Method And Means For Treatment Of Osteoarthritis

Abstract

The present invention relates to in vivo and in vitro methods, agents and compound screening assays for inducing anabolic stimulation of chondrocytes, including cartilage formation enhancing pharmaceutical compositions, and the use thereof in treating and/or preventing a disease involving a systemic or local decrease in mean cartilage thickness in a subject.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application is a divisional of U.S. application Ser. No. 11/158,252, filed Jun. 21, 2005 which claims priority to U.S. Provisional Application No. 60/581,568, filed Jun. 21, 2004, the disclosure of which is incorporated herein by reference.

FIELD OF THE INVENTION

[0002] The invention relates to the field of medicinal research, cartilage physiology and diseases involving the degeneration of cartilage tissue. More specifically, the invention relates to methods and means for identifying compounds that stimulate anabolic processes in chondrocytes and that typically induce the synthesis of cartilage. The invention also relates to the compounds that are useful in the treatment of osteoarthritis.

[0003] Cartilage is an avascular tissue made up largely of cartilage-specific cells, the chondrocytes, proteoglycans and collagen proteins, which are structural proteins that provide structural strength to connective tissue, such as skin, bone and cartilage. Collagen II, together with the protein collagen IX, forms a "biological alloy", which is molded into a fibril-like structure and is arranged in a precise network, providing cartilage with great mechanical strength. The chondrocytes in normal articular cartilage occupy approximately 5% of the tissue volume, while the extra-cellular matrix makes up the remaining 95% of the tissue. The chondrocytes secrete the components of the matrix, which in turn supplies the chondrocytes with an environment suitable for their survival under mechanical stress.

[0004] Breakdown of articular cartilage, which is part of joints and which cushions the ends of the bones, causes the bones to rub against each other leading to pain and loss of movement. Cartilage degradation may also be the result of an imbalance in cartilage synthesizing (anabolic) and cartilage degrading (catabolic) processes. Unlike most tissues, cartilage does not self-repair following injury. The inability of cartilage to self-repair after injury, disease, or surgery is a major limiting factor in rehabilitation of degrading joint surfaces and injury to meniscal cartilage.

[0005] There are many diseases involving the degeneration of cartilage. Rheumatoid arthritis and osteoarthritis are among the most prominent. Osteoarthritis (also referred to as OA, or as wear-and-tear arthritis) is the most common form of arthritis and is characterized by loss of articular cartilage, often associated with hypertrophy of the bone. The disease mainly affects hands and weight-bearing joints such as knees, hips and spines. This process thins the cartilage through a phenomenon called apoptosis, or programmed cell death. When the surface area has disappeared due to the thinning, there is a grade I osteoarthritis; when the tangential surface area has disappeared, there is a grade two osteoarthritis. There are other levels of degeneration and destruction, which affect the deep and the calcified layers that border with the subchondral bone.

[0006] The clinical manifestations of the development of the osteoarthritis condition are: increased volume of the joint, pain, crepitation and functional disability that, gradually and steadily, first hinders the performance of lengthy walks and forced flexion and extension movements, depending on the affected joint, and then pain and limitation of minimum efforts emerge as well as pain at rest which interrupts sleeping. If the condition persists without correction and/or therapy, the joint is destroyed, leading the patient to major replacement surgery with total prosthesis, or to disability.

[0007] Therapeutic methods for the correction of the articular cartilage lesions that appear during the osteoarthritic disease have been developed, but so far none of them have been able to achieve the regeneration of articular cartilage in situ and in vivo.

Reported Developments

[0008] Osteoarthritis is difficult to treat. At present, no cure is available and treatment focuses on relieving pain and preventing the affected joint from becoming deformed. Common treatments include the use of non-steroidal anti-inflammatory drugs (NSAID's), which are often used to relieve pain, while specific COX-2 inhibitors are used to relieve severe pain. Medicines such as chondroitin and glucosamine are thought to improve the cartilage itself. These treatments may be relatively successful, but not a substantive amount of research data is available.

[0009] In severe cases, joint replacement may be necessary. This is especially true for hips and knees. If a joint is extremely painful and cannot be replaced, it may be fused. This procedure stops the pain, but results in the permanent loss of joint function, making walking and bending difficult.

[0010] The treatment that has 74% to 90% effectiveness and produces excellent results is the transplantation of cultured autologous chondrocytes, by taking chondral cellular material from the patient, sending it to a laboratory where it is seeded in a proper medium for its proliferation, and, once enough volume is achieved after a variable period that may last from weeks to months, transporting it in a special container and implanting it in the damaged tissues to cover the tissue's defects.

[0011] Another treatment includes the intraarticular instillation of Hylan G-F 20 (Synvisc, Hyalgan, Artz etc.), a substance that improves temporarily the rheology of the synovial fluid, producing an almost immediate sensation of free movement and a marked reduction of pain. The residual effects of this substance act on the synovial receptors causing a pain reduction that lasts several weeks and even months. However, this isolated effect is counterproductive for the course of the disease and for the viability of the cartilage because, as it masks the symptoms, the joint is used with more intensity and its destruction is accelerated as the original problem is not corrected and the damaged articular cartilage is not restored.

[0012] Other reported methods include application of tendinous, periosteal, fascial, muscular or perichondral grafts; implantation of fibrin or cultured chondrocytes; implantation of synthetic matrices, such as collagen, carbon fiber; administration of electromagnetic fields. All of these have reported minimal and incomplete results with formation of repair, but not regenerative tissue, resulting in a poor quality tissue that can neither support the weighted load nor allow the restoration of an articular function with normal movement.

[0013] Stimulation of the anabolic processes, blocking catabolic processes, or a combination of these two, may result in stabilization of the cartilage, and perhaps even reversion of the damage, and therefore prevent further progression of the disease. Various triggers may stimulate anabolic stimulation of chondrocytes. Insulin-like growth factor-I (IGF-I) is the predominant anabolic growth factor in synovial fluid and stimulates the synthesis of both proteoglycans and collagen. It has also been shown that members of the bone morphogenetic protein (BMP) family, notably BMP2, BMP4, BMP6, and BMP7, and members of the human transforming growth factor-b (TGF-b) family can induce chondrocyte anabolic stimulation (Chubinskaya and Kuettner, 2003). A compound has recently been identified that induces anabolic stimulation of chondrocytes (U.S. Pat. No. 6,500,854; EP 1.391211). However, most of these compounds show severe side effects and, consequently, there is a strong need for compounds that stimulate chondrocyte differentiation without severe side effects.

[0014] The present invention relates to the relationship between the function of selected proteins identified by the present inventors (hereinafter referred to as "TARGETS") and anabolic stimulation of chondrocytes.

SUMMARY OF THE INVENTION

[0015] The present invention relates to a method for identifying compounds that induce cartilage-synthesizing processes, which lead to anabolic stimulation of chondrocytes, comprising contacting the compound with a polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 55-82, 198-391, and 480 or a functional fragment or derivative thereof, under conditions that allow said polypeptide to bind to the compound, and measuring a compound-polypeptide property related to the anabolic stimulation of chondrocytes.

[0016] The present invention also relates to expression inhibitory agents, pharmaceutical compositions comprising the same, methods for the in vitro production of cartilage tissue, and host cells expressing said agents.

[0017] Aspects of the present method include the in vitro assay of compounds using polypeptide of a TARGET, and cellular assays wherein TARGET inhibition is followed by observing indicators of efficacy, including collagen type II, alpha-1 (col2 1) and aggrecan levels.

[0018] Another aspect of the invention is a method of treatment or prevention of a condition involving de-differentiation of chondrocytes and/or loss of cartilage thickness, in a subject suffering or susceptible thereto, by administering a pharmaceutical composition comprising an effective cartilage formation-enhancing amount of a TARGET inhibitor.

[0019] A further aspect of the present invention is a pharmaceutical composition for use in said method wherein said inhibitor comprises a polynucleotide selected from the group of an antisense polynucleotide, a ribozyme, and a small interfering RNA (siRNA), wherein said inhibitor comprises a nucleic acid sequence complementary to, or engineered from, a naturally occurring polynucleotide sequence encoding a polypeptide, comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 55-82, 198-391, and 480 or a fragment thereof.

[0020] Another further aspect of the present invention is a pharmaceutical composition comprising a therapeutically effective cartilage formation-enhancing amount of a TARGET inhibitor or its pharmaceutically acceptable salt, hydrate, solvate, or prodrug thereof in admixture with a pharmaceutically acceptable carrier. The present polynucleotides and TARGET inhibitor compounds are also useful for the manufacturing of a medicament for the treatment of conditions involving de-differentiation of chondrocytes and/or cartilage thickness loss.

[0021] Furthermore, the invention relates also to diagnostic methods.

BRIEF DESCRIPTION OF THE DRAWINGS

[0022] FIG. 1. Quantification of Col2.alpha.1 expression in primary human chondrocytes 12 days post infection with the indicated viruses.

[0023] FIG. 2. Example of duplicate screening results for Col2.alpha.1 expression of part of the SILENCESELECT.RTM. library.

[0024] FIG. 3 (A-N): Quantification of Col2 1 expression in primary human chondrocytes 12 days post infection with the indicated viruses.

[0025] FIG. 4. Quantification of alcian blue staining on human primary chondrocytes, 12 days after infection with the indicated viruses, compared to uninfected cells.

[0026] FIG. 5 (A-N): Quantification of aggrecan expression in primary human chondrocytes 12 days post infection with the indicated viruses.

[0027] FIG. 6 (A-K): On target analysis with different constructs targeting the indicated genes. The on target analysis is assessed through detection of the Col2 1 expression in primary human chondrocytes 12 days post infection with the indicated viruses. Data are represented as luminescence units. The different thresholds corresponding to the different infection volumes are indicated as a line. Increasing the infection volumes leads to an increased threshold.

[0028] FIG. 7 (A-L): GAG analysis on chondrocytes in alginate cell culture 10 days post infection. The data are represented as relative GAG levels to the average of KD control 1 and KD control 2, being Ad-siRNA targeting PTGER4 and GRM7 respectively. Two individual data points are shown for every condition.

[0029] FIG. 8 (A-L): Hydroxyproline analysis on chondrocytes in alginate cell culture 10 days post infection. The data are represented as relative hydroxyproline levels to the average of KD control 1 and KD control 2, being Ad-siRNA targeting PTGER4 and GRM7 respectively. Two individual data points are shown for every condition.

[0030] FIG. 9 (A-L): mRNA marker analysis on chondrocytes in alginate cell culture 10 days post infection. The cells are infected with either Ad5/ALPL and Ad5/BMP2 overexpressing viruses, and with an Ad-siRNA targeting the indicated gene. The data are represented as relative mRNA levels to the ALPL control.

DETAILED DESCRIPTION

[0031] The following terms are used herein in accordance with the following definitions:

[0032] The term "agent" means any molecule, including polypeptides, polynucleotides and small molecules.

[0033] The term "anabolic stimulation of chondrocytes" should be understood as inducing chondrogenesis or as inducing or enhancing the anabolic activity of chondrocytes. Anabolic stimulation takes place for instance by stimulating the synthesis of cartilage components, or inducing synthesis of components that are required for cartilage synthesis. "Anabolic stimulation of chondrocytes" may also be understood as a process in which the expression of the matrix Gla protein (MGP) is induced. Anabolic stimulation of chondrocytes may furthermore be understood as inducing the expression of cartilage derived retinoic acid sensitive protein (CD-RAP), as inducing the expression of cartilage oligomeric matrix protein (COMP), as inducing the expression of aggrecan 1 (agc1, also termed chondroitin sulfate proteoglycan core protein 1, or CSPG1), or as inducing synthesis of collagen II, also known as collagen, type II, alpha-1 (col2 1), collagen of cartilage, chondrocalcin, and collagen, type xi, alpha-3 (col11 3).

[0034] The term `antisense nucleic acid` refers to an oligonucleotide that has a nucleotide sequence that interacts through base pairing with a specific complementary nucleic acid sequence involved in the expression of the target such that the expression of the gene is reduced. Preferably, the specific nucleic acid sequence involved in the expression of the gene is a genomic DNA molecule or mRNA molecule that encodes (a part of) the gene. This genomic DNA molecule can comprise regulatory regions of the gene, or the coding sequence for the mature gene.

[0035] The term "assay" means any process used to measure a specific property of a compound. A "screening assay" means a process used to characterize or select compounds based upon their activity from a collection of compounds.

[0036] The term "binding affinity" is a property that describes how strongly two or more compounds associate with each other in a non-covalent relationship. Binding affinities can be characterized qualitatively, (such as "strong", "weak", "high", or "low") or quantitatively (such as measuring the K.sub.D).

[0037] The term "carrier" means a non-toxic material used in the formulation of pharmaceutical compositions to provide a medium, bulk and/or useable form to a pharmaceutical composition. A carrier may comprise one or more of such materials such as an excipient, stabilizer, or an aqueous pH buffered solution. Examples of physiologically acceptable carriers include aqueous or solid buffer ingredients including phosphate, citrate, and other organic acids; antioxidants including ascorbic acid; low molecular weight (less than about 10 residues) polypeptide; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, arginine or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; salt-forming counterions such as sodium; and/or nonionic surfactants such as TWEEN.TM., polyethylene glycol (PEG), and PLURONICS.TM..

[0038] The term "complex" means the entity created when two or more compounds bind to each other.

[0039] The term "compound" is used herein in the context of a "test compound" or a "drug candidate compound" described in connection with the assays of the present invention. As such, these compounds comprise organic or inorganic compounds, derived synthetically or from natural sources. The compounds include inorganic or organic compounds such as polynucleotides, lipids or hormone analogs that are characterized by relatively low molecular weights. Other biopolymeric organic test compounds include peptides comprising from about 2 to about 40 amino acids and larger polypeptides comprising from about 40 to about 500 amino acids, such as antibodies or antibody conjugates.

[0040] The term `complementary to a nucleotide sequence` in the context of antisense oligonucleotides and methods should be understood as sufficiently complementary to such a sequence as to allow hybridization to that sequence in a cell, i.e., under physiological conditions.

[0041] The term "condition" or "disease" means the overt presentation of symptoms (i.e., illness) or the manifestation of abnormal clinical indicators (e.g., biochemical indicators). Alternatively, the term "disease" refers to a genetic or environmental risk of or propensity for developing such symptoms or abnormal clinical indicators.

[0042] The term "contact" or "contacting" means bringing at least two moieties together, whether in an in vitro system or an in vivo system.

[0043] The term "de-differentiation" refers to a general process wherein chondrocytes differentiate away from a cell phenotype that synthesizes cartilage components. Such components include, but are not limited to, collagen II, aggrecan 1, versican, link protein, perlecan, SZP/lubricin, biglycan (DS-PGI), decorin (DS-PGII), epiphycan (DS-PGIII), fibromodulin, lumican, CILP, C-type lectin, fibronectin, PRELP, COMP (thrombospondin-5), thrombospondin-1 and -3, CMP (matrilin-1), matrilin-3, C-type lectin, fibronectin, condroadherin, tenascin-C, fibrillin, elastin, gp-39/YKL-40, matrix Gla protein/MGP, pleiotrophin, chondromodulin-I/SCGP, chondromodulin-II, CD-RAP, chondrocalcin, PARP, lysozyme, and phospholipase A2.

[0044] The term "effective amount" or "therapeutically effective amount" means that amount of a compound or agent that will elicit the biological or medical response of a subject that is being sought by a medical doctor or other clinician. In particular, with regard to inducing anabolic stimulation of chondrocytes, the term "effective amount" is intended to mean an effective differentiation-promoting amount of an compound or agent that will bring about a biologically meaningful increase in the levels of chondrocyte markers, representative for the process of an increase in chondrocyte anabolism.

[0045] The term "expressible nucleic acid" means a nucleic acid coding for a proteinaceous molecule, an RNA molecule, or a DNA molecule.

[0046] The term "endogenous" shall mean a material that a mammal naturally produces. Endogenous in reference to the term "protease", "kinase", or G-Protein Coupled Receptor ("GPCR") shall mean that which is naturally produced by a mammal (for example, and not limitation, a human). In contrast, the term non-endogenous in this context shall mean that which is not naturally produced by a mammal (for example, and not limitation, a human). Both terms can be utilized to describe both "in vivo" and "in vitro" systems. For example, and not a limitation, in a screening approach, the endogenous or non-endogenous TARGET may be in reference to an in vitro screening system. As a further example and not limitation, where the genome of a mammal has been manipulated to include a non-endogenous TARGET, screening of a candidate compound by means of an in vivo system is viable.

[0047] The term "expression" comprises both endogenous expression and overexpression by transduction.

[0048] The term "expression inhibitory agent" means a polynucleotide designed to interfere selectively with the transcription, translation and/or expression of a specific polypeptide or protein normally expressed within a cell. More particularly, "expression inhibitory agent" comprises a DNA or RNA molecule that contains a nucleotide sequence identical to or complementary to at least about 17 sequential nucleotides within the polyribonucleotide sequence coding for a specific polypeptide or protein. Exemplary expression inhibitory molecules include ribozymes, double stranded siRNA molecules, self-complementary single-stranded siRNA molecules, genetic antisense constructs, and synthetic RNA antisense molecules with modified stabilized backbones.

[0049] The term "expressible nucleic acid" means a nucleic acid coding for a proteinaceous molecule, an RNA molecule, or a DNA molecule.

[0050] The term `genetic antisense` as used herein refers to the incorporation of antisense constructs complementary to sequences of genes into the genome of a cell. Such incorporation allows for the continued synthesis of the antisense molecule.

[0051] The term "hybridization" means any process by which a strand of nucleic acid binds with a complementary strand through base pairing. The term "hybridization complex" refers to a complex formed between two nucleic acid sequences by virtue of the formation of hydrogen bonds between complementary bases. A hybridization complex may be formed in solution (e.g., C.sub.0t or R.sub.0t analysis) or formed between one nucleic acid sequence present in solution and another nucleic acid sequence immobilized on a solid support (e.g., paper, membranes, filters, chips, pins or glass slides, or any other appropriate substrate to which cells or their nucleic acids have been fixed). The term "stringent conditions" refers to conditions that permit hybridization between polynucleotides and the claimed polynucleotides. Stringent conditions can be defined by salt concentration, the concentration of organic solvent, e.g., formamide, temperature, and other conditions well known in the art. In particular, reducing the concentration of salt, increasing the concentration of formamide, or raising the hybridization temperature can increase stringency.

[0052] The term "inhibit" or "inhibiting", in relationship to the term "response" means that a response is decreased or prevented in the presence of a compound as opposed to in the absence of the compound.

[0053] The term "inhibition" refers to the reduction, down regulation of a process or the elimination of a stimulus for a process that results in the absence or minimization of the expression of a protein or polypeptide.

[0054] The term "induction" refers to the inducing, up-regulation, or stimulation of a process that results in the expression of a protein or polypeptide, and that may also result in a phenotypical cellular change.

[0055] The term "ligand" means an endogenous, naturally occurring molecule specific for an endogenous, naturally occurring receptor.

[0056] The term "pharmaceutically acceptable salts" refers to the non-toxic, inorganic and organic acid addition salts, and base addition salts, of compounds of the present invention. These salts can be prepared in situ during the final isolation and purification of compounds useful in the present invention.

[0057] The term "polynucleotide" means a polynucleic acid, in single or double stranded form, and in the sense or antisense orientation, complementary polynucleic acids that hybridize to a particular polynucleic acid under stringent conditions, and polynucleotides that are homologous in at least about 60 percent of its base pairs, and more preferably 70 percent of its base pairs are in common, most preferably 90 percent, and in a special embodiment 100 percent of its base pairs. The polynucleotides include polyribonucleic acids, polydeoxyribonucleic acids, and synthetic analogues thereof. The polynucleotides are described by sequences that vary in length, that range from about 10 to about 5000 bases, preferably about 100 to about 4000 bases, more preferably about 250 to about 2500 bases. A preferred polynucleotide embodiment comprises from about 10 to about 30 bases in length. A special embodiment of polynucleotide is the polyribonucleotide of from about 10 to about 22 nucleotides, more commonly described as small interfering RNAs (siRNAs). Another special embodiment are nucleic acids with modified backcartilages such as peptide nucleic acid (PNA), polysiloxane, and 2'-O-(2-methoxy)ethylphosphorothioate, or including non-naturally occurring nucleic acid residues, or one or more nucleic acid substituents, such as methyl-, thio-, sulphate, benzoyl-, phenyl-, amino-, propyl-, chloro-, and methanocarbanucleosides, or a reporter molecule to facilitate its detection.

[0058] The term "polypeptide" relates to proteins (such as TARGETS), proteinaceous molecules, fractions of proteins peptides and oligopeptides.

[0059] The term `ribozymes` as used herein relates to catalytic RNA molecules capable of cleaving other RNA molecules at phosphodiester bonds in a manner specific to the sequence.

[0060] The term "solvate" means a physical association of a compound useful in this invention with one or more solvent molecules. This physical association includes hydrogen bonding. In certain instances the solvate will be capable of isolation, for example when one or more solvent molecules are incorporated in the crystal lattice of the crystalline solid. "Solvate" encompasses both solution-phase and isolable solvates. Representative solvates include hydrates, ethanolates and methanolates.

[0061] The term "subject" includes humans and other mammals.

[0062] The term "treating" means an intervention performed with the intention of preventing the development or altering the pathology of, and thereby alleviating a disorder, disease or condition, including one or more symptoms of such disorder or condition. Accordingly, "treating" refers to both therapeutic treatment and prophylactic or preventative measures. Those in need of treating include those already with the disorder as well as those in which the disorder is to be prevented. The related term "treatment," as used herein, refers to the act of treating a disorder, symptom, disease or condition, as the term "treating" is defined above.

[0063] The term `vectors` also relates to plasmids as well as to viral vectors, such as recombinant viruses, or the nucleic acid encoding the recombinant virus.

[0064] The term "vertebrate cells" means cells derived from animals having vertera structure, including fish, avian, reptilian, amphibian, marsupial, and mammalian species. Preferred cells are derived from mammalian species, and most preferred cells are human cells. Mammalian cells include feline, canine, bovine, equine, caprine, ovine, porcine murine, such as mice and rats, and rabbits.

Applicants' Invention Based on TARGET Relationship to Anabolic Stimulation of Chondrocytes

[0065] As noted above, the present invention is based on the present inventors' discovery that TARGETS are factors in the up-regulation and/or induction of anabolic processes of chondrocytes. The term "TARGET" or "TARGETS" means the proteins identified in accordance with the assay described below to be involved in the induction of the anabolic stimulation of chondrocytes. The present inventors have identified such TARGETS by screening recombinant adenoviruses mediating the expression of a library of shRNAs, referred to herein as "Ad-siRNAs." The collection used herein is further referred to as "adenoviral siRNA library" or SILENCESELECT.RTM. collection. These libraries contain recombinant adenoviruses, further referred to as knock-down (KD) viruses or Ad-siRNAs, that mediate the expression in cells of shRNAs which reduce the expression levels of targeted genes by a RNA interference (RNAi)-based mechanism (WO03/020931).

[0066] The preferred TARGETS are identified as SEQ ID NOS. 55-82, 198-391, and 480 in Table 1A. Table 1A lists the polypeptides, polynucleotides and knock-down target sequences of the present invention. Table 1B lists exemplary fragments of the TARGETS, SEQ ID NOS. 198-391. Table 1C lists exemplary KD target sequences useful in the practice of the present expression-inhibitory agent invention.

TABLE-US-00001 TABLE 1A KD Hit Gene GenBank DNA or SEQ ID KD Target Sequence Symbol Accession Name Class mRNA Protein NO. H33- CCTGAATGTGACTGTGGAC DGKB- NM_020238 diacylglycerol Kinase 1 55 84- 025 (SEQ ID NO: 91) INCENP NM_004080 kinase, beta 2 56 91 NM_145695 90 kDa/inner 3 57 centromere protein antigens 135/155 kDa H33- GACTGACTGGCCTGAAGGC ICK NM_016513 intestinal Kinase 4 58 92- 032 (SEQ ID NO: 92) NM_014920 cell (MAK- 5 59 99 like) kinase H33- GATCTACACCACCTTCATC GPR103 AF411117 G protein- GPCR 6 60 100- 034 (SEQ ID NO: 101) NM_198179 coupled 7 61 107 receptor 103 H33- GGTGTATGGGCTCATGTAC FZD1 NM_003505 frizzled GPCR 8 62 108- 041 (SEQ ID NO: 108) homolog 1 114 (Drosophila) H33- AGAACTGGGTGATGACAGC ELA1 NM_001971 elastase 1, Protease 9 63 115- 056 (SEQ ID NO: 116) pancreatic 122 H33- ATGAACTCTGTGATCCAGC USP9Y NM_004654 ubiquitin Protease 10 64 123- 061 (SEQ ID NO: 123) specific 130 protease 9, Y-linked (fat facets-like, Drosophila) H33- TTGGAATTCCAGTGTACCC DUSP11 NM_003584 dual specific- Phosphatase 11 65 131- 082 (SEQ ID NO: 132) ity phosphatase 138 11 (RNA/RNP complex 1- interacting) H33- GCTAGTTATCGCCTACCTC DUSP3 NM_004090 dual specific- Phosphatase 12 66 139- 083 (SEQ ID NO: 139) ity phosphatase 145 (vaccinia virus phosphatase VH1- related) H33- AGATTCCAGATGCAACCCC JAK1 SK185- Janus kinase 1 Kinase 13 67 146- 096 (SEQ ID NO: 148) NM_002227 (a protein 14 68 154 tyrosine kinase) H33- CTGAACTACTGGTACAGCC ABCG1 NM_016818 ATP-binding Transporter 15 69 155- 107 (SEQ ID NO: 157) NM_004915 cassette, sub- 16 70 162 NM_207174 family G 17 71 NM_207627 (WHITE), 18 72 NM_207628 member 1 19 73 NM_207629 20 74 NM_207630 21 75 H33- GCGAATTCCACCAGCATTC SLC26A8 NM_052961 solute carrier Transporter 22 76 163- 130 (SEQ ID NO: 165) family 26, 175 member 8 H33- ACATTGACCAGGAAGTGAC GGTLA4 NM_178312 gamma-glutamyl- Enzyme 23 77 176- 192 (SEQ ID NO: 178) NM_178311 transferase- 24 78 182 NM_080920 like activity 4 25 79 H33- GAAGCTGAATTAGGGCTTC PDE1A NM_005019 phosphodiesterase PDE 26 80 183- 217 (SEQ ID NO: 184) NM_00100-3683 1A, calmodulin- 27 81 190 dependent H33- GAAGCCATCTCCGACAATC SLC15A2 NM_021082 solute carrier Transporter 28 82 191- 279 (SEQ ID NO: 192) family 15 (H+/ 197 peptide trans- porter), member 2 H33- TTCACATCGCTGAGCACCC CPZ NM_003652 carboxypepti- Protease 479 480 410 059 (SEQ ID NO: 410) dase Z

TABLE-US-00002 TABLE 1B Seq ID Accession Name Protein Segment protein segment AF411117 GPR103 Extracellular domain 198 AF411117 GPR103 Transmembrane domain 199 AF411117 GPR103 Intracellular domain 200 AF411117 GPR103 Transmembrane domain 201 AF411117 GPR103 Extracellular domain 202 AF411117 GPR103 Transmembrane domain 203 AF411117 GPR103 Intracellular domain 204 AF411117 GPR103 Transmembrane domain 205 AF411117 GPR103 Extracellular domain 206 AF411117 GPR103 Transmembrane domain 207 AF411117 GPR103 Intracellular domain 208 AF411117 GPR103 Transmembrane domain 209 AF411117 GPR103 Extracellular domain 210 NM_198179 GPR103 Extracellular domain 211 NM_198179 GPR103 Transmembrane domain 212 NM_198179 GPR103 Intracellular domain 213 NM_198179 GPR103 Transmembrane domain 214 NM_198179 GPR103 Extracellular domain 215 NM_198179 GPR103 Transmembrane domain 216 NM_198179 GPR103 Intracellular domain 217 NM_198179 GPR103 Transmembrane domain 218 NM_198179 GPR103 Extracellular domain 219 NM_198179 GPR103 Transmembrane domain 220 NM_198179 GPR103 Intracellular domain 221 NM_198179 GPR103 Transmembrane domain 222 NM_198179 GPR103 Extracellular domain 223 NM_198179 GPR103 Transmembrane domain 224 NM_198179 GPR103 Intracellular domain 225 NM_003505 FZD1 Extracellular domain 226 NM_003505 FZD1 Transmembrane domain 227 NM_003505 FZD1 Intracellular domain 228 NM_003505 FZD1 Transmembrane domain 229 NM_003505 FZD1 Extracellular domain 230 NM_003505 FZD1 Transmembrane domain 231 NM_003505 FZD1 Intracellular domain 232 NM_003505 FZD1 Transmembrane domain 233 NM_003505 FZD1 Extracellular domain 234 NM_003505 FZD1 Transmembrane domain 235 NM_003505 FZD1 Intracellular domain 236 NM_003505 FZD1 Transmembrane domain 237 NM_003505 FZD1 Extracellular domain 238 NM_003505 FZD1 Transmembrane domain 239 NM_003505 FZD1 Intracellular domain 240 NM_016818 ABCG1 Extracellular domain 241 NM_016818 ABCG1 Transmembrane domain 242 NM_016818 ABCG1 Intracellular domain 243 NM_016818 ABCG1 Transmembrane domain 244 NM_016818 ABCG1 Extracellular domain 245 NM_016818 ABCG1 Transmembrane domain 246 NM_016818 ABCG1 Intracellular domain 247 NM_016818 ABCG1 Transmembrane domain 248 NM_016818 ABCG1 Extracellular domain 249 NM_016818 ABCG1 Transmembrane domain 250 NM_016818 ABCG1 Intracellular domain 251 NM_016818 ABCG1 Transmembrane domain 252 NM_016818 ABCG1 Extracellular domain 253 NM_016818 ABCG1 Transmembrane domain 254 NM_016818 ABCG1 Intracellular domain 255 NM_004915 ABCG1 Extracellular domain 256 NM_004915 ABCG1 Transmembrane domain 257 NM_004915 ABCG1 Intracellular domain 258 NM_004915 ABCG1 Transmembrane domain 259 NM_004915 ABCG1 Extracellular domain 260 NM_004915 ABCG1 Transmembrane domain 261 NM_004915 ABCG1 Intracellular domain 262 NM_004915 ABCG1 Transmembrane domain 263 NM_004915 ABCG1 Extracellular domain 264 NM_004915 ABCG1 Transmembrane domain 265 NM_004915 ABCG1 Intracellular domain 266 NM_004915 ABCG1 Transmembrane domain 267 NM_004915 ABCG1 Extracellular domain 268 NM_004915 ABCG1 Transmembrane domain 269 NM_004915 ABCG1 Intracellular domain 270 NM_207174 ABCG1 Extracellular domain 271 NM_207174 ABCG1 Transmembrane domain 272 NM_207174 ABCG1 Intracellular domain 273 NM_207174 ABCG1 Transmembrane domain 274 NM_207174 ABCG1 Extracellular domain 275 NM_207174 ABCG1 Transmembrane domain 276 NM_207174 ABCG1 Intracellular domain 277 NM_207174 ABCG1 Transmembrane domain 278 NM_207174 ABCG1 Extracellular domain 279 NM_207174 ABCG1 Transmembrane domain 280 NM_207174 ABCG1 Intracellular domain 281 NM_207174 ABCG1 Transmembrane domain 282 NM_207174 ABCG1 Extracellular domain 283 NM_207174 ABCG1 Transmembrane domain 284 NM_207174 ABCG1 Intracellular domain 285 NM_207627 ABCG1 Extracellular domain 286 NM_207627 ABCG1 Transmembrane domain 287 NM_207627 ABCG1 Intracellular domain 288 NM_207627 ABCG1 Transmembrane domain 289 NM_207627 ABCG1 Extracellular domain 290 NM_207627 ABCG1 Transmembrane domain 291 NM_207627 ABCG1 Intracellular domain 292 NM_207627 ABCG1 Transmembrane domain 293 NM_207627 ABCG1 Extracellular domain 294 NM_207627 ABCG1 Transmembrane domain 295 NM_207627 ABCG1 Intracellular domain 296 NM_207627 ABCG1 Transmembrane domain 297 NM_207627 ABCG1 Extracellular domain 298 NM_207627 ABCG1 Transmembrane domain 299 NM_207627 ABCG1 Intracellular domain 300 NM_207628 ABCG1 Extracellular domain 301 NM_207628 ABCG1 Transmembrane domain 302 NM_207628 ABCG1 Intracellular domain 303 NM_207628 ABCG1 Transmembrane domain 304 NM_207628 ABCG1 Extracellular domain 305 NM_207628 ABCG1 Transmembrane domain 306 NM_207628 ABCG1 Intracellular domain 307 NM_207628 ABCG1 Transmembrane domain 308 NM_207628 ABCG1 Extracellular domain 309 NM_207628 ABCG1 Transmembrane domain 310 NM_207628 ABCG1 Intracellular domain 311 NM_207628 ABCG1 Transmembrane domain 312 NM_207628 ABCG1 Extracellular domain 313 NM_207628 ABCG1 Transmembrane domain 314 NM_207628 ABCG1 Intracellular domain 315 NM_207629 ABCG1 Extracellular domain 316 NM_207629 ABCG1 Transmembrane domain 317 NM_207629 ABCG1 Intracellular domain 318 NM_207629 ABCG1 Transmembrane domain 319 NM_207629 ABCG1 Extracellular domain 320 NM_207629 ABCG1 Transmembrane domain 321 NM_207629 ABCG1 Intracellular domain 322 NM_207629 ABCG1 Transmembrane domain 323 NM_207629 ABCG1 Extracellular domain 324 NM_207629 ABCG1 Transmembrane domain 325 NM_207629 ABCG1 Intracellular domain 326 NM_207629 ABCG1 Transmembrane domain 327 NM_207629 ABCG1 Extracellular domain 328 NM_207629 ABCG1 Transmembrane domain 329 NM_207629 ABCG1 Intracellular domain 330 NM_207630 ABCG1 Extracellular domain 331 NM_207630 ABCG1 Transmembrane domain 332 NM_207630 ABCG1 Intracellular domain 333 NM_207630 ABCG1 Transmembrane domain 334 NM_207630 ABCG1 Extracellular domain 335 NM_207630 ABCG1 Transmembrane domain 336 NM_207630 ABCG1 Intracellular domain 337 NM_207630 ABCG1 Transmembrane domain 338 NM_207630 ABCG1 Extracellular domain 339 NM_207630 ABCG1 Transmembrane domain 340 NM_207630 ABCG1 Intracellular domain 341 NM_207630 ABCG1 Transmembrane domain 342 NM_207630 ABCG1 Extracellular domain 343 NM_207630 ABCG1 Transmembrane domain 344 NM_207630 ABCG1 Intracellular domain 345 NM_052961 SLC26A8 Intracellular domain 346 NM_052961 SLC26A8 Transmembrane domain 347 NM_052961 SLC26A8 Extracellular domain 348 NM_052961 SLC26A8 Transmembrane domain 349 NM_052961 SLC26A8 Intracellular domain 350 NM_052961 SLC26A8 Transmembrane domain 351 NM_052961 SLC26A8 Extracellular domain 352 NM_052961 SLC26A8 Transmembrane domain 353 NM_052961 SLC26A8 Intracellular domain 354 NM_052961 SLC26A8 Transmembrane domain 355 NM_052961 SLC26A8 Extracellular domain 356 NM_052961 SLC26A8 Transmembrane domain 357 NM_052961 SLC26A8 Intracellular domain 358 NM_052961 SLC26A8 Transmembrane domain 359 NM_052961 SLC26A8 Extracellular domain 360 NM_052961 SLC26A8 Transmembrane domain 361 NM_052961 SLC26A8 Intracellular domain 362 NM_052961 SLC26A8 Transmembrane domain 363 NM_052961 SLC26A8 Extracellular domain 364 NM_052961 SLC26A8 Transmembrane domain 365 NM_052961 SLC26A8 Intracellular domain 366 NM_052961 SLC26A8 Transmembrane domain 367 NM_052961 SLC26A8 Extracellular domain 368 NM_021082 SLC15A2 Intracellular domain 369 NM_021082 SLC15A2 Transmembrane domain 370 NM_021082 SLC15A2 Extracellular domain 371 NM_021082 SLC15A2 Transmembrane domain 372 NM_021082 SLC15A2 Intracellular domain 373 NM_021082 SLC15A2 Transmembrane domain 374 NM_021082 SLC15A2 Extracellular domain 375 NM_021082 SLC15A2 Transmembrane domain 376 NM_021082 SLC15A2 Intracellular domain 377 NM_021082 SLC15A2 Transmembrane domain 378 NM_021082 SLC15A2 Extracellular domain 379 NM_021082 SLC15A2 Transmembrane domain 380 NM_021082 SLC15A2 Intracellular domain 381 NM_021082 SLC15A2 Transmembrane domain 382 NM_021082 SLC15A2 Extracellular domain 383 NM_021082 SLC15A2 Transmembrane domain 384 7 NM_021082 SLC15A2 Intracellular domain 385 NM_021082 SLC15A2 Transmembrane domain 386 NM_021082 SLC15A2 Extracellular domain 387 NM_021082 SLC15A2 Transmembrane domain 388 NM_021082 SLC15A2 Intracellular domain 389 NM_021082 SLC15A2 Transmembrane domain 390 NM_021082 SLC15A2 Extracellular domain 391

TABLE-US-00003 TABLE 1C SEQ ID TARGET Name siRNA_Name KD Target Sequence NO. ABCG1 A150100-ABCG1_v5 NM_004915_idx1797 AGTGGATGTCCTACATCTC 155 A150100-ABCG1_v6 NM_004915_idx500 ATCATGCAGGATGACATGC 156 A150100-ABCG1_v7 NM_004915_idx1481 CTGAACTACTGGTACAGCC 157 A150100-ABCG1_v10 NM_004915_idx872 CAGCTTTACGTCCTGAGTC 158 A150100-ABCG1_v11 NM_004915_idx1067 TCAGACCACAAGAGAGACC 159 A150100-ABCG1_v12 NM_004915_idx1789 GTACCTACAGTGGATGTCC 160 A150100-ABCG1_v8 NM_016818_idx603 TGGTCAAGGAGATACTGAC 161 A150100-ABCG1_v9 NM_016818_idx718 CCCTCCAGTCATGTTCTTC 162 DGKB A150100-DGKB_v1 NM_004080_idx104 TTCCATGGTAATGGTGTGC 84 A150100-DGKB_v2 NM_004080_idx1064 CCTGAATGTGACTGTGGAC 91 A150100-DGKB_v3 NM_004080_idx2398 CCGAAGCAAGGAATAATCC 85 A150100-DGKB_v10 NM_145695_idx466 TATGTTTCGCCTTTATGAC 86 A150100-DGKB_v11 NM_145695_idx654 GGATTCAAGGAGGAATGAC 87 A150100-DGKB_v12 NM_145695_idx870 CTCCCTCTTGCATCAAGAC 88 A150100-DGKB_v13 NM_145695_idx1387 AAATCCTCGTCAGGTTTAC 89 A150100-DGKB_v14 NM_14S695_idx1729 AGTGCCTTACAGTATCATC 90 DUSP11 A150100-DUSP11_v1 NM_003584_idx427 CAGAGGATTTGCCAGAAAC 131 A150100-DUSP11_v2 NM_003584_idx743 TTGGAATTCCAGTGTACCC 132 A150100-DUSP11_v3 NM_003584_idx945 CAGAGACACCATCTCCCTC 133 A150100-DUSP11_v4 NM_003584_idx885 ACCCAGACCCAAAGTTTGC 134 A150100-DUSP11_v5 NM_003584_idx221 AAGGTGGAAAGACTATCTC 135 A150100-DUSP11_v6 NM_003584_idx420 TATAAACCAGAGGATTTGC 136 A150100-DUSP11_v7 NM_003584_idx836 GTATAATCTACATCAGATC 137 A150100-DUSP11_v8 NM_003584_idx933 CCACATGTTTACCAGAGAC 138 DUSP3 A150100-DUSP3_v1 NM_004090_idx425 GCTAGTTATCGCCTACCTC 139 A150100-DUSP3_v2 NM_004090_idx300 GACACACAGGAGTTCAACC 140 A150100-DUSP3_v3 NM_004090_idx176 GCTGCAGAAACTAGGCATC 141 A150100-DUSP3_v4 NM_004090_idx248 TGCCAACTTCTACAAGGAC 142 A150100-DUSP3_v5 NM_004090_idx299 CGACACACAGGAGTTCAAC 143 A150100-DUSP3_v6 NM_004090_idx458 GATGGACGTCAAGTCTGCC 144 A150100-DUSP3_v7 NM_004090_idx4305 ACAGGAGTTCAACCTCAGC 145 FLA1 A150100-FLA1_v1 NM_001971_idx754 TAATGTCATCGCCTCCAAC 115 A150100-FLA1_v2 NM_001971_idx162 AGAACTGGGTGATGACAGC 116 A150100-FLA1_v3 NM_001971_idx421 CAACAGTCCCTGCTACATC 117 A150100-FLA1_v4 NM_001971_idx280 GATCGTGGTGCATCCATAC 118 A150100-FLA1_v5 NM_001971_idx230 GCGTGGATTACCAGAAGAC 119 A150100-FLA1_v6 NM_001971_idx459 TAACAACAGTCCCTGCTAC 120 A150100-FLA1_v7 NM_001971_idx669 CCATTGCTTGGTGAATGGC 121 A150100-FLA1_v8 NM_001971_idx692 ATTCTCTCCATGGAGTGAC 122 FZD1 A150100-FZD1_v10 NM_003505_idx1323 GGTGTATGGGCTCATGTAC 108 A150100-FZD1_v11 NM_003505_idx2058 CATCGTCATCGCCTGCTAC 109 A150100-FZD1_v9 NM_003505_idx2007 GCTCATGGTGCGCATTGGC 110 A150100-FZD1_v12 NM_003505_idx2229 GTACCTTATGACGCTGATC 111 A150100-FZD1_v13 NM_003505_idx3317 ACCTGGTATGGGTTTGGCC 112 A150100-FZD1_v14 NM_003505_idx3883 ATGTGTGCAGGTCTACTGC 113 A150100-FZD1_v15 NM_003505_idx2704 TTATTTAGGGCGGTTTAAC 114 GGTLA4 A150100-GGT1_v8 NM_080839_idx451 ACTGGCCATCATCTACAAC 176 A150100-GGTLA4_v5 NM_080920_idx292 TGCTCACCTGTCTGTGGTC 177 A150100-GGTLA4_v6 NM_080920_idx702 ACATTGACCAGGAAGTGAC 178 A150100-GGTLA4_v7 NM_080920_idx411 TGGATGACTTCAGCTCTAC 179 A150100-GGT1_v10 NM_178311_idx629 CTACAACCTCTGGTTCGGC 180 A150100-GGT1_v11 NM_178311_idx707 CACGACAGTGGAGAGAAAC 181 A150100-GGTLA4_v8 NM_178311_idx287 GTTCTACATGCCGGATGAC 182 GPR103 A150100-GPR103_v5 AF411117_idx611 AGGCACCAGGGACTTGTGC 100 A150100-GPR103_v6 AF411117_idx820 GATCTACACCACCTTCATC 101 A150100-GPR103_v7 XM_172359_idx288 TGGTGTTCTACGTGGTGAC 102 A150100-GPR103_v8 AF411117_idx136 TGTTAGGCGCCTGCATTGC 103 A150100-GPR103_v10 AF411117_idx424 CAACATCTTTATCTGCTCC 104 A150100-GPR103_v11 AF411117_idx662 CGAAGGGCTTTCACAATGC 105 A150100-GPR103_v12 AF411117_idx106 GTACTACGTTGTAGCCCAC 106 A150100-GPR103_v9 AF411117_idx186 TGCAGGCGCTTAACATTAC 107 ICK A150100-ICK_v1 NM_016513_idx870 GACTGACTGGCCTGAAGGC 92 A150100-ICK_v2 NM_016513_idx1665 GCAGCACTATTTGAAGCAC 93 A150100-ICK_v3 NM_016513_idx588 GCCTGAGAACCTCCTCTGC 94 A150100-ICK_v10 NM_016513_idx1027 ACAGCTAGTCAGGCACTTC 95 A150100-ICK_v11 NM_016513_idx1707 TATAAGAAATGGCATACTC 96 A150100-ICK_v12 NM_016513_idx1754 CTAATCCATGGTCTAGTTC 97 A150100-ICK_v8 NM_016513_idx504 GTCTGCTATAAGGAATATC 98 A150100-ICK_v9 NM_016513_idx713 AAGTACTCCTGAGGTCTAC 99 JAK1 A150100-JAK1_v1 oKD271 TTGGCATGGAACCAACGAC 146 A150100-JAK1_v2 oKD270 CCTCTTTGCCCTGTATGAC 147 A150100-JAK1_v7 oKD272 AGATTCCAGATGCAACCCC 148 A150100-JAK1_v8 SK185_idx1743 CATGAGCCAGCTGAGTTTC 149 A150100-JAK1_v9 SK185_idx142 GTGGAAGTGATCTTCTATC 150 A150100-JAK1_v12 NM_002227_idx1351 TGGCTGTCATGGTCCAATC 151 A150100-JAK1_v13 NM_002227_idx2512 CCGCTGCATGAACTATGAC 152 A150100-JAK1_v14 NM_002227_idx3093 TTGGAGACTTCGGTTTAAC 153 A150100-JAK1_v15 NM_002227_idx3269 TGTGATTCAGATTCTAGTC 154 PDE1A A150100-PDE1A_v5 NM_005019_idx913 AGGTATCATGCACTGGCTC 183 A150100-PDE1A_v6 NM_005019_idx1382 GAAGCTGAATTAGGGCTTC 184 A150100-PDE1A_v7 NM_005019_idx1709 CTGGTGGACATCATTCAGC 185 A150100-PDE1A_v10 NM_005019_idx1413 TTTGTGATCGGAAGTCAAC 186 A150100-PDE1A_v11 NM_005019_idx1601 ATTGCTGATGCACTAAGAC 187 A150100-PDE1A_v12 NM_005019_idx754 CAGATATGATCTTATCAAC 188 A150100-PDE1A_v13 NM_005019_idx887 ACTGTGCATTACATAATGC 189 A150100-PDE1A_v9 NM_005019_idx1073 CACGTGAGTGCAGCTTATC 190 SLC15A2 A150100-SLC15A2_v1 NM_021082_idx457 AGTCCTATCATTGATCGGC 191 A150100-SLC15A2_v2 NM_021082_idx121 GAAGCCATCTCCGACAATC 192 A150100-SLC15A2_v3 NM_021082_idx1166 ATGGCTGTTGGTATGATCC 193 A150100-SLC15A2_v4 NM_021082_idx1575 CCGTGAGGTTTGTTAACAC 194 A150100-SLC15A2_v5 NM_021082_idx423 TTGGGTGCCTTACCAATAC 195 A150100-SLC15A2_v6 NM_021082_idx1136 CTCCAAGTGTGGAATTAAC 196 A150100-SLC15A2_v7 NM_021082_idx1534 GCATGATGGTAAAGGATAC 197 SLC26A8 A150100-SLC26A8_v10 NM_052961_idx1925 TTCTGCAACTGTGATGATC 163 A150100-SLC26A8_v11 NM_052961_idx2288 GTACACTACGTGGATTCAC 164 A150100-SLC26A8_v2 NM_052961_idx923 GCGAATTCCACCAGCATTC 165 A150100-SLC26A8_v3 NM_052961_idx1761 TCTTCCAGTGCTGCAGCTC 166 A150100-SLC26A8_v4 NM_052961_idx2693 TCAGAACAAGAGGCTGGGC 167 A150100-SLC26A8_v5 NM_052961_idx1228 GAAGATTGCCAGTCTTCAC 168 A150100-SLC26A8_v6 NM_052961_idx457 GATTCCTCCTCTCAACATC 169 A150100-SLC26A8_v7 NM_052961_idx936 GCATTCTAGTATTTCTAAC 170 A150100-SLC26A8_v8 NM_052961_idx1249 TTACAGTGTCAATTCCAAC 171 A150100-SLC26A8_v9 NM_052961_idx1723 TGATTATCGGGAGATCATC 172 A150100-SLC26A8_v12 NM_052961_idx338 GAATGGATGTGTATGTATC 173 A150100-SLC26A8_v13 NM_052961_idx1105 TGACATGATTCCTTATAGC 174 A150100-SLC26A8_v14 NM_052961_idx1446 TCTACACACTGCCAAATGC 175 USP9Y A150100-USP9Y_v1 NM_004654_idx5651 ATGAACTCTGTGATCCAGC 123 A150100-USP9Y_v2 NM_004654_idx1600 AGGTTGGCTAGTGGATCTC 124 A150100-USP9Y_v3 NM_004654_idx2636 AAGTGGGTAATTCCTGCTC 125 A150100-USP9X_v4 NM_021906_idx1189 CGAATGGCAGAATGGATAC 126 A150100-USP9X_vS NM_004654_idx7911 TCTGGCAGGTTGCATATTC 127 A150100-USP9Y_v4 NM_004654_idx1489 CTGCAAGTTTCATATCTAC 128 A150100-USP9Y_v5 NM_004654_idx2820 ATAGCATCAGATTGTATGC 129 A150100-USP9Y_v6 NM_004654_idx5731 TTTACACGATGATATGTTC 130

[0067] The present invention relates to a method for assaying for compounds that induce anabolic stimulation of chondrocytes, comprising contacting the compound with a polypeptide comprising an amino acid sequence of the polypeptides of SEQ ID NO: 55-82 and 480 ("TARGETS") or a functional fragment thereof under conditions that allow said polypeptide to bind to the compound, and detecting the formation of a complex between the polypeptide and the compound. One preferred means of measuring the complex formation is to determine the binding affinity of said compound to said polypeptide.

[0068] More particularly, the invention relates to a method for identifying an agent that induces anabolic stimulation of chondrocytes, the method comprising further: [0069] (a) contacting a population of chondrocyte cells with one or more of said compound that exhibits binding affinity for said TARGETS, and [0070] (b) measuring a compound-polypeptide property related to the anabolic stimulation of chondrocytes.

[0071] The compound-polypeptide property referred to above is related to the anabolic stimulation of chondrocytes, and is a measurable phenomenon chosen by the person of ordinary skill in the art. The measurable property may e.g. be the binding affinity for a peptide domain of the polypeptide TARGET or the level of any one of a number of biochemical marker levels of increased chondrocyte anabolism. Anabolic stimulation of chondrocytes can e.g. be measured by measuring the level of proteins and other molecules that are induced during the differentiation process, such as key components of normal cartilage. In particular, the induction of the major protein component of cartilage, collagen II, is measured.

[0072] In addition, compound-polypeptide properties related to the anabolic stimulation of chondrocytes are measured in C20/A4; T/C-28a2; T/C-28a4; C-28/12; Ch-4,8,N; Ch-8-OA; TC6; MCT; MC615; IRC; RCS2; Hig82; and D1 ORL UVA (D1) cells. However, such porterties are also measured in non-chondrocyte cell systems. For example, in situ binding assays that determine the affinity of compounds to bind to polypeptides of the invention are performed using any cell type that expresses the polypeptide. Expression of the polypeptide is exogenous or endogenous. Furthermore, when the compound-polypeptide property is activation of a biological pathway, any cell that contains the pathway cellular components is used to measure the compound-polypeptide property. For example, induction of col2 1 or aggrecan in chondrocytes is indicative of anabolic stimulation of chondrocytes. Specifically, non-chondrocyte cells can be engineered to contain a reporter molecule activated by the col2 1 or aggrecan promoters. In this way a non-chondrocyte can be used to measure a property indicative of anabolic stimulation of chondrocytes.

[0073] The invention relates to a method for identifying a compound that induces and/or increases anabolic stimulation of chondrocytes, said method comprising the steps of: culturing a population of cells expressing a polypeptide of any one of those listed in Table 1A, or a functional fragment or derivative thereof; determining a first level of chondrogenic differentiation in said population of cells; exposing said population of cells to a compound, or a mixture of compounds; determining the level of chondrogenic differentiation in said population of cells during or after exposure of said population of cells to the compound, or the mixture of compounds; and identifying the compound that induces and/or increases chondrogenic differentiation.

[0074] The invention also relates to a method for identifying a compound that decreases the expression and/or activity of any one of the polypeptides listed in Table 1A, said method comprising the steps of: culturing a population of cells expressing said polypeptide, or a fragment, or a derivative thereof; determining a first level of expression and/or activity of said polypeptide; exposing said population of cells to a compound, or a mixture of compounds; determining the level of expression and/or activity of said polypeptide during or after exposure of said population of cells to the compound, or the mixture of compounds; and identifying the compound that decreases the expression and/or activity of said polypeptide. If the polypeptide activity is not readily measurable, the identification of the compound may benefit from an extra step comprising exposing said population of cells to an agonist of said polypeptide. Furthermore, the methods of the present invention may comprise the step of introducing a gene encoding any one of the polypeptides listed in Table 1A, in said population of cells. For high-throughput purposes it may be beneficial to have the gene stably integrated in the genome of said cells.

[0075] In a preferred embodiment, the level of chondrocyte (re-)differentiation is determined by measuring the expression level of a marker gene, wherein a preferred marker gene encodes collagen type II, alpha-1 (col2.alpha.1) or aggrecan. For proper anabolic stimulation it is preferred that the expression and/or activity of col2.alpha.1 or aggrecan is increased.

[0076] The present invention provides in one particular embodiment methods for identifying novel compounds, wherein the polypeptide is a GPCR. If so, the expression and/or activity of said GPCR is preferably determined by measuring the level of a second messenger. Preferred second messengers are cyclic AMP, Ca.sup.2+ or both. Typically, the level of the second messenger is determined with a reporter gene under the control of a promoter that is responsive to the second messenger, wherein it is preferred that the promoter is a cyclic AMP-responsive promoter, an NF-KB responsive promoter, or a NF-AT responsive promoter, and wherein the reporter gene is selected from the group consisting of: alkaline phosphatase, GFP, eGFP, dGFP, luciferase and -galactosidase.

[0077] In another particular embodiment, the invention provides methods for identifying novel compounds, wherein the polypeptide is a kinase or a phosphatase. Preferably, the activity of said kinase or phosphatase is determined by measuring the level of phosphorylation of a substrate of said kinase or phosphatase.

[0078] In yet another particular embodiment, the invention provides methods for identifying novel compounds, wherein the polypeptide is a protease. Preferably, the activity of said protease is measured by determining the level of cleavage of a substrate of said protease.

[0079] Methods for determining second messenger levels, use of the reporter genes and second-messenger responsive promoters as well as phosphatase assays and protease assays are well known in the art and not further elaborated upon herein.

[0080] In a preferred embodiment, the compound that inhibits the polypeptide exhibits a binding affinity to the polypeptide of at most 10 micromolar.

[0081] In a preferred embodiment of the invention, the polypeptide TARGET comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 55-82, 198-391, and 480 (Tables 1A and 1B). In an especially preferred embodiment of the invention, the polypeptide TARGET comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 55-82 and 480 (Table 1A).

[0082] Depending on the choice of the skilled artisan, the present assay method may be designed to function as a series of measurements, each of which is designed to determine whether the drug candidate compound is indeed acting on the polypeptide to thereby induce the anabolic stimulation of chondrocytes. For example, an assay designed to determine the binding affinity of a compound to the polypeptide, or fragment thereof, may be necessary, but not sufficient, to ascertain whether the test compound would be useful for increasing mean cartilage thickness when administered to a subject. Nonetheless, such binding information would be useful in identifying a set of test compounds for use in an assay that would measure a different property, further up the biochemical pathway, such as cartilage component synthesis, assayed by measuring the amount of collagen II. Such second assay may be designed to confirm that the test compound, having binding affinity for the polypeptide, actually induces the anabolic stimulation of chondrocytes. Suitable controls should always be in place to insure against false positive readings.

[0083] The order of taking these measurements is not believed to be critical to the practice of the present invention, which may be practiced in any order. For example, one may first perform a screening assay of a set of compounds for which no information is known respecting the compounds' binding affinity for the polypeptide. Alternatively, one may screen a set of compounds identified as having binding affinity for a polypeptide domain, or a class of compounds identified as being an inhibitor of the polypeptide. However, for the present assay to be meaningful to the ultimate use of the drug candidate compounds, a measurement of collagen II levels or aggrecan is necessary. Validation studies including controls, and measurements of binding affinity to the polypeptides of the invention are nonetheless useful in identifying a compound useful in any therapeutic or diagnostic application.

[0084] The binding affinity of the compound with the polypeptide TARGET can be measured by methods known in the art, such as using surface plasmon resonance biosensors (Biacore), by saturation binding analysis with a labeled compound (e.g. Scatchard and Lindmo analysis), by differential UV spectrophotometer, fluorescence polarization assay, Fluorometric Imaging Plate Reader (FLIPR.RTM.) system, Fluorescence resonance energy transfer, and Bioluminescence resonance energy transfer. The binding affinity of compounds can also be expressed in dissociation constant (Kd) or as IC50 or EC50. The IC50 represents the concentration of a compound that is required for 50% inhibition of binding of another ligand to the polypeptide. The EC50 represents the concentration required for obtaining 50% of the maximum effect in any assay that measures TARGET function. The dissociation constant, Kd, is a measure of how well a ligand binds to the polypeptide, it is equivalent to the ligand concentration required to saturate exactly half of the binding-sites on the polypeptide. Compounds with a high affinity binding have low Kd, IC50 and EC50 values, i.e. in the range of 100 nM to 1 pM; a moderate to low affinity binding relates to a high Kd, IC50 and EC50 values, i.e. in the micromolar range.

[0085] The present assay method may also be practiced in a cellular assay, A host cell expressing TARGET can be a cell with endogenous expression or a cell over-expressing the TARGET e.g. by transduction. When the endogenous expression of the polypeptide is not sufficient to determine a baseline that can easily be measured, one may use using host cells that over-express TARGET. Over-expression has the advantage that the level of the TARGET substrate end products is higher than the activity level by endogenous expression. Accordingly, measuring such levels using presently available techniques is easier. In such cellular assay, the biological activity of TARGET may be measured by following the production of cartilage component synthesis.

[0086] The present invention further relates to a method for identifying a compound that induces anabolic stimulation of chondrocytes, comprising: [0087] (a) contacting a compound with a polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 55-82, 198-391 and 480; [0088] (b) determining the binding affinity of the compound to the polypeptide; [0089] (c) contacting a population of mammalian cells expressing said polypeptide with the compound that exhibits a binding affinity of at least 10 micromolar; and [0090] (d) identifying the compound that induces the synthesis of proteins that are a constituent of normal cartilage and/or that are required for the formation of cartilage.

[0091] For high-throughput purposes, libraries of compounds may be used such as antibody fragment libraries, peptide phage display libraries, peptide libraries (e.g. LOPAP.TM., Sigma Aldrich), lipid libraries (BioMol), synthetic compound libraries (e.g. LOPAC.TM., Sigma Aldrich) or natural compound libraries (Specs, TimTec).

[0092] Preferred drug candidate compounds are low molecular weight compounds. Low molecular weight compounds, i.e. with a molecular weight of 500 Dalton or less, are likely to have good absorption and permeation in biological systems and are consequently more likely to be successful drug candidates than compounds with a molecular weight above 500 Dalton (Lipinski et al. (1997)). Peptides comprise another preferred class of drug candidate compounds. Peptides may be excellent drug candidates and there are multiple examples of commercially valuable peptides such as fertility hormones and platelet aggregation inhibitors. Natural compounds are another preferred class of drug candidate compound. Such compounds are found in and extracted from natural sources, and which may thereafter be synthesized. The lipids are another preferred class of drug candidate compound.

[0093] Another preferred class of drug candidate compounds is an antibody. The present invention also provides antibodies directed against a TARGET. These antibodies may be endogenously produced to bind to the TARGET within the cell, or added to the tissue to bind to TARGET polypeptide present outside the cell. These antibodies may be monoclonal antibodies or polyclonal antibodies. The present invention includes chimeric, single chain, and humanized antibodies, as well as FAb fragments and the products of a FAb expression library, and Fv fragments and the products of an Fv expression library.

[0094] In certain embodiments, polyclonal antibodies may be used in the practice of the invention. The skilled artisan knows methods of preparing polyclonal antibodies. Polyclonal antibodies can be raised in a mammal, for example, by one or more injections of an immunizing agent and, if desired, an adjuvant. Typically, the immunizing agent and/or adjuvant will be injected in the mammal by multiple subcutaneous or intraperitoneal injections. Antibodies may also be generated against the intact TARGET protein or polypeptide, or against a fragment, derivatives including conjugates, or other epitope of the TARGET protein or polypeptide, such as the TARGET embedded in a cellular membrane, or a library of antibody variable regions, such as a phage display library.

[0095] It may be useful to conjugate the immunizing agent to a protein known to be immunogenic in the mammal being immunized. Examples of such immunogenic proteins include but are not limited to keyhole limpet hemocyanin, serum albumin, bovine thyroglobulin, and soybean trypsin inhibitor. Examples of adjuvants that may be employed include Freund's complete adjuvant and MPL-TDM adjuvant (monophosphoryl Lipid A, synthetic trehalose dicorynomycolate). One skilled in the art without undue experimentation may select the immunization protocol.

[0096] In some embodiments, the antibodies may be monoclonal antibodies. Monoclonal antibodies may be prepared using methods known in the art. The monoclonal antibodies of the present invention may be "humanized" to prevent the host from mounting an immune response to the antibodies. A "humanized antibody" is one in which the complementarity determining regions (CDRs) and/or other portions of the light and/or heavy variable domain framework are derived from a non-human immunoglobulin, but the remaining portions of the molecule are derived from one or more human immunoglobulins. Humanized antibodies also include antibodies characterized by a humanized heavy chain associated with a donor or acceptor unmodified light chain or a chimeric light chain, or vice versa. The humanization of antibodies may be accomplished by methods known in the art (see, e.g. Mark and Padlan, (1994) "Chapter 4. Humanization of Monoclonal Antibodies", The Handbook of Experimental Pharmacology Vol. 113, Springer-Verlag, New York). Transgenic animals may be used to express humanized antibodies.

[0097] Human antibodies can also be produced using various techniques known in the art, including phage display libraries (Hoogenboom and Winter, (1991) J. Mol. Biol. 227:381-8; Marks et al. (1991). J. Mol. Biol. 222:581-97). The techniques of Cole, et al. and Boerner, et al. are also available for the preparation of human monoclonal antibodies (Cole, et al. (1985) Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, p. 77; Boerner, et al (1991). J. Immunol., 147(1):86-95).

[0098] Techniques known in the art for the production of single chain antibodies can be adapted to produce single chain antibodies to the TARGET polypeptides and proteins of the present invention. The antibodies may be monovalent antibodies. Methods for preparing monovalent antibodies are well known in the art. For example, one method involves recombinant expression of immunoglobulin light chain and modified heavy chain. The heavy chain is truncated generally at any point in the Fc region so as to prevent heavy chain cross-linking. Alternatively; the relevant cysteine residues are substituted with another amino acid residue or are deleted so as to prevent cross-linking.

[0099] Bispecific antibodies are monoclonal, preferably human or humanized, antibodies that have binding specificities for at least two different antigens and preferably for a cell-surface protein or receptor or receptor subunit. In the present case, one of the binding specificities is for one domain of the TARGET; the other one is for another domain of the same or different TARGET.

[0100] Methods for making bispecific antibodies are known in the art. Traditionally, the recombinant production of bispecific antibodies is based on the co-expression of two immunoglobulin heavy-chain/light-chain pairs, where the two heavy chains have different specificities (Milstein and Cuello, (1983) Nature 305:537-9). Because of the random assortment of immunoglobulin heavy and light chains, these hybridomas (quadromas) produce a potential mixture of ten different antibody molecules, of which only one has the correct bispecific structure. Affinity chromatography steps usually accomplish the purification of the correct molecule. Similar procedures are disclosed in Trauneeker, et al. (1991) EMBO J. 10:3655-9.

[0101] According to another preferred embodiment, the assay method uses a drug candidate compound identified as having a binding affinity for a TARGET, and/or has already been identified as having down-regulating activity such as antagonist activity vis-a-vis one or more TARGET.

[0102] The present invention further relates to a method for inducing anabolic stimulation of chondrocytes comprising contacting said cells with an expression inhibitory agent comprising a polynucleotide sequence that complements at least about 17 nucleotides of the polyribonucleotide comprising a nucleotide sequence selected from the group consisting of SEQ ID NO: 1-28 and 479. In a preferred embodiment the expression-inhibitory agent comprises a polynucleotide sequence that complements a nucleotide sequence selected from the group consisting of SEQ ID NO: 84-197 and 410.

[0103] Another aspect of the present invention relates to a method for inducing the anabolic stimulation of chondrocytes, comprising by contacting said cell with an expression-inhibiting agent that inhibits the translation in the cell of a polyribonucleotide encoding a TARGET polypeptide. A particular embodiment relates to a composition comprising a polynucleotide including at least one antisense strand that functions to pair the agent with the TARGET TARGET mRNA, and thereby down-regulate or block the expression of TARGET polypeptide. The inhibitory agent preferably comprises antisense polynucleotide, a ribozyme, and a small interfering RNA (siRNA), wherein said agent comprises a nucleic acid sequence complementary to, or engineered from, a naturally-occurring polynucleotide sequence encoding a portion of a polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 55-82 and 480. In a preferred embodiment the expression-inhibiting agent is complementary to a polynucleotide sequence selected from the group consisting of SEQ ID NO: 1-28 and 479. In an especially preferred embodiment the expression-inhibiting agent is complementary to a polynucleotide sequence selected from the group consisting of SEQ ID NO: 84-197 and 410.

[0104] An embodiment of the present invention relates to a method wherein the expression-inhibiting agent is selected from the group consisting of antisense RNA, antisense oligodeoxynucleotide (ODN), a ribozyme that cleaves the polyribonucleotide coding for SEQ ID NO: 55-82 or 480, a small interfering RNA (siRNA, preferably shRNA,) that is sufficiently complementary to a portion of the polyribonucleotide coding for SEQ ID NO: 55-82 or 480, such that the siRNA, preferably shRNA, interferes with the translation of the TARGET polyribonucleotide to the TARGET polypeptide. Preferably the expression-inhibiting agent is an antisense RNA, ribozyme, antisense oligodeoxynucleotide, or siRNA, preferably shRNA, complementary to a nucleotide sequence selected from the group consisting of SEQ ID NO: 1-28 and 479. In an especially preferred embodiment the expression-inhibiting agent is complementary to a polynucleotide sequence selected from the group consisting of SEQ ID NO: 84-197 and 410.

[0105] A special embodiment of the present invention relates to a method wherein the expression-inhibiting agent is a nucleic acid expressing the antisense RNA, antisense oligodeoxynucleotide (ODN), a ribozyme that cleaves the polyribonucleotide coding for SEQ ID NO: 55-82 or 480, a small interfering RNA (siRNA, preferably shRNA,) that is sufficiently complementary to a portion of the polyribonucleotide coding for SEQ ID NO: 55-82 or 480, such that the siRNA, preferably shRNA, interferes with the translation of the TARGET polyribonucleotide to the TARGET polypeptide. Preferably the nucleotide sequence is complementary to a polynucleotide selected from the group consisting of SEQ ID NO: 1-28 and 479. In an especially preferred embodiment nucleotide sequence is complementary to a polynucleotide selected from the group consisting of SEQ ID NO: 84-197 and 410.

[0106] The down regulation of gene expression using antisense nucleic acids can be achieved at the translational or transcriptional level. Antisense nucleic acids of the invention are preferably nucleic acid fragments capable of specifically hybridizing with all or part of a nucleic acid encoding a TARGET polypeptide or the corresponding messenger RNA. In addition, antisense nucleic acids may be designed which decrease expression of the nucleic acid sequence capable of encoding a TARGET polypeptide by inhibiting splicing of its primary transcript. Any length of antisense sequence is suitable for practice of the invention so long as it is capable of down-regulating or blocking expression of a nucleic acid coding for a TARGET. Preferably, the antisense sequence is at least about 17 nucleotides in length. The preparation and use of antisense nucleic acids, DNA encoding antisense RNAs and the use of oligo and genetic antisense is known in the art.

[0107] One embodiment of expression-inhibitory agent is a nucleic acid that is antisense to a nucleic acid comprising SEQ ID NO: 1-28. For example, an antisense nucleic acid (e.g. DNA) may be introduced into cells in vitro, or administered to a subject in vivo, as gene therapy to inhibit cellular expression of nucleic acids comprising SEQ ID NO: 1-28. Antisense oligonucleotides preferably comprise a sequence containing from about 17 to about 100 nucleotides and more preferably the antisense oligonucleotides comprise from about 18 to about 30 nucleotides. Antisense nucleic acids may be prepared from about 10 to about 30 contiguous nucleotides complementary to a nucleic acid sequence selected from the sequences of SEQ ID NO: 1-28.

[0108] The antisense nucleic acids are preferably oligonucleotides and may consist entirely of deoxyribo-nucleotides, modified deoxyribonucleotides, or some combination of both. The antisense nucleic acids can be synthetic oligonucleotides. The oligonucleotides may be chemically modified, if desired, to improve stability and/or selectivity. Since oligonucleotides are susceptible to degradation by intracellular nucleases, the modifications can include, for example, the use of a sulfur group to replace the free oxygen of the phosphodiester bond. This modification is called a phosphorothioate linkage. Phosphorothioate antisense oligonucleotides are water soluble, polyanionic, and resistant to endogenous nucleases. In addition, when a phosphorothioate antisense oligonucleotide hybridizes to its TARGET site, the RN202-315NA duplex activates the endogenous enzyme ribonuclease (RNase) H, which cleaves the mRNA component of the hybrid molecule.

[0109] In addition, antisense oligonucleotides with phosphoramidite and polyamide (peptide) linkages can be synthesized. These molecules should be very resistant to nuclease degradation. Furthermore, chemical groups can be added to the 2' carbon of the sugar moiety and the 5 carbon (C-5) of pyrimidines to enhance stability and facilitate the binding of the antisense oligonucleotide to its TARGET site. Modifications may include 2'-deoxy, O-pentoxy, O-propoxy, O-methoxy, fluoro, methoxyethoxy phosphorothioates, modified bases, as well as other modifications known to those of skill in the art.

[0110] Another type of expression-inhibitory agent that reduces the levels of TARGETS is the ribozyme. Ribozymes are catalytic RNA molecules (RNA enzymes) that have separate catalytic and substrate binding domains. The substrate binding sequence combines by nucleotide complementarity and, possibly, non-hydrogen bond interactions with its TARGET sequence. The catalytic portion cleaves the TARGET RNA at a specific site. The substrate domain of a ribozyme can be engineered to direct it to a specified mRNA sequence. The ribozyme recognizes and then binds a TARGET mRNA through complementary base pairing. Once it is bound to the correct TARGET site, the ribozyme acts enzymatically to cut the TARGET mRNA. Cleavage of the mRNA by a ribozyme destroys its ability to direct synthesis of the corresponding polypeptide. Once the ribozyme has cleaved its TARGET sequence, it is released and can repeatedly bind and cleave at other mRNAs.

[0111] Ribozyme forms include a hammerhead motif, a hairpin motif, a hepatitis delta virus, group I intron or RNaseP RNA (in association with an RNA guide sequence) motif or Neurospora VS RNA motif Ribozymes possessing a hammerhead or hairpin structure are readily prepared since these catalytic RNA molecules can be expressed within cells from eukaryotic promoters (Chen, et al. (1992) Nucleic Acids Res. 20:4581-9). A ribozyme of the present invention can be expressed in eukaryotic cells from the appropriate DNA vector. If desired, the activity of the ribozyme may be augmented by its release from the primary transcript by a second ribozyme (Ventura, et al. (1993) Nucleic Acids Res. 21:3249-55).

[0112] Ribozymes may be chemically synthesized by combining an oligodeoxyribonucleotide with a ribozyme catalytic domain (20 nucleotides) flanked by sequences that hybridize to the TARGET mRNA after transcription. The oligodeoxyribonucleotide is amplified by using the substrate binding sequences as primers. The amplification product is cloned into a eukaryotic expression vector.

[0113] Ribozymes are expressed from transcription units inserted into DNA, RNA, or viral vectors. Transcription of the ribozyme sequences are driven from a promoter for eukaryotic RNA polymerase I (pol (I), RNA polymerase II (pol II), or RNA polymerase III (pol III). Transcripts from pol II or pol III promoters will be expressed at high levels in all cells; the levels of a given pol II promoter in a given cell type will depend on nearby gene regulatory sequences. Prokaryotic RNA polymerase promoters are also used, providing that the prokaryotic RNA polymerase enzyme is expressed in the appropriate cells (Gao and Huang, (1993) Nucleic Acids Res. 21:2867-72). It has been demonstrated that ribozymes expressed from these promoters can function in mammalian cells (Kashani-Sabet, et al. (1992) Antisense Res. Dev. 2:3-15).

[0114] A particularly preferred inhibitory agent is a small interfering RNA (siRNA, preferably shRNA). siRNA, preferably shRNA, mediate the post-transcriptional process of gene silencing by double stranded RNA (dsRNA) that is homologous in sequence to the silenced RNA. siRNA according to the present invention comprises a sense strand of 17-25 nucleotides complementary or homologous to a contiguous 17-25 nucleotide sequence selected from the group of sequences described in SEQ ID NO: 1-28 or 479, preferably from the group of sequences described in SEQ ID No: 84-197 or 410, and an antisense strand of 17-23 nucleotides complementary to the sense strand. Exemplary sequences are described as sequences complementary to SEQ ID NO: 84-197 or 410. The most preferred siRNA comprises sense and anti-sense strands that are 100 percent complementary to each other and the TARGET polynucleotide sequence. Preferably the siRNA further comprises a loop region linking the sense and the antisense strand.

[0115] A self-complementing single stranded siRNA molecule polynucleotide according to the present invention comprises a sense portion and an antisense portion connected by a loop region linker. Preferably, the loop region sequence is 4-30 nucleotides long, more preferably 5-15 nucleotides long and most preferably 8 nucleotides long. In a most preferred embodiment the linker sequence is UUGCUAUA (SEQ ID NO: 83). Self-complementary single stranded siRNAs form hairpin loops and are more stable than ordinary dsRNA. In addition, they are more easily produced from vectors.

[0116] Analogous to antisense RNA, the siRNA can be modified to confirm resistance to nucleolytic degradation, or to enhance activity, or to enhance cellular distribution, or to enhance cellular uptake, such modifications may consist of modified internucleoside linkages, modified nucleic acid bases, modified sugars and/or chemical linkage the siRNA to one or more moieties or conjugates. The nucleotide sequences are selected according to siRNA designing rules that give an improved reduction of the TARGET sequences compared to nucleotide sequences that do not comply with these siRNA designing rules (For a discussion of these rules and examples of the preparation of siRNA, WO2004094636, published Nov. 4, 2004, and UA20030198627, are hereby incorporated by reference).

[0117] The present invention also relates to compositions, and methods using said compositions, comprising a DNA expression vector capable of expressing a polynucleotide capable of inducing anabolic stimulation of chondrocytes and described hereinabove as an expression inhibition agent.

[0118] A special aspect of these compositions and methods relates to the down-regulation or blocking of the expression of a TARGET polypeptide by the induced expression of a polynucleotide encoding an intracellular binding protein that is capable of selectively interacting with the TARGET polypeptide. An intracellular binding protein includes any protein capable of selectively interacting, or binding, with the polypeptide in the cell in which it is expressed and neutralizing the function of the polypeptide. Preferably, the intracellular binding protein is a neutralizing antibody or a fragment of a neutralizing antibody having binding affinity to an epitope of the TARGET polypeptide of SEQ ID NO: 55-82, 198-391 and 480. More preferably, the intracellular binding protein is a single chain antibody.

[0119] A special embodiment of this composition comprises the expression-inhibiting agent selected from the group consisting of antisense RNA, antisense oligodeoxynucleotide (ODN), a ribozyme that cleaves the polyribonucleotide coding for SEQ ID NO: 55-82 or 480, and a small interfering RNA (siRNA) that is sufficiently homologous to a portion of the polyribonucleotide coding for SEQ ID NO: 55-82 or 480, such that the siRNA interferes with the translation of the TARGET polyribonucleotide to the TARGET polypeptide.

[0120] The polynucleotide expressing the expression-inhibiting agent is preferably included within a vector. The polynucleic acid is operably linked to signals enabling expression of the nucleic acid sequence and is introduced into a cell utilizing, preferably, recombinant vector constructs, which will express the antisense nucleic acid once the vector is introduced into the cell. A variety of viral-based systems are available, including adenoviral, retroviral, adeno-associated viral, lentiviral, herpes simplex viral or a sendaviral vector systems, and all may be used to introduce and express polynucleotide sequence for the expression-inhibiting agents in TARGET cells.

[0121] Preferably, the viral vectors used in the methods of the present invention are replication defective. Such replication defective vectors will usually pack at least one region that is necessary for the replication of the virus in the infected cell. These regions can either be eliminated (in whole or in part), or be rendered non-functional by any technique known to a person skilled in the art. These techniques include the total removal, substitution, partial deletion or addition of one or more bases to an essential (for replication) region. Such techniques may be performed in vitro (on the isolated DNA) or in situ, using the techniques of genetic manipulation or by treatment with mutagenic agents. Preferably, the replication defective virus retains the sequences of its genome, which are necessary for encapsidating, the viral particles.

[0122] In a preferred embodiment, the viral element is derived from an adenovirus. Preferably, the vehicle includes an adenoviral vector packaged into an adenoviral capsid, or a functional part, derivative, and/or analogue thereof. Adenovirus biology is also comparatively well known on the molecular level. Many tools for adenoviral vectors have been and continue to be developed, thus making an adenoviral capsid a preferred vehicle for incorporating in a library of the invention. An adenovirus is capable of infecting a wide variety of cells. However, different adenoviral serotypes have different preferences for cells. To combine and widen the TARGET cell population that an adenoviral capsid of the invention can enter in a preferred embodiment, the vehicle includes adenoviral fiber proteins from at least two adenoviruses. Preferred adenoviral fiber protein sequences are serotype 17, 45 and 51. Techniques or construction and expression of these chimeric vectors are disclosed in US Published Patent Applications 20030180258 and 20040071660, hereby incorporated by reference.

[0123] In a preferred embodiment, the nucleic acid derived from an adenovirus includes the nucleic acid encoding an adenoviral late protein or a functional part, derivative, and/or analogue thereof. An adenoviral late protein, for instance an adenoviral fiber protein, may be favorably used to TARGET the vehicle to a certain cell or to induce enhanced delivery of the vehicle to the cell. Preferably, the nucleic acid derived from an adenovirus encodes for essentially all adenoviral late proteins, enabling the formation of entire adenoviral capsids or functional parts, analogues, and/or derivatives thereof. Preferably, the nucleic acid derived from an adenovirus includes the nucleic acid encoding adenovirus E2A or a functional part, derivative, and/or analogue thereof. Preferably, the nucleic acid derived from an adenovirus includes the nucleic acid encoding at least one E4-region protein or a functional part, derivative, and/or analogue thereof, which facilitates, at least in part, replication of an adenoviral derived nucleic acid in a cell. The adenoviral vectors used in the examples of this application are exemplary of the vectors useful in the present method of treatment invention.

[0124] Certain embodiments of the present invention use retroviral vector systems. Retroviruses are integrating viruses that infect dividing cells, and their construction is known in the art. Retroviral vectors can be constructed from different types of retrovirus, such as, MoMuLV ("murine Moloney leukemia virus" MSV ("murine Moloney sarcoma virus"), HaSV ("Harvey sarcoma virus"); SNV ("spleen necrosis virus"); RSV ("Rous sarcoma virus") and Friend virus. Lentiviral vector systems may also be used in the practice of the present invention.

[0125] In other embodiments of the present invention, adeno-associated viruses ("AAV") are utilized. The AAV viruses are DNA viruses of relatively small size that integrate, in a stable and site-specific manner, into the genome of the infected cells. They are able to infect a wide spectrum of cells without inducing any effects on cellular growth, morphology or differentiation, and they do not appear to be involved in human pathologies.

[0126] In the vector construction, the polynucleotide agents of the present invention may be linked to one or more regulatory regions. Selection of the appropriate regulatory region or regions is a routine matter, within the level of ordinary skill in the art. Regulatory regions include promoters, and may include enhancers, suppressors, etc.

[0127] Promoters that may be used in the expression vectors of the present invention include both constitutive promoters and regulated (inducible) promoters. The promoters may be prokaryotic or eukaryotic depending on the host. Among the prokaryotic (including bacteriophage) promoters useful for practice of this invention are lac, lacZ, T3, T7, lambda P.sub.r, P.sub.1, and trp promoters. Among the eukaryotic (including viral) promoters useful for practice of this invention are ubiquitous promoters (e.g. HPRT, vimentin, actin, tubulin), intermediate filament promoters (e.g. desmin, neurofilaments, keratin, GFAP), therapeutic gene promoters (e.g. MDR type, CFTR, factor VIII), tissue-specific promoters (e.g. actin promoter in smooth muscle cells, or Flt and Flk promoters active in endothelial cells), including animal transcriptional control regions, which exhibit tissue specificity and have been utilized in transgenic animals: elastase I gene control region which is active in pancreatic acinar cells (Swift, et al. (1984) Cell 38:639-46; Ornitz, et al. (1986) Cold Spring Harbor Symp. Quant. Biol. 50:399-409; MacDonald, (1987) Hepatology 7:425-515); insulin gene control region which is active in pancreatic beta cells (Hanahan, (1985) Nature 315:115-22), immunoglobulin gene control region which is active in lymphoid cells (Grosschedl, et al. (1984) Cell 38:647-58; Adames, et al. (1985) Nature 318:533-8; Alexander, et al. (1987) Mol. Cell. Biol. 7:1436-44), mouse mammary tumor virus control region which is active in testicular, breast, lymphoid and mast cells (Leder, et al. (1986) Cell 45:485-95), albumin gene control region which is active in liver (Pinkert, et al. (1987) Genes and Devel. 1:268-76), alpha-fetoprotein gene control region which is active in liver (Krumlauf, et al. (1985) Mol. Cell. Biol., 5:1639-48; Hammer, et al. (1987) Science 235:53-8), alpha 1-antitrypsin gene control region which is active in the liver (Kelsey, et al. (1987) Genes and Devel., 1: 161-71), beta-globin gene control region which is active in myeloid cells (Mogram, et al. (1985) Nature 315:338-40; Kollias, et al. (1986) Cell 46:89-94), myelin basic protein gene control region which is active in oligodendrocyte cells in the brain (Readhead, et al. (1987) Cell 48:703-12), myosin light chain-2 gene control region which is active in skeletal muscle (Sani, (1985) Nature 314.283-6), and gonadotropic releasing hormone gene control region which is active in the hypothalamus (Mason, et al. (1986) Science 234:1372-8).

[0128] Other promoters which may be used in the practice of the invention include promoters which are preferentially activated in dividing cells, promoters which respond to a stimulus (e.g. steroid hormone receptor, retinoic acid receptor), tetracycline-regulated transcriptional modulators, cytomegalovirus immediate-early, retroviral LTR, metallothionein, SV-40, E1a, and MLP promoters.

[0129] Additional vector systems include the non-viral systems that facilitate introduction of polynucleotide agents into a patient. For example, a DNA vector encoding a desired sequence can be introduced in vivo by lipofection. Synthetic cationic lipids designed to limit the difficulties encountered with liposome-mediated transfection can be used to prepare liposomes for in vivo transfection of a gene encoding a marker (Felgner, et. al. (1987) Proc. Natl. Acad Sci. USA 84:7413-7); see Mackey, et al. (1988) Proc. Natl. Acad. Sci. USA 85:8027-31; Ulmer, et al. (1993) Science 259:1745-8). The use of cationic lipids may promote encapsulation of negatively charged nucleic acids, and also promote fusion with negatively charged cell membranes (Felgner and Ringold, (1989) Nature 337:387-8). Particularly useful lipid compounds and compositions for transfer of nucleic acids are described in International Patent Publications WO 95/18863 and WO 96/17823, and in U.S. Pat. No. 5,459,127. The use of lipofection to introduce exogenous genes into the specific organs in vivo has certain practical advantages and directing transfection to particular cell types would be particularly advantageous in a tissue with cellular heterogeneity, for example, pancreas, liver, kidney, and the brain. Lipids may be chemically coupled to other molecules for the purpose of targeting. Targeted peptides, e.g., hormones or neurotransmitters, and proteins for example, antibodies, or non-peptide molecules could be coupled to liposomes chemically. Other molecules are also useful for facilitating transfection of a nucleic acid in vivo, for example, a cationic oligopeptide (e.g., International Patent Publication WO 95/21931), peptides derived from DNA binding proteins (e.g., International Patent Publication WO 96/25508), or a cationic polymer (e.g., International Patent Publication WO 95/21931).

[0130] It is also possible to introduce a DNA vector in vivo as a naked DNA plasmid (see U.S. Pat. Nos. 5,693,622, 5,589,466 and 5,580,859). Naked DNA vectors for therapeutic purposes can be introduced into the desired host cells by methods known in the art, e.g., transfection, electroporation, microinjection, transduction, cell fusion, DEAE dextran, calcium phosphate precipitation, use of a gene gun, or use of a DNA vector transporter (see, e.g., Wilson, et al. (1992) J. Biol. Chem. 267:963-7; Wu and Wu, (1988) J. Biol. Chem. 263:14621-4; Hartmut, et al. Canadian Patent Application No. 2,012,311, filed Mar. 15, 1990; Williams, et al (1991). Proc. Natl. Acad. Sci. USA 88:2726-30). Receptor-mediated DNA delivery approaches can also be used (Curiel, et al. (1992) Hum. Gene Ther. 3:147-54; Wu and Wu, (1987) J. Biol. Chem. 262:4429-32).

[0131] The present invention also provides biologically compatible, cartilage formation-enhancing compositions comprising an effective amount of one or more compounds identified as TARGET inhibitors, and/or the expression-inhibiting agents as described hereinabove.

[0132] A biologically compatible composition is a composition, that may be solid, liquid, gel, or other form, in which the compound, polynucleotide, vector, and antibody of the invention is maintained in an active form, e.g., in a form able to effect a biological activity. For example, a compound of the invention would have inverse agonist or antagonist activity on the TARGET; a nucleic acid would be able to replicate, translate a message, or hybridize to a complementary mRNA of a TARGET; a vector would be able to transfect a TARGET cell and expression the antisense, antibody, ribozyme or siRNA as described hereinabove; an antibody would bind a TARGET polypeptide domain.

[0133] A preferred biologically compatible composition is an aqueous solution that is buffered using, e.g., Tris, phosphate, or HEPES buffer, containing salt ions. Usually the concentration of salt ions will be similar to physiological levels. Biologically compatible solutions may include stabilizing agents and preservatives. In a more preferred embodiment, the biocompatible composition is a pharmaceutically acceptable composition. Such compositions can be formulated for administration by topical, oral, parenteral, intranasal, subcutaneous, and intraocular, routes. Parenteral administration is meant to include intravenous injection, intramuscular injection, intraarterial injection or infusion techniques. The composition may be administered parenterally in dosage unit formulations containing standard, well-known non-toxic physiologically acceptable carriers, adjuvants and vehicles as desired.

[0134] A particularly preferred embodiment of the present composition invention is a cartilage formation-enhancing pharmaceutical composition comprising a therapeutically effective amount of an expression-inhibiting agent as described hereinabove, in admixture with a pharmaceutically acceptable carrier. Another preferred embodiment is a pharmaceutical composition for the treatment or prevention of a condition a systemic or local decrease in mean cartilage thickness, or a susceptibility to the condition, comprising an effective cartilage formation-enhancing amount of a TARGET antagonist or inverse agonist, its pharmaceutically acceptable salts, hydrates, solvates, or prodrugs thereof in admixture with a pharmaceutically acceptable carrier.

[0135] Pharmaceutical compositions for oral administration can be formulated using pharmaceutically acceptable carriers well known in the art in dosages suitable for oral administration. Such carriers enable the pharmaceutical compositions to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and the like, for ingestion by the patient. Pharmaceutical compositions for oral use can be prepared by combining active compounds with solid excipient, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragee cores. Suitable excipients are carbohydrate or protein fillers, such as sugars, including lactose, sucrose, mannitol, or sorbitol; starch from corn, wheat, rice, potato, or other plants; cellulose, such as methyl cellulose, hydroxypropylmethyl-cellulose, or sodium carboxymethyl-cellulose; gums including arabic and tragacanth; and proteins such as gelatin and collagen. If desired, disintegrating or solubilizing agents may be added, such as the cross-linked polyvinyl pyrrolidone, agar, alginic acid, or a salt thereof, such as sodium alginate. Dragee cores may be used in conjunction with suitable coatings, such as concentrated sugar solutions, which may also contain gum arabic, talc, polyvinyl-pyrrolidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures. Dyestuffs or pigments may be added to the tablets or dragee coatings for product identification or to characterize the quantity of active compound, i.e., dosage.

[0136] Pharmaceutical preparations that can be used orally include push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a coating, such as glycerol or sorbitol. Push-fit capsules can contain active ingredients mixed with filler or binders, such as lactose or starches, lubricants, such as talc or magnesium stearate, and, optionally, stabilizers. In soft capsules, the active compounds may be dissolved or suspended in suitable liquids, such as fatty oils, liquid, or liquid polyethylene glycol with or without stabilizers.

[0137] Preferred sterile injectable preparations can be a solution or suspension in a non-toxic parenterally acceptable solvent or diluent. Examples of pharmaceutically acceptable carriers are saline, buffered saline, isotonic saline (e.g. monosodium or disodium phosphate, sodium, potassium; calcium or magnesium chloride, or mixtures of such salts), Ringer's solution, dextrose, water, sterile water, glycerol, ethanol, and combinations thereof 1,3-butanediol and sterile fixed oils are conveniently employed as solvents or suspending media. Any bland fixed oil can be employed including synthetic mono- or di-glycerides. Fatty acids such as oleic acid also find use in the preparation of injectables.

[0138] The composition medium can also be a hydrogel, which is prepared from any biocompatible or non-cytotoxic homo- or hetero-polymer, such as a hydrophilic polyacrylic acid polymer that can act as a drug absorbing sponge. Certain of them, such as, in particular, those obtained from ethylene and/or propylene oxide are commercially available. A hydrogel can be deposited directly onto the surface of the tissue to be treated, for example during surgical intervention.

[0139] Embodiments of pharmaceutical compositions of the present invention comprise a replication defective recombinant viral vector encoding the polynucleotide inhibitory agent of the present invention and a transfection enhancer, such as poloxamer. An example of a poloxamer is Poloxamer 407, which is commercially available (BASF, Parsippany, N.J.) and is a non-toxic, biocompatible polyol. A poloxamer impregnated with recombinant viruses may be deposited directly on the surface of the tissue to be treated, for example during a surgical intervention. Poloxamer possesses essentially the same advantages as hydrogel while having a lower viscosity.

[0140] The active expression-inhibiting agents may also be entrapped in microcapsules prepared, for example, by interfacial polymerization, for example, hydroxymethylcellulose or gelatin-microcapsules and poly-(methylmethacylate) microcapsules, respectively, in colloidal drug delivery systems (for example, liposomes, albumin microspheres, microemulsions, nano-particles and nanocapsules) or in macroemulsions. Such techniques are disclosed in Remington's Pharmaceutical Sciences (1980) 16th edition, Osol, A. Ed.

[0141] Sustained-release preparations may be prepared. Suitable examples of sustained-release preparations include semi-permeable matrices of solid hydrophobic polymers containing the antibody, which matrices are in the form of shaped articles, e.g. films, or microcapsules. Examples of sustained-release matrices include polyesters, hydrogels (for example, poly(2-hydroxyethyl-methacrylate), or poly(vinylalcohol)), polylactides (U.S. Pat. No. 3,773,919), copolymers of L-glutamic acid and gamma-ethyl-L-glutamate, non-degradable ethylene-vinyl acetate, degradable lactic acid-glycolic acid copolymers such as the LUPRON DEPOT.TM.. (injectable microspheres composed of lactic acid-glycolic acid copolymer and leuprolide acetate), and poly-D-(-)-3-hydroxybutyric acid. While polymers such as ethylene-vinyl acetate and lactic acid-glycolic acid enable release of molecules for over 100 days, certain hydrogels release proteins for shorter time periods. When encapsulated antibodies remain in the body for a long time, they may denature or aggregate as a result of exposure to moisture at 37.degree. C., resulting in a loss of biological activity and possible changes in immunogenicity. Rational strategies can be devised for stabilization depending on the mechanism involved. For example, if the aggregation mechanism is discovered to be intermolecular S--S bond formation through thio-disulfide interchange, stabilization may be achieved by modifying sulfhydryl residues, lyophilizing from acidic solutions, controlling moisture content, using appropriate additives, and developing specific polymer matrix compositions.

[0142] As defined above, therapeutically effective dose means that amount of protein, polynucleotide, peptide, or its antibodies, agonists or antagonists, which ameliorate the symptoms or condition. Therapeutic efficacy and toxicity of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., ED50 (the dose therapeutically effective in 50% of the population) and LD50 (the dose lethal to 50% of the population). The dose ratio of toxic to therapeutic effects is the therapeutic index, and it can be expressed as the ratio, LD50/ED50. Pharmaceutical compositions that exhibit large therapeutic indices are preferred. The data obtained from cell culture assays and animal studies is used in formulating a range of dosage for human use. The dosage of such compounds lies preferably within a range of circulating concentrations that include the ED50 with little or no toxicity. The dosage varies within this range depending upon the dosage form employed, sensitivity of the patient, and the route of administration.

[0143] For any compound, the therapeutically effective dose can be estimated initially either in cell culture assays or in animal models, usually mice, rabbits, dogs, or pigs. The animal model is also used to achieve a desirable concentration range and route of administration. Such information can then be used to determine useful doses and routes for administration in humans. The exact dosage is chosen by the individual physician in view of the patient to be treated. Dosage and administration are adjusted to provide sufficient levels of the active moiety or to maintain the desired effect. Additional factors which may be taken into account include the severity of the disease state, age, weight and gender of the patient; diet, desired duration of treatment, method of administration, time and frequency of administration, drug combination(s), reaction sensitivities, and tolerance/response to therapy. Long acting pharmaceutical compositions might be administered every 3 to 4 days, every week, or once every two weeks depending on half-life and clearance rate of the particular formulation.

[0144] The pharmaceutical compositions according to this invention may be administered to a subject by a variety of methods. They may be added directly to TARGET tissues, complexed with cationic lipids, packaged within liposomes, or delivered to TARGET cells by other methods known in the art. Localized administration to the desired tissues may be done by direct injection, transdermal absorption, catheter, infusion pump or stent. The DNA, DNA/vehicle complexes, or the recombinant virus particles are locally administered to the site of treatment. Alternative routes of delivery include, but are not limited to, intravenous injection, intramuscular injection, subcutaneous injection, aerosol inhalation, oral (tablet or pill form), topical, systemic, ocular, intraperitoneal and/or intrathecal delivery. Examples of ribozyme delivery and administration are provided in Sullivan et al. WO 94/02595.

[0145] Antibodies according to the invention may be delivered as a bolus only, infused over time or both administered as a bolus and infused over time. Those skilled in the art may employ different formulations for polynucleotides than for proteins. Similarly, delivery of polynucleotides or polypeptides will be specific to particular cells, conditions, locations, etc.

[0146] As discussed hereinabove, recombinant viruses may be used to introduce DNA encoding polynucleotide agents useful in the present invention. Recombinant viruses according to the invention are generally formulated and administered in the form of doses of between about 10.sup.4 and about 10.sup.14 pfu. In the case of AAVs and adenoviruses, doses of from about 10.sup.6 to about 10.sup.11 pfu are preferably used. The term pfu ("plaque-forming unit") corresponds to the infective power of a suspension of virions and is determined by infecting an appropriate cell culture and measuring the number of plaques formed. The techniques for determining the pfu titre of a viral solution are well documented in the prior art.

[0147] The present invention also provides methods of enhancing cartilage formation, which comprise the administration to said subject a therapeutically effective amount of an expression-inhibiting agent of the invention. A further aspect of the invention relates to a method of treating or preventing a disease involving chondrocyte anabolic stimulation, comprising administering to said subject a cartilage formation-enhancing pharmaceutical composition as described herein.

[0148] Examples of diseases involving anabolic stimulation of chondrocytes that are treatable using the means and methods of the present invention include, but are not limited to osteoarthritis, rheumatoid arthritis, psoriatic arthritis, juvenile rheumatoid arthritis, gouty arthritis, septic or infectious arthritis, reactive arthritis, reflex sympathetic dystrophy, algodystrophy, Tietze syndrome or costal chondritis, fibromyalgia, osteochondritis, neurogenic or neuropathic arthritis, arthropathy, endemic forms of arthritis like osteoarthritis deformans endemica, Mseleni disease, and Handigodu disease; degeneration resulting from fibromyalgia, systemic lupus erythematosus, scleroderma, and ankylosing spondylitis. Furthermore, people suffering from congenital cartilage malformations, including hereditary chondrolysis, chondrodysplasias and pseudoachondrodysplasias, are likely to benefit from programs that result in anabolic stimulation of chondrocytes, and these diseases therefore may also be treated by using the methods and means of the present invention. Non-limiting examples of congenital cartilage malformation related diseases are microtia, anotia, and metaphyseal chondrodysplasia.

[0149] The polypeptides or the polynucleotides employed in the methods of the present invention may be free in solution, affixed to a solid support, borne on a cell surface, or located intracellularly. To perform the methods it is feasible to immobilize either the polypeptide of the present invention or the compound to facilitate separation of complexes from uncomplexed forms of the polypeptide, as well as to accommodate automation of the assay. Interaction (e.g., binding of) of the polypeptide of the present invention with a compound can be accomplished in any vessel suitable for containing the reactants. Examples of such vessels include microtitre plates, test tubes, and microcentrifuge tubes. In one embodiment, a fusion protein can be provided which adds a domain that allows the polypeptide to be bound to a matrix. For example, the polypeptide of the present invention can be "His" tagged, and subsequently adsorbed onto Ni-NTA microtitre plates, or ProtA fusions with the polypeptides of the present invention can be adsorbed to IgG, which are then combined with the cell lysates (e.g., (.sup.35S-labelled) and the candidate compound, and the mixture incubated under conditions favorable for complex formation (e.g., at physiological conditions for salt and pH). Following incubation, the plates are washed to remove any unbound label, and the matrix is immobilized. The amount of radioactivity can be determined directly, or in the supernatant after dissociation of the complexes. Alternatively, the complexes can be dissociated from the matrix, separated by SDS-PAGE, and the level of the protein binding to the protein of the present invention quantitated from the gel using standard electrophoretic techniques.

[0150] Other techniques for immobilizing protein on matrices can also be used in the method of identifying compounds. For example, either the polypeptide of the present invention or the compound can be immobilized utilizing conjugation of biotin and streptavidin. Biotinylated protein molecules of the present invention can be prepared from biotin-NHS (N-hydroxy-succinimide) using techniques well known in the art (e.g., biotinylation kit, Pierce Chemicals, Rockford, Ill.), and immobilized in the wells of streptavidin-coated 96 well plates (Pierce Chemical). Alternatively, antibodies reactive with the polypeptides of the present invention but which do not interfere with binding of the polypeptide to the compound can be derivatized to the wells of the plate, and the polypeptide of the present invention can be trapped in the wells by antibody conjugation. As described above, preparations of a labeled candidate compound are incubated in the wells of the plate presenting the polypeptide of the present invention, and the amount of complex trapped in the well can be quantitated.

[0151] Another embodiment of the present invention relates to a method for in vitro production of cartilage tissue, comprising the steps of contacting chondrocyte cells with a polynucleotide sequence comprising a sequence selected from the group consisting of sequences complementary to SEQ ID No: 1-28 or 479, preferably selected from the group consisting of sequences complementary to SEQ ID NO: 84-197 or 480 for a time sufficient to re-differentiate the chondrocytes thereby producing a cartilaginous matrix.

[0152] In a preferred embodiment, the method comprises the steps of: [0153] (a) applying chondrocyte cells on a substrate to form a cellular substrate, [0154] (b) introducing a polynucleotide comprising a nucleotide sequence selected from the group consisting of sequences complementary to SEQ ID No: 1-28 or 479, preferably selected from the group consisting of sequences complementary to SEQ ID NO: 84-197 or 479, for a time sufficient to re-differentiate the chondrocyte cells, thereby producing a cartilaginous matrix.

[0155] The invention thus provides a method for producing a substrate with a matrix grown thereon, which matrix may be used for the provision of load-bearing implants, including joint prostheses, such as artificial knee joints and finger joints, and maxillofacial implants. It can also be used for special surgery devices, such as spacers, or cartilage fillers, and for use in augmentation, obliteration or reconstitution of cartilage defects and damaged or lost cartilage.

[0156] The present invention also relates to a combination of a load-bearing implant (preferably coated with a matrix as described above) with a cartilage filler comprising a matrix as described.

[0157] The method of the invention is also very suitable in relation to revision surgery, i.e., when previous surgical devices require replacement.

[0158] Suitable cells are stem cells cells, including mesenchymal stem cells cells and in particular chondrosyte precursor cells. The mesenchymal stem cells, and especially the chondrosyte precursor cells are found to be very effective in the cartilage producing process when taken from their original environment. In addition, cells derived from cartilage biopsies of a subject may be cultured and utilized with the present invention.

[0159] The mesenchymal stem cells can be directly applied on the substrate or they can advantageously be multiplied in the absence of the substrate before being applied on the substrate. In the latter mode, the cells are still largely multipotent after multiplication and, for the purpose of the invention, they are still referred to as undifferentiated. Subsequently, the cells are allowed to differentiate. Differentiation can be induced or enhanced by the presence of suitable inductors, such as bone morphogenic proteins (BMP2; BM4; BMP7), transforming growth factor beta (TGFbeta), CDMP1 and CDMP2. Especially suitable inductors of differentiation are the expression inhibitory agents of the present invention.

[0160] The use of mesenchymal stem cells provides several advantages. Firstly, their lower differentiation implies a higher proliferation rate and allows the eventual functionality to be better directed and controlled. Moreover, culturing these cells not only produces the required cartilage matrix containing organic and inorganic components, but also results in the presence, in the culture medium and in the matrix, of several factors which are essential for growth of the tissue and for adaptation to existing living tissue. Also, the culture medium can be a source of active factors such as growth factors, to be used in connection with the implanting process. Furthermore, such undifferentiated cells are often available in large quantities and more conveniently than e.g., mature cartilage cells, and exhibit a lower morbidity during recovery. Moreover, the undifferentiated cells can be obtained from the patient for whom the implant is intended. The cartilage resulting from these cells is autologous to the patient and thus no immune response will be induced. Matrices as thick as 100 .mu.m can be produced as a result of the use of undifferentiated cells.

[0161] The substrate on which the undifferentiated cells can be applied and cultured can be a metal, such as titanium, cobalt/chromium alloy or stainless steel, a bioactive surface such as a calcium phosphate, polymer surfaces such as polyethylene, and the like. Although less preferred, siliceous material such as glass ceramics, can also be used as a substrate. Most preferred are metals, such as titanium, and calcium phosphates, even though calcium phosphate is not an indispensable component of the substrate. The substrate may be porous or non-porous. The cells can be applied at a rate of e.g., 10.sup.3-10.sup.6 per cm.sup.2, in particular 10.sup.4-2.times.10.sup.5 cells per cm.sup.2.

[0162] The culture medium to be used in the method according to the invention can be a commonly known culture medium such as MEM (minimum essential medium). Advantageously, the medium can be a conditioned medium. In this context, a conditioned medium is understood to be a medium wherein similar cells have previously been incubated, causing the medium to contain factors such as polypeptides, secreted by the cells which are important for cell growth and cell differentiation.

[0163] The cells are cultured for a time sufficient to produce a matrix layer, e.g., a matrix layer having a thickness of at least 0.5 .mu.m, in particular from 1 up to 100 .mu.m, more in particular of 10-50 .mu.m. The cells may be contacted with the culture medium for e.g. 2-15 weeks, in particular 4-10 weeks.

[0164] The production of the matrix, when applied on a substrate, results in a continuous or quasi-continuous coating covering the substrate for at least 50%, in particular at least 80% of its surface area.

[0165] In yet another aspect of the invention, the invention provides a method for diagnosing a pathological condition involving chondrocyte de-differentiation, said method comprising the steps of: determining the nucleic acid sequence of any one of the genes encoding the polypeptides listed in Table 1A in a genomic DNA sample; comparing the sequence from step (a) with the nucleic acid sequence of a healthy subject; and identifying any difference(s) related to the pathological condition. Such differences may be further checked in in vitro assays applying similar marker genes as disclosed herein. Such assays will reveal the role of the gene or its encoded polypeptide in anabolic stimulation processes of chondrocytes. If such mutations are identified this knowledge can be further exploited in test-kits for diagnosis of similar diseases.

[0166] Still another aspect or the invention relates to a method for diagnosing a pathological condition involving chondrocyte anabolic stimulation or a susceptibility to the condition in a subject, comprising determining the amount of polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 55-82, 198-391 and 480 in a biological sample, and comparing the amount with the amount of the polypeptide in a healthy subject, wherein an increase of the amount of polypeptide compared to the healthy subject is indicative of the presence of the pathological condition. Clearly, the activity and/or expression levels of the target genes as disclosed herein may have an effect on anabolic stimulation of chondrocytes. It remains to be determined to what level the activity should be elevated to diagnose for the disease. However, by comparing levels found in patients, individuals without symptoms and clearly healthy individuals the skilled person may easily determine these relevant levels. Since the skilled person is now aware which polypeptides should be monitored, the present invention provides novel tools for test assays for such diagnostics. A prominent disease that may be controlled, checked and diagnosed by using the knowledge provided by the present invention is osteoarthritis.

[0167] The rate of chondrocyte anabolic stimulation can typically be measured by determining the deposition of cartilage, or cartilage components, or cartilage-containing extra-cellular matrix produced by the chondrocytes, in the medium. A cell-based ELISA, enzymatic assays, or other general techniques known in the art can be used to measure cartilage components, like the ones described in Walsh G., Proteins: Biotechnology and Biochemistry. John Wiley and Sons, 2001.

[0168] The invention is further illustrated in the following figures and examples.

EXAMPLES

Example 1

Development of a High-Throughput Screening Method for the Detection of Endogenous Collagen Type IL Alpha-1 (col2 1)

Principle of the Assay:

[0169] Normal human articular chondrocytes (NHAC's) that are grown in two-dimensional cultures become dedifferentiated and gradually cease to synthesize cartilage. They can be re-differentiated into anabolic, active chondrocytes in the presence of appropriate factors (e.g. BMP2). An assay to screen for such factors was developed by monitoring the levels of collagen type ii, alpha-1 (col2.alpha.1), a major constituent of normal cartilage. NHAC's are seeded in 384 well plates and 1 day after plating infected with individual siRNA adenoviruses (Ad-siRNA) from the SILENCESELECT.RTM. collection (see WO03/020931). Col2.alpha.1 deposition is determined at 14 days after the start of the infection (14 dpi.

Control Viruses

[0170] Ad-BMP2; described in WO 03/018799 BMP4; Ad5 dE1/E2A adenoviruses that mediate the expression of full length bone morphogenetic protein 4 pre-protein (see NP.sub.--570912). Ad-LacZ; referred to as pIPspAdApt6-lacZ in WO 02/070744 Ad-eGFP; referred to as pIPspAdApt6-eGFP in WO 02/070744 Ad-Empty; described in WO 02/070744

Development of the Assay

[0171] NHAC's were isolated from donors who died from unrelated causes, and were obtained after informed consent (Cambrex, Verviers, Belgium).

[0172] In a series of experiments, carried out in 384-well plates, several parameters are optimized: cell seeding density, multiplicities of infection (MOI) of control viruses (Ad-BMP2 or Ad-eGFP), duration of infection, toxicity, infection efficiency (using Ad-eGFP) and the day of readout.

[0173] Using Ad-BMP2 (BMP2 over-expression) as a positive control for assay development, the following protocol resulted in the highest dynamic range for the assay with the lowest standard deviation on the background signal:

[0174] NHAC's are seeded on day 0 at 1500 cells/well of a 384-well plate in 60 .mu.l of DMEM/F12 (InVitrogen), containing 10% heat-inactivated fetal calf serum (FBS-HI) and Pen/Strep) and infected the next day with 2.5 .mu.l of Ad-control-virus (Ad-BMP2 or Ad-eGFP; this corresponds to an assumed MOI of 2000). After 7 days, 10 .mu.l of a 50 .mu.g/ml 2-Phospho-L-ascorbic acid in assay culture medium is added to each well. Up-regulation of Col2a1 is read at 10 dpi: The medium is removed with a VacuSafe; 50 .mu.l ice-cold MeOH is added with a multidrop and removed immediately with a VacuSafe; 80 .mu.l of ice-cold MeOH is added with a multidrop to fixate the cells, and plates are incubated for 20 min at -20.degree. C.; MeOH is removed with a VacuSafe; plates are air-dried for 20 min, followed by 2.times. washing with 80 .mu.l of phosphate buffered saline (PBS); 75 .mu.l of blocking buffer (0.1% casein in PBS) is added and plates are incubated for at least 2 h at room temperature (RT); blocking buffer is removed; cells are washed with 25 .mu.l of EC buffer (20 mM sodium phosphate, 2 mM EDTA, 400 mM NaCl, 0.2% BSA, 0.05% CHAPS, 0.4% casein, 0.05% NaN3, pH 7) and 35 .mu.l of the primary antibody (Collagen II Ab-2 Neomarkers. Catalogus number MS-235-P) diluted 1/450, 1/225 in buffer C (20 mM sodium phosphate, 2 mM EDTA, 400 mM NaCl, 1% BSA, pH 7)) is added with a multichannel pipette; plates are incubated overnight at 4.degree. C.; primary antibody is removed; cells are washed twice with 80 .mu.l of PBST (0.5% Tween 20 in PBS) and once with 80 .mu.l PBS; 35 .mu.l of the secondary antibody (Goat-anti-mouse Immunoglobulins/HRP. DAKO. Catalogus number P0477; diluted 1/2000 in buffer C) is added with multichannel pipette; plates are incubated at RT for 1 h; secondary antibody is removed and cells are washed twice with 80 .mu.l PBST and once with 80 .mu.l PBS; 50 .mu.l of luminol substrate is added and after 5 minutes read-out is determined on a luminometer.

[0175] After optimization of the assay (see FIG. 1), a 384 well control plate is prepared that contains positive control viruses (BMP2 and BMP4) and neutral viruses (eGFP; lacZ and empty, see FIG. 1). Aliquots of the control plate are prepared and frozen at -20.degree. C. A control plate is thawed and taken along in every screening batch.

Example 2

Screening of 9216 Adenoviral siRNA Vectors in the Chondrogenesis Assay

[0176] The optimized protocol for screening the SILENCESELECT.RTM. library runs as follows: on day 0, propagated human primary chondrocytes are seeded in Greiner white, flat bottom, TC-treated 384 well plates with clear bottom (Catalogue number 781080) in 60 .mu.l medium at a density of 1500 cells per well. One day later, 2.5 .mu.l Ad-siRNA virus from each well of the SILENCESELECT.RTM. collection (WO 03/020931), stored in 384 well plates (estimated titer of 1.times.10.sup.9 viral particles per ml) is transferred with the aid of a 96/384 channel dispenser (Tecan Freedom 200 equipped with TeMO96, TeMO384 and RoMa, Tecan AG, Switzerland) to individual wells of the 384 well plates containing chondrocytes. The control plate is run under the same conditions as the aliquot plates from the SILENCESELECT.RTM. collection. All Ad-siRNA viruses are screened in duplicate on independent assay plates. After infection, plates are incubated at 37.degree. C. Seven days post infection the medium containing the adenoviruses is replaced by fresh medium. Thirteen days post infection, the amounts of col2.alpha.1 depositions per well is determined with the cELISA method. A typical result of a 384 well screening plate is depicted in FIG. 2.

[0177] The duplicate screen is repeated once. Ad-siRNA viruses are nominated as hits if at least 2 data points of the four tested (two times screened in duplicate) score above threshold. Threshold is set at average plus 2.5 times standard deviation of all data points per plate.

[0178] A total of 282 hits are isolated that scored above the threshold, representing 274 independent genes. A representative example is provided in FIG. 2, in which the "times standard deviation" of duplicate data points are indicated on the X-axis and Y-axis. The threshold (2.5 times standard deviation) is indicated by dotted lines. Negative values indicate data points that scored below average.

[0179] The results for some of the genes are shown in FIG. 3. A clear induction of the collagen II levels is observed upon infection of the Ad-siRNA targeting the indicated gene. The data are represented as relative light units (du) correlating to collagen II levels.

Example 3

Propagation of Hits

[0180] The 282 Ad-siRNA hits are subjected to further analysis to establish their therapeutic potential to induce chondrocyte anabolic stimulation. A first step entails a quality control on the Ad-siRNA selected for further analysis (this example). Next steps are the screening of the targets in other assays to validate their role in chondrocyte anabolic stimulation such as the induction of aggrecan, another main constituent of cartilage besides collagen II (Example 4), the ability to induce chondrocyte anabolic stimulation in chondrocytes from other donors (Example 5), the induction of a correct marker profile in three-dimensional chondrocyte cultures (example 11), the presence of posttranslational modifications on aggrecan (example 9) and collagen II (example 10) in three-dimensional chondrocyte cultures, the development of additional Ad-siRNAs targeting the identified transcripts (example 7), and confirmation that the corresponding genes are indeed expressed in residing chondrocytes (example 12).

[0181] To propagate the 282 hits of the chondrogenesis assay, 2.25.times.10.sup.4 PerC6.E2A cells are seeded in 200 .mu.l of DMEM containing 10% non-heat inactivated FCS into each well of a 96 well plate and incubated overnight at 39.degree. C. in a humidified incubator at 10% CO.sub.2. Subsequently, 1 l of crude lysate from the siRNA adenovirus stocks in matrix tubes is added and incubation proceeds at 34.degree. C. in a humidified incubator at 10% CO.sub.2 for 7 days. All hits are propagated in duplicate on two independent plates. The two lysates are pooled and aliquots are frozen at -20.degree. C.

[0182] The propagated Ad-siRNAs are re-screened at three MOI's in the chondrogenesis assay in duplicate (see Example 1). The Ad-siRNAs have to score at least once above threshold (average+2.5 times standard deviation) to pass this quality control step.

Example 4

Aggrecan Induction

[0183] A second assay to screen for chondrocyte anabolic factors is developed by monitoring the levels of aggrecan, another major constituent of cartilage. In this assay, glycosaminoglycans on aggrecan are stained by Alcian blue. NHACs are seeded in 384 well plates and 1 day after plating infected with individual Ad-siRNA from the SILENCESELECT.RTM. collection. Aggrecan deposition is determined at 14 days post infection. Using Ad-BMP2 as a positive control, we confirm in a series of experiments that several parameters optimized for the ColII cELISA assay are also applicable for the Alcian blue stain assay for aggrecan. These parameters include cell seeding density, MOIs of control viruses, duration of infection, and the day of readout.

[0184] NHAC's are seeded on day 0 at 1500 cells/well of a 384 well black-plate with clear bottom in 60 .mu.l of DMEM/F12, containing 10% FBS-HI and Pen/Strep and infected the next day with 2.5 .mu.l of Ad-BMP2 or Ad-eGFP; at an MOI of 2000. After 7 days, 10 .mu.l of a 50 .mu.g/ml 2-Phospho-L-ascorbic acid in assay culture medium is added to each well. Up-regulation of aggrecan is read at 10 dpi with Alcian blue staining. The medium is removed with a VacuSafe; 50 .mu.l ice-cold MeOH is added with a multidrop and removed immediately with a VacuSafe; 80 .mu.l of ice-cold MeOH is added with a multidrop to fixate the cells, and plates are incubated for 20 min at -20.degree. C.; MeOH is removed with a VacuSafe; plates are air dried for 20 min. After washing once with 80 .mu.l of PBS; 80 .mu.l of 0.05% Alcian blue stain buffer (0.05% Alcian blue, Sigma, catalog number S-2889; 0.4 M MgCl.sub.2/25 mM sodium acetate, pH5.5) is added and plates are incubated overnight at RT. The next day cells are washed subsequently in 80 .mu.l of 3% acetic acid, 25% ethanol/3% acetic acid, and 50% ethanol/3% acetic acid. Solutions are added with a multidrop and removed with a Vacusafe. After replacing 50% ethanol/3% acetic acid with 70% ethanol/3% acetic acid, each individual well is photographed with a SONY CCD camera, images are analyzed using a Galapagos Alcian blue quantification algorithm based on the separation of the blue signal through a color threshold procedure after a noise reduction filter. The amount of blue staining, which is proportional to aggrecan content, is expressed in pixel unit (see FIG. 4).

[0185] The propagated hits from Example 3 are used to transduce NHAc cells at three MOI's in duplicate in the chondrogenesis assay (see Example 1). The Ad-siRNAs have to score in duplicate in at least one MOI above threshold (average+2.5.times. standard deviation) to pass this secondary assay. In total, 101 out of 282 hits passed the Alcian blue assay for aggrecan (see Table 1). The results for some of the genes are shown in FIG. 5. Values represent the numerical output of the described algorithm and are correlated to Alcian blue staining levels. A clear induction of the aggrecan levels is observed upon infection of the Ad-siRNA targeting the indicated gene. The Ad-siRNA targeting FZD1 does not seem to induce Alcian blue staining.

TABLE-US-00004 TABLE 1 Overview of the 101 target sequences and their respective KD target sequences corresponding to the genes encoding the different polypeptides involved in chondrogenic differentiation. The GenBank numbers for the polypeptides and target gene symbols (general names) are also given. KD KD Target Hit Target Gene GenBank Sequence ID Sequence Symbol Accession Name Class SEQ ID NO H33- ATAAGCGGTTATC PCTK2 NM_002595 PCTAIRE protein Kinase 392 006 ACTGCC kinase 2 H33- GCTGGGATTCCA RYK SK340- RYK receptor-like Kinase 393 007 AGTGGAC NM_002958 tyrosine kinase H33- AACTGTGCAGGG NTRK1 NM_002529 neurotrophic Kinase 394 008 CCTCTCC tyrosine kinase, receptor, type 1 H33- GCTGCTGGATGTC CDK2 NM_052827- cyclin-dependent Kinase 395 009 ATTCAC NM_001798 kinase 2 H33- AGAGACACAGTG PCK1 NM_002591 phosphoenol- Kinase 396 010 CCCATCC pyruvate carboxy- kinase 1 (soluble) H33- ACTGAACCTCCG NFK4 SK256- NIMA (never in Kinase 397 011 AAATGCC NM_003157 mitosis gene a)- related kinase 4 H33- GTGCTGGAGTGCT MAPK NM_004635 mitogen-activated Kinase 398 013 TCCATC APK3 protein kinase- activated protein kinase 3 H33- TTCAGACCTACCT UMP- NM_016308 UMP-CMP kinase Kinase 399 020 TCAGTC CMPK H33- CCTGAATGTGACT DGKB- NM_020238- diacylglycerol Kinase 91 025 GTGGAC INCENP NM_004080- kinase, beta NM_145695 90 kDa/inner centromere protein antigens 135/155 kDa H33- GAGTCACACAGA ROCK1 NM_005406 Rho-associated, Kinase 400 027 GATGAGC coiled-coil containing protein kinase 1 H33- CGATGTGCCTTCA PRKCN SK489- protein kinase C, Kinase 401 028 AGATTC NM_005813 nu H33- CAGTGGTTTGGG PLK4- SK341- serine/threonine Kinase 402 031 AATCTGC STK18 NM_014264 kinase 18 (STK18)/ polo-like kinase 4 (Drosophila) H33- GACTGACTGGCCT ICK NM_016513- intestinal cell Kinase 92 032 GAAGGC NM_014920 (MAK-like) kinase H33- GATCTACACCACC GPR103 AF411117- G protein-coupled GPCR 101 034 TTCATC NM_198179 receptor 103 H33- GTGACTACACAA CCR2 NM_000647 chemokine (C-C GPCR 403 036 GGACTCC motif) receptor 2 H33- GACTGATTCGCTC FPRL2 NM_002030 formyl peptide GPCR 404 040 TTTGCC receptor-like 2 H33- GGTGTATGGGCTC FZD1 NM_003505 frizzled homolog GPCR 108 041 ATGTAC 1 (Drosophila) H33- AGTGCAGCCTTGT P2RY10 NM_198333- purinergic GPCR 405 042 GGGTTC NM_014499 receptor P2Y, G- protein coupled, 10 H33- TAACACTCACTGC EMR3 NM_152939- egf-like module GPCR 406 044 ACCTGC NM_032571 containing, mucin- like, hormone receptor-like 3 H33- TAACTGAAACTC PROZ NM_003891 protein Z, vitamin Protease 407 049 AGCTAGC K-dependent plasma glycoprotein H33- ACTGAAGTAGCC THRB NM_000461 thyroid hormone NHR 408 054 CTCCTTC receptor, beta (erythroblastic leukemia viral (v- erb-a) oncogene homolog 2, avian) H33- AGAACTGGGTGA ELA1 NM_001971 elastase 1, Protease 116 056 TGACAGC pancreatic H33- AGTGCAGTACAG COL7A1 NM_000094 collagen, type VII, Not 409 058 CGATGAC alpha 1 (epidermolysis classified bullosa, dystrophic, dominant and recessive) H33- TTCACATCGCTGA CPZ NM_003652 carboxypeptidase Z Protease 410 059 GCACCC CPZ NM_003652 carboxypeptidase Z mRNA sequence SEQ ID 479 Protein sequence SEQ ID 480 H33- ATGAACTCTGTGA USP9Y NM_004654 ubiquitin specific Protease 123 061 TCCAGC protease 9, Y- linked (fat facets- like, Drosophila) H33- AGCCAGCAACGA CST3 NM_000099 cystatin C (amyloid Not 411 063 CATGTAC angiopathy and classified cerebral hemorrhage) H33- GCTGCTGGGCAT LNPEP NM_005575 leucyl/cystinyl Protease 412 065 GTCCTTC aminopeptidase H33- TGTGATCGTCATC NLGN1 NM_014932 neuroligin 1 Enzyme 413 066 ACAGTC H33- AACATGATATGT KLK10 NM_145888- kallikrein 10 Protease 068 GCTGGAC NM_002776 H33- CTGAGAAGGCTT LOC119795 XM_061692 similar to glutamyl Protease 415 069 CCACTGC aminopeptidase (aminopeptidase A); gp160 H33- TGATACGTGGATC LOC124221- NM_178453 similar to distal Protease 416 070 CAGGCC MGC52282 intestinal serine protease H33- CTACAGTGACAA OVTN- XM_089945- (similar to) Protease 417 072 GGCTAAC LOC159938 NM_198185 oviductin protease H33- GAACTGGATAGC LOC206008- XM_116274- similar to Protease 418 073 CCTCATC RNF150 XM_371709 KIAA1214 protein/ ring finger protein 150 H33- CCCTGGTAAAGCT LOC220213 XM_166659 similar to Protease 419 074 GCATTC evidence: NAS~ hypothetical protein~putative H33- GATGAAGGCTTC XYLB NM_005108 xylulokinase Kinase 420 076 GGGCTTC homolog (H. influenzae) H33- TGTAAAGCTGGA PTEN NM_000314- putative protein Phosphatase 421 080 AAGGGAC BC038293- tyrosine AF017999 phosphatase homologue H33- CTGAAGAAGCTG PTPN23 NM_015466 protein tyrosine Phosphatase 422 081 GAGTTGC phosphatase, non- receptor type 23/ protein tyrosine phosphatase TD14 H33- TTGGAATTCCAGT DUSP11 NM_003584 dual specificity Phosphatase 132 082 GTACCC phosphatase 11 (RNA/RNP complex 1-interacting) H33- GCTAGTTATCGCC DUSP3 NM_004090 dual specificity Phosphatase 139 083 TACCTC phosphatase 3 (vaccinia virus phosphatase VH1- related) H33- TCCTTGCAGCAGG SLC24A1 NM_004727 solute carrier Ion 423 084 CACATC family 24 Channel (sodium/potassium/ calcium exchanger), member 1 H33- TCTGTGCGTGGAC GABRP NM_014211 gamma- Ion 424 092 TGGAAC aminobutyric acid Channel (GABA) A receptor, pi H33- CTTTGCTCGGAAG RAF1 NM_002880 v-raf-1 murine Kinase 425 095 ACGTTC leukemia viral oncogene homolog 1 H33- AGATTCCAGATG JAK1 SK185- Janus kinase 1 (a Kinase 148 096 CAACCCC NM_002227 protein tyrosine kinase) H33- GAAGGCTTTGGA LOC167359- XM_094437- hypothetical Kinase 426 098 AAGTGTC MGC42105 NM_153361 protein MGC42105 H33- GTGAACTCTGCTG PKD1L3- XM_091397- similar to GPCR 427 102 CGACTC LOC162163 NM_181536 KIAA1879 protein/ polycystic kidney disease 1-like 3 H33- GACAAGGCTATG RPS6KA3 NM_004586 ribosomal protein Kinase 428 104 ATGCTGC S6 kinase, 90 kDa, polypeptide 3 H33- GGATGTGTGGTG RBKS NM_022128 ribokinase Kinase 429 105 CTGTCAC H33- CTGAACTACTGGT ABCG1 NM_016818- ATP-binding Transporter 157 107 ACAGCC NM_004915 cassette, sub- family G (WHITE), member 1 H33- CTCTGTGTTCCAC DPYD NM_000110 dihydropyrimidine Enzyme 430 108 TTCGGC dehydrogenase H33- CAGCAATGCAGA TNFRSF9 NM_001561 tumor necrosis Other 431 110 GTGTGAC factor receptor drugable superfamily, or member 9 secreted H33- CAAAGCTGGCTA TNFSF14 NM_172014- tumor necrosis Other 432 114 CTACTAC NM_003807 factor (ligand) drugable superfamily, or member 14 secreted H33- CAGTGCAAAGAG GAPDS NM_014364 glyceraldehyde-3- Enzyme 433 117 CCCAAAC phosphate dehydrogenase, testis-specific H33- GTATTCTGTACAC RDH11 NM_016026 retinol Enzyme 434 118 CCTGGC dehydrogenase 11 (all-trans and 9- cis) H33- GTGATCGACAGG PRKAG3 NM_017431 protein kinase, Kinase 435 120 ATTGCTC AMP-activated, gamma 3 non- catalytic subunit H33- GCGAATTCCACC SLC26A8 NM_052961 solute carrier Transporter 165 130 AGCATTC family 26, member 8

H33- CACAGTGAAACC B4GALT5 NM_004776 UDP- Enzyme 436 138 TTCCTGC Gal: betaGlcNAc beta 1,4-galacto- syltransferase, polypeptide 5 H33- ATCTGTGACACTG LOC125836 XM_064820 similar to Aldose Enzyme 437 145 GATCGC Reductase (E.C. 1.1.1.21) H33- AGAGACTGGAGT GNPNAT1 NM_198066 glucosamine- Enzyme 438 147 TGTCAGC phosphate N- acetyltransferase 1 H33- CCTGAGTTGAATG CYP17A1 NM_000102 cytochrome P450, Cytochrome 439 152 TCATAC family 17, P450 subfamily A, polypeptide 1 H33- CTGAACTAGTGA MAGI-3 NM_152900- membrane- Kinase 440 158 CTATCCC NM_020965 associated guanylate kinase- related H33- ATAAGCACCGTG LOC138967 XM_071222 similar to Cytochrome 441 161 AGCGACC cytochrome P450 P450 1A1 H33- CATTGGGCCACA ADORA1 NM_000674 adenosine A1 GPCR 442 167 GACCTAC receptor H33- GATGAAGACAGC OPRK1 NM_000912 opioid receptor, GPCR 443 168 AACCAAC kappa 1 H33- AGCATATGATGA CTSC NM_148170- cathepsin C Protease 444 175 CCTTGGC NM_001814 H33- ATTCCACTACTAC H105E3 NM_015922 NAD (P) Enzyme 445 180 AGCTGC dependent steroid dehydrogenase- like H33- GAAACTGTGGCA LOC256519 XM_171056 similar to Putative Kinase 446 182 GGCTAAC serine/threonine- protein kinase D1044.3 in chromosome III H33- CTGATGAAGGCC LOC123326 XM_063593 similar to NADH- Enzyme 447 186 TTCGACC ubiquinone oxidoreductase PDSW subunit (Complex I- PDSW) (CI- PDSW) H33- TTGAAACAAGAG ACYP1 XM_370768- (similar to) Phosphatase 448 188 GAAGTCC NM_203488- acylphosphatase 1, NM_001107 erythrocyte (common) type H33- TGAACTTGCTCTG KCNJ14 NM_170720- potassium Ion 449 190 AGCTGC NM_013348 inwardly- Channel rectifying channel, subfamily J, member 14 H33- ATCTGTAACCTCA PPP3CC S46622- protein Phosphatase 450 191 GCACAC NM_005605 phosphatase 3 (formerly 2B), catalytic subunit, gamma isoform (calcineurin A gamma) H33- ACATTGACCAGG GGTLA4 NM_178312- gamma- Enzyme 178 192 AAGTGAC NM_178311- glutamyltransferase- NM_080920 like activity 4 H33- GAAGCTAAGCCT PIK4CA NM_058004 phosphatidylinositol Kinase 451 202 CGGTTAC 4-kinase, catalytic, alpha polypeptide H33- TAACCGTGGCATC TPP2 NM_003291 tripeptidyl Protease 452 204 TACCTC peptidase II H33- TGACCACCTGGA CST11 NM_130794 cystatin II Not 453 205 GTATCAC classified H33- GTGGACATCTTTG GRIK4 NM_014619 glutamate receptor, Ion 454 208 AGCTTC ionotropic, Channel kainate 4 H33- GCTGAGAAGTAC ARHGEF16 NM_014448 Rho guanine Other 455 209 TTCCACC exchange factor drugable (GEF) 16 or secreted H33- AGACTACTGCAA STK23 NM_014370 serine/threonine Kinase 456 210 GGGCGGC kinase 23 H33- GAGTATTTGCTGG SLCO1A2- XM_372282- solute carrier Protease 457 213 CATTCC CRLF2 NM_134431- organic anion NM_022148- transporter family, NM_021094 member 1A2/ cytokine receptor- like factor 2 H33- GAAGCTGAATTA PDE1A NM_005019 phosphodiesterase PDE 184 217 GGGCTTC 1A, calmodulin- dependent H33- GGAGACACGGAA PPP1R12B NM_032105- protein Phosphatase 458 219 TAAACTC NM_002481 phosphatase 1, regulatory (inhibitor) subunit 12B H33- CCGAGACCACCT ACAD8 NM_014384 acyl-Coenzyme A Enzyme 459 222 CAATGTC dehydrogenase family, member 8 H33- ATGGACATCTCCA PTPRN NM_002846 protein tyrosine Phosphatase 460 223 CGGGAC phosphatase, receptor type, N H33- TATCCTGACCTTC KCNG1 NM_172318- potassium voltage- Ion 461 230 CTGCGC NM_002237 gated channel, Channel subfamily G, member 1 H33- CACATGATCAAG LOC220763 XM_055551 similar to Heat Kinase 462 236 CTAGGTC shock protein HSP 90-beta (HSP 84) (HSP 90) H33- GAAGCCAGGCAT SPOCK2 NM_014767 sparc/osteonectin, Enzyme 463 237 CTTCATC cwcv and kazal- like domains proteoglycan (testican) 2 H33- GCTGAAGTTATCC PTPN13 NM_080685- protein tyrosine Phosphatase 464 238 AGTCTC NM_080684- phosphatase, non- NM_080683- receptor type 13 NM_006264 (APO-1/CD95 (Fas)-associated phosphatase) H33- AGCATTGGACCA GABRG1 NM_173536 gamma- Ion 465 239 GTTGATC aminobutyric acid Channel (GABA) A receptor, gamma 1 H33- GTGATCTACGTGA DPP3 NM_005700 dipeptidylpeptidase Protease 466 243 ACTGGC 3 H33- GCCGACAGTGGT LYPLA3 NM_012320 lysophospholipase Enzyme 467 245 GCACTAC 3 (lysosomal phospholipase A2) H33- AACATGATGGCT CTSE NM_148964- cathepsin E Protease 468 251 CAGAACC NM_001910 H33- TACAGTGATGGA SULT1B1 NM_014465 sulfotransferase Enzyme 469 253 TCATAGC family, cytosolic, 1B, member 1 H33- ACCAATATGCCTA KLKB1 NM_000892 kallikrein B, Protease 470 255 CCTTCC plasma (Fletcher factor) 1 H33- ACTGTATCCCAGC SENP7 NM_020654 sentrin/SUMO- Protease 471 258 AGTCCC specific protease H33- AAGCTGAACATA PTPRR NM_002849 protein tyrosine Phosphatase 472 259 ACCTTGC phosphatase, receptor type, R H33- TTGAATAGCTCGG LOC169014 XM_095455 similar to Kinase 473 261 TGTCCC Mitogen-activated protein kinase 6 (Extracellular signal-regulated kinase 3) (ERK-3) (MAP kinase isoform p97) (p97-MAPK) H33- GTGGAAGGCAAG ABCD1- XM_372940- ATP-binding Transporter 474 263 ATCTTCC LOC388253- XM_370972- cassette, sub- LOC391403 NM_000033 family D (ALD), member 1/similar to Adrenoleukodystrophy protein (ALDP) H33- TGTATGGCTGGTC ABCA7 NM_033308- ATP-binding Transporter 475 264 GATCAC NM_019112 cassette, sub- family A (ABC1), member 7 H33- GCTGCGACAACTT GPR110 NM_153840 G protein-coupled GPCR 476 269 CTGTTC receptor 110 H33- GCCCACGGTCTTC ACPT NM_080791- acid phosphatase, Phosphatase 477 276 CACTAC NM_080789- testicular NM_033068 H33- GAAGCCATCTCC SLC15A2 NM_021082 solute carrier Transporter 192 279 GACAATC family 15 (H+/peptide transporter), member 2 H33- GACTGAATCAGG PPIH NM_006347 peptidyl prolyl Enzyme 478 295 CCTTCCC isomerase H (cyclophilin H)

Example 5

Donor Dependency

[0186] The 282 hits identified by the ColII cELISA assay are further subject to a donor dependency test to demonstrate that the induction of ColII production by a given hit is not restricted to a single donor. In addition to the 11-year-old donor (donor I) previously used, NHAC's from multiple donors with ages of 24 (donor II), 41 (donor III), and 50 (donor IV), are obtained after informed consent (Cambrex, Verviers, Belgium). Cells are seeded as described in Examples 1 and 3. The propagated Ad-siRNAs are used to transduce NHAc cells from these different donors at three MOI's in duplicate in the chondrogenesis assay (see Examples 1 and 3). The Ad-siRNAs have to score at least once above threshold (average+2.5 times standard deviation) to pass this donor dependency test.

[0187] Out of 101 hits that passed the Alcian blue assay for aggrecan, 97 score positive in Donor IV. Of the remaining 4, 1 score positive in Donor II. The other 3 did not score in the other donors tested. In addition, 40 of the 101 hits score positive in all three additional donors. These results demonstrate that 98 out of these 101 hits function in a non-donor-dependent manner. Exceptions are H33-145; H33-182; and H33-263 (see Table 1). Indicated in this Table 1 are the Target Gene Symbol, Gene Bank Accession Number, and drugability class of the genes that correspond to the target sequences. The results for some of the genes are shown in Table 2. These data show that knocking down the RNA levels of the indicated genes induces collagen II levels in at least 2 donors. The values represent times standard deviation of the background.

TABLE-US-00005 TABLE 2 overview donor dependency data. N = 2 for every condition. All data points are represented as fold standard deviation of the background. All values above 2.5 are considered to be positive and are shaded grey. ##STR00001## ##STR00002## ##STR00003## ##STR00004## ##STR00005## ##STR00006##

Example 6

Quality Control of Target Ad-siRNAs

[0188] Target Ad-siRNAs are propagated using derivatives of PER.C6.COPYRGT. cells (Crucell, Leiden, The Netherlands) at a 96-well plate level, followed by re-screening these viruses at several MOI's in the primary assay (see Example 1) and by sequencing the siRNAs encoded by the target Ad-siRNA viruses. PER.E2A cells are seeded in 96 well plates at a density of 40,000 cells per well in 180 .mu.l PER.E2A medium. Cells are then incubated overnight at 39.degree. C. in a 10% CO.sub.2 humidified incubator. One day later, cells are infected with 1 .mu.l of crude cell lysate from SILENCESELECT.RTM. stocks containing target Ad-siRNAs. Cells are incubated further at 34.degree. C., 10% CO.sub.2 until appearance of cytopathic effect (as revealed by the swelling and rounding up of the cells, typically 7 days post infection). The supernatant is collected and the virus crude lysate is treated with proteinase K: 12 .mu.l crude lysate is added to 4 .mu.l Lysis buffer (1.times. Expand High Fidelity buffer with MgCl.sub.2 (Roche Molecular Biochemicals, Cat. No 1332465) supplemented with 1 mg/ml proteinase K (Roche Molecular Biochemicals, Cat No 745 723) and 0.45% Tween-20 (Roche Molecular Biochemicals, Cat No 1335465) in sterile PCR tubes. These are incubated at 55.degree. C. for 2 h followed by a 15 min inactivation step at 95.degree. C. For the PCR reaction, 1 .mu.l lysate is added to a PCR master mix composed of 5 .mu.l 10.times. Expand High Fidelity buffer with MgCl.sub.2, 0.5 .mu.l of dNTP mix (10 mM for each dNTP), 1 .mu.l of `Forward primer` (10 mM stock, sequence: 5' CCG TTT ACG TGG AGA CTC GCC, SEQ ID NO: 29), 1 .mu.l of `Reverse Primer` (10 mM stock, sequence: 5' CCC CCA CCT TAT ATA TAT TCT TTC C, SEQ ID NO: 30), 0.2 .mu.l of Expand High Fidelity DNA polymerase (3.5 U/.mu.l, Roche Molecular Biochemicals) and 41.3 .mu.l of H.sub.2O. PCR is performed in a PE Biosystems GeneAmp PCR system 9700 as follows: the PCR mixture (50 .mu.l in total) is incubated at 95.degree. C. for 5 min; each cycle runs at 95.degree. C. for 15 sec, 55.degree. C. for 30 sec, 68.degree. C. for 4 min, and is repeated for 35 cycles. A final incubation at 68.degree. C. is performed for 7 min. 5 .mu.l of the PCR mixture is mixed with 2 .mu.l of 6.times. gel loading buffer, loaded on a 0.8% agarose gel containing 0.5 .mu.g/.mu.l ethidium bromide to resolve the amplification products. The size of the amplified fragments is estimated from a standard DNA ladder loaded on the same gel. The expected size is .about.500 bp. For sequencing analysis, the siRNA constructs expressed by the target adenoviruses are amplified by PCR using primers complementary to vector sequences flanking the SapI site of the pIPspAdapt6-U6 plasmid. The sequence of the PCR fragments is determined and compared with the expected sequence. All sequences are found to be identical to the expected sequence.

Example 7

Evaluation of the on Target Effect of the Identified siRNA Sequences

[0189] To evaluate whether the identified siRNA sequences really increase collagen II and aggrecan levels through the knock down of the target mRNA, a second siRNA sequence is identified that exerts the same effect.

[0190] A number of additional siRNA sequences targeting the HIT sequences are designed and incorporated in adenoviruses according to WO 03/020931. After production of these adenoviruses, the Ad-siRNAs are infected at different volumes (1.5 l, 5 l and 15 l) in the chondrocytes and their effect on collagen II is assessed as described in example 1. The threshold (average+2.5 standard deviation) is calculated for every volume. If a virus scores above the threshold for one or more of the different infection volumes, it is considered to be positive. The on target results are shown in FIG. 6. These results indicate that at least one additional siRNA, which targets the HIT sequence, can be identified. This underscores the on target effect of the siRNA sequences identified during the screening of the Silence Select library.

Example 8

Development of a Three-Dimensional-Alginate Culture System for a Quantitative Marker Analysis for Stable Cartilage and the Assessment of Glycosaminoglycans (GAG) and Hydroxyprolines (Hyp) Synthesis

Principle of the Assay:

[0191] Normal human articular chondrocytes (NHAC's) grown in three-dimensional cultures are able to maintain a "differentiated state" as measured by the expression of Collagen type II and aggrecan. De-differentiated chondrocytes cultured in a two-dimensional system for a limited amount of passages can revert to a differentiated state when transferred into a three-dimensional culture system. This system was established to test the capability of siRNA adenoviruses (Ad-siRNA) 1) to induce a mRNA expression pattern that correlates with anabolic active chondrocytes and 2) to induce protein modification of collagen type II (hydroxyprolines) and aggrecan (glycosaminoglycans) involved in the stability of cartilage. Normal cartilage NHAC's are cultured in a two-dimensional culture system for two or three passages for cell expansion purposes. Cells are transduced with individual siRNA adenoviruses (Ad-siRNA) in the two-dimensional culture system and three days later are transferred into the three-dimensional alginate culture system. After 10 days in the alginate culture, various parameters can be assessed (e.g. mRNA marker analysis and protein modifications).

Assay Procedure

[0192] Using Ad-BMP2 (BMP2: "strong" collagen II inducer) and Ad-BMP7 (BMP7: "weak" collagen II inducer) as positive controls and Ad-ALPL as negative control the following protocol is set up (for both mRNA marker analysis and protein modification assessment): After two or three passages in monolayer culture conditions NHAC's are seeded at 2.10E+06 cells/T175 flask in 30 ml of chondrocyte growing medium (Cambrex) and transduced the following day with control-viruses (Ad-BMP2, Ad-BMP4, Ad-BMP7, Ad-ALPL) using an MOI of 2000. After three days, cells are trypsinised using the chondrocyte reagent pack (Cambrex) and washed once with 155 mM sodium chloride/20 mM Hepes ph 7.4 (Cambrex). Cells are re-suspended at a density of 2.times.10.sup.6 cells/ml in 1.2% sodium alginate (Cambrex). The cell suspension is transferred into a syringe attached to a 21-22 gauge needle and expelled in a drop-wise fashion into 102 mM calcium chloride/5 mM Hepes pH 7.4 (1 ml and 5 ml respectively in 24-well and 6-well plate) Five and 50 beads per well are produced respectively in the 24-well and 6-well plates. Plates containing the alginate beads are incubated for 10 minutes with gentle shaking every 2 minutes. The calcium chloride solution is aspirated with a Vacusafe system and beads are washed three times with the sodium chloride solution using the Vacusafe and once with DMEMF/12 supplemented with 10% heat inactivated fetal bovine serum (FBS-HI) and 1% penicillin/streptomycin. Alginate beads are finally re-suspended into 0.5 ml and 3 ml (respectively in 24-well and 6-well plate) of DMEMF/12 supplemented with 10% heat inactivated fetal calf serum (FBS-HI), 1% penicillin/streptomycin and 25 .mu.g/ml of ascorbic acid (Fluka, Sigm101-128 and 401-5941drich). The alginate cultures are incubated in a humidified incubator at 37.degree. C. and 5% CO2 during 10 days with a medium refreshment every 48/72 h.

[0193] For each adenoviral transduction, 60 alginate beads are generated: 2.times.5 beads were cultured in 24-well plates for the GAGs/Hyps assessments and 50 beads are cultured in a single well of a 6-well plate for the mRNA expression pattern determination.

Control Viruses

[0194] Ad-BMP2; described in WO 03/018799 Ad-BMP7; Ad5 dE1/E2A adenoviruses that mediate the expression of full length bone morphogenetic protein 7 pre-protein (NP.sub.--001710). Ad-BMP4; Ad5 dE1/E2A adenoviruses that mediate the expression of full length bone morphogenetic protein 4 pre-protein (see NP.sub.--570912). Ad-ALPL; Ad5 dE1/E2A adenoviruses that mediate the expression of full length liver/bone/kidney alkaline phosphatase (NP.sub.--000469).

Example 9

Effect of Knock Down of Target Genes in Chondrocytes Embedded in Alginate Beads, on the Glycosaminoglycans (GAGs) Levels

[0195] Chondrocytes are infected and embedded in alginate beads according to example 8. After 10 days in culture the alginate beads are treated with papain in order to solubilise the glycosaminoglycans prior to quantification: Beads cultured in the 24-well plates are washed once with a 50 mM Phosphate buffer pH 6.5 and incubated for 3 to 4 h at 65.degree. C. with 250 .mu.l/well of the same buffer containing 2 mM EDTA, 2 mM L-cystein and 126 .mu.g/ml papain (Sigma). Complete digestion of the beads is assessed by microscopic observation. Papain digests are frozen at -20.degree. C. until glycosaminoglycans quantification is performed. The GAGs produced by the primary chondrocytes in the alginate culture system are measured using the Blyscan.TM. assay (Biocolor Ltd, Newtownabbey, Northern Ireland).

Principle of the Blyscan Assay

[0196] The Blyscan Assay is a quantitative dye-binding method for the analysis of sulfated GAGs. The dye label used in the assay is 1,9-dimethylmethylene blue employed under conditions that produce a specific label for the sulfated polysaccharides component of proteoglycans and/or the protein-free sulfated glycosaminoglycan chains. Aggrecan is the predomninant proteoglycan in articular cartilage, representing .+-.90% of the cartilage proteoglycans. It is composed of a central core protein attached to .+-.50 keratan sulfate and .+-.100 chondroitin sulfate chains known as GAGs required for the biological function and the stability of aggrecan.

Assay Description

[0197] The papain digests generated after culturing the chondrocytes for 10 days in alginate beads (Example 7) are diluted in water 1:100, 1:200 if cells were originally transduced with the positives controls and 1:50, 1:100 if transduced with the negative controls. This dilution step allows readout values within the standard range of the assay. The GAG standard provided by the manufacturer contains 100 .mu.g/ml of chondroitin 4-sulfate purified from bovine trachea. This standard is run in duplicate at four concentrations corresponding to 1, 2, 3 and 5 .mu.g of GAGs. Standard and controls are individually diluted in 100 .mu.l final volume in eppendorf tubes. One milliliter of the Blyscan Dye Reagent is added to each tube and incubated for 30 minutes at room temperature with continuous shaking. When formed, the GAG-dye complex becomes insoluble and is then separated from the remaining excess soluble unbound dye by centrifugation (10000.times.g for 10 minutes). Supernatant are discarded by inverting and careful draining of the tube contents. One milliliter of Blyscan Dissociation Reagent is added to each tube and incubated for one hour to one and a half hour with continuous shaking. This reagent brings the GAG-bound dye back into solution. The GAG content of the assayed samples is spectrophotometrically determined by the amount of dye recovered from the GAGs in the test sample. Two hundred microliters of the dissociation dye solutions are added to the wells of a 96-well plate and reading is performed on an automatic plate reader set at a dual wavelength (656 and 450 nm).

[0198] The GAGs concentrations measured in the Blyscan assay are normalized to DNA content by performing a fluorimetric Hoechst assay on the same papain digests. Hoechst 33342 dye reagent (Molecular Probes), a bisbenzimidasole dye that binds to adenine/thymine rich regions on DNA. Papain digests were diluted 1:1.7 and 1:3.3 in TE buffer, this dilution step allows readout values within the standard range of the assay. Purified calf thymus DNA (Sigm101-128 and 401-5941drich) is used as standard DNA: the initial stock solution (2 .mu.g/ml) is sequentially diluted in TE buffer in order to obtain the following concentration range: 1.5, 1.0, 0.75, 0.50, 0.2 .mu.g/ml. Standard and test samples are diluted in TE to a final volume of 100 .mu.l and added to a 96-well plate. One hundred microliters of Hoechst 33342 dye reagent are added to the wells, reading is performed on a multifunctional microplate reader (Fluostar Galaxy, BMG Labtechnologies GmbH) with an excitation wavelength set at 360 nm and an emission wavelength set at 440 nm.

[0199] When GAG concentrations are normalized to DNA content the resulting values expressed as the ratio GAG concentration (.mu.g/ml)/DNA concentration (.mu.g/ml) are used to calculate the assay window. This window is calculated as the ratio normalized GAG Ad-BMP2 (or Ad-BMP4)/normalized GAG Ad-ALPL.

[0200] The effect of the knock down of the 14 target genes on the GAG levels is assessed as described. The results are shown in FIG. 7. The results are expressed as fold induction of the GAG levels compared to the average of the normalized GAG values obtained for two negative control knock-down adenoviruses (Ad-PTGER4 and Ad-GRM7). Knock down of the mRNA of the respective genes results in an increase of the GAG levels.

Control Viruses

[0201] Ad-BMP2: described in WO 03/018799 Ad-BMP4: Ad5 dE1/E2A adenoviruses that mediate the expression of full length bone morphogenetic protein 4 pre-protein (see NP.sub.--570912). Ad-ALPL: Ad5 dE1/E2A adenoviruses that mediate the expression of full length liver/bone/kidney alkaline phosphatase (NP.sub.--000469). [0202] Ad-PTGER4: Ad5 dE1/E2A adenoviruses that comprise the siRNA sequence CCATGCCTATTTCTACAGC (SEQ ID NO: 31) to knock down the prostaglandin E receptor 4 mRNA. [0203] Ad-GRM7: Ad5 dE1/E2A adenoviruses that comprise the siRNA sequence TCAGTAACAGCTCCCAGAC (SEQ ID NO: 32) to knock down the metabotropic glutamate receptor 7 mRNA.

Example 10

Quantitative Analysis of Hydroxyprolines (Hyps)

[0204] In articular cartilage, approximately 95% of the collagen is type II collagen. Its polymers are the fibrils that form the basic cohesive framework of the tissue. The collagen biosynthesis involves several unique posttranslational modifications including hydroxylation of proline and lysine residues. These modifications are crucial for collagen stability and resistance to proteolytic enzymes.

[0205] Chondrocytes are infected and embedded in alginate beads according to example 8. After 10 days in culture the alginate beads are treated with papain: Beads cultured in the 24-well plates are washed once with a 50 mM Phosphate buffer pH 6.5 and incubated for 3 to 4 h at 65.degree. C. with 250 .mu.l/well of the same buffer containing 2 mM EDTA, 2 mM L-cystein and 126 .mu.g/ml papain (Sigma). Complete digestion of the beads is assessed by microscopic observation. Papain digests are frozen at -20.degree. C. until hydroxyproline quantification is performed.

[0206] Hydroxyproline asessment in the papain digests is performed by HPLC after acid hydrolysis and FMOC (9-fluorenylmethyl chloroformate) derivatisation of the samples. This method is described in "Bank R A, Jansen E J, Beekman B and Te Koppele J M. (1996) Amino acid analysis by reverse-phase high performance liquid chromatography: Improved derivatisation and detection conditions with 9-fluorenylmethyl chloroformate. Anal Biochem. 240 (2): 167-176.

[0207] The effect of the knock down of the 14 target genes on the hydroxyproline levels is assessed as described. The results are shown in FIG. 8. The results are expressed as fold induction compared to the average of Hyp concentrations measured for the two KD controls (Ad-PTGER4 and AD-GRM7). Knock down of the mRNA of the respective genes results in an increase of the hydroxyproline levels.

Control Viruses

[0208] Ad-BMP2; described in WO 03/018799 Ad-BMP4; Ad5 dE1/E2A adenoviruses that mediate the expression of full length bone morphogenetic protein 4 pre-protein (see NP.sub.--570912). Ad-ALPL: Ad5 dE1/E2A adenoviruses that mediate the expression of full length liver/bone/kidney alkaline phosphatase (NP.sub.--000469). Ad-PTGER4: Ad5 dE1/E2A adenoviruses that comprise the siRNA sequence CCATGCCTATTTCTACAGC (SEQ ID NO: 33) to knock down the prostaglandin E receptor 4 mRNA. Ad-GRM7: Ad5 dE1/E2A adenoviruses that comprise the siRNA sequence TCAGTAACAGCTCCCAGAC (SEQ ID NO: 34) to knock down the metabotropic glutamate receptor 7 mRNA.

Example 11

Quantitative Analysis of Markers for Stable Cartilage

Assay General Principle:

[0209] Chondrocyte phenotypes can be categorized by characteristic patterns of gene expression. Quantitative RT-PCR techniques are used to monitor the expression pattern of a set of key marker molecules to define which phenotype is induced on the chondrocytes. Positive markers included collagen type II and FGFR3, typically expressed by cartilage chondrocytes. Negative makers included (1) collagens types I and III for dedifferentiated or fibroblast-like chondrocytes, a phenotype that can also be induced by retinoic acid or interleukin-1; (2) collagen X, PTHLH and ALK-1 for hypertrophic chondrocytes that are found in the calcified zone of adult cartilage and the lower hypertrophic zone of the fetal growth-plate cartilage; and (3) MMP13 as proteolytic enzyme involved in cartilage degradation. Functional cartilage chondrocytes should express high levels of positive markers but low or not detectable levels of negative markers.

Assay Description

[0210] Chondrocytes are infected and embedded in alginate beads according to example 8. After 10 days in culture the alginate beads are treated with 55 mM sodium citrate (Cambrex) in order to recover the chondrocytes from the alginate beads and harvest RNA: Incubation medium was removed from the 6-well plates with the Vacusafe and 5 ml of 55 mM sodium citrate are added to each well and incubated for 15 minutes at room temperature. The partially solubilised beads are gently mixed and transferred to a FALCON tube, wells are rinsed once with 2 ml of sodium citrate solution to collect the remaining beads and released cells. Tubes are laid on their side and gently mixed every 2-3 minutes until beads have completely solubilised (+/-15 minutes). Tubes are centrifuged at 1000 rpm for 10 minutes. Supernatant is discarded and the cell pellet is re-suspended in 2 ml of sodium citrate solution and left for 5 minutes. Six milliliters of 155 mM sodium chloride/20 mM Hepes ph 7.4 (Cambrex) are added to each tube prior to a 5 minutes centrifugation at 210 g. Cell pellet is lysed in 180 .mu.l SV40 lysing buffer (Promega SV40 total RNA extraction kit) and frozen at -20.degree. C. until RNA isolation is performed with the Promega SV40 total RNA extraction kit according to the manufacturer's instructions. Purified RNA is quantified using ribogreen reagent (Molecular Probes) and yeast RNA (Ambion) as standard RNA.

[0211] Purified RNA from chondrocytes transduced with control adenoviruses and cultured for 10 days in the alginate 3-dimensional culture system is used in a reverse transcription (RT) reaction. RNA is first diluted in water (Life Technologies-Invitrogen, Breda, The Netherlands) depending on the initial concentration of the sample: For RNA concentration below 25 ng/ml, samples are used undiluted, for RNA concentration between 25 and 50 ng/ml samples are diluted 1:2.5, For RNA concentration between 50 and 100 ng/ml samples are diluted 1:5 and for RNA concentration between 100 and 160 ng/ml samples are diluted 1:10. Two microliters of diluted/undiluted RNA are added to 5 .mu.l of a reaction mix consisting of: 1.times. Taqman RT buffer, 5 mM MgCl2, 500 .mu.M dNTPs (2.5 mM each), 2.5 .mu.M Random hexamers, 0.4 U/.mu.l of RNAse inhibitor and 1.25 U/.mu.l of MultiScribe Reverse Transcriptase (all reagents purchased from Applied Biosystems). The PCR reaction is performed in a Peltier Thermal Cycler-200 (BIOzym, Landgraaf, The Netherlands) as followed: the PCR total mixture (60 .mu.l) is incubated 10 minutes at 25.degree. C. followed by 30 minutes at 48.degree. C., followed by 5 minutes at 95.degree. C. Each reaction is run in parallel with a control that does not contain any RNAse inhibitor or Reverse Transcriptase.

[0212] Reverse transcription is followed by a quantitative PCR for specific amplification of the selected positive and negative marker genes, GAPDH is included as the endogenous control. Five microliters of cDNA (from RT reaction) are added to 20 .mu.l of a PCR reaction mix consisting of: 1.times. Brilliant.RTM. SYBR.RTM. Green QPCR Master Mix (Sratagene Europe, Amsterdam, The Netherlands), 300 .mu.M of each forward and reverse primers (table 3) (except for GAPDH and ALK-1, used at 100 .mu.M) (Life Technologies-Invitrogen, Breda, The Netherlands) and 300 nM of reference dye (Stratagene) (diluted 1:100 in H2O). The PCR mixture (25 .mu.l) is incubated for 10 minutes at 95.degree. C. followed by 40 cycles: 15 seconds at 95.degree. C. followed by 1 minute at 60.degree. C. in the ABI PRISM.RTM. 7000 Sequence Detection System (Applied Biosystems, Nieuwerkerk A/D Ijssel, The Netherlands).

TABLE-US-00006 TABLE 3 primer sequences for the positive and negative markers: SEQ ID Primer Gene Primer sequence NO: Forward Collagen 2a1 GGCAATAGCAGGTTCACGTACA 35 L10347 Reverse Collagen 2a1 CGATAACAGTCTTGCCCCACTT 36 L10347 Forward FGFR3 NM_000142 ACGGCACACCCTACGTTACC 37 Reverse FGFR3 NM_000142 TGTGCAAGGAGAGAACCTCTAG 38 CT Forward BMP-2 NM_001200 CCAACACTGTGCGCAGCTT 39 Reverse BMP-2 NM_001200 AAGAATCTCCGGGTTGTTTTCC 40 Forward ALK-1 NM_000020 CAGTCTCATCCTGAAAGCATCT 41 GA Reverse ALK-1 NM_000020 TTTCCCACACACTCCACCAA 42 Forward collagen 10a1 TGGAGTGTTTTACGCTGAACGA 43 NM_000493 T Reverse collagen 10a1 CCTCTTACTGCTATACCTTTAC 44 NM_000493 TCTTTATGG Forward Collagen 1A1 TGCCATCAAAGTCTTCTGCAA 45 NM_000088 Reverse Collagen 1A1 CGCCATACTCGAACTGGAATC 46 NM_000088 Forward Collagen 3a1 CACTATTATTTTGGCACAACAG 47 NM_000090 GAA Reverse Collagen 3a1 AGACACATATTTGGCATGGTTC 48 NM_000090 TG Forward MMP13 NM_002427 CAAGGGATCCAGTCTCTCTATG 49 GT Reverse MMP13 NM_002427 GGATAAGGAAGGGTCACATTTG 50 TC Forward PTHLH NM_002820 GCTCGGTGGAGGGTCTCA 51 Reverse PTHLH NM_002820 CTGTGTGGATTTCTGCGATCA 52 Forward GAPDH NM_002046 CATCCATGACAACTTTGGTATCG 53 Reverse GAPDH NM_002046 AGTCTTCTGGGTGGCAGTGAT 54

[0213] Results are expressed for each tested marker gene as the relative expression in the sample (transduction with tested adenovirus) versus control (knock-down control adenoviruses) (Relative expression=2.sup.ddCt, where ddCt=dCt.sub.KD sample-dCt.sub.KD control and dCt=Ct.sub.sample-Ct.sub.GAPDH). The results for the 14 genes are shown in FIG. 9. The knock down of the mRNA of the respective genes results in expression of the positive markers, while the levels of the negative markers are either low or not detectable.

Control Viruses

[0214] Ad-BMP2; described in WO 03/018799 Ad-ALPL: Ad5 dE1/E2A adenoviruses that mediate the expression of full length liver/bone/kidney alkaline phosphatase (NP.sub.--000469).

Example 12

Expression of cDNA's in Human Cartilage

[0215] Upon identification of a modulator of cartilage synthesis, it is of the highest importance to evaluate whether the modulator is expressed in the tissue and the cells of interest. This can be achieved by measuring the RNA and/or protein levels. In recent years, RNA levels are being quantified through real time PCR technologies, whereby the RNA is first transcribed to cDNA and then the amplification of the cDNA of interest is monitored during a quantitative PCR reaction. The amplification plot and the resulting Ct value are indicators for the amount of a specific RNA transcript present in the sample. Ct values are determined in the presence or absence of the reverse transcriptase step (+RT versus -RT). An amplification signal in the -RT condition indicates the occurrence of non-specific PCR products originating from the genomic DNA. If the +RT Ct value is 3 Ct values higher than the -RT Ct value, then the investigated RNA is present in the sample.

[0216] To assess whether the polypeptides of the genes identified in the above assays are expressed in human cartilage, real time PCR with specific primers for the polynucleotides ("Assay on Demand" Applied Biosystems) is performed on human cartilage total RNA (Clinomics Biosciences). 2 samples of non-osteoarthritis and 2 of osteoarthritis patients are analyzed.

[0217] In short, 40 ng of RNA is transcribed to DNA using the MultiScribe Reverse Transcriptase (50 U/.mu.l) enzyme (Applied BioSystems). The resulting cDNA is amplified with AmpliTaq Gold DNA polymerase (Applied BioSystems) during 40 cycles using an ABI PRISM.RTM. 7000 Sequence Detection System. Amplification of the transcript is detected via SybrGreen which results in a fluorescent signal upon intercalation in double stranded DNA.

[0218] Total RNA isolated from human cartilage is analyzed for the presence of transcripts listed in Table 4 via quantitative real time PCR.

[0219] For the genes listed in Table 4 the obtained Ct values indicate that they are detected in all RNA samples. ELA1 RNA is not detected in the real time PCR analysis, underscoring the need for additional patient analysis.

TABLE-US-00007 TABLE 4 Ct values Normal Cartilage OA Cartilage TARGET Ct Sample 1 Ct Sample 2 Ct Sample 1 Ct Sample 2 PDE1A 30.8 28.5 30.7 30.2 GPR103 33.1 33.3 38.4 37.4 JAK1 26.2 24.1 27 26 ICK 36.3 33.8 36.1 35.5 DGKB 28.5 26.7 29.7 28.7 DUSP3 27.1 24.2 27 27.1 DUSP11 28.8 27.5 29.9 29.2 SLC26A8 36.13 34.04 37.12 37.22 SLC15A2 32.5 28.1 34.7 32.9 ABCG1 29.7 28 31.1 29.5 FZD1 28.1 25.4 34.1 27.1 ELA1 40 40 40 39.1

Example 13

Identification of Small Molecules that Inhibit TARGET Kinase Activity

[0220] Compounds are screened for inhibition of the activity of the TARGETS that are kinase polypeptides. The affinity of the compounds to the polypeptides is determined in an experiment detecting changed reaction conditions after phosphorylation. The TARGET kinase polypeptides are incubated with its substrate and ATP in an appropriate buffer. The combination of these components results in the in vitro phosphorylation of the substrate. Sources of compounds include commercially available screening library, peptides in a phage display library or an antibody fragment library, and compounds that have been demonstrated to have binding affinity for a TARGET kinase.

[0221] The TARGET kinase polypeptides can be prepared in a number of ways depending on whether the assay will be run using cells, cell fractions or biochemically, on purified proteins. The polypeptides can be applied as complete polypeptides or as polypeptide fragments, which still comprise TARGET kinase catalytic activity.

[0222] Identification of small molecules inhibiting the activity of the TARGET kinase polypeptides is performed by measuring changes in levels of phosphorylated substrate or ATP. Since ATP is consumed during the phosphorylation of the substrate, its levels correlate with the kinase activity. Measuring ATP levels via chemiluminescent reactions therefore represents a method to measure kinase activity in vitro (Perkin Elmer). In a second type of assay, changes in the levels of phosphorylated substrate are detected with phosphospecific agents and are correlated to kinase activity. These levels are detected in solution or after immobilization of the substrate on a microtiter plate or other carrier. In solution, the phosphorylated substrate is detected via fluorescence resonance energy transfer (FRET) between the Eu labeled substrate and an APC labeled phosphospecific antibody (Perkin Elmer), via fluorescence polarization (FP) after binding of a phosphospecific antibody to the fluorescently labeled phosphorylated substrate (Panvera), via an Amplified Luminescent Proximity Homogeneous Assay (ALPHA) using the phosphorylated substrate and phosphospecific antibody, both coupled to ALPHA beads (Perkin Elmer) or using the IMAP binding reagent that specifically detects phosphate groups and thus alleviates the use of the phosphospecific antibody (Molecular Devices). Alternatively, the substrate is immobilized directly or by using biotin-streptavidin on a microtiter plate. After immobilization, the level of phosphorylated substrate is detected using a classical ELISA where binding of the phosphospecific antibody is either monitored via an enzyme such as horseradish peroxidase (HRP) or alkaline phospahtase (AP) which are either directly coupled to the phosphospecific antibody or are coupled to a secondary antibody. Enzymatic activity correlates to phosphorylated substrate levels. Alternatively, binding of the Eu-labeled phosphospecific antibody to the immobilized phosphorylated substrate is determined via time resolved fluorescence energy (TRF) (Perkin Elmer). In addition, the substrate can be coated on FLASH plates (Perkin Elmer) and phosphorylation of the substrate is detected using .sup.33P labeled ATP or .sup.125I labeled phosphospecific antibody.

[0223] Small molecules are randomly screened or are preselected based upon drug class, (i.e. known kinase inhibitors), or upon virtual ligand screening (VLS) results. VLS uses virtual docking technology to test large numbers of small molecules in silico for their binding to the polypeptide of the invention. Small molecules are added to the kinase reaction and their effect on levels of phosphorylated substrate is measured with one or more of the above-described technologies.

[0224] Small molecules that inhibit the kinase activity are identified and are subsequently tested at different concentrations. IC.sub.50 values are calculated from these dose response curves. Strong binders have an IC.sub.50 in the nanomolar and even picomolar range. Compounds that have an IC.sub.50 of at least 10 micromol or better (nmol to pmol) are applied in collagen II assay to check for their effect on the induction of chondrocyte anabolic stimulation.

Example 14

Ligand Screens for TARGET GPCRs

Example 14 A

Reporter Gene Screen

[0225] Mammalian cells such as Hek293 or CHO-K1 cells are either stably transfected with a plasmid harboring the luciferase gene under the control of a cAMP dependent promoter (CRE elements) or transduced with an adenovirus harboring a luciferase gene under the control of a cAMP dependent promoter. In addition reporter constructs can be used with the luciferase gene under the control of a Ca.sup.2+ dependent promoter (NF-AT elements) or a promoter that is controlled by activated NF-.kappa.B. These cells, expressing the reporter construct, are then transduced with an adenovirus harboring the cDNA of a TARGET GPCR. Forty (40) hours after transduction the cells are treated with the following:

[0226] a) an agonist for the receptor and screened against a large collection of reference compounds comprising peptides (LOPAP, Sigma Aldrich), lipids (Biomol, TimTech), carbohydrates (Specs), natural compounds (Specs, TimTech), small chemical compounds (Tocris), commercially available screening libraries, and compounds that have been demonstrated to have binding affinity for a polypeptide comprising an amino acid sequence selected from the group consisting of the SEQ ID NOs of the TARGET GPCRs; or

[0227] b) a large collection of reference compounds comprising peptides (LOPAP, Sigma Aldrich), lipids (Biomol, TimTech), carbohydrates (Specs), natural compounds (Specs, TimTech), small chemical compounds (Tocris), commercially available screening libraries, and compounds that have been demonstrated to have binding affinity for a polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NOs of the TARGET GPCRs.

[0228] Compounds, which decrease the agonist induced increase in luciferase activity or the constitutive activity, are considered to be antagonists or inverse agonists for a TARGET GPCR. These compounds are screened again for verification and screened against their effect on anabolic stimulation of chondrocytes. The compounds are also screened to verify binding to the GPCR. The binding and reporter activity assays can be performed in essentially any order to screen compounds.

[0229] In addition, cells expressing the NF-AT reporter gene can be transduced with an adenovirus harboring the cDNA encoding the .alpha.-subunit of G.sub.15 or chimerical G.alpha. subunits. G.sub.15 is a promiscuous G protein of the G.sub.q class that couples to many different GPCRs and as such re-directs their signaling towards the release of intracellular Ca.sup.2+ stores. The chimerical G alpha subunits are members of the G.sub.s and G.sub.i/o family by which the last 5 C-terminal residues are replaced by those of G.sub..alpha.q, these chimerical G-proteins also redirect cAMP signaling to Ca.sup.2+ signaling.

Example 14 B

FLIPR Screen

[0230] Mammalian cells such as Hek293 or CHO-K1 cells are stably transfected with an expression plasmid construct harboring the cDNA of a TARGET GPCR. Cells are seeded, grown, and selected until sufficient stable cells can be obtained. Cells are loaded with a Ca.sup.2+ dependent fluorophore such as Fura3 or Fura4. After washing away the excess of fluorophore the cells are screened against a large collection of reference compounds comprising peptides (LOPAP, Sigma Aldrich), lipids (Biomol, TimTech), carbohydrates (Specs), natural compounds (Specs, TimTech), small chemical compounds (Tocris), commercially available screening libraries, and compounds that have been demonstrated to have binding affinity for a polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NOs of the TARGET GPCRs, by simultaneously adding an agonist (alternatively no agonist need be added if the constitutive activity of the receptor is used) and a compound to the cells. Activation of the receptor is measured as an almost instantaneously increase in fluorescence due to the interaction of the fluorophore and the Ca.sup.2+ that is released. Compounds that reduce or inhibit the agonist induced increase in fluorescence (or constitutive fluorescence) are considered to be antagonists or inverse agonists for the receptor they are screened against. These compounds are screened again to measure the amount of anabolic stimulation of chondrocytes as well as binding to a TARGET GPCR.

Example 14 C

AequoScreen

[0231] CHO cells, stably expressing Apoaequorin are stably transfected with a plasmid construct harboring the cDNA of a TARGET GPCR. Cells are seeded, grown, and selected until sufficient stable cells can be obtained. The cells are loaded with coelenterazine, a cofactor for apoaequorin. Upon receptor activation intracellular Ca.sup.2+ stores are emptied and the aequorin will react with the coelenterazine in a light emitting process. The emitted light is a measure for receptor activation. The CHO, stable expressing both the apoaequorin and the receptor are screened against a large collection of reference compounds comprising peptides (LOPAP, Sigma Aldrich), lipids (Biomol, TimTech), carbohydrates (Specs), natural compounds (Specs, TimTech), small chemical compounds (Tocris), commercially available screening libraries, and compounds that have been demonstrated to have binding affinity for a polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NOs of the TARGET GPCRs, by simultaneously adding an agonist (alternatively no agonist need be added if the constitutive activity of the receptor is used) and a compound to the cells. Activation of the receptor is measured as an almost instantaneously light flash due to the interaction of the apoaequorin, coelenterazine, and the Ca.sup.2+ that is released. Compounds that reduce or inhibit the agonist induced increase in light or the constitutive activity are considered to be antagonists or inverse agonists for the receptor they are screened against. These compounds are screened again to measure the amount of anabolic stimulation of chondrocytes as well as binding to a TARGET GPCR.

[0232] In addition, CHO cells stable expressing the apoaequorin gene are stably transfected with a plasmid construct harboring the cDNA encoding the .alpha.-subunit of G.sub.15 or chimerical G.sub..alpha. subunits. G.sub.15 is a promiscuous G protein of the G.sub.q class that couples to many different GPCRs and as such redirects their signaling towards the release of intracellular Ca.sup.2+ stores. The chimerical G alpha subunits are members of the G.sub.s and G.sub.i/o family by which the last 5 C-terminal residues are replaced by those of G.sub..alpha.q, these chimerical G-proteins also redirect cAMP signaling to Ca.sup.2+ signaling.

Example 14 D

Screening for Compounds that Bind to the GPCR Polypeptides (Displacement Experiment)

[0233] Compounds are screened for binding to the TARGET GPCR polypeptides. The affinity of the compounds to the polypeptides is determined in a displacement experiment. In brief, the GPCR polypeptides are incubated with a labeled (radiolabeled, fluorescent labeled) ligand that is known to bind to the polypeptide and with an unlabeled compound. The displacement of the labeled ligand from the polypeptide is determined by measuring the amount of labeled ligand that is still associated with the polypeptide. The amount associated with the polypeptide is plotted against the concentration of the compound to calculate IC.sub.50 values. This value reflects the binding affinity of the compound to its TARGET, i.e. the TARGET GPCR polypeptides. Strong binders have an IC.sub.50 in the nanomolar and even picomolar range. Compounds that have an IC.sub.50 of at least 10 micromol or better (nmol to pmol) are applied an anabolic stimulation of chondrocytes assay to check for their effect on osteogenesis. The TARGET GPCR polypeptides can be prepared in a number of ways depending on whether the assay are run on cells, cell fractions or biochemically, on purified proteins.

Example 14 E

Screening for Compounds that Bind to a Target GPCR (Generic GPCR Screening Assay)

[0234] When a G protein receptor becomes constitutively active, it binds to a G protein (G.sub.q, G.sub.s, G.sub.i, G.sub.o) and stimulates the binding of GTP to the G protein. The G protein then acts as a GTPase and slowly hydrolyses the GTP to GDP, whereby the receptor, under normal conditions, becomes deactivated. However, constitutively activated receptors continue to exchange GDP to GTP. A non-hydrolyzable analog of GTP, [.sup.35S]GTP.gamma.S, can be used to monitor enhanced binding to membranes which express constitutively activated receptors. It is reported that [.sup.35S]GTP.gamma.S can be used to monitor G protein coupling to membranes in the absence and presence of ligand. Moreover, a preferred approach is the use of a GPCR-G protein fusion protein. The strategy to generate a TARGET GPCR-G protein fusion protein is well known for those known in the art. Membranes expressing TARGET GPCR-G protein fusion protein are prepared for use in the direct identification of candidate compounds such as inverse agonist. Homogenized membranes with TARGET GPCR-G protein fusion protein are transferred in a 96-well plate. A pin-tool is used to transfer a candidate compound in each well plus [.sup.35S]GTP.gamma.S, followed by incubation on a shaker for 60 minutes at room temperature. The assay is stopped by spinning of the plates at 4000 RPM for 15 minutes at 22.degree. C. The plates are then aspirated and radioactivity is then read.

Example 14 F

Receptor Ligand Binding Study on Cell Surface

[0235] The receptor is expressed in mammalian cells (Hek293, CHO, COS7) by adenoviral transducing the cells (see U.S. Pat. No. 6,340,595). The cells are incubated with both labeled ligand (iodinated, tritiated, or fluorescent) and the unlabeled compound at various concentrations, ranging from 10 pM to 10 .mu.M (3 hours at 4.degree. C.: 25 mM HEPES, 140 mM NaCl, 1 mM CaCl.sub.2, 5 mM MgCl.sub.2 and 0.2% BSA, adjusted to pH 7.4). Reactions mixtures are aspirated onto PEI-treated GF/B glass filters using a cell harvester (Packard). The filters are washed twice with ice cold wash buffer (25 mM HEPES, 500 mM NaCl, 1 mM CaCl.sub.2, 5 mM MgCl.sub.2, adjusted to pH 7.4). Scintillant (MicroScint-10; 35 .mu.l) is added to dried filters and the filters counted in a (Packard Topcount) scintillation counter. Data are analyzed and plotted using Prism software (GraphPad Software, San Diego, Calif.). Competition curves are analyzed and IC.sub.50 values calculated. If one or more data points do not fall within the sigmoidal range of the competition curve or close to the sigmoidal range the assay is repeated and concentrations of labeled ligand and unlabeled compound adapted to have more data points close to or in the sigmoidal range of the curve.

Example 14 G

Receptor Ligand Binding Studies on Membrane Preparations

[0236] Membranes preparations are isolated from mammalian cells (Hek293, CHO, COS7) cells over expressing the receptor is done as follows: Medium is aspirated from the transduced cells and cells are harvested in 1.times.PBS by gentle scraping. Cells are pelleted (2500 rpm 5 min) and resuspended in 50 mM Tris pH 7.4 (10.times.10.sup.6 cells/ml). The cell pellet is homogenized by sonicating 3.times.5 sec (UP50H; sonotrode MS1; max amplitude: 140 .mu.m; max Sonic Power Thickness: 125 W/cm.sup.2). Membrane fractions are prepared by centrifuging 20 min at maximal speed (13,000 rpm.about.15,000 to 20,000 g or rcf). The resulting pellet is resuspended in 500 .mu.l 50 mM Tris pH 7.4 and sonicated again for 3.times.5 sec. The membrane fraction is isolated by centrifugation and finally resuspended in PBS. Binding competition and derivation of IC.sub.50 values are determined as described above.

Example 14 H

Internalization Screen (1)

[0237] Activation of a GPCR-associated signal transduction pathway commonly leads to translocation of specific signal transduction molecules from the cytoplasm to the plasma membrane or from the cytoplasm to the nucleus. Norak has developed their transfluor assay based on agonist-induced translocation of receptor-.beta.-arrestin-GFP complex from the cytosol to the plasma membrane and subsequent internalization of this complex, which occurs during receptor desensitization. A similar assay uses GFP tagged receptor instead of .beta.-arrestin. Hek293 cells are transduced with a TARGET GPCR vector that translates for a TARGET GPCR-eGFP fusion protein. 48 hours after transduction, the cells are set to fresh serum-free medium for 60 minutes and treated with a ligand for 15, 30, 60 or 120 minutes at 37.degree. C. and 5% CO.sub.2. After indicated exposure times, cells are washed with PBS and fixed with 5% paraformaldehyde for 20 minutes at RT. GFP fluorescence is visualized with a Zeiss microscope with a digital camera. This method aims for the identification of compounds that inhibit a ligand-mediated (constitutive activity-mediated) translocation of the fusion protein to intracellular compartments.

Example 14 I

Internalization Screen (2)

[0238] Various variations on translocation assays exists using .beta.-arrestin and .beta.-galactosidase enzyme complementation and BRET based assays with receptor as energy donor and .beta.-arrestin as energy acceptor. Also the use of specific receptor antibodies labeled with pH sensitive dyes are used to detect agonist induced receptor translocation to acidic lysosomes. All of the translocation assays are used for screening for both agonistic and antagonistic acting ligands.

Example 14 J

Melanophore Assay (Arena Pharmaceutical)

[0239] The melanophore assay is based on the ability of GPCRs to alter the distribution of melanin containing melanosomes in Xenopus melanophores. The distribution of the melanosomes depends on the exogenous receptor that is either G.sub.i/o or G.sub.s/q coupled. The distribution of the melanosomes (dispersed or aggregated) is easily detected by measuring light absorption. This type of assay is used for both agonist as well as antagonist compound screens.

Example 15

Identification of Small Molecules that Inhibit Protease Activity

[0240] Compounds are screened for inhibition of the activity of the polypeptides of the present invention. The affinity of the compounds to the polypeptides is determined in an experiment detecting changes in levels of cleaved substrate. In brief, the polypeptides of the present invention are incubated with its substrate in an appropriate buffer. The combination of these components results in the cleavage of the substrate.

[0241] The polypeptides can be applied as complete polypeptides or as polypeptide fragments, which still comprise the catalytic activity of the polypeptide of the invention.

[0242] Cleavage of the substrate can be followed in several ways. In a first method, the substrate protein is heavily labeled with a fluorescent dye, like fluorescein, resulting in a complete quenching of the fluorescent signal. Cleavage of the substrate however, releases individual fragments, which contain less fluorescent labels. This results in the loss of quenching and the generation of a fluorescent signal, which correlates to the levels of cleaved substrate. Cleavage of the protein, which results in smaller peptide fragments, can also be measured using fluorescent polarization (FP). Alternatively, cleavage of the substrate can also be detected using fluorescence resonance energy transfer (FRET): a peptide substrate is labeled on both sides with either a quencher and fluorescent molecule, like DABCYL and EDANS. Upon cleavage of the substrate both molecules are separated resulting in fluorescent signal correlating to the levels of cleaved substrate. In addition, cleavage of a peptide substrate can also generate a new substrate for another enzymatic reaction, which is then detected via a fluorescent, chemiluminescent or colorimetric method.

[0243] Small molecules are randomly screened or are preselected based upon drug class, i.e. protease, or upon virtual ligand screening (VLS) results. VLS uses virtual docking technology to test large numbers of small molecules in silico for their binding to the polypeptide of the invention. Small molecules are added to the proteolytic reaction and their effect on levels of cleaved substrate is measured with the described technologies.

[0244] Small molecules that inhibit the protease activity are identified and are subsequently tested at different concentrations. IC50 values are calculated from these dose response curves. Strong binders have an IC50 in the nanomolar and even picomolar range. Compounds that have an IC50 of at least 10 micromol or better (nmol to pmol) are applied in amyloid beta secretion assay to check for their effect on the beta amyloid secretion and processing.

Example 16

Identification of Small Molecules that Inhibit Phosphodiesterase Activity

[0245] Compounds are screened for inhibition of the activity of the polypeptides of the present invention. The affinity of the compounds to the polypeptides is determined in an experiment detecting changes in levels of substrate or product. In brief, the polypeptides of the present invention are incubated with its substrate in an appropriate buffer. The combination of these components results in the conversion of the substrate into its product.

[0246] The polypeptides can be applied as complete polypeptides or as polypeptide fragments, which still comprise the catalytic activity of the polypeptide of the invention.

[0247] Conversion of cAMP or cGMP in AMP or GMP can be followed 1) by determining the cAMP or cGMP levels using e.g. ELISA. Alpha screen technology, Time resolved fluorescent technology, IMAP 2) by determining the levels of the products AMP and GMP using a colorimetric assay. The basis for the latter assay is the cleavage of cAMP or

[0248] cGMP by a cyclic nucleotide phosphodiesterase. The 5'-nucleotide released is further cleaved into the nucleoside and phosphate by the enzyme 5'-nucleotidase. The phosphate released due to enzymatic cleavage is quantified using BIOMOL GREEN.TM. reagent in a modified Malachite Green assay.

[0249] Small molecules are randomly screened or are preselected based upon drug class, i.e. PDE, or upon virtual ligand screening (VLS) results. VLS uses virtual docking technology to test large numbers of small molecules in silico for their binding to the polypeptide of the invention. Small molecules are added to the PDE reaction and their effect on cyclic nucleotide levels is measured with the described technologies.

[0250] Small molecules that inhibit the PDE activity are identified and are subsequently tested at different concentrations. IC50 values are calculated from these dose response curves. Strong binders have an IC50 in the nanomolar and even picomolar range. Compounds that have an IC50 of at least 10 micromol or better (nmol to pmol) are applied in assays evaluating the anabolic activity of chondrocytes. This can be achieved by determining col2 1 and aggrecan levels produced by the chondrocytes.

REFERENCES

[0251] Arts et al. (2003) Genome Res 10:2325-32 [0252] Chubinskaya and Kuettner (2003). Int J Biochem Cell Biol 35; 1323-40 [0253] Cortez-Retamozo et al. (2004). Cancer Res 64: 2853-7 [0254] Dorsett Y, Tuschl T. (2004). Nature Reviews Drug Discovery 3: 318-329 [0255] Harborth J, et al. (2003) Antisense Nucleic Acid Drug Dev 13(2): 83-105 [0256] Khvorova A, et al. (2003) Cell. 115(2): 209-16 [0257] Lipinsky, C A, et al. (2001). Adv Drug Deliv Rev 46: 3-26 [0258] Reynolds A, et al. (2004) Nat Biotechnol 22: 326-30 [0259] Tuschl, (2002). Nature Biotechnol. 20:446-8 [0260] Ui-Tei K, et al. (2004) Nucleic Acids Res. 32(3): 936-48 [0261] Wang L and Mu FY. (2004) Bioinformatics (In press)

Sequence CWU 1

1

48013536DNAHomo sapiens 1atggggacga cggccccagg gcccattcac ctgctggagc tatgtgacca gaagctcatg 60gagtttctct gcaacatgga taataaggac ttggtgtggc ttgaggagat ccaagaggag 120gccgagcgca tgttcaccag agaattcagc aaagagccag agctgatgcc caaaacacct 180tctcagaaga accgacggaa gaagagacgg atttcttatg ttcaggatga aaacagagat 240cccatcagga gaaggttatc ccgcagaaag tctcggagca gccagctgag ctcccgacgc 300ctccgcagca aggacagtgt agagaagctg gctacagtgg tcggggagaa cggctccgtt 360ctgcggcgtg tgacccgtgc tgcggctgca gctgccgcgg ctaccatggc attggctgca 420ccttcttcac ccacccctga gtctcccacg atgctgacta agaagcccga ggataaccac 480acccagtgcc agctggtgcc tgtggtggag atcggcatca gtgagcgcca gaatgctgag 540cagcatgtca cccagctcat gtccaccgag cctctgcccc gcactctgtc cccgactcca 600gcttcagcca cagctccaac ctcccagggc atcccgacat cagatgagga atcaacacct 660aagaagtcga aggccaggat actggagtcc atcacagtga gctccctgat ggctacaccc 720caggacccca agggtcaagg ggtcgggacg gggcggtctg cgtctaagct caggattgcg 780caggtctccc ctggcccacg ggactcgcca gcctttccag attctccatg gcgggagcgg 840gtgctggctc ccatcctgcc ggataacttc tccacgccca cgggctctcg cacggactct 900caatcggtgc ggcacagccc gatcgccccg tcttccccga gtccccaagt cttagcccag 960aagtactctc tggtggccaa acaggaaagt gttgtccgca gggcgagcag aaggcttgcc 1020aagaagactg ccgaagagcc agctgcctct ggccgcatca tctgtcacag ttacctggag 1080aggctcctga atgttgaggt gccccagaaa gttggttctg agcagaagga accccccgag 1140gaggctgagc ctgtggcggc agctgagcca gaggtccctg agaacaacgg aaataactcg 1200tggccccaca atgacacgga gattgccaac agcacaccca acccgaagcc tgcagccagc 1260agcccggaaa caccctctgc agggcagcaa gaggccaaga cggaccaagc agatggaccc 1320agagagccac cgcagagtgc caggaggaag cgcagctaca agcaggccgt gagtgagctg 1380gacgaggagc agcacctgga ggatgaggag ctgcagcccc ccaggagcaa gaccccttcc 1440tcaccctgcc cagccagcaa ggtggtacgg cccctccgga cctttctgca cacagtgcag 1500aggaaccaga tgctcatgac ccctacctca gccccacgca gcgtcatgaa gtcctttatt 1560aagcgcaaca ctcccctgcg catggacccc aaggagaagg agcggcagcg cctggagaat 1620ctgcggcgga aggaggaggc cgagcagctg cgcaggcaga aggtggagga ggacaagcgg 1680cggcggctgg aggaggtgaa gctgaagcgt gaggaacgcc tccgcaaggt gctgcaggcc 1740cgcgagcggg tggagcagat gaaggaggag aagaagaagc agattgagca gaagtttgct 1800cagatcgacg agaagactga gaaggccaag gaggagcggc tggcagagga gaaggccaag 1860aaaaaggcgg cggccaagaa gatggaggag gtggaagcac gcaggaagca ggaagaggat 1920gcacgtaggc tcaggtggct gcagcaggag gaggaagagc ggcggcacca agagctgctg 1980cagaagaaga aggaagagga gcaggagcgg ctgcggaagg cggccgaggc taagcggctg 2040gcagagcagc gggagcagga gcggcgggag caggagcggc gggagcagga gcggcgcgag 2100caggagcggc gcgagcagga gcggcgggag caggagcggc gcgagcagga gcgacagctg 2160gcagagcagg agcgtcggcg ggagcaggag cggctccaag ccgagaggga gctgcaggag 2220cgggagaagg ccctgcggct gcagaaggag cagctgcaga gggaactgga ggagaagaag 2280aagaaggaag agcagcagcg tctggctgag cggcagctgc aggaggagca agagaagaaa 2340gccaaggagg cagcaggggc cagcaaggcc ctgaatgtga ctgtggacgt gcagtctcca 2400gcttgtacct catctcccat cactccgcaa gggcacaagg cccctcccca gatcaacccc 2460cacaactacg ggatggatct gaatagcgac gactccaccg atgatgaggc ccatccccgg 2520aagcccatcc ccacctgggc ccgaggcacc ccgctcagcc aggctatcat tcaccagtac 2580taccagccac cgaaccttct ggagctcttt ggaaccattc tcccactgga cttggaggat 2640atcttcaaga agagcaagcc ccgctatcac aagcgcacca gctctgctgt ctggaactca 2700ccgcccctgc agggcgccag ggtccccagc agcctggcct acagcctgaa gaagcactga 2760ggctggcctg cggccttctt ggcagcctcg cctcctgtcc atgtctatct gtctgtctgt 2820cggtctgtgt cttggtctgt tgccctcctt cttggcatgc cattgtggag ggcttggcca 2880ggtgtatata aacgtcctct gtgctgggtg tttctgctgc aggtggcagg tggccccagg 2940cctgtttgga ggatgggctg ggtgggtggg tggggaagaa atgggcccag ccccacatgg 3000cctgcagaca gtgctctgta aatagttgtt ttaatttagc tgaatgttag cattttagtc 3060tttggcattt tagcgtttgg gaggtagatt aataaagtat attccttcaa gcctgctgtt 3120gataccatga agactgggcg cctcagtccc agccctgtag ctgtgtgtct tgggccacca 3180gtggcctgca ggacgaaggt actgttccat cacctgcggt gtgcctcagg atcaccaggt 3240gcaggccccc accctcggag atgctgctgc agtgagtggt tccactgcct ggataaccct 3300tgaggaacac gtcagttact gtcacgatgg ggcaggtgga gctccttcct attttttggg 3360gtgctccctg tttgtaaagg ggagtttgtt cattgggaaa gacctgggtc ttgacacggc 3420cctgccactt agtcccctac cctctccatt ccccaggctc cacccgtgct gctcaagtgc 3480aaatggactt gagagtattt atgtgctggt gaagtatgag gtctgagtag aaaagg 353623926DNAHomo sapiens 2atgacaaacc aggaaaaatg ggcccacctc agcccttcgg aattttccca acttcagaaa 60tatgctgagt attctacaaa gaaattaaag gatgttcttg aagaattcca tggtaatggt 120gtgcttgcaa agtataatcc tgaagggaaa caagacattc ttaaccaaac aatagatttt 180gaaggtttca aactattcat gaagacattc ctggaagccg agcttcctga tgatttcact 240gcacaccttt tcatgtcatt tagcaacaag tttcctcatt ctagtccaat ggtaaaaagt 300aagcctgctc tcctatcagg cggtctgaga atgaataaag gtgccatcac ccctccccga 360actacttctc ctgcaaatac gtgttcccca gaagtaatcc atctgaagga cattgtctgt 420tacctgtctc tgcttgaaag aggaagacct gaggataagc ttgagtttat gtttcgcctt 480tatgacacgg atgggaatgg cttcctggac agctcggagc tagaaaatat catcagtcag 540atgatgcatg ttgcagaata ccttgagtgg gatgtcactg aacttaatcc aatcctccat 600gaaatgatgg aagaaattga ctatgatcat gatggaaccg tgtctctgga ggaatggatt 660caaggaggaa tgacaacgat tccacttctt gtgctcctgg gcttagaaaa taacgtgaag 720gatgatggac agcacgtgtg gcgactgaag cactttaaca aacctgccta ttgcaacctt 780tgcctgaaca tgctgattgg cgtggggaag cagggcctct gctgttcctt ctgcaagtac 840acagtccatg agcgctgtgt ggctcgagca cctccctctt gcatcaagac ctatgtgaag 900tccaaaagga acactgatgt catgcaccat tactgggttg aaggtaactg cccaaccaag 960tgtgataagt gccacaaaac tgttaaatgt taccagggcc tgacaggact gcattgtgtt 1020tggtgtcaga tcacactgca taataaatgt gcttctcatc taaaacctga atgtgactgt 1080ggacctttga aggaccatat tttaccaccc acaacaatct gtccagtggt actgcagact 1140ctgcccactt caggagtttc agttcctgag gaaagacaat caacagtgaa aaaggaaaag 1200agtggttccc agcagccaaa caaagtgatt gacaagaata aaatgcaaag agccaactct 1260gttactgtag atggacaagg cctgcaggtc actcctgtgc ctggtactca cccactttta 1320gtttttgtga accccaaaag tggtggaaaa caaggagaac gaatttacag aaaattccag 1380tatctattaa atcctcgtca ggtttacagt ctttctggaa atggaccaat gccagggtta 1440aactttttcc gtgatgttcc tgacttcaga gtgttagcct gtggtggaga tggaaccgtg 1500ggctgggttt tggattgcat agaaaaggcc aatgtaggca agcatcctcc agttgcgatt 1560ctgcctcttg ggactggcaa tgatctagca agatgcctgc gatggggagg aggttacgaa 1620ggtgagaatc tgatgaaaat tctaaaagac attgaaaaca gcacagaaat catgttggac 1680aggtggaagt ttgaagtcat acctaatgac aaagatgaga aaggagaccc agtgccttac 1740agtatcatca ataattactt ttccattggc gtggatgcct ccattgcaca cagattccac 1800atcatgagag aaaaacaccc agagaaattc aacagtagaa tgaagaacaa attttggtat 1860tttgagtttg gcacatctga aactttctca gccacctgca agaagctaca tgaatctgta 1920gaaatagaat gtgatggagt acagatagat ttaataaaca tctctctgga aggaattgct 1980attttgaata taccaagcat gcatggagga tccaatcttt ggggagagtc taagaaaaga 2040cgaagccatc gacgaataga gaaaaaaggg tctgacaaaa ggaccaccgt cacagatgcc 2100aaagagttga agtttgcaag tcaagatctc agtgaccagc tgctggaggt ggtcggcttg 2160gaaggagcca tggagatggg gcaaatatac acaggcctga aaagtgctgg ccggcggctg 2220gctcagtgct cctgcgtggt catcaggacg agcaagtctc tgccaatgca aattgatggg 2280gagccatgga tgcagacccc atgcacaata aaaattacac acaagaacca agccccaatg 2340ctgatgggcc cgcctccaaa aaccggttta ttctgctccc tcgtcaaaag gacaagaaac 2400cgaagcaagg aataatcctg tgttgtttca ctcttagaaa ttgaattagc ataattgggc 2460catggaacac atatgctgga aatctttgaa ccatttcaag tctcctgctc atgcaaaatc 2520atggaagtgg tttaacagtt tttgttacta agctaatgta aaattcagct attagaaaat 2580ttattgtctc agtttttata ggcatctttg catgaagaaa gcagaagttt acctgaagtg 2640atactgcata tttttggtgc atgcattccc atagattttt acatctccca cccaactctt 2700ccccaatttc cttttactaa cctgtgagaa aaacccgtga aacatgaaaa aggaaatacc 2760atgggaaacg tgattctcag tgtgattcca attattacga agcactaatc agtaacgcta 2820caatgatcat aattgcagat tgctatacgt ttccctttta gaatcagtgt atcagtgacc 2880tatgacttga ggagaaactt ttaattcgaa gattttatta aatagttgac tacaatacct 2940tgctatatat acatagtttt tcttcaacat cttaactctt ctgagtggaa ataaaaatat 3000caggcataag gttttctcat gctgaaaaat agaacgcggt ttttattttg cttagttttc 3060tttttaattc cagaaataag tgaaaacatg ttacttgaca gtcaagtgtg gtaatatggc 3120aagccttgtt cctttctgca tgagaatcta ggagagaatt cataaccaca ccaataacga 3180aatagaagtt ttaaactatg tgcctaatca atgtgtttcc caccaaagat tcagaaaaca 3240atgcttgaga gaaatgggtt aatgcataat taattaagca ttgtggagca aatttagggt 3300tcctgtgatt aattttgtga tgactaaaat gctggaaagc aagtgagttg cccattaatt 3360atgattaaaa ttctcacctt tcacagacag acaataagcc agacaacaca atcaaagctc 3420aatagatgat ttcttgcttt tttcagtcat ttataaatat aggtgtaatt tttcatggat 3480cagttaagta cacttgaagg aagtaaatga ttgtatcagt ttatttctag tataaatggg 3540tacctgtaat aatactgagc tcttggaagc gaatcatgca tgcaattagc tccctcctcc 3600tcacctactc cactcccatc tttatgacat ttcaaatgtt tatttggaaa caacagccta 3660gatcactgtt gaaggtgttc atggcatagt tggagtctct gactgtttaa agaaatcaca 3720gaacagtact tttcttttag tgtttcatta agcctatgat gtaaaatgaa atgcttctga 3780gcagtcttgt aatattgttc attcatattg acctgcatct catcattgca tgttttatgt 3840tttcaaacat gccataagga aaacgagtgc ctgaactgca tgatttatta gtttctctcc 3900actctgcatt aaagtgctaa tgattt 392633172DNAHomo sapiens 3atgacaaacc aggaaaaatg ggcccacctc agcccttcgg aattttccca acttcagaaa 60tatgctgagt attctacaaa gaaattaaag gatgttcttg aagaattcca tggtaatggt 120gtgcttgcaa agtataatcc tgaagggaaa caagacattc ttaaccaaac aatagatttt 180gaaggtttca aactattcat gaagacattc ctggaagccg agcttcctga tgatttcact 240gcacaccttt tcatgtcatt tagcaacaag tttcctcatt ctagtccaat ggtaaaaagt 300aagcctgctc tcctatcagg cggtctgaga atgaataaag gtgccatcac ccctccccga 360actacttctc ctgcaaatac gtgttcccca gaagtaatcc atctgaagga cattgtctgt 420tacctgtctc tgcttgaaag aggaagacct gaggataagc ttgagtttat gtttcgcctt 480tatgacacgg atgggaatgg cttcctggac agctcggagc tagaaaatat catcagtcag 540atgatgcatg ttgcagaata ccttgagtgg gatgtcactg aacttaatcc aatcctccat 600gaaatgatgg aagaaattga ctatgatcat gatggaaccg tgtctctgga ggaatggatt 660caaggaggaa tgacaacgat tccacttctt gtgctcctgg gcttagaaaa taacgtgaag 720gatgatggac agcacgtgtg gcgactgaag cactttaaca aacctgccta ttgcaacctt 780tgcctgaaca tgctgattgg cgtggggaag cagggcctct gctgttcctt ctgcaagtac 840acagtccatg agcgctgtgt ggctcgagca cctccctctt gcatcaagac ctatgtgaag 900tccaaaagga acactgatgt catgcaccat tactgggttg aaggtaactg cccaaccaag 960tgtgataagt gccacaaaac tgttaaatgt taccagggcc tgacaggact gcattgtgtt 1020tggtgtcaga tcacactgca taataaatgt gcttctcatc taaaacctga atgtgactgt 1080ggacctttga aggaccatat tttaccaccc acaacaatct gtccagtggt actgcagact 1140ctgcccactt caggagtttc agttcctgag gaaagacaat caacagtgaa aaaggaaaag 1200agtggttccc agcagccaaa caaagtgatt gacaagaata aaatgcaaag agccaactct 1260gttactgtag atggacaagg cctgcaggtc actcctgtgc ctggtactca cccactttta 1320gtttttgtga accccaaaag tggtggaaaa caaggagaac gaatttacag aaaattccag 1380tatctattaa atcctcgtca ggtttacagt ctttctggaa atggaccaat gccagggtta 1440aactttttcc gtgatgttcc tgacttcaga gtgttagcct gtggtggaga tggaaccgtg 1500ggctgggttt tggattgcat agaaaaggcc aatgtaggca agcatcctcc agttgcgatt 1560ctgcctcttg ggactggcaa tgatctagca agatgcctgc gatggggagg aggttacgaa 1620ggtgagaatc tgatgaaaat tctaaaagac attgaaaaca gcacagaaat catgttggac 1680aggtggaagt ttgaagtcat acctaatgac aaagatgaga aaggagaccc agtgccttac 1740agtatcatca ataattactt ttccattggc gtggatgcct ccattgcaca cagattccac 1800atcatgagag aaaaacaccc agagaaattc aacagtagaa tgaagaacaa attttggtat 1860tttgagtttg gcacatctga aactttctca gccacctgca agaagctaca tgaatctgta 1920gaaatagaat gtgatggagt acagatagat ttaataaaca tctctctgga aggaattgct 1980attttgaata taccaagcat gcatggagga tccaatcttt ggggagagtc taagaaaaga 2040cgaagccatc gacgaataga gaaaaaaggg tctgacaaaa ggaccaccgt cacagatgcc 2100aaagagttga agtttgcaag tcaagatctc agtgaccagc tgctggaggt ggtcggcttg 2160gaaggagcca tggagatggg gcaaatatac acaggcctga aaagtgctgg ccggcggctg 2220gctcagtgct cctgcgtggt catcaggacg agcaagtctc tgccaatgca aattgatggg 2280gagccatgga tgcagacccc atgcacagtg agtacagagt agttgatatg ctatgtcaat 2340ctcagttttg ctttcctctt tgactaaata accacaataa ctgatttttt tctttatttc 2400ttttcaacct atcagcaaat agtctttttg ttgttgttgt tatgtgtgtg tcagagccac 2460tacatttagg ctgtagacat tatataccct tggcaatgat ttagctcttg aatgtttgtg 2520ctagcctaag tataaataga tcttttaaat agatcaatta taaaccatag atcaattata 2580aactatggag ctaaacaaaa tattaataaa agtttatctg aaactttttt gtttatttca 2640gagcacatta ttagaatatt atttgcgaga aatgcagacc taagcttata tgtgaactta 2700tttctcagct tttctatgcc tccatttggg gatttgaggg ctttcttctc cataagaaaa 2760aaatttctct ccagtttcta ccataattaa ttgtgttttc cagaatgagg tattatttaa 2820ggcagacact gcccctctca aaaaaaatca gttttcattt gcatagtgaa tattttattg 2880catttcaaaa acatgctagg aactgctttt ggcactggga gtagacacat gaacaagacc 2940aacagtgtaa tttccttcaa gttacttaca ttcctataat agaggaccga ataaataaac 3000aactacatga taaatataac ttcagactgt gagagttatt aaaaaataag gtgaaatgat 3060gataagaagc tggattaggt gtggagaata aatactactt gagataaggg agacctcttt 3120gaaaggacat agccaaaagc ttagtataaa attaaaaaaa ataaaaaaaa aa 317246228DNAHomo sapiens 4cgggttcctg ctgcactacc atgcgccgtg cggcccgtgc gactcgccgg acctcgcggg 60cgtccctgta cggagccctc ggccggtcct agcagggatt gtccccattt ccagctccgg 120agcgggcggc tgcgccccgc tcgtcgagga gctgcgctca cctcaggggc gggcccccgc 180ctgcgttcgc ggcgccaaga agagtattcc tttccactta caactaaata agacctgctt 240ttgctggagc tgtgctaggc tgagggaatt ccacactgaa ttttacaagc gggatggatt 300tctctaaggc agaagactga tttttggaaa tatgtatttg ggagacagtc acgtcctatt 360gaataccttg tgctggtgct gccatcgaaa aatctggtta cactctgggg aggactgcta 420ccactgcaga actgaaccac ttcggccgtg agatgagtgt ccggcctgag caggcacacc 480atgaatagat acacaacaat caggcagctc ggggatggaa cctacggttc cgtcctgctg 540ggaagaagca ttgagtctgg ggagctgatc gctattaaaa aaatgaaaag aaaattttat 600tcctgggagg aatgcatgaa ccttcgggag gttaagtctt taaagaagct caaccatgcc 660aatgtagtca aattaaaaga agttatcagg gaaaatgatc atctttattt tatcttcgag 720tacatgaagg aaaatcttta ccagctcatt aaagagagaa ataagttgtt tcctgagtct 780gctataagga atatcatgta tcagatatta caaggactcg catttattca caaacacggc 840ttctttcatc gagacttaaa gcctgagaac ctcctctgca tgggaccaga acttgtgaaa 900attgcagact ttggtttggc ccgagaaata cgatcaaaac ctccatatac agattatgta 960tctaccagat ggtacagggc tccagaagta ctcctgaggt ctaccaacta cagctccccc 1020attgacgtct gggcggtggg ctgcatcatg gcagaagttt acaccctcag gccactcttc 1080cctggagcca gtgaaattga cacaatattc aaaatttgcc aagtgctggg gacaccaaaa 1140aagactgact ggcctgaagg ctatcaactt tcaagtgcaa tgaacttccg ttggccacag 1200tgtgtaccca ataacttaaa gaccttgatt cccaatgcta gcagtgaagc agtccagctc 1260ctgagagaca tgcttcagtg ggatcccaag aaacgaccaa cagctagtca ggcacttcga 1320tatccttact tccaagttgg acacccacta ggcagcacca cacaaaacct tcaggattca 1380gaaaaaccac agaaaggcat cctggaaaag gcaggcccac ctccttatat taagccagtc 1440ccacctgccc agccaccagc caagccacac acacgaattt cttcacgaca gcatcaagcc 1500agccagcccc ctctgcatct cacgtacccc tacaaagcag aggtctccag gacagatcac 1560ccaagccatc tccaggagga caagccaagc ccgttgcttt tcccatccct ccacaacaag 1620catccacagt cgaaaatcac agctggcctg gagcacaaaa atggtgagat aaagccaaag 1680agtaggagaa ggtggggtct tatttccagg tcaacaaagg attcagatga ttgggctgac 1740ttggatgact tggatttcag tccatccctc agcaggattg acctgaaaaa caagaaaaga 1800cagagtgatg acactctctg caggtttgag agtgttttgg acctgaagcc ctctgagcct 1860gtgggcacag gaaacagtgc ccccacccag acgtcatatc agcggcgaga cacgcccacc 1920ctgagatctg cagccaagca gcactatttg aagcactctc gatacttgcc tgggatcagt 1980ataagaaatg gcatactctc gaatccaggc aaggaattta ttccacctaa tccatggtct 2040agttctggct tgtctggaaa atcttcaggg acaatgtcag taatcagcaa agtaaattca 2100gttggttcca gctctacaag ttctagtgga ctgactggaa actatgtccc ttcctttctg 2160aaaaaagaaa tcggttctgc tatgcagagg gtacacctag cacctattcc agacccttcc 2220cctggttatt cctccctgaa ggccatgaga cctcatcctg ggcgaccatt cttccacacc 2280cagcctagaa gcactcctgg gttgatacca cggcctccag ccgcccagcc agtgcatggc 2340cggacagact gggcttccaa gtacgcatct cggcgatgac tgtctgcctt ggtgatgaat 2400ctcttcctag ggagaagcag gatactttcc ctcagctgac tggtgttcta cctgcaagat 2460gtgcagaggg cataaaagca aatcaacact ttatagttat tcttctgaac taagacatgt 2520caatattctt ttttaaagtt tttttttaaa atattgattt gaatgcagta ggcttttttg 2580tataaaatta ttttattcta aaactgggtc ccattatttt cttaaacaac agcattttgt 2640atatatggat tatgttttag cattttatac agtcaacttt gtaatgaact ttttaaaaat 2700taattgattt tcctttgggg ttccagataa tattttctac agattttgaa aaatgtaata 2760atattaatgc agtattgcaa caggggtgca atttaaggct atgtgataga gggttattta 2820ctcagtgtgt gcagatattt atgaagtggt gaaatttcaa gtgtggctca ctaggtactt 2880caggccttct tggactgttg ttagaaaagt gatcctctgc ttttcttagt aggtcattgg 2940tttgattttt ggataccact ctgctgttct aaaaggacta ttatattata taattcactt 3000tgttttactt ttgttcccca gatgaaagaa ctctaagtaa atacatttta aaaaattttt 3060ctgacaccct ttaatgtggt tgcagatctc agatgaaacc aagcttaatt atactatgcc 3120attatattct aatttattcc atttttgaaa tcaagttgta tgtgtaccaa taaaagagat 3180ttctgcttca aaaggctctc aacatgaagg ttaacacagt caatcaaact tacattcctg 3240ccaagatgca tggccaaaaa actaagtatc aaagcagcag aaggtttttg attatagtaa 3300ctgagatgga attttgtgcc tagctcagtt ctccagatct ggctaggagc agtcaatgac 3360taatgttctg tcctagccaa attctcagga caatttgggg agcagaaaga gttatggcag 3420aggttccact catctacaaa gtcacagtca catgccacat ttgatctcct aaccctggtg 3480tagtttcttt caagagtgag aactttattt gttgggcaga ggctgttcca ttgagaggaa 3540tgtttacagc agtttcaaaa atgacaaagt cagtttggag acagaaaaag acaaaaggtc 3600cagtctcatc catctctata tggtacattt gcctcactta tggttgcctt aaaggcaaga 3660gggaaggtca ccatcagtga acgcaatgca atctcaacag tgtattgatt catattctcc 3720tagggctcaa actactctct attggttcca ggataatgac aaattgaacc atatgtaagt 3780aatcttttat tttttatttt ttttttgaga cagagtctca ctctgtcacc caggctggag 3840tgcagtggcg cgatcttagc tctctgcaac ctctgcctcc caggttcaag cctcctgagt 3900aactgggact acaggcgccc gccaccacgc ccagctaatt ttttgtattt ttagtagaga 3960cggggtttca ctgtgttagc caggacggcc tcgatctcct gacctcgtga tccaccctcc 4020tccacctccc aaagtactgg gattacaggc atgagccact gcacccagcc aagtgatcat 4080ttttataggt taaaatgata ggtgaaatga atatagacac tttcatatgg ttcaacctaa 4140tgacttggta aattattgcc ttggtgtatt aataatatgt tgcattctga acaaataacc 4200atggcttcca aagggcccta acctaaaatc ggagagtaat ttatgctttg gagaatttga 4260ctcaaatata tacttgacca agcaccatga tccctagggg

catgagaaaa gcacataatg 4320gatgtggatg tgataggtgg tcttttcctg ttaacaagct ggcagcaaag cttcagaaaa 4380tatatatgca agcacaactt gaagctgaat tcatttctgt attatattct caactcgtta 4440tctaaagcat cagaacatgt gttttcagag atgagtcctt tactataagg ttaatattta 4500ttttcatttt ctgtattata tatgaaaagt aaattaatgt gaaacctggc ccagcttgct 4560ggaaagcagg ttttaaattg taaatattcc ttagaggagc aaatggattg tttaatacca 4620tagtctcagt aatctagctt atataaggtc attacatttt ttaactgaaa aacctagtta 4680cctgattatt gcacattata aaattgtttt tctaatactt tatagggccc aacttcagaa 4740aatacttcgc ttttttcttt ttatgctttc gtttgtttac cagcaagcaa cttccctggg 4800gaagccaaac acatattcat aaaaaaaatc aagtagctga tgtgcagttg agaaaactag 4860aggactgaaa aaacaaattt taactagcaa atgctgtgaa ttactcttcc tccccttctc 4920tgaaatgggt aaaggacaaa ttgtgtaaaa aaacctatgc actatagaag ggaatagtaa 4980ccatttcttt tgtctctctg tttctgttct gactgagaac ctgcagccat ttcttgttac 5040atgaaaacaa aatgctactt gttacctcta ttttttgtta ctatacaatt atgaaatgta 5100atgtaagaca ccaacagaaa tgatatacct gtaactgtac ctatcaggac tatacctcat 5160ttacagtcag aaagcttact gggatgtcag gaaatgatac agggttggtt ctcatttcgt 5220gccgaaatga gacagaaatt cagtgacgaa ggtgcgttgt aggggtattg atgtgcccca 5280ggtagtgcca gcagagtagg gaaaactgca tttgcataaa aactactctt gacatgattg 5340ttcattttac aaaaaaattc cattaattac caagccctca cccagcccat gtgtgatagg 5400atttatgtag gaagaaactt gattttcaaa taatttttta aatgtatctc ttgcctaaag 5460gactatatac atctaataaa gtaacactgt gtcatcttct ggagttatca aaaattgtat 5520acaatcaaga caacacaaga attattttat ttttgagtgc aaatacaggt actgttggag 5580ttgatgggca ccatgctttc tcatgaagta gcatttccct accatcaagc cattgttttg 5640tgccattcag gagaggaaaa aaaggaattt atgctgtaca tttcagttca gtgtatgacc 5700aaaagcaata tgtttataag aagatgtttg acatactaat tattttatat catttaaacc 5760atactgtagc aacataatat atggagctaa tttgtagaat tatttttacg atttccaaac 5820aaatgtactg tactgttata taatttattg tgaggacctt ctcatggaag ccattaggaa 5880aacaaactag aggtaaatat cacattaatc tgtattatca atttctcata gacactgtgc 5940taatgtgaat tttaaatgac ctgcatcaag tcttctgatc tcagataact cagtacagat 6000agcaattagt cagctgattt gattacaatg gagtaaccga caatatattt atttataaag 6060cacatattca taataacgag aagaattcag aaaaccactt aagcaagacc cttctgaaat 6120aaaaaatgtt gctttttaaa tagtttgtcc taaggtgttt aaaacatgtc aaccttatgt 6180aaggaaaaat ttcctggtcc aaataaagtt gaagtttaag aaaaattg 622856095DNAHomo sapiens 5gcgccgtgcg gcccgtgcga ctcgccggac ctcgcgggcg tccctgtacg gagccctcgg 60ccggtcctag cagggattgt ccccatttcc agctccggag cgggcggctg cgccccgctc 120gtcgaggagc tgcgctcacc tcaggggcgg gcccccgcct gcgttcgcgg cgccagcaga 180agactgattt ttggaaatat gtatttggga gacagtcacg tcctattgaa taccttgtgc 240tggtgctgcc atcgaaaaat ctggttacac tctggggagg actgctacca ctgcagaact 300gaaccacttc ggccgtgaga tgagtgtccg gcctgagcag gcacaccatg aatagataca 360caacaatcag gcagctcggg gatggaacct acggttccgt cctgctggga agaagcattg 420agtctgggga gctgatcgct attaaaaaaa tgaaaagaaa attttattcc tgggaggaat 480gcatgaacct tcgggaggtt aagtctttaa agaagctcaa ccatgccaat gtagtcaaat 540taaaagaagt tatcagggaa aatgatcatc tttattttat cttcgagtac atgaaggaaa 600atctttacca gctcattaaa gagagaaata agttgtttcc tgagtctgct ataaggaata 660tcatgtatca gatattacaa ggactcgcat ttattcacaa acacggcttc tttcatcgag 720acttaaagcc tgagaacctc ctctgcatgg gaccagaact tgtgaaaatt gcagactttg 780gtttggcccg agaaatacga tcaaaacctc catatacaga ttatgtatct accagatggt 840acagggctcc agaagtactc ctgaggtcta ccaactacag ctcccccatt gacgtctggg 900cggtgggctg catcatggca gaagtttaca ccctcaggcc actcttccct ggagccagtg 960aaattgacac aatattcaaa atttgccaag tgctggggac accaaaaaag actgactggc 1020ctgaaggcta tcaactttca agtgcaatga acttccgttg gccacagtgt gtacccaata 1080acttaaagac cttgattccc aatgctagca gtgaagcagt ccagctcctg agagacatgc 1140ttcagtggga tcccaagaaa cgaccaacag ctagtcaggc acttcgatat ccttacttcc 1200aagttggaca cccactaggc agcaccacac aaaaccttca ggattcagaa aaaccacaga 1260aaggcatcct ggaaaaggca ggcccacctc cttatattaa gccagtccca cctgcccagc 1320caccagccaa gccacacaca cgaatttctt cacgacagca tcaagccagc cagccccctc 1380tgcatctcac gtacccctac aaagcagagg tctccaggac agatcaccca agccatctcc 1440aggaggacaa gccaagcccg ttgcttttcc catccctcca caacaagcat ccacagtcga 1500aaatcacagc tggcctggag cacaaaaatg gtgagataaa gccaaagagt aggagaaggt 1560ggggtcttat ttccaggtca acaaaggatt cagatgattg ggctgacttg gatgacttgg 1620atttcagtcc atccctcagc aggattgacc tgaaaaacaa gaaaagacag agtgatgaca 1680ctctctgcag gtttgagagt gttttggacc tgaagccctc tgagcctgtg ggcacaggaa 1740acagtgcccc cacccagacg tcatatcagc ggcgagacac gcccaccctg agatctgcag 1800ccaagcagca ctatttgaag cactctcgat acttgcctgg gatcagtata agaaatggca 1860tactctcgaa tccaggcaag gaatttattc cacctaatcc atggtctagt tctggcttgt 1920ctggaaaatc ttcagggaca atgtcagtaa tcagcaaagt aaattcagtt ggttccagct 1980ctacaagttc tagtggactg actggaaact atgtcccttc ctttctgaaa aaagaaatcg 2040gttctgctat gcagagggta cacctagcac ctattccaga cccttcccct ggttattcct 2100ccctgaaggc catgagacct catcctgggc gaccattctt ccacacccag cctagaagca 2160ctcctgggtt gataccacgg cctccagccg cccagccagt gcatggccgg acagactggg 2220cttccaagta cgcatctcgg cgatgactgt ctgccttggt gatgaatctc ttcctaggga 2280gaagcaggat actttccctc agctgactgg tgttctacct gcaagatgtg cagagggcat 2340aaaagcaaat caacacttta tagttattct tctgaactaa gacatgtcaa tattcttttt 2400taaagttttt ttttaaaata ttgatttgaa tgcagtaggc ttttttgtat aaaattattt 2460tattctaaaa ctgggtccca ttattttctt aaacaacagc attttgtata tatggattat 2520gttttagcat tttatacagt caactttgta atgaactttt taaaaattaa ttgattttcc 2580tttggggttc cagataatat tttctacaga ttttgaaaaa tgtaataata ttaatgcagt 2640attgcaacag gggtgcaatt taaggctatg tgatagaggg ttatttactc agtgtgtgca 2700gatatttatg aagtggtgaa atttcaagtg tggctcacta ggtacttcag gccttcttgg 2760actgttgtta gaaaagtgat cctctgcttt tcttagtagg tcattggttt gatttttgga 2820taccactctg ctgttctaaa aggactatta tattatataa ttcactttgt tttacttttg 2880ttccccagat gaaagaactc taagtaaata cattttaaaa aatttttctg acacccttta 2940atgtggttgc agatctcaga tgaaaccaag cttaattata ctatgccatt atattctaat 3000ttattccatt tttgaaatca agttgtatgt gtaccaataa aagagatttc tgcttcaaaa 3060ggctctcaac atgaaggtta acacagtcaa tcaaacttac attcctgcca agatgcatgg 3120ccaaaaaact aagtatcaaa gcagcagaag gtttttgatt atagtaactg agatggaatt 3180ttgtgcctag ctcagttctc cagatctggc taggagcagt caatgactaa tgttctgtcc 3240tagccaaatt ctcaggacaa tttggggagc agaaagagtt atggcagagg ttccactcat 3300ctacaaagtc acagtcacat gccacatttg atctcctaac cctggtgtag tttctttcaa 3360gagtgagaac tttatttgtt gggcagaggc tgttccattg agaggaatgt ttacagcagt 3420ttcaaaaatg acaaagtcag tttggagaca gaaaaagaca aaaggtccag tctcatccat 3480ctctatatgg tacatttgcc tcacttatgg ttgccttaaa ggcaagaggg aaggtcacca 3540tcagtgaacg caatgcaatc tcaacagtgt attgattcat attctcctag ggctcaaact 3600actctctatt ggttccagga taatgacaaa ttgaaccata tgtaagtaat cttttatttt 3660ttattttttt tttgagacag agtctcactc tgtcacccag gctggagtgc agtggcgcga 3720tcttagctct ctgcaacctc tgcctcccag gttcaagcct cctgagtaac tgggactaca 3780ggcgcccgcc accacgccca gctaattttt tgtattttta gtagagacgg ggtttcactg 3840tgttagccag gacggcctcg atctcctgac ctcgtgatcc accctcctcc acctcccaaa 3900gtactgggat tacaggcatg agccactgca cccagccaag tgatcatttt tataggttaa 3960aatgataggt gaaatgaata tagacacttt catatggttc aacctaatga cttggtaaat 4020tattgccttg gtgtattaat aatatgttgc attctgaaca aataaccatg gcttccaaag 4080ggccctaacc taaaatcgga gagtaattta tgctttggag aatttgactc aaatatatac 4140ttgaccaagc accatgatcc ctaggggcat gagaaaagca cataatggat gtggatgtga 4200taggtggtct tttcctgtta acaagctggc agcaaagctt cagaaaatat atatgcaagc 4260acaacttgaa gctgaattca tttctgtatt atattctcaa ctcgttatct aaagcatcag 4320aacatgtgtt ttcagagatg agtcctttac tataaggtta atatttattt tcattttctg 4380tattatatat gaaaagtaaa ttaatgtgaa acctggccca gcttgctgga aagcaggttt 4440taaattgtaa atattcctta gaggagcaaa tggattgttt aataccatag tctcagtaat 4500ctagcttata taaggtcatt acatttttta actgaaaaac ctagttacct gattattgca 4560cattataaaa ttgtttttct aatactttat agggcccaac ttcagaaaat acttcgcttt 4620tttcttttta tgctttcgtt tgtttaccag caagcaactt ccctggggaa gccaaacaca 4680tattcataaa aaaaatcaag tagctgatgt gcagttgaga aaactagagg actgaaaaaa 4740caaattttaa ctagcaaatg ctgtgaatta ctcttcctcc ccttctctga aatgggtaaa 4800ggacaaattg tgtaaaaaaa cctatgcact atagaaggga atagtaacca tttcttttgt 4860ctctctgttt ctgttctgac tgagaacctg cagccatttc ttgttacatg aaaacaaaat 4920gctacttgtt acctctattt tttgttacta tacaattatg aaatgtaatg taagacacca 4980acagaaatga tatacctgta actgtaccta tcaggactat acctcattta cagtcagaaa 5040gcttactggg atgtcaggaa atgatacagg gttggttctc atttcgtgcc gaaatgagac 5100agaaattcag tgacgaaggt gcgttgtagg ggtattgatg tgccccaggt agtgccagca 5160gagtagggaa aactgcattt gcataaaaac tactcttgac atgattgttc attttacaaa 5220aaaattccat taattaccaa gccctcaccc agcccatgtg tgataggatt tatgtaggaa 5280gaaacttgat tttcaaataa ttttttaaat gtatctcttg cctaaaggac tatatacatc 5340taataaagta acactgtgtc atcttctgga gttatcaaaa attgtataca atcaagacaa 5400cacaagaatt attttatttt tgagtgcaaa tacaggtact gttggagttg atgggcacca 5460tgctttctca tgaagtagca tttccctacc atcaagccat tgttttgtgc cattcaggag 5520aggaaaaaaa ggaatttatg ctgtacattt cagttcagtg tatgaccaaa agcaatatgt 5580ttataagaag atgtttgaca tactaattat tttatatcat ttaaaccata ctgtagcaac 5640ataatatatg gagctaattt gtagaattat ttttacgatt tccaaacaaa tgtactgtac 5700tgttatataa tttattgtga ggaccttctc atggaagcca ttaggaaaac aaactagagg 5760taaatatcac attaatctgt attatcaatt tctcatagac actgtgctaa tgtgaatttt 5820aaatgacctg catcaagtct tctgatctca gataactcag tacagatagc aattagtcag 5880ctgatttgat tacaatggag taaccgacaa tatatttatt tataaagcac atattcataa 5940taacgagaag aattcagaaa accacttaag caagaccctt ctgaaataaa aaatgttgct 6000ttttaaatag tttgtcctaa ggtgtttaaa acatgtcaac cttatgtaag gaaaaatttc 6060ctggtccaaa taaagttgaa gtttaagaaa aattg 609561368DNAHomo sapiens 6atgatctgct gcagtgctct gagccctagg attcatcttt cttttcaccg tagcctgact 60ggcattgtat tagcaaactc atcactagac atcgtactac acgacacgta ctacgttgta 120gcccactgcg ggggaaatgt taggcgcctg cattgcggtg gccccgcgtc ccgggagcgc 180acagcaatgc aggcgcttaa cattaccccg gagcagttct ctcggctgct gcgggaccac 240aacctgacgc gggagcagtt catcgctctg taccggctgc gaccgctcgt ctacacccca 300gagctgccgg gacgcgccaa gctggccctc gtgctcaccg gcgtgctcat cttcgccctg 360gcactctttg gcaatgctct ggtgttctac gtggtgaccc gcagcaaggc catgcgcacc 420gtcaccaaca tctttatctg ctccttggcg ctcagtgacc tgctcatcac cttcttctgc 480attcccgtca ccatgctcca gaacatttcc gacaactggc tggggggtgc tttcatttgc 540aagatggtgc catttgtcca gtctaccgct gttgtgacag aaatcctcac tatgacctgc 600attgctgtgg aaaggcacca gggacttgtg catcctttta aaatgaagtg gcaatacacc 660aaccgaaggg ctttcacaat gctaggtgtg gtctggctgg tggcagtcat cgtaggatca 720cccatgtggc acgtgcaaca acttgagatc aaatatgact tcctatatga aaaggaacac 780atctgctgct tagaagagtg gaccagccct gtgcaccaga agatctacac caccttcatc 840ctgtcatcct cttcctcctg cctcttatgg aagaagaaac gagctgtcat tatgatggtg 900acagtggtgg ctctctttgc tgtgtgctgg gcaccattcc atgttgtcca tatgatgatt 960gaatacagta attttgaaaa ggaatatgat gatgtcacaa tcaagatgat ttttgctatc 1020gtgcaaatta ttggattttc caactccatc tgtaatccca ttgtctatgc atttatgaat 1080gaaaacttca aaaaaaatgt tttgtctgca gtttgttatt gcatagtaaa taaaaccttc 1140tctccagcac aaaggcatgg aaattcagga attacaatga tgcggaagaa agcaaagttt 1200tccctcagag agaatccagt ggaggaaacc aaaggagaag cattcagtga tggcaacatt 1260gaagtcaaat tgtgtgaaca gacagaggag aagaaaaagc tcaaacgaca tcttgctctc 1320tttaggtctg aactggctga gaattctcct ttagacagtg ggcattaa 136871296DNAHomo sapiens 7atgcaggcgc ttaacattac cccggagcag ttctctcggc tgctgcggga ccacaacctg 60acgcgggagc agttcatcgc agttcatcgc ctgcgaccgc tcgtctacac cccagagctg 120ccgggacgcg ccaagctggc cctcgtgctc accggcgtgc tcatcttcgc cctggcgctc 180tttggcaatg ctctggtgtt ctacgtggtg acccgcagca aggccatgcg caccgtcacc 240aacatcttta tctgctcctt ggcgctcagt gacctgctca tcaccttctt ctgcattccc 300gtcaccatgc tccagaacat ttccgacaac tggctggggg gtgctttcat ttgcaagatg 360gtgccatttg tccagtctac cgctgttgtg acagaaatcc tcactatgac ctgcattgct 420gtggaaaggc accagggact tgtgcatcct tttaaaatga agtggcaata caccaaccga 480agggctttca caatgctagg tgtggtctgg ctggtggcag tcatcgtagg atcacccatg 540tggcacgtgc aacaacttga gatcaaatat gacttcctat atgaaaagga acacatctgc 600tgcttagaag agtggaccag ccctgtgcac cagaagatct acaccacctt catccttgtc 660atcctcttcc tcctgcctct tatggtgatg cttattctgt acagtaaaat tggttatgaa 720ctttggataa agaaaagagt tggggatggt tcagtgcttc gaactattca tggaaaagaa 780atgtccaaaa tagccaggaa gaagaaacga gctgtcatta tgatggtgac agtggtggct 840ctctttgctg tgtgctgggc accattccat gttgtccata tgatgattga atacagtaat 900tttgaaaagg aatatgatga tgtcacaatc aagatgattt ttgctatcgt gcaaattatt 960ggattttcca actccatctg taatcccatt gtctatgcat ttatgaatga aaacttcaaa 1020aaaaatgttt tgtctgcagt ttgttattgc atagtaaata aaaccttctc tccagcacaa 1080aggcatggaa attcaggaat tacaatgatg cggaagaaag caaagttttc cctcagagag 1140aatccagtgg aggaaaccaa aggagaagca ttcagtgatg gcaacattga agtcaaattg 1200tgtgaacaga cagaggagaa gaaaaagctc aaacgacatc ttgctctctt taggtctgaa 1260ctggctgaga attctccttt agacagtggg cattaa 129684350DNAHomo sapiens 8agttgaggga ttgacacaaa tggtcaggcg gcggcggcgg agaaggaggc ggaggcgcag 60gggggagccg agcccgctgg gctgcggaga gttgcgctct ctacggggcc gcggccacta 120gcgcggcgcc gccagccggg agccagcgag ccgagggcca ggaaggcggg acacgacccc 180ggcgcgccct agccacccgg gttctccccg ccgcccgcgc ttcatgaatc gcaagtttcc 240gcggcggcgg cggctgcggt acgcagaaca ggagccgggg gagcgggccg aaagcggctt 300gggctcgacg gagggcaccc gcgcagaggt ctccctggcc gcagggggag ccgccgccgg 360ccgtgcccct ggcagcccca gcggagcggc gccaagagag gagccgagaa agtatggctg 420aggaggaggc gcctaagaag tcccgggccg ccggcggtgg cgcgagctgg gaactttgtg 480ccggggcgct ctcggcccgg ctggcggagg agggcagcgg ggacgccggt ggccgccgcc 540gcccgccagt tgacccccgg cgattggcgc gccagctgct gctgctgctt tggctgctgg 600aggctccgct gctgctgggg gtccgggccc aggcggcggg ccaggggcca ggccaggggc 660ccgggccggg gcagcaaccg ccgccgccgc ctcagcagca acagagcggg cagcagtaca 720acggcgagcg gggcatctcc gtcccggacc acggctattg ccagcccatc tccatcccgc 780tgtgcacgga catcgcgtac aaccagacca tcatgcccaa cctgctgggc cacacgaacc 840aggaggacgc gggcctggag gtgcaccagt tctaccctct agtgaaagtg cagtgttccg 900ctgagctcaa gttcttcctg tgctccatgt acgcgcccgt gtgcaccgtg ctagagcagg 960cgctgccgcc ctgccgctcc ctgtgcgagc gcgcgcgcca gggctgcgag gcgctcatga 1020acaagttcgg cttccagtgg ccagacacgc tcaagtgtga gaagttcccg gtgcacggcg 1080ccggcgagct gtgcgtgggc cagaacacgt ccgacaaggg caccccgacg ccctcgctgc 1140ttccagagtt ctggaccagc aaccctcagc acggcggcgg agggcaccgt ggcggcttcc 1200cggggggcgc cggcgcgtcg gagcgaggca agttctcctg cccgcgcgcc ctcaaggtgc 1260cctcctacct caactaccac ttcctggggg agaaggactg cggcgcacct tgtgagccga 1320ccaaggtgta tgggctcatg tacttcgggc ccgaggagct gcgcttctcg cgcacctgga 1380ttggcatttg gtcagtgctg tgctgcgcct ccacgctctt cacggtgctt acgtacctgg 1440tggacatgcg gcgcttcagc tacccggagc ggcccatcat cttcttgtcc ggctgttaca 1500cggccgtggc cgtggcctac atcgccggct tcctcctgga agaccgagtg gtgtgtaatg 1560acaagttcgc cgaggacggg gcacgcactg tggcgcaggg caccaagaag gagggctgca 1620ccatcctctt catgatgctc tacttcttca gcatggccag ctccatctgg tgggtgatcc 1680tgtcgctcac ctggttcctg gcggctggca tgaagtgggg ccacgaggcc atcgaagcca 1740actcacagta ttttcacctg gccgcctggg ctgtgccggc catcaagacc atcaccatcc 1800tggcgctggg ccaggtggac ggcgatgtgc tgagcggagt gtgcttcgtg gggcttaaca 1860acgtggacgc gctgcgtggc ttcgtgctgg cgcccctctt cgtgtacctg tttatcggca 1920cgtcctttct gctggccggc tttgtgtcgc tcttccgcat ccgcaccatc atgaagcacg 1980atggcaccaa gaccgagaag ctggagaagc tcatggtgcg cattggcgtc ttcagcgtgc 2040tgtacactgt gccagccacc atcgtcatcg cctgctactt ctacgagcag gccttccggg 2100accagtggga acgcagctgg gtggcccaga gctgcaagag ctacgctatc ccctgccctc 2160acctccaggc gggcggaggc gccccgccgc acccgcccat gagcccggac ttcacggtct 2220tcatgattaa gtaccttatg acgctgatcg tgggcatcac gtcgggcttc tggatctggt 2280ccggcaagac cctcaactcc tggaggaagt tctacacgag gctcaccaac agcaaacaag 2340gggagactac agtctgagac ccggggctca gcccatgccc aggcctcggc cggggcgcag 2400cgatccccca aagccagcgc cgtggagttc gtgccaatcc tgacatctcg aggtttcctc 2460actagacaac tctctttcgc aggctccttt gaacaactca gctcctgcaa aagcttccgt 2520ccctgaggca aaaggacacg agggcccgac tgccagaggg aggatggaca gacctcttgc 2580cctcacactc tggtaccagg actgttcgct tttatgattg taaatagcct gtgtaagatt 2640tttgtaagta tatttgtatt taaatgacga ccgatcacgc gtttttcttt ttcaaaagtt 2700tttaattatt tagggcggtt taaccatttg aggcttttcc ttcttgccct tttcggagta 2760ttgcaaagga gctaaaactg gtgtgcaacc gcacagcgct cctggtcgtc ctcgcgcgcc 2820tctccctacc acgggtgctc gggacggctg ggcgccagct ccggggcgag ttcagcactg 2880cggggtgcga ctagggctgc gctgccaggg tcacttcccg cctcctcctt ttgccccctc 2940cccctccttc tgtcccctcc ctttctttcc tggcttgagg taggggctct taaggtacag 3000aactccacaa accttccaaa tctggaggag ggcccccata cattacaatt cctcccttgc 3060tcggcggtgg attgcgaagg cccgtccctt cgacttcctg aagctggatt tttaactgtc 3120cagaactttc ctccaacttc atgggggccc acgggtgtgg gcgctggcag tctcagcctc 3180cctccacggt caccttcaac gcccagacac tcccttctcc caccttagtt ggttacaggg 3240tgagtgagat aaccaatgcc aaactttttg aagtctaatt tttgaggggt gagctcattt 3300cattctctag tgtctaaaac ctggtatggg tttggccagc gtcatggaaa gatgtggtta 3360ctgagatttg ggaagaagca tgaagctttg tgtgggttgg aagagactga agatatgggt 3420tataaaatgt taattctaat tgcatacgga tgcctggcaa ccttgccttt gagaatgaga 3480cagcctgcgc ttagatttta ccggtctgta aaatggaaat gttgaggtca cctggaaagc 3540tttgttaagg agttgatgtt tgctttcctt aacaagacag caaaacgtaa acagaaattg 3600aaaacttgaa ggatatttca gtgtcatgga cttcctcaaa atgaagtgct attttcttat 3660ttttaatcaa ataactagac atatatcaga aactttaaaa tgtaaaagtt gtacactttc 3720aacattttat tacgattatt attcagcagc acattctgag gggggaacaa ttcacaccac 3780caataataac ctggtaagat ttcaggaggt aaagaaggtg gaataattga cggggagata 3840gcgcctgaaa taaacaaaat atgggcatgc atgctaaagg gaaaatgtgt gcaggtctac 3900tgcattaaat cctgtgtgct cctcttttgg atttacagaa atgtgtcaaa tgtaaatctt 3960tcaaagccat ttaaaaatat tcactttagt tctctgtgaa gaagaggaga aaagcaatcc 4020tcctgattgt attgttttaa actttaagaa tttatcaaaa tgccggtact taggacctaa 4080atttatctat gtctgtcata cgctaaaatg atattggtct ttgaatttgg tatacattta 4140ttctgttcac tatcacaaaa tcatctatat ttatagagga atagaagttt atatatatat 4200aataccatat ttttaatttc

acaaataaaa aattcaaagt tttgtacaaa attatatgga 4260ttttgtgcct gaaaataata gagcttgagc tgtctgaact attttacatt ttatggtgtc 4320tcatagccaa tcccacagtg taaaaattca 43509952DNAHomo sapiens 9ttggtccaag caagaaggca gtggtctact ccatcggcaa catgctggtc ctttatggac 60acagcaccca ggaccttccg gaaaccaatg cccgcgtagt cggagggact gaggccggga 120ggaattcctg gccctctcag atttccctcc agtaccggtc tggaggttcc cggtatcaca 180cctgtggagg gacccttatc agacagaact gggtgatgac agctgctcac tgcgtggatt 240accagaagac tttccgcgtg gtggctggag accataacct gagccagaat gatggcactg 300agcagtacgt gagtgtgcag aagatcgtgg tgcatccata ctggaacagc gataacgtgg 360ctgccggcta tgacatcgcc ctgctgcgcc tggcccagag cgttaccctc aatagctatg 420tccagctggg tgttctgccc caggagggag ccatcctggc taacaacagt ccctgctaca 480tcacaggctg gggcaagacc aagaccaatg ggcagctggc ccagaccctg cagcaggctt 540acctgccctc tgtggactac gccatctgct ccagctcctc ctactggggc tccactgtga 600agaacaccat ggtgtgtgct ggtggagatg gagttcgctc tggatgccag ggtgactctg 660ggggccccct ccattgcttg gtgaatggca agtattctgt ccatggagtg accagctttg 720tgtccagccg gggctgtaat gtctccagga agcctacagt cttcacccag gtctctgctt 780acatctcctg gataaataat gtcatcgcct ccaactgaac attttcctga gtccaacgac 840cttcccaaaa tggttcttag atctgcaata ggacttgcga tcaaaaagta aaacacattc 900tgaaagacta ttgagccatt gatagaaaag caaataaaac tagatataca tt 952109372DNAHomo sapiens 10tgaataattg aactttgttt atttctccat atttttgcag tggtaattcc attataaaac 60ctaatgaaac aatgttttta tagatggtgt ggaaagactt ttctgggctc agaggtgaaa 120ctgacccttg tgtatcagca gcatttctga ctgactgaga gagtgtagtg attaacagag 180ttgtgatgtt agttaagaaa cttagatttg ccattgtagc ttttctacca attagcagat 240tgtttaactc actgaaattg taaagtggta gacgtggact tagtcattac tgggcagctt 300atgaattgta ttcatttact catgatgtaa aaatggttag tctccacttt taaggctcta 360gttctagtgg ctaaataggt acttatttat acagtatgat aactgctgta ttaaaataca 420tgtctcaaat gtggaatagt agaagaggtg aagaaaatca tagtttgagg tagaatactg 480tttgctggtc ttaaaaactg tggtattttg gtgattccat aaattaggtc agatacttcc 540actggaggga aacagtttaa aggatatatg tgatactatt aatagaatga ggaagacaca 600ccagatattt aggagggaat tagcgagctt gaaactaaga gctggtttga atgagactgg 660gtcataagtg atttcaagta ccagattaag gcactgagat tttattttta agcactgaag 720tcagattttt tccttttaaa agaaaggatt catgatgaaa tctgcttttt gttttgcaga 780gagcttggag ataattctgg tggctgtgtg gagtatgtgt tggaggtatt aaattttcac 840agtatatata aggcagcaat tgataggcct ttcacagatt cttctgataa ctacataaag 900agacaaaaaa aagaaaaaag agcaaagatc tgtgctgtgt caagtatgac agccatcact 960catggctctc cagtaggagg gaacgacagc cagggccagg ttcttgatgg ccagtctcag 1020catctcttcc aacagaacca gacttcatca cctgattctt ccaatgagaa ttccgtagca 1080actcctcctc cagaggaaca agggcaaggt gatgccccac cacagcatga agatgaagag 1140cctgcatttc cacatactga gctggcaaac ctggatgaca tgatcaacag gcctcgatgg 1200gtggttcctg ttttgccaaa aggggaatta gaagtgcttt tagaagctgc tattgatctt 1260agtgtaaaag gccttgatgt taaaagtgaa gcatgccaac gtttttttcg agatggacta 1320acaatatctt tcactaaaat tcttatggat gaggctgtga gtggctggaa gtttgaaatt 1380catagatgta ttattaacaa tactcatcgc ctagtggagc tttgtgtggc caagttgtcc 1440caagattggt ttccacttct agaacttctc gccatggcct taaatcctca ctgcaagttt 1500catatctaca atggtacacg tccgtgtgaa ttaatttcct caaatgctca gttgcctgaa 1560gaagaattat ttgctcgttc ttcagatcct cgatcaccaa aaggttggct agtggatctc 1620atcaataaat ttggcacatt aaatgggttc cagattttgc atgatcgttt ttttaatgga 1680tcagcattaa atattcaaat aattgcagct cttattaaac catttggaca atgctatgag 1740tttctcagtc aacatacact gaaaaagtac ttcattccag ttatagaaat agttccacat 1800ttattggaaa acttaactga tgaagaactg aaaaaggagg caaagaatga agccaaaaat 1860gatgcccttt caatgattat taaatctttg aagaacttag cttcaagaat ttcaggacaa 1920gatgagacta taaaaaattt ggaaattttt aggttaaaga tgatactcag attgttgcaa 1980atttcctctt ttaatggaaa gatgaatgca ctgaatgaaa taaataaggt tatatctagt 2040gtatcatatt atactcatcg gcatagtaat cctgaggagg aagaatggct gacagctgag 2100cgaatggcag aatggataca gcaaaataat atcttatcca tagtcttgca agacagtctt 2160catcaaccac aatatgtaga aaagctagag aaaattcttc gttttgtgat taaagaaaag 2220gctcttacat tacaggacct tgataatatc tgggcagcac aggcaggaaa acatgaagcc 2280attgtgaaga atgtacatga tctgctagca aagttggctt gggatttttc tcctggacaa 2340cttgatcatc tttttgattg ctttaaggca agttggacaa atgcaagtaa aaagcaacgt 2400gaaaagctcc ttgagttgat acgccgtctt gcagaagatg ataaagatgg tgtgatggca 2460cacaaagtgt tgaaccttct ttggaacctg gctcagagtg atgatgtgcc tgtagacatc 2520atggaccttg ctcttagtgc ccacataaaa atactagatt atagttgttc ccaggatcga 2580gatgcacaga agatccagtg gatagatcac tttatagaag aacttcgcac aaatgacaag 2640tgggtaattc ctgctctgaa acaaataaga gaaatttgta gtttgtttgg tgaagcatct 2700caaaatttga gtcaaactca gcgaagtccc cacatatttt atcgccatga tttaatcaac 2760cagcttcaac aaaatcatgc tttagttact ttggtagcag aaaaccttgc aacctacatg 2820aatagcatca gattgtatgc tggagatcat gaagactatg atccacaaac agtgaggctt 2880ggaagtcgat acagtcatgt tcaagaagtt caagaacgac taaacttcct tagattttta 2940ctgaaggatg gccaactgtg gctctgtgct cctcaggcaa aacaaatatg gaagtgctta 3000gcagaaaatg cagtttatct ttgtgatcgt gaagcctgtt ttaagtggta ttccaagtta 3060atgggggatg aaccagactt ggatcctgat attaataagg acttctttga aagtaatgta 3120cttcagcttg atccttccct tttaactgaa aatggaatga aatgctttga aagatttttc 3180aaagctgtca attgtcgaga aaggaaacta atagcaaaaa gaagatccta tatgatggat 3240gatttggaat taattggact agactacctt tggagggttg tgattcagag tagtgacgag 3300attgctaaca gagctataga tcttcttaaa gagatataca caaaccttgg cccaagatta 3360aaagccaatc aggtggttat ccatgaagac ttcattcagt cttgctttga tcgtttaaaa 3420gcatcatatg atacactgtg tgtttttgat ggtgacaaaa acagcattaa ttgtgcaaga 3480caagaagcca ttcgaatggt tagagtatta actgttataa aagagtacat taatgaatgt 3540gacagtgatt atcacaagga aagaatgatt ttacctatgt cgagagcatt ttgtggcaaa 3600cacctctctc ttatagttcg gtttccaaac cagggcagac aggttgatga gttggatata 3660tggtttcata cgaatgacac aattggttca gtacggcgat gtattgttaa tcgtattaaa 3720gccaatgtag cccacaaaaa aattgaactt tttgtgggtg gtgagctgat agattctgaa 3780aatgacagaa agctaattgg acaattaaac ttaaaagata aatctctaat tacagccaaa 3840cttacacaaa taaatttcaa tatgccatca agtcctgata gctcttccga ttcctcaact 3900gcatctcctg gaaaccaccg taatcattac aatgatggtc ccaatctaaa ggtggaaagt 3960tgtttgcctg gggtgataat gtcagtgcat cccaaataca tctctttcct ttggcaattt 4020gcaaacttag gtagcaacct gaatatgcca cctcttaaaa atggagcaag agtacttatg 4080aaacttatgc caccagatag aacagctgta gaaaaattac gaactgtttg tttggaccat 4140gcaaaccttg gagaaggcaa acttagtcca ccccttgact cccttttctt tggtccttct 4200gcctcccaag ttctatacct aacagaggta gtttatgcct tgttaatgcc tgctggtgtg 4260cctctaactg atgggtcctc tgactttcaa gttcacttct tgaaaagtgg tggcttacct 4320cttgtactga gtatgctaat aagaaataac ttcttgccaa atacagatat ggaaactcga 4380aggggtgctt atttaaatgc tcttaaaata gccaaactgt tgttaactgc gattggctat 4440ggccatgttc gagctgtagc agaagcttgt cagccagttg tagatggtac agaccccata 4500acacagatta accaagttac tcatgatcaa gcagtggtgc tacaaagtgc ccttcagagc 4560attcctaatc cctcatccga gtgcgtactt agaaatgagt ccatacttct tgctcaggaa 4620atatctaatg aggcttcaag atatatgcct gatatttgtg taattagggc tatacagaaa 4680attatctggg catcagcatg tggggcatta ggactatttt ttagcccaaa tgaagaaata 4740actaaaattt atcagatgac caccaatgga agcaataagc tggaggtgga agatgaacaa 4800gtttgttgtg aagcactgga agtgatgacc ttatgttttg ctttacttcc aacagcgttg 4860gatgcactta gtaaagaaaa agcctggcag accttcatca ttgacttatt attgcactgt 4920ccaagcaaaa ctgttcgtca gttggcacag gagcagttct ttttaatgtg caccagatgt 4980tgcatgggac acaggcctct gcttttcttc attactttac tctttaccat actggggagc 5040acagcaagag agaagggtaa atattcaggt gattatttca cacttttacg gcaccttctc 5100aattatgctt acaatggcaa tattaacata cccaatgctg aagttcttct tgtcagtgaa 5160attgattggc tcaaaaggat tagggataat gttaaaaaca caggtgaaac aggtgtcgaa 5220gagccaatac tggaaggcca ccttggggta acaaaagagt tattggcctt tcaaacttct 5280gagaaaaagt atcactttgg ttgtgaaaaa ggaggtgcta atctcattaa agaattaatt 5340gatgatttca tctttcccgc atccaaagtt tacctgcagt atttaagaag tggagaacta 5400ccagctgagc aggctattcc agtctgtagt tcacccgtta ccatcaatgc cggttttgag 5460ctacttgtag cattagctat tggctgtgtg aggaatctca aacagatagt agactgtttg 5520actgaaatgt attacatggg cacagcaatt actacttgtg aagcacttac tgagtgggaa 5580tatctgcccc ctgttggacc ccgcccacca aaaggatttg tgggactcaa aaatgctggt 5640gctacgtgtt acatgaactc tgtgatccag cagctataca tgattccttc tatcaggaac 5700agtattcttg caattgaagg cacaggtagt gatttacacg atgatatgtt cggggatgag 5760aagcaggaca gtgagagtaa tgttgatccc cgagatgatg tatttggata tcctcatcaa 5820tttgaagaca agccagcatt aagtaagaca gaagatagga aagagtataa tattggtgtc 5880ctaagacacc ttcaggtcat ctttggtcat ttagctgctt cccaactaca atactatgta 5940cccagaggat tttggaaaca gttcaggctt tggggtgaac ctgttaatct ccgtgaacaa 6000catgatgcct tagagttttt taattctttg gtggatagtt tagatgaagc tttaaaagct 6060ttaggacacc cggctatact aagtaaagtc ctaggaggct cctttgctga tcagaagatc 6120tgccagggct gcccacatag gtttgaatgt gaagaatctt ttacaacttt gaatgtggat 6180attagaaatc atcaaaatct tcttgactct ttggaacagt atatcaaagg agatttattg 6240gaaggtgcaa atgcatatca ttgtgaaaaa tgtgataaaa aggttgacac agtaaagcgc 6300ctgctaatta aaaaattgcc tcgggttctt gctatccaac tcaaacgatt tgactatgac 6360tgggaaagag aatgtgcaat taaattcaat gattattttg aatttcctcg agagctggat 6420atgggacctt acacagtagc aggtgttgca aacctggaaa gggataatgt aaactcagaa 6480aatgagttga ttgaacagaa agagcagtct gacaatgaaa ctgcaggagg cacaaagtac 6540agacttgtag gagtgcttgt acacagtggt caagcaagcg gtgggcatta ttattcttac 6600atcattcaaa ggaatggtaa agatgatcag acagatcact ggtataaatt tgatgatgga 6660gatgtaacag aatgcaaaat ggatgatgat gaagaaatga aaaatcagtg ttttggtgga 6720gagtacatgg gagaagtatt tgatcacatg atgaagcgca tgtcatatag gcgacagaag 6780aggtggtgga atgcttacat acctttttat gaacaaatgg atatgataga tgaagatgat 6840gagatgataa gatacatatc agagctaact attgcaagac cccatcagat cattatgtca 6900ccagccattg agagaagtgt acggaaacaa aatgtgaaat ttatgcataa ccgattgcaa 6960tatagtttag agtattttca gtttgtgaaa aaactgctta catgtaatgg tgtttattta 7020aaccctgctc cagggcagga ttatttgttg cctgaagcag aagaaattac tatgattagt 7080attcagcttg ctgctagatt cctctttacc actggatttc acaccaagaa aatagttcgt 7140ggtcctgcca gtgactggta tgatgcactg tgcgttcttc tccgtcacag caaaaatgta 7200cgtttttggt ttactcataa tgtccttttt aatgtatcaa atcgcttctc tgaatacctc 7260ctggagtgcc ctagtgcaga agtgaggggt gcatttgcaa aacttatagt gtttattgca 7320cacttttcct tgcaagatgg gtcttgtcct tctccttttg catctccagg accttctagt 7380caggcatgtg ataacttgag cttgagtgac cacttactaa gagccacact aaatctcttg 7440agaagggaag tttcagagca tggacatcat ttacagcaat attttaattt gtttgtaatg 7500tatgccaatt taggtgtggc agaaaaaaca cagcttctga aattgaatgt acctgctacc 7560tttatgcttg tgtctttaga cgagggacca ggtcctccaa tcaaatatca gtatgctgaa 7620ttaggcaagt tatattcagt agtgtctcag ctgattcgtt gttgcaatgt gtcatcaaca 7680atgcagtctt caatcaatgg taatccccct ctccccaatc ctttcggtga ccttaattta 7740tcacagccta taatgccaat tcagcagaat gtgttagaca ttttatttgt gagaacaagt 7800tatgtgaaga aaattattga agactgcagt aactcagagg ataccatcaa attacttcgc 7860ttttgctctt gggagaatcc tcagttctca tctactgtcc tcagcgaact tctctggcag 7920gttgcatatt catataccta tgaacttcgg ccatatttag atctactttt ccaaatttta 7980ctgattgagg actcctggca gactcacaga attcataatg cacttaaagg aattccagat 8040gacagagatg ggctgttcga tacaatacag cgctcgaaga atcactatca aaaacgagca 8100tatcagtgca taaaatgtat ggtagctcta tttagcagtt gtcctgttgc ttaccagatc 8160ttacagggta acggagatct taaaagaaaa tggacctggg cagtggaatg gctaggagat 8220gaacttgaaa gaagaccata tactggcaat cctcagtata gttacaacaa ttggtctcct 8280ccagtacaaa gcaatgaaac agcaaatggt tatttcttag aaagatcaca tagtgctagg 8340atgacacttg caaaagcttg tgaactctgt ccagaagagg agccagatga ccaggatgcc 8400ccagatgagc atgagccctc tccatcagaa gatgccccat tatatcctca ttcacctgcc 8460tctcagtatc aacagaataa tcatgtacat ggacagccat atacaggacc agcagcacat 8520cacttgaaca accctcagaa aacaggccaa cgaacacaag aaaattatga aggcaatgaa 8580gaagtatcct cacctcagat gaaggatcag tgaaaagcaa taattaactg cttcctttat 8640gactatgcac taaggtctta tagtccaaac tttctctgtg tctggctagt attgaaaact 8700agataaactg ctccaaacca acatggagta aagagcatat tcactggttt atttgcagta 8760atttgcaatt tgtcagtgta taagacacat gcagggtgaa gtgtacagag ttttgtaaca 8820aatgactggt cctaatctgt aaatgagaaa ggtatatata ctatgttaat gtctgactgt 8880taattcttaa gcaagaaact ttttttgatg aaaacaagtc agatctacac agtcacacaa 8940ttattttttg ttgtgttcac tacattgtgc aattgatatt gcctgctttg agcagtttgg 9000tcaacttacc aacttccccc caaaaaaggg aacataaaag agcccatctt tgtcagttta 9060caccaatagt ttcttgttaa tccttctttc ctggatatat aaggctggtg gtaacttttg 9120aattatatgg ttgatgtgga aaattggcag tgtaacattt ctagatactt ttcattacct 9180ttttattctg gtatataggc taaccacttt aaagctattc ttatgctgta acagttagca 9240tggcttcaca ctgtttgtgt agccaagagg acagaattac atgaatgaca gtgcccagag 9300tgacagctgt atattgctca gagcttttat ttcttatacc tagaataaat ataaaatggg 9360ggaaaaaaaa aa 9372111593DNAHomo sapiens 11ctgggagcgc ggcgtaggtg gctgccgagt cttttcctgt ttagggtctt atcctggcat 60tgagggcgcc ggactggcgc ttttggccgg cttggcattg ggtgggcggc ttcttgggac 120ccacatgagc cagtggcatc atccccgcag tggctggggc cggagacgcg acttttcagg 180acgctcctca gccaagaaga agggcggaaa ccacatcccc gaaaggtgga aagactatct 240cccagttgga cagcggatgc ctgggactcg tttcattgct ttcaaagttc ctttgcaaaa 300gagttttgaa aagaaacttg ctccagaaga atgcttttcc cctttggatc tttttaacaa 360aatccgagaa caaaatgaag aacttggact gattattgat ttaacatata ctcaacgcta 420ttataaacca gaggatttgc cagaaactgt tccttactta aaaattttta cagttggaca 480tcaagtgcct gatgatgaga ctatttttaa attcaaacac gctgttaatg ggtttttgaa 540agaaaataaa gataatgata aacttattgg tgtccactgt acccatggtt taaacaggac 600tggctacctc atttgcagat atttgattga tgtagaaggc gtgaggccag atgatgcaat 660tgaattattc aataggtgcc ggggacattg cttagaaaga caaaactaca ttgaagacct 720tcagaatggt cctatcagaa agaattggaa ttccagtgta cccaggtcaa gtgattttga 780agactcagca catctcatgc aaccagtcca caataagcct gttaaacaag gacctaggta 840taatctacat cagatccagg gtcactcagc tcctcgacat ttccacaccc agacccaaag 900tttgcaacaa tcagtcagaa aattttcaga gaatccacat gtttaccaga gacaccatct 960ccctcctcct ggtccccctg gagaggacta ttcacacagg aggtattctt ggaatgtgaa 1020gcccaatgcc agtcgggcag cccaggatag aagaaggtgg tatccttata attactccag 1080actctcctat ccagcctgtt gggaatggac ccagtgatac aaacctgtcc tggaattcta 1140cctggagacc agagctggcc tgaaaattac tggtgtgact tttaattagt tcaggtctaa 1200tcaggtttct ttattgttcc cttatgtatt caagcttaag gaaaaattgc attgctgttt 1260acctctttgc tgataaattt gcagtaatta cagcattgca ggaaaaacaa tctgttattc 1320cagtcttaaa tttttctaaa agaagacaat attttagaac tgaagcattg agaacttccc 1380ttgcaaatta tttttaaaat tctatcttgt ttttctatgt atttctttct gactagactt 1440gtgatatgcg tgtgtttatg tacagaaatt tttagtgttt ttgttatgtt ctgttattga 1500cccaaaggcc atctttattt tctataactg ttcaaaattt atattaaaat ctacttagga 1560gataatttct ttagaaaaaa aaaaaaaaaa aaa 1593124116DNAHomo sapiens 12cgccgctctc cgcctcgctt gctcctgccg ggcgtgcagg gccccgccgc cgccatgtcg 60ggctcgttcg agctctcggt gcaggatctc aacgacctgc tctcggacgg cagcggctgc 120tacagcctcc cgagccagcc ctgcaacgag gtcaccccgc ggatctacgt gggcaacgcg 180tctgtggctc aggacatccc caagctgcag aaactaggca tcacccatgt gctgaacgcg 240gctgagggca ggtccttcat gcacgtcaac accaatgcca acttctacaa ggactccggc 300atcacatacc tgggcatcaa ggccaacgac acacaggagt tcaacctcag cgcttacttt 360gaaagggctg ccgacttcat tgaccaggct ttggctcaaa agaatggccg ggtgctcgtc 420cactgccggg aaggttatag ccgctcccca acgctagtta tcgcctacct catgatgcgg 480cagaagatgg acgtcaagtc tgccctgagc atcgtgaggc agaaccgtga gatcggcccc 540aacgatggct tcctggccca gctctgccag ctcaatgaca gactagccaa ggaggggaag 600ttgaaaccct agggcacccc caccgcctct gctcgagagg tccgtggggg aggccgtggg 660caaaggtgtc ccgagctgcc atgtttagga aacacactgt accctgctcc cagcatcaca 720aggcacttgt ctacaagtgt gtcccaacac agtcctgggc cactttcccc accctgggga 780gcacataaag aagcttgcca aggggggcgt ccttgctccc cagttgtcct gtttctgtaa 840cttatgatgt cttttccctg agatgggggc tcagaggggg aaggcctgtg gcctgcatgc 900ttcccgatgg cccacggcag gaggtgtgtg gaagtgtaag gcctaagatg ctcacagagg 960tccctcatga cctcccttcc ccaactcccg aatcctctct tgagtgtgga cctcaacacc 1020ttgagcccta gtaaaggaac tatgcaaatg caggccactc tccccaccac gtctgtgccc 1080cgcactgtcc ccacagcctt ccacaccctg tgcataggca gccctctcac gtcttgaggt 1140ccgaagctgg ggtgggggtg tccgtcagtt attagtggat ggagattccc acagcaaggc 1200tgcatttgaa tgatttcctt aggatgaatg gtccctacac aaagaggcct tgtgggcaaa 1260cctggagaac cctcctaaat ccatagagtt ttcaaaatgt gaatctttgg aagccttgag 1320ttcagaatct gctgctctgg aatatttccc ttcgatctta tctcagtcac ttcgtttttg 1380agaagagtga tgccttgggc atgctttttt ttttttcttt tttagaaaac agggagttga 1440agtccaacct atttaaaaac cccaccattt ggagaattac aagggttttg tcctgaattg 1500tagtgttggc aagcccaagc cactcgtgct aactgctttt tgtctcggtt gctattccaa 1560gaacagaagg aggaagttgg ccaattacag cgtgtgtgca tggatgtgtg tggggggcgt 1620gcctctcaga aacgcggcca gaagacaagc agggaagtga aaggtcccag gcacacaccc 1680tgcccattgc aggtggctct tacagctctc tggtgccagc acgggatccc tgaagtgact 1740cagccaggca gacatgagac atggcggagt gtccaaatgg atcctttatt ggtggtagag 1800caaaaaaacc caaacacgat aaacctttca aaagactttc taaggatgat attggaatgc 1860accagccctc acatgtgtat gcacatttgc cagaatataa gagttttgtt ttaaatacag 1920tcttgttagg attttacgtt attgttatta tggaaagtga ttgtgatgct atttatcttc 1980agggtcactc tgggcaaaga gaaggtcctc agccatgccc ccagcacctt gcacataggt 2040gtctgataaa agtttaagaa attaaacact ttttgagcac caaatatata tagggcattg 2100ttctggtggg tgtgtcacgc tcccagaaga ctgaatttat ggtaggatca ctcgcaaggc 2160cttgtgaagg agtcttacct aaaacaaaag aaatatcagg gacttttgtt gactatttac 2220aactcagttt tacatttaaa ttcaggcagt gttaatatgc caaggtaggg aatgtgcctt 2280tttcagagtt ggccaggagc tcctggctgg gacacggaga ggcaggtgtg gcgtaaggcc 2340tcactcccgg ctgtgaaggt ctctgatcac acagaagcag ccctgcccag cctggtcatt 2400tgctgtccgc ttttctctgt gaccacagca gccctgaaca accagtatgt gtcttcttct 2460ccagatagtg aaaaaggtgt ccagataaac ccacctaagt gaaatggcca tcctctaaac 2520tgggtacctc actgcacagc ttctaggtag ccttccaact taatctaact tgagcctcac 2580agtaaccctg taaagttagt agagcttgtt cttgtattgt gacctttttt aaaaaaaagg 2640aactgaggtt cagaatgatt aagggcctgg cccccagggt tgtccagctc cataaggtgg 2700agctgggcaa gattttgggt ttgctgctcc ctgaagctgg attctttcat acgatactct 2760ttctcaagaa gggggctccc tgggatctcc aggtgtactg cacttaccct caatccagcc

2820ccggagaagc aagtgaaaag ggtgggtccc tcataggcta gaatgtgcag ctctttctcc 2880aggtgggatg tagcacccca aagtagagct ttctgctctg ctcctggaaa aggctaggga 2940gctggggctg gggctcccct cccatgacca ggcagtggtc accccatggg acaggcacag 3000ctacttacgc gaacacagca ggttggtgtg gctggctaac taggacctct cgaaagtctc 3060tgtgggggca tgagggagaa aaggccattg ggagaattac tgcctttact ttgggactac 3120ttttatgctg ataacttggg atttcttgat agtccttcac ccctgaaacc ccgtatttac 3180ttaacaagat ttagctctta gttcttcaag taaaattaaa gtctcttgtg taagagccaa 3240cacatgccca gctgcggatg ggagctgttc ctggacagcc ttctactgcc tgggaagtga 3300tggaacagga actcagggtg cccttacccc ctccccagac ctgttccctt tctttgactg 3360acagagcacc atccaggcaa aattagagcg ccaaatggtt ttcttctcaa tcttaaagca 3420gtataccttt ccacaggctc gtctgtgtcc ctgccactct gagttatcca gaaaccacca 3480cctacaaatg aggggactca tctagaagac ctctaaggtc cccttttggc tctgaggggt 3540ctctaataat ccccacttgg aattcagcac cgcaaggaaa ttatgggtat gtgagccata 3600atatgatggc cagcaggtgg cgctgccttc cacccatggt gatggatggt ttggaaaggg 3660aatgttggtg ccttttgtgc cacaagttaa gatgctactg ttttaaagga aaaaaaaaaa 3720aaaaagtact gatcttcaat atgaagacat gagcttttct cgcaggaaat tttctttttc 3780acagaactgg tgtcaggaat cactgaaggg ctaaccgtga tagtccttgc aagtaagtca 3840aggttttatc ctgattggaa atagaagaca tttccggttg agagaacaga ttcgttggaa 3900gcttaacttt tgttgcctct taacgccacc aaattttagg gtaatttgat tatgaaagag 3960tgaatttttc tggacagaaa agggagagct accaaattgt ttttttcttt ttaaaaggaa 4020gtttaatgtc cgttgtatca caaatcagtg ttaaaacacc agaactttag ccaaaataaa 4080tgtcttacat tacaaaggta aaaaaaaaaa aaaaaa 4116133540DNAHomo sapiens 13ccagtttgct tcttggagaa cactggacag ctgaataaat gcagtatcta aatataaaag 60aggactgcaa tgccatggct ttctgtgcta aaatgaggag ctccaagaag actgaggtga 120acctggaggc ccctgagcca ggggtggaag tgatcttcta tctgtcggac agggagcccc 180tccggctggg cagtggagag tacacagcag aggaactgtg catcagggct gcacaggcat 240gccgtatctc tcctctttgt cacaacctct ttgccctgta tgacgagaac accaagctct 300ggtatgctcc aaatcgcacc atcaccgttg atgacaagat gtccctccgg ctccactacc 360ggatgaggtt ctatttcacc aattggcatg gaaccaacga caatgagcag tcagtgtggc 420gtcattctcc aaagaagcag aaaaatggct acgagaaaaa aaagattcca gatgcaaccc 480ctctccttga tgccagctca ctggagtatc tgtttgctca gggacagtat gatttggtga 540aatgcctggc tcctattcga gaccccaaga ccgagcagga tggacatgat attgagaacg 600agtgtctagg gatggctgtc ctggccatct cacactatgc catgatgaag aagatgcagt 660tgccagaact gcccaaggac atcagctaca agcgatatat tccagaaaca ttgaataagt 720ccatcagaca gaggaacctt ctcaccagga tgcggataaa taatgttttc aaggatttcc 780taaaggaatt taacaacaag accatttgtg acagcagcgt gtccacgcat gacctgaagg 840tgaaatactt ggctaccttg gaaactttga caaaacatta cggtgctgaa atatttgaga 900cttccatgtt actgatttca tcagaaaatg agatgaattg gtttcattcg aatgacggtg 960gaaacgttct ctactacgaa gtgatggtga ctgggaatct tggaatccag tggaggcata 1020aaccaaatgt tgtttctgtt gaaaaggaaa aaaataaact gaagcggaaa aaactggaaa 1080ataaagacaa gaaggatgag gagaaaaaca agatccggga agagtggaac aatttttcat 1140tcttccctga aatcactcac attgtaataa aggagtctgt ggtcagcatt aacaagcagg 1200acaacaagaa aatggaactg aagctctctt cccacgagga ggccttgtcc tttgtgtccc 1260tggtagatgg ctacttccgg ctcacagcag atgcccatca ttacctctgc accgacgtgg 1320cccccccgtt gatcgtccac aacatacaga atggctgtca tggtccaatc tgtacagaat 1380acgccatcaa taaattgcgg caagaaggaa gcgaggaggg gatgtacgtg ctgaggtgga 1440gctgcaccga ctttgacaac atcctcatga ccgtcacctg ctttgagaag tctgagcagg 1500tgcagggtgc ccagaagcag ttcaagaact ttcagatcga ggtgcagaag ggccgctaca 1560gtctgcacgg ttcggaccgc agcttcccca gcttgggaga cctcatgagc cacctcaaga 1620agcagatcct gcgcacggat aacatcagct tcatgctaaa acgctgctgc cagcccaagc 1680cccgagaaat ctccaacctg ctggtggcta ctaagaaagc ccaggagtgg cagcccgtct 1740accccatgag ccagctgagt ttcgatcgga tcctcaagaa ggatctggtg cagggcgagc 1800accttgggag aggcacgaga acacacatct attctgggac cctgatggat tacaaggatg 1860acgaaggaac ttctgaagag aagaagataa aagtgatcct caaagtctta gaccccagcc 1920acagggatat ttccctggcc ttcttcgagg cagccagcat gatgagacag gtctcccaca 1980aacacatcgt gtacctctat ggcgtctgtg tccgcgacgt ggagaatatc atggtggaag 2040agtttgtgga agggggtcct ctggatctct tcatgcaccg gaaaagtgat gtccttacca 2100caccatggaa attcaaagtt gccaaacagc tggccagtgc cctgagctac ttggaggata 2160aagacctggt ccatggaaat gtgtgtacta aaaacctcct cctggcccgt gagggaatcg 2220acagtgagtg tggcccattc atcaagctca gtgaccccgg catccccatt acggtgctgt 2280ctaggcaaga atgcattgaa cgaatcccat ggattgctcc tgagtgtgtt gaggactcca 2340agaacctgag tgtggctgct gacaagtgga gctttggaac cacgctctgg gaaatctgct 2400acaatggcga gatccccttg aaagacaaga cgctgattga gaaagagaga ttctatgaaa 2460gccggtgcag gccagtgaca ccatcatgta aggagctggc tgacctcatg acccgctgca 2520tgaactatga ccccaatcag aggcctttct tccgagccat catgagagac attaataagc 2580ttgaagagca gaatccagat attgtttcca gaaaaaaaaa ccagccaact gaagtggacc 2640ccacacattt tgagaagcgc ttcctaaaga ggatccgtga cttgggagag ggccactttg 2700ggaaggttga gctctgcagg tatgaccccg aagacaatac aggggagcag gtggctgtta 2760aatctctgaa gcctgagagt ggaggtaacc acatagctga tctgaaaaag gaaatcgaga 2820tcttaaggaa cctctatcat gagaacattg tgaagtacaa aggaatctgc acagaagacg 2880gaggaaatgg tattaagctc atcatggaat ttctgccttc gggaagcctt aaggaatatc 2940ttccaaagaa taagaacaaa ataaacctca aacagcagct aaaatatgcc gttcagattt 3000gtaaggggat ggactatttg ggttctcggc aatacgttca ccgggacttg gcagcaagaa 3060atgtccttgt tgagagtgaa caccaagtga aaattggaga cttcggttta accaaagcaa 3120ttgaaaccga taaggagtat tacaccgtca aggatgaccg ggacagccct gtgttttggt 3180atgctccaga atgtttaatg caatctaaat tttatattgc ctctgacgtc tggtcttttg 3240gagtcactct gcatgagctg ctgacttact gtgattcaga ttctagtccc atggctttgt 3300tcctgaaaat gataggccca acccatggcc agatgacagt cacaagactt gtgaatacgt 3360taaaagaagg aaaacgcctg ccgtgcccac ctaactgtcc agatgaggtt tatcagctta 3420tgagaaaatg ctgggaattc caaccatcca atcggacaag ctttcagaac cttattgaag 3480gatttgaagc acttttaaaa taagaagcat gaataacatt taaattccac agattatcaa 3540143541DNAHomo sapiens 14tccagtttgc ttcttggaga acactggaca gctgaataaa tgcagtatct aaatataaaa 60gaggactgca atgccatggc tttctgtgct aaaatgagga gctccaagaa gactgaggtg 120aacctggagg cccctgagcc aggggtggaa gtgatcttct atctgtcgga cagggagccc 180ctccggctgg gcagtggaga gtacacagca gaggaactgt gcatcagggc tgcacaggca 240tgccgtatct ctcctctttg tcacaacctc tttgccctgt atgacgagaa caccaagctc 300tggtatgctc caaatcgcac catcaccgtt gatgacaaga tgtccctccg gctccactac 360cggatgaggt tctatttcac caattggcat ggaaccaacg acaatgagca gtcagtgtgg 420cgtcattctc caaagaagca gaaaaatggc tacgagaaaa aaaagattcc agatgcaacc 480cctctccttg atgccagctc actggagtat ctgtttgctc agggacagta tgatttggtg 540aaatgcctgg ctcctattcg agaccccaag accgagcagg atggacatga tattgagaac 600gagtgtctag ggatggctgt cctggccatc tcacactatg ccatgatgaa gaagatgcag 660ttgccagaac tgcccaagga catcagctac aagcgatata ttccagaaac attgaataag 720tccatcagac agaggaacct tctcaccagg atgcggataa ataatgtttt caaggatttc 780ctaaaggaat ttaacaacaa gaccatttgt gacagcagcg tgtccacgca tgacctgaag 840gtgaaatact tggctacctt ggaaactttg acaaaacatt acggtgctga aatatttgag 900acttccatgt tactgatttc atcagaaaat gagatgaatt ggtttcattc gaatgacggt 960ggaaacgttc tctactacga agtgatggtg actgggaatc ttggaatcca gtggaggcat 1020aaaccaaatg ttgtttctgt tgaaaaggaa aaaaataaac tgaagcggaa aaaactggaa 1080aataaagaca agaaggatga ggagaaaaac aagatccggg aagagtggaa caatttttca 1140ttcttccctg aaatcactca cattgtaata aaggagtctg tggtcagcat taacaagcag 1200gacaacaaga aaatggaact gaagctctct tcccacgagg aggccttgtc ctttgtgtcc 1260ctggtagatg gctacttccg gctcacagca gatgcccatc attacctctg caccgacgtg 1320gcccccccgt tgatcgtcca caacatacag aatggctgtc atggtccaat ctgtacagaa 1380tacgccatca ataaattgcg gcaagaagga agcgaggagg ggatgtacgt gctgaggtgg 1440agctgcaccg actttgacaa catcctcatg accgtcacct gctttgagaa gtctgagcag 1500gtgcagggtg cccagaagca gttcaagaac tttcagatcg aggtgcagaa gggccgctac 1560agtctgcacg gttcggaccg cagcttcccc agcttgggag acctcatgag ccacctcaag 1620aagcagatcc tgcgcacgga taacatcagc ttcatgctaa aacgctgctg ccagcccaag 1680ccccgagaaa tctccaacct gctggtggct actaagaaag cccaggagtg gcagcccgtc 1740taccccatga gccagctgag tttcgatcgg atcctcaaga aggatctggt gcagggcgag 1800caccttggga gaggcacgag aacacacatc tattctggga ccctgatgga ttacaaggat 1860gacgaaggaa cttctgaaga gaagaagata aaagtgatcc tcaaagtctt agaccccagc 1920cacagggata tttccctggc cttcttcgag gcagccagca tgatgagaca ggtctcccac 1980aaacacatcg tgtacctcta tggcgtctgt gtccgcgacg tggagaatat catggtggaa 2040gagtttgtgg aagggggtcc tctggatctc ttcatgcacc ggaaaagtga tgtccttacc 2100acaccatgga aattcaaagt tgccaaacag ctggccagtg ccctgagcta cttggaggat 2160aaagacctgg tccatggaaa tgtgtgtact aaaaacctcc tcctggcccg tgagggaatc 2220gacagtgagt gtggcccatt catcaagctc agtgaccccg gcatccccat tacggtgctg 2280tctaggcaag aatgcattga acgaatccca tggattgctc ctgagtgtgt tgaggactcc 2340aagaacctga gtgtggctgc tgacaagtgg agctttggaa ccacgctctg ggaaatctgc 2400tacaatggcg agatcccctt gaaagacaag acgctgattg agaaagagag attctatgaa 2460agccggtgca ggccagtgac accatcatgt aaggagctgg ctgacctcat gacccgctgc 2520atgaactatg accccaatca gaggcctttc ttccgagcca tcatgagaga cattaataag 2580cttgaagagc agaatccaga tattgtttcc agaaaaaaaa accagccaac tgaagtggac 2640cccacacatt ttgagaagcg cttcctaaag aggatccgtg acttgggaga gggccacttt 2700gggaaggttg agctctgcag gtatgacccc gaagacaata caggggagca ggtggctgtt 2760aaatctctga agcctgagag tggaggtaac cacatagctg atctgaaaaa ggaaatcgag 2820atcttaagga acctctatca tgagaacatt gtgaagtaca aaggaatctg cacagaagac 2880ggaggaaatg gtattaagct catcatggaa tttctgcctt cgggaagcct taaggaatat 2940cttccaaaga ataagaacaa aataaacctc aaacagcagc taaaatatgc cgttcagatt 3000tgtaagggga tggactattt gggttctcgg caatacgttc accgggactt ggcagcaaga 3060aatgtccttg ttgagagtga acaccaagtg aaaattggag acttcggttt aaccaaagca 3120attgaaaccg ataaggagta ttacaccgtc aaggatgacc gggacagccc tgtgttttgg 3180tatgctccag aatgtttaat gcaatctaaa ttttatattg cctctgacgt ctggtctttt 3240ggagtcactc tgcatgagct gctgacttac tgtgattcag attctagtcc catggctttg 3300ttcctgaaaa tgataggccc aacccatggc cagatgacag tcacaagact tgtgaatacg 3360ttaaaagaag gaaaacgcct gccgtgccca cctaactgtc cagatgaggt ttatcagctt 3420atgagaaaat gctgggaatt ccaaccatcc aatcggacaa gctttcagaa ccttattgaa 3480ggatttgaag cacttttaaa ataagaagca tgaataacat ttaaattcca cagattatca 3540a 3541152982DNAHomo sapiens 15cgcaccccgc gcagcggctg agccgggagc cagcgcagcc tcggccccgc agctcaagcc 60tcgtccccgc cgccgccgcc gccgccgccg ccgccgcccc cggggcatgg cctgtctgat 120ggccgctttc tcggtcggca ccgccatgaa tgccagcagt tactctgcag agatgacgga 180gcccaagtcg gtgtgtgtct cggtggatga ggtggtgtcc agcaacatgg aggccactga 240gacggacctg ctgaatggac atctgaaaaa agtagataat aacctcacgg aagcccagcg 300cttctcctcc ttgcctcgga gggcagctgt gaacattgaa ttcagggacc tttcctattc 360ggttcctgaa ggaccctggt ggaggaagaa aggatacaag accctcctga aaggaatttc 420cgggaagttc aatagtggtg agttggtggc cattatgggt ccttccgggg ccgggaagtc 480cacgctgatg aacatcctgg ctggatacag ggagacgggc atgaaggggg ccgtcctcat 540caacggcctg ccccgggacc tgcgctgctt ccggaaggtg tcctgctaca tcatgcagga 600tgacatgctg ctgccgcatc tcactgtgca ggaggccatg atggtgtcgg cacatctgaa 660gcttcaggag aaggatgaag gcagaaggga aatggtcaag gagatactga cagcgctggg 720cttgctgtct tgcgccaaca cgcggaccgg gagcctgtca ggtggtcagc gcaagcgcct 780ggccatcgcg ctggagctgg tgaacaaccc tccagtcatg ttcttcgatg agcccaccag 840cggcctggac agcgcctcct gcttccaggt ggtctcgctg atgaaagggc tcgctcaagg 900gggtcgctcc atcatttgca ccatccacca gcccagcgcc aaactcttcg agctgttcga 960ccagctttac gtcctgagtc aaggacaatg tgtgtaccgg ggaaaagtct gcaatcttgt 1020gccatatttg agggatttgg gtctgaactg cccaacctac cacaacccag cagattttgt 1080catggaggtt gcatccggcg agtacggtga tcagaacagt cggctggtga gagcggttcg 1140ggagggcatg tgtgactcag accacaagag agacctcggg ggtgatgccg aggtgaaccc 1200ttttctttgg caccggccct ctgaagagga ctcctcgtcc atggaaggct gccacagctt 1260ctctgccagc tgcctcacgc agttctgcat cctcttcaag aggaccttcc tcagcatcat 1320gagggactcg gtcctgacac acctgcgcat cacctcgcac attgggatcg gcctcctcat 1380tggcctgctg tacttgggga tcgggaacga agccaagaag gtcttgagca actccggctt 1440cctcttcttc tccatgctgt tcctcatgtt cgcggccctc atgcctactg ttctgacatt 1500tcccctggag atgggagtct ttcttcggga acacctgaac tactggtaca gcctgaaggc 1560ctactacctg gccaagacca tggcagacgt gccctttcag atcatgttcc cagtggccta 1620ctgcagcatc gtgtactgga tgacgtcgca gccgtccgac gccgtgcgct ttgtgctgtt 1680tgccgcgctg ggcaccatga cctccctggt ggcacagtcc ctgggcctgc tgatcggagc 1740cgcctccacg tccctgcagg tggccacttt cgtgggccca gtgacagcca tcccggtgct 1800cctgttctcg gggttcttcg tcagcttcga caccatcccc acgtacctac agtggatgtc 1860ctacatctcc tatgtcaggt atgggttcga aggggtcatc ctctccatct atggcttaga 1920ccgggaagat ctgcactgtg acatcgacga gacgtgccac ttccagaagt cggaggccat 1980cctgcgggag ctggacgtgg aaaatgccaa gctgtacctg gacttcatcg tactcgggat 2040tttcttcatc tccctccgcc tcattgccta ttttgtcctc aggtacaaaa tccgggcaga 2100gaggtaaaac acctgaatgc caggaaacag gaagattaga cactgtggcc gagggcacgt 2160ctagaatcga ggaggcaagc ctgtgcccga ccgacgacac agagactctt ctgatccaac 2220ccctagaacc gcgttgggtt tgtgggtgtc tcgtgctcag ccactctgcc cagctgggtt 2280ggatcttctc tccattcccc tttctagctt taactaggaa gatgtaggca gattggtggt 2340tttttttttt ttaacataca gaattttaaa taccacaact ggggcagaat ttaaagctgc 2400aacacagctg gtgatgagag gcttcctcag tccagtcgct ccttagcacc aggcaccgtg 2460ggtcctggat ggggaactgc aagcagcctc tcagctgatg gctgcacagt cagatgtctg 2520gtggcagaga gtccgagcat ggagcgattc cattttatga ctgttgtttt tcacattttc 2580atctttctaa ggtgtgtctc ttttccaatg agaagtcatt tttgcaagcc aaaagtcgat 2640caatcgcatt cattttaaga aattatacct ttttagtact tgctgaagaa tgattcaggg 2700taaatcacat actttgttta gagaggcgag gggtttaacc gagtcaccca gctggtctca 2760tacatagaca gcacttgtga aggattgaat gcaggttcca ggtggaggga agacgtggac 2820accatctcca ctgagccatg cagacatttt taaaagctat acaaaaaatt gtgagaagac 2880attggccaac tctttcaaag tctttctttt tccacgtgct tcttatttta agcgaaatat 2940attgtttgtt tcttcctaaa aaaaaaaaaa aaaaaaaaaa aa 2982163018DNAHomo sapiens 16cgcaccccgc gcagcggctg agccgggagc cagcgcagcc tcggccccgc agctcaagcc 60tcgtccccgc cgccgccgcc gccgccgccg ccgccgcccc cggggcatgg cctgtctgat 120ggccgctttc tcggtcggca ccgccatgaa tgccagcagt tactctgcag agatgacgga 180gcccaagtcg gtgtgtgtct cggtggatga ggtggtgtcc agcaacatgg aggccactga 240gacggacctg ctgaatggac atctgaaaaa agtagataat aacctcacgg aagcccagcg 300cttctcctcc ttgcctcgga gggcagctgt gaacattgaa ttcagggacc tttcctattc 360ggttcctgaa ggaccctggt ggaggaagaa aggatacaag accctcctga aaggaatttc 420cgggaagttc aatagtggtg agttggtggc cattatgggt ccttccgggg ccgggaagtc 480cacgctgatg aacatcctgg ctggatacag ggagacgggc atgaaggggg ccgtcctcat 540caacggcctg ccccgggacc tgcgctgctt ccggaaggtg tcctgctaca tcatgcagga 600tgacatgctg ctgccgcatc tcactgtgca ggaggccatg atggtgtcgg cacatctgaa 660gcttcaggag aaggatgaag gcagaaggga aatggtcaag gagatactga cagcgctggg 720cttgctgtct tgcgccaaca cgcggaccgg gagcctgtca ggtggtcagc gcaagcgcct 780ggccatcgcg ctggagctgg tgaacaaccc tccagtcatg ttcttcgatg agcccaccag 840cggcctggac agcgcctcct gcttccaggt ggtctcgctg atgaaagggc tcgctcaagg 900gggtcgctcc atcatttgca ccatccacca gcccagcgcc aaactcttcg agctgttcga 960ccagctttac gtcctgagtc aaggacaatg tgtgtaccgg ggaaaagtct gcaatcttgt 1020gccatatttg agggatttgg gtctgaactg cccaacctac cacaacccag cagattttgt 1080catggaggtt gcatccggcg agtacggtga tcagaacagt cggctggtga gagcggttcg 1140ggagggcatg tgtgactcag accacaagag agacctcggg ggtgatgccg aggtgaaccc 1200ttttctttgg caccggccct ctgaagaggt aaagcagaca aaacgattaa aggggttgag 1260aaaggactcc tcgtccatgg aaggctgcca cagcttctct gccagctgcc tcacgcagtt 1320ctgcatcctc ttcaagagga ccttcctcag catcatgagg gactcggtcc tgacacacct 1380gcgcatcacc tcgcacattg ggatcggcct cctcattggc ctgctgtact tggggatcgg 1440gaacgaagcc aagaaggtct tgagcaactc cggcttcctc ttcttctcca tgctgttcct 1500catgttcgcg gccctcatgc ctactgttct gacatttccc ctggagatgg gagtctttct 1560tcgggaacac ctgaactact ggtacagcct gaaggcctac tacctggcca agaccatggc 1620agacgtgccc tttcagatca tgttcccagt ggcctactgc agcatcgtgt actggatgac 1680gtcgcagccg tccgacgccg tgcgctttgt gctgtttgcc gcgctgggca ccatgacctc 1740cctggtggca cagtccctgg gcctgctgat cggagccgcc tccacgtccc tgcaggtggc 1800cactttcgtg ggcccagtga cagccatccc ggtgctcctg ttctcggggt tcttcgtcag 1860cttcgacacc atccccacgt acctacagtg gatgtcctac atctcctatg tcaggtatgg 1920gttcgaaggg gtcatcctct ccatctatgg cttagaccgg gaagatctgc actgtgacat 1980cgacgagacg tgccacttcc agaagtcgga ggccatcctg cgggagctgg acgtggaaaa 2040tgccaagctg tacctggact tcatcgtact cgggattttc ttcatctccc tccgcctcat 2100tgcctatttt gtcctcaggt acaaaatccg ggcagagagg taaaacacct gaatgccagg 2160aaacaggaag attagacact gtggccgagg gcacgtctag aatcgaggag gcaagcctgt 2220gcccgaccga cgacacagag actcttctga tccaacccct agaaccgcgt tgggtttgtg 2280ggtgtctcgt gctcagccac tctgcccagc tgggttggat cttctctcca ttcccctttc 2340tagctttaac taggaagatg taggcagatt ggtggttttt ttttttttaa catacagaat 2400tttaaatacc acaactgggg cagaatttaa agctgcaaca cagctggtga tgagaggctt 2460cctcagtcca gtcgctcctt agcaccaggc accgtgggtc ctggatgggg aactgcaagc 2520agcctctcag ctgatggctg cacagtcaga tgtctggtgg cagagagtcc gagcatggag 2580cgattccatt ttatgactgt tgtttttcac attttcatct ttctaaggtg tgtctctttt 2640ccaatgagaa gtcatttttg caagccaaaa gtcgatcaat cgcattcatt ttaagaaatt 2700ataccttttt agtacttgct gaagaatgat tcagggtaaa tcacatactt tgtttagaga 2760ggcgaggggt ttaaccgagt cacccagctg gtctcataca tagacagcac ttgtgaagga 2820ttgaatgcag gttccaggtg gagggaagac gtggacacca tctccactga gccatgcaga 2880catttttaaa agctatacaa aaaattgtga gaagacattg gccaactctt tcaaagtctt 2940tctttttcca cgtgcttctt attttaagcg aaatatattg tttgtttctt cctaaaaaaa 3000aaaaaaaaaa aaaaaaaa 3018172983DNAHomo sapiens 17gcgaggggca agcccggatt cctgccggcc gcctttctgc gcgcgccgga gagagagacg 60cggtggggac agggatgcgc atttcacttc cccgagctcc ggagagggat ggcggggtgt 120cggcgagttc actgctggac acagttacta atgccagcag ttactctgca gagatgacgg 180agcccaagtc ggtgtgtgtc tcggtggatg aggtggtgtc cagcaacatg gaggccactg 240agacggacct gctgaatgga catctgaaaa aagtagataa taacctcacg gaagcccagc 300gcttctcctc cttgcctcgg agggcagctg tgaacattga attcagggac ctttcctatt 360cggttcctga aggaccctgg tggaggaaga aaggatacaa gaccctcctg aaaggaattt 420ccgggaagtt caatagtggt

gagttggtgg ccattatggg tccttccggg gccgggaagt 480ccacgctgat gaacatcctg gctggataca gggagacggg catgaagggg gccgtcctca 540tcaacggcct gccccgggac ctgcgctgct tccggaaggt gtcctgctac atcatgcagg 600atgacatgct gctgccgcat ctcactgtgc aggaggccat gatggtgtcg gcacatctga 660agcttcagga gaaggatgaa ggcagaaggg aaatggtcaa ggagatactg acagcgctgg 720gcttgctgtc ttgcgccaac acgcggaccg ggagcctgtc aggtggtcag cgcaagcgcc 780tggccatcgc gctggagctg gtgaacaacc ctccagtcat gttcttcgat gagcccacca 840gcggcctgga cagcgcctcc tgcttccagg tggtctcgct gatgaaaggg ctcgctcaag 900ggggtcgctc catcatttgc accatccacc agcccagcgc caaactcttc gagctgttcg 960accagcttta cgtcctgagt caaggacaat gtgtgtaccg gggaaaagtc tgcaatcttg 1020tgccatattt gagggatttg ggtctgaact gcccaaccta ccacaaccca gcagattttg 1080tcatggaggt tgcatccggc gagtacggtg atcagaacag tcggctggtg agagcggttc 1140gggagggcat gtgtgactca gaccacaaga gagacctcgg gggtgatgcc gaggtgaacc 1200cttttctttg gcaccggccc tctgaagagg actcctcgtc catggaaggc tgccacagct 1260tctctgccag ctgcctcacg cagttctgca tcctcttcaa gaggaccttc ctcagcatca 1320tgagggactc ggtcctgaca cacctgcgca tcacctcgca cattgggatc ggcctcctca 1380ttggcctgct gtacttgggg atcgggaacg aagccaagaa ggtcttgagc aactccggct 1440tcctcttctt ctccatgctg ttcctcatgt tcgcggccct catgcctact gttctgacat 1500ttcccctgga gatgggagtc tttcttcggg aacacctgaa ctactggtac agcctgaagg 1560cctactacct ggccaagacc atggcagacg tgccctttca gatcatgttc ccagtggcct 1620actgcagcat cgtgtactgg atgacgtcgc agccgtccga cgccgtgcgc tttgtgctgt 1680ttgccgcgct gggcaccatg acctccctgg tggcacagtc cctgggcctg ctgatcggag 1740ccgcctccac gtccctgcag gtggccactt tcgtgggccc agtgacagcc atcccggtgc 1800tcctgttctc ggggttcttc gtcagcttcg acaccatccc cacgtaccta cagtggatgt 1860cctacatctc ctatgtcagg tatgggttcg aaggggtcat cctctccatc tatggcttag 1920accgggaaga tctgcactgt gacatcgacg agacgtgcca cttccagaag tcggaggcca 1980tcctgcggga gctggacgtg gaaaatgcca agctgtacct ggacttcatc gtactcggga 2040ttttcttcat ctccctccgc ctcattgcct attttgtcct caggtacaaa atccgggcag 2100agaggtaaaa cacctgaatg ccaggaaaca ggaagattag acactgtggc cgagggcacg 2160tctagaatcg aggaggcaag cctgtgcccg accgacgaca cagagactct tctgatccaa 2220cccctagaac cgcgttgggt ttgtgggtgt ctcgtgctca gccactctgc ccagctgggt 2280tggatcttct ctccattccc ctttctagct ttaactagga agatgtaggc agattggtgg 2340tttttttttt tttaacatac agaattttaa ataccacaac tggggcagaa tttaaagctg 2400caacacagct ggtgatgaga ggcttcctca gtccagtcgc tccttagcac caggcaccgt 2460gggtcctgga tggggaactg caagcagcct ctcagctgat ggctgcacag tcagatgtct 2520ggtggcagag agtccgagca tggagcgatt ccattttatg actgttgttt ttcacatttt 2580catctttcta aggtgtgtct cttttccaat gagaagtcat ttttgcaagc caaaagtcga 2640tcaatcgcat tcattttaag aaattatacc tttttagtac ttgctgaaga atgattcagg 2700gtaaatcaca tactttgttt agagaggcga ggggtttaac cgagtcaccc agctggtctc 2760atacatagac agcacttgtg aaggattgaa tgcaggttcc aggtggaggg aagacgtgga 2820caccatctcc actgagccat gcagacattt ttaaaagcta tacaaaaaat tgtgagaaga 2880cattggccaa ctctttcaaa gtctttcttt ttccacgtgc ttcttatttt aagcgaaata 2940tattgtttgt ttcttcctaa aaaaaaaaaa aaaaaaaaaa aaa 2983183142DNAHomo sapiens 18agacactgaa tcatcatttg tagtttgggg ggctttacat gcctgcagtg gtgaaaactg 60aaattttgtc ccacttaagg gagtttcttc ttccctttat taattgcaaa ataaatatat 120gtcacttcag agggcagcag ctggactacc tatgtttgtg gcgctacacc aacctgaact 180tcgcttcctg agacctaaga ttcagccccg tgctcagcag acatcaggga tcaccgactc 240tgtgccagga gctgttcttg atgctgggaa cgcaggggtg gacaaaacag agaaagccct 300gccctcagaa tgccagcagt tactctgcag agatgacgga gcccaagtcg gtgtgtgtct 360cggtggatga ggtggtgtcc agcaacatgg aggccactga gacggacctg ctgaatggac 420atctgaaaaa agtagataat aacctcacgg aagcccagcg cttctcctcc ttgcctcgga 480gggcagctgt gaacattgaa ttcagggacc tttcctattc ggttcctgaa ggaccctggt 540ggaggaagaa aggatacaag accctcctga aaggaatttc cgggaagttc aatagtggtg 600agttggtggc cattatgggt ccttccgggg ccgggaagtc cacgctgatg aacatcctgg 660ctggatacag ggagacgggc atgaaggggg ccgtcctcat caacggcctg ccccgggacc 720tgcgctgctt ccggaaggtg tcctgctaca tcatgcagga tgacatgctg ctgccgcatc 780tcactgtgca ggaggccatg atggtgtcgg cacatctgaa gcttcaggag aaggatgaag 840gcagaaggga aatggtcaag gagatactga cagcgctggg cttgctgtct tgcgccaaca 900cgcggaccgg gagcctgtca ggtggtcagc gcaagcgcct ggccatcgcg ctggagctgg 960tgaacaaccc tccagtcatg ttcttcgatg agcccaccag cggcctggac agcgcctcct 1020gcttccaggt ggtctcgctg atgaaagggc tcgctcaagg gggtcgctcc atcatttgca 1080ccatccacca gcccagcgcc aaactcttcg agctgttcga ccagctttac gtcctgagtc 1140aaggacaatg tgtgtaccgg ggaaaagtct gcaatcttgt gccatatttg agggatttgg 1200gtctgaactg cccaacctac cacaacccag cagattttgt catggaggtt gcatccggcg 1260agtacggtga tcagaacagt cggctggtga gagcggttcg ggagggcatg tgtgactcag 1320accacaagag agacctcggg ggtgatgccg aggtgaaccc ttttctttgg caccggccct 1380ctgaagagga ctcctcgtcc atggaaggct gccacagctt ctctgccagc tgcctcacgc 1440agttctgcat cctcttcaag aggaccttcc tcagcatcat gagggactcg gtcctgacac 1500acctgcgcat cacctcgcac attgggatcg gcctcctcat tggcctgctg tacttgggga 1560tcgggaacga agccaagaag gtcttgagca actccggctt cctcttcttc tccatgctgt 1620tcctcatgtt cgcggccctc atgcctactg ttctgacatt tcccctggag atgggagtct 1680ttcttcggga acacctgaac tactggtaca gcctgaaggc ctactacctg gccaagacca 1740tggcagacgt gccctttcag atcatgttcc cagtggccta ctgcagcatc gtgtactgga 1800tgacgtcgca gccgtccgac gccgtgcgct ttgtgctgtt tgccgcgctg ggcaccatga 1860cctccctggt ggcacagtcc ctgggcctgc tgatcggagc cgcctccacg tccctgcagg 1920tggccacttt cgtgggccca gtgacagcca tcccggtgct cctgttctcg gggttcttcg 1980tcagcttcga caccatcccc acgtacctac agtggatgtc ctacatctcc tatgtcaggt 2040atgggttcga aggggtcatc ctctccatct atggcttaga ccgggaagat ctgcactgtg 2100acatcgacga gacgtgccac ttccagaagt cggaggccat cctgcgggag ctggacgtgg 2160aaaatgccaa gctgtacctg gacttcatcg tactcgggat tttcttcatc tccctccgcc 2220tcattgccta ttttgtcctc aggtacaaaa tccgggcaga gaggtaaaac acctgaatgc 2280caggaaacag gaagattaga cactgtggcc gagggcacgt ctagaatcga ggaggcaagc 2340ctgtgcccga ccgacgacac agagactctt ctgatccaac ccctagaacc gcgttgggtt 2400tgtgggtgtc tcgtgctcag ccactctgcc cagctgggtt ggatcttctc tccattcccc 2460tttctagctt taactaggaa gatgtaggca gattggtggt tttttttttt ttaacataca 2520gaattttaaa taccacaact ggggcagaat ttaaagctgc aacacagctg gtgatgagag 2580gcttcctcag tccagtcgct ccttagcacc aggcaccgtg ggtcctggat ggggaactgc 2640aagcagcctc tcagctgatg gctgcacagt cagatgtctg gtggcagaga gtccgagcat 2700ggagcgattc cattttatga ctgttgtttt tcacattttc atctttctaa ggtgtgtctc 2760ttttccaatg agaagtcatt tttgcaagcc aaaagtcgat caatcgcatt cattttaaga 2820aattatacct ttttagtact tgctgaagaa tgattcaggg taaatcacat actttgttta 2880gagaggcgag gggtttaacc gagtcaccca gctggtctca tacatagaca gcacttgtga 2940aggattgaat gcaggttcca ggtggaggga agacgtggac accatctcca ctgagccatg 3000cagacatttt taaaagctat acaaaaaatt gtgagaagac attggccaac tctttcaaag 3060tctttctttt tccacgtgct tcttatttta agcgaaatat attgtttgtt tcttcctaaa 3120aaaaaaaaaa aaaaaaaaaa aa 3142193060DNAHomo sapiens 19acttcagagg gcagcagctg gactacctat gtttgtggcg ctacaccaac ctgaacttcg 60cttcctgaga cctaagattc agccccgtgc tcagcagaca tcagggatca ccgactctgt 120gccaggagct gttcttgatg ctgggaacgc aggggtggac aaaacagaga aagccctgcc 180ctcagtgaga aatatgctgt catgtaaatt gctttttccc ctatagaatg ccagcagtta 240ctctgcagag atgacggagc ccaagtcggt gtgtgtctcg gtggatgagg tggtgtccag 300caacatggag gccactgaga cggacctgct gaatggacat ctgaaaaaag tagataataa 360cctcacggaa gcccagcgct tctcctcctt gcctcggagg gcagctgtga acattgaatt 420cagggacctt tcctattcgg ttcctgaagg accctggtgg aggaagaaag gatacaagac 480cctcctgaaa ggaatttccg ggaagttcaa tagtggtgag ttggtggcca ttatgggtcc 540ttccggggcc gggaagtcca cgctgatgaa catcctggct ggatacaggg agacgggcat 600gaagggggcc gtcctcatca acggcctgcc ccgggacctg cgctgcttcc ggaaggtgtc 660ctgctacatc atgcaggatg acatgctgct gccgcatctc actgtgcagg aggccatgat 720ggtgtcggca catctgaagc ttcaggagaa ggatgaaggc agaagggaaa tggtcaagga 780gatactgaca gcgctgggct tgctgtcttg cgccaacacg cggaccggga gcctgtcagg 840tggtcagcgc aagcgcctgg ccatcgcgct ggagctggtg aacaaccctc cagtcatgtt 900cttcgatgag cccaccagcg gcctggacag cgcctcctgc ttccaggtgg tctcgctgat 960gaaagggctc gctcaagggg gtcgctccat catttgcacc atccaccagc ccagcgccaa 1020actcttcgag ctgttcgacc agctttacgt cctgagtcaa ggacaatgtg tgtaccgggg 1080aaaagtctgc aatcttgtgc catatttgag ggatttgggt ctgaactgcc caacctacca 1140caacccagca gattttgtca tggaggttgc atccggcgag tacggtgatc agaacagtcg 1200gctggtgaga gcggttcggg agggcatgtg tgactcagac cacaagagag acctcggggg 1260tgatgccgag gtgaaccctt ttctttggca ccggccctct gaagaggact cctcgtccat 1320ggaaggctgc cacagcttct ctgccagctg cctcacgcag ttctgcatcc tcttcaagag 1380gaccttcctc agcatcatga gggactcggt cctgacacac ctgcgcatca cctcgcacat 1440tgggatcggc ctcctcattg gcctgctgta cttggggatc gggaacgaag ccaagaaggt 1500cttgagcaac tccggcttcc tcttcttctc catgctgttc ctcatgttcg cggccctcat 1560gcctactgtt ctgacatttc ccctggagat gggagtcttt cttcgggaac acctgaacta 1620ctggtacagc ctgaaggcct actacctggc caagaccatg gcagacgtgc cctttcagat 1680catgttccca gtggcctact gcagcatcgt gtactggatg acgtcgcagc cgtccgacgc 1740cgtgcgcttt gtgctgtttg ccgcgctggg caccatgacc tccctggtgg cacagtccct 1800gggcctgctg atcggagccg cctccacgtc cctgcaggtg gccactttcg tgggcccagt 1860gacagccatc ccggtgctcc tgttctcggg gttcttcgtc agcttcgaca ccatccccac 1920gtacctacag tggatgtcct acatctccta tgtcaggtat gggttcgaag gggtcatcct 1980ctccatctat ggcttagacc gggaagatct gcactgtgac atcgacgaga cgtgccactt 2040ccagaagtcg gaggccatcc tgcgggagct ggacgtggaa aatgccaagc tgtacctgga 2100cttcatcgta ctcgggattt tcttcatctc cctccgcctc attgcctatt ttgtcctcag 2160gtacaaaatc cgggcagaga ggtaaaacac ctgaatgcca ggaaacagga agattagaca 2220ctgtggccga gggcacgtct agaatcgagg aggcaagcct gtgcccgacc gacgacacag 2280agactcttct gatccaaccc ctagaaccgc gttgggtttg tgggtgtctc gtgctcagcc 2340actctgccca gctgggttgg atcttctctc cattcccctt tctagcttta actaggaaga 2400tgtaggcaga ttggtggttt tttttttttt aacatacaga attttaaata ccacaactgg 2460ggcagaattt aaagctgcaa cacagctggt gatgagaggc ttcctcagtc cagtcgctcc 2520ttagcaccag gcaccgtggg tcctggatgg ggaactgcaa gcagcctctc agctgatggc 2580tgcacagtca gatgtctggt ggcagagagt ccgagcatgg agcgattcca ttttatgact 2640gttgtttttc acattttcat ctttctaagg tgtgtctctt ttccaatgag aagtcatttt 2700tgcaagccaa aagtcgatca atcgcattca ttttaagaaa ttataccttt ttagtacttg 2760ctgaagaatg attcagggta aatcacatac tttgtttaga gaggcgaggg gtttaaccga 2820gtcacccagc tggtctcata catagacagc acttgtgaag gattgaatgc aggttccagg 2880tggagggaag acgtggacac catctccact gagccatgca gacattttta aaagctatac 2940aaaaaattgt gagaagacat tggccaactc tttcaaagtc tttctttttc cacgtgcttc 3000ttattttaag cgaaatatat tgtttgtttc ttcctaaaaa aaaaaaaaaa aaaaaaaaaa 3060202946DNAHomo sapiens 20gctttataaa ggggagtttc cctgcacaag ctctctctct tgtctgccgc catgtgagac 60atgcctttca ccttccgcca tgatcatgag gcttccccag ccacatggaa ctaatgccag 120cagttactct gcagagatga cggagcccaa gtcggtgtgt gtctcggtgg atgaggtggt 180gtccagcaac atggaggcca ctgagacgga cctgctgaat ggacatctga aaaaagtaga 240taataacctc acggaagccc agcgcttctc ctccttgcct cggagggcag ctgtgaacat 300tgaattcagg gacctttcct attcggttcc tgaaggaccc tggtggagga agaaaggata 360caagaccctc ctgaaaggaa tttccgggaa gttcaatagt ggtgagttgg tggccattat 420gggtccttcc ggggccggga agtccacgct gatgaacatc ctggctggat acagggagac 480gggcatgaag ggggccgtcc tcatcaacgg cctgccccgg gacctgcgct gcttccggaa 540ggtgtcctgc tacatcatgc aggatgacat gctgctgccg catctcactg tgcaggaggc 600catgatggtg tcggcacatc tgaagcttca ggagaaggat gaaggcagaa gggaaatggt 660caaggagata ctgacagcgc tgggcttgct gtcttgcgcc aacacgcgga ccgggagcct 720gtcaggtggt cagcgcaagc gcctggccat cgcgctggag ctggtgaaca accctccagt 780catgttcttc gatgagccca ccagcggcct ggacagcgcc tcctgcttcc aggtggtctc 840gctgatgaaa gggctcgctc aagggggtcg ctccatcatt tgcaccatcc accagcccag 900cgccaaactc ttcgagctgt tcgaccagct ttacgtcctg agtcaaggac aatgtgtgta 960ccggggaaaa gtctgcaatc ttgtgccata tttgagggat ttgggtctga actgcccaac 1020ctaccacaac ccagcagatt ttgtcatgga ggttgcatcc ggcgagtacg gtgatcagaa 1080cagtcggctg gtgagagcgg ttcgggaggg catgtgtgac tcagaccaca agagagacct 1140cgggggtgat gccgaggtga acccttttct ttggcaccgg ccctctgaag aggactcctc 1200gtccatggaa ggctgccaca gcttctctgc cagctgcctc acgcagttct gcatcctctt 1260caagaggacc ttcctcagca tcatgaggga ctcggtcctg acacacctgc gcatcacctc 1320gcacattggg atcggcctcc tcattggcct gctgtacttg gggatcggga acgaagccaa 1380gaaggtcttg agcaactccg gcttcctctt cttctccatg ctgttcctca tgttcgcggc 1440cctcatgcct actgttctga catttcccct ggagatggga gtctttcttc gggaacacct 1500gaactactgg tacagcctga aggcctacta cctggccaag accatggcag acgtgccctt 1560tcagatcatg ttcccagtgg cctactgcag catcgtgtac tggatgacgt cgcagccgtc 1620cgacgccgtg cgctttgtgc tgtttgccgc gctgggcacc atgacctccc tggtggcaca 1680gtccctgggc ctgctgatcg gagccgcctc cacgtccctg caggtggcca ctttcgtggg 1740cccagtgaca gccatcccgg tgctcctgtt ctcggggttc ttcgtcagct tcgacaccat 1800ccccacgtac ctacagtgga tgtcctacat ctcctatgtc aggtatgggt tcgaaggggt 1860catcctctcc atctatggct tagaccggga agatctgcac tgtgacatcg acgagacgtg 1920ccacttccag aagtcggagg ccatcctgcg ggagctggac gtggaaaatg ccaagctgta 1980cctggacttc atcgtactcg ggattttctt catctccctc cgcctcattg cctattttgt 2040cctcaggtac aaaatccggg cagagaggta aaacacctga atgccaggaa acaggaagat 2100tagacactgt ggccgagggc acgtctagaa tcgaggaggc aagcctgtgc ccgaccgacg 2160acacagagac tcttctgatc caacccctag aaccgcgttg ggtttgtggg tgtctcgtgc 2220tcagccactc tgcccagctg ggttggatct tctctccatt cccctttcta gctttaacta 2280ggaagatgta ggcagattgg tggttttttt ttttttaaca tacagaattt taaataccac 2340aactggggca gaatttaaag ctgcaacaca gctggtgatg agaggcttcc tcagtccagt 2400cgctccttag caccaggcac cgtgggtcct ggatggggaa ctgcaagcag cctctcagct 2460gatggctgca cagtcagatg tctggtggca gagagtccga gcatggagcg attccatttt 2520atgactgttg tttttcacat tttcatcttt ctaaggtgtg tctcttttcc aatgagaagt 2580catttttgca agccaaaagt cgatcaatcg cattcatttt aagaaattat acctttttag 2640tacttgctga agaatgattc agggtaaatc acatactttg tttagagagg cgaggggttt 2700aaccgagtca cccagctggt ctcatacata gacagcactt gtgaaggatt gaatgcaggt 2760tccaggtgga gggaagacgt ggacaccatc tccactgagc catgcagaca tttttaaaag 2820ctatacaaaa aattgtgaga agacattggc caactctttc aaagtctttc tttttccacg 2880tgcttcttat tttaagcgaa atatattgtt tgtttcttcc taaaaaaaaa aaaaaaaaaa 2940aaaaaa 2946213498DNAHomo sapiens 21ttctttccaa gggtctctgg gtgaggcccg tgaccttccc aagcctctcc ctgtcttgtg 60aaacctgggc gtgatatacc tcccttttag ggctgctgcg atcatttagg cagattaaac 120ctcataagtg gtttcccata caagaaagat gctagcagtg caacagacag aacacttacc 180tgcctgccct cccgccagga ggtggtcttc caacttttgc ccggagtcta cagagggtgg 240gccctctctg ctggggctcc gggacatggt caggagaggt tggtctgtct gtaccgccat 300tctcttggcc agactgtggt gtctggtccc tactcacacc ttcctgtcag agtatccaga 360ggccgcagag tatccacacc ctggctgggt gtactggcta cagatggctg tggctccagg 420tcacctgcgt gcctgggtga tgagaaataa tgtcacaaca aatatcccat ctgcattctc 480tgggacactg acccatgaag agaaagcagt tctcacagtt tttacaggca cagccacagc 540cgtgcatgta caggtggcag ctttagcttc tgctaaactg gagagctcag tgtttgtgac 600agactgcgtg tcctgcaaaa tcgaaaatgt ctgtgattca gctcttcagg gaaaaagggt 660gccgatgtct ggcctacagg gctcaagcat tgtcatcatg cccccatcca accgtccact 720cgccagtgcg gcatcctgca cgtggtcagt ccaagtccag ggagggcccc atcacctggg 780ggtggtcgct atcagtggca aagtcttgtc agcagctcat ggggcaggaa gggcctatgg 840ttgggggttt cctggcgatc ccatggagga aggatacaag accctcctga aaggaatttc 900cgggaagttc aatagtggtg agttggtggc cattatgggt ccttccgggg ccgggaagtc 960cacgctgatg aacatcctgg ctggatacag ggagacgggc atgaaggggg ccgtcctcat 1020caacggcctg ccccgggacc tgcgctgctt ccggaaggtg tcctgctaca tcatgcagga 1080tgacatgctg ctgccgcatc tcactgtgca ggaggccatg atggtgtcgg cacatctgaa 1140gcttcaggag aaggatgaag gcagaaggga aatggtcaag gagatactga cagcgctggg 1200cttgctgtct tgcgccaaca cgcggaccgg gagcctgtca ggtggtcagc gcaagcgcct 1260ggccatcgcg ctggagctgg tgaacaaccc tccagtcatg ttcttcgatg agcccaccag 1320cggcctggac agcgcctcct gcttccaggt ggtctcgctg atgaaagggc tcgctcaagg 1380gggtcgctcc atcatttgca ccatccacca gcccagcgcc aaactcttcg agctgttcga 1440ccagctttac gtcctgagtc aaggacaatg tgtgtaccgg ggaaaagtct gcaatcttgt 1500gccatatttg agggatttgg gtctgaactg cccaacctac cacaacccag cagattttgt 1560catggaggtt gcatccggcg agtacggtga tcagaacagt cggctggtga gagcggttcg 1620ggagggcatg tgtgactcag accacaagag agacctcggg ggtgatgccg aggtgaaccc 1680ttttctttgg caccggccct ctgaagaggt aaagcagaca aaacgattaa aggggttgag 1740aaaggactcc tcgtccatgg aaggctgcca cagcttctct gccagctgcc tcacgcagtt 1800ctgcatcctc ttcaagagga ccttcctcag catcatgagg gactcggtcc tgacacacct 1860gcgcatcacc tcgcacattg ggatcggcct cctcattggc ctgctgtact tggggatcgg 1920gaacgaagcc aagaaggtct tgagcaactc cggcttcctc ttcttctcca tgctgttcct 1980catgttcgcg gccctcatgc ctactgttct gacatttccc ctggagatgg gagtctttct 2040tcgggaacac ctgaactact ggtacagcct gaaggcctac tacctggcca agaccatggc 2100agacgtgccc tttcagatca tgttcccagt ggcctactgc agcatcgtgt actggatgac 2160gtcgcagccg tccgacgccg tgcgctttgt gctgtttgcc gcgctgggca ccatgacctc 2220cctggtggca cagtccctgg gcctgctgat cggagccgcc tccacgtccc tgcaggtggc 2280cactttcgtg ggcccagtga cagccatccc ggtgctcctg ttctcggggt tcttcgtcag 2340cttcgacacc atccccacgt acctacagtg gatgtcctac atctcctatg tcaggtatgg 2400gttcgaaggg gtcatcctct ccatctatgg cttagaccgg gaagatctgc actgtgacat 2460cgacgagacg tgccacttcc agaagtcgga ggccatcctg cgggagctgg acgtggaaaa 2520tgccaagctg tacctggact tcatcgtact cgggattttc ttcatctccc tccgcctcat 2580tgcctatttt gtcctcaggt acaaaatccg ggcagagagg taaaacacct gaatgccagg 2640aaacaggaag attagacact gtggccgagg gcacgtctag aatcgaggag gcaagcctgt 2700gcccgaccga cgacacagag actcttctga tccaacccct agaaccgcgt tgggtttgtg 2760ggtgtctcgt gctcagccac tctgcccagc tgggttggat cttctctcca ttcccctttc 2820tagctttaac taggaagatg taggcagatt ggtggttttt ttttttttaa catacagaat 2880tttaaatacc acaactgggg cagaatttaa agctgcaaca cagctggtga tgagaggctt 2940cctcagtcca gtcgctcctt agcaccaggc accgtgggtc ctggatgggg aactgcaagc 3000agcctctcag ctgatggctg cacagtcaga tgtctggtgg cagagagtcc gagcatggag 3060cgattccatt ttatgactgt tgtttttcac attttcatct ttctaaggtg tgtctctttt 3120ccaatgagaa gtcatttttg caagccaaaa gtcgatcaat cgcattcatt ttaagaaatt

3180ataccttttt agtacttgct gaagaatgat tcagggtaaa tcacatactt tgtttagaga 3240ggcgaggggt ttaaccgagt cacccagctg gtctcataca tagacagcac ttgtgaagga 3300ttgaatgcag gttccaggtg gagggaagac gtggacacca tctccactga gccatgcaga 3360catttttaaa agctatacaa aaaattgtga gaagacattg gccaactctt tcaaagtctt 3420tctttttcca cgtgcttctt attttaagcg aaatatattg tttgtttctt cctaaaaaaa 3480aaaaaaaaaa aaaaaaaa 3498223400DNAHomo sapiens 22ggaaccgccg ccggtatccg cgtccgcagc gccgccagcc aggcgagagc cgtgtgggat 60cccagcgccc gcactcccgc ccccgccaag gagccaggaa tggcacaact agagaggagc 120gccatctctg gcttcagctc taagtccagg cgaaactcat tcgcatatga tgttaagcgt 180gaagtataca atgaggagac ctttcaacag gaacacaaaa ggaaggcctc ctcttctggg 240aacatgaaca tcaacatcac caccttcaga caccacgtcc agtgccgctg ctcatggcac 300aggttcctac gatgcgtgct tacaatcttt cccttcctag aatggatgtg tatgtatcga 360ttaaaggatt ggcttctggg agacttactt gctggtataa gtgttggcct tgtgcaagtt 420ccccaaggcc tgacacttag tttgctggca aggcaactga ttcctcctct caacatcgct 480tatgcagctt tctgttcttc ggtaatctat gtaatttttg gatcgtgtca tcaaatgtcc 540attggttcct tcttcctggt gagtgctctg ctgatcaacg ttctgaaagt gagcccattc 600aacaacggtc aactggtcat gggatctttc gtcaagaatg agttttcggc cccctcctac 660cttatgggct ataataaatc cttgagtgtg gtggcaacca caacttttct gactgggatt 720attcagctaa taatgggcgt attgggtttg ggcttcattg ccacttacct tccggagtct 780gcaatgagtg cttacctggc tgctgtggca cttcatatca tgctgtccca gctgactttc 840atctttggga ttatgattag tttccatgcc ggtcccatct ccttcttcta tgacataatt 900aattactgtg tagctctccc aaaagcgaat tccaccagca ttctagtatt tctaactgtt 960gttgttgctc tgcgaatcaa caaatgtatc agaatttctt tcaatcagta tcccattgag 1020tttcccatgg aattatttct gattattggc ttcactgtga ttgcaaacaa gataagcatg 1080gccacagaaa ccagccagac gcttattgac atgattcctt atagctttct gcttcctgta 1140acaccagatt tcagccttct tcccaagata attttacaag ccttctcctt atctttggtg 1200agctcctttc tgctcatatt tctgggcaag aagattgcca gtcttcacaa ttacagtgtc 1260aattccaacc aggatttaat agccatcggc ctttgcaatg tcgtcagttc atttttcaga 1320tcttgtgtgt ttactggtgc tattgctagg actattatcc aggataaatc tggaggaaga 1380caacagtttg catctctggt aggcgcaggt gtgatgctgc tcctgatggt gaagatggga 1440cactttttct acacactgcc aaatgctgtg ctggctggta ttattctgag caacgtcatt 1500ccctaccttg aaaccatttc taacctaccc agcctgtgga ggcaggacca atatgactgt 1560gctctttgga tgatgacatt ctcatcttca attttcctgg gactggacat tggactaatt 1620atctcagtag tttctgcttt cttcatcacc actgttcgtt cacacagagc taagattctt 1680ctcctgggtc aaatccctaa caccaacatt tatagaagca tcaatgatta tcgggagatc 1740atcaccattc ctggggtgaa aatcttccag tgctgcagct caattacatt tgtaaatgtt 1800tactacctaa agcataagct gttaaaagag gttgatatgg taaaggtgcc tcttaaagaa 1860gaagaaattt tcagcttgtt taattcaagt gacaccaatc tacaaggagg aaagatttgc 1920aggtgtttct gcaactgtga tgatctggag ccgctgccca ggattcttta cacagagcga 1980tttgaaaata aactggatcc cgaagcatcc tccattaacc tgattcactg ctcacatttt 2040gagagcatga acacaagcca aactgcatcc gaagaccaag tgccatacac agtatcgtcc 2100gtgtctcaga aaaatcaagg gcaacagtat gaggaggtgg aggaagtttg gcttcctaat 2160aactcatcaa gaaacagctc accaggactg cctgatgtgg cggaaagcca ggggaggaga 2220tcactcatcc cttactcaga tgcgtctcta ctgcccagtg tccacaccat catcctggat 2280ttctccatgg tacactacgt ggattcacgg gggttagtcg tattaagaca gatatgcaat 2340gcctttcaaa acgccaacat tttgatactc attgcagggt gtcactcttc catagtcagg 2400gcatttgaga ggaatgattt ctttgacgct ggcatcacca agacccagct gttcctcagc 2460gttcacgacg ccgtgctgtt tgccttgtca aggaaggtca taggctcctc tgagttaagc 2520atcgatgaat ccgagacagt gatacgggaa acctactcag aaacagacaa gaatgacaat 2580tcaagatata aaatgagcag cagttttcta ggaagccaaa aaaatgtaag tccaggcttc 2640atcaagatcc aacagcctgt agaagaggag tcggagttgg atttggagct ggaatcagaa 2700caagaggctg ggctgggtct ggacctagac ctggatcggg agctggagcc tgaaatggag 2760cccaaggctg agaccgagac caagacccag accgagatgg agccccagcc tgagactgag 2820cctgagatgg agcccaaccc caaatctagg ccaagagctc acacttttcc tcagcagcgt 2880tactggccta tgtatcatcc gtctatggct tccacccagt ctcagactca gactcggaca 2940tggtcagtgg agaggagacg ccatcctatg gattcatact caccagaggg caacagcaat 3000gaagatgtct aggagatgaa ctagaaataa ggggtcagat aatgctggca aatcctccta 3060cccaaaaagg ggtcaattgt ccagagacct agactggata cgaactagca gtacttcctt 3120cctgactgtg actcctacta cctgccagcc ttcttccttg ctctgcgctg ggatcatact 3180cccaaatcac attactaaat gccaacaatt atctctgaat tccctatcca ggctcccctc 3240atttcacctt cagcatatat tctagtcatg aatttccttc ttcacacacc ccacatctct 3300gggctttgtg ccagaccatc tctaacttaa tcctctcatc cctgttcccc tttctccaaa 3360gagatgaagc tcaaataaaa tgtataactc tagtaaaaaa 340023977DNAHomo sapiens 23attgaatgca gcaagggtct ggaggctgag gaccaggcag acaaacattc agagttgctg 60gaatgcgaca gagacaggga gtcagactgg tcatgcaagg ccagctctgg ggtctcggca 120ggtggtccgc gacatgacct ccgagttctt ctctgcccag ctccgggccc agatctctga 180cgacaccact cacccgatct cctactacaa gcccgagttc tacatgccgg atgacggggg 240cactgctcac ctgtctgtgg tcgcagagga cggcagtgct gtgtccgcca ccagcaccat 300caacctctac tttggctcca aggtgcgctc cccagtcagc gggatcctgc tcaataatga 360aatggatgac ttcagctcta ccagcatcac caacgagttt ggggtacccc cctcacctgc 420caatttcatc cagccaggga agcagccgct ctcgtccatg tgcccgacga tcatggtggg 480ccaggacggc caggtccgga tggtggtggg agctgccggg ggcacgcaga tcaccatggc 540cactgcactg gccatcatct acaacctctg gttcggctat gacgtgaagt gggccgtgga 600ggagccccgg ctgcacaacc agcttctgcc caacgtcacg acagtggaga gaaacattga 660ccaggaagtg actgcagccc tggagacccg gcaccatcac acccagatca cgtccacctt 720cattgctgtg gtgcaagcca tcgtccgcat ggctggtggc tgggcagctg cctcggactc 780caggaaaggt ggggaacctg ctggctactg attgctccag gcggacaagg ctgacaagca 840atccaggaac aaaatactca ccaggacgag gaagaggact ttgggggaca ggcttctcct 900gtgagcagca gagcagcaca ataaatgagg ccactgtgcc aggctccagg tggcctccct 960ggcctgtctc cccactc 977241049DNAHomo sapiens 24ctcgagagct gggctctgcg tcctcgtcca gccgccaact cggccaaagg cgaagccagc 60agtttcttct gctgccgggc aacgcgcctt ttaaacctga gggagtgggc gcgtgagcac 120ttaatggcgc cggtgacaga gtgagcttaa cggattaata agcgcagcca ggccagctct 180ggggtctcgg caggtggtcc gcgacatgac ctccgagttc ttctctgccc agctccgggc 240ccagatctct gacgacacca ctcacccgat ctcctactac aagcccgagt tctacatgcc 300ggatgacggg ggcactgctc acctgtctgt ggtcgcagag gacggcagtg ctgtgtccgc 360caccagcacc atcaacctct actttggctc caaggtgcgc tccccagtca gcgggatcct 420gctcaataat gaaatggatg acttcagctc taccagcatc accaacgagt ttggggtacc 480cccctcacct gccaatttca tccagccagg gaagcagccg ctctcgtcca tgtgcccgac 540gatcatggtg ggccaggacg gccaggtccg gatggtggtg ggagctgccg ggggcacgca 600gatcaccatg gccactgcac tggccatcat ctacaacctc tggttcggct atgacgtgaa 660gtgggccgtg gaggagcccc ggctgcacaa ccagcttctg cccaacgtca cgacagtgga 720gagaaacatt gaccaggaag tgactgcagc cctggagacc cggcaccatc acacccagat 780cacgtccacc ttcattgctg tggtgcaagc catcgtccgc atggctggtg gctgggcagc 840tgcctcggac tccaggaaag gtggggaacc tgctggctac tgattgctcc aggcggacaa 900ggctgacaag caatccagga acaaaatact caccaggacg aggaagagga ctttggggga 960caggcttctc ctgtgagcag cagagcagca caataaatga ggccactgtg ccaggctcca 1020ggtggcctcc ctggcctgtc tccccactc 1049251108DNAHomo sapiens 25attgaatgca gcaagggtct ggaggctgag gaccaggcag acaaacattc agagttgctg 60gaatgcgaca gagacaggga gtcagactgg tcatgcaagg tcctgggcct gcccttgggt 120cctggggagc cacggaaggt tgtgggtgcc agagggttgt ggtcagagcc acagtcaggg 180gccttctgag acctgtgccc cctccccacc ctccctcccc acctccctag gccagctctg 240gggtctcggc aggtggtccg cgacatgacc tccgagttct tctctgccca gctccgggcc 300cagatctctg acgacaccac tcacccgatc tcctactaca agcccgagtt ctacatgccg 360gatgacgggg gcactgctca cctgtctgtg gtcgcagagg acggcagtgc tgtgtccgcc 420accagcacca tcaacctcta ctttggctcc aaggtgcgct ccccagtcag cgggatcctg 480ctcaataatg aaatggatga cttcagctct accagcatca ccaacgagtt tggggtaccc 540ccctcacctg ccaatttcat ccagccaggg aagcagccgc tctcgtccat gtgcccgacg 600atcatggtgg gccaggacgg ccaggtccgg atggtggtgg gagctgccgg gggcacgcag 660atcaccatgg ccactgcact ggccatcatc tacaacctct ggttcggcta tgacgtgaag 720tgggccgtgg aggagccccg gctgcacaac cagcttctgc ccaacgtcac gacagtggag 780agaaacattg accaggaagt gactgcagcc ctggagaccc ggcaccatca cacccagatc 840acgtccacct tcattgctgt ggtgcaagcc atcgtccgca tggctggtgg ctgggcagct 900gcctcggact ccaggaaagg tggggaacct gctggctact gattgctcca ggcggacaag 960gctgacaagc aatccaggaa caaaatactc accaggacga ggaagaggac tttgggggac 1020aggcttctcc tgtgagcagc agagcagcac aataaatgag gccactgtgc caggctccag 1080gtggcctccc tggcctgtct ccccactc 1108262414DNAHomo sapiens 26gtcagagtct tccctcagct ttgtacatca gcactgtttt gatagataag agaggctact 60gtataagtgt gtaagatttg taatggactg aggaatgctt gttctagctg ctgaaactga 120ctgtaactgt attgtcttag gagcatcatc atggggtcta gtgccacaga gattgaagaa 180ttggaaaaca ccacttttaa gtatcttaca ggagaacaga ctgaaaaaat gtggcagcgc 240ctgaaaggaa tactaagatg cttggtgaag cagctggaaa gaggtgatgt taacgtcgtc 300gacttaaaga agaatattga atatgcggca tctgtgctgg aagcagttta tatcgatgaa 360acaagaagac ttctggatac tgaagatgag ctcagtgaca ttcagactga ctcagtccca 420tctgaagtcc gggactggtt ggcttctacc tttacacgga aaatggggat gacaaaaaag 480aaacctgagg aaaaaccaaa atttcggagc attgtgcatg ctgttcaagc tggaattttt 540gtggaaagaa tgtaccgaaa aacatatcat atggttggtt tggcatatcc agcagctgtc 600atcgtaacat taaaggatgt tgataaatgg tctttcgatg tatttgccct aaatgaagca 660agtggagagc atagtctgaa gtttatgatt tatgaactgt ttaccagata tgatcttatc 720aaccgtttca agattcctgt ttcttgccta atcacctttg cagaagcttt agaagttggt 780tacagcaagt acaaaaatcc atatcacaat ttgattcatg cagctgatgt cactcaaact 840gtgcattaca taatgcttca tacaggtatc atgcactggc tcactgaact ggaaatttta 900gcaatggtct ttgctgctgc cattcatgat tatgagcata cagggacaac aaacaacttt 960cacattcaga caaggtcaga tgttgccatt ttgtataatg atcgctctgt ccttgagaat 1020caccacgtga gtgcagctta tcgacttatg caagaagaag aaatgaatat cttgataaat 1080ttatccaaag atgactggag ggatcttcgg aacctagtga ttgaaatggt tttatctaca 1140gacatgtcag gtcacttcca gcaaattaaa aatataagaa acagtttgca gcagcctgaa 1200gggattgaca gagccaaaac catgtccctg attctccacg cagcagacat cagccaccca 1260gccaaatcct ggaagctgca ttatcggtgg accatggccc taatggagga gtttttcctg 1320cagggagata aagaagctga attagggctt ccattttccc cactttgtga tcggaagtca 1380accatggtgg cccagtcaca aataggtttc atcgatttca tagtagagcc aacattttct 1440cttctgacag actcaacaga gaaaattgtt attcctctta tagaggaagc ctcaaaagcc 1500gaaacttctt cctatgtggc aagcagctca accaccattg tggggttaca cattgctgat 1560gcactaagac gatcaaatac aaaaggctcc atgagtgatg ggtcctattc cccagactac 1620tcccttgcag cagtggacct gaagagtttc aagaacaacc tggtggacat cattcagcag 1680aacaaagaga ggtggaaaga gttagctgca caaggtgaat ctgatcttca taagaactca 1740gaagacttag taaatgctga agaaaaacat gatgagacac attcataggc ccgaaacacc 1800ttaaagactt ctgtcatttt aaacatgaga ggacaatgaa atcagcatga aaacatccta 1860aattctcaac tttccacaaa gctatggctc ttctttcaac atagaattgg attgggccat 1920tttaattgac tcctatacaa ggaattaaga agaacataaa ttttgagcta gtaactctgg 1980ccaaataaat acactcaagt ttttatcaga gtttttggcc agtgcttctg ccattttttt 2040ccctccacaa tttggccttc ttcaatcaag ccagataaat ttttgagaca aaagtcagac 2100agtttttaat ttttcttgct ttgaaccctg tcataatgac tgtgcaatac atgtgcagaa 2160gatgaggtat tttaaaattt acttccttgc actgtcttac acagagtgct ataactataa 2220atttttcaag gtcttaaata aaaggaagca aaaacaaaat tattgaaaaa ttttttttgt 2280tgtgctgggg aatatactat ttagattgtc cttcttattt taaatgcatg ggaacagaat 2340gacagggggg atgctgagga gctggttgaa gcatcagagc aatgctacag tccaacaatg 2400gagcattaga tccc 2414272009DNAHomo sapiens 27gaattctgat gtgcttcagt gcacagaaca gtaacagatg agctgctttt ggggagagct 60tgagtactca gtcggagcat catcatgggg tctagtgcca cagagattga agaattggaa 120aacaccactt ttaagtatct tacaggagaa cagactgaaa aaatgtggca gcgcctgaaa 180ggaatactaa gatgcttggt gaagcagctg gaaagaggtg atgttaacgt cgtcgactta 240aagaagaata ttgaatatgc ggcatctgtg ctggaagcag tttatatcga tgaaacaaga 300agacttctgg atactgaaga tgagctcagt gacattcaga ctgactcagt cccatctgaa 360gtccgggact ggttggcttc tacctttaca cggaaaatgg ggatgacaaa aaagaaacct 420gaggaaaaac caaaatttcg gagcattgtg catgctgttc aagctggaat ttttgtggaa 480agaatgtacc gaaaaacata tcatatggtt ggtttggcat atccagcagc tgtcatcgta 540acattaaagg atgttgataa atggtctttc gatgtatttg ccctaaatga agcaagtgga 600gagcatagtc tgaagtttat gatttatgaa ctgtttacca gatatgatct tatcaaccgt 660ttcaagattc ctgtttcttg cctaatcacc tttgcagaag ctttagaagt tggttacagc 720aagtacaaaa atccatatca caatttgatt catgcagctg atgtcactca aactgtgcat 780tacataatgc ttcatacagg tatcatgcac tggctcactg aactggaaat tttagcaatg 840gtctttgctg ctgccattca tgattatgag catacaggga caacaaacaa ctttcacatt 900cagacaaggt cagatgttgc cattttgtat aatgatcgct ctgtccttga gaatcaccac 960gtgagtgcag cttatcgact tatgcaagaa gaagaaatga atatcttgat aaatttatcc 1020aaagatgact ggagggatct tcggaaccta gtgattgaaa tggttttatc tacagacatg 1080tcaggtcact tccagcaaat taaaaatata agaaacagtt tgcagcagcc tgaagggatt 1140gacagagcca aaaccatgtc cctgattctc cacgcagcag acatcagcca cccagccaaa 1200tcctggaagc tgcattatcg gtggaccatg gccctaatgg aggagttttt cctgcaggga 1260gataaagaag ctgaattagg gcttccattt tccccacttt gtgatcggaa gtcaaccatg 1320gtggcccagt cacaaatagg tttcatcgat ttcatagtag agccaacatt ttctcttctg 1380acagactcaa cagagaaaat tgttattcct cttatagagg aagcctcaaa agccgaaact 1440tcttcctatg tggcaagcag ctcaaccacc attgtggggt tacacattgc tgatgcacta 1500agacgatcaa atacaaaagg ctccatgagt gatgggtcct attccccaga ctactccctt 1560gcagcagtgg acctgaagag tttcaagaac aacctggtgg acatcattca gcagaacaaa 1620gagaggtgga aagagttagc tgcacaagaa gcaagaacca gttcacagaa gtgtgagttt 1680attcatcagt aaacaccttt aagtaaaacc tcgtgcatgg tggcagctct aatttgacca 1740aaagacttgg agattttgat tatgcttgct ggaaatctac cctgtcctgt gtgagacagg 1800aaatctattt ttgcagattg ctcaataagc atcatgagcc acataaataa cagctgtaaa 1860ctccttaatt caccgggctc aactgctacc gaacagattc atctagtggc tacatcagca 1920ccttgtgctt tcagatatct gtttcaatgg cattttgtgg catttgtctt taccgagtgc 1980caataaattt tctttgagca gctaaaaaa 2009282846DNAHomo sapiens 28aaatgcttga ggagagagag agagtaagga gccagccatg aatcctttcc agaaaaatga 60gtccaaggaa actctttttt cacctgtctc cattgaagag gtaccacctc gaccacctag 120ccctccaaag aagccatctc cgacaatctg tggctccaac tatccactga gcattgcctt 180cattgtggtg aatgaattct gcgagcgctt ttcctattat ggaatgaaag ctgtgctgat 240cctgtatttc ctgtatttcc tgcactggaa tgaagatacc tccacatcta tataccatgc 300cttcagcagc ctctgttatt ttactcccat cctgggagca gccattgctg actcgtggtt 360gggaaaattc aagacaatca tctatctctc cttggtgtat gtgcttggcc atgtgatcaa 420gtccttgggt gccttaccaa tactgggagg acaagtggta cacacagtcc tatcattgat 480cggcctgagt ctaatagctt tggggacagg aggcatcaaa ccctgtgtgg cagcttttgg 540tggagaccag tttgaagaaa aacatgcaga ggaacggact agatacttct cagtcttcta 600cctgtccatc aatgcaggga gcttgatttc tacatttatc acacccatgc tgagaggaga 660tgtgcaatgt tttggagaag actgctatgc attggctttt ggagttccag gactgctcat 720ggtaattgca cttgttgtgt ttgcaatggg aagcaaaata tacaataaac caccccctga 780aggaaacata gtggctcaag ttttcaaatg tatctggttt gctatttcca atcgtttcaa 840gaaccgttct ggagacattc caaagcgaca gcactggcta gactgggcgg ctgagaaata 900tccaaagcag ctcattatgg atgtaaaggc actgaccagg gtactattcc tttatatccc 960attgcccatg ttctgggctc ttttggatca gcagggttca cgatggactt tgcaagccat 1020caggatgaat aggaatttgg ggttttttgt gcttcagccg gaccagatgc aggttctaaa 1080tccccttctg gttcttatct tcatcccgtt gtttgacttt gtcatttatc gtctggtctc 1140caagtgtgga attaacttct catcacttag gaaaatggct gttggtatga tcctagcatg 1200cctggcattt gcagttgcgg cagctgtaga gataaaaata aatgaaatgg ccccagccca 1260gccaggtccc caggaggttt tcctacaagt cttgaatctg gcagatgatg aggtgaaggt 1320gacagtggtg ggaaatgaaa acaattctct gttgatagag tccatcaaat cctttcagaa 1380aacaccacac tattccaaac tgcacctgaa aacaaaaagc caggattttc acttccacct 1440gaaatatcac aatttgtctc tctacactga gcattctgtg caggagaaga actggtacag 1500tcttgtcatt cgtgaagatg ggaacagtat ctccagcatg atggtaaagg atacagaaag 1560cagaacaacc aatgggatga caaccgtgag gtttgttaac actttgcata aagatgtcaa 1620catctccctg agtacagata cctctctcaa tgttggtgaa gactatggtg tgtctgctta 1680tagaactgtg caaagaggag aataccctgc agtgcactgt agaacagaag ataagaactt 1740ttctctgaat ttgggtcttc tagactttgg tgcagcatat ctgtttgtta ttactaataa 1800caccaatcag ggtcttcagg cctggaagat tgaagacatt ccagccaaca aaatgtccat 1860tgcgtggcag ctaccacaat atgccctggt tacagctggg gaggtcatgt tctctgtcac 1920aggtcttgag ttttcttatt ctcaggctcc ctctggcatg aaatctgtgc tccaggcagc 1980ttggctattg acaattgcag ttgggaatat catcgtgctt gttgtggcac agttcagtgg 2040cctggtacag tgggccgaat tcattttgtt ttcctgcctc ctgctggtga tctgcctgat 2100cttctccatc atgggctact actatgttcc tgtaaagaca gaggatatgc ggggtccagc 2160agataagcac attcctcaca tccaggggaa catgatcaaa ctagagacca agaagacaaa 2220actctgatga ctccctagat tctgtcctga ccccaattcc tggccctgtc ttgaagcatt 2280ttttttcttc tactggatta gacaagagag atagcagcat atcagagctg atctcctcca 2340cctttctcca atgacagaag ttccaggact ggttttccag tacatcttta aacaaggccc 2400cagagactct atgtctgccc gtccatcagt gaactcatta aaacttgtgc agtgttgctg 2460gagctggcct ggtgtctcca aatgaccatg aaaatacaca cgtataatgg agatcattct 2520ctgtgggtat gcaaagttat gggaattcct ttataggtaa ctgccattta ggactgatgg 2580ccctaatttt tgaggtgctg atttagaggc aaaattgcag aataacaaag aaatggtatt 2640tcaagttttt ttttttataa gcaatgtaat tatgctattc acaggggcct caagaattgg 2700tatgtatgat gtgatctggt ccagccaggg cctggcttgt cagctctcta ggtttgatat 2760gactttagta aatttgtcaa tatagatggt aggaagcaga atgccatttt attaaaacac 2820aggagaagtt aaaaaaaaaa aaaaaa 28462921DNAArtificial SequenceSynthetic oligonucleotide 29ccgtttacgt ggagactcgc c 213025DNAArtificial SequenceSynthetic oligonucleotide 30cccccacctt atatatattc tttcc 253119DNAArtificial SequenceSynthetic oligonucleotide 31ccatgcctat ttctacagc 193219DNAArtificial SequenceSynthetic oligonucleotide 32tcagtaacag ctcccagac 193319DNAArtificial SequenceSynthetic oligonucleotide 33ccatgcctat

ttctacagc 193419DNAArtificial SequenceSynthetic oligonucleotide 34tcagtaacag ctcccagac 193522DNAArtificial SequenceSynthetic oligonucleotide 35ggcaatagca ggttcacgta ca 223622DNAArtificial SequenceSynthetic oligonucleotide 36cgataacagt cttgccccac tt 223720DNAArtificial SequenceSynthetic oligonucleotide 37acggcacacc ctacgttacc 203824DNAArtificial SequenceSynthetic oligonucleotide 38tgtgcaagga gagaacctct agct 243919DNAArtificial SequenceSynthetic oligonucleotide 39ccaacactgt gcgcagctt 194022DNAArtificial SequenceSynthetic oligonucleotide 40aagaatctcc gggttgtttt cc 224124DNAArtificial SequenceSynthetic oligonucleotide 41cagtctcatc ctgaaagcat ctga 244220DNAArtificial SequenceSynthetic oligonucleotide 42tttcccacac actccaccaa 204323DNAArtificial SequenceSynthetic oligonucleotide 43tggagtgttt tacgctgaac gat 234431DNAArtificial SequenceSynthetic oligonucleotide 44cctcttactg ctataccttt actctttatg g 314521DNAArtificial SequenceSynthetic oligonucleotide 45tgccatcaaa gtcttctgca a 214621DNAArtificial SequenceSynthetic oligonucleotide 46cgccatactc gaactggaat c 214725DNAArtificial SequenceSynthetic oligonucleotide 47cactattatt ttggcacaac aggaa 254824DNAArtificial SequenceSynthetic oligonucleotide 48agacacatat ttggcatggt tctg 244924DNAArtificial SequenceSynthetic oligonucleotide 49caagggatcc agtctctcta tggt 245024DNAArtificial SequenceSynthetic oligonucleotide 50ggataaggaa gggtcacatt tgtc 245118DNAArtificial SequenceSynthetic oligonucleotide 51gctcggtgga gggtctca 185221DNAArtificial SequenceSynthetic oligonucleotide 52ctgtgtggat ttctgcgatc a 215323DNAArtificial SequenceSynthetic oligonucleotide 53catccatgac aactttggta tcg 235421DNAArtificial SequenceSynthetic oligonucleotide 54agtcttctgg gtggcagtga t 2155919PRTHomo sapiens 55Met Gly Thr Thr Ala Pro Gly Pro Ile His Leu Leu Glu Leu Cys Asp1 5 10 15Gln Lys Leu Met Glu Phe Leu Cys Asn Met Asp Asn Lys Asp Leu Val 20 25 30Trp Leu Glu Glu Ile Gln Glu Glu Ala Glu Arg Met Phe Thr Arg Glu 35 40 45Phe Ser Lys Glu Pro Glu Leu Met Pro Lys Thr Pro Ser Gln Lys Asn 50 55 60Arg Arg Lys Lys Arg Arg Ile Ser Tyr Val Gln Asp Glu Asn Arg Asp65 70 75 80Pro Ile Arg Arg Arg Leu Ser Arg Arg Lys Ser Arg Ser Ser Gln Leu 85 90 95Ser Ser Arg Arg Leu Arg Ser Lys Asp Ser Val Glu Lys Leu Ala Thr 100 105 110Val Val Gly Glu Asn Gly Ser Val Leu Arg Arg Val Thr Arg Ala Ala 115 120 125Ala Ala Ala Ala Ala Ala Thr Met Ala Leu Ala Ala Pro Ser Ser Pro 130 135 140Thr Pro Glu Ser Pro Thr Met Leu Thr Lys Lys Pro Glu Asp Asn His145 150 155 160Thr Gln Cys Gln Leu Val Pro Val Val Glu Ile Gly Ile Ser Glu Arg 165 170 175Gln Asn Ala Glu Gln His Val Thr Gln Leu Met Ser Thr Glu Pro Leu 180 185 190Pro Arg Thr Leu Ser Pro Thr Pro Ala Ser Ala Thr Ala Pro Thr Ser 195 200 205Gln Gly Ile Pro Thr Ser Asp Glu Glu Ser Thr Pro Lys Lys Ser Lys 210 215 220Ala Arg Ile Leu Glu Ser Ile Thr Val Ser Ser Leu Met Ala Thr Pro225 230 235 240Gln Asp Pro Lys Gly Gln Gly Val Gly Thr Gly Arg Ser Ala Ser Lys 245 250 255Leu Arg Ile Ala Gln Val Ser Pro Gly Pro Arg Asp Ser Pro Ala Phe 260 265 270Pro Asp Ser Pro Trp Arg Glu Arg Val Leu Ala Pro Ile Leu Pro Asp 275 280 285Asn Phe Ser Thr Pro Thr Gly Ser Arg Thr Asp Ser Gln Ser Val Arg 290 295 300His Ser Pro Ile Ala Pro Ser Ser Pro Ser Pro Gln Val Leu Ala Gln305 310 315 320Lys Tyr Ser Leu Val Ala Lys Gln Glu Ser Val Val Arg Arg Ala Ser 325 330 335Arg Arg Leu Ala Lys Lys Thr Ala Glu Glu Pro Ala Ala Ser Gly Arg 340 345 350Ile Ile Cys His Ser Tyr Leu Glu Arg Leu Leu Asn Val Glu Val Pro 355 360 365Gln Lys Val Gly Ser Glu Gln Lys Glu Pro Pro Glu Glu Ala Glu Pro 370 375 380Val Ala Ala Ala Glu Pro Glu Val Pro Glu Asn Asn Gly Asn Asn Ser385 390 395 400Trp Pro His Asn Asp Thr Glu Ile Ala Asn Ser Thr Pro Asn Pro Lys 405 410 415Pro Ala Ala Ser Ser Pro Glu Thr Pro Ser Ala Gly Gln Gln Glu Ala 420 425 430Lys Thr Asp Gln Ala Asp Gly Pro Arg Glu Pro Pro Gln Ser Ala Arg 435 440 445Arg Lys Arg Ser Tyr Lys Gln Ala Val Ser Glu Leu Asp Glu Glu Gln 450 455 460His Leu Glu Asp Glu Glu Leu Gln Pro Pro Arg Ser Lys Thr Pro Ser465 470 475 480Ser Pro Cys Pro Ala Ser Lys Val Val Arg Pro Leu Arg Thr Phe Leu 485 490 495His Thr Val Gln Arg Asn Gln Met Leu Met Thr Pro Thr Ser Ala Pro 500 505 510Arg Ser Val Met Lys Ser Phe Ile Lys Arg Asn Thr Pro Leu Arg Met 515 520 525Asp Pro Lys Glu Lys Glu Arg Gln Arg Leu Glu Asn Leu Arg Arg Lys 530 535 540Glu Glu Ala Glu Gln Leu Arg Arg Gln Lys Val Glu Glu Asp Lys Arg545 550 555 560Arg Arg Leu Glu Glu Val Lys Leu Lys Arg Glu Glu Arg Leu Arg Lys 565 570 575Val Leu Gln Ala Arg Glu Arg Val Glu Gln Met Lys Glu Glu Lys Lys 580 585 590Lys Gln Ile Glu Gln Lys Phe Ala Gln Ile Asp Glu Lys Thr Glu Lys 595 600 605Ala Lys Glu Glu Arg Leu Ala Glu Glu Lys Ala Lys Lys Lys Ala Ala 610 615 620Ala Lys Lys Met Glu Glu Val Glu Ala Arg Arg Lys Gln Glu Glu Asp625 630 635 640Ala Arg Arg Leu Arg Trp Leu Gln Gln Glu Glu Glu Glu Arg Arg His 645 650 655Gln Glu Leu Leu Gln Lys Lys Lys Glu Glu Glu Gln Glu Arg Leu Arg 660 665 670Lys Ala Ala Glu Ala Lys Arg Leu Ala Glu Gln Arg Glu Gln Glu Arg 675 680 685Arg Glu Gln Glu Arg Arg Glu Gln Glu Arg Arg Glu Gln Glu Arg Arg 690 695 700Glu Gln Glu Arg Arg Glu Gln Glu Arg Arg Glu Gln Glu Arg Gln Leu705 710 715 720Ala Glu Gln Glu Arg Arg Arg Glu Gln Glu Arg Leu Gln Ala Glu Arg 725 730 735Glu Leu Gln Glu Arg Glu Lys Ala Leu Arg Leu Gln Lys Glu Gln Leu 740 745 750Gln Arg Glu Leu Glu Glu Lys Lys Lys Lys Glu Glu Gln Gln Arg Leu 755 760 765Ala Glu Arg Gln Leu Gln Glu Glu Gln Glu Lys Lys Ala Lys Glu Ala 770 775 780Ala Gly Ala Ser Lys Ala Leu Asn Val Thr Val Asp Val Gln Ser Pro785 790 795 800Ala Cys Thr Ser Ser Pro Ile Thr Pro Gln Gly His Lys Ala Pro Pro 805 810 815Gln Ile Asn Pro His Asn Tyr Gly Met Asp Leu Asn Ser Asp Asp Ser 820 825 830Thr Asp Asp Glu Ala His Pro Arg Lys Pro Ile Pro Thr Trp Ala Arg 835 840 845Gly Thr Pro Leu Ser Gln Ala Ile Ile His Gln Tyr Tyr Gln Pro Pro 850 855 860Asn Leu Leu Glu Leu Phe Gly Thr Ile Leu Pro Leu Asp Leu Glu Asp865 870 875 880Ile Phe Lys Lys Ser Lys Pro Arg Tyr His Lys Arg Thr Ser Ser Ala 885 890 895Val Trp Asn Ser Pro Pro Leu Gln Gly Ala Arg Val Pro Ser Ser Leu 900 905 910Ala Tyr Ser Leu Lys Lys His 91556804PRTHomo sapiens 56Met Thr Asn Gln Glu Lys Trp Ala His Leu Ser Pro Ser Glu Phe Ser1 5 10 15Gln Leu Gln Lys Tyr Ala Glu Tyr Ser Thr Lys Lys Leu Lys Asp Val 20 25 30Leu Glu Glu Phe His Gly Asn Gly Val Leu Ala Lys Tyr Asn Pro Glu 35 40 45Gly Lys Gln Asp Ile Leu Asn Gln Thr Ile Asp Phe Glu Gly Phe Lys 50 55 60Leu Phe Met Lys Thr Phe Leu Glu Ala Glu Leu Pro Asp Asp Phe Thr65 70 75 80Ala His Leu Phe Met Ser Phe Ser Asn Lys Phe Pro His Ser Ser Pro 85 90 95Met Val Lys Ser Lys Pro Ala Leu Leu Ser Gly Gly Leu Arg Met Asn 100 105 110Lys Gly Ala Ile Thr Pro Pro Arg Thr Thr Ser Pro Ala Asn Thr Cys 115 120 125Ser Pro Glu Val Ile His Leu Lys Asp Ile Val Cys Tyr Leu Ser Leu 130 135 140Leu Glu Arg Gly Arg Pro Glu Asp Lys Leu Glu Phe Met Phe Arg Leu145 150 155 160Tyr Asp Thr Asp Gly Asn Gly Phe Leu Asp Ser Ser Glu Leu Glu Asn 165 170 175Ile Ile Ser Gln Met Met His Val Ala Glu Tyr Leu Glu Trp Asp Val 180 185 190Thr Glu Leu Asn Pro Ile Leu His Glu Met Met Glu Glu Ile Asp Tyr 195 200 205Asp His Asp Gly Thr Val Ser Leu Glu Glu Trp Ile Gln Gly Gly Met 210 215 220Thr Thr Ile Pro Leu Leu Val Leu Leu Gly Leu Glu Asn Asn Val Lys225 230 235 240Asp Asp Gly Gln His Val Trp Arg Leu Lys His Phe Asn Lys Pro Ala 245 250 255Tyr Cys Asn Leu Cys Leu Asn Met Leu Ile Gly Val Gly Lys Gln Gly 260 265 270Leu Cys Cys Ser Phe Cys Lys Tyr Thr Val His Glu Arg Cys Val Ala 275 280 285Arg Ala Pro Pro Ser Cys Ile Lys Thr Tyr Val Lys Ser Lys Arg Asn 290 295 300Thr Asp Val Met His His Tyr Trp Val Glu Gly Asn Cys Pro Thr Lys305 310 315 320Cys Asp Lys Cys His Lys Thr Val Lys Cys Tyr Gln Gly Leu Thr Gly 325 330 335Leu His Cys Val Trp Cys Gln Ile Thr Leu His Asn Lys Cys Ala Ser 340 345 350His Leu Lys Pro Glu Cys Asp Cys Gly Pro Leu Lys Asp His Ile Leu 355 360 365Pro Pro Thr Thr Ile Cys Pro Val Val Leu Gln Thr Leu Pro Thr Ser 370 375 380Gly Val Ser Val Pro Glu Glu Arg Gln Ser Thr Val Lys Lys Glu Lys385 390 395 400Ser Gly Ser Gln Gln Pro Asn Lys Val Ile Asp Lys Asn Lys Met Gln 405 410 415Arg Ala Asn Ser Val Thr Val Asp Gly Gln Gly Leu Gln Val Thr Pro 420 425 430Val Pro Gly Thr His Pro Leu Leu Val Phe Val Asn Pro Lys Ser Gly 435 440 445Gly Lys Gln Gly Glu Arg Ile Tyr Arg Lys Phe Gln Tyr Leu Leu Asn 450 455 460Pro Arg Gln Val Tyr Ser Leu Ser Gly Asn Gly Pro Met Pro Gly Leu465 470 475 480Asn Phe Phe Arg Asp Val Pro Asp Phe Arg Val Leu Ala Cys Gly Gly 485 490 495Asp Gly Thr Val Gly Trp Val Leu Asp Cys Ile Glu Lys Ala Asn Val 500 505 510Gly Lys His Pro Pro Val Ala Ile Leu Pro Leu Gly Thr Gly Asn Asp 515 520 525Leu Ala Arg Cys Leu Arg Trp Gly Gly Gly Tyr Glu Gly Glu Asn Leu 530 535 540Met Lys Ile Leu Lys Asp Ile Glu Asn Ser Thr Glu Ile Met Leu Asp545 550 555 560Arg Trp Lys Phe Glu Val Ile Pro Asn Asp Lys Asp Glu Lys Gly Asp 565 570 575Pro Val Pro Tyr Ser Ile Ile Asn Asn Tyr Phe Ser Ile Gly Val Asp 580 585 590Ala Ser Ile Ala His Arg Phe His Ile Met Arg Glu Lys His Pro Glu 595 600 605Lys Phe Asn Ser Arg Met Lys Asn Lys Phe Trp Tyr Phe Glu Phe Gly 610 615 620Thr Ser Glu Thr Phe Ser Ala Thr Cys Lys Lys Leu His Glu Ser Val625 630 635 640Glu Ile Glu Cys Asp Gly Val Gln Ile Asp Leu Ile Asn Ile Ser Leu 645 650 655Glu Gly Ile Ala Ile Leu Asn Ile Pro Ser Met His Gly Gly Ser Asn 660 665 670Leu Trp Gly Glu Ser Lys Lys Arg Arg Ser His Arg Arg Ile Glu Lys 675 680 685Lys Gly Ser Asp Lys Arg Thr Thr Val Thr Asp Ala Lys Glu Leu Lys 690 695 700Phe Ala Ser Gln Asp Leu Ser Asp Gln Leu Leu Glu Val Val Gly Leu705 710 715 720Glu Gly Ala Met Glu Met Gly Gln Ile Tyr Thr Gly Leu Lys Ser Ala 725 730 735Gly Arg Arg Leu Ala Gln Cys Ser Cys Val Val Ile Arg Thr Ser Lys 740 745 750Ser Leu Pro Met Gln Ile Asp Gly Glu Pro Trp Met Gln Thr Pro Cys 755 760 765Thr Ile Lys Ile Thr His Lys Asn Gln Ala Pro Met Leu Met Gly Pro 770 775 780Pro Pro Lys Thr Gly Leu Phe Cys Ser Leu Val Lys Arg Thr Arg Asn785 790 795 800Arg Ser Lys Glu57773PRTHomo sapiens 57Met Thr Asn Gln Glu Lys Trp Ala His Leu Ser Pro Ser Glu Phe Ser1 5 10 15Gln Leu Gln Lys Tyr Ala Glu Tyr Ser Thr Lys Lys Leu Lys Asp Val 20 25 30Leu Glu Glu Phe His Gly Asn Gly Val Leu Ala Lys Tyr Asn Pro Glu 35 40 45Gly Lys Gln Asp Ile Leu Asn Gln Thr Ile Asp Phe Glu Gly Phe Lys 50 55 60Leu Phe Met Lys Thr Phe Leu Glu Ala Glu Leu Pro Asp Asp Phe Thr65 70 75 80Ala His Leu Phe Met Ser Phe Ser Asn Lys Phe Pro His Ser Ser Pro 85 90 95Met Val Lys Ser Lys Pro Ala Leu Leu Ser Gly Gly Leu Arg Met Asn 100 105 110Lys Gly Ala Ile Thr Pro Pro Arg Thr Thr Ser Pro Ala Asn Thr Cys 115 120 125Ser Pro Glu Val Ile His Leu Lys Asp Ile Val Cys Tyr Leu Ser Leu 130 135 140Leu Glu Arg Gly Arg Pro Glu Asp Lys Leu Glu Phe Met Phe Arg Leu145 150 155 160Tyr Asp Thr Asp Gly Asn Gly Phe Leu Asp Ser Ser Glu Leu Glu Asn 165 170 175Ile Ile Ser Gln Met Met His Val Ala Glu Tyr Leu Glu Trp Asp Val 180 185 190Thr Glu Leu Asn Pro Ile Leu His Glu Met Met Glu Glu Ile Asp Tyr 195 200 205Asp His Asp Gly Thr Val Ser Leu Glu Glu Trp Ile Gln Gly Gly Met 210 215 220Thr Thr Ile Pro Leu Leu Val Leu Leu Gly Leu Glu Asn Asn Val Lys225 230 235 240Asp Asp Gly Gln His Val Trp Arg Leu Lys His Phe Asn Lys Pro Ala 245 250 255Tyr Cys Asn Leu Cys Leu Asn Met Leu Ile Gly Val Gly Lys Gln Gly 260 265 270Leu Cys Cys Ser Phe Cys Lys Tyr Thr Val His Glu Arg Cys Val Ala 275 280 285Arg Ala Pro Pro Ser Cys Ile Lys Thr Tyr Val Lys Ser Lys Arg Asn 290 295 300Thr Asp Val Met His His Tyr Trp Val Glu Gly Asn Cys Pro Thr Lys305 310 315 320Cys Asp Lys Cys His Lys Thr

Val Lys Cys Tyr Gln Gly Leu Thr Gly 325 330 335Leu His Cys Val Trp Cys Gln Ile Thr Leu His Asn Lys Cys Ala Ser 340 345 350His Leu Lys Pro Glu Cys Asp Cys Gly Pro Leu Lys Asp His Ile Leu 355 360 365Pro Pro Thr Thr Ile Cys Pro Val Val Leu Gln Thr Leu Pro Thr Ser 370 375 380Gly Val Ser Val Pro Glu Glu Arg Gln Ser Thr Val Lys Lys Glu Lys385 390 395 400Ser Gly Ser Gln Gln Pro Asn Lys Val Ile Asp Lys Asn Lys Met Gln 405 410 415Arg Ala Asn Ser Val Thr Val Asp Gly Gln Gly Leu Gln Val Thr Pro 420 425 430Val Pro Gly Thr His Pro Leu Leu Val Phe Val Asn Pro Lys Ser Gly 435 440 445Gly Lys Gln Gly Glu Arg Ile Tyr Arg Lys Phe Gln Tyr Leu Leu Asn 450 455 460Pro Arg Gln Val Tyr Ser Leu Ser Gly Asn Gly Pro Met Pro Gly Leu465 470 475 480Asn Phe Phe Arg Asp Val Pro Asp Phe Arg Val Leu Ala Cys Gly Gly 485 490 495Asp Gly Thr Val Gly Trp Val Leu Asp Cys Ile Glu Lys Ala Asn Val 500 505 510Gly Lys His Pro Pro Val Ala Ile Leu Pro Leu Gly Thr Gly Asn Asp 515 520 525Leu Ala Arg Cys Leu Arg Trp Gly Gly Gly Tyr Glu Gly Glu Asn Leu 530 535 540Met Lys Ile Leu Lys Asp Ile Glu Asn Ser Thr Glu Ile Met Leu Asp545 550 555 560Arg Trp Lys Phe Glu Val Ile Pro Asn Asp Lys Asp Glu Lys Gly Asp 565 570 575Pro Val Pro Tyr Ser Ile Ile Asn Asn Tyr Phe Ser Ile Gly Val Asp 580 585 590Ala Ser Ile Ala His Arg Phe His Ile Met Arg Glu Lys His Pro Glu 595 600 605Lys Phe Asn Ser Arg Met Lys Asn Lys Phe Trp Tyr Phe Glu Phe Gly 610 615 620Thr Ser Glu Thr Phe Ser Ala Thr Cys Lys Lys Leu His Glu Ser Val625 630 635 640Glu Ile Glu Cys Asp Gly Val Gln Ile Asp Leu Ile Asn Ile Ser Leu 645 650 655Glu Gly Ile Ala Ile Leu Asn Ile Pro Ser Met His Gly Gly Ser Asn 660 665 670Leu Trp Gly Glu Ser Lys Lys Arg Arg Ser His Arg Arg Ile Glu Lys 675 680 685Lys Gly Ser Asp Lys Arg Thr Thr Val Thr Asp Ala Lys Glu Leu Lys 690 695 700Phe Ala Ser Gln Asp Leu Ser Asp Gln Leu Leu Glu Val Val Gly Leu705 710 715 720Glu Gly Ala Met Glu Met Gly Gln Ile Tyr Thr Gly Leu Lys Ser Ala 725 730 735Gly Arg Arg Leu Ala Gln Cys Ser Cys Val Val Ile Arg Thr Ser Lys 740 745 750Ser Leu Pro Met Gln Ile Asp Gly Glu Pro Trp Met Gln Thr Pro Cys 755 760 765Thr Val Ser Thr Glu 77058632PRTHomo sapiens 58Met Asn Arg Tyr Thr Thr Ile Arg Gln Leu Gly Asp Gly Thr Tyr Gly1 5 10 15Ser Val Leu Leu Gly Arg Ser Ile Glu Ser Gly Glu Leu Ile Ala Ile 20 25 30Lys Lys Met Lys Arg Lys Phe Tyr Ser Trp Glu Glu Cys Met Asn Leu 35 40 45Arg Glu Val Lys Ser Leu Lys Lys Leu Asn His Ala Asn Val Val Lys 50 55 60Leu Lys Glu Val Ile Arg Glu Asn Asp His Leu Tyr Phe Ile Phe Glu65 70 75 80Tyr Met Lys Glu Asn Leu Tyr Gln Leu Ile Lys Glu Arg Asn Lys Leu 85 90 95Phe Pro Glu Ser Ala Ile Arg Asn Ile Met Tyr Gln Ile Leu Gln Gly 100 105 110Leu Ala Phe Ile His Lys His Gly Phe Phe His Arg Asp Leu Lys Pro 115 120 125Glu Asn Leu Leu Cys Met Gly Pro Glu Leu Val Lys Ile Ala Asp Phe 130 135 140Gly Leu Ala Arg Glu Ile Arg Ser Lys Pro Pro Tyr Thr Asp Tyr Val145 150 155 160Ser Thr Arg Trp Tyr Arg Ala Pro Glu Val Leu Leu Arg Ser Thr Asn 165 170 175Tyr Ser Ser Pro Ile Asp Val Trp Ala Val Gly Cys Ile Met Ala Glu 180 185 190Val Tyr Thr Leu Arg Pro Leu Phe Pro Gly Ala Ser Glu Ile Asp Thr 195 200 205Ile Phe Lys Ile Cys Gln Val Leu Gly Thr Pro Lys Lys Thr Asp Trp 210 215 220Pro Glu Gly Tyr Gln Leu Ser Ser Ala Met Asn Phe Arg Trp Pro Gln225 230 235 240Cys Val Pro Asn Asn Leu Lys Thr Leu Ile Pro Asn Ala Ser Ser Glu 245 250 255Ala Val Gln Leu Leu Arg Asp Met Leu Gln Trp Asp Pro Lys Lys Arg 260 265 270Pro Thr Ala Ser Gln Ala Leu Arg Tyr Pro Tyr Phe Gln Val Gly His 275 280 285Pro Leu Gly Ser Thr Thr Gln Asn Leu Gln Asp Ser Glu Lys Pro Gln 290 295 300Lys Gly Ile Leu Glu Lys Ala Gly Pro Pro Pro Tyr Ile Lys Pro Val305 310 315 320Pro Pro Ala Gln Pro Pro Ala Lys Pro His Thr Arg Ile Ser Ser Arg 325 330 335Gln His Gln Ala Ser Gln Pro Pro Leu His Leu Thr Tyr Pro Tyr Lys 340 345 350Ala Glu Val Ser Arg Thr Asp His Pro Ser His Leu Gln Glu Asp Lys 355 360 365Pro Ser Pro Leu Leu Phe Pro Ser Leu His Asn Lys His Pro Gln Ser 370 375 380Lys Ile Thr Ala Gly Leu Glu His Lys Asn Gly Glu Ile Lys Pro Lys385 390 395 400Ser Arg Arg Arg Trp Gly Leu Ile Ser Arg Ser Thr Lys Asp Ser Asp 405 410 415Asp Trp Ala Asp Leu Asp Asp Leu Asp Phe Ser Pro Ser Leu Ser Arg 420 425 430Ile Asp Leu Lys Asn Lys Lys Arg Gln Ser Asp Asp Thr Leu Cys Arg 435 440 445Phe Glu Ser Val Leu Asp Leu Lys Pro Ser Glu Pro Val Gly Thr Gly 450 455 460Asn Ser Ala Pro Thr Gln Thr Ser Tyr Gln Arg Arg Asp Thr Pro Thr465 470 475 480Leu Arg Ser Ala Ala Lys Gln His Tyr Leu Lys His Ser Arg Tyr Leu 485 490 495Pro Gly Ile Ser Ile Arg Asn Gly Ile Leu Ser Asn Pro Gly Lys Glu 500 505 510Phe Ile Pro Pro Asn Pro Trp Ser Ser Ser Gly Leu Ser Gly Lys Ser 515 520 525Ser Gly Thr Met Ser Val Ile Ser Lys Val Asn Ser Val Gly Ser Ser 530 535 540Ser Thr Ser Ser Ser Gly Leu Thr Gly Asn Tyr Val Pro Ser Phe Leu545 550 555 560Lys Lys Glu Ile Gly Ser Ala Met Gln Arg Val His Leu Ala Pro Ile 565 570 575Pro Asp Pro Ser Pro Gly Tyr Ser Ser Leu Lys Ala Met Arg Pro His 580 585 590Pro Gly Arg Pro Phe Phe His Thr Gln Pro Arg Ser Thr Pro Gly Leu 595 600 605Ile Pro Arg Pro Pro Ala Ala Gln Pro Val His Gly Arg Thr Asp Trp 610 615 620Ala Ser Lys Tyr Ala Ser Arg Arg625 63059632PRTHomo sapiens 59Met Asn Arg Tyr Thr Thr Ile Arg Gln Leu Gly Asp Gly Thr Tyr Gly1 5 10 15Ser Val Leu Leu Gly Arg Ser Ile Glu Ser Gly Glu Leu Ile Ala Ile 20 25 30Lys Lys Met Lys Arg Lys Phe Tyr Ser Trp Glu Glu Cys Met Asn Leu 35 40 45Arg Glu Val Lys Ser Leu Lys Lys Leu Asn His Ala Asn Val Val Lys 50 55 60Leu Lys Glu Val Ile Arg Glu Asn Asp His Leu Tyr Phe Ile Phe Glu65 70 75 80Tyr Met Lys Glu Asn Leu Tyr Gln Leu Ile Lys Glu Arg Asn Lys Leu 85 90 95Phe Pro Glu Ser Ala Ile Arg Asn Ile Met Tyr Gln Ile Leu Gln Gly 100 105 110Leu Ala Phe Ile His Lys His Gly Phe Phe His Arg Asp Leu Lys Pro 115 120 125Glu Asn Leu Leu Cys Met Gly Pro Glu Leu Val Lys Ile Ala Asp Phe 130 135 140Gly Leu Ala Arg Glu Ile Arg Ser Lys Pro Pro Tyr Thr Asp Tyr Val145 150 155 160Ser Thr Arg Trp Tyr Arg Ala Pro Glu Val Leu Leu Arg Ser Thr Asn 165 170 175Tyr Ser Ser Pro Ile Asp Val Trp Ala Val Gly Cys Ile Met Ala Glu 180 185 190Val Tyr Thr Leu Arg Pro Leu Phe Pro Gly Ala Ser Glu Ile Asp Thr 195 200 205Ile Phe Lys Ile Cys Gln Val Leu Gly Thr Pro Lys Lys Thr Asp Trp 210 215 220Pro Glu Gly Tyr Gln Leu Ser Ser Ala Met Asn Phe Arg Trp Pro Gln225 230 235 240Cys Val Pro Asn Asn Leu Lys Thr Leu Ile Pro Asn Ala Ser Ser Glu 245 250 255Ala Val Gln Leu Leu Arg Asp Met Leu Gln Trp Asp Pro Lys Lys Arg 260 265 270Pro Thr Ala Ser Gln Ala Leu Arg Tyr Pro Tyr Phe Gln Val Gly His 275 280 285Pro Leu Gly Ser Thr Thr Gln Asn Leu Gln Asp Ser Glu Lys Pro Gln 290 295 300Lys Gly Ile Leu Glu Lys Ala Gly Pro Pro Pro Tyr Ile Lys Pro Val305 310 315 320Pro Pro Ala Gln Pro Pro Ala Lys Pro His Thr Arg Ile Ser Ser Arg 325 330 335Gln His Gln Ala Ser Gln Pro Pro Leu His Leu Thr Tyr Pro Tyr Lys 340 345 350Ala Glu Val Ser Arg Thr Asp His Pro Ser His Leu Gln Glu Asp Lys 355 360 365Pro Ser Pro Leu Leu Phe Pro Ser Leu His Asn Lys His Pro Gln Ser 370 375 380Lys Ile Thr Ala Gly Leu Glu His Lys Asn Gly Glu Ile Lys Pro Lys385 390 395 400Ser Arg Arg Arg Trp Gly Leu Ile Ser Arg Ser Thr Lys Asp Ser Asp 405 410 415Asp Trp Ala Asp Leu Asp Asp Leu Asp Phe Ser Pro Ser Leu Ser Arg 420 425 430Ile Asp Leu Lys Asn Lys Lys Arg Gln Ser Asp Asp Thr Leu Cys Arg 435 440 445Phe Glu Ser Val Leu Asp Leu Lys Pro Ser Glu Pro Val Gly Thr Gly 450 455 460Asn Ser Ala Pro Thr Gln Thr Ser Tyr Gln Arg Arg Asp Thr Pro Thr465 470 475 480Leu Arg Ser Ala Ala Lys Gln His Tyr Leu Lys His Ser Arg Tyr Leu 485 490 495Pro Gly Ile Ser Ile Arg Asn Gly Ile Leu Ser Asn Pro Gly Lys Glu 500 505 510Phe Ile Pro Pro Asn Pro Trp Ser Ser Ser Gly Leu Ser Gly Lys Ser 515 520 525Ser Gly Thr Met Ser Val Ile Ser Lys Val Asn Ser Val Gly Ser Ser 530 535 540Ser Thr Ser Ser Ser Gly Leu Thr Gly Asn Tyr Val Pro Ser Phe Leu545 550 555 560Lys Lys Glu Ile Gly Ser Ala Met Gln Arg Val His Leu Ala Pro Ile 565 570 575Pro Asp Pro Ser Pro Gly Tyr Ser Ser Leu Lys Ala Met Arg Pro His 580 585 590Pro Gly Arg Pro Phe Phe His Thr Gln Pro Arg Ser Thr Pro Gly Leu 595 600 605Ile Pro Arg Pro Pro Ala Ala Gln Pro Val His Gly Arg Thr Asp Trp 610 615 620Ala Ser Lys Tyr Ala Ser Arg Arg625 63060455PRTHomo sapiens 60Met Ile Cys Cys Ser Ala Leu Ser Pro Arg Ile His Leu Ser Phe His1 5 10 15Arg Ser Leu Thr Gly Ile Val Leu Ala Asn Ser Ser Leu Asp Ile Val 20 25 30Leu His Asp Thr Tyr Tyr Val Val Ala His Cys Gly Gly Asn Val Arg 35 40 45Arg Leu His Cys Gly Gly Pro Ala Ser Arg Glu Arg Thr Ala Met Gln 50 55 60Ala Leu Asn Ile Thr Pro Glu Gln Phe Ser Arg Leu Leu Arg Asp His65 70 75 80Asn Leu Thr Arg Glu Gln Phe Ile Ala Leu Tyr Arg Leu Arg Pro Leu 85 90 95Val Tyr Thr Pro Glu Leu Pro Gly Arg Ala Lys Leu Ala Leu Val Leu 100 105 110Thr Gly Val Leu Ile Phe Ala Leu Ala Leu Phe Gly Asn Ala Leu Val 115 120 125Phe Tyr Val Val Thr Arg Ser Lys Ala Met Arg Thr Val Thr Asn Ile 130 135 140Phe Ile Cys Ser Leu Ala Leu Ser Asp Leu Leu Ile Thr Phe Phe Cys145 150 155 160Ile Pro Val Thr Met Leu Gln Asn Ile Ser Asp Asn Trp Leu Gly Gly 165 170 175Ala Phe Ile Cys Lys Met Val Pro Phe Val Gln Ser Thr Ala Val Val 180 185 190Thr Glu Ile Leu Thr Met Thr Cys Ile Ala Val Glu Arg His Gln Gly 195 200 205Leu Val His Pro Phe Lys Met Lys Trp Gln Tyr Thr Asn Arg Arg Ala 210 215 220Phe Thr Met Leu Gly Val Val Trp Leu Val Ala Val Ile Val Gly Ser225 230 235 240Pro Met Trp His Val Gln Gln Leu Glu Ile Lys Tyr Asp Phe Leu Tyr 245 250 255Glu Lys Glu His Ile Cys Cys Leu Glu Glu Trp Thr Ser Pro Val His 260 265 270Gln Lys Ile Tyr Thr Thr Phe Ile Leu Ser Ser Ser Ser Ser Cys Leu 275 280 285Leu Trp Lys Lys Lys Arg Ala Val Ile Met Met Val Thr Val Val Ala 290 295 300Leu Phe Ala Val Cys Trp Ala Pro Phe His Val Val His Met Met Ile305 310 315 320Glu Tyr Ser Asn Phe Glu Lys Glu Tyr Asp Asp Val Thr Ile Lys Met 325 330 335Ile Phe Ala Ile Val Gln Ile Ile Gly Phe Ser Asn Ser Ile Cys Asn 340 345 350Pro Ile Val Tyr Ala Phe Met Asn Glu Asn Phe Lys Lys Asn Val Leu 355 360 365Ser Ala Val Cys Tyr Cys Ile Val Asn Lys Thr Phe Ser Pro Ala Gln 370 375 380Arg His Gly Asn Ser Gly Ile Thr Met Met Arg Lys Lys Ala Lys Phe385 390 395 400Ser Leu Arg Glu Asn Pro Val Glu Glu Thr Lys Gly Glu Ala Phe Ser 405 410 415Asp Gly Asn Ile Glu Val Lys Leu Cys Glu Gln Thr Glu Glu Lys Lys 420 425 430Lys Leu Lys Arg His Leu Ala Leu Phe Arg Ser Glu Leu Ala Glu Asn 435 440 445Ser Pro Leu Asp Ser Gly His 450 45561431PRTHomo sapiens 61Met Gln Ala Leu Asn Ile Thr Pro Glu Gln Phe Ser Arg Leu Leu Arg1 5 10 15Asp His Asn Leu Thr Arg Glu Gln Phe Ile Ala Val His Arg Leu Arg 20 25 30Pro Leu Val Tyr Thr Pro Glu Leu Pro Gly Arg Ala Lys Leu Ala Leu 35 40 45Val Leu Thr Gly Val Leu Ile Phe Ala Leu Ala Leu Phe Gly Asn Ala 50 55 60Leu Val Phe Tyr Val Val Thr Arg Ser Lys Ala Met Arg Thr Val Thr65 70 75 80Asn Ile Phe Ile Cys Ser Leu Ala Leu Ser Asp Leu Leu Ile Thr Phe 85 90 95Phe Cys Ile Pro Val Thr Met Leu Gln Asn Ile Ser Asp Asn Trp Leu 100 105 110Gly Gly Ala Phe Ile Cys Lys Met Val Pro Phe Val Gln Ser Thr Ala 115 120 125Val Val Thr Glu Ile Leu Thr Met Thr Cys Ile Ala Val Glu Arg His 130 135 140Gln Gly Leu Val His Pro Phe Lys Met Lys Trp Gln Tyr Thr Asn Arg145 150 155 160Arg Ala Phe Thr Met Leu Gly Val Val Trp Leu Val Ala Val Ile Val 165 170 175Gly Ser Pro Met Trp His Val Gln Gln Leu Glu Ile Lys Tyr Asp Phe 180 185 190Leu Tyr Glu Lys Glu His Ile Cys Cys Leu Glu Glu Trp Thr Ser Pro 195 200 205Val His Gln Lys Ile Tyr Thr Thr Phe Ile Leu Val Ile Leu Phe Leu 210 215 220Leu Pro Leu Met Val Met Leu Ile Leu Tyr Ser Lys Ile Gly Tyr Glu225 230 235 240Leu Trp Ile Lys Lys Arg Val Gly Asp Gly Ser Val Leu Arg Thr Ile 245 250 255His Gly Lys Glu Met Ser Lys Ile Ala Arg Lys Lys Lys Arg Ala Val 260 265 270Ile Met Met Val Thr Val Val Ala Leu Phe Ala Val Cys Trp Ala Pro 275 280 285Phe His Val Val His Met Met Ile Glu Tyr Ser Asn Phe Glu Lys Glu 290

295 300Tyr Asp Asp Val Thr Ile Lys Met Ile Phe Ala Ile Val Gln Ile Ile305 310 315 320Gly Phe Ser Asn Ser Ile Cys Asn Pro Ile Val Tyr Ala Phe Met Asn 325 330 335Glu Asn Phe Lys Lys Asn Val Leu Ser Ala Val Cys Tyr Cys Ile Val 340 345 350Asn Lys Thr Phe Ser Pro Ala Gln Arg His Gly Asn Ser Gly Ile Thr 355 360 365Met Met Arg Lys Lys Ala Lys Phe Ser Leu Arg Glu Asn Pro Val Glu 370 375 380Glu Thr Lys Gly Glu Ala Phe Ser Asp Gly Asn Ile Glu Val Lys Leu385 390 395 400Cys Glu Gln Thr Glu Glu Lys Lys Lys Leu Lys Arg His Leu Ala Leu 405 410 415Phe Arg Ser Glu Leu Ala Glu Asn Ser Pro Leu Asp Ser Gly His 420 425 43062647PRTHomo sapiens 62Met Ala Glu Glu Glu Ala Pro Lys Lys Ser Arg Ala Ala Gly Gly Gly1 5 10 15Ala Ser Trp Glu Leu Cys Ala Gly Ala Leu Ser Ala Arg Leu Ala Glu 20 25 30Glu Gly Ser Gly Asp Ala Gly Gly Arg Arg Arg Pro Pro Val Asp Pro 35 40 45Arg Arg Leu Ala Arg Gln Leu Leu Leu Leu Leu Trp Leu Leu Glu Ala 50 55 60Pro Leu Leu Leu Gly Val Arg Ala Gln Ala Ala Gly Gln Gly Pro Gly65 70 75 80Gln Gly Pro Gly Pro Gly Gln Gln Pro Pro Pro Pro Pro Gln Gln Gln 85 90 95Gln Ser Gly Gln Gln Tyr Asn Gly Glu Arg Gly Ile Ser Val Pro Asp 100 105 110His Gly Tyr Cys Gln Pro Ile Ser Ile Pro Leu Cys Thr Asp Ile Ala 115 120 125Tyr Asn Gln Thr Ile Met Pro Asn Leu Leu Gly His Thr Asn Gln Glu 130 135 140Asp Ala Gly Leu Glu Val His Gln Phe Tyr Pro Leu Val Lys Val Gln145 150 155 160Cys Ser Ala Glu Leu Lys Phe Phe Leu Cys Ser Met Tyr Ala Pro Val 165 170 175Cys Thr Val Leu Glu Gln Ala Leu Pro Pro Cys Arg Ser Leu Cys Glu 180 185 190Arg Ala Arg Gln Gly Cys Glu Ala Leu Met Asn Lys Phe Gly Phe Gln 195 200 205Trp Pro Asp Thr Leu Lys Cys Glu Lys Phe Pro Val His Gly Ala Gly 210 215 220Glu Leu Cys Val Gly Gln Asn Thr Ser Asp Lys Gly Thr Pro Thr Pro225 230 235 240Ser Leu Leu Pro Glu Phe Trp Thr Ser Asn Pro Gln His Gly Gly Gly 245 250 255Gly His Arg Gly Gly Phe Pro Gly Gly Ala Gly Ala Ser Glu Arg Gly 260 265 270Lys Phe Ser Cys Pro Arg Ala Leu Lys Val Pro Ser Tyr Leu Asn Tyr 275 280 285His Phe Leu Gly Glu Lys Asp Cys Gly Ala Pro Cys Glu Pro Thr Lys 290 295 300Val Tyr Gly Leu Met Tyr Phe Gly Pro Glu Glu Leu Arg Phe Ser Arg305 310 315 320Thr Trp Ile Gly Ile Trp Ser Val Leu Cys Cys Ala Ser Thr Leu Phe 325 330 335Thr Val Leu Thr Tyr Leu Val Asp Met Arg Arg Phe Ser Tyr Pro Glu 340 345 350Arg Pro Ile Ile Phe Leu Ser Gly Cys Tyr Thr Ala Val Ala Val Ala 355 360 365Tyr Ile Ala Gly Phe Leu Leu Glu Asp Arg Val Val Cys Asn Asp Lys 370 375 380Phe Ala Glu Asp Gly Ala Arg Thr Val Ala Gln Gly Thr Lys Lys Glu385 390 395 400Gly Cys Thr Ile Leu Phe Met Met Leu Tyr Phe Phe Ser Met Ala Ser 405 410 415Ser Ile Trp Trp Val Ile Leu Ser Leu Thr Trp Phe Leu Ala Ala Gly 420 425 430Met Lys Trp Gly His Glu Ala Ile Glu Ala Asn Ser Gln Tyr Phe His 435 440 445Leu Ala Ala Trp Ala Val Pro Ala Ile Lys Thr Ile Thr Ile Leu Ala 450 455 460Leu Gly Gln Val Asp Gly Asp Val Leu Ser Gly Val Cys Phe Val Gly465 470 475 480Leu Asn Asn Val Asp Ala Leu Arg Gly Phe Val Leu Ala Pro Leu Phe 485 490 495Val Tyr Leu Phe Ile Gly Thr Ser Phe Leu Leu Ala Gly Phe Val Ser 500 505 510Leu Phe Arg Ile Arg Thr Ile Met Lys His Asp Gly Thr Lys Thr Glu 515 520 525Lys Leu Glu Lys Leu Met Val Arg Ile Gly Val Phe Ser Val Leu Tyr 530 535 540Thr Val Pro Ala Thr Ile Val Ile Ala Cys Tyr Phe Tyr Glu Gln Ala545 550 555 560Phe Arg Asp Gln Trp Glu Arg Ser Trp Val Ala Gln Ser Cys Lys Ser 565 570 575Tyr Ala Ile Pro Cys Pro His Leu Gln Ala Gly Gly Gly Ala Pro Pro 580 585 590His Pro Pro Met Ser Pro Asp Phe Thr Val Phe Met Ile Lys Tyr Leu 595 600 605Met Thr Leu Ile Val Gly Ile Thr Ser Gly Phe Trp Ile Trp Ser Gly 610 615 620Lys Thr Leu Asn Ser Trp Arg Lys Phe Tyr Thr Arg Leu Thr Asn Ser625 630 635 640Lys Gln Gly Glu Thr Thr Val 64563258PRTHomo sapiens 63Met Leu Val Leu Tyr Gly His Ser Thr Gln Asp Leu Pro Glu Thr Asn1 5 10 15Ala Arg Val Val Gly Gly Thr Glu Ala Gly Arg Asn Ser Trp Pro Ser 20 25 30Gln Ile Ser Leu Gln Tyr Arg Ser Gly Gly Ser Arg Tyr His Thr Cys 35 40 45Gly Gly Thr Leu Ile Arg Gln Asn Trp Val Met Thr Ala Ala His Cys 50 55 60Val Asp Tyr Gln Lys Thr Phe Arg Val Val Ala Gly Asp His Asn Leu65 70 75 80Ser Gln Asn Asp Gly Thr Glu Gln Tyr Val Ser Val Gln Lys Ile Val 85 90 95Val His Pro Tyr Trp Asn Ser Asp Asn Val Ala Ala Gly Tyr Asp Ile 100 105 110Ala Leu Leu Arg Leu Ala Gln Ser Val Thr Leu Asn Ser Tyr Val Gln 115 120 125Leu Gly Val Leu Pro Gln Glu Gly Ala Ile Leu Ala Asn Asn Ser Pro 130 135 140Cys Tyr Ile Thr Gly Trp Gly Lys Thr Lys Thr Asn Gly Gln Leu Ala145 150 155 160Gln Thr Leu Gln Gln Ala Tyr Leu Pro Ser Val Asp Tyr Ala Ile Cys 165 170 175Ser Ser Ser Ser Tyr Trp Gly Ser Thr Val Lys Asn Thr Met Val Cys 180 185 190Ala Gly Gly Asp Gly Val Arg Ser Gly Cys Gln Gly Asp Ser Gly Gly 195 200 205Pro Leu His Cys Leu Val Asn Gly Lys Tyr Ser Val His Gly Val Thr 210 215 220Ser Phe Val Ser Ser Arg Gly Cys Asn Val Ser Arg Lys Pro Thr Val225 230 235 240Phe Thr Gln Val Ser Ala Tyr Ile Ser Trp Ile Asn Asn Val Ile Ala 245 250 255Ser Asn642555PRTHomo sapiens 64Met Thr Ala Ile Thr His Gly Ser Pro Val Gly Gly Asn Asp Ser Gln1 5 10 15Gly Gln Val Leu Asp Gly Gln Ser Gln His Leu Phe Gln Gln Asn Gln 20 25 30Thr Ser Ser Pro Asp Ser Ser Asn Glu Asn Ser Val Ala Thr Pro Pro 35 40 45Pro Glu Glu Gln Gly Gln Gly Asp Ala Pro Pro Gln His Glu Asp Glu 50 55 60Glu Pro Ala Phe Pro His Thr Glu Leu Ala Asn Leu Asp Asp Met Ile65 70 75 80Asn Arg Pro Arg Trp Val Val Pro Val Leu Pro Lys Gly Glu Leu Glu 85 90 95Val Leu Leu Glu Ala Ala Ile Asp Leu Ser Val Lys Gly Leu Asp Val 100 105 110Lys Ser Glu Ala Cys Gln Arg Phe Phe Arg Asp Gly Leu Thr Ile Ser 115 120 125Phe Thr Lys Ile Leu Met Asp Glu Ala Val Ser Gly Trp Lys Phe Glu 130 135 140Ile His Arg Cys Ile Ile Asn Asn Thr His Arg Leu Val Glu Leu Cys145 150 155 160Val Ala Lys Leu Ser Gln Asp Trp Phe Pro Leu Leu Glu Leu Leu Ala 165 170 175Met Ala Leu Asn Pro His Cys Lys Phe His Ile Tyr Asn Gly Thr Arg 180 185 190Pro Cys Glu Leu Ile Ser Ser Asn Ala Gln Leu Pro Glu Glu Glu Leu 195 200 205Phe Ala Arg Ser Ser Asp Pro Arg Ser Pro Lys Gly Trp Leu Val Asp 210 215 220Leu Ile Asn Lys Phe Gly Thr Leu Asn Gly Phe Gln Ile Leu His Asp225 230 235 240Arg Phe Phe Asn Gly Ser Ala Leu Asn Ile Gln Ile Ile Ala Ala Leu 245 250 255Ile Lys Pro Phe Gly Gln Cys Tyr Glu Phe Leu Ser Gln His Thr Leu 260 265 270Lys Lys Tyr Phe Ile Pro Val Ile Glu Ile Val Pro His Leu Leu Glu 275 280 285Asn Leu Thr Asp Glu Glu Leu Lys Lys Glu Ala Lys Asn Glu Ala Lys 290 295 300Asn Asp Ala Leu Ser Met Ile Ile Lys Ser Leu Lys Asn Leu Ala Ser305 310 315 320Arg Ile Ser Gly Gln Asp Glu Thr Ile Lys Asn Leu Glu Ile Phe Arg 325 330 335Leu Lys Met Ile Leu Arg Leu Leu Gln Ile Ser Ser Phe Asn Gly Lys 340 345 350Met Asn Ala Leu Asn Glu Ile Asn Lys Val Ile Ser Ser Val Ser Tyr 355 360 365Tyr Thr His Arg His Ser Asn Pro Glu Glu Glu Glu Trp Leu Thr Ala 370 375 380Glu Arg Met Ala Glu Trp Ile Gln Gln Asn Asn Ile Leu Ser Ile Val385 390 395 400Leu Gln Asp Ser Leu His Gln Pro Gln Tyr Val Glu Lys Leu Glu Lys 405 410 415Ile Leu Arg Phe Val Ile Lys Glu Lys Ala Leu Thr Leu Gln Asp Leu 420 425 430Asp Asn Ile Trp Ala Ala Gln Ala Gly Lys His Glu Ala Ile Val Lys 435 440 445Asn Val His Asp Leu Leu Ala Lys Leu Ala Trp Asp Phe Ser Pro Gly 450 455 460Gln Leu Asp His Leu Phe Asp Cys Phe Lys Ala Ser Trp Thr Asn Ala465 470 475 480Ser Lys Lys Gln Arg Glu Lys Leu Leu Glu Leu Ile Arg Arg Leu Ala 485 490 495Glu Asp Asp Lys Asp Gly Val Met Ala His Lys Val Leu Asn Leu Leu 500 505 510Trp Asn Leu Ala Gln Ser Asp Asp Val Pro Val Asp Ile Met Asp Leu 515 520 525Ala Leu Ser Ala His Ile Lys Ile Leu Asp Tyr Ser Cys Ser Gln Asp 530 535 540Arg Asp Ala Gln Lys Ile Gln Trp Ile Asp His Phe Ile Glu Glu Leu545 550 555 560Arg Thr Asn Asp Lys Trp Val Ile Pro Ala Leu Lys Gln Ile Arg Glu 565 570 575Ile Cys Ser Leu Phe Gly Glu Ala Ser Gln Asn Leu Ser Gln Thr Gln 580 585 590Arg Ser Pro His Ile Phe Tyr Arg His Asp Leu Ile Asn Gln Leu Gln 595 600 605Gln Asn His Ala Leu Val Thr Leu Val Ala Glu Asn Leu Ala Thr Tyr 610 615 620Met Asn Ser Ile Arg Leu Tyr Ala Gly Asp His Glu Asp Tyr Asp Pro625 630 635 640Gln Thr Val Arg Leu Gly Ser Arg Tyr Ser His Val Gln Glu Val Gln 645 650 655Glu Arg Leu Asn Phe Leu Arg Phe Leu Leu Lys Asp Gly Gln Leu Trp 660 665 670Leu Cys Ala Pro Gln Ala Lys Gln Ile Trp Lys Cys Leu Ala Glu Asn 675 680 685Ala Val Tyr Leu Cys Asp Arg Glu Ala Cys Phe Lys Trp Tyr Ser Lys 690 695 700Leu Met Gly Asp Glu Pro Asp Leu Asp Pro Asp Ile Asn Lys Asp Phe705 710 715 720Phe Glu Ser Asn Val Leu Gln Leu Asp Pro Ser Leu Leu Thr Glu Asn 725 730 735Gly Met Lys Cys Phe Glu Arg Phe Phe Lys Ala Val Asn Cys Arg Glu 740 745 750Arg Lys Leu Ile Ala Lys Arg Arg Ser Tyr Met Met Asp Asp Leu Glu 755 760 765Leu Ile Gly Leu Asp Tyr Leu Trp Arg Val Val Ile Gln Ser Ser Asp 770 775 780Glu Ile Ala Asn Arg Ala Ile Asp Leu Leu Lys Glu Ile Tyr Thr Asn785 790 795 800Leu Gly Pro Arg Leu Lys Ala Asn Gln Val Val Ile His Glu Asp Phe 805 810 815Ile Gln Ser Cys Phe Asp Arg Leu Lys Ala Ser Tyr Asp Thr Leu Cys 820 825 830Val Phe Asp Gly Asp Lys Asn Ser Ile Asn Cys Ala Arg Gln Glu Ala 835 840 845Ile Arg Met Val Arg Val Leu Thr Val Ile Lys Glu Tyr Ile Asn Glu 850 855 860Cys Asp Ser Asp Tyr His Lys Glu Arg Met Ile Leu Pro Met Ser Arg865 870 875 880Ala Phe Cys Gly Lys His Leu Ser Leu Ile Val Arg Phe Pro Asn Gln 885 890 895Gly Arg Gln Val Asp Glu Leu Asp Ile Trp Phe His Thr Asn Asp Thr 900 905 910Ile Gly Ser Val Arg Arg Cys Ile Val Asn Arg Ile Lys Ala Asn Val 915 920 925Ala His Lys Lys Ile Glu Leu Phe Val Gly Gly Glu Leu Ile Asp Ser 930 935 940Glu Asn Asp Arg Lys Leu Ile Gly Gln Leu Asn Leu Lys Asp Lys Ser945 950 955 960Leu Ile Thr Ala Lys Leu Thr Gln Ile Asn Phe Asn Met Pro Ser Ser 965 970 975Pro Asp Ser Ser Ser Asp Ser Ser Thr Ala Ser Pro Gly Asn His Arg 980 985 990Asn His Tyr Asn Asp Gly Pro Asn Leu Lys Val Glu Ser Cys Leu Pro 995 1000 1005Gly Val Ile Met Ser Val His Pro Lys Tyr Ile Ser Phe Leu Trp 1010 1015 1020Gln Phe Ala Asn Leu Gly Ser Asn Leu Asn Met Pro Pro Leu Lys 1025 1030 1035Asn Gly Ala Arg Val Leu Met Lys Leu Met Pro Pro Asp Arg Thr 1040 1045 1050Ala Val Glu Lys Leu Arg Thr Val Cys Leu Asp His Ala Asn Leu 1055 1060 1065Gly Glu Gly Lys Leu Ser Pro Pro Leu Asp Ser Leu Phe Phe Gly 1070 1075 1080Pro Ser Ala Ser Gln Val Leu Tyr Leu Thr Glu Val Val Tyr Ala 1085 1090 1095Leu Leu Met Pro Ala Gly Val Pro Leu Thr Asp Gly Ser Ser Asp 1100 1105 1110Phe Gln Val His Phe Leu Lys Ser Gly Gly Leu Pro Leu Val Leu 1115 1120 1125Ser Met Leu Ile Arg Asn Asn Phe Leu Pro Asn Thr Asp Met Glu 1130 1135 1140Thr Arg Arg Gly Ala Tyr Leu Asn Ala Leu Lys Ile Ala Lys Leu 1145 1150 1155Leu Leu Thr Ala Ile Gly Tyr Gly His Val Arg Ala Val Ala Glu 1160 1165 1170Ala Cys Gln Pro Val Val Asp Gly Thr Asp Pro Ile Thr Gln Ile 1175 1180 1185Asn Gln Val Thr His Asp Gln Ala Val Val Leu Gln Ser Ala Leu 1190 1195 1200Gln Ser Ile Pro Asn Pro Ser Ser Glu Cys Val Leu Arg Asn Glu 1205 1210 1215Ser Ile Leu Leu Ala Gln Glu Ile Ser Asn Glu Ala Ser Arg Tyr 1220 1225 1230Met Pro Asp Ile Cys Val Ile Arg Ala Ile Gln Lys Ile Ile Trp 1235 1240 1245Ala Ser Ala Cys Gly Ala Leu Gly Leu Phe Phe Ser Pro Asn Glu 1250 1255 1260Glu Ile Thr Lys Ile Tyr Gln Met Thr Thr Asn Gly Ser Asn Lys 1265 1270 1275Leu Glu Val Glu Asp Glu Gln Val Cys Cys Glu Ala Leu Glu Val 1280 1285 1290Met Thr Leu Cys Phe Ala Leu Leu Pro Thr Ala Leu Asp Ala Leu 1295 1300 1305Ser Lys Glu Lys Ala Trp Gln Thr Phe Ile Ile Asp Leu Leu Leu 1310 1315 1320His Cys Pro Ser Lys Thr Val Arg Gln Leu Ala Gln Glu Gln Phe 1325 1330 1335Phe Leu Met Cys Thr Arg Cys Cys Met Gly His Arg Pro Leu Leu 1340 1345 1350Phe Phe Ile Thr Leu Leu Phe Thr Ile Leu Gly Ser Thr Ala Arg 1355 1360 1365Glu Lys Gly Lys Tyr Ser Gly Asp Tyr Phe Thr Leu Leu Arg His 1370 1375 1380Leu Leu Asn Tyr Ala Tyr Asn Gly Asn Ile Asn Ile Pro Asn Ala 1385 1390 1395Glu Val Leu Leu Val Ser Glu Ile Asp Trp Leu Lys Arg Ile Arg 1400 1405 1410Asp Asn Val Lys Asn Thr Gly Glu Thr Gly Val Glu Glu Pro Ile 1415

1420 1425Leu Glu Gly His Leu Gly Val Thr Lys Glu Leu Leu Ala Phe Gln 1430 1435 1440Thr Ser Glu Lys Lys Tyr His Phe Gly Cys Glu Lys Gly Gly Ala 1445 1450 1455Asn Leu Ile Lys Glu Leu Ile Asp Asp Phe Ile Phe Pro Ala Ser 1460 1465 1470Lys Val Tyr Leu Gln Tyr Leu Arg Ser Gly Glu Leu Pro Ala Glu 1475 1480 1485Gln Ala Ile Pro Val Cys Ser Ser Pro Val Thr Ile Asn Ala Gly 1490 1495 1500Phe Glu Leu Leu Val Ala Leu Ala Ile Gly Cys Val Arg Asn Leu 1505 1510 1515Lys Gln Ile Val Asp Cys Leu Thr Glu Met Tyr Tyr Met Gly Thr 1520 1525 1530Ala Ile Thr Thr Cys Glu Ala Leu Thr Glu Trp Glu Tyr Leu Pro 1535 1540 1545Pro Val Gly Pro Arg Pro Pro Lys Gly Phe Val Gly Leu Lys Asn 1550 1555 1560Ala Gly Ala Thr Cys Tyr Met Asn Ser Val Ile Gln Gln Leu Tyr 1565 1570 1575Met Ile Pro Ser Ile Arg Asn Ser Ile Leu Ala Ile Glu Gly Thr 1580 1585 1590Gly Ser Asp Leu His Asp Asp Met Phe Gly Asp Glu Lys Gln Asp 1595 1600 1605Ser Glu Ser Asn Val Asp Pro Arg Asp Asp Val Phe Gly Tyr Pro 1610 1615 1620His Gln Phe Glu Asp Lys Pro Ala Leu Ser Lys Thr Glu Asp Arg 1625 1630 1635Lys Glu Tyr Asn Ile Gly Val Leu Arg His Leu Gln Val Ile Phe 1640 1645 1650Gly His Leu Ala Ala Ser Gln Leu Gln Tyr Tyr Val Pro Arg Gly 1655 1660 1665Phe Trp Lys Gln Phe Arg Leu Trp Gly Glu Pro Val Asn Leu Arg 1670 1675 1680Glu Gln His Asp Ala Leu Glu Phe Phe Asn Ser Leu Val Asp Ser 1685 1690 1695Leu Asp Glu Ala Leu Lys Ala Leu Gly His Pro Ala Ile Leu Ser 1700 1705 1710Lys Val Leu Gly Gly Ser Phe Ala Asp Gln Lys Ile Cys Gln Gly 1715 1720 1725Cys Pro His Arg Phe Glu Cys Glu Glu Ser Phe Thr Thr Leu Asn 1730 1735 1740Val Asp Ile Arg Asn His Gln Asn Leu Leu Asp Ser Leu Glu Gln 1745 1750 1755Tyr Ile Lys Gly Asp Leu Leu Glu Gly Ala Asn Ala Tyr His Cys 1760 1765 1770Glu Lys Cys Asp Lys Lys Val Asp Thr Val Lys Arg Leu Leu Ile 1775 1780 1785Lys Lys Leu Pro Arg Val Leu Ala Ile Gln Leu Lys Arg Phe Asp 1790 1795 1800Tyr Asp Trp Glu Arg Glu Cys Ala Ile Lys Phe Asn Asp Tyr Phe 1805 1810 1815Glu Phe Pro Arg Glu Leu Asp Met Gly Pro Tyr Thr Val Ala Gly 1820 1825 1830Val Ala Asn Leu Glu Arg Asp Asn Val Asn Ser Glu Asn Glu Leu 1835 1840 1845Ile Glu Gln Lys Glu Gln Ser Asp Asn Glu Thr Ala Gly Gly Thr 1850 1855 1860Lys Tyr Arg Leu Val Gly Val Leu Val His Ser Gly Gln Ala Ser 1865 1870 1875Gly Gly His Tyr Tyr Ser Tyr Ile Ile Gln Arg Asn Gly Lys Asp 1880 1885 1890Asp Gln Thr Asp His Trp Tyr Lys Phe Asp Asp Gly Asp Val Thr 1895 1900 1905Glu Cys Lys Met Asp Asp Asp Glu Glu Met Lys Asn Gln Cys Phe 1910 1915 1920Gly Gly Glu Tyr Met Gly Glu Val Phe Asp His Met Met Lys Arg 1925 1930 1935Met Ser Tyr Arg Arg Gln Lys Arg Trp Trp Asn Ala Tyr Ile Pro 1940 1945 1950Phe Tyr Glu Gln Met Asp Met Ile Asp Glu Asp Asp Glu Met Ile 1955 1960 1965Arg Tyr Ile Ser Glu Leu Thr Ile Ala Arg Pro His Gln Ile Ile 1970 1975 1980Met Ser Pro Ala Ile Glu Arg Ser Val Arg Lys Gln Asn Val Lys 1985 1990 1995Phe Met His Asn Arg Leu Gln Tyr Ser Leu Glu Tyr Phe Gln Phe 2000 2005 2010Val Lys Lys Leu Leu Thr Cys Asn Gly Val Tyr Leu Asn Pro Ala 2015 2020 2025Pro Gly Gln Asp Tyr Leu Leu Pro Glu Ala Glu Glu Ile Thr Met 2030 2035 2040Ile Ser Ile Gln Leu Ala Ala Arg Phe Leu Phe Thr Thr Gly Phe 2045 2050 2055His Thr Lys Lys Ile Val Arg Gly Pro Ala Ser Asp Trp Tyr Asp 2060 2065 2070Ala Leu Cys Val Leu Leu Arg His Ser Lys Asn Val Arg Phe Trp 2075 2080 2085Phe Thr His Asn Val Leu Phe Asn Val Ser Asn Arg Phe Ser Glu 2090 2095 2100Tyr Leu Leu Glu Cys Pro Ser Ala Glu Val Arg Gly Ala Phe Ala 2105 2110 2115Lys Leu Ile Val Phe Ile Ala His Phe Ser Leu Gln Asp Gly Ser 2120 2125 2130Cys Pro Ser Pro Phe Ala Ser Pro Gly Pro Ser Ser Gln Ala Cys 2135 2140 2145Asp Asn Leu Ser Leu Ser Asp His Leu Leu Arg Ala Thr Leu Asn 2150 2155 2160Leu Leu Arg Arg Glu Val Ser Glu His Gly His His Leu Gln Gln 2165 2170 2175Tyr Phe Asn Leu Phe Val Met Tyr Ala Asn Leu Gly Val Ala Glu 2180 2185 2190Lys Thr Gln Leu Leu Lys Leu Asn Val Pro Ala Thr Phe Met Leu 2195 2200 2205Val Ser Leu Asp Glu Gly Pro Gly Pro Pro Ile Lys Tyr Gln Tyr 2210 2215 2220Ala Glu Leu Gly Lys Leu Tyr Ser Val Val Ser Gln Leu Ile Arg 2225 2230 2235Cys Cys Asn Val Ser Ser Thr Met Gln Ser Ser Ile Asn Gly Asn 2240 2245 2250Pro Pro Leu Pro Asn Pro Phe Gly Asp Leu Asn Leu Ser Gln Pro 2255 2260 2265Ile Met Pro Ile Gln Gln Asn Val Leu Asp Ile Leu Phe Val Arg 2270 2275 2280Thr Ser Tyr Val Lys Lys Ile Ile Glu Asp Cys Ser Asn Ser Glu 2285 2290 2295Asp Thr Ile Lys Leu Leu Arg Phe Cys Ser Trp Glu Asn Pro Gln 2300 2305 2310Phe Ser Ser Thr Val Leu Ser Glu Leu Leu Trp Gln Val Ala Tyr 2315 2320 2325Ser Tyr Thr Tyr Glu Leu Arg Pro Tyr Leu Asp Leu Leu Phe Gln 2330 2335 2340Ile Leu Leu Ile Glu Asp Ser Trp Gln Thr His Arg Ile His Asn 2345 2350 2355Ala Leu Lys Gly Ile Pro Asp Asp Arg Asp Gly Leu Phe Asp Thr 2360 2365 2370Ile Gln Arg Ser Lys Asn His Tyr Gln Lys Arg Ala Tyr Gln Cys 2375 2380 2385Ile Lys Cys Met Val Ala Leu Phe Ser Ser Cys Pro Val Ala Tyr 2390 2395 2400Gln Ile Leu Gln Gly Asn Gly Asp Leu Lys Arg Lys Trp Thr Trp 2405 2410 2415Ala Val Glu Trp Leu Gly Asp Glu Leu Glu Arg Arg Pro Tyr Thr 2420 2425 2430Gly Asn Pro Gln Tyr Ser Tyr Asn Asn Trp Ser Pro Pro Val Gln 2435 2440 2445Ser Asn Glu Thr Ala Asn Gly Tyr Phe Leu Glu Arg Ser His Ser 2450 2455 2460Ala Arg Met Thr Leu Ala Lys Ala Cys Glu Leu Cys Pro Glu Glu 2465 2470 2475Glu Pro Asp Asp Gln Asp Ala Pro Asp Glu His Glu Pro Ser Pro 2480 2485 2490Ser Glu Asp Ala Pro Leu Tyr Pro His Ser Pro Ala Ser Gln Tyr 2495 2500 2505Gln Gln Asn Asn His Val His Gly Gln Pro Tyr Thr Gly Pro Ala 2510 2515 2520Ala His His Leu Asn Asn Pro Gln Lys Thr Gly Gln Arg Thr Gln 2525 2530 2535Glu Asn Tyr Glu Gly Asn Glu Glu Val Ser Ser Pro Gln Met Lys 2540 2545 2550Asp Gln 255565330PRTHomo sapiens 65Met Ser Gln Trp His His Pro Arg Ser Gly Trp Gly Arg Arg Arg Asp1 5 10 15Phe Ser Gly Arg Ser Ser Ala Lys Lys Lys Gly Gly Asn His Ile Pro 20 25 30Glu Arg Trp Lys Asp Tyr Leu Pro Val Gly Gln Arg Met Pro Gly Thr 35 40 45Arg Phe Ile Ala Phe Lys Val Pro Leu Gln Lys Ser Phe Glu Lys Lys 50 55 60Leu Ala Pro Glu Glu Cys Phe Ser Pro Leu Asp Leu Phe Asn Lys Ile65 70 75 80Arg Glu Gln Asn Glu Glu Leu Gly Leu Ile Ile Asp Leu Thr Tyr Thr 85 90 95Gln Arg Tyr Tyr Lys Pro Glu Asp Leu Pro Glu Thr Val Pro Tyr Leu 100 105 110Lys Ile Phe Thr Val Gly His Gln Val Pro Asp Asp Glu Thr Ile Phe 115 120 125Lys Phe Lys His Ala Val Asn Gly Phe Leu Lys Glu Asn Lys Asp Asn 130 135 140Asp Lys Leu Ile Gly Val His Cys Thr His Gly Leu Asn Arg Thr Gly145 150 155 160Tyr Leu Ile Cys Arg Tyr Leu Ile Asp Val Glu Gly Val Arg Pro Asp 165 170 175Asp Ala Ile Glu Leu Phe Asn Arg Cys Arg Gly His Cys Leu Glu Arg 180 185 190Gln Asn Tyr Ile Glu Asp Leu Gln Asn Gly Pro Ile Arg Lys Asn Trp 195 200 205Asn Ser Ser Val Pro Arg Ser Ser Asp Phe Glu Asp Ser Ala His Leu 210 215 220Met Gln Pro Val His Asn Lys Pro Val Lys Gln Gly Pro Arg Tyr Asn225 230 235 240Leu His Gln Ile Gln Gly His Ser Ala Pro Arg His Phe His Thr Gln 245 250 255Thr Gln Ser Leu Gln Gln Ser Val Arg Lys Phe Ser Glu Asn Pro His 260 265 270Val Tyr Gln Arg His His Leu Pro Pro Pro Gly Pro Pro Gly Glu Asp 275 280 285Tyr Ser His Arg Arg Tyr Ser Trp Asn Val Lys Pro Asn Ala Ser Arg 290 295 300Ala Ala Gln Asp Arg Arg Arg Trp Tyr Pro Tyr Asn Tyr Ser Arg Leu305 310 315 320Ser Tyr Pro Ala Cys Trp Glu Trp Thr Gln 325 33066185PRTHomo sapiens 66Met Ser Gly Ser Phe Glu Leu Ser Val Gln Asp Leu Asn Asp Leu Leu1 5 10 15Ser Asp Gly Ser Gly Cys Tyr Ser Leu Pro Ser Gln Pro Cys Asn Glu 20 25 30Val Thr Pro Arg Ile Tyr Val Gly Asn Ala Ser Val Ala Gln Asp Ile 35 40 45Pro Lys Leu Gln Lys Leu Gly Ile Thr His Val Leu Asn Ala Ala Glu 50 55 60Gly Arg Ser Phe Met His Val Asn Thr Asn Ala Asn Phe Tyr Lys Asp65 70 75 80Ser Gly Ile Thr Tyr Leu Gly Ile Lys Ala Asn Asp Thr Gln Glu Phe 85 90 95Asn Leu Ser Ala Tyr Phe Glu Arg Ala Ala Asp Phe Ile Asp Gln Ala 100 105 110Leu Ala Gln Lys Asn Gly Arg Val Leu Val His Cys Arg Glu Gly Tyr 115 120 125Ser Arg Ser Pro Thr Leu Val Ile Ala Tyr Leu Met Met Arg Gln Lys 130 135 140Met Asp Val Lys Ser Ala Leu Ser Ile Val Arg Gln Asn Arg Glu Ile145 150 155 160Gly Pro Asn Asp Gly Phe Leu Ala Gln Leu Cys Gln Leu Asn Asp Arg 165 170 175Leu Ala Lys Glu Gly Lys Leu Lys Pro 180 185671154PRTHomo sapiens 67Met Gln Tyr Leu Asn Ile Lys Glu Asp Cys Asn Ala Met Ala Phe Cys1 5 10 15Ala Lys Met Arg Ser Ser Lys Lys Thr Glu Val Asn Leu Glu Ala Pro 20 25 30Glu Pro Gly Val Glu Val Ile Phe Tyr Leu Ser Asp Arg Glu Pro Leu 35 40 45Arg Leu Gly Ser Gly Glu Tyr Thr Ala Glu Glu Leu Cys Ile Arg Ala 50 55 60Ala Gln Ala Cys Arg Ile Ser Pro Leu Cys His Asn Leu Phe Ala Leu65 70 75 80Tyr Asp Glu Asn Thr Lys Leu Trp Tyr Ala Pro Asn Arg Thr Ile Thr 85 90 95Val Asp Asp Lys Met Ser Leu Arg Leu His Tyr Arg Met Arg Phe Tyr 100 105 110Phe Thr Asn Trp His Gly Thr Asn Asp Asn Glu Gln Ser Val Trp Arg 115 120 125His Ser Pro Lys Lys Gln Lys Asn Gly Tyr Glu Lys Lys Lys Ile Pro 130 135 140Asp Ala Thr Pro Leu Leu Asp Ala Ser Ser Leu Glu Tyr Leu Phe Ala145 150 155 160Gln Gly Gln Tyr Asp Leu Val Lys Cys Leu Ala Pro Ile Arg Asp Pro 165 170 175Lys Thr Glu Gln Asp Gly His Asp Ile Glu Asn Glu Cys Leu Gly Met 180 185 190Ala Val Leu Ala Ile Ser His Tyr Ala Met Met Lys Lys Met Gln Leu 195 200 205Pro Glu Leu Pro Lys Asp Ile Ser Tyr Lys Arg Tyr Ile Pro Glu Thr 210 215 220Leu Asn Lys Ser Ile Arg Gln Arg Asn Leu Leu Thr Arg Met Arg Ile225 230 235 240Asn Asn Val Phe Lys Asp Phe Leu Lys Glu Phe Asn Asn Lys Thr Ile 245 250 255Cys Asp Ser Ser Val Ser Thr His Asp Leu Lys Val Lys Tyr Leu Ala 260 265 270Thr Leu Glu Thr Leu Thr Lys His Tyr Gly Ala Glu Ile Phe Glu Thr 275 280 285Ser Met Leu Leu Ile Ser Ser Glu Asn Glu Met Asn Trp Phe His Ser 290 295 300Asn Asp Gly Gly Asn Val Leu Tyr Tyr Glu Val Met Val Thr Gly Asn305 310 315 320Leu Gly Ile Gln Trp Arg His Lys Pro Asn Val Val Ser Val Glu Lys 325 330 335Glu Lys Asn Lys Leu Lys Arg Lys Lys Leu Glu Asn Lys Asp Lys Lys 340 345 350Asp Glu Glu Lys Asn Lys Ile Arg Glu Glu Trp Asn Asn Phe Ser Phe 355 360 365Phe Pro Glu Ile Thr His Ile Val Ile Lys Glu Ser Val Val Ser Ile 370 375 380Asn Lys Gln Asp Asn Lys Lys Met Glu Leu Lys Leu Ser Ser His Glu385 390 395 400Glu Ala Leu Ser Phe Val Ser Leu Val Asp Gly Tyr Phe Arg Leu Thr 405 410 415Ala Asp Ala His His Tyr Leu Cys Thr Asp Val Ala Pro Pro Leu Ile 420 425 430Val His Asn Ile Gln Asn Gly Cys His Gly Pro Ile Cys Thr Glu Tyr 435 440 445Ala Ile Asn Lys Leu Arg Gln Glu Gly Ser Glu Glu Gly Met Tyr Val 450 455 460Leu Arg Trp Ser Cys Thr Asp Phe Asp Asn Ile Leu Met Thr Val Thr465 470 475 480Cys Phe Glu Lys Ser Glu Gln Val Gln Gly Ala Gln Lys Gln Phe Lys 485 490 495Asn Phe Gln Ile Glu Val Gln Lys Gly Arg Tyr Ser Leu His Gly Ser 500 505 510Asp Arg Ser Phe Pro Ser Leu Gly Asp Leu Met Ser His Leu Lys Lys 515 520 525Gln Ile Leu Arg Thr Asp Asn Ile Ser Phe Met Leu Lys Arg Cys Cys 530 535 540Gln Pro Lys Pro Arg Glu Ile Ser Asn Leu Leu Val Ala Thr Lys Lys545 550 555 560Ala Gln Glu Trp Gln Pro Val Tyr Pro Met Ser Gln Leu Ser Phe Asp 565 570 575Arg Ile Leu Lys Lys Asp Leu Val Gln Gly Glu His Leu Gly Arg Gly 580 585 590Thr Arg Thr His Ile Tyr Ser Gly Thr Leu Met Asp Tyr Lys Asp Asp 595 600 605Glu Gly Thr Ser Glu Glu Lys Lys Ile Lys Val Ile Leu Lys Val Leu 610 615 620Asp Pro Ser His Arg Asp Ile Ser Leu Ala Phe Phe Glu Ala Ala Ser625 630 635 640Met Met Arg Gln Val Ser His Lys His Ile Val Tyr Leu Tyr Gly Val 645 650 655Cys Val Arg Asp Val Glu Asn Ile Met Val Glu Glu Phe Val Glu Gly 660 665 670Gly Pro Leu Asp Leu Phe Met His Arg Lys Ser Asp Val Leu Thr Thr 675 680 685Pro Trp Lys Phe Lys Val Ala Lys Gln Leu Ala Ser Ala Leu Ser Tyr 690 695 700Leu Glu Asp Lys Asp Leu Val His Gly Asn Val Cys Thr Lys Asn Leu705 710 715 720Leu Leu Ala Arg Glu Gly Ile Asp Ser Glu Cys Gly Pro Phe Ile Lys 725 730 735Leu Ser Asp Pro Gly Ile Pro Ile Thr Val Leu Ser Arg Gln Glu Cys 740 745 750Ile Glu Arg Ile Pro Trp Ile Ala Pro Glu Cys Val Glu Asp Ser Lys 755 760 765Asn Leu Ser Val Ala Ala Asp Lys Trp Ser Phe Gly Thr Thr Leu Trp 770 775 780Glu Ile Cys Tyr Asn Gly Glu Ile Pro Leu Lys Asp Lys Thr Leu Ile785 790 795 800Glu Lys Glu Arg

Phe Tyr Glu Ser Arg Cys Arg Pro Val Thr Pro Ser 805 810 815Cys Lys Glu Leu Ala Asp Leu Met Thr Arg Cys Met Asn Tyr Asp Pro 820 825 830Asn Gln Arg Pro Phe Phe Arg Ala Ile Met Arg Asp Ile Asn Lys Leu 835 840 845Glu Glu Gln Asn Pro Asp Ile Val Ser Arg Lys Lys Asn Gln Pro Thr 850 855 860Glu Val Asp Pro Thr His Phe Glu Lys Arg Phe Leu Lys Arg Ile Arg865 870 875 880Asp Leu Gly Glu Gly His Phe Gly Lys Val Glu Leu Cys Arg Tyr Asp 885 890 895Pro Glu Asp Asn Thr Gly Glu Gln Val Ala Val Lys Ser Leu Lys Pro 900 905 910Glu Ser Gly Gly Asn His Ile Ala Asp Leu Lys Lys Glu Ile Glu Ile 915 920 925Leu Arg Asn Leu Tyr His Glu Asn Ile Val Lys Tyr Lys Gly Ile Cys 930 935 940Thr Glu Asp Gly Gly Asn Gly Ile Lys Leu Ile Met Glu Phe Leu Pro945 950 955 960Ser Gly Ser Leu Lys Glu Tyr Leu Pro Lys Asn Lys Asn Lys Ile Asn 965 970 975Leu Lys Gln Gln Leu Lys Tyr Ala Val Gln Ile Cys Lys Gly Met Asp 980 985 990Tyr Leu Gly Ser Arg Gln Tyr Val His Arg Asp Leu Ala Ala Arg Asn 995 1000 1005Val Leu Val Glu Ser Glu His Gln Val Lys Ile Gly Asp Phe Gly 1010 1015 1020Leu Thr Lys Ala Ile Glu Thr Asp Lys Glu Tyr Tyr Thr Val Lys 1025 1030 1035Asp Asp Arg Asp Ser Pro Val Phe Trp Tyr Ala Pro Glu Cys Leu 1040 1045 1050Met Gln Ser Lys Phe Tyr Ile Ala Ser Asp Val Trp Ser Phe Gly 1055 1060 1065Val Thr Leu His Glu Leu Leu Thr Tyr Cys Asp Ser Asp Ser Ser 1070 1075 1080Pro Met Ala Leu Phe Leu Lys Met Ile Gly Pro Thr His Gly Gln 1085 1090 1095Met Thr Val Thr Arg Leu Val Asn Thr Leu Lys Glu Gly Lys Arg 1100 1105 1110Leu Pro Cys Pro Pro Asn Cys Pro Asp Glu Val Tyr Gln Leu Met 1115 1120 1125Arg Lys Cys Trp Glu Phe Gln Pro Ser Asn Arg Thr Ser Phe Gln 1130 1135 1140Asn Leu Ile Glu Gly Phe Glu Ala Leu Leu Lys 1145 1150681142PRTHomo sapiens 68Met Ala Phe Cys Ala Lys Met Arg Ser Ser Lys Lys Thr Glu Val Asn1 5 10 15Leu Glu Ala Pro Glu Pro Gly Val Glu Val Ile Phe Tyr Leu Ser Asp 20 25 30Arg Glu Pro Leu Arg Leu Gly Ser Gly Glu Tyr Thr Ala Glu Glu Leu 35 40 45Cys Ile Arg Ala Ala Gln Ala Cys Arg Ile Ser Pro Leu Cys His Asn 50 55 60Leu Phe Ala Leu Tyr Asp Glu Asn Thr Lys Leu Trp Tyr Ala Pro Asn65 70 75 80Arg Thr Ile Thr Val Asp Asp Lys Met Ser Leu Arg Leu His Tyr Arg 85 90 95Met Arg Phe Tyr Phe Thr Asn Trp His Gly Thr Asn Asp Asn Glu Gln 100 105 110Ser Val Trp Arg His Ser Pro Lys Lys Gln Lys Asn Gly Tyr Glu Lys 115 120 125Lys Lys Ile Pro Asp Ala Thr Pro Leu Leu Asp Ala Ser Ser Leu Glu 130 135 140Tyr Leu Phe Ala Gln Gly Gln Tyr Asp Leu Val Lys Cys Leu Ala Pro145 150 155 160Ile Arg Asp Pro Lys Thr Glu Gln Asp Gly His Asp Ile Glu Asn Glu 165 170 175Cys Leu Gly Met Ala Val Leu Ala Ile Ser His Tyr Ala Met Met Lys 180 185 190Lys Met Gln Leu Pro Glu Leu Pro Lys Asp Ile Ser Tyr Lys Arg Tyr 195 200 205Ile Pro Glu Thr Leu Asn Lys Ser Ile Arg Gln Arg Asn Leu Leu Thr 210 215 220Arg Met Arg Ile Asn Asn Val Phe Lys Asp Phe Leu Lys Glu Phe Asn225 230 235 240Asn Lys Thr Ile Cys Asp Ser Ser Val Ser Thr His Asp Leu Lys Val 245 250 255Lys Tyr Leu Ala Thr Leu Glu Thr Leu Thr Lys His Tyr Gly Ala Glu 260 265 270Ile Phe Glu Thr Ser Met Leu Leu Ile Ser Ser Glu Asn Glu Met Asn 275 280 285Trp Phe His Ser Asn Asp Gly Gly Asn Val Leu Tyr Tyr Glu Val Met 290 295 300Val Thr Gly Asn Leu Gly Ile Gln Trp Arg His Lys Pro Asn Val Val305 310 315 320Ser Val Glu Lys Glu Lys Asn Lys Leu Lys Arg Lys Lys Leu Glu Asn 325 330 335Lys Asp Lys Lys Asp Glu Glu Lys Asn Lys Ile Arg Glu Glu Trp Asn 340 345 350Asn Phe Ser Phe Phe Pro Glu Ile Thr His Ile Val Ile Lys Glu Ser 355 360 365Val Val Ser Ile Asn Lys Gln Asp Asn Lys Lys Met Glu Leu Lys Leu 370 375 380Ser Ser His Glu Glu Ala Leu Ser Phe Val Ser Leu Val Asp Gly Tyr385 390 395 400Phe Arg Leu Thr Ala Asp Ala His His Tyr Leu Cys Thr Asp Val Ala 405 410 415Pro Pro Leu Ile Val His Asn Ile Gln Asn Gly Cys His Gly Pro Ile 420 425 430Cys Thr Glu Tyr Ala Ile Asn Lys Leu Arg Gln Glu Gly Ser Glu Glu 435 440 445Gly Met Tyr Val Leu Arg Trp Ser Cys Thr Asp Phe Asp Asn Ile Leu 450 455 460Met Thr Val Thr Cys Phe Glu Lys Ser Glu Gln Val Gln Gly Ala Gln465 470 475 480Lys Gln Phe Lys Asn Phe Gln Ile Glu Val Gln Lys Gly Arg Tyr Ser 485 490 495Leu His Gly Ser Asp Arg Ser Phe Pro Ser Leu Gly Asp Leu Met Ser 500 505 510His Leu Lys Lys Gln Ile Leu Arg Thr Asp Asn Ile Ser Phe Met Leu 515 520 525Lys Arg Cys Cys Gln Pro Lys Pro Arg Glu Ile Ser Asn Leu Leu Val 530 535 540Ala Thr Lys Lys Ala Gln Glu Trp Gln Pro Val Tyr Pro Met Ser Gln545 550 555 560Leu Ser Phe Asp Arg Ile Leu Lys Lys Asp Leu Val Gln Gly Glu His 565 570 575Leu Gly Arg Gly Thr Arg Thr His Ile Tyr Ser Gly Thr Leu Met Asp 580 585 590Tyr Lys Asp Asp Glu Gly Thr Ser Glu Glu Lys Lys Ile Lys Val Ile 595 600 605Leu Lys Val Leu Asp Pro Ser His Arg Asp Ile Ser Leu Ala Phe Phe 610 615 620Glu Ala Ala Ser Met Met Arg Gln Val Ser His Lys His Ile Val Tyr625 630 635 640Leu Tyr Gly Val Cys Val Arg Asp Val Glu Asn Ile Met Val Glu Glu 645 650 655Phe Val Glu Gly Gly Pro Leu Asp Leu Phe Met His Arg Lys Ser Asp 660 665 670Val Leu Thr Thr Pro Trp Lys Phe Lys Val Ala Lys Gln Leu Ala Ser 675 680 685Ala Leu Ser Tyr Leu Glu Asp Lys Asp Leu Val His Gly Asn Val Cys 690 695 700Thr Lys Asn Leu Leu Leu Ala Arg Glu Gly Ile Asp Ser Glu Cys Gly705 710 715 720Pro Phe Ile Lys Leu Ser Asp Pro Gly Ile Pro Ile Thr Val Leu Ser 725 730 735Arg Gln Glu Cys Ile Glu Arg Ile Pro Trp Ile Ala Pro Glu Cys Val 740 745 750Glu Asp Ser Lys Asn Leu Ser Val Ala Ala Asp Lys Trp Ser Phe Gly 755 760 765Thr Thr Leu Trp Glu Ile Cys Tyr Asn Gly Glu Ile Pro Leu Lys Asp 770 775 780Lys Thr Leu Ile Glu Lys Glu Arg Phe Tyr Glu Ser Arg Cys Arg Pro785 790 795 800Val Thr Pro Ser Cys Lys Glu Leu Ala Asp Leu Met Thr Arg Cys Met 805 810 815Asn Tyr Asp Pro Asn Gln Arg Pro Phe Phe Arg Ala Ile Met Arg Asp 820 825 830Ile Asn Lys Leu Glu Glu Gln Asn Pro Asp Ile Val Ser Arg Lys Lys 835 840 845Asn Gln Pro Thr Glu Val Asp Pro Thr His Phe Glu Lys Arg Phe Leu 850 855 860Lys Arg Ile Arg Asp Leu Gly Glu Gly His Phe Gly Lys Val Glu Leu865 870 875 880Cys Arg Tyr Asp Pro Glu Asp Asn Thr Gly Glu Gln Val Ala Val Lys 885 890 895Ser Leu Lys Pro Glu Ser Gly Gly Asn His Ile Ala Asp Leu Lys Lys 900 905 910Glu Ile Glu Ile Leu Arg Asn Leu Tyr His Glu Asn Ile Val Lys Tyr 915 920 925Lys Gly Ile Cys Thr Glu Asp Gly Gly Asn Gly Ile Lys Leu Ile Met 930 935 940Glu Phe Leu Pro Ser Gly Ser Leu Lys Glu Tyr Leu Pro Lys Asn Lys945 950 955 960Asn Lys Ile Asn Leu Lys Gln Gln Leu Lys Tyr Ala Val Gln Ile Cys 965 970 975Lys Gly Met Asp Tyr Leu Gly Ser Arg Gln Tyr Val His Arg Asp Leu 980 985 990Ala Ala Arg Asn Val Leu Val Glu Ser Glu His Gln Val Lys Ile Gly 995 1000 1005Asp Phe Gly Leu Thr Lys Ala Ile Glu Thr Asp Lys Glu Tyr Tyr 1010 1015 1020Thr Val Lys Asp Asp Arg Asp Ser Pro Val Phe Trp Tyr Ala Pro 1025 1030 1035Glu Cys Leu Met Gln Ser Lys Phe Tyr Ile Ala Ser Asp Val Trp 1040 1045 1050Ser Phe Gly Val Thr Leu His Glu Leu Leu Thr Tyr Cys Asp Ser 1055 1060 1065Asp Ser Ser Pro Met Ala Leu Phe Leu Lys Met Ile Gly Pro Thr 1070 1075 1080His Gly Gln Met Thr Val Thr Arg Leu Val Asn Thr Leu Lys Glu 1085 1090 1095Gly Lys Arg Leu Pro Cys Pro Pro Asn Cys Pro Asp Glu Val Tyr 1100 1105 1110Gln Leu Met Arg Lys Cys Trp Glu Phe Gln Pro Ser Asn Arg Thr 1115 1120 1125Ser Phe Gln Asn Leu Ile Glu Gly Phe Glu Ala Leu Leu Lys 1130 1135 114069666PRTHomo sapiens 69Met Ala Cys Leu Met Ala Ala Phe Ser Val Gly Thr Ala Met Asn Ala1 5 10 15Ser Ser Tyr Ser Ala Glu Met Thr Glu Pro Lys Ser Val Cys Val Ser 20 25 30Val Asp Glu Val Val Ser Ser Asn Met Glu Ala Thr Glu Thr Asp Leu 35 40 45Leu Asn Gly His Leu Lys Lys Val Asp Asn Asn Leu Thr Glu Ala Gln 50 55 60Arg Phe Ser Ser Leu Pro Arg Arg Ala Ala Val Asn Ile Glu Phe Arg65 70 75 80Asp Leu Ser Tyr Ser Val Pro Glu Gly Pro Trp Trp Arg Lys Lys Gly 85 90 95Tyr Lys Thr Leu Leu Lys Gly Ile Ser Gly Lys Phe Asn Ser Gly Glu 100 105 110Leu Val Ala Ile Met Gly Pro Ser Gly Ala Gly Lys Ser Thr Leu Met 115 120 125Asn Ile Leu Ala Gly Tyr Arg Glu Thr Gly Met Lys Gly Ala Val Leu 130 135 140Ile Asn Gly Leu Pro Arg Asp Leu Arg Cys Phe Arg Lys Val Ser Cys145 150 155 160Tyr Ile Met Gln Asp Asp Met Leu Leu Pro His Leu Thr Val Gln Glu 165 170 175Ala Met Met Val Ser Ala His Leu Lys Leu Gln Glu Lys Asp Glu Gly 180 185 190Arg Arg Glu Met Val Lys Glu Ile Leu Thr Ala Leu Gly Leu Leu Ser 195 200 205Cys Ala Asn Thr Arg Thr Gly Ser Leu Ser Gly Gly Gln Arg Lys Arg 210 215 220Leu Ala Ile Ala Leu Glu Leu Val Asn Asn Pro Pro Val Met Phe Phe225 230 235 240Asp Glu Pro Thr Ser Gly Leu Asp Ser Ala Ser Cys Phe Gln Val Val 245 250 255Ser Leu Met Lys Gly Leu Ala Gln Gly Gly Arg Ser Ile Ile Cys Thr 260 265 270Ile His Gln Pro Ser Ala Lys Leu Phe Glu Leu Phe Asp Gln Leu Tyr 275 280 285Val Leu Ser Gln Gly Gln Cys Val Tyr Arg Gly Lys Val Cys Asn Leu 290 295 300Val Pro Tyr Leu Arg Asp Leu Gly Leu Asn Cys Pro Thr Tyr His Asn305 310 315 320Pro Ala Asp Phe Val Met Glu Val Ala Ser Gly Glu Tyr Gly Asp Gln 325 330 335Asn Ser Arg Leu Val Arg Ala Val Arg Glu Gly Met Cys Asp Ser Asp 340 345 350His Lys Arg Asp Leu Gly Gly Asp Ala Glu Val Asn Pro Phe Leu Trp 355 360 365His Arg Pro Ser Glu Glu Asp Ser Ser Ser Met Glu Gly Cys His Ser 370 375 380Phe Ser Ala Ser Cys Leu Thr Gln Phe Cys Ile Leu Phe Lys Arg Thr385 390 395 400Phe Leu Ser Ile Met Arg Asp Ser Val Leu Thr His Leu Arg Ile Thr 405 410 415Ser His Ile Gly Ile Gly Leu Leu Ile Gly Leu Leu Tyr Leu Gly Ile 420 425 430Gly Asn Glu Ala Lys Lys Val Leu Ser Asn Ser Gly Phe Leu Phe Phe 435 440 445Ser Met Leu Phe Leu Met Phe Ala Ala Leu Met Pro Thr Val Leu Thr 450 455 460Phe Pro Leu Glu Met Gly Val Phe Leu Arg Glu His Leu Asn Tyr Trp465 470 475 480Tyr Ser Leu Lys Ala Tyr Tyr Leu Ala Lys Thr Met Ala Asp Val Pro 485 490 495Phe Gln Ile Met Phe Pro Val Ala Tyr Cys Ser Ile Val Tyr Trp Met 500 505 510Thr Ser Gln Pro Ser Asp Ala Val Arg Phe Val Leu Phe Ala Ala Leu 515 520 525Gly Thr Met Thr Ser Leu Val Ala Gln Ser Leu Gly Leu Leu Ile Gly 530 535 540Ala Ala Ser Thr Ser Leu Gln Val Ala Thr Phe Val Gly Pro Val Thr545 550 555 560Ala Ile Pro Val Leu Leu Phe Ser Gly Phe Phe Val Ser Phe Asp Thr 565 570 575Ile Pro Thr Tyr Leu Gln Trp Met Ser Tyr Ile Ser Tyr Val Arg Tyr 580 585 590Gly Phe Glu Gly Val Ile Leu Ser Ile Tyr Gly Leu Asp Arg Glu Asp 595 600 605Leu His Cys Asp Ile Asp Glu Thr Cys His Phe Gln Lys Ser Glu Ala 610 615 620Ile Leu Arg Glu Leu Asp Val Glu Asn Ala Lys Leu Tyr Leu Asp Phe625 630 635 640Ile Val Leu Gly Ile Phe Phe Ile Ser Leu Arg Leu Ile Ala Tyr Phe 645 650 655Val Leu Arg Tyr Lys Ile Arg Ala Glu Arg 660 66570678PRTHomo sapiens 70Met Ala Cys Leu Met Ala Ala Phe Ser Val Gly Thr Ala Met Asn Ala1 5 10 15Ser Ser Tyr Ser Ala Glu Met Thr Glu Pro Lys Ser Val Cys Val Ser 20 25 30Val Asp Glu Val Val Ser Ser Asn Met Glu Ala Thr Glu Thr Asp Leu 35 40 45Leu Asn Gly His Leu Lys Lys Val Asp Asn Asn Leu Thr Glu Ala Gln 50 55 60Arg Phe Ser Ser Leu Pro Arg Arg Ala Ala Val Asn Ile Glu Phe Arg65 70 75 80Asp Leu Ser Tyr Ser Val Pro Glu Gly Pro Trp Trp Arg Lys Lys Gly 85 90 95Tyr Lys Thr Leu Leu Lys Gly Ile Ser Gly Lys Phe Asn Ser Gly Glu 100 105 110Leu Val Ala Ile Met Gly Pro Ser Gly Ala Gly Lys Ser Thr Leu Met 115 120 125Asn Ile Leu Ala Gly Tyr Arg Glu Thr Gly Met Lys Gly Ala Val Leu 130 135 140Ile Asn Gly Leu Pro Arg Asp Leu Arg Cys Phe Arg Lys Val Ser Cys145 150 155 160Tyr Ile Met Gln Asp Asp Met Leu Leu Pro His Leu Thr Val Gln Glu 165 170 175Ala Met Met Val Ser Ala His Leu Lys Leu Gln Glu Lys Asp Glu Gly 180 185 190Arg Arg Glu Met Val Lys Glu Ile Leu Thr Ala Leu Gly Leu Leu Ser 195 200 205Cys Ala Asn Thr Arg Thr Gly Ser Leu Ser Gly Gly Gln Arg Lys Arg 210 215 220Leu Ala Ile Ala Leu Glu Leu Val Asn Asn Pro Pro Val Met Phe Phe225 230 235 240Asp Glu Pro Thr Ser Gly Leu Asp Ser Ala Ser Cys Phe Gln Val Val 245 250 255Ser Leu Met Lys Gly Leu Ala Gln Gly Gly Arg Ser Ile Ile Cys Thr 260 265 270Ile His Gln Pro Ser Ala Lys Leu Phe Glu Leu Phe Asp Gln Leu Tyr 275 280 285Val Leu Ser Gln Gly Gln Cys Val Tyr Arg Gly Lys Val Cys Asn Leu 290

295 300Val Pro Tyr Leu Arg Asp Leu Gly Leu Asn Cys Pro Thr Tyr His Asn305 310 315 320Pro Ala Asp Phe Val Met Glu Val Ala Ser Gly Glu Tyr Gly Asp Gln 325 330 335Asn Ser Arg Leu Val Arg Ala Val Arg Glu Gly Met Cys Asp Ser Asp 340 345 350His Lys Arg Asp Leu Gly Gly Asp Ala Glu Val Asn Pro Phe Leu Trp 355 360 365His Arg Pro Ser Glu Glu Val Lys Gln Thr Lys Arg Leu Lys Gly Leu 370 375 380Arg Lys Asp Ser Ser Ser Met Glu Gly Cys His Ser Phe Ser Ala Ser385 390 395 400Cys Leu Thr Gln Phe Cys Ile Leu Phe Lys Arg Thr Phe Leu Ser Ile 405 410 415Met Arg Asp Ser Val Leu Thr His Leu Arg Ile Thr Ser His Ile Gly 420 425 430Ile Gly Leu Leu Ile Gly Leu Leu Tyr Leu Gly Ile Gly Asn Glu Ala 435 440 445Lys Lys Val Leu Ser Asn Ser Gly Phe Leu Phe Phe Ser Met Leu Phe 450 455 460Leu Met Phe Ala Ala Leu Met Pro Thr Val Leu Thr Phe Pro Leu Glu465 470 475 480Met Gly Val Phe Leu Arg Glu His Leu Asn Tyr Trp Tyr Ser Leu Lys 485 490 495Ala Tyr Tyr Leu Ala Lys Thr Met Ala Asp Val Pro Phe Gln Ile Met 500 505 510Phe Pro Val Ala Tyr Cys Ser Ile Val Tyr Trp Met Thr Ser Gln Pro 515 520 525Ser Asp Ala Val Arg Phe Val Leu Phe Ala Ala Leu Gly Thr Met Thr 530 535 540Ser Leu Val Ala Gln Ser Leu Gly Leu Leu Ile Gly Ala Ala Ser Thr545 550 555 560Ser Leu Gln Val Ala Thr Phe Val Gly Pro Val Thr Ala Ile Pro Val 565 570 575Leu Leu Phe Ser Gly Phe Phe Val Ser Phe Asp Thr Ile Pro Thr Tyr 580 585 590Leu Gln Trp Met Ser Tyr Ile Ser Tyr Val Arg Tyr Gly Phe Glu Gly 595 600 605Val Ile Leu Ser Ile Tyr Gly Leu Asp Arg Glu Asp Leu His Cys Asp 610 615 620Ile Asp Glu Thr Cys His Phe Gln Lys Ser Glu Ala Ile Leu Arg Glu625 630 635 640Leu Asp Val Glu Asn Ala Lys Leu Tyr Leu Asp Phe Ile Val Leu Gly 645 650 655Ile Phe Phe Ile Ser Leu Arg Leu Ile Ala Tyr Phe Val Leu Arg Tyr 660 665 670Lys Ile Arg Ala Glu Arg 67571677PRTHomo sapiens 71Met Arg Ile Ser Leu Pro Arg Ala Pro Glu Arg Asp Gly Gly Val Ser1 5 10 15Ala Ser Ser Leu Leu Asp Thr Val Thr Asn Ala Ser Ser Tyr Ser Ala 20 25 30Glu Met Thr Glu Pro Lys Ser Val Cys Val Ser Val Asp Glu Val Val 35 40 45Ser Ser Asn Met Glu Ala Thr Glu Thr Asp Leu Leu Asn Gly His Leu 50 55 60Lys Lys Val Asp Asn Asn Leu Thr Glu Ala Gln Arg Phe Ser Ser Leu65 70 75 80Pro Arg Arg Ala Ala Val Asn Ile Glu Phe Arg Asp Leu Ser Tyr Ser 85 90 95Val Pro Glu Gly Pro Trp Trp Arg Lys Lys Gly Tyr Lys Thr Leu Leu 100 105 110Lys Gly Ile Ser Gly Lys Phe Asn Ser Gly Glu Leu Val Ala Ile Met 115 120 125Gly Pro Ser Gly Ala Gly Lys Ser Thr Leu Met Asn Ile Leu Ala Gly 130 135 140Tyr Arg Glu Thr Gly Met Lys Gly Ala Val Leu Ile Asn Gly Leu Pro145 150 155 160Arg Asp Leu Arg Cys Phe Arg Lys Val Ser Cys Tyr Ile Met Gln Asp 165 170 175Asp Met Leu Leu Pro His Leu Thr Val Gln Glu Ala Met Met Val Ser 180 185 190Ala His Leu Lys Leu Gln Glu Lys Asp Glu Gly Arg Arg Glu Met Val 195 200 205Lys Glu Ile Leu Thr Ala Leu Gly Leu Leu Ser Cys Ala Asn Thr Arg 210 215 220Thr Gly Ser Leu Ser Gly Gly Gln Arg Lys Arg Leu Ala Ile Ala Leu225 230 235 240Glu Leu Val Asn Asn Pro Pro Val Met Phe Phe Asp Glu Pro Thr Ser 245 250 255Gly Leu Asp Ser Ala Ser Cys Phe Gln Val Val Ser Leu Met Lys Gly 260 265 270Leu Ala Gln Gly Gly Arg Ser Ile Ile Cys Thr Ile His Gln Pro Ser 275 280 285Ala Lys Leu Phe Glu Leu Phe Asp Gln Leu Tyr Val Leu Ser Gln Gly 290 295 300Gln Cys Val Tyr Arg Gly Lys Val Cys Asn Leu Val Pro Tyr Leu Arg305 310 315 320Asp Leu Gly Leu Asn Cys Pro Thr Tyr His Asn Pro Ala Asp Phe Val 325 330 335Met Glu Val Ala Ser Gly Glu Tyr Gly Asp Gln Asn Ser Arg Leu Val 340 345 350Arg Ala Val Arg Glu Gly Met Cys Asp Ser Asp His Lys Arg Asp Leu 355 360 365Gly Gly Asp Ala Glu Val Asn Pro Phe Leu Trp His Arg Pro Ser Glu 370 375 380Glu Asp Ser Ser Ser Met Glu Gly Cys His Ser Phe Ser Ala Ser Cys385 390 395 400Leu Thr Gln Phe Cys Ile Leu Phe Lys Arg Thr Phe Leu Ser Ile Met 405 410 415Arg Asp Ser Val Leu Thr His Leu Arg Ile Thr Ser His Ile Gly Ile 420 425 430Gly Leu Leu Ile Gly Leu Leu Tyr Leu Gly Ile Gly Asn Glu Ala Lys 435 440 445Lys Val Leu Ser Asn Ser Gly Phe Leu Phe Phe Ser Met Leu Phe Leu 450 455 460Met Phe Ala Ala Leu Met Pro Thr Val Leu Thr Phe Pro Leu Glu Met465 470 475 480Gly Val Phe Leu Arg Glu His Leu Asn Tyr Trp Tyr Ser Leu Lys Ala 485 490 495Tyr Tyr Leu Ala Lys Thr Met Ala Asp Val Pro Phe Gln Ile Met Phe 500 505 510Pro Val Ala Tyr Cys Ser Ile Val Tyr Trp Met Thr Ser Gln Pro Ser 515 520 525Asp Ala Val Arg Phe Val Leu Phe Ala Ala Leu Gly Thr Met Thr Ser 530 535 540Leu Val Ala Gln Ser Leu Gly Leu Leu Ile Gly Ala Ala Ser Thr Ser545 550 555 560Leu Gln Val Ala Thr Phe Val Gly Pro Val Thr Ala Ile Pro Val Leu 565 570 575Leu Phe Ser Gly Phe Phe Val Ser Phe Asp Thr Ile Pro Thr Tyr Leu 580 585 590Gln Trp Met Ser Tyr Ile Ser Tyr Val Arg Tyr Gly Phe Glu Gly Val 595 600 605Ile Leu Ser Ile Tyr Gly Leu Asp Arg Glu Asp Leu His Cys Asp Ile 610 615 620Asp Glu Thr Cys His Phe Gln Lys Ser Glu Ala Ile Leu Arg Glu Leu625 630 635 640Asp Val Glu Asn Ala Lys Leu Tyr Leu Asp Phe Ile Val Leu Gly Ile 645 650 655Phe Phe Ile Ser Leu Arg Leu Ile Ala Tyr Phe Val Leu Arg Tyr Lys 660 665 670Ile Arg Ala Glu Arg 67572668PRTHomo sapiens 72Met Leu Gly Thr Gln Gly Trp Thr Lys Gln Arg Lys Pro Cys Pro Gln1 5 10 15Asn Ala Ser Ser Tyr Ser Ala Glu Met Thr Glu Pro Lys Ser Val Cys 20 25 30Val Ser Val Asp Glu Val Val Ser Ser Asn Met Glu Ala Thr Glu Thr 35 40 45Asp Leu Leu Asn Gly His Leu Lys Lys Val Asp Asn Asn Leu Thr Glu 50 55 60Ala Gln Arg Phe Ser Ser Leu Pro Arg Arg Ala Ala Val Asn Ile Glu65 70 75 80Phe Arg Asp Leu Ser Tyr Ser Val Pro Glu Gly Pro Trp Trp Arg Lys 85 90 95Lys Gly Tyr Lys Thr Leu Leu Lys Gly Ile Ser Gly Lys Phe Asn Ser 100 105 110Gly Glu Leu Val Ala Ile Met Gly Pro Ser Gly Ala Gly Lys Ser Thr 115 120 125Leu Met Asn Ile Leu Ala Gly Tyr Arg Glu Thr Gly Met Lys Gly Ala 130 135 140Val Leu Ile Asn Gly Leu Pro Arg Asp Leu Arg Cys Phe Arg Lys Val145 150 155 160Ser Cys Tyr Ile Met Gln Asp Asp Met Leu Leu Pro His Leu Thr Val 165 170 175Gln Glu Ala Met Met Val Ser Ala His Leu Lys Leu Gln Glu Lys Asp 180 185 190Glu Gly Arg Arg Glu Met Val Lys Glu Ile Leu Thr Ala Leu Gly Leu 195 200 205Leu Ser Cys Ala Asn Thr Arg Thr Gly Ser Leu Ser Gly Gly Gln Arg 210 215 220Lys Arg Leu Ala Ile Ala Leu Glu Leu Val Asn Asn Pro Pro Val Met225 230 235 240Phe Phe Asp Glu Pro Thr Ser Gly Leu Asp Ser Ala Ser Cys Phe Gln 245 250 255Val Val Ser Leu Met Lys Gly Leu Ala Gln Gly Gly Arg Ser Ile Ile 260 265 270Cys Thr Ile His Gln Pro Ser Ala Lys Leu Phe Glu Leu Phe Asp Gln 275 280 285Leu Tyr Val Leu Ser Gln Gly Gln Cys Val Tyr Arg Gly Lys Val Cys 290 295 300Asn Leu Val Pro Tyr Leu Arg Asp Leu Gly Leu Asn Cys Pro Thr Tyr305 310 315 320His Asn Pro Ala Asp Phe Val Met Glu Val Ala Ser Gly Glu Tyr Gly 325 330 335Asp Gln Asn Ser Arg Leu Val Arg Ala Val Arg Glu Gly Met Cys Asp 340 345 350Ser Asp His Lys Arg Asp Leu Gly Gly Asp Ala Glu Val Asn Pro Phe 355 360 365Leu Trp His Arg Pro Ser Glu Glu Asp Ser Ser Ser Met Glu Gly Cys 370 375 380His Ser Phe Ser Ala Ser Cys Leu Thr Gln Phe Cys Ile Leu Phe Lys385 390 395 400Arg Thr Phe Leu Ser Ile Met Arg Asp Ser Val Leu Thr His Leu Arg 405 410 415Ile Thr Ser His Ile Gly Ile Gly Leu Leu Ile Gly Leu Leu Tyr Leu 420 425 430Gly Ile Gly Asn Glu Ala Lys Lys Val Leu Ser Asn Ser Gly Phe Leu 435 440 445Phe Phe Ser Met Leu Phe Leu Met Phe Ala Ala Leu Met Pro Thr Val 450 455 460Leu Thr Phe Pro Leu Glu Met Gly Val Phe Leu Arg Glu His Leu Asn465 470 475 480Tyr Trp Tyr Ser Leu Lys Ala Tyr Tyr Leu Ala Lys Thr Met Ala Asp 485 490 495Val Pro Phe Gln Ile Met Phe Pro Val Ala Tyr Cys Ser Ile Val Tyr 500 505 510Trp Met Thr Ser Gln Pro Ser Asp Ala Val Arg Phe Val Leu Phe Ala 515 520 525Ala Leu Gly Thr Met Thr Ser Leu Val Ala Gln Ser Leu Gly Leu Leu 530 535 540Ile Gly Ala Ala Ser Thr Ser Leu Gln Val Ala Thr Phe Val Gly Pro545 550 555 560Val Thr Ala Ile Pro Val Leu Leu Phe Ser Gly Phe Phe Val Ser Phe 565 570 575Asp Thr Ile Pro Thr Tyr Leu Gln Trp Met Ser Tyr Ile Ser Tyr Val 580 585 590Arg Tyr Gly Phe Glu Gly Val Ile Leu Ser Ile Tyr Gly Leu Asp Arg 595 600 605Glu Asp Leu His Cys Asp Ile Asp Glu Thr Cys His Phe Gln Lys Ser 610 615 620Glu Ala Ile Leu Arg Glu Leu Asp Val Glu Asn Ala Lys Leu Tyr Leu625 630 635 640Asp Phe Ile Val Leu Gly Ile Phe Phe Ile Ser Leu Arg Leu Ile Ala 645 650 655Tyr Phe Val Leu Arg Tyr Lys Ile Arg Ala Glu Arg 660 66573644PRTHomo sapiens 73Met Thr Glu Pro Lys Ser Val Cys Val Ser Val Asp Glu Val Val Ser1 5 10 15Ser Asn Met Glu Ala Thr Glu Thr Asp Leu Leu Asn Gly His Leu Lys 20 25 30Lys Val Asp Asn Asn Leu Thr Glu Ala Gln Arg Phe Ser Ser Leu Pro 35 40 45Arg Arg Ala Ala Val Asn Ile Glu Phe Arg Asp Leu Ser Tyr Ser Val 50 55 60Pro Glu Gly Pro Trp Trp Arg Lys Lys Gly Tyr Lys Thr Leu Leu Lys65 70 75 80Gly Ile Ser Gly Lys Phe Asn Ser Gly Glu Leu Val Ala Ile Met Gly 85 90 95Pro Ser Gly Ala Gly Lys Ser Thr Leu Met Asn Ile Leu Ala Gly Tyr 100 105 110Arg Glu Thr Gly Met Lys Gly Ala Val Leu Ile Asn Gly Leu Pro Arg 115 120 125Asp Leu Arg Cys Phe Arg Lys Val Ser Cys Tyr Ile Met Gln Asp Asp 130 135 140Met Leu Leu Pro His Leu Thr Val Gln Glu Ala Met Met Val Ser Ala145 150 155 160His Leu Lys Leu Gln Glu Lys Asp Glu Gly Arg Arg Glu Met Val Lys 165 170 175Glu Ile Leu Thr Ala Leu Gly Leu Leu Ser Cys Ala Asn Thr Arg Thr 180 185 190Gly Ser Leu Ser Gly Gly Gln Arg Lys Arg Leu Ala Ile Ala Leu Glu 195 200 205Leu Val Asn Asn Pro Pro Val Met Phe Phe Asp Glu Pro Thr Ser Gly 210 215 220Leu Asp Ser Ala Ser Cys Phe Gln Val Val Ser Leu Met Lys Gly Leu225 230 235 240Ala Gln Gly Gly Arg Ser Ile Ile Cys Thr Ile His Gln Pro Ser Ala 245 250 255Lys Leu Phe Glu Leu Phe Asp Gln Leu Tyr Val Leu Ser Gln Gly Gln 260 265 270Cys Val Tyr Arg Gly Lys Val Cys Asn Leu Val Pro Tyr Leu Arg Asp 275 280 285Leu Gly Leu Asn Cys Pro Thr Tyr His Asn Pro Ala Asp Phe Val Met 290 295 300Glu Val Ala Ser Gly Glu Tyr Gly Asp Gln Asn Ser Arg Leu Val Arg305 310 315 320Ala Val Arg Glu Gly Met Cys Asp Ser Asp His Lys Arg Asp Leu Gly 325 330 335Gly Asp Ala Glu Val Asn Pro Phe Leu Trp His Arg Pro Ser Glu Glu 340 345 350Asp Ser Ser Ser Met Glu Gly Cys His Ser Phe Ser Ala Ser Cys Leu 355 360 365Thr Gln Phe Cys Ile Leu Phe Lys Arg Thr Phe Leu Ser Ile Met Arg 370 375 380Asp Ser Val Leu Thr His Leu Arg Ile Thr Ser His Ile Gly Ile Gly385 390 395 400Leu Leu Ile Gly Leu Leu Tyr Leu Gly Ile Gly Asn Glu Ala Lys Lys 405 410 415Val Leu Ser Asn Ser Gly Phe Leu Phe Phe Ser Met Leu Phe Leu Met 420 425 430Phe Ala Ala Leu Met Pro Thr Val Leu Thr Phe Pro Leu Glu Met Gly 435 440 445Val Phe Leu Arg Glu His Leu Asn Tyr Trp Tyr Ser Leu Lys Ala Tyr 450 455 460Tyr Leu Ala Lys Thr Met Ala Asp Val Pro Phe Gln Ile Met Phe Pro465 470 475 480Val Ala Tyr Cys Ser Ile Val Tyr Trp Met Thr Ser Gln Pro Ser Asp 485 490 495Ala Val Arg Phe Val Leu Phe Ala Ala Leu Gly Thr Met Thr Ser Leu 500 505 510Val Ala Gln Ser Leu Gly Leu Leu Ile Gly Ala Ala Ser Thr Ser Leu 515 520 525Gln Val Ala Thr Phe Val Gly Pro Val Thr Ala Ile Pro Val Leu Leu 530 535 540Phe Ser Gly Phe Phe Val Ser Phe Asp Thr Ile Pro Thr Tyr Leu Gln545 550 555 560Trp Met Ser Tyr Ile Ser Tyr Val Arg Tyr Gly Phe Glu Gly Val Ile 565 570 575Leu Ser Ile Tyr Gly Leu Asp Arg Glu Asp Leu His Cys Asp Ile Asp 580 585 590Glu Thr Cys His Phe Gln Lys Ser Glu Ala Ile Leu Arg Glu Leu Asp 595 600 605Val Glu Asn Ala Lys Leu Tyr Leu Asp Phe Ile Val Leu Gly Ile Phe 610 615 620Phe Ile Ser Leu Arg Leu Ile Ala Tyr Phe Val Leu Arg Tyr Lys Ile625 630 635 640Arg Ala Glu Arg74663PRTHomo sapiens 74Met Ile Met Arg Leu Pro Gln Pro His Gly Thr Asn Ala Ser Ser Tyr1 5 10 15Ser Ala Glu Met Thr Glu Pro Lys Ser Val Cys Val Ser Val Asp Glu 20 25 30Val Val Ser Ser Asn Met Glu Ala Thr Glu Thr Asp Leu Leu Asn Gly 35 40 45His Leu Lys Lys Val Asp Asn Asn Leu Thr Glu Ala Gln Arg Phe Ser 50 55 60Ser Leu Pro Arg Arg Ala Ala Val Asn Ile Glu Phe Arg Asp Leu Ser65 70 75 80Tyr Ser Val Pro Glu Gly Pro Trp Trp Arg Lys Lys Gly Tyr Lys Thr 85 90 95Leu Leu Lys Gly Ile Ser Gly Lys Phe Asn Ser

Gly Glu Leu Val Ala 100 105 110Ile Met Gly Pro Ser Gly Ala Gly Lys Ser Thr Leu Met Asn Ile Leu 115 120 125Ala Gly Tyr Arg Glu Thr Gly Met Lys Gly Ala Val Leu Ile Asn Gly 130 135 140Leu Pro Arg Asp Leu Arg Cys Phe Arg Lys Val Ser Cys Tyr Ile Met145 150 155 160Gln Asp Asp Met Leu Leu Pro His Leu Thr Val Gln Glu Ala Met Met 165 170 175Val Ser Ala His Leu Lys Leu Gln Glu Lys Asp Glu Gly Arg Arg Glu 180 185 190Met Val Lys Glu Ile Leu Thr Ala Leu Gly Leu Leu Ser Cys Ala Asn 195 200 205Thr Arg Thr Gly Ser Leu Ser Gly Gly Gln Arg Lys Arg Leu Ala Ile 210 215 220Ala Leu Glu Leu Val Asn Asn Pro Pro Val Met Phe Phe Asp Glu Pro225 230 235 240Thr Ser Gly Leu Asp Ser Ala Ser Cys Phe Gln Val Val Ser Leu Met 245 250 255Lys Gly Leu Ala Gln Gly Gly Arg Ser Ile Ile Cys Thr Ile His Gln 260 265 270Pro Ser Ala Lys Leu Phe Glu Leu Phe Asp Gln Leu Tyr Val Leu Ser 275 280 285Gln Gly Gln Cys Val Tyr Arg Gly Lys Val Cys Asn Leu Val Pro Tyr 290 295 300Leu Arg Asp Leu Gly Leu Asn Cys Pro Thr Tyr His Asn Pro Ala Asp305 310 315 320Phe Val Met Glu Val Ala Ser Gly Glu Tyr Gly Asp Gln Asn Ser Arg 325 330 335Leu Val Arg Ala Val Arg Glu Gly Met Cys Asp Ser Asp His Lys Arg 340 345 350Asp Leu Gly Gly Asp Ala Glu Val Asn Pro Phe Leu Trp His Arg Pro 355 360 365Ser Glu Glu Asp Ser Ser Ser Met Glu Gly Cys His Ser Phe Ser Ala 370 375 380Ser Cys Leu Thr Gln Phe Cys Ile Leu Phe Lys Arg Thr Phe Leu Ser385 390 395 400Ile Met Arg Asp Ser Val Leu Thr His Leu Arg Ile Thr Ser His Ile 405 410 415Gly Ile Gly Leu Leu Ile Gly Leu Leu Tyr Leu Gly Ile Gly Asn Glu 420 425 430Ala Lys Lys Val Leu Ser Asn Ser Gly Phe Leu Phe Phe Ser Met Leu 435 440 445Phe Leu Met Phe Ala Ala Leu Met Pro Thr Val Leu Thr Phe Pro Leu 450 455 460Glu Met Gly Val Phe Leu Arg Glu His Leu Asn Tyr Trp Tyr Ser Leu465 470 475 480Lys Ala Tyr Tyr Leu Ala Lys Thr Met Ala Asp Val Pro Phe Gln Ile 485 490 495Met Phe Pro Val Ala Tyr Cys Ser Ile Val Tyr Trp Met Thr Ser Gln 500 505 510Pro Ser Asp Ala Val Arg Phe Val Leu Phe Ala Ala Leu Gly Thr Met 515 520 525Thr Ser Leu Val Ala Gln Ser Leu Gly Leu Leu Ile Gly Ala Ala Ser 530 535 540Thr Ser Leu Gln Val Ala Thr Phe Val Gly Pro Val Thr Ala Ile Pro545 550 555 560Val Leu Leu Phe Ser Gly Phe Phe Val Ser Phe Asp Thr Ile Pro Thr 565 570 575Tyr Leu Gln Trp Met Ser Tyr Ile Ser Tyr Val Arg Tyr Gly Phe Glu 580 585 590Gly Val Ile Leu Ser Ile Tyr Gly Leu Asp Arg Glu Asp Leu His Cys 595 600 605Asp Ile Asp Glu Thr Cys His Phe Gln Lys Ser Glu Ala Ile Leu Arg 610 615 620Glu Leu Asp Val Glu Asn Ala Lys Leu Tyr Leu Asp Phe Ile Val Leu625 630 635 640Gly Ile Phe Phe Ile Ser Leu Arg Leu Ile Ala Tyr Phe Val Leu Arg 645 650 655Tyr Lys Ile Arg Ala Glu Arg 66075824PRTHomo sapiens 75Met Leu Ala Val Gln Gln Thr Glu His Leu Pro Ala Cys Pro Pro Ala1 5 10 15Arg Arg Trp Ser Ser Asn Phe Cys Pro Glu Ser Thr Glu Gly Gly Pro 20 25 30Ser Leu Leu Gly Leu Arg Asp Met Val Arg Arg Gly Trp Ser Val Cys 35 40 45Thr Ala Ile Leu Leu Ala Arg Leu Trp Cys Leu Val Pro Thr His Thr 50 55 60Phe Leu Ser Glu Tyr Pro Glu Ala Ala Glu Tyr Pro His Pro Gly Trp65 70 75 80Val Tyr Trp Leu Gln Met Ala Val Ala Pro Gly His Leu Arg Ala Trp 85 90 95Val Met Arg Asn Asn Val Thr Thr Asn Ile Pro Ser Ala Phe Ser Gly 100 105 110Thr Leu Thr His Glu Glu Lys Ala Val Leu Thr Val Phe Thr Gly Thr 115 120 125Ala Thr Ala Val His Val Gln Val Ala Ala Leu Ala Ser Ala Lys Leu 130 135 140Glu Ser Ser Val Phe Val Thr Asp Cys Val Ser Cys Lys Ile Glu Asn145 150 155 160Val Cys Asp Ser Ala Leu Gln Gly Lys Arg Val Pro Met Ser Gly Leu 165 170 175Gln Gly Ser Ser Ile Val Ile Met Pro Pro Ser Asn Arg Pro Leu Ala 180 185 190Ser Ala Ala Ser Cys Thr Trp Ser Val Gln Val Gln Gly Gly Pro His 195 200 205His Leu Gly Val Val Ala Ile Ser Gly Lys Val Leu Ser Ala Ala His 210 215 220Gly Ala Gly Arg Ala Tyr Gly Trp Gly Phe Pro Gly Asp Pro Met Glu225 230 235 240Glu Gly Tyr Lys Thr Leu Leu Lys Gly Ile Ser Gly Lys Phe Asn Ser 245 250 255Gly Glu Leu Val Ala Ile Met Gly Pro Ser Gly Ala Gly Lys Ser Thr 260 265 270Leu Met Asn Ile Leu Ala Gly Tyr Arg Glu Thr Gly Met Lys Gly Ala 275 280 285Val Leu Ile Asn Gly Leu Pro Arg Asp Leu Arg Cys Phe Arg Lys Val 290 295 300Ser Cys Tyr Ile Met Gln Asp Asp Met Leu Leu Pro His Leu Thr Val305 310 315 320Gln Glu Ala Met Met Val Ser Ala His Leu Lys Leu Gln Glu Lys Asp 325 330 335Glu Gly Arg Arg Glu Met Val Lys Glu Ile Leu Thr Ala Leu Gly Leu 340 345 350Leu Ser Cys Ala Asn Thr Arg Thr Gly Ser Leu Ser Gly Gly Gln Arg 355 360 365Lys Arg Leu Ala Ile Ala Leu Glu Leu Val Asn Asn Pro Pro Val Met 370 375 380Phe Phe Asp Glu Pro Thr Ser Gly Leu Asp Ser Ala Ser Cys Phe Gln385 390 395 400Val Val Ser Leu Met Lys Gly Leu Ala Gln Gly Gly Arg Ser Ile Ile 405 410 415Cys Thr Ile His Gln Pro Ser Ala Lys Leu Phe Glu Leu Phe Asp Gln 420 425 430Leu Tyr Val Leu Ser Gln Gly Gln Cys Val Tyr Arg Gly Lys Val Cys 435 440 445Asn Leu Val Pro Tyr Leu Arg Asp Leu Gly Leu Asn Cys Pro Thr Tyr 450 455 460His Asn Pro Ala Asp Phe Val Met Glu Val Ala Ser Gly Glu Tyr Gly465 470 475 480Asp Gln Asn Ser Arg Leu Val Arg Ala Val Arg Glu Gly Met Cys Asp 485 490 495Ser Asp His Lys Arg Asp Leu Gly Gly Asp Ala Glu Val Asn Pro Phe 500 505 510Leu Trp His Arg Pro Ser Glu Glu Val Lys Gln Thr Lys Arg Leu Lys 515 520 525Gly Leu Arg Lys Asp Ser Ser Ser Met Glu Gly Cys His Ser Phe Ser 530 535 540Ala Ser Cys Leu Thr Gln Phe Cys Ile Leu Phe Lys Arg Thr Phe Leu545 550 555 560Ser Ile Met Arg Asp Ser Val Leu Thr His Leu Arg Ile Thr Ser His 565 570 575Ile Gly Ile Gly Leu Leu Ile Gly Leu Leu Tyr Leu Gly Ile Gly Asn 580 585 590Glu Ala Lys Lys Val Leu Ser Asn Ser Gly Phe Leu Phe Phe Ser Met 595 600 605Leu Phe Leu Met Phe Ala Ala Leu Met Pro Thr Val Leu Thr Phe Pro 610 615 620Leu Glu Met Gly Val Phe Leu Arg Glu His Leu Asn Tyr Trp Tyr Ser625 630 635 640Leu Lys Ala Tyr Tyr Leu Ala Lys Thr Met Ala Asp Val Pro Phe Gln 645 650 655Ile Met Phe Pro Val Ala Tyr Cys Ser Ile Val Tyr Trp Met Thr Ser 660 665 670Gln Pro Ser Asp Ala Val Arg Phe Val Leu Phe Ala Ala Leu Gly Thr 675 680 685Met Thr Ser Leu Val Ala Gln Ser Leu Gly Leu Leu Ile Gly Ala Ala 690 695 700Ser Thr Ser Leu Gln Val Ala Thr Phe Val Gly Pro Val Thr Ala Ile705 710 715 720Pro Val Leu Leu Phe Ser Gly Phe Phe Val Ser Phe Asp Thr Ile Pro 725 730 735Thr Tyr Leu Gln Trp Met Ser Tyr Ile Ser Tyr Val Arg Tyr Gly Phe 740 745 750Glu Gly Val Ile Leu Ser Ile Tyr Gly Leu Asp Arg Glu Asp Leu His 755 760 765Cys Asp Ile Asp Glu Thr Cys His Phe Gln Lys Ser Glu Ala Ile Leu 770 775 780Arg Glu Leu Asp Val Glu Asn Ala Lys Leu Tyr Leu Asp Phe Ile Val785 790 795 800Leu Gly Ile Phe Phe Ile Ser Leu Arg Leu Ile Ala Tyr Phe Val Leu 805 810 815Arg Tyr Lys Ile Arg Ala Glu Arg 82076970PRTHomo sapiens 76Met Ala Gln Leu Glu Arg Ser Ala Ile Ser Gly Phe Ser Ser Lys Ser1 5 10 15Arg Arg Asn Ser Phe Ala Tyr Asp Val Lys Arg Glu Val Tyr Asn Glu 20 25 30Glu Thr Phe Gln Gln Glu His Lys Arg Lys Ala Ser Ser Ser Gly Asn 35 40 45Met Asn Ile Asn Ile Thr Thr Phe Arg His His Val Gln Cys Arg Cys 50 55 60Ser Trp His Arg Phe Leu Arg Cys Val Leu Thr Ile Phe Pro Phe Leu65 70 75 80Glu Trp Met Cys Met Tyr Arg Leu Lys Asp Trp Leu Leu Gly Asp Leu 85 90 95Leu Ala Gly Ile Ser Val Gly Leu Val Gln Val Pro Gln Gly Leu Thr 100 105 110Leu Ser Leu Leu Ala Arg Gln Leu Ile Pro Pro Leu Asn Ile Ala Tyr 115 120 125Ala Ala Phe Cys Ser Ser Val Ile Tyr Val Ile Phe Gly Ser Cys His 130 135 140Gln Met Ser Ile Gly Ser Phe Phe Leu Val Ser Ala Leu Leu Ile Asn145 150 155 160Val Leu Lys Val Ser Pro Phe Asn Asn Gly Gln Leu Val Met Gly Ser 165 170 175Phe Val Lys Asn Glu Phe Ser Ala Pro Ser Tyr Leu Met Gly Tyr Asn 180 185 190Lys Ser Leu Ser Val Val Ala Thr Thr Thr Phe Leu Thr Gly Ile Ile 195 200 205Gln Leu Ile Met Gly Val Leu Gly Leu Gly Phe Ile Ala Thr Tyr Leu 210 215 220Pro Glu Ser Ala Met Ser Ala Tyr Leu Ala Ala Val Ala Leu His Ile225 230 235 240Met Leu Ser Gln Leu Thr Phe Ile Phe Gly Ile Met Ile Ser Phe His 245 250 255Ala Gly Pro Ile Ser Phe Phe Tyr Asp Ile Ile Asn Tyr Cys Val Ala 260 265 270Leu Pro Lys Ala Asn Ser Thr Ser Ile Leu Val Phe Leu Thr Val Val 275 280 285Val Ala Leu Arg Ile Asn Lys Cys Ile Arg Ile Ser Phe Asn Gln Tyr 290 295 300Pro Ile Glu Phe Pro Met Glu Leu Phe Leu Ile Ile Gly Phe Thr Val305 310 315 320Ile Ala Asn Lys Ile Ser Met Ala Thr Glu Thr Ser Gln Thr Leu Ile 325 330 335Asp Met Ile Pro Tyr Ser Phe Leu Leu Pro Val Thr Pro Asp Phe Ser 340 345 350Leu Leu Pro Lys Ile Ile Leu Gln Ala Phe Ser Leu Ser Leu Val Ser 355 360 365Ser Phe Leu Leu Ile Phe Leu Gly Lys Lys Ile Ala Ser Leu His Asn 370 375 380Tyr Ser Val Asn Ser Asn Gln Asp Leu Ile Ala Ile Gly Leu Cys Asn385 390 395 400Val Val Ser Ser Phe Phe Arg Ser Cys Val Phe Thr Gly Ala Ile Ala 405 410 415Arg Thr Ile Ile Gln Asp Lys Ser Gly Gly Arg Gln Gln Phe Ala Ser 420 425 430Leu Val Gly Ala Gly Val Met Leu Leu Leu Met Val Lys Met Gly His 435 440 445Phe Phe Tyr Thr Leu Pro Asn Ala Val Leu Ala Gly Ile Ile Leu Ser 450 455 460Asn Val Ile Pro Tyr Leu Glu Thr Ile Ser Asn Leu Pro Ser Leu Trp465 470 475 480Arg Gln Asp Gln Tyr Asp Cys Ala Leu Trp Met Met Thr Phe Ser Ser 485 490 495Ser Ile Phe Leu Gly Leu Asp Ile Gly Leu Ile Ile Ser Val Val Ser 500 505 510Ala Phe Phe Ile Thr Thr Val Arg Ser His Arg Ala Lys Ile Leu Leu 515 520 525Leu Gly Gln Ile Pro Asn Thr Asn Ile Tyr Arg Ser Ile Asn Asp Tyr 530 535 540Arg Glu Ile Ile Thr Ile Pro Gly Val Lys Ile Phe Gln Cys Cys Ser545 550 555 560Ser Ile Thr Phe Val Asn Val Tyr Tyr Leu Lys His Lys Leu Leu Lys 565 570 575Glu Val Asp Met Val Lys Val Pro Leu Lys Glu Glu Glu Ile Phe Ser 580 585 590Leu Phe Asn Ser Ser Asp Thr Asn Leu Gln Gly Gly Lys Ile Cys Arg 595 600 605Cys Phe Cys Asn Cys Asp Asp Leu Glu Pro Leu Pro Arg Ile Leu Tyr 610 615 620Thr Glu Arg Phe Glu Asn Lys Leu Asp Pro Glu Ala Ser Ser Ile Asn625 630 635 640Leu Ile His Cys Ser His Phe Glu Ser Met Asn Thr Ser Gln Thr Ala 645 650 655Ser Glu Asp Gln Val Pro Tyr Thr Val Ser Ser Val Ser Gln Lys Asn 660 665 670Gln Gly Gln Gln Tyr Glu Glu Val Glu Glu Val Trp Leu Pro Asn Asn 675 680 685Ser Ser Arg Asn Ser Ser Pro Gly Leu Pro Asp Val Ala Glu Ser Gln 690 695 700Gly Arg Arg Ser Leu Ile Pro Tyr Ser Asp Ala Ser Leu Leu Pro Ser705 710 715 720Val His Thr Ile Ile Leu Asp Phe Ser Met Val His Tyr Val Asp Ser 725 730 735Arg Gly Leu Val Val Leu Arg Gln Ile Cys Asn Ala Phe Gln Asn Ala 740 745 750Asn Ile Leu Ile Leu Ile Ala Gly Cys His Ser Ser Ile Val Arg Ala 755 760 765Phe Glu Arg Asn Asp Phe Phe Asp Ala Gly Ile Thr Lys Thr Gln Leu 770 775 780Phe Leu Ser Val His Asp Ala Val Leu Phe Ala Leu Ser Arg Lys Val785 790 795 800Ile Gly Ser Ser Glu Leu Ser Ile Asp Glu Ser Glu Thr Val Ile Arg 805 810 815Glu Thr Tyr Ser Glu Thr Asp Lys Asn Asp Asn Ser Arg Tyr Lys Met 820 825 830Ser Ser Ser Phe Leu Gly Ser Gln Lys Asn Val Ser Pro Gly Phe Ile 835 840 845Lys Ile Gln Gln Pro Val Glu Glu Glu Ser Glu Leu Asp Leu Glu Leu 850 855 860Glu Ser Glu Gln Glu Ala Gly Leu Gly Leu Asp Leu Asp Leu Asp Arg865 870 875 880Glu Leu Glu Pro Glu Met Glu Pro Lys Ala Glu Thr Glu Thr Lys Thr 885 890 895Gln Thr Glu Met Glu Pro Gln Pro Glu Thr Glu Pro Glu Met Glu Pro 900 905 910Asn Pro Lys Ser Arg Pro Arg Ala His Thr Phe Pro Gln Gln Arg Tyr 915 920 925Trp Pro Met Tyr His Pro Ser Met Ala Ser Thr Gln Ser Gln Thr Gln 930 935 940Thr Arg Thr Trp Ser Val Glu Arg Arg Arg His Pro Met Asp Ser Tyr945 950 955 960Ser Pro Glu Gly Asn Ser Asn Glu Asp Val 965 97077225PRTHomo sapiens 77Met Thr Ser Glu Phe Phe Ser Ala Gln Leu Arg Ala Gln Ile Ser Asp1 5 10 15Asp Thr Thr His Pro Ile Ser Tyr Tyr Lys Pro Glu Phe Tyr Met Pro 20 25 30Asp Asp Gly Gly Thr Ala His Leu Ser Val Val Ala Glu Asp Gly Ser 35 40 45Ala Val Ser Ala Thr Ser Thr Ile Asn Leu Tyr Phe Gly Ser Lys Val 50 55 60Arg Ser Pro Val Ser Gly Ile Leu Leu Asn Asn Glu Met Asp Asp Phe65 70 75 80Ser Ser Thr Ser Ile Thr Asn Glu Phe Gly Val Pro Pro Ser Pro Ala 85 90 95Asn Phe Ile Gln Pro Gly Lys Gln Pro Leu Ser Ser Met Cys Pro Thr 100

105 110Ile Met Val Gly Gln Asp Gly Gln Val Arg Met Val Val Gly Ala Ala 115 120 125Gly Gly Thr Gln Ile Thr Met Ala Thr Ala Leu Ala Ile Ile Tyr Asn 130 135 140Leu Trp Phe Gly Tyr Asp Val Lys Trp Ala Val Glu Glu Pro Arg Leu145 150 155 160His Asn Gln Leu Leu Pro Asn Val Thr Thr Val Glu Arg Asn Ile Asp 165 170 175Gln Glu Val Thr Ala Ala Leu Glu Thr Arg His His His Thr Gln Ile 180 185 190Thr Ser Thr Phe Ile Ala Val Val Gln Ala Ile Val Arg Met Ala Gly 195 200 205Gly Trp Ala Ala Ala Ser Asp Ser Arg Lys Gly Gly Glu Pro Ala Gly 210 215 220Tyr22578225PRTHomo sapiens 78Met Thr Ser Glu Phe Phe Ser Ala Gln Leu Arg Ala Gln Ile Ser Asp1 5 10 15Asp Thr Thr His Pro Ile Ser Tyr Tyr Lys Pro Glu Phe Tyr Met Pro 20 25 30Asp Asp Gly Gly Thr Ala His Leu Ser Val Val Ala Glu Asp Gly Ser 35 40 45Ala Val Ser Ala Thr Ser Thr Ile Asn Leu Tyr Phe Gly Ser Lys Val 50 55 60Arg Ser Pro Val Ser Gly Ile Leu Leu Asn Asn Glu Met Asp Asp Phe65 70 75 80Ser Ser Thr Ser Ile Thr Asn Glu Phe Gly Val Pro Pro Ser Pro Ala 85 90 95Asn Phe Ile Gln Pro Gly Lys Gln Pro Leu Ser Ser Met Cys Pro Thr 100 105 110Ile Met Val Gly Gln Asp Gly Gln Val Arg Met Val Val Gly Ala Ala 115 120 125Gly Gly Thr Gln Ile Thr Met Ala Thr Ala Leu Ala Ile Ile Tyr Asn 130 135 140Leu Trp Phe Gly Tyr Asp Val Lys Trp Ala Val Glu Glu Pro Arg Leu145 150 155 160His Asn Gln Leu Leu Pro Asn Val Thr Thr Val Glu Arg Asn Ile Asp 165 170 175Gln Glu Val Thr Ala Ala Leu Glu Thr Arg His His His Thr Gln Ile 180 185 190Thr Ser Thr Phe Ile Ala Val Val Gln Ala Ile Val Arg Met Ala Gly 195 200 205Gly Trp Ala Ala Ala Ser Asp Ser Arg Lys Gly Gly Glu Pro Ala Gly 210 215 220Tyr22579225PRTHomo sapiens 79Met Thr Ser Glu Phe Phe Ser Ala Gln Leu Arg Ala Gln Ile Ser Asp1 5 10 15Asp Thr Thr His Pro Ile Ser Tyr Tyr Lys Pro Glu Phe Tyr Met Pro 20 25 30Asp Asp Gly Gly Thr Ala His Leu Ser Val Val Ala Glu Asp Gly Ser 35 40 45Ala Val Ser Ala Thr Ser Thr Ile Asn Leu Tyr Phe Gly Ser Lys Val 50 55 60Arg Ser Pro Val Ser Gly Ile Leu Leu Asn Asn Glu Met Asp Asp Phe65 70 75 80Ser Ser Thr Ser Ile Thr Asn Glu Phe Gly Val Pro Pro Ser Pro Ala 85 90 95Asn Phe Ile Gln Pro Gly Lys Gln Pro Leu Ser Ser Met Cys Pro Thr 100 105 110Ile Met Val Gly Gln Asp Gly Gln Val Arg Met Val Val Gly Ala Ala 115 120 125Gly Gly Thr Gln Ile Thr Met Ala Thr Ala Leu Ala Ile Ile Tyr Asn 130 135 140Leu Trp Phe Gly Tyr Asp Val Lys Trp Ala Val Glu Glu Pro Arg Leu145 150 155 160His Asn Gln Leu Leu Pro Asn Val Thr Thr Val Glu Arg Asn Ile Asp 165 170 175Gln Glu Val Thr Ala Ala Leu Glu Thr Arg His His His Thr Gln Ile 180 185 190Thr Ser Thr Phe Ile Ala Val Val Gln Ala Ile Val Arg Met Ala Gly 195 200 205Gly Trp Ala Ala Ala Ser Asp Ser Arg Lys Gly Gly Glu Pro Ala Gly 210 215 220Tyr22580545PRTHomo sapiens 80Met Gly Ser Ser Ala Thr Glu Ile Glu Glu Leu Glu Asn Thr Thr Phe1 5 10 15Lys Tyr Leu Thr Gly Glu Gln Thr Glu Lys Met Trp Gln Arg Leu Lys 20 25 30Gly Ile Leu Arg Cys Leu Val Lys Gln Leu Glu Arg Gly Asp Val Asn 35 40 45Val Val Asp Leu Lys Lys Asn Ile Glu Tyr Ala Ala Ser Val Leu Glu 50 55 60Ala Val Tyr Ile Asp Glu Thr Arg Arg Leu Leu Asp Thr Glu Asp Glu65 70 75 80Leu Ser Asp Ile Gln Thr Asp Ser Val Pro Ser Glu Val Arg Asp Trp 85 90 95Leu Ala Ser Thr Phe Thr Arg Lys Met Gly Met Thr Lys Lys Lys Pro 100 105 110Glu Glu Lys Pro Lys Phe Arg Ser Ile Val His Ala Val Gln Ala Gly 115 120 125Ile Phe Val Glu Arg Met Tyr Arg Lys Thr Tyr His Met Val Gly Leu 130 135 140Ala Tyr Pro Ala Ala Val Ile Val Thr Leu Lys Asp Val Asp Lys Trp145 150 155 160Ser Phe Asp Val Phe Ala Leu Asn Glu Ala Ser Gly Glu His Ser Leu 165 170 175Lys Phe Met Ile Tyr Glu Leu Phe Thr Arg Tyr Asp Leu Ile Asn Arg 180 185 190Phe Lys Ile Pro Val Ser Cys Leu Ile Thr Phe Ala Glu Ala Leu Glu 195 200 205Val Gly Tyr Ser Lys Tyr Lys Asn Pro Tyr His Asn Leu Ile His Ala 210 215 220Ala Asp Val Thr Gln Thr Val His Tyr Ile Met Leu His Thr Gly Ile225 230 235 240Met His Trp Leu Thr Glu Leu Glu Ile Leu Ala Met Val Phe Ala Ala 245 250 255Ala Ile His Asp Tyr Glu His Thr Gly Thr Thr Asn Asn Phe His Ile 260 265 270Gln Thr Arg Ser Asp Val Ala Ile Leu Tyr Asn Asp Arg Ser Val Leu 275 280 285Glu Asn His His Val Ser Ala Ala Tyr Arg Leu Met Gln Glu Glu Glu 290 295 300Met Asn Ile Leu Ile Asn Leu Ser Lys Asp Asp Trp Arg Asp Leu Arg305 310 315 320Asn Leu Val Ile Glu Met Val Leu Ser Thr Asp Met Ser Gly His Phe 325 330 335Gln Gln Ile Lys Asn Ile Arg Asn Ser Leu Gln Gln Pro Glu Gly Ile 340 345 350Asp Arg Ala Lys Thr Met Ser Leu Ile Leu His Ala Ala Asp Ile Ser 355 360 365His Pro Ala Lys Ser Trp Lys Leu His Tyr Arg Trp Thr Met Ala Leu 370 375 380Met Glu Glu Phe Phe Leu Gln Gly Asp Lys Glu Ala Glu Leu Gly Leu385 390 395 400Pro Phe Ser Pro Leu Cys Asp Arg Lys Ser Thr Met Val Ala Gln Ser 405 410 415Gln Ile Gly Phe Ile Asp Phe Ile Val Glu Pro Thr Phe Ser Leu Leu 420 425 430Thr Asp Ser Thr Glu Lys Ile Val Ile Pro Leu Ile Glu Glu Ala Ser 435 440 445Lys Ala Glu Thr Ser Ser Tyr Val Ala Ser Ser Ser Thr Thr Ile Val 450 455 460Gly Leu His Ile Ala Asp Ala Leu Arg Arg Ser Asn Thr Lys Gly Ser465 470 475 480Met Ser Asp Gly Ser Tyr Ser Pro Asp Tyr Ser Leu Ala Ala Val Asp 485 490 495Leu Lys Ser Phe Lys Asn Asn Leu Val Asp Ile Ile Gln Gln Asn Lys 500 505 510Glu Arg Trp Lys Glu Leu Ala Ala Gln Gly Glu Ser Asp Leu His Lys 515 520 525Asn Ser Glu Asp Leu Val Asn Ala Glu Glu Lys His Asp Glu Thr His 530 535 540Ser54581535PRTHomo sapiens 81Met Gly Ser Ser Ala Thr Glu Ile Glu Glu Leu Glu Asn Thr Thr Phe1 5 10 15Lys Tyr Leu Thr Gly Glu Gln Thr Glu Lys Met Trp Gln Arg Leu Lys 20 25 30Gly Ile Leu Arg Cys Leu Val Lys Gln Leu Glu Arg Gly Asp Val Asn 35 40 45Val Val Asp Leu Lys Lys Asn Ile Glu Tyr Ala Ala Ser Val Leu Glu 50 55 60Ala Val Tyr Ile Asp Glu Thr Arg Arg Leu Leu Asp Thr Glu Asp Glu65 70 75 80Leu Ser Asp Ile Gln Thr Asp Ser Val Pro Ser Glu Val Arg Asp Trp 85 90 95Leu Ala Ser Thr Phe Thr Arg Lys Met Gly Met Thr Lys Lys Lys Pro 100 105 110Glu Glu Lys Pro Lys Phe Arg Ser Ile Val His Ala Val Gln Ala Gly 115 120 125Ile Phe Val Glu Arg Met Tyr Arg Lys Thr Tyr His Met Val Gly Leu 130 135 140Ala Tyr Pro Ala Ala Val Ile Val Thr Leu Lys Asp Val Asp Lys Trp145 150 155 160Ser Phe Asp Val Phe Ala Leu Asn Glu Ala Ser Gly Glu His Ser Leu 165 170 175Lys Phe Met Ile Tyr Glu Leu Phe Thr Arg Tyr Asp Leu Ile Asn Arg 180 185 190Phe Lys Ile Pro Val Ser Cys Leu Ile Thr Phe Ala Glu Ala Leu Glu 195 200 205Val Gly Tyr Ser Lys Tyr Lys Asn Pro Tyr His Asn Leu Ile His Ala 210 215 220Ala Asp Val Thr Gln Thr Val His Tyr Ile Met Leu His Thr Gly Ile225 230 235 240Met His Trp Leu Thr Glu Leu Glu Ile Leu Ala Met Val Phe Ala Ala 245 250 255Ala Ile His Asp Tyr Glu His Thr Gly Thr Thr Asn Asn Phe His Ile 260 265 270Gln Thr Arg Ser Asp Val Ala Ile Leu Tyr Asn Asp Arg Ser Val Leu 275 280 285Glu Asn His His Val Ser Ala Ala Tyr Arg Leu Met Gln Glu Glu Glu 290 295 300Met Asn Ile Leu Ile Asn Leu Ser Lys Asp Asp Trp Arg Asp Leu Arg305 310 315 320Asn Leu Val Ile Glu Met Val Leu Ser Thr Asp Met Ser Gly His Phe 325 330 335Gln Gln Ile Lys Asn Ile Arg Asn Ser Leu Gln Gln Pro Glu Gly Ile 340 345 350Asp Arg Ala Lys Thr Met Ser Leu Ile Leu His Ala Ala Asp Ile Ser 355 360 365His Pro Ala Lys Ser Trp Lys Leu His Tyr Arg Trp Thr Met Ala Leu 370 375 380Met Glu Glu Phe Phe Leu Gln Gly Asp Lys Glu Ala Glu Leu Gly Leu385 390 395 400Pro Phe Ser Pro Leu Cys Asp Arg Lys Ser Thr Met Val Ala Gln Ser 405 410 415Gln Ile Gly Phe Ile Asp Phe Ile Val Glu Pro Thr Phe Ser Leu Leu 420 425 430Thr Asp Ser Thr Glu Lys Ile Val Ile Pro Leu Ile Glu Glu Ala Ser 435 440 445Lys Ala Glu Thr Ser Ser Tyr Val Ala Ser Ser Ser Thr Thr Ile Val 450 455 460Gly Leu His Ile Ala Asp Ala Leu Arg Arg Ser Asn Thr Lys Gly Ser465 470 475 480Met Ser Asp Gly Ser Tyr Ser Pro Asp Tyr Ser Leu Ala Ala Val Asp 485 490 495Leu Lys Ser Phe Lys Asn Asn Leu Val Asp Ile Ile Gln Gln Asn Lys 500 505 510Glu Arg Trp Lys Glu Leu Ala Ala Gln Glu Ala Arg Thr Ser Ser Gln 515 520 525Lys Cys Glu Phe Ile His Gln 530 53582729PRTHomo sapiens 82Met Asn Pro Phe Gln Lys Asn Glu Ser Lys Glu Thr Leu Phe Ser Pro1 5 10 15Val Ser Ile Glu Glu Val Pro Pro Arg Pro Pro Ser Pro Pro Lys Lys 20 25 30Pro Ser Pro Thr Ile Cys Gly Ser Asn Tyr Pro Leu Ser Ile Ala Phe 35 40 45Ile Val Val Asn Glu Phe Cys Glu Arg Phe Ser Tyr Tyr Gly Met Lys 50 55 60Ala Val Leu Ile Leu Tyr Phe Leu Tyr Phe Leu His Trp Asn Glu Asp65 70 75 80Thr Ser Thr Ser Ile Tyr His Ala Phe Ser Ser Leu Cys Tyr Phe Thr 85 90 95Pro Ile Leu Gly Ala Ala Ile Ala Asp Ser Trp Leu Gly Lys Phe Lys 100 105 110Thr Ile Ile Tyr Leu Ser Leu Val Tyr Val Leu Gly His Val Ile Lys 115 120 125Ser Leu Gly Ala Leu Pro Ile Leu Gly Gly Gln Val Val His Thr Val 130 135 140Leu Ser Leu Ile Gly Leu Ser Leu Ile Ala Leu Gly Thr Gly Gly Ile145 150 155 160Lys Pro Cys Val Ala Ala Phe Gly Gly Asp Gln Phe Glu Glu Lys His 165 170 175Ala Glu Glu Arg Thr Arg Tyr Phe Ser Val Phe Tyr Leu Ser Ile Asn 180 185 190Ala Gly Ser Leu Ile Ser Thr Phe Ile Thr Pro Met Leu Arg Gly Asp 195 200 205Val Gln Cys Phe Gly Glu Asp Cys Tyr Ala Leu Ala Phe Gly Val Pro 210 215 220Gly Leu Leu Met Val Ile Ala Leu Val Val Phe Ala Met Gly Ser Lys225 230 235 240Ile Tyr Asn Lys Pro Pro Pro Glu Gly Asn Ile Val Ala Gln Val Phe 245 250 255Lys Cys Ile Trp Phe Ala Ile Ser Asn Arg Phe Lys Asn Arg Ser Gly 260 265 270Asp Ile Pro Lys Arg Gln His Trp Leu Asp Trp Ala Ala Glu Lys Tyr 275 280 285Pro Lys Gln Leu Ile Met Asp Val Lys Ala Leu Thr Arg Val Leu Phe 290 295 300Leu Tyr Ile Pro Leu Pro Met Phe Trp Ala Leu Leu Asp Gln Gln Gly305 310 315 320Ser Arg Trp Thr Leu Gln Ala Ile Arg Met Asn Arg Asn Leu Gly Phe 325 330 335Phe Val Leu Gln Pro Asp Gln Met Gln Val Leu Asn Pro Leu Leu Val 340 345 350Leu Ile Phe Ile Pro Leu Phe Asp Phe Val Ile Tyr Arg Leu Val Ser 355 360 365Lys Cys Gly Ile Asn Phe Ser Ser Leu Arg Lys Met Ala Val Gly Met 370 375 380Ile Leu Ala Cys Leu Ala Phe Ala Val Ala Ala Ala Val Glu Ile Lys385 390 395 400Ile Asn Glu Met Ala Pro Ala Gln Pro Gly Pro Gln Glu Val Phe Leu 405 410 415Gln Val Leu Asn Leu Ala Asp Asp Glu Val Lys Val Thr Val Val Gly 420 425 430Asn Glu Asn Asn Ser Leu Leu Ile Glu Ser Ile Lys Ser Phe Gln Lys 435 440 445Thr Pro His Tyr Ser Lys Leu His Leu Lys Thr Lys Ser Gln Asp Phe 450 455 460His Phe His Leu Lys Tyr His Asn Leu Ser Leu Tyr Thr Glu His Ser465 470 475 480Val Gln Glu Lys Asn Trp Tyr Ser Leu Val Ile Arg Glu Asp Gly Asn 485 490 495Ser Ile Ser Ser Met Met Val Lys Asp Thr Glu Ser Arg Thr Thr Asn 500 505 510Gly Met Thr Thr Val Arg Phe Val Asn Thr Leu His Lys Asp Val Asn 515 520 525Ile Ser Leu Ser Thr Asp Thr Ser Leu Asn Val Gly Glu Asp Tyr Gly 530 535 540Val Ser Ala Tyr Arg Thr Val Gln Arg Gly Glu Tyr Pro Ala Val His545 550 555 560Cys Arg Thr Glu Asp Lys Asn Phe Ser Leu Asn Leu Gly Leu Leu Asp 565 570 575Phe Gly Ala Ala Tyr Leu Phe Val Ile Thr Asn Asn Thr Asn Gln Gly 580 585 590Leu Gln Ala Trp Lys Ile Glu Asp Ile Pro Ala Asn Lys Met Ser Ile 595 600 605Ala Trp Gln Leu Pro Gln Tyr Ala Leu Val Thr Ala Gly Glu Val Met 610 615 620Phe Ser Val Thr Gly Leu Glu Phe Ser Tyr Ser Gln Ala Pro Ser Gly625 630 635 640Met Lys Ser Val Leu Gln Ala Ala Trp Leu Leu Thr Ile Ala Val Gly 645 650 655Asn Ile Ile Val Leu Val Val Ala Gln Phe Ser Gly Leu Val Gln Trp 660 665 670Ala Glu Phe Ile Leu Phe Ser Cys Leu Leu Leu Val Ile Cys Leu Ile 675 680 685Phe Ser Ile Met Gly Tyr Tyr Tyr Val Pro Val Lys Thr Glu Asp Met 690 695 700Arg Gly Pro Ala Asp Lys His Ile Pro His Ile Gln Gly Asn Met Ile705 710 715 720Lys Leu Glu Thr Lys Lys Thr Lys Leu 725838RNAArtificial SequenceSynthetic oligonucleotide 83uugcuaua 88419DNAArtificial SequenceSynthetic oligonucleotide 84ttccatggta atggtgtgc 198519DNAArtificial SequenceSynthetic oligonucleotide 85ccgaagcaag gaataatcc 198619DNAArtificial SequenceSynthetic oligonucleotide 86tatgtttcgc ctttatgac 198719DNAArtificial SequenceSynthetic oligonucleotide 87ggattcaagg aggaatgac

198819DNAArtificial SequenceSynthetic oligonucleotide 88ctccctcttg catcaagac 198919DNAArtificial SequenceSynthetic oligonucleotide 89aaatcctcgt caggtttac 199019DNAArtificial SequenceSynthetic oligonucleotide 90agtgccttac agtatcatc 199119DNAArtificial SequenceSynthetic oligonucleotide 91cctgaatgtg actgtggac 199219DNAArtificial SequenceSynthetic oligonucleotide 92gactgactgg cctgaaggc 199319DNAArtificial SequenceSynthetic oligonucleotide 93gcagcactat ttgaagcac 199419DNAArtificial SequenceSynthetic oligonucleotide 94gcctgagaac ctcctctgc 199519DNAArtificial SequenceSynthetic oligonucleotide 95acagctagtc aggcacttc 199619DNAArtificial SequenceSynthetic oligonucleotide 96tataagaaat ggcatactc 199719DNAArtificial SequenceSynthetic oligonucleotide 97ctaatccatg gtctagttc 199819DNAArtificial SequenceSynthetic oligonucleotide 98gtctgctata aggaatatc 199919DNAArtificial SequenceSynthetic oligonucleotide 99aagtactcct gaggtctac 1910019DNAArtificial SequenceSynthetic oligonucleotide 100aggcaccagg gacttgtgc 1910119DNAArtificial SequenceSynthetic oligonucleotide 101gatctacacc accttcatc 1910219DNAArtificial SequenceSynthetic oligonucleotide 102tggtgttcta cgtggtgac 1910319DNAArtificial SequenceSynthetic oligonucleotide 103tgttaggcgc ctgcattgc 1910419DNAArtificial SequenceSynthetic oligonucleotide 104caacatcttt atctgctcc 1910519DNAArtificial SequenceSynthetic oligonucleotide 105cgaagggctt tcacaatgc 1910619DNAArtificial SequenceSynthetic oligonucleotide 106gtactacgtt gtagcccac 1910719DNAArtificial SequenceSynthetic oligonucleotide 107tgcaggcgct taacattac 1910819DNAArtificial SequenceSynthetic oligonucleotide 108ggtgtatggg ctcatgtac 1910919DNAArtificial SequenceSynthetic oligonucleotide 109catcgtcatc gcctgctac 1911019DNAArtificial SequenceSynthetic oligonucleotide 110gctcatggtg cgcattggc 1911119DNAArtificial SequenceSynthetic oligonucleotide 111gtaccttatg acgctgatc 1911219DNAArtificial SequenceSynthetic oligonucleotide 112acctggtatg ggtttggcc 1911319DNAArtificial SequenceSynthetic oligonucleotide 113atgtgtgcag gtctactgc 1911419DNAArtificial SequenceSynthetic oligonucleotide 114ttatttaggg cggtttaac 1911519DNAArtificial SequenceSynthetic oligonucleotide 115taatgtcatc gcctccaac 1911619DNAArtificial SequenceSynthetic oligonucleotide 116agaactgggt gatgacagc 1911719DNAArtificial SequenceSynthetic oligonucleotide 117caacagtccc tgctacatc 1911819DNAArtificial SequenceSynthetic oligonucleotide 118gatcgtggtg catccatac 1911919DNAArtificial SequenceSynthetic oligonucleotide 119gcgtggatta ccagaagac 1912019DNAArtificial SequenceSynthetic oligonucleotide 120taacaacagt ccctgctac 1912119DNAArtificial SequenceSynthetic oligonucleotide 121ccattgcttg gtgaatggc 1912219DNAArtificial SequenceSynthetic oligonucleotide 122attctctcca tggagtgac 1912319DNAArtificial SequenceSynthetic oligonucleotide 123atgaactctg tgatccagc 1912419DNAArtificial SequenceSynthetic oligonucleotide 124aggttggcta gtggatctc 1912519DNAArtificial SequenceSynthetic oligonucleotide 125aagtgggtaa ttcctgctc 1912619DNAArtificial SequenceSynthetic oligonucleotide 126cgaatggcag aatggatac 1912719DNAArtificial SequenceSynthetic oligonucleotide 127tctggcaggt tgcatattc 1912819DNAArtificial SequenceSynthetic oligonucleotide 128ctgcaagttt catatctac 1912919DNAArtificial SequenceSynthetic oligonucleotide 129atagcatcag attgtatgc 1913019DNAArtificial SequenceSynthetic oligonucleotide 130tttacacgat gatatgttc 1913119DNAArtificial SequenceSynthetic oligonucleotide 131cagaggattt gccagaaac 1913219DNAArtificial SequenceSynthetic oligonucleotide 132ttggaattcc agtgtaccc 1913319DNAArtificial SequenceSynthetic oligonucleotide 133cagagacacc atctccctc 1913419DNAArtificial SequenceSynthetic oligonucleotide 134acccagaccc aaagtttgc 1913519DNAArtificial SequenceSynthetic oligonucleotide 135aaggtggaaa gactatctc 1913619DNAArtificial SequenceSynthetic oligonucleotide 136tataaaccag aggatttgc 1913719DNAArtificial SequenceSynthetic oligonucleotide 137gtataatcta catcagatc 1913819DNAArtificial SequenceSynthetic oligonucleotide 138ccacatgttt accagagac 1913919DNAArtificial SequenceSynthetic oligonucleotide 139gctagttatc gcctacctc 1914019DNAArtificial SequenceSynthetic oligonucleotide 140gacacacagg agttcaacc 1914119DNAArtificial SequenceSynthetic oligonucleotide 141gctgcagaaa ctaggcatc 1914219DNAArtificial SequenceSynthetic oligonucleotide 142tgccaacttc tacaaggac 1914319DNAArtificial SequenceSynthetic oligonucleotide 143cgacacacag gagttcaac 1914419DNAArtificial SequenceSynthetic oligonucleotide 144gatggacgtc aagtctgcc 1914519DNAArtificial SequenceSynthetic oligonucleotide 145acaggagttc aacctcagc 1914619DNAArtificial SequenceSynthetic oligonucleotide 146ttggcatgga accaacgac 1914719DNAArtificial SequenceSynthetic oligonucleotide 147cctctttgcc ctgtatgac 1914819DNAArtificial SequenceSynthetic oligonucleotide 148agattccaga tgcaacccc 1914919DNAArtificial SequenceSynthetic oligonucleotide 149catgagccag ctgagtttc 1915019DNAArtificial SequenceSynthetic oligonucleotide 150gtggaagtga tcttctatc 1915119DNAArtificial SequenceSynthetic oligonucleotide 151tggctgtcat ggtccaatc 1915219DNAArtificial SequenceSynthetic oligonucleotide 152ccgctgcatg aactatgac 1915319DNAArtificial SequenceSynthetic oligonucleotide 153ttggagactt cggtttaac 1915419DNAArtificial SequenceSynthetic oligonucleotide 154tgtgattcag attctagtc 1915519DNAArtificial SequenceSynthetic oligonucleotide 155agtggatgtc ctacatctc 1915619DNAArtificial SequenceSynthetic oligonucleotide 156atcatgcagg atgacatgc 1915719DNAArtificial SequenceSynthetic oligonucleotide 157ctgaactact ggtacagcc 1915819DNAArtificial SequenceSynthetic oligonucleotide 158cagctttacg tcctgagtc 1915919DNAArtificial SequenceSynthetic oligonucleotide 159tcagaccaca agagagacc 1916019DNAArtificial SequenceSynthetic oligonucleotide 160gtacctacag tggatgtcc 1916119DNAArtificial SequenceSynthetic oligonucleotide 161tggtcaagga gatactgac 1916219DNAArtificial SequenceSynthetic oligonucleotide 162ccctccagtc atgttcttc 1916319DNAArtificial SequenceSynthetic oligonucleotide 163ttctgcaact gtgatgatc 1916419DNAArtificial SequenceSynthetic oligonucleotide 164gtacactacg tggattcac 1916519DNAArtificial SequenceSynthetic oligonucleotide 165gcgaattcca ccagcattc 1916619DNAArtificial SequenceSynthetic oligonucleotide 166tcttccagtg ctgcagctc 1916719DNAArtificial SequenceSynthetic oligonucleotide 167tcagaacaag aggctgggc 1916819DNAArtificial SequenceSynthetic oligonucleotide 168gaagattgcc agtcttcac 1916919DNAArtificial SequenceSynthetic oligonucleotide 169gattcctcct ctcaacatc 1917019DNAArtificial SequenceSynthetic oligonucleotide 170gcattctagt atttctaac 1917119DNAArtificial SequenceSynthetic oligonucleotide 171ttacagtgtc aattccaac 1917219DNAArtificial SequenceSynthetic oligonucleotide 172tgattatcgg gagatcatc 1917319DNAArtificial SequenceSynthetic oligonucleotide 173gaatggatgt gtatgtatc 1917419DNAArtificial SequenceSynthetic oligonucleotide 174tgacatgatt ccttatagc 1917519DNAArtificial SequenceSynthetic oligonucleotide 175tctacacact gccaaatgc 1917619DNAArtificial SequenceSynthetic oligonucleotide 176actggccatc atctacaac 1917719DNAArtificial SequenceSynthetic oligonucleotide 177tgctcacctg tctgtggtc 1917819DNAArtificial SequenceSynthetic oligonucleotide 178acattgacca ggaagtgac 1917919DNAArtificial SequenceSynthetic oligonucleotide 179tggatgactt cagctctac 1918019DNAArtificial SequenceSynthetic oligonucleotide 180ctacaacctc tggttcggc 1918119DNAArtificial SequenceSynthetic oligonucleotide 181cacgacagtg gagagaaac 1918219DNAArtificial SequenceSynthetic oligonucleotide 182gttctacatg ccggatgac 1918319DNAArtificial SequenceSynthetic oligonucleotide 183aggtatcatg cactggctc 1918419DNAArtificial SequenceSynthetic oligonucleotide 184gaagctgaat tagggcttc 1918519DNAArtificial SequenceSynthetic oligonucleotide 185ctggtggaca tcattcagc 1918619DNAArtificial SequenceSynthetic oligonucleotide 186tttgtgatcg gaagtcaac 1918719DNAArtificial SequenceSynthetic oligonucleotide 187attgctgatg cactaagac 1918819DNAArtificial SequenceSynthetic oligonucleotide 188cagatatgat cttatcaac 1918919DNAArtificial SequenceSynthetic oligonucleotide 189actgtgcatt acataatgc 1919019DNAArtificial SequenceSynthetic oligonucleotide 190cacgtgagtg cagcttatc 1919119DNAArtificial SequenceSynthetic oligonucleotide 191agtcctatca ttgatcggc 1919219DNAArtificial SequenceSynthetic oligonucleotide 192gaagccatct ccgacaatc 1919319DNAArtificial SequenceSynthetic oligonucleotide 193atggctgttg gtatgatcc 1919419DNAArtificial SequenceSynthetic oligonucleotide 194ccgtgaggtt tgttaacac 1919519DNAArtificial SequenceSynthetic oligonucleotide 195ttgggtgcct taccaatac 1919619DNAArtificial SequenceSynthetic oligonucleotide 196ctccaagtgt ggaattaac 1919719DNAArtificial SequenceSynthetic oligonucleotide 197gcatgatggt aaaggatac 19198109PRTHomo sapiens 198Met Ile Cys Cys Ser Ala Leu Ser Pro Arg Ile His Leu Ser Phe His1 5 10 15Arg Ser Leu Thr Gly Ile Val Leu Ala Asn Ser Ser Leu Asp Ile Val 20 25 30Leu His Asp Thr Tyr Tyr Val Val Ala His Cys Gly Gly Asn Val Arg 35 40 45Arg Leu His Cys Gly Gly Pro Ala Ser Arg Glu Arg Thr Ala Met Gln 50 55 60Ala Leu Asn Ile Thr Pro Glu Gln Phe Ser Arg Leu Leu Arg Asp His65 70 75 80Asn Leu Thr Arg Glu Gln Phe Ile Ala Leu Tyr Arg Leu Arg Pro Leu 85 90 95Val Tyr Thr Pro Glu Leu Pro Gly Arg Ala Lys Leu Ala 100 10519923PRTHomo sapiens 199Leu Val Leu Thr Gly Val Leu Ile Phe Ala Leu Ala Leu Phe Gly Asn1 5 10 15Ala Leu Val Phe Tyr Val Val 2020011PRTHomo sapiens 200Thr Arg Ser Lys Ala Met Arg Thr Val Thr Asn1 5 1020123PRTHomo sapiens 201Ile Phe Ile Cys Ser Leu Ala Leu Ser Asp Leu Leu Ile Thr Phe Phe1 5 10 15Cys Ile Pro Val Thr Met Leu 2020214PRTHomo sapiens 202Gln Asn Ile Ser Asp Asn Trp Leu Gly Gly Ala Phe Ile Cys1 5 1020323PRTHomo sapiens 203Lys Met Val Pro Phe Val Gln Ser Thr Ala Val Val Thr Glu Ile Leu1 5 10 15Thr Met Thr Cys Ile Ala Val 2020420PRTHomo sapiens 204Glu Arg His Gln Gly Leu Val His Pro Phe Lys Met Lys Trp Gln Tyr1 5 10 15Thr Asn Arg Arg 2020523PRTHomo sapiens 205Ala Phe Thr Met Leu Gly Val Val Trp Leu Val Ala Val Ile Val Gly1 5 10 15Ser Pro Met Trp His Val Gln 2020648PRTHomo sapiens 206Gln Leu Glu Ile Lys Tyr Asp Phe Leu Tyr Glu Lys Glu His Ile Cys1 5 10 15Cys Leu Glu Glu Trp Thr Ser Pro Val His Gln Lys Ile Tyr Thr Thr 20 25 30Phe Ile Leu Ser Ser Ser Ser

Ser Cys Leu Leu Trp Lys Lys Lys Arg 35 40 4520723PRTHomo sapiens 207Ala Val Ile Met Met Val Thr Val Val Ala Leu Phe Ala Val Cys Trp1 5 10 15Ala Pro Phe His Val Val His 2020819PRTHomo sapiens 208Met Met Ile Glu Tyr Ser Asn Phe Glu Lys Glu Tyr Asp Asp Val Thr1 5 10 15Ile Lys Met20923PRTHomo sapiens 209Ile Phe Ala Ile Val Gln Ile Ile Gly Phe Ser Asn Ser Ile Cys Asn1 5 10 15Pro Ile Val Tyr Ala Phe Met 2021096PRTHomo sapiens 210Asn Glu Asn Phe Lys Lys Asn Val Leu Ser Ala Val Cys Tyr Cys Ile1 5 10 15Val Asn Lys Thr Phe Ser Pro Ala Gln Arg His Gly Asn Ser Gly Ile 20 25 30Thr Met Met Arg Lys Lys Ala Lys Phe Ser Leu Arg Glu Asn Pro Val 35 40 45Glu Glu Thr Lys Gly Glu Ala Phe Ser Asp Gly Asn Ile Glu Val Lys 50 55 60Leu Cys Glu Gln Thr Glu Glu Lys Lys Lys Leu Lys Arg His Leu Ala65 70 75 80Leu Phe Arg Ser Glu Leu Ala Glu Asn Ser Pro Leu Asp Ser Gly His 85 90 9521147PRTHomo sapiens 211Met Gln Ala Leu Asn Ile Thr Pro Glu Gln Phe Ser Arg Leu Leu Arg1 5 10 15Asp His Asn Leu Thr Arg Glu Gln Phe Ile Ala Val His Arg Leu Arg 20 25 30Pro Leu Val Tyr Thr Pro Glu Leu Pro Gly Arg Ala Lys Leu Ala 35 40 4521223PRTHomo sapiens 212Leu Val Leu Thr Gly Val Leu Ile Phe Ala Leu Ala Leu Phe Gly Asn1 5 10 15Ala Leu Val Phe Tyr Val Val 2021311PRTHomo sapiens 213Thr Arg Ser Lys Ala Met Arg Thr Val Thr Asn1 5 1021423PRTHomo sapiens 214Ile Phe Ile Cys Ser Leu Ala Leu Ser Asp Leu Leu Ile Thr Phe Phe1 5 10 15Cys Ile Pro Val Thr Met Leu 2021514PRTHomo sapiens 215Gln Asn Ile Ser Asp Asn Trp Leu Gly Gly Ala Phe Ile Cys1 5 1021623PRTHomo sapiens 216Lys Met Val Pro Phe Val Gln Ser Thr Ala Val Val Thr Glu Ile Leu1 5 10 15Thr Met Thr Cys Ile Ala Val 2021720PRTHomo sapiens 217Glu Arg His Gln Gly Leu Val His Pro Phe Lys Met Lys Trp Gln Tyr1 5 10 15Thr Asn Arg Arg 2021823PRTHomo sapiens 218Ala Phe Thr Met Leu Gly Val Val Trp Leu Val Ala Val Ile Val Gly1 5 10 15Ser Pro Met Trp His Val Gln 2021928PRTHomo sapiens 219Gln Leu Glu Ile Lys Tyr Asp Phe Leu Tyr Glu Lys Glu His Ile Cys1 5 10 15Cys Leu Glu Glu Trp Thr Ser Pro Val His Gln Lys 20 2522023PRTHomo sapiens 220Ile Tyr Thr Thr Phe Ile Leu Val Ile Leu Phe Leu Leu Pro Leu Met1 5 10 15Val Met Leu Ile Leu Tyr Ser 2022134PRTHomo sapiens 221Lys Ile Gly Tyr Glu Leu Trp Ile Lys Lys Arg Val Gly Asp Gly Ser1 5 10 15Val Leu Arg Thr Ile His Gly Lys Glu Met Ser Lys Ile Ala Arg Lys 20 25 30Lys Lys22223PRTHomo sapiens 222Arg Ala Val Ile Met Met Val Thr Val Val Ala Leu Phe Ala Val Cys1 5 10 15Trp Ala Pro Phe His Val Val 2022319PRTHomo sapiens 223His Met Met Ile Glu Tyr Ser Asn Phe Glu Lys Glu Tyr Asp Asp Val1 5 10 15Thr Ile Lys22423PRTHomo sapiens 224Met Ile Phe Ala Ile Val Gln Ile Ile Gly Phe Ser Asn Ser Ile Cys1 5 10 15Asn Pro Ile Val Tyr Ala Phe 2022597PRTHomo sapiens 225Met Asn Glu Asn Phe Lys Lys Asn Val Leu Ser Ala Val Cys Tyr Cys1 5 10 15Ile Val Asn Lys Thr Phe Ser Pro Ala Gln Arg His Gly Asn Ser Gly 20 25 30Ile Thr Met Met Arg Lys Lys Ala Lys Phe Ser Leu Arg Glu Asn Pro 35 40 45Val Glu Glu Thr Lys Gly Glu Ala Phe Ser Asp Gly Asn Ile Glu Val 50 55 60Lys Leu Cys Glu Gln Thr Glu Glu Lys Lys Lys Leu Lys Arg His Leu65 70 75 80Ala Leu Phe Arg Ser Glu Leu Ala Glu Asn Ser Pro Leu Asp Ser Gly 85 90 95His226320PRTHomo sapiens 226Met Ala Glu Glu Glu Ala Pro Lys Lys Ser Arg Ala Ala Gly Gly Gly1 5 10 15Ala Ser Trp Glu Leu Cys Ala Gly Ala Leu Ser Ala Arg Leu Ala Glu 20 25 30Glu Gly Ser Gly Asp Ala Gly Gly Arg Arg Arg Pro Pro Val Asp Pro 35 40 45Arg Arg Leu Ala Arg Gln Leu Leu Leu Leu Leu Trp Leu Leu Glu Ala 50 55 60Pro Leu Leu Leu Gly Val Arg Ala Gln Ala Ala Gly Gln Gly Pro Gly65 70 75 80Gln Gly Pro Gly Pro Gly Gln Gln Pro Pro Pro Pro Pro Gln Gln Gln 85 90 95Gln Ser Gly Gln Gln Tyr Asn Gly Glu Arg Gly Ile Ser Val Pro Asp 100 105 110His Gly Tyr Cys Gln Pro Ile Ser Ile Pro Leu Cys Thr Asp Ile Ala 115 120 125Tyr Asn Gln Thr Ile Met Pro Asn Leu Leu Gly His Thr Asn Gln Glu 130 135 140Asp Ala Gly Leu Glu Val His Gln Phe Tyr Pro Leu Val Lys Val Gln145 150 155 160Cys Ser Ala Glu Leu Lys Phe Phe Leu Cys Ser Met Tyr Ala Pro Val 165 170 175Cys Thr Val Leu Glu Gln Ala Leu Pro Pro Cys Arg Ser Leu Cys Glu 180 185 190Arg Ala Arg Gln Gly Cys Glu Ala Leu Met Asn Lys Phe Gly Phe Gln 195 200 205Trp Pro Asp Thr Leu Lys Cys Glu Lys Phe Pro Val His Gly Ala Gly 210 215 220Glu Leu Cys Val Gly Gln Asn Thr Ser Asp Lys Gly Thr Pro Thr Pro225 230 235 240Ser Leu Leu Pro Glu Phe Trp Thr Ser Asn Pro Gln His Gly Gly Gly 245 250 255Gly His Arg Gly Gly Phe Pro Gly Gly Ala Gly Ala Ser Glu Arg Gly 260 265 270Lys Phe Ser Cys Pro Arg Ala Leu Lys Val Pro Ser Tyr Leu Asn Tyr 275 280 285His Phe Leu Gly Glu Lys Asp Cys Gly Ala Pro Cys Glu Pro Thr Lys 290 295 300Val Tyr Gly Leu Met Tyr Phe Gly Pro Glu Glu Leu Arg Phe Ser Arg305 310 315 32022723PRTHomo sapiens 227Thr Trp Ile Gly Ile Trp Ser Val Leu Cys Cys Ala Ser Thr Leu Phe1 5 10 15Thr Val Leu Thr Tyr Leu Val 2022812PRTHomo sapiens 228Asp Met Arg Arg Phe Ser Tyr Pro Glu Arg Pro Ile1 5 1022920PRTHomo sapiens 229Ile Phe Leu Ser Gly Cys Tyr Thr Ala Val Ala Val Ala Tyr Ile Ala1 5 10 15Gly Phe Leu Leu 2023027PRTHomo sapiens 230Glu Asp Arg Val Val Cys Asn Asp Lys Phe Ala Glu Asp Gly Ala Arg1 5 10 15Thr Val Ala Gln Gly Thr Lys Lys Glu Gly Cys 20 2523123PRTHomo sapiens 231Thr Ile Leu Phe Met Met Leu Tyr Phe Phe Ser Met Ala Ser Ser Ile1 5 10 15Trp Trp Val Ile Leu Ser Leu 2023220PRTHomo sapiens 232Thr Trp Phe Leu Ala Ala Gly Met Lys Trp Gly His Glu Ala Ile Glu1 5 10 15Ala Asn Ser Gln 2023323PRTHomo sapiens 233Tyr Phe His Leu Ala Ala Trp Ala Val Pro Ala Ile Lys Thr Ile Thr1 5 10 15Ile Leu Ala Leu Gly Gln Val 2023423PRTHomo sapiens 234Asp Gly Asp Val Leu Ser Gly Val Cys Phe Val Gly Leu Asn Asn Val1 5 10 15Asp Ala Leu Arg Gly Phe Val 2023523PRTHomo sapiens 235Leu Ala Pro Leu Phe Val Tyr Leu Phe Ile Gly Thr Ser Phe Leu Leu1 5 10 15Ala Gly Phe Val Ser Leu Phe 2023620PRTHomo sapiens 236Arg Ile Arg Thr Ile Met Lys His Asp Gly Thr Lys Thr Glu Lys Leu1 5 10 15Glu Lys Leu Met 2023723PRTHomo sapiens 237Val Arg Ile Gly Val Phe Ser Val Leu Tyr Thr Val Pro Ala Thr Ile1 5 10 15Val Ile Ala Cys Tyr Phe Tyr 2023842PRTHomo sapiens 238Glu Gln Ala Phe Arg Asp Gln Trp Glu Arg Ser Trp Val Ala Gln Ser1 5 10 15Cys Lys Ser Tyr Ala Ile Pro Cys Pro His Leu Gln Ala Gly Gly Gly 20 25 30Ala Pro Pro His Pro Pro Met Ser Pro Asp 35 4023923PRTHomo sapiens 239Phe Thr Val Phe Met Ile Lys Tyr Leu Met Thr Leu Ile Val Gly Ile1 5 10 15Thr Ser Gly Phe Trp Ile Trp 2024025PRTHomo sapiens 240Ser Gly Lys Thr Leu Asn Ser Trp Arg Lys Phe Tyr Thr Arg Leu Thr1 5 10 15Asn Ser Lys Gln Gly Glu Thr Thr Val 20 25241409PRTHomo sapiens 241Met Ala Cys Leu Met Ala Ala Phe Ser Val Gly Thr Ala Met Asn Ala1 5 10 15Ser Ser Tyr Ser Ala Glu Met Thr Glu Pro Lys Ser Val Cys Val Ser 20 25 30Val Asp Glu Val Val Ser Ser Asn Met Glu Ala Thr Glu Thr Asp Leu 35 40 45Leu Asn Gly His Leu Lys Lys Val Asp Asn Asn Leu Thr Glu Ala Gln 50 55 60Arg Phe Ser Ser Leu Pro Arg Arg Ala Ala Val Asn Ile Glu Phe Arg65 70 75 80Asp Leu Ser Tyr Ser Val Pro Glu Gly Pro Trp Trp Arg Lys Lys Gly 85 90 95Tyr Lys Thr Leu Leu Lys Gly Ile Ser Gly Lys Phe Asn Ser Gly Glu 100 105 110Leu Val Ala Ile Met Gly Pro Ser Gly Ala Gly Lys Ser Thr Leu Met 115 120 125Asn Ile Leu Ala Gly Tyr Arg Glu Thr Gly Met Lys Gly Ala Val Leu 130 135 140Ile Asn Gly Leu Pro Arg Asp Leu Arg Cys Phe Arg Lys Val Ser Cys145 150 155 160Tyr Ile Met Gln Asp Asp Met Leu Leu Pro His Leu Thr Val Gln Glu 165 170 175Ala Met Met Val Ser Ala His Leu Lys Leu Gln Glu Lys Asp Glu Gly 180 185 190Arg Arg Glu Met Val Lys Glu Ile Leu Thr Ala Leu Gly Leu Leu Ser 195 200 205Cys Ala Asn Thr Arg Thr Gly Ser Leu Ser Gly Gly Gln Arg Lys Arg 210 215 220Leu Ala Ile Ala Leu Glu Leu Val Asn Asn Pro Pro Val Met Phe Phe225 230 235 240Asp Glu Pro Thr Ser Gly Leu Asp Ser Ala Ser Cys Phe Gln Val Val 245 250 255Ser Leu Met Lys Gly Leu Ala Gln Gly Gly Arg Ser Ile Ile Cys Thr 260 265 270Ile His Gln Pro Ser Ala Lys Leu Phe Glu Leu Phe Asp Gln Leu Tyr 275 280 285Val Leu Ser Gln Gly Gln Cys Val Tyr Arg Gly Lys Val Cys Asn Leu 290 295 300Val Pro Tyr Leu Arg Asp Leu Gly Leu Asn Cys Pro Thr Tyr His Asn305 310 315 320Pro Ala Asp Phe Val Met Glu Val Ala Ser Gly Glu Tyr Gly Asp Gln 325 330 335Asn Ser Arg Leu Val Arg Ala Val Arg Glu Gly Met Cys Asp Ser Asp 340 345 350His Lys Arg Asp Leu Gly Gly Asp Ala Glu Val Asn Pro Phe Leu Trp 355 360 365His Arg Pro Ser Glu Glu Asp Ser Ser Ser Met Glu Gly Cys His Ser 370 375 380Phe Ser Ala Ser Cys Leu Thr Gln Phe Cys Ile Leu Phe Lys Arg Thr385 390 395 400Phe Leu Ser Ile Met Arg Asp Ser Val 40524223PRTHomo sapiens 242Leu Thr His Leu Arg Ile Thr Ser His Ile Gly Ile Gly Leu Leu Ile1 5 10 15Gly Leu Leu Tyr Leu Gly Ile 2024312PRTHomo sapiens 243Gly Asn Glu Ala Lys Lys Val Leu Ser Asn Ser Gly1 5 1024423PRTHomo sapiens 244Phe Leu Phe Phe Ser Met Leu Phe Leu Met Phe Ala Ala Leu Met Pro1 5 10 15Thr Val Leu Thr Phe Pro Leu 2024523PRTHomo sapiens 245Glu Met Gly Val Phe Leu Arg Glu His Leu Asn Tyr Trp Tyr Ser Leu1 5 10 15Lys Ala Tyr Tyr Leu Ala Lys 2024623PRTHomo sapiens 246Thr Met Ala Asp Val Pro Phe Gln Ile Met Phe Pro Val Ala Tyr Cys1 5 10 15Ser Ile Val Tyr Trp Met Thr 202476PRTHomo sapiens 247Ser Gln Pro Ser Asp Ala1 524823PRTHomo sapiens 248Val Arg Phe Val Leu Phe Ala Ala Leu Gly Thr Met Thr Ser Leu Val1 5 10 15Ala Gln Ser Leu Gly Leu Leu 202499PRTHomo sapiens 249Ile Gly Ala Ala Ser Thr Ser Leu Gln1 525023PRTHomo sapiens 250Val Ala Thr Phe Val Gly Pro Val Thr Ala Ile Pro Val Leu Leu Phe1 5 10 15Ser Gly Phe Phe Val Ser Phe 2025112PRTHomo sapiens 251Asp Thr Ile Pro Thr Tyr Leu Gln Trp Met Ser Tyr1 5 1025218PRTHomo sapiens 252Ile Ser Tyr Val Arg Tyr Gly Phe Glu Gly Val Ile Leu Ser Ile Tyr1 5 10 15Gly Leu25331PRTHomo sapiens 253Asp Arg Glu Asp Leu His Cys Asp Ile Asp Glu Thr Cys His Phe Gln1 5 10 15Lys Ser Glu Ala Ile Leu Arg Glu Leu Asp Val Glu Asn Ala Lys 20 25 3025423PRTHomo sapiens 254Leu Tyr Leu Asp Phe Ile Val Leu Gly Ile Phe Phe Ile Ser Leu Arg1 5 10 15Leu Ile Ala Tyr Phe Val Leu 202558PRTHomo sapiens 255Arg Tyr Lys Ile Arg Ala Glu Arg1 5256421PRTHomo sapiens 256Met Ala Cys Leu Met Ala Ala Phe Ser Val Gly Thr Ala Met Asn Ala1 5 10 15Ser Ser Tyr Ser Ala Glu Met Thr Glu Pro Lys Ser Val Cys Val Ser 20 25 30Val Asp Glu Val Val Ser Ser Asn Met Glu Ala Thr Glu Thr Asp Leu 35 40 45Leu Asn Gly His Leu Lys Lys Val Asp Asn Asn Leu Thr Glu Ala Gln 50 55 60Arg Phe Ser Ser Leu Pro Arg Arg Ala Ala Val Asn Ile Glu Phe Arg65 70 75 80Asp Leu Ser Tyr Ser Val Pro Glu Gly Pro Trp Trp Arg Lys Lys Gly 85 90 95Tyr Lys Thr Leu Leu Lys Gly Ile Ser Gly Lys Phe Asn Ser Gly Glu 100 105 110Leu Val Ala Ile Met Gly Pro Ser Gly Ala Gly Lys Ser Thr Leu Met 115 120 125Asn Ile Leu Ala Gly Tyr Arg Glu Thr Gly Met Lys Gly Ala Val Leu 130 135 140Ile Asn Gly Leu Pro Arg Asp Leu Arg Cys Phe Arg Lys Val Ser Cys145 150 155 160Tyr Ile Met Gln Asp Asp Met Leu Leu Pro His Leu Thr Val Gln Glu 165 170 175Ala Met Met Val Ser Ala His Leu Lys Leu Gln Glu Lys Asp Glu Gly 180 185 190Arg Arg Glu Met Val Lys Glu Ile Leu Thr Ala Leu Gly Leu Leu Ser 195 200 205Cys Ala Asn Thr Arg Thr Gly Ser Leu Ser Gly Gly Gln Arg Lys Arg 210 215 220Leu Ala Ile Ala Leu Glu Leu Val Asn Asn Pro Pro Val Met Phe Phe225 230 235 240Asp Glu Pro Thr Ser Gly Leu Asp Ser Ala Ser Cys Phe Gln Val Val 245 250 255Ser Leu Met Lys Gly Leu Ala Gln Gly Gly Arg Ser Ile Ile Cys Thr 260 265 270Ile His Gln Pro Ser Ala Lys Leu Phe Glu Leu Phe Asp Gln Leu Tyr 275 280 285Val Leu Ser Gln Gly Gln Cys Val Tyr Arg Gly Lys Val Cys Asn Leu 290 295 300Val Pro Tyr Leu Arg Asp Leu Gly Leu Asn Cys Pro Thr Tyr His Asn305 310 315 320Pro Ala Asp Phe Val Met Glu Val Ala Ser Gly Glu Tyr Gly Asp Gln 325 330 335Asn Ser Arg Leu Val Arg Ala Val Arg Glu Gly Met Cys Asp Ser Asp 340 345 350His Lys Arg Asp Leu Gly Gly Asp Ala Glu Val Asn Pro Phe Leu Trp 355 360 365His Arg Pro Ser Glu Glu Val Lys Gln Thr Lys Arg Leu Lys Gly Leu 370 375 380Arg Lys Asp Ser Ser Ser Met Glu Gly Cys His Ser Phe Ser Ala Ser385 390 395 400Cys Leu Thr Gln Phe Cys Ile Leu Phe Lys Arg Thr Phe Leu Ser Ile 405 410 415Met Arg Asp Ser Val 42025723PRTHomo sapiens 257Leu Thr His Leu Arg Ile Thr Ser His Ile Gly Ile Gly Leu Leu Ile1 5

10 15Gly Leu Leu Tyr Leu Gly Ile 2025812PRTHomo sapiens 258Gly Asn Glu Ala Lys Lys Val Leu Ser Asn Ser Gly1 5 1025923PRTHomo sapiens 259Phe Leu Phe Phe Ser Met Leu Phe Leu Met Phe Ala Ala Leu Met Pro1 5 10 15Thr Val Leu Thr Phe Pro Leu 2026023PRTHomo sapiens 260Glu Met Gly Val Phe Leu Arg Glu His Leu Asn Tyr Trp Tyr Ser Leu1 5 10 15Lys Ala Tyr Tyr Leu Ala Lys 2026123PRTHomo sapiens 261Thr Met Ala Asp Val Pro Phe Gln Ile Met Phe Pro Val Ala Tyr Cys1 5 10 15Ser Ile Val Tyr Trp Met Thr 202626PRTHomo sapiens 262Ser Gln Pro Ser Asp Ala1 526323PRTHomo sapiens 263Val Arg Phe Val Leu Phe Ala Ala Leu Gly Thr Met Thr Ser Leu Val1 5 10 15Ala Gln Ser Leu Gly Leu Leu 202649PRTHomo sapiens 264Ile Gly Ala Ala Ser Thr Ser Leu Gln1 526523PRTHomo sapiens 265Val Ala Thr Phe Val Gly Pro Val Thr Ala Ile Pro Val Leu Leu Phe1 5 10 15Ser Gly Phe Phe Val Ser Phe 2026612PRTHomo sapiens 266Asp Thr Ile Pro Thr Tyr Leu Gln Trp Met Ser Tyr1 5 1026718PRTHomo sapiens 267Ile Ser Tyr Val Arg Tyr Gly Phe Glu Gly Val Ile Leu Ser Ile Tyr1 5 10 15Gly Leu26831PRTHomo sapiens 268Asp Arg Glu Asp Leu His Cys Asp Ile Asp Glu Thr Cys His Phe Gln1 5 10 15Lys Ser Glu Ala Ile Leu Arg Glu Leu Asp Val Glu Asn Ala Lys 20 25 3026923PRTHomo sapiens 269Leu Tyr Leu Asp Phe Ile Val Leu Gly Ile Phe Phe Ile Ser Leu Arg1 5 10 15Leu Ile Ala Tyr Phe Val Leu 202708PRTHomo sapiens 270Arg Tyr Lys Ile Arg Ala Glu Arg1 5271420PRTHomo sapiens 271Met Arg Ile Ser Leu Pro Arg Ala Pro Glu Arg Asp Gly Gly Val Ser1 5 10 15Ala Ser Ser Leu Leu Asp Thr Val Thr Asn Ala Ser Ser Tyr Ser Ala 20 25 30Glu Met Thr Glu Pro Lys Ser Val Cys Val Ser Val Asp Glu Val Val 35 40 45Ser Ser Asn Met Glu Ala Thr Glu Thr Asp Leu Leu Asn Gly His Leu 50 55 60Lys Lys Val Asp Asn Asn Leu Thr Glu Ala Gln Arg Phe Ser Ser Leu65 70 75 80Pro Arg Arg Ala Ala Val Asn Ile Glu Phe Arg Asp Leu Ser Tyr Ser 85 90 95Val Pro Glu Gly Pro Trp Trp Arg Lys Lys Gly Tyr Lys Thr Leu Leu 100 105 110Lys Gly Ile Ser Gly Lys Phe Asn Ser Gly Glu Leu Val Ala Ile Met 115 120 125Gly Pro Ser Gly Ala Gly Lys Ser Thr Leu Met Asn Ile Leu Ala Gly 130 135 140Tyr Arg Glu Thr Gly Met Lys Gly Ala Val Leu Ile Asn Gly Leu Pro145 150 155 160Arg Asp Leu Arg Cys Phe Arg Lys Val Ser Cys Tyr Ile Met Gln Asp 165 170 175Asp Met Leu Leu Pro His Leu Thr Val Gln Glu Ala Met Met Val Ser 180 185 190Ala His Leu Lys Leu Gln Glu Lys Asp Glu Gly Arg Arg Glu Met Val 195 200 205Lys Glu Ile Leu Thr Ala Leu Gly Leu Leu Ser Cys Ala Asn Thr Arg 210 215 220Thr Gly Ser Leu Ser Gly Gly Gln Arg Lys Arg Leu Ala Ile Ala Leu225 230 235 240Glu Leu Val Asn Asn Pro Pro Val Met Phe Phe Asp Glu Pro Thr Ser 245 250 255Gly Leu Asp Ser Ala Ser Cys Phe Gln Val Val Ser Leu Met Lys Gly 260 265 270Leu Ala Gln Gly Gly Arg Ser Ile Ile Cys Thr Ile His Gln Pro Ser 275 280 285Ala Lys Leu Phe Glu Leu Phe Asp Gln Leu Tyr Val Leu Ser Gln Gly 290 295 300Gln Cys Val Tyr Arg Gly Lys Val Cys Asn Leu Val Pro Tyr Leu Arg305 310 315 320Asp Leu Gly Leu Asn Cys Pro Thr Tyr His Asn Pro Ala Asp Phe Val 325 330 335Met Glu Val Ala Ser Gly Glu Tyr Gly Asp Gln Asn Ser Arg Leu Val 340 345 350Arg Ala Val Arg Glu Gly Met Cys Asp Ser Asp His Lys Arg Asp Leu 355 360 365Gly Gly Asp Ala Glu Val Asn Pro Phe Leu Trp His Arg Pro Ser Glu 370 375 380Glu Asp Ser Ser Ser Met Glu Gly Cys His Ser Phe Ser Ala Ser Cys385 390 395 400Leu Thr Gln Phe Cys Ile Leu Phe Lys Arg Thr Phe Leu Ser Ile Met 405 410 415Arg Asp Ser Val 42027223PRTHomo sapiens 272Leu Thr His Leu Arg Ile Thr Ser His Ile Gly Ile Gly Leu Leu Ile1 5 10 15Gly Leu Leu Tyr Leu Gly Ile 2027312PRTHomo sapiens 273Gly Asn Glu Ala Lys Lys Val Leu Ser Asn Ser Gly1 5 1027423PRTHomo sapiens 274Phe Leu Phe Phe Ser Met Leu Phe Leu Met Phe Ala Ala Leu Met Pro1 5 10 15Thr Val Leu Thr Phe Pro Leu 2027523PRTHomo sapiens 275Glu Met Gly Val Phe Leu Arg Glu His Leu Asn Tyr Trp Tyr Ser Leu1 5 10 15Lys Ala Tyr Tyr Leu Ala Lys 2027623PRTHomo sapiens 276Thr Met Ala Asp Val Pro Phe Gln Ile Met Phe Pro Val Ala Tyr Cys1 5 10 15Ser Ile Val Tyr Trp Met Thr 202776PRTHomo sapiens 277Ser Gln Pro Ser Asp Ala1 527823PRTHomo sapiens 278Val Arg Phe Val Leu Phe Ala Ala Leu Gly Thr Met Thr Ser Leu Val1 5 10 15Ala Gln Ser Leu Gly Leu Leu 202799PRTHomo sapiens 279Ile Gly Ala Ala Ser Thr Ser Leu Gln1 528023PRTHomo sapiens 280Val Ala Thr Phe Val Gly Pro Val Thr Ala Ile Pro Val Leu Leu Phe1 5 10 15Ser Gly Phe Phe Val Ser Phe 2028112PRTHomo sapiens 281Asp Thr Ile Pro Thr Tyr Leu Gln Trp Met Ser Tyr1 5 1028218PRTHomo sapiens 282Ile Ser Tyr Val Arg Tyr Gly Phe Glu Gly Val Ile Leu Ser Ile Tyr1 5 10 15Gly Leu28331PRTHomo sapiens 283Asp Arg Glu Asp Leu His Cys Asp Ile Asp Glu Thr Cys His Phe Gln1 5 10 15Lys Ser Glu Ala Ile Leu Arg Glu Leu Asp Val Glu Asn Ala Lys 20 25 3028423PRTHomo sapiens 284Leu Tyr Leu Asp Phe Ile Val Leu Gly Ile Phe Phe Ile Ser Leu Arg1 5 10 15Leu Ile Ala Tyr Phe Val Leu 202858PRTHomo sapiens 285Arg Tyr Lys Ile Arg Ala Glu Arg1 5286411PRTHomo sapiens 286Met Leu Gly Thr Gln Gly Trp Thr Lys Gln Arg Lys Pro Cys Pro Gln1 5 10 15Asn Ala Ser Ser Tyr Ser Ala Glu Met Thr Glu Pro Lys Ser Val Cys 20 25 30Val Ser Val Asp Glu Val Val Ser Ser Asn Met Glu Ala Thr Glu Thr 35 40 45Asp Leu Leu Asn Gly His Leu Lys Lys Val Asp Asn Asn Leu Thr Glu 50 55 60Ala Gln Arg Phe Ser Ser Leu Pro Arg Arg Ala Ala Val Asn Ile Glu65 70 75 80Phe Arg Asp Leu Ser Tyr Ser Val Pro Glu Gly Pro Trp Trp Arg Lys 85 90 95Lys Gly Tyr Lys Thr Leu Leu Lys Gly Ile Ser Gly Lys Phe Asn Ser 100 105 110Gly Glu Leu Val Ala Ile Met Gly Pro Ser Gly Ala Gly Lys Ser Thr 115 120 125Leu Met Asn Ile Leu Ala Gly Tyr Arg Glu Thr Gly Met Lys Gly Ala 130 135 140Val Leu Ile Asn Gly Leu Pro Arg Asp Leu Arg Cys Phe Arg Lys Val145 150 155 160Ser Cys Tyr Ile Met Gln Asp Asp Met Leu Leu Pro His Leu Thr Val 165 170 175Gln Glu Ala Met Met Val Ser Ala His Leu Lys Leu Gln Glu Lys Asp 180 185 190Glu Gly Arg Arg Glu Met Val Lys Glu Ile Leu Thr Ala Leu Gly Leu 195 200 205Leu Ser Cys Ala Asn Thr Arg Thr Gly Ser Leu Ser Gly Gly Gln Arg 210 215 220Lys Arg Leu Ala Ile Ala Leu Glu Leu Val Asn Asn Pro Pro Val Met225 230 235 240Phe Phe Asp Glu Pro Thr Ser Gly Leu Asp Ser Ala Ser Cys Phe Gln 245 250 255Val Val Ser Leu Met Lys Gly Leu Ala Gln Gly Gly Arg Ser Ile Ile 260 265 270Cys Thr Ile His Gln Pro Ser Ala Lys Leu Phe Glu Leu Phe Asp Gln 275 280 285Leu Tyr Val Leu Ser Gln Gly Gln Cys Val Tyr Arg Gly Lys Val Cys 290 295 300Asn Leu Val Pro Tyr Leu Arg Asp Leu Gly Leu Asn Cys Pro Thr Tyr305 310 315 320His Asn Pro Ala Asp Phe Val Met Glu Val Ala Ser Gly Glu Tyr Gly 325 330 335Asp Gln Asn Ser Arg Leu Val Arg Ala Val Arg Glu Gly Met Cys Asp 340 345 350Ser Asp His Lys Arg Asp Leu Gly Gly Asp Ala Glu Val Asn Pro Phe 355 360 365Leu Trp His Arg Pro Ser Glu Glu Asp Ser Ser Ser Met Glu Gly Cys 370 375 380His Ser Phe Ser Ala Ser Cys Leu Thr Gln Phe Cys Ile Leu Phe Lys385 390 395 400Arg Thr Phe Leu Ser Ile Met Arg Asp Ser Val 405 41028723PRTHomo sapiens 287Leu Thr His Leu Arg Ile Thr Ser His Ile Gly Ile Gly Leu Leu Ile1 5 10 15Gly Leu Leu Tyr Leu Gly Ile 2028812PRTHomo sapiens 288Gly Asn Glu Ala Lys Lys Val Leu Ser Asn Ser Gly1 5 1028923PRTHomo sapiens 289Phe Leu Phe Phe Ser Met Leu Phe Leu Met Phe Ala Ala Leu Met Pro1 5 10 15Thr Val Leu Thr Phe Pro Leu 2029023PRTHomo sapiens 290Glu Met Gly Val Phe Leu Arg Glu His Leu Asn Tyr Trp Tyr Ser Leu1 5 10 15Lys Ala Tyr Tyr Leu Ala Lys 2029123PRTHomo sapiens 291Thr Met Ala Asp Val Pro Phe Gln Ile Met Phe Pro Val Ala Tyr Cys1 5 10 15Ser Ile Val Tyr Trp Met Thr 202926PRTHomo sapiens 292Ser Gln Pro Ser Asp Ala1 529323PRTHomo sapiens 293Val Arg Phe Val Leu Phe Ala Ala Leu Gly Thr Met Thr Ser Leu Val1 5 10 15Ala Gln Ser Leu Gly Leu Leu 202949PRTHomo sapiens 294Ile Gly Ala Ala Ser Thr Ser Leu Gln1 529523PRTHomo sapiens 295Val Ala Thr Phe Val Gly Pro Val Thr Ala Ile Pro Val Leu Leu Phe1 5 10 15Ser Gly Phe Phe Val Ser Phe 2029612PRTHomo sapiens 296Asp Thr Ile Pro Thr Tyr Leu Gln Trp Met Ser Tyr1 5 1029718PRTHomo sapiens 297Ile Ser Tyr Val Arg Tyr Gly Phe Glu Gly Val Ile Leu Ser Ile Tyr1 5 10 15Gly Leu29831PRTHomo sapiens 298Asp Arg Glu Asp Leu His Cys Asp Ile Asp Glu Thr Cys His Phe Gln1 5 10 15Lys Ser Glu Ala Ile Leu Arg Glu Leu Asp Val Glu Asn Ala Lys 20 25 3029923PRTHomo sapiens 299Leu Tyr Leu Asp Phe Ile Val Leu Gly Ile Phe Phe Ile Ser Leu Arg1 5 10 15Leu Ile Ala Tyr Phe Val Leu 203008PRTHomo sapiens 300Arg Tyr Lys Ile Arg Ala Glu Arg1 5301387PRTHomo sapiens 301Met Thr Glu Pro Lys Ser Val Cys Val Ser Val Asp Glu Val Val Ser1 5 10 15Ser Asn Met Glu Ala Thr Glu Thr Asp Leu Leu Asn Gly His Leu Lys 20 25 30Lys Val Asp Asn Asn Leu Thr Glu Ala Gln Arg Phe Ser Ser Leu Pro 35 40 45Arg Arg Ala Ala Val Asn Ile Glu Phe Arg Asp Leu Ser Tyr Ser Val 50 55 60Pro Glu Gly Pro Trp Trp Arg Lys Lys Gly Tyr Lys Thr Leu Leu Lys65 70 75 80Gly Ile Ser Gly Lys Phe Asn Ser Gly Glu Leu Val Ala Ile Met Gly 85 90 95Pro Ser Gly Ala Gly Lys Ser Thr Leu Met Asn Ile Leu Ala Gly Tyr 100 105 110Arg Glu Thr Gly Met Lys Gly Ala Val Leu Ile Asn Gly Leu Pro Arg 115 120 125Asp Leu Arg Cys Phe Arg Lys Val Ser Cys Tyr Ile Met Gln Asp Asp 130 135 140Met Leu Leu Pro His Leu Thr Val Gln Glu Ala Met Met Val Ser Ala145 150 155 160His Leu Lys Leu Gln Glu Lys Asp Glu Gly Arg Arg Glu Met Val Lys 165 170 175Glu Ile Leu Thr Ala Leu Gly Leu Leu Ser Cys Ala Asn Thr Arg Thr 180 185 190Gly Ser Leu Ser Gly Gly Gln Arg Lys Arg Leu Ala Ile Ala Leu Glu 195 200 205Leu Val Asn Asn Pro Pro Val Met Phe Phe Asp Glu Pro Thr Ser Gly 210 215 220Leu Asp Ser Ala Ser Cys Phe Gln Val Val Ser Leu Met Lys Gly Leu225 230 235 240Ala Gln Gly Gly Arg Ser Ile Ile Cys Thr Ile His Gln Pro Ser Ala 245 250 255Lys Leu Phe Glu Leu Phe Asp Gln Leu Tyr Val Leu Ser Gln Gly Gln 260 265 270Cys Val Tyr Arg Gly Lys Val Cys Asn Leu Val Pro Tyr Leu Arg Asp 275 280 285Leu Gly Leu Asn Cys Pro Thr Tyr His Asn Pro Ala Asp Phe Val Met 290 295 300Glu Val Ala Ser Gly Glu Tyr Gly Asp Gln Asn Ser Arg Leu Val Arg305 310 315 320Ala Val Arg Glu Gly Met Cys Asp Ser Asp His Lys Arg Asp Leu Gly 325 330 335Gly Asp Ala Glu Val Asn Pro Phe Leu Trp His Arg Pro Ser Glu Glu 340 345 350Asp Ser Ser Ser Met Glu Gly Cys His Ser Phe Ser Ala Ser Cys Leu 355 360 365Thr Gln Phe Cys Ile Leu Phe Lys Arg Thr Phe Leu Ser Ile Met Arg 370 375 380Asp Ser Val38530223PRTHomo sapiens 302Leu Thr His Leu Arg Ile Thr Ser His Ile Gly Ile Gly Leu Leu Ile1 5 10 15Gly Leu Leu Tyr Leu Gly Ile 2030312PRTHomo sapiens 303Gly Asn Glu Ala Lys Lys Val Leu Ser Asn Ser Gly1 5 1030423PRTHomo sapiens 304Phe Leu Phe Phe Ser Met Leu Phe Leu Met Phe Ala Ala Leu Met Pro1 5 10 15Thr Val Leu Thr Phe Pro Leu 2030523PRTHomo sapiens 305Glu Met Gly Val Phe Leu Arg Glu His Leu Asn Tyr Trp Tyr Ser Leu1 5 10 15Lys Ala Tyr Tyr Leu Ala Lys 2030623PRTHomo sapiens 306Thr Met Ala Asp Val Pro Phe Gln Ile Met Phe Pro Val Ala Tyr Cys1 5 10 15Ser Ile Val Tyr Trp Met Thr 203076PRTHomo sapiens 307Ser Gln Pro Ser Asp Ala1 530823PRTHomo sapiens 308Val Arg Phe Val Leu Phe Ala Ala Leu Gly Thr Met Thr Ser Leu Val1 5 10 15Ala Gln Ser Leu Gly Leu Leu 203099PRTHomo sapiens 309Ile Gly Ala Ala Ser Thr Ser Leu Gln1 531023PRTHomo sapiens 310Val Ala Thr Phe Val Gly Pro Val Thr Ala Ile Pro Val Leu Leu Phe1 5 10 15Ser Gly Phe Phe Val Ser Phe 2031112PRTHomo sapiens 311Asp Thr Ile Pro Thr Tyr Leu Gln Trp Met Ser Tyr1 5 1031218PRTHomo sapiens 312Ile Ser Tyr Val Arg Tyr Gly Phe Glu Gly Val Ile Leu Ser Ile Tyr1 5 10 15Gly Leu31331PRTHomo sapiens 313Asp Arg Glu Asp Leu His Cys Asp Ile Asp Glu Thr Cys His Phe Gln1 5 10 15Lys Ser Glu Ala Ile Leu Arg Glu Leu Asp Val Glu Asn Ala Lys 20 25 3031423PRTHomo sapiens 314Leu Tyr Leu Asp Phe Ile Val Leu Gly Ile Phe Phe Ile Ser Leu Arg1 5 10 15Leu Ile Ala Tyr Phe Val Leu 203158PRTHomo sapiens 315Arg Tyr Lys Ile Arg Ala Glu Arg1 5316406PRTHomo sapiens 316Met Ile Met Arg Leu Pro Gln Pro His Gly Thr Asn Ala Ser Ser Tyr1 5 10 15Ser Ala Glu Met Thr Glu Pro Lys Ser Val Cys Val Ser Val Asp Glu 20 25 30Val Val Ser Ser Asn Met Glu Ala Thr Glu Thr Asp Leu Leu Asn Gly 35 40 45His Leu Lys Lys Val Asp Asn Asn Leu Thr Glu Ala Gln Arg Phe Ser 50 55 60Ser Leu Pro Arg Arg Ala Ala Val Asn Ile Glu Phe Arg Asp Leu Ser65 70 75 80Tyr Ser Val Pro Glu Gly Pro Trp Trp Arg Lys Lys Gly Tyr Lys Thr 85 90 95Leu Leu

Lys Gly Ile Ser Gly Lys Phe Asn Ser Gly Glu Leu Val Ala 100 105 110Ile Met Gly Pro Ser Gly Ala Gly Lys Ser Thr Leu Met Asn Ile Leu 115 120 125Ala Gly Tyr Arg Glu Thr Gly Met Lys Gly Ala Val Leu Ile Asn Gly 130 135 140Leu Pro Arg Asp Leu Arg Cys Phe Arg Lys Val Ser Cys Tyr Ile Met145 150 155 160Gln Asp Asp Met Leu Leu Pro His Leu Thr Val Gln Glu Ala Met Met 165 170 175Val Ser Ala His Leu Lys Leu Gln Glu Lys Asp Glu Gly Arg Arg Glu 180 185 190Met Val Lys Glu Ile Leu Thr Ala Leu Gly Leu Leu Ser Cys Ala Asn 195 200 205Thr Arg Thr Gly Ser Leu Ser Gly Gly Gln Arg Lys Arg Leu Ala Ile 210 215 220Ala Leu Glu Leu Val Asn Asn Pro Pro Val Met Phe Phe Asp Glu Pro225 230 235 240Thr Ser Gly Leu Asp Ser Ala Ser Cys Phe Gln Val Val Ser Leu Met 245 250 255Lys Gly Leu Ala Gln Gly Gly Arg Ser Ile Ile Cys Thr Ile His Gln 260 265 270Pro Ser Ala Lys Leu Phe Glu Leu Phe Asp Gln Leu Tyr Val Leu Ser 275 280 285Gln Gly Gln Cys Val Tyr Arg Gly Lys Val Cys Asn Leu Val Pro Tyr 290 295 300Leu Arg Asp Leu Gly Leu Asn Cys Pro Thr Tyr His Asn Pro Ala Asp305 310 315 320Phe Val Met Glu Val Ala Ser Gly Glu Tyr Gly Asp Gln Asn Ser Arg 325 330 335Leu Val Arg Ala Val Arg Glu Gly Met Cys Asp Ser Asp His Lys Arg 340 345 350Asp Leu Gly Gly Asp Ala Glu Val Asn Pro Phe Leu Trp His Arg Pro 355 360 365Ser Glu Glu Asp Ser Ser Ser Met Glu Gly Cys His Ser Phe Ser Ala 370 375 380Ser Cys Leu Thr Gln Phe Cys Ile Leu Phe Lys Arg Thr Phe Leu Ser385 390 395 400Ile Met Arg Asp Ser Val 40531723PRTHomo sapiens 317Leu Thr His Leu Arg Ile Thr Ser His Ile Gly Ile Gly Leu Leu Ile1 5 10 15Gly Leu Leu Tyr Leu Gly Ile 2031812PRTHomo sapiens 318Gly Asn Glu Ala Lys Lys Val Leu Ser Asn Ser Gly1 5 1031923PRTHomo sapiens 319Phe Leu Phe Phe Ser Met Leu Phe Leu Met Phe Ala Ala Leu Met Pro1 5 10 15Thr Val Leu Thr Phe Pro Leu 2032023PRTHomo sapiens 320Glu Met Gly Val Phe Leu Arg Glu His Leu Asn Tyr Trp Tyr Ser Leu1 5 10 15Lys Ala Tyr Tyr Leu Ala Lys 2032123PRTHomo sapiens 321Thr Met Ala Asp Val Pro Phe Gln Ile Met Phe Pro Val Ala Tyr Cys1 5 10 15Ser Ile Val Tyr Trp Met Thr 203226PRTHomo sapiens 322Ser Gln Pro Ser Asp Ala1 532323PRTHomo sapiens 323Val Arg Phe Val Leu Phe Ala Ala Leu Gly Thr Met Thr Ser Leu Val1 5 10 15Ala Gln Ser Leu Gly Leu Leu 203249PRTHomo sapiens 324Ile Gly Ala Ala Ser Thr Ser Leu Gln1 532523PRTHomo sapiens 325Val Ala Thr Phe Val Gly Pro Val Thr Ala Ile Pro Val Leu Leu Phe1 5 10 15Ser Gly Phe Phe Val Ser Phe 2032612PRTHomo sapiens 326Asp Thr Ile Pro Thr Tyr Leu Gln Trp Met Ser Tyr1 5 1032718PRTHomo sapiens 327Ile Ser Tyr Val Arg Tyr Gly Phe Glu Gly Val Ile Leu Ser Ile Tyr1 5 10 15Gly Leu32831PRTHomo sapiens 328Asp Arg Glu Asp Leu His Cys Asp Ile Asp Glu Thr Cys His Phe Gln1 5 10 15Lys Ser Glu Ala Ile Leu Arg Glu Leu Asp Val Glu Asn Ala Lys 20 25 3032923PRTHomo sapiens 329Leu Tyr Leu Asp Phe Ile Val Leu Gly Ile Phe Phe Ile Ser Leu Arg1 5 10 15Leu Ile Ala Tyr Phe Val Leu 203308PRTHomo sapiens 330Arg Tyr Lys Ile Arg Ala Glu Arg1 5331567PRTHomo sapiens 331Met Leu Ala Val Gln Gln Thr Glu His Leu Pro Ala Cys Pro Pro Ala1 5 10 15Arg Arg Trp Ser Ser Asn Phe Cys Pro Glu Ser Thr Glu Gly Gly Pro 20 25 30Ser Leu Leu Gly Leu Arg Asp Met Val Arg Arg Gly Trp Ser Val Cys 35 40 45Thr Ala Ile Leu Leu Ala Arg Leu Trp Cys Leu Val Pro Thr His Thr 50 55 60Phe Leu Ser Glu Tyr Pro Glu Ala Ala Glu Tyr Pro His Pro Gly Trp65 70 75 80Val Tyr Trp Leu Gln Met Ala Val Ala Pro Gly His Leu Arg Ala Trp 85 90 95Val Met Arg Asn Asn Val Thr Thr Asn Ile Pro Ser Ala Phe Ser Gly 100 105 110Thr Leu Thr His Glu Glu Lys Ala Val Leu Thr Val Phe Thr Gly Thr 115 120 125Ala Thr Ala Val His Val Gln Val Ala Ala Leu Ala Ser Ala Lys Leu 130 135 140Glu Ser Ser Val Phe Val Thr Asp Cys Val Ser Cys Lys Ile Glu Asn145 150 155 160Val Cys Asp Ser Ala Leu Gln Gly Lys Arg Val Pro Met Ser Gly Leu 165 170 175Gln Gly Ser Ser Ile Val Ile Met Pro Pro Ser Asn Arg Pro Leu Ala 180 185 190Ser Ala Ala Ser Cys Thr Trp Ser Val Gln Val Gln Gly Gly Pro His 195 200 205His Leu Gly Val Val Ala Ile Ser Gly Lys Val Leu Ser Ala Ala His 210 215 220Gly Ala Gly Arg Ala Tyr Gly Trp Gly Phe Pro Gly Asp Pro Met Glu225 230 235 240Glu Gly Tyr Lys Thr Leu Leu Lys Gly Ile Ser Gly Lys Phe Asn Ser 245 250 255Gly Glu Leu Val Ala Ile Met Gly Pro Ser Gly Ala Gly Lys Ser Thr 260 265 270Leu Met Asn Ile Leu Ala Gly Tyr Arg Glu Thr Gly Met Lys Gly Ala 275 280 285Val Leu Ile Asn Gly Leu Pro Arg Asp Leu Arg Cys Phe Arg Lys Val 290 295 300Ser Cys Tyr Ile Met Gln Asp Asp Met Leu Leu Pro His Leu Thr Val305 310 315 320Gln Glu Ala Met Met Val Ser Ala His Leu Lys Leu Gln Glu Lys Asp 325 330 335Glu Gly Arg Arg Glu Met Val Lys Glu Ile Leu Thr Ala Leu Gly Leu 340 345 350Leu Ser Cys Ala Asn Thr Arg Thr Gly Ser Leu Ser Gly Gly Gln Arg 355 360 365Lys Arg Leu Ala Ile Ala Leu Glu Leu Val Asn Asn Pro Pro Val Met 370 375 380Phe Phe Asp Glu Pro Thr Ser Gly Leu Asp Ser Ala Ser Cys Phe Gln385 390 395 400Val Val Ser Leu Met Lys Gly Leu Ala Gln Gly Gly Arg Ser Ile Ile 405 410 415Cys Thr Ile His Gln Pro Ser Ala Lys Leu Phe Glu Leu Phe Asp Gln 420 425 430Leu Tyr Val Leu Ser Gln Gly Gln Cys Val Tyr Arg Gly Lys Val Cys 435 440 445Asn Leu Val Pro Tyr Leu Arg Asp Leu Gly Leu Asn Cys Pro Thr Tyr 450 455 460His Asn Pro Ala Asp Phe Val Met Glu Val Ala Ser Gly Glu Tyr Gly465 470 475 480Asp Gln Asn Ser Arg Leu Val Arg Ala Val Arg Glu Gly Met Cys Asp 485 490 495Ser Asp His Lys Arg Asp Leu Gly Gly Asp Ala Glu Val Asn Pro Phe 500 505 510Leu Trp His Arg Pro Ser Glu Glu Val Lys Gln Thr Lys Arg Leu Lys 515 520 525Gly Leu Arg Lys Asp Ser Ser Ser Met Glu Gly Cys His Ser Phe Ser 530 535 540Ala Ser Cys Leu Thr Gln Phe Cys Ile Leu Phe Lys Arg Thr Phe Leu545 550 555 560Ser Ile Met Arg Asp Ser Val 56533223PRTHomo sapiens 332Leu Thr His Leu Arg Ile Thr Ser His Ile Gly Ile Gly Leu Leu Ile1 5 10 15Gly Leu Leu Tyr Leu Gly Ile 2033312PRTHomo sapiens 333Gly Asn Glu Ala Lys Lys Val Leu Ser Asn Ser Gly1 5 1033423PRTHomo sapiens 334Phe Leu Phe Phe Ser Met Leu Phe Leu Met Phe Ala Ala Leu Met Pro1 5 10 15Thr Val Leu Thr Phe Pro Leu 2033523PRTHomo sapiens 335Glu Met Gly Val Phe Leu Arg Glu His Leu Asn Tyr Trp Tyr Ser Leu1 5 10 15Lys Ala Tyr Tyr Leu Ala Lys 2033623PRTHomo sapiens 336Thr Met Ala Asp Val Pro Phe Gln Ile Met Phe Pro Val Ala Tyr Cys1 5 10 15Ser Ile Val Tyr Trp Met Thr 203376PRTHomo sapiens 337Ser Gln Pro Ser Asp Ala1 533823PRTHomo sapiens 338Val Arg Phe Val Leu Phe Ala Ala Leu Gly Thr Met Thr Ser Leu Val1 5 10 15Ala Gln Ser Leu Gly Leu Leu 203399PRTHomo sapiens 339Ile Gly Ala Ala Ser Thr Ser Leu Gln1 534023PRTHomo sapiens 340Val Ala Thr Phe Val Gly Pro Val Thr Ala Ile Pro Val Leu Leu Phe1 5 10 15Ser Gly Phe Phe Val Ser Phe 2034112PRTHomo sapiens 341Asp Thr Ile Pro Thr Tyr Leu Gln Trp Met Ser Tyr1 5 1034218PRTHomo sapiens 342Ile Ser Tyr Val Arg Tyr Gly Phe Glu Gly Val Ile Leu Ser Ile Tyr1 5 10 15Gly Leu34331PRTHomo sapiens 343Asp Arg Glu Asp Leu His Cys Asp Ile Asp Glu Thr Cys His Phe Gln1 5 10 15Lys Ser Glu Ala Ile Leu Arg Glu Leu Asp Val Glu Asn Ala Lys 20 25 3034423PRTHomo sapiens 344Leu Tyr Leu Asp Phe Ile Val Leu Gly Ile Phe Phe Ile Ser Leu Arg1 5 10 15Leu Ile Ala Tyr Phe Val Leu 203458PRTHomo sapiens 345Arg Tyr Lys Ile Arg Ala Glu Arg1 534690PRTHomo sapiens 346Met Ala Gln Leu Glu Arg Ser Ala Ile Ser Gly Phe Ser Ser Lys Ser1 5 10 15Arg Arg Asn Ser Phe Ala Tyr Asp Val Lys Arg Glu Val Tyr Asn Glu 20 25 30Glu Thr Phe Gln Gln Glu His Lys Arg Lys Ala Ser Ser Ser Gly Asn 35 40 45Met Asn Ile Asn Ile Thr Thr Phe Arg His His Val Gln Cys Arg Cys 50 55 60Ser Trp His Arg Phe Leu Arg Cys Val Leu Thr Ile Phe Pro Phe Leu65 70 75 80Glu Trp Met Cys Met Tyr Arg Leu Lys Asp 85 9034723PRTHomo sapiens 347Trp Leu Leu Gly Asp Leu Leu Ala Gly Ile Ser Val Gly Leu Val Gln1 5 10 15Val Pro Gln Gly Leu Thr Leu 203485PRTHomo sapiens 348Ser Leu Leu Ala Arg1 534923PRTHomo sapiens 349Gln Leu Ile Pro Pro Leu Asn Ile Ala Tyr Ala Ala Phe Cys Ser Ser1 5 10 15Val Ile Tyr Val Ile Phe Gly 203506PRTHomo sapiens 350Ser Cys His Gln Met Ser1 535120PRTHomo sapiens 351Ile Gly Ser Phe Phe Leu Val Ser Ala Leu Leu Ile Asn Val Leu Lys1 5 10 15Val Ser Pro Phe 2035229PRTHomo sapiens 352Asn Asn Gly Gln Leu Val Met Gly Ser Phe Val Lys Asn Glu Phe Ser1 5 10 15Ala Pro Ser Tyr Leu Met Gly Tyr Asn Lys Ser Leu Ser 20 2535323PRTHomo sapiens 353Val Val Ala Thr Thr Thr Phe Leu Thr Gly Ile Ile Gln Leu Ile Met1 5 10 15Gly Val Leu Gly Leu Gly Phe 2035412PRTHomo sapiens 354Ile Ala Thr Tyr Leu Pro Glu Ser Ala Met Ser Ala1 5 1035523PRTHomo sapiens 355Tyr Leu Ala Ala Val Ala Leu His Ile Met Leu Ser Gln Leu Thr Phe1 5 10 15Ile Phe Gly Ile Met Ile Ser 2035614PRTHomo sapiens 356Phe His Ala Gly Pro Ile Ser Phe Phe Tyr Asp Ile Ile Asn1 5 1035723PRTHomo sapiens 357Tyr Cys Val Ala Leu Pro Lys Ala Asn Ser Thr Ser Ile Leu Val Phe1 5 10 15Leu Thr Val Val Val Ala Leu 2035820PRTHomo sapiens 358Arg Ile Asn Lys Cys Ile Arg Ile Ser Phe Asn Gln Tyr Pro Ile Glu1 5 10 15Phe Pro Met Glu 2035918PRTHomo sapiens 359Leu Phe Leu Ile Ile Gly Phe Thr Val Ile Ala Asn Lys Ile Ser Met1 5 10 15Ala Thr36027PRTHomo sapiens 360Glu Thr Ser Gln Thr Leu Ile Asp Met Ile Pro Tyr Ser Phe Leu Leu1 5 10 15Pro Val Thr Pro Asp Phe Ser Leu Leu Pro Lys 20 2536120PRTHomo sapiens 361Ile Ile Leu Gln Ala Phe Ser Leu Ser Leu Val Ser Ser Phe Leu Leu1 5 10 15Ile Phe Leu Gly 2036253PRTHomo sapiens 362Lys Lys Ile Ala Ser Leu His Asn Tyr Ser Val Asn Ser Asn Gln Asp1 5 10 15Leu Ile Ala Ile Gly Leu Cys Asn Val Val Ser Ser Phe Phe Arg Ser 20 25 30Cys Val Phe Thr Gly Ala Ile Ala Arg Thr Ile Ile Gln Asp Lys Ser 35 40 45Gly Gly Arg Gln Gln 5036323PRTHomo sapiens 363Phe Ala Ser Leu Val Gly Ala Gly Val Met Leu Leu Leu Met Val Lys1 5 10 15Met Gly His Phe Phe Tyr Thr 203644PRTHomo sapiens 364Leu Pro Asn Ala136520PRTHomo sapiens 365Val Leu Ala Gly Ile Ile Leu Ser Asn Val Ile Pro Tyr Leu Glu Thr1 5 10 15Ile Ser Asn Leu 2036620PRTHomo sapiens 366Pro Ser Leu Trp Arg Gln Asp Gln Tyr Asp Cys Ala Leu Trp Met Met1 5 10 15Thr Phe Ser Ser 2036723PRTHomo sapiens 367Ser Ile Phe Leu Gly Leu Asp Ile Gly Leu Ile Ile Ser Val Val Ser1 5 10 15Ala Phe Phe Ile Thr Thr Val 20368451PRTHomo sapiens 368Arg Ser His Arg Ala Lys Ile Leu Leu Leu Gly Gln Ile Pro Asn Thr1 5 10 15Asn Ile Tyr Arg Ser Ile Asn Asp Tyr Arg Glu Ile Ile Thr Ile Pro 20 25 30Gly Val Lys Ile Phe Gln Cys Cys Ser Ser Ile Thr Phe Val Asn Val 35 40 45Tyr Tyr Leu Lys His Lys Leu Leu Lys Glu Val Asp Met Val Lys Val 50 55 60Pro Leu Lys Glu Glu Glu Ile Phe Ser Leu Phe Asn Ser Ser Asp Thr65 70 75 80Asn Leu Gln Gly Gly Lys Ile Cys Arg Cys Phe Cys Asn Cys Asp Asp 85 90 95Leu Glu Pro Leu Pro Arg Ile Leu Tyr Thr Glu Arg Phe Glu Asn Lys 100 105 110Leu Asp Pro Glu Ala Ser Ser Ile Asn Leu Ile His Cys Ser His Phe 115 120 125Glu Ser Met Asn Thr Ser Gln Thr Ala Ser Glu Asp Gln Val Pro Tyr 130 135 140Thr Val Ser Ser Val Ser Gln Lys Asn Gln Gly Gln Gln Tyr Glu Glu145 150 155 160Val Glu Glu Val Trp Leu Pro Asn Asn Ser Ser Arg Asn Ser Ser Pro 165 170 175Gly Leu Pro Asp Val Ala Glu Ser Gln Gly Arg Arg Ser Leu Ile Pro 180 185 190Tyr Ser Asp Ala Ser Leu Leu Pro Ser Val His Thr Ile Ile Leu Asp 195 200 205Phe Ser Met Val His Tyr Val Asp Ser Arg Gly Leu Val Val Leu Arg 210 215 220Gln Ile Cys Asn Ala Phe Gln Asn Ala Asn Ile Leu Ile Leu Ile Ala225 230 235 240Gly Cys His Ser Ser Ile Val Arg Ala Phe Glu Arg Asn Asp Phe Phe 245 250 255Asp Ala Gly Ile Thr Lys Thr Gln Leu Phe Leu Ser Val His Asp Ala 260 265 270Val Leu Phe Ala Leu Ser Arg Lys Val Ile Gly Ser Ser Glu Leu Ser 275 280 285Ile Asp Glu Ser Glu Thr Val Ile Arg Glu Thr Tyr Ser Glu Thr Asp 290 295 300Lys Asn Asp Asn Ser Arg Tyr Lys Met Ser Ser Ser Phe Leu Gly Ser305 310 315 320Gln Lys Asn Val Ser Pro Gly Phe Ile Lys Ile Gln Gln Pro Val Glu 325 330 335Glu Glu Ser Glu Leu Asp Leu Glu Leu Glu Ser Glu Gln Glu Ala Gly 340 345 350Leu Gly Leu Asp Leu Asp Leu Asp Arg Glu Leu Glu Pro Glu Met Glu 355 360 365Pro Lys Ala Glu Thr Glu Thr Lys Thr Gln Thr Glu Met Glu Pro Gln 370 375 380Pro Glu Thr Glu Pro Glu Met Glu Pro Asn Pro Lys Ser Arg Pro Arg385 390 395 400Ala His Thr Phe Pro Gln Gln Arg Tyr Trp Pro Met Tyr His Pro Ser 405 410 415Met Ala Ser Thr Gln Ser Gln Thr Gln Thr Arg Thr Trp Ser Val Glu 420 425 430Arg Arg Arg His Pro

Met Asp Ser Tyr Ser Pro Glu Gly Asn Ser Asn 435 440 445Glu Asp Val 45036957PRTHomo sapiens 369Met Asn Pro Phe Gln Lys Asn Glu Ser Lys Glu Thr Leu Phe Ser Pro1 5 10 15Val Ser Ile Glu Glu Val Pro Pro Arg Pro Pro Ser Pro Pro Lys Lys 20 25 30Pro Ser Pro Thr Ile Cys Gly Ser Asn Tyr Pro Leu Ser Ile Ala Phe 35 40 45Ile Val Val Asn Glu Phe Cys Glu Arg 50 5537018PRTHomo sapiens 370Phe Ser Tyr Tyr Gly Met Lys Ala Val Leu Ile Leu Tyr Phe Leu Tyr1 5 10 15Phe Leu3719PRTHomo sapiens 371His Trp Asn Glu Asp Thr Ser Thr Ser1 537223PRTHomo sapiens 372Ile Tyr His Ala Phe Ser Ser Leu Cys Tyr Phe Thr Pro Ile Leu Gly1 5 10 15Ala Ala Ile Ala Asp Ser Trp 203736PRTHomo sapiens 373Leu Gly Lys Phe Lys Thr1 537423PRTHomo sapiens 374Ile Ile Tyr Leu Ser Leu Val Tyr Val Leu Gly His Val Ile Lys Ser1 5 10 15Leu Gly Ala Leu Pro Ile Leu 203753PRTHomo sapiens 375Gly Gly Gln137623PRTHomo sapiens 376Val Val His Thr Val Leu Ser Leu Ile Gly Leu Ser Leu Ile Ala Leu1 5 10 15Gly Thr Gly Gly Ile Lys Pro 2037720PRTHomo sapiens 377Cys Val Ala Ala Phe Gly Gly Asp Gln Phe Glu Glu Lys His Ala Glu1 5 10 15Glu Arg Thr Arg 2037820PRTHomo sapiens 378Tyr Phe Ser Val Phe Tyr Leu Ser Ile Asn Ala Gly Ser Leu Ile Ser1 5 10 15Thr Phe Ile Thr 2037914PRTHomo sapiens 379Pro Met Leu Arg Gly Asp Val Gln Cys Phe Gly Glu Asp Cys1 5 1038020PRTHomo sapiens 380Tyr Ala Leu Ala Phe Gly Val Pro Gly Leu Leu Met Val Ile Ala Leu1 5 10 15Val Val Phe Ala 2038161PRTHomo sapiens 381Met Gly Ser Lys Ile Tyr Asn Lys Pro Pro Pro Glu Gly Asn Ile Val1 5 10 15Ala Gln Val Phe Lys Cys Ile Trp Phe Ala Ile Ser Asn Arg Phe Lys 20 25 30Asn Arg Ser Gly Asp Ile Pro Lys Arg Gln His Trp Leu Asp Trp Ala 35 40 45Ala Glu Lys Tyr Pro Lys Gln Leu Ile Met Asp Val Lys 50 55 6038219PRTHomo sapiens 382Ala Leu Thr Arg Val Leu Phe Leu Tyr Ile Pro Leu Pro Met Phe Trp1 5 10 15Ala Leu Leu38329PRTHomo sapiens 383Asp Gln Gln Gly Ser Arg Trp Thr Leu Gln Ala Ile Arg Met Asn Arg1 5 10 15Asn Leu Gly Phe Phe Val Leu Gln Pro Asp Gln Met Gln 20 2538423PRTHomo sapiens 384Val Leu Asn Pro Leu Leu Val Leu Ile Phe Ile Pro Leu Phe Asp Phe1 5 10 15Val Ile Tyr Arg Leu Val Ser 2038511PRTHomo sapiens 385Lys Cys Gly Ile Asn Phe Ser Ser Leu Arg Lys1 5 1038618PRTHomo sapiens 386Met Ala Val Gly Met Ile Leu Ala Cys Leu Ala Phe Ala Val Ala Ala1 5 10 15Ala Val387250PRTHomo sapiens 387Glu Ile Lys Ile Asn Glu Met Ala Pro Ala Gln Pro Gly Pro Gln Glu1 5 10 15Val Phe Leu Gln Val Leu Asn Leu Ala Asp Asp Glu Val Lys Val Thr 20 25 30Val Val Gly Asn Glu Asn Asn Ser Leu Leu Ile Glu Ser Ile Lys Ser 35 40 45Phe Gln Lys Thr Pro His Tyr Ser Lys Leu His Leu Lys Thr Lys Ser 50 55 60Gln Asp Phe His Phe His Leu Lys Tyr His Asn Leu Ser Leu Tyr Thr65 70 75 80Glu His Ser Val Gln Glu Lys Asn Trp Tyr Ser Leu Val Ile Arg Glu 85 90 95Asp Gly Asn Ser Ile Ser Ser Met Met Val Lys Asp Thr Glu Ser Arg 100 105 110Thr Thr Asn Gly Met Thr Thr Val Arg Phe Val Asn Thr Leu His Lys 115 120 125Asp Val Asn Ile Ser Leu Ser Thr Asp Thr Ser Leu Asn Val Gly Glu 130 135 140Asp Tyr Gly Val Ser Ala Tyr Arg Thr Val Gln Arg Gly Glu Tyr Pro145 150 155 160Ala Val His Cys Arg Thr Glu Asp Lys Asn Phe Ser Leu Asn Leu Gly 165 170 175Leu Leu Asp Phe Gly Ala Ala Tyr Leu Phe Val Ile Thr Asn Asn Thr 180 185 190Asn Gln Gly Leu Gln Ala Trp Lys Ile Glu Asp Ile Pro Ala Asn Lys 195 200 205Met Ser Ile Ala Trp Gln Leu Pro Gln Tyr Ala Leu Val Thr Ala Gly 210 215 220Glu Val Met Phe Ser Val Thr Gly Leu Glu Phe Ser Tyr Ser Gln Ala225 230 235 240Pro Ser Gly Met Lys Ser Val Leu Gln Ala 245 25038823PRTHomo sapiens 388Ala Trp Leu Leu Thr Ile Ala Val Gly Asn Ile Ile Val Leu Val Val1 5 10 15Ala Gln Phe Ser Gly Leu Val 203894PRTHomo sapiens 389Gln Trp Ala Glu139023PRTHomo sapiens 390Phe Ile Leu Phe Ser Cys Leu Leu Leu Val Ile Cys Leu Ile Phe Ser1 5 10 15Ile Met Gly Tyr Tyr Tyr Val 2039132PRTHomo sapiens 391Pro Val Lys Thr Glu Asp Met Arg Gly Pro Ala Asp Lys His Ile Pro1 5 10 15His Ile Gln Gly Asn Met Ile Lys Leu Glu Thr Lys Lys Thr Lys Leu 20 25 3039219DNAArtificial SequenceSynthetic oligonucleotide 392ataagcggtt atcactgcc 1939319DNAArtificial SequenceSynthetic oligonucleotide 393gctgggattc caagtggac 1939419DNAArtificial SequenceSynthetic oligonucleotide 394aactgtgcag ggcctctcc 1939519DNAArtificial SequenceSynthetic oligonucleotide 395gctgctggat gtcattcac 1939619DNAArtificial SequenceSynthetic oligonucleotide 396agagacacag tgcccatcc 1939719DNAArtificial SequenceSynthetic oligonucleotide 397actgaacctc cgaaatgcc 1939819DNAArtificial SequenceSynthetic oligonucleotide 398gtgctggagt gcttccatc 1939919DNAArtificial SequenceSynthetic oligonucleotide 399ttcagaccta ccttcagtc 1940019DNAArtificial SequenceSynthetic oligonucleotide 400gagtcacaca gagatgagc 1940119DNAArtificial SequenceSynthetic oligonucleotide 401cgatgtgcct tcaagattc 1940219DNAArtificial SequenceSynthetic oligonucleotide 402cagtggtttg ggaatctgc 1940319DNAArtificial SequenceSynthetic oligonucleotide 403gtgactacac aaggactcc 1940419DNAArtificial SequenceSynthetic oligonucleotide 404gactgattcg ctctttgcc 1940519DNAArtificial SequenceSynthetic oligonucleotide 405agtgcagcct tgtgggttc 1940619DNAArtificial SequenceSynthetic oligonucleotide 406taacactcac tgcacctgc 1940719DNAArtificial SequenceSynthetic oligonucleotide 407taactgaaac tcagctagc 1940819DNAArtificial SequenceSynthetic oligonucleotide 408actgaagtag ccctccttc 1940919DNAArtificial SequenceSynthetic oligonucleotide 409agtgcagtac agcgatgac 1941019DNAArtificial SequenceSynthetic oligonucleotide 410ttcacatcgc tgagcaccc 1941119DNAArtificial SequenceSynthetic oligonucleotide 411agccagcaac gacatgtac 1941219DNAArtificial SequenceSynthetic oligonucleotide 412gctgctgggc atgtccttc 1941319DNAArtificial SequenceSynthetic oligonucleotide 413tgtgatcgtc atcacagtc 1941419DNAArtificial SequenceSynthetic oligonucleotide 414aacatgatat gtgctggac 1941519DNAArtificial SequenceSynthetic oligonucleotide 415ctgagaaggc ttccactgc 1941619DNAArtificial SequenceSynthetic oligonucleotide 416tgatacgtgg atccaggcc 1941719DNAArtificial SequenceSynthetic oligonucleotide 417ctacagtgac aaggctaac 1941819DNAArtificial SequenceSynthetic oligonucleotide 418gaactggata gccctcatc 1941919DNAArtificial SequenceSynthetic oligonucleotide 419ccctggtaaa gctgcattc 1942019DNAArtificial SequenceSynthetic oligonucleotide 420gatgaaggct tcgggcttc 1942119DNAArtificial SequenceSynthetic oligonucleotide 421tgtaaagctg gaaagggac 1942219DNAArtificial SequenceSynthetic oligonucleotide 422ctgaagaagc tggagttgc 1942319DNAArtificial SequenceSynthetic oligonucleotide 423tccttgcagc aggcacatc 1942419DNAArtificial SequenceSynthetic oligonucleotide 424tctgtgcgtg gactggaac 1942519DNAArtificial SequenceSynthetic oligonucleotide 425ctttgctcgg aagacgttc 1942619DNAArtificial SequenceSynthetic oligonucleotide 426gaaggctttg gaaagtgtc 1942719DNAArtificial SequenceSynthetic oligonucleotide 427gtgaactctg ctgcgactc 1942819DNAArtificial SequenceSynthetic oligonucleotide 428gacaaggcta tgatgctgc 1942919DNAArtificial SequenceSynthetic oligonucleotide 429ggatgtgtgg tgctgtcac 1943019DNAArtificial SequenceSynthetic oligonucleotide 430ctctgtgttc cacttcggc 1943119DNAArtificial SequenceSynthetic oligonucleotide 431cagcaatgca gagtgtgac 1943219DNAArtificial SequenceSynthetic oligonucleotide 432caaagctggc tactactac 1943319DNAArtificial SequenceSynthetic oligonucleotide 433cagtgcaaag agcccaaac 1943419DNAArtificial SequenceSynthetic oligonucleotide 434gtattctgta caccctggc 1943519DNAArtificial SequenceSynthetic oligonucleotide 435gtgatcgaca ggattgctc 1943619DNAArtificial SequenceSynthetic oligonucleotide 436cacagtgaaa ccttcctgc 1943719DNAArtificial SequenceSynthetic oligonucleotide 437atctgtgaca ctggatcgc 1943819DNAArtificial SequenceSynthetic oligonucleotide 438agagactgga gttgtcagc 1943919DNAArtificial SequenceSynthetic oligonucleotide 439cctgagttga atgtcatac 1944019DNAArtificial SequenceSynthetic oligonucleotide 440ctgaactagt gactatccc 1944119DNAArtificial SequenceSynthetic oligonucleotide 441ataagcaccg tgagcgacc 1944219DNAArtificial SequenceSynthetic oligonucleotide 442cattgggcca cagacctac 1944319DNAArtificial SequenceSynthetic oligonucleotide 443gatgaagaca gcaaccaac 1944419DNAArtificial SequenceSynthetic oligonucleotide 444agcatatgat gaccttggc 1944519DNAArtificial SequenceSynthetic oligonucleotide 445attccactac tacagctgc 1944619DNAArtificial SequenceSynthetic oligonucleotide 446gaaactgtgg caggctaac 1944719DNAArtificial SequenceSynthetic oligonucleotide 447ctgatgaagg ccttcgacc 1944819DNAArtificial SequenceSynthetic oligonucleotide 448ttgaaacaag aggaagtcc 1944919DNAArtificial SequenceSynthetic oligonucleotide 449tgaacttgct ctgagctgc 1945019DNAArtificial SequenceSynthetic oligonucleotide 450atctgtaacc tcagcacac 1945119DNAArtificial SequenceSynthetic oligonucleotide 451gaagctaagc ctcggttac 1945219DNAArtificial SequenceSynthetic oligonucleotide 452taaccgtggc atctacctc 1945319DNAArtificial SequenceSynthetic oligonucleotide 453tgaccacctg gagtatcac 1945419DNAArtificial SequenceSynthetic oligonucleotide 454gtggacatct ttgagcttc 1945519DNAArtificial SequenceSynthetic oligonucleotide 455gctgagaagt acttccacc 1945619DNAArtificial SequenceSynthetic oligonucleotide 456agactactgc aagggcggc 1945719DNAArtificial SequenceSynthetic oligonucleotide 457gagtatttgc tggcattcc 1945819DNAArtificial SequenceSynthetic oligonucleotide 458ggagacacgg aataaactc 1945919DNAArtificial SequenceSynthetic oligonucleotide 459ccgagaccac ctcaatgtc 1946019DNAArtificial SequenceSynthetic oligonucleotide 460atggacatct ccacgggac 1946119DNAArtificial SequenceSynthetic oligonucleotide 461tatcctgacc ttcctgcgc 1946219DNAArtificial SequenceSynthetic oligonucleotide 462cacatgatca agctaggtc 1946319DNAArtificial SequenceSynthetic oligonucleotide 463gaagccaggc atcttcatc 1946419DNAArtificial SequenceSynthetic oligonucleotide 464gctgaagtta tccagtctc 1946519DNAArtificial SequenceSynthetic oligonucleotide 465agcattggac cagttgatc 1946619DNAArtificial SequenceSynthetic oligonucleotide 466gtgatctacg tgaactggc 1946719DNAArtificial SequenceSynthetic oligonucleotide 467gccgacagtg gtgcactac 1946819DNAArtificial SequenceSynthetic oligonucleotide 468aacatgatgg ctcagaacc 1946919DNAArtificial SequenceSynthetic oligonucleotide 469tacagtgatg gatcatagc 1947019DNAArtificial SequenceSynthetic oligonucleotide 470accaatatgc ctaccttcc 1947119DNAArtificial SequenceSynthetic oligonucleotide 471actgtatccc agcagtccc 1947219DNAArtificial SequenceSynthetic oligonucleotide 472aagctgaaca taaccttgc 1947319DNAArtificial SequenceSynthetic oligonucleotide 473ttgaatagct cggtgtccc 1947419DNAArtificial SequenceSynthetic oligonucleotide 474gtggaaggca agatcttcc 1947519DNAArtificial SequenceSynthetic oligonucleotide 475tgtatggctg gtcgatcac 1947619DNAArtificial SequenceSynthetic oligonucleotide 476gctgcgacaa cttctgttc

1947719DNAArtificial SequenceSynthetic oligonucleotide 477gcccacggtc ttccactac 1947819DNAArtificial SequenceSynthetic oligonucleotide 478gactgaatca ggccttccc 194792196DNAhomo sapiens 479ccggcatttg cgtttggggc gccctccctg cgccgggggc gggagcccag cgagcgcaga 60gccccggccc cgcgcggccc gagtgccaca tcactgcgct ggccgtccaa ggtccgccgc 120cccaccatgc cgcccccgcc gccgctgctg ctccttacag tcctggtcgt cgccgctgcc 180cggccggggt gcgagtttga gcggaacccc gccgccacct gcgtggacct gcagctcagg 240acctgcagcg atgccgccta caaccacacc accttcccca acctgcttca gcaccggtcg 300tgggaggtgg tggaggccag ctccgagtac atcctgctga gcgttctaca ccagctcctg 360gaaggccagt gcaacccgga cctgcggctg ctgggctgtg ctgtgctggc cccccggtgt 420gagggcggct gggtgcgcag accctgccgg cacatctgcg agggcctgcg ggaggtctgc 480cagcccgcct tcgacgccat tgacatggcc tggccctact tccttgactg ccaccgctac 540ttcacgagag aggacgaggg ctgctatgac ccgctggaga agcttcgggg aggcctggag 600gctgacgagg cactgccctc agggctgccg cccaccttca tccgcttcag ccaccactcc 660tacgcccaga tggtgcgtgt gctgaggcgg acggcctccc gctgcgccca cgtggccagg 720acctacagca tcgggcgcag cttcgacggc agggagctgc tggtcatcga gttctccagc 780cgccccggcc agcacgagct gatggagccc gaggtgaagc tcatcggcaa cattcatggc 840aacgaggtgg cgggccggga gatgctcatc tacctagccc agtacctgtg ctctgagtac 900ctgcttggta acccccgcat ccagcgcctg ctcaacacca cccgcatcca cctgctgccc 960tccatgaacc ctgacggcta tgaggtggca gctgccgagg gtgccggcta caacgggtgg 1020acgagcggga ggcagaacgc gcagaacctg gatctgaacc gaaatttccc ggacctgacg 1080tccgagtact accggctggc ggagacccgc ggcgcacgca gcgaccacat ccccatcccc 1140cagcactact ggtggggtaa ggtggccccg gagacaaagg caatcatgaa gtggatgcag 1200accataccct ttgtgctctc agccagcctt catgggggcg acctggtggt gtcctacccc 1260ttcgacttct ccaagcaccc ccaggaggag aagatgtttt ctcccacgcc cgacgagaag 1320atgttcaagc tgctgtccag agcctacgct gacgtccacc ccatgatgat ggacaggtcg 1380gagaataggt gtggaggcaa tttcctgaag agggggagca tcatcaacgg ggcggactgg 1440tacagcttca cgggaggcat gtccgatttc aactacctgc acaccaactg ctttgagatc 1500acggtagagc tgggctgtgt gaagttcccc cccgaggagg ccctgtacac actctggcag 1560cacaacaagg agtcactcct gaatttcgtg gagacggtgc accggggcat caaaggtgtg 1620gtgacagata aattcggcaa gccagtcaaa aacgcccgga tctcagtcaa aggcattcgc 1680cacgacatca ccacagcccc agatggtgac tactggagac tgctgccccc aggtatccac 1740attgtcattg cccaagcccc tggctacgcc aaagtcatca agaaagtcat catccccgcc 1800cggatgaaga gggctggccg tgtggacttc attctgcaac ctctggggat gggacccaag 1860aactttattc atgggctgcg gaggactggg ccccacgacc cgctgggagg tgccagctct 1920ttgggggagg ccacggagcc cgacccgctc cgggcgcgca ggcagccctc ggccgacggg 1980agtaagccct ggtggtggtc ctacttcaca tcgctgagca cccacaggcc acgctggctg 2040ctcaagtact agccccggcc ccagcacccg ccaggatgtg gagaccgagg cccatctccg 2100catcccgggc tcctggctct tgattttgtc tgccacagac atcccacaaa gccgctgcca 2160ttttattaaa gtgttttgat ccactttcca ctggaa 2196480641PRThomo sapiens 480Met Pro Pro Pro Pro Pro Leu Leu Leu Leu Thr Val Leu Val Val Ala1 5 10 15Ala Ala Arg Pro Gly Cys Glu Phe Glu Arg Asn Pro Ala Ala Thr Cys 20 25 30Val Asp Leu Gln Leu Arg Thr Cys Ser Asp Ala Ala Tyr Asn His Thr 35 40 45Thr Phe Pro Asn Leu Leu Gln His Arg Ser Trp Glu Val Val Glu Ala 50 55 60Ser Ser Glu Tyr Ile Leu Leu Ser Val Leu His Gln Leu Leu Glu Gly65 70 75 80Gln Cys Asn Pro Asp Leu Arg Leu Leu Gly Cys Ala Val Leu Ala Pro 85 90 95Arg Cys Glu Gly Gly Trp Val Arg Arg Pro Cys Arg His Ile Cys Glu 100 105 110Gly Leu Arg Glu Val Cys Gln Pro Ala Phe Asp Ala Ile Asp Met Ala 115 120 125Trp Pro Tyr Phe Leu Asp Cys His Arg Tyr Phe Thr Arg Glu Asp Glu 130 135 140Gly Cys Tyr Asp Pro Leu Glu Lys Leu Arg Gly Gly Leu Glu Ala Asp145 150 155 160Glu Ala Leu Pro Ser Gly Leu Pro Pro Thr Phe Ile Arg Phe Ser His 165 170 175His Ser Tyr Ala Gln Met Val Arg Val Leu Arg Arg Thr Ala Ser Arg 180 185 190Cys Ala His Val Ala Arg Thr Tyr Ser Ile Gly Arg Ser Phe Asp Gly 195 200 205Arg Glu Leu Leu Val Ile Glu Phe Ser Ser Arg Pro Gly Gln His Glu 210 215 220Leu Met Glu Pro Glu Val Lys Leu Ile Gly Asn Ile His Gly Asn Glu225 230 235 240Val Ala Gly Arg Glu Met Leu Ile Tyr Leu Ala Gln Tyr Leu Cys Ser 245 250 255Glu Tyr Leu Leu Gly Asn Pro Arg Ile Gln Arg Leu Leu Asn Thr Thr 260 265 270Arg Ile His Leu Leu Pro Ser Met Asn Pro Asp Gly Tyr Glu Val Ala 275 280 285Ala Ala Glu Gly Ala Gly Tyr Asn Gly Trp Thr Ser Gly Arg Gln Asn 290 295 300Ala Gln Asn Leu Asp Leu Asn Arg Asn Phe Pro Asp Leu Thr Ser Glu305 310 315 320Tyr Tyr Arg Leu Ala Glu Thr Arg Gly Ala Arg Ser Asp His Ile Pro 325 330 335Ile Pro Gln His Tyr Trp Trp Gly Lys Val Ala Pro Glu Thr Lys Ala 340 345 350Ile Met Lys Trp Met Gln Thr Ile Pro Phe Val Leu Ser Ala Ser Leu 355 360 365His Gly Gly Asp Leu Val Val Ser Tyr Pro Phe Asp Phe Ser Lys His 370 375 380Pro Gln Glu Glu Lys Met Phe Ser Pro Thr Pro Asp Glu Lys Met Phe385 390 395 400Lys Leu Leu Ser Arg Ala Tyr Ala Asp Val His Pro Met Met Met Asp 405 410 415Arg Ser Glu Asn Arg Cys Gly Gly Asn Phe Leu Lys Arg Gly Ser Ile 420 425 430Ile Asn Gly Ala Asp Trp Tyr Ser Phe Thr Gly Gly Met Ser Asp Phe 435 440 445Asn Tyr Leu His Thr Asn Cys Phe Glu Ile Thr Val Glu Leu Gly Cys 450 455 460Val Lys Phe Pro Pro Glu Glu Ala Leu Tyr Thr Leu Trp Gln His Asn465 470 475 480Lys Glu Ser Leu Leu Asn Phe Val Glu Thr Val His Arg Gly Ile Lys 485 490 495Gly Val Val Thr Asp Lys Phe Gly Lys Pro Val Lys Asn Ala Arg Ile 500 505 510Ser Val Lys Gly Ile Arg His Asp Ile Thr Thr Ala Pro Asp Gly Asp 515 520 525Tyr Trp Arg Leu Leu Pro Pro Gly Ile His Ile Val Ile Ala Gln Ala 530 535 540Pro Gly Tyr Ala Lys Val Ile Lys Lys Val Ile Ile Pro Ala Arg Met545 550 555 560Lys Arg Ala Gly Arg Val Asp Phe Ile Leu Gln Pro Leu Gly Met Gly 565 570 575Pro Lys Asn Phe Ile His Gly Leu Arg Arg Thr Gly Pro His Asp Pro 580 585 590Leu Gly Gly Ala Ser Ser Leu Gly Glu Ala Thr Glu Pro Asp Pro Leu 595 600 605Arg Ala Arg Arg Gln Pro Ser Ala Asp Gly Ser Lys Pro Trp Trp Trp 610 615 620Ser Tyr Phe Thr Ser Leu Ser Thr His Arg Pro Arg Trp Leu Leu Lys625 630 635 640Tyr

Claims

1-32. (canceled)

33. A method for identifying a compound that induces chondrocyte anabolic stimulation, comprising (a) contacting a compound with a polypeptide comprising an amino acid sequence of SEQ ID NO: 480, in an in vitro cell-free preparation; (b) measuring the binding affinity of said compound to said polypeptide; and (c) selecting a compound for confirmation as an inducer of chondrocyte anabolic stimulation, which compound is selected based on its binding affinity for the polypeptide of SEQ ID NO. 480.

34. A method according to claim 33 for identifying a compound that induces chondrocyte anabolic stimulation in a mammalian cell, said method further comprising (d) contacting said compound selected to have binding affinity to, and capable of forming a complex with, said polypeptide of SEQ ID NO: 480 with a mammalian cell, which expresses a protein that is a normal constituent of cartilage and/or that is required for the formation of cartilage, which is in culture, and in which said polypeptide comprising the amino acid sequence of SEQ ID NO: 480 is expressed; and (e) measuring in said culture levels of at least protein that is a normal constituent of cartilage and/or that is required for the formation of cartilage; and (f) determining if said levels of said protein which is a normal constituent of cartilage and/or which is required for the formation of cartilage, are increased as compared to levels of said one or more protein in said mammalian cell that is not contacted with said compound; and (f) selecting a compound, based on its increase in level of said protein, for confirmation as an inducer of chondrocyte anabolic stimulation in a mammalian cell.

35. A method according to claim 34, wherein said one or more protein that is a normal constituent of cartilage and/or that is required for the formation of cartilage is a protein selected from the group consisting of collagen type II, alpha-1 (col2.alpha.1) and aggrecan.

36. The method according to claim 34 wherein said compound having binding affinity to, and capable of forming a complex with, said polypeptide of SEQ ID NO: 480 exhibits a binding affinity of at least 10 micromolar.

37. The method according to claim 34, wherein said mammalian cell are a mixture of chondrocytes and de-differentiated chondrocytes.

38. An agent for inducing the anabolic stimulation of chondrocytes, wherein said agent consists of (1) a targeting nucleic acid sequence consisting of a sequence that is complementary to at least about 17 nucleotides of the polyribonucleotide sequence of SEQ ID NO: 479, and (2) one or more other nucleic acid sequences that are not complementary to said nucleic acid sequence.

39. A vector comprising the agent according to claim 38, wherein said vector is capable of expressing said agent in a mammalian cell.

40. The vector according to claim 38, which is an adenoviral, retroviral, adeno-associated viral, lentiviral, a herpes simplex viral or a sendaiviral vector.

41. The agent according to claim 38, wherein a first sequence of said other nucleic acid sequences that are not complementary to said nucleic acid sequence in said undifferentiated mammalian cells is complementary to said targeting nucleotide sequence.

42. The agent according to claim 41, wherein a second sequence of said other nucleic acid sequences that are not complementary to said nucleic acid sequence in said undifferentiated mammalian cells consists of a loop region connecting said targeting nucleotide sequence and said first sequence of other nucleic acid sequences complementary to said targeting nucleic acid sequence.

43. The agent according to claim 42, wherein said loop region comprises a nucleic acid sequence of SEQ ID NO: 83.

44. A chondrocyte anabolic stimulation enhancing pharmaceutical composition comprising a therapeutically effective amount of an agent of claim 41 in admixture with a pharmaceutically acceptable carrier.

45. A method of treating and/or preventing a disease involving a systemic or local decrease in cartilage in a subject suffering from or susceptible to the disease, comprising administering to said subject a pharmaceutical composition according to claim 44.

46. A method according to claim 45, wherein said agent is administered locally to the site of treatment of said patient.

47. The method according to claim 45 wherein the disease is selected from the group consisting of osteoarthritis, rheumatoid arthritis, psoriatic arthritis, juvenile rheumatoid arthritis, gouty arthritis, septic or infectious arthritis, reactive arthritis, reflex sympathetic dystrophy, algodystrophy, Tietze syndrome or costal chondritis, fibromyalgia, osteochondritis, neurogenic or neuropathic arthritis, arthropathy, osteoarthritis deformans endemica, Mseleni disease, Handigodu disease, degeneration resulting from fibromyalgia, systemic lupus erythematosus, scleroderma, ankylosing spondylitis, hereditary chondrolysis, chondrodysplasias, pseudoachondrodysplasias, microtia, anotia, and metaphyseal chondrodysplasia.

48. The method according to claim 47, wherein the disease is osteoarthritis.

49. A method for in vitro production of cartilage tissue, comprising the steps of contacting de-differentiated chondrocyte cells with an effective amount of agent according to claim 41, for a time sufficient to re-differentiate the chondrocytes, thereby producing a cartilaginous matrix.

50. The method according to claim 49, comprising the steps of: applying a mixture of chondrocytes and de-differentiated chondrocytes on a substrate to form a cellular substrate, and contacting said cells with an effective amount of said agent, thereby producing a continuous cartilaginous matrix.

51. A method for diagnosing a pathological condition involving a systemic or local decrease in mean cartilage thickness or a susceptibility to the condition in a subject, comprising determining the amount of polypeptide comprising an amino acid sequence of SEQ ID NO: 480 in a biological sample obtained from said subject, and comparing said first amount with the ranges of amounts of the polypeptide determined in a population of healthy subjects, wherein an increase of the amount of polypeptide in said biological sample compared to the range of amounts determined for healthy subjects is indicative of the presence of the pathological condition.

52. A method for diagnosing a pathological condition involving chondrocyte de-differentiation, said method comprising the steps of: determining the nucleic acid sequence of the gene coding for the protein of SEQ. ID NO. 480 in a genomic DNA sample; comparing the sequence from step (a) with the nucleic acid sequence of a healthy subject; and identifying any difference(s) related to the pathological condition.

53. Method according to claim 51, wherein the pathological condition is osteoarthritis.