U.S. patent application number 12/595066 was filed with the patent office on 2010-03-11 for benzenesulfonyl compounds and the use thereof.
This patent application is currently assigned to Purdue Pharma L.P.. Invention is credited to Donald J. Kyle, Jiangchao Yao.
Application Number | 20100063030 12/595066 |
Document ID | / |
Family ID | 39592136 |
Filed Date | 2010-03-11 |
United States Patent
Application |
20100063030 |
Kind Code |
A1 |
Kyle; Donald J. ; et
al. |
March 11, 2010 |
Benzenesulfonyl Compounds and the Use Thereof
Abstract
The invention relates to pyrrolidinyl, piperidinyl, and
hexahydroazepinyl compounds of Formula I: and pharmaceutically
acceptable salts, prodrugs, or solvates thereof, wherein R.sup.1,
R.sup.2, Z and m are defined as set forth in the specification. The
invention is also directed to the use compounds of Formula I to
treat a disorder responsive to the blockade of calcium channels,
and particularly N-type calcium channels. Compounds of the present
invention are especially useful for treating pain. ##STR00001##
Inventors: |
Kyle; Donald J.; (Newtown,
PA) ; Yao; Jiangchao; (Monmouth Junction,
NJ) |
Correspondence
Address: |
STERNE, KESSLER, GOLDSTEIN & FOX P.L.L.C.
1100 NEW YORK AVENUE, N.W.
WASHINGTON
DC
20005
US
|
Assignee: |
Purdue Pharma L.P.
Stamford
CT
|
Family ID: |
39592136 |
Appl. No.: |
12/595066 |
Filed: |
April 8, 2008 |
PCT Filed: |
April 8, 2008 |
PCT NO: |
PCT/US08/04490 |
371 Date: |
October 8, 2009 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60907571 |
Apr 9, 2007 |
|
|
|
Current U.S.
Class: |
514/217.11 ;
436/501; 514/329; 514/424; 540/604; 546/224; 548/542 |
Current CPC
Class: |
A61P 25/22 20180101;
C07D 211/96 20130101; A61P 25/24 20180101; A61P 25/00 20180101;
C07D 207/48 20130101; A61P 9/12 20180101 |
Class at
Publication: |
514/217.11 ;
546/224; 548/542; 540/604; 514/329; 514/424; 436/501 |
International
Class: |
A61K 31/4468 20060101
A61K031/4468; C07D 211/56 20060101 C07D211/56; C07D 207/48 20060101
C07D207/48; C07D 223/04 20060101 C07D223/04; A61K 31/40 20060101
A61K031/40; A61K 31/55 20060101 A61K031/55; A61P 25/00 20060101
A61P025/00; A61P 9/12 20060101 A61P009/12; A61P 25/24 20060101
A61P025/24; A61P 25/22 20060101 A61P025/22; G01N 33/53 20060101
G01N033/53 |
Claims
1. A compound having the Formula I: ##STR00039## or a
pharmaceutically acceptable salt, prodrug or solvate thereof,
wherein: R.sup.1 is selected from the group consisting of hydrogen,
C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl,
halo(C.sub.1-C.sub.6)alkyl, C.sub.1-C.sub.6
alkoxy(C.sub.1-C.sub.6)alkyl,
halo(C.sub.1-C.sub.6)alkoxy(C.sub.1-C.sub.6)alkyl,
hydroxy(C.sub.1-C.sub.6)alkyl, amino(C.sub.1-C.sub.6)alkyl,
C.sub.1-C.sub.6 alkylamino(C.sub.1-C.sub.6)alkyl,
di(C.sub.1-C.sub.6)alkylamino(C.sub.1-C.sub.6)alkyl, cycloalkyl,
cycloalkenyl, and heterocyclo(C.sub.1-C.sub.6)alkyl, all of which
can be optionally substituted; R.sup.2 is selected from the group
consisting of C.sub.1-C.sub.6 alkyl, cycloalkyl, cycloalkenyl,
optionally substituted aryl, optionally substituted heteroaryl, and
di(C.sub.1-C.sub.6)alkylamino; Z is selected from the group
consisting of Z.sup.1, Z.sup.2, and Z.sup.3 wherein: Z.sup.1 is
##STR00040## Z.sup.2 is ##STR00041## and Z.sup.3 is ##STR00042## m
is 0, 1, or 2; n is 0, 1 or 2; p is 0 or 1; r is 0 or 1; provided
that n and p are not both 0; R.sup.3 and R.sup.4 are each
independently hydrogen, alkyl, or alkenyl; or R.sup.3 and R.sup.4
together form .dbd.O; or R.sup.3 and R.sup.4 together with the
carbon atom to which they are attached form a saturated C.sub.3-7
cycloalkyl ring optionally substituted with one substituent
selected from the group consisting of alkyl, hydroxy, hydroxyalkyl,
amino, and .dbd.O, wherein one or more carbon atoms of the
C.sub.3-7 cycloalkyl ring are optionally replaced with NR.sup.16,
O, S, or SO.sub.2, wherein R.sup.16 is hydrogen or C.sub.1-3 alkyl,
to form a heterocyclic ring; R.sup.5 is selected from the group
consisting of alkyl, optionally substituted aryl, optionally
substituted arylalkyl, and optionally substituted heteroaryl;
R.sup.6 is selected from the group consisting of hydrogen, alkyl,
alkenyl, optionally substituted cycloalkyl, optionally substituted
cycloalkenyl, optionally substituted aryl, optionally substituted
arylalkyl, and optionally substituted heteroaryl; or R.sup.5 and
R.sup.6 together with the nitrogen atom to which they are attached
form a heterocyclic ring to give Z.sup.11 having the structure:
##STR00043## where A is CH.sub.2, CHF, CF.sub.2 or CHOH; B is
CH.sub.2, O, or N--R.sup.51, where R.sup.51 is CH.sub.3 or
C(O)CH.sub.3; s is 0, 1, or 2; p is 0 or 1; R.sup.3 is as defined
above and R.sup.4 is hydrogen; R.sup.7 is selected from the group
consisting of alkyl, optionally substituted heterocyclo, optionally
substituted aryl, optionally substituted arylalkyl, optionally
substituted heteroaryl, optionally substituted heteroarylalkyl, and
--CH.sub.2--U--V, wherein U is CH.sub.2, CHF, CF.sub.2 or CHOH and
V is hydrogen, alkyl, or alkenyl; R.sup.8 is selected from the
group consisting of hydrogen, alkyl, alkenyl, optionally
substituted cycloalkyl, optionally substituted cycloalkenyl,
optionally substituted aryl, optionally substituted arylalkyl,
optionally substituted heteroaryl, and optionally substituted
heteroarylalkyl; (i) R.sup.9 and R.sup.10 are each independently
selected from the group consisting of hydrogen; alkyl; alkenyl;
hydroxyalkyl; alkoxyalkyl; cycloalkyl; cycloalkenyl, and phenyl
optionally substituted with one substituent selected from the group
consisting of alkyl, cycloalkyl, halogen, cyano, amino, alkylamino,
dialkylamino, hydroxy, nitro, hydroxyalkyl, haloalkyl, and alkoxy;
or R.sup.9 is hydrogen, alkyl, alkenyl, hydroxyalkyl, alkoxyalkyl,
cycloalkyl, cycloalkenyl, or phenyl optionally substituted with one
substituent selected from the group consisting of alkyl,
cycloalkyl, halogen, cyano, amino, alkylamino, dialkylamino,
hydroxy, nitro, hydroxyalkyl, haloalkyl, and alkoxy; and R.sub.10
is R.sup.17--C(O)--, where R.sup.17 is selected from the group
consisting of alkyl, alkoxy, optionally substituted benzyl, and
optionally substituted benzyloxy; or R.sup.9 and R.sup.10 together
with the nitrogen atom to which they are attached form a 5- or
6-membered heterocyclic ring wherein one or more carbon atoms of
the heterocyclic ring are optionally replaced with NR.sup.18, O, or
S, wherein R.sup.18 is hydrogen or C.sub.1-3 alkyl; R.sup.11 and
R.sup.12 are each independently selected from the group consisting
of hydrogen; alkyl; alkenyl; hydroxyalkyl; aminoalkyl; cycloalkyl;
cycloalkenyl; heterocyclo; heterocycloalkyl; phenyl optionally
substituted with one or two substituents independently selected
from the group consisting of alkyl, cycloalkyl, halogen, cyano,
amino, alkylamino, dialkylamino, hydroxy, nitro, hydroxyalkyl,
haloalkyl, and alkoxy; benzyl optionally substituted with one or
two substituents independently selected from the group consisting
of alkyl, cycloalkyl, halogen, cyano, amino, alkylamino,
dialkylamino, hydroxy, nitro, hydroxyalkyl, haloalkyl, and alkoxy;
benzyloxyalkyl; heteroaryl optionally substituted with one or two
substituents independently selected from the group consisting of
alkyl, cycloalkyl, halogen, cyano, amino, alkylamino, dialkylamino,
hydroxy, nitro, hydroxyalkyl, haloalkyl, and alkoxy; and
heteroarylalkyl optionally substituted with one or two substituents
independently selected from the group consisting of alkyl,
cycloalkyl, halogen, cyano, amino, alkylamino, dialkylamino,
hydroxy, nitro, hydroxyalkyl, haloalkyl, and alkoxy; or R.sup.11
and R.sup.12 together form .dbd.O; or R.sup.11 and R.sup.12
together with the carbon atom to which they are attached form a
saturated or unsaturated C.sub.3-7 cycloalkyl ring optionally
substituted with one or more substituents each independently
selected from the group consisting of alkyl, hydroxy, hydroxyalkyl,
amino, carboxy, alkoxycarbonyl, alkylamino, dialkylamino, phenyl,
and .dbd.O, wherein one or more carbon atoms of the C.sub.3-7
cycloalkyl ring are optionally replaced with NR.sup.19, O, S, or
SO.sub.2, wherein R.sup.19 is hydrogen or C.sub.1-3 alkyl, to form
a heterocyclic ring; or wherein two adjacent carbon atoms of the
C.sub.3-7 cycloalkyl ring can form a bridge --O-- to form a
bicyclic ring; or wherein two adjacent carbon atoms of the
C.sub.3-7 cycloalkyl ring together form a fused phenyl group
optionally substituted with alkyl, haloalkyl, amino, cyano, or
hydroxy; or R.sup.12 is hydrogen, alkyl, or alkenyl; R.sup.9 is as
defined above; and R.sup.10 and R.sup.11 together form a bridge
--CH.sub.2--CH.sub.2--CH.sub.2-- or
--CH.sub.2--CHG.sup.1-CHG.sup.2-CH.sub.2--, wherein G.sup.1 and
G.sup.2 are both hydrogen or together with the carbon atoms to
which they are attached form a fused phenyl group; or (ii) R.sup.9
is selected from the group consisting of alkyl, optionally
substituted aryl, optionally substituted arylalkyl, optionally
substituted heteroaryl, optionally substituted heteroarylalkyl, and
--CH.sub.2--U--V, wherein U is CH.sub.2, CHF, CF.sub.2 or CHOH and
V is hydrogen, alkyl, or alkenyl; and R.sup.10 is selected from the
group consisting of hydrogen, alkyl, alkenyl, optionally
substituted cycloalkyl, optionally substituted cycloalkenyl,
optionally substituted aryl, optionally substituted arylalkyl,
optionally substituted heteroaryl, and optionally substituted
heteroarylalkyl; or R.sup.9 and R.sup.10 together with the nitrogen
atom to which they are attached form a heterocyclic ring to give
Z.sup.31 having the structure: ##STR00044## where A is CH.sub.2,
CHF, CF.sub.2 or CHOH; B is CH.sub.2, O, or N--R.sup.51, where
R.sup.51 is CH.sub.3 or C(O)CH.sub.3; and s is 0, 1, or 2; r is 0
or 1; and R.sup.11 and R.sup.12 together form .dbd.O; or R.sup.11
and R.sup.12 are each independently selected from the group
consisting of hydrogen, alkyl, and alkenyl or together with the
carbon atom to which they are attached form a saturated or
unsaturated C.sub.3-7 cycloalkyl ring optionally substituted with
one or more substituents each independently selected from the group
consisting of alkyl, hydroxy, hydroxyalkyl, amino, carboxy,
alkoxycarbonyl, alkylamino, dialkylamino, phenyl, and .dbd.O,
wherein one or more carbon atoms of the C.sub.3-7 cycloalkyl ring
are optionally replaced with NR.sup.19, O, S, or SO.sub.2, wherein
R'.sup.9 is hydrogen or C.sub.1-3 alkyl, to form a heterocyclic
ring; or (iii) R.sup.11 and R.sup.12 are both hydrogen or together
form .dbd.O, R.sup.9 is selected from the group consisting of
alkyl, optionally substituted aryl, optionally substituted
arylalkyl, optionally substituted heteroaryl, optionally
substituted heteroarylalkyl, and --CH.sub.2--U--V, wherein U is
CH.sub.2, CHF, CF.sub.2 or CHOH and V is hydrogen, alkyl, or
alkenyl; and R.sup.10 and R.sup.1 together form a bridge -D-E-G-,
wherein D is CH.sub.2, C(O), CHCH.sub.3, C(CH.sub.3).sub.2 or
absent; E is CH.sub.2, C(O), C(S), CHF, CF.sub.2 or CHOH; and G is
CH.sub.2, C(O), CHCH.sub.3, C(CH.sub.3).sub.2 or absent; and Y is O
or S; with the following provisos: 1) R.sup.7 is not optionally
substituted 2-thiazolyl or optionally substituted benzothiazolyl;
2) when Z is Z.sup.2, R.sup.2 is not C.sub.1-6 alkyl, cycloalkyl or
unsubstituted phenyl; 3) when Z is Z.sup.2, R.sup.8 is hydrogen or
alkyl, and R.sup.7 is an optionally substituted phenyl or biphenyl,
then R.sup.1 is other than hydrogen or unsubstituted C.sub.1-6
alkyl; 4) when Z is Z.sup.3 and m is 2, then R.sup.2 is not phenyl
substituted with CN or R.sup.9 and R.sup.10 are not both hydrogen;
5) when Z is Z.sup.3 and R.sup.9 and R.sup.19 are both hydrogen,
then R.sup.1 is other than hydrogen; or 6) when Z is Z.sup.3, r is
0, and R.sup.11 and R.sup.12 are both hydrogen, then R.sup.1 is
other than unsubstituted C.sub.1-6 alkyl.
2. The compound of claim 1 or a pharmaceutically acceptable salt,
prodrug or solvate thereof, wherein: R.sup.1 is selected from the
group consisting of hydrogen, C.sub.1-C.sub.6 alkyl,
C.sub.2-C.sub.6 alkenyl, halo(C.sub.1-C.sub.6)alkyl,
C.sub.1-C.sub.6 alkoxy(C.sub.1-C.sub.6)alkyl,
halo(C.sub.1-C.sub.6)alkoxy(C.sub.1-C.sub.6)alkyl,
hydroxy(C.sub.1-C.sub.6)alkyl, amino(C.sub.1-C.sub.6)alkyl,
C.sub.1-C.sub.6 alkylamino(C.sub.1-C.sub.6)alkyl,
di(C.sub.1-C.sub.6)alkylamino(C.sub.1-C.sub.6)alkyl, cycloalkyl,
and heterocyclo(C.sub.1-C.sub.6)alkyl, all of which can be
optionally substituted; R.sup.2 is selected from the group
consisting of C.sub.1-C.sub.6 alkyl, cycloalkyl, optionally
substituted aryl, optionally substituted heteroaryl, and
di(C.sub.1-C.sub.6)alkylamino; Z is selected from the group
consisting of Z.sup.1, Z.sup.2, and Z.sup.3 wherein: Z.sup.1 is
##STR00045## Z.sup.2 is ##STR00046## and Z.sup.3 is ##STR00047## m
is 0, 1, or 2; n is 0, 1 or 2; p is 0 or 1; r is 0 or 1; provided
that n and p are not both 0; R.sup.3 and R.sup.4 are each
independently hydrogen, alkyl, or alkenyl; or R.sup.3 and R.sup.4
together form .dbd.O; or R.sup.3 and R.sup.4 together with the
carbon atom to which they are attached form a saturated C.sub.3-7
cycloalkyl ring optionally substituted with one substituent
selected from the group consisting of alkyl, hydroxy, hydroxyalkyl,
amino, and .dbd.O, wherein one or more carbon atoms of the
C.sub.3-7 cycloalkyl ring are optionally replaced with NR.sup.16,
O, S, or SO.sub.2, wherein R.sup.16 is hydrogen or C.sub.1-3 alkyl,
to form a heterocyclic ring; R.sup.5 is selected from the group
consisting of alkyl, optionally substituted aryl, optionally
substituted arylalkyl, and optionally substituted heteroaryl;
R.sup.6 is selected from the group consisting of hydrogen, alkyl,
alkenyl, optionally substituted cycloalkyl, optionally substituted
aryl, optionally substituted arylalkyl, and optionally substituted
heteroaryl; or R.sup.5 and R.sup.6 together with the nitrogen atom
to which they are attached form a heterocyclic ring to give
Z.sup.11 having the structure: ##STR00048## where A is CH.sub.2,
CHF, CF.sub.2 or CHOH; B is CH.sub.2, O, or N--R.sup.51, where
R.sup.51 is CH.sub.3 or C(O)CH.sub.3; s is 0, 1, or 2; p is 0 or 1;
R.sup.3 is as defined above and R.sup.4 is hydrogen; R.sup.7 is
selected from the group consisting of alkyl, optionally substituted
heterocyclo, optionally substituted aryl, optionally substituted
arylalkyl, optionally substituted heteroaryl, optionally
substituted heteroarylalkyl, and --CH.sub.2--U--V, wherein U is
CH.sub.2, CHF, CF.sub.2 or CHOH and V is hydrogen, alkyl, or
alkenyl; R.sup.8 is selected from the group consisting of hydrogen,
alkyl, alkenyl, optionally substituted cycloalkyl, optionally
substituted aryl, optionally substituted arylalkyl, optionally
substituted heteroaryl, and optionally substituted heteroarylalkyl;
(i) R.sup.9 and R.sup.10 are each independently selected from the
group consisting of hydrogen; alkyl; alkenyl; hydroxyalkyl;
alkoxyalkyl; cycloalkyl, and phenyl optionally substituted with one
substituent selected from the group consisting of alkyl,
cycloalkyl, halogen, cyano, amino, alkylamino, dialkylamino,
hydroxy, nitro, hydroxyalkyl, haloalkyl, and alkoxy; or R.sup.9 is
hydrogen, alkyl, alkenyl, hydroxyalkyl, alkoxyalkyl, cycloalkyl, or
phenyl optionally substituted with one substituent selected from
the group consisting of alkyl, cycloalkyl, halogen, cyano, amino,
alkylamino, dialkylamino, hydroxy, nitro, hydroxyalkyl, haloalkyl,
and alkoxy; and R.sup.10 is R.sup.17--C(O)--, where R.sup.17 is
selected from the group consisting of alkyl, alkoxy, optionally
substituted benzyl, and optionally substituted benzyloxy; or
R.sup.9 and R.sup.10 together with the nitrogen atom to which they
are attached form a 5- or 6-membered heterocyclic ring wherein one
or more carbon atoms of the heterocyclic ring are optionally
replaced with NR.sup.18, O, or S, wherein R.sup.18 is hydrogen or
C.sub.1-3 alkyl; R.sup.11 and R.sup.12 are each independently
selected from the group consisting of hydrogen; alkyl; alkenyl;
hydroxyalkyl; aminoalkyl; cycloalkyl; heterocyclo;
heterocycloalkyl; phenyl optionally substituted with one or two
substituents independently selected from the group consisting of
alkyl, cycloalkyl, halogen, cyano, amino, alkylamino, dialkylamino,
hydroxy, nitro, hydroxyalkyl, haloalkyl, and alkoxy; benzyl
optionally substituted with one or two substituents independently
selected from the group consisting of alkyl, cycloalkyl, halogen,
cyano, amino, alkylamino, dialkylamino, hydroxy, nitro,
hydroxyalkyl, haloalkyl, and alkoxy; benzyloxyalkyl; heteroaryl
optionally substituted with one or two substituents independently
selected from the group consisting of alkyl, cycloalkyl, halogen,
cyano, amino, alkylamino, dialkylamino, hydroxy, nitro,
hydroxyalkyl, haloalkyl, and alkoxy; and heteroarylalkyl optionally
substituted with one or two substituents independently selected
from the group consisting of alkyl, cycloalkyl, halogen, cyano,
amino, alkylamino, dialkylamino, hydroxy, nitro, hydroxyalkyl,
haloalkyl, and alkoxy; or R.sup.11 and R.sup.12 together form
.dbd.O; or R.sup.11 and R.sup.12 together with the carbon atom to
which they are attached form a saturated or unsaturated C.sub.3-7
cycloalkyl ring optionally substituted with one or more
substituents each independently selected from the group consisting
of alkyl, hydroxy, hydroxyalkyl, amino, carboxy, alkoxycarbonyl,
alkylamino, dialkylamino, phenyl, and .dbd.O, wherein one or more
carbon atoms of the C.sub.3-7 cycloalkyl ring are optionally
replaced with NR.sup.19, O, S, or SO.sub.2, wherein R.sup.19 is
hydrogen or C.sub.1-3 alkyl, to form a heterocyclic ring; or
wherein two adjacent carbon atoms of the C.sub.3-7 cycloalkyl ring
can form a bridge --O-- to form a bicyclic ring; or wherein two
adjacent carbon atoms of the C.sub.3-7 cycloalkyl ring together
form a fused phenyl group optionally substituted with alkyl,
haloalkyl, amino, cyano, or hydroxy; or R.sup.12 is hydrogen,
alkyl, or alkenyl; R.sup.9 is as defined above; and R.sup.10 and
R.sup.11 together form a bridge --CH.sub.2--CH.sub.2--CH.sub.2-- or
--CH.sub.2--CHG.sup.1-CHG.sup.2-CH.sub.2--, wherein G.sup.1 and
G.sup.2 are both hydrogen or together with the carbon atoms to
which they are attached form a fused phenyl group; or (ii) R.sup.9
is selected from the group consisting of alkyl, optionally
substituted aryl, optionally substituted arylalkyl, optionally
substituted heteroaryl, optionally substituted heteroarylalkyl, and
--CH.sub.2--U--V, wherein U is CH.sub.2, CHF, CF.sub.2 or CHOH and
V is hydrogen, alkyl, or alkenyl; and R.sup.10 is selected from the
group consisting of hydrogen, alkyl, alkenyl, optionally
substituted cycloalkyl, optionally substituted aryl, optionally
substituted arylalkyl, optionally substituted heteroaryl, and
optionally substituted heteroarylalkyl; or R.sup.9 and R.sup.10
together with the nitrogen atom to which they are attached form a
heterocyclic ring to give Z.sup.31 having the structure:
##STR00049## where A is CH.sub.2, CHF, CF.sub.2 or CHOH; B is
CH.sub.2, O, or N--R.sup.51, where R.sup.51 is CH.sub.3 or
C(O)CH.sub.3; and s is 0, 1, or 2; r is 0 or 1; and R.sup.11 and
R.sup.12 together form .dbd.O; or R.sup.11 and R.sup.12 are each
independently selected from the group consisting of hydrogen,
alkyl, and alkenyl or together with the carbon atom to which they
are attached form a saturated or unsaturated C.sub.3-7 cycloalkyl
ring optionally substituted with one or more substituents each
independently selected from the group consisting of alkyl, hydroxy,
hydroxyalkyl, amino, carboxy, alkoxycarbonyl, alkylamino,
dialkylamino, phenyl, and .dbd.O, wherein one or more carbon atoms
of the C.sub.3-7 cycloalkyl ring are optionally replaced with
NR.sup.19, O, S, or SO.sub.2, wherein R'.sup.9 is hydrogen or
C.sub.1-3 alkyl, to form a heterocyclic ring; or (iii) R.sup.11 and
R.sup.12 are both hydrogen or together form .dbd.O, R.sup.9 is
selected from the group consisting of alkyl, optionally substituted
aryl, optionally substituted arylalkyl, optionally substituted
heteroaryl, optionally substituted heteroarylalkyl, and
--CH.sub.2--U--V, wherein U is CH.sub.2, CHF, CF.sub.2 or CHOH and
V is hydrogen, alkyl, or alkenyl; and R.sup.10 and R.sup.1 together
form a bridge -D-E-G-, wherein D is CH.sub.2, C(O), CHCH.sub.3,
C(CH.sub.3).sub.2 or absent; E is CH.sub.2, C(O), C(S), CHF,
CF.sub.2 or CHOH; and G is CH.sub.2, C(O), CHCH.sub.3,
C(CH.sub.3).sub.2 or absent; and Y is O or S; with the following
provisos: 1) R.sup.7 is not optionally substituted 2-thiazolyl or
optionally substituted benzothiazolyl; 2) when Z is Z.sup.2,
R.sup.2 is not C.sub.1-6 alkyl, cycloalkyl or unsubstituted phenyl;
3) when Z is Z.sup.2, R.sup.8 is hydrogen or alkyl, and R.sup.7 is
an optionally substituted phenyl or biphenyl, then R.sup.1 is other
than hydrogen or unsubstituted C.sub.1-6 alkyl; 4) when Z is
Z.sup.3 and m is 2, then R.sup.2 is not phenyl substituted with CN
or R.sup.9 and R.sup.10 are not both hydrogen; 5) when Z is Z.sup.3
and R.sup.9 and R.sup.10 are both hydrogen, then R.sup.1 is other
than hydrogen; or 6) when Z is Z.sup.3, r is 0, and R.sup.11 and
R.sup.12 are both hydrogen, then R.sup.1 is other than
unsubstituted C.sub.1-6 alkyl.
3. The compound of claim 1, having the Formula II: ##STR00050## or
a pharmaceutically acceptable salt, prodrug or solvate thereof.
4. The compound of claim 1, having the Formula III: ##STR00051## or
a pharmaceutically acceptable salt, prodrug or solvate thereof.
5. The compound of claim 1, having the Formula IV: ##STR00052## or
a pharmaceutically acceptable salt, prodrug or solvate thereof.
6. The compound of claim 1, wherein Z is Z.sup.1.
7. The compound of claim 6, wherein Z.sup.1 is Z.sup.11 having the
structure: ##STR00053##
8. The compound of claim 6, wherein Z.sup.1 is Z.sup.12 having the
structure: ##STR00054##
9. The compound of claim 6, wherein Z.sup.1 is Z.sup.13 having the
structure: ##STR00055## where K is selected from the group
consisting of CH.sub.2, O, S, SO.sub.2, and NR.sup.16, R.sup.16 is
hydrogen or C.sub.1-3 alkyl, and v is 0, 1, or 2.
10. The compound of claim 6, wherein Z.sup.1 is selected from the
group consisting of Z.sup.14, Z.sup.15 and Z.sup.16, wherein:
Z.sup.14 is ##STR00056## Z.sup.15 is ##STR00057## and Z.sup.16 is
##STR00058##
11. The compound of claim 10, wherein R.sup.6 is hydrogen and n is
0 or 1.
12. The compound of claim 11, wherein R.sup.5 is optionally
substituted C.sub.6-10 aryl or optionally substituted heteroaryl
having 5-10 ring atoms.
13. The compound of claim 12, wherein R.sup.5 is selected from the
group consisting of phenyl, naphthyl, indenyl, isoindenyl, pyridyl,
pyrimidinyl, pyrazinyl, pyridazinyl, triazinyl, pyrrolyl,
pyrazolyl, benzothiazolyl, thiazolyl, imidazolyl, benzoimidazolyl,
benzoxazolyl, indolyl, indazolyl, and benzotriazolyl, all of which
can be optionally substituted.
14. The compound of claim 6, wherein Z.sup.1 is selected from the
group consisting of Z.sup.17 and Z.sup.18, wherein: Z.sup.17 is
##STR00059## Z.sup.18 is ##STR00060## and wherein R.sup.13,
R.sup.14 and R.sup.15 are each independently selected from the
group consisting of hydrogen, alkyl, alkoxy, halogen, haloalkyl,
hydroxy, hydroxyalkyl, cyano, amino, aminoalkyl, alkylamino,
dialkylamino, hydroxyalkylamino, --C(O)OR.sup.20, and
--C(O).sub.NR.sup.20R.sup.21, wherein R.sup.20 and R.sup.21 are
each independently selected from the group consisting of hydrogen,
alkyl, alkenyl, optionally substituted heterocyclo, optionally
substituted cycloalkyl, optionally substituted aryl, optionally
substituted arylalkyl, optionally substituted heteroaryl,
optionally substituted heteroarylalkyl, and --CH.sub.2--U--V,
wherein U is CH.sub.2, CHF, CF.sub.2 or CHOH and V is hydrogen,
alkyl, alkenyl or aryl.
15. The compound of claim 1, wherein Z is Z.sup.2.
16. The compound of claim 15, wherein Z.sup.2 is Z.sup.21 having
the structure: ##STR00061## wherein Y is O or S and R.sup.7 is
selected from the group consisting of aryl and heteroaryl, either
of which can be optionally substituted.
17. The compound of claim 16, wherein R.sup.7 is optionally
substituted C.sub.6-10 aryl or optionally substituted heteroaryl
having 5-10 ring atoms.
18. The compound of claim 17, wherein R.sup.7 is selected from the
group consisting of phenyl, naphthyl, indenyl, isoindenyl, pyridyl,
pyrimidinyl, pyrazinyl, pyridazinyl, triazinyl, pyrrolyl,
pyrazolyl, thiazolyl, imidazolyl, benzoimidazolyl, benzoxazolyl,
indolyl, indazolyl, and benzotriazolyl all of which can be
optionally substituted.
19. The compound of claim 18, wherein R.sup.7 is unsubstituted
phenyl or phenyl substituted with one, two, or three substituents
each independently selected from the group consisting of alkyl,
alkoxy, halogen, haloalkyl, hydroxy, hydroxyalkyl, cyano, amino,
aminoalkyl, alkylamino, dialkylamino, and hydroxyalkylamino.
20. The compound of claim 1, wherein Z is Z.sup.3.
21. The compound of claim 20, wherein R.sup.9 and R.sup.10 are each
independently selected from the group consisting of hydrogen;
alkyl; alkenyl; hydroxyalkyl; alkoxyalkyl; cycloalkyl, and phenyl
optionally substituted with one substituent selected from the group
consisting of alkyl, cycloalkyl, halogen, cyano, amino, alkylamino,
dialkylamino, hydroxy, nitro, hydroxyalkyl, haloalkyl, and
alkoxy.
22. The compound of claim 20, wherein R.sup.9 is hydrogen, alkyl,
alkenyl, hydroxyalkyl, alkoxyalkyl, cycloalkyl, or phenyl
optionally substituted with one substituent selected from the group
consisting of alkyl, cycloalkyl, halogen, cyano, amino, alkylamino,
dialkylamino, hydroxy, nitro, hydroxyalkyl, haloalkyl, and alkoxy;
and R.sup.10 is R.sup.17--C(O)--, where R.sup.17 is selected from
the group consisting of alkyl, alkoxy, optionally substituted
benzyl, and optionally substituted benzyloxy.
23. The compound of claim 20, wherein R.sup.9 and R.sup.10 together
with the nitrogen atom to which they are attached form a 5- or
6-membered heterocyclic ring wherein one or more carbon atoms of
the heterocyclic ring are optionally replaced with NR.sup.18, O, or
S, wherein R.sup.18 is hydrogen or C.sub.1-3 alkyl.
24. The compound of claim 20, wherein R.sup.11 and R.sup.12 are
each independently selected from the group consisting of hydrogen;
alkyl; alkenyl; hydroxyalkyl; aminoalkyl; cycloalkyl; heterocyclo;
heterocycloalkyl; phenyl optionally substituted with one or two
substituents independently selected from the group consisting of
alkyl, cycloalkyl, halogen, cyano, amino, alkylamino, dialkylamino,
hydroxy, nitro, hydroxyalkyl, haloalkyl, and alkoxy; benzyl
optionally substituted with one or two substituents independently
selected from the group consisting of alkyl, cycloalkyl, halogen,
cyano, amino, alkylamino, dialkylamino, hydroxy, nitro,
hydroxyalkyl, haloalkyl, and alkoxy; benzyloxyalkyl; heteroaryl
optionally substituted with one or two substituents independently
selected from the group consisting of alkyl, cycloalkyl, halogen,
cyano, amino, alkylamino, dialkylamino, hydroxy, nitro,
hydroxyalkyl, haloalkyl, and alkoxy; and heteroarylalkyl optionally
substituted with one or two substituents independently selected
from the group consisting of alkyl, cycloalkyl, halogen, cyano,
amino, alkylamino, dialkylamino, hydroxy, nitro, hydroxyalkyl,
haloalkyl, and alkoxy.
25. The compound of claim 20, wherein R.sup.11 and R.sup.12
together with the carbon atom to which they are attached form a
saturated or unsaturated C.sub.3-7 cycloalkyl ring optionally
substituted with one or more substituents each independently
selected from the group consisting of alkyl, hydroxy, hydroxyalkyl,
amino, carboxy, alkoxycarbonyl, alkylamino, dialkylamino, phenyl,
and .dbd.O, wherein one or more carbon atoms of the C.sub.3-7
cycloalkyl ring are optionally replaced with NR.sup.19, O, S, or
SO.sub.2, wherein R.sup.19 is hydrogen or C.sub.1-3 alkyl, to form
a heterocyclic ring; or wherein two adjacent carbon atoms of the
C.sub.3-7 cycloalkyl ring can form a bridge --O-- to form a
bicyclic ring; or wherein two adjacent carbon atoms of the
C.sub.3-7 cycloalkyl ring together form a fused phenyl group
optionally substituted with alkyl, haloalkyl, amino, cyano, or
hydroxy.
26. The compound of claim 20, wherein R.sup.11 and R.sup.12
together form .dbd.O.
27. The compound of claim 20, wherein R.sup.12 is hydrogen, alkyl,
or alkenyl; R.sup.9 is hydrogen, alkyl, alkenyl, hydroxyalkyl,
alkoxyalkyl, cycloalkyl, or phenyl optionally substituted with one
substituent selected from the group consisting of alkyl,
cycloalkyl, halogen, cyano, amino, alkylamino, dialkylamino,
hydroxy, nitro, hydroxyalkyl, haloalkyl, and alkoxy; and R.sup.10
and R.sup.11 together form a bridge
--CH.sub.2--CH.sub.2--CH.sub.2-- or
--CH.sub.2--CHG.sup.1-CHG.sup.2-CH.sub.2--, wherein G.sup.1 and
G.sup.2 are both hydrogen or together with the carbon atoms to
which they are attached form a fused phenyl group.
28. The compound of claim 20, wherein R.sup.9 is hydrogen and
R.sup.10 is hydrogen, alkyl, hydroxyalkyl, or cycloalkyl.
29. The compound of claim 20, wherein R.sup.9 and R.sup.10 together
with the nitrogen atom to which they are attached form a
heterocyclic ring; R.sup.11 is hydrogen, and R.sup.12 is hydrogen,
alkyl, cycloalkyl, heterocycloalkyl, or benzyl optionally
substituted with one or two substituents each independently
selected from the group consisting of alkyl, haloalkyl, halogen,
hydroxy, hydroxyalkyl, alkoxy and cyano.
30. The compound of claim 20, wherein R.sup.9 is selected from the
group consisting of alkyl, optionally substituted aryl, optionally
substituted arylalkyl, optionally substituted heteroaryl,
optionally substituted heteroarylalkyl, and --CH.sub.2--U--V,
wherein U is CH.sub.2, CHF, CF.sub.2 or CHOH and V is hydrogen,
alkyl, or alkenyl; and R.sup.10 is selected from the group
consisting of hydrogen, alkyl, alkenyl, optionally substituted
cycloalkyl, optionally substituted aryl, optionally substituted
arylalkyl, optionally substituted heteroaryl, and optionally
substituted heteroarylalkyl.
31. The compound of claim 20, wherein R.sup.9 and R.sup.10 together
with the nitrogen atom to which they are attached form a
heterocyclic ring to give Z.sup.31 having the structure:
##STR00062## where A is CH.sub.2, CHF, CF.sub.2 or CHOH; B is
CH.sub.2, O, or N--R.sup.51, where R.sup.51 is CH.sub.3 or
C(O)CH.sub.3; s is 0, 1, or 2; and r is 0 or 1.
32. The compound of claim 30, wherein R.sup.11 and R.sup.12
together form .dbd.O.
33. The compound of claim 30, wherein R.sup.11 and R.sup.12 are
each independently selected from the group consisting of hydrogen,
alkyl, and alkenyl or together with the carbon atom to which they
are attached form a saturated or unsaturated C.sub.3-7 cycloalkyl
ring optionally substituted with one or more substituents each
independently selected from the group consisting of alkyl, hydroxy,
hydroxyalkyl, amino, carboxy, alkoxycarbonyl, alkylamino,
dialkylamino, phenyl, and .dbd.O, wherein one or more carbon atoms
of the C.sub.3-7 cycloalkyl ring are optionally replaced with
NR.sup.19, O, S, or SO.sub.2, wherein R.sup.19 is hydrogen or
C.sub.1-3 alkyl, to form a heterocyclic ring.
34. The compound of 33, wherein Z.sup.3 is Z.sup.32 having the
structure: ##STR00063## where K is selected from the group
consisting of CH.sub.2, O, S, SO.sub.2, and NR.sup.19, and v is 0,
1, or 2.
35. The compound of claim 20 having the Formula V: ##STR00064##
wherein w is 1 or 2; D is CH.sub.2, C(O), CHCH.sub.3,
C(CH.sub.3).sub.2 or absent; E is CH.sub.2, C(O), C(S), CHF,
CF.sub.2, or CHOH; and G is CH.sub.2, C(O), CHCH.sub.3,
C(CH.sub.3).sub.2 or absent.
36. The compound of claim 20, wherein Z is Z.sup.3; R.sup.11 and
R.sup.12 together form .dbd.O; R.sup.9 is selected from the group
consisting of alkyl, optionally substituted aryl, optionally
substituted arylalkyl, optionally substituted heteroaryl,
optionally substituted heteroarylalkyl, and --CH.sub.2--U--V,
wherein U is CH.sub.2, CHF, CF.sub.2 or CHOH and V is hydrogen,
alkyl, or alkenyl; and R.sup.10 and R.sup.1 together form a bridge
-D-E-G-, wherein D is CH.sub.2, C(O), CHCH.sub.3, C(CH.sub.3).sub.2
or absent; E is CH.sub.2, C(O), C(S), CHF, CF.sub.2, or CHOH; and G
is CH.sub.2, C(O), CHCH.sub.3, C(CH.sub.3).sub.2 or absent.
37. The compound of claim 1, wherein R.sup.1 is selected from the
group consisting of hydrogen, C.sub.1-6 alkyl,
halo(C.sub.1-6)alkyl, C.sub.1-4 alkoxy(C.sub.1-6)alkyl,
halo(C.sub.1-4)alkoxy(C.sub.1-6)alkyl, hydroxy(C.sub.1-6)alkyl,
amino(C.sub.1-6)alkyl, C.sub.1-4 alkylamino(C.sub.1-6)alkyl,
di(C.sub.1-4alkylamino(C.sub.1-6)alkyl, and C.sub.3-7
cycloalkyl.
38. The compound of claim 1, wherein R.sup.2 is selected from the
group consisting of a) cycloalkyl; b) aryl optionally substituted
with one, two or three substituents each independently selected
from the group consisting of alkyl, alkoxy, alkoxycarbonyl, cyano,
halogen, haloalkyl, haloalkoxy, hydroxy, hydroxyalkyl, amino,
alkylamino, dialkylamino, hydroxyalkylamino, --C(O)OR.sup.20, and
--C(O)NR.sup.20R.sup.21, wherein R.sup.20 and R.sup.21 are each
independently selected from the group consisting of hydrogen,
alkyl, alkenyl, optionally substituted heterocyclo, optionally
substituted cycloalkyl, optionally substituted aryl, optionally
substituted arylalkyl, optionally substituted heteroaryl,
optionally substituted heteroarylalkyl, and --CH.sub.2--U--V,
wherein U is CH.sub.2, CHF, CF.sub.2 or CHOH and V is hydrogen,
alkyl, alkenyl or aryl; c) heteroaryl optionally substituted with
one, two or three substituents each independently selected from the
group consisting of alkyl, alkoxy, hydroxy, cyano, amino,
alkylamino, dialkylamino, hydroxyalkylamino, alkoxycarbonyl,
carboxy, alkylcarbonylamino, alkylcarbonylaminoalkyl, halogen,
haloalkyl, phenyl, phenoxy, heteroaryl, and heterocyclo; and d)
di(C.sub.1-6)alkylamino.
39. The compound of claim 38, wherein R.sup.2 is phenyl or pyridyl
optionally substituted with one or two substituents each
independently selected from the group consisting of alkyl, alkoxy,
halogen, haloalkyl, hydroxy, hydroxyalkyl, cyano, amino,
alkylamino, dialkylamino and hydroxyalkylamino.
40. The compound of claim 38, wherein R.sup.2 is phenyl substituted
with alkyl, alkoxy, halogen, haloalkyl, hydroxy, hydroxyalkyl,
cyano, amino, alkylamino, dialkylamino, hydroxyalkylamino,
--C(O)OR.sup.20, and --C(O)NR.sup.20R.sup.21, wherein R.sup.20 and
R.sup.21 are each independently selected from the group consisting
of hydrogen, alkyl, alkenyl, optionally substituted heterocyclo,
optionally substituted cycloalkyl, optionally substituted aryl,
optionally substituted arylalkyl, optionally substituted
heteroaryl, optionally substituted heteroarylalkyl, and
--CH.sub.2--U--V, wherein U is CH.sub.2, CHF, CF.sub.2 or CHOH and
V is hydrogen, alkyl, alkenyl or aryl.
41. The compound as claimed in claim 1, wherein said compound is:
N-(4-fluorophenyl)-2-[1-(3-trifluoromethyl-benzenesulfonyl)piperidin-4-yl-
amino]acetamide;
2-{cyclopropyl-[1-(3-trifluoromethyl-benzenesulfonyl)-piperidin-4-yl]amin-
o}-N-(4-fluorophenyl)acetamide;
N-(4-fluorophenyl)-2-[1-(3-trifluoromethyl-benzenesulfonyl)-pyrrolidin-3--
ylamino]acetamide;
N-(3,5-bis-(trifluoromethyl)phenyl)-2-[1-(3-trifluoromethyl-benzenesulfon-
yl)piperidin-4-ylamino]acetamide;
N-(2,4-difluorophenyl)-N'-[1-(3-trifluoromethyl-benzenesulfonyl)-piperidi-
n-4-yl]malonamide; or a pharmaceutically acceptable salt, prodrug
or solvate thereof.
42. A compound having the Formula VI: ##STR00065## or a
pharmaceutically acceptable salt, prodrug or solvate thereof,
wherein: R.sup.2 is selected from the group consisting of
cycloalkyl, optionally substituted aryl, optionally substituted
heteroaryl, and di(C.sub.1-C.sub.6)alkylamino; R.sup.9 is selected
from the group consisting of alkyl, optionally substituted aryl,
optionally substituted arylalkyl, optionally substituted
heteroaryl, optionally substituted heteroarylalkyl, and
--CH.sub.2--U--V, wherein U is CH.sub.2, CHF, CF.sub.2 or CHOH and
V is hydrogen, alkyl, or alkenyl; D is CH.sub.2, C(O), CHCH.sub.3,
C(CH.sub.3).sub.2 or absent; E is CH.sub.2, C(O), C(S), CHF,
CF.sub.2 or CHOH; G is CH.sub.2, C(O), CHCH.sub.3,
C(CH.sub.3).sub.2 or absent; w is 0; and m is 0, 1, or 2.
43. A pharmaceutical composition, comprising the compound of claim
1 and a pharmaceutically acceptable carrier.
44. A method of treating a disorder responsive to the blockade of
calcium channels in a mammal suffering from said disorder,
comprising administering to a mammal in need of such treatment an
effective amount of a compound of claim 1 or a pharmaceutically
acceptable salt, prodrug or solvate thereof.
45. The method of claim 44, wherein a disorder responsive to the
blockade of N-type calcium channels is treated.
46. A method for treating stroke, neuronal damage resulting from
head trauma, epilepsy, pain, migraine, a mood disorder,
schizophrenia, a neurodegenerative disorder, depression, anxiety, a
psychosis, hypertension or cardiac arrhythmia in a mammal,
comprising administering an effective amount of a compound of claim
1 or a pharmaceutically acceptable salt, prodrug or solvate
thereof, to a mammal in need of such treatment.
47. The method of claim 46, wherein the method is for treating
pain.
48. The method of claim 47, wherein method is for preemptive or
palliative treatment of pain.
49. The method of claim 47, wherein said pain is selected from the
group consisting of chronic pain, neuropathic pain, acute pain, and
surgical pain.
50. A method of modulating calcium channels in a mammal, comprising
administering to the mammal at least one compound of claim 1 or a
pharmaceutically acceptable salt, prodrug or solvate thereof.
51. The method of claim 50, wherein the N-type calcium channel is
modulated.
52. A compound as claimed in claim 1, wherein the compound is
.sup.3H, .sup.11C, or .sup.14C radiolabeled, or a pharmaceutically
acceptable salt, prodrug or solvate thereof.
53. A method of screening a candidate compound for the ability to
bind to a receptor using a radiolabeled compound of claim 52,
comprising a) introducing a fixed concentration of the radiolabeled
compound to the receptor to form a mixture; b) titrating the
mixture with a candidate compound; and c) determining the binding
of the candidate compound to said receptor.
54-55. (canceled)
56. A method of preparing a pharmaceutical composition, comprising
admixing a therapeutically effective amount of a compound of claim
1, or a pharmaceutically acceptable salt, prodrug or solvate
thereof, with a pharmaceutically acceptable carrier.
Description
BACKGROUND OF THE INVENTION
[0001] 1. Field of the Invention
[0002] This invention is in the field of medicinal chemistry. The
invention relates to novel pyrrolidinyl, piperidinyl, and
hexahydroazepinyl compounds and the use of these compounds as
blockers of calcium (Ca.sup.2+) channels.
[0003] 2. Background Art
[0004] Calcium ions play fundamental roles in the regulation of
many cellular processes. It is therefore essential that their
intracellular levels be maintained under strict, yet dynamic
control (Davila, H. M., Annals of the New York Academy of Sciences,
pp. 102-117 (1999)). Voltage-gated calcium channels (VGCC) serve as
one of the important mechanisms for fast calcium influx into the
cell. Calcium channels are hetero-oligomeric proteins consisting of
a pore-forming subunit (.alpha.1), which is able to form functional
channels on its own in heterologous expression systems, and a set
of auxiliary or regulatory subunits. Calcium channels have been
classified based on their pharmacological and/or
electrophysiological properties. The classification of
voltage-gated calcium channels divides them into three groups: (i)
high voltage-activated (HVA) channels, which include L-, N-, P-,
and Q-types; (ii) intermediate (IVA) voltage-activated R-type
channels; and (iii) low voltage-activated (LVA) T-type channels
(Davila, supra). Voltage-gated calcium channels (VGCC) are also
known as voltage-dependent calcium channels (VDCC) or
voltage-sensitive calcium channels (VSCC).
[0005] Voltage-sensitive calcium channels (VSCC) regulate
intracellular calcium concentration, which affects various
important neuronal functions such as cellular excitability,
neurotransmitter release, hormone secretion, intracellular
metabolism, neurosecretory activity and gene expression (Hu et al.,
Bioorganic & Medicinal Chemistry 8:1203-1212 (2000)). N-type
channels are found mainly in central and peripheral neurons, being
primarily located on presynaptic nerve terminals. These channels
regulate the calcium flux required for depolarization-evoked
release of a transmitter from synaptic endings. The transmission of
pain signals from the periphery to the central nervous system (CNS)
is mediated by N-type calcium channels located in the spinal cord
(Song et al., J. Med. Chem. 43:3474-3477 (2000)).
[0006] The six types of calcium channels (i.e., L, N, P, Q, R, and
T) are expressed throughout the nervous system (Wallace, M. S., The
Clinical Journal of Pain 16:580-585 (2000)). Voltage-sensitive
calcium channels of the N-type exist in the superficial laminae of
the dorsal horn and are thought to modulate nociceptive processing
by a central mechanism. Blockade of the N-type calcium channel in
the superficial dorsal horn modulates membrane excitability and
inhibits neurotransmitter release, resulting in pain relief.
Wallace (supra) suggests that based on animal models, N-type
calcium channel antagonists have a greater analgesic potency than
sodium channel antagonists.
[0007] N-type calcium channel blockers have usefulness for
neuroprotection and analgesia. Ziconotide, which is a selective
N-type calcium channel blocker, has been found to have analgesic
activity in animal models and neuroprotective activity in focal and
global ischemia models (Song et al., supra). Examples of known
calcium channel blockers include flunarizine, fluspirilene,
cilnipide, PD 157767, SB-201823, SB-206284, NNC09-0026, and PD
151307 (Hu et al., supra).
[0008] Blockade of N-type channels can prevent and/or attenuate
subjective pain as well as primary and/or secondary hyperalgesia
and allodynia in a variety of experimental and clinical conditions
(Vanegas, H. et al., Pain 85:9-18 (2000)). N-type voltage-gated
calcium channels (VGCC) play a major role in the release of
synaptic mediators such as glutamate, acetylcholine, dopamine,
norepinephrine, gamma-aminobutyric acid (GABA) and calcitonin
gene-related peptide (CGRP).
[0009] Inhibition of voltage-gated L-type calcium channels has been
shown to be beneficial for neuroprotection (Song et al., supra).
However, inhibition of cardiac L-type calcium channels can lead to
hypotension. It is believed that a rapid and profound lowering of
arterial pressure tends to counteract the neuroprotective effects
of L-type calcium channel blockers. A need exists for antagonists
that are selective for N-type calcium channels over L-type calcium
channels to avoid potential hypotensive effects.
BRIEF SUMMARY OF THE INVENTION
[0010] The present invention is related to the use of pyrrolidinyl,
piperidinyl, and hexahydroazepinyl compounds represented by Formula
I, below, and the pharmaceutically acceptable salts, prodrugs and
solvates thereof, as blockers of calcium (Ca.sup.2+) channels.
Compounds of Formula I show selectivity as N-type calcium channel
blockers.
[0011] The invention is also related to treating a disorder
responsive to the blockade of calcium channels in a mammal
suffering from excess activity of said channels by administering an
effective amount of a compound of Formula I, or a pharmaceutically
acceptable salt, prodrug or solvate thereof, as described herein.
Specifically, the invention is related to treating a disorder
responsive to the blockade of N-type calcium channels in a mammal
suffering from excess activity of said channels by administering an
effective amount of a compound of Formula I, or a pharmaceutically
acceptable salt, prodrug or solvate thereof, as described
herein.
[0012] Compounds useful in the present invention have not been
heretofore reported. Thus, one aspect of the present invention is
directed to novel compounds of Formula I, as well as their
pharmaceutically acceptable salts, prodrugs and solvates.
[0013] Another aspect of the present invention is directed to the
use of the novel compounds of Formula I, and their pharmaceutically
acceptable salts, prodrugs and solvates, as blockers of N-type
calcium channels.
[0014] A further aspect of the present invention is to provide a
method for treating pain (e.g., acute pain, chronic pain, which
includes but is not limited to, neuropathic pain and inflammatory
pain, or surgical pain) by administering an effective amount of a
compound of Formula I, or a pharmaceutically acceptable salt,
prodrug or solvate thereof, to a mammal in need of such treatment.
Specifically, the present invention provides a method for
preemptive or palliative treatment of pain by administering an
effective amount of a compound of Formula I, or a pharmaceutically
acceptable salt, prodrug or solvate thereof, to a mammal in need of
such treatment.
[0015] A further aspect of the present invention is to provide a
method for treating stroke, neuronal damage resulting from head
trauma, epilepsy, migraine, a mood disorder, schizophrenia, a
neurodegenerative disorder (e.g., Alzheimer's disease, amyotrophic
lateral sclerosis (ALS), or Parkinson's disease), depression,
anxiety, a psychosis, hypertension, or cardiac arrhythmia, by
administering an effective amount of a compound of Formula I, or a
pharmaceutically acceptable salt, prodrug or solvate thereof, to a
mammal in need of such treatment.
[0016] A further aspect of the present invention is to provide a
pharmaceutical composition useful for treating a disorder
responsive to the blockade of calcium ion channels, especially
N-type calcium ion channels, said pharmaceutical composition
containing an effective amount of a compound of Formula I, or a
pharmaceutically acceptable salt, prodrug or solvate thereof, in a
mixture with one or more pharmaceutically acceptable carriers.
[0017] Also, an aspect of the invention is to provide a method of
modulating calcium channels, especially N-type calcium channels, in
a mammal, wherein said method comprises administering to the mammal
an effective amount of at least one compound of Formula I, or a
pharmaceutically acceptable salt, prodrug or solvate thereof.
[0018] A further aspect of the present invention is to provide
radiolabeled compounds of Formula I and the use of such compounds,
or their pharmaceutically acceptable salts, prodrugs or solvates,
as radioligands for their binding site on the calcium channel.
[0019] A further aspect of the invention is to provide a method for
screening a candidate compound for the ability to bind to a
receptor using a radiolabeled compound of Formula I, which includes
but is not limited to, a .sup.3H, and .sup.14C radiolabeled
compound of Formula I, or a pharmaceutically acceptable salt,
prodrug or solvate thereof. This method comprises a) introducing a
fixed concentration of the radiolabeled compound to the receptor to
form a mixture; b) titrating the mixture with a candidate compound;
and c) determining the binding of the candidate compound to said
receptor.
[0020] A further aspect of the invention is to provide the use of a
compound of Formula I, or a pharmaceutically acceptable salt,
prodrug or solvate thereof, in the manufacture of a medicament for
treating pain in a mammal. In one embodiment, the invention
provides the use of a compound of Formula I, or a pharmaceutically
acceptable salt, prodrug or solvate thereof, in the manufacture of
a medicament for palliative or premptive treatment of pain, such as
acute pain, chronic pain, or surgical pain.
[0021] A further aspect of the invention is to provide the use of a
compound of Formula I, or a pharmaceutically acceptable salt,
prodrug or solvate thereof, in the manufacture of a medicament for
treating stroke, neuronal damage resulting from head trauma,
epilepsy, migraine, a mood disorder, schizophrenia, a
neurodegenerative disorder, depression, anxiety, a psychosis,
hypertension, or cardiac arrhythmia in a mammal.
[0022] Additional embodiments and advantages of the invention will
be set forth in part in the description that follows, and will flow
from the description, or may be learned by practice of the
invention. The embodiments and advantages of the invention will be
realized and attained by means of the elements and combinations
particularly pointed out in the appended claims.
[0023] It is to be understood that both the foregoing summary and
the following detailed description are exemplary and explanatory
only and are not restrictive of the invention, as claimed.
DETAILED DESCRIPTION OF THE INVENTION
[0024] One aspect of the present invention is based on the use of
compounds of Formula I, and the pharmaceutically acceptable salts,
prodrugs and solvates thereof, as blockers of Ca.sup.2+ channels.
In view of this property, compounds of Formula I, and the
pharmaceutically acceptable salts, prodrugs and solvates thereof,
are useful for treating disorders responsive to the blockade of
calcium ion channels. In one aspect, compounds of Formula I, and
the pharmaceutically acceptable salts, prodrugs and solvates
thereof, selectively block N-type calcium ion channels and, thus,
are useful for treating disorders responsive to the selective
blockade of N-type calcium ion channels.
[0025] The compounds useful in this aspect of the invention are
compounds represented by Formula I:
##STR00002##
and pharmaceutically acceptable salts, prodrugs and solvates
thereof, wherein:
[0026] R.sup.1 is selected from the group consisting of hydrogen,
C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl,
halo(C.sub.1-C.sub.6)alkyl, C.sub.1-C.sub.6
alkoxy(C.sub.1-C.sub.6)alkyl,
halo(C.sub.1-C.sub.6)alkoxy(C.sub.1-C.sub.6)alkyl,
hydroxy(C.sub.1-C.sub.6)alkyl, amino(C.sub.1-C.sub.6)alkyl,
C.sub.1-C.sub.6 alkylamino(C.sub.1-C.sub.6)alkyl,
di(C.sub.1-C.sub.6)alkylamino(C.sub.1-C.sub.6)alkyl, cycloalkyl,
and heterocyclo(C.sub.1-C.sub.6)alkyl, all of which can be
optionally substituted;
[0027] R.sup.2 is selected from the group consisting of
C.sub.1-C.sub.6 alkyl, cycloalkyl, optionally substituted aryl,
optionally substituted heteroaryl, and
di(C.sub.1-C.sub.6)alkylamino;
[0028] Z is selected from the group consisting of Z.sup.1, Z.sup.2,
and Z.sup.3 wherein:
Z.sup.1 is
##STR00003##
[0029] Z.sup.2 is
##STR00004##
[0030] and
Z.sup.3 is
##STR00005##
[0032] m is 0, 1, or 2;
[0033] n is 0, 1 or 2;
[0034] p is 0 or 1; provided that n and p are not both 0;
[0035] r is 0 or 1,
[0036] R.sup.3 and R.sup.4 are each independently hydrogen, alkyl,
or alkenyl; or
[0037] R.sup.3 and R.sup.4 together form .dbd.O; or
[0038] R.sup.3 and R.sup.4 together with the carbon atom to which
they are attached form a saturated C.sub.3-7 cycloalkyl ring
optionally substituted with one substituent selected from the group
consisting of alkyl, hydroxy, hydroxyalkyl, amino, and .dbd.O,
wherein one or more carbon atoms of the C.sub.3-7 cycloalkyl ring
are optionally replaced with NR.sup.16, O, S, or SO.sub.2, wherein
R.sup.16 is hydrogen or C.sub.1-3 alkyl, to form a heterocyclic
ring;
[0039] R.sup.5 is selected from the group consisting of alkyl,
optionally substituted aryl, optionally substituted arylalkyl, and
optionally substituted heteroaryl;
[0040] R.sup.6 is selected from the group consisting of hydrogen,
alkyl, alkenyl, optionally substituted cycloalkyl, optionally
substituted aryl, optionally substituted arylalkyl, and optionally
substituted heteroaryl; or
[0041] R.sup.5 and R.sup.6 together with the nitrogen atom to which
they are attached form a heterocyclic ring to give Z.sup.11 having
the structure:
##STR00006##
where
[0042] A is CH.sub.2, CHF, CF.sub.2 or CHOH;
[0043] B is CH.sub.2, O, or N--R.sup.51, where R.sup.51 is CH.sub.3
or C(O)CH.sub.3;
[0044] s is 0, 1, or 2;
[0045] p is 0 or 1;
[0046] R.sup.3 is as defined above and R.sup.4 is hydrogen; or
[0047] R.sup.7 is selected from the group consisting of alkyl,
optionally substituted heterocyclo, optionally substituted aryl,
optionally substituted arylalkyl, optionally substituted
heteroaryl, optionally substituted heteroarylalkyl, and
--CH.sub.2--U--V, wherein U is CH.sub.2, CHF, CF.sub.2 or CHOH and
V is hydrogen, alkyl, or alkenyl;
[0048] R.sup.8 is selected from the group consisting of hydrogen,
alkyl, alkenyl, optionally substituted cycloalkyl, optionally
substituted aryl, optionally substituted arylalkyl, optionally
substituted heteroaryl, and optionally substituted
heteroarylalkyl;
[0049] (i) R.sup.9 and R.sup.10 are each independently selected
from the group consisting of [0050] hydrogen; [0051] alkyl; [0052]
alkenyl; [0053] hydroxyalkyl; [0054] alkoxyalkyl; [0055]
cycloalkyl, and [0056] phenyl optionally substituted with one
substituent selected from the group consisting of alkyl,
cycloalkyl, halogen, cyano, amino, alkylamino, dialkylamino,
hydroxy, nitro, hydroxyalkyl, haloalkyl, and alkoxy; or
[0057] R.sup.9 is hydrogen, alkyl, alkenyl, hydroxyalkyl,
alkoxyalkyl, cycloalkyl, or phenyl optionally substituted with one
substituent selected from the group consisting of alkyl,
cycloalkyl, halogen, cyano, amino, alkylamino, dialkylamino,
hydroxy, nitro, hydroxyalkyl, haloalkyl, and alkoxy; and
[0058] R.sup.10 is R.sup.17--C(O)--, where
[0059] R.sup.17 is selected from the group consisting of alkyl,
alkoxy, optionally substituted benzyl, and optionally substituted
benzyloxy; or
[0060] R.sup.9 and R.sup.10 together with the nitrogen atom to
which they are attached form a 5- or 6-membered heterocyclic ring
wherein one or more carbon atoms of the heterocyclic ring are
optionally replaced with NR.sup.18, O, or S, wherein R.sup.18 is
hydrogen or C.sub.1-3 alkyl;
[0061] R.sup.11 and R.sup.12 are each independently selected from
the group consisting of [0062] hydrogen; [0063] alkyl; [0064]
alkenyl; [0065] hydroxyalkyl; [0066] aminoalkyl; [0067] cycloalkyl;
[0068] heterocyclo; [0069] heterocycloalkyl; [0070] phenyl
optionally substituted with one or two substituents independently
selected from the group consisting of alkyl, cycloalkyl, halogen,
cyano, amino, alkylamino, dialkylamino, hydroxy, nitro,
hydroxyalkyl, haloalkyl, and alkoxy; [0071] benzyl optionally
substituted with one or two substituents independently selected
from the group consisting of alkyl, cycloalkyl, halogen, cyano,
amino, alkylamino, dialkylamino, hydroxy, nitro, hydroxyalkyl,
haloalkyl, and alkoxy; [0072] benzyloxyalkyl; [0073] heteroaryl
optionally substituted with one or two substituents independently
selected from the group consisting of alkyl, cycloalkyl, halogen,
cyano, amino, alkylamino, dialkylamino, hydroxy, nitro,
hydroxyalkyl, haloalkyl, and alkoxy; and [0074] heteroarylalkyl
optionally substituted with one or two substituents independently
selected from the group consisting of alkyl, cycloalkyl, halogen,
cyano, amino, alkylamino, dialkylamino, hydroxy, nitro,
hydroxyalkyl, haloalkyl, and alkoxy; or
[0075] R.sup.11 and R.sup.12 together form .dbd.O; or
[0076] R.sup.11 and R.sup.12 together with the carbon atom to which
they are attached form a saturated or unsaturated C.sub.3-7
cycloalkyl ring optionally substituted with one or more
substituents each independently selected from the group consisting
of alkyl, hydroxy, hydroxyalkyl, amino, carboxy, alkoxycarbonyl,
alkylamino, dialkylamino, phenyl, and .dbd.O, wherein one or more
carbon atoms of the C.sub.3-7 cycloalkyl ring are optionally
replaced with NR.sup.19, O, S, or SO.sub.2, wherein R.sup.19 is
hydrogen or C.sub.1-3 alkyl, to form a heterocyclic ring; or
wherein two adjacent carbon atoms of the C.sub.3-7 cycloalkyl ring
can form a bridge --O-- to form a bicyclic ring; or wherein two
adjacent carbon atoms of the C.sub.3-7 cycloalkyl ring together
form a fused phenyl group optionally substituted with alkyl,
haloalkyl, amino, cyano, or hydroxy; or
[0077] R.sup.12 is hydrogen, alkyl, or alkenyl; R.sup.9 is as
defined above; and R.sup.10 and R.sup.11 together form a bridge
--CH.sub.2--CH.sub.2--CH.sub.2-- or
--CH.sub.2--CHG.sup.1-CHG.sup.2-CH.sub.2--, wherein G.sup.1 and
G.sup.2 are both hydrogen or together with the carbon atoms to
which they are attached form a fused phenyl group; or
[0078] (ii) R.sup.9 is selected from the group consisting of alkyl,
optionally substituted aryl, optionally substituted arylalkyl,
optionally substituted heteroaryl, optionally substituted
heteroarylalkyl, and --CH.sub.2--U--V, wherein U is CH.sub.2, CHF,
CF.sub.2 or CHOH and V is hydrogen, alkyl, or alkenyl; and
[0079] R.sup.10 is selected from the group consisting of hydrogen,
alkyl, alkenyl, optionally substituted cycloalkyl, optionally
substituted aryl, optionally substituted arylalkyl, optionally
substituted heteroaryl, and optionally substituted heteroarylalkyl;
or
[0080] R.sup.9 and R.sup.10 together with the nitrogen atom to
which they are attached form a heterocyclic ring to give Z.sup.31
having the structure:
##STR00007##
where
[0081] A is CH.sub.2, CHF, CF.sub.2 or CHOH;
[0082] B is CH.sub.2, O, or N--R.sup.51, where R.sup.51 is CH.sub.3
or C(O)CH.sub.3; and
[0083] s is 0, 1, or 2;
[0084] r is 0 or 1; and
[0085] R.sup.11 and R.sup.12 together form .dbd.O; or
[0086] R.sup.11 and R.sup.12 are each independently selected from
the group consisting of hydrogen, alkyl, and alkenyl or together
with the carbon atom to which they are attached form a saturated or
unsaturated C.sub.3-7 cycloalkyl ring optionally substituted with
one or more substituents each independently selected from the group
consisting of alkyl, hydroxy, hydroxyalkyl, amino, carboxy,
alkoxycarbonyl, alkylamino, dialkylamino, phenyl, and .dbd.O,
wherein one or more carbon atoms of the C.sub.3-7 cycloalkyl ring
are optionally replaced with NR.sup.19, O, S, or SO.sub.2, wherein
R.sup.19 is hydrogen or C.sub.1-3 alkyl, to form a heterocyclic
ring; or
[0087] (iii) R.sup.11 and R.sup.12 are both hydrogen or together
form .dbd.O; R.sup.9 is selected from the group consisting of
alkyl, optionally substituted aryl, optionally substituted
arylalkyl, optionally substituted heteroaryl, optionally
substituted heteroarylalkyl, and --CH.sub.2--U--V, wherein U is
CH.sub.2, CHF, CF.sub.2 or CHOH and V is hydrogen, alkyl, or
alkenyl; and R.sup.10 and R.sup.1 together form a bridge -D-E-G-,
wherein
[0088] D is CH.sub.2, C(O), CHCH.sub.3, C(CH.sub.3).sub.2 or
absent;
[0089] E is CH.sub.2, C(O), C(S), CHF, CF.sub.2 or CHOH; and
[0090] G is CH.sub.2, C(O), CHCH.sub.3, C(CH.sub.3).sub.2 or
absent; and
[0091] Y is O or S.
[0092] The carbon of the pyrrolidinyl, piperidinyl, and
hexahydroazepinyl ring where the Z group is attached, can be a
chiral center. Accordingly, the configuration at those carbon atoms
can be (R) or (S).
[0093] One group of compounds useful in this aspect of the present
invention are compounds of Formula I as defined above, with the
following provisos:
[0094] 1) R.sup.7 is not optionally substituted 2-thiazolyl or
optionally substituted benzothiazolyl;
[0095] 2) when Z is Z.sup.2, then R.sup.2 is not C.sub.1-6 alkyl,
cycloalkyl or unsubstituted phenyl;
[0096] 3) when Z is Z.sup.2, R.sup.8 is hydrogen or alkyl, and
R.sup.7 is an optionally substituted phenyl or biphenyl, then
R.sup.1 is other than hydrogen or unsubstituted alkyl;
[0097] 4) when Z is Z.sup.3 and m is 2, then R.sup.2 is not phenyl
substituted with CN or R.sup.9 and R.sup.10 are not both
hydrogen;
[0098] 5) when Z is Z.sup.3 and R.sup.9 and R.sup.10 are both
hydrogen, then R.sup.1 is other than hydrogen; or
[0099] 6) when Z is Z.sup.3, r is 0, and R.sup.11 and R.sup.12 are
both hydrogen, then R.sup.1 is other than unsubstituted C.sub.1-6
alkyl.
[0100] In one embodiment, compounds useful in the present invention
are compounds represented by Formula II:
##STR00008##
and pharmaceutically acceptable salts, prodrugs, and solvates
thereof, wherein R.sup.1, R.sup.2, and Z are as defined above.
[0101] In one embodiment, compounds useful in the present invention
are compounds represented by Formula III:
##STR00009##
and pharmaceutically acceptable salts, prodrugs, and solvates
thereof, wherein R.sup.1, R.sup.2, and Z are as defined above.
[0102] In one embodiment, compounds useful in the present invention
are compounds represented by Formula IV:
##STR00010##
and pharmaceutically acceptable salts, prodrugs, and solvates
thereof, wherein R.sup.1, R.sup.2, and Z are as defined above.
[0103] In one embodiment, compounds useful in the present invention
are compounds of any of Formulae I-IV where Z is Z.sup.1.
[0104] In one aspect, useful compounds falling into the scope of
any of Formulae I-IV are those where Z is Z.sup.11 having the
structure:
##STR00011##
where R.sup.3, R.sup.4, A, B, n, p, and s are as defined above.
[0105] In one aspect, useful compounds falling within the scope of
any of Formulae I-IV are those where Z is Z.sup.12 having the
structure:
##STR00012##
wherein R.sup.3-R.sup.6 and n are as defined above.
[0106] In one embodiment, compounds useful in the present invention
are compounds of any of Formulae I-IV, wherein Z is Z.sup.1 and p
is 0.
[0107] In one embodiment, compounds useful in the present invention
are compounds of any of Formulae I-IV, wherein Z is Z.sup.1 and p
is 1.
[0108] In one embodiment, compounds useful in the present invention
are compounds of any of Formulae I-IV, wherein Z is Z.sup.1 and
R.sup.3 and R.sup.4 are each independently hydrogen, alkyl, or
alkenyl.
[0109] In one embodiment, compounds useful in the present invention
are compounds of any of Formulae I-IV, wherein Z is Z.sup.1 and
R.sup.3 and R.sup.4 together form .dbd.O.
[0110] In one embodiment, compounds useful in the present invention
are compounds of any of Formulae I-IV, wherein Z is Z.sup.1 and
R.sup.3 and R.sup.4 together with the carbon atom to which they are
attached form a saturated C.sub.3-7 cycloalkyl ring optionally
substituted with one substituent selected from the group consisting
of alkyl, hydroxy, hydroxyalkyl, amino, and .dbd.O, wherein one or
more carbon atoms of the C.sub.3-7 cycloalkyl ring are optionally
replaced with NR.sup.16, O, S, or SO.sub.2, wherein R.sup.16 is
hydrogen or C.sub.1-3 alkyl, to form a heterocyclic ring. Useful
compounds include those where R.sup.3 and R.sup.4 together form a
C.sub.3-6 carbocyclic ring. Further useful compounds include those
where Z.sup.1 is Z.sup.13 having the structure:
##STR00013##
where R.sup.5, R.sup.6, and p are as defined above, K is selected
from the group consisting of CH.sub.2, O, S, SO.sub.2, and
NR.sup.16, and v is 0, 1, or 2.
[0111] Preferably, Z.sup.1 is selected from the group consisting of
Z.sup.14, Z.sup.15 and Z.sup.16, wherein:
[0112] Z.sup.14 is
##STR00014##
[0113] Z.sup.15 is
##STR00015##
and
[0114] Z.sup.16 is
##STR00016##
wherein R.sup.5, R.sup.6 and n are as defined above. Preferably,
R.sup.6 is hydrogen and n is 0 or 1. More preferably, R.sup.5 is
optionally substituted C.sub.6-10 aryl or optionally substituted
heteroaryl having 5-10 ring atoms. Useful compounds of any of
Formulae I-IV include those where R.sup.5 is selected from the
group consisting of phenyl, naphthyl, indenyl, isoindenyl, pyridyl,
pyrimidinyl, pyrazinyl, pyridazinyl, triazinyl, pyrrolyl,
pyrazolyl, benzothiazolyl, thiazolyl, imidazolyl, benzoimidazolyl,
benzoxazolyl, indolyl, indazolyl, and benzotriazolyl, all of which
can be optionally substituted. Preferably, R.sup.5 is optionally
substituted phenyl or pyridyl. More preferably, R.sup.5 is phenyl
or pyridyl that is unsubstituted or substituted with one or two
substituents each independently selected from the group consisting
of alkyl, haloalkyl, halogen, hydroxy, hydroxyalkyl, alkoxy, and
cyano.
[0115] Useful compounds of any of Formulae I-IV include those where
Z.sup.1 is selected from the group consisting of Z.sup.17 and
Z.sup.18, wherein
Z.sup.17 is
##STR00017##
[0116] and
Z.sup.18 is
##STR00018##
[0118] wherein R.sup.13, R.sup.14 and R.sup.15 are each
independently selected from the group consisting of hydrogen,
alkyl, alkoxy, halogen, haloalkyl, hydroxy, hydroxyalkyl, cyano,
amino, aminoalkyl, alkylamino, dialkylamino, hydroxyalkylamino,
--C(O)OR.sup.20, and --C(O)NR.sup.20R.sup.21, wherein R.sup.21 and
R.sup.21 are each independently selected from the group consisting
of hydrogen, alkyl, alkenyl, optionally substituted heterocyclo,
optionally substituted cycloalkyl, optionally substituted aryl,
optionally substituted arylalkyl, optionally substituted
heteroaryl, optionally substituted heteroarylalkyl, and
--CH.sub.2--U--V, wherein U is CH.sub.2, CHF, CF.sub.2 or CHOH and
V is hydrogen, alkyl, alkenyl or aryl.
[0119] The groups R.sup.13, R.sup.14, and R.sup.15, when they are
not equal to H, each take the place of a hydrogen atom that would
otherwise be present in any position on the phenyl ring to which
the particular R group is attached. Similarly, optional
substituents attached to aryl, phenyl, and heteroaryl rings each
take the place of a hydrogen atom that would otherwise be present
in any position on the aryl or heteroaryl rings.
[0120] In one embodiment, compounds useful in the present invention
are compounds of any of Formulae I-IV where Z is Z.sup.2. A group
of useful compounds include those where Y is O. Another group of
useful compounds include those where Y is S.
[0121] In one aspect, useful compounds falling within the scope of
any of Formulae I-IV are those where Z.sup.2 is Z.sup.21 having the
structure:
##STR00019##
wherein Y is O or S and R.sup.7 is selected from the group
consisting of aryl and heteroaryl, either of which can be
optionally substituted. Preferably, R.sup.7 is optionally
substituted C.sub.6-10 aryl or optionally substituted heteroaryl
having 5-10 ring atoms. Useful compounds of any of Formulae I-IV
include those where R.sup.7 is selected from the group consisting
of phenyl, naphthyl, indenyl, isoindenyl, pyridyl, pyrimidinyl,
pyrazinyl, pyridazinyl, triazinyl, pyrrolyl, pyrazolyl, thiazolyl,
imidazolyl, benzoimidazolyl, benzoxazolyl, indolyl, indazolyl, and
benzotriazolyl all of which can be optionally substituted.
Preferably, R.sup.7 is optionally substituted phenyl or
pyridyl.
[0122] In one embodiment, R.sup.7 is unsubstituted phenyl or phenyl
substituted with one, two, or three substituents each independently
selected from the group consisting of alkyl, alkoxy, halogen,
haloalkyl, hydroxy, hydroxyalkyl, cyano, amino, aminoalkyl,
alkylamino, dialkylamino, and hydroxyalkylamino. In another
embodiment, R.sup.7 is pyridyl that is unsubstituted or substituted
with one or two substituents each independently selected from the
group consisting of alkyl, haloalkyl, halogen, hydroxy,
hydroxyalkyl, alkoxy, and cyano.
[0123] In one embodiment, compounds useful in the present invention
are compounds of any of Formulae I-IV where Z is Z.sup.3.
[0124] In one embodiment, compounds useful in the present invention
are compounds of any of Formulae I-IV, wherein Z is Z.sup.3 and
R.sup.9 and R.sup.10 are each independently selected from the group
consisting of [0125] hydrogen; [0126] alkyl; [0127] alkenyl; [0128]
hydroxyalkyl; [0129] alkoxyalkyl; [0130] cycloalkyl, and [0131]
phenyl optionally substituted with one substituent selected from
the group consisting of alkyl, cycloalkyl, halogen, cyano, amino,
alkylamino, dialkylamino, hydroxy, nitro, hydroxyalkyl, haloalkyl,
and alkoxy. Preferably,
[0132] R.sup.9 is hydrogen and R.sup.10 is other than hydrogen.
[0133] In one embodiment, compounds useful in the present invention
are compounds of any of Formulae I-IV, wherein Z is Z.sup.3 and
R.sup.9 is hydrogen, alkyl, alkenyl, hydroxyalkyl, alkoxyalkyl,
cycloalkyl, or phenyl optionally substituted with one substituent
selected from the group consisting of alkyl, cycloalkyl, halogen,
cyano, amino, alkylamino, dialkylamino, hydroxy, nitro,
hydroxyalkyl, haloalkyl, and alkoxy; and
[0134] R.sup.10 is R.sup.17--C(O)--, where
[0135] R.sup.17 is selected from the group consisting of alkyl,
alkoxy, optionally substituted benzyl, and optionally substituted
benzyloxy.
[0136] In one embodiment, compounds useful in the present invention
are compounds of any of Formulae I-IV, wherein Z is Z.sup.3 and
R.sup.9 and R.sup.10 together with the nitrogen atom to which they
are attached form a 5- or 6-membered heterocyclic ring wherein one
or more carbon atoms of the heterocyclic ring are optionally
replaced with NR.sup.18, O, or S, wherein R.sup.18 is hydrogen or
C.sub.1-3 alkyl.
[0137] In one embodiment, compounds useful in the present invention
are compounds of any of Formulae I-IV, wherein Z is Z.sup.3 and
R.sup.11 and R.sup.12 are each independently selected from the
group consisting of [0138] hydrogen; [0139] alkyl; [0140] alkenyl;
[0141] hydroxyalkyl; [0142] aminoalkyl; [0143] cycloalkyl; [0144]
heterocyclo; [0145] heterocycloalkyl; [0146] phenyl optionally
substituted with one or two substituents independently selected
from the group consisting of alkyl, cycloalkyl, halogen, cyano,
amino, alkylamino, dialkylamino, hydroxy, nitro, hydroxyalkyl,
haloalkyl, and alkoxy; [0147] benzyl optionally substituted with
one or two substituents independently selected from the group
consisting of alkyl, cycloalkyl, halogen, cyano, amino, alkylamino,
dialkylamino, hydroxy, nitro, hydroxyalkyl, haloalkyl, and alkoxy;
[0148] benzyloxyalkyl; [0149] heteroaryl optionally substituted
with one or two substituents independently selected from the group
consisting of alkyl, cycloalkyl, halogen, cyano, amino, alkylamino,
dialkylamino, hydroxy, nitro, hydroxyalkyl, haloalkyl, and alkoxy;
and [0150] heteroarylalkyl optionally substituted with one or two
substituents independently selected from the group consisting of
alkyl, cycloalkyl, halogen, cyano, amino, alkylamino, dialkylamino,
hydroxy, nitro, hydroxyalkyl, haloalkyl, and alkoxy.
[0151] In one embodiment, compounds useful in the present invention
are compounds of any of Formulae I-IV, wherein Z is Z.sup.3 and
R.sup.11 and R.sup.12 together with the carbon atom to which they
are attached form a saturated or unsaturated C.sub.3-7 cycloalkyl
ring optionally substituted with one or more substituents each
independently selected from the group consisting of alkyl, hydroxy,
hydroxyalkyl, amino, carboxy, alkoxycarbonyl, alkylamino,
dialkylamino, phenyl, and .dbd.O, wherein one or more carbon atoms
of the C.sub.3-7 cycloalkyl ring are optionally replaced with
NR.sup.19, O, S, or SO.sub.2, wherein R.sup.19 is hydrogen or
C.sub.1-3 alkyl, to form a heterocyclic ring; or wherein two
adjacent carbon atoms of the C.sub.3-7 cycloalkyl ring can form a
bridge --O-- to form a bicyclic ring; or wherein two adjacent
carbon atoms of the C.sub.3-7 cycloalkyl ring together form a fused
phenyl group optionally substituted with alkyl, haloalkyl, amino,
cyano, or hydroxy.
[0152] In one embodiment, compounds useful in the present invention
are compounds of any of Formulae I-IV, wherein Z is Z.sup.3 and
R.sup.11 and R.sup.12 together form .dbd.O.
[0153] In one embodiment, compounds useful in the present invention
are compounds of any of Formulae I-IV, wherein Z is Z.sup.3 and
R.sup.12 is hydrogen, alkyl, or alkenyl; R.sup.9 is as defined
above; and R.sup.10 and R.sup.11 together form a bridge
--CH.sub.2--CH.sub.2--CH.sub.2-- or
--CH.sub.2--CHG.sup.1-CHG.sup.2-CH.sub.2--, wherein G.sup.1 and
G.sup.2 are both hydrogen or together with the carbon atoms to
which they are attached form a fused phenyl group.
[0154] In one embodiment, useful compounds of Formulae I-IV include
those where R.sup.9 and R.sup.10 are each independently selected
from the group consisting of hydrogen, alkyl, hydroxyalkyl, and
phenyl; more preferably independently selected from hydrogen,
C.sub.1-6 alkyl, hydroxy(C.sub.1-6)alkyl, and phenyl; more
preferably independently selected from hydrogen, C.sub.1-3 alkyl,
hydroxy(C.sub.1-3)alkyl, and phenyl; and more preferably
independently selected from hydrogen, methyl, ethyl, hydroxymethyl,
hydroxyethyl, and phenyl; or R.sup.9 and R.sup.10 together with the
nitrogen atom to which they are attached form a 5- or 6-membered
heterocyclic ring selected from the group consisting of
oxazolidinyl, isoxazolidinyl, pyrrolidinyl, pyrazolidinyl,
imidazolidinyl, hexahydropyrimidinyl, piperidinyl, piperazinyl,
4-methylpiperazinyl, morpholinyl, thiomorpholinyl, and
tetrahydropyridyl. Advantageously, R.sup.9 and R.sup.10 are
independently hydrogen, methyl or hydroxyethyl, or R.sup.9 and
R.sup.10 together with the nitrogen atom to which they are attached
form 1-pyrrolidinyl, 4-thiomorpholinyl, piperazinyl, or
4-methylpiperazinyl.
[0155] In one embodiment, useful compounds of Formulae I-IV include
those where R.sup.11 is hydrogen and R.sup.12 is selected from the
group consisting of alkyl; hydroxyalkyl; cycloalkyl;
heterocycloalkyl; phenyl optionally substituted with one or two
substituents independently selected from the group consisting of
alkyl, cycloalkyl, halogen, cyano, amino, alkylamino, dialkylamino,
hydroxy, nitro, haloalkyl, and alkoxy; benzyl optionally
substituted with one or two substituents independently selected
from the group consisting of alkyl, cycloalkyl, halogen, cyano,
amino, alkylamino, dialkylamino, hydroxy, nitro, haloalkyl, and
alkoxy; and benzyloxyalkyl. More preferably, R.sup.12 is selected
from the group consisting of straight chain C.sub.1-6 alkyl;
branched chain C.sub.3-6 alkyl; hydroxy(C.sub.1-6)alkyl; C.sub.3-6
cycloalkyl; 5-7-membered heterocyclo(C.sub.1-4)alkyl; phenyl
optionally substituted with one or two substituents independently
selected from the group consisting of C.sub.1-6 alkyl, C.sub.3-6
cycloalkyl, halogen, cyano, amino, C.sub.1-3 alkylamino,
di(C.sub.1-3)alkylamino, hydroxy, nitro, halo(C.sub.1-6)alkyl, and
C.sub.1-6 alkoxy; benzyl optionally substituted with one or two
substituents independently selected from the group consisting of
C.sub.1-6 alkyl, C.sub.3-6 cycloalkyl, halogen, cyano, amino,
C.sub.1-3 alkylamino, di(C.sub.1-3)alkylamino, hydroxy, nitro,
halo(C.sub.1-6)alkyl, and C.sub.1-6 alkoxy; and
benzyloxy(C.sub.1-3)alkyl. Advantageously, R.sup.12 is methyl;
propyl; iso-propyl; butyl; tert-butyl; sec-butyl; iso-butyl;
hydroxymethyl; 1-hydroxyethyl; tetrahydropyran-4-ylmethyl; phenyl
optionally substituted with one or two substituents independently
selected from the group consisting of methyl ethyl, propyl,
iso-propyl, butyl, tert-butyl, halogen, cyano, amino, methylamino,
dimethylamino, hydroxy, nitro, and trifluoromethyl; benzyl
optionally substituted with one or two substituents independently
selected from the group consisting of methyl ethyl, propyl,
iso-propyl, butyl, tert-butyl, halogen, cyano, amino, methylamino,
dimethylamino, hydroxy, nitro, and trifluoromethyl;
1-benzyloxyethyl; cyclopentyl; cyclohexyl; cyclopentylmethyl; or
cyclohexylmethyl.
[0156] Useful compounds include those where R.sup.11 and R.sup.12
together with the carbon atom to which they are attached form a
C.sub.3-6 cycloalkyl group, which is preferably cyclopentyl or
cyclohexyl.
[0157] Useful compounds of any of Formulae I-IV include those where
R.sup.9 is hydrogen and R.sup.10 is hydrogen, alkyl, hydroxyalkyl
(e.g., 2-hydroxyethyl), or cycloalkyl (e.g., cyclohexyl); or
R.sup.9 and R.sup.10 together with the nitrogen atom to which they
are attached form a heterocyclic ring (e.g., 1-piperidinyl);
R.sup.11 is hydrogen, and R.sup.12 is hydrogen, alkyl, cycloalkyl
(e.g., cyclohexyl), heterocycloalkyl (e.g.,
4-(2,3,5,6-tetrahydropyranyl)methyl), or benzyl optionally
substituted with one or two substituents each independently
selected from the group consisting of alkyl, haloalkyl, halogen,
hydroxy, hydroxyalkyl, alkoxy and cyano.
[0158] In one embodiment, compounds useful in the present invention
are compounds of any of Formulae I-IV, wherein Z is Z.sup.3 and
R.sup.9 is selected from the group consisting of alkyl, optionally
substituted aryl, optionally substituted arylalkyl, optionally
substituted heteroaryl, optionally substituted heteroarylalkyl, and
--CH.sub.2--U--V, wherein U is CH.sub.2, CHF, CF.sub.2 or CHOH and
V is hydrogen, alkyl, or alkenyl; and R.sup.10 is selected from the
group consisting of hydrogen, alkyl, alkenyl, optionally
substituted cycloalkyl, optionally substituted aryl, optionally
substituted arylalkyl, optionally substituted heteroaryl, and
optionally substituted heteroarylalkyl; or
[0159] R.sup.9 and R.sup.10 together with the nitrogen atom to
which they are attached form a heterocyclic ring to give Z.sup.31
having the structure:
##STR00020##
where
[0160] A is CH.sub.2, CHF, CF.sub.2 or CHOH;
[0161] B is CH.sub.2, O, or N--R.sup.51, where R.sup.51 is CH.sub.3
or C(O)CH.sub.3; and
[0162] s is 0, 1, or 2;
[0163] r is 0 or 1; and
[0164] R.sup.11 and R.sup.12 together form .dbd.O; or
[0165] R.sup.11 and R.sup.12 are each independently selected from
the group consisting of hydrogen, alkyl, and alkenyl or together
with the carbon atom to which they are attached form a saturated or
unsaturated C.sub.3-7 cycloalkyl ring optionally substituted with
one or more substituents each independently selected from the group
consisting of alkyl, hydroxy, hydroxyalkyl, amino, carboxy,
alkoxycarbonyl, alkylamino, dialkylamino, phenyl, and .dbd.O,
wherein one or more carbon atoms of the C.sub.3-7 cycloalkyl ring
are optionally replaced with NR.sup.19, O, S, or SO.sub.2, wherein
R.sup.19 is hydrogen or C.sub.1-3 alkyl, to form a heterocyclic
ring. In this embodiment, useful compounds include those where
R.sup.11 and R.sup.12 together form a C.sub.3-6 carbocyclic ring.
Further useful compounds include those where Z.sup.3 is Z.sup.32
having the structure:
##STR00021##
where R.sup.9, R.sup.10, and r are as defined above, K is selected
from the group consisting of CH.sub.2, O, S, SO.sub.2, and
NR.sup.19, and v is 0, 1, or 2.
[0166] In one embodiment, compounds useful in the present invention
are those where Z is Z.sup.3, R.sup.11 and R.sup.12 are both
hydrogen and R.sup.10 and R.sup.1 together form a bridge -D-E-G-
represented by Formula V:
##STR00022##
where R.sup.2, R.sup.9, D, E, G, and m are as defined above and w
is 1 or 2. Preferably, R.sup.9 is optionally substituted C.sub.6-10
aryl or optionally substituted heteroaryl having 5-10 ring atoms.
Useful compounds of Formula V include those where R.sup.9 selected
from the group consisting of phenyl, naphthyl, indenyl, isoindenyl,
pyridyl, pyrimidinyl, pyrazinyl, pyridazinyl, triazinyl, pyrrolyl,
pyrazolyl, and benzothiazolyl, all of which can be optionally
substituted. Preferably, R.sup.9 is optionally substituted phenyl
or pyridyl. In one embodiment, R.sup.9 is unsubstituted phenyl or
phenyl substituted with one, two, or three substituents each
independently selected from the group consisting of alkyl, alkoxy,
halogen, haloalkyl, hydroxy, hydroxyalkyl, cyano, amino,
aminoalkyl, alkylamino, dialkylamino, and hydroxyalkylamino. In
another embodiment, R.sup.9 is pyridyl that is unsubstituted or
substituted with one or two substituents each independently
selected from the group consisting of alkyl, haloalkyl, halogen,
hydroxy, hydroxyalkyl, alkoxy, and cyano.
[0167] Useful compounds of Formula V include those where m is 1.
Further useful compounds of Formula V include those where w is 1.
Preferable compounds of Formula V include those where m and w are
both 1 and a) D is absent and E and G are both CH.sub.2; or b) D, E
and G are each CH.sub.2.
[0168] In one embodiment, compounds useful in the present invention
are those where Z is Z.sup.3; R.sup.11 and R.sup.12 together form
.dbd.O; R.sup.9 is selected from the group consisting of alkyl,
optionally substituted aryl, optionally substituted arylalkyl,
optionally substituted heteroaryl, optionally substituted
heteroarylalkyl, and --CH.sub.2--U--V, wherein U is CH.sub.2, CHF,
CF.sub.2 or CHOH and V is hydrogen, alkyl, or alkenyl; and R.sup.10
and R.sup.1 together form a bridge -D-E-G-, wherein D is CH.sub.2,
C(O), CHCH.sub.3, C(CH.sub.3).sub.2 or absent; E is CH.sub.2, C(O),
C(S), CHF, CF.sub.2, or CHOH; and G is CH.sub.2, C(O), CHCH.sub.3,
C(CH.sub.3).sub.2 or absent.
[0169] The present invention is also directed to compounds of
Formula VI as follows:
##STR00023##
where R.sup.2, R.sup.9, D, E, G, and m are as defined above for
Formula V and w is 0. Preferably, R.sup.2, R.sup.9, D, E, G and m
as defined above for Formula V. One group of compounds useful in
this aspect of the invention are compounds of Formula VI as defined
above with the proviso that R.sup.2 is not C.sub.1-6 alkyl.
[0170] Preferably, in compounds of Formulae I-IV, R.sup.1 is
selected from the group consisting of hydrogen, C.sub.1-6 alkyl,
halo(C.sub.1-6)alkyl, C.sub.1-4 alkoxy(C.sub.1-6)alkyl,
halo(C.sub.1-4)alkoxy(C.sub.1-6)alkyl, hydroxy(C.sub.1-6)alkyl,
amino(C.sub.1-6)alkyl, C.sub.1-4 alkylamino(C.sub.1-6)alkyl,
di(C.sub.1-4)alkylamino(C.sub.1-6)alkyl, and C.sub.3-7 cycloalkyl;
and more preferably selected from the group consisting of hydrogen,
C.sub.1-6 alkyl, and C.sub.3-7 cycloalkyl.
[0171] Preferably, in compounds of Formulae I-VI, R.sup.2 is
selected from the group consisting of [0172] a) cycloalkyl; [0173]
b) aryl optionally substituted with one, two or three substituents
each independently selected from the group consisting of alkyl,
alkoxy, alkoxycarbonyl, cyano, halogen, haloalkyl, haloalkoxy,
hydroxy, hydroxyalkyl, amino, alkylamino, dialkylamino,
hydroxyalkylamino, --C(O)OR.sup.20, and --C(O)NR.sup.20R.sup.21,
wherein R.sup.20 and R.sup.21 are each independently selected from
the group consisting of hydrogen, alkyl, alkenyl, optionally
substituted heterocyclo, optionally substituted cycloalkyl,
optionally substituted aryl, optionally substituted arylalkyl,
optionally substituted heteroaryl, optionally substituted
heteroarylalkyl, and --CH.sub.2--U--V, wherein U is CH.sub.2, CHF,
CF.sub.2 or CHOH and V is hydrogen, alkyl, alkenyl or aryl; [0174]
c) heteroaryl optionally substituted with one, two or three
substituents each independently selected from the group consisting
of alkyl, alkoxy, hydroxy, hydroxyalkyl, cyano, amino, alkylamino,
dialkylamino, hydroxyalkylamino, alkoxycarbonyl, carboxy,
alkylcarbonylamino, alkylcarbonylaminoalkyl, halogen, haloalkyl,
phenyl, phenoxy, heteroaryl, and heterocyclo; and [0175] d)
di(C.sub.1-6)alkylamino.
[0176] More preferably, R.sup.2 is phenyl or pyridyl unsubstituted
or substituted with one or two substituents each independently
selected from the group consisting of alkyl, alkoxy, halogen,
haloalkyl, hydroxy, hydroxyalkyl, cyano, amino, alkylamino,
dialkylamino and hydroxyalkylamino. In one embodiment, R.sup.2 is
phenyl substituted with alkyl, alkoxy, halogen, haloalkyl, hydroxy,
hydroxyalkyl, cyano, amino, alkylamino, dialkylamino,
hydroxyalkylamino, --C(O)OR.sup.20, and --C(O)NR.sup.20R.sup.21,
wherein R.sup.20 and R.sup.21 are each independently selected from
the group consisting of hydrogen, alkyl, alkenyl, optionally
substituted heterocyclo, optionally substituted cycloalkyl,
optionally substituted aryl, optionally substituted arylalkyl,
optionally substituted heteroaryl, optionally substituted
heteroarylalkyl, and --CH.sub.2--U--V, wherein U is CH.sub.2, CHF,
CF.sub.2 or CHOH and V is hydrogen, alkyl, alkenyl or aryl;
preferably substituted with C.sub.1-4 alkyl, C.sub.1-4 alkoxy,
halo(C.sub.1-4)alkyl, halogen, cyano, hydroxy,
hydroxy(C.sub.1-4alkyl, carboxy, C.sub.1-4 alkyloxycarbonyl,
aminocarbonyl, C.sub.1-4 alkylaminocarbonyl, or
di(C.sub.1-4)alkylaminocarbonyl; and more preferably substituted
with haloalkyl, especially trifluoromethyl. Preferably, the
substituent is in the meta-position of the phenyl ring. In one
embodiment, R.sup.2 is pyridyl unsubstituted or substituted with
alkyl, alkoxy, halogen, haloalkyl, hydroxy, hydroxyalkyl, cyano,
amino, alkylamino, dialkylamino or hydroxyalkylamino; preferably
substituted with C.sub.1-4 alkyl, C.sub.1-4 alkoxy,
halo(C.sub.1-4)alkyl, halogen, cyano, hydroxy,
hydroxy(C.sub.1-4)alkyl; and more preferably substituted with
haloalkyl, especially trifluoromethyl.
[0177] Useful alkyl groups for R.sup.2 include straight chain or
branched C.sub.1-6 alkyl, preferably methyl, ethyl, n-propyl,
iso-propyl, n-butyl, sec-butyl, tert-butyl, n-pentyl, and
2-pentyl.
[0178] Useful cycloalkyl groups for R.sup.2 include C.sub.3-7
cycloalkyl groups, especially cyclopropyl, cyclopentyl, and
cyclohexyl.
[0179] Useful aryl groups for R.sup.2 include C.sub.6-10 aryl
groups optionally substituted with one, two or three substituents
each independently selected from the group consisting of alkyl,
alkoxy, alkoxycarbonyl, cyano, halogen, haloalkyl, haloalkoxy,
hydroxy, hydroxyalkyl, amino, alkylamino, dialkylamino and
hydroxyalkylamino; preferably phenyl or naphthyl optionally
substituted with one, two or three substituents each independently
selected from the group consisting of alkyl, alkoxy,
alkoxycarbonyl, cyano, halogen, haloalkyl, haloalkoxy, hydroxy,
hydroxyalkyl, amino, alkylamino, dialkylamino and
hydroxyalkylamino; especially unsubstituted phenyl or phenyl
substituted with one, two, or three substituents each independently
selected from the group alkyl, alkoxy, alkoxycarbonyl, cyano,
halogen, haloalkyl, amino, alkylamino, dialkylamino and
hydroxyalkylamino; preferably unsubstituted phenyl or phenyl
substituted with one, two or three substituents each independently
selected from the group consisting of C.sub.1-4 alkyl, C.sub.1-4
alkoxy, cyano, halogen, halo(C.sub.1-4)alkyl, hydroxy, and
hydroxy(C.sub.1-4alkyl; and preferably phenyl substituted with one
or two substituents each independently selected from the group
consisting of methyl, ethyl, isopropyl, tert-butyl, n-butyl,
methoxy, ethoxy, cyano, chlorine, fluorine, bromine, chloromethyl,
chloroethyl, fluoromethyl, fluoroethyl, difluoromethyl,
1,1-difluoroethyl, 2,2-difluoroethyl, trifluoromethyl,
2,2,2-trifluoroethyl, hydroxy, hydroxymethyl, and
2-hydroxyethyl.
[0180] Useful heteroaryl groups for R.sup.2 include 5- to
14-membered heteroaryl groups optionally substituted with one, two
or three substituents each independently selected from the group
consisting of alkyl, alkoxy, alkoxycarbonyl, cyano, halogen,
haloalkyl, haloalkoxy, hydroxy, hydroxyalkyl, carboxy, amino,
alkylamino, dialkylamino, hydroxyalkylamino, alkylcarbonylamino,
alkylcarbonylaminoalkyl, phenyl, phenoxy, heterocyclo and
heteroaryl. Suitable heteroaryl groups include, for example,
thiazolyl, thiadiazolyl, thiophenyl, isooxazolyl, benzothiazolyl,
imidazolyl, benzoxazolyl, pyridyl, pyrimidinyl, quinolinyl,
triazolyl, pyrazolyl, benzothiadiazolyl, furyl, benzofuranyl,
diazolyl, and benzothiophenyl optionally substituted with one, two
or three substituents each independently selected from the group
consisting of alkyl, alkoxy, alkoxycarbonyl, cyano, halogen,
haloalkyl, haloalkoxy, hydroxy, hydroxyalkyl, carboxy, amino,
alkylamino, dialkylamino, hydroxyalkylamino, alkylcarbonylamino,
alkylcarbonylaminoalkyl, phenyl, phenoxy, heterocyclo and
heteroaryl. Suitable heteroaryl groups include 2-, 3-, or 4-pyridyl
optionally substituted with one or two substituents each
independently selected from the group consisting of
alkyloxycarbonyl, 4-morpholinyl, phenoxy, halogen, alkoxy, alkyl,
hydroxy, hydroxyalkyl, cyano, and haloalkyl.
[0181] Useful di(C.sub.1-6)alkylamino groups for R.sup.2 include
di(C.sub.1-4)alkylamino groups, such as dimethylamino and
diethylamino.
[0182] Useful optionally substituted heteroaryl groups for R.sup.5
include 1-, 2-, or 3-pyridyl, 2-pyrazinyl, and 3-isoxazolyl.
[0183] Exemplary preferred compounds useful in the present
invention include: [0184]
N-(4-fluorophenyl)-2-[1-(3-trifluoromethyl-benzenesulfonyl)piperidin-4-yl-
amino]acetamide; [0185]
2-{cyclopropyl-[1-(3-trifluoromethyl-benzenesulfonyl)piperidin-4-yl]amino-
}-N-(4-fluorophenyl)acetamide; [0186]
N-(4-fluorophenyl)-2-[1-(3-trifluoromethyl-benzenesulfonyl)-pyrrolidin-3--
ylamino]acetamide; [0187]
N-(3,5-bis-(trifluoromethyl)phenyl)-2-[1-(3-trifluoromethyl-benzenesulfon-
yl)piperidin-4-ylamino]acetamide; [0188]
N-(2,4-difluorophenyl)-N'-[1-(3-trifluoromethylbenzenesulfonyl)-piperidin-
-4-yl]malonamide;
[0189] and the pharmaceutically acceptable salts, prodrugs and
solvates thereof.
[0190] Useful cycloalkyl groups are selected from C.sub.3-12
cycloalkyl. Typical cycloalkyl groups include cyclopropyl,
cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, and
cyclooctyl.
[0191] Useful halo or halogen groups include fluorine, chlorine,
bromine and iodine.
[0192] Useful alkyl groups are selected from straight-chained and
branched C.sub.1-10 alkyl groups, more preferably straight chain
C.sub.1-6 alkyl groups and branched chain C.sub.1-6 alkyl groups.
Typical C.sub.1-10 alkyl groups include methyl, ethyl, propyl,
isopropyl, butyl, sec-butyl, tert-butyl, iso-butyl, 3-pentyl, hexyl
and octyl, among others.
[0193] Useful alkenyl groups are selected from C.sub.2-6 alkenyl
groups, preferably C.sub.2-4 alkenyl. Typical C.sub.2-4 alkenyl
groups include ethenyl, propenyl, isopropenyl, butenyl, and
sec-butenyl.
[0194] Useful alkynyl groups are selected from C.sub.2-6 alkynyl
groups, preferably C.sub.2-4 alkynyl. Typical C.sub.2-4 alkynyl
groups include ethynyl, propynyl, butynyl, and 2-butynyl
groups.
[0195] Useful arylalkyl groups include any of the above-mentioned
C.sub.1-10 alkyl groups substituted by any of the C.sub.6-14 aryl
groups mentioned below. Typical arylalkyl groups include benzyl,
phenethyl, and naphthylmethyl.
[0196] Useful arylalkenyl groups include any of the above-mentioned
C.sub.2-6 alkenyl groups substituted by any of the C.sub.6-14 aryl
groups mentioned below.
[0197] Useful arylalkynyl groups include any of the above-mentioned
C.sub.2-6 alkynyl groups substituted by any of the C.sub.6-14 aryl
groups mentioned below.
[0198] Useful cycloalkylalkyl groups include any of the
above-mentioned C.sub.1-10 alkyl groups substituted by any of the
above-mentioned cycloalkyl groups.
[0199] Useful haloalkyl groups include any of the above-mentioned
C.sub.1-10 alkyl groups substituted by one or more fluorine,
chlorine, bromine or iodine atoms (e.g., fluoromethyl,
difluoromethyl, trifluoromethyl, pentafluoroethyl,
1,1-difluoroethyl and trichloromethyl groups).
[0200] Useful hydroxyalkyl groups include any of the
above-mentioned C.sub.1-10 alkyl groups substituted by hydroxy
(e.g., hydroxymethyl, hydroxyethyl, hydroxypropyl and hydroxybutyl
groups, and especially hydroxymethyl, 1-hydroxyethyl,
2-hydroxypropyl, 3-hydroxybutyl, and 2-hydroxy-1-methylpropyl).
[0201] Useful alkoxy groups include oxygen substituted by one of
the C.sub.1-10 alkyl groups mentioned above.
[0202] Useful alkoxyalkyl groups include any of the above-mentioned
C.sub.1-10 alkyl groups substituted with any of the above-mentioned
alkoxy groups.
[0203] Useful haloalkoxy groups include oxygen substituted by one
of the C.sub.1-10 haloalkyl groups mentioned above (e.g.,
fluoromethoxy, difluoromethoxy, and trifluoromethoxy).
[0204] Useful aryl groups are C.sub.6-14 aryl, especially
C.sub.6-10 aryl. Typical C.sub.6-14 aryl groups include phenyl,
naphthyl, phenanthryl, anthracyl, indenyl, azulenyl, biphenyl,
biphenylenyl, and fluorenyl groups, more preferably phenyl,
naphthyl, and biphenyl groups.
[0205] The term "heteroaryl" as employed herein refers to groups
having 5 to 14 ring atoms, with 6, 10 or 14.pi. electrons shared in
a cyclic array, and containing carbon atoms and 1, 2, or 3 oxygen,
nitrogen or sulfur heteroatoms. Examples of heteroaryl groups
include thienyl, benzo[b]thienyl, naphtho[2,3-b]thienyl,
thianthrenyl, furyl, benzofuryl, pyranyl, isobenzofuranyl,
benzooxazonyl, chromenyl, xanthenyl, 2H-pyrrolyl, pyrrolyl,
imidazolyl, pyrazolyl, pyridyl, pyrazinyl, pyrimidinyl,
pyridazinyl, isoindolyl, 3H-indolyl, indolyl, indazolyl, purinyl,
isoquinolyl, quinolyl, phthalazinyl, naphthyridinyl, cinnolinyl,
quinazolinyl, pteridinyl, 4aH-carbazolyl, carbazolyl,
.beta.-carbolinyl, phenanthridinyl, acridinyl, pyrimidinyl,
phenanthrolinyl, phenazinyl, thiazolyl, isothiazolyl,
phenothiazolyl, isoxazolyl, furazanyl, and phenoxazinyl. Preferred
heteroaryl groups include thienyl, furyl, pyrrolyl, imidazolyl,
pyrazolyl, pyridyl, pyrimidinyl, thiazolyl, isothiazolyl, and
isoxazolyl.
[0206] Useful heteroarylalkyl groups include any of the
above-mentioned C.sub.1-10 alkyl groups substituted by any of the
heteroaryl groups mentioned below. Useful values include, for
example, 2-pyridylmethyl, 3-pyridylmethyl, 4-pyridylmethyl.
[0207] The terms "heterocyclic" and "heterocyclo" are used herein
to mean saturated or wholly or partially unsaturated 3-7 membered
monocyclic, or 7-10 membered bicyclic ring system, which consist of
carbon atoms and from one to four heteroatoms independently
selected from the group consisting of O, N, and S, wherein the
nitrogen and sulfur heteroatoms can be optionally oxidized, the
nitrogen can be optionally quaternized, and including any bicyclic
group in which any of the above-defined heterocyclic rings is fused
to a benzene ring, and wherein the heterocyclic ring can be
substituted on a carbon atom or on a nitrogen atom if the resulting
compound is stable. Examples include, but are not limited to,
pyrrolidine, piperidine, piperazine, morpholine, imidazoline,
pyrazolidine, benzodiazepines, and the like.
[0208] Useful heterocycloalkyl groups include any of the
above-mentioned C.sub.1-10 alkyl groups substituted by any of the
above-mentioned heterocyclic groups.
[0209] As used herein, the term "amino" or "amino group" refers to
--NH.sub.2.
[0210] Useful aminoalkyl groups include any of the above-mentioned
C.sub.1-10 alkyl groups substituted with an amino group.
[0211] Useful diaminoalkyl groups include any of the
above-mentioned C.sub.1-10 alkyl groups substituted with two amino
groups.
[0212] Useful alkylamino and dialkylamino groups are --NHR.sup.22
and --NR.sup.22R.sup.23, respectively, wherein R.sup.22 and
R.sup.23 are each independently selected from a C.sub.1-10 alkyl
group.
[0213] Useful alkylaminoalkyl and dialkylaminoalkyl groups are any
of the above-mentioned C.sub.1--10 alkyl groups substituted by any
of the above-mentioned alkylamino and dialkylamino groups,
respectively.
[0214] Useful aminocarbonylalkyl groups include any of the
above-mentioned C.sub.1-10 alkyl groups substituted with an
aminocarbonyl group, i.e., --C(O)NH.sub.2.
[0215] Useful alkylcarbonyl groups include a carbonyl group, i.e.,
--C(O)--, substituted by any of the above-mentioned C.sub.1-10
alkyl groups.
[0216] Useful alkylcarbonylamino groups include any of the
above-mentioned alkylcarbonyl groups attached to an amino nitrogen,
such as methylcarbonylamino.
[0217] Useful mercaptoalkyl groups include any of the
above-mentioned C.sub.1-10 alkyl groups substituted by a --SH
group.
[0218] As used herein, the term "carboxy" refers to --COOH.
[0219] Useful carboxyalkyl groups include any of the
above-mentioned C.sub.1-10 alkyl groups substituted by --COOH.
[0220] As used herein, the term "ureido" refers to
--NH--C(O)--NH.sub.2.
[0221] As used herein, the term "azido" refers to --N.sub.3.
[0222] As used herein, the term "optionally substituted" refers to
a group that may be unsubstituted or substituted.
[0223] Optional substituents on optionally substituted groups, when
not otherwise indicated, include one or more groups, preferably 1,
2, or 3 groups, independently selected from the group consisting of
halo, halo(C.sub.1-6)alkyl, aryl, heterocycle, cycloalkyl,
C.sub.1-6 alkyl, C.sub.2-6 alkenyl, C.sub.2-6 alkynyl,
aryl(C.sub.1-6)alkyl, aryl(C.sub.2-6)alkenyl,
aryl(C.sub.2-6)alkynyl, cycloalkyl(C.sub.1-6)alkyl,
heterocyclo(C.sub.1-6)alkyl, hydroxy(C.sub.1-6)alkyl,
amino(C.sub.1-6)alkyl, carboxy(C.sub.1-6)alkyl,
alkoxy(C.sub.1-6)alkyl, nitro, amino, ureido, cyano,
alkylcarbonylamino, hydroxy, thiol, alkylcarbonyloxy, azido,
alkoxy, carboxy, aminocarbonyl, and mercapto(C.sub.1-6)alkyl groups
mentioned above. Preferred optional substituents include halo,
halo(C.sub.1-6)alkyl, hydroxy(C.sub.1-6)alkyl,
amino(C.sub.1-6)alkyl, hydroxy, nitro, C.sub.1-6 alkyl, alkoxy, and
amino.
[0224] The invention disclosed herein is also meant to encompass
prodrugs of any of the disclosed compounds. As used herein,
prodrugs are considered to be any covalently bonded carriers that
release the active parent drug in vivo. Non-limiting examples of
prodrugs include esters or amides of compounds of any of Formulae
I-VI having hydroxyalkyl or aminoalkyl as a substituent, and these
may be prepared by reacting such parent compounds with anhydrides
such as succinic anhydride.
[0225] The invention disclosed herein is also intended to encompass
any of the disclosed compounds being isotopically-labelled (i.e.,
radiolabeled) by having one or more atoms replaced by an atom
having a different atomic mass or mass number. Examples of isotopes
that can be incorporated into the disclosed compounds include
isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorous,
fluorine and chlorine, such as .sup.2H, .sup.3H, .sup.11C,
.sup.13C, .sup.14C, .sup.15N, .sup.18O, .sup.17O, .sup.31P,
.sup.32P, .sup.35S, .sup.18F, and .sup.36Cl, respectively, and
preferably .sup.3H, .sup.11C, and .sup.14C. Isotopically-labeled
compounds of the present invention can be prepared by methods known
in the art.
[0226] The present invention is also directed specifically to
.sup.3H, .sup.11C, or .sup.14C radiolabeled compounds of any of
Formulae I-VI, as well as their pharmaceutically acceptable salts,
prodrugs and solvates, and the use of any such compounds as
radioligands for their binding site on the calcium channel. For
example, one use of the labeled compounds of the present invention
is the characterization of specific receptor binding. Another use
of a labeled compound of the present invention is an alternative to
animal testing for the evaluation of structure-activity
relationships. For example, the receptor assay may be performed at
a fixed concentration of a labeled compound of the invention and at
increasing concentrations of a test compound in a competition
assay. For example, a tritiated compound of any of Formulae I-VI
can be prepared by introducing tritium into the particular
compound, for example, by catalytic dehalogenation with tritium.
This method may include reacting a suitably halogen-substituted
precursor of the compound with tritium gas in the presence of a
suitable catalyst, for example, Pd/C, in the presence or absence of
a base. Other suitable methods for preparing tritiated compounds
can be found in Filer, Isotopes in the Physical and Biomedical
Sciences, Vol. 1, Labeled Compounds (Part A), Chapter 6 (1987).
.sup.14C-labeled compounds can be prepared by employing starting
materials having a .sup.14C carbon.
[0227] Some of the compounds disclosed herein may contain one or
more asymmetric centers and may thus give rise to enantiomers,
diastereomers, and other stereoisomeric forms. The present
invention is meant to encompass the uses of all such possible
forms, as well as their racemic and resolved forms and mixtures
thereof. The individual enantiomers may be separated according to
methods known to those of ordinary skill in the art in view of the
present disclosure. When the compounds described herein contain
olefinic double bonds or other centers of geometric asymmetry, and
unless specified otherwise, it is intended that they include both E
and Z geometric isomers. All tautomers are intended to be
encompassed by the present invention as well.
[0228] As used herein, the term "stereoisomers" is a general term
for all isomers of individual molecules that differ only in the
orientation of their atoms in space. It includes enantiomers and
isomers of compounds with more than one chiral center that are not
mirror images of one another (diastereomers).
[0229] The term "chiral center" refers to a carbon atom to which
four different groups are attached.
[0230] The terms "enantiomer" and "enantiomeric" refer to a
molecule that cannot be superimposed on its mirror image and hence
is optically active wherein the enantiomer rotates the plane of
polarized light in one direction and its mirror image compound
rotates the plane of polarized light in the opposite direction.
[0231] The term "racemic" refers to a mixture of equal parts of
enantiomers and which mixture is optically inactive.
[0232] The term "resolution" refers to the separation or
concentration or depletion of one of the two enantiomeric forms of
a molecule.
[0233] The terms "a" and "an" refer to one or more.
[0234] The term "treating" or "treatment" is meant to encompass
administering to a subject a compound of the present invention for
the purposes of amelioration or cure, including preemptive and
palliative treatment.
[0235] The invention disclosed herein also encompasses the use of
salts of the disclosed compounds, including all non-toxic
pharmaceutically acceptable salts thereof of the disclosed
compounds. Examples of pharmaceutically acceptable addition salts
include inorganic and organic acid addition salts and basic salts.
The pharmaceutically acceptable salts include, but are not limited
to, metal salts such as sodium salt, potassium salt, cesium salt
and the like; alkaline earth metals such as calcium salt, magnesium
salt and the like; organic amine salts such as triethylamine salt,
pyridine salt, picoline salt, ethanolamine salt, triethanolamine
salt, dicyclohexylamine salt, N,N'-dibenzylethylenediamine salt and
the like; inorganic acid salts such as hydrochloride, hydrobromide,
phosphate, sulphate and the like; organic acid salts such as
citrate, lactate, tartrate, maleate, fumarate, mandelate, acetate,
dichloroacetate, trifluoroacetate, oxalate, formate and the like;
sulfonates such as methanesulfonate, benzenesulfonate,
p-toluenesulfonate and the like; and amino acid salts such as
arginate, asparginate, glutamate and he like.
[0236] Acid addition salts can be formed by mixing a solution of
the particular compound of the present invention with a solution of
a pharmaceutically acceptable non-toxic acid such as hydrochloric
acid, fumaric acid, maleic acid, succinic acid, acetic acid, citric
acid, tartaric acid, carbonic acid, phosphoric acid, oxalic acid,
dichloroacetic acid, or the like. Basic salts can be formed by
mixing a solution of the compound of the present invention with a
solution of a pharmaceutically acceptable non-toxic base such as
sodium hydroxide, potassium hydroxide, choline hydroxide, sodium
carbonate and the like.
[0237] The invention disclosed herein is also meant to encompass
solvates of any of the disclosed compounds. One type of solvate is
a hydrate. Solvates typically do not significantly alter the
physiological activity or toxicity of the compounds, and as such
may function as pharmacological equivalents.
[0238] Since compounds of Formulae I-VI are blockers of calcium
(Ca.sup.2+) channels, a number of diseases and conditions mediated
by calcium ion influx can be treated by employing these compounds.
The present invention is thus directed generally to a method for
treating a disorder responsive to the blockade of calcium channels,
and particularly the selective blockade of N-type calcium channels,
in an animal suffering from, or at risk of suffering from, said
disorder, said method comprising administering to the animal an
effective amount of a compound represented by any of defined
Formulae I-VI, or a pharmaceutically acceptable salt, prodrug or
solvate thereof.
[0239] The present invention is further directed to a method of
modulating calcium channels, especially N-type calcium channels, in
an animal in need thereof, said method comprising administering to
the animal at least one compound represented by any of defined
Formulae I-VI, or a pharmaceutically acceptable salt, prodrug or
solvate thereof.
[0240] More specifically, the present invention provides a method
of treating stroke, the neuronal damage resulting from head trauma,
epilepsy, pain (e.g., acute pain, chronic pain, which includes but
is not limited to neuropathic pain and inflammatory pain, or
surgical pain), migraine, a mood disorder, schizophrenia, a
neurodegenerative disorder (e.g., Alzheimer's disease, amyotrophic
lateral sclerosis (ALS), or Parkinson's disease), depression,
anxiety, a psychosis, hypertension, or cardiac arrhythmia. In one
embodiment, the invention provides a method of treating pain. In
another embodiment, the type of pain treated is chronic pain. In
another embodiment, the type of pain treated is neuropathic pain.
In another embodiment, the type of pain treated is inflammatory
pain. In another embodiment, the type of pain treated is surgical
pain. In another embodiment, the type of pain treated is acute
pain. In another embodiment, the treatment of pain (e.g., chronic
pain, such as neuropathic pain or inflammatory pain, acute pain or
surgical pain) is preemptive. In another embodiment, the treatment
of pain is palliative. In each instance, such method of treatment
requires administering to an animal in need of such treatment an
amount of a compound of the present invention that is
therapeutically effective in achieving said treatment. In one
embodiment, the amount of such compound is the amount that is
effective as to block calcium channels in vivo.
[0241] Chronic pain includes, but is not limited to, inflammatory
pain, postoperative pain, cancer pain, osteoarthritis pain
associated with metastatic cancer, trigeminal neuralgia, acute
herpetic and postherpetic neuralgia, diabetic neuropathy,
causalgia, brachial plexus avulsion, occipital neuralgia, reflex
sympathetic dystrophy, fibromyalgia, gout, phantom limb pain, burn
pain, and other forms of neuralgia, neuropathic, and idiopathic
pain syndromes.
[0242] Chronic somatic pain generally results from inflammatory
responses to tissue injury such as nerve entrapment, surgical
procedures, cancer or arthritis (Brower, Nature Biotechnology 2000;
18: 387-391).
[0243] The inflammatory process is a complex series of biochemical
and cellular events activated in response to tissue injury or the
presence of foreign substances (Levine, Inflammatory Pain, In:
Textbook of Pain, Wall and Melzack eds., 3.sup.rd ed., 1994).
Inflammation often occurs at the site of injured tissue, or foreign
material, and contributes to the process of tissue repair and
healing. The cardinal signs of inflammation include erythema
(redness), heat, edema (swelling), pain and loss of function
(ibid.). The majority of patients with inflammatory pain do not
experience pain continually, but rather experience enhanced pain
when the inflamed site is moved or touched. Inflammatory pain
includes, but is not limited to, that associated with
osteoarthritis and rheumatoid arthritis.
[0244] Chronic neuropathic pain is a heterogenous disease state
with an unclear etiology. In chronic neuropathic pain, the pain can
be mediated by multiple mechanisms. This type of pain generally
arises from injury to the peripheral or central nervous tissue. The
syndromes include pain associated with spinal cord injury, multiple
sclerosis, post-herpetic neuralgia, trigeminal neuralgia, phantom
pain, causalgia, and reflex sympathetic dystrophy and lower back
pain. Chronic pain is different from acute pain in that patients
suffer the abnormal pain sensations that can be described as
spontaneous pain, continuous superficial burning and/or deep aching
pain. The pain can be evoked by heat-, cold-, and
mechano-hyperalgesia or by heat-, cold-, or mechano-allodynia.
[0245] Neuropathic pain can be caused by injury or infection of
peripheral sensory nerves. It includes, but is not limited to, pain
from peripheral nerve trauma, herpes virus infection, diabetes
mellitus, causalgia, plexus avulsion, neuroma, limb amputation, and
vasculitis. Neuropathic pain is also caused by nerve damage from
chronic alcoholism, human immunodeficiency virus infection,
hypothyroidism, uremia, or vitamin deficiences. Stroke (spinal or
brain) and spinal cord injury can also induce neuropathic pain.
Cancer-related neuropathic pain results from tumor growth
compression of adjacent nerves, brain, or spinal cord. In addition,
cancer treatments, including chemotherapy and radiation therapy,
can also cause nerve injury. Neuropathic pain includes but is not
limited to pain caused by nerve injury such as, for example, the
pain from which diabetics suffer.
[0246] The present invention is also directed to the use of a
compound represented by any of defined Formulae I-VI, or a
pharmaceutically acceptable salt, prodrug or solvate thereof, in
the manufacture of a medicament for treating a disorder responsive
to the blockade of calcium channels (e.g., any of the disorders
listed above) in an animal suffering from said disorder. In one
embodiment, the disorder is responsive to the selective blockade of
N-type calcium channels.
[0247] Furthermore, the present invention is directed to a method
of modulating calcium channels, especially N-type calcium channels,
in an animal in need thereof, said method comprising administering
to the animal at least one compound represented by any defined
Formulae I-VI, or a pharmaceutically acceptable salt, prodrug or
solvate thereof.
[0248] The present invention is also directed to the use of a
compound represented by any of defined Formulae I-VI, or a
pharmaceutically acceptable salt, prodrug or solvate thereof, in
the manufacture of a medicament, in particular a medicament for
modulating calcium channels, especially N-type calcium channels, in
an animal in need thereof.
Synthesis of Compounds
[0249] The compounds of the present invention may be prepared using
methods known to those skilled in the art in view of this
disclosure. For example, compounds of Formula I where Z is Z.sup.1
can be prepared as shown in Schemes 1-4.
##STR00024##
where m, n, and R.sup.1-R.sup.6 are as defined above for Formula I,
and X is halogen, such as chlorine. The protecting group is removed
by HCl in an appropriate solvent and the free amine is reacted with
an appropriate chloride starting material to give the compounds of
Formula I. TEBAC (benzyltriethylammonium chloride) can be purchased
from ACROS.
[0250] Compounds of Formula I where Z is Z.sup.1 can be prepared as
follows:
##STR00025##
where R.sup.1, R.sup.2, R.sup.5, R.sup.6 and n are as defined for
Formula I and X is halogen, such as chlorine.
[0251] Compounds of Formula I where Z is Z.sup.1 can also be
prepared as shown in Scheme 3:
##STR00026##
where R.sup.1, R.sup.2, R.sup.5, R.sup.6 and m are as defined
above.
[0252] Further compounds of Formula I where Z is Z can be prepared
as follows:
##STR00027##
where R.sup.1, R.sup.2, R.sup.5, R.sup.6 and m are as defined for
Formula I. The reaction is conducted in the presence of diisopropyl
azodicarboxylate, triethylamine and 1-hydroxybenzotriazole in an
appropriate solvent, such as dichloromethane, at room temperature.
Suitable starting materials can be prepared, for example, as shown
in Examples 1 and 5 below.
[0253] A method for preparing compounds of Formula I where Z is
Z.sup.2 can be as follows:
##STR00028##
where R.sup.1, R.sup.2, R.sup.7, Y and m are as defined for Formula
I.
[0254] Compounds of Formula I where Z is Z.sup.3 and r is 0 can be
prepared as shown in Scheme 6:
##STR00029##
where R.sup.1, R.sup.2, R.sup.9-R.sup.12, and m are as defined
above for Formula I, and X is Cl, Br, I, or
--OSO.sub.2CF.sub.3.
[0255] Compounds of Formula V can be prepared as shown in Scheme
7:
##STR00030##
where R.sup.2, R.sup.9 and m are as defined above for Formula V;
w.sup.1 and w.sup.2 are each independently Cl, Br, or OH; w.sup.3
and w.sup.4 are each independently H, F, or OH, and t is 0 or 1.
Compounds of Formula VI can be prepared using a procedure similar
to that described above in Scheme 7 and appropriate reagents.
[0256] Further, compounds of Formula I where Z is Z.sup.3 can be
prepared as shown in Scheme 8:
##STR00031##
where R.sup.1 and R.sup.2 are as defined above for Formula I, R is
hydrogen, alkyl, hydroxyalkyl, alkoxyalkyl, haloalkyl, aminoalkyl,
cycloalkyl, optionally substituted phenyl, optionally substituted
benzyl, or benzyloxyalkyl and R.sup.1 is hydrogen, alkyl, alkenyl,
hydroxyalkyl, haloalkyl, aminoalkyl or phenyl.
[0257] Further, compounds of Formula I where Z is Z.sup.3 can be
prepared as shown in Scheme 9:
##STR00032##
where R.sup.1 and R.sup.2 are as defined above for Formula I, R is
hydrogen, alkyl, hydroxyalkyl, alkoxyalkyl, haloalkyl, aminoalkyl,
cycloalkyl, optionally substituted phenyl, optionally substituted
benzyl, or benzyloxyalkyl, and R'' is hydrogen, or R and R''
together with the carbon atom to which they are attached form a
C.sub.3-7 cycloalkyl group.
[0258] Further, compounds of Formula I where Z is Z.sup.3 can be
prepared as shown in Scheme 10:
##STR00033##
where R.sup.1 and R.sup.2 are as defined above for Formula I.
[0259] The method of Scheme 10 is similar to that described in
Scheme 8 except that the starting amino acid is a n-amino acid
instead of an .alpha.-amino acid.
Testing of Compounds
[0260] Compounds of the present invention were assessed by calcium
mobilization and/or electrophysiological assays for calcium channel
blocker activity. One aspect of the present invention is based on
the use of the compounds herein described as N-type calcium channel
blockers. In one aspect of the present invention, it has been found
that certain compounds herein described show selectivity as N-type
calcium channel blockers. Based upon this property, these compounds
are considered useful in treating stroke, neuronal damage resulting
from head trauma, migraine, epilepsy, a mood disorder,
schizophrenia, a neurodegenerative disorder (such as, e.g.,
Alzheimer's disease, ALS, or Parkinson's disease), a psychosis,
depression, anxiety, hypertension, or cardiac arrhythmia. The
compounds of the present invention are also expected to be
effective in treating pain, such as acute pain, chronic pain, which
includes but is not limited to neuropathic pain and inflammatory
pain, or surgical pain.
[0261] More specifically, the present invention is directed to
compounds of Formulae I-VI that are blockers of calcium channels.
According to the present invention, those compounds having
preferred N-type calcium channel blocking properties exhibit an
IC.sub.50 of about 100 .mu.M or less in the calcium mobilization
and/or electrophysiological assays described herein. Preferably,
the compounds of the present invention exhibit an IC.sub.50 of 10
.mu.M or less. More preferably, the compounds of the present
invention exhibit an IC.sub.50 of about 6 .mu.M or less. Most
preferably, the compounds of the present invention exhibit an
IC.sub.50 of about 1.0 .mu.M or less. Compounds of the present
invention can be tested for their N-type and L-type Ca.sup.2+
channel blocking activity by the following calcium mobilization
and/or electrophysiological assays.
[0262] In one embodiment, compounds useful in the present invention
are those represented by any one of Formulae I-VI that exhibit
selectivity for N-type calcium channels over L-type calcium
channels in the calcium mobilization and/or electrophysiological
assays described herein. The phrase "selectivity for N-type calcium
channels over L-type calcium channels" is used herein to mean that
the ratio of an IC.sub.50 for L-type channel blocking activity for
a compound of the present invention over an IC.sub.50 for N-type
channel blocking activity for the same compound is more than 1,
i.e., LTCC IC.sub.50/NTCC IC.sub.50>1. Preferably, compounds of
the present invention exhibit an LTCC IC.sub.50/NTCC IC.sub.50
ratio of about 2 or more, about 10 or more, about 20 or more, about
30 or more, about 50 or more, or about 100 or more.
Calcium Mobilization and Electrophysiological Assay Protocols:
[0263] Cell maintenance and differentiation. Unless noted
otherwise, cell culture reagents were purchased from Mediatech of
Herndon, Md. IMR32 cells (American Type Culture Collection, ATCC,
Manassas, Va.) were routinely cultured in growth medium consisting
of minimum essential medium containing 10% fetal bovine serum (FBS,
Hyclone, Logan, Utah), 100 U/mL penicillin, 100 .mu.g/mL
streptomycin, 2 mM L-glutamine, 1 mM sodium pyruvate, and
1.times.MEM non-essential amino acids. 80-90% confluent flasks of
cells were differentiated using the following differentiation
medium: Growth medium plus 1 mM dibutyryl cyclic AMP (Sigma, St.
Louis, Mo.), and 2.5 .mu.M bromodeoxyuridine (Sigma). Cells were
differentiated for 8 days by replacing differentiation medium every
2-3 days.
[0264] A7r5 (ATCC) cells were maintained and routinely cultured in
A7r5 growth medium consisting of Dulbecco's Modified Eagles Medium
containing 10% FBS, 100 U/mL penicillin, 100 .mu.g/mL streptomycin,
4 mM L-glutamine, and 0.15% sodium bicarbonate. 80-90% confluent
flasks of cells were differentiated using the following
differentiation medium: A7r5 Growth Medium plus 1 mM dibutyryl
cyclic AMP (Sigma). Cells were differentiated for 8 days by
replacing differentiation medium every 2-3 days.
[0265] Recombinant human embryonal kidney cells (HEK293, ATCC)
stably transfected with either N-type calcium channel (NTCC)
subunits (.alpha.1b, .alpha.2.delta., and .beta.3) or L-type
calcium channel (LTCC) subunits (.alpha.1c, .alpha.2.delta., and
.beta.1) were routinely cultured in growth medium consisting of
Dulbecco's Modified Eagles Medium containing 10% FBS, 100 U/mL
penicillin, 100 .mu.g/mL streptomycin, 4 mM L-glutamine, 500
.mu.g/mL geneticin (G418), 20 .mu.g/mL Blasticidin S (InVivogen,
San Diego, Calif.) and 500 .mu.g/mL zeocin (InVivogen).
[0266] FLIPR Calcium Mobilization Assay for N-type Calcium Channel.
One day prior to performing this assay, differentiated IMR32 cells
were treated with 1.times. CellStripper, and seeded on
poly-D-lysine-coated 96-well clear-bottom black plates (Becton
Dickinson, Franklin Lakes, N.J.) at 200,000 cells/well. On the day
of the assay, the cell plates were washed with IMR32 buffer (127 mM
NaCl, 1 mM KCl, 2 mM MgCl.sub.2, 700 .mu.M NaH.sub.2PO.sub.4, 5 mM
CaCl.sub.2, 5 mM NaHCO.sub.3, 8 mM HEPES, 10 mM glucose, pH 7.4),
then pre-stimulated with KCl and loaded as follows: 0.05 mL of
IMR32 buffer, 0.05 mL of each compound tested diluted in IMR32
buffer containing 20 .mu.M nitrendipine (Sigma), and 0.1 mL KCl
dissolved in IMR32 buffer, plus Fluo-4 were added (3 .mu.M final
concentration, Molecular Probes, Eugene, Oreg.). Final test
compound concentrations ranged from about 846 .mu.M to about 17
.mu.M, final nitrendipine concentration was 5 .mu.M, and final KCl
concentration was 90 mM. After 1 hour, the cells were washed twice
with 0.05 mL of each compound tested in nitrendipine-containing
IMR32 buffer (no KCl or Fluo-4), and then replaced with 0.1 mL of
each compound tested in nitrendipine-containing IMR32 buffer.
Plates were then transferred to a Fluorimetric Imaging Plate Reader
(FLIPR.sup.96, Molecular Devices, Inc., Sunnyvale, Calif.) for
assay. The FLIPR measured basal Fluo-4 fluorescence for 315 seconds
(i.e., 5 minutes and 15 seconds), then added 0.1 mL KCl agonist
dissolved in IMR32 buffer and measured fluorescence for another 45
seconds. Final test compound concentrations on the cells after
FLIPR read ranged from about 846 pM to about 17 .mu.M, final
nitrendipine concentration was 5 .mu.M, and final KCl concentration
was 90 mM. Data were collected over the entire time course and
analyzed using Excel, Graph Pad Prism (version 3.02, Graph Pad, San
Diego, Calif.), or an in-house non-linear regression analysis
software.
[0267] FLIPR Calcium Mobilization Assay for L-type Calcium Channel.
One day prior to performing this assay, HEK293 cells stably
expressing recombinant rat L-type calcium channel (LTCC) subunits
(.alpha.1c, .alpha.2.delta., and .beta.1) were trypsinized, then
seeded on poly-D-lysine-coated 96-well clear-bottom black plates
(Becton Dickinson, Franklin Lakes, N.J.) at 75,000 cells/well. On
the day of the assay, the plates were washed with LTCC wash buffer
(127 mM NaCl, 2 mM MgCl.sub.2, 700 .mu.M NaH2PO.sub.4, 5 mM
CaCl.sub.2, 5 mM NaHCO.sub.3, 8 mM HEPES, 10 mM glucose, pH 7.4),
then loaded with 0.1 mL of LTCC wash buffer containing Fluo-4 (3
.mu.M final concentration, Molecular Probes, Eugene, Oreg.). After
1 hour, the cells were washed with 0.1 mL LTCC wash buffer and
resuspended in 0.05 mL LTCC assay buffer (same composition as LTCC
wash buffer). Plates were then transferred to a FLIPR.sup.96 for
assay. The FLIPR measured basal Fluo-4 fluorescence for 15 seconds,
then added 0.05 mL of each compound tested diluted in LTCC assay
buffer at final concentrations ranging from about 846 pM to about
17 .mu.M. Fluo-4 fluorescence was then measured for 5 minutes. 0.1
mL KCl agonist dissolved in LTCC assay buffer was then added to the
cells to produce a final concentration of 90 mM KCl, and
fluorescence was measured for another 45 seconds. Data were
collected over the entire time course and analyzed using Excel,
Graph Pad Prism, or an in-house regression analysis software.
[0268] Alternative FLIPR Calcium Mobilization Assay for L-type
Calcium Channel. Alternatively, the following cell line and
procedure may be used for the FLIPR calcium mobilization assay for
L-type calcium channel. One day prior to performing this assay,
differentiated A7r5 cells are trypsinized, then seeded on tissue
culture treated 96-well clear-bottom black plates (Becton
Dickinson, Franklin Lakes, N.J.) at a dilution of 1:1 from a
confluent T150 cm.sup.2 flask. On the day of the assay, the plates
are washed with A7r5 wash buffer (127 mM NaCl, 2 mM MgCl.sub.2, 700
.mu.M NaH2PO.sub.4, 5 mM CaCl.sub.2, 5 mM NaHCO.sub.3, 8 mM HEPES,
10 mM glucose, pH 7.4), then loaded with 0.1 mL of A7r5 wash buffer
containing Fluo-4 (3 .mu.M final concentration, Molecular Probes,
Eugene, Oreg.). After 1 hour, the cells are washed with 0.1 mL A7r5
wash buffer and resuspended in 0.05 mL A7r5 assay buffer that is
composed of A7r5 wash buffer plus 50 .mu.M valinomycin (Sigma).
Plates are then transferred to a FLIPR.sup.96 for assay. The FLIPR
measures basal Fluo-4 fluorescence for 15 seconds, then adds 0.05
mL of each compound tested diluted in A7r5 assay buffer at final
concentrations ranging from about 846 pM to about 17 .mu.M. Fluo-4
fluorescence is then measured for 5 minutes. 0.1 mL KCl agonist
dissolved in A7r5 assay buffer is then added to the cells to
produce a final concentration of 90 mM KCl, and fluorescence was
measured for another 45 seconds. Data were collected over the
entire time course and analyzed using Excel, Graph Pad Prism, or an
in-house regression analysis software.
[0269] Cloning of N- and L-type calcium channel subunit open
reading frame cDNAs. Five cDNAs encoding subunits of the rat N- or
L-type calcium channels were cloned by PCR amplification in order
to reconstitute functional channels in a heterologous system. These
were the alpha1b (.alpha.1b), beta1 (.beta.1), beta3 (.beta.3),
alpha2delta (.alpha.2.delta.), and alpha1c (.alpha.1c) subunit
cDNAs. The alpha1b subunit cDNA has been described by Dubel et al.
in Proc. Natl. Acad. Sci. U.S.A 89: 5058-5062 (1992). The beta1
subunit cDNA has been described by Pragnell et al. in FEBS Lett.
291: 253-258 (1991). The beta3 subunit cDNA has been described by
Castellano et al. in J. Biol. Chem. 268: 12359-12366 (1993). The
alpha2delta subunit cDNA has been described by Kim et al. in Proc.
Natl. Acad. Sci. U.S.A. 89: 3251-3255 (1992). The alpha1c subunit
cDNA has been described by Koch et al. in J. Biol. Chem. 265:
17786-17791 (1990).
[0270] The 7.0 kb cDNA containing the entire .alpha.1b open reading
frame (ORF) was PCR amplified as two overlapping cDNA fragments,
i.e., a 2.7 kb 5' fragment and a 4.4 kb 3' fragment. The 5'
fragment was amplified from rat brain cDNA using primers 1 (SEQ ID
NO:1, TABLE 1) and 2 (SEQ ID NO:2, TABLE 1), and the 3' fragment
was amplified from rat spinal cord cDNA using primers 3 (SEQ ID
NO:3, TABLE 1) and 4 (SEQ ID NO:4, TABLE 1). The two fragments were
joined by ligation at a common restriction site to create the
entire 7.0 kb cDNA. This ORF encodes the protein isoform generated
by alternative splicing termed "+A .DELTA.SFMG SET" according to
the nomenclature of Lin et al. (Neuron 18: 153-166 (1997)). The
entire cDNA was sequenced with redundant coverage on both strands.
The cDNA was then inserted into the mammalian expression vector
pcDNA6.2DEST (Invitrogen, Carlsbad Calif.) by homologous
recombination using the Gateway system (Invitrogen).
[0271] The 1.8 kb cDNA encoding the .beta.1 subunit, the 1.45 cDNA
encoding the beta3 subunit, and the 3.3 kb cDNA encoding the
alpha2delta subunit were cloned by PCR amplification from rat
spinal cord cDNA (.beta.1) or brain cDNA (.beta.3,
.alpha.2.delta.). Primers 5 (SEQ ID NO:5, TABLE 1) and 6 (SEQ ID
NO:6, TABLE 1) were used for the .beta.1 cDNA amplification;
primers 7 (SEQ ID NO:7, TABLE 1) and 8 (SEQ ID NO:8, TABLE 1) were
used for the .beta.3 cDNA amplification; and primers 9 (SEQ ID
NO:9, TABLE 1) and 10 (SEQ ID NO:10, TABLE 1) were used for the
.alpha.2.delta. cDNA amplification. PCR products were subcloned and
fully sequenced on both strands. Clones matching the reference
sequence (.beta.1: NM.sub.--017346; .beta.3: NM.sub.--012828;
.alpha.2.delta.: M86621) and the gene's GenBank rat genomic DNA
sequences were recombined into the mammalian expression vector
pcDNA3.2DEST (.beta.1, .beta.3) or pcDNA3.1-Zeo (.alpha.2.delta.),
which had been modified to a vector compatible with the Gateway
recombination system using the Gateway vector adaptor kit
(Invitrogen). Proper recombination was confirmed by sequencing of
recombinogenic regions. For .beta.3 expression vector, proper
protein expression was confirmed by Western blot analysis of
lysates of transfected HEK293 cells using a rabbit polyclonal
antiserum directed against the rat .beta.3 subunit (USA
Biological).
[0272] The 6.5 kb cDNA encoding the L-type calcium channel
.alpha.1c subunit was cloned by PCR amplification from rat heart
cDNA using primers 11 (SEQ ID NO:11, TABLE 1) and 12 (SEQ ID NO:12,
TABLE 1). The PCR fragment was subcloned and fully sequenced on
both strands to confirm its identity. A clone matching consensus
reference sequence M59786 and rat genomic DNA sequences was
recombined into the mammalian expression vector pcDNA6.2DEST.
Sequences around the recombinogenic region were sequenced to
confirm accurate recombination into the expression vector.
TABLE-US-00001 TABLE 1 PRIMER SEQUENCE SEQ ID NO. CACC ATG GTC CGC
TTC GGG GAC 1 CCG TTC AGT GGC CTC CTC C 2 C TAG CAC CAG TGA TCC TGG
TCTG 3 AGT GCG TTG TGA GCG CAG TA 4 CAC CAT GGT CCA GAA GAG CGG 5
TCTCAGCGGATGTAGACGCCT 6 CAC CAT GTA TGA CGA CTC CTA C 7 GGT GGT CAG
TAG CTG TCC TTA GG 8 CAC CAT GGC TGC TGG CTG CCT 9 AGA GGG TCA CCA
TAG ATA GTG TCT G 10 CACCATGATTCGGGCCTTCGCT 11
AGCCTGCGGACTACAGGTTGCTGAC 12
[0273] N-type Recombinant Cell Line Development. N-type calcium
channel expressing HEK-293 cells were created in two stages. Stage
1 was created as follows. The rat .alpha.1b, and .beta.3 cDNA
expression constructs (2.5 .mu.g each) were co-transfected into
human embryonic kidney (HEK-293) cells by Lipofectamine Plus
reagent (Invitrogen), as per manufacturer's instructions. 24 hours
later, cells were split in limiting dilution into multiple 96-well
plates in selection media containing 20 .mu.g/mL blasticidin and
500 .mu.g/mL geneticin, and incubated for 3 weeks at 37.degree. C.,
5% CO.sub.2, 95% humidity. Plates containing 1 clone per well were
cultured until wells positive for single clones were confluent.
Individual clones were then arrayed into columns of a destination
96-well plate, and partly split into 6-well plates for culture
maintenance. Array plates were washed once with IMR32 buffer and
cells loaded for 1 hour with 0.1 mL of IMR32 buffer containing
Fluo-4 (3 .mu.M final concentration, Molecular Probes). Then they
were washed twice with 0.1 mL of IMR32 buffer, and replaced with
0.1 mL IMR32 buffer. Plates were then transferred to a FLIPR.sup.96
for assay. The FLIPR measured basal Fluo-4 fluorescence for 315
seconds, then added 0.1 mL KCl agonist dissolved in IMR32 buffer
and measured fluorescence for another 45 seconds. Final KCl
concentration was 90 mM. Data were collected over the entire time
course and analyzed using Excel, Graph Pad Prism, or Activity Base
(version 5.1, IDBS, Parsippany, N.J.) software. The clone with the
greatest signal-to-noise ratio, best stability of response with
passage number, and best adhesion to PDL precoated plates (Becton
Dickinson) was expanded, characterized and used for stage 2 cell
line development.
[0274] Stage 2 of N-type cell line development was carried out as
follows. The rat .alpha.2.delta. cDNA expression construct (5 .mu.g
each) was transfected into the stage 1 N-type clonal cell line by
Lipofectamine Plus reagent (Invitrogen), as per manufacturer's
instructions. 24 hours later, cells were split in limiting dilution
into multiple 96-well plates in selection media containing 20
.mu.g/mL blasticidin, 500 .mu.g/mL geneticin, and 250 .mu.g/mL
zeocin and incubated for 3 weeks at 37.degree. C., 5% CO.sub.2, 95%
humidity. Plates containing 1 clone per well were cultured and
handled according to the same steps and procedures described above
for the stage 1 cell line. The three clones with the greatest
signal-to-noise, best stability of response with passage number,
and best adhesion to PDL precoated plates (Becton Dickinson) were
expanded, characterized and tested in electrophysiology for the
best current size, N-type pharmacology, N-type characteristic
current-voltage relationship and kinetics as described below.
[0275] L-type Recombinant Cell Line Development. L-type calcium
channel expressing HEK-293 cells were created in two stages. Stage
1 was created as follows. The rat .alpha.1c, and .beta.1 cDNA
expression constructs (2.5 .mu.g each) were co-transfected into
human embryonic kidney (HEK-293) cells by Lipofectamine Plus
reagent (Invitrogen), as per manufacturer's instructions. 24 hours
later, cells were split in limiting dilution into multiple 96-well
plates in selection media containing 20 .mu.g/mL blasticidin and
500 .mu.g/mL geneticin, and incubated for 3 weeks at 37.degree. C.,
5% CO.sub.2, 95% humidity. Plates containing 1 clone per well were
cultured until wells positive for single clones were confluent.
Individual clones were then arrayed into columns of a destination
96-well plate, and partly split into 6-well plates for culture
maintenance. Array plates were washed once with LTCC wash (or
assay) buffer and cells loaded for 1 hour with 0.1 mL of LTCC
buffer containing Fluo-4 (3 .mu.M final concentration, Molecular
Probes). Then they were washed twice with 0.1 mL of LTCC buffer,
and replaced with 0.1 mL LTCC buffer. Plates were then transferred
to a FLIPR.sup.96 for assay. The FLIPR measured basal Fluo-4
fluorescence for 315 seconds, then added 0.1 mL KCl agonist
dissolved in LTCC buffer and measured fluorescence for another 45
seconds. Final KCl concentration was 90 mM. Data were collected
over the entire time course and analyzed using Excel, Graph Pad
Prism, or Activity Base software. The clone with the greatest
signal-to-noise ratio, best stability of response with passage
number, and best adhesion to PDL precoated plates (Becton
Dickinson) was expanded, characterized and used for stage 2 cell
line development.
[0276] Stage 2 of L-type cell line development was carried out as
follows. The rat .alpha.2.delta. cDNA expression construct (5 .mu.g
each) was transfected into the stage 1 L-type clonal cell line by
Lipofectamine Plus reagent (Invitrogen), as per manufacturer's
instructions. 24 hours later, cells were split in limiting dilution
into multiple 96-well plates in selection media containing 20
.mu.g/mL blasticidin, 500 .mu.g/mL geneticin, and 250 .mu.g/mL
zeocin and incubated for 3 weeks at 37.degree. C., 5% CO.sub.2, 95%
humidity. Plates containing .ltoreq.1 clone per well were cultured
and handled according to the same steps and procedures described
above for the stage 1 cell line. The three clones with the greatest
signal-to-noise, best stability of response with passage number,
and best adhesion to PDL precoated plates (Becton Dickinson) were
expanded and characterized.
[0277] N-type Electrophysiology in Recombinant Cells. For
electrophysiological recording, the cells expressing .alpha.1b,
.beta.3 and .alpha.2.delta. subunits were seeded on 35-mm culture
Petri dishes at a density of approximately 10.sup.4 cells/dish and
kept in an incubator for up to three days for subsequent
recordings. For recordings, the dishes were positioned on the stage
of an inverted microscope (Nikon, Eclipse E600, Japan) and
superfused with a bath solution comprised of BaCl.sub.2 (11 mM),
MgCl.sub.2 (1.5 mM), HEPES (10 mM), TEA chloride (120 mM), glucose
(10 mM) adjusted to pH 7.4 with KOH. Whole-cell voltage-clamp
recordings were made using conventional patch-clamp techniques
(Hamill et al., Pfluegers Arch. 391: 85-100 (1981)) at room
temperature (22-24.degree. C.). The patch-clamp pipettes were
pulled from WPI, thick-walled borosilicate glass (WPI, Sarasota,
Fla.). Currents were recorded using an Axopatch 200A amplifier
(Axon Instruments, Union City, Calif.) and were leak-subtracted
(P/4), low-pass filtered (1 kHz, 4-pole Bessel), digitized
(20-50-.mu.s intervals), and stored using Digidata 1200 B interface
and Pclamp8.0/Clampex software (Axon Instruments, Union City,
Calif.). The pipettes were back-filled with internal solution
containing CsCl (110 mM), MgCl.sub.2 (3 mM), EGTA (3 mM), HEPES (40
mM), Mg-ATP (4 mM), Na.sub.2GTP (0.5 mM), and adjusted to pH 7.2
with CsOH. The pipette resistance ranged from 2 to 3 MOhm and was
compensated by 75-80% by the built-in electronic circuitry.
[0278] Currents were elicited by stepping from a holding potential
of -90 mV to 0 mV for 20 ms every 20 sec. At the -90 mV membrane
voltage about 50% of channels were in the inactivated state, and
thus contact with a blocker would involve interaction with both
resting and inactivated channels. Every drug was applied at 3 to 4
concentrations increasing in a cumulative manner. Fractional
inhibition levels in steady-state were used to draw the partial
inhibition concentration curves to get the IC.sub.50 (i.e.
concentration causing 50% reduction in the size of the response)
values at -90 mV.
[0279] Stock solutions of each test compound were prepared using
DMSO. Serial dilutions to desired concentrations were done with
bath solution; concentration of DMSO in final solutions was 0.1%.
Drugs were applied by gravity flow using a plane multi-barrel array
shooter positioned 0.5 mm apart from the cell.
[0280] All curve fittings were carried out using Origin software
(version 5.0, Microcal). A Hill equation was fit to the
concentration-inhibition curves to determine IC.sub.50 values.
[0281] N-type Electrophysiology in Neuronal Cells. To determine
dissociation constants in resting versus inactivated state for
N-type calcium channels, neuronal cells that endogenously express
N-type calcium channels can be used. For electrophysiological
recording, the neuronal cells expressing N-type calcium channels
are seeded on 35-mm culture Petri dishes at a density of
approximately 10.sup.4 cells/dish and kept in an incubator for up
to three days for subsequent recordings. For recordings, the dishes
are positioned on the stage of an inverted microscope (Nikon,
Eclipse E600, Japan) and superfused with a bath solution comprised
of BaCl.sub.2 (11 mM), MgCl.sub.2 (1.5 mM), HEPES (10 mM), TEA
chloride (120 mM), glucose (10 mM) adjusted to pH 7.4 with KOH.
Whole-cell voltage-clamp recordings are made using conventional
patch-clamp techniques (Hamill et al., Pfluegers Arch. 391: 85-100
(1981)) at room temperature (22-24.degree. C.). The patch-clamp
pipettes are pulled from WPI, thick-walled borosilicate glass (WPI,
Sarasota, Fla.). Currents are recorded using an Axopatch 200A
amplifier (Axon Instruments, Union City, Calif.) and
leak-subtracted (P/4), low-pass filtered (1 kHz, 4-pole Bessel),
digitized (20-50-.mu.s intervals), and stored using Digidata 1200 B
interface and Pclamp8.0/Clampex software (Axon Instruments, Union
City, Calif.). The pipettes are back-filled with internal solution
containing CsCl (110 mM), MgCl.sub.2 (3 mM), EGTA (3 mM), HEPES (40
mM), Mg-ATP (4 mM), Na.sub.2GTP (0.5 mM), and adjusted to pH 7.2
with CsOH. The pipette resistance ranges from 2 to 3 MOhm and is
compensated by 75-80% by the built-in electronic circuitry.
[0282] Currents are elicited by stepping from a holding potential
of .+-.90 mV to 0 mV for 20 ms every 10 sec. At the .+-.90 mV
membrane voltage a proportion of channels is in the inactivated
state, and thus contact with a blocker would involve interaction
with both resting and inactivated channels. This protocol is used
as a first tier screen. For dissection of two components of
inhibition (resting block with the apparent dissociation constant
K.sub.r and inactivated state block with K.sub.i), steady-state
inactivation curves are collected using a double-pulse protocol.
Three-second long depolarizing pre-pulse incrementing in 10 mV
steps is followed by a 10 ms test pulse to 0 mV.
[0283] Stock solutions of each test compound are prepared using
DMSO. Serial dilutions to desired concentrations are done with bath
solution; concentration of DMSO in final solutions is 0.1%. Drugs
are applied by gravity flow using a plane multi-barrel array
shooter positioned .about.1 mm apart from the cell.
[0284] All curve fittings can be carried out using Origin software
(version 5.0, Microcal). A Hill equation is used to fit the
concentration-response curves and to determine IC.sub.50 values. A
Boltzman equation is used to fit inactivation curves, returning
half-inactivation voltage, V.sub.0.5, slope p and the amplitude of
current at the most negative voltage where eventually all channels
are in the resting state. These parameters are used to calculate
the apparent dissociation constants:
K.sub.r=((Ab/Ac)/(1-(Ab/Ac))*[b]) where [b] is the drug
concentration, Ac is the maximum test current amplitude in control
conditions and Ab is the maximum test current amplitude in the
presence of a blocker;
K.sub.i=[b]/((exp(-(dx/p))*(1+([b]/K.sub.r))-1) where dx is the
difference between half-inactivation voltage V.sub.0.5 in the
presence and absence of drug and p is the slope.
In Vivo Pharmacology
[0285] The compounds of the present invention can be tested for in
vivo anticonvulsant activity after i.v., p.o., or i.p. injection
using any of a number of anticonvulsant tests in mice, including
the maximum electroshock seizure test (MES). Maximum electroshock
seizures are induced in male NSA mice weighing between 15-20 g and
in male Sprague-Dawley rats weighing between 200-225 g by
application of current (for mice: 50 mA, 60 pulses/sec, 0.8 msec
pulse width, 1 sec duration, D.C.; for rats: 99 mA, 125 pulses/sec,
0.8 msec pulse width, 2 sec duration, D.C.) using a Ugo Basile ECT
device (Model 7801). Mice are restrained by gripping the loose skin
on their dorsal surface and saline-coated corneal electrodes are
held lightly against the two corneae. Rats are allowed free
movement on the bench top and ear-clip electrodes are used. Current
is applied and animals are observed for a period of up to 30
seconds for the occurrence of a tonic hindlimb extensor response. A
tonic seizure is defined as a hindlimb extension in excess of 90
degrees from the plane of the body. Results can be treated in a
quantal manner.
[0286] The compounds can be tested for their antinociceptive
activity in the formalin model as described in Hunskaar, S., O. B.
Fasmer, and K. Hole, J. Neurosci. Methods 14: 69-76 (1985). Male
Swiss Webster NIH mice (20-30 g; Harlan, San Diego, Calif.) can be
used in all experiments. Food is withdrawn on the day of
experiment. Mice are placed in Plexiglass jars for at least 1 hour
to acclimate to the environment. Following the acclimation period
mice are weighed and given either the compound of interest
administered i.p. or p.o., or the appropriate volume of vehicle
(10% Tween-80) as control. Fifteen minutes after the i.p. dosing,
and 30 minutes after the p.o. dosing mice are injected with
formalin (20 .mu.L of 5% formaldehyde solution in saline) into the
dorsal surface of the right hind paw. Mice are transferred to the
Plexiglass jars and monitored for the amount of time spent licking
or biting the injected paw. Periods of licking and biting are
recorded in 5-minute intervals for 1 hour after the formalin
injection. All experiments are done in a blinded manner during the
light cycle. The early phase of the formalin response is measured
as licking/biting between 0-5 minutes, and the late phase is
measured from 15-50 minutes. Differences between vehicle and drug
treated groups can be analyzed by one-way analysis of variance
(ANOVA). A P value <0.05 is considered significant. Compounds
are considered to be efficacious for treating acute and chronic
pain if they have activity in blocking both the early and second
phase of formalin-induced paw-licking activity.
[0287] Compounds can be tested for their potential to treat chronic
pain (i.e., antiallodynic and antihyperalgesic activities) using
the Chung model of peripheral neuropathy (Kim and Chung, Pain 50:
355-363 (1992)). Male Sprague-Dawley rats weighing between 200-225
g are anesthetized with halothane (1-3% in a mixture of 70% air and
30% oxygen), and their body temperature controlled during
anesthesia through use of a homeothermic blanket. A 2-cm dorsal
midline incision is then made at the L5 and L6 level, and the
para-vertebral muscle groups retracted bilaterally. L5 and L6
spinal nerves are then exposed, isolated, and tightly ligated with
6-0 or 7-0 silk suture. A sham operation is performed exposing the
contralateral L5 and L6 spinal nerves, without ligating, as a
negative control.
[0288] Tactile Allodynia: Sensitivity to non-noxious mechanical
stimuli can be measured in animals to assess tactile allodynia.
Rats are transferred to an elevated testing cage with a wire mesh
floor and allowed to acclimate for five to ten minutes. A series of
von Frey monofilaments are applied to the plantar surface of the
hindpaw to determine the animal's withdrawal threshold. The first
filament used possesses a buckling weight of 9.1 gms (0.96 log
value) and is applied up to five times to see if it elicits a
withdrawal response. If the animal has a withdrawal response, then
the next lightest filament in the series would be applied up to
five times to determine if it also could elicit a response. This
procedure is repeated with subsequent lesser filaments until there
is no response and the identity of the lightest filament that
elicits a response is recorded. If the animal does not have a
withdrawal response from the initial 9.1 gms filament, then
subsequent filaments of increased weight are applied until a
filament elicits a response and the identity of this filament is
recorded. For each animal, three measurements are made at every
time point to produce an average withdrawal threshold
determination. Tests can be performed prior to, and at 1, 2, 4 and
24 hours post drug administration.
[0289] Mechanical Hyperalgesia: Sensitivity to noxious mechanical
stimuli can be measured in animals using the paw pressure test to
assess mechanical hyperalgesia. In rats, hind paw withdrawal
thresholds ("PWT"), measured in grams, in response to a noxious
mechanical stimulus are determined using an analgesymeter (Model
7200, commercially available from Ugo Basile of Italy), as
described in Stein (Biochemistry & Behavior 31: 451-455
(1988)). The rat's paw is placed on a small platform, and weight is
applied in a graded manner up to a maximum of 250 grams. The
endpoint is taken as the weight at which the paw is completely
withdrawn. PWT is determined once for each rat at each time point.
PWT can be measured only in the injured paw, or in both the injured
and non-injured paw. In one non-limiting embodiment, mechanical
hyperalgesia associated with nerve injury induced pain (neuropathic
pain) can be assessed in rats. Rats are tested prior to surgery to
determine a baseline, or normal, PWT. Rats are tested again 2 to 3
weeks post-surgery, prior to, and at different times after (e.g. 1,
3, 5 and 24 hr) drug administration. An increase in PWT following
drug administration indicates that the test compound reduces
mechanical hyperalgesia.
Pharmaceutical Compositions
[0290] Although a compound of the present invention may be
administered to a mammal in the form of a raw chemical without any
other components present, the compound is preferably administered
as part of a pharmaceutical composition containing the compound
combined with a suitable pharmaceutically acceptable carrier. Such
a carrier can be selected from pharmaceutically acceptable
excipients and auxiliaries.
[0291] Pharmaceutical compositions within the scope of the present
invention include all compositions where a compound of the present
invention is combined with a pharmaceutically acceptable carrier.
In a preferred embodiment, the compound is present in the
composition in an amount that is effective to achieve its intended
therapeutic purpose. While individual needs may vary, a
determination of optimal ranges of effective amounts of each
compound is within the skill of the art. Typically, the compounds
may be administered to a mammal, e.g., a human, orally at a dose of
from about 0.0025 to about 1500 mg per kg body weight of the
mammal, or an equivalent amount of a pharmaceutically acceptable
salt, prodrug, or solvate thereof, per day to treat, prevent or
ameliorate the particular disorder. A useful oral dose of a
compound of the present invention administered to a mammal is from
about 0.0025 to about 50 mg per kg body weight of the mammal, or an
equivalent amount of the pharmaceutically acceptable salt, prodrug,
or solvate thereof. For intramuscular injection, the dose is
typically about one-half of the oral dose.
[0292] A unit oral dose may comprise from about 0.01 to about 50
mg, and preferably about 0.1 to about 10 mg, of the compound. The
unit dose can be administered one or more times daily, e.g., as one
or more tablets or capsules, each containing from about 0.01 to
about 50 mg of the compound, or an equivalent amount of a
pharmaceutically acceptable salt, prodrug or solvate thereof.
[0293] A pharmaceutical composition of the present invention can be
administered to any animal that may experience the beneficial
effects of a compound of the present invention. Foremost among such
animals are mammals, e.g., humans and companion animals, although
the invention is not intended to be so limited.
[0294] A pharmaceutical composition of the present invention can be
administered by any means that achieves its intended purpose. For
example, administration can be by the oral, parenteral,
subcutaneous, intravenous, intramuscular, intraperitoneal,
transdermal, intranasal, transmucosal, rectal, intravaginal or
buccal route, or by inhalation. The dosage administered and route
of administration will vary, depending upon the circumstances of
the particular subject, and taking into account such factors as
age, health, and weight of the recipient, condition or disorder to
be treated, kind of concurrent treatment, if any, frequency of
treatment, and the nature of the effect desired.
[0295] In one embodiment, a pharmaceutical composition of the
present invention can be administered orally and is formulated into
tablets, dragees, capsules or an oral liquid preparation. In one
embodiment, the oral formulation comprises extruded
multiparticulates comprising the compound of the invention.
[0296] Alternatively, a pharmaceutical composition of the present
invention can be administered rectally, and is formulated in
suppositories.
[0297] Alternatively, a pharmaceutical composition of the present
invention can be administered by injection.
[0298] Alternatively, a pharmaceutical composition of the present
invention can be administered transdermally.
[0299] Alternatively, a pharmaceutical composition of the present
invention can be administered by inhalation or by intranasal or
transmucosal administration.
[0300] Alternatively, a pharmaceutical composition of the present
invention can be administered by the intravaginal route.
[0301] A pharmaceutical composition of the present invention can
contain from about 0.01 to 99 percent by weight, and preferably
from about 0.25 to 75 percent by weight, of active compound(s).
[0302] A method of the present invention, such as a method for
treating a disorder responsive to the blockade of calcium channels
in an animal in need thereof, can further comprise administering a
second therapeutic agent to the animal in combination with a
compound of the present invention. In one embodiment, the other
therapeutic agent is administered in an effective amount.
[0303] Effective amounts of the other therapeutic agents are known
to those skilled in the art. However, it is well within the skilled
artisan's purview to determine the other therapeutic agent's
optimal effective-amount range.
[0304] A compound of the present invention (i.e., the first
therapeutic agent) and the second therapeutic agent can act
additively or, in one embodiment, synergistically. In one
embodiment, a compound of the present invention is administered
concurrently with a second therapeutic agent; for example, a single
composition comprising both an effective amount of a compound of
any of Formulae I-VI, and an effective amount of the second
therapeutic agent can be administered. Accordingly, the present
invention further provides a pharmaceutical composition comprising
a combination of a compound of the present invention, the second
therapeutic agent, and a pharmaceutically acceptable carrier.
Alternatively, a first pharmaceutical composition comprising an
effective amount of a compound of any of Formulae I-VI and a second
pharmaceutical composition comprising an effective amount of the
second therapeutic agent can be concurrently administered. In
another embodiment, an effective amount of a compound of the
present invention is administered prior or subsequent to
administration of an effective amount of the second therapeutic
agent. In this embodiment, the compound of the present invention is
administered while the second therapeutic agent exerts its
therapeutic effect, or the second therapeutic agent is administered
while the compound of the present invention exerts its therapeutic
effect for treating a disorder or condition.
[0305] The second therapeutic agent can be an opioid agonist, a
non-opioid analgesic, a non-steroidal anti-inflammatory agent, an
antimigraine agent, a Cox-II inhibitor, a .beta.-adrenergic
blocker, an anticonvulsant, an antidepressant, an anticancer agent,
an agent for treating addictive disorder, an agent for treating
Parkinson's disease and parkinsonism, an agent for treating
anxiety, an agent for treating epilepsy, an agent for treating a
seizure, an agent for treating a stroke, an agent for treating a
pruritic condition, an agent for treating psychosis, an agent for
treating ALS, an agent for treating a cognitive disorder, an agent
for treating a migraine, an agent for treating vomiting, an agent
for treating dyskinesia, or an agent for treating depression, or a
mixture thereof.
[0306] Examples of useful opioid agonists include, but are not
limited to, alfentanil, allylprodine, alphaprodine, anileridine,
benzylmorphine, bezitramide, buprenorphine, butorphanol,
clonitazene, codeine, desomorphine, dextromoramide, dezocine,
diampromide, diamorphone, dihydrocodeine, dihydromorphine,
dimenoxadol, dimepheptanol, dimethylthiambutene, dioxaphetyl
butyrate, dipipanone, eptazocine, ethoheptazine,
ethylmethylthiambutene, ethylmorphine, etonitazene, fentanyl,
heroin, hydrocodone, hydromorphone, hydroxypethidine, isomethadone,
ketobemidone, levorphanol, levophenacylmorphan, lofentanil,
meperidine, meptazinol, metazocine, methadone, metopon, morphine,
myrophine, nalbuphine, narceine, nicomorphine, norlevorphanol,
normethadone, nalorphine, normorphine, norpipanone, opium,
oxycodone, oxymorphone, papavereturn, pentazocine, phenadoxone,
phenomorphan, phenazocine, phenoperidine, piminodine, piritramide,
proheptazine, promedol, properidine, propiram, propoxyphene,
sufentanil, tilidine, tramadol, pharmaceutically acceptable salts
thereof, and mixtures thereof.
[0307] In certain embodiments, the opioid agonist is selected from
codeine, hydromorphone, hydrocodone, oxycodone, dihydrocodeine,
dihydromorphine, morphine, tramadol, oxymorphone, pharmaceutically
acceptable salts thereof, and mixtures thereof.
[0308] Examples of useful non-opioid analgesics include
non-steroidal anti-inflammatory agents, such as aspirin, ibuprofen,
diclofenac, naproxen, benoxaprofen, flurbiprofen, fenoprofen,
flubufen, ketoprofen, indoprofen, piroprofen, carprofen, oxaprozin,
pramoprofen, muroprofen, trioxaprofen, suprofen, aminoprofen,
tiaprofenic acid, fluprofen, bucloxic acid, indomethacin, sulindac,
tolmetin, zomepirac, tiopinac, zidometacin, acemetacin, fentiazac,
clidanac, oxpinac, mefenamic acid, meclofenamic acid, flufenamic
acid, niflumic acid, tolfenamic acid, diflurisal, flufenisal,
piroxicam, sudoxicam, isoxicam, and pharmaceutically acceptable
salts thereof, and mixtures thereof. Examples of other suitable
non-opioid analgesics include the following, non limiting, chemical
classes of analgesic, antipyretic, nonsteroidal antiinflammatory
drugs: salicylic acid derivatives, including aspirin, sodium
salicylate, choline magnesium trisalicylate, salsalate, diflunisal,
salicylsalicylic acid, sulfasalazine, and olsalazin; para
aminophennol derivatives including acetaminophen and phenacetin;
indole and indene acetic acids, including indomethacin, sulindac,
and etodolac; heteroaryl acetic acids, including tolmetin,
diclofenac, and ketorolac; anthranilic acids (fenamates), including
mefenamic acid, and meclofenamic acid; enolic acids, including
oxicams (piroxicam, tenoxicam), and pyrazolidinediones
(phenylbutazone, oxyphenthartazone); and alkanones, including
nabumetone. For a more detailed description of the NSAIDs, see Paul
A. Insel, Analgesic Antipyretic and Antiinflammatory Agents and
Drugs Employed in the Treatment of Gout, in Goodman & Gilman's
The Pharmacological Basis of Therapeutics 617-57 (Perry B.
Molinhoff and Raymond W. Ruddon eds., 9th ed 1996) and Glen R.
Hanson, Analgesic, Antipyretic and Anti Inflammatory Drugs in
Remington: The Science and Practice of Pharmacy Vol II 1196-1221
(A. R. Gennaro ed. 19th ed. 1995) which are hereby incorporated by
reference in their entireties. Suitable Cox-II inhibitors and
5-lipoxygenase inhibitors, as well as combinations thereof, are
described in U.S. Pat. No. 6,136,839, which is hereby incorporated
by reference in its entirety. Examples of useful Cox II inhibitors
include, but are not limited to, rofecoxib and celecoxib.
[0309] Examples of useful antimigraine agents include, but are not
limited to, alpiropride, bromocriptine, dihydroergotamine,
dolasetron, ergocornine, ergocorninine, ergocryptine, ergonovine,
ergot, ergotamine, flumedroxone acetate, fonazine, ketanserin,
lisuride, lomerizine, methylergonovine, methysergide, metoprolol,
naratriptan, oxetorone, pizotyline, propranolol, risperidone,
rizatriptan, sumatriptan, timolol, trazodone, zolmitriptan, and
mixtures thereof.
[0310] Examples of useful .beta.-adrenergic blockers include, but
are not limited to, acebutolol, alprenolol, amosulabol, arotinolol,
atenolol, befunolol, betaxolol, bevantolol, bisoprolol, bopindolol,
bucumolol, bufetolol, bufuralol, bunitrolol, bupranolol, butidrine
hydrochloride, butofilolol, carazolol, carteolol, carvedilol,
celiprolol, cetamolol, cloranolol, dilevalol, epanolol, esmolol,
indenolol, labetalol, levobunolol, mepindolol, metipranolol,
metoprolol, moprolol, nadolol, nadoxolol, nebivalol, nifenalol,
nipradilol, oxprenolol, penbutolol, pindolol, practolol,
pronethalol, propranolol, sotalol, sulfinalol, talinolol,
tertatolol, tilisolol, timolol, toliprolol, and xibenolol.
[0311] Examples of useful anticonvulsants include, but are not
limited to, acetylpheneturide, albutoin, aloxidone,
aminoglutethimide, 4-amino-3-hydroxybutyric acid, atrolactamide,
beclamide, buramate, calcium bromide, carbamazepine, cinromide,
clomethiazole, clonazepam, decimemide, diethadione, dimethadione,
doxenitroin, eterobarb, ethadione, ethosuximide, ethotoin,
felbamate, fluoresone, gabapentin, 5-hydroxytryptophan,
lamotrigine, magnesium bromide, magnesium sulfate, mephenyloin,
mephobarbital, metharbital, methetoin, methsuximide,
5-methyl-5-(3-phenanthryl)-hydantoin, 3-methyl-5-phenylhydantoin,
narcobarbital, nimetazepam, nitrazepam, oxcarbazepine,
paramethadione, phenacemide, phenetharbital, pheneturide,
phenobarbital, phensuximide, phenylmethylbarbituric acid,
phenyloin, phethenylate sodium, potassium bromide, pregabaline,
primidone, progabide, sodium bromide, solanum, strontium bromide,
suclofenide, sulthiame, tetrantoin, tiagabine, topiramate,
trimethadione, valproic acid, valpromide, vigabatrin, and
zonisamide.
[0312] Examples of useful antidepressants include, but are not
limited to, binedaline, caroxazone, citalopram, (S)-citalopram,
dimethazan, fencamine, indalpine, indeloxazine hydrocholoride,
nefopam, nomifensine, oxitriptan, oxypertine, paroxetine,
sertraline, thiazesim, trazodone, benmoxine, iproclozide,
iproniazid, isocarboxazid, nialamide, octamoxin, phenelzine,
cotinine, rolicyprine, rolipram, maprotiline, metralindole,
mianserin, mirtazepine, adinazolam, amitriptyline,
amitriptylinoxide, amoxapine, butriptyline, clomipramine,
demexiptiline, desipramine, dibenzepin, dimetacrine, dothiepin,
doxepin, fluacizine, imipramine, imipramine N-oxide, iprindole,
lofepramine, melitracen, metapramine, nortriptyline, noxiptilin,
opipramol, pizotyline, propizepine, protriptyline, quinupramine,
tianeptine, trimipramine, adrafinil, benactyzine, bupropion,
butacetin, dioxadrol, duloxetine, etoperidone, febarbamate,
femoxetine, fenpentadiol, fluoxetine, fluvoxamine, hematoporphyrin,
hypericin, levophacetoperane, medifoxamine, milnacipran, minaprine,
moclobemide, nefazodone, oxaflozane, piberaline, prolintane,
pyrisuccideanol, ritanserin, roxindole, rubidium chloride,
sulpiride, tandospirone, thozalinone, tofenacin, toloxatone,
tranylcypromine, L-tryptophan, venlafaxine, viloxazine, and
zimeldine.
[0313] Examples of useful anticancer agents include, but are not
limited to, acivicin, aclarubicin, acodazole hydrochloride,
acronine, adozelesin, aldesleukin, altretamine, ambomycin,
ametantrone acetate, aminoglutethimide, amsacrine, anastrozole,
anthramycin, asparaginase, asperlin, azacitidine, azetepa,
azotomycin, batimastat, benzodepa, bicalutamide, bisantrene
hydrochloride, bisnafide dimesylate, bizelesin, bleomycin sulfate,
brequinar sodium, bropirimine, busulfan, cactinomycin, calusterone,
caracemide, carbetimer, carboplatin, carmustine, carubicin
hydrochloride, carzelesin, cedefingol, chlorambucil, cirolemycin,
and cisplatin.
[0314] Therapeutic agents useful for treating an addictive disorder
include, but are not limited to, methadone, desipramine,
amantadine, fluoxetine, buprenorphine, an opiate agonist,
3-phenoxypyridine, or a serotonin antagonist.
[0315] Examples of useful therapeutic agents for treating
Parkinson's disease and parkinsonism include, but are not limited
to, carbidopa/levodopa, pergolide, bromocriptine, ropinirole,
pramipexole, entacapone, tolcapone, selegiline, amantadine, and
trihexyphenidyl hydrochloride.
[0316] Examples of useful therapeutic agents for treating anxiety
include, but are not limited to, benzodiazepines, such as
alprazolam, brotizolam, chlordiazepoxide, clobazam, clonazepam,
clorazepate, demoxepam, diazepam, estazolam, flumazenil,
flurazepam, halazepam, lorazepam, midazolam, nitrazepam,
nordazepam, oxazepam, prazepam, quazepam, temazepam, and triazolam;
non-benzodiazepine agents, such as buspirone, gepirone, ipsapirone,
tiospirone, zolpicone, zolpidem, and zaleplon; tranquilizers, such
as barbituates, e.g., amobarbital, aprobarbital, butabarbital,
butalbital, mephobarbital, methohexital, pentobarbital,
phenobarbital, secobarbital, and thiopental; and propanediol
carbamates, such as meprobamate and tybamate.
[0317] Examples of useful therapeutic agents for treating epilepsy
or seizure include, but are not limited to, carbamazepine,
ethosuximide, gabapentin, lamotrigine, phenobarbital, phenyloin,
primidone, valproic acid, trimethadione, benzodiazepines,
gamma-vinyl GABA, acetazolamide, and felbamate.
[0318] Examples of useful therapeutic agents for treating stroke
include, but are not limited to, anticoagulants such as heparin,
agents that break up clots such as streptokinase or tissue
plasminogen activator, agents that reduce swelling such as mannitol
or corticosteroids, and acetylsalicylic acid.
[0319] Examples of useful therapeutic agents for treating a
pruritic condition include, but are not limited to, naltrexone;
nalmefene; danazol; tricyclics such as amitriptyline, imipramine,
and doxepin; antidepressants such as those given below; menthol;
camphor; phenol; pramoxine; capsaicin; tar; steroids; and
antihistamines.
[0320] Examples of useful therapeutic agents for treating psychosis
include, but are not limited to, phenothiazines such as
chlorpromazine hydrochloride, mesoridazine besylate, and
thoridazine hydrochloride; thioxanthenes such as chloroprothixene
and thiothixene hydrochloride; clozapine; risperidone; olanzapine;
quetiapine; quetiapine fumarate; haloperidol; haloperidol
decanoate; loxapine succinate; molindone hydrochloride; pimozide;
and ziprasidone.
[0321] Examples of useful therapeutic agents for treating ALS
include, but are not limited to, baclofen, neurotrophic factors,
riluzole, tizanidine, benzodiazepines such as clonazepan and
dantrolene.
[0322] Examples of useful therapeutic agents for treating cognitive
disorders include, but are not limited to, agents for treating or
preventing dementia such as tacrine; donepezil; ibuprofen;
antipsychotic drugs such as thioridazine and haloperidol; and
antidepressant drugs such as those given below.
[0323] Examples of useful therapeutic agents for treating a
migraine include, but are not limited to, sumatriptan;
methysergide; ergotamine; caffeine; and beta-blockers such as
propranolol, verapamil, and divalproex.
[0324] Examples of useful therapeutic agents for treating vomiting
include, but are not limited to, 5-HT3 receptor antagonists such as
ondansetron, dolasetron, granisetron, and tropisetron; dopamine
receptor antagonists such as prochlorperazine, thiethylperazine,
chlorpromazine, metoclopramide, and domperidone; glucocorticoids
such as dexamethasone; and benzodiazepines such as lorazepam and
alprazolam.
[0325] Examples of useful therapeutic agents for treating
dyskinesia include, but are not limited to, reserpine and
tetrabenazine.
[0326] Examples of useful therapeutic agents for treating
depression include, but are not limited to, tricyclic
antidepressants such as amitryptyline, amoxapine, bupropion,
clomipramine, desipramine, doxepin, imipramine, maprotiline,
nefazadone, nortriptyline, protriptyline, trazodone, trimipramine,
and venlafaxine; selective serotonin reuptake inhibitors such as
citalopram, (S)-citalopram, fluoxetine, fluvoxamine, paroxetine,
and setraline; monoamine oxidase inhibitors such as isocarboxazid,
pargyline, phenelzine, and tranylcypromine; and psychostimulants
such as dextroamphetamine and methylphenidate.
[0327] A pharmaceutical composition of the present invention is
preferably manufactured in a manner which itself will be known in
view of the instant disclosure, for example, by means of
conventional mixing, granulating, dragee-making, dissolving,
extrusion, or lyophilizing processes. Thus, pharmaceutical
compositions for oral use can be obtained by combining the active
compound with solid excipients, optionally grinding the resulting
mixture and processing the mixture of granules, after adding
suitable auxiliaries, if desired or necessary, to obtain tablets or
dragee cores.
[0328] Suitable excipients include fillers such as saccharides (for
example, lactose, sucrose, mannitol or sorbitol), cellulose
preparations, calcium phosphates (for example, tricalcium phosphate
or calcium hydrogen phosphate), as well as binders such as starch
paste (using, for example, maize starch, wheat starch, rice starch,
or potato starch), gelatin, tragacanth, methyl cellulose,
hydroxypropylmethylcellulose, sodium carboxymethylcellulose, and/or
polyvinyl pyrrolidone. If desired, one or more disintegrating
agents can be added, such as the above-mentioned starches and also
carboxymethyl-starch, cross-linked polyvinyl pyrrolidone, agar, or
alginic acid or a salt thereof, such as sodium alginate.
[0329] Auxiliaries are typically flow-regulating agents and
lubricants such as, for example, silica, talc, stearic acid or
salts thereof (e.g., magnesium stearate or calcium stearate), and
polyethylene glycol. Dragee cores are provided with suitable
coatings that are resistant to gastric juices. For this purpose,
concentrated saccharide solutions may be used, which may optionally
contain gum arabic, talc, polyvinyl pyrrolidone, polyethylene
glycol and/or titanium dioxide, lacquer solutions and suitable
organic solvents or solvent mixtures. In order to produce coatings
resistant to gastric juices, solutions of suitable cellulose
preparations such as acetylcellulose phthalate or
hydroxypropymethyl-cellulose phthalate can be used. Dye stuffs or
pigments may be added to the tablets or dragee coatings, for
example, for identification or in order to characterize
combinations of active compound doses.
[0330] Examples of other pharmaceutical preparations that can be
used orally include push-fit capsules made of gelatin, or soft,
sealed capsules made of gelatin and a plasticizer such as glycerol
or sorbitol. The push-fit capsules can contain a compound in the
form of granules, which may be mixed with fillers such as lactose,
binders such as starches, and/or lubricants such as talc or
magnesium stearate and, optionally, stabilizers, or in the form of
extruded multiparticulates. In soft capsules, the active compounds
are preferably dissolved or suspended in suitable liquids, such as
fatty oils or liquid paraffin. In addition, stabilizers may be
added.
[0331] Possible pharmaceutical preparations for rectal
administration include, for example, suppositories, which consist
of a combination of one or more active compounds with a suppository
base. Suitable suppository bases include natural and synthetic
triglycerides, and paraffin hydrocarbons, among others. It is also
possible to use gelatin rectal capsules consisting of a combination
of active compound with a base material such as, for example, a
liquid triglyceride, polyethylene glycol, or paraffin
hydrocarbon.
[0332] Suitable formulations for parenteral administration include
aqueous solutions of the active compound in a water-soluble form
such as, for example, a water-soluble salt, alkaline solution, or
acidic solution. Alternatively, a suspension of the active compound
may be prepared as an oily suspension. Suitable lipophilic solvents
or vehicles for such as suspension may include fatty oils (for
example, sesame oil), synthetic fatty acid esters (for example,
ethyl oleate), triglycerides, or a polyethylene glycol such as
polyethylene glycol-400 (PEG-400). An aqueous suspension may
contain one or more substances to increase the viscosity of the
suspension, including, for example, sodium carboxymethyl cellulose,
sorbitol, and/or dextran. The suspension may optionally contain
stabilizers.
[0333] The following examples are illustrative, but not limiting,
of the compounds, compositions and methods of the present
invention. Suitable modifications and adaptations of the variety of
conditions and parameters normally encountered in clinical therapy
and which are obvious to those skilled in the art in view of this
disclosure are within the spirit and scope of the invention.
EXAMPLES
Example 1
N-(4-Fluorophenyl)-2-[1-(3-trifluoromethyl-benzenesulfonyl)-piperidin-4-yl-
amino]acetamide (6)
##STR00034##
[0335]
N-(4-Fluoro-phenyl)-2-[1-(3-trifluoromethyl-benzenesulfonyl)-piperi-
din-4-ylamino]acetamide (6) was prepared as follows.
3-Trifluoromethylphenylsulfonyl chloride (2) (1.7 g, Aldrich) was
added to a solution of compound 1 (1.16 g, Aldrich) and
triethylamine (TEA, 1 mL) at 0.about.5.degree. C. The reaction
mixture was stirred and warmed to room temperature over 12 hours
and then quenched with water (4 mL), extracted with dichloromethane
(DCM, 2.times.10 mL), and washed with brine (6 mL). The organic
layer was concentrated to obtain the crude product 3, which was
dissolved in 1,4-dioxane (15 mL) and treated with HCl (4N, 4 mL in
1,4-dioxane, Aldrich) at room temperature for 12 hours. The
solvents were removed under vacuum, and the residue was washed with
Et.sub.2O (2.times.15 mL) to give compound 4 as HCl-salt (white
solid).
[0336] A mixture of compound 4 (160 mg, 1.0 eq), K.sub.2CO.sub.3
(400 mg), KI (20 mg) and compound 5 (70 mg, 0.7 eq, Oakwood) in
CH.sub.3CN (3 mL) was heated and shaked at 40.degree. C. for 48
hours. The reaction mixture was diluted with EtOAc (4 mL), washed
with water (2 mL), concentrated under vacuum and purified by column
(Silica gel, EtOAc/Hexanes 1/1) to get the title compound 6 as
white solid (50 mg, yield 34%). .sup.1H NMR (400 MHz, CD.sub.3OD):
.delta. 9.09 (br, 1H, NH), 8.02 (s, 1H), 7.95 (d, 1H, 7.9 Hz), 7.87
(d, 1H, 7.7 Hz), 7.70 (dd, 1H, 7.7 & 7.9 Hz), 7.46-7.52 (m,
2H), 7.03 (dd, 2H, 8.5 & 8.9 Hz), 3.76-3.84 (m, 2H), 3.37 (s,
2H), 2.36-2.48 (m, 3H), 1.96-2.04 (m, 2H), 1.48-1.56 (m, 2H); LC:
100%; MS: m/z=460 (M+1).
Example 2
N-(4-Fluorophenyl)-2-[1-(3-trifluoromethylbenzenesulfonyl)-pyrrolidin-3-yl-
amino]-acetamide (10)
##STR00035##
[0338]
N-(4-Fluorophenyl)-2-[1-(3-trifluoromethylbenzenesulfonyl)-pyrrolid-
in-3-ylamino]-acetamide (10) was prepared as follows.
3-Trifluoromethylphenylsulfonyl chloride (2) (1.7 g, Aldrich) was
added to a solution of compound 7 (1.16 g, Astatech. Inc) and TEA
(1 mL) at 0.about.5.degree. C. The reaction mixture was stirred and
warmed to room temperature over 12 hours and then quenched with
water (4 mL), extracted with DCM (2.times.10 mL), and washed with
brine (6 mL). The organic layer was concentrated to obtain the
crude product 8, which was dissolved in 1,4-dioxane (15 mL) and
treated with HCl (4N, 4 mL in 1,4-dioxane, Aldrich) at room
temperature for 12 hours. The solvents were removed under vacuum,
and the residue was washed with Et.sub.2O (2.times.15 mL) to give
compound 9 as a HCl-salt (white solid).
[0339] A mixture of compound 9 (180 mg, 1.0 eq), K.sub.2CO.sub.3
(400 mg), KI (20 mg) and compound 5 (70 mg, 0.7 eq, Oakwood) in
CH.sub.3CN (3 mL) was heated and shaked at 40.degree. C. for 48
hours. The reaction mixture was diluted with EtOAc (4 mL), washed
with water (2 mL), concentrated under vacuum and purified by column
(Silica gel, EtOAc/Hexanes 1/1) to obtain the title compound 10 as
white solid (120 mg, yield 72%). .sup.1H NMR (400 MHz, CD.sub.3OD):
.delta. 8.93 (br, 1H, NH), 8.12 (s, 1H), 8.03 (d, 1H, 7.9 Hz), 7.86
(d, 1H, 7.7 Hz), 7.70 (dd, 1H, 7.7 & 7.9 Hz), 7.51-7.59 (m,
2H), 7.03 (dd, 2H, 8.5 & 8.6 Hz), 3.52-3.58 (m, 1H), 3.36-3.41
(m, 3H), 3.3-3.33 (m, 2H), 3.21-3.26 (m, 1H), 2.01-2.11 (m, 2H),
1.76-1.84 (m, 2H); LC: 100%; MS: m/z=446 (M+1).
Example 3
2-{Cyclopropyl-[1-(3-trifluoromethylbenzenesulfonyl)-piperidin-4-yl]amino}-
-N-(4-fluorophenyl)acetamide (14)
##STR00036##
[0341]
2-{Cyclopropyl-[1-(3-trifluoromethylbenzenesulfonyl)piperidin-4-yl]-
amino}-N-(4-fluorophenyl)acetamide (14) was prepared as follows. A
mixture of compound 11 (1.1 g, Oakwood), compound 5 (1.0 g),
K.sub.2CO.sub.3 (2 g), KI (100 mg) and CH.sub.3CN (15 mL) was
heated and stirred at 40.degree. C. for 72 hours. The reaction
mixture was diluted with EtOAc (30 mL), washed with water (10 mL),
and brine (10 mL). The organic layer was concentrated and purified
by column (silica gel, EtOAc/hexanes 1/1) to give compound 12 as a
colorless oil. Compound 12 was then dissolved in 10 mL of
1,4-dioxane and treated with 4 mL of HCl (4N in 1,4-dioxane) at
room temperature for 12 hours. The solvent was removed under
vacuum, the residue was washed with Et.sub.2O (2.times.20 mL), and
the solid was collected and dried to give compound 13 as white
solid (HCl-salt).
[0342] A mixture of compound 13 (180 mg), TEA (0.5 mL) and compound
2 (0.1 mL) in DCM (2 mL) was shaken at room temperature for 48
hours. The reaction mixture was then washed with water (2 mL) and
extracted with EtOAc (2 mL). The combined organic layers were
combined and washed with brine (2 mL), concentrated, and purified
by column (Silica gel, EtOAc/hexane 1/1) to give the title compound
14 as white solid (100 mg, yield 36%). .sup.1H NMR (400 MHz,
CD.sub.3OD): .delta. 8.78 (br, 1H, NH), 8.02 (s, 1H), 7.95 (d, 1H,
7.9 Hz), 7.86 (d, 1H, 7.8 Hz), 7.70 (dd, 1H, 7.8 & 7.9 Hz),
7.41-7.44 (m, 2H), 6.99-7.04 (m, 2H), 3.91-3.96 (m, 2H), 3.37 (s,
2H), 2.53-2.60 (m, 1H), 2.26-2.33 (m, 2H), 2.13-2.18 (m, 1H),
1.91-1.96 (m, 2H), 1.76-1.84 (m, 2H), 0.58-0.62 (m, 2H), 0.47-0.51
(m, 2H); LC: 100%; MS: m/z=500 (M+1).
Example 4
N-(3,5-Bis-(trifluoromethyl)phenyl)-2-[1-(3-trifluoromethyl-benzenesulfony-
l)piperidin-4-ylamino]acetamide (18)
##STR00037##
[0344]
N-(3,5-Bis-(trifluoromethyl)phenyl)-2-[1-(3-trifluoromethyl-benzene-
sulfonyl)piperidin-4-ylamino]acetamide (18) was prepared as
follows. Compound 16 (1.2 g, Aldrich) was added to a solution of
compound 15 (2.0 g, Aldrich) and TEA (2 mL) in DCM (20 mL) at
0.degree. C. The reaction mixture was warmed to room temperature
over 3 hours and then quenched with water (6 mL), washed with brine
(4 mL), concentrated, and purified by column (silica gel,
EtOAc/hexanes 1/9) to give compound 17 as colorless oil. A mixture
of compound 17 (150 mg), compound 4 (180 mg), K.sub.2CO.sub.3 (300
mg), and KI (20 mg) in CH.sub.3CN (4 mL) was shaken at 40.degree.
C. for 72 hours. The reaction mixture was diluted with EtOAc (4
mL), washed with water (2 mL), brine (4 mL), concentrated under
vacuum and purified by column (Silica gel, EtOAc/Hexanes 7/3) to
obtain the title compound 18 as white solid (100 mg, yield 37%).
.sup.1H NMR (400 MHz, CD.sub.3OD): .delta. 9.54 (br, 1H, NH), 8.06
(s, 2H), 8.0 (s, 1H), 7.94 (d, 1H, 7.9 Hz), 7.87 (d, 1H, 7.9 Hz),
7.70 (dd, 1H, 7.9 & 7.9 Hz), 7.59 (s, 1H), 3.81-3.84 (m, 2H),
3.42 (s, 2H), 2.45-2.51 (m, 1H), 2.35-2.42 (m, 2H), 1.98-2.04 (m,
2H), 1.49-1.59 (m, 2H); LC: 100%; MS: m/z=578 (M+1).
Example 5
N-(2,4-Difluorophenyl)-N'-[1-(3-trifluoromethylbenzenesulfonyl)-piperidin--
4-yl]malonamide (23)
##STR00038##
[0346]
N-(2,4-Difluorophenyl)-N'-[1-(3-trifluoromethylbenzenesulfonyl)-pip-
eridin-4-yl]malonamide (23) was prepared as follows. Compound 20
(6.0 mL, Aldrich) was added to a solution of compound 19 (5.0 g,
Aldrich) and TEA (6 mL) in DCM (30 mL) at 0.degree. C. The reaction
mixture was warmed to room temperature over 48 hours and then
quenched with water (10 mL), washed with brine (4 mL),
concentrated, and purified by column (silica gel, EtOAc/hexanes
3/7) to give compound 21 as white solid (5.0 g).
[0347] A solution of compound 21 (5 g, in 25 mL of MeOH) was
treated with KOH (2.2 g in 8 mL of water) at room temperature for
24 hours. The solvents were removed under vacuum, water (10 mL) and
EtOAc (30 mL) were added to dissolve the residue, and neutralized
with HCl (5N aquous) to pH.about.5. The organic layer was
separated, washed with brine, and concentrated to give compound 22
as pale-yellow solid (4.5 g). Diisopropyl azodicarboxylate (DIC, 70
mg) was added to a mixture of compound 22 (100 mg), compound 4 (200
mg), TEA (0.3 mL), 1-hydroxybenzotriazole (HOBt, 30 mg) in DCM (2
mL) at room temperature. The resulting mixture was shaken at room
temperature for 48 hours and then the solid was filtered of, the
filtrate was concentrated and purified by column (silica gel,
EtOAc/hexane 1/1) to give the title compound 23 as white solid (150
mg, yield 65%). NMR (400 MHz, CD.sub.3OD): .delta. 9.33 (br, 1H,
NH), 8.11-8.17 (m, 1H), 8.02 (s, 1H), 7.95 (d, 1H, 7.9 Hz), 7.89
(d, 1H, 7.9 Hz), 7.72 (dd, 1H, 7.9 & 7.9 Hz), 6.85-6.89 (m,
2H), 6.51 (d, 1H, 7.9 Hz), 3.78-3.84 (m, 3H), 3.32 (s, 2H),
2.45-2.52 (m, 1H), 2.01-2.06 (m, 2H), 1.58-1.65 (m, 2H); MS:
m/z=506 (M+1).
Example 6
[0348] Compounds of the invention have been tested in the calcium
mobilization and/or electrophysiological assay for N-type calcium
channel blocking activity, which are described in detail above.
Some compounds described have also been tested in the calcium
mobilization assay for L-type calcium channel blocking activity,
which is described in detail above. Representative values are
presented in TABLE 2.
TABLE-US-00002 TABLE 2 Evaluation of the tested compounds as N-type
calcium channel (NTCC) blockers and L-type calcium channel (LTCC)
blockers after a calcium mobilization in vitro assay NTCC LTCC
COMPOUND IC.sub.50 (.mu.M) IC.sub.50 (.mu.M)
N-(4-fluorophenyl)-2-[1-(3-trifluoromethyl- 0.46 >20
benzenesulfonyl)piperidin-4-ylamino]acetamide (6)
2-{cyclopropyl-[1-3-trifluoromethyl- 0.79 9.33
benzenesulfonyl)piperidin-4-yl]amino}-N-(4- fluorophenyl)acetamide
(14) N-(4-fluorophenyl)-2-[1-(3-trifluoromethyl- 0.47 5.98
benzenesulfonyl)pyrrolidin-3-ylamino]acetamide (10)
N-(3,5-bis-(trifluoromethyl)phenyl)-2-[1-(3- 0.74 >20
trifluoromethylbenzenesulfonyl)piperidin-4- ylamino]acetamide (18)
N-(2,4-difluorophenyl)-N'-[1-(3-trifluoromethyl- 1.29 ND
benzenesulfonyl)-piperidin-4-yl]malonamide (23) ND = not
determined
[0349] Having now fully described this invention, it will be
understood by those of ordinary skill in the art that the same can
be performed within a wide and equivalent range of conditions,
formulations and other parameters without affecting the scope of
the invention or any embodiment thereof.
[0350] Other embodiments of the invention will be apparent to those
skilled in the art from consideration of the specification and
practice of the invention disclosed herein. It is intended that the
specification and examples be considered as exemplary only, with a
true scope and spirit of the invention being indicated by the
following claims.
[0351] All patents and publications cited herein are fully
incorporated by reference herein in their entirety.
* * * * *