U.S. patent application number 12/552103 was filed with the patent office on 2010-03-18 for methods of treating bone disease using vascular endothelial growth factor fusion constructs.
Invention is credited to Michael ROSENBLUM.
Application Number | 20100069303 12/552103 |
Document ID | / |
Family ID | 36060483 |
Filed Date | 2010-03-18 |
United States Patent
Application |
20100069303 |
Kind Code |
A1 |
ROSENBLUM; Michael |
March 18, 2010 |
METHODS OF TREATING BONE DISEASE USING VASCULAR ENDOTHELIAL GROWTH
FACTOR FUSION CONSTRUCTS
Abstract
The 121-amino acid isoform of vascular endothelial growth factor
(VEGF.sub.121) is linked by a flexible G4S tether to a cytotoxic
molecule such as toxin gelonin or granzyme B and expressed as a
soluble fusion protein. The VEGF.sub.121 fusion protein exhibits
significant anti-tumor vascular-ablative effects that inhibit the
growth of primary tumors and inhibit metastatic spread and
vascularization of metastases. The VEGF.sub.121 fusion protein also
target osteoclast precursor cells in vivo and inhibits
osteoclastogenesis.
Inventors: |
ROSENBLUM; Michael;
(Sugarland, TX) |
Correspondence
Address: |
FULBRIGHT & JAWORSKI, L.L.P.
600 CONGRESS AVENUE, SUITE 2400
AUSTIN
TX
78701
US
|
Family ID: |
36060483 |
Appl. No.: |
12/552103 |
Filed: |
September 1, 2009 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10919193 |
Aug 16, 2004 |
7601341 |
|
|
12552103 |
|
|
|
|
10846022 |
May 14, 2004 |
|
|
|
10919193 |
|
|
|
|
60476209 |
Jun 5, 2003 |
|
|
|
Current U.S.
Class: |
514/6.9 |
Current CPC
Class: |
C07K 14/52 20130101;
C07K 2319/55 20130101; C07K 2319/02 20130101; A61K 47/642 20170801;
A61P 19/02 20180101; A61P 19/10 20180101; A61K 38/00 20130101; A61P
35/00 20180101; C07K 2319/00 20130101 |
Class at
Publication: |
514/12 |
International
Class: |
A61K 38/16 20060101
A61K038/16; A61P 19/02 20060101 A61P019/02 |
Goverment Interests
FEDERAL FUNDING LEGEND
[0002] This invention was produced in part using funds obtained
through Grants 5P30CA16672-26 and P30 CA016672-28 from the National
Cancer Institute and Grants ROI CA 7495 and P50 CA91846 from the
National Institutes of Health. Consequently, the federal government
has certain rights in this invention.
Claims
1-21. (canceled)
22. A method of treating a subject with a bone disease, comprising
administering to a subject with a bone disease a pharmaceutically
effective amount of a composition comprising a conjugate comprising
a cytotoxic polypeptide and a VEGF polypeptide that binds to both
vascular endothelial growth factor (VEGF) receptor type 1 (Flt-1)
and VEGF receptor type 2 (kinase domain receptor/Flk-1).
23. The method of claim 22, wherein the subject is a human.
24. The method of claim 22, wherein the bone disease is an
osteolytic bone lesion.
25. The method of claim 22, wherein the bone disease is bone
lysis.
26. The method of claim 22, wherein the bone disease is
osteoporosis.
27. The method of claim 22, wherein the bone disease is
osteoarthritis.
28. The method of claim 22, wherein the bone disease is a
tumor.
29. The method of claim 22, wherein tumor is skeletal
metastasis.
30. The method of claim 22, wherein the conjugate is a fusion
protein of a VEGF polypeptide and a cytotoxic polypeptide.
31. The method of claim 22, wherein said VEGF polypeptide comprises
an amino acid sequence selected from the group consisting of SEQ ID
NOs:28-34.
32. The method of claim 22, wherein the cytotoxic polypeptide is a
toxin or a signal transduction protein capable of generating
apoptotic signals.
33. The method of claim 22, wherein the toxin is gelonin.
34. The method of claim 32, wherein the signal transduction protein
capable of generating apoptotic signals is selected from the group
consisting of granzyme B, Bax, TNF-a, TNF-b, TNF-like molecule,
TGF-b, IL-12, IL-3, IL-24, IL-18, TRAIL, IFN-a, IFN-b, IFN-g,
Bcl-2, Fas ligand and caspases.
35. The method of claim 34, wherein the signal transduction protein
capable of generating apoptotic signals is granzyme B.
36. The method of claim 22, wherein the conjugate is a fusion
protein comprising the 121-amino acid isoform of vascular
endothelial growth factor (VEGF.sub.121) and gelonin.
37. The method of claim 22, wherein the conjugate is a fusion
protein comprising the 121-amino acid isoform of vascular
endothelial growth factor (VEGF.sub.121) and granzyme B.
Description
CROSS-REFERENCE TO RELATED APPLICATION
[0001] This continuation-in-part patent application claims benefit
of priority of U.S. Ser. No. 10/846,022, filed May 14, 2004, which
claims benefit of provisional patent application U.S. Ser. No.
60/476,209, filed Jun. 5, 2003, now abandoned.
BACKGROUND OF THE INVENTION
[0003] 1. Field of the Invention
[0004] The present invention relates generally to the fields of
cancer research and targeted therapy. More specifically, the
present invention relates to fusion constructs comprising an
isoform of vascular endothelial growth factor and uses of such
constructs.
[0005] 2. Description of the Related Art
[0006] Vascular endothelial growth factor (VEGF)-A plays a central
role in the growth and metastasis of solid tumors, and acts as a
primary stimulant of vascularization in solid tumors. VEGF-A
enhances endothelial cell proliferation, migration, and survival
and is essential for blood vessel formation. Other roles of
vascular endothelial growth factor include wound healing, vascular
permeability and the regulation of blood flow. Through alternative
splicing of RNA, human vascular endothelial growth factor exists as
at least four isoforms of 121, 165, 189, or 206 amino acids. The
lowest molecular weight isoform, designated VEGF.sub.121, is a
non-heparan sulfate-binding isoform that exists in solution as a
disulfide-linked homodimer.
[0007] VEGF is released by a variety of tumor cells. The angiogenic
actions of VEGF are mediated through two related receptor tyrosine
kinases, kinase domain receptor (KDR) and FLT-1 in the human, and
Flk-1 and Flt-1 in the mouse. Both are largely restricted to
vascular endothelial cells. KDR/Flk-1 and FLT-1 receptors are
overexpressed on the endothelium of tumor vasculature. In contrast,
these receptors are almost undetectable in the vascular endothelium
of adjacent normal tissues. The receptors for vascular endothelial
growth factor thus seem to be excellent targets for the development
of therapeutic agents that inhibit tumor growth and metastatic
spread through inhibition of tumor neovascularization.
[0008] To this end, VEGF.sub.121 would be an appropriate carrier to
deliver a toxic agent selectively to tumor vascular endothelium.
VEGF.sub.121 exists in solution as a disulfide linked homodimer and
binds to KDR and FLT-1 in a heparin-independent manner. It does not
bind neuropilin-1 or neuropilin-2. VEGF.sub.121 has been shown to
contain the full biological activity of the larger variants.
[0009] Molecular engineering enabled the synthesis of novel
chimeric molecules having therapeutic potential. Chimeric fusion
constructs targeting the IL-2 receptor, the EGF receptor, and other
growth factor/cytokine receptors have been described. It has also
been showed that a chemical conjugate of vascular endothelial
growth factor and truncated diphtheria toxin has impressive
cytotoxic activity on cell lines expressing receptors for vascular
endothelial growth factor. Further studies with VEGF/diphtheria
toxin fusion constructs demonstrated selective toxicity to
Caprice's sarcoma cells and dividing endothelial cells in vitro and
in vivo. However, the prior art is deficient in fusion constructs
comprising vascular endothelial growth factor and other cytotoxic
molecule with improved biochemical and pharmacological properties.
The present invention fulfills this long-standing need and desire
in the art.
SUMMARY OF THE INVENTION
[0010] The present invention discloses targeting of neovasculature
of solid tumors with a chimeric fusion toxin comprising the
121-amino acid isoform of vascular endothelial growth factor
(VEGF.sub.121). In one embodiment, the chimeric fusion toxin
(VEGF.sub.121/rGel) consists of VEGF.sub.121 and recombinant
gelonin (rGel), a low molecular weight single chain toxin with a
mechanism of action similar to that of ricin A-chain. VEGF.sub.121
is linked by a flexible G4S tether to the toxin gelonin and
expressed as a soluble protein in bacteria. Both VEGF.sub.121/rGel
and VEGF.sub.121 stimulated cellular kinase domain receptor (KDR)
phosphorylation. The VEGF.sub.121/rGel fusion construct was highly
cytotoxic to endothelial cells overexpressing the KDR/Flk-1
receptor. Endothelial cells overexpressing FLT-1 were not sensitive
to the fusion protein.
[0011] While several studies have shown both receptors of
VEGF.sub.121, namely VEGFR-1 (FLT-1) and VEGFR-2 (KDR/Flk-1), to be
over-expressed on the endothelium of tumor vasculature, the present
invention reports several surprising results which demonstrate that
VEGF.sub.121/rGel has several advantageous properties. Cell ELISA
using antibodies specific to either KDR or FLT-1 indicate binding
of VEGF.sub.121/rGel to both receptors. While VEGF.sub.121/rGel
binds to both FLT-1 and KDR, internalization of VEGF.sub.121/rGel
is mediated only by KDR and not FLT-1.
[0012] Experiments with human melanoma, human prostate tumor or
bladder tumor xenografts demonstrate successful use of
VEGF.sub.121/rGel fusion construct for the targeted destruction of
tumor vasculature in viva The present invention also indicates that
the anti-tumor vascular-ablative effect of VEGF.sub.121/rGel may be
utilized not only for treating primary tumors but also for
inhibiting metastatic spread and vascularization of metastases.
Taken together, these results indicate that selective destruction
of tumor vasculature can be achieved with VEGF.sub.121/rGel in
mice, giving impressive antitumor effects. Gross morphological
toxicity to normal organs was not visible in animals treated with a
therapeutic dose. Therefore, VEGF.sub.121/rGel is a potential
antitumor agent useful for treating cancer patients.
[0013] In another embodiment, there is provided a chimeric fusion
toxin (GrB/VEGF.sub.121) consisting of VEGF.sub.121 and granzyme B
(GrB), a serine protease capable of inducing apoptosis through both
caspase-dependent and caspase-independent pathways.
GrB/VEGF.sub.121 induced apoptotic events specifically on
FLK-1-expressing porcine aortic endothelial cells as assessed by
terminal deoxynucleotidyl transferase-mediated nick end labeling
assay, DNA laddering, and cytochrome c release from mitochondria.
In addition, the fusion construct mediated cleavage of caspase-8,
caspase-3, and poly(ADP-ribose) polymerase in target endothelial
cells within 4 h after treatment. In conclusion, delivery of the
human proapoptotic pathway enzyme granzyme B to tumor vascular
endothelial cells or to tumor cells may have significant
therapeutic potential and represents a potent new class of targeted
therapeutic agents with a unique mechanism of action.
[0014] Thus, the present invention is directed to compositions of
matter comprising a conjugate comprising an isoform of vascular
endothelial growth factor (VEGF) and a cytotoxic molecule. In
another embodiment, the conjugate comprises a cytotoxic molecule
and a peptide that binds to both VEGF receptor type 1 (Flt-1) and
VEGF receptor type 2 (kinase domain receptor/Flk-1). In general,
the cytotoxic molecule is a toxin such as gelonin or a molecule
that induces apoptosis such as granzyme B.
[0015] In another embodiment of the present invention, there are
provided methods of killing cells expressing type 2 or type 1 VEGF
receptors by the present conjugates which are internalized by VEGF
receptor type 2 or type 1 respectively.
[0016] In yet another embodiment, there are provided methods of
using the conjugates of the present invention to inhibit tumor
growth, metastatic spread or vascularization of metastases in an
animal or a human.
[0017] The present invention further provides methods of using the
conjugates of the present invention to inhibit osteoclastogenesis
or angiogenesis in an animal or a human.
[0018] Other aspects, features, and advantages of the present
invention will be apparent from the following description of the
presently preferred embodiments of the invention. These embodiments
are given for the purpose of disclosure.
BRIEF DESCRIPTION OF THE DRAWINGS
[0019] FIG. 1 shows the design and construction of
VEGF.sub.121/rGel. Constructs of the targeting molecule
(VEGF.sub.121) to the cytotoxic agent (gelonin) were expressed in
two orientations, with either VEGF.sub.121 or gelonin at the
N-terminus. A G4S tether was used to fuse VEGF.sub.121 and gelonin
and reduce steric hindrance.
[0020] FIG. 2 shows a rabbit reticulocyte assay used to determine
the ability of VEGF.sub.121/rGel and rGel to inhibit translation in
a cell-free system. The fusion of VEGF.sub.121 and recombinant
gelonin does not reduce the activity of the toxin component.
[0021] FIG. 3 shows an ELISA demonstrating that VEGF.sub.121/rGel
binds to the receptor. VEGF.sub.121/rGel, VEGF.sub.121 and rGel
were incubated with biotinylated mouse flk-1 receptor attached to
NeutrAvidin-coated plates. Binding was assessed using anti-gelonin
and anti-VEGF antibodies. FIG. 4 shows binding to flk-1 receptor is
specific for VEGF.sub.121/rGel. VEGF.sub.121/rGel or VEGF.sub.121
was incubated with flk-1 receptor. Binding of VEGF.sub.121/rGel was
competed with VEGF.sub.121 and a rabbit anti-gelonin antibody was
used for detection. VEGF.sub.121 specifically reduced binding of
VEGF.sub.121/rGel to flk-1. VEGF.sub.121 was not detected by the
anti-gelonin antibody (data not shown).
[0022] FIG. 5 shows cytotoxicity of VEGF.sub.121/rGel to
KDR-expressing porcine aortic endothelial cells (PAE). Cells
transfected with either the FLT-1 or KDR receptor were treated with
various doses of VEGF.sub.121/rGel or rGel for 72 h. Cells
expressing the FLT-1 receptor were equally insensitive to
VEGF.sub.121/rGel and rGel (IC.sub.50/300 nM). In contrast, cells
expressing KDR were about 200-fold more sensitive to the fusion
construct (IC.sub.50 of 0.5 nM) than they were to rGel.
[0023] FIGS. 6A-B show expression of KDR and FLT-1. FIG. 6A: Whole
cell lysate (30 .mu.g) of PAE/KDR and PAE/FLT-1 was run on an
SDS-PAGE gel, transferred to a PVDF membrane and immunoblotted
using the appropriate antibody. Expression of both receptors on
their respective cell lines was confirmed. FIG. 6B:
Receptor-specific binding of radio-labeled VEGF.sub.121/rGel is
demonstrated on cells expressing these receptors. Binding was
reduced with unlabeled VEGF.sub.121/rGel but not by unlabeled
gelonin.
[0024] FIG. 7 shows internalization of VEGF.sub.121/rGel into
PAE/KDR and PAE/FLT-1 cells. PAE/KDR cells were incubated with 4
.mu.g/ml VEGF.sub.121/rGel at the timepoints indicated. Cells were
then incubated with an anti-gelonin polyclonal antibody (1:200)
followed by a FITC-conjugated secondary antibody (1:80). Nuclei
were stained with propidium iodide. VEGF.sub.121/rGel enters
PAE/KDR cells within one hour of treatment. However, PAE/FLT-1
cells did not internalize VEGF.sub.121/rGel even after 24 hours of
incubation with VEGF.sub.121/rGel.
[0025] FIG. 8 shows the effect of exposure time of
VEGF.sub.121/rGel on PAE/KDR cells on cytotoxicity.
VEGF.sub.121/rGel was incubated with PAE/KDR cells for varying
lengths of time. While VEGF.sub.121/rGel retained cytotoxicity
towards PAE/KDR cells even with a 1 h exposure time, cytotoxicity
of this fusion toxin was markedly enhanced by an exposure time of
48 hours.
[0026] FIG. 9 shows that cytotoxicity of VEGF.sub.121/rGel to
PAE/KDR cells does not result in apoptosis. PAE/KDR cells were
grown overnight. 1 nM VEGF.sub.121/rGel (twice the IC.sub.50) was
added and incubated for 24, 48 and 72 hours. The cells were
analyzed for TUNEL. Positive control cells were incubated with 1
mg/ml DNAse for 10 minutes at 37.degree. C.
[0027] FIG. 10 shows that treatment of PAE/KDR cells with
VEGF.sub.121/rGel does not result in PARP cleavage. PAE/KDR cells
were stimulated with VEGF.sub.121/rGel or VEGF.sub.121 for the
times indicated. Cells were washed and lysed and the cell lysate
was analyzed by Western using an anti-PARP antibody. No PARP
cleavage was observed.
[0028] FIG. 11 shows inhibition of human melanoma growth in mice by
VEGF/rGel. Groups of nude mice bearing A-375M tumors were treated
intravenously with saline, rGel, or fusion construct every 2-3 days
for 11 days. Administration of rGel did not affect tumor growth.
Treatment with VEGF.sub.121/rGel at a total dose of either 17 mg/kg
or 25 mg/kg significantly suppressed tumor growth. However,
treatment at the 25 mg/kg dose level resulted in mortality by day
19. None of the animals dosed at 17 mg/kg showed gross evidence of
toxicity.
[0029] FIG. 12 shows inhibition of human prostate carcinoma growth
in mice by VEGF/rGel. Groups of nude mice bearing PC-3 tumors were
treated intravenously with saline, rGel, or the VEGF.sub.121/rGel
fusion construct (20 mg/kg total dose) every 2-3 days for 11 days.
Administration of rGel (10 mg/kg) had no effect on tumor growth. In
contrast, treatment with the fusion construct completely inhibited
tumor growth for 26 days and resulted in a 7-fold reduction in
tumor volume compared with saline-treated or rGel-treated
controls.
[0030] FIG. 13 shows the specific localization of VEGF/rGel to
tumor vasculature in PC3 tumors. Nude mice bearing human prostate
PC-3 tumors were injected i.v. with VEGF.sub.121/rGel or rGel (2.5
mg/kg). Thirty minutes after administration, tissues were removed
and snap frozen. Sections were stained with immunofluorescent
reagents to detect murine blood vessels (MECA-32, red) and with
antirGel (green). Vessels stained with both reagents appear yellow.
VEGF/rGel localized to tumor vessels, whereas rGel did not. Vessels
in all normal organs other than the kidney (glomerulus) were
unstained by VEGF/rGel. FIG. 14 shows the destruction and
thrombosis of tumor blood vessels by VEGF/rGel. Nude mice bearing
human prostate PC-3 tumors were treated i.v. with one dose of
VEGF.sub.121/rGel (2.5 mg/kg). Forty-eight hours after
administration, tissues were snap-frozen, sectioned, and stained
with hematoxylin and eosin. As shown in this representative image,
tumors from mice treated with the fusion construct had damaged
vascular endothelium. Clots were visible in the larger vessels of
the tumors, and erythrocytes were visible in the tumor
interstitium, indicating a loss of vascular integrity. In contrast,
histological damage was not visible in any normal organs, including
the kidneys, of treated mice.
[0031] FIGS. 15A-B show VEGF.sub.121/rGel is not cytotoxic to
MDA-MB-231 cells. Log-phase MDA-MB-231 cells were treated with
various doses of VEGF.sub.121/rGel or rGel for 72 hrs. The
cytotoxic effects of both agents were similar, indicating no
specific cytotoxicity of the fusion construct compared to free
toxin on these cells (FIG. 15B). Western analysis demonstrated the
presence of VEGFR-2 on endothelial cells transfected with the R2
receptor (PAE/KDR) but not on cells expressing the FLT-1 receptor
(PAE/FLT-1, negative control). The MDA-MB-231 cells did not express
detectable amounts of VEGFR-2 (FIG. 15A).
[0032] FIG. 16 shows VEGF.sub.121/rGel localizes to blood vessels
of MDA-MB-231 tumor. Mice bearing orthotopically-placed MDA-MB-31
tumors were administered one dose (i.v., tail vein) of
VEGF.sub.121/rGel. Four hours later, the mice were sacrificed and
tumors excised and fixed. Tissue sections were stained for blood
vessels using the Meca 32 antibody (red) and the section was
counter-stained using an anti-gelonin antibody (green).
Co-localization of the stains (yellow) demonstrate the presence of
the VEGF.sub.121/rGel fusion construct specifically in blood
vessels and not on tumor cells.
[0033] FIG. 17 shows VEGF.sub.121/rGel reduces number of large
metastatic colonies in lungs. The size of tumor colonies was
analyzed on slides stained with 6w/32 antibody that specifically
recognizes human HLA antigens. The antibody delineates colonies of
human tumor cells and defines borders between metastatic lesions
and mouse lung parenchyma. The largest size differences between
VEGF.sub.121/rGel and control groups were found in groups of
colonies having diameter either less than 50 .mu.m or more than
1000 .mu.m. In the VEGF.sub.121/rGel-treated mice more than 40% of
total foci were extremely small (<50 micron) as compared to 18%
in the control group. The control mice had approximately 8% of
extremely large colonies (>1000 .mu.m) whereas
VEGF.sub.121/rGel-treated mice did not have colonies of this
size.
[0034] FIGS. 18A-B show VEGF.sub.121/rGel inhibits vascularization
of MDA-MB-231 pulmonary metastases. Lungs derived from
VEGF.sub.121/rGel and rGel-treated mice were stained with MECA 32
antibody and the number of vessels per mm.sup.2 within the
metastatic foci was determined (FIG. 18A). The mean number of
vessels per mm.sup.2 in lung metastases of
VEGF.sub.121/rGel-treated mice was reduced by approximately 50% as
compared to those in rGel-treated mice. FIG. 18B shows
representative images demonstrating reduction of vascular density
in foci of comparable size in mice treated with rGel (left) and
VEGF.sub.121/rGel fusion protein (right).
[0035] FIG. 19 shows VEGF.sub.121/rGel inhibits proliferation of
metastatic MDA-MB-231 cells in the lungs. Frozen sections of lungs
derived from VEGF.sub.121/rGel or rGel-treated mice were stained
with Ki-67 antibody. Stained sections were examined under x40
objective to determine the number of tumor cells with positive
nuclei (cycling cells). Positive cells were enumerated in 10
colonies per slide on six sections derived from individual mice per
each treatment group. The mean number per group.+-.SEM is
presented. VEGF.sub.121/rGel treatment reduced the average number
of cycling cells within the metastatic foci by approximately
60%.
[0036] FIG. 20 shows detection of VEGFR-2 on vasculature of
metastatic lesions by anti-VEGFR-2 antibody RAFL-1. Frozen sections
of lungs from mice treated with VEGF.sub.121/rGel or free gelonin
were stained with monoclonal rat anti-mouse VEGFR-2 antibody RAFL-1
(10 .mu.g/ml). RAFL-1 antibody was detected by goat anti-rat
IgG-HRP. Sections were developed with DAB and counterstained with
hematoxylin. Representative images of lung metastases of comparable
size (700-800 .mu.m in the largest diameter) from each treatment
group are shown. Images were taken with an objective of X20. Note
that the pulmonary metastases from the VEGF.sub.121/rGel treated
group show both reduced vessel density and decreased intensity of
anti-VEGFR-2 staining compared to control lesions.
[0037] FIG. 21 shows in vitro cytotoxicity of VEGF.sub.121/rGel on
253J B-V bladder tumor cells. Log-phase cells were plated in
96-well plates and incubated with serial dilutions of
VEGF.sub.121/rGel or rGel for 72 h. Cytotoxicity experiment was
performed in triplicate, and data points are represented as the
mean. VEGF.sub.121/rGel is far more toxic than rGel on PAE/KDR
cells (IC.sub.50 of 1 nM versus 100 nM). In contrast, the cytotoxic
effects of both agents are substantially reduced towards 253J B-V
cells (IC.sub.50 of 100 nM with VEGF.sub.121/rGel versus 700 nM
with rGel), demonstrating less specific cytotoxicity of the fusion
construct compared to free toxin on these cells.
[0038] FIG. 22 shows the effects of VEGF.sub.121/rGel treatment on
in vivo growth of orthotopic 253J B-V bladder tumor cells. Tumor
bearing mice were treated intravenously with saline, rGel or
VEGF.sub.121/rGel. Mice were necropsied 21 days after tumor
implantation and bladder tumors were harvested. Treatment with
VEGF.sub.121/rGel results in significant suppression of bladder
tumor growth, roughly 60%, compared to controls (p<0.05).
[0039] FIG. 23 shows immunofluorescence of bladder tumor tissue
sections from mice treated with rGel or VEGF.sub.121/rGel. CD-31
(green) was seen in tissue sections from mice treated with both
VEGF.sub.121/rGel and rGel (panel A). However, the presence of
gelonin (red) was only seen in tumor tissues of mice treated with
VEGF.sub.121/rGel (panel B). Overlay of anti-CD-31 and anti-rGel
antibody fluorescence shows co-localization of rGel and CD-31,
indicating that VEGF.sub.121/rGel targets the tumor neovasculature
(panel C). No such co-localization of rGel and CD-31 was seen in
tumors from animals treated only with rGel.
[0040] FIG. 24 shows TUNEL analysis of orthotopic bladder tumors.
Tumors treated with VEGF.sub.121/rGel showed a much higher TUNEL
staining compared to controls. Negative control denotes cells
analyzed for TUNEL without addition of terminal deoxynucleotidyl
transferase, Control is a bladder tumor that was treated with
rGel.
[0041] FIG. 25 shows the effect of VEGF.sub.121/rGel in nude mice
with PC-3 tumors in bone. Mice treated with either saline or
VEGF.sub.121/Gel were analyzed by X-ray. Arrows indicate location
of osteolytic lesion only in the saline-treated animals.
[0042] FIG. 26 shows VEGF.sub.121/rGel strongly inhibits the growth
of prostate cancer cells PC-3 placed in the bone micro-environment
in mice. Animals were anesthesized prior to injection of 50,000
PC-3 cells into the distal epipysis of the right femur. Treatment
with VEGF.sub.121/rGel or saline (control) began one week after
tumor placement. Maximum tolerated dose of VEGF.sub.121/rGel was
utilized and administered i.v. as shown. Tumor growth was monitored
by X-ray and animals with large osteolytic lesions or bone lysis
were sacrificed. All control mice were sacrificed by day 67. In
contrast, 50% of the VEGF.sub.121/rGel-treated mice survived past
day 140 without sign of osteolysis. Asterisk indicates one mouse
(without tumor) did not recover from anesthesia.
[0043] FIG. 27 shows the effect of VEGF.sub.121/rGel on the number
of osteoclasts in bone sections of nude mice with PC-3 tumor
cells.
[0044] FIG. 28 shows H&E staining of bone tissue two weeks
after injection of PC-3 tumor cells. Mice treated with saline show
proliferation of PC-3 tumor cells (left panel). In contrast, mice
treated with VEGF.sub.121/rGel show isolated pockets of PC-3 tumor
cells (middle panel). Shown on the right is a representative bone
section from a VEGF.sub.121/rGel-treated mouse.
[0045] FIG. 29 shows the effects of VEGF.sub.121/rGel and rGel on
RANKL-mediated osteoclast formation. Each experiment was performed
in triplicate. The data shown is representative of three separate
experiments. RAW cells (1.times.10.sup.4/well) were cultured
overnight in 24-well plates. The cells were treated with RANKL (100
ng/ml) in the absence or presence of increasing concentrations of
VEGF.sub.121/rGel or rGel. After 4 days, the cells were fixed, TRAP
stained, and the total number of TRAP.sup.+ osteoclasts was
counted. Cytotoxicity of VEGF.sub.121/rGel and rGel was assessed in
96-well plates as described above.
[0046] FIG. 30 shows the effects of VEGF.sub.121/rGel and rGel on
M-CSF and RANKL-mediated differentiation of primary bone marrow
monocytes. Each experiment was performed in triplicate. The data
shown is representative of three separate experiments. Non-adherent
mouse bone marrow-derived monocytes were isolated from the tibia
and femur of mice and plated in 24-well plates (5.times.10.sup.4
/well) and incubated with M-CSF (10 ng/ml). After 3 days, the cells
were washed and stimulated with M-CSF (10 ng/ml) in the absence or
presence of increasing concentrations of VEGF.sub.121/rGel or rGel
and RANKL (100 ng/ml). Medium was changed on day 3. On day 5 the
cells were fixed, stained for TRAP, and the total number of
TRAP.sup.+ osteoclasts was counted. Cytotoxicity of
VEGF.sub.121/rGel and rGel was assessed in 96-well plates as
described above.
[0047] FIGS. 31A-C show PCR and Western blot analysis of osteoclast
precursor cells. RAW 264.7 cells express Flt-1 but not Flk-1.
Endothelial cells that express Flt-1 (PAE/Flt-1), KDR (PAE/KDR) or
both (HUVEC) were used as controls (FIG. 31A). Bone marrow-derived
cells of monocyte/macrophage lineage express Flt-1 but not
Flk-1/KDR. Bone marrow-derived monocyte stimulated to differentiate
by RANKL were harvested at the time points indicated and analyzed
by PCR (FIG. 31B). PCR analysis showed that Flt-1 mRNA is
down-regulated during RANKL-mediated osteoclasts differentiation of
bone marrow-derived monocyte (FIG. 31C).
[0048] FIG. 32 shows intracellular delivery of VEGF.sub.121/rGel to
RAW cells. RAW cells were treated with either VEGF.sub.121/rGel or
rGel for 24 hrs. The cells were fixed, acid-washed to remove
surface-bound material, permeabilized, and immunostained for the
presence of rGel (green). The cells were counterstained with
propidium iodide (red) to identify nuclei.
[0049] FIG. 33 shows neutralizing antibody to Flt-1, but not
anti-Flk-1/KDR, blocks the cytotoxic effect of VEGF.sub.121/rGel.
Cells were pre-treated with neutralizing antibody for 1 h prior to
addition of 40 nM VEGF.sub.121/rGel.
[0050] FIG. 34 proposes a role for VEGF in tumor invasion and
osteolytic penetration in bone.
[0051] FIG. 35 shows cloning of human granzyme B (GrB) gene from
HuT-78 cells. HuT-78 RNA was isolated, and premature GrB cDNA
(.about.800 bp) was amplified by reverse transcription-PCR and
cloned into the PCR 2.1 TA vector. The human granzyme B sequence
with 20-amino acid signal sequence was confirmed and designated as
premature granzyme B. Once the signal peptide was removed, the
mature amino-terminal Ile-Ile-Gly-Gly sequence of granzyme B was
generated.
[0052] FIG. 36 shows the construction of GrB/VEGF.sub.121 fusion
toxin by PCR and insertion into the pET32a(+) vector. Mature
granzyme B was attached to the recombinant VEGF.sub.121 carrier via
a flexible tether (G4S). A cleavage site for EK (DDDDK) was
inserted upstream and adjacent to the first amino acid isoleucine
of granzyme B. The fused gene fragment was then introduced into
XbaI and XhoI sites of the pET32a(+) vector to form the expression
vector pET32GrB/VEGF.sub.121.
[0053] FIGS. 37A-B show bacterial expression, purification, and
Western blot analysis of the GrB/VEGF.sub.121 fusion toxin. 8.5%
SDS-PAGE and Coomassie blue staining under reducing conditions
showed that GrB/VEGF.sub.121 was expressed as a 55-kDa molecule
with tags and the size of the final purified GrB/VEGF.sub.121 was
.about.38 kDa (FIG. 37A). Western blotting confirmed that the
fusion protein reacted with either mouse anti-VEGF or mouse
anti-GrB antibody (FIG. 37B).
[0054] FIGS. 38A-B show GrB/VEGF.sub.121 bound to PAE/FLK-1 cells
but not to PAE/FLT-1 cells, A375M or SKBR3 cells. Binding of
GrB/VEGF.sub.121 to cells was assessed by 96-well ELISA plates
coated with 50,000 cells/well of PAE/FLK-1, PAE/FLT-1, A375M or
SKBR3 cells. The wells were blocked with 5% BSA and then treated
with purified GrB/VEGF.sub.121 at various concentrations. The wells
were then incubated with either anti-GrB antibody (FIG. 38A) or
anti-VEGF antibody (FIG. 38B) followed by HRP-goat anti-mouse IgG.
ABTS solution with 1 ml/ml of 30% H.sub.2O.sub.2 were added to the
wells, and absorbance at 405 nm was measured after 30 min.
[0055] FIG. 39 shows internalization of GrB/VEGF.sub.121 into
porcine aortic endothelial (PAE) cells. PAE cells were plated onto
16-well chamber slides (1.times.10.sup.4 cells/well), treated with
100 nM of GrB/VEGF.sub.121 for 4 h and then washed briefly with
PBS. The cell surface was stripped with glycine buffer (pH 2.5) and
the cells were fixed in 3.7% formaldehyde and permeabilized in PBS
containing 0.2% Triton X-100. After blocking, samples were
incubated with anti-granzyme B antibody and treated with
FITC-coupled anti-mouse IgG. The slides were analyzed under a
fluorescence microscope. The granzyme B moiety of GrB/VEGF.sub.121
was delivered into the cytosol of PAE/FLK-1 but not into that of
PAE/FLT-1 cells after 4-h treatment.
[0056] FIG. 40A shows cytotoxicity of the GrB/VEGF.sub.121 fusion
toxin on transfected endothelial cells. Log-phase PAE cells were
plated into 96-well plates at a density of 2.5.times.10.sup.3
cells/well and allowed to attach for 24 h. The medium was replaced
with medium containing different concentrations of
GrB/VEGF.sub.121. After 72 h, the effect of fusiontoxin on the
growth of cells in culture was determined using XTT. Plates were
read on a microplate ELISA reader at 540 nm. IC.sub.50 of
GrB/VEGF.sub.121 was .about.10 nM on PAE/FLK-1 cells; it was not
cytotoxic on PAE/FLT-1 cells.
[0057] FIG. 40B shows growth inhibitory effects of GrB/VEGF.sub.121
as determined by colony-forming assay. PAE cells (5.times.10.sup.5
cells/ml) were incubated at 37.degree. C. and 5% CO.sub.2 for 72 h
with different concentrations of GrB/VEGF.sub.121 and 100 nM of
irrelevant fusion protein GrB/scFvMEL. Cells were then washed with
PBS, trypsinized, counted, and diluted serially. The serial cell
suspensions were then plated in triplicate and cultured in six-well
plates for 5-7 days. Cells were stained with crystal violet and
colonies consisting of >20 cells were counted. The results are
shown as percentage of colonies in relation to the number of
colonies formed by untreated cells.
[0058] FIGS. 41A-B show GrB/VEGF.sub.121 induces apoptosis on
PAE/FLK-1 cells. Cells (1.times.10.sup.4 cells/well) were treated
with GrB/VEGF.sub.121 at an IC.sub.50 concentration for different
times (0, 24, and 48 h) and washed with PBS. Cells were fixed with
3.7% formaldehyde and permeabilized with 0.1% Triton X-100 and 0.1%
sodium citrate. Cells were incubated with TUNEL reaction mixture,
incubated with Converter-AP, and finally treated with Fast Red
substrate solution. The slides were analyzed under a light
microscope. Apoptosis cells were stained red (400.times.) (FIG.
41A). FIG. 41B shows apoptotic cells as percentage of the total
counted cells (>200 cells) in randomly selected fields
(200.times.); bars, SD.
[0059] FIG. 42 shows granzyme B/VEGF.sub.121 induces cytochrome c
release from mitochondria to cytosol and Bax translocation from
cytosol to mitochondria. PAE cells (5.times.10.sup.7) were treated
with granzyme B/VEGF.sub.121 at concentrations of 0, 0.1, and 20 nM
for 24 h. Cells were collected, and the cytosolic and mitochondrial
fractions were isolated as described below. Fractions of 30 mg each
from non-treated and treated cells were loaded onto 15% SDS-PAGE
gels, and standard Western blotting procedure was performed. The
blot was probed with anti-cytochrome c antibody or anti-Bax
antibody.
[0060] FIG. 43 shows GrB/VEGF.sub.121 induces DNA laddering in
PAE/FLK-1 cells. Cells were plated into six-well plates at a
density of 2.times.10.sup.5 cells/well and exposed to 20 nM
GrB/VEGF.sub.121 for 24 h. DNA was isolated from cell lysates and
fractionated on 1.5% agarose gel.
[0061] FIG. 44 shows cleavage and activation of caspase-3,
caspase-8, and PARP in PAE/FLK-1 cells treated with
GrB/VEGF.sub.121. PAE cells were plated into six-well plates at a
density of 2.times.10.sup.5 cells/well and treated with 20 nM
GrB/VEGF.sub.121 for 4 h. The total cell lysates were loaded onto
12% SDS-PAGE and Western blot was performed using appropriate
primary antibodies.
[0062] FIG. 45 shows validation of the microarray analysis by PCR.
Upregulation of genes for E-selectin, TNFAIP3, NF-kBla and SCYA2
were validated by RT-PCR. GAPDH levels were assessed as a control.
Protein levels of E-selectin in HUVECs treated with
VEGF.sub.121/rGel are shown on the right. NT, not treated.
[0063] FIG. 46 shows VEGF.sub.121/rGel-induced E-selectin
expression in PAE/KDR cells. RNA from PAE/KDR cells that were
untreated or treated with VEGF.sub.121/rGel for the periods
indicated were examined by PCR. GAPDH primers were used as a
control for loading. RNA levels of E-selectin were all upregulated
in PAE/KDR cells (FIG. 46A). Protein levels of E-selectin are also
upregulated (FIG. 46B).
[0064] FIGS. 47A-B show VEGF.sub.121/rGel-mediated inhibition of
tube formation in PAE/KDR cells. PAE/KDR (FIG. 47A) and PAE/Flt-1
cells (FIG. 47B) were added to Matrigel-coated plates, treated with
VEGF.sub.121/rGel or rGel at the concentrations indicated, and
analyzed for tube formation after 24 h. For PAE/KDR cells, a dose
of 1 nM VEGF.sub.121/rGel was sufficient to inhibit tube formation
by 50%, whereas the same degree of inhibition was seen with rGel
only at 100 nM. In contrast, up to 100 nM VEGF.sub.121/rGel was
needed to inhibit tube formation in PAE/Flt-1 cells.
[0065] FIG. 48 shows time-dependent inhibition of tube formation of
PAE/KDR cells by VEGF.sub.121/rGel. PAE/KDR cells were treated with
1 nM VEGF.sub.121/rGel for the periods indicated, detached,
incubated on Matrigel-coated plates for 24 h, and assessed for tube
formation. Incubation of PAE/KDR cells with VEGF.sub.121/rGel for
as little as 9 h was sufficient to abolish the ability of these
cells to form tubes by 50%.
[0066] FIGS. 49A-C show VEGF.sub.121/rGel-mediated inhibition of
angiogenesis in chicken embryo chorioallantoic membranes.
Angiogenesis was induced on chorioallantoic membranes from
9-day-old chicken embryos by filter disks saturated with bFGF.
Disks were simultaneously treated with VEGF.sub.121/rGel or rGel.
At 72 h, chorioallantoic membranes were harvested and examined
using an Olympus stereomicroscope. Experiments were performed twice
per treatment, with 6 to 10 embryos per condition in every
experiment. Shown are vessels in representative chorioallantoic
membranes treated with 50 ng bFGF alone (FIG. 49A), bFGF in
combination with 10 nM rGel (.times.0.5 objective) (FIG. 49B), or
bFGF in combination with 1 nM VEGF.sub.121/rGel (FIG. 49C).
[0067] FIGS. 50A-B show VEGF.sub.121/rGel-mediated reduction of
vascular area and number of vascular branches in the
chorioallantoic membranes assay. Quantitative evaluation of
VEGF.sub.121/rGel-mediated inhibition of angiogenesis in the
chorioallantoic membranes model was determined after the indicated
treatments by image analyses, and the results were normalized to
chorioallantoic membranes treated with buffer (PBS; equal to 100%).
VEGF.sub.121/rGel at both 1 and 10 nM decreased the vascular area
(FIG. 50A). As expected, rGel alone had no effect. Data represent
the means.+-.standard deviations from replicated experiments. *,
P<0.001; t-test, double-sided. FIG. 50B shows VEGF.sub.121/rGel
decreased the number of newly sprouting vessels. VEGF.sub.121/rGel
at a concentration of 1 nM dramatically affected the formation of
the neovasculature, completely inhibiting bFGF-mediated stimulation
of the neovasculature. As expected, rGel did not affect the number
of newly sprouting vessels. Data shown represent the
means.+-.standard deviations from replicated experiments. *,
P<0.001; t-test, double-sided.
DETAILED DESCRIPTION OF THE INVENTION
[0068] The expression of vascular endothelial growth factor and its
receptors has been closely linked to tumor vascularity, metastasis,
and progression. Several groups have developed anti-angiogenic
drugs that block kinase activity of the vascular endothelial growth
factor receptors or monoclonal antibodies that block vascular
endothelial growth factor-receptor interactions. The present
invention demonstrates chimeric fusion constructs containing the
121-amino acid isoform of vascular endothelial growth factor
(VEGF.sub.121) and a cytotoxic molecule such as plant toxin gelonin
or serine protease granzyme B.
[0069] Agents targeting the neovascularization process in tumors
have significant potential for therapeutic impact. Molecules which
interfere with the growth and development of vascular endothelial
cells by targeting the VEGF/receptor complex have an additional
advantage since these agents do not have to penetrate into the
tumor parenchyma and the receptor targets are expressed on the
luminal surface of tumor vascular endothelium.
[0070] Possible binding of vascular endothelial growth
factor-containing constructs to the neuropilin receptor could be a
source of unwanted toxicity and mis-targeting of the complex;
however, it has been shown that the VEGF.sub.121 fragment as
opposed to other isoforms of VEGF-A does not appear to bind to this
receptor.
[0071] It is specifically contemplated that pharmaceutical
compositions may be prepared using the novel fusion constructs of
the present invention. In such a case, the pharmaceutical
composition comprises the novel fusion constructs of the present
invention and a pharmaceutically acceptable carrier. A person
having ordinary skill in this art would readily be able to
determine, without undue experimentation, the appropriate dosages
and routes of administration of this fusion toxin of the present
invention. When used in vivo for therapy, the fusion construct of
the present invention is administered to the patient or an animal
in therapeutically effective amounts, i.e., amounts that eliminate
or reduce the tumor burden or other desired biological effects. It
will normally be administered parenterally, preferably
intravenously, but other routes of administration will be used as
appropriate.
[0072] The dose and dosage regimen will depend upon the nature of
the disease or cancer (primary or metastatic) and its population,
the characteristics of the particular fusion toxin, e.g., its
therapeutic index, the patient, the patient's history and other
factors. The amount of fusion toxin administered will typically be
in the range of about 0.01 to about 100 mg/kg of patient weight.
The schedule will be continued to optimize effectiveness while
balanced against negative effects of treatment. See Remington's
Pharmaceutical Science, 17th
[0073] Ed. (1990) Mark Publishing Co., Easton, Pa.; and Goodman and
Gilman's: The Pharmacological Basis of Therapeutics, 8th Ed. (1990)
Pergamon Press. For parenteral administration, the fusion toxin
protein will most typically be formulated in a unit dosage
injectable form (solution, suspension, emulsion) in association
with a pharmaceutically acceptable parenteral vehicle. Such
vehicles are preferably non-toxic and non-therapeutic. Examples of
such vehicles are water, saline, Ringer's solution, dextrose
solution, and 5% human serum albumin. Non-aqueous vehicles such as
fixed oils and ethyl oleate may also be used.
[0074] Liposomes may be used as carriers. The vehicle may contain
minor amounts of additives such as substances that enhance
isotonicity and chemical stability, e.g., buffers and
preservatives. The fusion toxin will typically be formulated in
such vehicles at concentrations of about 0.01 mg/ml to 1000
mg/ml.
[0075] The present invention is directed to a composition of matter
comprising a conjugate comprising a cytotoxic molecule and a
peptide that binds to both VEGF receptor type 1 (Flt-1) and VEGF
receptor type 2 (kinase domain receptor/Flk-1). In one embodiment,
the peptide is an isoform of VEGF such as those having a sequence
of SEQ ID NOs:28-34. In general, the cytotoxic molecule is a toxin
such as gelonin or a signal transduction protein capable of
generating apoptotic signals. Representative signal transduction
proteins for apoptosis induction include granzyme B, Bax, TNF-a,
TNF-b, TNF-like molecule, TGF-b, small interfering RNA, IL-12,
IL-3, IL-24, IL-18, TRAIL, IFN-a, IFN-b, IFN-g, Bcl-2, Fas ligand
and caspases. In one embodiment, the conjugate is a fusion protein
of the 121-amino acid isoform of VEGF (VEGF.sub.121) and a
cytotoxic molecule. For example, the fusion protein may include a
linker such as G.sub.4S, (G.sub.4S)2, the 218 linker, (G.sub.4S)3,
enzymatically cleavable linker, pH cleavable linker or any similar
linker well known to a person having ordinary skill in this
art.
[0076] In addition to the 121-amino acid isoform of VEGF, the
present invention encompasses other peptides that bind to both VEGF
receptor type 1 and type 2. A number of such peptides have been
reported. For example, peptides binding type 2 VEGF receptor can be
identified by screening with membrane-expressed type 2 VEGF
receptors or with anti-VEGF neutralizing monoclonal antibody
(Binetruy-Tournaire et al., 2000; Wu et al., 2002). A heterodimeric
VEGF antagonist comprising binding domains for VEGF receptor type 1
and type 2 at one pole of the dimer has been shown to block VEGF
receptor type 1- and type 2-mediated activities (Leenders et al.,
2002). Moreover, VEGF receptor-targeting peptides can be high
affinity antibodies selected from phage display library (Lu et al.,
2003).
[0077] In another embodiment, there is provided a method of using
the conjugates of the present invention to kill cells expressing
type 2 VEGF receptors (kinase domain receptor/Flk-1 receptors). The
conjugate can bind to both VEGF receptor type 1 (Flt-1) and VEGF
receptor type 2 (KDR/Flk-1) but is internalized by VEGF receptor
type 2 expressed on the cells. In general, the conjugate is
cytotoxic to cells expressing more than 2000 type 2 VEGF receptors
per cell. Examples of cells that are susceptible to the claimed
conjugate include prostate tumor cells, breast cancer cells and
bladder tumor cells.
[0078] In another embodiment, there is provided a method of using
the conjugates of the present invention to kill cells expressing
type 1 VEGF receptors. The conjugate can bind to both VEGF receptor
type 1 (Flt-1) and VEGF receptor type 2 (KDR/Flk-1) but is
internalized by VEGF receptor type 1 expressed on the cells.
Examples of cells that are susceptible to the claimed conjugate
include osteoclast precursor cells.
[0079] In yet another embodiment, there is provided a method of
using the claimed conjugates to inhibit tumor growth, metastatic
spread or vascularization of metastases in a subject. As used
herein, a "subject" refers to an animal or a human. The method
involves using a biologically effective amount of the claimed
conjugates to exert cytotoxic effect on the tumor vasculature. The
method may further comprise treatment with chemotherapeutic agents
or radiotherapeutic agents well known in the art.
[0080] The present invention further provides methods of using the
claimed conjugates to inhibit osteoclastogenesis, angiogenesis or
to treat bone disease such as osteoporosis and osteoarthritis in an
animal or a human.
[0081] In yet another embodiment, there is provided a method of
inducing a cytotoxic effect or an anti-tumor effect such as
inhibition of tumor growth, metastatic spread or vascularization of
metastases. The method comprises the step of inducing expression of
one or more genes listed in Table 4.
[0082] The following examples are given for the purpose of
illustrating various embodiments of the invention and are not meant
to limit the present invention. The present examples, along with
the methods, procedures, treatments, and specific compounds
described herein are representative of preferred embodiments. One
skilled in the art will appreciate that the present invention is
well adapted to carry out the objects and obtain the advantages
mentioned, as well as those objects, ends and advantages inherent
herein. Changes therein and other uses which are encompassed within
the spirit of the invention as defined by the scope of the claims
will occur to those skilled in the art.
Example 1
Cell Lines And Reagents
[0083] Endothelial cell growth supplement from bovine neural tissue
was obtained from Sigma. Murine brain endothelioma bEnd.3 cells
were provided by Werner Risau (Max Plank Institute, Munich,
Germany). Porcine aortic endothelial cells (PAE) transfected with
either the human FLT-1 receptor (PAE/FLT-1) or the KDR receptor
(PAE/KDR) were provided by Dr. J. Waltenberger. Soluble mouse Flk-1
was expressed in Sf9 cells as described by Warren et al. (1995).
The human melanoma A-375 M cell line, human breast cancer SKBR3-HP,
and HuT-78 cells were obtained from American Type Culture
Collection. Tissue culture reagents were from GIBCO/BRL or
Mediatech Cellgro (Herndon, Va.).
[0084] Rabbit anti-gelonin antisera was obtained from the
Veterinary Medicine Core Facility at M.D. Anderson Cancer Center.
Anti-flt-1 (sc-316), anti-flk-1 (sc-504), and anti-PARP (sc-8007)
antibodies were purchased from Santa Cruz Biotechnology, Inc.
(Santa Cruz, Calif.). BALB/c nude mice were purchased from The
Jackson Laboratory and maintained under sterile pathogen-free
conditions according to American Association of Laboratory Animal
Care standards.
[0085] Anti-granzyme B mouse monoclonal antibody, and anti-caspase
antibodies were obtained from Santa Cruz Biotechnology (Santa Cruz,
Calif.). Horseradish peroxidase-goat anti-mouse (HRP-GAM) or
anti-rabbit conjugate were purchased from Bio-Rad (Hercules,
Calif.). FITC-coupled anti-mouse IgG was obtained from Sigma
Chemical Co. (St. Louis, Mo.). Cytochrome c release apoptosis assay
kit was purchased from Oncogene Research Products (Boston, Mass.).
In situ cell death detection kit, AP [terminal deoxynucleotidyl
transferase-mediated nick end labeling (TUNEL) assay], and Fast Red
were from Roche Molecular Biochemicals (Indianapolis, Ind.).
[0086] The PCR reagents were obtained from Fisher Scientific, and
the molecular biology enzymes were purchased from Roche Molecular
Biochemicals or New England Biolabs. Bacterial strains, pET
bacterial expression plasmids, and recombinant enterokinase were
obtained from Novagen. All other chemicals were obtained from Sigma
or Fisher Scientific. Metal affinity resin (Talon) was obtained
from CLONTECH. Other chromatography resin and materials were
purchased from Amersham Pharmacia.
Example 2
[0087] Construction of VEGF.sub.121/rGelonin Fusion Toxin
[0088] The cDNA encoding human VEGF.sub.121 and recombinant gelonin
were fused together by using the splice overlap extension PCR
method with VEGF and gelonin DNA as templates. Primers used were:
VEGF Nterm, (5'-TGGTCCCAGGCTCATATGGCA CCCATGGCAGAA-3', SEQ ID
NO:1); VEGF Cterm, (5'-TCTAGACCGGAGCCACCGCCACCCCGCCTCGGCTTGTC-3',
SEQ ID NO:2); Gel Nterm, (5'-GGTGGCGGTGG CTCCGGTCTAGACACCGTGAGC-3',
SEQ ID NO:3); Gel Cterm, (5'-AAGGCTCGTGTCGACCTCGAGTCATTAAGCTTTAGGAT
CTTTATC-3', SEQ ID NO:4). A G4S linker was incorporated between the
VEGF.sub.121 and the rGel sequences. Purified PCR products were
digested with the restriction enzymes BspHI and XhoI and ligated
into pET-32a. The constructs were transformed into Escherichia coli
strain AD494 (DE3) pLys S for expression of the fusion protein.
[0089] The combination of VEGF.sub.121 and recombinant gelonin was
originally prepared in two different orientations (FIG. 1) with
both orientations displaying similar cytotoxicity profiles.
However, the orientation with VEGF.sub.121 at the N-terminus
results in a higher yield following purification from bacteria, and
is used in subsequent experiments.
Example 3
[0090] VEGF.sub.121/rGelonin Expression in E. Coli and
Purification
[0091] The expression and purification of VEGF.sub.121/rGel has
been previously described (Veenendaal et al., 2002). Bacterial
colonies transformed with the plasmid carrying the
VEGF.sub.121/rGel insert were cultured in LB growth medium (Sigma)
containing 200 mg/ml ampicillin, 70 mg/ml chloramphenicol, and 15
mg/ml kanamycin at 37.degree. C. overnight in a shaker bath at 240
rpm. The cultures then were diluted 1:20 with fresh LB medium with
antibiotics and grown to early log phase (A600/0.6) at 37.degree.
C. Thereafter, the cultures were diluted 1:1 with fresh LB medium
plus antibiotics. Protein synthesis was induced at 23.degree. C. by
the addition of 0.1 mM isopropyl b-D-thiogalactoside (IPTG)
overnight. The cells were collected by centrifugation, resuspended
in 10 mM Tris/HCl (pH 8.0), and frozen.
[0092] The fusion protein was expressed and purified from bacterial
supernatant. E. coli cells were lysed with 100 ml 0.1 mm glass
beads (BioSpec Products, Inc) in a Bead Beater (BioSped Products,
Inc) for eight cycles of 3 minutes each. The lysate was
ultracentrifuged at 40,000 rpm for 90 minutes at 4.degree. C. The
supernatant was carefully collected and adjusted to 40 mM Tris-HCl
(pH 8.0), 300 mM NaCl, and incubated at 4.degree. C. with metal
affinity resin. The resin was washed with 40 mM Tris-HCl (pH8.0),
0.5 M NaCl buffer containing 5 mM Imidazole and eluted with buffer
containing 100 mM Imidazole. After pooling fractions containing
VEGF.sub.121/rGel, the sample was dialyzed against 20 mM Tris (pH
8.0), 200 mM NaCl and digested with recombinant Enterokinase at
room temperature. Enterokinase was removed by agarose-linked
soybean trypsin inhibitor. Other proteins of non-interest were
removed by Q Sepharose Fast Flow resin and metal affinity resin as
described previously.sup.26. VEGF.sub.121/rGel was concentrated and
stored in sterile PBS at -20.degree. C.
[0093] SDS/PAGE analysis of protein expression after induction with
IPTG showed a new protein at 62 kDa, which is the expected
molecular weight for the fusion protein plus the 21 kDa
purification tag. This material was purified by binding and elution
from IMAC resin. Cleavage with recombinant enterokinase removed the
tag resulting in a 42-kDa protein under reducing conditions. The
construct migrated as a homodimer at 84 kDa under nonreducing
conditions. The fusion construct was immunoreactive with antibodies
to both VEGF and rGel. One liter of induced bacterial culture
initially contained .about.2,000 mg of soluble fusion construct.
Initial IMAC purification resulted in 750 mg of VEGF.sub.121/rGel
product (yield 37.5%), and digestion with recombinant enterokinase
generated 400 mg of target protein (yield 20%). Subsequent
purification yielded 230 mg of VEGF.sub.121/rGel final product
(11.5% overall yield).
Example 4
Anti-VEGF and Anti-rGel Western Blot Analysis
[0094] Protein samples were analyzed by SDS/15% PAGE under reducing
conditions. The gel was electrophoretically transferred to
nitrocellulose overnight at 4.degree. C. in transfer buffer (25 mM
Tris/HCl, pH 7.6/190 mM glycine/20% HPLC-grade methanol). The
membranes were blocked by the addition of 5% BSA in Western
blocking buffer [(TBS)/Tween] and then incubated for 1 h with
rabbit anti-gelonin polyclonal antibody (2 mg/ml in TBS/Tween) or
mouse anti-VEGF monoclonal antibody 2C3 (2 mg/ml in TBS/Tween). The
membrane then was incubated with goat-anti-rabbit IgG horseradish
peroxidase (HRP) or goat-anti-mouse IgG-HRP (1:5,000 dilution in
TBS/Tween). Then, the membrane was developed with the Amersham
Pharmacia enhanced chemiluminescence (ECL) detection system and
exposed to x-ray film.
Example 5
[0095] Biological Activity of the rGel Component
[0096] The functional activity of rGel and VEGF.sub.121/rGel were
assayed by using a cell-free protein translation inhibition assay
kit from Amersham Pharmacia as described by the manufacturer. As
determined by the rabbit reticulocyte translation assay, the
purified VEGF.sub.121/rGel and rGel had IC.sub.50 values of
.about.47 and 234 pM, respectively, showing that fusion of rGel and
VEGF.sub.121 did not reduce the activity of the toxin component
(FIG. 2).
Example 6
[0097] Binding of VEGF.sub.121/rGelonin to Soluble Flk-1
Receptor
[0098] Binding to Flk-1 was tested on microtiter plates coated with
soluble mouse Flk-1. Plates were treated with 2 mg/ml of
NeutrAvidin (Pierce) for 6 h. Purified, biotinylated Flk-1 (Warren
et al., 1995) was incubated with NeutrAvidin-coated wells for 2 h.
VEGF.sub.121 or VEGF.sub.121/rGel was added to the wells at various
concentrations in the presence of PBS containing 2% (vol/vol) BSA.
After 2 h of incubation, plates were washed and incubated with
nonblocking mouse monoclonal anti-VEGF antibody, 2C3 (Brekken et
al., 1998), or rabbit polyclonal anti-gelonin IgG. For competition
studies of VEGF.sub.121/rGel and VEGF.sub.121, binding of the
VEGF.sub.121/rGel fusion protein was detected by using a rabbit
anti-gelonin antibody. Mouse and rabbit IgG were detected by
HRP-labeled goat anti-mouse and anti-rabbit antibodies,
respectively (Dako). Peroxidase activity was measured by adding
O-phenylenediamine (0.5 mg/ml) and hydrogen peroxide (0.03%
vol/vol) in citrate-phosphate buffer (pH 5.5). The reaction was
stopped by the addition of 100 ml of 0.18 M of H.sub.2SO.sub.4. The
absorbance was read at 490 nM. In competition experiments, a
10-fold molar excess of VEGF.sub.121 was premixed with
VEGF.sub.121/rGel before addition to the plate.
[0099] As shown in FIG. 3, VEGF.sub.121/rGel and native human
VEGF.sub.121 bind equally well to Flk-1 at all concentrations,
indicating that the VEGF component of the fusion protein is fully
capable of binding to Flk-1. The specificity of binding of
VEGF.sub.121/rGel to Flk-1 was confirmed by using a 10-fold molar
excess of free VEGF.sub.121 (FIG. 4).
Example 7
[0100] VEGF.sub.121/rGelonin and VEGF.sub.121-Induced
Phosphorylation of KDR
[0101] Porcine aortic endothelial cells (PAE/KDR) overexpressing
the kinase domain receptor (KDR) were incubated overnight in F-12
culture medium and then incubated at 37.degree. C. for 5 min with
100 mM Na3 VO4. VEGF or VEGF.sub.121/rGel then were added and, at
various times, cells were lysed by the addition of a lysis buffer
(50 mM Hepes, pH 7.4/150 mM NaCl/1 mM EGTA/10 mM sodium
pyrophosphate/1.5 mM MgCl2/100 mM NaF/10% (vol/vol) glycerol/1%
Triton X-100). Cell lysates were centrifuged (16,000.times.g), the
supernatants were removed, and their protein concentrations were
determined. Lysate supernatants were incubated with 9 mg
anti-phosphotyrosine monoclonal antibody (Santa Cruz Biotechnology)
for 2 h at 4.degree. C. and then precipitated by the addition of
Protein A Sepharose beads for 2 h at 4.degree. C. Beads were washed
and mixed with SDS sample buffer, heated for 5 min at 100.degree.
C., centrifuged, analyzed by SDS/10% PAGE, and then transferred to
nitrocellulose filters. The membranes were blocked with 5% nonfat
dry milk and incubated with rabbit polyclonal anti-KDR antibody
(1:250; Santa Cruz Biotechnology) for 1 h at room temperature. The
membranes then were washed, incubated with a peroxidase-linked goat
anti-rabbit antibody (1:2,000) for 1 h at room temperature, and
then enhanced chemiluminescence reagent (Amersham Pharmacia) was
used to visualize the immunoreactive bands.
[0102] Results from these experiments showed that addition of
VEGF.sub.121/rGel or VEGF.sub.121 increased phosphotyrosine
content. There were two phases of phosphorylation; an early phase
(1-10 min) and a later phase (4-8 h). The time course of induction
of KDR phosphorylation was the same for VEGF.sub.121/rGel and
VEGF.sub.121. Phosphorylation of FLT-1 in PAE/FLT-1 cells treated
with either VEGF.sub.121/rGel or VEGF.sub.121 was not observed, as
expected from the weaker signaling of FLT-1 compared with KDR
observed by others.
[0103] Although VEGF.sub.121/rGel induces phosphorylation of KDR
receptor, no growth-stimulatory effects of the fusion toxin on VEGF
receptor-expressing cells were observed. These findings are in
keeping with studies of other fusion toxins such as IL-2/DT that
initially stimulate target cells in a manner similar to that of
IL-2 itself, but ultimately kill the target cells through the
actions of the internalized toxin.
Example 8
[0104] Cytotoxicity of VEGF.sub.121/rGelonin to Endothelial Cells
In Vitro
[0105] To determine cytotoxicity on adult bovine aortic
arch-derived endothelial cells (ABAE), log-phase adult bovine
aortic arch-derived endothelial cells in DMEM [10% (vol/vol) FBS]
were diluted to 4,000 cells per 200 ml. Aliquots (200 ml) were
added to 96-well flat-bottomed tissue culture plates and incubated
at 37.degree. C. for 1-72 h in 5% CO.sub.2. Purified
VEGF.sub.121/rGel or rGel were diluted in culture medium to various
concentrations, added to the plate, and the cultures were incubated
for 72 h. Remaining adherent cells were stained by the addition of
100 ml of crystal violet [0.5% in 20% (vol/vol) methanol].
Dye-stained cells were solubilized by the addition of 100 ml of
Sorenson's buffer [0.1M sodium citrate, pH 4.2 in 50% (vol/vol)
ethanol]. The absorbance was measured at 595 nM.
[0106] To determine cytotoxicity on mouse brain-derived endothelial
cells bEnd.3, the cells were seeded at a density of 50,000/well in
24-well plates. Twenty-four hours later, VEGF.sub.121/rGel or rGel
alone were added at various concentrations. After 5 days of
treatment at 37.degree. C., remaining attached cells were
trypsinized and counted. The results are presented as total cell
number per well. Two identical experiments were performed in
duplicate. Standard error in all experiments was less than 5% of
the mean.
[0107] To determine cytotoxicity on PAE/KDR and PAE/FLT-1 cells,
log-phase PAE/KDR cells and PAE/FLT-1 cells in F-12 medium [10%
(vol/vol) FBS] were diluted to 3,000 cells per 200 ml. Aliquots
(200 ml) were added to 96-well flat-bottomed tissue culture plates
and incubated at 37.degree. C. for 24 h in 5% CO.sub.2. Purified
VEGF.sub.121/rGel or rGel were diluted in culture medium, added to
the plate, and incubated for 72 h. Adherent cells were quantified
by using the crystal violet staining method described above.
[0108] VEGF.sub.121/rGel was specifically toxic to KDR/Flk-1
expressing endothelial cells in vitro (FIG. 5 and Table 1). The
IC.sub.50 values for VEGF.sub.121/rGel on log-phase PAE/KDR, ABAE,
and bEnd.3 cells, which express 1-3.times.10.sup.5 KDR/Flk-1
receptors per cell, was 0.06 to 1 nM. Cells expressing FLT-1 and
having low endogenous expression of KDR (PAE/FLT-1, HUVEC) were
several hundred-fold more resistant to VEGF.sub.121/rGel than were
the KDR/Flk-1 expressing cells. Thus, FLT-1 appears not to mediate
cytotoxicity of VEGF.sub.121/rGel.
[0109] The ratio of IC.sub.50 values of rGel to VEGF.sub.121/rGel
was calculated for each cell type. This ratio (the targeting index)
represents the ability of the VEGF component of the fusion
construct to mediate the delivery of the toxin to the endothelial
cell surface and into the intracellular ribosomal compartment. As
summarized in Table 1, bEnd.3 and adult bovine aortic arch-derived
endothelial cells were, respectively, 100-fold and 9-fold more
sensitive to the fusion construct than they were to free rGel.
TABLE-US-00001 TABLE 1 Number of VEGF Receptors Per Cell And
Sensitivity To VEGF.sub.121/rGelonin Number of FLT-1 Number of
IC.sub.50 for sites per KDR sites VEGF.sub.121/rGel IC.sub.50 for
Targeting Cell Type cell per cell (nM) rGel (nM) index * PAE/KDR 0
2-3 .times. 10.sup.5 0.5 300 600 (log phase) PAE/KDR 0 2-3 .times.
10.sup.5 30 5000 167 (confluent) bEnd3 Not done .sup. 2 .times.
10.sup.5 1 100 100 (log phase) ABAE 0 0.4 .times. 10.sup.5 0.059
0.524 8.9 (log phase) HUVEC Not done 0.023 .times. 10.sup.5 700
>1000 ~1 (hypoxia) HUVEC Not done 0.017 .times. 10.sup.5 800
>1000 ~1 (normoxia) PAE/FLT-1 0.5 .times. 10.sup.5 Not done 300
300 1 (log phase) PAE/FLT-1 0.5 .times. 10.sup.5 Not done >5000
10000 <2 (confluent) A-375 Not done Not done 330 109 0.3 (log
phase) PC-3 Not done Not done 225 100 0.4 (log phase) * Targeting
index is defined as the ratio of IC.sub.50 of rGel to
VEGF.sub.121/rGel.
Example 9
[0110] Selective Cytotoxicity of VEGF.sub.121/rGelonin for Dividing
PAE/KDR Cells
[0111] VEGF.sub.121/rGel was 60-fold more toxic to PAE/KDR cells in
log-phase growth than it was to PAE/KDR cells that had been grown
to confluence and rested (Table 1). This effect was not caused by
differences in KDR expression, because the cells expressed the same
number of KDR receptors per cell in both phases of growth. The
log-phase PAE/KDR cells also were more sensitive to rGel itself
than were the confluent cells, suggesting that the quiescence of
confluent cells impacts their sensitivity to both targeted and
nontargeted rGel. It is possible that the rate or route of entry of
both VEGF.sub.121/rGel and rGel is different for dividing and
nondividing cells.
Example 10
[0112] VEGF.sub.121/rGelonin Binds to Both KDR and FLT-1
[0113] VEGF.sub.121 has been shown to bind to the FLT-1 receptor
with greater affinity than to KDR. Because cytotoxicity of
VEGF.sub.121/rGel to KDR-expressing cells was found to be nearly
600-fold greating than for FLT-1 expressing cells, the relative
binding of VEGF.sub.121/rGel to PAE cells expressing each of the
receptors was investigated.
[0114] ELISA analysis was performed to confirm the expression of
both receptors on the cell surface using receptor-specific
antibodies (data not shown). Expression of VEGFR-1 (FLT-1) and
VEGFR-2 (KDR) was confirmed by western blot (FIG. 6A). Whole cell
lysates of PAE/KDR and PAE/FLT-1 cells were obtained by lysing
cells in Cell Lysis buffer (50 mM Tris, pH 8.0, 0.1 mM EDTA, 1 mM
DTT, 12.5 mM MgCl.sub.2, 0.1 M KCl, 20% glycerol) supplemented with
protease inhibitors (0.5% leupeptin, 0.5% aprotinin and 0.1% PMSF).
Protein samples were separated by SDS-PAGE under reducing
conditions and electrophoretically transferred to a PVDF memberane
overnight at 4.sup.BC in transfer buffer (25 mM Tris-HCl, pH 7.6,
190 mM glycine, 20% HPLC-grade methanol). The samples were analyzed
for KDR with rabbit anti-flk-1 polyclonal antibody and FLT-1 using
an anti-fit-1 polyclonal antibody. The membranes were then
incubated with goat-anti-rabbit IgG horseradish peroxidase (HRP),
developed using the Amersham ECL detection system and exposed to
X-ray film.
[0115] In order to confirm that VEGF.sub.121/rGel bound to human
VEGFR-1 and VEGFR-2 and that the presence of recombinant gelonin
did not interfere with the binding properties of VEGF.sub.121 the
binding of radiolabeled VEGF.sub.121/rGel to both KDR and FLT-1
receptors expressed on the surface of PAE cells was investigated.
One hundred .mu.g of VEGF.sub.121/rGel was radiolabeled with 1 mCi
of NaI.sup.125 using Chloramine T.sup.27 for a specific activity of
602 Ci/mMol. Cells were grown overnight in 24-well plates.
Non-specific binding sites were blocked for 30 minutes with
PBS/0.2% gelatin followed by incubation for 4 hours with
.sup.125I-VEGF.sub.121/rGel in PBS/0.2% gelatin solution. For
competition experiments, cold VEGF.sub.121/rGel or gelonin were
pre-mixed with .sup.125I-VEGF.sub.121/rGel. Cells were washed four
times with PBS/0.2% gelatin solution, detached and bound cpm was
measured.
[0116] FIG. 6B shows that the binding of
.sup.125I-VEGF.sub.121/rGel to both cells was nearly identical.
Binding of VEGF.sub.121/rGel to both PAE/KDR and PAE/FLT-1 cells
was competed by unlabeled VEGF.sub.121/rGel but not by unlabeled
gelonin, indicating that binding of VEGF.sub.121/rGel was mediated
by VEGF.sub.121.
Example 11
[0117] Internalization of VEGF.sub.121/rGelonin into PAE/KDR
Cells
[0118] The internalization of VEGF.sub.121/rGel into PAE/KDR and
PAE/FLT-1 cells was investigated using immunofluorescence staining.
PAE/KDR and PAE/FLT-1 cells were incubated with 4 .mu.g/ml
VEGF.sub.121/rGel at various time points. After stripping the cell
surface, cells were fixed with 3.7% formaldehyde and permeabilized
with 0.2% Triton X-100. Non-specific binding sites were blocked
with 5% BSA in PBS. Cells were then incubated with a rabbit
anti-gelonin polyclonal antibody (1:200) followed by a
TRITC-conjugated anti-rabbit secondary antibody (1:80). Nuclei were
stained with propidium iodide (1 .mu.g/ml) in PBS. The slides were
fixed with DABCO media, mounted and visualized under fluorescence
(Nikon Eclipse TS1000) and confocal (Zeiss LSM 510)
microscopes.
[0119] VEGF.sub.121/rGel was detected in PAE/KDR cells within 1
hour of treatment with the immunofluoresence signal progressively
increasing to 24 hours (FIG. 7). As expected, cell density also
decreased over the 24 hour time period. No VEGF.sub.121/rGel was
detected in PAE/FLT-1 cells up to 24 hours after treatment with the
fusion toxin. Treatment of cells with the same concentration of
rGelonin showed no internalization, confirming that entry of
VEGF.sub.121/rGel into PAE cells was specifically via the KDR
receptor.
Example 12
[0120] Cytotoxic Effects of VEGF.sub.121/rGelonin as a Function of
Exposure Time on Endothelial Cells
[0121] The IC.sub.50 of VEGF.sub.121/rGel incubated for 72 hours on
log-phase PAE/KDR cells has been shown to be about 1 nM. However,
VEGF.sub.121/rGel internalizes into these cells within one hour of
incubation. To study the cytototoxic effect of VEGF.sub.121/rGel as
a function of exposure time of this agent on endothelial cells,
cells were incubated with VEGF.sub.121/rGel from 1-72 hours and its
cytotoxicity on PAE/KDR cells was assessed at the end of the
72-hour period.
[0122] While VEGF.sub.121/rGel retained cytotoxicity even after a
one hour incubation, appreciable cytotoxicity was observed after 24
hours and maximal cytotoxic effect of VEGF.sub.121/rGel on PAE/KDR
cells was observed after 48 hours (FIG. 8). The cytotoxic effect of
VEGF.sub.121/rGel on PAE/FLT-1 cells was also affected as a
function of exposure duration (data not shown).
Example 13
[0123] Cytotoxic Mechanism of VEGF.sub.121/rGelonin
[0124] In order to investigate the mechanism of cytotoxicity of
VEGF.sub.121/rGel to PAE/KDR cells, a TUNEL assay was performed for
24, 48 and 72 hours. Log phase PAE/KDR and PAE/FLT-1 cells were
diluted to 2000 cells/100 .mu.l. Aliquots (100 .mu.l) were added in
16-well chamber slides (Nalge Nunc International) and incubated
overnight at 37.degree. C. with 5% CO.sub.2. Purified
VEGF.sub.121/rGel was diluted in culture media and added at 72, 48
and 24 hour time points at a final concentration of 1 nM (twice the
IC.sub.50). The cells were then processed and analyzed for TUNEL as
described by the manufacturer of the reagent. Positive control
cells were incubated with 1 mg/ml DNAse for 10 minutes at
37.degree. C.
[0125] No TUNEL staining was observed with PAE/KDR cells exposed to
VEGF.sub.121/rGel up to 72 hours (FIG. 9). In contrast nuclei of
positive control cells showed intense staining, indicating that the
mechanism of cytotoxicity of VEGF.sub.121/rGel is not
apoptotic.
[0126] Effects of VEGF.sub.121/rGel on PARP-mediated apoptosis were
investigated by pre-incubating PAE/KDR cells with 100 mM
Na.sub.2VO.sub.4 for 5 minutes at 37.degree. C. followed by
stimulation with VEGF.sub.121/rGel or VEGF.sub.121 for 5 minutes,
30 minutes, 4 h, 24 h and 48 h. Cells were washed and lysed. Cell
lysate was analyzed by Western using an anti-PARP antibody. Western
blot analysis of these cells showed that VEGF.sub.121/rGel did not
activate PARP-mediated apoptosis (FIG. 10).
Example 14
[0127] Inhibition of Tumor Growth In Vivo by
VEGF.sub.121/rGelonin
[0128] Human melanoma xenograft model was established as follows.
Female nu/nu mice were divided into groups of five mice each.
Log-phase A-375M human melanoma cells were injected s.c.
(5.times.10.sup.6 cells per mouse) into the right flank. After the
tumors had become established (.about.50 mm.sup.3), the mice were
injected with VEGF.sub.121/rGel through a tail vein five times over
an 11 day period. The total dose of VEGF.sub.121/rGel was 17 or 25
mg/kg. Other mice received rGel alone at a dose totaling 10 mg/kg.
Mice were killed by cervical dislocation after the 40th day of
tumor measurement.
[0129] Human prostate cancer xenograft model was established as
follows. Male nude mice weighing .about.20 g were divided into
groups of five mice each. Log-phase, PC-3 human prostate tumor
cells were injected s.c. (5.times.10.sup.6 cells per mouse) in the
right flank. The mice were injected with VEGF.sub.121/rGel through
a tail vein every 2-3 days for 11 days. The total dose of
VEGF.sub.121/rGel was 20 mg/kg. Other mice received rGel alone at a
dose totaling 10 mg/kg. Tumor volume was calculated according to
the formula: volume=L.times.W.times.H, where L=length, W=width,
H=height.
[0130] As shown in FIG. 11, saline-treated human melanoma A-375M
tumors showed an increase in tumor volume 24-fold (from 50 mm.sup.3
to 1200 mm.sup.3) over the 30-day observation period. Treatment of
the mice with VEGF.sub.121/rGel strongly retarded tumor growth. At
high doses of VEGF.sub.121/rGel totaling 25 mg/kg, tumor growth was
completely prevented, but all mice died from drug toxicity on day
19. At lower doses totaling 17 mg/kg, all mice survived. Tumor
growth was completely prevented throughout the 14-day course of
treatment, but thereafter, tumor regrowth slowly recurred. Compared
with controls, mice treated with VEGF.sub.121/rGel at doses
totaling 17 mg/kg showed a 6-fold decrease in tumor volume (1,200
mm.sup.3 vs. 200 mm.sup.3).
[0131] Human prostatic carcinoma (PC-3) tumors increased 12-fold in
volume during the 26-day observation period (FIG. 12). Treatment of
the mice with five doses of VEGF.sub.121/rGel totaling 20 mg/kg
virtually abolished tumor growth, even after cessation of
treatment. Tumor volume in the treated group only increased from
100 to 200 mm.sup.3 over the course of the experiment. Compared
with controls, treatment with VEGF.sub.121/rGel resulted in a
7-fold decrease in tumor volume (1,400 mm.sup.3 vs. 200
mm.sup.3).
Example 15
[0132] Localization of VEGF.sub.121/rGelonin to Vascular
Endothelium in Prostate Tumor Xenografts
[0133] Mice (three mice per group) bearing PC-3 human prostate
tumors were injected intravenously with 50 ug of the fusion protein
gelonin (2.5 mg/kg) or free gelonin (1 mg/kg). The mean tumor
volume per group was 260 mm.sup.3. Thirty minutes later, mice were
killed, exsanguinated, and all major tissues were snap frozen.
Frozen sections were cut and double stained with pan-endothelial
marker MECA-32 (5 mg/ml) followed by detection of the localized
fusion protein using rabbit anti-gelonin antibody (10 mg/ml).
MECA-32 rat IgG was visualized with goat anti-rat IgG conjugated to
FITC (red fluorescence). Anti-gelonin antibody was detected with
goat anti-rabbit IgG conjugated to Cy-3 (green fluorescence).
Colocalization of both markers was indicated by a yellow color.
Anti-gelonin antibody had no reactivity with tissue sections from
mice injected with saline or VEGF.sub.121. To determine the
percentage of vessels with localized fusion protein, the number of
vessels stained with MECA-32 (red), gelonin (green), or both
(yellow) were counted at a magnification of .times.200 in at least
10 fields per section. Two slides from each mouse were analyzed,
and the average percentage of positive vessels was calculated.
[0134] As shown in FIG. 13, VEGF.sub.121/rGel was detected
primarily on vascular endothelium of PC-3 tumors (FIG. 13). On
average, 62% of vessels positive for MECA 32 were also positive for
VEGF.sub.121/rGel, as detected by using anti-gelonin antibody. In
tumor regions of increased vascularity ("hot spots"), approximately
90% of tumor vessels had bound VEGF.sub.121/rGel. Vessels in normal
organs were unstained, with the exception of the kidney, where weak
and diffuse staining was detected in the glomeruli. Free gelonin
did not localize to tumor or normal vessels in any of the mice.
These results indicate that VEGF.sub.121/rGel localized
specifically to tumor vessels after i.v. injection.
Example 16
[0135] Destruction and Thrombosis of Tumor Vessels by
VEGF.sub.121/rGelonin
[0136] Mice bearing s.c. PC-3 tumors were given one i.v. dose of
VEGF.sub.121/rGel (2.5 mg/kg) or saline. The mice were killed 48 h
later, and the tumors and various organs were removed. Paraffin
sections were prepared and stained with hematoxylin and eosin. The
tumors from VEGF.sub.121/rGel recipients (FIG. 14) displayed
damaged vascular endothelium, thrombosis of vessels, and
extravasation of RBC components into the tumor interstitium. Normal
tissues had un-damaged vasculature. Treatment of mice with saline
had no effect on tumor or normal tissues. As assessed by image
analysis, necrotic areas of the tumor increased from .about.4% in
saline-treated mice to .about.12% after treatment with the fusion
construct.
Example 17
[0137] Cytotoxicity of VEGF.sub.121/rGelonin to MDA-MB-231 Breast
Tumor Cells
[0138] As assessed by Western blot, MDA-MB-231 breast cancer cells
do not appear to express VEGFR-1 or VEGFR-2, the receptors which
bind VEGF.sub.121 (FIG. 15A). Cytotoxicity of VEGF.sub.121/rGel and
rGel against log phase MDA-MB-231 cells was determined as follows.
Cells were grown in 96-well flat-bottom tissue culture plates.
Purified VEGF.sub.121/rGel and rGel were diluted in culture media
and added to the wells in 5-fold serial dilutions. Cells were
incubated for 72 hours. The remaining adherent cells were stained
with crystal violet (0.5% in 20% methanol) and solubilized with
Sorenson's buffer (0.1 M sodium citrate, pH 4.2 in 50% ethanol).
Absorbance was measured at 630 nm. As shown in FIG. 15B, the
cytotoxicity of VEGF.sub.121/rGel on MDA-MB-231 cells showed an
IC.sub.50 slightly higher than that observed for recombinant
gelonin, indicating that VEGF.sub.121/rGel does not have a specific
target on MBA-MB-231 cells.
Example 18
[0139] Localization of VEGF.sub.121/rGelonin to Vascular
Endothelium in Breast Tumor Xenografts
[0140] SCID mice (3 mice per group) bearing orthotopic MDA-MB-231
tumors were intravenously injected with 50 ug of the fusion protein
or equivalent amount of free gelonin. The mean tumor volume per
group was 260 mm.sup.3. Four hours later the mice were sacrificed
and exsanguinated. All major organs and tumor were harvested and
snap-frozen for preparation of cryosections.
[0141] Frozen sections were double stained with a pan-endothelial
marker MECA 32 (5 ug/ml) followed by detection of the localized
fusion protein using rabbit anti-gelonin antibody (10 ug/ml). MECA
32 rat IgG (provided by Dr. E. Butcher of Stanford University, CA)
was visualized by goat anti-rat IgG conjugated to FITC (green
fluorescence). Rabbit anti-gelonin antibody was detected by goat
anti-rabbit IgG conjugated to Cy-3 (red fluorescence).
[0142] Co-localization of both markers was indicated by yellow
color. Anti-gelonin antibody had no reactivity with tissues
sections derived from mice injected with saline or with
VEGF.sub.121. To determine % of vessels with localized fusion
protein, MECA 32 positive, gelonin-positive and vessels with
combined color were counted at magnification of .times.200 in at
least 10 fields per section. Two slides from each mouse were
analyzed and percent of positive vessels was averaged.
[0143] As shown in FIG. 16, VEGF.sub.121/rGel was primarily
detected on endothelium of tumor. In average, sixty percent of
vessels positive for MECA 32 were also positive for gelonin in the
group of VEGF.sub.121/rGel-injected mice. In the tumor regions of
increased vascularity (hot spots), up to 90% of tumor vessels were
labeled by anti-gelonin IgG. Vessels with bound VEGF.sub.121/rGel
were homogeneously distributed within the tumor vasculature.
Vessels in normal organs were unstained with the exception of the
kidney where weak and diffuse staining was detected in the
glomeruli. Free gelonin did not localize to tumor or normal vessels
in any of the mice, indicating that only targeted gelonin was able
to bind to the tumor endothelium. These results indicate that
VEGF.sub.121/rGel specifically localizes to tumor vessels that
demonstrate high density and favorable distribution of
VEGF.sub.121/rGel-binding sites.
Example 19
Metastatic Model of MDA-MB-231 Tumors
[0144] The following examples utilize a breast cancer pulmonary
metastatic model to establish VEGF.sub.121/rGel fusion toxin can
inhibit metastatic spread and vascularization of metastases.
[0145] Human breast carcinoma MDA-MB-231 cells consistently lodge
in lungs following intravenous injection into the tail vein of
athymic or SCID mice. Micrometastases are first detected 3 to 7
days after injection of 5.times.10.sup.5 cells and macroscopic
colonies develop in 100% of the injected mice within 4 to 7 weeks.
Mortality occurs in all mice within 10-15 weeks. This model of
experimental breast cancer metastasis examines the ability of tumor
cells to survive in the blood circulation, extravasate through the
pulmonary vasculature and establish growing colonies in the lung
parenchyma.
[0146] Female SCID mice, aged 4-5 weeks, were injected in a tail
vein with 0.1 ml of MDA-MB-231 cell suspension (5.times.10.sup.5
cells). The mice were randomly separated into two groups (6 mice
per group) and were treated with either VEGF.sub.121/rGel or
gelonin alone (100 .mu.g intraperitoneally, 6 times total with an
interval of 3 days) starting the 8.sup.th day after the injection
of cells. Treatment with VEGF.sub.121/rGel for 2 weeks allow the
mice to receive the maximal tolerated accumulative dose of the drug
(600 .mu.g per mouse). Prior studies established that
VEGF.sub.121/rGel given at such dose did not cause
histopathological changes in normal organs. The accumulative dose
of 640-800 .mu.g of total VEGF.sub.121/rGel fusion protein, given
i.p. over period of 4 weeks, did not induce significant toxicity as
judged by morphological evaluation of normal organs. Transient loss
of weight (.about.10%) was observed 24 hours after most of the
treatments with complete weight recovery thereafter.
[0147] Metastatic colonies were allowed to expand for three weeks
after treatment with VEGF.sub.121/rGel in order to evaluate
long-term effect of VEGF.sub.121/rGel on the size of the colonies,
proliferation index of tumor cells and their ability to induce new
blood vessel formation. Three weeks after termination of the
treatment, the animals were sacrificed and their lungs were
removed. One lobe was fixed in Bouin's fixative and the other lobe
was snap-frozen. After fixation in Bouin's fixative, the tumor
colonies on the lung surface appear white, whereas the normal lung
tissue appears brown. The number of tumor colonies on the surface
of each lung was counted and the weight of each lung was measured.
The values obtained from individual mice in the VEGF.sub.121/rGel
and rGel groups were averaged per group.
Example 20
[0148] Effects of VEGF.sub.121/rGelonin on the Number, Size And
Vascular Density of MDA-MB-231 Pulmonary Metastatic Foci
[0149] Frozen samples of lung tissue was cut to produce sections of
6 .mu.m. Blood vessels were visualized by MECA 32 antibody and
metastatic lesions were identified by morphology and by 6w/32
antibody directed against human HLA antigens. Hybridoma producing
the mouse monoclonal 6w/32 antibody was purchased from ATCC. The
6w/32 antibody was purified from hybridoma supernatant using
Protein A resin.
[0150] Each section was double stained by MECA 32 and 6w/32
antibodies to ensure that the analyzed blood vessels are located
within a metastatic lesion. Slides were first viewed at low
magnification (.times.2 objective) to determine total number of
foci per a cross-section. Six slides derived from individual mice
in each group were analyzed and the number was averaged. Images of
each colony were taken using digital camera (CoolSnap) at
magnifications of .times.40 and .times.100 and analyzed using
Metaview software that allows measurements of smallest and largest
diameter, perimeter (.mu.m) and area (mm.sup.2).
[0151] The vascular endothelial structures identified within a
lesion were counted and number of vessels per each lesion was
determined and normalized per mm.sup.2. The mean number of vessels
per mm.sup.2 was calculated per each slide and averaged per
VEGF.sub.121/rGel and rGel groups (6 slides per group). The results
are expressed.+-.SEM. The same method applied to determine the mean
number of vessels in non-malignant tissues.
[0152] Treatment with VEGF.sub.121/rGel but not with free gelonin
significantly reduced both the number of colonies per lung and the
size of the metastatic foci present in lung by 42-58% as shown in
FIG. 17 and Table 2.
[0153] The overall mean vascular density of lung colonies was
reduced by 51% compared to the rGel treated controls (Table 3 and
FIG. 18). The observed effect, however, was non-uniformly
distributed among different tumor colony sizes. The greatest impact
on vascularization was observed on mid-size and extremely small
tumors (62 and 69% inhibition respectively) while large tumors
demonstrated the lease effect (10% inhibition). The majority of
lesions in the VEGF.sub.121/rGel-treated mice (.about.70%) were
avascular whereas only 40% of lesions from the control group did
not have vessels within the metastatic lung foci.
TABLE-US-00002 TABLE 2 Effect of VEGF.sub.121/rGelonin on Number
And Size of Pulmonary Metastases of MDA-MB- 231 Human Breast
Carcinoma Cells Treatment.sup.a % inhibition vs. Parameter rGelonin
VEGF.sub.121/rGel rGelonin treatment P value.sup.b No. surface
colonies 53.3 .+-. 22 22.4 .+-. 9.2 58.0% 0.03 per lung
(range).sup.c (33-80) (11-41) No. intraparenchymal 22 .+-. 7.5 12.8
.+-. 5.5 42.0% 0.02 colonies per cross- (18-28) (5-18) section
(range).sup.d Mean area of 415 .+-. 10 201 .+-. 37 51.9% 0.01
colonies (.mu.m).sup.e Mean % of colonies- 57.3 .+-. 19 25.6 .+-.
10.5 55.4% 0.01 occupied area per lung section.sup.f .sup.aMice
with MDA-MB-231 pulmonary micrometastases were treated i.p. with
VEGF.sub.121/rGel or free gelonin as described. .sup.bP value was
calculated using t-Student test. .sup.cLungs were fixed with
Bouin's fixative for 24 hours. Number of surface white colonies was
determined for each sample and averaged among 6 mice from
VEGF.sub.121/rGel or rGel control group. Mean number per group .+-.
SEM is shown. Numbers in parentheses represent range of colonies in
each group. .sup.dFrozen sections were prepared from metastatic
lungs. Sections were stained with 6w/32 antibody recognizing human
tumor cells. Number of intraparenchymal colonies identified by
brown color was determined for each cross-section and averaged
among 6 samples of individual mice from VEGF.sub.121/rGel or rGel
control group. Mean number per group .+-. SEM is shown. Numbers in
parentheses represent range of colonies in each group. .sup.eArea
of foci identified by 6w/32 antibody was measured by using Metaview
software. Total number of evaluated colonies was 101 and 79 for
rGel and VEGF.sub.121/rGel group, respectively. Six individual
slides per each group were analyzed. The mean area of colony in
each group .+-. SEM is shown. .sup.fThe sum of all regions occupied
by tumor cells and the total area of each lung cross-section was
determined and % of metastatic regions from total was calculated.
The values obtained from each slide were averaged among 6 samples
from VEGF.sub.121/rGel or rGel control group. The mean % area
occupied by metastases from total area per group .+-. SEM is
shown.
TABLE-US-00003 TABLE 3 Effect of VEGF.sub.121/rGelonin On
Vascularity of Pulmonary Metastases of MDA-MB-231 Human Breast
Carcinoma Cells Largest No. vascularized colonies Size of diameter
from total analyzed (%).sup.b % Inhibition vs. colonies.sup.a range
(.mu.m) rGel VEGF.sub.121/rGel radiation treatment Extremely <50
7/24 (29%) 3/32 (9.3%) 69 small Small 50-200 19/48 (39.5%) 6/24
(25%) 37 Mid-size 200-500 25/30 (83.3%) 8/25 (32%) 62 Large
500-1000 17/17 (100%) 10/11 (90.0%) 10 Extremely >1000 .sup. 8/8
(100%) N/A N/A large No. vascular foci/ 76/127 (59.8%) 27/92
(29.3%) 51 total analyzed (%).sup.c .sup.aColonies identified on
each slide of a metastatic lung were subdivided into 5 groups
according to their largest diameter. .sup.bFrozen lung sections
from VEGF.sub.121/rGel or rGel treated mice were stained with MECA
32 antibody. A colony was defined as vascularized if at least one
blood vessel branched out from the periphery and reached a center
of the lesion. Six slides per each group derived from individual
mice were analyzed and data were combined. .sup.cTotal number of
the analyzed colonies was 127 and 92 for rGel and VEGF.sub.121/rGel
treated groups, respectively. Seventy percent of foci in the
VEGF.sub.121/rGel-treated group were avascular whereas only 40% of
lesions from the control group did not have vessels within the
metastatic foci.
Example 21
[0154] Effect of VEGF.sub.121/rGelonin on the Number of Cycling
Cells in the MDA-MB-231 Pulmonary Metastatic Foci
[0155] Frozen sections of normal mouse organs and metastatic lungs
were fixed with acetone for 5 min and rehydrated with PBST for 10
min. All dilutions of antibodies were prepared in PBST containing
0.2% BSA. Primary antibodies were detected by appropriate
anti-mouse, anti-rat or anti-rabbit HRP conjugates (Daco,
Carpinteria, Calif.). HRP activity was detected by developing with
DAB substrate (Research Genetics).
[0156] To determine the number of cycling cells, tissue sections
were stained with the ki-67 antibody (Abcam, Inc., Cambridge, UK)
followed by anti-mouse IgG HRP conjugate. Sections were analyzed at
magnification of .times.100. Number of cells positive for ki-67 was
normalized per mm.sup.2. The mean number.+-.SD per
VEGF.sub.121/rGel or control group is presented. The average
numbers derived from analysis of each slide were combined per
either VEGF.sub.121/rGel or rGel group and analyzed for statistical
differences.
[0157] The number of cycling tumor cells in lesions from the
VEGF.sub.121/rGel group was reduced by .about.60% as compared to
controls (FIG. 19). The overall mean vascular density of lung
colonies was reduced by 51% (Table 3 and FIG. 18). These findings
suggest that vascularity of metastases directly affects tumor cell
proliferation.
Example 22
[0158] Effect of VEGF.sub.121/rGelonin on flk-1 Expression in Tumor
Vessel Endotheluim of MDA-MB-231 Pulmonary Metastatic Foci
[0159] The expression of VEGF receptor-2 on the vasculature of
breast tumors metastatic to lung was assessed using the RAF-1
antibody. Frozen sections of lungs from mice treated with
VEGF.sub.121/rGel or free gelonin were stained with monoclonal rat
anti-mouse VEGFR-2 antibody RAFL-1 (10 .mu.g/ml). RAFL-1 antibody
was detected by goat anti-rat IgG-HRP. The expression of KDR on the
remaining few vessels present in lung metastatic foci demonstrated
a significant decline compared to that of lung foci present in
control tumors (FIG. 20). This suggests that the VEGF.sub.121/rGel
agent is able to significantly down-regulate the receptor or
prevent the outgrowth of highly receptor-positive endothelial
cells.
Example 23
[0160] Summary of the Biological Properties of
VEGF.sub.121/rGelonin
[0161] VEGF.sub.121/rGel was found to be selectively toxic to
dividing endothelial cells overexpressing the KDR/Flk-1 receptor.
Nondividing (confluent) endothelial cells were almost 60-fold more
resistant than were dividing cells to the fusion construct and also
were more resistant to free gelonin (Table 1). These findings
accord with those of previous studies that showed conjugates of
vascular endothelial growth factor and diphtheria toxin were highly
toxic to log-phase cells but were not toxic to confluent
endothelial cells. The greater sensitivity of dividing endothelial
cells to VEGF-toxin constructs may be because of differences in
intracellular routing or catabolism of the construct as observed
with other targeted therapeutic agents.
[0162] Cytotoxicity studies demonstrated that expression of the
KDR/Flk-1 receptor is needed for VEGF.sub.121/rGel to be cytotoxic.
Cells overexpressing KDR/Flk-1 (>1.times.10.sup.5 sites per
cell) were highly sensitive to the VEGF.sub.121/rGel fusion
construct, whereas cells expressing fewer than 0.4.times.10.sup.5
sites per cell were no more sensitive to the fusion toxin than they
were to free gelonin. Again, the requirement to surpass a threshold
level of KDR/Flk-1 for cytotoxicity may contribute to the safety of
VEGF.sub.121/rGel. In normal organs, including the kidney
glomerulus and pulmonary vascular endothelium, the level of
KDR/Flk-1 may be below that needed to cause toxicity. The number of
receptors for vascular endothelial growth factor on endothelial
cells in the vasculature of normal organs has been reported to be
significantly lower than on tumor vasculature. Indeed, one could
not detect binding of VEGF.sub.121/rGel to normal vascular
endothelium in organs other than the kidney, where weak binding was
observed. Furthermore, no damage to vascular endothelium was
observed in normal organs, including the kidney.
[0163] Other gelonin-based-targeted therapeutics also have been
observed to become toxic to cells only when a certain threshold
level of binding is surpassed. In a recent study of immunotoxins
directed against the c-erb-2/HER2/neu oncogene product,
immunotoxins were not cytotoxic to tumor cells expressing less than
about 1.times.10.sup.6 HER2/neu sites per cell. The lack of
sensitivity of cells having low levels of receptors is presumably
because the cells internalize too little of the toxin or traffic it
to compartments that do not permit translocation of the toxin to
the ribosomal compartment.
[0164] Although VEGF/rGel fusion can bind to both the KDR and FLT-1
receptors, only cells expressing KDR were able to internalize the
construct thereby delivering the toxin component to the cytoplasmic
compartment. It has been suggested that it is the interaction of
vascular endothelial growth factor with the KDR receptor but not
the FLT-1 receptor that is responsible for the growth proliferative
signal on endothelial cells. Other studies suggest that the KDR
receptor is primarily responsible for mediating the vascular
permeability effects of VEGF-A. Although FLT-1 receptor may
modulate signaling of the KDR receptor and impact monocyte response
to vascular endothelial growth factor, its role in
neovascularization has not been well-defined.
[0165] The presence of FLT-1, even at high levels, does not seem to
mediate cellular toxicity of the VEGF.sub.121/rGel fusion toxin.
Although VEGF binds to the FLT-1 receptor, the current study has
been unable to demonstrate receptor phosphorylation as a result of
ligand binding. It has been suggested that receptor phosphorylation
may be required for KDR signaling and internalization. If so, the
receptor-fusion-toxin complex may not internalize efficiently after
binding to FLT-1 for the fusion protein to be routed to an
intracellular compartment from which the toxin can escape to the
cytosol. The relative contributions of the FLT-1 and KDR receptors
to the biological effects of vascular endothelial growth factor
examined by using a monoclonal antibody that blocks the interaction
of vascular endothelial growth factor with KDR/Flk-1 but not FLT-1
demonstrate that KDR/Flk-1 is the major receptor determining the
vascular permeability-inducing and angiogenic effects of vascular
endothelial growth factor in tumors.
[0166] Another important observation was that the cytotoxic effects
of the VEGF.sub.121/rGel construct on vascular endothelial cells
did not involve an apoptotic mechanism. This is in sharp contrast
to studies of other toxins such as ricin A chain (RTA) and
Pseudomonas exotoxin (PE) which demonstrate generation of apoptotic
effects that are mediated, at least in part, by caspase activation.
It has been suggested that PE toxins may generate cytotoxic effects
through both caspase-dependant and protein synthesis inhibitory
mechanisms. Despite the sequence homology of ricin A chain and rGel
and the known similarities in their mechanism of action, it appears
that these two toxins differ in their pro-apoptotic effects. One
possible explanation for the observed differences in apoptotic
effects between ricin A chain and the rGel toxin could be in the
cell types examined. The cells targeted in the current study of
rGel are non-transformed endothelial cells while those in the ricin
A chain study were tumor cells.
[0167] The exposure duration studies for the VEGF.sub.121/rGel
fusion toxin demonstrate that as little as 1 hr exposure to target
cells is required to develop a cytotoxic effect 72 hrs later.
However, continual exposure for up to 48 hrs was shown to improve
the cytotoxic effect by almost 10 fold. Should pharmacokinetic
studies demonstrate a relatively short plasma half-life for this
agent, this may suggest that optimal therapeutic effect could be
achieved by maintaining blood concentrations of drug at therapeutic
concentrations for at least 48 hrs. This could be achieved by
frequent interval dosing or continuous infusion but may be
important in the development of pre-clinical and clinical dosing
strategies.
[0168] The antitumor effects of the VEGF.sub.121/rGel fusion
construct against both melanoma and human prostate carcinoma
xenografts was impressive in magnitude and prolonged. A-375M and
PC-3 cells in culture were resistant to the fusion construct in
vitro, despite the reported presence of KDR on the melanoma (but
not on PC-3) cells. Therefore, the antitumor effects observed in
vivo appear not to be caused by direct cytotoxic effects of
VEGF.sub.121/rGel on the tumor cells themselves. The antitumor
effect seems to be exerted indirectly on the tumor cells through
specific damage to tumor vasculature. The VEGF.sub.121 fusion toxin
localized to tumor blood vessels after i.v. administration.
Vascular damage and thrombosis of tumor blood vessels were observed
within 48 h of administration of VEGF.sub.121/rGel to PC-3 mice,
consistent with the primary action of the construct being exerted
on tumor vascular endothelium.
[0169] VEGF.sub.121/rGel also has an impressive inhibitory effect
on tumor metastases. Administration of the VEGF.sub.121/rGel
construct to mice previously injected (i.v.) with the MDA-MB-231
human breast tumor cells dramatically reduced the number of tumor
colonies found in lung, their size and their vascularity. In
addition, the number of cycling breast tumor cells within lung
metastatic foci was found to be reduced by an average of 60%. In
addition to the reduced number of blood vessels present in lung
metastases of treated mice, the few vessels present had a greatly
reduced expression of VEGFR-2. Therefore, VEGF.sub.121/rGel
demonstrated an impressive, long-term impact on the growth and
development of breast tumor metastatic foci found in lung.
[0170] The salient finding of the effects of VEGF.sub.121/rGel
construct is that this fusion toxin is specifically cytotoxic to
cells over-expressing the KDR receptor for VEGF. However, the human
breast MDA-MB-231 cancer cells employed for the metastatic studies
described above do not express this receptor and, therefore, were
not directly affected by this agent. The antitumor effects of
VEGF.sub.121/rGel observed on the MDA-MB-231 metastases thus appear
to be solely the result of targeting tumor vasculature.
[0171] Neovascularization is a particularly important hallmark of
breast tumor growth and metastatic spread. The growth factor VEGF-A
and the receptor KDR have both been implicated in highly metastatic
breast cancer. It is of interest to note that administration of
VEGF.sub.121/rGel resulted in a 3-fold decrease in the number of
Ki-67 labeled (cycling) cells in the metastatic foci present in
lung (FIG. 19). Clinical studies have suggested that tumor cell
cycling may be an important prognostic marker for disease-free
survival in metastatic breast cancer, but that Ki-67 labeling
index, tumor microvessel density (MVD) and neovascularization
appear to be independently regulated processes (Honkoop et al.,
1998; Vartanian and Weidner, 1994). This is the first report of a
significant reduction in tumor labeling index produced by a
vascular targeting agent.
[0172] The vascular-ablative effects of the VEGF.sub.121/rGel
fusion construct alone were able to partially eradicate lung
metastases. Although development of small, avascular, metastatic
foci within lung tissue was observed, the growth of larger
pulmonary metastases was completely inhibited by treatment with the
VEGF.sub.121/rGel fusion toxin. It is conceivable that combination
of VEGF.sub.121/rGel fusion construct with chemotherapeutic agents
or with radiotherapeutic agents that directly damage tumor cells
themselves may provide for greater therapeutic effect. Studies of
several vascular targeting agents in combination with
chemotherapeutic agents have already demonstrated a distinct in
vivo anti-tumor advantage of this combination modality against
experimental tumors in mice (Siemann et al., 2002). Studies by
Pedley et al. (2002) have also suggested that combination of
vascular targeting and radioimmunotherapy may also present a potent
antitumor combination. Finally, studies combining hyperthermia and
radiotherapy with vascular targeting agents have demonstrated
enhanced activity against mammary carcinoma tumors in mice (Murata
et al., 2001).
Example 24
[0173] Treatment of Orthotopic BladderTumors With
VEGF.sub.121/rGelonin
[0174] Direct cytotoxic effect of VEGF.sub.121/rGel and rGel on the
highly tumorigenic and metastatic human bladder tumor cell line
253J B-V was initially evaluated in vitro and compared to the
cytotoxic effect on PAE/KDR cells. Treatment of log-phase cells
with VEGF.sub.121/rGel for 72 h showed the greatest cytotoxic
effect against PAE/KDR cells, with an IC.sub.50 of 1 nM (FIG. 21).
In contrast, the IC.sub.50 of rGel on these cells was approximately
100 nM, similar to the IC.sub.50 of VEGF.sub.121/rGel on 253J B-V
cells. However, 253J B-V cells were approximately 7-fold more
sensitive to the cytotoxic effects of VEGF.sub.121/rGel compared to
that of untargeted rGel toxin (100 nM vs. 700 nM respectively).
These values are similar to those for other tumor cells. Thus,
VEGF.sub.121/rGel is far more potent towards endothelial cells that
over-express the KDR receptor than to 253J B-V cells in vitro.
[0175] The therapeutic and anti-angiogenic effect of the fusion
protein VEGF.sub.121/rGel was evaluated against human bladder
cancer xenografts growing in athymic nude mice. Each mouse was
anesthetized with sodium pentobarbital (25 mg/kg) i.p. and placed
in the supine position. A lower midline incision was performed, and
the bladder was exposed. The highly tumorigenic and metastatic 253J
B-V human transitional cell carcinoma cells (3.5.times.10.sup.5
cells in 50 .mu.l of HBSS) were implanted into the wall of the
bladder in the area of the bladder dome using 30-gauge needles on
disposable 1 ml syringes. A successful implantation was indicated
by a bleb in the bladder wall serosa. The abdominal wound was
closed in one layer with metal wound clips.
[0176] Thirty mice were randomized into three treatment groups, and
treatment began on the third day after tumor injection into the
bladder. The animals were treated with the following protocol:
Group 1, 200 .mu.l saline every other day for ten days (5
treatments); Group 2, 29 .mu.g recombinant gelonin in 200 .mu.l
saline every other day for ten days (5 treatments); Group 3, 80
.mu.g VEGF.sub.121/rGel in 200 .mu.l saline every other day for ten
days (5 treatments). Twenty-one days after tumor injection, the
animals were sacrificed and the bladders were harvested, weighed
and processed.
[0177] As shown in FIG. 21, no difference was observed in tumor
weight from mice treated with saline or rGel (p<0.05). In
contrast, tumors from mice treated with VEGF.sub.121/rGel weighed
about 40% that of the control (p<0.05).
[0178] Bladder tumors from treated mice were processed for
histology and immunohistochemical analysis. Immunofluorescence of
tumor tissue sections with anti-CD-31 and anti-gelonin antibodies
showed dramatic co-localization of VEGF.sub.121/rGel with CD-31 on
tumor neovasculature (FIG. 22), indicating that VEGF.sub.121/rGel
targets the tumor endothelium. In some instances, VEGF.sub.121/rGel
did not co-localize with CD-31. VEGF.sub.121/rGel was not detected
in other tissues. Immunostaining with anti-gelonin antibody of
tumors from animals treated with rGel were negative, indicating the
specificity of VEGF.sub.121 as a targeting moiety for the tumor
vasculature.
[0179] To study the in vivo effect on tumor cells as a result of
VEGF.sub.121/rGel cytotoxicity on endothelial cells, bladder tumors
from mice treated with VEGF.sub.121/rGel, rGel or saline were
stained for apoptotic effects. Both necrotic as well as
non-necrotic regions were examined by immunofluorescent terminal
deoxynucleotidyl-dUTP nick-end labeling (TUNEL) assay. As shown in
FIG. 23, tumors treated with either saline or rGel showed virtually
no apoptotic regions. In contrast, treatment with VEGF.sub.121/rGel
resulted in an increase in necrotic areas.
VEGF.sub.121/rGel-treated tumors showed significantly higher TUNEL
staining than rGel- or saline-treated tumor-bearing mice.
[0180] Laser Scanning Cytometry (LSC)-mediated quantitative
analysis was used to determine the number of TUNEL positive cells
in each tissue section. Negative control slides were used to set
the gates on the scattergram, and each bladder tumor section was
scanned by LSC to determine the percentage of apoptotic cells in
1.times.10.sup.4 total cells per tumor. Tumor sections from
rGel-treated mice had 2.73.+-.0.72% (n=3) TUNEL positive cells,
whereas tumor sections from VEGF.sub.121/rGel-treated mice had
6.3.+-.1.67% (n=3) TUNEL positive cells (p=0.027). Thus,
VEGF.sub.121/rGel is a cytotoxic agent that targets the
neovasculature of bladder carcinoma and a useful combination
therapy for the treatment of bladder cancer.
Example 25
[0181] VEGF.sub.121/rGelonin Inhibits Intrafemoral PC3 Tumor Growth
and Reduces the Number of Osteoclasts
[0182] The anti-tumor effect of the fusion protein
VEGF.sub.121/rGel was evaluated in a prostate cancer bone model by
injecting PC3 tumor cells into the distal epiphysis of the right
femur of athymic nude mice. The animals were anesthetized with
intramuscular injections of ketamine (100 mg/kg) plus acepromazine
(2.5 mg/kg). Aliquots of 5.times.10.sup.4 of PC3 cells were diluted
in 5 .mu.l of growth medium and then injected into the distal
epiphysis of the right femur of each mouse using a 28-gauge
Hamilton needle. The contralateral femur was used as an internal
control. Twenty mice were randomized into two treatment groups.
Treatment began one week after tumor placement. The animals were
treated (i.v.) with the following protocol: Group 1, 200 .mu.l
saline every other day for nine days (5 treatments); Group 2, 180
.mu.g VEGF.sub.121/rGel in 200 .mu.l saline every other day for
nine days (5 treatments). Mice were monitored weekly for tumor bulk
and bone loss. Tumor growth was monitored by X-ray analysis and
animals with large osteolytic lesions or bone lysis were
sacrificed.
[0183] Prostate cancer-bearing mice treated with saline developed
osteolytic lesions (FIGS. 25) and 50% survival occurred 40 days
after tumor placement (FIG. 26). In contrast, treatment with
VEGF.sub.121/rGel resulted in suppression of intrafemoral tumor
growth as assessed radiologically (FIGS. 25) and 50% of the
VEGF.sub.121/rGel-treated mice survived past 140 days without sign
of osteolysis (FIG. 26).
[0184] TRAP staining of bone sections revealed a dramatic increase
in the number of osteoclasts in the tumor-bearing leg of mice
treated with saline (FIG. 27). In contrast, bone sections of
VEGF.sub.121/rGel-treated mice showed a normalized number of
osteoclasts, suggesting that VEGF.sub.121/rGel may play a role in
inhibiting osteoclast proliferation and/or differentiation. H&E
staining showed PC3 cells proliferating in bone sections of mice
treated with saline (FIG. 28, left panel) and in isolated pockets
in some bone sections from VEGF.sub.121/rGel-treated mice (FIG. 28,
arrows, middle panel). FIG. 28, right panel, showed bone sections
without any tumor cells from mice treated with
VEGF.sub.121/rGel.
Example 26
[0185] VEGF.sub.121/rGelonin is Cytotoxic to Osteoclast Precursor
Cells and Inhibits Differentiation to Mature Osteoclasts
[0186] To examine the effect of VEGF.sub.121/rGel in the bone
microenvironment and test if VEGF.sub.121/rGel may be targeting
osteoclast precursor cells in vivo, the effect of VEGF.sub.121/rGel
fusion toxin on RANKL-induced osteoclast differentiation of
osteoclast precursor RAW cells was examined in vitro. The effect of
VEGF.sub.121/rGel and rGel on M-CSF and RANKL-dependent osteoclast
differentiation of primary bone marrow monocytes was also
examined.
[0187] M-CSF dependent, non-adherent bone marrow cells representing
cells of the monocyte lineage were isolated from tibiae and femora
of mice. Tibiae and femora were aseptically dissected from mice.
Bone ends were cut off, and marrow was forced out in MEM
supplemented with 10% FBS and penicillin. The marrow suspension was
filtered through a fine meshed sieve to remove bone particles and
gentle pipetting was used to obtain a single cell suspension. The
bone marrow cells were washed and plated at 1.5-2.times.10.sup.7
cells/10 cm dish with 10 ml of MEM and cultured for 24 h in the
presence of M-CSF (10 ng/ml). On the following day, non-adherent
cells were re-suspended in MEM, plated at 2.5.times.10.sup.4 cells
per well in a 96 well dish for cytotoxicity assays or
5.times.10.sup.3 per well in a 96 well plate for osteoclast assays.
The cells were then cultured for 3 days in the presence of 10 ng/ml
M-CSF before they were used for further experiments.
[0188] For in vitro osteoclast differentiation assay, primary bone
marrow monocytes or RAW 264.7 cells were cultured in 96-well dishes
at a density of 5.times.10.sup.3 cells per well and
3.times.10.sup.3 cells per well, respectively. RAW 264.7 cells were
cultured with 100 ng/ml RANKL. Primary bone marrow monocytes were
cultured with 10 ng/ml M-CSF and 100 ng/ml RANKL and culture medium
was changed on day 3. Osteoclast differentiation was determined by
counting the total number of multinucleated (3 nuclei),
tartrate-resistant acid phosphatase (TRAP)-positive cells per well
on day 5 using Leucocyte Acid phosphatase kit (Sigma-Aldrich, St.
Louis, Mo.).
[0189] As shown in FIG. 29, increasing concentrations of
VEGF.sub.121/rGel, but not rGel, caused a dramatic decrease of
TRAP.sup.+ multi-nucleated osteoclasts in the RAW 264.7 cell
culture. The observed effect was not mediated by either
VEGF.sub.121 or gelonin alone but was a characteristic unique to
the VEGF.sub.121/rGel fusion protein. The IC.sub.50 of
VEGF.sub.121/rGel on dividing RAW cells was 40 nM as compared with
900 nM for rGel itself, indicating the presence of a receptor for
VEGF.sub.121.
[0190] Similar to the effects on RAW cells, VEGF.sub.121/rGel
inhibited M-CSF and RANKL-mediated osteoclast differentiation of
primary mouse bone marrow-derived osteoclast progenitors in a
dose-dependent manner (FIG. 30). rGel had little effect. While RAW
cells do not require M-CSF for their survival or differentiation
into osteoclasts, primary bone marrow-derived monocytes require
exogenous M-CSF for their survival. VEGF.sub.121/rGel, but not
rGel, inhibited the M-CSF-dependent survival of the monocytes. As
with RAW cells, the IC.sub.50 of VEGF.sub.121/rGel (10 nM) was
lower than the IC.sub.50 of rGel (FIG. 30, exact IC.sub.50 not
determined) on bone marrow-derived monocytes. Furthermore,
VEGF.sub.121/rGel exhibited a greater inhibitory effect on the
primary monocytes as compared to RAW cells. Thus VEGF.sub.121/rGel
not only inhibited RANKL-mediated differentiation of osteoclast
precursors, it also exhibited cytotoxicity towards undifferentiated
cells in a targeted manner.
Example 27
[0191] Localization of VEGF.sub.121/rGelonin into Osteoclast
Precursor Cells is Mediated by Flt-1
[0192] Because VEGF.sub.121/rGel exhibited targeted cytotoxicity on
RAW and bone marrow-derived monocytes, the levels of expression of
VEGF.sub.121 receptors Flk-1/KDR and Flt-1 were examined in these
cells. PCR analysis indicated low levels of Flt-1, but no Flk-1/KDR
transcript, in RAW cells (FIG. 31A). Western blot analysis of RAW
cells validated this observation. PCR analysis of unstimulated bone
marrow-derived monocytes showed a higher level of the Flt-1
transcript as compared to RAW cells (FIG. 31B). No Flk-1/KDR was
detected in bone marrow-derived monocytes.
[0193] PCR analysis of VEGF-A isoforms indicated the presence of
low levels of VEGF164 and VEGF120. VEGF189 and VEGFx were not
detected. Stimulation of RANKL-mediated osteoclastogenesis did not
change the levels of Flk-1/KDR or VEGF-A isoforms, but
downregulated Flt-1 transcript by 72 h after addition of RANKL
(FIG. 31B). The downregulation of Flt-1 mRNA in bone marrow-derived
monocytes following stimulation of osteoclastogenesis by RANKL was
confirmed by RT-PCR analysis (FIG. 31C).
[0194] Based on the observation that the cytotoxicity of
VEGF.sub.121/rGel on endothelial cells is mediated through
Flk-1/KDR and not Flt-1, it is hypothesized that Flk-1/KDR plays an
important but as yet unknown role in RANKL-mediated
osteoclastogenesis. However, it is also possible that the biology
of VEGF receptors is different in osteoclasts compared to
endothelial cells, and VEGF.sub.121/rGel is able to inhibit
formation of osteoclasts via Flt-1. To this end, whether
VEGF.sub.121/rGel was delivered into the cytoplasm of the cells was
examined by immunostaining.
[0195] To study internalization of VEGF.sub.121/rGel into RAW
cells, the cells were incubated with various concentrations of
VEGF.sub.121/rGel or rGel for various periods of time. To
demonstrate receptor specificity, the cells were pre-treated with
Flt-1 or Flk-1 neutralizing antibodies for one hour prior to
treatment with VEGF.sub.121/rGel or rGel. Glycine buffer (500 mM
NaCl, 0.1 glycine, pH 2.5) was used to strip the cell surface of
non-internalized VEGF.sub.121/rGel. Cells were fixed with 3.7%
formaldehyde and permeabilized with 0.2% Triton X-100. Non-specific
binding sites were blocked with 5% BSA in PBS. The cells were then
incubated with a rabbit anti-gelonin polyclonal antibody (1:200)
followed by a TRITC-conjugated anti-rabbit secondary antibody
(1:80). Nuclei were stained with propidium iodide (1 .mu.g/ml) in
PBS. The slides were fixed with DABCO media, mounted and visualized
under fluorescence (Nikon Eclipse TS1000) and confocal (Zeiss LSM
510) microscopes.
[0196] As shown in FIG. 32, only RAW cells treated with
VEGF.sub.121/rGel, but not rGel, showed VEGF.sub.121/rGel
localization in the cytoplasm and this appears to account for the
cytotoxic effect of this agent. The internalization of
VEGF.sub.121/rGel was tempered by addition of VEGF.sub.121 as a
competitor. Pretreatment of RAW cells with neutralizing antibodies
to Flt-1, but not anti-Flk-1/KDR, inhibited the localization of
VEGF.sub.121/rGel into these cells.
[0197] To determine the role of VEGF.sub.121 receptors in
VEGF.sub.121/rGel-mediated cytotoxicity of osteoclast precursor
cells, bone marrow-derived monocytes were preincubated with
neutralizing antibodies to Flt-1 or Flk-1/KDR for one hour prior to
addition of VEGF.sub.121/rGel for 72 h. Cell viability was not
affected by the addition of up to 20 .mu.g/ml anti-Flk-1 antibody
(FIG. 33). However, neutralizing antibody to Flt-1 blocked the
cytotoxic effects of VEGF.sub.121/rGel in a dose-dependent manner
(FIG. 33). Less than 2 .mu.g/ml of antibody was sufficient to
restore cell viability to 100% in the presence of 40 nM
VEGF.sub.121/rGel. Thus Flt-1, but not Flk-1/KDR, mediates
VEGF.sub.121/rGel cytotoxicity in osteoclast precursors. In
addition, Flt-1, but not Flk-1/KDR mediates VEGF-A signaling in
osteoclast precursor cells.
[0198] FIG. 34 proposes a role for VEGF in tumor invasion and
osteolytic penetration in bone. Tumor growth following skeletal
metastases requires proliferation of new blood vessels as well as
resorption of bone. VEGF and its receptors play a critical role in
both pathways and in the development of skeletal metastases. The
fusion protein VEGF.sub.121/rGel is a useful molecule to probe the
roles of VEGF and its receptors, as it can prevent both
angiogenesis and bone resorption by competing with VEGF as well as
exerting cytotoxic effects.
Example 28
Cloning of Human Granzyme B Gene and Construction of Granzyme
B/VEGF.sub.121 Fusion Gene
[0199] The following examples describe a fusion construct of
VEGF.sub.121 and proapoptotic enzyme granzyme B (GrB) designed for
specific delivery to tumor neovasculature. Human granzyme B gene
was cloned from human cutaneous T-cell lymphoma (HuT-78) cells and
then fused to VEGF.sub.121 via a short, flexible tether using a
PCR-based construction method. The fusion protein was expressed in
Escherichia coli and purified by nickel-NTA metal affinity
chromatography. The fusion protein GrB/VEGF.sub.121 was
characterized and the biological activities and mechanism were
determined.
[0200] RNA from HuT-78 cells was isolated and target premature
human granzyme B cDNA was amplified by reverse transcription-PCR
using the following primers: Ncolgb,
5'-GGTGGCGGTGGCTCCATGGAACCAATCCTGCTTCTG-3' (SEQ ID NO:5) and
CxhoIgb, 5'-GCCACCGCCTCCCTCGAGCTATTAGTAGCGTTTCATGGT-3' (SEQ ID
NO:6). The human granzyme B sequence with signal sequence was
designated as premature granzyme B (.about.800 bp) (FIG. 35). The
PCR product was then cloned into the PCR 2.1 TA vector designated
as gbTA. The gbTA was transformed into INVaF' competent cells, and
positive clones were screened by PCR. The DNA from positive clones
was isolated and then sequenced. The correct clone was designated
gbTA-2.
[0201] In cytotoxic cells, active granzyme B was generated from a
zymogen by dipeptidyl peptidase I-mediated proteolysis, which
removes the two residue (Gly-Glu) propeptide and exposes
Ile.sup.21. The amino-terminal Ile-Ile-Gly-Gly sequence of granzyme
B is necessary for the mature, active granzyme B.
[0202] To construct GrB/VEGF.sub.121 fusion gene, the coding
sequence of granzyme B was amplified by PCR from Ile.sup.21,
effectively deleting the signal sequence and Gly-Glu domain. At the
same time, a cleavage site for EK (DDDDK, SEQ ID NO:7) was inserted
upstream and adjacent to Ile.sup.21. Mature granzyme B was attached
to the recombinant VEGF.sub.121 carrier via flexible tether
(G.sub.4S). The fused gene fragment was then introduced into the
XbaI and XhoI sites of the pET32a(+) to form the expression vector
pET32GrB/VEGF.sub.121 (FIG. 36). This vector contains a T7 promoter
for high-level expression followed by a Trx.tag, a His.tag, a
thrombin cleavage site, and an EK cleavage site for final removal
of the protein purification tag. Once protein tag is removed by rEK
digestion, the first residue (isoleucine) of mature granzyme B is
exposed, thereby activating the granzyme B moiety of
GrB/VEGF.sub.121 construct.
[0203] The GrB/VEGF.sub.121 fusion gene was constructed by an
overlap PCR method. Briefly, granzyme B coding sequence was
amplified from gbTA-2 using the following primers: NgbEK,
5'-GGTACCGACGACGACGACAAGATCATCGGGGGACATG AG-3' (SEQ ID NO:8) and
Cgb, 5'-GGAGCCACCGCCACCGTAGCGTTTCATGGT-3' (SEQ ID NO:9). These were
designed to delete the signal sequence of premature granzyme B,
insert an EK cleavage site at the amino terminus, and add a G4S
linker sequence to the carboxyl terminus to serve as a link to the
VEGF.sub.121 gene. VEGF.sub.121 sequence was amplified from a
plasmid pET22-VEGF.sub.121 (from Dr. Philip Thorpe, University of
Texas Southwestern Medical Center, Dallas, Tex.) using the
following primers: Nvegf, 5'-GGTGGCGGTGGCTCCGCACCCATGGCAGAA-3' (SEQ
ID NO:10) and CxhoI veg, 5'-AAGGCTCGTGTCGACCTCGAGTCATTACCG
CCTCGGCTTGTC-3' (SEQ ID NO:11). To clone the fused genes into
pET32a(+) vector with an EK site at the amino terminus of granzyme
B, the fragment from pET32a(+) was amplified using the following
primers: T7 promoter, 5'-TAATACGACTCACTATAG (SEQ ID NO:12) and
CpET32EK, 5'-CTTGTCGTCGTCGTCGGTACCCAGATCTGG-3' (SEQ ID NO:13). The
primer has an EK site at carboxyl terminus overlapping with the
amino terminus of the fused gene. Using overlap PCR, the fusion
genes (EK-GrB/VEGF.sub.121) were constructed using as primers the
T7 promoter and CxhoI veg. Amplified fragments were purified,
digested with XbaI and XhoI, and cloned into pET32a(+) vector,
designed as pET32GrB/VEGF.sub.121. A correct clone was chosen for
transformation into AD.sub.494 (DE.sub.3) pLysS-competent cells for
further induction and expression.
Example 29
Expression And Purification of Granzyme B/VEGF.sub.121 Fusion
Protein
[0204] Bacterial colonies transformed with the constructed plasmid
were grown in Luria broth medium (containing 400 mg/ml
carbenicillin, 70 mg/ml chloramphenicol, and 15 mg/ml kanamycin) at
37.degree. C. overnight at 240 rpm in a shaking incubator. The
cultures were then diluted 1:100 in fresh Luria broth+antibiotics
(200 mg/ml ampicillin, 70 mg/ml chloramphenicol, and 15 mg/ml
kanamycin) and grown to A.sub.600nm=0.6 at 37.degree. C.;
thereafter, isopropyl-1-thio-b-D-galactopyranoside was added to a
final concentration of 100 mM and the cells were incubated at
37.degree. C. for 2 h to induce fusion protein expression. The
cells were harvested, resuspended in 10 mM Tris (pH 8.0), and
stored frozen at -80.degree. C. for later purification.
[0205] Thawed, resuspended cells were lysed by addition of lysozyme
to a final concentration of 100 mg/ml with agitation for 30 min at
4.degree. C. followed by sonication. Extracts were centrifuged at
186,000.times.g for 1 h. The supernatant containing only soluble
protein was adjusted to 40 mM Tris, 300 mM NaCl, and 5 mM imidazole
(pH 8.0) and applied to nickel-NTA agarose resin equilibrated with
the same buffer. The nickel-NTA agarose was washed with 300 mM NaCl
and 20 mM imidazole and the bound proteins were eluted with 500 mM
NaCl and 500 mM imidazole. Absorbance (280 nm) and SDS-PAGE
analyses were performed to determine the presence of the
polyhistidine-tagged protein, designated as Pro-GrB/VEGF.sub.121.
The eluted Pro-GrB/VEGF.sub.121 was dialyzed against 20 mM Tris-HCl
(pH 7.4) and 150 mM NaCl. The GrB moiety of Pro-GrB/VEGF.sub.121
was activated by the addition of bovine rEK to remove the
polyhistidine tag according to the manufacturer's instructions (1
unit of rEK for cleavage of 50 mg protein incubated at room
temperature for 16 h). The rEK was removed by EK capture agarose.
The protein solution was then passed through a column containing
Q-Sepharose to remove non-rEK-digested construct and nonspecific
proteins. The product was analyzed by SDS-PAGE to determine purity,
and Bio-Rad protein assay was used to determine protein
concentration. Samples were then aliquoted and stored at 4.degree.
C.
[0206] One liter of the culture typically yielded .about.100 mg of
the final purified GrB/VEGF.sub.121 product. SDS-PAGE analysis
showed that the final purified GrB/VEGF.sub.121 fusion construct
migrated under reducing conditions as a band at the expected
molecular mass of 38 kDa (FIG. 37A). Specificity of the cleaved
fusion protein was confirmed by Western blot using either VEGF121
mouse monoclonal antibody or GrB mouse monoclonal antibody (FIG.
37B).
Example 30
Binding Activity of Granzyme B/VEGF.sub.121 Fusion Protein
[0207] Binding activity of GrB/VEGF.sub.121 was determined by
ELISA. Ninety six-well plates coated with 50,000 cells/well of
PAE/FLK-1, PAE/FLT-1, human melanoma A375M or human breast cancer
SKBR3-HP cells were blocked by 5% BSA and then treated with
purified GrB/VEGF.sub.121 at various concentrations. After washing,
the plates were incubated with either GrB antibody or VEGF.sub.121
antibody followed by HRP-goat anti-mouse IgG. Then, the substrate
2,2'-azino-bis-3-ethylbenzthiazoline-6-sulfonic acid (ABTS)
solution with 1 ml/ml of 30% H.sub.2O.sub.2 was added to the wells.
Absorbance at 405 nm was measured after 30 min.
[0208] GrB/VEGF.sub.121 specifically bound to PAE/FLK-1 cells.
However, the protein did not bind to PAE/FLT-1 cells or to melanoma
A375M or human breast cancer SKBR3-HP cells, as detected by either
an anti-GrB mouse monoclonal antibody (FIG. 38A) or an
anti-VEGF.sub.121 mouse monoclonal antibody (FIG. 38B).
Example 31
Internalization of Granzyme B/VEGF.sub.121 Fusion Protein Assessed
by Immunofluorescence Microscopy
[0209] Cells were plated in 16-well chamber slides (Nunc, Nalge
Nunc International, Naperville, Ill.) at 1.times.10.sup.4
cells/well and incubated overnight at 37.degree. C. in a 5%
CO.sub.2 air atmosphere. Cells were treated with 100 nM of
GrB/VEGF.sub.121 for 4 h and then washed briefly with PBS. The cell
surface was stripped by incubation with glycine buffer (500 mM
NaCl, 0.1 M glycine [pH 2.5]) and neutralized for 2 min with 0.5 M
Tris (pH 7.4) followed by wash with PBS. Cells were fixed in 3.7%
formaldehyde for 15 min at room temperature, permeabilized for 10
min in PBS containing 0.2% Triton X-100 and washed thrice with PBS.
Samples were incubated with 3% BSA for 1 h at room temperature to
block nonspecific binding sites before incubating with anti-GrB
mouse monoclonal antibody (1:100 dilution) at room temperature for
1 h followed by incubation with FITC-coupled anti-mouse IgG (1:100
dilution) at room temperature for 1 h. The walls and gaskets of the
chamber slide were then removed carefully. After air drying, the
slide was mounted and analyzed under a Nikon Eclipse TS-100
fluorescence microscope. Photographs were taken with a
scope-mounted camera.
[0210] Immunofluorescent staining clearly showed that the GrB
moiety of GrB/VEGF.sub.121 was delivered into the cytosol of
PAE/FLK-1 but not into that of PAE/FLT-1 cells after treatment with
GrB/VEGF.sub.121 for 4 h (FIG. 39). Analysis of PAE/FLK-1 cells
treated for 24 and 48 h demonstrated no further increase in
immunofluorescent staining over that observed at 4 h.
Example 32
Cytotoxicity of Granzyme B/VEGF.sub.121 Fusion Protein
[0211] The cytotoxicity of GrB/VEGF.sub.121 was assessed against
log-phase PAE/FLK-1 and PAE/FLT-1 cells in culture. PAE cells in
Ham's F-12 medium with 10% fetal bovine serum were plated into
96-well plates at a density of 2.5.times.10.sup.3 cells/well and
allowed to adhere for 24 h at 37.degree. C. in 5% CO.sub.2. After
24 h, the medium was replaced with medium containing different
concentrations of GrB/VEGF.sub.121 or VEGF.sub.121/rGel. After 72
h, the effect of GrB/VEGF.sub.121 or VEGF.sub.121/rGel on the
growth of cells in culture was determined using
2,3-bis[2-methoxy-4-nitro-5-sulfophenyl]-2H-tetrazolium-5-carboxanilide
inner salt (XTT). Plates were read on a microplate ELISA reader at
540 nm.
[0212] An IC.sub.50 effect was found at a concentration of
.about.10 nM on PAE/FLK-1 cells. However, no cytotoxic effects were
found on PAE/FLT-1 cells at doses up to 200 nM (FIG. 40A). By
comparison, the cytotoxic effects of another fusion toxin,
VEGF.sub.121/rGel, were relatively greater (on a molar basis)
against target cells in culture and demonstrated specific
cytotoxicity against PAE/FLK-1 cells at an IC.sub.50 of .about.1
nM.
[0213] The growth inhibitory effects of GrB/VEGF.sub.121 on the
proliferation of PAE cells were evaluated by clonogenic assay.
Briefly, 5.times.10.sup.5 PAE cells/ml were incubated at 37.degree.
C. and 5% CO.sub.2 for 72 h with different concentrations of either
GrB/VEGF.sub.121 or 100 nM of irrelevant fusion protein
GrB/scFvMEL. Cells were then washed with PBS, trypsinized, counted
by hemacytometer, and diluted serially. The serial cell suspensions
were then plated in triplicate and cultured in six-well plates for
5-7 days. Cells were stained with crystal violet and colonies
consisting of >20 cells were counted using an inverted light
microscope. Growth inhibition was defined as the percentage of cell
growth/number of colonies in treated samples in relation to that in
the nontreated control sample.
[0214] In the clonogenic assay (FIG. 40B), the concentration of
GrB/VEGF.sub.121 which suppressed cell colony growth by 50%
(IC.sub.50) was determined to be .about.20 nM on PAE/FLK-cells. In
contrast, there was no effect on colony growth of PAE/FLT-1 cells
at concentrations of GrB/VEGF.sub.121 up to 100 nM. There was also
no effect of irrelevant fusion protein GrB/scFvMEL targeting human
melanoma cells on colony growth of PAE cells at concentrations of
100 nM.
Example 33
GrB/VEGF.sub.121 Induced Apoptosis as Measured by TUNEL Assay
[0215] Cleavage of genomic DNA during apoptosis may yield
double-stranded, low molecular mass DNA fragments as well as
single-strand breaks (nicks) in high molecular mass DNA. The DNA
strand breaks can be identified by labeling free 3' hydroxyl
termini with modified nucleotides in an enzymatic reaction. Cells
(1.times.10.sup.4 cells/well) were treated with GrB/VEGF.sub.121 at
the IC.sub.50 concentration for different times (24 and 48 h) and
washed briefly with PBS. Cells were fixed with 3.7% formaldehyde at
room temperature for 20 min, rinsed with PBS, permeablized with
0.1% Triton X-100, 0.1% sodium citrate on ice for 2 min, and washed
with PBS twice. Cells were incubated with TUNEL reaction mixture at
37.degree. C. for 60 min followed by incubation with Converter-AP
at 37.degree. C. for 30 min and finally treated with Fast Red
substrate solution at room temperature for 10 min. After the final
wash step, the slides were mounted and analyzed for nucleus
staining of apoptotic cells under a light microscope with
400.times. magnification.
[0216] TUNEL assay produced positive results on
GrB/VEGF.sub.121-treated PAE/FLK-1 cells at 24 h (75%) and 48 h
(85%) but not on GrB/VEGF.sub.121-treated PAE/FLT-1 cells (10%)
(FIG. 41), indicating that GrB/VEGF.sub.121 induced apoptosis in
PAE/FLK-1 cells.
Example 34
GrB/VEGF.sub.121 Treatment Results in Cytochrome c Release and Bax
Translocation
[0217] PAE cells (5.times.10.sup.7) were treated with
GrB/VEGF.sub.121 at concentrations of 0.1 and 20 nM for 24 h. After
cells were washed with 10 ml of ice-cold PBS, they were resuspended
with 0.5 ml of 1.times. cytosol extraction buffer mix containing
DTT and protease inhibitors and incubated on ice for 10 min. Cells
were homogenized in an ice-cold glass homogenizer. The homogenate
was centrifuged at 700.times.g for 10 min at 4.degree. C. The
supernatant was transferred to a fresh 1.5 ml tube and centrifuged
at 10,000.times.g for 30 min at 4.degree. C. The supernatant was
collected and labeled as cytosolic fraction. The pellet was
resuspended in 0.1 ml mitochondrial extraction buffer mix
containing DTT and protease inhibitors, vortexed for 10 s, and
saved as mitochondrial fraction. Protein concentrations were
determined by using Bio-Rad Bradford protein assay. Aliquots of 30
mg from each cytosolic and mitochondrial fraction isolated from
non-treated and treated cells were loaded on a 15% SDS-PAGE.
Standard Western blot procedure was performed, and the blot was
probed with mouse anti-cytochrome c antibody (1 mg/ml) or mouse
anti-Bax antibody (1 mg/ml).
[0218] Western blot studies demonstrated that cytochrome c was
released from mitochondria into the cytosol after treating
PAE/FLK-1 cells with 20 nM GrB/VEGF.sub.121, but this effect was
not observed on PAE/FLT-1 cells (FIG. 42). Bax was found to be
normally present in both cytosol and mitochondria of untreated PAE
cells. However, when PAE/FLK-1 cells were treated with 20 nM of
GrB/VEGF.sub.121, Bax levels decreased in cytosol and increased in
mitochondria. This effect was not observed on PAE/FLT-1 cells (FIG.
42).
Example 35
Granzyme B/VEGF.sub.121 Induces DNA Laddering
[0219] PAE cells were plated onto six-well plates (2.times.10.sup.5
cells/well). Twenty-four hours later, cells were shifted to fresh
culture medium containing 20 nM of GrB/VEGF.sub.121 (1.5 ml/well).
After 24 h of incubation at 37.degree. C., DNA was extracted and
purified with DNA ladder kit (Roche) and fractionated on 1.5%
agarose gels.
[0220] DNA laddering indicative of apoptosis was observed after a
24-h exposure with GrB/VEGF.sub.121 on PAE/FLK-1 cells. As
expected, there was no DNA laddering detected on PAE/FLT-1 cells
after treatment with the fusion construct (FIG. 43).
Example 36
Granzyme B/VEGF.sub.121 Activates Caspases on Porcine Aortic
Endothelial Cells
[0221] PAE cells were treated with GrB/VEGF.sub.121, total cell
lysates were loaded onto 12% SDS-PAGE, and standard Western
blotting was performed. The results showed that treatment with
GrB/VEGF.sub.121 cleaved caspase-8, caspase-3, and PARP in
PAE/FLK-1 cells but not in PAE/FLT-1 cells (FIG. 44). These data
indicate that the GrB/VEGF.sub.121 construct activated caspases
involved in the apoptosis pathway.
Example 37
[0222] Microarray Analysis of Human Umbilical Vein Endothelial
Cells (HUVECs) Treated with VEGF.sub.121-rGel
[0223] To further elucidate the biochemical mechanisms that govern
the effects of VEGF.sub.121/rGel on endothelial cells, HUVECs were
treated with saline or the IC.sub.50 dose of VEGF.sub.121/rGel for
24 h. RNA was then isolated, evaluated for integrity, and subjected
to microarray analysis
[0224] HUVEC RNA was amplified using protocol previously described.
Test and control samples (HUVECs treated for 24 h with
VEGF.sub.121/rGel or saline, respectively) were labeled using Cy3-
and Cy5-dCTP in reverse transcription reaction. Duplicate
experiments were conducted by dye swapping. The labeled samples
were hybridized to a cDNA array of 2304 sequence-verified clones in
duplicate printed by the Cancer Genomics Core Laboratory of the
Department of Pathology at M. D. Anderson Cancer Center. The array
included 4800 genes involved in signal transduction, stress
response, cell cycle control, hypoxia, and metastatic spread.
Hybridization was performed overnight at 60.degree. C. in a humid
incubator. After washing, the hybridized slides were scanned using
a GENETAC LS IV laser scanner (Genomic Solutions, Ann Arbor, Mich.)
and signal intensities were quantified with ARRAYVISION (Imaging
Research Inc., St. Catherines, Ontario, Canada). Local
background-subtracted spot intensities were used for further
analysis. Differentially expressed genes were identified on the
basis of a cutoff value of T value. Generally, a cutoff value of
|3| is considered statistically significant.
[0225] Dye swapping experiments were designed to limit dye bias
that raises concern in microarray experiments. The two factors
addressed by this design are the differences in dye incorporation
and gene-specific effects of the dye. Normalization of the data
typically corrects for differences in incorporation of dye that
affects all the genes. Dye-specific effects can be insignificant
compared with other sources of variation in the experiment. Hence,
the dye swapping experiments were treated as duplicates. The
signal-to-noise ratio of the images was evaluated to determine the
quality of the array. Only those spots with a signal-to-noise ratio
of .gtoreq.2 were evaluated (80%). Genes that showed values greater
than |2| in at least 3 of 4 arrays were identified, and the average
fold change was determined.
[0226] On this basis, 22 genes (out of the 4800 in the microarray)
were upregulated by VEGF.sub.121/rGel at 24 h (Table 4). In
addition to upregulating select genes known to be induced by VEGF
alone, treatment with VEGF.sub.121/rGel upregulated genes involved
in inflammation, chemotaxis and transcription regulation.
[0227] Microarray data were verified by performing RT-PCR analysis
on genes that showed the highest level of induction, namely
E-selectin (SELE), cytokine A2 (SCYA2, MCP-1), tumor necrosis
factor alpha induced protein 3 (TNFAIP3) and NF-kB inhibitor alpha
(NF-kBla). Primers were designed on the basis of the accession
numbers from the microarray and confirmation of homology using
BLAST (NCBI). Induction of E-selectin in PAE/KDR cells was also
verified by RT-PCR. GAPDH primers were used as controls. The
primers used were as follows: SELE forward--5'GGTTTGGTGAGGTGTGCTC
(SEQ ID NO:16); SELE reverse--5'TGATCTTTCCCGGAACTGC (SEQ ID NO:17);
SCYA2 forward--5' TCTGTGCCTGCTGCTCATAG (SEQ ID NO:18); SCYA2
reverse--5' TGGAATCCTGAACCCACTTC (SEQ ID NO:19); TNFAIP3
forward--5'ATGCACCGATACACACTGGA (SEQ ID NO:20); TNFAIP3 reverse--5'
CGCCTTCCTCAGTACCAAGT (SEQ ID NO:21); NF-kBla forward--5'
AACCTGCAGCAGACTCCACT (SEQ ID NO:22); NF-kBla reverse
5'GACACGTGTGGCCATTGTAG (SEQ ID NO:23); porcine E-selectin (PORESEL)
forward--5'GCCAACGTGTAAAGCTGTGA (SEQ ID NO:24); PORESEL reverse--5'
TCCTCACAGCTGAAGGCACA (SEQ ID NO:25); GAPDH forward--5'
GTCTTCACCACCATGGAG (SEQ ID NO:26); and GAPDH
reverse--5'CCACCCTGTTGCTGTAGC (SEQ ID NO:27). Isolated RNA was
subjected to first-strand cDNA synthesis as described by the
manufacturer of the Superscript First Strand synthesis system
(Invitrogen, Carlsbad, Calif.). RT-PCR was performed using a
Minicycler PCR machine (MJ Research, Inc., San Francisco,
Calif.).
[0228] When normalized for GAPDH, transcripts for E-selectin
(SELE), cytokine A2 (SCYA2, MCP-1), tumor necrosis factor alpha
induced protein 3 (TNFAIP3) and NF-kB inhibitor alpha (NF-kBla)
were all increased after treatment with VEGF.sub.121/rGel, thus
validating the results observed in the original microarray (FIG.
45). However, the induction of E-selectin protein levels did not
match the induction of mRNA (FIG. 45).
[0229] Because PAE/KDR cells have been used as in vitro models for
endothelial cells in tumor neovasculature, the effect of
VEGF.sub.121/rGel on gene induction and protein expression in these
cells was investigated. PAE/KDR cells were treated with saline or
the IC.sub.50 dose of VEGF.sub.121/rGel for up to 48 h. As shown in
FIG. 46A, PCR analysis for E-selectin confirmed the increase in
message within 2 h after treatment with VEGF.sub.121/rGel. In
addition, western blot analysis demonstrated a slight increase in
E-selectin protein expression, although the increase in cellular
protein levels was slight compared with the observed increase in
message (FIG. 46B). Western blots using anti-MKP-1 and anti-ERK2
antibodies also showed no change in protein expression (data not
shown).
[0230] The results suggest that treatment of HUVECs with
VEGF.sub.121/rGel increases RNA levels of several genes that are
involved in inflammation, chemotaxis, intermediary metabolism, and
apoptotic pathways (Table I). A previous report showed that only
two of these genes, MKP-1 and CXCR4, were upregulated after
treatment with VEGF.sub.165 for 24 h. Therefore, for most of the
genes found to be upregulated in the present study, the
upregulation appears to be attributable to the VEGF.sub.121/rGel
construct and not the VEGF component itself. This microarray
analysis was the first performed on cells treated with a
plant-derived protein toxin such as gelonin.
[0231] Of all the molecules we studied, the highest level of mRNA
induced was that of the cell adhesion molecule E-selectin. In
previous studies, treatment with VEGF induced adhesion molecules
(E-selectin, VCAM-1, and ICAM-1) in HUVECs via an NF kB-mediated
process. E-selectin has been shown to be upregulated after VEGF
treatment or in response to inflammation and plays an important
role in both tube formation and angiogenesis. Previous studies have
shown that E-selectin also plays a major role in the adhesion of
epithelial cancer cells to the endothelium and that the ability of
cancer cell clones to bind E-selectin on endothelial cells is
directly proportional to their metastatic potential. Moreover,
drugs that inhibit the expression of E-selectin, such a s
cimetidine, block the adhesion of tumor cells to the endothelium
and prevent metastasis.
[0232] However, E-selectin does not necessarily have a role in the
adhesion of all cancer cells, nor do all cancer cells require
expression of the same endothelial adhesive molecule. The present
study shows that VEGF.sub.121/rGel is a member of a class of
molecules that can prevent E-selectin-mediated metastasis because
protein levels barely doubled in both PAE/KDR and HUVECs after
treatment with VEGF.sub.121/rGel. A similar pattern of induction of
RNA but not protein levels was observed with other genes as well.
For example, although MKP-1 RNA levels were induced in HUVECs after
treatment with VEGF.sub.121/rGel, western blots of PAE/KDR and
HUVEC whole cell extract did not show a corresponding increase in
protein levels (data not shown). In addition, levels of ERK2, which
was previously shown to be upregulated by MKP-1 in HUVECs after
endothelial cell injury, did not show a change up to 48 h after
VEGF.sub.121/rGel treatment. Taken together, we conclude
VEGF.sub.121/rGel induces an increase in mRNA levels of genes that
are important in cell adhesion, migration, and spread but generally
does not induce a concomitant increase in protein expression. Since
the rGel component of the fusion construct operates by inhibiting
protein synthesis, VEGF.sub.121/rGel could inhibit synthesis of
critical proteins that are important for suppression of these
specific genes.
[0233] This data also suggest that in addition to exerting a
cytotoxic effect, VEGF.sub.121/rGel may act through cellular
mechanisms involved in inflammation and stress. Previous studies
have showed that several genes are induced as a result of cellular
inflammation. For example, early growth response factor 1 (EGR1),
SCYA2, E-selectin and VCAM-1 are all up-regulated in HUVECs, and
all of these genes are induced by treatment with VEGF.sub.121/rGel.
In addition, several members of the small inducible cytokine (SCYA)
family of proteins are overexpressed after VEGF.sub.121/rGel
treatment. All of these SCYA proteins respond to inflammation
stimuli and play a role in chemotaxis: SCYA2 plays a role in
inflammation and wound healing; SCYA4 (MIP-1b) is involved in
directional migration of cells during normal and inflammatory
processes; and SCYA7 (MCP-3) and SCYA11 (eotaxin) share 65% amino
acid sequence identity and play major roles in the recruitment and
activation of eosinophils in allergic disorders. Another molecule
that plays a role in chemotaxis is CXCR4. Although treatment with
VEGF.sub.121/rGel increases the CXCR4 level to less than twice the
level without treatment, array spot intensities and reproducibility
data indicate that the increase is significant.
[0234] Transcription factors represent one of the larger classes of
genes to be upregulated by treatment with VEGF.sub.121/rGel.
Interestingly, two of them, NF-kBla (IkB-a) and NF-kB (p105
subunit), are from the NF-kB family. Since NF-kB and IkB-a interact
in an autoregulatory mechanism, the upregulation of IkB-a is most
likely due to NF-kB's mediating activation of the IkB-a gene,
resulting in replenishment of the cytoplasmic pool of its own
inhibitor. NF-kB may play a role in the upregulation of several
genes, including SCYA2, SCYA7, SCYA11, and JunB. Another
transcription factor, Kruppel-like factor (KLF4), has not been
shown to be expressed in endothelial cells. However, this molecule
is an important nuclear factor in the up-regulation of histidine
decarboxylase, an enzyme that catalyzes the conversion of histidine
to histamine, a bioamine that plays an important role in allergic
responses, inflammation, neurotransmission, and gastric acid
secretion.
[0235] Among the molecules governing apoptosis, TNFAIP3, a putative
DNA binding protein in the NF-kB signal transduction pathway,
functions by inhibiting NF-kB activation and TNF-mediated
apoptosis. BIRC3, another gene that is upregulated by treatment
with VEGF.sub.121/rGel, forms a heterodimer with a caspase-9
monomer in vitro and prevents the activation of caspase-9 in
apoptosis. Surprisingly, several genes involved in the control of
the apoptotic pathway were modulated in response to the fusion
toxin even though the overall cytotoxic effect on target cells did
not include an observable impact on the apoptotic pathway.
[0236] A finding of this study is the identification of several
genes that are regulated in response to treatment with the
VEGF.sub.121/rGel fusion construct. Since many of these genes
regulate cell adhesion, chemotaxis, and inflammatory responses, the
construct may influence tumor development in addition to exerting
direct cycotoxic effects on the tumor neovasculature. Therefore,
important considerations for future study are the effects of
VEGF.sub.121/rGel cytotoxicity on tumor endothelial cells and the
potential bystander effects of the construct on adjacent tumor
cells.
TABLE-US-00004 TABLE 4 Genes Induced by Treatment With
VEGF.sub.121/rGel Gene Accession Gene Mean Fold Classification
Number Symbol Change Cell H39560 SELE E-selectin (endothelial
adhesion molecule 1).sup.a 94.6 Adhesion H07071 VCAM Vascular cell
adhesion molecule 1 4.9 AA284668 PLAU Plasminogen activator,
urokinase 2.3 Apoptosis AA476272 TNFAIP3 Tumor necrosis factor
a-induced protein 3.sup.a 13.5 H48706 BIRC3 Baculoviral IAP
repeat-containing 3 3.3 Transcription T99236 JUNB Jun B
proto-oncogene 4.9 Factor W55872 NF-kBIa a inhibitor of nuclear
factor of kappa light chain gene enhancer 4.8 in B cell.sup.a
AA451716 NF-kB1 Nuclear factor of kappa light chain gene enhancer
in B cell 2.3 H45711 KLF4 Kruppel-like factor 4 2.3 Chemotaxis
AA425102 SCYA2 Small inducible cytokine A2 (MCP-1).sup.a 20.2
H62985 SCYA4 Small inducible cytokine A4 (MIP-1b) 5.8 AA040170
SCYA7 Small inducible cytokine A7 (MCP-3) 5.5 T62491 CXCR4
Chemokine (C-X-C motif) receptor 4 (fusin) 1.85 Structural NM004856
KNSL5 Kinesin-like 5 (mitotic kinesin-like protein 1) 6.4
Organization AA479199 NID2 Nidogen 2 3.1 AA453105 H2AFL H2A histone
family, member L 2.5 Inflammation W69211 SCYA11 Small inducible
cytokine A11 (Cys-Cys) (eotaxin) 8.4 NM001964 EGR1 Early growth
response 1 3.9 NM000963 PTGS2 Prostaglandin-endoperoxide synthase 2
(COX-2) 3.3 AA148736 SCD4 Syndecan 4 (amphiglycan, ryudocan) 3.2
Signalling W65461 DUSP5 Dual specificity phosphatase 5 (MKP-1) 2.7
Metabolic AA011215 SAT Spermidine/spermine N1-acetyltransferase 2.1
.sup.aconfirmed by RT-PCR at 4 and 24 h post-treatment
Example 38
[0237] VEGF.sub.121/rGel Inhibits Tube Formation in KDR-Expressing
Endothelial Cells
[0238] This example investigates the anti-angiogenic effect of
VEGF.sub.121/rGel in vitro by examining the inhibition of tube
formation in receptor-transfected PAE cells.
[0239] PAE/KDR and PAE/Flt-1 cells were grown to 80% confluence,
detached using Versene, and plated at a concentration of
2.times.10.sup.4 cellsper well in a 96-well Matrigel-coated plate
under reduced serum (2% FBS) conditions. Cells were treated with
100 nM, 10 nM, 1 nM, 0.1 nM, or 0.01 nM VEGF.sub.121/rGel or rGel
in triplicate for 24 h. Inhibition of tube formation was assessed
by counting the number of tubes formed per well under bright field
microscopy. The ability of VEGF.sub.121/rGel to inhibit tube
formation as a function of incubation time before plating on
Matrigel was studied by incubating PAE/KDR cells at the IC.sub.50
dose (1 nM) for different periods up to 24 h. Cells were detached
and plated in 96-well Matrigel-coated plates under the conditions
described above.
[0240] As shown in FIG. 47A, the addition of 1 nM VEGF.sub.121/rGel
significantly inhibited tube formation in KDR-transfected cells,
whereas rGel alone had little effect at this dose level. Doses of
rGel alone caused .about.42% inhibition at only the highest
concentration tested (100 nM). Endothelial cells expressing VEGFR-1
(PAE/Flt-1) were not as sensitive to VEGF.sub.121/rGel as were the
PAE/KDR cells, requiring 100 nM VEGF.sub.121/rGel or rGel to
inhibit tube formation by 50% (FIG. 47B).
[0241] To determine whether pre-treatment of PAE/KDR cells with
VEGF.sub.121/rGel affects tube formation, cells were treated with
the IC.sub.50 dose of VEGF.sub.121/rGel for 4, 16, and 24 h, washed
with PBS, detached, added to Matrigel-coated plates in
VEGF.sub.121/rGel-free medium, and incubated for an additional 24
h. Prior incubation of cells with VEGF.sub.121/rGel for 16 or 24 h
virtually abolished tube formation (FIG. 48).
[0242] The effect of VEGF.sub.121/rGel on tube formation of
endothelial cells on Matrigel-coated plates was striking in that
cells overexpressing the KDR receptor, but not cells overexpressing
the Flt-1 receptor, were affected. This result is consistent with
the findings that VEGF.sub.121/rGel is cytotoxic only to
KDR-expressing endothelial cells and that VEGF.sub.121/rGel is
internalized only into endothelial cells that express KDR but not
Flt-1. The fact that the IC.sub.50 dose for cytotoxicity is
identical to the IC.sub.50 dose for preventing tube formation in
PAE/KDR cells suggests that VEGF.sub.121/rGel action in vitro
immediately disrupts angiogenic tube formation as a temporal
prelude to its eventual cytotoxicity to rapidly dividing
endothelial cells. Preliminary results examining in vivo
endothelialization of Matrigel plugs appear to support the
observation that VEGF.sub.121/rGel construct can ablate
neovascularization at several steps in this complex process.
Example 39
[0243] VEGF.sub.121/rGel Inhibits Angiogenesis in the
Chorioallantoic Membranes of Chicken Embryos
[0244] This example investigates the antiangiogenic effects of
VEGF.sub.121/rGel in vivo using a chicken chorioallantoic membranes
model. Fertilized chicken eggs (SPAFAS; Charles River Laboratories,
Wilmington, Mass.) were incubated at 37.degree. C. at 55% humidity
for 9 days. An artificial air sac was created over a region
containing small blood vessels in the chorioallantoic membranes as
previously described (Brooks et al., 1999). A small "window" was
cut in the shell after removal of 3 ml of albumen. Filter disks
measuring 6 mm in diameter were coated with cortisone acetate in
absolute ethanol (3 mg/ml). Each chorioallantoic membranes was
locally treated with filter disks saturated with a solution
containing bFGF (50 ng/disk) and VEGF.sub.121/rGel (1 or 10 nM),
rGel (1 or 10 nM), or buffer (PBS). The filter was placed on the
chorioallantoic membranes in a region with the lowest density of
blood vessels and, as a reference, in the vicinity of a large
vessel. Angiogenesis was documented photographically 3 days after
treatment. Images were captured using an Olympus stereomicroscope
(SZ x12) and Spot Basic software (Diagnostic Instruments, Inc.).
The relative vascular density was determined by measuring the area
taken up by blood vessels in treated chorioallantoic membranes,
normalized to that in chorioallantoic membranes treated with PBS
(equal to 100%) (Jiang et al., 2000). This analysis was performed
on a Macintosh computer using the public domain NIH Image program.
The numbers of blood vessel branch points were quantified by two
researchers and compared with the numbers in the treatment controls
(Brooks et al., 1999).
[0245] As shown in FIGS. 49A and 50A, vascularized area was about
35% higher in the chorioallantoic membranes treated with bFGF than
in those treated with PBS, and the difference was significant
(P<0.001; t-test, double-sided). This observation was consistent
with the finding of more than a 60% increase in the number of newly
sprouted vessels in the bFGF-treated chorioallantoic membranes
compared to the PBS-treated chorioallantoic membranes (P<0.001;
t-test, double-sided; FIG. 50B). Incubation of chorioallantoic
membranes with bFGF without or with 10 nM rGel resulted in
angiogenic activity and formation of an ordered neovasculature
(FIGS. 49A and 49B). In contrast, treatment with 1 or 10 nM
VEGF.sub.121/rGel resulted in considerable destruction of the
neovasculature (FIG. 49C). Treatment with VEGF.sub.121/rGel also
completely inhibited bFGF-stimulated angiogenesis (P<0.001;
t-test, double sided; FIG. 50). Many of the treated chorioallantoic
membranes also appeared to be devoid of vessel infiltration.
Interestingly, the number of branching points in the
VEGF.sub.121/rGel-treated chorioallantoic membranes was similar to
that in the PBS-treated chorioallantoic membranes (P>0.5;
t-test, double-sided; FIG. 50B), suggesting that VEGF.sub.121/rGel
mainly inhibits bFGF-mediated formation of newly sprouting branches
from preexisiting vessels. As expected, the disks treated with bFGF
in combination with rGel (at 1 or 10 nM) consistently showed
extensive vascularization that was comparable to that found in
those treated with bFGF alone (P>0.5; t-test, double-sided).
This critical finding suggests that VEGF.sub.121/rGel does not
affect mature vessels in either normal tissues or tumors.
Therefore, small, newly vascularizing tumors and metastases may the
lesions most responsive to therapy with this agent.
[0246] The following references were cited herein: [0247]
Binetruy-Tournaire et al., EMBO 19:1525-33 (2000). [0248] Brekken,
et al., Cancer Res. 58:1952-1959 (1998). [0249] Brooks et al.,
Methods Mol. Biol. 129:257-269 (1999). [0250] Honkoop et al., Br.
J. Cancer 77:621-26 (1998). [0251] Jiang et al., Proc. Natl. Acad.
Sci. U.S.A. 97:1749-1753 (2000). [0252] Leenders et al., Lab.
Invest. 82:473-81 (2002). [0253] Lu et al., J. Biol. Chem.
278:43496-507 (2003). [0254] Murata et al., Int. J. Radiat. Oncol.
Biol. Phys. 51:1018-24 (2001). [0255] Pedley et al., Int. J.
Radiat. Oncol. Biol. Phys. 54:1524-31 (2002). [0256] Siemann et
al., Int. J. Cancer 99:1-6 (2002). [0257] Vartanian and Weidner,
Am. J. Pathol. 144:1188-94 (1994). [0258] Veenendaal et al., Proc
Natl Acad Sci U.S.A. 99:7866-71 (2002). [0259] Wu et al., Zhonghua
Zhong Liu Za Zhi 24:540-543 (2002).
[0260] Any patents or publications mentioned in this specification
are indicative of the levels of those skilled in the art to which
the invention pertains. Further, these patents and publications are
incorporated by reference herein to the same extent as if each
individual publication was specifically and individually indicated
to be incorporated by reference.
Sequence CWU 1
1
35133DNAArtificial SequenceSynthetic primer 1tggtcccagg ctcatatggc
acccatggca gaa 33238DNAArtificial SequenceSynthetic primer
2tctagaccgg agccaccgcc accccgcctc ggcttgtc 38333DNAArtificial
SequenceSynthetic primer 3ggtggcggtg gctccggtct agacaccgtg agc
33445DNAArtificial SequenceSynthetic primer 4aaggctcgtg tcgacctcga
gtcattaagc tttaggatct ttatc 45536DNAArtificial SequenceSynthetic
primer 5ggtggcggtg gctccatgga accaatcctg cttctg 36639DNAArtificial
SequenceSynthetic primer 6gccaccgcct ccctcgagct attagtagcg
tttcatggt 39715PRTArtificial SequenceSynthetic peptide 7Ala Ser Pro
Ala Ser Pro Ala Ser Pro Ala Ser Pro Leu Tyr Ser1 5 10
15839DNAArtificial SequenceSynthetic primer 8ggtaccgacg acgacgacaa
gatcatcggg ggacatgag 39930DNAArtificial SequenceSynthetic primer
9ggagccaccg ccaccgtagc gtttcatggt 301030DNAArtificial
SequenceSynthetic primer 10ggtggcggtg gctccgcacc catggcagaa
301142DNAArtificial SequenceSynthetic primer 11aaggctcgtg
tcgacctcga gtcattaccg cctcggcttg tc 421218DNAArtificial
SequenceSynthetic primer 12taatacgact cactatag 181330DNAArtificial
SequenceSynthetic primer 13cttgtcgtcg tcgtcggtac ccagatctgg
3014744DNAArtificial SequenceSynthetic primer 14atgcaaccaa
tcctgcttct gctggccttc ctcctgctgc ccagggcaga tgcaggggag 60atcatcgggg
gacatgaggc caagccccac tcccgcccct acatggctta tcttatgatc
120tgggatcaga agtctctgaa gaggtgcggt ggcttcctga tacaagacga
cttcgtgctg 180acagctgctc actgttgggg aagctccata aatgtcacct
tgggggccca caatatcaaa 240gaacaggagc cgacccagca gtttatccct
gtgaaaagac ccatccccca tccagcctat 300aatcctaaga acttctccaa
cgacatcatg ctactgcagc tggagagaaa ggccaagcgg 360accagagctg
tgcagcccct caggctacct agcaacaagg cccaggtgaa gccagggcag
420acatgcagtg tggccggctg ggggcagacg gcccccctgg gaaaacactc
acacacacta 480caagaggtga agatgacagt gcaggaagat cgaaagtgcg
aatctgactt acgccattat 540tacgacagta ccattgagtt gtgcgtgggg
gacccagaga ttaaaaagac ttcctttaag 600ggggactctg gaggccctct
tgtgtgtaac aaggtggccc agggcattgt ctcctatgga 660cgaaacaatg
gcatgcctcc acgagcctgc accaaagtct caagctttgt acactggata
720aagaaaacca tgaaacgcta ctaa 74415247PRTArtificial
SequenceSynthetic primer 15Met Gln Pro Ile Leu Leu Leu Leu Ala Phe
Leu Leu Leu Pro Arg Ala1 5 10 15Gly Ala Gly Glu Ile Ile Gly Gly His
Glu Ala Lys Pro His Ser Arg 20 25 30Pro Tyr Met Ala Tyr Leu Met Ile
Trp Asp Gln Lys Ser Leu Lys Arg 35 40 45Cys Gly Gly Phe Leu Ile Gln
Asp Asp Phe Val Leu Thr Ala Ala His 50 55 60Cys Trp Gly Ser Ser Ile
Asn Val Thr Leu Gly Ala His Asn Ile Lys65 70 75 80Glu Gln Glu Pro
Thr Gln Gln Phe Ile Pro Val Lys Arg Pro Ile Pro 85 90 95His Pro Ala
Tyr Asn Pro Lys Asn Phe Ser Asn Asp Ile Met Leu Leu 100 105 110Gln
Leu Glu Arg Lys Ala Lys Arg Thr Arg Ala Val Gln Pro Leu Arg 115 120
125Leu Pro Ser Asn Lys Ala Gln Val Lys Pro Gly Gln Thr Cys Ser Val
130 135 140Ala Gly Trp Gly Gln Thr Ala Pro Leu Gly Lys His Ser His
Thr Leu145 150 155 160Gln Glu Val Lys Met Thr Val Gln Glu Asp Arg
Lys Cys Glu Ser Asp 165 170 175Leu Arg His Tyr Tyr Asp Ser Thr Ile
Glu Leu Cys Val Gly Asp Pro 180 185 190Glu Ile Lys Lys Thr Ser Phe
Lys Gly Asp Ser Gly Gly Pro Leu Val 195 200 205Cys Asn Lys Val Ala
Gln Gly Ile Val Ser Tyr Gly Arg Asn Asn Gly 210 215 220Met Pro Pro
Arg Ala Cys Thr Lys Val Ser Ser Phe Val His Trp Ile225 230 235
240Lys Lys Thr Met Lys Arg Tyr 2451619DNAArtificial
SequenceSynthetic primer 16ggtttggtga ggtgtgctc 191719DNAArtificial
SequenceSynthetic primer 17tgatctttcc cggaactgc 191820DNAArtificial
SequenceSynthetic primer 18tctgtgcctg ctgctcatag
201920DNAArtificial SequenceSynthetic primer 19tggaatcctg
aacccacttc 202020DNAArtificial SequenceSynthetic primer
20atgcaccgat acacactgga 202120DNAArtificial SequenceSynthetic
primer 21cgccttcctc agtaccaagt 202220DNAArtificial
SequenceSynthetic primer 22aacctgcagc agactccact
202320DNAArtificial SequenceSynthetic primer 23gacacgtgtg
gccattgtag 202420DNAArtificial SequenceSynthetic primer
24gccaacgtgt aaagctgtga 202520DNAArtificial SequenceSynthetic
primer 25tcctcacagc tgaaggcaca 202618DNAArtificial
SequenceSynthetic primer 26gtcttcacca ccatggag 182718DNAArtificial
SequenceSynthetic primer 27ccaccctgtt gctgtagc 1828121PRTArtificial
SequenceSynthetic peptide 28Ala Pro Met Ala Glu Gly Gly Gly Gln Asn
His His Glu Val Val Lys1 5 10 15Phe Met Asp Val Tyr Gln Arg Ser Tyr
Cys His Pro Ile Glu Thr Leu 20 25 30Val Asp Ile Phe Gln Glu Tyr Pro
Asp Glu Ile Glu Tyr Ile Phe Lys 35 40 45Pro Ser Cys Val Pro Leu Met
Arg Cys Gly Gly Cys Cys Asn Asp Glu 50 55 60Gly Leu Glu Cys Val Pro
Thr Glu Glu Ser Asn Ile Thr Met Gln Ile65 70 75 80Met Arg Ile Lys
Pro His Gln Gly Gln His Ile Gly Glu Met Ser Phe 85 90 95Leu Gln His
Asn Lys Cys Glu Cys Arg Pro Lys Lys Asp Arg Ala Arg 100 105 110Gln
Glu Asn Cys Asp Lys Pro Arg Arg 115 12029206PRTArtificial
SequenceSynthetic peptide 29Ala Pro Met Ala Glu Gly Gly Gly Gln Asn
His His Glu Val Val Lys1 5 10 15Phe Met Asp Val Tyr Gln Arg Ser Tyr
Cys His Pro Ile Glu Thr Leu 20 25 30Val Asp Ile Phe Gln Glu Tyr Pro
Asp Glu Ile Glu Tyr Ile Phe Lys 35 40 45Pro Ser Cys Val Pro Leu Met
Arg Cys Gly Gly Cys Cys Asn Asp Glu 50 55 60Gly Leu Glu Cys Val Pro
Thr Glu Glu Ser Asn Ile Thr Met Gln Ile65 70 75 80Met Arg Ile Lys
Pro His Gln Gly Gln His Ile Gly Glu Met Ser Phe 85 90 95Leu Gln His
Asn Lys Cys Glu Cys Arg Pro Lys Lys Asp Arg Ala Arg 100 105 110Gln
Glu Lys Lys Ser Val Arg Gly Lys Gly Lys Gly Gln Lys Arg Lys 115 120
125Arg Lys Lys Ser Arg Tyr Lys Ser Trp Ser Val Tyr Val Gly Ala Arg
130 135 140Cys Cys Leu Met Pro Trp Ser Leu Pro Gly Pro His Pro Cys
Gly Pro145 150 155 160Cys Ser Glu Arg Arg Lys His Leu Phe Val Gln
Asp Pro Gln Thr Cys 165 170 175Lys Cys Ser Cys Lys Asn Thr Asp Ser
Arg Cys Lys Ala Arg Gln Leu 180 185 190Glu Leu Asn Glu Arg Thr Cys
Arg Cys Asp Lys Pro Arg Arg 195 200 20530189PRTArtificial
SequenceSynthetic peptide 30Ala Pro Met Ala Glu Gly Gly Gly Gln Asn
His His Glu Val Val Lys1 5 10 15Phe Met Asp Val Tyr Gln Arg Ser Tyr
Cys His Pro Ile Glu Thr Leu 20 25 30Val Asp Ile Phe Gln Glu Tyr Pro
Asp Glu Ile Glu Tyr Ile Phe Lys 35 40 45Pro Ser Cys Val Pro Leu Met
Arg Cys Gly Gly Cys Cys Asn Asp Glu 50 55 60Gly Leu Glu Cys Val Pro
Thr Glu Glu Ser Asn Ile Thr Met Gln Ile65 70 75 80Met Arg Ile Lys
Pro His Gln Gly Gln His Ile Gly Glu Met Ser Phe 85 90 95Leu Gln His
Asn Lys Cys Glu Cys Arg Pro Lys Lys Asp Arg Ala Arg 100 105 110Gln
Glu Lys Lys Ser Val Arg Gly Lys Gly Lys Gly Gln Lys Arg Lys 115 120
125Arg Lys Lys Ser Arg Tyr Lys Ser Trp Ser Val Pro Cys Gly Pro Cys
130 135 140Ser Glu Arg Arg Lys His Leu Phe Val Gln Asp Pro Gln Thr
Cys Lys145 150 155 160Cys Ser Cys Lys Asn Thr Asp Ser Arg Cys Lys
Ala Arg Gln Leu Glu 165 170 175Leu Asn Glu Arg Thr Cys Arg Cys Asp
Lys Pro Arg Arg 180 18531183PRTArtificial SequenceSynthetic peptide
31Ala Pro Met Ala Glu Gly Gly Gly Gln Asn His His Glu Val Val Lys1
5 10 15Phe Met Asp Val Tyr Gln Arg Ser Tyr Cys His Pro Ile Glu Thr
Leu 20 25 30Val Asp Ile Phe Gln Glu Tyr Pro Asp Glu Ile Glu Tyr Ile
Phe Lys 35 40 45Pro Ser Cys Val Pro Leu Met Arg Cys Gly Gly Cys Cys
Asn Asp Glu 50 55 60Gly Leu Glu Cys Val Pro Thr Glu Glu Ser Asn Ile
Thr Met Gln Ile65 70 75 80Met Arg Ile Lys Pro His Gln Gly Gln His
Ile Gly Glu Met Ser Phe 85 90 95Leu Gln His Asn Lys Cys Glu Cys Arg
Pro Lys Lys Asp Arg Ala Arg 100 105 110Gln Glu Lys Lys Ser Val Arg
Gly Lys Gly Lys Gly Gln Lys Arg Lys 115 120 125Arg Lys Lys Ser Arg
Pro Cys Gly Pro Cys Ser Glu Arg Arg Lys His 130 135 140Leu Phe Val
Gln Asp Pro Gln Thr Cys Lys Cys Ser Cys Lys Asn Thr145 150 155
160Asp Ser Arg Cys Lys Ala Arg Gln Leu Glu Leu Asn Glu Arg Thr Cys
165 170 175Arg Cys Asp Lys Pro Arg Arg 18032165PRTArtificial
SequenceSynthetic peptide 32Ala Pro Met Ala Glu Gly Gly Gly Gln Asn
His His Glu Val Val Lys1 5 10 15Phe Met Asp Val Tyr Gln Arg Ser Tyr
Cys His Pro Ile Glu Thr Leu 20 25 30Val Asp Ile Phe Gln Glu Tyr Pro
Asp Glu Ile Glu Tyr Ile Phe Lys 35 40 45Pro Ser Cys Val Pro Leu Met
Arg Cys Gly Gly Cys Cys Asn Asp Glu 50 55 60Gly Leu Glu Cys Val Pro
Thr Glu Glu Ser Asn Ile Thr Met Gln Ile65 70 75 80Met Arg Ile Lys
Pro His Gln Gly Gln His Ile Gly Glu Met Ser Phe 85 90 95Leu Gln His
Asn Lys Cys Glu Cys Arg Pro Lys Lys Asp Arg Ala Arg 100 105 110Gln
Glu Asn Pro Cys Gly Pro Cys Ser Glu Arg Arg Lys His Leu Phe 115 120
125Val Gln Asp Pro Gln Thr Cys Lys Cys Ser Cys Lys Asn Thr Asp Ser
130 135 140Arg Cys Lys Ala Arg Gln Leu Glu Leu Asn Glu Arg Thr Cys
Arg Cys145 150 155 160Asp Lys Pro Arg Arg 16533148PRTArtificial
SequenceSynthetic peptide 33Ala Pro Met Ala Glu Gly Gly Gly Gln Asn
His His Glu Val Val Lys1 5 10 15Phe Met Asp Val Tyr Gln Arg Ser Tyr
Cys His Pro Ile Glu Thr Leu 20 25 30Val Asp Ile Phe Gln Glu Tyr Pro
Asp Glu Ile Glu Tyr Ile Phe Lys 35 40 45Pro Ser Cys Val Pro Leu Met
Arg Cys Gly Gly Cys Cys Asn Asp Glu 50 55 60Gly Leu Glu Cys Val Pro
Thr Glu Glu Ser Asn Ile Thr Met Gln Ile65 70 75 80Met Arg Ile Lys
Pro His Gln Gly Gln His Ile Gly Glu Met Ser Phe 85 90 95Leu Gln His
Asn Lys Cys Glu Cys Arg Pro Lys Lys Asp Arg Ala Arg 100 105 110Gln
Glu Asn Pro Cys Gly Pro Cys Ser Glu Arg Arg Lys His Leu Phe 115 120
125Val Gln Asp Pro Gln Thr Cys Lys Cys Ser Cys Lys Asn Thr Asp Ser
130 135 140Arg Cys Lys Met14534145PRTArtificial SequenceSynthetic
peptide 34Ala Pro Met Ala Glu Gly Gly Gly Gln Asn His His Glu Val
Val Lys1 5 10 15Phe Met Asp Val Tyr Gln Arg Ser Tyr Cys His Pro Ile
Glu Thr Leu 20 25 30Val Asp Ile Phe Gln Glu Tyr Pro Asp Glu Ile Glu
Tyr Ile Phe Lys 35 40 45Pro Ser Cys Val Pro Leu Met Arg Cys Gly Gly
Cys Cys Asn Asp Glu 50 55 60Gly Leu Glu Cys Val Pro Thr Glu Glu Ser
Asn Ile Thr Met Gln Ile65 70 75 80Met Arg Ile Lys Pro His Gln Gly
Gln His Ile Gly Glu Met Ser Phe 85 90 95Leu Gln His Asn Lys Cys Glu
Cys Arg Pro Lys Lys Asp Arg Ala Arg 100 105 110Gln Glu Lys Lys Ser
Val Arg Gly Lys Gly Lys Gly Gln Lys Arg Lys 115 120 125Arg Lys Lys
Ser Arg Tyr Lys Ser Trp Ser Val Cys Asp Lys Pro Arg 130 135
140Arg1453526PRTArtificial SequenceSynthetic peptide 35Met Asn Phe
Leu Leu Ser Trp Val His Trp Ser Leu Ala Leu Leu Leu1 5 10 15Tyr Leu
His His Ala Lys Trp Ser Gln Ala 20 25
* * * * *