U.S. patent application number 11/982034 was filed with the patent office on 2010-03-04 for ikb kinase, subunits thereof, and methods of using same.
This patent application is currently assigned to The Regents Of the University Of California. Invention is credited to Joseph A. DiDonato, Makio Hayakawa, Michael Karin, David M. Rothwarf, Ebrahim Zandi.
Application Number | 20100055714 11/982034 |
Document ID | / |
Family ID | 26741106 |
Filed Date | 2010-03-04 |
United States Patent
Application |
20100055714 |
Kind Code |
A1 |
Karin; Michael ; et
al. |
March 4, 2010 |
IKB kinase, subunits thereof, and methods of using same
Abstract
The present invention provides an isolated nucleic acid
molecules encoding I.kappa.B kinase (IKK) catalytic subunit
polypeptides, which are associated with an IKK serine protein
kinase that phosphorylates a protein (I.kappa.B) that inhibits the
activity of the NF-.kappa.B transcription factor, vectors
comprising such nucleic acid molecules and host cells containing
such vectors. In addition, the invention provides nucleotide
sequences that can bind to a nucleic acid molecule of the
invention, such nucleotide sequences being useful as probes or as
antisense molecules. The invention also provides isolated IKK
catalytic subunits, which can phosphorylate an I.kappa.B protein,
and peptide portions of such IKK subunit. In addition, the
invention provides anti-IKK antibodies, which specifically bind to
an IKK complex or an IKK catalytic subunit, and IKK-binding
fragments of such antibodies. The invention further provides
methods of substantially purifying an IKK complex, methods of
identifying an agent that can alter the association of an IKK
complex or an IKK catalytic subunit with a second protein, and
methods of identifying proteins that can interact with an IKK
complex or an IKK catalytic subunit.
Inventors: |
Karin; Michael; (San Diego,
CA) ; DiDonato; Joseph A.; (Westlake, OH) ;
Rothwarf; David M.; (La Jolla, CA) ; Hayakawa;
Makio; (Tokyo, JP) ; Zandi; Ebrahim; (Duarte,
CA) |
Correspondence
Address: |
MEDLEN & CARROLL, LLP
101 HOWARD STREET, SUITE 350
SAN FRANCISCO
CA
94105
US
|
Assignee: |
The Regents Of the University Of
California
|
Family ID: |
26741106 |
Appl. No.: |
11/982034 |
Filed: |
October 31, 2007 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10739821 |
Dec 17, 2003 |
7314615 |
|
|
11982034 |
|
|
|
|
09796872 |
Feb 28, 2001 |
6689575 |
|
|
10739821 |
|
|
|
|
09168629 |
Oct 8, 1998 |
6242253 |
|
|
09796872 |
|
|
|
|
60061470 |
Oct 9, 1997 |
|
|
|
Current U.S.
Class: |
435/7.2 ;
435/194; 435/325; 435/326; 435/7.1; 530/387.1 |
Current CPC
Class: |
G01N 2333/9121 20130101;
C12Q 1/48 20130101; C12Y 207/1101 20130101; G01N 33/6842 20130101;
A61K 38/00 20130101; C07K 16/40 20130101; G01N 33/68 20130101; C12N
9/1205 20130101 |
Class at
Publication: |
435/7.2 ;
530/387.1; 435/326; 435/7.1; 435/194; 435/325 |
International
Class: |
G01N 33/53 20060101
G01N033/53; C07K 16/18 20060101 C07K016/18; C12N 5/16 20060101
C12N005/16; C12N 9/12 20060101 C12N009/12; C12N 5/071 20100101
C12N005/071 |
Goverment Interests
[0002] This invention was made with government support under grant
number CA50528 awarded by the National Institutes of Health. The
government has certain rights in the invention.
Claims
1-12. (canceled)
13. An antibody that specifically binds to the protein set forth as
SEQ ID NO: 15.
14. A cell line producing the antibody of claim 13.
15. The cell line of claim 14, which is a hybridoma cell line.
16. A method of identifying an agent that modulates the specific
association of a polypeptide of an IKB kinase (IKK) subunit and a
second protein, comprising the steps of: a) contacting the IKK
subunit and the second protein, under conditions suitable for the
specific association of said IKK subunit and said second protein,
with an agent suspected of being able to modulate said specific
association; and b) detecting an altered association of said IKK
subunit and said second protein in the presence of said agent,
wherein said altered association identifies an agent that modulates
the specific association of said IKK subunit and said second
protein.
17. The method of claim 16, wherein said contacting is in an in
vitro reaction and said IKK subunit is isolated.
18. The method of claim 17, wherein said contacting is in a cell in
culture.
19. The method of claim 18, wherein said cell is selected from the
group consisting of a mammalian cell and a yeast cell.
20. The method of claim 18, wherein said altered association is
detected by measuring the transcriptional activity of a reporter
gene.
21. The method of claim 16, wherein said IKK subunit is IKK.alpha.
or IKK.beta..
22. The method of claim 16, wherein said second protein is an IKB
protein.
23. The method of claim 22, wherein said IKB protein is selected
from the group consisting of IKB.alpha. and IK.beta..
24. The method of claim 16, wherein said second protein is a
subunit of a 300 kDa IKB kinase complex or a 900 kDa IKB kinase
complex.
25. The method of claim 25, wherein said subunit is IKK.alpha. or
IKK.beta..
26. The method of claim 16, wherein said agent is an organic
molecule.
27. The method of claim 16, wherein said agent is a peptide.
28. The method of claim 27, wherein said peptide is a mutant IKB
protein selected from the group consisting of a mutant IKB.alpha.
containing amino acid substitutions for serine-32 and for serine-36
and a mutant IKB.beta. containing amino acid substitutions for
serine-19 and for serine-23.
29. A method for identifying an agent that alters IKB kinase (IKK)
activity, comprising the steps of: a) incubating an isolated
composition having IKK activity with an agent suspected of being
able to alter said IKK activity; and b) determining altered IKK
activity of said composition in the presence of said agent, wherein
said altered IKK activity identifies an agent that alters said IKK
activity of said composition.
30. The method of claim 29, wherein said agent is a protein kinase
inhibitor.
31. The method of claim 29, wherein said composition comprises an
IKK subunit.
32. The method of claim 29, wherein said composition comprises a
300 kDa IKB kinase complex or a 900 kDa IKB kinase complex.
33. The method of claim 32, wherein said composition comprises
IKK.alpha. or IKK.beta..
34. A method of obtaining isolated IKB kinase (IKK) from a sample
containing the IKK, comprising the steps of: a) contacting the
sample containing the IKK with an antibody that specifically binds
to said IKK or binds to a tag linked thereto; and b) obtaining
isolated IKK bound to said antibody.
35. The method of claim 34, wherein said antibody specifically
binds an IKK catalytic subunit.
36. The method of claim 35, wherein said catalytic subunit is
IKK.alpha. or IKK.beta..
37. The method of claim 34, wherein said antibody specifically
binds said tag linked to an IKK catalytic subunit.
38. The method of claim 37, wherein said tag comprises a peptide
tag selected from an HA tag, a HIS6 tag and a FLAG tag.
39. The method of claim 34, wherein said antibody specifically
binds an IKK complex.
40. A method of modulating NF-KB activity in a cell, comprising
contacting the cell with an agent that i) either alters the
association of an IKB kinase (IKK) or an IKK catalytic subunit and
a second protein; ii) alters the activity of said IKB kinase; or
iii) alters expression of said IKK catalytic subunit.
41. (canceled)
42. The method of claim 40, comprising introducing into the cell an
antisense I.kappa.B kinase subunit nucleic acid molecule.
43. The method of claim 42, wherein said antisense I.kappa.B kinase
subunit nucleic acid molecule is expressed in the cell from a
vector.
Description
[0001] This application is based on, and claims the benefit of,
U.S. Provisional Application No. 60/061,470, filed Oct. 9, 1997,
the entire contents of which is herein incorporated by
reference.
BACKGROUND OF THE INVENTION
[0003] 1. Field of the Invention
[0004] The present invention relates generally to molecular biology
and biochemistry and more specifically to a protein kinase,
I.kappa.B kinase, which is activated in response to environmental
stresses and proinflammatory signals to phosphorylate inhibitors of
the NF-.kappa.B transcription factors and to methods of using the
protein kinase.
[0005] 2. Background Information
[0006] The induction of gene expression due to exposure of a cell
to a specific stimulus is a tightly controlled process. Depending
on the inducing stimulus, it can be critical to survival of the
cell that one or more genes be rapidly induced, such that the
expressed gene product can mediate its effect. For example, an
inflammatory response stimulated due to an injury to or infection
of a tissue results in rapid vasodilation in the area of the injury
and infiltration of effector cells such as macrophages.
Vasodilation occurs within minutes of the response and is due, in
part, to the expression of cytokines in the injured region.
[0007] The rapid induction, for example, of an inflammatory
response or an immune response, requires that the transcription
factors involved in regulating such responses be present in the
cell in a form that is amenable to rapid activation. Thus, upon
exposure to an inducing stimulus, the response can occur quickly.
If, on the other hand, such transcription factors were not already
present in a cell in an inactive state, the factors first would
have to be synthesized upon exposure to an inducing stimulus,
greatly reducing the speed with which a response such as an
inflammatory response could occur.
[0008] Regulation of the activity of transcription factors involved
in such rapid induction of gene expression can occur by various
mechanisms. For example, in some cases, a transcription factor that
exists in an inactive state in a cell can be activated by a
post-translational modification such as phosphorylation on one or
more serine, threonine or tyrosine residues. In addition, a
transcription factor can be inactive due to an association with a
regulatory factor, which, upon exposure to an inducing stimulus, is
released from the transcription factor, thereby activating the
transcription factor. Alternatively, an inactive transcription
factor may have to associate with a second protein in order to have
transcriptional activity.
[0009] Rarely, as in the case of glucocorticoids, the inducing
stimulus interacts directly with the inactive transcription factor,
rendering it active and resulting in the induction of gene
expression. More often, however, an inducing stimulus initiates the
induced response by interacting with a specific receptor present on
the cell membrane or by entering the cell and interacting with an
intracellular protein. Furthermore, the signal generally is
transmitted along a pathway, for example, from the cell membrane to
the nucleus, due to a series of interactions of proteins. Such
signal transduction pathways allow for the rapid transmission of an
extracellular inducing stimulus such that the appropriate gene
expression is rapidly induced.
[0010] Although the existence of signal transduction pathways has
long been recognized and many of the cellular factors involved in
such pathways have been described, the pathways responsible for the
expression of many critical responses, including the inflammatory
response and immune response, have not been completely defined. For
example, it is recognized that various inducing stimuli such as
bacteria or viruses activate common arms of the immune and
inflammatory responses. However, differences in the gene products
expressed also are observed, indicating that these stimuli share
certain signal transduction pathways but also induce other pathways
unique to the inducing stimulus. Furthermore, since inducing agents
such as bacteria or viruses initially stimulate different signal
transduction pathways, yet induce the expression of common genes,
some signal transduction pathways must converge at a point such
that the different pathways activate common transcription
factors.
[0011] A clearer understanding of the proteins involved in such
pathways can allow a description, for example, of the mechanism of
action of a drug that is known to interfere with the expression of
genes regulated by a particular pathway, but the target of which is
not known. In addition, the understanding of such pathways can
allow the identification of a defect in the pathway that is
associated with a disease such as cancer. For example, the altered
expression of cell adhesion molecules is associated with the
ability of a cancer cell to metastasize. However, the critical
proteins involved in the signal transduction pathway leading to
expression of cell adhesion molecules have not been identified.
Thus, a need exists to identify the proteins involved in signal
transduction pathways, particularly those proteins present at the
convergence point of different initial pathways that result in the
induction, for example, of gene products involved in the
inflammatory and immune responses. The present invention satisfies
this need and provides related advantages as well.
SUMMARY OF THE INVENTION
[0012] The present invention provides isolated nucleic acid
molecules encoding full length human serine protein kinases,
designated I.kappa.B kinase (IKK) subunits IKK.alpha. and
IKK.beta.. The disclosed IKK subunits share substantial sequence
homology and are activated in response to proinflammatory signals
to phosphorylate proteins (I.kappa.B's) that inhibit the activity
of the NF-.kappa.B transcription factor.
[0013] For example, the invention provides a nucleic acid molecule
having the nucleotide sequence shown as SEQ ID NO: 1, which encodes
a cytokine inducible I.kappa.B kinase subunit designated
IKK.alpha., particularly the sequence shown as nucleotides -35 to
92 in SEQ ID NO: 1, and nucleic acid molecules encoding the amino
acid sequence shown as SEQ ID NO: 2, as well as nucleotide
sequences complementary thereto. In addition, the invention
provides a nucleic acid molecule having the nucleotide sequence
shown as SEQ ID NO: 14, which encodes a second cytokine inducible
I.kappa.B kinase subunit, designated IKK.beta., and nucleic acid
molecules encoding the amino acid sequence shown as SEQ ID NO: 15,
as well nucleotide sequences complementary thereto. The invention
also provides vectors comprising the nucleic acid molecules of the
invention and host cells containing such vectors.
[0014] In addition, the invention provides nucleotide sequences
that bind to a nucleic acid molecule of the invention, including to
nucleotides -35 to 92 as shown in SEQ ID NO: 1. Such nucleotide
sequences of the invention are useful as probes, which can be used
to identify the presence of a nucleic acid molecule encoding an IKK
subunit in a sample, and as antisense molecules, which can be used
to inhibit the expression of a nucleic acid molecule encoding an
IKK subunit.
[0015] The present invention also provides isolated full length
human IKK subunits, which can phosphorylate an I.kappa.B protein.
For example, the invention provides an IKK.alpha. polypeptide
having the amino acid sequence shown as SEQ ID NO: 2, particularly
the amino acid sequence comprising amino acids 1 to 31 at the
N-terminus of the polypeptide of SEQ ID NO: 2. In addition, the
invention provides an IKK polypeptide having the amino acid
sequence shown as SEQ ID NO: 15. The invention also provides
peptide portions of an IKK subunit, including, for example, peptide
portions comprising one or more contiguous amino acids of the
N-terminal amino acids shown as residues 1 to 31 in SEQ ID NO: 2. A
peptide portion of an IKK subunit can comprise the kinase domain of
the IKK subunit or can comprise a peptide useful for eliciting
production of an antibody that specifically binds to an I.kappa.B
kinase or to the IKK subunit. Accordingly, the invention also
provides anti-IKK antibodies that specifically bind to an IKK
complex comprising an IKK subunit, particularly to the IKK subunit,
for example, to an epitope comprising at least one of the amino
acids shown as residues 1 to 31 of SEQ ID NO: 2, and also provides
IKK subunit-binding fragments of such antibodies. In addition, the
invention provides cell lines producing anti-IKK antibodies or
IKK-binding fragments thereof.
[0016] The invention also provides isolated I.kappa.B kinase
complexes. As disclosed herein, an IKK complex can have an apparent
molecular mass of about 900 kDa or about 300 kDa. An IKK complex is
characterized, in part, in that it comprises an IKK.alpha. subunit,
an IKK.beta. subunit, or both and can phosphorylate an I.kappa.B
protein.
[0017] The present invention further provides methods for isolating
an IKK complex or an IKK subunit, as well as methods of identifying
an agent that can alter the association of an IKK complex or an IKK
subunit with a second protein that associates with the IKK in vitro
or in vivo. Such a second protein can be, for example, another IKK
subunit; an I.kappa.B protein, which is a substrate for IKK
activity and is involved in a signal transduction pathway that
results in the regulated expression of a gene; a protein that is
upstream of the I.kappa.B kinase in a signal transduction pathway
and regulates IKK activity; or a protein that acts as a regulatory
subunit of the I.kappa.B kinase or of an IKK subunit and is
necessary for full activation of the IKK complex. An agent that
alters the association of an IKK subunit with a second protein can
be, for example, a peptide, a polypeptide, a peptidomimetic or a
small organic molecule. Such agents can be useful for modulating
the level of phosphorylation of I.kappa.B in a cell, thereby
modulating the activity of NF-.kappa.B in the cell and the
expression of a gene regulated by NF-.kappa.B.
[0018] The invention also provides methods of identifying proteins
that can interact with an I.kappa.B kinase, including with an IKK
subunit, such proteins which can be a downstream effector of the
IKK such as a member of the I.kappa.B family of proteins or an
upstream activator or a regulatory subunit of an IKK. Such proteins
that interact with an IKK complex or the IKK subunit can be
isolated, for example, by coprecipitation with the IKK or by using
the IKK subunit as a ligand, and can be involved, for example, in
tissue specific regulation of NF-.kappa.B activation and consequent
tissue specific gene expression.
BRIEF DESCRIPTION OF THE DRAWINGS
[0019] FIG. 1 shows a nucleotide sequence (SEQ ID NO: 1; lower case
letter) and deduced amino acid sequence (SEQ ID NO: 2; upper case
letters) of full length human IKK.alpha. subunit of an IKK complex.
Nucleotide positions are indicated to the right and left of the
sequence; the "A" of the ATG encoding the initiator methionine is
shown as position 1. Underlined amino acid residues indicate the
peptide portions of the protein ("peptide 1" and "peptide 2") that
were sequenced and used to design oligonucleotide probes. The
asterisk indicates the sequence encoding the STOP codon.
[0020] FIG. 2 shows a nucleotide sequence (SEQ ID NO: 14) encoding
a full length IKK.beta. polypeptide (see FIG. 3). Numbers to the
left and right of the sequence indicate nucleotide position number.
The initiator ATG codon is present at nucleotides 36-38 and the
first stop codon (TGA) is present at nucleotides 2304-2306.
[0021] FIG. 3 shows an alignment of the deduced amino acid
sequences of IKK.alpha. (".alpha.", SEQ ID NO: 2) and IKK.beta.
(".beta.", SEQ ID NO: 15). Numbers to the right of the sequences
indicate the respective amino acid positions. Underlined amino acid
residues indicate peptide portions of the IKK.beta. subunit that
were sequenced and used to search an EST database (see Example
III). Vertical bars between amino acid residues indicate identical
amino acids; two dots between amino acid residues indicates very
similar amino acids (e.g., Glu and Asp; Arg and Lys) and one dot
between amino acid residues indicates a lesser degree of
similarity. A dot within an amino acid sequence indicates a space
introduced to maintain sequence homology. The kinase domains in the
N-terminal half of the sequences and helix-loop-helix domains in
the C-terminal half of the sequences are bracketed and the leucine
residues involved in the leucine zippers are indicated by the
filled circles above the IKK.alpha. sequence.
DETAILED DESCRIPTION OF THE INVENTION
[0022] The present invention provides isolated nucleic acid
molecules encoding polypeptide subunits of human serine protein
kinase complex, the I.kappa.B kinase (IKK), which is activated in
response to proinflammatory signals and phosphorylates proteins
(I.kappa.B's) that bind to and inhibit the activity of NF-.kappa.B
transcription factors. For example, the invention provides an
isolated nucleic acid molecule (SEQ ID NO: 1) encoding a full
length human IKK.alpha. subunit having the amino acid sequence
shown as SEQ ID NO: 2 (FIG. 1). In addition, the invention provides
an isolated nucleic acid molecule (SEQ ID NO: 14; FIG. 2) encoding
a full length human IKK.beta. subunit having the amino acid
sequence shown as SEQ ID NO: 15 (FIG. 3).
[0023] As used herein, the term "isolated," when used in reference
to a nucleic acid molecule of the invention, means that the nucleic
acid molecule is relatively free from contaminating lipids,
proteins, nucleic acids or other cellular material normally
associated with a nucleic acid molecule in a cell. An isolated
nucleic acid molecule of the invention can be obtained, for
example, by chemical synthesis of the nucleotide sequence shown as
SEQ ID NO: 1 or SEQ ID NO: 14 or by cloning the molecule using
methods such as those disclosed in Examples II and III. In general,
an isolated nucleic acid molecule comprises at least about 30% of a
sample containing the nucleic acid molecule, and generally
comprises about 50% or 70% or 90% of a sample, preferably 95% or
98% of the sample. Such an isolated nucleic acid molecule can be
identified by comparing, for example, a sample containing the
isolated nucleic acid molecule with the material from which the
sample originally was obtained. Thus, an isolated nucleic acid
molecule can be identified, for example, by comparing the relative
amount of the nucleic acid molecule in fraction of a cell lysate
obtained following gel electrophoresis with the relative amount of
the nucleic acid molecule in the cell, itself.
[0024] IKK.alpha. and IKK.beta. have been designated IKK subunits
because they are components of an approximately 900 kDa complex
having I.kappa.B kinase (IKK) activity and because they share
substantial nucleotide and amino acid sequence homology. As
disclosed herein, IKK.alpha. and IKK.beta. are related members of a
family of IKK catalytic subunits (see FIG. 3). The 900 kDa
I.kappa.B kinase complex can be isolated in a single step, for
example, by immunoprecipitation using an antibody specific for an
IKK subunit or by using metal ion chelation chromatography methods
(see Example IV). A 300 kDa IKK complex also can be isolated as
disclosed herein and has kinase activity for an I.kappa.B substrate
(see Example III).
[0025] Nucleic acid molecules related to SEQ ID NO: 1 previously
have been described (Connelly and Marcu, Cell. Mol. Biol. Res.
41:537-549 (1995), which is incorporated herein by reference). For
example, Connelly and Marcu describe a 3466 base pair (bp) nucleic
acid molecule (GenBank Accession #U12473; Locus MMU 12473), which
is incorporated herein by reference), which encodes a full length
mouse polypeptide having an apparent molecular mass of 85
kiloDaltons (kDa) and designated CHUK. A 2146 bp nucleic acid
molecule (GenBank Accession #U22512; Locus HSU 22512), which is
incorporated herein by reference), which encodes a portion of the
polypeptide shown in SEQ ID NO: 2 also was described. However, the
amino acid sequence deduced from #U22512 lacks amino acids 1 to 31
as shown in SEQ ID NO: 2 and, therefore, is not a full length
protein. In addition, several nucleotide differences occur in SEQ
ID NO: 1 as compared to the sequence of #U22512, including
nucleotide changes that encode different amino acids at positions
543, 604, 679, 680, 684 and 685 of SEQ ID NO: 2; silent nucleotide
changes also occur at codons 665 and 678. The polypeptides encoded
by the nucleotide sequences of GenBank Accession #U12473 and
#U22512 share about 95% identity at the amino acid level and are
substantially similar to that shown in SEQ ID NO: 2. No function
has been demonstrated for the polypeptides described by Connelly
and Marcu, although Regnier et al. (Cell 90:373-383 (1997))
recently have confirmed that human CHUK corresponds to IKK.alpha.,
as disclosed herein.
[0026] A nucleic acid molecule of the invention is exemplified by
the nucleotide sequences shown as SEQ ID NO: 1, which encodes a
full length human IKK.alpha. (SEQ ID NO: 2; FIG. 1), the activity
of which is stimulated by a cytokine or other proinflammatory
signal, and as SEQ ID NO: 14, which encodes a full length IKK.beta.
(SEQ ID NO: 15). Due to the degeneracy of the genetic code and in
view of the disclosed amino acid sequence of a full length human
IKK.alpha. (SEQ ID NO: 2) and of the IKK.beta. (SEQ ID NO: 15),
additional nucleic acid molecules of the invention would be well
known to those skilled in the art. Such nucleic acid molecules,
respectively, have a nucleotide sequence that is different from SEQ
ID NO: 1 but, nevertheless, encodes the amino acid sequence shown
as SEQ ID NO: 2, or have a nucleotide sequence that is different
from SEQ ID NO: 14 but, nevertheless, encodes the amino acid
sequence shown as SEQ ID NO: 15. Thus, the invention provides a
nucleic acid molecule comprising a nucleotide sequence encoding the
amino acid sequence of a full length human IKK.alpha. as shown in
SEQ ID NO: 2 or of IKK.beta. as shown in SEQ ID NO: 15.
[0027] As used herein, reference to "a nucleic acid molecule
encoding an IKK subunit" indicates 1) the polynucleotide sequence
of one strand of a double stranded DNA molecule comprising the
nucleotide sequence that codes for the IKK subunit and can be
transcribed into an RNA that encodes the IKK subunit, or 2) an RNA
molecule, which can be translated into an IKK subunit. It is
recognized that a double stranded DNA molecule also comprises a
second polynucleotide strand that is complementary to the coding
strand and that the disclosure of a polynucleotide sequence
comprising a coding sequence necessarily discloses the
complementary polynucleotide sequence. Accordingly, the invention
provides polynucleotide sequences, including, for example,
polydeoxyribonucleotide or polyribonucleotide sequences that are
complementary to the nucleotide sequence shown as SEQ ID NO: 1 or
as SEQ ID NO: 14, or to a nucleic acid molecule encoding an IKK
catalytic subunit having the amino acid sequence shown as SEQ ID
NO: 2 or as SEQ ID NO: 15, respectively.
[0028] As used herein, the term "polynucleotide" is used in its
broadest sense to mean two or more nucleotides or nucleotide
analogs linked by a covalent bond. The term "oligonucleotide" also
is used herein to mean two or more nucleotides or nucleotide
analogs linked by a covalent bond, although those in the art will
recognize that oligonucleotides generally are less than about fifty
nucleotides in length and, therefore, are a subset within the
broader meaning of the term "polynucleotide."
[0029] In general, the nucleotides comprising a polynucleotide are
naturally occurring deoxyribonucleotides, such as adenine,
cytosine, guanine or thymine linked to 2'-deoxyribose, or
ribonucleotides such as adenine, cytosine, guanine or uracil linked
to ribose. However, a polynucleotide also can comprise nucleotide
analogs, including non-naturally occurring synthetic nucleotides or
modified naturally occurring nucleotides. Such nucleotide analogs
are well known in the art and commercially available, as are
polynucleotides containing such nucleotide analogs (Lin et al.,
Nucl. Acids Res. 22:5220-5234 (1994); Jellinek et al., Biochemistry
34:11363-11372 (1995); Pagratis et al., Nature Biotechnol. 15:68-73
(1997)). The covalent bond linking the nucleotides of a
polynucleotide generally is a phosphodiester bond. However, the
covalent bond also can be any of numerous other bonds, including a
thiodiester bond, a phosphorothioate bond, a peptide-like bond or
any other bond known to those in the art as useful for linking
nucleotides to produce synthetic polynucleotides (see, for example,
Tam et al., Nucl. Acids Res. 22:977-986 (1994); Ecker and Crooke,
BioTechnology 13:351360 (1995)).
[0030] Where it is desired to synthesize a polynucleotide of the
invention, the artisan will know that the selection of particular
nucleotides or nucleotide analogs and the covalent bond used to
link the nucleotides will depend, in part, on the purpose for which
the polynucleotide is prepared. For example, where a polynucleotide
will be exposed to an environment containing substantial nuclease
activity, the artisan will select nucleotide analogs or covalent
bonds that are relatively resistant to the nucleases. A
polynucleotide comprising naturally occurring nucleotides and
phosphodiester bonds can be chemically synthesized or can be
produced using recombinant DNA methods, using an appropriate
polynucleotide as a template. In comparison, a polynucleotide
comprising nucleotide analogs or covalent bonds other than
phosphodiester bonds generally will be chemically synthesized,
although an enzyme such as T7 polymerase can incorporate certain
types of nucleotide analogs and, therefore, can be used to produce
such a polynucleotide recombinantly from an appropriate template
(Jellinek et al., supra, 1995).
[0031] The invention also provides nucleotide sequences that can
specifically hybridize to a nucleic acid molecule of the invention.
Such hybridizing nucleotide sequences are useful, for example, as
probes, which can hybridize to a nucleic acid molecule encoding an
IKK catalytic subunit and allow the identification of the nucleic
acid molecule in a sample. A nucleotide sequence of the invention
is characterized, in part, in that it is at least nine nucleotides
in length, such sequences being particularly useful as primers for
the polymerase chain reaction (PCR), and can be at least fourteen
nucleotides in length or, if desired, at least seventeen
nucleotides in length, such nucleotide sequences being particularly
useful as hybridization probes, although such sequences also can be
used for PCR. A nucleotide sequence of the invention can comprise
at least six nucleotides 5' to nucleotide position 92 as shown in
SEQ ID NO: 1 (FIG. 1), preferably at least nine nucleotides 5' to
position 92, or more as desired, where SEQ ID NO: 1 is shown in the
conventional manner from the 5'-terminus (FIG. 1; upper left) to
the 3'-terminus. Such nucleotide sequences of the invention are
particularly useful in methods of diagnosing a pathology, for
example, a human disease, characterized by aberrant IKK activity.
For convenience, such nucleotide sequences can comprise a kit,
which can be made commercially available and can provide a
standardized diagnostic assay.
[0032] A nucleic acid molecule encoding an IKK.alpha. such as the
nucleotide sequence shown in SEQ ID NO: 1 diverges from the
sequence encoding the mouse homolog (GenBank Accession #U12473) in
the region encoding amino acid 30. Thus, a nucleotide sequence
comprising nucleotides 88 to 90 as shown in SEQ ID NO: 1, which
encodes amino acid 30 of human IKK.alpha., can be particularly
useful, for example, for identifying the presence of a nucleic acid
molecule encoding a human IKK.alpha. in a sample. Furthermore,
based on a comparison of SEQ ID NO: 1 with SEQ ID NO: 14, the
skilled artisan readily can select nucleotide sequences that can
hybridize with a nucleic acid molecule encoding a human IKK.alpha.
or a human IKK.beta. or both by designing the sequence to contain
conserved or non-conserved nucleotide sequences, as desired. For
example, selection of a nucleotide sequence that is highly
conserved among SEQ ID NO: 1 and SEQ ID NO: 14 can allow the
identification of related members of the IKK subunit family of
proteins. In comparison, selection of a nucleotide sequence that is
present, for example, in SEQ ID NO: 14, but that is not present in
SEQ ID NO: 1 or that shares only minimal homology can allow
identification of the expression of SEQ ID NO: 14 in a cell,
irrespective of whether SEQ ID NO: 1 also is expressed in the cell.
It should be recognized, however, that a nucleotide sequence of the
invention readily is identifiable in comparison to GenBank
Accession #U12473 or #U22512 in that a nucleotide sequence of the
invention is not the nucleotide sequence of GenBank Accession
#U12473 or #U22512.
[0033] A nucleotide sequence of the invention can comprise a
portion of a coding sequence of a nucleic acid molecule encoding an
IKK subunit or of a sequence complementary thereto, depending on
the purpose for which the nucleotide sequence is to be used. In
addition, a mixture of a coding sequence and its complementary
sequence can be prepared and, if desired, can be allowed to anneal
to produce double stranded molecules.
[0034] The invention also provides antisense nucleic acid
molecules, which are complementary to a nucleic acid molecule
encoding an IKK subunit and can bind to and inhibit the expression
of the nucleic acid molecule. As disclosed herein, expression of an
antisense molecule complementary to the nucleotide sequence shown
in SEQ ID NO: 1 inhibited the cytokine inducible expression of an
NF-.kappa.B dependent reporter gene in a cell (Example II.B.).
Thus, an antisense molecule of the invention can be useful for
decreasing IKK activity in a cell, thereby reducing or inhibiting
the level of NF-.kappa.B mediated gene expression. These
experiments were performed twenty-four hours after the cells were
transfected (Example II.B.). Expression of the antisense molecule
in the cell also resulted in a decreased level of IKK.alpha.
activity as compared to vector transfected control cells,
indicating that the IKK.alpha. has a relatively short half life.
Antisense nucleic acid molecules specific for IKK.alpha. or for
IKK.beta. or for both can be designed based on the criteria
discussed above for the selection of hybridizing nucleotide
sequences.
[0035] An antisense nucleic acid molecule of the invention can
comprise a sequence complementary to the entire coding sequence of
an IKK catalytic subunit such as a sequence complementary to SEQ ID
NO: 1 or SEQ ID NO: 14, provided the antisense sequence is not
complementary in its entirety to the sequences of GenBank Accession
#U12473 or #U22512. In addition, a nucleotide sequence
complementary to a portion of a nucleic acid molecule encoding an
IKK subunit can be useful as an antisense molecule, particularly a
nucleotide sequence complementary to nucleotides -35 to 92 of SEQ
ID NO: 1 or, for example, a nucleotide sequence comprising at least
9 nucleotides on each side of the ATG encoding the initiator
methionine (complementary to positions -9 to 12 of SEQ ID NO: 1)
or, if desired, at least 17 nucleotides on each side of the ATG
codon (complementary to positions -17 to 20 of SEQ ID NO: 1), or to
the corresponding sequences of SEQ ID NO: 14.
[0036] Antisense methods involve introducing the nucleic acid
molecule, which is complementary to and can hybridize to the target
nucleic acid molecule, into a cell. An antisense nucleic acid
molecule can be a chemically synthesized polynucleotide, which can
be introduced into the target cells by methods of transfection, or
can be expressed from a plasmid or viral vector, which can be
introduced into the cell and stably or transiently expressed using
well known methods (see, for example, Sambrook et al., Molecular
Cloning: A laboratory manual (Cold Spring Harbor Laboratory Press
1989); Ausubel et al., Current Protocols in Molecular Biology
(Green Publ., NY 1989), each of which is incorporated herein by
reference). One in the art would know that the ability of an
antisense (or other hybridizing) nucleotide sequence to
specifically hybridize to the target nucleic acid sequence depends,
for example, on the degree of complementarity shared between the
sequences, the GC content of the hybridizing molecules, and the
length of the antisense nucleic acid sequence, which can be at
least ten nucleotides in length, generally at least thirty
nucleotides in length or at least fifty nucleotides in length, and
can be up to the full length of a nucleotide sequence of SEQ ID NO:
1 or SEQ ID NO: 14 or a nucleotide sequence encoding an IKK subunit
as shown in SEQ ID NO: 2 or in SEQ ID NO: 15 (see Sambrook et al.,
supra, 1989).
[0037] The invention also provides vectors comprising a nucleic
acid molecule of the invention and host cells, which are
appropriate for maintaining such vectors. Vectors, which can be
cloning vectors or expression vectors, are well known in the art
and commercially available. An expression vector comprising a
nucleic acid molecule of the invention, which can encode an
IKK-.alpha. or can be an antisense molecule, can be used to express
the nucleic acid molecule in a cell.
[0038] In general, an expression vector contains the expression
elements necessary to achieve, for example, sustained transcription
of the nucleic acid molecule, although such elements also can be
inherent to the nucleic acid molecule cloned into the vector. In
particular, an expression vector contains or encodes a promoter
sequence, which can provide constitutive or, if desired, inducible
expression of a cloned nucleic acid sequence, a poly-A recognition
sequence, and a ribosome recognition site, and can contain other
regulatory elements such as an enhancer, which can be tissue
specific. The vector also contains elements required for
replication in a procaryotic or eukaryotic host system or both, as
desired. Such vectors, which include plasmid vectors and viral
vectors such as bacteriophage, baculovirus, retrovirus, lentivirus,
adenovirus, vaccinia virus, semliki forest virus and
adeno-associated virus vectors, are well known and can be purchased
from a commercial source (Promega, Madison Wis.; Stratagene, La
Jolla Calif.; GIBCO/BRL, Gaithersburg Md.) or can be constructed by
one skilled in the art (see, for example, Meth. Enzymol., Vol. 185,
D. V. Goeddel, ed. (Academic Press, Inc., 1990); Jolly, Canc. Gene
Ther. 1:51-64 (1994); Flotte, J. Bioenerg. Biomemb. 25:37-42
(1993); Kirshenbaum et al., J. Clin. Invest 92:381-387 (1993),
which is incorporated herein by reference).
[0039] A nucleic acid molecule, including a vector, can be
introduced into a cell by any of a variety of methods known in the
art (Sambrook et al., supra, 1989, and in Ausubel et al., Current
Protocols in Molecular Biology, John Wiley and Sons, Baltimore, Md.
(1994), which is incorporated herein by reference). Such methods
include, for example, transfection, lipofection, microinjection,
electroporation and infection with recombinant vectors or the use
of liposomes.
[0040] Introduction of a nucleic acid molecule by infection with a
viral vector is particularly advantageous in that it can
efficiently introduce the nucleic acid molecule into a cell ex vivo
or in vivo. Moreover, viruses are very specialized and typically
infect and propagate in specific cell types. Thus, their natural
specificity can be used to target the nucleic acid molecule
contained in the vector to specific cell types. For example, a
vector based on HIV-1 can be used to target an antisense IKK
subunit molecule to HIV-1 infected cells, thereby reducing the
phosphorylation of I.kappa.B, which can decrease the high level of
constitutive NF-.kappa.B activity present in HIV-1 infected cells.
Viral or non-viral vectors also can be modified with specific
receptors or ligands to alter target specificity through receptor
mediated events.
[0041] A nucleic acid molecule also can be introduced into a cell
using methods that do not require the initial introduction of the
nucleic acid molecule into a vector. For example, a nucleic acid
molecule encoding an IKK catalytic subunit can be introduced into a
cell using a cationic liposomes, which also can be modified with
specific receptors or ligands as described above (Morishita et al.,
J. Clin. Invest., 91:2580-2585 (1993), which is incorporated herein
by reference; see, also, Nabel et al., supra, 1993)). In addition,
a nucleic acid molecule can be introduced into a cell using, for
example, adenovirus-polylysine DNA complexes (see, for example,
Michael et al., J. Biol. Chem., 268:6866-6869 (1993), which is
incorporated herein by reference). Other methods of introducing a
nucleic acid molecule into a cell such that the encoded IKK subunit
or antisense nucleic acid molecule can be expressed are well known
(see, for example, Goeddel, supra, 1990).
[0042] Selectable marker genes encoding, for example, a polypeptide
conferring neomycin resistance (Neo.sup.R) also are readily
available and, when linked to a nucleic acid molecule of the
invention or incorporated into a vector containing the nucleic acid
molecule, allows for the selection of cells that have incorporated
the nucleic acid molecule. Other selectable markers such as that
conferring hygromycin, puromycin or ZEOCIN (Invitrogen) resistance
are known to those in the art of gene transfer can be used to
identify cells containing the nucleic acid molecule, including the
selectable marker gene.
[0043] A "suicide" gene also can be incorporated into a vector so
as to allow for selective inducible killing of a cell containing
the gene. A gene such as the herpes simplex virus thymidine kinase
gene (TK) can be used as a suicide gene to provide for inducible
destruction of such cells. For example, where it is desired to
terminate the expression of an introduced nucleic acid molecule
encoding IKK or an antisense IKK subunit molecule in cells
containing the nucleic acid molecule, the cells can be exposed to a
drug such as acyclovir or gancyclovir, which can be administered to
an individual.
[0044] Numerous methods are available for transferring nucleic acid
molecules into cultured cells, including the methods described
above. In addition, a useful method can be similar to that employed
in previous human gene transfer studies, where tumor infiltrating
lymphocytes (TILs) were modified by retroviral gene transduction
and administered to cancer patients (Rosenberg et al., New Engl. J.
Med. 323:570-578 (1990)). In that Phase I safety study of
retroviral mediated gene transfer, TILs were genetically modified
to express the Neomycin resistance (Neo.sup.R) gene. Following
intravenous infusion, polymerase chain reaction analyses
consistently found genetically modified cells in the circulation
for as long as two months after administration. No infectious
retroviruses were identified in these patients and no side effects
due to gene transfer were noted in any patients. These retroviral
vectors have been altered to prevent viral replication by the
deletion of viral gag, pol and env genes. Such a method can also be
used ex vivo to transduce cells taken from a subject (see Anderson
et al., U.S. Pat. No. 5,399,346, issued Mar. 21, 1995, which is
incorporated herein by reference).
[0045] When retroviruses are used for gene transfer, replication
competent retroviruses theoretically can develop due to
recombination of retroviral vector and viral gene sequences in the
packaging cell line utilized to produce the retroviral vector.
Packaging cell lines in which the production of replication
competent virus by recombination has been reduced or eliminated can
be used to minimize the likelihood that a replication competent
retrovirus will be produced. Hence, all retroviral vector
supernatants used to infect cells will be screened for replication
competent virus by standard assays such as PCR and reverse
transcriptase assays.
[0046] To function properly, a cell requires the precise regulation
of expression of nearly all genes. Such gene regulation is
accomplished by activation or repression of transcription by
various transcription factors, which interact directly with
regulatory sequences on nuclear DNA. The ability of transcription
factors to bind DNA or activate or repress transcription is
regulated in response to external stimuli. In the case of the
transcription factor NF-.kappa.B, critical factors involved in the
signaling pathway mediating its activation have not been identified
(Verma, et al., Genes Devel. 9:2723-2735 (1995); Baeuerle and
Baltimore, Cell 87:13-20 (1996)).
[0047] NF-.kappa.B is a member of the Rel family of transcription
factors, which are present in most if not all animal cells (Thanos
and Maniatis, Cell 80:629-532 (1995)). Rel proteins, which include,
for example, RelA (p65), c-Rel, p50, p52 and the Drosophila dorsal
and Dif gene products, are characterized by region of about 300
amino acids sharing approximately 35% to 61% homology ("Rel
homology domain"). The Rel homology domain includes DNA binding and
dimerization domains and a nuclear localization signal. Rel
proteins are grouped into one of two classes, depending on whether
the protein also contains a transcriptional activation domain
(Siebenlist et al., Ann. Rev. Cell Biol. 10:405-455 (1994)).
[0048] Rel proteins can from homodimers or heterodimers, which can
be transcriptionally activating depending on the presence of a
transactivation domain. The most common Rel/NF-.kappa.B dimer,
which is designated "NF-.kappa.B," is a p50/p65 heterodimer that
can activate transcription of genes containing the appropriate KB
binding sites. p50/p65 NF-.kappa.B is present in most cell types
and is considered the prototype of the Rel/NF-.kappa.B family of
transcription factors. Different dimers vary in their binding to
different .kappa.B elements, kinetics of nuclear translocation and
levels of expression in a tissue (Siebenlist et al., supra, 1994).
As used herein, the term "Rel/NF-.kappa.B" is used to refer
generally to the Rel family of transcription factors, and the term
"NF-.kappa.B" is used to refer specifically to the Rel/NF-.kappa.B
factor consisting of a p50/p65 heterodimer.
[0049] NF-.kappa.B originally was identified by its ability to bind
a specific DNA sequence present in the immunoglobulin .kappa. light
chain gene enhancer, the ".kappa.B element" (Sen and Baltimore,
Cell 46:705-709 (1986)). The .kappa.B element has been identified
in numerous cellular and viral promotors, including promotors
present in human immunodeficiency virus-1 (HIV-1); immunoglobulin
superfamily genes such as the MHC class 1 (H-2.kappa.) gene;
cytokine genes such as the tumor necrosis factor .alpha.
(TNF.alpha.), interleukin-1.beta. (IL-1.beta.), IL-2, IL-6 and the
granulocyte-macrophage colony stimulating factor (GM-CSF) gene;
chemokine genes such as RANTES and IL-8; and cell adhesion protein
genes such as E-selectin. The KB element exhibits dyad symmetry and
each half site of the element likely is bound by one subunit of an
NF-.kappa.B dimer.
[0050] In the absence of an appropriate signaling stimulus, a
Rel/NF-.kappa.B is maintained in the cytoplasm in an inactive form
complexed with an I.kappa.B protein. Rel/NF-.kappa.B
transcriptional activity is induced by numerous pathogenic events
or stresses, including cytokines, chemokines, viruses and viral
products, double stranded RNA, bacteria and bacterial products such
as lipopolysaccharide (LPS) and toxic shock syndrome toxin-1,
mitogens such as phorbol esters, physical and oxidative stresses,
and chemical agents such as okadaic acid and cycloheximide (Thanos
and Maniatis, supra, 1995; Siebenlist et al., supra, 1994).
Significantly, the expression of genes encoding agents such as
TNF.alpha., IL-1, IL-6, interferon-.beta. and various chemokines,
which induce NF-.kappa.B activity, are, themselves, induced by
NF-.kappa.B, resulting in amplification of their signal by a
positive, self-regulatory loop (Siebenlist et al., supra, 1994).
Phorbol esters, which-activate T cells, also activate NF-.kappa.B
and immunosuppressants such as cyclosporin A inhibit activation of
T cells through T cell receptor mediated signals (Baldwin, Ann.
Rev. Immunol. 14:649-681, (1996), which is incorporated herein by
reference).
[0051] Regulation of specific genes by NF-.kappa.B can require
interaction of NF-.kappa.B with one or more other DNA binding
proteins. For example, expression of E-selectin requires an
interaction of NF-.kappa.B, the bZIP protein ATF-2 and HMG-I(Y),
and expression of the IL-2 receptor .alpha. gene requires an
interaction of NF-.kappa.B, HMG-I(Y) and the ets-like protein,
ELF-1 (Baldwin, supra, 1996).
[0052] The numerous agents that induce activation of NF-.kappa.B
likely act through various converging signal transduction pathways,
including pathways involving activation of protein kinase C, Raf
kinase and tyrosine kinases. The ability of antioxidants to inhibit
NF-.kappa.B activation by various inducing agents suggests that
reactive oxygen species are a converging point of such pathways
(Siebenlist et al., supra, 1994).
[0053] Upon activation by an appropriate inducing agent, a
Rel/NF-.kappa.B dimer is translocated into the nucleus, where it
can activate gene transcription. The subcellular localization of a
Rel/NF-.kappa.B is controlled by specific inhibitory proteins
("inhibitors of Rel/NF-.kappa.B" or "I.kappa.B's"), which
noncovalently bind the Rel/NF-.kappa.B and mask its nuclear
localization signal (NLS), thereby preventing nuclear uptake.
Various I.kappa.B's, including, for example, I.kappa.B.alpha.,
I.kappa.B.beta., Bcl-3 and the Drosophila cactus gene product, have
been identified (Baeuerle and Baltimore, supra, 1996). In addition,
Rel precursor proteins, such as p105 and p100, which are precursors
of p50 and p52, respectively, function as I.kappa.B's (Siebenlist
et al., supra, 1994). I.kappa.B.alpha. and I.kappa.B.beta. are
expressed in most cell types and generally bind p65- and
c-Rel-containing Rel/NF-.kappa.B dimers. Other I.kappa.B's appear
to be expressed in a tissue specific manner (Thompson et al., Cell
80:573-582 (1995)).
[0054] I.kappa.B proteins are characterized by the presence of 5 to
8 ankyrin repeat domains, each about 30 amino acids, and a
C-terminal PEST domain. For example, I.kappa.BA contains a 70 amino
acid N-terminal domain, a 205 amino acid internal domain containing
the ankyrin repeats, and a 42 amino acid C-terminal domain
containing the PEST domain (Baldwin, supra, 1996). Although
I.kappa.B proteins interact through their ankyrin repeats with the
Rel homology domain of Rel/NF-.kappa.B dimers, binding of
particular I.kappa.B proteins with particular Rel/NF-.kappa.B
proteins appears to be relatively specific. For example,
I.kappa.B.alpha. and I.kappa.B.beta. associate primarily with RelA-
and c-Rel-containing Rel/NF-.kappa.B dimers, thereby blocking their
nuclear localization signal. The binding of an I.kappa.B to
NF-.kappa.B also interferes with the ability of NF-.kappa.B to bind
DNA. However, whereas I.kappa.B.alpha. is phosphorylated following
exposure of cells to tumor necrosis factor (TNF), IL-1, bacterial
lipopolysaccharide (LPS) or phorbol esters, I.kappa.B.beta. is
phosphorylated in certain cell types only in response to LPS or
IL-1 (Baldwin, supra, 1996). However, in other cell types,
I.kappa.B.beta. is phosphorylated in response to the same signals
that induce I.kappa.Bo, although with slower kinetics than
I.kappa.B.alpha. (DiDonato et al., Mol. Cell. Biol. 16:1295-1304
(1996), which is incorporated herein by reference).
[0055] Formation of a complex between an I.kappa.B protein and a
Rel protein is due to an interaction of the ankyrin domains with a
Rel homology domain (Baeuerle and Baltimore, supra, 1996). Upon
exposure to an appropriate stimulus, the I.kappa.B portion of the
complex is rapidly degraded and the Rel/NF-.kappa.B portion becomes
free to translocate to the cell nucleus. Thus, activation of a
Rel/NF-.kappa.B does not require de novo protein synthesis and,
therefore, occurs extremely rapidly. Consequently, activation of
gene expression due to a Rel/NF-.kappa.B can be exceptionally rapid
and provides an effective means to respond to an external stimulus.
Such a rapid response of Rel/NF-.kappa.B transcription factors is
particularly important since these factors are involved in the
regulation of genes involved in the immune, inflammatory and acute
phase responses, including responses to viral and bacterial
infections and to various stresses.
[0056] Upon exposure of a cell to an appropriate inducing agent,
I.kappa.B.alpha., for example, is phosphorylated at serine residue
32 (Ser-32) and Ser-36 (Haskill et al., Cell 65:1281-1289 (1991)).
Phosphorylation of I.kappa.B.alpha. triggers its rapid
ubiquitination, which results in proteasome-mediated degradation of
the inhibitor and translocation of active NF-.kappa.B to the
nucleus (Brown et al., Science 267:1485-1488 (1995); Scherer et
al., Proc. Natl. Acad. Sci. USA. 92:11259-11263 (1995); DiDonato et
al., supra, 1996; DiDonato et al., Mol. Cell. Biol. 15:1302-1311
(1995); Baldi et al., J. Biol. Chem. 271:376-379 (1996)). The same
mechanism also accounts for I.kappa.B: degradation (DiDonato et
al., supra, 1996).
[0057] Rel/NF-.kappa.B activation can be transient or persistent,
depending on the inducing agent and the I.kappa.B that is
phosphorylated. For example, exposure of a cell to particular
cytokines induces I.kappa.B.alpha. phosphorylation and degradation,
resulting in NF-.kappa.B activation, which induces the expression
of various genes, including the gene encoding I.kappa.B.alpha.. The
newly expressed I.kappa.B.alpha. then binds to NF-.kappa.B in the
nucleus, resulting in its export to the cytoplasm and inactivation
and, therefore, a transient NF-.kappa.B mediated response. In
comparison, bacterial LPS induces I.kappa.B.beta. phosphorylation,
resulting in NF-.kappa.B activation. However, the I.kappa.B.beta.
gene is not induced by NF-.kappa.B and, as a result, activation of
NF-.kappa.B is more persistent (Thompson et al., supra, 1995).
[0058] A constitutively active multisubunit kinase of approximately
700 kDa phosphorylates I.kappa.BA at Ser-32 and Ser-36 and, in some
cases, requires polyubiquitination for activity (Chen et al., Cell
84:853-862 (1996); Lee et al., Cell 88:213-222 (1997)). The
mitogen-activated protein kinase/ERK kinase kinase-1 (MEKK1)
phosphorylates several proteins that copurify with this complex and
have molecular weights of approximately 105 kDa, 64 kDa and 54 kDa;
three other copurifying proteins having molecular weights of about
200 kDa, 180 kDa and 120 kDa are phosphorylated in the absence of
MEKK1 (Lee et al., supra, 1997). However, a catalytically inactive
MEKK1 mutant, which can block TNF.alpha. mediated activation of the
jun kinase, does not block NF-.kappa.B activation (Liu et al., Cell
87:565-576 (1996)).
[0059] Overexpression of MEKK1 also induces the site-specific
phosphorylation of I.kappa.B.alpha. in vivo and can directly
activate I.kappa.B.alpha. in vitro by an ubiquitin-independent
mechanism. However, MEKK1 did not phosphorylate I.kappa.B.alpha. at
Ser-32 and Ser-36 in the in vitro experiments, indicating that it
is not an I.kappa.B.alpha. kinase, but may act upstream of
I.kappa.B.alpha. kinase in a signal transduction pathway (Lee et
al., supra, 1997).
[0060] In addition to the above described ubiquitin dependent
kinase 700 kDa complex, an ubiquitin independent 700 kDa complex,
as well as an ubiquitin independent 300 kDa kinase complex
phosphorylates I.kappa.B.alpha. Ser-32 and Ser-36, but not a mutant
containing threonines substituted for these serines (Baeuerle and
Baltimore, supra, 1996). The specific polypeptides responsible for
the I.kappa.B kinase activity of these complexes have not been
described.
[0061] A double stranded RNA-dependent protein kinase (PKR) that
phosphorylates I.kappa.B.alpha. in vitro has been described (Kumar
et al., Proc. Natl. Acad. Sci. USA 91:6288-6292 (1994)). Moreover,
an antisense PKR DNA molecule prevented NF-.kappa.B activation by
double stranded RNA, but did not prevent NF-.kappa.B activation by
TNF.alpha. (Maran et al., Science 265:789-792 (1995)). Casein
kinase II (CKII) also can interact with and phosphorylate
I.kappa.B.alpha., although weakly as compared to CKII
phosphorylation of casein, and the Ser-32 and Ser-36 residues in
I.kappa.B.alpha. represent CKII phosphorylation sites (Roulston et
al., supra, 1995). However, all of the inducers of NF-.kappa.B
activity do not stimulate these protein kinases to phosphorylate
I.kappa.B, indicating that, if they are involved in NF-.kappa.B
activation, these kinases, like MEKK1, operate upstream of the
I.kappa.B kinase. Thus, a rapidly stimulated I.kappa.B kinase that
directly phosphorylates I.kappa.B.alpha. on Ser-32 and Ser-36 and
results in activation of NF-.kappa.B has not been identified.
[0062] A putative serine-threonine protein kinase has been
identified in mouse cells by probing for nucleic acid molecules
that encode proteins containing a consensus helix-loop-helix
domain, which is involved in protein-protein interactions (Connelly
and Marcu, supra, 1995). This putative kinase, which is
ubiquitously expressed in various established cell lines, but
differentially expressed in normal mouse tissues, was named CHUK
(conserved helix-loop-helix ubiquitous kinase; GenBank Accession
#U12473). In addition, a nucleic acid molecule (GenBank Accession
#U22512) encoding a portion of a human CHUK protein that is 93%
identical at the nucleotide level (95% identical at the amino acid
level) with the mouse CHUK also was identified. However, neither
the function of a CHUK protein in a cell nor a potential substrate
for the putative kinase was described.
[0063] The present invention provides an isolated I.kappa.B kinase
(IKK), including isolated full length IKK catalytic subunits. For
example, the invention provides an isolated 300 kDa or 900 kDa
complex, which comprises an IKK.alpha. or an IKK.beta. subunit and
has I.kappa.B kinase activity (see Examples I, III and IV). In
addition, the invention provides is an isolated human IKK.alpha.
catalytic subunit (SEQ ID NO: 2; Example II), which contains a
previously undescribed N-terminal amino acid sequence and
essentially the C-terminal region of human CHUK (Connelly and
Marcu, supra, 1995) and phosphorylates I.kappa.B.alpha. on Ser-32
and Ser-36 and I.kappa.B.beta. on Ser-19 and Ser-23 (DiDonato et
al., supra, 1996; see, also, Regnier et al., supra, 1997). The
invention also provides an isolated IKK.beta. catalytic subunit
(SEQ ID NO: 15; Example III), which shares greater than 50% amino
acid sequence identity with IKK.alpha., including conserved
homology in the kinase domain, helix-loop-helix domain and leucine
zipper domain.
[0064] As used herein, the term "isolated," when used in reference
to an I.kappa.B kinase complex or to an IKK catalytic subunit of
the invention, means that the complex or the subunit is relatively
free from contaminating lipids, proteins, nucleic acids or other
cellular material normally associated with an IKK in a cell. An
isolated 900 kDa I.kappa.B kinase complex or 300 kDa complex can be
isolated, for example, by immunoprecipitation using an antibody
that binds to an IKK catalytic subunit (see Examples III and IV).
In addition, an isolated IKK subunit can be obtained, for example,
by expression of a recombinant nucleic acid molecule such as SEQ ID
NO: 1 or SEQ ID NO: 14, or can be isolated from a cell by a method
comprising affinity chromatography using ATP or I.kappa.B as
ligands (Example I) or using an anti-IKK subunit antibody. An
isolated IKK complex or IKK subunit comprises at least 30% of the
material in a sample, generally about 50% or 70% or 90% of a
sample, and preferably about 95% or 98% of a sample, as described
above with respect to nucleic acids.
[0065] The amino acid sequences for MEKK1 (GenBank Accession #
U48596; locus RNU48596), PKR (GenBank Accession # M35663; locus
HUMP68A) and CKII (GenBank Accession # M55268 J02924; locus
HUMA1CKII) are different from the sequences of the IKK subunits
disclosed herein (SEQ ID NO: 2 and SEQ ID NO: 15) and, therefore,
are distinguishable from the present invention. In addition, a full
length human IKK.alpha. of the invention is distinguishable from
the partial human CHUK polypeptide sequence in that the partial
human CHUK polypeptide (Connelly and Marcu, supra, 1995; GenBank
Accession #22512) lacks amino acids 1 to 31 as shown in SEQ ID NO:
2. As disclosed herein, a polypeptide having the amino acid
sequence of the partial human CHUK polypeptide does not have
I.kappa.B kinase activity when expressed in a cell, indicating that
some or all of amino acid residues 1 to 31 are essential for kinase
activity.
[0066] A full length IKK catalytic subunit of the invention is
exemplified by human IKK.alpha., which has an apparent molecular
mass of about 85 kDa and phosphorylates I.kappa.B.alpha. on Ser-32
and Ser-36. An IKK catalytic subunit of the invention also is
exemplified by IKK.beta., which is an 87 kDa polypeptide that
shares substantial amino acid sequence homology with IKK.alpha.
(FIG. 3). As used herein, the term "full length," when used in
reference to an IKK subunit of the invention, means a polypeptide
having an amino acid sequence of an IKK subunit expressed normally
in a cell. Such a normally expressed IKK polypeptide begins with a
methionine residue at its N-terminus (Met-1; FIG. 3), the Met-1
being encoded by the initiator ATG (AUG) codon, and ends as a
result of the termination of translation due to the presence of a
STOP codon. A full length human IKK catalytic subunit can be a
native IKK polypeptide, which is isolated from a cell, or can be
produced using recombinant DNA methods such as by expressing the
nucleic acid molecule shown as SEQ ID NO: 1 or SEQ ID NO: 14.
[0067] The apparent molecular mass of an isolated IKK subunit can
be measured using routine methods such as polyacrylamide gel
electrophoresis performed in the presence of sodium dodecyl sulfate
(SDS-PAGE) or column chromatography performed under reducing and
denaturing conditions. In addition, the ability of an IKK subunit
to phosphorylate I.kappa.BA on Ser-32 and Ser-36 can be identified
using the methods disclosed herein.
[0068] With regard to the disclosed 85 kDa and 87 kDa apparent
molecular masses of human IKK.alpha. and IKK.beta., it is
recognized that the apparent molecular mass of a previously unknown
protein as determined, for example, by SDS-PAGE is an estimate
based on the relative migration of the unknown protein as compared
to the migration of several other proteins having known molecular
masses. Thus, one investigator reasonably can estimate, for
example, that an unknown protein has an apparent molecular mass of
82 kDa, whereas a second investigator, looking at the same unknown
protein under substantially similar conditions, reasonably can
estimate that the protein has an apparent molecular mass of 87 kDa.
Accordingly, reference herein to an I.kappa.B kinase having an
apparent molecular mass of "about 85 kDa" indicates that the kinase
migrates by SDS-PAGE in an 8 gel under reducing conditions in the
range of 80 kDa to 90 kDa, preferably in the range of 82 kDa to 87
kDa. Furthermore, reference herein to an 87 kDa IKK.beta. indicates
that IKK.beta. has a relatively higher apparent molecular mass than
the 85 kDa apparent molecular mass of IKK.alpha..
[0069] An IKK catalytic subunit of the invention is exemplified by
the isolated full length polypeptide comprising the amino acid
sequence shown as SEQ ID NO: 2 or SEQ ID NO: 15. In addition, the
invention provides peptide portions of an IKK subunit polypeptide,
wherein such peptide portions contain at least three contiguous
amino acids as shown in SEQ ID NO: 2 or SEQ ID NO: 15, and
generally contain at least six contiguous amino acids or, if
desired, at least nine contiguous amino acids, as provided herein.
Thus, the invention provides peptide portions of IKK.alpha.,
containing, for example, at least three contiguous amino acids of
SEQ ID NO: 2, including amino acid residue 30, preferably at least
four contiguous amino acids, including amino acid residue 30, and
more preferably at least six contiguous amino acids, including
amino acid residue 30. The invention also provides a peptide
portion of IKK.beta. comprising at least three contiguous amino
acids, generally six contiguous amino acids, and preferably ten
contiguous amino acids of SEQ ID NO: 15. It is recognized, however,
that a peptide of the invention does not consist of a polypeptide
disclosed as GenBank Accession #U12473 or #U22512.
[0070] A peptide portion of an IKK subunit generally is a
tripeptide or larger, preferably a hexapeptide or larger, and more
preferably a decapeptide or larger, up to a contiguous amino acid
sequence having a maximum length that lacks one or more N-terminal
or C-terminal amino acids of the full length polypeptide (SEQ ID.
NO: 2 or SEQ ID NO: 15). Thus, a peptide portion of IKK.alpha.
having the amino acid sequence shown as SEQ ID NO: 2 can be from
three amino acids long to 744 amino acids long, which is one
residue less than the full length polypeptide, except as provided
above.
[0071] A peptide portion of an IKK subunit polypeptide of the
invention can be produced by any of several methods well known in
the art. For example, a peptide portion of an IKK subunit can be
produced by enzymatic cleavage of an IKK subunit protein, which has
been isolated from a cell, using a proteolytic enzyme such as
trypsin, chymotrypsin, Lys-C or the like, or combinations of such
enzymes. Such proteolytic cleavage products can be isolated using
methods as disclosed in Example I, to obtain peptide portions of
IKK.alpha. and IKK.beta., for example. A peptide portion of an IKK
subunit also can be produced using methods of solution or solid
phase peptide synthesis or can be expressed from a nucleic acid
molecule such as a portion of the coding region of the nucleic acid
sequence shown as SEQ ID NO: 1 or SEQ ID NO: 14, or can be
purchased from a commercial source.
[0072] A peptide portion of an IKK subunit can comprise the kinase
domain of the IKK subunit and, therefore, can have the ability to
phosphorylate an I.kappa.B protein. For example, a peptide portion
of SEQ ID NO: 2 comprising amino acids 15 to 301 has the
characteristics of a serine-threonine protein kinase domain (Hanks
and Quinn, Meth. Enzymol. 200:38-62 (1991), which is incorporated
herein by reference). Such a peptide portion of an IKK subunit can
be examined for kinase activity by determining that it can
phosphorylate I.kappa.B.alpha. at Ser-32 and Ser-36 or
I.kappa.B.beta. at Ser-19 and Ser-23, using methods as disclosed
herein. In addition, a peptide portion of an IKK subunit can
comprise an immunogenic amino acid sequence of the polypeptide and,
therefore, can be useful for eliciting production of an antibody
that can specifically bind the IKK subunit or to an IKK complex
comprising the subunit, particularly to an epitope comprising amino
acid residue 30 as shown in SEQ ID NO: 2 or to an epitope of SEQ ID
NO: 15, provided said epitope is not present in a CHUK protein.
Accordingly, the invention also provides anti-IKK antibodies, which
specifically bind to an epitope of an IKK complex, particularly an
IKK catalytic subunit, and to IKK subunit binding fragments of such
antibodies. In addition, the invention provides cell lines
producing anti-IKK antibodies or IKK-binding fragments of such
antibodies.
[0073] As used herein, the term "antibody" is used in its broadest
sense to include polyclonal and monoclonal antibodies, as well as
antigen binding fragments of such antibodies. With regard to an
anti-IKK antibody of the invention, the term "antigen" means an IKK
catalytic subunit protein, polypeptide or peptide portion thereof,
or an IKK complex comprising an IKK catalytic subunit protein,
polypeptide or peptide portion thereof. Thus, it should be
recognized that, while an anti-IKK antibody can bind to and, for
example, immunoprecipitate an IKK complex, the antibody
specifically binds an epitope comprising at least a portion of an
IKK catalytic subunit. An antibody of the invention also can be
used to immunoprecipitate an IKK subunit, free of the IKK
complex.
[0074] An anti-IKK antibody, or antigen binding fragment of such an
antibody, is characterized by having specific binding activity for
an epitope of an IKK subunit of at least about 1.times.10.sup.5
M.sup.-1, generally, at least about 1.times.10.sup.6 M.sup.-1.
Thus, Fab, F(ab').sub.2, Fd and Fv fragments of an anti-IKK
antibody, which retain specific binding activity for an IKK
subunit, are included within the definition of an antibody. In
particular, an anti-IKK antibody can react with an epitope
comprising the N-terminus of IKK.alpha. or with an epitope of
IKK.beta., but not to a polypeptide having an amino acid sequence
shown as residues 32 to 745 of SEQ ID NO: 2.
[0075] The term "antibody" as used herein includes naturally
occurring antibodies as well as non-naturally occurring antibodies,
including, for example, single chain antibodies, chimeric,
bifunctional and humanized antibodies, as well as antigen-binding
fragments thereof. Such non-naturally occurring antibodies can be
constructed using solid phase peptide synthesis, can be produced
recombinantly or can be obtained, for example, by screening
combinatorial libraries consisting of variable heavy chains and
variable light chains as described by Huse et al., Science
246:1275-1281 (1989), which is incorporated herein by reference.
These and other methods of making, for example, chimeric,
humanized, CDR-grafted, single chain, and bifunctional antibodies
are well known to those skilled in the art (Winter and Harris,
Immunol. Today 14:243-246 (1993); Ward et al., Nature 341:544-546
(1989); Harlow and Lane, Antibodies: A laboratory manual (Cold
Spring Harbor Laboratory Press, 1988); Hilyard et al., Protein
Engineering: A practical approach (IRL Press 1992); Borrabeck,
Antibody Engineering, 2d ed. (Oxford University Press 1995); each
of which is incorporated herein by reference).
[0076] An anti-IKK antibody of the invention can be raised using an
isolated IKK subunit or a peptide portion thereof and can bind to a
free, uncomplexed form of IKK subunit or can bind to IKK subunit
when it is associated with a 300 kDa or 900 kDa IKK complex. In
addition, an anti-IKK antibody of the invention can be raised
against an isolated 300 kDa or 900 kDa I.kappa.B kinase complex,
which can be obtained as disclosed herein. For convenience, an
antibody of the invention is referred to generally herein as an
"anti-I.kappa.B kinase antibody" or an "anti-IKK antibody."
However, the skilled recognize that the various antibodies of the
invention will have unique antigenic specificities, for example,
for a free or complexed IKK subunit, or both, or for a 300 kDa or
900 kDa I.kappa.B kinase complex, or both.
[0077] Anti-IKK antibodies can be raised using as an immunogen an
isolated full length IKK catalytic subunit, which can be prepared
from natural sources or produced recombinantly, or a peptide
portion of an IKK subunit as defined herein, including synthetic
peptides as described above. A non-immunogenic peptide portion of
an IKK catalytic subunit can be made immunogenic by coupling the
hapten to a carrier molecule such bovine serum albumin (BSA) or
keyhole limpet hemocyanin (KLH), or by expressing the peptide
portion as a fusion protein. Various other carrier molecules and
methods for coupling a hapten to a carrier molecule are well known
in the art and described, for example, by Harlow and Lane, supra,
1988). It is recognized that, due to the apparently high amino acid
sequence identity of the full length human IKK.alpha. and mouse
CHUK, the amino acid sequences of IKK.alpha. polypeptides, as well
as IKK.beta. polypeptides, likely are highly conserved among
species, particularly among mammalian species. However, antibodies
to highly conserved proteins have been raised successfully, for
example, in chickens. Such a method can be used to obtain an
antibody to an IKK subunit, if desired.
[0078] Particularly useful antibodies of the invention include
antibodies that bind with the free, but not the complexed, form of
an IKK subunit or, alternatively, with the complexed, but not free,
form of an IKK subunit. Antibodies of the invention also include
antibodies that bind with the 300 kDa I.kappa.B kinase complex or
the 900 kDa I.kappa.B kinase complex or both. It should be
recognized, however, that an antibody specific for the 300 kDa or
900 kDa I.kappa.B kinase complex need not recognize an IKK subunit
epitope in order to be encompassed within the claimed invention,
since, prior to the present disclosure, the 300 kDa and 900 kDa IKK
complexes were not known (see DiDonato et al., Nature 388:548-554
(1997)).
[0079] Antibodies of the invention that bind to an activated IKK
but not to an inactive IKK, and, conversely, those that bind to an
inactive form of the kinase but not to the activated form also are
particularly useful. For example, an IKK can be activated by
phosphorylation of an IKK subunit and, therefore, an antibody that
recognizes the phosphorylated form of the IKK, but that does not
bind to the unphosphorylated form can be obtained. In addition, IKK
can be activated by release of a regulatory subunit and, therefore,
an antibody that recognizes a form of the IKK complex that is not
bound to the regulatory subunit can be obtained. Such antibodies
are useful for identifying the presence of active IKK in a
cell.
[0080] An anti-IKK antibody is useful, for example, for determining
the presence or level of an IKK or of an IKK subunit in a tissue
sample, which can be a lysate or a histological section. The
identification of the presence or level of an IKK or an IKK subunit
in the sample can be made using well known immunoassay and
immunohistochemical methods (Harlow and Lane, supra, 1988). An
anti-IKK antibody also can be used to substantially purify an
I.kappa.B kinase or an IKK subunit from a sample. In addition, an
anti-IKK antibody can be used in a screening assay to identify
agents that alter the activity of an I.kappa.B kinase.
[0081] A kit incorporating an anti-IKK antibody, which can be
specific for the active or inactive form of I.kappa.B kinase or can
bind to an IKK complex or to an IKK subunit, regardless of the
activity state, can be particularly useful. Such a kit can contain,
in addition to an anti-IKK antibody, a reaction cocktail that
provides the proper conditions for performing the assay, control
samples that contain known amounts of an IKK or IKK subunit and, if
desired, a second antibody specific for the anti-IKK antibody. Such
an assay also should include a simple method for detecting the
presence or amount of an IKK or an IKK subunit in a sample that is
bound to the anti-IKK antibody.
[0082] A protein such as anti-IKK antibody, as well as an IKK
subunit or a peptide portion thereof, can be labeled so as to be
detectable using methods well known in the art (Hermanson,
"Bioconjugate Techniques" (Academic Press 1996), which is
incorporated herein by reference; Harlow and Lane, 1988; chap. 9).
For example, a protein can be labeled with various detectable
moieties including a radiolabel, an enzyme, biotin or a
fluorochrome. Reagents for labeling a protein such as an anti-IKK
antibody can be included in a kit containing the protein or can be
purchased separately from a commercial source.
[0083] Following contact, for example, of a labeled antibody with a
sample such as a tissue homogenate or a histological section of a
tissue, specifically bound labeled antibody can be identified by
detecting the particular moiety. Alternatively, a labeled second
antibody can be used to identify specific binding of an unlabeled
anti-IKK antibody. A second antibody generally will be specific for
the particular class of the first antibody. For example, if an
anti-I.kappa.B kinase antibody is of the IgG class, a second
antibody will be an anti-IgG antibody. Such second antibodies are
readily available from commercial sources. The second antibody can
be labeled using a detectable moiety as described above. When a
sample is labeled using a second antibody, the sample is first
contacted with a first antibody, which is an anti-IKK antibody,
then the sample is contacted with the labeled second antibody,
which specifically binds to the anti-IKK antibody and results in a
labeled sample.
[0084] Methods for raising polyclonal antibodies, for example, in a
rabbit, goat, mouse or other mammal, are well known in the art (see
Example V). In addition, monoclonal antibodies can be obtained
using methods that are well known and routine in the art (Harlow
and Lane, supra, 1988). Essentially, spleen cells from a mouse
immunized with an IKK complex or an IKK subunit or peptide portion
thereof can be fused to an appropriate myeloma cell line such as
SP/02 myeloma cells to produce hybridoma cells. Cloned hybridoma
cell lines can be screened using a labeled IKK subunit to identify
clones that secrete anti-IKK monoclonal antibodies. Hybridomas
expressing anti-IKK monoclonal antibodies having a desirable
specificity and affinity can be isolated and utilized as a
continuous source of the antibodies, which are useful, for example,
for preparing standardized kits as described above. Similarly, a
recombinant phage that expresses, for example, a single chain
anti-IKK also provides a monoclonal antibody that can used for
preparing standardized kits.
[0085] A monoclonal anti-IKK antibody can be used to prepare
anti-idiotypic antibodies, which present an epitope that mimics the
epitope recognized by the monoclonal antibody used to prepare the
anti-idiotypic antibodies. Where the epitope to which the
monoclonal antibody includes, for example, a portion of the IKK
catalytic subunit kinase domain, the anti-idiotypic antibody can
act as a competitor of I.kappa.B and, therefore, can be useful for
reducing the level of phosphorylation of I.kappa.B and,
consequently, the activity of NF-.kappa.B.
[0086] The present invention further provides methods of
identifying an agent that can alter the association of an IKK
catalytic subunit with a second protein, which can be an upstream
activator, a downstream effector such as I.kappa.B, an interacting
regulatory protein of the IKK subunit, or an interacting subunit
associated with the 300 kDa or 900 kDa I.kappa.B kinase complex. As
used herein, the term "associate" or "association," when used in
reference to an IKK subunit and a second protein means that the IKK
subunit and the second protein have a binding affinity for each
other such that they form a bound complex in vivo or in vitro,
including in a cell in culture or in a reaction comprising
substantially purified reagents. For convenience, the term "bind"
or "interact" is used interchangeably with the term
"associate."
[0087] The affinity of binding of an IKK subunit and a second
protein such as an I.kappa.B or another IKK subunit or other
subunit present in an IKK complex is characterized in that it is
sufficiently specific such that a bound complex can form in vivo in
a cell or can form in vitro under appropriate conditions as
disclosed herein. The formation or dissociation of a bound complex
can be identified, for example, using the two hybrid assay or
demonstrating coimmunoprecipitation of the second protein with the
IKK subunit, as disclosed herein, or using other well known methods
such as equilibrium dialysis. Methods for distinguishing the
specific association of an IKK subunit and a second protein from
nonspecific binding to the IKK subunit are known in the art and,
generally, include performing the appropriate control experiments
to demonstrate the absence of nonspecific protein binding.
[0088] As used herein, the term "second protein" refers to a
protein that specifically associates with an IKK subunit ("first
protein"). Such a second protein is exemplified herein by I.kappa.B
proteins, including I.kappa.B.alpha. and I.kappa.B.beta., which are
substrates for I.kappa.B kinase activity and are downstream of the
I.kappa.B kinase in a signal transduction pathway that results in
the regulated expression of a gene. In addition, such second
proteins are exemplified by the proteins that, together with the
IKK subunits, form a 300 kDa or 900 kDa I.kappa.B kinase complex,
which coimmunoprecipitates using an anti-IKK antibody (see Example
IV). Furthermore, since IKK subunits such as IKK.alpha. and IKK
interact with each other to form homodimers or heterodimers, a
second protein also can be a second IKK subunit, which can be the
same as or different from the "first" protein.
[0089] Agents that alter the association of an IKK catalytic
subunit and a second protein such as I.kappa.B protein or an IKK
regulatory subunit can be extremely valuable, for example, for
limiting excessive cytokine expression as occurs in an acute phase
response by preventing the activation of NF-.kappa.B, thereby
preventing NF-.kappa.B mediated induction of cytokine gene
expression. Where, in a drug screening assay of the invention, the
second protein is an I.kappa.B, the IKK subunit can be any protein
involved in I.kappa.B kinase activity, including, for example,
mouse CHUK (Connelly and Marcu, supra, 1995; GenBank Accession
#12473), which, prior to the present disclosure, was not known to
have the ability to associate with I.kappa.B or to have I.kappa.B
kinase activity.
[0090] In addition, a second protein can be a protein that is
upstream of I.kappa.B kinase in a signal transduction pathway and
associates with the IKK complex, particularly with an IKK catalytic
subunit of the IKK complex. Such a second protein, which can be an
upstream activator of the I.kappa.B kinase, can be identified using
routine methods for identifying protein-protein interactions as
disclosed herein. Such second proteins can be, for example, MEKK1
or PKR or CKII, each of which has been reported to be involved in a
pathway leading to phosphorylation of I.kappa.B and activation of
NF-.kappa.B, but neither of which has the characteristics expected
of the common I.kappa.B kinase present at the point where the
various NF-.kappa.B activation pathways converge (see, for example,
Lee et al., supra, 1997), or can be the NF-.kappa.B-inducing kinase
(NIK), which reportedly is upstream from IKK in an NF-.kappa.B
activation pathway (Regnier et al., supra, 1997; Malinin et al.,
Nature 385:540-544 (1997)).
[0091] A second protein also can be a regulatory protein, which
associates with an IKK catalytic subunit in an IKK complex, either
constitutively as part of a 300 kDa or 900 kDa complex or in
response to activation of a pathway leading to IKK activation. Such
a regulatory protein can inhibit or activate IKK activity
depending, for example, on whether the regulatory protein is
associated with IKK and whether the regulatory protein associates
with an IKK catalytic subunit in a free form or as part of an IKK
complex. The regulatory protein also can be important for "docking"
a catalytic IKK subunit to its substrate. The ability of a
regulatory protein to associate with or dissociate from an IKK
subunit or IKK complex can depend, for example, on the relative
phosphorylation state of the regulatory protein. It is recognized
that an upstream activator of IKK also can interact with such a
regulatory protein, thereby indirectly inhibiting or activating the
IKK.
[0092] As disclosed herein, two copurifying proteins were isolated
by ATP and I.kappa.B affinity chromatography and identified by
SDS-PAGE (Example I). Partial amino acid sequences were determined
and cDNA molecules encoding the proteins were obtained (see
Examples I, II and III). One of the proteins has an apparent
molecular mass of 85 kDa. Expression in a cell of a cDNA molecule
encoding the 85 kDa protein resulted in increased NF-.kappa.B
activity following cytokine induction as compared to control cells,
whereas expression of the antisense of this cDNA decreased the
basal NF-.kappa.B activity in the cells and prevented cytokine
induction of NF-.kappa.B activity. Immunoprecipitation of the 85
kDa protein resulted in isolation of the IKK complex, the kinase
activity of which was stimulated rapidly in response to TNF or to
IL-1. Based on these functional analyses, the 85 kDa protein was
determined to be a component of the 900 kDa I.kappa.B kinase
complex and has been designated IKK.alpha. (SEQ ID NO: 2). The
second protein, which copurified with the 85 kDa I.kappa.B kinase,
has an apparent molecular mass of 87 kDa and shares greater than
50' amino acid sequence identity with IKK.alpha. and has been
designated IKK.beta. (SEQ ID NO: 15).
[0093] The ability of the 85 kDa and 87 kDa IKK subunits to
associate with other proteins such as a regulatory subunit as well
as with I.kappa.B is suggested, for example, by the presence in the
I.kappa.B kinase of two different protein binding domains, a
helix-loop-helix domain and a leucine zipper domain (see Connelly
and Marcu, supra, 1995; see, also, FIG. 3). While the leucine
zipper motif mediates homotypic and heterotopic interactions
between IKK.alpha. and IKK.beta., the helix-loop-helix motif serves
as a binding site for regulatory proteins necessary for I.kappa.B
kinase activation.
[0094] A screening assay of the invention provides a means to
identify an agent that alters the association of an IKK complex or
an IKK catalytic subunit with a second protein such as the
regulatory subunits discussed above. As used herein, the term
"modulate" or "alter" when used in reference to the association of
an IKK and a second protein, means that the affinity of the
association is increased or decreased with respect to a steady
state, control level of association, i.e., in the absence of an
agent. Agents that can alter the association of an IKK with a
second protein can be useful for modulating the level of
phosphorylation of I.kappa.B in a cell, which, in turn, modulates
the activity of NF-.kappa.B in the cell and the expression of a
gene regulated by NF-.kappa.B. Such an agent can be, for example,
an anti-idiotypic antibody as described above, which can inhibit
the association of an IKK and I.kappa.B. A peptide portion of
I.kappa.B.alpha. comprising amino acids 32 to 36, but containing
substitutions for Ser-32 and Ser-36, is another example of such an
agent, since the peptide can compete with I.kappa.B.alpha. binding
to IKK, as is the corresponding peptide of I.kappa.B.beta..
[0095] A screening assay of the invention also is useful for
identifying agents that directly alter the activity of an IKK.
While such an agent can act, for example, by altering the
association of an IKK complex or IKK catalytic subunit with a
second protein, the agent also can act directly as a specific
activator or inhibitor of IKK activity. Specific protein kinase
inhibitors include, for example, staurosporin, the heat stable
inhibitor of cAMP-dependent protein kinase, and the MLCK inhibitor,
which are known in the art and commercially available. A library of
molecules based, generally, on such inhibitors or on ATP or
adenosine can be screened using an assay of the invention to obtain
agents that desirably modulate the activity of an IKK complex or an
IKK subunit.
[0096] As disclosed herein, IKK activity can be measured by
identifying phosphorylation, for example, of I.kappa.B.alpha.,
either directly or using an antibody specific for the Ser-32 and
Ser-36 phosphorylated form of I.kappa.B.alpha.. An antibody that
binds to I.kappa.B.alpha. that is phosphorylated on Ser-32, for
example, can be purchased from a commercial source (New England
Biolabs; Beverly Mass.). Cultured cells can be exposed to various
agents suspected of having the ability to directly alter IKK
activity, then aliquots of the cells either are collected or are
treated with a proinflammatory stimulus such as a cytokine, and
collected. The collected cells are lysed and the kinase is
immunoprecipitated using an anti-IKK antibody. A substrate such as
I.kappa.B.alpha. or I.kappa.B.beta. is added to the immunocomplex
and the ability of the IKK to phosphorylate the substrate is
determined as described above. If desired, the anti-IKK antibody
first can be coated onto a plastic surface such as in 96 well
plates, then the cell lysate is added to the wells under conditions
that allow binding of IKK by the antibody. Following washing of the
wells, IKK activity is measured as described above. Such a method
is extremely rapid and provides the additional advantage that it
can be automated for high through-put assays.
[0097] A screening assay of the invention is particularly useful to
identify, from among a diverse population of molecules, those
agents that modulate the association of an IKK complex or an IKK
catalytic subunit and another protein (referred to herein as a
"second protein") or that directly alter the activity of IKK.
Methods for producing libraries containing diverse populations of
molecules, including chemical or biological molecules such as
simple or complex organic molecules, peptides, proteins,
peptidomimetics, glycoproteins, lipoproteins, polynucleotides, and
the like, are well known in the art (Huse, U.S. Pat. No. 5,264,563,
issued Nov. 23, 1993; Blondelle et al., Trends Anal. Chem. 14:83-92
(1995); York et al., Science 274:1520-1522 (1996); Gold et al.,
Proc. Natl. Acad. Sci. USA 94:59-64 (1997); Gold, U.S. Pat. No.
5,270,163, issued Dec. 14, 1993). Such libraries also can be
obtained from commercial sources.
[0098] Since libraries of diverse molecules can contain as many as
10.sup.14 to 10.sup.15 different molecules, a screening assay of
the invention provides a simple means for identifying those agents
in the library that can modulate the association of an IKK and a
second protein or can alter the activity of an IKK. In particular,
a screening assay of the invention can be automated, which allows
for high through-put screening of randomly designed libraries of
agents to identify those particular agents that can modulate the
ability of an IKK and a second protein to associate or that alter
the activity of the IKK.
[0099] A drug screening assay of the invention utilizes an IKK
complex, which can be isolated as disclosed herein; or an IKK
subunit, which can be expressed, for example, from a nucleic acid
molecule encoding the amino acid sequence shown in SEQ ID NO: 2 or
in SEQ ID NO: 15; or can be purified as disclosed herein; or can
utilize an IKK subunit fusion protein such as an
IKK.alpha.-glutathione-S-transferase (GST) or
IKK.beta.-histidine.sub.6 (HIS6) fusion protein, wherein the GST or
HIS6 is linked to the IKK subunit and comprises a tag (see Example
VI). The IKK or IKK subunit fusion protein is characterized, in
part, by having an affinity for a solid substrate as well as having
the ability to specifically associate with an appropriate second
protein such as an I.kappa.B protein. For example, when an IKK
catalytic subunit is used in a screening assay, the solid substrate
can contain a covalently attached anti-IKK antibody, provided that
the antibody binds the IKK subunit without interfering with the
ability of the IKK subunit to associate with the second protein.
Where an IKK.alpha.-GST fusion protein, for example, is used in
such a screening assay, the solid substrate can contain covalently
attached glutathione, which is bound by the GST tag component of
the fusion protein. If desired, the IKK subunit or IKK subunit
fusion protein can be part of an IKK complex in a drug screening
assay of the invention.
[0100] A drug screening assay to identify an agent that alters the
association of an IKK complex or an IKK subunit and a second
protein can be performed by allowing, for example, the IKK complex
or IKK subunit, which can be a fusion protein, to bind to the solid
support, then adding the second protein, which can be an I.kappa.B
such as I.kappa.B.alpha., and an agent to be tested, under
conditions suitable for the association of the IKK and
I.kappa.B.alpha. in the absence of a drug (see Example VI) As
appropriate, the IKK can be activated or inactivated as disclosed
herein and, typically, the IKK or the second protein is detectably
labeled so as to facilitate identification of the association.
Control reactions, which contain or lack either, the IKK component,
or the I.kappa.B protein, or the agent, or which substitute the
I.kappa.B protein with a second protein that is known not to
associate specifically with the IKK, also are performed.
[0101] Following incubation of the reaction mixture, the amount of
I.kappa.B.alpha. specifically bound to the IKK in the presence of
an agent can be determined and compared to the amount of binding in
the absence of the agent so that agents that modulate the
association can be identified.
[0102] An IKK subunit such as IKK.alpha. or IKK.beta. used in a
screening assay can be detectably labeled with a radionuclide, a
fluorescent label, an enzyme, a peptide epitope or other such
moiety, which facilitates a determination of the amount of
association in a reaction. By comparing the amount of specific
binding of an IKK subunit or an IKK complex and I.kappa.B in the
presence of an agent as compared to the control level of binding,
an agent that increases or decreases the binding of the IKK and the
I.kappa.B can be identified. In comparison, where a drug screening
assay is used to identify an agent that alters the activity of an
IKK, the detectable label can be, for example,
.gamma.-.sup.32P-ATP, and the amount of .sup.32P-I.kappa.B can be
detected as a measure of IKK activity. Thus, the drug screening
assay provides a rapid and simple method for selecting agents that
desirably alter the association of an IKK and a second protein such
as an I.kappa.B or for altering the activity of an IKK. Such agents
can be useful, for example, for modulating the activity of
NF-.kappa.B in a cell and, therefore, can be useful as medicaments
for the treatment of a pathology due, at least in part, to aberrant
NF-.kappa.B activity.
[0103] The method for performing a drug screening assay as
disclosed herein also provides a research tool for identifying a
target of a drug that is or can be used therapeutically to
ameliorate an undesirable inflammatory or immune response, but for
which the target of the drug is not known. Cytokine restraining
agents, for example, are a class of agents that can alter the level
of cytokine expression (U.S. Pat. No. 5,420,109, issued May 30,
1995) and can be used to treat various pathologies, including
patho-immunogenic diseases such as rheumatoid arthritis and those
induced by exposure to bacterial endotoxin such as occur in septic
shock (see, also, WO96/27386, published Sep. 12, 1996).
[0104] The specific cellular target upon which a cytokine
restraining agent acts has not been reported. However, the myriad
of pathologic effects ameliorated by such agents are similar to
various pathologies associated with aberrant NF-.kappa.B activity,
suggesting that cytokine restraining agents may target an effector
molecule in a NF-.kappa.B signal transduction pathway. Thus, one
potential target of a cytokine restraining agent can be an
I.kappa.B kinase, particularly an IKK catalytic subunit of the
kinase. Accordingly, a screening assay of the invention can be used
to determine whether a cytokine restraining agent alters the
activity of I.kappa.B kinase or alters the association of an IKK
and a second protein such as I.kappa.B.
[0105] If it is determined that a cytokine restraining agent has
such an effect, the screening assay then can be used to screen a
library of cytokine regulatory agents to identify those having
desirable characteristics, such as those having the highest
affinity for the IKK.
[0106] The invention also provides a method of obtaining an
isolated IKK complex or an IKK catalytic subunit. For example, a
300 kDa or a 900 kDa IKK complex, comprising an IKK.alpha. subunit
can be isolated from a sample by immunoprecipitation using an
anti-IKKa antibody or by tagging the IKK.alpha. and using an
antibody specific for the tag (see Examples III and IV). In
addition, an IKK catalytic subunit can be isolated from a sample by
1) incubating the sample containing the IKK subunit with ATP, which
is immobilized on a matrix, under conditions suitable for binding
of the IKK subunit to the ATP; 2) obtaining from the immobilized
ATP a fraction of the sample containing the IKK subunit; 3)
incubating the fraction containing the IKK subunit with an
I.kappa.B, which is immobilized on a matrix, under conditions
suitable for binding of the IKK subunit to the I.kappa.B; and 4)
obtaining from the immobilized I.kappa.B an isolated IKK catalytic
subunit. Such a method of isolating an IKK subunit is exemplified
herein by the use of ATP affinity chromatography and
I.kappa.B.alpha. affinity chromatography to isolate IKK.alpha. or
IKK.beta. from a sample of HeLa cells (see Example I).
[0107] The skilled artisan will recognize that a ligand such as ATP
or an I.kappa.B or an anti-IKK antibody also can be immobilized on
various other matrices, including, for example, on magnetic beads,
which provide a rapid and simple method of obtaining a fraction
containing an ATP-- or an I.kappa.B-bound IKK complex or IKK
subunit or an anti-I.kappa.B kinase-bound IKK from the remainder of
the sample. Methods for immobilizing a ligand such as ATP or an
I.kappa.B or an antibody are well known in the art (Haystead et
al., Eur. J. Biochem. 214:459-467 (1993), which is incorporated
herein by reference; see, also, Hermanson, supra, 1996). Similarly,
the artisan will recognize that a sample containing an IKK complex
or an IKK subunit can be a cell, tissue or organ sample, which is
obtained from an animal, including a mammal such as a human, and
prepared as a lysate; or can be a bacterial, insect, yeast or
mammalian cell lysate, in which an IKK catalytic subunit is
expressed from a recombinant nucleic acid molecule. As disclosed
herein, a recombinantly expressed IKK.alpha. or IKK.beta. such as a
tagged IKK.alpha. or IKK.beta. associates into an active 300 kDa
and 900 kDa IKK complex (see Examples III and IV).
[0108] The invention also provides a method of identifying a second
protein that associates with an IKK complex, particularly with an
IKK subunit. A transcription activation assay such as the yeast two
hybrid system is particularly useful for the identification of
protein-protein interactions (Fields and Song, Nature 340:245-246
(1989), which is incorporated herein by reference). In addition,
the two hybrid assay is useful for the manipulation of
protein-protein interaction and, therefore, also is useful in a
screening assay to identify agents that modulate the specific
interaction.
[0109] A transcription activation assay such as the two hybrid
assay also can be performed in mammalian cells (Fearon et al.,
Proc. Natl. Acad. Sci. USA 89:7958-7962 (1992), which is
incorporated herein by reference).
[0110] However, the yeast two hybrid system provides a particularly
useful assay due to the ease of working with yeast and the speed
with which the assay can be performed. Thus, the invention also
provides methods of identifying proteins that can interact with an
IKK subunit, including proteins that can act as upstream activators
or downstream effectors of IKK activity in a signal transduction
pathway mediated by the IKK or proteins that bind to and regulate
the activity of the IKK. Such proteins that interact with an IKK
catalytic subunit can be involved, for example, in tissue specific
regulation of NF-.kappa.B activation or constitutive NF-.kappa.B
activation and consequent gene expression.
[0111] The conceptual basis for a transcription activation assay is
predicated on the modular nature of transcription factors, which
consist of functionally separable DNA-binding and trans-activation
domains. When expressed as separate proteins, these two domains
fail to mediate gene transcription. However, the ability to
activate transcription can be restored if the DNA-binding domain
and the trans-activation domain are bridged together through a
protein-protein interaction. These domains can be bridged, for
example, by expressing the DNA-binding domain and trans-activation
domain as fusion proteins (hybrids), where the proteins that are
appended to these domains can interact with each other. The
protein-protein interaction of the hybrids can bring the
DNA-binding and trans-activation domains together to create a
transcriptionally competent complex.
[0112] One adaptation of the transcription activation assay, the
yeast two hybrid system, uses S. cerevisiae as a host cell for
vectors that express the hybrid proteins. For example, a yeast host
cell containing a reporter lacZ gene linked to a LexA operator
sequence can be used to identify specific interactions between an
IKK subunit and a second protein, where the DNA-binding domain is
the LexA binding domain, which binds the LexA promoter, and the
trans-activation domain is the B42 acidic region. When the LexA
domain is bridged to the B42 transactivation domain through the
interaction of the IKK subunit with a second protein, which can be
expressed, for example, from a cDNA library, transcription of the
reporter lacZ gene is activated. In this way, proteins that
interact with the IKK subunit can be identified and their role in a
signal transduction pathway mediated by the IKK can be elucidated.
Such second proteins can include additional subunits comprising the
300 kDa or 900 kDa IKK complex.
[0113] In addition to identifying proteins that were not previously
known to interact with an IKK, particularly with an IKK.alpha. or
IKK.beta. subunit, a transcription activation assay such as the
yeast two hybrid system also is useful as a screening assay to
identify agents that alter association of an IKK subunit and a
second protein known to bind the IKK. Thus, as described above for
in vitro screening assays, a transcription activation assay can be
used to screen a panel of agents to identify those agents
particularly useful for altering the association of an IKK subunit
and a second protein in a cell. Such agents can be identified by
detecting an altered level of transcription of a reporter gene, as
described above, as compared to the level of transcription in the
absence of the agent. For example, an agent that increases the
interaction between an IKK subunit and I.kappa.B can be identified
by an increased level of transcription of the reporter gene as
compared to the control level of transcription in the absence of
the agent. Such a method is particularly useful because it
identifies an agent that alters the association of an IKK subunit
and a second protein in a living cell.
[0114] In some cases, an agent may not be able to cross the yeast
cell wall and, therefore, cannot enter the yeast cell to alter a
protein-protein interaction.
[0115] The use of yeast spheroplasts, which are yeast cells that
lack a cell wall, can circumvent this problem (Smith and Corcoran,
In Current Protocols in Molecular Biology (ed. Ausubel et al.;
Green Publ., NY 1989), which is incorporated herein by reference).
In addition, an agent, upon entering a cell, may require
"activation" by a cellular mechanism that may not be present in
yeast. Activation of an agent can include, for example, metabolic
processing of the agent or a modification such as phosphorylation
of the agent, which can be necessary to confer activity upon the
agent. In this case, a mammalian cell line can be used to screen a
panel of agents (Fearon et al., supra, 1992).
[0116] An agent that alters the catalytic activity of an IKK or
that alters the association of an IKK subunit or IKK complex and a
second protein such as an I.kappa.B or an IKK regulatory subunit or
an upstream activator of an IKK can be useful as a drug to reduce
the severity of a pathology characterized by aberrant NF-.kappa.B
activity. For example, a drug that increases the activity of an IKK
or that increases the affinity of an IKK catalytic subunit and
I.kappa.B.alpha. can increase the amount of I.kappa.B.alpha.
phosphorylated on Ser-32 or Ser-36 and, therefore, increase the
amount of active NF-.kappa.B and the expression of a gene regulated
by NF-.kappa.B, since the drug will increase the level of
phosphorylated I.kappa.B.alpha. in the cell, thereby allowing
NF-.kappa.B translocation to the nucleus. In contrast, a drug that
decreases or inhibits the catalytic activity of an IKK or the
association of an IKK catalytic subunit and I.kappa.B.alpha. can be
useful where it is desirable to decrease the level of active
NF-.kappa.B in a cell and the expression of a gene induced by
activated NF-.kappa.B. It should be recognized that an antisense
IKK subunit molecule of the invention also can be used to decrease
IKK activity in a cell by reducing or inhibiting expression of the
IKK subunit or by reducing or inhibiting its responsiveness to an
inducing agent such as TNF.alpha., Il-1 or phorbol ester (see
Example II). Accordingly, the invention also provides methods of
treating an individual suffering from a pathology characterized by
aberrant NF-.kappa.B activity by administering to the individual an
agent that modulates the catalytic activity of an IKK or that
alters the association of an IKK subunit and a second protein such
as I.kappa.B or a subunit of a 300 kDa or 900 kDa IKK complex that
interacts with the IKK subunit.
[0117] An agent that decreases the activity of an IKK or otherwise
decreases the amount of I.kappa.B phosphorylation in a cell can
reduce or inhibit NF-.kappa.B mediated gene expression, including,
for example, the expression of proinflammatory molecules such as
cytokines and other biological effectors involved in an
inflammatory, immune or acute phase response. The ability to reduce
or inhibit such gene expression can be particularly valuable for
treating various pathological conditions such as rheumatoid
arthritis, asthma and septic shock, which are characterized or
exacerbated by the expression of such proinflammatory
molecules.
[0118] Glucocorticoids are potent anti-inflammatory and
immunosuppressive agents that are used clinically to treat various
pathologic conditions, including autoimmune diseases such as
rheumatoid arthritis, systemic lupus erythematosis and asthma.
Glucocorticoids suppress the immune and inflammatory responses, at
least in part, by increasing the rate of I.kappa.B.alpha.
synthesis, resulting in increased cellular levels of
I.kappa.B.alpha., which bind to and inactivate NF-.kappa.B
(Scheinman et al., Science 270:283-286 (1995); Auphan et al.,
Science 270:286-290 (1995)). Thus, glucocorticoids suppress
NF-.kappa.B mediated expression of genes encoding, for example,
cytokines, thereby suppressing the immune, inflammatory and acute
phase responses. However, glucocorticoids and glucocorticoid-like
steroids also are produced physiologically and are required for
normal growth and development. Unfortunately, prolonged treatment
of an individual with higher than physiological amounts of
glucocorticoids produces clinically undesirable side effects. Thus,
the use of an agent that alters the activity of an IKK or that
alters the association of an IKK complex or IKK subunit and a
second protein, as identified using a method of the invention, can
provide a means for selectively altering NF-.kappa.B activity
without producing some of the undesirable side effects associated
with glucocorticoid treatment.
[0119] Inappropriate regulation of Rel/NF-.kappa.B transcription
factors is associated with various human diseases. For example,
many viruses, including human immunodeficiency virus-1 (HIV-1),
herpes simplex virus-1 (HSV-1) and cytomegalovirus (CMV) contain
genes regulated by a KB regulatory element and these viruses, upon
infecting a cell, utilize cellular Rel/NF-.kappa.B transcription
factors to mediate viral gene expression (Siebenlist et al., supra,
1994). Tat-mediated transcription from the HIV-1 enhancer, for
example, is decreased if the NF-.kappa.B and SP1 binding sites are
deleted from the enhancer/promotor region, indicating that Tat
interacts with NF-.kappa.B, SP1 or other transcription factors
bound at this site to stimulate transcription (Roulston et al.,
Microbiol. Rev. 59:481-505 (1995)). In addition, chronic HIV-1
infection, and progression to AIDS, is associated with the
development of constitutive NF-.kappa.B DNA binding activity in
myeloid cells (Roulston et al., supra, 1995). Thus, a positive
autoregulatory loop is formed, whereby HIV-1 infection results in
constitutively active NF-.kappa.B, which induces expression of
HIV-1 genes (Baeuerle and Baltimore, Cell 87:13-20 (1996).
Constitutive NF-.kappa.B activation also may protect cells against
apoptosis, preventing clearance of virus-infected cells by the
immune system (Liu et al., supra, 1996).
[0120] An agent that decreases the activity of an IKK or that
alters the association of an IKK and a second protein such that
I.kappa.B phosphorylation is decreased can be useful for reducing
the severity of a viral infection such as HIV-1 infection in an
individual by providing increased levels of unphosphorylated
I.kappa.B in virus-infected cells. The unphosphorylated I.kappa.B
then can bind to NF-.kappa.B in the cell, thereby preventing
nuclear translocation of the NF-.kappa.B and viral gene expression.
In this way, the rate of expansion of the virus population can be
limited, thereby providing a therapeutic advantage to the
individual.
[0121] In addition, the decreased level of NF-.kappa.B activity may
allow the virus-infected cell to undergo apoptosis, resulting in a
decrease in the viral load in the individual. As such, it can be
particularly useful to treat virus-infected cells ex vivo with an
agent identified using a method of the invention. For example,
peripheral blood mononuclear cells (PBMCs) can be collected from an
HIV-1 infected individual and treated in culture with an agent that
decreases the activity of an IKK or alters the association of an
IKK complex or an IKK catalytic subunit with an I.kappa.B. Such a
treatment can be useful to purge the PBMCs of the virus-infected
cells by allowing apoptosis to proceed. The purged population of
PBMCs then can be expanded, if desired, and readministered to the
individual.
[0122] Rel/NF-.kappa.B proteins also are involved in a number of
different types of cancer. For example, the adhesion of cancer
cells to endothelial cells is S6 increased due to treatment of the
cancer cells with IL-1, suggesting that NF-.kappa.B induced the
expression of cell adhesion molecules, which mediated adherence of
the tumor cells to the endothelial cells; agents such as aspirin,
which decrease NF-.kappa.B activity, blocked the adhesion by
inhibiting expression of the cell adhesion molecules (Tozawa et
al., Cancer Res. 55:4162-4167 (1995)). These results indicate that
an agent that decreases the activity of an IKK or that decrease the
association of an IKK and I.kappa.B or of an IKK subunit and a
second protein, for example, a second protein present in an IKK
complex, can be useful for reducing the likelihood of metastasis of
a tumor in an individual.
[0123] As discussed above for virus-infected cells, constitutive
NF-.kappa.B activation also may protect tumor cells against
programmed cell death as well as apoptosis induced by
chemotherapeutic agents (Liu et al., supra, 1996; Baeuerle and
Baltimore, Cell 87:13-20 (1996)). Thus, an agent that decreases IKK
activity or that decreases the association of IKK and I.kappa.B
also can be useful for allowing programmed cell death to occur in a
tumor cell by increasing the level of unphosphorylated I.kappa.B,
which can bind NF-.kappa.B and decrease the level of active
NF-.kappa.B in the tumor cell.
[0124] The following examples are intended to illustrate but not
limit the present invention.
Example I
Identification and Characterization of a Human I.kappa.B Kinase
Complex and IKK Subunits
[0125] This example provides a method for identifying and isolating
a cytokine responsive protein kinase complex that phosphorylates
I.kappa.B, which regulates NF-.kappa.B activity, and catalytic
subunits of the protein kinase complex.
A. Kinase Assays:
[0126] Kinase assays were performed using GST fusion proteins
containing amino acid residues 1 to 54 of I.kappa.B. The fusion
proteins were linked to glutathione SEPHAROSE and the beads were
used directly in the assays. At earlier stages in the purification
of the IKK activity, the beads were washed prior to loading onto
the gel to minimize contributions from other proteins. In some of
the later characterization of highly purified material, soluble
fusion protein was used.
[0127] Three distinct substrates for the IKK activity were used: 1)
substrate "WT" contained amino acid residues 1 to 54 of
I.kappa.B.alpha.; 2) substrate "AA" contained amino acid residues 1
to 54 of I.kappa.B.alpha., except that Ser-32 (S32) and S36 were
replaced with Ala-32 (A32) and A36, respectively; and 3) substrate
"TT" contained amino acid residues 1 to 54 of I.kappa.B.alpha.,
except that S32 and S36 were replaced with Thr-32 (T32) and T36,
respectively (DiDonato et al., Mol. Cell. Biol. 16:1295-1304
(1996)). Each substrate was expressed as a GST fusion protein. The
physiologic, inducible I.kappa.B kinase is specific for S32 and S36
(WT) in I.kappa.B.alpha., but does not recognize the TT or AA
mutants (DiDonato et al., Mol. Cell. Biol. 16:1295-1304
(1996)).
[0128] Kinase assays were carried out in 20 mM HEPES (pH 7.5-7.6),
20 mM .beta.-glycerophosphate (.beta.-GP), 10 mM MgCl.sub.2, 10 mM
PNPP, 100 .mu.M Na.sub.3VO.sub.4, 2 mM dithiothreitol (DTT), 20
.mu.M ATP, 10 .mu.g/ml aprotinin. NaCl concentration was 150-200 mM
and the assays were carried out at 30.degree. C. for 30 min.
Fractionation was performed by SDS-PAGE, followed by quantitation
by phosphoimager analysis.
B. Purification of IKK Complex and IKK Subunits:
[0129] The protein purification buffer (Buffer A) consisted of 20
mM Tris (pH 7.6, measured at RT), 20 mM NaF, 20 mM .beta.-GP, 1 mM
PNPP, 500 .mu.M Na.sub.3VO.sub.4, 2 mM DTT, 2.5 mM metabisulfite, 5
mM benzamidine, 1 mM EDTA, 0.5 mM EGTA, 1 mM PMSF, and 10 glycerol.
Brij-35 was added as indicated. Cell lysis buffer was Buffer A
containing an additional 19 mM PNPP, 20 mM .beta.-GP and 500 .mu.M
Na.sub.3VO.sub.4, and 20 .mu.g/ml aprotinin, 2.5 .mu.g/ml
leupeptin, 8.3 .mu.g/ml bestatin, 1.7 .mu.g/ml pepstatin.
[0130] Purification was performed using 5 to 130 liters of HeLa S3
cells. For illustration, the procedure for a 15 liter preparation
is presented. All purification steps were performed in a cold room
at 4.degree. C.
[0131] In order to activate the IKK, cells were stimulated with
TNF.alpha. prior to purification. TNF.alpha. was either recombinant
TNF.alpha., which was purchased from R&D Systems and used at 20
ng/ml, or HIS6-tagged TNF.alpha., which was expressed and partially
purified from E. coli and used at 5 .mu.g/ml. TNF.alpha.-induced
HeLa S3 cell killing activity assays were performed in the presence
of cycloheximide and indicated that the partially purified
HIS6-tagged TNF.alpha. had approximately one-tenth the activity of
the commercial TNF.alpha..
[0132] Fifteen liters of HeLa S3 cells were grown in suspension in
high glucose Dulbecco's modified Eagle's medium supplemented with
10% calf serum, 2 mg/ml L-glutamine, 100 U/ml
penicillin/streptomycin, 0.11 mg/ml sodium pyruvate, and 1.times.
nonessential amino acids (Irvine Scientific; Irvine Calif.). Cell
density was approximately 5.times.10.sup.5 cells/ml at the time of
collection. Cells were concentrated 10-fold by centrifugation
stimulated for 5 min with TNF.alpha. at 37.degree. C., then diluted
with 2.5 volumes of ice cold phosphate buffered saline (PBS)
containing 50 mM NaF and pelletted at 2000.times.g. The cell pellet
was washed once with ice cold PBS/50 mM NaF, then suspended in
lysis buffer, quick frozen in liquid nitrogen and stored at
-80.degree. C.
[0133] For purification of I.kappa.B kinase, cells were thawed and
cytoplasmic extract prepared. Lysis was achieved by 40 strokes in
an all glass Dounce homogenizer (pestle A) in lysis buffer
containing 0.05 k NP-40 on ice. The homogenate was centrifuged at
12,000 rpm for 19 min in a Beckman SS34 rotor at 4.degree. C.
[0134] Supernatant was collected and centrifuged at 38,000 rpm for
80 min in a Beckman 50.1 Ti rotor at 4.degree. C. The supernatant
(S100 fraction) was quick frozen in liquid nitrogen and stored at
-80.degree. C. Small aliquots of S100 material, prepared from
either unstimulated HeLa cells or from TNF.alpha. stimulated cells,
were purified in a single passage over a SUPEROSE 6 gel filtration
column (1.0.times.30 cm; Pharmacia; Uppsalla Sweden) equilibrated
in Buffer A containing 0.1% Brij-35 and 300 mM NaCl and eluted at a
flow rate of 0.3 ml/min. 0.6 ml fractions were collected and kinase
assays were performed on an aliquot of each fraction. The high
molecular weight material (fractions 16-20) contained
TNF.alpha.-inducible IKK activity, which is specific for the WT
substrate.
[0135] 110 ml of S100 material (900 mg of protein; Bio-Rad Protein
Assay) was pumped onto a Q-SEPHAROSE FAST FLOW column (56 ml bed
volume, 2.6 cm ID) equilibrated at 2 ml/min with Buffer A
containing 0.1% Brij-35. After the sample was loaded, the column
was washed with 100 ml of Buffer A containing 0.1% Brij-35 and 100
mM NaCl, then a linear NaCl gradient was run from 100-300 mM. The
gradient volume was 500 ml and the flow rate was 2 ml/min. Ten ml
fractions were collected and the kinase assay was performed on
those fractions that eluted during the gradient. Fractions
corresponding to the TNF.alpha.-inducible IKK activity (fractions
30-42; i.e., 20-32 of the gradient portion) were pooled. The pooled
material contained 40 mg of protein.
[0136] The pooled material was diluted to 390 ml by addition of
Buffer A containing 0.1% Brij-35 and loaded onto a pre-equilibrated
5 ml HITRAP Q column (Pharmacia) at a flow rate of 4 ml/min.
Following sample loading, the column was washed with 20 ml of
Buffer A containing 0.1% Brij-35. The protein was eluted at 1
ml/min isocratically in Buffer A containing 0.1% Brij-35 and 300 mM
NaCl and 1 ml fractions were collected. Protein-containing
fractions were identified using the BioRad assay and were collected
and pooled to yield 4 ml of solution. Previously performed control
experiments demonstrated that the IKK activity directly correlated
with protein concentration.
[0137] The pooled material was diluted 1:1 with ATP column buffer
(20 mM HEPES (pH 7.3), 50 mM .beta.-GP, 60 mM MgCl.sub.2, 1 mM
Na.sub.2VO.sub.4, 1.5 mM EGTA, 1 mM DTT, 10 .mu.g/ml aprotinin),
then passed 4 times over a .gamma.-ATP affinity column having 4 ml
bed volume (Haystead et al., supra, 1993); the column had been
prewashed with 2 M NaCl, 0.25% Brij-35 and equilibrated with 10 bed
volumes of ATP column buffer containing 0.05% Brij-35 at a flow
rate of 0.5 ml/min. Following loading of the sample, the column was
washed with 10 ml of ATP column buffer containing 0.05% Brij-35,
then with 10 ml ATP column buffer containing 0.05% Brij-35 and 250
mM NaCl.
[0138] Bound material was eluted in 10 ml of ATP column buffer
containing 0.05% Brij-35, 250 mM NaCl and 10 mM ATP (elution
buffer). Elution was performed by passing 5 ml of elution buffer
through the column, allowing the column to incubate, capped, for 20
min, then passing an additional 5 ml of elution buffer through the
column. The samples were pooled to yield 10 ml.
[0139] The 10 ml pooled sample from the ATP column was diluted with
30 ml Buffer A containing 0.1a Brij-35 and loaded onto a 1 ml
HITRAP Q column (Pharmacia) at 1 ml/min. The column was eluted at
0.4 ml/min with Buffer A containing 0.1% Brij-35 and 300 mM NaCl.
0.2 ml fractions were collected and the four protein-containing
fractions were pooled (0.5 mg). The pooled material was
concentrated to 200 .mu.l on a 10K NANOSEP concentrator
(Pall/Filtron) and loaded onto a SUPEROSE 6 gel filtration column
(1.0.times.30 cm). The SUPEROSE 6 column was equilibrated in Buffer
A containing 0.1% Brij-35 and 300 mM NaCl and run at a flow rate of
0.3 ml/min; 0.6 ml fractions were collected. Fractions 17, 18 and
19 contained kinase activity.
[0140] Based on silver stained SDS-PAGE gels, the final purified
material consisted of approximately 20 .mu.g to 40 .mu.g of total
protein, of which approximately 2 .mu.g corresponded to the 85 kDa
band, later designated IKK.alpha. (see Example II). A second band
migrating at 87 kDa was later designated IKK (see Example III). The
total time from the thawing of the S100 material until the
collection of fractions from the gel filtration column was 24
hours.
C. Confirmation of IKK purification.
[0141] Since the 85 kDa IKK.alpha. band identified by the kinase
assay following the above procedure contained only about 10% of the
total purified protein, three additional criteria were used to
confirm that the identified band was an intrinsic component of the
IKK complex.
[0142] In one procedure, the elution profile of the SUPEROSE 6
column was analyzed by silver stained 8% SDS-PAGE gels, then
compared to the kinase activity profile. For this analysis, 0.3 ml
fractions were collected from the SUPEROSE 6 column, then separated
by 8% SDS-PAGE and silver stained. This comparison confirmed that a
single band of 85 kDa correlated precisely with the elution of IKK
activity.
[0143] In a second procedure, the IKK activity was further purified
on a substrate affinity column at 4.degree. C.
A GST fusion protein was prepared containing the A32/A36 1 to 54
amino acid sequence of I.kappa.B.alpha. repeated 8 times
(GST-(8X-AA)). The GST-(8X-AA) then was covalently linked to a CNBr
activated SEPHAROSE 4B resin to produce the substrate affinity
resin.
[0144] IKK-containing material was diluted into
[0145] Buffer A to yield a final concentration of 70 mM NaCl,
0.025% Brij-35, then added to the substrate affinity resin at a
ratio of 4:1 (solution:swollen beads). The resin was suspended and
the mixture rotated gently overnight in a small column at 4.degree.
C. The resin was allowed to settle for 30 min, then the column was
eluted by gravity. The column was washed with 4 bed volumes Buffer
A containing 0.02% Brij-35, then the resin was suspended with 1.1
bed volumes of Buffer A containing 600 mM NaCl and 0.1% Brij-35.
The resin was allowed to settle for 40 min, then gravity elution
was performed.
[0146] The column was washed with an additional 1.1 bed volumes of
Buffer A containing 600 mM NaCl and 0.1% Brij-35 and the two
fractions were pooled.
[0147] The I.kappa.B.alpha. substrate affinity column was used for
two separate experiments. In one experiment, the material that
eluted from the final SUPEROSE 6 column was further purified on the
I.kappa.BA substrate affinity column.
[0148] In the second experiment, material obtained after the
initial Q-SEPHAROSE column was purified on the I.kappa.B.alpha.
substrate affinity column. The Q-SEPHAROSE bound fraction then was
further purified on the ATP column and the SUPEROSE 6 column (see
above).
[0149] Analysis of the purified material from these two experiments
by silver stained SDS-PAGE gels revealed different protein
profiles. However, comparison of these profiles revealed only two
bands common to both preparations, one of which was confirmed to be
the same 85 kDa IKK.alpha. band that was identified by the SUPEROSE
6 profile analysis and cofractionated with I.kappa.B kinase
activity. The other band, which was 87 kDa in size, later was
identified as IKK5. In several different experiments, the 85 kDa
protein and 87 kDa protein were specifically purified by the
substrate affinity column in what appeared to be an equimolar
ratio.
[0150] In a third procedure, purified IKK was treated with excess
phosphatase, which inactivates the IKK, then reactivated by
addition of a semi-purified HeLa extract.
[0151] Phosphatase inactivation was performed by adding excess
protein phosphatase 2A catalytic domain (PP2A) to purified
I.kappa.B kinase in 50 mM Tris (pH 7.6), 50 mM NaCl, 1 mM
MgCl.sub.2, then equilibrating the reaction for 60 min at
30.degree. C. 1.25 .mu.M okadaic acid was added to completely
inactivate the phosphatase and the phosphatase inactivated material
was used in standard kinase assays and to perform the reactivation
and phosphorylation procedure.
[0152] Cytoplasmic extract was prepared using HeLa S3 cells. The
cells were stimulated with TNF.alpha. for 5 min, then harvested in
lysis buffer containing 0.1% NP-40 and 0.15 M NaCl. Reactivation
was performed at 30.degree. C. in kinase buffer for 60 min in the
absence of (.gamma.-.sup.32P)ATP. Samples containing only cold ATP
were used for kinase activity assays. Reactivation by the HeLa cell
extract was performed in the presence of (.gamma.-.sup.32P)ATP,
then the sample was separated by 8% SDS-PAGE and examined by
autoradiography. A band of approximately 86 kDa was phosphorylated
in the reactivated material and, associated with the reactivation
procedure, was restoration of the IKK activity.
D. Partial Amino Acid Sequences of IKK.alpha. and IKK.beta.
[0153] Following SDS-PAGE as described above, the 85 kDa IKK.alpha.
and 87 kDa IKK bands were excised from the gel and submitted for
internal peptide sequencing analysis. From the IKK.alpha.
polypeptide, the sequences of two proteolytic fragments were
identified, as follows: KIIDLLPK (SEQ ID NO: 3) and
KHR(D/A)LKPENIVLQDVG(P/G)K (SEQ ID NO: 4). Where a residue could
not be unambiguously determined, an "X" was used to indicate no
amino acid could be determined and parentheses were used to delimit
amino acids that could not be distinguished. Since Lys-C protease
was used to digest the protein, the presence of lysine residues at
the N-termini of the peptides was inferred. From the 87 kDa
IKK.beta. band, the sequences of five proteolytic fragments were
determined (see FIG. 3, underlined; see, also, Example III).
Example II
Identification and Characterization of a Full Length Human
IKK.alpha. Subunit
[0154] This example provides methods for isolating a nucleic acid
molecule encoding the IKK.alpha. subunit and for characterizing the
functional activity of the subunit.
A. Cloning of cDNA Encoding human IKK.alpha.:
[0155] Degenerate oligonucleotide (length) sequences of the amino
acid sequences of two peptide fragments (SEQ ID NOS: 3 and 4) of
the IKK.alpha. (see FIG. 1) were searched in the GenBank DNA
sequence database. This search revealed that nucleotide sequences
encoding both peptide fragments were present in a partial cDNA
encoding a portion of a protein designated human CHUK (GenBank
Accession #U22512; Connelly and Marcu, supra, 1995).
[0156] Based on the human CHUK cDNA sequence, PCR primers were
prepared corresponding to the 5'-terminus
(5'-CCCCATATGTACCAGCATCGGGAA-3'; SEQ ID NO: 5) and 3'-terminus
(3'-CCCCTCGAGTTCTGTTAACCAACT-5'; SEQ ID NO: 6). SEQ ID NO: 5 also
contains a Nde I restriction endonuclease site (underlined) and an
ATG (AUG) methionine codon (bold) and SEQ ID NO: 6 also contains an
Xho I site. RNA was isolated from HeLa cells and first strand cDNA
was prepared and used for a template by PCR using SEQ ID NOS: 5 and
6 as primers. The resulting 2.1 kilobase (kb) fragment was gel
purified, .sup.32P-labeled using oligo-dT and random primers, and
used to screen a human fetal brain library (Clontech; Palo Alto
Calif.) under high stringency conditions (50% formamide, 42.degree.
C.; Sambrook et al., supra, 1989).
[0157] In order to obtain the 5'-end of the cDNA encoding
IKK.alpha., positive plaques from above were screened by PCR using
two internal primers, (5'-CATGGCACCATCGTTCTCTG-3'; SEQ ID NO: 7),
which is complementary to the sequence including the Ban I site
around position 136 of SEQ ID NO: 1, and
(5'-CTCAAAGAGCTCTGGGGCCAGATAC-3'; SEQ ID NO: 8), which is
complementary to the sequence including the Sac I site around
position 475, and a vector specific primer (TCCGAGATCTGGACGAGC-3';
SEQ ID NO: 9), which is complementary to vector sequences at the
5'-end of the cDNA insert. The longest PCR product was selected and
sequenced by the dideoxy method.
[0158] DNA sequencing revealed that the cloned IKK.alpha. cDNA
contained an additional 31 amino acids at the --N-terminus as
compared to human CHUK. The human IKK.alpha. shares a high amount
of sequence identity with a protein designated mouse CHUK (GenBank
Accession #U12473; Connelly and Marcu, supra, 1995). Although the
mouse CHUK contains a domain having characteristics of a
serine-threonine protein kinase, no functional activity of the
protein was reported and no potential substrates were identified.
The putative serine-threonine protein kinase domain of human CHUK
was truncated at the N-terminus.
B. Expression of Human IKK.alpha. or of an Antisense IKK.alpha.
Nucleic Acid in a Cell:
[0159] The full length IKK.alpha. cDNA and a cDNA encoding the
.DELTA.31 human CHUK protein (Connelly and Marcu, supra, 1995) were
subcloned into the Nde I and Xho I sites of a bacterial expression
vector encoding a carboxy terminal FLAG epitope and HIS6 tag.
Mammalian cell expression vectors were constructed by cleaving the
bacterial expression vector with Nde I and Hind III, to release the
cDNA inserts, converting the ends of the inserts to blunt ends
using Klenow polymerase, and ligating the cDNA inserts encoding the
full length IKK.alpha. or the .DELTA.31 human CHUK into pcDNA3
(Invitrogen).
[0160] Alternatively, the IKK.alpha. cDNA and A31 cDNA were
subcloned into the Bst XI site of the pRc.beta.actin vector
(DiDonato et al., supra, 1996). Orientation of the inserts (sense
or antisense) was determined by restriction endonuclease mapping
and partial sequence using vector-specific primers. Vector
containing the cDNA's inserted in the sense orientation were
examined for expression of the encoded product by immunoblot
analysis using an antibody specific for the FLAG epitope.
[0161] Transfection experiments were performed to determine the
effect of expressing the cloned IKK.alpha. in HeLa cells or of
expressing the cloned IKK.alpha. cDNA in the antisense orientation.
One day prior to performing the transfections, HeLa cells were
split into 35 mm dishes to approximately 50% confluency. Cells were
transfected with 0.25 .mu.g of a luciferase reporter gene
containing an IL-8 promotor (Eckman et al., Amer. Soc. Clin.
Invest. 96:1269-1279 (1995), which is incorporated herein by
reference) along with either 1 .mu.g pcDNA3 (Invitrogen, La Jolla
Calif.; vector control), 1 .mu.g pRc.beta.actin-IKK.alpha.-AA
(sense orientation), 1 .mu.g pRc.beta.actin-IKK.alpha.-K
(antisense), or 0.1 .mu.g pcDNA-IKK.alpha.-K using the
LIPOFECTAMINE method as recommended by the manufacturer (GIBCO/BRL,
Gaithersburg Md.). Total DNA concentrations were kept constant by
addition of empty pRc.beta.actin DNA.
[0162] Transfected cells were incubated in DMEM containing 10% FBS
for 24 hr. The cells then were washed and the growth medium was
replaced with DMEM containing 0.1 FBS. Cells either were left
untreated, or were treated with 20 ng/ml TNF.alpha., 20 ng/ml
IL-1.alpha., or 100 ng/ml TPA (phorbol ester) for 3.5 hr. Cells
were harvested by scraping and washed once with PBS, then lysed in
100 .mu.l PBS containing 1% TRITON-X100. Luciferase assays were
performed using 20 .mu.l of lysate (DiDonato et al., supra, 1995).
The protein concentration of each extract was determined using the
BIORAD protein assay kit and luciferase activity was normalized
according to the protein concentrations.
[0163] NF-.kappa.B is known to induce expression for the IL-8
promotor. Thus, as expected, treatment of the vector transfected
control cells with TNF.alpha., IL-1.alpha. or TPA resulted in a 3-
to 5-fold increase in normalized luciferase activity. In
comparison, in cells transfected with the cDNA encoding IKK.alpha.,
treatment with TNF.alpha., IL-1.alpha. or TPA potentiated induction
of luciferase activity 5- to 6-fold above the level of induction
observed in the vector transfected cells. These results indicate
that expression of IKK.alpha. in cells increased the amount of
NF-.kappa.B activated in response to the inducing agents.
[0164] In cells transfected with the vector expressing the
antisense IKK.alpha. nucleic acid molecule, transcription of the
luciferase reporter gene induced by IL-1 or TNF.alpha. was at the
limit of detection, indicating transcription was almost completely
inhibited due to expression of the antisense IKK.alpha.. This
result indicates that the native IKK.alpha. is turned over
relatively rapidly in the cells. Furthermore, treatment of the
cells with the various inducing agents had no effect on the level
of luciferase expression of control reporter genes, which are not
responsive to NF-.kappa.B, as compared to the untreated cells.
Other appropriate control experiments were performed in parallel.
These results demonstrate the an expression of an antisense
IKK.alpha. nucleic acid molecule in a cell can specifically inhibit
NF-.kappa.B mediated gene expression.
Example III
[0165] Identification and Characterization of a Full Length Human
IKK.beta. Subunit
[0166] This example provides methods for isolating a nucleic acid
molecule encoding an IKK.beta. catalytic subunit of IKK and
characterizing the activity of the IKK.beta. subunit.
A. Cloning of IKK.beta. cDNA:
[0167] IKK.beta. was purified following SDS-PAGE and subjected to
internal peptide sequencing (Example I). Five peptide sequences
were obtained as follows: KIIDLGYAK (SEQ ID NO: 9);
KXVHILN(M/Y)(V/G)(T/N/R/E)(G/N)TI(H/I/S) (SEQ ID NO: 10);
KXXIQQD(T/A)GIP (SEQ ID NO: 11); KXRVIYTQL (SEQ ID NO: 12); and
KXEEVVSLMNEDEK (SEQ ID NO: 13), where amino acid residues that
could not be unambiguously determined are indicated by an "X" and
where amino acids that could not be distinguished are shown in
parentheses. These peptide sequences were used to screen the NCBI
EST database and a 336 base pair EST (EST29518; Accession No.
AA326115) encoding SEQ ID NOS: 12 and 13 was identified. This EST
was determined to correspond to amino acid residues 551 to 661 of
SEQ ID NO: 15.
[0168] cDNA corresponding to the EST was obtained by PCR using
first strand HeLa cDNA as a template and used to probe a human
fetal brain library (Clontech). A 1 kb fragment was identified and
used as a probe to screen a plasmid based B cell library
(Invitrogen). A 3 kb cDNA insert was isolated and sequenced (FIG.
2; SEQ ID NO: 14) and encoded the full length IKK.beta. (SEQ ID NO:
15), including all five proteolytic fragments (see FIG. 3).
[0169] Comparison of the amino acid sequences of IKK.alpha. and
IKK.beta. revealed greater than 50' amino acid identity (FIG. 3).
In addition, SEQ ID NO: 15 contains a kinase domain, which shares
65% amino acid identity with IKK.alpha., a leucine zipper and a
helix-loop-helix domain. Based on the sequence homology and domain
structure, the polypeptide (SEQ ID NO: 15) was determined to be a
member of the IKK catalytic subunit family of proteins with
IKK.alpha. and, therefore, was designated IKK.beta..
B. Characterization of IKK.beta.:
[0170] This section describes the results of various assays
characterizing IKK.beta. activity, particularly with regard to its
association with IKK.alpha.. In addition, northern blot analysis
revealed that IKK.crclbar. and IKK.alpha. are coexpressed in most
tissues examined, including pancreas, kidney, skeletal muscle,
lung, placenta, brain, heart, peripheral blood lymphocytes, colon,
small intestine, prostate, thymus and spleen.
1. IKK.beta. Kinase Activity
[0171] The kinase activity associated with IKK.beta. was
characterized using HeLa or 293 cells transiently transfected with
an HA-tagged IKK.beta. expression vector. Transfected cells were
stimulated with 20 ng/ml TNF for 10 min and HA-IKK.beta. was
isolated by immunoprecipitation using anti-HA antibody (Kolodziej
and Young, Meth. Enzymol. 194:508-519 (1991)). The immune complexes
were tested for the ability to phosphorylate wild type (wt) and
mutant forms of I.kappa.B.alpha. and I.kappa.B.beta. (see Example
I).
[0172] Similarly to the purified IKK complex and the complex
associated with IKK.alpha., the IKK.beta. immune complex
phosphorylated wt I.kappa.B.alpha. and I.kappa.B.beta., but not
mutants in which the inducible phosphorylation sites (Ser-32 and
Ser-36 for I.kappa.B.alpha. and Ser-19 and Ser-23 for
I.kappa.B.alpha.) were replaced with either alanines or threonines.
However, a low level of residual phosphorylation of full length
I.kappa.B.alpha.(A32/A36) was observed due to phosphorylation of
sites in the C-terminal portion of the protein (DiDonato et al.,
supra, 1997). Single substitution mutants, I.kappa.B.alpha.(A32)
and I.kappa.B(A36), were phosphorylated almost as efficiently as wt
I.kappa.B.alpha., indicating that IKK.beta.-associated IKK activity
can phosphorylate I.kappa.B.alpha. at both Ser-32 and Ser-36.
[0173] The response of IKK.beta.-associated kinase activity to
various stimuli also was examined in HeLa cells transiently
transfected with the HA-IKK.beta. expression vector. After 24 hr,
the cells were stimulated with either 10 ng/ml IL-1, 20 ng/ml TNF
or 100 ng/ml TPA, then HA-IKK.beta. immune complexes were isolated
by immunoprecipitation and IKK activity was measured. TNF and IL-1
potently stimulated IKK-associated kinase activity, whereas the
response to TPA was weaker. The kinetics of IKK.beta. activation by
either TNF or IL-1 essentially were identical to the kinetics of
activation of the IKK.beta.-associated I.kappa.B kinase measured by
a similar protocol.
2. Functional Interactions Between IKK.alpha. and IKK.beta.
[0174] As shown in Example I, IKK.alpha. and IKK.beta. copurified
in about a 1:1 ratio through several chromatographic steps,
suggesting that the two proteins interact with each other. The
ability of the IKK subunits to interact in a functional complex and
the effect of each subunit on the activity of the other subunit was
examined using 293 cells transfected with expression vectors
encoding Flag(M2)-IKK.alpha. or M2-IKK.alpha. and HA-IKK.beta.,
either alone or in combination (see Hopp et al., BioTechnology
6:1204-1210 (1988)). After 24 hr, samples of the cells were
stimulated with TNF, lysates were prepared from stimulated and
unstimulated cells, and one portion of the lysates was precipitated
with anti-Flag antibodies (Eastman Kodak Co.; New Haven Conn.) and
another portion was precipitated with anti-HA antibodies. The IKK
activity associated with the different immune complexes and their
content of IKK.alpha. and IKK.beta. were measured.
[0175] Considerably more basal IKK activity was precipitated with
HA-IKK.beta. than with Flag-IKK.alpha.. However, the activity
associated with HA-IKK.beta. was further elevated upon coexpression
of M2-IKK.alpha. and the low basal activity associated with
Flag-IKK.alpha. was strongly augmented by coexpression of
IKK.alpha.. Immunoblot analysis revealed that the potentiating
effect of such coexpression was not due to changes in the level of
expression of IKK.alpha. or IKK.beta..
[0176] The levels of IKK activities associated with IKK.alpha. and
IKK.beta. were compared more precisely by transfecting 293 cells
with increasing amounts of HA-IKK.alpha. or HA-IKK.beta. expression
vectors (0.1 to 0.5 .mu.g/10.sup.6 cells) and determining the
kinase activities associated with the two proteins in cell lysates
prepared before or after TNF stimulation (20 ng/ml, 5 min);
GST-I.kappa.B.alpha.(1-54) was used as substrate. The level of
expression of each protein was determined by immunoblot analysis
and used to calculate the relative levels of specific IKK
activity.
[0177] The HA-IKK.alpha.-associated IKK had a low level of basal
specific activity, whereas expression of HA-IKK.beta. resulted in
high basal specific activity that was increased when higher amounts
of HA-IKK.beta. were expressed. However, the specific IKK activity
associated with either IKK.alpha. or IKK.beta. isolated from
TNF-stimulated cells was very similar and was not considerably
affected by their expression level. These results indicate that
titration of a negative regulator or formation of a constitutively
active IKK complex can occur due to overexpression of
IKK.beta..
[0178] The ability of IKK.alpha. and IKK.beta. to physically
interact was examined. Immunoblot analysis demonstrated that
precipitation of HA-IKK.beta. using an anti-HA antibody
coprecipitated both endogenous IKK.alpha. and coexpressed
Flag-IKK.alpha., as indicated by the higher amount of
coprecipitating IKK.alpha. detected after cotransfection with
Flag-IKK.alpha.. Similarly, immunoprecipitation of Flag-IKK.alpha.
with anti-Flag(M2) antibody resulted in coprecipitation of
cotransfected HA-IKK.beta.. Exposure of the cells to TNF had no
significant effect on the association of IKK.alpha. and
IKK.beta..
[0179] The interaction between IKK.alpha. and IKK.beta. was further
examined by transfecting HeLa cells with various amounts (0.1 to
1.0 .mu.g/10.sup.6 cells) of the HA-IKK.beta. vector. After 24 hr,
the cells were incubated for 5 min in the absence or presence of 20
ng/ml TNF, then lysed. The lysates were examined for IKK activity
and for the amount of HA-IKK.beta. and endogenous IKK.alpha..
Expression of increasing amounts of HA-IKK.beta. resulted in higher
basal levels of IKK activity and increasing amounts of
coprecipitated IKK.alpha..
[0180] The level of TNF stimulated IKK activity increased only
marginally in response to IKK.beta. overexpression and TNF had no
effect on the association of IKK.beta. and IKK.alpha..
[0181] Since the results described above revealed that HA-IKK.beta.
associates with endogenous IKK.alpha. to generate a functional
cytokine-regulated IKK complex, this association was examined
further by transfecting HeLa cells with either empty expression
vector or small amounts (1 .mu.g/60 mm plate) of either
HA-IKK.alpha. or HA-IKK.beta. vectors. After 24 hr. samples of the
transfected cell populations were stimulated with 20 ng/ml TNF for
5 min, then cell lysates were prepared and separated by gel
filtration on a SUPEROSE 6 column. One portion of each column
fraction was immunoprecipitated with a polyclonal antibody specific
for IKK.alpha. and assayed for IKK.alpha.-associated IKK activity,
while a second portion was precipitated with anti-HA antibody and
examined for HA-IKK.beta.- or HA-IKK.alpha.-associated IKK
activity. Relative specific activity was determined by
immunoprecipitating the complexes, separating the proteins by
SDS-PAGE, blotting the proteins onto IMOBILON membranes (Millipore;
Bedford Mass.), immunoblotting with anti-HA antibody and
quantitating the levels of I.kappa.B phosphorylation and HA-tagged
proteins by phosphoimaging. The results demonstrated that
endogenous IKK.alpha.-associated IKK activity exists as two
complexes, a larger complex of approximately 900 kDa and a smaller
one of approximately 300 kDa. Stimulation with TNF increased the
IKK activity of both complexes, although the extent of increase was
considerably greater for the 900 kDa complex.
[0182] HA-IKK.beta.-associated IKK activity had exactly the same
distribution as the IKK.alpha.-associated activity, eluting at 900
kDa and 300 kDa and, again, the extent of TNF responsiveness was
considerably greater for the 900 kDa complex. Comparison to the
IKK.alpha.-associated activity in cells transfected with the empty
vector indicated that HA-IKK.beta. expression produced a modest,
approximately 2-fold increase in the relative amount of IKK
activity associated with the smaller 300 kDa complex. These results
indicate that the 300 kDa IKK complex, like the 900 kDa complex,
contains both IKK.alpha. and IKK.beta.. However, the 300 kDa lacks
other subunits present in the 900 kDa complex. When IKK.beta. was
overexpressed, the relative amount of the smaller complex
increased, indicating that some of the subunits that are unique to
the larger complex are present in a limited amount.
3. Both IKK.alpha. and IKK.beta. Contribute to IKK Activity
[0183] The relative contribution of IKK.alpha. and IKK.beta. to IKK
activity was examined by constructing mutant subunits in which the
lysine (K) codon present at position 44 of each subunit was
substituted with a codon for either methionine (M) or alanine (A)
codon, respectively. Similar mutations in other protein kinases
render the enzymes defective in binding ATP and, therefore,
catalytically inactive (Taylor et al., Ann. Rev. Cell Biol.
8:429-462 (1992)). The activity of the IKK mutants was compared to
the activity of their wild type (wt) counterparts by cell-free
translation in reticulocyte lysates using
GST-I.kappa.B.alpha.(1-54) as a substrate. Translation of
IKK.alpha.(KM) resulted in formation of I.kappa.B kinase having
only slightly less activity than the IKK formed by translation of
wt IKK.alpha.. In comparison, translation of IKK.beta.(KA) did not
generate IKK activity. Translation of wt IKK.beta. generated
I.kappa.B kinase activity as expected.
[0184] The activities of the different proteins also was examined
by transient transfection in mammalian cells. Expression and
immunoprecipitation of HA-IKK.alpha.(KM) resulted in isolation of
cytokine stimulated IKK activity that, after TNF stimulation, was
2- to 3-fold lower than the activity of IKK formed by wt
HA-IKK.alpha. isolated from TNF-stimulated cells. Similarly,
expression and immunoprecipitation of HA-IKK.beta. resulted in
formation of a cytokine responsive IKK activity that, after TNF
stimulation, was 3- to 5-fold lower than the activity of IKK
generated by wt HA-IKK.beta. isolated from TNF stimulated cells. In
contrast to results obtained by overexpression of wt HA-IKK.beta.,
however, overexpression of HA-IKK.beta.(KA) did not result in the
generation of basal IKK activity. Immunoprecipitation experiments
revealed that IKK.beta.(KM) associates IKK.beta. and that
IKK.beta.(KA) associates with IKK.alpha. and that both IKK.alpha.
and IKK.beta. undergo homotypic interactions as efficiently as they
undergo heterotypic interactions.
[0185] Autophosphorylation of wt and kinase-defective HA-IKK.alpha.
and HA-IKK.beta. was examined in transiently transfected HeLa
cells. HeLa cells expressing these proteins were treated with TNF
for 10 min, then cell lysates of TNF treated or untreated cells
were immunoprecipitated with HA antibodies and the immune complexes
were subjected to a phosphorylation reaction (DiDonato et al.,
supra, 1997). Both wt HA-IKK.alpha. and wt HA-IKK.beta. were
phosphorylated and their autophosphorylation was enhanced in
TNF-stimulated extracts. In contrast, the kinase-defective
IKK.alpha. or IKK.beta. mutants did not exhibit significant
autophosphorylation.
4. The role of the LZ and HLH motifs in IKK.alpha. and IKK.beta.
IKK.alpha. and IKK.beta. both contain leucine zipper (LZ) and
helix-loop-helix (HLH) motifs, which are known to mediate
protein-protein interactions through their hydrophobic surfaces.
The role of the LZ motif in the IKK subunit interaction was
examined using an IKK.alpha. mutant in which the L462 and L469
residues within the LZ region were substituted with serine
residues. The role of the HLH motif was examined using an HLH
mutant of IKK.alpha. containing a substitution of L605 with
arginine (R) and of F606 with proline (P). The activity of the
IKK.alpha. LZ.sup.- and HLH.sup.- mutants was examined by transient
transfection in 293 cells, either alone or in the presence of
cotransfected Flag-IKK.alpha..
[0186] Expression of wt HA-IKK.alpha. generated substantial IKK
activity that was isolated by immunoprecipitation with anti-HA,
whereas very little IKK activity was generated in cells transfected
with either the HA-IKK.alpha.(LZ).sup.- or HA-IKK.alpha.(HLH).sup.-
mutant. Coexpression of the mutant IKK subunits with Flag-IKK.beta.
resulted in a substantial increase in the IKK activity isolated by
immunoprecipitation of HA-IKK.alpha., but had no effect on the very
low activity that coprecipitated with HA-IKK.alpha.(LZ).sup.-.
[0187] However, coexpression of Flag-IKK.beta. did stimulate the
low level of IKK activity associated with HA-IKK.alpha.(HLH).sup.-.
Probing of the HA immune complexes with anti-Flag(M2) antibodies
indicated that both wt HA-IKK.alpha. and HA-IKK.alpha.(HLH).sup.-
associated with similar amounts of Flag-IKK.beta., but that the
HA-IKK.alpha.(LZ).sup.- mutant did not associate with
Flag-IKK.beta.. These results indicate that the lower I.kappa.B
kinase activity associated with the IKK.alpha.(LZ).sup.- mutant is
due to a defect in its ability to interact with IKK.beta.. The
lower I.kappa.B kinase activity of the IKK.alpha.(HLH).sup.-
mutant, on the other hand, likely is due to a defect in the ability
to interact with a second, undefined protein, since the HLH mutant
can interact with IKK.beta..
5. Both IKK.alpha. and IKK.beta. are Necessary for NF-.kappa.B
Activation
[0188] The contribution of IKK.alpha. and IKK.beta. to NF-.kappa.B
activation was examined using HeLa cells transfected with
expression vectors encoding HA-tagged wt IKK.alpha.,
IKK.alpha.(KM), wt IKK.beta. and IKK.beta.(KA); an HA-JNK1 vector
was used as a control. NF-.kappa.B activation was assessed by
examining the subcellular distribution of RelA(p65) by indirect
immunofluorescence.
[0189] HeLa cells were grown on glass cover slips in growth medium,
then transfected with 1 .mu.g plasmid DNA by the lipofectamine
method. After 24 hr, samples of cells were stimulated with 20 ng/ml
TNF for 30 min, then stimulated or unstimulated cells were washed
with PBS and fixed with 3.5% formaldehyde in PBS for 15 min at room
temperature (RT). The fixed cells were permeablized with 0.02 k
NP-40 in PBS for 1 min, then incubated with 100% goat serum at
4.degree. C. for 12 hr. The cells then were washed 3 times with PBS
and incubated with a mixture of a rabbit anti-NF-.kappa.B p65
(RelA) antibody (1:100 dilution; Santa Cruz Biotech) and a mouse
monoclonal anti-HA antibody in PBS containing 1% BSA and 0.2%
TRITON X-100 at 37.degree. C. for 2 hr. Cells then were washed 3
times with PBS containing 0.2% TRITON X-100 and incubated for 2 hr
at RT with secondary antibodies, fluorescein-conjugated goat
affinity purified anti-mouse IgG-IgM and rhodamine-conjugated IgG
fraction goat anti-rabbit IgG (1:200 dilution; Cappel). Cells were
washed 4 times with PBS containing 0.2% TRITON X-100, then covered
with a drop of gelvatol mounting solution and viewed and
photographed using a Zeiss Axioplan microscope equipped for
epifluorescence with the aid of fluoroscein and rhodamine specific
filters.
[0190] Double staining with both anti-RelA and anti-HA revealed
that expression of moderate amounts of either wt IKK.alpha. or wt
IKK.beta. did not produce considerable stimulation of RelA nuclear
translocation. In addition, the wt IKK proteins did not interfere
with the nuclear translocation of RelA induced by TNF treatment.
However, expression of similar levels of either IKK.alpha.(KM) or
IKK.beta.(KA), as determined by the intensity of the fluorescent
signal, inhibited the nuclear translocation of RelA in TNF-treated
cells. Expression of HA-JNK1 had no effect on the subcellular
distribution of RelA. Since the subcellular distribution of RelA is
dependent on the state and abundance of I.kappa.B, these results
indicate that expression of either IKK.alpha.(KM) or IKK.alpha.(KA)
inhibits the induction of I.kappa.B phosphorylation and degradation
by TNF.
Example IV
Isolation of I.kappa.B Kinase Complex
[0191] This example demonstrates a method for isolating the 900 kDa
I.kappa.B kinase complex comprising an IKK.alpha. polypeptide.
[0192] Proteins that associate with IKK.alpha. in vivo were
isolated by immunoprecipitation using HIS6 and FLAG epitope tags.
The HIS6--FLAG-IKK.alpha. (HF-IKK.alpha.) encoding construct was
prepared using a double stranded oligonucleotide,
5'-AGCTTGCGCGTATGGCTTCGGGTCATCACCATCACCA
TCACGGTGACTACAAGGACGACGATGACAAAGGTGACATCGAAGGTAGAGGTCA-31 (SEQ ID
NO: 16), which encodes six histidine residues (HIS6), the FLAG
epitope and the factor Xa site in tandem. The oligonucleotide was
inserted using HindIII-NdeI site in frame with the N-terminus of
the IKK.alpha. coding sequence in the BLUESCRIPT KS plasmid
(Stratagene; La Jolla Calif.). The HindIII-NotI fragment of this
plasmid, which contains the HF-IKK.alpha. cDNA sequence, was
subcloned into the pRc.beta.actin mammalian expression vector,
which contains a nucleic acid sequence conferring neomycin
resistance, to produce plasmid pRC-HF-IKK.alpha.. Expression of the
HF-IKK.alpha. polypeptide was confirmed by western blot analysis
using anti-FLAG antibodies.
[0193] PRC-HF-IKK.alpha. was transfected into human embryonic
kidney 293 cells and transfected cells were selected for growth in
the presence of G418. A low basal level of IKK activity was
detected in cells expressing HF-IKK.alpha. and IKK activity
increased several fold when the cells were treated with TNF.alpha..
This result indicates that the HF-IKK.alpha. expression in 293
cells is associated with IKK activity in the cells and that such
IKK activity is inducible in response to TNF.alpha..
[0194] A 293 cell line that expresses HF-IKK.alpha. was selected
and expanded to approximately 4.times.10.sup.8 cells. The cells
were treated with 10 ng/ml TNF.alpha. for 5 min, then harvested in
ice cold PBS by centrifugation at 2500.times.g. The cell pellet was
washed with ice cold PBS, resuspended in lysis buffer (20 mM Tris,
pH 7.6), 150 mM NaCl, 1% TRITON X-100, 20 mM
.beta.-glycerophosphate, 2 mM PNPP, 1 mM Na.sub.3VO.sub.4, 5 mM
.alpha.-mercaptoethanol, 1 mM EDTA, 0.5 mM EGTA, 1 mM PMSF, 3
.mu.g/ml pepstatin, 3 Hg/ml leupeptin, 10 .mu.g/ml bestatin and 25
.mu.g/ml aprotinin), and lysed by 20 strokes in a glass Dounce
homogenizer (pestle A).
[0195] The homogenate was centrifuged at 15,000 rpm in a Beckman
SS34 rotor for 30 min at 4.degree. C. The supernatant was
collected, supplemented with 20 mM imidazole and 300 mM NaCl, then
mixed with 0.5 ml of a 50% slurry of Ni-NTA (nickel
nitrilotriacetic acid; Qiagen, Inc.; Chatsworth Calif.) and stirred
for 4 hr at 4.degree. C. Following incubation, the resin was
pelleted at 200.times.g and the supernatant was removed. The resin
was washed 3 times with 50 ml binding buffer containing 25 mM
imidazole.
[0196] Proteins bound to the resin were eluted in 2 ml binding
buffer containing 150 mM imidazole and 20 mM DTT. The eluate was
mixed with 100 .mu.l of a 50% slurry of anti-FLAG antibody coupled
to SEPHAROSE resin using the AMINOLINK PLUS immobilization kit
(Pierce Chem. Co.; Rockford Ill.) and stirred for 4 hr at 4.degree.
C. The resin was pelleted at 1000.times.g, the supernatant was
removed, and the resin was washed with 10 ml binding buffer
(without imidazole). Proteins bound to the resin then were eluted
with 1% SDS or with FLAG peptide and examined by 10% SDS-PAGE.
[0197] Silver staining revealed the presence of seven proteins,
including the HF-IKK.alpha., which was confirmed by western blot
analysis using anti-FLAG antibody. The copurified proteins had
apparent molecular masses of about 100 kDa, 63 kDa, 60 kDa, 55 kDa,
46 kDa and 29 kDa; the endogenous 87 kDa IKK.beta. comigrates with
the HA-IKK.alpha. protein. These results indicate that IKK.alpha.,
along with some or all of the copurifying proteins, comprise the
900 kDa I.kappa.B kinase complex.
Example V
Anti-IKK Antisera
[0198] This example provides a method of producing anti-IKK
antisera.
[0199] Anti-IKK.alpha. antibodies were raised in rabbits using
either His-tagged IKK.alpha. expressed in E. coli or the IKK.alpha.
peptide ERPPGLRPGAGGPWE (SEQ ID NO: 17) or TIIHEAWEEQGNS (SEQ ID
NO: 18) as an immunogen. Anti-IKK.beta. antibodies were raised
using the peptide SKVRGPVSGSPDS (SEQ ID NO: 19). The peptides were
conjugated to keyhole limpet hemocyanin (Sigma Chemical Co.; St.
Louis Mo.). Rabbits were immunized with 250 to 500 .mu.g conjugated
peptide in complete Freund's adjuvant. Three weeks after the
primary immunization, booster immunizations were performed using 50
to 100 .mu.g immunogen and were repeated three times, at 3 to 4
week intervals. Rabbits were bled one week after the final booster
and antisera were collected. Anti-IKK.alpha. antiserum was specific
for IKK.alpha. and did not cross react with IKK.beta..
Example VI
[0200] Use of an IKK Subunit in a Drug Screening Assay
[0201] This example describes an assay for screening for agents
such as drugs that alter the association of an IKK subunit and a
second protein that specifically associates with the IKK
subunit.
[0202] A GST-IKK subunit fusion protein or HIS6-IKK subunit fusion
protein can be prepared using methods as described above and
purified using glutathione- or metal-chelation chromatography,
respectively (Smith and Johnson, Gene 67:31-40 (1988), which is
incorporated herein by reference; see, also, Example IV). The
fusion protein is immobilized to a solid support taking advantage
of the ability of the GST protein to specifically bind glutathione
or of the HIS6 peptide region to chelate a metal ion such as nickel
(Ni) ion or cobalt (Co) ion (Clontech) by immobilized metal
affinity chromatography. Alternatively, an anti-IKK antibody can be
immobilized on a matrix and the IKK-.alpha. can be allowed to bind
to the antibody.
[0203] The second protein, which can be I.kappa.B or a protein that
copurifies with IKK subunit as part of the 900 kDa I.kappa.B
kinase, for example, can be detectably labeled with a moiety such
as a fluorescent molecule or a radiolabel (Hermanson, supra, 1996),
then contacted in solution with the immobilized IKK subunit under
conditions as described in Example I, which allow I.kappa.B to
specifically associate with the IKK subunit. Preferably, the
reactions are performed in 96 well plates, which allow automated
reading of the reactions. Various agents such as drugs then are
screened for the ability to alter the association of the IKK
subunit and I.kappa.B.
[0204] The agent and labeled I.kappa.B, for example, can be added
together to the immobilized IKK subunit, incubated to allow
binding, then washed to remove unbound labeled I.kappa.B. The
relative amount of binding of labeled I.kappa.B in the absence as
compared to the presence of the agent being screened is determined
by detecting the amount of label remaining in the plate.
Appropriate controls are performed to account, for example, for
nonspecific binding of the labeled I.kappa.B to the matrix. Such a
method allows the identification of an agent that alter the
association of an IKK subunit and a second protein such as
I.kappa.B.
[0205] Alternatively, the labeled I.kappa.B or other appropriate
second protein can be added to the immobilized IKK subunit and
allowed to associate, then the agent can be added. Such a method
allows the identification of agents that can induce the
dissociation of a bound complex comprising the IKK subunit and
I.kappa.B.
[0206] Similarly, a screening assay of the invention can be
performed using the 900 kDa IKK complex, comprising an IKK
subunit.
[0207] Although the invention has been described with reference to
the examples provided above, it should be understood that various
modifications can be made without departing from the spirit of the
invention. Accordingly, the invention is limited only by the
claims.
Sequence CWU 1
1
2012273DNAHomo sapiensCDS(36)..(2273) 1tcgacggaac ctgaggccgc
ttgccctccc gcccc atg gag cgg ccc ccg ggg 53 Met Glu Arg Pro Pro Gly
1 5ctg cgg ccg ggc gcg ggc ggg ccc tgg gag atg cgg gag cgg ctg ggc
101Leu Arg Pro Gly Ala Gly Gly Pro Trp Glu Met Arg Glu Arg Leu Gly
10 15 20acc ggc ggc ttc ggg aac gtc tgt ctg tac cag cat cgg gaa ctt
gat 149Thr Gly Gly Phe Gly Asn Val Cys Leu Tyr Gln His Arg Glu Leu
Asp 25 30 35ctc aaa ata gca att aag tct tgt cgc cta gag cta agt acc
aaa aac 197Leu Lys Ile Ala Ile Lys Ser Cys Arg Leu Glu Leu Ser Thr
Lys Asn 40 45 50aga gaa cga tgg tgc cat gaa atc cag att atg aag aag
ttg aac cat 245Arg Glu Arg Trp Cys His Glu Ile Gln Ile Met Lys Lys
Leu Asn His55 60 65 70gcc aat gtt gta aag gcc tgt gat gtt cct gaa
gaa ttg aat att ttg 293Ala Asn Val Val Lys Ala Cys Asp Val Pro Glu
Glu Leu Asn Ile Leu 75 80 85att cat gat gtg cct ctt cta gca atg gaa
tac tgt tct gga gga gat 341Ile His Asp Val Pro Leu Leu Ala Met Glu
Tyr Cys Ser Gly Gly Asp 90 95 100ctc cga aag ctg ctc aac aaa cca
gaa aat tgt tgt gga ctt aaa gaa 389Leu Arg Lys Leu Leu Asn Lys Pro
Glu Asn Cys Cys Gly Leu Lys Glu 105 110 115agc cag ata ctt tct tta
cta agt gat ata ggg tct ggg att cga tat 437Ser Gln Ile Leu Ser Leu
Leu Ser Asp Ile Gly Ser Gly Ile Arg Tyr 120 125 130ttg cat gaa aac
aaa att ata cat cga gat cta aaa cct gaa aac ata 485Leu His Glu Asn
Lys Ile Ile His Arg Asp Leu Lys Pro Glu Asn Ile135 140 145 150gtt
ctt cag gat gtt ggt gga aag ata ata cat aaa ata att gat ctg 533Val
Leu Gln Asp Val Gly Gly Lys Ile Ile His Lys Ile Ile Asp Leu 155 160
165gga tat gcc aaa gat gtt gat caa gga agt ctg tgt aca tct ttt gtg
581Gly Tyr Ala Lys Asp Val Asp Gln Gly Ser Leu Cys Thr Ser Phe Val
170 175 180gga aca ctg cag tat ctg gcc cca gag ctc ttt gag aat aag
cct tac 629Gly Thr Leu Gln Tyr Leu Ala Pro Glu Leu Phe Glu Asn Lys
Pro Tyr 185 190 195aca gcc act gtt gat tat tgg agc ttt ggg acc atg
gta ttt gaa tgt 677Thr Ala Thr Val Asp Tyr Trp Ser Phe Gly Thr Met
Val Phe Glu Cys 200 205 210att gct gga tat agg cct ttt ttg cat cat
ctg cag cca ttt acc tgg 725Ile Ala Gly Tyr Arg Pro Phe Leu His His
Leu Gln Pro Phe Thr Trp215 220 225 230cat gag aag att aag aag aag
gat cca aag tgt ata ttt gca tgt gaa 773His Glu Lys Ile Lys Lys Lys
Asp Pro Lys Cys Ile Phe Ala Cys Glu 235 240 245gag atg tca gga gaa
gtt cgg ttt agt agc cat tta cct caa cca aat 821Glu Met Ser Gly Glu
Val Arg Phe Ser Ser His Leu Pro Gln Pro Asn 250 255 260agc ctt tgt
agt tta ata gta gaa ccc atg gaa aac tgg cta cag ttg 869Ser Leu Cys
Ser Leu Ile Val Glu Pro Met Glu Asn Trp Leu Gln Leu 265 270 275atg
ttg aat tgg gac cct cag cag aga gga gga cct gtt gac ctt act 917Met
Leu Asn Trp Asp Pro Gln Gln Arg Gly Gly Pro Val Asp Leu Thr 280 285
290ttg aag cag cca aga tgt ttt gta tta atg gat cac att ttg aat ttg
965Leu Lys Gln Pro Arg Cys Phe Val Leu Met Asp His Ile Leu Asn
Leu295 300 305 310aag ata gta cac atc cta aat atg act tct gca aag
ata att tct ttt 1013Lys Ile Val His Ile Leu Asn Met Thr Ser Ala Lys
Ile Ile Ser Phe 315 320 325ctg tta cca cct gat gaa agt ctt cat tca
cta cag tct cgt att gag 1061Leu Leu Pro Pro Asp Glu Ser Leu His Ser
Leu Gln Ser Arg Ile Glu 330 335 340cgt gaa act gga ata aat act ggt
tct caa gaa ctt ctt tca gag aca 1109Arg Glu Thr Gly Ile Asn Thr Gly
Ser Gln Glu Leu Leu Ser Glu Thr 345 350 355gga att tct ctg gat cct
cgg aaa cca gcc tct caa tgt gtt cta gat 1157Gly Ile Ser Leu Asp Pro
Arg Lys Pro Ala Ser Gln Cys Val Leu Asp 360 365 370gga gtt aga ggc
tgt gat agc tat atg gtt tat ttg ttt gat aaa agt 1205Gly Val Arg Gly
Cys Asp Ser Tyr Met Val Tyr Leu Phe Asp Lys Ser375 380 385 390aaa
act gta tat gaa ggg cca ttt gct tcc aga agt tta tct gat tgt 1253Lys
Thr Val Tyr Glu Gly Pro Phe Ala Ser Arg Ser Leu Ser Asp Cys 395 400
405gta aat tat att gta cag gac agc aaa ata cag ctt cca att ata cag
1301Val Asn Tyr Ile Val Gln Asp Ser Lys Ile Gln Leu Pro Ile Ile Gln
410 415 420ctg cgt aaa gtg tgg gct gaa gca gtg cac tat gtg tct gga
cta aaa 1349Leu Arg Lys Val Trp Ala Glu Ala Val His Tyr Val Ser Gly
Leu Lys 425 430 435gaa gac tat agc agg ctc ttt cag gga caa agg gca
gca atg tta agt 1397Glu Asp Tyr Ser Arg Leu Phe Gln Gly Gln Arg Ala
Ala Met Leu Ser 440 445 450ctt ctt aga tat aat gct aac tta aca aaa
atg aag aac act ttg atc 1445Leu Leu Arg Tyr Asn Ala Asn Leu Thr Lys
Met Lys Asn Thr Leu Ile455 460 465 470tca gca tca caa caa ctg aaa
gct aaa ttg gag ttt ttt cac aaa agc 1493Ser Ala Ser Gln Gln Leu Lys
Ala Lys Leu Glu Phe Phe His Lys Ser 475 480 485att cag ctt gac ttg
gag aga tac agc gag cag atg acg tat ggg ata 1541Ile Gln Leu Asp Leu
Glu Arg Tyr Ser Glu Gln Met Thr Tyr Gly Ile 490 495 500tct tca gaa
aaa atg cta aaa gca tgg aaa gaa atg gaa gaa aag gcc 1589Ser Ser Glu
Lys Met Leu Lys Ala Trp Lys Glu Met Glu Glu Lys Ala 505 510 515atc
cac tat gct gag gtt ggt gtc att gga tac ctg gag gat cag att 1637Ile
His Tyr Ala Glu Val Gly Val Ile Gly Tyr Leu Glu Asp Gln Ile 520 525
530atg tct ttg cat gct gaa atc atg gag cta cag aag agc ccc tat gga
1685Met Ser Leu His Ala Glu Ile Met Glu Leu Gln Lys Ser Pro Tyr
Gly535 540 545 550aga cgt cag gga gac ttg atg gaa tct ctg gaa cag
cgt gcc att gat 1733Arg Arg Gln Gly Asp Leu Met Glu Ser Leu Glu Gln
Arg Ala Ile Asp 555 560 565cta tat aag cag tta aaa cac aga cct tca
gat cac tcc tac agt gac 1781Leu Tyr Lys Gln Leu Lys His Arg Pro Ser
Asp His Ser Tyr Ser Asp 570 575 580agc aca gag atg gtg aaa atc att
gtg cac act gtg cag agt cag gac 1829Ser Thr Glu Met Val Lys Ile Ile
Val His Thr Val Gln Ser Gln Asp 585 590 595cgt gtg ctc aag gag cgt
ttt ggt cat ttg agc aag ttg ttg ggc tgt 1877Arg Val Leu Lys Glu Arg
Phe Gly His Leu Ser Lys Leu Leu Gly Cys 600 605 610aag cag aag att
att gat cta ctc cct aag gtg gaa gtg gcc ctc agt 1925Lys Gln Lys Ile
Ile Asp Leu Leu Pro Lys Val Glu Val Ala Leu Ser615 620 625 630aat
atc aaa gaa gct gac aat act gtc atg ttc atg cag gga aaa agg 1973Asn
Ile Lys Glu Ala Asp Asn Thr Val Met Phe Met Gln Gly Lys Arg 635 640
645cag aaa gaa ata tgg cat ctc ctt aaa att gcc tgt aca cag agt tct
2021Gln Lys Glu Ile Trp His Leu Leu Lys Ile Ala Cys Thr Gln Ser Ser
650 655 660gcc cgc tct ctt gta gga tcc agt cta gaa ggt gca gta acc
cct caa 2069Ala Arg Ser Leu Val Gly Ser Ser Leu Glu Gly Ala Val Thr
Pro Gln 665 670 675gca tac gca tgg ctg gcc ccc gac tta gca gaa cat
gat cat tct ctg 2117Ala Tyr Ala Trp Leu Ala Pro Asp Leu Ala Glu His
Asp His Ser Leu 680 685 690tca tgt gtg gta act cct caa gat ggg gag
act tca gca caa atg ata 2165Ser Cys Val Val Thr Pro Gln Asp Gly Glu
Thr Ser Ala Gln Met Ile695 700 705 710gaa gaa aat ttg aac tgc ctt
ggc cat tta agc act att att cat gag 2213Glu Glu Asn Leu Asn Cys Leu
Gly His Leu Ser Thr Ile Ile His Glu 715 720 725gca aat gag gaa cag
ggc aat agt atg atg aat ctt gat tgg agt tgg 2261Ala Asn Glu Glu Gln
Gly Asn Ser Met Met Asn Leu Asp Trp Ser Trp 730 735 740tta aca gaa
tga 2273Leu Thr Glu 7452745PRTHomo sapiens 2Met Glu Arg Pro Pro Gly
Leu Arg Pro Gly Ala Gly Gly Pro Trp Glu1 5 10 15Met Arg Glu Arg Leu
Gly Thr Gly Gly Phe Gly Asn Val Cys Leu Tyr 20 25 30Gln His Arg Glu
Leu Asp Leu Lys Ile Ala Ile Lys Ser Cys Arg Leu 35 40 45Glu Leu Ser
Thr Lys Asn Arg Glu Arg Trp Cys His Glu Ile Gln Ile 50 55 60Met Lys
Lys Leu Asn His Ala Asn Val Val Lys Ala Cys Asp Val Pro65 70 75
80Glu Glu Leu Asn Ile Leu Ile His Asp Val Pro Leu Leu Ala Met Glu
85 90 95Tyr Cys Ser Gly Gly Asp Leu Arg Lys Leu Leu Asn Lys Pro Glu
Asn 100 105 110Cys Cys Gly Leu Lys Glu Ser Gln Ile Leu Ser Leu Leu
Ser Asp Ile 115 120 125Gly Ser Gly Ile Arg Tyr Leu His Glu Asn Lys
Ile Ile His Arg Asp 130 135 140Leu Lys Pro Glu Asn Ile Val Leu Gln
Asp Val Gly Gly Lys Ile Ile145 150 155 160His Lys Ile Ile Asp Leu
Gly Tyr Ala Lys Asp Val Asp Gln Gly Ser 165 170 175Leu Cys Thr Ser
Phe Val Gly Thr Leu Gln Tyr Leu Ala Pro Glu Leu 180 185 190Phe Glu
Asn Lys Pro Tyr Thr Ala Thr Val Asp Tyr Trp Ser Phe Gly 195 200
205Thr Met Val Phe Glu Cys Ile Ala Gly Tyr Arg Pro Phe Leu His His
210 215 220Leu Gln Pro Phe Thr Trp His Glu Lys Ile Lys Lys Lys Asp
Pro Lys225 230 235 240Cys Ile Phe Ala Cys Glu Glu Met Ser Gly Glu
Val Arg Phe Ser Ser 245 250 255His Leu Pro Gln Pro Asn Ser Leu Cys
Ser Leu Ile Val Glu Pro Met 260 265 270Glu Asn Trp Leu Gln Leu Met
Leu Asn Trp Asp Pro Gln Gln Arg Gly 275 280 285Gly Pro Val Asp Leu
Thr Leu Lys Gln Pro Arg Cys Phe Val Leu Met 290 295 300Asp His Ile
Leu Asn Leu Lys Ile Val His Ile Leu Asn Met Thr Ser305 310 315
320Ala Lys Ile Ile Ser Phe Leu Leu Pro Pro Asp Glu Ser Leu His Ser
325 330 335Leu Gln Ser Arg Ile Glu Arg Glu Thr Gly Ile Asn Thr Gly
Ser Gln 340 345 350Glu Leu Leu Ser Glu Thr Gly Ile Ser Leu Asp Pro
Arg Lys Pro Ala 355 360 365Ser Gln Cys Val Leu Asp Gly Val Arg Gly
Cys Asp Ser Tyr Met Val 370 375 380Tyr Leu Phe Asp Lys Ser Lys Thr
Val Tyr Glu Gly Pro Phe Ala Ser385 390 395 400Arg Ser Leu Ser Asp
Cys Val Asn Tyr Ile Val Gln Asp Ser Lys Ile 405 410 415Gln Leu Pro
Ile Ile Gln Leu Arg Lys Val Trp Ala Glu Ala Val His 420 425 430Tyr
Val Ser Gly Leu Lys Glu Asp Tyr Ser Arg Leu Phe Gln Gly Gln 435 440
445Arg Ala Ala Met Leu Ser Leu Leu Arg Tyr Asn Ala Asn Leu Thr Lys
450 455 460Met Lys Asn Thr Leu Ile Ser Ala Ser Gln Gln Leu Lys Ala
Lys Leu465 470 475 480Glu Phe Phe His Lys Ser Ile Gln Leu Asp Leu
Glu Arg Tyr Ser Glu 485 490 495Gln Met Thr Tyr Gly Ile Ser Ser Glu
Lys Met Leu Lys Ala Trp Lys 500 505 510Glu Met Glu Glu Lys Ala Ile
His Tyr Ala Glu Val Gly Val Ile Gly 515 520 525Tyr Leu Glu Asp Gln
Ile Met Ser Leu His Ala Glu Ile Met Glu Leu 530 535 540Gln Lys Ser
Pro Tyr Gly Arg Arg Gln Gly Asp Leu Met Glu Ser Leu545 550 555
560Glu Gln Arg Ala Ile Asp Leu Tyr Lys Gln Leu Lys His Arg Pro Ser
565 570 575Asp His Ser Tyr Ser Asp Ser Thr Glu Met Val Lys Ile Ile
Val His 580 585 590Thr Val Gln Ser Gln Asp Arg Val Leu Lys Glu Arg
Phe Gly His Leu 595 600 605Ser Lys Leu Leu Gly Cys Lys Gln Lys Ile
Ile Asp Leu Leu Pro Lys 610 615 620Val Glu Val Ala Leu Ser Asn Ile
Lys Glu Ala Asp Asn Thr Val Met625 630 635 640Phe Met Gln Gly Lys
Arg Gln Lys Glu Ile Trp His Leu Leu Lys Ile 645 650 655Ala Cys Thr
Gln Ser Ser Ala Arg Ser Leu Val Gly Ser Ser Leu Glu 660 665 670Gly
Ala Val Thr Pro Gln Ala Tyr Ala Trp Leu Ala Pro Asp Leu Ala 675 680
685Glu His Asp His Ser Leu Ser Cys Val Val Thr Pro Gln Asp Gly Glu
690 695 700Thr Ser Ala Gln Met Ile Glu Glu Asn Leu Asn Cys Leu Gly
His Leu705 710 715 720Ser Thr Ile Ile His Glu Ala Asn Glu Glu Gln
Gly Asn Ser Met Met 725 730 735Asn Leu Asp Trp Ser Trp Leu Thr Glu
740 74538PRTHomo sapiens 3Lys Ile Ile Asp Leu Leu Pro Lys1
5418PRTHomo sapiensSITE(4)/note=" Xaa is apartic acid or alanine
(D/A)." 4Lys His Arg Xaa Leu Lys Pro Glu Asn Ile Val Leu Gln Asp
Val Gly1 5 10 15Xaa Lys524DNAArtificial SequenceDescription of
Artificial Sequence Synthetic Construct 5ccccatatgt accagcatcg ggaa
24624DNAArtificial SequenceDescription of Artificial Sequence
Synthetic Construct 6tcaaccaatt gtcttgagct cccc 24720DNAHomo
sapiens 7catggcacca tcgttctctg 20825DNAHomo sapiens 8ctcaaagagc
tctggggcca gatac 25918DNAArtificial SequenceDescription of
Artificial Sequence Synthetic Construct 9tccgagatct ggacgagc
18109PRTHomo sapiens 10Lys Ile Ile Asp Leu Gly Tyr Ala Lys1
51114PRTHomo sapiensSITE(8)/note="Xaa is Methionine or Tyrosine
(M/Y)." 11Lys Xaa Val His Ile Leu Asn Xaa Xaa Xaa Xaa Thr Ile Xaa1
5 101211PRTHomo sapiensSITE(2)..(3)/note="Xaa is any amino acid."
12Lys Xaa Xaa Ile Gln Gln Asp Xaa Gly Ile Pro1 5 10139PRTHomo
sapiensSITE(2)/note="Xaa is any amino acid." 13Lys Xaa Arg Val Ile
Tyr Thr Gln Leu1 5142931DNAHomo sapiensCDS(36)..(2306) 14cgcgtccctg
ccgacagagt tagcacgaca tcagt atg agc tgg tca cct tcc 53 Met Ser Trp
Ser Pro Ser 1 5ctg aca acg cag aca tgc ggg gcc tgg gaa atg aaa gag
cgc ctt ggg 101Leu Thr Thr Gln Thr Cys Gly Ala Trp Glu Met Lys Glu
Arg Leu Gly 10 15 20aca ggg gga ttt gga aat gtc atc cga tgg cac aat
cag gaa aca ggt 149Thr Gly Gly Phe Gly Asn Val Ile Arg Trp His Asn
Gln Glu Thr Gly 25 30 35gag cag att gcc atc aag cag tgc cgg cag gag
ctc agc ccc cgg aac 197Glu Gln Ile Ala Ile Lys Gln Cys Arg Gln Glu
Leu Ser Pro Arg Asn 40 45 50cga gag cgg tgg tgc ctg gag atc cag atc
atg aga agg ctg acc cac 245Arg Glu Arg Trp Cys Leu Glu Ile Gln Ile
Met Arg Arg Leu Thr His55 60 65 70ccc aat gtg gtg gct gcc cga gat
gtc cct gag ggg atg cag aac ttg 293Pro Asn Val Val Ala Ala Arg Asp
Val Pro Glu Gly Met Gln Asn Leu 75 80 85gcg ccc aat gac ctg ccc ctg
ctg gcc atg gag tac tgc caa gga gga 341Ala Pro Asn Asp Leu Pro Leu
Leu Ala Met Glu Tyr Cys Gln Gly Gly 90 95 100gat ctc cgg aag tac
ctg aac cag ttt gag aac tgc tgt ggt ctg cgg 389Asp Leu Arg Lys Tyr
Leu Asn Gln Phe Glu Asn Cys Cys Gly Leu Arg 105 110 115gaa ggt gcc
atc ctc acc ttg ctg agt gac att gcc tct gcg ctt aga 437Glu Gly Ala
Ile Leu Thr Leu Leu Ser Asp Ile Ala Ser Ala Leu Arg 120 125 130tac
ctt cat gaa aac aga atc atc cat cgg gat cta aag cca gaa aac 485Tyr
Leu His Glu Asn Arg Ile Ile His Arg Asp Leu Lys Pro Glu Asn135 140
145 150atc gtc ctg cag caa gga gaa cag agg tta ata cac aaa att att
gac 533Ile Val Leu Gln Gln Gly Glu Gln Arg Leu Ile His Lys Ile Ile
Asp 155 160 165cta gga tat gcc aag gag ctg gat cag ggc agt ctt tgc
aca tca ttc 581Leu Gly Tyr Ala Lys Glu Leu Asp Gln Gly Ser Leu Cys
Thr Ser Phe
170 175 180gtg ggg acc ctg cag tac ctg gcc cca gag cta ctg gag cag
cag aag 629Val Gly Thr Leu Gln Tyr Leu Ala Pro Glu Leu Leu Glu Gln
Gln Lys 185 190 195tac aca gtg acc gtc gac tac tgg agc ttc ggc acc
ctg gcc ttt gag 677Tyr Thr Val Thr Val Asp Tyr Trp Ser Phe Gly Thr
Leu Ala Phe Glu 200 205 210tgc atc acg ggc ttc cgg ccc ttc ctc ccc
aac tgg cag ccc gtg cag 725Cys Ile Thr Gly Phe Arg Pro Phe Leu Pro
Asn Trp Gln Pro Val Gln215 220 225 230tgg cat tca aaa gtg cgg cag
aag agt gag gtg gac att gtt gtt agc 773Trp His Ser Lys Val Arg Gln
Lys Ser Glu Val Asp Ile Val Val Ser 235 240 245gaa gac ttg aat gga
acg gtg aag ttt tca agc tct tta ccc tac ccc 821Glu Asp Leu Asn Gly
Thr Val Lys Phe Ser Ser Ser Leu Pro Tyr Pro 250 255 260aat aat ctt
aac agt gtc ctg gct gag cga ctg gag aag tgg ctg caa 869Asn Asn Leu
Asn Ser Val Leu Ala Glu Arg Leu Glu Lys Trp Leu Gln 265 270 275ctg
atg ctg atg tgg cac ccc cga cag agg ggc acg gat ccc acg tat 917Leu
Met Leu Met Trp His Pro Arg Gln Arg Gly Thr Asp Pro Thr Tyr 280 285
290ggg ccc aat ggc tgc ttc aag gcc ctg gat gac atc tta aac tta aag
965Gly Pro Asn Gly Cys Phe Lys Ala Leu Asp Asp Ile Leu Asn Leu
Lys295 300 305 310ctg gtt cat atc ttg aac atg gtc acg ggc acc atc
cac acc tac cct 1013Leu Val His Ile Leu Asn Met Val Thr Gly Thr Ile
His Thr Tyr Pro 315 320 325gtg aca gag gat gag agt ctg cag agc ttg
aag gcc aga atc caa cag 1061Val Thr Glu Asp Glu Ser Leu Gln Ser Leu
Lys Ala Arg Ile Gln Gln 330 335 340gac acg ggc atc cca gag gag gac
cag gag ctg ctg cag gaa gcg ggc 1109Asp Thr Gly Ile Pro Glu Glu Asp
Gln Glu Leu Leu Gln Glu Ala Gly 345 350 355ctg gcg ttg atc ccc gat
aag cct gcc act cag tgt att tca gac ggc 1157Leu Ala Leu Ile Pro Asp
Lys Pro Ala Thr Gln Cys Ile Ser Asp Gly 360 365 370aag tta aat gag
ggc cac aca ttg gac atg gat ctt gtt ttt ctc ttt 1205Lys Leu Asn Glu
Gly His Thr Leu Asp Met Asp Leu Val Phe Leu Phe375 380 385 390gac
aac agt aaa atc acc tat gag act cag atc tcc cca cgg ccc caa 1253Asp
Asn Ser Lys Ile Thr Tyr Glu Thr Gln Ile Ser Pro Arg Pro Gln 395 400
405cct gaa agt gtc agc tgt atc ctt caa gag ccc aag agg aat ctc gcc
1301Pro Glu Ser Val Ser Cys Ile Leu Gln Glu Pro Lys Arg Asn Leu Ala
410 415 420ttc ttc cag ctg agg aag gtg tgg ggc cag gtc tgg cac agc
atc cag 1349Phe Phe Gln Leu Arg Lys Val Trp Gly Gln Val Trp His Ser
Ile Gln 425 430 435acc ctg aag gaa gat tgc aac cgg ctg cag cag gga
cag cga gcc gcc 1397Thr Leu Lys Glu Asp Cys Asn Arg Leu Gln Gln Gly
Gln Arg Ala Ala 440 445 450atg atg aat ctc ctc cga aac aac agc tgc
ctc tcc aaa atg aag aat 1445Met Met Asn Leu Leu Arg Asn Asn Ser Cys
Leu Ser Lys Met Lys Asn455 460 465 470tcc atg gct tcc atg tct cag
cag ctc aag gcc aag ttg gat ttc ttc 1493Ser Met Ala Ser Met Ser Gln
Gln Leu Lys Ala Lys Leu Asp Phe Phe 475 480 485aaa acc agc atc cag
att gac ctg gag aag tac agc gag caa acc gag 1541Lys Thr Ser Ile Gln
Ile Asp Leu Glu Lys Tyr Ser Glu Gln Thr Glu 490 495 500ttt ggg atc
aca tca gat aaa ctg ctg ctg gcc tgg agg gaa atg gag 1589Phe Gly Ile
Thr Ser Asp Lys Leu Leu Leu Ala Trp Arg Glu Met Glu 505 510 515cag
gct gtg gag ctc tgt ggg cgg gag aac gaa gtg aaa ctc ctg gta 1637Gln
Ala Val Glu Leu Cys Gly Arg Glu Asn Glu Val Lys Leu Leu Val 520 525
530gaa cgg atg atg gct ctg cag acc gac att gtg gac tta cag agg agc
1685Glu Arg Met Met Ala Leu Gln Thr Asp Ile Val Asp Leu Gln Arg
Ser535 540 545 550ccc atg ggc cgg aag cag ggg gga acg ctg gac gac
cta gag gag caa 1733Pro Met Gly Arg Lys Gln Gly Gly Thr Leu Asp Asp
Leu Glu Glu Gln 555 560 565gca agg gag ctg tac agg aga cta agg gaa
aaa cct cga gac cag cga 1781Ala Arg Glu Leu Tyr Arg Arg Leu Arg Glu
Lys Pro Arg Asp Gln Arg 570 575 580act gag ggt gac agt cag gaa atg
gta cgg ctg ctg ctt cag gca att 1829Thr Glu Gly Asp Ser Gln Glu Met
Val Arg Leu Leu Leu Gln Ala Ile 585 590 595cag agc ttc gag aag aaa
gtg cga gtg atc tat acg cag ctc agt aaa 1877Gln Ser Phe Glu Lys Lys
Val Arg Val Ile Tyr Thr Gln Leu Ser Lys 600 605 610act gtg gtt tgc
aag cag aag gcg ctg gaa ctg ttg ccc aag gtg gaa 1925Thr Val Val Cys
Lys Gln Lys Ala Leu Glu Leu Leu Pro Lys Val Glu615 620 625 630gag
gtg gtg agc tta atg aat gag gat gag aag act gtt gtc cgg ctg 1973Glu
Val Val Ser Leu Met Asn Glu Asp Glu Lys Thr Val Val Arg Leu 635 640
645cag gag aag cgg cag aag gag ctc tgg aat ctc ctg aag att gct tgt
2021Gln Glu Lys Arg Gln Lys Glu Leu Trp Asn Leu Leu Lys Ile Ala Cys
650 655 660agc aag gtc cgt ggt cct gtc agt gga agc ccg gat agc atg
aat gcc 2069Ser Lys Val Arg Gly Pro Val Ser Gly Ser Pro Asp Ser Met
Asn Ala 665 670 675tct cga ctt agc cag cct ggg cag ctg atg tct cag
ccc tcc acg gcc 2117Ser Arg Leu Ser Gln Pro Gly Gln Leu Met Ser Gln
Pro Ser Thr Ala 680 685 690tcc aac agc tta cct gag cca gcc aag aag
agt gaa gaa ctg gtg gct 2165Ser Asn Ser Leu Pro Glu Pro Ala Lys Lys
Ser Glu Glu Leu Val Ala695 700 705 710gaa gca cat aac ctc tgc acc
ctg cta gaa aat gcc ata cag gac act 2213Glu Ala His Asn Leu Cys Thr
Leu Leu Glu Asn Ala Ile Gln Asp Thr 715 720 725gtg agg gaa caa gac
cag agt ttc acg gcc cta gac tgg agc tgg tta 2261Val Arg Glu Gln Asp
Gln Ser Phe Thr Ala Leu Asp Trp Ser Trp Leu 730 735 740cag acg gaa
gaa gaa gag cac agc tgc ctg gag cag gcc tca tga 2306Gln Thr Glu Glu
Glu Glu His Ser Cys Leu Glu Gln Ala Ser 745 750 755tgtgggggga
ctcgaccccc tgacatgggg cagcccatag caggccttgt gcagtggggg
2366gactcgaccc cctgacatgg ggctgcctgg agcaggccgc gtgacgtggg
gctgcctggc 2426cgtggctctc acatggtggt tcctgctgca ctgatggccc
aggggtctct ggtatccaga 2486tggagctctc gcttcctcag cagctgtgac
tttcacccag gacccaggac gcagccctcc 2546gtgggcactg ccggcgcctt
gtctgcacac tggaggtcct ccattacaga ggcccagcgc 2606acatcgctgg
ccccacaaac gttcaggggt acagccatgg cagctccttc ctctgccgtg
2666agaaaagtgc ttggagtacg gtttgccaca cacgtgactg gacagtgtcc
aattcaaatc 2726tttcagggca gagtccgagc agcgcttggt gacagcctgt
cctctcctgc tctccaaagg 2786ccctgctccc tgtcctctct cactttacag
cttgtgtttc ttctggattc agcttctcct 2846aaacagacag tttaattata
gttgcggcct ggccccatcc tcacttcctc tttttatttc 2906actgctgcta
aaattgtgtt tttac 293115756PRTHomo sapiens 15Met Ser Trp Ser Pro Ser
Leu Thr Thr Gln Thr Cys Gly Ala Trp Glu1 5 10 15Met Lys Glu Arg Leu
Gly Thr Gly Gly Phe Gly Asn Val Ile Arg Trp 20 25 30His Asn Gln Glu
Thr Gly Glu Gln Ile Ala Ile Lys Gln Cys Arg Gln 35 40 45Glu Leu Ser
Pro Arg Asn Arg Glu Arg Trp Cys Leu Glu Ile Gln Ile 50 55 60Met Arg
Arg Leu Thr His Pro Asn Val Val Ala Ala Arg Asp Val Pro65 70 75
80Glu Gly Met Gln Asn Leu Ala Pro Asn Asp Leu Pro Leu Leu Ala Met
85 90 95Glu Tyr Cys Gln Gly Gly Asp Leu Arg Lys Tyr Leu Asn Gln Phe
Glu 100 105 110Asn Cys Cys Gly Leu Arg Glu Gly Ala Ile Leu Thr Leu
Leu Ser Asp 115 120 125Ile Ala Ser Ala Leu Arg Tyr Leu His Glu Asn
Arg Ile Ile His Arg 130 135 140Asp Leu Lys Pro Glu Asn Ile Val Leu
Gln Gln Gly Glu Gln Arg Leu145 150 155 160Ile His Lys Ile Ile Asp
Leu Gly Tyr Ala Lys Glu Leu Asp Gln Gly 165 170 175Ser Leu Cys Thr
Ser Phe Val Gly Thr Leu Gln Tyr Leu Ala Pro Glu 180 185 190Leu Leu
Glu Gln Gln Lys Tyr Thr Val Thr Val Asp Tyr Trp Ser Phe 195 200
205Gly Thr Leu Ala Phe Glu Cys Ile Thr Gly Phe Arg Pro Phe Leu Pro
210 215 220Asn Trp Gln Pro Val Gln Trp His Ser Lys Val Arg Gln Lys
Ser Glu225 230 235 240Val Asp Ile Val Val Ser Glu Asp Leu Asn Gly
Thr Val Lys Phe Ser 245 250 255Ser Ser Leu Pro Tyr Pro Asn Asn Leu
Asn Ser Val Leu Ala Glu Arg 260 265 270Leu Glu Lys Trp Leu Gln Leu
Met Leu Met Trp His Pro Arg Gln Arg 275 280 285Gly Thr Asp Pro Thr
Tyr Gly Pro Asn Gly Cys Phe Lys Ala Leu Asp 290 295 300Asp Ile Leu
Asn Leu Lys Leu Val His Ile Leu Asn Met Val Thr Gly305 310 315
320Thr Ile His Thr Tyr Pro Val Thr Glu Asp Glu Ser Leu Gln Ser Leu
325 330 335Lys Ala Arg Ile Gln Gln Asp Thr Gly Ile Pro Glu Glu Asp
Gln Glu 340 345 350Leu Leu Gln Glu Ala Gly Leu Ala Leu Ile Pro Asp
Lys Pro Ala Thr 355 360 365Gln Cys Ile Ser Asp Gly Lys Leu Asn Glu
Gly His Thr Leu Asp Met 370 375 380Asp Leu Val Phe Leu Phe Asp Asn
Ser Lys Ile Thr Tyr Glu Thr Gln385 390 395 400Ile Ser Pro Arg Pro
Gln Pro Glu Ser Val Ser Cys Ile Leu Gln Glu 405 410 415Pro Lys Arg
Asn Leu Ala Phe Phe Gln Leu Arg Lys Val Trp Gly Gln 420 425 430Val
Trp His Ser Ile Gln Thr Leu Lys Glu Asp Cys Asn Arg Leu Gln 435 440
445Gln Gly Gln Arg Ala Ala Met Met Asn Leu Leu Arg Asn Asn Ser Cys
450 455 460Leu Ser Lys Met Lys Asn Ser Met Ala Ser Met Ser Gln Gln
Leu Lys465 470 475 480Ala Lys Leu Asp Phe Phe Lys Thr Ser Ile Gln
Ile Asp Leu Glu Lys 485 490 495Tyr Ser Glu Gln Thr Glu Phe Gly Ile
Thr Ser Asp Lys Leu Leu Leu 500 505 510Ala Trp Arg Glu Met Glu Gln
Ala Val Glu Leu Cys Gly Arg Glu Asn 515 520 525Glu Val Lys Leu Leu
Val Glu Arg Met Met Ala Leu Gln Thr Asp Ile 530 535 540Val Asp Leu
Gln Arg Ser Pro Met Gly Arg Lys Gln Gly Gly Thr Leu545 550 555
560Asp Asp Leu Glu Glu Gln Ala Arg Glu Leu Tyr Arg Arg Leu Arg Glu
565 570 575Lys Pro Arg Asp Gln Arg Thr Glu Gly Asp Ser Gln Glu Met
Val Arg 580 585 590Leu Leu Leu Gln Ala Ile Gln Ser Phe Glu Lys Lys
Val Arg Val Ile 595 600 605Tyr Thr Gln Leu Ser Lys Thr Val Val Cys
Lys Gln Lys Ala Leu Glu 610 615 620Leu Leu Pro Lys Val Glu Glu Val
Val Ser Leu Met Asn Glu Asp Glu625 630 635 640Lys Thr Val Val Arg
Leu Gln Glu Lys Arg Gln Lys Glu Leu Trp Asn 645 650 655Leu Leu Lys
Ile Ala Cys Ser Lys Val Arg Gly Pro Val Ser Gly Ser 660 665 670Pro
Asp Ser Met Asn Ala Ser Arg Leu Ser Gln Pro Gly Gln Leu Met 675 680
685Ser Gln Pro Ser Thr Ala Ser Asn Ser Leu Pro Glu Pro Ala Lys Lys
690 695 700Ser Glu Glu Leu Val Ala Glu Ala His Asn Leu Cys Thr Leu
Leu Glu705 710 715 720Asn Ala Ile Gln Asp Thr Val Arg Glu Gln Asp
Gln Ser Phe Thr Ala 725 730 735Leu Asp Trp Ser Trp Leu Gln Thr Glu
Glu Glu Glu His Ser Cys Leu 740 745 750Glu Gln Ala Ser
7551691DNAArtificial SequenceDescription of Artificial
SequenceSynthetic Construct 16agcttgcgcg tatggcttcg ggtcatcacc
atcaccatca cggtgactac aaggacgacg 60atgacaaagg tgacatcgaa ggtagaggtc
a 911715PRTHomo sapiens 17Glu Arg Pro Pro Gly Leu Arg Pro Gly Ala
Gly Gly Pro Trp Glu1 5 10 151813PRTHomo sapiens 18Thr Ile Ile His
Glu Ala Trp Glu Glu Gln Gly Asn Ser1 5 101913PRTHomo sapiens 19Ser
Lys Val Arg Gly Pro Val Ser Gly Ser Pro Asp Ser1 5 102014PRTHomo
sapiensSITE(2)/note="Xaa is any amino acid." 20Lys Xaa Glu Glu Val
Val Ser Leu Met Asn Glu Asp Glu Lys1 5 10
* * * * *