Metabolic Engineering Of Arabinose-fermenting Yeast Cells

Abstract

The invention relates to an eukaryotic cell expressing nucleotide sequences encoding the ara A, ara B and ara D enzymes whereby the expression of these nucleotide sequences confers on the cell the ability to use L-arabinose and/or convert L-arabinose into L-ribulose, and/or xylulose 5-phosphate and/or into a desired fermentation product such as ethanol. Optionally, the eukaryotic cell is also able to convert xylose into ethanol.

Description

FIELD OF THE INVENTION

[0001] The invention relates to an eukaryotic cell having the ability to use L-arabinose and/or to convert L-arabinose into L-ribulose, and/or xylulose 5-phosphate and/or into a desired fermentation product and to a process for producing a fermentation product wherein this cell is used.

BACKGROUND OF THE INVENTION

[0002] Fuel ethanol is acknowledged as a valuable alternative to fossil fuels. Economically viable ethanol production from the hemicellulose fraction of plant biomass requires the simultaneous fermentative conversion of both pentoses and hexoses at comparable rates and with high yields. Yeasts, in particular Saccharomyces spp., are the most appropriate candidates for this process since they can grow and ferment fast on hexoses, both aerobically and anaerobically. Furthermore they are much more resistant to the toxic environment of lignocellulose hydrolysates than (genetically modified) bacteria.

[0003] EP 1 499 708 describes a process for making S. cerevisiae strains able to produce ethanol from L-arabinose. These strains were modified by introducing the araA (L-arabinose isomerase) gene from Bacillus subtilis, the araB (L-ribulokinase) and araD (L-ribulose-5-P4-epimerase) genes from Escherichia coli. Furthermore, these strains were either carrying additional mutations in their genome or overexpressing a TAL1 (transaldolase) gene. However, these strains have several drawbacks. They ferment arabinose in oxygen limited conditions. In addition, they have a low ethanol production rate of 0.05 gg.sup.-1h.sup.-1 (Becker and Boles, 2003). Furthermore, these strains are not able to use L-arabinose under anaerobic conditions. Finally, these S. cerevisiae strains have a wild type background, therefore they can not be used to co-ferment several C5 sugars.

[0004] WO 03/062430 and WO 06/009434 disclose yeast strains able to convert xylose into ethanol. These yeast strains are able to directly isomerise xylose into xylulose.

[0005] Still, there is a need for alternative strains for producing ethanol, which perform better and are more robust and resistant to relatively harsh production conditions.

DESCRIPTION OF THE FIGURES

[0006] FIG. 1. Plasmid maps of pRW231 and pRW243.

[0007] FIG. 2. Growth pattern of shake flask cultivations of strain RWB219 (.largecircle.) and IMS0001 ( ) in synthetic medium containing 0.5% galactose (A) and 0.1% galactose +2% L-arabinose (B). Cultures were grown for 72 hours in synthetic medium with galactose (A) and then transferred to synthetic medium with galactose and arabinose (B). Growth was determined by measuring the OD.sub.660.

[0008] FIG. 3. Growth rate during serial transfers of S. cerevisiae IMS0001 in shake flask cultures containing synthetic medium with 2% (w/v) L-arabinose. Each datapoint represents the growth rate estimated from the OD.sub.660 measured during (exponential) growth. The closed and open circles represent duplicate serial transfer experiments.

[0009] FIG. 4. Growth rate during an anaerobic SBR fermentation of S. cerevisiae IMS0001 in synthetic medium with 2% (w/v) L-arabinose. Each datapoint represents the growth rate estimated from the CO.sub.2 profile (solid line) during exponential growth.

[0010] FIG. 5. Sugar consumption and product formation during anaerobic batch fermentations of strain IMS0002. The fermentations were performed in 1 synthetic medium supplemented with: 20 g l.sup.-1 arabinose (A); 20 g l.sup.-1 glucose and 20 g l.sup.-1 arabinose (B); 30 g l.sup.-1 glucose, 15 g l.sup.-1 xylose, and 15 g l.sup.-1 arabinose (C); Sugar consumption and product formation during anaerobic batch fermentations with a mixture of strains IMS0002 and RWB218. The fermentations were performed in 1 liter of synthetic medium supplemented with 30 g l.sup.-1 glucose, 15 g l.sup.-1 xylose, and 15 g l.sup.-1 arabinose (D). Symbols: glucose ( ); xylose (.largecircle.); arabinose (.box-solid.); ethanol calculated from cumulative CO.sub.2 production (.quadrature.); ethanol measured by HPLC (.tangle-solidup.); cumulative CO.sub.2 production (.DELTA.); xylitol ()

[0011] FIG. 6. Sugar consumption and product formation during an anaerobic batch fermentation of strain IMS0002 cells selected for anaerobic growth on xylose. The fermentation was performed in 1 liter of synthetic medium supplemented with 20 g l.sup.-1 xylose and 20 g l.sup.-1 arabinose. Symbols: xylose (.largecircle.); arabinose (.box-solid.); ethanol measured by HPLC (.tangle-solidup.); cumulative CO.sub.2 production (.DELTA.); xylitol ().

[0012] FIG. 7. Sugar consumption and product formation during an anaerobic batch fermentation of strain IMS0003. The fermentation was performed in 1 liter of synthetic medium supplemented with: 30 g l.sup.-1 glucose, 15 g l.sup.-1 xylose, and 15 g l.sup.-1 arabinose. Symbols: glucose ( ); xylose (.largecircle.); arabinose (.box-solid.); ethanol calculated from cumulative CO.sub.2 production (.quadrature.); ethanol measured by HPLC (.tangle-solidup.); cumulative CO.sub.2 production (.DELTA.);

DESCRIPTION OF THE INVENTION

Eukaryotic Cell

[0013] In a first aspect, the invention relates to a eukaryotic cell capable of expressing the following nucleotide sequences, whereby the expression of these nucleotide sequences confers on the cell the ability to use L-arabinose and/or to convert L-arabinose into L-ribulose, and/or xylulose 5-phosphate and/or into a desired fermentation product such as ethanol: [0014] (a) a nucleotide sequence encoding an arabinose isomerase (araA), wherein said nucleotide sequence is selected from the group consisting of: [0015] (i) nucleotide sequences encoding an araA, said araA comprising an amino acid sequence that has at least 55% sequence identity with the amino acid sequence of SEQ ID NO:1. [0016] (ii) nucleotide sequences comprising a nucleotide sequence that has at least 60% sequence identity with the nucleotide sequence of SEQ ID NO:2. [0017] (iii) nucleotide sequences the complementary strand of which hybridizes to a nucleic acid molecule of sequence of (i) or (ii); [0018] (iv) nucleotide sequences the sequences of which differ from the sequence of a nucleic acid molecule of (iii) due to the degeneracy of the genetic code, [0019] (b) a nucleotide sequence encoding a L-ribulokinase (araB), wherein said nucleotide sequence is selected from the group consisting of: [0020] (i) nucleotide sequences encoding an araB, said araB comprising an amino acid sequence that has at least 20% sequence identity with the amino acid sequence of SEQ ID NO:3. [0021] (ii) nucleotide sequences comprising a nucleotide sequence that has at least 50% sequence identity with the nucleotide sequence of SEQ ID NO:4. [0022] (iii) nucleotide sequences the complementary strand of which hybridizes to a nucleic acid molecule of sequence of (i) or (ii); [0023] (iv) nucleotide sequences the sequences of which differ from the sequence of a nucleic acid molecule of (iii) due to the degeneracy of the genetic code, [0024] (c) a nucleotide sequence encoding an L-ribulose-5-P-4-epimerase (araD), wherein said nucleotide sequence is selected from the group consisting of: [0025] (i) nucleotide sequences encoding an araD, said araD comprising an amino acid sequence that has at least 60% sequence identity with the amino acid sequence of SEQ ID NO:5. [0026] (ii) nucleotide sequences comprising a nucleotide sequence that has at least 60% sequence identity with the nucleotide sequence of SEQ ID NO:6. [0027] (iii) nucleotide sequences the complementary strand of which hybridizes to a nucleic acid molecule of sequence of (i) or (ii); [0028] (iv) nucleotide sequences the sequences of which differ from the sequence of a nucleic acid molecule of (iii) due to the degeneracy of the genetic code.

[0029] A preferred embodiment relates to an eukaryotic cell capable of expressing the following nucleotide sequences, whereby the expression of these nucleotide sequences confers on the cell the ability to use L-arabinose and/or to convert L-arabinose into L-ribulose, and/or xylulose 5-phosphate and/or into a desired fermentation product such as ethanol: [0030] (a) a nucleotide sequence encoding an arabinose isomerase (araA), wherein said nucleotide sequence is selected from the group consisting of: [0031] (i) nucleotide sequences comprising a nucleotide sequence that has at least 60% sequence identity with the nucleotide sequence of SEQ ID NO:2, [0032] (ii) nucleotide sequences the complementary strand of which hybridizes to a nucleic acid molecule of sequence of (i); [0033] (iii) nucleotide sequences the sequences of which differ from the sequence of a nucleic acid molecule of (ii) due to the degeneracy of the genetic code, [0034] (b) a nucleotide sequence encoding a L-ribulokinase (araB), wherein said nucleotide sequence is selected from the group consisting of: [0035] (i) nucleotide sequences encoding an araB, said araB comprising an amino acid sequence that has at least 20% sequence identity with the amino acid sequence of SEQ ID NO:3. [0036] (ii) nucleotide sequences comprising a nucleotide sequence that has at least 50% sequence identity with the nucleotide sequence of SEQ ID NO:4. [0037] (iii) nucleotide sequences the complementary strand of which hybridizes to a nucleic acid molecule of sequence of (i) or (ii); [0038] (iv) nucleotide sequences the sequences of which differ from the sequence of a nucleic acid molecule of (iii) due to the degeneracy of the genetic code, [0039] (c) a nucleotide sequence encoding an L-ribulose-5-P-4-epimerase (araD), wherein said nucleotide sequence is selected from the group consisting of: [0040] (i) nucleotide sequences encoding an araD, said araD comprising an amino acid sequence that has at least 60% sequence identity with the amino acid sequence of SEQ ID NO:5. [0041] (ii) nucleotide sequences comprising a nucleotide sequence that has at least 60% sequence identity with the nucleotide sequence of SEQ ID NO:6. [0042] (iii) nucleotide sequences the complementary strand of which hybridizes to a nucleic acid molecule of sequence of (i) or (ii); [0043] (iv) nucleotide sequences the sequences of which differ from the sequence of a nucleic acid molecule of (iii) due to the degeneracy of the genetic code.

Sequence Identity and Similarity

[0044] Sequence identity is herein defined as a relationship between two or more amino acid (polypeptide or protein) sequences or two or more nucleic acid (polynucleotide) sequences, as determined by comparing the sequences. Usually, sequence identities or similarities are compared over the whole length of the sequences compared. In the art, "identity" also means the degree of sequence relatedness between amino acid or nucleic acid sequences, as the case may be, as determined by the match between strings of such sequences. "Similarity" between two amino acid sequences is determined by comparing the amino acid sequence and its conserved amino acid substitutes of one polypeptide to the sequence of a second polypeptide. "Identity" and "similarity" can be readily calculated by various methods, known to those skilled in the art.

[0045] Preferred methods to determine identity are designed to give the largest match between the sequences tested. Methods to determine identity and similarity are codified in publicly available computer programs. Preferred computer program methods to determine identity and similarity between two sequences include e.g. the BestFit, BLASTP, BLASTN, and FASTA (Altschul, S. F. et al., J. Mol. Biol. 215:403-410 (1990), publicly available from NCBI and other sources (BLAST Manual, Altschul, S., et al., NCBI NLM NIH Bethesda, Md. 20894). A most preferred algorithm used is EMBOSS (http://www.ebi.ac.uk/emboss/align). Preferred parameters for amino acid sequences comparison using EMBOSS are gap open 10.0, gap extend 0.5, Blosum 62 matrix. Preferred parameters for nucleic acid sequences comparison using EMBOSS are gap open 10.0, gap extend 0.5, DNA full matrix (DNA identity matrix).

[0046] Optionally, in determining the degree of amino acid similarity, the skilled person may also take into account so-called "conservative" amino acid substitutions, as will be clear to the skilled person. Conservative amino acid substitutions refer to the interchangeability of residues having similar side chains. For example, a group of amino acids having aliphatic side chains is glycine, alanine, valine, leucine, and isoleucine; a group of amino acids having aliphatic-hydroxyl side chains is serine and threonine; a group of amino acids having amide-containing side chains is asparagine and glutamine; a group of amino acids having aromatic side chains is phenylalanine, tyrosine, and tryptophan; a group of amino acids having basic side chains is lysine, arginine, and histidine; and a group of amino acids having sulphur-containing side chains is cysteine and methionine. Preferred conservative amino acids substitution groups are: valine-leucine-isoleucine, phenylalanine-tyrosine, lysine-arginine, alanine-valine, and asparagine-glutamine. Substitutional variants of the amino acid sequence disclosed herein are those in which at least one residue in the disclosed sequences has been removed and a different residue inserted in its place. Preferably, the amino acid change is conservative. Preferred conservative substitutions for each of the naturally occurring amino acids are as follows: Ala to ser; Arg to lys; Asn to gln or his; Asp to glu; Cys to ser or ala; Gln to asn; Glu to asp; Gly to pro; His to asn or gln; Ile to leu or val; Leu to ile or val; Lys to arg; gin or glu; Met to leu or ile; Phe to met, leu or tyr; Ser to thr; Thr to ser; Trp to tyr; Tyr to trp or phe; and, Val to ile or leu.

Hybridising Nucleic Acid Sequences

[0047] Nucleotide sequences encoding the enzymes expressed in the cell of the invention may also be defined by their capability to hybridise with the nucleotide sequences of SEQ ID NO.'s 2, 4, 6, 8, 16, 18, 20, 22, 24, 26, 28, 30 respectively, under moderate, or preferably under stringent hybridisation conditions. Stringent hybridisation conditions are herein defined as conditions that allow a nucleic acid sequence of at least about 25, preferably about 50 nucleotides, 75 or 100 and most preferably of about 200 or more nucleotides, to hybridise at a temperature of about 65.degree. C. in a solution comprising about 1 M salt, preferably 6.times.SSC or any other solution having a comparable ionic strength, and washing at 65.degree. C. in a solution comprising about 0.1 M salt, or less, preferably 0.2.times.SSC or any other solution having a comparable ionic strength. Preferably, the hybridisation is performed overnight, i.e. at least for 10 hours and preferably washing is performed for at least one hour with at least two changes of the washing solution. These conditions will usually allow the specific hybridisation of sequences having about 90% or more sequence identity.

[0048] Moderate conditions are herein defined as conditions that allow a nucleic acid sequences of at least 50 nucleotides, preferably of about 200 or more nucleotides, to hybridise at a temperature of about 45.degree. C. in a solution comprising about 1 M salt, preferably 6.times.SSC or any other solution having a comparable ionic strength, and washing at room temperature in a solution comprising about 1 M salt, preferably 6.times.SSC or any other solution having a comparable ionic strength. Preferably, the hybridisation is performed overnight, i.e. at least for 10 hours, and preferably washing is performed for at least one hour with at least two changes of the washing solution. These conditions will usually allow the specific hybridisation of sequences having up to 50% sequence identity. The person skilled in the art will be able to modify these hybridisation conditions in order to specifically identify sequences varying in identity between 50% and 90%.

AraA

[0049] A preferred nucleotide sequence encoding a arabinose isomerase (araA) expressed in the cell of the invention is selected from the group consisting of: [0050] (a) nucleotide sequences encoding an araA polypeptide said araA comprising an amino acid sequence that has at least 55, 60, 65, 70, 75, 80, 85, 90, 95, 97, 98, or 99% sequence identity with the amino acid sequence of SEQ ID NO. 1; [0051] (b) nucleotide sequences comprising a nucleotide sequence that has at least 60, 70, 80, 90, 95, 97, 98, or 99% sequence identity with the nucleotide sequence of SEQ ID NO. 2; [0052] (c) nucleotide sequences the complementary strand of which hybridises to a nucleic acid molecule sequence of (a) or (b); [0053] (d) nucleotide sequences the sequence of which differ from the sequence of a nucleic acid molecule of (c) due to the degeneracy of the genetic code. The nucleotide sequence encoding an araA may encode either a prokaryotic or an eukaryotic araA, i.e. an araA with an amino acid sequence that is identical to that of an araA that naturally occurs in the prokaryotic or eukaryotic organism. The present inventors have found that the ability of a particular araA to confer to a eukaryotic host cell the ability to use arabinose and/or to convert arabinose into L-ribulose, and/or xylulose 5-phosphate and/or into a desired fermentation product such as ethanol when co-expressed with araB and araD does not depend so much on whether the araA is of prokaryotic or eukaryotic origin. Rather this depends on the relatedness of the araA's amino acid sequence to that of the sequence SEQ ID NO. 1.

AraB

[0054] A preferred nucleotide sequence encoding a L-ribulokinase (AraB) expressed in the cell of the invention is selected from the group consisting of: [0055] (a) nucleotide sequences encoding a polypeptide comprising an amino acid sequence that has at least 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 97, 98, or 99% sequence identity with the amino acid sequence of SEQ ID NO. 3; [0056] (b) nucleotide sequences comprising a nucleotide sequence that has at least 50, 60, 70, 80, 90, 95, 97, 98, or 99% sequence identity with the nucleotide sequence of SEQ ID NO.4; [0057] (c) nucleotide sequences the complementary strand of which hybridises to a nucleic acid molecule sequence of (a) or (b); [0058] (d) nucleotide sequences the sequence of which differ from the sequence of a nucleic acid molecule of (c) due to the degeneracy of the genetic code. The nucleotide sequence encoding an araB may encode either a prokaryotic or an eukaryotic araB, i.e. an araB with an amino acid sequence that is identical to that of a araB that naturally occurs in the prokaryotic or eukaryotic organism. The present inventors have found that the ability of a particular araB to confer to a eukaryotic host cell the ability to use arabinose and/or to convert arabinose into L-ribulose, and/or xylulose 5-phosphate and/or into a desired fermentation product when co-expressed with araA and araD does not depend so much on whether the araB is of prokaryotic or eukaryotic origin. Rather this depends on the relatedness of the araB's amino acid sequence to that of the sequence SEQ ID NO. 3.

AraD

[0059] A preferred nucleotide sequence encoding a L-ribulose-5-P-4-epimerase (araD) expressed in the cell of the invention is selected from the group consisting of: [0060] (e) nucleotide sequences encoding a polypeptide comprising an amino acid sequence that has at least 60, 65, 70, 75, 80, 85, 90, 95, 97, 98, or 99% sequence identity with the amino acid sequence of SEQ ID NO. 5; [0061] (f) nucleotide sequences comprising a nucleotide sequence that has at least 60, 65, 70, 75, 80, 85, 90, 95, 97, 98, or 99% sequence identity with the nucleotide sequence of SEQ ID NO.6; [0062] (g) nucleotide sequences the complementary strand of which hybridises to a nucleic acid molecule sequence of (a) or (b); [0063] (h) nucleotide sequences the sequence of which differs from the sequence of a nucleic acid molecule of (c) due to the degeneracy of the genetic code. The nucleotide sequence encoding an araD may encode either a prokaryotic or an eukaryotic araD, i.e. an araD with an amino acid sequence that is identical to that of a araD that naturally occurs in the prokaryotic or eukaryotic organism. The present inventors have found that the ability of a particular araD to confer to a eukaryotic host cell the ability to use arabinose and/or to convert arabinose into L-ribulose, and/or xylulose 5-phosphate and/or into a desired fermentation product when co-expressed with araA and araB does not depend so much on whether the araD is of prokaryotic or eukaryotic origin. Rather this depends on the relatedness of the araD's amino acid sequence to that of the sequence SEQ ID NO. 5.

[0064] Surprisingly, the codon bias index indicated that expression of the Lactobacillus plantarum araA, araB and araD genes were more favorable for expression in yeast than the prokaryolic araA, araB and araD genes described in EP 1 499 708.

[0065] It is to be noted that L. plantarum is a Generally Regarded As Safe (GRAS) organism, which is recognized as safe by food registration authorities. Therefore, a preferred nucleotide sequence encodes an araA, araB or araD respectively having an amino acid sequence that is related to the sequences SEQ ID NO: 1, 3, or 5 respectively as defined above. A preferred nucleotide sequence encodes a fungal araA, araB or araD respectively (e.g. from a Basidiomycete), more preferably an araA, araB or araD respectively from an anaerobic fungus, e.g. an anaerobic fungus that belongs to the families Neocallimastix, Caecomyces, Pfromyces, Orpinomyces, or Ruminomyces. Alternatively, a preferred nucleotide sequence encodes a bacterial araA, araB or araD respectively, preferably from a Gram-positive bacterium, more preferably from the genus Lactobacillus, most preferably from Lactobacillus plantarum species. Preferably, one, two or three or the araA, araB and araD nucleotide sequences originate from a Lactobacillus genus, more preferably a Lactobacillus plantarum species. The bacterial araA expressed in the cell of the invention is not the Bacillus subtilis araA disclosed in EP 1 499 708 and given as SEQ ID NO:9. SEQ ID NO:10 represents the nucleotide acid sequence coding for SEQ ID NO:9. The bacterial araB and araD expressed in the cell of the invention are not the ones of Escherichia coli (E. coli) as disclosed in EP 1 499 708 and given as SEQ ID NO: 11 and SEQ ID NO:13. SEQ ID NO: 12 represents the nucleotide acid sequence coding for SEQ ID NO:11. SEQ ID NO:14 represents the nucleotide acid sequence coding for SEQ ID NO:13.

[0066] To increase the likelihood that the (bacterial) araA, araB and araD enzymes respectively are expressed in active form in a eukaryotic host cell of the invention such as yeast, the corresponding encoding nucleotide sequence may be adapted to optimise its codon usage to that of the chosen eukaryotic host cell. The adaptiveness of a nucleotide sequence encoding the araA, araB, and araD enzymes (or other enzymes of the invention, see below) to the codon usage of the chosen host cell may be expressed as codon adaptation index (CAI). The codon adaptation index is herein defined as a measurement of the relative adaptiveness of the codon usage of a gene towards the codon usage of highly expressed genes. The relative adaptiveness (w) of each codon is the ratio of the usage of each codon, to that of the most abundant codon for the same amino acid. The CAI index is defined as the geometric mean of these relative adaptiveness values. Non-synonymous codons and termination codons (dependent on genetic code) are excluded. CAI values range from 0 to 1, with higher values indicating a higher proportion of the most abundant codons (see Sharp and Li, 1987, Nucleic Acids Research 15: 1281-1295; also see: Jansen et al., 2003, Nucleic Acids Res. 31(8):2242-51). An adapted nucleotide sequence preferably has a CAI of at least 0.2, 0.3, 0.4, 0.5, 0.6 or 0.7.

[0067] In a preferred embodiment, expression of the nucleotide sequences encoding an ara A, an ara B and an ara D as defined earlier herein confers to the cell the ability to use L-arabinose and/or to convert it into L-ribulose, and/or xylulose 5-phosphate. Without wishing to be bound by any theory, L-arabinose is expected to be first converted into L-ribulose, which is subsequently converted into xylulose 5-phosphate which is the main molecule entering the pentose phosphate pathway. In the context of the invention, "using L-arabinose" preferably means that the optical density measured at 660 nm (OD.sub.660) of transformed cells cultured under aerobic or anaerobic conditions in the presence of at least 0.5% L-arabinose during at least 20 days is increased from approximately 0.5 till 1.0 or more. More preferably, the OD.sub.660 is increased from 0.5 till 1.5 or more. More preferably, the cells are cultured in the presence of at least 1%, at least 1.5%, at least 2% L-arabinose. Most preferably, the cells are cultured in the presence of approximately 2% L-arabinose.

[0068] In the context of the invention, a cell is able "to convert L-arabinose into L-ribulose" when detectable amounts of L-ribulose are detected in cells cultured under aerobic or anaerobic conditions in the presence of L-arabinose (same preferred concentrations as in previous paragraph) during at least 20 days using a suitable assay. Preferably the assay is HPLC for L-ribulose.

[0069] In the context of the invention, a cell is able "to convert L-arabinose into xylulose 5-phosphate" when an increase of at least 2% of xylulose 5-phosphate is detected in cells cultured under aerobic or anaerobic conditions in the presence of L-arabinose (same preferred concentrations as in previous paragraph) during at least 20 days using a suitable assay. Preferably, an HPCL-based assay for xylulose 5-phosphate has been described in Zaldivar J., et al ((2002), Appl. Microbiol. Biotechnol., 59:436-442). This assay is briefly described in the experimental part. More preferably, the increase is of at least 5%, 10%, 15%, 20%, 25% or more.

[0070] In another preferred embodiment, expression of the nucleotide sequences encoding an ara A, ara B and ara D as defined earlier herein confers to the cell the ability to convert L-arabinose into a desired fermentation product when cultured under aerobic or anaerobic conditions in the presence of L-arabinose (same preferred concentrations as in previous paragraph) during at least one month till one year. More preferably, a cell is able to convert L-arabinose into a desired fermentation product when detectable amounts of a desired fermentation product are detected using a suitable assay and when the cells are cultured under the conditions given in previous sentence. Even more preferably, the assay is HPLC. Even more preferably, the fermentation product is ethanol.

[0071] A cell for transformation with the nucleotide sequences encoding the araA, araB, and araD enzymes respectively as described above, preferably is a host cell capable of active or passive xylose transport into and xylose isomerisation within the cell. The cell preferably is capable of active glycolysis. The cell may further contain an endogenous pentose phosphate pathway and may contain endogenous xylulose kinase activity so that xylulose isomerised from xylose may be metabolised to pyruvate. The cell further preferably contains enzymes for conversion of pyruvate to a desired fermentation product such as ethanol, lactic acid, 3-hydroxy-propionic acid, acrylic acid, acetic acid, succinic acid, citric acid, malic acid, fumaric acid, an amino acid, 1,3-propane-diol, ethylene, glycerol, butanol, a .beta.-lactam antibiotic or a cephalosporin. The cell may be made capable of producing butanol by introduction of one or more genes of the butanol pathway as disclosed in WO2007/041269.

[0072] A preferred cell is naturally capable of alcoholic fermentation, preferably, anaerobic alcoholic fermentation. The host cell further preferably has a high tolerance to ethanol, a high tolerance to low pH (i.e. capable of growth at a pH lower than 5, 4, 3, or 2.5) and towards organic acids like lactic acid, acetic acid or formic acid and sugar degradation products such as furfural and hydroxy-methylfurfural, and a high tolerance to elevated temperatures. Any of these characteristics or activities of the host cell may be naturally present in the host cell or may be introduced or modified through genetic selection or by genetic modification. A suitable host cell is a eukaryotic microorganism like e.g. a fungus, however, most suitable as host cell are yeasts or filamentous fungi.

[0073] Yeasts are herein defined as eukaryotic microorganisms and include all species of the subdivision Eumycotina (Alexopoulos, C. J., 1962, In: Introductory Mycology, John Wiley & Sons, Inc., New York) that predominantly grow in unicellular form. Yeasts may either grow by budding of a unicellular thallus or may grow by fission of the organism. Preferred yeasts as host cells belong to one of the genera Saccharomyces, Kluyveromyces, Candida, Pichia, Schizosaccharomyces, Hansenula, Kloeckera, Schwanniomyces, or Yarrowia. Preferably the yeast is capable of anaerobic fermentation, more preferably anaerobic alcoholic fermentation.

[0074] Filamentous fungi are herein defined as eukaryotic microorganisms that include all filamentous forms of the subdivision Eumycotina. These fungi are characterized by a vegetative mycelium composed of chitin, cellulose, and other complex polysaccharides. The filamentous fungi of the present invention are morphologically, physiologically, and genetically distinct from yeasts. Vegetative growth by filamentous fungi is by hyphal elongation and carbon catabolism of most filamentous fungi is obligately aerobic. Preferred filamentous fungi as host cells belong to one of the genera Aspergillus, Trichoderma, Humicola, Acremonium, Fusarium, or Penicillium.

[0075] Over the years suggestions have been made for the introduction of various organisms for the production of bio-ethanol from crop sugars. In practice, however, all major bio-ethanol production processes have continued to use the yeasts of the genus Saccharomyces as ethanol producer. This is due to the many attractive features of Saccharomyces species for industrial processes, i.e., a high acid-, ethanol- and osmo-tolerance, capability of anaerobic growth, and of course its high alcoholic fermentative capacity. Preferred yeast species as host cells include S. cerevisiae, S. bulderi, S. barnetti, S. exiguus, S. uvarum, S. diastaticus, K. lactis, K. marxianus, K. fragilis.

[0076] In a preferred embodiment, the host cell of the invention is a host cell that has been transformed with a nucleic acid construct comprising the nucleotide sequence encoding the araA, araB, and araD enzymes as defined above. In one more preferred embodiment, the host cell is co-transformed with three nucleic acid constructs, each nucleic acid construct comprising the nucleotide sequence encoding araA, araB or araD. The nucleic acid construct comprising the araA, araB, and/or araD coding sequence is capable of expression of the araA, araB, and/or araD enzymes in the host cell. To this end the nucleic acid construct may be constructed as described in e.g. WO 03/0624430. The host cell may comprise a single but preferably comprises multiple copies of each nucleic acid construct. The nucleic acid construct may be maintained episomally and thus comprise a sequence for autonomous replication, such as an ARS sequence. Suitable episomal nucleic acid constructs may e.g. be based on the yeast 2.mu. or pKD1 (Fleer et al., 1991, Biotechnology 9:968-975) plasmids. Preferably, however, each nucleic acid construct is integrated in one or more copies into the genome of the host cell. Integration into the host cell's genome may occur at random by illegitimate recombination but preferably nucleic acid construct is integrated into the host cell's genome by homologous recombination as is well known in the art of fungal molecular genetics (see e.g. WO 90/14423, EP-A-0 481 008, EP-A-0 635 574 and U.S. Pat. No. 6,265,186). Accordingly, in a more preferred embodiment, the cell of the invention comprises a nucleic acid construct comprising the araA, araB, and/or araD coding sequence and is capable of expression of the araA, araB, and/or araD enzymes. In an even more preferred embodiment, the araA, araB, and/or araD coding sequences are each operably linked to a promoter that causes sufficient expression of the corresponding nucleotide sequences in a cell to confer to the cell the ability to use L-arabinose, and/or to convert L-arabinose into L-ribulose, and/or xylulose 5-phosphate. Preferably the cell is a yeast cell. Accordingly, in a further aspect, the invention also encompasses a nucleic acid construct as earlier outlined herein. Preferably, a nucleic acid construct comprises a nucleic acid sequence encoding an araA, araB and/or araD. Nucleic acid sequences encoding an araA, araB, or araD have been all earlier defined herein. Even more preferably, the expression of the corresponding nucleotide sequences in a cell confer to the cell the ability to convert L-arabinose into a desired fermentation product as defined later herein. In an even more preferred embodiment, the fermentation product is ethanol. Even more preferably, the cell is a yeast cell.

[0077] As used herein, the term "operably linked" refers to a linkage of polynucleotide elements (or coding sequences or nucleic acid sequence) in a functional relationship. A nucleic acid sequence is "operably linked" when it is placed into a functional relationship with another nucleic acid sequence. For instance, a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the coding sequence. Operably linked means that the nucleic acid sequences being linked are typically contiguous and, where necessary to join two protein coding regions, contiguous and in reading frame.

[0078] As used herein, the term "promoter" refers to a nucleic acid fragment that functions to control the transcription of one or more genes, located upstream with respect to the direction of transcription of the transcription initiation site of the gene, and is structurally identified by the presence of a binding site for DNA-dependent RNA polymerase, transcription initiation sites and any other DNA sequences, including, but not limited to transcription factor binding sites, repressor and activator protein binding sites, and any other sequences of nucleotides known to one of skill in the art to act directly or indirectly to regulate the amount of transcription from the promoter. A "constitutive" promoter is a promoter that is active under most environmental and developmental conditions. An "inducible" promoter is a promoter that is active under environmental or developmental regulation.

[0079] The promoter that could be used to achieve the expression of the nucleotide sequences coding for araA, araB and/or araD may be not native to the nucleotide sequence coding for the enzyme to be expressed, i.e. a promoter that is heterologous to the nucleotide sequence (coding sequence) to which it is operably linked. Although the promoter preferably is heterologous to the coding sequence to which it is operably linked, it is also preferred that the promoter is homologous, i.e. endogenous to the host cell. Preferably the heterologous promoter (to the nucleotide sequence) is capable of producing a higher steady state level of the transcript comprising the coding sequence (or is capable of producing more transcript molecules, i.e. mRNA molecules, per unit of time) than is the promoter that is native to the coding sequence, preferably under conditions where arabinose, or arabinose and glucose, or xylose and arabinose or xylose and arabinose and glucose are available as carbon sources, more preferably as major carbon sources (i.e. more than 50% of the available carbon source consists of arabinose, or arabinose and glucose, or xylose and arabinose or xylose and arabinose and glucose), most preferably as sole carbon sources. Suitable promoters in this context include both constitutive and inducible natural promoters as well as engineered promoters. A preferred promoter for use in the present invention will in addition be insensitive to catabolite (glucose) repression and/or will preferably not require arabinose and/or xylose for induction.

[0080] Promotors having these characteristics are widely available and known to the skilled person. Suitable examples of such promoters include e.g. promoters from glycolytic genes, such as the phosphofructokinase (PPK), triose phosphate isomerase (TPI), glyceraldehyde-3-phosphate dehydrogenase (GPD, TDH3 or GAPDH), pyruvate kinase (PYK), phosphoglycerate kinase (PGK) promoters from yeasts or filamentous fungi; more details about such promoters from yeast may be found in (WO 93/03159). Other useful promoters are ribosomal protein encoding gene promoters, the lactase gene promoter (LAC4), alcohol dehydrogenase promoters (ADH1, ADH4, and the like), the enolase promoter (ENO), the glucose-6-phosphate isomerase promoter (PGI1, Hauf et al, 2000) or the hexose(glucose) transporter promoter (HXT7) or the glyceraldehyde-3-phosphate dehydrogenase (TDH3). The sequence of the PGI1 promoter is given in SEQ ID NO:51. The sequence of the HXT7 promoter is given in SEQ ID NO:52. The sequence of the TDH3 promoter is given in SEQ ID NO:49. Other promoters, both constitutive and inducible, and enhancers or upstream activating sequences will be known to those of skill in the art. The promoters used in the host cells of the invention may be modified, if desired, to affect their control characteristics. A preferred cell of the invention is a eukaryotic cell transformed with the araA, araB and araD genes of L. plantarum. More preferably, the eukaryotic cell is a yeast cell, even more preferably a S. cerevisiae strain transformed with the araA, araB and araD genes of L. plantarum. Most preferably, the cell is either CBS120327 or CBS120328 both deposited at the CBS Institute (The Netherlands) on Sep. 27, 2006.

[0081] The term "homologous" when used to indicate the relation between a given (recombinant) nucleic acid or polypeptide molecule and a given host organism or host cell, is understood to mean that in nature the nucleic acid or polypeptide molecule is produced by a host cell or organisms of the same species, preferably of the same variety or strain. If homologous to a host cell, a nucleic acid sequence encoding a polypeptide will typically be operably linked to another promoter sequence or, if applicable, another secretory signal sequence and/or terminator sequence than in its natural environment. When used to indicate the relatedness of two nucleic acid sequences the term "homologous" means that one single-stranded nucleic acid sequence may hybridize to a complementary single-stranded nucleic acid sequence. The degree of hybridization may depend on a number of factors including the amount of identity between the sequences and the hybridization conditions such as temperature and salt concentration as earlier presented. Preferably the region of identity is greater than about 5 bp, more preferably the region of identity is greater than 10 bp.

[0082] The term "heterologous" when used with respect to a nucleic acid (DNA or RNA) or protein refers to a nucleic acid or protein that does not occur naturally as part of the organism, cell, genome or DNA or RNA sequence in which it is present, or that is found in a cell or location or locations in the genome or DNA or RNA sequence that differ from that in which it is found in nature. Heterologous nucleic acids or proteins are not endogenous to the cell into which it is introduced, but has been obtained from another cell or synthetically or recombinantly produced. Generally, though not necessarily, such nucleic acids encode proteins that are not normally produced by the cell in which the DNA is transcribed or expressed. Similarly exogenous RNA encodes for proteins not normally expressed in the cell in which the exogenous RNA is present. Heterologous nucleic acids and proteins may also be referred to as foreign nucleic acids or proteins. Any nucleic acid or protein that one of skill in the art would recognize as heterologous or foreign to the cell in which it is expressed is herein encompassed by the term heterologous nucleic acid or protein. The term heterologous also applies to non-natural combinations of nucleic acid or amino acid sequences, i.e. combinations where at least two of the combined sequences are foreign with respect to each other.

Preferred Eukaryotic Cell Able to Use and/or Convert L-Arabinose and Xylose

[0083] In a more preferred embodiment, the cell of the invention that expresses araA, araB and araD is able to use L-arabinose and/or to convert it into L-ribulose, and/or xylulose 5-phosphate and/or a desired fermentation product as earlier defined herein and additionally exhibits the ability to use xylose and/or convert xylose into xylulose. The conversion of xylose into xylulose is preferably a one step isomerisation step (direct isomerisation of xylose into xylulose). This type of cell is therefore able to use both L-arabinose and xylose. "Using" xylose has preferably the same meaning as "using" L-arabinose as earlier defined herein.

[0084] Enzyme definitions are as used in WO 06/009434, for xylose isomerase (EC 5.3.1.5), xylulose kinase (EC 2.7.1.17), ribulose 5-phosphate epimerase (5.1.3.1), ribulose 5-phosphate isomerase (EC 5.3.1.6), transketolase (EC 2.2.1.1), transaldolase (EC 2.2.1.2), and aldose reductase" (EC 1.1.1.21).

[0085] In a preferred embodiment, the eukaryotic cell of the invention expressing araA, araB and araD as earlier defined herein has the ability of isomerising xylose to xylulose as e.g. described in WO 03/0624430 or in WO 06/009434. The ability of isomerising xylose to xylulose is conferred to the host cell by transformation of the host cell with a nucleic acid construct comprising a nucleotide sequence encoding a xylose isomerase. The transformed host cell's ability to isomerise xylose into xylulose is the direct isomerisation of xylose to xylulose. This is understood to mean that xylose isomerised into xylulose in a single reaction catalysed by a xylose isomerase, as opposed to the two step conversion of xylose into xylulose via a xylitol intermediate as catalysed by xylose reductase and xylitol dehydrogenase, respectively.

[0086] The nucleotide sequence encodes a xylose isomerase that is preferably expressed in active form in the transformed host cell of the invention. Thus, expression of the nucleotide sequence in the host cell produces a xylose isomerase with a specific activity of at least 10 U xylose isomerase activity per mg protein at 30.degree. C., preferably at least 20, 25, 30, 50, 100, 200, 300 or 500 U per mg at 30.degree. C. The specific activity of the xylose isomerase expressed in the transformed host cell is herein defined as the amount of xylose isomerase activity units per mg protein of cell free lysate of the host cell, e.g. a yeast cell free lysate. Determination of the xylose isomerase activity has already been described earlier herein.

[0087] Preferably, expression of the nucleotide sequence encoding the xylose isomerase in the host cell produces a xylose isomerase with a K.sub.m for xylose that is less than 50, 40, 30 or 25 mM, more preferably, the K.sub.m for xylose is about 20 mM or less.

[0088] A preferred nucleotide sequence encoding the xylose isomerase may be selected from the group consisting of: [0089] (e) nucleotide sequences encoding a polypeptide comprising an amino acid sequence that has at least 60, 65, 70, 75, 80, 85, 90, 95, 97, 98, or 99% sequence identity with the amino acid sequence of SEQ ID NO. 7 or SEQ ID NO:15; [0090] (f) nucleotide sequences comprising a nucleotide sequence that has at least 40, 50, 60, 70, 80, 90, 95, 97, 98, or 99% sequence identity with the nucleotide sequence of SEQ ID NO. 8 or SEQ ID NO:16; [0091] (g) nucleotide sequences the complementary strand of which hybridises to a nucleic acid molecule sequence of (a) or (b); [0092] (h) nucleotide sequences the sequence of which differs from the sequence of a nucleic acid molecule of (c) due to the degeneracy of the genetic code.

[0093] The nucleotide sequence encoding the xylose isomerase may encode either a prokaryotic or an eukaryotic xylose isomerase, i.e. a xylose isomerase with an amino acid sequence that is identical to that of a xylose isomerase that naturally occurs in the prokaryotic or eukaryotic organism. The present inventors have found that the ability of a particular xylose isomerase to confer to a eukaryotic host cell the ability to isomerise xylose into xylulose does not depend so much on whether the isomerase is of prokaryotic or eukaryotic origin. Rather this depends on the relatedness of the isomerase's amino acid sequence to that of the Piromyces sequence (SEQ ID NO. 7). Surprisingly, the eukaryotic Piromyces isomerase is more related to prokaryotic isomerases than to other known eukaryotic isomerases. Therefore, a preferred nucleotide sequence encodes a xylose isomerase having an amino acid sequence that is related to the Piromyces sequence as defined above. A preferred nucleotide sequence encodes a fungal xylose isomerase (e.g. from a Basidiomycete), more preferably a xylose isomerase from an anaerobic fungus, e.g. a xylose isomerase from an anaerobic fungus that belongs to the families Neocallimastix, Caecomyces, Piromyces, Orpinomyces, or Ruminomyces. Alternatively, a preferred nucleotide sequence encodes a bacterial xylose isomerase, preferably a Gram-negative bacterium, more preferably an isomerase from the class Bacteroides, or from the genus Bacteroides, most preferably from B. thetaiotaomicron (SEQ ID NO. 15).

[0094] To increase the likelihood that the xylose isomerase is expressed in active form in a eukaryotic host cell such as yeast, the nucleotide sequence encoding the xylose isomerase may be adapted to optimise its codon usage to that of the eukaryotic host cell as earlier defined herein.

[0095] A host cell for transformation with the nucleotide sequence encoding the xylose isomerase as described above, preferably is a host capable of active or passive xylose transport into the cell. The host cell preferably contains active glycolysis. The host cell may further contain an endogenous pentose phosphate pathway and may contain endogenous xylulose kinase activity so that xylulose isomerised from xylose may be metabolised to pyruvate. The host further preferably contains enzymes for conversion of pyruvate to a desired fermentation product such as ethanol, lactic acid, 3-hydroxy-propionic acid, acrylic acid, acetic acid, succinic acid, citric acid, malic acid, fumaric acid, an amino acid, 1,3-propane-diol, ethylene, glycerol, butanol, a .beta.-lactam antibiotic or a cephalosporin. A preferred host cell is a host cell that is naturally capable of alcoholic fermentation, preferably, anaerobic alcoholic fermentation. The host cell further preferably has a high tolerance to ethanol, a high tolerance to low pH (i.e. capable of growth at a pH lower than 5, 4, 3, or 2.5) and towards organic acids like lactic acid, acetic acid or formic acid and sugar degradation products such as furfural and hydroxy-methylfurfural, and a high tolerance to elevated temperatures. Any of these characteristics or activities of the host cell may be naturally present in the host cell or may be introduced or modified by genetic modification. A suitable cell is a eukaryotic microorganism like e.g. a fungus, however, most suitable as host cell are yeasts or filamentous fungi. Preferred yeasts and filamentous fungi have already been defined herein.

[0096] As used herein the wording host cell has the same meaning as cell.

[0097] The cell of the invention is preferably transformed with a nucleic acid construct comprising the nucleotide sequence encoding the xylose isomerase. The nucleic acid construct that is preferably used is the same as the one used comprising the nucleotide sequence encoding araA, araB or araD.

[0098] In another preferred embodiment of the invention, the cell of the invention: [0099] expressing araA, araB and araD, and exhibiting the ability to directly isomerise xylose into xylulose, as earlier defined herein further comprises a genetic modification that increases the flux of the pentose phosphate pathway, as described in WO 06/009434. In particular, the genetic modification causes an increased flux of the non-oxidative part pentose phosphate pathway. A genetic modification that causes an increased flux of the non-oxidative part of the pentose phosphate pathway is herein understood to mean a modification that increases the flux by at least a factor 1.1, 1.2, 1.5, 2, 5, 10 or 20 as compared to the flux in a strain which is genetically identical except for the genetic modification causing the increased flux. The flux of the non-oxidative part of the pentose phosphate pathway may be measured by growing the modified host on xylose as sole carbon source, determining the specific xylose consumption rate and substracting the specific xylitol production rate from the specific xylose consumption rate, if any xylitol is produced. However, the flux of the non-oxidative part of the pentose phosphate pathway is proportional with the growth rate on xylose as sole carbon source, preferably with the anaerobic growth rate on xylose as sole carbon source. There is a linear relation between the growth rate on xylose as sole carbon source (.mu..sub.max) and the flux of the non-oxidative part of the pentose phosphate pathway. The specific xylose consumption rate (Q.sub.s) is equal to the growth rate (.mu.) divided by the yield of biomass on sugar (Y.sub.xs) because the yield of biomass on sugar is constant (under a given set of Conditions: anaerobic, growth medium, pH, genetic background of the strain, etc.; i.e. Q.sub.s=.mu./Y.sub.xs). Therefore the increased flux of the non-oxidative part of the pentose phosphate pathway may be deduced from the increase in maximum growth rate under these conditions. In a preferred embodiment, the cell comprises a genetic modification that increases the flux of the pentose phosphate pathway and has a specific xylose consumption rate of at least 346 mg xylose/g biomass/h.

[0100] Genetic modifications that increase the flux of the pentose phosphate pathway may be introduced in the host cell in various ways. These including e.g. achieving higher steady state activity levels of xylulose kinase and/or one or more of the enzymes of the non-oxidative part pentose phosphate pathway and/or a reduced steady state level of unspecific aldose reductase activity. These changes in steady state activity levels may be effected by selection of mutants (spontaneous or induced by chemicals or radiation) and/or by recombinant DNA technology e.g. by overexpression or inactivation, respectively, of genes encoding the enzymes or factors regulating these genes.

[0101] In a more preferred host cell, the genetic modification comprises overexpression of at least one enzyme of the (non-oxidative part) pentose phosphate pathway. Preferably the enzyme is selected from the group consisting of the enzymes encoding for ribulose-5-phosphate isomerase, ribulose-5-phosphate epimerase, transketolase and transaldolase, as described in WO 06/009434.

[0102] Various combinations of enzymes of the (non-oxidative part) pentose phosphate pathway may be overexpressed. E.g. the enzymes that are overexpressed may be at least the enzymes ribulose-5-phosphate isomerase and ribulose-5-phosphate epimerase; or at least the enzymes ribulose-5-phosphate isomerase and transketolase; or at least the enzymes ribulose-5-phosphate isomerase and transaldolase; or at least the enzymes ribulose-5-phosphate epimerase and transketolase; or at least the enzymes ribulose-5-phosphate epimerase and transaldolase; or at least the enzymes transketolase and transaldolase; or at least the enzymes ribulose-5-phosphate epimerase, transketolase and transaldolase; or at least the enzymes ribulose-5-phosphate isomerase, transketolase and transaldolase; or at least the enzymes ribulose-5-phosphate isomerase, ribulose-5-phosphate epimerase, and transaldolase; or at least the enzymes ribulose-5-phosphate isomerase, ribulose-5-phosphate epimerase, and transketolase. In one embodiment of the invention each of the enzymes ribulose-5-phosphate isomerase, ribulose-5-phosphate epimerase, transketolase and transaldolase are overexpressed in the host cell. More preferred is a host cell in which the genetic modification comprises at least overexpression of both the enzymes transketolase and transaldolase as such a host cell is already capable of anaerobic growth on xylose. In fact, under some conditions we have found that host cells overexpressing only the transketolase and the transaldolase already have the same anaerobic growth rate on xylose as do host cells that overexpress all four of the enzymes, i.e. the ribulose-5-phosphate isomerase, ribulose-5-phosphate epimerase, transketolase and transaldolase. Moreover, host cells overexpressing both of the enzymes ribulose-5-phosphate isomerase and ribulose-5-phosphate epimerase are preferred over host cells overexpressing only the isomerase or only the epimerase as overexpression of only one of these enzymes may produce metabolic imbalances.

[0103] There are various means available in the art for overexpression of enzymes in the cells of the invention. In particular, an enzyme may be overexpressed by increasing the copy number of the gene coding for the enzyme in the host cell, e.g. by integrating additional copies of the gene in the host cell's genome, by expressing the gene from an episomal multicopy expression vector or by introducing a episomal expression vector that comprises multiple copies of the gene.

[0104] Alternatively overexpression of enzymes in the host cells of the invention may be achieved by using a promoter that is not native to the sequence coding for the enzyme to be overexpressed, i.e. a promoter that is heterologous to the coding sequence to which it is operably linked. Suitable promoters to this end have already been defined herein.

[0105] The coding sequence used for overexpression of the enzymes preferably is homologous to the host cell of the invention. However, coding sequences that are heterologous to the host cell of the invention may likewise be applied, as mentioned in WO 06/009434.

[0106] A nucleotide sequence used for overexpression of ribulose-5-phosphate isomerase in the host cell of the invention is a nucleotide sequence encoding a polypeptide with ribulose-5-phosphate isomerase activity, whereby preferably the polypeptide has an amino acid sequence having at least 50, 60, 70, 80, 90 or 95% identity with SEQ ID NO. 17 or whereby the nucleotide sequence is capable of hybridising with the nucleotide sequence of SEQ ID NO. 18, under moderate conditions, preferably under stringent conditions.

[0107] A nucleotide sequence used for overexpression of ribulose-5-phosphate epimerase in the host cell of the invention is a nucleotide sequence encoding a polypeptide with ribulose-5-phosphate epimerase activity, whereby preferably the polypeptide has an amino acid sequence having at least 50, 60, 70, 80, 90 or 95% identity with SEQ ID NO. 19 or whereby the nucleotide sequence is capable of hybridising with the nucleotide sequence of SEQ ID NO. 20, under moderate conditions, preferably under stringent conditions.

[0108] A nucleotide sequence used for overexpression of transketolase in the host cell of the invention is a nucleotide sequence encoding a polypeptide with transketolase activity, whereby preferably the polypeptide has an amino acid sequence having at least 50, 60, 70, 80, 90 or 95% identity with SEQ ID NO. 21 or whereby the nucleotide sequence is capable of hybridising with the nucleotide sequence of SEQ ID NO. 22, under moderate conditions, preferably under stringent conditions.

[0109] A nucleotide sequence used for overexpression of transaldolase in the host cell of the invention is a nucleotide sequence encoding a polypeptide with transaldolase activity, whereby preferably the polypeptide has an amino acid sequence having at least 50, 60, 70, 80, 90 or 95% identity with SEQ ID NO. 23 or whereby the nucleotide sequence is capable of hybridising with the nucleotide sequence of SEQ ID NO. 24, under moderate conditions, preferably under stringent conditions.

[0110] Overexpression of an enzyme, when referring to the production of the enzyme in a genetically modified host cell, means that the enzyme is produced at a higher level of specific enzymatic activity as compared to the unmodified host cell under identical conditions. Usually this means that the enzymatically active protein (or proteins in case of multi-subunit enzymes) is produced in greater amounts, or rather at a higher steady state level as compared to the unmodified host cell under identical conditions. Similarly this usually means that the mRNA coding for the enzymatically active protein is produced in greater amounts, or again rather at a higher steady state level as compared to the unmodified host cell under identical conditions. Overexpression of an enzyme is thus preferably determined by measuring the level of the enzyme's specific activity in the host cell using appropriate enzyme assays as described herein. Alternatively, overexpression of the enzyme may determined indirectly by quantifying the specific steady state level of enzyme protein, e.g. using antibodies specific for the enzyme, or by quantifying the specific steady level of the mRNA coding for the enzyme. The latter may particularly be suitable for enzymes of the pentose phosphate pathway for which enzymatic assays are not easily feasible as substrates for the enzymes are not commercially available. Preferably in the host cells of the invention, an enzyme to be overexpressed is overexpressed by at least a factor 1.1, 1.2, 1.5, 2, 5, 10 or 20 as compared to a strain which is genetically identical except for the genetic modification causing the overexpression. It is to be understood that these levels of overexpression may apply to the steady state level of the enzyme's activity, the steady state level of the enzyme's protein as well as to the steady state level of the transcript coding for the enzyme.

[0111] In a further preferred embodiment, the host cell of the invention: [0112] expressing araA, araB and araD, and exhibiting the ability to directly isomerise xylose into xylulose, and optionally [0113] comprising a genetic modification that increase the flux of the pentose pathway as earlier defined herein further comprises a genetic modification that increases the specific xylulose kinase activity. Preferably the genetic modification causes overexpression of a xylulose kinase, e.g. by overexpression of a nucleotide sequence encoding a xylulose kinase. The gene encoding the xylulose kinase may be endogenous to the host cell or may be a xylulose kinase that is heterologous to the host cell. A nucleotide sequence used for overexpression of xylulose kinase in the host cell of the invention is a nucleotide sequence encoding a polypeptide with xylulose kinase activity, whereby preferably the polypeptide has an amino acid sequence having at least 50, 60, 70, 80, 90 or 95% identity with SEQ ID NO. 25 or whereby the nucleotide sequence is capable of hybridising with the nucleotide sequence of SEQ ID NO. 26, under moderate conditions, preferably under stringent conditions.

[0114] A particularly preferred xylulose kinase is a xylose kinase that is related to the xylulose kinase xylB from Piromyces as mentioned in WO 03/0624430. A more preferred nucleotide sequence for use in overexpression of xylulose kinase in the host cell of the invention is a nucleotide sequence encoding a polypeptide with xylulose kinase activity, whereby preferably the polypeptide has an amino acid sequence having at least 45, 50, 55, 60, 65, 70, 80, 90 or 95% identity with SEQ ID NO. 27 or whereby the nucleotide sequence is capable of hybridising with the nucleotide sequence of SEQ ID NO. 28, under moderate conditions, preferably under stringent conditions.

[0115] In the host cells of the invention, genetic modification that increases the specific xylulose kinase activity may be combined with any of the modifications increasing the flux of the pentose phosphate pathway as described above, but this combination is not essential for the invention. Thus, a host cell of the invention comprising a genetic modification that increases the specific xylulose kinase activity in addition to the expression of the araA, araB and araD enzymes as defined herein is specifically included in the invention. The various means available in the art for achieving and analysing overexpression of a xylulose kinase in the host cells of the invention are the same as described above for enzymes of the pentose phosphate pathway. Preferably in the host cells of the invention, a xylulose kinase to be overexpressed is overexpressed by at least a factor 1.1, 1.2, 1.5, 2, 5, 10 or 20 as compared to a strain which is genetically identical except for the genetic modification causing the overexpression. It is to be understood that these levels of overexpression may apply to the steady state level of the enzyme's activity, the steady state level of the enzyme's protein as well as to the steady state level of the transcript coding for the enzyme.

[0116] In a further preferred embodiment, the host cell of the invention: [0117] expressing araA, araB and araD, and exhibiting the ability to directly isomerise xylose into xylulose, and optionally [0118] comprising a genetic modification that increase the flux of the pentose pathway and/or [0119] further comprising a genetic modification that increases the specific xylulose kinase activity all as earlier defined herein further comprises a genetic modification that reduces unspecific aldose reductase activity in the host cell. Preferably, unspecific aldose reductase activity is reduced in the host cell by one or more genetic modifications that reduce the expression of or inactivate a gene encoding an unspecific aldose reductase, as described in WO 06/009434. Preferably, the genetic modifications reduce or inactivate the expression of each endogenous copy of a gene encoding an unspecific aldose reductase in the host cell. Host cells may comprise multiple copies of genes encoding unspecific aldose reductases as a result of di-, poly- or aneu-ploidy, and/or the host cell may contain several different (iso)enzymes with aldose reductase activity that differ in amino acid sequence and that are each encoded by a different gene. Also in such instances preferably the expression of each gene that encodes an unspecific aldose reductase is reduced or inactivated. Preferably, the gene is inactivated by deletion of at least part of the gene or by disruption of the gene, whereby in this context the term gene also includes any non-coding sequence up- or down-stream of the coding sequence, the (partial) deletion or inactivation of which results in a reduction of expression of unspecific aldose reductase activity in the host cell. A nucleotide sequence encoding an aldose reductase whose activity is to be reduced in the host cell of the invention is a nucleotide sequence encoding a polypeptide with aldose reductase activity, whereby preferably the polypeptide has an amino acid sequence having at least 50, 60, 70, 80, 90 or 95% identity with SEQ ID NO. 29 or whereby the nucleotide sequence is capable of hybridising with the nucleotide sequence of SEQ ID NO. 30 under moderate conditions, preferably under stringent conditions.

[0120] In the host cells of the invention, the expression of the araA, araB and araD enzymes as defined herein is combined with genetic modification that reduces unspecific aldose reductase activity. The genetic modification leading to the reduction of unspecific aldose reductase activity may be combined with any of the modifications increasing the flux of the pentose phosphate pathway and/or with any of the modifications increasing the specific xylulose kinase activity in the host cells as described above, but these combinations are not essential for the invention. Thus, a host cell expressing araA, araB, and araD, comprising an additional genetic modification that reduces unspecific aldose reductase activity is specifically included in the invention.

[0121] In a preferred embodiment, the host cell is CBS120327 deposited at the CBS Institute (The Netherlands) on Sep. 27, 2006.

[0122] In a further preferred embodiment, the invention relates to modified host cells that are further adapted to L-arabinose (use L-arabinose and/or convert it into L-ribulose, and/or xylulose 5-phosphate and/or into a desired fermentation product and optionally xylose utilisation by selection of mutants, either spontaneous or induced (e.g. by radiation or chemicals), for growth on L-arabinose and optionally xylose, preferably on L-arabinose and optionally xylose as sole carbon source, and more preferably under anaerobic conditions. Selection of mutants may be performed by serial passaging of cultures as e.g. described by Kuyper et al. (2004, FEMS Yeast Res. 4: 655-664) and/or by cultivation under selective pressure in a chemostat culture as is described in Example 4 of WO 06/009434. This selection process may be continued as long as necessary. This selection process is preferably carried out during one week till one year. However, the selection process may be carried out for a longer period of time if necessary. During the selection process, the cells are preferably cultured in the presence of approximately 20 g/l L-arabinose and/or approximately 20 g/l xylose. The cell obtained at the end of this selection process is expected to be improved as to its capacities of using L-arabinose and/or xylose, and/or converting L-arabinose into L-ribulose and/or xylulose 5-phosphate and/or a desired fermentation product such as ethanol. In this context "improved cell" may mean that the obtained cell is able to use L-arabinose and/or xylose in a more efficient way than the cell it derives from. For example, the obtained cell is expected to better grow: increase of the specific growth rate of at least 2% than the cell it derives from under the same conditions. Preferably, the increase is of at least 4%, 6%, 8%, 10%, 15%, 20%, 25% or more. The specific growth rate may be calculated from OD.sub.660 as known to the skilled person. Therefore, by monitoring the OD.sub.660, one can deduce the specific growth rate. In this context "improved cell" may also mean that the obtained cell converts L-arabinose into L-ribulose and/or xylulose 5-phosphate and/or a desired fermentation product such as ethanol in a more efficient way than the cell it derives from. For example, the obtained cell is expected to produce higher amounts of L-ribulose and/or xylulose 5-phosphate and/or a desired fermentation product such as ethanol: increase of at least one of these compounds of at least 2% than the cell it derives from under the same conditions. Preferably, the increase is of at least 4%, 6%, 8%, 10%, 15%, 20%, 25% or more. In this context "improved cell" may also mean that the obtained cell converts xylose into xylulose and/or a desired fermentation product such as ethanol in a more efficient way than the cell it derives from. For example, the obtained cell is expected to produce higher amounts of xylulose and/or a desired fermentation product such as ethanol: increase of at least one of these compounds of at least 2% than the cell it derives from under the same conditions. Preferably, the increase is of at least 4%, 6%, 8%, 10%, 15%, 20%, 25% or more.

[0123] In a preferred host cell of the invention at least one of the genetic modifications described above, including modifications obtained by selection of mutants, confer to the host cell the ability to grow on L-arabinose and optionally xylose as carbon source, preferably as sole carbon source, and preferably under anaerobic conditions. Preferably the modified host cell produce essentially no xylitol, e.g. the xylitol produced is below the detection limit or e.g. less than 5, 2, 1, 0.5, or 0.3% of the carbon consumed on a molar basis.

[0124] Preferably the modified host cell has the ability to grow on L-arabinose and optionally xylose as sole carbon source at a rate of at least 0.001, 0.005, 0.01, 0.03, 0.05, 0.1, 0.2, 0.25 or 0.3 h.sup.-1 under aerobic conditions, or, if applicable, at a rate of at least 0.001, 0.005, 0.01, 0.03, 0.05, 0.07, 0.08, 0.09, 0.1, 0.12, 0.15 or 0.2 h.sup.-1 under anaerobic conditions Preferably the modified host cell has the ability to grow on a mixture of glucose and L-arabinose and optionally xylose (in a 1:1 weight ratio) as sole carbon source at a rate of at least 0.001, 0.005, 0.01, 0.03, 0.05, 0.1, 0.2, 0.25 or 0.3 h.sup.-1 under aerobic conditions, or, if applicable, at a rate of at least 0.001, 0.005, 0.01, 0.03, 0.05, 0.1, 0.12, 0.15, or 0.2 h.sup.-1 under anaerobic conditions.

[0125] Preferably, the modified host cell has a specific L-arabinose and optionally xylose consumption rate of at least 346, 350, 400, 500, 600, 650, 700, 750, 800, 900 or 1000 mg/g cells/h. Preferably, the modified host cell has a yield of fermentation product (such as ethanol) on L-arabinose and optionally xylose that is at least 20, 25, 30, 35, 40, 45, 50, 55, 60, 70, 80, 85, 90, 95 or 98% of the host cell's yield of fermentation product (such as ethanol) on glucose. More preferably, the modified host cell's yield of fermentation product (such as ethanol) on L-arabinose and optionally xylose is equal to the host cell's yield of fermentation product (such as ethanol) on glucose. Likewise, the modified host cell's biomass yield on L-arabinose and optionally xylose is preferably at least 55, 60, 70, 80, 85, 90, 95 or 98% of the host cell's biomass yield on glucose. More preferably, the modified host cell's biomass yield on L-arabinose and optionally xylose is equal to the host cell's biomass yield on glucose. It is understood that in the comparison of yields on glucose and L-arabinose and optionally xylose both yields are compared under aerobic conditions or both under anaerobic conditions.

[0126] In a more preferred embodiment, the host cell is CBS120328 deposited at the CBS Institute (The Netherlands) on Sep. 27, 2006 or CBS121879 deposited at the CBS Institute (The Netherlands) on Sep. 20, 2007.

[0127] In a preferred embodiment, the cell expresses one or more enzymes that confer to the cell the ability to produce at least one fermentation product selected from the group consisting of ethanol, lactic acid, 3-hydroxy-propionic acid, acrylic acid, acetic acid, succinic acid, citric acid, malic acid, fumaric acid, an amino acid, 1,3-propane-diol, ethylene, glycerol, butanol, a .beta.-lactam antibiotic and a cephalosporin. In a more preferred embodiment, the host cell of the invention is a host cell for the production of ethanol. In another preferred embodiment, the invention relates to a transformed host cell for the production of fermentation products other than ethanol. Such non-ethanolic fermentation products include in principle any bulk or fine chemical that is producible by a eukaryotic microorganism such as a yeast or a filamentous fungus. Such fermentation products include e.g. lactic acid, 3-hydroxy-propionic acid, acrylic acid, acetic acid, succinic acid, citric acid, malic acid, fumaric acid, an amino acid, 1,3-propane-diol, ethylene, glycerol, butanol, a .beta.-lactam antibiotic and a cephalosporin. A preferred host cell of the invention for production of non-ethanolic fermentation products is a host cell that contains a genetic modification that results in decreased alcohol dehydrogenase activity.

Method

[0128] In a further aspect, the invention relates to fermentation processes in which a host cell of the invention is used for the fermentation of a carbon source comprising a source of L-arabinose and optionally a source of xylose. Preferably, the source of L-arabinose and the source of xylose are L-arabinose and xylose. In addition, the carbon source in the fermentation medium may also comprise a source of glucose. The source of L-arabinose, xylose or glucose may be L-arabinose, xylose or glucose as such or may be any carbohydrate oligo- or polymer comprising L-arabinose, xylose or glucose units, such as e.g. lignocellulose, xylans, cellulose, starch, arabinan and the like. For release of xylose or glucose units from such carbohydrates, appropriate carbohydrases (such as xylanases, glucanases, amylases and the like) may be added to the fermentation medium or may be produced by the modified host cell. In the latter case the modified host cell may be genetically engineered to produce and excrete such carbohydrases. An additional advantage of using oligo- or polymeric sources of glucose is that it enables to maintain a low(er) concentration of free glucose during the fermentation, e.g. by using rate-limiting amounts of the carbohydrases. This, in turn, will prevent repression of systems required for metabolism and transport of non-glucose sugars such as xylose. In a preferred process the modified host cell ferments both the L-arabinose (optionally xylose) and glucose, preferably simultaneously in which case preferably a modified host cell is used which is insensitive to glucose repression to prevent diauxic growth. In addition to a source of L-arabinose, optionally xylose (and glucose) as carbon source, the fermentation medium will further comprise the appropriate ingredient required for growth of the modified host cell. Compositions of fermentation media for growth of microorganisms such as yeasts or filamentous fungi are well known in the art.

[0129] In a preferred process, there is provided a process for producing a fermentation product selected from the group consisting of ethanol, lactic acid, 3-hydroxy-propionic acid, acrylic acid, acetic acid, succinic acid, citric acid, malic acid, fumaric acid, an amino acid, 1,3-propane-diol, ethylene, glycerol, butanol, a .beta.-lactam antibiotic and a cephalosporin whereby the process comprises the steps of: [0130] (a) fermenting a medium containing a source of L-arabinose and optionally xylose with a modified host cell as defined herein, whereby the host cell ferments L-arabinose and optionally xylose to the fermentation product, and optionally, [0131] (b) recovering the fermentation product.

[0132] The fermentation process is a process for the production of a fermentation product such as e.g. ethanol, lactic acid, 3-hydroxy-propionic acid, acrylic acid, acetic acid, succinic acid, citric acid, malic acid, fumaric acid, an amino acid, 1,3-propane-diol, ethylene, glycerol, butanol, a .beta.-lactam antibiotic, such as Penicillin G or Penicillin V and fermentative derivatives thereof, and/or a cephalosporin. The fermentation process may be an aerobic or an anaerobic fermentation process. An anaerobic fermentation process is herein defined as a fermentation process run in the absence of oxygen or in which substantially no oxygen is consumed, preferably less than 5, 2.5 or 1 mmol/L/h, more preferably 0 mmol/L/h is consumed (i.e. oxygen consumption is not detectable), and wherein organic molecules serve as both electron donor and electron acceptors. In the absence of oxygen, NADH produced in glycolysis and biomass formation, cannot be oxidised by oxidative phosphorylation. To solve this problem many microorganisms use pyruvate or one of its derivatives as an electron and hydrogen acceptor thereby regenerating NAD.sup.+. Thus, in a preferred anaerobic fermentation process pyruvate is used as an electron (and hydrogen acceptor) and is reduced to fermentation products such as ethanol, lactic acid, 3-hydroxy-propionic acid, acrylic acid, acetic acid, succinic acid, citric acid, malic acid, fumaric acid, an amino acid, 1,3-propane-diol, ethylene, glycerol, butanol, a .beta.-lactam antibiotics and a cephalosporin. In a preferred embodiment, the fermentation process is anaerobic. An anaerobic process is advantageous since it is cheaper than aerobic processes: less special equipment is needed. Furthermore, anaerobic processes are expected to give a higher product yield than aerobic processes. Under aerobic conditions, usually the biomass yield is higher than under anaerobic conditions. As a consequence, usually under aerobic conditions, the expected product yield is lower than under anaerobic conditions. According to the inventors, the process of the invention is the first anaerobic fermentation process with a medium comprising a source of L-arabinose that has been developed so far.

[0133] In another preferred embodiment, the fermentation process is under oxygen-limited conditions. More preferably, the fermentation process is aerobic and under oxygen-limited conditions. An oxygen-limited fermentation process is a process in which the oxygen consumption is limited by the oxygen transfer from the gas to the liquid. The degree of oxygen limitation is determined by the amount and composition of the ingoing gasflow as well as the actual mixing/mass transfer properties of the fermentation equipment used. Preferably, in a process under oxygen-limited conditions, the rate of oxygen consumption is at least 5.5, more preferably at least 6 and even more preferably at least 7 mmol/L/h.

[0134] The fermentation process is preferably run at a temperature that is optimal for the modified cell. Thus, for most yeasts or fungal cells, the fermentation process is performed at a temperature which is less than 42.degree. C., preferably less than 38.degree. C. For yeast or filamentous fungal host cells, the fermentation process is preferably performed at a temperature which is lower than 35, 33, 30 or 28.degree. C. and at a temperature which is higher than 20, 22, or 25.degree. C.

[0135] A preferred process is a process for the production of ethanol, whereby the process comprises the steps of: (a) fermenting a medium containing a source of L-arabinose and optionally xylose with a modified host cell as defined herein, whereby the host cell ferments L-arabinose and optionally xylose to ethanol; and optionally, (b) recovery of the ethanol. The fermentation medium may also comprise a source of glucose that is also fermented to ethanol. In a preferred embodiment, the fermentation process for the production of ethanol is anaerobic. Anaerobic has already been defined earlier herein. In another preferred embodiment, the fermentation process for the production of ethanol is aerobic. In another preferred embodiment, the fermentation process for the production of ethanol is under oxygen-limited conditions, more preferably aerobic and under oxygen-limited conditions. Oxygen-limited conditions have already been defined earlier herein.

[0136] In the process, the volumetric ethanol productivity is preferably at least 0.5, 1.0, 1.5, 2.0, 2.5, 3.0, 5.0 or 10.0 g ethanol per litre per hour. The ethanol yield on L-arabinose and optionally xylose and/or glucose in the process preferably is at least 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 95 or 98%. The ethanol yield is herein defined as a percentage of the theoretical maximum yield, which, for glucose and L-arabinose and optionally xylose is 0.51 g. ethanol per g. glucose or xylose. In another preferred embodiment, the invention relates to a process for producing a fermentation product selected from the group consisting of lactic acid, 3-hydroxy-propionic acid, acrylic acid, acetic acid, succinic acid, citric acid, malic acid, fumaric acid, an amino acid, 1,3-propane-diol, ethylene, glycerol, butanol, a .beta.-lactam antibiotic and a cephalosporin. The process preferably comprises the steps of (a) fermenting a medium containing a source of L-arabinose and optionally xylose with a modified host cell as defined herein above, whereby the host cell ferments L-arabinose and optionally xylose to the fermentation product, and optionally, (b) recovery of the fermentation product. In a preferred process, the medium also contains a source of glucose.

[0137] In the fermentation process of the invention leading to the production of ethanol, several advantages can be cited by comparison to known ethanol fermentations processes: [0138] anaerobic processes are possible. [0139] oxygen limited conditions are also possible. [0140] higher ethanol yields and ethanol production rates can be obtained. [0141] the strain used may be able to use L-arabinose and optionally xylose.

[0142] Alternatively to the fermentation processes described above, another fermentation process is provided as a further aspect of the invention wherein, at least two distinct cells are used for the fermentation of a carbon source comprising at least two sources of carbon selected from the group consisting of but not limited thereto: a source of L-arabinose, a source of xylose and a source of glucose. In this fermentation process, "at least two distinct cells" means this process is preferably a co-fermentation process. In one preferred embodiment, two distinct cells are used: one being the one of the invention as earlier defined able to use L-arabinose, and/or to convert it into L-ribulose, and/or xylulose 5-phosphate and/or into a desired fermentation product such as ethanol and optionally being able to use xylose, the other one being for example a strain which is able to use xylose and/or convert it into a desired fermentation product such as ethanol as defined in WO 03/062430 and/or WO 06/009434. A cell which is able to use xylose is preferably a strain which exhibits the ability of directly isomerising xylose into xylulose (in one step) as earlier defined herein. These two distinct strains are preferably cultived in the presence of a source of L-arabinose, a source of xylose and optionally a source of glucose. Three distinct cells or more may be co-cultivated and/or three or more sources of carbon may be used, provided at least one cell is able to use at least one source of carbon present and/or to convert it into a desired fermentation product such as ethanol. The expression "use at least one source of carbon" has the same meaning as the expression "use of L-arabinose". The expression "convert it (i.e. a source of carbon) into a desired fermentation product has the same meaning as the expression "convert L-arabinose into a desired fermentation product".

[0143] In a preferred embodiment, the invention relates to a process for producing a fermentation product selected from the group consisting of ethanol, lactic acid, 3-hydroxy-propionic acid, acrylic acid, acetic acid, succinic acid, citric acid, malic acid, fumaric acid, amino acids, 1,3-propane-diol, ethylene, glycerol, butanol, .beta.-lactam antibiotics and cephalosporins, whereby the process comprises the steps of: [0144] (a) fermenting a medium containing at least a source of L-arabinose and a source of xylose with a cell of the invention as earlier defined herein and a cell able to use xylose and/or exhibiting the ability to directly isomerise xylose into xylulose, whereby each cell ferments L-arabinose and/or xylose to the fermentation product, and optionally, [0145] (b) recovering the fermentation product. All preferred embodiments of the fermentation processes as described above are also preferred embodiments of this further fermentation processes: identity of the fermentation product, identity of source of L-arabinose and source of xylose, conditions of fermentation (aerobical or anaerobical conditions, oxygen-limited conditions, temperature at which the process is being carried out, productivity of ethanol, yield of ethanol).

Genetic Modifications

[0146] For overexpression of enzymes in the host cells of the inventions as described above, as well as for additional genetic modification of host cells, preferably yeasts, host cells are transformed with the various nucleic acid constructs of the invention by methods well known in the art. Such methods are e.g. known from standard handbooks, such as Sambrook and Russel (2001) "Molecular Cloning: A Laboratory Manual (3.sup.rd edition), Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, or F. Ausubel et al, eds., "Current protocols in molecular biology", Green Publishing and Wiley Interscience, New York (1987). Methods for transformation and genetic modification of fungal host cells are known from e.g. EP-A-0 635 574, WO 98/46772, WO 99/60102 and WO 00/37671.

[0147] Promoters for use in the nucleic acid constructs for overexpression of enzymes in the host cells of the invention have been described above. In the nucleic acid constructs for overexpression, the 3'-end of the nucleotide acid sequence encoding the enzyme(s) preferably is operably linked to a transcription terminator sequence. Preferably the terminator sequence is operable in a host cell of choice, such as e.g. the yeast species of choice. In any case the choice of the terminator is not critical; it may e.g. be from any yeast gene, although terminators may sometimes work if from a non-yeast, eukaryotic, gene. The transcription termination sequence further preferably comprises a polyadenylation signal. Preferred terminator sequences are the alcohol dehydrogenase (ADH1) and the PGI1 terminators. More preferably, the ADH1 and the PGI1 terminators are both from S. cerevisiae (SEQ ID NO:50 and SEQ ID NO:53 respectively).

[0148] Optionally, a selectable marker may be present in the nucleic acid construct. As used herein, the term "marker" refers to a gene encoding a trait or a phenotype which permits the selection of, or the screening for, a host cell containing the marker. The marker gene may be an antibiotic resistance gene whereby the appropriate antibiotic can be used to select for transformed cells from among cells that are not transformed. Preferably however, non-antibiotic resistance markers are used, such as auxotrophic markers (URA3, TRP1, LEU). In a preferred embodiment the host cells transformed with the nucleic acid constructs are marker gene free. Methods for constructing recombinant marker gene free microbial host cells are disclosed in EP-A-0 635 574 and are based on the use of bidirectional markers. Alternatively, a screenable marker such as Green Fluorescent Protein, lacZ, luciferase, chloramphenicol acetyltransferase, beta-glucuronidase may be incorporated into the nucleic acid constructs of the invention allowing to screen for transformed cells.

[0149] Optional further elements that may be present in the nucleic acid constructs of the invention include, but are not limited to, one or more leader sequences, enhancers, integration factors, and/or reporter genes, intron sequences, centromers, telomers and/or matrix attachment (MAR) sequences. The nucleic acid constructs of the invention may further comprise a sequence for autonomous replication, such as an ARS sequence. Suitable episomal nucleic acid constructs may e.g. be based on the yeast 2.mu. or pKD1 (Fleer et al., 1991, Biotechnology 9:968-975) plasmids. Alternatively the nucleic acid construct may comprise sequences for integration, preferably by homologous recombination. Such sequences may thus be sequences homologous to the target site for integration in the host cell's genome. The nucleic acid constructs of the invention can be provided in a manner known per se, which generally involves techniques such as restricting and linking nucleic acids/nucleic acid sequences, for which reference is made to the standard handbooks, such as Sambrook and Russel (2001) "Molecular Cloning: A Laboratory Manual (3.sup.rd edition), Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press.

[0150] Methods for inactivation and gene disruption in yeast or fungi are well known in the art (see e.g. Fincham, 1989, Microbiol Rev. 53(1):148-70 and EP-A-0 635 574).

[0151] In this document and in its claims, the verb "to comprise" and its conjugations is used in its non-limiting sense to mean that items following the word are included, but items not specifically mentioned are not excluded. In addition, reference to an element by the indefinite article "a" or "an" does not exclude the possibility that more than one of the element is present, unless the context clearly requires that there be one and only one of the elements. The indefinite article "a" or "an" thus usually means "at least one".

[0152] The invention is further described by the following examples, which should not be construed as limiting the scope of the invention.

EXAMPLES

Plasmid and Strain Construction

Strains

[0153] The L-arabinose consuming Sachharomyces cerevisiae strain described in this work is based on strain RWB220, which is itself a derivative of RWB217. RWB217 is a CEN.PK strain in which four genes coding for the expression of enzymes in the pentose phosphate pathway have been overexpressed, TAL1, TKL1, RPE1, RKI1 (Kuyper et al., 2005a). In addition the gene coding for an aldose reductase (GRE3), has been deleted. Strain RWB217 also contains two plasmids, a single copy plasmid with a LEU2 marker for overexpression of the xylulokinase (XKS1) and an episomal, multicopy plasmid with URA3 as the marker for the expression of the xylose isomerase, XylA. RWB217 was subjected to a selection procedure for improved growth on xylose which is described in Kuyper et al. (2005b). The procedure resulted in two pure strains, RWB218 (Kuyper et al., 2005b) and RWB219. The difference between RWB218 and RWB219 is that after the selection procedure, RWB218 was obtained by plating and restreaking on mineral medium with glucose as the carbon source, while for RWB219 xylose was used.

[0154] Strain RWB219 was grown non-selectively on YP with glucose (YPD) as the carbon source in order to facilitate the loss of both plasmids. After plating on YPD single colonies were tested for plasmid loss by looking at uracil and leucine auxotrophy. A strain that had lost both plasmids was transformed with pSH47, containing the cre recombinase, in order to remove a KanMX cassette (Guldener et al., 1996), still present after integrating the RKI1 overexpression construct. Colonies with the plasmid were resuspended in Yeast Peptone medium (YP) (10 g/l yeast extract and 20 g/l peptone both from BD Difco Belgium) with 1% galactose and incubated for 1 hour at 30.degree. C. About 200 cells were plated on YPD. The resulting colonies were checked for loss of the KanMX marker (G418 resistance) and pSH47 (URA3). A strain that had lost both the KanMX marker and the pSH47 plasmid was then named RWB220. To obtain the strain tested in this patent, RWB220 was transformed with pRW231 and pRW243 (table 2), resulting in strain IMS0001.

[0155] During construction strains were maintained on complex YP: 10 g l.sup.-1 yeast extract (BD Difco), 20 g l.sup.-1 peptone (BD Difco) or synthetic medium (MY) (Verduyn et al., 1992) supplemented with glucose (2%) as carbon source (YPD or MYD) and 1.5% agar in the case of plates. After transformation with plasmids strains were plated on MYD. Transformations of yeast were done according to Gietz and Woods (2002). Plasmids were amplified in Escherichia coli strain XL-1 blue (Stratagene, La Jolla, Calif., USA). Transformation was performed according to Inoue et al. (1990). E. coli was grown on LB (Luria-Bertani) plates or in liquid TB (Terrific Broth) medium for the isolation of plasmids (Sambrook et al, 1989).

Plasmids

[0156] In order to grow on L-arabinose, yeast needs to express three different genes, an L-arabinose isomerase (AraA), a L-ribulokinase (AraB), and a L-ribulose-5-P 4-epimerase (AraD) (Becker and Boles, 2003). In this work we have chosen to express AraA, AraB, and AraD from the lactic acid bacterium Lactobacillus plantarum in S. cerevisiae. Because the eventual aim is to consume L-arabinose in combination with other sugars, like D-xylose, the genes encoding the bacterial L-arabinose pathway were combined on the same plasmid with the genes coding for D-xylose consumption.

[0157] In order to get a high level of expression, the L. plantarum AraA and AraD genes were ligated into plasmid pAKX002, the 2.mu. XylA bearing plasmid.

[0158] The AraA cassette was constructed by amplifying a truncated version of the TDH3 promoter with SpeI5'Ptdh3 and 5'AraAPtdh3 (SEQ ID NO: 49), the AraA gene with Ptdh5'AraA and Tadh3'AraA and the ADH1 terminator (SEQ ID NO:50) with 3'AraATadh1 and 3'Tadh1-SpeI. The three fragments were extracted from gel and mixed in roughly equimolar amounts. On this mixture a PCR was performed using the SpeI-5'Ptdh3 and 3'Tadh1SpeI oligos. The resulting P.sub.TDH3-AraA-T.sub.ADH1 cassette was gel purified, cut at the 5' and 3' SpeI sites and then ligated into pAKX002 cut with NheI, resulting in plasmid pRW230.

[0159] The AraD construct was made by first amplifying a truncated version of the HXT7 promoter (SEQ ID NO:52) with oligos SalI5'Phxt7 and 5'AraDPhxt, the AraD gene with Phxt5'AraD and Tpgi3'AraD and the GPI1 terminator (SEQ ID NO:53) region with the 3'AraDTpgi and 3'TpgiSalI oligos. The resulting fragments were extracted from gel and mixed in roughly equimolar amounts, after which a PCR was performed using the SalI5'Phxt7 and 3'Tpgi1SalI oligos. The resulting P.sub.HXT7-AraD-T.sub.PGI1 cassette was gel purified, cut at the 5' and 3' SalI sites and then ligated into pRW230 cut with XhoI, resulting in plasmid pRW231 (FIG. 1).

[0160] Since too high an expression of the L-ribulokinase is detrimental to growth (Becker and Boles, 2003), the AraB gene was combined with the XKS1 gene, coding for xylulokinase, on an integration plasmid. For this, p415ADHXKS (Kuyper et al., 2005a) was first changed into pRW229, by cutting both p415ADHXKS and pRS305 with PvuI and ligating the ADHXKS-containing PvuI fragment from p415ADHXKS to the vector backbone from pRS305, resulting in pRW229.

[0161] A cassette, containing the L. plantarum AraB gene between the PGI1 promoter (SEQ ID NO:51) and ADH1 terminator (SEQ ID NO:50) was made by amplifying the PGI1 promoter with the SacI5'Ppgi1 and 5'AraBPpgi1 oligos, the AraB gene with the Ppgi5'AraB and Tadh3'AraB oligos and the ADH1 terminator with 3'AraBTadh1 and 3'Tadh1SacI oligos. The three fragments were extracted from gel and mixed in roughly equimolar amounts. On this mixture a PCR was performed using the SacI-5'Ppgi 1 and 3'Tadh1SacI oligos. The resulting P.sub.PGI1-AraB-T.sub.ADH1 cassette was gel purified, cut at the 5' and 3' Sad sites and then ligated into pRW229 cut with SacI, resulting in plasmid pRW243 (FIG. 1).

[0162] Strain RWB220 was transformed with pRW231 and pRW243 (table 2), resulting in strain IMS0001.

[0163] Restriction endonucleases (New England Biolabs, Beverly, Mass., USA and Roche, Basel, Switzerland) and DNA ligase (Roche) were used according to the manufacturers' specifications. Plasmid isolation from E. coli was performed with the Qiaprep spin miniprep kit (Qiagen, Hilden, Germany). DNA fragments were separated on a 1% agarose (Sigma, St. Louis, Mo., USA) gel in 1.times.TBE (Sambrook et al, 1989). Isolation of fragments from gel was carried out with the Qiaquick gel extraction kit (Quiagen). Amplification of the (elements of the) AraA, AraB and AraD cassettes was done with Vent.sub.R DNA polymerase (New England Biolabs) according to the manufacturer's specification. The template was chromosomal DNA of S. cerevisiae CEN.PK113-7D for the promoters and terminators, or Lactobacillus plantarum DSM20205 for the Ara genes. The polymerase chain reaction (PCR) was performed in a Biometra TGradient Thermocycler (Biometra, Gottingen, Germany) with the following settings: 30 cycles of 1 min annealing at 55.degree. C., 60.degree. C. or 65.degree. C., 1 to 3 min extension at 75.degree. C., depending on expected fragment size, and 1 min denaturing at 94.degree. C.

Cultivation and Media

[0164] Shake-flask cultivations were performed at 30.degree. C. in a synthetic medium (Verduyn et al., 1992). The pH of the medium was adjusted to 6.0 with 2 M KOH prior to sterilisation. For solid synthetic medium, 1.5% of agar was added.

[0165] Pre-cultures were prepared by inoculating 100 ml medium containing the appropriate sugar in a 500-ml shake flask with a frozen stock culture. After incubation at 30.degree. C. in an orbital shaker (200 rpm), this culture was used to inoculate either shake-flask cultures or fermenter cultures. The synthetic medium for anaerobic cultivation was supplemented with 0.01 g l.sup.-1 ergosterol and 0.42 g Tween 80 dissolved in ethanol (Andreasen and Stier, 1953; Andreasen and Stier, 1954). Anaerobic (sequencing) batch cultivation was carried out at 30.degree. C. in 2-1 laboratory fermenters (Applikon, Schiedam, The Netherlands) with a working volume of 1 l. The culture pH was maintained at pH 5.0 by automatic addition of 2 M KOH. Cultures were stirred at 800 rpm and sparged with 0.5 l min.sup.-1 nitrogen gas (<10 ppm oxygen). To minimise diffusion of oxygen, fermenters were equipped with Norprene tubing (Cole Palmer Instrument company, Vernon Hills, USA). Dissolved oxygen was monitored with an oxygen electrode (Applisens, Schiedam, The Netherlands). Oxygen-limited conditions were achieved in the same experimental set-up by headspace aeration at approximately 0.05 l min.sup.-1.

Determination of Dry Weight

[0166] Culture samples (10.0 ml) were filtered over preweighed nitrocellulose filters (pore size 0.45 .mu.m; Gelman laboratory, Ann Arbor, USA). After removal of medium, the filters were washed with demineralised water and dried in a microwave oven (Bosch, Stuttgart, Germany) for 20 min at 360 W and weighed. Duplicate determinations varied by less than 1%.

Gas Analysis

[0167] Exhaust gas was cooled in a condensor (2.degree. C.) and dried with a Permapure dryer type MD-110-48P-4 (Permapure, Toms River, USA). O2 and CO2 concentrations were determined with a NGA 2000 analyser (Rosemount Analytical, Orrville, USA). Exhaust gasflow rate and specific oxygen-consumption and carbondioxide production rates were determined as described previously (Van Urk et al., 1988; Weusthuis et al., 1994). In calculating these biomass-specific rates, volume changes caused by withdrawing culture samples were taken account for.

Metabolite Analysis

[0168] Glucose, xylose, arabinose, xylitol, organic acids, glycerol and ethanol were analysed by HPLC using a Waters Alliance 2690 HPLC (Waters, Milford, USA) supplied with a BioRad HPX 87H column (BioRad, Hercules, USA), a Waters 2410 refractive-index detector and aWaters 2487 UV detector. The column was eluted at 60.degree. C. with 0.5 g l.sup.-1 sulphuric acid at a flow rate of 0.6 ml min.sup.-1.

Assay for Xylulose 5-Phosphate (Zaldivar J., et al, Appl. Microbiol. Biotechnol., (2002), 59:436-442)

[0169] For the analysis of intracellular metabolites such as xylulose 5-phosphate, 5 ml broth was harvested in duplicate from the reactors, before glucose exhaustion (at 22 and 26 h of cultivation) and after glucose exhaustion (42, 79 and 131 h of cultivation). Procedures for metabolic arrest, solid-phase extraction of metabolites and analysis have been described in detail by Smits H. P. et al. (Anal. Biochem., 261:36-42, (1998)). However, the analysis by high-pressure ion exchange chromatography coupled to pulsed amperometric detection used to analyze cell extracts, was slightly modified. Solutions used were eluent A, 75 mM NaOH, and eluent B, 500 mM NaAc. To prevent contamination of carbonate in the eluent solutions, a 50% NaOH solution with low carbonate concentration (Baker Analysed, Deventer, The Netherlands) was used instead of NaOH pellets. The eluents were degassed with Helium (He) for 30 min and then kept under a He atmosphere. The gradient pump was programmed to generate the following gradients: 100% A and 0% B (0 min), a linear decrease of A to 70% and a linear increase of B to 30% (0-30 min), a linear decrease of A to 30% and a linear increase of B to 70% (30-70 min), a linear decrease of A to 0% and a linear increase of B to 100% (70-75 min), 0% A and 100% B (75-85 min), a linear increase of A to 100% and a linear decrease of B to 0% (85-95 min). The mobile phase was run at a flow rate of 1 ml/min. Other conditions were according to Smits et al. (1998).

Carbon Recovery

[0170] Carbon recoveries were calculated as carbon in products formed, divided by the total amount of sugar carbon consumed, and were based on a carbon content of biomass of 48%. To correct for ethanol evaporation during the fermentations, the amount of ethanol produced was assumed to be equal to the measured cumulative production of CO.sub.2 minus the CO.sub.2 production that occurred due to biomass synthesis (5.85 mmol CO.sub.2 per gram biomass (Verduyn et al., 1990)) and the CO.sub.2 associated with acetate formation.

Selection for Growth on L-Arabinose

[0171] Strain IMS0001 (CBS120327 deposited at the CBS on 27/09/06), containing the genes encoding the pathways for both xylose (XylA and XKS1) and arabinose (AraA, AraB, AraD) metabolization, was constructed according the procedure described above. Although capable of growing on xylose (data not shown), strain IMS0001 did not seem to be capable of growing on solid synthetic medium supplemented with 2% L-arabinose. Mutants of IMS0001 capable of utilizing L-arabinose as carbon source for growth were selected by serial transfer in shake flasks and by sequencing-batch cultivation in fermenters (SBR).

[0172] For the serial transfer experiments, a 500-ml shake flask containing 100 ml synthetic medium containing 0.5% galactose were inoculated with either strain IMS0001, or the reference strain RWB219. After 72 hours, at an optical density at 660 nm of 3.0, the cultures were used to inoculate a new shake flask containing 0.1% galactose and 2% arabinose. Based on HPLC determination with D-ribulose as calibration standard, it was determined that already in the first cultivations of strain IMS0001, on medium containing a galactose/arabinose mixture, part of the arabinose was converted into ribulose and subsequently excreted to the supernatant. These HPLC analyses were performed using a Waters Alliance 2690 HPLC (Waters, Milford, USA) supplied with a BioRad HPX 87H column (BioRad, Hercules, USA), a Waters 2410 refractive-index detector and a Waters 2487 UV detector. The column was eluted at 60.degree. C. with 0.5 g sulphuric acid at a flow rate of 0.6 ml min.sup.-1. In contrast to the reference strain RWB219, the OD.sub.660 of the culture of strain IMS0001 increased after depletion of the galactose. When after approximately 850 hours growth on arabinose by strain IMS0001 was observed (FIG. 2), this culture was transferred at an OD.sub.660 of 1.7 to a shake flask containing 2% arabinose. Cultures were then sequentially transferred to fresh medium containing 2% arabinose at an OD.sub.660 of 2-3. Utilization of arabinose was confirmed by occasionally measuring arabinose concentrations by HPLC (data not shown). The growth rate of these cultures increased from 0 to 0.15 h.sup.-1 in approximately 3600 hours (FIG. 3).

[0173] A batch fermentation under oxygen limited conditions was started by inoculating 1 l of synthetic medium supplemented with 2% of arabinose with a 100 ml shake flask culture of arabinose-grown IMS0001 cells with a maximum growth rate on 2% of L-arabinose of approximately 0.12 h.sup.-1. When growth on arabinose was observed, the culture was subjected to anaerobic conditions by sparging with nitrogen gas. The sequential cycles of anaerobic batch cultivation were started by either manual or automated replacement of 90% of the culture with synthetic medium with 20 g l.sup.-1 arabinose. For each cycle during the SBR fermentation, the exponential growth rate was estimated from the CO.sub.2 profile (FIG. 4). In 13 cycles, the exponential growth rate increased from 0.025 to 0.08 h.sup.-1. After 20 cycles a sample was taken, and plated on solid synthetic medium supplemented with 2% of L-arabinose and incubated at 30.degree. C. for several days. Separate colonies were re-streaked twice on solid synthetic medium with L-arabinose. Finally, a shake flask containing synthetic medium with 2% of L-L-arabinose was inoculated with a single colony, and incubated for 5 days at 30.degree. C. This culture was designated as strain IMS0002 (CBS120328 deposited at the Centraal Bureau voor Schimmelculturen (CBS) on 27/09/06). Culture samples were taken, 30% of glycerol was added and samples were stored at -80.degree. C.

Mixed Culture Fermentation

[0174] Biomass hydrolysates, a desired feedstock for industrial biotechnology, contain complex mixtures consisting of various sugars amongst which glucose, xylose and arabinose are commonly present in significant fractions. To accomplish ethanolic fermentation of not only glucose and arabinose, but also xylose, an anaerobic batch fermentation was performed with a mixed culture of the arabinose-fermenting strain IMS0002, and the xylose-fermenting strain RWB218. An anaerobic batch fermenter containing 800 ml of synthetic medium supplied with 30 g l.sup.-1 D-glucose, 15 g l.sup.-1 D-xylose, and 15 g l.sup.-1 L-arabinose was inoculated with 100 ml of pre-culture of strain IMS0002. After 10 hours, a 100 ml inoculum of RWB218 was added. In contrast to the mixed sugar fermentation with only strain IMS0002, both xylose and arabinose were consumed after glucose depletion (FIG. 5D). The mixed culture completely consumed all sugars, and within 80 hours 564.0.+-.6.3 mmol 1.sup.1 ethanol (calculated from the CO.sub.2 production) was produced with a high overall yield of 0.42 g g.sup.-1 sugar. Xylitol was produced only in small amounts, to a concentration of 4.7 mmol l.sup.-1.

Characterization of Strain IMS0002

[0175] Growth and product formation of strain IMS0002 was determined during anaerobic batch fermentations on synthetic medium with either L-arabinose as the sole carbon source, or a mixture of glucose, xylose and L-arabinose. The pre-cultures for these anaerobic batch fermentations were prepared in shake flasks containing 100 ml of synthetic medium with 2% L-arabinose, by inoculating with -80.degree. C. frozen stocks of strain IMS0002, and incubating for 48 hours at 30.degree. C.

[0176] FIG. 5A shows that strain IMS0002 is capable of fermenting 20 g l.sup.-1 L-arabinose to ethanol during an anaerobic batch fermentation of approximately 70 hours. The specific growth rate under anaerobic conditions with L-arabinose as sole carbon source was 0.05.+-.0.001 h.sup.-1. Taking into account the ethanol evaporation during the batch fermentation, the ethanol yield from 20 g l.sup.-1 arabinose was 0.43.+-.0.003 g g.sup.-1. Without evaporation correction the ethanol yield was 0.35.+-.0.01 g g.sup.-1 of arabinose. No formation of arabinitol was observed during anaerobic growth on arabinose. In FIG. 5B, the ethanolic fermentation of a mixture of 20 g l.sup.-1 glucose and 20 g l.sup.-1 L-arabinose by strain IMS0002 is shown. L-arabinose consumption started after glucose depletion. Within 70 hours, both the glucose and L-arabinose were completely consumed. The ethanol yield from the total of sugars was 0.42.+-.0.003 g g.sup.-1.

[0177] In FIG. 5C, the fermentation profile of a mixture of 30 g l.sup.-1 glucose, 15 g l.sup.-1 D-xylose, and 15 g l.sup.-1 L-arabinose by strain IMS0002 is shown. Arabinose consumption started after glucose depletion. Within 80 hours, both the glucose and arabinose were completely consumed. Only 20 mM from 100 mM of xylose was consumed by strain IMS0002. In addition, the formation of 20 mM of xylitol was observed. Apparently, the xylose was converted into xylitol by strain IMS0002. Hence, the ethanol yield from the total of sugars was lower than for the above described fermentations: 0.38.+-.0.001 g g.sup.-1. The ethanol yield from the total of glucose and arabinose was similar to the other fermentations: 0.43.+-.0.001 g g.sup.-1.

[0178] Table 1 shows the arabinose consumption rates and the ethanol production rates observed for the anaerobic batch fermentation of strain IMS0002. Arabinose was consumed with a rate of 0.23-0.75 g h.sup.-1 g.sup.-1 biomass dry weight. The rate of ethanol produced from arabinose varied from 0.08-0.31 g h.sup.-1 g.sup.-1 biomass dry weight.

[0179] Initially, the constructed strain IMS0001 was able to ferment xylose (data not shown). In contrast to our expectations, the selected strain IMS0002 was not capable of fermenting xylose to ethanol (FIG. 5C). To regain the capability of fermenting xylose, a colony of strain IMS0002 was transferred to solid synthetic medium with 2% of D-xylose, and incubated in an anaerobic jar at 30.degree. C. for 25 days. Subsequently, a colony was again transferred to solid synthetic medium with 2% of arabinose. After 4 days of incubation at 30.degree. C., a colony was transferred to a shake flask containing synthetic medium with 2% arabinose. After incubation at 30.degree. C. for 6 days, 30% of glycerol was added, samples were taken and stored at -80.degree. C. A shake flask containing 100 ml of synthetic medium with 2% arabinose was inoculated with such a frozen stock, and was used as preculture for an anaerobic batch fermentation on synthetic medium with 20 g l.sup.-1 xylose and 20 g l.sup.-1 arabinose. In FIG. 6, the fermentation profile of this batch fermentation is shown. Xylose and arabinose were consumed simultaneously. The arabinose was completed within 70 hours, whereas the xylose was completely consumed in 120 hours. At least 250 mM of ethanol was produced from the total of sugars, not taking into account the evaporation of the ethanol. Assuming an end biomass dry weight of 3.2 g l.sup.-1 (assuming a biomass yield of 0.08 g g.sup.-1 sugar), the end ethanol concentration estimated from the cumulative CO.sub.2 production (355 mmol l.sup.-1) was approximately 330 mmol l.sup.-1, corresponding to a ethanol yield of 0.41 g g.sup.-1 pentose sugar. In addition to ethanol, glycerol, and organic acids, a small amount of xylitol was produced (approximately 5 mM).

Selection of Strain IMS0003

[0180] Initially, the constructed strain IMS0001 was able to ferment xylose (data not shown). In contrast to our expectations, the selected strain IMS0002 was not capable of fermenting xylose to ethanol (FIG. 5C). To regain the capability of fermenting xylose, a colony of strain IMS0002 was transferred to solid synthetic medium with 2% of D-xylose, and incubated in an anaerobic jar at 30.degree. C. for 25 days. Subsequently, a colony was again transferred to solid synthetic medium with 2% of arabinose. After 4 days of incubation at 30.degree. C., a colony was transferred to a shake flask containing synthetic medium with 2% arabinose. After incubation at 30.degree. C. for 6 days, 30% of glycerol was added, samples were taken and stored at -80.degree. C.

[0181] From this frozen stock, samples were spread on solid synthetic medium with 2% of L-arabinose and incubated at 30.degree. C. for several days. Separate colonies were re-streaked twice on solid synthetic medium with L-arabinose. Finally, a shake flask containing synthetic medium with 2% of L-arabinose was inoculated with a single colony, and incubated for 4 days at 30.degree. C. This culture was designated as strain IMS0003 (CBS 121879 deposited at the CBS on 20/09/07). Culture samples were taken, 30% of glycerol was added and samples were stored at -80.degree. C.

Characterization of Strain IMS0003

[0182] Growth and product formation of strain IMS0003 was determined during an anaerobic batch fermentation on synthetic medium with a mixture of 30 g l.sup.-1 glucose, 15 g l.sup.-1 D-xylose and 15 g l.sup.-1 L-arabinose. The pre-culture for this anaerobic batch fermentation was prepared in a shake flasks containing 100 ml of synthetic medium with 2% L-arabinose, by inoculating with a -80.degree. C. frozen stock of strain IMS0003, and incubated for 48 hours at 30.degree. C.

[0183] In FIG. 7, the fermentation profile of a mixture of 30 g l.sup.-1 glucose, 15 g l.sup.-1 D-xylose, and 15 g l.sup.-1 L-arabinose by strain IMS0003 is shown. Arabinose consumption started after glucose depletion. Within 70 hours, the glucose, xylose and arabinose were completely consumed. Xylose and arabinose were consumed simultaneously. At least 406 mM of ethanol was produced from the total of sugars, not taking into account the evaporation of the ethanol. The final ethanol concentration calculated from the cumulative CO.sub.2 production was 572 mmol l.sup.-1, corresponding to an ethanol yield of 0.46 g g.sup.-1 of total sugar. In contrast to the fermentation of a mixture of glucose, xylose and arabinose by strain IMS0002 (FIG. 5C) or a mixed culture of strains IMS0002 and RWB218 (FIG. 5D), strain IMS0003 did not produce detectable amounts of xylitol.

TABLE-US-00001 TABLE 1 S. cerevisiae strains used. Strain Characteristics Reference RWB217 MATA ura3-52 leu2-112 loxP-P.sub.TPI::(-266, -1)TALl gre3::hphMX pUGP.sub.TPI- Kuyper et al. 2005a TKLl pUGP.sub.TPI-RPEl KanloxP-P.sub.TPI::(-?, -1)RKIl {p415ADHXKS, PAKX002} RWB218 MATA ura3-52 leu2-112 loxP-P.sub.TPI::(-266, -1)TALl gre3::hphMX pUGP.sub.TPI- Kuyper et al. 2005b TKLl pUGP.sub.TPI-RPEl KanloxP-P.sub.TPI::(-?, -1)RKIl {p415ADHXKS1, pAKX002} RWB219 MATA ura3-52 leu2-112 loxP-P.sub.TPI::(-266, -1)TALl gre3::hphMX pUGP.sub.TPI- This work TKLl pUGP.sub.TPI-RPEl KanloxP-P.sub.TPI::(-?, -1)RKIl {p415ADHXKS1, pAKX002} RWB220 MATA ura3-52 leu2-112 loxP-P.sub.TPI::(-266, -1)TALl gre3::hphMX pUGP.sub.TPI- This work TKLl .sub.PUGP.sub.TPI-RPEl loxP-P.sub.TPI::(-?, -1)RKIl IMS0001 MATA ura3-52 leu2-112 loxP-P.sub.TPI::(-266, -1)TALl gre3::hphMX pUGP.sub.TPI- This work TKLl pUGP.sub.TPI-RPEl loxP-P.sub.TPI::(-?, -1)RKIl {pRW231, PRW243} IMS0002 MATA ura3-52 leu2-112 loxP-P.sub.TPI::(-266, -1)TALl gre3::hphMX pUGP.sub.TPI- This work TKLl pUGP.sub.TPI-RPEl loxP-P.sub.TPI::(-?, -1)RKIl {pRW231, PRW243} selected for anaerobic growth on L-arabinose

TABLE-US-00002 TABLE 2 Plasmids used plasmid characteristics Reference pRS305 Integration, LEU2 Gietz and Sugino, 1988 pAKX002 2.mu., URA3, P.sub.TPIl-Piromyces xylA Kuyper et al. 2003 p415ADHXKS1 CEN, LEU2, P.sub.ADHI-S.cerXKS1 Kuyper et al., 2005a pRW229 integration, LEU2, P.sub.ADHI-S.cerXKS1 This work pRW230 pAKX002 with P.sub.TDH3-AraA This work pRW231 pAKX002 with P.sub.TDH3-AraA and P.sub.HXT7-AraD This work pRW243 LEU2, integration, P.sub.ADHI-ScXKS1-T.sub.CYC, This work P.sub.PGIl-L.plantarumAraB-T.sub.ADHI

TABLE-US-00003 TABLE 3 oligos used in this work Oligo DNA sequence AraA expression cassette SpeI5'Ptdh3 5'GACTAGTCGAGTTTATCATTATCAATACTGC3' SEQ ID NO: 31 5'AraAPtdh 5'CTCATAATCAGGTACTGATAACATTTTGTTTGTTTATGTGTGTTTATTC3' SEQ ID NO: 32 Ptdh5'AraA 5'GAATAAACACACATAAACAAACAAAATGTTATCAGTACCTGATTATGAG3 SEQ ID NO: 33 Tadh3'AraA 5'AATCATAAATCATAAGAAATTCGCTTACTTTAAGAATGCCTTAGTCAT3' SEQ ID NO: 34 3'AraATadh 1 5'ATGACTAAGGCATTCTTAAAGTAAGCGAATTTCTTATGATTTATGATT3' SEQ ID NO: 35 3'Tadh 1 SpeI 5'CACTAGTCTCGAGTGTGGAAGAACGATTACAACAGG3' SEQ ID NO: 36 AraB expression cassette SacI5'Ppgi1 5'CGAGCTCGTGGGTGTATTGGATTATAGGAAG3' SEQ ID NO: 37 5'AraBPpgi1 5'TTGGGCTGTTTCAACTAAATTCATTTTTAGGCTGGTATCTTGATTCTA3' SEQ ID NO: 38 Ppgi5'AraB 5'TAGAATCAAGATACCAGCCTAAAAATGAATTTAGTTGAAACAGCCCAA3' SEQ ID NO: 39 Tadh3'AraB 5'AATCATAAATCATAAGAAATTCGCTCTAATATTTGATTGCTTGCCCAG3' SEQ ID NO: 40 3'AraBTadh 1 5'CTGGGCAAGCAATCAAATATTAGAGCGAATTTCTTATGATTTATGATT3' SEQ ID NO: 41 3'Tadh 1 SacI 5'TGAGCTCGTGTGGAAGAACGATTACAACAGG3' SEQ ID NO: 42 AraD expression cassette SalI5'Phxt7 5'ACGCGTCGACTCGTAGGAACAATTTCGG3' SEQ ID NO: 43 5'AraDPhxt 5'CTTCTTGTTTTAATGCTTCTAGCATTTTTTGATTAAAATTAAAAAAACTT3' SEQ ID NO: 44 Phxt5'AraD 5'AAGTTTTTTTAATTTTAATCAAAAAATGCTAGAAGCATTAAAACAAGAAG3' SEQ ID NO: 45 Tpgi3'AraD 5'GGTATATATTTAAGAGCGATTTGTTTACTTGCGAACTGCATGATCC3' SEQ ID NO: 46 3'AraDTpgi 5'GGATCATGCAGTTCGCAAGTAAACAAATCGCTCTTAAATATATACC3' SEQ ID NO: 47 3'TpgiSalI 5'CGCAGTCGACCTTTTAAACAGTTGATGAGAACC3' SEQ ID NO: 48

TABLE-US-00004 TABLE 4 Maximum observed specific glucose and arabinose consumption rates and ethanol production rates during anaerobic batch fermentations of S. cerevisiae IMS0002. q.sub.glu q.sub.ara q.sub.eth, glu q.sub.eth, ara C-source g h.sup.-1 g.sup.-1 DW g h.sup.-1 g.sup.-1 DW g h.sup.-1 g.sup.-1 DW g h.sup.-1 g.sup.-1 DW 20 g l.sup.-1 arabinose -- 0.75 .+-. 0.04 -- 0.31 .+-. 0.02 20 g l.sup.-1 glucose 2.08 .+-. 0.09 0.41 .+-. 0.01 0.69 .+-. 0.00 0.19 .+-. 0.00 20 g l.sup.-1 arabinose 30 g l.sup.-1 glucose 1.84 .+-. 0.04 0.23 .+-. 0.01 0.64 .+-. 0.03 0.08 .+-. 0.01 15 g l.sup.-1 xylose 15 g l.sup.-1 arabinose q.sub.glu: specific glucose consumption rate q.sub.ara: specific arabinose consumption rate q.sub.eth, glu: specific ethanol production rate during growth on glucose q.sub.eth, ara: specific ethanol production rate during growth on arabinose

REFERENCE LIST

[0184] Andreasen A A, Stier T J (1954) Anaerobic nutrition of Saccharomyces cerevisiae. II. Unsaturated fatty acid requirement for growth in a defined medium. J Cell Physiol 43:271-281 [0185] Andreasen A A, Stier T J (1953) Anaerobic nutrition of Saccharomyces cerevisiae. I. Ergosterol requirement for growth in a defined medium. J Cell Physiol 41:23-36 [0186] Becker J, Boles E (2003) A modified Saccharomyces cerevisiae strain that consumes L-Arabinose and produces ethanol, Appl Environ Microbiol 69:4144-4150 [0187] Gietz R. D., Sugino A. (1988). New yeast-Escherichia coli shuttle vectors constructed with in vitro mutagenized yeast genes lacking six-base pair restriction sites. Gene 74:527-534. [0188] Gietz, R. D., and R. A. Woods. 2002. Transformation of yeast by lithium acetate/single-stranded carrier DNA/polyethylene glycol method. Methods Enzymol. 350:87-96. [0189] Guldener U, Heck S, Fielder T, Beinhauer J, Hegemann J H. (1996) A new efficient gene disruption cassette for repeated use in budding yeast. Nucleic Acids Res. 1996 Jul. 1; 24(13):2519-24. [0190] Hauf J, Zimmermann F K, Muller S. Simultaneous genomic overexpression of seven glycolytic enzymes in the yeast Saccharomyces cerevisiae. Enzyme Microb Technol. 2000 Jun. 1; 26(9-10):688-698. [0191] Inoue H., H. Nojima and H. Okayama, High efficiency transformation of Escherichia coli with plasmids. Gene 96 (1990), pp. 23-28 [0192] Kuyper M, Hartog M M P, Toirkens M J, Almering M J H, Winkler A A, Van Dijken J P, Pronk J T (2005a) Metabolic engineering of a xylose-isomerase-expressing Saccharomyces cerevisiae strain for rapid anaerobic xylose fermentation. Ferns Yeast Research 5:399-409 [0193] Kuyper M, Toirkens M J, Diderich J A, Winkler A A, Van Dijken J P, Pronk J T (2005b) Evolutionary engineering of mixed-sugar utilization by a xylose-fermenting Saccharomyces cerevisiae strain. Ferns Yeast Research 5:925-934 [0194] Sambrook, K., Fritsch, E. F. and Maniatis, I. (1989) Molecular Cloning: A Laboratory Manual, 2nd edn. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. [0195] Van Urk H, Mak P R, Scheffers W A, Van Dijken J P (1988) Metabolic responses of Saccharomyces cerevisiae CBS 8066 and Candida utilis CBS 621 upon transition from glucose limitation to glucose excess. Yeast 4:283-291 [0196] Verduyn C, Postma E, Scheffers W A, Van Dijken J P (1990) Physiology of Saccharomyces cerevisiae in anaerobic glucose-limited chemostat cultures. J Gen Microbiol 136:395-403 [0197] Verduyn C, Postma E, Scheffers W A, Van Dijken J P (1992) Effect of benzoic acid on metabolic fluxes in yeasts: a continuous-culture study on the regulation of respiration and alcoholic fermentation. Yeast 8:501-517 [0198] Weusthuis R A, Visser W, Pronk J T, Scheffers W A, Van Dijken J P (1994) Effects of oxygen limitation on sugar metabolism in yeasts--a continuous-culture study of the Kluyver effect. Microbiology 140:703-715

Sequence CWU 1

1

531474PRTLactobacillus plantarum 1Met Leu Ser Val Pro Asp Tyr Glu Phe Trp Phe Val Thr Gly Ser Gln1 5 10 15His Leu Tyr Gly Glu Glu Gln Leu Lys Ser Val Ala Lys Asp Ala Gln 20 25 30Asp Ile Ala Asp Lys Leu Asn Ala Ser Gly Lys Leu Pro Tyr Lys Val 35 40 45Val Phe Lys Asp Val Met Thr Thr Ala Glu Ser Ile Thr Asn Phe Met 50 55 60Lys Glu Val Asn Tyr Asn Asp Lys Val Ala Gly Val Ile Thr Trp Met65 70 75 80His Thr Phe Ser Pro Ala Lys Asn Trp Ile Arg Gly Thr Glu Leu Leu 85 90 95Gln Lys Pro Leu Leu His Leu Ala Thr Gln Tyr Leu Asn Asn Ile Pro 100 105 110Tyr Ala Asp Ile Asp Phe Asp Tyr Met Asn Leu Asn Gln Ser Ala His 115 120 125Gly Asp Arg Glu Tyr Ala Tyr Ile Asn Ala Arg Leu Gln Lys His Asn 130 135 140Lys Ile Val Tyr Gly Tyr Trp Gly Asp Glu Asp Val Gln Glu Gln Ile145 150 155 160Ala Arg Trp Glu Asp Val Ala Val Ala Tyr Asn Glu Ser Phe Lys Val 165 170 175Lys Val Ala Arg Phe Gly Asp Thr Met Arg Asn Val Ala Val Thr Glu 180 185 190Gly Asp Lys Val Glu Ala Gln Ile Lys Met Gly Trp Thr Val Asp Tyr 195 200 205Tyr Gly Ile Gly Asp Leu Val Glu Glu Ile Asn Lys Val Ser Asp Ala 210 215 220Asp Val Asp Lys Glu Tyr Ala Asp Leu Glu Ser Arg Tyr Glu Met Val225 230 235 240Gln Val Asp Asn Asp Ala Asp Thr Tyr Lys His Ser Val Arg Val Gln 245 250 255Leu Ala Gln Tyr Leu Gly Ile Lys Arg Phe Leu Glu Arg Gly Gly Tyr 260 265 270Thr Ala Phe Thr Thr Asn Phe Glu Asp Leu Trp Gly Met Glu Gln Leu 275 280 285Pro Gly Leu Ala Ser Gln Leu Leu Ile Arg Asp Gly Tyr Gly Phe Gly 290 295 300Ala Glu Gly Asp Trp Lys Thr Ala Ala Leu Gly Arg Val Met Lys Ile305 310 315 320Met Ser His Asn Lys Gln Thr Ala Phe Met Glu Asp Tyr Thr Leu Asp 325 330 335Leu Arg His Gly His Glu Ala Ile Leu Gly Ser His Met Leu Glu Val 340 345 350Asp Pro Ser Ile Ala Ser Asp Lys Pro Arg Val Glu Val His Pro Leu 355 360 365Asp Ile Gly Gly Lys Asp Asp Pro Ala Arg Leu Val Phe Thr Gly Ser 370 375 380Glu Gly Glu Ala Ile Asp Val Thr Val Ala Asp Phe Arg Asp Gly Phe385 390 395 400Lys Met Ile Ser Tyr Ala Val Asp Ala Asn Lys Pro Glu Ala Glu Thr 405 410 415Pro Asn Leu Pro Val Ala Lys Gln Leu Trp Thr Pro Lys Met Gly Leu 420 425 430Lys Lys Gly Ala Leu Glu Trp Met Gln Ala Gly Gly Gly His His Thr 435 440 445Met Leu Ser Phe Ser Leu Thr Glu Glu Gln Met Glu Asp Tyr Ala Thr 450 455 460Met Val Gly Met Thr Lys Ala Phe Leu Lys465 47021425DNALactobacillus plantarum 2atgttatcag tacctgatta tgagttttgg tttgttaccg gttcacaaca cctttatggt 60gaagaacaat tgaagtctgt tgctaaggat gcgcaagata ttgcggataa attgaatgca 120agcggcaagt taccttataa agtagtcttt aaggatgtta tgacgacggc tgaaagtatc 180accaacttta tgaaagaagt taattacaat gataaggtag ccggtgttat tacttggatg 240cacacattct caccagctaa gaactggatt cgtggaactg aactgttaca aaaaccatta 300ttacacttag caacgcaata tttgaataat attccatatg cagacattga ctttgattac 360atgaacctta accaaagtgc ccatggcgac cgcgagtatg cctacattaa cgcccggttg 420cagaaacata ataagattgt ttacggctat tggggcgatg aagatgtgca agagcagatt 480gcacgttggg aagacgtcgc cgtagcgtac aatgagagct ttaaagttaa ggttgctcgc 540tttggcgaca caatgcgtaa tgtggccgtt actgaaggtg acaaggttga agctcaaatt 600aagatgggct ggacagttga ctattatggt atcggtgact tagttgaaga gatcaataag 660gtttcggatg ctgatgttga taaggaatac gctgacttgg agtctcggta tgaaatggtc 720caagttgata acgatgcgga cacgtataaa cattcagttc gggttcaatt ggcacaatat 780ctgggtatta agcggttctt agaaagaggc ggttacacag cctttaccac gaactttgaa 840gatctttggg ggatggagca attacctggt ctagcttcac aattattaat tcgtgatggg 900tatggttttg gtgctgaagg tgactggaag acggctgctt taggacgggt tatgaagatt 960atgtctcaca acaagcaaac cgcctttatg gaagactaca cgttagactt gcgtcatggt 1020catgaagcga tcttaggttc acacatgttg gaagttgatc cgtctatcgc aagtgataaa 1080ccacgggtcg aagttcatcc attggatatt gggggtaaag atgatcctgc tcgcctagta 1140tttactggtt cagaaggtga agcaattgat gtcaccgttg ccgatttccg tgatgggttc 1200aagatgatta gctacgcggt agatgcgaat aagccagaag ccgaaacacc taatttacca 1260gttgctaagc aattatggac cccaaagatg ggcttgaaga agggtgcact agaatggatg 1320caagctggtg gtggtcacca cacgatgctg tccttctcgt taactgaaga acaaatggaa 1380gactatgcaa ccatggttgg catgactaag gcattcttaa agtaa 14253533PRTLactobacillus plantarum 3Met Asn Leu Val Glu Thr Ala Gln Ala Ile Lys Thr Gly Lys Val Ser1 5 10 15Leu Gly Ile Glu Leu Gly Ser Thr Arg Ile Lys Ala Val Leu Ile Thr 20 25 30Asp Asp Phe Asn Thr Ile Ala Ser Gly Ser Tyr Val Trp Glu Asn Gln 35 40 45Phe Val Asp Gly Thr Trp Thr Tyr Ala Leu Glu Asp Val Trp Thr Gly 50 55 60Ile Gln Gln Ser Tyr Thr Gln Leu Ala Ala Asp Val Arg Ser Lys Tyr65 70 75 80His Met Ser Leu Lys His Ile Asn Ala Ile Gly Ile Ser Ala Met Met 85 90 95His Gly Tyr Leu Ala Phe Asp Gln Gln Ala Lys Leu Leu Val Pro Phe 100 105 110Arg Thr Trp Arg Asn Asn Ile Thr Gly Gln Ala Ala Asp Glu Leu Thr 115 120 125Glu Leu Phe Asp Phe Asn Ile Pro Gln Arg Trp Ser Ile Ala His Leu 130 135 140Tyr Gln Ala Ile Leu Asn Asn Glu Ala His Val Lys Gln Val Asp Phe145 150 155 160Ile Thr Thr Leu Ala Gly Tyr Val Thr Trp Lys Leu Ser Gly Glu Lys 165 170 175Val Leu Gly Ile Gly Asp Ala Ser Gly Val Phe Pro Ile Asp Glu Thr 180 185 190Thr Asp Thr Tyr Asn Gln Thr Met Leu Thr Lys Phe Ser Gln Leu Asp 195 200 205Lys Val Lys Pro Tyr Ser Trp Asp Ile Arg His Ile Leu Pro Arg Val 210 215 220Leu Pro Ala Gly Ala Ile Ala Gly Lys Leu Thr Ala Ala Gly Ala Ser225 230 235 240Leu Leu Asp Gln Ser Gly Thr Leu Asp Ala Gly Ser Val Ile Ala Pro 245 250 255Pro Glu Gly Asp Ala Gly Thr Gly Met Val Gly Thr Asn Ser Val Arg 260 265 270Lys Arg Thr Gly Asn Ile Ser Val Gly Thr Ser Ala Phe Ser Met Asn 275 280 285Val Leu Asp Lys Pro Leu Ser Lys Val Tyr Arg Asp Ile Asp Ile Val 290 295 300Met Thr Pro Asp Gly Ser Pro Val Ala Met Val His Val Asn Asn Cys305 310 315 320Ser Ser Asp Ile Asn Ala Trp Ala Thr Ile Phe Arg Glu Phe Ala Ala 325 330 335Arg Leu Gly Met Glu Leu Lys Pro Asp Arg Leu Tyr Glu Thr Leu Phe 340 345 350Leu Glu Ser Thr Arg Ala Asp Ala Asp Ala Gly Gly Leu Ala Asn Tyr 355 360 365Ser Tyr Gln Ser Gly Glu Asn Ile Thr Lys Ile Gln Ala Gly Arg Pro 370 375 380Leu Phe Val Arg Thr Pro Asn Ser Lys Phe Ser Leu Pro Asn Phe Met385 390 395 400Leu Thr Gln Leu Tyr Ala Ala Phe Ala Pro Leu Gln Leu Gly Met Asp 405 410 415Ile Leu Val Asn Glu Glu His Val Gln Thr Asp Val Met Ile Ala Gln 420 425 430Gly Gly Leu Phe Arg Thr Pro Val Ile Gly Gln Gln Val Leu Ala Asn 435 440 445Ala Leu Asn Ile Pro Ile Thr Val Met Ser Thr Ala Gly Glu Gly Gly 450 455 460Pro Trp Gly Met Ala Val Leu Ala Asn Phe Ala Cys Arg Gln Thr Ala465 470 475 480Met Asn Leu Glu Asp Phe Leu Asp Gln Glu Val Phe Lys Glu Pro Glu 485 490 495Ser Met Thr Leu Ser Pro Glu Pro Glu Arg Val Ala Gly Tyr Arg Glu 500 505 510Phe Ile Gln Arg Tyr Gln Ala Gly Leu Pro Val Glu Ala Ala Ala Gly 515 520 525Gln Ala Ile Lys Tyr 53041602DNALactobacillus plantarum 4atgaatttag ttgaaacagc ccaagcgatt aaaactggca aagtttcttt aggaattgag 60cttggctcaa ctcgaattaa agccgttttg atcacggacg attttaatac gattgcttcg 120ggaagttacg tttgggaaaa ccaatttgtt gatggtactt ggacttacgc acttgaagat 180gtctggaccg gaattcaaca aagttatacg caattagcag cagatgtccg cagtaaatat 240cacatgagtt tgaagcatat caatgctatt ggcattagtg ccatgatgca cggataccta 300gcatttgatc aacaagcgaa attattagtt ccgtttcgga cttggcgtaa taacattacg 360gggcaagcag cagatgaatt gaccgaatta tttgatttca acattccaca acggtggagt 420atcgcgcact tataccaggc aatcttaaat aatgaagcgc acgttaaaca ggtggacttc 480ataacaacgc tggctggcta tgtaacctgg aaattgtcgg gtgagaaagt tctaggaatc 540ggtgatgcgt ctggcgtttt cccaattgat gaaacgactg acacatacaa tcagacgatg 600ttaaccaagt ttagccaact tgacaaagtt aaaccgtatt catgggatat ccggcatatt 660ttaccgcggg ttttaccagc gggagccatt gctggaaagt taacggctgc cggggcgagc 720ttacttgatc agagcggcac gctcgacgct ggcagtgtta ttgcaccgcc agaaggggat 780gctggaacag gaatggtcgg tacgaacagc gtccgtaaac gcacgggtaa catctcggtg 840ggaacctcag cattttcgat gaacgttcta gataaaccat tgtctaaagt ctatcgcgat 900attgatattg ttatgacgcc agatgggtca ccagttgcaa tggtgcatgt taataattgt 960tcatcagata ttaatgcgtg ggcaacgatt tttcgtgagt ttgcagcccg gttgggaatg 1020gaattgaaac cggatcgatt atatgaaacg ttattcttgg aatcaactcg cgctgatgcg 1080gatgctggag ggttggctaa ttatagttat caatccggtg agaatattac taagattcaa 1140gctggtcggc cgctatttgt acggacacca aacagtaaat ttagtttacc gaactttatg 1200ttgacccaat tatatgcggc gttcgcaccc ctccaacttg gtatggatat tcttgttaac 1260gaagaacatg ttcaaacgga cgttatgatt gcacagggtg gattgttccg aacgccggta 1320attggccaac aagtattggc caacgcactg aacattccga ttactgtaat gagtactgct 1380ggtgaaggcg gcccatgggg gatggcagtg ttagccaact ttgcttgtcg gcaaactgca 1440atgaacctag aagatttctt agatcaagaa gtctttaaag agccagaaag tatgacgttg 1500agtccagaac cggaacgggt ggccggatat cgtgaattta ttcaacgtta tcaagctggc 1560ttaccagttg aagcagcggc tgggcaagca atcaaatatt ag 16025242PRTLactobacillus plantarum 5Met Leu Glu Ala Leu Lys Gln Glu Val Tyr Glu Ala Asn Met Gln Leu1 5 10 15Pro Lys Leu Gly Leu Val Thr Phe Thr Trp Gly Asn Val Ser Gly Ile 20 25 30Asp Arg Glu Lys Gly Leu Phe Val Ile Lys Pro Ser Gly Val Asp Tyr 35 40 45Gly Glu Leu Lys Pro Ser Asp Leu Val Val Val Asn Leu Gln Gly Glu 50 55 60Val Val Glu Gly Lys Leu Asn Pro Ser Ser Asp Thr Pro Thr His Thr65 70 75 80Val Leu Tyr Asn Ala Phe Pro Asn Ile Gly Gly Ile Val His Thr His 85 90 95Ser Pro Trp Ala Val Ala Tyr Ala Ala Ala Gln Met Asp Val Pro Ala 100 105 110Met Asn Thr Thr His Ala Asp Thr Phe Tyr Gly Asp Val Pro Ala Ala 115 120 125Asp Ala Leu Thr Lys Glu Glu Ile Glu Ala Asp Tyr Glu Gly Asn Thr 130 135 140Gly Lys Thr Ile Val Lys Thr Phe Gln Glu Arg Gly Leu Asp Tyr Glu145 150 155 160Ala Val Pro Ala Ser Leu Val Ser Gln His Gly Pro Phe Ala Trp Gly 165 170 175Pro Thr Pro Ala Lys Ala Val Tyr Asn Ala Lys Val Leu Glu Val Val 180 185 190Ala Glu Glu Asp Tyr His Thr Ala Gln Leu Thr Arg Ala Ser Ser Glu 195 200 205Leu Pro Gln Tyr Leu Leu Asp Lys His Tyr Leu Arg Lys His Gly Ala 210 215 220Ser Ala Tyr Tyr Gly Gln Asn Asn Ala His Ser Lys Asp His Ala Val225 230 235 240Arg Lys6729DNALactobacillus plantarum 6atgctagaag cattaaaaca agaagtttat gaggctaaca tgcagcttcc aaagctgggc 60ctggttactt ttacctgggg caatgtctcg ggcattgacc gggaaaaagg cctattcgtg 120atcaagccat ctggtgttga ttatggtgaa ttaaaaccaa gcgatttagt cgttgttaac 180ttacagggtg aagtggttga aggtaaacta aatccgtcta gtgatacgcc gactcatacg 240gtgttatata acgcttttcc taatattggc ggaattgtcc atactcattc gccatgggca 300gttgcctatg cagctgctca aatggatgtg ccagctatga acacgaccca tgctgatacg 360ttctatggtg acgtgccggc cgcggatgcg ctgactaagg aagaaattga agcagattat 420gaaggcaaca cgggtaaaac cattgtgaag acgttccaag aacggggcct cgattatgaa 480gctgtaccag cctcattagt cagccagcac ggcccatttg cttggggacc aacgccagct 540aaagccgttt acaatgctaa agtgttggaa gtggttgccg aagaagatta tcatactgcg 600caattgaccc gtgcaagtag cgaattacca caatatttat tagataagca ttatttacgt 660aagcatggtg caagtgccta ttatggtcaa aataatgcgc attctaagga tcatgcagtt 720cgcaagtaa 7297437PRTPiromyces sp. 7Met Ala Lys Glu Tyr Phe Pro Gln Ile Gln Lys Ile Lys Phe Glu Gly1 5 10 15Lys Asp Ser Lys Asn Pro Leu Ala Phe His Tyr Tyr Asp Ala Glu Lys 20 25 30Glu Val Met Gly Lys Lys Met Lys Asp Trp Leu Arg Phe Ala Met Ala 35 40 45Trp Trp His Thr Leu Cys Ala Glu Gly Ala Asp Gln Phe Gly Gly Gly 50 55 60Thr Lys Ser Phe Pro Trp Asn Glu Gly Thr Asp Ala Ile Glu Ile Ala65 70 75 80Lys Gln Lys Val Asp Ala Gly Phe Glu Ile Met Gln Lys Leu Gly Ile 85 90 95Pro Tyr Tyr Cys Phe His Asp Val Asp Leu Val Ser Glu Gly Asn Ser 100 105 110Ile Glu Glu Tyr Glu Ser Asn Leu Lys Ala Val Val Ala Tyr Leu Lys 115 120 125Glu Lys Gln Lys Glu Thr Gly Ile Lys Leu Leu Trp Ser Thr Ala Asn 130 135 140Val Phe Gly His Lys Arg Tyr Met Asn Gly Ala Ser Thr Asn Pro Asp145 150 155 160Phe Asp Val Val Ala Arg Ala Ile Val Gln Ile Lys Asn Ala Ile Asp 165 170 175Ala Gly Ile Glu Leu Gly Ala Glu Asn Tyr Val Phe Trp Gly Gly Arg 180 185 190Glu Gly Tyr Met Ser Leu Leu Asn Thr Asp Gln Lys Arg Glu Lys Glu 195 200 205His Met Ala Thr Met Leu Thr Met Ala Arg Asp Tyr Ala Arg Ser Lys 210 215 220Gly Phe Lys Gly Thr Phe Leu Ile Glu Pro Lys Pro Met Glu Pro Thr225 230 235 240Lys His Gln Tyr Asp Val Asp Thr Glu Thr Ala Ile Gly Phe Leu Lys 245 250 255Ala His Asn Leu Asp Lys Asp Phe Lys Val Asn Ile Glu Val Asn His 260 265 270Ala Thr Leu Ala Gly His Thr Phe Glu His Glu Leu Ala Cys Ala Val 275 280 285Asp Ala Gly Met Leu Gly Ser Ile Asp Ala Asn Arg Gly Asp Tyr Gln 290 295 300Asn Gly Trp Asp Thr Asp Gln Phe Pro Ile Asp Gln Tyr Glu Leu Val305 310 315 320Gln Ala Trp Met Glu Ile Ile Arg Gly Gly Gly Phe Val Thr Gly Gly 325 330 335Thr Asn Phe Asp Ala Lys Thr Arg Arg Asn Ser Thr Asp Leu Glu Asp 340 345 350Ile Ile Ile Ala His Val Ser Gly Met Asp Ala Met Ala Arg Ala Leu 355 360 365Glu Asn Ala Ala Lys Leu Leu Gln Glu Ser Pro Tyr Thr Lys Met Lys 370 375 380Lys Glu Arg Tyr Ala Ser Phe Asp Ser Gly Ile Gly Lys Asp Phe Glu385 390 395 400Asp Gly Lys Leu Thr Leu Glu Gln Val Tyr Glu Tyr Gly Lys Lys Asn 405 410 415Gly Glu Pro Lys Gln Thr Ser Gly Lys Gln Glu Leu Tyr Glu Ala Ile 420 425 430Val Ala Met Tyr Gln 43581669DNAPiromyces sp. 8gtaaatggct aaggaatatt tcccacaaat tcaaaagatt aagttcgaag gtaaggattc 60taagaatcca ttagccttcc actactacga tgctgaaaag gaagtcatgg gtaagaaaat 120gaaggattgg ttacgtttcg ccatggcctg gtggcacact ctttgcgccg aaggtgctga 180ccaattcggt ggaggtacaa agtctttccc atggaacgaa ggtactgatg ctattgaaat 240tgccaagcaa aaggttgatg ctggtttcga aatcatgcaa aagcttggta ttccatacta 300ctgtttccac gatgttgatc ttgtttccga aggtaactct attgaagaat acgaatccaa 360ccttaaggct gtcgttgctt acctcaagga aaagcaaaag gaaaccggta ttaagcttct 420ctggagtact gctaacgtct tcggtcacaa gcgttacatg aacggtgcct ccactaaccc 480agactttgat gttgtcgccc gtgctattgt tcaaattaag aacgccatag acgccggtat 540tgaacttggt gctgaaaact acgtcttctg gggtggtcgt gaaggttaca tgagtctcct 600taacactgac caaaagcgtg aaaaggaaca catggccact atgcttacca tggctcgtga 660ctacgctcgt tccaagggat tcaagggtac tttcctcatt gaaccaaagc caatggaacc 720aaccaagcac caatacgatg ttgacactga aaccgctatt ggtttcctta aggcccacaa

780cttagacaag gacttcaagg tcaacattga agttaaccac gctactcttg ctggtcacac 840tttcgaacac gaacttgcct gtgctgttga tgctggtatg ctcggttcca ttgatgctaa 900ccgtggtgac taccaaaacg gttgggatac tgatcaattc ccaattgatc aatacgaact 960cgtccaagct tggatggaaa tcatccgtgg tggtggtttc gttactggtg gtaccaactt 1020cgatgccaag actcgtcgta actctactga cctcgaagac atcatcattg cccacgtttc 1080tggtatggat gctatggctc gtgctcttga aaacgctgcc aagctcctcc aagaatctcc 1140atacaccaag atgaagaagg aacgttacgc ttccttcgac agtggtattg gtaaggactt 1200tgaagatggt aagctcaccc tcgaacaagt ttacgaatac ggtaagaaga acggtgaacc 1260aaagcaaact tctggtaagc aagaactcta cgaagctatt gttgccatgt accaataagt 1320taatcgtagt taaattggta aaataattgt aaaatcaata aacttgtcaa tcctccaatc 1380aagtttaaaa gatcctatct ctgtactaat taaatatagt acaaaaaaaa atgtataaac 1440aaaaaaaagt ctaaaagacg gaagaattta atttagggaa aaaataaaaa taataataaa 1500caatagataa atcctttata ttaggaaaat gtcccattgt attattttca tttctactaa 1560aaaagaaagt aaataaaaca caagaggaaa ttttcccttt tttttttttt tgtaataaat 1620tttatgcaaa tataaatata aataaaataa taaaaaaaaa aaaaaaaaa 16699496PRTBacillus subtilis 9Met Leu Gln Thr Lys Asp Tyr Glu Phe Trp Phe Val Thr Gly Ser Gln1 5 10 15His Leu Tyr Gly Glu Glu Thr Leu Glu Leu Val Asp Gln His Ala Lys 20 25 30Ser Ile Cys Glu Gly Leu Ser Gly Ile Ser Ser Arg Tyr Lys Ile Thr 35 40 45His Lys Pro Val Val Thr Ser Pro Glu Thr Ile Arg Glu Leu Leu Arg 50 55 60Glu Ala Glu Tyr Ser Glu Thr Cys Ala Gly Ile Ile Thr Trp Met His65 70 75 80Thr Phe Ser Pro Ala Lys Met Trp Ile Glu Gly Leu Ser Ser Tyr Gln 85 90 95Lys Pro Leu Met His Leu His Thr Gln Tyr Asn Arg Asp Ile Pro Trp 100 105 110Gly Thr Ile Asp Met Asp Phe Met Asn Ser Asn Gln Ser Ala His Gly 115 120 125Asp Arg Glu Tyr Gly Tyr Ile Asn Ser Arg Met Gly Leu Ser Arg Lys 130 135 140Val Ile Ala Gly Tyr Trp Asp Asp Glu Glu Val Lys Lys Glu Met Ser145 150 155 160Gln Trp Met Asp Thr Ala Ala Ala Leu Asn Glu Ser Arg His Ile Lys 165 170 175Val Ala Arg Phe Gly Asp Asn Met Arg His Val Ala Val Thr Asp Gly 180 185 190Asp Lys Val Gly Ala His Ile Gln Phe Gly Trp Gln Val Asp Gly Tyr 195 200 205Gly Ile Gly Asp Leu Val Glu Val Met Asp Arg Ile Thr Asp Asp Glu 210 215 220Val Asp Thr Leu Tyr Ala Glu Tyr Asp Arg Leu Tyr Val Ile Ser Glu225 230 235 240Glu Thr Lys Arg Asp Glu Ala Lys Val Ala Ser Ile Lys Glu Gln Ala 245 250 255Lys Ile Glu Leu Gly Leu Thr Ala Phe Leu Glu Gln Gly Gly Tyr Thr 260 265 270Ala Phe Thr Thr Ser Phe Glu Val Leu His Gly Met Lys Gln Leu Pro 275 280 285Gly Leu Ala Val Gln Arg Leu Met Glu Lys Gly Tyr Gly Phe Ala Gly 290 295 300Glu Gly Asp Trp Lys Thr Ala Ala Leu Val Arg Met Met Lys Ile Met305 310 315 320Ala Lys Gly Lys Arg Thr Ser Phe Met Glu Asp Tyr Thr Tyr His Phe 325 330 335Glu Pro Gly Asn Glu Met Ile Leu Gly Ser His Met Leu Glu Val Cys 340 345 350Pro Thr Val Ala Leu Asp Gln Pro Lys Ile Glu Val His Ser Leu Ser 355 360 365Ile Gly Gly Lys Glu Asp Pro Ala Arg Leu Val Phe Asn Gly Ile Ser 370 375 380Gly Ser Ala Ile Gln Ala Ser Ile Val Asp Ile Gly Gly Arg Phe Arg385 390 395 400Leu Val Leu Asn Glu Val Asn Gly Gln Glu Ile Glu Lys Asp Met Pro 405 410 415Asn Leu Pro Val Ala Arg Val Leu Trp Lys Pro Glu Pro Ser Leu Lys 420 425 430Thr Ala Ala Glu Ala Trp Ile Leu Ala Gly Gly Ala His His Thr Cys 435 440 445Leu Ser Tyr Glu Leu Thr Ala Glu Gln Met Leu Asp Trp Ala Glu Met 450 455 460Ala Gly Ile Glu Ser Val Leu Ile Ser Arg Asp Thr Thr Ile His Lys465 470 475 480Leu Lys His Glu Leu Lys Trp Asn Glu Ala Leu Tyr Arg Leu Gln Lys 485 490 495101511DNABacillus subtilis 10atgagaaagg ggcagtttac atgcttcaga caaaggatta tgaattctgg tttgtgacag 60gaagccagca cctatacggg gaagagacgc tggaactcgt agatcagcat gctaaaagca 120tttgtgaggg gctcagcggg atttcttcca gatataaaat cactcataag cccgtcgtca 180cttcaccgga aaccattaga gagctgttaa gagaagcgga gtacagtgag acatgtgctg 240gcatcattac atggatgcac acattttccc ctgcaaaaat gtggatagaa ggcctttcct 300cttatcaaaa accgcttatg catttgcata cccaatataa tcgcgatatc ccgtggggta 360cgattgacat ggattttatg aacagcaacc aatccgcgca tggcgatcga gagtacggtt 420acatcaactc gagaatgggg cttagccgaa aagtcattgc cggctattgg gatgatgaag 480aagtgaaaaa agaaatgtcc cagtggatgg atacggcggc tgcattaaat gaaagcagac 540atattaaggt tgccagattt ggagataaca tgcgtcatgt cgcggtaacg gacggagaca 600aggtgggagc gcatattcaa tttggctggc aggttgacgg atatggcatc ggggatctcg 660ttgaagtgat ggatcgcatt acggacgacg aggttgacac gctttatgcc gagtatgaca 720gactatatgt gatcagtgag gaaacaaaac gtgacgaagc aaaggtagcg tccattaaag 780aacaggcgaa aattgaactt ggattaaccg cttttcttga gcaaggcgga tacacagcgt 840ttacgacatc gtttgaagtg ctgcacggaa tgaaacagct gccgggactt gccgttcagc 900gcctgatgga gaaaggctat gggtttgccg gtgaaggaga ttggaagaca gcggcccttg 960tacggatgat gaaaatcatg gctaaaggaa aaagaacttc cttcatggaa gattacacgt 1020accattttga accgggaaat gaaatgattc tgggctctca catgcttgaa gtgtgtccga 1080ctgtcgcttt ggatcagccg aaaatcgagg ttcattcgct ttcgattggc ggcaaagagg 1140accctgcgcg tttggtattt aacggcatca gcggttctgc cattcaagct agcattgttg 1200atattggcgg gcgtttccgc cttgtgctga atgaagtcaa cggccaggaa attgaaaaag 1260acatgccgaa tttaccggtt gcccgtgttc tctggaagcc ggagccgtca ttgaaaacag 1320cagcggaggc atggatttta gccggcggtg cacaccatac ctgcctgtct tatgaactga 1380cagcggagca aatgcttgat tgggcggaaa tggcgggaat cgaaagtgtt ctcatttccc 1440gtgatacgac aattcataaa ctgaaacacg agttaaaatg gaacgaggcg ctttaccggc 1500ttcaaaagta g 151111566PRTE. coli 11Met Ala Ile Ala Ile Gly Leu Asp Phe Gly Ser Asp Ser Val Arg Ala1 5 10 15Leu Ala Val Asp Cys Ala Ser Gly Glu Glu Ile Ala Thr Ser Val Glu 20 25 30Trp Tyr Pro Arg Trp Gln Lys Gly Gln Phe Cys Asp Ala Pro Asn Asn 35 40 45Gln Phe Arg His His Pro Arg Asp Tyr Ile Glu Ser Met Glu Ala Ala 50 55 60Leu Lys Thr Val Leu Ala Glu Leu Ser Val Glu Gln Arg Ala Ala Val65 70 75 80Val Gly Ile Gly Val Asp Ser Thr Gly Ser Thr Pro Ala Pro Ile Asp 85 90 95Ala Asp Gly Asn Val Leu Ala Leu Arg Pro Glu Phe Ala Glu Asn Pro 100 105 110Asn Ala Met Phe Val Leu Trp Lys Asp His Thr Ala Val Glu Arg Ser 115 120 125Glu Glu Ile Thr Arg Leu Cys His Ala Pro Gly Asn Val Asp Tyr Ser 130 135 140Arg Tyr Ile Gly Gly Ile Tyr Ser Ser Glu Trp Phe Trp Ala Lys Ile145 150 155 160Leu His Val Thr Arg Gln Asp Ser Ala Val Ala Gln Ser Ala Ala Ser 165 170 175Trp Ile Glu Leu Cys Asp Trp Val Pro Ala Leu Leu Ser Gly Thr Thr 180 185 190Arg Pro Gln Asp Ile Arg Arg Gly Arg Cys Ser Ala Gly His Lys Ser 195 200 205Leu Trp His Glu Ser Trp Gly Gly Leu Pro Pro Ala Ser Phe Phe Asp 210 215 220Glu Leu Asp Pro Ile Leu Asn Arg His Leu Pro Ser Pro Leu Phe Thr225 230 235 240Asp Thr Trp Thr Ala Asp Ile Pro Val Gly Thr Leu Cys Pro Glu Trp 245 250 255Ala Gln Arg Leu Gly Leu Pro Glu Ser Val Val Ile Ser Gly Gly Ala 260 265 270Phe Asp Cys His Met Gly Ala Val Gly Ala Gly Ala Gln Pro Asn Ala 275 280 285Leu Val Lys Val Ile Gly Thr Ser Thr Cys Asp Ile Leu Ile Ala Asp 290 295 300Lys Gln Ser Val Gly Glu Arg Ala Val Lys Gly Ile Cys Gly Gln Val305 310 315 320Asp Gly Ser Val Val Pro Gly Phe Ile Gly Leu Glu Ala Gly Gln Ser 325 330 335Ala Phe Gly Asp Ile Tyr Ala Trp Phe Gly Arg Val Leu Ser Trp Pro 340 345 350Leu Glu Gln Leu Ala Ala Gln His Pro Glu Leu Lys Ala Gln Ile Asn 355 360 365Ala Ser Gln Lys Gln Leu Leu Pro Ala Leu Thr Glu Ala Trp Ala Lys 370 375 380Asn Pro Ser Leu Asp His Leu Pro Val Val Leu Asp Trp Phe Asn Gly385 390 395 400Arg Arg Ser Pro Asn Ala Asn Gln Arg Leu Lys Gly Val Ile Thr Asp 405 410 415Leu Asn Leu Ala Thr Asp Ala Pro Leu Leu Phe Gly Gly Leu Ile Ala 420 425 430Ala Thr Ala Phe Gly Ala Arg Ala Ile Met Glu Cys Phe Thr Asp Gln 435 440 445Gly Ile Ala Val Asn Asn Val Met Ala Leu Gly Gly Ile Ala Arg Lys 450 455 460Asn Gln Val Ile Met Gln Ala Cys Cys Asp Val Leu Asn Arg Pro Leu465 470 475 480Gln Ile Val Ala Ser Asp Gln Cys Cys Ala Leu Gly Ala Ala Ile Phe 485 490 495Ala Ala Val Ala Ala Lys Val His Ala Asp Ile Pro Ser Ala Gln Gln 500 505 510Lys Met Ala Ser Ala Val Glu Lys Thr Leu Gln Pro Arg Ser Glu Gln 515 520 525Ala Gln Arg Phe Glu Gln Leu Tyr Arg Arg Tyr Gln Gln Trp Ala Met 530 535 540Ser Ala Glu Gln His Tyr Leu Pro Thr Ser Ala Pro Ala Gln Ala Ala545 550 555 560Gln Ala Val Ala Thr Leu 565121453DNAE. coli 12atggcgattg caattggcct cgattttggc agtgattctg tgcgagcttt ggcggtggac 60tgcgccagcg gtgaagagat cgccaccagc gtagagtggt atccccgttg gcaaaaaggg 120caattttgtg atgccccgaa taaccagttc cgtcatcatc cgcgtgacta cattgagtca 180atggaagcgg cactgaaaac cgtgcttgca gagcttagcg tcgaacagcg cgcagctgtg 240gtcgggattg gcgttgacag taccggctcg acgcccgcac cgattgatgc cgacggtaac 300gtgctggcgc tgcgcccgga gtttgccgaa aacccgaacg cgatgttcgt attgtggaaa 360gaccacactg cggttgaaag aagcgaagag attacccgtt tgtgccacgc gccgggcaat 420gttgactact cccgctatat tggcggtatt tattccagcg aatggttctg ggcaaaaatc 480ctgcatgtga ctcgccagga cagcgccgtg gcgcaatctg ccgcatcgtg gattgagctg 540tgcgactggg tgccagctct gctttccggt accacccgcc cgcaggatat tcgtcgcgga 600cgttgcagcg ccgggcataa atctctgtgg cacgaaagct ggggcggctt gccgccagcc 660agtttctttg atgagctgga cccgatcctc aatcgccatt tgccttcccc gctgttcact 720gacacctgga ctgccgatat tccggtgggc accttatgcc cggaatgggc gcagcgtctc 780ggcctgcctg aaagcgtggt gatttccggc ggcgcgtttg actgccatat gggcgcagtt 840ggcgcaggcg cacagcctaa cgcactggta aaagttatcg gtacttccac ctgcgacatt 900ctgattgccg acaaacagag cgttggcgag cgggcagtta aaggtatttg cggtcaggtt 960gatggcagcg tggtgcctgg atttatcggt ctggaagcag gccaatcggc gtttggtgat 1020atctacgcct ggttcggtcg cgtactcagc tggccgctgg aacagcttgc cgcccagcat 1080ccggaactga aagcgcaaat caacgccagc cagaaacaac tgcttccggc gctgaccgaa 1140gcatgggcca aaaatccgtc tctggatcac ctgccggtgg tgctcgactg gtttaacggt 1200cgtcgctcgc caaacgctaa ccaacgcctg aaaggggtga ttaccgatct taacctcgct 1260accgacgctc cgctgctgtt cggcggtttg attgctgcca ccgcctttgg cgcacgcgca 1320atcatggagt gctttaccga tcaggggatc gccgtcaata acgtgatggc gctgggcggc 1380atcgcgcgga aaaaccaagt cattatgcag gcctgctgcg acgtgctgaa tcgcccgctg 1440caaattgttg cct 145313231PRTE. coli 13Met Leu Glu Asp Leu Lys Arg Gln Val Leu Glu Ala Asn Leu Ala Leu1 5 10 15Pro Lys His Asn Leu Val Thr Leu Thr Trp Gly Asn Val Ser Ala Val 20 25 30Asp Arg Glu Arg Gly Val Phe Val Ile Lys Pro Ser Gly Val Asp Tyr 35 40 45Ser Ile Met Thr Ala Asp Asp Met Val Val Val Ser Ile Glu Thr Gly 50 55 60Glu Val Val Glu Gly Ala Lys Lys Pro Ser Ser Asp Thr Pro Thr His65 70 75 80Arg Leu Leu Tyr Gln Ala Phe Pro Ser Ile Gly Gly Ile Val His Thr 85 90 95His Ser Arg His Ala Thr Ile Trp Ala Gln Ala Gly Gln Ser Ile Pro 100 105 110Ala Thr Gly Thr Thr His Ala Asp Tyr Phe Tyr Gly Thr Ile Pro Cys 115 120 125Thr Arg Lys Met Thr Asp Ala Glu Ile Asn Gly Glu Tyr Glu Trp Glu 130 135 140Thr Gly Asn Val Ile Val Glu Thr Phe Glu Lys Gln Gly Ile Asp Ala145 150 155 160Ala Gln Met Pro Gly Val Leu Val His Ser His Gly Pro Phe Ala Trp 165 170 175Gly Lys Asn Ala Glu Asp Ala Val His Asn Ala Ile Val Leu Glu Glu 180 185 190Val Ala Tyr Met Gly Ile Phe Cys Arg Gln Leu Ala Pro Gln Leu Pro 195 200 205Asp Met Gln Gln Thr Leu Leu Asn Lys His Tyr Leu Arg Lys His Gly 210 215 220Ala Lys Ala Tyr Tyr Gly Gln225 23014696DNAE. coli 14atgttagaag atctcaaacg ccaggtatta gaggccaacc tggcgctgcc aaaacataac 60ctggtcacgc tcacatgggg caacgtcagc gccgttgatc gcgagcgcgg cgtctttgtg 120atcaaacctt ccggcgtcga ttacagcatc atgaccgctg acgatatggt cgtggttagc 180atcgaaaccg gtgaagtggt tgaaggtgcg aaaaagccct cctccgatac gccaactcac 240cgactgctct atcaggcatt cccgtccatt ggcggcattg tgcacacaca ctcgcgccac 300gccactatct gggcgcaggc gggccagtcg attccagcaa ccggcaccac ccacgccgac 360tatttctacg gcaccattcc ctgcacccgc aaaatgaccg acgcagaaat caacggtgaa 420tatgagtggg aaaccggtaa cgtcatcgta gaaaccttcg aaaaacaggg tatcgatgca 480gcgcaaatgc ccggcgtcct ggtccattct cacggcccat ttgcatgggg caaaaatgcc 540gaagatgcgg tgcataacgc catcgtgctg gaagaggtcg cttatatggg gatattctgc 600cgtcagttag cgccgcagtt accggatatg cagcaaacgc tgctgaataa acactatctg 660cgtaagcatg gcgcgaaggc atattacggg cagtaa 69615438PRTBacteroides thetaiotaomicron 15Met Ala Thr Lys Glu Phe Phe Pro Gly Ile Glu Lys Ile Lys Phe Glu1 5 10 15Gly Lys Asp Ser Lys Asn Pro Met Ala Phe Arg Tyr Tyr Asp Ala Glu 20 25 30Lys Val Ile Asn Gly Lys Lys Met Lys Asp Trp Leu Arg Phe Ala Met 35 40 45Ala Trp Trp His Thr Leu Cys Ala Glu Gly Gly Asp Gln Phe Gly Gly 50 55 60Gly Thr Lys Gln Phe Pro Trp Asn Gly Asn Ala Asp Ala Ile Gln Ala65 70 75 80Ala Lys Asp Lys Met Asp Ala Gly Phe Glu Phe Met Gln Lys Met Gly 85 90 95Ile Glu Tyr Tyr Cys Phe His Asp Val Asp Leu Val Ser Glu Gly Ala 100 105 110Ser Val Glu Glu Tyr Glu Ala Asn Leu Lys Glu Ile Val Ala Tyr Ala 115 120 125Lys Gln Lys Gln Ala Glu Thr Gly Ile Lys Leu Leu Trp Gly Thr Ala 130 135 140Asn Val Phe Gly His Ala Arg Tyr Met Asn Gly Ala Ala Thr Asn Pro145 150 155 160Asp Phe Asp Val Val Ala Arg Ala Ala Val Gln Ile Lys Asn Ala Ile 165 170 175Asp Ala Thr Ile Glu Leu Gly Gly Glu Asn Tyr Val Phe Trp Gly Gly 180 185 190Arg Glu Gly Tyr Met Ser Leu Leu Asn Thr Asp Gln Lys Arg Glu Lys 195 200 205Glu His Leu Ala Gln Met Leu Thr Ile Ala Arg Asp Tyr Ala Arg Ala 210 215 220Arg Gly Phe Lys Gly Thr Phe Leu Ile Glu Pro Lys Pro Met Glu Pro225 230 235 240Thr Lys His Gln Tyr Asp Val Asp Thr Glu Thr Val Ile Gly Phe Leu 245 250 255Lys Ala His Gly Leu Asp Lys Asp Phe Lys Val Asn Ile Glu Val Asn 260 265 270His Ala Thr Leu Ala Gly His Thr Phe Glu His Glu Leu Ala Val Ala 275 280 285Val Asp Asn Gly Met Leu Gly Ser Ile Asp Ala Asn Arg Gly Asp Tyr 290 295 300Gln Asn Gly Trp Asp Thr Asp Gln Phe Pro Ile Asp Asn Tyr Glu Leu305 310 315 320Thr Gln Ala Met Met Gln Ile Ile Arg Asn Gly Gly Leu Gly Thr Gly 325 330 335Gly Thr Asn Phe Asp Ala Lys Thr Arg Arg Asn Ser Thr Asp Leu Glu 340 345 350Asp Ile Phe Ile Ala His Ile Ala Gly Met Asp Ala Met Ala Arg Ala 355 360 365Leu Glu Ser Ala Ala Ala Leu Leu Asp Glu Ser Pro Tyr Lys Lys Met 370 375 380Leu Ala Asp Arg Tyr Ala Ser Phe Asp Gly Gly Lys Gly Lys Glu Phe385

390 395 400Glu Asp Gly Lys Leu Thr Leu Glu Asp Val Val Ala Tyr Ala Lys Thr 405 410 415Lys Gly Glu Pro Lys Gln Thr Ser Gly Lys Gln Glu Leu Tyr Glu Ala 420 425 430Ile Leu Asn Met Tyr Cys 435161317DNABacteroides thetaiotaomicron 16atggcaacaa aagaattttt tccgggaatt gaaaagatta aatttgaagg taaagatagt 60aagaacccga tggcattccg ttattacgat gcagagaagg tgattaatgg taaaaagatg 120aaggattggc tgagattcgc tatggcatgg tggcacacat tgtgcgctga aggtggtgat 180cagttcggtg gcggaacaaa gcaattccca tggaatggta atgcagatgc tatacaggca 240gcaaaagata agatggatgc aggatttgaa ttcatgcaga agatgggtat cgaatactat 300tgcttccatg acgtagactt ggtttcggaa ggtgccagtg tagaagaata cgaagctaac 360ctgaaagaaa tcgtagctta tgcaaaacag aaacaggcag aaaccggtat caaactactg 420tggggtactg ctaatgtatt cggtcacgcc cgctatatga acggtgcagc taccaatcct 480gacttcgatg tagtagctcg tgctgctgtt cagatcaaaa atgcgattga tgcaacgatt 540gaacttggcg gagagaatta tgtgttttgg ggtggtcgtg aaggctatat gtctcttctg 600aacacagatc agaaacgtga aaaagaacac cttgcacaga tgttgacgat tgctcgtgac 660tatgcccgtg cccgtggttt caaaggtact ttcctgatcg aaccgaaacc gatggaaccg 720actaaacatc aatatgacgt agatacggaa actgtaatcg gcttcctgaa agctcatggt 780ctggataagg atttcaaagt aaatatcgag gtgaatcacg caactttggc aggtcacact 840ttcgagcatg aattggctgt agctgtagac aatggtatgt tgggctcaat tgacgccaat 900cgtggtgact atcagaatgg ctgggataca gaccaattcc cgatcgacaa ttatgaactg 960actcaggcta tgatgcagat tatccgtaat ggtggtctcg gtaccggtgg tacgaacttt 1020gatgctaaaa cccgtcgtaa ttctactgat ctggaagata tctttattgc tcacatcgca 1080ggtatggacg ctatggcccg tgcactcgaa agtgcagcgg ctctgctcga cgaatctccc 1140tataagaaga tgctggctga ccgttatgct tcatttgatg ggggcaaagg taaagaattt 1200gaagacggca agctgactct ggaggatgtg gttgcttatg caaaaacaaa aggcgaaccg 1260aaacagacta gcggcaagca agaactttat gaggcaattc tgaatatgta ttgctaa 131717258PRTSaccharomyces cerevisiae 17Met Ala Ala Gly Val Pro Lys Ile Asp Ala Leu Glu Ser Leu Gly Asn1 5 10 15Pro Leu Glu Asp Ala Lys Arg Ala Ala Ala Tyr Arg Ala Val Asp Glu 20 25 30Asn Leu Lys Phe Asp Asp His Lys Ile Ile Gly Ile Gly Ser Gly Ser 35 40 45Thr Val Val Tyr Val Ala Glu Arg Ile Gly Gln Tyr Leu His Asp Pro 50 55 60Lys Phe Tyr Glu Val Ala Ser Lys Phe Ile Cys Ile Pro Thr Gly Phe65 70 75 80Gln Ser Arg Asn Leu Ile Leu Asp Asn Lys Leu Gln Leu Gly Ser Ile 85 90 95Glu Gln Tyr Pro Arg Ile Asp Ile Ala Phe Asp Gly Ala Asp Glu Val 100 105 110Asp Glu Asn Leu Gln Leu Ile Lys Gly Gly Gly Ala Cys Leu Phe Gln 115 120 125Glu Lys Leu Val Ser Thr Ser Ala Lys Thr Phe Ile Val Val Ala Asp 130 135 140Ser Arg Lys Lys Ser Pro Lys His Leu Gly Lys Asn Trp Arg Gln Gly145 150 155 160Val Pro Ile Glu Ile Val Pro Ser Ser Tyr Val Arg Val Lys Asn Asp 165 170 175Leu Leu Glu Gln Leu His Ala Glu Lys Val Asp Ile Arg Gln Gly Gly 180 185 190Ser Ala Lys Ala Gly Pro Val Val Thr Asp Asn Asn Asn Phe Ile Ile 195 200 205Asp Ala Asp Phe Gly Glu Ile Ser Asp Pro Arg Lys Leu His Arg Glu 210 215 220Ile Lys Leu Leu Val Gly Val Val Glu Thr Gly Leu Phe Ile Asp Asn225 230 235 240Ala Ser Lys Ala Tyr Phe Gly Asn Ser Asp Gly Ser Val Glu Val Thr 245 250 255Glu Lys182467DNASaccharomyces cerevisiae 18ggatccaaga ccattattcc atcagaatgg aaaaaagttt aaaagatcac ggagattttg 60ttcttctgag cttctgctgt ccttgaaaac aaattattcc gctggccgcc ccaaacaaaa 120acaaccccga tttaataaca ttgtcacagt attagaaatt ttctttttac aaattaccat 180ttccagctta ctacttccta taatcctcaa tcttcagcaa gcgacgcagg gaatagccgc 240tgaggtgcat aactgtcact tttcaattcg gccaatgcaa tctcaggcgg acgaataagg 300gggccctctc gagaaaaaca aaaggaggat gagattagta ctttaatgtt gtgttcagta 360attcagagac agacaagaga ggtttccaac acaatgtctt tagactcata ctatcttggg 420tttgatcttt cgacccaaca actgaaatgt ctcgccatta accaggacct aaaaattgtc 480cattcagaaa cagtggaatt tgaaaaggat cttccgcatt atcacacaaa gaagggtgtc 540tatatacacg gcgacactat cgaatgtccc gtagccatgt ggttaggggc tctagatctg 600gttctctcga aatatcgcga ggctaaattt ccattgaaca aagttatggc cgtctcaggg 660tcctgccagc agcacgggtc tgtctactgg tcctcccaag ccgaatctct gttagagcaa 720ttgaataaga aaccggaaaa agatttattg cactacgtga gctctgtagc atttgcaagg 780caaaccgccc ccaattggca agaccacagt actgcaaagc aatgtcaaga gtttgaagag 840tgcataggtg ggcctgaaaa aatggctcaa ttaacagggt ccagagccca ttttagattt 900actggtcctc aaattctgaa aattgcacaa ttagaaccag aagcttacga aaaaacaaag 960accatttctt tagtgtctaa ttttttgact tctatcttag tgggccatct tgttgaatta 1020gaggaggcag atgcctgtgg tatgaacctt tatgatatac gtgaaagaaa attcatgtat 1080gagctactac atctaattga tagttcttct aaggataaaa ctatcagaca aaaattaatg 1140agagcaccca tgaaaaattt gatagcgggt accatctgta aatattttat tgagaagtac 1200ggtttcaata caaactgcaa ggtctctccc atgactgggg ataatttagc cactatatgt 1260tctttacccc tgcggaagaa tgacgttctc gtttccctag gaacaagtac tacagttctt 1320ctggtcaccg ataagtatca cccctctccg aactatcatc ttttcattca tccaactctg 1380ccaaaccatt atatgggtat gatttgttat tgtaatggtt ctttggcaag ggagaggata 1440agagacgagt taaacaaaga acgggaaaat aattatgaga agactaacga ttggactctt 1500tttaatcaag ctgtgctaga tgactcagaa agtagtgaaa atgaattagg tgtatatttt 1560cctctggggg agatcgttcc tagcgtaaaa gccataaaca aaagggttat cttcaatcca 1620aaaacgggta tgattgaaag agaggtggcc aagttcaaag acaagaggca cgatgccaaa 1680aatattgtag aatcacaggc tttaagttgc agggtaagaa tatctcccct gctttcggat 1740tcaaacgcaa gctcacaaca gagactgaac gaagatacaa tcgtgaagtt tgattacgat 1800gaatctccgc tgcgggacta cctaaataaa aggccagaaa ggactttttt tgtaggtggg 1860gcttctaaaa acgatgctat tgtgaagaag tttgctcaag tcattggtgc tacaaagggt 1920aattttaggc tagaaacacc aaactcatgt gcccttggtg gttgttataa ggccatgtgg 1980tcattgttat atgactctaa taaaattgca gttccttttg ataaatttct gaatgacaat 2040tttccatggc atgtaatgga aagcatatcc gatgtggata atgaaaattg gatcgctata 2100attccaagat tgtcccctta agcgaactgg aaaagactct catctaaaat atgtttgaat 2160aatttatcat gccctgacaa gtacacacaa acacagacac ataatataca tacatatata 2220tatatcaccg ttattatgcg tgcacatgac aatgcccttg tatgtttcgt atactgtagc 2280aagtagtcat cattttgttc cccgttcgga aaatgacaaa aagtaaaatc aataaatgaa 2340gagtaaaaaa caatttatga aagggtgagc gaccagcaac gagagagaca aatcaaatta 2400gcgctttcca gtgagaatat aagagagcat tgaaagagct aggttattgt taaatcatct 2460cgagctc 246719238PRTSaccharomyces cerevisiae 19Met Val Lys Pro Ile Ile Ala Pro Ser Ile Leu Ala Ser Asp Phe Ala1 5 10 15Asn Leu Gly Cys Glu Cys His Lys Val Ile Asn Ala Gly Ala Asp Trp 20 25 30Leu His Ile Asp Val Met Asp Gly His Phe Val Pro Asn Ile Thr Leu 35 40 45Gly Gln Pro Ile Val Thr Ser Leu Arg Arg Ser Val Pro Arg Pro Gly 50 55 60Asp Ala Ser Asn Thr Glu Lys Lys Pro Thr Ala Phe Phe Asp Cys His65 70 75 80Met Met Val Glu Asn Pro Glu Lys Trp Val Asp Asp Phe Ala Lys Cys 85 90 95Gly Ala Asp Gln Phe Thr Phe His Tyr Glu Ala Thr Gln Asp Pro Leu 100 105 110His Leu Val Lys Leu Ile Lys Ser Lys Gly Ile Lys Ala Ala Cys Ala 115 120 125Ile Lys Pro Gly Thr Ser Val Asp Val Leu Phe Glu Leu Ala Pro His 130 135 140Leu Asp Met Ala Leu Val Met Thr Val Glu Pro Gly Phe Gly Gly Gln145 150 155 160Lys Phe Met Glu Asp Met Met Pro Lys Val Glu Thr Leu Arg Ala Lys 165 170 175Phe Pro His Leu Asn Ile Gln Val Asp Gly Gly Leu Gly Lys Glu Thr 180 185 190Ile Pro Lys Ala Ala Lys Ala Gly Ala Asn Val Ile Val Ala Gly Thr 195 200 205Ser Val Phe Thr Ala Ala Asp Pro His Asp Val Ile Ser Phe Met Lys 210 215 220Glu Glu Val Ser Lys Glu Leu Arg Ser Arg Asp Leu Leu Asp225 230 235201328DNASaccharomyces cerevisiae 20gttaggcact tacgtatctt gtatagtagg aatggctcgg tttatgtata ttaggagatc 60aaaacgagaa aaaaatacca tatcgtatag tatagagagt ataaatataa gaaatgccgc 120atatgtacaa ctaatctagc aaatctctag aacgcaattc cttcgagact tcttctttca 180tgaaggagat aacatcgtgc gggtcagctg cagtgaaaac actggtacca gcgacaataa 240cgttggcacc ggctttggcg gctttcggga tggtctcctt gcccaaacca ccatcgactt 300ggatattcaa atgggggaac ttggctctca aagtttccac ttttggcatc atgtcttcca 360tgaatttttg gcctccaaac ccaggttcca cagtcataac aagagccata tccaaatgag 420gagctagttc aaataaaacg tcaacagaag taccaggttt gatggcgcat gcagctttga 480tgcccttaga cttaatcaac ttaactaaat gcaaagggtc ttgtgtggcc tcgtagtgga 540acgtaaattg gtcagcacca catttagcaa aatcgtcgac ccatttttca ggattttcaa 600ccatcatgtg acaatcgaag aacgcagtgg gcttcttttc tgtgttgcta gcatcgccag 660ggcgtggcac agaacgacgt agggaggtaa caattggttg gcccagagta atgtttggaa 720caaaatggcc gtccatgaca tcgatatgta accaatctgc gccggcgttg atgaccttat 780gacattcgca acccaagttg gcgaagtcag aagcaaggat actgggagct ataattggtt 840tgaccatttt ttcttgtgtg tttacctcgc tcttggaatt agcaaatggc cttcttgcat 900gaaattgtat cgagtttgct ttatttttct ttttacgggc ggattctttc tattctggct 960ttcctataac agagatcatg aaagaagttc cagcttacgg atcaagaaag tacctataca 1020tatacaaaaa tctgattact ttcccagctc gacttggata gctgttcttg ttttctcttg 1080gcgacacatt ttttgtttct gaagccacgt cctgctttat aagaggacat ttaaagttgc 1140aggacttgaa tgcaattacc ggaagaagca accaaccggc atggttcagc atacaataca 1200catttgatta gaaaagcaga gaataaatag acatgatacc tctcttttta tcctctgcag 1260cgtattattg tttattccac gcaggcatcg gtcgttggct gttgttatgt ctcagataag 1320cgcgtttg 132821680PRTSaccharomyces cerevisiae 21Met Thr Gln Phe Thr Asp Ile Asp Lys Leu Ala Val Ser Thr Ile Arg1 5 10 15Ile Leu Ala Val Asp Thr Val Ser Lys Ala Asn Ser Gly His Pro Gly 20 25 30Ala Pro Leu Gly Met Ala Pro Ala Ala His Val Leu Trp Ser Gln Met 35 40 45Arg Met Asn Pro Thr Asn Pro Asp Trp Ile Asn Arg Asp Arg Phe Val 50 55 60Leu Ser Asn Gly His Ala Val Ala Leu Leu Tyr Ser Met Leu His Leu65 70 75 80Thr Gly Tyr Asp Leu Ser Ile Glu Asp Leu Lys Gln Phe Arg Gln Leu 85 90 95Gly Ser Arg Thr Pro Gly His Pro Glu Phe Glu Leu Pro Gly Val Glu 100 105 110Val Thr Thr Gly Pro Leu Gly Gln Gly Ile Ser Asn Ala Val Gly Met 115 120 125Ala Met Ala Gln Ala Asn Leu Ala Ala Thr Tyr Asn Lys Pro Gly Phe 130 135 140Thr Leu Ser Asp Asn Tyr Thr Tyr Val Phe Leu Gly Asp Gly Cys Leu145 150 155 160Gln Glu Gly Ile Ser Ser Glu Ala Ser Ser Leu Ala Gly His Leu Lys 165 170 175Leu Gly Asn Leu Ile Ala Ile Tyr Asp Asp Asn Lys Ile Thr Ile Asp 180 185 190Gly Ala Thr Ser Ile Ser Phe Asp Glu Asp Val Ala Lys Arg Tyr Glu 195 200 205Ala Tyr Gly Trp Glu Val Leu Tyr Val Glu Asn Gly Asn Glu Asp Leu 210 215 220Ala Gly Ile Ala Lys Ala Ile Ala Gln Ala Lys Leu Ser Lys Asp Lys225 230 235 240Pro Thr Leu Ile Lys Met Thr Thr Thr Ile Gly Tyr Gly Ser Leu His 245 250 255Ala Gly Ser His Ser Val His Gly Ala Pro Leu Lys Ala Asp Asp Val 260 265 270Lys Gln Leu Lys Ser Lys Phe Gly Phe Asn Pro Asp Lys Ser Phe Val 275 280 285Val Pro Gln Glu Val Tyr Asp His Tyr Gln Lys Thr Ile Leu Lys Pro 290 295 300Gly Val Glu Ala Asn Asn Lys Trp Asn Lys Leu Phe Ser Glu Tyr Gln305 310 315 320Lys Lys Phe Pro Glu Leu Gly Ala Glu Leu Ala Arg Arg Leu Ser Gly 325 330 335Gln Leu Pro Ala Asn Trp Glu Ser Lys Leu Pro Thr Tyr Thr Ala Lys 340 345 350Asp Ser Ala Val Ala Thr Arg Lys Leu Ser Glu Thr Val Leu Glu Asp 355 360 365Val Tyr Asn Gln Leu Pro Glu Leu Ile Gly Gly Ser Ala Asp Leu Thr 370 375 380Pro Ser Asn Leu Thr Arg Trp Lys Glu Ala Leu Asp Phe Gln Pro Pro385 390 395 400Ser Ser Gly Ser Gly Asn Tyr Ser Gly Arg Tyr Ile Arg Tyr Gly Ile 405 410 415Arg Glu His Ala Met Gly Ala Ile Met Asn Gly Ile Ser Ala Phe Gly 420 425 430Ala Asn Tyr Lys Pro Tyr Gly Gly Thr Phe Leu Asn Phe Val Ser Tyr 435 440 445Ala Ala Gly Ala Val Arg Leu Ser Ala Leu Ser Gly His Pro Val Ile 450 455 460Trp Val Ala Thr His Asp Ser Ile Gly Val Gly Glu Asp Gly Pro Thr465 470 475 480His Gln Pro Ile Glu Thr Leu Ala His Phe Arg Ser Leu Pro Asn Ile 485 490 495Gln Val Trp Arg Pro Ala Asp Gly Asn Glu Val Ser Ala Ala Tyr Lys 500 505 510Asn Ser Leu Glu Ser Lys His Thr Pro Ser Ile Ile Ala Leu Ser Arg 515 520 525Gln Asn Leu Pro Gln Leu Glu Gly Ser Ser Ile Glu Ser Ala Ser Lys 530 535 540Gly Gly Tyr Val Leu Gln Asp Val Ala Asn Pro Asp Ile Ile Leu Val545 550 555 560Ala Thr Gly Ser Glu Val Ser Leu Ser Val Glu Ala Ala Lys Thr Leu 565 570 575Ala Ala Lys Asn Ile Lys Ala Arg Val Val Ser Leu Pro Asp Phe Phe 580 585 590Thr Phe Asp Lys Gln Pro Leu Glu Tyr Arg Leu Ser Val Leu Pro Asp 595 600 605Asn Val Pro Ile Met Ser Val Glu Val Leu Ala Thr Thr Cys Trp Gly 610 615 620Lys Tyr Ala His Gln Ser Phe Gly Ile Asp Arg Phe Gly Ala Ser Gly625 630 635 640Lys Ala Pro Glu Val Phe Lys Phe Phe Gly Phe Thr Pro Glu Gly Val 645 650 655Ala Glu Arg Ala Gln Lys Thr Ile Ala Phe Tyr Lys Gly Asp Lys Leu 660 665 670Ile Ser Pro Leu Lys Lys Ala Phe 675 680222046DNASaccharomyces cerevisiae 22atggcacagt tctccgacat tgataaactt gcggtttcca ctttaagatt actttccgtt 60gaccaggtgg aaagcgcaca atctggccac ccaggtgcac cactaggatt ggcaccagtt 120gcccatgtaa ttttcaagca actgcgctgt aaccctaaca atgaacattg gatcaataga 180gacaggtttg ttctgtcgaa cggtcactca tgcgctcttc tgtactcaat gctccatcta 240ttaggatacg attactctat cgaggacttg agacaattta gacaagtaaa ctcaaggaca 300ccgggtcatc cagaattcca ctcagcggga gtggaaatca cttccggtcc gctaggccag 360ggtatctcaa atgctgttgg tatggcaata gcgcaggcca actttgccgc cacttataac 420gaggatggct ttcccatttc cgactcatat acgtttgcta ttgtagggga tggttgctta 480caagagggtg tttcttcgga gacctcttcc ttagcgggac atctgcaatt gggtaacttg 540attacgtttt atgacagtaa tagcatttcc attgacggta aaacctcgta ctcgttcgac 600gaagatgttt tgaagcgata cgaggcatat ggttgggaag tcatggaagt cgataaagga 660gacgacgata tggaatccat ttctagcgct ttggaaaagg caaaactatc gaaggacaag 720ccaaccataa tcaaggtaac tactacaatt ggatttgggt ccctacaaca gggtactgct 780ggtgttcatg ggtccgcttt gaaggcagat gatgttaaac agttgaagaa gaggtggggg 840tttgacccaa ataaatcatt tgtagtacct caagaggtgt acgattatta taagaagact 900gttgtggaac ccggtcaaaa acttaatgag gaatgggata ggatgtttga agaatacaaa 960accaaatttc ccgagaaggg taaagaattg caaagaagat tgaatggtga gttaccggaa 1020ggttgggaaa agcatttacc gaagtttact ccggacgacg atgctctggc aacaagaaag 1080acatcccagc aggtgctgac gaacatggtc caagttttgc ctgaattgat cggtggttct 1140gccgatttga caccttcgaa tctgacaagg tgggaaggcg cggtagattt ccaacctccc 1200attacccaac taggtaacta tgcaggaagg tacattagat acggtgtgag ggaacacgga 1260atgggtgcca ttatgaacgg tatctctgcc tttggtgcaa actacaagcc ttacggtggt 1320acctttttga acttcgtctc ttatgctgca ggagccgtta ggttagccgc cttgtctggt 1380aatccagtca tttgggttgc aacacatgac tctatcgggc ttggtgagga tggtccaacg 1440caccaaccta ttgaaactct ggctcacttg agggctattc caaacatgca tgtatggaga 1500cctgctgatg gtaacgaaac ttctgctgcg tattattctg ctatcaaatc tggtcgaaca 1560ccatctgttg tggctttatc acgacagaat cttcctcaat tggagcattc ctcttttgaa 1620aaagccttga agggtggcta tgtgatccat gacgtggaga atcctgatat tatcctggtg 1680tcaacaggat cagaagtctc catttctata gatgcagcca aaaaattgta cgatactaaa 1740aaaatcaaag caagagttgt ttccctgcca gacttttata cttttgacag gcaaagtgaa 1800gaatacagat tctctgttct accagacggt gttccgatca tgtcctttga agtattggct 1860acttcaagct ggggtaagta tgctcatcaa tcgttcggac tcgacgaatt tggtcgttca 1920ggcaaggggc ctgaaattta caaattgttc gatttcacag cggacggtgt tgcgtcaagg 1980gctgaaaaga caatcaatta ctacaaagga aagcagttgc tttctcctat gggaagagct 2040ttctaa 204623335PRTSaccharomyces cerevisiae 23Met Ser Glu Pro Ala Gln Lys Lys Gln Lys Val Ala Asn Asn Ser Leu1

5 10 15Glu Gln Leu Lys Ala Ser Gly Thr Val Val Val Ala Asp Thr Gly Asp 20 25 30Phe Gly Ser Ile Ala Lys Phe Gln Pro Gln Asp Ser Thr Thr Asn Pro 35 40 45Ser Leu Ile Leu Ala Ala Ala Lys Gln Pro Thr Tyr Ala Lys Leu Ile 50 55 60Asp Val Ala Val Glu Tyr Gly Lys Lys His Gly Lys Thr Thr Glu Glu65 70 75 80Gln Val Glu Asn Ala Val Asp Arg Leu Leu Val Glu Phe Gly Lys Glu 85 90 95Ile Leu Lys Ile Val Pro Gly Arg Val Ser Thr Glu Val Asp Ala Arg 100 105 110Leu Ser Phe Asp Thr Gln Ala Thr Ile Glu Lys Ala Arg His Ile Ile 115 120 125Lys Leu Phe Glu Gln Glu Gly Val Ser Lys Glu Arg Val Leu Ile Lys 130 135 140Ile Ala Ser Thr Trp Glu Gly Ile Gln Ala Ala Lys Glu Leu Glu Glu145 150 155 160Lys Asp Gly Ile His Cys Asn Leu Thr Leu Leu Phe Ser Phe Val Gln 165 170 175Ala Val Ala Cys Ala Glu Ala Gln Val Thr Leu Ile Ser Pro Phe Val 180 185 190Gly Arg Ile Leu Asp Trp Tyr Lys Ser Ser Thr Gly Lys Asp Tyr Lys 195 200 205Gly Glu Ala Asp Pro Gly Val Ile Ser Val Lys Lys Ile Tyr Asn Tyr 210 215 220Tyr Lys Lys Tyr Gly Tyr Lys Thr Ile Val Met Gly Ala Ser Phe Arg225 230 235 240Ser Thr Asp Glu Ile Lys Asn Leu Ala Gly Val Asp Tyr Leu Thr Ile 245 250 255Ser Pro Ala Leu Leu Asp Lys Leu Met Asn Ser Thr Glu Pro Phe Pro 260 265 270Arg Val Leu Asp Pro Val Ser Ala Lys Lys Glu Ala Gly Asp Lys Ile 275 280 285Ser Tyr Ile Ser Asp Glu Ser Lys Phe Arg Phe Asp Leu Asn Glu Asp 290 295 300Ala Met Ala Thr Glu Lys Leu Ser Glu Gly Ile Arg Lys Phe Ser Ala305 310 315 320Asp Ile Val Thr Leu Phe Asp Leu Ile Glu Lys Lys Val Thr Ala 325 330 335242046DNASaccharomyces cerevisiae 24atggcacagt tctccgacat tgataaactt gcggtttcca ctttaagatt actttccgtt 60gaccaggtgg aaagcgcaca atctggccac ccaggtgcac cactaggatt ggcaccagtt 120gcccatgtaa ttttcaagca actgcgctgt aaccctaaca atgaacattg gatcaataga 180gacaggtttg ttctgtcgaa cggtcactca tgcgctcttc tgtactcaat gctccatcta 240ttaggatacg attactctat cgaggacttg agacaattta gacaagtaaa ctcaaggaca 300ccgggtcatc cagaattcca ctcagcggga gtggaaatca cttccggtcc gctaggccag 360ggtatctcaa atgctgttgg tatggcaata gcgcaggcca actttgccgc cacttataac 420gaggatggct ttcccatttc cgactcatat acgtttgcta ttgtagggga tggttgctta 480caagagggtg tttcttcgga gacctcttcc ttagcgggac atctgcaatt gggtaacttg 540attacgtttt atgacagtaa tagcatttcc attgacggta aaacctcgta ctcgttcgac 600gaagatgttt tgaagcgata cgaggcatat ggttgggaag tcatggaagt cgataaagga 660gacgacgata tggaatccat ttctagcgct ttggaaaagg caaaactatc gaaggacaag 720ccaaccataa tcaaggtaac tactacaatt ggatttgggt ccctacaaca gggtactgct 780ggtgttcatg ggtccgcttt gaaggcagat gatgttaaac agttgaagaa gaggtggggg 840tttgacccaa ataaatcatt tgtagtacct caagaggtgt acgattatta taagaagact 900gttgtggaac ccggtcaaaa acttaatgag gaatgggata ggatgtttga agaatacaaa 960accaaatttc ccgagaaggg taaagaattg caaagaagat tgaatggtga gttaccggaa 1020ggttgggaaa agcatttacc gaagtttact ccggacgacg atgctctggc aacaagaaag 1080acatcccagc aggtgctgac gaacatggtc caagttttgc ctgaattgat cggtggttct 1140gccgatttga caccttcgaa tctgacaagg tgggaaggcg cggtagattt ccaacctccc 1200attacccaac taggtaacta tgcaggaagg tacattagat acggtgtgag ggaacacgga 1260atgggtgcca ttatgaacgg tatctctgcc tttggtgcaa actacaagcc ttacggtggt 1320acctttttga acttcgtctc ttatgctgca ggagccgtta ggttagccgc cttgtctggt 1380aatccagtca tttgggttgc aacacatgac tctatcgggc ttggtgagga tggtccaacg 1440caccaaccta ttgaaactct ggctcacttg agggctattc caaacatgca tgtatggaga 1500cctgctgatg gtaacgaaac ttctgctgcg tattattctg ctatcaaatc tggtcgaaca 1560ccatctgttg tggctttatc acgacagaat cttcctcaat tggagcattc ctcttttgaa 1620aaagccttga agggtggcta tgtgatccat gacgtggaga atcctgatat tatcctggtg 1680tcaacaggat cagaagtctc catttctata gatgcagcca aaaaattgta cgatactaaa 1740aaaatcaaag caagagttgt ttccctgcca gacttttata cttttgacag gcaaagtgaa 1800gaatacagat tctctgttct accagacggt gttccgatca tgtcctttga agtattggct 1860acttcaagct ggggtaagta tgctcatcaa tcgttcggac tcgacgaatt tggtcgttca 1920ggcaaggggc ctgaaattta caaattgttc gatttcacag cggacggtgt tgcgtcaagg 1980gctgaaaaga caatcaatta ctacaaagga aagcagttgc tttctcctat gggaagagct 2040ttctaa 204625600PRTSaccharomyces cerevisiae 25Met Leu Cys Ser Val Ile Gln Arg Gln Thr Arg Glu Val Ser Asn Thr1 5 10 15Met Ser Leu Asp Ser Tyr Tyr Leu Gly Phe Asp Leu Ser Thr Gln Gln 20 25 30Leu Lys Cys Leu Ala Ile Asn Gln Asp Leu Lys Ile Val His Ser Glu 35 40 45Thr Val Glu Phe Glu Lys Asp Leu Pro His Tyr His Thr Lys Lys Gly 50 55 60Val Tyr Ile His Gly Asp Thr Ile Glu Cys Pro Val Ala Met Trp Leu65 70 75 80Glu Ala Leu Asp Leu Val Leu Ser Lys Tyr Arg Glu Ala Lys Phe Pro 85 90 95Leu Asn Lys Val Met Ala Val Ser Gly Ser Cys Gln Gln His Gly Ser 100 105 110Val Tyr Trp Ser Ser Gln Ala Glu Ser Leu Leu Glu Gln Leu Asn Lys 115 120 125Lys Pro Glu Lys Asp Leu Leu His Tyr Val Ser Ser Val Ala Phe Ala 130 135 140Arg Gln Thr Ala Pro Asn Trp Gln Asp His Ser Thr Ala Lys Gln Cys145 150 155 160Gln Glu Phe Glu Glu Cys Ile Gly Gly Pro Glu Lys Met Ala Gln Leu 165 170 175Thr Gly Ser Arg Ala His Phe Arg Phe Thr Gly Pro Gln Ile Leu Lys 180 185 190Ile Ala Gln Leu Glu Pro Glu Ala Tyr Glu Lys Thr Lys Thr Ile Ser 195 200 205Leu Val Ser Asn Phe Leu Thr Ser Ile Leu Val Gly His Leu Val Glu 210 215 220Leu Glu Glu Ala Asp Ala Cys Gly Met Asn Leu Tyr Asp Ile Arg Glu225 230 235 240Arg Lys Phe Ser Asp Glu Leu Leu His Leu Ile Asp Ser Ser Ser Lys 245 250 255Asp Lys Thr Ile Arg Gln Lys Leu Met Arg Ala Pro Met Lys Asn Leu 260 265 270Ile Ala Gly Thr Ile Cys Lys Tyr Phe Ile Glu Lys Tyr Gly Phe Asn 275 280 285Thr Asn Cys Lys Val Ser Pro Met Thr Gly Asp Asn Leu Ala Thr Ile 290 295 300Cys Ser Leu Pro Leu Arg Lys Asn Asp Val Leu Val Ser Leu Gly Thr305 310 315 320Ser Thr Thr Val Leu Leu Val Thr Asp Lys Tyr His Pro Ser Pro Asn 325 330 335Tyr His Leu Phe Ile His Pro Thr Leu Pro Asn His Tyr Met Gly Met 340 345 350Ile Cys Tyr Cys Asn Gly Ser Leu Ala Arg Glu Arg Ile Arg Asp Glu 355 360 365Leu Asn Lys Glu Arg Glu Asn Asn Tyr Glu Lys Thr Asn Asp Trp Thr 370 375 380Leu Phe Asn Gln Ala Val Leu Asp Asp Ser Glu Ser Ser Glu Asn Glu385 390 395 400Leu Gly Val Tyr Phe Pro Leu Gly Glu Ile Val Pro Ser Val Lys Ala 405 410 415Ile Asn Lys Arg Val Ile Phe Asn Pro Lys Thr Gly Met Ile Glu Arg 420 425 430Glu Val Ala Lys Phe Lys Asp Lys Arg His Asp Ala Lys Asn Ile Val 435 440 445Glu Ser Gln Ala Leu Ser Cys Arg Val Arg Ile Ser Pro Leu Leu Ser 450 455 460Asp Ser Asn Ala Ser Ser Gln Gln Arg Leu Asn Glu Asp Thr Ile Val465 470 475 480Lys Phe Asp Tyr Asp Glu Ser Pro Leu Arg Asp Tyr Leu Asn Lys Arg 485 490 495Pro Glu Arg Thr Phe Phe Val Gly Gly Ala Ser Lys Asn Asp Ala Ile 500 505 510Val Lys Lys Phe Ala Gln Val Ile Gly Ala Thr Lys Gly Asn Phe Arg 515 520 525Leu Glu Thr Pro Asn Ser Cys Ala Leu Gly Gly Cys Tyr Lys Ala Met 530 535 540Trp Ser Leu Leu Tyr Asp Ser Asn Lys Ile Ala Val Pro Phe Asp Lys545 550 555 560Phe Leu Asn Asp Asn Phe Pro Trp His Val Met Glu Ser Ile Ser Asp 565 570 575Val Asp Asn Glu Asn Trp Asp Arg Tyr Asn Ser Lys Ile Val Pro Leu 580 585 590Ser Glu Leu Glu Lys Thr Leu Ile 595 600262467DNASaccharomyces cerevisiae 26ggatccaaga ccattattcc atcagaatgg aaaaaagttt aaaagatcac ggagattttg 60ttcttctgag cttctgctgt ccttgaaaac aaattattcc gctggccgcc ccaaacaaaa 120acaaccccga tttaataaca ttgtcacagt attagaaatt ttctttttac aaattaccat 180ttccagctta ctacttccta taatcctcaa tcttcagcaa gcgacgcagg gaatagccgc 240tgaggtgcat aactgtcact tttcaattcg gccaatgcaa tctcaggcgg acgaataagg 300gggccctctc gagaaaaaca aaaggaggat gagattagta ctttaatgtt gtgttcagta 360attcagagac agacaagaga ggtttccaac acaatgtctt tagactcata ctatcttggg 420tttgatcttt cgacccaaca actgaaatgt ctcgccatta accaggacct aaaaattgtc 480cattcagaaa cagtggaatt tgaaaaggat cttccgcatt atcacacaaa gaagggtgtc 540tatatacacg gcgacactat cgaatgtccc gtagccatgt ggttaggggc tctagatctg 600gttctctcga aatatcgcga ggctaaattt ccattgaaca aagttatggc cgtctcaggg 660tcctgccagc agcacgggtc tgtctactgg tcctcccaag ccgaatctct gttagagcaa 720ttgaataaga aaccggaaaa agatttattg cactacgtga gctctgtagc atttgcaagg 780caaaccgccc ccaattggca agaccacagt actgcaaagc aatgtcaaga gtttgaagag 840tgcataggtg ggcctgaaaa aatggctcaa ttaacagggt ccagagccca ttttagattt 900actggtcctc aaattctgaa aattgcacaa ttagaaccag aagcttacga aaaaacaaag 960accatttctt tagtgtctaa ttttttgact tctatcttag tgggccatct tgttgaatta 1020gaggaggcag atgcctgtgg tatgaacctt tatgatatac gtgaaagaaa attcatgtat 1080gagctactac atctaattga tagttcttct aaggataaaa ctatcagaca aaaattaatg 1140agagcaccca tgaaaaattt gatagcgggt accatctgta aatattttat tgagaagtac 1200ggtttcaata caaactgcaa ggtctctccc atgactgggg ataatttagc cactatatgt 1260tctttacccc tgcggaagaa tgacgttctc gtttccctag gaacaagtac tacagttctt 1320ctggtcaccg ataagtatca cccctctccg aactatcatc ttttcattca tccaactctg 1380ccaaaccatt atatgggtat gatttgttat tgtaatggtt ctttggcaag ggagaggata 1440agagacgagt taaacaaaga acgggaaaat aattatgaga agactaacga ttggactctt 1500tttaatcaag ctgtgctaga tgactcagaa agtagtgaaa atgaattagg tgtatatttt 1560cctctggggg agatcgttcc tagcgtaaaa gccataaaca aaagggttat cttcaatcca 1620aaaacgggta tgattgaaag agaggtggcc aagttcaaag acaagaggca cgatgccaaa 1680aatattgtag aatcacaggc tttaagttgc agggtaagaa tatctcccct gctttcggat 1740tcaaacgcaa gctcacaaca gagactgaac gaagatacaa tcgtgaagtt tgattacgat 1800gaatctccgc tgcgggacta cctaaataaa aggccagaaa ggactttttt tgtaggtggg 1860gcttctaaaa acgatgctat tgtgaagaag tttgctcaag tcattggtgc tacaaagggt 1920aattttaggc tagaaacacc aaactcatgt gcccttggtg gttgttataa ggccatgtgg 1980tcattgttat atgactctaa taaaattgca gttccttttg ataaatttct gaatgacaat 2040tttccatggc atgtaatgga aagcatatcc gatgtggata atgaaaattg gatcgctata 2100attccaagat tgtcccctta agcgaactgg aaaagactct catctaaaat atgtttgaat 2160aatttatcat gccctgacaa gtacacacaa acacagacac ataatataca tacatatata 2220tatatcaccg ttattatgcg tgcacatgac aatgcccttg tatgtttcgt atactgtagc 2280aagtagtcat cattttgttc cccgttcgga aaatgacaaa aagtaaaatc aataaatgaa 2340gagtaaaaaa caatttatga aagggtgagc gaccagcaac gagagagaca aatcaaatta 2400gcgctttcca gtgagaatat aagagagcat tgaaagagct aggttattgt taaatcatct 2460cgagctc 246727494PRTPiromyces species 27Met Lys Thr Val Ala Gly Ile Asp Leu Gly Thr Gln Ser Met Lys Val1 5 10 15Val Ile Tyr Asp Tyr Glu Lys Lys Glu Ile Ile Glu Ser Ala Ser Cys 20 25 30Pro Met Glu Leu Ile Ser Glu Ser Asp Gly Thr Arg Glu Gln Thr Thr 35 40 45Glu Trp Phe Asp Lys Gly Leu Glu Val Cys Phe Gly Lys Leu Ser Ala 50 55 60Asp Asn Lys Lys Thr Ile Glu Ala Ile Gly Ile Ser Gly Gln Leu His65 70 75 80Gly Phe Val Pro Leu Asp Ala Asn Gly Lys Ala Leu Tyr Asn Ile Lys 85 90 95Leu Trp Cys Asp Thr Ala Thr Val Glu Glu Cys Lys Ile Ile Thr Asp 100 105 110Ala Ala Gly Gly Asp Lys Ala Val Ile Asp Ala Leu Gly Asn Leu Met 115 120 125Leu Thr Gly Phe Thr Ala Pro Lys Ile Leu Trp Leu Lys Arg Asn Lys 130 135 140Pro Glu Ala Phe Ala Asn Leu Lys Tyr Ile Met Leu Pro His Asp Tyr145 150 155 160Leu Asn Trp Lys Leu Thr Gly Asp Tyr Val Met Glu Tyr Gly Asp Ala 165 170 175Ser Gly Thr Ala Leu Phe Asp Ser Lys Asn Arg Cys Trp Ser Lys Lys 180 185 190Ile Cys Asp Ile Ile Asp Pro Lys Leu Leu Asp Leu Leu Pro Lys Leu 195 200 205Ile Glu Pro Ser Ala Pro Ala Gly Lys Val Asn Asp Glu Ala Ala Lys 210 215 220Ala Tyr Gly Ile Pro Ala Gly Ile Pro Val Ser Ala Gly Gly Gly Asp225 230 235 240Asn Met Met Gly Ala Val Gly Thr Gly Thr Val Ala Asp Gly Phe Leu 245 250 255Thr Met Ser Met Gly Thr Ser Gly Thr Leu Tyr Gly Tyr Ser Asp Lys 260 265 270Pro Ile Ser Asp Pro Ala Asn Gly Leu Ser Gly Phe Cys Ser Ser Thr 275 280 285Gly Gly Trp Leu Pro Leu Leu Cys Thr Met Asn Cys Thr Val Ala Thr 290 295 300Glu Phe Val Arg Asn Leu Phe Gln Met Asp Ile Lys Glu Leu Asn Val305 310 315 320Glu Ala Ala Lys Ser Pro Cys Gly Ser Glu Gly Val Leu Val Ile Pro 325 330 335Phe Phe Asn Gly Glu Arg Thr Pro Asn Leu Pro Asn Gly Arg Ala Ser 340 345 350Ile Thr Gly Leu Thr Ser Ala Asn Thr Ser Arg Ala Asn Ile Ala Arg 355 360 365Ala Ser Phe Glu Ser Ala Val Phe Ala Met Arg Gly Gly Leu Asp Ala 370 375 380Phe Arg Lys Leu Gly Phe Gln Pro Lys Glu Ile Arg Leu Ile Gly Gly385 390 395 400Gly Ser Lys Ser Asp Leu Trp Arg Gln Ile Ala Ala Asp Ile Met Asn 405 410 415Leu Pro Ile Arg Val Pro Leu Leu Glu Glu Ala Ala Ala Leu Gly Gly 420 425 430Ala Val Gln Ala Leu Trp Cys Leu Lys Asn Gln Ser Gly Lys Cys Asp 435 440 445Ile Val Glu Leu Cys Lys Glu His Ile Lys Ile Asp Glu Ser Lys Asn 450 455 460Ala Asn Pro Ile Ala Glu Asn Val Ala Val Tyr Asp Lys Ala Tyr Asp465 470 475 480Glu Tyr Cys Lys Val Val Asn Thr Leu Ser Pro Leu Tyr Ala 485 490282041DNAPiromyces sp. 28attatataaa ataactttaa ataaaacaat ttttatttgt ttatttaatt attcaaaaaa 60aattaaagta aaagaaaaat aatacagtag aacaatagta ataatatcaa aatgaagact 120gttgctggta ttgatcttgg aactcaaagt atgaaagtcg ttatttacga ctatgaaaag 180aaagaaatta ttgaaagtgc tagctgtcca atggaattga tttccgaaag tgacggtacc 240cgtgaacaaa ccactgaatg gtttgacaag ggtcttgaag tttgttttgg taagcttagt 300gctgataaca aaaagactat tgaagctatt ggtatttctg gtcaattaca cggttttgtt 360cctcttgatg ctaacggtaa ggctttatac aacatcaaac tttggtgtga tactgctacc 420gttgaagaat gtaagattat cactgatgct gccggtggtg acaaggctgt tattgatgcc 480cttggtaacc ttatgctcac cggtttcacc gctccaaaga tcctctggct caagcgcaac 540aagccagaag ctttcgctaa cttaaagtac attatgcttc cacacgatta cttaaactgg 600aagcttactg gtgattacgt tatggaatac ggtgatgcct ctggtaccgc tctcttcgat 660tctaagaacc gttgctggtc taagaagatt tgcgatatca ttgacccaaa acttttagat 720ttacttccaa agttaattga accaagcgct ccagctggta aggttaatga tgaagccgct 780aaggcttacg gtattccagc cggtattcca gtttccgctg gtggtggtga taacatgatg 840ggtgctgttg gtactggtac tgttgctgat ggtttcctta ccatgtctat gggtacttct 900ggtactcttt acggttacag tgacaagcca attagtgacc cagctaatgg tttaagtggt 960ttctgttctt ctactggtgg atggcttcca ttactttgta ctatgaactg tactgttgcc 1020actgaattcg ttcgtaacct cttccaaatg gatattaagg aacttaatgt tgaagctgcc 1080aagtctccat gtggtagtga aggtgtttta gttattccat tcttcaatgg tgaaagaact 1140ccaaacttac caaacggtcg tgctagtatt actggtctta cttctgctaa caccagccgt 1200gctaacattg ctcgtgctag tttcgaatcc gccgttttcg ctatgcgtgg tggtttagat 1260gctttccgta agttaggttt ccaaccaaag gaaattcgtc ttattggtgg tggttctaag 1320tctgatctct ggagacaaat tgccgctgat atcatgaacc ttccaatcag agttccactt 1380ttagaagaag ctgctgctct tggtggtgct gttcaagctt tatggtgtct taagaaccaa 1440tctggtaagt gtgatattgt tgaactttgc aaagaacaca ttaagattga tgaatctaag 1500aatgctaacc caattgccga aaatgttgct gtttacgaca aggcttacga tgaatactgc 1560aaggttgtaa atactctttc tccattatat gcttaaattg ccaatgtaaa aaaaaatata 1620atgccatata attgccttgt caatacactg ttcatgttca tataatcata ggacattgaa

1680tttacaaggt ttatacaatt aatatctatt atcatattat tatacagcat ttcattttct 1740aagattagac gaaacaattc ttggttcctt gcaatataca aaatttacat gaatttttag 1800aatagtctcg tatttatgcc caataatcag gaaaattacc taatgctgga ttcttgttaa 1860taaaaacaaa ataaataaat taaataaaca aataaaaatt ataagtaaat ataaatatat 1920aagtaatata aaaaaaaagt aaataaataa ataaataaat aaaaattttt tgcaaatata 1980taaataaata aataaaatat aaaaataatt tagcaaataa attaaaaaaa aaaaaaaaaa 2040a 204129327PRTSaccharomyces cerevisiae 29Met Ser Ser Leu Val Thr Leu Asn Asn Gly Leu Lys Met Pro Leu Val1 5 10 15Gly Leu Gly Cys Trp Lys Ile Asp Lys Lys Val Cys Ala Asn Gln Ile 20 25 30Tyr Glu Ala Ile Lys Leu Gly Tyr Arg Leu Phe Asp Gly Ala Cys Asp 35 40 45Tyr Gly Asn Glu Lys Glu Val Gly Glu Gly Ile Arg Lys Ala Ile Ser 50 55 60Glu Gly Leu Val Ser Arg Lys Asp Ile Phe Val Val Ser Lys Leu Trp65 70 75 80Asn Asn Phe His His Pro Asp His Val Lys Leu Ala Leu Lys Lys Thr 85 90 95Leu Ser Asp Met Gly Leu Asp Tyr Leu Asp Leu Tyr Tyr Ile His Phe 100 105 110Pro Ile Ala Phe Lys Tyr Val Pro Phe Glu Glu Lys Tyr Pro Pro Gly 115 120 125Phe Tyr Thr Gly Ala Asp Asp Glu Lys Lys Gly His Ile Thr Glu Ala 130 135 140His Val Pro Ile Ile Asp Thr Tyr Arg Ala Leu Glu Glu Cys Val Asp145 150 155 160Glu Gly Leu Ile Lys Ser Ile Gly Val Ser Asn Phe Gln Gly Ser Leu 165 170 175Ile Gln Asp Leu Leu Arg Gly Cys Arg Ile Lys Pro Val Ala Leu Gln 180 185 190Ile Glu His His Pro Tyr Leu Thr Gln Glu His Leu Val Glu Phe Cys 195 200 205Lys Leu His Asp Ile Gln Val Val Ala Tyr Ser Ser Phe Gly Pro Gln 210 215 220Ser Phe Ile Glu Met Asp Leu Gln Leu Ala Lys Thr Thr Pro Thr Leu225 230 235 240Phe Glu Asn Asp Val Ile Lys Lys Val Ser Gln Asn His Pro Gly Ser 245 250 255Thr Thr Ser Gln Val Leu Leu Arg Trp Ala Thr Gln Arg Gly Ile Ala 260 265 270Val Ile Pro Lys Ser Ser Lys Lys Glu Arg Leu Leu Gly Asn Leu Glu 275 280 285Ile Glu Lys Lys Phe Thr Leu Thr Glu Gln Glu Leu Lys Asp Ile Ser 290 295 300Ala Leu Asn Ala Asn Ile Arg Phe Asn Asp Pro Trp Thr Trp Leu Asp305 310 315 320Gly Lys Phe Pro Thr Phe Ala 32530984DNASaccharomyces cerevisiae 30atgtcttcac tggttactct taataacggt ctgaaaatgc ccctagtcgg cttagggtgc 60tggaaaattg acaaaaaagt ctgtgcgaat caaatttatg aagctatcaa attaggctac 120cgtttattcg atggtgcttg cgactacggc aacgaaaagg aagttggtga aggtatcagg 180aaagccatct ccgaaggtct tgtttctaga aaggatatat ttgttgtttc aaagttatgg 240aacaattttc accatcctga tcatgtaaaa ttagctttaa agaagacctt aagcgatatg 300ggacttgatt atttagacct gtattatatt cacttcccaa tcgccttcaa atatgttcca 360tttgaagaga aataccctcc aggattctat acgggcgcag atgacgagaa gaaaggtcac 420atcaccgaag cacatgtacc aatcatagat acgtaccggg ctctggaaga atgtgttgat 480gaaggcttga ttaagtctat tggtgtttcc aactttcagg gaagcttgat tcaagattta 540ttacgtggtt gtagaatcaa gcccgtggct ttgcaaattg aacaccatcc ttatttgact 600caagaacacc tagttgagtt ttgtaaatta cacgatatcc aagtagttgc ttactcctcc 660ttcggtcctc aatcattcat tgagatggac ttacagttgg caaaaaccac gccaactctg 720ttcgagaatg atgtaatcaa gaaggtctca caaaaccatc caggcagtac cacttcccaa 780gtattgctta gatgggcaac tcagagaggc attgccgtca ttccaaaatc ttccaagaag 840gaaaggttac ttggcaacct agaaatcgaa aaaaagttca ctttaacgga gcaagaattg 900aaggatattt ctgcactaaa tgccaacatc agatttaatg atccatggac ctggttggat 960ggtaaattcc ccacttttgc ctga 9843131DNAArtificial Sequenceprimer 31gactagtcga gtttatcatt atcaatactg c 313249DNAArtificial Sequenceprimer 32ctcataatca ggtactgata acattttgtt tgtttatgtg tgtttattc 493349DNAArtificial Sequenceprimer 33gaataaacac acataaacaa acaaaatgtt atcagtacct gattatgag 493448DNAArtificial Sequenceprimer 34aatcataaat cataagaaat tcgcttactt taagaatgcc ttagtcat 483548DNAArtificial Sequenceprimer 35atgactaagg cattcttaaa gtaagcgaat ttcttatgat ttatgatt 483636DNAArtificial Sequenceprimer 36cactagtctc gagtgtggaa gaacgattac aacagg 363731DNAArtificial Sequenceprimer 37cgagctcgtg ggtgtattgg attataggaa g 313848DNAArtificial Sequenceprimer 38ttgggctgtt tcaactaaat tcatttttag gctggtatct tgattcta 483948DNAArtificial Sequenceprimer 39tagaatcaag ataccagcct aaaaatgaat ttagttgaaa cagcccaa 484048DNAArtificial Sequenceprimer 40aatcataaat cataagaaat tcgctctaat atttgattgc ttgcccag 484148DNAArtificial Sequenceprimer 41ctgggcaagc aatcaaatat tagagcgaat ttcttatgat ttatgatt 484231DNAArtificial Sequenceprimer 42tgagctcgtg tggaagaacg attacaacag g 314328DNAArtificial Sequenceprimer 43acgcgtcgac tcgtaggaac aatttcgg 284450DNAArtificial Sequenceprimer 44cttcttgttt taatgcttct agcatttttt gattaaaatt aaaaaaactt 504550DNAArtificial Sequenceprimer 45aagttttttt aattttaatc aaaaaatgct agaagcatta aaacaagaag 504646DNAArtificial Sequenceprimer 46ggtatatatt taagagcgat ttgtttactt gcgaactgca tgatcc 464746DNAArtificial Sequenceprimer 47ggatcatgca gttcgcaagt aaacaaatcg ctcttaaata tatacc 464833DNAArtificial Sequenceprimer 48cgcagtcgac cttttaaaca gttgatgaga acc 3349676DNAArtificial Sequencepromoter 49tcgagtttat cattatcaat actgccattt caaagaatac gtaaataatt aatagtagtg 60attttcctaa ctttatttag tcaaaaaatt agccttttaa ttctgctgta acccgtacat 120gcccaaaata gggggcgggt tacacagaat atataacatc gtaggtgtct gggtgaacag 180tttattcctg gcatccacta aatataatgg agcccgcttt ttaagctggc atccagaaaa 240aaaaagaatc ccagcaccaa aatattgttt tcttcaccaa ccatcagttc ataggtccat 300tctcttagcg caactacaga gaacaggggc acaaacaggc aaaaaacggg cacaacctca 360atggagtgat gcaacctgcc tggagtaaat gatgacacaa ggcaattgac ccacgcatgt 420atctatctca ttttcttaca ccttctatta ccttctgctc tctctgattt ggaaaaagct 480gaaaaaaaag gttgaaacca gttccctgaa attattcccc tacttgacta ataagtatat 540aaagacggta ggtattgatt gtaattctgt aaatctattt cttaaacttc ttaaattcta 600cttttatagt tagtcttttt tttagtttta aaacaccaag aacttagttt cgaataaaca 660cacataaaca aacaaa 67650326DNAArtificial Sequenceterminator 50gcgaatttct tatgatttat gatttttatt attaaataag ttataaaaaa aataagtgta 60tacaaatttt aaagtgactc ttaggtttta aaacgaaaat tcttattctt gagtaactct 120ttcctgtagg tcaggttgct ttctcaggta tagcatgagg tcgctcttat tgaccacacc 180tctaccggca tgccgagcaa atgcctgcaa atcgctcccc atttcaccca attgtagata 240tgctaactcc agcaatgagt tgatgaatct cggtgtgtat tttatgtcct cagaggacaa 300cacctgttgt aatcgttctt ccacac 32651374DNAArtificial Sequencepromoter 51gtgggtgtat tggattatag gaagccacgc gctcaacctg gaattacagg aagctggtaa 60ttttttgggt ttgcaatcat caccatctgc acgttgttat aatgtcccgt gtctatatat 120atccattgac ggtattctat ttttttgcta ttgaaatgag cgttttttgt tactacaatt 180ggttttacag acggaatttt ccctatttgt ttcgtcccat ttttcctttt ctcattgttc 240tcatatctta aaaaggtcct ttcttcataa tcaatgcttt cttttactta atattttact 300tgcattcagt gaattttaat acatattcct ctagtcttgc aaaatcgatt tagaatcaag 360ataccagcct aaaa 37452390DNAArtificial Sequencepromoter 52ctcgtaggaa caatttcggg cccctgcgtg ttcttctgag gttcatcttt tacatttgct 60tctgctggat aattttcaga ggcaacaagg aaaaattaga tggcaaaaag tcgtctttca 120aggaaaaatc cccaccatct ttcgagatcc cctgtaactt attggcaact gaaagaatga 180aaaggaggaa aatacaaaat atactagaac tgaaaaaaaa aaagtataaa tagagacgat 240atatgccaat acttcacaat gttcgaatct attcttcatt tgcagctatt gtaaaataat 300aaaacatcaa gaacaaacaa gctcaacttg tcttttctaa gaacaaagaa taaacacaaa 360aacaaaaagt ttttttaatt ttaatcaaaa 39053302DNAArtificial Sequenceterminator 53acaaatcgct cttaaatata tacctaaaga acattaaagc tatattataa gcaaagatac 60gtaaattttg cttatattat tatacacata tcatatttct atatttttaa gatttggtta 120tataatgtac gtaatgcaaa ggaaataaat tttatacatt attgaacagc gtccaagtaa 180ctacattatg tgcactaata gtttagcgtc gtgaagactt tattgtgtcg cgaaaagtaa 240aaattttaaa aattagagca ccttgaactt gcgaaaaagg ttctcatcaa ctgtttaaaa 300gg 302

Claims

1. A eukaryotic cell capable of expressing the following nucleotide sequences, wherein the expression of these nucleotide sequences confers on the cell the ability to use L-arabinose and/or to convert L-arabinose into L-ribulose, and/or xylulose 5-phosphate and/or into a desired fermentation product: (a) a nucleotide sequence encoding an arabinose isomerase (araA), wherein said nucleotide sequence is selected from the group consisting of: i. nucleotide sequences encoding an araA, said araA comprising an amino acid sequence that has at least 55% sequence identity with the amino acid sequence of SEQ ID NO:1, ii. nucleotide sequences comprising a nucleotide sequence that has at least 60% sequence identity with the nucleotide sequence of SEQ ID NO:2, iii. nucleotide sequences the complementary strand of which hybridizes to a nucleic add molecule of sequence of (i) or (ii); iv, nucleotide sequences the sequences of which differs from the sequence of a nucleic acid molecule of (iii) due to the degeneracy of the genetic; code, (b) a nucleotide sequence encoding a L-ribulokinase (araB), wherein said nucleotide sequence is selected from the group consisting of: i. nucleotide sequences encoding an araB, said araB comprising an amino acid sequence that has at least 20% sequence identity with the amino acid sequence of SEQ ID NO:3, ii. nucleotide sequences comprising a nucleotide sequence that has at least 50% sequence identity with the nucleotide sequence of SEQ ID NO:4, iii. nucleotide sequences the complementary strand of which hybridizes to a nucleic acid molecule of sequence of (i) or (ii); iv. nucleotide sequences the sequences of which differs from the sequence of a nucleic acid molecule of (iii) due to the degeneracy of the genetic code, (c) a nucleotide sequence encoding an L-ribulose-5-P-4-epimerase (araD), wherein said nucleotide sequence is selected from the group consisting of: i. nucleotide sequences encoding an araD, said araD comprising an amino acid sequence that has at least 60% sequence identity with the amino acid sequence of SEQ ID NO:5, ii. nucleotide sequences comprising a nucleotide sequence that has at least 60% sequence identity with the nucleotide sequence of SEQ ID NO:6, iii. nucleotide sequences the complementary strand of which hybridizes to a nucleic acid molecule of sequence of (i) or (ii); iv. nucleotide sequences the sequences of which differs from the sequence of a nucleic acid molecule of (iii) due to the degeneracy of the genetic code.

2. A cell according to claim 1, wherein one, two or three of the araA, araB and araD nucleotide sequences originate from a Lactobacillus genus, preferably a Lactobacillus plantarum species.

3. A cell according to claim 1, wherein the cell is a yeast cell, preferably belonging to one of the genera: Saccharomyces, Kluyveromyces, Candida, Pichia, Schizosaccharomyces, Hansenula, Kloeckera, Schwanniomyces or Yarrowia.

4. A cell according to claim 3, wherein the yeast cell belongs to one of the species: S. cerevisiae, S. bulderi, S. barnetti, S. exiguus, S. uvarum, S. diastaticus, K. lactis, K. marxianus or K. fragilis.

5. A cell according to claim 1, wherein the nucleotide sequences encoding the araA, araB and/or araD are operably linked to a promoter that causes sufficient expression of the corresponding nucleotide sequences in the cell to confer to the cell the ability to use L-arabinose and/or to convert L-arabinose into L-ribulose, and/or xylulose 5-phosphate and/or into a desired fermentation product.

6. A cell according to claim 1, wherein the cell exhibits the ability to directly isomerise xylose into xylulose.

7. A cell according to claim 6, wherein the cell comprises a genetic modification that increases the flux of the pentose phosphate pathway.

8. A cell according to claim 6, wherein the genetic modification comprises overexpression of at least one gene of the non-oxidative part of the pentose phosphate pathway.

9. A cell according to claim 8, wherein the gene is selected from the group consisting of the genes encoding ribulose-5-phosphate isomerase, ribulose-5-phosphate epimerase, transketolase and transaldolase.

10. A cell according to claim 8, wherein the genetic modification comprises overexpression of at least the genes coding for a transketolase and a transaldolase.

11. A cell according to claim 1, wherein the cell further comprises a genetic modification that increases the specific xylulose kinase activity.

12. A cell according to claim 11, wherein the genetic modification comprises overexpression of a gene encoding a xylulose kinase.

13. A cell according to claim 8, wherein the gene that is overexpressed is endogenous to the cell.

14. A cell according to claim 5, wherein the cell comprises a genetic modification that reduces unspecific aldose reductase activity in the cell.

15. A cell according to claim 14, wherein the genetic modification reduces the expression of, or inactivates a gene encoding an unspecific aldose reductase.

16. A cell according to claim 15, wherein the gene is inactivated by deletion of at least part of the gene or by disruption of the gene.

17. A cell according to claim 14, wherein the expression of each gene in the cell that encodes an unspecific aldose reductase is reduced or inactivated.

18. A cell according to claim 1, wherein the fermentation product is selected from the group consisting of ethanol, lactic acid, 3-hydroxy-propionic acid, acrylic acid, acetic acid, succinic acid, citric acid, malic acid, fumaric acid, an amino acid, 1,3-propane-diol, ethylene, glycerol, butanol, a .beta.-lactam antibiotic and a cephalosporin.

19. A nucleic acid construct comprising a nucleic acid sequence encoding an araA, a nucleic acid sequence encoding an araB and/or a nucleic acid sequence encoding an araD all as defined in claim 1.

20. A process for producing a fermentation product selected from the group consisting of ethanol, lactic acid, 3-hydroxy-propionic acid, acrylic acid, acetic acid, succinic acid, citric acid, malic acid, fumaric acid, an amino acid, 1,3-propane-diol, ethylene, glycerol, butanol, a .beta.-lactam, antibiotic and a cephalosporin, whereby the process comprises: (a) fermenting a medium containing a source of arabinose and optionally xylose with a modified cell as defined in claim 1, whereby the cell ferments arabinose and optionally xylose to the fermentation product; and optionally, (b) recovering the fermentation product.

21. A process for producing a fermentation product selected from the group consisting of ethanol, lactic acid, 3-hydroxy-propionic acid, acrylic acid, acetic acid, succinic acid, citric acid, malic acid, fumaric acid, an amino acid, 1,3-propane-diol, ethylene, glycerol, butanol, a .beta.-lactam antibiotic and a cephalosporin, wherein the process comprises: (a) fermenting a medium containing at least a source of L-arabinose and a source of xylose with a cell as defined in claim 1 and a cell able to use xylose and/or exhibiting the ability to directly isomerise xylose into xylulose, whereby each cell ferments L-arabinose and/or xylose to the fermentation product; and optionally, (b) recovering the fermentation product.

22. A process according to claim 20, wherein the medium also contains a source of glucose.

23. A process according to claim 20, wherein the fermentation product is ethanol.

24. A process according to claim 23, wherein the volumetric ethanol productivity is at least 0.5 g ethanol per litre per hour.

25. A process according to claim 23, wherein the ethanol yield is at least 30%.

26. A process according to claim 20, wherein the process is anaerobic.

27. A process according to claim 20, wherein the process is aerobic, preferably performed under oxygen limited conditions.