U.S. patent application number 12/577141 was filed with the patent office on 2010-04-15 for use and identification of biomarkers for gastrointestinal diseases.
Invention is credited to Asit Panja.
Application Number | 20100093552 12/577141 |
Document ID | / |
Family ID | 42099404 |
Filed Date | 2010-04-15 |
United States Patent
Application |
20100093552 |
Kind Code |
A1 |
Panja; Asit |
April 15, 2010 |
USE AND IDENTIFICATION OF BIOMARKERS FOR GASTROINTESTINAL
DISEASES
Abstract
The described invention relates to the identification of
biomarkers for gastrointestinal diseases and provides methods
utilizing the biomarkers for in drug discovery, monitoring of
treatment efficacy, and diagnostics. The invention further provides
methods for identifying a therapeutic target to treat ulcerative
colitis, colorectal cancer, and Crohn's disease.
Inventors: |
Panja; Asit; (Somerset,
NJ) |
Correspondence
Address: |
GREENBERG TRAURIG, LLP
200 PARK AVE., P.O. BOX 677
FLORHAM PARK
NJ
07932
US
|
Family ID: |
42099404 |
Appl. No.: |
12/577141 |
Filed: |
October 9, 2009 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
61195646 |
Oct 9, 2008 |
|
|
|
Current U.S.
Class: |
506/7 ; 435/29;
435/6.14 |
Current CPC
Class: |
G01N 33/5044 20130101;
C12N 5/0679 20130101; C12N 5/068 20130101; G01N 33/57419 20130101;
C12Q 2600/158 20130101; G01N 33/53 20130101; G01N 2500/10 20130101;
G01N 33/5073 20130101; C12Q 2600/136 20130101; C12Q 1/68 20130101;
G01N 2800/065 20130101; C12Q 1/6886 20130101; G01N 33/57446
20130101 |
Class at
Publication: |
506/7 ; 435/29;
435/6 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68; C12Q 1/25 20060101 C12Q001/25; C40B 30/00 20060101
C40B030/00 |
Claims
1. A method for identifying a therapeutic target to treat a colon
cancer in a subject in need thereof, the method comprising the
steps: (a) isolating normal differentiable segment-specific human
stem cell-like progenitor cells from normal mucosal tissue of the
subject derived from at least one normal gastrointestinal segment;
(b) isolating diseased differentiable segment-specific human stem
cell-like progenitor cells from diseased mucosal tissue derived
from at least one segment of the subject's diseased human
gastrointestinal segment; (c) cultivating the normal differentiable
segment-specific human stem cell-like progenitor cells from step
(a) on a biosimilar matrix environment formed from the normal
mucosal tissue derived from the at least one normal human
gastrointestinal segment to produce a normal human intestinal
primary epithelial cell line; (d) cultivating the diseased
differentiable segment-specific human stem cell-like progenitor
cells from step (b) on a biosimilar matrix environment formed from
the diseased mucosal tissue of step (b) to produce a diseased human
intestinal primary epithelial cell line; (e) exposing the normal
human intestinal primary epithelial cell line of step (c) and the
diseased human intestinal primary epithelial cell line of step (d)
to a therapeutic agent; (f) measuring the level of expression of a
biomarker, wherein the level of expression of the biomarker is
measured in the normal human intestinal primary epithelial cell
line of step (e) and in the diseased human intestinal primary
epithelial cell line of step (e); and (g) identifying a therapeutic
target for the treatment of colon cancer by comparing the level of
expression of the biomarker in the normal human intestinal primary
cell line of step (f) and in the diseased human intestinal primary
epithelial cell line of step (f).
2. The method according to claim 1, wherein the biomarker is
selected from the group consisting of STX5A, GZMB, PCSK5, and
SOD3.
3. The method according to claim 1, wherein step (f) further
comprises the step of performing an assay that detects at least one
of (i) at least one overexpressed gene in a sample obtained from
the subject and (ii) at least one underexpressed gene in a sample
obtained from the subject.
4. The method according to claim 3, wherein the assay in step (f)
is a microarray hybridization assay.
5. The method according to claim 1, wherein the cell lines of step
(f) are compared by immunoassay.
6. The method according to claim 1, wherein the gastrointestinal
segment is at least one gastrointestinal segment selected from the
group consisting of an esophagus segment, a stomach segment, a
jejunum segment, an ileum segment, a duodenum segment, an ascending
colon segment, a transverse colon segment, a sigmoid colon segment,
or a rectum segment.
7. The method according to claim 1, wherein the normal
differentiable segment-specific human stem cell-like progenitor
cells have a phenotype of at least cytokeratin (+) and
.beta.-1-integrin(+).
8. The method according to claim 1, wherein the normal
differentiable segment-specific human stem cell-like progenitor
cells have a phenotype of cytokeratin (+), .beta.-1-integrin(+),
defensin-5(+), trefoil factor-3(+), mucin-2(+), chomogranin-A(+),
intestinal alkaline phosphatase(+), and lysozyme(+).
9. A method for identifying at least one therapeutic target to
treat ulcerative colitis in a subject in need thereof, the method
comprising the steps: (a) isolating normal differentiable
segment-specific human stem cell-like progenitor cells from normal
mucosal tissue of the subject derived from at least one normal
gastrointestinal segment; (b) isolating diseased differentiable
segment-specific human stem cell-like progenitor cells from
diseased mucosal tissue derived from at least one segment of the
subject's diseased human gastrointestinal segment; (c) cultivating
the normal differentiable segment-specific human stem cell-like
progenitor cells from step (a) on a biosimilar matrix environment
formed from the normal mucosal tissue derived from the at least one
normal human gastrointestinal segment to produce a normal human
intestinal primary epithelial cell line; (d) cultivating the
diseased differentiable segment-specific human stem cell-like
progenitor cells from step (b) on a biosimilar matrix environment
formed from the diseased mucosal tissue of step (b) to produce a
diseased human intestinal primary epithelial cell line; (e)
exposing the normal human intestinal primary epithelial cell line
of step (c) and the diseased human intestinal primary epithelial
cell line of step (d) to a therapeutic agent; (f) measuring the
level of expression of a biomarker, wherein the level of expression
of the biomarker is measured in the normal human intestinal primary
epithelial cell line of step (e) and in the diseased human
intestinal primary epithelial cell line of step (e); and (g)
identifying a therapeutic target for the treatment of ulcerative
colitis by comparing the level of expression of the biomarker
within the normal human intestinal primary cell line of step (f)
and in the diseased human intestinal primary epithelial cell line
of step (f).
10. The method according to claim 9, wherein the biomarker is
selected from the group consisting of BST2, MMP1, CACNA1E, PCSK5,
GSTT1, SOD3, IL1RL1, ARH1 and IFIT156.
11. The method according to claim 9, wherein step (f) further
comprises the step of performing an assay that detects at least one
of (i) at least one overexpressed gene in a sample obtained from
the subject or (ii) at least one underexpressed gene in a sample
obtained from the subject.
12. The method according to claim 11, wherein the assay in step (f)
is a microarray hybridization assay.
13. The method according to claim 9, wherein in step (d), the
biomarker is in a regulated state.
14. The method according to claim 9, wherein the cell lines of step
(f) are compared by an immunoassay.
15. The method according to claim 9, wherein the gastrointestinal
segment is an esophagus segment, a stomach segment, a duodenum
segment, a jejunum segment, an ileum segment, an ascending colon
segment, a transverse colon segment, a sigmoid colon segment, or a
rectum segment.
16. The method according to claim 9, wherein the normal
differentiable segment-specific human stem cell-like progenitor
cells have a phenotype of at least cytokeratin (+) and
.beta.-1-integrin(+).
17. The method according to claim 9, wherein the normal
differentiable segment-specific human stem cell-like progenitor
cells have a phenotype of cytokeratin (+), .beta.-1-integrin(+),
defensin-5(+), trefoil factor-3(+), mucin-2(+), chomogranin-A(+),
intestinal alkaline phosphatase(+), and lysozyme(+).
18. A method for identifying at least one therapeutic target to
treat Crohn's disease in a subject in need thereof, the method
comprising the steps: (a) isolating normal differentiable
segment-specific human stem cell-like progenitor cells from normal
mucosal tissue of the subject derived from at least one normal
gastrointestinal segment; (b) isolating diseased differentiable
segment-specific human stem cell-like progenitor cells from
diseased mucosal tissue derived from at least one segment of the
subject's diseased human gastrointestinal segment; (c) cultivating
the normal differentiable segment-specific human stem cell-like
progenitor cells from step (a) on a biosimilar matrix environment
formed from the normal mucosal tissue derived from the at least one
normal human gastrointestinal segment to produce a normal human
intestinal primary epithelial cell line; (d) cultivating the
diseased differentiable segment-specific human stem cell-like
progenitor cells from step (b) on a biosimilar matrix environment
formed from the diseased mucosal tissue of step (b) to produce a
diseased human intestinal primary epithelial cell line; (e)
exposing the normal human intestinal primary epithelial cell line
of step (c) and the diseased human intestinal primary epithelial
cell line of step (d) to a therapeutic agent; (f) measuring the
level of expression of a biomarker, wherein the level of expression
of the biomarker is measured in the normal human intestinal primary
epithelial cell line of step (e) and in the diseased human
intestinal primary epithelial cell line of step (e); and (g)
identifying a therapeutic target for the treatment of Crohn's
disease by comparing the level of expression of the biomarker in
the normal human intestinal primary cell line of step (f) and in
the diseased human intestinal primary epithelial cell line of step
(f).
19. The method according to claim 18, wherein the biomarker is
selected from the group consisting of CACNA1E, GSTT1, PCSK5,
COL15A1, EDIL3 and MM2.
20. The method according to claim 18, wherein step (f) further
comprises the step of performing an assay that detects at least one
of (i) at least one overexpressed gene in a sample obtained from
the subject or (ii) at least one underexpressed gene in a sample
obtained from the subject.
21. The method according to claim 20, wherein the assay in step (f)
is a microarray hybridization assay.
22. The method according to claim 18, wherein in step (d), the
biomarker is in a regulated state.
23. The method according to claim 18, wherein the cell lines of
step (f) are compared by an immunoassay.
24. The method according to claim 18, wherein the gastrointestinal
segment is an esophagus segment, a stomach segment, a jejunum
segment, an ileum segment, a duodenum segment, an ascending colon
segment, a transverse colon segment, a sigmoid colon segment, or a
rectum segment.
25. The method according to claim 18, wherein the normal
differentiable segment-specific human stem cell-like progenitor
cells have a phenotype of at least cytokeratin (+) and
.beta.-1-integrin(+).
26. The method according to claim 18, wherein the normal
differentiable segment-specific human stem cell-like progenitor
cells have a phenotype of cytokeratin (+), .beta.-1-integrin(+),
defensin-5(+), trefoil factor-3(+), mucin-2(+), chomogranin-A(+),
intestinal alkaline phosphatase(+), and lysozyme(+).
27. A method for identifying at least one therapeutic target to
treat a gastrointestinal disease in a subject in need thereof, the
method comprising the steps: (a) isolating normal differentiable
segment-specific human stem cell-like progenitor cells from normal
mucosal tissue of the subject derived from at least one normal
gastrointestinal segment; (b) isolating diseased differentiable
segment-specific human stem cell-like progenitor cells from
diseased mucosal tissue derived from at least one segment of the
subject's diseased human gastrointestinal segment; (c) cultivating
the normal differentiable segment-specific human stem cell-like
progenitor cells from step (a) on a biosimilar matrix environment
formed from the normal mucosal tissue derived from the at least one
normal human gastrointestinal segment to produce a normal human
intestinal primary epithelial cell line; (d) cultivating the
diseased differentiable segment-specific human stem cell-like
progenitor cells from step (b) on a biosimilar matrix environment
formed from the diseased mucosal tissue of step (b) to produce a
diseased human intestinal primary epithelial cell line; (e)
exposing the normal human intestinal primary epithelial cell line
of step (c) and the diseased human intestinal primary epithelial
cell line of step (d) to a therapeutic agent; and (f) identifying
at least one biomarker as a therapeutic target for treating a
gastrointestinal disease by comparing the normal human intestinal
primary epithelial cell line and the diseased human intestinal
primary epithelial cell line of step (e).
28. The method according to claim 27, wherein the gastrointestinal
disease is selected from the group consisting of achalasia,
Barrett's oesophagus, colorectal cancer, gastric cancer,
oesophageal cancer, coeliac disease, colitis, Crohn's disease,
diverticulosis, diverticulitis, gastritis, inflammatory bowel
disease, ulcerative colitis, irritable bowel syndrome, microscopic
colitis, collagenous colitis, lymphocytic colitis, pancreatitis,
reflux oesophagitis, and ulcerative colitis.
29. The method according to claim 27, wherein in step (f) further
comprises the step of performing an assay that detects at least one
of (i) at least one overexpressed gene in a sample obtained from
the subject and (ii) at least one underexpressed gene in a sample
obtained from the subject.
30. The method according to claim 29, wherein the assay in step (f)
is a microarray hybridization assay.
31. The method according to claim 27, wherein step (f) further
comprises the step of comparing telomerase activity of the normal
human intestinal primary epithelial cell line of step (c) and the
cancerous human intestinal primary epithelial cell line of step (d)
after exposing the normal human intestinal primary epithelial cell
line of step (c) and the cancerous human intestinal primary
epithelial cell line of step (d) to a therapeutic agent.
32. The method according to claim 27, wherein in step (d) the
biomarker is in a regulated state.
33. The method according to claim 27, wherein the cell lines of
step (f) are compared by an immunoassay.
34. The method according to claim 27, wherein the gastrointestinal
disease is colon cancer.
35. The method according to claim 27, wherein the gastrointestinal
segment is an esophagus segment, a stomach segment, a jejunum
segment, an ileum segment, a duodenum segment, an ascending colon
segment, a transverse colon segment, a sigmoid colon segment, or a
rectum segment.
36. The method according to claim 27, wherein the normal
differentiable segment-specific human stem cell-like progenitor
cells have a phenotype of at least cytokeratin (+) and
.beta.-1-integrin(+).
37. The method according to claim 27, wherein the normal
differentiable segment-specific human stem cell-like progenitor
cells have a phenotype of cytokeratin (+), .beta.-1-integrin(+),
defensin-5(+), trefoil factor-3(+), mucin-2(+), chromogranin-A(+),
intestinal alkaline phosphatase(+), and lysozyme(+).
38. A method for monitoring the therapeutic efficacy of a
therapeutic agent for treating a gastrointestinal inflammatory
disease, the method comprising the steps: (a) isolating normal
differentiable segment-specific human stem cell-like progenitor
cells from normal mucosal tissue of the subject derived from at
least one normal gastrointestinal segment; (b) isolating diseased
differentiable segment-specific human stem cell-like progenitor
cells from diseased mucosal tissue derived from at least one
segment of the subject's diseased human gastrointestinal segment;
(c) cultivating the normal differentiable segment-specific human
stem cell-like progenitor cells from step (a) on a biosimilar
matrix environment formed from the normal mucosal tissue derived
from the at least one normal human gastrointestinal segment to
produce a normal human intestinal primary epithelial cell line; (d)
cultivating the diseased differentiable segment-specific human stem
cell-like progenitor cells from step (b) on a biosimilar matrix
environment formed from the diseased mucosal tissue of step (b) to
produce a diseased human intestinal primary epithelial cell line;
(e) exposing the normal human intestinal primary epithelial cell
line of step (c) and the diseased human intestinal primary
epithelial cell line of step (d) to a therapeutic agent; (f)
measuring the level of expression of a biomarker, wherein the level
of expression of the biomarker is measured in the normal human
intestinal primary epithelial cell line of step (e) and in the
diseased human intestinal primary epithelial cell line of step (e);
(g) correlating the difference between the level of expression of
the biomarker measured in the normal human intestinal primary
epithelial cell line and the level of expression of the biomarker
measured in the diseased human intestinal primary epithelial cell
with the therapeutic efficacy of the therapeutic agent.
39. The method according to claim 38, wherein the biomarker is
selected from the group consisting of STX5A, GZMB, and PCSK5.
40. The method according to claim 38, wherein the biomarker is
selected from the group consisting of BST2, MMP1, CACNA1E, PCSK5,
GSTT1, IL1RL1, ARH1 and IFIT156.
41. The method according to claim 38, wherein the biomarker is
SOD3.
42. The method according to claim 38, wherein the gastrointestinal
segment is at least one gastrointestinal segment selected from the
group consisting of an esophagus segment, a stomach segment, a
jejunum segment, an ileum segment, a duodenum segment, an ascending
colon segment, a transverse colon segment, a sigmoid colon segment,
or a rectum segment.
43. The method according to claim 38, wherein the normal
differentiable segment-specific human stem cell-like progenitor
cells have a phenotype of at least cytokeratin (+) and
.beta.-1-integrin(+).
44. The method according to claim 38, wherein the normal
differentiable segment-specific human stem cell-like progenitor
cells have a phenotype of cytokeratin (+), .beta.-1-integrin(+),
defensin-5(+), trefoil factor-3(+), mucin-2(+), chomogranin-A(+),
intestinal alkaline phosphatase(+), and lysozyme(+).
45. The method according to claim 38, wherein the gastrointestinal
disease is selected from the group consisting of achalasia,
Barrett's oesophagus, colorectal cancer, gastric cancer,
oesophageal cancer, coeliac disease, colitis, Crohn's disease,
diverticulosis, diverticulitis, gastritis, inflammatory bowel
disease, ulcerative colitis, irritable bowel syndrome, microscopic
colitis, collagenous colitis, lymphocytic colitis, pancreatitis,
reflux oesophagitis, and ulcerative colitis.
46. A method for diagnosing a gastrointestinal disease in a
subject, the method comprising the steps: (a) isolating normal
differentiable segment-specific human stem cell-like progenitor
cells from normal mucosal tissue of the subject derived from at
least one normal gastrointestinal segment; (b) isolating diseased
differentiable segment-specific human stem cell-like progenitor
cells from diseased mucosal tissue derived from at least one
segment of the subject's diseased human gastrointestinal segment;
(c) cultivating the normal differentiable segment-specific human
stem cell-like progenitor cells from step (a) on a biosimilar
matrix environment formed from the normal mucosal tissue derived
from the at least one normal human gastrointestinal segment to
produce a normal human intestinal primary epithelial cell line; (d)
cultivating the diseased differentiable segment-specific human stem
cell-like progenitor cells from step (b) on a biosimilar matrix
environment formed from the diseased mucosal tissue of step (b) to
produce a diseased human intestinal primary epithelial cell line;
(e) measuring the level of expression of a biomarker, wherein the
level of expression of the biomarker is measured in the normal
human intestinal primary epithelial cell line of step (e) and in
the diseased human intestinal primary epithelial cell line of step
(e); (f) correlating the difference between the level of expression
of the biomarker measured in the normal human intestinal primary
epithelial cell line and the level of expression of the biomarker
measured in the diseased human intestinal primary epithelial cell
line to a gastrointestinal disease state.
47. The method according to claim 46, wherein the biomarker is
selected from the group consisting of STX5A, GZMB, and PCSK5.
48. The method according to claim 46, wherein the biomarker is
selected from the group consisting of BST2, MMP1, CACNA1E, PCSK5,
GSTT1, IL1RL1, ARH1 and IFIT156.
49. The method according to claim 46, wherein the biomarker is
SOD3.
50. The method according to claim 46, wherein the biomarker is SOD3
and wherein step (f) the difference between the level of expression
of the biomarker measured in the normal human intestinal primary
epithelial cell line and the level of expression of the biomarker
measured in the diseased human intestinal primary epithelial cell
line is at least about 2-fold.
51. The method according to claim 46, wherein the gastrointestinal
segment is at least one gastrointestinal segment selected from the
group consisting of an esophagus segment, a stomach segment, a
jejunum segment, an ileum segment, a duodenum segment, an ascending
colon segment, a transverse colon segment, a sigmoid colon segment,
or a rectum segment.
52. The method according to claim 46, wherein the normal
differentiable segment-specific human stem cell-like progenitor
cells have a phenotype of at least cytokeratin (+) and
.beta.-1-integrin(+).
53. The method according to claim 46, wherein the normal
differentiable segment-specific human stem cell-like progenitor
cells have a phenotype of cytokeratin (+), .beta.-1-integrin(+),
defensin-5(+), trefoil factor-3(+), mucin-2(+), chomogranin-A(+),
intestinal alkaline phosphatase(+), and lysozyme(+).
54. The method according to claim 46, wherein the gastrointestinal
disease is selected from the group consisting of achalasia,
Barrett's oesophagus, colorectal cancer, gastric cancer,
oesophageal cancer, coeliac disease, colitis, Crohn's disease,
diverticulosis, diverticulitis, gastritis, inflammatory bowel
disease, ulcerative colitis, irritable bowel syndrome, microscopic
colitis, collagenous colitis, lymphocytic colitis, pancreatitis,
reflux oesophagitis, and ulcerative colitis.
Description
CROSS REFERENCES
[0001] This application claims the benefit of priority to U.S.
provisional application 61/195,646, filed 9 Oct. 2008, which is
incorporated in its entirety herein by reference.
FIELD OF THE INVENTION
[0002] The present invention relates to the identification of
biomarkers for gastrointestinal diseases and further provides
methods utilizing such biomarkers in drug discovery, the monitoring
of treatment efficacy, and diagnostics.
BACKGROUND OF THE INVENTION
[0003] Components of the Human Gastrointestinal Tract
[0004] The gastrointestinal tract is a continuous tube that extends
from the mouth to the anus. On a gross level, the gastrointestinal
tract is composed of the following organs: the mouth, most of the
pharynx, the esophagus, the stomach, the small intestine (duodenum,
jejunum and ileum), and the large intestine (cecum including the
appendix, colon and rectum) (Tortora, G. J., et al., Principles of
Anatomy and Physiology, Wiley & Sons, Inc. Hoboken, N.J. 2006).
Each segment of the gastrointestinal tract participates in the
absorptive processes essential to digestion by producing chemical
substances that facilitate digestion of foods, liquids, and other
substances, such as therapeutic agents, taken orally.
[0005] Within the gastrointestinal tract, the small intestine is
the site of most digestion and absorption and is structured
specifically for these important functions. The small intestine is
divided into three segments: the duodenum, the jejunum, and the
ileum. The absorptive cells of the small intestine produce several
digestive enzymes known as `brush-border` enzymes. The brush-border
enzymes, together with pancreatic and intestinal juices, facilitate
the absorption of substances from the chime in the small intestine.
The large intestine is the terminal portion of the gastrointestinal
tract and contributes to the completion of absorption, the
production of certain vitamins, and the formation and expulsion of
feces.
[0006] The epithelium is a purely cellular avascular tissue layer
that covers all free surfaces (cutaneous, mucous, and serous) of
the body, including the glands and other structures derived from
it. The epithelium lines both the exterior of the body, as skin,
the interior cavities, and lumen of the body. The outermost layer
of human skin is composed of dead stratified squamous, keratinized
epithelial cells. The mucous membranes lining the inside of the
mouth, the esophagus, and parts of the rectum are lined by
nonkeratinized stratified squamous epithelium. Epithelial cell
lines also are present inside of the lungs, the gastrointestinal
tract, and the reproductive and urinary tracts, and form the
exocrine and endrocrine glands.
[0007] Epithelial cells are involved in secretion, absorption,
protection, transcellular transport, sensation detection and
selective permeability. There are variations in the cellular
structures and functions in the epithelium throughout the
gastrointestinal tract. The epithelium in the mouth, pharynx,
esophagus and anal canal is mainly a protective, nonkeratinized,
squamous epithelium that has a protective role against abrasion and
wear-and-tear from mechanical movements of food particles that are
chewed and swallowed (mouth, pharynx, and esophagus) or
undigested/unabsorbed substances eliminated by defecation (anal
canal). The epithelium of the stomach is composed of several kinds
of cells. Columnar cells, present in a single layer, participate
minimally in absorption and secretion. Goblet cells produce mucus
and participate in protective and mechanical functions.
Enteroendocrine cells participate in the secretion of
gastrointestinal hormones. Additionally, the columnar epithelial
lining of the stomach has millions of gastric pits, which lead to
gastric glands. Various types of specialized epithelial cells
located in these gastric glands produce gastric juice that contains
pepsin (an enzyme produced by Chief cells and needed for protein
digestion), intrinsic factor (needed for absorption of vitamin B12)
and hydrochloric acid to decontaminate food and activate pepsin)
produced by Parietal cells, plus mucus (produced by surface mucous
cells and mucous neck cells) in the stomach. Simple columnar
epithelia, with microvilli, line the lumen to facilitate the role
of the small intestine as the primary absorptive organ in the body;
as the absorptive function of the large intestine is not as great
as that of the small intestine, microvilli are not present in
epithelia of the large intestine. Within the large intestine,
protective mucus is produced in copious amounts and goblet cells
are abundant. The epithelial lining provides an important defense
barrier against microbial pathogens throughout the GI tract.
[0008] The development of intestinal epithelium involves three
major phases: 1) an early phase of epithelial proliferation and
morphogenesis; 2) an intermediate period of cellular
differentiation in which the distinctive cell types characteristic
of intestinal epithelium appear; and 3) a final phase of
biochemical and functional maturation (Mathan, M. P., et al. Am. J.
Anat. 146(1):73-92. 1976; Hirano, S. and Kataoka, K. Arch. Histol.
Jpn. 49(3):333-48. 1986; Bjerknes, M. and Cheng, H. Am. J. Physiol.
Gastrointest. Liver Physiol. 283(3):G767-77. 2002; Brittan, M. and
Wright, N. A. J. Pathol. 197(4):492-5. 2002; Potten, C. et al. Cell
Prolif. 36(3):115-29. 2003; Sancho, E., et al. Curr. Opin. Cell.
Biol. 15(6):763-70. 2003; Stappenbeck, T., et al. Proc. Natl. Acad.
Sci. USA. 100(3):1004-9. 2003).
[0009] Intestinal crypts, located at the base of villi, contain
stem cells (Burgess, D., et al. J. Cell Biol. 109(5):2139-44. 1989;
Weiser, M., et al., Immnunol. Invest. 18(1-4):417-30. 1989;
Bjerknes, M. and Cheng, H. Gastroenterol. 116(1):7-14. 1999;
Brittan, M. and Wright, N. A. J. Pathol. 197(4):492-5. 2002), which
supply the entire epithelial cell surface with a variety of
epithelial cell subtypes (Brink, G. R., et al., Science, 294:2115.
2001; Burgess, D., et al. J. Cell Biol. 109(5):2139-44. 1989;
Weiser, M., et al., Immnunol. Invest. 18(1-4):417-30. 1989;
Quaroni, A. and Beaulieu, J. Gastroenterol., 113(4):1198-213.
1997). These specialized cells provide for an external
environment-internal environment interface, ion and fluid secretion
and reabsorption (Sanderson, I., et al., Gut. 38(6):853-8. 1996),
antigen recognition (Hoyne, G., et al. Immunol. 80(2):204-8. 1993;
Neutra, M., and Kraehenbuhl, J. Am. J. Trop. Med. Hyg. 50(5
Suppl.):10-3. 1994; Balimane, P., et al. J. Pharmacol. Toxicol.
Methods. 44(1):301-12. 2000), hormone secretion (Schuerer-Maly, C.,
et al. Immunol. 81(1):85-91. 1994; Panja, A., et al. Clin Exp
Immunol 100(2):298-305. 1995), and surface protection (Flemstrom,
G. and Garner, A. Ciba Found Symp. 109:94-108. 1984; Schuerer-Maly,
C., et al. Immunol. 81(1):85-91. 1994; Kindon, H., et al.
Gastroenterol. 109(2):516-23. 1995; Panja, A., et al. Clin Exp
Immunol 100(2):298-305. 1995; Podolsky, D. K. Gastroenterol.
32(1):122-6. 1997).
[0010] The epithelium forms upon stem cell differentiation
(Brittan, M., and Wright, N. A. Gut. 53:899-910. 2004) within the
intestinal tract. Stem cells are undifferentiated cells having high
proliferative potential with the ability to self-renew. Stem cells
may generate daughter cells that may undergo terminal
differentiation into more than one distinct cell type (Morrison,
S., et al. Cell 88(3):287-981997. 1997). Pluripotent (a cell that
is able to differentiate into many cell types) stem cells undergo
further specialization into multipotent progenitor cells that then
give rise to functional cells. For example, hematopoietic stem
cells give rise to red blood cells, white blood cells, and
platelets. Mesenchymal stem cells are multipotent cells that are
capable of differentiating along several lineage pathways,
including, but not limited to, chondrocytes, osteoblasts,
adipocytes, fibroblasts, marrow stroma, and other tissues of
mesenchymal origin. Epithelial stem cells give rise to the various
types of skin cells; and muscle satellite cells contribute to
differentiated muscle tissue. The technologies for retrieval, and
maintenance of such cells in an undifferentiated state, of stem
cells and growing them in vitro have been the subject of study.
[0011] Molecular Markers of Gastrointestinal Epithelial Stem
Cells
[0012] The surfaces of all cells in the body are coated with
specialized protein receptors that have the capability to
selectively bind or adhere to other signaling molecules (Weiss and
Littman Cell 76.263-74.1994). These receptors and the molecules
that bind to them are used for communicating with other cells and
for carrying out proper cell functions in the body. Each cell type
has a certain combination of receptors, or markers, on their
surface that makes them distinguishable from other kinds of
cells.
[0013] Stem cell markers are given short-hand names based on the
molecules that bind to the corresponding stem cell surface
receptors. A combination of multiple markers frequently is used to
identify a particular stem cell type. Researchers often identify
stem cells in shorthand by a combination of marker names reflecting
the marker's presence (+) or absence (-). For example, a special
type of hematopoietic stem cell from blood and bone marrow called
"side population" (or "SP") is described as (CD34-/low, c-Kit+,
Sca-1+).
[0014] The following markers commonly are used by skilled artisans
to identify stem cells and to characterize differentiated cell
types (see http://stemcells.nih.gov/info/scireport/appendixE.asp;
visited Dec. 28, 07):
TABLE-US-00001 Marker Cell Type Notes CD34 Hematopoietic a highly
glycosylated type I transmembrane protein stem cell (HSC),
expressed on 1-4% of bone marrow cells muscle satellite,
endothelial progenitor CD38 immature T and a type II transmembrane
protein found on immature T and B cells B cells but not most mature
peripheral lymphocytes CD41 platelets and the integrin .alpha.IIb
subunit megakaryocytes CD45 WBC progenitor the leukocyte common
antigen found on all cells of hematopoietic origin CD105
Endothelial cells a disulfide-linked homodimer found on endothelial
cells but absent from most T and B cells CD133 primitive a
pentaspan transmembrane glycoprotein hematopoietic progenitors CD3
T cells a member of the T cell receptor complex CD4, CD8 Mature T
cells Cell-surface protein markers specific for mature T lymphocyte
(WBC subtype) CD7 Early T cells An early T cell lineage marker CD10
early T and B a type II membrane metalloprotease cell precursors
CD13 granulocytes, a type II membrane metalloprotease monocytes and
their precursors CD14 myelomonocytic a GPI-linked protein expressed
mainly on myelomonocytic lineage lineage cells CD19 B cells a
component of the B cell antigen signaling complex CD33
Myelomonocytic a sialic acid binding protein absent from
pluripotent stem precursors cells that appears on myelomonocytic
precursors after CD34 CD38 WBC lineages A Cell-surface molecule
that identifies WBC lineages. Selection of CD34+/CD38- cells allows
for purification of HSC populations CD44 Mesenchymal A type of
cell-adhesion molecule used to identify specific types of
mesenchymal cells CD56 NK cells an isoform of the neural adhesion
molecule found exclusively on natural killer (NK) cells; CD127
lymphocytes the high affinity interleukin 7 receptor expressed on
lymphocytes CD138 Immature B an extracellular matrix receptor found
on immature B cells cells and plasma and plasma cells cells
Glycophorin A RBCs, embryoid a sialoprotein present on human RBCs
and embryoid precursors precursors CD90 prothymocytes a GPI-cell
anchored molecule found on prothymocyte cells in humans- c-kit HSC,
MSC Cell-surface receptor on BM cell types that identifies HSC and
MSC; binding by fetal calf serum (FCS) enhances proliferation of ES
cells, HSCs, MSCs, and hematopoietic progenitor cells Fetal liver
endothelial Cell-surface receptor protein that identifies
endothelial cell kinase-1 progenitor; marker of cell-cell contacts
(Flk-1)
[0015] There are no universally accepted molecular markers that
identify gastrointestinal stem cells. However, several markers have
been used to identify stem cells in small and large intestinal
tissues. These include: .beta.-1-integrin (Jones, R., et al. J Cell
Biol 175(3):505-14. 2006), mushashi-1 (Booth, C. and Potten, C. J
Clin Invest 105(11):1493-9. 2000; Potten, C., et al.
Differentiation 71(1):28-41. 2003; Yen, T. and Wright, N. Stem Cell
Rev 2(3):203-12. 2006), CD45 (Dekaney, C., et al. Gastroenterology
129(5):1567-80. 2005; Lynch, L., et al. J Immunol 176(9):5199-204.
2006), and cytokeratin (Raju, G. Ann Acad Med Singapore
18(3):298-301. 1989).
[0016] CD45 (also called the common leukocyte antigen, T220 and
B220 in mice), is a transmembrane protein with cytoplasmic protein
tyrosine phosphatase (PTP) activity. CD45 is found in hematopoietic
cells except erythrocytes and platelets. It has several isoforms
that can be seen in the various stages of differentiation of normal
hematopoietic cells (Greaves, M., et al. Blood 61(4):628-39. 1983;
Alt, F., et al. Immunol Rev 89:5-30. 1986; Thomas, M. L. Ann. Rev
Immunol 7:339-69. 1989; Weiss, A. and Littman, D. Cell
76(2):263-74. 1994).
[0017] Mushashi-1 is an early developmental antigenic marker of
stem cells and glial/neuronal cell precursor cells (Jones, P., et
al. Cell 80(1):83-93. 1995; Kayahara, T., et al. FEBS Lett
535(1-3):131-5. 2003; Potten, C., et al. Differentiation
71(1):28-41. 2003; Asai, R., et al. Dev Growth Differ 47(8):501-10.
2005).
[0018] .beta.-1-integrin (CD29, fibronectin receptor), is a
.beta.-subunit of a heterodimer protein member of the integrin
family of proteins that are membrane receptors involved in cell
adhesion and recognition (Pytela, R., et al. (1985). Cell
40(1):191-8. 1985; Fujimoto, K., et al. Gastroenterol.
123(6):1941-8. 2002; Shackleton, M., et al. Nature 439(7072):84-8.
2006).
[0019] Cytokeratins are intermediate filament proteins found in the
intracytoplasmic cytoskeleton of the cells that comprise epithelial
tissue. Over twenty different cytokeratin polypeptides have been
identified (Franke, W., et al. Differentiation 15(1):7-25. 1979;
Steinert, P., et al. Cell 42(2):411-20. 1985).
[0020] There are four main epithelial cell lineages in the
gastrointestinal tract: columnar epithelial cells, goblet cells,
enteroendocrine chromaffin cells, and Paneth cells. Several
molecular markers have been used to identify these cells (Simon, T.
and Gordon, J. Curr Opin Genet Dev 5(5):577-86. 1995).
[0021] The markers used to identify columnar epithelial cells
include: intestinal alkaline phosphatase (ALP1), sucrase isomaltase
(SI), sodium/glucose cotransporter (SLGT1), dipeptidyl-peptidase 4
(DPP4), and CD26. Intestinal alkaline phosphatase (E.C. 3.1.3.1) is
a membrane-bound enzyme localized in the brush border of
enterocytes in the human intestinal epithelium. Sucrase-isomaltase
(SI, EC 3.2.1.48) is an enterocyte-specific small intestine
brush-border membrane disaccharidase. Dipeptidyl-peptidase 4 (E.C.
3.4.14.5) is a membrane bound serine-type peptidase. Sodium/glucose
transporter (SGLT) mediates transport of glucose into epithelial
cells. SGLT belongs to the sodium/glucose cotransporter family
SLCA5. Two different SGLT isoforms, SGLT1 and SGLT2, have been
identified to mediate renal tubular glucose reabsorption in humans.
Both of them are characterized by their different substrate
affinity(Panayotova-Heiermann et al. J Biol Chem
271.10029-34.1996). SGLT1 transports glucose as well as galactose,
and is expressed both in the kidney and in the intestine. CD26 is a
multifunctional protein of 110 KDa strongly expressed on epithelial
cells (kidney proximal tubules, intestine, and bile duct) and on
several types of endothelial cells and fibroblasts and on leukocyte
subsets (Kikkawa et al. Biochim Biophys Acta 1751.45-51.2005;
Tokunaga et al. J Histochem Cytochem 55.735-44.2007).
[0022] The markers used to identify goblet cells include mucin 2
(MUC2) and trefoil factor 3 (TFF3) (Bergstrom et al. Infect Immun
76.796-811.2008). Mucin-2, a secreted gel-forming mucin, is the
major gel-forming mucin secreted by goblet cells of the small and
large intestines and the main structural component of the mucus
gel. Intestinal trefoil factor 3 is a nonmucin protein and a
product of fully differentiated goblet cells (Chinery, R., et al.
Genomics 32(2):281-4. 1996; Ogata, Inoue et al. 1998; Itoh, H., et
al. Biochem J 341 (Pt 2):461-72. 1999; Yamachika, T., et al. Clin
Cancer Res 8(5):1092-9. 2002; Bergstrom, K, et al. (2008). Infect
Immun 76(2):796-811. 2008).
[0023] The markers used to identify enteroendocrine chromaffin
cells include chromogranin A (CHGA) (Ho, S., et al. Gastroenterol.
97(2):392-404. 1989; Wimley, W., et al. Protein Sci 3(9):1362-73.
1994; Moller, P., et al. Am J Pathol 149(1):9-13. 1996; Ouellette,
A. J. and Selsted, M. Faseb J 10(11):1280-9. 1996; Taupin, D., et
al. Lab Invest 75(1):25-32. 1996; Turner, J. R. and Odze, R.
(1996). Hum Pathol 27(1):63-9. 1996; Ronnblom, A., et al. J Intern
Med 245(4):91-7 1999; Wong, W., et al. (2000). J Pathol
190(1):107-13. 2000; Andersson, N., et al. Biochem Biophys Res
Commun 332(2):404-10. 2005; Stewart, C. and Hillery, S. J Clin
Pathol 60(11):1284-9. 2007) and synaptophysin (SYP) (Andersson, N.,
et al. Biochem Biophys Res Commun 332(2):404-10. 2005).
Chromogranin A (CHGA) and its derived peptides, which are stored
and released from dense-core secretory granules of neuroendocrine
cells, have been implicated as playing multiple roles in the
endocrine, cardiovascular, and nervous systems. Synaptophysin I
(SYP) is a synaptic vesicle membrane protein that is ubiquitously
expressed throughout the brain without a definite synaptic
function.
[0024] The markers used to identify Paneth cells include lysozyme,
defensin, and matrix metallopeptidase 7 (MMP7) (Ho, S., et al.
Gastroenterol. 97(2):392-404. 1989). Lysozyme (LYZ or muramidase)
(E.C. 3.2.1.17) catalyzes the hydrolysis of 1,4-beta-linkages
between N-acetylmuramic acid and N-acetyl-D-glucosamine residues in
a peptidoglycan and between N-acetyl-D-glucosamine residues in
chitodextrins. Defensins (DEFA1) are small peptides that are
produced by leukocytes and epithelial cells. Human defensin
.alpha.-1 is a 3.5-kDa, 30-amino-acid peptide that has shown
effector functions in host innate immunity against some
microorganisms (Semenza, G. Ann. Rev Cell Biol 2:255-313. 1986;
Wimley, W., et al. Protein Sci 3(9):1362-73. 1994; Moller, P., et
al. Am J Pathol 149(1):9-13. 1996; Ouellette, A. and Selsted, M.
Faseb J 10(11):1280-9. 1996; Taupin, D., et al. Lab Invest
75(1):25-32. 1996; Turner, J. and Odze, R. Hum Pathol 27(1):63-9.
1996). Matrix metalloproteinases (MMPs) are an important family of
metal-dependant enzymes that are responsible for the degradation of
extracellular matrix components. MMPs are involved in various
physiologic processes including embryogenesis and tissue
remodeling. They also play a key role in invasion and metastasis of
tumor cells, which require proteolysis of basal membranes and
extracellular matrix (Ayabe, T., et al. J Biol Chem 277(7):5219-28.
2002; Satchell, D., et al. (2003). J Biol Chem 278(16):13838-46.
2003; Weeks, C., et al. J Biol Chem 281(39):28932-42. 2006).
[0025] The epithelial cells on the surfaces of the intestinal lumen
are subjected to a wide range of assaults including microbial,
chemical, and physical forces (Savage, D. C. Am J Clin Nutr
25(12):1372-9. 1972; Keren, D. F. Am J Surg Pathol. 12 Suppl
1:100-5. 1988; Ouellette, A. J. and M. E. Selsted. Faseb J.
10(11):1280-9. 1996; Neutra, M. R. Am J Physiol. 274(5 Pt 1):
G785-91. 1998; Owen, R. L. Semin Immunol 11(3):157-63. 1999;
Neutra, M. R., et al. Nat Immunol 2(11):1004-9. 2001; Otte, J. M.
and Podolsky, D. Am J Physiol Gastrointest Liver Physiol
286(4):G613-26. 2004); thus they also may contribute to
patho-physiologic impairment in diseases. Additionally, these cells
are targets for inflammation, infection, and malignant
transformation.
[0026] Biomarkers for Pathogenesis
[0027] Several biomarkers have been utilized as potential
indicators for pathogenic processes.
[0028] SCYA (small inducible cytokine subfamily) 16 and 20 (or CCL
16 and 20) are members of a family of cytokines characterized by
two adjacent cysteines (C-C) involved in immunoregulatory and
inflammatory processes. They display chemotactic activity for
lymphocytes and monocytes but not for neutrophils (Hieshima et al.
J Biol Chem 272.5846-53.1997). CCL16 has been reported to be
up-regulated selectively by IL-10 in inflammatory cell recruitment
and cytokine and chemokine production during ulcerative colitis
(Pannellini et al. Int J Immunopathol Pharmacol 17.171-80.2004).
This chemokine significantly enhances the effector and the
antigen-presenting function of macrophages and augments the
cytolytic activity T cell which in turn activate caspase-8 via
overexpression of TNF-alpha and Fas ligand in tumor target cells
(Cappello et al. J Leukoc Biol 75.135-42.2004). Intratumoral
injection of adenoviral vectors expressing CCL16 prevented
metastatic spread and cured 63% of mice bearing the 4T1 mammary
adenocarcinoma, a model of spontaneous metastasis (Guiducci et al.
J Immunol 172.4026-36.2004). CCL20 expression in intestinal
epithelial-type cells is induced by proinflammatory cytokines such
as IL-1 and TNF-alpha primarily through activation of NF-kappaB
(Fujiie et al. Int Immunol 13.1255-63.2001).
[0029] Retinoids, which have roles in the modulation of cell
growth, differentiation, and apoptosis, are mediated by nuclear
retinoic acid receptors (RARs) and retinoid X receptors (RXRs)
((Clifford et al. EMBO J 15.4142-55.1996)). Altered expression of
nuclear retinoid receptors is associated with the malignant
transformation of human cells (Zhao et al. Exp Cell Res
219.555-61.1995). RAR beta is the best-studied RAR subtype in the
biology of retinoid effects on carcinogenesis and is the receptor
subtype whose expression is frequently most decreased in lung
cancer. Three different isoforms of this receptor have been
reported in humans: beta1, beta2 and beta4 (Zelent et al. EMBO J
10.71-81.1991). Close investigation of the importance of the
distinct functions of these isoforms in the pathogenesis of cancer
identifies Beta 1 and 2 as tumor suppressors (Petty et al. J Natl
Cancer Inst 97.1645-51.2005), (Soprano and Soprano J Nutr
132.3809S-13S.2002). Isoform beta1 is a fetal isoform not generally
detected in normal tissues of adult humans, although it is
expressed in small-cell lung cancer (Houle et al. Cancer Res
54.365-9.1994). Loss of expression of RARbeta2 is associated with
esophageal squamous cell carcinomas (Ralhan et al. Int J Cancer
118.1077-89.2006), cerebral glioma (Klein et al. Neurochirurgie
51.147-54.2005), and epidermoid lung cancer ((Houle, Rochette-Egly
and Bradley Proc Natl Acad Sci USA 90.985-9.1993). It's
inactivation by hypermethylation is reported in oral premalignant
lesions, head and neck squamous cell carcinomas (HNSCCs) and in
human colon cancer (Youssef et al. Clin Cancer Res
10.1733-42.2004).
[0030] NCAM (neural cell adhesion molecule) is an epithelial cell
adhesion molecule that is found in normal colon epithelium as well
as in colon tumors. Roesler et al reported that this adhesion
molecule was present more often in colon cancers with a more benign
course compared to clinically aggressive tumors of the colon,
leading to the conclusion that this molecule might serve as a tumor
suppressor in colon carcinoma (Roesler et al. Am J Surg
174.251-7.1997).
[0031] The tissue inhibitor of metalloproteinase (TIMP) gene
encodes an extracellular matrix protein. It has been shown to
increase cell death and growth inhibition (via delaying the G1
phase), and thus is presumed to be involved in tumor suppression
(Wang et al. Cancer 112.1325-36.2008; Smith et al. Cytokine
9.770-80.1997). It originally was reported in several human cell
lines including CaCo-2, a colon adenocarcinoma cell line.
((Kishnani et al. Matrix Biol 14.479-88.1995). Lee et al have
demonstrated greater hypermethylation of TIMP3 in colon carcinoma
compared to normal colon mucosa and adenomas (Lee et al. Lab Invest
84.884-93.2004), although a subsequent study by Xu et al showed no
change in the methylation of this gene (Xu et al. World J
Gastroenterol 10.3441-54.2004).
[0032] The small GTP-binding proteins of Rab family have more than
30 proteins that play important roles at defined steps of vesicular
transport in protein secretion and the endocytosis pathway. Rab33B
is a Golgi-specific rab protein; it plays a role in the recycling
of glycosyltransferases from the Golgi to the ER. (Valsdottir et
al. FEBS Lett 508.201-9.2001). No reports linking this specific
protein with any cancer could be found in the literature. Rab32 is
down regulated in colon cancer (Mori et al. Cancer Res
64.2434-8.2004). Rab25 mRNA also was detected in several colon
carcinoma lines, including LIM1215 and HT-29 (Goldenring et al.
Methods Enzymol 329.225-34.2001). Some other members of the Rab
family have been reported to be upregulated and aid in the
development and aggressiveness of liver and several epithelial
cancers (ovarian, breast, skin) (Gebhardt et al. Am J Pathol
167.243-53.2005; Cheng et al. Nat Med 10.1251-6.2004).
[0033] SOD3 (superoxide dismutase 3), a surface bound epithelial
enzyme known to protect cells from oxygen free radical damage, is
underexpressed in human intestinal tumor-derived epithelial cell
(HITEC) lines. In a mouse model, Gao et al have shown that a
chimeric recombinant SOD2/3 reduces lung leakage by 13% in acute
lung injury (Gao et al. Am J Physiol Lung Cell Mol Physiol
284.L917-25.2003).
[0034] Myb (myeloblastosis) family transcription factors, A-Myb,
B-Myb, and c-Myb, also called oncoproteins, share a highly
conserved DNA binding domain and bind to the same DNA sequences,
but have completely different biological roles. A-Myb is regulated
by the cell cycle machinery. The carboxy-terminal domain of A-Myb
itself acts as a cell cycle sensor; its activity is maximal during
the G1/S-transition and the S-phase of the cell cycle. (Ziebold et
al. Curr Biol 7.253-60.1997). This transcription factor has been
linked to the regulation of proliferation and/or differentiation of
normal B cells and is overexpressed in Burkitt's lymphoma cells
(Golay et al. Leuk Lymphoma 26.271-9.1997; Facchinetti et al.
Biochem J 324 (Pt 3).729-36.1997).
[0035] The VCAM1 (vascular cell adhesion molecule 1) gene is a
member of the Ig superfamily and encodes a cell surface
sialoglycoprotein expressed by cytokine IL-6 and TNFalpha in
activated endothelium (Khatib et al. Am J Pathol 167.749-59.2005).
VCAM1 expression is variable in different types of carcinomas; it
is detectable in colon cancers (Banner, Savas and Woda Ultrastruct
Pathol 19.113-8.1995) and liver metastasis (Kitakata et al. Cancer
Res 62.6682-7.2002), but not in adenocarcinoma of lung (Jiang et
al. Mod Pathol 11.1189-92.1998) or esophagus (Heidemann et al. Int
J Oncol 28.77-85.2006), and is downregulated during nodal
metastasis in breast cancer. Madhavan and Heidmann had proposed a
potential role of VCAM-1 in the development of metastasis, since
they found it was strongly expressed in squamous cell carcinoma
(Madhavan et al. Pathol Oncol Res 8.125-8.2002; Heidemann et al.
Int J Oncol 28.77-85.2006). However Lieder's group observed a
gradual decrease in expression of VCAM-1 with progressive
metastatic disease (Lieder et al. Anticancer Res
25.4141-7.2005).
[0036] MSH2 (Muts (Escherichia coli) Homolog 2 (colon cancer,
nonpolyposis Type 1)) is a human analog of the protein found in E.
coli that plays a critical role in DNA nucleotide mismatch repair.
It is well known that deletion of mismatch repair genes results in
microsatellite instability (MSI), which is implicated in 15-20% of
colorectal cancers (Hoops and Traber Hematol Oncol Clin North Am
11.609-33.1997; Lynch and Kaul J Natl Cancer Inst 92.511-2.2000).
According to a recent study by Parc et al, microsatellite unstable
tumors exhibited a better recurrence free survival than
microsatellite stable tumors (Parc et al. Int J Cancer
86.60-6.2000).
[0037] Apoptosis Inhibitor 2 (API2) initially was identified in
mucosa associated lymphoid tumors (MALT) and subsequently has been
shown to inhibit apoptosis in a p53 mediated process (Stoffel and
Le Beau Hum Hered 51.1-7.2001). Carcinogenic cells that have
undergone numerous genetic mutations somehow escape apoptosis.
Without being limited by theory, one likely explanation is
underexpression of API2 in such cells.
[0038] Interferon induced protein 56, referred to as IFI-56K, is
highly inducible by interferon gamma as well as by viral stimuli.
Gene array studies have shown downregulation of this mRNA in
oligodendrogliomas (Huang et al. Oncogene 23.6012-22.2004),
however, large-cell lymphoma-derived cell lines show significant
upregulation (Gaiser et al. J Hematother Stem Cell Res
11.423-8.2002). The literature contains a limited number of reports
about the possible role of this protein.
[0039] Presenilin 2 (PSEN4; Alzheimer disease 4) has been
associated with Alzheimer's disease (AD) and its expression
signifies the induction and/or proliferation of an inflammatory
response in AD brain (Riazanskaia et al. Mol Psychiatry
7.891-8.2002).
[0040] The GTPase Ran regulates multiple cellular functions
throughout the cell cycle, including nucleocytoplasmic transport,
nuclear membrane and spindle assembly (Trieselmann et al. J Cell
Sci 116.4791-8.2003). A gene expression profiling study by
Harousseau et al. correlated abnormal expression of RAN with rapid
relapses of multiple myeloma (Harousseau, Shaughnessy and
Richardson Hematology Am Soc Hematol Educ Program 237-56.2004).
[0041] The Fos gene family consists of 4 members: FOS, FOSB, FOSL1,
and FOSL2. These genes encode leucine zipper proteins that dimerize
with proteins of the JUN family and form the transcription factor
complex AP-1. The FOS proteins function as regulators of cell
proliferation, differentiation, and transformation. They have been
implicated in gliomas (Debinski and Gibo Mol Cancer Res
3.237-49.2005), breast cancer (Belguise et al. Oncogene
24.1434-44.2005) and colorectal adenocarcinomas (Wang et al. Int J
Cancer 101.301-10.2002).
[0042] Gastrointestinal (GI) diseases, such as colon cancer,
inflammatory bowel disease (IBD), short bowel syndrome,
gastroesophageal reflux disease (GERD), irritable bowel syndrome
(IBS), and iatrogenic injuries to the billiary epithelium, have a
significant health and economic impact worldwide. Many treatments
focus on symptom relief, and are not curative. Studies have
suggested the main affected cellular component of these diseases is
the epithelium.
[0043] Colorectal cancer (CRC) is the second leading cause of
cancer death and is the third most common cause of malignancy in
the U.S. While early stage disease can be cured with multimodality
therapies, the majority of patients present with Stage III or IV
disease (Jemal et al. CA Cancer J Clin 58.71-96.2008). The
prognosis for patients with advanced CRC generally is poor.
[0044] Currently, no specific biomarker exists to aid in early
diagnosis and/or management of CRC. While the actual cause of CRC
remains unknown, the source of this disease is transformation of
the epithelial cells lining the colon and or rectum. Previous
studies with colonic tumor epithelial cell lines and/or tissues
indicate that in most cases, tumor development is associated with
aberrant gene expression (Rieker et al. Pathol Oncol Res
14.199-204.2008; Hagymasi et al. Ory Hetil 148.779-85.2007).
Comparisons of the gene and/or protein expression profiles of
normal and cancerous tissues in histological samples have
identified several candidates that may be responsible for cancer
development (Solmi et al. BMC Cancer 6.250.2006; Lepourcelet et al.
Development 132.415-27.2005; Solmi et al. Int J Oncol
25.1049-56.2004; Ohnishi et al. Cancer Res 58.2440-4.1998; Hargest
and Williamson Gut 37.826-9.1995). However, none of these genes or
molecules have proved to be specific. This partially may be due to
the fact that studies that compare differential gene expression
between tumor and normal colorectal epithelium have been limited by
the lack of paired normal and tumor-derived colorectal epithelial
cell lines from the same individual.
[0045] Identification of early stage CRC biomarkers is vital for
earlier CRC detection, biopsies, therapeutic target identification,
drug testing, efficacy and treatment. However, significant
difficulties for identifying these biomarkers exist. Most subjects
with early CRC are asymptomatic, and symptoms usually do not appear
until the cancer has reached an advanced stage (Schneider et al.
Cancer 110.2075-82.2007; Glimelius et al. Acta Oncol
31.645-51.1992). Additionally, many individuals do not avail
themselves of colonoscopy (the best means of early detection) due
to its costly and invasive nature. Therefore, a high percentage of
CRC cases are not detected until the cancer has progressed
substantially, invaded adjoining tissues, and/or metastasized,
which accounts for both the high percentage of reoccurrence and
relatively high mortality rate observed (Walgenbach-Brunagel et al.
J Cell Biochem 104.286-94.2008; Shapero et al. Gastrointest Endosc
65.640-5.2007). Further, the vast majority of CRC biomarkers that
have been discovered do not have a function in vivo, are not very
effective in early detection of CRC, recognize only a small subset
of cancers, and often only detect CRC after it has progressed to
later stages and grades.
[0046] Research efforts have utilized whole tissue sections,
peripheral blood cells, serum and urine. These models do not allow
the identification of the specific cellular, molecular, and genetic
changes that the colonic epithelium undergoes throughout its
malignant transformation.
[0047] Chronic inflammatory diseases, such as, for example,
ulcerative colitis (UC) and Crohn's disease (CD), have been known
for many years to predispose to cancer development (Herszenyi,
Miheller and Tulassay Dig Dis 25.267-9.2007; Svrcek et al.
Histopathology 50.574-83.2007; van Hogezand et al. Scand J
Gastroenterol Suppl 48-53.2002).
[0048] Models incorporating malignant transformed cell lines,
isolated epithelial cells, and animals have been used to study the
functional capabilities, and alterations in the acute and chronic
inflammatory or malignant states of epithelial cells. However, each
of these model systems has limitations and differs markedly from an
in vivo system of primary epithelial cells. For example, malignant
cell lines usually have chromosomal abnormalities that cause
instability. Tumor lines also differ from cell line to cell line,
and from passage to passage (Jobin et al. J Immunol
158.226-34.1997; Khan et al. Anticancer Res 11.1343-8.1991;
Owen-Schaub et al. Cancer Res 54.1580-6.1994). The use of freshly
isolated epithelial cells often is complicated due to the mixture
of several cell types present (T cells, B cells, or macrophages),
especially when diseased tissue is used as cell source).
Additionally, the isolation procedure can alter the phenotype of
the cells by cleaving certain molecules from the cell surface.
Furthermore, surface and crypt epithelial cells may have different
phenotypes and functions and are not usually used in fully
separated populations.
[0049] A model incorporating SV40 transformed epithelial cell lines
established from human, mouse and rat epithelium (Brandsch et al.
Scand J Gastroenterol 33.833-8.1998; Moyer et al. Prog Clin Biol
Res 279.363-72.1988; Quaroni and Beaulieu Gastroenterology
113.1198-213.1997; Schorkhuber et al. Cell Biol Toxicol
14.211-23.1998). has been utilized. Although this model system
allows the cells to retain some specific functions and to survive
indefinitely, there has been concern about the altered growth
control in these cells through the transfection of viral DNA (such
as the large T-antigen gene from SV40) (Hauft et al. J Cell Biol
117.825-39.1992; Kim et al. Dev Biol Stand 94.297-302.1998; Ozer
Prog Mol Subcell Biol 24.121-53.2000). Similarly, findings with
animal model systems show that these do not always mimic precisely
the functional scenarios of human intestinal epithelial cells in
vivo (Seshimo et al. Cell Struct Funct 18.345-54.1993).
[0050] Cell lines of non-transformed human intestinal epithelial
cells and of colorectal cancer cells (derived from primary cells
and not artificially transformed) have long been needed for
advancing research into the cause(s), prevention, treatment, and
cure of colorectal cancer as well as other GI disorders such as,
but not limited to, inflammatory bowel disease (IBD), Barrett's
esophagitis/esophageal adenocarcinoma, gastritis, gastric cancer,
ulcerative colitis (UC), Crohn's Disease (CD), and irritable bowel
syndrome.
[0051] An understanding of the pathogenesis of CRC is heavily
dependent on identifying differences between normal and tumorous
colon epithelium. A non-transformed comparative cell line model
using cells derived from normal and tumorous colon epithelium from
the same individual would provide insight into these differences.
However, no such model has been available. Therefore a need exists
for an adequate preclinical model that provides an environment
similar to the physiological environment of a human
gastrointestinal tract.
[0052] The described invention provides a preclinical, in vitro
system comprising gastrointestinal epithelial stem cell-like
progenitor cells having the structural and functional
characteristics of the normal human gastrointestinal tract. The
system is useful for identifying specific bio-molecules that are
involved in, or indicative of, inflammatory (e.g. ulcerative
colitis and Crohn's disease) processes and/or cancerous
development. Further, the specific biomolecules involved in, or
indicative of, cancerous development may be used to develop and
commercialize diagnostic and/or therapeutic constructs (such as
antibodies, peptides, and small interfering RNA) against these
molecules.
[0053] The described invention also provides a system useful for
simulating microenvironments that may cause malignant changes on
normal Human Intestinal Primary Epithelial Cells (HIPECs) as well
as for evaluating of the effects of various therapeutic agents in
reversing the malignant transformation process.
[0054] The described invention further provides a cell system
useful for identifying biomarkers for colon cancer and other tumors
of the gastrointestinal tract. The described invention moreover
provides a system useful for studying differential alterations in
the cellular machinery of tumorous epithelial stem cells by
comparing these cells with their normal counterparts.
BRIEF DESCRIPTION OF THE DRAWINGS
[0055] FIG. 1 shows biomarkers that were identified in epithelial
cell lines derived from patients with IBD (both UC and CD) samples.
Total RNA was extracted from a panel (normal control (NL);
ulcerative colitis (UC); and Crohn's disease (CD)) of HIPEC
monolayers and processed for RT-PCR (35 cycles) with specific
primers. Electrophoresis of amplified PCR products on 1.8% agarose
gel and subsequent staining with ethidium bromide, showed distinct
bands of predicted molecular weight for MIP1.alpha., RHO GTPase,
MMP1 and Rantes. Detection of glyceraldehyde-3-phosphate
dehydrogenase (G3PDH; housekeeping gene) mRNA in all lanes served
as a control (lower panels) for normalization. All four genes
examined were aberrantly expressed in UC, CD, or in both when
compared to NL control.
[0056] FIG. 2 shows light photomicrographs of one embodiment of
primary epithelial monolayers derived from stem-cell-like
progenitor crypt cells isolated from various segments of the human
gastrointestinal tract of different subjects. (A) ascending colon
segment; (B) transverse colon segment; (C) sigmoid segment, derived
from normal portion of sigmoid resected from a patient with colon
cancer; (D) rectum segment.
[0057] FIG. 3 shows primary cell culture derived from isolated
stem-cell-like progenitor cells derived from different subject's
(A) ascending colon segment; (B) transverse colon segment; (C)
sigmoid segment, derived from normal portion of sigmoid resected
from a patient with colon cancer; (D) a rectum segment grown on
mucosal derived matrix coated plastic surface in culture stained
with anti-cytokeratin-18 antibody. Expression of cytokeratin-18 is
present in 100% of cells.
[0058] FIG. 4 shows flow cytometric analysis of secretory component
(SC), von Willebrand's Factor (VWF), and carcinoembryonic antigen
(CEA) expression by HIPEC lines derived from different subjects.
Dissociated cells from HIPEC monolayers of ascending colon,
transverse colon, sigmoid, and rectum were permeabilized by
treatment with permeafix (for CEA and VWF) and stained with
anti-CEA (right panel--green lines), anti-VWF (middle panel--green
lines) or control antibody (black lines). For the detection of SC,
staining was performed on unpermeabilized cells with an anti-SC
antibody (left panel--blue lines) or an isotype control (left
panel--black lines). All HIPEC lines were positive for secretory
component (left panel) and negative for VWF (middle panel) and SMC
(data not shown). Variable level of CEA expression (middle panel)
was seen in all colonic HIPEC lines). 1=ascending colon;
2=transverse colon; 3=sigmoid; 4=rectum; 5=control cell line.
[0059] FIG. 5 shows HIPEC lines derived from a patient that were
grown on soft agar, stained with 0.1% crystal violet, destained,
and photographed (10.times. magnification). A) and C) normal
colonic HIPEC line; B) and D) control malignant colonic epithelial
cell line HT29. No growth is observed on A) and C); foci formation
and cell growth were observed on B) and D).
[0060] FIG. 6 shows that dual immunofluorescence staining of HIPECs
derived from a patient with antibodies against vimentin (red)
(marker for mesenchymal origin) and cytokeratin 18 (green) (marker
for epithelial origin) demonstrated the presence of both of these
lineage markers at the initial stage (between passage 2-3) of
culture.
[0061] FIG. 7 shows a flow cytometric analysis of cytokeratin 18
(an epithelial marker) and vimentin (a mesenchymal marker)
expression on HIPECs from different patients at various stages
(passages 1-18) of cell growth.
[0062] FIG. 8 shows representative photomicrographs of a paired
human intestinal primary epithelial cell (HIPEC) (upper panel) and
actual tumor derived epithelial cell (HITEC) (lower panel) lines
derived from a patient with colonic adenoma.
[0063] FIG. 9 shows a microarray analysis of over-expressed genes
in tumor derived epithelial cells (HITEC) compared to their normal
mucosa derived counterpart (HIPEC) from the same individual.
[0064] FIG. 10 shows a microarray analysis of under-expressed genes
in tumor derived epithelial cells (HITEC) compared to normal mucosa
derived counterpart (HIPEC) from the same individual.
[0065] FIG. 11 shows RT-PCR amplicons derived from normal cells and
gastrointestinal diseased cells. Lane 1: positive control; Lane 2:
normal CRC cell line; Lane 3, diseased CRC cell line; Lane 4:
non-active ulcerative colitis cell line; Lane 5: active ulcerative
colitis cell line; Lane 6: non-active Crohn's disease cell line;
Lane 7: active Crohn's disease cell line; Row A: IFIT-1 (508 bp);
Row B: EDIL3 (514 bp); Row C: PCKS5 (506 bp); Row D: BST2 (305 bp);
Row E: RGS2 (361 bp); Row F: RASA2 (515 bp); Row G: TNFAIP6 (558
bp); Row H: API2 (698 bp); Row I: TIMP3 (611 bp); Row J: STX11 (745
bp); Row K: STX5 (523 bp); Row L: BT (508 bp).
[0066] FIG. 12 shows an immunohistochemical comparison of the
differential expression of SOD3 between cancer and normal colonic
tissue from patients with CRC. Right panel: cancerous tissue; left
panel: normal counterpart.
[0067] FIG. 13 shows immunohistochemical comparison of the
differential expression of TIMP3 between cancer and normal colonic
tissue from patients with CRC. Right panel: cancerous tissue; left
panel: normal counterpart.
[0068] FIG. 14 shows immunohistochemical comparison of the
differential expression of IFIT-1 between cancer and normal colonic
tissue from patients with CRC. Right panel: cancerous tissue; left
panel: normal counterpart.
[0069] FIG. 15 shows immunohistochemical comparison of the
differential expression of PCSK5 between cancer and normal colonic
tissue from patients with CRC. Right panel: cancerous tissue; left
panel: normal counterpart.
SUMMARY
[0070] According to one aspect, the described invention provides a
method for identifying a therapeutic target to treat a colon cancer
in a subject in need thereof, the method comprising the steps: (a)
isolating normal differentiable segment-specific human stem
cell-like progenitor cells from normal mucosal tissue of the
subject derived from at least one normal gastrointestinal segment;
(b) isolating diseased differentiable segment-specific human stem
cell-like progenitor cells from diseased mucosal tissue derived
from at least one segment of the subject's diseased human
gastrointestinal segment; (c) cultivating the normal differentiable
segment-specific human stem cell-like progenitor cells from step
(a) on a biosimilar matrix environment formed from the normal
mucosal tissue derived from the at least one normal human
gastrointestinal segment to produce a normal human intestinal
primary epithelial cell line; (d) cultivating the diseased
differentiable segment-specific human stem cell-like progenitor
cells from step (b) on a biosimilar matrix environment formed from
the diseased mucosal tissue of step (b) to produce a diseased human
intestinal primary epithelial cell line; (e) exposing the normal
human intestinal primary epithelial cell line of step (c) and the
diseased human intestinal primary epithelial cell line of step (d)
to a therapeutic agent; (f) measuring the level of expression of a
biomarker, wherein the level of expression of the biomarker is
measured in the normal human intestinal primary epithelial cell
line of step (e) and in the diseased human intestinal primary
epithelial cell line of step (e); and (g) identifying a therapeutic
target for the treatment of colon cancer by comparing the level of
expression of the biomarker in the normal human intestinal primary
cell line of step (f) and in the diseased human intestinal primary
epithelial cell line of step (f). According to one embodiment, the
biomarker is selected from the group consisting of STX5A, GZMB,
PCSK5, and SOD3. According to another embodiment, step (f) further
comprises the step of performing an assay that detects at least one
of (i) at least one overexpressed gene in a sample obtained from
the subject and (ii) at least one underexpressed gene in a sample
obtained from the subject. According to another embodiment, the
assay in step (f) is a microarray hybridization assay. According to
another embodiment, the cell lines of step (f) are compared by
immunoassay. According to another embodiment, the gastrointestinal
segment is at least one gastrointestinal segment selected from the
group consisting of an esophagus segment, a stomach segment, a
jejunum segment, an ileum segment, a duodenum segment, an ascending
colon segment, a transverse colon segment, a sigmoid colon segment,
or a rectum segment. According to another embodiment, the normal
differentiable segment-specific human stem cell-like progenitor
cells have a phenotype of at least cytokeratin (+) and
.beta.-1-integrin(+). According to another embodiment, the normal
differentiable segment-specific human stem cell-like progenitor
cells have a phenotype of cytokeratin (+), .beta.-1-integrin(+),
defensin-5(+), trefoil factor-3(+), mucin-2(+), chomogranin-A(+),
intestinal alkaline phosphatase(+), and lysozyme(+).
[0071] According to another aspect, the described invention
provides a method for identifying at least one therapeutic target
to treat ulcerative colitis in a subject in need thereof, the
method comprising the steps: (a) isolating normal differentiable
segment-specific human stem cell-like progenitor cells from normal
mucosal tissue of the subject derived from at least one normal
gastrointestinal segment; (b) isolating diseased differentiable
segment-specific human stem cell-like progenitor cells from
diseased mucosal tissue derived from at least one segment of the
subject's diseased human gastrointestinal segment; (c) cultivating
the normal differentiable segment-specific human stem cell-like
progenitor cells from step (a) on a biosimilar matrix environment
formed from the normal mucosal tissue derived from the at least one
normal human gastrointestinal segment to produce a normal human
intestinal primary epithelial cell line; (d) cultivating the
diseased differentiable segment-specific human stem cell-like
progenitor cells from step (b) on a biosimilar matrix environment
formed from the diseased mucosal tissue of step (b) to produce a
diseased human intestinal primary epithelial cell line; (e)
exposing the normal human intestinal primary epithelial cell line
of step (c) and the diseased human intestinal primary epithelial
cell line of step (d) to a therapeutic agent; (f) measuring the
level of expression of a biomarker, wherein the level of expression
of the biomarker is measured in the normal human intestinal primary
epithelial cell line of step (e) and in the diseased human
intestinal primary epithelial cell line of step (e); and (g)
identifying a therapeutic target for the treatment of ulcerative
colitis by comparing the level of expression of the biomarker
within the normal human intestinal primary cell line of step (f)
and in the diseased human intestinal primary epithelial cell line
of step (f). According to another embodiment, the biomarker is
selected from the group consisting of BST2, MMP1, CACNA1E, PCSK5,
GSTT1, SOD3, IL1RL1, ARH1 and IFIT156. According to another
embodiment, step (f) further comprises the step of performing an
assay that detects at least one of (i) at least one overexpressed
gene in a sample obtained from the subject or (ii) at least one
underexpressed gene in a sample obtained from the subject.
According to another embodiment, the assay in step (f) is a
microarray hybridization assay. According to another embodiment, in
step (d), the biomarker is in a regulated state. According to
another embodiment, the cell lines of step (f) are compared by an
immunoassay. According to another embodiment, the gastrointestinal
segment is an esophagus segment, a stomach segment, a duodenum
segment, a jejunum segment, an ileum segment, an ascending colon
segment, a transverse colon segment, a sigmoid colon segment, or a
rectum segment. According to another embodiment, the normal
differentiable segment-specific human stem cell-like progenitor
cells have a phenotype of at least cytokeratin (+) and
.beta.-1-integrin(+). According to another embodiment, the normal
differentiable segment-specific human stem cell-like progenitor
cells have a phenotype of cytokeratin (+), .beta.-1-integrin(+),
defensin-5(+), trefoil factor-3(+), mucin-2(+), chomogranin-A(+),
intestinal alkaline phosphatase(+), and lysozyme(+).
[0072] According to another aspect, the described invention
provides a method for identifying at least one therapeutic target
to treat Crohn's disease in a subject in need thereof, the method
comprising the steps: (a) isolating normal differentiable
segment-specific human stem cell-like progenitor cells from normal
mucosal tissue of the subject derived from at least one normal
gastrointestinal segment; (b) isolating diseased differentiable
segment-specific human stem cell-like progenitor cells from
diseased mucosal tissue derived from at least one segment of the
subject's diseased human gastrointestinal segment; (c) cultivating
the normal differentiable segment-specific human stem cell-like
progenitor cells from step (a) on a biosimilar matrix environment
formed from the normal mucosal tissue derived from the at least one
normal human gastrointestinal segment to produce a normal human
intestinal primary epithelial cell line; (d) cultivating the
diseased differentiable segment-specific human stem cell-like
progenitor cells from step (b) on a biosimilar matrix environment
formed from the diseased mucosal tissue of step (b) to produce a
diseased human intestinal primary epithelial cell line; (e)
exposing the normal human intestinal primary epithelial cell line
of step (c) and the diseased human intestinal primary epithelial
cell line of step (d) to a therapeutic agent; (f) measuring the
level of expression of a biomarker, wherein the level of expression
of the biomarker is measured in the normal human intestinal primary
epithelial cell line of step (e) and in the diseased human
intestinal primary epithelial cell line of step (e); and (g)
identifying a therapeutic target for the treatment of Crohn's
disease by comparing the level of expression of the biomarker in
the normal human intestinal primary cell line of step (f) and in
the diseased human intestinal primary epithelial cell line of step
(f). According to another embodiment, the biomarker is selected
from the group consisting of CACNA1E, GSTT1, PCSK5, COL15A1, EDIL3
and MM2. According to another embodiment, step (f) further
comprises the step of performing an assay that detects at least one
of (i) at least one overexpressed gene in a sample obtained from
the subject or (ii) at least one underexpressed gene in a sample
obtained from the subject. According to another embodiment, the
assay in step (f) is a microarray hybridization assay. According to
another embodiment, in step (d), the biomarker is in a regulated
state. According to another embodiment, the cell lines of step (f)
are compared by an immunoassay. According to another embodiment,
the gastrointestinal segment is an esophagus segment, a stomach
segment, a jejunum segment, an ileum segment, a duodenum segment,
an ascending colon segment, a transverse colon segment, a sigmoid
colon segment, or a rectum segment. According to another
embodiment, the normal differentiable segment-specific human stem
cell-like progenitor cells have a phenotype of at least cytokeratin
(+) and .beta.-1-integrin(+). According to another embodiment, the
normal differentiable segment-specific human stem cell-like
progenitor cells have a phenotype of cytokeratin (+),
.beta.-1-integrin(+), defensin-5(+), trefoil factor-3(+),
mucin-2(+), chomogranin-A(+), intestinal alkaline phosphatase(+),
and lysozyme(+).
[0073] According to another aspect, the described invention
provides a method for identifying at least one therapeutic target
to treat a gastrointestinal disease in a subject in need thereof,
the method comprising the steps: (a) isolating normal
differentiable segment-specific human stem cell-like progenitor
cells from normal mucosal tissue of the subject derived from at
least one normal gastrointestinal segment; (b) isolating diseased
differentiable segment-specific human stem cell-like progenitor
cells from diseased mucosal tissue derived from at least one
segment of the subject's diseased human gastrointestinal segment;
(c) cultivating the normal differentiable segment-specific human
stem cell-like progenitor cells from step (a) on a biosimilar
matrix environment formed from the normal mucosal tissue derived
from the at least one normal human gastrointestinal segment to
produce a normal human intestinal primary epithelial cell line; (d)
cultivating the diseased differentiable segment-specific human stem
cell-like progenitor cells from step (b) on a biosimilar matrix
environment formed from the diseased mucosal tissue of step (b) to
produce a diseased human intestinal primary epithelial cell line;
(e) exposing the normal human intestinal primary epithelial cell
line of step (c) and the diseased human intestinal primary
epithelial cell line of step (d) to a therapeutic agent; and (f)
identifying at least one biomarker as a therapeutic target for
treating a gastrointestinal disease by comparing the normal human
intestinal primary epithelial cell line and the diseased human
intestinal primary epithelial cell line of step (e). According to
another embodiment, the gastrointestinal disease is selected from
the group consisting of achalasia, Barrett's oesophagus, colorectal
cancer, gastric cancer, oesophageal cancer, coeliac disease,
colitis, Crohn's disease, diverticulosis, diverticulitis,
gastritis, inflammatory bowel disease, ulcerative colitis,
irritable bowel syndrome, microscopic colitis, collagenous colitis,
lymphocytic colitis, pancreatitis, reflux oesophagitis, and
ulcerative colitis. According to another embodiment, step (f)
further comprises the step of performing an assay that detects at
least one of (i) at least one overexpressed gene in a sample
obtained from the subject and (ii) at least one underexpressed gene
in a sample obtained from the subject. According to another
embodiment, the assay in step (f) is a microarray hybridization
assay. According to another embodiment, step (f) further comprises
the step of comparing telomerase activity of the normal human
intestinal primary epithelial cell line of step (c) and the
cancerous human intestinal primary epithelial cell line of step (d)
after exposing the normal human intestinal primary epithelial cell
line of step (c) and the cancerous human intestinal primary
epithelial cell line of step (d) to a therapeutic agent. According
to another embodiment, in step (d) the biomarker is in a regulated
state. According to another embodiment, the cell lines of step (f)
are compared by an immunoassay. According to another embodiment,
the gastrointestinal disease is colon cancer. According to another
embodiment, the gastrointestinal segment is an esophagus segment, a
stomach segment, a jejunum segment, an ileum segment, a duodenum
segment, an ascending colon segment, a transverse colon segment, a
sigmoid colon segment, or a rectum segment. According to another
embodiment, the normal differentiable segment-specific human stem
cell-like progenitor cells have a phenotype of at least cytokeratin
(+) and .beta.-1-integrin(+). According to another embodiment, the
normal differentiable segment-specific human stem cell-like
progenitor cells have a phenotype of cytokeratin (+),
.beta.-1-integrin(+), defensin-5(+), trefoil factor-3(+),
mucin-2(+), chromogranin-A(+), intestinal alkaline phosphatase(+),
and lysozyme(+).
[0074] According to another aspect, the described invention
provides a method for monitoring the therapeutic efficacy of a
therapeutic agent for treating a gastrointestinal inflammatory
disease, the method comprising the steps: (a) isolating normal
differentiable segment-specific human stem cell-like progenitor
cells from normal mucosal tissue of the subject derived from at
least one normal gastrointestinal segment; (b) isolating diseased
differentiable segment-specific human stem cell-like progenitor
cells from diseased mucosal tissue derived from at least one
segment of the subject's diseased human gastrointestinal segment;
(c) cultivating the normal differentiable segment-specific human
stem cell-like progenitor cells from step (a) on a biosimilar
matrix environment formed from the normal mucosal tissue derived
from the at least one normal human gastrointestinal segment to
produce a normal human intestinal primary epithelial cell line; (d)
cultivating the diseased differentiable segment-specific human stem
cell-like progenitor cells from step (b) on a biosimilar matrix
environment formed from the diseased mucosal tissue of step (b) to
produce a diseased human intestinal primary epithelial cell line;
(e) exposing the normal human intestinal primary epithelial cell
line of step (c) and the diseased human intestinal primary
epithelial cell line of step (d) to a therapeutic agent; (f)
measuring the level of expression of a biomarker, wherein the level
of expression of the biomarker is measured in the normal human
intestinal primary epithelial cell line of step (e) and in the
diseased human intestinal primary epithelial cell line of step (e);
(g) correlating the difference between the level of expression of
the biomarker measured in the normal human intestinal primary
epithelial cell line and the level of expression of the biomarker
measured in the diseased human intestinal primary epithelial cell
with the therapeutic efficacy of the therapeutic agent. According
to another embodiment, the biomarker is selected from the group
consisting of STX5A, GZMB, and PCSK5. According to another
embodiment, the biomarker is selected from the group consisting of
BST2, MMP1, CACNA1E, PCSK5, GSTT1, IL1RL1, ARH1 and IFIT156.
According to another embodiment, the biomarker is SOD3. According
to another embodiment, the gastrointestinal segment is at least one
gastrointestinal segment selected from the group consisting of an
esophagus segment, a stomach segment, a jejunum segment, an ileum
segment, a duodenum segment, an ascending colon segment, a
transverse colon segment, a sigmoid colon segment, or a rectum
segment. According to another embodiment, the normal differentiable
segment-specific human stem cell-like progenitor cells have a
phenotype of at least cytokeratin (+) and .beta.-1-integrin(+).
According to another embodiment, the normal differentiable
segment-specific human stem cell-like progenitor cells have a
phenotype of cytokeratin (+), .beta.-1-integrin(+), defensin-5(+),
trefoil factor-3(+), mucin-2(+), chomogranin-A(+), intestinal
alkaline phosphatase(+), and lysozyme(+). According to another
embodiment, the gastrointestinal disease is selected from the group
consisting of achalasia, Barrett's oesophagus, colorectal cancer,
gastric cancer, oesophageal cancer, coeliac disease, colitis,
Crohn's disease, diverticulosis, diverticulitis, gastritis,
inflammatory bowel disease, ulcerative colitis, irritable bowel
syndrome, microscopic colitis, collagenous colitis, lymphocytic
colitis, pancreatitis, reflux oesophagitis, and ulcerative
colitis.
DETAILED DESCRIPTION
Glossary
[0075] The term "analyze" (or "analysis") in its various
grammatical forms as used herein refers to the process whereby a
material is separated into constituent parts or elements or
essential features. Analyses according to the present invention may
be performed by numerous assays including, but not limited to,
ELISA, HPLC, PCR, real-time PCR, permeability assays,
immunochemistry, flow cytometry, TEER, SDS-PAGE, microscopic
analysis, fluorescence microscopy, electron microscopy, NMR, LC-MS,
or other analytical or bioanalytical assays known to artisans of
skill in the art.
[0076] As used herein, the term "antibody" includes, by way of
example, both naturally occurring and non-naturally occurring
antibodies. Specifically, the term "antibody" includes polyclonal
antibodies and monoclonal antibodies, and fragments thereof.
Furthermore, the term "antibody" includes single chain antibodies,
chimeric antibodies, wholly synthetic antibodies, and fragments
thereof. The terms "epitope" and "antigenic determinant" are used
interchangeably herein to refer to the site on a molecule that an
antibody combining site (ACS) recognizes and with which that
antigenic antibody binds (combines). The epitope may be primary,
secondary, or tertiary-sequence related.
[0077] The term "biomarkers" (or "biosignatures") as used herein
refers to peptides, proteins, nucleic acids, antibodies, genes,
metabolites, or any other substances used as indicators of a
biologic state. It is a characteristic that is measured objectively
and evaluated as a cellular or molecular indicator of normal
biologic processes, pathogenic processes, or pharmacologic
responses to a therapeutic intervention. The term "indicator" as
used herein refers to any substance, number or ratio derived from a
series of observed facts that may reveal relative changes as a
function of time; or a signal, sign, mark, note or symptom that is
visible or evidence of the existence or presence thereof. Once a
proposed biomarker has been validated, it may be used to diagnose
disease risk, presence of disease in an individual, or to tailor
treatments for the disease in an individual (choices of drug
treatment or administration regimes). In evaluating potential drug
therapies, a biomarker may be used as a surrogate for a natural
endpoint, such as survival or irreversible morbidity. If a
treatment alters the biomarker, and that alteration has a direct
connection to improved health, the biomarker may serve as a
surrogate endpoint for evaluating clinical benefit. Clinical
endpoints are variables that can be used to measure how patients
feel, function or survive. Surrogate endpoints are biomarkers that
are intended to substitute for a clinical endpoint; these
biomarkers are demonstrated to predict a clinical endpoint with a
confidence level acceptable to regulators and the clinical
community.
[0078] The terms "bio-similar matrix environment" and "BSME" are
used interchangeably herein to refer to a growth substrate upon
which human gastrointestinal stem-cell-like progenitor cells may be
grown. A segment-specific BSME (herein referred to as "SS-BSME") is
formed when each BSME is supplemented with gastrointestinal mucosal
tissue derived growth supporting factors (MTD-GSF) appropriate for
the isolated viable stem-cell-like progenitor cells of the
gastrointestinal mucosal tissue segment of the human
gastrointestinal tract that the BSME is to host. Thus, in some
embodiments, stomach-BSME is supplemented with growth supporting
factors derived from the mucosal tissues of the stomach. In some
embodiments, duodenum-BSME is supplemented with growth supporting
factors derived from the mucosal tissues of the duodenum. In some
embodiments, jejunum-BSME is supplemented with growth supporting
factors derived from the mucosal tissues of the jejunum. In some
embodiments, ileum-BSME is supplemented with growth supporting
factors derived from the mucosal tissues of the ileum. In some
embodiments, colon-BSME is supplemented with growth supporting
factors derived from the mucosal tissues of the colon. In some
embodiments, rectum-BSME is supplemented with growth supporting
factors derived from the mucosal tissues of the rectum. Each
SS-BSME is adjusted to a pH most appropriate for the
gastrointestinal stem-like epithelial progenitor cell it is to
host. Thus, the stomach-BSME is adjusted to about pH 1-2.0. The
duodenum-BSME is adjusted to about pH 4-5.5. The jejunum-BSME is
adjusted to about pH 5.5-7. The ileum-BSME is adjusted to about
7-7.5. The colon-BSME and rectum-BSME were adjusted to about pH
7-7.5.
[0079] The term "correlate" as used herein refers to place or bring
into a mutual or reciprocal relation, or to establish an orderly
connection between two (or more) sets of measures thought to be
related.
[0080] The term "compare" as used herein refers to the examination
of two or more objects, substances, molecules, states, proteins,
nucleic acids, peptides, antibodies, segments, or subjects in order
to note similarities and/or differences.
[0081] The term "crypt" as used herein refers to a pit-like
depression or tubular recess. For example, within the
gastrointestinal tract, at the base of the intestinal villi lie
crypts where the epithelial cells proliferate.
[0082] The term "cultivate" and its various grammatical forms, as
used herein, refers to the promoting, fostering, improving the
growth of, or producing by allowing reproduction in predetermined
media under controlled laboratory conditions.
[0083] The term "cytokine" as used herein refers to small soluble
protein substances secreted by cells which have a variety of
effects on other cells. Cytokines mediate many important
physiological functions including growth, development, wound
healing, and the immune response. They act by binding to their
cell-specific receptors located in the cell membrane, which allows
a distinct signal transduction cascade to start in the cell, which
eventually will lead to biochemical and phenotypic changes in
target cells. Generally, cytokines act locally. They include type I
cytokines, which encompass many of the interleukins, as well as
several hematopoietic growth factors; type II cytokines, including
the interferons and interleukin-10; tumor necrosis factor
("TNF")-related molecules, including TNF.alpha. and lymphotoxin;
immunoglobulin super-family members, including interleukin 1
("IL-1"); and the chemokines, a family of molecules that play a
critical role in a wide variety of immune and inflammatory
functions. The same cytokine can have different effects on a cell
depending on the state of the cell. Cytokines often regulate the
expression of, and trigger cascades of, other cytokines
[0084] The phrase "cytokine profile" refers to a set of
characteristics or analysis of at least one cytokine of a cell(s),
tissue(s), or organ(s).
[0085] The term "daughter cell" as used herein refers to one of the
resultant cells that is generated when a cell undergoes cell
division and divides into two cells. A cell that undergoes cell
division and divides into two cells is referred to as a "parent"
cell.
[0086] The term "differentiation" or "cellular differentiation" as
used herein refers to the process by which a less specialized cell
becomes a more specialized cell type. In adults, adult stem cells
divide and create fully differentiated daughter cells during tissue
repair and during normal cell turnover. Cell differentiation causes
a cells' size, shape, polarity, metabolic activity, and
responsiveness to signals to change dramatically. These changes
largely are due to highly controlled modifications in gene
expression. With a few exceptions, cellular differentiation almost
never involves a change in the DNA sequence itself; thus, different
cells can have very different physical characteristics despite
having the same genome. The term "differentiated" as used herein
refers to having a different character or function from the
surrounding structures or from the original type. The term
"differentiable" as used herein refers to the ability to undergo
differentiation or to become differentiated.
[0087] The term "disease" or "disorder" are used interchangeably
herein to refer to an impairment of health or a condition of
abnormal functions. The term "diseased state" as used herein refers
to being in a condition of disease or disorder. The term "syndrome"
as used herein refers to a pattern of symptoms indicative of some
disease or condition. The term "condition" as used herein refers to
a variety of health states and is meant to include disorders or
disease caused by any underlying mechanism or disorder.
[0088] Diseases of the human gastrointestinal tract include, but
are not limited to, achalasia, Barrett's oesophagus, colorectal
cancer, gastric cancer, esophageal cancer, celiac disease,
ulcerative colitis, Crohn's disease, diverticulosis,
diverticulitis, gastritis, irritable bowel syndrome, microscopic
colitis, collagenous colitis, lymphocytic colitis, pancreatitis,
reflux esophagitis and other inflammatory, infectious, or malignant
conditions. Disease states often are quantified in the art using
well known scoring systems, such as those elucidated in Goodman
& Gilman's The Pharmacological Basis of Therapeutics, 10th
Edition, Eds. J. G. Hardman and L. E. Limbird, McGraw-Hill
Publishing, New York, N.Y., 2001, the entirety of which is
incorporated herein by reference.
[0089] The phrase "DNA characteristic" refers to a trait, property
or biological activity of a DNA molecule that may be used as an
indicator.
[0090] The term "drug" as used herein refers to a therapeutic agent
or any substance, other than food, used in the prevention,
diagnosis, alleviation, treatment, or cure of disease. A drug is:
(a) any article recognized in the official United States
Pharmacopeia, official Homeopathic Pharmacopeia of the United
States, or official National Formulary, or any supplement to any of
them; (b) articles intended for use in the diagnosis, cure,
mitigation, treatment, or prevention of disease in man or other
animals; (c) articles (other than food) intended to affect the
structure or any function of the body of man or other animals, and
d) articles intended for use as a component of any articles
specified in (a), (b) or (c) above.
[0091] The term "efficacy" as used herein means a therapeutic agent
is therapeutically effective. Generally, a greater level of
efficacy will be achieved by increasing the dose and/or frequency
of administration of a therapeutic agent given to a population,
such that a greater proportion of the population will receive a
benefit and/or there will be a greater magnitude of benefit in an
individual patient, or cell. If a first therapeutic agent is more
potent than a second therapeutic agent, it will reach a greater
level of efficacy than the second therapeutic agent using identical
amounts of each.
[0092] The terms "expose" in its various grammatical forms, as used
herein, refers to subjecting or allowing to be subjected to an
action, influence, or condition.
[0093] The term human "gastrointestinal epithelial stem cell-like
progenitor cell" as used herein refers to a cell having the
phenotype cytokeratin(+), .beta.-1-integrin(+), defensin-5(+),
trefoil factor-3(+), mucin-2(+), chomogranin-A(+), intestinal
alkaline phosphatase(+), lysozyme(+) or at least
.beta.-1-integrin(+), and cytokeratin(+).
[0094] The term "gastrointestinal mucosal tissue segments" as used
herein refers to isolated anatomical segments of the human
gastrointestinal tract. Gastrointestinal mucosal tissue segments
include those prepared from the stomach, the duodenum, the jejunum,
the ileum, the ascending colon, the transverse colon, the sigmoid,
and the rectum.
[0095] The terms "gastrointestinal malignancy" or "colon cancer"
are used interchangeably herein to refer to neoplastic changes in
the epithelial linings of the colon and/or any other parts of the
gastrointestinal tract characterized by uncontrolled growth of
undifferentiated (anaplastic) cells that tend to invade surrounding
tissue and to metastasize to distant body sites.
[0096] The terms "gene expression" and "expression" are used
interchangeably herein to refer to the process by which inheritable
information from a gene, such as a DNA sequence, is made into a
functional gene product, such as protein or RNA.
[0097] The term "HIPEC" as used herein refers to human intestinal
primary epithelial cell lines derived from gastrointestinal
epithelial stem cell-like progenitor cells.
[0098] The term "HITEC" as used herein refers to human intestinal
tumor-derived epithelial cells.
[0099] The term "human gastrointestinal tract" as used herein
refers to the coordinated structure (mouth to rectum) having the
function of ingesting and absorbing nutrients and excreting
unabsorbed and waste products.
[0100] The term "inflammation" as used herein refers to a
physiologic response to infection and injury in which cells
involved in detoxification and repair are mobilized to the
compromised site by inflammatory mediators. The classic signs of
inflammation are pain (dolor), heat (calor), redness (rubor),
swelling (tumor), and loss of function (functiolaesa).
Histologically, inflammation involves a complex series of events,
including dilatation of arterioles, capillaries, and venules, with
increased permeability and blood flow; exudation of fluids,
including plasma proteins; and leukocytic migration into the
inflammatory focus.
[0101] The term "acute inflammation" as used herein refers to
inflammation, usually of sudden onset, characterized by the
classical signs, with predominance of the vascular and exudative
processes. The term "chronic inflammation" as used herein refers to
inflammation of slow progress and marked chiefly by the formation
of new connective tissue; it may be a continuation of an acute form
or a prolonged low-grade form, and usually causes permanent tissue
damage.
[0102] Regardless of the initiating agent, the physiologic changes
accompanying acute inflammation encompass four main features: (1)
vasodilation, which results in a net increase in blood flow, is one
of the earliest physical responses to acute tissue injury; (2) in
response to inflammatory stimuli, endothelial cells lining the
venules contract, widening the intracellular junctions to produce
gaps, leading to increased vascular permeability which permits
leakage of plasma proteins and blood cells out of blood vessels;
(3) inflammation often is characterized by a strong infiltration of
leukocytes at the site of inflammation, particularly neutrophils
(polymorphonuclear cells). These cells promote tissue damage by
releasing toxic substances at the vascular wall or in uninjured
tissue; and (4) fever, produced by pyrogens released from
leukocytes in response to specific stimuli.
[0103] During the inflammatory process, soluble inflammatory
mediators of the inflammatory response work together with cellular
components in a systemic fashion in the attempt to contain and
eliminate the agents causing physical distress. The term
"inflammatory mediators" as used herein refers to the molecular
mediators of the inflammatory process. These soluble, diffusible
molecules act both locally at the site of tissue damage and
infection and at more distant sites. Some inflammatory mediators
are activated by the inflammatory process, while others are
synthesized and/or released from cellular sources in response to
acute inflammation or by other soluble inflammatory mediators.
Examples of inflammatory mediators of the inflammatory response
include, but are not limited to, plasma proteases, complement,
kinins, clotting and fibrinolytic proteins, lipid mediators,
prostaglandins, leukotrienes, platelet-activating factor (PAF),
peptides and amines, including, but not limited to, histamine,
serotonin, and neuropeptides, proinflammatory cytokines, including,
but not limited to, interleukin-1, interleukin-4, interleukin-6,
interleukin-8, tumor necrosis factor (TNF), interferon-gamma, and
interleukin 12.
[0104] The term "isolate" as used herein refers to a process of
obtaining a substance, molecule, protein, peptide, nucleic acid,
virus, or antibody that is substantially pure and is free of other
substances with which it ordinarily is found in nature or in vivo
systems to an extent practical and appropriate for its intended
use. The terms "substantially or essentially free" or
"substantially or essentially pure" are used interchangeably to
refer to a material, which is at least about 50%, at least about
60%, at least about 70%, at least about 80%, and/or at least about
90% free from components that normally accompany or interact with
it as found in its naturally occurring environment. The term
"measure" as used herein refers to any standard of comparison,
estimation or judgment, or to ascertaining the extent, dimensions,
quantity, or capacity by comparison with a standard.
[0105] The term "mucosa" as used herein refers to the mucous tissue
lining various tubular structures, which comprises an epithelium, a
lamina propria, and in the digestive tract, a layer of smooth
muscle (muscularis mucomucosa).
[0106] The term "mucosal" as used herein means relating to the
mucosa or mucous membrane.
[0107] The term "mutual" as used herein refers to something common
to or shared by tow or more things.
[0108] The term "native" as used herein refers to the condition of
an organ, molecule, compound, protein, or nucleic acid as it would
normally occur in nature. For example, a native human
gastrointestinal tract refers to a gastrointestinal tract found
within a normal human subject.
[0109] The term "normal" is used herein to refer to a state of
natural occurrence or on average being subtantially free from any
infection or other form of disease or malformation, or from
experimental therapy or manipulation.
[0110] The term "overexpressed" as used herein refers to an
increased quantity of a gene or gene product.
[0111] The term "progenitor cell" as used herein refers to an
immature or undifferentiated cell population in the
gastrointestinal tract. Progenitor cells have a capacity for
self-renewal and differentiation, although these properties may be
limited. The majority of progenitor cells may lie dormant or
possess little activity in the tissue in which they reside. They
exhibit slow growth and their main role is to replace cells lost by
normal attrition. Upon tissue damage or injury, progenitor cells
may be activated by growth factors or cytokines, leading to
increased cell division important for the repair process.
[0112] The term "regional specificity" as used herein refers to the
ability of a therapeutic agent to affect a specific identified
segment of the human gastrointestinal tract.
[0113] The term "regulated" as used herein refers to a modulation
of gene expression. For example, transcription of a gene may be
regulated by various factors such as, but not limited to,
specificity factors, repressors, general transcription factors,
activators or enhancers. "Up-regulation" is a process which occurs
within a cell triggered by a signal (originating internal or
external to the cell) which results in increased expression of one
or more genes and as a result the protein(s) encoded by those
genes. "Down-regulation" is a process resulting in decreased gene
and corresponding protein expression.
[0114] The phrase "RNA characteristic" refers to a trait, property
or biological activity of a RNA molecule that may be used as an
indicator.
[0115] The term "specificity" as used herein refers to the ability
of a biological molecule to selectively affect only one substance;
for example, an antibody that binds to an antigen.
[0116] The term "stem cell" as used herein refers to
undifferentiated cells having high proliferative potential with the
ability to self-renew that can generate daughter cells that can
undergo terminal differentiation into more than one distinct cell
type. A cell that is able to differentiate into many cell types may
be referred to as "pluripotent." A cell that is able to
differentiate into all cell types may be referred to as
"totipotent." Pluripotent stem cells undergo further specialization
into multipotent progenitor cells that then give rise to functional
cells. Examples of stem and progenitor cells include: hematopoietic
stem cells (adult stem cells) from the bone marrow that give rise
to red blood cells, white blood cells, and platelets; mesenchymal
stem cells (adult stem cells) from the bone marrow that give rise
to stromal cells, fat cells, and types of bone cells; epithelial
stem cells (progenitor cells) that give rise to the various types
of skin cells; and muscle satellite cells (progenitor cells) that
contribute to differentiated muscle tissue.
[0117] The term "subject" or "individual" or "patient" are used
interchangeably to refer to a member of an animal species of
mammalian origin, including but not limited to, a mouse, a rat, a
cat, a goat, sheep, horse, hamster, ferret, pig, a dog, a guinea
pig, a platypus, a rabbit and a primate, such as, for example, a
monkey, ape, or human.
[0118] The term "therapeutic agent" as used herein refers to a
drug, molecule, nucleic acid, protein, composition or other
substance that provides a therapeutic effect.
[0119] The term "therapeutic component" as used herein refers to a
therapeutically effective dosage (i.e., dose and frequency of
administration) that eliminates, reduces, or prevents the
progression of a particular disease manifestation in a percentage
of a population. An example of a commonly used therapeutic
component is the ED.sub.50 which describes the dose in a particular
dosage that is therapeutically effective for a particular disease
manifestation in 50% of a population.
[0120] The term "therapeutic effect" as used herein refers to a
consequence of treatment, the results of which are judged to be
desirable and beneficial. A therapeutic effect may include,
directly or indirectly, the arrest, reduction, or elimination of a
disease manifestation. A therapeutic effect may also include,
directly or indirectly, the arrest, reduction or elimination of the
progression of a disease manifestation. A therapeutic effect may
directly or indirectly kill the diseased cells, arrest the
accumulation of diseased cells, or reduce the accumulation of
diseased cells in a human subject with a disease such as, but not
limited to, achalasia, Barrett's esophagus, colorectal cancer,
gastric cancer, esophageal cancer, coeliac disease, colitis,
Crohn's disease, diverticulosis, diverticulitis, gastritis,
inflammatory bowel disease, ulcerative colitis, irritable bowel
syndrome, microscopic colitis, collagenous colitis, lymphocytic
colitis, pancreatitis, reflux esophagitis, and ulcerative
colitis.
[0121] The terms "therapeutically effective amount" and
"pharmaceutically effective amount" are used interchangeably to
refer to the amount that results in a therapeutic beneficial
effect. The term as used herein shall also mean the dosage of a
therapeutic agent which directly or indirectly reduces or increases
the activity of molecules secreted by diseased and/or non-diseased
cells participating in a disease manifestation, such that the
amount of therapeutic agent arrests, reduces, or eliminates
altogether the degree of the disease manifestation. Typically, a
therapeutically effective amount will also eliminate, reduce, or
prevent the progression of one or more diseases. A skilled artisan
recognizes that in many cases a therapeutic agent may not provide a
cure, but may only provide a partial benefit. Furthermore, the
skilled artisan recognizes that because individual patients and
disease states may vary, some patients may receive little, or no
benefit at all. A dosage of therapeutic agent that "kills,"
"arrests," "reduces," or "eliminates" as described above, in at
least some patients, is considered therapeutically effective. The
term "dosage" as used herein refers to the dose or amount, and
frequency of administering of a therapeutic agent in prescribed
amounts. The term "dose" as used herein refers to the amount of
therapeutic agent to be taken or applied all at one time or in
fractional amounts within a given period.
[0122] The term "therapeutic target" as used herein refers to a
native protein, molecule, compound, nucleic acid, organ, gland,
ligand, receptor, organelle, or cell whose activity is modified by
a drug resulting in a desirable therapeutic effect.
[0123] As used herein the term "treating" includes abrogating,
substantially inhibiting, slowing or reversing the progression of a
condition, substantially ameliorating clinical or aesthetical
symptoms of a condition, substantially preventing the appearance of
clinical or aesthetical symptoms of a condition, and protecting
from harmful or annoying stimuli.
[0124] The term "variation" as used herein refers to a difference
or deviation in structure or character from others of the same
species or group.
[0125] The term "villi" as used herein refers to projections from
the surface, especially of a mucous membrane. Intestinal villi are
projections, about 0.5 mm to about 1.5 mm in length, of the mucous
membrane of the small intestine. They are leaf-shaped in the
duodenum and become shorter, more finger-shaped, and sparser in the
ileum.
[0126] The term "underexpressed" as used herein refers to decreased
quantity of a gene or gene product.
1. Method for Identifying Therapeutic Targets to Treat
Gastrointestinal Disease
[0127] According to one aspect, the described invention provides a
method for identifying a therapeutic target to treat a
gastrointestinal disease in a subject in need thereof, the method
comprising steps: (a) isolating normal differentiable
segment-specific human stem cell-like progenitor cells from normal
mucosal tissue derived from at least one normal gastrointestinal
segment of the subject; (b) isolating diseased differentiable
segment-specific human stem cell-like progenitor cells from
diseased muscosal tissue derived from at least one segment of the
subject's diseased human gastrointestinal segment; (c) cultivating
the normal differentiable segment-specific human stem cell-like
progenitor cells from step (a) on a biosimilar matrix environment
formed from the normal mucosal tissue derived from the at least one
normal human gastrointestinal segment to produce a normal human
intestinal primary epithelial cell line (HIPEC); (d) cultivating
the diseased differentiable segment-specific human stem cell-like
progenitor cells from step (b) on a biosimilar matrix environment
formed from the diseased mucosal tissue of step (b) to produce a
diseased human intestinal primary epithelial cell line; (e)
exposing the normal human intestinal primary epithelial cell line
of step (c) and the diseased human intestinal primary epithelial
cell line of step (d) to a therapeutic agent; and (f) identifying
at least one biomarker as a therapeutic target by comparing the
normal human intestinal primary epithelial cell line and the
diseased human intestinal primary epithelial cell line of step
(e).
[0128] According to one embodiment, the gastrointestinal disease is
achalasia. According to another embodiment, the gastrointestinal
disease is Barrett's oesophagus. According to another embodiment,
the gastrointestinal disease is colorectal cancer. According to
another embodiment, the gastrointestinal disease is gastric cancer.
According to another embodiment, the gastrointestinal disease is
oesophageal cancer. According to another embodiment, the
gastrointestinal disease is coeliac disease. According to another
embodiment, the gastrointestinal disease is colitis. According to
another embodiment, the gastrointestinal disease is Crohn's
disease. According to another embodiment, the gastrointestinal
disease is diverticulosis. According to another embodiment, the
gastrointestinal disease is diverticulitis. According to another
embodiment, the gastrointestinal disease is gastritis. According to
another embodiment, the gastrointestinal disease is inflammatory
bowel disease. According to another embodiment, the
gastrointestinal disease is ulcerative colitis. According to
another embodiment, the gastrointestinal disease is irritable bowel
syndrome. According to another embodiment, the gastrointestinal
disease is microscopic colitis. According to another embodiment,
the gastrointestinal disease is collagenous colitis. According to
another embodiment, the gastrointestinal disease is lymphocytic
colitis. According to another embodiment, the gastrointestinal
disease is pancreatitus. According to another embodiment, the
gastrointestinal disease is reflux oesophagitis. According to
another embodiment, the gastrointestinal disease is ulcerative
colitis.
[0129] According to another embodiment, step (f) further comprises
the step of performing an assay that detects at least one of either
(i) at least one overexpressed gene or (ii) at least
oneunderexpressed gene in a sample obtained from the subject.
According to some such embodiments, the assay is a microarray
hybridization assay.
[0130] According to another embodiment, step (f) further comprises
the step of identifying at least one variation in a DNA
characteristic.
[0131] According to another embodiment, step (f) further comprises
the step of identifying at least one variation in an RNA
characteristic.
[0132] According to another embodiment, step (f) further comprises
the step of identifying at least one variation in a cytokine
profile.
[0133] According to another embodiment, step (f) further comprises
the step of comparing telomerase activity of the normal HIPEC line
and the diseased HIPEC line of step (e).
[0134] According to another embodiment, the normal HIPEC line and
the diseased HIPEC are compared by gene array. According to some
embodiments, the normal HIPEC line and the diseased HIPEC are
compared by telomerase assay. According to some embodiments, the
normal HIPEC line and the diseased HIPEC are compared by RT-PCR.
According to some embodiments, the normal HIPEC line and the
diseased HIPEC are compared by Northern analysis. According to some
embodiments, the normal HIPEC line and the diseased HIPEC are
compared by fluorescence 2-dimensional difference gel
electrophoresis. According to some embodiments, the normal HIPEC
line and the diseased HIPEC are compared by iTRAQ (isobaric tag for
relative and absolute quantitation). According to some embodiments,
the normal HIPEC line and the diseased HIPEC are compared by cICAT
(cleavable isotope coded affinity tag). According to some
embodiments, proteins expressed by the normal HIPEC line and the
diseased HIPEC are compared by immunoassay. According to some such
embodiments, the immunoassay is an ELISA. According to some such
embodiments, the immunoassay is an immunoblot. According to some
such embodiments, the immunoassay is a protein array. According to
some such embodiments, the immunoassay is flow cytometry.
[0135] According to another embodiment, the gastrointestinal
disease is colon cancer.
[0136] According to another embodiment, the gastrointestinal
segment is an esophagus segment. According to another embodiment,
the gastrointestinal segment is a stomach segment. According to
another embodiment, the gastrointestinal segment is a duodenum
segment. According to another embodiment, the gastrointestinal
segment is a jejunum segment. According to another embodiment, the
gastrointestinal segment is an ileum segment. According to another
embodiment, the gastrointestinal segment is an ascending colon
segment. According to another embodiment, the gastrointestinal
segment is a transverse colon segment. According to another
embodiment, the gastrointestinal segment is a sigmoid colon
segment. According to another embodiment, the gastrointestinal
segment is a rectum segment.
[0137] According to another embodiment, the normal differentiable
segment-specific human stem cell-like progenitor cells have a
phenotype of at least cytokeratin(+) and .beta.-1-integrin(+).
[0138] According to some embodiments, the normal differentiable
segment-specific human stem cell-like progenitor cells have a
phenotype of cytokeratin(+), .beta.-1-integrin(+), defensin-5(+),
trefoil factor-3(+), mucin-2(+), chromogranin-A(+), intestinal
alkaline phosphatase(+) and lysozyme(+).
2. Method for Identifying Therapeutic Targets to Treat Colon
Cancer
[0139] According to another aspect, the described invention
provides a method for identifying a therapeutic target to treat
colon cancer in a subject in need thereof, the method comprising
the steps: (a) isolating normal differentiable segment-specific
human stem cell-like progenitor cells from normal mucosal tissue of
the subject derived from at least one normal gastrointestinal
segment; (b) isolating diseased differentiable segment-specific
human stem cell-like progenitor cells from diseased mucosal tissue
derived from at least one segment of the subjects's diseased human
gastrointestinal segment; (c) cultivating the normal differentiable
segment-specific human stem cell-like progenitor cells from step
(a) on a biosimilar matrix environment formed from the normal
mucosal tissue derived from the at least one normal human
gastrointestinal segment to produce a normal human intestinal
primary epithelial cell line; (d) cultivating the diseased
differentiable segment-specific human stem cell-like progenitor
cells from step (b) on a biosimilar matrix environment formed from
the diseased mucosal tissue of step (b) to produce a diseased human
intestinal primary epithelial cell line; (e) exposing the normal
human intestinal primary epithelial cell line of step (c) and the
diseased human intestinal primary epithelial cell line of step (d)
to a therapeutic agent; (f) measuring a level of expression of a
biomarker, wherein the level of expression of the biomarker is
measured in the normal human intestinal primary epithelial cell
line of step (e) and in the diseased human intestinal primary
epithelial cell line of step (e); and (g) identifying a therapeutic
target for the treatment of colon cancer by comparing the level of
expression of the biomarker within the normal human intestinal
primary cell line of step (f) and the diseased human intestinal
primary epithelial cell line of step (f).
[0140] According to some embodiments, the biomarker is STX5A.
According to another embodiment, the biomarker is GZMB. According
to another embodiment, the biomarker is PCSK5. According to another
embodiment, the biomarker is SOD3.
[0141] According to another embodiment, step (f) further comprises
the step of performing an assay that detects at least one of (i) at
least one overexpressed gene and (ii) at least one underexpressed
gene in a sample obtained from the subject.
[0142] According to another embodiment, the assay in step (f) is a
microarray hybridization assay.
[0143] According to another embodiment, step (f) further comprises
the step of identifying at least one variation in a DNA
characteristic. According to another embodiment, step (f) further
comprises the step of identifying at least one variation in an RNA
characteristic.
[0144] According to another embodiment, the cell lines of step (f)
are compared by gene array. According to another embodiment, the
cell lines of step (f) are compared by RT-PCR. According to another
embodiment, the cell lines of step (f) are compared by Northern
analysis. According to another embodiment, the cell lines of step
(f) are compared by fluorescence 2-dimensional difference gel
electrophoresis. According to another embodiment, the cell lines of
step (f) are compared by iTRAQ. According to another embodiment,
the cell lines of step (f) are compared by cICAT. According to
another embodiment, the cell lines of step (f) are compared by
immunoassay.
[0145] According to another embodiment, the immunoassay is an
ELISA. According to another embodiment, the immunoassay is an
immunoblot. According to another embodiment, the immunoassay is a
protein array. According to another embodiment, the immunoassay
comprises flow cytometry.
[0146] According to another embodiment, the gastrointestinal
segment is an esophagus segment. According to another embodiment,
the gastrointestinal segment is a stomach segment. According to
another embodiment, the gastrointestinal segment is a duodenum
segment. According to another embodiment, the gastrointestinal
segment is a jejunum segment. According to another embodiment, the
gastrointestinal segment is an ileum segment. According to another
embodiment, the gastrointestinal segment is an ascending colon
segment. According to another embodiment, the gastrointestinal
segment is a transverse colon segment. According to another
embodiment, the gastrointestinal segment is a sigmoid colon
segment. According to another embodiment, the gastrointestinal
segment is a rectum segment.
[0147] According to another embodiment, the normal differentiable
segment-specific human stem cell-like progenitor cells have a
phenotype of at least cytokeratin (+) and .beta.-1-integrin(+).
[0148] According to another embodiment, the normal differentiable
segment-specific human stem cell-like progenitor cells have a
phenotype of cytokeratin (+), .beta.-1-integrin(+), defensin-5(+),
trefoil factor-3(+), mucin-2(+), chomogranin-A(+), intestinal
alkaline phosphatase(+), and lysozyme(+).
[0149] According to some embodiments, the described invention
provides a method for identifying a therapeutic target to treat a
colon cancer in a subject in need thereof, the method comprising
the steps: (a) isolating normal differentiable segment-specific
human stem cell-like progenitor cells from normal mucosal tissue of
the subject derived from at least one normal gastrointestinal
segment; (b) isolating diseased differentiable segment-specific
human stem cell-like progenitor cells from diseased mucosal tissue
derived from at least one segment of the subject's diseased human
gastrointestinal segment; (c) cultivating the normal differentiable
segment-specific human stem cell-like progenitor cells from step
(a) on a biosimilar matrix environment formed from the normal
mucosal tissue derived from the at least one normal human
gastrointestinal segment to produce a normal human intestinal
primary epithelial cell line; (d) cultivating the diseased
differentiable segment-specific human stem cell-like progenitor
cells from step (b) on a biosimilar matrix environment formed from
the diseased mucosal tissue of step (b) to produce a diseased human
intestinal primary epithelial cell line, wherein a biomarker is in
a regulated state; (e) exposing the normal human intestinal primary
epithelial cell line of step (c) and the diseased human intestinal
primary epithelial cell line of step (d) to a therapeutic agent;
(f) measuring a level of expression of the biomarker of step (d) in
the normal human intestinal primary epithelial cell line of step
(e) and in the diseased human intestinal primary epithelial cell
line of step (e); and (g) comparing the level of expression of the
biomarker within the normal human intestinal primary cell line of
step (f) and the diseased human intestinal primary epithelial cell
line of step (f), whereby a change in the level of expression of
the biomarker of step (d) identifies a therapeutic target for the
treatment of the colon cancer.
[0150] According to another embodiment, the regulated state of step
(d) is an up-regulated state. According to another embodiment, the
regulated state of step (d) is a down-regulated state.
[0151] According to another embodiment, the change in the level of
expression of the biomarker of step (g) is an increase in the level
of expression. According to another embodiment, the change in the
level of expression of the biomarker of step (g) is a decrease in
the level of expression.
3. Method for Identifying Therapeutic Targets to Treat Ulcerative
Colitis
[0152] According to another aspect, the described invention
provides a method for identifying a therapeutic target to treat
ulcerative colitis in a subject in need thereof, the method
comprising the steps: (a) isolating normal differentiable
segment-specific human stem cell-like progenitor cells from normal
mucosal tissue of the subject derived from at least one normal
gastrointestinal segment; (b) isolating diseased differentiable
segment-specific human stem cell-like progenitor cells from
diseased mucosal tissue derived from at least one segment of the
subject's diseased human gastrointestinal segment; (c) cultivating
the normal differentiable segment-specific human stem cell-like
progenitor cells from step (a) on a biosimilar matrix environment
formed from the normal mucosal tissue derived from the at least one
normal human gastrointestinal segment to produce a normal human
intestinal primary epithelial cell line; (d) cultivating the
diseased differentiable segment-specific human stem cell-like
progenitor cells from step (b) on a biosimilar matrix environment
formed from the diseased mucosal tissue of step (b) to produce a
diseased human intestinal primary epithelial cell line; (e)
exposing the normal human intestinal primary epithelial cell line
of step (c) and the diseased human intestinal primary epithelial
cell line of step (d) to a therapeutic agent; (f) measuring a level
of expression of a biomarker, wherein the level of expression of
the biomarker is measured in the normal human intestinal primary
epithelial cell line of step (e) and in the diseased human
intestinal primary epithelial cell line of step (e); and (g)
identifying a therapeutic target for the treatment of colon cancer
by comparing the level of expression of the biomarker within the
normal human intestinal primary cell line of step (f) and the
diseased human intestinal primary epithelial cell line of step
(f).
[0153] According to one embodiment, the biomarker is BST2.
According to another embodiment, the biomarker is MMP1. According
to another embodiment, the biomarker is CACNA1E. According to
another embodiment, the biomarker is PCSK5. According to another
embodiment, the biomarker is GSTT1. According to another
embodiment, the biomarker is SOD3. According to another embodiment,
the biomarker is IL1RL1. According to another embodiment, the
biomarker is ARH1. According to another embodiment, the biomarker
is IFIT156.
[0154] According to another embodiment, step (f) further comprises
the step of performing an assay that detects at least one of (i) at
least one overexpressed gene or (ii) at least one underexpressed
gene in a sample obtained from the subject.
[0155] According to another embodiment, the assay in step (f) is a
microarray hybridization assay. According to another embodiment,
step (f) further comprises the step of identifying at least one
variation in a DNA characteristic. According to another embodiment,
step (f) further comprises the step of identifying at least one
variation in an RNA characteristic. According to another
embodiment, the cell lines of step (f) are compared by gene array.
According to another embodiment, the cell lines of step (f) are
compared by RT-PCR. According to another embodiment, the cell lines
of step (f) are compared by Northern analysis. According to another
embodiment, the cell lines of step (f) are compared by fluorescence
2-dimensional difference gel electrophoresis. According to another
embodiment, the cell lines of step (f) are compared by iTRAQ.
According to another embodiment, the cell lines of step (f) are
compared by cICAT.
[0156] According to another embodiment, the proteins expressed by
cell lines of step (f) are compared by immunoassay. According to
another embodiment, the immunoassay is an ELISA. According to
another embodiment, the immunoassay is an immunoblot. According to
another embodiment, the immunoassay is a protein array. According
to another embodiment, the immunoassay comprises flow
cytometry.
[0157] According to another embodiment, the gastrointestinal
segment is an esophagus segment. According to another embodiment,
the gastrointestinal segment is a stomach segment. According to
another embodiment, the gastrointestinal segment is a duodenum
segment. According to another embodiment, the gastrointestinal
segment is a jejunum segment. According to another embodiment, the
gastrointestinal segment is an ileum segment. According to another
embodiment, the gastrointestinal segment is an ascending colon
segment. According to another embodiment, the gastrointestinal
segment is a transverse colon segment. According to another
embodiment, the gastrointestinal segment is a sigmoid colon
segment. According to another embodiment, the gastrointestinal
segment is a rectum segment.
[0158] According to another embodiment, the normal differentiable
segment-specific human stem cell-like progenitor cells have a
phenotype of at least cytokeratin (+) and .beta.-1-integrin(+).
[0159] According to another embodiment, the normal differentiable
segment-specific human stem cell-like progenitor cells have a
phenotype of cytokeratin (+), .beta.-1-integrin(+), defensin-5(+),
trefoil factor-3(+), mucin-2(+), chomogranin-A(+), intestinal
alkaline phosphatase(+), and lysozyme(+).
[0160] According to some embodiments, the described invention
provides a method for identifying a therapeutic target to treat
ulcerative colitis in a subject in need thereof, the method
comprising the steps: (a) isolating normal differentiable
segment-specific human stem cell-like progenitor cells from normal
mucosal tissue of the subject derived from at least one normal
gastrointestinal segment; (b) isolating diseased differentiable
segment-specific human stem cell-like progenitor cells from
diseased mucosal tissue derived from at least one segment of the
subject's diseased human gastrointestinal segment; (c) cultivating
the normal differentiable segment-specific human stem cell-like
progenitor cells from step (a) on a biosimilar matrix environment
formed from the normal mucosal tissue derived from the at least one
normal human gastrointestinal segment to produce a normal human
intestinal primary epithelial cell line; (d) cultivating the
diseased differentiable segment-specific human stem cell-like
progenitor cells from step (b) on a biosimilar matrix environment
formed from the diseased mucosal tissue of step (b) to produce a
diseased human intestinal primary epithelial cell line; (e)
exposing the normal human intestinal primary epithelial cell line
of step (c) and the diseased human intestinal primary epithelial
cell line of step (d) to a therapeutic agent; wherein the normal
human intestinal primary epithelial cell line and the diseased
human intestinal primary epithelial cell line have a mutual
biomarker, wherein the biomarker is in a regulated state; (f)
measuring the level of expression of the biomarker of step (e) in
the normal human intestinal primary epithelial cell line and in the
diseased human intestinal primary epithelial cell line; and (g)
comparing the level of expression of the biomarker in the normal
human intestinal primary cell line of step (f) and in the diseased
human intestinal primary epithelial cell line of step (f), such
that a change in the level of expression of the biomarker of step
(e) identifies a therapeutic target for the treatment of ulcerative
colitis.
[0161] According to another embodiment, the regulated state of step
(d) is an up-regulated state. According to another embodiment, the
regulated state of step (d) is a down-regulated state.
[0162] According to another embodiment, the change in the level of
expression of the biomarker of step (g) is an increase in the level
of expression. According to another embodiment, the change in the
level of expression of the biomarker of step (g) is a decrease in
the level of expression.
4. Method for Identifying Therapeutic Targets to Treat Crohn's
Disease
[0163] According to another aspect, the described invention
provides a method for identifying a therapeutic target to treat
Crohn's disease in a subject in need thereof, the method comprising
the steps: (a) isolating normal differentiable segment-specific
human stem cell-like progenitor cells from normal mucosal tissue of
the subject derived from at least one normal gastrointestinal
segment; (b) isolating diseased differentiable segment-specific
human stem cell-like progenitor cells from diseased mucosal tissue
derived from at least one segment of the subject's diseased human
gastrointestinal segment; (c) cultivating the normal differentiable
segment-specific human stem cell-like progenitor cells from step
(a) on a biosimilar matrix environment formed from the normal
mucosal tissue derived from the at least one normal human
gastrointestinal segment to produce a normal human intestinal
primary epithelial cell line; (d) cultivating the diseased
differentiable segment-specific human stem cell-like progenitor
cells from step (b) on a biosimilar matrix environment formed from
the diseased mucosal tissue of step (b) to produce a diseased human
intestinal primary epithelial cell line; (e) exposing the normal
human intestinal primary epithelial cell line of step (c) and the
diseased human intestinal primary epithelial cell line of step (d)
to a therapeutic agent; (f) measuring the level of expression of a
biomarker, wherein the level of expression of the biomarker is
measured in the normal human intestinal primary epithelial cell
line of step (e) and in the diseased human intestinal primary
epithelial cell line of step (e); and (g) identifying a therapeutic
target for the treatment of colon cancer by comparing the level of
expression of the biomarker within the normal human intestinal
primary cell line of step (f) and the diseased human intestinal
primary epithelial cell line of step (f).
[0164] According to another embodiment, the biomarker is CACNA1E.
According to another embodiment, the biomarker is GSTT1. According
to another embodiment, the biomarker is PCSK5. According to another
embodiment, the biomarker is COL15A1. According to another
embodiment, the biomarker is EDIL3. According to another
embodiment, the biomarker is MM2.
[0165] According to another embodiment, step (f) further comprises
the step of performing an assay that detects at least one of at
least one overexpressed gene or at least one underexpressed gene in
a sample obtained from the subject.
[0166] According to another embodiment, the assay in step (f) is a
microarray hybridization assay.
[0167] According to another embodiment, step (f) further comprises
the step of identifying at least one variation in a DNA
characteristic. According to another embodiment, step (f) further
comprises the step of identifying at least one variation in an RNA
characteristic.
[0168] According to another embodiment, the proteins expressed by
the cell lines of step (f) are compared by gene array. According to
another embodiment, the cell lines of step (f) are compared by
RT-PCR. According to another embodiment, the cell lines of step (f)
are compared by Northern analysis. According to another embodiment,
the cell lines of step (f) are compared by fluorescence
2-dimensional difference gel electrophoresis. According to another
embodiment, the cell lines of step (f) are compared by iTRAQ.
According to another embodiment, the cell lines of step (f) are
compared by cICAT.
[0169] According to another embodiment, the cell lines of step (f)
are compared by immunoassay. According to another embodiment, the
immunoassay is an ELISA. According to another embodiment, the
immunoassay is an immunoblot. According to another embodiment, the
immunoassay is a protein array. According to another embodiment,
the immunoassay comprises flow cytometry.
[0170] According to another embodiment, the gastrointestinal
segment is an esophagus segment. According to another embodiment,
the gastrointestinal segment is a stomach segment. According to
another embodiment, the gastrointestinal segment is a duodenum
segment. According to another embodiment, the gastrointestinal
segment is a jejunum segment. According to another embodiment, the
gastrointestinal segment is an ileum segment. According to another
embodiment, the gastrointestinal segment is an ascending colon
segment. According to another embodiment, the gastrointestinal
segment is a transverse colon segment. According to another
embodiment, the gastrointestinal segment is a sigmoid colon
segment. According to another embodiment, the gastrointestinal
segment is a rectum segment.
[0171] According to another embodiment, the normal differentiable
segment-specific human stem cell-like progenitor cells have a
phenotype of at least cytokeratin (+) and .beta.-1-integrin(+).
According to another embodiment, the normal differentiable
segment-specific human stem cell-like progenitor cells have a
phenotype of cytokeratin (+), .beta.-1-integrin(+), defensin-5(+),
trefoil factor-3(+), mucin-2(+), chomogranin-A(+), intestinal
alkaline phosphatase(+), and lysozyme(+).
[0172] According to some embodiments, the described invention
provides a method for identifying a therapeutic target to treat
Crohn's disease in a subject in need thereof, the method comprising
the steps: (a) isolating normal differentiable segment-specific
human stem cell-like progenitor cells from normal mucosal tissue of
the subject derived from at least one normal gastrointestinal
segment; (b) isolating diseased differentiable segment-specific
human stem cell-like progenitor cells from diseased mucosal tissue
derived from at least one segment of the subject's diseased human
gastrointestinal segment; (c) cultivating the normal differentiable
segment-specific human stem cell-like progenitor cells from step
(a) on a biosimilar matrix environment formed from the normal
mucosal tissue derived from the at least one normal human
gastrointestinal segment to produce a normal human intestinal
primary epithelial cell line; (d) cultivating the diseased
differentiable segment-specific human stem cell-like progenitor
cells from step (b) on a biosimilar matrix environment formed from
the diseased mucosal tissue of step (b) to produce a diseased human
intestinal primary epithelial cell line, wherein a biomarker is in
a regulated state; (e) exposing the normal human intestinal primary
epithelial cell line of step (c) and the diseased human intestinal
primary epithelial cell line of step (d) to a therapeutic agent;
(f) measuring the level of expression of the biomarker of step (d)
in the normal human intestinal primary epithelial cell line of step
(e) and in the diseased human intestinal primary epithelial cell
line of step (e); and (g) comparing the level of expression of the
biomarker within the normal human intestinal primary cell line of
step (f) and in the diseased human intestinal primary epithelial
cell line of step (f), whereby a change in the level of expression
of the biomarker of step (d) identifies a therapeutic target for
the treatment of Crohn's disease.
[0173] According to another embodiment, the regulated state of step
(d) is an up-regulated state. According to another embodiment, the
regulated state of step (d) is a down-regulated state. According to
another embodiment, the change in the expression level of the
biomarker of step (g) is an increase in the expression level.
According to another embodiment, the change in the expression level
of the biomarker of step (g) is a decrease in the expression
level.
5. Method for Monitoring Treatment of a Gastrointestinal
Disease
[0174] According to another aspect, the described invention
provides a method for monitoring the efficacy of a therapeutic
agent for treating a gastrointestinal inflammatory disease, the
method comprising the steps: (a) isolating normal differentiable
segment-specific human stem cell-like progenitor cells from normal
mucosal tissue of the subject derived from at least one normal
gastrointestinal segment; (b) isolating diseased differentiable
segment-specific human stem cell-like progenitor cells from
diseased mucosal tissue derived from at least one segment of the
subject's diseased human gastrointestinal segment; (c) cultivating
the normal differentiable segment-specific human stem cell-like
progenitor cells from step (a) on a biosimilar matrix environment
formed from the normal mucosal tissue derived from the at least one
normal human gastrointestinal segment to produce a normal human
intestinal primary epithelial cell line; (d) cultivating the
diseased differentiable segment-specific human stem cell-like
progenitor cells from step (b) on a biosimilar matrix environment
formed from the diseased mucosal tissue of step (b) to produce a
diseased human intestinal primary epithelial cell line; (e)
exposing the normal human intestinal primary epithelial cell line
of step (c) and the diseased human intestinal primary epithelial
cell line of step (d) to a therapeutic agent; (f) measuring the
level of expression of a biomarker, wherein the level of expression
of the biomarker is measured in the normal human intestinal primary
epithelial cell line of step (e) and in the diseased human
intestinal primary epithelial cell line of step (e); (g)
correlating the difference between the level of expression of the
biomarker measured in the normal human intestinal primary
epithelial cell line and the level of expression of the biomarker
measured in the diseased human intestinal primary epithelial cell
with the treatment efficacy of the therapeutic agent.
[0175] According to some embodiments, wherein step (g) the
correlating the difference between the level of expression of the
biomarker measured in the normal human intestinal primary
epithelial cell line and the level of expression of the biomarker
measured in the diseased human intestinal primary epithelial cell
with the treatment efficacy of the therapeutic agent is by use of a
computer.
[0176] According to some embodiments, wherein step (g) the
correlating the difference between the level of expression of the
biomarker measured in the normal human intestinal primary
epithelial cell line and the level of expression of the biomarker
measured in the diseased human intestinal primary epithelial cell
with the treatment efficacy of the therapeutic agent allowing for
optimizing the therapeutic efficacy of a treatment for a
gastrointestinal inflammatory disease. According to some such
embodiments, the correlating the difference between the level of
expression of the biomarker measured in the normal human intestinal
primary epithelial cell line and the level of expression of the
biomarker measured in the diseased human intestinal primary
epithelial cell with the treatment efficacy of the therapeutic
agent allowing for optimizing the therapeutic efficacy of a
treatment for a gastrointestinal inflammatory disease is by use of
a computer.
[0177] According to another such embodiment, the gastrointestinal
disease is colon cancer. According to another embodiment, the
gastrointestinal disease is ulcerative colitis. According to
another embodiment, the gastrointestinal disease is Crohn's
disease. gastrointestinal disease is achalasia. According to
another embodiment, the gastrointestinal disease is Barrett's
oesophagus. According to another embodiment, the gastrointestinal
disease is colorectal cancer. According to another embodiment, the
gastrointestinal disease is gastric cancer. According to another
embodiment, the gastrointestinal disease is oesophageal cancer.
According to another embodiment, the gastrointestinal disease is
coeliac disease. According to another embodiment, the
gastrointestinal disease is colitis. According to another
embodiment, the gastrointestinal disease is diverticulosis.
According to another embodiment, the gastrointestinal disease is
diverticulitis. According to another embodiment, the
gastrointestinal disease is gastritis. According to another
embodiment, the gastrointestinal disease is inflammatory bowel
disease. According to another embodiment, the gastrointestinal
disease is irritable bowel syndrome. According to another
embodiment, the gastrointestinal disease is microscopic colitis
According to another embodiment, the gastrointestinal disease is
collagenous colitis. According to another embodiment, the
gastrointestinal disease is lymphocytic colitis. According to
another embodiment, the gastrointestinal disease is pancreatitis.
According to another embodiment, the gastrointestinal disease is
reflux oesophagitis.
[0178] According to another embodiment, the biomarker is CACNA1E.
According to another embodiment, the biomarker is PCSK5. According
to another embodiment, the biomarker is COL15A1. According to
another embodiment, the biomarker is EDIL3. According to another
embodiment, the biomarker is MM2. According to one embodiment, the
biomarker is BST2. According to another embodiment, the biomarker
is MMP1. According to another embodiment, the biomarker is GSTT1.
According to another embodiment, the biomarker is SOD3. According
to another embodiment, the biomarker is IL1RL1. According to
another embodiment, the biomarker is ARH1. According to another
embodiment, the biomarker is IFIT156. According to some
embodiments, the biomarker is STX5A. According to another
embodiment, the biomarker is GZMB. According to another embodiment,
the biomarker is SOD3.
[0179] According to another embodiment, the gastrointestinal
segment is an esophagus segment. According to another embodiment,
the gastrointestinal segment is a stomach segment. According to
another embodiment, the gastrointestinal segment is a duodenum
segment. According to another embodiment, the gastrointestinal
segment is a jejunum segment. According to another embodiment, the
gastrointestinal segment is an ileum segment. According to another
embodiment, the gastrointestinal segment is an ascending colon
segment. According to another embodiment, the gastrointestinal
segment is a transverse colon segment. According to another
embodiment, the gastrointestinal segment is a sigmoid colon
segment. According to another embodiment, the gastrointestinal
segment is a rectum segment.
[0180] According to another embodiment, the normal differentiable
segment-specific human stem cell-like progenitor cells have a
phenotype of cytokeratin(+), .beta.-1-integrin(+),
defdefensin-5(+), trefoil factor-3(+), mucin-2(+),
chromogranin-A(+), intestinal alkaline phosphatase(+), and
lysozyme(+).
[0181] According to another embodiment, the the normal
differentiable segment-specific human stem cell-like progenitor
cells have a phenotype of at least cytokeratin (+) and
.beta.-1-integrin(+).
[0182] According to another embodiment, the described invention
provides a method of monitoring treatment of a gastrointestinal
disease in a subject being treated with a therapeutic agent, the
method comprising the steps: (a) performing an assay that detects a
change in one or more biomarkers indicative of transformation of an
intestinal epithelial cell in a sample obtained from a subject; (b)
performing an assay that detects a change in expression of at least
one overexpressed and underexpressed gene in a sample obtained from
a subject; and (c) correlating the assay results obtained from the
assays performed in step (a) and step (b) to the treatment efficacy
of a therapeutic agent in the patient.
[0183] According to one embodiment, the sample is a tissue sample.
According to another embodiment, the sample is a blood sample.
According to another embodiment, the sample is a serum sample.
According to another embodiment, the sample is a plasma sample.
[0184] According to another embodiment, the assay in step (a)
further comprises the steps: (i) isolating differentiable
segment-specific human stem cell-like progenitor cells from mucosal
tissue derived from at least one gastrointestinal segment; (ii)
cultivating the differentiable segment-specific human stem
cell-like progenitor cells on a biosimilar matrix environment
formed from the mucosal tissue derived from at least one
gastrointestinal segment to produce a HIPEC line derived from the
differentiable segment-specific epithelial stem cell-like
progenitor cells; and (iii) comparing at least one aspect of the
HIPEC line to a reference HIPEC line.
[0185] According to another such embodiment, the at least one
aspect in step (iii) comprises a variation in a DNA characteristic.
According to another embodiment, the at least one aspect in step
(iii) comprises a variation in a RNA characteristic. According to
another embodiment, the at least one aspect in step (iii) comprises
a variation in a cytokine profile.
[0186] According to another such embodiment, the assay in step (b)
is a microarray hybridization assay.
6. Method for Diagnosing a Gastrointestinal Disease
[0187] According to another aspect, the described invention
provides a method for diagnosing a gastrointestinal disease in a
subject, the method comprising the steps: (a) isolating normal
differentiable segment-specific human stem cell-like progenitor
cells from normal mucosal tissue of the subject derived from at
least one normal gastrointestinal segment; (b) isolating diseased
differentiable segment-specific human stem cell-like progenitor
cells from diseased mucosal tissue derived from at least one
segment of the subject's diseased human gastrointestinal egment;
(c) cultivating the normal differentiable segment-specific human
stem cell-like progenitor cells from step (a) on a biosimilar
matrix environment formed from the normal mucosal tissue derived
from the at least one normal human gastrointestinal segment to
produce a normal human intestinal primary epithelial cell line; (d)
cultivating the diseased differentiable segment-specific human stem
cell-like progenitor cells from step (b) on a biosimilar matrix
environment formed from the diseased mucosal tissue of step (b) to
produce a diseased human intestinal primary epithelial cell line;
(e) measuring the level of expression of a biomarker, wherein the
level of expression of the biomarker is measured in the normal
human intestinal primary epithelial cell line of step (e) and in
the diseased human intestinal primary epithelial cell line of step
(e); (f) correlating the difference between the level of expression
of the biomarker measured in the normal human intestinal primary
epithelial cell line and the level of expression of the biomarker
measured in the diseased human intestinal primary epithelial cell
line with a gastrointestinal disease state.
[0188] According to some embodiments, wherein step (g) correlating
the difference between the level of expression of the biomarker
measured in the normal human intestinal primary epithelial cell
line and the level of expression of the biomarker measured in the
diseased human intestinal primary epithelial cell line with a
gastrointestinal disease state is by use of a computer.
[0189] According to another embodiment, the gastrointestinal
disease is colon cancer. According to another embodiment, the
gastrointestinal disease is ulcerative colitis. According to
another embodiment, the gastrointestinal disease is Crohn's
disease. According to another embodiment, the gastrointestinal
disease is achalasia. According to another embodiment, the
gastrointestinal disease is Barrett's oesophagus. According to
another embodiment, the gastrointestinal disease is colorectal
cancer. According to another embodiment, the gastrointestinal
disease is gastric cancer. According to another embodiment, the
gastrointestinal disease is oesophageal cancer. According to
another embodiment, the gastrointestinal disease is coeliac
disease. According to another embodiment, the gastrointestinal
disease is colitis. According to another embodiment, the
gastrointestinal disease is diverticulosis. According to another
embodiment, the gastrointestinal disease is diverticulitis.
According to another embodiment, the gastrointestinal disease is
gastritis. According to another embodiment, the gastrointestinal
disease is inflammatory bowel disease. According to another
embodiment, the gastrointestinal disease is irritable bowel
syndrome. According to another embodiment, the gastrointestinal
disease is microscopic colitis According to another embodiment, the
gastrointestinal disease is collagenous colitis. According to
another embodiment, the gastrointestinal disease is lymphocytic
colitis. According to another embodiment, the gastrointestinal
disease is pancreatitis. According to another embodiment, the
gastrointestinal disease is reflux oesophagitis.
[0190] According to another embodiment, the biomarker is CACNA1E.
According to another embodiment, the biomarker is PCSK5. According
to another embodiment, the biomarker is COL15A1. According to
another embodiment, the biomarker is EDIL3. According to another
embodiment, the biomarker is MM2. According to one embodiment, the
biomarker is BST2. According to another embodiment, the biomarker
is MMP1. According to another embodiment, the biomarker is GSTT1.
According to another embodiment, the biomarker is SOD3. According
to another embodiment, the biomarker is IL1RL1. According to
another embodiment, the biomarker is ARH1. According to another
embodiment, the biomarker is IFIT156. According to some
embodiments, the biomarker is STX5A. According to another
embodiment, the biomarker is GZMB.
[0191] According to another embodiment, the biomarker is SOD3 and
wherein step (f) the difference between the level of expression of
the biomarker measured in the normal human intestinal primary
epithelial cell line and the level of expression of the biomarker
measured in the diseased human intestinal primary epithelial cell
line is at least about 2-fold.
[0192] According to another embodiment, the described invention
provides a method of diagnosing a gastrointestinal disease in a
subject, the method comprising the steps: (a) performing an assay
that detects at least one biomarker indicative of transformation of
an intestinal epithelial cell in a sample obtained from the
subject; (b) performing an assay that detects at least one of (i)
at least one overexpressed gene and (ii) at least one
underexpressed gene in a sample obtained from the subject; and (c)
correlating the assay results obtained from the assays performed in
step (a) and step (b) to the presence or absence of at least one
transformed intestinal epithelial cell in the patient.
[0193] According to some such embodiments, the assay in step (a)
further comprises the steps: (i) isolating differentiable
gastrointestinal segment-specific human stem cell-like progenitor
cells from mucosal tissue derived from at least one
gastrointestinal segment; (ii) cultivating the differentiable
gastrointestinal segment-specific human stem cell-like progenitor
cells on a biosimilar matrix environment formed from the mucosal
tissue derived from the at least one segment to produce a human
intestinal primary epithelial cell line; and (iii) comparing at
least one aspect of the human intestinal primary epithelial cell
line to at least one aspect of a reference human intestinal
tumor-derived epithelial cell line.
[0194] According to some such embodiments, the at least one aspect
in step (iii) comprises a variation in a DNA characteristic.
According to some such embodiments, the at least one aspect in step
(iii) comprises a variation in an RNA characteristic. According to
some such embodiments, the at least one aspect in step (iii)
comprises a variation in a cytokine profile.
[0195] According to some such embodiments, the assay in step (b) is
a microarray hybridization assay.
[0196] According to some such embodiments, the method further
comprises the step of performing at least one additional assay that
detects at least one additional diagnostic indicator. Such
additional diagnostic indicators include, but are not limited to,
increased telomerase activity.
[0197] According to another embodiment, the sample is a tissue
sample. According to another embodiment, the sample is a blood
sample. According to another embodiment, the sample is a serum
sample. According to another embodiment, the sample is a plasma
sample.
7. Paired Epithelial Cell System
[0198] The described invention provides for a paired epithelial
cell system obtained from tumorous and normal segments of the
gastrointestinal (GI) tract. Such a system is established from
isolated stem cell-like progenitor cells from various segments of
the human gastrointestinal tract, e.g., human esophageal normal
epithelial cells (HENEC), and human esophageal tumor epithelial
cells (HETEC), human gastric normal epithelial cells (HGNEC), and
human gastric tumor epithelial cells (HGTEC), etc.
[0199] According to one embodiment, the paired epithelial cell
system from actively inflamed (diseased) and non-inflamed (normal)
segments of the gastrointestinal tract can be established from
isolated stem cell-like progenitor cells from various segments of
the human GI tract, including, but not limited to, human epithelial
cells from actively inflamed (AIEC) and uninflamed (UIEC) tissues
from patients with ulcerative colitis (UC), Crohn's disease (CD),
and irritable bowel syndrome (IBS).
[0200] It generally is believed that better recurrence-free
survival in patients will be correlated with aberrant gene
expression. For example, better recurrence free survival in
patients may be correlated with aberrant MSH2 gene expression.
Consequently, such patients may be selected for various treatment
regimens depending on prognosis as indicated by such MSH2
expression.
[0201] General methods in molecular genetics and genetic
engineering useful in the present invention are described in the
current editions of Molecular Cloning: A Laboratory Manual,
(Sambrook et al., Cold Spring Harbor); Gene Transfer Vectors for
Mammalian Cells (Miller & Calos eds.); and Current Protocols in
Molecular Biology (F. M. Ausubel et al. eds., Wiley & Sons).
Cell biology, protein chemistry, and antibody techniques can be
found in Current Protocols in Protein Science (J. E. Colligan et
al. eds., Wiley & Sons); Current Protocols in Cell Biology (J.
S. Bonifacino et al., Wiley & Sons) and Current Protocols in
Immunology (J. E. Colligan et al. eds., Wiley & Sons.).
Reagents, cloning vectors, and kits for genetic manipulation are
available from commercial vendors such as BioRad, Stratagene,
Invitrogen, ClonTech, and Sigma-Aldrich Co.
[0202] Cell culture methods useful in the present invention are
described generally in the current edition of Culture of Animal
Cells: A Manual of Basic Technique (R. I. Freshney ed., Wiley &
Sons); General Techniques of Cell Culture (M. A. Harrison & I.
F. Rae, Cambridge Univ. Press), and Embryonic Stem Cells: Methods
and Protocols (K. Turksen ed., Humana Press). Other relevant texts
are Creating a High Performance Culture (Aroselli, Hu. Res. Dev.
Pr. 1996) and Limits to Growth (D. H. Meadows et al., Universe
Publ. 1974). Tissue culture supplies and reagents are available
from commercial vendors such as Gibco/BRL, Nalgene-Nunc
International, Sigma Chemical Co., and ICN Biomedicals.
[0203] Unless defined otherwise, all technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art to which this invention belongs. Although
any methods and materials similar or equivalent to those described
herein can also be used in the practice or testing of the present
invention, the preferred methods and materials are now described.
All publications mentioned herein are incorporated herein by
reference to disclose and described the methods and/or materials in
connection with which the publications are cited.
[0204] It must be noted that as used herein and in the appended
claims, the singular forms "a", "and" and "the" include plural
references unless the context clearly dictates otherwise. All
technical and scientific terms used herein have the same
meaning
[0205] Publications discussed herein are provided solely for their
disclosure prior to the filing date of the present application.
Nothing herein is to be construed as an admission that the present
invention is not entitled to antedate such publication by virtue of
prior invention. Further, the dates of publication provided may be
different from the actual publication dates which may need to be
independently confirmed.
Examples
[0206] The following examples are put forth so as to provide those
of ordinary skill in the art with a complete disclosure and
description of how to make and use the present invention, and are
not intended to limit the scope of what the inventors regard as
their invention nor are they intended to limit the scope of what
the inventors regard as their invention nor are they intended to
represent that the experiments below are all or the only
experiments performed. Efforts have been made to ensure accuracy
with respect to numbers used (e.g., amounts, temperature, etc.) but
some experimental errors and deviations should be accounted for.
Unless indicated otherwise, parts are parts by weight, molecular
weight is weight average molecular weight, temperature is in
degrees Centigrade, and pressure is at or near atmospheric.
Example 1
Isolation and Culture of HIPEC and HITEC Lines
[0207] 1.1. Isolation of Human Gastrointestinal Segment-Specific
Stem-Cell-Like Progenitor Cells and Establishment of Epithelial
Cell Lines in Long Term Culture
[0208] Human intestinal primary epithelial cell lines (HIPEC) and
human intestinal tumor-acquired epithelial cell lines (HITEC) are
derived from gastrointestinal epithelial stem cell-like progenitor
cells obtained from normal colon epithelium and from cancerous
colon epithelium. Normal intestinal epithelial cells (IECs) are
obtained from patients with colon cancer using surgical specimens
excised at least 10 cm away from the tumor. Cancer tissue IECs are
excised from the same patient. Both surgical specimens are made
available from the Departments of Surgery and Pathology at the
Robert Wood Johnson University Hospital.
[0209] 1.1(a) Tissue Isolation
[0210] Surgical specimens of tissue are transported from an
operating room to the laboratory within 30 minutes of surgery. The
specimens are rinsed vigorously in sterile phosphate buffered
saline (1.times.), pH 7.4 (PBS) to remove loosely adherent
material, gently rubbed with sterile gauze, and washed at least ten
times in PBS supplemented with antibiotic and antimycotic (1%
penicillin/streptomycin) (ICN Biomedical, Costa Mesa, Calif.)
("supplemented PBS").
[0211] The mucosa is stripped off by careful dissection from the
underlying submucosa and minced into small pieces (Panja, A. Lab.
Invest. 2000. 80:9; 1473-1475, incorporated herein by reference in
its entirety). Tissue pieces are treated with 1 mM dithiothreitol
for 15 minutes (Sigma Chemical Co., St. Louis, Mo.) in RPMI 1460
(Gibco).
[0212] 1.1(b) Generation of Mucosal Tissue Derived Growth
Supporting Factors (MTD-GSF)
[0213] A portion (approximately 5 grams or one-third of the
specimen) of the mucosal tissue pieces is cultured (250 mg/ml)
overnight in serum free minimum essential medium (MEM) to generate
culture supernatants containing autologous growth
factor(s)/cytokines that mimic the cytokine milieu of the mucosal
site. The collected supernatant is diluted in F-12 medium
(Gibco/Invitrogen, Carlsbad, Calif.) and supplemented with
hydrocortisone (5 .mu.M), transferin (50 .mu.g/ml), insulin (0.2
.mu.g/ml), epidermal growth factor (5 ng/ml), and retinoic acid (25
.mu.g/ml) (Sigma-Aldrich, St. Louis, Mo.).
[0214] 1.1(c) Cell Isolation
[0215] The remaining tissue pieces are processed for isolation of
surface and crypt epithelial cells by using sequential protease
(dispase) treatments.
[0216] Mucosal tissue segments are treated with dispase (0.5 mg/ml
in RPMI 1406 (Invitrogen, Carlsbad, Calif.)) solution for up to
five treatments (5 minutes for the first treatment, 30 minutes for
second and third treatments, then 40 minutes each for the next two
treatments) to obtain intestinal epithelial cells (IECs). At each
interval, sample tissue (for histological examination to detect the
disappearance of surface epithelium and subsequent crypt cell
liberation) and cell suspensions are collected (Panja et al. J
Immunol 161.3675-84.1998). Epithelial cells are separated by
percoll density gradient, and the purity of IECs is evaluated by
staining with anti-CD3, CD14, CD20, CD45 mAbs and
anti-cytokeratin-18 antibody (Panja et al. J Exp Med
178.1115-9.1993; Panja, Barone and Mayer J Exp Med
179.943-50.1994). Only cell preparations having greater than 95%
viability will be used in the experiments. The IECs from fourth and
fifth dispase treatments are used as a source of gastrointestinal
segment-specific stem-cell-like progenitor cells for the generation
of normal and diseased (e.g. colon cancer, ulcerative colitis,
Crohn's disease, Barrett's esophagitis, gastric cancer, esophageal
cancer, celiac disease, irritable bowel syndrome etc.) primary
epithelial cell lines.
[0217] 1.1(d) Formation of Bio-Similar-Matrix-Environments (BSMEs)
on Plastic Surfaces
[0218] The de-epithelialized mucosal tissues remaining after the
dispase treatment are collected and homogenized in PBS (1 ml/1 mg
tissue). A cocktail of protease inhibitors, which includes PMSF (1
mM), Aprotinin (0.15 Units/ml), Lenpeptin (5 .mu.g/ml), Pepstatin
(1 .mu.g/ml) and fluoride (1 mM), are added to the homogenate (0.5
ml of protease inhibitor cocktail for 20 grams of tissue lysate) to
prevent degradation of matrix protein substances that may provide
anchorage and/or support for epithelial growth. This mucosal tissue
homogenate is diluted to 1 mg/ml in RPMI medium (Invitrogen,
Carlsbad, Calif.) and used to coat the surfaces of plastic Petri
dishes for 30 minutes to form a bio-similar-matrix-environment
(BSME) on the plastic surface. The resulting BSME facilitates the
attachment and growth of the isolated gastrointestinal
stem-cell-like progenitor cells. Colon-BSME is supplemented with
growth supporting factors derived from the mucosal tissues of the
colon; and rectum-BSME is supplemented with growth supporting
factors derived from the mucosal tissues of the rectum.
[0219] Isolated gastrointestinal stem-cell-like epithelial
progenitor cells, are cultured for 24 hours in F-12 medium
(Mediatech, Inc., Manassas, Va.) (1.times.106 cells/ml)
supplemented with MTD-GSF (10%) on the appropriate BSME. Each of
the isolated stem-cell-like progenitor cells are seeded onto the
appropriate media. Thus, the stem-cell-like progenitor cells
isolated from the colon are seeded onto colon-BSME; and the
stem-cell-like progenitor cells isolated from the rectum are seeded
onto rectum-BSME.
[0220] FIG. 2 shows light photomicrographs (Zeiss axiovert) of
representative primary epithelial monolayers from stem cells
isolated from the (a) ascending colon; (b) transverse colon, (c)
sigmoid colon, and (d) rectum. Monolayers from all colonic HIPEC
lines had similar morphology with polygonal shape with slight
variations among each other. Without being limited by theory, the
variance in morphology may represent an actual regional difference
or may relate to the age or density of the cells in culture. The
HIPEC monolayers are detached easily from the plastic surface and
can be subjected to multiple passages (up to 24 passages in cases
of normal tissue derived cells) allowing up to 165.times.10.sup.9
cells in 18-24 passages to be obtained. A portion of each HIPEC
line from each passage is kept frozen in multiple aliquots and the
capacity to grow in culture after thawing was tested. The defrosted
cells from each passage were capable of growing in secondary
cultures.
[0221] FIG. 6 and FIG. 7 show the stem cell nature of the isolated
cells which can be programmed to lose the mesenchymal marker
(vimentin) and to retain the epithelial lineage property of
cytokeratin expression. Further, this epithelial lineage may be
conditioned to differentiate into at least 4 subtypes of epithelial
cells (columnar, goblet, entero-endocrine and Paneth).
Example 2
Proof of Epithelial Origin of HIPEC Lines
[0222] 2.1(a) Cytokeratin 18 Staining
[0223] Cells of epithelial origin are known specifically to contain
cytoskeletal keratin. The intermediate filament system of
intestinal epithelial cells in vivo contains cytokeratin 18 and 8.
In order to confirm the epithelial origin of the HIPEC cells in
culture, these cells are stained with an antibody (anti-cytokeratin
18) against one of the two intestinal epithelial filament
proteins.
[0224] Gastrointestinal stem-cell-like progenitor cells, as
isolated in Example 1 (see above), are grown on cover slips (Fisher
Scientific). After permeabilization and fixation, cells are stained
with anti-CK-18 antibody. The cover slips are washed three times in
PBS/BSA and subsequently fixed in cold methanol at -20.degree. C.
for 10 minutes. The coverslips then are incubated in 2% FCS/PBS for
5 minutes. A FITC conjugated antibody against anti-human
cytokeratin (Sigma) is used to detect the presence of cytokeratin
and is incubated for 45 minutes followed by washings with 1%
PBS/BSA.
[0225] As shown in FIG. 3, expression of the CK-18 is present
(green fluorescence) in about 100% cells of the monolayer as
confirmed by fluorescence microscopic analysis.
[0226] 2.1(b) Flow Cytometric Analysis of Secretory Component (SC),
Von Willebrand's Factor (VWF), and Carcinoembryonic Antigen (CEA)
Expression by HIPEC Lines.
[0227] Dissociated cells from HIPEC monolayers of ascending colon,
transverse colon, sigmoid, and rectum are permeabilized by
treatment with permeafix (for CEA and VWF) and stained (FIG. 4)
with an anti-CEA (right panel--green lines), anti-VWF (middle
panel--green lines), or control antibody (black lines). For the
detection of SC, staining is performed on unpermeabilized cells
with an anti-SC antibody (left panel--blue lines) or an isotype
control (left panel--black lines).
[0228] FIG. 4 shows that all HIPEC lines are strongly positive for
secretory component (SC), usually expressed only in the epithelial
cells (FIG. 4 left panel). They also express, to a varying degree,
carcinoembryonic antigen (CEA), another specific marker for
intestinal epithelial cells (FIG. 4 middle panel). All HIPEC lines
are negative for Von-Willebrand's Factor, a marker for cells of
endothelial origin (FIG. 4 right panel) and SMC (data not shown).
Variable levels of CEA expression (middle panel) are seen in all
colonic HIPEC lines.
Example 3
Characterization of HIPEC Lines
[0229] 3.1. Morphology
[0230] The morphology of the HIPEC cell lines is examined using
light microscopy. The epithelial origin of the cells is confirmed
by staining with anti-cytokeratin 18. Electron microscopy is used
to evaluate the ultrastructural characteristics of the cells. The
cells were found to have a structural organization typical of
intestinal epithelial cells as well as microvilli found at the
apical membrane and a basement membrane formed at the base of the
monolayer.
[0231] 3.2. HIPEC Lines are Non-Transformed
[0232] Soft agar was prepared as follows: a) 1% agarose solution (5
ml) was added into a 10 cm.sup.2 petri dish until the plate was
completely covered; b) the agarose was pipetted off leaving a thin
film of agarose on the bottom of the petri dish; c) after drying
the plate for 20 minutes with the lid on, 10 ml of cell suspension
(0.5.times.10.sup.6) was added on the top of the agarose film; d)
medium was replaced every 4-5 days. Suspensions (2.0 ml) of normal
HIPEC and control HT-29 cells were grown on soft agar medium for 3
weeks. The culture dishes were stained with 0.1% crystal violet for
5 minutes, destained, and photographed.
[0233] FIG. 5 shows that normal colonic HIPEC lines (a, c), failed
to grow in this medium, while foci formation and cell growth was
observed in the cultures with control malignant colonic epithelial
cell line HT-29 (b, d).
[0234] A karyotype analysis of the HIPEC cells revealed no
chromosomal abnormalities.
[0235] These results confirm that the HIPEC lines do not possess a
transformed phenotype or malignant nature, and thus are
non-transformed.
Example 4
Establishment of a Model System to Compare Functional and Genotypic
Differences Between Affected and Unaffected Epithelium of Patients
Suffering from Colorectal Cancer (CRC)
[0236] Multiple pairs (normal and diseased) of HIPEC and HITEC
lines will be generated from the gastrointestinal epithelium of
individuals affected by a cancer, such as an esophageal cancer, a
gastric cancer, and a colorectal cancer ("affected epithelium") and
from the epithelium from the same regional segment of the GI tract
unaffected by cancer ("unaffected epithelium") for the
identification of molecular biomarkers and for study of the
pathophysiological mechanisms of cancerous development in the human
GI tract. As used herein, the term "unaffected epithelium" refers
to epithelium that is at least 10 cm away from the tumor. Such
multiple lines will aid in identifying and separating markers
specific to disease from inherent normal variations in expression
patterns between individuals and their conditions.
[0237] In order to ensure the reliability of data used to identify
the differences between normal and CRC epithelium, each HIPEC lines
will be fully characterized as follows:
[0238] a) Demonstration of uniform morphology: One of the decisive
criteria for HIPECs to be considered as epithelial cells is a
demonstration of typical morphological features, such as a
polygonal shape. The morphology of HIPEC lines will be examined and
photographed under light microscopy and DIC interference contrast
(DIC) microscopy using a Zeiss Axiovert 25 inverted microscope
equipped with a digital imaging system.
[0239] b) Demonstration of ultrastructural features typical of
epithelial cells, including: microvilli, tight junctions, and
microfilaments: Ultrastructural studies will be carried out
utilizing a Jeol JEM-1200EX electron microscope. Confluent
monolayers grown on collagen coated transwell nylon membranes
(Costar) will be fixed with 3% glutaraldehyde in 0.1 M PBS, pH 7.2,
at 4.degree. C. for 1 hour and post fixed in 1% osmium tetroxide.
After dehydration in ethanol, the samples will be embedded in Epon.
Thin sections will be stained with uranyl acetate and lead citrate.
In some cases, embedded monolayers will be reembedded and sectioned
perpendicularly.
[0240] c) Expression of junctional complex proteins, such as
E-cadherin, .beta.-catenin, and Tight junction protein ZO-1 (Zonula
occludens protein 1, ZO-1): One of the unique features of
epithelial cells is their ability to form tight junctions between
the cells. Demonstration of the presence of junction complexes in
HIPEC monolayers will confirm their epithelial identity, and
validate use of this cell system for barrier function studies.
[0241] Analysis of junction protein expression will be carried out
by both immunohistochemical and western blot analysis. For western
blot analysis, cell lysate samples (containing 25 .mu.g (for
.beta.-catenin), 50 .mu.g (for ZO-1) and 80 .mu.g (for E-cadherin)
of protein per lane) will be run on a 7.5% SDS-polyacrylamide gel
under reducing conditions. After 2 hours of electrophoresis at 200
volts in Laemmli running buffer, the proteins will be transferred
to nitrocellulose by electroblotting in 25 mM Tris, 192 mM glycine
and 20% methanol transfer buffer. Proteins on the nitrocellulose
will be detected after 1 hour of blocking in 10% non-fat dry milk.
The blot then will be incubated with primary antibodies
(Transduction Laboratories). After overnight incubation, the blot
will be washed extensively in TBS-Tween followed by incubation with
an HRP-conjugated sheep anti-mouse immunoglobulin (Amersham,
Piscataway, N.J.) for 1 hour. The blot will be washed and signals
will be detected on a X-ray film by enhanced chemiluminescence
(Amersham).
[0242] The expression of junction proteins by all cells in the
monolayer will be confirmed immunohistochemically. Subconfluent
monolayers of HIPEC lines will be grown on glass cover slips
(Fisher Scientific), washed three times in PBS/BSA and subsequently
fixed in cold methanol at -20.degree. C. for 10 minutes. The
coverslips will be incubated in 2% FCS/PBS for 5 minutes. Primary
antibodies against anti-human E-cadherin (Transduction
Laboratories), .beta.-catenin (Transduction Laboratories, San
Diego, Calif.) or an appropriate isotype-matched control antibody
will be added and incubated at 4.degree. C. for 1 hour.
FITC-conjugated goat anti-mouse immunoglobulins used as secondary
antibodies will be incubated for another 1 hour. Between each
incubation the coverslips will be rinsed with cold PBS.
[0243] d) Expression of epithelial specific markers, such as
cytokeratin, secretory component (SC), carcinoembryonic antigen
(CEA), and intestinal alkaline phosphatase:
[0244] Expression of cell type specific cytoskeletal protein will
be determined by intracellular staining with monoclonal antibodies
(mAbs) against cytokeratin-18 (Sigma), or an appropriate isotype
control antibody. Cells will be dissociated with trypsin, then
permeabilized and fixed by incubation with permeafix (Ortho) for 1
hour at room temperature. Cells then will be washed twice with
PBS/BSA and resuspended at 4.times.10.sup.6 cells/ml. A 25 .mu.l
fraction of the suspension (10.sup.5 cells) will be incubated at
4.degree. C. for 45 minutes with an appropriate amount of antibody
(as determined through serial dilution analysis with control
cells). Either the above mentioned mAbs or an appropriate isotype
control will be used. This will be followed by 3 washes with
PBS/BSA and subsequent incubation of the cell suspension with FITC
conjugated F(ab)'.sub.2 goat anti-mouse IgG (except for
cytokeratin, since the anti-cytokeratin is a FITC conjugated
antibody) for another 45 minutes. After this second incubation,
cells will be washed three times with PBS/BSA, resuspended in 200
.mu.l of PBS and analyzed with a FACScan flow cytometer.
[0245] Immunohistochemical Detection of Epithelial Specific Markers
Secretory Component (SC) and Carcinoembryonic Antigen (CEA):
Expression of SC and CEA, combined with a lack of smooth muscle
actin expression in these cells, will rule out contamination by
myofibroblasts (Valentich et al. Am J Physiol 272.C1513-24.1997).
Secretory component serves as a characteristic marker of epithelial
cell type and indicates the differentiating stage of intestinal
epithelium (glandular epithelium) (Ahnen, Brown and Kloppel
Gastroenterology 89.667-82.1985; Brandtzaeg Histochem J
9.553-72.1977). The level of SC expression (high or low) in HIPECs
(duodenum segment through rectum segment) will indicate the
maturity (crypt or surface like cells) of the cells, which will be
used in subsequent studies of IgA transport using the cell system
of the present invention (Lamm et al. APMIS 103.241-6.1995).
[0246] Expression of epithelial cell specific surface molecules
(CEA and SC) will be assessed by immunofluorescence staining using
monoclonal antibodies (commercially available from SIGMA and DAKO,
respectively) against these molecules. An unrelated control
antibody will serve as a negative control. Additionally, to
ascertain that HIPEC lines are not contaminated with smooth muscle
or endothelial cells, the cells will be treated with an antibody
directed to a marker for smooth muscle cells (anti-smooth muscle
actin) and an antibody directed to a marker for endothelial cells
(Von-Willebrand Factor). It is worth noting that that to our
knowledge there is no specific marker for fibroblasts. Although
there are cases in the literature where vimentin has been described
as a marker for mesenchymal cells, recent data demonstrates that it
is expressed by epithelial cells as well.
[0247] Dissociated HIPECs will be washed twice in PBS/BSA and then
stained by the procedure described above. Stained cell suspensions
will be analyzed on a flow cytometer (BD) gating on viable cells,
as described in (Panja et al. J Immunol 161.3675-84.1998; Martin
and Panja Am J Physiol Gastrointest Liver Physiol
282.G92-G104.2002), incorporated herein by reference in its
entirety. Mean channel fluorescence, which correlates with
fluorescence intensity, will be determined from the peak of
positively stained cells and will be recorded on a log scale.
[0248] e) Obtain evidence of cytokine production and receptor
expression (IL-6, IL-8, IL-10, GM-CSF, Gro-.alpha., and
TGF-.beta.): Tests to determine the cytokine production ability of
the cell system of the present invention will validate the
functional properties of the cell system model. Intestinal
epithelial cells (IECs) are considered as potential antigen
presenting cell (APC) participants in mucosal immunoregulatory
events. One general property of an APC is its ability to produce
regulatory or accessory cytokines The terms "regulatory cytokine"
and "accessory cytokine" are used interchangeably herein to refer
to cytokines that can either enhance T cell activation, inhibit T
cell activation, or are proinflammatory; these cytokines include,
but not limited to, IL-1, IL-6, TNF-.alpha., IL-10, TGF-.beta.,
IL-8, Gro-.alpha., MCP-1, and MIP-1.alpha.. IECs also are capable
of cytokine production. Several studies have shown that intestinal
epithelial cells are capable of producing many of the cytokines
(IL-6, GM-CSF) known to be associated with enhanced APC function in
conventional APCs. However, the cytokine profile of IECs differs
from conventional APCs in that they fail to produce IL-1.beta.
(Panja, Siden and Mayer Clin Exp Immunol 100.298-305.1995), a
cytokine believed to be important for T cell activation.
[0249] HIPECs derived from each segment of the intestine will be
seeded at a concentration of 100,000 cells/ml/well in 24 well
plates and cultured in serum free HIPEC medium for 24 hours at
37.degree. C. Culture supernatants will be centrifuged and filtered
through a 0.25 .mu.m filter and kept frozen at -20.degree. C. until
assayed. The cytokine content of culture supernatants will be
measured using quantitative ELISA kits following the manufacturers'
directions (Immunotech, for IL-6, and R & D Systems for IL-8,
GM-CSF, and Gro-.alpha.). Briefly, about 50 .mu.l to about 200
.mu.l of a standard or a test sample (HIPEC supernatant) will be
added to ELISA wells (are coated with a specific cytokine antibody)
in duplicate and incubated at room temperature for 2 hours. ELISA
wells then will be washed 3 times in kit wash buffer, and the
appropriate substrate or cytokine conjugate then will be added to
each well. The ELISA wells will be washed again after 2 hours of
incubation. The color development reaction will be stopped after 15
minutes and the intensity of the color will be measured by reading
the absorbance at 405 nM. The sensitivity for IL-6 is 3 pg/ml, for
IL-8 10 pg/ml, for GM-CSF 0.5 pg/ml and for Gro-.alpha. 10
pg/ml.
[0250] 4.1. Cytokine Production and T Cell Activation by Paired
HIPEC Lines:
[0251] Intestinal epithelial cells (IECs) play a critical role in
immune response regulation by cognate interactions (meaning these
mediated through surface molecules) as well as non-cognate
interactions (meaning the mediated through soluble
factors/cytokines) in the intestine. Altered cytokine production
may lead to an active immune response in the mucosal environment
leading to inflammation and tissue destruction. Previous studies
from a number of laboratories have shown that multiple cytokines
are produced in the mucosa (Podolsky J Gastroenterol 32.122-6.1997;
Fiocchi Am J Physiol 273.G769-75.1997; Panja and Mayer Baillieres
Clin Gastroenterol 10.407-25.1996). These operate as a cytokine
network in a redundant, overlapping and synergistic fashion.
Because pathophysiological consequences may result from the
unregulated action or inappropriate production of particular
cytokines, the levels of immunoregulatory and proinflammatory
cytokine production by HIPEC lines derived from patients with CRC
and from normal controls will be measured to determine the extent
to which epithelial cells contribute to the altered cytokine
concentration seen in CRC mucosa. The constitutive secretion level
of proinflammatory and anti-inflammatory/inhibitory cytokines in
HIPEC cultures will be measured using direct binding ELISA kits (R
& D Systems); these cytokines include, but are not limited to,
IL-6, IL-8, GM-CSF, TNF-.alpha., IL-10, and TGF-.beta.. Levels of
cytokine production in affected cell lines will be compared and
contrasted to levels of cytokine production in unaffected cell
lines.
[0252] Previous studies with freshly isolated IECs have shown that
production of several cytokines (GM-CSF and IL-8) is significantly
increased in IBD (Panja Gastroenterology (abstract)
106(4):A750.1994). However, freshly isolated CRC cells often are
contaminated with other cell types, making it difficult to
interpret the results.
[0253] Cytokine production by unaffected (HIPEC) and affected
(HITEC) CRC cell lines will provide more reliable information about
the contribution of intestinal epithelial cells to cancer-induced
inflammatory states.
[0254] Non-transformed HIPEC lines, which represent a system more
comparable to physiological conditions, will be used to measure the
level of production of several cytokines (GM-CSF and IL-8) in CRC.
The presence of immunophenotypic/genotypic alterations also will be
identified.
[0255] Table 1 shows altered genes in HITEC compared to normal
counterpart HIPEC. The cytokine profile of normal HIPEC lines is
similar to what has been observed in freshly isolated IECs.
TABLE-US-00002 TABLE 1 Altered Gene Expression in HITEC Relative to
HIPEC Lines Fold- Fold- UniGene Symbol Gene Description increased
decreased PMPCB peptidase (mitochondrial processing) beta 4.04
GTPBP1 GTP binding protein 1 2.16 RAB2 RAB2, member RAS oncogene
family 2.25 PSMB6 proteasome (prosome, macropain) subunit, beta
2.38 type, 6 PSMD8 proteasome (prosome, macropain) 26S subunit,
2.09 non-ATPase, 8 TIMP3 tissue inhibitor of metalloproteinase
(Sorsby 8.51 0.12 fundus dystrophy, pseudoinflammatory) ECM1
extracellular matrix protein 1 3.15 BRCA1 breast cancer 1, early
onset 5.69 CRKL v-crk avian sarcoma virus CT10 oncogene 5.98
homolog-like D10S170 DNA segment, single copy, probe pH4 3.48
(transforming sequence, thyroid-1 COL1A2 collagen, type I, alpha 2
3.42 FXR2 fragile X mental retardation, autosomal homolog 2 2.08
SCA2 spinocerebellar ataxia 2 (olivoponotcerebellar 2.22 ataxia 2,
autosomal dominant, ataxin 2) ADAM20 a disintegrin and
metalloproteinase domain 20 2.09 STX3A syntaxin 3A 4.23 WISP1 WNT1
inducible signaling pathway protein 1 2.05 CLN2
ceroid-lipofuscinosis, neuronal 2, late infantile 2.18
(Jansky-Bielschowsky disease) KCNS3 potassium voltage-gated
channel, delayed- 52.41 rectifier, subfamily S, member 3 MKI67
antigen identified by monoclonal antibody Ki-67 12.25 NAPTB
Neuronal adaptin-like protein, beta-subunit 11.98 CACNA1E calcium
channel, voltage-dependent, alpha 1E 121.38 subunit ITGA7 integrin,
alpha 7 4.82 MLH1 mutL (E. coli) homolog 1 (colon cancer, 2.57
nonpolyposis type 2) MSH2 mutS (E. coli) homolog 2 (colon cancer,
5.14 nonpolyposis type 10 MYBL1 v-myb avian myeloblastosis viral
oncogene 31.26 homolog-like 1 SCYA20 small inducible cytokine
subfamily A (Cys- 6.66 Cys), member 20 MADCAM1 mucosal vascular
addressin cell adhesion 2.41 molecule 1 NPAS1 neuronal PAS domain
protein 1 3.08 API2 apoptosis inhibitor 2 5.14 BCL2L1 BCL2-like 1
2.01 SACM2L suppressor of actin mutations 2, yeast, homolog- 7.02
like AQP2 aquaporin 2 (collecting duct) 2.59 BNIP1 BCL2/adenovirus
E1B 19 kD-interacting protein 1 2.74 RARB retinoic acid receptor,
beta 17.71 K-ALPHA-1 tubulin, alpha, ubiquitous // Dilution 1:625
2.02 IL13RA1 interleukin 13 receptor, alpha 1 2.49 IL18R1
interleukin 18 receptor 1 4.42 TTC1 tetratricopeptide repeat domain
1 7.10 GAPD glyceraldehyde-3-phosphate dehydrogenase // 2.19
Dilution 1:25 PCSK5 proprotein convertase subtilisin/kexin type 5
148.52 PCSK7 proprotein convertase subtilisin/kexin type 7 2.45
ALCAM activated leucocyte cell adhesion molecule 2.28 BST1 bone
marrow stromal cell antigen 1 2.18 MSLN mesothelin 12.92 PSMC2
proteasome (prosome, macropain) 26S subunit, 2.20 ATPase, 2 RASA1
RAS p21 protein activator (GTPase activating 4.55 protein) 1 RGS10
regulator of G-protein signalling 10 2.71 ELAVL3 ELAV (embryonic
lethal, abnormal vision, 2.28 Drosophila)-like 3 (Hu antigen C)
SPC18 signal peptidase complex (18 kD) 8.42 HLA-B major
histocompatibility complex, class I, B 2.41 X HLA-DR alpha-chain
11.77 DCC deleted in colorectal carcinoma 4.26 FXR1 fragile X
mental retardation, autosomal homolog 1 5.37 SOX9 SRY
(sex-determining region Y)-box 9 2.20 (campomelic dysplasia,
autosomal sex-reversal) PCSK1 proprotein convertase
subtilisin/kexin type 1 5.38 CLIC2 chloride intracellular channel 2
2.37 ADAM23 a disintegrin and metalloproteinase domain 23 5.75
APAF1 apoptotic protease activating factor 2.98 STX5A syntaxin 5A
482.28 KCNJ1 potassium inwardly-rectifying channel, 2.21 subfamily
J, member 1 PRSC1 protease, cysteine, 1 (legumain) 5.45 APLP2
amyloid beta (A4) precursor-like protein 2 4.91 PRSS15 protease,
serine, 15 2.45 MIC2 antigen identified by monoclonal antibodies
3.25 12E7, F21 and O13 NOVA1 neuro-oncological ventral antigen 1
2.89 F12 coagulation factor XII (Hageman factor) 2.66 F13B
coagulation factor XIII, B polypeptide 2.06 CLCN5 chloride channel
5 (nephrolithiasis 2, X-liniked, 4.70 Dent disease) GLI
glioma-associated oncogene homolog (zinc 2.17 finger protein)
ITGA2B integrin, alpha 2b (platelet glycoprotein IIb of 8.31
IIb/IIIa complex, antigen CD41B) ITGAX integrin, alpha X (antigen
CD11C (p150), alpha 2.53 polypeptide) MOS v-mos Moloney murine
sarcoma viral oncogene 7.98 homolog SCYA21 small inducible cytokine
subfamily A (Cys- 2.68 Cys), member 21 SCYA23 small inducible
cytokine subfamily A (Cys- 2.31 Cys), member 23 NCAM1 neural cell
adhesion molecule 1 5.42 MYO9B myosin IXB 2.27 MJD Machado-Joseph
disease (spinocerebellar ataxia 7.49 3, olivopontocerebellar ataxia
3, autosomal dominant, ataxin 3) DDB1 damage-specific DNA binding
protein 1 7.68 (127 kD) IL6 interleukin 6 (interferon, beta 2)
18.88 IL15 interleukin 15 4.03 CLN3 ceroid-lipofuscinosis, neuronal
3, juvenile 3.78 (Batten, Spielmeyer-Vogt disease) IL11RA
interleukin 11 receptor, alpha 4.20 IL17R interleukin 17 receptor
2.56 YWHAZ tyrosine 3-monooxygenase/tryptophan 5- 2.05
monooxygenase activation protein, zeta polypeptide // Dilution 1:5
TTC2 tetratricopeptide repeat domain 2 5.38 PKD2 polycystic kidney
disease 2 (autosomal 26.03 dominant) PSMA5 proteasome (prosome,
macropain) subunit, alpha 12.76 type, 5 RAB3B RAB3B, member RAS
oncogene family 117.44 CAMLG calcium modulating ligand 14.58
CEACAM4 carcinoembryonic antigen-related cell adhesion 10.46
molecule 4 PSMD1 proteasome (prosome, macropain) 26S subunit, 2.15
non-ATPase, 1 PSMD4 proteasome (prosome, macropain) 26S subunit,
3.56 non-ATPase, 4 RGS13 regulator of G-protein signalling 13 9.51
RGS2 regulator of G-protein signalling 2, 24 kD 16.16 RGS4
regulator of G-protein signalling 4 2.42 RIN1 ras inhibitor 2.40
GAGE5 G antigen 5 2.30 GAGE7 G antigen 7 3.14 EMP1 epithelial
membrane protein 1 5.35 CASP13 caspase 13, apoptosis-related
cysteine protease 2.60 STXBP3 syntaxin binding protein 3 4.88 CANPX
calpain-like protease CANPX 2.16 CAPN5 calpain 5 3.87 PLOD
procollagen-lysine, 2-oxoglutarate 5- 2.15 dioxygenase (lysine
hydroxylase, Ehlers-Danlos syndrome type VI) KCNJ13 potassium
inwardly-rectifying 2.47 channel, subfamily J, member 13 ELA2
elastase 2, neutrophil 3.23 GZMB granzyme B (granzyme 2, cytotoxic
T- 15.34 lymphocyte-associated serine esterase 1) MCC mutated in
colorectal cancers 2.14 MYH9 myosin, heavy polypeptide 9,
non-muscle 7.66 MYL1 myosin, light polypeptide 1, alkali; skeletal,
fast 6.23 HRK harakiri, BCL2-interacting protein (contains 2.23
only BH3 domain) ARHGAP1 Rho GTPase activating protein 1 2.26 G3BP
Ras-GTPase-activating protein SH3-domain- 5.70 binding protein GNB3
guanine nucleotide binding protein (G protein), 2.36 beta
polypeptide 3 IFNA2 interferon, alpha 2 4.10 UBC ubiquitin C 3.04
HD huntingtin (Huntington disease) 2.17 MCF2 MCF.2 cell line
derived transforming sequence 2.58 NAGLU N-acetylglucosaminidase,
alpha-(Sanfilippo 2.04 disease IIIB) IL3RA interleukin 3 receptor,
alpha (low affinity) 2.90 PRNP prion protein (p27-30)
(Creutzfeld-Jakob 2.04 disease, Gerstmann-Strausler-Scheinker
syndrome, fatal familial insomnia) GAPD glyceraldehyde-3-phosphate
dehydrogenase // 2.05 Dilution 1:625 GAPD
glyceraldehyde-3-phosphate dehydrogenase 2.74 KLK10 kallikrein 10
3.74 RAB3A RAB3A, member RAS oncogene family 2.89 PSMD7 proteasome
(prosome, macropain) 26S subunit, 3.34 non-ATPase, 7 (Mov34
homolog) RGS5 regulator of G-protein signalling 5 2.12 ERG v-ets
avian erythroblastosis virus E26 4.41 oncogene related ETV6 ets
variant gene 6 (TEL oncogene) 2.25 0.44 ADAM3B a disintegrin and
metalloproteinase domain 3b 6.05 (cyritestin 2) TSC1 tuberous
sclerosis 1 2.24 CAPN4 calpain, small polypeptide 3.22 PAH
phenylalanine hydroxylase 2.52 SCYA3 small inducible cytokine A3
(homologous to 11.78 mouse Mip-1a) SCN4A sodium channel,
voltage-gated, type IV, alpha 10.97 polypeptide MMP13 matrix
metalloproteinase 13 (collagenase 3) 2.69 MMPL1 matrix
metalloproteinase-like 1 15.02 ICAM2 intercellular adhesion
molecule 2 2.98 M1S1 membrane component, chromosome 1, surface 2.53
marker 1 (40 kD glycoprotein, identified by monoclonal antibody
GA733) MCF2 MCF.2 cell line derived transforming sequence 3.43
SCYA14 small inducible cytokine subfamily A (Cys- 3.10 Cys), member
14 SCYA17 small inducible cytokine subfamily A (Cys- 0.49 2.04
Cys), member 17 SIP2-28 calcium and integring binding protein (DNA-
3.30 dependent protein kinase interacting protein) NF2
neurofibromin 2 (bilateral acoustic neuroma) 2.26 NRAS
neuroblastoma RAS viral (v-ras) oncogene 2.23 homolog MYHL myosin,
heavy polypeptide-like (110 kD) 2.69 CACNA1C calcium channel,
voltage-dependent, L type, 3.03 alpha 1C subunit CACNA1E calcium
channel, voltage-dependent, alpha 1E 3.00 subunit WNT1
wingless-type MMTV integration site family, 2.38 member 1 X alkali
myosin light chain 3 mRNA, complete cds 4.03 GNG11 guanine
nucleotide binding protein 11 18.99 TNFRSF6 tumor necrosis factor
receptor superfamily, 2.04 member 6 IL8 interleukin 8 27.07 GJB5
gap junction protein, beta 5 (connexin 31.1) 2.40 UBC ubiquitin C
2.14 0.47 HEXA hexosaminidase A (alpha polypeptide) 13.38 IGHG3
immunoglobulin gamma 3 (Gm marker) 2.83 0.35 IL4R interleukin 4
receptor 2.54 YWHAZ tyrosine 3-monooxygenase/tryptophan 5- 13.92
monooxygenase activation protein, zeta polypeptide SNCA synuclein,
alpha (non A4 component of amyloid 9.28 precursor)
[0256] f) Evidence of non-transformed state by soft agar assay and
karyotype analysis: The non malignant nature of the HIPEC lines
will be demonstrated by soft agar assay, karyotype analysis, and by
injection of these cell lines into nude mice.
[0257] Soft agar assay: A concentration of 2% agarose (Bacto agar
DIFCO) will be prepared in DMEM medium at 40.degree. C. and added
to 100 mm culture dishes. The agar will be allowed to solidify in
the incubator. A suspension (50,000 cells/ml in DMEM cell culture
medium with 0.5% agarose) of normal HIPEC lines or control colonic
adenocarcinoma cell line (HT-29) will be overlaid on the solidified
agar layer. Plates will be incubated at 37.degree. C. Liquid medium
will be added 3 days after the incubation and renewed every 3 days.
Cell growth will be observed for 3 weeks.
[0258] Karyotype analysis: HIPEC cells grown on in situ coverslips
will be treated with colcemide (0.01 .mu.g/ml) for 30 minutes. The
cells will be subjected to hypotonic shock with 0.07M KCl for 30
minutes at 37.degree. C. followed by fixation with methanol/glacial
acetic acid (3:1). Chromosome preparations will be made by air dry
method, giemsa banding, and karyotyping as described by Seabright
et. al. (Seabright Lancet 2.971-2.1971).
[0259] 4.2. Injections Into Nude Mice:
[0260] g) Demonstration that cells are capable of being maintained
in culture and in a cryofrozen condition for extended periods of
time.
[0261] Epithelial cell lines derived from affected regions of CRC
(HITEC; human intestinal tumorogenic epithelial cells) will be
characterized in a similar fashion to the HIPEC lines as described
above in Example 3. The non-transformed state assay will be
omitted.
Example 5
Identification of Potential Therapeutic Targets and Treatment
Efficacy Markers
[0262] It has been hypothesized that cellular, molecular, genetic,
and functional changes in IEC are involved in CRC. A comparison of
specific genes expression in affected and unaffected IEC may be
important to understand mechanisms of the CRC for identification of
genes for use as biomarkers, and for identification of potential
therapeutic targets or treatment efficacy markers.
[0263] Paired nontransformed cell lines derived from the tumorous
(HITEC) and normal (HIPEC) epithelium of the same patient with
colorectal cancer have been used in pilot studies to identify
differences in the morphology, function and gene expression of
these epithelia.
[0264] 5.1. Gene Array Analysis
[0265] An understanding of pathogenetic mechanisms of cancer in the
human colonic epithelium have not progressed very far, at least in
part because there has not been a comprehensive study comparing the
genetic properties of paired epithelial cells originating from
normal and tumorous colonic epithelium of the same individual.
[0266] According to the described invention, several paired HIPEC
(normal) and HITEC (tumor) lines have been established from
patients undergoing colon resection secondary to carcinoma and
their morphologic and phenotypic characteristics, telomerase
activity, and gene expression compared.
[0267] a) Gene array analysis was performed by microarray
hybridization. Total RNA from confluent monolayers of HIPEC and
HITEC were used for expression analysis of 1,154 genes
(representing oncogenes/suppressors, matrix proteins, G proteins,
receptors and channels, apoptosis/proteases and cytokines) by using
the ExpressChip.TM. DNA microarray system (Mergen Ltd, San Leandro,
Calif.).
[0268] 5.2. RNA Isolation
[0269] Trizol (Gibco BRL) was added (5 ml/T75 flask) to HIPEC
monolayers on plastic surfaces and homogenized by Pasteur pipette
followed by addition of 0.5 ml of chloroform with 4% isoamyl
alcohol. After mixing, the suspension was placed on ice for 15
minutes and centrifuged at 12,000 RPM for 15 minutes. After
centrifugation, the aqueous phase was transferred to a fresh tube;
an equal volume of isopropanol was added, kept on ice for 15
minutes and centrifuged again at 12,000 RPM for 15 minutes. After
removal of the supernatant, the RNA pellet was washed with 75%
ethanol by vortexing and subsequent centrifugation for 8 minutes at
7,500 RPM. The pellet was then dried and dissolved in
diethylpyrocarbonate (DEPC, Sigma) treated RNAse free sterile
water. RNA concentration of all preparations was determined by
measuring the absorbance at 260 nm/280 nm (260/280 ration). Only
those samples with a 260/280 ratio greater than 1.9 were used for
the experiments. Each RNA preparation was be checked for lack of
degradation by mini-gel prior to the use for gene array
analysis.
[0270] 5.3. cDNA Synthesis and Microarray Hybridization
[0271] The ExpressChip DNA microarray system was used to perform
the genetic analysis using the total RNA from confluent monolayers
of both cell lines. Total cellular RNA (50 .mu.g) was annealed to
the oligo(dT) oligonucleotide and reverse-transcribed in the
presence of Cy3-labeled (Control) or Cy5-labeled (experimental)
dUTP (Amersham Pharmacia Biotech, Piscataway, N.J.), using 10,000
Units/ml of Superscript II reverse transcriptase (Life
Technologies). The resulting Cy3- and Cy5-labeled cDNA was treated
with RNase One (Promega, Madison, Wis.) for 10 minutes at
37.degree. C., combined and purified by passing through a
Centricon-50 filtration spin column (Millipore, Bedford, Mass.) to
a final volume of 6.5 ml. The cDNA probes were combined with 32.5
ml of hybridization solution and 1.0 ml of blocking solution to a
final volume of 40 ml. The probe mixture was heated at 94.degree.
C. for 2 minutes and then centrifuged at 11,500 g for 10 minutes.
Next, the supernatant was transferred to a clean tube and incubated
at 50.degree. C. for 1 hour before hybridizing to the microarrays.
Hybridizations were performed on cDNA microarray glass slides
ExpressChip.TM. EO2 (Mergen Ltd, San Leandro, Calif.) consisting of
1,154 cDNAs representing families of cytokines/receptors, surface
antigens, matrix metalloproteinases, proteases, and oncogenes. The
hybridization solution (40 ml) was then placed on a pretreated
(UV-cross linked) microarray slide, covered with a coverglass (60
mm) and incubated in a hybridization chamber overnight at
50.degree. C. After hybridization, the slide was washed at room
temperature, first with 0.2.times.SSC, 0.1% SDS for 20 minutes with
gentle shaking, and then with 0.2.times.SSC twice (20 minutes
each). The slide then was dried by spinning at low speed (150 g) in
a centrifuge for 5 minutes and stored in a dark box free from
dust.
[0272] 5.4. Analysis of Gene Array Data
[0273] Slides were scanned using a microarray scanner. The final
intensities of red and green channels were filtered and the ratio
of the red to the green intensity was determined. cDNA microarray
results were derived by comparing total RNA from HITECs
(Cy5-labeled) vs. HIPECs (Cy3-labeled). These experiments were
conducted in triplicate and the results were analyzed using
GeneSpring software (Silicon Genetics, Redwood City, Calif.). To
generate the relative intensity (ratio) values, each gene's
measured intensity was divided by its control channel value in each
sample. To correct for artifacts caused by nonlinear rates of dye
incorporation as well as inconsistencies of the relative
fluorescence intensity between some red and green dyes, an
intensity-dependent normalization (Lowess normalization) was used.
This normalization method fits a curve through the data and uses
this curve to adjust the control value for each measurement. The
average expression level of each gene in 2 groups was calculated
with a cutoff value set to 1.7 or 0.5 for the ratio of median.
Above 2 and below 0.5 were assigned as cutoff values, for up
regulation of gene expression and/or down regulation of gene
expression, respectively.
[0274] 5.5. Results
[0275] The HITEC lines had aberrant expression of several genes in
contrast to the HIPEC lines. The results of microarray analysis of
over-expressed genes in HITEC compared to HIPEC from the same
individuals are shown in FIG. 9. The results of microarray analysis
of underexpressed genes in HITEC compared to HIPEC from the same
individual are shown in FIG. 10. The data revealed that about 50
genes were upregulated and 106 genes were downregulated in each
HITEC compared to its normal counterpart HIPEC (see Table 4). Table
2 and Table 3 show over-expressed genes and under-expressed genes
in tissue from subjects with GI disorders with an increase in
expression greater than 5-fold (i.e., S/C ratios>5, with at
least one value above threshold; S=sample; C=control). Table 5
shows altered genes in CD; Table 6 shows altered genes in UC. Among
the most abundantly increased (greater than 6 fold) transcripts
were the TIMP3, MIP3a, and IL-10 inducible chemokine (SCYA16),
retinoic acid receptor beta, RAB33 (RAS oncogene) (see Table 2).
Among the most underexpressed (at least 6 fold less than control)
genes were interferon induced protein 56 (IFIT1), presenilin-2
(PSEN2), VCAM1, MYBL2, SOD3, RAN (RAS oncogene), and FOSL1 (see
Table 2).
TABLE-US-00003 TABLE 2 Genes over- and under-expressed in HITEC
compared to the normal counterpart in HIPEC Over-expression
Under-expression (fold-increase) (fold-decrease) Gene (S/C) (C/S)
MSH2 5.1 MYBL1 31.3 API2 5.1 SOD3 482.3 MYBL2 8 VCAM1 6.2 TIMP 3
8.5 SCYA20 6.7 NRCAM 5.4 CSYA16 7.7
[0276] Among the overexpressed (greater than 6-fold increase) genes
were tissue inhibitor of metalloproteinase 3 (TIMP 3), small
inducible cytokine subfamily member A 20, and small inducible
cytokine family A member 16 (CSYA 16). TIMP 3, SCYA20, NCAM, and
CSYA16 had 8.5, 6.7, and 7.7 fold increase in gene expression,
respectively in comparison to HIPEC. The HITEC line also exhibited
underexpression of several genes. Mutants (Escherichia coli)
homolog 2 (MSH2), MYBL1, API2, SOD3, MYBL2, and VCAM1 showed a 5.1,
31.3, 5.1, 482.3, 8, and 6.2 fold decrease in expression compared
to its normal counterpart.
TABLE-US-00004 TABLE 3 Over- and Under-expressed Genes in
Gastrointestinal Disorders. Over- Over- Under- Under- expressed
expressed expressed expressed Ratio S/C Ratio S/C in Ratio S/C in
Ratio S/C in in Crohn's Ulcerative Ulcerative Crohn's Gene Disease
Colitis Colitis Disease SCYB6 5.4 5.1 PSMB9 6.4 TNFAIP6 6.7 hla-f
6.8 SCYA3 14.2 APOC1 26.9 31.3 IFIT1 35.9 SCYA20 6.1 41.5 GSTT1
123.4 58.4 SCYA5 64.9 ARHI 74.8 MMP1 42.7 122.6 BST2 247.9 IL1RL1
301.6 PDCD2 5.8 TIM 6.4 NPAS1 6.5 ARHGAP5 7.1 APBA2 8.0 NRCAM 9.0
SFRP1 9.1 IL18R1 9.5 CACNA1H 10.0 ARHGDIB 18.9 PCSK5 35.5 BST2 41.3
EDIL3 60.1 MET 5.1 CLU 5.3 HLA-DPB1 5.5 40.7 IL18 5.9 11.6 MM2 10.7
46.6 HLA-B 12.6 ITGAV 30.2 SOD3 286.4 MYLK 6.2 MYLB1 9.5 RPL32 13.1
COL7A1 31 TNFSF10 47.8 COL15A1 64.6 API2 80.1
TABLE-US-00005 TABLE 5 Altered Gene Expression in Crohn's Disease
Patients Over- Under-expressed Unigene expressed in in Symbol Gene
description CD (S/C) CD (C/S) PDCD2 programmed cell death 2 5.84
NGAP ras GTPase activating protein-like 3.41 5T4 5T4 oncofetal
trophoblast 2.54 glycoprotein COVA1 cytosolic ovarian carcinoma
antigen 1 11.86 BST2 bone marrow stromal cell antigen 2 41.28
FLT3LG fms-related tyrosine kinase 3 ligand 3.51 RPL32 ribosomal
protein L32 13.06 ECM1 extracellular matrix protein 1 6.17 BRCA1
breast cancer 1, early onset 6.55 D10S170 DNA segment, single copy,
probe 0.28 pH4 (transforming sequence, thyroid- 1) COL1A2 collagen,
type 1, alpha 2 2.48 COL13A1 collagen, type XIII, alpha I 2.20 MM2
paraneoplastic neuronal antigen 46.63 TIAF1 TGFB1-induced
anti-apoptotic factor 1 2.06 IL18 interleukin 18 (interferon-gamma-
11.64 inducing factor) STX11 syntaxin 11 11.28 KCNC4 potassium
voltage-gated channel, 4.12 Shaw-related subfamily, member 4 CLN2
ceroid-lipofuscinosis, neuronal 2, late 2.36 infantile
(Jansky-Bielschowsky disease) CST3 cystatin C (amyloid angiopathy
and 2.05 cerebral hemorrhage) APBB2 amyloid beta (A4) precursor
protein- 13.13 binding, family B, member 2 (Fe65- like) APBA3
amyloid beta (A4) precursor protein- 2.11 binding, family A, member
3 (X11- like 2) KCNQ3 potassium voltage-gated channel, 13.97
KQT-like subfamily, member 3 KCNS3 potassium voltage-gated channel,
45.58 delayed-rectifier, subfamily S, member 3 MMP1 matrix
metalloproteinase 1 (interstitial 42.73 collagenase) MMP3 matrix
metalloproteinase 3 3.84 (stromelysin 1, progelatinase) CACNA1E
calcium channel, voltage-dependent, 160.77 alpha 1E subunit GLI3
GLI-Kruppel family member GLI3 5.66 (Greig cephalopolysyndactyly
syndrome) ITGA integrin, alpha 7 5.60 ITGAV integrin, alpha V
(vitronectin receptor, 2.61 alpha polypeptide, antigen CD51) MSH2
mutS (E. coli) homolog 2 (colon 2.12 cancer, nonpolyposis type 1)
MYBL1 v-myb avian myeloblastosis viral 9.49 oncogene homolog-like 1
SCYA20 small inducible cytokine subfamily A 6.10 (Cys-Cys), member
20 NPAS1 neuronal PAS domain protein 1 6.46 ASPA aspartoacylase
(aminoacylase 2, 17.28 Canavan disease) API2 apoptosis inhibitor 2
80.07 BNIP1 BCL2/adenovirus E1B 19 kD- 2.64 interacting protein 1
IGF2 insulin-like growth factor 2 2.86 (somatomedin A) GSTT1
glutathione S-transferase theta 1 123.36 MYO1C myosin 1C 2.75 MYO5A
myosin VA (heavy polypeptide 12, 7.70 myoxin) IFNB1 interferon,
beta 1, fibroblast 2.01 CLN2 ceroid-lipofuscinosis, neuronal 2 late
2.13 0.47 infantile (Jansky-Bielschowsky disease) G6PC
glucose-6-phosphatase, catalytic 12.86 (glycogen storage disease
type 1, von Gierke disease) IL13RA1 interleukin 13 receptor, alpha
1 2.40 IL15RA interleukin 15 receptor, alpha 2.92 IL18R1
interleukin 18 receptor 1 9.51 TTC1 tetratricopeptide repeat domain
1 8.17 IRS2 insulin receptor substrate 2 2.42 proprotein convertase
subtilisin/kexin 1389.26 type 5 ALCAM activated leucoyte cell
adhesion 2.92 molecule MFGE8 milk fat globule-EGF factor 8 protein
3.34 BST1 bone marrow stromal cell antigen 1 6.11 PSMB3 proteasome
(prosome, macropain) 3.74 subunit, beta type 3 RASA1 RAS p21
protein activator (GTPase 2.30 activating protein) 1 RAN RAN,
member of RAS oncogene 2.67 family HLA-DPB1 major
histocompatibility complex, 40.72 class II, DP beta 1 BRCA1 breast
cancer 2, early onset 13.53 COL15A1 collagen, type XV, alpha 1
64.56 MDU1 antigen identified by monoclonal 2.63 antibodies 4F2,
TRA1.10, TROP4 and T43 CST6 cystatin E/M 2.04 ADAM21 a disintegrin
and metalloproteinase 10.37 domain 21 C1NH complement component 1
inhibitor 3.57 (angioedema, hereditary) CASP9 caspase 9,
apoptosis-related cysteine 2.39 protease PRSC1 protease, cysteine 1
(legumain) 0.49 2.04 CMAH cytidine monophosphate-N- 2.43
acetylneuraminic acid hydroxylase (CMP-N-acetylneuraminate) APBB1
amyloid beta (A4) precursor protein- 8.00 binding, family A, member
2 (X11- like) CASP2 caspase 2, apoptosis-related cysteine 11.70
protease MMP2 matrix metalloproteinase 2 (gelatinase 2.00 A, 72 kD
gelatinase, 72 kD type IV collagenase) MIC2 antigen identified by
monoclonal 2.27 0.44 antibodies 12E7, F21 and O13 SCN2A2 sodium
channel, voltage-gated, type 2.14 II, alpha 2 polypeptide F10
coagulation factor X 3.68 F3 coagulation factor III
(thromboplastin, 3.91 tissue factor) CLCN2 chloride channel 2 2.22
CLCN3 chloride channel 3 2.13 GRO1 GRO1 oncogene (melanoma growth
3.03 stimulating activity, alpha) APOC1 apolipoprotein C-1 26.94
ITGA4 integrin, alpha 4 (antigen CD49D, 3.00 alpha 4 subunit of
VLA-4 receptor) MYB v-myb avian myeloblastosis viral 2.33 oncogene
homolog SCYA5 small inducible cytokine A5 2.05 (RANTES) NRCAM
neuronal cell adhesion molecule 9.00 HTLF T-cell leukemia virus
enhancer factor 2.47 ACCN2 amiloride-sensitive cation channel 2,
3.78 neuronal ARHE ras homolog gene family, member E 2.02 ARHGAP4
Rho GTPase activating protein 4 2.06 0.48 IGF2 insulin-like growth
factor 2 0.32 3.11 (somatomedin A) MYLK mysoin, light polypeptide
kinase 0.16 6.22 IL11RA interleukin 11 receptor, alpha 2.03 0.49
IL13RA2 interleukin 13 receptor, alpha 2 3.04 0.33 YWHAZ tyrosine
3-monooxygenase/tryptophan 0.16 6.11 5-monoxygenase activation
protein, zeta polypeptide//dilution 1:3125 PSEN2 presenilin 2
(Alzheimer diease 4) 0.30 3.28 TRAF4 TNF receptor associated factor
4 0.41 2.45 PKD2 polycystic kidney disease 2 0.35 2.87 (autosomal
dominant) PSMA5 proteasome (prosome, macropain) 0.37 2.70 subunit,
alpha type 5 RAB33A RAB33A, member RAS oncogene 3.87 0.26 family
CEACAM4 carcinoembryonic antigen-related cell 0.14 7.33 adhesion
molecule 4 PSMC5 proteasome (prosome, macropain) 26S 0.08 12.03
subunit, ATPase, 5 PSMD12 proteasome (prosome, macropain) 26S 0.44
2.30 subunit, non-ATPase, 12 RGS4 regulator of G-protein signalling
4 0.09 10.93 RGS7 regulator of G-protein signalling 7 0.05 18.59
FUT4 fucosyltransferase 4 (alpha (1,3) 3.07 0.33
fucosyltransferase, myeloid-specific) AKAP12 A kinase (PRKA) anchor
protein 3.05 0.33 (gravin) 12 hla-f HLA-F gene for leukocyte
antigen F 0.50 2.01 HLA-G HLA-G histocompatibility antigen, 4.04
0.25 class I, G COL7A1 collagen, type VII, alpha I 0.03 31.01
(epidermolysis bullosa, dystrophic, dominant and recessive) ACCN2
amiloride-sensitive cation channel 2, 14.53 0.07 neuronal KCNJ4
potassium inwardly-rectifying 0.35 2.84 channel, subfamily J,
member 4 ELA2 elastase 2, neutrophil 11.72 0.09 IL1RL1 interleukin
1 receptor-like 1 17.69 0.06 SCYA2 small inducible cytokine A2 0.22
4.56 (monocyte chemotactic protein 1, homologous to mouse Sig-je)
F8C coagulation factor VIIIc procoagulant 2.35 0.43 component
(hemophilia A) MAAT1 melanoma antigen antigen recognized 0.37 2.70
by T lymphocytes ICAP-1A integrin cytoplasmic domain- 7.12 0.14
associated protein 1 LTB lymphotoxin beta (TNF superfamily, 24.48
0.04 member 3) SCYB6 small inducible cytokine subfamily B 0.20 5.12
(Cys-X-Cys), member 6 (granulocyte chemotactic protein 2) SCYA16
small inducible cytokine subfamily A 2.01 0.50 (Cys-Cys), member 16
L1CAM L1 cell adhesion molecule 7.50 0.13 (hydrocephalus, stenosis
of aqueduct of Sylvius 1), MASA TIM oncogene TIM 6.36 0.16 SFRP1
secreted frizzled-related protein 1 9.09 0.11 TNFSF-10 tumor
necrosis factor (ligand) 0.02 47.84 superfamily, member 10 ARHGDIB
Rho GDP dissociation inhibitor (GDI) 18.93 0.05 GNB3 guanine
nucleotide binding protein (G 2.36 0.42 protein), beta polypeptide
3 BCL2L2 BCL2-like 2 0.37 2.71 IL1R1 interleukin 1 receptor, type 1
3.94 0.25 IL1RAP interleukin 1 receptor accessory 0.11 8.80 protein
PRSS3 protease, serine, 3 (trypsin 3) 8.61 0.12 PSMA4 proteasome
(prosome, macropain) 0.34 2.97 subunit, alpha type 4 RAB3A RAB3A,
member RAS oncogene 0.29 3.41 family MGP matrix GIa protein 3.03
0.33 COL11A1 collagen, type XI, alpha 1 8.04 0.12 HLA-G HLA-G
histocompatibility antigen, 9.76 0.10 class I, G HLA-G HLA-G
histocompatibility antigen, 3.62 0.28 class I, G KIAA0830 KIAA0830
protein 0.34 2.98 COL8A1 collagen, type VIII, alpha 1 0.38 2.63
PCSK4 proprotein convertase subtilisin/kexin 0.14 6.96 type 4 PLOD2
procollagen-lysine, 2 oxyglutarate 5- 0.34 2.94 dioxygenase (lysine
hydroxylase) 2 KCNJ8 potassium inwardly-rectifying 23.62 0.04
channel, subfamily J, member 8 KCNK1 potassium channel, subfamily
K, 17.39 0.06 member 1 (TWIK-1) HAT airway trypsin-like protease
0.48 2.10 SCYA3 small inducible cytokine A3 8.17 0.12 (homologous
to mouse Mip-1a) IL12A interleukin 12A (natural killer cell 0.07
13.55 stimulatory factor 1, cytotoxic lymphocyte maturation factor
1, p35) CASP1 caspase 1, apoptosis-related cysteine 0.45 2.23
protease (interleukin 1, beta, convertase) SCN1B sodium channel,
voltage-gated, type 1, 2.14 0.47
beta polypeptide SCN9A sodium channel, voltage-gated, type 0.42
2.41 IX, alpha polypeptide MMP17 matrix metalloproteinase 17 0.32
3.09 (membrane-inserted) MMP23A matrix metalloproteinase 23A 2.86
0.35 F7 coagulation factor VII (serum 0.05 21.19 prothrombin
conversion prothrombin conversion) SCYB5 small inducible cytokine
subfamily B 0.28 3.60 (Cys-X-Cys), member 5 (epithelial- derived
neutrophil-activating peptide 78) EDIL3 EGF-like repeats and
discoidin I-like 60.14 0.02 domains 3 M1S1 membrane component,
chromosome 2.58 0.39 1, surface marker 1 (40 kD glycoprotein,
identified by monoclonal antibody GA733) NBL1 neuroblastoma
candidate region, 2.39 0.42 suppression of tumorigenicity 1 TNFAIP6
tumor necrosis factor, alpha-induced 0.05 20.62 protein 6 CACNA1A
calcium channel, voltage-dependent 7.33 0.14 P/Q type, alpha 1A
subunit CACNA1H calcium channel, voltage-dependent, 10.03 0.10
alpha 1H subunit CACNA2D1 calcium channel, voltage-dependent, 0.35
2.87 alpha 2/delta subunit 1 WNT5A wingless-type MMTV integration
site 0.39 2.58 family, member 5A NAIP neuronal apoptosis inhibitory
protein 0.15 6.82 ARHGAP5 Rho GTPase activating protein 5 7.06 0.14
ARHI ras homolog gene family, member 1 2.61 0.38 RASA2 RAS p21
protein activator 2 11.88 0.08 GNG11 guanine nucleotide binding
protein 11 0.43 2.34 IFIT1 interferon-inducing protein 56 0.03
31.13 VMD2 vitelliform macular dystrophy (Best 3.66 0.27 disease,
bestrophin) PSEN2 presenlin 2 (Alzheimer disease 4) 0.24 4.15
D13S1056E Probe hTg737 (polycystic kidney 2.74 0.37 disease,
autosomal recessive)
TABLE-US-00006 TABLE 6 Altered Gene Expression in Ulcerative
Colitis Disease Patients Over- Under- expressed in expressed in UC
UC Unigene Symbol Gene description (S/C) (C/S) PDCD2 programmed
cell death 2 3.19 0.31 GTPBP1 GTP binding protein 1 5.66 0.18 KNSL2
kinesin-like 2 0.15 6.53 RAB2 RAB2, member RAS oncogene family 0.07
13.79 COVA1 cytosolic ovarian carcinoma antigen 1 2.41 0.41 BST2
bone marrow stromal cell antigen 2 247.90 0.00 PSMB8 proteasome
(prosome, macropain) subunit, 3.12 0.32 beta type, 8 (large
multifunctional protease 7) FLT3LG fms-related tyrosine kinase 3
ligand 12.50 0.08 ZMPSTE24 zinc metalloproteinase, STE24 (yeast,
0.49 2.05 homolog) TIMP1 tissue inhibitor of metalloproteinase 1
1.01 0.99 (erythroid potentiating activity, colleganase inhibitor)
TIMP3 tissue inhibitor of metalloproteinase 3 4.37 0.23 (Sorsby
fundus dystrophy, pseudoinflammatory) HLA-C major
histocompatibility complex, class I, C 2.31 0.43 D10S170 DNA
segment, single copy, probe pH4 0.43 2.31 (transforming sequence,
thyroid-1) MM2 paraneoplastic neuronal antigen 0.09 10.72 LY6E
lymphocyte antigen 6 complex, locus E 4.48 0.22 SCA2
spinocerebellar ataxia 2 0.47 2.13 (olivopontocerebellar ataxia 2,
autosomal dominant, ataxin 2) IL18 interleukin 18
(interferon-gamma-inducing 0.17 5.89 factor) STX3A syntaxin 3A 0.28
3.57 STX11 syntaxin 11 13.29 0.08 KCNC4 potassium voltage-gated
channel, Shaw- 3.15 0.32 related subfamily, member 4 CLN2
ceroid-lipofuscinosis, neuronal 2, late 2.38 0.42 infantile
(Jansky-Bielschowsky disease) KCNQ3 potassium voltage-gated
channel, KQT-like 0.28 3.62 subfamily, member 3 KCNS3 potassium
voltage-gated channel, delayed- 52.41 0.02 rectifier, subfamily S,
member 3 MMP1 matrix metalloproteinase 1 (interstitial 122.60 0.01
collagenase) CACNA1E calcium channel, voltage-dependent, alpha
121.38 0.01 1E subunit FOSL2 FOS-like antigen 2 7.83 0.13 GRO2 GRO2
oncogene 4.90 0.20 ITGA7 integrin, alpha 7 0.12 8.30 ITGAV
integrin, alpha V (vitronectin receptor, 0.03 30.23 alpha
polypeptide, antigen CD51) MYBL1 v-myb avian myeloblastosis viral
oncogene 0.26 3.78 homolog-like 1 SCYA20 small inducible cytokine
subfamily A (Cys- 41.55 0.02 Cys), member 20 LMO4 LIM domain only 4
2.38 0.42 NPAS1 neuronal PAS domain protein 1 3.35 0.30 APG5L APG5
(autophagy 5, S. cerevisiae)-like 0.41 2.44 BNIP1 BCL2/adenovirus
E1B 19 kD-interacting 2.33 0.43 protein 1 IGF2 insulin-like growth
factor 2 (somatomedin 0.34 2.96 A) IL1A interleukin 1, alpha 5.57
0.18 GSTT1 glutathione S-transferase theta 1 58.37 0.02 IL18R1
interleukin 18 receptor 1 4.93 0.20 YWHAZ tyrosine
3-monooxygenase/tryptophan 5- 0.14 7.29 monooxygenase activation
protein, zeta polypeptide // Dilution 1:3125 TTC1 tetratricopeptide
repeat domain 1 0.08 12.26 IRS2 insulin receptor substrate 2 3.25
0.31 PCSK5 proprotein convertase subtilisin/kexin type 5 519.20
0.00 PCSK7 proprotein convertase subtilisin/kexin type 7 0.38 2.65
PSMB9 proteasome (prosome, macropain) subunit, 6.45 0.16 beta type,
9 (large multifunctional protease 2) RASA1 RAS p21 protein
activator (GTPase 0.46 2.19 activating protein) 1 RAN RAN, member
RAS oncogene family 0.50 2.01 FALZ fetal Alzheimer antigen 0.38
2.62 TIMP2 tissue inhibitor of metalloproteinase 2 0.29 3.50 TPP2
tripeptidyl peptidase II 0.39 2.56 HLA-B major histocompatibility
complex, class I, B 0.08 12.61 HLA-DPB1 major histocompatibility
complex, class II, 0.18 5.46 DP beta 1 CST6 cystatin E/M 0.22 4.51
DDX17 DEAD/H (Asp-Glu-Ala-Asp/His) box 0.42 2.37 polypeptide 17 (72
kD) ADAM21 a disintegrin and metalloproteinase domain 0.11 9.02 21
WNT2B wingless-type MMTV integration site 0.31 3.18 family, member
2B SOD3 superoxide dismutase 3, extracellular 0.00 286.37 CMAH
cytidine monophosphate-N- 3.52 0.28 acetylneuraminic acid
hydroxylase (CMP- N-acetylneuraminate APBA2 amyloid beta (A4)
precursor protein- 5.45 0.18 binding, family A, member 2 (X11-like)
MME membrane metallo-endopeptidase (neutral 3.39 0.29
endopeptidase, enkephalinase, CALLA, CD10) NOVA1 neuro-oncological
ventral antigen 1 3.88 0.26 GRO3 GRO3 oncogene 2.24 0.45 APOC1
apolipoprotein C-I 31.29 0.03 ITGA6 integrin, alpha 6 0.12 8.31 MET
met proto-oncogene (hepatocyte growth 0.19 5.13 factor receptor)
MYB v-myb avian myeloblastosis viral oncogene 3.22 0.31 homolog
SCYA5 small inducible cytokine A5 (RANTES) 64.90 0.02 NRCAM
neuronal cell adhesion molecule 2.70 0.37 IGF2 insulin-like growth
factor 2 (somatomedin 0.29 3.40 A) IL6 interleukin 6 (interferon,
beta 2) 2.81 0.36 IL1B interleukin 1, beta 5.35 0.19 IL3
interleukin 3 (colony-stimulating factor, 4.27 0.23 multiple) MYLK
myosin, light polypeptide kinase 0.44 2.28 MYO6 myosin VI 0.45 2.22
IFIT2 interferon-induced protein 54 4.84 0.21 FIC1 familial
intrahepatic cholestasis 1, 0.33 3.00 (progressive, Byler disease
and benign recurrent) IL13RA2 interleukin 13 receptor, alpha 2 4.19
0.24 PSEN2 presenilin 2 (Alzheimer disease 4) 0.49 2.03 PKD2
polycystic kidney disease 2 (autosomal 0.49 2.06 dominant) PKD2
polycystic kidney disease 2 (autosomal 0.11 9.19 dominant) RAB4
RAB4, member RAS oncogene family 0.34 2.94 RAB5B RAB5B, member RAS
oncogene family 0.18 5.43 PSMC5 proteasome (prosome, macropain) 26S
0.21 4.75 subunit, ATPase, 5 PSMD12 proteasome (prosome, macropain)
26S 0.45 2.22 subunit, non-ATPase, 12 RGS2 regulator of G-protein
signalling 2, 24 kD 3.07 0.33 RGS4 regulator of G-protein
signalling 4 0.11 9.51 RGS7 regulator of G-protein signalling 7
0.06 16.16 FUT4 fucosyltransferase 4 (alpha (1,3) 2.04 0.49
fucosyltransferase, myeloid-specific) AKAP12 A kinase (PRKA) anchor
protein (gravin) 2.06 0.48 12 ENC1 ectodermal-neural cortex (with
BTB-like 0.47 2.14 domain) hla-f HLA-F gene for leukocyte antigen F
6.77 0.15 HLA-G HLA-G histocompatibility antigen, class I, G 3.00
0.33 X MHC class I HLA-J gene, exons 1-8 and 4.64 0.22 complete cds
SPG7 spastic paraplegia 7, paraplegin (pure and 0.47 2.12
complicated autosomal recessive) ACCN2 amiloride-sensitive cation
channel 2, 8.60 0.12 neuronal KCNJ4 potassium inwardly-rectifying
channel, 0.35 2.83 subfamily J, member 4 IL1RL1 interleukin 1
receptor-like 1 301.56 0.00 IL16 interleukin 16 (lymphocyte
chemoattractant 0.25 4.05 factor) STUB1 STIP1 homology and U-Box
containing 0.48 2.09 protein 1 LTB lymphotoxin beta (TNF
superfamily, 4.79 0.21 member 3) SCYB6 small inducible cytokine
subfamily B (Cys- 5.45 0.18 X-Cys), member 6 (granulocyte
chemotactic protein 2) SCYA16 small inducible cytokine subfamily A
(Cys- 3.46 0.29 Cys), member 16 NF1 neurofibromin 1
(neurofibromatosis, 5.25 0.19 vonRecklinghausen disease, Watson
disease) SPG7 spastic paraplegia 7, paraplegin (pure and 0.47 2.11
complicated autosomal recessive ARHGDIB Rho GDP dissociation
inhibitor (GDI) 4.94 0.20 BCL2L2 BCL2-like 2 0.42 2.36 IFNW1
interferon, omega 1 4.15 0.24 IRS2 insulin receptor substrate 2
2.65 0.38 IFNAR2 interferon (alpha, beta and omega) receptor 2 2.38
0.42 RAC3 ras-related C3 botulinum toxin substrate 3 6.92 0.14 (rho
family, small GTP binding protein Rac3) CLU clusterin (complement
lysis inhibitor, SP- 0.33 2.99 40,40, sulfated glycoprotein 2, . .
. , apolipoprotein J) TNFRSF1B tumor necrosis factor receptor
superfamily, 0.25 4.03 member 1B PRSS11 protease, serine, 11 (IGF
binding) 0.44 2.29 PRSS3 protease, serine, 3 (trypsin 3) 7.08 0.14
RAB5A RAB5A, member RAS oncogene family 0.01 68.39 PSMD13
proteasome (prosome, macropain) 26S 0.46 2.18 subunit, non-ATPase,
13 MGP matrix Gla protein 0.24 4.17 COL11A1 collagen, type XI,
alpha 1 21.90 0.05 HLA-G HLA-G histocompatibility antigen, class I,
G 3.07 0.33 KIAA0830 KIAA0830 protein 0.30 3.33 EMS1 ems1 sequence
(mammary tumor and 0.44 2.29 squamous cell carcinoma-associated
(p80/85 src substrate) PCSK4 proprotein convertase subtilisin/kexin
type 4 0.17 6.05 CASP3 caspase 3, apoptosis-related cysteine 0.48
2.09 protease PLOD2 procollagen-lysine, 2-oxoglutarate 5- 0.28 3.57
dioxygenase (lysine hydroxylase) 2 KCNK1 potassium channel,
subfamily K, member 1 9.00 0.11 (TWIK-1) SCYA3 small inducible
cytokine A3 (homologous 14.18 0.07 to mouse Mip-1a) IL12A
interleukin 12A (natural killer cell 0.36 2.75 stimulatory factor
1, cytotoxic lymphocyte maturation factor 1, p35) MMP17 matrix
metalloproteinase 17 (membrane- 0.47 2.15 inserted) X Smooth muscle
myosin heavy chain 2.20 0.45 isoform Smemb ITGA1 integrin, alpha 1
2.34 0.43 CLU clusterin (complement lysis inhibitor, SP- 0.19 5.26
40,40, sulfated glycoprotein 2, testosterone- repressed prostate
message 2, apolipoprotein J) TNFAIP6 tumor necrosis factor,
alpha-induced protein 6 6.68 0.15 CACNA1H calcium channel,
voltage-dependent, alpha 9.50 0.11 1H subunit WNT5A wingless-type
MMTV integration site 0.47 2.12 family, member 5A ARHI ras homolog
gene family, member I 74.84 0.01 CNK1 connector enhancer of
KSR-like 1.00 1.00 (Drosophila kinase suppressor of ras) RASA2 RAS
p21 protein activator 2 9.85 0.10 IFIT1 interferon-induced protein
56 35.91 0.03 ATP6C ATPase, H+ transporting, lysosomal 0.44 2.27
(vacuolar proton pump)16 kD RHO rhodopsin (retinitis pigmentosa 4,
0.27 3.68 autosomal dominant) VMD2 vitelliform macular dystrophy
(Best disease, 2.49 0.40 bestrophin) PSEN2 presenilin 2 (Alzheimer
disease 4) 0.28 3.61 D13S1056E Probe hTg737 (polycystic kidney
disease, 0.32 3.09 autosomal recessive, in)
[0277] 5.6. Telomerase Assay.
[0278] Cells (3.times.10.sup.3) were lysed in Telomerase Repeat
Amplification Protocol (TRAP) buffer and telomerase activity was
assayed using a Telomerase PCR ELISA kit (for example, Roche
Diagnostics GmbH, Mannheim, Del.) following the manufacturers
instructions. Briefly, in the first step, telomerase adds telomeric
repeats to a biotinylated primer, which then is amplified by PCR.
In the second step, the PCR product of telemerase activity is
detected by ELISA using strepavidin coated plates, a digoxigenin
(DIG)-labeled probe and an anti-DIG antibody conjugated to
peroxidase. The reaction then is developed with the peroxidase
substrate, TMB. A heat inactivated negative sample control is run
for each test sample. The test sample is considered positive for
Telomerase activity when the sample OD.sub.490 is a minimum of
0.200 above that for the heat inactivated sample control
(.DELTA.OD>0.200). HT-29 cells and the kit positive lysate were
run as positive controls. Freshly isolated IEC from normal colon
were run as a negative control.
[0279] The HITEC lines had increased telomerase activity as well as
in contrast to the HIPEC lines. As shown in Table 4, HITEC-WT
(tumor line) lysate contained significantly more telomerase
activity as compared to its normal counterpart, HIPEC-WT.
Additionally, active telomerase was detected in HITECs but not in
HIPECs.
TABLE-US-00007 TABLE 4 Telomerase Activity in Paired Normal and
Tumor Colonic Cell Lines Telomerase Activity Sample Description
(.DELTA. OD) HIPEC-WT Normal colon-derived cell line 0.009 HITEC-WT
Tumor colon-derived cell line 0.479 Normal Colonic IEC Freshly
isolated intestinal 0.000 epithelial cells HT-29 Colon
adenocarcinoma cell 2.120 line Positive Control lysate 2.416
Example 6
Identification of Potential Colon Cancer Biomarkers
[0280] Potential biomarkers will be identified using paired HIPEC
and HITEC cell lines to examine differential expression of mRNAs,
proteins, and lipids in CRC IECs compared to unaffected normal IECs
from the same individuals. FIG. 8 shows one embodiment wherein
isolated stem cells differentiate to an epithelial lineage from
both diseased (colon cancer) and normal intestinal tissues.
[0281] 6.1(a) mRNA Expression.
[0282] Gene array data yielding the over expression or under
expression of transcripts (by at least 6 fold or greater) will be
corroborated with mRNA expression by both RT-PCR and Northern
analysis, as described in Example 5 above. If any specific
alteration of gene expression by CRC HIPEC lines is detected, the
conditions will be determined whereby normal HIPEC lines may be
altered to the genotype (profile of gene expression) comparable to
(1) CRC HIPECs and (2) the phenotype of CRC HIPEC lines may be
reverted to a genotype comparable to normal HIPECs. Normal HIPEC
lines will be subjected to the cytokine milieu produced in affected
CRC tissue by co-culturing normal HIPECs with biopsy or tissue
explants from patients with active CRC. Normal HIPEC will be
co-cultured with normal tissues as controls.
[0283] 6.1(b) Analysis Using Microarrays
[0284] An Affymetrix GeneChip Human Genome U133 Plus 2.0 Array
(47,000 characterized transcripts) will be utilized for RNA
expression analysis. Depending on the transcripts identified,
Affymetrix Exon 1.0 ST Arrays or Gene 1.0 ST Arrays, which allow
both a more detailed examination of expression levels and an
examination of alternative splicing of the genes, will be included
on the array. RNA will be isolated by, for example, the Affymetrix
protocol. The slides will be scanned using a Microarray Scanner.
The fluorescence intensities will be calculated using the GenePix
3.05 software. Microarray results will be derived by comparing
total RNA from experimental (affected) HITECs (Cy5-labeled) vs.
control (unaffected) HIPECs (Cy3-labeled). These results will be
analyzed using GeneSpring software (Silicon Genetics). Artifact
correction will be applied using an intensity-dependent
normalization (Lowess normalization). The average expression level
of each gene in the two groups will be calculated and the cutoff
value set to 1.7 or 0.5 for the ratio of the median. Generally,
cutoff values are assigned as above 2 and below 0.5, for up
regulation of gene expression and/or down regulation of gene
expression, respectively.
[0285] 6.1(c) mRNA Expression Analysis Using RT-PCR
[0286] The expression of gene products identified via microarray
analysis as potential biomarkers will be verified via RT-PCR in
order to demonstrate expression in the cell line examined and to
compare relative level of expression against other cell lines.
[0287] The cDNA sequence of genes identified via gene microarrays
will be sourced from GenBank and PCR primers will be synthesized
(Integrated DNA Technologies) for their detection. Depending on the
type of gene identified, either total RNA or poly-A mRNA will be
isolated from the cells, primed with N-capped random
oligonucleotide or oligo-dT primers respectively, reverse
transcribed with Superscript II, and amplified with the use of a
Techne Progene thermal cycler and PlatPfx (Invitrogen). Reaction
products will be run in TBE agarose gels, and RT-PCR products
visualized with Ethidum Bromide staining DNA sequencing will be
performed upon RT-PCR products to further verify their
identity.
[0288] 6.1(d) Analysis Using Northern Blots
[0289] Because splicing changes may cause, or may be a consequence
of, transformation in CRC epithelial cells could also potentially
be one of splicing changes, therefore, Northern analysis will be
performed on identified potential biomarkers to determine whether
any gross splicing alterations are observable.
[0290] Total RNA from the cells being examined will be isolated
using an Applied Biosystems' ToTALLY RNA kit according to the
manufacturer's instructions. Briefly, samples are lysed in a
guanidinium based lysis solution and are then extracted
sequentially with Phenol:Chloroform: IAA and
Acid-Phenol:Chloroform. The RNA is then precipitated with
isopropanol, and reagents are provided for an optional lithium
chloride (LiCl) precipitation as well. The kit includes all the
reagents (except isopropanol) required for isolation of total RNA
from up to 10 g of tissue or about 109 cultured cells, and also
includes ancillary reagents for analysis and storage of the RNA.The
RT-PCR primers and products generated during the RT-PCR analysis
will used to generate the detection probes. Northern analysis will
be accomplished utilizing Applied Biosystems' NorthernMax kit and
subsequent blotting to BrightStar-Plus nylon membranes.
[0291] 6.2(a) Protein Analysis.
[0292] Without being limited by theory, it is believed that the
cancerous state of the IECs in CRC results in the differential
expression, when compared with unaffected IECs, of certain
disease-specific proteins. The paired cell system of the present
invention allows purification of such proteins from pure cell
populations. There are many means for the analytical analysis of
proteins being expressed in CRC cells that are complementary, but
no one method is optimal for detecting all expressed proteins.
Therefore, extracted proteins from paired cell lines will be
analyzed and compared utilizing: 2D-DIGE, iTRAQ, cICAT, and coupled
liquid chromatography-mass spectrometry (LC-MS/MS) and
gas-chromatography-mass spectrometry (GC-MS/MS) utilizing different
separation medias, procedures, and extraction methods.
[0293] Proteins isolated from HIPEC and HITEC cells will be
analyzed via tandem GC/MS, LC/MS, and 2D-DIGE coupled with
MALDI-TOF MS.
[0294] 6.2(b) Protein Extraction and Purification.
[0295] Proteins will be extracted and purified from both media and
cells as follows. Media will be removed from two 100 mm plates, (or
a number of plates that will yield approximately 1 mg of total
protein) per cell line and the plates washed twice with cold PBS.
Cold PBS (3 ml) will be added to each plate and the cells will be
scraped off and collected (first material). An additional 3 ml of
cold PBS will then be added per plate. The plates will be scraped
again, and the cells collected, combined with the first material in
a 15 ml centrifuge tube. Cells will be pelleted by centrifugation
at 500 g for 5 minutes, and the supernatant aspirated off. Cell
pellets will be washed twice more with cold PBS. Cell pellets will
be dissolved in Lysis Buffer (7M Urea, 2M Thiourea, 4% CHAPS, 0.2%
BioLytes 3/10, 0.5% Triton X-100, 2.5 mM Na-pyrophosphate, 1.0 mM
Na.sub.3VO.sub.4, 15 .mu.l SIGMA's Protease Inhibitor Cocktail),
incubated for 10 minutes on ice, sonicated three times for 5
seconds, centrifuged at 14,000.times.g for 30 minutes, and the
supernatant collected. Amersham's 2-D Clean-Up kit will be used to
remove salts. Protein pellets will be dissolved in Lysis Buffer,
sonicated for 5 seconds, and the protein concentration quantified
by the Bradford method using a Bio-Rad Protein Assay kit. The pH of
sample will be adjusted to 8.5 and the concentration adjusted to
5-10 mg/ml.
[0296] This assay also will be repeated utilizing differential
extractions with different detergent combinations in order to
enrich for membrane bound proteins. Furthermore, the media from the
cells also will be collected and analyzed for protein to identify
secretory proteins useful as potential biomarkers.
[0297] 6.2(c) Fluorescence 2-D difference Gel Electrophoresis
(2D-DIGE) Using Cy2, Cy3, and Cy5.
[0298] Stock CyDye DIGE fluors from Amersham will be resuspended in
DMF to a concentration of 1 nmol/.mu.l. These stocks of Cy2, Cy3,
and Cy5 will be diluted further with DMF to 400 pmol/.mu.l and the
protein samples will be diluted to 5-10 pmol/.mu.l. 400 pmol of
fluor will be used to label 50 .mu.g of protein. The fluor and
protein sample will be mixed by vortexing, spin briefly, and
incubated on ice for 30 minutes in the dark. 1 .mu.l of 10 mM
Lysine will be added to stop the reaction. The sample will be
mixed, spun briefly, and incubated on ice for 10 minutes in the
dark.
[0299] 6.2(d) Protein Separation: 2-Dimensional Gel
Electrophoresis.
[0300] Three of the labeled protein samples (Cy2, Cy3, and Cy5)
will be mixed and separated, first utilizing isoelectric focusing
(IEF), and second by molecular weight via SDS-PAGE. A BioRad
Citerion 2D-Gel In CAPR, utilizing a BioRad PROTEAN IEF Cell and a
BioRad Criterion Dodeca cell will enable simultaneous running of up
to twelve 2-D gels at a time. Approximately 300-500 .mu.g of
protein will be loaded per gel when staining with Coomassie Blue
and 100-200 .mu.g for Sypro Ruby staining
[0301] 6.2(e) Spot Picking
[0302] Gels will be stained with Coomassie Blue or Sypro Ruby,
scanned using a Molecular Dynamics' Densitometer SI or Amersham
Biosciences' Typhoon 9410 Fluorescent Imager, and analyzed by Image
Quant or DeCyder software packages. A pick list of desired spots
will be generated, the spots will be picked by an Amersham
Pharmacia Biotech's Ettan Spot Picker, and the gel plugs deposited
into 96-well microtiter plates.
[0303] 6.2(f) Protein Digestion.
[0304] Protein(s) within the gel plugs in the microtiter plates
will be digested with trypsin using a robotic protein digestor,
e.g., TECAN's Genesis Pro Team 150.
[0305] 6.2(g) Mass Spectrometry.
[0306] MALDI-TOF/TOF mass spectrometry analysis will be performed
upon the digested samples utilizing Applied Biosystems' 4700
Proteomics Analyzer, Micromass' Q-TOF API-US, and PerSeptive
Biosystems' Voyager-DE PRO. Proteins that cannot be identified
unambiguously using a MALDI-TOF MS and MS-FiT will undergo de novo
sequence analysis by tandem mass spectrometry, on-line LC coupled
QTOF MS/MS, and MALDI-TOF-TOF tandem MS. The tandem MS experiments
will be performed with a Micromass cLC capillary HPLC coupled to a
QTOF MS/MS system and a LC Packings capillary HPLC coupled to an
MALDI-TOF-TOF tandem mass spectrometer
[0307] 6.2(h) Amino Acid Sequencing.
[0308] Samples for protein sequencing will be applied to a PVDF
membrane and sequenced using Edman degradation on an Applied
Biosystems' Procise 494 cLC.
[0309] 6.2(i) iTRAQ.
[0310] This proteomics method allows the multiplexed comparison of
up to 4 samples in a single experiment. The labeling reagent
consists of a quantification group, N-methylpiperazine, a balance
group, carbonyl, and a hydroxyl succinimide ester group that reacts
with primary amines in the peptide fragments derived from the
digestion of the purified proteins. Quantification is accomplished
by measuring the relative abundance of the four reporter ions (m/z
114.1, 115.1, 116.1, and 117.1) produced following MS/MS
fragmentation of the isobaric iTRAQ labeled peptide mixture.
Purified proteins will be dissolved in 100 mM triethylammonium
bicarbonate buffer, pH 8.5, cysteine residues will be blocked and
alkylated with MMTS as described in Applied Biosystems' iTRAQ.TM.
protocol, and the proteins then digested overnight with trypsin.
The resulting peptide fragments then will be labeled with the iTRAQ
reagent in 70% ethanol following the Applied Biosystems' iTRAQ.TM.
protocol. Samples then will be fractionated using cation exchange
and subjected to LC/MS/MS analysis for protein identification and
quantification. MS results will be analyzed using iTracker and
Quant.
[0311] 6.2(j) cICAT
[0312] This proteomics method will be utilized to compare paired
HIPEC and HITEC cell lines to one another. Like the iTRAQ method,
the cICAT method involves post-harvest labeling of the purified
protein. The cICAT system consists of three components: a reactive
group that reacts with free thiol moieties of cysteine residues, a
linker containing a stable isotope, and a biotin tag for affinity
purification and detection of peptides labeled with either a heavy
or light version of the ICAT reagent. Purified proteins will be
reduced using TCEP and boiled for 10 minutes. The two protein
samples, one HIPEC and the corresponding paired HITEC, then will be
transferred into a vial containing either the cICAT heavy reagent
or light reagent (Applied Biosystems), mixed, briefly centrifuged,
incubated for 2 hours at 37.degree. C. in the dark, combined, and
dried using a SpeedVac. Samples then will be fractionated using
either SDS-PAGE or cation exchange LC, and digested with trypsin.
ICAT labeled peptides will be purified with avidin cartridges
(Applied Biosystems)and the eluate from the avidin cartridge dried
in a SpeedVac. Peptide sequences will be determined using
reversed-phase liquid chromatography-tandem mass spectrometry,
LC-MS/MS. The ProID and ProICAT software packages from Applied
Biosystems will be used for the identification and quantitation of
proteins based upon the LC-MS/MS analysis of the purified
peptides.
[0313] Protein expression also will be analyzed by
immunofluorescence staining and subsequent flow cytometry analysis,
immunohistochemical staining, and Western blot analysis subject to
the availability of antibodies against identified target
molecules.
[0314] 6.3(a) Lipid Analysis.
[0315] Lipids will be analyzed via tandem GC/MS, LC/MS, and
post-separation TLC dye staining and antibody overlays,
immunofluorescence staining and subsequent flow cytometry analysis,
and immunohistochemical staining subject to the availability of
antibodies against identified target molecules.
Example 7
Analysis of Other Reputed Colon Cancer Biomarkers
[0316] Putative previously identified colon cancer biomarkers will
be analyzed utilizing the same paired HIPEC lines and panels used
in validating the biomarkers (see Examples 5 and 6) identified by
the described methods.
Example 8
Validation of Identified Biomarkers.
[0317] Validation of putative biomarkers will be accomplished using
several methodologies to provide a direct comparison between paired
samples or cell lines derived from disease affected tissue regions
and unaffected normal controls. Comparisons obtained with the
paired system will allow an increase, a decrease, a stimulation, an
activation or an inhibition of expression of the biomarker signal
to be identified and measured/quantified between the disease state
and unaffected state.
[0318] 8.1. RT-PCR Analysis:
[0319] RT-PCR analysis entails four steps: (1) RNA purification,
(2) the RT reaction, (3) the RT-PCR reaction, and (4)
visualization/quantitation/scoring of RT-PCR products. An
oligo(dT)20 primer is utilized to prime the RT reaction. By
forgoing a gene specific primer (GSP), costs and efforts are
reduced and the samples and RT-PCR reactions remain equilibrated
with a minimum of effort.
[0320] 8.2. Purification of Total RNA:
[0321] Total RNA will be purified either from tissue
samples/biopsies or from adherent cells growing in tissue culture
flasks. Tissue samples will be placed in RNA Later (Invitrogen) and
are stored at -20.degree. C. till processed (total RNA purified).
Approximately 1 ml of TRIZOL LS reagent (Invitrogen) will be added
per 50-100 mg of tissue sample and the sample homogenized using a
glass-Teflon probe. Cells grown in culture will be lysed directly
in the culture dish by the addition of 1 ml of TRIZOL per 10
cm.sup.2 of dish surface area with repetitive pipetting. After
homogenization, the samples are allowed to sit for 5 minutes at
15-30.degree. C. (room temperature) in order to allow dissociation
of nucleoprotein complexes. An appropriate amount of chloroform
(0.2 ml) is added per ml of TRIZOL utilized to homogenize the cells
or tissue samples. Samples are shaken vigorously by hand for 15
seconds and then incubated at 15-30.degree. C. for 3 minutes.
Samples then are centrifuged 12,000.times.g for 15 minutes at
2-8.degree. C. The upper aqueous phase is removed to a fresh tube
and 0.5 ml of isopropanol per ml of TRIZOL utilized in the initial
homogenization is added to the tube. The sample is vortexed for 1
minute and then incubated for 10 minutes at 15-30.degree. C. prior
to centrifugation of 12,000.times.g for 10 minutes at 2-8.degree.
C. The supernatant is removed and the pellet washed with 75%
ethanol such that 1 ml of ethanol per ml of TriZOL is utilized. The
pellet is allowed to air dry and then is resuspended in DEPC
treated distilled filtered H.sub.2O. The total RNA purified then is
measured utilizing a spectrophotometer and absorbance at A260.
[0322] 8.3(a) RT Reaction:
[0323] The RT and PCR reactions and incubations are performed in a
Techne PROGENE thermal cycler with a heated lid (Techne,
Burlington, N.J.).
[0324] Generally, RT reactions are performed in a 26 .mu.l reaction
volume with 2 .mu.g of total RNA, 2 .mu.l of 50 .mu.M oligo(dT)20
to prime the RT reaction, and 4 .mu.l of 10 mM dNTP. The reaction
is incubated for 5 minutes at 65.degree. C.; then quickly cooled to
4.degree. C. A 14 .mu.l mixture composed of 8 .mu.l of 5.times.
cDNA synthesis buffer (250 mM Tris acetate; pH 8.4, 375 mM
potassium acetate, 40 mM magnesium acetate, and a stabilizer
(Invitrogen)), 2 .mu.l of 0.1M DTT, 2 .mu.l of RNaseOUT (40 U/.mu.l
(Invitrogen)), and 2 .mu.l of ThermoScript RT (15 U/.mu.l
(Invitrogen)) is added to the microcentrifuge tube containing the
annealed 26 .mu.l reaction. The combined 40 .mu.l reaction is
heated to 55.degree. C. for 60 minutes. The temperature then is
raised to 85.degree. C. for 5 minutes, before returning it to
4.degree. C. RNAse H (2 .mu.l) (Invitrogen) is added to the mixture
and the tubes heated to 37.degree. C. for 20 minutes; followed by
cooling to 4.degree. C. 4 .mu.l of this RT reaction will be used in
the subsequent 50 .mu.l PCR reactions described below.
[0325] 8.3(b) PCR:
[0326] Master mixes comprised of all PCR reaction components
(except the RT product) are utilized in order to maximize
efficiency and to minimize amplification variability from
sample-to-sample, as well as from experiment to experiment. A 50
.mu.l PCR reaction is assembled using 4 .mu.l from the prepared RT
reaction described above, 5 .mu.l of 10.times. Plat Taq PCR buffer
Minus Mg (Invitrogen), 1.5 .mu.l of 50 mM MgCl.sub.2, 1 .mu.l of 10
mM dNTP, 3 .mu.l of a 10 .mu.M stock of sense/forward target gene
specific oligonucleotide primer, 3 .mu.l of 10 .mu.M
antisense/reverse oligonucleotide primer, 0.4 .mu.l of Platinum Taq
DNA polymerase (5 U/.mu.l) (Invitrogen), and 32.1 .mu.l of DEPC
H.sub.2O. The reaction is incubated for 2 minutes at 94.degree. C.
before proceeding on to 35 cycles of 94.degree. C. for 1 minute,
56.degree. C. for 30 seconds, and 68.degree. C. for 30 seconds. The
reaction then is cooled to 4.degree. C. and kept at -20.degree. C.
until loading of the reaction onto an agarose gel for analysis.
[0327] 8.3(c) Visualization, Measurement, Quantitation, and
Scoring:
[0328] RT-PCR products are run on a 1% agarose gel, in 1.times. TBE
buffer, imaged with a BioRad Gel Doc 2000 in brightfield mode,
analyzed, and quantitated with Quantity One software (BioRad). The
agarose gels are not stained with ethidium bromide; instead 10
.mu.l of RT-PCR product is mixed with 2 .mu.l of EZ-Vision Three,
6.times. loading dye (Amresco) prior to loading onto the agarose
gel. A Low DNA Mass Ladder (Invitrogen) is also utilized to provide
both accurate and consistent MW size and mass measurements. Values
are normalized based upon the control RT-PCR amplification of both
beta tubulin and GAPDH. Intensity values differences in samples
which are greater than 25% of the mean intensity value are
considered significant.
[0329] 8.3(d) Controls:
[0330] Master mixes of reagents are utilized in order to minimize
variability. Samples for RT-PCR are prepared together, total RNA
concentration determined by A260, oligo dT utilized to prime all RT
reactions, and the samples equilibrated not just for RNA content,
but also normalized based upon amplification of two control primers
sets which amplify beta tubulin and GAPDH. Low DNA Mass Ladder
(Invitrogen) is used to provide a consistent normalization
reference from gel to gel.
[0331] 8.4. Immunohistological (IH) Analysis:
[0332] Biopsies of tissue will be washed three times with PBS,
fixed for 1 hour at room temperature in 3% paraformaldehyde, and
washed three times with PBS. Samples will be either paraffin
embedded or frozen/embedded in Optimal Cutting Temperature
compound, (OCT, Tissue-Tek), and sectioned with a microtome or
cryostat. Slides will be viewed by indirect immunofluorescence
using an inverted microscope (model IX70; Olympus) fitted with an
IX-FLA fluorescence observation attachment and a MicroMax 5-mHz CCD
camera (Princeton Instruments) controlled by IP Lab
(Scanalytics).
[0333] For the purpose of immunohistochemical staining of cell
lines, subconfluent monolayers of HIPEC lines will be grown on
glass cover slips (Fisher Scientific), rinsed three times with PBS
(10 mM sodium phosphate, pH 7.4, 127 mM NaCl), fixed in cold
methanol, washed three times with PBS, blocked with 5% goat serum
(Sigma-Aldrich)/PBS, and incubated with primary antibodies against
the appropriate antigen being examined or an appropriate
isotype-matched control antibody, followed by detection with
appropriate fluorescent conjugated secondary antibodies. Methanol
fixation may also be replaced with a 1 hour room temperature
fixation in 3% paraformaldehyde. Slides will be counterstained with
DAPI during the last 5 minutes of the secondary antibody
incubation.
[0334] Immunofluorescence levels will be quantitated from digital
images (average of 9, each 1300.times.1030 pixels, 437.times.346
.mu.m) recorded using a 20.times. microscope objective with IPLab
3.7 software (Scanalytics). A segmentation range will be chosen to
subtract background and accellular immunofluorescence. The sum of
pixels and their intensities in highlighted cellular areas of
fluorescence will be measured and normalized by dividing by the
number of cells determined from a count of DAPI-stained nuclei for
each image. Data will be expressed as the mean and standard
deviation of normalized summed intensities with the data analyzed
by one-way ANOVA with Holm-Sidak comparisons in SigmaPlot v. 9.01
and SigmaStat v 3.1 (Jandel).
[0335] When intracellular epitopes need to be stained, the cells
will be permeabilized with 0.1% Triton X-100 in PBS on ice for 5
minutes. Slides are blocked with 5% goat serum and stained with
primary and appropriate secondary antibodies conjugated with FITC,
Cy3, or Cy5 (Jackson ImmunoResearch Laboratories). Control staining
is achieved using the appropriate IgG or IgM. Nuclear staining is
accomplished with DAPI. Immunofluorescence and phase microscopy is
performed on an inverted microscope (model IX70; Olympus) with
IX-FLA fluorescence and CCD camera, and the data collected and
analyzed utilizing IPLab v. 3.52 (Scanalytics). The spatial
location and signal intensity (using IPLab) difference of any
epitope based upon immunoflourescence with a change in total
intensity of 25% between disease affected and unaffected tissue
regions will be considered significant. In order to be considered a
validated biomarker for any given sample according to the described
invention, (1) there must be a demonstration of about 80% or higher
intensity differential value or alteration in spatial location of
the epitope between disease affected and the paired unaffected or
normal tissue and/or cells; (2) the alteration in expression of
this identified biomarker must be exclusive to the disease
condition; (3) there must be a demonstration of its alteration
repeatable in at least 50% of a panel of unrelated disease
controls.
[0336] 8.5. Western Blot Analysis:
[0337] For Western blot analysis, cell lysate samples containing 50
.mu.g of protein per lane will be run on a 7.5% SDS-PAGE gel under
reducing conditions and transferred to nitrocellulose by
electroblotting. The blot then will be incubated with primary
antibodies, followed by detection with HRP-conjugated secondary
antibodies.
[0338] 8.6. Protein Visualizations and Quantifications.
[0339] Protein concentrations are determined by absorbance at 280
nm, Bradford assay (BioRad Laboratories), amino acid analysis, and
compared against known standards in Coomassie blue-stained gels.
Proteins are solubilized in Laemmli sample buffer and evaluated by
SDS-PAGE under reducing conditions on 3.5-12% linear gradient, 6%,
or 10% acrylamide gels. Electrophoresed gels are stained with
Coomassie Brilliant Blue R-250, imaged with a BioRad Gel Doc 2000
in brightfield mode, and analyzed with Quantity One software
(BioRad).
[0340] 8.7. Immunoprecipitation (IP) and Immunoblotting (IB).
[0341] Cell lysates of adherent cells are prepared by washing the
cells with cold PBS, followed by disruption in lysis buffer ((50 mM
Tris, pH 7.4, 100 mM NaCl, 0.5 mM EDTA, 1% Triton X-100, 1% SDS,
and protease and phosphatase inhibitor cocktails (Sigma-Aldrich);
diluted 1:10 and 1:100, respectively) and centrifuged to remove the
cellular debri pellet. Immunoprecipitations are performed at
4.degree. C. with the addition of protease inhibitor cocktails
(Sigma-Aldrich) to all the protein samples and buffers. Conditioned
medium or lysates are precleared with 20 .mu.A of an equal mixture
of protein A-agarose and protein G-Sepharose bead slurry. Samples
are incubated with antibody overnight and precipitated with 40
.mu.A protein A-agarose or protein G-Sepharose beads for 2 hours
and followed by washing in 50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1%
NP-40, and 0.1% SDS. After an additional wash, the supernatant is
removed and the immunoprecipitates are analyzed by SDS-PAGE. After
SDS-PAGE is performed, proteins from the gels are
electrophoretically transferred onto polyvinylidene difluoride
membranes (PVDF; BioRad) using an electroblotter, blocked with 5%
nonfat dried milk and 0.2% Tween 20 in 150 mM NaCl, 50 mM Tris-HCl;
pH 7.4, and incubated with primary antibodies followed by
HRP-conjugated secondary antibodies (Pierce). Blots are developed
with ECL reagents (Amersham Biosciences). Band intensities are
quantified from the membrane or scanned films using Quantity 1
software (Bio-Rad Laboratories) after data acquisition with a gel
documentation system (ChemiDoc XRS; Bio-Rad Laboratories).
[0342] 8.8. Electron Microscopy (EM)
[0343] Ultrastructural studies will be performed utilizing a Jeol
JEM-1200EX electron microscope. Confluent monolayers of cells grown
on transwell nylon membranes (Costar) will be fixed with
glutaraldehyde and then treated with osmium tetroxide. After
dehydration in ethanol, the samples will be embedded in Epon. Thin
sections will be stained with uranyl acetate and lead citrate. In
some cases, embedded monolayers will be reembedded and sectioned
perpendicularly.
[0344] 8.9. RNA Array Analysis
[0345] An Affymetrix GeneChip Human Genome U133 Plus 2.0 Array
(47,000 characterized transcripts) will be utilized for RNA
expression analysis. Either Affymetrix Exon 1.0 ST Arrays or Gene
1.0 ST Arrays will be utilized; both provide a detailed examination
of expression levels and an examination of alternative splicing of
the genes included on the array. RNA isolation will be according to
the Affymetrix protocol. The slides will be scanned using a
Microarray Scanner (UMDNJ-RWJMS's Cancer Institute Microarray
Facility, Piscataway, N.J.). The fluorescence intensities will be
calculated using the GenePix 3.05 software. Microarray results will
be derived by comparing total RNA from experimental (affected)
HIPECs (Cy5-labeled) vs. control (unaffected) HIPECs (Cy3-labeled).
These results will be analyzed using GeneSpring software (Silicon
Genetics). Artifact correction will be applied using an
intensity-dependent normalization (Lowess normalization). The
average expression level of each gene in the two groups will be
calculated and the cutoff value set to 1.7 or 0.5 for the ratio of
median. Generally, cutoff values are assigned as above 2 and below
5, for up and/or down regulation respectively, of gene
expression.
[0346] The cDNA sequence of genes identified via the gene
microarrays will be obtained from GenBank and RT-PCR primers
synthesized (Integrated DNA Technologies) for their detection. As
described above, total RNA will be isolated from the cells, primed
with oligo (dT)20 primers, reverse transcribed with ThermoScript
RT, and amplified with the use of a Techne PROGENE thermal cycler
and Plat Taq (Invitrogen). DNA sequencing will be performed upon
RT-PCR products to further verify their identity.
[0347] 8.10. Electron Microscopy:
[0348] 8.10(a) Thin Sections of Cell Layers.
[0349] HIPEC cells are plated in 60 mm Permanox dishes (Nalgene
Nunc) at least 2 days before the experiment. The next day the media
is changed. The media is removed and the adherent cells washed once
in PBS. The cells are fixed in 0.5% gluteraldehyde and 0.2% tannic
acid in PBS for 1 hour at room temperature, and then transferred to
modified Karnovsky's fixative (4% formaldehyde and 2.5%
gluteraldehyde containing 8 mM CaCl.sub.2 in 0.1 M sodium
cacodylate buffer, pH 7.4). Samples are washed with PBS and
post-fixed in 1% osmium tetroxide in 0.1 M sodium cacodylate
buffer, pH 7.4 for 1 hour to produce osmium black. Samples then are
dehydrated through a graded series of ethanol and embedded in
Epon/SPURR resin (EM Science) polymerized at 65.degree. C.
overnight. Sections (approximately 90 nm) are cut with a diamond
knife and stained with saturated uranyl acetate (20 minutes)
followed by 0.2% lead citrate (2.5 minutes). Images are
photographed with a Jeol JEM-1200EX electron microscope (JEOL) as
described in Tsiper et al., 2002, incorporated herein by
reference.
[0350] 8.10(b) Microscopy of EB Sections:
[0351] Slides are viewed by indirect immunofluorescence using an
inverted microscope (Model IX70; Olympus) fitted with an IX-FLA
fluorescence observation attachment and a MicroMax 5-mHz CCD camera
(Princeton Instruments) controlled by IP Lab (Scanalytics).
[0352] 8.10(c) Gel Electrophoresis of Biomarkers
[0353] FIG. 1 shows biomarkers from patients with inflammatory
bowel disease (IBD). Total RNA was extracted from a panel (normal
control (NL); ulcerative colitis (UC); and Crohn's disease (CD)) of
HIPEC monolayers and processed for RT-PCR (35 cycles) with specific
primers. Electrophoresis of amplified PCR products on 1.8% agarose
gel and subsequent staining with ethidium bromide, showed distinct
bands of predicted molecular weight for MIP1.alpha., RHO GTPase,
MMP1 and Rantes. Detection of glyceraldehyde-3-phosphate
dehydrogenase (G3PDH; housekeeping gene) mRNA in all lanes served
as a control (lower panels) for normalization. All four genes
examined were aberrantly expressed in UC, CD, or in both when
compared to NL control which is consistent with the gene array
data.
Example 9
Development of Therapeutic Agents for Colon Cancer
[0354] Antibodies are developed against identified surface and/or
secretory proteins that are abnormally expressed in colon cancer by
a standard protocol. Briefly, this protocol includes the following
steps: 1) immunization of mice (in vitro or in vivo); 2) spleen
removal and preparation of a single cell suspension; 3) myeloma
cell preparation; 4) fusion of spleen cells and myeloma cells; 5)
post-fusion cells cultured in hybridoma selection medium (HAT); 6)
collection and dispersion of peritoneal macrophages; 7) addition of
fused cells to microtiter plates with macrophage (48 hours
post-fusion (2-4.times.10.sup.6 cells/ml)); 8) culture of cells:
37.degree. C., 5% CO.sub.2 [feed with HAT medium]; 9) 7 to 21 days
post fusion, observe and numerate hybridoma clones; 10) screen for
specific antibody production; 11) expand positive cultures by
screening test; 12) redone by limiting dilution technique all
positive hybridoma clones to assure monoclonality and to select for
the fastest growing cell line with the greatest antibody
production; hybridomas will be be recloned periodically (after 3 to
4 months of culture) to prevent overgrowth of the preferred culture
by mutants or cells expressing an altered phenotype; 13) inject
2-10.times.10.sup.6 recloned hybridoma cells into BALB/c mice which
had received an i.p. injection of 0.3 ml of pristane 7 days
previously; and collect ascites 7-21 days latter; and 14) guard
against loss of the hybridoma by storing several ampules of each
clone in liquid nitrogen.
Example 10
Differential mRNA Expression Pattern of Several Cell Lines
Demonstrated by RT-PCR
[0355] 10.1(a) RT-PCR Analysis
[0356] RT-PCR analysis entails four steps: RNA purification, the RT
reaction, the RT-PCR reaction, and
visualization/quantitation/scoring of RT-PCR products. An
oligo(dT).sub.20 primer is utilized to prime the RT reaction rather
than a gene specific primer (GSP) to reduce the effort and costs
which would be incurred by having to individually prime each RT-PCR
reaction with a GSP and to keep the starting material as
equilibrated as possible between samples and RT-PCR reactions with
a minimum of effort.
[0357] 10.1(b) Purification of Total RNA
[0358] Total RNA was purified from adherent cells growing in tissue
culture flasks. Cells grown in culture were lysed directly in the
culture dish by the addition of 1 ml of TRIzol per 10 cm.sup.2 of
dish surface area and by repetitive pipetting. After
homogenization, samples were allowed to sit for 5 minutes at
15-30.degree. C. (room temperature) in order to allow dissociation
of nucleoprotein complex. 0.2 ml of chloroform was added per ml of
TRIzol utilized to homogenize the cells or tissue samples. Samples
were shaken vigorously by hand for 15 seconds and then incubated at
15-30.degree. C. for 3 minutes. Samples then were centrifuged
12,000.times.g for 15 minutes at 2-8.degree. C. The upper aqueous
phase was removed to a fresh tube and 0.5 ml of isopropanol per ml
of TRIzol utilized in the initial homogenization was added to the
tube. The sample was vortexed for 1 minute, incubated for 10
minutes at 15-30.degree. C., and then centrifuged at 12,000.times.g
for 10 minutes at 2-8.degree. C. The supernatant was removed and
the pellet washed with 75% ethanol; such that 1 ml of ethanol per
ml of Trizol was utilized. The pellet was allowed to air dry and
then resuspended in DEPC treated distilled filtered H.sub.2O. Total
RNA purified then was measured utilizing a spectrophotometer and
absorbance at A.sub.260.
[0359] 10.1(c) RT Reaction
[0360] The RT and PCR reactions and incubations were performed in a
thermal cycler with a heated lid. AlfaGene typically employs a
Techne PROGENE thermal cycler for the RT and PCR reactions. The
primers and thermocycler protocols utilized are shown in Table 7
and Table 8, respectively.
TABLE-US-00008 TABLE 7 Primers upstream/sense primer Gene target
designation primer sequence (5' 3') SEQ ID NO Nanog hNanog-2f
ATGCCTGTGATTTGTGGGCC SEQ ID NO: 1 LIN28 hLIN28-1f
CAACCAGCAGTTTGCAGGTGGCTG SEQ ID NO: 2 Oct4 hOct4f-2
CATCAAAGCTCTGCAGAAAGAACTC SEQ ID NO: 3 (variant 1 and 2) Oct4
(variant 1) hOct4f-4 CGGGACACCTGGCTTCGGATTTCG SEQ ID NO: 4 Oct4
(variant 2) hOct4f-5 CATGAGTCAGTGAACAGGGAATG SEQ ID NO: 5 SOX2
hSOX2-6f CAAAAGTCTTTACCAATAATATTTAGAG SEQ ID NO: 6 hSOX2-5f
TAAAAGTTCTAGTGGTACGGTAGGAG SEQ ID NO: 7 Bmi1 bmi-f1
CATAATAGAATGTCTACATTCCTTCTG SEQ ID NO: 8 LGR5 hLGR5-8f
GATCTGTCTTACAACCTATTAGAAG SEQ ID NO: 9 .beta.-tubulin BT8
CTGAAAACACATGTAGATAATGGC SEQ ID NO: 10 TLR1 hTLR1f-4
GTTCTTGGACTAAAAGTTTATTAAG SEQ ID NO: 11 TLR2 hTLR2f-2
CTTATCCAGCACACGAATACACAG SEQ ID NO: 12 TLR4 hTLR4f
TGGATACGTTTCCTTATAAG SEQ ID NO: 13 TLR6 hTLR6f
TTGGACTCATATCAAGATGCTCTG SEQ ID NO: 14 TLR10 hTLR10f
ATGCTTTTCCCGAATTATCCTACG SEQ ID NO: 15 myD88 myD88f-2
CTCCAGGACCGCCCGCCATGGCTG SEQ ID NO: 16 IL8 IL8-1
CTGTGTGTAAACATGACTTCCAAG SEQ ID NO: 17 IFIT1 IFIT1-F2
CAGCAACCATGAGTACAAATGGTG SEQ ID NO: 18 EDIL3 EDIL3-F1
GAAATTGTCAATACAAATGCTCAG SEQ ID NO: 19 BST2 BST2-F2
CCTGCAACCACACTGTGATGGCC SEQ ID NO: 20 API2 API2-F1
CCAAGTGGTTTCCAAGGTGTGAG SEQ ID NO: 21 PCSK2 PCSK2-F1
CAGAGGATTATGCAGGTCCCTGC SEQ ID NO: 22 RGS2 RGS2-F2
GCAAGCTTTCATCAAGCCTTCTC SEQ ID NO: 23 RASA2 RASA2-F4
CTTGTTGTACACATCAAGGCATGC SEQ ID NO: 24 TNFAIP6 TNFAIP6-F1
CCATATGGCTTGAACGAGCAGCCG SEQ ID NO: 25 TIMP3 TIMP3-F1
CAAGCAGATGAAGATGTACCGAG SEQ ID NO: 26 STX11 STX11-F3
GAGGAGTATGTGAATTCTTTGGAG SEQ ID NO: 27 STX5 STX5-F1
CACCCTCATGGCCAAGCGCATTG SEQ ID NO: 28 oligo dT (20 mer)
downstream/sense primer Gene target designation primer sequence (5'
3') SEQ ID NO Nanog hNanog-6r CTCATCTTCACACGTCTTCAGGTTG SEQ ID NO:
29 LIN28 hLIN28-5r GAACCCTCACTTGCATTTGGACAGAG SEQ ID NO: 30 Oct4
hOct4r-3 CTGCTTGATCGCTTGCCCTTCTGGC SEQ ID NO: 31 (variant 1 and 2)
Oct4 (variant 1) hOct4r-5 CTTGTAAGAACATAAACACACCAG SEQ ID NO: 32
Oct4 (variant 2) hOct4-z GGTTTCTGCTTTGCATATCTCCTG SEQ ID NO: 33
SOX2 hSOX2-7r GCCGAATCTTTTAAAATACAACTACG SEQ ID NO: 34 hSOX2-7r
GCCGAATCTTTTAAAATACAACTACG SEQ ID NO: 35 Bmi1 bmi-r4
GGAAGTGGACCATTCCTTCTCCAG SEQ ID NO: 36 LGR5 hLGR5-3r
CTTCAAGGTCACGTTCATCTTGAGC SEQ ID NO: 37 .beta.-tubulin BT9R
CTGGAGGCTTAGGGACCAAGGCTG SEQ ID NO: 38 TLR1 hTLR1r-3
GTGATAACTGCTAGGAATGGAGTAC SEQ ID NO: 39 TLR2 hTLR2r
TTGAAGTTCTCCAGCTCCTG SEQ ID NO: 40 TLR4 hTLR4r GAAATGGAGGCACCCCTTC
SEQ ID NO: 41 TLR6 hTLR6r TCAGAATTTGTAGACTTTCTGTCTC SEQ ID NO: 42
TLR10 hTLR10r CAACCATCATGACCTCTGAATATG SEQ ID NO: 43 myD88 myD88r-3
GTTCCAGTTGCCGGATCATCTCCTG SEQ ID NO: 44 IL8 IL9-6
GAATTTTTTTATGAATTCTCAGCCCTC SEQ ID NO: 45 IFIT1 IFIT1-R2
CACCTTTTCAAAGCAGGCCTTGGC SEQ ID NO: 46 EDIL3 EDIL3-R1
CAGAGGCTCAGAACAACCCGACAG SEQ ID NO: 47 BST2 BST2-R1
CTTCCAAGATGTGCCAGCTTCCTG SEQ ID NO: 48 API2 API2-R2
CTTCCACTGGTAGATCTGAAACATC SEQ ID NO: 49 PCSK5 PCSK5-R1
CAGCTCCTGCCCCAGCACAAGTG SEQ ID NO: 50 RGS2 RGS2-R1
GATAAGAGTTGTTCTCCATCAAG SEQ ID NO: 51 RASA2 RASA2-R4
GGCAGATATTGGTTGAACATCTG SEQ ID NO: 52 TNFAIP6 TNFAIP6-R2
CTCATCTCCACAGTATCTTCCCAC SEQ ID NO: 53 TIMP3 TIMP3-R2
GTTCCCAATAAACCCCATATGACAG SEQ ID NO: 54 STX11 STX11-R3
CATGTGCCAGGCACTGTTCTAGGTG SEQ ID NO: 55 STX5 STX5-R2
GACTCTGGATGTAGGAATCCTGCTC SEQ ID NO: 56 oligo dT (20 mer) (dT)20
TTTTTTTTTTTTTTTTTTTT SEQ ID NO: 57
TABLE-US-00009 TABLE 8 Thermocycler Protocols Positive control for
RT- PCR parameters PCR was PCR denaturation annealing extension
total product step step step # RNA Gene size temp duration temp
duration temp duration of prepared target (bp) (.degree. C.)
(min:sec) (.degree. C.) (min:sec) (.degree. C.) (min:sec) cycles
from: Nanog 852 94.0 :40 56.0 :30 73.0 1:00 35 LIN28 828 94.0 :40
56.0 :30 73.0 1:00 35 Oct4 455 94.0 :40 56.0 :30 73.0 :45 30
(variant 1 and 2) Oct4 828 94.0 :40 56.0 :30 73.0 1:00 35 (variant
1) Oct4 471 94.0 :40 56.0 :30 73.0 :45 40 (variant 2) SOX2 581 94.0
:40 56.0 :30 73.0 :45 35 621 94.0 :40 56.0 :30 73.0 :45 35 Bmi1 576
94.0 :40 56.0 :30 73.0 :45 40 LGR5 498 94.0 :40 56.0 :30 73.0 :45
40 b- 385 94.0 :40 56.0 :30 73.0 :45 30 tubulin TLR1 976 94.0 :40
56.0 :30 73.0 1:00 30 TLR2 676 94.0 :40 56.0 :30 73.0 1:00 30 TLR4
514 94.0 :40 56.0 :30 73.0 1:00 30 TLR6 643 94.0 :40 56.0 :30 73.0
1:00 30 TLR10 615 94.0 :40 56.0 :30 73.0 1:00 30 myD88 566 94.0 :40
56.0 :30 73.0 1:00 30 IL8 319 94.0 :40 56.0 :30 73.0 :30 30 IFIT1
508 94.0 :40 56.0 :30 73.0 :45 38 cervix EDIL3 514 94.0 :40 56.0
:30 73.0 :45 38 brain BST2 305 94.0 :40 56.0 :30 73.0 :30 38 kidney
API2 698 94.0 :40 56.0 :30 73.0 1:00 38 kidney PCSK5 506 94.0 :40
56.0 :30 73.0 :45 38 thyroid RGS2 361 94.0 :40 56.0 :30 73.0 :30 38
prostate RASA2 515 94.0 :40 56.0 :30 73.0 :45 38 muscle TNFAIP6 558
94.0 :40 56.0 :30 73.0 :45 38 lung TIMP3 611 94.0 :40 56.0 :30 73.0
1:00 42 cervix STX11 745 94.0 :40 56.0 :30 73.0 1:00 42 placenta
STX5 523 94.0 :40 56.0 :30 73.0 :45 42 prostate oligo dT
(20mer)
[0361] Typical RT reactions were performed in a 26 ul reaction
volume with 2 ug of total RNA, 2 ul of 50 uM oligo(dT).sub.20 to
prime the RT reaction, and 4 ul of 10 mM dNTP. The reaction was
incubated for 5 minutes at 65.degree. C. and then quickly cooled to
4.degree. C. A 14 ul mixture composed of 8 ul of 5.times. cDNA
synthesis buffer (250 mM Tris acetate; pH 8.4, 375 mM potassium
acetate, 40 mM magnesium acetate, and a stabilizer; Invitrogen), 2
ul of 0.1M DTT, 2 ul of RNaseOUT (40 U/ul; Invitrogen), and 2 ul of
ThermoScript RT (15 U/ul; Invitrogen) was added to the
microcentrifuge tube containing the annealed 26 ul reaction. The
combined 40 ul reaction was heated to 55.degree. C. for 60 minutes;
the temperature is raised to 85.degree. C. for 5 minutes, before
returning it to 4.degree. C. 2 ul of RNAse H (Invitrogen) was added
to the mixture and the tubes heated to 37.degree. C. for 20 minutes
followed by cooling to 4.degree. C. 4 ul of this RT reaction was
used in the subsequent 50 ul PCR reactions.
[0362] 10.1(d) PCR Reaction
[0363] Master mixes comprised of everything except the RT product
were utilized in order to maximize efficiency and minimize both
effort and sample-to-sample, as well as experiment to experiment,
amplification variability. A 50 ul PCR reaction was assembled using
4 ul from the prepared RT reaction described earlier, 5 ul of
10.times. Plat Taq PCR buffer Minus Mg (Invitrogen), 1.5 ul of 50
mM MgC.sub.2, 1 ul of 10 mM dNTP, 3 ul of a 10 uM stock of
sense/forward target gene specific oligonucleotide primer, 3 ul of
10 uM antisense/reverse oligonucleotide primer, 0.4 ul of Platinum
Taq DNA polymerase (5 U/ul; Invitrogen), and 32.1 ul of DEPC
H.sub.2O. The reaction was incubated for 2 minutes at 94.degree. C.
before proceeding onto 35 cycles of 94.degree. C. for 1 minute,
56.degree. C. for 30 seconds, and 68.degree. C. for 30 seconds. The
reaction was then cooled to 4.degree. C. and kept at -20.degree. C.
untiil is was loaded on to an agarose gel for analysis.
[0364] 10.1(e) Visualization, Measurement, Quantitation, and
Scoring
[0365] RT-PCR products were run on a 1% agarose gel in 1.times. TBE
buffer, imaged with a BioRad Gel Doc 2000 in brightfield mode,
analyzed, and quantitated with Quantity One software (BioRad).
Agarose gels were not stained with ethidium bromide, instead 10 ul
of RT-PCR product was mixed with 2 ul of EZ-Vision Three, 6.times.
loading dye (Amresco) prior to loading onto the agarose gel. A Low
DNA Mass Ladder (Invitrogen) was also utilized to provide both
accurate and consistent MW size and mass measurements. Values are
normalized based upon the control RT-PCR amplification of both beta
tubulin and GAPDH. Intensity values differences in samples which
are greater than 25% of the mean intensity values are considered
significant.
[0366] 10.1(F) Controls
[0367] Master mixes of reagents were utilized in order to minimize
variability. Samples for RT-PCR were prepared together, total RNA
concentration determined by A.sub.260, oligo dT utilized to prime
all RT reactions, and the samples equilibrated for RNA content, and
normalized based upon amplification of two control primers sets,
which amplify beta tubulin and GAPDH. The use of the Low DNA Mass
Ladder (Invitrogen) provides a consistent normalization reference
from gel to gel.
[0368] FIG. 11 shows RT-PCR amplicons derived from normal cells and
from gastrointestinal diseased cells. FIG. 11 (lane 2) shows that
normal cells display a IFIT-1(-), EDIL3(-), PCSK5(lo), BST2(+),
RGS2(+), RASA2(-), TNFAIP6(+), AIPI2 (-), TIMP3(+), STX11(+), STX5
(+), BT(+) phenotype; CRC cells (lane 3) display a IFIT-1(+),
EDIL3(-), PCSK5(lo), BST2(+), RGS2(+), RASA2(+), TNFAIP6(+), AIPI2
(+), TIMP3(+), STX11(+), STX5(+), BT(+) phenotype.
[0369] FIG. 11 (lane 4) shows that non-active ulcerative colitis
cells display a IFIT-1(+), EDIL3(-), PCSK5(-), BST2(+), RGS2(+),
RASA2(-), TNFAIP6(+), AIPI2 (-), TIMP3(+), STX11(+), STX5(-), BT(+)
phenotype; cells with active ulcerative colitis (lane 5) displayed
a a IFIT-1(+), EDIL3(-), PCSK5(+), BST2(+), RGS2(+), RASA2(+),
TNFAIP6(+), AIPI2 (+), TIMP3(+), STX11(+), STX5(+), BT(+)
phenotype.
[0370] FIG. 11 (lane 6) shows that non-active Crohn's disease cells
display a IFIT-1(lo), EDIL3(lo), PCSKT(lo), BST2(+), RGS2(+),
RASA2(lo), TNFAIP6(lo), AIPI2(+), TIMP3(+), STX11(+), STX5(+),
BT(+) phenotype; active Crohn's disease cells (lane 7) display a
IFIT-1(+), EDIL3(+), PCSKT(+), BST2(+), RGS2(+), RASA2(+),
TNFAIP6(+), AIPI2 (-), TIMP3(+), STX11(+), STX5(-), BT(+)
phenotype.
[0371] These results show that according to the described
invention, normal and diseased cells can be distinguished from each
other by RT-PCR to analyze the differential mRNA expression of the
biomarker set.
Example 11
Immunohistochemical Comparison of the Differential Expression of
SOD3 Between Cancer and Normal Colonic Tissue from Patients with
CRC
[0372] Paired cancerous and normal tissue samples from patients
with gastrointestinal cancer who underwent surgical treatment at
the JSS Medical College Hospital, Mysore, India were obtained
within 30 minutes from the surgery and were washed three times with
PBS, fixed for 1 hour at room temperature in 3% paraformaldehyde,
and washed three times with PBS. Samples were paraffin embedded and
sectioned with a microtome. Postoperative clinical diagnosis was
confirmed by an expert pathologist. Subsequently, histological
sections (4 micron thickness) were cut from the paraffin blocks and
embedded on glass slides for immunohistochmical staining with
rabbit polyclonal antibodies (abCAM, Cambridge, Mass.) against
human SOD3 (FIG. 12), TIMP3 (FIG. 13), IFIT-1 (FIG. 14), and PCSK5
(FIG. 15). The histological sections were de-paraffinized and
washed 2.times.5 minutes in TBS plus 0.25% Triton X-100 with gentle
agitation. Tissue sections then were blocked with 10% normal serum
with 1% BSA in TBS for 2 hours at room temperature. Sections from
each of the paired tissue sections were dual stained by incubation
with primary antibodies (1:1000 dilution in TBS with 1% BSA)
against the above mentioned antigens (TIMP3, SOD3, IFIT1, and
PCSK5) or by incubation with an isotype matched control antibody
for two hours at room temperature. Slides then were rinsed
3.times.5 minutes in TBS 0.025% triton with gentle agitation.
Subsequently, a secondary red fluorochome-conjugated (Alexa
Fluor--Invitrogen) goat anti-rabbit IgG (1:100 dilution) was added
and incubated for 1 hour. Slides also were stained with a FITC
conjugated mouse anti-human cytokeratin 18 antibody (Sigma) or an
FITC conjugated goat anti mouse control IgG. Finally, the slides
were rinsed 3.times.5 min in TBS and mounted with one drop of
mounting medium (Fluoroguard, BioRad) and a glass cover slip.
Stained tissue samples then were analyzed using a Nikon Eclipse 80i
microscope fitted with a fluorescence observation attachment and a
Cool Snap CCD camera (Photometric) controlled by Nikon Imaging
System (NIS--Elements AR) software.
[0373] Exemplary antibodies useful for this protocol include, but
are not limited to, mouse anti-human CK18 monoclonal IgG1 FITC
conjugated antibody (for cytokeratin-18 (CK18)) (Sigma, St. Loius,
Mo.); rabbit polyclonal anti-human SOD3 IgG (for superoxide
dismutase 3 (SOD3)) (AbCam, Cambridge, Mass.); rabbit polyclonal
anti-human PCSK5 IgG (for proprotein convertase subtilisin/kexin
type 5 (PCSK5)) (Abcam, Cambridge, Mass.); rabbit polyclonal
anti-human IFIT1 IgG (for interferon-induced protein with
tetratricopeptide repeats 1 (IFIT1)) (Abcam, Cambridge, Mass.); and
rabbit polyclonal anti-human TIMP3 IgG, goat anti-rabbit IgG Alexa
546 conjugated IgG (for TIMP metallopeptidase inhibitor 3 (TIMP3))
(Abcam, Cambridge, Mass.).
[0374] Results are shown in FIGS. 12-15. These results show that
(a) SOD3 (FIG. 12) expression is reduced dramatically in cancerous
tissue (right panel) compared to its normal counterpart (left
panel); (b) TIMP3 (FIG. 13) expression is increased in cancerous
tissue (right panel) compared to its normal counterpart (left
panel); IFIT-1 (FIG. 14) expression is increased in cancerous
tissue (right panel) compared to its normal counterpart (left
panel); and PCSK5 (FIG. 15) expression is increased in cancerous
tissue (right panel) compared to its normal counterpart (left
panel).
[0375] While the present invention has been described with
reference to the specific embodiments thereof it should be
understood by those skilled in the art that various changes may be
made and equivalents may be substituted without departing from the
true spirit and scope of the invention. In addition, many
modifications may be made to adopt a particular situation,
material, composition of matter, process, process step or steps, to
the objective spirit and scope of the present invention. All such
modifications are intended to be within the scope of the claims
appended hereto.
Sequence CWU 1
1
57120DNAUnknownMAMMALIAN 1atgcctgtga tttgtgggcc
20224DNAUnknownMAMMALIAN 2caaccagcag tttgcaggtg gctg
24325DNAUnknownMAMMALIAN 3catcaaagct ctgcagaaag aactc
25424DNAUnknownMAMMALIAN 4cgggacacct ggcttcggat ttcg
24523DNAUnknownMAMMALIAN 5catgagtcag tgaacaggga atg
23628DNAUnknownMAMMALIAN 6caaaagtctt taccaataat atttagag
28726DNAUnknownMAMMALIAN 7taaaagttct agtggtacgg taggag
26827DNAUnknownMAMMALIAN 8cataatagaa tgtctacatt ccttctg
27925DNAUnknownMAMMALIAN 9gatctgtctt acaacctatt agaag
251024DNAUnknownMAMMALIAN 10ctgaaaacac atgtagataa tggc
241125DNAUnknownMAMMALIAN 11gttcttggac taaaagttta ttaag
251224DNAUnknownMAMMALIAN 12cttatccagc acacgaatac acag
241320DNAUnknownMAMMALIAN 13tggatacgtt tccttataag
201424DNAUnknownMAMMALIAN 14ttggactcat atcaagatgc tctg
241524DNAUnknownMAMMALIAN 15atgcttttcc cgaattatcc tacg
241624DNAUnknownMAMMALIAN 16ctccaggacc gcccgccatg gctg
241724DNAUnknownMAMMALIAN 17ctgtgtgtaa acatgacttc caag
241824DNAUnknownMAMMALIAN 18cagcaaccat gagtacaaat ggtg
241924DNAUnknownMAMMALIAN 19gaaattgtca atacaaatgc tcag
242023DNAUnknownMAMMALIAN 20cctgcaacca cactgtgatg gcc
232123DNAUnknownMAMMALIAN 21ccaagtggtt tccaaggtgt gag
232223DNAUnknownMAMMALIAN 22cagaggatta tgcaggtccc tgc
232323DNAUnknownMAMMALIAN 23gcaagctttc atcaagcctt ctc
232424DNAUnknownMAMMALIAN 24cttgttgtac acatcaaggc atgc
242524DNAUnknownMAMMALIAN 25ccatatggct tgaacgagca gccg
242623DNAUnknownMAMMALIAN 26caagcagatg aagatgtacc gag
232724DNAUnknownMAMMALIAN 27gaggagtatg tgaattcttt ggag
242823DNAUnknownMAMMALIAN 28caccctcatg gccaagcgca ttg
232925DNAUnknownMAMMALIAN 29ctcatcttca cacgtcttca ggttg
253026DNAUnknownMAMMALIAN 30gaaccctcac ttgcatttgg acagag
263125DNAUnknownMAMMALIAN 31ctgcttgatc gcttgccctt ctggc
253224DNAUnknownMAMMALIAN 32cttgtaagaa cataaacaca ccag
243324DNAUnknownMAMMALIAN 33ggtttctgct ttgcatatct cctg
243426DNAUnknownMAMMALIAN 34gccgaatctt ttaaaataca actacg
263526DNAUnknownMAMMALIAN 35gccgaatctt ttaaaataca actacg
263624DNAUnknownMAMMALIAN 36ggaagtggac cattccttct ccag
243725DNAUnknownMAMMALIAN 37cttcaaggtc acgttcatct tgagc
253824DNAUnknownMAMMALIAN 38ctggaggctt agggaccaag gctg
243925DNAUnknownMAMMALIAN 39gtgataactg ctaggaatgg agtac
254020DNAUnknownMAMMALIAN 40ttgaagttct ccagctcctg
204119DNAUnknownMAMMALIAN 41gaaatggagg caccccttc
194225DNAUnknownMAMMALIAN 42tcagaatttg tagactttct gtctc
254324DNAUnknownMAMMALIAN 43caaccatcat gacctctgaa tatg
244425DNAUnknownMAMMALIAN 44gttccagttg ccggatcatc tcctg
254527DNAUnknownMAMMALIAN 45gaattttttt atgaattctc agccctc
274624DNAUnknownMAMMALIAN 46caccttttca aagcaggcct tggc
244724DNAUnknownMAMMALIAN 47cagaggctca gaacaacccg acag
244824DNAUnknownMAMMALIAN 48cttccaagat gtgccagctt cctg
244925DNAUnknownMAMMALIAN 49cttccactgg tagatctgaa acatc
255023DNAUnknownMAMMALIAN 50cagctcctgc cccagcacaa gtg
235123DNAUnknownMAMMALIAN 51gataagagtt gttctccatc aag
235223DNAUnknownMAMMALIAN 52ggcagatatt ggttgaacat ctg
235324DNAUnknownMAMMALIAN 53ctcatctcca cagtatcttc ccac
245425DNAUnknownMAMMALIAN 54gttcccaata aaccccatat gacag
255525DNAUnknownMAMMALIAN 55catgtgccag gcactgttct aggtg
255625DNAUnknownMAMMALIAN 56gactctggat gtaggaatcc tgctc
255720DNAUnknownMAMMALIAN 57tttttttttt tttttttttt 20
* * * * *
References