U.S. patent application number 12/231900 was filed with the patent office on 2010-01-28 for long interfering nucleic acid duplexes targeting multiple rna targets.
Invention is credited to Kunyuan Cui, Dong Liang, David Sweedler.
Application Number | 20100022618 12/231900 |
Document ID | / |
Family ID | 40452745 |
Filed Date | 2010-01-28 |
United States Patent
Application |
20100022618 |
Kind Code |
A1 |
Liang; Dong ; et
al. |
January 28, 2010 |
Long interfering nucleic acid duplexes targeting multiple RNA
targets
Abstract
Long interfering nucleic acid (iNA) duplexes, which are at least
30 nucleotides in length, which have at least one nick or
nucleotide gap in the antisense or the sense strands or in both the
sense and antisense strands. These long iNA duplexes do not induce
an interferon response when transfected into mammalian cells. The
antisense strands can target two separate mRNAs or two segments of
one mRNA.
Inventors: |
Liang; Dong; (Everett,
WA) ; Sweedler; David; (Louisville, CO) ; Cui;
Kunyuan; (Botthell, WA) |
Correspondence
Address: |
Paul G. Lunn
14606 - 135th Ct. N.E.
Woodinville
WA
98072-4607
US
|
Family ID: |
40452745 |
Appl. No.: |
12/231900 |
Filed: |
September 5, 2008 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
61069029 |
Mar 13, 2008 |
|
|
|
61065844 |
Feb 16, 2008 |
|
|
|
60992695 |
Dec 5, 2007 |
|
|
|
60969951 |
Sep 5, 2007 |
|
|
|
Current U.S.
Class: |
514/44A ;
536/24.5 |
Current CPC
Class: |
C12N 2310/141 20130101;
C12N 2310/341 20130101; C12N 15/111 20130101; C12N 2310/351
20130101; C12N 15/1136 20130101; C12N 2310/531 20130101; C12N
2310/14 20130101; C12N 2310/53 20130101; C12N 2310/51 20130101;
C12N 15/1138 20130101 |
Class at
Publication: |
514/44.A ;
536/24.5 |
International
Class: |
A61K 31/713 20060101
A61K031/713; C12N 15/113 20100101 C12N015/113 |
Claims
1. An interfering nucleic acid (iNA) duplex comprised of a sense
strand of nucleotides having a 5' end and a 3' end annealed onto an
antisense strand of nucleotides having a 5' end and a 3' end
wherein the antisense strand has at least two segments, wherein one
segment of the antisense strand can target a first RNA and another
segment of the antisense strand can target a second RNA, or one
segment of the antisense strand can target a first portion of an
RNA and another segment of the antisense strand can target a second
portion of said RNA, and wherein the iNA does not induce an
interferon-response when transfected into a cell.
2. The iNA of claim 1 wherein there is a nick between 2 nucleotides
in the sense strand wherein said nucleotide gap in said sense
strand is at least 1-20 nucleotides in length.
3. The iNA of claim 2 wherein there is a nucleotide modification on
one or more of the nucleotides on the sense strand and wherein the
nucleotide modification is either a pyrrolindol or a stilbene
linked to a nucleotide.
4. The iNA of claim 3 wherein the pyrrolindo is
pyrenylmethylpyrrolindol and the stilbene is
trimethoxystilbene.
5. The iNA of claim 1 wherein there is a nick between 2 nucleotides
in the antisense strand or a nucleotide gap in the antisense strand
wherein said nucleotide gap in said antisense strand is at least
1-20 nucleotides in length.
6. The iNA of claim 5 wherein there is a nucleotide modification on
one or more of the nucleotides on the antisense strand and wherein
the nucleotide modification is either a pyrrolindol or a stilbene
linked to a nucleotide.
7. The iNA of claim 6 wherein the pyrrolindo is
pyrenylmethylpyrrolindol and the stilbene is
trimethoxystilbene.
8. The iNA duplex of claim 1 wherein there is a nick or a gap in
the sense strand and a nick or a nucleotide gap in the antisense
strand.
9. The iNA duplex of claim 1 wherein the RNA is a messenger RNA
(mRNA).
10. The iNA duplex of claim 9 wherein the RNA is a micro RNA
(miRNA).
11. The iNA duplex of claim 9 wherein the 3' end of the sense
strand is connected to the 5' end of the antisense strand by means
of a hairpin-loop of nucleotides.
12. The iNA duplex of claim 1 wherein the iNA duplex is at least
30-80 nucleotides in length.
13. An iNA duplex comprised of a sense strand of nucleotides, and
two or more antisense strands annealed to the sense strand wherein
there is at least one nucleotide gap or a nick between the
antisense strands, and wherein the iNA duplex has a length of at
least 30 nucleotides, and wherein each antisense strand a has 5'
and a 3' end and the sense strand has a 5' end and a 3' end.
14. The iNA duplex of claim 13 wherein each antisense strand
targets a different mRNA or miRNA.
15. The iNA duplex of claim 13 wherein each antisense strand
targets different portions of an mRNA or miRNA.
16. The iNA duplex of claim 13 wherein the length of the iNA duplex
has a length of at least 30-80 nucleotides.
17. The iNA duplex of claim 13 wherein the sense and antisense
strands are joined together at one end of each of the strands by
means of a hairpin-loop of nucleotides.
18. The iNA duplex of claim 17 wherein the 5' end of the sense
strand is connected to the 3' end of the antisense strand by means
of a hairpin-loop of nucleotides.
19. The iNA duplex of claim 18 wherein the 3' end of the sense
strand is connected to the 5' end of the antisense strand by means
of a hairpin-loop of nucleotides.
20. The iNA duplex of claim 13 wherein the gap between the
antisense strands is at least 1-20 nucleotides in length.
21. The iNA duplex of claim 13 wherein each antisense strand is at
least 15 nucleotides in length.
22. The iNA duplex of claim 13 wherein there is a nucleotide gap or
nick in the sense strand.
23. An iNA duplex comprised of a sense strand and an antisense
strand, wherein the antisense strand is annealed to the sense
strand, wherein there is at least one nick or one nucleotide gap in
the antisense strand, and wherein the iNA duplex has a length of at
least 30 nucleotides and wherein there is at least one nick or at
least one nucleotide gap in the sense strand.
24. The iNA duplex of claim 23 wherein the sense and antisense
strands are joined together at one end of each of the strands by
means of a hairpin-loop of nucleotides.
25. The iNA duplex of claim 24 wherein the 5' end of the sense
strand is connected to the 3' end of antisense strand by means of a
hairpin-loop of nucleotides.
26. The iNA duplex of claim 24 wherein the 3' end of the sense
strand is connected to the 5' end of the antisense strand by means
of a hairpin-loop of nucleotides.
27. The iNA duplex of claim 23 wherein the iNA duplex has a length
of at least 30-80 nucleotides.
28. An iNA duplex comprised of two or more sense strands and two or
more antisense strands wherein the antisense strands are annealed
to the sense strands so as to produce one iNA duplex, and wherein
said iNA duplex has a length of at least 30-80 nucleotides.
29. The iNA duplex of claim 28 wherein there is a nick in one or
more of the sense strands or in one or more of the antisense
strands.
30. The iNA duplex of claim 28 wherein the sense and antisense
strands are joined together at one end of each of the strands by
means of a hairpin-loop of nucleotides.
31. The iNA duplex of claim 30 wherein the 5' end of the sense
strand is connected to the 3' end of the antisense strand by means
of a hairpin-loop of nucleotides.
32. The iNA duplex of claim 32 wherein the 3' end of the sense
strand is connected to the 5' end of the antisense strand by means
of a hairpin-loop of nucleotides.
33. A pharmaceutical composition comprised of an iNA duplex having
a sense strand of nucleotides having a 5' end and a 3' end annealed
onto two or more antisense strands of nucleotides each strand
having a 5' end and a 3' end wherein one antisense strand can
target a first mRNA and one antisense strand can target a second
mRNA, or one antisense strand can target one site on an mRNA and
one antisense strand can target another site on said mRNA and
wherein the iNA does not induce an interferon-response when
transfected into a cell, and a pharmaceutically acceptable
excipient.
34. The pharmaceutical composition of claim 33 wherein the first
mRNA encodes a ligand and the second mRNA encodes a receptor to
said ligand.
35. A method for down-regulating an mRNA in a mammal comprising
administering an iNA to said mammal wherein said iNA duplex has a
sense strand of nucleotides having a 5' end and a 3' end annealed
onto two or more antisense strands of nucleotides each strand
having a 5' end and a 3' end wherein one antisense strand can
target a first segment of said mRNA and a second antisense strand
can target a second segment of said mRNA, and wherein the iNA does
not induce an interferon-response when transfected into a cell.
36. The method of claim 35 wherein the mammal is a human.
37. An iNA duplex comprised of two or more sense strands and two or
more antisense strands wherein the antisense strands are annealed
to the sense strands so as to produce one iNA duplex, wherein each
of the antisense strands target different mRNAs or different sites
on one mRNA or different miRNAs and at least one sense strand that
can target an mRNA or miRNA and wherein said iNA duplex has a
length of at least 30-80 nucleotides.
Description
[0001] This claims priority under 35 U.S.C. .sctn.119 (e) of U.S.
Provisional Application Ser. No. 61/069,029 filed Mar. 11, 2008;
U.S. Provisional Application Ser. No. 61/065,844 filed Feb. 16,
2008; U.S. Provisional Application Ser. No. 60/992,695 filed Dec.
5, 2007; and U.S. Provisional Application Ser. No. 60/969,951 filed
Sep. 5, 2007 all the teachings of which are incorporated in their
entirety herein by reference.
BACKGROUND
[0002] All publications, references, patents, patent publications
and patent applications cited herein are each hereby specifically
incorporated by reference in its entirety.
[0003] RNA interference (RNAi) is a form of post-transcriptional
gene silencing in which double-stranded RNA (dsRNA) induces the
enzymatic degradation of homologous messenger RNA (mRNA). When a
long dsRNA enters a cell, an enzyme called Dicer binds and cleaves
long, dsRNA. Cleavage by Dicer results in the production of a small
interfering RNA (iRNA) that is generally 20-25 base pairs in length
and has a 2-nucleotide-long 3' overhang on each strand.
Generically, an interfering RNA is also called an interfering
nucleic acid (iNA), because non-RNA nucleotides can be incorporated
into the construct. One of the two strands of each iNA, generally
the antisense strand, is then incorporated into an RNA-induced
silencing complex (RISC), and pairs with complementary sequences.
RISC first mediates the unwinding of the iNA duplex. A
single-stranded iNA that is coupled to RISC, then binds to a target
mRNA in a sequence-specific manner. The binding mediates target
mRNA cleavage by Slicer, an argonaute protein that is the catalytic
component of RISC. The cleavage of the mRNA prevents translation
from occurring, which prevents the ultimate expression of the gene
from which the mRNA was transcribed.
[0004] As the fragments produced by Dicer are double-stranded, they
could each in theory produce a functional iNA. The strand selected
to be that with a less stable 5' end.
[0005] RNA interference has a tremendous potential in medicinal
therapeutics, such as in anti-viral, oncogenic and
anti-inflammatory applications. The double-stranded iNA may be a
long double-strand designed to be cleaved by Dicer, called Dicer
substrate. Or the iNA may be short and designed to bypass Dicer
serve directly as a RISC substrate. The dsRNAs are synthesized with
a sequence complementary to a gene of interest and introduced into
a cell or organism, where it is recognized as exogenous genetic
material and activates the RNAi pathway. Using this mechanism, RNA
interference can cause a drastic decrease in the expression of a
targeted gene.
Medicine
[0006] RNAi interference can be used to develop a whole new class
of therapeutics. Although it is difficult to introduce long dsRNA
strands into mammalian cells due to the interferon response, the
use of short interfering RNA mimics has been more successful. Among
the first applications to reach clinical trials were in the
treatment of age-related macular degeneration, and respiratory
syncytial virus. Other proposed clinical uses center on antiviral
therapies, including the inhibition of viral gene expression in
cancerous cells, knockdown of host receptors and co-receptors for
HIV, the silencing of hepatitis A, hepatitis B and hepatitis C
genes, silencing of influenza gene expression, and inhibition of
measles viral replication. Potential treatments for
neurodegenerative diseases have also been proposed, with particular
attention being paid to the polyglutamine diseases such as
Huntington's disease. RNA interference is also often seen as a
promising way to treat cancer by silencing genes differentially
up-regulated in tumor cells or genes involved in cell division. A
key area of research in the use of RNAi for clinical applications
is the development of a safe delivery method, which to date has
involved mainly viral vector systems similar to those suggested for
gene therapy.
[0007] Despite the proliferation of promising cell culture studies
for RNAi-based drugs, some concern has been raised regarding the
safety of RNA interference, especially the potential for
"off-target" effects in which a gene with a coincidentally similar
sequence to the targeted gene is also repressed. A computational
genomics study estimated that the error rate of off-target
interactions is about 10%. In mammalian cells, however, the use of
RNAi for targeted gene silencing has been limited due to
nonspecific effects induced by long dsRNAs, which result in
interferon response. Therefore, for applications in mammals, iNAs
had to be designed to be less than 30 based pairs in length to
prevent the PKR response.
[0008] However, in developing a therapeutic drug for a mammal, it
would be desirable to create a long iNA for use in RNAi. An example
of this is an iNA that contains multiple therapeutic targets, such
as a sequence that anneals to an mRNA that produces a ligand and a
sequence that anneals to the mRNA that produces the receptor of the
ligand. However, such a long dsRNA containing two targets would
induce the interferon response resulting in undesirable side
effects to the patient.
[0009] Thus, there is a need to produce iNAs that can target more
than one mRNA or more than one target or subsequence on a single
mRNA.
DESCRIPTION
[0010] The disclosed compounds and processes fill this need by
providing for interfering nucleic acid (iNA) duplexes having
antisense sequences that can target or hybridize to two or more
mRNAs or two or more microRNA (miRNA) or two or more subsequences
of one mRNA or miRNA and which does not induce an interferon
response. The present invention further provides for an iNA having
a discontinuous antisense strand and an intact sense strand. In an
alternative embodiment, the sense strand can be discontinuous and
the antisense strand is intact and the antisense strand can target
two different mRNAs or two different sequences on a single mRNA.
Generally, the iNA is comprised of a sense strand and an antisense
strand in which the total length of the duplex is at least 30
nucleotides in length and one or both of the strands of the iNA
duplex has a nick or a gap in the nucleotide strand. This results
in the segmentation of the sense or antisense strands. The use of
such a long iNA having a segmented sense or antisense strand
unexpectedly results in the lowering of an interferon response in a
mammalian cell that would be predicted when a double-stranded RNA
that has a length of at least 30 nucleotides is introduced into the
cytoplasm of a mammalian cell.
[0011] The present invention further provides for an interfering
nucleic acid (iNA) duplex comprised of a sense strand of
nucleotides having a 5' end and a 3' end annealed onto an antisense
strand of nucleotides having a 5' end and a 3' end wherein the
antisense strand has at least two segments, wherein one segment of
the antisense strand can target a first RNA and another segment of
the antisense strand can target a second RNA, or one segment of the
antisense strand can is a target to a first portion of an RNA and
another segment of the antisense strand is target to a second
portion of said RNA, and wherein the iNA does not induce an
interferon-response when transfected into a cell.
[0012] The present invention further provides for an iNA duplex
comprised of a sense strand of nucleotides, and two or more
antisense strands annealed to the sense strand wherein there is at
least one nucleotide gap or a nick between the antisense strands,
and wherein the iNA duplex has a length of at least 30 nucleotides,
and wherein each antisense strand a has 5' and a 3' end and the
sense strand has a 5' end and a 3' end.
[0013] The disclosed compounds and processes further fill this need
by providing for interfering nucleic acid (iNA) duplexes comprised
of a sense strand and an antisense strand in which one or both of
the strands of the iNA duplex has at least one nick or at least one
nucleotide gap in the nucleotide strand resulting in the
segmentation of the sense or antisense strands such that there are
two or more partial sense strands or two or more partial antisense
strands and at least one of the partial sense strand or partial
antisense strand has a molecular cap attached to at least one
nucleotide of the strand. For example, at the 5' end or 3' end of
at least one of the partial sense strands or partial antisense
strands is a molecular cap covalently bonded to the nucleotide at a
5' or a 3' end of a partial sense or a partial antisense
strand.
[0014] The present invention further provides for n iNA duplex
comprised of a sense strand and an antisense strand, wherein the
antisense strand is annealed to the sense strand, wherein there is
at least one nick or one nucleotide gap in the antisense strand,
and wherein the iNA duplex has a length of at least 30-80
nucleotides and wherein there is at least one nick or at least one
nucleotide gap in the sense strand.
[0015] The present invention further provides for an iNA duplex
comprised of two or more sense strands and two or more antisense
strands wherein the antisense strands are annealed to the sense
strands so as to produce one iNA duplex, and wherein said iNA
duplex has a length of at least 30-80 nucleotides.
[0016] The present invention further provides for a pharmaceutical
composition comprised of an iNA duplex having a sense strand of
nucleotides having a 5' end and a 3'end annealed onto two or more
antisense strands of nucleotides each strand having a 5' end and a
3' end wherein one antisense strand can target a first mRNA and one
antisense strand can target a second mRNA, or one antisense strand
can target one site on an mRNA and one antisense strand can target
another site on said mRNA and wherein the iNA does not induce an
interferon-response when transfected into a cell, and a
pharmaceutically acceptable excipient.
[0017] The present invention further provides for a method for
down-regulating an mRNA in a mammal comprising administering an iNA
to said mammal wherein said iNA duplex has a sense strand of
nucleotides having a 5' end and a 3' end annealed onto two or more
antisense strands of nucleotides each strand having a 5' end and a
3' end wherein one antisense strand can target a first segment of
said mRNA and a second antisense strand can target a second segment
of said mRNA, and wherein the iNA does not induce an
interferon-response when transfected into a cell.
[0018] The present invention further provides for an iNA duplex
comprised of two or more sense strands and two or more antisense
strands wherein the antisense strands are annealed to the sense
strands so as to produce one iNA duplex, wherein each of the
antisense strands target different mRNAs or different sites on one
mRNA or different miRNAs and at least one sense strand that can
target an mRNA or miRNA and wherein said iNA duplex has a length of
at least 30-80 nucleotides.
[0019] The disclosed capped iNA constructs can be designed to take
advantage of the observations that the thermodynamically least
stable 5' end of an iNA construct is preferentially utilized at the
antisense strand in activated RISC. The chemical structures of the
preferred caps are shown in FIG. 14. Compound A in FIG. 14 is
pyrenylmethylpyrrolindol and compound B in FIG. 14 is
trimethoxystilbene. Pyrenylmethylpyrrolindol produces a cap that is
more lipophilic than the cap produced by trimethoxystilbene. Both
of these compounds are phosphoramadites that can be readily
introduced by automated nucleic acid synthesis. The preferred 5'
caps shown in FIG. 14 are described by Narayanan et al., Nucleic
Acid Res. 32:2901-2911 (2004) and sold by Glen Research, Sterling,
Va., USA.
[0020] Preferably each partial sense or antisense strand should be
at least 9 nucleotides long to properly anneal to its complementary
antisense or sense sequence. If it is desired that a particular
partial strand be an available target to an mRNA, then the length
of the partial sequence should be at least 14 nucleotides in length
or more in length.
[0021] This disclosure provides for pharmaceutically acceptable
nucleic acid compositions useful for therapeutic delivery of
nucleic acids and gene-silencing iNAs. In particular, this
invention provides compositions and methods for in vitro and in
vivo delivery of iNAs applicable for decreasing, down regulating,
or silencing the translation of a target nucleic acid sequence or
expression of a gene. These compositions and methods may be used
for prevention and/or treatment of diseases in a mammal. A
therapeutic strategy based on RNAi can be used to treat a wide
range of diseases by shutting down the growth or function of a
virus or microorganism, as well as by shutting down the function of
an endogenous gene product in the pathway of the disease.
[0022] In some embodiments, this invention provides novel
compositions and methods for delivery of RNAi-inducing entities
such as long interfering oligonucleotide molecules having one or
more segmented or partial strands wherein one or more of the
segmented strands is capped by a molecular cap covalently bonded at
the 5' or 3' end of the partial nucleic acid strand. In particular,
this invention further provides for compositions containing an
RNAi-inducing entity that is targeted to one or more transcripts of
a cell, tissue, and/or organ of a subject.
[0023] The iNAs can mediate selective gene silencing in the
mammalian system. Hairpin iNAs, with a short loop and a stem that
has a nick or nucleotide gap in the sense or antisense strands and
a cap at the 5' or 3' end of a segmented strand also selectively
silence expression of genes that are homologous to a sequence in
the double-stranded stem. Mammalian cells can convert hairpin iNA
into iNA to mediate selective gene silencing.
[0024] Preferably each partial sense or antisense strand should be
at least 9 nucleotides long to properly anneal to its complementary
antisense or sense sequence. If it is desired that a particular
partial strand be available as a target to an mRNA, then the length
of the partial sequence should be at least 14 nucleotides in
length, preferably 17-27 nucleotides or more in length.
[0025] It has been surprisingly discovered that when such an iNA
duplex having a length of at least 30 nucleotides and a segmented
sense or antisense strand, is transfected into a mammalian cell,
the expected interferon response is greatly reduced or
undetectable. This allows for the use of iNA duplexes that are
30-80 or more nucleotides in length.
[0026] This disclosure provides pharmaceutically acceptable nucleic
acid compositions useful for therapeutic delivery of nucleic acids
and gene-silencing iNAs. In particular, this invention provides
compositions and methods for in vitro and in vivo delivery of iNAs
decreasing, down-regulating, or silencing the translation of a
target nucleic acid sequence or expression of a gene. These
compositions and methods may be used for prevention and/or
treatment of diseases in a mammal. A therapeutic strategy based on
RNAi can be used to treat a wide range of diseases by shutting down
the growth or function of a virus or microorganism, as well as by
shutting down the function of an endogenous gene product in the
pathway of the disease.
[0027] In some embodiments, this invention provides novel
compositions and methods for delivery of RNAi-inducing entities
such as long interfering oligonucleotide molecules having one or
more segmented strands, and precursors thereof. In particular, this
invention further provides for compositions containing an
RNAi-inducing entity that is targeted to one or more transcripts of
a cell, tissue, and/or organ of a subject.
[0028] The iNAs can mediate selective gene silencing in the
mammalian system. Hairpin iNAs, with a short loop and a stem that
has a length of at least 30 nucleotides and has a nick or
nucleotide gap in the sense or antisense strands also selectively
silence expression of genes that are homologous to a sequence in
the double-stranded stem. Mammalian cells can convert hairpin iNA
into iNA to mediate selective gene silencing.
[0029] By having the ability to transfect a mammalian cell with an
iNA duplex that is 30 nucleotides in length or longer, one can
design iNA duplexes that have an antisense strand that can be
processed to target more than one mRNA. For example, one segment of
the antisense strand could target the mRNA for a ligand while a
second segment of the same antisense strand could target the mRNA
of a receptor or another ligand. Each segment should be at least
16, 17, 18, 19, 20 or 21 nucleotides in length or longer, thus the
length of each iNA duplex will be preferably 32 to 80 nucleotides
in length or longer. In another embodiment, both the sense and
antisense strands can be designed so that one or more segments of
both the sense and antisense strands target one or more mRNAs.
[0030] The iNAs can be delivered as single or multiple
transcription products expressed by a polynucleotide vector
encoding the single or multiple iNAs and directing their expression
within target cells. Typically, the iNA will target a gene that is
expressed at an elevated level as a causal or contributing factor
associated with the subject disease state or adverse condition. In
this context, the iNA will effectively downregulate expression of
the gene to levels that prevent, alleviate, or reduce the severity
or recurrence of one or more associated disease symptoms.
Alternatively, for various distinct disease models where expression
of the target gene is not necessarily elevated as a consequence or
sequel of disease or other adverse condition, down-regulation of
the target gene will nonetheless result in a therapeutic result by
lowering gene expression (i.e., to reduce levels of a selected mRNA
and/or protein product of the target gene). Alternatively, iNAs of
the invention may be targeted to lower expression of one gene,
which can result in upregulation of a "downstream", gene whose
expression is negatively regulated by a product or activity of the
target gene.
DESCRIPTION OF THE DRAWINGS
[0031] FIG. 1 shows the ability of iNA constructs disclosed in the
specification to inhibit the expression of VEGF.
[0032] FIG. 2 shows the ability of iNA constructs disclosed in the
specification to inhibit the expression of KDR.
[0033] FIG. 3 shows the level of interferon.beta.1 (IFN.beta.1)
induced when iNA constructs disclosed in the specification are
transfected into ARPE-19 cells.
[0034] FIG. 4 shows the level of interferon.beta.1 (IFN.beta.1)
induced when iNA constructs disclosed in the specification are
transfected into HUVEC-CS cells.
[0035] FIG. 5 shows the level of OAS1 induced when iNA constructs
disclosed in the specification are transfected into ARPE-19
cells.
[0036] FIG. 6 shows the level of OAS1 induced when iNA constructs
disclosed in the specification are transfected into HUVEC-CS
cells.
[0037] FIG. 7 shows that a long iNA having a segment of the
antisense that targets the VEGF A ligand mRNA and a section of the
antisense strand that targets the KDR VEGF receptor can mRNA can
silence the expression of VEGF A and that iNA constructs that have
sense strand segmentation and anti-sense strand segmentation both
inhibit the expression of VEGF A in ARPE-19 cells.
[0038] FIG. 8 shows that a long iNA having a segment of the
antisense that targets the VEGF A ligand mRNA and a section of the
antisense strand that targets the KDR VEGF receptor can mRNA can
silence the expression of the KDR VEGF receptor and that iNA
constructs that have sense strand segmentation and anti-sense
strand segmentation both inhibit the expression of VEGF A in
HUVEC-CS cells.
[0039] FIG. 9 indicates that the long iNAs having gaps in the sense
strand or gaps in the antisense strand do not induce the expression
of interferon.beta.1 when transfected into ARPE-19 cells.
[0040] FIG. 10 indicates that the long iNAs having gaps in the
sense strand or gaps in the antisense strand do not induce the
expression of interferon.beta.1 when transfected into HUVEC-CS
cells.
[0041] FIG. 11 indicates that the long iNAs having gaps in the
sense strand or gaps in the antisense strand do not induce the
expression of OAS1 expression when transfected into ARPE-19
cells.
[0042] FIG. 12 indicates that the long iNAs having gaps in the
sense strand or gaps in the antisense strand do not induce the
expression of OAS1 expression when transfected into HUVEC-CS
cells.
[0043] FIG. 13 shows two long iNAs each having a nucleotide gap in
the antisense strands, the first antisense strand having a
7-nucleotide gap dividing the antisense strand into two segments,
each segment having 19 nucleotides, and a second iNA having an
antisense strand that has a 3-nucleotide gap dividing the antisense
strand into two segments, each segment having 21 nucleotides.
[0044] FIG. 14 shows the molecular structures of trimethoxystilbene
and pyrenylmethylpyrrolindol two molecular caps that can be
covalently bonded to the 5' end of partial strands in an iNA that
have a nick or nucleotide gap.
[0045] FIG. 15 shows a functional analysis of the knockdown of LacZ
gene expression and of iNAs having a stilbene or pyrrolindol linked
to one or more nucleotides.
[0046] FIG. 16 shows the interferon response of 40 mer iNAs having
nicks or gaps in the sense strand.
[0047] FIG. 17 shows the ability of 40 siRNAs with nicks or gaps in
the sense strand to silence the Lac Z enzyme expression.
[0048] FIG. 18 shows an iNA construct of the present invention that
has nucleotide gaps in the antisense and sense strands
DEFINITIONS
[0049] Definitions of technical terms provided herein should be
construed to include without recitation those meanings associated
with these terms known to those skilled in the art, and are not
intended to limit the scope of the invention.
[0050] The use herein of the terms "a," "an," "the," and similar
terms in describing the invention, and in the claims, are to be
construed to include both the singular and the plural. The terms
"comprising," "having," "including," and "containing" are to be
construed as open-ended terms which mean, for example, "including,
but not limited to."
[0051] Recitation of a range of values herein refers individually
to each and any separate value falling within the range as if it
were individually recited herein, whether or not some of the values
within the range are expressly recited. Specific values employed
herein will be understood as exemplary and not to limit the scope
of the invention.
[0052] As used herein, the term interfering nucleic acid (iNA)
refers to a nucleic acid duplexes having a sense and antisense
strand, which when entered into a RISC complex induces enzymatic
degradation of mRNA. Generally each strand contains predominantly
RNA nucleotides but the strands can contain RNA analogs, RNA and
RNA analogs, RNA and DNA, RNA analogs and DNA, or one strand that
is completely DNA and one strand that is RNA as long as the iNA
construct induces enzymatic degradation of a homologous mRNA.
[0053] As used herein, the term "iNA duplex" is a generic term used
throughout the specification to include interfering nucleic acids
(iNAs), hairpin iNAs which can be cleaved in vivo to form iNAs. The
iNA duplexes herein also include expression vectors (also referred
to as iNA expression vectors) capable of giving rise to transcripts
which form iNA duplexes or hairpin iNAs in cells, and/or
transcripts which can produce iNAs in vivo. Optionally, the iNA
include single strands that form a duplex by a hairpin-loop or
double strands of iNA. The iNA is a double-stranded polynucleotide
molecule comprising self-complementary sense and antisense regions,
wherein the antisense region comprises a nucleotide sequence that
is complementary to a nucleotide sequence in a target ribonucleic
acid molecule for down regulating expression, or a portion thereof.
The sense strand or antisense strand have one or more nicks or
nucleotide. The terminal structure of iNA may be either blunt or
cohesive (overhanging) as long as the iNA can silence the target
mRNA. The cohesive (overhanging) end structure is not limited only
to the 3' overhang, as the 5'overhanging structure may be included
as long as it is capable of inducing the RNAi effect. In addition,
the number of overhanging nucleotides is not limited to the
reported 2 or 3, but can be any number as long as the overhang is
capable of inducing the RNAi effect. For example, the overhang may
be 1 to 8, or 2 to 4 nucleotides.
[0054] As used herein the length of the iNA duplex is determined by
counting the number of nucleotides in the duplex starting at the
first base-pair at the 5' end of the sense strand and ending at the
last base-pair at the 3' end of the sense strand.
[0055] In genetics, microRNAs (miRNA) are single-stranded RNA
molecules of about 21-23 nucleotides in length, which regulate gene
expression. miRNAs are encoded by genes that are transcribed from
DNA but not translated into protein (non-coding RNA); instead they
are processed from primary transcripts known as pri-miRNA to short
stem-loop structures called pre-miRNA and finally to functional
miRNA. Mature miRNA molecules are partially complementary to one or
more messenger RNA (mRNA) molecules, and their main function is to
downregulate gene expression.
[0056] Modified nucleotides in an iNA molecule can be in the
antisense strand, the sense strand, or both. For example, modified
nucleotides can have a Northern conformation (e.g., Northern
pseudorotation cycle, see, for example, Saenger, Principles of
Nucleic Acid Structure, Springer-Verlag ed., 1984). Examples of
nucleotides having a Northern configuration include locked nucleic
acid (LNA) nucleotides (e.g., 2'-O,
4'-C-methylene-(D-ribofuranosyl) nucleotides), 2'-methoxyethoxy
(MOE) nucleotides, 2'-methyl-thio-ethyl, 2'-deoxy-2'-fluoro
nucleotides, 2'-deoxy-2'-chloro nucleotides, 2'-azido nucleotides,
and 2'-O-methyl nucleotides. Chemically modified nucleotides can be
resistant to nuclease degradation while at the same time
maintaining the capacity to mediate RNAi. A conjugate molecule
attached to a chemically-modified iNA molecule is a polyethylene
glycol, human serum albumin, or a ligand for a cellular receptor
that can mediate cellular uptake. Examples of specific conjugate
molecules contemplated by the instant invention that can be
attached to chemically-modified iNA molecules are described in
Vargeese, et al., U.S. Patent Publication No. 20030130186 and U.S.
Patent Publication No. 20040110296, which are each hereby
incorporated by reference in their entirety.
[0057] There are several examples in the art describing sugar, base
and phosphate modifications that can be introduced into nucleic
acid molecules with significant enhancement in their nuclease
stability and efficacy. For example, oligonucleotides are modified
to enhance stability and/or enhance biological activity by
modification with nuclease resistant groups, for example, 2'-amino,
2'-C-allyl, 2'-fluoro, 2'-O-methyl, 2'-O-allyl, 2'-H, nucleotide
base modifications. For a review see Usman and Cedergren, TIBS
17:34, 1992; Usman, et al, Nucleic Acids Symp. Ser. 31:163, 1994;
Burgin, et al, Biochemistry 35:14090, 1996. Sugar modification of
nucleic acid molecules have been extensively described in the art.
See Eckstein et al., International Publication PCT No. WO 92/07065;
Perrault, et al. Nature 344:565-568, 1990; Pieken, et al. Science
253:314-317, 1991; Usman and Cedergren, Trends in Biochem. Sci.
17:334-339, 1992; Usman et al. International Publication PCT No. WO
93/15187; Sproat, U.S. Pat. No. 5,334,711 and Beigelman, et al., J.
Biol. Chem. 270:25702, 1995; Beigelman, et al., International PCT
Publication No. WO 97/26270; Beigelman, et al., U.S. Pat. No.
5,716,824; Usman, et al., U.S. Pat. No. 5,627,053; Woolf, et al.,
International PCT Publication No. WO 98/13526; Thompson, et al.,
Karpeisky, et al, Tetrahedron Lett. 39:1131, 1998; Earnshaw and
Gait, Biopolymers (Nucleic Acid Sciences) 48:39-55, 1998; Verma and
Eckstein, Annu. Rev. Biochem. 67:99-134, 1998; and Burlina, et al.,
Bioorg. Med. Chem. 5:1999-2010, 1997. Such publications describe
general methods and strategies to determine the location of
incorporation of sugar, base and/or phosphate modifications and the
like into nucleic acid molecules without modulating catalysis. In
view of such teachings, similar modifications can be used as
described herein to modify the iNA nucleic acid molecules of the
claimed duplexes so long as the ability of iNA to promote RNAi in
cells is not significantly inhibited.
[0058] The iNA duplexes may contain modified iNA molecules, with
phosphate backbone modifications comprising one or more
phosphorothioate, phosphorodithioate, methylphosphonate,
phosphotriester, morpholino, amidate carbamate, carboxymethyl,
acetamidate, polyamide, sulfonate, sulfonamide, sulfamate,
formacetal, thioformacetal, and/or alkylsilyl, substitutions. For a
review of oligonucleotide backbone modifications, see Hunziker and
Leumann, Nucleic Acid Analogues: Synthesis and Properties, in
Modern Synthetic Methods, VCH, 1995, pp. 331-417, and Mesmaeker, et
al., "Novel Backbone Replacements for Oligonucleotides, in
Carbohydrate Modifications in Antisense Research," ACS, 1994, pp.
24-39. Examples of chemical modifications that can be made in an
iNA include phosphorothioate internucleotide linkages,
2'-deoxyribonucleotides, 2'-O-methyl ribonucleotides,
2'-deoxy-2'-fluoro ribonucleotides, "universal base" nucleotides,
"acyclic" nucleotides, 5-C-methyl nucleotides, and terminal
glyceryl and/or inverted deoxy abasic residue incorporation. The
antisense region of a iNA molecule can include a phosphorothioate
internucleotide linkage at the 3'-end of said antisense region. The
antisense region can comprise about one to about five
phosphorothioate internucleotide linkages at the 5'-end of said
antisense region. The 3'-terminal nucleotide overhangs of a iNA
molecule can include ribonucleotides or deoxyribonucleotides that
are chemically-modified at a nucleic acid sugar, base, or backbone.
The 3'-terminal nucleotide overhangs can include one or more
universal base ribonucleotides. The 3'-terminal nucleotide
overhangs can comprise one or more acyclic nucleotides. For
example, a chemically-modified iNA can have 1, 2, 3, 4, 5, 6, 7, 8,
or more phosphorothioate internucleotide linkages in one strand, or
can have 1 to 8 or more phosphorothioate internucleotide linkages
in each strand. The phosphorothioate internucleotide linkages can
be present in one or both oligonucleotide strands of the iNA
duplex, for example in the sense strand, the antisense strand, or
both strands. In some embodiments, a iNA molecule includes 1, 2, 3,
4, 5, 6, 7, 8, 9, 10, or more purine phosphorothioate
internucleotide linkages in the sense strand, the antisense strand,
or in both strands.
[0059] The iNA molecules, which can be chemically-modified, can be
synthesized by: (a) synthesis of two complementary strands of the
iNA molecule; and (b) annealing the two complementary strands
together under conditions suitable to obtain a double-stranded iNA
molecule. In some embodiments, synthesis of the complementary
portions of the iNA molecule is by solid phase oligonucleotide
synthesis, or by solid phase tandem oligonucleotide synthesis.
[0060] Oligonucleotides (e.g., certain modified oligonucleotides or
portions of oligonucleotides lacking ribonucleotides) are
synthesized using protocols known in the art, for example as
described in Caruthers, et al, Methods in Enzymology 211:3-19,
1992; Thompson, et al., International PCT Publication No. WO
99/54459; Wincott, et al., Nucleic Acids Res. 23:2677-2684, 1995;
Wincott, et al., Methods Mol. Bio. 74:59, 1997; Brennan, et al.,
Biotechnol Bioeng. 61:33-45, 1998; and Brennan, U.S. Pat. No.
6,001,311. Synthesis of RNA, including certain iNA molecules of the
invention, follows general procedures as described, for example, in
Usman, et al., J. Am. Chem. Soc. 109:7845, 1987; Scaringe, et al.,
Nucleic Acids Res. 18:5433, 1990; and Wincott, et al, Nucleic Acids
Res. 23:2677-2684, 1995; Wincott, et al, Methods Mol. Bio. 74:59,
1997. The double-stranded structure may be formed by
self-complementary iNA strand such as occurs for a hairpin RNA or
by annealing of two distinct complementary iNA strands.
[0061] "Overlapping" refers to when two iNA fragments have
sequences which overlap by a plurality of nucleotides on one
strand, for example, where the plurality of nucleotides (nt)
numbers as few as 2-5 nucleotides or by 5-10 nucleotides or
more.
[0062] "One or more iNAs" refers to iNAs that differ from each
other on the basis of primary sequence.
[0063] By "target site" or "target sequence" or "targeted sequence"
is meant a sequence within a target nucleic acid (e.g., RNA) that
is "targeted" for cleavage mediated by an iNA duplex which contains
sequences within its antisense region that are complementary to the
target sequence.
[0064] A nick in a strand is a break in the phosphodiester bond
between two nucleotides in the backbone in one of the strands of
the duplex of the iNA molecule.
[0065] A hybrid iNA molecule is an iNA that is a double-stranded
nucleic acid. Instead of a double-stranded RNA molecule, a hybrid
iNA is comprised of an RNA strand and a DNA strand. Preferably, the
RNA strand is the antisense strand as that is the strand that binds
to the target mRNA. The hybrid iNA created by the hybridization of
the DNA and RNA strands have a hybridized complementary portion and
preferably at least one 3'overhanging end.
[0066] To "modulate gene expression" as used herein is to
up-regulate or down-regulate expression of a target gene, which can
include upregulation or down-regulation of mRNA levels present in a
cell, or of mRNA translation, or of synthesis of protein or protein
subunits, encoded by the target gene.
[0067] The terms "inhibit," "down-regulate," or "reduce
expression," as used herein mean that the expression of the gene,
or level of RNA molecules or equivalent RNA molecules encoding one
or more proteins or protein subunits, or level or activity of one
or more proteins or protein subunits encoded by a target gene, is
reduced below that observed in the absence of the nucleic acid
molecules (e.g., iNA) of the invention.
[0068] "Gene silencing" as used herein refers to partial or
complete inhibition of gene expression in a cell and may also be
referred to as "gene knockdown." The extent of gene silencing may
be determined by methods known in the art, some of which are
summarized in International Publication No. WO 99/32619.
[0069] In some embodiments, iNA molecules comprise separate sense
and antisense sequences or regions, wherein the sense and antisense
regions are covalently linked by nucleotide or non-nucleotide
linker molecules, or are non-covalently linked by ionic
interactions, hydrogen bonding, van der waals interactions,
hydrophobic interactions, and/or stacking interactions.
[0070] The iNAs can be assembled from two separate oligonucleotides
into a duplex, where one strand is the sense strand and the other
is the antisense strand, wherein the antisense and sense strands
are self-complementary (i.e., each strand comprises nucleotide
sequence that is complementary to nucleotide sequence in the other
strand; such as where the antisense strand and sense strand form a
duplex or double stranded structure, for example wherein the duplex
is at least 30 nucleotides in length). The antisense strand may
comprise a nucleotide sequence that is complementary to a
nucleotide sequence in a target nucleic acid molecule or a portion
thereof, and the sense strand may comprise a nucleotide sequence
corresponding to the target nucleic acid sequence or a portion
thereof. Alternatively, the iNA can be assembled from a single
oligonucleotide, where the self-complementary sense and antisense
regions of the iNA are linked by means of a nucleic acid-based or
non-nucleic acid-based linker(s).
[0071] A iNA may be contain a nucleotide, non-nucleotide, or mixed
nucleotide/non-nucleotide linker that joins the sense region of the
iNA to the antisense region of the iNA. In some embodiments, a
nucleotide linker can be 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides in
length. In some embodiments, the nucleotide linker can be a nucleic
acid aptamer. As used herein, the terms "aptamer" or "nucleic acid
aptamer" encompass a nucleic acid molecule that binds specifically
to a target molecule, wherein the nucleic acid molecule contains a
sequence that is recognized by the target molecule in its natural
setting. Alternately, an aptamer can be a nucleic acid molecule
that binds to a target molecule where the target molecule does not
naturally bind to a nucleic acid. For example, the aptamer can be
used to bind to a ligand-binding domain of a protein, thereby
preventing interaction of the naturally occurring ligand with the
protein. See, for example, Gold, et al., Annu. Rev. Biochem.
64:763, 1995; Brody and Gold, J. Biotechnol. 74:5, 2000; Sun, Curr.
Opin. Mol. Ther. 2:100, 2000; Kusser, J. Biotechnol. 74:27, 2000;
Hermann and Patel, Science 287:820, 2000; and Jayasena, Clinical
Chemistry 45:1628, 1999.
[0072] A non-nucleotide linker can be an abasic nucleotide,
polyether, polyamine, polyamide, peptide, carbohydrate, lipid,
polyhydrocarbon, or other polymeric compounds (e.g., polyethylene
glycols such as those having between 2 and 100 ethylene glycol
units). Specific examples include those described by Seela and
Kaiser, Nucleic Acids Res. 18:6353, 1990, and Nucleic Acids Res.
15:3113, 1987; Cload and Schepartz, J. Am. Chem. Soc. 113:6324,
1991; Richardson and Schepartz, J. Am. Chem. Soc. 113:5109, 1991;
Ma, et al., Nucleic Acids Res. 21:2585, 1993, and Biochemistry
32:1751, 1993; Durand, et al., Nucleic Acids Res. 18:6353, 1990;
McCurdy, et al, Nucleosides & Nucleotides 10:287, 1991; Jschke,
et al., Tetrahedron Lett. 34:301, 1993; Ono, et al., Biochemistry
30:9914, 1991; Arnold, et al., International Publication No. WO
89/02439; Usman, et al., International Publication No. WO 95/06731;
Dudycz, et al., International Publication No. WO 95/11910, and
Ferentz and Verdine, J. Am. Chem. Soc. 113:4000, 1991. A
"non-nucleotide linker" refers to a group or compound that can be
incorporated into a nucleic acid chain in the place of one or more
nucleotide units, including either sugar and/or phosphate
substitutions, and allows the remaining bases to exhibit their
enzymatic activity. The group or compound can be abasic in that it
does not contain a commonly recognized nucleotide base, such as
adenosine, guanine, cytosine, uracil or thymine, for example at the
C1 position of the sugar.
[0073] The term "biodegradable linker" as used herein, refers to a
nucleic acid or non-nucleic acid linker molecule that is designed
as a biodegradable linker to connect one molecule to another
molecule, for example, a biologically active molecule to a iNA
molecule or the sense and antisense strands of a iNA molecule. The
biodegradable linker is designed such that its stability can be
modulated for a particular purpose, such as delivery to a
particular tissue or cell type. The stability of a nucleic
acid-based biodegradable linker molecule can be variously
modulated, for example, by combinations of ribonucleotides,
deoxyribonucleotides, and chemically-modified nucleotides, such as
2'-O-methyl, 2'-fluoro, 2'-amino, 2'-O-amino, 2'-C-allyl,
2'-O-allyl, and other 2'-modified or base modified nucleotides. The
biodegradable nucleic acid linker molecule can be a dimer, trimer,
tetramer or longer nucleic acid molecule, for example, an
oligonucleotide of about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13,
14, 15, 16, 17, 18, 19, or 20 nucleotides in length, or can
comprise a single nucleotide with a phosphorus-based linkage, for
example, a phosphoramidate or phosphodiester linkage. The
biodegradable nucleic acid linker molecule can also comprise
nucleic acid backbone, nucleic acid sugar, or nucleic acid base
modifications.
[0074] By "antisense nucleic acid", it is meant a non-enzymatic
nucleic acid molecule that binds to target RNA by means of RNA-RNA
or RNA-DNA or RNA-PNA (protein nucleic acid; Egholm et al., 1993
Nature 365, 566) interactions and alters the activity of the target
RNA (for a review, see Stein and Cheng, 1993 Science 261, 1004 and
Woolf et al., U.S. Pat. No. 5,849,902). Typically, antisense
molecules are complementary to a target sequence along a single
contiguous sequence of the antisense molecule. However, in certain
embodiments, an antisense molecule can bind to substrate such that
the substrate molecule forms a loop, and/or an antisense molecule
can bind such that the antisense molecule forms a loop. Thus, the
antisense molecule can be complementary to two (or even more)
non-contiguous substrate sequences or two (or even more)
non-contiguous sequence portions of an antisense molecule can be
complementary to a target sequence or both. In addition, antisense
DNA can be used to target RNA by means of DNA-RNA interactions,
thereby activating RNase H, which digests the target RNA in the
duplex. The antisense oligonucleotides can comprise one or more
RNAse H activating region, which is capable of activating RNAse H
cleavage of a target RNA. Antisense DNA can be synthesized
chemically or expressed via the use of a single stranded DNA
expression vector or equivalent thereof. "Antisense RNA" is an RNA
strand having a sequence complementary to a target gene mRNA, that
can induce RNAi by binding to the target gene mRNA. Antisense RNA"
is an RNA strand having a sequence complementary to a target gene
mRNA, and thought to induce RNAi by binding to the target gene
mRNA. "Sense RNA" has a sequence complementary to the antisense
RNA, and annealed to its complementary antisense RNA to form iNA.
These antisense and sense RNAs have been conventionally synthesized
with an RNA synthesizer.
[0075] "Nucleic acid" refers to deoxyribonucleotides or
ribonucleotides and polymers thereof in single- or double-stranded
form. The term encompasses nucleic acids containing known
nucleotide analogs or modified backbone residues or linkages, which
are synthetic, naturally occurring, and non-naturally occurring,
which have similar binding properties as the reference nucleic
acid, and which are metabolized in a manner similar to the
reference nucleotides. Examples of such analogs include, without
limitation, phosphorothioates, phosphoramidates, methyl
phosphonates, chiral-methyl phosphonates, 2'-O-methyl
ribonucleotides, peptide-nucleic acids (PNAs).
[0076] By "RNA" is meant a molecule comprising at least one
ribonucleotide residue. By "ribonucleotide" is meant a nucleotide
with a hydroxyl group at the 2' position of a .beta.D-ribo-furanose
moiety. The terms include double-stranded RNA, single-stranded RNA,
isolated RNA such as partially purified RNA, essentially pure RNA,
synthetic RNA, recombinantly produced RNA, as well as altered RNA
that differs from naturally occurring RNA by the addition,
deletion, substitution and/or alteration of one or more
nucleotides. Such alterations can include addition of
non-nucleotide material, such as to the end(s) of the iNA or
internally, for example at one or more nucleotides of the RNA.
Nucleotides in the RNA molecules of the instant invention can also
comprise non-standard nucleotides, such as non-naturally occurring
nucleotides or chemically synthesized nucleotides or
deoxynucleotides. These altered RNAs can be referred to as analogs
or analogs of naturally-occurring RNA. As used herein, the terms
"ribonucleic acid" and "RNA" refer to a molecule containing at
least one ribonucleotide residue. A ribonucleotide is a nucleotide
with a hydroxyl group at the 2' position of a
.beta.-D-ribo-furanose moiety. These terms include double-stranded
RNA, single-stranded RNA, isolated RNA such as partially purified
RNA, essentially pure RNA, synthetic RNA, recombinantly produced
RNA, as well as modified and altered RNA that differs from
naturally occurring RNA by the addition, deletion, substitution,
modification, and/or alteration of one or more nucleotides.
Alterations of an RNA can include addition of non-nucleotide
material, such as to the end(s) of a iNA or internally, for example
at one or more nucleotides of an RNA nucleotides in an RNA molecule
include non-standard nucleotides, such as non-naturally occurring
nucleotides or chemically synthesized nucleotides or
deoxynucleotides. These altered RNAs can be referred to as
analogs.
[0077] By the term "non-nucleotide" is meant any group or compound
which can be incorporated into a nucleic acid chain in the place of
one or more nucleotide units, including either sugar and/or
phosphate substitutions, and allows the remaining bases to exhibit
their enzymatic activity. The group or compound is abasic in that
it does not contain a commonly recognized nucleotide base, such as
adenosine, guanine, cytosine, uracil or thymine and therefore lacks
a base at the 1'-position.
[0078] By "nucleotide" as used herein is as recognized in the art
to include natural bases (standard), and modified bases well known
in the art. Such bases are generally located at the 1' position of
a nucleotide sugar moiety. Nucleotides generally comprise a base,
sugar and a phosphate group. The nucleotides can be unmodified or
modified at the sugar, phosphate and/or base moiety, (also referred
to interchangeably as nucleotide analogs, modified nucleotides,
non-natural nucleotides, non-standard nucleotides and other; see,
for example, Usman and McSwiggen, supra; Eckstein, et al.,
International PCT Publication No. WO 92/07065; Usman, et al,
International PCT Publication No. WO 93/15187; Uhlman & Peyman,
supra, all are hereby incorporated by reference herein). There are
several examples of modified nucleic acid bases known in the art as
summarized by Limbach, et al, Nucleic Acids Res. 22:2183, 1994.
Some of the non-limiting examples of base modifications that can be
introduced into nucleic acid molecules include, inosine, purine,
pyridin-4-one, pyridin-2-one, phenyl, pseudouracil,
2,4,6-trimethoxy benzene, 3-methyl uracil, dihydrouridine,
naphthyl, aminophenyl, 5-alkylcytidines (e.g., 5-methylcytidine),
5-alkyluridines (e.g., ribothymidine), 5-halouridine (e.g.,
5-bromouridine) or 6-azapyrimidines or 6-alkylpyrimidines (e.g.
6-methyluridine), propyne, and others (Burgin, et al., Biochemistry
35:14090, 1996; Uhlman & Peyman, supra). By "modified bases" in
this aspect is meant nucleotide bases other than adenine, guanine,
cytosine and uracil at 1' position or their equivalents.
[0079] As used herein complementary nucleotide bases are a pair of
nucleotide bases that form hydrogen bonds with each other. Adenine
(A) pairs with thymine (T) or with uracil (U) in RNA, and guanine
(G) pairs with cytosine (C). Complementary segments or strands of
nucleic acid that hybridize (join by hydrogen bonding) with each
other. By "complementarity" is meant that a nucleic acid can form
hydrogen bond(s) with another nucleic acid sequence either by
traditional Watson-Crick or by other non-traditional modes of
binding.
[0080] The sense strand of a double stranded iNA molecule may have
a terminal cap moiety such as an inverted deoxyabasic moiety, at
the 3'-end, 5'-end, or both 3' and 5'-ends of the sense strand.
[0081] By "cap structure" is meant chemical modifications, which
have been incorporated at either terminus of the oligonucleotide
(see, for example, Adamic, et al, U.S. Pat. No. 5,998,203,
incorporated by reference herein). These terminal modifications
protect the nucleic acid molecule from exonuclease degradation, and
may help in delivery and/or localization within a cell. The cap may
be present at the 5'-terminus (5'-cap) or at the 3'-terminal
(3'-cap) or may be present on both termini. In non-limiting
examples, the 5'-cap includes, but is not limited to, glyceryl,
inverted deoxy abasic residue (moiety); 4',5'-methylene nucleotide;
1-(beta-D-erythrofuranosyl) nucleotide, 4'-thio nucleotide;
carbocyclic nucleotide; 1,5-anhydrohexitol nucleotide;
L-nucleotides; alpha-nucleotides; modified base nucleotide;
phosphorodithioate linkage; threo-pentofuranosyl nucleotide;
acyclic 3',4'-seco nucleotide; acyclic 3,4-dihydroxybutyl
nucleotide; acyclic 3,5-dihydroxypentyl nucleotide, 3'-3'-inverted
nucleotide moiety; 3'-3'-inverted abasic moiety; 3'-2'-inverted
nucleotide moiety; 3'-2'-inverted abasic moiety; 1,4-butanediol
phosphate; 3'-phosphoramidate; hexylphosphate; aminohexyl
phosphate; 3'-phosphate; 3'-phosphorothioate; phosphorodithioate;
or bridging or non-bridging methylphosphonate moiety stillben and
pyrene.
[0082] Examples of the 3'-cap include, but are not limited to,
glyceryl, inverted deoxy abasic residue (moiety), 4',5'-methylene
nucleotide; 1-(beta-D-erythrofuranosyl) nucleotide; 4'-thio
nucleotide, carbocyclic nucleotide; 5'-amino-alkyl phosphate;
1,3-diamino-2-propyl phosphate; 3-aminopropyl phosphate;
6-aminohexyl phosphate; 1,2-aminododecyl phosphate; hydroxypropyl
phosphate; 1,5-anhydrohexitol nucleotide; L-nucleotide;
alpha-nucleotide; modified base nucleotide; phosphorodithioate;
threo-pentofuranosyl nucleotide; acyclic 3',4'-seco nucleotide;
3,4-dihydroxybutyl nucleotide; 3,5-dihydroxypentyl nucleotide,
5'-5'-inverted nucleotide moiety; 5'-5'-inverted abasic moiety;
5'-phosphoramidate; 5'-phosphorothioate; 1,4-butanediol phosphate;
5'-amino; bridging and/or non-bridging 5'-phosphoramidate,
phosphorothioate and/or phosphorodithioate, bridging or non
bridging methylphosphonate and 5'-mercapto moieties (for more
details see Beaucage and Lyer, Tetrahedron 49:1925, 1993) and
stillben and pyrene.
[0083] An "asymmetric hairpin" as used herein is a linear iNA
molecule comprising an antisense region, a loop portion that can
comprise nucleotides or non-nucleotides, and a sense region that
comprises fewer nucleotides than the antisense region to the extent
that the sense region has enough complementary nucleotides to base
pair with the antisense region and form a duplex with loop.
[0084] An "asymmetric duplex" as used herein is an iNA molecule
having two separate strands comprising a sense region and an
antisense region, wherein the sense region comprises fewer
nucleotides than the antisense region to the extent that the sense
region has enough complementary nucleotides to base pair with the
antisense region and form a duplex.
[0085] Formulations and Administration
The RNAi-inducing compound of this invention can be administered in
conjunction with other known treatments for a disease
condition.
[0086] Comparable methods and compositions are provided that target
expression of one or more different genes associated with a
particular disease condition in a subject, including any of a large
number of genes whose expression is known to be aberrantly
increased as a causal or contributing factor associated with the
selected disease condition.
[0087] Supplemental or complementary methods for delivery of
nucleic acid molecules for use within then invention are described,
for example, in Akhtar et al., Trends Cell Bio. 2:139, 1992;
"Delivery Strategies for Antisense Oligonucleotide Therapeutics,"
ed. Akhtar, 1995, Maurer et al., Mol. Membr. Biol. 16:129-140,
1999; Hofland and Huang, Handb. Exp. Pharmacol. 13 7:165-192, 1999;
and Lee et al., ACS Symp. Ser. 752:184-192, 2000. Sullivan, et al.,
International PCT Publication No. WO 94/02595, further describes
general methods for delivery of enzymatic nucleic acid
molecules.
[0088] Nucleic acid molecules can be administered within
formulations that include one or more additional components, such
as a pharmaceutically acceptable carrier, diluent, excipient,
adjuvant, emulsifier, buffer, stabilizer, or preservative.
[0089] As used herein, the term "carrier" means a pharmaceutically
acceptable solid or liquid filler, diluent or encapsulating
material. A water-containing liquid carrier can contain
pharmaceutically acceptable additives such as acidifying agents,
alkalizing agents, antimicrobial preservatives, antioxidants,
buffering agents, chelating agents, complexing agents, solubilizing
agents, humectants, solvents, suspending and/or
viscosity-increasing agents, tonicity agents, wetting agents or
other biocompatible materials. Examples of ingredients of the above
categories can be found in the U.S. Pharmacopeia National
Formulary, 1990, pp. 1857-1859, as well as in Raymond C. Rowe, et
al., Handbook of Pharmaceutical Excipients, 5th ed., 2006, and
"Remington: The Science and Practice of Pharmacy," 21st ed., 2006,
editor David B. Troy.
[0090] Examples of preservatives include phenol, methyl paraben,
paraben, m-cresol, thiomersal, benzylalkonium chloride, and
mixtures thereof.
[0091] Examples of surfactants include oleic acid, sorbitan
trioleate, polysorbates, lecithin, phosphotidylcholines, various
long chain diglycerides and phospholipids, and mixtures
thereof.
[0092] Examples of phospholipids include phosphatidylcholine,
lecithin, phosphatidylglycerol, phosphatidylinositol,
phosphatidylserine, and phosphatidylethanolamine, and mixtures
thereof.
[0093] Examples of dispersants include ethylenediaminetetraacetic
acid.
[0094] Examples of gases include nitrogen, helium,
chlorofluorocarbons (CFCs), hydrofluorocarbons (HFCs), carbon
dioxide, air, and mixtures thereof.
In certain embodiments, the iNA and/or the polypeptide can be
encapsulated in liposomes, administered by iontophoresis, or
incorporated into other vehicles, such as hydrogels, cyclodextrins,
biodegradable nanocapsules, bioadhesive microspheres, or
proteinaceous vectors (see e.g., O'Hare and Normand, International
PCT Publication No. WO 00/53722). Alternatively, a nucleic acid
composition can be locally delivered by direct injection or by use
of an infusion pump. Direct injection of the nucleic acid molecules
of the invention, whether subcutaneous, intramuscular, or
intradermal, can take place using standard needle and syringe
methodologies, or by needle-free technologies such as those
described in Conry et al., Clin. Cancer Res. 5:2330-2337, 1999, and
Barry et al., International PCT Publication No. WO 99/31262.
[0095] The compositions of this invention can be effectively
employed as pharmaceutical agents. Pharmaceutical agents prevent,
modulate the occurrence or severity of, or treat (alleviate one or
more symptom(s) to a detectable or measurable extent) of a disease
state or other adverse condition in a patient.
[0096] In some embodiments, this invention provides pharmaceutical
compositions and methods featuring the presence or administration
of one or more polynucleic acid(s), typically one or more iNAs,
combined, complexed, or conjugated with a lipid, which may further
be formulated with a pharmaceutically-acceptable carrier, such as a
diluent, stabilizer, or buffer.
[0097] The iNAs of the present invention may be administered in any
form, for example transdermally or by local injection (e.g., local
injection at sites of psoriatic plaques to treat psoriasis, or into
the joints of patients afflicted with psoriatic arthritis or RA).
In more detailed embodiments, the invention provides formulations
and methods to administer therapeutically effective amounts of iNAs
directed against of a mRNA of TNF-.alpha., which effectively
down-regulate the TNF-.alpha. RNA and thereby reduce or prevent one
or more TNF-.alpha.-associated inflammatory condition(s).
Comparable methods and compositions are provided that target
expression of one or more different genes associated with a
selected disease condition in animal subjects, including any of a
large number of genes whose expression is known to be aberrantly
increased as a causal or contributing factor associated with the
selected disease condition.
[0098] The compositions of the present invention may also be
formulated and used as tablets, capsules or elixirs for oral
administration, suppositories for rectal administration, sterile
solutions, suspensions for injectable administration, and the other
forms known in the art.
[0099] A pharmacological composition or formulation refers to a
composition or formulation in a form suitable for administration,
e.g., systemic administration, into a cell or patient, including
for example a human. Suitable forms, in part, depend upon the use
or the route of entry, for example oral, transdermal,
transepithelial, or by injection. Such forms should not prevent the
composition or formulation from reaching a target cell (i.e., a
cell to which the negatively charged nucleic acid is desirable for
delivery). For example, pharmacological compositions injected into
the blood stream should be soluble. Other factors are known in the
art, and include considerations such as toxicity.
[0100] The iNA molecules can be complexed with cationic lipids,
packaged within liposomes, or otherwise delivered to target cells
or tissues. The nucleic acid or nucleic acid complexes can be
locally administered to through injection, infusion pump or stent,
with or without their incorporation in biopolymers. In another
embodiment, polyethylene glycol (PEG) can be covalently attached to
iNA compounds of the present invention, to the polypeptide, or
both. The attached PEG can be any molecular weight, preferably from
about 2,000 to about 50,000 daltons (Da).
[0101] By "systemic administration" is meant in vivo systemic
absorption or accumulation of drugs in the blood stream followed by
distribution throughout the entire body. Administration routes
which lead to systemic absorption include, without limitation:
intravenous, subcutaneous, intraperitoneal, inhalation, oral,
intrapulmonary and intramuscular.
[0102] Examples of agents suitable for formulation with the nucleic
acid molecules of this invention include: P-glycoprotein inhibitors
(such as Pluronic P85), which can enhance entry of drugs into the
CNS (Jolliet-Riant and Tillement, Fundam. Clin. Pharmacol.
13:16-26, 1999); biodegradable polymers, such as poly
(DL-lactide-coglycolide) microspheres for sustained release
delivery after intracerebral implantation (Emerich, D. F., et al.,
Cell Transplant 8:47-58, 1999, Alkermes, Inc., Cambridge, Mass.);
and loaded nanoparticles, such as those made of
polybutylcyanoacrylate, which can deliver drugs across the blood
brain barrier and can alter neuronal uptake mechanisms (Prog.
Neuropsychopharmacol Biol. Psychiatry 23:941-949, 1999). Other
examples of delivery strategies for the nucleic acid molecules of
the instant invention include material described in Boado, et al.,
J. Pharm. Sci. 87:1308-1315, 1998; Tyler, et al., FEBS Lett.
421:280-284, 1999; Pardridge, et al., PNAS USA. 92:5592-5596, 1995;
Boado, Adv. Drug Delivey Rev. 15:73-107, 1995; Aldrian-Herrada et
al., Nucleic Acids Res. 26:4910-4916, 1998; and Tyler, et al., PNAS
USA. 96:7053-7058, 1999.
[0103] The present invention also includes compositions prepared
for storage or administration, which include a pharmaceutically
effective amount of the desired compounds in a pharmaceutically
acceptable carrier or diluent. Acceptable carriers or diluents for
therapeutic use are well known in the pharmaceutical art, and are
described, for example, in Remington's Pharmaceutical Sciences,
Mack Publishing Co. (A. R. Gennaro ed. 1985). For example,
preservatives, stabilizers, dyes and flavoring agents may be
provided. These include sodium benzoate, sorbic acid and esters of
p-hydroxybenzoic acid. In addition, antioxidants and suspending
agents may be used.
[0104] A pharmaceutically effective dose is that dose required to
prevent, inhibit the occurrence of, treat, or alleviate a symptom
to some extent of a disease state. An amount of from 0.01 mg/kg to
50 mg/kg body weight/day of active nucleic acid should be
administered.
[0105] Aqueous suspensions contain the active materials in
admixture with excipients suitable for the manufacture of aqueous
suspensions. Such excipients are suspending agents, for example
sodium carboxymethylcellulose, methylcellulose,
hydropropyl-methylcellulose, sodium alginate, polyvinylpyrrolidone,
gum tragacanth and gum acacia; dispersing or wetting agents can be
a naturally-occurring phosphatide, for example, lecithin, or
condensation products of an alkylene oxide with fatty acids, for
example polyoxyethylene stearate, or condensation products of
ethylene oxide with long chain aliphatic alcohols, for example
heptadecaethyleneoxycetanol, or condensation products of ethylene
oxide with partial esters derived from fatty acids and a hexitol
such as polyoxyethylene sorbitol monooleate, or condensation
products of ethylene oxide with partial esters derived from fatty
acids and hexitol anhydrides, for example polyethylene sorbitan
monooleate. The aqueous suspensions can also contain one or more
preservatives, for example ethyl, or n-propyl p-hydroxybenzoate,
one or more coloring agents, one or more flavoring agents, and one
or more sweetening agents, such as sucrose or saccharin.
[0106] Oily suspensions can be formulated by suspending the active
ingredients in a vegetable oil, for example arachis oil, olive oil,
sesame oil or coconut oil, or in a mineral oil such as liquid
paraffin. The oily suspensions can contain a thickening agent, for
example beeswax, hard paraffin or cetyl alcohol. Sweetening agents
and flavoring agents can be added to provide palatable oral
preparations. These compositions can be preserved by the addition
of an anti-oxidant such as ascorbic acid.
[0107] Dispersible powders and granules suitable for preparation of
an aqueous suspension by the addition of water provide the active
ingredient in admixture with a dispersing or wetting agent,
suspending agent and one or more preservatives. Additional
excipients, for example sweetening, flavoring and coloring agents,
can also be present.
[0108] Pharmaceutical compositions of the invention can also be in
the form of oil-in-water emulsions. The oily phase can be a
vegetable oil or a mineral oil or mixtures of these. Suitable
emulsifying agents can be naturally-occurring gums, for example gum
acacia or gum tragacanth, naturally-occurring phosphatides, for
example soy bean, lecithin, and esters or partial esters derived
from fatty acids and hexitol, anhydrides, for example sorbitan
monooleate, and condensation products of the said partial esters
with ethylene oxide, for example polyoxyethylene sorbitan
monooleate. The emulsions can also contain sweetening and flavoring
agents.
[0109] The pharmaceutical compositions can be in the form of a
sterile injectable aqueous or oleaginous suspension. This
suspension can be formulated according to the known art using those
suitable dispersing or wetting agents and suspending agents that
have been mentioned above. The sterile injectable preparation can
also be a sterile injectable solution or suspension in a non-toxic
parentally acceptable diluent or solvent, for example as a solution
in 1,3-butanediol. Among the acceptable vehicles and solvents that
can be employed are water, Ringer's solution and isotonic sodium
chloride solution. In addition, sterile, fixed oils are
conventionally employed as a solvent or suspending medium. For this
purpose, any bland fixed oil can be employed including synthetic
mono- or diglycerides. In addition, fatty acids such as oleic acid
find use in the preparation of injectables.
[0110] The iNAs can also be administered in the form of
suppositories, e.g., for rectal administration of the drug. These
compositions can be prepared by mixing the drug with a suitable
non-irritating excipient that is solid at ordinary temperatures but
liquid at the rectal temperature and will therefore melt in the
rectum to release the drug. Such materials include cocoa butter and
polyethylene glycols.
[0111] Methods for the delivery of nucleic acid molecules are
described in Akhtar, et al., Trends Cell Bio. 2:139, 1992;
"Delivery Strategies for Antisense Oligonucleotide Therapeutics,"
ed. Akhtar, 1995; Maurer, et al., Mol. Membr. Biol. 16:129-140,
1999; Hofland and Huang, Handb. Exp. Pharmacol. 137:165-192, 1999;
and Lee, et al., ACS Symp. Ser. 752:184-192, 2000. Beigelman, et
al., U.S. Pat. No. 6,395,713, and Sullivan et al., PCT WO 94/02595
further describe the general methods for delivery of nucleic acid
molecules. These protocols can be utilized for the delivery of
virtually any nucleic acid molecule. Nucleic acid molecules can be
administered to cells by a variety of methods known to those of
skill in the art, including, but not restricted to, encapsulation
in liposomes, by iontophoresis, or by incorporation into other
vehicles, such as biodegradable polymers, hydrogels, cyclodextrins
(see for example, Gonzalez, et al., Bioconjugate Chem.
10:1068-1074, 1999; Wang, et al., International PCT Publication
Nos. WO 03/47518 and WO 03/46185), poly(lactic-co-glycolic)acid
(PLGA) and PLCA microspheres (see for example U.S. Pat. No.
6,447,796 and U.S. Patent Application Publication No. US
2002130430), biodegradable nanocapsules, and bioadhesive
microspheres, or by proteinaceous vectors (O'Hare and Normand,
International PCT Publication No. WO 00/53722). Alternatively, the
nucleic acid/vehicle combination is locally delivered by direct
injection or by use of an infusion pump. Direct injection of the
nucleic acid molecules of the invention, whether subcutaneous,
intramuscular, or intradermal, can take place using standard needle
and syringe methodologies, or by needle-free technologies such as
those described in Conry, et al., Clin. Cancer Res. 5:2330-2337,
1999, and Barry, et al., International PCT Publication No. WO
99/31262. The molecules of the instant invention can be used as
pharmaceutical agents. Pharmaceutical agents prevent, modulate the
occurrence, or treat (alleviate a symptom to some extent,
preferably all of the symptoms) of a disease state in a
subject.
[0112] Determining the Length of an iNA Duplex
As stated above, the length of the iNA duplex is determined by
counting the number of nucleotides in the duplex starting at the
first base-pair at the 5' end of the sense strand and ending at the
last base-pair at the 3' end of the sense strand regardless of any
nicks or nucleotide gaps between the first and last base pairs.
Designing of iNA Duplexes Targeting Multiple mRNAs
[0113] Because the claimed iNA duplexes are at least 30 nucleotides
in length and do not induce an interferon response when transfected
into mammalian cells, iNA duplexes can be effectively designed that
target two or more mRNA transcripts. One segment of the antisense
can be complementary to one mRNA transcript and another segment of
the antisense strand can be complementary to another mRNA.
Furthermore, the sense strand can be designed so that one or more
segments are long enough to enter RISC and bind to a target
mRNA.
[0114] The examples given herein, and the exemplary language used
herein are solely for the purpose of illustration, and are not
intended to limit the scope of the invention.
[0115] While this invention has been described in relation to
certain embodiments, and many details have been set forth for
purposes of illustration, it will be apparent to those skilled in
the art that this invention includes additional embodiments, and
that some of the details described herein may be varied
considerably without departing from this invention. This invention
includes such additional embodiments, modifications and
equivalents. In particular, this invention includes any combination
of the features, terms, or elements of the various illustrative
components and examples.
Example 1
An iNA Having a Segmented Sense Strand a First Segment of the
Antisense Strand Targeted to KDR mRNA and a Second Segment of the
Antisense Strand Targeted to the VEGF A mRNA
[0116] The following constructs illustrate the design of single iNA
that target multiple mRNAs that encode polypeptides associated with
angiogenesis.
Design of KV-1A iNA Targeting KDR-54 and VEGF A-11
[0117] SEQ ID NO: 1 shows an antisense sequence of an iNA that has
a first 3'-segment (refer to anti-sense strand) that can to and
target an mRNA that encodes VEGF, and a second 5'-segment (refer to
anti-sense strand) that can anneal to and target an mRNA that
encodes the receptor KDR.
TABLE-US-00001 (SEQ ID NO: 1) 5'
UUCUACAUCACUGAGGGACdTdTcucAUUUACACGUCUGCGGAUCUU 3'
[0118] SEQ ID NO:2 is a sense nucleotide sequence that anneals to a
the segment of the antisense sequence SEQ ID NO:1 that targets the
KDR mRNA.
TABLE-US-00002 KV-1KS: GUCCCUCAGUGAUGUAGAAdTdT (SEQ ID NO: 2)
[0119] SEQ ID NO:3 is a sense nucleotide sequence that anneals to a
the segment of the antisense sequence SEQ ID NO: 1 that targets the
VEGF mRNA.
TABLE-US-00003 KV-1VS: AAGAUCCGCAGACGUGUAAAU (SEQ ID NO: 3)
[0120] Using SEQ ID NOs: 1-3 the following iNA duplex was made (iNA
Duplex VEGF A-11 and KDR-54 iNA)
TABLE-US-00004 (SEQ ID NO: 3) 5'AAGAUCCGCAGACGUGUAAAU (SEQ ID NO:
2) GUCCCUCAGUGAUGUAGAATT 3' (SEQ ID NO: 1)
3'UUCUAGGCGUCUGCACAUUUACUCTTCAGGGAGUCACUACAUCUU 5'
Example 2
An iNA Having a First 3'-Segment of the Antisense Strand Targeted
to KDR mRNA and a Second 5'-Segment of the Antisense Strand
Targeted to the VEGF A mRNA
[0121] KV-1B iNA (KDR-54+VEGF A-11):
SEQ ID NO: 4 shows an antisense sequence of an iNA that has a
3'-first segment that can to and target an mRNA that encodes VEGF,
and a second 5'-segment that can anneal to and target an mRNA that
encodes the receptor KDR.
TABLE-US-00005 (SEQ ID NO: 4)
UUCUACAUCACUGAGGGACUUcucAUUUACACGUCUGCGGAUCUU
[0122] SEQ ID NO:5 is a sense nucleotide sequence that anneals to a
the segment of the antisense sequence SEQ ID NO:4 that targets the
KDR mRNA.
TABLE-US-00006 KV-1KS: GUCCCUCAGUGAUGUAGAAdTdT (SEQ ID NO: 5)
[0123] SEQ ID NO:6 is a sense nucleotide sequence that anneals to a
the segment of the antisense sequence SEQ ID NO:4 that targets the
VEGF mRNA.
TABLE-US-00007 KV-1VS: AAGAUCCGCAGACGUGUAAAU (SEQ ID NO: 6)
[0124] Using SEQ ID NOs: 4-6 the following iNA duplex was made
KV-1B iNA (KDR-54+VEGF A-11)
TABLE-US-00008 (SEQ ID NO: 6) 5' AAGAUCCGCAGACGUGUAAAU (SEQ ID NO:
5) GUCCCUCAGUGAUGUAGAATT 3' (SEQ ID NO: 4) 3'
UUCUAGGCGUCUGCACAUUUACUCUUCAGGGAGUCACUACAUCUU 5'
Example 3
An iNA Having a First 5'-Segment of the Antisense Strand Targeted
to KDR mRNA and a Second 3'-Segment of the Antisense Strand
Targeted to the VEGF A mRNA
[0125] SEQ ID NO: 7 shows an antisense sequence of an iNA that has
a first 3'-segment that can to and target an mRNA that encodes
VEGF, and a second 5'-segment that can anneal to and target an mRNA
that encodes the receptor KDR.
TABLE-US-00009 KV-2 (KDR-18 + VEGF A-12): (SEQ ID NO: 7)
UGUUGCUCCUUCUUUCAACdAdTuuuUUUGCAGGAACAUUUACACGU
[0126] SEQ ID NO:8 is a sense nucleotide sequence that anneals to a
the segment of the antisense sequence SEQ ID NO:7 that targets the
KDR mRNA.
TABLE-US-00010 KV-2KS: GUUGAAAGAAGGAGCAACAdTdT (SEQ ID NO: 8)
[0127] SEQ ID NO:9 is a sense nucleotide sequence that anneals to a
the segment of the antisense sequence SEQ ID NO:7 that targets the
VEGF mRNA.
TABLE-US-00011 KV-2VS: ACGUGUAAAUGUUCCUGCAAA (SEQ ID NO: 9)
Using SEQ ID NOs: 7-9 the following iNA duplex was made KV-1B iNA
(KDR-18+VEGF A-12)
TABLE-US-00012 (SEQ ID NO: 9) 5' ACGUGUAAAUGUUCCUGCAAA (SEQ ID NO:
8) GUUGAAAGAAGGAGCAACATT 3' (SEQ ID NO: 7) 3'
UGCACAUUUACAAGGACGUUUUUUTACAACUUUCUUCCUCGUUGU 5'
Example 4
An iNA Having a First 5'-Segment of the Antisense Strand Targeted
to KDR mRNA and a Second 3'-Segment of the Antisense Strand
Targeted to the VEGF A mRNA
[0128] KV-3 (KDR-25+VEGF A-14):
SEQ ID NO: 10 shows an antisense sequence of an iNA that has a
first 3'-segment that can to and target an mRNA that encodes VEGF,
and a second 5'-segment that can anneal to and target an mRNA that
encodes the receptor KDR.
TABLE-US-00013 KV-3AS: (SEQ ID NO: 10)
UUCAAAUGUUUUUACACUCdAdCagcACAUCUGCAAGUACGUUCGUU
[0129] SEQ ID NO:11 is a sense nucleotide sequence that anneals to
a the segment of the antisense sequence SEQ ID NO:10 that targets
the KDR mRNA.
TABLE-US-00014 KV-3KS: GAGUGUAAAAACAUUUGAAdTdT (SEQ ID NO: 11)
[0130] SEQ ID NO:12 is a sense nucleotide sequence that anneals to
a the segment of the antisense sequence SEQ ID NO:10 that targets
the VEGF mRNA.
TABLE-US-00015 KV-3VS: AACGAACGUACUUGCAGAUGU (SEQ ID NO: 12)
Using SEQ ID NOs: 7-9 the following iNA duplex was made KV-3 iNA
(KDR-25+VEGF A-14)
TABLE-US-00016 (SEQ ID NO: 12) 5' AACGAACGUACUUGCAGAUGU (SEQ ID NO:
11) GAGUGUAAAAACAUUUGAATT 3' (SEQ ID NO: 10) 3'
UUGCUUGCAUGAACGUCUACACGACACUCACAUUUUUGUAAACUU 5'
Example 5
TABLE-US-00017 [0131] NT-VEGF A-11 Sense: GAUCCGCAGACGUGUAAAUdTdT
(SEQ ID NO: 13) Anti-sense: AUUUACACGUCUGCGGAUCdTdT (SEQ ID NO: 14)
5' GAUCCGCAGACGUGUAAAUTT 3' (SEQ ID NO: 13 3' TTCUAGGCGUCUGCACAUUUA
5' (SEQ ID NO: 14)
Example 6
TABLE-US-00018 [0132] NT-VEGF A-12 Sense: GUGUAAAUGUUCCUGCAAAdTdT
(SEQ ID NO: 15) Anti-sense: UUUGCAGGAACAUUUACACdGdT (SEQ ID NO: 16)
5' GUGUAAAUGUUCCUGCAAAdTdT 3' (SEQ ID NO: 15) 3'
TGCACAUUUACAAGGACGUUU 5' (SEQ ID NO: 16)
Example 7
TABLE-US-00019 [0133] NT-VEGF A-14 Sense: CGAACGUACUUGCAGAUGUdTdT
(SEQ ID NO: 17) Anti-sense: ACAUCUGCAAGUACGUUCGdTdT (SEQ ID NO: 18)
5' CGAACGUACUUGCAGAUGUdTdT 3' (SEQ ID NO: 17) 3'
TTGCUUGCAUGAACGUCUACA 5' (SEQ ID NO: 18)
Example 8
TABLE-US-00020 [0134] KDR-18 Sense: GUUGAAAGAAGGAGCAACAdTdT (SEQ ID
NO: 19) Anti-sense: UGUUGCUCCUUCUUUCAACdAdT (SEQ ID NO: 20) 5'
GUUGAAAGAAGGAGCAACATT 3' (SEQ ID NO: 19) 3' TACAACUUUCUUCCUCGUUGU
5' (SEQ ID NO: 20)
Example 9
TABLE-US-00021 [0135] KDR-25 Sense: GAGUGUAAAAACAUUUGAAdTdT (SEQ ID
NO: 21) Anti-sense: UUCAAAUGUUUUUACACUCdAdC (SEQ ID NO: 22) 5'
GAGUGUAAAAACAUUUGAATT (SEQ ID NO: 21) 3' CACUCACAUUUUUGUAAACUU (SEQ
ID NO: 22)
Example 10
TABLE-US-00022 [0136] KDR-54 Sense: GUCCCUCAGUGAUGUAGAAdTdT (SEQ ID
NO: 23) Anti-sense: UUCUACAUCACUGAGGGACdTdT (SEQ ID NO: 24) 5'
GUCCCUCAGUGAUGUAGAAdTdT (SEQ ID NO: 23) 3' TTCAGGGAGUCACUACAUCUU
(SEQ ID NO: 24)
siRNA Concentration:
[0137] KV1A, B, 2, 3: 10 nM
[0138] All the other siRNA: 10 nM
[0139] Experimental Methods
mRNA isolation: Cells were washed once with 100 .mu.L PBS and then
70 .mu.L of lysis buffer (SPY4, Sigma) was added. The lysate (60
.mu.L) was transferred to a 96-well mRNA capture plate and
incubated for 1-2 hours at room temperature. After decanting the
lysate, the plate was washed three times with 80 .mu.L wash buffer
each. Then 60 .mu.L of elution buffer was added to each well and
incubated at 65.degree. C. for 5 minutes. The elution solution
(containing mRNA) was transferred to new 96-well clear plate.
[0140] Cells are harvested at 48 hrs after transfection. Check cell
confluency before harvest. Then, remove media and add 90 .mu.l TCL
cell lysis buffer to each well. Keep at room temperature for 20
min. Transfer 80 .mu.l lysate into each well of TurboCaptuer plate
(Qiagen, Cat#: 72251). Keep in room temperature for 60 min. Then
wash three time with TCW buffer with 100 .mu.l for each wash. Add
80 .mu.l TCE buffer and keep in 65.degree. C. for 5 min. Transfer
80 .mu.l elution solution into new 96-well plate.
[0141] qRT-PCR:
1 .mu.L of isolated mRNA was used to run RT-PCR with SYBR Green
one-step qRT-PCR kit (SensiMix one-step SYBR Green kit, Bioline) by
mixing with 13 .mu.L master mix containing 7 .mu.L of 2.times.
master mix (containing reverse transcriptase), 1 .mu.L forward and
reverse primer (6 .mu.M), 0.3 uL 50.times.SYBR Green and 4.7 .mu.L
water. The reverse transcription reaction took place at 42.degree.
C., 30 min; after another 95.degree. C., 10 min; the thermocyle of
reaction of 95.degree. C., 15 sec; 60.degree. C., 30 sec;
72.degree. C., 20 sec; 50 cycles was used. Taking 4 .mu.l diluted
mRNA to run qRT-PCR with Bioline one-step qRT-PCR kit. Reaction
size: 14 .mu.l.
[0142] 7 .mu.l 2.times. master mix (ABI, Cat #: 4309169)
[0143] 0.3 .mu.l 50.times.SYBR Green
[0144] 0.35 .mu.l F+R primer (6 .mu.M)
[0145] 1.7 .mu.l water
[0146] 42.degree. C., 30 min; 95.degree. C., 10 min; 95.degree. C.,
15 sec; 60.degree. C., 20 sec; 72.degree. C., 20 sec; 50 cycles,
then melt curve.
[0147] KDR-VEGF A iNA (KV-1A, KV-1B, KV-2, KV-3) is as Good as
Standard siRNA in Knockdown KDR and VEGF A Gene Expression
[0148] VEGF A-11 works better than VEGF A-12, 14
[0149] KDR-18 and KDR-25 works similarly, both are better than
KDR-54
[0150] None of iNA induce INFb1 or OAS1 significantly in ARPE-19 or
HUVEC-CS cells
[0151] Measuring Interferon-Response
At 48 hours post-transfection the level of mRNA encoding interferon
was measured using RT-PCR. The cells were washed once with 100
.mu.L PBS and then 70 .mu.L of lysis buffer (SPY4, Sigma) was
added. The lysate (60 .mu.L) was transferred to a 96-well mRNA
capture plate and incubated for 1-2 hours at room temperature.
After decanting the lysate, the plate was washed three times with
80 .mu.L wash buffer each. Then 60 .mu.L of elution buffer was
added to each well and incubated at 65.degree. C. for 5 minutes.
The elution solution (containing mRNA) was transferred to new
96-well clear plate.
[0152] Real-time RT-PCR: The level of mRNA encoding interferon was
determined by RT-PCT wherein 1 .mu.L of isolated mRNA was used to
run RT-PCR with SYBR Green one-step qRT-PCR kit (SensiMix one-step
SYBR Green kit, Bioline) by mixing with 13 .mu.L master mix
containing 7 .mu.L of 2.times. master mix (containing reverse
transcriptase), 1 .mu.L forward and reverse primer (6 .mu.M), 0.3
.mu.L 50.times.SYBR Green and 4.7 .mu.L water. The reverse
transcription reaction took place at 5042.degree. C., 30 min; after
another 95.degree. C., 15 min 10 min; the thermocyle of reaction of
95.degree. C., 15 sec; 5560.degree. C., 30 sec; 72.degree. C., 30
sec 20 sec; 40 50 cycles was used. For interferon response,
interferon .beta.1gene and OAS1 gene were used. The primers used to
detect the level of interferon .beta.1genes by QRTqRT-PCR were:
TABLE-US-00023 Forward primer: TTTGACATCCCTGAGGAGATT (SEQ ID NO:
25) Reverse primer: GATAGACATTAGCCAGGAGGTT (SEQ ID NO: 26)
[0153] The primers used to detect the level of OAS1 genes by
qRT-PCR were:
TABLE-US-00024 Forward primer: GTGAGCTCCTGGATTCTGCT (SEQ ID NO: 27)
Reverse primer: TGTTCCAATGTAACCATATTTCTGA (SEQ ID NO: 28)
[0154] Experimental Purpose
[0155] compare knockdown and interference response of the selected
siRNA and the iNA constructs
[0156] Experimental Methods
[0157] Cells: ARPE-19 cells (passage#: 5) and HUVEC-CS (passage#:
3) plated (96-well plate) overnight. The cell confluency for both
the cell lines is 40% at the moment for transfection next
morning.
[0158] Transfection:
[0159] siRNA diluted in 10 .mu.l Opti-MEM. RNAiMAX (0.2 .mu.l/well)
diluted into 10 .mu.l Opti-MEM and keep for 5 min at room
temperatureer. Mix above two by vortexing 10 sec and keep in room
temperature for 10 min. Add 20 .mu.l transfection complex to each
well which has 80 .mu.l Opti-MEM. Four hours later, add 100 .mu.l
complete media to each well, then replaced with 100 .mu.l complete
media in following morning.
Example 11
Comparison of iNA (Sense or Anti-sense Segmentation) and siRNA in
Knockdown of Gene Expression and Interferon Response
[0160] Introduction
[0161] Experimental Purpose
[0162] Compare knockdown and interference response of the selected
siRNA and the iNA constructs (sense segmentation and anti-sense
segmentation)
[0163] Experimental Methods
[0164] Cells: ARPE-19 cells (passage#: 3) and HUVEC-CS (passage#:
2) plated (96-well plate) overnight. The cell confluency for both
the cell lines is 40% at the moment for transfection next
morning.
[0165] Transfection:
[0166] siRNA diluted in 10 .mu.l Opti-MEM. iNTFect (0.5 .mu.l/well)
diluted into 10 .mu.l Opti-MEM and keep for 5 min at room
temperatuer. Mix above two by vortexing 10 sec and keep in room
temperature for 10 min. Add 20 .mu.l transfection complex to each
well which has 80 .mu.l Opti-MEM. Four hours later, add 100 .mu.l
complete media to each well, then replaced with 100 .mu.l complete
media in following morning.
[0167] Experimental Methods
TABLE-US-00025 siRNA: Vksti (VEGF A-11 + KDR-25) (SEQ ID NO: 29)
Vksti-S: GAUCCGCAGACGUGUAAAUdTdTuguGAGUGUAAAAACAUUUGAAdTdT (SEQ ID
NO: 14) VEGF A-11AS: AUUUACACGUCUGCGGAUCdTdT (SEQ ID NO: 22) KDR-25
AS: UUCAAAUGUUUUUACACUCdAdC Vkbln (VEGF A-11 + KDR-25) (SEQ ID NO:
30) Vksti-S: GAUCCGCAGACGUGUAAAUdTdTuguGAGUGUAAAAACAUUUGAA (SEQ ID
NO: 14) VEGF A-11AS: AUUUACACGUCUGCGGAUCdTdT (SEQ ID NO: 22) KDR-25
AS: UUCAAAUGUUUUUACACUCdAdC KV-1A (KDR-54 + VEGF A-11): (SEQ ID NO:
31) KV-1AS: UUCUACAUCACUGAGGGACdTdTcucAUUUACACGUCUGCGGAUCUU (SEQ ID
NO: 2) KV-1KS: GUCCCUCAGUGAUGUAGAAdTdT (SEQ ID NO: 3) KV-1VS:
AAGAUCCGCAGACGUGUAAAU KV-1B (KDR-54 + VEGF A-11): (SEQ ID NO: 32)
K-1AS: UUCUACAUCACUGAGGGACUUcucAUUUACACGUCUGCGGAUCUU (SEQ ID NO: 2)
KV-1KS: GUCCCUCAGUGAUGUAGAAdTdT (SEQ ID NO: 3) KV-1VS:
AAGAUCCGCAGACGUGUAAAU KV-2 (KDR-18 + VEGF A-12): (SEQ ID NO: 33)
KV-2AS: UGUUGCUCCUUCUUUCAACdAdTuuuUUUGCAGGAACAUUUACACGU (SEQ ID NO:
8) KV-2KS: GUUGAAAGAAGGAGCAACAdTdT (SEQ ID NO: 9) KV-2VS:
ACGUGUAAAUGUUCCUGCAAA KV-3 (KDR-25 + VEGF A-14): (SEQ ID NO: 34)
KV-3AS: UUCAAAUGUUUUUACACUCdAdCagcACAUCUGCAAGUACGUUCGUU (SEQ ID NO:
11) KV-3KS: GAGUGUAAAAACAUUUGAAdTdT (SEQ ID NO: 12) KV-3VS:
AACGAACGUACUUGCAGAUGU NT-VEGF A-11 (SEQ ID NO: 13) Sense:
GAUCCGCAGACGUGUAAAUdTdT (SEQ ID NO: 14) Anti-sense:
AUUUACACGUCUGCGGAUCdTdT NT-VEGF A-12 (SEQ ID NO: 15) Sense:
GUGUAAAUGUUCCUGCAAAdTdT (SEQ ID NO: 16) Anti-sense:
UUUGCAGGAACAUUUACACdGdT NT-VEGF A-14 (SEQ ID NO: 17) Sense:
CGAACGUACUUGCAGAUGUdTdT (SEQ ID NO: 18) Anti-sense:
ACAUCUGCAAGUACGUUCGdTdT KDR-18 (SEQ ID NO: 19) Sense:
GUUGAAAGAAGGAGCAACAdTdT (SEQ ID NO: 20) Anti-sense:
UGUUGCUCCUUCUUUCAACdAdT KDR-25 (SEQ ID NO: 21) Sense:
GAGUGUAAAAACAUUUGAAdTdT (SEQ ID NO: 22) Anti-sense:
UUCAAAUGUUUUUACACUCdAdC KDR-54 (SEQ ID NO: 23) Sense:
GUCCCUCAGUGAUGUAGAAdTdT (SEQ ID NO: 24) Anti-sense:
UUCUACAUCACUGAGGGACdTdT
[0168] siRNA Concentration:
[0169] KV1A, B, 2, 3: 10 nM
[0170] All the siRNA: 10 nM
iNA of Segmented Anti-Sense Strand
[0171] VEGF A-11+KDR-25 with 3 nt Gap and Stick End
TABLE-US-00026 (SEQ ID NO: 35) 5'-
GAUCCGCAGACGUGUAAAUdTdTuguGAGUGUAAAAACAUUUGAAd TdT -3' (SEQ ID NO:
14) 3'-dTdTCUAGGCGUCUGCACAUUUA-5' (SEQ ID NO: 22)
3'-dCdACUCACAUUUUUGUAAACUU-5'
[0172] VEGF A-11+KDR-25 with 4 nt Gap and One Blunt End
TABLE-US-00027 (SEQ ID NO: 36) 5'-
GAUCCGCAGACGUGUAAAUdTdTcuguGAGUGUAAAAACAUUUGAA -3' (SEQ ID NO: 14)
3'-dTdTCUAGGCGUCUGCACAUUUA-5' (SEQ ID NO: 22)
3'-dCdACUCACAUUUUUGUAAACUU-5'
[0173] VEGF A+KDR-25+PDGFRB-16 with 3 nt Gap and Blunt End
TABLE-US-00028 (SEQ ID NO: 37)
5'GAUCCGCAGACGUGUAAAUdTdTuguGAGUGUAAAAACAUUUGAAdTd
TacgAGAUCUAUGAGAUCAUGCA3' (SEQ ID NO: 14) 3'dTdTCUAGGCGUCUGCACAUUUA
(SEQ ID NO: 22) dCdACUCACAUUUUUGUAAACUU (SEQ ID NO: 38)
dGdCUCUAGAUACUCUAGUACGU 5' U, A, G, C are RNA bases; dT, dA, dC and
dG are DNA bases
[0174] Standard iNA design usually features a 10-27 base pair
contiguous double strand region that is believed to be important
for RISC incorporation. Studies have shown that iNAs duplexes
longer than 30 base pair double strand RNA can cause interferon
response. Therefore it was necessary to use iNAs duplexes shorter
than 30 base pairs to prevent interferon response. Here we
described a novel design in which a strand longer than 30 base
paired RNA complement with two more strand (s) separated by either
nick or gap(s) improves silencing property without causing
interferon response in both the sense and antisense strands. A 30
mer contiguous double strand RNA causes interferon response as
indicated by increased expression level of interferon .beta.. With
same sequence and new design in which two or more sense strands or
two more antisense strands separated with either gap or nick and
complement with a long contiguous sense or antisense strands, the
interferon response was diminished. Moreover, when using the novel
iNA duplexes of the present invention, one can target more than one
site in the same mRNA or more than one mRNA. The novel iNAs of the
present invention have the therapeutic potential to treat viral or
bacterial diseases that have a number of mutated forms or diseases
wherein the down-regulation of multiple genes would be
desirable.
Example 13
Knockdown of LacZ Gene Expression and Analysis of Interferon
Response of iNAs Having a Stilbene or Pyrrolindol Linked to One or
More Nucleotides
[0175] Overview
A number of iNAs of were designed and synthesized to suppress the
expression of the LacZ gene in 9 L/LacZ cells (A rat gliosarcoma
cell line, ATCC # CRL-2200. These iNAs were transfected into cells
expressing the LacZ gene to see if they could silence the
expression of the LacZ gene. The full-length DNA sequence of the
LacZ gene is shown below.
[0176] Each of the iNAs were placed in separate wells of a 96-well
plate containing 9 L/LacZ cells which expressed the LacZ gene under
conditions wherein the iNAs were transfected into the 9 L/LacZ
cells as described below in the procedure section. FIG. 15 shows
the level of suppression of the LacZ gene caused by each of the
iNAs FIG. 15 shows that all of the iNA duplexes were able to reduce
the expression of the LacZ gene, especially at a concentration of
0.1 nM or greater and that construct L3B was more effective than
construct L3A, and construct L4B was more effective than construct
L4A. The procedures used to transfect the iNA duplexes into the 9 L
cells are described below.
[0177] Cell Culture:
9 L/LacZ cells were grown in DMEM supplemented with 10% FBS at
37.degree. C., supplied with 5% CO.sub.2.
Transfection:
[0178] 9 L/LacZ cells were plated in a 96-well plate and grown
overnight. The cells were about 20% (9 L/LacZ) confluency at the
time of transfection.
[0179] The different amounts of iNA transfected into the 9 L/LacZ
cells were 100 nM, 10 nM, 1 nM, 0.1 nM, and 0.01 nM, which had been
diluted in 10 .mu.L Opti-MEM. In a separate microcentrifuge tube,
transfection reagents (RNAiMAX, Invitrogen) were diluted in 10
.mu.L Opti-MEM also and kept in room temperature for 5 minutes. The
contents of each tube were combined and vortexed for approximately
10 seconds and then incubated for 10-15 minutes at room
temperature. Then the transfection complex was added to each well
which has 80 .mu.L Opti-MEM. The cells were allowed to be incubated
with the transfection mixture for four hours. Fresh media (100
.mu.L) was added to each well. Following morning, fresh growth
media (100 .mu.L) was replaced for each well.
[0180] .beta.-Galactosidase Assay
Three days after transfection, the 9 L/LacZ cells were harvested.
The cells were washed once with 100 .mu.L phosphate buffered saline
(PBS) and lysed with 70 .mu.L M-PER.RTM. Reagent (Pierce). 20 .mu.L
of lysate was transferred from each well to new 96-well plate for
protein assay with micro BCA kit (Pierce). 30 .mu.L lysate was
taken from each well to put in another new plate and add 30 .mu.L
All-in-One.TM. .beta.-Galactosidase Assay Reagent (Pierce) to each
well. Cover plate and incubate for 30-40 minutes at 37.degree. C.
and light absorbance the absorbance was measured at 405 nm.
[0181] Micro BCA Assay:
[0182] To measure total protein within the 9 L/LacZ cells, 20 .mu.L
of cell lysate was transferred to each well of a 96-well plate, 130
.mu.L of water was added to each well, and 150 .mu.L Micro BCA
(Pierce) working solution (25:24:1 of Reagent A:B:C) was added to
each well and incubated at 37.degree. C. for 2 hours and then the
light absorbance was measured at 562 nm.
[0183] Nucleotide Sequences of Constructs L3A & L3B Long
Strand
TABLE-US-00029 (SEQ ID NO: 39)
UCAGCGAUUUGAGAAAAUCGCUGAUUUGUGUAGdTdC
L3A & L3B Short Sense Strand--CUACACAAA
[0184] In the first `U` of the long strands of constructs L3A and
L3B, the nucleotide 5' position does not contain a phosphodiester
bond forming a nick in the sense strands. A molecular cap,
trimethoxystilbene, compound B in FIG. 14, is covalently bonded to
the `U` at the 5' end of the long strand of construct L3B. The last
`A` at the 3' end of the short strands of constructs L3A and L3B
does not contain a phosphodiester bond forming a nick in the sense
strand. The first `C` at the 5' end of the short strand of the
sense strand of construct L3B has a molecular cap,
trimethoxystilbene, covalently bonded to the `C`.
[0185] Nucleotide Sequence of Constructs L4A & L4B Long
Strand
TABLE-US-00030 (SEQ ID NO: 40)
GCGAUUUCCAUGUGAGAACAUGGAAAUCGCUGAUUUGUGUAGUC
The first `G` on the sense strand of the Long Strand of constructs
L4A & L4B does not contain a phosphodiester bond at the 5' end
of the nucleotide forming a nick in the sense strand. The first `G`
has on the sense long strand is covalently bonded at the 5' end to
a molecular cap, trimethoxystilbene. L4A & L4B Short Sense
strand
TABLE-US-00031 CUACACAAAUCA (SEQ ID NO: 41)
The last `A` on the 5' end of the short strands of constructs L4A
& L4B does not contain a phosphodiester bond at the 3' end of
nucleotide forming a nick in the sense strand. The first `C` at the
5' end of the short strand of construct L4B has a molecular cap
bonded to it.
Example 14
Inhibition of Lac Z Gene Using a 40 mer iNA
[0186] Using the techniques described above a series of iNAs were
designed targeting the LacZ gene, each iNA either having no gaps or
nicks the sense or antisense strand or a series of nicks and gaps
in the sense strand. FIGS. 16 and 17 show the results. The only
construct that produced an appreciable interferon response, as
shown in FIG. 16, was the iNA construct that had no nicks or gaps
in either strand. While all of the iNA constructs were able to
silence the LacZ gene.
Sequence CWU 1
1
41145DNAHomo sapiens 1uucuacauca cugagggact tcucauuuac acgucugcgg
aucuu 45221DNAHomo sapiens 2gucccucagu gauguagaat t 21345DNAHomo
sapiens 3uguugcuccu ucuuucaaca tuuuuuugca ggaacauuua cacgu
45445RNAHomo sapiens 4uucuacauca cugagggacu ucucauuuac acgucugcgg
aucuu 45521DNAHomo sapiens 5gucccucagu gauguagaat t 21621RNAHomo
sapiens 6aagauccgca gacguguaaa u 21745DNAHomo sapiens 7uguugcuccu
ucuuucaaca tuuuuuugca ggaacauuua cacgu 45821DNAHomo sapiens
8gucccucagu gauguagaat t 21921RNAHomo sapiens 9acguguaaau
guuccugcaa a 211045DNAHomo sapiens 10uucaaauguu uuuacacuca
cagcacaucu gcaaguacgu ucguu 451121DNAHomo sapiens 11gaguguaaaa
acauuugaat t 211221RNAHomo sapiens 12aacgaacgua cuugcagaug u
211320DNAHomo sapiens 13acaucugcaa guacguucgt 201421DNAHomo sapiens
14auuuacacgu cugcggauct t 211521DNAHomo sapiens 15guguaaaugu
uccugcaaat t 211621DNAHomo sapiens 16uuugcaggaa cauuuacacg t
211743DNAHomo sapiens 17gauccgcaga cguguaaaut tugugagugu aaaaacauuu
gaa 431845DNAHomo sapiens 18uucuacauca cugagggact tcucauuuac
acgucugcgg aucuu 451945DNAHomo sapiens 19uguugcuccu ucuuucaaca
tuuuuuugca ggaacauuua cacgu 452021DNAHomo sapiens 20uguugcuccu
ucuuucaaca t 212121DNAHomo sapiens 21gaguguaaaa acauuugaat t
212221RNAHomo sapiens 22uucaaauguu uuuacacuca c 212321DNAHomo
sapiens 23gucccucagu gauguagaat t 212421DNAHomo sapiens
24uucuacauca cugagggact t 212521DNAHomo sapiens 25tttgacatcc
ctgaggagat t 212622DNAHomo sapiens 26gatagacatt agccaggagg tt
222720DNAHomo sapiens 27gtgagctcct ggattctgct 202825DNAHomo sapiens
28tgttccaatg taaccatatt tctga 252945DNAHomo sapiens 29gauccgcaga
cguguaaaut tugugagugu aaaaacauuu gaatt 453043DNAHomo sapiens
30gauccgcaga cguguaaaut tugugagugu aaaaacauuu gaa 433145DNAHomo
sapiens 31uucuacauca cugagggact tcucauuuac acgucugcgg aucuu
453245RNAHomo sapiens 32uucuacauca cugagggacu ucucauuuac acgucugcgg
aucuu 453345DNAHomo sapiens 33uguugcuccu ucuuucaaca tuuuuuugca
ggaacauuua cacgu 453445RNAHomo sapiens 34uucaaauguu uuuacacuca
cagcacaucu gcaaguacgu ucguu 453545DNAHomo sapiens 35gauccgcaga
cguguaaaut tugugagugu aaaaacauuu gaatt 453644DNAHomo sapiens
36gauccgcaga cguguaaaut tcugugagug uaaaaacauu ugaa 443767DNAHomo
sapiens 37gauccgcaga cguguaaaut tugugagugu aaaaacauuu gaattacgag
aucuaugaga 60ucaugca 673821RNAHomo sapiens 38ugcaugaucu cauagaucuc
g 213935DNAEscherichia coli 39ucagcgauuu gagaaaaucg cugauuugug
uagtc 354044RNAEscherichia coli 40gcgauuucca ugugagaaca uggaaaucgc
ugauuugugu aguc 444112RNAEscherichia coli 41cuacacaaau ca 12
* * * * *