U.S. patent application number 12/584571 was filed with the patent office on 2010-04-01 for decreasing rubisco content of algae and cyanobacteria cultivated in high carbon dioxide.
This patent application is currently assigned to TransAlgae Ltd. Invention is credited to Doron Eisenstadt, Jonathan Gressel, Daniella Schatz, Shai Ufaz.
Application Number | 20100081177 12/584571 |
Document ID | / |
Family ID | 43733265 |
Filed Date | 2010-04-01 |
United States Patent
Application |
20100081177 |
Kind Code |
A1 |
Schatz; Daniella ; et
al. |
April 1, 2010 |
Decreasing RUBISCO content of algae and cyanobacteria cultivated in
high carbon dioxide
Abstract
Algae and cyanobacteria are genetically engineered to have lower
RUBISCO (ribulose-1,5-bisphosphate carboxylase/oxygenase) content
in order to grow more efficiently at elevated carbon dioxide levels
while recycling industrial CO.sub.2 emissions back to products, and
so as not to be able to grow outside of cultivation.
Inventors: |
Schatz; Daniella; (Givataim,
IL) ; Gressel; Jonathan; (Rehovot, IL) ;
Eisenstadt; Doron; (Haifa, IL) ; Ufaz; Shai;
(Givat Ada, IL) |
Correspondence
Address: |
DODDS & ASSOCIATES
1707 N STREET NW
WASHINGTON
DC
20036
US
|
Assignee: |
TransAlgae Ltd
Rehovot
IL
|
Family ID: |
43733265 |
Appl. No.: |
12/584571 |
Filed: |
September 8, 2009 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
61191169 |
Sep 5, 2008 |
|
|
|
61191453 |
Sep 9, 2008 |
|
|
|
Current U.S.
Class: |
435/134 ;
435/170; 435/252.3; 435/257.2; 435/41; 435/471 |
Current CPC
Class: |
C12N 2310/11 20130101;
C12N 9/90 20130101; C12N 1/20 20130101; C12N 9/88 20130101; C12P
7/6463 20130101; C12N 2310/14 20130101; C12N 15/1137 20130101; C12N
1/12 20130101; C12P 21/02 20130101; C12Y 401/01039 20130101; C12N
9/16 20130101; C12N 9/93 20130101; C07K 14/62 20130101 |
Class at
Publication: |
435/134 ;
435/170; 435/41; 435/252.3; 435/471; 435/257.2 |
International
Class: |
C12P 7/64 20060101
C12P007/64; C12P 1/04 20060101 C12P001/04; C12P 1/00 20060101
C12P001/00; C12N 1/21 20060101 C12N001/21; C12N 15/74 20060101
C12N015/74; C12N 1/13 20060101 C12N001/13 |
Claims
1. A method to over produce homologous or heterologous compounds in
cyanobacteria or algae cells, said method comprising the steps of:
a) Reducing amount of RUBISCO protein in the cells by genetically
transforming the cells; b) Transforming the cells with a gene of
interest under control of constitutive or inducible promoter to
express production of the compound; and c) Cultivating the
transgenic cell line in elevated carbon dioxide concentrations.
2. The method of claim 1, wherein reducing the amount of RUBISCO is
achieved by transforming the cells with a transformation vector
comprising rbcS or rbcL encoding polynucleotides in an antisense or
in an RNAi-construct under a constitutive promoter.
3. The method of claim 2, wherein the transformation vector also
comprises a polynucleotide sequence encoding the gene of
interest.
4. The method of claim 1, wherein the cyanobacteria is selected
from the group consisting Synechococcus PCC7002, Synechococcus
WH-7803, and Thermosynechococcus elongatus BP-1.
5. The method of claim 4, wherein the cells are transformed by
electroporation, microporation or by particle bombardment.
6. (canceled)
7. (canceled)
8. (canceled)
9. The method of claim 1, wherein the gene of interest encodes
proteins.
10. The method of claim 9, wherein the proteins are pharmaceutical
proteins or industrial proteins.
11. The method of claim 10, wherein the protein is human
insulin.
12. The method of claim 10, wherein the protein is thermostable
phytase.
13. The method of claim 9, wherein the proteins enhance algal or
cyanobacterial growth.
14. The method of claim 13, wherein the proteins are rate limiting
enzymes of photosynthesis.
15. The method of claim 14, wherein the enzyme is selected from the
group consisting of fructose-1,6,-bisphosphate aldolase, choloplast
triosephosphate isomerase and acetyl CoA carboxylase.
16. The method of claim 9, wherein the proteins are storage
proteins.
17. The method of claim 16, wherein the protein is 15 Kd zein or
BHL8.
18. The method of claim 1, wherein the gene of interest is encoding
of production of oils or lipids.
19. The method of claim 18, wherein the gene of interest encodes
acetylCo-carboxylase.
20. A method to cultivate algae and cyanobacteria under high
CO.sub.2 concentration, wherein the algae and cyanobacteria are
genetically modified to express low amounts of RUBISCO protein.
21. A method to prevent establishment of transgenic algal or
cyanobacterial cells in the natural environment by down regulating
the amount of RUBISCO protein in the cells by genetic modification,
whereby the cells become incapable to grow in ambient carbon
dioxide concentrations.
22. A transgenic alga or cyanobacterium, transformed with a vector
comprising rbcS or rbcL encoding polynucleotides in an antisense or
an RNAi-construct under a constitutive promoter; whereby the
transgenic alga or cyanobacterium expresses reduced content of
RUBISCO protein.
23. The transgenic alga or cyanobacterium of claim 22, wherein the
alga or cyanobacterium also transformed to express a gene of
interest.
24. The transgenic alga or cyanobacterium of claim 23, wherein the
gene of interest and the antisense or RNAi construct are
transformed in tandem.
25. The method of claim 1, wherein the alga is selected from the
group consisting of Chlamydomon reinhardtii, Pavlova lutheri,
Isochrysis CS-177, Nanochloropsis CS-179, Nanochloropsis CS-24
Nanochloropsis salina CS-190, Tetraselmis suecica, Tetraselmis
chuii and Nannochloris sp
26. The method of claim 25, wherein the cells are transformed by
electroporation, microporation or by particle bombardment.
27. The method of claim 26, wherein the RNAi-construct comprises
SEQ ID NO: 1.
Description
PRIORITY
[0001] This application claims priority of the U.S. Provisional
applications No. 61/191,169 filed on Sep. 5.sup.th 2008 and
61/191,453 filed on Sep. 9.sup.th 2008.
SEQUENCE LISTING
[0002] This application contains sequence data provided on a
computer readable diskette and as a paper version. The paper
version of the sequence data is identical to the data provided on
the diskette
FIELD OF THE INVENTION
[0003] This invention relates to the field of genetically
engineering algae and cyanobacteria to grow more efficiently on
industrial waste emissions of carbon dioxide and is applicable for
use with algae and cyanobacteria cultured in closed bioreactors and
covered or open ponds for producing high value products, as well as
biofuels. It builds on integrating principles of genetic
engineering, photosynthetic physiology and biochemistry, chemical
engineering of bioreactors, and waste emission engineering.
BACKGROUND OF THE INVENTION
[0004] A major breakthrough in the large scale cultivation of algae
and cyanobacteria to produce commercially useful products was the
discovery that many such species could be cultivated with flue gas
(up to 80% CO.sub.2) or even pure CO.sub.2 whereas most other
organisms (plants and animals) are "biochemically anaesthetized" at
CO.sub.2 levels of 5% or higher, slowing all metabolism. This
opened the way for cultivating such organisms on CO.sub.2 emissions
to the environment (Murakami and Ikenouchi 1997, Negoro, et al.
1993).
[0005] Cyanobacteria have already begun to be genetically
engineered to utilize these elevated CO.sub.2 levels by over
expressing genes encoding rate limiting enzymes of the "dark
reactions" (CO.sub.2 assimilating reactions that utilize NADPH and
ATP from the light reactions) of photosynthesis. Thus, for example,
engineering genes from rice encoding for cytosolic
fructose-1,6-bisphosphate aldolase and spinach triose phosphate
isomerase in cells of a cyanobacterium doubled their activities and
greatly increased photosynthetic efficiency and biomass yields
(Kang et al. 2005, Ma et al. 2007).
[0006] However, one can only over-express enzymes to a limited
extent, as the cell does not have unlimited capacity. Therefore,
the existing methods have only a limited capacity and there is a
need to improve these methods to enhance the use of elevated carbon
dioxide concentration in algal cultures.
SUMMARY OF THE INVENTION
[0007] The instant invention provides a solution to this existing
problem by reducing the levels of other enzymes to "make room" for
the over expressed, rate limiting enzymes such as
fructose-1,6-bisphosphate aldolase (ALD), chloroplast
triosephosphate isomerase (TPI) or acetyl CoA carboxylase (ACCase)
that enhance sink capacity to utilize fixed carbon dioxide.
[0008] Ribulose-1,5-bisphosphate carboxylase/oxygenase (RUBISCO) is
the key photosynthetic enzyme that catalyzes the first step of
CO.sub.2 fixation. The chloroplast localized holoenzyme of plants
and algae in Sub-kingdom Viridaeplantae, Phylum Chlorophyta
(heretofore referred to as green algae) contain eight nuclear
genome encoded small subunits and eight chloroplast genome encoded
large subunits. In red lineage algae (Sub-Kingdom Chromobiota,
Phylum Haptophyta, Heterokonotophyta, Bacillariophyta and others
(Table 1), all sub-units are encoded in the chloroplast.
TABLE-US-00001 TABLE 1 Phylogeny of some of algae used Genus Family
Order Phylum Sub-Kingdom Chlamydomonas Chlamydomonadaceae
Volvocales Chlorophyta Viridaeplantae Nannochloris Coccomyxaceae
Chlorococcales Chlorophyta Viridaeplantae Tetraselmis
Chlorodendraceae Chlorodendrales Chlorophyta Viridaeplantae
Phaeodactylum Phaeodactylaceae Naviculales Bacillariophyta
Chromobiota Nannochloropsis Monodopsidaceae Eustigmatales
Heterokontophyta Chromobiota Pavlova Pavlovaceae Pavlovales
Haptophyta Chromobiota Isochrysis Isochrysidaceae Isochrysidales
Haptophyta Chromobiota Phylogeny according to:
http://www.algaebase.org/browse/taxonomy/ Note: Many genes that in
higher plants and Chlorophyta are encoded in the nucleus are
encoded on the chloroplast genome (plastome) of Chromobiota, red
lineage algae (Grzebyk, et al. (2003).
[0009] The present consensus is that even more RUBISCO is needed
for efficient photosynthesis, as demonstrated in the recent
suggestion that elevated RUBISCO would enhance the rate of
photosynthesis in algae commercially cultivated for biofuels
(Huntley and Redalje 2007). Counter-intuitively, the inventors of
this disclosure chose to "make room" for other enzymes by reducing
concentration of the RUBISCO enzyme, typically considered to be
rate limiting for CO.sub.2 assimilation in photosynthetic cells;
RUBISCO can comprise up to 70% of the soluble protein in plant
cells.
[0010] Photosynthesis produces the sugars needed for the
biosynthesis of the specific primary and secondary metabolites of
interest in each case (biofuels, pigments, enzymes,
pharmaceuticals, starch, etc.). RUBISCO is the first enzyme in the
dark reactions of photosynthesis, "fixing" carbon dioxide onto an
organic molecule. The later reactions use NADPH and ATP generated
by the light reactions to reduce the fixed CO.sub.2 to
carbohydrates. RUBISCO was the best enzyme evolution could produce
pre-antiquity, which was of little matter early in the evolution of
earth, e.g. in the Archean era 3.5 billion years ago when CO.sub.2
concentrations in the atmosphere were thought to be at least 100
times more than at present (FIG. 1.4 in Falkowski and Raven, 1997),
and the very low affinity for CO.sub.2 to RUBISCO was of little
consequence. As oxygenous photosynthesis began to remove CO.sub.2
from the atmosphere and elevate atmospheric O.sub.2, the levels of
RUBISCO became limiting, and evolution gradually increased the
levels of RUBISCO in photosynthetic organisms to the present high
levels. Presently, high concentrations of CO.sub.2 can be
inexpensively provided to algae and cyanobacteria in culture from
industrial combustion of fuels. This will lead to much of the
RUBISCO being superfluous, and decreasing its content "makes way"
for over-expressing other enzymes needed for photosynthesis as well
as releasing resources for more soluble products. This would be one
way of sequestering large amounts of carbon dioxide, presently
imperative due to the purported relationships between elevated
global carbon dioxide levels and global warming. Even though the
small subunit of RUBISCO is encoded by a family of genes, the gene
products are interchangeable, with considerable consensus among
them.
[0011] According to this disclosure, reducing RUBISCO in green
algae can be done by using either antisense or RNAi technology,
both targeting the consensus sequences of the small nuclear encoded
subunit, which, in many cases, has been shown to control the
biosynthesis of both subunits. Obviously, total suppression is
undesirable, as RUBISCO is needed for CO.sub.2 fixation. The level
of suppression that is advantageous is a function of: a.
experimental determination for each pond or bioreactor condition
and concentration of CO.sub.2 introduced into the system; and b.
the availability of the CO.sub.2 to the organisms in the medium.
Reducing RUBISCO in red lineage algae according to this disclosure,
can be done by knockout of one or both RUBISCO subunits in the
chloroplast by homologous recombination and transformation of the
same RUBISCO gene under a mutated promoter, which will decrease the
RUBISCO expression level.
[0012] Many algae and especially cyanobacteria have atypical (for
higher organisms) G:C contents and consequently atypical codon
usages and DNA sequences. While there is a high consensus in amino
acid sequences in RUBISCO subunits, it is far less at the
nucleotide level, requiring sequencing of the genes encoding
RUBISCO subunits from each target organism before embarking on
generating RNAi or antisense constructs and engineering them into
the cell thus reducing RUBISCO according to the codon usage of the
target organism.
[0013] One drawback to genetically engineering algae and
cyanobacteria for large scale cultivation is the risk of
inadvertent "spills" into the environment. It is highly unlikely
(i.e. as near to impossible as a scientist can evaluate) that
organisms optimized to live and grow in an atmosphere of >5%
CO.sub.2, yet having a lower than normal RUBISCO content can
survive for long in nature where the CO.sub.2 concentration is
<0.5%, as the engineered organism has lost most of its ability
to scavenge CO.sub.2 from the environment. Thus, this risk from
inadvertent transgenic release is negated, whether the organism is
engineered just for lowered RUBISCO, or engineered with lowered
RUBISCO and elevated other enzymes, whether photosynthesis related,
or related to other properties.
[0014] The present invention relates to the use of algae or
cyanobacteria cultivated in ponds or bioreactors that have had
their RUBISCO contents transgenically lowered by antisense or RNAi
or other transgenic technologies giving rise to similarly lowered
RUBISCO contents. These novel organisms are especially adapted to
thrive in cultivation with high CO.sub.2 levels in the medium,
allowing for the over-expression of other, rate limiting enzymes of
photosynthesis as well as enzymes encoding for other desirable
traits. Thus, these organisms are platforms for further
engineering.
[0015] In one embodiment the small subunit of RUBISCO is subjected
to RNAi suppression and in another it is subjected to antisense. In
yet another embodiment both large and small subunits are suppressed
by chloroplast transformation of the rbcLS gene cluster under the
control of a mutated promoter replacing the endogenous promoter and
genes.
[0016] In other embodiments DNA encoding other traits is either
engineered in tandem with the RUBISCO suppression simultaneously
(co-transformation) or subsequent to the engineering of partial
RUBISCO suppression. In such embodiments algae or cyanobacteria
with reduced RUBISCO levels are used as a platform for further
engineering of other desired traits, with greater efficiency of
organism activity. These include genes encoding enzymes such as
fructose-1,6-bisphosphate aldolase (ALD), chloroplast
triosephosphate isomerase (TPI) or acetyl CoA carboxylase (ACCase)
that enhance sink capacity to utilize fixed carbon dioxide.
Conversely, other transgenic traits may be in the algae or
cyanobacteria prior to transformation for partial RUBISCO
suppression.
[0017] According to one embodiment the alga or cyanobacterium
transformed to express reduced RUBISCO content is also transformed
to express pharmaceutical or industrial proteins, such as human
insulin AAN39451 or AY138590 or thermostable phytase, such as
disclosed in U.S. Pat. No. 6,720,174. Other desired proteins to be
expressed in transgenic algae or cyanobacteria with reduced RUBISCO
content are storage proteins, such as 15 kDZein or BHL8. The
transgenic algae expressing reduced RUBISCO content may also be
transformed to express altered oil or lipid contents.
A SHORT DESCRIPTION OF THE DRAWINGS
[0018] FIG. 1. Map of the plasmid pSI-PDS-rbcS RNAi containing the
cassette designed to induce RNAi of C. reinhardtii RUBISCO small
subunit. An inverted repeat of the first 234 by of RbcS2 coding
region encoding the RUBISCO small subunit is cloned downstream to
the pds gene conferring resistance to the herbicide
fluorochloridone. The transgene is under the control of the
HSP70-RbcS2 promoter and RbcS2 terminator (taken from pDI103,
Sizova et al, 2001).
[0019] FIG. 2. Map of the plasmid pSI-rbcS-AS containing the
cassette designed to induce antisense of C. reinhardtii RUBISCO
small subunit and the psaD-Ble cassette conferring resistance to
the antibiotic Zeocin. The coding region of RbcS2 from C.
reinhardtii encoding the RUBISCO small subunit is cloned in
antisense orientation downstream to the HSP70-rbcS promoter.
DETAILED DESCRIPTION OF THE INVENTION
[0020] Algae and cyanobacteria with biotechnological utility are
chosen from among the following, non-exclusive list of
organisms.
List of Species:
[0021] Pavlova lutheri, Isochrysis CS-177, Nannochloropsis oculata
CS-179, Nannochloropsis like CS-246, Nannochloropsis salina CS-190,
Tetraselmis suecica, Tetraselmis chuii and Nannochloris sp.,
Chlamydomonas reinhardtii as representatives of all algae species.
The phylogeny of the algae is summarized in Table 1. Synechococcus
PCC7002, Synechococcus WH-7803, Thermosynechococcus elongaues BP-1
are used as representatives of all cyanobactrial species.
[0022] Algae and cyanobacteria with partially suppressed RUBISCO
are achieved by standard molecular biological procedures, as
outlined in numerous texts and papers. First, consensus sequences
of the large and small subunits of RUBISCO are used to "fish out"
the respective genes by low stringency PCR using a consensus
sequences chosen to have the least number of nucleotide variants.
Standard software is used to design degenerate primers according to
these consensus sequences. After fishing out fragments of the
genes, larger segments of the genes are obtained using the RACE
(rapid amplification of cDNA ends) technique. The resulting
sequences are used to design anti-sense and RNAi constructs that
are then inserted into respective cassettes and transformed into
the algae and cyanobacteria using techniques readily available to
those skilled in the art. Different cassettes are used having
different promoters such that a large variety of expression levels
are achieved, so that RUBISCO will be reduced by varying amounts. A
large number of transformation events were generated for each algal
species, and the best transformants chosen as described below.
[0023] The growth rates of the transformants are measured under
conditions of various levels of high CO.sub.2 (1%; 5%; 14%; 100%)
and those that appear best are rechecked in mini bioreactors and
pilot scale ponds to ascertain which have the best yield, under a
variety of environmental conditions and CO.sub.2
concentrations.
[0024] The best transformants of each organism can then be used as
platforms for inserting other genes into the algae or cyanobacteria
to optimize the production of valuable compounds. The algae come
from a large taxonomical cross section of species (Table 1)
[0025] The general approach for green algae is as follows: [0026]
1. Cloning of the algae RUBISCO small subunit (rbcS) cDNA in
antisense (AS) orientation under the control of a constitutive
promoter such as the rbcS promoter and 3'rbcS terminator,
downstream to a selectable marker. The selectable marker can be Sh
ble, which confers resistance to the antibiotic Zeocine, the pds
gene, which confers resistance to fluridone and fluorochloridone.
[0027] 2. Generation of an RNAi cassette (as described in detail in
Schroda, 2006) of the algae rbcS gene comprising a 300 by cDNA/cDNA
inverted repeat under the control of a constitutive promoter
downstream to a selectable marker described above.
[0028] The general approach for red lineage marine algae species
(Sub-kingdom Chromobiota, Table 1), is to replace the chloroplast
RUBISCO small or large subunit with a DNA construct containing the
same RUBISCO subunit gene controlled by a mutated promoter, use
antisense or with a chloroplast expression vector, and directly
transform the chloroplasts, as has been done with Chlamydomonas
(Franklin and Mayfield, 2004)
[0029] The general approach for cyanobacteria is as follows:
[0030] Cloning of the RUBISCO small subunit (rbcS) or large subunit
(rbcL) gene from a cyanobacteria species under the control of
mutated promoter and replacing the respective endogenous gene with
the cloned cassette using homologous recombination, as described in
Clerico et al. (2007).
[0031] The methodology used in the various steps of enabling the
invention is described here below:
[0032] Nucleic Acid Extraction Genomic DNA is isolated using either
the Stratagene (La Jolla, Calif., USA) DNA purification kit or a
combination of the QIAGEN (Valencia, Calif., USA) DNeasy plant mini
kit and phenol chloroform extraction method (Davies et al. 1992).
Total RNA is isolated using either the QIAGENS Plant RNeasy Kit or
the Trizol Reagent (Invitrogen, Carlsbad, Calif., USA).
[0033] RACE analysis The full length RbcS small and large subunits
from algae or cyanobacteria with unknown genomic sequences are
determined by 3' and 5' RACE and nested PCR using the First Choice
RLM-RACE Kit (Ambion, Austin, Tex., USA), as described by Liu and
Gorovsky (1993).
[0034] Transformation of Plasmid DNA
[0035] Transformation of Chlamydomonas Algae cells in 0.4 mL of
growth medium containing 5% PEG (polyethylene glycol MW6000) were
transformed with the plasmid from examples 1 and 2 by the glass
bead vortex method (Kindle, 1990). The transformation mixture was
then transferred to 50 mL of non-selective growth medium for
recovery and incubated for at least 18 h at 25.degree. C. in the
light. Cells were collected by centrifugation and plated at a
density of 10.sup.8 cells per Petri dish. Transformants were grown
on fresh TAP or SGII agar plates containing a selection agent for
7-10 days in 25.degree. C.
Transformation of Marine Algae
I. Electroporation
[0036] Fresh algal cultures are grown to mid exponential phase in
artificial sea water (ASW)+f/2 media. Cells are then harvested and
washed twice with fresh media. After resuspending the cells in 1/50
of the original volume, protoplasts are prepared by adding an equal
volume of 4% hemicellulase (Sigma) and 2% Driselase (Sigma) in ASW
and are incubated at 37.degree. C. for 4 hours. Protoplast
formation is tested by Calcofluor white (Fluka) staining.
Protoplasts are washed twice with ASW containing 0.6M D-mannitol
(Sigma) and 0.6M D-sorbitol (Sigma) and resuspended in the same
media, after which DNA is added (10 .mu.g linear DNA for each 100
.mu.l protoplasts). Protoplasts are transferred to cold
electroporation cuvettes and incubated on ice for 7 minutes, then
pulsed in a BTX ECM830 (Harvard Apparatus, Holliston, Mass., USA)
electroporation apparatus. A variety of pulses is usually applied,
ranging from 1000 to 1500 volts, 10-20 ms each pulse. Each cuvette
is pulsed 5-10 times. Immediately after pulsing the cuvettes are
placed on ice for 5 minutes and then the protoplasts are added to
250 .mu.l of fresh growth media (without selection). After
incubating the protoplasts for 24 hours in low light, 25.degree. C.
the cells are plated onto selective solid media and incubated under
normal growth conditions until single colonies appear.
II. Microporation
[0036] [0037] A fresh algal culture is grown to mid exponential
phase in ASW+f/2 media. A 10 mL sample of the culture is harvested,
washed twice with Dulbecco's phosphate buffered saline (DPBS,
Gibco) and resuspended in 250 .mu.l of buffer R (supplied by
Digital Bio, Seoul, Korea, the producer of the microporation
apparatus and kit). After adding 8 .mu.g linear DNA to every 100
.mu.l cells, the cells are pulsed. A variety of pulses is usually
needed, depending on the type of cells, ranging from 700 to 1700
volts, 10-40 ms pulse length; each sample is pulsed 1-5 times.
Immediately after pulsing the cells are transferred to 200 .mu.l
fresh growth media (without selection). After incubating for 24
hours in low light, 25.degree. C., the cells are plated onto
selective solid media and incubated under normal growth conditions
until single colonies appear.
III. Particle Bombardment
[0037] [0038] A fresh algal culture is grown to mid exponential
phase in ASW+f/2 media. 24 hours prior to bombardment cells are
harvested, washed twice with fresh ASW+f/2 and re-suspended in 1/10
of the original cell volume in ASW+f/2. 0.5 mL of each cell
suspension is spotted onto the center of a 55 mm Petri dish
containing 1.5% agar solidified ASW+f/2 media. Plates are left to
dry under normal growth conditions. Bombardment is carried out
using a BioRad PDS1000/He system according to the manufacturer's
(BioRad) instructions, using M10 tungsten powder for cells larger
than 2 microns in diameter, and tungsten powder comprised of
particles smaller than 0.6 microns (FW06, Canada Fujian Jinxin
Powder Metallurgy Co., Markham, ON, Canada) for smaller cells. The
tungsten is coated with linear DNA. 1100 or 1350 psi rupture discs
are used. All disposables are supplied by BioRad. After bombardment
the plates are incubated under normal growth conditions for 24
hours followed by transferring the cells onto selective solid media
and incubated under normal growth conditions until single colonies
appear. For chloroplast transformation, this method is carried out
in the same way, but the resulting transformants are screened for
the presence of the transgene in the chloroplast.
Transformation of Cyanobacteria
[0039] For transformation to Synechococcus PCC7002, cells are
cultured in 100 mL of BG-11+Turks Island Salts liquid medium
(http://www.crbip.pasteur.fr/fiches/fichemediumjsp?id=548) at
28.degree. C. under white fluorescent light and cultured to mid
exponential growth phase. To 1.0 mL of cell suspension containing
2.times.10.sup.8 cells, 0.5-1.0 .mu.g of donor DNA (in 10 mM Tris/1
mM EDTA, pH 8.0) is added, and the mixture is incubated in the dark
at 26.degree. C. overnight. After incubation for a further 6 h in
the light, the transformants are selected on BG-11+Turks Island
Salts 1.5% agar plates containing a selection agent until single
colonies appear.
There is no prior art known to us of previously transforming the
following species: Pavlova lutheri, Isochrysis CS-177,
Nannochloropsis oculata CS-179, Nannochloropsis like CS-246,
Nannochloropsis salina CS-190, Tetraselmis suecica, Tetraselmis
chuii and Nannochloris sp. nor has microporation been used
previously for transforming algae cyanobacteria or higher
plants.
[0040] RNA extraction, cDNA synthesis and quantitative RT-PCR
analysis Total RNA is isolated using either the QIAGENS Plant
RNeasy Kit or the Trizol Reagent (Invitrogen, Carlsbad, Calif.,
USA). cDNA is synthesized using 3 .mu.g total RNA as a template
using SuperscriptII kit (Invitrogen, Carlsbad, Calif., USA)
according to the manufacturer's instructions. Real-time
quantitative PCR reactions are preformed in an optical 96-well
plate using the ABI PRISM 7300 Sequence Detection System (Applied
Biosystems, Scoresby, Victoria, Australia) and SYBR Green I for
monitoring dsDNA synthesis. For all PCR reactions the following
standard thermal profile is used: 50.degree. C. for 2 min;
95.degree. C. for 15 min; 40 cycles of 95.degree. C. for 15 sec and
60.degree. C. for 1 min. In order to compare data from different
cDNA samples, C.sub.T (threshold cycle) values for all genes are
normalized to the C.sub.T values of Ubiquitin, or 16S rDNA for
algae and cyanobacteria, respectively, which are used as internal
references in all experiments. All primers are designed using the
Primer Express 2.0 software (Applied Biosystems, Foster City,
Calif., USA). The sequences of sense and antisense designed primers
correspond to two consecutive exons of the studied genes, excluding
any genomic DNA amplification. The real-time PCR data is analyzed
using the comparative CT-method with appropriate validation
experiments performed beforehand (Applied Biosystems, User Bulletin
#2, http://home.appliedbiosystems.com/). All experiments are
repeated at least three times with cDNA templates prepared from
three independent colonies of algae or cyanobacteria and every
reaction is set up in triplicates.
[0041] Protein extraction 1 to 10 mL cells at 5.times.10.sup.6
cell/mL are harvested and resuspended in 500 .mu.l extraction
buffer (50 mM Tris pH=7.0; 1 mM EDTA; 100 mM NaCl; 0.5% NP-40; and
protease inhibitor (Sigma cat# P9599). Then 100 .mu.l of glass
beads (425-600 .mu.m, Sigma) are added and cells are broken in a
bead beater (MP FastPrep-24, MP Biomedicals, Solon, Ohio, USA) for
20 sec. The tube content is centrifuged for 15 min, 13000.times.g,
at 4.degree. C. The supernatant is removed to new vial.
[0042] Protein separation by PAGE and western analysis Extracted
proteins are separated on a 4-20% gradient SDS-PAGE (Gene
Bio-Application Ltd., Kfar Hanagid, Israel, at 160V for 1 hr. They
were then either stained by Coomassie (Sigma) or blotted onto PVDF
(Millipore, Billerica, Mass., USA) membranes for 1 h at 100 volts
in the transfer buffer (25 mM Tris, 192 mM glycine and 20%
methanol). The proteins are detected with the RbcL RUBISCO large
subunit, form I and form II antibody (Agrisera, Vannas, Sweden)
diluted to a ratio of 1:10000 in antibody incubation buffer (5%
skim milk, Difco). An alkaline phosphatase conjugated anti-rabbit
antibody (Millipore, Billerica, Mass., USA), at 1:10000 dilution in
the same buffer was used as a secondary antibody. Detection was
carried out using the standard alkaline phosphatase detection
procedure (Blake et al., 1984).
[0043] Physiological Assessment To assess physiological properties
of genetically modified algae compared with their relevant wild
type strains and other algal candidates we perform a set of
procedures that enable us to evaluate each strain. Initially, each
genetically modified strain is checked for the modified trait,
(reduced RUBISCO content). A screening process is established where
colonies of transgenic algae or cyanobacteria are allowed to grow
on solid media supplemented with selection reagent (an antibiotic
or herbicide) to check if the desired trait has been established.
Next, the fastest growing colonies are picked and transferred to
liquid medium for further physiological evaluation.
This includes: [0044] 1. Growth rate [0045] 2. Photosynthetic
activity at ambient and high carbon dioxide concentrations [0046]
3. Respiration activity [0047] 4. Tolerance to a-biotic parameters
[0048] 5. Lipid content [0049] 6. Protein content An overall report
is generated for each strain that is used to estimate the
feasibility of using the strain.
[0050] Growth Rate Growth rates are measured using one or more of
the following techniques: [0051] Direct cell count [0052] Optical
density at a relevant wavelength (e.g. 730 nm) [0053]
Pigment/Chlorophyll concentration (where this method is applicable)
[0054] Percentage of packed volume
[0055] Photosynthetic Activity One of the important parameters
indicating the welfare of a photoautotrophic culture is its
photosynthetic capability. To measure this, one or more of several
methodologies are applied: [0056] Oxygen evolution--using Clark
Type electrodes. [0057] Variable fluorescence--using PAM (Pulse
Amplitude Modulated fluorometry)
[0058] Oxygen consumption in darkness is also evaluated in order to
estimate net photosynthetic potential of the algal culture. As part
of the photosynthetic evaluation several abiotic parameters that
potentially influence the physiological state of a culture are
followed. [0059] Light intensity tolerance (at a given cell
density) is evaluated. P/I (photosynthesis vs. irradiance) curves
are used to determine optimal light intensity per cell. [0060]
Performance at different CO.sub.2 levels (e.g. ambient; 1%; 5%;
14%; 100%). This is coupled with pH tolerance. [0061] Temperature
tolerance. Each culture is tested at optimal temp. In addition,
temperatures are raised temperatures to the highest points possible
without inhibiting other culture activities.
[0062] Growth conditions Cells of eukaryotic marine cultures and
transformants thereof are grown on artificial seawater medium
(Goyet, 1989) supplemented with f/2 (Guillard, 1962). Marine
cultures are grown at 18-20.degree. C. with a 16/8 h light/dark
period. Fresh water cultures (e.g. the diploid wild-type
Chlamydomonas reinhardtii) and transformants thereof are grown
photoautotrophically on liquid medium, using mineral medium as
previously described (Harris, 1989), with the addition of 5 mM
NaHCO.sub.3.sup.-, with continuous shaking and illumination at
22.degree. C. Marine cyanobactertial cultures and transformants
thereof are grown in BG11 medium BG11 (Stanier et al., 1971)
supplemented with Turks Island Salts and with 20 mM HEPES-NaOH
buffer pH 7.8
(http://www.crbip.pasteur.fr/fiches/fichemedium.jsp?id=548).
Cyanobacterial cultures are grown at 25.degree. C. where relevant
under continuous white light, with constant CO.sub.2-air
bubbling.
[0063] Growth Rate Estimation Cells are harvested in the
logarithmic growth phase and re-suspended in fresh growth media.
Cultures are brought to a cell density corresponding to .about.3
.mu.g/mL chlorophyll a. Light intensity is optimized for each
culture and temperature is maintained at growth temperature
.+-.1.degree. C. Where required, cells are concentrated by
centrifugation (3000 g, 5 min) and re-suspended in fresh media. A
time-series sampling procedure is followed where a subsample of
each culture is collected and the number of cells per mL is
estimated. As well as direct counting, optical density at different
wavelengths, percentage of packed volume and chlorophyll
concentrations are also measured.
[0064] Photosynthetic Activity: Oxygen evolution Measurements of
O.sub.2 concentrations are performed using a Clark type O.sub.2
electrode (Pasco Scientific, Roseville, Calif., USA). Twenty mL of
cell suspension containing 15 .mu.g chlorophyll/mL are placed in
the O.sub.2 electrode chamber, at relevant temperature. Cells are
exposed to various light intensities and regimes (e.g. flashing
light). Incubations in darkness are performed in these air-tight
vessels to follow oxygen consumption in the dark.
[0065] Fluorescence measurements Electron transfer activity of
photosystem II is measured by pulse modulated fluorescence (PAM)
kinetics using PAM-101 (Walz, Effertlich, Germany). Light intensity
(measured at the surface of the chamber) of the modulated measuring
beam (at 1.6 kHz frequency) is 0.1 .mu.mol photons m.sup.-2
s.sup.-1. White actinic light is delivered at 50-1500 .mu.mol
photons m.sup.-2 s.sup.-1 as required in different experiments and
is used to assess steady state fluorescence (F.sub.s). Maximum
fluorescence (F.sub.m) is measured with saturating white light
pulses of 4000 .mu.mol photons m.sup.-2 s.sup.-1 for 1 s.
[0066] Additional Experiments [0067] Light intensity tolerance (at
a given cell density) is evaluated. P/I (photosynthesis vs.
irradiance) curves are used to determine optimal light intensity
per cell. Four mL of cell suspension containing 15 .mu.g
chlorophyll/mL are placed in the O.sub.2 electrode chamber, at
relevant temperatures and various light intensities. Oxygen
evolution rates are measured at each light intensity. [0068]
Performance at different CO.sub.2 levels (e.g. ambient; 1%; 5%;
14%; 100%). Growth rate estimations and photosynthetic activity
(methodology described above) are evaluated when cultures are
maintained at different CO.sub.2 levels. [0069] Temperature
tolerance. Each culture is tested at optimal temp. In addition, we
attempt to raise temperatures to the highest point possible without
inhibiting other culture activities. The invention is now described
by means of various non limiting examples using the above
methods:
Example 1
Generation of C. reinhardtii Expressing RNAi of RbcS2B Gene Under
the Control of the HSP70-rbcS2 Promoter
[0070] For generation of RNAi of rbcS2 (ACCESSION NO: X04472), a
774 by fragment (SEQ ID NO:1) corresponding to forward and reverse
orientation of nucleotides 1 to 234 of rbcS2 gene separated by 246
by spacer region comprised from the 3.sup.rd intron of the rbcS2
gene (REGION: 1947.2184), was custom synthesized by DNA2.0 Inc,
(Menlo Park, Calif., USA). The 774 by region (SEQ OD NO:1) was then
cloned into BamHI restriction site in plasmid pSI-PDS downstream to
the pds gene, generating the plasmid pSI-PDS rbcS RNAi (FIG.
1).
[0071] The plasmid was transformed to C. reinhardtii CW15 strain
(CC-400) and transfromants were selected on SGII medium
supplemented with 3.times.10.sup.7 M fluorochloridone (FCD). FCD
resistant colonies were transferred to liquid media for DNA and
protein extraction. Tetraselmis suecica, Tetraselmis chuii and
Nannochloris sp are transformed with the above cassette using to
the transformation methods described above. Total proteins are
separated on 4-20% gradient SDS-PAGE (Geba, Israel) and stained
with Coomassie blue or transferred to PVDF membranes (Millipore,
Billerica, Mass., USA) for western blot analysis using the anti
RbcL RUBISCO large subunit, form I and form II antibody (Agrisera,
Vannas, Sweden).
[0072] Colonies with reduced RUBISCO levels are further analyzed as
described in examples 5 to 7.
Example 2
Generation of C. reinhardtii Expressing the rbcS2 Gene in Antisense
Orientation Under the Control of the HSP70-rbcS2 Promoter
[0073] For the generation of plasmids containing the C. reinhardtii
rbcS2 gene in antisense orientation under the control of the
HSP70-rbcS2 promoter (FIG. 2), the 579 by fragment of the C.
reinhardtii rbcS2 gene was PCR amplified with primers BstBI-rbcS2B:
GCTTCGAATCAACGAGCGCCTCCATTTAC (SEQ ID NO:2), and XhoI-rbcS2 AS
GCCTCGAGATGGCCGCCGTCATTGCCAA (SEQ ID NO:3) containing the BstBI and
XhoI sites at their 5' and 3' regions, respectively, and was cloned
into pGEM-T vector (Promega, Madison, Wis., USA). The BstBI-XhoI
fragment was then introduced into the BstBI/XhoI sites of plasmid
pSI-PDS rbcS RNAi, replacing the pds-rbcS RNAi cassette (Example
1). A psaD-Ble fragment (comprising the Ble selectable marker (SEQ
ID NO: 4) under the control of the psaD promoter (SEQ ID NO:5),
excised from pGenD-Ble) was further ligated into the plasmid using
NotI restriction site. The resulting pSI-rbcS-AS plasmid was then
transformed to C. reinhardtii CW15 (CC-400) and transformants were
selected on TAP medium supplemented with 5 .mu.g/mL Zeocin.
Approximately 100 Zeocin resistant colonies were transferred to
liquid media for protein extraction and rbcS level analysis.
[0074] Tetraselmis suecica, Tetraselmis chuii and Nannochloris sp
are transformed with the above cassette using to the transformation
methods described above. Colonies with reduced RUBISCO levels are
further analyzed as described in examples 5 to 7.
Example 3
Generation of Cyanobacterial Transformants with Reduced Rubisco
Expression Levels
[0075] In order to reduce expression level of rbcL in the
cyanobacterium Synechococcus PCC7002, the native rbcL promoter is
replaced with a mutated one. The rbcL region (SEQ ID NO: 6) is
synthesized with random mutations in the promoter region
(nucleotides 1165-1638 in SEQ ID NO: 6) and a spectinomycin
resistance cassette upstream of the promoter. Resulting fragments
are then cloned into pGEM-T (Promega, Madison, Wis., USA) to create
a library of plasmids containing a myriad of mutated promoters. The
resulting library is transformed into Synechococcus PCC7002, and
following homologous recombination (that occurs naturally in
cyanobacteria) clones are screened for transformants with reduced
RUBISCO content.
Example 4
Chloroplast Transformation of Red Lineage Algae
[0076] To reduce rbcS expression level of red lineage marine algae,
the sequence of the algae chloroplast DNA is obtained using 454
sequencing (CD Genomics, Shirley, N.Y., USA). Then, a DNA fragment
containing the rbcS gene and its flanking regions is obtained by
PCR on DNA isolated from the marine algae. The rbcS coding sequence
is then cloned under a mutated rbcL promoter and rbcL terminator
together with a spectinomycin resistance gene cassette comprising
rbcL promoter, bacterial AAD gene (SEQ ID NO:7) and rbcL terminator
as described in Takahashi, (1991). This construct is then
transformed to the algae chloroplast DNA using particle bombardment
as described in the methods part, and according to Spectinomycin
resistant colonies are then selected and analyzed using PCR on
genomic DNA to confirm the homologous recombination. Positive
colonies are then selected for further analysis as described in
Examples 5-7.
Example 5
Demonstration that Transformed Algae and Cyanobacteria have Optimal
Photosynthesis at Elevated CO.sub.2
[0077] Cultures of reduced RUBISCO-content transformants of algae
and cyanobacteria are compared to those of their respective wild
type. While the latter reveal maximal photosynthesis rates at
concentrations of 0.03-1% CO.sub.2, transformed algal and
cyanobacterial cells exhibit maximal photosynthesis rates at
CO.sub.2 concentrations above 4%. The increased CO.sub.2
concentrations compensated for reduced RUBISCO contents.
Example 6
Demonstration that Transformed Algal and Cyanobacterial Strains
Cannot Compete with Wild Type Cultures at Ambient CO.sub.2
Concentrations
[0078] The algal and cyanobacterial transformants described above
function best under bioreactor and/or pond conditions at high
CO.sub.2 concentrations. An additional benefit arising from this
condition is that these strains cannot cope with natural occurring
conditions such as ambient CO.sub.2 concentration. Being currently
at 0.03% in the atmosphere, CO.sub.2 becomes a major limiting
factor for the transformants cultured with ambient carbon dioxide
levels. In order to demonstrate such growth limitation
reduced-RUBISCO-content transformants are co-cultured with
wild-type cells at ambient CO.sub.2 concentrations. A time-sequence
sampling protocol is followed and cells are collected from the
growth vessels. Cells are then transferred to plates for colony
isolation, then replicas are made of each colony. One plate
contains normal growth media while its duplicate contained a
selection factor (e.g. antibiotics/herbicides). This enables the
differentiation between wild-type cells and transformants, allowing
following wild-type cells outcompeting reduced RUBISCO content
transformants co-cultivated under ambient carbon dioxide.
Example 7
Demonstration that Transformed Algal and Cyanobacterial Strains
have Increased Levels of Photosynthesis when Sink-Enhancing Genes
are Transformed into These Strains
[0079] Reduced-RUBISCO-content transgenic algae and cyanobacteria
are further transformed with sink-enhancing genes. As was
previously demonstrated by Miyagawa et al., (2001), overexpression
of cyanobacteria fructose-1,6-/sedoheptulose-1,7-bisphosphatase
(FBP/SBPase) (SEQ ID NO:8) in tobacco enhances photosynthesis and
growth, is used. The reduced-RUBISCO-content.times.FBP/SBPase
transformants are compared with the reduced-RUBISCO-content
transformants alone under conditions of 14% CO.sub.2. Oxygen
evolution is followed as an indication for photoautotrophic
assimilation, and higher oxygen production rates are observed with
the reduced-RUBISCO-content.times.FBP/SBPase transformants. This
implies higher Ci assimilation rates, and therefore suggests
enhanced energy harvesting even at when RUBISCO levels are
reduced.
Growth Rate Estimation
[0080] Cultures of Reduced-RUBISCO-Content (RRC) transformants of
green algae (Tetraselmis suecica, Tetraselmis chuii, Nannochloris
sp. and Chlamydomonas reinhardtii) are compared to those of their
respective wild type. Wild type cells reveal a
saturation-curve-like pattern where growth rates increase with
increasing CO.sub.2 concentrations. At ambient CO.sub.2
concentrations, reduced-RUBISCO-content cells exhibit reduced
growth rates. Their doubling times are reduced (at ambient
CO.sub.2) but increased with increasing CO.sub.2
concentrations.
Photosynthetic Activity:
Oxygen Evolution and PAM Fluorescence
[0081] Again, cultures of Reduced-RUBISCO-Content transformants of
green algae (Tetraselmis suecica, Tetraselmis chuii, Nannochloris
sp and Chlamydomonas reinhardtii) are compared to those of their
respective wild type. Wild-type cells reveal a typical P/I
saturation curve. In contrast, reduced-RUBISCO-content cells
exhibit a slight decrease in optimal light intensity, i.e.
saturation and inhibition occurs at lower light intensities. When
CO.sub.2 levels are raised to 14% or more, P/I curves of
reduced-RUBISCO-content cells return to normal parameters. The
increase of CO.sub.2 concentrations compensates for the reduced
RUBISCO content.
Lipid and Protein Contents
[0082] Finally, we test reduced-RUBISCO-content transformants for
lipid and protein content, and compare them to those of wild type
cells. Lipid and protein content are lower in the transformants
than in wild type cells at ambient CO.sub.2 concentrations.
However, when CO.sub.2 levels are increased to 14% or more, lipid
and protein contents exceed those of wild type cells.
REFERENCES
[0083] Blake M S, Johnston K H, Russell-Jones G J and Gotschlich E
C. (1984) A rapid, sensitive method for detection of alkaline
phosphatase-conjugated anti-antibody on Western blots. Anal Biochem
136:175-9. [0084] Clerico E M, Ditty J L, Golden S S (2007)
Specialized techniques for site-directed mutagenesis in
cyanobacteria. Methods Mol Biol 362: 155-171. [0085] Deng M D,
Coleman J R (1999) Ethanol synthesis by genetic engineering in
cyanobacteria. Appl Environ Microbiol 65:523-528 [0086] Falkowski,
P G and Raven J A (1997) Aquatic Photosynthesis. Blackwell Science.
Malden, Mass. 373, 705-509. [0087] Franklin S E and Mayfield S P.
(2004) Prospects for molecular farming in the green alga
Chlamydomonas reinhardtii. Curr Opin Plant Biol, 7:159-165. [0088]
Grzebyk, D., Schofield O., Falkowski P., and J. Bernhard (2003) The
Mesozoic radiation of eukaryotic algae: the portable plastid
hypothesis. J Phycol 39:259-267 [0089] Harris, E. (1989). The
Chlamydomonas Sourcebook: a Comprehensive Guide to Biology and
Laboratory Use, Academic Press. [0090] Helman, Y., Tchernov, D.,
Reinhold, L., Shibata, M., Ogawa, T., Schwarz, R., Ohad, I. and
Kaplan, A. (2003) Genes encoding A-type flavoproteins are essential
for photoreduction of O.sub.2 in cyanobacteria. Curr Biol 13:
230-235 [0091] Huntley M. E. and Redalje, D. G. (2007). CO.sub.2
mitigation and renewable oil from photosynthetic microbes: A new
appraisal, Mitig. Adapt. Strateg. Glob. Change 12, 573-608. [0092]
Kang R J, Shi D J, Cong W, Ma W M, Cai Z L, Ouyang F. (2005)
Effects of co-expression of two higher plants genes ALD and TPI in
Anabaena sp. PCC7120 on photosynthetic CO.sub.2 fixation. Enzym
Microb Tech 36: 600-604. [0093] Kindle K L (1990) High-frequency
nuclear transformation of Chlamydomonas reinhardtii. PNAS 87:1228.
[0094] Liu X, and Gorovsky M A (1993) Mapping the 5' and 3' ends of
Tetrahymena thermophila mRNAs using RNA ligase mediated
amplification of cDNA ends (RLM-RACE). Nucl Acids Res 21:
4954-4960. [0095] Lumbreras V, Stevens D. and, Purton S (1998)
Efficient foreign gene expression in Chlamydomonas reinhardtii
mediated by an endogenous intron. Plant J 14: 441-447. [0096] Ma, V
M, Wei, L, Wang, Q, Shi, D and Chen, H. (2007) Increased activity
of the non-regulated enzymes fructose-1,6-bisphosphate aldolase and
triosephosphate isomerase in Anabaena sp strain PCC 7120 increases
photosynthetic yield, J Appl Phycol 19:207-213. [0097] Miyagawa, Y.
Tamoi, M. and Shigeoka. S. (2001) Overexpression of a
cyanobacterial fructose-1,6-/sedoheptulose-1,7 bisphosphatase in
tobacco enhances photosynthesis and growth. Nature 19: 965-969.
[0098] Murakami M. and Ikenouchi M. (1997) The biological CO.sub.2
fixation and utilization project by RITE (2)--Screening and
breeding of microalgae with high capability in fixing CO.sub.2.
Energy Conyers Mgmt. 38: S493-S497. [0099] Negoro, M, Hamansaki, A,
Ikuta, Y Makita, T, Hirayama, K. and Suzuki, S. (1993) Carbon
dioxide fixation by microalgae photosynthesis using actual flue gas
discharged from a boiler, 39: 643-653. [0100] Prentki P and Krisch
H M (1984) In vitro insertional mutagenesis with a selectable DNA
fragment. Gene 29: 303-313 [0101] Schroda M. (2006) RNA silencing
in Chlamydomonas: mechanisms and tools. Curr Genet. 49: 69-84
[0102] Sizova, I, Fuhrmann, M, and Hegemann, P. (2001) A
Streptomyces rimosus aphVIII gene coding for a new type
phosphotransferase provides stable antibiotic resistance to
Chlamydomonas reinhardtii. Gene 277: 221-229. [0103] Stanier, R Y,
Kunisawa, R, Mandel, M and Cohen-Bazire, G. (1971) Purification and
properties of unicellular blue-green algae (order Chroococcales).
Bacteriol. Rev. 35: 171-205. [0104] Y. Takahashi, M.
Goldschmidt-Clermont, S.-Y. Soen, L. G. Franzenl and J.-D. Rochaix.
(1991) Directed chloroplast transformation in Chiamydomonas
reinhardtii: insertional inactivation of the psaC gene encoding the
iron sulfur protein destabilizes photosystem I. EMBO J. 10:
2033-2040. [0105] Wyman, M, Gregolry, R P F, and Carr, N G. (1985)
Novel role for phycoerythrin in a marine cyanobacterium,
Synechochoccus strain DC2. Science 230: 818-820.
Sequence CWU 1
1
81774DNAartificial sequencechemically synthetized 1ggatcctcta
gagtcactca acatcttaaa atggccgccg tcattgccaa gtcctccgtc 60tccgcggccg
tggcccgccc ggcccgctcc agcgtgcgcc ccatggccgc gctgaagccc
120gccgtcaagg ccgcccccgt ggctgccccg gctcaggcca accagatgat
ggtctggacc 180ccggtcaaca acaagatgtt cgagaccttc tcctacctgc
cccccctgag cgacgagcag 240atcgccgccc aggtcgacta cattgtaagt
ctggcgagag cccgacgggt ccactgtggc 300actgggttag cttttggcac
acgggtccac tgtggcactg gttagcttgg caccgggaca 360gcgcctatct
caccgcgggg aactgacgca tacccctgct cgtgcttcag cacggaaaag
420caaggggccc aattccatct ttggtggttc tgtgcgctgg tgactgaacc
tcttctccct 480cccatttccc gtgcgcccgc agctgtacta aatgtagtcg
acctgggcgg cgatctgctc 540gtcgctcagg gggggcaggt aggagaaggt
ctcgaacatc ttgttgttga ccggggtcca 600gaccatcatc tggttggcct
gagccggggc agccacgggg gcggccttga cggcgggctt 660cagcgcggcc
atggggcgca cgctggagcg ggccgggcgg gccacggccg cggagacgga
720ggacttggca atgacggcgg ccattttaag atgttgagtg actctagagg atcc
774229DNAartificial sequencechemically synthetized 2gcttcgaatc
aacgagcgcc tccatttac 29328DNAartificial sequencechemically
synthetized 3gcctcgagat ggccgccgtc attgccaa 284375DNAPichia
pastorismisc_feature(1)..(375)bleomycin binding protein(Ble) gene
sequence 4atggccaagt tgaccagtgc cgttccggtg ctcaccgcgc gcgacgtcgc
cggagcggtc 60gagttctgga ccgaccggct cgggttctcc cgggacttcg tggaggacga
cttcgccggt 120gtggtccggg acgacgtgac cctgttcatc agcgcggtcc
aggaccaggt ggtgccggac 180aacaccctgg cctgggtgtg ggtgcgcggc
ctggacgagc tgtacgccga gtggtcggag 240gtcgtgtcca cgaacttccg
ggacgcctcc gggccggcca tgaccgagat cggcgagcag 300ccgtgggggc
gggagttcgc cctgcgcgac ccggccggca actgcgtgca cttcgtggcc
360gaggagcagg actga 3755822DNAChalmydomonas
sp.promoter(1)..(822)Chlamydomonas psaD promoter 5gcggccgcca
cacacctgcc cgtctgcctg acaggaagtg aacgcatgtc gagggaggcc 60tcaccaatcg
tcacacgagc cctcgtcaga aacacgtctc cgccacgctc tccctctcac
120ggccgacccc gcagcccttt tgccctttcc taggccaccg acaggaccca
ggcgctctca 180gcatgcctca acaacccgta ctcgtgccag cggtgccctt
gtgctggtga tcgcttggaa 240gcgcatgcga agacgaaggg gcggagcagg
cggcctggct gttcgaaggg ctcgccgcca 300gttcgggtgc ctttctccac
gcgcgcctcc acacctaccg atgcgtgaag gcaggcaaat 360gctcatgttt
gcccgaactc ggagtcctta aaaagccgct tcttgtcgtc gttccgagac
420atgttagcag atcgcagtgc cacctttcct gacgcgctcg gccccatatt
cggacgcaat 480tgtcatttgt agcacaattg gagcaaatct ggcgaggcag
taggctttta agttgcaagg 540cgagagagca aagtgggacg cggcgtgatt
attggtattt acgcgacggc ccggcgcgtt 600agcggccctt cccccaggcc
agggacgatt atgtatcaat attgttgcgt tcgggcactc 660gtgcgagggc
tcctgcgggc tggggagggg gatctgggaa ttggaggtac gaccgagatg
720gcttgctcgg ggggaggttt cctcgccgag caagccaggg ttaggtgttg
cgctcttgac 780tcgttgtgca ttctaggacc ccactgctac tcacaacaag cc
82263001DNAartificial sequencechemically synthetized 6tttcaacgag
ggcaggcatg tgccatacgt ggataccacc ggaagccaca ggcatggtgc 60cggggagaga
agcgtagtct tgggtgaaga atacaccgcg agaacgatct tcttcaacgt
120agtcttcacg catcaggtct acgaaaccga gggtggcggc gcgatcgcct
tcgagcttac 180caacaaccgt accggagtgg aggtggtcac caccagagag
gcggagacac ttagcgagaa 240cgcggaagtg aataccgtgg ttcttctgac
ggtcgattac cgcgtgcatt gcccggtgga 300tgtggagcag aacgccgtta
tcacgacacc acttcgcaag ggtagtattc gcagtgaaac 360caccagttaa
gaagtcgtgc atgatgatgg gagtgccgat ttccttagcg aattcagccc
420gcttgagcat ttcttcgcaa gtgccagcgg tgacgttaag gtagtgaccc
ttaacttcgt 480tggtttcagc ttgggatttt tcgatagctt cttgaacgaa
caggaagcga tcgcgccaac 540gcatgaaagg ctgagagttg atgttttcgt
catctttggt gaagtcaaga ccaccacgga 600gacattcata aaccgcacga
ccgtagttct tcgcagacag accgagcttc ggcttaatcg 660tacaaccgag
gagaggacga ccatacttgt tgaggaggtc acgctctaca gtgatcccgt
720ggggaggccc ttggtaagtt ttgattaacg caacggggaa gcggatatct
tcgaggcgca 780gggcacgcag cgctttaaaa ccgaatacgt taccaaccaa
ggaagtcaaa acgttggtta 840cagaaccttc ttcaaacaga tcgagggggt
aagcaacgaa acagaaatat tggttgtctt 900caccgggaac gggttcaaca
ttgtagcaac gacccttgta gcggtcgagg tcagttaaac 960catcggtcca
tacagtggtc caagtaccgg tagaagattc agccgcaaca gccgcagcac
1020attcttcggg ggggactcca ggttggggag tcatccggaa acaagcgagt
aagtcggtat 1080ctttcggggt gtaatcgggg gtgtagtaag tcaggcggta
gtcctgtaca ccggcattaa 1140acccagcaga tttggtctga accatgcggt
tttcctccag caaaaatgct tatctttaac 1200agacaaatac cagtaacggt
attgttggtc gaaaacttca aaaatcttac gttggcaaaa 1260ctgcttttta
aaattctgaa gattcaagtc ttatgacttt ctttaatctg tgggatatgt
1320taccacagcc tcgacttatt tttatctttt agcaacaaaa aaagattgct
tttgtttttt 1380gggctgatta gcatttctaa tgctgtttga tgggcctatt
ttacccttac aaaaatacct 1440aaaaaagcca taaaatcccg ctcgaattca
gccatgctac ctaatgagac attgggctaa 1500aaccgttttc tgtcgggatc
tttagagagg gaaagcgttc aaatgagatg aattaagtat 1560ttatgtttct
caacaatctc ctttaagaac tttaaacatt taattttcac tcaagcaatc
1620atgaaagttt tgtggggcta aggctcatct ggttgatttg gggtattgag
agaattttgg 1680tgagggaata gggtcattaa tagttgattg atataaactt
gcccgacaac tggtgttttt 1740tcgcccgatt ctagggattc ctttgattct
ggaaccgtcg gcatcacttc ggtgtttggt 1800gtttcagttg gaggggatcc
tgcttctggt gggggctgga cattgggacg attgctgctg 1860ctagtgggcg
atcgccctgg tggcgaaaag gttgtggcag tctggttagt tgtatcttct
1920gcctgccaag gatcgagggg ttgggttgtc gattgattcg cgggttttgg
cggttgagtc 1980tggtaagaag cggtggtttc ttggcgggac ggatcgccga
tgaggctttg gggcgggaga 2040attgcggcgg cggcgatcgc cgcttgaaat
agggtagagc cataacctaa gcaggcattt 2100tctcccactg agcattggcc
aatgatcagg cagcctgccc cgataatcgc gccggcatgg 2160atctcgatgt
tgccgccgtg ggcctggata atcgcacctg caccaataca agcaccagtg
2220gcgatcgcca cataattgcc ttcggttgct tgcagaataa caccgggggc
aataaccgca 2280cggggatgaa tccttacatc gccactaatt tgaatatctg
gatgggtaat tgcctggaaa 2340gtcacaatga ttctgtcaac ggtgattcaa
ttaatcacag gtggggtaag ggttggggga 2400tagacattcg ttttctcccc
cataacgaag tggtcgcgtt acacaaccta ggggcgttgg 2460ataatttcct
caagcacccg tcgtttagcc gcttcatcga caccaatcat gcggacatat
2520tcgccactgt gctcctggag acaaccttcg aggtgacgta aaacttctgc
ctcttgggtg 2580ctgtcaatgg tgccacaact actccaggac ttaacacgga
aacggcgctt atcggcgtgt 2640tctgttccaa tcttgtagcc ttgcatcaaa
agcgaacgga ctttagaaac cacatcccca 2700ctgagactcc cgctactgtg
acccccgaaa ccattgctgc ttggggctgc tttcgtgcct 2760cccgaaaaac
tactggttgc ggttgctgtc tggacaggcg cattgttgcc agggcgttgg
2820atgatgatct ctgcggcccg tgttttggag ttggggtcaa cggcgattaa
ctggacatat 2880tcgttgggga actgggcggc gatcgcctgg atatttgcca
aaatctgatt agcagaatga 2940ccctccacaa agcctgcccc tagccaagac
tgggttttaa aacggcgagt gctggcgtgt 3000t 30017792DNAEscherichia
colimisc_feature(1)..(792)aadA gene sequence 7atgagggaag cggtgatcgc
cgaagtatcg actcaactat cagaggtagt tggcgtcatc 60gagcgccatc tcgaaccgac
gttgctggcc gtacatttgt acggctccgc agtggatggc 120ggcctgaagc
cacacagtga tattgatttg ctggttacgg tgaccgtaag gcttgatgaa
180acaacgcggc gagctttgat caacgacctt ttggaaactt cggcttcccc
tggagagagc 240gagattctcc gcgctgtaga agtcaccatt gttgtgcacg
acgacatcat tccgtggcgt 300tatccagcta agcgcgaact gcaatttgga
gaatggcagc gcaatgacat tcttgcaggt 360atcttcgagc cagccacgat
cgacattgat ctggctatct tgctgacaaa agcaagagaa 420catagcgttg
ccttggtagg tccagcggcg gaggaactct ttgatccggt tcctgaacag
480gatctatttg aggcgctaaa tgaaacctta acgctatgga actcgccgcc
cgactgggct 540ggcgatgagc gaaatgtagt gcttacgttg tcccgcattt
ggtacagcgc agtaaccggc 600agaatcgcgc cgaaggatgt cgctgccgac
tgggcaatgg agcgcctgcc ggcccagtat 660cagcccgtca tacttgaagc
tagacaggct tatcttggac aagaagaaga tcgcttggcc 720tcgcgcgcag
atcagttgga agaatttgtt cactacgtga aaggcgagat caccaaggta
780gtcggcaaat aa 79281935DNAartificial sequencechemically
synthetized 8atggccgccg tcattgccaa gtcctccgtc tccgcggccg tggcccgccc
ggcccgctcc 60agcgtgcgcc ccatggccgc gctgaagccc gccgtcaagg ccgcccccgt
ggctgccccg 120gctcaggcca accagatgga gaagactatt ggcctggaga
tcattgaggt ggtggagcag 180gccgcgatcg cctccgctcg cctcatgggc
aagggcgaga agaacgaggc tgaccgcgtg 240gccgtggagg cgatgcgggt
gcgcatgaac caggtggaga tgctgggccg catcgtgatt 300ggcgagggcg
agcgcgacga ggcgcccatg ctgtatatcg gcgaggaggt gggcatctac
360cgcgacgcgg acaagcgcgc gggtgtgccc gccggcaagc tggtggagat
cgacattgcc 420gtggacccct gcgagggcac caacctgtgc gcgtacggcc
agccggggtc catggccgtc 480ctggccatca gcgagaaggg cggcctgttc
gcggcccccg acttctacat gaagaagctg 540gcggctcctc cggcggcgaa
gggcaaggtc gacattaaca agtcggccac ggagaacctg 600aagatcctgt
ccgagtgcct ggaccgggcc atcgatgagc tggtggtggt cgtgatggac
660atggccgccg tcattgccaa gtcctccgtc tccgcggccg tggcccgccc
ggcccgctcc 720agcgtgcgcc ccatggccgc gctgaagccc gccgtcaagg
ccgcccccgt ggctgccccg 780gctcaggcca accagatgga gaagactatt
ggcctggaga tcattgaggt ggtggagcag 840gccgcgatcg cctccgctcg
cctcatgggc aagggcgaga agaacgaggc tgaccgcgtg 900gccgtggagg
cgatgcgggt gcgcatgaac caggtggaga tgctgggccg catcgtgatt
960ggcgagggcg agcgcgacga ggcgcccatg ctgtatatcg gcgaggaggt
gggcatctac 1020cgcgacgcgg acaagcgcgc gggtgtgccc gccggcaagc
tggtggagat cgacattgcc 1080gtggacccct gcgagggcac caacctgtgc
gcgtacggcc agccggggtc catggccgtc 1140ctggccatca gcgagaaggg
cggcctgttc gcggcccccg acttctacat gaagaagctg 1200gcggctcctc
cggcggcgaa gggcaaggtc gacattaaca agtcggccac ggagaacctg
1260aagatcctgt ccgagtgcct ggaccgggcc atcgatgagc tggtggtggt
cgtgatggac 1320cggccgcgcc acaaggagct catccaagag atccgccagg
cgggtgcccg ggtgcgcctg 1380atcagcgacg gggacgtgag cgcggctatc
agctgcggct tcgcggggac caacacccac 1440gccctgatgg gcatcggcgc
cgctcctgag ggcgtgatta gcgccgcggc gatgcgctgc 1500ctgggcggcc
actttcaggg ccagctgatc tacgacccgg aggtggtgaa gacgggcctc
1560atcggcgagt cgcgcgagtc gaacatcgcc cggctgcagg agatggggat
cacggacccc 1620gaccgcgtgt acgatgctaa cgagctggct tcgggccagg
aggtcctctt cgccgcctgc 1680ggcatcaccc ccggcctgct gatggagggc
gtccgcttct tcaagggtgg cgcccggacc 1740cagagcctcg tcatttcctc
gcagtcgcgc acggcccgct tcgtggacac cgtccacatg 1800ttcgacgacg
tgaagaccgt gagcctgcgc ctggagtacc cctacgacgt gccggactac
1860gcgggctacc cttacgacgt ccccgattat gccggttcct acccgtacga
tgtgcccgac 1920tacgccgccc agtaa 1935
* * * * *
References