U.S. patent application number 12/429832 was filed with the patent office on 2010-01-28 for treatment of hepatic encephalopathy and liver cirrhosis.
This patent application is currently assigned to Yissum Research Development Company of the Hebrew University of Jerusalem. Invention is credited to Yosefa Avraham, Elliot BERRY, Yossi Dagon, Nicholas Grigoriadis, Yaron Ilan, Iddo Magen, Raphael Mechoulam, Theofilos Poutachidis.
Application Number | 20100022631 12/429832 |
Document ID | / |
Family ID | 39125279 |
Filed Date | 2010-01-28 |
United States Patent
Application |
20100022631 |
Kind Code |
A1 |
BERRY; Elliot ; et
al. |
January 28, 2010 |
Treatment of hepatic encephalopathy and liver cirrhosis
Abstract
The compounds D9-tetrahydrocannabinol (THC), cannabidiol (CBD)
and capsaicin are useful for prevention, treatment, or both, of
hepatic encephalopathy. The compounds capsaicin,
2-arachidonoylglycerol (2-AG), HU-308 and cannabidiol are useful
for prevention, treatment, or both, of liver cirrhosis.
Inventors: |
BERRY; Elliot; (Jerusalem,
IL) ; Avraham; Yosefa; (Jerusalem, IL) ;
Mechoulam; Raphael; (Jerusalem, IL) ; Ilan;
Yaron; (Givat Massua, IL) ; Dagon; Yossi;
(Ness Ziona, IL) ; Magen; Iddo; (Kfar Shmuel,
IL) ; Grigoriadis; Nicholas; (Panorama, GR) ;
Poutachidis; Theofilos; (Ano Toumpa, GR) |
Correspondence
Address: |
BROWDY AND NEIMARK, P.L.L.C.;624 NINTH STREET, NW
SUITE 300
WASHINGTON
DC
20001-5303
US
|
Assignee: |
Yissum Research Development Company
of the Hebrew University of Jerusalem
Jerusalem
IL
Hadasit Medical Research Services & Development Ltd.
Jerusalem
IL
Aristotle University of Thessaloniki
Thessaloniki
GR
|
Family ID: |
39125279 |
Appl. No.: |
12/429832 |
Filed: |
April 24, 2009 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
PCT/IL07/01300 |
Oct 25, 2007 |
|
|
|
12429832 |
|
|
|
|
60854073 |
Oct 25, 2006 |
|
|
|
60929443 |
Jun 27, 2007 |
|
|
|
60929444 |
Jun 27, 2007 |
|
|
|
Current U.S.
Class: |
514/454 ;
514/549; 514/627; 514/719; 514/729 |
Current CPC
Class: |
A61K 31/09 20130101;
A61P 1/16 20180101; A61K 31/232 20130101; A61K 31/352 20130101;
Y02A 50/423 20180101; A61K 31/165 20130101; Y02A 50/30 20180101;
A61K 31/05 20130101 |
Class at
Publication: |
514/454 ;
514/729; 514/627; 514/549; 514/719 |
International
Class: |
A61K 31/352 20060101
A61K031/352; A61K 31/05 20060101 A61K031/05; A61K 31/165 20060101
A61K031/165; A61K 31/22 20060101 A61K031/22; A61K 31/09 20060101
A61K031/09; A61P 1/16 20060101 A61P001/16 |
Claims
1. A method for prevention, treatment, or both, of hepatic
encephalopathy, comprising administering to a subject in need a
therapeutically effective amount of a compound selected from the
group consisting of D9-tetrahydrocannabinol, cannabidiol and
capsaicin.
2. The method according to claim 1, wherein said compound is
D9-tetrahydrocannabinol.
3. The method according to claim 1, wherein said compound is
administered orally, parenterally, sublingually, or by
inhalation.
4. The method according to claim 1, wherein said hepatic
encephalopathy is of Type A or Type C.
5. A method for prevention, treatment, or both, of liver cirrhosis,
comprising administering to a subject in need a therapeutically
effective amount of a compound selected from the group consisting
of capsaicin, 2-arachidonoylglycerol (2-AG), HU-308 and
cannabidiol.
6. The method according to claim 5, wherein said compound
capsaicin.
7. The method according to claim 5, wherein said compound is
administered orally, parenterally, sublingually, or by
inhalation.
8. A method according to claim 1, wherein said compound is
capsaicin.
9. A method for prevention, treatment, or both, of hepatic
encephalopathy, comprising administering to a subject in need a
therapeutically effective amount of D9-tetrahydrocannabinol.
10. A method for prevention, treatment, or both, of hepatic
encephalopathy, comprising administering to a subject in need a
therapeutically effective amount of capsaicin.
11. A method for prevention, treatment, or both, of liver cirrhosis
comprising administering to a subject in need a therapeutically
effective amount of capsaicin.
Description
FIELD OF THE INVENTION
[0001] The present invention relates to a composition and methods
for the treatment or prevention of hepatic encephalopathy and liver
cirrhosis.
BACKGROUND OF THE INVENTION
[0002] Cirrhosis is a consequence of acute and chronic liver
disease characterized by replacement of liver tissue by fibrotic
scar tissue as well as regenerative nodules, leading to progressive
loss of liver function. Cirrhosis is most commonly caused by
alcoholism, hepatitis C, toxins and fatty liver but has many other
possible causes.
[0003] Ascites (fluid retention in the abdominal cavity) is the
most common complication of cirrhosis and is associated with a poor
quality of life, increased risk of infection, and a poor long-term
outcome. Other potentially life-threatening complications are
hepatic encephalopathy and bleeding from esophageal varices. Today,
cirrhosis is generally irreversible once it occurs, and treatment
generally focuses on preventing progression and complications. In
advanced stages of cirrhosis the only option is a liver
transplant.
[0004] Modern medicine defines hepatic encephalopathy (HE) as a
neuropsychiatric syndrome, which is associated with acute or
chronic liver dysfunction and has quantitatively and qualitatively
distinct features relating to its severity. In cirrhosis, cerebral
dysfunction is heterogeneous ranging from mild neuropsychiatric and
psychomotor dysfunction, impaired memory, increased reaction time,
sensory abnormalities and poor concentration to severe features
such as confusion, stupor, coma and eventually death.
[0005] Hepatic encephalopathy is caused by disorders affecting the
liver including disorders that reduce liver function (such as
cirrhosis or hepatitis) and conditions where there is impaired
blood circulation in the liver.
[0006] While the symptoms of hepatic encephalopathy are well
documented, its pathogenesis is not clear yet and a number of
possible scenarios have been suggested. First, liver failure
induces impaired glucose oxidative pathways and increased lactate
synthesis in the brain which results in energy failure. Second,
hypoglycemia and hypoxia are also major contributors to the energy
failure seen in hepatic encephalopathy. Third, ammonia is
considered to play a major role in the pathogenesis of the
neuropsychiatric disturbances observed in hepatic encephalopathy.
The liver is the major organ for detoxifying ammonia. When the
liver fulls the body is incapable of efficiently converting ammonia
to urea or glutamine, resulting in systemic hyperammonemia
including the brain. Unlike the liver, the brain lacks an effective
urea cycle and therefore relies entirely on glutamine synthesis for
the removal of blood-borne ammonia. Since glutamine synthetase is
dependent on an adequate level of ATP to amidate glutamate to
glutamine, ammonia intoxication results in depletion of brain ATP
resources and eventually cell death (Ott et al., 2005; Hardie,
2004). Finally, decreased glucose utilization in the brain may be
compensated by mobilization of amino acids to provide carbon
skeletons as substrates for energy metabolism. Yet, attempts to
balance energy failure at the expense of cerebral proteins may end
in destructive brain proteolysis (Hardie and Carling, 1997).
[0007] However, other factors such as an inflammatory response and
astrogliosis in the brain are also implicated in hepatic
encephalopathy.
[0008] The AMP-activated protein kinase (AMPK) is an evolutionarily
conserved metabolic master switch. AMPK is allosterically activated
by 5'-AMP, which accumulates following ATP hydrolysis. Conversely,
high ATP antagonizes the activating effects of 5'-AMP on AMPK. AMP
binding to AMPK leads to activation of the enzyme by inducing a
conformational change exposing threonine-172 in the catalytic
domain, which undergoes phosphorylation by an upstream AMPK kinase
(AMPKK) (Hawley et al., 1996).
[0009] Once activated, it switches on catabolic pathways (such as
fatty acid oxidation and glycolysis) and switches off ATP-consuming
pathways (such as lipogenesis) both by short-term effect on
phosphorylation of regulatory proteins and by long-term effect on
gene expression (Foretz et al., 2006). Stresses such as nutrient
depletion, hypoxia, heat shock, metabolic poisoning and exercise,
all activate AMPK by their effect on the ratio of 5'-AMP to ATP.
AMPK, in turn, phosphorylates multiple targets, which switch off
anabolic pathways and stimulate catabolic ones. AMPK was recently
recognized as a key regulator of whole body energy metabolism
(Minokoshi et al., 2004). Cerebral AMPK responds to integration of
nutritional and hormonal input. Hypothalamic AMPK controls energy
balance via regulation of food intake, body weight and glucose and
lipid homeostasis (Dagon et al., 2005; Pagotto et al., 2005).
Hippocampal AMPK controls cognitive function via regulation of
neurogenesis and neuroapoptosis (Dagon et al, 2005).
[0010] The cannabinoid (CB) system consists of two receptor
subtypes. The CB-1 receptors are predominantly found in the brain,
while the CB-2 receptors are mostly found in the peripheral tissue
(Matsuda, et al., 1990). The main endogenous endocannabinoids are
small molecules derived from membrane arachidonic acid, such as
anandamide(arachidonoylethanolamide) and 2-arachidonoylglycerol
(2-AG) (Iversen, 2000; Berry et al., 2002). D9-tetrahydrocannabinol
(THC), the major psychoactive constituent of the Cannabis plant, is
a cannabinoid agonist which produces a myriad of complex
pharmacological effects (Baker et al., 2003; Avraham et al., 2006).
It is now recognized that most of the central effects of endogenous
as well as exogenous cannabinoids are mediated through the CB-1
receptor, a family of G-protein-coupled receptors. Cerebral CB-1
receptors are part of the complex mechanisms involved in the
control of energy balance via regulation of food intake and body
weight (Teixeira-Clerc et al., 2006). The endocannabinoid system
has also been demonstrated to exert neuroprotective effects in
several types of cerebral insults via regulation of motor control,
cognition, emotional responses, motivated behavior and homeostasis
(Julien et al., 2005).
[0011] The endocannabinoid system was shown to have an important
role in the pathogenesis of hepatic encephalopathy. Modulation of
this system, either by specific antagonists to the CB1 cannabinoid
receptor, or by agonists specific for the CB2 receptor, such as
HU-308 was shown to be effective (Avraham et al., 2006).
SUMMARY OF THE INVENTION
[0012] The present invention is based on the surprising finding
that D9-tetrahydrocannabinol (THC) is effective in the treatment of
hepatic encephalopathy. This finding is surprising in view of the
fact that THC was previously known to have about equal affinity
both to the CB1 and the CB2 receptors and the above-mentioned
Avraham et al, 2006 publication teaches that modulation of the
endocannabinoid system is effected either by specific antagonists
to the CB1 cannabinoid receptor or by agonists specific for the CB2
receptor.
[0013] The present invention is further based on the findings that
cannabidiol (CBD) and capsaicin are effective in the treatment of
hepatic encephalopathy. This finding is also surprising since
cannabidiol does not exert its physiological activity through
neither of the CB1 or the CB2 receptors while capsaicin is known to
act through the vanilloid receptors subtype 1.
[0014] Accordingly, the present invention relates to a compound
selected from D9-tetrahydrocannabinol (THC), cannabidiol or
capsaicin, comprising said compound, for prevention, treatment, or
both, of hepatic encephalopathy.
[0015] The present invention also relates to pharmaceutical
composition comprising a compound selected from
D9-tetrahydrocannabinol (THC), cannabidiol or capsaicin, for
prevention, treatment, or both, of hepatic encephalopathy.
[0016] Furthermore a method for prevention, treatment, or both, of
hepatic encephalopathy comprising administering to a subject in
need an effective amount of a compound selected from the group
consisting of D9-tetrahydrocannabinol, cannabidiol and capsaicin,
is provided.
[0017] The term "hepatic encephalopathy", in the context of the
invention, and in accordance with the World Congress of
Gastroenterology 1998 in Vienna, refers to all subclasses of the
disease as follows: Type A (acute), hepatic encephalopathy
associated with acute liver failure; type B (bypass), caused by
portal-systemic shunting without associated intrinsic liver
disease; and type C (cirrhosis), occurring in patients with
cirrhosis.
[0018] This term refers to all durations and characteristics of
hepatic encephalopathy and includes episodic, persistent and
minimal. The term "minimal encephalopathy" refers to patients with
cirrhosis who do not demonstrate clinically overt cognitive
dysfunction, but who show a cognitive impairment on
neuropsychological studies.
[0019] The evaluation of severity of persistent hepatic
encephalopathy is based on the West Haven Criteria for
semi-quantitative grading of mental status, referring to the level
of impairment of autonomy, changes in consciousness, intellectual
function, behavior, and the dependence on therapy, and includes:
Grade 1--trivial lack of awareness; euphoria or anxiety; shortened
attention span; impaired performance of addition. Grade 2--lethargy
or apathy; minimal disorientation for time or place; subtle
personality change; inappropriate behavior; impaired performance of
subtraction. Grade 3--somnolence to semistupor, but responsive to
verbal stimuli; confusion; gross disorientation. Grade 4--Coma
(unresponsive to verbal or noxious stimuli).
[0020] The term "treatment" in the context of the present invention
refers to at least one of the following: decrease in the severity
of at least one undesired side effect associated with the disease;
improvement in the overall cognitive function of the treated
subject; delay in the progression from one disease stage to the
other; shortening the length of an hepatic encephalopathy episode
and lengthening the period between episodes.
[0021] The term "treatment" is also meant to refer to preventive or
prophylactic treatment--meaning that a person known to have liver
dysfunction or to be at risk for developing liver dysfunction (for
example, due to hepatitis C) is administered with THC, cannabidiol
or capsaicin, even before manifestation of hepatic encephalopathy
in order to prevent its occurrence.
[0022] The terms "THC" or "D9-tetrahydrocannabinol" are used herein
interchangeably for the compound
(-)-(6aR,10aR)-6,6,9-trimethyl-3-pentyl-6a,7,8,10a-tetrahydro-6H-benzo[c]-
chromen-1-ol. This substance may be isolated from the natural
source (cannabis), for example, in accordance with the method in
Gaoni and Mechoulam (1964) or may be synthetically produced such as
dronabinol, which is available as a prescription drug (under the
trade name Marinol.TM. of Unimed Pharmaceuticals, Inc.)
[0023] The present invention also relates to a compound selected
from capsaicin, 2-arachidonoylglycerol (2-AG), HU-308 or
cannabidiol for prevention, treatment, or both, of liver
cirrhosis.
[0024] The invention further relates to the use of capsaicin,
cannabidiol (CBD), 2-arachidonoylglycerol or HU-308 for the
preparation of a medicament for prevention, treatment, or both, of
liver cirrhosis.
[0025] Furthermore the invention concerns a method for the
prevention, treatment, or both, of liver cirrhosis comprising
administering to a subject a therapeutically effective amount of
capsaicin, cannabidiol, 2-arachidonoylglycerol or HU-308.
[0026] The term "liver cirrhosis" as used herein refers to any
stage in the development of the pathological condition, from very
initial development of fibrotic scar tissue to full-blown liver
cirrhosis. Examples of diseases or conditions that are known to
lead to liver cirrhosis are, but are not limited to: alcoholic
liver disease, chronic viral hepatitis (Type B and C), chronic bile
duct blockage, metabolic diseases resulting in abnormal storage of
copper (Wilson's disease) or iron (Hemochromatosis). Cirrhosis may
also be caused by exposure to drugs and toxins, by autoimmune
processes such as autoimmune hepatitis, by inherited diseases such
as cystic fibrosis and alpha antitrypsin deficiency, and by obesity
(so called "fatty liver" or nonalcoholic steatohepatitis).
Furthermore, severe reactions to prescription drugs, prolonged
exposure to environmental toxins such as arsenic, the parasitic
infection schistosomiasis, and repeated bouts of heart failure with
liver congestion can all lead to cirrhosis.
[0027] The treatment may be initiated when a disease is established
to stop or slow disease progression. Alternatively, as many of the
conditions (e.g. hepatitis, excessive consumption of alcohol and
obesity) are evident long before cirrhosis develops, often many
years before, capsaicin, cannabidiol, 2-AG or HU-308 may be given
in a preventive prophylactic manner to prevent or delay the onset
of cirrhosis.
BRIEF DESCRIPTION OF THE FIGURES
[0028] The patent or application file contains at least one drawing
executed in color. Copies of this patent or patent application
publication with color drawings will be provided by the Office upon
request and payment of the necessary fee.
[0029] In some of the following figures, the level of significance
of differences between treatment groups is designated with one, two
or three asterisks(s).
[0030] FIG. 1 shows D9-tetrahydrocannabinol (THC)-induced AMPK
activation following thioacetamide (TAA)-induced liver failure in
mice. Mice were administrated with saline or TAA. After 5 days,
mice were treated with 0.1-10 mg/kg THC for 1 h. AMPK expression
and phosphorylation on Thr172 were analyzed by immunoblotting.
Black columns represent control group and the gray columns
represents the TAA-treated group.
[0031] FIGS. 2A-E show that THC activates AMPK and improves
impaired brain function in TAA-induced liver failure in mice. Mice
were treated with TAA for 5 days, then 0.1 mM THC was administrated
daily for 5 days. (2A) Hippocampal AMPK expression and
phosphorylation on Thr 172 were analyzed by immunoblotting. P-AMPK,
phosphorylated AMPK. (2B) Mice were treated as above and
performance in an eight arm maze was measured every day after the
THC treatment. AUC, area under the curve. (2C) Activity score. (2D)
Neurological score under the same conditions. (2E) Catecholamines
levels were analyzed by HPLC. DA, dopamine.
[0032] FIGS. 3A-F show the effect of AICAR and THC treatment on
hepatic failure. Mice were treated with TAA or saline and then with
0.5 mM AICAR or 0.1 mg/l THC. Blood plasma was obtained for liver
functions analysis. (3A) Ammonia; (3B) Bilirubin; (3C) alanine
transaminase (ALT); (3D) aspartate aminotransferase (AST); (3E)
gamma-glutamyltransferase (GGT); (3F) Glucose.
[0033] FIGS. 4A-F depict histopathological changes in the liver
after treatment with TAA. 4A, normal mouse liver histology-score=0;
4B, mild centrilobular necrosis/apoptosis (score=1); FIG. 4C,
Centrilobular coagulative necrosis (score=2); 4D, Central to
central (bridging) necrosis (score=3); 4E, massive necrosis
effacing liver architecture (score=4); 4F, higher magnification of
liver centrilobular area (score=1).
[0034] FIGS. 5A-B show TAA effect on (5A) alanine transaminase
(ALT) and (5B) aspartate aminotransferase (AST) in mice treated
with different cannabinoid receptor ligands.
[0035] FIGS. 6A-B show effect of 2-arachidonoylglycerol (2-AG) and
SR141716A on blood ALT (6A) and AST levels (6B) in TAA treated
CB2-KO mice.
[0036] FIGS. 7A-B show that capsaicin significantly reduces both
the ALT (7A) and the AST (7B) level in TAA treated mice.
[0037] FIGS. 8A-F depict glial cell staining at the area of
hippocampus in naive animals (8A), and astrogliosis following TAA
administration (8B-F). Hepatic encephalopathy induced intensive
glial fibrillary acidic protein (GFAP, a marker for glial cells)
staining intensity and increased process complexity. These changes
were minimal following capsaicin--(8C), CB1 antagonist--(8D) and
CB2 agonist--(8E) treatment, whereas CB2 antagonist administration
(8F) did not alter either the number or morphology of activated
astroglia compared to untreated animals (8B).
[0038] FIGS. 9A-C show that capsaicin significantly improves
TAA-induced impaired cognitive function (9A), poor activity
performances (9B) and reduced neurological score (9C).
[0039] FIGS. 10A-B depict the effect of 2-AG treatment of chronic
liver failure induced by bile duct ligation (BDL) on cognitive
impairment (10A) and motor impairment (10B) relative to Sham
operated animals. AUC, area under the curve.
[0040] FIGS. 11A-B depict the effect of cannabidiol (CBD) treatment
of chronic liver failure induced by bile duct ligation (BDL) on
cognitive impairment (11A) and motor impairment (11) relative to
Sham operated animals. AUC, area under the curve.
[0041] FIGS. 12A-B depict the effect of cannabidiol (CBD) treatment
of chronic liver failure induced by bile duct ligation (BDL) on
IL-1.beta. mRNA level in the hippocampus relative to Sham operated
animals. 12A, RT-PCR gel separation; 12B quantification of
measurements done on the gel depicted in 12A. L19, ribosomal
protein commonly used as invariant control gene; AUC, area under
the curve.
[0042] FIG. 13 shows the effect of cannabidiol (CBD) treatment of
chronic liver failure induced by bile duct ligation (BDL) on
oxidative stress in the liver. MDA, malondialdehyde.
DETAILED DESCRIPTION OF THE INVENTION
[0043] Our study shows that AMPK is potently activated in murine
models of hepatic encephalopathy. This correlates with the observed
hyperammonia and hypoglycemia--two major causes of cerebral energy
depletion. Nonetheless, as found in acute hepatotoxicity (caused by
TAA), this response decreases with time, and eventually reaches the
same level as that of the chronic stress induced by bile duct
ligation. Such a cerebral adaptation response fulls to meet the
intact brain energy requirements and may be augmented by
pharmacological means (AICAR).
[0044] In light of this, pharmacological activation of AMPK might
provide a new strategy for the management of hepatic
encephalopathy. However, unselective drugs such as AICAR, which
activate AMPK under normal as well as under stress conditions, are
not suitable for clinical use. THC, the main active constituent of
marijuana, has been repeatedly demonstrated to cause brain
dysfunction and neurotoxicity (Mishima et al., 2001). This finding
is in line with our observations disclosed herein below of its
ability to stimulate AMPK. In addition, these studies have used
high dosage of THC (1-15 mg/kg), quantities that we found necessary
for AMPK activation under normal circumstances.
[0045] It is a finding of the present invention that the quantity
of THC required to activate AMPK drops (from 10 mg/kg in healthy
animals to 0.1 mg/kg in experimental hepatic encephalopathy
animals) as shown herein below. Therefore, THC could be suitable as
a selective agent that could function as a "stress specific drug"
by activating AMPK only under pathological conditions.
[0046] The surprising fact that THC, which has about equal affinity
for the CB1 and CB2 receptor, was effective in the treatment of
induced hepatic encephalopathy in animal models, motivated us to
investigate other compounds known to interact with receptors other
than the endocannabinoid receptors. For example, capsaicin,
suggested by Di Marzo et al (1998) to interact with the
endocannabinoid system, acts on neural cells via vanilloid
receptors subtype 1 (VR1, also known as transient receptor
potential 1 TRPV1), a non-selective cation channel, which can be
blocked by capsazepine. As shown herein below, capsaicin treatment
of induced hepatic encephalopathy in animal models resulted in both
improved hepatic and brain functions.
[0047] A second compound tested herein to treat the animals is
cannabidiol, an active ingredient of Cannabis Sativa devoid of
adverse effects related to the CB1 receptor owing to its
CB1-independent mechanism of action. Cannabidiol is also a very
potent anti-inflammatory agent. It is a finding of the present
invention that cannabidiol improves impaired brain and liver
function in experimental hepatic encephalopathy in animal models.
Furthermore, two additional cannabinoids, 2-AG and HU-308 were
shown herein to positively affect liver function in experimental
hepatic encephalopathy in animal models.
[0048] The present invention thus provides a compound selected from
D9-tetrahydrocannabinol (THC), cannabidiol and capsaicin for
prevention, treatment, or both of hepatic encephalopathy.
[0049] In one preferred embodiment the compound is
D9-tetrahydrocannabinol. In another preferred embodiment the
compound is cannabidiol. In still another preferred embodiment the
compound is capsaicin.
[0050] The compound may be formulated in any suitable form for
administration, preferably in an oral, parenteral, sublingual or
intranasal dosage form.
[0051] According to the present invention, D9-tetrahydrocannabinol,
cannabidiol and capsaicin are intended for prevention and/or
treatment of all subclasses of hepatic encephalopathy as described
above, i.e. Type A, Type B or Type C, preferably type A or type
C.
[0052] The present invention further provides a pharmaceutical
composition for prevention, treatment, or both, of hepatic
encephalopathy comprising a compound selected from
D9-tetrahydrocannabinol, cannabidiol and capsaicin and a
pharmaceutically acceptable carrier.
[0053] The present invention also concerns a method for prevention,
treatment, or both, of hepatic encephalopathy comprising
administering to a subject in need a therapeutically effective
amount of a compound selected from D9-tetrahydrocannabinol (THC),
cannabidiol and capsaicin.
[0054] In one aspect the present invention relates to a compound
selected from capsaicin, 2-arachidonoylglycerol (2-AG), HU-308 or
cannabidiol for prevention, treatment, or both, of liver
cirrhosis.
[0055] The invention further relates to a pharmaceutical
composition comprising a compound, selected from capsaicin,
2-arachidonoylglycerol (2-AG), HU-308 or cannabidiol for
prevention, treatment, or both, of liver cirrhosis
[0056] In one preferred embodiment the compound is
2-arachidonoylglycerol. In another preferred embodiment the
compound is HU-308. In still another preferred embodiment the
compound is capsaicin. In yet another preferred embodiment the
compound is cannabidiol.
[0057] The term "prevention of liver cirrhosis" refers herein to
preventing or slowing the deterioration of any damage caused to the
liver tissue, such as the accumulation of fibrotic scar tissue, by
factors known to cause cirrhosis such as, but not limited to,
alcoholic liver disease, chronic viral hepatitis type C, chronic
viral hepatitis type B, chronic bile duct blockage, Wilson's
disease, hemochromatosis, exposures to drug and toxins, autoimmune
hepatitis, cystic fibrosis, alpha antitrypsin deficiency, obesity
or schistosomiasis.
[0058] It is envisioned that prevention of the development of liver
cirrhosis can be achieved by treating subjects in need, such as
alcoholics, people infected with hepatitis C and obese people, at
very early stages of their disease or condition, even before
appearance of physical symptoms of liver cirrhosis.
[0059] The present invention also concerns a method for prevention,
treatment, or both, of liver cirrhosis, comprising administering to
a subject in need a therapeutically effective amount of a compound
selected from capsaicin, 2-arachidonoylglycerol (2-AG), HU-308 or
cannabidiol.
[0060] The present invention further provides a compound selected
from cannabidiol (CBD) or capsaicin for prevention, treatment, or
both, of hepatic encephalopathy or liver cirrhosis.
[0061] The invention further provides a pharmaceutical composition
for prevention, treatment, or both, of hepatic encephalopathy or
liver cirrhosis, comprising cannabidiol or capsaicin and a
pharmaceutically acceptable carrier.
[0062] The invention will now be illustrated by the following
non-limiting examples.
EXAMPLES
Materials and Methods
[0063] (i) Reagents. THC, SR141716A, SR144528 and CBD were provided
by Prof. Raphael Mechoulam (Faculty of Medicine and Department of
Pharmacology, Hebrew University of Jerusalem). Hepatotoxin
thioacetamide (TAA) and capsaicin were obtained from Sigma-Aldrich
(Rehovot, Israel). 5-aminoimidazole-4-carboxamide ribonucleoside
(AICAR) was obtained from Toronto Research Chemicals (TRC). HU-308
was synthesized as described in Hanus et al. (1999).
[0064] (ii) Mice. Eight- to 10-week old female Sabra mice (29-32
g), obtained from the animal facility of the Hebrew University,
Israel, were assigned at random to different groups of 10 mice per
cage and were used in all experiments. All cages contained
wood-chip bedding and were placed in a temperature-controlled room
at 22.degree. C., on a 12 h light/dark cycle (lights on at 07.00
a.m.). The mice had free access to water 24 h a day. The food
provided was Purina chow, the animals were maintained in the animal
facility (SPF unit) of the Hebrew University Hadassah Medical
School, Jerusalem. CB-2 KO mice were provided by Prof. Zimmer,
Institute of Molecular Psychiatry, University of Bonn, Germany.
[0065] Mice were sacrificed after treatment by decapitation between
10.00-12.00 a.m. Brains were rapidly removed and were dissected out
and kept at -70.degree. C.
[0066] (iii) Induction of Hepatic Failure
[0067] (iiia) Bile duct ligation. A midline incision was made under
general anesthesia. The common bile duct was localized, doubly
ligated, and cut between these two ligatures. In sham animals, a
midline incision was performed, but with BDL.
[0068] (iiib) TAA. A single dose of 200 mg kg-1 of TAA was injected
by the intraperitoneal route (i.p.). 24 hours after injection all
animals (including control) were injected (s. c) with 0.5 ml
solution of 0.45% NaCl, 5% dextrose and 0.2% KCl in order to
prevent hypovolemia, hypokalemia and hypoglycemia. The mice were
intermittently exposed to infrared light in order to prevent
hypothermia. THC was administered i.p. either alone or with
SR141716A on day 6 after TAA administration. Mice were sacrificed 1
h post treatment and analyzed for AMPK level. For the behavioral
tests which started on day 6 after TAA administration, THC was
administered i.p. during days 6-10. Neurological score, activity
and cognitive function were analyzed during these days.
[0069] (iv) Immunoblot analysis. Total hippocampal protein was
extracted using TriFast reagent (peqLab, Germany). Aliquots of the
clarified lysates containing 30 mg protein were denatured in
Laemmli sample buffer (6% SDS 30%, glycerol, 0.02% bromophenol
blue, 200 mM Tris-HCl (pH 6.8), and 250 mM-mercaptoethanol, at
95.degree. C. for 5 min. The samples were resolved by SDS--PAGE
(10% acrylamide), and blotted onto nitrocellulose membrane.
Non-specific binding in a Western blot analysis was prevented by
immersing the membranes in blocking buffer (5% nonfat dry milk in
Tris-buffer saline-Tween 20 (TBS-T)), for 2 h at room temperature.
The membranes were then exposed to the indicated antibodies diluted
1:1000 for 1 h at room temperature. Anti-AMPK and phospho-AMPK
antibodies were obtained from Cell Signaling. Anti-protein kinase B
(AKT) was obtained from Upstate. Anti-actin was from Santa Cruz
Biotechnology Inc. (Santa Cruz, Calif.). The blots were rinsed in
TBS-T and then incubated with horseradish peroxidase-conjugated
goat anti-mouse antibodies (1:10,000; Santa Cruz Biotechnology
Inc., Santa Cruz, Calif.) for 1 h at room temperature.
Antibody-antigen complexes were visualized by detecting enhanced
chemiluminescence with X-ray film.
[0070] (v) RT-PCR analysis. Total hippocampal RNA was extracted
using TriFast reagent according to the manufacturer's instructions
and reverse transcribed. Primers specific for CB1 were
GGAGAACATCCAGTGTGGGG [SEQ ID NO: 1] and CATTGGGGCTGTCTTTACGG [SEQ
ID NO: 2], for CB2 GGGTCCTCTCAGCATTGATTT [SEQ ID NO: 3], and
GTTAACAAGGCACAGCATGGAAC [SEQ ID NO: 4], and for actin CAG
CTTCTTTGCAGCTCCTT [SEQ ID NO: 5] and TCACCCACATAGGAGTCCT [SEQ ID
NO: 6]. All primers were synthesized by Danyel Biotech, Israel.
[0071] (vi) Catecholamine measurements. Catecholamines were
measured as described previously (Avraham et al, 1996). The assay
for dopamine was performed by High Pressure Liquid Chromatography
(HPLC) separation and detection using HPLC-electrochemical
detection (ECD). Values are presented as concentration (ng/g
tissue).
[0072] (vii) Neurological function. Neurological function was
assessed by a 10 point scale based on reflexes and task performance
(Chen et al., 1996): exit from a circle 1 meter in diameter in less
than 1 minute, seeking, walking a straight line, startle reflex,
grasping reflex, righting reflex, placing reflex, corneal reflex,
maintaining balance on a beam 3, 2 and 1 cm in width, climbing onto
a square and a round pole. For each task failed or abnormal reflex
reaction a score of 1 was assigned. Thus, a higher score indicates
poorer neurological function. The neurological score was assessed
one day after TAA induction (day 2). The mice were then divided
between treatment groups so that each group had a similar baseline
neurological score after TAA induction. The post-treatment
neurological score was assessed one day after administration of the
agonist or the antagonist or the vehicle (day 3).
[0073] (viii) Activity. The activity test was performed on day 4,
since in the first 3 days after TAA injection almost no motor
activity was observed. One of two methods was utilized: a) an
activity apparatus, which consists of a cylindrical chamber (60 cm
in diameter) with crossing infrared beams. Locomotor activity was
recorded by a counter (attached to the apparatus), that counts the
number of beam crossings made by the mice at one-minute intervals.
Activity of two mice was measured simultaneously for a five-minute
period. Two mice were tested together to lower stress to the
minimum. Activity is presented as the mean number of beam crossings
in 5 minutes.
[0074] Activity was also assessed in the open field (20.times.30 cm
field divided into 12 squares of equal size) as described
previously (Fride and Mechoulam, 1993). Two mice were observed
simultaneously for 5 minutes. Locomotor activity was recorded by
counting the number of crossings by the mice at one minute
intervals. Results are presented as the mean number of crossings
per minute.
[0075] (ix) Eight-arm maze. The animals were placed in an eight-arm
maze, which is a scaled-down version of that developed for rats
(Olton and Samuelson, 1976; Pick and Yanai, 1983). We used water
deprivation achieved by limiting water consumption overnight and a
reward of 50 .mu.l of water presented at the end of each arm. The
mice were tested until they made entries into all eight arms or
until they completed 24 entries, whichever came first. Hence, the
lower the score, the better the performance. Maze performance was
calculated each day for five consecutive days. Results were
presented as area under the curve (AUC) utilizing the formula: (day
2+day 3+day 4+day 5)-4*(day 1).
[0076] (x) Statistical analysis. Data are presented as means and
standard deviations (SD) or standard errors (SEM). Results were
evaluated by one-way ANOVA and 2-tailed t-test. Post-hoc testing
was carried out using the Tukey-Kramer multiple comparisons
procedure.
[0077] (xi) Liver function analysis. Ammonia, bilirubin, ALT, AST,
GGT and glucose were analyzed using standard analytical methods in
the Hadassah Hospital Biochemistry Department, Jerusalem,
Israel.
Example 1
Experimental Hepatic Encephalopathy is Accompanied by Activation of
AMPK by Cannabinoids
[0078] To consider their role in AMPK stimulation, we studied the
effects of giving exogenous cannabinoids to activate AMPK. In the
first step, control mice were administrated with 0.01 to 10 mg/kg
THC and hippocampal AMPK phosphorylation was analyzed. THC
treatment showed a biphasic effect (Sulcova et al., 1998). While
low levels of THC (less than 0.1 mg/kg) reduced the level of
activated AMPK, higher concentrations exhibited a dose dependent
elevation in activated enzyme, reaching a significant activation of
AMPK (FIG. 1). In the next step, the effect of THC was tested in
TAA treated mice. In this instance THC also demonstrated a biphasic
effect. However, an inactivating effect was already observed in
0.01 mg/kg and AMPK activation was achieved by 0.1 mg/kg. Elevation
of the cerebral responsiveness to THC suggested that low doses of
THC, which do not activate the AMPK in the healthy animals, could
be used in the pathological state.
Example 2
THC Activates AMPK and Improves Impaired Brain Function in
Experimental Hepatic Encephalopathy
[0079] Since treatment of 0.1 mg/kg THC augmented AMPK activation
in a similar manner to AICAR treatment, we chose this dose to test
THC's physiological effects on the experimental hepatic
encephalopathy. TAA treated mice were administrated daily with 0.1
mg/kg THC for 5 days. Amplification of AMPK activation in response
to THC administration was confirmed in the brains of the
experimental animals at the end of the behavioral studies (FIG.
2A).
[0080] Next, we investigated the outcome of AMPK activation
increase on brain function. Following the treatment, TAA-induced
impaired cognitive function was improved significantly (FIG. 2B),
poor activity performances were restored (FIG. 2C) and the reduced
neurological score was improved (FIG. 2D). To reveal the mechanism
by which THC could improve brain function, we studied the
catecholaminergic response to THC treatment. Brain tissue in
animals with experimental hepatic encephalopathy exhibited reduced
dopamine concentrations while THC administration, similarly to
AICAR administration, restored levels to normal (FIG. 2E). These
results demonstrated the potential of THC to stimulate cerebral
AMPK activity in treating hepatic encephalopathy.
Example 3
AICAR and THC Treatment do not Improve Markers of Hepatic
Function
[0081] To investigate the possibility that the neural benefits of
AICAR and THC might also result from peripheral effects (i.e.
improvement of liver function) rather than cerebral function, we
studied their effects on liver function. Animals treated with TAA
exhibited hyperammonemia as a result of the liver dysfunction;
AICAR and THC treatment had no effect on the ammonia level (FIG.
3A). Bilirubin levels and liver enzymes activity are the most
commonly used laboratory markers of liver function. TAA treated
mice demonstrated increased levels of bilirubin (FIG. 3B), alanine
transaminase (ALT) (FIG. 3C), aspartate aminotransferase (AST)
(FIG. 3D) and gamma-glutamyltransferase (GGT) (FIG. 3E). Neither
AICAR nor THC ameliorated these markers indicating lack of direct
action on liver recovery. Glucose analysis revealed a systemic
hypoglycemia following TAA treatment (FIG. 3F) providing additional
evidence for the metabolic energy impairment characterizing
experimental hepatic encephalopathy.
Example 4
Capsaicin Improves Impaired Markers of Hepatic Function in
Experimental Hepatic Encephalopathy
[0082] The surprising fact that THC, which has about equal affinity
for the CB1 and CB2 receptor, was effective in the treatment of
induced hepatic encephalopathy in animal models, motivated us to
investigate other compounds known to interact with receptors other
than the endocannabinoid receptors. For example, capsaicin,
suggested by Di Marzo et al (1998) to interact with the
endocannabinoid system, acts on neural cells via vanilloid
receptors subtype 1 (VR1, also known as transient receptor
potential 1 TRPV1), a non-selective cation channel, which can be
blocked by capsazepine. Thus, TAA treated mice were administered
different agonist/antagonists and capsaicin and their effect on
hepatic function was assessed.
[0083] First, histopathological changes were observed after the
treatment with TAA. FIGS. 4A-F depict varying degrees of necrosis
which were semi-quantitated as histopathological indices 1-4.
[0084] Second, the effect on hepatic function of different agents
administered to the TAA treated animals was tested. Comparison of
the histopathological indices assessed for each group indicated
that amelioration of TAA-induced apoptosis/necrosis reached
statistical significance (P<0.05) only with capsaicin treatment.
However, inflammation was reduced also in HU308 and
SR141716A--treated animals when compared to TAA-treated group,
whereas, SR144528 treatment resulted in non-significant changes
with regard to the inflammatory process.
[0085] The regenerative capacity of the liver in all cannabinoid
receptor agonists or antagonists--treated groups was higher when
compared to animals to which only TAA was administered, except
capsaicin treated animals which exhibited significantly less
hepatic regeneration (Table 1).
TABLE-US-00001 TABLE 1 Comparison of the frequency of cells showing
apoptosis/necrosis, inflammation and regeneration in the liver.
Groups comparison Apoptosis Inflammation Regeneration TAA vs normal
Increase Increase Increase (p < 0.001*) (p < 0.001*) (p <
0.001*) TAA + capsaicin Decreased Decreased Decreased vs TAA (p
< 0.005*) (p < 0.01*) (p < 0.001*) TAA + NS** Decreased
Increased SR141716A vs (p < 0.001**) (p < 0.005*) TAA TAA +
HU-308 NS* Decreased Increased vs TAA (p < 0.005*) (p <
0.001*) TAA + NS* NS* Increased SR144528 vs (p < 0.05*) TAA TAA
+ 2Ag vs NS* Decreased Increased TAA (p < 0.05*) (p < 0.05*)
TAA + 2Ag + SR1 NS* Decreased Increased 41716A vs TAA (p <
0.05*) (p < 0.05*) *= Fisher's exact test; **= Pearson's
chi-square test
Example 5
CB1 Antagonist and CB2 Agonist Treatment Improve Markers of Hepatic
Function
[0086] TAA treated mice demonstrated increased levels of alanine
transaminase (ALT) (FIG. 5A) (see also FIG. 3C) and aspartate
aminotransferase (AST) (FIG. 5B) (see also FIG. 3D); treatment of
the TAA treated mice with 2-AG--a CB1 agonist, SR141716A--a CB1
antagonist, HU-308--a CB2 agonist, and SR144528--a CB2 antagonist,
all significantly reduced ALT and AST levels. Moreover, 2-AG did
not counteract the effect of SR141716A or SR144528, and HU-308 did
not counteract the effect of SR144528. Thus, the results imply that
the agonists/antagonists did not convey their effect specifically
through the CB1 or CB2 receptors.
Example 6
CB2 Agonist, but not CB1 Antagonist Treatment Improves Markers of
Hepatic Function in CB2-KO Mice
[0087] In the transgenic mice lacking the CB2 receptor, 2-AG but
not SR141716A modestly but significantly reduced the ALT level and
SR141716A blocked the effect of 2-AG (FIG. 6A), confirming that
effect was achieved through the CB1 receptor.
[0088] The effect of the endocannabioid agonist and antagonist on
the second hepatic function marker tested, AST, was inconsistent
with the result obtained for ALT in that both the CB1 antagonist
SR141716A and the CB1 agonist 2-AG were effective in reducing its
level (FIG. 6B). SR141716A abolished the effect of 2-AG, or
vice-versa.
Example 7
Capsaicin Treatment Improves Markers of Hepatic Function
[0089] The results disclosed above imply that the effect observed
with the endocannabioid agonist and antagonist may have been
affected through another receptor than the CB1 receptor. We
therefore tested the effect of capsaicin, which as mentioned above,
has been suggested to interact with the endocannabinoid system.
FIGS. 7A-B show that indeed, capsaicin significantly reduces both
the ALT and the AST level in TAA treated mice. The effect of
capsaicin is specifically affected through the VR1 receptor as
evidenced by the abolishment of the effect of capsaicin by the VR1
antagonist capsazepine.
Example 8
Endocannabioid Agonist and Antagonist and Capsaicin Treatment
Reduce Astrogliosis in TAA Treated Mice
[0090] To assess whether endocannabioid agonist and antagonist and
capsaicin treatment affect the important aspect of hepatic
encephalopathy pathology--astrogliosis--TAA treated animals were
treated with these compounds and hippocampus was stained for glial
cells in naive animals (FIG. 8A) and after treatment (FIGS.
8B-F).
[0091] It was found that hepatic encephalopathy induced intensive
glial fibrillary acidic protein (GFAP, a marker for glial cells)
staining intensity and increased process complexity, i.e. more
processes and increased branching (FIG. 8B) as compared with naive
animals (FIG. 8 A). These changes were prevented following
capsaicin--(FIG. 8C), CB1 antagonist (SR141716A)--(FIG. 8D) and CB2
agonist (HU-308)--(FIG. 8E) treatment, whereas CB2 antagonist
(SR144528) administration (FIG. 8F) failed to prevent the hepatic
encephalopathy induced changes and did not alter either the number
or morphology of activated astroglia compared to untreated animals
(FIG. 8B), as can be seen in Table 2, presenting the changes in
quantitative terms.
TABLE-US-00002 TABLE 2 Quantification of the changes in
astrogliosis following TAA and treatments with various compounds.
(two-sided Fisher's exact test) Comparison Direction of change TAA
vs normal Increase (p < 0.001) TAA + capsaicin vs TAA Decrease
(p < 0.001) TAA + SR141716A vs TAA Decrease (p < 0.001) TAA +
HU-308 vs TAA Decrease (p < 0.001) TAA + SR144528 vs TAA NS
Example 9
Capsaicin Improves Impaired Brain Function in Experimental Hepatic
Encephalopathy
[0092] Since treatment with capsaicin reduced astrogliosis in TAA
treated mice, we were interested in assessing whether the treatment
also had a positive effective on the impaired brain functions of
hepatic encephalopathy mice. Following the treatment with
capsaicin, TAA-induced impaired cognitive function was improved
significantly (FIG. 9A), poor activity performances were restored
(FIG. 9B) and the reduced neurological score was improved (FIG.
9C).
Example 10
2-AG Treatment Effect on Cognitive Impairment Secondary to Biliary
Cirrhosis and Motor Impairments
[0093] As can be seen in FIGS. 10A-B, 2-AG effectively reversed
cognitive impairments secondary to biliary cirrhosis in mice (FIG.
10A), but failed to reverse the motor impairments (FIG. 10B) which
are also typical to this disorder.
Example 11
Cannabidiol Improves Impaired Brain and Liver Function in
Experimental Hepatic Encephalopathy
[0094] We decided to treat the animals with cannabidiol, an active
ingredient of Cannabis Sativa devoid of adverse effects related to
the CB1 receptor owing to its CB1-independent mechanism of action.
Cannabidiol is also a very potent anti-inflammatory agent.
[0095] Chronic liver failure was induced by bile duct ligation
(BDL) in female Sabra mice. Sham-operated mice served as controls.
BDL animals were divided randomly to control and treatment groups,
which received, respectively, saline and 5 mg/kg cannabidiol i.p.
daily for 3 weeks.
[0096] Two weeks post-surgery, the cognitive and the motor function
of the mice were evaluated. Mice were decapitated 3 weeks
post-surgery and their hippocampi were taken for analysis of IL-1b
mRNA level by RT-PCR. The results clearly show that cognitive
function (FIG. 11A) and motor activity (FIG. 11B) are impaired by
BDL after 2 weeks and is restored by cannabidiol. Also, IL-1.beta.
mRNA level (normalized to ribosomal protein L19 mRNA levels; a
commonly used invariant control gene) in the hippocampus is
elevated following BDL and is restored by cannabidiol (FIGS.
12A-B).
[0097] Oxidative stress in liver tissue due to chronic liver
failure induced by BDL was assessed by measuring malondialdehyde, a
well accepted biomarker for oxidative stress. As can be seen in
FIG. 13, oxidative stress is elevated following BDL and is restored
by cannabidiol. As oxidative stress is commonly known to be
involved in the development of cirrhosis (Ara et al., 2005) and
treatment with cannabidiol reduces the oxidative stress, one can
deduce that this treatment will prevent or slow down the
development of cirrhosis.
[0098] In summary, after 2 weeks, bile duct ligation induced
cognitive and motor deficits and increased oxidative stress in the
liver, which were reversed by cannabidiol. In the hippocampus,
which is responsible for learning and memory, there was an
up-regulation of IL-1b mRNA following BDL, which was also reversed
by cannabidiol, suggesting causal relationship between an
inflammatory response in this region and impaired learning.
REFERENCES
[0099] Ara C, Kirimlioglu H, Karabulut A B, Coban S, Ay S,
Harputluoglu M, [0100] Kirimlioglu V, Yilmaz S. (2005) Protective
effect of resveratrol against oxidative stress in cholestasis. J
Surg Res. 127(2): 112-7 [0101] Avraham Y, Bonne O, Berry E M.
Behavioral and neurochemical alterations caused by diet
restriction--The effect of tyrosine administration in mice. Brain
Research 1996; 732:133-144. [0102] Avraham Y, Israeli E, Gabbay E,
Okun A, Zolotarev O, Silberman I, Ganzburg V, Dagon Y, Magen I,
Vorobia L, Pappo O, Mechoulam R, Ilan Y, Berry E M.
Endocannabinoids affect neurological and cognitive function in
thioacetamide-induced hepatic encephalopathy in mice. Neurobiol
Dis. 2006 January; 21(1):237-45. [0103] Baker D, Pryce G,
Giovannoni G, Thompson A J. The therapeutic potential of cannabis.
Review. Lancet Neurol 2003; 2:291-298. [0104] Barbiroli B, Gaiani
S, Lodi R, Totti S, Tonon C, Clementi V, Donati G, Bolondi L.
Abnormal brain energy metabolism shown by in vivo phosphorus
magnetic resonance spectroscopy in patients with chronic liver
disease. Brain Res Bull 2002; 59:75-82. [0105] Bergold P J, Sweatt
J D, Winicov I, Weiss K R, Kandel E R, Schwartz J H. Protein
synthesis during acquisition of long-term facilitation is needed
for the persistent loss of regulatory subunits of the Aplysia
cAMP-dependent protein kinase. Proc Natl Acad Sci USA. 1990;
87:3788-91. [0106] Bernard A, Roger D, Luigi C, and Ramon L.
Actinomycin D Blocks Formation of Memory of shock-avoidance in
Goldfish. Science 1967; 158: 3808, 1600-1601 [0107] Berry E M,
Mechoulam R. Tetrahydrocannabinol and endocannabinoids in feeding
and appetite. Review. Pharmacol Ther 2002; 95:185-190. [0108]
Bezuglov V, Bobrov M, Gretskaya N, Gonchar A, Zinchenko G, Melck D,
Bisogno T, Di Marzo V, Kuklev D, Rossi J C, Vidal J P, Durand T.
Synthesis and biological evaluation of novel amides of
polyunsaturated fatty acids with dopamine. Bioorg Med Chem Lett
2001; 1.1:447-449 [0109] Bisogno T, Melck D, Bobrov M Yu, Gretskaya
N M, Bezuglov U V, De Petrocellis L, Di Marzo V. N-Acyl-dopamines:
novel synthetic CB(1) cannabinoid-receptor ligands and inhibitors
of anandamide inactivation with cannabimimetic activity in vitro
and in vivo. Biochem J 2000; 351:817-824. [0110] Cheer J F, Wassum
K M, Heien M L, Phillips, P E, Wightman, R M. Cannabinoids enhance
subsecond dopamine release in the nucleus accumbens of awake rats.
J Neurosci 2004; 24:4393-4400. [0111] Chen Y, Constantini S,
Trembovler V, Weinstock M, Shohami E. An experimental model of
closed head injury in mice: pathophysiology, histopathology and
cognitive deficits. J Neurotrauma 1996; 13:557-568. [0112]
Costa-Mattioli M, Gobert D, Harding H, Herdy B, Azzi M, Bruno M,
Bidinosti M, Ben Mamou C, Marcinkiewicz E, Yoshida M, Imataka H,
Cuello A C, Seidah N, Sossin W, Lacaille J C, Ron D, Nader K,
Sonenberg N. Translational control of hippocampal synaptic
plasticity and memory by the eIF2alpha kinase GCN2. Nature. 2005;
436:1166-73. [0113] Dagon Y, Avraham Y, Berry E M. AMPK activation
regulates apoptosis, adipogenesis, and lipolysis by eIF2alpha in
adipocytes. Biochem Biophys Res Commun. 2006; 340:43-7. [0114]
Dagon Y, Avraham Y, Magen I, Gertler A, Ben-Hur T, Berry E M.
Nutritional status, cognition, and survival: a new role for leptin
and AMP kinase. J Biol Chem 2005; 280:42142-42148. [0115] Devane W
A, Hanus L, Breuer A, Pertwee R G, Stevenson L A, Griffin G, Gibson
D, Mandelbaum A, Etinger A, Mechoulam R. Isolation and structure of
a brain constituent that binds to the cannabinoid receptor. Science
1992; 258:1946-1949. [0116] Folbergrova J, Zhao Q, Katsura K,
Siesjo B K. N-tert-butyl-alpha-phenylnitrone improves recovery of
brain energy state in rats following transient focal ischemia. Proc
Natl Acad Sci USA. 1995; 92:5057-5061. [0117] Foretz M, Taleux N,
Guigas B, Horman S, Beauloye C, Andreelli F, Bertrand L, Viollet B.
(2006) Regulation of energy metabolism by AMPK: a novel therapeutic
approach for the treatment of metabolic and cardiovascular
diseases. Med Sci (Paris) 22(4):381-8. [0118] Fride E, Mechoulam R.
Pharmacological activity of the cannabinoid receptor agonist,
anandamide, a brain constituent. Eur J Pharmacol 1993; 231:313-314.
[0119] Gaoni Y and Mechoulam R Isolation, structure and partial
synthesis of an active constituent of hashish. J Am Chem Soc 1964;
86:1646-7 [0120] Gerber T, Schomerus H. Hepatic encephalopathy in
liver cirrhosis: pathogenesis, diagnosis and management. Review.
Drugs 2000; 60:1353-1370. [0121] Gerdeman G L, Partridge J G,
Lupica C R, Lovinger D M. It could be habit forming: drugs of abuse
and striatal synaptic plasticity. Review. Trends Neurosci 2003; 26:
184-192. [0122] Hanus, A. Breuer, S. Tchilibon, S. Shiloah, D.
Goldenberg, M. Horowitz, R. G. Pertwee, R. A. Ross, R. Mechoulam,
and E. Fride (1999) PNAS 96:14228-14233. [0123] Hardie D G, Carling
D. The AMP-activated protein kinase--fuel gauge of the mammalian
cell? Review. Eur J Biochem 1997; 246:259-273. [0124] Hardie D G.
The AMP-activated protein kinase pathway--new players upstream and
downstream. Review. J Cell Sci 2004; 117:5479-5487. [0125] Hawley S
A, Davison M, Woods A, Davies S P, Beri R K, Carling D, and Hardie
D G. Characterization of the AMP-activated protein kinase kinase
from rat liver and identification of threonine 172 as the major
site at which it phosphorylates AMP-activated protein kinase. J
Biol Chem 271: 27887-27879, 1996 [0126] Hoyer S. Abnormalities in
brain glucose utilization and its impact on cellular and molecular
mechanisms in sporadic dementia of Alzheimer type. Ann N Y Acad Sci
1993; 695:77-80. [0127] Iversen L L. The Science of Marijuana
(Oxford Univ. Press, New York, 2000), p. 36. [0128] Julien B,
Grenard P, Teixeira-Clerc F, Van Nhieu J T, Li L, Karsak M, Zimmer
A, Mallat A, Lotersztajn S. Antifibrogenic role of the cannabinoid
receptor CB2 in the liver. Gastroenterology. 2005; 3:128:742-55.
[0129] Kola B, Hubina E, Tucci S A, Kirkham T C, Garcia E A,
Mitchell S E, Williams L M, Hawley S A, Hardie D G, Grossman A B,
Korbonits M. Cannabinoids and ghrelin have both central and
peripheral metabolic and cardiac effects via AMP-activated protein
kinase. J Biol Chem. 2005; 280:25196-201. [0130] Martin B R. Role
of lipids and lipid signaling in the development of cannabinoid
tolerance. Review. Life Sci 2005; 77:1543-1558. [0131] Matsuda L A,
Lolait S J, Brownstein M J, Young A C, Bonner T I. Structure of a
cannabinoid receptor and functional expression of the cloned cDNA.
Nature 1990; 346:561-564. [0132] Minokoshi Y, Alquier T, Furukawa
N, Kim Y B, Lee A, Xue B, Mu J, Foufelle F, Ferre P, Birnabaum M J,
Stuck B J, Kahn B B. AMP-kinase regulates food intake by responding
to hormonal and nutrient signals in the hypothalamus. Nature 2004;
428:569-574. [0133] Mishima K, Egashira N, Hirosawa N, Fujii M,
Matsumoto Y, Iwasaki K, Fujiwara M. Characteristics of learning and
memory impairment induced by delta9-tetrahydrocannabinol in rats.
Jpn J Pharmacol. 2001; 87:297-308. [0134] Mizuno Y, Ikebe S,
Hattori N, Nakagawa-Hattori Y, Mochizuki H, Tanaka M. Role of
mitochondria in the etiology and pathogenesis of Parkinson's
disease. Review. Biochim Biophys Acta 1995; 1271:265-274. [0135]
Molina-Holgado F, Pinteaux E, Heenan L, Moore J D, Rothwell N J,
Gibson R M. Neuroprotective effects of the synthetic cannabinoid
HU-210 in primary cortical neurons are mediated by
phosphatidylinositol 3-kinase/AKT signaling. Mol Cell Neurosci.
2005; 28:189-94. [0136] Olton D S, Samuelson R J. Remembrance of
places passed: Spatial memory in rats. J Exp Psychol Anim Behav
Process 1976; 2:97-116. [0137] Ott P, Clemmesen O, Larsen F S.
Cerebral metabolic disturbances in the brain during acute liver
failure: from hyperammonemia to energy failure and proteolysis.
Review. Neurochem Int 2005; 47:13-18. [0138] Pagotto U, Vicennati
V, Pasquali R. The endocannabinoid system and the treatment of
obesity. Ann Med. 2005; 37:270-5. Review. [0139] Pick C G, Yanai J.
Eight arm maze for mice. Int J Neurosci 1983; 21:63-66. [0140] Ross
B D, et al. 31P spectroscopic imaging shows energy deficit of
thalamus in chronic hepatic encephalopathy. In: Book of Abstracts,
Annual Meeting of the Society of Magnetic Resonance in Medicine,
Amsterdam; 1989: 465. [0141] Sulcova E, Mechoulam R, Fride E.
Biphasic effects of anandamide. Pharmacol Biochem Behav 1998;
59:347-353. [0142] Teixeira-Clerc F, Julien B, Grenard P, Tran Van
Nhieu J, Deveaux V, Li L, Serriere-Lanneau V, Ledent C, Mallat A,
Lotersztajn S. CB1 cannabinoid receptor antagonism: a new strategy
for the treatment of liver fibrosis. Nat Med. 2006; 6:12:671-6.
[0143] Xiong Y, Peterson P L, Lee C P. Alterations in cerebral
energy metabolism induced by traumatic brain injury. Review. Neurol
Res 2001; 23:129-138. [0144] Zimmermann C, Ferenci P, Pifl C,
Yurdaydin C, Ebner J, Lassmann H, Roth E, Hortangl H. Hepatic
encephalopathy in thioacetamide-induced acute liver failure in
rats: characterization of an improved model and study of amino
acid-ergic neurotransmission. Hepatology 1989; 9:594-601.
Sequence CWU 1
1
6120DNAArtificialPrimer specific for CB1 1ggagaacatc cagtgtgggg
20220DNAArtificialPrimer specific for CB1 2cattggggct gtctttacgg
20321DNAArtificialPrimer specific for CB2 3gggtcctctc agcattgatt t
21423DNAArtificialPrimer specific for CB2 4gttaacaagg cacagcatgg
aac 23520DNAArtificialPrimer specific for actin 5cagcttcttt
gcagctcctt 20619DNAArtificialPrimer specific for actin 6tcacccacat
aggagtcct 19
* * * * *