U.S. patent application number 12/550233 was filed with the patent office on 2010-03-25 for dutpase inhibitors.
This patent application is currently assigned to Medivir AB. Invention is credited to Ian Gilbert, Nils-Gunnar Johansson, Ganasan Kasinathan, Corinne Nguyen, Dolores Gonzales Pacanowska, Gian Filippo Ruda, Alessandro Schhipani.
Application Number | 20100075924 12/550233 |
Document ID | / |
Family ID | 31503550 |
Filed Date | 2010-03-25 |
United States Patent
Application |
20100075924 |
Kind Code |
A1 |
Gilbert; Ian ; et
al. |
March 25, 2010 |
DUTPASE INHIBITORS
Abstract
Deoxyuridine derivatives of the formula ##STR00001## where A is
O, S or CH.sub.2; B is O, S or CHR.sup.3; R.sup.1 is H, or various
substituents; R.sup.2 is H, F; R.sup.3 is H, F, OH, NH.sub.2; or
R.sup.2 and R.sup.3 together form a chemical bond; D is --NHCO--,
--CONH--, --O--, --C(.dbd.O)--, --CH.dbd.CH, --C.dbd.C--,
--NR.sup.5--; R.sup.4 is hydrogen or various substituents; R.sup.5
is H, C.sub.1-C.sub.4 alkyl, C.sub.1-C.sub.4 alkanoyl; E is Si or
C; R.sup.6, R.sup.7 and R.sup.8 are independently selected from
C.sub.1-C.sub.8 alkyl, C.sub.2-C.sub.8 alkenyl, C.sub.2-C.sub.8
alkynyl, or a stable monocyclic, bicyclic or tricyclic ring system
have utility in the prophylaxis o treatment of parasitic diseases
such as malaria
Inventors: |
Gilbert; Ian; (Gwent,
GB) ; Nguyen; Corinne; (Gwent, GB) ; Ruda;
Gian Filippo; (Gwent, GB) ; Schhipani;
Alessandro; (Gwent, GB) ; Kasinathan; Ganasan;
(Gwent, GB) ; Johansson; Nils-Gunnar; (Huddinge,
SE) ; Pacanowska; Dolores Gonzales; (Granada,
ES) |
Correspondence
Address: |
BIRCH STEWART KOLASCH & BIRCH
PO BOX 747
FALLS CHURCH
VA
22040-0747
US
|
Assignee: |
Medivir AB
Huddinge
SE
|
Family ID: |
31503550 |
Appl. No.: |
12/550233 |
Filed: |
August 28, 2009 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10585281 |
Oct 2, 2006 |
7601702 |
|
|
PCT/GB2005/050001 |
Jan 6, 2005 |
|
|
|
12550233 |
|
|
|
|
Current U.S.
Class: |
514/63 ;
514/252.1; 514/255.05; 544/229; 544/405; 544/408 |
Current CPC
Class: |
A61P 33/00 20180101;
A61P 33/06 20180101; Y02A 50/411 20180101; C07D 405/06 20130101;
Y02A 50/409 20180101; A61K 31/7072 20130101; C07D 239/54 20130101;
A61K 31/506 20130101; C07F 7/1804 20130101; A61K 31/505 20130101;
Y02A 50/30 20180101 |
Class at
Publication: |
514/63 ; 544/229;
544/405; 544/408; 514/255.05; 514/252.1 |
International
Class: |
A61K 31/695 20060101
A61K031/695; C07F 7/02 20060101 C07F007/02; C07D 405/04 20060101
C07D405/04; C07D 241/10 20060101 C07D241/10; A61K 31/4965 20060101
A61K031/4965; A61K 31/497 20060101 A61K031/497 |
Foreign Application Data
Date |
Code |
Application Number |
Jan 8, 2004 |
GB |
0400290.3 |
Claims
1. Use of a compound of formula I', in the manufacture of a
medicament for the treatment or prophylaxis of plasmodium
infections in mammals, including man. ##STR00059## where A is O, S
or CH.sub.2; B is O, S or CHR.sup.3; R.sup.1 is H, C.sub.1-C.sub.5
alkyl, C.sub.2-C.sub.5 alkenyl, C.sub.2-C.sub.5 alkynyl or a 5 or 6
membered, saturated or unsaturated ring containing 0 to 3
heteroatoms selected from N, O and S, the alkyl, alkenyl, alkynyl
or ring being independently optionally substituted with R.sup.4;
R.sup.2 is H, F; R.sup.3 is H, F, OH, NH.sub.2 or a
pharmaceutically acceptable ester, amide or ether thereof; or
R.sup.2 and R.sup.3 together form a chemical bond; D is --NHCO--,
--CONH--, --O--, --C(.dbd.O)--, --CH.dbd.CH, --C.dbd.C--,
--NR.sup.5--; R.sup.4 is independently selected from hydrogen,
halo, cyano, amino, nitro, carboxy, carbamoyl, hydroxy, oxo,
C.sub.1-C.sub.5 alkyl, C.sub.1-C.sub.5 haloalkyl, C.sub.1-C.sub.5
alkyloxy, C.sub.1-C.sub.5 alkanoyl, C.sub.1-C.sub.5 alkanoyloxy,
C.sub.1-C.sub.5 alkylthio, --N(C.sub.0-C.sub.3-alkyl).sub.2,
hydroxymethyl, aminomethyl, carboxymethyl;
--SO.sub.nN(C.sub.0-C.sub.3-alkyl),
--SO.sub.nC.sub.1-C.sub.5-alkyl, where n is 1 or 2; R.sup.5 is H,
C.sub.1-C.sub.4 alkyl, C.sub.1-C.sub.4 alkanoyl; E is Si or C;
R.sup.6, R.sup.7 and R.sup.8 are independently selected from
C.sub.1-C.sub.8 alkyl, C.sub.2-C.sub.8 alkenyl, C.sub.2-C.sub.8
alkynyl, or a stable monocyclic, bicyclic or tricyclic ring system
which is saturated or unsaturated in which each ring has 0 to 3
heteroatoms selected from N, O and S; R.sup.6, R.sup.7 and R.sup.8
are independently optionally substituted with R.sup.4; with the
proviso that if R.sup.3 is H, OH, F, NH.sub.2 or a bond, then at
least one of R.sup.6, R.sup.7 and/or R.sup.8 comprises an
unsaturated ring; or a pharmaceutically acceptable salts
thereof.
2. Use according to claim 1, wherein A is --O-- and B is
--CHR.sup.3--, or A is --O-- and B is --S--.
3. Use according to claim 1, wherein R.sup.2 and R.sup.3 form a
chemical bond.
4. Use according to claim 1, wherein R.sup.3 is OH, NH.sub.2 or
F.
5. Use according to claim 1, wherein R.sup.1 is H.
6. Use according to claim 1, wherein
C.sub.0-C.sub.3-alkylene-D-C.sub.0-C.sub.3-alkylene is
oxymethylene, oxyethylene or oxypropylene.
7. Use according to claim 1, wherein
C.sub.0-C.sub.3-alkylene-D-C.sub.0-C.sub.3-alkylene is
aminomethylene, aminoethylene or aminopropylene.
8. Use according to claim 1, wherein at least two of R.sup.6,
R.sup.7 and R.sup.8 have an aromatic nature.
9. Use according to claim 1, wherein R.sup.6 is optionally
substituted phenyl.
10. Use according to claim 9, wherein R.sup.8 is optionally
substituted phenyl or pyridyl.
11. Use according to claim 1, wherein E is C.
12. A compound of the formula I ##STR00060## where A is O, S or
CH.sub.2; B is O, S or CHR.sup.3; R.sup.1 is H, C.sub.1-C.sub.5
alkyl, C.sub.2-C.sub.5 alkenyl, C.sub.2-C.sub.5 alkynyl or a 5 or 6
membered, saturated or unsaturated ring containing 0 to 3
heteroatoms selected from N, O and S, the alkyl, alkenyl, alkynyl
or ring being independently optionally substituted with R.sup.4;
R.sup.2 is H, F; R.sup.3 is H, F, OH, NH.sub.2 or a
pharmaceutically acceptable ester, amide or ether thereof; or
R.sup.2 and R.sup.3 together form a chemical bond; D is ONHCO--,
--CONH--, --O--, --C(.dbd.O)--, --CH.dbd.CH, --C.dbd.C--,
--NR.sup.5--; R.sup.4 is independently selected from hydrogen,
halo, cyano, amino, nitro, carboxy, carbamoyl, hydroxy, oxo,
C.sub.1-C.sub.5 alkyl, C.sub.1-C.sub.5 haloalkyl, C.sub.1-C.sub.5
alkyloxy, C.sub.1-C.sub.5 alkanoyl, C.sub.1-C.sub.5 alkanoyloxy,
C.sub.1-C.sub.5 alkylthio, --N(C.sub.0-C.sub.3-alkyl).sub.2,
hydroxymethyl, aminomethyl, carboxymethyl;
--SO.sub.nN(C.sub.0-C.sub.3-alkyl),
--SO.sub.nC.sub.1-C.sub.5-alkyl, where n is 1 or 2; R.sup.5 is H,
C.sub.1-C.sub.4-alkyl, C.sub.1-C.sub.4-alkanoyl; E is Si or C;
R.sup.6 and R.sup.7 are independently a stable monocyclic, bicyclic
or tricyclic ring system which has an aromatic nature and wherein
each ring has 0 to 3 heteroatoms selected from N, O and S; R.sup.8
is C.sub.1-C.sub.8 alkyl, C.sub.2-C.sub.8 alkenyl, C.sub.2-C.sub.8
alkynyl, or a stable monocyclic, bicyclic or tricyclic ring system
which is saturated or unsaturated and in which each ring has 0 to 3
heteroatoms selected from N, O and S; R.sup.6, R.sup.7 and R.sup.8
are independently optionally substituted with R.sup.4; with the
proviso that if the group C.sub.0-C.sub.3alkyl-D-C.sub.0-C.sub.3
alkyl is --O--CH.sub.2--, then the group E(R6)(R7)(R8) is not
CPh.sub.3 (trityl), methoxylated trityl or tert.butyldiphenylsilyl;
and pharmaceutically acceptable salts thereof.
13. A compound according to claim 12, wherein A is --O-- and B is
--CHR.sup.3--, or A is --O and B is --S--.
14. A compound according to claim 12, wherein R.sup.2 and R.sup.3
form a chemical bond.
15. A compound according to claim 12, wherein R.sup.3 is OH,
NH.sub.2 or F.
16. A compound according to claim 12, wherein R.sup.1 is H.
17. A compound according to claim 12, wherein
C.sub.0-C.sub.3-alkylene-D-C.sub.0-C.sub.3-alkylene is
oxymethylene, oxyethylene or oxypropylene.
18. A compound according to claim 12, wherein
C.sub.0-C.sub.3-alkylene-D-C.sub.0-C.sub.3-alkylene is
aminomethylene, aminoethylene or aminopropylene.
19. A compound according to claim 12, wherein R.sup.6 is optionally
substituted phenyl.
20. A compound according to claim 19 wherein R.sup.7 is optionally
substituted phenyl or pyridyl.
21. A compound according to claim 12 wherein E is C.
22. A pharmaceutical composition comprising a compound as defined
in claim 12 and a pharmaceutically acceptable carrier or diluent
therefor.
23. Use of a compound as defined in claim 12 in the manufacture of
a medicament for the treatment or prophylaxis of parasite
infections in mammals, including man.
24. Use according to claim 23, wherein the parasite is a
trypanosome or Leishmania species.
Description
CROSS REFERENCES TO RELATED APPLICATIONS
[0001] This application is a Divisional of co-pending application
Ser. No. 10/585,281, filed on Jul. 3, 2006, which is a national
phase under 35 U.S.C. .sctn.371 of PCT International Application
No. PCT/GB/2005/050001 which has an international filing date of
Jan. 6, 2005, which designated the United States and on which
priority is claimed under 35 U.S.C. .sctn.120, the entire contents
of which are hereby incorporated by reference. This Divisional
application claims priority under 35 U.S.C. .sctn.119 on
Application 0400290.3 filed in the United Kingdom on Jan. 8, 2004,
the entire contents of which are hereby incorporated by
reference.
FIELD OF THE INVENTION
[0002] The present invention relates to pharmaceuticals active
against parasite dUTPase and methods for treating parasitical
infections, especially malaria, by administering such
compounds.
TECHNICAL BACKGROUND
[0003] Deoxyuridine triphosphate nucleotidohydrolase (dUTPase) E.C.
3.6.1.23 is an ubiquitous enzyme which hydrolyzes deoxyuridine
triphosphate (dUTP) to deoxyuridine monophosphate (dUMP) and
pyrophosphate, typically in the presence of magnesium ions. This
reaction is thought to occur primarily to limit pools of
intracellular dUTP in order to prevent significant uridine
incorporation into DNA during replication and repair. A second role
of dUTPase is to provide substrate (dUMP) for the de novo synthesis
of thymidylate.
[0004] Two groups of researchers, McIntosh et al., PNAS,
89:8020-8024 (1992) and Strahler et al., PNAS, 90:4991-4995 (1993),
have reportedly isolated the trimeric human dUTPase enzyme and
characterized the enzyme by its cDNA and amino acid sequences.
[0005] McIntosh reported a cDNA of 526 base pairs containing an ORF
which encoded a protein of 141 amino acids and a 3 f flanking
sequence following the ORF. Strahler reported the identical cDNA
and amino acid sequence as did McIntosh, with the exception of two
additional bases at the 51 end of the cDNA and a longer 3 f
flanking sequence. The human dUTPase reported by both groups was
found to have a high degree of homology with dUTPase from other
organisms including that from yeasts, bacteria and viruses.
Strahler further reported that human dUTPase exists in both,
phosphorylated and a non-phosphorylated forms.
[0006] International patent application no WO97/36916 discloses the
sequence of nuclear and mitochondrial isoforms of dUTPase.
[0007] In both prokaryotic and eukaryotic cell systems, dUTPase has
been clearly shown to be an essential enzyme, without which the
cell will die. Lack of dUTPase leads to elevated cellular dUTP
pools, resulting in an increased misincorporation of uridine into
DNA. In addition to prokaryotes and eukaryotes, a number of
viruses, such as herpes simplex, are known to encode a dUTPase
function.
[0008] International patent application no WO95/15332 proposes a
range of uridine di- and triphosphate analogues in which the oxygen
atoms between phosphate groups are replaced with methylene,
secondary amine or tertiary amine, and/or oxo functions on the
phosphate are replaced with sulphur. These compounds are postulated
as cytostatics for use against rapidly growing cancer cells and/or
antivirals against herpes. Substantially similar compounds are
disclosed in Zalud et al Adv. Exp. Med. Biol. 1995 370 135-138 and
Persson et al Bioiorg Med Biochem 1996 4 553-556. It should be
noted, however that these compounds have been primarily designed
for crystallographic purposes and the analysis of enzyme kinetics.
These compounds therefore do not possess physicochemical attributes
suggestive of a drug.
[0009] The present inventors have established that the substrate
specificity of the dUTPases of certain protozoal and bacterial
parasites of man differ from the corresponding human cellular and
mitochondrial enzymes to such an extent that a specific set of
inhibitor compounds can be prepared which selectively inhibit the
parasite dUTPase without substantially inhibiting the human
counterparts. Examples of such parasites include Plasmodium species
especially P. falciparum responsible for malaria, Mycobacterial
species, especially M. tuberculosum responsible for tuberculosis
and Leishmania spp.
[0010] Hidalgo-Zarco and Gonzalez-Pacanowska Current Protein and
Peptide Science, 2001, 2, 389-397 describe the isolation and
characterisation of trypanosomal dUTPases. In contrast to the
trimeric form of dUTPase shared by human and malarial enzymes, the
trypanosomal enzyme is a dimmer. Competitive inhibition of
Leishmania dUTPase was shown by the triphosphate substrate analogue
.alpha.-.beta.-imido-dUTP, whereas no inhibition of that parasite
was apparent in the case of
5'-O-(4-4'-dimethoxytrityl)-2'-deoxyuridine.
BRIEF DESCRIPTION OF THE INVENTION
[0011] In accordance with a first aspect of the invention there are
provided use of deoxyuridine derivatives of the formula I, in the
manufacture of a medicament for the treatment or prophylaxis of
parasitic infections, particularly plasmodium infections in
mammals, including man.
##STR00002##
[0012] where
[0013] A is O, S or CH.sub.2;
[0014] B is O, S or CHR.sup.3;
[0015] R.sup.1 is H, C.sub.1-C.sub.5 alkyl, C.sub.2-C.sub.5
alkenyl, C.sub.2-C.sub.5 alkynyl or a 5 or 6 membered, saturated or
unsaturated ring containing 0 to 3 heteroatoms selected from N, O
and S, the alkyl, alkenyl, alkynyl or ring is optionally
substituted with R.sup.4;
[0016] R.sup.2 is H or F;
[0017] R.sup.3 is H, F, OH, NH.sub.2 or a pharmaceutically
acceptable ester, amide or ether thereof; or
[0018] R.sup.2 and R.sup.3 together form a chemical bond;
[0019] D is --NHCO--, --CONH--, --O--, --C(.dbd.O)--, --CH.dbd.CH,
--C.dbd.C--, --NR.sup.5--,
[0020] R.sup.4 is independently hydrogen, halo, cyano, amino,
nitro, carboxy, carbamoyl, hydroxy, oxo, C.sub.1-C.sub.5 alkyl,
C.sub.1-C.sub.5 haloalkyl, C.sub.1-C.sub.5 alkyloxy,
C.sub.1-C.sub.5 alkanoyl, C.sub.1-C.sub.5 alkanoyloxy,
C.sub.1-C.sub.5 alkylthio, --N(C.sub.0-C.sub.3-alkyl).sub.2,
hydroxymethyl, aminomethyl, carboxymethyl;
--SO.sub.2N(C.sub.0-C.sub.3-alkyl),
--SO.sub.2C.sub.1-C.sub.5-alkyl, where n is 1 or 2;
[0021] R.sup.5 is H, C.sub.1-C.sub.3-alkyl,
C.sub.1-C.sub.3-alkanoyl;
[0022] E is Si or C;
[0023] R.sup.6, R.sup.7 and R.sup.8 are independently selected from
C.sub.1-C.sub.8 alkyl, C.sub.2-C.sub.8 alkenyl, C.sub.2-C.sub.8
alkynyl, or a stable monocyclic, bicyclic or tricyclic ring system
which is saturated or unsaturated in which each ring has 0 to 3
heteroatoms selected from N, O and S, wherein any the R.sup.6,
R.sup.7 and/or R.sup.8 group may be optionally substituted with
R.sup.4;
and pharmaceutically acceptable salts thereof.
[0024] According to a second aspect of the invention there are
provided novel compounds of the formula II
##STR00003##
[0025] where
[0026] A is O, S or CH.sub.2;
[0027] B is O, S or CHR.sup.3;
[0028] R.sup.1 is H, C.sub.1-C.sub.5 alkyl, C.sub.2-C.sub.5
alkenyl, C.sub.2-C.sub.5 alkynyl or a 5 or 6 membered, saturated or
unsaturated ring containing 0 to 3 heteroatoms selected from N, O
and S, the alkyl, alkenyl, alkynyl or ring is optionally
substituted with R.sup.4;
[0029] R.sup.2 is H or F;
[0030] R.sup.3 is H, F, OH, NH.sub.2 or a pharmaceutically
acceptable ester, amide or ether thereof; or
[0031] R.sup.2 and R.sup.3 together form a chemical bond;
[0032] D is --NHCO--, --CONH--, --O--, --C(.dbd.O)--, --CH.dbd.CH,
--C.dbd.C--, --NR.sup.5--,
[0033] R.sup.4 is independently hydrogen, halo, cyano, amino,
nitro, carboxy, carbamoyl, hydroxy, oxo, C.sub.1-C.sub.5 alkyl,
C.sub.1-C.sub.5 haloalkyl, C.sub.1-C.sub.5 alkyloxy,
C.sub.1-C.sub.5 alkanoyl, C.sub.1-C.sub.5 alkanoyloxy,
C.sub.1-C.sub.5 alkylthio, --N(C.sub.0-C.sub.3-alkyl).sub.2,
hydroxymethyl, aminomethyl, carboxymethyl;
--SO.sub.nN(C.sub.0-C.sub.3-alkyl), --SO.sub.nC.sub.1-C.sub.5
alkyl, where n is 1 or 2;
[0034] R.sup.5 is H, C.sub.1-C.sub.3 alkyl, C.sub.1-C.sub.3
alkanoyl;
[0035] E is Si or C;
[0036] R.sup.6 and R.sup.7 are independently selected from a stable
monocyclic, bicyclic or tricyclic ring system which has an aromatic
nature in which each ring has 0 to 3 heteroatoms selected from N, O
and S;
[0037] R.sup.8 selected from C.sub.1-C.sub.8 alkyl, C.sub.2-C.sub.8
alkenyl, C.sub.2-C.sub.8 alkynyl, or a stable monocyclic, bicyclic
or tricyclic ring system which is saturated or unsaturated in which
each ring has 0 to 3 heteroatoms selected from N, O and S;
wherein
[0038] R.sup.6, R.sup.7 and R.sup.8 group are optionally
substituted with R.sup.4;
[0039] with the proviso that if the group
C.sub.0-C.sub.3alkyl-D-C.sub.0-C.sub.3 alkyl is --O--CH.sub.2--,
then the group E(R.sup.6)(R.sup.7)(R.sup.8) is not trityl,
methoxylated trityl or tert.butyldiphenylsilyl;
[0040] or a pharmaceutically acceptable salt thereof.
[0041] The novel compounds of the invention are useful in methods
for the treatment or propylaxis, or in the manufacture of a
medicament for such treatment or prophylaxis, of parasitic
infections, such as Leishmania, trypansoma, human African
trypanosomiasis, Chagas disease or plasmodium (malaria).
[0042] The potency and selectivity of the compounds and methods of
the invention, which presuppose substantial lipophilicity at the 5'
position is surprising bearing in mind that the active site of the
dUTPase enzyme is intended to recognize and accommodate highly
polar, hydrophilic moieties, ie the triphosphorylated
nucleotides.
[0043] Conveniently, A is --O-- and B is --CHR.sup.3-- thus
defining a 2'-deoxyribose analogues.
[0044] Alternative preferred variants include those where A is
--O-- and B is --O--, or --S--, thus defining a dioxolane or
especially an oxathiolane derivative.
[0045] Other preferred variants include those wherein R.sup.2 and
R.sup.3 form a chemical bond and A is --O--, thus defining a
2'3'-dideoxy, didehydroribose derivative or R.sup.2 and R.sup.3 are
H, thus defining a 2',3'-dideoxyribose derivative.
[0046] Still further preferred variants include those wherein
R.sup.2 and R.sup.3 form a chemical bond and A is --CH.sub.2--,
thus defining a 2-cyclopentene derivative or those wherein R.sup.2
and R.sup.3 are H, thus defining a cyclopentane derivative.
[0047] It is currently preferred that R.sup.3 is H, NH.sub.2, OH or
F. An alternative, but currently less favoured, R.sup.3 is a
lipophilic ester such as straight or branched chain alkyl or benzyl
ester or an ether such as straight or branched chain alkyl or
benzyl ether or alkylated silyl function.
[0048] R.sup.1 is preferably a small substituent, most preferably
H.
[0049] Favoured C.sub.0-C.sub.3-alkylene-D-C.sub.0-C.sub.3-alkylene
configurations include aminomethylene, aminoethylene and
aminopropylene, methylaminomethylene, methylaminoethylene,
ethylaminomethylene, --(N-methyl)aminomethylene,
--(N-methyl)aminoethylene, --(N-methyl)aminopropylene and
methyl-(N-methyl)aminomethylene. Currently the most preferred is
-aminomethylene-. The order of the hetero atom and alkylene
moieties in the indicated groups as used herein corresponds to the
configuration of FIG. I or II as depicted above, that is
"aminomethylene" has the nitrogen atom adjacent E and the methylene
moiety proximal to the base.
[0050] Particularly preferred
C.sub.0-C.sub.3-alkylene-D-C.sub.0-C.sub.3-alkylene configurations
include --O--, oxymethylene, oxyethylene, oxypropylene
methyloxymethylene and methyloxyethylene. Currently the most
preferred in this series is -oxymethylene-.
[0051] Preferably at least one of R.sup.6, R.sup.7 and/or R.sup.8
has an aromatic nature, although this tends to be less important if
R.sup.3 has a lipophilic nature. Conveniently two of R.sup.6,
R.sup.7 and/or R.sup.8 have an aromatic nature and the invention
even embraces compounds wherein all three have an aromatic
nature.
[0052] Ring systems for R.sup.6, R.sup.7 and/or R.sup.8 are
typically bonded direct to E, but may optionally be bonded to E via
a methylene linker. For example R.sup.6 may be optionally
substituted benzyl, thereby representing phenyl bonded through a
methylene to E.
[0053] Ring systems for R.sup.6, R.sup.7 and/or R.sup.8 having an
aromatic nature include optionally substituted heteroaryls such as
furyl, thienyl, pyrrolyl, pyrazolyl, imidazolyl, pyridyl,
pyrimidinyl, pyridazinyl, oxazolyl, isoxazolyl, thiazolyl,
isothiazolyl, especially pyridyl; and optionally substituted
carbocycles such as phenyl. Ring systems having an aromatic nature
also include multi-ring systems wherein only one ring has an
aromatic nature such as indolinyl and ring systems wherein more
than one ring has an aromatic nature such as naphthyl or any of the
above heterocyclic rings fused to phenyl, such as
benzimidazolyl.
[0054] Convenient values for R.sup.6, R.sup.7 and/or R.sup.8
include heterocycles such as furyl, thienyl, pyranyl, pyrrolyl,
pyrrolinyl, pyrrolidinyl, pyrazolyl, pyrazolinyl, pyrazolidinyl,
imidazolyl, imidazolinyl, imidazolidinyl, pyridyl, piperidinyl,
pyrazinyl, piperazinyl, pyrimidinyl, pyridazinyl, oxazolyl,
oxazolidinyl, isoxazolyl, isoxazolidinyl, morpholinyl, thiazolyl,
thiazolidinyl, isothiazolyl, isothiazolidinyl, especially pyridyl,
and carbocycles such as cycloalkyl, cycloalkenyl and especially
phenyl. Alternative values for R.sup.6, R.sup.7 and/or R.sup.8
include straight or branched alkyl, including methyl, ethyl,
i-propyl and t-butyl.
[0055] The optional substituent(s) to R.sup.6, R.sup.7, and/or
R.sup.8 include 1 to 3, preferably 1 substituent per ring, selected
from halo, preferably fluoro, cyano (preferably cyano), amino,
nitro, carboxy, carbamoyl, hydroxy, oxo, C.sub.1-C.sub.5 alkyl,
preferably methyl or t-butyl, C.sub.1-C.sub.5 haloalkyl, preferably
trifluoromethyl, C.sub.1-C.sub.5 alkyloxy, preferably methoxy,
C.sub.1-C.sub.5 alkanoyl, preferably acetyl, C.sub.1-C.sub.5
alkanoyloxy, preferably acetoxy, C.sub.1-C.sub.5 alkylthio,
--N(C.sub.0-C.sub.3-alkyl).sub.2, preferably NHMe or NMe,
hydroxymethyl, aminomethyl, carboxymethyl;
--SO.sub.nN(C.sub.0-C.sub.3-alkyl) (n=1, 2), preferably
SO.sub.2NH.sub.2 or SO.sub.2NMe.sub.2 or
SO.sub.nC.sub.1-C.sub.5-alkyl, (n=1, 2) preferably sulphonylmethyl
or sulphinylmethyl.
[0056] Favoured R.sup.6(R.sup.7)(R.sup.8)-E-configurations include
--C(Ph).sub.3 (trityl), --CH(Ph).sub.2, --CH.sub.2Ph,
--Si(Ph).sub.2(t-Bu), 1,1-bis(4-methylphenyl)-1'-pyrenylmethyl,
where Ph is phenyl or phenyl substituted with R.sup.4.
[0057] Note, however, that the novel compounds of the invention
exclude by way of proviso certain compounds with common protecting
groups at the 5'-oxygen of the nucleoside, such as 5'-O-trityl,
methoxylated 5'-O-trityl or 5'-O-tert.butyldiphenylsilyl.
Accordingly 5'-O-(4',4'-dimethoxytrityl)-2'-deoxyuridine is outside
the scope of the novel compound aspect of the invention. This
exclusion of trityl and tBuPh.sub.2Si in the compound claims only
is not believed to be required in respect of other permutations of
C.sub.0-C.sub.3alkyl-D-C.sub.0-C.sub.3 alkyl, such as compounds
wherein D is N. The novel compounds of the invention will however
typically avoid conventional hydroxyl protecting groups (such as
those cited in Greene below), when
C.sub.0-C.sub.3alkyl-D-C.sub.0-C.sub.3 alkyl is --O--CH.sub.2--. It
will be appreciated, however, that the use/method of treatment
aspects of the invention include those compounds excluded from the
compound claims by proviso.
[0058] Compounds wherein E is carbon are currently favoured on
pharmacokinetic grounds, although compounds with E as Si have shown
advantageous potency and selectivity.
[0059] The compounds of the invention include a number of chiral
centres, and the invention extends to include racemates,
enantiomers and stereoisomers at each of these centres. For example
the ring carbon attached to the uracil N1 in Formula I may be in
the alpha (down) or preferably the beta (up) configuration. R.sub.2
as F in Formula I may be in the ribo (down) position although it is
currently preferred to have the arabino (up) position. It is
currently preferred that the ring carbon intermediate A and B in
Formula I projects the adjacent C.sub.0-C.sub.3 alkylene in the
beta configuration.
[0060] Compounds of the invention are generally at least 80%
preferably at least 90% such as 97% stereoisometrically pure at
chiral centres.
[0061] Additional aspects of the invention include a pharmaceutical
composition comprising a compound of the formula I in conjunction
with a pharmaceutically acceptable carrier or diluent therefore.
The invention further provides a method for the treatment or
prophylaxis of parasite infections, such as malaria, tuberculosis
or leishmaniasis, in man or a zoonose vector comprising the
administration of an effective amount of a compound of the formula
I to a patient in need thereof, or to the vector.
[0062] While it is possible for the active agent to be administered
alone, it is preferable to present it as part of a pharmaceutical
formulation. Such a formulation will comprise the above defined
active agent together with one or more acceptable carriers or
excipients and optionally other therapeutic ingredients. The
carrier(s) must be acceptable in the sense of being compatible with
the other ingredients of the formulation and not deleterious to the
recipient.
[0063] The formulations include those suitable for rectal, nasal,
topical (including buccal and sublingual), vaginal or parenteral
(including subcutaneous, intramuscular, intravenous and
intradermal) administration, but preferably the formulation is an
orally administered formulation. The formulations may conveniently
be presented in unit dosage form, e.g. tablets and sustained
release capsules, and may be prepared by any methods well known in
the art of pharmacy.
[0064] Such methods include the step of bringing into association
the above defined active agent with the carrier. In general, the
formulations are prepared by uniformly and intimately bringing into
association the active agent with liquid carriers or finely divided
solid carriers or both, and then if necessary shaping the product.
The invention extends to methods for preparing a pharmaceutical
composition comprising bringing a compound of Formula I or its
pharmaceutically acceptable salt in conjunction or association with
a pharmaceutically acceptable carrier or vehicle. If the
manufacture of pharmaceutical formulations involves intimate mixing
of pharmaceutical excipients and the active ingredient in salt
form, then it is often preferred to use excipients which are
non-basic in nature, i.e. either acidic or neutral.
[0065] Formulations for oral administration in the present
invention may be presented as discrete units such as capsules,
cachets or tablets each containing a predetermined amount of the
active agent; as a powder or granules; as a solution or a
suspension of the active agent in an aqueous liquid or a
non-aqueous liquid; or as an oil-in-water liquid emulsion or a
water in oil liquid emulsion and as a bolus etc.
[0066] With regard to compositions for oral administration (e.g.
tablets and capsules), the term suitable carrier includes vehicles
such as common excipients e.g. binding agents, for example syrup,
acacia, gelatin, sorbitol, tragacanth, polyvinylpyrrolidone
(Povidone), methylcellulose, ethylcellulose, sodium
carboxymethylcellulose, hydroxypropylmethyl cellulose, sucrose and
starch; fillers and carriers, for example corn starch, gelatin,
lactose, sucrose, microcrystalline cellulose, kaolin, mannitol,
dicalcium phosphate, sodium chloride and alginic acid; and
lubricants such as magnesium stearate, sodium stearate and other
metallic stearates, stearic acid, glycerol stearate, silicone
fluid, talc waxes, oils and colloidal silica. Flavouring agents
such as peppermint, oil of wintergreen, cherry flavouring or the
like can also be used. It may be desirable to add a colouring agent
to make the dosage form readily identifiable. Tablets may also be
coated by methods well known in the art.
[0067] A tablet may be made by compression or moulding, optionally
with one or more accessory ingredients. Compressed tablets may be
prepared by compressing in a suitable machine the active agent in a
free flowing form such as a powder or granules, optionally mixed
with a binder, lubricant, inert diluent, preservative,
surface-active or dispersing agent. Moulded tablets may be made by
moulding in a suitable machine a mixture of the powdered compound
moistened with an inert liquid diluent. The tablets may be
optionally be coated or scored and may be formulated so as to
provide slow or controlled release of the active agent.
[0068] Other formulations suitable for oral administration include
lozenges comprising the active agent in a flavoured base, usually
sucrose and acacia or tragacanth; pastilles comprising the active
agent in an inert base such as gelatin and glycerin, or sucrose and
acacia; and mouthwashes comprising the active agent in a suitable
liquid carrier.
[0069] Dosages are set in the conventional manner to take into
account the severity of the disease, the susceptibility of the
parasite strain, the size and metabolic health of the patient, the
mode and form of administration, concomitant medication and other
relevant factors. The compounds of the invention may be
administered at a daily dose generally in the range 0.1 to 200
mg/kg/day, advantageously, 0.5 to 100 mg/kg/day, more preferably 10
to 50 mg/kg/day, such as 10 to 25 mg/kg/day. A typical dosage rate
for a normal adult will be around 50 to 500 mg, for example 300 mg,
once or twice per day.
[0070] The compounds of formula I can form salts which form an
additional aspect of the invention. Appropriate pharmaceutically
acceptable salts of the compounds of formula I include salts of
organic acids, especially carboxylic acids, including but not
limited to acetate, trifluoroacetate, lactate, gluconate, citrate,
tartrate, maleate, malate, pantothenate, isethionate, adipate,
alginate, aspartate, benzoate, butyrate, digluconate,
cyclopentanate, glucoheptanate, glycerophosphate, oxalate,
heptanoate, hexanoate, fumarate, nicotinate, palmoate, pectinate,
3-phenylpropionate, picrate, pivalate, proprionate, tartrate,
lactobionate, pivolate, camphorate, undecanoate and succinate,
organic sulphonic acids such as methanesulphonate,
ethanesulphonate, 2-hydroxyethane sulphonate, camphorsulphonate,
2-napthalenesulphonate, benzenesulphonate,
p-chlorobenzenesulphonate and p-toluenesulphonate; and inorganic
acids such as hydrochloride, hydrobromide, hydroiodide, sulphate,
bisulphate, hemisulphate, thiocyanate, persulphate, phosphoric and
sulphonic acids.
[0071] Examples of monocyclic rings for R.sup.1 include
heterocycles such as furyl, thienyl, pyranyl, pyrrolyl, pyrrolinyl,
pyrrolidinyl, pyrazolyl, pyrazolinyl, pyrazolidinyl, imidazolyl,
imidazolinyl, imidazolidinyl, pyridyl, piperidinyl, pyrazinyl,
piperazinyl, pyrimidinyl, pyridazinyl, oxazolyl, oxazolidinyl,
isoxazolyl, isoxazolidinyl, morpholinyl, thiazolyl, thiazolidinyl,
isothiazolyl, isothiazolidinyl, especially pyridyl, and carbocycles
such as cycloalkyl, cycloalkenyl and phenyl.
[0072] Examples of monocyclic, bicyclic or tricyclic rings for
R.sup.6, R.sup.7 and/or R.sup.8 include heterocycles such as furyl,
thienyl, pyranyl, pyrrolyl, pyrrolinyl, pyrrolidinyl, pyrazolyl,
pyrazolinyl, pyrazolidinyl, imidazolyl, imidazolinyl,
imidazolidinyl, pyridyl, piperidinyl, pyrazinyl, piperazinyl,
pyrimidinyl, pyridazinyl, oxazolyl, oxazolidinyl, isoxazolyl,
isoxazolidinyl, morpholinyl, thiazolyl, thiazolidinyl,
isothiazolyl, isothiazolidinyl, thiadiazolyl, tetrazolyl,
triazolyl, and the like or bicyclic rings especially of the above
fused to a phenyl ring such as indolyl, quinolyl quinolinyl,
isoquinolinyl, benzimidazolyl, benzothiazolyl, benzoxazolyl,
benzotriazolyl, benzofuryl, benzothienyl etc. Additional rings
include xanthenyl (such as 9-xanthenyl, 9-alkylxanthenyl,
9-(9-alkyl)xanthenyl, 9-phenylxanthenyl, 9-(9-phenyl)xanthenyl,
9-heteroarylxanthenyl, 9-(9-heteroaryl)xanthenyl), dibenzosuberyl,
5-dibenzosuberyl, fluorenyl (such as 5-fluorenyl,
5-(5-alkyl)fluorenyl, 5-(5-phenyl)fluorenyl,
5-(5-heteroaryl)fluorenyl) and the like.
[0073] Examples of monocyclic, bicyclic or tricyclic ring systems
with an aromatic nature for R.sup.6, and/or R.sup.7 include
heteroaryls such as furyl, thienyl, pyrrolyl, pyrazolyl,
imidazolyl, pyridyl, pyrazinyl, pyrimidinyl, pyridazinyl, oxazolyl,
isoxazolyl, thiazolyl, isothiazolyl, thiadiazolyl, tetrazolyl,
triazolyl, and the like or bicyclic rings especially of the above
fused to a phenyl ring such as indolyl, quinolyl, quinolinyl,
isoquinolinyl, benzimidazolyl, benzothiazolyl, benzoxazolyl,
benzotriazolyl, benzofuryl, benzothienyl etc. Additional rings
include xanthenyl (such as 9-xanthenyl, 9-alkylxanthenyl,
9-(9-alkyl)xanthenyl, 9-phenylxanthenyl, 9-(9-phenyl)xanthenyl,
9-heteroarylxanthenyl, 9-(9-heteroaryl)xanthenyl), dibenzosuberyl,
5-dibenzosuberyl, fluorenyl (such as 5-fluorenyl,
5-(5-alkyl)fluorenyl, 5-(5-phenyl)fluorenyl,
5-(5-heteroaryl)fluorenyl) and the like.
[0074] Examples of carbocycles for R.sup.6, R.sup.7 and/or R.sup.8
include monocyclic rings such as phenyl, cyclohexenyl,
cyclopentenyl, cyclohexanyl, cyclopentanyl, bicyclic rings such as
indanyl, napthyl, and tricyclic rings such as adamantyl, and the
like.
[0075] The carbo or heterocyclic ring may be bonded via a carbon or
via a hetero atom, typically a nitrogen atom, such as N-piperidyl,
N-morpholinyl etc. Other examples of such ring systems may also be
found in J. Fletcher, O. Dermer, R. Fox, Nomenclature of Organic
Compounds, pp. 20-63 (1974).
[0076] The term "C.sub.1-C.sub.5 alkyl" includes such groups as
methyl, ethyl, n-propyl, isopropyl, n-butyl, s-butyl, t-butyl,
cyclopropyl, n-pentyl and the like with C.sub.1-C.sub.8 alkyl
further including n-hexyl, 3-methylpentyl, and the like.
[0077] The term "halo" and "halogen" refer to chloro, bromo, iodo,
and especially fluoro.
[0078] "C.sub.1-C.sub.5 alkoxy" refers to those groups such as
methoxy, ethoxy, propoxy, t-butoxy and the like.
[0079] "C.sub.2-C.sub.5 alkenyl" refers to those groups such as
vinyl, 1-propen-2-yl, 1-butene-4-yl, 1-pentene-5-yl, 1-butene-1-yl
and the like, with C.sub.2-C.sub.8 alkenyl further including
hex-3-enyl and the like.
[0080] "C.sub.1-C.sub.5 alkylthio" refers to those groups such as
methylthio, ethylthio, t-butylthio, and the like.
[0081] "C.sub.1-C.sub.5 alkanoyl" refers to groups such as acetyl,
propionyl, butyryl and the like.
[0082] "C.sub.1-C.sub.5 alkanoyloxy" refers to those groups such as
acetoxy, propionoxy, formyloxy, butyryloxy, and the like.
[0083] The term "C.sub.2-C.sub.8 alkenoxy" includes groups such as
ethenyloxy, propenyloxy, iso-butoxy ethenyl, and the like.
[0084] The term "C.sub.2-C.sub.5 alkynyl" includes groups such as
ethynyl, propynyl, butynyl, pentynyl, and the like with
C.sub.2-C.sub.8 alkynyl further including hexynyl and the like.
[0085] The term "halo C.sub.1-C.sub.5 alkyl" includes alkyls
substituted 1, 2 or 3 times by a halogen including groups such as
trifluoromethyl, fluoromethyl, 2-dichloroethyl, 2,2-difluoroethyl,
2,2,2-trifluoroethyl, 3,3-difluoropropyl, 1,1-2,2,2
pentafluoroethyl and the like.
[0086] The term --C.sub.0-C.sub.3-alkylene- as a bivalent in
expressions such as
--C.sub.0-C.sub.3-alkylene-D-C.sub.0-C.sub.3-alkylene includes a
bond (i.e C.sub.0), methylene (C.sub.1), ethylene (C.sub.2),
1,1-dimethyl-methylene (C.sub.3), propylene (C.sub.3) and the like,
with each --C.sub.0-C.sub.3-alkylene- being selected
independently.
[0087] The term (C.sub.0-C.sub.3-alkyl) in monovalent expressions
includes H (i.e C.sub.0), Me (C.sub.1), Et (C.sub.2), propyl (C3)
with each C.sub.0-C.sub.3-alkyl being selected independently.
Accordingly --N(C.sub.0-C.sub.3-alkyl).sub.2 includes --NH.sub.2,
--NHMe, NHEt NHPr, --N(Me).sub.2, N(Et).sub.2 etc,
--SO.sub.2N(C.sub.0-C.sub.3-alkyl).sub.2, includes
--SO.sub.2NH.sub.2, --SO.sub.2NHMe, --SO.sub.2N(Me).sub.2 etc
[0088] As used herein, "the esters, amides and ethers thereof"
refer to the appropriate derivatives of each of the preceding
hydroxyl or amino groups in the respective definition.
[0089] Representative esters thus include carboxylic acid esters in
which the non-carbonyl moiety of the carboxylic acid portion of the
ester grouping is selected from straight or branched chain alkyl
(for example, methyl, n-propyl, t-butyl, or n-butyl), cycloalkyl,
alkoxyalkyl (for example, methoxymethyl), aralkyl (for example
benzyl), aryloxyalkyl (for example, phenoxymethyl), aryl (for
example, phenyl, optionally substituted by, for example, halogen,
C.sub.1-4 alkyl, or C.sub.1-4 alkoxy) or amino); sulphonate esters,
such as alkyl- or aralkylsulphonyl (for example, methanesulphonyl);
amino acid esters (for example, L-valyl or L-isoleucyl); and mono-,
di-, or tri-phosphate esters. In such esters, unless otherwise
specified, any alkyl moiety present advantageously contains from 1
to 18 carbon atoms, particularly from 1 to 6 carbon atoms, more
particularly from 1 to 4 carbon atoms. Any cycloalkyl moiety
present in such esters advantageously contains from 3 to 6 carbon
atoms. Any aryl moiety present in such esters advantageously
comprises an optionally R.sup.4-substituted phenyl group.
[0090] Pharmaceutically acceptable esters thus include
C.sub.1-C.sub.22 fatty acid esters, such as acetyl, t-butyl or long
chain straight or branched unsaturated or omega-6 monounsaturated
fatty acids such as palmoyl, stearoyl and the like.
[0091] Alternative aryl or heteroaryl esters include benzoyl,
pyridylmethyloyl and the like any of which may be substituted with
R.sup.4, Preferred pharmaceutically acceptable esters include
aliphatic L-amino acid esters such as leucyl, isoleucyl and
especially valyl. Additional preferred amino acid esters include
the 2-O-AA-C.sub.3-C.sub.22 fatty acid esters described in WO99
09031, where AA is an aliphatic amino acid ester, especially those
derived from L-lactic acid and L-valyl.
[0092] Pharmaceutically acceptable ethers include straight or
branched chain saturated or omega 6 unsaturated C.sub.1-C.sub.22
alkyl ethers such as methyl ethers, t-butyl ethers or aryl or
heteroaryl ethers such as phenoxy, benzylether, pyridylmethyl
ether, any of which may be substituted with R.sup.4.
[0093] Alternative ethers include alkylated silyl functions such as
--Si(C.sub.1-C.sub.5-alkyl).sub.3 such as
--Si(t-Bu)(CH.sub.3).sub.2, or --Si(Ph).sub.2(t-Bu), C(Ph).sub.3
(trityl), --CH(Ph).sub.2,
--CH.sub.2Ph,1,1-bis(4-methylphenyl)-1'-pyrenylmethyl and the
like.
[0094] Pharmaceutically acceptable amides include those derived
from C.sub.1-C.sub.22 branched or straight chain aminoalkyl
optionally including 1 to 3 unsaturations and/or optionally
substituted with R.sup.4, or anilines or benzylamines. Preferred
amides include those formed from reaction of the amine with a
C.sub.1-C.sub.4 straight or branched chain alkanoic acid. Other
pharmaceutically acceptable amides of amine functions of R.sup.2 or
R.sup.11 correspond to the esters indicated above.
[0095] It is currently preferred that the ester, amide or ether is
lipophilic in nature.
[0096] Compounds of the invention are typically synthesized as
outlined below.
[0097] Scheme 1 depicts a method for alkylation of the 5'-position
of a nucleoside or a nucleoside analogue.
##STR00004##
[0098] Nucleoside derivative (1a) wherein A, B, R.sup.1 and R.sup.2
are as defined above for formula I and D is O or NH, can be reacted
with an alkylating agent of formula Ib wherein R.sup.6, R.sup.7,
R.sup.8 and E are as defined above for formula I and Lg is a
leaving group that can be replaced by the nucleophile D, in a
solvent like pyridine optionally in the presence of a catalyst such
as dimethylaminopyridine or in a solvent like dimethylformamide in
the presence of a catalyst like imidazole, to provide 5'-alkylated
nucleoside analogues (1c). Various alkylating agents (1b) are
available either commercially or in the literature, se for example
Greene, "Protective Groups in Organic Synthesis (John Wiley &
Sons, New York, 1981). For example, they can be prepared by
transforming the hydroxy group of the corresponding alcohol into a
leaving group such as a halide like chloride or bromide by
treatment with a halogenating agent such as acetyl bromide or
thionyl chloride or the like or they can be transformed into a
derivative of sulfonic acid like a mesyl, tosyl, triflate or the
like by treatment with for example the anhydride or acid chloride
of the desired sulfonic acid derivative. An example of a route to
alkylating agents is shown in scheme 2.
##STR00005##
[0099] Reaction of an electrophilic carbonyl compound like a keto
compound (2a) or any carboxylic acid derivative for instance an
ester or acid halide, and a suitable nucleophile for example a
Grignard reagent (2b) or an organolithium reagent, provides the
alcohol (2c). The formed hydroxy group can subsequently be
transformed into a leaving group as described above thus forming
the alkylating agent (1b). Examples of the above procedure are
described in the literature, se for example Hodges et al., J. Org.
Chem. 56, 1991, 449-452, and Jones et al., J. Med. Chem. 33, 1990,
416-419.
[0100] Compounds wherein the leaving group in the alkylating agent
(1b) is spaced by a C.sub.1-C.sub.3-alkylene chain, available
either commercially or in the literature, may also be used as
alkylating agents in scheme 1. An example of a route to a compound
containing a C.sub.2-alkylene chain is shown in scheme 3.
##STR00006##
[0101] A reaction performed with triphenylmethyl sodium (3a) and
ethylene oxide provides alcohol (3b). Subsequent transformation of
the hydroxy group into a leaving group for example as described
above provides alkylating agent (3c). Use of any other appropriate
electrophilic reagent for example formaldehyde, provides analogues
with other length of the C.sub.1-C.sub.3-alkyl chain. Se for
example Wooster et al., J. Amer. Chem. Soc., 60, 1938, 1666 and
McPhee et al., J. Amer. Chem. Soc. 65, 1943, 2177, 2180.
Alternatively, alkylating agents containing a C.sub.1-C.sub.3-alkyl
chain may be obtained by reduction of an appropriate acyl
derivative to the desired alcohol.
[0102] A suitable acylating agent like the acid chloride or
anhydride can be used to acylate the amino group of a
5'-aminonucleoside, thus providing compounds according to the
general formula I where D is --CONH--.
[0103] The 5'-substituent can also be introduced by way of a
Mitsunobu reaction of a desired alcohol and the 5'-unprotected
nucleoside derivative as illustrated in scheme 3A.
##STR00007##
[0104] Treatment of a desired optionally suitably protected alcohol
(3Aa) and a nucleoside derivative (3Ab) with triphenyl phosphine
and DIAD in a solvent like THF provides the nucleoside analogue
(3Ac).
[0105] An example of the introduction of an ether group at the
3'-position of the nucleoside analogue is shown in scheme 4.
##STR00008##
[0106] Treatment of a 5'-substituted nucleoside analogue (4a) with
a silylating agent for example tert-butyldimethylsilyl chloride in
a solvent like dimethylformamide in the presence of a catalyst like
imidazole, provides 3'-O-silylated derivatives (4b).
[0107] Other ether or ester groups can be introduced at the
3'-position by methods known in the art, for example by treating
the 3'-OH nucleoside with the desired alkylating or acylating agent
optionally in the presence of a suitable base, se for example
Greene, "Protective Groups in Organic Synthesis (John Wiley &
Sons, New York, 1981).
[0108] Nucleoside analogues used in the synthesis of compounds
according to the present invention are available either
commercially or in the literature or they can be prepared as
described herein. For example compound 1 wherein B is CH.sub.2F,
R.sup.1 and R.sup.2 are H and A and D are O i.e. FLU
(3'-fluoro-2',3'-dideoxyuridine) can be prepared in analogy with
the procedure described for FLT (Balzarini et al. BIochem.
Pharmacol. 37, 2847, 1988). The didehydro derivative d4U
(2',3'-didehydro-2',3'-dideoxyuridine) can be prepared in analogy
with the procedure described for d4T
(2',3'-didehydro-2',3'-dideoxythymidine, Stavudine, Balzarini et
al.; Mol. Pharmacol. 32, 162, 1987). 2'-Fluoro-2'deoxyarabino
furanosyluracil is conveniently prepared for example as described
by H. Howell in J. Org. Chem., 53, 85, 1988 and the corresponding
ribo derivative, 2'-fluoro-2'deoxyribofuranosyluracil can be
prepared as described for example by Mercer et al. in J. Med.
Chem., 30, 670-675, 1987.
[0109] 5'-aminonucleoside analogues, useful for the preparation of
compounds according to the general formula I wherein D is NH or
--CONH-- can be prepared from the corresponding 5'-alcohols by a
displacement-reduction sequence for example as shown in scheme
5.
##STR00009##
[0110] Nucleoside analogue 5a where Y is F or suitably protected OH
or NH.sub.2, can be reacted with triphenylphosphine in a solvent
like carbon tetrabromide followed by displacement of
triphenylphosphine oxide with azide ion to form 5b. Alternatively
the hydroxy group can be transformed into a leaving group such as a
halide like chloride or bromide or a derivative of sulphonic acid
such as a tosyl, mesyl or a triflyl group which is subsequently
displaced by azide ion. Reduction of the azide group for example by
catalytic hydrogenation over palladium on carbon, gives the amino
derivative 5c.
[0111] The procedures described in scheme 5 can be also applied to
carbocyclic uridine and thiouridine analogues providing compounds
useful for the preparation of compounds of the general formula I
wherein A is CH.sub.2 and S.
DETAILED DESCRIPTION OF THE EMBODIMENTS
[0112] Various aspects of the invention, including end product
inhibitors and intermediates towards those inhibitors will now be
described by way of illustration only with reference to the
following non-limiting examples. Note that the exemplified
intermediates, such as the acyclic side chain building blocks are
readily reacted with alternative bases to form additional compounds
of the invention.
Example 1
##STR00010##
[0113]
1-(5-Trityloxymethyl-2,5-dihydro-furan-2-yl)-1H-pyrimidine-2,4-dion-
e or 5'-O-trityl-2',3'-dideoxydidehydrouridine (1)
[0114] 2',3'-Dideoxy-didehydrouridine (0.30 g, 1.43 mmol) and
triphenylmethyl chloride (0.44 g, 1.57 mmol) was stirred in dry
pyridine (10 ml) at 50.degree. C. overnight under an atmosphere of
nitrogen. The reaction mixture was poured into ice-H.sub.2O (30 ml)
with vigorous stirring and filtered. The precipitate was dissolved
in EtOAc (50 ml) and the solution was washed with 0.5M HCl (20 ml),
H.sub.2O (20 ml), dried (Na.sub.2SO.sub.4) and reduced in vacuo to
yield a crude product, which was purified by gradient flash column
chromatography eluting with 0.fwdarw.3% MeOH/CHCl.sub.3 to yield
the title compound as white crystals (0.37 g, 58%).
[0115] .sup.1H NMR (300 MHz; MeOH): .delta. 3.56 (2H, m, 5'-H),
5.02 (1H, m, 4'-H), 5.08 (1H, m, 5-H), 5.93 (1H, m, 1'-H), 6.40
(1H, m, 2'-H), 7.09 (1H, m, 3'-H), 7.30-7.44 (15H, m, Ph-H), 7.87
(1H, d, J=8.1 Hz, 6-H);
[0116] .sup.13C NMR (75 MHz; MeOH): .delta. 64.82 (5'-CH.sub.2),
86.38 (1'-CH), 87.84 (a), 90.04 (4'-CH), 102.70 (5-CH), 126.79
(Ph-CH), 127.79 (2'-CH), 128.41 (Ph-CH), 129.20 (Ph-CH), 134.89
(3'-CH), 141.79 (6-CH), 143.49 (Ph-C), 151.04 (2-C), 159.95
(4-C);
[0117] MS (Cl/NH.sub.3, m/z); 470.2 (M+NH.sub.4.sup.+, 100%), 453.1
(M+H.sup.+, 20%);
[0118] HRMS (ES+ve., M+H): Calculated for
C.sub.28H.sub.24N.sub.2O.sub.4, requires 453.1814, found
453.1807.
[0119] IR.sub.vmax/cm.sup.-1 (KBr): 714 and 756 (Aromatic,
monosubstituted), 1681.0 (C.dbd.O) and 1692.3 (C.dbd.O); Mp:
68.degree. C., R.sub.f (10% MeOH/CHCl.sub.3): 0.30;
Example 2
##STR00011##
[0120] 5'-O-tert-butyldiphenylsilyl-2',3'-dideoxydidehydrouridine
(2)
[0121] 2'3'-dideoxy-didehydrouridine (0.30 g, 1.43 mmol) in dry DMF
(10 ml) were added drop-wise under an atmosphere of nitrogen, with
ice bath cooling, to a stirred solution of
tert-butyldiphenyllsilylchloride (0.41 ml, 1.57 mmol) and imidazole
(0.21 g, 3.14 mmol) in dry DMF (10 ml). The mixture was allowed to
warm to room temperature and stirred overnight.
[0122] H.sub.2O (10 ml) was added and the mixture was extracted
with CHCl.sub.3 (2.times.30 ml). The combined extracts were washed
with saturated aqueous NaHCO.sub.3 solution (10 ml) and H.sub.2O
(10 ml), dried (Na.sub.2SO.sub.4) and reduced in vacuo to obtain a
crude product, which was purified by gradient flash column
chromatography eluting with 0.fwdarw.3% MeOH/CHCl.sub.3 to yield
the title compound as colourless viscous oil (0.46 g, 73%).
[0123] .sup.1H NMR (300 MHz; MeOH): .delta. 1.15 [9H, s,
C(CH.sub.3).sub.3], 3.95 (1H, dd, J=2.9, 11.7 Hz, 5'-H), 4.06 (1H,
dd, J=2.9, 11.7 Hz, 5'-H), 4.97 (1H, m, 4'-H), 5.26 (1H, d, J=8.1
Hz, 5-H), 5.58 (1H, m, 1'-H), 6.38 (1H, m, 2'-H), 7.10 (1H, m,
3'-H), 7.34-7.55 (6H, m, Ph-CH), 7.66-7.81 (5H, m, Ph-H and
6-H).
[0124] .sup.13C NMR (75 MHz; MeOH): .delta. 19.81
[C(CH.sub.3).sub.3], 26.99 and 27.42 [C(CH.sub.3).sub.3], 65.40
(5'-CH.sub.2), 87.56 (1'-CH), 90.06 (4'-CH), 102.96 (5-CH), 126.96
(2'-CH), 128.41 (Ph-CH), 128.32 (Ph-CH), 128.12 (Ph-CH), 130.03
(Ph-CH), 130.47 (Ph-CH), 130.59 (Ph-CH), 132.78 (Ph-C), 133.46
(Ph-C), 134.99 (3'-CH), 135.25 (Ph-CH), 135.79 (Ph-CH) 135.99
(Ph-CH), 141.20 (6-CH), 150.99 (2-C), 163.45 (4-C);
[0125] MS (Cl/NH.sub.3., m/z); 449.1 (M+H.sup.+, 50%), 466.2
(M+NH.sub.4.sup.+, 100%);
[0126] HRMS (ES+ve., M+H.sup.+): Calculated for
C.sub.25H.sub.28N.sub.2O.sub.4Si, requires 449.1896, found
449.1894.
[0127] IR.sub.vmax/cm.sup.-1 (film): 1697.3 (C.dbd.O).
[0128] R.sub.f (10% MeOH/CHCl.sub.3): 0.73.
Example 3
##STR00012##
[0129] Diphenyl (pyridin-3-yl)methanol (3)
[0130] A solution of 3-bromopyridine (10 g, 0.063 mol) in dry THF
(200 mL)/hexane (50 mL) was cooled to -90.degree. C. To this cooled
solution was added n-BuLi (2.2 M, 32 mL, 0.063 mol) slowly and
allowed to stir for 30 min under N.sub.2 atmosphere. A solution of
benzophenone (11.5 g, 0.063 mol) in dry THF (50 mL) was added to
this at the same temperature over a period of 30 min. The reaction
mixture was warmed slowly to RT and allowed to stir another 3 h at
RT. The reaction mixture was cooled, quenched with water (200 mL)
and extracted with ethylacetate (2.times.100 mL). The organic layer
was dried, concentrated under vacuum and crude purified by column
chromatography over silica gel (30% ethyl acetate in petroleum
ether) to give the title product (3.3 g).
Example 4
##STR00013##
[0131] 5'-O-Tosyl-2'-deoxyuridine (4)
[0132] To an ice-cold solution of 2'-deoxyuridine (5 g, 0.0219 mol)
in dry pyridine (25 mL) tosyl chloride (5 g, 0.0263 mol) was added
portion wise with stirring. The reaction mixture was stirred at
0.degree. C. for 12 h. The reaction mixture was concentrated under
vacuum and the crude residue was washed with diethyl ether
(5.times.25 mL). The residue was further treated with water. The
solid precipitate formed was filtered, washed with water
(2.times.25 mL), diethyl ether (5.times.25 mL) and petroleum ether
(5.times.25 mL). The solid was dried under vacuum and used for next
reaction without any purification. Yield: 7.5 g, 89%.
[0133] TLC: CHCl.sub.3/MeOH, 4:1, R.sub.f=0.6
Example 5
##STR00014##
[0134] 5'-Azido-2',5'-dideoxyuridine (5)
[0135] To a solution of 5'-O-tosyl-2'-deoxyuridine (13.5 g, 0.035
mol) in dry DMF (90 mL) was added NaN.sub.3 (9.2 g, 0.141 mol) and
the reaction mixture was allowed to stir at 95.degree. C. for 12 h.
The reaction mixture was cooled, the solid residue was removed by
filtration and the filtrate was concentrated under vacuum to give
the crude product. The crude was purified by column chromatography
on silica gel (4% methanol in chloroform) which gave the title
product (5.2 g, 56%) as a white solid.
[0136] TLC: CHCl.sub.3/MeOH, 4:1, R.sub.f=0.45
Example 6
##STR00015##
[0137] 5'-Amino-2',5'-dideoxyuridine (6)
[0138] To a mixture of 5'-azido-2',5'-dideoxyuridine (5 g, 0.0197
mol) in methanol/water (150 mL, 1:1) was added Pd/C (0.25 g, 10%)
under N.sub.2 atmosphere and then hydrogenated for 4 h at RT. The
reaction mixture was filtered through bed of celite and the
filtrate was concentrated under vacuum. The solid obtained was
washed with 3% methanol in chloroform which gave the title product
(4.1 g, 89%) as an off-white solid.
[0139] TLC: CHCl.sub.3/MeOH, 4:1, R.sub.f=0.1.
Example 7
##STR00016##
[0140] 5'-O-Triisopropylsilyl-2'-deoxyuridine (7)
[0141] Imidazole (0.183 g, 2.69 mmol) was added to a solution of
2'-deoxyuridine (0.272 g, 1.19 mmol) in dry DMF (5 mL) under
nitrogen. The mixture was cooled in an ice-salt bath before
drop-wise addition of triisopropylsilyl chloride (0.28 mL, 1.31
mmol) via a syringe. The reaction mixture was kept at 0.degree. C.
for 3 h, allowed to warm up to room temperature and then stirred at
room temperature for 22 h. After addition of water (5 mL), the
crude mixture was extracted with CHCl.sub.3 (2.times.10 mL). The
organic layers were combined and dried over MgSO.sub.4. Removal of
the solvent under reduced pressure afforded a crude transparent oil
which was further purified by flash chromatography eluting the
column (ISOLUTE SI) a gradient of 0.fwdarw.10% CH.sub.3OH in
CHCl.sub.3. The title compound was obtained from the fractions with
R.sub.f=0.25 (10% CH.sub.3OH in CHCl.sub.3) as a crystalline white
solid (0.366 g, 74%). M.p. 152-153.degree. C.
[0142] .sup.1H NMR (300 MHz, CDCl.sub.3) .delta. 1.08 (21H, m,
Pr-H), 2.18 (1H, m, 2'-H), 2.49 (1H, m, 2'-H), 3.97 (2H, m, 5'-H),
4.08 (1H, m, 4'-H), 4.56 (1H, m, 3'-H), 5.70 (1H, d, J=8.1 Hz,
5-H), 6.38 (1H, t, J=6.2 Hz, 1'-H), 7.96 (1H, d, J=8.1 Hz, 6-H),
10.16 (1H, bs, 3-NH).
[0143] .sup.13C NMR (75 MHz, CDCl.sub.3) .delta. 12.7 (iPr-CH),
18.4 (iPr-CH.sub.3), 41.9 (2'-CH.sub.2), 63.8 (5'-CH.sub.2), 71.7
(3'-CH), 85.7 (1'-CH), 88.0 (4'-CH), 102.5 (5-CH), 140.9 (6-CH),
151.1 (2-C), 164.5 (4-C).
[0144] ES.sup.+ m/z (%) 790 ([2M+Na].sup.+, 10), 407 ([M+Na].sup.+,
100).
[0145] HRMS (ES.sup.+) Found [M+Na].sup.+407.1988;
C.sub.18H.sub.32N.sub.2O.sub.5SiNa.sup.+ requires 407.1973.
[0146] Anal. Calcd for C.sub.18H.sub.32N.sub.2O.sub.5Si (%) C,
56.22; H, 8.39; N, 7.28, found C, 56.07; H, 8.50; N, 7.18.
Example 8
##STR00017##
[0147] 5'-(4-pyridydiphenylmethyl)amino-2',5'-dideoxyuridine
(8)
[0148] 5'-Amino-2',5'-dideoxyuridine (0.108 g, 0.475 mmol) was
added to a solution of diphenyl(4-pyridyl)chloromethane
hydrochloride (0.150 g, 0.474 mmol), pyridine (3 mL) and Et.sub.3N
(0.12 mL, 0.862 mmol). The reaction mixture was heated at
40.degree. C. for 4 h then the temperature was increased to
70.degree. C. for 10 h. The crude solution was partitioned between
water (5 mL) and EtOAc (3.times.7 mL). The organic extracts were
combined, dried over Na.sub.2SO.sub.4 and concentrated in vacuo.
The brown solid obtained was taken in MeOH and the remaining
insoluble material was filtered off. The filtrate was concentrated
under reduced pressure and further purified by flash column
chromatography (ISOLUTE SI column) using a gradient elution of
0.fwdarw.8% MeOH in CHCl.sub.3. The fractions with R.sub.f=0.24
(10% MeOH/CHCl.sub.3) afforded the title compound as a pale yellow
solid (61 mg, 27%).
[0149] .sup.1H NMR (300 MHz, CD.sub.3OD) .delta. 2.15-2.60 (4H, m,
2',5'-H), 4.03 (1H, m, 3'-H or 4'-H), 4.18 (1H, m, 3'-H or 4'-H),
5.63 (1H, d, J=8.0 Hz, 5-H), 6.21 (1H, t, J=6.4 Hz, 1'-H),
7.20-7.48 (11H, m, 6-H and Ph-H), 7.59 (2H, d, J=5.9 Hz, 4''-H),
8.42 (2H, d, J=5.9 Hz, 5''-H).
[0150] .sup.13C NMR (75 MHz, CD.sub.3OD) .delta. 40.9
(2'-CH.sub.2), 47.6 (5'-CH.sub.2), 72.2 (2''-C), 73.3 (3'-CH), 87.1
(1'-CH or 4'-CH), 87.9 (1'-CH or 4'-CH), 103.4 (5-CH), 125.7
(4''-CH), 128.6 (Ph-CH), 129.7 (Ph-CH), 130.2 (Ph-CH), 130.3
(Ph-CH), 142.7 (6-CH), 145.8 (Ph-C), 146.1 (Ph-C), 150.2 (5''-CH),
152.4 (3''-C), 158.1 (2-C), 166.4 (4-C).
[0151] ES.sup.+ m/z (%) 963 ([2M+Na].sup.+, 13), 493 ([M+Na].sup.+,
84), 471 ([M+H].sup.+ , 13).
[0152] HRMS (ES.sup.+) Found [M+H].sup.+ 471.2033;
C.sub.27H.sub.27N.sub.4O.sub.4.sup.+ requires 471.2027.
[0153] M.p. 131-133.degree. C.
Example 9
##STR00018##
[0154] 5'-O-trityl-2'-deoxyuridine (9)
[0155] 2'-Deoxyuridine (1.00 g, 4.39 mmol) and
triphenylmethylchloride (1.34 g, 4.83 mmol) were stirred in dry
pyridine (20 ml) overnight at 50.degree. C. under an atmosphere of
nitrogen. The reaction mixture was then poured into ice-H.sub.2O
(100 ml) with vigorous stirring and filtered. The precipitate was
dissolved in EtOAc (100 ml) and the solution was washed with 0.5M
HCl (100 ml) and H.sub.2O (100 ml), dried (Na.sub.2SO.sub.4) and
reduced in vacuo. The residue was washed with toluene to leave the
title compound (1.99 g, 97%) as a pale yellow solid. For analytical
purposes, the compound was purified by gradient flash column
chromatography, eluting with 5.fwdarw.10% MeOH/CHCl.sub.3.
[0156] .sup.1H NMR (300 MHz; CDCl.sub.3): .delta. 2.34 (1H, m,
2'-H), 2.45 (1H, m, 2'-H), 3.51 (2H, ddd, J=3.5, 8.6, 10.6 Hz,
5'-H), 4.12 (1H, dd, J=3.6, 7.2 Hz, 4'-H), 4.64 (1H, m, 3'-H), 5.47
(1H, d, J=8.1 Hz, 5-H), 6.40 (1H, t, J=6.3 Hz, 1'H), 7.22-7.49
(15H, m, Ph-H), 7.86 (1H, d, J=8.1 Hz, 6-H), 9.37 (1H, s,
3--NH);
[0157] .sup.13C NMR (75 MHz; CDCl.sub.3): .delta. 41.60
(2'-CH.sub.2), 63.53 (5'-CH.sub.2), 71.84 (3'-CH), 85.49 (4'-CH),
86.43 (1'-CH), 88.03 (Ph.sub.3C), 127.92 (Ph-CH), 128.68 (Ph-CH),
129.49 (Ph-CH), 140.69 (6-CH), 143.67 (Ph-CH), 153.24 (2-C), 163.93
(4-C).
[0158] MS (AP.sup.+., m/z): 243 (Tr.sup.+, 100%); R.sub.f (10%
MeOH/CHCl.sub.3): 0.49;
Example 10
##STR00019##
[0160]
1-[4-(tert-Butyl-dimethyl-silanyloxy)-5-trityloxymethyl-tetrahydro--
furan-2-yl]-1H pyrimidine-2,4-dione or
3'-O-tert-Butylsilyl-5'-O-trityl-2'-deoxyuridine (10)
[0161] 5'-O-trityl-2'deoxyuridine (0.70 g, 1.49 mmol) in dry DMF (3
ml) was added drop-wise under an atmosphere of nitrogen, with ice
bath cooling, to a stirred solution of tert-butyldimethylsilyl
chloride (0.25 g, 1.65 mmol) and imidazole (0.22 g, 3.28 mmol) in
dry DMF (3 ml). The mixture was allowed to warm to room temperature
and stirred overnight. H.sub.2O (10 ml) was added (10 ml) and the
mixture was extracted with Et.sub.2O (2.times.50 ml). The combined
extracts were washed with saturated NaHCO.sub.3 (50 ml) and
H.sub.2O (50 ml), dried (Na.sub.2SO.sub.4) and reduced in vacuo. A
flash silica column eluting with 3% MeOH/CHCl.sub.3 gave the title
compound (0.65 g, 74%) as white foam.
[0162] .sup.1H NMR (300 MHz; CDCl.sub.3): .delta.-0.05 [3H, s,
Si(CH.sub.3).sub.2] and 0.00 [3H, s, Si(CH.sub.3).sub.2], 0.85 [9H,
s, C(CH.sub.3).sub.3], 2.12-2.20 (1H, m, 2'-H), 2.31-2.39 (1H, m,
2'-H), 3.33 (1H, dd, J=2.8, 10.7 Hz, 5'-H), 3.46 (1H, dd, J=2.9,
10.7 Hz, 5'-H), 3.92 (1H, dt, J=2.8, 4.4 Hz, 4'-H), 4.51 (1H, dd,
J=4.9, 10.9 Hz, 3'-H), 5.34 (1H, d, J=8.1 Hz, 5-H), 6.26 (1H, t,
J=6.0 Hz, 1'-H), 7.23-7.39 (15H, m, Ph-H), 7.85 (1H, d, J=8.1 Hz,
6-H), 9.11 (1H, s, 3--NH);
[0163] .sup.13C NMR (75 MHz; CDCl.sub.3): -4.49 and -4.20
(Si(CH.sub.3).sub.2), 18.37[C(CH.sub.3).sub.3], 22.06 and 26.17
[C(CH.sub.3).sub.3], 42.23 (2'-CH.sub.2), 62.27 (5'-CH.sub.2),
71.38 (3'-CH), 85.55 (4'-CH) 86.83 (1'-CH), 87.89 (Ph.sub.3C),
102.70 (5-CH), 127.91 (Ph-CH), 128.48 (Ph-CH), 129.15 (Ph-CH),
140.62 (6-CH), 143.59 (Ph-CH), 150.68 (2-C), 163.81 (4-C);
[0164] MS (AP.sup.+., m/z): 243 (Tr.sup.+, 50%), 341 (M-Tr.sup.+,
75%), 607 (M+Na.sup.+, 100%)
[0165] R.sub.f (3% MeOH/CHCl.sub.3): 0.33;
Example 11
##STR00020##
[0166] 5'-O-Triphenylsilyl-2'-deoxyuridine (11)
[0167] A solution of triphenylsilyl chloride (0.437 g, 1.48 mmol)
in dry pyridine (4 mL) was added drop-wise to a solution of
2'-deoxyuridine (0.278 g, 1.22 mmol) in dry pyridine (4 mL)
previously cooled in an ice-salt bath. The reaction mixture was
kept at 0.degree. C. for 1 h. The reaction was monitored by TLC
(10% CH.sub.3OH in CHCl.sub.3) and quenched with CH.sub.3OH (50 L).
The solvent was removed under reduced pressure to give a crude
yellow liquid which was further purified by silica gel column
chromatography (Isolute SI column) using a gradient elution of
0.fwdarw.10% CH.sub.3OH in CHCl.sub.3. The fractions with
R.sub.f=0.30 (10% CH.sub.3OH/CHCl.sub.3) were combined and
concentrated to yield the title compound as a white crystalline
solid (0.506 g, 85%).
[0168] .sup.1H NMR (300 MHz, CDCl.sub.3) .delta. 2.25 (1H, m,
2'-H), 2.44 (1H, m, 2'-H), 2.95 (1H, bs, 3'-OH), 3.93-4.27 (3H, m,
5'-H and 4'-H), 4.60 (1H, m, 3'-H), 5.19 (1H, d, J=8.2 Hz, 5-H),
6.41 (1H, t, J=6.4 Hz, 1'-H), 7.35-7.73 (15H, m, Ph-H), 7.80 (1H,
d, J=8.1 Hz, 6-H), 9.46 (1H, bs, 3-NH).
[0169] .sup.13C NMR (75 MHz, CDCl.sub.3) .delta. 41.6
(2'-CH.sub.2), 63.8 (5'-CH.sub.2), 71.7 (3'-CH), 85.3 (1'-CH), 87.3
(4'-CH), 102.7 (5-CH), 128.6 (Ph-CH), 131.1 (Ph-CH), 133.3 (Ph-C),
135.8 (Ph-CH), 140.5 (6-CH), 150.9 (2-C), 163.9 (4-C).
[0170] ES.sup.+ m/z (%) 509 ([M+Na].sup.+, 100).
[0171] ES.sup.+ m/z (%) 509 ([M+Na].sup.+, 78), 151 (100).
[0172] HRMS (ES.sup.+) Found [M+Na].sup.+509.1504;
C.sub.27H.sub.26N.sub.2O.sub.5Si requires 509.1503.
[0173] Anal. calcd for C.sub.27H.sub.26N.sub.2O.sub.5Si (%): 0.32
HCl C, 65.09; H, 5.32; N, 5.62 found: C, 65.01; H, 5.27; N,
5.62.
Example 12
##STR00021##
[0174] 5'-O-tert-Butyldiphenylsilyl-2'-deoxyuridine (12)
[0175] 2'-Deoxyuridine (0.530 g, 2.32 mmol) was dissolved in dry
DMF (5 mL) under nitrogen and the solution was cooled in an
ice-salt bath. A solution of tert-butyldiphenylsilyl chloride
(0.710 g, 2.58 mmol) and imidazole (0.342 g, 5.69 mmol) in dry DMF
(4 mL) was then added drop-wise. The reaction mixture was stirred
at 0.degree. C. for 2 h and then at room temperature for 15 h. The
reaction was quenched by addition of water (15 mL). The crude
mixture was extracted with CHCl.sub.3 (2.times.15 mL). The organic
layers were combined, dried over MgSO.sub.4 and concentrated in
vacuo to give a transparent oil (0.419 g). This oil was
chromatographed on a silica gel column (Isolute SI column) eluted
with a gradient of 0.fwdarw.10% CH.sub.3OH in CHCl.sub.3. The
fractions with R.sub.f=0.26 (10% CH.sub.3OH/CHCl.sub.3) were
gathered and concentrated to afford the title compound as a white
crystalline solid (0.823 g, 76%).
[0176] .sup.1H NMR (300 MHz, CDCl.sub.3) .delta. 1.14 (9H, m,
tBu-H), 2.27 (1H, m, 2'-H), 2.50 (1H, m, 2'-H), 2.69 (1H, bs,
3'-OH), 3.90 (1H, m, 4'-H), 4.05 (2H, m, 5'-H), 4.60 (1H, m, 3'-H),
5.52 (1H, d, J=8.1 Hz, 5-H), 6.41 (1H, t, J=6.4 Hz, 1'-H), 7.48
(6H, m, Ph-H), 7.70 (4H, m, Ph-H), 7.87 (1H, d, J=8.1 Hz, 6-H),
9.34 (1H, bs, 3--NH).
[0177] .sup.13C NMR (75 MHz, CDCl.sub.3) .delta. 19.7 (tBu-C), 27.4
(tBu-CH.sub.3), 41.7 (2'-CH.sub.2), 64.1 (5'-CH.sub.2), 71.9
(3'-CH), 85.4 (1'-CH), 87.5 (4'-CH), 102.6 (5-CH), 128.4 (Ph-CH),
128.5 (Ph-CH), 130.6 (Ph-CH), 132.7 (Ph-C), 133.1 (Ph-C), 135.8
(Ph-CH), 136.0 (Ph-CH), 140.5 (6-CH), 150.9 (2-C), 163.9 (4-C).
[0178] ES.sup.+ m/z (%) 489 ([M+Na].sup.+, 100).
[0179] Anal. calcd for C.sub.25H.sub.30N.sub.2O.sub.5Si 0.58 (%):
HCl C, 61.56; H, 6.32; N, 5.74, found C, 61.61; H, 6.23; N,
5.72.
Example 13
##STR00022##
[0180] 3',5'-O-bistertbutyldimethylsilyl-2'-deoxyuridine
[0181] A solution of t-butyl dimethylsilylchloride (2.18 g, 14.46
mmol) and imidazole (1.07 g, 28.92 mmol) in DMF (30 ml) was added
slowly (drop wise) to a stirred solution of 2'-deoxyuridine (3 g,
13.15 mmol) in dry DMF (40 ml), with ice-bath cooling at 0.degree.
C., under atmosphere of nitrogen.
[0182] After 2 hours, H.sub.2O (100 ml) was added and the mixture
was extracted with AcOEt (3.times.100 ml). The combined extracts
were washed with saturated NaHCO.sub.3 (2.times.100 ml), dried
(MgSO.sub.4) and concentrated. The residue was purified by flash
chromatography and the title compound was isolated as a white
amorphous solid from the fractions with Rf=0.65 (10% CH.sub.3OH in
CHCl.sub.3).
[0183] .sup.1H-NMR (300 MHz, CDCl.sub.3) .delta. 0.2 (s, 12H,
tBu[CH.sub.3].sub.2Si), 1.0 (s, 18H, tBu[CH.sub.3].sub.2Si), 2.5
(1H, m, 2'-H), 2.2 (1H, m, 2'-H), 3.06 (1H, d, J=5.0 Hz, 3'-H),
3.95 (1H, dd, J=11.5 Hz, 2.2 Hz, 5'-H), 4.01 (1H, dd, J=11.5, 2.6
Hz, 5'-H), 4.15 (1H, m, 4'-H), 5.78 (1H, d, J=8.23 Hz, 5-H), 6.45
(1H, t, J=6.95 Hz, 1'-H), 8.02 (1H, d, J=8.2 Hz, 6-H), 9.5 (1H, s,
3--NH).
[0184] .sup.13C-NMR (75 MHz, CDCl.sub.3) .delta. 163.9 (4-C), 150.9
(2-C), 140.8 (6-CH), 102.7 (5-CH), 87.9 (4'-CH), 85.8 (1'-CH), 72.5
(3'-CH), 63.7 (5'-CH.sub.2), 42.0 (2'-CH.sub.2), 26.3 (CH.sub.3),
18.8 (CH.sub.3).
Example 14
##STR00023##
[0185] 5'-Tritylamino-2',5'-dideoxyuridine (14)
[0186] 5'-Amino-2',5'-dideoxyuridine (0.200 g, 0.88 mmol) was taken
in dry pyridine (5 mL) and the mixture was sonicated for a few
minutes. Trityl chloride (0.278 g, 1.00 mmol) was added and the
reaction mixture was stirred at 50.degree. C. overnight. The
reaction was then quenched with water (20 mL). The crude mixture
was extracted with DCM (3.times.10 mL). The organic layers were
combined, washed with water (10 mL), dried over MgSO.sub.4 and
concentrated on the rotary evaporator. The resultant brown oil was
further purified by silica gel column chromatography (Isolute SI
column) using a gradient elution of 0.fwdarw.10% CH.sub.3OH in
CHCl.sub.3. The fractions with R.sub.f=0.28 (10%
CH.sub.3OH/CHCl.sub.3) were pooled and evaporated to dryness to
yield the title compound as a white solid (0.202 g, 49%).
[0187] .sup.1H NMR (300 MHz, CDCl.sub.3) .delta. 2.07 (2H, m,
2'-H), 2.28-2.53 (2H, m, 5'-H), 2.73 (1H, dd, J=3.5, 12.1 Hz,
1''--NH), 2.97 (1H, bs, 3'-OH), 4.19 (1H, m, 4'-H), 4.33 (1H, m,
3'-H), 5.72 (1H, d, J=8.1 Hz, 5-H), 6.36 (1H, t, J=6.4 Hz, 1'-H),
7.14 (1H, d, J=8.1 Hz, 6-H), 7.23-7.43 (9H, m, Ph-H), 7.57 (6H, m,
Ph-CH), 9.47 (1H, bs, 3-NH).
[0188] .sup.13C NMR (75 MHz, CDCl.sub.3) .delta. 40.8
(2'-CH.sub.2), 46.6 (5'-CH.sub.2), 71.1 (2''-C), 73.0 (3'-CH), 85.4
(1'-CH), 86.7 (4'-CH), 103.2 (5-CH), 127.0 (Ph-CH), 128.4 (Ph-CH),
129.0 (Ph-CH), 139.8 (6-CH), 145.8 (Ph-C), 150.7 (2-C), 163.7
(4-C).
[0189] ES.sup.+ m/z (%) 243 (Ph.sub.3C.sup.+, 100), 470
([M+H].sup.+ , 4), 492 ([M+Na].sup.+, 23).
[0190] HRMS (ES.sup.+) Found [M+H].sup.+ 470.2076;
C.sub.28H.sub.28N.sub.3O.sub.4 requires 470.2074.
[0191] M.p. 132-134.degree. C.
[0192] Anal calcd for C.sub.28H.sub.27N.sub.3O.sub.4 (%): 0.53 HCl
C 68.79; H, 5.68; N, 8.60 found: C, 68.79; H, 5.55; N, 8.59.
Example 15
##STR00024##
[0193]
3'-O-tertbutyldimethylsilyl-5'-Tritylamino-2',5'-dideoxyuridine
(15)
[0194] A solution of 5'-tritylamino-2',5'-dideoxyuridine (0.172 g,
0.37 mmol) in anhydrous DMF (2 mL) was added drop-wise to an ice
cold solution of tert-butyl dimethylsilyl chloride (68 mg, 0.45
mmol) and imidazole (60 mg, 0.88 mmol) in anhydrous DMF (2 mL). The
reaction mixture was stirred at 0.degree. C. for 2 h and at room
temperature for a further 20 h. It was then partitioned between
water (10 mL) and Et.sub.2O (2.times.20 mL). The combined organic
layers were washed with a saturated aqueous solution of NaHCO.sub.3
(15 mL), dried over MgSO.sub.4 and concentrated in vacuo. The
resultant white solid was further purified by column chromatography
(Isolute SI column) using a gradient elution of 0.fwdarw.10%
CH.sub.3OH in CHCl.sub.3. The fractions with R.sub.f=0.69 (10%
CH.sub.3OH/CHCl.sub.3) were pooled and evaporated to dryness to
yield the title compound as a white solid (154 mg, 72%).
[0195] .sup.1H NMR (300 MHz, CDCl.sub.3) .delta. 0.00-0.02 (6H,
2.times.s, Si(CH.sub.3).sub.2), 0.86 (9H, s, C(CH.sub.3).sub.3),
1.90 (2H, m, 2'-H), 2.11-2.35 (2H, m, 5'-H), 2.59 (1H, bd,
J.apprxeq.13 Hz, 1''-NH), 4.06 (2H, m, 3'-H and 4'-H), 5.65 (1H, d,
J=8.1 Hz, 5-H), 6.25 (1H, t, J=6.3 Hz, 1'-H), 7.07 (1H, d, J=8.1
Hz, 6-H), 7.14-7.37 (9H, m, Ph-H), 7.48 (6H, m,).
[0196] .sup.13C NMR (75 MHz, CDCl.sub.3) .delta.-4.4 (SiCH.sub.3),
-4.2 (SiCH.sub.3), 18.4 (C(CH.sub.3).sub.3), 26.1
(C(CH.sub.3).sub.3), 41.4 (2'-CH.sub.2), 46.5 (5'-CH.sub.2), 71.2
(2''-C), 73.3 (3'-CH), 85.6 (1'-CH), 87.3 (4'-CH), 103.1 (5-CH),
127.0 (Ph-CH), 128.4 (Ph-CH), 129.0 (Ph-CH), 139.7 (6-CH), 145.9
(Ph-C), 150.6 (2-C), 163.7 (4-C).
[0197] ES.sup.+ m/z (%) 584 ([M+H].sup.+), 606 ([M+Na].sup.+).
[0198] HRMS (ES.sup.+) Found [M+H].sup.+ 584.2938;
C.sub.34H.sub.42N.sub.3O.sub.4Si requires 584.2939.
Example 16
##STR00025##
[0199]
1-(4-Fluoro-5-trityloxymethyl-tetrahydro-furan-2-yl)2,3-dihydro-1H--
pyrimidin-4-one or 3'-Fluoro-5'-O-trityl-2',3'-dideoxyuridine
(16)
[0200] 3'-Fluoro-2',3'-dideoxyuridine (0.3 g, 1.30 mmol) and
triphenylmethyl chloride (0.44 g, 1.57 mmol) were stirred in dry
pyridine (20 ml) overnight at 50.degree. C. under an atmosphere of
nitrogen. The reaction mixture was then poured into ice-H.sub.2O
(50 ml) with vigorous stirring and filtered. The precipitate was
dissolved in EtOAc (50 ml) and the solution was washed with 0.5M
HCl (50 ml) and H.sub.2O (50 ml) dried (Na.sub.2SO.sub.4) and
reduced in vacuo to obtain a crude product, which was purified by
gradient flash column chromatography eluting with 2.fwdarw.6%
MeOH/CHCl.sub.3 to obtain the title compound as a white solid (0.48
g, 77%).
[0201] .sup.1H NMR (300 MHz; CDCl.sub.3): .delta. 2.27-2.50 (1H, m,
2'-H), 2.78-2.92 (1H, m, 2'-H), 3.53-3.63 (2H, m, 5'H), 4.41-4.51
(1H, d, J=27.3 Hz, 4'-H), 5.33-5.53 (2H, m, 3', 5-H), 6.50-6.55
(1H, m, 1'-H), 7.46 (15H, m, Ph-H), 7.80 (1H, d, J 8.1, 6-H);
[0202] .sup.13C NMR (75 MHz; CDCl.sub.3): .delta. 39.43 and 39.71
(2'-CH.sub.2), 63.75 and 63.89 (5'-CH.sub.2), 84.54 and 84.88
(4'-CH), 85.38 (1'-CH), 88.27 (Ph-C)--, 93.44 (Ph-CH), 95.80
(Ph-CH), J 178.48, 3'-CH), 103.08 (5-CH), 128.06 (Ph-CH), 128.58
(Ph-CH), 129.00 (Ph-CH), 140.18 (6-CH), 143.31 (Ph-C), 150.67
(2-C), 163.53 (4-C);
[0203] .sup.19F NMR (282 MHz; CDCl.sub.3): .delta. -174.26;
[0204] MS (Cl/NH.sub.3., m/z): 473.2 (M+H.sup.+, 50%), 490.3
(M+NH.sub.4.sup.+, 80%);
[0205] HRMS (EI., M.sup.+): Calculated for
C.sub.28H.sub.25N.sub.2O.sub.4F, requires 472.1798, found
472.1797.
[0206] IR.sub.vmax/cm.sup.-1 (KBr): 703 (s) and 763(s) (Aromatic,
monosubstituted), 1107.9 (C--F), 1689.3 (C.dbd.O) and 1702.3
(C.dbd.O). R.sub.f (10% MeOH/CHCl.sub.3): 0.52.
[0207] Mp: 128-130.degree. C.
Example 17
##STR00026##
[0208] 3'-Fluoro-5'-tritylamino-2',3',5'-trideoxyuridine (17)
[0209] The title compound was obtained as a light yellow
crystalline solid (91 mg, 32%) from the reaction of the
corresponding amine (0.137 g, 0.59 mmol) and trityl chloride (0.199
g, 0.66 mmol) in dry pyridine (4 mL). The procedure was similar to
that followed for the preparation of the 3' hydroxy analogue
5'tritylamino-2',5'-dideoxyuridine (WSP871, see example 14).
[0210] .sup.1H NMR (300 MHz, CDCl.sub.3), .delta. 1.87-2.13 (2H, m,
2'-H), 2.28 (1H, dd, J=8.1, 12.0 Hz, 1''-NH), 2.57-2.78 (2H, m,
5'-H), 4.48 (1H, dm, J.apprxeq.25 Hz, 4'-H), 5.11 (1H, dd, J=5.3,
53.7 Hz, 3'-H), 5.71 (1H, d, J=8.1 Hz, 5-H), 6.37 (1H, dd, J=5.6,
8.7 Hz, 1'-H), 6.98 (1H, d, J=8.1 Hz, 6-H), 7.23-7.43 (9H, m,
Ph-H), 7.53 (6H, m, Ph-CH), 9.39 (1H, s, 3-NH).
[0211] .sup.13C NMR (75 MHz, CDCl.sub.3) .delta. 38.5 (d, J=21.8
Hz, 2'-CH.sub.2), 46.1 (d, J=9.2 Hz, 5'-CH.sub.2), 71.1
(Ph.sub.3C), 85.2 (d, J=25.3 Hz, 4'-CH), 85.5 (1'-CH), 94.4 (d,
J=179.9 Hz, 3'-CH), 103.6 (5-CH), 127.1 (Ph-CH), 128.5 (Ph-CH),
128.9 (Ph-CH), 139.3 (6-CH), 145.7 (Ph-C), 150.5 (2-C), 163.4
(4-C).
[0212] .sup.19F NMR (282 MHz, CDCl.sub.3) .delta.-175.7 (m,
3'-F).
[0213] ES.sup.+ m/z (%) 243 (Ph.sub.3C.sup.+, 93), 494
([M+Na].sup.+, 92).
Example 18
##STR00027##
[0214] 3'-Fluoro-5'-O-triphenylsilyl-2',3'-dideoxyuridine (18)
[0215] The title compound was synthesised following a similar
procedure as described for Example 11.
3'-Fluoro-2',3'-dideoxyuridine (0.214 g, 0.93 mmol) was reacted
with triphenylsilyl chloride (0.332 g, 1.12 mmol) in dry pyridine
(7 mL) for 3 h. to yield the title compound as a white solid (0.274
g, 60%).
[0216] .sup.1H NMR (300 MHz, CDCl.sub.3) .delta. 2.19 (1H, m,
2'-H), 2.67 (1H, m, 2'-H), 4.11 (2H, m, 5'-OH), 4.36 (1H, d, J=27.1
Hz, 3'-H), 5.22 (1.5H, m, 4'-H and 5-H), 5.40 (0.5H, d, J=4.8 Hz,
4'-H), 6.50 (1H, dd, J=5.4, 9.1 Hz, 1'-H), 7.41-7.75 (16H, m, 6-H
and Ph-H), 9.04 (1H, bs, 3-NH).
[0217] .sup.13C NMR (75 MHz, CDCl.sub.3) .delta. 39.5 (d, J=20.7
Hz, 2'-CH.sub.2), 64.3 (d, J=11.5 Hz, 5'-CH.sub.2), 85.2 (1'-CH),
85.4 (d, J=24.7 Hz, 4'-CH), 94.9 (d, J=178.7 Hz, 3'-CH), 103.1
(5-CH), 128.8 (Ph-CH), 131.2 (Ph-CH), 133.0 (Ph-C), 135.7 (Ph-CH),
140.1 (6-CH), 150.7 (2-C), 163.5 (4-C).
[0218] .sup.19F NMR (282 MHz, CDCl.sub.3) .delta.-175.1 (m,
3'-F).
[0219] ES.sup.+ m/z (%) 511 ([M+Na].sup.+, 5), 87 (100).
[0220] ES.sup.- m/z (%) 487 ([M-H.sup.+], 31), 75 (100).
Example 19
##STR00028##
[0221] 3'-Fluoro-5'-O-tert-Butyldiphenylsilyl-2',3'-dideoxyuridine
(19)
[0222] The title compound was synthesised following a similar
procedure as described for Example 12.
3'-Fluoro-2',3'-dideoxyuridine (0.176 g, 0.77 mmol) was reacted
with tert-butyldiphenylsilyl chloride (0.238 g, 0.87 mmol) and
imidazole (0.116 g, 1.70 mmol) in dry DMF (4 mL) for 3 h. Compound
WSP948 was obtained as a white solid (0.331 g, 92%).
[0223] .sup.1H NMR (300 MHz, CDCl.sub.3) .delta. 1.17 (9H, m,
tBu-H), 2.24 (1H, m, 2'-H), 2.78 (1H, m, 2'-H), 4.00 (2H, m, 5'-H),
4.38 (1H, d, J=26.7 Hz, 4'-H), 5.34 (1H, dd, J=4.9, 53.8 Hz, 3'-H),
5.56 (1H, d, J=8.1 Hz, 5-H), 6.51 (1H, m, 1'-H), 7.43-7.60 (6H, m,
Ph-H), 7.65-7.74 (4H, m, Ph-H), 7.27 (1H, d, J=8.1 Hz, 6-H), 9.11
(1H, bs, 3-NH).
[0224] .sup.13C NMR (75 MHz, CDCl.sub.3) .delta. 19.7 (tBu-C), 27.4
(tBu-CH.sub.3), 39.7 (d, J=21.3 Hz, 2'-CH.sub.2), 64.1 (d, J=10.9
Hz, 5'-CH.sub.2), 85.4 (1'-CH), 85.6 (d, J=24.7 Hz, 4'-CH), 94.7
(d, J=178.7 Hz, 3'-CH), 103.2 (5-CH), 128.5 (Ph-CH), 128.6 (Ph-CH),
130.7 (Ph-CH), 132.2 (Ph-C), 132.8 (Ph-C), 135.7 (Ph-CH), 136.0
(Ph-CH), 140.0 (6-CH), 150.6 (2-C), 163.5 (4-C).
[0225] .sup.19F NMR (282 MHz, CDCl.sub.3) .delta.-175.5 (m,
3'-F).
[0226] ES.sup.- m/z (%) 467 ([M-H.sup.+], 53), 75 (100).
Example 20
##STR00029##
[0227] 5'-O-paramethoxytrityl-2'-deoxyuridine (20)
[0228] 4-Methoxytrityl (0.610 g, 1.98 mmol) was added to a solution
of 2'-deoxyuridine (0.410 g, 1.80 mmol) in anhydrous pyridine (10
mL). The reaction mixture was stirred at 50.degree. C. for 40 h.
The crude mixture was partitioned between water (40 mL) and DCM
(2.times.40 mL). The organic layers were combined, washed with
water (2.times.80 mL), dried over MgSO.sub.4 and concentrated in
vacuo. The resultant yellow oil was further purified by silica gel
column chromatography (using Jones Chromatography (solute SI
columns). The column was eluted with a gradient of 0.fwdarw.5%
CH.sub.3OH in CHCl.sub.3. The fractions with R.sub.f=0.28 (10%
CH.sub.3OH/CHCl.sub.3) yielded the title compound as a white
crystalline solid (0.625 g, 69%).
[0229] .sup.1H NMR (300 MHz, CDCl.sub.3) .delta. 2.27 (1H, m,
5'-H), 2.42 (1H, m, 5'-H), 2.57 (1H, bs, 3'-OH), 3.42 (2H, m,
2'-H), 3.76 (3H, s, OCH.sub.3), 4.00 (1H, m, 4'-H), 4.54 (1H, m,
3'-H), 5.37 (1H, d, J=8.1 Hz, 5-H), 6.29 (1H, t, J=6.3 Hz, 1'-H),
6.82 (2H, m, Ar--H), 7.18-7.38 (12H, m, Ar--H), 7.74 (1H, d, J=8.1
Hz, 6-H), 9.20 (1H, bs, 3--NH).
[0230] .sup.13C NMR (75 MHz, CDCl.sub.3) .delta. 41.6
(2'-CH.sub.2), 55.7 (OCH.sub.3), 63.5 (5'-CH.sub.2), 71.9 (3'-CH),
85.5 (4'-CH), 86.5 (1'-CH), 87.8 (Ar.sub.3C), 102.7 (5-CH), 113.8
(Ar--CH), 127.7 (Ar--CH), 128.5 (Ar--CH), 128.8 (Ar--CH), 130.8
(Ar--CH), 135.1 (Ar--C), 140.6 (6-CH), 144.1 (Ar--C), 144.3
(Ar--C), 150.8 (2-C), 159.3 (Ar--C), 163.7 (4-C).
[0231] ES.sup.+ m/z (%) 523 ([M+Na].sup.+, 100)
[0232] HRMS (ES.sup.+) Found [M+Na].sup.+523.1848;
C.sub.29H.sub.28N.sub.2O.sub.6Na requires 523.1845.
[0233] IR (KBr) 3208, 3054, 1714, 1694, 1682, 1507, 1470, 1250,
1092, 1035, 759 cm.sup.-1.
[0234] M.p. 96-97.degree. C.
[0235] Anal calcd for C.sub.29H.sub.28N.sub.2O.sub.6 (%): 1.43 HCl,
0.40 H.sub.2O C, 62.21; H, 5.44; N, 5.00; Cl, 9.06; found: C,
62.17; H, 5.05; N, 4.85, Cl, 8.86.
Example 21
##STR00030##
[0236] 5'-O-(4-cyanotrityl)-2'-deoxyuridine (21)
[0237] 4-Cyanotrityl (0.397 g, 1.31 mmol) was added to a solution
of 2'-deoxyuridine (0.229 g, 1.00 mmol) in dry pyridine (5 mL). As
the reaction was not complete after 72 h at 50.degree. C., DMAP (11
mg, 0.09 mmol) was added and the reaction mixture was kept at
50.degree. C. for a further 20 h. H.sub.2O (20 mL) was added and
the crude mixture was extracted with DCM (2.times.15 mL and 10 mL).
The combined organic layers were dried over Na.sub.2SO.sub.4,
concentrated in vacuo and purified by flash column chromatography
eluting the column (ISOLUTE SI) with a gradient of 0.fwdarw.6%
CH.sub.3OH in CHCl.sub.3. The fractions with R.sub.f=0.29 (10%
CH.sub.3OH/CHCl.sub.3) afforded the title compound as a white solid
(0.215 g, 43%).
[0238] .sup.1H NMR (300 MHz, CDCl.sub.3) .delta. 2.19 (1H, m,
2'-CHH), 2.45 (1H, m, 2'-CHH), 2.94 (1H, bs, 3'-OH), 3.38 (2H, m,
5'-H), 4.06 (1H, m, 4'-H), 4.50 (1H, m, 3'-H), 5.45 (1H, d, J=8.1
Hz, 5-H), 6.27 (1H, t, J=6.2 Hz, 1'-H), 7.24-7.34 (10H, m, Ph-H),
7.53-7.60 (5H, m, 6-H and Ar--H), 9.50 (1H, bs, 3-NH).
[0239] .sup.13C NMR (75 MHz, CDCl.sub.3) .delta. 41.4
(2'-CH.sub.2), 63.9 (5'-CH.sub.2), 71.7 (3'-CH), 85.6 (1'-CH), 86.1
(4'-CH), 87.6 (ArPh.sub.2C), 102.8 (5-CH), 111.4 (Ar--C), 119.0
(C.ident.N), 128.6 (Ph-CH), 128.8 (Ph-CH), 129.0 (Ar--CH), 132.4
(Ar--CH), 140.3 (6-CH), 142.0 (Ph-C), 142.1 (Ph-C), 150.1 (Ar--C),
150.8 (2-C), 163.8 (4-C).
[0240] ES.sup.+ m/z (%) 518 ([M+Na].sup.+, 23), 268 (CNTr.sup.+,
100).
[0241] ES.sup.- m/z (%) 494 (M-H.sup.+, 100).
[0242] HRMS (ES.sup.+) Found [M+NH.sub.4].sup.+513.2132;
C.sub.29H.sub.29N.sub.4O.sub.5.sup.+ requires 513.2132.
[0243] M.p. 92-95.degree. C.
[0244] IR (KBr) 3401, 3180, 3060, 2230 (CN), 1685, 1463, 1273, 1088
cm.sup.-1.
[0245] Anal calcd for C.sub.29H.sub.25N.sub.3O.sub.5 (%): 2.35 HCl
C, 59.93; H, 4.74; N, 7.23 found: C, 59.89; H, 4.45; N, 7.02.
Example 22
##STR00031##
[0246] 5'-[(4-cyanotrityl)amino]-2',5'-dideoxyuridine (22)
[0247] 4-Cyanotrityl chloride (0.406 g, 1.34 mmol) was added to a
solution of 5'-amino-2',5'-dideoxyuridine (0.239 g, 1.05 mmol) in
dry pyridine (5 mL). The reaction mixture was stirred at 40.degree.
C. for 48 h. The reaction mixture was filtered and the filtrate
concentrated in vacuo. Purification was carried out using flash
column chromatography eluting the column (ISOLUTE SI) with a
gradient of 0.fwdarw.5% CH.sub.3OH in CHCl.sub.3. The fractions
with R.sub.f=0.31 (10% CH.sub.3OH/CHCl.sub.3) afforded the title
compound as a white crystalline solid (0.386 g, 37%).
[0248] .sup.1H NMR (300 MHz, CDCl.sub.3) .delta. 2.03 (2H, m,
2'-CHH and 5'-NH), 2.21 (1H, m, 5'-CHH), 2.37 (1H, m, 2'-CHH), 2.58
(1H, m, 5'-CHH), 3.31 (1H, bs, 3'-OH), 4.10 (1H, m, 4'-H), 4.24
(1H, m, 3'-H), 5.63 (1H, d, J=8.1 Hz, 5-H), 6.24 (1H, t, J=6.3 Hz,
1'-H), 7.00 (1H, dd, J=2.1, 8.1 Hz, 6-H), 7.18-7.48 (10H, m, Ph-H),
7.54 (2H, d, J=8.1 Hz, Ar--H), 7.66 (2H, d, J=8.1 Hz, Ar--H), 9.74
(1H, bs, 3-NH).
[0249] .sup.13C NMR (75 MHz, CDCl.sub.3) .delta. 40.7
(2'-CH.sub.2), 46.5 (5'-CH.sub.2), 71.3 (ArPh.sub.2C), 72.8
(3'-CH), 85.6 (1'-CH), 86.5 (4'-CH), 103.3 (5-CH), 110.7 (Ar--CH),
119.2 (CN), 127.6 (Ph-CH), 128.7 (Ph-CH), 128.9 (Ph-CH), 129.1
(Ph-CH), 129.5 (Ar--CH), 132.4 (Ar--CH), 139.9 (6-CH), 144.3
(Ph-C), 145.0 (Ph-C), 150.8 (2-C), 151.6 (Ar--C), 163.8 (4-C).
[0250] ES.sup.+ m/z (%) 517 ([M+Na].sup.+, 19), 495 ([M+H].sup.+ ,
9), 517 (CNTr.sup.+, 100).
[0251] ES.sup.- m/z (%) 493 (M-H.sup.+, 19), 111 (uracil-W,
100).
[0252] HRMS (ES.sup.+) Found [M+H].sup.+ 495.2023;
C.sub.29H.sub.27N.sub.4O.sub.4.sup.+ requires 495.2027.
[0253] M.p. 160-163.degree. C.
[0254] IR (KBr) 3387, 3177, 3027, 2230 (CN), 1699, 1661, 1466,
1267, 1097, 1039 cm.sup.-1.
[0255] Anal calcd for C.sub.29H.sub.29N.sub.3O.sub.5, 0.98 (%):
HCl, 0.40H.sub.2O C, 64.80; H, 5.21; N, 10.42; Cl, 6.46; found: C,
64.69; H, 4.90; N, 10.28; Cl, 6.84.
Example 23
##STR00032##
[0256] 5'-paraMethoxytritylamino-2',5'-dideoxyuridine (23)
[0257] The procedure was similar to that described for example 20.
5'-Amino-2',5'-dideoxyuridine (0.204 g, 0.90 mmol) was reacted with
4-methoxytrityl (0.292 g, 0.99 mmol) to yield the title compound as
a white solid (0.115 g, 26%).
[0258] .sup.1H NMR (300 MHz, CDCl.sub.3) .delta. 2.04 (2H, m,
2'-H), 2.29-2.48 (2H, m, 5'-H), 2.69 (1H, dd, J=3.7, 12.1 Hz,
5'--NH), 3.83 (3H, s, OCH.sub.3), 4.15 (1H, m, 4'-H), 4.30 (1H, m,
3'-H), 5.69 (1H, d, J=8.1 Hz, 5-H), 6.32 (1H, t, J=6.4 Hz, 1'-H),
6.88 (2H, m, Ar--H), 7.17 (1H, d, J=8.1 Hz, 6-H), 7.21-7.61 (12H,
m, Ar--H).
[0259] .sup.13C NMR (75 MHz, CDCl.sub.3) .delta. 40.8
(2'-CH.sub.2), 46.6 (5'-CH.sub.2), 55.7 (OCH.sub.3), 70.7
(Ar.sub.3C), 73.0 (3'-CH), 85.4 (4'-CH), 86.8 (1'-CH), 103.2
(5-CH), 113.7 (Ar--CH), 126.9 (Ar--CH), 128.4 (Ar--CH), 128.9
(Ar--CH), 130.2 (Ar--CH), 138.0 (Ar--C), 139.9 (6-CH), 146.2
(Ar--C), 150.8 (2-C), 158.4 (Ar--C), 163.8 (4-C).
[0260] ES.sup.+ m/z (%) 522 ([M+Na].sup.+, 27).
[0261] HRMS (ES.sup.+) Found [M+H].sup.+ 500.2174;
C.sub.29H.sub.30N.sub.3O.sub.5.sup.+ requires 500.2180.
[0262] IR (KBr) 3052, 1713, 1694, 1682, 1666, 1650, 1506, 1250,
1034, 760 cm.sup.-1.
[0263] M.p. 140-142.degree. C.
[0264] TLC (10% CH.sub.3OH/CHCl.sub.3) R.sub.f=0.29.
[0265] Anal (%) found C, 65.69; H, 5.52; N, 7.86, Cl, 6.05;
[0266] Calcd for C.sub.29H.sub.29N.sub.3O.sub.5, 0.87 HCl C, 65.56;
H, 5.67; N, 7.91, Cl 5.81.
Example 24
##STR00033##
[0267] 5'-[(2-chlorotrityl)amino]-2',5'-dideoxyuridine (24)
[0268] 5'-Amino-2',5'-dideoxyuridine (0.237 g, 1.04 mmol) was
reacted with 2-chlorotrityl chloride (0.415 g, 1.33 mmol) in dry
pyridine (5 mL) at 40.degree. C. for 24 h. A second portion of
2-chlorotrityl chloride (0.198 g, 0.63 mmol) was added. After a
further 2 h stirring at 40.degree. C., the reaction was quenched
with MeOH (2 mL). The reaction mixture was concentrated in vacuo
and purified by flash column chromatography using an ISOLUTE SI
column eluted with a gradient of 0.fwdarw.5% CH.sub.3OH in
CHCl.sub.3. The fractions with R.sub.f=0.17 (10%
CH.sub.3OH/CHCl.sub.3) yielded the title compound as a white solid
(85 mg, 16%).
[0269] .sup.1H NMR (300 MHz, CDCl.sub.3) .delta. 2.02 (1H, m,
2'-H), 2.20 (1H, m, 5'-H), 2.37 (1H, m, 2'-H), 2.53 (1H, m, 5'-H),
4.16 (1H, m, 3'-H), 4.24 (1H, m, 4'-H), 5.62 (1H, d, J=8.1 Hz,
5-H), 6.26 (1H, t, J=6.4 Hz, 1'-H), 7.05-7.45 (15H, m, 6-H and
Ar--H).
[0270] .sup.13C NMR (75 MHz, CDCl.sub.3) .delta. 41.1
(2'-CH.sub.2), 47.3 (5'-CH.sub.2), 71.5 (ArPh.sub.2C), 72.9
(3'-CH), 85.5 (1'-CH), 86.8 (4'-CH), 103.0 (5-CH), 126.8 (CITr-CH),
126.9 (CITr-CH), 127.6 (CITr-CH), 128.4 (CITr-CH), 128.5 (CITr-CH),
128.6 (CITr-CH), 129.2 (CITr-CH), 132.3 (CITr-CH), 132.9 (CITr-CH),
134.7 (CITr-C), 140.0 (6-CH), 140.9 (CITr-C), 144.8 (CITr-C), 146.0
(CITr-C), 150.7 (2-C), 163.7 (4-C).
[0271] ES.sup.+ m/z (%) 526 ([M+Na].sup.+, 11), 504 ([M+H].sup.+ ,
14), 277 (CITr.sup.+, 100).
[0272] ES.sup.- m/z (%) 504 (M-H.sup.+, 11), 111 (uracil-W,
100).
[0273] HRMS (ES.sup.+) Found [M+H].sup.+ 504.1689;
C.sub.28H.sub.27N.sub.3O.sub.4Cl.sup.+ requires 504.1685.
[0274] M.p. 129-131.degree. C.
Example 25
##STR00034##
[0275] 5'-Triphenylsilyloxy-2',3'-dideoxydidehydrouridine (25)
[0276] To a solution of 2',3'-dideoxydidehydrouridine (0.316 g,
1.50 mmol) in dry pyridine (5 mL) cooled in an ice-salt bath was
added drop-wise a solution of triphenylsilyl chloride (0.595 g,
2.02 mmol) in dry pyridine (3 mL). The reaction mixture was kept at
0.degree. C. under nitrogen for 2 h30. As TLC monitoring evidenced
the presence of unreacted starting material, additional
triphenylsilyl chloride (0.296 g, 1.00 mmol) in dry pyridine (1 mL)
was added. After 1 h30 min the reaction was quenched with
CH.sub.3OH (50 uL). Removal of the solvent in vacuo afforded a
crude white gum which was purified by silica gel chromatography
(Jones Chromatography (solute SI column) eluted with 0.fwdarw.5%
CH.sub.3OH in CHCl.sub.3. The title was obtained as a white solid
(0.476 g, 68%) from the fractions with R.sub.f=0.57 (10%
CH.sub.3OH/CHCl.sub.3).
[0277] .sup.1H NMR (300 MHz, CDCl.sub.3) .delta. 4.04 (1H, dd,
J=2.2, 11.7 Hz, 5'-H), 4.19 (1H, dd, J=2.5, 11.7 Hz, 5'-H), 4.78
(1H, dd, J=1.9, 8.1 Hz, 5-H), 4.98 (1H, m, 4'-H), 5.90 (1H, d,
J=5.7 Hz, 1'-H), 6.33 (1H, dd, J=1.4, 4.5 Hz, 2'-H), 7.12 (1H, m,
3'-H), 7.40-7.65 (15H, m, Ph-H), 7.80 (1H, d, J=8.1 Hz, 6-H), 8.99
(1H, bs, 3-NH).
[0278] .sup.13C NMR (75 MHz, CDCl.sub.3) .delta. 64.7
(5'-CH.sub.2), 87.4 (1'-CH), 90.0 (4'-CH), 102.6 (5-CH), 127.1
(2'-CH), 128.6 (Ph-CH), 131.0 (Ph-CH), 133.3 (Ph-C), 134.9 (3'-CH),
135.8 (Ph-CH), 141.5 (6-CH), 151.2 (2-C), 163.6 (4-C).
[0279] ES.sup.+ m/z (%) 491 ([M+Na].sup.+, 36), 119 (100).
[0280] HRMS (ES.sup.+) Found [M+NH.sub.4].sup.+446.1887;
C.sub.25H.sub.28N.sub.3OSi.sup.+ requires 446.1894.
[0281] M.p. 73-74.degree. C.
[0282] Anal (%) found C, 67.75; H, 5.04; N, 5.84; Cl, 1.89;
[0283] Calcd for C.sub.27H.sub.27N.sub.2O.sub.4Si, 0.25 HCl C,
67.89; H, 5.12; N, 5.86; Cl, 1.86.
Example 26
##STR00035##
[0284] 5'-Pixylamino-2',5'-dideoxyuridine (26)
[0285] 2'-Amino-2',5'-deoxyuridine (0.231 g, 1.02 mmol) was reacted
with pixyl chloride (0.390 g, 1.33 mmol) in dry pyridine (5 mL) at
40.degree. C. for 48 h. H.sub.2O (10 mL) was added and the crude
mixture was extracted with DCM (2.times.15 mL). The organic layers
were dried over Na.sub.2SO.sub.4, concentrated in vacuo and
purified by flash column chromatography eluting the column (ISOLUTE
SI) with a gradient of 0.fwdarw.10% CH.sub.3OH in CHCl.sub.3. The
fractions with R.sub.f=0.11 (10% CH.sub.3OH/CHCl.sub.3) yielded the
title compound as a white solid (0.118 g, 24%).
[0286] .sup.1H NMR (300 MHz, CDCl.sub.3) .delta. 1.31 (1H, m,
2'-CHH), 2.04 (1H, m, 2'-CHH), 2.29 (1H, dd, J=4.3, 13.8 Hz,
5'-CHH), 2.58 (1H, m, 5'-CHH), 3.84 (2H, m, 3'-H and 4'-H), 5.69
(1H, d, J=8.1 Hz, 5-H), 6.21 (1H, t, J=6.5 Hz, 1'-H), 7.03-7.53
(14H, m, 6-H and Ar--H).
[0287] .sup.13C NMR (75 MHz, CDCl.sub.3) .delta. 39.4
(2'-CH.sub.2), 42.3 (5'-CH.sub.2), 72.1 (3'-CH), 76.9 (pixyl-C),
84.7 (1'-CH), 86.1 (4'-CH), 103.1 (5-CH), 116.8 (pixyl-CH), 116.9
(pixyl-CH), 123.3 (pixyl-C), 123.6 (pixyl-C), 123.97 (pixyl-CH),
124.03 (pixyl-CH), 127.4 (pixyl-CH), 127.6 (--CH), 128.2
(pixyl-CH), 130.20 (pixyl-CH), 130.24 (pixyl-CH), 131.1 (pixyl-CH),
131.5 (pixyl-CH), 140.3 (6-CH), 148.0 (pixyl-C), 150.5 (2-C), 151.4
(pixyl-C), 151.9 (pixyl-C), 163.5 (4-C).
[0288] ES.sup.+ m/z (%) 506 ([M+Na].sup.+, 4), 257 (Pixyl.sup.+
that is C.sub.19H.sub.13O.sup.+, 100).
[0289] ES.sup.- m/z (%) 482 (M-H.sup.+, 100).
[0290] HRMS (ES.sup.+) Found [M+H].sup.+ 484.1871;
C.sub.28H.sub.26N.sub.3O.sub.5.sup.+ requires 484.1867.
[0291] M.p. 117-119.degree. C.
[0292] Anal calcd for C.sub.28H.sub.25N.sub.3O.sub.5 (%): 1.58 HCl
C, 62.15; H, 4.95; N, 7.7; 7 found C, 62.07; H, 4.66; N, 7.50.
Example 27
##STR00036##
[0293] 5'-O-trityl-2'-deoxyuridine (27)
[0294] 2''-deoxyuridine (4.00 g, 17.5 mmol) and triphenylmethyl
chloride (5.37 g, 19.25 mmol) were stirred in anhydrous pyridine
(70 ml) at 50.degree. C. overnight. Additional triphenylmethyl
chloride (1.00 g, 3.59 mmol) was added after 18 hours, and the
mixture was stirred for a further 4 hours at 50.degree. C. The
reaction mixture was then poured into ice-H.sub.2O (300 ml) and
stirred vigorously. The precipitate was extracted with EtOAc
(3.times.100 ml). The organic solution was then washed with 0.5 M
HCl (4.times.100 ml), dried with MgSO.sub.4 and filtered. The
filtrate was then washed further with EtOAc, which was then
evaporated, and finally with DCM. Solvent was removed using a Buchi
rotary evaporator, and finally with the vacuum pump.
[0295] White solid (7.69 g, 93%).
Example 28
##STR00037##
[0296] 3'-O-Mesyl-5''-O-trityl-2''-deoxyuridine (28)
[0297] Methanesulphonyl chloride (0.173 ml, 2.24 mmol) was added to
a solution of (8) (0.30 g, 0.64 mmol) in anhydrous pyridine (5 ml)
with ice-bath cooling. The mixture was stirred for 4 hours at room
temperature. After this time, ice-water (1 ml) was added; the
mixture was stirred for 5 minutes, then poured into ice-water (30
ml) and filtered. The precipitate was dissolved in CHCl.sub.3 (30
ml), the solution was washed with 0.5 M HCl (10 ml) and water
(3.times.10 ml), dried (MgSO.sub.4), filtered, and reduced in vacuo
which gave the title product as a yellow/orange solid (0.29 g,
83%).
Example 29
##STR00038##
[0298] 2,3'-Anhydro-5'-O-trityl-2',3'-dideoxyuridine (29)
[0299] DBU (1.00 ml, 7.12 mmol) and compound 28 (3.55 g, 6.48 mmol)
were stirred in DCM (25 ml) over 30 hours. The mixture was washed
with water (2.times.30 ml), the organic layer was dried
(MgSO.sub.4), filtered and reduced in vacuo. The residue was
purified by column chromatography (5% MeOH/CHCl.sub.3) which gave
the title product as a white solid (2.42 g, 82%).
Example 30
##STR00039##
[0300] 3'-Azido-5''-O-trityl-2',3'-dideoxyuridine (30)
[0301] Lithium fluoride (0.145 g, 5.61 mmol) was suspended in DMF
(3 ml) and heated to 105.degree. C. with stirring. To the stirred
suspension was added N,N,N',N'-tetramethylethylenediamine (5 ml)
followed by azidotrimethylsilane (0.64 g, 5.61 mmol). After
stirring for an hour, compound 29 (1.41 g, 3.11 mmol) dissolved in
N,N-dimethylformamide (2 ml) was added, and the reaction was
allowed to proceed for 20 hours at 110.degree. C. The mixture was
cooled, poured into CHCl.sub.3 (110 ml) and filtered through
Celite. The solvent was removed under reduced pressure and the
residue (brown oil) was taken in EtOAc (100 ml). The organic phase
was washed with water (4.times.180 ml), dried (MgSO.sub.4),
filtered and concentrated. The concentrated mixture was purified by
column chromatography (3% MeOH/CHCl.sub.3) which gave the title
product as an orange solid (0.996 g, 65%).
Example 31
##STR00040##
[0302] 3'-Amino-5'-O-trityl-2',3'-dideoxyuridine (31)
[0303] Lindlar's catalyst (20 mg) was added to compound 30 (0.10 g,
0.20 mmol), and was then suspended in ethanol (5 ml). Air was
removed from the flask by flushing with nitrogen several times. The
nitrogen was then removed and replaced with hydrogen. The mixture
was stirred for 5 hours, and then filtered through Celite. Fresh
Lindlar's catalyst (20 mg) was added to the filtrate. The flask was
flushed with nitrogen and then hydrogen as previously, and the
reaction was left stirring for another 3 hours. The reaction
mixture was filtered through Celite. The solvent was evaporated and
the concentrated solution was purified by column chromatography
(MeOH/DCM 2%.fwdarw.10%) which gave the title product as a white
solid (0.065 g, 70%). R.sub.f: 0.3 in DCM/MeOH 90:10.
[0304] .sup.1H-NMR (300 MHz, CDCl.sub.3): .delta. 7.97 (d, J=8.2
Hz, 1H, H-6), 7.47-7.27 (m, 15H, H-aromatic), 6.20 (q, J=3.3 Hz,
1H, H-1') 5.41 (d, J=8.1 Hz, 1H, H-5), 3.73-3.38 (m, 5H, H-3',
H-4', H-5'), 2.44.+-.2.18 (m, 2H, H-2').
[0305] .sup.13C-NMR (75 MHz, CDCl.sub.3): .delta. 163.5 (C-4),
150.5 (C-2), 143.7 (C-7'), 140.7 (C-6), 129.1 (C-8'), 128.5 (C-9'),
127.8 (C-10'), 102.2 (C-5), 87.9 (C-6'), 87.2 (C-4'), 85.2 (C-1'),
62.2 (C-5'), 50.7 (C-3'), 42.7 (C-2').
[0306] LRMS: (ES+mode): m/z=491.7 [(M+Na).sup.+, 45%]; m/z=243.2
[(Tr).sup.+, 100%].
[0307] HRMS: (ES+mode): found 492.1902; required 492.1899 for
C.sub.28H.sub.27N.sub.3O.sub.4Na [M Na].sup.+.
[0308] Microanalysis calculated for
C.sub.28H.sub.27N.sub.3O.sub.4.times.0.5H.sub.2O:
[0309] C, 70.28; H, 5.90; N, 8.78%; found: C, 70.64; H, 5.92; N,
8.41%.
Example 32
##STR00041##
[0310] 3'-Acetylamino-5'-O-trityl-2',3'-dideoxyuridine (32)
[0311] Compound 31 (0.10 g, 0.213 mmol) was suspended in DCM (5
ml), and to this was added acetic anhydride (0.047 g, 0.044 ml,
0.469 mmol) and triethylamine (0.065 ml, 0.469 mmol). The mixture
was stirred at room temperature for 3 hours. After this time the
solvent was evaporated to give a white solid. The product was
purified by column chromatography (MeOH/DCM 2%.fwdarw.6%), and
evaporation of the solvent gave the title compound as a white solid
(0.103 g, 95%).
[0312] R.sub.f: 0.45 in DCM/MeOH 90:10.
[0313] .sup.1H-NMR (300 MHz, CDCl.sub.3): .delta. 9.82 (s, 1H,
N--H), 7.83 (d, J=8.2 Hz, 1H, H-6), 7.46-7.28 (m, 16H, H-aromatic)
6.94 (s, 1H, N--H), 6.34 (t, J=6.3 Hz, 1H, H-1'), 5.39 (d, J=8.1
Hz, 1H, H-5), 4.79-4.72 (m, 1H, H-3'), 4.07 (s, 1H, H-4') 3.59-3.47
(m, 2H, H-5'), 2.50-2.32 (m, 2H, H-2'), 2.04 (s, 3H, H-12')
[0314] .sup.13C-NMR (75 MHz, CDCl.sub.3): .delta. 163.6 (C-4),
154.9 (C-2), 143.6 (C-7'), 140.5 (C-6), 129.1 (C-8'), 128.5 (C-9'),
127.9 (C-10'), 103.1 (C-5), 88.1 (C-6'), 87.3 (C-1'), 85.2 (CH,
C-4'), 62.1 (C-5'), 50.9 (C-3'), 38.8 (C-2')
[0315] LRMS: (ES+mode): m/z=533.8 [(M+Na).sup.+, 20%].
[0316] HRMS: (ES+mode): Found 534.2009; required 534.2005 for
C.sub.30H.sub.29N.sub.3O.sub.5Na [M+Na].sup.30
[0317] Microanalysis calculated for
C.sub.30H.sub.29N.sub.3O.sub.5.times.1.0 HCl.times.1.0 H.sub.2O
[0318] C, 63.66; H, 5.70; N, 7.42%; found C, 63.20; H, 5.15; N,
7.11%.
Example 33
##STR00042##
[0319] Diphenyl(pyridin-2-yl)methanol (33)
[0320] A solution of 2-bromopyridine (5 g, 0.032 mol) in dry THF
(15 0 mL) was cooled to -70.degree. C. To this cooled solution was
added n-BuLi (2.8 M, 12.4 mL, 0.034 mol) over a period of 20 min
and allowed to stir for 2 h under N.sub.2 atmosphere. A solution of
benzophenone (5.8 g, 0.032 mol) in dry THF (50 mL) was added to the
solution at the same temperature over a period of 30 min. The
reaction mixture was warmed slowly to RT and allowed to stir
another 5 h at RT. The reaction mixture was concentrated under
vacuum and the residue was washed with petroleum ether. The organic
layer was filtered and the filtrate was concentrated under vacuum
to give the title compound (8 g, 95%).
Example 34
##STR00043##
[0321] 2-[Chloro (diphenyl)methyl]pyridine hydrochloride (34)
[0322] To a mixture of diphenyl(pyridin-2-yl)methanol (4 g, 0.015
mol) in thionylchloride (50 mL) was added acetylchloride (15 mL,
0.195 mol) at RT and heated to 50.degree. C. for 48 h. The reaction
mixture was concentrated under vacuum and the residue was
azeotroped with dry benzene (100 mL.times.2) to give the title
compound as the hydrochloride salt (4.4 g, >95%).
Example 35
##STR00044##
[0323] 4-[Hydroxy(diphenyl)methyl]benzonitrile (35)
[0324] The procedure described in example 49 was followed but using
4-bromobenzonitrile (5 g, 0.027 mol) instead of 2-bromopyridine
which gave the title compound (7.5 g, 94%).
Example 36
##STR00045##
[0325] 4-[Chloro(diphenyl)methyl]benzonitrile (36)
[0326] To a mixture of 4-[hydroxy(diphenyl)methyl] in dry toluene
(60 mL) was added acetylchloride (3 mL) at RT and heated to
50.degree. C. for 12 h. The reaction mixture was concentrated under
vacuum. The residue was recrystallized from pet. ether to give the
product (1.7 g, 40%).
Example 37
##STR00046##
[0327] Diphenyl (pyrimidin-5-yl)methanol (37)
[0328] A solution of 5-bromopyrimidine (10 g, 0.063 mol) in a
mixture of dry THF (150 mL) and hexane (50 mL) was cooled to
-100.degree. C. To this cooled solution was added n-BuLi (4 g, 21
mL, 0.062 mol) over a period of 30 min and stirred for another 30
min. A solution of benzophenone (11.5 g, 0.063 mol) in dry THF (50
mL) was added to this at the same temperature over a period of 30
min. The reaction mixture was warmed slowly to RT and allowed to
stir another 1 h at RT. The reaction was quenched with cold water
(200 mL), ethyl acetate was added and the organic layer was
separated. The organic layer was dried, concentrated and the crude
product was purified by column chromatography on silica gel (up-to
25% ethyl acetate in pet. ether) to give the product (8 g). TLC:
Pet. ether/EtOAc, 1:1, R.sub.f=0.3
Example 38
##STR00047##
[0329] 2,2,2-Triphenylethanol (38)
[0330] To a suspension of LAH (3.9 g, 0.104 mol) in dry THF (200
mL) was stirred at 0.degree. C. for 20 min. A solution of
2,2,2-triphenylacetic acid (10 g, 0.034 mol) in dry THF (50 mL) was
added in a drop-wise manner. The reaction mixture was stirred at RT
overnight. Excess LAH was quenched with 1.5 N HCl and the reaction
mixture was further stirred for 2 h at RT. The reaction mixture was
filtered through celite, washed with ethyl acetate and the filtrate
was concentrated under vacuum. The crude product was purified by
column chromatography on silica gel (4% ethyl acetate in pet.
ether) to give the title compound (4.6 g, 48%). TLC: Pet.
ether/EtOAc, 7:3, R.sub.f=0.2
Example 39
##STR00048##
[0331] 3,3,3-Triphenylpropan-1-ol (39)
[0332] To a magnetically stirred suspension of LAH (8.3 g, 0.219
mol) in dry THF (50 mL) was added a solution of
3,3,3-triphenylpropionic acid (9.5 g, 0.0314 mol) over a period of
30 min at 0.degree. C. The reaction mixture was allowed to stir at
RT for 14 h. The reaction mixture was cooled and excess LAH was
quenched with 20% NaOH solution (50 mL). The reaction mixture was
passed through celite, washed with THF and the filtrate was
concentrated under vacuum. The residue was washed with pet. ether
and dried which gave the title compound (8 g, >85%).
[0333] TLC: Pet. ether/EtOAc, 7:3, R.sub.f=0.2
Example 40
##STR00049##
[0334] 1,1,2-Triphenylethanol (40)
[0335] To a suspension of Mg (1.7 g, 0.07 mol) in dry ether (25 mL)
was added a solution of benzyl bromide (10 mL, 1.5 equ.) in dry
ether (25 mL) drop-wise and allowed to stir at RT for 1 h. By the
time all magnesium was dissolved and the reaction mixture was
cooled to 0.degree. C. To this was added a solution of benzophenone
(10 g, 0.05 mol) in dry ether (25 mL) and allowed to stir at RT for
5 h. The progress of the reaction was followed by TLC and when it
was ready the reaction mixture was quenched with saturated
NH.sub.4Cl solution, extracted with ether (100 mL), washed with
brine, dried and concentrated under vacuum. The crudeproduct was
purified by column chromatography on silica gel (10% ethyl acetate
in pet. ether) to give the title compound (9.6 g, 65%) as a white
solid.
[0336] TLC: Pet. ether/EtOAc, 9:1, R.sub.f=0.4
Example 41
##STR00050##
[0337] 4-Trityloxy-but-2-en-1-ol (41)
[0338] Trityl chloride (557 mg; 2 mmol) Et.sub.3N (0.306 ml; 2.2
mmol) and DMAP (10 mg; 0.08 mmol) were added to a emulsion of
cis-2-buten-1,4-diol (1.76 g; 20 mmol) in DCM (10 ml). The mixture
was stirred at room temperature under atmosphere of nitrogen for 24
hours. After such period of time the complete disappearance of
trityl chloride was observed by TLC (EtOAc/Hexane 50:50). DCM (20
ml) and water (10 ml) were added to the mixture. The phases were
separated and the organic layer was washed with water (10 ml) and
brine (10 ml). The solvent was dried over MgSO.sub.4 and evaporated
under reduced pressure affording a residue (white oil) which was
purified by flash chromatography using Hexane/EtOAc
70:30.fwdarw.40:60 as gradient which gave the title product as a
colourless oil (563 mg, 81%).
Example 42
##STR00051##
[0339] Trans-2-buten-1,4-diol (42)
[0340] 2-Butyn-1,4-diol (1 g; 11.64 mmol) was dissolved in dry THF
(25 ml) under atmosphere of nitrogen. The solution was cooled to
-78.degree. C. with a dry-ice/acetone bath. A cold solution of LAH
in THF 1M (12.7 ml; 12.7 mmol) was added with a syringe. The
reaction was left worm to room temperature in 4 hours. The
disappearance of the starting alkyne was observed by TLC
(Hexane/EtOAc 30:70); then the solution was cooled to -0.degree. C.
with an ice bath and the quenched with NaOH 1M, until no gas was
developed. The pH was adjusted to 8 with HCl 1M and then silica was
added to the solution. The solvents were removed under reduced
pressure and the residue was loaded into a chromatographic column
and purified using Hexane/EtOAc 30:70 as eluent which gave the
title compound as a colourless oil (817 mg, 79%). R.sub.f: 0.11 in
Hexane/EtOAc 30:70 (PMA)
[0341] .sup.1H-NMR (300 MHz, CD.sub.3OD): .delta. 5.83 (bs; 2H;
H-2+H-3); 4.07 (d; J=3.57 Hz; 4H; H-1+H-4)
[0342] .sup.13C-NMR (75 MHz, CD.sub.3OD): .delta. 131.7 (C-2 &
C-3); 63.4 (C-1 & C-4)
[0343] LRMS (ES+): m/z 111.0 [M+Na].sup.+100%.
Example 43
##STR00052##
[0344] (E)-4-(Trityloxy)but-2-en-1-ol (43)
[0345] A solution of Trityl chloride (500 mg; 1.81 mmol), TEA
(0.277 ml; 1.99 mmol) and DMAP (8.8 mg; 0.072 mmol) in dry DCM (5
ml) was added with a syringe to a solution of the diol (10) (800
mg; 9.07 mmol) in DCM (15 ml). The mixture was stirred at room
temperature for 1 hour and 30 minutes, then other TrCl, TEA and
DMAP (half quantities than before) were added. The reaction was
stirred at the same temperature until TLC (Hexane/EtOAc 50:50)
showed complete disappearance of Trityl chloride. After 1.5 hours
water (20 ml) was added and the reaction was stirred for few
minutes, then the phases were separated. The organic layer was
washed with water (25 ml) and brine (25 ml). The solvent was dried
over MgSO.sub.4 and evaporated to afford a crude oil which was
purified by flash chromatography using Hexane/EtOAc 50:50 as eluent
which gave the title compound as a colourless oil, 637 mg, 71%.
R.sub.f: 0.72 in Hexane/EtOAc 50:50 (UV/PMA).
[0346] .sup.1H-NMR (300 MHz, CDCl.sub.3): .delta. 7.54-7.51 (m; 6H;
H-7); 7.39-7.27 (m; 9H; H-8+H-9); 6.12-6.03 (m; 1H; H-3); 5.91-5.83
(m; 1H; H-2); 4.24 (bs; 2H; H-4); 3.71-3.71 (m; 2H; H-1).
[0347] .sup.13C-NMR (75 MHz, CDCl.sub.3): .delta. 144.6 (C-6);
130.5 (C-3 & C-2); 129.0 (C-8); 128.7 (C-7); 127.4 (C-9); 87.3
(C-5); 64.5 (C-4); 63.8 (C-1).
[0348] LRMS (ES+): m/z 331.2 [M+H].sup.+ 100%.
Example 44
##STR00053##
[0349] 5-Trityloxypentanol (44)
[0350] The procedure described in example 41 was followed but using
1,5-pentanediol (376 mg, 3.6 mmol) as alcohol instead of
cis-2-buten-1,4-diol in the reaction with trityl chloride, which
gave the title compound (300 mg, 24%).
Example 45
##STR00054##
[0351] 5-(Tritylamino)-pentan-1-ol (45)
[0352] The title compound (24%) was prepared as described in
example 41 but using 5-aminopentanol instead of
cis-2-buten-1,4-diol in the reaction with trityl chloride.
Biological Examples
Example B1
Malaria Whole Cell Assays
Parasite Cultures
[0353] Two strains of P. falciparum are used in this study: The
drug sensitive NF54 (an airport strain of unknown origin) and K1
(Thailand, chloroquine and pyrimethamine resistant). The strains
are maintained in RPMI-1640 medium with 0.36 mM hypoxanthine
supplemented with 25 mM HEPES, 25 mM NaHCO.sub.3, neomycin (100
U/ml) and Albumax.RTM. (lipid-rich bovine serum albumin) (GIBCO,
Grand Island, N.Y.) (5 g/l), together with 5% washed human A+
erythrocytes. All cultures and assays are conducted at 37.degree.
C. under an atmosphere of 4% CO.sub.2, 3% O.sub.2 and 93% N.sub.2.
Cultures are kept in incubation chambers filled with the gas
mixture. Subcultures are diluted to a parasitaemia of 0.1-0.5% and
the medium changed daily.
Drug Sensitivity Assays
[0354] Antimalarial activity is assessed using an adaptation of the
procedures described by Desjardins et al. (Antimicrob. Agents
Chemother. 16(6):710-8, 1979), and Matile and Pink (In: Lefkovits,
I. and Pernis, B. (Eds.). Immunological Methods. Academic Press,
San Diego, pp. 221-234, 1990). Stock drug solutions are prepared in
100% DMSO (dimethylsulfoxide) at 10 mg/ml, unless otherwise
suggested by the supplier, and heated or sonicated if necessary.
After use the stocks are kept at -20.degree. C. The compound is
further diluted to the appropriate concentration using complete
medium without hypoxanthine. Assays are performed in sterile
96-well microtiter plates, each well containing 200 .mu.l of
parasite culture (0.15% parasitemia, 2.5% hematocrit) with or
without serial drug solutions. Seven 2-fold dilutions are used
covering a range from 5 .mu.g/ml to 0.078 .mu.g/ml. For active
compounds the highest concentration is lowered (e.g. to 100 ng/ml),
for plant extracts the highest concentration is increased to 50
.mu.g/ml. Each drug is tested in duplicate and repeated once for
active compounds showing an IC.sub.50 below 0.5 .mu.g/ml. After 48
hours of incubation at 37.degree. C., 0.5 .mu.Ci
.sup.3H-hypoxanthine is added to each well. Cultures are incubated
for a further 24 h before they are harvested onto glass-fiber
filters and washed with distilled water. The radioactivity is
counted using a Betaplate.TM. liquid scintillation counter (Wallac,
Zurich, Switzerland). The results are recorded as counts per minute
(CPM) per well at each drug concentration and expressed as
percentage of the untreated controls. From the sigmoidal inhibition
curves IC.sub.50 values are calculated.
Primary Screen
[0355] K1 strain is used. The compounds are tested at 7
concentrations (5000 to 78 ng/ml). Artemisinin and chloroquine are
included as reference drugs. If the IC.sub.50 is >5 .mu.g/ml,
the compound is classified as inactive If the IC.sub.50 is 0.5-5
.mu.g/ml, the compound is classified as moderately active If the
IC.sub.50 is <0.5 .mu.g/ml, the compound is classified as active
and is further evaluated using two strains, K1 and NF54. A new
range of concentrations is chosen depending on the IC.sub.50
determined (e.g. 100 to 1.56 ng/ml) and the assay is carried out
2.times. independently. The standard drugs are chloroquine and
artemisinin which are run in the same assay. The IC.sub.50 values
for chloroquine are 2.9 ng/ml for NF54 and 48 ng/ml for K1; for
artemisinin 1.9 ng/ml for NF54 and 0.8 ng/ml for K1.
Secondary Screen
[0356] Test compounds are tested against a panel of say, 14
different of different origin and some show resistances to
chloroquine and/or pyrimethamine. If the range of the IC.sub.50
values for the 14 strains is within a factor 3-5.times. then the
tested compound is considered not to show cross resistance.
Example B2
Malaria Enzyme Assays
[0357] Inhibition of Plasmodium falciparum dUTPase
Chemicals
[0358] 2'-dUTP, was purchased from Pharmacia. MgCl.sub.2, BSA, and
the pH indicator cresol red were from Sigma. The buffer
N,N-bis(2-hydroxyethyl)glycine (BICINE) was obtained from USB
(United States Biochemical), Ohio. All the concentrations of
nucleotides were calculated spectrophotometrically (HP-8453,
Hewlett Packard) at 280 nm, using the extinction coefficient
(.epsilon..sub.280 nm=1.75 ml mg.sup.-1 cm.sup.-1). Other chemicals
used in these experiments were of the highest quality
available.
Cloning of the PFdut Gene
[0359] Conserved motifs of the human dUTPase enzyme were used as
query to identify the PFdut gene in the www.tigr.org database of
the Plasmodium falciparum 3D7 strain. The entire coding sequence
was amplified by the PCR using as template cDNA and as primers the
oligonucleotides ATG-PFdut (CATATGCATTTAAAAATTGTATGTCTG) and
TGA-PFdut (GGATCCTCAATATTTATTATCGATGTCGATC) which were designed so
that NdeI and BamHI restriction sites were introduced at the 5' and
3' ends for convenient cloning in the expression vector pET11
(Stratagene). The amplified product was cloned into pGEMT (Promega)
and propagated in E. coli XL1B cells. In order to confirm the
correct sequence after amplification, sequencing was performed
using an Applied Biosystems Automated Sequencer, at the Analytical
Services of the Instituto de Parasitologia y Biomedicina "Lopez
Neyra". These Services also supplied the oligonucleotides designed
for the sequencing
P. falciparum dUTPase Overexpression and Purification
[0360] Recombinant P. falciparum dUTPase was purified from E. coli
BL21 (DE3) cells transformed with pET-PFdut. Pellets from a liter
of culture were resuspended in a solution consisting of buffer A
(20 mM MES pH 5.5, 50 mM NaCl, 1 mM DTT) plus the protease
inhibitors 1 mM PMSF, 20 .mu.g/ml leupeptin and 1 mM benzamidine.
Purification was carried out in a cold room (4.degree. C.). The
soluble crude extract was obtained by sonication in a Vibra-cell
(Sonics and Materials Inc. Danbury, Conn., USA) and centrifugation
at 14000.times.g. The extract was loaded onto a phosphocellulose
column (Whatman) pre-equilibrated with buffer A at a flow rate of 1
ml/min. After washing the column with 100 ml of buffer A, elution
was performed using a linear NaCl gradient of 50 to 1000 mM. Peak
fractions with a low concentration of contaminating protein, as
judged by 15% SDS-PAGE gels, were pooled and then loaded and
chromatographed on a Superdex 200 column at a flow rate of 0.5
ml/min. The column was equilibrated with buffer B (50 mM Bicine, 1
mM DTT, 10 mM MgCl.sub.2). Peak fractions were pooled and
concentrated to about 5 mg/ml by ultrafiltration in a Centripep
tube (Amicon) and stored at -80.degree. C.
Kinetic Measurements
[0361] Nucleotide hydrolysis was monitored by mixing enzyme and
substrate with a rapid kinetic accessory (Hi-Tech Scientific)
attached to a spectrophotometer (Cary 50) and connected to a
computer for data acquisition and storage. Protons, released
through the hydrolysis of nucleotides, were neutralised by a pH
indicator in a weak buffered medium with similar pK.sub.a and
monitored spectrophotometrically at the absorbance peak of the
basic form of the indicator. Absorbance changes were kept within
0.1 units. The indicator/buffer pair used was cresol red/BICINE (2
mM/50 .mu.M, pH 8, 573 nm). The measurements were performed at
25.degree. C., and the solutions were previously degassed. Assays
contained 30 nM purified recombinant enzyme, 50 .mu.M dUTP, 5 mM
MgCl.sub.2 and 2.5 mM DTT, 1.25 mg/ml BSA and 100 mM KCl. Indicator
absorbance changes corresponding to complete hydrolysis of
nucleotides were recorded in the computer, and the kinetic
parameters V.sub.max and K.sub.mapp (or slope) were calculated by
fitting the data to the integrated Michaelis-Menten equation
(Segel, 1975).
[dUMP]/t=V.sub.max-K.sub.map/t In [dUTP]/([dUTP]-[dUMP])
[0362] Solutions of potential inhibitors were prepared at 10 mg/ml
and tested routinely at concentrations of 2, 10, and 50
.mu.g/.mu.l. A wider range of concentrations was further tested
when necessary for K.sub.i determination. The different apparent
K.sub.m values attained were plotted against inhibitor
concentration and K.sub.i values were obtained according to the
following equation:
K map = K m K i [ I ] + K m ##EQU00001##
Example B3
Human dUTPase Assay
[0363] Human recombinant dUTPase was purified from E. coli BL21
(DE3) cells transformed with pETHudut (Dr. P. O. Nyman, Lund
University). Purification was accomplished as described for the
dUTPase above except that the last step in Superdex 200 was
omitted. Likewise, conditions for enzyme assays were the same as
described above except that the enzyme concentration was 50 nM.
Example B4
Trypanosoma brucei Whole Cell Assays
Parasite Cultures
[0364] Three strains of T. brucei spp. are used in this study: (a)
Trypanosoma brucei rhodesiense STIB 900, a clone of a population
isolated in 1982 from a patient in Tanzania which is known to be
susceptible to all currently used drugs; (b) Trypanosoma brucei
gambiense STIB 930, a derivative of strain TH1/78E (031) isolated
in 1978 from a patient in Ivory Coast which is known to be
sensitive to all drugs used, and (c) Trypanosoma brucei brucei STIB
950, a clone of a population isolated in 1985 from a bovine in
Somalia which shows drug resistance to diminazene, isometamidium
and quinapyramine. The bloodstream form trypomastigotes of the
strains a and c are maintained in MEM medium with Earle's salts
supplemented with 25 mM HEPES, 1 g/l additional glucose, 1% MEM
non-essential amino acids (100.times.), 0.2 mM 2-mercaptoethanol, 2
mM Na-pyruvate, 0.1 mM hypoxanthine and 15% heat inactivated horse
serum. The bloodstream form trypomastigotes of strain b are
maintained in MEM medium with Earle's salts supplemented with 25 mM
HEPES, 1 g/l additional glucose, 1% MEM non-essential aminoacids
(100.times.), 0.2 mM 2-mercaptoethanol, 2 mM Na-pyruvate, 0.1 mM
hypoxanthine, 0.05 mM bathocuproine disulphonic acid, 0.15 mM
L-cysteine and 15% heat inactivated pooled human serum. All
cultures and assays are conducted at 37.degree. C. under an
atmosphere of 5% CO.sub.2 in air.
Drug Sensitivity Assays
[0365] Stock drug solutions are prepared in 100% DMSO (unless
otherwise suggested by the supplier) at 10 mg/ml, and heated or
sonicated if necessary. After use the stocks are kept at
-20.degree. C. For the assays, the compound is further diluted to
the appropriate concentration using complete medium. Assays are
performed in 96-well microtiter plates, each well containing 100
.mu.l of culture medium with 8.times.10.sup.3 bloodstream forms
with or without a serial drug dilution. The highest concentration
for the test compounds is 90 .mu.g/ml. Seven 3-fold dilutions are
used covering a range from 90 .mu.g/ml to 0.123 .mu.g/ml. Each drug
is tested in duplicate and each assay is repeated at least once.
After 72 hrs of incubation the plates are inspected under an
inverted microscope to assure growth of the controls and sterile
conditions. 10 .mu.l of Alamar Blue (12.5 mg resazurin dissolved in
100 ml distilled water) are now added to each well and the plates
incubated for another 2 hours. Then the plates are read with a
Spectramax Gemini XS microplate fluorometer (Molecular Devices
Cooperation, Sunnyvale, Calif., USA) using an excitation wave
length of 536 nm and an emission wave length of 588 nm. Data are
analysed using the microplate reader software Softmax Pro
(Molecular Devices Cooperation, Sunnyvale, Calif., USA).
Primary Screen
[0366] The preliminary screen uses the Trypanosoma b. rhodesiense
strain. The compounds are tested at 7 concentrations (drug
concentrations ranging from 90 .mu.g/ml to 0.123 .mu.g/ml in 3-fold
dilutions). If the IC.sub.50 is >3 .mu.g/ml, the compound is
classified as inactive If the IC.sub.50 is 0.2-3 .mu.g/ml, the
compound is classified as moderately active If the IC.sub.50 is
<0.2 .mu.g/ml, the compound is classified as active The standard
drug is melarsoprol which is run in the same assay; the IC.sub.50
for melarsoprol is 1.6 ng/ml.
Secondary Screen
[0367] Active compounds (IC.sub.50<0.2 .mu.g/ml) are tested
against the Trypanosoma brucei gambiense STIB 930 and the drug
resistant T. b. brucei STIB 950 following the same protocol as
described above. The standard drug is melarsoprol which is run in
the same assay; the IC.sub.50 for melarsoprol is 4.2 ng/ml for STIB
930 and 2.8 ng/ml for STIB 950
Example B5
Trypanosoma cruzi Whole Cell Assays
[0368] Trypanosoma cruzi Cell Cultures: The Trypanosoma cruzi
Tulahuen C2C4 strain, containing the -galactosidase (Lac Z) gene,
is used. The plasmid construct by Dr. S. Reed was obtained from Dr.
F. Buckner, Seattle, as epimastigotes in LIT medium. The infective
amastigote and trypomastigote stages are cultivated in L-6 cells
(rat skeletal myoblast cell line) in RPMI 1640 supplemented with 2
mM L-glutamine and 10% heat-inactivated foetal bovine serum in 12.5
cm.sup.2 tissue culture flasks. Amastigotes develop
intracellularly, differentiate into trypomastigotes and leave the
host cell. These trypomastigotes infect new L-6 cells and are the
stages used to initiate an infection in the assay. All cultures and
assays are conducted at 37.degree. C. under an atmosphere of 5%
CO.sub.2 in air.
Drug Sensitivity Assays
[0369] Stock drug solutions are prepared in 100% DMSO
(dimethylsulfoxide) unless otherwise suggested by the supplier at
10 mg/ml, and heated or sonicated if necessary. The stocks are kept
at -20.degree. C. For the assays, the compound is further diluted
to the appropriate concentration using complete medium. Assays are
performed in sterile 96-well microtiter plates, each well
containing 100 .mu.l medium with 2.times.10.sup.3 L-6 cells. After
24 hours 50 .mu.l of a trypanosome suspension containing
5.times.10.sup.3 trypomastigote bloodstream forms from culture are
added to the wells. 48 hours later the medium is removed from the
wells and replaced by 100 .mu.l fresh medium with or without a
serial drug dilution. At this point the L-6 cells should be
infected with amastigotes and no free trypomastigotes should be in
the medium. Seven 3-fold dilutions are used covering a range from
90 .mu.g/ml to 0.123 .mu.g/ml. Each drug is tested in duplicate.
After 96 hours of incubation the plates are inspected under an
inverted microscope to assure growth of the controls and sterility.
Then the substrate CPRG/Nonidet (50 l) is added to all wells. A
colour reaction will become visible within 2-6 hours and can be
read photometrically at 540 nm. Data are transferred into a graphic
programme (e.g. EXCEL), sigmoidal inhibition curves determined and
IC.sub.50 values calculated.
Primary Screen
[0370] Benznidazole is used as the reference drug and shows an
IC.sub.50 value of 0.34 .mu.g/ml. If the IC.sub.50 is >30
.mu.g/ml, the compound is classified as inactive. If the IC.sub.50
is between 2 and 30 .mu.g/ml, the compound is classified as
moderately active. If the IC.sub.50 is <2 .mu.g/ml, the compound
is classified as active.
Example B6
Leishmaniasis
Macrophage In Vitro Screening Model
Parasite and Cell Cultures
[0371] The Leishmania.donovani strain MHOM/ET/67/L82 obtained from
Dr. S. Croft, London) is used. The strain is maintained in the
Syrian Golden hamster. Amastigotes are collected from the spleen of
an infected hamster Amastigotes are grown in axenic culture at
37.degree. C. in SM medium (Cunningham I., J. Protozool. 24,
325-329, 1977) at pH 5.4 supplemented with 10% heat-inactivated
foetal bovine serum under an atmosphere of 5% CO.sub.2 in air.
Primary peritoneal macrophages from NMRI mice are collected 1 day
after a macrophage production stimulation with an i.p injection of
2 ml of a 2% potato starch suspension (FLUKA, Switzerland) All
cultures and assays are done at 37.degree. C. under an atmosphere
of 5% CO.sub.2 in air.
Drug Sensitivity Assays
[0372] Stock drug solutions are prepared in 100% DMSO (unless
otherwise suggested by the supplier) at 10 mg/ml, and heated or
sonicated if necessary. After use the stocks are kept at
-20.degree. C. For the assays, the compound is further diluted in
serum-free culture medium and finally to the appropriate
concentration in complete medium. Assays are performed in sterile
16-well chamber slides (LabTek, Nalgene/Nunc Int.) To each well 100
.mu.l of a murine macrophage suspension (4.times.10.sup.5/ml) in
RPMI 1640 (containing bicarbonate and HEPES) supplemented with 10%
heat inactivated fetal bovine serum is added. After 24 hrs 100
.mu.l of a suspension containing amastigotes
(1.2.times.10.sup.6/ml) is added resulting in a 3:1 ratio of
amastigotes/macrophages. The amastigotes are harvested from an
axenic amastigote culture and suspended in RPMI/FBS. 24 hrs later,
the medium containing free amastigotes is removed, washed 1.times.
and replaced by fresh medium containing four 3-fold drug dilutions.
In this way 4 compounds can be tested on one 16-well tissue culture
slide. Untreated wells serve as controls. Parasite growth in the
presence of the drug is compared to control wells. After 4 days of
incubation the culture medium is removed and the slides fixed with
methanol for 10 min followed by staining with a 10% Giemsa
solution. Infected and non-infected macrophages are counted for the
control cultures and the ones exposed to the serial drug dilutions.
The infection rates are determined. The results are expressed as %
reduction in parasite burden compared to control wells, and the
IC.sub.50 calculated by linear regression analysis.
Primary Screen
[0373] The compounds are tested in duplicate at 4 concentrations
ranging from 9 to 0.3 .mu.g/m. If the 1050 is below 0.3 .mu.g/ml
then the range is changed to 1 to 0.03 .mu.g/ml. Miltefosine is
used as the reference drug and shows an IC.sub.50 value of 0.325
.mu.g/ml (0.22-0.42 .mu.g/ml; n=4) If the IC.sub.50 is higher than
10 .mu.g/ml, the compound is classified as inactive. If the
IC.sub.50 is between 2 and 10 .mu.g/ml, the compound is classified
as moderately active. If the IC.sub.50 is <2 .mu.g/ml, the
compound is classified as active and is further evaluated in a
secondary screening.
Drug Sensitivity Assays
[0374] Stock drug solutions are prepared in 100% DMSO
(dimethylsulfoxide) unless otherwise suggested by the supplier at
10 mg/ml, and heated or sonicated if necessary. The stocks are kept
at -20.degree. C. For the assays, the compound is further diluted
to the appropriate concentration using complete medium. Assays are
performed in sterile 96-well microtiter plates, each well
containing 100 .mu.l medium with 2.times.10.sup.3 L-6 cells. After
24 hours 50 .mu.l of a trypanosome suspension containing
5.times.10.sup.3 trypomastigote bloodstream forms from culture are
added to the wells. 48 hours later the medium is removed from the
wells and replaced by 100 .mu.l fresh medium with or without a
serial drug dilution. At this point the L-6 cells should be
infected with amastigotes and no free trypomastigotes should be in
the medium. Seven 3-fold dilutions are used covering a range from
90 .mu.g/ml to 0.123 .mu.g/ml. Each drug is tested in duplicate.
After 96 hours of incubation the plates are inspected under an
inverted microscope to assure growth of the controls and sterility.
Then the substrate CPRG/Nonidet (50 .mu.l) is added to all wells. A
colour reaction will become visible within 2-6 hours and can be
read photometrically at 540 nm. Data are transferred into a graphic
programme (e.g. EXCEL), sigmoidal inhibition curves determined and
IC.sub.50 values calculated.
Primary Screen
[0375] Benznidazole is used as the reference drug and shows an
IC.sub.50 value of 0.34 .mu.g/ml. If the IC.sub.50 is >30
.mu.g/ml, the compound is classified as inactive. If the IC.sub.50
is between 2 and 30 .mu.g/ml, the compound is classified as
moderately active. If the IC.sub.50 is <2 .mu.g/ml, the compound
is classified as active.
Example B7
Leishmania donovani, Axenic Amastigote Assay
Parasite and Cell Cultures:
[0376] The Leishmania donovani strain MHOM/ET/67/L82) is used. The
strain is maintained in the hamster. Amastigotes are collected from
the spleen of an infected hamster and adapted to axenic culture
conditions at 37.degree. C. The medium is a 1:1 mixture of SM
medium (Cunningham I., J. Protozool. 24, 325-329, 1977) and SDM-79
medium (Brun, R. & Schonenberger, M., Acta Trop. 36, 289-292,
1979) at pH 5.4 supplemented with 10% heat-inactivated FBS under an
atmosphere of 5% CO.sub.2 in air.
Drug Sensitivity Assays
[0377] Stock drug solutions are prepared in 100% DMSO (unless
otherwise suggested by the supplier) at 10 mg/ml, and heated or
sonicated if necessary. After use the stocks are kept at
-20.degree. C. For the assays, the compound is further diluted to
the appropriate concentration using complete medium. Assays are
performed in 96-well microtiter plates, each well containing 100
.mu.l of culture medium with 10.sup.5 amastigotes from axecic
culture with or without a serial drug dilution. The highest
concentration for the test compounds is 90 .mu.g/ml. Seven 3-fold
dilutions are used covering a range from 30 .mu.g/ml to 0.041
.mu.g/ml. Each drug is tested in duplicate and each assay is
repeated at least once. After 72 hours of incubation the plates are
inspected under an inverted microscope to assure growth of the
controls and sterile conditions. 10 .mu.l of Alamar Blue (12.5 mg
resazurin dissolved in 1 L distilled water) are now added to each
well and the plates incubated for another 2 hours. Then the plates
are read with a Spectramax Gemini XS microplate fluorometer
(Molecular Devices Cooperation, Sunnyvale, Calif., USA) using an
excitation wave length of 536 nm and an emission wave length of 588
nm. Data are analysed using the microplate reader software Softmax
Pro (Molecular Devices Cooperation, Sunnyvale, Calif., USA).
Primary Screen
[0378] The compounds are tested in duplicate at 7 concentrations.
Miltefosine is used as the reference drug and shows an IC.sub.50
value of 0.12 .mu.g/ml. If the IC.sub.50 is >3 .mu.g/ml, the
compound is classified as inactive If the IC.sub.50 is 0.1-3
.mu.g/ml, the compound is classified as moderately active If the
IC.sub.50 is <0.1 .mu.g/ml, the compound is classified as
active
Secondary Screen
[0379] Active and moderately active compounds are tested in the
macrophage assay with intracellular amastigotes in their host
cells, murine macrophages.
Example B8
Biological Results
[0380] Compounds of the invention, such as those in the examples
above typically show activities in the low micromolar range for
Plasmodium falciparum enzyme (K.sub.i) and cell culture
(ED.sub.50), with selectivity (SI) over the human enzyme of at
least 10-fold:
TABLE-US-00001 R Ki uM SI ED.sub.50 uM ##STR00055## Ph.sub.3CO
TBDPSO TPSO Ph.sub.3CNH 1.8 4.2 2.8 0.2 10 191 324 230 6 6.6 1.1
4.5 ##STR00056## Ph.sub.3CO Ph.sub.3NH 515 313 nd nd 1 1.8
##STR00057## TBDPSO TPSO 1.2 1.3 >833 >769 3.0 1.0
##STR00058## TBDPSO TPSO Ph.sub.3CO Ph.sub.3NH 89 975 5 12 9 nd 91
>83 8.8 1.0 2.0 5.3
ABBREVIATIONS
TABLE-US-00002 [0381] TBDPSO tert-butyldiphenylsilyloxy DMF
dimethylformamide TPSO triphenylsilyloxy DCM dichloromethane TBDMS
tert-butyldimethylsilyl RT room temperature THF tetrahydrofuran Ac
acetyl TEA triethylamine LAH lithium- TLC thin layer chromatography
aluminiumhydride DMAP dimethylaminopyridine
Throughout the specification and the claims which follow, unless
the context requires otherwise, the word `comprise`, and variations
such as `comprises` and `comprising`, will be understood to imply
the inclusion of a stated integer, step, group of integers or group
of steps but not to the exclusion of any other integer, step, group
of integers or group of steps.
Sequence CWU 1
1
2127DNAArtificial SequenceSynthetic oligonucleotide 1catatgcatt
taaaaattgt atgtctg 27231DNAArtificial SequenceSynthetic
oligonucleotide 2ggatcctcaa tatttattat cgatgtcgat c 31
* * * * *
References