasis to
lymph node.
[0044] FIG. 11. Expression of 161P2F10B in normal human tissues.
Two multiple tissue Northern blots, with 2 mg of mRNA/lane, were
probed with the 161P2F10B sequence. Size standards in kilobases
(kb) are indicated on the side. The results show expression of two
161P2F10B transcripts comigrating at approximately 4.4 kb, in
kidney, prostate and colon, and to lower levels, in thymus.
[0045] FIG. 12. Expression of 161P2F10B in kidney cancer
xenografts. RNA was extracted from normal kidney (N), prostate
cancer xenografts, LAPC-4AD, LAPC-4AI, LAPC-9AD, and LAPC-9AI, and
two kidney cancer xenografts (Ki Xeno-1 and Ki Xeno-2). A Northern
blot with 10 mg of total RNA/lane was probed with the 161P2F10B
sequence. Size standards in kilobases (kb) are indicated on the
side. The results showed expression of 161P2F10B in both kidney
xenografts, LAPC-4AI, LAPC-9AI, but not in normal kidney or the
tested cell lines.
[0046] FIG. 13. Expression of 161P2F10B in patient kidney cancer
specimens and in normal tissues. RNA was extracted from a pool of
three kidney cancers, as well as from normal prostate (NP), normal
bladder (NB), normal kidney (NK), and normal colon (NC). A Northern
blot with 10 mg of total RNA/lane was probed with the 161P2F10B
sequence. Size standards in kilobases (kb) are indicated on the
side. The results showed expression of 161P2F10B in the kidney
cancer pool but not in the normal tissues tested.
[0047] FIG. 14. Expression of 161P2F10B in kidney cancer patient
specimens. RNA was extracted from kidney cancer cell lines (CL),
normal kidney (N), kidney tumors (T), and matched normal adjacent
tissue (NAT) isolated from kidney cancer patients. Northern blots
with 10 mg of total RNA/lane were probed with the 161P2F10B
sequence. Size standards in kilobases (kb) are indicated on the
side. The results showed expression of 161P2F10B in all four clear
cell carcinoma kidney tumors, but not in papillary carcinoma nor in
normal kidney tissues.
[0048] FIG. 15. Expression of 161P2F10B in kidney cancer metastasis
specimens and in normal tissues. RNA was extracted from kidney
cancer metastasis to lung, kidney cancer metastasis to lymph node,
normal bladder (NB), normal kidney (NK), and normal lung (NL),
normal breast (NBr), normal ovary (NO), and normal pancreas (NPa).
Northern blots with 10 mg of total RNA/lane were probed with the
161P2F10B sequence. Size standards in kilobases (kb) are indicated
on the side. The results showed expression of 161P2F10B in the two
kidney cancer metastasis tested. Weak expression was detected in
normal kidney and normal breast but not in other normal tissues.
The ethidium-bromide staining of the gel showed equivalent loading
of the RNA samples.
[0049] FIG. 16: Detection of 161P2F10B protein by
immunohistochemistry in kidney cancer patient specimens. Renal
clear cell carcinoma tissue and its matched normal adjacent tissue
as well as its metastatic cancer to lymph node were obtained from a
kidney cancer patient. Frozen tissues were cut into 4 micron
sections and fixed in acetone for 10 minutes. The sections were
then incubated with PE-labeled mouse monoclonal anti-ENPP3 antibody
(Coulter-Immunotech, Marseilles, France) for 3 hours (FIG. 16
panels A-F), or isotype control antibody (FIG. 16 panels G-I). The
slides were washed three times in buffer, and either analyzed by
fluorescence microscopy (FIG. 16 panels A, B and C), or further
incubated with DAKO Envision+.TM. peroxidase-conjugated goat
anti-mouse secondary antibody (DAKO Corporation, Carpenteria,
Calif.) for 1 hour (FIG. 16 panels D, E, and F). The sections were
then washed in buffer, developed using the DAB kit (SIGMA
Chemicals), counterstained using hematoxylin, and analyzed by
bright field microscopy (FIG. 16 panels D, E and F). The results
showed strong expression of 161P2F10B in the renal carcinoma
patient tissue (FIG. 16 panels A and D) and the kidney cancer
metastasis to lymph node tissue (FIG. 16 panels C and F), but
weakly in normal kidney (FIG. 16 B and E). The expression was
detected mostly around the cell membrane indicating that 161P2F10B
is membrane associated in kidney cancer tissues. The weak
expression detected in normal kidney was localized to the kidney
tubules. The sections stained with the isotype control antibody
were negative showing the specificity of the anti-ENPP3 antibody
(FIG. 16 panels G-I).
[0050] FIG. 17: Expression of 161P2F10B protein on the cell surface
of renal cell carcinoma xenografts. Renal cell carcinoma xenograft
tissues (FIG. 17 A) and renal cell carcinoma metastasis to lymph
node xenograft tissues (FIG. 17 B) were harvested from animals and
dispersed into single cell suspension. The cells were stained using
the commercially available antibody 97A6 specific for ENPP3 protein
(also called anti-CD203c) (Immunotech, Marseilles, France). They
were then washed in PBS and analyzed by flow cytometry. The results
showed strong expression of 161P2F10B in both renal cell carcinoma
xenograft (FIG. 17 A) as well as renal cancer metastasis xenograft
(FIG. 17 B). These data demonstrate that 161P2F10B is expressed on
the cell surface of the kidney cancer and kidney cancer metastasis
xenograft cells.
[0051] FIG. 18. Detection of 161P2F10B protein by
immunohistochemistry in human cancer xenograft tissues. Renal cell
carcinoma (FIG. 18 panels A, D, G), renal cell carcinoma metastasis
to lymph node (FIG. 18 panels B, E, H), and prostate cancer
LAPC-4AI (FIG. 18 panels C, F, I) xenografts were grown in SCID
mice. Xenograft tissues were harvested, 4 micron thick frozen
sections were cut and fixed in acetone for 10 minutes. The sections
were then incubated with PE-labeled mouse monoclonal anti-ENPP3
antibody (Immunotech, Marseilles, France) for 3 hours (FIG. 18
panels A-F), or isotype control antibody (FIG. 18 panels G-I). The
slides were washed three times in buffer, and either analyzed by
fluorescence microscopy (FIG. 18 panels A-C), or further incubated
with DAKO Envision+.TM. peroxidase-conjugated goat anti-mouse
secondary antibody (DAKO Corporation, Carpenteria, Calif.) for 1
hour (FIG. 18 panels D-I). The sections were then washed in buffer,
developed using the DAB kit (SIGMA Chemicals), counterstained using
hematoxylin, and analyzed by bright field microscopy (FIG. 18
panels C-F). The results showed strong expression of 161P2F10B in
the renal cell carcinoma xenograft tissue (FIG. 18 panels A and D),
in the kidney cancer metastasis to lymph node (FIG. 18 panels B and
E) as well as in the LAPC-4AI prostate xenograft (C and F) but not
in the negative isotype control sections (FIG. 18 panels G, H, I).
The expression was detected mostly around the cell membrane
indicating that 161P2F10B is membrane-associated.
[0052] FIG. 19. The secondary structure of 161P2F10B, namely the
predicted presence and location of alpha helices, extended strands,
and random coils, is predicted from the primary amino acid sequence
using the HNN--Hierarchical Neural Network method (Guermeur, 1997),
accessed from the ExPasy molecular biology server. The analysis
indicates that 161P2F10B is composed 31.31% alpha helix, 11.31%
extended strand, and 57.37% random coil (FIG. 19A). Shown
graphically in FIG. 19 panels B and C are the results of analysis
using the TMpred (FIG. 19B) and TMHMM (FIG. 19C) prediction
programs depicting the location of the transmembrane domain
[0053] FIG. 20. Expression of 161P2F10B in Human Patient Cancers by
Western Blot. Cell lysates from kidney cancer tissues (KiCa),
kidney cancer metastasis to lymph node (KiCa Met), as well as
normal kidney (NK) were subjected to Western analysis using an
anti-161P2F10B mouse monoclonal antibody. Briefly, tissues (-25
.mu.g total protein) were solubilized in SDS-PAGE sample buffer and
separated on a 10-20% SDS-PAGE gel and transferred to
nitrocellulose. Blots were blocked in Tris-buffered saline (TBS)+3%
non-fat milk and then probed with purified anti-161P2F10B antibody
in TBS+0.15% TWEEN-20+1% milk. Blots were then washed and incubated
with a 1:4,000 dilution of anti-mouse IgG-HRP conjugated secondary
antibody. Following washing, anti-161P2F10B immunoreactive bands
were developed and visualized by enhanced chemiluminescence and
exposure to autoradiographic film. The specific anti-161P2F10B
immunoreactive bands represent a monomeric form of the 161P2F10B
protein, which runs at approximately 130 kDa. These results
demonstrate that 161P2F10B may be useful as a diagnostic and
therapeutic target for kidney cancers, metastatic cancers and
potentially other human cancers.
[0054] FIG. 21. Expression of 161P2F10B in Human Xenograft Tissues
by Western Blot. Cell lysates from kidney cancer xenograft (KiCa
Xeno), kidney cancer metastasis to lymph node xenograft (Met Xeno),
as well as normal kidney (NK) were subjected to Western analysis
using an anti-161P2F10B mouse monoclonal antibody. Briefly, tissues
(.about.25 .mu.g total protein) were solubilized in SDS-PAGE sample
buffer and separated on a 10-20% SDS-PAGE gel and transferred to
nitrocellulose. Blots were blocked in Tris-buffered saline (TBS)+3%
non-fat milk and then probed with purified anti-161P2F10B antibody
in TBS+0.15% TWEEN-20+1% milk. Blots were then washed and incubated
with a 1:4,000 dilution of anti-mouse IgG-HRP conjugated secondary
antibody. Following washing, anti-161P2F10B immunoreactive bands
were developed and visualized by enhanced chemiluminescence and
exposure to autoradiographic film. The specific anti-161P2F10B
immunoreactive bands represent a monomeric form of the 161P2F10B
protein, which runs at approximately 130 kDa, and a multimer of
approximately 260 kDa. These results demonstrate that the human
cancer xenograft mouse models can be used to study the diagnostic
and therapeutic effects of 161P2F10B.
DETAILED DESCRIPTION OF THE INVENTION
[0055] Outline of Sections
[0056] I.) Definitions
[0057] II.) 161P2F10B Polynucleotides [0058] II.A.) Uses of
161P2F10B Polynucleotides [0059] II.A.1.) Monitoring of Genetic
Abnormalities [0060] II.A.2.) Antisense Embodiments [0061] II.A.3.)
Primers and Primer Pairs [0062] II.A.4.) Isolation of
161P2F10B-Encoding Nucleic Acid Molecules [0063] II.A.5.)
Recombinant Nucleic Acid Molecules and Host-Vector Systems
[0064] III.) 161P2F10B-related Proteins [0065] III.A.)
Motif-bearing Protein Embodiments [0066] III.B.) Expression of
161P2F10B-related Proteins [0067] III.C.) Modifications of
161P2F10B-related Proteins [0068] III.D.) Uses of 161P2F10B-related
Proteins
[0069] IV.) 161P2F10B Antibodies
[0070] V.) 161P2F10B Cellular Immune Responses
[0071] VI.) 161P2F10B Transgenic Animals
[0072] VII.) Methods for the Detection of 161P2F10B
[0073] VIII.) Methods for Monitoring the Status of
161P2F10B-related Genes and Their Products
[0074] IX.) Identification of Molecules That Interact With
161P2F10B
[0075] X.) Therapeutic Methods and Compositions [0076] X.A.)
Anti-Cancer Vaccines [0077] X.B.) 161P2F10B as a Target for
Antibody-Based Therapy [0078] X.C.) 161P2F10B as a Target for
Cellular Immune Responses [0079] X.C.1. Minigene Vaccines [0080]
X.C.2. Combinations of CTL Peptides with Helper Peptides [0081]
X.C.3. Combinations of CTL Peptides with T Cell Priming Agents
[0082] X.C.4. Vaccine Compositions Comprising DC Pulsed with CTL
and/or HTL Peptides [0083] X.D.) Adoptive Immunotherapy [0084]
X.E.) Administration of Vaccines for Therapeutic or Prophylactic
Purposes
[0085] XI.) Diagnostic and Prognostic Embodiments of 161P2F10B.
[0086] XII.) Inhibition of 161P2F10B Protein Function [0087]
XII.A.) Inhibition of 161P2F10B With Intracellular Antibodies
[0088] XII.B.) Inhibition of 161P2F10B with Recombinant Proteins
[0089] XII.C.) Inhibition of 161P2F10B Transcription or Translation
[0090] XII.D.) General Considerations for Therapeutic
Strategies
[0091] XIII.) Kits
I.) Definitions
[0092] Unless otherwise defined, all terms of art, notations and
other scientific terms or terminology used herein are intended to
have the meanings commonly understood by those of skill in the art
to which this invention pertains. In some cases, terms with
commonly understood meanings are defined herein for clarity and/or
for ready reference, and the inclusion of such definitions herein
should not necessarily be construed to represent a substantial
difference over what is generally understood in the art. Many of
the techniques and procedures described or referenced herein are
well understood and commonly employed using conventional
methodology by those skilled in the art, such as, for example, the
widely utilized molecular cloning methodologies described in
Sambrook et al., Molecular Cloning: A Laboratory Manual 2nd.
edition (1989) Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, N.Y. As appropriate, procedures involving the use of
commercially available kits and reagents are generally carried out
in accordance with manufacturer defined protocols and/or parameters
unless otherwise noted.
[0093] The terms "advanced prostate cancer", "locally advanced
prostate cancer", "advanced disease" and "locally advanced disease"
mean prostate cancers that have extended through the prostate
capsule, and are meant to include stage C disease under the
American Urological Association (AUA) system, stage C1-C2 disease
under the Whitmore-Jewett system, and stage T3-T4 and N+ disease
under the TNM (tumor, node, metastasis) system. In general, surgery
is not recommended for patients with locally advanced disease, and
these patients have substantially less favorable outcomes compared
to patients having clinically localized (organ-confined) prostate
cancer. Locally advanced disease is clinically identified by
palpable evidence of induration beyond the lateral border of the
prostate, or asymmetry or induration above the prostate base.
Locally advanced prostate cancer is presently diagnosed
pathologically following radical prostatectomy if the tumor invades
or penetrates the prostatic capsule, extends into the surgical
margin, or invades the seminal vesicles.
[0094] "Altering the native glycosylation pattern" is intended for
purposes herein to mean deleting one or more carbohydrate moieties
found in native sequence 161P2F10B (either by removing the
underlying glycosylation site or by deleting the glycosylation by
chemical and/or enzymatic means), and/or adding one or more
glycosylation sites that are not present in the native sequence
161P2F10B. In addition, the phrase includes qualitative changes in
the glycosylation of the native proteins, involving a change in the
nature and proportions of the various carbohydrate moieties
present.
[0095] The term "analog" refers to a molecule which is structurally
similar or shares similar or corresponding attributes with another
molecule (e.g. a 161P2F10B-related protein). For example an analog
of the 161P2F10B protein can be specifically bound by an antibody
or T cell that specifically binds to 161P2F10B.
[0096] The term "antibody" is used in the broadest sense. Therefore
an "antibody" can be naturally occurring or man-made such as
monoclonal antibodies produced by conventional hybridoma
technology. Anti-161P2F10B antibodies comprise monoclonal and
polyclonal antibodies as well as fragments containing the
antigen-binding domain and/or one or more complementarity
determining regions of these antibodies.
[0097] An "antibody fragment" is defined as at least a portion of
the variable region of the immunoglobulin molecule that binds to
its target, i.e., the antigen-binding region. In one embodiment it
specifically covers single anti-161P2F10B antibodies and clones
thereof (including agonist, antagonist and neutralizing antibodies)
and anti-161P2F10B antibody compositions with polyepitopic
specificity.
[0098] The term "codon optimized sequences" refers to nucleotide
sequences that have been optimized for a particular host species by
replacing any codons having a usage frequency of less than about
20%. Nucleotide sequences that have been optimized for expression
in a given host species by elimination of spurious polyadenylation
sequences, elimination of exon/intron splicing signals, elimination
of transposon-like repeats and/or optimization of GC content in
addition to codon optimization are referred to herein as an
"expression enhanced sequences."
[0099] The term "cytotoxic agent" refers to a substance that
inhibits or prevents the expression activity of cells, function of
cells and/or causes destruction of cells. The term is intended to
include radioactive isotopes chemotherapeutic agents, and toxins
such as small molecule toxins or enzymatically active toxins of
bacterial, fungal, plant or animal origin, including fragments
and/or variants thereof. Examples of cytotoxic agents include, but
are not limited to maytansinoids, yttrium, bismuth, ricin, ricin
A-chain, doxorubicin, daunorubicin, TAXOL, ethidium bromide,
mitomycin, etoposide, tenoposide, vincristine, vinblastine,
colchicine, dihydroxy anthracin dione, actinomycin, diphtheria
toxin, Pseudomonas exotoxin (PE) A, PE40, abrin, abrin A chain,
modeccin A chain, alpha-sarcin, gelonin, mitogellin, retstrictocin,
phenomycin, enomycin, curicin, crotin, calicheamicin, sapaonaria
officinalis inhibitor, and glucocorticoid and other
chemotherapeutic agents, as well as radioisotopes such as
At.sup.211, I.sup.131, I.sup.125, Y.sup.90, Re.sup.186, Sm.sup.153,
Bi.sup.212, P.sup.32 and radioactive isotopes of Lu. Antibodies may
also be conjugated to an anti-cancer pro-drug activating enzyme
capable of converting the pro-drug to its active form.
[0100] The term "homolog" refers to a molecule which exhibits
homology to another molecule, by for example, having sequences of
chemical residues that are the same or similar at corresponding
positions.
[0101] "Human Leukocyte Antigen" or "HLA" is a human class I or
class II Major Histocompatibility Complex (MHC) protein (see, e.g.,
Stites, et al., IMMUNOLOGY, 8.sup.th ED., Lange Publishing, Los
Altos, Calif. (1994).
[0102] The terms "hybridize", "hybridizing", "hybridizes" and the
like, used in the context of polynucleotides, are meant to refer to
conventional hybridization conditions, preferably such as
hybridization in 50% formamide/6.times.SSC/0.1% SDS/100 .mu.g/ml
ssDNA, in which temperatures for hybridization are above 37 degrees
C. and temperatures for washing in 0.1.times.SSC/0.1% SDS are above
55 degrees C.
[0103] The phrases "isolated" or "biologically pure" refer to
material which is substantially or essentially free from components
which normally accompany the material as it is found in its native
state. Thus, isolated peptides in accordance with the invention
preferably do not contain materials normally associated with the
peptides in their in situ environment. For example, a
polynucleotide is said to be "isolated" when it is substantially
separated from contaminant polynucleotides that correspond or are
complementary to genes other than the 161P2F10B gene or that encode
polypeptides other than 161P2F10B gene product or fragments
thereof. A skilled artisan can readily employ nucleic acid
isolation procedures to obtain an isolated 161P2F10B
polynucleotide. A protein is said to be "isolated," for example,
when physical, mechanical or chemical methods are employed to
remove the 161P2F10B protein from cellular constituents that are
normally associated with the protein. A skilled artisan can readily
employ standard purification methods to obtain an isolated
161P2F10B protein. Alternatively, an isolated protein can be
prepared by chemical means.
[0104] The term "mammal" refers to any organism classified as a
mammal, including mice, rats, rabbits, dogs, cats, cows, horses and
humans. In one embodiment of the invention, the mammal is a mouse.
In another embodiment of the invention, the mammal is a human.
[0105] The terms "metastatic prostate cancer" and "metastatic
disease" mean prostate cancers that have spread to regional lymph
nodes or to distant sites, and are meant to include stage D disease
under the AUA system and stage TxNxM+under the TNM system. As is
the case with locally advanced prostate cancer, surgery is
generally not indicated for patients with metastatic disease, and
hormonal (androgen ablation) therapy is a preferred treatment
modality. Patients with metastatic prostate cancer eventually
develop an androgen-refractory state within 12 to 18 months of
treatment initiation. Approximately half of these
androgen-refractory patients die within 6 months after developing
that status. The most common site for prostate cancer metastasis is
bone. Prostate cancer bone metastases are often osteoblastic rather
than osteolytic (i.e., resulting in net bone formation). Bone
metastases are found most frequently in the spine, followed by the
femur, pelvis, rib cage, skull and humerus. Other common sites for
metastasis include lymph nodes, lung, liver and brain. Metastatic
prostate cancer is typically diagnosed by open or laparoscopic
pelvic lymphadenectomy, whole body radionuclide scans, skeletal
radiography, and/or bone lesion biopsy.
[0106] The term "monoclonal antibody" refers to an antibody
obtained from a population of substantially homogeneous antibodies,
i.e., the antibodies comprising the population are identical except
for possible naturally occurring mutations that are present in
minor amounts.
[0107] A "motif", as in biological motif of an 161P2F10B-related
protein, refers to any pattern of amino acids forming part of the
primary sequence of a protein, that is associated with a particular
function (e.g. protein-protein interaction, protein-DNA
interaction, etc) or modification (e.g. that is phosphorylated,
glycosylated or amidated), or localization (e.g. secretory
sequence, nuclear localization sequence, etc.) or a sequence that
is correlated with being immunogenic, either humorally or
cellularly. A motif can be either contiguous or capable of being
aligned to certain positions that are generally correlated with a
certain function or property. In the context of HLA motifs, "motif"
refers to the pattern of residues in a peptide of defined length,
usually a peptide of from about 8 to about 13 amino acids for a
class I HLA motif and from about 6 to about 25 amino acids for a
class II HLA motif, which is recognized by a particular HLA
molecule. Peptide motifs for HLA binding are typically different
for each protein encoded by each human HLA allele and differ in the
pattern of the primary and secondary anchor residues.
[0108] A "pharmaceutical excipient" comprises a material such as an
adjuvant, a carrier, pH-adjusting and buffering agents, tonicity
adjusting agents, wetting agents, preservative, and the like.
[0109] "Pharmaceutically acceptable" refers to a non-toxic, inert,
and/or composition that is physiologically compatible with humans
or other mammals.
[0110] The term "polynucleotide" means a polymeric form of
nucleotides of at least 10 bases or base pairs in length, either
ribonucleotides or deoxynucleotides or a modified form of either
type of nucleotide, and is meant to include single and double
stranded forms of DNA and/or RNA. In the art, this term if often
used interchangeably with "oligonucleotide". A polynucleotide can
comprise a nucleotide sequence disclosed herein wherein thymidine
(T) can also be uracil (U); this definition pertains to the
differences between the chemical structures of DNA and RNA, in
particular the observation that one of the four major bases in RNA
is uracil (U) instead of thymidine (T).
[0111] The term "polypeptide" means a polymer of at least about 4,
5, 6, 7, or 8 amino acids. Throughout the specification, standard
three letter or single letter designations for amino acids are
used. In the art, this term is often used interchangeably with
"peptide" or "protein".
[0112] An HLA "primary anchor residue" is an amino acid at a
specific position along a peptide sequence which is understood to
provide a contact point between the immunogenic peptide and the HLA
molecule. One to three, usually two, primary anchor residues within
a peptide of defined length generally defines a "motif" for an
immunogenic peptide. These residues are understood to fit in close
contact with peptide binding groove of an HLA molecule, with their
side chains buried in specific pockets of the binding groove. In
one embodiment, for example, the primary anchor residues for an HLA
class I molecule are located at position 2 (from the amino terminal
position) and at the carboxyl terminal position of a 8, 9, 10, 11,
or 12 residue peptide epitope in accordance with the invention. In
another embodiment, for example, the primary anchor residues of a
peptide that will bind an HLA class II molecule are spaced relative
to each other, rather than to the termini of a peptide, where the
peptide is generally of at least 9 amino acids in length. The
primary anchor positions for each motif and supermotif are set
forth in Table IV. For example, analog peptides can be created by
altering the presence or absence of particular residues in the
primary and/or secondary anchor positions shown in Table IV. Such
analogs are used to modulate the binding affinity and/or population
coverage of a peptide comprising a particular HLA motif or
supermotif.
[0113] A "recombinant" DNA or RNA molecule is a DNA or RNA molecule
that has been subjected to molecular manipulation in vitro.
[0114] Non-limiting examples of small molecules include compounds
that bind or interact with 161P2F10B, ligands including hormones,
neuropeptides, chemokines, odorants, phospholipids, and functional
equivalents thereof that bind and preferably inhibit 161P2F10B
protein function. Such non-limiting small molecules preferably have
a molecular weight of less than about 10 kDa, more preferably below
about 9, about 8, about 7, about 6, about 5 or about 4 kDa. In
certain embodiments, small molecules physically associate with, or
bind, 161P2F10B protein; are not found in naturally occurring
metabolic pathways; and/or are more soluble in aqueous than
non-aqueous solutions
[0115] "Stringency" of hybridization reactions is readily
determinable by one of ordinary skill in the art, and generally is
an empirical calculation dependent upon probe length, washing
temperature, and salt concentration. In general, longer probes
require higher temperatures for proper annealing, while shorter
probes need lower temperatures. Hybridization generally depends on
the ability of denatured nucleic acid sequences to reanneal when
complementary strands are present in an environment below their
melting temperature. The higher the degree of desired homology
between the probe and hybridizable sequence, the higher the
relative temperature that can be used. As a result, it follows that
higher relative temperatures would tend to make the reaction
conditions more stringent, while lower temperatures less so. For
additional details and explanation of stringency of hybridization
reactions, see Ausubel et al., Current Protocols in Molecular
Biology, Wiley Interscience Publishers, (1995).
[0116] "Stringent conditions" or "high stringency conditions", as
defined herein, are identified by, but not limited to, those that:
(1) employ low ionic strength and high temperature for washing, for
example 0.015 M sodium chloride/0.0015 M sodium citrate/0.1% sodium
dodecyl sulfate at 50.degree. C.; (2) employ during hybridization a
denaturing agent, such as formamide, for example, 50% (v/v)
formamide with 0.1% bovine serum albumin/0.1% Ficoll/0.1%
polyvinylpyrrolidone/50 mM sodium phosphate buffer at pH 6.5 with
750 mM sodium chloride, 75 mM sodium citrate at 42 .degree. C.; or
(3) employ 50% formamide, 5.times.SSC (0.75 M NaCl, 0.075 M sodium
citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium
pyrophosphate, 5.times.Denhardt's solution, sonicated salmon sperm
DNA (50 .mu.g/ml), 0.1% SDS, and 10% dextran sulfate at 42.degree.
C., with washes at 42.degree. C. in 0.2.times.SSC (sodium
chloride/sodium. citrate) and 50% formamide at 55.degree. C.,
followed by a high-stringency wash consisting of 0.1.times.SSC
containing EDTA at 55.degree. C. "Moderately stringent conditions"
are described by, but not limited to, those in Sambrook et al.,
Molecular Cloning: A Laboratory Manual, New York: Cold Spring
Harbor Press, 1989, and include the use of washing solution and
hybridization conditions (e.g., temperature, ionic strength and %
SDS) less stringent than those described above. An example of
moderately stringent conditions is overnight incubation at
37.degree. C. in a solution comprising: 20% formamide, 5.times.SSC
(150 mM NaCl, 15 mM trisodium citrate), 50 mM sodium phosphate (pH
7.6), 5.times.Denhardt's solution, 10% dextran sulfate, and 20
mg/mL denatured sheared salmon sperm DNA, followed by washing the
filters in 1.times.SSC at about 37-50.degree. C. The skilled
artisan will recognize how to adjust the temperature, ionic
strength, etc. as necessary to accommodate factors such as probe
length and the like.
[0117] An HLA "supermotif" is a peptide binding specificity shared
by HLA molecules encoded by two or more HLA alleles.
[0118] As used herein "to treat" or "therapeutic" and grammatically
related terms, refer to any improvement of any consequence of
disease, such as prolonged survival, less morbidity, and/or a
lessening of side effects which are the byproducts of an
alternative therapeutic modality; full eradication of disease is
not required.
[0119] A "transgenic animal" (e.g., a mouse or rat) is an animal
having cells that contain a transgene, which transgene was
introduced into the animal or an ancestor of the animal at a
prenatal, e.g., an embryonic stage. A "transgene" is a DNA that is
integrated into the genome of a cell from which a transgenic animal
develops.
[0120] As used herein, an HLA or cellular immune response "vaccine"
is a composition that contains or encodes one or more peptides of
the invention. There are numerous embodiments of such vaccines,
such as a cocktail of one or more individual peptides; one or more
peptides of the invention comprised by a polyepitopic peptide; or
nucleic acids that encode such individual peptides or polypeptides,
e.g., a minigene that encodes a polyepitopic peptide. The "one or
more peptides" can include any whole unit integer from 1-150 or
more, e.g., at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,
15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31,
32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48,
49, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115,
120, 125, 130, 135, 140, 145, or 150 or more peptides of the
invention. The peptides or polypeptides can optionally be modified,
such as by lipidation, addition of targeting or other sequences.
HLA class I peptides of the invention can be admixed with, or
linked to, HLA class II peptides, to facilitate activation of both
cytotoxic T lymphocytes and helper T lymphocytes. HLA vaccines can
also comprise peptide-pulsed antigen presenting cells, e.g.,
dendritic cells.
[0121] The term "variant" refers to a molecule that exhibits a
variation from a described type or norm, such as a protein that has
one or more different amino acid residues in the corresponding
position(s) of a specifically described protein (e.g. the 161P2F10B
protein shown in FIG. 2 or FIG. 3). An analog is an example of a
variant protein.
[0122] The 161P2F10B-related proteins of the invention include
those specifically identified herein, as well as allelic variants,
conservative substitution variants, analogs and homologs that can
be isolated/generated and characterized without undue
experimentation following the methods outlined herein or readily
available in the art. Fusion proteins that combine parts of
different 161P2F10B proteins or fragments thereof, as well as
fusion proteins of a 161P2F10B protein and a heterologous
polypeptide are also included. Such 161P2F10B proteins are
collectively referred to as the 161P2F10B-related proteins, the
proteins of the invention, or 161P2F10B. The term
"161P2F10B-related protein" refers to a polypeptide fragment or an
161P2F10B protein sequence of 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,
15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or more than 25 amino
acids; or, at least 30, 35, 40, 45, 50, 55, 60, 65, 70, 80, 85, 90,
95, 100 or more than 100 amino acids.
II.) 161P2F10B Polynucleotides
[0123] One aspect of the invention provides polynucleotides
corresponding or complementary to all or part of an 161P2F10B gene,
mRNA, and/or coding sequence, preferably in isolated form,
including polynucleotides encoding an 161P2F10B-related protein and
fragments thereof, DNA, RNA, DNA/RNA hybrid, and related molecules,
polynucleotides or oligonucleotides complementary to an 161P2F10B
gene or mRNA sequence or a part thereof, and polynucleotides or
oligonucleotides that hybridize to an 161P2F10B gene, mRNA, or to
an 161P2F10B encoding polynucleotide (collectively, "161P2F10B
polynucleotides"). In all instances when referred to in this
section, T can also be U in FIG. 2.
[0124] Embodiments of a 161P2F10B polynucleotide include: a
161P2F10B polynucleotide having the sequence shown in FIG. 2, the
nucleotide sequence of 161P2F10B as shown in FIG. 2 wherein T is U;
at least 10 contiguous nucleotides of a polynucleotide having the
sequence as shown in FIG. 2; or, at least 10 contiguous nucleotides
of a polynucleotide having the sequence as shown in FIG. 2 where T
is U. For example, embodiments of 161P2F10B nucleotides comprise,
without limitation:
[0125] (a) a polynucleotide comprising or consisting of the
sequence as shown in FIG. 2, wherein T can also be U;
[0126] (b) a polynucleotide comprising or consisting of the
sequence as shown in FIG. 2, from nucleotide residue number 44
through nucleotide residue number 2671, wherein T can also be
U;
[0127] (c) a polynucleotide that encodes an 161P2F10B-related
protein that is at least 90% homologous to the entire amino acid
sequence shown in FIG. 2;
[0128] (d) a polynucleotide that encodes an 161P2F10B-related
protein that is at least 90% identical to the entire amino acid
sequence shown in FIG. 2;
[0129] (e) a polynucleotide that encodes at least one peptide set
forth in Tables V-XVIII;
[0130] (f) a polynucleotide that encodes a peptide region of at
least 5 amino acids of FIG. 3 in any whole number increment up to
875 that includes an amino acid position having a value greater
than 0.5 in the Hydrophilicity profile of FIG. 5;
[0131] (g) a polynucleotide that encodes a peptide region of at
least 5 amino acids of FIG. 3 in any whole number increment up to
875 that includes an amino acid position having a value less than
0.5 in the Hydropathicity profile of FIG. 6;
[0132] (h) a polynucleotide that encodes a peptide region of at
least 5 amino acids of FIG. 3 in any whole number increment up to
875 that includes an amino acid position having a value greater
than 0.5 in the Percent Accessible Residues profile of FIG. 7;
[0133] (i) a polynucleotide that encodes a peptide region of at
least 5 amino acids of FIG. 3 in any whole number increment up to
875 that includes an amino acid position having a value greater
than 0.5 in the Average Flexibility profile on FIG. 8;
[0134] (j) a polynucleotide that encodes a peptide region of at
least 5 amino acids of FIG. 3 in any whole number increment up to
875 that includes an amino acid position having a value greater
than 0.5 in the Beta-turn profile of FIG. 9;
[0135] (k) a polynucleotide that is fully complementary to a
polynucleotide of any one of (a)-(j);
[0136] (l) a polynucleotide that selectively hybridizes under
stringent conditions to a polynucleotide of (a)-(k);
[0137] (m) a peptide that is encoded by any of (a)-(j); and,
[0138] (n) a polynucleotide of any of (a)-(l)or peptide of (m)
together with a pharmaceutical excipient and/or in a human unit
dose form.
[0139] As used herein, a range is understood to specifically
disclose all whole unit positions thereof.
[0140] Typical embodiments of the invention disclosed herein
include 161P2F10B polynucleotides that encode specific portions of
the 161P2F10B mRNA sequence (and those which are complementary to
such sequences) such as those that encode the protein and fragments
thereof, for example of 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15,
16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 55, 60,
65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135,
140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, 200,
205, 210, 215, 220, 225, 250, 275, 300, 325, 350, 375, 400, 425,
450, 475, 500, 525, 550, 575, 600, 625, 650, 675, 700, 725, 750,
775, 900, 825, 850, or 875 contiguous amino acids.
[0141] For example, representative embodiments of the invention
disclosed herein include: polynucleotides and their encoded
peptides themselves encoding about amino acid 1 to about amino acid
10 of the 161P2F10B protein shown in FIG. 2 or FIG. 3,
polynucleotides encoding about amino acid 10 to about amino acid 20
of the 161P2F10B protein shown in FIG. 2, or FIG. 3,
polynucleotides encoding about amino acid 20 to about amino acid 30
of the 161P2F10B protein shown in FIG. 2 or FIG. 3, polynucleotides
encoding about amino acid 30 to about amino acid 40 of the
161P2F10B protein shown in FIG. 2 or FIG. 3, polynucleotides
encoding about amino acid 40 to about amino acid 50 of the
161P2F10B protein shown in FIG. 2 or FIG. 3, polynucleotides
encoding about amino acid 50 to about amino acid 60 of the
161P2F10B protein shown in FIG. 2 or FIG. 3, polynucleotides
encoding about amino acid 60 to about amino acid 70 of the
161P2F10B protein shown in FIG. 2 or FIG. 3, polynucleotides
encoding about amino acid 70 to about amino acid 80 of the
161P2F10B protein shown in FIG. 2 or FIG. 3, polynucleotides
encoding about amino acid 80 to about amino acid 90 of the
161P2F10B protein shown in FIG. 2 or FIG. 3, polynucleotides
encoding about amino acid 90 to about amino acid 100 of the
161P2F10B protein shown in FIG. 2 or FIG. 3, in increments of about
10 amino acids, ending at the carboxyl terminal amino acid set
forth in FIG. 2 or FIG. 3. Accordingly polynucleotides encoding
portions of the amino acid sequence (of about 10 amino acids), of
amino acids 100 through the carboxyl terminal amino acid of the
161P2F10B protein are embodiments of the invention. Wherein it is
understood that each particular amino acid position discloses that
position plus or minus five amino acid residues.
[0142] Polynucleotides encoding relatively long portions of the
161P2F10B protein are also within the scope of the invention. For
example, polynucleotides encoding from about amino acid 1 (or 20 or
30 or 40 etc.) to about amino acid 20, (or 30, or 40 or 50 etc.) of
the 161P2F10B00 protein shown in FIG. 2 or FIG. 3 can be generated
by a variety of techniques well known in the art. These
polynucleotide fragments can include any portion of the 161P2F10B
sequence as shown in FIG. 2 or FIG. 3.
[0143] Additional illustrative embodiments of the invention
disclosed herein include 161P2F10B polynucleotide fragments
encoding one or more of the biological motifs contained within the
161P2F10B protein sequence, including one or more of the
motif-bearing subsequences of the 161P2F10B protein set forth in
Tables V-XVIII. In another embodiment, typical polynucleotide
fragments of the invention encode one or more of the regions of
161P2F10B that exhibit homology to a known molecule. In another
embodiment of the invention, typical polynucleotide fragments can
encode one or more of the 161P2F10B N-glycosylation sites, cAMP and
cGMP-dependent protein kinase phosphorylation sites, casein kinase
II phosphorylation sites or N-myristoylation site and amidation
sites.
[0144] ILA.) Uses of 161P2F10B Polynucleotides
[0145] II.A.1.) Monitoring of Genetic Abnormalities
[0146] The polynucleotides of the preceding paragraphs have a
number of different specific uses. The human 161P2F10B gene maps to
the chromosomal location set forth in Example 3. For example,
because the 161P2F10B gene maps to this chromosome, polynucleotides
that encode different regions of the 161P2F10B protein are used to
characterize cytogenetic abnormalities of this chromosomal locale,
such as abnormalities that are identified as being associated with
various cancers. In certain genes, a variety of chromosomal
abnormalities including rearrangements have been identified as
frequent cytogenetic abnormalities in a number of different cancers
(see e.g. Krajinovic et al., Mutat. Res. 382(3-4): 81-83 (1998);
Johansson et al., Blood 86(10): 3905-3914 (1995) and Finger et al.,
P.N.A.S. 85(23): 9158-9162 (1988)). Thus, polynucleotides encoding
specific regions of the 161P2F10B protein provide new tools that
can be used to delineate, with greater precision than previously
possible, cytogenetic abnormalities in the chromosomal region that
encodes 161P2F10B that may contribute to the malignant phenotype.
In this context, these polynucleotides satisfy a need in the art
for expanding the sensitivity of chromosomal screening in order to
identify more subtle and less common chromosomal abnormalities (see
e.g. Evans et al., Am. J. Obstet. Gynecol 171(4): 1055-1057
(1994)).
[0147] Furthermore, as 161P2F10B was shown to be highly expressed
in prostate and other cancers, 161P2F10B polynucleotides are used
in methods assessing the status of 161P2F10B gene products in
normal versus cancerous tissues. Typically, polynucleotides that
encode specific regions of the 161P2F10B protein are used to assess
the presence of perturbations (such as deletions, insertions, point
mutations, or alterations resulting in a loss of an antigen etc.)
in specific regions of the 161P2F10B gene, such as such regions
containing one or more motifs. Exemplary assays include both RT-PCR
assays as well as single-strand conformation polymorphism (SSCP)
analysis (see, e.g., Marrogi et al., J. Cutan. Pathol. 26(8):
369-378 (1999), both of which utilize polynucleotides encoding
specific regions of a protein to examine these regions within the
protein.
[0148] II.A.2.) Antisense Embodiments
[0149] Other specifically contemplated nucleic acid related
embodiments of the invention disclosed herein are genomic DNA,
cDNAs, ribozymes, and antisense molecules, as well as nucleic acid
molecules based on an alternative backbone, or including
alternative bases, whether derived from natural sources or
synthesized, and include molecules capable of inhibiting the RNA or
protein expression of 161P2F10B. For example, antisense molecules
can be RNAs or other molecules, including peptide nucleic acids
(PNAs) or non-nucleic acid molecules such as phosphorothioate
derivatives, that specifically bind DNA or RNA in a base
pair-dependent manner. A skilled artisan can readily obtain these
classes of nucleic acid molecules using the 161P2F10B
polynucleotides and polynucleotide sequences disclosed herein.
[0150] Antisense technology entails the administration of exogenous
oligonucleotides that bind to a target polynucleotide located
within the cells. The term "antisense" refers to the fact that such
oligonucleotides are complementary to their intracellular targets,
e.g., 161P2F10B. See for example, Jack Cohen,
Oligodeoxynucleotides, Antisense Inhibitors of Gene Expression, CRC
Press, 1989; and Synthesis 1:1-5 (1988). The 161P2F10B antisense
oligonucleotides of the present invention include derivatives such
as S-oligonucleotides (phosphorothioate derivatives or S-oligos,
see, Jack Cohen, supra), which exhibit enhanced cancer cell growth
inhibitory action. S-oligos (nucleoside phosphorothioates) are
isoelectronic analogs of an oligonucleotide (O-oligo) in which a
nonbridging oxygen atom of the phosphate group is replaced by a
sulfur atom. The S-oligos of the present invention can be prepared
by treatment of the corresponding O-oligos with
3H-1,2-benzodithiol-3-one-1,1-dioxide, which is a sulfur transfer
reagent. See Iyer, R. P. et al, J. Org. Chem. 55:4693-4698 (1990);
and Iyer, R. P. et al., J. Am. Chem. Soc. 112:1253-1254 (1990).
Additional 161P2F10B antisense oligonucleotides of the present
invention include morpholino antisense oligonucleotides known in
the art (see, e.g., Partridge et al., 1996, Antisense & Nucleic
Acid Drug Development 6: 169-175).
[0151] The 161P2F10B antisense oligonucleotides of the present
invention typically can be RNA or DNA that is complementary to and
stably hybridizes with the first 100 5' codons or last 100 3'
codons of the 161P2F10B genomic sequence or the corresponding mRNA.
Absolute complementarity is not required, although high degrees of
complementarity are preferred. Use of an oligonucleotide
complementary to this region allows for the selective hybridization
to 161P2F10B mRNA and not to mRNA specifying other regulatory
subunits of protein kinase. In one embodiment, 161P2F10B antisense
oligonucleotides of the present invention are 15 to 30-mer
fragments of the antisense DNA molecule that have a sequence that
hybridizes to 161P2F10B mRNA. Optionally, 161P2F10B antisense
oligonucleotide is a 30-mer oligonucleotide that is complementary
to a region in the first 10 5' codons or last 10 3' codons of
161P2F10B. Alternatively, the antisense molecules are modified to
employ ribozymes in the inhibition of 161P2F10B expression, see,
e.g., L. A. Couture & D. T. Stinchcomb; Trends Genet 12:
510-515 (1996).
[0152] II.A.3.) Primers and Primer Pairs
[0153] Further specific embodiments of this nucleotides of the
invention include primers and primer pairs, which allow the
specific amplification of polynucleotides of the invention or of
any specific parts thereof, and probes that selectively or
specifically hybridize to nucleic acid molecules of the invention
or to any part thereof. Probes can be labeled with a detectable
marker, such as, for example, a radioisotope, fluorescent compound,
bioluminescent compound, a chemiluminescent compound, metal
chelator or enzyme. Such probes and primers are used to detect the
presence of a 161P2F10B polynucleotide in a sample and as a means
for detecting a cell expressing a 161P2F10B protein.
[0154] Examples of such probes include polypeptides comprising all
or part of the human 161P2F10B cDNA sequence shown in FIG. 2.
Examples of primer pairs capable of specifically amplifying
161P2F10B mRNAs are also described in the Examples. As will be
understood by the skilled artisan, a great many different primers
and probes can be prepared based on the sequences provided herein
and used effectively to amplify and/or detect a 161P2F10B mRNA.
[0155] The 161P2F10B polynucleotides of the invention are useful
for a variety of purposes, including but not limited to their use
as probes and primers for the amplification and/or detection of the
161P2F10B gene(s), mRNA(s), or fragments thereof; as reagents for
the diagnosis and/or prognosis of prostate cancer and other
cancers; as coding sequences capable of directing the expression of
161P2F10B polypeptides; as tools for modulating or inhibiting the
expression of the 161P2F10B gene(s) and/or translation of the
161P2F10B transcript(s); and as therapeutic agents.
[0156] The present invention includes the use of any probe as
described herein to identify and isolate a 161P2F10B or 161P2F10B
related nucleic acid sequence from a naturally occurring source,
such as humans or other mammals, as well as the isolated nucleic
acid sequence per se, which would comprise all or most of the
sequences found in the probe used.
[0157] II.A.4.) Isolation of 161P2F10B-Encoding Nucleic Acid
Molecules
[0158] The 161P2F10B cDNA sequences described herein enable the
isolation of other polynucleotides encoding 161P2F10B gene
product(s), as well as the isolation of polynucleotides encoding
161P2F10B gene product homologs, alternatively spliced isoforms,
allelic variants, and mutant forms of the 161P2F10B gene product as
well as polynucleotides that encode analogs of 161P2F10B-related
proteins. Various molecular cloning methods that can be employed to
isolate full length cDNAs encoding an 161P2F10B gene are well known
(see, for example, Sambrook, J. et al., Molecular Cloning: A
Laboratory Manual, 2d edition, Cold Spring Harbor Press, New York,
1989; Current Protocols in Molecular Biology. Ausubel et al., Eds.,
Wiley and Sons, 1995). For example, lambda phage cloning
methodologies can be conveniently employed, using commercially
available cloning systems (e.g., Lambda ZAP Express, Stratagene).
Phage clones containing 161P2F10B gene cDNAs can be identified by
probing with a labeled 161P2F10B cDNA or a fragment thereof. For
example, in one embodiment, the 161P2F10B cDNA (FIG. 2) or a
portion thereof can be synthesized and used as a probe to retrieve
overlapping and full-length cDNAs corresponding to a 161P2F10B
gene. The 161P2F10B gene itself can be isolated by screening
genomic DNA libraries, bacterial artificial chromosome libraries
(BACs), yeast artificial chromosome libraries (YACs), and the like,
with 161P2F10B DNA probes or primers.
[0159] II.A.5.) Recombinant Nucleic Acid Molecules and Host-Vector
Systems
[0160] The invention also provides recombinant DNA or RNA molecules
containing an 161P2F10B polynucleotide, a fragment, analog or
homologue thereof, including but not limited to phages, plasmids,
phagemids, cosmids, YACs, BACs, as well as various viral and
non-viral vectors well known in the art, and cells transformed or
transfected with such recombinant DNA or RNA molecules. Methods for
generating such molecules are well known (see, for example,
Sambrook et al, 1989, supra).
[0161] The invention further provides a host-vector system
comprising a recombinant DNA molecule containing a 161P2F10B
polynucleotide, fragment, analog or homologue thereof within a
suitable prokaryotic or eukaryotic host cell. Examples of suitable
eukaryotic host cells include a yeast cell, a plant cell, or an
animal cell, such as a mammalian cell or an insect cell (e.g., a
baculovirus-infectible cell such as an Sf9 or HighFive cell).
Examples of suitable mammalian cells include various prostate
cancer cell lines such as DU145 and TsuPr1, other transfectable or
transducible prostate cancer cell lines, primary cells (PrEC), as
well as a number of mammalian cells routinely used for the
expression of recombinant proteins (e.g., COS, CHO, 293, 293T
cells). More particularly, a polynucleotide comprising the coding
sequence of 161P2F10B or a fragment, analog or homolog thereof can
be used to generate 161P2F10B proteins or fragments thereof using
any number of host-vector systems routinely used and widely known
in the art.
[0162] A wide range of host-vector systems suitable for the
expression of 161P2F10B proteins or fragments thereof are
available, see for example, Sambrook et al., 1989, supra; Current
Protocols in Molecular Biology, 1995, supra). Preferred vectors for
mammalian expression include but are not limited to pcDNA 3.1
myc-His-tag (Invitrogen) and the retroviral vector pSR.alpha.tkneo
(Muller et al., 1991, MCB 11:1785). Using these expression vectors,
161P2F10B can be expressed in several prostate cancer and
non-prostate cell lines, including for example 293, 293T, rat-1,
NIH 3T3 and TsuPr1. The host-vector systems of the invention are
useful for the production of a 161P2F10B protein or fragment
thereof. Such host-vector systems can be employed to study the
functional properties of 161P2F10B and 161P2F10B mutations or
analogs.
[0163] Recombinant human 161P2F10B protein or an analog or homolog
or fragment thereof can be produced by mammalian cells transfected
with a construct encoding a 161P2F10B-related nucleotide. For
example, 293T cells can be transfected with an expression plasmid
encoding 161P2F10B or fragment, analog or homolog thereof, the
161P2F10B or related protein is expressed in the 293T cells, and
the recombinant 161P2F10B protein is isolated using standard
purification methods (e.g., affinity purification using
anti-161P2F10B antibodies). In another embodiment, a 161P2F10B
coding sequence is subcloned into the retroviral vector
pSR.alpha.MSVtkneo and used to infect various mammalian cell lines,
such as NIH 3T3, TsuPr1, 293 and rat-1 in order to establish
161P2F10B expressing cell lines. Various other expression systems
well known in the art can also be employed. Expression constructs
encoding a leader peptide joined in frame to the 161P2F10B coding
sequence can be used for the generation of a secreted form of
recombinant 161P2F10B protein.
[0164] As discussed herein, redundancy in the genetic code permits
variation in 161P2F10B gene sequences. In particular, it is known
in the art that specific host species often have specific codon
preferences, and thus one can adapt the disclosed sequence as
preferred for a desired host. For example, preferred analog codon
sequences typically have rare codons (i.e., codons having a usage
frequency of less than about 20% in known sequences of the desired
host) replaced with higher frequency codons. Codon preferences for
a specific species are calculated, for example, by utilizing codon
usage tables available on the INTERNET.
[0165] Additional sequence modifications are known to enhance
protein expression in a cellular host. These include elimination of
sequences encoding spurious polyadenylation signals, exon/intron
splice site signals, transposon-like repeats, and/or other such
well-characterized sequences that are deleterious to gene
expression. The GC content of the sequence is adjusted to levels
average for a given cellular host, as calculated by reference to
known genes expressed in the host cell. Where possible, the
sequence is modified to avoid predicted hairpin secondary mRNA
structures. Other useful modifications include the addition of a
translational initiation consensus sequence at the start of the
open reading frame, as described in Kozak, Mol. Cell Biol.,
9:5073-5080 (1989). Skilled artisans understand that the general
rule that eukaryotic ribosomes initiate translation exclusively at
the 5' proximal AUG codon is abrogated only under rare conditions
(see, e.g., Kozak PNAS 92(7): 2662-2666, (1995) and Kozak NAR
15(20): 8125-8148 (1987)).
III.) 161P2F10B-Related Proteins
[0166] Another aspect of the present invention provides
161P2F10B-related proteins. Specific embodiments of 161P2F10B
proteins comprise a polypeptide having all or part of the amino
acid sequence of human 161P2F10B as shown in FIG. 2 or FIG. 3.
Alternatively, embodiments of 161P2F10B proteins comprise variant,
homolog or analog polypeptides that have alterations in the amino
acid sequence of 161P2F10B shown in FIG. 2 or FIG. 3.
[0167] In general, naturally occurring allelic variants of human
161P2F10B share a high degree of structural identity and homology
(e.g., 90% or more homology). Typically, allelic variants of the
161P2F10B protein contain conservative amino acid substitutions
within the 161P2F10B sequences described herein or contain a
substitution of an amino acid from a corresponding position in a
homologue of 161P2F10B. One class of 161P2F10B allelic variants are
proteins that share a high degree of homology with at least a small
region of a particular 161P2F10B amino acid sequence, but further
contain a radical departure from the sequence, such as a
non-conservative substitution, truncation, insertion or frame
shift. In comparisons of protein sequences, the terms, similarity,
identity, and homology each have a distinct meaning as appreciated
in the field of genetics. Moreover, orthology and paralogy can be
important concepts describing the relationship of members of a
given protein family in one organism to the members of the same
family in other organisms.
[0168] Amino acid abbreviations are provided in Table II.
Conservative amino acid substitutions can frequently be made in a
protein without altering either the conformation or the function of
the protein. Proteins of the invention can comprise 1, 2, 3, 4, 5,
6, 7, 8, 9, 10, 11, 12, 13, 14, 15 conservative substitutions. Such
changes include substituting any of isoleucine (I), valine (V), and
leucine (L) for any other of these hydrophobic amino acids;
aspartic acid (D) for glutamic acid (E) and vice versa; glutamine
(Q) for asparagine (N) and vice versa; and serine (S) for threonine
(T) and vice versa. Other substitutions can also be considered
conservative, depending on the environment of the particular amino
acid and its role in the three-dimensional structure of the
protein. For example, glycine (G) and alanine (A) can frequently be
interchangeable, as can alanine (A) and valine (V). Methionine (M),
which is relatively hydrophobic, can frequently be interchanged
with leucine and isoleucine, and sometimes with valine. Lysine (K)
and arginine (R) are frequently interchangeable in locations in
which the significant feature of the amino acid residue is its
charge and the differing pK's of these two amino acid residues are
not significant. Still other changes can be considered
"conservative" in particular environments (see, e.g. Table III
herein; pages 13-15 "Biochemistry" 2.sup.nd ED. Lubert Stryer ed
(Stanford University); Henikoff et al., PNAS 1992 Vol 89
10915-10919; Lei et al., J Biol Chem 1995 May 19;
270(20):11882-6).
[0169] Embodiments of the invention disclosed herein include a wide
variety of art-accepted variants or analogs of 161P2F10B proteins
such as polypeptides having amino acid insertions, deletions and
substitutions. 161P2F10B variants can be made using methods known
in the art such as site-directed mutagenesis, alanine scanning, and
PCR mutagenesis. Site-directed mutagenesis (Carter et al., Nucl.
Acids Res., 13:4331 (1986); Zoller et al., Nucl. Acids Res.,
10:6487 (1987)), cassette mutagenesis (Wells et al., Gene, 34:315
(1985)), restriction selection mutagenesis (Wells et al., Philos.
Trans. R. Soc. London SerA, 317:415 (1986)) or other known
techniques can be performed on the cloned DNA to produce the
161P2F10B variant DNA.
[0170] Scanning amino acid analysis can also be employed to
identify one or more amino acids along a contiguous sequence that
is involved in a specific biological activity such as a
protein-protein interaction. Among the preferred scanning amino
acids are relatively small, neutral amino acids. Such amino acids
include alanine, glycine, serine, and cysteine. Alanine is
typically a preferred scanning amino acid among this group because
it eliminates the side-chain beyond the beta-carbon and is less
likely to alter the main-chain conformation of the variant. Alanine
is also typically preferred because it is the most common amino
acid. Further, it is frequently found in both buried and exposed
positions (Creighton, The Proteins, (W. H. Freeman & Co.,
N.Y.); Chothia, J. Mol. Biol., 150:1 (1976)). If alanine
substitution does not yield adequate amounts of variant, an
isosteric amino acid can be used.
[0171] As defined herein, 161P2F10B variants, analogs or homologs,
have the distinguishing attribute of having at least one epitope
that is "cross reactive" with a 161P2F10B protein having the amino
acid sequence of SEQ ID NO: 703. As used in this sentence, "cross
reactive" means that an antibody or T cell that specifically binds
to an 161P2F10B variant also specifically binds to the 161P2F10B
protein having the amino acid sequence of SEQ ID NO: 703. A
polypeptide ceases to be a variant of the protein shown in SEQ ID
NO: 703 when it no longer contains any epitope capable of being
recognized by an antibody or T cell that specifically binds to the
161P2F10B protein. Those skilled in the art understand that
antibodies that recognize proteins bind to epitopes of varying
size, and a grouping of the order of about four or five amino
acids, contiguous or not, is regarded as a typical number of amino
acids in a minimal epitope. See, e.g., Nair et al., J. Immunol 2000
165(12): 6949-6955; Hebbes et al., Mol Immunol (1989) 26(9):865-73;
Schwartz et al., J Immunol (1985) 135(4):2598-608.
[0172] Another class of 161P2F10B-related protein variants share
70%, 75%, 80%, 85% or 90% or more similarity with the amino acid
sequence of FIG. 2 or a fragment thereof. Another specific class of
161P2F10B protein variants or analogs comprise one or more of the
161P2F10B biological motifs described herein or presently known in
the art. Thus, encompassed by the present invention are analogs of
161P2F10B fragments (nucleic or amino acid) that have altered
functional (e.g. immunogenic) properties relative to the starting
fragment. It is to be appreciated that motifs now or which become
part of the art are to be applied to the nucleic or amino acid
sequences of FIG. 2 or FIG. 3.
[0173] As discussed herein, embodiments of the claimed invention
include polypeptides containing less than the full amino acid
sequence of the 161P2F10B protein shown in FIG. 2 or FIG. 3. For
example, representative embodiments of the invention comprise
peptides/proteins having any 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,
15 or more contiguous amino acids of the 161P2F10B protein shown in
FIG. 2 or FIG. 3.
[0174] Moreover, representative embodiments of the invention
disclosed herein include polypeptides consisting of about amino
acid 1 to about amino acid 10 of the 161P2F10B protein shown in
FIG. 2 or FIG. 3, polypeptides consisting of about amino acid 10 to
about amino acid 20 of the 161P2F10B protein shown in FIG. 2 or
FIG. 3, polypeptides consisting of about amino acid 20 to about
amino acid 30 of the 161P2F10B protein shown in FIG. 2 or FIG. 3,
polypeptides consisting of about amino acid 30 to about amino acid
40 of the 161P2F10B protein shown in FIG. 2 or FIG. 3, polypeptides
consisting of about amino acid 40 to about amino acid 50 of the
161P2F10B protein shown in FIG. 2 or FIG. 3, polypeptides
consisting of about amino acid 50 to about amino acid 60 of the
161P2F10B protein shown in FIG. 2 or FIG. 3, polypeptides
consisting of about amino acid 60 to about amino acid 70 of the
161P2F10B protein shown in FIG. 2 or FIG. 3, polypeptides
consisting of about amino acid 70 to about amino acid 80 of the
161P2F10B protein shown in FIG. 2 or FIG. 3, polypeptides
consisting of about amino acid 80 to about amino acid 90 of the
161P2F10B protein shown in FIG. 2 or FIG. 3, polypeptides
consisting of about amino acid 90 to about amino acid 100 of the
161P2F10B protein shown in FIG. 2 or FIG. 3, etc. throughout the
entirety of the 161P2F10B amino acid sequence. Moreover,
polypeptides consisting of about amino acid 1 (or 20 or 30 or 40
etc.) to about amino acid 20, (or 130, or 140 or 150 etc.) of the
161P2F10B protein shown in FIG. 2 or FIG. 3 are embodiments of the
invention. It is to be appreciated that the starting and stopping
positions in this paragraph refer to the specified position as well
as that position plus or minus 5 residues.
[0175] 161P2F10B-related proteins are generated using standard
peptide synthesis technology or using chemical cleavage methods
well known in the art. Alternatively, recombinant methods can be
used to generate nucleic acid molecules that encode a
161P2F10B-related protein. In one embodiment, nucleic acid
molecules provide a means to generate defined fragments of the
161P2F10B protein (or variants, homologs or analogs thereof).
[0176] III.A.) Motif-Bearing Protein Embodiments
[0177] Additional illustrative embodiments of the invention
disclosed herein include 161P2F10B polypeptides comprising the
amino acid residues of one or more of the biological motifs
contained within the 161P2F10B polypeptide sequence set forth in
FIG. 2 or FIG. 3. Various motifs are known in the art, and a
protein can be evaluated for the presence of such motifs by a
number of publicly available Internet sites (see, e.g.,
Epimatrix.TM. and Epimer.TM. Brown University; and BIMAS.
[0178] Motif bearing subsequences of the 161P2F10B protein are set
forth and identified in Table XIX.
[0179] Table XX sets forth several frequently occurring motifs
based on pfam searches. The columns of Table XX list (1) motif name
abbreviation, (2) percent identity found amongst the different
member of the motif family, (3) motif name or description and (4)
most common function; location information is included if the motif
is relevant for location.
[0180] Polypeptides comprising one or more of the 161P2F10B motifs
discussed above are useful in elucidating the specific
characteristics of a malignant phenotype in view of the observation
that the 161P2F10B motifs discussed above are associated with
growth dysregulation and because 161P2F10B is overexpressed in
certain cancers (See, e.g., Table I). Casein kinase II, cAMP and
camp-dependent protein kinase, and Protein Kinase C, for example,
are enzymes known to be associated with the development of the
malignant phenotype (see e.g. Chen et al., Lab Invest., 78(2):
165-174 (1998); Gaiddon et al., Endocrinology 136(10): 4331-4338
(1995); Hall et al., Nucleic Acids Research 24(6): 1119-1126
(1996); Peterziel et al., Oncogene 18(46): 6322-6329 (1999) and
O'Brian, Oncol. Rep. 5(2): 305-309 (1998)). Moreover, both
glycosylation and myristoylation are protein modifications also
associated with cancer and cancer progression (see e.g. Dennis et
al., Biochem. Biophys. Acta 1473(1):21-34 (1999); Raju et al., Exp.
Cell Res. 235(1): 145-154 (1997)). Amidation is another protein
modification also associated with cancer and cancer progression
(see e.g. Treston et al., J. Natl. Cancer Inst. Monogr. (13):
169-175 (1992)).
[0181] In another embodiment, proteins of the invention comprise
one or more of the immunoreactive epitopes identified in accordance
with art-accepted methods, such as the peptides set forth in Tables
V-XVIII. CTL epitopes can be determined using specific algorithms
to identify peptides within an 161P2F10B protein that are capable
of optimally binding to specified HLA alleles (e.g., Table IV;
Epimatrix.TM. and Epimer.TM., Brown University; and BIMAS).
Moreover, processes for identifying peptides that have sufficient
binding affinity for HLA molecules and which are correlated with
being immunogenic epitopes, are well known in the art, and are
carried out without undue experimentation. In addition, processes
for identifying peptides that are immunogenic epitopes, are well
known in the art, and are carried out without undue experimentation
either in vitro or in vivo.
[0182] Also known in the art are principles for creating analogs of
such epitopes in order to modulate immunogenicity. For example, one
begins with an epitope that bears a CTL or HTL motif (see, e.g.,
the HLA Class I and HLA Class II motifs/supermotifs of Table IV).
The epitope is analoged by substituting out an amino acid at one of
the specified positions, and replacing it with another amino acid
specified for that position. For example, one can substitute out a
deleterious residue in favor of any other residue, such as a
preferred residue as defined in Table IV; substitute a
less-preferred residue with a preferred residue as defined in Table
IV; or substitute an originally-occurring preferred residue with
another preferred residue as defined in Table IV. Substitutions can
occur at primary anchor positions or at other positions in a
peptide; see, e.g., Table IV.
[0183] A variety of references reflect the art regarding the
identification and generation of epitopes in a protein of interest
as well as analogs thereof. See, for example, WO 9733602 to Chesnut
et al.; Sette, Immunogenetics 1999 50(3-4): 201-212; Sette et al.,
J. Immunol. 2001 166(2): 1389-1397; Sidney et al., Hum. Immunol.
1997 58(1): 12-20; Kondo et al., Immunogenetics 1997 45(4):
249-258; Sidney et al., J. Immunol. 1996 157(8): 3480-90; and Falk
et al., Nature 351: 290-6 (1991); Hunt et al., Science 255:1261-3
(1992); Parker et al., J. Immunol. 149:3580-7 (1992); Parker et
al., J. Immunol. 152:163-75 (1994)); Kast et al., 1994 152(8):
3904-12; Borras-Cuesta et al., Hum. Immunol. 2000 61(3): 266-278;
Alexander et al., J. Immunol. 2000 164(3); 164(3): 1625-1633;
Alexander et al., PMID: 7895164, UI: 95202582; O'Sullivan et al.,
J. Immunol. 1991 147(8): 2663-2669; Alexander et al., Immunity 1994
1(9): 751-761 and Alexander et al., Immunol. Res. 1998 18(2):
79-92.
[0184] Related embodiments of the inventions include polypeptides
comprising combinations of the different motifs set forth in Table
XIX, and/or, one or more of the predicted CTL epitopes of Table V
through Table XVIII, and/or, one or more of the T cell binding
motifs known in the art. Preferred embodiments contain no
insertions, deletions or substitutions either within the motifs or
the intervening sequences of the polypeptides. In addition,
embodiments which include a number of either N-terminal and/or
C-terminal amino acid residues on either side of these motifs may
be desirable (to, for example, include a greater portion of the
polypeptide architecture in which the motif is located). Typically
the number of N-terminal and/or C-terminal amino acid residues on
either side of a motif is between about 1 to about 100 amino acid
residues, preferably 5 to about 50 amino acid residues.
[0185] 161P2F10B-related proteins are embodied in many forms,
preferably in isolated form. A purified 161P2F10B protein molecule
will be substantially free of other proteins or molecules that
impair the binding of 161P2F10B to antibody, T cell or other
ligand. The nature and degree of isolation and purification will
depend on the intended use. Embodiments of a 161P2F10B-related
proteins include purified 161P2F10B-related proteins and
functional, soluble 161P2F10B-related proteins. In one embodiment,
a functional, soluble 161P2F10B protein or fragment thereof retains
the ability to be bound by antibody, T cell or other ligand.
[0186] The invention also provides 161P2F10B proteins comprising
biologically active fragments of the 161P2F10B amino acid sequence
shown in FIG. 2 or FIG. 3. Such proteins exhibit properties of the
161P2F10B protein, such as the ability to elicit the generation of
antibodies that specifically bind an epitope associated with the
161P2F10B protein; to be bound by such antibodies; to elicit the
activation of HTL or CTL; and/or, to be recognized by HTL or
CTL.
[0187] 161P2F10B-related polypeptides that contain particularly
interesting structures can be predicted and/or identified using
various analytical techniques well known in the art, including, for
example, the methods of Chou-Fasman, Garnier-Robson,
Kyte-Doolittle, Eisenberg, Karplus-Schultz or Jameson-Wolf
analysis, or on the basis of immunogenicity. Fragments that contain
such structures are particularly useful in generating
subunit-specific anti-161P2F10B antibodies, or T cells or in
identifying cellular factors that bind to 161P2F10B.
[0188] CTL epitopes can be determined using specific algorithms to
identify peptides within an 161P2F10B protein that are capable of
optimally binding to specified HLA alleles (e.g., by using the
SYFPEITHI site; the listings in Table IV(A)-(E); Epimatrix.TM. and
Epimer.TM., Brown University; and BIMAS. Illustrating this, peptide
epitopes from 161P2F10B that are presented in the context of human
MHC class I molecules HLA-A1, A2, A3, A11, A24, B7 and B35 were
predicted (Tables V-XVIII). Specifically, the complete amino acid
sequence of the 161P2F10B protein was entered into the HLA Peptide
Motif Search algorithm found in the Bioinformatics and Molecular
Analysis Section (BIMAS) web site listed above. The HLA peptide
motif search algorithm was developed by Dr. Ken Parker based on
binding of specific peptide sequences in the groove of HLA Class I
molecules, in particular HLA-A2 (see, e.g., Falk et al., Nature
351: 290-6 (1991); Hunt et al., Science 255:1261-3 (1992); Parker
et al., J. Immunol. 149:3580-7 (1992); Parker et al., J. Immunol.
152:163-75 (1994)). This algorithm allows location and ranking of
8-mer, 9-mer, and 10-mer peptides from a complete protein sequence
for predicted binding to HLA-A2 as well as numerous other HLA Class
I molecules. Many HLA class I binding peptides are 8-, 9-, 10 or
11-mers. For example, for class I HLA-A2, the epitopes preferably
contain a leucine (L) or methionine (M) at position 2 and a valine
(V) or leucine (L) at the C-terminus (see, e.g., Parker et al., J.
Immunol. 149:3580-7 (1992)). Selected results of 161P2F10B
predicted binding peptides are shown in Tables V-XVIII herein. In
Tables V-XVIII, the top 50 ranking candidates, 9-mers and 10-mers,
for each family member are shown along with their location, the
amino acid sequence of each specific peptide, and an estimated
binding score. The binding score corresponds to the estimated half
time of dissociation of complexes containing the peptide at
37.degree. C. at pH 6.5. Peptides with the highest binding score
are predicted to be the most tightly bound to HLA Class I on the
cell surface for the greatest period of time and thus represent the
best immunogenic targets for T-cell recognition.
[0189] Actual binding of peptides to an HLA allele can be evaluated
by stabilization of HLA expression on the antigen-processing
defective cell line T2 (see, e.g., Xue et al., Prostate 30:73-8
(1997) and Peshwa et al., Prostate 36:129-38 (1998)) Immunogenicity
of specific peptides can be evaluated in vitro by stimulation of
CD8+ cytotoxic T lymphocytes (CTL) in the presence of antigen
presenting cells such as dendritic cells.
[0190] It is to be appreciated that every epitope predicted by the
BIMAS site, Epimer.TM. and Epimatrix.TM. sites, or specified by the
HLA class I or class II motifs available in the art or which become
part of the art such as set forth in Table IV are to be "applied"
to the 161P2F10B protein. As used in this context "applied" means
that the 161P2F10B protein is evaluated, e.g., visually or by
computer-based patterns finding methods, as appreciated by those of
skill in the relevant art. Every subsequence of the 161P2F10B of 8,
9, 10, or 11 amino acid residues that bears an HLA Class I motif,
or a subsequence of 9 or more amino acid residues that bear an HLA
Class II motif are within the scope of the invention.
[0191] III.B.) Expression of 161P2F10B-Related Proteins
[0192] In an embodiment described in the examples that follow,
161P2F10B can be conveniently expressed in cells (such as 293T
cells) transfected with a commercially available expression vector
such as a CMV-driven expression vector encoding 161P2F10B with a
C-terminal 6.times.His and MYC tag (pcDNA3.1/mycHIS, Invitrogen or
TagS, GenHunter Corporation, Nashville Tenn.). The TagS vector
provides an IgG.kappa. secretion signal that can be used to
facilitate the production of a secreted 161P2F10B protein in
transfected cells. The secreted HIS-tagged 161P2F10B in the culture
media can be purified, e.g., using a nickel column using standard
techniques.
[0193] III.C.) Modifications of 161P2F10B-Related Proteins
[0194] Modifications of 161P2F10B-related proteins such as covalent
modifications are included within the scope of this invention. One
type of covalent modification includes reacting targeted amino acid
residues of a 161P2F10B polypeptide with an organic derivatizing
agent that is capable of reacting with selected side chains or the
N- or C-terminal residues of the 161P2F10B. Another type of
covalent modification of the 161P2F10B polypeptide included within
the scope of this invention comprises altering the native
glycosylation pattern of a protein of the invention. Another type
of covalent modification of 161P2F10B comprises linking the
161P2F10B polypeptide to one of a variety of nonproteinaceous
polymers, e.g., polyethylene glycol (PEG), polypropylene glycol, or
polyoxyalkylenes, in the manner set forth in U.S. Pat. Nos.
4,640,835; 4,496,689; 4,301,144; 4,670,417; 4,791,192 or
4,179,337.
[0195] The 161P2F10B-related proteins of the present invention can
also be modified to form a chimeric molecule comprising 161P2F10B
fused to another, heterologous polypeptide or amino acid sequence.
Such a chimeric molecule can be synthesized chemically or
recombinantly. A chimeric molecule can have a protein of the
invention fused to another tumor-associated antigen or fragment
thereof. Alternatively, a protein in accordance with the invention
can comprise a fusion of fragments of the 161P2F10B sequence (amino
or nucleic acid) such that a molecule is created that is not,
through its length, directly homologous to the amino or nucleic
acid sequences shown in FIG. 2 or FIG. 3. Such a chimeric molecule
can comprise multiples of the same subsequence of 161P2F10B. A
chimeric molecule can comprise a fusion of a 161P2F10B-related
protein with a polyhistidine epitope tag, which provides an epitope
to which immobilized nickel can selectively bind, with cytokines or
with growth factors. The epitope tag is generally placed at the
amino- or carboxyl- terminus of the 161P2F10B. In an alternative
embodiment, the chimeric molecule can comprise a fusion of a
161P2F10B-related protein with an immunoglobulin or a particular
region of an immunoglobulin. For a bivalent form of the chimeric
molecule (also referred to as an "immunoadhesin"), such a fusion
could be to the Fc region of an IgG molecule. The Ig fusions
preferably include the substitution of a soluble (transmembrane
domain deleted or inactivated) form of a 161P2F10B polypeptide in
place of at least one variable region within an Ig molecule. In a
preferred embodiment, the immunoglobulin fusion includes the hinge,
CH2 and CH3, or the hinge, CH1, CH2 and CH3 regions of an IgG1
molecule. For the production of immunoglobulin fusions see, e.g.,
U.S. Pat. No. 5,428,130 issued Jun. 27, 1995.
[0196] III.D.) Uses of 161P2F10B-Related Proteins
[0197] The proteins of the invention have a number of different
specific uses. As 161P2F10B is highly expressed in prostate and
other cancers, 161P2F10B-related proteins are used in methods that
assess the status of 161P2F10B gene products in normal versus
cancerous tissues, thereby elucidating the malignant phenotype.
Typically, polypeptides from specific regions of the 161P2F10B
protein are used to assess the presence of perturbations (such as
deletions, insertions, point mutations etc.) in those regions (such
as regions containing one or more motifs). Exemplary assays utilize
antibodies or T cells targeting 161P2F10B-related proteins
comprising the amino acid residues of one or more of the biological
motifs contained within the 161P2F10B polypeptide sequence in order
to evaluate the characteristics of this region in normal versus
cancerous tissues or to elicit an immune response to the epitope.
Alternatively, 161P2F10B-related proteins that contain the amino
acid residues of one or more of the biological motifs in the
161P2F10B protein are used to screen for factors that interact with
that region of 161P2F10B.
[0198] 161P2F10B protein fragments/subsequences are particularly
useful in generating and characterizing domain-specific antibodies
(e.g., antibodies recognizing an extracellular or intracellular
epitope of an 161P2F10B protein), for identifying agents or
cellular factors that bind to 161P2F10B or a particular structural
domain thereof, and in various therapeutic and diagnostic contexts,
including but not limited to diagnostic assays, cancer vaccines and
methods of preparing such vaccines.
[0199] Proteins encoded by the 161P2F10B genes, or by analogs,
homologs or fragments thereof, have a variety of uses, including
but not limited to generating antibodies and in methods for
identifying ligands and other agents and cellular constituents that
bind to an 161P2F10B gene product. Antibodies raised against an
161P2F10B protein or fragment thereof are useful in diagnostic and
prognostic assays, and imaging methodologies in the management of
human cancers characterized by expression of 161P2F10B protein,
such as those listed in Table I. Such antibodies can be expressed
intracellularly and used in methods of treating patients with such
cancers. 161P2F10B-related nucleic acids or proteins are also used
in generating HTL or CTL responses.
[0200] Various immunological assays useful for the detection of
161P2F10B proteins are used, including but not limited to various
types of radioimmunoassays, enzyme-linked immunosorbent assays
(ELISA), enzyme-linked immunofluorescent assays (ELIFA),
immunocytochemical methods, and the like. Antibodies can be labeled
and used as immunological imaging reagents capable of detecting
161P2F10B-expressing cells (e.g., in radio scintigraphic imaging
methods). 161P2F10B proteins are also particularly useful in
generating cancer vaccines, as further described herein.
IV.) 161P2F10B Antibodies
[0201] Another aspect of the invention provides antibodies that
bind to 161P2F10B-related proteins. Preferred antibodies
specifically bind to a 161P2F10B-related protein and do not bind
(or bind weakly) to peptides or proteins that are not
161P2F10B-related proteins. For example, antibodies that bind
161P2F10B can bind 161P2F10B-related proteins such as the homologs
or analogs thereof.
[0202] 161P2F10B antibodies of the invention are particularly
useful in cancer (see, e.g., Table I) diagnostic and prognostic
assays, and imaging methodologies. Similarly, such antibodies are
useful in the treatment, diagnosis, and/or prognosis of other
cancers, to the extent 161P2F10B is also expressed or overexpressed
in these other cancers. Moreover, intracellularly expressed
antibodies (e.g., single chain antibodies) are therapeutically
useful in treating cancers in which the expression of 161P2F10B is
involved, such as advanced or metastatic prostate cancers.
[0203] The invention also provides various immunological assays
useful for the detection and quantification of 161P2F10B and mutant
161P2F10B-related proteins. Such assays can comprise one or more
161P2F10B antibodies capable of recognizing and binding a
161P2F10B-related protein, as appropriate. These assays are
performed within various immunological assay formats well known in
the art, including but not limited to various types of
radioimmunoassays, enzyme-linked immunosorbent assays (ELISA),
enzyme-linked immunofluorescent assays (ELIFA), and the like.
[0204] Immunological non-antibody assays of the invention also
comprise T cell immunogenicity assays (inhibitory or stimulatory)
as well as major histocompatibility complex (MHC) binding
assays.
[0205] In addition, immunological imaging methods capable of
detecting prostate cancer and other cancers expressing 161P2F10B
are also provided by the invention, including but not limited to
radioscintigraphic imaging methods using labeled 161P2F10B
antibodies. Such assays are clinically useful in the detection,
monitoring, and prognosis of 161P2F10B expressing cancers such as
prostate cancer.
[0206] 161P2F10B antibodies are also used in methods for purifying
a 161P2F10B-related protein and for isolating 161P2F10B homologues
and related molecules. For example, a method of purifying a
161P2F10B-related protein comprises incubating an 161P2F10B
antibody, which has been coupled to a solid matrix, with a lysate
or other solution containing a 161P2F10B-related protein under
conditions that permit the 161P2F10B antibody to bind to the
161P2F10B-related protein; washing the solid matrix to eliminate
impurities; and eluting the 161P2F10B-related protein from the
coupled antibody. Other uses of the 161P2F10B antibodies of the
invention include generating anti-idiotypic antibodies that mimic
the 161P2F10B protein.
[0207] Various methods for the preparation of antibodies are well
known in the art. For example, antibodies can be prepared by
immunizing a suitable mammalian host using a 161P2F10B-related
protein, peptide, or fragment, in isolated or immunoconjugated form
(Antibodies: A Laboratory Manual, CSH Press, Eds., Harlow, and Lane
(1988); Harlow, Antibodies, Cold Spring Harbor Press, NY (1989)).
In addition, fusion proteins of 161P2F10B can also be used, such as
a 161P2F10B GST-fusion protein. In a particular embodiment, a GST
fusion protein comprising all or most of the amino acid sequence of
FIG. 2 or FIG. 3 is produced, then used as an immunogen to generate
appropriate antibodies. In another embodiment, a 161P2F10B-related
protein is synthesized and used as an immunogen.
[0208] In addition, naked DNA immunization techniques known in the
art are used (with or without purified 161P2F10B-related protein or
161P2F10B expressing cells) to generate an immune response to the
encoded immunogen (for review, see Donnelly et al., 1997, Ann Rev.
Immunol. 15: 617-648).
[0209] The amino acid sequence of 161P2F10B as shown in FIG. 2 or
FIG. 3 can be analyzed to select specific regions of the 161P2F10B
protein for generating antibodies. For example, hydrophobicity and
hydrophilicity analyses of the 161P2F10B amino acid sequence are
used to identify hydrophilic regions in the 161P2F10B structure.
Regions of the 161P2F10B protein that show immunogenic structure,
as well as other regions and domains, can readily be identified
using various other methods known in the art, such as Chou-Fasman,
Garnier-Robson, Kyte-Doolittle, Eisenberg, Karplus-Schultz or
Jameson-Wolf analysis. Thus, each region identified by any of these
programs or methods is within the scope of the present invention.
Methods for the generation of 161P2F10B antibodies are further
illustrated by way of the examples provided herein. Methods for
preparing a protein or polypeptide for use as an immunogen are well
known in the art. Also well known in the art are methods for
preparing immunogenic conjugates of a protein with a carrier, such
as BSA, KLH or other carrier protein. In some circumstances, direct
conjugation using, for example, carbodiimide reagents are used; in
other instances linking reagents such as those supplied by Pierce
Chemical Co., Rockford, Ill., are effective. Administration of a
161P2F10B immunogen is often conducted by injection over a suitable
time period and with use of a suitable adjuvant, as is understood
in the art. During the immunization schedule, titers of antibodies
can be taken to determine adequacy of antibody formation.
[0210] 161P2F10B monoclonal antibodies can be produced by various
means well known in the art. For example, immortalized cell lines
that secrete a desired monoclonal antibody are prepared using the
standard hybridoma technology of Kohler and Milstein or
modifications that immortalize antibody-producing B cells, as is
generally known Immortalized cell lines that secrete the desired
antibodies are screened by immunoassay in which the antigen is a
161P2F10B-related protein. When the appropriate immortalized cell
culture is identified, the cells can be expanded and antibodies
produced either from in vitro cultures or from ascites fluid.
[0211] The antibodies or fragments of the invention can also be
produced, by recombinant means. Regions that bind specifically to
the desired regions of the 161P2F10B protein can also be produced
in the context of chimeric or complementarity determining region
(CDR) grafted antibodies of multiple species origin. Humanized or
human 161P2F10B antibodies can also be produced, and are preferred
for use in therapeutic contexts. Methods for humanizing murine and
other non-human antibodies, by substituting one or more of the
non-human antibody CDRs for corresponding human antibody sequences,
are well known (see for example, Jones et al., 1986, Nature 321:
522-525; Riechmann et al., 1988, Nature 332: 323-327; Verhoeyen et
al., 1988, Science 239: 1534-1536). See also, Carter et al., 1993,
Proc. Natl. Acad. Sci. USA 89: 4285 and Sims et al., 1993, J.
Immunol. 151: 2296.
[0212] Methods for producing fully human monoclonal antibodies
include phage display and transgenic methods (for review, see
Vaughan et al., 1998, Nature Biotechnology 16: 535-539). Fully
human 161P2F10B monoclonal antibodies can be generated using
cloning technologies employing large human Ig gene combinatorial
libraries (i.e., phage display) (Griffiths and Hoogenboom, Building
an in vitro immune system: human antibodies from phage display
libraries. In: Protein Engineering of Antibody Molecules for
Prophylactic and Therapeutic Applications in Man, Clark, M. (Ed.),
Nottingham Academic, pp 45-64 (1993); Burton and Barbas, Human
Antibodies from combinatorial libraries. Id., pp 65-82). Fully
human 161P2F10B monoclonal antibodies can also be produced using
transgenic mice engineered to contain human immunoglobulin gene
loci as described in PCT Patent Application WO98/24893,
Kucherlapati and Jakobovits et al., published Dec. 3, 1997 (see
also, Jakobovits, 1998, Exp. Opin. Invest. Drugs 7(4): 607-614;
U.S. Pat. No. 6,162,963 issued 19 Dec. 2000; 6,150,584 issued 12
Nov. 2000; and, U.S. Pat. No. 6,114,598 issued 5 Sep. 2000). This
method avoids the in vitro manipulation required with phage display
technology and efficiently produces high affinity authentic human
antibodies.
[0213] Reactivity of 161P2F10B antibodies with an 161P2F10B-related
protein can be established by a number of well known means,
including Western blot, immunoprecipitation, ELISA, and FACS
analyses using, as appropriate, 161P2F10B-related proteins,
161P2F10B-expressing cells or extracts thereof. A 161P2F10B
antibody or fragment thereof can be labeled with a detectable
marker or conjugated to a second molecule. Suitable detectable
markers include, but are not limited to, a radioisotope, a
fluorescent compound, a bioluminescent compound, chemiluminescent
compound, a metal chelator or an enzyme. Further, bi-specific
antibodies specific for two or more 161P2F10B epitopes are
generated using methods generally known in the art. Homodimeric
antibodies can also be generated by cross-linking techniques known
in the art (e.g., Wolff et al., Cancer Res. 53: 2560-2565).
V.) 161P2F10B Cellular Immune Responses
[0214] The mechanism by which T cells recognize antigens has been
delineated. Efficacious peptide epitope vaccine compositions of the
invention induce a therapeutic or prophylactic immune responses in
very broad segments of the world-wide population. For an
understanding of the value and efficacy of compositions of the
invention that induce cellular immune responses, a brief review of
immunology-related technology is provided.
[0215] A complex of an HLA molecule and a peptidic antigen acts as
the ligand recognized by HLA-restricted T cells (Buus, S. et al.,
Cell 47:1071, 1986; Babbitt, B. P. et al., Nature 317:359, 1985;
Townsend, A. and Bodmer, H., Annu. Rev. Immunol. 7:601, 1989;
Germain, R. N., Annu. Rev. Immunol. 11:403, 1993). Through the
study of single amino acid substituted antigen analogs and the
sequencing of endogenously bound, naturally processed peptides,
critical residues that correspond to motifs required for specific
binding to HLA antigen molecules have been identified and are set
forth in Table IV (see also, e.g., Southwood, et al., J. Immunol.
160:3363, 1998; Rammensee, et al., Immunogenetics 41:178, 1995;
Rammensee et al., SYFPEITHI; Sette, A. and Sidney, J. Curr. Opin.
Immunol. 10:478, 1998; Engelhard, V. H., Curr. Opin. Immunol. 6:13,
1994; Sette, A. and Grey, H. M., Curr. Opin. Immunol. 4:79, 1992;
Sinigaglia, F. and Hammer, J. Curr. Biol. 6:52, 1994; Ruppert et
al., Cell 74:929-937, 1993; Kondo et al., J. Immunol.
155:4307-4312, 1995; Sidney et al., J. Immunol. 157:3480-3490,
1996; Sidney et al., Human Immunol. 45:79-93, 1996; Sette, A. and
Sidney, J. Immunogenetics 1999 November; 50(3-4):201-12,
Review).
[0216] Furthermore, x-ray crystallographic analyses of HLA-peptide
complexes have revealed pockets within the peptide binding
cleft/groove of HLA molecules which accommodate, in an
allele-specific mode, residues borne by peptide ligands; these
residues in turn determine the HLA binding capacity of the peptides
in which they are present. (See, e.g., Madden, D. R. Annu. Rev.
Immunol. 13:587, 1995; Smith, et al., Immunity 4:203, 1996; Fremont
et al., Immunity 8:305, 1998; Stern et al., Structure 2:245, 1994;
Jones, E. Y. Curr. Opin. Immunol. 9:75, 1997; Brown, J. H. et al.,
Nature 364:33, 1993; Guo, H. C. et al., Proc. Natl. Acad. Sci. USA
90:8053, 1993; Guo, H. C. et al., Nature 360:364, 1992; Silver, M.
L. et al., Nature 360:367, 1992; Matsumura, M. et al., Science
257:927, 1992; Madden et al., Cell 70:1035, 1992; Fremont, D. H. et
al., Science 257:919, 1992; Saper, M. A. , Bjorkman, P. J. and
Wiley, D. C., J. Mol. Biol. 219:277, 1991.)
[0217] Accordingly, the definition of class I and class II
allele-specific HLA binding motifs, or class I or class II
supermotifs allows identification of regions within a protein that
are correlated with binding to particular HLA antigen(s).
[0218] Thus, by a process of HLA motif identification, candidates
for epitope-based vaccines have been identified; such candidates
can be further evaluated by HLA-peptide binding assays to determine
binding affinity and/or the time period of association of the
epitope and its corresponding HLA molecule. Additional confirmatory
work can be performed to select, amongst these vaccine candidates,
epitopes with preferred characteristics in terms of population
coverage, and/or immunogenicity.
[0219] Various strategies can be utilized to evaluate cellular
immunogenicity, including:
[0220] 1) Evaluation of primary T cell cultures from normal
individuals (see, e.g., Wentworth, P. A. et al., Mol. Immunol.
32:603, 1995; Celis, E. et al., Proc. Natl. Acad. Sci. USA 91:2105,
1994; Tsai, V. et al., J. Immunol. 158:1796, 1997; Kawashima, I. et
al., Human Immunol. 59:1, 1998). This procedure involves the
stimulation of peripheral blood lymphocytes (PBL) from normal
subjects with a test peptide in the presence of antigen presenting
cells in vitro over a period of several weeks. T cells specific for
the peptide become activated during this time and are detected
using, e.g., a lymphokine- or .sup.51Cr-release assay involving
peptide sensitized target cells.
[0221] 2) Immunization of HLA transgenic mice (see, e.g.,
Wentworth, P. A. et al., J. Immunol. 26:97, 1996; Wentworth, P. A.
et al., Int. Immunol. 8:651, 1996; Alexander, J. et al., J.
Immunol. 159:4753, 1997). For example, in such methods peptides in
incomplete Freund's adjuvant are administered subcutaneously to HLA
transgenic mice. Several weeks following immunization, splenocytes
are removed and cultured in vitro in the presence of test peptide
for approximately one week. Peptide-specific T cells are detected
using, e.g., a .sup.51Cr-release assay involving peptide sensitized
target cells and target cells expressing endogenously generated
antigen.
[0222] 3) Demonstration of recall T cell responses from immune
individuals who have been either effectively vaccinated and/or from
chronically ill patients (see, e.g., Rehermann, B. et al., J. Exp.
Med. 181:1047, 1995; Doolan, D. L. et al., Immunity 7:97, 1997;
Bertoni, R. et al., J. Clin. Invest. 100:503, 1997; Threlkeld, S.
C. et al., J. Immunol. 159:1648, 1997; Diepolder, H. M. et al., J.
Virol. 71:6011, 1997). Accordingly, recall responses are detected
by culturing PBL from subjects that have been exposed to the
antigen due to disease and thus have generated an immune response
"naturally", or from patients who were vaccinated against the
antigen. PBL from subjects are cultured in vitro for 1-2 weeks in
the presence of test peptide plus antigen presenting cells (APC) to
allow activation of "memory" T cells, as compared to "naive" T
cells. At the end of the culture period, T cell activity is
detected using assays including .sup.51Cr release involving
peptide-sensitized targets, T cell proliferation, or lymphokine
release.
VI.) 161P2F10B Transgenic Animals
[0223] Nucleic acids that encode a 161P2F10B-related protein can
also be used to generate either transgenic animals or "knock
.sup.out animals which, in turn, are useful in the development and
screening of therapeutically useful reagents. In accordance with
established techniques, cDNA encoding 161P2F10B can be used to
clone genomic DNA that encodes 161P2F10B. The cloned genomic
sequences can then be used to generate transgenic animals
containing cells that express DNA that encode 161P2F10B. Methods
for generating transgenic animals, particularly animals such as
mice or rats, have become conventional in the art and are
described, for example, in U.S. Pat. No. 4,736,866 issued 12 Apr.
1988, and U.S. Pat. No. 4,870,009 issued 26 Sep. 1989. Typically,
particular cells would be targeted for 161P2F10B transgene
incorporation with tissue-specific enhancers.
[0224] Transgenic animals that include a copy of a transgene
encoding 161P2F10B can be used to examine the effect of increased
expression of DNA that encodes 161P2F10B. Such animals can be used
as tester animals for reagents thought to confer protection from,
for example, pathological conditions associated with its
overexpression. In accordance with this aspect of the invention, an
animal is treated with a reagent and a reduced incidence of a
pathological condition, compared to untreated animals that bear the
transgene, would indicate a potential therapeutic intervention for
the pathological condition.
[0225] Alternatively, non-human homologues of 161P2F10B can be used
to construct a 161P2F10B "knock .sup.out animal that has a
defective or altered gene encoding 161P2F10B as a result of
homologous recombination between the endogenous gene encoding
161P2F10B and altered genomic DNA encoding 161P2F10B introduced
into an embryonic cell of the animal. For example, cDNA that
encodes 161P2F10B can be used to clone genomic DNA encoding
161P2F10B in accordance with established techniques. A portion of
the genomic DNA encoding 161P2F10B can be deleted or replaced with
another gene, such as a gene encoding a selectable marker that can
be used to monitor integration. Typically, several kilobases of
unaltered flanking DNA (both at the 5' and 3' ends) are included in
the vector (see, e.g., Thomas and Capecchi, Cell, 51:503 (1987) for
a description of homologous recombination vectors). The vector is
introduced into an embryonic stem cell line (e.g., by
electroporation) and cells in which the introduced DNA has
homologously recombined with the endogenous DNA are selected (see,
e.g.,, Li et al., Cell, 69:915 (1992)). The selected cells are then
injected into a blastocyst of an animal (e.g., a mouse or rat) to
form aggregation chimeras (see, e.g.,, Bradley, in Teratocarcinomas
and Embryonic Stem Cells: A Practical Approach, E. J. Robertson,
ed. (IRL, Oxford, 1987), pp. 113-152). A chimeric embryo can then
be implanted into a suitable pseudopregnant female foster animal,
and the embryo brought to term to create a "knock out" animal.
Progeny harboring the homologously recombined DNA in their germ
cells can be identified by standard techniques and used to breed
animals in which all cells of the animal contain the homologously
recombined DNA. Knock out animals can be characterized, for
example, for their ability to defend against certain pathological
conditions or for their development of pathological conditions due
to absence of the 161P2F10B polypeptide.
VII.) Methods for the Detection of 161P2F10B
[0226] Another aspect of the present invention relates to methods
for detecting 161P2F10B polynucleotides and 161P2F10B-related
proteins, as well as methods for identifying a cell that expresses
161P2F10B. The expression profile of 161P2F10B makes it a
diagnostic marker for metastasized disease. Accordingly, the status
of 161P2F10B gene products provides information useful for
predicting a variety of factors including susceptibility to
advanced stage disease, rate of progression, and/or tumor
aggressiveness. As discussed in detail herein, the status of
161P2F10B gene products in patient samples can be analyzed by a
variety protocols that are well known in the art including
immunohistochemical analysis, the variety of Northern blotting
techniques including in situ hybridization, RT-PCR analysis (for
example on laser capture micro-dissected samples), Western blot
analysis and tissue array analysis.
[0227] More particularly, the invention provides assays for the
detection of 161P2F10B polynucleotides in a biological sample, such
as serum, bone, prostate, and other tissues, urine, semen, cell
preparations, and the like. Detectable 161P2F10B polynucleotides
include, for example, a 161P2F10B gene or fragment thereof,
161P2F10B mRNA, alternative splice variant 161P2F10B mRNAs, and
recombinant DNA or RNA molecules that contain a 161P2F10B
polynucleotide. A number of methods for amplifying and/or detecting
the presence of 161P2F10B polynucleotides are well known in the art
and can be employed in the practice of this aspect of the
invention.
[0228] In one embodiment, a method for detecting an 161P2F10B mRNA
in a biological sample comprises producing cDNA from the sample by
reverse transcription using at least one primer; amplifying the
cDNA so produced using an 161P2F10B polynucleotides as sense and
antisense primers to amplify 161P2F10B cDNAs therein; and detecting
the presence of the amplified 161P2F10B cDNA. Optionally, the
sequence of the amplified 161P2F10B cDNA can be determined.
[0229] In another embodiment, a method of detecting a 161P2F10B
gene in a biological sample comprises first isolating genomic DNA
from the sample; amplifying the isolated genomic DNA using
161P2F10B polynucleotides as sense and antisense primers; and
detecting the presence of the amplified 161P2F10B gene. Any number
of appropriate sense and antisense probe combinations can be
designed from the nucleotide sequence provided for the 161P2F10B
(FIG. 2) and used for this purpose.
[0230] The invention also provides assays for detecting the
presence of an 161P2F10B protein in a tissue or other biological
sample such as serum, semen, bone, prostate, urine, cell
preparations, and the like. Methods for detecting a
161P2F10B-related protein are also well known and include, for
example, immunoprecipitation, immunohistochemical analysis, Western
blot analysis, molecular binding assays, ELISA, ELIFA and the like.
For example, a method of detecting the presence of a
161P2F10B-related protein in a biological sample comprises first
contacting the sample with a 161P2F10B antibody, a
161P2F10B-reactive fragment thereof, or a recombinant protein
containing an antigen binding region of a 161P2F10B antibody; and
then detecting the binding of 161P2F10B-related protein in the
sample.
[0231] Methods for identifying a cell that expresses 161P2F10B are
also within the scope of the invention. In one embodiment, an assay
for identifying a cell that expresses a 161P2F10B gene comprises
detecting the presence of 161P2F10B mRNA in the cell. Methods for
the detection of particular mRNAs in cells are well known and
include, for example, hybridization assays using complementary DNA
probes (such as in situ hybridization using labeled 161P2F10B
riboprobes, Northern blot and related techniques) and various
nucleic acid amplification assays (such as RT-PCR using
complementary primers specific for 161P2F10B, and other
amplification type detection methods, such as, for example,
branched DNA, SISBA, TMA and the like). Alternatively, an assay for
identifying a cell that expresses a 161P2F10B gene comprises
detecting the presence of 161P2F10B-related protein in the cell or
secreted by the cell. Various methods for the detection of proteins
are well known in the art and are employed for the detection of
161P2F10B-related proteins and cells that express 161P2F10B-related
proteins.
[0232] 161P2F10B expression analysis is also useful as a tool for
identifying and evaluating agents that modulate 161P2F10B gene
expression. For example, 161P2F10B expression is significantly
upregulated in prostate cancer, and is expressed in cancers of the
tissues listed in Table I. Identification of a molecule or
biological agent that inhibits 161P2F10B expression or
over-expression in cancer cells is of therapeutic value. For
example, such an agent can be identified by using a screen that
quantifies 161P2F10B expression by RT-PCR, nucleic acid
hybridization or antibody binding.
VIII.) Methods for Monitoring the Status of 161P2F10B-related Genes
and Their Products
[0233] Oncogenesis is known to be a multistep process where
cellular growth becomes progressively dysregulated and cells
progress from a normal physiological state to precancerous and then
cancerous states (see, e.g., Alers et al., Lab Invest. 77(5):
437-438 (1997) and Isaacs et al., Cancer Surv. 23: 19-32 (1995)).
In this context, examining a biological sample for evidence of
dysregulated cell growth (such as aberrant 161P2F10B expression in
cancers) allows for early detection of such aberrant physiology,
before a pathologic state such as cancer has progressed to a stage
that therapeutic options are more limited and or the prognosis is
worse. In such examinations, the status of 161P2F10B in a
biological sample of interest can be compared, for example, to the
status of 161P2F10B in a corresponding normal sample (e.g. a sample
from that individual or alternatively another individual that is
not affected by a pathology). An alteration in the status of
161P2F10B in the biological sample (as compared to the normal
sample) provides evidence of dysregulated cellular growth. In
addition to using a biological sample that is not affected by a
pathology as a normal sample, one can also use a predetermined
normative value such as a predetermined normal level of mRNA
expression (see, e.g., Greyer et al., J. Comp. Neurol. 1996 Dec.
9;376(2):306-14 and U.S. Pat. No. 5,837,501) to compare 161P2F10B
status in a sample.
[0234] The term "status" in this context is used according to its
art accepted meaning and refers to the condition or state of a gene
and its products. Typically, skilled artisans use a number of
parameters to evaluate the condition or state of a gene and its
products. These include, but are not limited to the location of
expressed gene products (including the location of 161P2F10B
expressing cells) as well as the level, and biological activity of
expressed gene products (such as 161P2F10B mRNA, polynucleotides
and polypeptides). Typically, an alteration in the status of
161P2F10B comprises a change in the location of 161P2F10B and/or
161P2F10B expressing cells and/or an increase in 161P2F10B mRNA
and/or protein expression.
[0235] 161P2F10B status in a sample can be analyzed by a number of
means well known in the art, including without limitation,
immunohistochemical analysis, in situ hybridization, RT-PCR
analysis on laser capture micro-dissected samples, Western blot
analysis, and tissue array analysis. Typical protocols for
evaluating the status of the 161P2F10B gene and gene products are
found, for example in Ausubel et al. eds., 1995, Current Protocols
In Molecular Biology, Units 2 (Northern Blotting), 4 (Southern
Blotting), 15 (Immunoblotting) and 18 (PCR Analysis). Thus, the
status of 161P2F10B in a biological sample is evaluated by various
methods utilized by skilled artisans including, but not limited to
genomic Southern analysis (to examine, for example perturbations in
the 161P2F10B gene), Northern analysis and/or PCR analysis of
161P2F10B mRNA (to examine, for example alterations in the
polynucleotide sequences or expression levels of 161P2F10B mRNAs),
and, Western and/or immunohistochemical analysis (to examine, for
example alterations in polypeptide sequences, alterations in
polypeptide localization within a sample, alterations in expression
levels of 161P2F10B proteins and/or associations of 161P2F10B
proteins with polypeptide binding partners). Detectable 161P2F10B
polynucleotides include, for example, a 161P2F10B gene or fragment
thereof, 161P2F10B mRNA, alternative splice variants, 161P2F10B
mRNAs, and recombinant DNA or RNA molecules containing a 161P2F10B
polynucleotide.
[0236] The expression profile of 161P2F10B makes it a diagnostic
marker for local and/or metastasized disease, and provides
information on the growth or oncogenic potential of a biological
sample. In particular, the status of 161P2F10B provides information
useful for predicting susceptibility to particular disease stages,
progression, and/or tumor aggressiveness. The invention provides
methods and assays for determining 161P2F10B status and diagnosing
cancers that express 161P2F10B, such as cancers of the tissues
listed in Table I. For example, because 161P2F10B mRNA is so highly
expressed in prostate and other cancers relative to normal prostate
tissue, assays that evaluate the levels of 161P2F10B mRNA
transcripts or proteins in a biological sample can be used to
diagnose a disease associated with 161P2F10B dysregulation, and can
provide prognostic information useful in defining appropriate
therapeutic options.
[0237] The expression status of 161P2F10B provides information
including the presence, stage and location of dysplastic,
precancerous and cancerous cells, predicting susceptibility to
various stages of disease, and/or for gauging tumor aggressiveness.
Moreover, the expression profile makes it useful as an imaging
reagent for metastasized disease. Consequently, an aspect of the
invention is directed to the various molecular prognostic and
diagnostic methods for examining the status of 161P2F10B in
biological samples such as those from individuals suffering from,
or suspected of suffering from a pathology characterized by
dysregulated cellular growth, such as cancer.
[0238] As described above, the status of 161P2F10B in a biological
sample can be examined by a number of well-known procedures in the
art. For example, the status of 161P2F10B in a biological sample
taken from a specific location in the body can be examined by
evaluating the sample for the presence or absence of 161P2F10B
expressing cells (e.g. those that express 161P2F10B mRNAs or
proteins). This examination can provide evidence of dysregulated
cellular growth, for example, when 161P2F10B-expressing cells are
found in a biological sample that does not normally contain such
cells (such as a lymph node), because such alterations in the
status of 161P2F10B in a biological sample are often associated
with dysregulated cellular growth. Specifically, one indicator of
dysregulated cellular growth is the metastases of cancer cells from
an organ of origin (such as the prostate) to a different area of
the body (such as a lymph node). In this context, evidence of
dysregulated cellular growth is important for example because
occult lymph node metastases can be detected in a substantial
proportion of patients with prostate cancer, and such metastases
are associated with known predictors of disease progression (see,
e.g., Murphy et al., Prostate 42(4): 315-317 (2000); Su et al.,
Semin Surg. Oncol. 18(1): 17-28 (2000) and Freeman et al., J Urol
1995 August 154(2 Pt 1):474-8).
[0239] In one aspect, the invention provides methods for monitoring
161P2F10B gene products by determining the status of 161P2F10B gene
products expressed by cells from an individual suspected of having
a disease associated with dysregulated cell growth (such as
hyperplasia or cancer) and then comparing the status so determined
to the status of 161P2F10B gene products in a corresponding normal
sample. The presence of aberrant 161P2F10B gene products in the
test sample relative to the normal sample provides an indication of
the presence of dysregulated cell growth within the cells of the
individual.
[0240] In another aspect, the invention provides assays useful in
determining the presence of cancer in an individual, comprising
detecting a significant increase in 161P2F10B mRNA or protein
expression in a test cell or tissue sample relative to expression
levels in the corresponding normal cell or tissue. The presence of
161P2F10B mRNA can, for example, be evaluated in tissue samples
including but not limited to those listed in Table I. The presence
of significant 161P2F10B expression in any of these tissues is
useful to indicate the emergence, presence and/or severity of a
cancer, since the corresponding normal tissues do not express
161P2F10B mRNA or express it at lower levels.
[0241] In a related embodiment, 161P2F10B status is determined at
the protein level rather than at the nucleic acid level. For
example, such a method comprises determining the level of 161P2F10B
protein expressed by cells in a test tissue sample and comparing
the level so determined to the level of 161P2F10B expressed in a
corresponding normal sample. In one embodiment, the presence of
161P2F10B protein is evaluated, for example, using
immunohistochemical methods. 161P2F10B antibodies or binding
partners capable of detecting 161P2F10B protein expression are used
in a variety of assay formats well known in the art for this
purpose.
[0242] In a further embodiment, one can evaluate the status of
161P2F10B nucleotide and amino acid sequences in a biological
sample in order to identify perturbations in the structure of these
molecules. These perturbations can include insertions, deletions,
substitutions and the like. Such evaluations are useful because
perturbations in the nucleotide and amino acid sequences are
observed in a large number of proteins associated with a growth
dysregulated phenotype (see, e.g., Marrogi et al., 1999, J. Cutan.
Pathol. 26(8):369-378). For example, a mutation in the sequence of
161P2F10B may be indicative of the presence or promotion of a
tumor. Such assays therefore have diagnostic and predictive value
where a mutation in 161P2F10B indicates a potential loss of
function or increase in tumor growth.
[0243] A wide variety of assays for observing perturbations in
nucleotide and amino acid sequences are well known in the art. For
example, the size and structure of nucleic acid or amino acid
sequences of 161P2F10B gene products are observed by the Northern,
Southern, Western, PCR and DNA sequencing protocols discussed
herein. In addition, other methods for observing perturbations in
nucleotide and amino acid sequences such as single strand
conformation polymorphism analysis are well known in the art (see,
e.g., U.S. Pat. No. 5,382,510 issued 7 Sep. 1999, and U.S. Pat. No.
5,952,170 issued 17 Jan. 1995).
[0244] Additionally, one can examine the methylation status of the
161P2F10B gene in a biological sample. Aberrant demethylation
and/or hypermethylation of CpG islands in gene 5' regulatory
regions frequently occurs in immortalized and transformed cells,
and can result in altered expression of various genes. For example,
promoter hypermethylation of the pi-class glutathione S-transferase
(a protein expressed in normal prostate but not expressed in
>90% of prostate carcinomas) appears to permanently silence
transcription of this gene and is the most frequently detected
genomic alteration in prostate carcinomas (De Marzo et al., Am. J.
Pathol. 155(6): 1985-1992 (1999)). In addition, this alteration is
present in at least 70% of cases of high-grade prostatic
intraepithelial neoplasia (PIN) (Brooks et al, Cancer Epidemiol.
Biomarkers Prey., 1998, 7:531-536). In another example, expression
of the LAGE-I tumor specific gene (which is not expressed in normal
prostate but is expressed in 25-50% of prostate cancers) is induced
by deoxy-azacytidine in lymphoblastoid cells, suggesting that
tumoral expression is due to demethylation (Lethe et al., Int. J.
Cancer 76(6): 903-908 (1998)). A variety of assays for examining
methylation status of a gene are well known in the art. For
example, one can utilize, in Southern hybridization approaches,
methylation-sensitive restriction enzymes which cannot cleave
sequences that contain methylated CpG sites to assess the
methylation status of CpG islands. In addition, MSP (methylation
specific PCR) can rapidly profile the methylation status of all the
CpG sites present in a CpG island of a given gene. This procedure
involves initial modification of DNA by sodium bisulfite (which
will convert all unmethylated cytosines to uracil) followed by
amplification using primers specific for methylated versus
unmethylated DNA. Protocols involving methylation interference can
also be found for example in Current Protocols In Molecular
Biology, Unit 12, Frederick M. Ausubel et al. eds., 1995.
[0245] Gene amplification is an additional method for assessing the
status of 161P2F10B. Gene amplification is measured in a sample
directly, for example, by conventional Southern blotting or
Northern blotting to quantitate the transcription of mRNA (Thomas,
1980, Proc. Natl. Acad. Sci. USA, 77:5201-5205), dot blotting (DNA
analysis), or in situ hybridization, using an appropriately labeled
probe, based on the sequences provided herein. Alternatively,
antibodies are employed that recognize specific duplexes, including
DNA duplexes, RNA duplexes, and DNA-RNA hybrid duplexes or
DNA-protein duplexes. The antibodies in turn are labeled and the
assay carried out where the duplex is bound to a surface, so that
upon the formation of duplex on the surface, the presence of
antibody bound to the duplex can be detected.
[0246] Biopsied tissue or peripheral blood can be conveniently
assayed for the presence of cancer cells using for example,
Northern, dot blot or RT-PCR analysis to detect 161P2F10B
expression. The presence of RT-PCR amplifiable 161P2F10B mRNA
provides an indication of the presence of cancer. RT-PCR assays are
well known in the art. RT-PCR detection assays for tumor cells in
peripheral blood are currently being evaluated for use in the
diagnosis and management of a number of human solid tumors. In the
prostate cancer field, these include RT-PCR assays for the
detection of cells expressing PSA and PSM (Verkaik et al., 1997,
Urol. Res. 25:373-384; Ghossein et al., 1995, J. Clin. Oncol.
13:1195-2000; Heston et al., 1995, Clin. Chem. 41:1687-1688).
[0247] A further aspect of the invention is an assessment of the
susceptibility that an individual has for developing cancer. In one
embodiment, a method for predicting susceptibility to cancer
comprises detecting 161P2F10B mRNA or 161P2F10B protein in a tissue
sample, its presence indicating susceptibility to cancer, wherein
the degree of 161P2F10B mRNA expression correlates to the degree of
susceptibility. In a specific embodiment, the presence of 161P2F10B
in prostate or other tissue is examined, with the presence of
161P2F10B in the sample providing an indication of prostate cancer
susceptibility (or the emergence or existence of a prostate tumor).
Similarly, one can evaluate the integrity 161P2F10B nucleotide and
amino acid sequences in a biological sample, in order to identify
perturbations in the structure of these molecules such as
insertions, deletions, substitutions and the like. The presence of
one or more perturbations in 161P2F10B gene products in the sample
is an indication of cancer susceptibility (or the emergence or
existence of a tumor).
[0248] The invention also comprises methods for gauging tumor
aggressiveness. In one embodiment, a method for gauging
aggressiveness of a tumor comprises determining the level of
161P2F10B mRNA or 161P2F10B protein expressed by tumor cells,
comparing the level so determined to the level of 161P2F10B mRNA or
161P2F10B protein expressed in a corresponding normal tissue taken
from the same individual or a normal tissue reference sample,
wherein the degree of 161P2F10B mRNA or 161P2F10B protein
expression in the tumor sample relative to the normal sample
indicates the degree of aggressiveness. In a specific embodiment,
aggressiveness of a tumor is evaluated by determining the extent to
which 161P2F10B is expressed in the tumor cells, with higher
expression levels indicating more aggressive tumors. Another
embodiment is the evaluation of the integrity of 161P2F10B
nucleotide and amino acid sequences in a biological sample, in
order to identify perturbations in the structure of these molecules
such as insertions, deletions, substitutions and the like. The
presence of one or more perturbations indicates more aggressive
tumors.
[0249] Another embodiment of the invention is directed to methods
for observing the progression of a malignancy in an individual over
time. In one embodiment, methods for observing the progression of a
malignancy in an individual over time comprise determining the
level of 161P2F10B mRNA or 161P2F10B protein expressed by cells in
a sample of the tumor, comparing the level so determined to the
level of 161P2F10B mRNA or 161P2F10B protein expressed in an
equivalent tissue sample taken from the same individual at a
different time, wherein the degree of 161P2F10B mRNA or 161P2F10B
protein expression in the tumor sample over time provides
information on the progression of the cancer. In a specific
embodiment, the progression of a cancer is evaluated by determining
161P2F10B expression in the tumor cells over time, where increased
expression over time indicates a progression of the cancer. Also,
one can evaluate the integrity 161P2F10B nucleotide and amino acid
sequences in a biological sample in order to identify perturbations
in the structure of these molecules such as insertions, deletions,
substitutions and the like, where the presence of one or more
perturbations indicates a progression of the cancer.
[0250] The above diagnostic approaches can be combined with any one
of a wide variety of prognostic and diagnostic protocols known in
the art. For example, another embodiment of the invention is
directed to methods for observing a coincidence between the
expression of 161P2F10B gene and 161P2F10B gene products (or
perturbations in 161P2F10B gene and 161P2F10B gene products) and a
factor that is associated with malignancy, as a means for
diagnosing and prognosticating the status of a tissue sample. A
wide variety of factors associated with malignancy can be utilized,
such as the expression of genes associated with malignancy (e.g.
PSA, PSCA and PSM expression for prostate cancer etc.) as well as
gross cytological observations (see, e.g., Bocking et al., 1984,
Anal. Quant. Cytol. 6(2):74-88; Epstein, 1995, Hum. Pathol.
26(2):223-9; Thorson et al., 1998, Mod. Pathol. 11(6):543-51;
Baisden et al., 1999, Am. J. Surg. Pathol. 23(8):918-24). Methods
for observing a coincidence between the expression of 161P2F10B
gene and 161P2F10B gene products (or perturbations in 161P2F10B
gene and 161P2F10B gene products) and another factor that is
associated with malignancy are useful, for example, because the
presence of a set of specific factors that coincide with disease
provides information crucial for diagnosing and prognosticating the
status of a tissue sample.
[0251] In one embodiment, methods for observing a coincidence
between the expression of 161P2F10B gene and 161P2F10B gene
products (or perturbations in 161P2F10B gene and 161P2F10B gene
products) and another factor associated with malignancy entails
detecting the overexpression of 161P2F10B mRNA or protein in a
tissue sample, detecting the overexpression of PSA mRNA or protein
in a tissue sample (or PSCA or PSM expression), and observing a
coincidence of 161P2F10B mRNA or protein and PSA mRNA or protein
overexpression (or PSCA or PSM expression). In a specific
embodiment, the expression of 161P2F10B and PSA mRNA in prostate
tissue is examined, where the coincidence of 161P2F10B and PSA mRNA
overexpression in the sample indicates the existence of prostate
cancer, prostate cancer susceptibility or the emergence or status
of a prostate tumor.
[0252] Methods for detecting and quantifying the expression of
161P2F10B mRNA or protein are described herein, and standard
nucleic acid and protein detection and quantification technologies
are well known in the art. Standard methods for the detection and
quantification of 161P2F10B mRNA include in situ hybridization
using labeled 161P2F10B riboprobes, Northern blot and related
techniques using 161P2F10B polynucleotide probes, RT-PCR analysis
using primers specific for 161P2F10B, and other amplification type
detection methods, such as, for example, branched DNA, SISBA, TMA
and the like. In a specific embodiment, semi-quantitative RT-PCR is
used to detect and quantify 161P2F10B mRNA expression. Any number
of primers capable of amplifying 161P2F10B can be used for this
purpose, including but not limited to the various primer sets
specifically described herein. In a specific embodiment, polyclonal
or monoclonal antibodies specifically reactive with the wild-type
161P2F10B protein can be used in an immunohistochemical assay of
biopsied tissue.
IX.) Identification of Molecules that Interact with 161P2F10B
[0253] The 161P2F10B protein and nucleic acid sequences disclosed
herein allow a skilled artisan to identify proteins, small
molecules and other agents that interact with 161P2F10B, as well as
pathways activated by 161P2F10B via any one of a variety of art
accepted protocols. For example, one can utilize one of the
so-called interaction trap systems (also referred to as the
"two-hybrid assay"). In such systems, molecules interact and
reconstitute a transcription factor which directs expression of a
reporter gene, whereupon the expression of the reporter gene is
assayed. Other systems identify protein-protein interactions in
vivo through reconstitution of a eukaryotic transcriptional
activator, see, e.g., U.S. Pat. No. 5,955,280 issued 21 Sep. 1999,
U.S. Pat. No. 5,925,523 issued 20 Jul. 1999, U.S. Pat. No.
5,846,722 issued 8 Dec. 1998 and U.S. Pat. No. 6,004,746 issued 21
Dec. 1999. Algorithms are also available in the art for
genome-based predictions of protein function (see, e.g., Marcotte,
et al., Nature 402: 4 Nov. 1999, 83-86).
[0254] Alternatively one can screen peptide libraries to identify
molecules that interact with 161P2F10B protein sequences. In such
methods, peptides that bind to 161P2F10B are identified by
screening libraries that encode a random or controlled collection
of amino acids. Peptides encoded by the libraries are expressed as
fusion proteins of bacteriophage coat proteins, the bacteriophage
particles are then screened against the 161P2F10B protein.
[0255] Accordingly, peptides having a wide variety of uses, such as
therapeutic, prognostic or diagnostic reagents, are thus identified
without any prior information on the structure of the expected
ligand or receptor molecule. Typical peptide libraries and
screening methods that can be used to identify molecules that
interact with 161P2F10B protein sequences are disclosed for example
in U.S. Pat. No. 5,723,286 issued 3 Mar. 1998 and U.S. Pat. No.
5,733,731 issued 31 Mar. 1998.
[0256] Alternatively, cell lines that express 161P2F10B are used to
identify protein-protein interactions mediated by 161P2F10B. Such
interactions can be examined using immunoprecipitation techniques
(see, e.g., Hamilton B. J., et al. Biochem. Biophys. Res. Commun
1999, 261:646-51). 161P2F10B protein can be immunoprecipitated from
161P2F10B-expressing cell lines using anti-161P2F10B antibodies.
Alternatively, antibodies against His-tag can be used in a cell
line engineered to express fusions of 161P2F10B and a His-tag
(vectors mentioned above). The immunoprecipitated complex can be
examined for protein association by procedures such as Western
blotting, .sup.35S-methionine labeling of proteins, protein
microsequencing, silver staining and two-dimensional gel
electrophoresis.
[0257] Small molecules and ligands that interact with 161P2F10B can
be identified through related embodiments of such screening assays.
For example, small molecules can be identified that interfere with
protein function, including molecules that interfere with
161P2F10B's ability to mediate phosphorylation and
de-phosphorylation, interaction with DNA or RNA molecules as an
indication of regulation of cell cycles, second messenger signaling
or tumorigenesis. Similarly, small molecules that modulate
161P2F10B-related ion channel, protein pump, or cell communication
functions are identified and used to treat patients that have a
cancer that expresses 161P2F10B (see, e.g., Hille, B., Ionic
Channels of Excitable Membranes 2.sup.nd Ed., Sinauer Assoc.,
Sunderland, Mass., 1992). Moreover, ligands that regulate 161P2F10B
function can be identified based on their ability to bind 161P2F10B
and activate a reporter construct. Typical methods are discussed
for example in U.S. Pat. No. 5,928,868 issued 27 Jul. 1999, and
include methods for forming hybrid ligands in which at least one
ligand is a small molecule. In an illustrative embodiment, cells
engineered to express a fusion protein of 161P2F10B and a
DNA-binding protein are used to co-express a fusion protein of a
hybrid ligand/small molecule and a cDNA library transcriptional
activator protein. The cells further contain a reporter gene, the
expression of which is conditioned on the proximity of the first
and second fusion proteins to each other, an event that occurs only
if the hybrid ligand binds to target sites on both hybrid proteins.
Those cells that express the reporter gene are selected and the
unknown small molecule or the unknown ligand is identified. This
method provides a means of identifying modulators which activate or
inhibit 161P2F10B.
[0258] An embodiment of this invention comprises a method of
screening for a molecule that interacts with an 161P2F10B amino
acid sequence shown in FIG. 2 or FIG. 3, comprising the steps of
contacting a population of molecules with the 161P2F10B amino acid
sequence, allowing the population of molecules and the 161P2F10B
amino acid sequence to interact under conditions that facilitate an
interaction, determining the presence of a molecule that interacts
with the 161P2F10B amino acid sequence, and then separating
molecules that do not interact with the 161P2F10B amino acid
sequence from molecules that do. In a specific embodiment, the
method further comprises purifying, characterizing and identifying
a molecule that interacts with the 161P2F10B amino acid sequence.
The identified molecule can be used to modulate a function
performed by 161P2F10B. In a preferred embodiment, the 161P2F10B
amino acid sequence is contacted with a library of peptides.
X.) Therapeutic Methods and Compositions
[0259] The identification of 161P2F10B as a protein that is
normally expressed in a restricted set of tissues, but which is
also expressed in prostate and other cancers, opens a number of
therapeutic approaches to the treatment of such cancers. As
contemplated herein, 161P2F10B functions as a transcription factor
involved in activating tumor-promoting genes or repressing genes
that block tumorigenesis.
[0260] Accordingly, therapeutic approaches that inhibit the
activity of the 161P2F10B protein are useful for patients suffering
from a cancer that expresses 161P2F10B. These therapeutic
approaches generally fall into two classes. One class comprises
various methods for inhibiting the binding or association of the
161P2F10B protein with its binding partner or with other proteins.
Another class comprises a variety of methods for inhibiting the
transcription of the 161P2F10B gene or translation of 161P2F10B
mRNA.
[0261] X.A.) Anti-Cancer Vaccines
[0262] The invention provides cancer vaccines comprising a
161P2F10B-related protein or 161P2F10B-related nucleic acid. In
view of the expression of 161P2F10B, cancer vaccines prevent and/or
treat 161P2F10B-expressing cancers with minimal or no effects on
non-target tissues. The use of a tumor antigen in a vaccine that
generates humoral and/or cell-mediated immune responses as
anti-cancer therapy is well known in the art and has been employed
in prostate cancer using human PSMA and rodent PAP immunogens
(Hodge et al., 1995, Int. J. Cancer 63:231-237; Fong et al., 1997,
J. Immunol. 159:3113-3117).
[0263] Such methods can be readily practiced by employing a
161P2F10B-related protein, or an 161P2F10B-encoding nucleic acid
molecule and recombinant vectors capable of expressing and
presenting the 161P2F10B immunogen (which typically comprises a
number of antibody or T cell epitopes). Skilled artisans understand
that a wide variety of vaccine systems for delivery of
immunoreactive epitopes are known in the art (see, e.g., Heryln et
al., Ann Med 1999 February 31(1):66-78; Maruyama et al., Cancer
Immunol Immunother 2000 June 49(3):123-32) Briefly, such methods of
generating an immune response (e.g. humoral and/or cell-mediated)
in a mammal, comprise the steps of: exposing the mammal's immune
system to an immunoreactive epitope (e.g. an epitope present in the
161P2F10B protein shown in SEQ ID NO: 703 or analog or homolog
thereof) so that the mammal generates an immune response that is
specific for that epitope (e.g. generates antibodies that
specifically recognize that epitope). In a preferred method, the
161P2F10B immunogen contains a biological motif, see e.g., Tables
V-XVIII, or a peptide of a size range from 161P2F10B indicated in
FIG. 5, FIG. 6, FIG. 7, FIG. 8, and FIG. 9.
[0264] The entire 161P2F10B protein, immunogenic regions or
epitopes thereof can be combined and delivered by various means.
Such vaccine compositions can include, for example, lipopeptides
(e.g., Vitiello, A. et al., J. Clin. Invest. 95:341, 1995), peptide
compositions encapsulated in poly(DL-lactide-co-glycolide) ("PLG")
microspheres (see, e.g., Eldridge, et al., Molec. Immunol.
28:287-294, 1991: Alonso et al., Vaccine 12:299-306, 1994; Jones et
al., Vaccine 13:675-681, 1995), peptide compositions contained in
immune stimulating complexes (ISCOMS) (see, e.g., Takahashi et al.,
Nature 344:873-875, 1990; Hu et al., Clin Exp Immunol. 113:235-243,
1998), multiple antigen peptide systems (MAPs) (see e.g., Tam, J.
P., Proc. Natl. Acad. Sci. U.S.A. 85:5409-5413, 1988; Tam, J. P.,
J. Immunol. Methods 196:17-32, 1996), peptides formulated as
multivalent peptides; peptides for use in ballistic delivery
systems, typically crystallized peptides, viral delivery vectors
(Perkus, M. E. et al., In: Concepts in vaccine development,
Kaufmann, S. H. E., ed., p. 379, 1996; Chakrabarti, S. et al.,
Nature 320:535, 1986; Hu, S. L. et al., Nature 320:537, 1986;
Kieny, M.-P. et al., AIDS Bio/Technology 4:790, 1986; Top, F. H. et
al., J. Infect. Dis. 124:148, 1971; Chanda, P. K. et al., Virology
175:535, 1990), particles of viral or synthetic origin (e.g.,
Kofler, N. et al., J. Immunol. Methods. 192:25, 1996; Eldridge, J.
H. et al., Sem. Hematol. 30:16, 1993; Falo, L. D., Jr. et al.,
Nature Med. 7:649, 1995), adjuvants (Warren, H. S., Vogel, F. R.,
and Chedid, L. A. Annu. Rev. Immunol. 4:369, 1986; Gupta, R. K. et
al., Vaccine 11:293, 1993), liposomes (Reddy, R. et al., J.
Immunol. 148:1585, 1992; Rock, K. L., Immunol. Today 17:131, 1996),
or, naked or particle absorbed cDNA (Ulmer, J. B. et al., Science
259:1745, 1993; Robinson, H. L., Hunt, L. A., and Webster, R. G.,
Vaccine 11:957, 1993; Shiver, J. W. et al., In: Concepts in vaccine
development, Kaufmann, S. H. E., ed., p. 423, 1996; Cease, K. B.,
and Berzofsky, J. A., Annu. Rev. Immunol. 12:923, 1994 and
Eldridge, J. H. et al., Sem. Hematol. 30:16, 1993). Toxin-targeted
delivery technologies, also known as receptor mediated targeting,
such as those of Avant Immunotherapeutics, Inc. (Needham, Mass.)
may also be used.
[0265] In patients with 161P2F10B-associated cancer, the vaccine
compositions of the invention can also be used in conjunction with
other treatments used for cancer, e.g., surgery, chemotherapy, drug
therapies, radiation therapies, etc. including use in combination
with immune adjuvants such as IL-2, IL-12, GM-CSF, and the
like.
[0266] Cellular Vaccines
[0267] CTL epitopes can be determined using specific algorithms to
identify peptides within 161P2F10B protein that bind corresponding
HLA alleles (see e.g., Table IV; Epimer.TM. and Epimatrix.TM.,
Brown University; and, BIMAS. In a preferred embodiment, the
161P2F10B immunogen contains one or more amino acid sequences
identified using techniques well known in the art, such as the
sequences shown in Tables V-XVIII or a peptide of 8, 9, 10 or 11
amino acids specified by an HLA Class I motif/supermotif (e.g.,
Table IV (A), Table IV (D), or Table IV (E)) and/or a peptide of at
least 9 amino acids that comprises an HLA Class II motif/supermotif
(e.g., Table IV (B) or Table IV (C)). As is appreciated in the art,
the HLA Class I binding groove is essentially closed ended so that
peptides of only a particular size range can fit into the groove
and be bound, generally HLA Class I epitopes are 8, 9, 10, or 11
amino acids long. In contrast, the HLA Class II binding groove is
essentially open ended; therefore a peptide of about 9 or more
amino acids can be bound by an HLA Class II molecule. Due to the
binding groove differences between HLA Class I and II, HLA Class I
motifs are length specific, i.e., position two of a Class I motif
is the second amino acid in an amino to carboxyl direction of the
peptide. The amino acid positions in a Class II motif are relative
only to each other, not the overall peptide, i.e., additional amino
acids can be attached to the amino and/or carboxyl termini of a
motif-bearing sequence. HLA Class II epitopes are often 9, 10, 11,
12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 amino
acids long, or longer than 25 amino acids.
[0268] Antibody-Based Vaccines
[0269] A wide variety of methods for generating an immune response
in a mammal are known in the art (for example as the first step in
the generation of hybridomas). Methods of generating an immune
response in a mammal comprise exposing the mammal's immune system
to an immunogenic epitope on a protein (e.g. the 161P2F10B protein)
so that an immune response is generated. A typical embodiment
consists of a method for generating an immune response to 161P2F10B
in a host, by contacting the host with a sufficient amount of at
least one 161P2F10B B cell or cytotoxic T-cell epitope or analog
thereof; and at least one periodic interval thereafter
re-contacting the host with the 161P2F10B B cell or cytotoxic
T-cell epitope or analog thereof. A specific embodiment consists of
a method of generating an immune response against a
161P2F10B-related protein or a man-made multiepitopic peptide
comprising: administering 161P2F10B immunogen (e.g. the 161P2F10B
protein or a peptide fragment thereof, an 161P2F10B fusion protein
or analog etc.) in a vaccine preparation to a human or another
mammal. Typically, such vaccine preparations further contain a
suitable adjuvant (see, e.g., U.S. Pat. No. 6,146,635) or a
universal helper epitope such as a PADRE (Epimmune Inc., San Diego,
Calif.; see, e.g., Alexander et al., J. Immunol. 2000 164(3);
164(3): 1625-1633; Alexander et al., Immunity 1994 1(9): 751-761
and Alexander et al., Immunol. Res. 1998 18(2): 79-92). An
alternative method comprises generating an immune response in an
individual against a 161P2F10B immunogen by: administering in vivo
to muscle or skin of the individual's body a DNA molecule that
comprises a DNA sequence that encodes an 161P2F10B immunogen, the
DNA sequence operatively linked to regulatory sequences which
control the expression of the DNA sequence; wherein the DNA
molecule is taken up by cells, the DNA sequence is expressed in the
cells and an immune response is generated against the immunogen
(see, e.g., U.S. Pat. No. 5,962,428). Optionally a genetic vaccine
facilitator such as anionic lipids; saponins; lectins; estrogenic
compounds; hydroxylated lower alkyls; dimethyl sulfoxide; and urea
is also administered. In addition, an antiidiotypic antibody can be
administered that mimics 161P2F10B, in order to generate a response
to the target antigen.
[0270] Nucleic Acid Vaccines:
[0271] Vaccine compositions of the invention include nucleic
acid-mediated modalities. DNA or RNA that encode protein(s) of the
invention can be administered to a patient. Genetic immunization
methods can be employed to generate prophylactic or therapeutic
humoral and cellular immune responses directed against cancer cells
expressing 161P2F10B. Constructs comprising DNA encoding a
161P2F10B-related protein/immunogen and appropriate regulatory
sequences can be injected directly into muscle or skin of an
individual, such that the cells of the muscle or skin take-up the
construct and express the encoded 161P2F10B protein/immunogen.
Alternatively, a vaccine comprises a 161P2F10B-related protein.
Expression of the 161P2F10B-related protein immunogen results in
the generation of prophylactic or therapeutic humoral and cellular
immunity against cells that bear 161P2F10B protein. Various
prophylactic and therapeutic genetic immunization techniques known
in the art can be used. Nucleic acid-based delivery is described,
for instance, in Wolff et. al., Science 247:1465 (1990) as well as
U.S. Pat. Nos. 5,580,859; 5,589,466; 5,804,566; 5,739,118;
5,736,524; 5,679,647; WO 98/04720. Examples of DNA-based delivery
technologies include "naked DNA", facilitated (bupivicaine,
polymers, peptide-mediated) delivery, cationic lipid complexes, and
particle-mediated ("gene gun") or pressure-mediated delivery (see,
e.g., U.S. Pat. No. 5,922,687).
[0272] For therapeutic or prophylactic immunization purposes,
proteins of the invention can be expressed via viral or bacterial
vectors. Various viral gene delivery systems that can be used in
the practice of the invention include, but are not limited to,
vaccinia, fowlpox, canarypox, adenovirus, influenza, poliovirus,
adeno-associated virus, lentivirus, and sindbis virus (see, e.g.,
Restifo, 1996, Curr. Opin. Immunol. 8:658-663; Tsang et al. J.
Natl. Cancer Inst. 87:982-990 (1995)). Non-viral delivery systems
can also be employed by introducing naked DNA encoding a
161P2F10B-related protein into the patient (e.g., intramuscularly
or intradermally) to induce an anti-tumor response.
[0273] Vaccinia virus is used, for example, as a vector to express
nucleotide sequences that encode the peptides of the invention.
Upon introduction into a host, the recombinant vaccinia virus
expresses the protein immunogenic peptide, and thereby elicits a
host immune response. Vaccinia vectors and methods useful in
immunization protocols are described in, e.g., U.S. Pat. No.
4,722,848. Another vector is BCG (Bacille Calmette Guerin). BCG
vectors are described in Stover et al., Nature 351:456-460 (1991).
A wide variety of other vectors useful for therapeutic
administration or immunization of the peptides of the invention,
e.g. adeno and adeno-associated virus vectors, retroviral vectors,
Salmonella typhi vectors, detoxified anthrax toxin vectors, and the
like, will be apparent to those skilled in the art from the
description herein.
[0274] Thus, gene delivery systems are used to deliver a
161P2F10B-related nucleic acid molecule. In one embodiment, the
full-length human 161P2F10B cDNA is employed. In another
embodiment, 161P2F10B nucleic acid molecules encoding specific
cytotoxic T lymphocyte (CTL) and/or antibody epitopes are
employed.
[0275] Ex Vivo Vaccines
[0276] Various ex vivo strategies can also be employed to generate
an immune response. One approach involves the use of antigen
presenting cells (APCs) such as dendritic cells (DC) to present
161P2F10B antigen to a patient's immune system. Dendritic cells
express MHC class I and II molecules, B7 co-stimulator, and IL-12,
and are thus highly specialized antigen presenting cells. In
prostate cancer, autologous dendritic cells pulsed with peptides of
the prostate-specific membrane antigen (PSMA) are being used in a
Phase I clinical trial to stimulate prostate cancer patients'
immune systems (Tjoa et al., 1996, Prostate 28:65-69; Murphy et
al., 1996, Prostate 29:371-380). Thus, dendritic cells can be used
to present 161P2F10B peptides to T cells in the context of MHC
class I or II molecules. In one embodiment, autologous dendritic
cells are pulsed with 161P2F10B peptides capable of binding to MHC
class I and/or class II molecules. In another embodiment, dendritic
cells are pulsed with the complete 161P2F10B protein. Yet another
embodiment involves engineering the overexpression of the 161P2F10B
gene in dendritic cells using various implementing vectors known in
the art, such as adenovirus (Arthur et al., 1997, Cancer Gene Ther.
4:17-25), retrovirus (Henderson et al., 1996, Cancer Res.
56:3763-3770), lentivirus, adeno-associated virus, DNA transfection
(Ribas et al., 1997, Cancer Res. 57:2865-2869), or tumor-derived
RNA transfection (Ashley et al., 1997, J. Exp. Med. 186:1177-1182).
Cells that express 161P2F10B can also be engineered to express
immune modulators, such as GM-CSF, and used as immunizing
agents.
[0277] X.B.) 161P2F10B as a Target for Antibody-Based Therapy
[0278] 161P2F10B is an attractive target for antibody-based
therapeutic strategies. A number of antibody strategies are known
in the art for targeting both extracellular and intracellular
molecules (see, e.g., complement and ADCC mediated killing as well
as the use of intrabodies). Because 161P2F10B is expressed by
cancer cells of various lineages relative to corresponding normal
cells, systemic administration of 161P2F10B-immunoreactive
compositions are prepared that exhibit excellent sensitivity
without toxic, non-specific and/or non-target effects caused by
binding of the immunoreactive composition to non-target organs and
tissues. Antibodies specifically reactive with domains of 161P2F10B
are useful to treat 161P2F10B-expressing cancers systemically,
either as conjugates with a toxin or therapeutic agent, or as naked
antibodies capable of inhibiting cell proliferation or
function.
[0279] 161P2F10B antibodies can be introduced into a patient such
that the antibody binds to 161P2F10B and modulates a function, such
as an interaction with a binding partner, and consequently mediates
destruction of the tumor cells and/or inhibits the growth of the
tumor cells. Mechanisms by which such antibodies exert a
therapeutic effect can include complement-mediated cytolysis,
antibody-dependent cellular cytotoxicity, modulation of the
physiological function of 161P2F10B, inhibition of ligand binding
or signal transduction pathways, modulation of tumor cell
differentiation, alteration of tumor angiogenesis factor profiles,
and/or apoptosis.
[0280] Those skilled in the art understand that antibodies can be
used to specifically target and bind immunogenic molecules such as
an immunogenic region of the 161P2F10B sequence shown in FIG. 2 or
FIG. 3. In addition, skilled artisans understand that it is routine
to conjugate antibodies to cytotoxic agents (see, e.g., Slevers et
al. Blood 93:11 3678-3684 (Jun. 1, 1999)). When cytotoxic and/or
therapeutic agents are delivered directly to cells, such as by
conjugating them to antibodies specific for a molecule expressed by
that cell (e.g. 161P2F10B), the cytotoxic agent will exert its
known biological effect (i.e. cytotoxicity) on those cells.
[0281] A wide variety of compositions and methods for using
antibody-cytotoxic agent conjugates to kill cells are known in the
art. In the context of cancers, typical methods entail
administering to an animal having a tumor a biologically effective
amount of a conjugate comprising a selected cytotoxic and/or
therapeutic agent linked to a targeting agent (e.g. an
anti-161P2F10B antibody) that binds to a marker (e.g. 161P2F10B)
expressed, accessible to binding or localized on the cell surfaces.
A typical embodiment is a method of delivering a cytotoxic and/or
therapeutic agent to a cell expressing 161P2F10B, comprising
conjugating the cytotoxic agent to an antibody that
immunospecifically binds to a 161P2F10B epitope, and, exposing the
cell to the antibody-agent conjugate. Another illustrative
embodiment is a method of treating an individual suspected of
suffering from metastasized cancer, comprising a step of
administering parenterally to said individual a pharmaceutical
composition comprising a therapeutically effective amount of an
antibody conjugated to a cytotoxic and/or therapeutic agent.
[0282] Cancer immunotherapy using anti-161P2F10B antibodies can be
done in accordance with various approaches that have been
successfully employed in the treatment of other types of cancer,
including but not limited to colon cancer (Arlen et al., 1998,
Crit. Rev. Immunol. 18:133-138), multiple myeloma (Ozaki et al.,
1997, Blood 90:3179-3186, Tsunenari et al., 1997, Blood
90:2437-2444), gastric cancer (Kasprzyk et al., 1992, Cancer Res.
52:2771-2776), B-cell lymphoma (Funakoshi et al., 1996, J.
Immunother. Emphasis Tumor Immunol. 19:93-101), leukemia (Zhong et
al., 1996, Leuk. Res. 20:581-589), colorectal cancer (Moun et al.,
1994, Cancer Res. 54:6160-6166; Velders et al., 1995, Cancer Res.
55:4398-4403), and breast cancer (Shepard et al., 1991, J. Clin.
Immunol. 11:117-127). Some therapeutic approaches involve
conjugation of naked antibody to a toxin, such as the conjugation
of Y.sup.91 or I.sup.131 to anti-CD20 antibodies (e.g.,
Zevalin.TM., IDEC Pharmaceuticals Corp. or Bexxar.TM., Coulter
Pharmaceuticals), while others involve co-administration of
antibodies and other therapeutic agents, such as Herceptin.TM.
(trastuzumab) with paclitaxel (Genentech, Inc.). The antibodies can
be conjugated to a therapeutic agent. To treat prostate cancer, for
example, 161P2F10B antibodies can be administered in conjunction
with radiation, chemotherapy or hormone ablation.
[0283] Although 161P2F10B antibody therapy is useful for all stages
of cancer, antibody therapy can be particularly appropriate in
advanced or metastatic cancers. Treatment with the antibody therapy
of the invention is indicated for patients who have received one or
more rounds of chemotherapy. Alternatively, antibody therapy of the
invention is combined with a chemotherapeutic or radiation regimen
for patients who have not received chemotherapeutic treatment.
Additionally, antibody therapy can enable the use of reduced
dosages of concomitant chemotherapy, particularly for patients who
do not tolerate the toxicity of the chemotherapeutic agent very
well.
[0284] Cancer patients can be evaluated for the presence and level
of 161P2F10B expression, preferably using immunohistochemical
assessments of tumor tissue, quantitative 161P2F10B imaging, or
other techniques that reliably indicate the presence and degree of
161P2F10B expression Immunohistochemical analysis of tumor biopsies
or surgical specimens is preferred for this purpose. Methods for
immunohistochemical analysis of tumor tissues are well known in the
art.
[0285] Anti-161P2F10B monoclonal antibodies that treat prostate and
other cancers include those that initiate a potent immune response
against the tumor or those that are directly cytotoxic. In this
regard, anti-161P2F10B monoclonal antibodies (mAbs) can elicit
tumor cell lysis by either complement-mediated or
antibody-dependent cell cytotoxicity (ADCC) mechanisms, both of
which require an intact Fc portion of the immunoglobulin molecule
for interaction with effector cell Fc receptor sites on complement
proteins. In addition, anti-161P2F10B mAbs that exert a direct
biological effect on tumor growth are useful to treat cancers that
express 161P2F10B. Mechanisms by which directly cytotoxic mAbs act
include: inhibition of cell growth, modulation of cellular
differentiation, modulation of tumor angiogenesis factor profiles,
and the induction of apoptosis. The mechanism(s) by which a
particular anti-161P2F10B mAb exerts an anti-tumor effect is
evaluated using any number of in vitro assays that evaluate cell
death such as ADCC, ADMMC, complement-mediated cell lysis, and so
forth, as is generally known in the art.
[0286] In some patients, the use of murine or other non-human
monoclonal antibodies, or human/mouse chimeric mAbs can induce
moderate to strong immune responses against the non-human antibody.
This can result in clearance of the antibody from circulation and
reduced efficacy. In the most severe cases, such an immune response
can lead to the extensive formation of immune complexes which,
potentially, can cause renal failure. Accordingly, preferred
monoclonal antibodies used in the therapeutic methods of the
invention are those that are either fully human or humanized and
that bind specifically to the target 161P2F10B antigen with high
affinity but exhibit low or no antigenicity in the patient.
[0287] Therapeutic methods of the invention contemplate the
administration of single anti-161P2F10B mAbs as well as
combinations, or cocktails, of different mAbs. Such mAb cocktails
can have certain advantages inasmuch as they contain mAbs that
target different epitopes, exploit different effector mechanisms or
combine directly cytotoxic mAbs with mAbs that rely on immune
effector functionality. Such mAbs in combination can exhibit
synergistic therapeutic effects. In addition, anti-161P2F10B mAbs
can be administered concomitantly with other therapeutic
modalities, including but not limited to various chemotherapeutic
agents, androgen-blockers, immune modulators (e.g., IL-2, GM-CSF),
surgery or radiation. The anti-161P2F10B mAbs are administered in
their "naked" or unconjugated form, or can have a therapeutic
agent(s) conjugated to them.
[0288] Anti-161P2F10B antibody formulations are administered via
any route capable of delivering the antibodies to a tumor cell.
Routes of administration include, but are not limited to,
intravenous, intraperitoneal, intramuscular, intratumor,
intradermal, and the like. Treatment generally involves repeated
administration of the anti-161P2F10B antibody preparation, via an
acceptable route of administration such as intravenous injection
(IV), typically at a dose in the range of about 0.1, 0.2, 0.3, 0.4,
0.5, 0.6, 0.7, 0.8, 0.9., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, or
25 mg/kg body weight. In general, doses in the range of 10-1000 mg
mAb per week are effective and well tolerated.
[0289] Based on clinical experience with the Herceptin.TM. mAb in
the treatment of metastatic breast cancer, an initial loading dose
of approximately 4 mg/kg patient body weight IV, followed by weekly
doses of about 2 mg/kg IV of the anti-161P2F10B mAb preparation
represents an acceptable dosing regimen. Preferably, the initial
loading dose is administered as a 90 minute or longer infusion. The
periodic maintenance dose is administered as a 30 minute or longer
infusion, provided the initial dose was well tolerated. As
appreciated by those of skill in the art, various factors can
influence the ideal dose regimen in a particular case. Such factors
include, for example, the binding affinity and half life of the Ab
or mAbs used, the degree of 161P2F10B expression in the patient,
the extent of circulating shed 161P2F10B antigen, the desired
steady-state antibody concentration level, frequency of treatment,
and the influence of chemotherapeutic or other agents used in
combination with the treatment method of the invention, as well as
the health status of a particular patient.
[0290] Optionally, patients should be evaluated for the levels of
161P2F10B in a given sample (e.g. the levels of circulating
161P2F10B antigen and/or 161P2F10B expressing cells) in order to
assist in the determination of the most effective dosing regimen,
etc. Such evaluations are also used for monitoring purposes
throughout therapy, and are useful to gauge therapeutic success in
combination with the evaluation of other parameters (for example,
urine cytology and/or ImmunoCyt levels in bladder cancer therapy,
or by analogy, serum PSA levels in prostate cancer therapy).
[0291] Anti-idiotypic anti-161P2F10B antibodies can also be used in
anti-cancer therapy as a vaccine for inducing an immune response to
cells expressing a 161P2F10B-related protein. In particular, the
generation of anti-idiotypic antibodies is well known in the art;
this methodology can readily be adapted to generate anti-idiotypic
anti-161P2F10B antibodies that mimic an epitope on a
161P2F10B-related protein (see, for example, Wagner et al., 1997,
Hybridoma 16: 33-40; Foon et al., 1995, J. Clin. Invest.
96:334-342; Herlyn et al., 1996, Cancer Immunol. Immunother.
43:65-76). Such an anti-idiotypic antibody can be used in cancer
vaccine strategies.
[0292] X.C.) 161P2F10B as a Target for Cellular Immune
Responses
[0293] Vaccines and methods of preparing vaccines that contain an
immunogenically effective amount of one or more HLA-binding
peptides as described herein are further embodiments of the
invention. Furthermore, vaccines in accordance with the invention
encompass compositions of one or more of the claimed peptides. A
peptide can be present in a vaccine individually. Alternatively,
the peptide can exist as a homopolymer comprising multiple copies
of the same peptide, or as a heteropolymer of various peptides.
Polymers have the advantage of increased immunological reaction
and, where different peptide epitopes are used to make up the
polymer, the additional ability to induce antibodies and/or CTLs
that react with different antigenic determinants of the pathogenic
organism or tumor-related peptide targeted for an immune response.
The composition can be a naturally occurring region of an antigen
or can be prepared, e.g., recombinantly or by chemical
synthesis.
[0294] Carriers that can be used with vaccines of the invention are
well known in the art, and include, e.g., thyroglobulin, albumins
such as human serum albumin, tetanus toxoid, polyamino acids such
as poly L-lysine, poly L-glutamic acid, influenza, hepatitis B
virus core protein, and the like. The vaccines can contain a
physiologically tolerable (i.e., acceptable) diluent such as water,
or saline, preferably phosphate buffered saline. The vaccines also
typically include an adjuvant. Adjuvants such as incomplete
Freund's adjuvant, aluminum phosphate, aluminum hydroxide, or alum
are examples of materials well known in the art. Additionally, as
disclosed herein, CTL responses can be primed by conjugating
peptides of the invention to lipids, such as
tripalmitoyl-S-glycerylcysteinlyseryl-serine (P.sub.3CSS).
Moreover, an adjuvant such as a synthetic
cytosine-phosphorothiolated-guanine-containing (CpG)
oligonucleotides has been found to increase CTL responses 10- to
100-fold. (see, e.g. Davila and Celis J. Immunol. 165:539-547
(2000))
[0295] Upon immunization with a peptide composition in accordance
with the invention, via injection, aerosol, oral, transdermal,
transmucosal, intrapleural, intrathecal, or other suitable routes,
the immune system of the host responds to the vaccine by producing
large amounts of CTLs and/or HTLs specific for the desired antigen.
Consequently, the host becomes at least partially immune to later
development of cells that express or overexpress 161P2F10B antigen,
or derives at least some therapeutic benefit when the antigen was
tumor-associated.
[0296] In some embodiments, it may be desirable to combine the
class I peptide components with components that induce or
facilitate neutralizing antibody and or helper T cell responses
directed to the target antigen. A preferred embodiment of such a
composition comprises class I and class II epitopes in accordance
with the invention. An alternative embodiment of such a composition
comprises a class I and/or class II epitope in accordance with the
invention, along with a cross reactive HTL epitope such as
PADRE.TM. (Epimmune, San Diego, Calif.) molecule (described e.g.,
in U.S. Pat. No. 5,736,142).
[0297] A vaccine of the invention can also include
antigen-presenting cells (APC), such as dendritic cells (DC), as a
vehicle to present peptides of the invention. Vaccine compositions
can be created in vitro, following dendritic cell mobilization and
harvesting, whereby loading of dendritic cells occurs in vitro. For
example, dendritic cells are transfected, e.g., with a minigene in
accordance with the invention, or are pulsed with peptides. The
dendritic cell can then be administered to a patient to elicit
immune responses in vivo. Vaccine compositions, either DNA- or
peptide-based, can also be administered in vivo in combination with
dendritic cell mobilization whereby loading of dendritic cells
occurs in vivo.
[0298] Preferably, the following principles are utilized when
selecting an array of epitopes for inclusion in a polyepitopic
composition for use in a vaccine, or for selecting discrete
epitopes to be included in a vaccine and/or to be encoded by
nucleic acids such as a minigene. It is preferred that each of the
following principles be balanced in order to make the selection.
The multiple epitopes to be incorporated in a given vaccine
composition may be, but need not be, contiguous in sequence in the
native antigen from which the epitopes are derived.
[0299] 1.) Epitopes are selected which, upon administration, mimic
immune responses that have been observed to be correlated with
tumor clearance. For HLA Class I this includes 3-4 epitopes that
come from at least one tumor associated antigen (TAA). For HLA
Class II a similar rationale is employed; again 3-4 epitopes are
selected from at least one TAA (see, e.g., Rosenberg et al.,
Science 278:1447-1450). Epitopes from one TAA may be used in
combination with epitopes from one or more additional TAAs to
produce a vaccine that targets tumors with varying expression
patterns of frequently-expressed TAAs.
[0300] 2.) Epitopes are selected that have the requisite binding
affinity established to be correlated with immunogenicity: for HLA
Class I an IC.sub.50 of 500 nM or less, often 200 nM or less; and
for Class II an IC.sub.50 of 1000 nM or less.
[0301] 3.) Sufficient supermotif bearing-peptides, or a sufficient
array of allele-specific motif-bearing peptides, are selected to
give broad population coverage. For example, it is preferable to
have at least 80% population coverage. A Monte Carlo analysis, a
statistical evaluation known in the art, can be employed to assess
the breadth, or redundancy of, population coverage.
[0302] 4.) When selecting epitopes from cancer-related antigens it
is often useful to select analogs because the patient may have
developed tolerance to the native epitope.
[0303] 5.) Of particular relevance are epitopes referred to as
"nested epitopes." Nested epitopes occur where at least two
epitopes overlap in a given peptide sequence. A nested peptide
sequence can comprise B cell, HLA class I and/or HLA class II
epitopes. When providing nested epitopes, a general objective is to
provide the greatest number of epitopes per sequence. Thus, an
aspect is to avoid providing a peptide that is any longer than the
amino terminus of the amino terminal epitope and the carboxyl
terminus of the carboxyl terminal epitope in the peptide. When
providing a multi-epitopic sequence, such as a sequence comprising
nested epitopes, it is generally important to screen the sequence
in order to insure that it does not have pathological or other
deleterious biological properties.
[0304] 6.) If a polyepitopic protein is created, or when creating a
minigene, an objective is to generate the smallest peptide that
encompasses the epitopes of interest. This principle is similar, if
not the same as that employed when selecting a peptide comprising
nested epitopes. However, with an artificial polyepitopic peptide,
the size minimization objective is balanced against the need to
integrate any spacer sequences between epitopes in the polyepitopic
protein. Spacer amino acid residues can, for example, be introduced
to avoid junctional epitopes (an epitope recognized by the immune
system, not present in the target antigen, and only created by the
man-made juxtaposition of epitopes), or to facilitate cleavage
between epitopes and thereby enhance epitope presentation.
Junctional epitopes are generally to be avoided because the
recipient may generate an immune response to that non-native
epitope. Of particular concern is a junctional epitope that is a
"dominant epitope." A dominant epitope may lead to such a zealous
response that immune responses to other epitopes are diminished or
suppressed.
[0305] 7.) Where the sequences of multiple variants of the same
target protein are present, potential peptide epitopes can also be
selected on the basis of their conservancy. For example, a
criterion for conservancy may define that the entire sequence of an
HLA class I binding peptide or the entire 9-mer core of a class II
binding peptide be conserved in a designated percentage of the
sequences evaluated for a specific protein antigen.
[0306] X.C.1.) Minigene Vaccines
[0307] A number of different approaches are available which allow
simultaneous delivery of multiple epitopes. Nucleic acids encoding
the peptides of the invention are a particularly useful embodiment
of the invention. Epitopes for inclusion in a minigene are
preferably selected according to the guidelines set forth in the
previous section. A preferred means of administering nucleic acids
encoding the peptides of the invention uses minigene constructs
encoding a peptide comprising one or multiple epitopes of the
invention.
[0308] The use of multi-epitope minigenes is described below and
in, Ishioka et al., J. Immunol. 162:3915-3925, 1999; An, L. and
Whitton, J. L., J. Virol. 71:2292, 1997; Thomson, S. A. et al., J.
Immunol. 157:822, 1996; Whitton, J. L. et al., J. Virol. 67:348,
1993; Hanke, R. et al., Vaccine 16:426, 1998. For example, a
multi-epitope DNA plasmid encoding supermotif- and/or motif-bearing
epitopes derived 161P2F10B, the PADRE.RTM. universal helper T cell
epitope (or multiple HTL epitopes from 161P2F10B), and an
endoplasmic reticulum-translocating signal sequence can be
engineered. A vaccine may also comprise epitopes that are derived
from other TAAs.
[0309] The immunogenicity of a multi-epitopic minigene can be
confirmed in transgenic mice to evaluate the magnitude of CTL
induction responses against the epitopes tested. Further, the
immunogenicity of DNA-encoded epitopes in vivo can be correlated
with the in vitro responses of specific CTL lines against target
cells transfected with the DNA plasmid. Thus, these experiments can
show that the minigene serves to both: 1.) generate a CTL response
and 2.) that the induced CTLs recognized cells expressing the
encoded epitopes.
[0310] For example, to create a DNA sequence encoding the selected
epitopes (minigene) for expression in human cells, the amino acid
sequences of the epitopes may be reverse translated. A human codon
usage table can be used to guide the codon choice for each amino
acid. These epitope-encoding DNA sequences may be directly
adjoined, so that when translated, a continuous polypeptide
sequence is created. To optimize expression and/or immunogenicity,
additional elements can be incorporated into the minigene design.
Examples of amino acid sequences that can be reverse translated and
included in the minigene sequence include: HLA class I epitopes,
HLA class II epitopes, antibody epitopes, a ubiquitination signal
sequence, and/or an endoplasmic reticulum targeting signal. In
addition, HLA presentation of CTL and HTL epitopes may be improved
by including synthetic (e.g. poly-alanine) or naturally-occurring
flanking sequences adjacent to the CTL or HTL epitopes; these
larger peptides comprising the epitope(s) are within the scope of
the invention.
[0311] The minigene sequence may be converted to DNA by assembling
oligonucleotides that encode the plus and minus strands of the
minigene. Overlapping oligonucleotides (30-100 bases long) may be
synthesized, phosphorylated, purified and annealed under
appropriate conditions using well known techniques. The ends of the
oligonucleotides can be joined, for example, using T4 DNA ligase.
This synthetic minigene, encoding the epitope polypeptide, can then
be cloned into a desired expression vector.
[0312] Standard regulatory sequences well known to those of skill
in the art are preferably included in the vector to ensure
expression in the target cells. Several vector elements are
desirable: a promoter with a down-stream cloning site for minigene
insertion; a polyadenylation signal for efficient transcription
termination; an E. coli origin of replication; and an E. coli
selectable marker (e.g. ampicillin or kanamycin resistance).
Numerous promoters can be used for this purpose, e.g., the human
cytomegalovirus (hCMV) promoter. See, e.g., U.S. Pat. Nos.
5,580,859 and 5,589,466 for other suitable promoter sequences.
[0313] Additional vector modifications may be desired to optimize
minigene expression and immunogenicity. In some cases, introns are
required for efficient gene expression, and one or more synthetic
or naturally-occurring introns could be incorporated into the
transcribed region of the minigene. The inclusion of mRNA
stabilization sequences and sequences for replication in mammalian
cells may also be considered for increasing minigene
expression.
[0314] Once an expression vector is selected, the minigene is
cloned into the polylinker region downstream of the promoter. This
plasmid is transformed into an appropriate E. coli strain, and DNA
is prepared using standard techniques. The orientation and DNA
sequence of the minigene, as well as all other elements included in
the vector, are confirmed using restriction mapping and DNA
sequence analysis. Bacterial cells harboring the correct plasmid
can be stored as a master cell bank and a working cell bank.
[0315] In addition, immunostimulatory sequences (ISSs or CpGs)
appear to play a role in the immunogenicity of DNA vaccines. These
sequences may be included in the vector, outside the minigene
coding sequence, if desired to enhance immunogenicity.
[0316] In some embodiments, a bi-cistronic expression vector which
allows production of both the minigene-encoded epitopes and a
second protein (included to enhance or decrease immunogenicity) can
be used. Examples of proteins or polypeptides that could
beneficially enhance the immune response if co-expressed include
cytokines (e.g., IL-2, IL-12, GM-CSF), cytokine-inducing molecules
(e.g., LeIF), costimulatory molecules, or for HTL responses, pan-DR
binding proteins (PADRE.TM., Epimmune, San Diego, Calif.). Helper
(HTL) epitopes can be joined to intracellular targeting signals and
expressed separately from expressed CTL epitopes; this allows
direction of the HTL epitopes to a cell compartment different than
that of the CTL epitopes. If required, this could facilitate more
efficient entry of HTL epitopes into the HLA class II pathway,
thereby improving HTL induction. In contrast to HTL or CTL
induction, specifically decreasing the immune response by
co-expression of immunosuppressive molecules (e.g. TGF-.beta.) may
be beneficial in certain diseases.
[0317] Therapeutic quantities of plasmid DNA can be produced for
example, by fermentation in E. coli, followed by purification.
Aliquots from the working cell bank are used to inoculate growth
medium, and grown to saturation in shaker flasks or a bioreactor
according to well-known techniques. Plasmid DNA can be purified
using standard bioseparation technologies such as solid phase
anion-exchange resins supplied by QIAGEN, Inc. (Valencia, Calif.).
If required, supercoiled DNA can be isolated from the open circular
and linear forms using gel electrophoresis or other methods.
[0318] Purified plasmid DNA can be prepared for injection using a
variety of formulations. The simplest of these is reconstitution of
lyophilized DNA in sterile phosphate-buffer saline (PBS). This
approach, known as "naked DNA," is currently being used for
intramuscular (IM) administration in clinical trials. To maximize
the immunotherapeutic effects of minigene DNA vaccines, an
alternative method for formulating purified plasmid DNA may be
desirable. A variety of methods have been described, and new
techniques may become available. Cationic lipids, glycolipids, and
fusogenic liposomes can also be used in the formulation (see, e.g.,
as described by WO 93/24640; Mannino & Gould-Fogerite,
BioTechniques 6(7): 682 (1988); U.S. Pat. No. 5,279,833; WO
91/06309; and Feigner, et al., Proc. Nat'l Acad. Sci. USA 84:7413
(1987). In addition, peptides and compounds referred to
collectively as protective, interactive, non-condensing compounds
(PINC) could also be complexed to purified plasmid DNA to influence
variables such as stability, intramuscular dispersion, or
trafficking to specific organs or cell types.
[0319] Target cell sensitization can be used as a functional assay
for expression and HLA class I presentation of minigene-encoded CTL
epitopes. For example, the plasmid DNA is introduced into a
mammalian cell line that is suitable as a target for standard CTL
chromium release assays. The transfection method used will be
dependent on the final formulation. Electroporation can be used for
"naked" DNA, whereas cationic lipids allow direct in vitro
transfection. A plasmid expressing green fluorescent protein (GFP)
can be co-transfected to allow enrichment of transfected cells
using fluorescence activated cell sorting (FACS). These cells are
then chromium-51 (.sup.51Cr) labeled and used as target cells for
epitope-specific CTL lines; cytolysis, detected by .sup.51Cr
release, indicates both production of, and HLA presentation of,
minigene-encoded CTL epitopes. Expression of HTL epitopes may be
evaluated in an analogous manner using assays to assess HTL
activity.
[0320] In vivo immunogenicity is a second approach for functional
testing of minigene DNA formulations. Transgenic mice expressing
appropriate human HLA proteins are immunized with the DNA product.
The dose and route of administration are formulation dependent
(e.g., IM for DNA in PBS, intraperitoneal (i.p.) for
lipid-complexed DNA). Twenty-one days after immunization,
splenocytes are harvested and restimulated for one week in the
presence of peptides encoding each epitope being tested.
Thereafter, for CTL effector cells, assays are conducted for
cytolysis of peptide-loaded, .sup.51Cr-labeled target cells using
standard techniques. Lysis of target cells that were sensitized by
HLA loaded with peptide epitopes, corresponding to minigene-encoded
epitopes, demonstrates DNA vaccine function for in vivo induction
of CTLs. Immunogenicity of HTL epitopes is confirmed in transgenic
mice in an analogous manner.
[0321] Alternatively, the nucleic acids can be administered using
ballistic delivery as described, for instance, in U.S. Pat. No.
5,204,253. Using this technique, particles comprised solely of DNA
are administered. In a further alternative embodiment, DNA can be
adhered to particles, such as gold particles.
[0322] Minigenes can also be delivered using other bacterial or
viral delivery systems well known in the art, e.g., an expression
construct encoding epitopes of the invention can be incorporated
into a viral vector such as vaccinia.
[0323] X.C.2.) Combinations of CTL Peptides with Helper
Peptides
[0324] Vaccine compositions comprising CTL peptides of the
invention can be modified, e.g., analoged, to provide desired
attributes, such as improved serum half life, broadened population
coverage or enhanced immunogenicity.
[0325] For instance, the ability of a peptide to induce CTL
activity can be enhanced by linking the peptide to a sequence which
contains at least one epitope that is capable of inducing a T
helper cell response. Although a CTL peptide can be directly linked
to a T helper peptide, often CTL epitope/HTL epitope conjugates are
linked by a spacer molecule. The spacer is typically comprised of
relatively small, neutral molecules, such as amino acids or amino
acid mimetics, which are substantially uncharged under
physiological conditions. The spacers are typically selected from,
e.g., Ala, Gly, or other neutral spacers of nonpolar amino acids or
neutral polar amino acids. It will be understood that the
optionally present spacer need not be comprised of the same
residues and thus may be a hetero- or homo-oligomer. When present,
the spacer will usually be at least one or two residues, more
usually three to six residues and sometimes 10 or more residues.
The CTL peptide epitope can be linked to the T helper peptide
epitope either directly or via a spacer either at the amino or
carboxy terminus of the CTL peptide. The amino terminus of either
the immunogenic peptide or the T helper peptide may be
acylated.
[0326] In certain embodiments, the T helper peptide is one that is
recognized by T helper cells present in a majority of a genetically
diverse population. This can be accomplished by selecting peptides
that bind to many, most, or all of the HLA class II molecules.
Examples of such amino acid bind many HLA Class II molecules
include sequences from antigens such as tetanus toxoid at positions
830-843 (QYIKANSKFIGITE; SEQ ID NO: 760[[710]]), Plasmodium
falciparum circumsporozoite (CS) protein at positions 378-398
(DIEKKIAKMEKASSVFNVVNS; SEQ ID NO: 761[[711]]), and Streptococcus
18 kD protein at positions 116-131 (GAVDSILGGVATYGAA; SEQ ID NO:
762[[712]]). Other examples include peptides bearing a DR 1-4-7
supermotif, or either of the DR3 motifs.
[0327] Alternatively, it is possible to prepare synthetic peptides
capable of stimulating T helper lymphocytes, in a loosely
HLA-restricted fashion, using amino acid sequences not found in
nature (see, e.g., PCT publication WO 95/07707). These synthetic
compounds called Pan-DR-binding epitopes (e.g., PADRE.TM.,
Epimmune, Inc., San Diego, Calif.) are designed to most preferably
bind most HLA-DR (human HLA class II) molecules. For instance, a
pan-DR-binding epitope peptide having the formula: aKXVAAWTLKAAa
(SEQ ID NO: 763[[713]]), where "X" is either cyclohexylalanine,
phenylalanine, or tyrosine, and a is either D-alanine or L-alanine,
has been found to bind to most HLA-DR alleles, and to stimulate the
response of T helper lymphocytes from most individuals, regardless
of their HLA type. An alternative of a pan-DR binding epitope
comprises all "L" natural amino acids and can be provided in the
form of nucleic acids that encode the epitope.
[0328] HTL peptide epitopes can also be modified to alter their
biological properties. For example, they can be modified to include
D-amino acids to increase their resistance to proteases and thus
extend their serum half life, or they can be conjugated to other
molecules such as lipids, proteins, carbohydrates, and the like to
increase their biological activity. For example, a T helper peptide
can be conjugated to one or more palmitic acid chains at either the
amino or carboxyl termini.
[0329] X.C.3.) Combinations of CTL Peptides with T Cell Priming
Agents
[0330] In some embodiments it may be desirable to include in the
pharmaceutical compositions of the invention at least one component
which primes B lymphocytes or T lymphocytes. Lipids have been
identified as agents capable of priming CTL in vivo. For example,
palmitic acid residues can be attached to the .epsilon.- and
.alpha.-amino groups of a lysine residue and then linked, e.g., via
one or more linking residues such as Gly, Gly-Gly-, Ser, Ser-Ser,
or the like, to an immunogenic peptide. The lipidated peptide can
then be administered either directly in a micelle or particle,
incorporated into a liposome, or emulsified in an adjuvant, e.g.,
incomplete Freund's adjuvant. In a preferred embodiment, a
particularly effective immunogenic composition comprises palmitic
acid attached to .epsilon.- and .alpha.-amino groups of Lys, which
is attached via linkage, e.g., Ser-Ser, to the amino terminus of
the immunogenic peptide.
[0331] As another example of lipid priming of CTL responses, E.
coli lipoproteins, such as
tripalmitoyl-S-glycerylcysteinlyseryl-serine (P.sub.3CSS) can be
used to prime virus specific CTL when covalently attached to an
appropriate peptide (see, e.g., Deres, et al., Nature 342:561,
1989). Peptides of the invention can be coupled to P.sub.3CSS, for
example, and the lipopeptide administered to an individual to
specifically prime an immune response to the target antigen.
Moreover, because the induction of neutralizing antibodies can also
be primed with P.sub.3CSS-conjugated epitopes, two such
compositions can be combined to more effectively elicit both
humoral and cell-mediated responses.
[0332] X.C.4.) Vaccine Compositions Comprising DC Pulsed with CTL
and/or HTL Peptides
[0333] An embodiment of a vaccine composition in accordance with
the invention comprises ex vivo administration of a cocktail of
epitope-bearing peptides to PBMC, or isolated DC therefrom, from
the patient's blood. A pharmaceutical to facilitate harvesting of
DC can be used, such as Progenipoietin.TM. (Pharmacia-Monsanto, St.
Louis, Mo.) or GM-CSF/IL-4. After pulsing the DC with peptides and
prior to reinfusion into patients, the DC are washed to remove
unbound peptides. In this embodiment, a vaccine comprises
peptide-pulsed DCs which present the pulsed peptide epitopes
complexed with HLA molecules on their surfaces.
[0334] The DC can be pulsed ex vivo with a cocktail of peptides,
some of which stimulate CTL responses to 161P2F10B. Optionally, a
helper T cell (HTL) peptide, such as a natural or artificial
loosely restricted HLA Class II peptide, can be included to
facilitate the CTL response. Thus, a vaccine in accordance with the
invention is used to treat a cancer which expresses or
overexpresses 161P2F10B.
[0335] X.D.) Adoptive Immunotherapy
[0336] Antigenic 161P2F10B-related peptides are used to elicit a
CTL and/or HTL response ex vivo, as well. The resulting CTL or HTL
cells, can be used to treat tumors in patients that do not respond
to other conventional forms of therapy, or will not respond to a
therapeutic vaccine peptide or nucleic acid in accordance with the
invention. Ex vivo CTL or HTL responses to a particular antigen are
induced by incubating in tissue culture the patient's, or
genetically compatible, CTL or HTL precursor cells together with a
source of antigen-presenting cells (APC), such as dendritic cells,
and the appropriate immunogenic peptide. After an appropriate
incubation time (typically about 7-28 days), in which the precursor
cells are activated and expanded into effector cells, the cells are
infused back into the patient, where they will destroy (CTL) or
facilitate destruction (HTL) of their specific target cell (e.g., a
tumor cell). Transfected dendritic cells may also be used as
antigen presenting cells.
[0337] X.E.) Administration of Vaccines for Therapeutic or
Prophylactic Purposes
[0338] Pharmaceutical and vaccine compositions of the invention are
typically used to treat and/or prevent a cancer that expresses or
overexpresses 161P2F10B. In therapeutic applications, peptide
and/or nucleic acid compositions are administered to a patient in
an amount sufficient to elicit an effective B cell, CTL and/or HTL
response to the antigen and to cure or at least partially arrest or
slow symptoms and/or complications. An amount adequate to
accomplish this is defined as "therapeutically effective dose."
Amounts effective for this use will depend on, e.g., the particular
composition administered, the manner of administration, the stage
and severity of the disease being treated, the weight and general
state of health of the patient, and the judgment of the prescribing
physician.
[0339] For pharmaceutical compositions, the immunogenic peptides of
the invention, or DNA encoding them, are generally administered to
an individual already bearing a tumor that expresses 161P2F10B. The
peptides or DNA encoding them can be administered individually or
as fusions of one or more peptide sequences. Patients can be
treated with the immunogenic peptides separately or in conjunction
with other treatments, such as surgery, as appropriate.
[0340] For therapeutic use, administration should generally begin
at the first diagnosis of 161P2F10B-associated cancer. This is
followed by boosting doses until at least symptoms are
substantially abated and for a period thereafter. The embodiment of
the vaccine composition (i.e., including, but not limited to
embodiments such as peptide cocktails, polyepitopic polypeptides,
minigenes, or TAA-specific CTLs or pulsed dendritic cells)
delivered to the patient may vary according to the stage of the
disease or the patient's health status. For example, in a patient
with a tumor that expresses 161P2F10B, a vaccine comprising
161P2F10B-specific CTL may be more efficacious in killing tumor
cells in patient with advanced disease than alternative
embodiments.
[0341] It is generally important to provide an amount of the
peptide epitope delivered by a mode of administration sufficient to
effectively stimulate a cytotoxic T cell response; compositions
which stimulate helper T cell responses can also be given in
accordance with this embodiment of the invention.
[0342] The dosage for an initial therapeutic immunization generally
occurs in a unit dosage range where the lower value is about 1, 5,
50, 500, or 1,000 .mu.g and the higher value is about 10,000;
20,000; 30,000; or 50,000 .mu.g. Dosage values for a human
typically range from about 500 .mu.g to about 50,000 .mu.g per 70
kilogram patient. Boosting dosages of between about 1.0 .mu.g to
about 50,000 .mu.g of peptide pursuant to a boosting regimen over
weeks to months may be administered depending upon the patient's
response and condition as determined by measuring the specific
activity of CTL and HTL obtained from the patient's blood.
Administration should continue until at least clinical symptoms or
laboratory tests indicate that the neoplasia, has been eliminated
or reduced and for a period thereafter. The dosages, routes of
administration, and dose schedules are adjusted in accordance with
methodologies known in the art.
[0343] In certain embodiments, the peptides and compositions of the
present invention are employed in serious disease states, that is,
life-threatening or potentially life threatening situations. In
such cases, as a result of the minimal amounts of extraneous
substances and the relative nontoxic nature of the peptides in
preferred compositions of the invention, it is possible and may be
felt desirable by the treating physician to administer substantial
excesses of these peptide compositions relative to these stated
dosage amounts.
[0344] The vaccine compositions of the invention can also be used
purely as prophylactic agents. Generally the dosage for an initial
prophylactic immunization generally occurs in a unit dosage range
where the lower value is about 1, 5, 50, 500, or 1000 .mu.g and the
higher value is about 10,000; 20,000; 30,000; or 50,000 .mu.g.
Dosage values for a human typically range from about 500 .mu.g to
about 50,000 .mu.g per 70 kilogram patient. This is followed by
boosting dosages of between about 1.0 .mu.g to about 50,000 .mu.g
of peptide administered at defined intervals from about four weeks
to six months after the initial administration of vaccine. The
immunogenicity of the vaccine can be assessed by measuring the
specific activity of CTL and HTL obtained from a sample of the
patient's blood.
[0345] The pharmaceutical compositions for therapeutic treatment
are intended for parenteral, topical, oral, nasal, intrathecal, or
local (e.g. as a cream or topical ointment) administration.
Preferably, the pharmaceutical compositions are administered
parentally, e.g., intravenously, subcutaneously, intradermally, or
intramuscularly. Thus, the invention provides compositions for
parenteral administration which comprise a solution of the
immunogenic peptides dissolved or suspended in an acceptable
carrier, preferably an aqueous carrier.
[0346] A variety of aqueous carriers may be used, e.g., water,
buffered water, 0.8% saline, 0.3% glycine, hyaluronic acid and the
like. These compositions may be sterilized by conventional,
well-known sterilization techniques, or may be sterile filtered.
The resulting aqueous solutions may be packaged for use as is, or
lyophilized, the lyophilized preparation being combined with a
sterile solution prior to administration.
[0347] The compositions may contain pharmaceutically acceptable
auxiliary substances as required to approximate physiological
conditions, such as pH-adjusting and buffering agents, tonicity
adjusting agents, wetting agents, preservatives, and the like, for
example, sodium acetate, sodium lactate, sodium chloride, potassium
chloride, calcium chloride, sorbitan monolaurate, triethanolamine
oleate, etc.
[0348] The concentration of peptides of the invention in the
pharmaceutical formulations can vary widely, i.e., from less than
about 0.1%, usually at or at least about 2% to as much as 20% to
50% or more by weight, and will be selected primarily by fluid
volumes, viscosities, etc., in accordance with the particular mode
of administration selected.
[0349] A human unit dose form of a composition is typically
included in a pharmaceutical composition that comprises a human
unit dose of an acceptable carrier, in one embodiment an aqueous
carrier, and is administered in a volume/quantity that is known by
those of skill in the art to be used for administration of such
compositions to humans (see, e.g., Remington's Pharmaceutical
Sciences, 17.sup.th Edition, A. Gennaro, Editor, Mack Publishing
Co., Easton, Pa., 1985). For example a peptide dose for initial
immunization can be from about 1 to about 50,000 .mu.g, generally
100-5,000 .mu.g, for a 70 kg patient. For example, for nucleic
acids an initial immunization may be performed using an expression
vector in the form of naked nucleic acid administered IM (or SC or
ID) in the amounts of 0.5-5 mg at multiple sites. The nucleic acid
(0.1 to 1000 .mu.g) can also be administered using a gene gun.
Following an incubation period of 3-4 weeks, a booster dose is then
administered. The booster can be recombinant fowlpox virus
administered at a dose of 5-10.sup.7 to 5.times.10.sup.9 pfu.
[0350] For antibodies, a treatment generally involves repeated
administration of the anti-161P2F10B antibody preparation, via an
acceptable route of administration such as intravenous injection
(IV), typically at a dose in the range of about 0.1 to about 10
mg/kg body weight. In general, doses in the range of 10-500 mg mAb
per week are effective and well tolerated. Moreover, an initial
loading dose of approximately 4 mg/kg patient body weight IV,
followed by weekly doses of about 2 mg/kg IV of the anti-161P2F10B
mAb preparation represents an acceptable dosing regimen. As
appreciated by those of skill in the art, various factors can
influence the ideal dose in a particular case. Such factors
include, for example, half life of a composition, the binding
affinity of an Ab, the immunogenicity of a substance, the degree of
161P2F10B expression in the patient, the extent of circulating shed
161P2F10B antigen, the desired steady-state concentration level,
frequency of treatment, and the influence of chemotherapeutic or
other agents used in combination with the treatment method of the
invention, as well as the health status of a particular patient.
Non-limiting preferred human unit doses are, for example, 500 .mu.g
-1 mg, 1 mg-50 mg, 50 mg-100 mg, 100 mg-200 mg, 200 mg-300 mg, 400
mg-500 mg, 500 mg-600 mg, 600 mg-700 mg, 700 mg-800 mg, 800 mg-900
mg 900 mg-1 g, or 1 mg-700 mg. In certain embodiments, the dose is
in a range of 2-5 mg/kg body weight, e.g., with follow on weekly
doses of 1-3 mg/kg; 0.5mg, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 mg/kg body
weight followed, e.g., in two, three or four weeks by weekly doses;
0.5-10 mg/kg body weight, e.g., followed in two, three or four
weeks by weekly doses; 225, 250, 275, 300, 325, 350, 375, 400 mg
m.sup.2 of body area weekly; 1-600 mg m.sup.2 of body area weekly;
225-400 mg m.sup.2 of body area weekly; these does can be followed
by weekly doses for 2, 3, 4, 5, 6, 7, 8, 9, 19, 11, 12 or more
weeks.
[0351] In one embodiment, human unit dose forms of polynucleotides
comprise a suitable dosage range or effective amount that provides
any therapeutic effect. As appreciated by one of ordinary skill in
the art a therapeutic effect depends on a number of factors,
including the sequence of the polynucleotide, molecular weight of
the polynucleotide and route of administration. Dosages are
generally selected by the physician or other health care
professional in accordance with a variety of parameters known in
the art, such as severity of symptoms, history of the patient and
the like. Generally, for a polynucleotide of about 20 bases, a
dosage range may be selected from, for example, an independently
selected lower limit such as about 0.1, 0.25, 0.5, 1, 2, 5, 10, 20,
30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400 or 500 mg/kg up to
an independently selected upper limit, greater than the lower
limit, of about 60, 80, 100, 200, 300, 400, 500, 750, 1000, 1500,
2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000 or 10,000 mg/kg. For
example, a dose may be about any of the following: 0.1 to 100
mg/kg, 0.1 to 50 mg/kg, 0.1 to 25 mg/kg, 0.1 to 10 mg/kg, 1 to 500
mg/kg, 100 to 400 mg/kg, 200 to 300 mg/kg, 1 to 100 mg/kg, 100 to
200 mg/kg, 300 to 400 mg/kg, 400 to 500 mg/kg, 500 to 1000 mg/kg,
500 to 5000 mg/kg, or 500 to 10,000 mg/kg. Generally, parenteral
routes of administration may require higher doses of polynucleotide
compared to more direct application to the nucleotide to diseased
tissue, as do polynucleotides of increasing length.
[0352] In one embodiment, human unit dose forms of T-cells comprise
a suitable dosage range or effective amount that provides any
therapeutic effect. As appreciated by one of ordinary skill in the
art, a therapeutic effect depends on a number of factors. Dosages
are generally selected by the physician or other health care
professional in accordance with a variety of parameters known in
the art, such as severity of symptoms, history of the patient and
the like. A dose may be about 10.sup.4 cells to about 10.sup.6
cells, about 10.sup.6 cells to about 10.sup.8 cells, about 10.sup.8
to about 10.sup.11 cells, or about 10.sup.8 to about
5.times.10.sup.10 cells. A dose may also about 10.sup.6
cells/m.sup.2 to about 10.sup.10 cells/m.sup.2, or about 10.sup.6
cells/m.sup.2 to about 10.sup.8 cells/m.sup.2.
[0353] Proteins(s) of the invention, and/or nucleic acids encoding
the protein(s), can also be administered via liposomes, which may
also serve to: 1) target the proteins(s) to a particular tissue,
such as lymphoid tissue; 2) to target selectively to diseases
cells; or, 3) to increase the half-life of the peptide composition.
Liposomes include emulsions, foams, micelles, insoluble monolayers,
liquid crystals, phospholipid dispersions, lamellar layers and the
like. In these preparations, the peptide to be delivered is
incorporated as part of a liposome, alone or in conjunction with a
molecule which binds to a receptor prevalent among lymphoid cells,
such as monoclonal antibodies which bind to the CD45 antigen, or
with other therapeutic or immunogenic compositions. Thus, liposomes
either filled or decorated with a desired peptide of the invention
can be directed to the site of lymphoid cells, where the liposomes
then deliver the peptide compositions. Liposomes for use in
accordance with the invention are formed from standard
vesicle-forming lipids, which generally include neutral and
negatively charged phospholipids and a sterol, such as cholesterol.
The selection of lipids is generally guided by consideration of,
e.g., liposome size, acid lability and stability of the liposomes
in the blood stream. A variety of methods are available for
preparing liposomes, as described in, e.g., Szoka, et al., Ann.
Rev. Biophys. Bioeng. 9:467 (1980), and U.S. Pat. Nos. 4,235,871,
4,501,728, 4,837,028, and 5,019,369.
[0354] For targeting cells of the immune system, a ligand to be
incorporated into the liposome can include, e.g., antibodies or
fragments thereof specific for cell surface determinants of the
desired immune system cells. A liposome suspension containing a
peptide may be administered intravenously, locally, topically, etc.
in a dose which varies according to, inter alia, the manner of
administration, the peptide being delivered, and the stage of the
disease being treated.
[0355] For solid compositions, conventional nontoxic solid carriers
may be used which include, for example, pharmaceutical grades of
mannitol, lactose, starch, magnesium stearate, sodium saccharin,
talcum, cellulose, glucose, sucrose, magnesium carbonate, and the
like. For oral administration, a pharmaceutically acceptable
nontoxic composition is formed by incorporating any of the normally
employed excipients, such as those carriers previously listed, and
generally 10-95% of active ingredient, that is, one or more
peptides of the invention, and more preferably at a concentration
of 25%-75%.
[0356] For aerosol administration, immunogenic peptides are
preferably supplied in finely divided form along with a surfactant
and propellant. Typical percentages of peptides are about 0.01%-20%
by weight, preferably about 1%-10%. The surfactant must, of course,
be nontoxic, and preferably soluble in the propellant.
Representative of such agents are the esters or partial esters of
fatty acids containing from about 6 to 22 carbon atoms, such as
caproic, octanoic, lauric, palmitic, stearic, linoleic, linolenic,
olesteric and oleic acids with an aliphatic polyhydric alcohol or
its cyclic anhydride. Mixed esters, such as mixed or natural
glycerides may be employed. The surfactant may constitute about
0.1%-20% by weight of the composition, preferably about 0.25-5%.
The balance of the composition is ordinarily propellant. A carrier
can also be included, as desired, as with, e.g., lecithin for
intranasal delivery.
XI.) Diagnostic and Prognostic Embodiments of 161P2F10B.
[0357] As disclosed herein, 161P2F10B polynucleotides,
polypeptides, reactive cytotoxic T cells (CTL), reactive helper T
cells (HTL) and anti-polypeptide antibodies are used in well known
diagnostic, prognostic and therapeutic assays that examine
conditions associated with dysregulated cell growth such as cancer,
in particular the cancers listed in Table I (see, e.g., both its
specific pattern of tissue expression as well as its overexpression
in certain cancers as described for example in Example 4).
[0358] 161P2F10B can be analogized to a prostate associated antigen
PSA, the archetypal marker that has been used by medical
practitioners for years to identify and monitor the presence of
prostate cancer (see, e.g., Merrill et al., J. Urol. 163(2):
503-5120 (2000); Polascik et al., J. Urol. August; 162(2):293-306
(1999) and Fortier et al., J. Nat. Cancer Inst. 91(19):
1635-1640(1999)). A variety of other diagnostic markers are also
used in similar contexts including p53 and K-ras (see, e.g.,
Tulchinsky et al., Int J Mol Med 1999 July 4(1):99-102 and Minimoto
et al., Cancer Detect Prey 2000;24(1):1-12). Therefore, this
disclosure of the 161P2F10B polynucleotides and polypeptides (as
well as the 161P2F10B polynucleotide probes and anti-161P2F10B
antibodies used to identify the presence of these molecules) and
their properties allows skilled artisans to utilize these molecules
in methods that are analogous to those used, for example, in a
variety of diagnostic assays directed to examining conditions
associated with cancer.
[0359] Typical embodiments of diagnostic methods which utilize the
161P2F10B polynucleotides, polypeptides, reactive T cells and
antibodies are analogous to those methods from well-established
diagnostic assays which employ, e.g., PSA polynucleotides,
polypeptides, reactive T cells and antibodies. For example, just as
PSA polynucleotides are used as probes (for example in Northern
analysis, see, e.g., Sharief et al., Biochem. Mol. Biol. Int.
33(3):567-74(1994)) and primers (for example in PCR analysis, see,
e.g., Okegawa et al., J. Urol. 163(4): 1189-1190 (2000)) to observe
the presence and/or the level of PSA mRNAs in methods of monitoring
PSA overexpression or the metastasis of prostate cancers, the
161P2F10B polynucleotides described herein can be utilized in the
same way to detect 161P2F10B overexpression or the metastasis of
prostate and other cancers expressing this gene. Alternatively,
just as PSA polypeptides are used to generate antibodies specific
for PSA which can then be used to observe the presence and/or the
level of PSA proteins in methods to monitor PSA protein
overexpression (see, e.g., Stephan et al., Urology 55(4):560-3
(2000)) or the metastasis of prostate cells (see, e.g., Alanen et
al., Pathol. Res. Pract. 192(3):233-7 (1996)), the 161P2F10B
polypeptides described herein can be utilized to generate
antibodies for use in detecting 161P2F10B overexpression or the
metastasis of prostate cells and cells of other cancers expressing
this gene.
[0360] Specifically, because metastases involves the movement of
cancer cells from an organ of origin (such as the lung or prostate
gland etc.) to a different area of the body (such as a lymph node),
assays which examine a biological sample for the presence of cells
expressing 161P2F10B polynucleotides and/or polypeptides can be
used to provide evidence of metastasis. For example, when a
biological sample from tissue that does not normally contain
161P2F10B-expressing cells (lymph node) is found to contain
161P2F10B-expressing cells such as the 161P2F10B expression seen in
LAPC4 and LAPC9, xenografts isolated from lymph node and bone
metastasis, respectively, this finding is indicative of
metastasis.
[0361] Alternatively 161P2F10B polynucleotides and/or polypeptides
can be used to provide evidence of cancer, for example, when cells
in a biological sample that do not normally express 161P2F10B or
express 161P2F10B at a different level are found to express
161P2F10B or have an increased expression of 161P2F10B (see, e.g.,
the 161P2F10B expression in the cancers listed in Table I and in
patient samples etc. shown in the accompanying Figures). In such
assays, artisans may further wish to generate supplementary
evidence of metastasis by testing the biological sample for the
presence of a second tissue restricted marker (in addition to
161P2F10B) such as PSA, PSCA etc. (see, e.g., Alanen et al.,
Pathol. Res. Pract. 192(3): 233-237 (1996)).
[0362] Just as PSA polynucleotide fragments and polynucleotide
variants are employed by skilled artisans for use in methods of
monitoring PSA, 161P2F10B polynucleotide fragments and
polynucleotide variants are used in an analogous manner. In
particular, typical PSA polynucleotides used in methods of
monitoring PSA are probes or primers which consist of fragments of
the PSA cDNA sequence. Illustrating this, primers used to PCR
amplify a PSA polynucleotide must include less than the whole PSA
sequence to function in the polymerase chain reaction. In the
context of such PCR reactions, skilled artisans generally create a
variety of different polynucleotide fragments that can be used as
primers in order to amplify different portions of a polynucleotide
of interest or to optimize amplification reactions (see, e.g.,
Caetano-Anolles, G. Biotechniques 25(3): 472-476, 478-480 (1998);
Robertson et al., Methods Mol. Biol. 98:121-154 (1998)). An
additional illustration of the use of such fragments is provided in
Example 4, where a 161P2F10B polynucleotide fragment is used as a
probe to show the expression of 161P2F10B RNAs in cancer cells. In
addition, variant polynucleotide sequences are typically used as
primers and probes for the corresponding mRNAs in PCR and Northern
analyses (see, e.g., Sawai et al., Fetal Diagn. Ther. 1996
Nov.-Dec. 11(6):407-13 and Current Protocols In Molecular Biology,
Volume 2, Unit 2, Frederick M. Ausubel et al. eds., 1995)).
Polynucleotide fragments and variants are useful in this context
where they are capable of binding to a target polynucleotide
sequence (e.g. the 161P2F10B polynucleotide shown in SEQ ID NO:
701) under conditions of high stringency.
[0363] Furthermore, PSA polypeptides which contain an epitope that
can be recognized by an antibody or T cell that specifically binds
to that epitope are used in methods of monitoring PSA. 161P2F10B
polypeptide fragments and polypeptide analogs or variants can also
be used in an analogous manner. This practice of using polypeptide
fragments or polypeptide variants to generate antibodies (such as
anti-PSA antibodies or T cells) is typical in the art with a wide
variety of systems such as fusion proteins being used by
practitioners (see, e.g., Current Protocols In Molecular Biology,
Volume 2, Unit 16, Frederick M. Ausubel et al. eds., 1995). In this
context, each epitope(s) functions to provide the architecture with
which an antibody or T cell is reactive. Typically, skilled
artisans create a variety of different polypeptide fragments that
can be used in order to generate immune responses specific for
different portions of a polypeptide of interest (see, e.g., U.S.
Pat. No. 5,840,501 and U.S. Pat. No. 5,939,533). For example it may
be preferable to utilize a polypeptide comprising one of the
161P2F10B biological motifs discussed herein or a motif-bearing
subsequence which is readily identified by one of skill in the art
based on motifs available in the art. Polypeptide fragments,
variants or analogs are typically useful in this context as long as
they comprise an epitope capable of generating an antibody or T
cell specific for a target polypeptide sequence (e.g. the 161P2F10B
polypeptide).
[0364] As shown herein, the 161P2F10B polynucleotides and
polypeptides (as well as the 161P2F10B polynucleotide probes and
anti-161P2F10B antibodies or T cells used to identify the presence
of these molecules) exhibit specific properties that make them
useful in diagnosing cancers such as those listed in Table I.
Diagnostic assays that measure the presence of 161P2F10B gene
products, in order to evaluate the presence or onset of a disease
condition described herein, such as prostate cancer, are used to
identify patients for preventive measures or further monitoring, as
has been done so successfully with PSA. Moreover, these materials
satisfy a need in the art for molecules having similar or
complementary characteristics to PSA in situations where, for
example, a definite diagnosis of metastasis of prostatic origin
cannot be made on the basis of a test for PSA alone (see, e.g.,
Alanen et al., Pathol. Res. Pract. 192(3): 233-237 (1996)), and
consequently, materials such as 161P2F10B polynucleotides and
polypeptides (as well as the 161P2F10B polynucleotide probes and
anti-161P2F10B antibodies used to identify the presence of these
molecules) must be employed to confirm metastases of prostatic
origin.
[0365] Finally, in addition to their use in diagnostic assays, the
161P2F10B polynucleotides disclosed herein have a number of other
utilities such as their use in the identification of oncogenetic
associated chromosomal abnormalities in the chromosomal region to
which the 161P2F10B gene maps (see Example 3 below). Moreover, in
addition to their use in diagnostic assays, the 161P2F10B-related
proteins and polynucleotides disclosed herein have other utilities
such as their use in the forensic analysis of tissues of unknown
origin (see, e.g., Takahama K Forensic Sci Int 1996 Jun.
28;80(1-2): 63-9).
[0366] Additionally, 161P2F10B-related proteins or polynucleotides
of the invention can be used to treat a pathologic condition
characterized by the over-expression of 161P2F10B. For example, the
amino acid or nucleic acid sequence of FIG. 2 or FIG. 3, or
fragments of either, can be used to generate an immune response to
the 161P2F10B antigen. Antibodies or other molecules that react
with 161P2F10B can be used to modulate the function of this
molecule, and thereby provide a therapeutic benefit.
XII.) Inhibition of 161P2F10B Protein Function
[0367] The invention includes various methods and compositions for
inhibiting the binding of 161P2F10B to its binding partner or its
association with other protein(s) as well as methods for inhibiting
161P2F10B function.
[0368] XII.A.) Inhibition of 161P2F10B with Intracellular
Antibodies
[0369] In one approach, a recombinant vector that encodes single
chain antibodies that specifically bind to 161P2F10B are introduced
into 161P2F10B expressing cells via gene transfer technologies.
Accordingly, the encoded single chain anti-161P2F10B antibody is
expressed intracellularly, binds to 161P2F10B protein, and thereby
inhibits its function. Methods for engineering such intracellular
single chain antibodies are well known. Such intracellular
antibodies, also known as "intrabodies", are specifically targeted
to a particular compartment within the cell, providing control over
where the inhibitory activity of the treatment is focused. This
technology has been successfully applied in the art (for review,
see Richardson and Marasco, 1995, TIBTECH vol. 13). Intrabodies
have been shown to virtually eliminate the expression of otherwise
abundant cell surface receptors (see, e.g., Richardson et al.,
1995, Proc. Natl. Acad. Sci. USA 92: 3137-3141; Beerli et al.,
1994, J. Biol. Chem. 289: 23931-23936; Deshane et al., 1994, Gene
Ther. 1: 332-337).
[0370] Single chain antibodies comprise the variable domains of the
heavy and light chain joined by a flexible linker polypeptide, and
are expressed as a single polypeptide. Optionally, single chain
antibodies are expressed as a single chain variable region fragment
joined to the light chain constant region. Well-known intracellular
trafficking signals are engineered into recombinant polynucleotide
vectors encoding such single chain antibodies in order to precisely
target the intrabody to the desired intracellular compartment. For
example, intrabodies targeted to the endoplasmic reticulum (ER) are
engineered to incorporate a leader peptide and, optionally, a
C-terminal ER retention signal, such as the KDEL amino acid motif.
Intrabodies intended to exert activity in the nucleus are
engineered to include a nuclear localization signal. Lipid moieties
are joined to intrabodies in order to tether the intrabody to the
cytosolic side of the plasma membrane. Intrabodies can also be
targeted to exert function in the cytosol. For example, cytosolic
intrabodies are used to sequester factors within the cytosol,
thereby preventing them from being transported to their natural
cellular destination.
[0371] In one embodiment, intrabodies are used to capture 161P2F10B
in the nucleus, thereby preventing its activity within the nucleus.
Nuclear targeting signals are engineered into such 161P2F10B
intrabodies in order to achieve the desired targeting. Such
161P2F10B intrabodies are designed to bind specifically to a
particular 161P2F10B domain. In another embodiment, cytosolic
intrabodies that specifically bind to the 161P2F10B protein are
used to prevent 161P2F10B from gaining access to the nucleus,
thereby preventing it from exerting any biological activity within
the nucleus (e.g., preventing 161P2F10B from forming transcription
complexes with other factors).
[0372] In order to specifically direct the expression of such
intrabodies to particular cells, the transcription of the intrabody
is placed under the regulatory control of an appropriate
tumor-specific promoter and/or enhancer. In order to target
intrabody expression specifically to prostate, for example, the PSA
promoter and/or promoter/enhancer can be utilized (See, for
example, U.S. Pat. No. 5,919,652 issued 6 Jul. 1999).
[0373] XII.B.) Inhibition of 161P2F10B with Recombinant
Proteins
[0374] In another approach, recombinant molecules bind to 161P2F10B
and thereby inhibit 161P2F10B function. For example, these
recombinant molecules prevent or inhibit 161P2F10B from
accessing/binding to its binding partner(s) or associating with
other protein(s). Such recombinant molecules can, for example,
contain the reactive part(s) of a 161P2F10B specific antibody
molecule. In a particular embodiment, the 161P2F10B binding domain
of a 161P2F10B binding partner is engineered into a dimeric fusion
protein, whereby the fusion protein comprises two 161P2F10B ligand
binding domains linked to the Fc portion of a human IgG, such as
human IgG1. Such IgG portion can contain, for example, the C.sub.H2
and C.sub.H3 domains and the hinge region, but not the C.sub.H1
domain Such dimeric fusion proteins are administered in soluble
form to patients suffering from a cancer associated with the
expression of 161P2F10B, whereby the dimeric fusion protein
specifically binds to 161P2F10B and blocks 161P2F10B interaction
with a binding partner. Such dimeric fusion proteins are further
combined into multimeric proteins using known antibody linking
technologies.
[0375] XII.C.) Inhibition of 161P2F10B Transcription or
Translation
[0376] The present invention also comprises various methods and
compositions for inhibiting the transcription of the 161P2F10B
gene. Similarly, the invention also provides methods and
compositions for inhibiting the translation of 161P2F10B mRNA into
protein.
[0377] In one approach, a method of inhibiting the transcription of
the 161P2F10B gene comprises contacting the 161P2F10B gene with a
161P2F10B antisense polynucleotide. In another approach, a method
of inhibiting 161P2F10B mRNA translation comprises contacting the
161P2F10B mRNA with an antisense polynucleotide. In another
approach, a 161P2F10B specific ribozyme is used to cleave the
161P2F10B message, thereby inhibiting translation. Such antisense
and ribozyme based methods can also be directed to the regulatory
regions of the 161P2F10B gene, such as the 161P2F10B promoter
and/or enhancer elements. Similarly, proteins capable of inhibiting
a 161P2F10B gene transcription factor are used to inhibit 161P2F10B
mRNA transcription. The various polynucleotides and compositions
useful in the aforementioned methods have been described above. The
use of antisense and ribozyme molecules to inhibit transcription
and translation is well known in the art.
[0378] Other factors that inhibit the transcription of 161P2F10B by
interfering with 161P2F10B transcriptional activation are also
useful to treat cancers expressing 161P2F10B. Similarly, factors
that interfere with 161P2F10B processing are useful to treat
cancers that express 161P2F10B. Cancer treatment methods utilizing
such factors are also within the scope of the invention.
[0379] XII.D.) General Considerations for Therapeutic
Strategies
[0380] Gene transfer and gene therapy technologies can be used to
deliver therapeutic polynucleotide molecules to tumor cells
synthesizing 161P2F10B (i.e., antisense, ribozyme, polynucleotides
encoding intrabodies and other 161P2F10B inhibitory molecules). A
number of gene therapy approaches are known in the art. Recombinant
vectors encoding 161P2F10B antisense polynucleotides, ribozymes,
factors capable of interfering with 161P2F10B transcription, and so
forth, can be delivered to target tumor cells using such gene
therapy approaches.
[0381] The above therapeutic approaches can be combined with any
one of a wide variety of surgical, chemotherapy or radiation
therapy regimens. The therapeutic approaches of the invention can
enable the use of reduced dosages of chemotherapy (or other
therapies) and/or less frequent administration, an advantage for
all patients and particularly for those that do not tolerate the
toxicity of the chemotherapeutic agent well.
[0382] The anti-tumor activity of a particular composition (e.g.,
antisense, ribozyme, intrabody), or a combination of such
compositions, can be evaluated using various in vitro and in vivo
assay systems. In vitro assays that evaluate therapeutic activity
include cell growth assays, soft agar assays and other assays
indicative of tumor promoting activity, binding assays capable of
determining the extent to which a therapeutic composition will
inhibit the binding of 161P2F10B to a binding partner, etc.
[0383] In vivo, the effect of a 161P2F10B therapeutic composition
can be evaluated in a suitable animal model. For example, xenogenic
prostate cancer models can be used, wherein human prostate cancer
explants or passaged xenograft tissues are introduced into immune
compromised animals, such as nude or SCID mice (Klein et al., 1997,
Nature Medicine 3: 402-408). For example, PCT Patent Application
WO98/16628 and U.S. Pat. No. 6,107,540, Sawyers et al., published
Apr. 23, 1998, describes various xenograft models of human prostate
cancer capable of recapitulating the development of primary tumors,
micrometastasis, and the formation of osteoblastic metastases
characteristic of late stage disease. Efficacy can be predicted
using assays that measure inhibition of tumor formation, tumor
regression or metastasis, and the like.
[0384] In vivo assays that evaluate the promotion of apoptosis are
useful in evaluating therapeutic compositions. In one embodiment,
xenografts from tumor bearing mice treated with the therapeutic
composition can be examined for the presence of apoptotic foci and
compared to untreated control xenograft-bearing mice. The extent to
which apoptotic foci are found in the tumors of the treated mice
provides an indication of the therapeutic efficacy of the
composition.
[0385] The therapeutic compositions used in the practice of the
foregoing methods can be formulated into pharmaceutical
compositions comprising a carrier suitable for the desired delivery
method. Suitable carriers include any material that when combined
with the therapeutic composition retains the anti-tumor function of
the therapeutic composition and is generally non-reactive with the
patient's immune system. Examples include, but are not limited to,
any of a number of standard pharmaceutical carriers such as sterile
phosphate buffered saline solutions, bacteriostatic water, and the
like (see, generally, Remington's Pharmaceutical Sciences 16.sup.th
Edition, A. Osal., Ed., 1980).
[0386] Therapeutic formulations can be solubilized and administered
via any route capable of delivering the therapeutic composition to
the tumor site. Potentially effective routes of administration
include, but are not limited to, intravenous, parenteral,
intraperitoneal, intramuscular, intratumor, intradermal,
intraorgan, orthotopic, and the like. A preferred formulation for
intravenous injection comprises the therapeutic composition in a
solution of preserved bacteriostatic water, sterile unpreserved
water, and/or diluted in polyvinylchloride or polyethylene bags
containing 0.9% sterile Sodium Chloride for Injection, USP.
Therapeutic protein preparations can be lyophilized and stored as
sterile powders, preferably under vacuum, and then reconstituted in
bacteriostatic water (containing for example, benzyl alcohol
preservative) or in sterile water prior to injection.
[0387] Dosages and administration protocols for the treatment of
cancers using the foregoing methods will vary with the method and
the target cancer, and will generally depend on a number of other
factors appreciated in the art.
XIII.) Kits
[0388] For use in the diagnostic and therapeutic applications
described herein, kits are also within the scope of the invention.
Such kits can comprise a carrier, package or container that is
compartmentalized to receive one or more containers such as vials,
tubes, and the like, each of the container(s) comprising one of the
separate elements to be used in the method. For example, the
container(s) can comprise a probe that is or can be detectably
labeled. Such probe can be an antibody or polynucleotide specific
for a 161P2F10B-related protein or a 161P2F10B gene or message,
respectively. Where the method utilizes nucleic acid hybridization
to detect the target nucleic acid, the kit can also have containers
containing nucleotide(s) for amplification of the target nucleic
acid sequence and/or a container comprising a reporter-means, such
as a biotin-binding protein, such as avidin or streptavidin, bound
to a reporter molecule, such as an enzymatic, florescent, or
radioisotope label. The kit can include all or part of the amino
acid sequence of FIG. 2 or FIG. 3 or analogs thereof, or a nucleic
acid molecules that encodes such amino acid sequences.
[0389] The kit of the invention will typically comprise the
container described above and one or more other containers
comprising materials desirable from a commercial and user
standpoint, including buffers, diluents, filters, needles,
syringes, and package inserts with instructions for use.
[0390] A label can be present on the container to indicate that the
composition is used for a specific therapy or non-therapeutic
application, and can also indicate directions for either in vivo or
in vitro use, such as those described above. Directions and or
other information can also be included on an insert which is
included with the kit.
Examples
[0391] Various aspects of the invention are further described and
illustrated by way of the several examples that follow, none of
which are intended to limit the scope of the invention.
Example 1
SSH-Generated Isolation of a cDNA Fragment of the 161P2F10B
Gene
[0392] To isolate genes that are over-expressed in kidney cancer we
used the Suppression Subtractive Hybridization (SSH) procedure
using cDNA derived from kidney cancer patient tissues.
[0393] The 161P2F10B SSH cDNA sequence was derived from a
subtraction consisting of a kidney cancer minus normal kidney and a
mixture of 9 normal tissues: stomach, skeletal muscle, lung, brain,
liver, kidney, pancreas, small intestine and heart. By RT-PCR, the
161P2F10B cDNA was identified as highly expressed in kidney cancer
pool, with lower expression detected in prostate cancer xenograft
pool, prostate cancer pool, colon cancer pool, lung cancer pool,
ovary cancer pool, breast cancer pool, metastasis cancer pool,
pancreas cancer pool, 2 different prostate cancer metastasis to
lymph node, VP1 and VP2. (FIG. 10).
[0394] The 161P2F10B SSH cDNA sequence of 182 by matches the cDNA
for phosphodiesterase I/nucleotide pyrophosphatase 3 (PDNP3). The
full length 161P2F10B cDNA and ORF are described in FIG. 2 with the
protein sequence listed in FIG. 3.
[0395] Materials and Methods
[0396] RNA Isolation:
[0397] Tumor tissues were homogenized in TRIZOL reagent (Life
Technologies, Gibco BRL) using 10 ml/g tissue or 10 ml/10.sup.8
cells to isolate total RNA. Poly A RNA was purified from total RNA
using Qiagen's OLIGOTEX mRNA Mini and Midi kits. Total and mRNA
were quantified by spectrophotometric analysis (O.D. 260/280 nm)
and analyzed by gel electrophoresis.
[0398] Oligonucleotides:
[0399] The following HPLC purified oligonucleotides were used.
TABLE-US-00002 DPNCDN (cDNA synthesis primer): (SEQ ID NO: 752)
5'TTTTGATCAAGCTT.sub.303' Adaptor 1: (SEQ ID NO: 715
5'CTAATACGACTCACTATAGGGCTCGAGCGGCCGCCCGGGCAG3' (SEQ ID NO: 754)
3'GGCCCGTCCTAG5' Adaptor 2: (SEQ ID NO: 717
5'GTAATACGACTCACTATAGGGCAGCGTGGTCGCGGCCGAG3' (SEQ ID NO: 756)
3'CGGCTCCTAG5' PCR primer 1: (SEQ ID NO: 757)
5'CTAATACGACTCACTATAGGGC3' Nested primer (NP)1: (SEQ ID NO: 758)
5'TCGAGCGGCCGCCCGGGCAGGA3' Nested primer (NP)2: (SEQ ID NO: 759)
5'AGCGTGGTCGCGGCCGAGGA3'
[0400] Suppression Subtractive Hybridization:
[0401] Suppression Subtractive Hybridization (SSH) was used to
identify cDNAs corresponding to genes that may be differentially
expressed in prostate cancer. The SSH reaction utilized cDNA from
kidney cancer patient specimens. The gene 161P2F10B was derived
from kidney cancer patient tissues minus normal kidney and a
mixture of 9 normal tissues: stomach, skeletal muscle, lung, brain,
liver, kidney, pancreas, small intestine and heart. The SSH DNA
sequence (FIG. 1) was identified.
[0402] The cDNA derived from kidney cancer patient tissues was used
as the source of the "driver" cDNA, while the cDNA from normal
tissues was used as the source of the "tester" cDNA. Double
stranded cDNAs corresponding to tester and driver cDNAs were
synthesized from 2 .mu.g of poly(A).sup.+ RNA isolated from the
relevant tissue, as described above, using CLONTECH's PCR-Select
cDNA Subtraction Kit and 1 ng of oligonucleotide DPNCDN as primer.
First- and second-strand synthesis were carried out as described in
the Kit's user manual protocol (CLONTECH Protocol No. PT1117-1,
Catalog No. K1804-1). The resulting cDNA was digested with Dpn II
for 3 hrs at 37.degree. C. Digested cDNA was extracted with
phenol/chloroform (1:1) and ethanol precipitated.
[0403] Tester cDNA was generated by diluting 1 .mu.l of Dpn II
digested cDNA from the relevant tissue source (see above) (400 ng)
in 5 .mu.l of water. The diluted cDNA (2 .mu.l, 160 ng) was then
ligated to 2 .mu.l of Adaptor 1 and Adaptor 2 (10 .mu.M), in
separate ligation reactions, in a total volume of 10 .mu.l at
16.degree. C. overnight, using 400 u of T4 DNA ligase (CLONTECH).
Ligation was terminated with 1 .mu.l of 0.2 M EDTA and heating at
72.degree. C. for 5 min.
[0404] The first hybridization was performed by adding 1.5 .mu.l
(600 ng) of driver cDNA to each of two tubes containing 1.5 .mu.l
(20 ng) Adaptor 1- and Adaptor 2-ligated tester cDNA. In a final
volume of 4 .mu.l, the samples were overlaid with mineral oil,
denatured in an MJ Research thermal cycler at 98.degree. C. for 1.5
minutes, and then were allowed to hybridize for 8 hrs at 68.degree.
C. The two hybridizations were then mixed together with an
additional 1 .mu.l of fresh denatured driver cDNA and were allowed
to hybridize overnight at 68.degree. C. The second hybridization
was then diluted in 200 .mu.l of 20 mM Hepes, pH 8.3, 50 mM NaCl,
0.2 mM EDTA, heated at 70.degree. C. for 7 min. and stored at
-20.degree. C.
[0405] PCR Amplification, Cloning and Sequencing of Gene Fragments
Generated from SSH:
[0406] To amplify gene fragments resulting from SSH reactions, two
PCR amplifications were performed. In the primary PCR reaction 1 pl
of the diluted final hybridization mix was added to 1 .mu.l of PCR
primer 1 (10 .mu.M), 0.5 .mu.l dNTP mix (10 .mu.M), 2.5 .mu.l
10.times. react (CLONTECH) and 0.5 .mu.l 50.times. Advantage cDNA
polymerase Mix (CLONTECH) in a final volume of 25 .mu.l. PCR 1 was
conducted using the following conditions: 75.degree. C. for 5 min.,
94.degree. C. for 25 sec., then 27 cycles of 94.degree. C. for 10
sec, 66.degree. C. for 30 sec, 72.degree. C. for 1.5 min. Five
seperate primary PCR reactions were performed for each experiment.
The products were pooled and diluted 1:10 with water. For the
secondary PCR reaction, 1 .mu.l from the pooled and diluted primary
PCR reaction was added to the same reaction mix as used for PCR 1,
except that primers NP1 and NP2 (10 .mu.M) were used instead of PCR
primer 1. PCR 2 was performed using 10-12 cycles of 94.degree. C.
for 10 sec, 68.degree. C. for 30 sec, and 72.degree. C. for 1.5
minutes. The PCR products were analyzed using 2% agarose gel
electrophoresis.
[0407] The PCR products were inserted into pCR2.1 using the T/A
vector cloning kit (Invitrogen). Transformed E. coli were subjected
to blue/white and ampicillin selection. White colonies were picked
and arrayed into 96 well plates and were grown in liquid culture
overnight. To identify inserts, PCR amplification was performed on
1 ml of bacterial culture using the conditions of PCR1 and NP1 and
NP2 as primers. PCR products were analyzed using 2% agarose gel
electrophoresis.
[0408] Bacterial clones were stored in 20% glycerol in a 96 well
format. Plasmid DNA was prepared, sequenced, and subjected to
nucleic acid homology searches of the GENBANK, dBest, and NCI-CGAP
databases.
[0409] RT-PCR Expression Analysis:
[0410] First strand cDNAs can be generated from 1 .mu.g of mRNA
with oligo (dT)12-18 priming using the Gibco-BRL Superscript
Preamplification system. The manufacturer's protocol was used which
included an incubation for 50 min at 42.degree. C. with reverse
transcriptase followed by RNAse H treatment at 37.degree. C. for 20
min. After completing the reaction, the volume can be increased to
200 .mu.l with water prior to normalization. First strand cDNAs
from 16 different normal human tissues can be obtained from
Clontech.
[0411] Normalization of the first strand cDNAs from multiple
tissues was performed by using the primers
5'atatcgccgcgctcgtcgtcgacaa3' (SEQ ID NO: 722) and
5'agccacacgcagctcattgtagaagg 3' (SEQ ID NO: 723) to amplify
.beta.-actin. First strand cDNA (5 .mu.l) were amplified in a total
volume of 50 .mu.l containing 0.4 .mu.M primers, 0.2 .mu.M each
dNTPs, 1.times.PCR buffer (Clontech, 10 mM Tris-HCl, 1.5 mM
MgCl.sub.2, 50 mM KCl, pH8.3) and 1.times. KLENTAQ DNA polymerase
(Clontech). Five .mu.l of the PCR reaction can be removed at 18,
20, and 22 cycles and used for agarose gel electrophoresis. PCR was
performed using an MJ Research thermal cycler under the following
conditions: Initial denaturation can be at 94.degree. C. for 15
sec, followed by a 18, 20, and 22 cycles of 94.degree. C. for 15,
65.degree. C. for 2 min, 72.degree. C. for 5 sec. A final extension
at 72.degree. C. was carried out for 2 min. After agarose gel
electrophoresis, the band intensities of the 283 by .beta.-actin
bands from multiple tissues were compared by visual inspection.
Dilution factors for the first strand cDNAs were calculated to
result in equal .beta.-actin band intensities in all tissues after
22 cycles of PCR. Three rounds of normalization can be required to
achieve equal band intensities in all tissues after 22 cycles of
PCR.
[0412] To determine expression levels of the 161P2F10B gene, 5
.mu.l of normalized first strand cDNA were analyzed by PCR using
26, and 30 cycles of amplification. Semi-quantitative expression
analysis can be achieved by comparing the PCR products at cycle
numbers that give light band intensities.
[0413] A typical RT-PCR expression analysis is shown in FIG. 10.
RT-PCR expression analysis was performed on first strand cDNAs
generated using pools of tissues from multiple samples. The cDNAs
were shown to be normalized using beta-actin PCR. Strong expression
of 161P2F10B was observed in kidney cancer pool. Expression was
also detected in VP1, prostate cancer xenograft pool, prostate
cancer pool and colon cancer pool. Low expression was observed in
VP2, lung cancer pool, ovary cancer pool, breast cancer pool,
metastasis pool, pancreas cancer pool, and in the 2 different
prostate cancer metastasis to lymph node.
Example 2
Full Length Cloning of 161P2F10B
[0414] To isolate genes that are involved in kidney cancer, an
experiment was conducted using kidney cancer patient specimens. The
gene 161P2F10B was derived from a subtraction consisting of kidney
cancer specimens, minus normal kidney mixed with a cocktail of 9
normal tissues: stomach, skeletal muscle, lung, brain, liver,
kidney, pancreas, small intestine and heart. The SSH DNA sequence
(FIG. 1) was designated 161P2F10B. cDNA clone 161P2F10B was cloned
from kidney cancer specimens (FIG. 2 and FIG. 3). 161P2F10B showed
homology to the gene ENPP3. The amino acid alignment of 161P2F10B
with ENPP3 is shown in FIG. 4 (also, see, e.g., Buhring, et al.,
Blood 97:3303-3305 (2001)).
[0415] 161P2F10B variant 1 was identified with a single base pair
variation at nucleotide position 408 with a G instead of an A when
compared to the published ENPP3 sequence (FIG. 2B, FIG. 3B). This
nucleotide variation coded for amino acid Lysine in variant 1,
compared to amino acid arginine in ENPP3.
Example 3
Chromosomal Localization of 161P2F10B
[0416] Chromosomal localization can implicate genes in disease
pathogenesis. Several chromosome mapping approaches are available
including fluorescent in situ hybridization (FISH), human/hamster
radiation hybrid (RH) panels (Walter et al., 1994; Nature Genetics
7:22; Research Genetics, Huntsville Ala.), human-rodent somatic
cell hybrid panels such as is available from the Coriell Institute
(Camden, N.J.), and genomic viewers utilizing BLAST homologies to
sequenced and mapped genomic clones (NCBI, Bethesda, Md.).
[0417] 161P2F10B maps to chromosome 6q22, using 161P2F10B sequence
and the NCBI BLAST tool.
Example 4
Expression Analysis of 161P2F10B in Normal Tissues and Patient
Specimens
[0418] Expression of 161P2F10B was analyzed as illustrated in FIG.
10. First strand cDNA was prepared from vital pool 1 (VP1: liver,
lung and kidney), vital pool 2 (VP2, pancreas, colon and stomach),
prostate xenograft pool (LAPC-4AD, LAPC-4AI, LAPC-9AD, LAPC-9AI),
prostate cancer pool, bladder cancer pool, kidney cancer pool,
colon cancer pool, lung cancer pool, ovary cancer pool, breast
cancer pool, metastasis cancer pool, pancreas cancer pool, and from
prostate cancer metastasis to lymph node from 2 different patients.
Normalization was performed by PCR using primers to actin and
GAPDH. Semi-quantitative PCR, using primers to 161P2F10B, was
performed at 26 and 30 cycles of amplification. Strong expression
of 161P2F10B was observed in kidney cancer pool. Expression was
also detected in VP1, prostate cancer xenograft pool, prostate
cancer pool and colon cancer pool. Low expression was observed in
VP2, lung cancer pool, ovary cancer pool, breast cancer pool,
metastasis pool, pancreas cancer pool, and in the 2 different
prostate cancer metastasis to lymph node.
[0419] Extensive northern blot analysis of 161P2F10B in 16 human
normal tissues confirms the expression observed by RT-PCR (FIG.
11). Two transcripts of 161P2F10B comigrating at approximately 4
kb, were detected in kidney, prostate and colon, and to lower
levels, in thymus
[0420] FIG. 12 shows expression of 161P2F10B in kidney cancer
xenografts. RNA was extracted from normal kidney (N), prostate
cancer xenografts, LAPC-4AD, LAPC-4AI, LAPC-9AD, and LAPC-9AI, and
2 kidney cancer xenografts (Ki Xeno-1 and Ki Xeno-2). Northern blot
with 10 .mu.g of total RNA/lane was probed with 161P2F10B sequence.
The results show expression of 161P2F10B in both kidney xenografts,
LAPC-4AI, LAPC-9AI, but not in normal kidney. The expression
detected in normal kidney after long exposure of the northern blot
in FIG. 11, but not in FIG. 12 suggests that 161P2F10B is expressed
at low levels in normal kidney, but is upregulated in kidney
cancer.
[0421] To test expression of 161P2F10B in patient cancer specimens,
RNA was extracted from a pool of three kidney cancer patients, as
well as from normal prostate (NP), normal bladder (NB), normal
kidney (NK), normal colon (NC). Northern blots with 10 .mu.g of
total RNA/lane were probed with 161P2F10B sequence (FIG. 13).
Results show expression of 161P2F10B in kidney cancer pool, but not
in any of the normal tissues tested.
[0422] Analysis of individual kidney cancer tissues by northern
blot shows expression of 161P2F10B in all 4 clear cell carcinoma
kidney tumors, but not in papillary carcinoma, kidney cancer cell
lines, nor in normal kidney tissues (FIG. 14).
[0423] Expression of 161P2F10B was also analyzed on kidney cancer
metastasis samples (FIG. 15). RNA was extracted from kidney cancer
metastasis to lung, kidney cancer metastasis to lymph node, normal
bladder (NB), normal kidney (NK), and normal lung (NL), normal
breast (NBr), normal ovary (NO), and normal pancreas (NPa).
Northern blots with 10 .mu.g of total RNA/lane were probed with
161P2F10B sequence. Results show strong expression of 161P2F10B in
both kidney cancer metastasis tissues tested. Weak expression is
detected in normal kidney and normal breast but not in other normal
tissues.
[0424] The restricted expression of 161P2F10B in normal tissues and
the upregulation detected in kidney cancer, in kidney cancer
metastasis, as well as in other cancers, suggest that 161P2F10B is
a potential therapeutic target and a diagnostic marker for human
cancers.
Example 5
Production of Recombinant 161P2F10B in Prokaryotic Systems
[0425] To express recombinant 161P2F10B in prokaryotic cells, the
full or partial length 161P2F10B cDNA sequences can be cloned into
any one of a variety of expression vectors known in the art. One or
more of the following regions of 161P2F10B are expressed in these
contructs, amino acids 1 to 875; or any 8, 9, 10, 11, 12, 13, 14,
15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or
more contiguous amino acids from 161P2F10B, variants, or analogs
thereof.
[0426] A. In vitro Transcription and Translation Constructs:
[0427] pCRII: To generate 161P2F10B sense and anti-sense RNA probes
for RNA in situ investigations, pCRII constructs (Invitrogen,
Carlsbad Calif.) are generated encoding either all or fragments of
the 161P2F10B cDNA. The pCRII vector has Sp6 and T7 promoters
flanking the insert to drive the transcription of 161P2F10B RNA for
use as probes in RNA in situ hybridization experiments. These
probes are used to analyze the cell and tissue expression of
161P2F10B at the RNA level. Transcribed 161P2F10B RNA representing
the cDNA amino acid coding region of the 161P2F10B gene is used in
in vitro translation systems such as the TnT.TM. Coupled
Reticulolysate System (Promega, Corp., Madison, Wis.) to synthesize
161P2F10B protein.
[0428] B. Bacterial Constructs:
[0429] pGEX Constructs: To generate recombinant 161P2F10B proteins
in bacteria that are fused to the Glutathione S-transferase (GST)
protein, all or parts of the 161P2F10B cDNA protein coding sequence
are fused to the GST gene by cloning into pGEX-6P-1 or any other
GST-fusion vector of the pGEX family (Amersham Pharmacia Biotech,
Piscataway, N.J.). These constructs allow controlled expression of
recombinant 161P2F10B protein sequences with GST fused at the
amino-terminus and a six histidine epitope (6.times. His) at the
carboxyl-terminus The GST and 6.times. His tags permit purification
of the recombinant fusion protein from induced bacteria with the
appropriate affinity matrix and allow recognition of the fusion
protein with anti-GST and anti-His antibodies. The 6.times. His tag
is generated by adding 6 histidine codons to the cloning primer at
the 3' end, e.g., of the open reading frame (ORF). A proteolytic
cleavage site, such as the PreScission.TM. recognition site in
pGEX-6P-1, may be employed such that it permits cleavage of the GST
tag from 161P2F10B-related protein. The ampicillin resistance gene
and pBR322 origin permits selection and maintenance of the pGEX
plasmids in E. coli.
[0430] pMAL Constructs: To generate, in bacteria, recombinant
161P2F10B proteins that are fused to maltose-binding protein (MBP),
all or parts of the 161P2F10B cDNA protein coding sequence are
fused to the MBP gene by cloning into the pMAL-c2X and pMAL-p2X
vectors (New England Biolabs, Beverly, Mass.). These constructs
allow controlled expression of recombinant 161P2F10B protein
sequences with MBP fused at the amino-terminus and a 6.times. His
epitope tag at the carboxyl-terminus The MBP and 6.times. His tags
permit purification of the recombinant protein from induced
bacteria with the appropriate affinity matrix and allow recognition
of the fusion protein with anti-MBP and anti-His antibodies. The
6.times. His epitope tag is generated by adding 6 histidine codons
to the 3' cloning primer. A Factor Xa recognition site permits
cleavage of the pMAL tag from 161P2F10B. The pMAL-c2X and pMAL-p2X
vectors are optimized to express the recombinant protein in the
cytoplasm or periplasm respectively. Periplasm expression enhances
folding of proteins with disulfide bonds.
[0431] pET Constructs: To express 161P2F10B in bacterial cells, all
or parts of the 161P2F10B cDNA protein coding sequence are cloned
into the pET family of vectors (Novagen, Madison, Wis.). These
vectors allow tightly controlled expression of recombinant
161P2F10B protein in bacteria with and without fusion to proteins
that enhance solubility, such as NusA and thioredoxin (Trx), and
epitope tags, such as 6.times. His and S-Tag.TM. that aid
purification and detection of the recombinant protein. For example,
constructs are made utilizing pET NusA fusion system 43.1 such that
regions of the 161P2F10B protein are expressed as amino-terminal
fusions to NusA.
[0432] C. Yeast Constructs:
[0433] pESC Constructs: To express 161P2F10B in the yeast species
Saccharomyces cerevisiae for generation of recombinant protein and
functional studies, all or parts of the 161P2F10B cDNA protein
coding sequence are cloned into the pESC family of vectors each of
which contain 1 of 4 selectable markers, HIS3, TRP1, LEU2, and URA3
(Stratagene, La Jolla, Calif.). These vectors allow controlled
expression from the same plasmid of up to 2 different genes or
cloned sequences containing either Flag.TM. or Myc epitope tags in
the same yeast cell. This system is useful to confirm
protein-protein interactions of 161P2F10B. In addition, expression
in yeast yields similar post-translational modifications, such as
glycosylations and phosphorylations, that are found when expressed
in eukaryotic cells.
[0434] pESP Constructs: To express 161P2F10B in the yeast species
Saccharomyces pombe, all or parts of the 161P2F10B cDNA protein
coding sequence are cloned into the pESP family of vectors. These
vectors allow controlled high level of expression of a 161P2F10B
protein sequence that is fused at either the amino terminus or at
the carboxyl terminus to GST which aids purification of the
recombinant protein. A Flag.TM. epitope tag allows detection of the
recombinant protein with anti-Flag.TM. antibody.
Example 6
Production of Recombinant 161P2F10B in Eukaryotic Systems
[0435] A. Mammalian Constructs:
[0436] To express recombinant 161P2F10B in eukaryotic cells, the
full or partial length 161P2F10B cDNA sequences can be cloned into
any one of a variety of expression vectors known in the art. One or
more of the following regions of 161P2F10B are expressed in these
constructs, amino acids 1 to 875; or any 8, 9, 10, 11, 12, 13, 14,
15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or
more contiguous amino acids from 161P2F10B, variants, or analogs
thereof.
[0437] The constructs can be transfected into any one of a wide
variety of mammalian cells such as 293T cells. Transfected 293T
cell lysates can be probed with the anti-161P2F10B polyclonal
serum, described herein.
[0438] pcDNA4/HisMax Constructs: To express 161P2F10B in mammalian
cells, the 161P2F10B ORF, or portions thereof, of 161P2F10B are
cloned into pcDNA4/HisMax Version A (Invitrogen, Carlsbad, Calif.).
Protein expression is driven from the cytomegalovirus (CMV)
promoter and the SP16 translational enhancer. The recombinant
protein has Xpress.TM. and six histidine (6.times. His) epitopes
fused to the amino-terminus The pcDNA4/HisMax vector also contains
the bovine growth hormone (BGH) polyadenylation signal and
transcription termination sequence to enhance mRNA stability along
with the SV40 origin for episomal replication and simple vector
rescue in cell lines expressing the large T antigen. The Zeocin
resistance gene allows for selection of mammalian cells expressing
the protein and the ampicillin resistance gene and ColE1 origin
permits selection and maintenance of the plasmid in E. coli.
[0439] pcDNA3.1/MycHis Constructs: To express 161P2F10B in
mammalian cells, the 161P2F10B ORF, or portions thereof, of
161P2F10B with a consensus Kozak translation initiation site are
cloned into pcDNA3.1/MycHis Version A (Invitrogen, Carlsbad,
Calif.). Protein expression is driven from the cytomegalovirus
(CMV) promoter. The recombinant proteins have the myc epitope and
6.times. His epitope fused to the carboxyl-terminus. The
pcDNA3.1/MycHis vector also contains the bovine growth hormone
(BGH) polyadenylation signal and transcription termination sequence
to enhance mRNA stability, along with the SV40 origin for episomal
replication and simple vector rescue in cell lines expressing the
large T antigen. The Neomycin resistance gene can be used, as it
allows for selection of mammalian cells expressing the protein and
the ampicillin resistance gene and ColE1 origin permits selection
and maintenance of the plasmid in E. coli.
[0440] pcDNA3.1/CT-GFP-TOPO Construct: To express 161P2F10B in
mammalian cells and to allow detection of the recombinant proteins
using fluorescence, the 161P2F10B ORF, or portions thereof, of
161P2F10B with a consensus Kozak translation initiation site are
cloned into pcDNA3.1/CT-GFP-TOPO (Invitrogen, CA). Protein
expression is driven from the cytomegalovirus (CMV) promoter. The
recombinant proteins have the Green Fluorescent Protein (GFP) fused
to the carboxyl-terminus facilitating non-invasive, in vivo
detection and cell biology studies. The pcDNA3.1CT-GFP-TOPO vector
also contains the bovine growth hormone (BGH) polyadenylation
signal and transcription termination sequence to enhance mRNA
stability along with the SV40 origin for episomal replication and
simple vector rescue in cell lines expressing the large T antigen.
The Neomycin resistance gene allows for selection of mammalian
cells that express the protein, and the ampicillin resistance gene
and ColE1 origin permits selection and maintenance of the plasmid
in E. coli. Additional constructs with an amino-terminal GFP fusion
are made in pcDNA3.1/NT-GFP-TOPO spanning the entire length of the
161P2F10B proteins.
[0441] PAPtag: The 161P2F10B ORF, or portions thereof, of 161P2F10B
are cloned into pAPtag-5 (GenHunter Corp. Nashville, Tenn.). This
construct generates an alkaline phosphatase fusion at the
carboxyl-terminus of the 161P2F10B proteins while fusing the
IgG.kappa. signal sequence to the amino-terminus. Constructs are
also generated in which alkaline phosphatase with an amino-terminal
IgG.kappa. signal sequence is fused to the amino-terminus of
161P2F10B proteins. The resulting recombinant 161P2F10B proteins
are optimized for secretion into the media of transfected mammalian
cells and can be used to identify proteins such as ligands or
receptors that interact with the 161P2F10B proteins. Protein
expression is driven from the CMV promoter and the recombinant
proteins also contain myc and 6.times. His epitopes fused at the
carboxyl-terminus that facilitates detection and purification. The
Zeocin resistance gene present in the vector allows for selection
of mammalian cells expressing the recombinant protein and the
ampicillin resistance gene permits selection of the plasmid in E.
coli.
[0442] ptag5: The 161P2F10B ORF, or portions thereof, of 161P2F10B
are cloned into pTag-5. This vector is similar to pAPtag but
without the alkaline phosphatase fusion. This construct generates
161P2F10B protein with an amino-terminal IgG.kappa. signal sequence
and myc and 6.times. His epitope tags at the carboxyl-terminus that
facilitate detection and affinity purification. The resulting
recombinant 161P2F10B protein is optimized for secretion into the
media of transfected mammalian cells, and is used as immunogen or
ligand to identify proteins such as ligands or receptors that
interact with the 161P2F10B proteins. Protein expression is driven
from the CMV promoter. The Zeocin resistance gene present in the
vector allows for selection of mammalian cells expressing the
protein, and the ampicillin resistance gene permits selection of
the plasmid in E. coli.
[0443] PsecFc: The 161P2F10B ORF, or portions thereof, of 161P2F10B
were cloned into psecFc. The psecFc vector was assembled by cloning
the human immunoglobulin G1 (IgG) Fc (hinge, CH2, CH3 regions) into
pSecTag2 (Invitrogen, California). This construct generates an IgG1
Fc fusion at the amino-terminus of the 161P2F10B proteins.
161P2F10B fusions utilizing the murine IgG1 Fc region are also
used. The resulting recombinant 161P2F10B proteins are optimized
for secretion into the media of transfected mammalian cells, and
can be used as immunogens or to identify proteins such as ligands
or receptors that interact with the 161P2F10B protein. Protein
expression is driven from the CMV promoter. The hygromycin
resistance gene present in the vector allows for selection of
mammalian cells that express the recombinant protein, and the
ampicillin resistance gene permits selection of the plasmid in E.
coli.
[0444] pSR.alpha. Constructs: To generate mammalian cell lines that
express 161P2F10B constitutively, 161P2F10B ORF, or portions
thereof, of 161P2F10B are cloned into pSR.alpha. constructs.
Amphotropic and ecotropic retroviruses are generated by
transfection of pSR.alpha. constructs into the 293T-10A1 packaging
line or co-transfection of pSR.alpha. and a helper plasmid
(containing deleted packaging sequences) into the 293 cells,
respectively. The retrovirus is used to infect a variety of
mammalian cell lines, resulting in the integration of the cloned
gene, 161P2F10B, into the host cell-lines. Protein expression is
driven from a long terminal repeat (LTR). The Neomycin resistance
gene present in the vector allows for selection of mammalian cells
that express the protein, and the ampicillin resistance gene and
ColE1 origin permit selection and maintenance of the plasmid in E.
coli. The retroviral vectors can thereafter be used for infection
and generation of various cell lines using, for example, PC3, NIH
3T3, TsuPr1, 293 or rat-1 cells.
[0445] Additional pSR.alpha. constructs are made that fuse an
epitope tag such as the FLAG.TM. tag to the carboxyl-terminus of
161P2F10B sequences to allow detection using anti-Flag antibodies.
For example, the FLAG.TM. sequence 5' gat tac aag gat gac gac gat
aag 3' (SEQ. ID. No. 764) is added to cloning primer at the 3' end
of the ORF. Additional pSR.alpha. constructs are made to produce
both amino-terminal and carboxyl-terminal GFP and myc/6.times. His
fusion proteins of the full-length 161P2F10B proteins.
[0446] Additional Viral Vectors: Additional constructs are made for
viral-mediated delivery and expression of 161P2F10B. High virus
titer leading to high level expression of 161P2F10B is achieved in
viral delivery systems such as adenoviral vectors and herpes
amplicon vectors. The 161P2F10B coding sequences or fragments
thereof are amplified by PCR and subcloned into the ADEASY shuttle
vector (Stratagene). Recombination and virus packaging are
performed according to the manufacturer's instructions to generate
adenoviral vectors. Alternatively, 161P2F10B coding sequences or
fragments thereof are cloned into the HSV-1 vector (Imgenex) to
generate herpes viral vectors. The viral vectors are thereafter
used for infection of various cell lines such as PC3, NIH 3T3, 293
or rat-1 cells.
[0447] Regulated Expression Systems: To control expression of
161P2F10B in mammalian cells, coding sequences of 161P2F10B, or
portions thereof, are cloned into regulated mammalian expression
systems such as the T-Rex System (Invitrogen), the GeneSwitch
System (Invitrogen) and the tightly-regulated Ecdysone System
(Sratagene). These systems allow the study of the temporal and
concentration dependent effects of recombinant 161P2F10B. These
vectors are thereafter used to control expression of 161P2F10B in
various cell lines such as PC3, NIH 3T3, 293 or rat-1 cells.
[0448] B. Baculovirus Expression Systems
[0449] To generate recombinant 161P2F10B proteins in a Baculovirus
expression system, 161P2F10B ORF, or portions thereof, are cloned
into the Baculovirus transfer vector pBlueBac 4.5 (Invitrogen),
which provides a His-tag at the N-terminus. Specifically,
pBlueBac-161P2F10B is co-transfected with helper plasmid
pBac-N-Blue (Invitrogen) into SF9 (Spodoptera frugiperda) insect
cells to generate recombinant Baculovirus (see Invitrogen
instruction manual for details). Baculovirus is then collected from
cell supernatant and purified by plaque assay.
[0450] Recombinant 161P2F10B protein is then generated by infection
of HighFive insect cells (Invitrogen) with purified Baculovirus.
Recombinant 161P2F10B protein can be detected using anti-161P2F10B
or anti-His-tag antibody. 161P2F10B protein can be purified and
used in various cell-based assays or as immunogen to generate
polyclonal and monoclonal antibodies specific for 161P2F10B.
Example 7
Antigenicity Profiles and Secondary Structure
[0451] FIG. 5, FIG. 6, FIG. 7, FIG. 8, and FIG. 9 depict
graphically five amino acid profiles of the 161P2F10B amino acid
sequence, each assessment available by accessing the ProtScale
website on the ExPasy molecular biology server.
[0452] These profiles: FIG. 5, Hydrophilicity, (Hopp T. P., Woods
K. R., 1981. Proc. Natl. Acad. Sci. U.S.A. 78:3824-3828); FIG. 6,
Hydropathicity, (Kyte J., Doolittle R. F., 1982. J. Mol. Biol.
157:105-132); FIG. 7, Percentage Accessible Residues (Janin J.,
1979 Nature 277:491-492); FIG. 8, Average Flexibility, (Bhaskaran
R., and Ponnuswamy P. K., 1988. Int. J. Pept. Protein Res.
32:242-255); FIG. 9, Beta-turn (Deleage, G., Roux B. 1987 Protein
Engineering 1:289-294); and optionally others available in the art,
such as on the ProtScale website, were used to identify antigenic
regions of the 161P2F10B protein. Each of the above amino acid
profiles of 161P2F10B were generated using the following ProtScale
parameters for analysis: 1) A window size of 9; 2) 100% weight of
the window edges compared to the window center; and, 3) amino acid
profile values normalized to lie between 0 and 1.
[0453] Hydrophilicity (FIG. 5), Hydropathicity (FIG. 6) and
Percentage Accessible Residues (FIG. 7) profiles were used to
determine stretches of hydrophilic amino acids (i.e., values
greater than 0.5 on the Hydrophilicity and Percentage Accessible
Residues profile, and values less than 0.5 on the Hydropathicity
profile). Such regions are likely to be exposed to the aqueous
environment, be present on the surface of the protein, and thus
available for immune recognition, such as by antibodies.
[0454] Average Flexibility (FIG. 8) and Beta-turn (FIG. 9) profiles
determine stretches of amino acids (i.e., values greater than 0.5
on the Beta-turn profile and the Average Flexibility profile) that
are not constrained in secondary structures such as beta sheets and
alpha helices. Such regions are also more likely to be exposed on
the protein and thus accessible to immune recognition, such as by
antibodies.
[0455] Antigenic sequences of the 161P2F10B protein indicated,
e.g., by the profiles set forth in FIG. 5, FIG. 6, FIG. 7, FIG. 8,
and/or FIG. 9 are used to prepare immunogens, either peptides or
nucleic acids that encode them, to generate therapeutic and
diagnostic anti-161P2F10B antibodies. The immunogen can be any 5,
6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23,
24, 25, 30, 35, 40, 45, 50 or more than 50 contiguous amino acids,
or the corresponding nucleic acids that encode them, from the
161P2F10B protein. In particular, peptide immunogens of the
invention can comprise, a peptide region of at least 5 amino acids
of FIG. 2 in any whole number increment up to 875 that includes an
amino acid position having a value greater than 0.5 in the
Hydrophilicity profile of FIG. 5; a peptide region of at least 5
amino acids of FIG. 2 in any whole number increment up to 875 that
includes an amino acid position having a value less than 0.5 in the
Hydropathicity profile of FIG. 6; a peptide region of at least 5
amino acids of FIG. 2 in any whole number increment up to 875 that
includes an amino acid position having a value greater than 0.5 in
the Percent Accessible Residues profile of FIG. 7; a peptide region
of at least 5 amino acids of FIG. 2 in any whole number increment
up to 875 that includes an amino acid position having a value
greater than 0.5 in the Average Flexibility profile on FIG. 8; and,
a peptide region of at least 5 amino acids of FIG. 2 in any whole
number increment up to 875 that includes an amino acid position
having a value greater than 0.5 in the Beta-turn profile of FIG. 9.
Peptide immunogens of the invention can also comprise nucleic acids
that encode any of the forgoing.
[0456] All immunogens of the invention, peptide or nucleic acid,
can be embodied in human unit dose form, or comprised by a
composition that includes a pharmaceutical excipient compatible
with human physiology.
[0457] The secondary structure of 161P2F10B, namely the predicted
presence and location of alpha helices, extended strands, and
random coils, is predicted from the primary amino acid sequence
using the HNN--Hierarchical Neural Network method (Guermeur, 1997),
accessed from the ExPasy molecular biology server. The analysis
indicates that 161P2F10B is composed 31.31% alpha helix, 11.31%
extended strand, and 57.37% random coil (FIG. 19A).
[0458] Analysis for the potential presence of transmembrane domains
in 161P2F10B was carried out using a variety of transmembrane
prediction algorithms accessed from the ExPasy molecular biology
server. The programs predict the presence of 1 transmembrane domain
in 161P2F10B, consistent with that of a Type II cell surface
protein. Shown graphically in FIG. 19 are the results of analysis
using the TMpred (FIG. 19B) and TMHMM (FIG. 19C) prediction
programs depicting the location of the transmembrane domain. The
results of each program, namely the amino acids encoding the
transmembrane domain are summarized in Table XXI.
Example 8
Generation of 161P2F10B Polyclonal Antibodies
[0459] Polyclonal antibodies can be raised in a mammal, for
example, by one or more injections of an immunizing agent and, if
desired, an adjuvant. Typically, the immunizing agent and/or
adjuvant will be injected in the mammal by multiple subcutaneous or
intraperitoneal injections. In addition to immunizing with the full
length 161P2F10B protein, computer algorithms are employed in
design of immunogens that, based on amino acid sequence analysis
contain characteristics of being antigenic and available for
recognition by the immune system of the immunized host (see the
Example entitled "Antigenicity Profiles"). Such regions would be
predicted to be hydrophilic, flexible, in beta-turn conformations,
and be exposed on the surface of the protein (see, e.g., FIG. 5,
FIG. 6, FIG. 7, FIG. 8, or FIG. 9 for amino acid profiles that
indicate such regions of 161P2F10B).
[0460] For example, 161P2F10B recombinant bacterial fusion proteins
or peptides containing hydrophilic, flexible, beta-turn regions of
the 161P2F10B, in which numerous regions are found in the predicted
extracellular domain coded by amino acids 45-870, are used as
antigens to generate polyclonal antibodies in New Zealand White
rabbits. For example, such regions include, but are not limited to,
amino acids 43-93, 100-134, 211-246, 467-492, 500-517, and amino
acids 810-870. In addition, recombinant proteins are made that
encode the whole extracellular domain, amino acids 45-870, or
halves of the domain, such as amino acids 45-450 and amino acids
451-870. Antigens are also created encoding the Somatomedin-B-like
domain (amino acids 53-133), the catalytic domain (amino acids
158-538), and the nuclease like domain (amino acids 609-875) of
161P2F10B (Bollen et. al., 2000. Crit. Rev. Biochem. Mol. Biol.,
35: 393-432), in order to generate antibodies specific to these
regions. Ideally antibodies are raised to non-conserved regions of
these domains such that they do not crossreact with other
homologous nucleotide pyrophosphatases/phosphodiesterases. It is
useful to conjugate the immunizing agent to a protein known to be
immunogenic in the mammal being immunized. Examples of such
immunogenic proteins include, but are not limited to, keyhole
limpet hemocyanin (KLH), serum albumin, bovine thyroglobulin, and
soybean trypsin inhibitor. In one embodiment, a peptide encoding
amino acids 500-517 of 161P2F10B is conjugated to KLH and used to
immunize the rabbit. Alternatively the immunizing agent may include
all or portions of the 161P2F10B protein, analogs or fusion
proteins thereof. For example, the 161P2F10B amino acid sequence
can be fused using recombinant DNA techniques to any one of a
variety of fusion protein partners that are well known in the art,
such as glutathione-S-transferase (GST) and HIS tagged fusion
proteins. Such fusion proteins are purified from induced bacteria
using the appropriate affinity matrix.
[0461] In one embodiment, a GST-fusion protein encoding amino acids
45-875 is produced and purified and used as immunogen. Other
recombinant bacterial fusion proteins that may be employed include
maltose binding protein, LacZ, thioredoxin, NusA, or an
immunoglobulin constant region (see the section entitled
"Production of 161P2F10B in Prokaryotic Systems" and Current
Protocols In Molecular Biology, Volume 2, Unit 16, Frederick M.
Ausubul et al. eds., 1995; Linsley, P. S., Brady, W., Urnes, M.,
Grosmaire, L., Damle, N., and Ledbetter, L. (1991) J. Exp. Med.
174, 561-566).
[0462] In addition to bacterial derived fusion proteins, mammalian
expressed protein antigens are also used. These antigens are
expressed from mammalian expression vectors such as the TagS and
Fc-fusion vectors (see the section entitled "Production of
Recombinant 161P2F10B in Eukaryotic Systems"), and retain
post-translational modifications such as glycosylations found in
native protein. In one embodiment, amino acids 45-875 is cloned
into the TagS mammalian secretion vector. The recombinant protein
is purified by metal chelate chromatography from tissue culture
supernatants of 293T cells stably expressing the recombinant
vector. The purified TagS 161P2F10B protein is then used as
immunogen.
[0463] During the immunization protocol, it is useful to mix or
emulsify the antigen in adjuvants that enhance the immune response
of the host animal. Examples of adjuvants include, but are not
limited to, complete Freund's adjuvant (CFA) and MPL-TDM adjuvant
(monophosphoryl Lipid A, synthetic trehalose dicorynomycolate).
[0464] In a typical protocol, rabbits are initially immunized
subcutaneously with up to 200 .mu.g, typically 100-200 .mu.g, of
fusion protein or peptide conjugated to KLH mixed in complete
Freund's adjuvant (CFA). Rabbits are then injected subcutaneously
every two weeks with up to 200 .mu.g, typically 100-200 .mu.g, of
the immunogen in incomplete Freund's adjuvant (IFA). Test bleeds
are taken approximately 7-10 days following each immunization and
used to monitor the titer of the antiserum by ELISA.
[0465] To test reactivity and specificity of immune serum, such as
the rabbit serum derived from immunization with TagS 161P2F10B
encoding amino acids 58-538, the full-length 161P2F10B cDNA is
cloned into pCDNA 3.1 myc-his expression vector (Invitrogen, see
the Example entitled "Production of Recombinant 161P2F10B in
Eukaryotic Systems"). After transfection of the constructs into
293T cells, cell lysates are probed with the anti-161P2F10B serum
and with anti-His antibody (Santa Cruz Biotechnologies, Santa Cruz,
Calif.) to determine specific reactivity to denatured 161P2F10B
protein using the Western blot technique. Immunoprecipitation and
flow cytometric analyses of 293T and other recombinant
161P2F10B-expressing cells determine recognition of native protein
by the antiserum. In addition, Western blot, immunoprecipitation,
fluorescent microscopy, and flow cytometric techniques using cells
that endogenously express 161P2F10B are carried out to test
specificity.
[0466] The anti-serum from the TagS 161P2F10B immunized rabbit is
affinity purified by passage over a column composed of the TagS
antigen covalently coupled to Affigel matrix (BioRad, Hercules,
Calif.). The serum is then further purified by protein G affinity
chromatography to isolate the IgG fraction. Serum from rabbits
immunized with fusion proteins, such as GST and MBP fusion
proteins, are purified by depletion of antibodies reactive to the
fusion partner sequence by passage over an affinity column
containing the fusion partner either alone or in the context of an
irrelevant fusion protein. Sera from other His-tagged antigens and
peptide immunized rabbits as well as fusion partner depleted sera
are affinity purified by passage over a column matrix composed of
the original protein immunogen or free peptide.
Example 9
Generation of 161P2F10B Monoclonal Antibodies (mAbs)
[0467] In one embodiment, therapeutic mAbs to 161P2F10B comprise
those that react with epitopes of the protein that would disrupt or
modulate the biological function of 161P2F10B, for example those
that would disrupt its catalytic activity or its interaction with
ligands or proteins that mediate its biological activity.
Therapeutic mAbs also comprise those that specifically bind
epitopes of 161P2F10B exposed on the cell surface and thus are
useful in targeting mAb-toxin conjugates Immunogens for generation
of such mAbs include those designed to encode or contain the entire
161P2F10B protein, the predicted extracellular domain (amino acids
45-875), predicted functional domains such as the
somatomedin-B-like domain (amino acids 53-133), the catalytic
domain (amino acids 158-538), or the nuclease-like domain (amino
acids 609-875), or regions of the 161P2F10B protein predicted to be
antigenic from computer analysis of the amino acid sequence (see,
e.g., FIG. 5, FIG. 6, FIG. 7, FIG. 8, or FIG. 9, and the Example
entitled "Antigenicity Profiles") Immunogens include peptides,
recombinant bacterial proteins, and mammalian expressed Tag 5
proteins and human and murine IgG FC fusion proteins. In addition,
cells expressing high levels of 161P2F10B, such as 293T-161P2F10B
or 300.19-161P2F10B murine Pre-B cells, are used to immunize
mice.
[0468] To generate mAbs to 161P2F10B, mice are first immunized
intraperitoneally (IP) with, typically, 10-50 .mu.g of protein
immunogen or 10.sup.7 161P2F10B-expressing cells mixed in complete
Freund's adjuvant. Alternatively, mice are immunized intradermally
for lymph node fusions. Mice are then subsequently immunized IP
every 2-4 weeks with, typically, 10-50 .mu.g of protein immunogen
or 10.sup.7 cells mixed in incomplete Freund's adjuvant.
Alternatively, MPI TDM adjuvant is used in immunizations. In
addition to the above protein and cell-based immunization
strategies, a DNA-based immunization protocol is employed in which
a mammalian expression vector encoding 161P2F10B sequence is used
to immunize mice by direct injection of the plasmid DNA. For
example, the catalytic domain of 161P2F10B, amino acids 158-538, is
cloned into the TagS mammalian secretion vector and the recombinant
vector is used as immunogen. In another example the same amino
acids are cloned into an Fc-fusion secretion vector in which the
161P2F10B sequence is fused at the amino-terminus to an IgK leader
sequence and at the carboxyl-terminus to the coding sequence of the
human or murine IgG Fc region. This recombinant vector is then used
as immunogen. The plasmid immunization protocols are used in
combination with purified proteins expressed from the same vector
and with cells expressing 161P2F10B.
[0469] During the immunization protocol, test bleeds are taken 7-10
days following an injection to monitor titer and specificity of the
immune response. Once appropriate reactivity and specificity is
obtained as determined by ELISA, Western blotting,
immunoprecipitation, fluorescence microscopy, and flow cytometric
analyses, fusion and hybridoma generation is then carried out with
established procedures well known in the art (see, e.g., Harlow and
Lane, 1988).
[0470] In one embodiment for generating 161P2F10B monoclonal
antibodies, a TagS-161P2F10B antigen encoding amino acids 158-538
is expressed and purified from stably transfected 293T cells. Balb
C mice are initially immunized intraperitoneally with 25 .mu.g of
the TagS-161P2F10B protein mixed in complete Freund's adjuvant.
Mice are subsequently immunized every two weeks with 25 .mu.g of
the antigen mixed in incomplete Freund's adjuvant for a total of
three immunizations. ELISA using the TagS antigen determines the
titer of serum from immunized mice. Reactivity and specificity of
serum to full length 161P2F10B protein is monitored by Western
blotting, immunoprecipitation and flow cytometry using 293T cells
transfected with an expression vector encoding the 161P2F10B cDNA
(see e.g., the Example entitled "Production of Recombinant
161P2F10B in Eukaryotic Systems"). Other recombinant
161P2F10B-expressing cells or cells endogenously expressing
161P2F10B are also used. Mice showing the strongest reactivity are
rested and given a final injection of TagS antigen in PBS and then
sacrificed four days later. The spleens of the sacrificed mice are
harvested and fused to SPO/2 myeloma cells using standard
procedures (Harlow and Lane, 1988). Supernatants from HAT selected
growth wells are screened by ELISA, Western blot,
immunoprecipitation, fluorescent microscopy, and flow cytometry to
identify 161P2F10B specific antibody-producing clones.
[0471] The binding affinity of a 161P2F10B monoclonal antibody is
determined using standard technologies. Affinity measurements
quantify the strength of antibody to epitope binding and are used
to help define which 161P2F10B monoclonal antibodies preferred for
diagnostic or therapeutic use, as appreciated by one of skill in
the art. The BIACORE system (Uppsala, Sweden) is a preferred method
for determining binding affinity. The BIACORE system uses surface
plasmon resonance (SPR, Welford K. 1991, Opt. Quant. Elect. 23:1;
Morton and Myszka, 1998, Methods in Enzymology 295: 268) to monitor
biomolecular interactions in real time. BIACORE analysis
conveniently generates association rate constants, dissociation
rate constants, equilibrium dissociation constants, and affinity
constants.
Example 10
HLA Class I and Class II Binding Assays
[0472] HLA class I and class II binding assays using purified HLA
molecules are performed in accordance with disclosed protocols
(e.g., PCT publications WO 94/20127 and WO 94/03205; Sidney et al.,
Current Protocols in Immunology 18.3.1 (1998); Sidney, et al., J.
Immunol. 154:247 (1995); Sette, et al., Mol. Immunol. 31:813
(1994)). Briefly, purified MHC molecules (5 to 500 nM) are
incubated with various unlabeled peptide inhibitors and 1-10 nM
.sup.125I-radiolabeled probe peptides as described. Following
incubation, MHC-peptide complexes are separated from free peptide
by gel filtration and the fraction of peptide bound is determined.
Typically, in preliminary experiments, each MHC preparation is
titered in the presence of fixed amounts of radiolabeled peptides
to determine the concentration of HLA molecules necessary to bind
10-20% of the total radioactivity. All subsequent inhibition and
direct binding assays are performed using these HLA
concentrations.
[0473] Since under these conditions [label]<[HLA] and
IC.sub.50.gtoreq.HLA], the measured IC.sub.50 values are reasonable
approximations of the true K.sub.D values. Peptide inhibitors are
typically tested at concentrations ranging from 120 .mu.g/ml to 1.2
ng/ml, and are tested in two to four completely independent
experiments. To allow comparison of the data obtained in different
experiments, a relative binding figure is calculated for each
peptide by dividing the IC.sub.50 of a positive control for
inhibition by the IC.sub.50 for each tested peptide (typically
unlabeled versions of the radiolabeled probe peptide). For database
purposes, and inter-experiment comparisons, relative binding values
are compiled. These values can subsequently be converted back into
IC.sub.50 nM values by dividing the IC.sub.50 nM of the positive
controls for inhibition by the relative binding of the peptide of
interest. This method of data compilation is accurate and
consistent for comparing peptides that have been tested on
different days, or with different lots of purified MHC.
[0474] Binding assays as outlined above may be used to analyze HLA
supermotif and/or HLA motif-bearing peptides.
Example 11
Identification of HLA Supermotif- and Motif-Bearing CTL Candidate
Epitopes
[0475] HLA vaccine compositions of the invention can include
multiple epitopes. The multiple epitopes can comprise multiple HLA
supermotifs or motifs to achieve broad population coverage. This
example illustrates the identification and confirmation of
supermotif- and motif-bearing epitopes for the inclusion in such a
vaccine composition. Calculation of population coverage is
performed using the strategy described below.
Computer Searches and Algorithms for Identification of Supermotif
and/or Motif-Bearing Epitopes
[0476] The searches performed to identify the motif-bearing peptide
sequences in the Example entitled "Antigenicity Profiles" and
Tables V-XVIII employ the protein sequence data from the gene
product of 161P2F10B set forth in FIGS. 2 and 3.
[0477] Computer searches for epitopes bearing HLA Class I or Class
II supermotifs or motifs are performed as follows. All translated
161P2F10B protein sequences are analyzed using a text string search
software program to identify potential peptide sequences containing
appropriate HLA binding motifs; such programs are readily produced
in accordance with information in the art in view of known
motif/supermotif disclosures. Furthermore, such calculations can be
made mentally.
[0478] Identified A2-, A3-, and DR-supermotif sequences are scored
using polynomial algorithms to predict their capacity to bind to
specific HLA-Class I or Class II molecules. These polynomial
algorithms account for the impact of different amino acids at
different positions, and are essentially based on the premise that
the overall affinity (or AG) of peptide-HLA molecule interactions
can be approximated as a linear polynomial function of the
type:
".DELTA.G"=a.sub.1i.times.a.sub.2i.times.a.sub.3i . . .
.times.a.sub.ni
where a.sub.ji is a coefficient which represents the effect of the
presence of a given amino acid (j) at a given position (i) along
the sequence of a peptide of n amino acids. The crucial assumption
of this method is that the effects at each position are essentially
independent of each other (i.e., independent binding of individual
side-chains). When residue j occurs at position i in the peptide,
it is assumed to contribute a constant amount j.sub.i to the free
energy of binding of the peptide irrespective of the sequence of
the rest of the peptide.
[0479] The method of derivation of specific algorithm coefficients
has been described in Gulukota et al., J. Mol. Biol. 267:1258-126,
1997; (see also Sidney et al., Human Immunol. 45:79-93, 1996; and
Southwood et al., J. Immunol. 160:3363-3373, 1998). Briefly, for
all i positions, anchor and non-anchor alike, the geometric mean of
the average relative binding (ARB) of all peptides carrying/is
calculated relative to the remainder of the group, and used as the
estimate of j.sub.i. For Class II peptides, if multiple alignments
are possible, only the highest scoring alignment is utilized,
following an iterative procedure. To calculate an algorithm score
of a given peptide in a test set, the ARB values corresponding to
the sequence of the peptide are multiplied. If this product exceeds
a chosen threshold, the peptide is predicted to bind. Appropriate
thresholds are chosen as a function of the degree of stringency of
prediction desired.
[0480] Selection of HLA-A2 Supertype Cross-Reactive Peptides
[0481] Complete protein sequences from 161P2F10B are scanned
utilizing motif identification software, to identify 8-, 9- 10- and
11-mer sequences containing the HLA-A2-supermotif main anchor
specificity. Typically, these sequences are then scored using the
protocol described above and the peptides corresponding to the
positive-scoring sequences are synthesized and tested for their
capacity to bind purified HLA-A*0201 molecules in vitro (HLA-A*0201
is considered a prototype A2 supertype molecule).
[0482] These peptides are then tested for the capacity to bind to
additional A2-supertype molecules (A*0202, A*0203, A*0206, and
A*6802). Peptides that bind to at least three of the five
A2-supertype alleles tested are typically deemed A2-supertype
cross-reactive binders. Preferred peptides bind at an affinity
equal to or less than 500 nM to three or more HLA-A2 supertype
molecules.
[0483] Selection of HLA-A3 Supermotif-Bearing Epitopes
[0484] The 161P2F10B protein sequence scanned above is also
examined for the presence of peptides with the HLA-A3-supermotif
primary anchors. Peptides corresponding to the HLA A3
supermotif-bearing sequences are then synthesized and tested for
binding to HLA-A*0301 and HLA-A*1101 molecules, the molecules
encoded by the two most prevalent A3-supertype alleles. The
peptides that bind at least one of the two alleles with binding
affinities of .ltoreq.500 nM, often .ltoreq.200 nM, are then tested
for binding cross-reactivity to the other common A3-supertype
alleles (e.g., A*3101, A*3301, and A*6801) to identify those that
can bind at least three of the five HLA-A3-supertype molecules
tested.
[0485] Selection of HLA-B7 Supermotif Bearing Epitopes
[0486] The 161P2F10B protein is also analyzed for the presence of
8-, 9- 10-, or 11-mer peptides with the HLA-B7-supermotif.
Corresponding peptides are synthesized and tested for binding to
HLA-B*0702, the molecule encoded by the most common B7-supertype
allele (i.e., the prototype B7 supertype allele). Peptides binding
B*0702 with IC.sub.50 of .ltoreq.500 nM are identified using
standard methods. These peptides are then tested for binding to
other common B7-supertype molecules (e.g., B*3501, B*5101, B*5301,
and B*5401). Peptides capable of binding to three or more of the
five B7-supertype alleles tested are thereby identified.
[0487] Selection of A1 and A24 Motif-Bearing Epitopes
[0488] To further increase population coverage, HLA-A1 and -A24
epitopes can also be incorporated into vaccine compositions. An
analysis of the 161P2F10B protein can also be performed to identify
HLA-A1- and A24-motif-containing sequences.
[0489] High affinity and/or cross-reactive binding epitopes that
bear other motif and/or supermotifs are identified using analogous
methodology.
Example 12
Confirmation of Immunogenicity
[0490] Cross-reactive candidate CTL A2-supermotif-bearing peptides
that are identified as described herein are selected to confirm in
vitro immunogenicity. Confirmation is performed using the following
methodology:
[0491] Target Cell Lines for Cellular Screening:
[0492] The .221A2.1 cell line, produced by transferring the
HLA-A2.1 gene into the HLA-A, -B, -C null mutant human
B-lymphoblastoid cell line 721.221, is used as the peptide-loaded
target to measure activity of HLA-A2.1-restricted CTL. This cell
line is grown in RPMI-1640 medium supplemented with antibiotics,
sodium pyruvate, nonessential amino acids and 10% (v/v) heat
inactivated FCS. Cells that express an antigen of interest, or
transfectants comprising the gene encoding the antigen of interest,
can be used as target cells to confirm the ability of
peptide-specific CTLs to recognize endogenous antigen.
[0493] Primary CTL Induction Cultures:
[0494] Generation of Dendritic Cells (DC): PBMCs are thawed in RPMI
with 30 .mu.g/ml DNAse, washed twice and resuspended in complete
medium (RPMI-1640 plus 5% AB human serum, non-essential amino
acids, sodium pyruvate, L-glutamine and penicillin/streptomycin).
The monocytes are purified by plating 10.times.10.sup.6 PBMC/well
in a 6-well plate. After 2 hours at 37.degree. C., the non-adherent
cells are removed by gently shaking the plates and aspirating the
supernatants. The wells are washed a total of three times with 3 ml
RPMI to remove most of the non-adherent and loosely adherent cells.
Three ml of complete medium containing 50 ng/ml of GM-CSF and 1,000
U/ml of IL-4 are then added to each well. TNF.alpha. is added to
the DCs on day 6 at 75 ng/ml and the cells are used for CTL
induction cultures on day 7.
[0495] Induction of CTL with DC and Peptide: CD8+ T-cells are
isolated by positive selection with Dynal immunomagnetic beads
(Dynabeads.RTM. M-450) and the detacha-bead.RTM. reagent. Typically
about 200-250.times.10.sup.6 PBMC are processed to obtain
24.times.10.sup.6 CD8+ T-cells (enough for a 48-well plate
culture). Briefly, the PBMCs are thawed in RPMI with 30 .mu.g/ml
DNAse, washed once with PBS containing 1% human AB serum and
resuspended in PBS/1% AB serum at a concentration of
20.times.10.sup.6 cells/ml. The magnetic beads are washed 3 times
with PBS/AB serum, added to the cells (140.mu.l
beads/20.times.10.sup.6 cells) and incubated for 1 hour at
4.degree. C. with continuous mixing. The beads and cells are washed
4.times. with PBS/AB serum to remove the nonadherent cells and
resuspended at 100.times.10.sup.6 cells/ml (based on the original
cell number) in PBS/AB serum containing 100 .mu.l/ml
detacha-bead.RTM. reagent and 30 .mu.g/ml DNAse. The mixture is
incubated for 1 hour at room temperature with continuous mixing.
The beads are washed again with PBS/AB/DNAse to collect the CD8+
T-cells. The DC are collected and centrifuged at 1300 rpm for 5-7
minutes, washed once with PBS with 1% BSA, counted and pulsed with
40 .mu.g/ml of peptide at a cell concentration of
1-2.times.10.sup.6/ml in the presence of 3.mu.g/ml
.beta..sub.2-microglobulin for 4 hours at 20.degree. C. The DC are
then irradiated (4,200 rads), washed 1 time with medium and counted
again.
[0496] Setting up induction cultures: 0.25 ml cytokine-generated DC
(at 1.times.10.sup.5 cells/ml) are co-cultured with 0.25ml of CD8+
T-cells (at 2.times.10.sup.6 cell/ml) in each well of a 48-well
plate in the presence of 10 ng/ml of IL-7. Recombinant human IL-10
is added the next day at a final concentration of 10 ng/ml and
rhuman IL-2 is added 48 hours later at 10 IU/ml.
[0497] Restimulation of the induction cultures with peptide-pulsed
adherent cells: Seven and fourteen days after the primary
induction, the cells are restimulated with peptide-pulsed adherent
cells. The PBMCs are thawed and washed twice with RPMI and DNAse.
The cells are resuspended at 5.times.10.sup.6 cells/ml and
irradiated at .about.4200 rads. The PBMCs are plated at
2.times.10.sup.6 in 0.5 ml complete medium per well and incubated
for 2 hours at 37.degree. C. The plates are washed twice with RPMI
by tapping the plate gently to remove the nonadherent cells and the
adherent cells pulsed with 10 .mu.g/ml of peptide in the presence
of 3 .mu.g/ml .beta..sub.2 microglobulin in 0.25 ml RPMI/5%AB per
well for 2 hours at 37.degree. C. Peptide solution from each well
is aspirated and the wells are washed once with RPMI. Most of the
media is aspirated from the induction cultures (CD8+ cells) and
brought to 0.5 ml with fresh media. The cells are then transferred
to the wells containing the peptide-pulsed adherent cells. Twenty
four hours later recombinant human IL-10 is added at a final
concentration of 10 ng/ml and recombinant human IL2 is added the
next day and again 2-3 days later at 50IU/ml (Tsai et al., Critical
Reviews in Immunology 18(1-2):65-75. 1998). Seven days later, the
cultures are assayed for CTL activity in a .sup.51Cr release assay.
In some experiments the cultures are assayed for peptide-specific
recognition in the in situ IFN.gamma. ELISA at the time of the
second restimulation followed by assay of endogenous recognition 7
days later. After expansion, activity is measured in both assays
for a side-by-side comparison.
[0498] Measurement of CTL Lytic Activity by .sup.51Cr Release.
[0499] Seven days after the second restimulation, cytotoxicity is
determined in a standard (5 hr) .sup.51Cr release assay by assaying
individual wells at a single E:T. Peptide-pulsed targets are
prepared by incubating the cells with 10 .mu.g/ml peptide overnight
at 37.degree. C.
[0500] Adherent target cells are removed from culture flasks with
trypsin-EDTA. Target cells are labeled with 200.mu. Ci of .sup.51Cr
sodium chromate (Dupont, Wilmington, Del.) for 1 hour at 37.degree.
C. Labeled target cells are resuspended at 10.sup.6 per ml and
diluted 1:10 with K562 cells at a concentration of
3.3.times.10.sup.6/ml (an NK-sensitive erythroblastoma cell line
used to reduce non-specific lysis). Target cells (100 .mu.l) and
effectors (100 .mu.l) are plated in 96 well round-bottom plates and
incubated for 5 hours at 37.degree. C. At that time, 100 .mu.l of
supernatant are collected from each well and percent lysis is
determined according to the formula:
[(cpm of the test sample-cpm of the spontaneous .sup.51Cr release
sample)/(cpm of the maximal .sup.51Cr release sample-cpm of the
spontaneous .sup.51Cr release sample)].times.100.
[0501] Maximum and spontaneous release are determined by incubating
the labeled targets with 1% Triton X-100 and media alone,
respectively. A positive culture is defined as one in which the
specific lysis (sample-background) is 10% or higher in the case of
individual wells and is 15% or more at the two highest E:T ratios
when expanded cultures are assayed.
[0502] In situ Measurement of Human IFN.gamma. Production as an
Indicator of Peptide-Specific and Endogenous Recognition
[0503] IMMULON 2 plates are coated with mouse anti-human IFN.gamma.
monoclonal antibody (4 .mu.g/ml 0.1M NaHCO.sub.3, pH8.2) overnight
at 4.degree. C. The plates are washed with Ca.sup.2+,
Mg.sup.2+-free PBS/0.05% TWEEN 20 and blocked with PBS/10% FCS for
two hours, after which the CTLs (100 .mu.l/well) and targets (100
.mu.l/well) are added to each well, leaving empty wells for the
standards and blanks (which received media only). The target cells,
either peptide-pulsed or endogenous targets, are used at a
concentration of 1.times.10.sup.6 cells/ml. The plates are
incubated for 48 hours at 37.degree. C. with 5% CO.sub.2.
[0504] Recombinant human IFN-gamma is added to the standard wells
starting at 400 pg or 1200 pg/100 microliter/well and the plate
incubated for two hours at 37.degree. C. The plates are washed and
100 .mu.l of biotinylated mouse anti-human IFN-gamma monoclonal
antibody (2 microgram/ml in PBS/3%FCS/0.05% TWEEN 20) are added and
incubated for 2 hours at room temperature. After washing again, 100
microliter HRP-streptavidin (1:4000) are added and the plates
incubated for one hour at room temperature. The plates are then
washed 6.times. with wash buffer, 100 microliter/well developing
solution (TMB 1:1) are added, and the plates allowed to develop for
5-15 minutes. The reaction is stopped with 50 microliter/well 1M
H.sub.3PO.sub.4 and read at OD450. A culture is considered positive
if it measured at least 50 pg of IFN-gamma/well above background
and is twice the background level of expression.
[0505] CTL Expansion.
[0506] Those cultures that demonstrate specific lytic activity
against peptide-pulsed targets and/or tumor targets are expanded
over a two week period with anti-CD3. Briefly, 5.times.10.sup.4
CD8+ cells are added to a T25 flask containing the following:
1.times.10.sup.6 irradiated (4,200 rad) PBMC (autologous or
allogeneic) per ml, 2.times.10.sup.5 irradiated (8,000 rad)
EBV-transformed cells per ml, and OKT3 (anti-CD3) at 30 ng per ml
in RPMI-1640 containing 10% (v/v) human AB serum, non-essential
amino acids, sodium pyruvate, 25 .mu.M 2-mercaptoethanol,
L-glutamine and penicillin/streptomycin. Recombinant human IL2 is
added 24 hours later at a final concentration of 200 IU/ml and
every three days thereafter with fresh media at 50 IU/ml. The cells
are split if the cell concentration exceeds 1.times.10.sup.6/ml and
the cultures are assayed between days 13 and 15 at E:T ratios of
30, 10, 3 and 1:1 in the .sup.51Cr release assay or at
1.times.10.sup.6/ml in the in situ IFN.gamma. assay using the same
targets as before the expansion.
[0507] Cultures are expanded in the absence of anti-CD3.sup.+ as
follows. Those cultures that demonstrate specific lytic activity
against peptide and endogenous targets are selected and
5.times.10.sup.4 CD8.sup.+ cells are added to a T25 flask
containing the following: 1.times.10.sup.6 autologous PBMC per ml
which have been peptide-pulsed with 10 .mu.g/ml peptide for two
hours at 37.degree. C. and irradiated (4,200 rad); 2.times.10.sup.5
irradiated (8,000 rad) EBV-transformed cells per ml RPMI-1640
containing 10%(v/v) human AB serum, non-essential AA, sodium
pyruvate, 25 mM 2-ME, L-glutamine and gentamicin.
[0508] Immunogenicity of A2 Supermotif-Bearing Peptides
[0509] A2-supermotif cross-reactive binding peptides are tested in
the cellular assay for the ability to induce peptide-specific CTL
in normal individuals. In this analysis, a peptide is typically
considered to be an epitope if it induces peptide-specific CTLs in
at least individuals, and preferably, also recognizes the
endogenously expressed peptide.
[0510] Immunogenicity can also be confirmed using PBMCs isolated
from patients bearing a tumor that expresses 161P2F10B. Briefly,
PBMCs are isolated from patients, re-stimulated with peptide-pulsed
monocytes and assayed for the ability to recognize peptide-pulsed
target cells as well as transfected cells endogenously expressing
the antigen.
[0511] Evaluation of A*03/A11 Immunogenicity
[0512] HLA-A3 supermotif-bearing cross-reactive binding peptides
are also evaluated for immunogenicity using methodology analogous
for that used to evaluate the immunogenicity of the HLA-A2
supermotif peptides.
[0513] Evaluation of B7 Immunogenicity
[0514] Immunogenicity screening of the B7-supertype cross-reactive
binding peptides identified as set forth herein are confirmed in a
manner analogous to the confirmation of A2-and
A3-supermotif-bearing peptides.
[0515] Peptides bearing other supermotifs/motifs, e.g., HLA-A1,
HLA-A24 etc. are also confirmed using similar methodology
Example 13
Implementation of the Extended Supermotif to Improve the Binding
Capacity of Native Epitopes by Creating Analogs
[0516] HLA motifs and supermotifs (comprising primary and/or
secondary residues) are useful in the identification and
preparation of highly cross-reactive native peptides, as
demonstrated herein. Moreover, the definition of HLA motifs and
supermotifs also allows one to engineer highly cross-reactive
epitopes by identifying residues within a native peptide sequence
which can be analoged to confer upon the peptide certain
characteristics, e.g. greater cross-reactivity within the group of
HLA molecules that comprise a supertype, and/or greater binding
affinity for some or all of those HLA molecules. Examples of
analoging peptides to exhibit modulated binding affinity are set
forth in this example.
[0517] Analoging at Primary Anchor Residues
[0518] Peptide engineering strategies are implemented to further
increase the cross-reactivity of the epitopes. For example, the
main anchors of A2-supermotif-bearing peptides are altered, for
example, to introduce a preferred L, I, V, or M at position 2, and
I or V at the C-terminus.
[0519] To analyze the cross-reactivity of the analog peptides, each
engineered analog is initially tested for binding to the prototype
A2 supertype allele A*0201, then, if A*0201 binding capacity is
maintained, for A2-supertype cross-reactivity.
[0520] Alternatively, a peptide is confirmed as binding one or all
supertype members and then analoged to modulate binding affinity to
any one (or more) of the supertype members to add population
coverage.
[0521] The selection of analogs for immunogenicity in a cellular
screening analysis is typically further restricted by the capacity
of the parent wild type (WT) peptide to bind at least weakly, i.e.,
bind at an IC.sub.50 of 5000 nM or less, to three of more A2
supertype alleles. The rationale for this requirement is that the
WT peptides must be present endogenously in sufficient quantity to
be biologically relevant. Analoged peptides have been shown to have
increased immunogenicity and cross-reactivity by T cells specific
for the parent epitope (see, e.g., Parkhurst et al., J. Immunol.
157:2539, 1996; and Pogue et al., Proc. Natl. Acad. Sci. USA
92:8166, 1995).
[0522] In the cellular screening of these peptide analogs, it is
important to confirm that analog-specific CTLs are also able to
recognize the wild-type peptide and, when possible, target cells
that endogenously express the epitope.
[0523] Analoging of HLA-A3 and B7-Supermotif-Bearing Peptides
[0524] Analogs of HLA-A3 supermotif-bearing epitopes are generated
using strategies similar to those employed in analoging HLA-A2
supermotif-bearing peptides. For example, peptides binding to 3/5
of the A3-supertype molecules are engineered at primary anchor
residues to possess a preferred residue (V, S, M, or A) at position
2.
[0525] The analog peptides are then tested for the ability to bind
A*03 and A*11 (prototype A3 supertype alleles). Those peptides that
demonstrate .ltoreq.500 nM binding capacity are then confirmed as
having A3-supertype cross-reactivity.
[0526] Similarly to the A2- and A3-motif bearing peptides, peptides
binding 3 or more B7-supertype alleles can be improved, where
possible, to achieve increased cross-reactive binding or greater
binding affinity or binding half life. B7 supermotif-bearing
peptides are, for example, engineered to possess a preferred
residue (V, I, L, or F) at the C-terminal primary anchor position,
as demonstrated by Sidney et al. (J. Immunol. 157:3480-3490,
1996).
[0527] Analoging at primary anchor residues of other motif and/or
supermotif-bearing epitopes is performed in a like manner.
[0528] The analog peptides are then be confirmed for
immunogenicity, typically in a cellular screening assay. Again, it
is generally important to demonstrate that analog-specific CTLs are
also able to recognize the wild-type peptide and, when possible,
targets that endogenously express the epitope.
[0529] Analoging at Secondary Anchor Residues
[0530] Moreover, HLA supermotifs are of value in engineering highly
cross-reactive peptides and/or peptides that bind HLA molecules
with increased affinity by identifying particular residues at
secondary anchor positions that are associated with such
properties. For example, the binding capacity of a B7
supermotif-bearing peptide with an F residue at position 1 is
analyzed. The peptide is then analoged to, for example, substitute
L for F at position 1. The analoged peptide is evaluated for
increased binding affinity, binding half life and/or increased
cross-reactivity. Such a procedure identifies analoged peptides
with enhanced properties.
[0531] Engineered analogs with sufficiently improved binding
capacity or cross-reactivity can also be tested for immunogenicity
in HLA-B7-transgenic mice, following for example, IFA immunization
or lipopeptide immunization. Analoged peptides are additionally
tested for the ability to stimulate a recall response using PBMC
from patients with 161P2F10B-expressing tumors.
[0532] Other Analoging Strategies
[0533] Another form of peptide analoging, unrelated to anchor
positions, involves the substitution of a cysteine with
.alpha.-amino butyric acid. Due to its chemical nature, cysteine
has the propensity to form disulfide bridges and sufficiently alter
the peptide structurally so as to reduce binding capacity.
Substitution of .alpha.-amino butyric acid for cysteine not only
alleviates this problem, but has been shown to improve binding and
crossbinding capabilities in some instances (see, e.g., the review
by Sette et al., In: Persistent Viral Infections, Eds. R. Ahmed and
I. Chen, John Wiley & Sons, England, 1999).
[0534] Thus, by the use of single amino acid substitutions, the
binding properties and/or cross-reactivity of peptide ligands for
HLA supertype molecules can be modulated.
Example 14
Identification and Confirmation of 161P2F10B-Derived Sequences with
HLA-DR Binding Motifs
[0535] Peptide epitopes bearing an HLA class II supermotif or motif
are identified and confirmed as outlined below using methodology
similar to that described for HLA Class I peptides.
[0536] Selection of HLA-DR-Supermotif-Bearing Epitopes.
[0537] To identify 161P2F10B-derived, HLA class II HTL epitopes,
the 161P2F10B antigen is analyzed for the presence of sequences
bearing an HLA-DR-motif or supermotif. Specifically, 15-mer
sequences are selected comprising a DR-supermotif, comprising a
9-mer core, and three-residue N- and C-terminal flanking regions
(15 amino acids total).
[0538] Protocols for predicting peptide binding to DR molecules
have been developed (Southwood et al., J. Immunol. 160:3363-3373,
1998). These protocols, specific for individual DR molecules, allow
the scoring, and ranking, of 9-mer core regions. Each protocol not
only scores peptide sequences for the presence of DR-supermotif
primary anchors (i.e., at position 1 and position 6) within a 9-mer
core, but additionally evaluates sequences for the presence of
secondary anchors. Using allele-specific selection tables (see,
e.g., Southwood et al., ibid.), it has been found that these
protocols efficiently select peptide sequences with a high
probability of binding a particular DR molecule. Additionally, it
has been found that performing these protocols in tandem,
specifically those for DR1, DR4w4, and DR7, can efficiently select
DR cross-reactive peptides.
[0539] The 161P2F10B-derived peptides identified above are tested
for their binding capacity for various common HLA-DR molecules. All
peptides are initially tested for binding to the DR molecules in
the primary panel: DR1, DR4w4, and DR7. Peptides binding at least
two of these three DR molecules are then tested for binding to
DR2w2 .beta.1, DR2w2 .beta.2, DR6w19, and DR9 molecules in
secondary assays. Finally, peptides binding at least two of the
four secondary panel DR molecules, and thus cumulatively at least
four of seven different DR molecules, are screened for binding to
DR4w15, DR5w11, and DR8w2 molecules in tertiary assays. Peptides
binding at least seven of the ten DR molecules comprising the
primary, secondary, and tertiary screening assays are considered
cross-reactive DR binders. 161P2F10B-derived peptides found to bind
common HLA-DR alleles are of particular interest.
[0540] Selection of DR3 Motif Peptides
[0541] Because HLA-DR3 is an allele that is prevalent in Caucasian,
Black, and Hispanic populations, DR3 binding capacity is a relevant
criterion in the selection of HTL epitopes. Thus, peptides shown to
be candidates may also be assayed for their DR3 binding capacity.
However, in view of the binding specificity of the DR3 motif,
peptides binding only to DR3 can also be considered as candidates
for inclusion in a vaccine formulation.
[0542] To efficiently identify peptides that bind DR3, target
161P2F10B antigens are analyzed for sequences carrying one of the
two DR3-specific binding motifs reported by Geluk et al. (J.
Immunol. 152:5742-5748, 1994). The corresponding peptides are then
synthesized and confirmed as having the ability to bind DR3 with an
affinity of 1 .mu.M or better, i.e., less than 1 .mu.M. Peptides
are found that meet this binding criterion and qualify as HLA class
II high affinity binders.
[0543] DR3 binding epitopes identified in this manner are included
in vaccine compositions with DR supermotif-bearing peptide
epitopes.
[0544] Similarly to the case of HLA class I motif-bearing peptides,
the class II motif-bearing peptides are analoged to improve
affinity or cross-reactivity. For example, aspartic acid at
position 4 of the 9-mer core sequence is an optimal residue for DR3
binding, and substitution for that residue often improves DR 3
binding.
Example 15
Immunogenicity of 161P2F10B-Derived HTL Epitopes
[0545] This example determines immunogenic DR supermotif- and DR3
motif-bearing epitopes among those identified using the methodology
set forth herein.
[0546] Immunogenicity of HTL epitopes are confirmed in a manner
analogous to the determination of immunogenicity of CTL epitopes,
by assessing the ability to stimulate HTL responses and/or by using
appropriate transgenic mouse models Immunogenicity is determined by
screening for: 1.) in vitro primary induction using normal PBMC or
2.) recall responses from patients who have 161P2F10B-expressing
tumors.
Example 16
Calculation of Phenotypic Frequencies of HLA-Supertypes in Various
Ethnic Backgrounds to Determine Breadth of Population Coverage
[0547] This example illustrates the assessment of the breadth of
population coverage of a vaccine composition comprised of multiple
epitopes comprising multiple supermotifs and/or motifs.
[0548] In order to analyze population coverage, gene frequencies of
HLA alleles are determined. Gene frequencies for each HLA allele
are calculated from antigen or allele frequencies utilizing the
binomial distribution formulae gf=1-(SQRT(1-af)) (see, e.g., Sidney
et al., Human Immunol. 45:79-93, 1996). To obtain overall
phenotypic frequencies, cumulative gene frequencies are calculated,
and the cumulative antigen frequencies derived by the use of the
inverse formula [af=1-(1-Cgf).sup.2].
[0549] Where frequency data is not available at the level of DNA
typing, correspondence to the serologically defined antigen
frequencies is assumed. To obtain total potential supertype
population coverage no linkage disequilibrium is assumed, and only
alleles confirmed to belong to each of the supertypes are included
(minimal estimates). Estimates of total potential coverage achieved
by inter-loci combinations are made by adding to the A coverage the
proportion of the non-A covered population that could be expected
to be covered by the B alleles considered (e.g., total=A+B*(1-A)).
Confirmed members of the A3-like supertype are A3, A11, A31,
A*3301, and A*6801. Although the A3-like supertype may also include
A34, A66, and A*7401, these alleles were not included in overall
frequency calculations Likewise, confirmed members of the A2-like
supertype family are A*0201, A*0202, A*0203, A*0204, A*0205,
A*0206, A*0207, A*6802, and A*6901. Finally, the B7-like
supertype-confirmed alleles are: B7, B*3501-03, B51, B*5301,
B*5401, B*5501-2, B*5601, B*6701, and B*7801 (potentially also
B*1401, B*3504-06, B*4201, and B*5602).
[0550] Population coverage achieved by combining the A2-, A3- and
B7-supertypes is approximately 86% in five major ethnic groups.
Coverage may be extended by including peptides bearing the A1 and
A24 motifs. On average, A1 is present in 12% and A24 in 29% of the
population across five different major ethnic groups (Caucasian,
North American Black, Chinese, Japanese, and Hispanic). Together,
these alleles are represented with an average frequency of 39% in
these same ethnic populations. The total coverage across the major
ethnicities when A1 and A24 are combined with the coverage of the
A2-, A3- and B7-supertype alleles is >95%. An analogous approach
can be used to estimate population coverage achieved with
combinations of class II motif-bearing epitopes.
[0551] Immunogenicity studies in humans (e.g., Bertoni et al., J.
Clin. Invest. 100:503, 1997; Doolan et al., Immunity 7:97, 1997;
and Threlkeld et al., J. Immunol. 159:1648, 1997) have shown that
highly cross-reactive binding peptides are almost always recognized
as epitopes. The use of highly cross-reactive binding peptides is
an important selection criterion in identifying candidate epitopes
for inclusion in a vaccine that is immunogenic in a diverse
population.
[0552] With a sufficient number of epitopes (as disclosed herein
and from the art), an average population coverage is predicted to
be greater than 95% in each of five major ethnic populations. The
game theory Monte Carlo simulation analysis, which is known in the
art (see e.g., Osborne, M. J. and Rubinstein, A. "A course in game
theory" MIT Press, 1994), can be used to estimate what percentage
of the individuals in a population comprised of the Caucasian,
North American Black, Japanese, Chinese, and Hispanic ethnic groups
would recognize the vaccine epitopes described herein. A preferred
percentage is 90%. A more preferred percentage is 95%.
Example 17
CTL Recognition of Endogenously Processed Antigens after
Priming
[0553] This example confirms that CTL induced by native or analoged
peptide epitopes identified and selected as described herein
recognize endogenously synthesized, i.e., native antigens.
[0554] Effector cells isolated from transgenic mice that are
immunized with peptide epitopes, for example HLA-A2
supermotif-bearing epitopes, are re-stimulated in vitro using
peptide-coated stimulator cells. Six days later, effector cells are
assayed for cytotoxicity and the cell lines that contain
peptide-specific cytotoxic activity are further re-stimulated. An
additional six days later, these cell lines are tested for
cytotoxic activity on .sup.51Cr labeled Jurkat-A2.1/K.sup.b target
cells in the absence or presence of peptide, and also tested on
.sup.51Cr labeled target cells bearing the endogenously synthesized
antigen, i.e. cells that are stably transfected with 161P2F10B
expression vectors.
[0555] The results demonstrate that CTL lines obtained from animals
primed with peptide epitope recognize endogenously synthesized
161P2F10B antigen. The choice of transgenic mouse model to be used
for such an analysis depends upon the epitope(s) that are being
evaluated. In addition to HLA-A*0201/K.sup.b transgenic mice,
several other transgenic mouse models including mice with human
All, which may also be used to evaluate A3 epitopes, and B7 alleles
have been characterized and others (e.g., transgenic mice for
HLA-Al and A24) are being developed. HLA-DR1 and HLA-DR3 mouse
models have also been developed, which may be used to evaluate HTL
epitopes.
Example 18
Activity of CTL-HTL Conjugated Epitopes in Transgenic Mice
[0556] This example illustrates the induction of CTLs and HTLs in
transgenic mice, by use of a 161P2F10B-derived CTL and HTL peptide
vaccine compositions. The vaccine composition used herein comprise
peptides to be administered to a patient with a
161P2F10B-expressing tumor. The peptide composition can comprise
multiple CTL and/or HTL epitopes. The epitopes are identified using
methodology as described herein. This example also illustrates that
enhanced immunogenicity can be achieved by inclusion of one or more
HTL epitopes in a CTL vaccine composition; such a peptide
composition can comprise an HTL epitope conjugated to a CTL
epitope. The CTL epitope can be one that binds to multiple HLA
family members at an affinity of 500 nM or less, or analogs of that
epitope. The peptides may be lipidated, if desired.
[0557] Immunization procedures: Immunization of transgenic mice is
performed as described (Alexander et al., J. Immunol.
159:4753-4761, 1997). For example, A2/K.sup.b mice, which are
transgenic for the human HLA A2.1 allele and are used to confirm
the immunogenicity of HLA-A*0201 motif- or HLA-A2
supermotif-bearing epitopes, and are primed subcutaneously (base of
the tail) with a 0.1 ml of peptide in Incomplete Freund's Adjuvant,
or if the peptide composition is a lipidated CTL/HTL conjugate, in
DMSO/saline, or if the peptide composition is a polypeptide, in PBS
or Incomplete Freund's Adjuvant. Seven days after priming,
splenocytes obtained from these animals are restimulated with
syngenic irradiated LPS-activated lymphoblasts coated with
peptide.
[0558] Cell lines: Target cells for peptide-specific cytotoxicity
assays are Jurkat cells transfected with the HLA-A2.1/K.sup.b
chimeric gene (e.g., Vitiello et al., J. Exp. Med. 173:1007,
1991)
[0559] In vitro CTL activation: One week after priming, spleen
cells (30.times.10.sup.6 cells/flask) are co-cultured at 37.degree.
C. with syngeneic, irradiated (3000 rads), peptide coated
lymphoblasts (10.times.10.sup.6 cells/flask) in 10 ml of culture
medium/T25 flask. After six days, effector cells are harvested and
assayed for cytotoxic activity.
[0560] Assay for cytotoxic activity: Target cells (1.0 to
1.5.times.10.sup.6) are incubated at 37.degree. C. in the presence
of 200 .mu.l of .sup.51Cr. After 60 minutes, cells are washed three
times and resuspended in R10 medium. Peptide is added where
required at a concentration of 1 .mu.g/ml. For the assay, 10.sup.4
51Cr-labeled target cells are added to different concentrations of
effector cells (final volume of 200 .mu.l) in U-bottom 96-well
plates. After a six hour incubation period at 37.degree. C., a 0.1
ml aliquot of supernatant is removed from each well and
radioactivity is determined in a Micromedic automatic gamma
counter. The percent specific lysis is determined by the formula:
percent specific release=100.times.(experimental
release-spontaneous release)/(maximum release-spontaneous release).
To facilitate comparison between separate CTL assays run under the
same conditions, % .sup.51Cr release data is expressed as lytic
units/10.sup.6 cells. One lytic unit is arbitrarily defined as the
number of effector cells required to achieve 30% lysis of 10,000
target cells in a six hour .sup.51Cr release assay. To obtain
specific lytic units/10.sup.6, the lytic units/10.sup.6 obtained in
the absence of peptide is subtracted from the lytic units/10.sup.6
obtained in the presence of peptide. For example, if 30% .sup.51Cr
release is obtained at the effector (E): target (T) ratio of 50:1
(i.e., 5.times.10.sup.5 effector cells for 10,000 targets) in the
absence of peptide and 5:1 (i.e., 5.times.10.sup.4 effector cells
for 10,000 targets) in the presence of peptide, the specific lytic
units would be: [(1/50,000)-(1/500,000)].times.10.sup.6=18 LU.
[0561] The results are analyzed to assess the magnitude of the CTL
responses of animals injected with the immunogenic CTL/HTL
conjugate vaccine preparation and are compared to the magnitude of
the CTL response achieved using, for example, CTL epitopes as
outlined above in the Example entitled "Confirmation of
Immunogenicity". Analyses similar to this may be performed to
confirm the immunogenicity of peptide conjugates containing
multiple CTL epitopes and/or multiple HTL epitopes. In accordance
with these procedures, it is found that a CTL response is induced,
and concomitantly that an HTL response is induced upon
administration of such compositions.
Example 19
Selection of CTL and HTL Epitopes for Inclusion in an
161P2F10B-Specific Vaccine
[0562] This example illustrates a procedure for selecting peptide
epitopes for vaccine compositions of the invention. The peptides in
the composition can be in the form of a nucleic acid sequence,
either single or one or more sequences (i.e., minigene) that
encodes peptide(s), or can be single and/or polyepitopic
peptides.
[0563] The following principles are utilized when selecting a
plurality of epitopes for inclusion in a vaccine composition. Each
of the following principles is balanced in order to make the
selection.
[0564] Epitopes are selected which, upon administration, mimic
immune responses that are correlated with 161P2F10B clearance. The
number of epitopes used depends on observations of patients who
spontaneously clear 161P2F10B. For example, if it has been observed
that patients who spontaneously clear 161P2F10B generate an immune
response to at least three (3) from 161P2F10B antigen, then three
or four (3-4) epitopes should be included for HLA class I. A
similar rationale is used to determine HLA class II epitopes.
[0565] Epitopes are often selected that have a binding affinity of
an IC.sub.50 of 500 nM or less for an HLA class I molecule, or for
class II, an IC.sub.50 of 1000 nM or less; or HLA Class I peptides
with high binding scores from the BIMAS web site.
[0566] In order to achieve broad coverage of the vaccine through
out a diverse population, sufficient supermotif bearing peptides,
or a sufficient array of allele-specific motif bearing peptides,
are selected to give broad population coverage. In one embodiment,
epitopes are selected to provide at least 80% population coverage.
A Monte Carlo analysis, a statistical evaluation known in the art,
can be employed to assess breadth, or redundancy, of population
coverage.
[0567] When creating polyepitopic compositions, or a minigene that
encodes same, it is typically desirable to generate the smallest
peptide possible that encompasses the epitopes of interest. The
principles employed are similar, if not the same, as those employed
when selecting a peptide comprising nested epitopes. For example, a
protein sequence for the vaccine composition is selected because it
has maximal number of epitopes contained within the sequence, i.e.,
it has a high concentration of epitopes. Epitopes may be nested or
overlapping (i.e., frame shifted relative to one another). For
example, with overlapping epitopes, two 9-mer epitopes and one
10-mer epitope can be present in a 10 amino acid peptide. Each
epitope can be exposed and bound by an HLA molecule upon
administration of such a peptide. A multi-epitopic, peptide can be
generated synthetically, recombinantly, or via cleavage from the
native source. Alternatively, an analog can be made of this native
sequence, whereby one or more of the epitopes comprise
substitutions that alter the cross-reactivity and/or binding
affinity properties of the polyepitopic peptide. Such a vaccine
composition is administered for therapeutic or prophylactic
purposes. This embodiment provides for the possibility that an as
yet undiscovered aspect of immune system processing will apply to
the native nested sequence and thereby facilitate the production of
therapeutic or prophylactic immune response-inducing vaccine
compositions. Additionally such an embodiment provides for the
possibility of motif-bearing epitopes for an HLA makeup that is
presently unknown. Furthermore, this embodiment (absent the
creating of any analogs) directs the immune response to multiple
peptide sequences that are actually present in 161P2F10B, thus
avoiding the need to evaluate any junctional epitopes. Lastly, the
embodiment provides an economy of scale when producing nucleic acid
vaccine compositions. Related to this embodiment, computer programs
can be derived in accordance with principles in the art, which
identify in a target sequence, the greatest number of epitopes per
sequence length.
[0568] A vaccine composition comprised of selected peptides, when
administered, is safe, efficacious, and elicits an immune response
similar in magnitude to an immune response that controls or clears
cells that bear or overexpress 161P2F10B.
Example 20
Construction of "Minigene" Multi-Epitope DNA Plasmids
[0569] This example discusses the construction of a minigene
expression plasmid. Minigene plasmids may, of course, contain
various configurations of B cell, CTL and/or HTL epitopes or
epitope analogs as described herein.
[0570] A minigene expression plasmid typically includes multiple
CTL and HTL peptide epitopes. In the present example, HLA-A2, -A3,
-B7 supermotif-bearing peptide epitopes and HLA-A1 and -A24
motif-bearing peptide epitopes are used in conjunction with DR
supermotif-bearing epitopes and/or DR3 epitopes. HLA class I
supermotif or motif-bearing peptide epitopes derived 161P2F10B, are
selected such that multiple supermotifs/motifs are represented to
ensure broad population coverage. Similarly, HLA class II epitopes
are selected from 161P2F10B to provide broad population coverage,
i.e. both HLA DR-1-4-7 supermotif-bearing epitopes and HLA DR-3
motif-bearing epitopes are selected for inclusion in the minigene
construct. The selected CTL and HTL epitopes are then incorporated
into a minigene for expression in an expression vector.
[0571] Such a construct may additionally include sequences that
direct the HTL epitopes to the endoplasmic reticulum. For example,
the Ii protein may be fused to one or more HTL epitopes as
described in the art, wherein the CLIP sequence of the Ii protein
is removed and replaced with an HLA class II epitope sequence so
that HLA class II epitope is directed to the endoplasmic reticulum,
where the epitope binds to an HLA class II molecules.
[0572] This example illustrates the methods to be used for
construction of a minigene-bearing expression plasmid. Other
expression vectors that may be used for minigene compositions are
available and known to those of skill in the art.
[0573] The minigene DNA plasmid of this example contains a
consensus Kozak sequence and a consensus murine kappa Ig-light
chain signal sequence followed by CTL and/or HTL epitopes selected
in accordance with principles disclosed herein. The sequence
encodes an open reading frame fused to the Myc and His antibody
epitope tag coded for by the pcDNA 3.1 Myc-His vector.
[0574] Overlapping oligonucleotides that can, for example, average
about 70 nucleotides in length with 15 nucleotide overlaps, are
synthesized and HPLC-purified. The oligonucleotides encode the
selected peptide epitopes as well as appropriate linker
nucleotides, Kozak sequence, and signal sequence. The final
multiepitope minigene is assembled by extending the overlapping
oligonucleotides in three sets of reactions using PCR. A
Perkin/Elmer 9600 PCR machine is used and a total of 30 cycles are
performed using the following conditions: 95.degree. C. for 15 sec,
annealing temperature (5.degree. below the lowest calculated Tm of
each primer pair) for 30 sec, and 72.degree. C. for 1 min
[0575] For example, a minigene is prepared as follows. For a first
PCR reaction, 5 .mu.g of each of two oligonucleotides are annealed
and extended: In an example using eight oligonucleotides, i.e.,
four pairs of primers, oligonucleotides 1+2, 3+4, 5+6, and 7+8 are
combined in 100 .mu.l reactions containing Pfu polymerase buffer
(1x=10 mM KCL, 10 mM (NH4).sub.2SO.sub.4, 20 mM Tris-chloride, pH
8.75, 2 mM MgSO.sub.4, 0.1% Triton X-100, 100 .mu.g/ml BSA), 0.25
mM each dNTP, and 2.5 U of Pfu polymerase. The full-length dimer
products are gel-purified, and two reactions containing the product
of 1+2 and 3+4, and the product of 5+6 and 7+8 are mixed, annealed,
and extended for 10 cycles. Half of the two reactions are then
mixed, and 5 cycles of annealing and extension carried out before
flanking primers are added to amplify the full length product. The
full-length product is gel-purified and cloned into pCR-blunt
(Invitrogen) and individual clones are screened by sequencing.
Example 21
The Plasmid Construct and the Degree to which it Induces
Immunogenicity
[0576] The degree to which a plasmid construct, for example a
plasmid constructed in accordance with the previous Example, is
able to induce immunogenicity is confirmed in vitro by determining
epitope presentation by APC following transduction or transfection
of the APC with an epitope-expressing nucleic acid construct. Such
a study determines "antigenicity" and allows the use of human APC.
The assay determines the ability of the epitope to be presented by
the APC in a context that is recognized by a T cell by quantifying
the density of epitope-HLA class I complexes on the cell surface.
Quantitation can be performed by directly measuring the amount of
peptide eluted from the APC (see, e.g., Sijts et al., J. Immunol.
156:683-692, 1996; Demotz et al., Nature 342:682-684, 1989); or the
number of peptide-HLA class I complexes can be estimated by
measuring the amount of lysis or lymphokine release induced by
diseased or transfected target cells, and then determining the
concentration of peptide necessary to obtain equivalent levels of
lysis or lymphokine release (see, e.g., Kageyama et al., J.
Immunol. 154:567-576, 1995).
[0577] Alternatively, immunogenicity is confirmed through in vivo
injections into mice and subsequent in vitro assessment of CTL and
HTL activity, which are analyzed using cytotoxicity and
proliferation assays, respectively, as detailed e.g., in Alexander
et al., Immunity 1:751-761, 1994.
[0578] For example, to confirm the capacity of a DNA minigene
construct containing at least one HLA-A2 supermotif peptide to
induce CTLs in vivo, HLA-A2.1/K.sup.b transgenic mice, for example,
are immunized intramuscularly with 100 .mu.g of naked cDNA. As a
means of comparing the level of CTLs induced by cDNA immunization,
a control group of animals is also immunized with an actual peptide
composition that comprises multiple epitopes synthesized as a
single polypeptide as they would be encoded by the minigene.
[0579] Splenocytes from immunized animals are stimulated twice with
each of the respective compositions (peptide epitopes encoded in
the minigene or the polyepitopic peptide), then assayed for
peptide-specific cytotoxic activity in a .sup.51Cr release assay.
The results indicate the magnitude of the CTL response directed
against the A2-restricted epitope, thus indicating the in vivo
immunogenicity of the minigene vaccine and polyepitopic
vaccine.
[0580] It is, therefore, found that the minigene elicits immune
responses directed toward the HLA-A2 supermotif peptide epitopes as
does the polyepitopic peptide vaccine. A similar analysis is also
performed using other HLA-A3 and HLA-B7 transgenic mouse models to
assess CTL induction by HLA-A3 and HLA-B7 motif or supermotif
epitopes, whereby it is also found that the minigene elicits
appropriate immune responses directed toward the provided
epitopes.
[0581] To confirm the capacity of a class II epitope-encoding
minigene to induce HTLs in vivo, DR transgenic mice, or for those
epitopes that cross react with the appropriate mouse MHC molecule,
I-A.sup.b-restricted mice, for example, are immunized
intramuscularly with 100 .mu.g of plasmid DNA. As a means of
comparing the level of HTLs induced by DNA immunization, a group of
control animals is also immunized with an actual peptide
composition emulsified in complete Freund's adjuvant. CD4+ T cells,
i.e. HTLs, are purified from splenocytes of immunized animals and
stimulated with each of the respective compositions (peptides
encoded in the minigene). The HTL response is measured using a
.sup.3H-thymidine incorporation proliferation assay, (see, e.g.,
Alexander et al. Immunity 1:751-761, 1994). The results indicate
the magnitude of the HTL response, thus demonstrating the in vivo
immunogenicity of the minigene.
[0582] DNA minigenes, constructed as described in the previous
Example, can also be confirmed as a vaccine in combination with a
boosting agent using a prime boost protocol. The boosting agent can
consist of recombinant protein (e.g., Barnett et al., Aids Res. and
Human Retroviruses 14, Supplement 3:S299-S309, 1998) or recombinant
vaccinia, for example, expressing a minigene or DNA encoding the
complete protein of interest (see, e.g., Hanke et al., Vaccine
16:439-445, 1998; Sedegah et al., Proc. Natl. Acad. Sci USA
95:7648-53, 1998; Hanke and McMichael, Immunol. Letters 66:177-181,
1999; and Robinson et al., Nature Med. 5:526-34, 1999).
[0583] For example, the efficacy of the DNA minigene used in a
prime boost protocol is initially evaluated in transgenic mice. In
this example, A2.1/K.sup.b transgenic mice are immunized IM with
100 .mu.g of a DNA minigene encoding the immunogenic peptides
including at least one HLA-A2 supermotif-bearing peptide. After an
incubation period (ranging from 3-9 weeks), the mice are boosted IP
with 10.sup.7 pfu/mouse of a recombinant vaccinia virus expressing
the same sequence encoded by the DNA minigene. Control mice are
immunized with 100 .mu.g of DNA or recombinant vaccinia without the
minigene sequence, or with DNA encoding the minigene, but without
the vaccinia boost. After an additional incubation period of two
weeks, splenocytes from the mice are immediately assayed for
peptide-specific activity in an ELISPOT assay. Additionally,
splenocytes are stimulated in vitro with the A2-restricted peptide
epitopes encoded in the minigene and recombinant vaccinia, then
assayed for peptide-specific activity in an alpha, beta and/or
gamma IFN ELISA.
[0584] It is found that the minigene utilized in a prime-boost
protocol elicits greater immune responses toward the HLA-A2
supermotif peptides than with DNA alone. Such an analysis can also
be performed using HLA-A11 or HLA-B7 transgenic mouse models to
assess CTL induction by HLA-A3 or HLA-B7 motif or supermotif
epitopes. The use of prime boost protocols in humans is described
below in the Example entitled "Induction of CTL Responses Using a
Prime Boost Protocol."
Example 22
Peptide Composition for Prophylactic Uses
[0585] Vaccine compositions of the present invention can be used to
prevent 161P2F10B expression in persons who are at risk for tumors
that bear this antigen. For example, a polyepitopic peptide epitope
composition (or a nucleic acid comprising the same) containing
multiple CTL and HTL epitopes such as those selected in the above
Examples, which are also selected to target greater than 80% of the
population, is administered to individuals at risk for a
161P2F10B-associated tumor.
[0586] For example, a peptide-based composition is provided as a
single polypeptide that encompasses multiple epitopes. The vaccine
is typically administered in a physiological solution that
comprises an adjuvant, such as Incomplete Freunds Adjuvant. The
dose of peptide for the initial immunization is from about 1 to
about 50,000 .mu.g, generally 100-5,000 .mu.g, for a 70 kg patient.
The initial administration of vaccine is followed by booster
dosages at 4 weeks followed by evaluation of the magnitude of the
immune response in the patient, by techniques that determine the
presence of epitope-specific CTL populations in a PBMC sample.
Additional booster doses are administered as required. The
composition is found to be both safe and efficacious as a
prophylaxis against 161P2F10B-associated disease.
[0587] Alternatively, a composition typically comprising
transfecting agents is used for the administration of a nucleic
acid-based vaccine in accordance with methodologies known in the
art and disclosed herein.
Example 23
Polyepitopic Vaccine Compositions Derived from Native 161P2F10B
Sequences
[0588] A native 161P2F10B polyprotein sequence is analyzed,
preferably using computer algorithms defined for each class I
and/or class II supermotif or motif, to identify "relatively short"
regions of the polyprotein that comprise multiple epitopes. The
"relatively short" regions are preferably less in length than an
entire native antigen. This relatively short sequence that contains
multiple distinct or overlapping, "nested" epitopes is selected; it
can be used to generate a minigene construct. The construct is
engineered to express the peptide, which corresponds to the native
protein sequence. The "relatively short" peptide is generally less
than 250 amino acids in length, often less than 100 amino acids in
length, preferably less than 75 amino acids in length, and more
preferably less than 50 amino acids in length. The protein sequence
of the vaccine composition is selected because it has maximal
number of epitopes contained within the sequence, i.e., it has a
high concentration of epitopes. As noted herein, epitope motifs may
be nested or overlapping (i.e., frame shifted relative to one
another). For example, with overlapping epitopes, two 9-mer
epitopes and one 10-mer epitope can be present in a 10 amino acid
peptide. Such a vaccine composition is administered for therapeutic
or prophylactic purposes.
[0589] The vaccine composition will include, for example, multiple
CTL epitopes from 161P2F10B antigen and at least one HTL epitope.
This polyepitopic native sequence is administered either as a
peptide or as a nucleic acid sequence which encodes the peptide.
Alternatively, an analog can be made of this native sequence,
whereby one or more of the epitopes comprise substitutions that
alter the cross-reactivity and/or binding affinity properties of
the polyepitopic peptide.
[0590] The embodiment of this example provides for the possibility
that an as yet undiscovered aspect of immune system processing will
apply to the native nested sequence and thereby facilitate the
production of therapeutic or prophylactic immune response-inducing
vaccine compositions. Additionally such an embodiment provides for
the possibility of motif-bearing epitopes for an HLA makeup that is
presently unknown. Furthermore, this embodiment (excluding an
analoged embodiment) directs the immune response to multiple
peptide sequences that are actually present in native 161P2F10B,
thus avoiding the need to evaluate any junctional epitopes. Lastly,
the embodiment provides an economy of scale when producing peptide
or nucleic acid vaccine compositions.
[0591] Related to this embodiment, computer programs are available
in the art which can be used to identify in a target sequence, the
greatest number of epitopes per sequence length.
Example 24
Polyepitopic Vaccine Compositions from Multiple Antigens
[0592] The 161P2F10B peptide epitopes of the present invention are
used in conjunction with epitopes from other target
tumor-associated antigens, to create a vaccine composition that is
useful for the prevention or treatment of cancer that expresses
161P2F10B and such other antigens. For example, a vaccine
composition can be provided as a single polypeptide that
incorporates multiple epitopes from 161P2F10B as well as
tumor-associated antigens that are often expressed with a target
cancer associated with 161P2F10B expression, or can be administered
as a composition comprising a cocktail of one or more discrete
epitopes. Alternatively, the vaccine can be administered as a
minigene construct or as dendritic cells which have been loaded
with the peptide epitopes in vitro.
Example 25
Use of Peptides to Evaluate an Immune Response
[0593] Peptides of the invention may be used to analyze an immune
response for the presence of specific antibodies, CTL or HTL
directed to 161P2F10B. Such an analysis can be performed in a
manner described by Ogg et al., Science 279:2103-2106, 1998. In
this Example, peptides in accordance with the invention are used as
a reagent for diagnostic or prognostic purposes, not as an
immunogen.
[0594] In this example highly sensitive human leukocyte antigen
tetrameric complexes ("tetramers") are used for a cross-sectional
analysis of, for example, 161P2F10B HLA-A*0201-specific CTL
frequencies from HLA A*0201-positive individuals at different
stages of disease or following immunization comprising an 161P2F10B
peptide containing an A*0201 motif. Tetrameric complexes are
synthesized as described (Musey et al., N. Engl. J. Med. 337:1267,
1997). Briefly, purified HLA heavy chain (A*0201 in this example)
and .beta.2-microglobulin are synthesized by means of a prokaryotic
expression system. The heavy chain is modified by deletion of the
transmembrane-cytosolic tail and COOH-terminal addition of a
sequence containing a BirA enzymatic biotinylation site. The heavy
chain, .beta.2-microglobulin, and peptide are refolded by dilution.
The 45-kD refolded product is isolated by fast protein liquid
chromatography and then biotinylated by BirA in the presence of
biotin (Sigma, St. Louis, Mo.), adenosine 5' triphosphate and
magnesium. Streptavidin-phycoerythrin conjugate is added in a 1:4
molar ratio, and the tetrameric product is concentrated to 1 mg/ml.
The resulting product is referred to as tetramer-phycoerythrin.
[0595] For the analysis of patient blood samples, approximately one
million PBMCs are centrifuged at 300 g for 5 minutes and
resuspended in 50 .mu.l of cold phosphate-buffered saline.
Tri-color analysis is performed with the tetramer-phycoerythrin,
along with anti-CD8-Tricolor, and anti-CD38. The PBMCs are
incubated with tetramer and antibodies on ice for 30 to 60 min and
then washed twice before formaldehyde fixation. Gates are applied
to contain >99.98% of control samples. Controls for the
tetramers include both A*0201-negative individuals and
A*0201-positive non-diseased donors. The percentage of cells
stained with the tetramer is then determined by flow cytometry. The
results indicate the number of cells in the PBMC sample that
contain epitope-restricted CTLs, thereby readily indicating the
extent of immune response to the 161P2F10B epitope, and thus the
status of exposure to 161P2F10B, or exposure to a vaccine that
elicits a protective or therapeutic response.
Example 26
Use of Peptide Epitopes to Evaluate Recall Responses
[0596] The peptide epitopes of the invention are used as reagents
to evaluate T cell responses, such as acute or recall responses, in
patients. Such an analysis may be performed on patients who have
recovered from 161P2F10B-associated disease or who have been
vaccinated with an 161P2F10B vaccine.
[0597] For example, the class I restricted CTL response of persons
who have been vaccinated may be analyzed. The vaccine may be any
161P2F10B vaccine. PBMC are collected from vaccinated individuals
and HLA typed. Appropriate peptide epitopes of the invention that,
optimally, bear supermotifs to provide cross-reactivity with
multiple HLA supertype family members, are then used for analysis
of samples derived from individuals who bear that HLA type.
[0598] PBMC from vaccinated individuals are separated on
Ficoll-Histopaque density gradients (Sigma Chemical Co., St. Louis,
Mo.), washed three times in HBSS (GIBCO Laboratories), resuspended
in RPMI-1640 (GIBCO Laboratories) supplemented with L-glutamine (2
mM), penicillin (50 U/ml), streptomycin (50 .mu.g/ml), and Hepes
(10 mM) containing 10% heat-inactivated human AB serum (complete
RPMI) and plated using microculture formats. A synthetic peptide
comprising an epitope of the invention is added at 10 .mu.g/ml to
each well and HBV core 128-140 epitope is added at 1 .mu.g/ml to
each well as a source of T cell help during the first week of
stimulation.
[0599] In the microculture format, 4.times.10.sup.5 PBMC are
stimulated with peptide in 8 replicate cultures in 96-well round
bottom plate in 100 .mu.l/well of complete RPMI. On days 3 and 10,
100 .mu.l of complete RPMI and 20 U/ml final concentration of rIL-2
are added to each well. On day 7 the cultures are transferred into
a 96-well flat-bottom plate and restimulated with peptide, rIL-2
and 10.sup.5 irradiated (3,000 rad) autologous feeder cells. The
cultures are tested for cytotoxic activity on day 14. A positive
CTL response requires two or more of the eight replicate cultures
to display greater than 10% specific .sup.51Cr release, based on
comparison with non-diseased control subjects as previously
described (Rehermann, et al., Nature Med. 2:1104,1108, 1996;
Rehermann et al., J. Clin. Invest. 97:1655-1665, 1996; and
Rehermann et al. J. Clin. Invest. 98:1432-1440, 1996).
[0600] Target cell lines are autologous and allogeneic
EBV-transformed B-LCL that are either purchased from the American
Society for Histocompatibility and Immunogenetics (ASHI, Boston,
Mass.) or established from the pool of patients as described
(Guilhot, et al. J. Virol. 66:2670-2678, 1992).
[0601] Cytotoxicity assays are performed in the following manner.
Target cells consist of either allogeneic HLA-matched or autologous
EBV-transformed B lymphoblastoid cell line that are incubated
overnight with the synthetic peptide epitope of the invention at 10
.mu.M, and labeled with 100 .mu.Ci of .sup.51Cr (Amersham Corp.,
Arlington Heights, Ill.) for 1 hour after which they are washed
four times with HBSS.
[0602] Cytolytic activity is determined in a standard 4-h, split
well .sup.51Cr release assay using U-bottomed 96 well plates
containing 3,000 targets/well. Stimulated PBMC are tested at
effector/target (E/T) ratios of 20-50:1 on day 14. Percent
cytotoxicity is determined from the formula:
100.times.[(experimental release-spontaneous release)/maximum
release-spontaneous release)]. Maximum release is determined by
lysis of targets by detergent (2% Triton X-100; Sigma Chemical Co.,
St. Louis, Mo.). Spontaneous release is <25% of maximum release
for all experiments.
[0603] The results of such an analysis indicate the extent to which
HLA-restricted CTL populations have been stimulated by previous
exposure to 161P2F10B or an 161P2F10B vaccine.
[0604] Similarly, Class II restricted HTL responses may also be
analyzed. Purified PBMC are cultured in a 96-well flat bottom plate
at a density of 1.5.times.10.sup.5 cells/well and are stimulated
with 10 .mu.g/ml synthetic peptide of the invention, whole
161P2F10B antigen, or PHA. Cells are routinely plated in replicates
of 4-6 wells for each condition. After seven days of culture, the
medium is removed and replaced with fresh medium containing 10 U/ml
IL-2. Two days later, 1 .mu.Ci .sup.3H-thymidine is added to each
well and incubation is continued for an additional 18 hours.
Cellular DNA is then harvested on glass fiber mats and analyzed for
.sup.3H-thymidine incorporation. Antigen-specific T cell
proliferation is calculated as the ratio of .sup.3H-thymidine
incorporation in the presence of antigen divided by the
.sup.3H-thymidine incorporation in the absence of antigen.
Example 27
Induction of Specific CTL Response in Humans
[0605] A human clinical trial for an immunogenic composition
comprising CTL and HTL epitopes of the invention is set up as an
IND Phase I, dose escalation study and carried out as a randomized,
double-blind, placebo-controlled trial. Such a trial is designed,
for example, as follows:
[0606] A total of about 27 individuals are enrolled and divided
into 3 groups:
[0607] Group I: 3 subjects are injected with placebo and 6 subjects
are injected with 5 .mu.g of peptide composition;
[0608] Group II: 3 subjects are injected with placebo and 6
subjects are injected with 50 .mu.g peptide composition;
[0609] Group III: 3 subjects are injected with placebo and 6
subjects are injected with 500 .mu.g of peptide composition.
[0610] After 4 weeks following the first injection, all subjects
receive a booster inoculation at the same dosage.
[0611] The endpoints measured in this study relate to the safety
and tolerability of the peptide composition as well as its
immunogenicity. Cellular immune responses to the peptide
composition are an index of the intrinsic activity of this the
peptide composition, and can therefore be viewed as a measure of
biological efficacy. The following summarize the clinical and
laboratory data that relate to safety and efficacy endpoints.
[0612] Safety: The incidence of adverse events is monitored in the
placebo and drug treatment group and assessed in terms of degree
and reversibility.
[0613] Evaluation of Vaccine Efficacy: For evaluation of vaccine
efficacy, subjects are bled before and after injection. Peripheral
blood mononuclear cells are isolated from fresh heparinized blood
by Ficoll-Hypaque density gradient centrifugation, aliquoted in
freezing media and stored frozen. Samples are assayed for CTL and
HTL activity.
[0614] The vaccine is found to be both safe and efficacious.
Example 28
Phase II Trials in Patients Expressing 161P2F10B
[0615] Phase II trials are performed to study the effect of
administering the CTL-HTL peptide compositions to patients having
cancer that expresses 161P2F10B. The main objectives of the trial
are to determine an effective dose and regimen for inducing CTLs in
cancer patients that express 161P2F10B, to establish the safety of
inducing a CTL and HTL response in these patients, and to see to
what extent activation of CTLs improves the clinical picture of
these patients, as manifested, e.g., by the reduction and/or
shrinking of lesions. Such a study is designed, for example, as
follows:
[0616] The studies are performed in multiple centers. The trial
design is an open-label, uncontrolled, dose escalation protocol
wherein the peptide composition is administered as a single dose
followed six weeks later by a single booster shot of the same dose.
The dosages are 50, 500 and 5,000 micrograms per injection.
Drug-associated adverse effects (severity and reversibility) are
recorded.
[0617] There are three patient groupings. The first group is
injected with 50 micrograms of the peptide composition and the
second and third groups with 500 and 5,000 micrograms of peptide
composition, respectively. The patients within each group range in
age from 21-65 and represent diverse ethnic backgrounds. All of
them have a tumor that expresses 161P2F10B.
[0618] Clinical manifestations or antigen-specific T-cell responses
are monitored to assess the effects of administering the peptide
compositions. The vaccine composition is found to be both safe and
efficacious in the treatment of 161P2F10B-associated disease.
Example 29
Induction of CTL Responses Using a Prime Boost Protocol
[0619] A prime boost protocol similar in its underlying principle
to that used to confirm the efficacy of a DNA vaccine in transgenic
mice, such as described above in the Example entitled "The Plasmid
Construct and the Degree to Which It Induces Immunogenicity," can
also be used for the administration of the vaccine to humans. Such
a vaccine regimen can include an initial administration of, for
example, naked DNA followed by a boost using recombinant virus
encoding the vaccine, or recombinant protein/polypeptide or a
peptide mixture administered in an adjuvant.
[0620] For example, the initial immunization may be performed using
an expression vector, such as that constructed in the Example
entitled "Construction of `Minigene` Multi-Epitope DNA Plasmids" in
the form of naked nucleic acid administered IM (or SC or ID) in the
amounts of 0.5-5 mg at multiple sites. The nucleic acid (0.1 to
1000 .mu.g) can also be administered using a gene gun. Following an
incubation period of 3-4 weeks, a booster dose is then
administered. The booster can be recombinant fowlpox virus
administered at a dose of 5-10.sup.7 to 5.times.10.sup.9 pfu. An
alternative recombinant virus, such as an MVA, canarypox,
adenovirus, or adeno-associated virus, can also be used for the
booster, or the polyepitopic protein or a mixture of the peptides
can be administered. For evaluation of vaccine efficacy, patient
blood samples are obtained before immunization as well as at
intervals following administration of the initial vaccine and
booster doses of the vaccine. Peripheral blood mononuclear cells
are isolated from fresh heparinized blood by Ficoll-Hypaque density
gradient centrifugation, aliquoted in freezing media and stored
frozen. Samples are assayed for CTL and HTL activity.
[0621] Analysis of the results indicates that a magnitude of
response sufficient to achieve a therapeutic or protective immunity
against 161P2F10B is generated.
Example 30
Administration of Vaccine Compositions Using Dendritic Cells
(DC)
[0622] Vaccines comprising peptide epitopes of the invention can be
administered using APCs, or "professional" APCs such as DC. In this
example, peptide-pulsed DC are administered to a patient to
stimulate a CTL response in vivo. In this method, dendritic cells
are isolated, expanded, and pulsed with a vaccine comprising
peptide CTL and HTL epitopes of the invention. The dendritic cells
are infused back into the patient to elicit CTL and HTL responses
in vivo. The induced CTL and HTL then destroy or facilitate
destruction, respectively, of the target cells that bear the
161P2F10B protein from which the epitopes in the vaccine are
derived.
[0623] For example, a cocktail of epitope-comprising peptides is
administered ex vivo to PBMC, or isolated DC therefrom. A
pharmaceutical to facilitate harvesting of DC can be used, such as
Progenipoietin.TM. (Monsanto, St. Louis, Mo.) or GM-CSF/IL-4. After
pulsing the DC with peptides, and prior to reinfusion into
patients, the DC are washed to remove unbound peptides.
[0624] As appreciated clinically, and readily determined by one of
skill based on clinical outcomes, the number of DC reinfused into
the patient can vary (see, e.g., Nature Med. 4:328, 1998; Nature
Med. 2:52, 1996 and Prostate 32:272, 1997). Although
2-50.times.10.sup.6 DC per patient are typically administered,
larger number of DC, such as 10.sup.7 or 10.sup.8 can also be
provided. Such cell populations typically contain between 50-90%
DC.
[0625] In some embodiments, peptide-loaded PBMC are injected into
patients without purification of the DC. For example, PBMC
generated after treatment with an agent such as Progenipoietin.TM.
are injected into patients without purification of the DC. The
total number of PBMC that are administered often ranges from
10.sup.8 to 10.sup.10. Generally, the cell doses injected into
patients is based on the percentage of DC in the blood of each
patient, as determined, for example, by immunofluorescence analysis
with specific anti-DC antibodies. Thus, for example, if
Progenipoietin.TM. mobilizes 2% DC in the peripheral blood of a
given patient, and that patient is to receive 5.times.10.sup.6 DC,
then the patient will be injected with a total of
2.5.times.10.sup.8 peptide-loaded PBMC. The percent DC mobilized by
an agent such as Progenipoietin.TM. is typically estimated to be
between 2-10%, but can vary as appreciated by one of skill in the
art.
[0626] Ex vivo Activation of CTL/HTL Responses
[0627] Alternatively, ex vivo CTL or HTL responses to 161P2F10B
antigens can be induced by incubating, in tissue culture, the
patient's, or genetically compatible, CTL or HTL precursor cells
together with a source of APC, such as DC, and immunogenic
peptides. After an appropriate incubation time (typically about
7-28 days), in which the precursor cells are activated and expanded
into effector cells, the cells are infused into the patient, where
they will destroy (CTL) or facilitate destruction (HTL) of their
specific target cells, i.e., tumor cells.
Example 31
An Alternative Method of Identifying and Confirming Motif-Bearing
Peptides
[0628] Another method of identifying and confirming motif-bearing
peptides is to elute them from cells bearing defined MHC molecules.
For example, EBV transformed B cell lines used for tissue typing
have been extensively characterized to determine which HLA
molecules they express. In certain cases these cells express only a
single type of HLA molecule. These cells can be transfected with
nucleic acids that express the antigen of interest, e.g. 161P2F10B.
Peptides produced by endogenous antigen processing of peptides
produced as a result of transfection will then bind to HLA
molecules within the cell and be transported and displayed on the
cell's surface. Peptides are then eluted from the HLA molecules by
exposure to mild acid conditions and their amino acid sequence
determined, e.g., by mass spectral analysis (e.g., Kubo et al., J.
Immunol. 152:3913, 1994). Because the majority of peptides that
bind a particular HLA molecule are motif-bearing, this is an
alternative modality for obtaining the motif-bearing peptides
correlated with the particular HLA molecule expressed on the
cell.
[0629] Alternatively, cell lines that do not express endogenous HLA
molecules can be transfected with an expression construct encoding
a single HLA allele. These cells can then be used as described,
i.e., they can then be transfected with nucleic acids that encode
161P2F10B to isolate peptides corresponding to 161P2F10B that have
been presented on the cell surface. Peptides obtained from such an
analysis will bear motif(s) that correspond to binding to the
single HLA allele that is expressed in the cell.
[0630] As appreciated by one in the art, one can perform a similar
analysis on a cell bearing more than one HLA allele and
subsequently determine peptides specific for each HLA allele
expressed. Moreover, one of skill would also recognize that means
other than transfection, such as loading with a protein antigen,
can be used to provide a source of antigen to the cell.
Example 32
Complementary Polynucleotides
[0631] Sequences complementary to the 161P2F10B-encoding sequences,
or any parts thereof, are used to detect, decrease, or inhibit
expression of naturally occurring 161P2F10B. Although use of
oligonucleotides comprising from about 15 to 30 base pairs is
described, essentially the same procedure is used with smaller or
with larger sequence fragments. Appropriate oligonucleotides are
designed using, e.g., OLIGO 4.06 software (National Biosciences)
and the coding sequence of 161P2F10B. To inhibit transcription, a
complementary oligonucleotide is designed from the most unique 5'
sequence and used to prevent promoter binding to the coding
sequence. To inhibit translation, a complementary oligonucleotide
is designed to prevent ribosomal binding to the 161P2F10B-encoding
transcript.
Example 33
Purification of Naturally-Occurring or Recombinant 161P2F10B Using
161P2F10B Specific Antibodies
[0632] Naturally occurring or recombinant 161P2F10B is
substantially purified by immunoaffinity chromatography using
antibodies specific for 161P2F10B. An immunoaffinity column is
constructed by covalently coupling anti-161P2F10B antibody to an
activated chromatographic resin, such as CNBr-activated SEPHAROSE
(Amersham Pharmacia Biotech). After the coupling, the resin is
blocked and washed according to the manufacturer's
instructions.
[0633] Media containing 161P2F10B are passed over the
immunoaffinity column, and the column is washed under conditions
that allow the preferential absorbance of 161P2F10B (e.g., high
ionic strength buffers in the presence of detergent). The column is
eluted under conditions that disrupt antibody/161P2F10B binding
(e.g., a buffer of pH 2 to pH 3, or a high concentration of a
chaotrope, such as urea or thiocyanate ion), and GCR.P is
collected.
Example 34
Identification of Molecules which Interact with 161P2F10B
[0634] 161P2F10B, or biologically active fragments thereof, are
labeled with 121 1 Bolton-Hunter reagent. (See, e.g., Bolton et al.
(1973) Biochem. J. 133:529.) Candidate molecules previously arrayed
in the wells of a multi-well plate are incubated with the labeled
161P2F10B, washed, and any wells with labeled 161P2F10B complex are
assayed. Data obtained using different concentrations of 161P2F10B
are used to calculate values for the number, affinity, and
association of 161P2F10B with the candidate molecules.
Example 35
In Vivo Assay for 161P2F10B Tumor Growth Promotion
[0635] The effect of the 161P2F10B protein on tumor cell growth is
evaluated in vivo by gene overexpression in tumor-bearing mice. For
example, SCID mice are injected subcutaneously on each flank with
1.times.10.sup.6 of either PC3, TSUPR1, or DU145 cells containing
tkNeo empty vector or 161P2F10B. At least two strategies may be
used: (1) Constitutive 161P2F10B expression under regulation of a
promoter such as a constitutive promoter obtained from the genomes
of viruses such as polyoma virus, fowlpox virus (UK 2,211,504
published 5 Jul. 1989), adenovirus (such as Adenovirus 2), bovine
papilloma virus, avian sarcoma virus, cytomegalovirus, a
retrovirus, hepatitis-B virus and Simian Virus 40 (SV40), or from
heterologous mammalian promoters, e.g., the actin promoter or an
immunoglobulin promoter, provided such promoters are compatible
with the host cell systems, and (2) regulated expression under
control of an inducible vector system, such as ecdysone, tet, etc.,
provided such promoters are compatible with the host cell systems.
Tumor volume is then monitored at the appearance of palpable tumors
and followed over time and determines that 161P2F10B-expressing
cells grow at a faster rate and/or tumors produced by
161P2F10B-expressing cells demonstrate characteristics of altered
aggressiveness (e.g. enhanced metastasis, vascularization, reduced
responsiveness to chemotherapeutic drugs).
[0636] Additionally, mice can be implanted with 1.times.10.sup.5 of
the same cells orthotopically to determine that 161P2F10B has an
effect on local growth in the prostate and/or on the ability of the
cells to metastasize, e.g., to lungs, lymph nodes, and bone
marrow.
[0637] The assay is also useful to determine the
161P2F10B-inhibitory effect of candidate therapeutic compositions,
such as for example, small molecule drugs, 161P2F10B intrabodies,
161P2F10B antisense molecules and ribozymes.
Example 36
161P2F10B Monoclonal Antibody-Mediated Inhibition of Prostate
Tumors In Vivo
[0638] The significant expression of 161P2F10B, in cancer tissues,
together with its restricted expression in normal tissues along
with its cell surface expression makes 161P2F10B an excellent
target for antibody therapy. Similarly, 161P2F10B is a target for T
cell-based immunotherapy. Thus, the therapeutic efficacy of
anti-161P2F10B mAbs is evaluated, e.g., in human prostate cancer
xenograft mouse models using androgen-independent LAPC-4 and LAPC-9
xenografts (Craft, N., et al.,. Cancer Res, 1999. 59(19): p.
5030-6), kidney cancer xenografts (AGS-K3, AGS-K6), kidney cancer
metastases to lymph node (AGS-K6 met) xenografts, and kidney cancer
cell lines transfected with 161P2F10B, such as 769P-161P2F10B,
A498-161P2F10B.
[0639] Antibody efficacy on tumor growth and metastasis formation
is studied, e.g., in mouse orthotopic prostate cancer xenograft
models and mouse kidney xenograft models. The antibodies can be
unconjugated, as discussed in this Example, or can be conjugated to
a therapeutic modality, as appreciated in the art. Anti-161P2F10B
mAbs inhibit formation of both the androgen-dependent LAPC-9 and
androgen-independent PC3-161P2F10B tumor xenografts. Anti-161P2F10B
mAbs also retard the growth of established orthotopic tumors and
prolonged survival of tumor-bearing mice. These results indicate
the utility of anti-161P2F10B mAbs in the treatment of local and
advanced stages of prostate cancer. (See, e.g., Saffran, D., et
al., PNAS 10:1073-1078). Similarly, anti-161P2F10B mAbs can inhibit
formation of AGS-K3 and AGS-K6 tumors in SCID mice, and prevent or
retard the growth A498-161P2F10B tumor xenografts. These results
indicate the use of anti-161P2F10B mAbs in the treatment of
prostate and/or kidney cancer.
[0640] Administration of the anti-161P2F10B mAbs leads to
retardation of established orthotopic tumor growth and inhibition
of metastasis to distant sites, resulting in a significant
prolongation in the survival of tumor-bearing mice. These studies
indicate that 161P2F10B is an attractive target for immunotherapy
and demonstrate the therapeutic use of anti-161P2F10B mAbs for the
treatment of local and metastatic prostate cancer. This example
demonstrates that unconjugated 161P2F10B monoclonal antibodies are
effective to inhibit the growth of human prostate tumor xenografts
and human kidney xenografts grown in SCID mice.
[0641] Tumor Inhibition using Multiple Unconjugated 161P2F10B
mAbs
[0642] Materials and Methods
[0643] 161P2F10B Monoclonal Antibodies:
[0644] Monoclonal antibodies are raised against 161P2F10B as
described in the Example entitled "Generation of 161P2F10B
Monoclonal Antibodies (mAbs)" or are obtained commercially, e.g.,
97A6 (Coulter Immunotech). The antibodies are characterized by
ELISA, Western blot, FACS, and immunoprecipitation for their
capacity to bind 161P2F10B. Epitope mapping data for the
anti-161P2F10B mAbs, as determined by ELISA and Western analysis,
recognize epitopes on the 161P2F10B protein. The 97A6 antibody
binds to amino acids 393-405 of the 161P2F10B protein shown in FIG.
2 Immunohistochemical analysis of cancer tissues and cells is
performed with these antibodies.
[0645] The monoclonal antibodies are purified from ascites or
hybridoma tissue culture supernatants by Protein-G SEPHAROSE
chromatography, dialyzed against PBS, filter sterilized, and stored
at -20.degree. C. Protein determinations are performed by a
Bradford assay (Bio-Rad, Hercules, Calif.). A therapeutic
monoclonal antibody or a cocktail comprising a mixture of
individual monoclonal antibodies is prepared and used for the
treatment of mice receiving subcutaneous or orthotopic injections
of LAPC-9 prostate tumor xenografts.
[0646] Cancer Xenografts and Cell Lines
[0647] The LAPC-9 xenograft, which expresses a wild-type androgen
receptor and produces prostate-specific antigen (PSA), is passaged
in 6- to 8-week-old male ICR-severe combined immunodeficient (SCID)
mice (Taconic Farms) by s.c. trocar implant (Craft, N., et al.,
supra). The AGS-K3 and AGS-K6 kidney xenografts are also passaged
by subcutaneous implants in 6- to 8-week old SCID mice. Single-cell
suspensions of tumor cells are prepared as described in Craft, et
al. The prostate carcinoma cell line PC3 (American Type Culture
Collection) is maintained in RPMI supplemented with L-glutamine and
10% FBS, and the kidney carcinoma line A498 (American Type Culture
Collection) is maintained in DMEM supplemented with L-glutamine and
10% FBS.
[0648] PC3-161P2F10B and A498-161P2F10B cell populations are
generated by retroviral gene transfer as described in Hubert, R.
S., et al., STEAP: A Prostate-specific Cell-surface Antigen Highly
Expressed in Human Prostate Tumors, Proc Natl Acad Sci USA, 1999.
96(25): p. 14523-8. Anti-161P2F10B staining is detected by using an
FITC-conjugated goat anti-mouse antibody (Southern Biotechnology
Associates) followed by analysis on a Coulter Epics-XL f low
cytometer.
[0649] Xenograft Mouse Models.
[0650] Subcutaneous (s.c.) tumors are generated by injection of
1.times.10 .sup.6 LAPC-9, AGS-K3, AGS-K6, PC3, PC3-161P2F10B, A498
or A498-161P2F10B cells mixed at a 1:1 dilution with MATRIGEL
(Collaborative Research) in the right flank of male SCID mice. To
test antibody efficacy on tumor formation, i.p. antibody injections
are started on the same day as tumor-cell injections. As a control,
mice are injected with either purified mouse IgG (ICN) or PBS; or a
purified monoclonal antibody that recognizes an irrelevant antigen
not expressed in human cells. In preliminary studies, no difference
is found between mouse IgG or PBS on tumor growth. Tumor sizes are
determined by vernier caliper measurements, and the tumor volume is
calculated as length.times.width.times.height. Mice with s.c.
tumors greater than 1.5 cm in diameter are sacrificed. PSA levels
are determined by using a PSA ELISA kit (Anogen, Mississauga,
Ontario). Circulating levels of anti-161P2F10B mAbs are determined
by a capture ELISA kit (Bethyl Laboratories, Montgomery, Tex.).
(See, e.g., (Saffran, D., et al., PNAS 10:1073-1078)
[0651] Orthotopic prostate injections are performed under
anesthesia by using ketamine/xylazine. For prostate orthotopic
studies, an incision is made through the abdominal muscles to
expose the bladder and seminal vesicles, which then are delivered
through the incision to expose the dorsal prostate. LAPC-9 cells
(5.times.10.sup.5) mixed with MATRIGEL are injected into each
dorsal lobe in a 10-.mu.l volume. To monitor tumor growth, mice are
bled on a weekly basis for determination of PSA levels. For kidney
orthopotic models, an incision is made through the abdominal
muscles to expose the kidney. AGS-K3 or AGS-K6 cells mixed with
MATRIGEL are injected under the kidney capsule. The mice are
segregated into groups for the appropriate treatments, with
anti-161P2F10B or control mAbs being injected i.p.
[0652] Anti-161P2F10B mAbs Inhibit Growth of 161P2F10B-Expressing
Xenograft-Cancer Tumors
[0653] The effect of anti-161P2F10B mAbs on tumor formation is
tested by using LAPC-9 and/or AGS-K3 orthotopic models. As compared
with the s.c. tumor model, the orthotopic model, which requires
injection of tumor cells directly in the mouse prostate or kidney,
respectively, results in a local tumor growth, development of
metastasis in distal sites, deterioration of mouse health, and
subsequent death (Saffran, D., et al., PNAS supra; Fu, X., et al.,
Int J Cancer, 1992. 52(6): p. 987-90; Kubota, T., J Cell Biochem,
1994. 56(1): p. 4-8). The features make the orthotopic model more
representative of human disease progression and allowed for
tracking of the therapeutic effect of mAbs on clinically relevant
end points.
[0654] Accordingly, tumor cells are injected into the mouse
prostate or kidney, and 2 days later, the mice are segregated into
two groups and treated with either: a) 200-500 .mu.g, of
anti-161P2F10B Ab, or b) PBS three times per week for two to five
weeks.
[0655] A major advantage of the orthotopic prostate-cancer model is
the ability to study the development of metastases. Formation of
metastasis in mice bearing established orthotopic tumors is studies
by IHC analysis on lung sections using an antibody against a
prostate-specific cell-surface protein STEAP expressed at high
levels in LAPC-9 xenografts (Hubert, R. S., et al., Proc Natl Acad
Sci USA, 1999. 96(25): p. 14523-8) or anti-G250 antibody for kidney
cancer models.
[0656] Mice bearing established orthotopic LAPC-9 tumors are
administered 1000 .mu.g injections of either anti-161P2F10B mAb or
PBS over a 4-week period. Mice in both groups are allowed to
establish a high tumor burden (PSA levels greater than 300 ng/ml),
to ensure a high frequency of metastasis formation in mouse lungs.
Mice then are killed and their prostate/kidney and lungs are
analyzed for the presence of tumor cells by IHC analysis.
[0657] These studies demonstrate a broad anti-tumor efficacy of
anti-161P2F10B antibodies on initiation and progression of prostate
and kidney cancer in xenograft mouse models. Anti-161P2F10B
antibodies inhibit tumor formation of both androgen-dependent and
androgen-independent prostate tumors as well as retarding the
growth of already established tumors and prolong the survival of
treated mice. Moreover, anti-161P2F10B mAbs demonstrate a dramatic
inhibitory effect on the spread of local prostate tumor to distal
sites, even in the presence of a large tumor burden. Similar
therapeutic effects are seen in the kidney cancer model. Thus,
anti-161P2F10B mAbs are efficacious on major clinically relevant
end points (tumor growth), prolongation of survival, and
health.
Example 37
Inhibition of 161P2F10B Phosphodiesterase Activity
[0658] A number of phosphodiesterase inhibitors are currently in
clinical trials to investigate their use as vasodilators,
anti-inflammatory, anti-asthmatic, anti-thrombotic and
anti-depressant agents. Some of these inhibitors are non-selective,
such as Theophylline used for the treatment of asthma, whereas
others exhibit substrate specificity. For example, the
phosphodiesterase V inhibitor sildenafil showed great success for
the treatment of male erectile dysfunction. The phosphodiesterase I
inhibitor vinpocetine is currently being investigated for the
treatment of urge incontinence and low compliance bladder.
KF-119514 is a phosphodiesterase I/IV inhibitor shown to protect
against asthma by virtue of its anti-allergic and bronchodilator
activities (Fujimura et al. European Journal of Pharmacology 327:
57, 1997). Metformin is another phosphodiesterase I inhibitor that
has been shown to reduce lymphocyte PC-1 activity after 3-months
administration to Type 2 diabetic patients, corresponding to an
improvement in insulin sensitivity (Stefanovic et al.
Diabetes/Metabolism Research and Reviews 15:400, 1999).
[0659] The significant expression of 161P2F10B in cancer tissues,
together with its restricted expression in normal tissues, makes
161P2F10B an excellent target for phosphodiesterase inhibitor
therapy. Accordingly, the efficacy of the phosphodiesterase
inhibitors in human cancer mouse models is modeled in
161P2F10B-expressing kidney, bladder or prostate cancer xenografts
or cancer cell lines, either expressing 161P2F10B endogenously, or
have been engineered to express 161P2F10B as discussed in Example 6
above. Such studies performed on human pancreatic cancer cells have
demonstrated the utility of phosphodiesterase inhibitors in
preventing cell cycle progression of cancer cells (Boucher M et al,
Biochem. Biophys. Res. Commun. 2001, 13:285). Moreover, studies
performed in SCID mice demonstrate that phosphodiesterase
inhibitors such as Zaprinast decrease tumor weight in neuroblastoma
bearing mice (Giorgi Met al. J. Neurooncol. 2001, 51:25).
[0660] Administration of phosphodiesterase inhibitors retard
established tumor growth and inhibit metastasis to distant sites,
resulting in a significant prolongation in the survival of
tumor-bearing mice. These studies show that 161P2F10B is an
attractive target for cancer therapy and demonstrate the
therapeutic efficacy of phosphodiesterase inhibitors for the
treatment of local and metastatic cancers, e.g., kidney, bladder
and prostate cancers.
[0661] This example demonstrates that phosphodieterase inhibitors
effectively inhibit the growth of human tumors grown in SCID mice.
Accordingly, in one embodiment it is also seen that a combination
of such efficacious phosphodiesterase inhibitors and/or derivatives
thereof are also effective.
Example 38
"ENPP Activity": Detection of 161P2F10B Phosphodiesterase Activity
in Human Cancer Cells
[0662] 161P2F10B is identical to ENPP3 phosphodieterase (also
called CD203c or PD-1 beta). ENPP3 is an ecto-enzyme belonging to a
family of ectonucleotide phosphodiesterases and pyrophospahatases.
ENPP3 is a phosphodiesterase I ecto-enzyme. It is expressed in
normal prostate and uterus, as well as on basophils and mast cells.
Expression on the hematopoietic cells is upregulated in presence of
allergen or by cross-linking with IgE (Buring et al., 1999, Blood
94: 2343).
[0663] Members of the ENPP family possess ATPase and ATP
pyrophosphatase activities. They hydrolyze extracellular
nucleotides, nucleoside phosphates, and NAD. They are involved in
extracellular nucleotide metabolism, nucleotide signaling, and
recycling of extracellular nucleotides. They are also involved in
cell-cell and cell-matrix interactions. ENPP enzymes differ in
their substrate specificity and tissue distribution.
[0664] ENPP enzymes also play a role in recycling extracellular
nucleotides. It has been demonstrated that ENNP1 allows activated
T-cells to use NAD+ from dying cells as a source of adenosine.
ENPP3 expressed in the intestine may also be involved in the
hydrolysis of nucleotides derived from food (Byrd et al 1985, Scott
et al. 1997).
[0665] To assess phosphodiesterase I activity of 161P2F10B, cell
lysates or purified protein are prepared from human normal and
cancer tissues, and incubated for 5 hr at 37 degrees in 20 mM
Tris/HCL, pH 9.6 containing 5 mM MgCl.sub.2 and 1 mM p-nitrophenyl
thymidine-5'-L-monophosphate. The reaction is terminated by the
addition of 0.1 N NaOH and the reaction product quantified by
reading absorbance at 410 nm (A410.times.64=nmol p-nitrophenol).
Thus, the phosphodiesterase I activity of 161P2F10B in cancer
tissues is confirmed. When 161P2F10B shows phosphodiesterase
activity, it is used as a target for diagnostic, prognostic,
preventative and/or therapeutic purposes.
Example 39
Detection of 161P2F10B Protein in Kidney Cancer Patient
Specimens
[0666] To confirm the expression of 161P2F10B protein, kidney
cancer specimens were obtained from kidney cancer patients, and
stained using the commercially available antibody 97A6 specific for
ENPP3 protein (also called anti-CD203c) (Immunotech, Marseilles,
France). Briefly, frozen tissues were cut into 4 micron sections
and fixed in acetone for 10 minutes. The sections were then
incubated with PE-labeled mouse monoclonal anti-ENPP3 antibody for
3 hours (FIG. 16A-F), or isotype control antibody (FIG. 16G-I). The
slides were washed three times in buffer, and either analyzed by
fluorescence microscopy (FIGS. 16A, B and C), or further incubated
with DAKO Envision+.TM. peroxidase-conjugated goat anti-mouse
secondary antibody (DAKO Corporation, Carpenteria, Calif.) for 1
hour (FIGS. 16D, E, and F). The sections were then washed in
buffer, developed using the DAB kit (SIGMA Chemicals),
counterstained using hematoxylin, and analyzed by bright field
microscopy (FIGS. 16D, E and F). The results showed strong
expression of 161P2F10B in the renal carcinoma patient tissue
(FIGS. 16A and D) and the kidney cancer metastasis to lymph node
tissue (FIGS. 16C and F), but weakly in normal kidney (FIGS. 16B
and E). The expression was detected mostly around the cell membrane
indicating that 161P2F10B is membrane associated in kidney cancer
tissues. The weak expression detected in normal kidney was
localized to the kidney tubules. The sections stained with the
isotype control antibody were negative showing the specificity of
the anti-ENPP3 antibody (FIG. 16G-I).
[0667] FIG. 20 shows expression of 161P2F10B in human patient
cancers by Western blot analysis. Cell lysates from kidney cancer
tissues (KiCa), kidney cancer metastasis to lymph node (KiCa Met),
as well as normal kidney (NK) were subjected to western analysis
using an anti-161P2F10B mouse monoclonal antibody. Briefly, tissues
(-25 .mu.g total protein) were solubilized in SDS-PAGE sample
buffer and separated on a 10-20% SDS-PAGE gel and transferred to
nitrocellulose. Blots were blocked in Tris-buffered saline (TBS)+3%
non-fat milk and then probed with purified anti-161P2F10B antibody
in TBS+0.15% TWEEN-20+1% milk. Blots were then washed and incubated
with a 1:4,000 dilution of anti-mouse IgG-HRP conjugated secondary
antibody. Following washing, anti-161P2F10B immunoreactive bands
were developed and visualized by enhanced chemiluminescence and
exposure to autoradiographic film. The specific anti-161P2F10B
immunoreactive bands represent a monomeric form of the 161P2F10B
protein, which runs at approximately 130 kDa. These results
demonstrate that 161P2F10B is useful as a diagnostic and
therapeutic target for kidney cancers, metastatic cancers and other
human cancers that express this protein.
[0668] The strong expression of 161P2F10B in kidney cancer tissues
and its restricted expression in normal kidney as well as its
membrane localization show that 161P2F10B is a target, e.g., for
kidney cancer diagnosis and therapy. The expression detected in
kidney cancer metastatic tissue indicates that 161P2F10B is also a
target for metastatic disease.
Example 40
Expression of 161P2F10B Protein in Kidney Cancer Xenograft
Tissues
[0669] Cancer xenografts were established from patient renal clear
cell carcinoma and from its metastatic tissue to lymph node.
Xenograft tissues were harvested from animals and dispersed into
single cell suspension. The cells were stained with the using the
commercially available antibody 97A6 specific for ENPP3 protein
(also called anti-CD203c) (Immunotech, Marseilles, France). They
were then washed in PBS and analyzed by flow cytometry as shown in
FIG. 17. Results show strong expression of 161P2F10B in both renal
cell carcinoma xenograft (FIG. 17A) as well as renal cancer
metastasis xenograft (FIG. 17B). These data demonstrate that
161P2F10B is expressed on the cell surface of the kidney cancer and
kidney cancer metastasis xenograft cells.
[0670] FIG. 18 shows expression of 161P2F10B in xenograft tissues
by immunohistochemistry. Renal cell carcinoma (FIG. 18A, D, G),
renal cell carcinoma metastasis to lymph node (FIG. 18B, E, H), and
prostate cancer LAPC-4AI (FIG. 18C, F, I) xenografts were grown in
SCID mice. Xenograft tissues were harvested, frozen sections were
cut into 4 micron sections and fixed in acetone for 10 minutes. The
sections were then incubated with PE-labeled mouse monoclonal
anti-ENPP3 antibody (Immunotech, Marseilles, France) for 3 hours
(FIG. 18A-F), or isotype control antibody (FIG. 18G-I). The slides
were washed three times in buffer, and either analyzed by
fluorescence microscopy (FIG. 18A-C), or further incubated with
DAKO Envision+.TM. peroxidase-conjugated goat anti-mouse secondary
antibody (DAKO Corporation, Carpenteria, Calif.) for 1 hour (FIG.
18D-I). The sections were then washed in buffer, developed using
the DAB kit (SIGMA Chemicals), counterstained using hematoxylin,
and analyzed by bright field microscopy (FIG. 17C-F). The results
showed strong expression of 161P2F10B in the renal cell carcinoma
xenograft tissue (FIGS. 17A and D), in the kidney cancer metastasis
to lymph node, as well as in the LAPC-4AI prostate xenograft, but
not in the negative isotype control sections (FIG. 17G, H, I). The
expression was detected mostly around the cell membrane indicating
that 161P2F10B is membrane-associated in these tissues.
[0671] FIG. 21 shows expression of 161P2F10B in human xenograft
tissues by Western blot analysis. Cell lysates from kidney cancer
xenograft (KiCa Xeno), kidney cancer metastasis to lymph node
xenograft (Met Xeno), as well as normal kidney (NK) were subjected
to Western analysis using an anti-161P2F10B mouse monoclonal
antibody. Briefly, tissues (.about.25 .mu.g total protein) were
solubilized in SDS-PAGE sample buffer and separated on a 10-20%
SDS-PAGE gel and transferred to nitrocellulose. Blots were blocked
in Tris-buffered saline (TBS)+3% non-fat milk and then probed with
purified anti-161P2F10B antibody in TBS+0.15% TWEEN-20+1% milk
Blots were then washed and incubated with a 1:4,000 dilution of
anti-mouse IgG-HRP conjugated secondary antibody. Following
washing, anti-161P2F10B immunoreactive bands were developed and
visualized by enhanced chemiluminescence and exposure to
autoradiographic film. The specific anti-161P2F10B immunoreactive
bands represent a monomeric form of the 161P2F10B protein, which
runs at approximately 130 kDa, and a multimer of approximately 260
kDa. These results demonstrate that the human cancer xenograft
mouse models can be used to study the diagnostic and therapeutic
effects of 161P2F10B.
[0672] The strong expression of 161P2F10B detected in kidney and
prostate cancer xenograft tissues show that 161P2F10B is a cell
surface target, e.g., for cancer diagnosis and therapy; these
features can be modeled in human cancer xenograft mouse models.
Example 41
Therapeutic and Diagnostic use of Anti-161P2F10B Antibodies (such
as Monoclonal Antibody 97A6) in Humans
[0673] Anti-161P2F10B monoclonal antibodies are safely and
effectively used for diagnostic, prophylactic, prognostic and/or
therapeutic purposes in humans. In one embodiment, the
anti-161P2F10B monoclonal antibody is 97A6 (Coulter-Immunotech).
The monoclonal antibody 97A6 was generated through immunization of
mice with erythro-megakaryoblastic cell line UT-7 and screening for
monoclonal hybridomas that specifically react with only a small
subset of mononuclear peripheral blood cells and bone marrow cells.
Further characterization of the recognized population demonstrated
that the mAb specifically identifies mature basophils and mast
cells (Buhring, H. J. et. al. 1999. Blood 94:2343-2356). The
antigen specifically recognized by mAb 97A6 was later identified as
ectonucleotide pyrophosphatase/phosphodiesterase 3 (ENPP3) (see,
e.g., Buhring, H. J. et. al. 2001. Blood 97:3303-3305). The
antibody specifically binds ENPP3 under native non-denatured
conditions such as those used in flow cytometric and therapeutic
applications in which it is useful to bind to live cancer cells.
The 97A6 mAb also specifically binds ENPP3 under denatured/fixed
conditions such as those used in diagnostic applications such as
immunohistochemistry and Western blotting.
[0674] As disclosed herein, Western blot and immunohistochemical
analysis of kidney cancer tissues and kidney cancer xenografts with
mAb 97A6 showed strong extensive staining of ENPP3 in clear cell
kidney carcinoma but significantly lower or undetectable levels in
normal kidney (FIG. 16, 18, 20, 21). Detection of 161P2F10B (ENPP3)
in high grade clear cell carcinoma and in metastatic disease
demonstrates the usefulness of the mAb as a diagnostic and/or
prognostic indicator. 97A6 is therefore used in diagnostic
applications such as immunohistochemistry of kidney biopsy
specimens to detect cancer from suspect patients. ENPP3 exhibits
polarized apical surface expression in normal cells (Meerson, N.
R., et. al. 2000. J. Cell Sci. 113 Pt 23:4193-4202). Detection of a
redistribution of ENPP3 from apical surface expression in normal
cells to high level contiguous surface expression in advanced
cancer or a change in expression levels of ENPP3 among grades of
cancer by mAb 97A6 also demonstrates the usefulness in diagnostic
and/or prognostic applications.
[0675] As determined by flow cytometry (FIG. 18), mAb 97A6
specifically binds to the surface of clear cell kidney carcinoma
cells. Thus, anti-161P2F10B antibodies, such as mAb 97A6 is used in
diagnostic whole body imaging applications, such as
radioimmunoscintigraphy and radioimmunotherapy, (see, e.g.,
Potamianos S., et. al. Anticancer Res 20(2A):925-948 (2000)) for
the detection of localized and metastatic kidney cancers and other
cancers that exhibit expression of 161P2F10B (ENPP3). Shedding or
release of the extracellular domain of ENPP3 into the extracellular
milieu, such as that seen for alkaline phosphodiesterase B10
(Meerson, N. R., Hepatology 27:563-568 (1998)), allows diagnostic
detection of ENPP3 by mAb 97A6 in serum and urine samples from
suspect patients.
[0676] MAb 97A6, due to its ability to specifically bind cell
surface ENPP3, is used in therapeutic applications for the
treatment of cancers that express ENPP3, such as clear cell kidney
carcinoma. MAb 97A6 is used as an unconjugated modality and as
conjugated form in which it is attached to one of various
therapeutic or imaging modalities well known in the art, such as a
prodrugs, enzymes or radioisotopes. In preclinical studies,
unconjugated and conjugated 97A6 is tested for efficacy of tumor
prevention and growth inhibition in the SCID mouse kidney cancer
xenograft models AGS-K3 and AGS-K6, (see, e.g., the Example
entitled "Monoclonal Antibody-mediated Inhibition of Prostate and
Kidney Tumors In Vivo". Conjugated and unconjugated 97A6 is used as
a therapeutic modality in human clinical trials either alone or in
combination with other treatments as described in Examples
42-45.
Example 42
Human Clinical Trials for the Treatment and Diagnosis of Human
Carcinomas Through use of Human Anti-161P2F10B Antibodies In
Vivo
[0677] Antibodies are used in accordance with the present
invention, such as 97A6 antibody (Coulter) which recognizes the
following epitope on 161P2F10B (amino acids 393-405): are used in
the treatment of certain solid tumors. Based upon a number of
factors, including 161P2F10B expression levels among other
criteria, tumors, such as those listed in Table I, e.g., breast,
colon, kidney, lung, ovary, pancreas and prostate, are present
preferred indications. In connection with each of these
indications, three clinical approaches are successfully
pursued.
[0678] I.) Adjunctive therapy: In adjunctive therapy, patients are
treated with anti-161P2F10B antibodies in combination with a
chemotherapeutic or antineoplastic agent and/or radiation therapy.
Primary targets, such as those listed above, are treated under
standard protocols by the addition anti-161P2F10B antibodies to
standard first and second line therapy. Protocol designs address
effectiveness as assessed by reduction in tumor mass as well as the
ability to reduce usual doses of standard chemotherapy. These
dosage reductions allow additional and/or prolonged therapy by
reducing dose-related toxicity of the chemotherapeutic agent.
Anti-161P2F10B antibodies are utilized in several adjunctive
clinical trials in combination with the chemotherapeutic or
antineoplastic agents ADRIAMYCIN (doxorubicin) (advanced prostrate
carcinoma), cisplatin (advanced head and neck and lung carcinomas),
and TAXOL (breast cancer).
[0679] II.) Monotherapy: In connection with the use of the
anti-161P2F10B antibodies in monotherapy of tumors, the antibodies
are administered to patients without a chemotherapeutic or
antineoplastic agent. In one embodiment, monotherapy is conducted
clinically in end stage cancer patients with extensive metastatic
disease. Patients show some disease stabilization. Trials
demonstrate an effect in refractory patients with (cancer)
tumor.
[0680] III.) Imaging Agent: Through binding a radionuclide (e.g.,
yttrium (.sup.90Y)) to anti-161P2F10B antibodies, the radiolabeled
antibodies are utilized as a diagnostic and/or imaging agent. In
such a role, the labeled antibodies localize to both solid tumors,
as well as, metastatic lesions of cells expressing 161P2F10B. In
connection with the use of the anti-161P2F10B antibodies as imaging
agents, the antibodies are used in assisting surgical treatment of
solid tumors, as both a pre-surgical screen as well as a
post-operative follow-up to determine what tumor remains and/or
returns. In one embodiment, a (.sup.111In)-161P2F10B antibody is
used as an imaging agent in a Phase I human clinical trial in
patients having a carcinoma that expresses 161P2F10B (by analogy
see, e.g., Divgi et al. J. Natl. Cancer Inst. 83:97-104 (1991)).
Patients are followed with standard anterior and posterior gamma
camera. Initial data indicates that all primary lesions and
metastatic lesions are identified
[0681] Dose and Route of Administration
[0682] As appreciated by those of ordinary skill in the art, dosing
considerations can be determined through comparison with the
analogous products that are in the clinic. Thus, anti-161P2F10B
antibodies can be administered with doses in the range of 5 to 400
mg/m.sup.2, with the lower doses used, e.g., in connection with
safety studies. The affinity of anti-161P2F10B antibodies relative
to the affinity of a known antibody for its target is one parameter
used by those of skill in the art for determining analogous dose
regimens. Further, anti-161P2F10B antibodies that are fully human
antibodies, as compared to the chimeric antibody, have slower
clearance; accordingly, dosing in patients with such fully human
anti-161P2F10B antibodies can be lower, perhaps in the range of 50
to 300 mg/m.sup.2, and still remain efficacious. Dosing in
mg/m.sup.2, as opposed to the conventional measurement of dose in
mg/kg, is a measurement based on surface area and is a convenient
dosing measurement that is designed to include patients of all
sizes from infants to adults.
[0683] Three distinct delivery approaches are useful for delivery
of the anti-161P2F10B antibodies. Conventional intravenous delivery
is one standard delivery technique for many tumors. However, in
connection with tumors in the peritoneal cavity, such as tumors of
the ovaries, biliary duct, other ducts, and the like,
intraperitoneal administration may prove favorable for obtaining
high dose of antibody at the tumor and to also minimize antibody
clearance. In a similar manner certain solid tumors possess
vasculature that is appropriate for regional perfusion. Regional
perfusion allow the obtention of a high dose of the antibody at the
site of a tumor and minimizes short term clearance of the
antibody.
[0684] Clinical Development Plan (CDP)
[0685] Overview: The CDP follows and develops treatments of
anti-161P2F10B antibodies in connection with adjunctive therapy,
monotherapy, and as an imaging agent. Trials initially demonstrate
safety and thereafter confirm efficacy in repeat doses. Trails are
open label comparing standard chemotherapy with standard therapy
plus anti-161P2F10B antibodies. As will be appreciated, one
criteria that can be utilized in connection with enrollment of
patients is 161P2F10B expression levels of patient tumors as
determined in biopsy.
[0686] As with any protein or antibody infusion based therapeutic,
safety concerns are related primarily to (i) cytokine release
syndrome, i.e., hypotension, fever, shaking, chills, (ii) the
development of an immunogenic response to the material (i.e.,
development of human antibodies by the patient to the antibody
therapeutic, or HAHA response), and (iii) toxicity to normal cells
that express 161P2F10B. Standard tests and follow-up are utilized
to monitor each of these safety concerns. Anti-161P2F10B antibodies
are found to be safe upon human administration.
Example 43
Human Clinical Trial Adjunctive Therapy with Human Anti-161P2F10B
Antibody and Chemotherapeutic Agent
[0687] A phase I human clinical trial is initiated to assess the
safety of six intravenous doses of a human anti-161P2F10B antibody
in connection with the treatment of a solid tumor, e.g., breast
cancer. In the study, the safety of single doses of anti-161P2F10B
antibodies when utilized as an adjunctive therapy to an
antineoplastic or chemotherapeutic agent, such as cisplatin,
topotecan, doxorubicin, ADRIAMYCIN, TAXOL, or the like, is
assessed. The trial design includes delivery of six single doses of
an anti-161P2F10B antibody with dosage of antibody escalating from
approximately about 25 mg/m.sup.2 to about 275 mg/m.sup.2 over the
course of the treatment in accordance with the following
schedule:
TABLE-US-00003 Day 0 Day 7 Day 14 Day 21 Day 28 Day 35 mAb Dose 25
75 125 175 225 275 mg/m .sup.2 mg/m .sup.2 mg/m .sup.2 mg/m .sup.2
mg/m .sup.2 mg/m .sup.2 Chemotherapy + + + + + + (standard
dose)
[0688] Patients are closely followed for one-week following each
administration of antibody and chemotherapy. In particular,
patients are assessed for the safety concerns mentioned above: (i)
cytokine release syndrome, i.e., hypotension, fever, shaking,
chills, (ii) the development of an immunogenic response to the
material (i.e., development of human antibodies by the patient to
the human antibody therapeutic, or HAHA response), and (iii)
toxicity to normal cells that express 161P2F10B. Standard tests and
follow-up are utilized to monitor each of these safety concerns.
Patients are also assessed for clinical outcome, and particularly
reduction in tumor mass as evidenced by MRI or other imaging.
[0689] The anti-161P2F10B antibodies are demonstrated to be safe
and efficacious, Phase II trials confirm the efficacy and refine
optimum dosing.
Example 44
Human Clinical Trial: Monotherapy with Human Anti-161P2F10B
Antibody
[0690] Anti-161P2F10B antibodies are safe in connection with the
above-discussed adjunctive trial, a Phase II human clinical trial
confirms the efficacy and optimum dosing for monotherapy. Such
trial is accomplished, and entails the same safety and outcome
analyses, to the above-described adjunctive trial with the
exception being that patients do not receive chemotherapy
concurrently with the receipt of doses of anti-161P2F10B
antibodies.
Example 45
Human Clinical Trial: Diagnostic Imaging with Anti-161P2F10B
Antibody
[0691] Once again, as the adjunctive therapy discussed above is
safe within the safety criteria discussed above, a human clinical
trial is conducted concerning the use of anti-161P2F10B antibodies
as a diagnostic imaging agent. The protocol is designed in a
substantially similar manner to those described in the art, such as
in Divgi et al. J. Natl. Cancer Inst. 83:97-104 (1991).
Example 46
Homology Comparison of 161P2F10B to Known Sequences
[0692] The 161P2F10B gene is identical to a previously cloned and
sequenced gene, namely ectonucleotide
pyrophosphatase/phosphodiesterase 3 (gi 4826896) (Jin-Hua P et al,
Genomics 1997, 45:412), also known as phosphodiesterase-I beta;
gp130RB13-6; E-NPP3 (ENPP3), PDNP3 and CD203c. The 161P2F10B
protein shows 100% identity to human ectonucleotide
pyrophosphatase/phosphodiesterase 3 (gi 4826896), and 81% homology
and 89% identity to rat alkaline phosphodiesterase (gi 1699034).
The 161P2F10B protein consists of 875 amino acids, with calculated
molecular weight of 100.09 kDa, and pI of 6.12. 161P2F10B is a cell
surface protein as shown by immunostaining in basophils (Buhring H
J et al, Blood 2001, 97:3303) and in epithelial tumor cells as
shown in the example entitled "Expression of 161P2F10B protein in
kidney cancer xenograft tissues". Some localization to the
golgi-endoplasmic fraction has also been observed (Geoffroy V et
al, Arch Biochem Biophys. 2001, 387:154).
[0693] Two isoforms of phosphodiesterase 3 have been identified,
with one protein containing an additional 145 aa at its
amino-terminus (Choi Y H et al, Biochem J. 2001, 353:41). In
addition, two variants of 161P2F10B have been identified. The first
variant contains a single nucleotide polymorphism (SNP) from A to G
at nucleotide 408, resulting in point mutation at amino acid 122 of
the 161P2F10B protein, changing a lysine to an arginine at that
position. The second variant contains a SNP (A to C) at nucleotide
2663 resulting in an amino acid change at position 383, from amino
acid threonine to proline (FIG. 4C).
[0694] Motif analysis revealed the presence of several known
motifs, including 2-3 somatostatin B domains located at the amino
terminus of the 161P2F10B protein, a phosphodiesterase domain and
an endonuclease domain at the C-terminus. 161P2F10B belongs to a
family of closely related phosphodiesterases, consisting of PDNP1,
-2, and -3 (Bollen M et al, Crit. Rev. Biochem Mol. Biol. 2000, 35:
393). All three members of this family are type II proteins, with a
short N-terminus domain located intracellularly. They contain one
transmembrane domain, a catalytic phosphodiesterase domain and a
C-terminal nuclease domain.
[0695] Phosphodiesterase 3 expression has been detected in human
neoplastic submandibular cells, glioma cells, and tansformed
lymphocytes (Murata T et al, Anticancer Drugs 2001, 12:79; Andoh K
et al, Biochim Biophys Acta 1999, 1446:213; Ekholm D et al, Biochem
Pharmacol 1999, 58: 935).
[0696] Phosphodiesterase 3 plays an important role in several
biological processes, including release of nucleotides, cell
differentiation, metabolism, cell growth, survival, angiogenesis
and cell motility (Bollen M et al, Crit. Rev. Biochem Mol. Biol.
2000, 35: 393; Rawadi G et al, Endocrinol 2001, 142:4673; DeFouw L
et al, Microvasc Res 2001, 62:263). In addition, Phosphodiesterase
3 regulates gene expression in epithelial cells, including the
expression of key adhesion molecules such as VCAM-1 (Blease K et
al, Br J Pharmacol. 1998, 124:229).
[0697] This information indicates that 161P2F10B plays a role in
the growth of mammalian cells, supports cell survival and motility,
and regulate gene transcription by regulating events in the
nucleus.
[0698] Accordingly, when 161P2F10B functions as a regulator of cell
transformation, tumor formation, or as a modulator of transcription
involved in activating genes associated with inflammation,
tumorigenesis or proliferation, 161P2F10B is used for therapeutic,
diagnostic, prognostic and/or preventative purposes. In addition,
when a molecule, such as a a variant, polymorphism or SNP of
161P2F110B is expressed in cancerous tissues, such as those listed
in Table I, they are used for therapeutic, diagnostic, prognostic
and/or preventative purposes.
Example 47
Identification and Confirmation of Potential Signal Transduction
Pathways
[0699] Many mammalian proteins have been reported to interact with
signaling molecules and to participate in regulating signaling
pathways. (J Neurochem. 2001; 76:217-223). In particular, GPCRs
have been reported to activate MAK cascades as well as G proteins,
and been associated with the EGFR pathway in epithelial cells
(Naor, Z., et al, Trends Endocrinol Metab. 2000, 11:91; Vacca F et
al, Cancer Res. 2000, 60:5310; Della Rocca G J et al, J Biol Chem.
1999, 274:13978). Using immunoprecipitation and Western blotting
techniques, proteins are identified that associate with 161P2F10B
and mediate signaling events. Several pathways known to play a role
in cancer biology can be regulated by 161P2F10B, including
phospholipid pathways such as PI3K, AKT, etc, adhesion and
migration pathways, including FAK, Rho, Rac-1, etc, as well as
mitogenic/survival cascades such as ERK, p38, etc (Cell Growth
Differ. 2000, 11:279; J Biol Chem. 1999, 274:801; Oncogene. 2000,
19:3003, J. Cell Biol. 1997, 138:913.).
[0700] To confirm that 161P2F10B directly or indirectly activates
known signal transduction pathways in cells, luciferase (luc) based
transcriptional reporter assays are carried out in cells expressing
individual genes. These transcriptional reporters contain
consensus-binding sites for known transcription factors that lie
downstream of well-characterized signal transduction pathways. The
reporters and examples of these associated transcription factors,
signal transduction pathways, and activation stimuli are listed
below. [0701] 1. NFkB-luc, NFkB/Rel; Ik-kinase/SAPK;
growth/apoptosis/stress [0702] 2. SRE-luc, SRF/TCF/ELK1; MAPK/SAPK;
growth/differentiation [0703] 3. AP-1-luc, FOS/JUN; MAPK/SAPK/PKC;
growth/apoptosis/stress [0704] 4. ARE-luc, androgen receptor;
steroids/MAPK; growth/differentiation/apoptosis [0705] 5. p53-luc,
p53; SAPK; growth/differentiation/apoptosis [0706] 6. CRE-luc,
CREB/ATF2; PKA/p38; growth/apoptosis/stress
[0707] Gene-mediated effects can be assayed in cells showing mRNA
expression. Luciferase reporter plasmids can be introduced by
lipid-mediated transfection (TFX-50, Promega). Luciferase activity,
an indicator of relative transcriptional activity, is measured by
incubation of cell extracts with luciferin substrate and
luminescence of the reaction is monitored in a luminometer.
[0708] Signaling pathways activated by 161P2F10B are mapped and
used for the identification and validation of therapeutic targets.
When 161P2F10B is involved in cell signaling, it is used as target
for diagnostic, prognostic, preventative and/or therapeutic
purposes.
Example 48
Involvement in Tumor Progression
[0709] The 161P2F10B gene contributes to the growth of cancer
cells. The role of 161P2F10B in tumor growth is confirmed in a
variety of primary and transfected cell lines including prostate,
colon, bladder and kidney cell lines, as well as NIH3T3 cells
engineered to stably express 161P2F10B. Parental cells lacking
161P2F10B and cells expressing 161P2F10B are evaluated for cell
growth using a well-documented proliferation assay (Fraser, S. P.,
et al., Prostate, 2000; 44:61, Johnson, D. E., et al., Anticancer
Drugs, 1996, 7:288).
[0710] To confirm the role of 161P2F10B in the transformation
process, its effect in colony forming assays is investigated.
Parental NIH-3T3 cells lacking 161P2F10B are compared to NIH-3T3
cells expressing 161P2F10B, using a soft agar assay under stringent
and more permissive conditions (Song Z. et al., Cancer Res.
2000;60:6730).
[0711] To confirm the role of 161P2F10B in invasion and metastasis
of cancer cells, a well-established assay is used, e.g., a
TRANSWELL Insert System assay (Becton Dickinson) (Cancer Res. 1999;
59:6010). Control cells, including prostate, colon, bladder and
kidney cell lines lacking 161P2F10B are compared to cells
expressing 161P2F10B. Cells are loaded with the fluorescent dye,
calcein, and plated in the top well of the TRANSWELL insert coated
with a basement membrane analog. Invasion is determined by
fluorescence of cells in the lower chamber relative to the
fluorescence of the entire cell population.
[0712] 161P2F10B can also play a role in cell cycle and apoptosis.
Parental cells and cells expressing 161P2F10B are compared for
differences in cell cycle regulation using a well-established BrdU
assay (Abdel-Malek, Z. A., J Cell Physiol. 1988, 136:247). In
short, cells are grown under both optimal (full serum) and limiting
(low serum) conditions are labeled with BrdU and stained with
anti-BrdU Ab and propidium iodide. Cells are analyzed for entry
into the G1, S, and G2M phases of the cell cycle. Alternatively,
the effect of stress on apoptosis is evaluated in control parental
cells and cells expressing 161P2F10B, including normal and tumor
prostate, colon and lung cells. Engineered and parental cells are
treated with various chemotherapeutic agents, such as etoposide,
flutamide, etc, and protein synthesis inhibitors, such as
cycloheximide Cells are stained with annexin V-FITC and cell death
is measured by FACS analysis. The modulation of cell death by
161P2F10B can play a critical role in regulating tumor progression
and tumor load.
[0713] When 161P2F10B plays a role in cell growth, transformation,
invasion or apoptosis, it is used as a target for diagnostic,
prognostic, preventative and/or therapeutic purposes.
Example 49
Involvement in Angiogenesis
[0714] Angiogenesis or new capillary blood vessel formation is
necessary for tumor growth (Hanahan D, Folkman J. Cell, 1996,
86:353; Folkman, J. Endocrinology, 1998 139:441). Based on the
effect of phsophodieseterase inhibitors on endothelial cells,
161P2F10B plays a role in angiogenesis (DeFouw L et al, Microvasc
Res 2001, 62:263). Several assays have been developed to measure
angiogenesis in vitro and in vivo, such as the tissue culture
assays endothelial cell tube formation and endothelial cell
proliferation. Using these assays as well as in vitro
neo-vascularization, the role of 161P2F10B in angiogenesis,
enhancement or inhibition, is confirmed.
[0715] For example, endothelial cells engineered to express
161P2F10B are evaluated using tube formation and proliferation
assays. The effect of 161P2F10B is also confirmed in animal models
in vivo. For example, cells either expressing or lacking 161P2F10B
are implanted subcutaneously in immunocompromised mice. Endothelial
cell migration and angiogenesis are evaluated 5-15 days later using
immunohistochemistry techniques. 161P2F10B affects angiogenesis,
and it is used as a target for diagnostic, prognostic, preventative
and/or therapeutic purposes
Example 50
Regulation of Transcription
[0716] The cell surface localization of 161P2F10B and ability to
regulate VCAM expression indicate that 161P2F10B is effectively
used as a modulator of the transcriptional regulation of eukaryotic
genes. Regulation of gene expression is confirmed, e.g., by
studying gene expression in cells expressing or lacking 161P2F10B.
For this purpose, two types of experiments are performed.
[0717] In the first set of experiments, RNA from parental and
161P2F10B-expressing cells are extracted and hybridized to
commercially available gene arrays (Clontech) (Smid-Koopman E et
al. Br J Cancer, 2000. 83:246). Resting cells as well as cells
treated with FBS or androgen are compared. Differentially expressed
genes are identified in accordance with procedures known in the
art. The differentially expressed genes are then mapped to
biological pathways (Chen, K., et al., Thyroid, 2001 11:41).
[0718] In a second set of experiments, specific transcriptional
pathway activation is evaluated using commercially available
(Stratagene) luciferase reporter constructs including: NFkB-luc,
SRE-luc, ELK1-luc, ARE-luc, p53-luc, and CRE-luc. These
transcriptional reporters contain consensus binding sites for known
transcription factors that lie downstream of well-characterized
signal transduction pathways, and represent a good tool to
ascertain pathway activation and screen for positive and negative
modulators of pathway activation.
[0719] Thus, it is found that 161P2F10B plays a role in gene
regulation, and it is used as a target for diagnostic, prognostic,
preventative and/or therapeutic purposes.
Example 51
Involvement in Cell Adhesion
[0720] Cell adhesion plays a critical role in tissue colonization
and metastasis. 161P2F10B can participate in cellular organization,
and as a consequence cell adhesion and motility. To confirm that
161P2F10B regulates cell adhesion, control cells lacking 161P2F10B
are compared to cells expressing 161P2F10B, using techniques
previously described (see, e.g., Haier, et al., Br. J. Cancer,
1999, 80:1867; Lehr and Pienta, J. Natl. Cancer Inst., 1998,
90:118). Briefly, in one embodiment, cells labeled with a
fluorescent indicator, such as calcein, are incubated on tissue
culture wells coated with media alone or with matrix proteins.
Adherent cells are detected by fluorimetric analysis and percent
adhesion is calculated. In another embodiment, cells lacking or
expressing 161P2F10B are analyzed for their ability to mediate
cell-cell adhesion using similar experimental techniques as
described above. Both of these experimental systems are used to
identify proteins, antibodies and/or small molecules that modulate
cell adhesion to extracellular matrix and cell-cell interaction.
Cell adhesion plays a critical role in tumor growth, progression,
and, colonization, and 161P2F10B is involved in these processes.
Thus, 161P2F10B serves in diagnostic, prognostic, preventative
and/or therapeutic modalities.
Example 52
Protein-Protein Association
[0721] Several phosophodiesterases have been shown to interact with
other proteins, thereby regulating gene transcription as well as
cell growth (Butt E et al, Mol Pharmacol. 1995, 47:340). Using
immunoprecipitation techniques as well as two yeast hybrid systems,
proteins are identified that associate with 161P2F10B
Immunoprecipitates from cells expressing 161P2F10B and cells
lacking 161P2F10B are compared for specific protein-protein
associations.
[0722] Studies are performed to confirm the extent of association
of 161P2F10B with effector molecules, such as nuclear proteins,
transcription factors, kinases, phsophates etc. Studies comparing
161P2F10B positive and 161P2F10B negative cells as well as studies
comparing unstimulated/resting cells and cells treated with
epithelial cell activators, such as cytokines, growth factors,
androgen and anti-integrin Ab reveal unique interactions.
[0723] In addition, protein-protein interactions are confirmed
using two yeast hybrid methodology (Curr Opin Chem Biol., 1999,
3:64). A vector carrying a library of proteins fused to the
activation domain of a transcription factor is introduced into
yeast expressing a 161P2F10B-DNA-binding domain fusion protein and
a reporter construct. Protein-protein interaction is detected by
colorimetric reporter activity. Specific association with effector
molecules and transcription factors directs one of skill to the
mode of action of 161P2F10B, and thus identifies therapeutic,
prognostic, preventative and/or diagnostic targets for cancer. This
and similar assays are also used to identify and screen for small
molecules that interact with 161P2F10B.
[0724] Thus it is found that 161P2F10B associates with proteins and
small molecules. Accordingly, 161P2F10Band these proteins and small
molecules are used for diagnostic, prognostic, preventative and/or
therapeutic purposes.
[0725] Throughout this application, various website data content,
publications, patent applications and patents are referenced. The
disclosures of each of these references are hereby incorporated by
reference herein in their entireties.
[0726] The present invention is not to be limited in scope by the
embodiments disclosed herein, which are intended as single
illustrations of individual aspects of the invention, and any that
are functionally equivalent are within the scope of the invention.
Various modifications to the models and methods of the invention,
in addition to those described herein, will become apparent to
those skilled in the art from the foregoing description and
teachings, and are similarly intended to fall within the scope of
the invention. Such modifications or other embodiments can be
practiced without departing from the true scope and spirit of the
invention.
[0727] TABLES
TABLE-US-00004 TABLE I Tissues that Express 161P2F10B When
Malignant Breast Colon Kidney Lung Ovary Pancreas Prostate
TABLE-US-00005 TABLE II AMINO ACID ABBREVIATIONS SINGLE LETTER
THREE LETTER FULL NAME F Phe phenylalanine L Leu leucine S Ser
serine Y Tyr tyrosine C Cys cysteine W Trp tryptophan P Pro proline
H His histidine Q Gln glutamine R Arg arginine I Ile isoleucine M
Met methionine T Thr threonine N Asn asparagine K Lys lysine V Val
valine A Ala alanine D Asp aspartic acid E Glu glutamic acid G Gly
glycine
TABLE-US-00006 TABLE III AMINO ACID SUBSTITUTION MATRIX . A C D E F
G H I K L M N P Q R S T V W Y A 4 0 -2 -1 -2 0 -2 -1 -1 -1 -1 -2 -1
-1 -1 1 0 0 -3 -2 C 9 -3 -4 -2 -3 -3 -1 -3 -1 -1 -3 -3 -3 -3 -1 -1
-1 -2 -2 D 6 2 -3 -1 -1 -3 -1 -4 -3 1 -1 0 -2 0 -1 -3 -4 -3 E 5 -3
-2 0 -3 1 -3 -2 0 -1 2 0 0 -1 -2 -3 -2 F 6 -3 -1 0 -3 0 0 -3 -4 -3
-3 -2 -2 -1 1 3 G 6 -2 -4 -2 -4 -3 0 -2 -2 -2 0 -2 -3 -2 -3 H 8 -3
-1 -3 -2 1 -2 0 0 -1 -2 -3 -2 2 I 4 -3 2 1 -3 -3 -3 -3 -2 -1 3 -3
-1 K 5 -2 -1 0 -1 1 2 0 -1 -2 -3 -2 L 4 2 -3 -3 -2 -2 -2 -1 1 -2 -1
M 5 -2 -2 0 -1 -1 -1 1 -1 -1 N 6 -2 0 0 1 0 -3 -4 -2 P 7 -1 -2 -1
-1 -2 -4 -3 Q 5 1 0 -1 -2 -2 -1 R 5 -1 -1 -3 -3 -2 S 4 1 -2 -3 -2 T
5 0 -2 -2 V 4 -3 -1 W 11 2 Y 7 Adapted from the GCG Software 9.0
BLOSUM62 amino acid substitution matrix (block substitution
matrix). The higher the value, the more likely a substitution is
found in related, natural proteins.
TABLE-US-00007 TABLE IV A POSITION POSITION POSITION 2 (Primary 3
(Primary C Terminus Anchor) Anchor) (Primary Anchor) SUPERMOTIFS A1
TILVMS FWY A2 LIVMATQ IVMATL A3 VSMATLI RK A24 YFWIVLMT FIYWLM B7 P
VILFMWYA B27 RHK FYLWMIVA B44 ED FWYLIMVA B58 ATS FWYLIVMA B62
QLIVMP FWYMIVLA MOTIFS A1 TSM Y A1 DEAS Y A2.1 LMVQIAT VLIMAT A3
LMVISATFCGD KYRHFA A11 VTMLISAGNCDF KRYH A24 YFWM FLIW A*3101
MVTALIS RK A*3301 MVALFIST RK A*6801 AVTMSLI RK B*0702 P LMFWYAIV
B*3501 P LMFWYIVA B51 P LIVFWYAM B*5301 P IMFWYALV B*5401 P
ATIVLMFWY Bolded residues are preferred, italicized residues are
less preferred: A peptide is considered motif-bearing if it has
primary anchors at each primary anchor position for a motif or
supermotif as specified in the above table.
TABLE-US-00008 TABLE IV (B) HLA CLASS II SUPERMOTIF 1 6 9 W, F, Y,
V, .I, L A, V, I, L, P, C, S, T A, V, I, L, C, S, T, M, Y
TABLE-US-00009 TABLE IV C MOTIFS 1.degree. anchor 1 2 3 4 5
1.degree. anchor 6 7 8 9 DR4 preferred FMYLIVW M T I VSTCPALIM MH
MH deleterious W R WDE DR1 preferred MFLIVWY PAMQ VMATSPLIC M AVM
deleterious C CH FD CWD GDE D DR7 preferred MFLIVWY M W A IVMSACTPL
M IV deleterious C G GRD N G DR3 MOTIFS 1.degree. anchor 1 2 3
1.degree. anchor 4 5 1.degree. anchor 6 motif a LIVMFY D preferred
motif b LIVMFAY DNQEST KRH preferred DR MFLIVWY VMSTACPLI
Supermotif Italicized residues indicate less preferred or
"tolerated" residues.
TABLE-US-00010 TABLE IV D SUPER- POSITION MOTIFS 1 2 3 4 5 6 7 8
C-terminus A1 1.degree. Anchor 1.degree. Anchor TILVMS FWY A2
1.degree. Anchor 1.degree. Anchor LIVMATQ LIVMAT A3 preferred
1.degree. Anchor YFW (4/5) YFW (3/5) YFW (4/5) P (4/5) 1.degree.
Anchor VSMATLI RK deleterious DE (3/5); DE (4/5) P (5/5) A24
1.degree. Anchor 1.degree. Anchor YFWIVLMT FIYWLM B7 preferred FWY
(5/5) 1.degree. Anchor FWY (4/5) FWY (3/5) 1.degree.Anchor LIVM
(3/5) P VILFMWYA deleterious DE (3/5); DE G (4/5) QN (4/5) DE (4/5)
P (5/5); (3/5) G (4/5); A (3/5); QN (3/5) B27 1.degree. Anchor
1.degree.Anchor RHK FYLWMIVA B44 1.degree. Anchor 1.degree. Anchor
ED FWYLIMVA B58 1.degree. Anchor 1.degree. Anchor ATS FWYLIVMA B62
1.degree. Anchor 1.degree. Anchor QLIVMP FWYMIVLA
TABLE-US-00011 TABLE IV E 1 2 3 4 5 A1 preferred GFYW
1.degree.Anchor DEA YFW 9-mer STM deleterious DE RHKLIVMP A G A1
preferred GRHK ASTCLIVM 1.degree.Anchor GSTC 9-mer DEAS deleterious
A RHKDEPYFW DE PQN A1 preferred YFW 1.degree.Anchor DEAQN A YFWQN
10-mer STM deleterious GP RHKGLIVM DE RHK A1 preferred YFW STCLIVM
1.degree.Anchor A YFW 10-mer DEAS deleterious RHK RHKDEPYFW P A2.1
preferred YFW 1.degree.Anchor YFW STC YFW 9-mer LMIVQAT deleterious
DEP DERKH A2.1 preferred AYFW 1.degree.Anchor LVIM G 10-mer LMIVQAT
deleterious DEP DE RKHA P A3 preferred RHK 1.degree.Anchor YFW
PRHKYFW A LMVISA TFCGD deleterious DEP DE A11 preferred A
1.degree.Anchor YFW YFW A VTLMIS AGNCDF deleterious DEP A24
preferred YFWRHK 1.degree.Anchor STC 9-mer YFWM deleterious DEG DE
G QNP A24 preferred 1.degree.Anchor P YFWP 10-mer YFWM deleterious
GDE QN RHK A3101 preferred RHK 1.degree.Anchor YFW P MVTALIS
deleterious DEP DE ADE A3301 preferred 1.degree.Anchor YFW MVALFIST
deleterious GP DE A6801 preferred YFWSTC 1.degree.Anchor YFWLIVM
AVTMSLI deleterious GP DEG RHK B0702 preferred RHKFWY
1.degree.Anchor RHK RHK P deleterious DEQNP DEP DE DE B3501
preferred FWYLIVM 1.degree.Anchor FWY P deleterious AGP G B51
preferred LIVMFWY 1.degree.Anchor FWY STC FWY P deleterious AGPDE
DE RHKSTC B5301 preferred LIVMFWY 1.degree.Anchor FWY STC FWY P
deleterious AGPQN B5401 preferred FWY 1.degree.Anchor FWYLIVM LIVM
P deleterious GPQNDE GDESTC RHKDE 9 or 6 7 8 C-terminus C-terminus
A1 preferred P DEQN YFW 1.degree.Anchor 9-mer Y deleterious A A1
preferred ASTC LIVM DE 1.degree.Anchor 9-mer Y deleterious RHK PG
GP A1 preferred PASTC GDE P 1.degree.Anchor 10-mer Y deleterious
QNA RHKYFW RHK A A1 preferred PG G YFW 1.degree.Anchor 10-mer Y
deleterious G PRHK QN A2.1 preferred A P 1.degree.Anchor 9-mer
VLIMAT deleterious RKH DERKH A2.1 preferred G FYWLVIM
1.degree.Anchor 10-mer VLIMAT deleterious RKH DERKH RKH A3
preferred YFW P 1.degree.Anchor KYRHFA deleterious A11 preferred
YFW YFW P 1.degree.Anchor KRYH deleterious A G A24 preferred YFW
YFW 1.degree.Anchor 9-mer FLIW deleterious DERHK G AQN A24
preferred P 1.degree.Anchor 10-mer FLIW deleterious DE A QN DEA
A3101 preferred YFW YFW AP 1.degree.Anchor RK deleterious DE DE DE
A3301 preferred AYFW 1.degree.Anchor RK deleterious A6801 preferred
YFW P 1.degree.Anchor RK deleterious A B0702 preferred RHK RHK PA
1.degree.Anchor LMFWYAIV deleterious GDE QN DE B3501 preferred FWY
1.degree.Anchor LMFWYIVA deleterious G B51 preferred G FWY
1.degree.Anchor LIVFWYAM deleterious G DEQN GDE B5301 preferred
LIVMFWY FWY 1.degree.Anchor IMFWYALV deleterious G RHKQN DE B5401
preferred ALIVM FWYAP 1.degree.Anchor ATIVLMFWY deleterious DE
QNDGE DE Italicized residues indicate less preferred or "tolerated"
residues. The information in this Table is specific for 9-mers
unless otherwise specified.
TABLE-US-00012 TABLE V HLA PEPTIDE SCORING RESULTS - 161P2F10B -
A1, 9-MERS SCORE (ESTIMATE OF HALF TIME OF SUBSEQUENCE
DISASSOCIATION OF START RESIDUE A MOLECULE CONTAINING SEQ. RANK
POSITION LISTING THIS SUBSEQUENCE) ID# 1 165 SMDGFRAEY 25.000 1. 2
814 NVESCPEGK 18.000 2. 3 115 CSDDCLQKK 15.000 3. 4 506 KTEVEPFEN
11.250 4. 5 305 WLDLPKAER 10.000 5. 6 858 VSEILQLKT 6.750 6. 7 431
KPDQHFKPY 6.250 7. 8 377 QTYCNKMEY 6.250 8. 9 374 GMDQTYCNK 5.000
9. 10 70 RCDVACKDR 5.000 10. 11 514 NIEVYNLMC 4.500 11. 12 382
KMEYMTDYF 4.500 12. 13 89 CVESTRIWM 4.500 13. 14 800 WLDVLPFII
2.500 14. 15 462 FVDQQWLAV 2.500 15. 16 619 NVDHCLLYH 2.500 16. 17
771 NTDVPIPTH 2.500 17. 18 178 DTLMPNINK 2.500 18. 19 710 ITSNLVPMY
2.500 19. 20 745 VVSGPIFDY 2.500 20. 21 491 SMEAIFLAH 2.250 21. 22
8 ATEQPVKKN 2.250 22. 23 670 RVPPSESQK 2.000 23. 24 439 YLTPDLPKR
2.000 24. 25 673 PSESQKCSF 1.350 25. 26 273 GSEVAINGS 1.350 26. 27
419 NSEEIVRNL 1.350 27. 28 188 KTCGIHSKY 1.250 28. 29 386 MTDYFPRIN
1.250 29. 30 486 NNEFRSMEA 1.125 30. 31 572 SLDCFCPHL 1.000 31. 32
713 NLVPMYEEF 1.000 32. 33 692 FLYPPASNR 1.000 33. 34 42 GLGLRKLEK
1.000 34. 35 114 SCSDDCLQK 1.000 35. 36 126 CADYKSVCQ 1.000 36. 37
223 IIDNNMYDV 1.000 37. 38 666 RADVRVPPS 1.000 38. 39 585 QLEQVNQML
0.900 39. 40 65 GLENCRCDV 0.900 40. 41 827 WVEERFTAH 0.900 41. 42
139 WLEENCDTA 0.900 42. 43 107 RLEASLCSC 0.900 43. 44 508 EVEPFENIE
0.900 44. 45 597 QEEITATVK 0.900 45. 46 47 KLEKQGSCR 0.900 46. 47
552 HAEEVSKFS 0.900 47. 48 701 TSDSQYDAL 0.750 48. 49 686 KNITHGFLY
0.625 49. 50 618 KNVDHCLLY 0.625 50.
TABLE-US-00013 TABLE VI HLA PEPTIDE SCORING RESULTS - 161P2F10B -
A1, 10-MERS SCORE (ESTIMATE OF HALF TIME OF SUBSEQUENCE
DISASSOCIATION OF START RESIDUE A MOLECULE CONTAINING SEQ. RANK
POSITION LISTING THIS SUBSEQUENCE) ID# 1 858 VSEILQLKTY 67.500 51.
2 386 MTDYFPRINF 62.500 52. 3 771 NTDVPIPTHY 62.500 53. 4 841
DVELLTGLDF 45.000 54. 5 508 EVEPFENIEV 45.000 55. 6 280 GSFPSIYMPY
37.500 56. 7 441 TPDLPKRLHY 31.250 57. 8 370 LADHGMDQTY 25.000 58.
9 746 VSGPIFDYNY 15.000 59. 10 273 GSEVAINGSF 13.500 60. 11 619
NVDHCLLYHR 10.000 61. 12 462 FVDQQWLAVR 10.000 62. 13 673
PSESQKCSFY 6.750 63. 14 552 HAEEVSKFSV 4.500 64. 15 627 HREYVSGFGK
4.500 65. 16 585 QLEQVNQMLN 4.500 66. 17 596 TQEEITATVK 2.700 67.
18 758 HFDAPDEITK 2.500 68. 19 744 NVVSGPIFDY 2.500 69. 20 344
VVDHAFGMLM 2.500 70. 21 506 KTEVEPFENI 2.250 71. 22 8 ATEQPVKKNT
2.250 72. 23 718 YEEFRKMWDY 2.250 73. 24 822 KPEALWVEER 2.250 74.
25 802 DVLPFIIPHR 2.000 75. 26 179 TLMPNINKLK 2.000 76. 27 827
WVEERFTAHI 1.800 77. 28 47 KLEKQGSCRK 1.800 78. 29 701 TSDSQYDALI
1.500 79. 30 164 FSMDGFRAEY 1.500 80. 31 113 CSCSDDCLQK 1.500 81.
32 419 NSEEIVRNLS 1.350 82. 33 409 HNIPHDFFSF 1.250 83. 34 388
DYFPRINFFY 1.250 84. 35 155 GFDLPPVILF 1.250 85. 36 661 VPDCLRADVR
1.250 86. 37 217 YPESHGIIDN 1.125 87. 38 713 NLVPMYEEFR 1.000 88.
39 714 LVPMYEEFRK 1.000 89. 40 38 GLGLGLGLRK 1.000 90. 41 5
LTLATEQPVK 1.000 91. 42 709 LITSNLVPMY 1.000 92. 43 89 CVESTRIWMC
0.900 93. 44 139 WLEENCDTAQ 0.900 94. 45 170 RAEYLYTWDT 0.900 95.
46 107 RLEASLCSCS 0.900 96. 47 491 SMEAIFLAHG 0.900 97. 48 65
GLENCRCDVA 0.900 98. 49 416 FSFNSEEIVR 0.750 99. 50 572 SLDCFCPHLQ
0.500 100.
TABLE-US-00014 TABLE VII HLA PEPTIDE SCORING RESULTS - 161P2F10B -
A2, 9-MERS SCORE (ESTIMATE OF HALF TIME OF SUBSEQUENCE
DISASSOCIATION OF START RESIDUE A MOLECULE CONTAINING SEQ. RANK
POSITION LISTING THIS SUBSEQUENCE) ID# 1 723 KMWDYFHSV 11367.476
101. 2 623 CLLYHREYV 693.538 102. 3 385 YMTDYFPRI 270.002 103. 4
867 YLPTFETTI 182.365 104. 5 179 TLMPNINKL 181.794 105. 6 256
WLTAMYQGL 147.401 106. 7 519 NLMCDLLRI 88.783 107. 8 173 YLYTWDTLM
73.129 108. 9 607 NLPFGRPRV 69.552 109. 10 825 ALWVEERFT 68.037
110. 11 800 WLDVLPFII 45.649 111. 12 298 RISTLLKWL 37.157 112. 13
31 LLVIMSLGL 36.316 113. 14 215 GLYPESHGI 33.385 114. 15 572
SLDCFCPHL 32.471 115. 16 639 RMPMWSSYT 29.601 116. 17 27 VLLALLVIM
29.468 117. 18 259 AMYQGLKAA 26.408 118. 19 455 RIDKVHLFV 21.039
119. 20 462 FVDQQWLAV 19.036 120. 21 33 VIMSLGLGL 18.476 121. 22
584 TQLEQVNQM 17.575 122. 23 807 IIPHRPTNV 16.258 123. 24 223
IIDNNMYDV 14.957 124. 25 460 HLFVDQQWL 14.781 125. 26 847 GLDFYQDKV
13.632 126. 27 150 SQCPEGFDL 12.562 127. 28 753 YNYDGHFDA 11.352
128. 29 343 QVVDHAFGM 10.337 129. 30 360 NLHNCVNII 9.838 130. 31 40
GLGLGLRKL 9.827 131. 32 25 CIVLLALLV 9.563 132. 33 615 VLQKNVDHC
9.518 133. 34 592 MLNLTQEEI 8.691 134. 35 630 YVSGFGKAM 7.599 135.
36 862 LQLKTYLPT 7.129 136. 37 560 SVCGFANPL 7.103 137. 38 865
KTYLPTFET 6.723 138. 39 490 RSMEAIFLA 6.563 139. 40 5 LTLATEQPV
6.076 140. 41 337 RVIKALQVV 5.739 141. 42 22 KIACIVLLA 5.499 142.
43 26 IVLLALLVI 5.415 143. 44 231 VNLNKNFSL 5.087 144. 45 594
NLTQEEITA 4.968 145. 46 119 CLQKKDCCA 4.968 146. 47 443 DLPKRLHYA
4.713 147. 48 860 EILQLKTYL 4.483 148. 49 65 GLENCRCDV 4.451 149.
50 512 FENIEVYNL 4.395 150.
TABLE-US-00015 TABLE VIII HLA PEPTIDE SCORING RESULTS - 161P2F10B -
A2, 10-MERS SCORE (ESTIMATE OF HALF TIME OF SUBSEQUENCE
DISASSOCIATION OF START RESIDUE A MOLECULE CONTAINING SEQ. RANK
POSITION LISTING THIS SUBSEQUENCE) ID# 1 723 KMWDYFHSVL 2862.980
151. 2 397 YMYEGPAPRI 454.740 152. 3 825 ALWVEERFTA 239.160 153. 4
162 ILFSMDGFRA 181.243 154. 5 692 FLYPPASNRT 109.693 155. 6 439
YLTPDLPKRL 98.267 156. 7 222 GIIDNNMYDV 90.183 157. 8 28 LLALLVIMSL
83.527 158. 9 30 ALLVIMSLGL 79.041 159. 10 4 TLTLATEQPV 69.552 160.
11 369 LLADHGMDQT 58.537 161. 12 175 YTWDTLMPNI 52.169 162. 13 639
RMPMWSSYTV 50.232 163. 14 806 FIIPHRPTNV 43.992 164. 15 615
VLQKNVDHCL 36.316 165. 16 467 WLAVRSKSNT 34.279 166. 17 94
RIWMCNKFRC 32.884 167. 18 584 TQLEQVNQML 32.857 168. 19 34
IMSLGLGLGL 26.228 169. 20 660 TVPDCLRADV 24.952 170. 21 22
KIACIVLLAL 23.646 171. 22 36 SLGLGLGLGL 21.362 172. 23 861
ILQLKTYLPT 19.003 173. 24 259 AMYQGLKAAT 17.222 174. 25 594
NLTQEEITAT 17.140 175. 26 165 SMDGFRAEYL 16.632 176. 27 81
CCWDFEDTCV 15.450 177. 28 591 QMLNLTQEEI 13.661 178. 29 580
LQNSTQLEQV 13.511 179. 30 674 SESQKCSFYL 13.251 180. 31 708
ALITSNLVPM 11.426 181. 32 111 SLCSCSDDCL 10.468 182. 33 447
RLHYAKNVRI 10.433 183. 34 131 SVCQGETSWL 10.281 184. 35 180
LMPNINKLKT 9.149 185. 36 360 NLHNCVNIIL 8.759 186. 37 855
VQPVSEILQL 8.469 187. 38 293 VPFEERISTL 8.271 188. 39 204
KTFPNHYTIV 7.693 189. 40 64 RGLENCRCDV 6.887 190. 41 595 LTQEEITATV
6.733 191. 42 157 DLPPVILFSM 4.970 192. 43 342 LQVVDHAFGM 4.966
193. 44 460 HLFVDQQWLA 4.687 194. 45 827 WVEERFTAHI 4.187 195. 46
431 KPDQHFKPYL 4.080 196. 47 284 SIYMPYNGSV 3.978 197. 48 846
TGLDFYQDKV 3.375 198. 49 682 YLADKNITHG 3.233 199. 50 32 LVIMSLGLGL
3.178 200.
TABLE-US-00016 TABLE IX HLA PEPTIDE SCORING RESULTS - 161P2F10B -
A3, 9-MERS SCORE (ESTIMATE OF HALF TIME OF SUBSEQUENCE
DISASSOCIATION OF START RESIDUE A MOLECULE CONTAINING SEQ. RANK
POSITION LISTING THIS SUBSEQUENCE) ID# 1 227 NMYDVNLNK 300.000 651.
2 42 GLGLRKLEK 120.000 652. 3 374 GMDQTYCNK 60.000 653. 4 692
FLYPPASNR 45.000 654. 5 302 LLKWLDLPK 40.000 655. 6 397 YMYEGPAPR
30.000 656. 7 723 KMWDYFHSV 27.000 657. 8 196 YMRAMYPTK 20.000 658.
9 496 FLAHGPSFK 20.000 659. 10 6 TLATEQPVK 20.000 660. 11 165
SMDGFRAEY 18.000 661. 12 180 LMPNINKLK 15.000 662. 13 215 GLYPESHGI
13.500 663. 14 47 KLEKQGSCR 12.000 664. 15 803 VLPFIIPHR 9.000 665.
16 863 QLKTYLPTF 9.000 666. 17 439 YLTPDLPKR 9.000 667. 18 351
MLMEGLKQR 6.750 668. 19 382 KMEYMTDYF 6.000 669. 20 732 LLIKHATER
6.000 670. 21 305 WLDLPKAER 6.000 671. 22 162 ILFSMDGFR 6.000 672.
23 38 GLGLGLGLR 5.400 673. 24 385 YMTDYFPRI 5.400 674. 25 92
STRIWMCNK 4.500 675. 26 713 NLVPMYEEF 4.500 676. 27 745 VVSGPIFDY
4.050 677. 28 447 RLHYAKNVR 4.000 678. 29 173 YLYTWDTLM 3.000 679.
30 341 ALQVVDHAF 3.000 680. 31 670 RVPPSESQK 3.000 681. 32 460
HLFVDQQWL 3.000 682. 33 519 NLMCDLLRI 2.700 683. 34 678 KCSFYLADK
2.700 684. 35 843 ELLTGLDFY 2.700 685. 36 179 TLMPNINKL 2.025 686.
37 204 KTFPNHYTI 2.025 687. 38 377 QTYCNKMEY 2.000 688. 39 423
IVRNLSCRK 2.000 689. 40 814 NVESCPEGK 2.000 690. 41 867 YLPTFETTI
1.800 691. 42 410 NIPHDFFSF 1.800 692. 43 491 SMEAIFLAH 1.800 693.
44 263 GLKAATYFW 1.800 694. 45 847 GLDFYQDKV 1.800 695. 46 31
LLVIMSLGL 1.800 696. 47 360 NLHNCVNII 1.800 697. 48 572 SLDCFCPHL
1.800 698. 49 800 WLDVLPFII 1.800 699. 50 782 VVLTSCKNK 1.500
700.
TABLE-US-00017 TABLE X HLA PEPTIDE SCORING RESULTS - 161P2F10B -
A3, 10-MERS SCORE (ESTIMATE OF HALF TIME OF SUBSEQUENCE
DISASSOCIATION OF START RESIDUE A MOLECULE CONTAINING SEQ. RANK
POSITION LISTING THIS SUBSEQUENCE) ID# 1 38 GLGLGLGLRK 120.000 201.
2 186 KLKTCGIHSK 90.000 202. 3 47 KLEKQGSCRK 60.000 203. 4 301
TLLKWLDLPK 60.000 204. 5 179 TLMPNINKLK 33.750 205. 6 713
NLVPMYEEFR 27.000 206. 7 723 KMWDYFHSVL 27.000 207. 8 6 TLATEQPVKK
20.000 208. 9 443 DLPKRLHYAK 18.000 209. 10 256 WLTAMYQGLK 18.000
210. 11 350 GMLMEGLKQR 13.500 211. 12 437 KPYLTPDLPK 9.000 212. 13
397 YMYEGPAPRI 6.750 213. 14 731 VLLIKHATER 6.000 214. 15 714
LVPMYEEFRK 6.000 215. 16 215 GLYPESHGII 4.050 216. 17 744
NVVSGPIFDY 4.050 217. 18 637 AMRMPMWSSY 4.000 218. 19 845
LTGLDFYQDK 3.000 219. 20 460 HLFVDQQWLA 3.000 220. 21 825
ALWVEERFTA 3.000 221. 22 162 ILFSMDGFRA 3.000 222. 23 28 LLALLVIMSL
2.700 223. 24 538 SLNHLLKVPF 2.000 224. 25 286 YMPYNGSVPF 2.000
225. 26 374 GMDQTYCNKM 1.800 226. 27 462 FVDQQWLAVR 1.800 227. 28
30 ALLVIMSLGL 1.800 228. 29 360 NLHNCVNIIL 1.800 229. 30 619
NVDHCLLYHR 1.800 230. 31 277 AINGSFPSIY 1.800 231. 32 781
FVVLTSCKNK 1.500 232. 33 5 LTLATEQPVK 1.500 233. 34 280 GSFPSIYMPY
1.350 234. 35 34 IMSLGLGLGL 1.200 235. 36 603 TVKVNLPFGR 1.200 236.
37 709 LITSNLVPMY 1.200 237. 38 36 SLGLGLGLGL 1.200 238. 39 822
KPEALWVEER 1.080 239. 40 390 FPRINFFYMY 1.080 240. 41 494
AIFLAHGPSF 1.000 241. 42 17 TLKKYKIACI 0.900 242. 43 615 VLQKNVDHCL
0.900 243. 44 165 SMDGFRAEYL 0.900 244. 45 591 QMLNLTQEEI 0.900
245. 46 355 GLKQRNLHNC 0.900 246. 47 422 EIVRNLSCRK 0.900 247. 48
596 TQEEITATVK 0.900 248. 49 22 KIACIVLLAL 0.810 249. 50 692
FLYPPASNRT 0.750 250.
TABLE-US-00018 TABLE XI HLA PEPTIDE SCORING RESULTS - 161P2F10B -
A11, 9-MERS SCORE (ESTIMATE OF HALF TIME OF SUBSEQUENCE
DISASSOCIATION OF START RESIDUE A MOLECULE CONTAINING SEQ. RANK
POSITION LISTING THIS SUBSEQUENCE) ID# 1 670 RVPPSESQK 6.000 251. 2
42 GLGLRKLEK 2.400 252. 3 423 IVRNLSCRK 2.000 253. 4 814 NVESCPEGK
2.000 254. 5 227 NMYDVNLNK 1.600 255. 6 782 VVLTSCKNK 1.500 256. 7
715 VPMYEEFRK 1.200 257. 8 374 GMDQTYCNK 1.200 258. 9 628 REYVSGFGK
1.080 259. 10 92 STRIWMCNK 1.000 260. 11 257 LTAMYQGLK 1.000 261.
12 332 GPVSARVIK 0.900 262. 13 178 DTLMPNINK 0.900 263. 14 302
LLKWLDLPK 0.800 264. 15 678 KCSFYLADK 0.600 265. 16 444 LPKRLHYAK
0.400 266. 17 727 YFHSVLLIK 0.400 267. 18 114 SCSDDCLQK 0.400 268.
19 12 PVKKNTLKK 0.400 269. 20 496 FLAHGPSFK 0.400 270. 21 714
LVPMYEEFR 0.400 271. 22 6 TLATEQPVK 0.400 272. 23 450 YAKNVRIDK
0.400 273. 24 196 YMRAMYPTK 0.400 274. 25 780 YFVVLTSCK 0.300 275.
26 11 QPVKKNTLK 0.300 276. 27 94 RIWMCNKFR 0.240 277. 28 38
GLGLGLGLR 0.240 278. 29 447 RLHYAKNVR 0.240 279. 30 47 KLEKQGSCR
0.240 280. 31 7 LATEQPVKK 0.200 281. 32 857 PVSEILQLK 0.200 282. 33
68 NCRCDVACK 0.200 283. 34 180 LMPNINKLK 0.200 284. 35 162
ILFSMDGFR 0.160 285. 36 397 YMYEGPAPR 0.160 286. 37 692 FLYPPASNR
0.160 287. 38 384 EYMTDYFPR 0.144 288. 39 438 PYLTPDLPK 0.120 289.
40 465 QQWLAVRSK 0.120 290. 41 204 KTFPNHYTI 0.120 291. 42 732
LLIKHATER 0.120 292. 43 343 QVVDHAFGM 0.090 293. 44 337 RVIKALQVV
0.090 294. 45 614 RVLQKNVDH 0.090 295. 46 803 VLPFIIPHR 0.080 296.
47 439 YLTPDLPKR 0.080 297. 48 351 MLMEGLKQR 0.080 298. 49 417
SFNSEEIVR 0.080 299. 50 305 WLDLPKAER 0.080 300.
TABLE-US-00019 TABLE XII HLA PEPTIDE SCORING RESULTS - 161P2F10B -
A11, 10-MERS SCORE (ESTIMATE OF HALF TIME OF SUBSEQUENCE
DISASSOCIATION OF START RESIDUE A MOLECULE CONTAINING SEQ. RANK
POSITION LISTING THIS SUBSEQUENCE) ID# 1 714 LVPMYEEFRK 6.000 301.
2 437 KPYLTPDLPK 2.400 302. 3 195 KYMRAMYPTK 2.400 303. 4 38
GLGLGLGLRK 2.400 304. 5 781 FVVLTSCKNK 1.500 305. 6 5 LTLATEQPVK
1.500 306. 7 301 TLLKWLDLPK 1.200 307. 8 47 KLEKQGSCRK 1.200 308. 9
186 KLKTCGIHSK 1.200 309. 10 603 TVKVNLPFGR 1.200 310. 11 845
LTGLDFYQDK 1.000 311. 12 779 HYFVVLTSCK 0.800 312. 13 619
NVDHCLLYHR 0.800 313. 14 449 HYAKNVRIDK 0.800 314. 15 11 QPVKKNTLKK
0.600 315. 16 596 TQEEITATVK 0.600 316. 17 726 DYFHSVLLIK 0.480
317. 18 462 FVDQQWLAVR 0.400 318. 19 6 TLATEQPVKK 0.400 319. 20 758
HFDAPDEITK 0.400 320. 21 256 WLTAMYQGLK 0.400 321. 22 179
TLMPNINKLK 0.400 322. 23 630 YVSGFGKAMR 0.400 323. 24 856
QPVSEILQLK 0.300 324. 25 495 IFLAHGPSFK 0.300 325. 26 443
DLPKRLHYAK 0.240 326. 27 114 SCSDDCLQKK 0.200 327. 28 428
SCRKPDQHFK 0.200 328. 29 348 AFGMLMEGLK 0.200 329. 30 691
GFLYPPASNR 0.180 330. 31 802 DVLPFIIPHR 0.180 331. 32 350
GMLMEGLKQR 0.180 332. 33 422 EIVRNLSCRK 0.180 333. 34 10 EQPVKKNTLK
0.180 334. 35 396 FYMYEGPAPR 0.160 335. 36 226 NNMYDVNLNK 0.160
336. 37 517 VYNLMCDLLR 0.160 337. 38 161 VILFSMDGFR 0.120 338. 39
822 KPEALWVEER 0.120 339. 40 605 KVNLPFGRPR 0.120 340. 41 713
NLVPMYEEFR 0.120 341. 42 295 FEERISTLLK 0.120 342. 43 731
VLLIKHATER 0.120 343. 44 497 LAHGPSFKEK 0.100 344. 45 744
NVVSGPIFDY 0.090 345. 46 189 TCGIHSKYMR 0.080 346. 47 383
MEYMTDYFPR 0.072 347. 48 41 LGLGLRKLEK 0.060 348. 49 627 HREYVSGFGK
0.060 349. 50 813 TNVESCPEGK 0.060 350.
TABLE-US-00020 TABLE XIII HLA PEPTIDE SCORING RESULTS - 161P2F10B -
A24, 9-MERS SCORE (ESTIMATE OF HALF TIME OF SUBSEQUENCE
DISASSOCIATION OF START RESIDUE A MOLECULE CONTAINING SEQ. RANK
POSITION LISTING THIS SUBSEQUENCE) ID# 1 20 KYKIACIVL 400.000 351.
2 172 EYLYTWDTL 300.000 352. 3 517 VYNLMCDLL 300.000 353. 4 388
DYFPRINFF 144.000 354. 5 216 LYPESHGII 90.000 355. 6 398 MYEGPAPRI
75.000 356. 7 726 DYFHSVLLI 50.000 357. 8 484 GYNNEFRSM 45.000 358.
9 100 KFRCGETRL 40.000 359. 10 378 TYCNKMEYM 25.000 360. 11 58
CFDASFRGL 24.000 361. 12 348 AFGMLMEGL 24.000 362. 13 854 KVQPVSEIL
20.160 363. 14 155 GFDLPPVIL 20.000 364. 15 195 KYMRAMYPT 15.000
365. 16 495 IFLAHGPSF 15.000 366. 17 866 TYLPTFETT 10.800 367. 18
693 LYPPASNRT 10.800 368. 19 850 FYQDKVQPV 10.800 369. 20 585
QLEQVNQML 10.080 370. 21 419 NSEEIVRNL 10.080 371. 22 720 EFRKMWDYF
10.000 372. 23 488 EFRSMEAIF 10.000 373. 24 629 EYVSGFGKA 9.900
374. 25 298 RISTLLKWL 9.600 375. 26 179 TLMPNINKL 9.504 376. 27 260
MYQGLKAAT 9.000 377. 28 681 FYLADKNIT 9.000 378. 29 285 IYMPYNGSV
9.000 379. 30 717 MYEEFRKMW 9.000 380. 31 440 LTPDLPKRL 8.640 381.
32 657 LPPTVPDCL 8.400 382. 33 29 LALLVIMSL 8.400 383. 34 200
MYPTKTFPN 7.500 384. 35 24 ACIVLLALL 7.200 385. 36 10 EQPVKKNTL
7.200 386. 37 37 LGLGLGLGL 7.200 387. 38 860 EILQLKTYL 7.200 388.
39 33 VIMSLGLGL 7.200 389. 40 35 MSLGLGLGL 7.200 390. 41 209
HYTIVTGLY 7.000 391. 42 779 HYFVVLTSC 7.000 392. 43 761 APDEITKHL
6.720 393. 44 228 MYDVNLNKN 6.600 394. 45 300 STLLKWLDL 6.000 395.
46 856 QPVSEILQL 6.000 396. 47 132 VCQGETSWL 6.000 397. 48 587
EQVNQMLNL 6.000 398. 49 793 TPENCPGWL 6.000 399. 50 382 KMEYMTDYF
6.000 400.
TABLE-US-00021 TABLE XIV HLA PEPTIDE SCORING RESULTS - 161P2F10B -
A24, 10-MERS SCORE (ESTIMATE OF HALF TIME OF SUBSEQUENCE
DISASSOCIATION OF START RESIDUE A MOLECULE CONTAINING SEQ. RANK
POSITION LISTING THIS SUBSEQUENCE) ID# 1 20 KYKIACIVLL 400.000 401.
2 705 QYDALITSNL 280.000 402. 3 228 MYDVNLNKNF 120.000 403. 4 625
LYHREYVSGF 100.000 404. 5 384 EYMTDYFPRI 90.000 405. 6 866
TYLPTFETTI 90.000 406. 7 629 EYVSGFGKAM 37.500 407. 8 172
EYLYTWDTLM 37.500 408. 9 435 HFKPYLTPDL 28.800 409. 10 488
EFRSMEAIFL 20.000 410. 11 850 FYQDKVQPVS 12.600 411. 12 584
TQLEQVNQML 12.096 412. 13 452 KNVRIDKVHL 12.000 413. 14 57
KCFDASFRGL 11.520 414. 15 22 KIACIVLLAL 11.200 415. 16 760
DAPDEITKHL 10.080 416. 17 155 GFDLPPVILF 10.000 417. 18 750
IFDYNYDGHF 10.000 418. 19 547 FYEPSHAEEV 9.900 419. 20 700
RTSDSQYDAL 9.600 420. 21 723 KMWDYFHSVL 9.600 421. 22 693
LYPPASNRTS 9.000 422. 23 343 QVVDHAFGML 8.640 423. 24 388
DYFPRINFFY 8.400 424. 25 615 VLQKNVDHCL 8.400 425. 26 340
KALQVVDHAF 8.400 426. 27 431 KPDQHFKPYL 8.000 427. 28 178
DTLMPNINKL 7.920 428. 29 752 DYNYDGHFDA 7.500 429. 30 260
MYQGLKAATY 7.500 430. 31 817 SCPEGKPEAL 7.200 431. 32 103
CGETRLEASL 7.200 432. 33 571 ESLDCFCPHL 7.200 433. 34 32 LVIMSLGLGL
7.200 434. 35 792 HTPENCPGWL 7.200 435. 36 559 FSVCGFANPL 7.200
436. 37 255 MWLTAMYQGL 7.200 437. 38 564 FANPLPTESL 7.200 438. 39
418 FNSEEIVRNL 6.720 439. 40 39 LGLGLGLRKL 6.600 440. 41 855
VQPVSEILQL 6.000 441. 42 149 QSQCPEGFDL 6.000 442. 43 30 ALLVIMSLGL
6.000 443. 44 352 LMEGLKQRNL 6.000 444. 45 530 APNNGTHGSL 6.000
445. 46 230 DVNLNKNFSL 6.000 446. 47 607 NLPFGRPRVL 6.000 447. 48
269 YFWPGSEVAI 6.000 448. 49 648 VPQLGDTSPL 6.000 449. 50 439
YLTPDLPKRL 5.760 450.
TABLE-US-00022 TABLE XV HLA PEPTIDE SCORING RESULTS - 161P2F10B -
B7, 9-MERS SCORE (ESTIMATE OF HALF TIME OF SUBSEQUENCE
DISASSOCIATION OF START RESIDUE A MOLECULE CONTAINING SEQ. RANK
POSITION LISTING THIS SUBSEQUENCE) ID# 1 403 APRIRAHNI 240.000 451.
2 390 FPRINFFYM 200.000 452. 3 453 NVRIDKVHL 200.000 453. 4 836
IARVRDVEL 120.000 454. 5 856 QPVSEILQL 80.000 455. 6 608 LPFGRPRVL
80.000 456. 7 776 IPTHYFVVL 80.000 457. 8 657 LPPTVPDCL 80.000 458.
9 761 APDEITKHL 72.000 459. 10 612 RPRVLQKNV 40.000 460. 11 818
CPEGKPEAL 24.000 461. 12 793 TPENCPGWL 24.000 462. 13 516 EVYNLMCDL
20.000 463. 14 854 KVQPVSEIL 20.000 464. 15 158 LPPVILFSM 20.000
465. 16 560 SVCGFANPL 20.000 466. 17 565 ANPLPTESL 18.000 467. 18
29 LALLVIMSL 12.000 468. 19 24 ACIVLLALL 12.000 469. 20 179
TLMPNINKL 12.000 470. 21 23 IACIVLLAL 12.000 471. 22 33 VIMSLGLGL
12.000 472. 23 640 MPMWSSYTV 12.000 473. 24 344 VVDHAFGML 6.000
474. 25 838 RVRDVELLT 5.000 475. 26 630 YVSGFGKAM 5.000 476. 27 343
QVVDHAFGM 5.000 477. 28 534 GTHGSLNHL 4.000 478. 29 362 HNCVNIILL
4.000 479. 30 31 LLVIMSLGL 4.000 480. 31 313 RPRFYTMYF 4.000 481.
32 225 DNNMYDVNL 4.000 482. 33 587 EQVNQMLNL 4.000 483. 34 35
MSLGLGLGL 4.000 484. 35 440 LTPDLPKRL 4.000 485. 36 300 STLLKWLDL
4.000 486. 37 643 WSSYTVPQL 4.000 487. 38 675 ESQKCSFYL 4.000 488.
39 334 VSARVIKAL 4.000 489. 40 298 RISTLLKWL 4.000 490. 41 774
VPIPTHYFV 4.000 491. 42 460 HLFVDQQWL 4.000 492. 43 100 KFRCGETRL
4.000 493. 44 796 NCPGWLDVL 4.000 494. 45 860 EILQLKTYL 4.000 495.
46 256 WLTAMYQGL 4.000 496. 47 150 SQCPEGFDL 4.000 497. 48 10
EQPVKKNTL 4.000 498. 49 40 GLGLGLRKL 4.000 499. 50 37 LGLGLGLGL
4.000 500.
TABLE-US-00023 TABLE XVI HLA PEPTIDE SCORING RESULTS - 161P2F10B -
B7, 10-MERS SCORE (ESTIMATE OF HALF TIME OF SUBSEQUENCE
DISASSOCIATION OF START RESIDUE A MOLECULE CONTAINING SEQ. RANK
POSITION LISTING THIS SUBSEQUENCE) ID# 1 530 APNNGTHGSL 240.000
501. 2 836 IARVRDVELL 120.000 502. 3 577 CPHLQNSTQL 80.000 503. 4
648 VPQLGDTSPL 80.000 504. 5 293 VPFEERISTL 80.000 505. 6 715
VPMYEEFRKM 60.000 506. 7 431 KPDQHFKPYL 24.000 507. 8 343
QVVDHAFGML 20.000 508. 9 516 EVYNLMCDLL 20.000 509. 10 32
LVIMSLGLGL 20.000 510. 11 230 DVNLNKNFSL 20.000 511. 12 246
NPAWWHGQPM 20.000 512. 13 131 SVCQGETSWL 20.000 513. 14 564
FANPLPTESL 18.000 514. 15 469 AVRSKSNTNC 15.000 515. 16 30
ALLVIMSLGL 12.000 516. 17 760 DAPDEITKHL 12.000 517. 18 347
HAFGMLMEGL 12.000 518. 19 23 IACIVLLALL 12.000 519. 20 403
APRIRAHNIP 6.000 520. 21 335 SARVIKALQV 6.000 521. 22 154
EGFDLPPVIL 6.000 522. 23 26 IVLLALLVIM 5.000 523. 24 488 EFRSMEAIFL
4.000 524. 25 584 TQLEQVNQML 4.000 525. 26 452 KNVRIDKVHL 4.000
526. 27 111 SLCSCSDDCL 4.000 527. 28 599 EITATVKVNL 4.000 528. 29
57 KCFDASFRGL 4.000 529. 30 418 FNSEEIVRNL 4.000 530. 31 795
ENCPGWLDVL 4.000 531. 32 149 QSQCPEGFDL 4.000 532. 33 616
LQKNVDHCLL 4.000 533. 34 615 VLQKNVDHCL 4.000 534. 35 700
RTSDSQYDAL 4.000 535. 36 39 LGLGLGLRKL 4.000 536. 37 559 FSVCGFANPL
4.000 537. 38 36 SLGLGLGLGL 4.000 538. 39 28 LLALLVIMSL 4.000 539.
40 835 HIARVRDVEL 4.000 540. 41 22 KIACIVLLAL 4.000 541. 42 607
NLPFGRPRVL 4.000 542. 43 299 ISTLLKWLDL 4.000 543. 44 792
HTPENCPGWL 4.000 544. 45 723 KMWDYFHSVL 4.000 545. 46 774
VPIPTHYFVV 4.000 546. 47 533 NGTHGSLNHL 4.000 547. 48 390
FPRINFFYMY 4.000 548. 49 817 SCPEGKPEAL 4.000 549. 50 34 IMSLGLGLGL
4.000 550.
TABLE-US-00024 TABLE XVII HLA PEPTIDE SCORING RESULTS - 161P2F10B -
B35, 9-MERS SCORE (ESTIMATE OF HALF TIME OF SUBSEQUENCE
DISASSOCIATION OF START RESIDUE A MOLECULE CONTAINING SEQ. RANK
POSITION LISTING THIS SUBSEQUENCE) ID# 1 390 FPRINFFYM 120.000 551.
2 313 RPRFYTMYF 120.000 552. 3 308 LPKAERPRF 90.000 553. 4 510
EPFENIEVY 80.000 554. 5 568 LPTESLDCF 40.000 555. 6 158 LPPVILFSM
40.000 556. 7 253 QPMWLTAMY 40.000 557. 8 856 QPVSEILQL 30.000 558.
9 193 HSKYMRAMY 30.000 559. 10 431 KPDQHFKPY 24.000 560. 11 403
APRIRAHNI 24.000 561. 12 612 RPRVLQKNV 24.000 562. 13 657 LPPTVPDCL
20.000 563. 14 608 LPFGRPRVL 20.000 564. 15 287 MPYNGSVPF 20.000
565. 16 776 IPTHYFVVL 20.000 566. 17 556 VSKFSVCGF 15.000 567. 18
761 APDEITKHL 12.000 568. 19 836 IARVRDVEL 9.000 569. 20 618
KNVDHCLLY 8.000 570. 21 634 FGKAMRMPM 6.000 571. 22 793 TPENCPGWL
6.000 572. 23 198 RAMYPTKTF 6.000 573. 24 818 CPEGKPEAL 6.000 574.
25 293 VPFEERIST 6.000 575. 26 698 SNRTSDSQY 6.000 576. 27 407
RAHNIPHDF 6.000 577. 28 35 MSLGLGLGL 5.000 578. 29 675 ESQKCSFYL
5.000 579. 30 643 WSSYTVPQL 5.000 580. 31 334 VSARVIKAL 5.000 581.
32 453 NVRIDKVHL 4.500 582. 33 188 KTCGIHSKY 4.000 583. 34 584
TQLEQVNQM 4.000 584. 35 343 QVVDHAFGM 4.000 585. 36 640 MPMWSSYTV
4.000 586. 37 513 ENIEVYNLM 4.000 587. 38 774 VPIPTHYFV 4.000 588.
39 411 IPHDFFSFN 4.000 589. 40 686 KNITHGFLY 4.000 590. 41 23
IACIVLLAL 3.000 591. 42 616 LQKNVDHCL 3.000 592. 43 240 SSKEQNNPA
3.000 593. 44 29 LALLVIMSL 3.000 594. 45 863 QLKTYLPTF 3.000 595.
46 428 SCRKPDQHF 3.000 596. 47 545 VPFYEPSHA 3.000 597. 48 671
VPPSESQKC 3.000 598. 49 221 HGIIDNNMY 3.000 599. 50 824 EALWVEERF
3.000 600.
TABLE-US-00025 TABLE XVIII HLA PEPTIDE SCORING RESULTS - 161P2F10B
- B35, 10-MERS SCORE (ESTIMATE OF HALF TIME OF SUBSEQUENCE
DISASSOCIATION OF START RESIDUE A MOLECULE CONTAINING SEQ. RANK
POSITION LISTING THIS SUBSEQUENCE) ID# 1 308 LPKAERPRFY 120.000
601. 2 390 FPRINFFYMY 120.000 602. 3 715 VPMYEEFRKM 60.000 603. 4
246 NPAWWHGQPM 40.000 604. 5 201 YPTKTFPNHY 40.000 605. 6 293
VPFEERISTL 40.000 606. 7 797 CPGWLDVLPF 30.000 607. 8 648
VPQLGDTSPL 30.000 608. 9 530 APNNGTHGSL 20.000 609. 10 577
CPHLQNSTQL 20.000 610. 11 164 FSMDGFRAEY 20.000 611. 12 240
SSKEQNNPAW 15.000 612. 13 836 IARVRDVELL 13.500 613. 14 431
KPDQHFKPYL 12.000 614. 15 441 TPDLPKRLHY 12.000 615. 16 280
GSFPSIYMPY 10.000 616. 17 697 ASNRTSDSQY 10.000 617. 18 631
VSGFGKAMRM 10.000 618. 19 571 ESLDCFCPHL 10.000 619. 20 746
VSGPIFDYNY 10.000 620. 21 219 ESHGIIDNNM 10.000 621. 22 149
QSQCPEGFDL 7.500 622. 23 380 CNKMEYMTDY 6.000 623. 24 637
AMRMPMWSSY 6.000 624. 25 407 RAHNIPHDFF 6.000 625. 26 760
DAPDEITKHL 6.000 626. 27 500 GPSFKEKTEV 6.000 627. 28 444
LPKRLHYAKN 6.000 628. 29 340 KALQVVDHAF 6.000 629. 30 120
LQKKDCCADY 6.000 630. 31 427 LSCRKPDQHF 5.000 631. 32 299
ISTLLKWLDL 5.000 632. 33 130 KSVCQGETSW 5.000 633. 34 559
FSVCGFANPL 5.000 634. 35 616 LQKNVDHCLL 4.500 635. 36 510
EPFENIEVYN 4.000 636. 37 723 KMWDYFHSVL 4.000 637. 38 57 KCFDASFRGL
4.000 638. 39 700 RTSDSQYDAL 4.000 639. 40 672 PPSESQKCSF 4.000
640. 41 188 KTCGIHSKYM 4.000 641. 42 88 TCVESTRIWM 4.000 642. 43
411 IPHDFFSFNS 4.000 643. 44 568 LPTESLDCFC 4.000 644. 45 774
VPIPTHYFVV 4.000 645. 46 310 KAERPRFYTM 3.600 646. 47 858
VSEILQLKTY 3.000 647. 48 74 ACKDRGDCCW 3.000 648. 49 452 KNVRIDKVHL
3.000 649. 50 23 IACIVLLALL 3.000 650.
TABLE-US-00026 TABLE XIX Motifs and Post-translational
Modifications of 161P2F10B N-glycosylation sites Number of matches:
10 1 236-239 NFSL (SEQ. ID. No. 701) 2 279-282 NGSF (SEQ. ID. No.
702) 3 290-293 NGSV (SEQ. ID. No. 703) 4 426-429 NLSC (SEQ. ID. No.
704) 5 533-536 NGTH (SEQ. ID. No. 705) 6 582-585 NSTQ (SEQ. ID. No.
706) 7 594-597 NLTQ (SEQ. ID. No. 707) 8 687-690 NITH (SEQ. ID. No.
708) 9 699-702 NRTS (SEQ. ID. No. 709) 10 789-792 NKSH (SEQ. ID.
No. 710) cAMP- and cGMP-dependent protein kinase phosphorylation
site 14-17 KKNT (SEQ. ID. No. 711) Protein kinase C phosphorylation
sites Number of matches: 13 1 17-19 TLK 2 53-55 SCR 3 428-430 SCR 4
62-64 SFR 5 92-94 STR 6 240-242 SSK 7 335-337 SAR 8 53-55 SCR 9
428-430 SCR 10 502-504 SFK 11 603-605 TVK 12 676-678 SQK 13 698-700
SNR Casein kinase II phosphorylation sites Number of matches: 15 1
88-91 TCVE (SEQ. ID. No. 712) 2 106-109 TRLE (SEQ. ID. No. 713) 3
114-117 SCSD (SEQ. ID. No. 714) 4 138-141 SWLE (SEQ. ID. No. 715) 5
240-243 SSKE (SEQ. ID. No. 716) 6 502-505 SFKE (SEQ. ID. No. 717) 7
507-510 TEVE (SEQ. ID. No. 718) 8 551-554 SHAE (SEQ. ID. No. 719) 9
584-587 TQLE (SEQ. ID. No. 720) 10 596-599 TQEE (SEQ. ID. No. 721)
11 660-663 TVPD (SEQ. ID. No. 722) 12 704-707 SQYD (SEQ. ID. No.
723) 13 813-816 TNVE (SEQ. ID. No. 724) 14 817-820 SCPE (SEQ. ID.
No. 725) 15 846-849 TGLD (SEQ. ID. No. 726) Tyrosine kinase
phosphorylation site 700-706 RTSDSQY (SEQ. ID. No. 727)
N-myristoylation sites Number of matches: 11 1 38-43 GLGLGL (SEQ.
ID. No. 728) 2 40-45 GLGLGL (SEQ. ID. No. 729) 3 38-43 GLGLGL (SEQ.
ID. No. 730) 4 40-45 GLGLGL (SEQ. ID. No. 731) 5 65-70 GLENCR (SEQ.
ID. No. 732) 6 222-227 GIIDNN (SEQ. ID. No. 733) 7 263-268 GLKAAT
(SEQ. ID. No. 734) 8 273-278 GSEVAI (SEQ. ID. No. 735) 9 280-285
GSFPSI (SEQ. ID. No. 736) 10 331-336 GGPVSA (SEQ. ID. No. 737) 11
374-379 GMDQTY (SEQ. ID. No. 738) Cell attachment sequence 78-80
RGD (SEQ. ID. No. 739) Somatomedin B domain signatures Number of
matches: 2 1 69-89 CRCDVACKDRGDCCWDFEDTC (SEQ. ID. No. 740) 2
113-133 CSCSDDCLQKKDCCADYKSVC (SEQ. ID. No. 741)
TABLE-US-00027 TABLE XX Frequently Occurring Motifs avrg. % Name
identity Description Potential Function zf-C2H2 34% Zinc finger,
C2H2 type Nucleic acid-binding protein functions as transcription
factor, nuclear location probable cytochrome_b_N 68% Cytochrome
b(N- membrane bound oxidase, generate terminal)/b6/petB superoxide
ig 19% Immunoglobulin domains are one hundred amino domain acids
long and include a conserved intradomain disulfide bond. WD40 18%
WD domain, G-beta tandem repeats of about 40 residues, repeat each
containing a Trp-Asp motif. Function in signal transduction and
protein interaction PDZ 23% PDZ domain may function in targeting
signaling molecules to sub-membranous sites LRR 28% Leucine Rich
Repeat short sequence motifs involved in protein-protein
interactions pkinase 23% Protein kinase domain conserved catalytic
core common to both serine/threonine and tyrosine protein kinases
containing an ATP binding site and a catalytic site PH 16% PH
domain pleckstrin homology involved in intracellular signaling or
as constituents of the cytoskeleton EGF 34% EGF-like domain 30-40
amino-acid long found in the extracellular domain of membrane-
bound proteins or in secreted proteins rvt 49% Reverse
transcriptase (RNA-dependent DNA polymerase) ank 25% Ank repeat
Cytoplasmic protein, associates integral membrane proteins to the
cytoskeleton oxidored_q1 32% NADH- membrane associated. Involved in
Ubiquinone/plastoquin proton translocation across the one (complex
I), membrane various chains efhand 24% EF hand calcium-binding
domain, consists of a12 residue loop flanked on both sides by a 12
residue alpha-helical domain rvp 79% Retroviral aspartyl Aspartyl
or acid proteases, centered protease on a catalytic aspartyl
residue Collagen 42% Collagen triple helix extracellular structural
proteins repeat (20 copies) involved in formation of connective
tissue. The sequence consists of the G-X-Y and the polypeptide
chains forms a triple helix. fn3 20% Fibronectin type III Located
in the extracellular ligand- domain binding region of receptors and
is about 200 amino acid residues long with two pairs of cysteines
involved in disulfide bonds 7tm_1 19% 7 transmembrane seven
hydrophobic transmembrane receptor (rhodopsin regions, with the
N-terminus located family) extracellularly while the C-terminus is
cytoplasmic. Signal through G proteins
TABLE-US-00028 TABLE XXI Properties of 161P2F10B Bioinformatic
Feature Program Outcome ORF (includes stop ORF finder 44-2671
codon) # of amino acids 875 Transmembrane region TM Pred One TM, aa
23-41 HMMTop One TM, aa 23-45 Sosui One TM, aa 23-45 TMHMM One TM,
aa 23-45 Signal Peptide Signal P none pI pI/MW tool 6.12 Molecular
weight pI/MW tool 100.09 kDa Localization PSORT Plasma membrane 74%
Golgi 30% PSORT II Endoplasmic 30.4% Golgi 21.7% Motifs Pfam
Somatomedin B, Type I phosphodiesterase/ nucleotide pyrophosphatase
Prints Cell Attachement RGD Blocks Somatomedin B, DNA/RNA non-
specific endonuclease, Prosite Somatomedin B
Sequence CWU 1
1
76519PRTHomo sapiens 1Ser Met Asp Gly Phe Arg Ala Glu Tyr1
529PRTHomo sapiens 2Asn Val Glu Ser Cys Pro Glu Gly Lys1 539PRTHomo
sapiens 3Cys Ser Asp Asp Cys Leu Gln Lys Lys1 549PRTHomo sapiens
4Lys Thr Glu Val Glu Pro Phe Glu Asn1 559PRTHomo sapiens 5Trp Leu
Asp Leu Pro Lys Ala Glu Arg1 569PRTHomo sapiens 6Val Ser Glu Ile
Leu Gln Leu Lys Thr1 579PRTHomo sapiens 7Lys Pro Asp Gln His Phe
Lys Pro Tyr1 589PRTHomo sapiens 8Gln Thr Tyr Cys Asn Lys Met Glu
Tyr1 599PRTHomo sapiens 9Gly Met Asp Gln Thr Tyr Cys Asn Lys1
5109PRTHomo sapiens 10Arg Cys Asp Val Ala Cys Lys Asp Arg1
5119PRTHomo sapiens 11Asn Ile Glu Val Tyr Asn Leu Met Cys1
5129PRTHomo sapiens 12Lys Met Glu Tyr Met Thr Asp Tyr Phe1
5139PRTHomo sapiens 13Cys Val Glu Ser Thr Arg Ile Trp Met1
5149PRTHomo sapiens 14Trp Leu Asp Val Leu Pro Phe Ile Ile1
5159PRTHomo sapiens 15Phe Val Asp Gln Gln Trp Leu Ala Val1
5169PRTHomo sapiens 16Asn Val Asp His Cys Leu Leu Tyr His1
5179PRTHomo sapiens 17Asn Thr Asp Val Pro Ile Pro Thr His1
5189PRTHomo sapiens 18Asp Thr Leu Met Pro Asn Ile Asn Lys1
5199PRTHomo sapiens 19Ile Thr Ser Asn Leu Val Pro Met Tyr1
5209PRTHomo sapiens 20Val Val Ser Gly Pro Ile Phe Asp Tyr1
5219PRTHomo sapiens 21Ser Met Glu Ala Ile Phe Leu Ala His1
5229PRTHomo sapiens 22Ala Thr Glu Gln Pro Val Lys Lys Asn1
5239PRTHomo sapiens 23Arg Val Pro Pro Ser Glu Ser Gln Lys1
5249PRTHomo sapiens 24Tyr Leu Thr Pro Asp Leu Pro Lys Arg1
5259PRTHomo sapiens 25Pro Ser Glu Ser Gln Lys Cys Ser Phe1
5269PRTHomo sapiens 26Gly Ser Glu Val Ala Ile Asn Gly Ser1
5279PRTHomo sapiens 27Asn Ser Glu Glu Ile Val Arg Asn Leu1
5289PRTHomo sapiens 28Lys Thr Cys Gly Ile His Ser Lys Tyr1
5299PRTHomo sapiens 29Met Thr Asp Tyr Phe Pro Arg Ile Asn1
5309PRTHomo sapiens 30Asn Asn Glu Phe Arg Ser Met Glu Ala1
5319PRTHomo sapiens 31Ser Leu Asp Cys Phe Cys Pro His Leu1
5329PRTHomo sapiens 32Asn Leu Val Pro Met Tyr Glu Glu Phe1
5339PRTHomo sapiens 33Phe Leu Tyr Pro Pro Ala Ser Asn Arg1
5349PRTHomo sapiens 34Gly Leu Gly Leu Arg Lys Leu Glu Lys1
5359PRTHomo sapiens 35Ser Cys Ser Asp Asp Cys Leu Gln Lys1
5369PRTHomo sapiens 36Cys Ala Asp Tyr Lys Ser Val Cys Gln1
5379PRTHomo sapiens 37Ile Ile Asp Asn Asn Met Tyr Asp Val1
5389PRTHomo sapiens 38Arg Ala Asp Val Arg Val Pro Pro Ser1
5399PRTHomo sapiens 39Gln Leu Glu Gln Val Asn Gln Met Leu1
5409PRTHomo sapiens 40Gly Leu Glu Asn Cys Arg Cys Asp Val1
5419PRTHomo sapiens 41Trp Val Glu Glu Arg Phe Thr Ala His1
5429PRTHomo sapiens 42Trp Leu Glu Glu Asn Cys Asp Thr Ala1
5439PRTHomo sapiens 43Arg Leu Glu Ala Ser Leu Cys Ser Cys1
5449PRTHomo sapiens 44Glu Val Glu Pro Phe Glu Asn Ile Glu1
5459PRTHomo sapiens 45Gln Glu Glu Ile Thr Ala Thr Val Lys1
5469PRTHomo sapiens 46Lys Leu Glu Lys Gln Gly Ser Cys Arg1
5479PRTHomo sapiens 47His Ala Glu Glu Val Ser Lys Phe Ser1
5489PRTHomo sapiens 48Thr Ser Asp Ser Gln Tyr Asp Ala Leu1
5499PRTHomo sapiens 49Lys Asn Ile Thr His Gly Phe Leu Tyr1
5509PRTHomo sapiens 50Lys Asn Val Asp His Cys Leu Leu Tyr1
55110PRTHomo sapiens 51Val Ser Glu Ile Leu Gln Leu Lys Thr Tyr1 5
105210PRTHomo sapiens 52Met Thr Asp Tyr Phe Pro Arg Ile Asn Phe1 5
105310PRTHomo sapiens 53Asn Thr Asp Val Pro Ile Pro Thr His Tyr1 5
105410PRTHomo sapiens 54Asp Val Glu Leu Leu Thr Gly Leu Asp Phe1 5
105510PRTHomo sapiens 55Glu Val Glu Pro Phe Glu Asn Ile Glu Val1 5
105610PRTHomo sapiens 56Gly Ser Phe Pro Ser Ile Tyr Met Pro Tyr1 5
105710PRTHomo sapiens 57Thr Pro Asp Leu Pro Lys Arg Leu His Tyr1 5
105810PRTHomo sapiens 58Leu Ala Asp His Gly Met Asp Gln Thr Tyr1 5
105910PRTHomo sapiens 59Val Ser Gly Pro Ile Phe Asp Tyr Asn Tyr1 5
106010PRTHomo sapiens 60Gly Ser Glu Val Ala Ile Asn Gly Ser Phe1 5
106110PRTHomo sapiens 61Asn Val Asp His Cys Leu Leu Tyr His Arg1 5
106210PRTHomo sapiens 62Phe Val Asp Gln Gln Trp Leu Ala Val Arg1 5
106310PRTHomo sapiens 63Pro Ser Glu Ser Gln Lys Cys Ser Phe Tyr1 5
106410PRTHomo sapiens 64His Ala Glu Glu Val Ser Lys Phe Ser Val1 5
106510PRTHomo sapiens 65His Arg Glu Tyr Val Ser Gly Phe Gly Lys1 5
106610PRTHomo sapiens 66Gln Leu Glu Gln Val Asn Gln Met Leu Asn1 5
106710PRTHomo sapiens 67Thr Gln Glu Glu Ile Thr Ala Thr Val Lys1 5
106810PRTHomo sapiens 68His Phe Asp Ala Pro Asp Glu Ile Thr Lys1 5
106910PRTHomo sapiens 69Asn Val Val Ser Gly Pro Ile Phe Asp Tyr1 5
107010PRTHomo sapiens 70Val Val Asp His Ala Phe Gly Met Leu Met1 5
107110PRTHomo sapiens 71Lys Thr Glu Val Glu Pro Phe Glu Asn Ile1 5
107210PRTHomo sapiens 72Ala Thr Glu Gln Pro Val Lys Lys Asn Thr1 5
107310PRTHomo sapiens 73Tyr Glu Glu Phe Arg Lys Met Trp Asp Tyr1 5
107410PRTHomo sapiens 74Lys Pro Glu Ala Leu Trp Val Glu Glu Arg1 5
107510PRTHomo sapiens 75Asp Val Leu Pro Phe Ile Ile Pro His Arg1 5
107610PRTHomo sapiens 76Thr Leu Met Pro Asn Ile Asn Lys Leu Lys1 5
107710PRTHomo sapiens 77Trp Val Glu Glu Arg Phe Thr Ala His Ile1 5
107810PRTHomo sapiens 78Lys Leu Glu Lys Gln Gly Ser Cys Arg Lys1 5
107910PRTHomo sapiens 79Thr Ser Asp Ser Gln Tyr Asp Ala Leu Ile1 5
108010PRTHomo sapiens 80Phe Ser Met Asp Gly Phe Arg Ala Glu Tyr1 5
108110PRTHomo sapiens 81Cys Ser Cys Ser Asp Asp Cys Leu Gln Lys1 5
108210PRTHomo sapiens 82Asn Ser Glu Glu Ile Val Arg Asn Leu Ser1 5
108310PRTHomo sapiens 83His Asn Ile Pro His Asp Phe Phe Ser Phe1 5
108410PRTHomo sapiens 84Asp Tyr Phe Pro Arg Ile Asn Phe Phe Tyr1 5
108510PRTHomo sapiens 85Gly Phe Asp Leu Pro Pro Val Ile Leu Phe1 5
108610PRTHomo sapiens 86Val Pro Asp Cys Leu Arg Ala Asp Val Arg1 5
108710PRTHomo sapiens 87Tyr Pro Glu Ser His Gly Ile Ile Asp Asn1 5
108810PRTHomo sapiens 88Asn Leu Val Pro Met Tyr Glu Glu Phe Arg1 5
108910PRTHomo sapiens 89Leu Val Pro Met Tyr Glu Glu Phe Arg Lys1 5
109010PRTHomo sapiens 90Gly Leu Gly Leu Gly Leu Gly Leu Arg Lys1 5
109110PRTHomo sapiens 91Leu Thr Leu Ala Thr Glu Gln Pro Val Lys1 5
109210PRTHomo sapiens 92Leu Ile Thr Ser Asn Leu Val Pro Met Tyr1 5
109310PRTHomo sapiens 93Cys Val Glu Ser Thr Arg Ile Trp Met Cys1 5
109410PRTHomo sapiens 94Trp Leu Glu Glu Asn Cys Asp Thr Ala Gln1 5
109510PRTHomo sapiens 95Arg Ala Glu Tyr Leu Tyr Thr Trp Asp Thr1 5
109610PRTHomo sapiens 96Arg Leu Glu Ala Ser Leu Cys Ser Cys Ser1 5
109710PRTHomo sapiens 97Ser Met Glu Ala Ile Phe Leu Ala His Gly1 5
109810PRTHomo sapiens 98Gly Leu Glu Asn Cys Arg Cys Asp Val Ala1 5
109910PRTHomo sapiens 99Phe Ser Phe Asn Ser Glu Glu Ile Val Arg1 5
1010010PRTHomo sapiens 100Ser Leu Asp Cys Phe Cys Pro His Leu Gln1
5 101019PRTHomo sapiens 101Lys Met Trp Asp Tyr Phe His Ser Val1
51029PRTHomo sapiens 102Cys Leu Leu Tyr His Arg Glu Tyr Val1
51039PRTHomo sapiens 103Tyr Met Thr Asp Tyr Phe Pro Arg Ile1
51049PRTHomo sapiens 104Tyr Leu Pro Thr Phe Glu Thr Thr Ile1
51059PRTHomo sapiens 105Thr Leu Met Pro Asn Ile Asn Lys Leu1
51069PRTHomo sapiens 106Trp Leu Thr Ala Met Tyr Gln Gly Leu1
51079PRTHomo sapiens 107Asn Leu Met Cys Asp Leu Leu Arg Ile1
51089PRTHomo sapiens 108Tyr Leu Tyr Thr Trp Asp Thr Leu Met1
51099PRTHomo sapiens 109Asn Leu Pro Phe Gly Arg Pro Arg Val1
51109PRTHomo sapiens 110Ala Leu Trp Val Glu Glu Arg Phe Thr1
51119PRTHomo sapiens 111Trp Leu Asp Val Leu Pro Phe Ile Ile1
51129PRTHomo sapiens 112Arg Ile Ser Thr Leu Leu Lys Trp Leu1
51139PRTHomo sapiens 113Leu Leu Val Ile Met Ser Leu Gly Leu1
51149PRTHomo sapiens 114Gly Leu Tyr Pro Glu Ser His Gly Ile1
51159PRTHomo sapiens 115Ser Leu Asp Cys Phe Cys Pro His Leu1
51169PRTHomo sapiens 116Arg Met Pro Met Trp Ser Ser Tyr Thr1
51179PRTHomo sapiens 117Val Leu Leu Ala Leu Leu Val Ile Met1
51189PRTHomo sapiens 118Ala Met Tyr Gln Gly Leu Lys Ala Ala1
51199PRTHomo sapiens 119Arg Ile Asp Lys Val His Leu Phe Val1
51209PRTHomo sapiens 120Phe Val Asp Gln Gln Trp Leu Ala Val1
51219PRTHomo sapiens 121Val Ile Met Ser Leu Gly Leu Gly Leu1
51229PRTHomo sapiens 122Thr Gln Leu Glu Gln Val Asn Gln Met1
51239PRTHomo sapiens 123Ile Ile Pro His Arg Pro Thr Asn Val1
51249PRTHomo sapiens 124Ile Ile Asp Asn Asn Met Tyr Asp Val1
51259PRTHomo sapiens 125His Leu Phe Val Asp Gln Gln Trp Leu1
51269PRTHomo sapiens 126Gly Leu Asp Phe Tyr Gln Asp Lys Val1
51279PRTHomo sapiens 127Ser Gln Cys Pro Glu Gly Phe Asp Leu1
51289PRTHomo sapiens 128Tyr Asn Tyr Asp Gly His Phe Asp Ala1
51299PRTHomo sapiens 129Gln Val Val Asp His Ala Phe Gly Met1
51309PRTHomo sapiens 130Asn Leu His Asn Cys Val Asn Ile Ile1
51319PRTHomo sapiens 131Gly Leu Gly Leu Gly Leu Arg Lys Leu1
51329PRTHomo sapiens 132Cys Ile Val Leu Leu Ala Leu Leu Val1
51339PRTHomo sapiens 133Val Leu Gln Lys Asn Val Asp His Cys1
51349PRTHomo sapiens 134Met Leu Asn Leu Thr Gln Glu Glu Ile1
51359PRTHomo sapiens 135Tyr Val Ser Gly Phe Gly Lys Ala Met1
51369PRTHomo sapiens 136Leu Gln Leu Lys Thr Tyr Leu Pro Thr1
51379PRTHomo sapiens 137Ser Val Cys Gly Phe Ala Asn Pro Leu1
51389PRTHomo sapiens 138Lys Thr Tyr Leu Pro Thr Phe Glu Thr1
51399PRTHomo sapiens 139Arg Ser Met Glu Ala Ile Phe Leu Ala1
51409PRTHomo sapiens 140Leu Thr Leu Ala Thr Glu Gln Pro Val1
51419PRTHomo sapiens 141Arg Val Ile Lys Ala Leu Gln Val Val1
51429PRTHomo sapiens 142Lys Ile Ala Cys Ile Val Leu Leu Ala1
51439PRTHomo sapiens 143Ile Val Leu Leu Ala Leu Leu Val Ile1
51449PRTHomo sapiens 144Val Asn Leu Asn Lys Asn Phe Ser Leu1
51459PRTHomo sapiens 145Asn Leu Thr Gln Glu Glu Ile Thr Ala1
51469PRTHomo sapiens 146Cys Leu Gln Lys Lys Asp Cys Cys Ala1
51479PRTHomo sapiens 147Asp Leu Pro Lys Arg Leu His Tyr Ala1
51489PRTHomo sapiens 148Glu Ile Leu Gln Leu Lys Thr Tyr Leu1
51499PRTHomo sapiens 149Gly Leu Glu Asn Cys Arg Cys Asp Val1
51509PRTHomo sapiens 150Phe Glu Asn Ile Glu Val Tyr Asn Leu1
515110PRTHomo sapiens 151Lys Met Trp Asp Tyr Phe His Ser Val Leu1 5
1015210PRTHomo sapiens 152Tyr Met Tyr Glu Gly Pro Ala Pro Arg Ile1
5 1015310PRTHomo sapiens 153Ala Leu Trp Val Glu Glu Arg Phe Thr
Ala1 5 1015410PRTHomo sapiens 154Ile Leu Phe Ser Met Asp Gly Phe
Arg Ala1 5 1015510PRTHomo sapiens 155Phe Leu Tyr Pro Pro Ala Ser
Asn Arg Thr1 5 1015610PRTHomo sapiens 156Tyr Leu Thr Pro Asp Leu
Pro Lys Arg Leu1 5 1015710PRTHomo sapiens 157Gly Ile Ile Asp Asn
Asn Met Tyr Asp Val1 5 1015810PRTHomo sapiens 158Leu Leu Ala Leu
Leu Val Ile Met Ser Leu1 5 1015910PRTHomo sapiens 159Ala Leu Leu
Val Ile Met Ser Leu Gly Leu1 5 1016010PRTHomo sapiens 160Thr Leu
Thr Leu Ala Thr Glu Gln Pro Val1 5 1016110PRTHomo sapiens 161Leu
Leu Ala Asp His Gly Met Asp Gln Thr1 5 1016210PRTHomo sapiens
162Tyr Thr Trp Asp Thr Leu Met Pro Asn Ile1 5 1016310PRTHomo
sapiens 163Arg Met Pro Met Trp Ser Ser Tyr Thr Val1 5
1016410PRTHomo sapiens 164Phe Ile Ile Pro His Arg Pro Thr Asn Val1
5 1016510PRTHomo sapiens 165Val Leu Gln Lys Asn Val Asp His Cys
Leu1 5 1016610PRTHomo sapiens 166Trp Leu Ala Val Arg Ser Lys Ser
Asn Thr1 5 1016710PRTHomo sapiens 167Arg Ile Trp Met Cys Asn Lys
Phe Arg Cys1 5 1016810PRTHomo sapiens 168Thr Gln Leu Glu Gln Val
Asn Gln Met Leu1 5 1016910PRTHomo sapiens 169Ile Met Ser Leu Gly
Leu Gly Leu Gly Leu1 5 1017010PRTHomo sapiens 170Thr Val Pro Asp
Cys Leu Arg Ala Asp Val1 5 1017110PRTHomo sapiens 171Lys Ile Ala
Cys Ile Val Leu Leu Ala Leu1 5 1017210PRTHomo sapiens 172Ser Leu
Gly Leu Gly Leu Gly Leu Gly Leu1 5 1017310PRTHomo sapiens 173Ile
Leu Gln Leu Lys Thr Tyr Leu Pro Thr1 5 1017410PRTHomo sapiens
174Ala Met Tyr Gln Gly Leu Lys Ala Ala Thr1 5 1017510PRTHomo
sapiens 175Asn Leu Thr Gln Glu Glu Ile Thr Ala Thr1 5
1017610PRTHomo sapiens 176Ser Met Asp Gly Phe Arg Ala Glu Tyr Leu1
5 1017710PRTHomo sapiens 177Cys Cys Trp Asp Phe Glu Asp Thr Cys
Val1 5 1017810PRTHomo sapiens 178Gln Met Leu Asn Leu Thr Gln Glu
Glu Ile1 5 1017910PRTHomo sapiens 179Leu Gln Asn Ser Thr Gln Leu
Glu Gln Val1 5 1018010PRTHomo sapiens 180Ser Glu Ser Gln Lys Cys
Ser Phe Tyr Leu1 5 1018110PRTHomo sapiens 181Ala Leu Ile Thr Ser
Asn Leu Val Pro Met1 5 1018210PRTHomo sapiens 182Ser Leu Cys Ser
Cys Ser Asp Asp Cys Leu1 5 1018310PRTHomo sapiens 183Arg Leu His
Tyr Ala Lys Asn Val Arg Ile1 5 1018410PRTHomo sapiens 184Ser Val
Cys Gln Gly Glu Thr Ser Trp Leu1 5 1018510PRTHomo sapiens 185Leu
Met Pro Asn Ile Asn Lys Leu Lys Thr1 5 1018610PRTHomo sapiens
186Asn Leu His Asn Cys Val Asn Ile Ile Leu1 5 1018710PRTHomo
sapiens 187Val Gln Pro Val Ser Glu Ile Leu Gln Leu1 5
1018810PRTHomo sapiens 188Val Pro Phe Glu Glu Arg Ile Ser Thr Leu1
5 1018910PRTHomo sapiens 189Lys Thr Phe Pro Asn His Tyr Thr Ile
Val1 5 1019010PRTHomo sapiens 190Arg Gly Leu Glu Asn Cys Arg Cys
Asp Val1 5 1019110PRTHomo sapiens 191Leu Thr Gln Glu Glu Ile Thr
Ala Thr Val1 5 1019210PRTHomo sapiens 192Asp Leu Pro Pro Val Ile
Leu Phe Ser Met1 5 1019310PRTHomo sapiens 193Leu Gln Val Val Asp
His Ala Phe Gly Met1 5 1019410PRTHomo sapiens 194His Leu Phe Val
Asp Gln Gln Trp Leu Ala1 5 1019510PRTHomo sapiens 195Trp Val Glu
Glu Arg Phe Thr Ala His Ile1 5 1019610PRTHomo sapiens 196Lys Pro
Asp Gln His Phe Lys Pro Tyr Leu1 5 1019710PRTHomo sapiens 197Ser
Ile Tyr Met Pro Tyr Asn Gly Ser Val1 5 1019810PRTHomo sapiens
198Thr Gly Leu Asp Phe Tyr Gln Asp Lys Val1 5 1019910PRTHomo
sapiens 199Tyr Leu Ala Asp Lys Asn Ile Thr His Gly1 5
1020010PRTHomo sapiens 200Leu Val Ile Met Ser Leu Gly Leu Gly Leu1
5 1020110PRTHomo sapiens 201Gly Leu Gly Leu Gly Leu Gly Leu Arg
Lys1 5 1020210PRTHomo sapiens 202Lys Leu Lys Thr Cys Gly Ile His
Ser Lys1 5 1020310PRTHomo sapiens 203Lys Leu Glu Lys Gln Gly Ser
Cys Arg Lys1 5 1020410PRTHomo sapiens 204Thr Leu Leu Lys Trp Leu
Asp Leu Pro Lys1 5 1020510PRTHomo sapiens 205Thr Leu Met Pro Asn
Ile Asn Lys Leu Lys1 5 1020610PRTHomo sapiens 206Asn Leu Val Pro
Met Tyr Glu Glu Phe Arg1 5 1020710PRTHomo sapiens 207Lys Met Trp
Asp Tyr Phe His Ser Val Leu1 5 1020810PRTHomo
sapiens 208Thr Leu Ala Thr Glu Gln Pro Val Lys Lys1 5
1020910PRTHomo sapiens 209Asp Leu Pro Lys Arg Leu His Tyr Ala Lys1
5 1021010PRTHomo sapiens 210Trp Leu Thr Ala Met Tyr Gln Gly Leu
Lys1 5 1021110PRTHomo sapiens 211Gly Met Leu Met Glu Gly Leu Lys
Gln Arg1 5 1021210PRTHomo sapiens 212Lys Pro Tyr Leu Thr Pro Asp
Leu Pro Lys1 5 1021310PRTHomo sapiens 213Tyr Met Tyr Glu Gly Pro
Ala Pro Arg Ile1 5 1021410PRTHomo sapiens 214Val Leu Leu Ile Lys
His Ala Thr Glu Arg1 5 1021510PRTHomo sapiens 215Leu Val Pro Met
Tyr Glu Glu Phe Arg Lys1 5 1021610PRTHomo sapiens 216Gly Leu Tyr
Pro Glu Ser His Gly Ile Ile1 5 1021710PRTHomo sapiens 217Asn Val
Val Ser Gly Pro Ile Phe Asp Tyr1 5 1021810PRTHomo sapiens 218Ala
Met Arg Met Pro Met Trp Ser Ser Tyr1 5 1021910PRTHomo sapiens
219Leu Thr Gly Leu Asp Phe Tyr Gln Asp Lys1 5 1022010PRTHomo
sapiens 220His Leu Phe Val Asp Gln Gln Trp Leu Ala1 5
1022110PRTHomo sapiens 221Ala Leu Trp Val Glu Glu Arg Phe Thr Ala1
5 1022210PRTHomo sapiens 222Ile Leu Phe Ser Met Asp Gly Phe Arg
Ala1 5 1022310PRTHomo sapiens 223Leu Leu Ala Leu Leu Val Ile Met
Ser Leu1 5 1022410PRTHomo sapiens 224Ser Leu Asn His Leu Leu Lys
Val Pro Phe1 5 1022510PRTHomo sapiens 225Tyr Met Pro Tyr Asn Gly
Ser Val Pro Phe1 5 1022610PRTHomo sapiens 226Gly Met Asp Gln Thr
Tyr Cys Asn Lys Met1 5 1022710PRTHomo sapiens 227Phe Val Asp Gln
Gln Trp Leu Ala Val Arg1 5 1022810PRTHomo sapiens 228Ala Leu Leu
Val Ile Met Ser Leu Gly Leu1 5 1022910PRTHomo sapiens 229Asn Leu
His Asn Cys Val Asn Ile Ile Leu1 5 1023010PRTHomo sapiens 230Asn
Val Asp His Cys Leu Leu Tyr His Arg1 5 1023110PRTHomo sapiens
231Ala Ile Asn Gly Ser Phe Pro Ser Ile Tyr1 5 1023210PRTHomo
sapiens 232Phe Val Val Leu Thr Ser Cys Lys Asn Lys1 5
1023310PRTHomo sapiens 233Leu Thr Leu Ala Thr Glu Gln Pro Val Lys1
5 1023410PRTHomo sapiens 234Gly Ser Phe Pro Ser Ile Tyr Met Pro
Tyr1 5 1023510PRTHomo sapiens 235Ile Met Ser Leu Gly Leu Gly Leu
Gly Leu1 5 1023610PRTHomo sapiens 236Thr Val Lys Val Asn Leu Pro
Phe Gly Arg1 5 1023710PRTHomo sapiens 237Leu Ile Thr Ser Asn Leu
Val Pro Met Tyr1 5 1023810PRTHomo sapiens 238Ser Leu Gly Leu Gly
Leu Gly Leu Gly Leu1 5 1023910PRTHomo sapiens 239Lys Pro Glu Ala
Leu Trp Val Glu Glu Arg1 5 1024010PRTHomo sapiens 240Phe Pro Arg
Ile Asn Phe Phe Tyr Met Tyr1 5 1024110PRTHomo sapiens 241Ala Ile
Phe Leu Ala His Gly Pro Ser Phe1 5 1024210PRTHomo sapiens 242Thr
Leu Lys Lys Tyr Lys Ile Ala Cys Ile1 5 1024310PRTHomo sapiens
243Val Leu Gln Lys Asn Val Asp His Cys Leu1 5 1024410PRTHomo
sapiens 244Ser Met Asp Gly Phe Arg Ala Glu Tyr Leu1 5
1024510PRTHomo sapiens 245Gln Met Leu Asn Leu Thr Gln Glu Glu Ile1
5 1024610PRTHomo sapiens 246Gly Leu Lys Gln Arg Asn Leu His Asn
Cys1 5 1024710PRTHomo sapiens 247Glu Ile Val Arg Asn Leu Ser Cys
Arg Lys1 5 1024810PRTHomo sapiens 248Thr Gln Glu Glu Ile Thr Ala
Thr Val Lys1 5 1024910PRTHomo sapiens 249Lys Ile Ala Cys Ile Val
Leu Leu Ala Leu1 5 1025010PRTHomo sapiens 250Phe Leu Tyr Pro Pro
Ala Ser Asn Arg Thr1 5 102519PRTHomo sapiens 251Arg Val Pro Pro Ser
Glu Ser Gln Lys1 52529PRTHomo sapiens 252Gly Leu Gly Leu Arg Lys
Leu Glu Lys1 52539PRTHomo sapiens 253Ile Val Arg Asn Leu Ser Cys
Arg Lys1 52549PRTHomo sapiens 254Asn Val Glu Ser Cys Pro Glu Gly
Lys1 52559PRTHomo sapiens 255Asn Met Tyr Asp Val Asn Leu Asn Lys1
52569PRTHomo sapiens 256Val Val Leu Thr Ser Cys Lys Asn Lys1
52579PRTHomo sapiens 257Val Pro Met Tyr Glu Glu Phe Arg Lys1
52589PRTHomo sapiens 258Gly Met Asp Gln Thr Tyr Cys Asn Lys1
52599PRTHomo sapiens 259Arg Glu Tyr Val Ser Gly Phe Gly Lys1
52609PRTHomo sapiens 260Ser Thr Arg Ile Trp Met Cys Asn Lys1
52619PRTHomo sapiens 261Leu Thr Ala Met Tyr Gln Gly Leu Lys1
52629PRTHomo sapiens 262Gly Pro Val Ser Ala Arg Val Ile Lys1
52639PRTHomo sapiens 263Asp Thr Leu Met Pro Asn Ile Asn Lys1
52649PRTHomo sapiens 264Leu Leu Lys Trp Leu Asp Leu Pro Lys1
52659PRTHomo sapiens 265Lys Cys Ser Phe Tyr Leu Ala Asp Lys1
52669PRTHomo sapiens 266Leu Pro Lys Arg Leu His Tyr Ala Lys1
52679PRTHomo sapiens 267Tyr Phe His Ser Val Leu Leu Ile Lys1
52689PRTHomo sapiens 268Ser Cys Ser Asp Asp Cys Leu Gln Lys1
52699PRTHomo sapiens 269Pro Val Lys Lys Asn Thr Leu Lys Lys1
52709PRTHomo sapiens 270Phe Leu Ala His Gly Pro Ser Phe Lys1
52719PRTHomo sapiens 271Leu Val Pro Met Tyr Glu Glu Phe Arg1
52729PRTHomo sapiens 272Thr Leu Ala Thr Glu Gln Pro Val Lys1
52739PRTHomo sapiens 273Tyr Ala Lys Asn Val Arg Ile Asp Lys1
52749PRTHomo sapiens 274Tyr Met Arg Ala Met Tyr Pro Thr Lys1
52759PRTHomo sapiens 275Tyr Phe Val Val Leu Thr Ser Cys Lys1
52769PRTHomo sapiens 276Gln Pro Val Lys Lys Asn Thr Leu Lys1
52779PRTHomo sapiens 277Arg Ile Trp Met Cys Asn Lys Phe Arg1
52789PRTHomo sapiens 278Gly Leu Gly Leu Gly Leu Gly Leu Arg1
52799PRTHomo sapiens 279Arg Leu His Tyr Ala Lys Asn Val Arg1
52809PRTHomo sapiens 280Lys Leu Glu Lys Gln Gly Ser Cys Arg1
52819PRTHomo sapiens 281Leu Ala Thr Glu Gln Pro Val Lys Lys1
52829PRTHomo sapiens 282Pro Val Ser Glu Ile Leu Gln Leu Lys1
52839PRTHomo sapiens 283Asn Cys Arg Cys Asp Val Ala Cys Lys1
52849PRTHomo sapiens 284Leu Met Pro Asn Ile Asn Lys Leu Lys1
52859PRTHomo sapiens 285Ile Leu Phe Ser Met Asp Gly Phe Arg1
52869PRTHomo sapiens 286Tyr Met Tyr Glu Gly Pro Ala Pro Arg1
52879PRTHomo sapiens 287Phe Leu Tyr Pro Pro Ala Ser Asn Arg1
52889PRTHomo sapiens 288Glu Tyr Met Thr Asp Tyr Phe Pro Arg1
52899PRTHomo sapiens 289Pro Tyr Leu Thr Pro Asp Leu Pro Lys1
52909PRTHomo sapiens 290Gln Gln Trp Leu Ala Val Arg Ser Lys1
52919PRTHomo sapiens 291Lys Thr Phe Pro Asn His Tyr Thr Ile1
52929PRTHomo sapiens 292Leu Leu Ile Lys His Ala Thr Glu Arg1
52939PRTHomo sapiens 293Gln Val Val Asp His Ala Phe Gly Met1
52949PRTHomo sapiens 294Arg Val Ile Lys Ala Leu Gln Val Val1
52959PRTHomo sapiens 295Arg Val Leu Gln Lys Asn Val Asp His1
52969PRTHomo sapiens 296Val Leu Pro Phe Ile Ile Pro His Arg1
52979PRTHomo sapiens 297Tyr Leu Thr Pro Asp Leu Pro Lys Arg1
52989PRTHomo sapiens 298Met Leu Met Glu Gly Leu Lys Gln Arg1
52999PRTHomo sapiens 299Ser Phe Asn Ser Glu Glu Ile Val Arg1
53009PRTHomo sapiens 300Trp Leu Asp Leu Pro Lys Ala Glu Arg1
530110PRTHomo sapiens 301Leu Val Pro Met Tyr Glu Glu Phe Arg Lys1 5
1030210PRTHomo sapiens 302Lys Pro Tyr Leu Thr Pro Asp Leu Pro Lys1
5 1030310PRTHomo sapiens 303Lys Tyr Met Arg Ala Met Tyr Pro Thr
Lys1 5 1030410PRTHomo sapiens 304Gly Leu Gly Leu Gly Leu Gly Leu
Arg Lys1 5 1030510PRTHomo sapiens 305Phe Val Val Leu Thr Ser Cys
Lys Asn Lys1 5 1030610PRTHomo sapiens 306Leu Thr Leu Ala Thr Glu
Gln Pro Val Lys1 5 1030710PRTHomo sapiens 307Thr Leu Leu Lys Trp
Leu Asp Leu Pro Lys1 5 1030810PRTHomo sapiens 308Lys Leu Glu Lys
Gln Gly Ser Cys Arg Lys1 5 1030910PRTHomo sapiens 309Lys Leu Lys
Thr Cys Gly Ile His Ser Lys1 5 1031010PRTHomo sapiens 310Thr Val
Lys Val Asn Leu Pro Phe Gly Arg1 5 1031110PRTHomo sapiens 311Leu
Thr Gly Leu Asp Phe Tyr Gln Asp Lys1 5 1031210PRTHomo sapiens
312His Tyr Phe Val Val Leu Thr Ser Cys Lys1 5 1031310PRTHomo
sapiens 313Asn Val Asp His Cys Leu Leu Tyr His Arg1 5
1031410PRTHomo sapiens 314His Tyr Ala Lys Asn Val Arg Ile Asp Lys1
5 1031510PRTHomo sapiens 315Gln Pro Val Lys Lys Asn Thr Leu Lys
Lys1 5 1031610PRTHomo sapiens 316Thr Gln Glu Glu Ile Thr Ala Thr
Val Lys1 5 1031710PRTHomo sapiens 317Asp Tyr Phe His Ser Val Leu
Leu Ile Lys1 5 1031810PRTHomo sapiens 318Phe Val Asp Gln Gln Trp
Leu Ala Val Arg1 5 1031910PRTHomo sapiens 319Thr Leu Ala Thr Glu
Gln Pro Val Lys Lys1 5 1032010PRTHomo sapiens 320His Phe Asp Ala
Pro Asp Glu Ile Thr Lys1 5 1032110PRTHomo sapiens 321Trp Leu Thr
Ala Met Tyr Gln Gly Leu Lys1 5 1032210PRTHomo sapiens 322Thr Leu
Met Pro Asn Ile Asn Lys Leu Lys1 5 1032310PRTHomo sapiens 323Tyr
Val Ser Gly Phe Gly Lys Ala Met Arg1 5 1032410PRTHomo sapiens
324Gln Pro Val Ser Glu Ile Leu Gln Leu Lys1 5 1032510PRTHomo
sapiens 325Ile Phe Leu Ala His Gly Pro Ser Phe Lys1 5
1032610PRTHomo sapiens 326Asp Leu Pro Lys Arg Leu His Tyr Ala Lys1
5 1032710PRTHomo sapiens 327Ser Cys Ser Asp Asp Cys Leu Gln Lys
Lys1 5 1032810PRTHomo sapiens 328Ser Cys Arg Lys Pro Asp Gln His
Phe Lys1 5 1032910PRTHomo sapiens 329Ala Phe Gly Met Leu Met Glu
Gly Leu Lys1 5 1033010PRTHomo sapiens 330Gly Phe Leu Tyr Pro Pro
Ala Ser Asn Arg1 5 1033110PRTHomo sapiens 331Asp Val Leu Pro Phe
Ile Ile Pro His Arg1 5 1033210PRTHomo sapiens 332Gly Met Leu Met
Glu Gly Leu Lys Gln Arg1 5 1033310PRTHomo sapiens 333Glu Ile Val
Arg Asn Leu Ser Cys Arg Lys1 5 1033410PRTHomo sapiens 334Glu Gln
Pro Val Lys Lys Asn Thr Leu Lys1 5 1033510PRTHomo sapiens 335Phe
Tyr Met Tyr Glu Gly Pro Ala Pro Arg1 5 1033610PRTHomo sapiens
336Asn Asn Met Tyr Asp Val Asn Leu Asn Lys1 5 1033710PRTHomo
sapiens 337Val Tyr Asn Leu Met Cys Asp Leu Leu Arg1 5
1033810PRTHomo sapiens 338Val Ile Leu Phe Ser Met Asp Gly Phe Arg1
5 1033910PRTHomo sapiens 339Lys Pro Glu Ala Leu Trp Val Glu Glu
Arg1 5 1034010PRTHomo sapiens 340Lys Val Asn Leu Pro Phe Gly Arg
Pro Arg1 5 1034110PRTHomo sapiens 341Asn Leu Val Pro Met Tyr Glu
Glu Phe Arg1 5 1034210PRTHomo sapiens 342Phe Glu Glu Arg Ile Ser
Thr Leu Leu Lys1 5 1034310PRTHomo sapiens 343Val Leu Leu Ile Lys
His Ala Thr Glu Arg1 5 1034410PRTHomo sapiens 344Leu Ala His Gly
Pro Ser Phe Lys Glu Lys1 5 1034510PRTHomo sapiens 345Asn Val Val
Ser Gly Pro Ile Phe Asp Tyr1 5 1034610PRTHomo sapiens 346Thr Cys
Gly Ile His Ser Lys Tyr Met Arg1 5 1034710PRTHomo sapiens 347Met
Glu Tyr Met Thr Asp Tyr Phe Pro Arg1 5 1034810PRTHomo sapiens
348Leu Gly Leu Gly Leu Arg Lys Leu Glu Lys1 5 1034910PRTHomo
sapiens 349His Arg Glu Tyr Val Ser Gly Phe Gly Lys1 5
1035010PRTHomo sapiens 350Thr Asn Val Glu Ser Cys Pro Glu Gly Lys1
5 103519PRTHomo sapiens 351Lys Tyr Lys Ile Ala Cys Ile Val Leu1
53529PRTHomo sapiens 352Glu Tyr Leu Tyr Thr Trp Asp Thr Leu1
53539PRTHomo sapiens 353Val Tyr Asn Leu Met Cys Asp Leu Leu1
53549PRTHomo sapiens 354Asp Tyr Phe Pro Arg Ile Asn Phe Phe1
53559PRTHomo sapiens 355Leu Tyr Pro Glu Ser His Gly Ile Ile1
53569PRTHomo sapiens 356Met Tyr Glu Gly Pro Ala Pro Arg Ile1
53579PRTHomo sapiens 357Asp Tyr Phe His Ser Val Leu Leu Ile1
53589PRTHomo sapiens 358Gly Tyr Asn Asn Glu Phe Arg Ser Met1
53599PRTHomo sapiens 359Lys Phe Arg Cys Gly Glu Thr Arg Leu1
53609PRTHomo sapiens 360Thr Tyr Cys Asn Lys Met Glu Tyr Met1
53619PRTHomo sapiens 361Cys Phe Asp Ala Ser Phe Arg Gly Leu1
53629PRTHomo sapiens 362Ala Phe Gly Met Leu Met Glu Gly Leu1
53639PRTHomo sapiens 363Lys Val Gln Pro Val Ser Glu Ile Leu1
53649PRTHomo sapiens 364Gly Phe Asp Leu Pro Pro Val Ile Leu1
53659PRTHomo sapiens 365Lys Tyr Met Arg Ala Met Tyr Pro Thr1
53669PRTHomo sapiens 366Ile Phe Leu Ala His Gly Pro Ser Phe1
53679PRTHomo sapiens 367Thr Tyr Leu Pro Thr Phe Glu Thr Thr1
53689PRTHomo sapiens 368Leu Tyr Pro Pro Ala Ser Asn Arg Thr1
53699PRTHomo sapiens 369Phe Tyr Gln Asp Lys Val Gln Pro Val1
53709PRTHomo sapiens 370Gln Leu Glu Gln Val Asn Gln Met Leu1
53719PRTHomo sapiens 371Asn Ser Glu Glu Ile Val Arg Asn Leu1
53729PRTHomo sapiens 372Glu Phe Arg Lys Met Trp Asp Tyr Phe1
53739PRTHomo sapiens 373Glu Phe Arg Ser Met Glu Ala Ile Phe1
53749PRTHomo sapiens 374Glu Tyr Val Ser Gly Phe Gly Lys Ala1
53759PRTHomo sapiens 375Arg Ile Ser Thr Leu Leu Lys Trp Leu1
53769PRTHomo sapiens 376Thr Leu Met Pro Asn Ile Asn Lys Leu1
53779PRTHomo sapiens 377Met Tyr Gln Gly Leu Lys Ala Ala Thr1
53789PRTHomo sapiens 378Phe Tyr Leu Ala Asp Lys Asn Ile Thr1
53799PRTHomo sapiens 379Ile Tyr Met Pro Tyr Asn Gly Ser Val1
53809PRTHomo sapiens 380Met Tyr Glu Glu Phe Arg Lys Met Trp1
53819PRTHomo sapiens 381Leu Thr Pro Asp Leu Pro Lys Arg Leu1
53829PRTHomo sapiens 382Leu Pro Pro Thr Val Pro Asp Cys Leu1
53839PRTHomo sapiens 383Leu Ala Leu Leu Val Ile Met Ser Leu1
53849PRTHomo sapiens 384Met Tyr Pro Thr Lys Thr Phe Pro Asn1
53859PRTHomo sapiens 385Ala Cys Ile Val Leu Leu Ala Leu Leu1
53869PRTHomo sapiens 386Glu Gln Pro Val Lys Lys Asn Thr Leu1
53879PRTHomo sapiens 387Leu Gly Leu Gly Leu Gly Leu Gly Leu1
53889PRTHomo sapiens 388Glu Ile Leu Gln Leu Lys Thr Tyr Leu1
53899PRTHomo sapiens 389Val Ile Met Ser Leu Gly Leu Gly Leu1
53909PRTHomo sapiens 390Met Ser Leu Gly Leu Gly Leu Gly Leu1
53919PRTHomo sapiens 391His Tyr Thr Ile Val Thr Gly Leu Tyr1
53929PRTHomo sapiens 392His Tyr Phe Val Val Leu Thr Ser Cys1
53939PRTHomo sapiens 393Ala Pro Asp Glu Ile Thr Lys His Leu1
53949PRTHomo sapiens 394Met Tyr Asp Val Asn Leu Asn Lys Asn1
53959PRTHomo sapiens 395Ser Thr Leu Leu Lys Trp Leu Asp Leu1
53969PRTHomo sapiens 396Gln Pro Val Ser Glu Ile Leu Gln Leu1
53979PRTHomo sapiens 397Val Cys Gln Gly Glu Thr Ser Trp Leu1
53989PRTHomo sapiens 398Glu Gln Val Asn Gln Met Leu Asn Leu1
53999PRTHomo sapiens 399Thr Pro Glu Asn Cys Pro Gly Trp Leu1
54009PRTHomo sapiens 400Lys Met Glu Tyr Met Thr Asp Tyr Phe1
540110PRTHomo sapiens 401Lys Tyr Lys Ile Ala Cys Ile Val Leu Leu1 5
1040210PRTHomo sapiens 402Gln Tyr Asp Ala Leu Ile Thr Ser Asn Leu1
5 1040310PRTHomo sapiens 403Met Tyr Asp Val Asn Leu Asn Lys Asn
Phe1 5 1040410PRTHomo sapiens 404Leu Tyr His Arg Glu Tyr Val Ser
Gly Phe1 5 1040510PRTHomo sapiens 405Glu Tyr Met Thr Asp Tyr Phe
Pro Arg Ile1 5 1040610PRTHomo sapiens 406Thr Tyr Leu Pro Thr Phe
Glu Thr Thr Ile1 5 1040710PRTHomo sapiens 407Glu Tyr Val Ser Gly
Phe Gly Lys Ala Met1 5 1040810PRTHomo sapiens 408Glu Tyr Leu Tyr
Thr Trp Asp Thr Leu Met1 5 1040910PRTHomo sapiens 409His Phe Lys
Pro Tyr Leu Thr Pro Asp Leu1 5 1041010PRTHomo sapiens 410Glu Phe
Arg Ser Met Glu Ala Ile Phe Leu1 5 1041110PRTHomo sapiens 411Phe
Tyr Gln Asp Lys Val Gln Pro Val Ser1 5 1041210PRTHomo sapiens
412Thr Gln Leu Glu Gln Val Asn Gln Met Leu1 5 1041310PRTHomo
sapiens 413Lys Asn Val Arg Ile Asp Lys Val His Leu1 5
1041410PRTHomo sapiens 414Lys Cys Phe Asp Ala Ser Phe Arg Gly Leu1
5 1041510PRTHomo sapiens 415Lys Ile Ala Cys Ile Val Leu Leu Ala
Leu1 5 1041610PRTHomo sapiens 416Asp Ala Pro Asp Glu Ile Thr Lys
His Leu1 5 1041710PRTHomo sapiens 417Gly Phe Asp Leu Pro Pro Val
Ile Leu Phe1 5 1041810PRTHomo sapiens 418Ile Phe Asp Tyr Asn Tyr
Asp Gly His Phe1 5 1041910PRTHomo sapiens 419Phe Tyr Glu Pro Ser
His Ala Glu Glu Val1 5 1042010PRTHomo sapiens 420Arg Thr Ser Asp
Ser Gln Tyr Asp Ala Leu1 5 1042110PRTHomo sapiens 421Lys Met Trp
Asp Tyr Phe His Ser Val Leu1 5 1042210PRTHomo sapiens 422Leu Tyr
Pro Pro Ala Ser Asn Arg Thr Ser1 5 1042310PRTHomo sapiens 423Gln
Val Val Asp His Ala Phe Gly Met Leu1 5 1042410PRTHomo sapiens
424Asp Tyr Phe Pro Arg Ile Asn Phe Phe Tyr1 5 1042510PRTHomo
sapiens 425Val Leu Gln Lys Asn Val Asp His Cys Leu1 5
1042610PRTHomo sapiens 426Lys Ala Leu Gln Val Val Asp His Ala Phe1
5 1042710PRTHomo sapiens 427Lys Pro Asp Gln His Phe Lys Pro Tyr
Leu1 5 1042810PRTHomo sapiens 428Asp Thr Leu Met Pro Asn Ile Asn
Lys Leu1 5 1042910PRTHomo sapiens 429Asp Tyr Asn Tyr Asp Gly His
Phe Asp Ala1 5 1043010PRTHomo sapiens 430Met Tyr Gln Gly Leu Lys
Ala Ala Thr Tyr1 5 1043110PRTHomo sapiens 431Ser Cys Pro Glu Gly
Lys Pro Glu Ala Leu1 5 1043210PRTHomo sapiens 432Cys Gly Glu Thr
Arg Leu Glu Ala Ser Leu1 5 1043310PRTHomo sapiens 433Glu Ser Leu
Asp Cys Phe Cys Pro His Leu1 5 1043410PRTHomo sapiens 434Leu Val
Ile Met Ser Leu Gly Leu Gly Leu1 5 1043510PRTHomo sapiens 435His
Thr Pro Glu Asn Cys Pro Gly Trp Leu1 5 1043610PRTHomo sapiens
436Phe Ser Val Cys Gly Phe Ala Asn Pro Leu1 5 1043710PRTHomo
sapiens 437Met Trp Leu Thr Ala Met Tyr Gln Gly Leu1 5
1043810PRTHomo sapiens 438Phe Ala Asn Pro Leu Pro Thr Glu Ser Leu1
5 1043910PRTHomo sapiens 439Phe Asn Ser Glu Glu Ile Val Arg Asn
Leu1 5 1044010PRTHomo sapiens 440Leu Gly Leu Gly Leu Gly Leu Arg
Lys Leu1 5 1044110PRTHomo sapiens 441Val Gln Pro Val Ser Glu Ile
Leu Gln Leu1 5 1044210PRTHomo sapiens 442Gln Ser Gln Cys Pro Glu
Gly Phe Asp Leu1 5 1044310PRTHomo sapiens 443Ala Leu Leu Val Ile
Met Ser Leu Gly Leu1 5 1044410PRTHomo sapiens 444Leu Met Glu Gly
Leu Lys Gln Arg Asn Leu1 5 1044510PRTHomo sapiens 445Ala Pro Asn
Asn Gly Thr His Gly Ser Leu1 5 1044610PRTHomo sapiens 446Asp Val
Asn Leu Asn Lys Asn Phe Ser Leu1 5 1044710PRTHomo sapiens 447Asn
Leu Pro Phe Gly Arg Pro Arg Val Leu1 5 1044810PRTHomo sapiens
448Tyr Phe Trp Pro Gly Ser Glu Val Ala Ile1 5 1044910PRTHomo
sapiens 449Val Pro Gln Leu Gly Asp Thr Ser Pro Leu1 5
1045010PRTHomo sapiens 450Tyr Leu Thr Pro Asp Leu Pro Lys Arg Leu1
5 104519PRTHomo sapiens 451Ala Pro Arg Ile Arg Ala His Asn Ile1
54529PRTHomo sapiens 452Phe Pro Arg Ile Asn Phe Phe Tyr Met1
54539PRTHomo sapiens 453Asn Val Arg Ile Asp Lys Val His Leu1
54549PRTHomo sapiens 454Ile Ala Arg Val Arg Asp Val Glu Leu1
54559PRTHomo sapiens 455Gln Pro Val Ser Glu Ile Leu Gln Leu1
54569PRTHomo sapiens 456Leu Pro Phe Gly Arg Pro Arg Val Leu1
54579PRTHomo sapiens 457Ile Pro Thr His Tyr Phe Val Val Leu1
54589PRTHomo sapiens 458Leu Pro Pro Thr Val Pro Asp Cys Leu1
54599PRTHomo sapiens 459Ala Pro Asp Glu Ile Thr Lys His Leu1
54609PRTHomo sapiens 460Arg Pro Arg Val Leu Gln Lys Asn Val1
54619PRTHomo sapiens 461Cys Pro Glu Gly Lys Pro Glu Ala Leu1
54629PRTHomo sapiens 462Thr Pro Glu Asn Cys Pro Gly Trp Leu1
54639PRTHomo sapiens 463Glu Val Tyr Asn Leu Met Cys Asp Leu1
54649PRTHomo sapiens 464Lys Val Gln Pro Val Ser Glu Ile Leu1
54659PRTHomo sapiens 465Leu Pro Pro Val Ile Leu Phe Ser Met1
54669PRTHomo sapiens 466Ser Val Cys Gly Phe Ala Asn Pro Leu1
54679PRTHomo sapiens 467Ala Asn Pro Leu Pro Thr Glu Ser Leu1
54689PRTHomo sapiens 468Leu Ala Leu Leu Val Ile Met Ser Leu1
54699PRTHomo sapiens 469Ala Cys Ile Val Leu Leu Ala Leu Leu1
54709PRTHomo sapiens 470Thr Leu Met Pro Asn Ile Asn Lys Leu1
54719PRTHomo sapiens 471Ile Ala Cys Ile Val Leu Leu Ala Leu1
54729PRTHomo sapiens 472Val Ile Met Ser Leu Gly Leu Gly Leu1
54739PRTHomo sapiens 473Met Pro Met Trp Ser Ser Tyr Thr Val1
54749PRTHomo sapiens 474Val Val Asp His Ala Phe Gly Met Leu1
54759PRTHomo sapiens 475Arg Val Arg Asp Val Glu Leu Leu Thr1
54769PRTHomo sapiens 476Tyr Val Ser Gly Phe Gly Lys Ala Met1
54779PRTHomo sapiens 477Gln Val Val Asp His Ala Phe Gly Met1
54789PRTHomo sapiens 478Gly Thr His Gly Ser Leu Asn His Leu1
54799PRTHomo sapiens 479His Asn Cys Val Asn Ile Ile Leu Leu1
54809PRTHomo sapiens 480Leu Leu Val Ile Met Ser Leu Gly Leu1
54819PRTHomo sapiens 481Arg Pro Arg Phe Tyr Thr Met Tyr Phe1
54829PRTHomo sapiens 482Asp Asn Asn Met Tyr Asp Val Asn Leu1
54839PRTHomo sapiens 483Glu Gln Val Asn Gln Met Leu Asn Leu1
54849PRTHomo sapiens 484Met Ser Leu Gly Leu Gly Leu Gly Leu1
54859PRTHomo sapiens 485Leu Thr Pro Asp Leu Pro Lys Arg Leu1
54869PRTHomo sapiens 486Ser Thr Leu Leu Lys Trp Leu Asp Leu1
54879PRTHomo sapiens 487Trp Ser Ser Tyr Thr Val Pro Gln Leu1
54889PRTHomo sapiens 488Glu Ser Gln Lys Cys Ser Phe Tyr Leu1
54899PRTHomo sapiens 489Val Ser Ala Arg Val Ile Lys Ala Leu1
54909PRTHomo sapiens 490Arg Ile Ser Thr Leu Leu Lys Trp Leu1
54919PRTHomo sapiens 491Val Pro Ile Pro Thr His Tyr Phe Val1
54929PRTHomo sapiens 492His Leu Phe Val Asp Gln Gln Trp Leu1
54939PRTHomo sapiens 493Lys Phe Arg Cys Gly Glu Thr Arg Leu1
54949PRTHomo sapiens 494Asn Cys Pro Gly Trp Leu Asp Val Leu1
54959PRTHomo sapiens 495Glu Ile Leu Gln Leu Lys Thr Tyr Leu1
54969PRTHomo sapiens 496Trp Leu Thr Ala Met Tyr Gln Gly Leu1
54979PRTHomo sapiens 497Ser Gln Cys Pro Glu Gly Phe Asp Leu1
54989PRTHomo sapiens 498Glu Gln Pro Val Lys Lys Asn Thr Leu1
54999PRTHomo sapiens 499Gly Leu Gly Leu Gly Leu Arg Lys Leu1
55009PRTHomo sapiens 500Leu Gly Leu Gly Leu Gly Leu Gly Leu1
550110PRTHomo sapiens 501Ala Pro Asn Asn Gly Thr His Gly Ser Leu1 5
1050210PRTHomo sapiens 502Ile Ala Arg Val Arg Asp Val Glu Leu Leu1
5 1050310PRTHomo sapiens 503Cys Pro His Leu Gln Asn Ser Thr Gln
Leu1 5 1050410PRTHomo sapiens 504Val Pro Gln Leu Gly Asp Thr Ser
Pro Leu1 5 1050510PRTHomo sapiens 505Val Pro Phe Glu Glu Arg Ile
Ser Thr Leu1 5 1050610PRTHomo sapiens 506Val Pro Met Tyr Glu Glu
Phe Arg Lys Met1 5 1050710PRTHomo sapiens 507Lys Pro Asp Gln His
Phe Lys Pro Tyr Leu1 5 1050810PRTHomo sapiens 508Gln Val Val Asp
His Ala Phe Gly Met Leu1 5 1050910PRTHomo sapiens 509Glu Val Tyr
Asn Leu Met Cys Asp Leu Leu1 5 1051010PRTHomo sapiens 510Leu Val
Ile Met Ser Leu Gly Leu Gly Leu1 5 1051110PRTHomo sapiens 511Asp
Val Asn Leu Asn Lys Asn Phe Ser Leu1 5 1051210PRTHomo sapiens
512Asn Pro Ala Trp Trp His Gly Gln Pro Met1 5 1051310PRTHomo
sapiens 513Ser Val Cys Gln Gly Glu Thr Ser Trp Leu1 5
1051410PRTHomo sapiens 514Phe Ala Asn Pro Leu Pro Thr Glu Ser Leu1
5 1051510PRTHomo sapiens 515Ala Val Arg Ser Lys Ser Asn Thr Asn
Cys1 5 1051610PRTHomo sapiens 516Ala Leu Leu Val Ile Met Ser Leu
Gly Leu1 5 1051710PRTHomo sapiens 517Asp Ala Pro Asp Glu Ile Thr
Lys His Leu1 5 1051810PRTHomo sapiens 518His Ala Phe Gly Met Leu
Met Glu Gly Leu1 5 1051910PRTHomo sapiens 519Ile Ala Cys Ile Val
Leu Leu Ala Leu Leu1 5 1052010PRTHomo sapiens 520Ala Pro Arg Ile
Arg Ala His Asn Ile Pro1 5 1052110PRTHomo sapiens 521Ser Ala Arg
Val Ile Lys Ala Leu Gln Val1 5 1052210PRTHomo sapiens 522Glu Gly
Phe Asp Leu Pro Pro Val Ile Leu1 5 1052310PRTHomo sapiens 523Ile
Val Leu Leu Ala Leu Leu Val Ile Met1 5 1052410PRTHomo sapiens
524Glu Phe Arg Ser Met Glu Ala Ile Phe Leu1 5 1052510PRTHomo
sapiens 525Thr Gln Leu Glu Gln Val Asn Gln Met Leu1 5
1052610PRTHomo sapiens 526Lys Asn Val Arg Ile Asp Lys Val His Leu1
5 1052710PRTHomo sapiens 527Ser Leu Cys Ser Cys Ser Asp Asp Cys
Leu1 5 1052810PRTHomo sapiens 528Glu Ile Thr Ala Thr Val Lys Val
Asn Leu1 5 1052910PRTHomo sapiens 529Lys Cys Phe Asp Ala Ser Phe
Arg Gly Leu1 5 1053010PRTHomo sapiens 530Phe Asn Ser Glu Glu Ile
Val Arg Asn Leu1 5 1053110PRTHomo sapiens 531Glu Asn Cys Pro Gly
Trp Leu Asp Val Leu1 5 1053210PRTHomo sapiens 532Gln Ser Gln Cys
Pro Glu Gly Phe Asp Leu1 5 1053310PRTHomo sapiens 533Leu Gln Lys
Asn Val Asp His Cys Leu Leu1 5 1053410PRTHomo sapiens 534Val Leu
Gln Lys Asn Val Asp His Cys Leu1 5 1053510PRTHomo sapiens 535Arg
Thr Ser Asp Ser Gln Tyr Asp Ala Leu1 5 1053610PRTHomo sapiens
536Leu Gly Leu Gly Leu Gly Leu Arg Lys Leu1 5 1053710PRTHomo
sapiens 537Phe Ser Val Cys Gly Phe Ala Asn Pro Leu1 5
1053810PRTHomo sapiens 538Ser Leu Gly Leu Gly Leu Gly Leu Gly Leu1
5 1053910PRTHomo sapiens 539Leu Leu Ala Leu Leu Val Ile Met Ser
Leu1 5 1054010PRTHomo sapiens 540His Ile Ala Arg Val Arg Asp Val
Glu Leu1 5 1054110PRTHomo sapiens 541Lys Ile Ala Cys Ile Val Leu
Leu Ala Leu1 5 1054210PRTHomo sapiens 542Asn Leu Pro Phe Gly Arg
Pro Arg Val Leu1 5 1054310PRTHomo sapiens 543Ile Ser Thr Leu Leu
Lys Trp Leu Asp Leu1 5 1054410PRTHomo sapiens 544His Thr Pro Glu
Asn Cys Pro Gly Trp Leu1 5 1054510PRTHomo sapiens 545Lys Met Trp
Asp Tyr Phe His Ser Val Leu1 5 1054610PRTHomo sapiens 546Val Pro
Ile Pro Thr His Tyr Phe Val Val1 5 1054710PRTHomo sapiens 547Asn
Gly Thr His Gly Ser Leu Asn His Leu1 5 1054810PRTHomo sapiens
548Phe Pro Arg Ile Asn Phe Phe Tyr Met Tyr1 5 1054910PRTHomo
sapiens 549Ser Cys Pro Glu Gly Lys Pro Glu Ala Leu1 5
1055010PRTHomo sapiens 550Ile Met Ser Leu Gly Leu Gly Leu Gly Leu1
5 105519PRTHomo sapiens 551Phe Pro Arg Ile Asn Phe Phe Tyr Met1
55529PRTHomo sapiens 552Arg Pro Arg Phe Tyr Thr Met Tyr Phe1
55539PRTHomo sapiens 553Leu Pro Lys Ala Glu Arg Pro Arg Phe1
55549PRTHomo sapiens 554Glu Pro Phe Glu Asn Ile Glu Val Tyr1
55559PRTHomo sapiens 555Leu Pro Thr Glu Ser Leu Asp Cys Phe1
55569PRTHomo sapiens 556Leu Pro Pro Val Ile Leu Phe Ser Met1
55579PRTHomo sapiens 557Gln Pro Met Trp Leu Thr Ala Met Tyr1
55589PRTHomo sapiens 558Gln Pro Val Ser Glu Ile Leu Gln Leu1
55599PRTHomo sapiens 559His Ser Lys Tyr Met Arg Ala Met Tyr1
55609PRTHomo sapiens 560Lys Pro Asp Gln His Phe Lys Pro Tyr1
55619PRTHomo sapiens 561Ala Pro Arg Ile Arg Ala His Asn Ile1
55629PRTHomo sapiens 562Arg Pro Arg Val Leu Gln Lys Asn Val1
55639PRTHomo sapiens 563Leu Pro Pro Thr Val Pro Asp Cys Leu1
55649PRTHomo sapiens 564Leu Pro Phe Gly Arg Pro Arg Val Leu1
55659PRTHomo sapiens 565Met Pro Tyr Asn Gly Ser Val Pro Phe1
55669PRTHomo sapiens 566Ile Pro Thr His Tyr Phe Val Val Leu1
55679PRTHomo sapiens 567Val Ser Lys Phe Ser Val Cys Gly Phe1
55689PRTHomo sapiens 568Ala Pro Asp Glu Ile Thr Lys His Leu1
55699PRTHomo sapiens 569Ile Ala Arg Val Arg Asp Val Glu Leu1
55709PRTHomo sapiens 570Lys Asn Val Asp His Cys Leu Leu Tyr1
55719PRTHomo sapiens 571Phe Gly Lys Ala Met Arg Met Pro Met1
55729PRTHomo sapiens 572Thr Pro Glu Asn Cys Pro Gly Trp Leu1
55739PRTHomo sapiens 573Arg Ala Met Tyr Pro Thr Lys Thr Phe1
55749PRTHomo sapiens 574Cys Pro Glu Gly Lys Pro Glu Ala Leu1
55759PRTHomo sapiens 575Val Pro Phe Glu Glu Arg Ile Ser Thr1
55769PRTHomo sapiens 576Ser Asn Arg Thr Ser Asp Ser Gln Tyr1
55779PRTHomo sapiens 577Arg Ala His Asn Ile Pro His Asp Phe1
55789PRTHomo sapiens 578Met Ser Leu Gly Leu Gly Leu Gly Leu1
55799PRTHomo sapiens 579Glu Ser Gln Lys Cys Ser Phe Tyr Leu1
55809PRTHomo sapiens 580Trp Ser Ser Tyr Thr Val Pro Gln Leu1
55819PRTHomo sapiens 581Val Ser Ala Arg Val Ile Lys Ala Leu1
55829PRTHomo sapiens 582Asn Val Arg Ile Asp Lys Val His Leu1
55839PRTHomo sapiens 583Lys Thr Cys Gly Ile His Ser Lys Tyr1
55849PRTHomo sapiens 584Thr Gln Leu Glu Gln Val Asn Gln Met1
55859PRTHomo sapiens 585Gln Val Val Asp His Ala Phe Gly Met1
55869PRTHomo sapiens 586Met Pro Met Trp Ser Ser Tyr Thr Val1
55879PRTHomo sapiens 587Glu Asn Ile Glu Val Tyr Asn Leu Met1
55889PRTHomo sapiens 588Val Pro Ile Pro Thr His Tyr Phe Val1
55899PRTHomo sapiens 589Ile Pro His Asp Phe Phe Ser Phe Asn1
55909PRTHomo sapiens 590Lys Asn Ile Thr His Gly Phe Leu Tyr1
55919PRTHomo sapiens 591Ile Ala Cys Ile Val Leu Leu Ala Leu1
55929PRTHomo sapiens 592Leu Gln Lys Asn Val Asp His Cys Leu1
55939PRTHomo sapiens 593Ser Ser Lys Glu Gln Asn Asn Pro Ala1
55949PRTHomo sapiens 594Leu Ala Leu Leu Val Ile Met Ser Leu1
55959PRTHomo sapiens 595Gln Leu Lys Thr Tyr Leu Pro Thr Phe1
55969PRTHomo sapiens 596Ser Cys Arg Lys Pro Asp Gln His Phe1
55979PRTHomo sapiens 597Val Pro Phe Tyr Glu Pro Ser His Ala1
55989PRTHomo sapiens 598Val Pro Pro Ser Glu Ser Gln Lys Cys1
55999PRTHomo sapiens 599His Gly Ile Ile Asp Asn Asn Met Tyr1
56009PRTHomo sapiens 600Glu Ala Leu Trp Val Glu Glu Arg Phe1
560110PRTHomo sapiens 601Leu Pro Lys Ala Glu Arg Pro Arg Phe Tyr1 5
1060210PRTHomo sapiens 602Phe Pro Arg Ile Asn Phe Phe Tyr Met Tyr1
5 1060310PRTHomo sapiens 603Val Pro Met Tyr Glu Glu Phe Arg Lys
Met1 5 1060410PRTHomo sapiens 604Asn Pro Ala Trp Trp His Gly Gln
Pro Met1 5 1060510PRTHomo sapiens 605Tyr Pro Thr Lys Thr Phe Pro
Asn His Tyr1 5 1060610PRTHomo sapiens 606Val Pro Phe Glu Glu Arg
Ile Ser Thr Leu1 5 1060710PRTHomo sapiens 607Cys Pro Gly Trp Leu
Asp Val Leu Pro Phe1 5 1060810PRTHomo sapiens 608Val Pro Gln Leu
Gly Asp Thr Ser Pro Leu1 5 1060910PRTHomo sapiens 609Ala Pro Asn
Asn Gly Thr His Gly Ser Leu1 5 1061010PRTHomo sapiens 610Cys Pro
His Leu Gln Asn Ser Thr Gln Leu1 5 1061110PRTHomo sapiens 611Phe
Ser Met Asp Gly Phe Arg Ala Glu Tyr1 5 1061210PRTHomo sapiens
612Ser Ser Lys Glu Gln Asn Asn Pro Ala Trp1 5 1061310PRTHomo
sapiens 613Ile Ala Arg Val Arg Asp Val Glu Leu Leu1 5
1061410PRTHomo sapiens 614Lys Pro Asp Gln His Phe Lys Pro Tyr Leu1
5 1061510PRTHomo sapiens 615Thr Pro Asp Leu Pro Lys Arg Leu His
Tyr1 5 1061610PRTHomo sapiens 616Gly Ser Phe Pro Ser Ile Tyr Met
Pro Tyr1 5 1061710PRTHomo sapiens 617Ala Ser Asn Arg Thr Ser Asp
Ser Gln Tyr1 5 1061810PRTHomo
sapiens 618Val Ser Gly Phe Gly Lys Ala Met Arg Met1 5
1061910PRTHomo sapiens 619Glu Ser Leu Asp Cys Phe Cys Pro His Leu1
5 1062010PRTHomo sapiens 620Val Ser Gly Pro Ile Phe Asp Tyr Asn
Tyr1 5 1062110PRTHomo sapiens 621Glu Ser His Gly Ile Ile Asp Asn
Asn Met1 5 1062210PRTHomo sapiens 622Gln Ser Gln Cys Pro Glu Gly
Phe Asp Leu1 5 1062310PRTHomo sapiens 623Cys Asn Lys Met Glu Tyr
Met Thr Asp Tyr1 5 1062410PRTHomo sapiens 624Ala Met Arg Met Pro
Met Trp Ser Ser Tyr1 5 1062510PRTHomo sapiens 625Arg Ala His Asn
Ile Pro His Asp Phe Phe1 5 1062610PRTHomo sapiens 626Asp Ala Pro
Asp Glu Ile Thr Lys His Leu1 5 1062710PRTHomo sapiens 627Gly Pro
Ser Phe Lys Glu Lys Thr Glu Val1 5 1062810PRTHomo sapiens 628Leu
Pro Lys Arg Leu His Tyr Ala Lys Asn1 5 1062910PRTHomo sapiens
629Lys Ala Leu Gln Val Val Asp His Ala Phe1 5 1063010PRTHomo
sapiens 630Leu Gln Lys Lys Asp Cys Cys Ala Asp Tyr1 5
1063110PRTHomo sapiens 631Leu Ser Cys Arg Lys Pro Asp Gln His Phe1
5 1063210PRTHomo sapiens 632Ile Ser Thr Leu Leu Lys Trp Leu Asp
Leu1 5 1063310PRTHomo sapiens 633Lys Ser Val Cys Gln Gly Glu Thr
Ser Trp1 5 1063410PRTHomo sapiens 634Phe Ser Val Cys Gly Phe Ala
Asn Pro Leu1 5 1063510PRTHomo sapiens 635Leu Gln Lys Asn Val Asp
His Cys Leu Leu1 5 1063610PRTHomo sapiens 636Glu Pro Phe Glu Asn
Ile Glu Val Tyr Asn1 5 1063710PRTHomo sapiens 637Lys Met Trp Asp
Tyr Phe His Ser Val Leu1 5 1063810PRTHomo sapiens 638Lys Cys Phe
Asp Ala Ser Phe Arg Gly Leu1 5 1063910PRTHomo sapiens 639Arg Thr
Ser Asp Ser Gln Tyr Asp Ala Leu1 5 1064010PRTHomo sapiens 640Pro
Pro Ser Glu Ser Gln Lys Cys Ser Phe1 5 1064110PRTHomo sapiens
641Lys Thr Cys Gly Ile His Ser Lys Tyr Met1 5 1064210PRTHomo
sapiens 642Thr Cys Val Glu Ser Thr Arg Ile Trp Met1 5
1064310PRTHomo sapiens 643Ile Pro His Asp Phe Phe Ser Phe Asn Ser1
5 1064410PRTHomo sapiens 644Leu Pro Thr Glu Ser Leu Asp Cys Phe
Cys1 5 1064510PRTHomo sapiens 645Val Pro Ile Pro Thr His Tyr Phe
Val Val1 5 1064610PRTHomo sapiens 646Lys Ala Glu Arg Pro Arg Phe
Tyr Thr Met1 5 1064710PRTHomo sapiens 647Val Ser Glu Ile Leu Gln
Leu Lys Thr Tyr1 5 1064810PRTHomo sapiens 648Ala Cys Lys Asp Arg
Gly Asp Cys Cys Trp1 5 1064910PRTHomo sapiens 649Lys Asn Val Arg
Ile Asp Lys Val His Leu1 5 1065010PRTHomo sapiens 650Ile Ala Cys
Ile Val Leu Leu Ala Leu Leu1 5 106519PRTHomo sapiens 651Asn Met Tyr
Asp Val Asn Leu Asn Lys1 56529PRTHomo sapiens 652Gly Leu Gly Leu
Arg Lys Leu Glu Lys1 56539PRTHomo sapiens 653Gly Met Asp Gln Thr
Tyr Cys Asn Lys1 56549PRTHomo sapiens 654Phe Leu Tyr Pro Pro Ala
Ser Asn Arg1 56559PRTHomo sapiens 655Leu Leu Lys Trp Leu Asp Leu
Pro Lys1 56569PRTHomo sapiens 656Tyr Met Tyr Glu Gly Pro Ala Pro
Arg1 56579PRTHomo sapiens 657Lys Met Trp Asp Tyr Phe His Ser Val1
56589PRTHomo sapiens 658Tyr Met Arg Ala Met Tyr Pro Thr Lys1
56599PRTHomo sapiens 659Phe Leu Ala His Gly Pro Ser Phe Lys1
56609PRTHomo sapiens 660Thr Leu Ala Thr Glu Gln Pro Val Lys1
56619PRTHomo sapiens 661Ser Met Asp Gly Phe Arg Ala Glu Tyr1
56629PRTHomo sapiens 662Leu Met Pro Asn Ile Asn Lys Leu Lys1
56639PRTHomo sapiens 663Gly Leu Tyr Pro Glu Ser His Gly Ile1
56649PRTHomo sapiens 664Lys Leu Glu Lys Gln Gly Ser Cys Arg1
56659PRTHomo sapiens 665Val Leu Pro Phe Ile Ile Pro His Arg1
56669PRTHomo sapiens 666Gln Leu Lys Thr Tyr Leu Pro Thr Phe1
56679PRTHomo sapiens 667Tyr Leu Thr Pro Asp Leu Pro Lys Arg1
56689PRTHomo sapiens 668Met Leu Met Glu Gly Leu Lys Gln Arg1
56699PRTHomo sapiens 669Lys Met Glu Tyr Met Thr Asp Tyr Phe1
56709PRTHomo sapiens 670Leu Leu Ile Lys His Ala Thr Glu Arg1
56719PRTHomo sapiens 671Trp Leu Asp Leu Pro Lys Ala Glu Arg1
56729PRTHomo sapiens 672Ile Leu Phe Ser Met Asp Gly Phe Arg1
56739PRTHomo sapiens 673Gly Leu Gly Leu Gly Leu Gly Leu Arg1
56749PRTHomo sapiens 674Tyr Met Thr Asp Tyr Phe Pro Arg Ile1
56759PRTHomo sapiens 675Ser Thr Arg Ile Trp Met Cys Asn Lys1
56769PRTHomo sapiens 676Asn Leu Val Pro Met Tyr Glu Glu Phe1
56779PRTHomo sapiens 677Val Val Ser Gly Pro Ile Phe Asp Tyr1
56789PRTHomo sapiens 678Arg Leu His Tyr Ala Lys Asn Val Arg1
56799PRTHomo sapiens 679Tyr Leu Tyr Thr Trp Asp Thr Leu Met1
56809PRTHomo sapiens 680Ala Leu Gln Val Val Asp His Ala Phe1
56819PRTHomo sapiens 681Arg Val Pro Pro Ser Glu Ser Gln Lys1
56829PRTHomo sapiens 682His Leu Phe Val Asp Gln Gln Trp Leu1
56839PRTHomo sapiens 683Asn Leu Met Cys Asp Leu Leu Arg Ile1
56849PRTHomo sapiens 684Lys Cys Ser Phe Tyr Leu Ala Asp Lys1
56859PRTHomo sapiens 685Glu Leu Leu Thr Gly Leu Asp Phe Tyr1
56869PRTHomo sapiens 686Thr Leu Met Pro Asn Ile Asn Lys Leu1
56879PRTHomo sapiens 687Lys Thr Phe Pro Asn His Tyr Thr Ile1
56889PRTHomo sapiens 688Gln Thr Tyr Cys Asn Lys Met Glu Tyr1
56899PRTHomo sapiens 689Ile Val Arg Asn Leu Ser Cys Arg Lys1
56909PRTHomo sapiens 690Asn Val Glu Ser Cys Pro Glu Gly Lys1
56919PRTHomo sapiens 691Tyr Leu Pro Thr Phe Glu Thr Thr Ile1
56929PRTHomo sapiens 692Asn Ile Pro His Asp Phe Phe Ser Phe1
56939PRTHomo sapiens 693Ser Met Glu Ala Ile Phe Leu Ala His1
56949PRTHomo sapiens 694Gly Leu Lys Ala Ala Thr Tyr Phe Trp1
56959PRTHomo sapiens 695Gly Leu Asp Phe Tyr Gln Asp Lys Val1
56969PRTHomo sapiens 696Leu Leu Val Ile Met Ser Leu Gly Leu1
56979PRTHomo sapiens 697Asn Leu His Asn Cys Val Asn Ile Ile1
56989PRTHomo sapiens 698Ser Leu Asp Cys Phe Cys Pro His Leu1
56999PRTHomo sapiens 699Trp Leu Asp Val Leu Pro Phe Ile Ile1
57009PRTHomo sapiens 700Val Val Leu Thr Ser Cys Lys Asn Lys1
57014PRTHomo sapiens 701Asn Phe Ser Leu17024PRTHomo sapiens 702Asn
Gly Ser Phe17034PRTHomo sapiens 703Asn Gly Ser Val17044PRTHomo
sapiens 704Asn Leu Ser Cys17054PRTHomo sapiens 705Asn Gly Thr
His17064PRTHomo sapiens 706Asn Ser Thr Gln17074PRTHomo sapiens
707Asn Leu Thr Gln17084PRTHomo sapiens 708Asn Ile Thr
His17094PRTHomo sapiens 709Asn Arg Thr Ser17104PRTHomo sapiens
710Asn Lys Ser His17114PRTHomo sapiens 711Lys Lys Asn
Thr17124PRTHomo sapiens 712Thr Cys Val Glu17134PRTHomo sapiens
713Thr Arg Leu Glu17144PRTHomo sapiens 714Ser Cys Ser
Asp17154PRTHomo sapiens 715Ser Trp Leu Glu17164PRTHomo sapiens
716Ser Ser Lys Glu17174PRTHomo sapiens 717Ser Phe Lys
Glu17184PRTHomo sapiens 718Thr Glu Val Glu17194PRTHomo sapiens
719Ser His Ala Glu17204PRTHomo sapiens 720Thr Gln Leu
Glu17214PRTHomo sapiens 721Thr Gln Glu Glu17224PRTHomo sapiens
722Thr Val Pro Asp17234PRTHomo sapiens 723Ser Gln Tyr
Asp17244PRTHomo sapiens 724Thr Asn Val Glu17254PRTHomo sapiens
725Ser Cys Pro Glu17264PRTHomo sapiens 726Thr Gly Leu
Asp17277PRTHomo sapiens 727Arg Thr Ser Asp Ser Gln Tyr1
57286PRTHomo sapiens 728Gly Leu Gly Leu Gly Leu1 57296PRTHomo
sapiens 729Gly Leu Gly Leu Gly Leu1 57306PRTHomo sapiens 730Gly Leu
Gly Leu Gly Leu1 57316PRTHomo sapiens 731Gly Leu Gly Leu Gly Leu1
57326PRTHomo sapiens 732Gly Leu Glu Asn Cys Arg1 57336PRTHomo
sapiens 733Gly Ile Ile Asp Asn Asn1 57346PRTHomo sapiens 734Gly Leu
Lys Ala Ala Thr1 57356PRTHomo sapiens 735Gly Ser Glu Val Ala Ile1
57366PRTHomo sapiens 736Gly Ser Phe Pro Ser Ile1 57376PRTHomo
sapiens 737Gly Gly Pro Val Ser Ala1 57386PRTHomo sapiens 738Gly Met
Asp Gln Thr Tyr1 57393PRTHomo sapiens 739Arg Gly Asp174021PRTHomo
sapiens 740Cys Arg Cys Asp Val Ala Cys Lys Asp Arg Gly Asp Cys Cys
Trp Asp1 5 10 15Phe Glu Asp Thr Cys 2074121PRTHomo sapiens 741Cys
Ser Cys Ser Asp Asp Cys Leu Gln Lys Lys Asp Cys Cys Ala Asp1 5 10
15Tyr Lys Ser Val Cys 20742182DNAHomo sapiensmisc_feature19n =
Unknown 742gatcacacat taggttatng acttcaatat tttcaaatgg ttcaacttca
gtcttctctt 60taaaactggg tccatgtgcc aagaaagata gcctccatgc tcctaaactc
attgttataa 120ccatggttgc ctcctccaca atttgtattt gatttactcc
taacagccag ccactgttga 180tc 182743875PRTHomo sapiens 743Met Glu Ser
Thr Leu Thr Leu Ala Thr Glu Gln Pro Val Lys Lys Asn1 5 10 15Thr Leu
Lys Lys Tyr Lys Ile Ala Cys Ile Val Leu Leu Ala Leu Leu 20 25 30Val
Ile Met Ser Leu Gly Leu Gly Leu Gly Leu Gly Leu Arg Lys Leu 35 40
45Glu Lys Gln Gly Ser Cys Arg Lys Lys Cys Phe Asp Ala Ser Phe Arg
50 55 60Gly Leu Glu Asn Cys Arg Cys Asp Val Ala Cys Lys Asp Arg Gly
Asp65 70 75 80Cys Cys Trp Asp Phe Glu Asp Thr Cys Val Glu Ser Thr
Arg Ile Trp 85 90 95Met Cys Asn Lys Phe Arg Cys Gly Glu Thr Arg Leu
Glu Ala Ser Leu 100 105 110Cys Ser Cys Ser Asp Asp Cys Leu Gln Lys
Lys Asp Cys Cys Ala Asp 115 120 125Tyr Lys Ser Val Cys Gln Gly Glu
Thr Ser Trp Leu Glu Glu Asn Cys 130 135 140Asp Thr Ala Gln Gln Ser
Gln Cys Pro Glu Gly Phe Asp Leu Pro Pro145 150 155 160Val Ile Leu
Phe Ser Met Asp Gly Phe Arg Ala Glu Tyr Leu Tyr Thr 165 170 175Trp
Asp Thr Leu Met Pro Asn Ile Asn Lys Leu Lys Thr Cys Gly Ile 180 185
190His Ser Lys Tyr Met Arg Ala Met Tyr Pro Thr Lys Thr Phe Pro Asn
195 200 205His Tyr Thr Ile Val Thr Gly Leu Tyr Pro Glu Ser His Gly
Ile Ile 210 215 220Asp Asn Asn Met Tyr Asp Val Asn Leu Asn Lys Asn
Phe Ser Leu Ser225 230 235 240Ser Lys Glu Gln Asn Asn Pro Ala Trp
Trp His Gly Gln Pro Met Trp 245 250 255Leu Thr Ala Met Tyr Gln Gly
Leu Lys Ala Ala Thr Tyr Phe Trp Pro 260 265 270Gly Ser Glu Val Ala
Ile Asn Gly Ser Phe Pro Ser Ile Tyr Met Pro 275 280 285Tyr Asn Gly
Ser Val Pro Phe Glu Glu Arg Ile Ser Thr Leu Leu Lys 290 295 300Trp
Leu Asp Leu Pro Lys Ala Glu Arg Pro Arg Phe Tyr Thr Met Tyr305 310
315 320Phe Glu Glu Pro Asp Ser Ser Gly His Ala Gly Gly Pro Val Ser
Ala 325 330 335Arg Val Ile Lys Ala Leu Gln Val Val Asp His Ala Phe
Gly Met Leu 340 345 350Met Glu Gly Leu Lys Gln Arg Asn Leu His Asn
Cys Val Asn Ile Ile 355 360 365Leu Leu Ala Asp His Gly Met Asp Gln
Thr Tyr Cys Asn Lys Met Glu 370 375 380Tyr Met Thr Asp Tyr Phe Pro
Arg Ile Asn Phe Phe Tyr Met Tyr Glu385 390 395 400Gly Pro Ala Pro
Arg Ile Arg Ala His Asn Ile Pro His Asp Phe Phe 405 410 415Ser Phe
Asn Ser Glu Glu Ile Val Arg Asn Leu Ser Cys Arg Lys Pro 420 425
430Asp Gln His Phe Lys Pro Tyr Leu Thr Pro Asp Leu Pro Lys Arg Leu
435 440 445His Tyr Ala Lys Asn Val Arg Ile Asp Lys Val His Leu Phe
Val Asp 450 455 460Gln Gln Trp Leu Ala Val Arg Ser Lys Ser Asn Thr
Asn Cys Gly Gly465 470 475 480Gly Asn His Gly Tyr Asn Asn Glu Phe
Arg Ser Met Glu Ala Ile Phe 485 490 495Leu Ala His Gly Pro Ser Phe
Lys Glu Lys Thr Glu Val Glu Pro Phe 500 505 510Glu Asn Ile Glu Val
Tyr Asn Leu Met Cys Asp Leu Leu Arg Ile Gln 515 520 525Pro Ala Pro
Asn Asn Gly Thr His Gly Ser Leu Asn His Leu Leu Lys 530 535 540Val
Pro Phe Tyr Glu Pro Ser His Ala Glu Glu Val Ser Lys Phe Ser545 550
555 560Val Cys Gly Phe Ala Asn Pro Leu Pro Thr Glu Ser Leu Asp Cys
Phe 565 570 575Cys Pro His Leu Gln Asn Ser Thr Gln Leu Glu Gln Val
Asn Gln Met 580 585 590Leu Asn Leu Thr Gln Glu Glu Ile Thr Ala Thr
Val Lys Val Asn Leu 595 600 605Pro Phe Gly Arg Pro Arg Val Leu Gln
Lys Asn Val Asp His Cys Leu 610 615 620Leu Tyr His Arg Glu Tyr Val
Ser Gly Phe Gly Lys Ala Met Arg Met625 630 635 640Pro Met Trp Ser
Ser Tyr Thr Val Pro Gln Leu Gly Asp Thr Ser Pro 645 650 655Leu Pro
Pro Thr Val Pro Asp Cys Leu Arg Ala Asp Val Arg Val Pro 660 665
670Pro Ser Glu Ser Gln Lys Cys Ser Phe Tyr Leu Ala Asp Lys Asn Ile
675 680 685Thr His Gly Phe Leu Tyr Pro Pro Ala Ser Asn Arg Thr Ser
Asp Ser 690 695 700Gln Tyr Asp Ala Leu Ile Thr Ser Asn Leu Val Pro
Met Tyr Glu Glu705 710 715 720Phe Arg Lys Met Trp Asp Tyr Phe His
Ser Val Leu Leu Ile Lys His 725 730 735Ala Thr Glu Arg Asn Gly Val
Asn Val Val Ser Gly Pro Ile Phe Asp 740 745 750Tyr Asn Tyr Asp Gly
His Phe Asp Ala Pro Asp Glu Ile Thr Lys His 755 760 765Leu Ala Asn
Thr Asp Val Pro Ile Pro Thr His Tyr Phe Val Val Leu 770 775 780Thr
Ser Cys Lys Asn Lys Ser His Thr Pro Glu Asn Cys Pro Gly Trp785 790
795 800Leu Asp Val Leu Pro Phe Ile Ile Pro His Arg Pro Thr Asn Val
Glu 805 810 815Ser Cys Pro Glu Gly Lys Pro Glu Ala Leu Trp Val Glu
Glu Arg Phe 820 825 830Thr Ala His Ile Ala Arg Val Arg Asp Val Glu
Leu Leu Thr Gly Leu 835 840 845Asp Phe Tyr Gln Asp Lys Val Gln Pro
Val Ser Glu Ile Leu Gln Leu 850 855 860Lys Thr Tyr Leu Pro Thr Phe
Glu Thr Thr Ile865 870 8757443858DNAHomo sapiens 744ctactttatt
ctgataaaac aggtctatgc agctaccagg acaatggaat ctacgttgac 60tttagcaacg
gaacaacctg ttaagaagaa cactcttaag aaatataaaa tagcttgcat
120tgttcttctt gctttgctgg tgatcatgtc acttggatta ggcctggggc
ttggactcag 180gaaactggaa aagcaaggca gctgcaggaa gaagtgcttt
gatgcatcat ttagaggact 240ggagaactgc cggtgtgatg tggcatgtaa
agaccgaggt gattgctgct gggattttga 300agacacctgt gtggaatcaa
ctcgaatatg gatgtgcaat aaatttcgtt gtggagagac 360cagattagag
gccagccttt gctcttgttc agatgactgt ttgcagaaga aagattgctg
420tgctgactat aagagtgttt gccaaggaga aacctcatgg ctggaagaaa
actgtgacac 480agcccagcag tctcagtgcc cagaagggtt tgacctgcca
ccagttatct tgttttctat 540ggatggattt agagctgaat atttatacac
atgggatact ttaatgccaa atatcaataa 600actgaaaaca tgtggaattc
attcaaaata catgagagct atgtatccta ccaaaacctt 660cccaaatcat
tacaccattg tcacgggctt gtatccagag tcacatggca tcattgacaa
720taatatgtat gatgtaaatc tcaacaagaa tttttcactt tcttcaaagg
aacaaaataa 780tccagcctgg tggcatgggc aaccaatgtg gctgacagca
atgtatcaag gtttaaaagc 840cgctacctac ttttggcccg gatcagaagt
ggctataaat ggctcctttc cttccatata 900catgccttac aacggaagtg
tcccatttga agagaggatt tctacactgt taaaatggct 960ggacctgccc
aaagctgaaa gacccaggtt ttataccatg tattttgaag aacctgattc
1020ctctggacat gcaggtggac cagtcagtgc cagagtaatt aaagccttac
aggtagtaga 1080tcatgctttt gggatgttga tggaaggcct gaagcagcgg
aatttgcaca actgtgtcaa 1140tatcatcctt ctggctgacc atggaatgga
ccagacttat tgtaacaaga tggaatacat 1200gactgattat tttcccagaa
taaacttctt ctacatgtac gaagggcctg ccccccgcat 1260ccgagctcat
aatatacctc atgacttttt tagttttaat tctgaggaaa ttgttagaaa
1320cctcagttgc cgaaaacctg atcagcattt caagccctat ttgactcctg
atttgccaaa 1380gcgactgcac tatgccaaga acgtcagaat cgacaaagtt
catctctttg tggatcaaca 1440gtggctggct gttaggagta aatcaaatac
aaattgtgga ggaggcaacc atggttataa 1500caatgagttt aggagcatgg
aggctatctt tctggcacat ggacccagtt ttaaagagaa 1560gactgaagtt
gaaccatttg aaaatattga agtctataac ctaatgtgtg atcttctacg
1620cattcaacca gcaccaaaca atggaaccca
tggtagttta aaccatcttc tgaaggtgcc 1680tttttatgag ccatcccatg
cagaggaggt gtcaaagttt tctgtttgtg gctttgctaa 1740tccattgccc
acagagtctc ttgactgttt ctgccctcac ctacaaaata gtactcagct
1800ggaacaagtg aatcagatgc taaatctcac ccaagaagaa ataacagcaa
cagtgaaagt 1860aaatttgcca tttgggaggc ctagggtact gcagaagaac
gtggaccact gtctccttta 1920ccacagggaa tatgtcagtg gatttggaaa
agctatgagg atgcccatgt ggagttcata 1980cacagtcccc cagttgggag
acacatcgcc tctgcctccc actgtcccag actgtctgcg 2040ggctgatgtc
agggttcctc cttctgagag ccaaaaatgt tccttctatt tagcagacaa
2100gaatatcacc cacggcttcc tctatcctcc tgccagcaat agaacatcag
atagccaata 2160tgatgcttta attactagca atttggtacc tatgtatgaa
gaattcagaa aaatgtggga 2220ctacttccac agtgttcttc ttataaaaca
tgccacagaa agaaatggag taaatgtggt 2280tagtggacca atatttgatt
ataattatga tggccatttt gatgctccag atgaaattac 2340caaacattta
gccaacactg atgttcccat cccaacacac tactttgtgg tgctgaccag
2400ttgtaaaaac aagagccaca caccggaaaa ctgccctggg tggctggatg
tcctaccctt 2460tatcatccct caccgaccta ccaacgtgga gagctgtcct
gaaggtaaac cagaagctct 2520ttgggttgaa gaaagattta cagctcacat
tgcccgggtc cgtgatgtag aacttctcac 2580tgggcttgac ttctatcagg
ataaagtgca gcctgtctct gaaattttgc aactaaagac 2640atatttacca
acatttgaaa ccactattta acttaataat gtctacttaa tatataattt
2700actgtataaa gtaattttgg caaaatataa gtgatttttt ctggagaatt
gtaaaataaa 2760gttttctatt tttccttaaa aaaaaaaccg gaattccggg
cttgggaggc tgaggcagga 2820gactcgcttg aacccgggag gcagaggttg
cagtgagcca agattgcgcc attgcactcc 2880agagcctggg tgacagagca
agactacatc tcaaaaaata aataaataaa ataaaagtaa 2940caataaaaat
aaaaagaaca gcagagagaa tgagcaagga gaaatgtcac aaactattgc
3000aaaatactgt tacactgggt tggctctcca agaagatact ggaatctctt
cagccatttg 3060cttttcagaa gtagaaacca gcaaaccacc tctaagcgga
gaacatacga ttctttatta 3120agtagctctg gggaaggaaa gaataaaagt
tgatagctcc ctgattggga aaaaatgcac 3180aattaataaa gaatgaagat
gaaagaaagc atgcttatgt tgtaacacaa aaaaaattca 3240caaacgttgg
tggaaggaaa acagtataga aaacattact ttaactaaaa gctggaaaaa
3300ttttcagttg ggatgcgact gacaaaaaga acgggatttc caggcataaa
gttggcgtga 3360gctacagagg gcaccatgtg gctcagtgga agacccttca
agattcaaag ttccatttga 3420cagagcaaag gcacttcgca aggagaaggg
tttaaattat gggtccaaaa gccaagtggt 3480aaagcgagca atttgcagca
taactgcttc tcctagacag ggctgagtgg gcaaaatacg 3540acagtacaca
cagtgactat tagccactgc cagaaacagg ctgaacagcc ctgggagaca
3600agggaaggca ggtggtggga gttgttcatg gagagaaagg agagttttag
aaccagcaca 3660tccactggag atgctgggcc accagacccc tcccagtcaa
taaagtctgg tgcctcattt 3720gatctcagcc tcatcatgac cctggagaga
ccctgatacc atctgccagt ccccgacagc 3780ttaggcactc cttgccatca
acctgacccc ccgagtggtt ctccaggctc cctgccccac 3840ccattcaggc cggaattc
3858745875PRTHomo sapiens 745Met Glu Ser Thr Leu Thr Leu Ala Thr
Glu Gln Pro Val Lys Lys Asn1 5 10 15Thr Leu Lys Lys Tyr Lys Ile Ala
Cys Ile Val Leu Leu Ala Leu Leu 20 25 30Val Ile Met Ser Leu Gly Leu
Gly Leu Gly Leu Gly Leu Arg Lys Leu 35 40 45Glu Lys Gln Gly Ser Cys
Arg Lys Lys Cys Phe Asp Ala Ser Phe Arg 50 55 60Gly Leu Glu Asn Cys
Arg Cys Asp Val Ala Cys Lys Asp Arg Gly Asp65 70 75 80Cys Cys Trp
Asp Phe Glu Asp Thr Cys Val Glu Ser Thr Arg Ile Trp 85 90 95Met Cys
Asn Lys Phe Arg Cys Gly Glu Thr Arg Leu Glu Ala Ser Leu 100 105
110Cys Ser Cys Ser Asp Asp Cys Leu Gln Arg Lys Asp Cys Cys Ala Asp
115 120 125Tyr Lys Ser Val Cys Gln Gly Glu Thr Ser Trp Leu Glu Glu
Asn Cys 130 135 140Asp Thr Ala Gln Gln Ser Gln Cys Pro Glu Gly Phe
Asp Leu Pro Pro145 150 155 160Val Ile Leu Phe Ser Met Asp Gly Phe
Arg Ala Glu Tyr Leu Tyr Thr 165 170 175Trp Asp Thr Leu Met Pro Asn
Ile Asn Lys Leu Lys Thr Cys Gly Ile 180 185 190His Ser Lys Tyr Met
Arg Ala Met Tyr Pro Thr Lys Thr Phe Pro Asn 195 200 205His Tyr Thr
Ile Val Thr Gly Leu Tyr Pro Glu Ser His Gly Ile Ile 210 215 220Asp
Asn Asn Met Tyr Asp Val Asn Leu Asn Lys Asn Phe Ser Leu Ser225 230
235 240Ser Lys Glu Gln Asn Asn Pro Ala Trp Trp His Gly Gln Pro Met
Trp 245 250 255Leu Thr Ala Met Tyr Gln Gly Leu Lys Ala Ala Thr Tyr
Phe Trp Pro 260 265 270Gly Ser Glu Val Ala Ile Asn Gly Ser Phe Pro
Ser Ile Tyr Met Pro 275 280 285Tyr Asn Gly Ser Val Pro Phe Glu Glu
Arg Ile Ser Thr Leu Leu Lys 290 295 300Trp Leu Asp Leu Pro Lys Ala
Glu Arg Pro Arg Phe Tyr Thr Met Tyr305 310 315 320Phe Glu Glu Pro
Asp Ser Ser Gly His Ala Gly Gly Pro Val Ser Ala 325 330 335Arg Val
Ile Lys Ala Leu Gln Val Val Asp His Ala Phe Gly Met Leu 340 345
350Met Glu Gly Leu Lys Gln Arg Asn Leu His Asn Cys Val Asn Ile Ile
355 360 365Leu Leu Ala Asp His Gly Met Asp Gln Thr Tyr Cys Asn Lys
Met Glu 370 375 380Tyr Met Thr Asp Tyr Phe Pro Arg Ile Asn Phe Phe
Tyr Met Tyr Glu385 390 395 400Gly Pro Ala Pro Arg Ile Arg Ala His
Asn Ile Pro His Asp Phe Phe 405 410 415Ser Phe Asn Ser Glu Glu Ile
Val Arg Asn Leu Ser Cys Arg Lys Pro 420 425 430Asp Gln His Phe Lys
Pro Tyr Leu Thr Pro Asp Leu Pro Lys Arg Leu 435 440 445His Tyr Ala
Lys Asn Val Arg Ile Asp Lys Val His Leu Phe Val Asp 450 455 460Gln
Gln Trp Leu Ala Val Arg Ser Lys Ser Asn Thr Asn Cys Gly Gly465 470
475 480Gly Asn His Gly Tyr Asn Asn Glu Phe Arg Ser Met Glu Ala Ile
Phe 485 490 495Leu Ala His Gly Pro Ser Phe Lys Glu Lys Thr Glu Val
Glu Pro Phe 500 505 510Glu Asn Ile Glu Val Tyr Asn Leu Met Cys Asp
Leu Leu Arg Ile Gln 515 520 525Pro Ala Pro Asn Asn Gly Thr His Gly
Ser Leu Asn His Leu Leu Lys 530 535 540Val Pro Phe Tyr Glu Pro Ser
His Ala Glu Glu Val Ser Lys Phe Ser545 550 555 560Val Cys Gly Phe
Ala Asn Pro Leu Pro Thr Glu Ser Leu Asp Cys Phe 565 570 575Cys Pro
His Leu Gln Asn Ser Thr Gln Leu Glu Gln Val Asn Gln Met 580 585
590Leu Asn Leu Thr Gln Glu Glu Ile Thr Ala Thr Val Lys Val Asn Leu
595 600 605Pro Phe Gly Arg Pro Arg Val Leu Gln Lys Asn Val Asp His
Cys Leu 610 615 620Leu Tyr His Arg Glu Tyr Val Ser Gly Phe Gly Lys
Ala Met Arg Met625 630 635 640Pro Met Trp Ser Ser Tyr Thr Val Pro
Gln Leu Gly Asp Thr Ser Pro 645 650 655Leu Pro Pro Thr Val Pro Asp
Cys Leu Arg Ala Asp Val Arg Val Pro 660 665 670Pro Ser Glu Ser Gln
Lys Cys Ser Phe Tyr Leu Ala Asp Lys Asn Ile 675 680 685Thr His Gly
Phe Leu Tyr Pro Pro Ala Ser Asn Arg Thr Ser Asp Ser 690 695 700Gln
Tyr Asp Ala Leu Ile Thr Ser Asn Leu Val Pro Met Tyr Glu Glu705 710
715 720Phe Arg Lys Met Trp Asp Tyr Phe His Ser Val Leu Leu Ile Lys
His 725 730 735Ala Thr Glu Arg Asn Gly Val Asn Val Val Ser Gly Pro
Ile Phe Asp 740 745 750Tyr Asn Tyr Asp Gly His Phe Asp Ala Pro Asp
Glu Ile Thr Lys His 755 760 765Leu Ala Asn Thr Asp Val Pro Ile Pro
Thr His Tyr Phe Val Val Leu 770 775 780Thr Ser Cys Lys Asn Lys Ser
His Thr Pro Glu Asn Cys Pro Gly Trp785 790 795 800Leu Asp Val Leu
Pro Phe Ile Ile Pro His Arg Pro Thr Asn Val Glu 805 810 815Ser Cys
Pro Glu Gly Lys Pro Glu Ala Leu Trp Val Glu Glu Arg Phe 820 825
830Thr Ala His Ile Ala Arg Val Arg Asp Val Glu Leu Leu Thr Gly Leu
835 840 845Asp Phe Tyr Gln Asp Lys Val Gln Pro Val Ser Glu Ile Leu
Gln Leu 850 855 860Lys Thr Tyr Leu Pro Thr Phe Glu Thr Thr Ile865
870 8757463858DNAHomo sapiens 746ctactttatt ctgataaaac aggtctatgc
agctaccagg acaatggaat ctacgttgac 60tttagcaacg gaacaacctg ttaagaagaa
cactcttaag aaatataaaa tagcttgcat 120tgttcttctt gctttgctgg
tgatcatgtc acttggatta ggcctggggc ttggactcag 180gaaactggaa
aagcaaggca gctgcaggaa gaagtgcttt gatgcatcat ttagaggact
240ggagaactgc cggtgtgatg tggcatgtaa agaccgaggt gattgctgct
gggattttga 300agacacctgt gtggaatcaa ctcgaatatg gatgtgcaat
aaatttcgtt gtggagagac 360cagattagag gccagccttt gctcttgttc
agatgactgt ttgcagagga aagattgctg 420tgctgactat aagagtgttt
gccaaggaga aacctcatgg ctggaagaaa actgtgacac 480agcccagcag
tctcagtgcc cagaagggtt tgacctgcca ccagttatct tgttttctat
540ggatggattt agagctgaat atttatacac atgggatact ttaatgccaa
atatcaataa 600actgaaaaca tgtggaattc attcaaaata catgagagct
atgtatccta ccaaaacctt 660cccaaatcat tacaccattg tcacgggctt
gtatccagag tcacatggca tcattgacaa 720taatatgtat gatgtaaatc
tcaacaagaa tttttcactt tcttcaaagg aacaaaataa 780tccagcctgg
tggcatgggc aaccaatgtg gctgacagca atgtatcaag gtttaaaagc
840cgctacctac ttttggcccg gatcagaagt ggctataaat ggctcctttc
cttccatata 900catgccttac aacggaagtg tcccatttga agagaggatt
tctacactgt taaaatggct 960ggacctgccc aaagctgaaa gacccaggtt
ttataccatg tattttgaag aacctgattc 1020ctctggacat gcaggtggac
cagtcagtgc cagagtaatt aaagccttac aggtagtaga 1080tcatgctttt
gggatgttga tggaaggcct gaagcagcgg aatttgcaca actgtgtcaa
1140tatcatcctt ctggctgacc atggaatgga ccagacttat tgtaacaaga
tggaatacat 1200gactgattat tttcccagaa taaacttctt ctacatgtac
gaagggcctg ccccccgcat 1260ccgagctcat aatatacctc atgacttttt
tagttttaat tctgaggaaa ttgttagaaa 1320cctcagttgc cgaaaacctg
atcagcattt caagccctat ttgactcctg atttgccaaa 1380gcgactgcac
tatgccaaga acgtcagaat cgacaaagtt catctctttg tggatcaaca
1440gtggctggct gttaggagta aatcaaatac aaattgtgga ggaggcaacc
atggttataa 1500caatgagttt aggagcatgg aggctatctt tctggcacat
ggacccagtt ttaaagagaa 1560gactgaagtt gaaccatttg aaaatattga
agtctataac ctaatgtgtg atcttctacg 1620cattcaacca gcaccaaaca
atggaaccca tggtagttta aaccatcttc tgaaggtgcc 1680tttttatgag
ccatcccatg cagaggaggt gtcaaagttt tctgtttgtg gctttgctaa
1740tccattgccc acagagtctc ttgactgttt ctgccctcac ctacaaaata
gtactcagct 1800ggaacaagtg aatcagatgc taaatctcac ccaagaagaa
ataacagcaa cagtgaaagt 1860aaatttgcca tttgggaggc ctagggtact
gcagaagaac gtggaccact gtctccttta 1920ccacagggaa tatgtcagtg
gatttggaaa agctatgagg atgcccatgt ggagttcata 1980cacagtcccc
cagttgggag acacatcgcc tctgcctccc actgtcccag actgtctgcg
2040ggctgatgtc agggttcctc cttctgagag ccaaaaatgt tccttctatt
tagcagacaa 2100gaatatcacc cacggcttcc tctatcctcc tgccagcaat
agaacatcag atagccaata 2160tgatgcttta attactagca atttggtacc
tatgtatgaa gaattcagaa aaatgtggga 2220ctacttccac agtgttcttc
ttataaaaca tgccacagaa agaaatggag taaatgtggt 2280tagtggacca
atatttgatt ataattatga tggccatttt gatgctccag atgaaattac
2340caaacattta gccaacactg atgttcccat cccaacacac tactttgtgg
tgctgaccag 2400ttgtaaaaac aagagccaca caccggaaaa ctgccctggg
tggctggatg tcctaccctt 2460tatcatccct caccgaccta ccaacgtgga
gagctgtcct gaaggtaaac cagaagctct 2520ttgggttgaa gaaagattta
cagctcacat tgcccgggtc cgtgatgtag aacttctcac 2580tgggcttgac
ttctatcagg ataaagtgca gcctgtctct gaaattttgc aactaaagac
2640atatttacca acatttgaaa ccactattta acttaataat gtctacttaa
tatataattt 2700actgtataaa gtaattttgg caaaatataa gtgatttttt
ctggagaatt gtaaaataaa 2760gttttctatt tttccttaaa aaaaaaaccg
gaattccggg cttgggaggc tgaggcagga 2820gactcgcttg aacccgggag
gcagaggttg cagtgagcca agattgcgcc attgcactcc 2880agagcctggg
tgacagagca agactacatc tcaaaaaata aataaataaa ataaaagtaa
2940caataaaaat aaaaagaaca gcagagagaa tgagcaagga gaaatgtcac
aaactattgc 3000aaaatactgt tacactgggt tggctctcca agaagatact
ggaatctctt cagccatttg 3060cttttcagaa gtagaaacca gcaaaccacc
tctaagcgga gaacatacga ttctttatta 3120agtagctctg gggaaggaaa
gaataaaagt tgatagctcc ctgattggga aaaaatgcac 3180aattaataaa
gaatgaagat gaaagaaagc atgcttatgt tgtaacacaa aaaaaattca
3240caaacgttgg tggaaggaaa acagtataga aaacattact ttaactaaaa
gctggaaaaa 3300ttttcagttg ggatgcgact gacaaaaaga acgggatttc
caggcataaa gttggcgtga 3360gctacagagg gcaccatgtg gctcagtgga
agacccttca agattcaaag ttccatttga 3420cagagcaaag gcacttcgca
aggagaaggg tttaaattat gggtccaaaa gccaagtggt 3480aaagcgagca
atttgcagca taactgcttc tcctagacag ggctgagtgg gcaaaatacg
3540acagtacaca cagtgactat tagccactgc cagaaacagg ctgaacagcc
ctgggagaca 3600agggaaggca ggtggtggga gttgttcatg gagagaaagg
agagttttag aaccagcaca 3660tccactggag atgctgggcc accagacccc
tcccagtcaa taaagtctgg tgcctcattt 3720gatctcagcc tcatcatgac
cctggagaga ccctgatacc atctgccagt ccccgacagc 3780ttaggcactc
cttgccatca acctgacccc ccgagtggtt ctccaggctc cctgccccac
3840ccattcaggc cggaattc 3858747875PRTHomo sapiens 747Met Glu Ser
Thr Leu Thr Leu Ala Thr Glu Gln Pro Val Lys Lys Asn1 5 10 15Thr Leu
Lys Lys Tyr Lys Ile Ala Cys Ile Val Leu Leu Ala Leu Leu 20 25 30Val
Ile Met Ser Leu Gly Leu Gly Leu Gly Leu Gly Leu Arg Lys Leu 35 40
45Glu Lys Gln Gly Ser Cys Arg Lys Lys Cys Phe Asp Ala Ser Phe Arg
50 55 60Gly Leu Glu Asn Cys Arg Cys Asp Val Ala Cys Lys Asp Arg Gly
Asp65 70 75 80Cys Cys Trp Asp Phe Glu Asp Thr Cys Val Glu Ser Thr
Arg Ile Trp 85 90 95Met Cys Asn Lys Phe Arg Cys Gly Glu Thr Arg Leu
Glu Ala Ser Leu 100 105 110Cys Ser Cys Ser Asp Asp Cys Leu Gln Lys
Lys Asp Cys Cys Ala Asp 115 120 125Tyr Lys Ser Val Cys Gln Gly Glu
Thr Ser Trp Leu Glu Glu Asn Cys 130 135 140Asp Thr Ala Gln Gln Ser
Gln Cys Pro Glu Gly Phe Asp Leu Pro Pro145 150 155 160Val Ile Leu
Phe Ser Met Asp Gly Phe Arg Ala Glu Tyr Leu Tyr Thr 165 170 175Trp
Asp Thr Leu Met Pro Asn Ile Asn Lys Leu Lys Thr Cys Gly Ile 180 185
190His Ser Lys Tyr Met Arg Ala Met Tyr Pro Thr Lys Thr Phe Pro Asn
195 200 205His Tyr Thr Ile Val Thr Gly Leu Tyr Pro Glu Ser His Gly
Ile Ile 210 215 220Asp Asn Asn Met Tyr Asp Val Asn Leu Asn Lys Asn
Phe Ser Leu Ser225 230 235 240Ser Lys Glu Gln Asn Asn Pro Ala Trp
Trp His Gly Gln Pro Met Trp 245 250 255Leu Thr Ala Met Tyr Gln Gly
Leu Lys Ala Ala Thr Tyr Phe Trp Pro 260 265 270Gly Ser Glu Val Ala
Ile Asn Gly Ser Phe Pro Ser Ile Tyr Met Pro 275 280 285Tyr Asn Gly
Ser Val Pro Phe Glu Glu Arg Ile Ser Thr Leu Leu Lys 290 295 300Trp
Leu Asp Leu Pro Lys Ala Glu Arg Pro Arg Phe Tyr Thr Met Tyr305 310
315 320Phe Glu Glu Pro Asp Ser Ser Gly His Ala Gly Gly Pro Val Ser
Ala 325 330 335Arg Val Ile Lys Ala Leu Gln Val Val Asp His Ala Phe
Gly Met Leu 340 345 350Met Glu Gly Leu Lys Gln Arg Asn Leu His Asn
Cys Val Asn Ile Ile 355 360 365Leu Leu Ala Asp His Gly Met Asp Gln
Thr Tyr Cys Asn Lys Met Glu 370 375 380Tyr Met Thr Asp Tyr Phe Pro
Arg Ile Asn Phe Phe Tyr Met Tyr Glu385 390 395 400Gly Pro Ala Pro
Arg Ile Arg Ala His Asn Ile Pro His Asp Phe Phe 405 410 415Ser Phe
Asn Ser Glu Glu Ile Val Arg Asn Leu Ser Cys Arg Lys Pro 420 425
430Asp Gln His Phe Lys Pro Tyr Leu Thr Pro Asp Leu Pro Lys Arg Leu
435 440 445His Tyr Ala Lys Asn Val Arg Ile Asp Lys Val His Leu Phe
Val Asp 450 455 460Gln Gln Trp Leu Ala Val Arg Ser Lys Ser Asn Thr
Asn Cys Gly Gly465 470 475 480Gly Asn His Gly Tyr Asn Asn Glu Phe
Arg Ser Met Glu Ala Ile Phe 485 490 495Leu Ala His Gly Pro Ser Phe
Lys Glu Lys Thr Glu Val Glu Pro Phe 500 505 510Glu Asn Ile Glu Val
Tyr Asn Leu Met Cys Asp Leu Leu Arg Ile Gln 515 520 525Pro Ala Pro
Asn Asn Gly Thr His Gly Ser Leu Asn His Leu Leu Lys 530 535 540Val
Pro Phe Tyr Glu Pro Ser His Ala Glu Glu Val Ser Lys Phe Ser545 550
555 560Val Cys Gly Phe Ala Asn Pro Leu Pro Thr Glu Ser Leu Asp Cys
Phe 565 570 575Cys Pro His Leu
Gln Asn Ser Thr Gln Leu Glu Gln Val Asn Gln Met 580 585 590Leu Asn
Leu Thr Gln Glu Glu Ile Thr Ala Thr Val Lys Val Asn Leu 595 600
605Pro Phe Gly Arg Pro Arg Val Leu Gln Lys Asn Val Asp His Cys Leu
610 615 620Leu Tyr His Arg Glu Tyr Val Ser Gly Phe Gly Lys Ala Met
Arg Met625 630 635 640Pro Met Trp Ser Ser Tyr Thr Val Pro Gln Leu
Gly Asp Thr Ser Pro 645 650 655Leu Pro Pro Thr Val Pro Asp Cys Leu
Arg Ala Asp Val Arg Val Pro 660 665 670Pro Ser Glu Ser Gln Lys Cys
Ser Phe Tyr Leu Ala Asp Lys Asn Ile 675 680 685Thr His Gly Phe Leu
Tyr Pro Pro Ala Ser Asn Arg Thr Ser Asp Ser 690 695 700Gln Tyr Asp
Ala Leu Ile Thr Ser Asn Leu Val Pro Met Tyr Glu Glu705 710 715
720Phe Arg Lys Met Trp Asp Tyr Phe His Ser Val Leu Leu Ile Lys His
725 730 735Ala Thr Glu Arg Asn Gly Val Asn Val Val Ser Gly Pro Ile
Phe Asp 740 745 750Tyr Asn Tyr Asp Gly His Phe Asp Ala Pro Asp Glu
Ile Thr Lys His 755 760 765Leu Ala Asn Thr Asp Val Pro Ile Pro Thr
His Tyr Phe Val Val Leu 770 775 780Thr Ser Cys Lys Asn Lys Ser His
Thr Pro Glu Asn Cys Pro Gly Trp785 790 795 800Leu Asp Val Leu Pro
Phe Ile Ile Pro His Arg Pro Thr Asn Val Glu 805 810 815Ser Cys Pro
Glu Gly Lys Pro Glu Ala Leu Trp Val Glu Glu Arg Phe 820 825 830Thr
Ala His Ile Ala Arg Val Arg Asp Val Glu Leu Leu Thr Gly Leu 835 840
845Asp Phe Tyr Gln Asp Lys Val Gln Pro Val Ser Glu Ile Leu Gln Leu
850 855 860Lys Thr Tyr Leu Pro Thr Phe Glu Thr Thr Ile865 870
875748875PRTHomo sapiens 748Met Glu Ser Thr Leu Thr Leu Ala Thr Glu
Gln Pro Val Lys Lys Asn1 5 10 15Thr Leu Lys Lys Tyr Lys Ile Ala Cys
Ile Val Leu Leu Ala Leu Leu 20 25 30Val Ile Met Ser Leu Gly Leu Gly
Leu Gly Leu Gly Leu Arg Lys Leu 35 40 45Glu Lys Gln Gly Ser Cys Arg
Lys Lys Cys Phe Asp Ala Ser Phe Arg 50 55 60Gly Leu Glu Asn Cys Arg
Cys Asp Val Ala Cys Lys Asp Arg Gly Asp65 70 75 80Cys Cys Trp Asp
Phe Glu Asp Thr Cys Val Glu Ser Thr Arg Ile Trp 85 90 95Met Cys Asn
Lys Phe Arg Cys Gly Glu Thr Arg Leu Glu Ala Ser Leu 100 105 110Cys
Ser Cys Ser Asp Asp Cys Leu Gln Arg Lys Asp Cys Cys Ala Asp 115 120
125Tyr Lys Ser Val Cys Gln Gly Glu Thr Ser Trp Leu Glu Glu Asn Cys
130 135 140Asp Thr Ala Gln Gln Ser Gln Cys Pro Glu Gly Phe Asp Leu
Pro Pro145 150 155 160Val Ile Leu Phe Ser Met Asp Gly Phe Arg Ala
Glu Tyr Leu Tyr Thr 165 170 175Trp Asp Thr Leu Met Pro Asn Ile Asn
Lys Leu Lys Thr Cys Gly Ile 180 185 190His Ser Lys Tyr Met Arg Ala
Met Tyr Pro Thr Lys Thr Phe Pro Asn 195 200 205His Tyr Thr Ile Val
Thr Gly Leu Tyr Pro Glu Ser His Gly Ile Ile 210 215 220Asp Asn Asn
Met Tyr Asp Val Asn Leu Asn Lys Asn Phe Ser Leu Ser225 230 235
240Ser Lys Glu Gln Asn Asn Pro Ala Trp Trp His Gly Gln Pro Met Trp
245 250 255Leu Thr Ala Met Tyr Gln Gly Leu Lys Ala Ala Thr Tyr Phe
Trp Pro 260 265 270Gly Ser Glu Val Ala Ile Asn Gly Ser Phe Pro Ser
Ile Tyr Met Pro 275 280 285Tyr Asn Gly Ser Val Pro Phe Glu Glu Arg
Ile Ser Thr Leu Leu Lys 290 295 300Trp Leu Asp Leu Pro Lys Ala Glu
Arg Pro Arg Phe Tyr Thr Met Tyr305 310 315 320Phe Glu Glu Pro Asp
Ser Ser Gly His Ala Gly Gly Pro Val Ser Ala 325 330 335Arg Val Ile
Lys Ala Leu Gln Val Val Asp His Ala Phe Gly Met Leu 340 345 350Met
Glu Gly Leu Lys Gln Arg Asn Leu His Asn Cys Val Asn Ile Ile 355 360
365Leu Leu Ala Asp His Gly Met Asp Gln Thr Tyr Cys Asn Lys Met Glu
370 375 380Tyr Met Thr Asp Tyr Phe Pro Arg Ile Asn Phe Phe Tyr Met
Tyr Glu385 390 395 400Gly Pro Ala Pro Arg Ile Arg Ala His Asn Ile
Pro His Asp Phe Phe 405 410 415Ser Phe Asn Ser Glu Glu Ile Val Arg
Asn Leu Ser Cys Arg Lys Pro 420 425 430Asp Gln His Phe Lys Pro Tyr
Leu Thr Pro Asp Leu Pro Lys Arg Leu 435 440 445His Tyr Ala Lys Asn
Val Arg Ile Asp Lys Val His Leu Phe Val Asp 450 455 460Gln Gln Trp
Leu Ala Val Arg Ser Lys Ser Asn Thr Asn Cys Gly Gly465 470 475
480Gly Asn His Gly Tyr Asn Asn Glu Phe Arg Ser Met Glu Ala Ile Phe
485 490 495Leu Ala His Gly Pro Ser Phe Lys Glu Lys Thr Glu Val Glu
Pro Phe 500 505 510Glu Asn Ile Glu Val Tyr Asn Leu Met Cys Asp Leu
Leu Arg Ile Gln 515 520 525Pro Ala Pro Asn Asn Gly Thr His Gly Ser
Leu Asn His Leu Leu Lys 530 535 540Val Pro Phe Tyr Glu Pro Ser His
Ala Glu Glu Val Ser Lys Phe Ser545 550 555 560Val Cys Gly Phe Ala
Asn Pro Leu Pro Thr Glu Ser Leu Asp Cys Phe 565 570 575Cys Pro His
Leu Gln Asn Ser Thr Gln Leu Glu Gln Val Asn Gln Met 580 585 590Leu
Asn Leu Thr Gln Glu Glu Ile Thr Ala Thr Val Lys Val Asn Leu 595 600
605Pro Phe Gly Arg Pro Arg Val Leu Gln Lys Asn Val Asp His Cys Leu
610 615 620Leu Tyr His Arg Glu Tyr Val Ser Gly Phe Gly Lys Ala Met
Arg Met625 630 635 640Pro Met Trp Ser Ser Tyr Thr Val Pro Gln Leu
Gly Asp Thr Ser Pro 645 650 655Leu Pro Pro Thr Val Pro Asp Cys Leu
Arg Ala Asp Val Arg Val Pro 660 665 670Pro Ser Glu Ser Gln Lys Cys
Ser Phe Tyr Leu Ala Asp Lys Asn Ile 675 680 685Thr His Gly Phe Leu
Tyr Pro Pro Ala Ser Asn Arg Thr Ser Asp Ser 690 695 700Gln Tyr Asp
Ala Leu Ile Thr Ser Asn Leu Val Pro Met Tyr Glu Glu705 710 715
720Phe Arg Lys Met Trp Asp Tyr Phe His Ser Val Leu Leu Ile Lys His
725 730 735Ala Thr Glu Arg Asn Gly Val Asn Val Val Ser Gly Pro Ile
Phe Asp 740 745 750Tyr Asn Tyr Asp Gly His Phe Asp Ala Pro Asp Glu
Ile Thr Lys His 755 760 765Leu Ala Asn Thr Asp Val Pro Ile Pro Thr
His Tyr Phe Val Val Leu 770 775 780Thr Ser Cys Lys Asn Lys Ser His
Thr Pro Glu Asn Cys Pro Gly Trp785 790 795 800Leu Asp Val Leu Pro
Phe Ile Ile Pro His Arg Pro Thr Asn Val Glu 805 810 815Ser Cys Pro
Glu Gly Lys Pro Glu Ala Leu Trp Val Glu Glu Arg Phe 820 825 830Thr
Ala His Ile Ala Arg Val Arg Asp Val Glu Leu Leu Thr Gly Leu 835 840
845Asp Phe Tyr Gln Asp Lys Val Gln Pro Val Ser Glu Ile Leu Gln Leu
850 855 860Lys Thr Tyr Leu Pro Thr Phe Glu Thr Thr Ile865 870
875749384PRTHomo sapiens 749Met Glu Ala Ile Phe Leu Ala His Gly Pro
Ser Phe Lys Glu Lys Thr1 5 10 15Glu Val Glu Pro Phe Glu Asn Ile Glu
Val Tyr Asn Leu Met Cys Asp 20 25 30Leu Leu Arg Ile Gln Pro Ala Pro
Asn Asn Gly Thr His Gly Ser Leu 35 40 45Asn His Leu Leu Lys Val Pro
Phe Tyr Glu Pro Ser His Ala Glu Glu 50 55 60Val Ser Lys Phe Ser Val
Cys Gly Phe Ala Asn Pro Leu Pro Thr Glu65 70 75 80Ser Leu Asp Cys
Phe Cys Pro His Leu Gln Asn Ser Thr Gln Leu Glu 85 90 95Gln Val Asn
Gln Met Leu Asn Leu Thr Gln Glu Glu Ile Thr Ala Thr 100 105 110Val
Lys Val Asn Leu Pro Phe Gly Arg Pro Arg Val Leu Gln Lys Asn 115 120
125Val Asp His Cys Leu Leu Tyr His Arg Glu Tyr Val Ser Gly Phe Gly
130 135 140Lys Ala Met Arg Met Pro Met Trp Ser Ser Tyr Thr Val Pro
Gln Leu145 150 155 160Gly Asp Thr Ser Pro Leu Pro Pro Thr Val Pro
Asp Cys Leu Arg Ala 165 170 175Asp Val Arg Val Pro Pro Ser Glu Ser
Gln Lys Cys Ser Phe Tyr Leu 180 185 190Ala Asp Lys Asn Ile Thr His
Gly Phe Leu Tyr Pro Pro Ala Ser Asn 195 200 205Arg Thr Ser Asp Ser
Gln Tyr Asp Ala Leu Ile Thr Ser Asn Leu Val 210 215 220Pro Met Tyr
Glu Glu Phe Arg Lys Met Trp Asp Tyr Phe His Ser Val225 230 235
240Leu Leu Ile Lys His Ala Thr Glu Arg Asn Gly Val Asn Val Val Ser
245 250 255Gly Pro Ile Phe Asp Tyr Asn Tyr Asp Gly His Phe Asp Ala
Pro Asp 260 265 270Glu Ile Thr Lys His Leu Ala Asn Thr Asp Val Pro
Ile Pro Thr His 275 280 285Tyr Phe Val Val Leu Thr Ser Cys Lys Asn
Lys Ser His Thr Pro Glu 290 295 300Asn Cys Pro Gly Trp Leu Asp Val
Leu Pro Phe Ile Ile Pro His Arg305 310 315 320Pro Thr Asn Val Glu
Ser Cys Pro Glu Gly Lys Pro Glu Ala Leu Trp 325 330 335Val Glu Glu
Arg Phe Thr Ala His Ile Ala Arg Val Arg Asp Val Glu 340 345 350Leu
Leu Thr Gly Leu Asp Phe Tyr Gln Asp Lys Val Gln Pro Val Ser 355 360
365Glu Ile Leu Gln Leu Lys Thr Tyr Leu Pro Thr Phe Glu Thr Thr Ile
370 375 380750384PRTHomo sapiens 750Met Glu Ala Ile Phe Leu Ala His
Gly Pro Ser Phe Lys Glu Lys Thr1 5 10 15Glu Val Glu Pro Phe Glu Asn
Ile Glu Val Tyr Asn Leu Met Cys Asp 20 25 30Leu Leu Arg Ile Gln Pro
Ala Pro Asn Asn Gly Thr His Gly Ser Leu 35 40 45Asn His Leu Leu Lys
Val Pro Phe Tyr Glu Pro Ser His Ala Glu Glu 50 55 60Val Ser Lys Phe
Ser Val Cys Gly Phe Ala Asn Pro Leu Pro Thr Glu65 70 75 80Ser Leu
Asp Cys Phe Cys Pro His Leu Gln Asn Ser Thr Gln Leu Glu 85 90 95Gln
Val Asn Gln Met Leu Asn Leu Thr Gln Glu Glu Ile Thr Ala Thr 100 105
110Val Lys Val Asn Leu Pro Phe Gly Arg Pro Arg Val Leu Gln Lys Asn
115 120 125Val Asp His Cys Leu Leu Tyr His Arg Glu Tyr Val Ser Gly
Phe Gly 130 135 140Lys Ala Met Arg Met Pro Met Trp Ser Ser Tyr Thr
Val Pro Gln Leu145 150 155 160Gly Asp Thr Ser Pro Leu Pro Pro Thr
Val Pro Asp Cys Leu Arg Ala 165 170 175Asp Val Arg Val Pro Pro Ser
Glu Ser Gln Lys Cys Ser Phe Tyr Leu 180 185 190Ala Asp Lys Asn Ile
Thr His Gly Phe Leu Tyr Pro Pro Ala Ser Asn 195 200 205Arg Thr Ser
Asp Ser Gln Tyr Asp Ala Leu Ile Thr Ser Asn Leu Val 210 215 220Pro
Met Tyr Glu Glu Phe Arg Lys Met Trp Asp Tyr Phe His Ser Val225 230
235 240Leu Leu Ile Lys His Ala Thr Glu Arg Asn Gly Val Asn Val Val
Ser 245 250 255Gly Pro Ile Phe Asp Tyr Asn Tyr Asp Gly His Phe Asp
Ala Pro Asp 260 265 270Glu Ile Thr Lys His Leu Ala Asn Thr Asp Val
Pro Ile Pro Thr His 275 280 285Tyr Phe Val Val Leu Thr Ser Cys Lys
Asn Lys Ser His Thr Pro Glu 290 295 300Asn Cys Pro Gly Trp Leu Asp
Val Leu Pro Phe Ile Ile Pro His Arg305 310 315 320Pro Thr Asn Val
Glu Ser Cys Pro Glu Gly Lys Pro Glu Ala Leu Trp 325 330 335Val Glu
Glu Arg Phe Thr Ala His Ile Ala Arg Val Arg Asp Val Glu 340 345
350Leu Leu Thr Gly Leu Asp Phe Tyr Gln Asp Lys Val Gln Pro Val Ser
355 360 365Glu Ile Leu Gln Leu Lys Thr Tyr Leu Pro Thr Phe Glu Thr
Pro Ile 370 375 380751875PRTHomo sapiens 751Met Glu Ser Thr Leu Thr
Leu Ala Thr Glu Gln Pro Val Lys Lys Asn1 5 10 15Thr Leu Lys Lys Tyr
Lys Ile Ala Cys Ile Val Leu Leu Ala Leu Leu 20 25 30Val Ile Met Ser
Leu Gly Leu Gly Leu Gly Leu Gly Leu Arg Lys Leu 35 40 45Glu Lys Gln
Gly Ser Cys Arg Lys Lys Cys Phe Asp Ala Ser Phe Arg 50 55 60Gly Leu
Glu Asn Cys Arg Cys Asp Val Ala Cys Lys Asp Arg Gly Asp65 70 75
80Cys Cys Trp Asp Phe Glu Asp Thr Cys Val Glu Ser Thr Arg Ile Trp
85 90 95Met Cys Asn Lys Phe Arg Cys Gly Glu Thr Arg Leu Glu Ala Ser
Leu 100 105 110Cys Ser Cys Ser Asp Asp Cys Leu Gln Lys Lys Asp Cys
Cys Ala Asp 115 120 125Tyr Lys Ser Val Cys Gln Gly Glu Thr Ser Trp
Leu Glu Glu Asn Cys 130 135 140Asp Thr Ala Gln Gln Ser Gln Cys Pro
Glu Gly Phe Asp Leu Pro Pro145 150 155 160Val Ile Leu Phe Ser Met
Asp Gly Phe Arg Ala Glu Tyr Leu Tyr Thr 165 170 175Trp Asp Thr Leu
Met Pro Asn Ile Asn Lys Leu Lys Thr Cys Gly Ile 180 185 190His Ser
Lys Tyr Met Arg Ala Met Tyr Pro Thr Lys Thr Phe Pro Asn 195 200
205His Tyr Thr Ile Val Thr Gly Leu Tyr Pro Glu Ser His Gly Ile Ile
210 215 220Asp Asn Asn Met Tyr Asp Val Asn Leu Asn Lys Asn Phe Ser
Leu Ser225 230 235 240Ser Lys Glu Gln Asn Asn Pro Ala Trp Trp His
Gly Gln Pro Met Trp 245 250 255Leu Thr Ala Met Tyr Gln Gly Leu Lys
Ala Ala Thr Tyr Phe Trp Pro 260 265 270Gly Ser Glu Val Ala Ile Asn
Gly Ser Phe Pro Ser Ile Tyr Met Pro 275 280 285Tyr Asn Gly Ser Val
Pro Phe Glu Glu Arg Ile Ser Thr Leu Leu Lys 290 295 300Trp Leu Asp
Leu Pro Lys Ala Glu Arg Pro Arg Phe Tyr Thr Met Tyr305 310 315
320Phe Glu Glu Pro Asp Ser Ser Gly His Ala Gly Gly Pro Val Ser Ala
325 330 335Arg Val Ile Lys Ala Leu Gln Val Val Asp His Ala Phe Gly
Met Leu 340 345 350Met Glu Gly Leu Lys Gln Arg Asn Leu His Asn Cys
Val Asn Ile Ile 355 360 365Leu Leu Ala Asp His Gly Met Asp Gln Thr
Tyr Cys Asn Lys Met Glu 370 375 380Tyr Met Thr Asp Tyr Phe Pro Arg
Ile Asn Phe Phe Tyr Met Tyr Glu385 390 395 400Gly Pro Ala Pro Arg
Ile Arg Ala His Asn Ile Pro His Asp Phe Phe 405 410 415Ser Phe Asn
Ser Glu Glu Ile Val Arg Asn Leu Ser Cys Arg Lys Pro 420 425 430Asp
Gln His Phe Lys Pro Tyr Leu Thr Pro Asp Leu Pro Lys Arg Leu 435 440
445His Tyr Ala Lys Asn Val Arg Ile Asp Lys Val His Leu Phe Val Asp
450 455 460Gln Gln Trp Leu Ala Val Arg Ser Lys Ser Asn Thr Asn Cys
Gly Gly465 470 475 480Gly Asn His Gly Tyr Asn Asn Glu Phe Arg Ser
Met Glu Ala Ile Phe 485 490 495Leu Ala His Gly Pro Ser Phe Lys Glu
Lys Thr Glu Val Glu Pro Phe 500 505 510Glu Asn Ile Glu Val Tyr Asn
Leu Met Cys Asp Leu Leu Arg Ile Gln 515 520
525Pro Ala Pro Asn Asn Gly Thr His Gly Ser Leu Asn His Leu Leu Lys
530 535 540Val Pro Phe Tyr Glu Pro Ser His Ala Glu Glu Val Ser Lys
Phe Ser545 550 555 560Val Cys Gly Phe Ala Asn Pro Leu Pro Thr Glu
Ser Leu Asp Cys Phe 565 570 575Cys Pro His Leu Gln Asn Ser Thr Gln
Leu Glu Gln Val Asn Gln Met 580 585 590Leu Asn Leu Thr Gln Glu Glu
Ile Thr Ala Thr Val Lys Val Asn Leu 595 600 605Pro Phe Gly Arg Pro
Arg Val Leu Gln Lys Asn Val Asp His Cys Leu 610 615 620Leu Tyr His
Arg Glu Tyr Val Ser Gly Phe Gly Lys Ala Met Arg Met625 630 635
640Pro Met Trp Ser Ser Tyr Thr Val Pro Gln Leu Gly Asp Thr Ser Pro
645 650 655Leu Pro Pro Thr Val Pro Asp Cys Leu Arg Ala Asp Val Arg
Val Pro 660 665 670Pro Ser Glu Ser Gln Lys Cys Ser Phe Tyr Leu Ala
Asp Lys Asn Ile 675 680 685Thr His Gly Phe Leu Tyr Pro Pro Ala Ser
Asn Arg Thr Ser Asp Ser 690 695 700Gln Tyr Asp Ala Leu Ile Thr Ser
Asn Leu Val Pro Met Tyr Glu Glu705 710 715 720Phe Arg Lys Met Trp
Asp Tyr Phe His Ser Val Leu Leu Ile Lys His 725 730 735Ala Thr Glu
Arg Asn Gly Val Asn Val Val Ser Gly Pro Ile Phe Asp 740 745 750Tyr
Asn Tyr Asp Gly His Phe Asp Ala Pro Asp Glu Ile Thr Lys His 755 760
765Leu Ala Asn Thr Asp Val Pro Ile Pro Thr His Tyr Phe Val Val Leu
770 775 780Thr Ser Cys Lys Asn Lys Ser His Thr Pro Glu Asn Cys Pro
Gly Trp785 790 795 800Leu Asp Val Leu Pro Phe Ile Ile Pro His Arg
Pro Thr Asn Val Glu 805 810 815Ser Cys Pro Glu Gly Lys Pro Glu Ala
Leu Trp Val Glu Glu Arg Phe 820 825 830Thr Ala His Ile Ala Arg Val
Arg Asp Val Glu Leu Leu Thr Gly Leu 835 840 845Asp Phe Tyr Gln Asp
Lys Val Gln Pro Val Ser Glu Ile Leu Gln Leu 850 855 860Lys Thr Tyr
Leu Pro Thr Phe Glu Thr Thr Ile865 870 87575214DNAHomo sapiens
752ttttgatcaa gctt 1475342DNAHomo sapiens 753ctaatacgac tcactatagg
gctcgagcgg ccgcccgggc ag 4275412DNAHomo sapiens 754ggcccgtcct ag
1275540DNAHomo sapiens 755gtaatacgac tcactatagg gcagcgtggt
cgcggccgag 4075610DNAHomo sapiens 756cggctcctag 1075722DNAHomo
sapiens 757ctaatacgac tcactatagg gc 2275822DNAHomo sapiens
758tcgagcggcc gcccgggcag ga 2275920DNAHomo sapiens 759agcgtggtcg
cggccgagga 2076014PRTHomo sapiens 760Gln Tyr Ile Lys Ala Asn Ser
Lys Phe Ile Gly Ile Thr Glu1 5 1076121PRTHomo sapiens 761Asp Ile
Glu Lys Lys Ile Ala Lys Met Glu Lys Ala Ser Ser Val Phe1 5 10 15Asn
Val Val Asn Ser 2076216PRTHomo sapiens 762Gly Ala Val Asp Ser Ile
Leu Gly Gly Val Ala Thr Tyr Gly Ala Ala1 5 10 1576311PRTHomo
sapiensVARIANT2Xaa = cyclohexylalanine, phenylalanine, or tyrosine
763Lys Xaa Val Ala Ala Trp Thr Leu Lys Ala Ala1 5 1076424DNAHomo
sapiens 764gattacaagg atgacgacga taag 24765871PRTHomo sapiens
765Met Glu Ser Thr Leu Thr Leu Ala Thr Glu Gln Pro Val Lys Lys Asn1
5 10 15Thr Leu Lys Lys Tyr Lys Ile Ala Cys Ile Val Leu Leu Ala Leu
Leu 20 25 30Val Ile Met Ser Leu Gly Leu Gly Leu Gly Leu Gly Leu Arg
Lys Leu 35 40 45Glu Lys Gln Gly Ser Cys Arg Lys Lys Cys Phe Asp Ala
Ser Phe Arg 50 55 60Gly Leu Glu Asn Cys Arg Cys Asp Val Ala Cys Lys
Asp Arg Gly Asp65 70 75 80Cys Cys Trp Asp Phe Glu Asp Thr Cys Val
Glu Ser Thr Arg Ile Trp 85 90 95Met Cys Asn Lys Phe Arg Cys Gly Glu
Thr Arg Leu Glu Ala Ser Leu 100 105 110Cys Ser Cys Ser Asp Asp Cys
Leu Gln Lys Lys Asp Cys Cys Ala Asp 115 120 125Tyr Lys Ser Val Cys
Gln Gly Glu Thr Ser Trp Leu Glu Glu Asn Cys 130 135 140Asp Thr Ala
Gln Gln Ser Gln Cys Pro Glu Gly Phe Asp Leu Pro Pro145 150 155
160Val Ile Leu Phe Ser Met Asp Gly Phe Arg Ala Glu Tyr Leu Tyr Thr
165 170 175Trp Asp Thr Leu Met Pro Asn Ile Asn Lys Leu Lys Thr Cys
Gly Ile 180 185 190His Ser Lys Tyr Met Arg Ala Met Tyr Pro Thr Lys
Thr Phe Pro Asn 195 200 205His Tyr Thr Ile Val Thr Gly Leu Tyr Pro
Glu Ser His Gly Ile Asp 210 215 220Asn Asn Met Tyr Asp Val Leu Asn
Lys Asn Phe Ser Leu Ser Ser Lys225 230 235 240Glu Gln Asn Pro Ala
Trp Trp His Gly Gln Pro Met Trp Leu Thr Ala 245 250 255Met Tyr Gln
Gly Leu Lys Ala Ala Thr Tyr Phe Trp Pro Gly Ser Glu 260 265 270Val
Ala Ile Asn Gly Ser Phe Pro Ser Ile Tyr Met Pro Tyr Asn Gly 275 280
285Ser Val Pro Phe Glu Glu Arg Ile Ser Thr Leu Leu Lys Trp Leu Asp
290 295 300Leu Pro Lys Ala Glu Arg Pro Arg Phe Tyr Thr Met Tyr Phe
Glu Glu305 310 315 320Pro Asp Ser Ser Gly His Ala Gly Gly Pro Val
Ser Ala Arg Val Ile 325 330 335Lys Ala Leu Gln Val Val Asp His Ala
Phe Gly Met Leu Met Glu Gly 340 345 350Leu Lys Gln Arg Asn Ile Leu
His Asn Arg Val Asn Ile Ile Leu Leu 355 360 365Ala Asp His Gly Met
Asp Gln Thr Tyr Cys Asn Lys Met Glu Tyr Met 370 375 380Thr Asp Tyr
Phe Pro Arg Ile Asn Phe Phe Tyr Met Tyr Glu Gly Pro385 390 395
400Ala Pro Arg Ile Arg Ala His Asn Ile Pro His Asp Phe Phe Ser Phe
405 410 415Asn Ser Glu Glu Ile Val Arg Asn Leu Ser Cys Arg Lys Pro
Asp Gln 420 425 430His Phe Lys Pro Tyr Leu Thr Pro Asp Leu Pro Lys
Arg Leu His Tyr 435 440 445Ala Lys Asn Val Arg Ile Asp Lys Val His
Leu Phe Val Asp Gln Gln 450 455 460Trp Leu Ala Val Arg Ser Lys Ser
Asn Thr Asn Cys Gly Gly Gly Asn465 470 475 480His Gly Tyr Asn Asn
Glu Phe Arg Ser Met Glu Ala Ile Phe Leu Ala 485 490 495His Gly Pro
Ser Phe Lys Glu Lys Thr Glu Val Glu Pro Phe Glu Asn 500 505 510Ile
Glu Val Tyr Asn Leu Met Cys Asp Leu Leu Arg Ile Gln Pro Ala 515 520
525Pro Asn Asn Gly Thr His Gly Ser Leu Asn His Leu Leu Lys Val Pro
530 535 540Phe Tyr Glu Pro Ser His Ala Glu Glu Val Ser Lys Phe Ser
Val Cys545 550 555 560Gly Phe Ala Asn Pro Leu Pro Thr Glu Ser Leu
Asp Cys Phe Cys Pro 565 570 575His Leu Gln Asn Ser Thr Gln Leu Glu
Gln Val Asn Gln Met Leu Asn 580 585 590Leu Thr Gln Glu Glu Ile Thr
Ala Thr Val Lys Val Asn Leu Pro Phe 595 600 605Gly Arg Pro Arg Val
Leu Gln Lys Asn Val Asp His Cys Leu Leu Tyr 610 615 620His Arg Glu
Tyr Val Ser Gly Phe Gly Lys Ala Met Arg Met Pro Met625 630 635
640Trp Ser Ser Tyr Thr Val Pro Gln Leu Gly Asp Thr Ser Pro Leu Pro
645 650 655Pro Thr Val Pro Asp Cys Leu Arg Ala Asp Val Arg Val Pro
Pro Ser 660 665 670Glu Ser Gln Lys Cys Ser Phe Tyr Leu Ala Asp Lys
Asn Ile Thr His 675 680 685Gly Phe Leu Tyr Pro Pro Ala Ser Asn Arg
Thr Ser Asp Ser Gln Tyr 690 695 700Asp Ala Leu Ile Thr Ser Asn Leu
Val Pro Met Tyr Glu Glu Phe Arg705 710 715 720Lys Met Trp Asp Tyr
Phe His Ser Val Leu Leu Ile Lys His Ala Thr 725 730 735Glu Arg Asn
Gly Val Asn Val Val Ser Gly Pro Phe Asp Tyr Asn Tyr 740 745 750Asp
Gly His Phe Asp Ala Pro Asp Glu Ile Thr Lys His Leu Ala Asn 755 760
765Thr Asp Val Pro Ile Pro Thr His Tyr Phe Val Val Leu Thr Ser Cys
770 775 780Lys Asn Ser His Thr Pro Glu Asn Cys Pro Gly Trp Leu Asp
Val Leu785 790 795 800Pro Phe Ile Ile Pro His Arg Pro Thr Asn Val
Glu Ser Cys Pro Glu 805 810 815Gly Lys Pro Glu Ala Leu Trp Val Glu
Glu Arg Phe Thr Ala His Ile 820 825 830Ala Arg Val Arg Asp Val Glu
Leu Leu Thr Gly Leu Asp Phe Tyr Gln 835 840 845Asp Lys Val Gln Pro
Val Ser Glu Ile Leu Gln Leu Lys Thr Tyr Leu 850 855 860Pro Thr Phe
Glu Thr Thr Ile865 870
* * * * *