U.S. patent application number 12/408458 was filed with the patent office on 2010-04-08 for cytokine receptor chain.
This patent application is currently assigned to GENETICS INSTITUTE, LLC. Invention is credited to Mary Collins, Debra Donaldson, Lori Fitz, Tamlyn Neben, Matthew J. Whitters, Marsha Wills-Karp, Clive Wood.
Application Number | 20100086516 12/408458 |
Document ID | / |
Family ID | 35460991 |
Filed Date | 2010-04-08 |
United States Patent
Application |
20100086516 |
Kind Code |
A1 |
Collins; Mary ; et
al. |
April 8, 2010 |
CYTOKINE RECEPTOR CHAIN
Abstract
Polynucleotides encoding the IL-13 receptor and fragments
thereof are disclosed. IL-13 receptor proteins, methods for their
production, inhibitors of binding of IL-13 and its receptor and
methods for their identification are also disclosed. Methods of
medical treatment using such molecules and antagonists of the
IL-13/IL-13R interaction are also provided.
Inventors: |
Collins; Mary; (Natick,
MA) ; Donaldson; Debra; (Medford, MA) ; Fitz;
Lori; (Somerville, MA) ; Neben; Tamlyn;
(Walnut Creek, CA) ; Whitters; Matthew J.;
(Hudson, MA) ; Wood; Clive; (Cambridge, MA)
; Wills-Karp; Marsha; (Cincinnati, OH) |
Correspondence
Address: |
LANDO & ANASTASI, LLP
ONE MAIN STREET, SUITE 1100
CAMBRIDGE
MA
02142
US
|
Assignee: |
GENETICS INSTITUTE, LLC
Cambridge
MA
THE JOHNS HOPKINS UNIVERSITY
Baltimore
MD
|
Family ID: |
35460991 |
Appl. No.: |
12/408458 |
Filed: |
March 20, 2009 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
09868123 |
Apr 2, 2002 |
7507706 |
|
|
12408458 |
|
|
|
|
09211335 |
Dec 14, 1998 |
|
|
|
09868123 |
|
|
|
|
Current U.S.
Class: |
424/85.2 ;
424/139.1; 424/158.1; 435/325; 435/375; 435/69.52; 436/501;
530/351; 530/387.9; 536/23.5 |
Current CPC
Class: |
G01N 33/6863 20130101;
G01N 2333/54 20130101 |
Class at
Publication: |
424/85.2 ;
424/139.1; 424/158.1; 435/69.52; 435/325; 435/375; 436/501;
530/351; 530/387.9; 536/23.5 |
International
Class: |
A61K 38/20 20060101
A61K038/20; A61K 39/395 20060101 A61K039/395; C12P 21/06 20060101
C12P021/06; C12N 5/00 20060101 C12N005/00; G01N 33/566 20060101
G01N033/566; C07K 14/54 20060101 C07K014/54; C07K 16/24 20060101
C07K016/24; C07H 21/04 20060101 C07H021/04 |
Foreign Application Data
Date |
Code |
Application Number |
Dec 13, 1999 |
WO |
US99/29493 |
Claims
1. An isolated polynucleotide comprising a nucleotide sequence
selected from the group consisting of: (a) the nucleotide sequence
of SEQ ID NO:1 from nucleotide 256 to nucleotide 1404; (b) the
nucleotide sequence of SEQ ID NO:3 from nucleotide 103 to
nucleotide 1242; (c) a nucleotide sequence varying from the
sequence of the nucleotide sequence specified in (a) or (b) as a
result of degeneracy of the genetic code; (d) a nucleotide sequence
capable of hybridizing under stringent conditions to the nucleotide
specified in (a) or (b); (e) a nucleotide sequence encoding a
species homologue of the sequence specified in (a) or (b); and (f)
an allelic variant of the nucleotide sequence specified in (a) or
(b).
2. The polynucleotide of claim 1 wherein said nucleotide sequence
encodes for a protein having a biological activity of the IL-13R
binding chain.
3. The polynucleotide of claim 1 wherein said nucleotide sequence
is operably linked to an expression control sequence.
4. The polynucleotide of claim 1 comprising the nucleotide sequence
of SEQ ID NO:1 from nucleotide 319 to nucleotide 1257.
5. The polynucleotide of claim 1 comprising the nucleotide sequence
of SEQ ID NO:1 from nucleotide 1324 to nucleotide 1404.
6. The polynucleotide of claim 1 comprising the nucleotide sequence
of SEQ ID NO:3 from nucleotide 178 to nucleotide 1125.
7. The polynucleotide of claim 1 comprising the nucleotide sequence
of SEQ ID NO:3 from nucleotide 1189 to nucleotide 1242.
8. A host cell transformed with the polynucleotide of claim 3.
9. The host cell of claim 8, wherein said cell is a mammalian
cell.
10. A process for producing a IL-13bc protein, said process
comprising: (a) growing a culture of the host cell of claim 8 in a
suitable culture medium; and (b) purifying the IL-13bc protein from
the culture.
11. An isolated IL-13bc protein comprising an amino acid sequence
selected from the group consisting of: (a) the amino acid sequence
of SEQ ID NO:2; (b) the amino acid sequence of SEQ ID NO:2 from
amino acids 22 to 334; (c) the amino acid sequence of SEQ ID NO:2
from amino acids 357 to 383; (d) the amino acid sequence of SEQ ID
NO:4; (e) the amino acid sequence of SEQ ID NO:4 from amino acids
26 to 341; (f) the amino acid sequence of SEQ ID NO:4 from amino
acids 363 to 380; and (g) fragments of (a)-(f) having a biological
activity of the IL-13 receptor binding chain.
12. The protein of claim 11 comprising the amino acid sequence of
SEQ ID NO:2.
13. The protein of claim 11 comprising the sequence from amino acid
22 to 334 of SEQ ID NO:2.
14. The protein of claim 11 comprising the amino acid sequence of
SEQ ID NO:4.
15. The protein of claim 11 comprising the sequence from amino acid
26 to 341 of SEQ ID NO:4.
16. A pharmaceutical composition comprising a protein of claim 11
and a pharmaceutically acceptable carrier.
17. A protein produced according to the process of claim 10.
18. A composition comprising an antibody which specifically reacts
with a protein of claim 11.
19. A method of identifying an inhibitor of IL-13 binding to the
IL-13 receptor which comprises: (a) combining a protein of claim 11
with IL-13 or a fragment thereof, said combination forming a first
binding mixture; (b) measuring the amount of binding between the
protein and the IL-13 or fragment in the first binding mixture; (c)
combining a compound with the protein and the IL-13 or fragment to
form a second binding mixture; (d) measuring the amount of binding
in the second binding mixture; and (e) comparing the amount of
binding in the first binding mixture with the amount of binding in
the second binding mixture; wherein the compound is capable of
inhibiting IL-13 binding to the IL-13 receptor when a decrease in
the amount of binding of the second binding mixture occurs.
20. An inhibitor identified by the method of claim 19.
21. A pharmaceutical composition comprising the inhibitor of claim
20 and a pharmaceutically acceptable carrier.
22. A method of inhibiting binding of IL-13 to the IL-13 receptor
in a mammalian subject, said method comprising administering a
therapeutically effective amount of a composition of claim 21.
23. A method of inhibiting binding of IL-13 to the IL-13 receptor
in a mammalian subject, said method comprising administering a
therapeutically effective amount of a composition of claim 16.
24. A method of inhibiting binding of IL-13 to the IL-13 receptor
in a mammalian subject, said method comprising administering a
therapeutically effective amount of a composition of claim 18.
25. An isolated polynucleotide comprising a nucleotide sequence
encoding a peptide or protein comprising an amino acid sequence
selected from the group consisting of: (a) the amino acid sequence
of SEQ ID NO:2; (b) the amino acid sequence of SEQ ID NO:2 from
amino acids 22 to 334; (c) the amino acid sequence of SEQ ID NO:2
from amino acids 357 to 383; (d) the amino acid sequence of SEQ ID
NO:4; (e) the amino acid sequence of SEQ ID NO:4 from amino acids
26 to 341; (f) the amino acid sequence of SEQ ID NO:4 from amino
acids 363 to 380; and (g) fragments of (a)-(f) having a biological
activity of the IL-13 receptor binding chain.
26. The protein of claim 11 wherein said amino acid sequence is
part of a fusion protein.
27. The protein of claim 26 comprising an Fc fragment.
28. A method of treating an IL-13-related condition in a mammalian
subject, said method comprising administering a therapeutically
effective amount of a composition of claim 16.
29. The method of claim 28 wherein said condition is an
IgE-mediated condition.
30. The method of claim 29 wherein said condition is selected from
the group consisting of atopy, an allergic condition, asthma and an
immune complex disease.
31. The method of claim 30 wherein said condition is selected from
the group consisting of lupus, nephritis, thyroiditis and Grave's
disease.
32. A method for potentiating IL-13 activity, said method
comprising combining a protein having IL-13 activity with a protein
of claim 11 and contacting such combination with a cell expressing
at least one chain of IL-13R other than IL-13bc.
33. The method of claim 32 wherein the contacting step is performed
by administering a therapeutically effective amount of such
combination to a mammalian subject.
34. The protein of claim 11 comprising the amino acid sequence of
SEQ ID NO:2 from amino acids 1 to 331.
35. The protein of claim 11 comprising the amino acid sequence of
SEQ ID NO:2 from amino acids 26 to 331.
36. The polynucleotide of claim 25 encoding a peptide or protein
comprising the amino acid sequence of SEQ ID NO:2 from amino acids
1 to 331
37. The polynucleotide of claim 25 encoding a peptide or protein
comprising the amino acid sequence of SEQ ID NO:2 from amino acids
26 to 331.
38. The method of claim 28 wherein said condition is an
inflammatory condition of the lung.
39. A method of treating an IL-13-related condition in a mammalian
subject, said method comprising administering a therapeutically
effective amount of a composition comprising an IL-13 antagonist
and a pharmaceutically acceptable carrier.
40. The method of claim 39 wherein said condition is an
IgE-mediated condition.
41. The method of claim 40 wherein said condition is selected from
the group consisting of atopy, an allergic condition, asthma and an
immune complex disease.
42. The method of claim 41 wherein said condition is selected from
the group consisting of lupus, nephritis, thyroiditis and Grave's
disease.
43. The method of claim 39 wherein said antagonist is selected from
the group consisting of an IL-13bc protein, a soluble form of
IL-13R.alpha.1, an antibody to IL-13 or an IL-13-binding fragment
thereof, an antibody to IL-13bc or an IL-13bc-binding fragment
thereof, an antibody to IL-13R.alpha.1 or an IL-13R.alpha.1-binding
fragment thereof, IL-13R-binding mutants of IL-4, a small molecule
capable of inhibiting the interaction of IL-13 with IL-13bc and a
small molecule capable of inhibiting the interaction of IL-13 with
IL-13R.alpha.1.
44. The method of claim 43 wherein said IL-13bc protein is a
protein of claim 11.
45. A method of inhibiting the interaction of IL-13 with an IL-13bc
protein in a mammalian subject, said method comprising
administering a therapeutically effective amount of a composition
comprising an IL-13 antagonist and a pharmaceutically acceptable
carrier.
46. The method of claim 45 wherein said antagonist is selected from
the group consisting of an IL-13bc protein, a soluble form of
IL-13R.alpha.1, an antibody to IL-13 or an IL-13-binding fragment
thereof, an antibody to IL-13bc or an IL-13bc-binding fragment
thereof, an antibody to IL-13R.alpha.1 or an IL-13R.alpha.1-binding
fragment thereof, IL-13R-binding mutants of IL-4, a small molecule
capable of inhibiting the interaction of IL-13 with IL-13bc and a
small molecule capable of inhibiting the interaction of IL-13 with
EL-13R.alpha.1.
47. The method of claim 46 wherein said IL-13bc protein is a
protein of claim 11.
Description
[0001] This application is a continuation-in-part of application
Ser. No. 08/841,751, filed Apr. 30, 1997, which was a divisional
application of application Ser. No. 08/609,572, filed Mar. 1,
1996.
FIELD OF THE INVENTION
[0002] The present invention relates to mammalian cytokine receptor
proteins with affinity for IL-13 (including without limitation
human and murine receptor proteins), fragments thereof and
recombinant polynucleotides and cells useful for expressing such
proteins.
BACKGROUND OF THE INVENTION
[0003] A variety of regulatory molecules, known as cytokines, have
been identified including interleukin-13 (IL-13). Various protein
forms of IL-13 and DNA encoding various forms of IL-13 activity are
described in McKenzie et al., Proc. Natl. Acad. Sci. USA 90:3735
(1993); Minty et al., Nature 362:248 (1993); and Aversa et al.,
WO94/04680. Thus, the term "IL-13" includes proteins having the
sequence and/or biological activity described in these documents,
whether produced by recombinant genetic engineering techniques;
purified from cell sources producing the factor naturally or upon
induction with other factors; or synthesized by chemical
techniques; or a combination of the foregoing.
[0004] IL-13 is a cytokine that has been implicated in production
of several biological activities including: induction of IgG4 and
IgE switching, including in human immature B cells (Punnonen et
al., J. Immunol. 152:1094 (1994)); induction of germ line IgE heavy
chain (.epsilon.) transcription and CD23 expression in normal human
B cells (Punnonen et al., Proc. Natl. Acad. Sci. USA 90:3730
(1993)); and induction of B cell proliferation in the presence of
CD40L or anti-CD40 mAb (Cocks et al., Int. Immunol. 5:657 (1993)).
Although many activities of IL-13 are similar to those of IL-4, in
contrast to IL-4, IL-13 does not have growth promoting effects on
activated T cells or T cell clones (Zurawski et al., EMBO J.
12:2663 (1993)).
[0005] Like most cytokines, IL-13 exhibits certain biological
activities by interacting with an IL-13 receptor ("IL-13R") on the
surface of target cells. IL-13R and the IL-4 receptor ("IL-4R")
sharing a common component, which is required for receptor
activation; however, IL-13 does not bind to cells transfected with
the 130 kD IL-4R (Zurawski et al., supra). Thus, the IL-13R must
contain at least one other ligand binding chain. Cytokine receptors
are commonly composed or two or three chains. The cloning of one
ligand binding chain for IL-13 has been recently reported (Hilton
et al., Proc. Natl. Acad. Sci. 93:497-501).
[0006] It would be desirable to identify and clone the sequence for
any other IL-13 binding chain of IL-13R so that IL-13R proteins can
be produced for various reasons, including production of
therapeutics and screening for inhibitors of IL-13 binding to the
receptor and receptor signaling.
SUMMARY OF THE INVENTION
[0007] In accordance with the present invention, polynucleotides
encoding the IL-13 binding chains of the interleukin-13 receptor
are disclosed, including without limitation those from the murine
and human receptors. In certain embodiments, the invention provides
an isolated polynucleotide comprising a nucleotide sequence
selected from the group consisting of:
[0008] (a) the nucleotide sequence of SEQ ID NO:1 from nucleotide
256 to nucleotide 1404;
[0009] (b) the nucleotide sequence of SEQ ID NO:3 from nucleotide
103 to nucleotide 1242;
[0010] (c) a nucleotide sequence varying from the sequence of the
nucleotide sequence specified in (a) or (b) as a result of
degeneracy of the genetic code;
[0011] (d) a nucleotide sequence capable of hybridizing under
stringent conditions to the nucleotide specified in (a) or (b);
[0012] (e) a nucleotide sequence encoding a species homologue of
the sequence specified in (a) or (b); and
[0013] (f) an allelic variant of the nucleotide sequence specified
in (a) or (b). Preferably, the nucleotide sequence encodes a
protein having a biological activity of the human IL-13 receptor.
The nucleotide sequence may be operably linked to an expression
control sequence. In preferred embodiments, the polynucleotide
comprises the nucleotide sequence of SEQ ID NO:1 from nucleotide
256 to nucleotide 1404; the nucleotide sequence of SEQ ID NO:1 from
nucleotide 319 to nucleotide 1257; the nucleotide sequence of SEQ
ID NO:1 from nucleotide 1324 to nucleotide 1404; the nucleotide
sequence of SEQ ID NO:3 from nucleotide 103 to nucleotide 1242; the
nucleotide sequence of SEQ ID NO:3 from nucleotide 178 to
nucleotide 1125; or the nucleotide sequence of SEQ ID NO:3 from
nucleotide 1189 to nucleotide 1242.
[0014] The invention also provides isolated polynucleotides
comprising a nucleotide sequence encoding a peptide or protein
comprising an amino acid sequence selected from the group
consisting of:
[0015] (a) the amino acid sequence of SEQ ID NO:2;
[0016] (b) the amino acid sequence of SEQ ID NO:2 from amino acids
22 to 334;
[0017] (c) the amino acid sequence of SEQ ID NO:2 from amino acids
357 to 383;
[0018] (d) the amino acid sequence of SEQ ID NO:4;
[0019] (e) the amino acid sequence of SEQ ID NO:4 from amino acids
26 to 341;
[0020] (f) the amino acid sequence of SEQ ID NO:4 from amino acids
363 to 380; and
[0021] (g) fragments of (a)-(f) having a biological activity of the
IL-13 receptor binding chain. Other preferred embodiments encode
the amino acid sequence of SEQ ID NO:2 from amino acids 1 to 331
and the amino acid sequence of SEQ ID NO:2 from amino acids 26 to
331.
[0022] Host cells, preferably mammalian cells, transformed with the
polynucleotides are also provided.
[0023] In other embodiments, the invention provides a process for
producing a IL-13bc protein. The process comprises:
[0024] (a) growing a culture of the host cell of the present
invention in a suitable culture medium; and (b) purifying the human
IL-13bc protein from the culture. Proteins produced according to
these methods are also provided.
[0025] The present invention also provides for an isolated IL-13bc
protein comprising an amino acid sequence selected from the group
consisting of:
[0026] (a) the amino acid sequence of SEQ ID NO:2;
[0027] (b) the amino acid sequence of SEQ ID NO:2 from amino acids
22 to 334;
[0028] (c) the amino acid sequence of SEQ ID NO:2 from amino acids
357 to 383;
[0029] (d) the amino acid sequence of SEQ ID NO:4;
[0030] (e) the amino acid sequence of SEQ ID NO:4 from amino acids
26 to 341;
[0031] (f) the amino acid sequence of SEQ ID NO:4 from amino acids
363 to 380; and
[0032] (g) fragments of (a)-(f) having a biological activity of the
IL-13 receptor binding chain
Preferably the protein comprises the amino acid sequence of SEQ ID
NO:2; the sequence from amino acid 22 to 334 of SEQ ID NO:2; the
sequence of SEQ ID NO:4; or the sequence from amino acid 26 to 341
of SEQ ID NO:4. In other preferred embodiments, the specified amino
acid sequence is part of a fusion protein (with an additional amino
acid sequence not derived from IL-13bc). Preferred fusion proteins
comprise an antibody fragment, such as an Fc fragment. Particularly
preferred embodiments comprise the amino acid sequence of SEQ ID
NO:2 from amino acids 1 to 331 and the amino acid sequence of SEQ
ID NO:2 from amino acids 26 to 331.
[0033] Pharmaceutical compositions comprising a protein of the
present invention and a pharmaceutically acceptable carrier are
also provided.
[0034] The present invention further provides for compositions
comprising an antibody which specifically reacts with a protein of
the present invention.
[0035] Methods of identifying an inhibitor of IL-13 binding to the
IL-13bc or IL-13 receptor are also provided. These methods
comprise:
[0036] (a) combining an IL-13bc protein or a fragment thereof with
IL-13 or a fragment thereof, said combination forming a first
binding mixture;
[0037] (b) measuring the amount of binding between the protein and
the IL-13 or fragment in the first binding mixture;
[0038] (c) combining a compound with the protein and the IL-13 or
fragment to form a second binding mixture;
[0039] (d) measuring the amount of binding in the second binding
mixture; and
[0040] (e) comparing the amount of binding in the first binding
mixture with the amount of binding in the second binding
mixture;
wherein the compound is capable of inhibiting IL-13 binding to the
IL-13bc protein or IL-13 receptor when a decrease in the amount of
binding of the second binding mixture occurs. Inhibitors of IL-13R
identified by these methods and pharmaceutical compositions
containing them are also provided.
[0041] Methods of inhibiting binding of IL-13 to the IL-13bc
proteins or IL-13 receptor in a mammalian subject are also
disclosed which comprise administering a therapeutically effective
amount of a composition containing an IL-13bc protein, an IL-13bc
or IL-13R inhibitor or an antibody to an IL-13bc protein.
[0042] Methods are also provided for potentiating IL-13 activity,
which comprise combining a protein having IL-13 activity with a
protein of claim 11 and contacting such combination with a cell
expressing at least one chain of IL-13R other than IL-13bc.
Preferably, the contacting step is performed by administering a
therapeutically effective amount of such combination to a mammalian
subject.
[0043] Further methods are provided for treating an IL-13-related
condition in a mammalian subject, said method comprising
administering a therapeutically effective amount of a composition
comprising an IL-13 antagonist and a pharmaceutically acceptable
carrier. Other methods provide for a method of inhibiting the
interaction of IL-13 with an IL-13bc protein in a mammalian subject
comprising administering a therapeutically effective amount of a
composition comprising an IL-13 antagonist and a pharmaceutically
acceptable carrier. Preferably, the antagonist is selected from the
group consisting of an IL-13bc protein, a soluble form of
IL-13R.alpha.1 , an antibody to IL-13 or an IL-13-binding fragment
thereof, an antibody to IL-13bc or an IL-13bc-binding fragment
thereof, an antibody to IL-13R.alpha.1 or an IL-13R.alpha.1-binding
fragment thereof, IL-13R-binding mutants of IL-4, a small molecule
capable of inhibiting the interaction of IL-13 with IL-13bc and a
small molecule capable of inhibiting the interaction of IL-13 with
IL-13R.alpha.1.
BRIEF DESCRIPTION OF THE FIGURE
[0044] FIG. 1: The figure presents photographs of IL-13, IL-4,
IL-11 and mock transfected COS cells after exposure to IL-13bc-Fc
as described in Example 4 below.
[0045] FIG. 2: Reversal of allergen-induced airway hyper
responsiveness by in vivo blockade of interleukin-13. 10 days after
initial intratracheal challenge, OVA- and PBS-immunized mice were
again challenged intratracheally with either OVA or PBS. Mice were
given sIL-13bc-Fc (400 ug) or an equivalent amount of control
hu-IgG by intraperitoneal injection on Day -1, O, +1 and +3 of the
secondary antigen challenge. The allergic phenotype was assessed 4
days after the PBS or OVA challenge. (A) Airway hyper
responsiveness (AHR) to acetylcholine challenge, defined by the
time-integrated rise in peak airway pressure (airway-pressure-time
index [APT] in cmH.sub.2O.times.sec). (B) Inflammatory cell
composition of bronchoalveolar lavage fluids. Cell differential
percentages were determined by light microscopic evaluation of
cytospin preparations. Data are expressed as absolute numbers of
cells. (C) OVA-specific serum IgE concentrations. Results are means
+/- SEM of 8-10 animals per group. *P<0.05 compared with
respective PBS control groups; **P<0.05 compared to OVA/Hu-Ig
group (one-way ANOVA followed by Fisher's least significant
difference test for multiple comparisons).
[0046] FIG. 3: Effects of IL-13 blockade on allergen-driven
increases in mucus-containing cells in the airway epithelium. Lung
sections (N=4 per experimental group, four sections per animal)
were fixed in formalin, cut into 10 um sections and stained with
hematoxylin and eosin, and periodic acid Schiff. Representative
sections are shown. Bars=100 um. PBS/Hu-Ig: PBS-immunized and
challenged controls, demonstrating few mucus-containing cells.
OVA/Hu-Ig: allergen-induced increases in interstitial inflammatory
cells and increases in the number of goblet cells containing mucus.
OVA/sIL-13bc-Fc: dramatic inhibitory effect of IL-13 blockade on
allergen-induced goblet cell mucus production.
[0047] FIG. 4: IL-13 induction of airway hyperreactivity. Naive
mice were given recombinant IL-13 (5 ug/mouse, 50 ul volume) or PBS
daily by intratracheal instillation. 24 hrs after the last
treatment, (A) Airway hyper responsiveness, (B) BAL eosinophil
levels, (C) Serum total IgE levels, and (D) Mucus score were
determined. Results are means +/- SEM (vertical bars) of 7-10
animals per group. *P<0.05 compared to PBS group (Student's t
test).
DETAILED DESCRIPTION OF PREFERRED EMBODIMENTS
[0048] The inventors of the present application have for the first
time identified and provided polynucleotides encoding the IL-13
binding chain of IL-13R (hereinafter "IL-13bc"), including without
limitation polynucleotides encoding murine and human IL-13bc.
[0049] SEQ ID NO:1 provides the nucleotide sequence of a cDNA
encoding the murine IL-13bc. SEQ ID NO:2 provides predicted the
amino acid sequence of the receptor chain, including a putative
signal sequence from amino acids 1-21. The mature murine IL-13bc is
believed to have the sequence of amino acids 22-383 of SEQ ID NO:2.
The mature murine receptor chain has at least three distinct
domains: an extracellular domain (comprising approximately amino
acids 22-334 of SEQ ID NO:2), a transmembrane domain (comprising
approximately amino acids 335-356 of SEQ ID NO:2) and an
intracellular domain (comprising approximately amino acids 357-383
of SEQ ID NO:2).
[0050] SEQ ID NO:3 provides the nucleotide sequence of a cDNA
encoding the human IL-13bc. SEQ ID NO:4 provides predicted the
amino acid sequence of the receptor chain, including a putative
signal sequence from amino acids I-25. The mature human IL-13bc is
believed to have the sequence of amino acids 26-380 of SEQ ID NO:4.
The mature human receptor chain has at least three distinct
domains: an extracellular domain (comprising approximately amino
acids 26-341 of SEQ ID NO:4), a transmembrane domain (comprising
approximately amino acids 342-362 of SEQ ID NO:4) and an
intracellular domain (comprising approximately amino acids 363-380
of SEQ ID NO:4).
[0051] The first 81 amino acids of the human IL-13bc sequence are
identical to the translated sequence of an expressed sequence tag
(EST) identified as "yg99f10.r1 Homo sapiens cDNA clone 41648 5'"
and assigned database accession number R52795.gb_est2. There are no
homologies or sequence motifs in this EST sequence which would lead
those skilled in the art to identify the encoded protein as a
cytokine receptor. A cDNA clone corresponding to this database
entry is publicly-available from the I.M.A.G.E. Consortium.
Subsequent to the priority date of the present application, such
clone was ordered by applicants and sequenced. The sequence of such
clone was determined to be the sequence previously reported by
applicants as SEQ ID NO:3 herein.
[0052] Soluble forms of IL-13bc protein can also be produced. Such
soluble forms include without limitation proteins comprising amino
acids 1-334 or 22-334 of SEQ ID NO:2 or amino acids 1-341 or 26-341
of SEQ ID NO:4. The soluble forms of the IL-13bc are further
characterized by being soluble in aqueous solution, preferably at
room temperature. IL -13bc proteins comprising only the
intracellular domain or a portion thereof may also be produced. Any
forms of IL-13bc of less than full length are encompassed within
the present invention and are referred to herein collectively with
full length and mature forms as "IL-13bc" or "IL-13bc proteins." IL
-13bc proteins of less than full length may be produced by
expressing a corresponding fragment of the polynucleotide encoding
the full-length IL-13bc protein (SEQ ID NO:1 or SEQ ID NO:3). These
corresponding polynucleotide fragments are also part of the present
invention. Modified polynucleotides as described above may be made
by standard molecular biology techniques, including construction of
appropriate desired deletion mutants, site-directed mutagenesis
methods or by the polymerase chain reaction using appropriate
oligonucleotide primers.
[0053] For the purposes of the present invention, a protein has "a
biological activity of the IL-13 receptor binding chain" if it
possess one or more of the following characteristics: (I) the
ability to bind IL-13 or a fragment thereof (preferably a
biologically active fragment thereof); and/or (2) the ability to
interact with the second non-IL-13-binding chain of IL-13R to
produce a signal characteristic of the binding of IL-13 to IL-13R.
Preferably, the biological activity possessed by the protein is the
ability to bind IL-13 or a fragment hereof, more preferably with a
K.sub.D of about 0.1 to about 100 nM. Methods for determining
whether a particular protein or peptide has such activity include
without limitation the methods described in the examples provided
herein.
[0054] IL-13bc or active fragments thereof (IL-13bc proteins) may
be fused to carrier molecules such as immunoglobulins. For example,
soluble forms of the IL-13bc may be fused through "linker"
sequences to the Fc portion of an immunoglobulin. Other fusions
proteins, such as those with GST, Lex-A or MBP, may also be
used.
[0055] The invention also encompasses allelic variants of the
nucleotide sequences as set forth in SEQ ID NO:1 or SEQ ID NO:3,
that is, naturally-occurring alternative forms of the isolated
polynucleotide of SEQ ID NO:1 or SEQ ID NO:3 which also encode
IL-13bc proteins, preferably those proteins having a biological
activity of IL-13bc. Also included in the invention are isolated
polynucleotides which hybridize to the nucleotide sequence set
forth in SEQ ID NO:1 or SEQ ID NO:3 under highly stringent
conditions (for example, 0.1.times.SSC at 65.degree. C.). Isolated
polynucleotides which encode IL-13bc proteins but which differ from
the nucleotide sequence set forth in SEQ ID NO:1 or SEQ ID NO:3 by
virtue of the degeneracy of the genetic code are also encompassed
by the present invention. Variations in the nucleotide sequence as
set forth in SEQ ID NO:1 or SEQ ID NO:3 which are caused by point
mutations or by induced modifications are also included in the
invention.
[0056] The present invention also provides polynucleotides encoding
homologues of the murine and human IL-13bc from other animal
species, particularly other mammalian species. Species homologues
can be identified and isolated by making probes or primers from the
murine or human sequences disclosed herein and screening a library
from an appropriate species, such as for example libraries
constructed from PBMCs, thymus or testis of the relevant
species.
[0057] The isolated polynucleotides of the invention may be
operably linked to an expression control sequence such as the pMT2
or pED expression vectors disclosed in Kaufman et al., Nucleic
Acids Res. 19, 4485-4490 (1991), in order to produce the IL-13bc
protein recombinantly. Many suitable expression control sequences
are known in the art. General methods of expressing recombinant
proteins are also known and are exemplified in R Kaufman, Methods
in Enzymology 185, 537-566 (1990). As defined herein "operably
linked" means enzymatically or chemically ligated to form a
covalent bond between the isolated polynucleotide of the invention
and the expression control sequence, in such a way that the IL-13bc
protein is expressed by a host cell which has been transformed
(transfected) with the ligated polynucleotide/expression control
sequence.
[0058] A number of types of cells may act as suitable host cells
for expression of the IL-13bc protein. Any cell type capable of
expressing functional IL-13bc protein may be used. Suitable
mammalian host cells include, for example, monkey COS cells,
Chinese Hamster Ovary (CHO) cells, human kidney 293 cells, human
epidermal A431 cells, human Colo205 cells, 3T3 cells, CV-1 cells,
other transformed primate cell lines, normal diploid cells, cell
strains derived from in vitro culture of primary tissue, primary
explants, HeLa cells, mouse L cells, BHK, HL-60, U937, HaK, Rat2,
BaF3, 32D, FDCP-1, PC12, Mix or C2C12 cells.
[0059] The IL-13bc protein may also be produced by operably linking
the isolated polynucleotide of the invention to suitable control
sequences in one or more insect expression vectors, and employing
an insect expression system. Materials and methods for
baculovirus/insect cell expression systems are commercially
available in kit form from, e.g., Invitrogen, San Diego, Calif.,
U.S.A. (the MaxBac.RTM. kit), and such methods are well known in
the art, as described in Summers and Smith, Texas Agricultural
Experiment Station Bulletin No. 1555 (1987), incorporated herein by
reference. Soluble forms of the IL-13bc protein may also be
produced in insect cells using appropriate isolated polynucleotides
as described above.
[0060] Alternatively, the IL-13bc protein may be produced in lower
eukaryotes such as yeast or in prokaryotes such as bacteria.
Suitable yeast strains include Saccharomyces cerevisiae,
Schizosaccharomyces pombe, Kluyveromyces strains, Candida, or any
yeast strain capable of expressing heterologous proteins. Suitable
bacterial strains include Escherichia coli, Bacillus subtilis,
Salmonella typhimurium, or any bacterial strain capable of
expressing heterologous proteins.
[0061] Expression in bacteria may result in formation of inclusion
bodies incorporating the recombinant protein. Thus, refolding of
the recombinant protein may be required in order to produce active
or more active material. Several methods for obtaining correctly
folded heterologous proteins from bacterial inclusion bodies are
known in the art. These methods generally involve solubilizing the
protein from the inclusion bodies, then denaturing the protein
completely using a chaotropic agent. When cysteine residues are
present in the primary amino acid sequence of the protein, it is
often necessary to accomplish the refolding in an environment which
allows correct formation of disulfide bonds (a redox system).
General methods of refolding are disclosed in Kohno, Meth. Enzym.,
185:187-195 (1990). EP 0433225 and copending application U.S. Ser.
No. 08/163,877 describe other appropriate methods.
[0062] The IL-13bc protein of the invention may also be expressed
as a product of transgenic animals, e.g., as a component of the
milk of transgenic cows, goats, pigs, or sheep which are
characterized by somatic or germ cells containing a polynucleotide
sequence encoding the IL-13bc protein.
[0063] The IL-13bc protein of the invention may be prepared by
growing a culture transformed host cells under culture conditions
necessary to express the desired protein. The resulting expressed
protein may then be purified from the culture medium or cell
extracts. Soluble forms of the IL-13bc protein of the invention can
be purified from conditioned media. Membrane-bound forms of IL-13bc
protein of the invention can be purified by preparing a total
membrane fraction from the expressing cell and extracting the
membranes with a non-ionic detergent such as Triton X-100.
[0064] The IL-13bc protein can be purified using methods known to
those skilled in the art. For example, the IL-13bc protein of the
invention can be concentrated using a commercially available
protein concentration filter, for example, an Amicon or Millipore
Pellicon ultrafiltration unit. Following the concentration step,
the concentrate can be applied to a purification matrix such as a
gel filtration medium. Alternatively, an anion exchange resin can
be employed, for example, a matrix or substrate having pendant
diethylaminoethyl (DEAE) or polyetheyleneimine (PEI) groups. The
matrices can be acrylamide, agarose, dextran, cellulose or other
types commonly employed in protein purification. Alternatively, a
cation exchange step can be employed. Suitable cation exchangers
include various insoluble matrices comprising sulfopropyl or
carboxymethyl groups. Sulfopropyl groups are preferred (e.g.,
S-Sepharose.RTM. columns). The purification of the IL-13bc protein
from culture supernatant may also include one or more column steps
over such affinity resins as concanavalin A-agarose,
heparin-toyopearl.RTM. or Cibacrom blue 3GA Sepharose.RTM.; or by
hydrophobic interaction chromatography using such resins as phenyl
ether, butyl ether, or propyl ether; or by immunoaffinity
chromatography. Finally, one or more reverse-phase high performance
liquid chromatography (RP-HPLC) steps employing hydrophobic RP-HPLC
media, e.g., silica gel having pendant methyl or other aliphatic
groups, can be employed to further purify the IL-13bc protein.
Affinity columns including IL-13 or fragments thereof or including
antibodies to the M-13bc protein can also be used in purification
in accordance with known methods. Some or all of the foregoing
purification steps, in various combinations or with other known
methods, can also be employed to provide a substantially purified
isolated recombinant protein. Preferably, the isolated IL-13bc
protein is purified so that it is substantially free of other
mammalian proteins.
[0065] IL-13bc proteins of the invention may also be used to screen
for agents which are capable of binding to IL-13bc or IL-13R or
which interfere with the binding of IL-13 to the IL-13 or IL-13bc
(either the extracellular or intracellular domains) and thus may
act as inhibitors of normal binding and cytokine action ("IL-13R
inhibitors"). Binding assays using a desired binding protein,
immobilized or not, are well known in the art and may be used for
this purpose using the IL-13bc protein of the invention. Purified
cell based or protein based (cell free) screening assays may be
used to identify such agents. For example, IL-13bc protein may be
immobilized in purified form on a carrier and binding to purified
IL-13bc protein may be measured in the presence and in the absence
of potential inhibiting agents. A suitable binding assay may
alternatively employ a soluble form of IL-13bc of the invention.
Another example of a system in which inhibitors may be screened is
described in Example 2 below.
[0066] In such a screening assay, a first binding mixture is formed
by combining IL-13 or a fragment thereof and IL-13bc protein, and
the amount of binding in the first binding mixture (B.sub.o) is
measured. A second binding mixture is also formed by combining
1L-13 or a fragment thereof, IL-13bc protein, and the compound or
agent to be screened, and the amount of binding in the second
binding mixture (B) is measured. The amounts of binding in the
first and second binding mixtures are compared, for example, by
performing a calculation of the ratio B/B.sub.o. A compound or
agent is considered to be capable of inhibiting binding if a
decrease in binding in the second binding mixture as compared to
the first binding mixture is observed. Optionally, the second chain
of IL-13R can be added to one or both of the binding mixtures. The
formulation and optimization of binding mixtures is within the
level of skill in the art, such binding mixtures may also contain
buffers and salts necessary to enhance or to optimize binding, and
additional control assays may be included in the screening assay of
the invention.
[0067] Compounds found to reduce the binding activity of IL-13bc
protein to IL-13 or its fragment to any degree, preferably by at
least about 10%, more preferably greater than about 50% or more,
may thus be identified and then secondarily screened in other
binding assays and in vivo assays. By these means compounds having
inhibitory activity for IL-13bc binding which may be suitable as
therapeutic agents may be identified.
[0068] IL-13bc proteins, and polynucleotides encoding them, may
also be used as diagnostic agents for detecting the expression or
presence of IL-13bc, IL-13R, IL-13 or cells expressing IL-13bc,
IL-13R or IL-13. The proteins or polynucleotides may be employed
for such purpose in standard procedures for diagnostics assays
using these types of materials. Suitable methods are well known to
those skilled in the art.
[0069] As used herein "IL-13R" refers to IL-13bc and/or a second
IL-13 receptor chain known as "IL-13R.alpha.1" or "NR4" (see:
murine receptor chain, Hilton et al., Proc. Natl. Acad. Sci. USA
1996, 93:497-501; human receptor chain, Aman et al., J. Biol. Chem.
1996, 271:29265-70, and Gauchat et al., Eur. J. Immunol. 1997,
27:971-8).
[0070] IL-13bc acts as a mediator of the known biological
activities of IL-13. As a result, IL-13bc protein (particularly,
soluble IL-13bc proteins), IL-13R inhibitors (i.e., antagonists of
interaction of IL-13 with IL-13R (such as, for example, antibodies
to IL-13R (including particularly to IL-13bc or to IL-13R.alpha.1)
and fragments thereof, antibodies to IL-13 and fragments thereof,
soluble IL-13R.alpha.1 proteins, and small molecule and other
inhibitors of the interaction of IL-13 with IL-13R (including with
IL-13bc and/or with IL-13R.alpha.1) may be useful in treatment or
modulation of various medical conditions in which IL-13 is
implicated or which are effected by the activity (or lack thereof)
of IL-13 (collectively "IL-13-related conditions"). Mutated forms
of IL-4 which bind to IL-13R can also be used as IL-13 antagonists
(see, for example, those disclosed in Shanafelt et a., Proc. Natl.
Acad. Sci. USA 1998, 95:9454-8; Aversa et al., J. Exp. Med. 1993,
178:2213-8; and Grunwald et al., J. Immunol. 1998, 160:4004-9).
[0071] IL-13-related conditions include without limitation
Ig-mediated conditions and diseases, particularly IgE-mediated
conditions (including without limitation atopy, allergic
conditions, asthma, immune complex diseases (such as, for example,
lupus, nephrotic syndrome, nephritis, glomerulonephritis,
thyroiditis and Grave's disease)); inflammatory conditions of the
lungs; immune deficiencies, specifically deficiencies in
hematopoietic progenitor cells, or disorders relating thereto;
cancer and other disease. Such pathological states may result from
disease, exposure to radiation or drugs, and include, for example,
leukopenia, bacterial and viral infections, anemia, B cell or T
cell deficiencies such as immune cell or hematopoietic cell
deficiency following a bone marrow transplantation. Since IL-13
inhibits macrophage activation, IL-13bc proteins may also be useful
to enhance macrophage activation (i.e., in vaccination, treatment
of mycobacterial or intracellular organisms, or parasitic
infections).
[0072] IL-13bc proteins may also be used to potentiate the effects
of IL-13 in vitro and in vivo. For example, an IL-13bc protein can
be combined with a protein having IL-13 activity (preferably IL-13)
and the resulting combination can be contacted with a cell
expressing at least one chain of IL-13R other than IL-13bc
(preferably all chains of IL-13R other than IL-13bc, such as
IL-13R.alpha.1). Preferably, the contacting step is performed by
administering a therapeutically effective amount of such
combination to a mammalian subject in vivo. The pre-established
association of the IL-13 protein with the IL-13bc protein will aid
in formation of the complete IL-13/IL-13R complex necessary for
proper signaling. See for example the methods described by
Economides et al., Science 270:1351 (1995).
[0073] IL-13bc protein and IL-13R inhibitors, purified from cells
or recombinantly produced, may be used as a pharmaceutical
composition when combined with a pharmaceutically acceptable
carrier. Such a composition may contain, in addition to IL-13bc or
inhibitor and carrier, various diluents, fillers, salts, buffers,
stabilizers, solubilizers, and other materials well known in the
art. The term "pharmaceutically acceptable" means a non-toxic
material that does not interfere with the effectiveness of the
biological activity of the active ingredient(s). The
characteristics of the carrier will depend on the route of
administration.
[0074] The pharmaceutical composition of the invention may also
contain cytokines, lymphokines, or other hematopoietic factors such
as M-CSF, GM-CSF, IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8,
IL-9, IL-10, IL-12, IL-14, IL-15, G-CSF, stem cell factor, and
erythropoietin. The pharmaceutical composition may also include
anti-cytokine antibodies. The pharmaceutical composition may
contain thrombolytic or anti-thrombotic factors such as plasminogen
activator and Factor VIII. The pharmaceutical composition may
further contain other anti-inflammatory agents. Such additional
factors and/or agents may be included in the pharmaceutical
composition to produce a synergistic effect with isolated IL-13bc
protein or IL-13bc inhibitor, or to minimize side effects caused by
the isolated IL-13bc or IL-13bc inhibitor. Conversely, isolated
IL-13bc or IL-13bc inhibitor may be included in formulations of the
particular cytokine, lymphokine, other hematopoietic factor,
thrombolytic or anti-thrombotic factor, or anti-inflammatory agent
to minimize side effects of the cytokine, lymphokine, other
hematopoietic factor, thrombolytic or anti-thrombotic factor, or
anti-inflammatory agent.
[0075] The pharmaceutical composition of the invention may be in
the form of a liposome in which isolated IL-13bc protein or IL-13bc
inhibitor is combined, in addition to other pharmaceutically
acceptable carriers, with amphipathic agents such as lipids which
exist in aggregated form as micelles, insoluble monolayers, liquid
crystals, or lamellar layers which in aqueous solution. Suitable
lipids for liposomal formulation include, without limitation,
monoglycerides, diglycerides, sulfatides, lysolecithin,
phospholipids, saponin, bile acids, and the like. Preparation of
such liposomal formulations is within the level of skill in the
art, as disclosed, for example, in U.S. Pat. No. 4,235,871; U.S.
Pat. No. 4,501,728; U.S. Pat. No. 4,837,028; and U.S. Pat. No.
4,737,323, all of which are incorporated herein by reference.
[0076] As used herein, the term "therapeutically effective amount"
means the total amount of each active component of the
pharmaceutical composition or method that is sufficient to show a
meaningful patient benefit, e.g., amelioration of symptoms of,
healing of, or increase in rate of healing of such conditions. When
applied to an individual active ingredient, administered alone, the
term refers to that ingredient alone. When applied to a
combination, the term refers to combined amounts of the active
ingredients that result in the therapeutic effect, whether
administered in combination, serially or simultaneously.
[0077] In practicing the method of treatment or use of the present
invention, a therapeutically effective amount of isolated IL-13bc
protein or IL-13bc inhibitor is administered to a mammal. Isolated
IL-13bc protein or IL-13bc inhibitor may be administered in
accordance with the method of the invention either alone or in
combination with other therapies such as treatments employing
cytokines, lymphokines or other hematopoietic factors. When
co-administered with one or more cytokines, lymphokines or other
hematopoietic factors, IL-13bc protein or IL-13bc inhibitor may be
administered either simultaneously with the cytokine(s),
lymphokine(s), other hematopoietic factor(s), thrombolytic or
anti-thrombotic factors, or sequentially. If administered
sequentially, the attending physician will decide on the
appropriate sequence of administering IL-13bc protein or IL-13bc
inhibitor in combination with cytokine(s), lymphokine(s), other
hematopoietic factor(s), thrombolytic or anti-thrombotic
factors.
[0078] Administration of IL-13bc protein or IL-13bc inhibitor used
in the pharmaceutical composition or to practice the method of the
present invention can be carried out in a variety of conventional
ways, such as oral ingestion, inhalation, or cutaneous,
subcutaneous, or intravenous injection. Intravenous administration
to the patient is preferred.
[0079] When a therapeutically effective amount of IL-13bc protein
or IL-13bc inhibitor is administered orally, IL-13bc protein or
IL-13bc inhibitor will be in the form of a tablet, capsule, powder,
solution or elixir. When administered in tablet form, the
pharmaceutical composition of the invention may additionally
contain a solid carrier such as a gelatin or an adjuvant. The
tablet, capsule, and powder contain from about 5 to 95% IL-13bc
protein or IL-13bc inhibitor, and preferably from about 25 to 90%
IL-13bc protein or IL-13bc inhibitor. When administered in liquid
form, a liquid carrier such as water, petroleum, oils of animal or
plant origin such as peanut oil, mineral oil, soybean oil, or
sesame oil, or synthetic oils may be added. The liquid form of the
pharmaceutical composition may further contain physiological saline
solution, dextrose or other saccharide solution, or glycols such as
ethylene glycol, propylene glycol or polyethylene glycol. When
administered in liquid form, the pharmaceutical composition
contains from about 0.5 to 90% by weight of IL-13bc protein or
IL-13bc inhibitor, and preferably from about 1 to 50% IL-13bc
protein or IL-13bc inhibitor.
[0080] When a therapeutically effective amount of IL-13bc protein
or IL-13bc inhibitor is administered by intravenous, cutaneous or
subcutaneous injection, IL-13bc protein or IL-13bc inhibitor will
be in the form of a pyrogen-free, parenterally acceptable aqueous
solution. The preparation of such parenterally acceptable protein
solutions, having due regard to pH, isotonicity, stability, and the
like, is within the skill in the art. A preferred pharmaceutical
composition for intravenous, cutaneous, or subcutaneous injection
should contain, in addition to IL-13bc protein or IL-13bc inhibitor
an isotonic vehicle such as Sodium Chloride Injection, Ringer's
Injection, Dextrose Injection, Dextrose and Sodium Chloride
Injection, Lactated Ringer's Injection, or other vehicle as known
in the art. The pharmaceutical composition of the present invention
may also contain stabilizers, preservatives, buffers, antioxidants,
or other additive known to those of skill in the art.
[0081] The amount of IL-13bc protein or IL-13bc inhibitor in the
pharmaceutical composition of the present invention will depend
upon the nature and severity of the condition being treated, and on
the nature of prior treatments which the patient has undergone.
Ultimately, the attending physician will decide the amount of
IL-13bc protein or IL-13bc inhibitor with which to treat each
individual patient. Initially, the attending physician will
administer low doses of IL-13bc protein or IL-13bc inhibitor and
observe the patient's response. Larger doses of IL-13bc protein or
IL-13bc inhibitor may be administered until the optimal therapeutic
effect is obtained for the patient, and at that point the dosage is
not generally increased further. It is contemplated that the
various pharmaceutical compositions used to practice the method of
the present invention should contain about 0.1 .mu.g to about 100
mg of IL-13bc protein or IL-13bc inhibitor per kg body weight.
[0082] The duration of intravenous therapy using the pharmaceutical
composition of the present invention will vary, depending on the
severity of the disease being treated and the condition and
potential idiosyncratic response of each individual patient. It is
contemplated that the duration of each application of the IL-13bc
protein or IL-13bc inhibitor will be in the range of 12 to 24 hours
of continuous intravenous administration. Ultimately the attending
physician will decide on the appropriate duration of intravenous
therapy using the pharmaceutical composition of the present
invention.
[0083] IL-13bc proteins of the invention may also be used to
immunize animals to obtain polyclonal and monoclonal antibodies
which specifically react with the IL-13bc protein and which may
inhibit binding of IL-13 or fragments thereof to the receptor. Such
antibodies may be obtained using the entire IL-13bc as an
immunogen, or by using fragments of IL-13bc, such as the soluble
mature IL-13bc. Smaller fragments of the IL-13bc may also be used
to immunize animals. The peptide immunogens additionally may
contain a cysteine residue at the carboxyl terminus, and are
conjugated to a hapten such as keyhole limpet hemocyanin (KLH).
Additional peptide immunogens may be generated by replacing
tyrosine residues with sulfated tyrosine residues. Methods for
synthesizing such peptides are known in the art, for example, as in
R. P. Merrifield, J. Amer. Chem. Soc. 85, 2149-2154 (1963); J. L.
Krstenansky, et al., FEBS Lett. 211, 10 (1987).
[0084] Neutralizing or non-neutralizing antibodies (preferably
monoclonal antibodies) binding to IL-13bc protein may also be
useful therapeutics for certain tumors and also in the treatment of
conditions described above. These neutralizing monoclonal
antibodies may be capable of blocking IL-13 binding to the
IL-13bc.
EXAMPLE 1
Isolation of IL-13bc cDNAs
Isolation of the Murine IL-13 Receptor Chain.
[0085] 5 ug of polyA+ RNA was prepared from the thymuses of 6-8
week old C3H/HeJ mice. Double stranded, hemimethylated cDNA was
prepared using Stratagene's cDNA synthesis kit according to
manufacturers instructions. Briefly, the first strand was primed
with an oligodT-Xho primer, and after second strand synthesis,
EcoRI adapters were added, and the cDNA was digested with XhoI, and
purified. The cDNA was ligated to the XhoI-EcoRI sites of the Zap
Express (Stratagene) lambda vector, and packaged using Gigapak II
Gold packaging extracts (Stratagene) according to the manufacturers
instructions. A library of 1.5.times.10.sup.6 resulting recombinant
phage was amplified following manufacturer's instructions. This
library was screened with a degenerate 17mer oligonucleotide probe
of the sequence KSRCTCCABK CRCTCCA (SEQ ID NO:5) (K=G+T; S=C+G;
R=A+G; B=C+G+T) using standard TMAC hybridization conditions as
described (Current Protocols in Molecular Biology, Ausubel, et al.,
editors., John Wiley and Sons, 1995, section 6.4.3). Clone A25 was
identified because it hybridized to the 17mer probe, but not to
probes derived from known hematopoietin receptors. This clone was
isolated in plasmid form from the ZapExpress vector as per
manufacturers instruction, and the DNA sequence was determined. The
DNA sequence encoded a novel member of the hematopoietin receptor
family.
[0086] Clone A25 containing the polynucleotide having the sequence
of SEQ ID NO:1 was deposited with ATCC as pA25pBKCMV at accession
number 69997 on Feb. 22, 1996.
Isolation of the Human IL-13 Receptor Chain.
[0087] A partial fragment of the human homolog of the murine
receptor was isolated by PCR using oligonucleotides derived from
the murine sequence. cDNA was prepared from human testis polyA+ RNA
that was obtained from Clontech. A DNA fragment of 274 base pairs
was amplified from this cDNA by PCR with the following
oligonucleotides: ATAGTTAAACCATMCCACC (SEQ ID NO:6) and
CTCCATTCGCTCCAAATTCC (SEQ ID NO:7) using AmpliTaq polymerase
(Promega) in 1.times. Taq buffer containing 1.5 mM MgC12 for 30
cycles of incubation (94.degree. C..times.1 minute, 42.degree. C.
for 1 minute, and 72.degree. C. for 1 minute). The DNA sequence of
this fragment was determined, and two oligonucleotides were
prepared from an internal portion of this fragment with the
following sequence: AGTCTATCTTACTMACTCG (SEQ ID NO:8) and
CATCTGAGCAATAAATATTCAC (SEQ ID NO:9). These oligonucleotides were
used as probes to screen a human testis cDNA library purchased from
CLONTECH (cat #HL1161). Filters were hybridized at 52.degree. C.
using standard 5.times.SSC hybridization conditions and washed in
2.times.SSC at 52.degree. C. Twenty two clones were isolated that
hybridized to both oligonucleotides in a screen of 400,000 clones.
DNA sequence was determined from four of the cDNA clones, and all
encoded the same novel hematopoietin receptor. The predicted DNA
sequence of the full length human receptor chain is shown as SEQ ID
NO:3.
[0088] The human clone was deposited with ATCC as phA25#11pDR2 at
accession number 69998 on Feb. 22, 1996.
EXAMPLE 2
Expression of Soluble IL-13bc Protein and Assay of Activity
[0089] Production and Purification of Soluble IL-13bc-Ig.
[0090] DNA encoding amino acids 1-331 of the extracellular domain
of murine IL-13bc was fused to a spacer sequence encoding
gly-ser-gly by PCR and ligated in frame with sequences encoding the
hinge CH2 CH3 regions of human IgG1 of the COS-1 expression vector
pED.Fc. IL-13bc-Ig was produced from DEAE-dextran transfected COS-1
cells and purified via protein A sepharose chromatography
(Pharmacia).
B9 Proliferation Assay
[0091] Stimulation of proliferation of B9 cells (Aarden et al. Eur.
J. Immunol. 1987. 17:1411-1416) in response to IL-13 or IL-4 was
measured by 3H-thymidine incorporation into DNA. Cells
(5.times.103/well) were seeded into 96 well plates with media
containing growth factors at varying concentrations in the presence
or absence of IL-13bc-Ig at 1 ug/ml. After incubation for 3 days 1
uCi/well of 3H-thymidine was added and the cells incubated for an
additional 4 hrs. Incorporated radioactivity was determined using a
LKB 1205 Plate reader.
[0092] The B9 cell line proliferated in response to IL-13, IL-4 or
IL-6. Only responses to IL-13 were inhibited by the soluble
EL-13bc-Ig, indicating that this receptor binds IL-13 specifically,
but not IL-4 or IL-6. The tables show cpm. Two separate experiments
are shown.
TABLE-US-00001 IL-13 plus IL-4 plus cytokine IL-13 A25-Fc IL-4
A25-Fc Cos IL-6 dilution (3 ng/ml) (1 ug/ml) (20 ng/ml) (1 ug/ml)
(1/10,000) 1 37734 1943 6443 6945 37887 1/3 30398 1571 2680 2442
36500 1/10 16101 1461 1767 1771 33335 1/30 2148 1567 1619 1783
27271 1/100 1574 1419 1522 1576 18831 1/300 1512 1531 1373 1577
7768 1/1000 1316 1392 1190 1474 2760 1/3000 1834 1994 1482 1819
1672 IL-13 plus IL-4 plus Cos IL-6 cytokine IL-13 A25-Fc IL-4
A25-Fc Cos IL-6 plus A25-Fc dilution (3 ng/ml) (5 ug/ml) (20 ng/ml)
(5 ug/ml) (1/10,000) (5 ug/ml) 1 6413 295 1216 1158 6969 7703 1/3
5432 281 518 656 7827 8804 1/10 2051 281 489 520 8345 10027 1/30
506 319 279 476 8680 9114 1/100 430 372 288 423 7426 10364 1/300
330 287 323 420 5531 6254 1/1000 326 389 348 nt 2524 nt no cytokine
339 279 404 394 326 279
EXAMPLE 3
Direct Binding of Soluble IL-13bc to IL-13 Measured by Surface
Plasmon Resonance (Biacore Analysis)
[0093] A Biacore biosensor was used to measure directly the
specific binding of IL-13 to purified IL-13bc-Ig (Pharmacia,
Johnsson et al., 1991). Approximately 10,000 to 17,000 resonance
units (RU) of purified IL-13bc-Ig , human IgG1 or irrelevant
receptor were each covalently immobilized to different flow cells
on the sensor chip as recommended by the manufacturer. (RU's are a
refelction of the mass of protein bound to the sensor chip
surface.) Purified IL-13 was injected across the flow cells at 5
ul/min for 10 mins in the presence or absence of excess purified
IL-13bc-Ig. Binding was quantified as the difference in RU before
and after sample injection. Specific IL-13 binding of 481.9 RU was
observed only for immobilized IL-13bc-Ig whereas coinjection of
IL-13 plus IL-13bc-Ig resulted in no binding to the immobilized
IL-13bc-Ig (4 RU). No IL-13 binding was observed for either
immobilized IgG or IL-11R-Ig (5.4 and 3.7 RU respectively).
TABLE-US-00002 IL-13bc-Ig IgG control IL-11R-Ig Sample (10,383 RU)
(13,399 RU) (17,182 RU) 100 ng/ml human 481.9 RU bound 5.4 RU bound
3.7 RU bound IL-13 100 ng/ml human 4.0 RU bound not tested not
tested IL-13 + soluble IL-13bc-Ig
EXAMPLE 4
Binding of IL-13 Expressed in COS Cells to Labeled IL-13BC-Ig
Fusion Protein: COS in situ Detection of IL-13 with IL-13bc-Fc
[0094] Expression vectors for IL-13, IL-4, IL-11 or empty vector
were transfected into COS-1 cells in duplicated plates via the
DEAE-dextran method. Two days after transfection cells were washed
twice in phosphate buffered saline (PBS) and fixed in the culture
dish for 10' at 4.degree. C. with methanol. Following fixation
cells were washed twice with PBS then rinsed once with binding
buffer (PBS, 1% (w/v) bovine serum albumin,). 1% (w/v) sodium
azide) and incubated for two hours at 4.degree. C. in binding
buffer with IL-13bc-Fc at 1.0 ug/ml or with relevant anti-cytokine
antisera. Cells were washed twice with PBS and incubated at 4o C
with shaking in alkaline phosphatase labeled Rabbit F(ab)2'
anti-human IgG diluted 1:500 in binding buffer (for Fc fusion
detection) or Rabbit F(ab)2' anti-rat IgG (for anti-cytokine
detection). Cells were again washed twice in PBS. Alkaline
phosphatase activity was visualized using nitro blue tetrazolium
and 5-bromo-4-chloro-3-indolyl-phosphate.
[0095] Specific binding was visualized under the microscope. Only
cells transfected with IL-13 showed specific binding to IL13bc-Ig.
(see photo of transfected cells, the Figure).
EXAMPLE 5
Other Systems for Determination Biological Activity of IL-13bc
Protein
[0096] Other systems can be used to determine whether a specific
IL-13bc protein exhibits a "biological activity" of IL-13bc as
defined herein. The following are examples of such systems.
Assays for IL-13 Binding
[0097] The ability of a IL-13bc protein to bind IL-13 or a fragment
thereof can be determine by any suitable assays which can detect
such binding. Some suitable examples follow.
[0098] Binding of IL-13 to the extracellular region of the IL-13bc
protein will specifically cause a rapid induction of
phosphotyrosine on the receptor protein. Assays for ligand binding
activity as measured by induction of phosphorylation are described
below.
[0099] Alternatively, a IL-13bc protein (such as, for example, a
soluble form of the extracellular domain) is produced and used to
detect IL-13 binding. For example, a DNA construct is prepared in
which the extracellular domain (truncated prior, preferably
immediately prior, to the predicted transmembrane domain) is
ligated in frame to a cDNA encoding the hinge C.sub.H2 and C.sub.H3
domains of a human immunoglobulin (Ig) .gamma.1. This construct is
generated in an appropriate expression vector for COS cells, such
as pED.DELTA.C or pMT2. The plasmid is transiently transfected into
COS cells. The secreted IL-13bc-Ig fusion protein is collected in
the conditioned medium and purified by protein A
chromatography.
[0100] The purified IL-13bc-Ig fusion protein is used to
demonstrate IL-13 binding in a number of applications. IL-13 can be
coated onto the surface of an enzyme-linked immunosorbent assay
(ELISA) plate, and then additional binding sites blocked with
bovine serum albumin or casein using standard ELISA buffers. The
IL-13bc-Ig fusion protein is then bound to the solid-phase IL-13,
and binding is detected with a secondary goat anti-human Ig
conjugated to horseradish peroxidase. The activity of specifically
bound enzyme can be measured with a colorimetric substrate, such as
tetramethyl benzidine and absorbance readings.
[0101] IL-13 may also be expressed on the surface of cells, for
example by providing a transmembrane domain or glucosyl
phosphatidyl inositol (GPI) linkage. Cells expressing the membrane
bound IL-13 can be identified using the IL-13bc-Ig fusion protein.
The soluble IL-13bc-Ig fusion is bound to the surface of these
cells and detected with goat anti-human Ig conjugated to a
fluorochrome, such as fluorescein isothiocyanate and flow
cytometry.
Interaction Trap
[0102] A yeast genetic selection method, the "interaction trap"
[Gyuris et al, Cell 75:791-803, 1993], can be used to determine
whether a IL-13bc protein has a biological activity of IL-13bc as
defined herein. In this system, the expression of reporter genes
from both LexAop-Leu2 and LexAop-LacZ relies on the interaction
between the bait protein, for example in this case a species which
interacts with human IL-13bc, and the prey, for example in this
case the human IL-13bc protein. Thus, one can measure the strength
of the interaction by the level of Leu2 or LacZ expression. The
most simple method is to measure the activity of the LacZ encoded
protein, .beta.-galactosidase. This activity can be judged by the
degree of blueness on the X-Gal containing medium or filter. For
the quantitative measurement of .beta.-galactosidase activity,
standard assays can be found in "Methods in Yeast Genetics" Cold
Spring Harbor, N.Y., 1990 (by Rose, M. D., Winston, F., and Hieter,
P.).
[0103] In such methods, if one wishes to determine whether the
IL-13bc protein interacts with a particular species (such as, for
example, a cytosolic protein which binds to the intracellular
domain of the IL-13bc in vivo), that species can be used as the
"bait" in the interaction trap with the IL-13bc protein to be
tested serving as the "prey", or vice versa.
EXAMPLE 6
Treatment of Asthma Using Soluble IL-13bc Protein
[0104] A well-characterized murine model of allergic asthma was
used, in which allergen exposure leads to airway hyper
responsiveness ("AHR"), pulmonary eosinophilia, elevations in
antigen-specific serum IgE levels, and increases in airway
epithelial mucus content (3, 11). Male A/J mice were immunized
intraperitoneally and subsequently challenged intratracheally with
soluble ovalbumin (OVA), the allergic phenotype being assessed 4
days after antigen challenge (13). Blockade of IL-13 was performed
by the systemic administration of a soluble IL-13bc-IgGFc fusion
protein (sIL-13bc-Fc), which specifically binds to and neutralizes
IL-13, 24 hours before subsequent intratracheal allergen challenge
(14). Challenge of allergen-immunized mice resulted in significant
increases in airway responsiveness to acetylcholine (15) (FIG. 2A).
Blockade of IL-13 resulted in complete reversal of such established
allergen-induced AHR; thus IL-13 is necessary for the expression of
AHR in this model. The ability of IL-13 ablation to reverse AHR
after full development of the phenotype of allergic asthma
contrasts with the inability of IL-4 ablation to accomplish such a
reversal. The mechanism underlying the effectiveness of
IL-4R.alpha. blockade in reversing allergen-induced AHR may be the
inhibition of IL-13-mediated processes, consistent with the fact
that Stat6 activation is downstream of IL-4R.alpha.-mediated
signaling for both cytokines. IL-13 is probably the primary CD4+ T
cell-derived factor responsible for allergen-induced AHR.
[0105] To evaluate candidate mechanisms underlying IL-13-dependent
expression of AHR, we characterized known allergic effector
cascades. Eosinophils have been implicated as primary effector
cells in asthma and asthmatic AHR (16), but inhibition of IL-13
prior to repeat antigen provocation did not significantly affect
allergen-induced pulmonary eosinophilia (17) (FIG. 2B). To assess
the relevance of IgE-mediated pathways, we measured OVA-specific
serum IgE (18). OVA-specific levels of IgE were observed in
OVA-sensitized and -challenged mice, whereas no antigen-specific
antibody levels were detected in PBS-immunized and -challenged mice
(FIG. 2C). Blockade of IL-13 did not alter OVA-specific IgE levels,
a lack of suppression which is likely due to the fact that IL-13
blockade occurred after initial antigen priming and antibody
formation. Nonetheless, these results show that AHR is not
dependent upon IgE production in this model, consistent with
reports that allergic AHR develops normally in IgE deficient and B
cell deficient mice (19).
[0106] In congruence with the pathology of human asthma, allergic
asthma in murine models is associated with a marked increase in the
mucus content of the airway epithelium (5, 11). Mucus
hypersecretion is particularly profound in autopsy specimens from
patients who die of acute asthma attacks (20). Blockade of IL-13
reverses allergen-induced increases in mucus-containing cells in
the airways (FIG. 3), demonstrating that allergen-induced increases
in airway mucus content are dependent upon IL-13. IL-4 is also
implicated in this process, as IL-4 transgenic mice display marked
goblet cell hyperplasia in the absence of antigen sensitization
(5). However, transfer of Th2 clones from both IL-4-deficient and
control mice into murine airways induces mucus overproduction (21),
suggesting, yet again, that the immunoregulatory role of IL-4 needs
to be carefully differentiated from its role as an effector
molecule.
[0107] Daily administration of recombinant IL-13 (rIL-13) to the
airways of naive (unimmunized) mice induced AHR, demonstrating that
increases in IL-13 activity were sufficient to induce AHR (FIG. 4A)
(22). AHR developed by 72 hours after the start of rIL-13
administration. A significant influx of eosinophils into
bronchoalveolar lavage fluid was observed early after rIL-13
administration, however pulmonary eosinophilia was not observed at
the time of expression of AHR (FIG. 4B). Although the significance
of the time course of eosinophil influx remains unclear, it
suggests that IL-13 alone may be sufficient to initiate
eosinophilic infiltration of the airways, perhaps through its
ability to upregulate chemokine expression (23). Airway
administration of rIL-13 also resulted in a time-dependent increase
in total serum IgE (FIG. 4C) (24), in line with the
previously-reported ability of IL-13 to regulate IgE synthesis
(25). Increases in serum IgE were independent of any immunization
with allergen, findings that resonate with the observation that the
human asthmatic phenotype correlates better with total, rather than
allergen-specific, serum IgE concentrations (26). As predicted from
the above IL-13 inhibition studies, the administration of rIL-13
induced an increase in airway mucus production (FIG. 4D) (27).
REFERENCES AND NOTES
[0108] 1. R. M. Sly, Ann. Allergy 53, 20 (1984); R. Evans et al.,
Chest 91, 65S (1987); N. Halfon and P. W. Newcheck, Am. J. Pub.
Health 76, 1308 (1986); R. M. Jackson, M. R. Sears, R. Beaglehole,
H. H. Rea, Chest 94, 914 (1988); P. J. Gergen and K. B. Weiss, JAMA
264, 1688 (1990); W. M. Vollmer, A. S. Buist, M. L. Osborne, J.
Clin. Epid. 45, 999 (1992). 2. R. Beasley, W. R. Roche, J. A.
Roberts, S. T. Holgate, Am. Rev. Respir. Dis. 139, 806 (1989); R.
Pauwels, Clin. Exp. Allergy19, 395 (1989); J. Bousquet et al., N.
Eng. J. Med. 323, 1033 (1990). 3. S. H. Gavett et al., Am. J. Resp.
Cell. Mol. Biol. 10, 587 (1994); A. A. Gerblich, H. Salik, M. R.
Schuyler, Amer. Rev. Resp. Dis. 143, 533 (1991); C. J. Corrigan, A.
B. Kay, Am. Rev. Resp. Dis. 141, 970 (1990); D. S. Robinson et al.,
N. Engl. J. Med. 326, 298 (1992); C. Walker et al., Am. Rev. Resp.
Dis. 146, 109 (1992); S. H. Gavett et al., J. Exp. Med. 182, 1527
(1995); N. W. Lukacs, R. M. Strieter, S. W. Chensue, S. L. Kunkel,
Am. J. Resp. Cell Mol. Biol. 10, 526 (1994). 4. F. D. Finkelman et
al., J. Immunol. 141, 2335 (1988); J. M. Wang et al., Eur. J.
Immunol. 19, 701 (1989). 5. J. A. Rankin et al., Proc. Natl Acad.
Sci. USA 93, 7821 (1996). 6. G. Brusselle, J. Kips, G. Joos, H.
Bluethmann, R. Pauwels, Am. J. Resp. Cell. Mol. Biol. 12, 254
(1995); D. B. Corry, et al., J. Exp. Med. 183, 109 (1996); P. S.
Foster et al., J. Exp. Med. 183, 195 (1996). 7. A. J. Coyle et al.,
Am. J. Resp. Cell. Mol. Biol. 13, 54 (1995).
8. A. K. Abbas, K. M. Murphy, A. Sher, Nature 383, 787 (1996).
9. S. P. Hogan, et al., J. Immunol. 161, 1501 (1998).
[0109] 10. J. Punnonen et al., Proc. Natl. Acad Sci. USA 90, 3730
(1993); R. de Waal Malefyt, C. G. Figdor, J. E. de Vries, Res.
Immunol. 144, 629 (1993); G. Zurawski, J. E. de Vries, Immunol.
Today 15, 19 (1994). 11. S. H. Gavett et al., Am. J. Physiol. 272,
L253 (1977); D. Kuperman, B. Schofield, M. Wills-Karp, M. J.
Grusby, J. Exp. Med. 187, 939 (1998). 12. S. M. Zurawski, G.
Zurawski, EMBO J. 11, 3905 (1993); S. M. Zurawski et al., J. Biol.
Chem. 270, (1995). J.-X. Lin et al., Immunity 2, 331 (1995). 13.
Six-week-old male A/J mice were obtained from The Jackson
Laboratory (Bar Harbor, Me.) and were housed under laminar flow
hoods in an environmentally-controlled specific pathogen-free
animal facility for the duration of experiments (N=4-10
mice/experimental group). The studies reported here conformed to
the principles for laboratory animal research outlined by the
Animal Welfare Act and the Department of Health, Education and
Welfare (N.I.H.) guidelines for the experimental use of animals.
Mice were immunized by an intraperitoneal injection of 10 ug
ovalbumin (OVA; Crude grade IV, Sigma; St. Louis, Mo.) in 0.2 ml
PBS or PBS alone. 14 days after immunization, mice were
anesthetized with a mixture of ketamine and xylazine (45 and 8
mg/kg, respectively) and challenged intratracheally with 50 ul of a
1.5% solution of OVA or an equivalent volume of PBS as a control.
10 days after this first antigen challenge, mice were challenged
again intratracheally with either OVA or PBS. Characterization of
the allergic phenotype was performed 96 hours after the second
antigen challenge. 14. Human IL-13bc was cloned as described above.
For soluble expression of the murine homolog, a pED expression
vector containing DNA encoding the murine sIL-13bc extracellular
domain, fused in frame with the hinge CH2/CH3 regions of human IgG1
(as described in previous examples), was transfected into CHO cells
[D. D. Donaldson et al., J. Immunol. 161, 2317 (1998)]. The
sIL-13bc-Fc was purified with rProtein A-Sepharose [J. F. Urban et
al., Immunity 8, 255 (1998)]. The in vitro ID.sub.50, as determined
by the ability to neutralize 3 ng/ml of murine IL-13 in the B9
proliferation assay was approximately 10 ng/ml. Human IgG, used as
a control for sIL-13bc-Fc, was similarly purified by rProtein
A-Sepharose chromatography from a 10% solution of human immune
globulin that is commercially available for intravenous
administration (Miles) [ibid]. Mice were given sIL-13bc-Fc (400
ug), or an equivalent amount of the control hu-IgG, by
intraperitoneal injection on Day -1, O, +1, and +3 of secondary
antigen challenge. 15. Airway reactivity to intravenous
administration of acetylcholine was measured (11), 3 days after
final intratracheal challenge. Mice were anesthetized with sodium
pentobarbital (90 mg/kg), intubated, ventilated at a rate of 120
breaths/minute with a constant tidal volume of air (0.2 ml), and
paralyzed with decamethonium bromide (25 mg/kg). After
establishment of a stable airway pressure, acetylcholine was
injected intravenously (50 ug/kg) and dynamic airway pressure was
followed for 5 minutes. 16. G. J. Gleich, J. All. Clin. Immunol.
8,422 (1990). 17. Bronchoalveolar lavage was conducted as described
(11). 18. A kidney was excised, and pooled blood was collected for
antibody analysis as described (11). Serum was separated by
centrifugation and stored at -80.degree. C. until analysis. Serum
OVA-specific IgE levels were determined by sandwich ELISA.
[0110] Sample wells were coated with a 0.01% OVA solution in PBS,
blocked with 10% FBS in PBS, and washed with 0.05% Tween-20 in PBS.
Serum samples were diluted 1:10 and 1:100 with 10% FBS in PBS.
After an overnight incubation, plates were washed with 0.05%
Tween-20 in PBS and biotin-conjugated anti-mouse IgE (PharMingen,
San Diego, Calif.) was added. After a wash, 0.0025 mg/ml avidin
peroxidase (Sigma) in 10% FBS/PBS was added, and plates were
developed with ABTS (2.2'-azino-did[3-ethyl-benzthiazone
sulfonate]) (Kirkegaard and Perry). Plates were read at 405 nm
within 30 minutes. Reported 0.D. values are of serum samples
diluted 1:10 since these values were proven to be below the
saturation point of the assay by comparison of O.D. values of serum
samples diluted 1:100 with 10% FBS/PBS.
19. P. D. Mehlhop et al., Proc. Natl. Acad. Sci. USA 94, 1344
(1997); M. Korsgren et al., J. Exp. Med. 185, 885 (1997).
20. T. Aikawa et al., Chest 101, 916 (1992).
[0111] 21. L. Cohn, R. J. Homer, A. Marinov, J. Rankin, K.
Bottomly. J. Exp. Med. 186, 1737 (1997). 22. DNA encoding a
honeybee melittin leader [D. C. Tessier, D. Y. Thomas, H. E.
Khouri, F. Laliberte, T. Vernet, Gene 2, 177 (1991)] followed by a
six-histidine tag was fused by an enterokinase cleavage site to the
mature region of murine IL-13 at Gly21 and constructed in the
mammalian expression vector pHTop. H6-EK murine IL-13 protein was
produced from stably-transfected CHO cells and purified via Ni-NTA
chromatography to greater than 97% purity as determined by
SDS-PAGE. Protein concentration was determined by absorption at 280
nm and endotoxin contamination was less than 30 EU/mg as measured
by Cape Cod Associates LAL assay. The ED.sub.50 of H6-EK murine
IL-13 as determined by the Ba/F3.IL-13R 1 proliferation assay was 1
ng/ml. Murine rIL-13 (5 ug in a total volume of 50 ul) was
administered daily by intratracheal instillation to naive mice
anesthesized with a mixture of ketamine and xylazine (45 and 8
mg/kg, respectively).
23. M. Goebeler et al., Immunol. 91, 450 (1997).
[0112] 24. A murine IgE-specific ELISA was used to quantitate total
IgE immunoglobulin levels in serum using complementary antibody
pairs for mouse IgE (R35-72 and R35-92) obtained from PharMingen
according to the manufacturer's instructions. Duplicate samples (of
a 1/10 dilution in 10% FBS in PBS) were examined from each animal.
O.D. readings of samples were converted to pg/ml using values
obtained from standard curves generated with known concentrations
of recombinant mouse IgE (5-2000 pg/ml), and the final
concentration was obtained by multiplying by the dilution factor.
25. C. L. Emson, S. E. Bell, A. Jones, W. Wisden, A. N. J.
McKenzie, J. Exp. Med. 188, 399 (1998). 26. L. R. Friedhoff, D. G.
Marsh, Int. Arch. All. Immunol. 100, 355 (1993). 27. To examine the
effects of rIL-13 on mucus cell content of the airway epithelium,
lungs were excised and fixed in 10% formalin. They were then washed
in 70% ethanol, dehydrated, embedded in glycol methacrylate, cut
into 10 uM sections, mounted on slides, and stained with
hematoxylin and eosin and periodic acid Schiff. Four sections were
examined per animal; 4 fields were scored per lung section.
Sections were scored on a scale from 1-4 with 1 representing no
mucus cell content. 28. J. Luyimbazi, X. Xu, M. Wills-Karp,
unpublished results. 29. C. Walker et al., Am. Rev. Respir. Dis.
146, 109 (1992); M. Humbert et al., J. All Clin. Immunol. 99, 657
(1997); S. K. Huang, J. Immunol. 155, 2688 (1995).
30. D. G. Marsh, et al., Science 264, 1152 (1996).
[0113] 31. L. J. Rosenwasser. N. Engl. J. Med. 337, 1766 (1977).
32. G. K. Hershey et al., N Engl. J. Med. 337, 1720 (1997).
[0114] All patent and literature references cited herein are
incorporated by reference as if fully set forth.
Sequence CWU 1
1
911525DNAMus sp.CDS(256)..(1404) 1gaattcggca cgagggagag gaggagggaa
agatagaaag agagagagaa agattgcttg 60ctacccctga acagtgacct ctctcaagac
agtgctttgc tcttcacgta taaggaagga 120aaacagtaga gattcaattt
agtgtctaat gtggaaagga ggacaaagag gtcttgtgat 180aactgcctgt
gataatacat ttcttgagaa accatattat tgagtagagc tttcagcaca
240ctaaatcctg gagaa atg gct ttt gtg cat atc aga tgc ttg tgt ttc att
291 Met Ala Phe Val His Ile Arg Cys Leu Cys Phe Ile 1 5 10ctt ctt
tgt aca ata act ggc tat tct ttg gag ata aaa gtt aat cct 339Leu Leu
Cys Thr Ile Thr Gly Tyr Ser Leu Glu Ile Lys Val Asn Pro 15 20 25cct
cag gat ttt gaa ata ttg gat cct gga tta ctt ggt tat ctc tat 387Pro
Gln Asp Phe Glu Ile Leu Asp Pro Gly Leu Leu Gly Tyr Leu Tyr 30 35
40ttg caa tgg aaa cct cct gtg gtt ata gaa aaa ttt aag ggc tgt aca
435Leu Gln Trp Lys Pro Pro Val Val Ile Glu Lys Phe Lys Gly Cys
Thr45 50 55 60cta gaa tat gag tta aaa tac cga aat gtt gat agc gac
agc tgg aag 483Leu Glu Tyr Glu Leu Lys Tyr Arg Asn Val Asp Ser Asp
Ser Trp Lys 65 70 75act ata att act agg aat cta att tac aag gat ggg
ttt gat ctt aat 531Thr Ile Ile Thr Arg Asn Leu Ile Tyr Lys Asp Gly
Phe Asp Leu Asn 80 85 90aaa ggc att gaa gga aag ata cgt acg cat ttg
tca gag cat tgt aca 579Lys Gly Ile Glu Gly Lys Ile Arg Thr His Leu
Ser Glu His Cys Thr 95 100 105aat gga tca gaa gta caa agt cca tgg
ata gaa gct tct tat ggg ata 627Asn Gly Ser Glu Val Gln Ser Pro Trp
Ile Glu Ala Ser Tyr Gly Ile 110 115 120tca gat gaa gga agt ttg gaa
act aaa att cag gac atg aag tgt ata 675Ser Asp Glu Gly Ser Leu Glu
Thr Lys Ile Gln Asp Met Lys Cys Ile125 130 135 140tat tat aac tgg
cag tat ttg gtc tgc tct tgg aaa cct ggc aag aca 723Tyr Tyr Asn Trp
Gln Tyr Leu Val Cys Ser Trp Lys Pro Gly Lys Thr 145 150 155gta tat
tct gat acc aac tat acc atg ttt ttc tgg tat gag ggc ttg 771Val Tyr
Ser Asp Thr Asn Tyr Thr Met Phe Phe Trp Tyr Glu Gly Leu 160 165
170gat cat gcc tta cag tgt gct gat tac ctc cag cat gat gaa aaa aat
819Asp His Ala Leu Gln Cys Ala Asp Tyr Leu Gln His Asp Glu Lys Asn
175 180 185gtt gga tgc aaa ctg tcc aac ttg gac tca tca gac tat aaa
gat ttt 867Val Gly Cys Lys Leu Ser Asn Leu Asp Ser Ser Asp Tyr Lys
Asp Phe 190 195 200ttt atc tgt gtt aat gga tct tca aag ttg gaa ccc
atc aga tcc agc 915Phe Ile Cys Val Asn Gly Ser Ser Lys Leu Glu Pro
Ile Arg Ser Ser205 210 215 220tat aca gtt ttt caa ctt caa aat ata
gtt aaa cca ttg cca cca gaa 963Tyr Thr Val Phe Gln Leu Gln Asn Ile
Val Lys Pro Leu Pro Pro Glu 225 230 235ttc ctt cat att agt gtg gag
aat tcc att gat att aga atg aaa tgg 1011Phe Leu His Ile Ser Val Glu
Asn Ser Ile Asp Ile Arg Met Lys Trp 240 245 250agc aca cct gga gga
ccc att cca cca agg tgt tac act tat gaa att 1059Ser Thr Pro Gly Gly
Pro Ile Pro Pro Arg Cys Tyr Thr Tyr Glu Ile 255 260 265gtg atc cga
gaa gac gat att tcc tgg gag tct gcc aca gac aaa aac 1107Val Ile Arg
Glu Asp Asp Ile Ser Trp Glu Ser Ala Thr Asp Lys Asn 270 275 280gat
atg aag ttg aag agg aga gca aat gaa agt gaa gac cta tgc ttt 1155Asp
Met Lys Leu Lys Arg Arg Ala Asn Glu Ser Glu Asp Leu Cys Phe285 290
295 300ttt gta aga tgt aag gtc aat ata tat tgt gca gat gat gga att
tgg 1203Phe Val Arg Cys Lys Val Asn Ile Tyr Cys Ala Asp Asp Gly Ile
Trp 305 310 315agc gaa tgg agt gaa gag gaa tgt tgg gaa ggt tac aca
ggg cca gac 1251Ser Glu Trp Ser Glu Glu Glu Cys Trp Glu Gly Tyr Thr
Gly Pro Asp 320 325 330tca aag att att ttc ata gta cca gtt tgt ctt
ttc ttt ata ttc ctt 1299Ser Lys Ile Ile Phe Ile Val Pro Val Cys Leu
Phe Phe Ile Phe Leu 335 340 345ttg tta ctt ctt tgc ctt att gtg gag
aag gaa gaa cct gaa ccc aca 1347Leu Leu Leu Leu Cys Leu Ile Val Glu
Lys Glu Glu Pro Glu Pro Thr 350 355 360ttg agc ctc cat gtg gat ctg
aac aaa gaa gtg tgt gct tat gaa gat 1395Leu Ser Leu His Val Asp Leu
Asn Lys Glu Val Cys Ala Tyr Glu Asp365 370 375 380acc ctc tgt
taaaccacca atttcttgac atagagccag ccagcaggag 1444Thr Leu
Cystcatattaaa ctcaatttct cttaaaattt cgaatacatc ttcttgaaaa
tccaaaaaaa 1504aaaaaaaaaa aaaaactcga g 15252383PRTMus sp. 2Met Ala
Phe Val His Ile Arg Cys Leu Cys Phe Ile Leu Leu Cys Thr1 5 10 15Ile
Thr Gly Tyr Ser Leu Glu Ile Lys Val Asn Pro Pro Gln Asp Phe 20 25
30Glu Ile Leu Asp Pro Gly Leu Leu Gly Tyr Leu Tyr Leu Gln Trp Lys
35 40 45Pro Pro Val Val Ile Glu Lys Phe Lys Gly Cys Thr Leu Glu Tyr
Glu 50 55 60Leu Lys Tyr Arg Asn Val Asp Ser Asp Ser Trp Lys Thr Ile
Ile Thr65 70 75 80Arg Asn Leu Ile Tyr Lys Asp Gly Phe Asp Leu Asn
Lys Gly Ile Glu 85 90 95Gly Lys Ile Arg Thr His Leu Ser Glu His Cys
Thr Asn Gly Ser Glu 100 105 110Val Gln Ser Pro Trp Ile Glu Ala Ser
Tyr Gly Ile Ser Asp Glu Gly 115 120 125Ser Leu Glu Thr Lys Ile Gln
Asp Met Lys Cys Ile Tyr Tyr Asn Trp 130 135 140Gln Tyr Leu Val Cys
Ser Trp Lys Pro Gly Lys Thr Val Tyr Ser Asp145 150 155 160Thr Asn
Tyr Thr Met Phe Phe Trp Tyr Glu Gly Leu Asp His Ala Leu 165 170
175Gln Cys Ala Asp Tyr Leu Gln His Asp Glu Lys Asn Val Gly Cys Lys
180 185 190Leu Ser Asn Leu Asp Ser Ser Asp Tyr Lys Asp Phe Phe Ile
Cys Val 195 200 205Asn Gly Ser Ser Lys Leu Glu Pro Ile Arg Ser Ser
Tyr Thr Val Phe 210 215 220Gln Leu Gln Asn Ile Val Lys Pro Leu Pro
Pro Glu Phe Leu His Ile225 230 235 240Ser Val Glu Asn Ser Ile Asp
Ile Arg Met Lys Trp Ser Thr Pro Gly 245 250 255Gly Pro Ile Pro Pro
Arg Cys Tyr Thr Tyr Glu Ile Val Ile Arg Glu 260 265 270Asp Asp Ile
Ser Trp Glu Ser Ala Thr Asp Lys Asn Asp Met Lys Leu 275 280 285Lys
Arg Arg Ala Asn Glu Ser Glu Asp Leu Cys Phe Phe Val Arg Cys 290 295
300Lys Val Asn Ile Tyr Cys Ala Asp Asp Gly Ile Trp Ser Glu Trp
Ser305 310 315 320Glu Glu Glu Cys Trp Glu Gly Tyr Thr Gly Pro Asp
Ser Lys Ile Ile 325 330 335Phe Ile Val Pro Val Cys Leu Phe Phe Ile
Phe Leu Leu Leu Leu Leu 340 345 350Cys Leu Ile Val Glu Lys Glu Glu
Pro Glu Pro Thr Leu Ser Leu His 355 360 365Val Asp Leu Asn Lys Glu
Val Cys Ala Tyr Glu Asp Thr Leu Cys 370 375 38031369DNAHomo
sapiensCDS(103)..(1245) 3ggatccgcgc ggatgaaggc tatttgaagt
cgccataacc tggtcagaag tgtgcctgtc 60ggcggggaga gaggcaatat caaggtttta
aatctcggag aa atg gct ttc gtt 114 Met Ala Phe Val 1tgc ttg gct atc
gga tgc tta tat acc ttt ctg ata agc aca aca ttt 162Cys Leu Ala Ile
Gly Cys Leu Tyr Thr Phe Leu Ile Ser Thr Thr Phe5 10 15 20ggc tgt
act tca tct tca gac acc gag ata aaa gtt aac cct cct cag 210Gly Cys
Thr Ser Ser Ser Asp Thr Glu Ile Lys Val Asn Pro Pro Gln 25 30 35gat
ttt gag ata gtg gat ccc gga tac tta ggt tat ctc tat ttg caa 258Asp
Phe Glu Ile Val Asp Pro Gly Tyr Leu Gly Tyr Leu Tyr Leu Gln 40 45
50tgg caa ccc cca ctg tct ctg gat cat ttt aag gaa tgc aca gtg gaa
306Trp Gln Pro Pro Leu Ser Leu Asp His Phe Lys Glu Cys Thr Val Glu
55 60 65tat gaa cta aaa tac cga aac att ggt agt gaa aca tgg aag acc
atc 354Tyr Glu Leu Lys Tyr Arg Asn Ile Gly Ser Glu Thr Trp Lys Thr
Ile 70 75 80att act aag aat cta cat tac aaa gat ggg ttt gat ctt aac
aag ggc 402Ile Thr Lys Asn Leu His Tyr Lys Asp Gly Phe Asp Leu Asn
Lys Gly85 90 95 100att gaa gcg aag ata cac acg ctt tta cca tgg caa
tgc aca aat gga 450Ile Glu Ala Lys Ile His Thr Leu Leu Pro Trp Gln
Cys Thr Asn Gly 105 110 115tca gaa gtt caa agt tcc tgg gca gaa act
act tat tgg ata tca cca 498Ser Glu Val Gln Ser Ser Trp Ala Glu Thr
Thr Tyr Trp Ile Ser Pro 120 125 130caa gga att cca gaa act aaa gtt
cag gat atg gat tgc gta tat tac 546Gln Gly Ile Pro Glu Thr Lys Val
Gln Asp Met Asp Cys Val Tyr Tyr 135 140 145aat tgg caa tat tta ctc
tgt tct tgg aaa cct ggc ata ggt gta ctt 594Asn Trp Gln Tyr Leu Leu
Cys Ser Trp Lys Pro Gly Ile Gly Val Leu 150 155 160ctt gat acc aat
tac aac ttg ttt tac tgg tat gag ggc ttg gat cat 642Leu Asp Thr Asn
Tyr Asn Leu Phe Tyr Trp Tyr Glu Gly Leu Asp His165 170 175 180gca
tta cag tgt gtt gat tac atc aag gct gat gga caa aat ata gga 690Ala
Leu Gln Cys Val Asp Tyr Ile Lys Ala Asp Gly Gln Asn Ile Gly 185 190
195tgc aga ttt ccc tat ttg gag gca tca gac tat aaa gat ttc tat att
738Cys Arg Phe Pro Tyr Leu Glu Ala Ser Asp Tyr Lys Asp Phe Tyr Ile
200 205 210tgt gtt aat gga tca tca gag aac aag cct atc aga tcc agt
tat ttc 786Cys Val Asn Gly Ser Ser Glu Asn Lys Pro Ile Arg Ser Ser
Tyr Phe 215 220 225act ttt cag ctt caa aat ata gtt aaa cct ttg ccg
cca gtc tat ctt 834Thr Phe Gln Leu Gln Asn Ile Val Lys Pro Leu Pro
Pro Val Tyr Leu 230 235 240act ttt act cgg gag agt tca tgt gaa att
aag ctg aaa tgg agc ata 882Thr Phe Thr Arg Glu Ser Ser Cys Glu Ile
Lys Leu Lys Trp Ser Ile245 250 255 260cct ttg gga cct att cca gca
agg tgt ttt gat tat gaa att gag atc 930Pro Leu Gly Pro Ile Pro Ala
Arg Cys Phe Asp Tyr Glu Ile Glu Ile 265 270 275aga gaa gat gat act
acc ttg gtg act gct aca gtt gaa aat gaa aca 978Arg Glu Asp Asp Thr
Thr Leu Val Thr Ala Thr Val Glu Asn Glu Thr 280 285 290tac acc ttg
aaa aca aca aat gaa acc cga caa tta tgc ttt gta gta 1026Tyr Thr Leu
Lys Thr Thr Asn Glu Thr Arg Gln Leu Cys Phe Val Val 295 300 305aga
agc aaa gtg aat att tat tgc tca gat gac gga att tgg agt gag 1074Arg
Ser Lys Val Asn Ile Tyr Cys Ser Asp Asp Gly Ile Trp Ser Glu 310 315
320tgg agt gat aaa caa tgc tgg gaa ggt gaa gac cta tcg aag aaa act
1122Trp Ser Asp Lys Gln Cys Trp Glu Gly Glu Asp Leu Ser Lys Lys
Thr325 330 335 340ttg cta cgt ttc tgg cta cca ttt ggt ttc atc tta
ata tta gtt ata 1170Leu Leu Arg Phe Trp Leu Pro Phe Gly Phe Ile Leu
Ile Leu Val Ile 345 350 355ttt gta acc ggt ctg ctt ttg cgt aag cca
aac acc tac cca aaa atg 1218Phe Val Thr Gly Leu Leu Leu Arg Lys Pro
Asn Thr Tyr Pro Lys Met 360 365 370att cca gaa ttt ttc tgt gat aca
tga agactttcca tatcaagaga 1265Ile Pro Glu Phe Phe Cys Asp Thr 375
380catggtattg actcaacagt ttccagtcat ggccaaatgt tcaatatgag
tctcaataaa 1325ctgaattttt cttgcgaaaa aaaaaaaaaa aaatccgcgg atcc
13694380PRTHomo sapiens 4Met Ala Phe Val Cys Leu Ala Ile Gly Cys
Leu Tyr Thr Phe Leu Ile1 5 10 15Ser Thr Thr Phe Gly Cys Thr Ser Ser
Ser Asp Thr Glu Ile Lys Val 20 25 30Asn Pro Pro Gln Asp Phe Glu Ile
Val Asp Pro Gly Tyr Leu Gly Tyr 35 40 45Leu Tyr Leu Gln Trp Gln Pro
Pro Leu Ser Leu Asp His Phe Lys Glu 50 55 60Cys Thr Val Glu Tyr Glu
Leu Lys Tyr Arg Asn Ile Gly Ser Glu Thr65 70 75 80Trp Lys Thr Ile
Ile Thr Lys Asn Leu His Tyr Lys Asp Gly Phe Asp 85 90 95Leu Asn Lys
Gly Ile Glu Ala Lys Ile His Thr Leu Leu Pro Trp Gln 100 105 110Cys
Thr Asn Gly Ser Glu Val Gln Ser Ser Trp Ala Glu Thr Thr Tyr 115 120
125Trp Ile Ser Pro Gln Gly Ile Pro Glu Thr Lys Val Gln Asp Met Asp
130 135 140Cys Val Tyr Tyr Asn Trp Gln Tyr Leu Leu Cys Ser Trp Lys
Pro Gly145 150 155 160Ile Gly Val Leu Leu Asp Thr Asn Tyr Asn Leu
Phe Tyr Trp Tyr Glu 165 170 175Gly Leu Asp His Ala Leu Gln Cys Val
Asp Tyr Ile Lys Ala Asp Gly 180 185 190Gln Asn Ile Gly Cys Arg Phe
Pro Tyr Leu Glu Ala Ser Asp Tyr Lys 195 200 205Asp Phe Tyr Ile Cys
Val Asn Gly Ser Ser Glu Asn Lys Pro Ile Arg 210 215 220Ser Ser Tyr
Phe Thr Phe Gln Leu Gln Asn Ile Val Lys Pro Leu Pro225 230 235
240Pro Val Tyr Leu Thr Phe Thr Arg Glu Ser Ser Cys Glu Ile Lys Leu
245 250 255Lys Trp Ser Ile Pro Leu Gly Pro Ile Pro Ala Arg Cys Phe
Asp Tyr 260 265 270Glu Ile Glu Ile Arg Glu Asp Asp Thr Thr Leu Val
Thr Ala Thr Val 275 280 285Glu Asn Glu Thr Tyr Thr Leu Lys Thr Thr
Asn Glu Thr Arg Gln Leu 290 295 300Cys Phe Val Val Arg Ser Lys Val
Asn Ile Tyr Cys Ser Asp Asp Gly305 310 315 320Ile Trp Ser Glu Trp
Ser Asp Lys Gln Cys Trp Glu Gly Glu Asp Leu 325 330 335Ser Lys Lys
Thr Leu Leu Arg Phe Trp Leu Pro Phe Gly Phe Ile Leu 340 345 350Ile
Leu Val Ile Phe Val Thr Gly Leu Leu Leu Arg Lys Pro Asn Thr 355 360
365Tyr Pro Lys Met Ile Pro Glu Phe Phe Cys Asp Thr 370 375
380517DNAArtificial Sequenceoligonucleotide 5ksrctccabk crctcca
17620DNAArtificial Sequenceoligonucleotide 6atagttaaac cattgccacc
20720DNAArtificial Sequenceoligonucleotide 7ctccattcgc tccaaattcc
20821DNAArtificial Sequenceoligonucleotide 8agtctatctt acttttactc g
21922DNAArtificial Sequenceoligonucleotide 9catctgagca ataaatattc
ac 22
* * * * *