U.S. patent application number 12/472010 was filed with the patent office on 2010-01-21 for cellomics system.
Invention is credited to Kazunori Okano, Kenji Yasuda.
Application Number | 20100016569 12/472010 |
Document ID | / |
Family ID | 35427450 |
Filed Date | 2010-01-21 |
United States Patent
Application |
20100016569 |
Kind Code |
A1 |
Okano; Kazunori ; et
al. |
January 21, 2010 |
CELLOMICS SYSTEM
Abstract
In labeling a cell, and separating and collecting the cell
according to a degree of the labeling using a cell separator,
effects on the cell is minimized and the use of the collected cell
is facilitated, thereby, when labeling a cell, the cell is labeled
in the state where interaction of each cell is retained. In the
labeling, a specific labeling material present on a surface of a
target cell is taken in the cell via a transporter, and the cell is
dispersed one by one to separate the same with a cell separator.
Immediately after the separation, the cell is put in a solution not
containing the specific labeling substance to remove the specific
labeling substance taken in the cell. This series of steps is
continuously conducted with a cell separation chip.
Inventors: |
Okano; Kazunori; (Tokyo,
JP) ; Yasuda; Kenji; (Tokyo, JP) |
Correspondence
Address: |
ANTONELLI, TERRY, STOUT & KRAUS, LLP
1300 NORTH SEVENTEENTH STREET, SUITE 1800
ARLINGTON
VA
22209-3873
US
|
Family ID: |
35427450 |
Appl. No.: |
12/472010 |
Filed: |
May 26, 2009 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11195662 |
Aug 3, 2005 |
7569354 |
|
|
12472010 |
|
|
|
|
Current U.S.
Class: |
536/23.1 ;
506/17 |
Current CPC
Class: |
A01N 1/0284 20130101;
G01N 33/566 20130101; G01N 33/5061 20130101; B01L 7/50
20130101 |
Class at
Publication: |
536/23.1 ;
506/17 |
International
Class: |
C07H 21/04 20060101
C07H021/04; C40B 40/08 20060101 C40B040/08 |
Foreign Application Data
Date |
Code |
Application Number |
Aug 3, 2004 |
JP |
2004-226359 |
Aug 3, 2004 |
JP |
2004-226361 |
Aug 4, 2004 |
JP |
2004-227640 |
Aug 4, 2004 |
JP |
2004-227686 |
Aug 25, 2004 |
JP |
2004-244575 |
Aug 30, 2004 |
JP |
2004-249659 |
Sep 8, 2004 |
JP |
2004-260501 |
Sep 13, 2004 |
JP |
2004-264866 |
Sep 17, 2004 |
JP |
2004-270768 |
Sep 24, 2004 |
JP |
2004-276558 |
Sep 28, 2004 |
JP |
2004-281347 |
Sep 29, 2004 |
JP |
2004-283715 |
Sep 30, 2004 |
JP |
2004-287133 |
Sep 30, 2004 |
JP |
2004-287197 |
Sep 30, 2004 |
JP |
2004-287249 |
Oct 1, 2004 |
JP |
2004-289554 |
Oct 5, 2004 |
JP |
2004-292142 |
Oct 12, 2004 |
JP |
2004-297184 |
Oct 12, 2004 |
JP |
2004-297194 |
Oct 13, 2004 |
JP |
2004-298529 |
Oct 14, 2004 |
JP |
2004-299647 |
Oct 20, 2004 |
JP |
2004-305258 |
Nov 1, 2004 |
JP |
2004-317701 |
Nov 2, 2004 |
JP |
2004-318770 |
Nov 5, 2004 |
JP |
2004-323395 |
Dec 2, 2004 |
JP |
2004-349583 |
Dec 2, 2004 |
JP |
2004-349609 |
Dec 24, 2004 |
JP |
2004-372938 |
Dec 28, 2004 |
JP |
2004-379351 |
Mar 7, 2005 |
JP |
2005-062098 |
Claims
1. A DNA probe chip comprising: a substrate; an electrode formed on
the substrate and having a plurality of discrete probe fixing areas
formed thereon; and prespecified DNA probes each fixed on
respective probe fixing areas with covalent bonding, wherein the
DNA probe being configured to cause hybridization with a
complementary strand DNA from the terminus side fixed onto the
probe fixing area.
2. A DNA probe chip comprising: a substrate; an electrode formed on
the substrate and having a plurality of discrete probe fixing areas
formed thereon; and prespecified DNA probes each fixed on
respective probe fixing areas with covalent bonding, wherein a
dissociative group having a negative charge on the terminus
different from that fixed on the probe fixing area being added to
each of the DNA probes.
3. The DNA probe chip according to claim 1, wherein the electrode
with a plurality of discrete probes formed thereon is an ITO
electrode, and a water repellent surface coating is applied to the
area other than the probe fixing areas.
4. The DNA probe chip according to claim 1, wherein an electrode
surface in the plurality of discrete probe fixing areas is prepared
by introducing a residue dissociating positive.
5. The DNA probe chip according to claim 1, wherein the DNA probe
is a PNA whose main chain is composed with the peptide bond, or a
CAS having S-carboxymethyl-L-cysteine as a basic skeleton.
6. The DNA probe chip according to claim 1, wherein the DNA probe
is designed to have a sequence complementary to that having a
prespecified base length starting from an mRNA sequence having a
sequence to be hybridized with the DNA probe, and the DNA probe is
selected from an area in which the quantity of GC fixed onto the
plurality of discrete probe fixing areas on the terminus side is
higher than that on the free end side.
7. The DNA probe chip according to claim 1, wherein the DNA probe
has a sequence complementary to that having a prespecified base
length starting from an mRNA sequence having a sequence to be
hybridized with the DNA probe, and the DNA probe has a
configuration in which, between the terminus side fixed onto the
plurality of discrete probe fixing areas and the free end side is
inserted a sequence mismatched with a sequence to be hybridized
with the DNA probe between the position about 10 bases and that
about 30 bases from the free end, or a blank sequence not forming a
stable complementary strand with any of ACGT.
8. A method of controlling DNA hybridization comprising the steps
of: adding a sample solution containing a target polynucleotide to
between a DNA probe chip comprising: a substrate; an electrode with
a plurality of discrete probe fixing areas formed on the substrate
formed thereon; and prespecified DNA probes each fixed on
respective probe fixing areas with covalent bonding, a dissociative
group having a negative charge on the terminus different from that
fixed on the probe fixing area being added to the DNA probe: and a
member provided opposing to a surface of the DNA probe chip;
applying prespecified electric field to between the electrode and
the sample solution site to condense the polynucleotide in the
proximity of the surface of the DNA probe chip; and inverting the
electric field for applying to between the electrode and the sample
solution site to start hybridization in the state where the probe
is stretched.
9. The method of controlling DNA hybridization according to claim
7, wherein a DNA probe chip is employed in which the electrode
formed thereon a plurality of discrete probe is an ITO electrode,
and a water repellent surface coating is applied to the area other
than the probe fixing areas.
10. The method of controlling DNA hybridization according to claim
7, wherein a DNA probe chip is employed in which an electrode
surface in the plurality of discrete probe fixing areas is prepared
by introducing a residue dissociating positive.
11. The method of controlling DNA hybridization according to claim
7, wherein a DNA probe chip is employed in which the DNA probe is a
PNA whose main chain is composed with the peptide bond, or a CAS
having S-carboxymethyl-L-cysteine as a basic skeleton.
12. A DNA probe chip comprising: a substrate; an electrode with a
plurality of discrete probe fixing areas formed on the substrate
formed thereon; and prespecified DNA probes each fixed on
respective probe fixing areas with covalent bonding, wherein the
DNA probe being configured to form more stable hybridization on the
terminus side fixed onto the probe fixing area than on the free end
side.
13. The DNA probe chip according to claim 1, wherein the DNA probe
with one end thereof fixed on a substrate has a sequence
complementary to that having a prespecified base length starting
from an mRNA sequence having a sequence to be hybridized with the
DNA probe, and the DNA probe is selected from an area in which the
quantity of GC fixed onto the plurality of discrete probe fixing
areas on the terminus side is higher than that on the free end
side.
Description
CROSS REFERENCE TO RELATED APPLICATION
[0001] This application is a continuation application of
application Ser. No. 11/195,662 filed Aug. 3, 2005, the disclosure
of which is herein incorporated by reference.
FIELD OF THE INVENTION
[0002] The present invention relates to promotion of researches in
the field of cellomics for comprehensively understanding vital
functions as those of a cell assembly, and more particularly to
measurement of expression of genes in discrete cells in the state
where functions of each cell structure are preserved, namely in the
state where interactions between cells are preserved.
BACKGROUND OF THE INVENTION
[0003] With the active researches in the fields of genomics or
proteomics from the last decade of 20.sup.th century up to this
day, data has been accumulated concerning types and quantities of
genes in various cell groups each regarded as an assembly of cells.
Especially, accumulation of data concerning precise comparisons
among genome sequences different from species to species, or
frequencies of expression of various genes in organs and tissues in
one species has reached a level allowing sketchy descriptions of
the life process. In the future, various active researches will be
made not only for accumulation of data, but also for development of
more advanced analysis methods for acquiring data allowing
clarification of the life process at a higher level. This
clarification of the life process at a higher level is a research
scheme called cellomics, and different from the researches using
homogeneous cell systems basically prepared by the cloning
technique in the past, complex systems each formed with
multicellular aggregate each having different functions are treated
as objects for research in the field of cellomics.
[0004] For promotion of researches in the field of cellomics for
comprehensively understanding vital functions as those of a cell
assembly, it is necessary to measure expression of genes in
discrete cells in the state where functions of each cell structure
are preserved, namely in the state where interactions between cells
are preserved. To achieve this objective, it is necessary to
develop a technique for measuring local expressions of all
concerned genes at a level of a cell, which has been impossible in
the prior art.
[0005] For instance, the genes involved in the circadian rhythm
have been identified, and the relation between the cycle and
external factors (impetuses) such as insolation has been clarified.
The researches as described above are generally carried out using
DNA micro-arrays or kinetic PCR which is more quantitative
(sometimes called as real time PCR). It is not too much to say,
however, that there are few cases, excluding the cases fluctuating
with certain cycles such as the circadian rhythm, in which precise
data can be obtained from data concerning frequency of gene
expressions. The main reason for this is that the relation between
the sensitivity and reproducibility has not sufficiently be
clarified in the researches using DNA micro-arrays.
[0006] To obtain data concerning a frequency of expression of a
gene, mRNAs extracted from at least several hundreds of cells are
required. By amplifying these mRNAs in the form of cRNAs or cDNAs,
the mRNAs can be finally detected in the current situation. If the
sensitivity is just insufficient, it is simply required to further
amplify the mRNAs in the form of cRNAs or cDNAs, but in the
quantitative analysis, sometimes amplifying operations cause
errors. Even if it is tried to analyze gene expression (including
protein translation) in discrete cells in the tissue, it is
impossible to obtain a sufficient quantity of amplification
products from a discrete cell with the conventional amplifying
operation using, for instance, a DNA micro-array, and even when
amplification is forcefully performed to a level allowing for
analysis with a DNA micro-array, it is impossible to obtain data
reflecting the actual abundance ratio of mRNAs.
[0007] Researchers in this field are not satisfied with the
knowledge currently available in the fields of genomics and
proteomics, and the many researchers are aware of the importance of
analysis of a complex system formed with multiple cells at the
"cell" level, namely the potential importance of cellomics
described above. Further, as an expected application of the
cellomics for industrial purposes, many researchers point out the
importance of development of the measuring technique at the "cell"
level available as an alternative for animal experiments in
relation to recent developments of genomic sciences, acceleration
of drug developments, and development of pharmaceuticals and
chemicals which are safer as compared to those currently available
in the market. At present, a vast number of laboratory animals such
as guinea pigs or crab-eating macaque are used in experiments for
testing the safety or effects of chemical substances such as
pharmaceuticals or cosmetics.
[0008] However, it has been impossible to overcome the differences
between humans and other animals, now the tendency for abolishing
the animal experiments has been becoming stronger. When the
circumstances as described above are taken into consideration, the
preparation, along with its excellent reproducibility, of cell
groups each having the minimal functions on the basis of a cell,
and of a human cell, and also development of a testing system using
the cell groups are conceivably essential to the industries and to
realization of safer and more comfortable life of mankind. The
cellomics enables researches and development of the technique for
realization of the objects as described above.
SUMMARY OF THE INVENTION
[0009] In the cellomics, a cell is grasped and understood in
relation to a cell assembly, and the understanding and knowledge
are applied to the industrial utilization as described above, and
the cellomics is not complete only with establishment of discrete
techniques, and for promoting industrial utilization of cell
measurement in a multicellular organism, it is necessary to build
up a system satisfying the following three requirements:
[0010] 1) technique for separating a specified cell,
[0011] 2) technique for culturing the separated cell, and
[0012] 3) analysis (or utilization) of the cultured cell. Herein
the "technique for separating a specified cell" means separation of
cells involving in a specific function of an organ tissue such as a
tissue stem cell. There is a case where the separated cell is
immediately analyzed, and in this case, a technique is required for
destructing the separated cell according to a prespecified
procedure and quantitatively analyzing the mRNA or proteins
included in the cell. Assuming that the cell size is about 10
.mu.m, a means for analysis corresponding to the size is
required.
[0013] Naturally the technique for achieving the object above is
important, but only a passive analysis of a separated cell is
insufficient for implementing the cellomics enabling breakthrough
from the omics researches in the prior art. A key for development
of cellomics is establishment of active analysis of a separated
cell. The technique for active analysis of a separated cell as used
herein indicates a cell networking technique for forming a desired
pseudo tissue by placing the separated cell at a specified position
or a technique making it possible for a researcher to give an
electrical or chemical impetus to each discrete cell in a cell
network organized by the researcher for obtaining a response from
the cell. For achieving this objective, it is necessary to analyze
a cell without killing the cell. Further it is necessary to
establish a technique enabling analysis of proteins and mRNAs in
each discrete cell in a cell network artificially constracted to
clarify the differences between cells or distribution of the
substances in each cell.
[0014] For achieving the cellomics as described above, the present
inventors have made efforts for theoretical research and
development of a technique allowing constitutively forming and
measuring a cell network at a level of "one cell" on a microchip by
making use of micro-fabrication of a particular cell separated from
a tissue, and invented a cellomics system including a cell culture
chip, measuring devices and the like. Further by using the
cellomics system, the inventors found the fact that responses of
cell assemblies substantially vary according to differences in
"assembly network patterns" such as a spatial position, a type, and
the number of the cell assemblies, and recognized the importance of
the co-working phenomenon of a "cell assembly/cell network" one
rank higher than the simple "cell" level.
[0015] The inventors anticipated, based on the achievements as
described above, the possibility of preparation of a cell assembly
(network) expectedly allowing responses similar to those by actual
organ tissues, which can hardly be measured with "cell lines
belonging to a single species", by controlling "patterns" of the
cell assembly/cell network according to the necessity. Therefore
the present inventors propose herein the screening technique based
on the "cell network" cultured by means of cell-by-cell control of
the "patterns" of this cell assembly as the "on-chip cellomics"
measuring technique.
[0016] Outline of the cellomics system according to the present
invention is shown in FIG. 1. The present invention provides a
general system including the broad items as described below, and
researchers are required to carry out a series of operations
according to the item order as described below.
[0017] 1) A method and an apparatus for separating a target cell
without giving substantial damages to the cell: The method also
includes the steps of reversibly labeling a target cell, separating
the cell, and reproducing the original cell by removing the labeled
material.
[0018] 2) A method and apparatus for immediately freezing and
storing the separated cell according to the necessity
[0019] 3) A method of and an apparatus for handling a cell: Namely
a method of and an apparatus for freely handling a cell and
inserting the cell into a cell culture microchip in the next
step.
[0020] 4) A method of and apparatus for culturing each separated
cell discretely for a long time: This technique is required to
allow for not only a long time incubation of a single cell but also
constitutive construction of and measurement for a cell network at
a "single cell level" on a microchip.
[0021] 5) A method of an apparatus for acquiring information from
an incubated cell or a network-constructed cell: This technique
includes a method of and an apparatus for giving a stimulus to a
cell network by adding a stimulating substance to a specified cell
in the cell network, or by providing an electrode on a chip to
stimulate a cell, and also a method of and an apparatus for
measuring a response to a stimulus as an electric signal. Further
the technique includes a method and an apparatus for measuring
genes and proteins expressed in a cell. For achieving the objective
as described above, either a method and an apparatus for destroying
a cell and measuring the contents of the cell or a method of and an
apparatus for acquiring information without killing the cell are
employed according to the necessity.
[0022] Many methods for analysis and separation have been proposed
and put into practical use in the field of cell researches and
medical examination. For instance, for separation of a cell, flow
cytometer has been developed and an apparatus for optically
separating a cell is now available. For measurement of a separated
cell, there have been developed the DNA micro-array technique, the
in situ hybridization technique for detecting distribution of mRNA
expressed in each discrete cell using a tissue fragment as a
sample, or the immunohistochemistry for detecting distribution of
proteins, and these techniques are now used for analyzing
expression of a particular cell in a tissue. These techniques are
used for analyzing functions of a cell or for differentiating a
normal tissue from a cancer or tumor tissue, and therefore are used
for screening a cancer.
[0023] These techniques have made great contributions to medical
researches and services, however, when the techniques are viewed as
those based on the cellomics system, the techniques are still
insufficient in the points that the techniques do not systemize a
series of steps from cell separation to detection, can not be used
for active measurement, and can not be used for quantitative
measurement for distribution of various substances in a cell.
[0024] An object of the present invention is to develop the
researches on a cell assembly or a cell network constitutively
constructed in the past into a pharmaceutical and medical screening
system. The present system has the potentials of not only
realization of a novel measurement technique at a cell level based
on new understandings and recognition of the importance of
"patterns" in a "cell network" not available so far, but also
provision of new understandings concerning a life system based on
the findings described above. In addition, if the cellomics system
enabling measurement of a cell network base in place of animal
experiments is successfully industrialized, high speed and low cost
measurement using only a small number of samples will be possible
not only in the fundamental researches but also in the field of
screening technique for medical examination and food sanitary
inspection, which would make great contributions to our health
control.
BRIEF DESCRIPTION OF THE DRAWINGS
[0025] FIG. 1 is a diagram for illustrating a concept for a
cellomics system according to the present invention;
[0026] FIG. 2 is a view showing general configuration of a
centrifugal separator for cell separation in Example 1 of a first
embodiment of the present invention;
[0027] FIG. 3 is a plan view schematically showing configuration of
a centrifugal chip in Example 2 of the first embodiment
advantageously applicable to the centrifugal separator in Example
1;
[0028] FIG. 4 is a perspective view schematically showing
configuration of a reservoir section of the centrifugal chip 100
shown in FIG. 3;
[0029] FIG. 5 is a view schematically showing configuration of the
centrifugal chip 100 in Example 3 of the first embodiment;
[0030] FIG. 6 is a perspective view schematically showing a
separation chamber 70 in Example 3;
[0031] FIG. 7 is a view schematically showing the situation in
which a separated materials are moving in a separation chamber 70
where two flow paths converge;
[0032] FIG. 8 is a view showing the situation in which a separated
material is moving in a separation chamber 17 where three flow
paths converge;
[0033] FIG. 9 is a flowchart showing processing steps in a method
of separating and collecting a cell in a second embodiment;
[0034] FIG. 10 is a view showing general characteristics in a case
where a cell with the fluorescence intensity of 5000 or more is
separated with a cell separator;
[0035] FIG. 11 is a histogram plotted with the number of cells
taking a fluorescent labeled material against the fluorescence
intensity;
[0036] FIG. 12 is a graph showing culture time of a cell on the
horizontal axis and the separated cells with the fluorescence
intensity of 500 or more on the vertical axis;
[0037] FIG. 13 is a plan view schematically showing an example of a
cell separation chip adapted to implementation of a protocol for
cell separation according to a second embodiment;
[0038] FIGS. 14(A) to 14(D) are cross-sectional views of the cell
separation chip shown in FIG. 13 taken along the lines A-A, B-B,
C-C, and D-D and viewed in the direction indicated by the arrows at
respective positions;
[0039] FIG. 15 is a plan view schematically showing an example of a
cell separator with a plurality of cell separation chips
illustrated in FIG. 13 and FIG. 14 mounted thereon;
[0040] FIG. 16 is a view for illustrating an optical system of the
cell separation chip;
[0041] FIG. 17 is a view showing a process flow of specifically
labeling a cell surface antigen with the
.beta.-phycoerythrin-modified RNA aptamer for separating a cell
according to a third embodiment of the present invention;
[0042] FIG. 18 is a diagram showing an effect of removal of the
.beta.-phycoerythrin-modified RNA aptamer used for identifying a
cell by adding nuclease;
[0043] FIG. 19 is a diagram indicating the fact that a cell
obtained after the .beta.-phycoerythrin-modified RNA aptamer is
removed can be cultured;
[0044] FIG. 20 is a diagram showing the generally known water
phases;
[0045] FIGS. 21(A) and 21(B) are cross-sectional views illustrating
outlines of a cell freezer and a method of freezing a cell
according to a fourth embodiment of the present invention
respectively;
[0046] FIG. 22(a) is a plan view showing a cell culture chip 100
advantageously used in Example 1 of a fifth embodiment of the
present invention, and FIG. 22(b) is a cross-sectional view showing
the cell culture chip 100 taken along the line A-A in FIG. 22(a)
and viewed in the direction indicated by the arrow;
[0047] FIG. 23(a) is a conceptual diagram for illustrating
configuration of a system for distributing a cell to the cell
culture chip 100 in Example 2, and FIG. 23(b) is a cross-sectional
view showing the state in which the cell has been placed in a
hydrophilic area 4 of the cell culture chip 100;
[0048] FIG. 24 is a conceptual diagram illustrating system
configuration in Example 3 in which the function for exchanging a
droplet 15 enveloping a cell 12 with a new culture fluid in the
system configuration in Example 2 is emphasized;
[0049] FIG. 25 is a conceptual diagram showing system configuration
in Example 4 in which the function for recovering a cell from
inside of the droplet 15 enveloping a prespecified cell 12 in the
system configuration shown in Example 2 is emphasized;
[0050] FIG. 26(a) is a plan view showing another configuration of
the cell culture chip 100 in Example 5 advantageously applicable to
a fifth embodiment of the present invention; FIG. 26(b) is a
cross-sectional view showing the cell culture chip 100 above taken
along the line A-A in the plan view and viewed in the direction
indicated by the arrow; and FIG. 26(C) is a view illustrating a
method of forming a droplet;
[0051] FIGS. 27(a) and 27(b) are views showing a tip of a pipet
having two flow paths;
[0052] FIG. 28(a) is a perspective view showing a substrate
applicable to the droplet manipulation according to a sixth
embodiment of the present invention, FIG. 28(b) is a perspective
view showing the substrate in which discrete droplets to be reacted
are placed on a surface of the substrate, and FIG. 28(c) is a
perspective view schematically showing the substrate during the
droplet manipulation;
[0053] FIGS. 29(a) and 29(b) are views each illustrating a
procedure for charging a droplet in a droplet holding area, FIG.
29(a) is a view showing the initial state in the process for
charging the droplet, and FIG. 29(b) is a view showing the state in
which the charged droplet has been removed to the droplet holding
area;
[0054] FIG. 30(a) is a cross-sectional view showing the relation
between an electrode portion for charging in the droplet holding
area of a substrate 100 and a switchboard 74, and FIG. 30(b) is a
cross-sectional view showing the relation between an electrode
portion for discharging in the droplet holding area of the
substrate 100, and the switchboard 74;
[0055] FIG. 31 is a view schematically showing the configuration in
which a droplet including a cell 62 is formed at a tip of a pipet
61, and the cell is distributed, while optically monitoring, to the
droplet holding area of the substrate 100;
[0056] FIG. 32 is a view schematically showing the state in which a
droplet 105 is being transferred with a manipulation rod 107 on a
droplet transfer line shown in FIG. 28;
[0057] FIG. 33 is another view schematically showing the state in
which a droplet 105 is being transferred with a manipulation rod
107 on a droplet transfer line shown in FIG. 28;
[0058] FIG. 34 is a view illustrating configuration and
manipulation method for giving electric charge to a droplet;
[0059] FIG. 35 is a view for illustrating configuration and a
manipulation method for controlling flight of a charged droplet 58
to give an electric charge to a droplet;
[0060] FIG. 36(a) is a plan view showing the cell culture chip 100
advantageously applicable in Example 1 of a seventh embodiment of
the present invention, and FIG. 36(b) is a cross-sectional view
showing the cell culture chip 100 taken along the line A-A in the
plan view and viewed in the direction indicated by the arrow;
[0061] FIG. 37 is a schematic diagram showing an outline of a
device for controlling size of a droplet in Example 1;
[0062] FIG. 38 is a schematic diagram showing Example 2 in which
size of each discrete droplet among a plurality of droplets on a
substrate 1 is controlled;
[0063] FIG. 39 is a schematic diagram showing Example 3 in which
operations of forming two types of droplets on a substrate 50,
mixing the droplets to each other, and transferring the mixture
droplet to a prespecified position can be easily performed;
[0064] FIG. 40 is a plan view schematically showing an example of a
structure of a cell culture micro-array with an electrode according
to Example 1 of an eighth embodiment of the present invention;
[0065] FIG. 41 is a cross-sectional view showing the cell culture
micro-array shown in FIG. 40 taken along the line A-A and viewed in
the direction indicated by the arrow;
[0066] FIG. 42 is a plan view showing Example 2 of the eighth
embodiment;
[0067] FIG. 43 is a cross-sectional view showing the cell culture
micro-array shown in FIG. 42 taken along the line B-B and viewed in
the direction indicated by the arrow;
[0068] FIG. 44 is a plan view showing Example 3 in which a
plurality of cell culture zones 2 most important in the practical
use are adjoined to each other and formed as a one-dimensional
array;
[0069] FIG. 45 is a plan view schematically showing one example of
a structure of a cell reconstituting device having a circuit
between different types of cells according to Example 1 of a ninth
embodiment of the present invention;
[0070] FIG. 46 is a view schematically showing a cross section of a
cell reconstituting device shown in FIG. 45 taken along the line
A-A and viewed in the direction indicated by the arrow, and also
showing an optical system for forming a tunnel communicating
between cell holding zones in the device as well as a control
system for the optical system;
[0071] FIG. 47 is a plan view schematically showing an example of
the cell reconstituting device having a circuit between different
types of cells according to Example 2 of the ninth embodiment;
[0072] FIG. 48 is a view schematically showing a cross section of a
cell reconstituting device shown in FIG. 47 taken along the line
A-A and viewed in the direction indicated by the arrow, and also
showing an optical system for forming a tunnel communicating
between cell holding zones in the device as well as a control
system for the optical system;
[0073] FIGS. 49(A) and 49(B) are waveform diagrams each showing a
result of assessment for influences, in a case that a network
consists of a socillating myocardial cell and a neurocyte, when an
electric stimulus is given to the neurocyte;
[0074] FIG. 50 is a plan view showing a different type cell
bioassay chip in which cell holding zones are placed in the array
state and the zones are correlated to each other;
[0075] FIGS. 51(A) to 51(D) are views each showing an example in
which a cell is cultured on a cellulose membrane according to
Example 1 of a tenth embodiment of the present invention, the
cultured cells are recovered in the sheet state, and further a
multi-layered cell sheet is formed;
[0076] FIG. 52(A) is a plan view showing a cell culture support
body functioning as a support body for holding a cellulose sheet,
FIG. 52(B) is a cross-sectional view showing the cell culture
support above taken along the line A-A in FIG. 52(A) and viewed in
the direction indicated by the arrow, and FIG. 52(C) is a
cross-sectional view showing the cell culture support above taken
along the line B-B in FIG. 52(A) and viewed in the direction
indicated by the arrow;
[0077] FIG. 53(A) is a cross-sectional view corresponding to a view
taking along the line A-A in FIG. 52 and viewed in the direction
indicated by the arrow, illustrating the situation in which the
cell sheet described in Example 1 is formed by using the substrate
100 illustrated in FIG. 52, and FIG. 53(B) is a cross-sectional
view showing the same situation taken along the line B-B and viewed
in the direction indicated by the arrow;
[0078] FIG. 54(A) is a perspective view showing a cell culture
micro-chamber according to Example 1 of an eleventh embodiment of
the present invention, and FIG. 54(B) is a cross-sectional view
showing the cell culture micro-chamber taken along the line A-A and
viewed in the direction indicated by the arrow;
[0079] FIG. 55 is a plan view showing an example of a cell culture
micro-chamber with a cell circuit formed thereon;
[0080] FIG. 56 is a cross-sectional view showing an example of a
cell structure construct 20 in which a circuit formed with a neural
cell 23 and a oscillating myocardial cell 24 is fixed on a
fibroblast sheet 22 on a cellulose membrane 21;
[0081] FIG. 57(A) is a perspective view showing the cell culture
micro-chamber, and FIG. 57(B) is a cross-sectional view showing the
cell culture micro-chamber shown in FIG. 57(A) taken along the line
B-B and viewed in the direction indicated by the arrow;
[0082] FIG. 58 is a schematic view for illustrating a system in
which a converging light is converted to heat with a micro-needle
and an agarose gel film 1 is processed with the heat;
[0083] FIG. 59 is a schematic view illustrating outline of the
situation in which a groove between wells 5 is formed on the
agarose gel film 1, during cell culture, with a micro-needle in the
same way as that illustrated in FIG. 58;
[0084] FIG. 60 is a plan view schematically showing an example of a
structure of a cardiac-myocyte-cell bioassay chip in Example 1 of a
twelfth embodiment of the present invention;
[0085] FIG. 61 is a cross-sectional view showing the
cardiac-myocyte-cell-bioassay chip shown in FIG. 60 taken along the
line A-A and viewed in the direction indicated by the arrow;
[0086] FIG. 62 is a view showing a transmission microscope image
accommodating oscillating myocardial cells in all of zones in the
cardiac-myocyte-cell chip in Example 1;
[0087] FIG. 63 is a diagram showing a measuring result of the
variation of palmic intervals in the cells in the
cardiac-myocyte-cell chip;
[0088] FIG. 64 is a cross-sectional view showing an example of a
structure of the cardiac-myocyte-cell bioassay chip in Example 4
with the cross section corresponding to that shown in FIG. 61;
[0089] FIG. 65 is a view illustrating an operation flow in a method
of recovering and analyzing biological materials in a cell
according to a thirteenth embodiment of the present invention;
[0090] FIG. 66(A) is an enlarged view schematically showing a tip
section 3 of a biological sample chip according to the thirteenth
embodiment, while FIG. 66(B) is a perspective view schematically
showing the biological sample chip according to the thirteenth
embodiment;
[0091] FIG. 67 is a diagram showing a quantitative comparison of
EpCAMs alternatively expressed in a cancerous focus cell in a
cancerouse colon tissue piece and in adjoining cells along the
cancer focus cell line;
[0092] FIG. 68 is a schematic view showing the situation in which a
plurality of PNAs having different sequences respectively labeled
with nanoparticles of gold having different diameters are
hybridizing at a tip section of the biological sample chip;
[0093] FIG. 69(A) is a schematic view showing a tip section of a
biological sample chip measuring targets, and FIG. 69(B) is a
cross-sectional view showing the tip section shown in FIG. 69(A)
taken along the line A-A and viewed in the direction indicated by
the arrow;
[0094] FIG. 70 is a view schematically showing a tip section 3 of
the biological sample chip in Example 4;
[0095] FIG. 71 is a view showing outline of a flow of operations
for sampling mRNA which is an intracellular biological material in
Example 1 of a fourteenth embodiment of the present invention;
[0096] FIG. 72 is a view showing a specific example of a needle 43
used in Example 2;
[0097] FIG. 73 is a view showing outline of a method of sampling
mRNA which is an intracellular biological material in Example
2;
[0098] FIG. 74(A) is a view showing a tip section 53 of a needle
which may be employed in Example 3, while FIG. 74(B) is a
perspective view showing general configuration of the needle which
may be employed in Example 3;
[0099] FIG. 75 is a schematic diagram showing a process flow for
acquiring matured mRNAs in Example 1 of a fifteenth embodiment of
the present invention;
[0100] FIG. 76 is a view illustrating outline of a process for
converting, of the mRNAs obtained in steps 1 to step 5 shown in
FIG. 75, only those having the substantially full length to
cDNAs;
[0101] FIG. 77 is a schematic diagram showing an initial stage
(step 1) of a process flow for acquiring matured mRNAs in Example
2;
[0102] FIG. 78(a) to 78(c) are views each showing an example of
configuration of a tip section of a capillary 5 which can be used
in Example 1 or in Example 2;
[0103] FIGS. 79(A) and 79(B) are views each illustrating a
contrivance in an operation for inserting the capillary 5 into a
cell, for reducing damages to the cell;
[0104] FIG. 80(a) is a cross-sectional view schematically
illustrating outline of a method of making a biological material
separation chip which can be used in a biochemical material
separator in Example 1 of a sixteenth embodiment of the present
invention, while FIG. 80(b) is a cross-sectional view schematically
showing one example of a structure of the completed biological
material separation chip;
[0105] FIGS. 81(a) to 81(g) are views each schematically
illustrating outline of a process for forming a substrate 1 of a
biological-material separation-chip 100, and each view shows a
cross section on the left side and a plan view corresponding to the
cross section on the right side;
[0106] FIG. 82 is a view for illustrating an example of a
biological-material separation by a biological material separation
chip 100 with a transporter 12 fixed to a pore thereof;
[0107] FIG. 83 is a cross-sectional view showing outline of a
biological material separator in Example 2 in which three sheets of
biological material separation chips 100 stored in a buffer suited
to cell culture are combined with each other;
[0108] FIG. 84 is a perspective view showing an appearance of the
biological material separator in Example 2 in which three sheets of
biological material separation chips 100 are combined with each
other;
[0109] FIGS. 85(a) to 85(e) are views illustrating a procedure for
preparing a biological material separation chip with a nucleic
membrane fixed to a tip section of the capillary chip in Example
3;
[0110] FIG. 86 is a view illustrating a specific example in which
an mRNA is separated and acquired by using the biological material
separation chip in Example 3;
[0111] FIG. 87 is a view illustrating a simple method of realizing
the example of triple structure in Example 2 with the glass
capillary in Example 3;
[0112] FIG. 88 is a cross-sectional view showing outline of the
relation between a cell chip in Example 1 of a seventeenth
embodiment of the present invention and a cell fixed to a pore
portion thereof;
[0113] FIGS. 89(a) to 89(g) are views each illustrating outline of
a process for forming a cell fixing substrate 1 in Example 1;
[0114] FIG. 90 is a cross-sectional view showing outline of the
relation between the cell chip in Example 2 and a cell fixed to a
pore portion thereof;
[0115] FIGS. 91(a) to 91(d) are views illustrating outline of a
process for forming a cell fixing substrate 41 in Example 2;
[0116] FIG. 92 is a conceptual diagram showing an example of a
molecule measuring device based on detection of scattered light by
making use of a resonance plasmon according to an eighteenth
embodiment of the present invention;
[0117] FIG. 93 is a conceptual diagram showing a result of
measurement with a photon counter 6;
[0118] FIG. 94(A) is a cross-sectional view showing an example in
which the measuring device based on the concept described in
Example 1 is formed with a substrate and a chip-like detector
placed on the substrate, while FIG. 94(B) is a plan view showing
outline of the relation between the substrate of the measuring
device and the chip-like detector placed on the substrate;
[0119] FIG. 95 is a cross-sectional view showing a measuring device
in Example 3, in which a chip with a cell membrane including a
transporter adhered thereon is placed on the chip-like detector of
the measuring device described in Example 2;
[0120] FIG. 96 is a cross-sectional view showing a measuring device
in which a tubule with a cell membrane including a transporter
adhered thereon is placed outside the chip-like detector of the
measuring device described in Example 1;
[0121] FIG. 97 is a perspective view conceptually showing a portion
of a DNA chip in Example 1 of a nineteenth embodiment of the
present invention;
[0122] FIG. 98 is a view schematically showing a more detailed
relation among DNA probes fixed on each element 1, a DNA piece
prepared by hybridizing the DNA probe, and an AFM probe for
detecting the DNA piece;
[0123] FIGS. 99(a) to 99(c) are views illustrating an effect of a
pillar 4 for speeding up the probe hybridization;
[0124] FIG. 100 is an explanatory view illustrating details of the
effect provided by the pillar shown in FIG. 99;
[0125] FIG. 101 is a view schematically showing a position signal
for an AFM probe 60 obtained by scanning the chip 100 shown in FIG.
97 with the AFM probe 60 in the lateral direction;
[0126] FIGS. 102 (a) to 102(c) are views illustrating the effect of
the pillar 4 in Example 2 for speeding up probe hybridization;
[0127] FIG. 103 is an explanatory view illustrating details of the
effect shown in FIG. 102;
[0128] FIG. 104 is a perspective view showing an example of
configuration of an AFM cantilever well suited to the nineteenth
embodiment of the present invention;
[0129] FIG. 105 is a view schematically showing each relation among
DNA probes fixed on each element, a DNA piece obtained by
hybridizing the DNA probe, and a scanning electron microscope
detecting the DNA piece and the DNA probe in a twentieth embodiment
of the present invention;
[0130] FIG. 106 is a view schematically showing a scanning electron
microscope image obtained by two-dimensionally scanning the chip
100 shown in FIG. 97 with a scanning electron microscope;
[0131] FIG. 107A is a plan view showing a DNA probe chip
advantageously applicable to a twenty first embodiment of the
present invention;
[0132] FIG. 107B is a cross-sectional view showing the DNA probe
chip 100 shown in FIG. 107A taken along the line A-A and viewed in
the direction indicated by the arrow;
[0133] FIG. 108A is a view showing the state in which a sample
liquid including a target polynucleotide is introduced on a surface
of the DNA probe chip 100 described with reference to FIGS. 107A
and 107B;
[0134] FIG. 108B is a view showing the state in a step of process
for forming a concentration gradient of the target polynucleotide
on a surface of the DNA probe chip 100;
[0135] FIG. 108C is a view showing the state in the next step for
forming the concentration gradient as a cross-sectional view;
[0136] FIG. 109 is a diagram showing the effect in Example 2;
[0137] FIG. 110A is a view schematically showing the situation in
which a probe 12-3 and a target polynucleotide 14 hybridize with
each other using a root portion of the probe 12-3 (a portion close
to a surface of the DNA probe chip) as a nuclear for
hybridization;
[0138] FIG. 110B is a view schematically showing the situation in
which the probe 12-3 and the target polynucleotide 14 hybridize
with each other using a tip portion of the probe 12-3 (a portion
close to a free edge of the DNA probe chip) as a nuclear for
hybridization;
[0139] FIG. 111 is a diagram showing a comparison of hybridizations
under the state of being formed a concentration gradient of the
target polynucleotide on a surface of a substrate;
[0140] FIG. 112 is a view showing a case where the probe in Example
4 is used in the case shown in FIG. 110A showing the situation in
which a probe 12-3 and a target polynucleotide 14 hybridize with
each other using a root portion of the probe 12-3 (a portion close
to a surface of the DNA probe chip) as a nuclear for
hybridization;
[0141] FIG. 113 is a view schematically showing the state in which
an edge of a probe 12-1 is configured based on the concept
according to a twenty-second embodiment of the present
invention;
[0142] FIG. 114 is a diagram showing a comparison between a result
obtained when a sample with SEQ No. 11 is processed with a DNA
probe chip with a probe with SEQ. No. 13 fixed to the 5' terminal
thereof (as indicated by a characteristic curve 111) and a result
obtained when the sample with SEQ No. 11 is processed with a DNA
probe chip with SEQ. No. 13 fixed to the 3' terminal thereof (as
indicated by a characteristic curve 113);
[0143] FIG. 115A is a plan view showing the DNA probe chip 100
advantageously applicable in a twenty third embodiment of the
present invention;
[0144] FIG. 115B is a cross-sectional view showing the DNA probe
chip 100 shown in FIG. 115(A) taken along the line A-A and viewed
in the direction indicated by the arrow;
[0145] FIG. 115C is a cross-sectional view showing details of a
probe fixing area of the DNA probe chip 100 advantageously
applicable to the twenty third embodiment;
[0146] FIG. 116A is a cross-sectional view showing the state in
which a sample liquid containing a target polynucleotide is
introduced onto a surface of the DNA probe chip;
[0147] FIG. 116B is a cross-sectional view showing the state in a
first step of a process for forming a concentration gradient of the
target polynucleotide from a solid-liquid interface between a
surface of the DNA probe chip and of a sample liquid toward a
sample liquid;
[0148] FIG. 116C is a cross-sectional view showing the state in the
next step for forming the concentration gradient;
[0149] FIG. 117 is a diagram showing the effect in Example 2;
[0150] FIG. 118 is a view schematically showing the state in which
an edge of the probe 12-1 is configured based on the concept
according to a twenty third embodiment of the present invention and
is fixed to a surface of a pillar 7;
[0151] FIGS. 119(A) and 119(B) are an enlarged plan view and a
cross-sectional view, respectively, showing probe fixing areas 4
according to a twenty fourth embodiment of the present invention
and described in relation to FIG. 107 around one of the areas at a
center;
[0152] FIGS. 120(A) and 120(B) are an enlarged plan view and a
cross-sectional view, respectively, showing the probe fixing areas
4 described in relation to FIG. 107 around one of the areas at a
center;
[0153] FIG. 121A is a cross-sectional view showing the state in
which a sample liquid containing a target polynucleotide is
introduced onto a surface of the DNA probe chip 100 described with
reference to FIG. 107, FIG. 119, and FIG. 120;
[0154] FIG. 121B is a cross-sectional view showing the state where
a first step of the process for forming a concentration gradient of
a target polynucleotide from a solid-liquid interface between a
surface of the DNA probe chip 100 and a sample liquid toward the
sample liquid is being performed;
[0155] FIG. 121C is a cross-sectional view showing the state in
which the next step of a process for forming a concentration
gradient is being performed;
[0156] FIGS. 122(A) to 122(F) are views illustrating the effect in
Example 2;
[0157] FIG. 123 is a diagram showing an example of a result of
examination concerning the fluorescence intensity by varying a
period of time for capturing a target polynucleotide with reference
to conditions of an electric field loaded to the DNA probe chip as
parameters;
[0158] FIG. 124 is a cross-sectional view showing the DNA chip in
Example 3 in which a surface area is increased by preparing a
number of wells on the substrate;
[0159] FIG. 125 is a perspective view conceptually showing as a
portion of the DNA chip in Example 1 of a twenty fifth embodiment
of the present invention;
[0160] FIG. 126 is a conceptual diagram illustrating the situation
in which the probe chip 1 described with reference to FIG. 125 is
being monitored with a scanning electron microscope;
[0161] FIG. 127 is a conceptual diagram illustrating a method of
identifying an mRNA to which a labeling probe of gold nanoparticle
is hybridized based on a correspondence between an SEM image and an
element analysis image;
[0162] FIG. 128 is a view illustrating a concept of a biological
sample measurement in Example 3 of a twenty sixth embodiment;
[0163] FIG. 129 is a view illustrating identification of positions
and sizes of indexing particles 41 to 44 and assessment of a
specific biological material to which a labeling particle
hybridized to the indexing particles 41 to 44 is added;
[0164] FIG. 130(A) is a view schematically showing the indexing
particles 41 to 44 in Example 3 and probes fixed to the surface of
the particles respectively, FIG. 130(B) is a view schematically
showing specific biological materials hybridizing to the probes
with labeling particles added thereto, and FIG. 130(C) is a view
schematically showing the situation in which the probes and the
specific biological materials have been hybridized to each
other;
[0165] FIG. 131(A) is a view schematically showing the indexing
particles in Example 4 and probes respectively fixed to the surface
of the particles, FIG. 131(B) is a view schematically showing the
specific biological materials each with poly A hybridizing to
probes, and FIG. 131(C) is a view schematically showing a poly T
with a label hybridizing to poly A added thereto;
[0166] FIG. 132 is a view showing an operation for mixing
particles, a sample, and a label, and a result that hybrids of DNA
probes of the respective indexing particles, respective mRNAs, and
poly-T gold nanoparticles have been obtained;
[0167] FIG. 133 is a view showing the on-going situation during a
process potentially providing the more precise result as compared
to the homogeneous reaction illustrated in FIG. 132 in which the
indexing particles, sample mRNAs, and poly T-gold nanoparticles are
reacted simultaneously;
[0168] FIG. 134(A) is a view schematically showing discrete probes
fixed to the surfaces of the indexing particles like in Example 4
and Example 5, FIG. 134(B) is a view schematically showing the
state in which, to specific biological materials with the poly A
hybridizing to discrete probes added thereto are further added
probes for a sequence in another portion of the same specific
biological material, FIG. 134(C) is a view schematically showing an
example in which synthetic olygonucleotides (20 to 50 bases)
complementary to the probes having the sequence described above is
labeled with gold nanoparticles (20 nm), and FIG. 134(D) is a view
showing the state of the indexing particles, the samples, and the
gold nanoparticle oligonucleotide, after hybridization;
[0169] FIGS. 135(A) to 135(D) are views illustrating an example of
detection of multiple biological materials by means of the
antigen-antibody reaction;
[0170] FIG. 136 is a view schematically showing the situation in
which a separated band is formed by electrophoresis in Example 1 of
a twenty seventh embodiment of the present invention;
[0171] FIGS. 137(A), 137(B), and 137(C) are views schematically
showing melting and recovery of the separated band shown in FIG.
136 with heat;
[0172] FIGS. 138(A) and 138(B) are waveform diagrams each showing a
dot 11 of the separated band obtained as described above and a
result of analysis of a solution obtained by PCR amplification
before separation;
[0173] FIG. 139 is a schematic diagram showing configuration of a
device for recovering a specific band separated by two-dimensional
electrophoresis;
[0174] FIG. 140 is a view showing a recovery method in Example 2
which is different from a method of recovering a thermally melted
gel of the electrophoretic spot section melted by being heated with
converged light and a structure of a pipet used in the method;
[0175] FIG. 141(A) is a plan view showing a cell holding substrate
100 advantageously applicable in a twenty eighth embodiment of the
present invention, while FIG. 141(B) is a cross-sectional view of
the cell holding substrate 100 shown in FIG. 141(A) taken along the
line A-A and viewed in the direction indicated by the arrow;
[0176] FIG. 142(A) is a conceptual diagram illustrating an example
of configuration of a system for preparing a droplet containing a
cell in a hydrophilic area 3 of the cell holding substrate 100
advantageously applicable to the twenty eighth embodiment, while
FIG. 142(B) is a cross-section of a result of preparation of the
droplet containing a cell in the hydrophilic area 3 of the cell
holding substrate 100;
[0177] FIG. 143 is a perspective view showing outline of an example
of a device for destroying a cell in a droplet 15 on the substrate
as a target as described with reference to FIG. 141 and FIG.
142;
[0178] FIG. 144 is a conceptual diagram illustrating a specific
example of recovery of a biological material directly from a
suspension of cell pieces in the droplet 15 with the cell destroyed
therein;
[0179] FIG. 145 is a waveform diagram showing an example of a
migration pattern obtained by electrophoresis;
[0180] FIG. 146(A) is a plan view of a reaction substrate 100
advantageously applicable in a twenty ninth embodiment of the
present invention, while FIG. 146(B) is a cross-sectional view
showing the reaction substrate 100 shown in FIG. 146(A) taken along
the line A-A and viewed in the direction indicated by the
arrow;
[0181] FIG. 147(A) is a conceptual diagram illustrating an example
of configuration of a system for preparing a droplet containing a
material to be reacted to the hydrophilic areas 31 and 33 of the
reaction substrate 100 advantageously applicable in the twenty
ninth embodiment, while FIG. 147(B) is a plan view showing a
portion of the reaction substrate 100 with the droplet containing a
material to be reacted to the hydrophilic areas 31 and 33 of the
reaction substrate 100 formed thereon;
[0182] FIG. 148(A) is a perspective view showing outline of an
example of a device for making two droplets 15.sub.1, 15.sub.2
formed on the reaction substrate 100 as shown in FIG. 147(B) run
into and react with each other, while FIG. 148(B) is a plan view
schematically showing the situation in which the two droplets
15.sub.1, 15.sub.2 run into each other to form one droplet;
[0183] FIG. 149 is a waveform diagram showing change over time in
fluorescence intensity obtained by monitoring the fluorescence
intensity of a droplet 15.sub.3;
[0184] FIG. 150 is a plan view showing a example of the reaction
substrate 100 which may advantageously be used for spectroscopic
measurement with a microspectroscope;
[0185] FIG. 151(A) is a plan view showing a measuring substrate 100
advantageously applicable in Example 1 of a thirtieth embodiment of
the present invention and a conceptual diagram showing a measuring
system constructed with the measuring substrate as a basis, while
FIG. 151(B) is a cross-sectional view showing the measuring
substrate 100 shown in FIG. 151(A) taken along the line A-A on the
plan view of the measuring substrate 100 and viewed in the
direction indicated by the arrow;
[0186] FIG. 152 is a conceptual diagram illustrating an example of
configuration of a system for preparing a droplet at a left edge of
a hydrophilic line 4 on the measuring substrate 100 advantageously
applicable in the thirtieth embodiment and also for measuring the
droplet;
[0187] FIG. 153 is a characteristic diagram in which absorption of
light measured in Example 1 is plotted;
[0188] FIG. 154(A) is a plan view showing a measuring substrate 100
advantageously applicable in Example 2 and a conceptual diagram
showing a measuring system configured with this measuring
substrate, while FIG. 154(B) is a cross-sectional view showing the
measuring substrate 100 shown in FIG. 154(A) taken along the line
A-A on the plan view of the substrate 100 and viewed in the
direction indicated by the arrow; and
[0189] FIG. 155 is a conceptual diagram illustrating an example of
configuration of a system for preparing a droplet at a left edge of
the hydrophilic line 4, migrating the droplet with surface elastic
wave, and measuring the migration.
DESCRIPTION OF THE PREFERRED EMBODIMENT
[0190] The present invention is described below with reference to
specific embodiments, and the embodiments are independent from each
other, and in a case where an embodiment has some connections with
another embodiment, the relation is described, for instance, with
reference to the related drawings.
[0191] (A) At first, a method of and a device for separating a
target cell without any substantial damage thereto are
described.
[I] First Embodiment
[0192] Descriptions are provided below for a centrifugal chip and a
centrifugation method enabling separation of a cell or a granule
from a minute quantity of sample liquid by centrifugation as a
first embodiment of the present invention.
[0193] In the first embodiment, a chip for centrifugation is
attached to a rotary plate rotating around a rotary shaft. The chip
for centrifugation includes flow paths for supplying a plurality of
solutions having different specific gravities respectively onto a
substrate, a separation chamber functioning as a separation area in
which the flow paths converge, and a plurality of flow paths
branching from the separation chamber. Reservoirs are provided at
entrances and exits of all flow paths for supplying solutions
having different specific gravities respectively to the flow paths,
and in this configuration distances of all reservoirs at entrances
to the flow paths from the rotary shaft are equal, and also liquid
levels in reservoirs at exits from the plurality of flow paths
branching from the separation chamber are equal to each other from
the rotary.
Example 1
[0194] FIG. 2 is a view showing outline of a centrifugal separator
according to a first embodiment of the present invention. In this
figure, the reference numeral 1 indicates a rotary plate, and a
space 2 is formed on a surface thereof for mounting a centrifugal
chip according to the first embodiment. The centrifugal chip can
easily be mounted to or dismounted from the space 2. The rotary
plate 1 is rotated by a motor 3 at a prespecified rotational speed
in the horizontal direction. The reference numeral 4 indicates a
light source, which irradiates light onto a separation section of
the centrifugal chip mounted on the rotary plate 1. The reference
numeral 5 indicates a lens, which converges the light transmitted
through the separation section of the centrifugal chip. The light
converged by the lens 5 is reflected by a mirror 6, and the image
is picked up by a high speed camera 7. The reference numeral 8
indicates a personal computer, which analyzes the separation
section of the centrifugal chip photographed by the high speed
camera 7 and computes a speed signal for the motor 3 to control a
rotational speed of the motor 3.
[0195] In Example 1, a sample can be separated monitoring the
separation state during centrifugation with the camera 7. Optical
separation of a sample can be performed by monitoring a degree of
separation with a monitor (not shown) equipped with the personal
computer 8, or a controlling a rotational speed of the motor 3 with
a program implemented in the personal computer 8. The observation
is performed, for instance, as described below. For instance, the
motor 3 is rotated at 1800 rpm and an image of the separation
section of the centrifugal chip mounted on the space 2 is monitored
with an optical system including the light source 4, lens 5, and
camera 7. In this step, the rotational speed of the motor is
controlled so that the number of passages of the centrifugal chip
under the light source per second is a multiple of an image
fetching rate of the high speed camera 13. With this control, an
image of the rotating centrifugal chip can be picked up like a
still picture. For instance, when photographing is performed with a
camera operating with the image fetching rate of 30 frames per
second, centrifugation should be performed by rotating the motor 3
with the rotational speed of 30.times.N/second (N: an integral
number or a fraction of an integral number). Therefore, in the
above case, by performed the centrifugation at the rotational speed
of 1800 rpm described above, an image of the sample like a still
image can be obtained. When a plurality of chips are photographed
simultaneously, by dividing the fetched image to those for each
discrete centrifugal chips with the personal computer 8, images of
each chip can be obtained.
Example 2
[0196] FIG. 3 is a plan view schematically showing configuration of
a centrifugal chip 100 advantageously applicable to a centrifugal
separator in Example 1. FIG. 4 is a perspective view schematically
showing cross-sectional configuration of a reservoir section of the
centrifugal chip 100 shown in FIG. 3.
[0197] The reference numerals 11, 12, 13 indicate flow paths, which
are independent from each other, for supplying solution having
different specific gravities respectively, and edges of the flow
paths are connected to reservoirs 21 to 23 on one side, and other
edges of the flow paths are connected to the separation chamber 17
on the other side. The drain flow paths 14, 15, 16 are connected to
the other edge of the separation chamber 17, and reservoirs 24 to
26 are connected to the other edges of the drain flow paths 14, 15,
16 respectively. Of the reservoirs 21 to 26 communicated to the
flow paths respectively, the reservoir 23 contains therein a
solution having the lowest specific gravity and including a sample,
and reservoirs 22, 21 contain the solutions with the specific
gravities in the descending order respectively. When the motor 3 is
rotated in this state to perform centrifugation, layers of
solutions 31, 32, 33 having the specific gravities in the
descending order are formed according to the centrifugal
acceleration in the separation chamber 17. Of the components of the
sample, those having specified gravities higher than that of the
solution 31 go into the solution layer 31, and those having the
specific gravities lower as compared to those going into the
solution layer 31 but higher as compared to the lowest specific
gravity go into the solution layer 32, and components having
specific gravities lower than the lowest one go into the solution
layer 33. The components are recovered into the reservoirs 24 to 26
through the drain flow paths 14, 15, 16 corresponding to each
solution layer respectively. Herein the reference numeral 30
indicates a difference between liquid levels viewed in the
direction of the centrifugal acceleration in the initial state of
the centrifugation. Because of the difference between the liquid
levels, each solution flows in the direction 35 indicated by the
arrow in the laminar flow state, and the components separated into
the laminar flow in the separation chamber 17 flow into the drain
flow paths 14, 15, and 16. What is important herein is the fact
that the liquid levels in the reservoirs 21 to 23 and reservoirs 24
to 26 are aligned with the solution having the lowest specific
gravity and therefore a liquid flow in each flow path is prevented
from being disturbed.
[0198] Configuration of this centrifugal chip 100 is as described
below. The flow paths 11 to 16 and separation chamber 17 are formed
on one face of the PDMS substrate by casting, and the reservoirs 21
to 26 are formed with glass on the other face of the substrate and
adhered thereto. The flow paths 11 to 16 and reservoirs 21 to 26
are communicated to each other with a hole penetrating the
substrate. External dimensions of the chip are 30.times.30 mm.
Although the centrifugal chip 100 is shown with a fan-like form in
the figure, there is no restriction over an external form of the
chip so long as the chip can be mounted on the space 2 of the
rotary plate 1. At first, descriptions are provided for the casting
mold for forming the flow paths 11 to 16 and the separation chamber
17 on the substrate.
[0199] A casting mold is used for mass production. At first a
cleaned glass substrate or a silicon substrate is subjected to
ashing for 5 minutes with oxygen plasma for removing organic
materials deposited on a surface thereof. Then the substrate is
spin-coated with SU 8-25 which is a photosensitive resist.
Excellent spin coat can be obtained by executing the spin coating
at 500 rpm for 10 seconds, and then at 2000 rpm for 30 seconds. The
glass substrate with SU8-25 homogeneously coated thereon by spin
coating is pre-baked for 1 minute at 75.degree. C., and then at
100.degree. C. for 5 minutes on a hot plate to form a layer of
SU8-25 with the thickness of 25 .mu.m. The SU8-25 layer is exposed
to UV light for 15 seconds with a chromium mask with a form
corresponding to the flow paths 11 to 16 and separation chamber 17
punched out thereon. Then the glass substrate is baked at
75.degree. C. for 3 minutes and then at 100.degree. C. for 5
minutes on a hot plate. Development is performed using a SU-8
developer according to instructions in a prespecified manual. A
not-polymerized portion of the SU8-25 is removed with isopropanol,
and the substrate is baked at 160.degree. C. for 30 minutes to
obtain a casting mold. As a result, a projection with the height of
25 .mu.m for the flow paths 11 to 16 and the separation chamber 17
is formed on the glass substrate or the silicon substrate. In this
case, a width of each of the flow paths 11 to 16 is 50 .mu.m, that
of the separation chamber 17 (between the positions where the inlet
flow paths and outlet flow paths are attached respectively) is 4
mm, and the width of the separation chamber 17 in the centrifugal
direction is 150 .mu.m (=50 .mu.m.times.3).
[0200] Next descriptions are provided for a method of preparing a
centrifugal chip using this casting mold. On the glass substrate or
the silicon substrate, a wall with the height of 1.5 mm is provided
to surround the casting mold for a projection with the height of 25
.mu.m for the flow paths 11 to 16 and separation chamber 17.
Internal size of this wall is 30.times.30 mm which is the same as
the external size of the chip. A PDMS monomer mixture liquid
prepared according to instructions provided in the manual is filled
and then degassed and is heated at 75.degree. C. for 30 minutes in
an air constant temperature bath to polymerize PDMS. In this step,
it is preferable to mount silicon wafer on a top surface of the
wall and held thereon so that the thickness of the PDMS monomer
mixture liquid layer is homogeneous. The wall is provided only for
sustain the PDMS monomer mixture liquid, and therefore either a
glass substrate or a silicon substrate may be used for this
purpose. When the wall, silicon wafer, and casting mold are peeled
off from the polymerized PDMS, a substrate 41 is obtained, and this
substrate 41 has concaved portions formed on a surface of PDMS and
corresponding to the flow paths 11 to 16 and separation chamber 17.
FIG. 4 shows the state in which the flow paths 11 to 13 are formed
on a surface of the substrate 41.
[0201] Then through holes 43, 44, and 45 each with the diameter of
2 mm are provided with a punch at positions where the flow paths
and reservoirs are connected to each other on the substrate 41.
Then a glass plate 42 with the dimensions of 30.times.30 mm and
thickness of 1 mm is subjected to ashing for 10 seconds with oxygen
plasma, and is adhered to a surface of the substrate 41 (PDMS) on
which the flow paths 11 to 16 and separation chamber 17 are formed.
With this operation, the concave sections formed on the surface of
the substrate 41 and corresponding to the flow paths 11 to 16 as
well as to the separation chamber 17 are shielded with the glass
plate 42, thus the flow paths 11 to 16 and separation chamber 17
being completed.
[0202] The reservoirs 21 to 23 formed by adhering glass plates to
each other are adhered to a surface of the substrate 41 contrary to
that on which the flow paths and separation chamber are formed. The
reservoirs and PDMS are adhered to each other with covalent
bonding. In this step, the flow paths 11 to 13 are communicated to
the reservoirs 21 to 23 with the through holes 43, 44, 45 formed on
the substrate 41. FIG. 3 shows the state in which the flow paths 11
to 13 are communicated to the reservoirs 21 to 23 adhered on the
other surface of the substrate 41 via the through holes 43, 44, 45.
FIG. 4 shows only a cross-section of a portion to indicates that
the two surfaces of the substrate 41 are used, and therefore the
relations between the reservoirs 24 to 26 and the flow paths 14 to
16 are not shown, but it is easily understood from the figure that
the relations are the same as those shown in FIG. 3. Further it is
easily understood from this figure that the separation chamber 17
is formed, like the flow paths 11 to 13, on one surface of the
substrate 41. The reservoirs 21 to 23 are formed with a glass
plate, and therefore the reservoirs 21 to 23 should be shown with a
certain thickness respectively in FIG. 3, but only a contour
thereof is shown to simplify the figure. Further the reservoirs 21
to 23 are formed by adhering glass plates to each other, but the
reservoirs 21 to 23 may be molded on a glass plate having a
prespecified thickness, and the plate may be adhered for forming
the reservoirs 21 to 23.
[0203] Holes for injecting solutions therethrough are provided on a
top surface of the reservoirs 21 to 23 on the side close to the
rotation center, and the reservoirs 21 to 23 are basically
independent and separated with partition walls 51, 52 from each
other, and the partition walls 51, 52 are lacked in the upper
sections thereof at positions closed to the holes 46, 47, 48 for
injection of solutions.
[0204] Now descriptions are provided for a method of feeding
solutions into the reservoirs 21 to 23 of the centrifugal chip 100
to effect the state shown in FIG. 3 with reference to FIG. 4. At
first, a solution with the lowest specific gravity is poured from
the hole 48 for injection of a solution into the reservoir 23. In
this step, a large quantity of solution is poured into the
reservoirs 23 so that the solution is also poured into the other
reservoirs 22, 21 through the lacks 51, 52 of on the partition wall
51, 52 for the reservoirs 21 to 23. When a centrifugal force is
loaded in the state in which the reservoirs 21 to 23 are completely
filled with the solution having the lowest specific gravity, all of
the flow paths 11 to 16 and separation chamber 17 are completely
filled with the solution with the lowest specific gravity. The
liquid levels in the reservoirs 24 to 26 on the exit side are
aligned to the same level, centrifugation is stopped. In this
state, a solution having a higher specific gravity is poured from
the holes 47, 46 into the reservoirs 22, 21 by the quantities
almost equal to capacities of the respective reservoirs. As a
result, the solution having the lowest specified gravity is flooded
out from the reservoirs 22, 21 and is substituted with the solution
having the higher specific gravity. Further a sample solution
including a target for separation is poured into the reservoir 23.
This step corresponds to the state shown in FIG. 3. When the
centrifugal chip 100 is mounted on the space 2 of the rotary plate
1 and centrifugation is performed by driving the motor 3, the
solution layers are formed according to the specific gravities of
the solutions as shown in FIG. 2, and components in the sample
solution are separated into the solution layers according to the
specific gravities.
Example 3
[0205] FIG. 5 is a view schematically showing configuration of the
centrifugal chip 100 in Example 3. As clearly understood when the
centrifugal chip 100 in Example 3 is compared to that in Example 2
shown in FIG. 2, in the centrifugal chip in Example 3, distance of
the reservoirs 61, 62 on the sample side from the rotation center
10 is different from that of the reservoirs 63, 64 on the recovery
side. Because of this configuration, a larger G is loaded, during
rotation, to the reservoirs 61, 62 as compared to the reservoirs
63, 64, so that the potentials at liquid levels are different from
each other. Therefore the liquid flows in the direction indicated
by the arrow 69. Flow paths 65 to 68 from their respective
reservoirs are coupled to the separation chamber 70. In this
example, two types of solutions are used, and the solutions flow
from the reservoirs 61, 62 on the sample side to the reservoirs 63,
64 on the recovery side because of the difference in a centrifugal
force corresponding to the drop between the liquid levels. Also in
this step, it is important that distances of the levels of the
solution with high specific gravity in the reservoirs on the
entrance side and exit side and also distances of the levels of the
solution with low specific gravity on the entrance side and exit
side from the center of centrifugation are equal. To satisfy this
requirements, like in Example 2, it is desirable that the solution
with low specific gravity covers the solution with high specific
gravity in the reservoirs 63, 64. In addition, it is necessary to
align the liquid levels in the reservoirs 63, 64 on the recovery
side. If there is a drop between the liquid levels, a two-liquid
layer is not formed in the separation chamber 70.
[0206] Also in Example 3, dimensions of the centrifugal chip 100
are the same as those in Example 2. FIG. 6 is a perspective view
schematically showing the separation chamber 70 in Example 3. The
width of the separation chamber 70 is 100 .mu.m and the thickness
is 25 .mu.m in the direction in which G is loaded owing to a
centrifugal force. Flow paths 65, 66, and 67, 68 each having the
thickness of 25 .mu.m and width of 50 .mu.m are coupled to both
edges of the separation section respectively. Namely the
configuration is the same as that including the flow paths 11 to 13
formed on a surface of the substrate 41 shown in FIG. 4, though not
shown in FIG. 5.
(Description of Operations of the Separation Section)
[0207] FIG. 7 is a view schematically showing the situation in
which materials to be separated are moving in the separation
chamber 70 to which the flow path 55 for a solution with low
specific gravity and the flow path 56 for a solution with high
specific gravity are coupled. Descriptions are provided below for a
case in which a human erythrocyte and a human lymphocyte are
separated with the centrifugal chip 100 in Example 3.
[0208] At first, a PBS containing 2-methacryloxyethyl
phosphorylcholine polymer or BAS (pH 7.4) is put in the reservoirs
61, 62 of the chip to completely fill the flow paths 65 to 68 and
separation chamber 70 with the PBS, and is left for 30 minutes in
the state to coat surfaces of the flow paths with
2-methacryloxyethyl phosphorylcholine polymer or BSA. This
operation is important for preventing non-specific absorption of
cells. Then washing is performed with PBS to remove excessive BSA
and the like in the flow paths 65 to 68 and in the separation
chamber 70. Then PBS is filled in the reservoir 62 on the sample
side (for a solution with low specific gravity) as well as in the
reservoir 61 on the recovery side (for a solution with high
specific gravity). In this step, the liquid is poured into the
reservoirs up to a position above the lack on the partition wall
between the reservoirs described above so that a constant pressure
is loaded to the two flow paths (namely so that the liquid flows in
the two flow paths at the same flow rate. Then a solution with the
specific gravity adjusted to 1.077 is added in the reservoir 61 on
the recovery side (for the solution with high specific gravity),
and the reservoir is rotated at 1800 rpm to apply a centrifugal
force thereto so that the solution with low specific gravity and
that with high specific gravity are filled in the respective flow
paths. The operations are performed at the room temperature. Then,
an image of the separation chamber 70 is monitored with the optical
system described with reference to FIG. 2. In this case, as shown
in FIG. 7, it can be observed that the solution with low specific
gravity and solution with high specific gravity form a two-layered
laminar flow, and erythrocytes each shown with a large black circle
moves into the solution with high specific gravity and the
lymphocytes each shown with a small blank circle remain in the
solution with low specific gravity.
[0209] FIG. 8 is a view schematically showing the situation in
which separated materials are moving in the separation chamber 17
to which a flow path 13 for a solution with low specific gravity, a
flow path 12 for a solution with medium specific gravity, and a
flow path 11 for solution with high specific gravity are coupled.
In this case, descriptions are provided for an example in which
blood serum is separated with the centrifugal chip 100 in Example
1.
[0210] At first, as described by referring to FIG. 4 above, the
flow path 13 (for a solution with low specific gravity), two flow
paths 12, 11 (for a solution with medium specific gravity and for a
solution with high specific gravity) on the sample side, and
separation chamber 17 are washed. In this case, a specific gravity
of the solution with low specific gravity is adjusted to about 1,
that of the solution with medium specific gravity to 1.077, and
that of the solution with high specific gravity to 1.113. After
washing, the solution with low specific gravity is filled in the
reservoir 23 on the sample side (for the solution with low specific
gravity) and in the reservoirs 22, 21 on the recovery side (for
solutions with medium and high specific gravities). In this step,
the solution is filled up to a position above the lack on the
partition wall 51 between the reservoirs described above so that a
constant pressure is loaded to the three flow paths (namely, so
that the solutions will flow at the same flow rate in the three
flow paths). Next, the solutions with the specific gravities
adjusted to 1.077 and 1.113 are filled in the reservoirs 22, 21 on
the recovery side (for solutions with medium and high specific
gravities) respectively and centrifugation is performed at 1800
rpm, so that the solutions with low, medium, and high specific
gravities are filled in the respective flow paths. The operations
are performed at the room temperature. Then a sample (serum)
mixture solution is added in the reservoir 23 on the sample side
(for the solution with low specific gravity) and centrifugation is
carried out at 1800 rpm. In this state, an image of the separation
chamber 70 is monitored with the optical system described by
referring to FIG. 2, and in this case, as shown in FIG. 8, in the
separation chamber 17, the solutions with low, medium, and high
specific gravities form a three-layered laminar flow, and the
erythrocytes each shown with a large black circle move into the
solution with high specific gravity, polykaryocytes each shown with
a star mark move into the solutions with medium and high specific
gravities, and a monokaryocytes each shown with a small blank
circle remain in the solution with low specific gravity.
[0211] In this step, by adjusting the rotational speed of the
centrifugal chip 100 and the image fetching rate of the high speed
camera 101 to appropriate values, the images of the separation
state can be picked up as still images.
[II] Second Embodiment
[0212] Descriptions are provided below for a method of once
labeling a target cell to be separated with a particular material
for identification, separating the cell, and discharging the
particular material by a transporter present in the target cell
after separation thereof.
[0213] At first descriptions are provided for the use of a
transporter for labeling a target cell which is a feature of the
second embodiment.
[0214] The transporter is generally used for transporting an amino
acid such as glutamic acid, an oligopeptide such as dipeptide or
tripeptide or other various types of organic materials having a low
molecular weight through a cell membrane. Examples of transporters
advantageously applicable to the second embodiment are shown in
Table 1 each in relation to a labeling material and types of cells
to be labeled. In Table 1, a transporter name is shown in item 93,
a substrate moving through the cell membrane in item 94, and an
organ or a cell in which the transporter is expressed in item
95.
TABLE-US-00001 TABLE 1 Substrate Transporter Tissue, cell, organ
Glucose SLC2A1-6,8,10,11 Erythrocyte, leukocyte Fructose SLC5A1, 2
Lever, renal, intestine, lung Galactose Islet of Langerhans Brain
Fat cell Cardiac tissue Testis Placenta
[0215] It is needless to say that all of transporters present in
all cells have not yet been known, and there are orphan
transporters anticipated from the genome sequences, materials for
which transporters are unknown, and materials which can pass
through a cell membrane without using the channel as defined by the
term of "transporter", such as arginine oligomer described in Table
2. For instance, the second embodiment can be implemented, if it is
known that a material having the function involved in transport
through a cell membrane such as steroids, chemical substances, and
organic materials generally having a high lipophilicity easily
fetched into a cell is present. Namely, it is desirable to confirm
the presence of a substance capable of transporting various types
of fluorescent molecules or the like into and out from a cell.
TABLE-US-00002 TABLE 2 Substrate Transporter Tissue, cell, organ
(Arg)n (n = 6~8) -- Nuclei of most cells Lactoferrin -- Most cells
Fibroblast growth -- Most cells factor Herpes simplex virus -- Most
cells type 1 protein 22 HIV type 1 -- Most cells transactivator
protein Engrailed -- Most cells
[0216] In order to label a target cell with a specific material by
passing a transporter present in the target cell, the transporter
is required to be exposed in a solution containing a specific
labeling material to be passed for a prespecified period of time.
However, in order to eliminate the specific material from the
target cell by making a transporter pass therethrough after
separating the target cell, the target cell is cultured in a
solution not containing the specific labeling material for a
prespecified period of time, so that the target cell can be
separated causing little damage thereto. With the second
embodiment, the target cell can be recognized and separated without
damaging a cell surface thereof and a protein or a sugar chain of
cytoplasm thereof.
[0217] FIG. 9 is a flowchart showing processing steps in the method
of separating and collecting a cell according to the second
embodiment.
[0218] In step 1, a tissue piece containing a target cell desired
to be separated and collected is obtained, and is incubated in a
culture solution according to the known method. It is to be noted
that a targeted tissue piece may be, depending on the type thereof,
subjected to conditioning for 15 to 30 minutes prior to incubation.
To prevent the problem of dispersion of a specific material to be
intaked into the target cell, size of the tissue piece is
preferably small in general, and more preferably, the tissue piece
is sliced into a thin segment having 20 layers or less of a cell.
However, for instance, with an aim that a target cell present in
the upper portion of epithelium existing in a large intestine
tissue piece is labeled to separate the same from that reside in
the deep portion the epithelium, the tissue piece is preferably
sliced into a rather thick piece and is labeled via a transporter.
In this case, cells on the side opposite to the upper portion of
epithelium may be removed with a razor or the like after
labeling.
[0219] In step 2, a specific material to be intaked into a target
cell is added thereto employing a transporter presumably expressed
in the target cell.
[0220] The specific material herein includes sugar substances such
as glucose, fructose and galactose, amino acids such as glycine,
glutamic acid and .beta.-aminobutyric acid, an oligopeptide such as
dipeptide and tripeptide, various types of medicaments,
noradrenaline, dopamine, serotonin, or the like. Each specific
material is labeled for an easy detection. A fluorescent material
is used for labeling, and it is important that the fluorescent
material does not bring about a change in a charge of the specific
material. In addition, the fluorescent material with a size thereof
being as small as possible is suited for the purpose, and a
derivative of 6-(N-(7-nitrobenz-2-oxa-1.3-diazol-4-yl) or a
derivative of 4,4-difluoro-4-bora-3a,4a-diaza-s-indacene may be
employed. When an amino acid is used for labeling, in order not to
change a charge thereof, a linker portion coupling the amino acid
with a fluorescent material is adjusted so as not to cause a change
in the number of charges after fluorescent labeling. A method of
labeling without changing a charge of an amino acid may include,
for instance, introducing a labeling material by modifying an amino
group of the amino acid with imido esters. Imido esters react with
an amino acid at pH 8.5 to 9 to turn into imido amido, namely
amidine. An amidine group is protonated at a physiological pH, like
an amino group prior to the reaction, so that the amidine group is
not easily affected by a charge gap when the amidine group passes a
transporter.
[0221] In step 3, a cell is subjected to dispersion processing by
treating an issue piece with a specific material added thereto by
means of, for instance, trypsin.
[0222] In step 4, a dispersed cell is generally incubated for 15
minutes to 2 hours so that a specific labeling material is intaked
into a target cell. In this case, when, prior to the step of
separating and collecting a target cell to be implemented in step
5, the cells are rinsed with a culture solution not containing a
specific labeling material to remove the excessive one if any,
reproducibility is excellent and incorrect separation is scarce
owing to background noise, often leading to a good result.
[0223] In step 5, a target cell is separated and collected. A cell
separation chip and a cell separator used in this step 5 are
described hereinafter. Cell separation is optically recognized in
the course where a labeled image is flowing down in a fluid, and
cells having a prespecified level or more of fluorescent intensity
are collected. In this case, image recognition can be done by
recognition of a cell as a point light source, and for more
advanced type of cell separation, distribution of a specific
labeling material within a cell captured as an image is acquired,
and only a cell having a specific organelle with a specific
labeling material gathering therein can be separated. For instance,
only a cell having mitochondria with a specific labeling material
condensed therein can be separated.
[0224] In step 6, in order to remove a labeling material from cells
having a target cell with a labeling material as a foreign material
present therein, the cells are incubated in a culture solution not
containing a specific labeling material to remove the specific
labeling material from a target cell. Removal of the specific
labeling material may include reversibly excluding the same via a
transporter, excluding the same via a transporter related to a
foreign material release such as an ABC transporter, and
decomposing the same in lysosome.
[0225] Removal is possible with respect to a target cell obtained
according to the second embodiment, unlike the case in which a
labeling material is irreversibly bonded to a cell such as a CD
marker commonly used so far, so that the initial state of a target
cell can be advantageously preserved.
[0226] The aforementioned processing is described below more
specifically.
[0227] 10 .mu.M of a fluorescent labeled material is added to a
tissue piece collected, and the piece is incubated at 37.degree.
C., a portion thereof is taken out at regular intervals, and the
cells therein are dispersed according to the known method to be
separated with a cell separator described later. FIG. 10 is a view
showing general characteristics in a case where a cell with the
fluorescence intensity of 5000 or more is separated with a cell
separator, suggesting that intake of a fluorescent labeled material
into a target cell becomes constant in about 20 minutes. It should
be naturally understood that the period of time varies
significantly according to the size and state of a cell piece or
how to collect the same. It is needless to say that a user is
required to determine how to set conditions for one's own
samples.
[0228] Next is described whether separation of a target cell with a
fluorescent labeled material intaked therein from a cell with the
same not intaked therein is possible or not. FIG. 11 is a histogram
showing fluorescence intensity of a fluorescent labeled material
when the material is intaked into a target cell. The fluorescence
intensity is shown on the horizontal axis, and the number of cells
on the vertical axis on percentage. Two groups are generally
obtained as shown in the figure with lines 21, 22. The group shown
with the line 21 is regarded as a cell group not having been
labeled, while the cell group shown with the line 22 as a cell
group having been labeled.
[0229] Then the target cell group shown with the line 22 is
continued to be incubated in a culture solution not containing a
fluorescent labeled material, and a portion of the cells are taken
out at regular intervals to separate cells, for instance, with the
fluorescence intensity of 500 or more. FIG. 12 is a graph showing
culture time of cells on the horizontal axis and the separated
cells with the fluorescence intensity of 500 or more on the
vertical axis. In this case, the figure demonstrates that the
number of a cell with 90% of a labeling material removed therefrom
reaches 70% of the total cell number in 24 hours, and in 48 hours,
the labeling material is removed from almost all cells.
[0230] As described above, in the second embodiment, a material
capable of passing a transporter present in a target cell is used
as a labeling material, and the target cell, after separation, is
incubated in a culture solution not containing a material
fluorescently labeling the target cell, so that the target cell can
be returned to its original state (native state). This is an
important advantage because any foreign material does not get into
a target cell in the case, for instance, where a separated target
cell is returned to the body. Further in the cell researches, the
availability of quickly removing a labeling material for cell
separation makes it possible to minimize influences of the labeling
material over the cell, and therefore this technique can make a
great contribution to researches for accurately understanding the
cellular physiology.
[0231] With regard to a transporter, it is generally contemplated
that a plurality types of transporters exist in relation to one
type of substrate, and a different type(s) of transporter is used
according to the type or state of a cell. Therefore it is possible
to modify a specific material as an original substrate of a
transporter with a fluorescent material or to alter a side chain of
the substrate itself, so that specificity of the specific material
to a transporter can be altered. Thus the second embodiment in
which a target cell is identified and separated using a transporter
may be suited for identifying and separating a cell in various
phases of cytodiffentiation or in the active state.
[0232] As described above, in the second embodiment, a target cell
is separated and collected with the steps of: adding a specific
material passing a transporter into a target cell by making use of
a transporter for a target cell to be separated to introduce the
specific material into the target cell; detecting a target cell
with a specific material intaked therein using the cell separator
described above; and separating the target cell with the specific
material intaked therein by the cell separator, which makes it
possible to obtain a target cell with little damage. In this case,
the step of adding a specific material passing a transporter into a
target cell to introduce the specific material into the target cell
may be carried out, as the target cell is in just the state when it
was collected, without making any major treatment thereon, which is
effective for labeling a target cell in a further natural state
thereof. For instance, in order to divide a tissue piece into
discrete cells, treatment with an enzyme such as trypsin is
available, however, the cells each having kept a specific form up
to then become rounded, which may cause a trouble to the subsequent
use depending on the circumstances. In this case, the second
embodiment is designed to take steps for obtaining a target cell
further accurately by exposing a tissue piece as it is in a
solution containing a specific labeling material passing a
transporter for a prespecified period of time, and then treating
the tissue piece for being divided into discrete cells.
[0233] In the second embodiment, the aforementioned is applies to a
culture cell, namely, a single-layer cell is incubated on a surface
of a culture flask or the like, and then the cell is incubated as
it is in a solution containing a specific labeling material passing
a transporter, after which a cell group is divided into discrete
cells using trypsin or the like to separate and collect the
appropriate cells. In the conventional technology, a cell surface
antigen is labeled using a labeled antibody after a cell group is
divided into discrete cells, which means that labeling is conducted
after a cell is treated with trypsin or the like, so that only a
labeling material which is not affected even when a target cell is
denatured with this operation can be used.
[0234] Moreover, if the cell dispersion treatment is forced to be
executed after a cell surface antigen is labeled with a labeled
antibody, a protein portion of a molecule assembly comprising the
surface antigen or a labeled antigen is decomposed, thereby a state
with high reproducibility can not be obtained. In the second
embodiment, a material intaked in a target cell is used as a
labeling material, so that, even when labeling is conducted before
the cell dispersion processing, there is no possibility that the
labeling material is discomposed or eliminated like in the case
according to the conventional method. Further, if labeling is
carried out before the cell dispersion processing, even though the
subsequent operation changes the state of a cell, original
characteristics of the cell are maintained at the time of labeling,
enabling separation of a target cell without any problems.
[0235] A certain period of time is generally required for a
labeling material to be intaked into a target cell via a
transporter. Therefore a culture step may be provided in which a
sample possibly containing a target cell is incubated for a
prespecified period of time in a solution containing a specific
material passing a transporter present in the target cell. With
this step, a target cell can be labeled with a specific material
passing a transporter. After the above culture step is completed
and target cells each with a specific material for labeling
identification intaked therein are separated, another culture step
is added in which the separated target cells are exposed for a
prespecified period of time to a solution not containing a specific
labeling material passing the transporter described above, so that
the target cells finally obtained do not contain any specific
labeling material possibly having an effect on cell functions, or
contains the specific material but only to the extent that the
concentration of the same is reduced to have no effect on cell
functions.
(Example of a Cell Separation Chip)
[0236] FIG. 13 is a plan view schematically showing an example of a
cell separation chip adapted to implementation of a protocol for
cell separation according to the second embodiment. FIG. 14 is a
cross-sectional view of the cell separation chip shown in FIG. 13
taken along the lines A-A, B-B, C-C, and D-D and viewed in the
direction indicated by the arrows at respective positions. FIG. 14
shows, to avoid excessive complexity, only those viewed in the
vicinity of the cross section. FIG. 15 is a plan view schematically
showing an example of a cell separator with a plurality of cell
separation chips illustrated in FIG. 13 and FIG. 14 mounted
thereon.
[0237] Reference numeral 100 indicates a cell separation chip, size
of which is about 30 mm.times.40 mm. Reference numeral 50 indicates
a substrate, for instance, a mold substrate made of plastic
material having a thickness of about 1 mm. Reference numeral 51
indicates a cone-shaped hole for being poured a buffer containing a
target cell to be separated. Reference numerals 52 and 53 indicate
holes with the buffer poured therein. The hole 51 is 0.1 mm.phi. in
diameter of the bottom face and 5 mm.phi. of the top face. The
holes 52 and 53 are formed to penetrate the substrate 50 and are
about 3 mm.phi. in diameter. Reference numerals 55, 56 and 57 are
flow paths, each of whose one end is open to the holes 51, 52 and
53 respectively. The flow paths 55, 56 and 57 are formed on the
bottom face of the substrate 50, and have a height of about 50
.mu.m and a width of 100 .mu.m. On the top face of the substrate 50
is formed a buffer retention bath 54. The buffer retention bath 54
is designed to be about 10 mm in height and 10 mm.phi. in
diameter.
[0238] The flow paths 55, 56 and 57 are converged together on the
downstream side to form a flow path 59. A portion of the flow path
59 is provided to be a cell monitoring area 60, on the downstream
side of which is formed a cell separation area 70. The flow path 59
has, like the flow paths 55, 56 and 57, a height of about 50 .mu.m
and a width of 100 .mu.m. In the cell separation area 70 are
provided openings of gel for two gel electrodes opposing to each
other on both sides of the flow path 59. Each of the openings is
placed in a position slightly deviated from the flow direction of
the flow path 59. At the rear of the openings of gel for the gel
electrodes are formed spaces 61, 62 for holding gel, and each of
the spaces has the substantially same height as that of the flow
path 59, and is provided with gel supply holes 65, 66 respectively.
The gel supply holes 65, 66 are about 3 mm.phi. in diameter. On a
portion of the spaces 61, 62 are deposited metal thin films 63, 64,
and the thin films are extended from the bottom face of the
substrate to a side face thereof.
[0239] A flow path 71 as a flow path for a target cell to be
collected and a flow path 72 as a flow path for a target cell to be
discharged are provided on the downstream side of the cell
separation area 70. Each of the flow paths 71, 72 has, like the
flow paths 55, 56 and 57, a height of about 50 .mu.m and a width of
100 .mu.m. It is assumed herein that, when a cell flowing down is
determined to be labeled as a target in the cell monitoring area
60, voltage is not applied to the two gel electrodes on both sides
of the flow path 59, in the meantime, when a cell flowing down is
not determined to be labeled as a target, voltage is applied to the
two gel electrodes when the cell reaches the cell separation area
70. In this case, the two gel electrodes are placed in a position
slightly deviated from the flow direction of the flow path 59, so
that the direction of force acting on a cell owing to an electrical
field acted by the two gel electrodes can be turned to somewhat
upper right. Consequently, force in the direction in which a cell
flows down and that acting on the cell owing to an electrical field
is synthesized, and the cell is thereby acted by force heading in
the lower right direction, so that the flow path 72 as a flow path
for cells to be discharged is provided in a position of this
direction, and the cells to be discharged can be easily introduced
to the flow path 72. When a cell flowing down is determined to be
labeled as a target, because voltage is not applied to the two gel
electrodes on both sides of the flow path 59, the flowing-down
target cell flows, without delay, in the flow path 71 as a flow
path for cells to be discharged.
[0240] The other end of the flow path 72 is communicated to a
discharged-cell collecting hole 73. The discharged-cell collecting
hole 73 is about 3 mm.phi. in diameter. On the top face of the
substrate 50 is formed a buffer retention bath 74 communicating to
the discharged-cell collecting hole 73. The buffer retention bath
74 is, like the buffer retention bath 54, designed to be about 10
mm in height and 10 mm.phi. in diameter. The flow path 71 as a flow
path for target cells to be collected is connected to a dialysis
section 80. The dialysis section 80 extends from the top face to
the bottom face of the substrate 50, and forms a hooked flow path
therein. The end of the hooked flow path is communicated to a
collecting path 83. When the hooked flow path is designed to have a
flow path width of 100 .mu.m, a partition width of 100 .mu.m, and
the total size of 10 mm.times.10 mm, the total length thereof
results in about 50 cm. On the top of the hooked flow path is
attached a porous membrane (0.2 .mu.m) or a dialysis membrane
(molecular weight cut 100000 Da) to form a space 82 with a solution
not containing a fluorescent labeled material flowing down on the
top face thereof. On both ends of the space 82 are provided a
buffer retention bath 86 for supplying a buffer (a solution not
containing a fluorescent labeled material) and a buffer retention
bath 89 for collecting a buffer flowing down in the space 82. When
a target cell to be collected is flowing down in the hooked flow
path in the dialysis section 80, a specific labeling material
intaked in the target cell is removed by a solution not containing
a fluorescent labeled material. In order to sufficiently supply a
solution not containing a fluorescent labeled material, it is
desirable to replenish the retention bath 86 with a solution not
containing a fluorescent labeled material from a retention bath not
shown, and to discharge a collected solution not containing a
fluorescent labeled material from the retention bath 89. Reference
numeral 87 indicates a flow path connecting the retention 86 and
the space 82, while reference numeral 86 indicates a flow path
connecting the space 82 and the retention bath 89. These flow paths
are formed on the top face of the substrate 50. Since the retention
baths 86, 89 are intermediary baths, the size of which is designed
to be about 10 mm in height and 5 mm.phi. in diameter
respectively.
[0241] The dialysis section 80 on the substrate 50 may be a lack,
and in the lack may be embedded a unit with the dialysis section
80, the porous membrane or dialysis membrane 81 and the space 82
integrated therein. This has an advantage in manufacturing the
substrate 50 by molding.
[0242] The other end of the collecting path 83 is communicated to a
cone-shaped hole 85. On the top face of the substrate 50 is formed
a buffer retention bath 84 for collecting a target cell collected
via the collecting path 83 and a flowing-down buffer. The buffer
retention bath 84 is designed to be 10 mm in height and 10 mm.phi.
in diameter. Walls of various retention baths described above and
the space 82 are about 1 mm thick respectively.
[0243] As seen in FIG. 14, onto the bottom face of the substrate 50
is attached a plastic thin film 58 such as PMMA to complete the
flow path on the bottom face of the substrate 50. On the other
hand, on the top face of the substrate 50 are formed walls of
various retention baths described above and the space 82, and the
walls may also be those formed with plastic made of PMMA and
attached to the top face. The PMMA plastic may be substituted by
polyolefin plastic. The porous membrane can be obtained by periodic
acid-oxidizing a cellulose membrane (molecular weight cut off 30000
Da), partially introducing an aldehyde group therein, reacting the
membrane with avidin, and reduction-stabilizing a Schiff base
bonding with the hydroboration reaction, and attaching the
resultant membrane to a surface of a biotin-modified chip with the
biotin-avidin bonding. Biotinylation of a chip surface is
introduced by, in the case of plastic, treating the surface with
oxygen plasma to generate a radical, and immediately soaking the
chip in a solution containing a biotin derivative having a double
bond residue.
[0244] Additionally, as shown in FIG. 15, a cell separator 300
having a number of cell separation chips 100 can be configured to
raise the throughput for cell separation as a whole. In the figure,
reference numeral 91 indicates plumbing for replenishing the
retention bath 86 with a solution not containing a fluorescent
labeled material, and the plumbing is branched out to thereby
replenish the retention bath 86 on the cell separation chip 100
with a solution not containing a fluorescent labeled material.
Reference numeral 91 indicates plumbing for discharging a solution
not containing a fluorescent labeled material collected from the
retention bath 89, and the plumbing is branched out to thereby
discharge the solution from the retention bath 89 on the cell
separation chip 100. The cell separation chip 100 is inserted in a
position for a cell separation chip holder 200 provided by
hollowing a surface of the cell separator 300, so that, when a chip
is exchanged with another, the new chip can be provided in the same
position. With a configuration in which voltage is applied to the
gel electrodes via electrodes 63, 64 provided in a position
corresponding to metal thin film 63, 64 on the plane of the cell
separation chip holder 200 extended from the plane of the cell
separation chip 100, labor of connecting an electrode can be saved
in exchanging a chip. It is needless to say that, in place of
providing metal thin films 63, 64 on the cell separation chip 100,
terminals for connection may be provided in a position adjoining to
the cell separation chip 100 on a surface of the cell separator
300, so that voltage can be applied to the gel electrodes by
inserting the terminals into the gel supply holes 65, 66.
[0245] Whether a cell separator is configured with a single cell
separation chip 100 or with a plurality of cell separation chips
100 incorporated therein, it is necessary to provide an optical
system for determining whether a cell flowing in a flow path in the
cell monitoring area 60 is a target cell to be collected or a cell
to be discharged, and voltage is applied to the gel electrodes by
means of a signal from the system according to the necessity.
[0246] FIG. 16 is a view for illustrating an optical system
provided in a cell monitoring section 60 of the cell separation
chip. Although the optical system is omitted and not shown in FIG.
13 to FIG. 15, it is necessary to monitor a cell flowing down the
flow path 59, determine that the cell is a target cell to be
collected or a cell to be discharged, as well as to measure the
flowing speed, and to provide controls so that, when a target cell
is recognized and reaches the cell separation area 70, voltage is
applied to the gel electrodes, or otherwise, voltage is not applied
to the gel electrodes. The optical system is used for the purposes
described above.
[0247] Reference numeral 101 indicates a light source of a
stereomicroscope, for which is generally used a halogen lamp.
Reference numeral 102 indicates a band pass filter for transmitting
only light at a specific wavelength from light of the light source
101 for the stereomicroscope. Reference numeral 103 indicates a
condenser lens, to which is introduced a phase contrast ring in the
case of a phase contrast observation, and a polarizer in the case
of a differential interference observation. Reference numeral 100
indicates a cell separation chip. The state of the flow path 59 in
the cell monitoring area 60 on the cell separation chip is observed
with an objective lens 105. What is observed hereupon with the
objective lens 105 is a stereoscopic image of a cell in the flow
path 59 reflected by light transmitted from the light source 101,
and a fluoroscopic image reflecting fluorescence emitted by a
target cell labeled with excitation light in which only a
wavelength of excitation light of light from the light source 108
through the band pass filter 109 is eradiated from the objective
lens 105 by a dichroic mirror 106. In this step, it is desirable
that the wavelength of light used for a stereomicroscopic
observation is sufficiently shorter or sufficiently longer than a
fluorescent wavelength area to be observed, and, if possible, is
different from the excitation light wavelength area.
[0248] Only a stereoscopic image in a flow path is observed with a
camera 113 utilizing a dichroic mirror 110 and a band pass filter
112 reflecting light at the same wavelength as that transmitting
the band pass filter 102 described above. On the other hand, a
fluoroscopic image is observed with a camera 115 by selectively
transmitting the wavelength band for the fluoroscopic observation
of light passing through the objective lens 105 utilizing a mirror
111 and a band pass filter 114. Images picked up by the two cameras
113, 115 are subjected to image data processing for analysis, and
comparison of the relative positional relation between the two
images makes it possible to compare and identify fine structures
and fluorescence emitting positions of a cell. According to this
result, a computing machine 116 determines whether voltage is
applied to gel electrodes or not, and, when voltage is applied to
gel electrodes, sends a voltage applying signal at a prespecified
timing as indicated by the arrow. It is to be noted that in this
case, stereoscopic images in a single wavelength band and
fluoroscopic images in a single wavelength band are observed for
comparison and analysis, and similarly, stereoscopic images in two
or more wavelength bands may be compared to each other, or
fluoroscopic images in two or more wavelength bands may be compared
and analyzed. In doing so, one or more dichroic mirror and a light
source or a camera observation system may be further provided in
the light path as described above.
[0249] Descriptions are made in more detail for a case in which a
CCD camera is used in an optical system. In this case, the cameras
112, 115 illustrated in FIG. 16 are integrated into a single
camera.
[0250] As a prerequisite, suppose that a cell is moving in the flow
path 59 at an average of 1 mm per second, and that a cell is
flowing while turning around approximately once in 0.5 second in
some cases, though depending on a shape of the cell. Assuming that
10 frames are required for recognizing a cell, detection of a cell
image at intervals of 50 microseconds allows measurement of a shape
of the cell or the like, even when the cell is turning around.
Thus, on this condition, a system of observing an image at the rate
of at least 20 frames/second will suffice. Assuming that one cell
is picked up in the same frame on average, cell recognition becomes
possible at the rate of 20 cells/second, however, a CCD camera
capable of picking up an image at the rate of 200 frames/second is
used herein to be on the safe side. Thus, cell recognition and
separation at the rate of several ten thousands of cells/10 minutes
is actually possible.
[0251] Such a camera has the cell monitoring area 60 as an imaging
range, and observes an area of 100 .mu.m along the flow path 59 in
a position 0.5 mm upstream of the cell separation area 70 in the
flow path 59 of the cell monitoring area 60. A cell observed in the
area reaches the cell separation area 70 in 0.1 second. As the cell
is flowing at 1 mm per second, 20 frames of a cell image are
fetched while the cell passes the observation area, and the shape
of a cell and fluorescent images are observed.
[0252] The camera recognizes a cell as an image by operating
scanning lines of the camera in the orthogonal direction against
the direction in which a cell flows. The camera constitutes an
optical system in which a cell is subjected to incident light from
a lens 105, fluorescence emitted by the cell returns to the lens
105, and the fluorescence is separated according to the wavelength
through a band pass filter for image formation, and another optical
system in which light from the light source 101 irradiates a cell,
and a transmission image thereof is detected. The optical system
may be designed so that a transmission image and a fluorescent
image are projected in different sections on the same CCD imaging
screen of the camera, which enables measurement of both
transmission image and fluorescent image with a single unit of an
upmarket high-speed low-light camera.
[0253] How to use the cell separation chip 100 described above is
outlined. First, the cell separation chip 100 is warmed to about
60.degree. C., and material for gel electrodes is supplied by
applying prespecified pressure from holes 65, 66 on the material
for gel electrodes in the amount corresponding to the space for gel
electrodes 61, 62. Consequently, the material for gel electrodes
reaches the openings of the gel electrodes 61, 62. Further, the
holes 65, 66 are almost filled with the material for gel
electrodes. Nevertheless, on the assumption that the chip according
to the second embodiment is brought on the market, material for gel
electrodes may be filled in the chip beforehand.
[0254] Next, a tank 54 is filled with a buffer. As a result, the
buffer sequentially flows in the flow path 59, cell separation area
70, flow path 71, flow path 72, dialysis section 80 and flow path
83 via a sample hole 51 for supplying a fluid containing cells and
the buffer holes 52, 53 for supplying a buffer and via flow paths
55, 56 and 57. Then the buffer also flows in holes 73, 85. In this
state, when a fluid containing cells is fed into a sample hole 51,
the cells get lined up as passing in the tapered flow path 55, and
become a laminar flow in the position where the cells converges
with the flow paths 55, 56 to then reach the flow path 59 in the
cell monitoring area 60. Each flowing down cell is sequentially
identified as a target cell to be collected or that to be
discharged, since cells are monitored with the optical system
flowing down the flow path 59. The optical system applies or does
not apply voltage to the gel electrodes 61, 62 according to the
result of identification. When prespecified voltage is applied to
the gel electrodes 61, 62, force owing to an electric field acts on
a cell to introduce the cell to the flow path 72. When voltage is
not applied to the gel electrodes 61, 62, force owing to an
electric field does not act on a target cell, allowing the cell to
flow down in the flow path 71. The target cell flowing down in the
flow path 71 flows down in the flow path of the dialysis section
80. In the upper section of the dialysis section 80 is provided a
porous membrane 81, on which a buffer fed from a buffer retention
bath 86 flows, so that the target cell flowing down in the flow
path of the dialysis section 80 has a reduced amount of a
fluorescent labeled material having been intaked into the target
cell. Because only a capacity of a tank 86 is insufficient for the
quantity of a buffer to be fed in the dialysis section 80, buffer
is to be fed also from other source, and a buffer collected into
the buffer retention bath 89 is to be discharged. The buffer
retention baths 86, 89 are intermediary tanks for a buffer.
[0255] Taking a length of the flow path of the dialysis section 80
and a passing speed of a cell into consideration, it is
contemplated that, in some cases, a sufficient dialysis effect is
not achieved with the cell separation chip described above. In such
cases, it is desirable that a target cell is collected from a hole
85 for holding a fluid containing the target cell, and then
dialysis is performed separately.
[0256] Several specific examples are described below in which a
protocol for cell separation according to the second embodiment is
implemented with the cell separation chip shown in Examples.
(Example of Cell Separation 1)
[0257] Descriptions are provided below for a case, as a specific
example, in which cerebrum tissue piece cut off from a cerebral
corium of a mouse is used. Tissue cells (in this case, a cerebral
tissue piece) are directly put in an isotonic culture fluid, and
are incubated at 37.degree. C. for 15 minutes in atmosphere
containing 5% carbon dioxide for conditioning. Substances and
labeling materials presumably available in a neural cell system are
descried with reference to Table 3. The transporters are disclosed
in http://www.bioparadigms.org/slc/intro.asp.
TABLE-US-00003 TABLE 3 Substrate Transporter Tissue, cell, organ
.gamma.-aminobutylic SLC6A1 Brain (neuron) acid (GABA)
Noradrenaline SLC6A2 Peripheral nerve system Dopamine SLC6A2, 3
Serotonin SLC6A4 Glycine SLC6A5
[0258] More specifically, in the neural cell system, such
transporters as .gamma.-aminobutylic acid (GABA), noradrenaline
(4-tetrahydro-N-methyl-1-naphthylamine), dopamine
(2-dihydroxyphenylethylamine), serotonin have been known, and these
amino acid sequences share homology with each other, and form a
type of family. It is known that any of these transporters has a
structure 12-times transmembrane structure. For instance, when
labeled serotonin is added in the state of tissue piece, the
labeled serotonin is taken into the neural cell system via a
transporter which may be regarded as a serotonin transporter.
Serotonin is labeled with a fluorescent material in use. Not only
in the transporters each having homology with GABA, but also in a
glutamic acid transporter which can be regarded as one belonging to
a different transporter family, a labeling material can be
introduced into a target cell by using a glutamic acid with a
fluorescent body bonded thereto with a linker. In this example, a
membrane-permeable transporter having a relatively small molecule
size and no electric charge such as various derivatives of
4,4-difluoro-4-bora-3a,4a-diaza-s-indacene is used. As a label, a
fluorescent material can be introduced by using, for instance, an
amino group of serotonin through the amidic group of serotonin.
[0259] At first, 10 .mu.M serotonin labeled with the fluorescent
material (described as labeled serotonin hereinafter) is added to
the tissue piece and incubated at 37.degree. C. for 30 minutes, and
the cells are dispersed according to the known method, and are
analyzed with a cell sorter independently developed by the
inventors. Cell with the fluorescence intensity of 5000 or more
obtained with this device are separated. 1000 cells are used as
starting cells, and when operations are performed up to this step,
26% of the cells are separated in this process. When a group of
labeled target cells are cultured in a culture fluid not containing
labeled serotonin for 18 hours and then cells with the fluorescence
intensity of 500 or below are separated, 156 target cells are
recovered. This technique prevents foreign materials from being
intaked, and provides an important merit, for instance, in a case
where the separated target cells are returned to a human body.
Further in the cell researches, the availability of quickly
removing a labeling material for cell separation makes it possible
to minimize influences of the labeling material over the cell, and
therefore this technique can make a great contribution to
researches for accurately understanding the cellular
physiology.
(Example of Cell Separation 2)
[0260] Cell separation is performed by using any of the
sugar-related transporters shown in Table 1. The glucose labeling
method described in Cytometory 27, 262-268 (1997) may be used for
labeling the sugar. This document suggests that cells can actually
be stained by fluorescent material-labeled glucose and detected
with a cell sorter (not separated and recovered in this
document).
[0261] In Example 2 for cell separation, a case is described in
which differences of cells are recognized by measuring differences
in cell permeability of a plurality of substrates and then discrete
cells are separated. In this example, cells are identified and
separated by observing the cell permeability of galactose or
fructose against the glucose described in the aforementioned
document. Generally, glucose is often used as an energy source for
cells, but galactose or fructose is not directly consumed. For
instance, when Escherichia coli is cultured in a mixed culture
medium of glucose and fructose, glucose is consumed at first, and
then galactose is consumed when glucose decreases. Therefore, for
instance, by measuring cell permeability of various types of
substrates using a quantity of intaked glucose as control data,
cell separation reflecting the state of cell more accurately can be
performed.
[0262] In this example, a glucose labeling derivative of
6-(N-(7-nitrobenz-2-oxa-1.3-diazol-4-yl) amino) sugar (Ex465/Em540)
(NBD-labeled sugar) is used. As a labeling fluorescent material for
galactose or fructose, a membrane-permeable material having a
relatively small molecular size and not electrically charged such
as various derivatives of
4,4-difluoro-4-bora-3a,4a-diaza-s-indacene may be used. Various
types of NDM-labeled sugars are added to the culture fluid, and
cells dispersed in the culture fluid via the brain tissue pieces
(the cut-off site unknown) are trisected, and then the three types
of NBD-labeled sugars are added to the culture fluids respectively
and incubated for 15 minutes at 37.degree. C. The culture fluid is
exchanged with that not containing the NBD-labeled sugar, and the
sample is immediately added to a cell sorter independently
developed by the inventors, and cells with the relative
fluorescence intensity of 500 or more are separated. 200 cells were
processed with the sorter, and 66 cells using the NBD-labeled
glucose and 13 cells using the NBD galactose were obtained
respectively, and any cell using the NBD-labeled fructose could not
be obtained. Similarly in a case of a sample in which cells from a
lever tissue were suspended, 46 cells using the NBD-labeled glucose
as an index, 37 cells using the NBD-labeled fructose, and 8 cells
using the NBD-labeled galactose were obtained, and this result is
different from that obtained using the brain-derived cells.
[0263] The glucose, fructose, and galactose are expressed by
various transporters on cell surfaces, and substrate-specificity of
each transporter is not so high, but actually the cells can be
divided into several groups. This fact suggests that change in
specificity due to a fluorescent material bonded to each
transporter causes change in easiness of fetching glucose,
fructose, and galactose into the cell.
(Example of Cell Separation 3)
[0264] In Example of cell separation 3, descriptions are provided
for a case in which difference of cells are identified and discrete
cells are separated by measuring the difference in cell
permeability of a plurality of labeling amino acids or labeling
peptides.
[0265] In Example 2 for cell separation, glucose is used as a
control, but it is better to use herein substrates of transporters
expressed in various organs. As shown in Table 4, thiamine, folic
acid, eicosanoids, prostaglandin, L-ascorbic acid, arginine, and
nucleoside may advantageously be used for this purpose. The
transporters are ubiquitously present in various cells.
TABLE-US-00004 TABLE 4 Substrate Transporter Tissue, cell, organ
Thiamine SLC19A2, 3 Nonspecific Folic acid SLC19A1 Eicosanoids
SLC2A1 Prostaglandin SLCO3A1, 4A1 L-ascorbic acid SLC2O3A2 Arginine
Nucleoside SLC28A, 29A
[0266] Alternatively, a material such as arginine olygomer, a
transporter for which is still unknown (intaked into a cell via
another mechanism), but which is always intaked into a cell is
used. As a substrate for measurement against a control, for
instance, substances based on amino acid-related peptides and
transporters corresponding to the substances as shown in Table 5
may be used.
TABLE-US-00005 TABLE 5 Substrate Transporter Tissue cell, organ
L-Glu SLC1A1-3,6,7 Cerebral cells such as D/L-Asp neuron and
astrocyte Purkinje cell in cerebellum Retina Small intestine,
kidney, lever, skeletal muscle, placenta L-Ala SLC1A5 L-Ser Lung
L-Thr Skeletal muscle L-Cys Intestine, kidney, testis L-Gln Fatty
tissue L-Asn -- Asparagin-demanding tumor cell (Acute leukemia,
malignant lymphoma, various types of cancerous cells) Dipeptide
SLC15A -- Tripeptide
[0267] L-Glu or D/L-Asp is used for identification and separation
of cell groups consuming much energy such as cerebral cells such as
neuron or astrocyte, Purkinje cell of cerebellum, retina, small
intestine, kidney, lever, skeletal muscle, and placenta. L-Ala,
L-Ser, L-Thr, L-Cys and L-Gln are used for identification and
separation of cells in lung, skeletal muscle, intestine, kidney,
testis, and fatty tissue. L-Asn is effectively used for detection
and separation of asparagines-demanding tumor cells in acute
leukemia or malignant lymphoma. L-Asn may also be used for
examination of the acute leukemia. For labeling, for instance, a
fluorescent material modified by using isodiamido binding is used
to prevent an electric charge of the amino group from being
lost.
(Example of Cell Separation 4)
[0268] Descriptions are provided below for a case in which cells
causing leukemia are separated by applying the technique in Example
3 for cell separation. NDB folic acid (Ex465/Em540),
4,4-difluoro-1,3,5,7-tetramethyl-4-bora-3a,4a-diaza-s-indacene-8-propiona-
te labeled ASn, and
4,4-difluoro-5-(2-pyrrole)-4-bora-3a,4a-diaza-s-indacene-3-propionate
labeled Thr are added to blood from a patient suffering from
leukemia, and the mixture is incubated for 30 minutes at 37.degree.
C. Using the NDB folic acid (Ex465/Em540) as a control, the amounts
of intaked
4,4-difluoro-3,5,7-tetramethyl-4-bora-3a,4a-diaza-s-indacene-8-propionate
labeled ASn (Ex493/Em503) and intaked
4,4-difluoro-5-(2-pyrrole)-4-bora-3a,4a-diaza-s-indacene-3-propionate
labeled Thr are measured by detecting the fluorescent intensities
of various derivatives of
4,4-difluoro-4-bora-3a,4a-diaza-s-indacene against the fluorescence
intensity generated by NDB-labeled folic acid, and cells having
high fluorescence intensity with the fluorescence wavelength of
around 503 nm, namely cells having a large intake amount of the
4,4-difluoro-1,3,5,7-tetramethyl-4-bora-3a,4a-diaza-s-indacene-8-propiona-
te labeled ASn are sorted with a cell sorter. Histological
examination of the sorted cells with a microscope shows that 95% or
more of the sorted cells are cancerous leukocytes. An intake rate
of the 4,
4-difluoro-5-(2-pyrrole)-4-bora-3a,4a-diaza-s-indacene-3-propionate
labeled Thr in normal cells against cancer cells is not so
remarkable as compared to the intake rate of 4,
4-difluoro-1,3,5,7-tetramethyl-4-bora-3a,4a-diaza-s-indacene-8-propionate
labeled Asn.
(Example of Cell Separation 5)
[0269] In Example of cell separation 5, descriptions are provided
for a case in which a substance taken into a target cell via an
unknown mechanism is used. In this case, arginine oligomer is
herein used as a substrate. The arginine oligomer can be intaked
into a target cell even by conjugating, in addition to various
fluorescent materials, a giant molecule such as an enzyme thereto.
Further the arginine oligomer shows the cell membrane permeability
to any cell (J. Mol. Recognit. 16, 260-264 (2003)). The mechanism
of arginine oligomer intake into a cell is still unknown, but it is
clear that the mechanism is not endocytosis nor phagocytosis, and
now discussions are made for a model in which a guanidil residue of
arginine forms a hydrogen binding to phospholipids present in a
cell membrane and the molecule directly overcomes the membrane gap
and also for the influence by a strong base in the guadinil group.
The present inventors speculate, in addition to the assumptions
described above, the possibility that the arginine oligomer acts as
a weak denaturing agent because of the influence by chaotropic ions
and the cell membrane is partially denatured.
(Example of Cell Separation 6)
[0270] In this example, sulforhodamine 101-labeled arginine octamer
(Em605) and NBD-labeled Asn (Em540) are sent into a target cell,
and cancerous cells are separated according to a different in
intake rates of the two labeling materials. The sulforhodamine
101-labeled arginine octamer (Arg.sub.8-Cys-S-sulforhodamine 101)
is ether-bonded to an SH group of Cys using a reagent having a
maleimide group (produced by Molecular Probe Corp., Texas Red
C.sub.2 maleimide). Actions of the arginine oligomer to a cell are
specific, and additional descriptions are provided below. J. Mol.
Recognit. 16, 260-264 (2003) suggests that there is an optimal
value for length of arginine oligomer, and the optimal value is in
the range from 6 to 8. When the length is too short, the oligomer
hardly permeates a cell membrane, and when the length is too large,
the oligomer tends to be bonded to the cell membrane. Further, when
the length is several tens mer, the oligomer may be cytotoxic. In
this Example, an octamer is used. Actually, Cys is conjugated to a
COOH terminal of arginine octamer for binding a fluorescent
material, and a fluorescent material having a maleimido group is
conjugated to the SH group of this Cys. Alternatively, the
fluorescent labeling may be performed by using, in place of Cys,
Lys with a fluorescent material previously conjugated to the
.epsilon.-amino group thereof when synthesizing peptide. In this
case the arginine oligomer is
Arg.sub.8-Lys-.epsilon.-NH-sulforhodamine 101. A concentration of
the arginine oligomer is 1 .mu.m, and the processing time may be
0.5 hour. When labeled with arginine oligomer with the length of 6
to 8, strong fluorescence is generated in an internal structure of
the nuclear, and therefore it is conceivable that the fluorescent
material is specifically migrated to the nuclear. However, in which
portion of the nuclear the fluorescent material is concentrated is
still unknown. Fluorescence can be observed also from cytoplasm,
although the intensity is not so strong as that in the nuclear. In
any way, a percentage of a projection area of a nuclear in a cell
can be measured. In addition to the materials described above, it
is possible to use, as a fluorescent material, fluorescein,
tetramethylrhodamine, sulforhodamine 101, pyrene derivatives, Cy3,
Cy5, europium complexes of
N,N,N.sup.1,N.sup.1-[2,6-bis(3'-aminomethyl-1'-pyrazolyl)-4-phenylpyridin-
e], and various types of fluorescent nanoparticles (with the
diameter of 30 nm). Therefore, an excitation wavelength and a
fluorescence wavelength can be obtained according to the
necessity.
(Example of Cell Separation 7)
[0271] In this example, descriptions are provided for cell
separating operations using a tissue cut off from the overhead
colon in intestine with the epithelium partially being cancerous.
The two types of fluorescent substrates described above are mixed
in the medium as the tissue piece, and are incubated for 30 minutes
at 37.degree. C. After the tissue is washed with 0.15 M NaCl not
containing the substrate, and the cells are dispersed in a solution
containing trypsin. Then immediately the dispersion is processed
with an image analysis type of cell sorter according to the second
embodiment of the present invention to measure fluorescence
intensity distribution around the fluorescence wavelength of 605 nm
from the sulforhodamine 101-labeled arginine octamer for each cell.
To identify a cancer cell by making use of the fact that cancer
cells have a larger size, a percentage of the nuclear in each
cancer cell becomes larger as compared to that in normal cells, so
that cells, in which an area ratio of the portion having high
fluorescence intensity against to the total area of the cell is 20%
or more, are detected. However, sometimes it is hard to make a
determination only with the operation above because the actually
stained structural body is not known, and a ratio of false negative
may disadvantageously increase. Therefore, at the same time, by
making use of the fact that a cancer cell has a high demand for
Asn, the fluorescence intensity at and around the wavelength of 540
nm from the NBD-labeled Asn is observed. Then, cells showing a
positive reaction with either sulforhodamine 101-labeled arginine
octamer or NBD-labeled Asn are sorted with a cell sorter. The
separated cells vary according to a type of tissue piece, and in
this case, of 1000 cells in the tissue piece, 16 cells are
separated. The separated cells are visually and histologically
compared to cells (presumably not cancerous) in another portion of
intestine of the same person, and based on the result of the
operation above, it can be guessed that all of the separated cells
are cancerous. The separated cells can be proliferated by
culturing, and when cultured according to the known method, the
cells can be proliferated infinitely. As described above, the
cancerous cells can be separated more accurately by checking the
two facts that nuclei of cancerous cells are substantially stained
by the sulforhodamine 101-labeled arginine octamer, and that the
NBD-labeled Asn is intaked into the cytoplasm of the cells.
(Example of Cell Separation 8)
[0272] In Example of cell separation 8, descriptions are provided
for the availability of conjugating a substrate which specifically
permeates to mitochondria in a cell like a mitochondria transporter
and using the substrate for specifically staining mitochondria.
Most arginine compounds often show the cell membrane permeability
and also specifically reach mitochondria. Actually, Arg-specific
transporters are present on a surface of mitochondria (See
http://www.bioparadigms.org/slc/intro.asp). Therefore, it can be
anticipated that the arginine oligomer conjugated to sulforhodamine
101 described in Example 5 for cell separation is taken into
mitochondria. By introducing sulforhodamine 101-Arg.sub.6 into a
cell and observing the situation in the cell with an optical system
using a water-submerged lens with the resolution of 100 times shown
in FIG. 16 as an object lens 105, spotted patterns can be observed
in the cytoplasm. This result of observation suggests that the
sulforhodamine 101-Arg.sub.6 has migrated into mitochondria.
[0273] Therefore, sulforhodamine 101-Arg.sub.6 is added to the
cells, and the cells are sorted checking localization of
fluorescence in the cells. For observing mitochondria with high
resolution, the water-submerged lens with the resolution of 100
times is used as an object lens 105 in the optical system shown in
FIG. 16. In this case, a degree of distribution of fluorescent
light emitting points in each cell are checked, and cells with the
fluorescence intensity of 40 times or more from the cytoplasm
against the background are sorted as ones having taken the
fluorescent material into the mitochondria. The sorted cells are
transferred into a culture liquid to remove the intaked
sulforhodamine 101-Arg.sub.6. The cells having lower fluorescence
intensity ratio as compared to the value described above has a low
survival rate after sorting, while most of cells having high
fluorescence intensity can be cultured. This fact suggests that
apoptosis is induced in cells with low mitochondria staining
intensity, or that the cells are substantially damaged. With the
second embodiment of the present invention, fresh cells can easily
be sorted from damaged ones.
[III] Third Embodiment
[0274] As a third embodiment, a method is disclosed for adding a
labeling substance to a cell for separation based on a certain
characteristic of the cell and after isolation removing the
labeling substance, for the purpose of avoiding degeneration of the
target cell to be separated by the labeling substance to the extent
as much as possible, by selecting as the labeling substance to a
surface antigen a substance degradable under a mild condition and
by degrading and removing the labeling substance to the surface
antigen under a physiological condition without impacts to the
cell.
[0275] Before describing an example of the third embodiment, a
method of preparing aptamer to a cell surface antigen CD4 is
described as an example of the labeling substance useful in the
third embodiment.
[0276] As aptamer for use as the labeling substance, aptamer to the
cell surface antigen CD4 disclosed in an article "Staining of cell
surface human CD4 with 3'-F-pyrimidine-containing RNA aptamers for
flow cytometry" (Nucleic Acids Research 26, 3915-3924 (1998)). The
aptamer is of type ribonucleotide, that is, RNA aptamer. In the
above article, GDP-.beta.-S is introduced to the 5' end of the RNA
aptamer as an identification substance by in vitro transcription,
for the purpose of identifying the aptamer with fluorescence. At
this stage, a thiophosphoric acid group is inserted to the 5' end
of the aptamer. A 5' biotinylated RNA aptamer is obtained by
reacting biotin introduced with an iodine acetyl group to the
thiophosphoric acid group.
[0277] As a fluorescent pigment, a conjugate of phycobiliprotein
and streptavidin is reacted to the 5' biotinylated RNA aptamer and
through biotin/avidin reaction phycobiliprotein-modified RNA
aptamer is obtained. Of types of phycobiliprotein,
.beta.-phycoerythrin is a fluorescent substance of type fluorescent
protein, characterized by a high light absorbance at
2.41.times.10.sup.6 M.sup.-1 cm.sup.-1 as well as a high quantum
yield at 0.98 and is suitable for high-sensitive detection, but a
large size thereof at a molecular weight of 240K daltons as well as
nonspecific adsorption and instability characteristic to proteins
proves problematic occasionally. In one of the examples of the
third embodiment, the phycobiliprotein-modified RNA aptamer is
used. Since the molecular weight is as large as 240K daltons, it is
equivalent, in terms of size, to using particles of about 10 nm in
diameter as a marker substance. In addition to phycobiliprotein,
therefore, a particle containing fluorescent pigment, a gold
nanoparticle and a magnetic particle, all 10 nm in diameter, are
also used.
[0278] An example of identification element with phycobiliprotein
or a nanoparticle as the marker substance is described
hereinafter.
[0279] (i) Phycobiliprotein-modified RNA aptamer: A method
described in the article hereinabove may be used, but another
method is used hereinafter. Synthesis of RNA aptamer is securely
achieved by chemical synthesis. An amino group is introduced to the
5' end of the synthesized RNA aptamer. The amino group is
introduced at the time of chemical synthesis of the RNA aptamer. A
bifunctional reagent such as N-(8-Maleimidocapryloxy)
sulfosuccinimide is reacted to the amino group introduced at the 5'
end, and as a result, an SH-reactive maleimide group is introduced
to the 5' end of the RNA aptamer. Separately .beta.-phycoerythrin
with an SH group introduced thereinto is prepared. For the
introduction of the SH group, an amino group of the
.beta.-phycoerythrin is modified with 2-iminothiolane.
.beta.-phycoerythrin-modified RNA aptamer is obtained by mixing the
maleimide group-introduced RNA aptamer and the SH group-introduced
.beta.-phycoerythrin through 2-iminothiolane modification at pH
7.
[0280] (ii) Gold nanoparticle-modified RNA aptamer: A method of
preparing gold nanoparticle-modified RNA aptamer is described
hereinafter, with reference to methods disclosed by Tonya M. Herne
and Michael J. Tarlov (J. Am. Chem. Soc. 1997, 119, 8916-8920) and
by James J. Storhoff (J. Am. Chem. Soc. 1998, 120, 1959-1964). In a
suspension of gold nanoparticles (20 nm .phi.) are added synthetic
RNA aptamer with an SH group at the 5' end and
6-mercapto-1-hexanol, and the mixture is left for an hour. The
molar ratio of the synthetic RNA aptamer and 6-mercapto-1-hexanol
is 1:100, but if gold nanoparticles get agglomerated, or the
synthetic RNA aptamer does not bond with the gold nanoparticles, it
is necessary to change the ratio according to the necessity until
an optimal ratio is found. The gold nanoparticles easily get
agglomerated, and hence it is necessary, at the time of adding
synthetic RNA aptamer, to stir the liquid, so that concentration
gradients of potassium carbonate buffer or the synthetic RNA
aptamer do not result. The synthetic RNA aptamer and the gold
nanoparticles are reacted under a condition where the molecular
ratio of the synthetic RNA aptamer to the gold nanoparticles is 100
times. That is, the reaction takes place where the ratio between
the number of the gold nanoparticles and the number of synthetic
RNA aptamer molecules is 1:1000. The synthetic RNA aptamer with an
SH group are chemically synthesized. After the reaction the
solution is centrifuged at 8000 G for an hour and the supernatant
is discarded. The aptamer is suspended again in 10 mM potassium
carbonate buffer with 0.1 M NaCl added (pH 9), then is centrifuged
again, the supernatant is discarded again, and the aptamer is
finally suspended in 10 mM potassium phosphate buffer with 0.1 M
NaCl added (pH 7.4) to make stock.
[0281] (iii) RNA aptamer modified with nanoparticles other than
gold: Nanoparticles like quantum dot is generally inorganic
nanoparticles. A product covered with biotin-introduced
polyethyleneglycol is already in the market, for example, under the
trade name of EviFluor from Evident Technologies, Inc. RNA aptamer
bonded with streptavidin can be used together with nanoparticles
with biotin introduced thereinto. A method of preparing RNA aptamer
bonded with streptavidin is described hereinafter. RNA aptamer with
a maleimide group introduced at the 5' end and streptavidin
introduced with an SH group by a 2-iminothiolane modification is
mixed at pH 7 with the method (i) and streptavidin-bonded RNA
aptamer is obtained. Mixing the streptavidin-bonded RNA aptamer
with the nanoparticles with biotin results in nanoparticle-modified
RNA aptamer as identification element.
[0282] From nanoparticles with a carboxyl group introduced
thereinto is obtained nanoparticle-modified RNA aptamer as
identification element with a well-known method of first reacting
carbodiimide to the carboxyl group to obtain active ester and then
reacting 5'-aminated RNA aptamer thereto.
[0283] Methods of preparing nanoparticle-modified RNA aptamer have
been described above, and similar methods are applicable for
preparation of DNA aptamer of type deoxyribonucleotide:
phycobiliprotein-modified DNA aptamer, gold nanoparticle-modified
DNA aptamer and DNA aptamer-modified with nanoparticles other than
gold may be prepared each as identification element in a similar
fashion, because an SH group, an amino group and the like may be
introduced to the 5' end at a time when the DNA aptamer is
synthesized in a synthesizing machine, as in the case of RNA
aptamer.
[0284] In addition to methods as described hereinabove, RNA aptamer
may be synthesized according to a commonly used method of first
synthesizing single-chain DNA with a T7-promoter at the 5' end and
then transcribing the synthesized DNA to RNA with RNA
polymerase.
Example
[0285] An example is described hereinafter with identification
element made up of RNA aptamer as a labeling substance to label
cell surface antigen CD4 and .beta.-phycoerythrin as a marker
substance in isolating and collecting cells bonded with the RNA
aptamer. That is, cells presenting the cell surface antigen CD4 is
specifically labeled with the .beta.-phycoerythrin-modified RNA
aptamer as described hereinabove, and then a cell isolation chip,
which is a cell sorter formed on a plastic chip substrate as
disclosed in Japan Patent Application 2004-379327.
[0286] FIG. 17 is a view showing a process flow of specifically
labeling a cell presenting the cell surface antigen CD4 with the
.beta.-phycobiliprotein-modified RNA aptamer and thereafter
isolating the cell with a cell sorter. The top-most part of FIG. 17
shows a sample 10 with two kinds of cells 3 and 4 in a mixed
manner. The cells 3 present a cell surface antigen CD4 indicated by
a triangular marked out in black with a reference numeral 1. The
cells 4 present a surface antigen 2 other than CD4 indicated with a
circle marked out in black. With the sample is mixed
.beta.-phycoerythrin-modified RNA aptamer 11 as described
hereinabove. The RNA aptamer is indicated with a reference numeral
5 while the .beta.-phycoerythrin is indicated with a numeral 6.
Concentration of labeling substance 11 is 100 nM.
[0287] As a result, to the antigen 1, which is CD4 present on a
surface of the cells 3, is bonded the labeling-substance RNA
aptamer modified with .beta.-phycoerythrin as an identification
substance. To the antigen 2, which is not CD4, the
labeling-substance RNA aptamer is not bonded. The identification
substance .beta.-phycoerythrin, modifying the labeling-substance
RNA aptamer, yields a strong fluorescence at around 575 nm when
excited with 532-nm second harmonic of YAG laser. In the cell
isolation chip, therefore, cells presenting CD4 can be isolated
from the other cells through detection of this fluorescence. In the
top-most part of FIG. 17, an arrow leading to the vertical line of
a reverse "Y" shape extending from the sample 10 indicates that
such isolation is carried out with the cell sorter. Reference
numeral 12 at the end of one of the diagonal lines of the reverse
"Y" shape indicates a group of the cells 3 bonded to the
labeling-substance RNA aptamer. Reference numeral 13 at the end of
the other diagonal line of the reverse "Y" shape indicates a group
of the cells 4 not bonded to the labeling-substance RNA
aptamer.
[0288] Next the cells presenting CD4 and isolated with the cell
sorter are collected into a microtube and are immediately reacted
with nuclease 14. Since the RNA aptamer has a three-dimensional
structure, types of nucleases like ribonuclease A that breaks down
single-chain RNAs alone may not decompose the aptamer sufficiently.
A nuclease that breaks down both single- and double-chained RNAs
can be used effectively. For the purpose of this example, Benzonase
(registered trademark) is used, a nuclease derived from Serratia
marcescens as described in "The Journal of Biological Chemistry
244, 5219-5225 (1669)" mass produced genetically (European patent
No. 0229866, U.S. Pat. No. 5,173,418). The enzyme works at a
temperature of 37.degree. C., and has a working pH range at a
neutral range between 6 and 9, and is therefore easy to use on
cells. Highly concentrated phosphoric acid or monovalent metal ion
reduces activity of the enzyme, hence buffer liquid of type
non-phosphoric acid is used, for example, 10 mM HEPES at pH 7.4
with 0.15 M NaCl, 2 mM MgCl.sub.2 and 1 mg/ml BSA contained
therein. If buffer liquid of type phosphoric acid must be used,
then concentration of potassium phosphate/sodium phosphate should
be held down to 5 mM, and the liquid should be used with 0.15 M
NaCl, 2 mM MgCl.sub.2 and 1 mg/ml BSA contained therein. Benzonaze
(registered trademark) nuclease is used at a concentration of
10.about.100 u/ml. Alternatively, a mixture of ribonuclease A and
ribonuclease T1 may be used, but nuclease derived from Serratia
marcescens has wider applications.
[0289] If necessary, blood serum may be substituted with buffer
liquid, although it may be necessary to adjust the concentration of
Benzonase (registered trademark) nuclease for each blood serum lot,
because of the effect of nuclease inhibitor found in blood serum.
Generally, if blood serum is used, concentration between 100-400
u/ml gives a good result.
[0290] In FIG. 17, an arrow representing the nuclease leading to
another arrow indicated on the lower side of the group 12 of the
cells 3 bonded with the labeling-substance RNA aptamer indicates a
process of adding the nuclease. This process is given a reference
numeral 14. As a result of the nuclease acting on the aptamer, the
labeling-substance RNA aptamer 6 bonded with the CD4 antigen 1 on
the surface of the cells 3 is degraded. In FIG. 17, the degraded
labeling-substance RNA aptamers are indicated as a group of dots
and are given a reference numeral 7. A reference numeral 15
indicates a mixture of the cells 3, the degraded labeling-substance
RNA aptamers 7, and the identification-substance
.beta.-phycoerythrin 6.
[0291] Next, by changing cell supernatant of this mixture and
removing the decomposed substance 17 (the mixture of the degraded
labeling-substance RNA aptamers 7 and the marker-substance
.beta.-phycoerythrin 6), only the cells 3 with CD4 antigen 1 on the
surface are collected. In changing the cell supernatant,
centrifugal action is used. The mixture is centrifuged for 15
minutes at 3000 rpm, the cells are precipitated, and thereafter the
decomposed substance 17 can be removed by discarding the
supernatant. The precipitated cells are resuspended. This process
is given a reference numeral 16. A reference numeral 18 indicates a
group of the collected cells 3 with the CD4 antigen 1 on the
surface. A reference numeral 3' is given to the cells 3 and a
reference numeral 1' to the surface antigen CD4 1, indicating that,
as a result of acting the nuclease on the cells 3, there is a
chance, be it slim, that the cells 3 and the antigen 4 are affected
in some way, and that they may not be exactly the same as
before.
[0292] FIG. 18 is a view showing a time change of fluorescence
intensity of the identification-substance .beta.-phycoerythrin
bonded to the cell surface with the addition of the nuclease.
Herein, the cells are placed on a preparation, the cell surface is
observed under a fluorescence microscope, and an integrated value
of the fluorescence intensity obtained from the entire cell is
observed. When the aptamer is degraded with the nuclease, the
identification-substance .beta.-phycoerythrin is diffused from the
cell surface and turns unobservable, hence by following the
fluorescence intensity, progress in degradation of the aptamer by
the nuclease can be followed. In FIG. 18, the horizontal axis
represents time, while the vertical axis indicates integrated value
of the fluorescence per cell shown as the fluorescence intensity
per cell. The figure is a result of time course observation under
the fluorescence microscope of the fluorescence intensity
(excitation wavelength at 532 nm, fluorescence wavelength at 575
nm, a band pass filter in use) of the cell surface of the cells
presenting the cell surface CD4 bonded with the
.beta.-phycoerythrin-modified RNA aptamer (the group 12 in FIG. 17
of the cells 3 bonded with the labeling-substance RNA aptamer)
isolated with the cell sorter. In order to avoid fluorescent
degradation, radiation time of the excitation light is limited to a
minimum length: for instance, the light is radiated for a second at
a minute interval for the fluorescence observation.
[0293] Reference numeral 22 is a line indicating the time change of
the fluorescence intensity. An arrow 21 indicates the timing at
which the Benzonase (registered trademark) nuclease is added. It is
difficult to completely prevent the fluorescence degradation, even
if the radiation time of the excitation light at excitation
wavelength at 532 nm is kept short, and upon the defection of the
Benzonase (registered trademark) nuclease (time area 23), the
fluorescence intensity slightly reduces over time. Upon the
addition of the Benzonase (registered trademark) nuclease at the
timing 21, the fluorescence intensity detectable from the cells
reduces rapidly in the time zone 24, although with some delay in
timing.
[0294] This indicates that during the isolation process, with the
cell sorter, of the cells presenting the cell surface CD4 bonded
with the .beta.-phycoerythrin-modified RNA aptamer, the
functionality of the .beta.-phycoerythrin as the identification
substance remains intact, but that when the nuclease is added, the
portion of the RNA aptamer (the reference numeral 5 in FIG. 17) of
the .beta.-phycoerythrin-modified RNA aptamer bonded with the cell
surface is decomposed, and that the fluorescence-substance
.beta.-phycoerythrin 6 is diffused into the solution.
[0295] FIG. 19 is a diagram indicating culturability of the cells
presenting the surface CD4 obtained by removing the
.beta.-phycoerythrin-modified RNA aptamer according to the third
embodiment. The horizontal axis represents time, while the vertical
axis indicates the number of cells. From the characteristics in
FIG. 18, the time necessary for the .beta.-phycoerythrin-modified
RNA aptamer to be regarded as sufficiently removed by adding
Benzonase (registered trademark) is evaluated beforehand. The cells
with the .beta.-phycoerythrin-modified RNA aptamer removed are
obtained after waiting for the time described hereinabove after
adding the nuclease to the cells isolated with the cell sorter. The
cells thus obtained are incubated in, for example, a microchamber
for cell incubation disclosed in Japanese Patent Application No.
2004-305258 filed by the inventors of the present invention. The
microchamber for cell incubation is made of agarose and made up of
an array of microchambers, has a structure allowing changes of
culture liquid at any time through a semipermeable membrane, and
allows a long-term incubation of cells on an individual cell basis.
Upon incubation of the cells presenting the surface CD4 with the
.beta.-phycoerythrin-modified RNA aptamer removed therefrom, the
cells divide, as shown in Graph 31. Graph 31 shows a stepwise
increase, indicating that, as the process starts with a single
cell, the number of cells grows each time the cells divide. The
cells not subjected to the Benzonase (registered trademark)
nuclease process are unable to divide as is shown in Graph 32, and
become extinct over time.
[0296] When surface antigen is recognized by bonding an RNA aptamer
to a cell marking and, when the cell marking is no longer required,
the RNA aptamer is degraded and removed with ribonuclease, the
cells can be returned to a state as natural to the extent as allows
them to divide, like before the cell marking. This technique, as
described in the first example, brings about a revolutionary impact
to the cell isolation with a cell sorter. In the conventional
method of cell separation by labeling a surface antigen with an
antibody, the labeling substance cannot be removed from the cell
after the separation of target cells, and in most cases damages to
the cells are fatal. The third embodiment allows a reversible
removal of the labeling substance to the surface antigen, therefore
the separated cells can be used.
(Other Example of Aptamer 1)
[0297] In the previous example, a detailed description is given to
a case in which RNA aptamer is used as the aptamer as the labeling
substance and a cell surface antigen CD4 is used as the labeling
target. In this example a use of aptamer of type DNA as the
labeling substance for micro separation of a live cell tissue is
described.
[0298] In preparation of the DNA aptamer, a sequence of about 40
bases long and random to the CD4 antigen, with priming sequences
for PCR amplification attached to both ends, is prepared in
advance, and is affinity-separated with CD4 antigen fixed to a
magnetic particle. The affinity-purified fraction is PCR-amplified
using the priming sequences at both ends, and is once again
affinity-separated with CD4 antigen fixed to a magnetic particle.
By repeating this process, DNA aptamer bonding to the CD4 antigen
is obtained, although the bonding strength is weaker than that of
RNA aptamer. Finally, by using primer with an SH group having a
blocking group at 5' end as one of the primers through PCR
amplification, DNA aptamer with the 5' end modified with an SH base
is obtained. Thereafter, by using a method similar to that
described in the example is applied: the DNA aptamer is reacted to
gold nanoparticle .beta.-phycoerythrin, and
1-phycoerythrin-modified DNA aptamer is obtained as identification
element.
[0299] A biopsy sample is lightly crushed up on a slide glass and
fixed thereto. The sample is added with the
.beta.-phycoerythrin-modified DNA aptamer; is left for 30 minutes
and cells in the sample presenting the CD4 are labeled with the
.beta.-phycoerythrin-modified DNA aptamer; then the labeled part is
cut out (or the unlabeled part is removed by laser killing); the
part is treated in culture fluid with Benzonase (registered
trademark) nuclease or DNasel added at pH 7; and part of the tissue
rich in CD4 is obtained as the tissue remains alive.
(Other Example of Aptamer 2)
[0300] In this example, labeling-substance aptamer is of type RNA
bonding to EpCAM, and magnetic particles around 100 nm in diameter
are used as the identification substance. The object is to identify
and separate tumor-originated cells circulating in the blood and
having EpCAM as surface antigen.
[0301] In preparation for RNA aptamer bonding to EpCAM, a sequence
90 bases long is synthesized by introducing a sequence of 26 bases,
including a sequence for T7 promoter, to the 5' end of a
single-chain DNA random sequence of 40 bases, and a priming site
for PCR made up of 24 bases to the 3' end of the single-chain DNA.
The sequence is from the
TABLE-US-00006 (SEQ ID NO: 14) TAATACGACTCACTATAGGGAGACAAN(40)
TTCGACAGGAGGCTCACAACAGG.
The T7 sequence is used for transcription to RNA with RNA
polymerase. For the transcription to RNA, a quantity of 500 .mu.l
of DNA at 100 pmol is reacted with 100 u of T7 polymerase. For the
bases, 3 mM each of 2'-F-CTP and 2'-F-UTP as well as 1 mM each of
ATP and GTP are used, and the polymerase is acted on at 25.degree.
C. for 10 hours. After the RNA transcription is completed, the DNA
is degraded with DNasel and the transcribed RNA products are
collected with electrophoresis. The collected transcribed RNA
products are heat-denatured, and then are passed through a
sepharose CL4B column, fixed with EpCAM, in PBS (at pH 7.4) added
with 2 mM of MgCl.sub.2. The bonded transcribed RNA elements are
eluted in solution containing 7M urea. The resultant transcribed
RNA elements are reverse-transcribed and PCR-amplified with a pair
of primers each complementary to each of the known sequences at
both ends. The resultant PCR products are again transcribed with T7
promoter, the transcribed RNA is captured with a sepharose CL4B
column fixed with EpCAM, in a similar fashion as before, and the
bonded transcribed RNA elements are collected. By repeating the
process of transcription, capture, collection and PCR amplification
15 times, RNA aptamer specifically reactive to EpCAM is
obtained.
[0302] At the 5' end of the resultant RNA aptamer is inserted a
thiophosphoric acid group through in vitro transcription, as
described in an article "Staining of cell surface human CD4 with
3'-F-pyrimidine-containing RNA aptamers for flow cytometry"
(Nucleic Acids Research 26, 3915-3924 (1998)). To the
thiophosphoric acid group is reacted biotin with an iodine acetyl
group introduced thereinto, and 5' biotin-modified RNA aptamer is
obtained. Magnetic beads conjugated with streptoavidin are reacted,
and RNA aptamer specifically reactive to EpCAM with a magnetic
particle as the identification substance is obtained.
[0303] Reaction of a magnetic particle with RNA aptamer label to an
EpCAM-positive tumor cell is described hereinafter. 10 ml of blood
is suspended in culture solution 5 times the quantity of the blood,
the RNA aptamer specifically reactive to EpCAM with the
marker-substance magnetic particle is added, and is stirred slowly
for 30 minutes. The suspension fluid is sent through a tube with 2
mm in inner diameter, and magnetic particles are captured with an
array of neodymium magnets spaced at an interval of 1 cm. The
collected magnetic particles are washed with culture fluid, and
cells are separated using the cell sorter in example 1. To the
separated cells is added Benzonase (registered trademark) nuclease
for degradation of the RNA aptamer, and live cells are obtained.
The separated live cells are incubated in the microchamber
disclosed in Japanese Patent Application No. 2004-305258.
Tumor-derived cells, if any, can endure incubation for a prolonged
period, and some of them start dividing shortly.
[0304] Generally most of live cells circulating in the blood are,
apart from hematopoietic cell groups, derived from tumor. Cells
other than tumor cells do not normally break off the surface of
vascular endothelium alive, and if they do, they are degraded in
blood with the work of host defense mechanism. On the other hand
tumor cells do break off alive, resist to degradation in blood as
well, and circulate in the blood alive. The number of such cells,
however, is small, making it unsuitable for biopsy. If
tumor-derived cells circulating in the blood are collected alive in
a large number and are incubated for a certain period of time, it
can be known that there is a tumor somewhere in the body, although
it is not possible to identify the tumor site.
[0305] If particles or magnetic particles are used as
identification substance of the identification element as used in
the above example, such methods as particle imaging, scattered
light detection or magnetic detection can be used in identifying
cells bonded to the marker substance of the identification
element.
[0306] (B) A method of and an apparatus for immediately freezing
and storing the separated cell according to the necessity is
described hereinafter.
[IV] Fourth Embodiment
[0307] A fourth embodiment discloses a method and a means of
freezing a sample cytoplasm without destroying the same; in the
fourth embodiment a freezing rate of a cell is quickened to the
utmost limit, namely, water mixed with a sample is cooled in a
pressurized state to a temperature of a little under 0.degree. C.
so that it won't freeze; the water is then frozen by reducing
pressure rapidly, while at the same time the sample is frozen
quickly. By instantly skipping over a zone of maximum ice crystal
formation, and by freezing the sample cytoplasm amorphously, the
cytoplasm of the sample can be frozen without being destroyed.
[0308] In general, it is difficult to freeze water mixed with a
sample in a very short time by controlling outside temperature
because temperature transmission depends on heat conduction of a
substance and convection of a solvent. Therefore, in general, a
thinly sliced section of a sample is cooled in liquid nitrogen to
cope with it. However, when a thicker section is used, a heat
conduction influence emerges, making it difficult to cool it at a
high rate. On the other hand, because the fourth embodiment is a
method dependent on pressure transmission of a substance, it is
possible to cool at a much higher rate than a heat conduction
method. In respect to a relationship between pressure and
temperature, a pressure transmission rate can be equivalent to that
of a pressurized substance itself; therefore it is possible to
transmit virtually at the speed of sound.
[0309] In the fourth embodiment, water and the sample are put into
a pressure-resistant vessel so that no gas phase exists. Namely,
the sample is put inside the vessel so that there will be no
bubbles or air space; while applying pressure slowly so that a
temperature doesn't go up, the water is cooled at a temperature of
not more than 0.degree. C. in such a condition as no sample in the
water freezes. After reaching the prescribed pressure and
temperature, the pressure is instantly reduced. Then a temperature
in the sample goes down according to a decompressing time, and
finally the sample freezes. Of course, water consumes latent heat
to change its phase into ice, which has to be taken into
consideration. Instant freezing is made possible by reducing
pressure right before the water changes its phase into ice, after
the water reaches the prescribed temperature with the prescribed
pressure. A phrase, "no gas phase exists" means that water is
degassed; and it means that no bubbles can be seen on the walls of
the pressure-resistant vessel or the outside surface of the
sample.
Example 1
[0310] FIG. 20 indicates a diagram of water which is commonly
known. The horizontal axis indicates pressure applied on water,
while the vertical axis indicates temperature; information on a
high temperature region is skipped because there is no need for it.
The triple point of water coincides with the pressure 0 point on
line segment 5 (on the vertical axis of FIG. 20) which divides
liquid water region 1 and ice-I region 2. Ice changes into various
phases depending on pressure and temperature; there are ice-III
region 3 and ice-V region 4, but here the relationship between the
ice-I region 2 and the liquid water region 1 is important.
[0311] FIGS. 21 (A) and (B) indicate a cross-sectional view showing
an outline of examples for describing a cell freezing method and a
cell freezing apparatus according to the fourth embodiment. In FIG.
21 (A) the reference numeral 22 indicates a stainless pressuring
vessel having, in the middle, a cylinder, for example, with an 8
mm-bore and a 10 mm height, with its top end open for putting water
21 and a sample 24. The cylinder has a tapered top end. A
pressurizing vessel 22 is supposed to be sturdy enough to sustain
the pressure applied on water. The numeral number 23 indicates a
piston, which is inserted into the cylinder of the pressurizing
vessel 22. The surface of the piston 23 and the inside of the
cylinder of the pressurizing vessel 22 are mirror surfaces; and
both of them have to be large enough for the piston 23 to move
inside the cylinder, but at the same time they have to have tight
space in which a tight built-in can be realized so that no water
leaks out from a contact surface of the piston 23 and the cylinder
of the pressurized vessel 22.
[0312] A 0.1 g of liver cell tissue sample is put into the water 21
as a sample 24 (herein, it is regarded as a culture solution and is
called a sample solution 21). The sample solution 21 is poured into
the cylinder so that there will be no gas phase; that means the
solution 21 is poured to a degree that the solution is spilt from
the cylinder so that no bubbles stick on the surface of the
cylinder. Then the sample 24 is put into the cylinder.
[0313] As described in FIG. 21 (B), the piston 23 is slowly
inserted into the pressurizing vessel 22. As a matter of fact, this
insertion is conducted with a pressurizing device 25 utilizing
hydraulics and the like. The pressurizing device 25 is controlled
with a control device 26. At this time, by pouring a plenty of
sample solution 21 so that the sample solution overflows from the
top of the pressurizing vessel 22, it is possible to prevent air
from coming inside the cylinder when the piston 23 is inserted.
[0314] When the piston 23 is inserted into the cylinder of the
pressuring vessel 22, pressure is applied slowly up until 0.1 GPa
while paying attention so that the temperature of the sample
solution 21 inside the cylinder doesn't go up. A signal given by
the control device 26 to the pressuring device 25 is programmed so
that a scope of temperature drop and pressurization fall is within
the range of not under the line segment 5 as well as in the range
of the line segment 5 plus 4.degree. C. In this case, it is
permissible to write a program according to a previous experiment,
and it is permissible to mount a thermometer not shown in the
cylinder, in order to control this signal while feeding back the
signal to the control device 26. At a time when the pressure inside
the cylinder, namely the pressure applied by the pressurizing
device 25, reaches 0.1 GPa; namely when the pressure reaches a
state of almost the lowest temperature in the relationship between
the ice-I region 2 and the liquid water region 1, the control
device 2 6 releases hydraulic pressure, reducing the pressure
rapidly. That makes a liver cell tissue sample 24' inside the
cylinder freeze.
[0315] Due to a latent heat influence of the pressurizing vessel
22, it is in fact impossible to reduce a temperature of the sample
to -20.degree. C., but it can be cooled to around -10.degree. C.
According to molecular dynamic calculation of ice, it takes
250.about.350 nanoseconds for water to change its phase into ice
with only molecular reorganization, while ignoring heat conduction.
Assuming that a slice of the sample 24 is around 5 mm thick, and a
pressure transmission rate is 1500 m/second, it takes about 3.mu.
seconds to transmit pressure. It is assumed that a time needed for
the freezing of the invention is from several .mu. seconds to
several dozen .mu. seconds. Because of that, it is possible to
freeze cells instantly.
[0316] (C) Next, a device and a method for handling separated cells
in a cell-by-cell way are described.
[V] Fifth Embodiment
[0317] Descriptions are provided below for example cases where, in
order to place a prespecified number of the separated cells each in
a prespecified position on a cell culture chip, hydrophilic areas
are separately formed with a prespecified distance between one
another on the surface of the cell culture chip, a suspension of
cells is dropped as a droplet of an appropriate size containing a
required number of cells from the tip of a pipet having sucked the
suspension, and the size of a droplet and the number of cells are
monitored and controlled by monitoring the tip of the pipet with an
optical system.
Example 1
[0318] FIG. 22(a) is a plan view showing a cell culture chip 100
advantageously used in Example 1, and FIG. 22(b) is a
cross-sectional view showing the cell culture chip 100 taken along
the line A-A in the plan view and viewed in the direction indicated
by the arrow. The reference numeral 1 indicates a silicon
substrate, for instance, with a thickness of 1 mm and with a size
of 20 mm.times.20 mm. 2 indicate walls, which are made of silicon
substrates, with a thickness of, for instance, 1 mm, and with a
height of 0.5 mm. An area surrounded by the walls 2 is a
hydrophobic area 3, in which hydrophilic areas 4 are regularly
placed. The size of the hydrophilic area 4, which is determined
from the size or the number of cells to be placed in one of these
areas, is approximately 400 .mu.m.times.400 .mu.m. Spacing between
the hydrophilic areas 4, which should have a distance sufficient
for droplets containing the cells not to contact and not to be
mixed one another, is preferably about 2000 to 4000 .mu.m for
convenience of handling. 5 indicates a marker for positioning,
which is formed on one side of the silicon substrate 1.
[0319] In a method of producing hydrophilic areas and a hydrophobic
area, for instance, the upper side of the hydrophobic silicon
substrate 1 is oxidized once to turn the entire area into a
hydrophilic SiO.sub.2 thin film. Then, a hydrophobic area may be
produced by dissolving and removing the SiO.sub.2 thin film in the
area to be hydrophobic with hydrofluoric acid.
Example 2
[0320] FIG. 23(a) is a conceptual diagram for illustrating
configuration of a system for distributing a cell to the cell
culture chip 100 in Example 2, and FIG. 23(b) is a cross-sectional
view showing the state in which the cell has been placed in a
hydrophilic area 4 of the cell culture chip 100.
[0321] In Example 2, a cell 12 is placed in a hydrophilic area 4 on
a cell culture chip 100 while optically monitoring a droplet formed
at the tip of a pipet 11 for distributing the cell 12. In FIG.
23(a), 19 indicates a stage to be driven in the direction of XY,
and 27 indicates a driving unit for the stage 19. A heater 22 for
controlling the temperature of the cell culture chip 100 is
provided on the upper side of the stage 19, on which the cell
culture chip 100 is placed. Above the cell culture chip 100, the
pipet 11 is placed, in which a suspension 13 containing the cell 12
to be distributed has been sucked up in advance and held. At the
root of the pipet 11, a syringe pump 31 is provided via a tube 30,
and the syringe pump 31 is attached with a driving unit 32. When
the syringe pump 31 is driven by the driving unit 32, the
suspension 13 in the pipet 11 is squeezed out together with the
cell 12. It is to be noted that a joint between the root of the
pipet 11 and the tube 30 is illustrated as like they are separated
because it is intended to show the pipet 11 in an enlarged view,
but they are not actually separated.
[0322] On the other hand, at the tip of the pipet 11, the tip of
another pipet 20 for supplying a culture solution to the tip of the
pipet 11 is placed. At the root of the pipet 20, a syringe pump 35
is provided via a tube 34, and the syringe pump 35 is attached with
a driving unit 36. When the syringe pump 35 is driven by the
driving unit 36, the culture solution in the syringe pump 35 is
squeezed out from the pipet 20.
[0323] Also, a driving unit 37 for vertical motion of the pipet to
transfer a droplet formed at the tip of the pipet 11 into a
hydrophilic area 4 of the cell culture chip 100 is provided.
Herein, the vertical motion driving unit 37 is correlated to the
pipet 11. When a signal to lower the pipet 11 is given to the
vertical motion driving unit 37 by a user, the pipet 11 is moved
downward and the droplet formed at the tip of the pipet 11 is
transferred into a hydrophilic area 4 of the cell culture chip 100.
When a signal to restore the pipet 11 is given to the vertical
motion driving unit 37 by the user, the pipet 11 is moved back to
the position shown in the figure. Restoration of the pipet 11 to
the position shown in the figure may be carried out
time-sequentially after the downward operation using a PC 26. An
alternate long and short dash line 39 denotes a correlation between
the vertical motion driving unit 37 and the pipet 11.
[0324] Further, a light source 16 and a condenser lens 17 are
provided, which construct an optical system for monitoring the size
of a droplet formed inside the pipet 11 adjacent to the tip and
formed at the tip of the pipet 11, while in the opposite position
to the light source and the condenser lens, a collimate lens 18 and
a monitor 25 are provided below the cell culture chip 100.
Accordingly, the cell culture chip 100, the heat regulator 22, and
the stage 19 must be optically transparent. 26 indicates a PC,
which provides a control signal obtained from a prespecified
program stored in advance in response to an input signal from the
monitor 25, and necessary signals for the driving units 27, 32 and
36 in response to an operation input signal 28 which the user gives
while watching the display screen of the monitor 25. Although it is
not shown in the figure here, it is convenient that the same
display as the screen of the monitor 25 detecting are displayed on
the monitor screen of the PC 26. Thus, the monitor 25 can be a
small CCD camera. The operation input signal 28 is to be given via
an input device of the PC 26.
[0325] Consideration about the size of the pipet 11 is provided as
follows. The pipet 11 must be able to form a droplet of an
appropriate size containing a required number of cells, at the tip
thereof. On the other hand, in the pipet 11, the suspension
containing cells is sucked up by the pipet prior to its use, and
when forming a droplet, the cells passing through the tip of the
pipet 11 must be detected by the monitor 25 without error.
Therefore, the diameter of the tip of the pipet 11 allows only a
cell or a mass of a prespecified number of cells to pass through,
but does not allow cells to pass through at once so many as
uncountable. Namely, unlike pipets for culture with a large
diameter currently used for general purpose, it is preferable to be
transparent and to have a diameter at the tip of 20 to 100 .mu.m
for general animal cells, or of about 5 .mu.m for microbes such as
bacteria.
[0326] An operation to distribute a cell 12 into a hydrophilic area
4 of the cell culture chip 100 is described below. Firstly, when
the system is started-up, the user positions the cell culture chip
100 to lie in a prespecified start-up position by focusing
attention on the marker 5 described in FIG. 22(a). Next, in
response to the operation input signal 28 which transfers the first
distribution position of the cell 12 to the position corresponding
to the tip of the pipet 11 and pipet 20, the stage 19 is operated
with the driving unit 27. When the cell culture chip 100 reaches a
prespecified position, an operation is carried out to eject the
suspension 13 in the pipet 11 together with the cell 12. In this
step, the outside of the tip and the inside adjacent to the tip of
the pipet 11 are monitored with the optical system including the
light source 16 and the monitor 25. Output from the monitor 25 is
captured into the PC 26, and the driving unit 32 is activated based
on a result of image computing by the PC 26, to control a transfer
of liquid in the syringe pump 31.
[0327] While monitoring the tip of the pipet 11 with the monitor
25, the driving unit 32 is moved by activating the driving unit 32,
and a droplet 21 is formed at the tip of the pipet 11 by ejecting
the suspension 13 containing the cell 12 from the tip of the pipet.
In this step, the PC 26 determines through the monitor 25 that a
prespecified number of cells are inserted into the droplet 21, and
sends a stop command to the driving unit 32 to stop the syringe
pump 31.
[0328] To simplify descriptions, it is described below as the
number of cells 12 to be inserted into a droplet 21 is one, but the
number of cells may be discretionally determined by the user
according to a purpose. For instance, it may be 10 cells.
Identification of the cell 12 may be carried out just by directly
detecting the cell 12 present in the droplet 21 at the tip of the
pipet 11, but more efficiently, the syringe pump 31 may be
controlled by monitoring the cell 12 passing inside the pipet 11
with the monitor 25, and by calculating the cell's position and
passing speed inside the pipet with the PC 26 to predict a timing
of ejecting the cell into the droplet 21 from the tip of the pipet
11. Using the latter identification method, it is advantageous for
inserting just one cell into the droplet, for instance, when a
plurality of cells is passing inside the pipet 11 at a short
interval.
[0329] When the cell concentration of the cell suspension 13 is
low, each droplet 21 can be made in a certain size by starting to
form the droplet 21 just before a cell being ejected from the tip
of the pipet 11 and then stopping droplet formation after a
prespecified time period. When a droplet is not required to be
formed, for instance, liquid being ejected from the tip of the
pipet 11 may be blown off with a blower. Alternatively, a drain may
be provided outside the substrate 1 to eject the unwanted liquid
thereto.
[0330] On the other hand, when the cell concentration of the cell
suspension 13 is high, quantities of drops ejected from the pipet
11 are varied. Namely, since the frequency of ejection of a cell 12
being ejected from the pipet 11 increases, if the time period for
ejecting liquid is fixed at a prespecified time period, the next
cell may possibly be inserted into the same droplet 21 within the
time period. In such a case, the pipet 20 is to be used. In the
pipet 20 and the syringe pump 35 correlated thereto, only culture
solution or cell dilution is held. Namely, when via the monitor 25
the PC 26 checks that a cell 12 enters a droplet 21, it issues a
stop command to the driving unit 32 to stop the syringe pump 31 as
well as it calculates the volume of the droplet 21 at that moment
based on the fed quantity until that moment by the syringe pump 31
driven to form droplets 21. The difference between this volume and
the desired volume of a droplet 21 is calculated with the PC 26.
According to this calculation result, the PC 26 sends an operation
signal to the driving unit 36 so as to add culture solution or cell
dilution with the pipet 20 to the droplet 21 which has been already
formed, so that liquid is added to the droplet 21 using the pipet
20 by driving the syringe pump 35 until the volume of the droplet
21 reaches a prespecified value.
[0331] In this step, in order to prevent the cell in the droplet
from flowing back to the pipet 20, the tip of the pipet 20
preferably has a size unavailable for a cell to pass through, for
instance, with a diameter of 0.2 .mu.m. Alternatively, the tip may
preferably have a structure with 0.2 .mu.m filter.
[0332] The droplet 21 containing a single cell produced in this way
is contacted with a hydrophilic area 4 on the substrate 1 placed on
the stage 19 using the vertical motion driving unit 37 for the
pipet 11, then the droplet 21 is transferred into the hydrophilic
area 4 on the substrate 1. When the transfer is checked of the
droplet 21 containing the cell 12 into the hydrophilic area 4 on
the substrate 1, namely, the hydrophilic area 4 of the cell culture
chip 100, the user gives an operation signal 28 to move a stage
driving unit 10, and moves the cell culture chip 100 so that the
tip of the pipet is to be positioned in a position for the next
droplet to be placed. This movement can be automatically carried
out by the PC 26 as positional information of the hydrophilic areas
4 has been provided to the PC 26. Then, in this new position, a new
droplet is formed at the tip of the pipet 11 as described above,
and transferred into another hydrophilic area 4 of the cell culture
chip 100. By repeating this step, droplets are placed in required
positions in hydrophilic areas 4 of the cell culture chip 100. All
of these operations are carried out in a moist atmosphere in order
to avoid drying. When placement of droplets 21 is finished, the
whole area surrounded by the walls 2 is filled with silicon oil
38.
[0333] FIG. 23(b) is a cross-sectional view showing the state in
which the cell has been placed in a hydrophilic area 4 of the cell
culture chip 100, by a system for distributing a cell to the cell
culture chip 100 in Example 2, as described with reference to FIG.
23(a). A cell 12 and a droplet 15 enveloping thereof are placed in
a hydrophilic area 4 within the area surrounded by the walls 2 on
the silicon substrate 1. The area surrounded by the walls 2 is
fully filled with silicon oil 38. Since each droplet 15 is about
0.2 to 2 .mu.l, the droplet 15 is protected from drying by filling
silicon oil 38 inside the walls 2 of 0.5 mm in height.
[0334] The reason for using silicon oil here is because silicon oil
has excellent gas permeability. This allows to supply oxygen
constantly to the cell 12 in the droplet 15, and to keep the cell
12 alive in a very small quantity of culture solution. The
thickness of the silicon oil is preferred to be thinner, but thick
enough to cover the droplet 15, for instance, so as to be 0.5 mm in
depth, the silicon oil being poured softly. Depending on kind and
state of the cell, for instance, in a case of epithelial cells,
this allows them to be observed usually for several hours. For cell
observation, the monitor 25 may be used, or alternatively the chip
may be transferred to another device for observation.
Example 3
[0335] In order to observe the cells by incubating for longer
hours, ensuring oxygen permeability is not enough and a droplet 15
enveloping a cell 12 must be exchanged with a new culture
solution.
[0336] FIG. 24 is a conceptual diagram illustrating system
configuration in Example 3 in which the function for exchanging a
droplet 15 enveloping a cell 12 with a new culture solution in the
system configuration in Example 2 is emphasized. In practice, a
pipet 20 and a tube 34 correlated thereto, a syringe pump 35, and a
driving unit 36 in the system configuration in Example 2 can be
used, therefore descriptions are provided with reference to FIG. 23
but without irrelevant parts deleted from the configuration. It is
needless to say that a pipet 20 and a tube 34 correlated thereto,
and a syringe pump 35 may be exchanged with new ones from a point
of view to avoid contamination or the like.
[0337] The stage 19 is moved so that the tip of the pipet 20 comes
in a position of the droplet 15 to be exchanged with a new culture
solution, and the droplet 15 in question is monitored with the
monitor 25. While monitoring the droplet 15 and the tip of the
pipet 20 with the monitor 25, the pipet 20 is inserted into the
droplet 15. Here, the vertical motion driving unit 37 is to be
correlated to the pipet 20. To the vertical motion driving unit 37,
a signal to lower the pipet 20 is given by the user, then the pipet
20 is moved downward and the tip of the pipet 20 is inserted into
the droplet 15.
[0338] After it is checked via the monitor 25 that the tip of the
pipet 20 is inserted into the droplet 15, the user gives a signal
28 to exchange culture solution to the PC 26. If the PC 26 has been
given with information about the size of the droplet 15 and the
number and size of cells enveloped therein, in response to the
signal 28 to exchange culture solution, the PC 26 can automatically
and time sequentially carry out operations to eject (to absorb and
throw away) a prespecified amount of old culture solution and to
supply a new culture solution containing such as substrates and
growth factors by driving the syringe pump 36. In this step, it is
important that the cell 12 enveloped in the droplet 15 must not be
ejected together with the old culture solution, and unwanted
bacteria must not contaminate with the new culture solution.
[0339] For this purpose, the tip of the pipet 20 preferably has an
inner diameter not to suck in any cell, for instance, 0.2 .mu.m.
Alternatively, the tip may have a structure with 0.2 .mu.m filter.
Further, the pipet 20 and the tube 34 correlated thereto, and the
syringe pump 35 should be treated to keep them sufficiently
clean.
Example 4
[0340] Operations to incubate cells for a prespecified period of
time, to complete observation by the monitor 25, and to recover
only a prespecified cell are described.
[0341] FIG. 25 is a conceptual diagram showing system configuration
in Example 4 in which the function for recovering a cell from
inside of the droplet 15 enveloping a prespecified cell 12 in the
system configuration shown in Example 2 is emphasized. In practice,
a pipet 11 and a tube 30 correlated thereto, a syringe pump 31, and
a driving unit 32 in the system configuration in Example 2 can be
used, therefore descriptions are provided with reference to FIG. 25
but without irrelevant parts deleted from the configuration. It is
needless to say that a pipet 11 and a tube 30 correlated thereto,
and a syringe pump 31 may be exchanged with new ones from a point
of view to avoid contamination or the like. Further, considering
for recovering a cell, a pipet 11 may have a larger diameter.
[0342] By moving the stage 19 so as to lie in a position of the
droplet 15 enveloping the cell to be recovered, the droplet 15 in
question is monitored with the monitor 25. While monitoring the
droplet 15 and the tip of the pipet 11 with the monitor 25, the
pipet 11 is inserted into the droplet 15. Herein, the vertical
motion driving unit 37 is to be correlated to the pipet 11. To the
vertical motion driving unit 37, a signal to lower the pipet 11 is
given by the user, then the pipet 11 is moved downward and the tip
of the pipet 11 is inserted into the droplet 15, to recover the
cell 12 in the droplet 15 by sucking it up into the pipet 11.
[0343] After it is checked via the monitor 25 that the tip of the
pipet 11 is inserted into the droplet 15, the user gives a signal
28 to suck the cell 12 in the droplet 15 to the PC 26. If the PC 26
has been given with information about the size of the droplet 15
and the number and size of cells enveloped therein, in response to
the signal 28 to suck in the cell 12, the PC 26 can automatically
and time sequentially carry out an operation to suck the cell 12
into the pipet 11 together with the culture solution by driving the
syringe pump 31. Herein, since sucking is carried out by inserting
the pipet 11 into the droplet 15 enveloping the cell 12 through the
silicon oil 38, more or less the silicon oil 38 is sucked up
together, but it can be ignored without problem.
[0344] The cell 12 sucked into the pipet 11 is ejected to a
prespecified recovery container to recover the targeted cell.
[0345] After recovering the targeted cell, when recovering a cell
12 from another droplet 15, the stage 19 is moved so that a droplet
15 enveloping a new cell to be recovered lies in a position able to
be monitored with the monitor 25, while monitoring the new droplet
15 in question with the monitor 25, the new cell is sucked into the
pipet 11 and ejected into a prespecified recovery container to
recover the new targeted cell, according to the procedure as
described above.
[0346] Consideration about the size of the pipet 11 suitable for
Example 4 is provided as follows. When producing a droplet in
Example 2, the pipet 11 preferably has a diameter at the tip of 20
to 100 .mu.m for general animal cells, or of 5 .mu.m for microbes
such as bacteria, however, considering ejection of cells after a
prespecified time period of incubation in Example 4, the pipet
needs a sufficiently large diameter to suck up a mass of cells made
by cell division. Specifically, it is approximately 100 to 400
.mu.m.
Example 5
[0347] FIG. 26(a) is a plan view showing another configuration of
the cell culture chip 100 in Example 5 advantageously applicable to
a fifth embodiment of the present invention; FIG. 26(b) is a
cross-sectional view showing the cell culture chip 100 above taken
along the line A-A in the plan view and viewed in the direction
indicated by the arrow; and FIG. 26(C) is a view illustrating a
method of forming a droplet. By comparing FIG. 26(a) and FIG.
22(a), it is obvious that the cell culture chip 100 in Example 5
has the same planar structure as that in Example 1. Also materials,
size and a producing method are the same. The cross-sectional
structure of the cell culture chip 100 in Example 5 is different
from that in Example 1. Namely, hydrophilic areas 4 are formed as
wells, while it is the same that the area surrounded by the walls 2
is the hydrophobic area 3, in which hydrophilic areas 4 are
regularly placed. The size of the well is to be 400 .mu.m in
diameter (or 400 .mu.m.times.400 .mu.m) and 100 .mu.m in depth.
[0348] As shown in FIG. 26(c), in this Example 5, silicon oil 38 is
applied in advance over the area surrounded by the walls 2. Passing
through the layer of silicon oil 38, the pipet 11 and the pipet 20
in Example 2 as described with reference to FIG. 23 are inserted,
and within the well 4, by supplying the cell suspension 13 from the
pipet 11 and dilution from the pipet 20, a droplet 21 is formed
directly in a well in a hydrophilic area 4. By contacting the tips
of the pipets 11 and 20 with walls of the well on the substrate 1,
the formed droplet 21 is automatically formed inside the well, to
be used as the droplet 15 in Example 2.
[0349] Also in Example 5, the well area to form the droplet 21 and
the tips of the pipets 11 and 20 have to be controlled while
monitoring with the monitor 25, but the figures and descriptions
are simplified because it can be understood easily from the
description in Example 2.
Example 6
[0350] In the examples as described above, a pipet is described in
each case as it has one function, while in Example 6, an example of
a pipet having two functions is described.
[0351] FIG. 27(a) is a view showing a tip of a pipet 81 having two
flow paths separated by a partition plate 82, and FIG. 27(b) is a
view showing configuration in which a pipet 89 is provided inside a
pipet 87 to form two flow paths.
[0352] In the configuration shown in FIG. 27 (a), by making a first
flow path 83 sufficiently larger than a second flow path 84, and by
designing a structure in which cell suspension can be supplied from
the first flow path 83 and dilution can be supplied from the second
flow path 84, the pipet 11 and the pipet 20 described in Example 2
can be integrated. It is needless to say that controls of the
respective flow paths are carried out with respective independent
syringe pumps.
[0353] In the configuration shown in FIG. 27(b), the inner pipet 89
has an inner diameter of 50 .mu.m, and spacing therefrom to the
inner wall of the outer pipet 87 is up to 8 .mu.m. This allows cell
suspension to be supplied from the inner pipet 87 and dilution to
be supplied from the outer pipet 89, so that the pipet 11 and the
pipet 20 described in Example 2 can be integrated. It is needless
to say that controls of the respective flow paths are carried out
with respective independent syringe pumps.
[0354] In each case, the size of a pipet for supplying dilution is
determined so as to avoid getting mixed with cells from the pipet
for supplying cell suspension, so that the pipet 11 and the pipet
20 described in Example 2 can be integrated.
Other Examples
[0355] In any example described above, underneath the substrate 1,
there is a device 22 for controlling a substrate temperature in
case of incubation of cells. Incubation is basically carried out
while observing cells via microscope, the substrate 1 itself should
be transparent. The heater 22 for controlling temperature should
also be transparent, for which ITO element may be preferably used.
When it is not ITO element, for instance, a structure inside which
transparent and thermally controlled circulation fluid flows may be
used. In this case, limitations may occur in the optical system of
the monitor 25, but it is to be solved by using long-focus
objective lens.
[0356] With respect to measurement of the number of cells passing
through the tip of a pipet, it can be measured by checking a cell
being ejected from the pipet, for instance, via installation of a
pair of electrodes at the tip of the pipet to capture an electrical
change when ejecting a cell from the pipet, or via irradiation of
laser light to the tip to detect light scattering when a cell
passing through.
[0357] By using a function of exchanging a droplet 15 enveloping a
cell 12 with a new culture solution, which is described with
reference to FIG. 24, influences on cells can be assessed by
injecting various materials influential on cells, for instance,
substrates for culturing cells, growth factors, chemical substances
such as cytokine or endocrine disrupting chemicals.
[VI] Sixth Embodiment
[0358] A reliable droplet manipulation is disclosed as a sixth
embodiment in which any droplet selected from a droplet group
arranging densely on the substrate are transferred to a predefined
position. In particular, droplet transfer lines with hydrophilic
property are arranged in the shape of matrix on the substrate with
an insulating surface having water-repellent property, and a
droplet holding area is provided at both ends of the droplet
transfer lines. A droplet is formed at the droplet holding area and
only a targeted droplet to be transferred is charged. When an
electrode with the same polarity as the electricity charged to the
targeted droplet closes to the targeted droplet, the targeted
droplet is transferred by a repulsion force generated between the
electrode and the targeted droplet along the droplet transfer line
with hydrophilic property. The transferred droplet is stopped in
the droplet holding area with hydrophilic property, and then
discharged to keep stable at the position. The transferred droplet
is contacted with any other droplet in the droplet holding area to
be reacted thereto.
Example 1
[0359] FIG. 28 (a) is a perspective view showing a substrate
applicable to the droplet manipulation according to the sixth
embodiment of the present invention; FIG. 28(b) is a perspective
view showing the substrate in which discrete droplets to be reacted
are placed on a surface of the substrate; and FIG. 28(c) is a
perspective view schematically showing the substrate during the
droplet manipulation.
[0360] In FIG. 28(a), a reference numeral 100 denotes a substrate
made of an insulating material, the whole surface thereof having
water-repellent property; droplet transfer lines 23 and 24 with
hydrophilic property are formed in a shape of matrix on the surface
thereof; droplet holding areas with hydrophilic property a, b, . .
. , p and droplet-holding areas with hydrophilic property 1, 2, . .
. , 16 are formed on both ends of the droplet transfer lines 23 and
24 in shape of matrix, in this example the droplet holding areas
with hydrophilic property a, b, . . . , p and the droplet holding
areas with hydrophilic property 1, 2, . . . , 8 are used as a
droplet holding area for holding a droplet to be reacted, whereas
the droplet-holding areas with hydrophilic property 9, 10, . . . ,
16 are used as a droplet holding area for holding a droplet after
two droplets are collided and reacted to each other. It is assumed
in this example that the droplet is 0.1 to 1 .mu.l in quantity, the
droplet holding area is for instance 30 .mu.m.phi. dot with
hydrophilic property, and the hydrophilic lines 23 or 24 used as a
path for droplet transfer is 2 .mu.m in width. The droplet can be
pushed out from the droplet holding area onto the hydrophilic lines
23, 24 by the repulsion force generated by the static electricity,
and role along the line. The reference numeral 101 denotes a
positioning mark.
[0361] In order to make the droplet on the droplet holding area
receive the repulsion force generated by the static electricity,
the droplet is required to be charged. This charging manipulation
is a modification based on a method described on Micro Total
Analysis Systems 2004, vol. 1, pp. 144-146 (Proceedings of .mu. TAS
2004, 8.sup.th International Conference on Minitualized Systems for
Chemistry and Life Sciences, ISBN 0-85404-643-7 or the like. FIGS.
29(a) and 29(b) are views showing a process for making the droplet
on the droplet holding area to be charged, in which FIG. 29(a)
shows an initial stage of making the droplet charged, and FIG.
29(b) shows a state in which the charged droplet is transferred to
the droplet holding area.
[0362] In this example, the substrate 100 is made of an insulating
material, and a reference numeral 201 is the droplet holding area
described in FIG. 28 with a droplet 204 is formed therein. There is
provided an electrode 112 on an area in the back of the substrate
100 corresponding to the droplet holding area 201. A capillary 210
is provided on the droplet holding area 201, capable of contacting
the droplet 204 freely, with a conductive solution 211 filled
therein, and contacting the electrode 212 at the opposite side
thereof. A predetermined voltage is applied to the electrodes 112
and 212, and then the solution 211 on the edge of capillary 210
contacts with the droplet 204. As a result, when the voltage is
loaded so as to make the electrode 112 positive and the electrode
212 negative, the droplet 204 and the solution 211 within the
capillary are polarized generally, where the droplet 204 carries
excessive negative electricity 221. In the state described above,
when the capillary 210 is lifted away from the droplet 204
immediately, the droplet 204 is charged with negative electricity
as shown in FIG. 29(b). On the contrary, in a case where a voltage
is loaded so as to make the electrodes 112 negative and the
electrode 212 positive, the droplet 204 can be charged with
positive electricity. As described hereinafter, the voltage applied
to between the electrodes 112 and 212 can be determined whether it
is applied or not via a switch 115 on a switchboard 74.
[0363] FIG. 30(a) is a cross-sectional view showing a relation
between an electrode portion for charging in the droplet holding
area of the substrate 100 and the switchboard 74; and FIG. 30(b) is
a cross-sectional view showing the relation between an electrode
portion for discharging in the droplet holding area of the
substrate 100 and the switchboard 74. Namely, FIG. 30(a) is a
cross-sectional view showing the electrode portion of the
hydrophilic droplet holding areas a, b, . . . , p or the
hydrophilic droplet holding areas 1, 2, . . . , 8, each area
holding a droplet to be reacted; and FIG. 30(b) is a
cross-sectional view showing the electrode portion of the
hydrophilic droplet holding areas 9, 10, . . . , 16 each holding a
droplet to induce reaction by colliding droplets or a resulted
droplet after reaction and integration.
[0364] As shown in FIG. 30(a), an electrode 112.sub.1 is provided
at an area on the back face of the substrate 100 corresponding to
the droplet holding area 201.sub.1 with the droplet to be reacted.
When the droplet is formed on the droplet holding area 201.sub.1,
the droplet faces to the electrode 112.sub.1 provided in a position
on the back face of the substrate 100 corresponding to the droplet.
The switchboard 74 is provided on the back of the substrate 100.
The switchboard 74 has a connecting electrode 114.sub.1 in a
position corresponding to the electrode 112.sub.1 on the back face
of the substrate 100. When the substrate 100 is mounted on the
switchboard 74, the electrode 112.sub.1 and the connecting
electrode 114.sub.1 corresponding thereto are connected each other.
The connecting electrode 114.sub.1 is connected with a power supply
116 through the switch 115 capable of switching open or close
selectively. As described above in FIGS. 29(a) and 29(b), when the
switch 115 is closed and the voltage is applied to between the
droplet on the droplet holding area 201.sub.1 and the electrode
112.sub.1, the droplet is charged. In the Figs. the switch 115 is
described as an independent part, however, it can be acceptable
that the switchboard 74 is a silicon substrate including
semiconductor circuits and the on-off switching operation thereof
is controlled with a personal computer 76 as described
hereinafter.
[0365] As shown in FIG. 30(b) similarly, in the droplet holding
area 201.sub.2 for holding the resultant droplet after two droplets
are collided and reacted to each other to be integrated, electrodes
110 are provided to be contacted with the droplet. The electrodes
110 are connected with an electrode 112.sub.2 provided in a
position corresponding to the back of the substrate 100 by a
connecting line 111. A connecting electrode 114.sub.2 is provided
in a position corresponding to an electrode 112.sub.2 of the
switchboard 74, therefore, when the substrate 100 is mounted on the
switchboard 74, the electrode 112.sub.2 and the connecting
electrode 114.sub.2 corresponding thereto are connected to each
other. The connecting electrode 114.sub.2 is grounded. As a result,
when a droplet enters the droplet holding area 201, the droplet is
discharged and kept stable in the area. Needless to say that
capacitance of the switchboard 74 or circuits in the example should
be minimized.
[0366] FIG. 28(b) shows a state in which a droplet is formed on the
droplet holding areas a, b, . . . , p and the hydrophilic droplet
holding areas 1, 2, . . . , 8 on the substrate 100. The droplet
forming is carried out, for instance, with a method described
below.
[0367] FIG. 31 is a view schematically showing a configuration in
which a droplet with a cell 62 is formed at a tip of a pipet 61,
and the cell is distributed, while optically monitoring, to the
droplet holding area of the substrate 100. A reference numeral 69
indicates a stage to be driven toward X or Y directions; and a
reference numeral 77 indicates a driving device for driving the
stage 69. The switchboard 74 is provided on an upper surface of the
stage 69, and the substrate 100 is mounted on the upper surface
thereof. On an upper part of the substrate 100, the pipet 61 is
provided with a suspension 63 including the cell 62 prepared
therein. When the cell to be put in the droplet is changed, the
pipet 61 is exchanged for a new one in order to prevent
contamination. At a root of the pipet 61, a syringe pump 81 is
provided via a tube 80 with a driving device 82 attaching to the
syringe pump 81. When the syringe pump is driven by the driving
device 82, the suspension 63 in the pipet 61 is pushed out
accompanying the cell 62.
[0368] While at the tip of pipet 61, a tip of a pipet 70 for
supplying a culture solution to the pipet 61 is provided. At a root
of the pipet 70, a syringe pump 85 is provided via a tube 84, with
a driving device 86 attaching to the syringe pump 85. When the
syringe pump 85 is driven by the driving device 86, the culture
solution in the syringe pump 85 is pushed out from the pipet
70.
[0369] A vertical motion driving device 87 for a pipet is provided
to place the droplet formed on the tip of the pipet 61 to the
substrate. In this example, the vertical motion driving device 87
is connected with the pipet 61. When the vertical motion driving
force 87 receives a signal for lowering the pipet 61 by a user, the
pipet 61 moves downward and the droplet formed on the tip thereof
is transferred to the droplet holding area on the substrate 100.
When the vertical motion driving device 87 receives a signal for
returning to the normal position by the user, the pipet returns to
the normal position as described in the figure. Restoration of the
pipet 61 to the position shown in the figure may be carried out
time-sequentially after the downward operation using a personal
computer 76. An alternate long and short dash line 89 denotes a
correlation between the vertical motion driving unit 37 and the
pipet 61.
[0370] Further, in order to monitor a size of the droplet formed on
the tip of the pipet 61 and inside near the tip thereof, there is
provided an optical system including a light source 66, a condenser
lens 67, a collimating lens 68, and a monitor 75, the latter two
provided on the bottom of the substrate 100 in a position opposing
to the former two. The substrate 100, the switchboard 74, and the
stage 69, therefore, are required to be optically transparent. In
this example, reference numeral 76 indicates a personal computer,
which transmits controlling signals according to prespecifed
program stored therein responding to an input signal via the
monitor 75 by a user and necessary signals to the driving devices
77, 82, 86 and 87 responding to the operational input signals 78
given by the user while monitoring a display screen of the monitor
75. Though not shown in the figure, it is convenient to display the
same screen on a monitor on the personal computer 76 as that being
detected by the monitor 75, the monitor 75 can operate as a small
CCD camera. Also, the operating input signal 78 is transmitted via
an input device of the personal computer 76.
[0371] With regard to the size of the pipet 61, a transparent pipet
is preferable having a tip thereof with the diameter of around 20
to 100 .mu.m for a general animal cell and of around 5 .mu.m for a
microorganism such as bacteria, based on the same reason as
described in Example 2 of the fifth embodiment.
[0372] A process is described as follows in which a cell 62 is
distributed to the droplet holding area on the substrate 100. At
first when the system starts up, the user positions the substrate
100 at a predefined starting-up position with reference to the
marker 101 shown in FIG. 28. Secondly the user operates the stage
69 by the driving device 77 responding to an operating input signal
78 to adjust an initial distributing position for the cell 62 to a
position corresponding to the tips of pipet 61 and 70. When the
substrate 100 moves to the predefined position, an operation for
discharging a cell suspension 63 within the pipet 61 accompanying
the cell 62, while monitoring the outside of the pipet 61 at the
tip thereof and the inside of the pipet 61 near the tip thereof
with the optical system including the light source 66 and the
monitor 75. Controls of sending the solution from the syringe pump
81 can be provided by capturing the output from the monitor 75, and
operating the driving device 82 based on computed results of images
by the personal computer 76.
[0373] The droplet is formed on the tip of the pipet 61 by
operating the driving device 82 while monitoring the tip of the
pipet 61 through the monitor 75 to operate the syringe pump, and
discharging the suspension 63 including the cell 62 from the tip of
the pipet 61. At that time, after the personal computer 76
recognizes through the monitor 75 that the predefined number of
cells is inserted in the droplet, the personal computer 76 commands
the driving device 82 to stop for stopping the syringe pump 81.
[0374] In order to make the description simple, the number of the
cell 62 inserted in the droplet is assumed to be one in this
example. However, the user can change the number thereof according
to a user's purpose to, for instance, 10 or the like. In order to
recognize the presence of the cell 62, the method of directly
detecting the cell 62 present in the droplet 71 formed at the tip
of the pipet 61 may be enough. However, more effective method is
allowable such as, monitoring the cell 62 moving inside the pipet
61 with the monitor 75, computing the position of the cell 62 and a
moving velocity thereof in the pipet 61 with the personal computer
76, and controlling the syringe pump 81 based on the calculated
timing of discharging the cell 62 into the droplet 21 from the tip
of the pipet 61. The latter recognizing method may bring advantages
in a case where only one cell is inserted into a droplet when
several cells are moving inside the pipet at a short interval.
[0375] In a case where the cell suspension 63 has a low cell
density, a droplet can be formed of a prespecified size by forming
the droplet 71 just before the cell comes out from the tip of the
pipet 61, and stopping the droplet forming after a predefined
period of time. When formation of the droplet is not desired, the
suspension coming out from the tip of the pipet 61 may be blown
out. Alternatively, the liquid may be discharged to a drain
provided outside the substrate 1.
[0376] On the other hand, in a case where the cell suspension 63
has a high cell density, the amount of suspension discharged from
the pipet 61 is not varied. Namely, as the cell 62 is discharged
from the pipet 61 more frequently, if the time for discharging the
suspension is fixed, the next cell may be disadvantageously
inserted into the droplet 71 within such period of time. To deal
with the case described above, the pipet 70 is used. The pipet 70
and the syringe pump 85 connected thereto are filled only with the
culture solution or the cell diluted solution. Namely when the
personal computer 76 recognizes via monitor 75 the cell 62 inserted
in the droplet 71, the personal computer 76 commands the driving
device 82 to stop for stopping the syringe pump 81, calculates the
volume of the droplet 71 at that time based on a fed amount from
the syringe pump 81 driven to form the droplet 71, and computes the
difference between the calculated volume of the droplet 71 and the
desired volume. According to the computed result, the personal
computer 76 sends an operational signal to driving device 86, so
that a culture solution or a cell diluted solution is added to the
droplet 71 being produced at that time with a pipet 70, makes the
syringe pump 85 drive, and adds the solution to the extent that the
volume of droplet 71 becoming the predefined value using the pipet
70.
[0377] To prevent the cell in the pipet 70 from going backward, the
pipet 70 is preferably of the size through which the cell can not
pass, for instance 0.2 .mu.m.phi., or has a filter structure with
the size of 0.2 .mu.m provided at the tip thereof.
[0378] The droplet 71, which is formed with the method described
above and contains a single cell, is contacted with a cell holding
area on the substrate 100 placed on the stage 69 by the vertical
motion driving device 87 of the pipet 61, and moves to the cell
holding area on the substrate 100. When it is confirmed that the
droplet 71 including the cell 62 moves to the cell holding area,
namely the droplet holding area on the substrate 100, the user
operates the stage driving device 77 by giving an operational
signal 78, and moves the substrate 100 to the position where the
tip of the pipet is set to a position for placing a next droplet.
The personal computer 76 can automatically operate the process, if
positional information concerning placement of the hydrophilic area
4 has been stored in the personal computer 76 in advance. In the
new position, the next droplet is formed at the tip of the pipet 61
and is moved to the droplet holding area on the substrate 100 as
described above. By repeating this process, the droplet is placed
to the correct position in the droplet holding area on the
substrate 100. In a case where the formed droplet does not include
a cell or the like, the pipet 70 for adjusting the size of the
droplet and the related device thereto is not necessary.
[0379] FIG. 28(c) shows conceptually a process for integrating to
react any of droplets selected from a droplet formed in the droplet
holding areas a, b, . . . , p and the hydrophilic droplet holding
areas 1, 2, . . . , 8 on the substrate 100. Also FIG. 28(c) shows a
state where the droplet 102 is transferred from the droplet holding
area 3 to the droplet holding area 11 and discharged, the droplet
103 charged with negative electricity is transferred from the
droplet holding area c to a point where two droplet transfer lines
crossing each other, one line extending from the droplet holding
area e and the other extending from the droplet holding area 3, and
the droplet 105 charged with negative electricity is transferred
from the droplet holding area 1 along the droplet transfer line
extending from the droplet holding area 1. Of those droplets, the
droplets charged with negative electricity are transferred by a
manipulation rod 107. Because the manipulation rod 107 is charged
with electricity in the same polarity as droplets to be
transferred, the droplets can be transferred just by making the
manipulation rod 107 close to the droplets from the opposite side
to the direction the droplets transferred thereto, without touching
the droplets. The other droplets do not move because they are not
charged, even being adjacent to each other. In the figures, the
droplets 103 and 105 are transferred at the same time, though in
the actual operation, the droplet is moved one by one. The detailed
process for transferring a droplet by the manipulation rod is
described below.
[0380] FIG. 32 is a view schematically showing a state where the
droplet 105 is transferred with the manipulation rod 107 on one of
the droplet transfer lines shown in FIG. 28. In this case, the
pipet 61 is replaced by the insulating manipulation rod 107 charged
with electricity, as similar to the case of forming a droplet
described above in FIG. 31, the manipulation rod 107 is moved
upward or downward under the control by the vertical motion driving
device 87 with an operational signal 78 while monitoring the tip of
the manipulation rod 107 and the droplet 105 via monitor 75, and
the direction to which the stage 69 moves is also controlled,
paying attention not to contacting the manipulation rod 107 with
the droplet 105. With this case described above, the vertical
motion driving device 87 simply controls upward or downward
operations, however, as is obvious with reference to FIG. 28(c),
the driving device preferably deals with operations for the other
directions because the droplet to be moved may need to be turned.
Namely, desirable positioning and formation should be made for the
driving device 87, so that a droplet receives a repulsion force
from backside at any time.
[0381] While the droplet 105 is transferred between the hydrophilic
droplet holding areas after pushed away by the repulsion force
generated between the manipulation rod 107 and the droplet 105, the
droplet 105 is discharged due to contacting the electrode to be
grounded, and stops automatically in a position with lower energy.
The driving device 87 lifts up the manipulation rod 107 and
prevents it from contacting with the droplet 105.
[0382] The droplet manipulation with the manipulation rod 107 in
shape of a bar is described in FIG. 32, though it is more practical
to use a manipulation rod 107' with a shape of ring in FIG. 33. For
instance in a case where the droplet 105 charged with negative
electricity is transferred along the hydrophilic lines 23 and 24,
the ring of the manipulation rod charged with negative electricity
is pulled down from above the droplet so as to make the droplet
placed inside the ring. As both of the droplet 105 and the ring of
manipulation rod 107' are charged with negative electricity, the
droplet keeps within around the center of the ring stably.
Therefore when the ring is transferred, the droplet is also
transferred, keeping within around the center thereof. With the
manipulation rod described in the FIG. 32, the droplet unavoidably
swings side to side during its transfer because the rod pushes the
droplet from the back thereof. As a result when the speed of
transfer is too high, the droplet to be transferred may deviate
from the hydrophilic line. Also, the droplet usually stops in a
stable position associating with the substrate, however, in a case
where the speed is too high, the droplet may not stop in the
position by inertial force. With the manipulation rod with a shape
of a ring, on the other hand, the droplet is transferred with
support from all horizontal directions, therefore the accidents
such as deviating from the hydrophilic line or passing over the
stop position due to the inertial force may decrease, which enables
more reliable droplet transfer.
[0383] In Example 1, to confirm the droplet position on the
substrate, the optical system is used for observing the substrate
with a configuration including the light source 66, the condenser
lens 67, the collimating lens 68, and the monitor 75, the latter
two placed at the bottom of the substrate 100 opposite to the
former two. Therefore the substrate 100 is required to be made of a
transparent material. A thin-layer silicon substrate is also
applicable, in this case the infrared rays, which can be absorbed
into water, are used for an observation so as to confirm the
droplet position easily. Of course, the optical system such as a
stereo microscope from the top surface of the substrate can also be
used, which allows less limited substrate compositions. The optical
system is used similarly in Examples 2 and 3 described below.
[0384] Various reactions can be generated by similarly transferring
and colliding another droplet to the droplet being stopped. Or
other usages are possible like preparing a cell store with droplets
each including a cell arranging in a shape of array and a droplet
array including various chemical materials to examine an effect of
a chemical material against a cell by transferring a cell and a
reaction liquid assorted from any of cells and droplets to a
reaction section.
Example 2
[0385] Another method of charging a droplet is described in Example
2. As in the method used in Example 2, a charged particle is
launched into a droplet, those equipments used in Example 1 for
charging are not required such as the electrode 100 and the related
equipments like the connecting line, the electrode, the switchboard
or the power supply.
[0386] FIG. 34 is a view showing a configuration of and
manipulating method for making a droplet formed similarly to the
method described in FIG. 31 in the droplet holding area on the
substrate 100 shown in FIG. 28 charged with electricity. In this
state, droplets 33.sub.1, 33.sub.2, . . . 33.sub.8 are still on a
hydrophilic droplet holding area 32 with no electricity. The
droplet 33.sub.4, which is selected arbitrary from the droplets, is
charged with electricity with a charged particle launching device
200. The charged particle launching device 200 includes a gas
compressor 40, a solution holding container 41, electrodes 42.sub.1
and 42.sub.2, power supply section 43, and a solenoid valve 44.
While the solution holding container with a conductive outlet 46 at
an edge thereof is connected with the power supply 43 by the
electrode 42.sub.1, the solution holding container and the entire
circuit keep an electrically floating state and are isolated from
grounding. Inside of the solution holding container 41 is partially
shown in the figure. The power supply includes a power supply
43.sub.1, a condenser 43.sub.2, a blockage section 43.sub.3, and
other circuits. As the charged particle launching device 200 is
provided on an upper stage of the droplet forming measure, the
configuration shown in FIG. 34 is realized after forming a droplet
and putting the droplet forming measure aside. Though only the
bottom parts below the substrate of the optical system in the
droplet forming measure is used in this example, when the upper
parts have a configuration which is not obstructive to the charged
particle launching device 200, the optical system can be used in
both.
[0387] The solenoid valve 44 and the blockage section 43.sub.3 are
synchronously carried out sequence operations by an instruction of
the personal computer 76 described in FIG. 31. At first, the
condenser 43.sub.2 is charged with static electricity from the
power supply 43.sub.1 by an instruction of the personal computer
76. Because the blockage section 43.sub.3 is open, an electric
field is not loaded on between the electrode 42.sub.1 and the
electrode 42.sub.2. Though the solution holding container 41 is
applied pressure at all times by the gas compressor 40, as the
outlet 46 is closed by the solenoid valve 44, a solution 48 does
not come out in this state. When the solenoid valve 44 is opened in
an instant by an instruction of the personal computer 76, the
solution comes out from the outlet 46 because the solution holding
container 41 is applied pressure. The blockage section 43.sub.3 is
closed by an instruction of the personal computer 76, just before
the droplet 45 leaves the outlet 46. Then the outlet 46 is charged
with negative electricity and the electrode 42.sub.2 is charged
with positive electricity. Therefore the droplet 48 leaving the
outlet 46 is charged with negative electricity. As the positive
electrode 42.sub.2 has a slit 47 opened thereto, the charged
droplet 48 gets together with the droplet 33.sub.4 on the substrate
100 passing through the slit 47. Therefore the droplet 33.sub.4 is
also charged with negative electricity. After the droplet is
charged, the stage moves while monitoring though the monitor 75 and
a next droplet to be charged is charged.
[0388] As the series of the droplets 33 is 0.1 to 1 .mu.l in
volume, the charged droplet 48 to be put in the droplet 33 should
be significantly smaller than the droplet 33. The conventional
technique can be used to form an extremely small droplet. The
method with the solenoid valve 44 can form a droplet in size of
nanoliter level, which has already been commercialized as a DNA
micro-array forming device. Such technique can be used directly. Or
another technique can also be used like a technique for forming a
droplet with an oscillator like piezo instead of a solenoid valve
used in an existing cell sorter.
Example 3
[0389] The charged droplet 48 is put in a droplet directly under
the charged particle launching device 200 in the example 2, so
that, the stage should shift (or the charged particle launching
device 200 should shift) to select the targeted droplet 33 to be
put in the charged particle. While in the example 3, using a fact
that the particle to be put in the droplet is charged, a method for
controlling flight of the charged droplet is described.
[0390] FIG. 35 is a view for illustrating configuration and a
manipulation method for controlling flight of a charged droplet 58
to give an electric charge to a droplet formed by a method similar
to that illustrated in FIG. 31, in a droplet holding area of the
substrate 100 shown in FIG. 28. The droplets 33.sub.1, 33.sub.2, .
. . , 33.sub.8 in which the charged droplet 58 is put are placed on
the hydrophilic droplet holding area 32 in a state of rest. Then
the charged droplet 58 is put out in a state where the electric
field is loaded on between the electrodes 42.sub.1 and 42.sub.2,
and the electric field is also loaded on a plate spanned between
biased electrodes 51.sub.1 and 51.sub.2. In a case, for instance,
where the droplet 58 is charged with negative electricity, the
electric field is loaded to make a state in which the bias
electrode 51.sub.1 become positive. By controlling the size of
electric field loaded on the plate between the biased electrodes
51.sub.1 and 51.sub.2 depending on the droplet position at which
the charged droplet is launched, a droplet to be launched into the
charged droplet 58 therein can be selected arbitrary. Another
method is allowed such as controlling an angle, for instance
changing the biased electrode 51.sub.1 to 51.sub.1' in a state
where the electric field is loaded keeping a voltage of 3000. In
this method, when the biased electrode 51.sub.1 is at 51.sub.1, the
charged droplet is applied the stronger electric field, so that the
droplet 58 is launched into the droplet 33.sub.1 placed at outside.
On the other hand when the biased electrode 51.sub.1 is at
51.sub.1', the charged droplet is applied the weaker electric
field, so that the droplet 58 is put in the droplet 33.sub.2.
Similarly, by changing the position of electrode 51.sub.2, it can
be controlled which droplets 33.sub.4 or 33.sub.5 the charged
droplet 58 should be put in. The user controls via the personal
computer 76 the voltage applied to the electrode 51, the angle of
the electrode 51, the timing of releasing the charged particle, or
the like. (D) The method for and device of culturing separated cell
one by one in a long time are described below.
[VII] Seventh Embodiment
[0391] A seventh embodiment of the present invention provides a
method of and a reliable system for conducting various reactions in
the droplet(s) placed on a substrate. This embodiment enables to
make a reaction more reproducible by keeping the volume or size of
a droplet at constant values on the substrate. Further in this
embodiment, a series of chemical reactions and cell culture can be
carried out without unnecessary delays by freely changing the size
of a droplet on a substrate in the substantially non-contact state
to control concentrations of a matrix or reaction products in the
droplet.
Example 1
[0392] Detailed descriptions are provided below for a method of
controlling the size of a droplet when an operation takes so long a
time that a droplet on a substrate may be affected by vaporization
thereof and some specific operations are required to prevent this
phenomenon.
[0393] The basic idea of the seventh embodiment is to realize a
balance between vaporization and agglutination by making use of the
that fluctuation in the size of a droplet occurs due to the
difference between a vaporization rate of the solvent from the
droplet in a small area on a phase boundary between the droplet and
a gas phase and an agglutination rage from the gas phase to the
droplet in the same area. Generally, a droplet grows when the vapor
pressure of water as a solvent increases, and the size of a droplet
becomes smaller when the vapor pressure thereof decreases. Because
of this, the size of a droplet can be controlled, for instance, by
increasing the humidity or controlling the temperature according to
the saturation vapor pressure curve of the solvent.
[0394] FIG. 36A is a plan view illustrating a cell culture chip 100
advantageously applicable to the embodiment 1, while FIG. 36B is a
cross-sectional view showing the cell culture chip shown in FIG.
36A taken at the line A-A and viewed in the direction indicated by
the arrow. The reference numeral 1 indicates a silicon substrate,
for instance, with the thickness of 1 mm and the size of 20
mm.times.20 mm. The region of the top surface of the silicon
substrate 1 is a hydrophobic region 3 with some hydrophilic regions
4 regularly provided at intervals therein. The size of the
hydrophilic region 4 may be approximately 400 .mu.m.times.400 .mu.m
depending on the size of cells or the number of the cells placed on
the region. The interval between the hydrophilic regions should be
wide enough so that droplets including cells are not contacted and
mixed with other cells on neighboring hydrophilic regions, and is
preferably approximately 2000 .mu.m when convenience in operations
dealing with the droplet(s) is taken into consideration. When the
diameter of the droplet is less than 100 .mu.m, the interval
between two hydrophilic regions 4 may be approximately 500 .mu.m.
In general, the size of a droplet, the size of the hydrophilic
region, and an interval between two hydrophilic regions should be
determined in accordance with the intended use thereof. FIG. 36
shows an example where hydrophilic regions are provided at a
regular interval. But, in some cases when, for instance, a number
of droplets are need to be mixed and reacted on a substrate as
described below, it may be more effective to provide hydrophilic
regions with various intervals therebetween. Basically, positions
of the hydrophilic regions on a surface of the substrate should be
decided assuming the case where the interval between the droplets
is narrowest and also by providing the interval which is two times
or larger than the size of a droplet. The reference numeral 5
denotes an alignment marker, and the markers 5 are formed on the
entire surface of the silicon substrate 1.
[0395] For preparing hydrophilic regions and hydrophobic regions,
for instance, the top surface of the hydrophilic silicon substrate
1 is oxidized to cover the surface with a hydrophilic SiO.sub.2
film. Then portions of the SiO.sub.2 film to be changed to
hydrophobic regions are melted and removed by using hydrofluoric
Acid. Alternatively, in a case where the SiO.sub.2 film is
previously formed to provide a hydrophilic surface on the surface
of the material of the substrate 1, hydrophobic regions can be
formed by placing hydrophobic material like fluorocarbon resin or
silicon resin thereon. In this case, the height of the hydrophilic
region placed on the hydrophobic region is higher than that of the
hydrophobic region by the thickness of the hydrophobic
material.
[0396] Another method of forming hydrophilic regions on a surface
of the substrate 1 is to make a fractal structure on the surface of
the substrate 1 by mixing powders of fluorinated carbon having
super water-shedding property (fluoride pitch) during metal plating
to form various Figures of fluoride pitch on the surface to make
super-hydrophobic surface having 145-170 degrees of contact angle.
In this case, it is also possible by treating only necessary
portions on hydrophilic surface so that it will have the
water-repelling property. Also the other technique generally called
the super-hydrophilic treatment may be used for portions on which
water drops are to be formed. The super-hydrophilic treatment is
performed by forming a thin (10-20 nm) coating film with SiO.sub.2
component on the surface of TiO.sub.2 multilayered film. For using
the film of titanium oxide (TiO.sub.2), it is necessary to
irradiate the substrate 1 with ultraviolet rays in advance and to
introduce a hydroxyl group into the surface of the TiO.sub.2. By
this previous treatment, TiO.sub.2 on the surface is converted to
TiOH with the super-hydrophilic property. With this method, a
super-hydrophilic region with less than 10 degrees of contact angle
can be retained for several weeks.
[0397] FIG. 37 is a schematic diagram view illustrating the outline
of a device capable of controlling the size of droplet in Example 1
of the seventh embodiment. The substrate 1 in FIG. 37 is prepared
by oxidizing the upper surface of the silicon substrate 1 with the
above-mentioned hydrophilic property to form a hydrophilic
SiO.sub.2 thin film over the whole surface, and then by melting and
removing the SiO.sub.2 thin film from the portions, where
hydrophobic regions are to be formed, with a fluorinated acid. The
hydrophilic region 4 on the substrate 1 is higher than the surface
of the substrate 1. The peripheral area around the hydrophilic
region 4 is the hydrophobic region 3. A droplet 14 is placed on the
hydrophilic region 4. The reference numeral 15 denotes a
temperature regulator provided on the bottom surface of the
substrate 1 to control the temperature of the substrate 1. The
reference numeral 18 denotes a temperature sensor installed on the
contact surface between the substrate 1 and the temperature
regulator 15. The reference numerals 19 and 20 denote water tanks
for hydration, which are provided on both sides of the substrate 1.
The reference numeral 21 denotes a stage on which the temperature
regulator 15 and water tanks 19 and 20 are placed. On the stage 21,
there is an upper cover 22 in the shape of a reversed transparent
vessel. The temperature regulator 15, substrate 1, water tanks 19,
and droplet 14 on the substrate 1 are all covered with this upper
cover 22. The space defined by the upper cover 22 and the stage 21
is not sealed off, but is closed. Because of this feature, the
inside is filled with saturated steam. The reference numeral 23
denotes a drive unit capable of receiving a signal from a personal
computer 41 and moving the stage 21 in both X and Y directions.
[0398] As the above temperature regulator 15, for instance, a
Peltier device may be used. With the Peltier device, it is possible
to control either heating or cooling according to the direction of
a current flowing through the device, and, in addition, the heating
or cooling rate can be controlled by amplitude of the current
flowing through the device.
[0399] The reference numeral 31 denotes a camera, for instance, a
CCD camera, for picking images of the droplet 14 via lenses 32, 33.
In addition, a light source 34 is used to illuminate in the
direction indicated by the arrow 36 via a half mirror 35 placed
between the lenses 32 and 33. It is also allowable to illuminate
the droplet 14 directly from above the upper cover 22 without using
the half mirror 35.
[0400] The reference numeral 41 denotes the so-called personal
computer capable of storing therein a necessary program and also
receiving a temperature signal from the temperature sensor 18 on
the substrate 1 and information concerning the size of the droplet
14 from the camera 31. In addition, the personal computer receives
input operation-related signal inputted by a user. When the
personal computer 41 recognizes based on the information described
above that the size of the droplet 14 is not appropriate, or when
the user monitors the display device (not shown) and then sends the
operation signal 42 to adjust the size of the droplet 14, the
personal computer provides controls so that an appropriate current
will flow through the Peltier device constituting the temperature
regulator 15. When the user changes the droplet 14 to be monitored
by the camera 31 to the other droplet, the user can send the
operation-related signal 42 to the personal computer 41, and then
the personal computer 41 sends a drive signal to the drive unit 23
to move the stage 21.
[0401] Descriptions are provide below for outline of the operations
of the control device for controlling the droplet size according to
the example 1 in FIG. 37. The personal computer 41 analyzes the
image data sent from the camera 31, and then calculates
successively the size of droplet 4 on the substrate 1. When it is
observed that the droplet is growing, the personal computer 41
gives an instruction so that the temperature in the temperature
regulator 15 will rise, and when it is observed that the droplet is
shrinking, the personal computer gives an instruction so that the
temperature in the temperature regulator 41 will decline.
[0402] Temperature of the substrate 1 can be monitored with a
temperature sensor 18, and the temperature data is sent to the
personal computer 41 together the size data for the droplet 14 from
the camera 31 to be used for the temperature control. In a case
where there are provided a plurality of hydrophilic regions 4 and
also there are a plurality of droplets 14, sometimes the camera 31
may not be capable to simultaneously monitor all of the droplets
with a scope thereof. In this case, only the representative
droplets 4 should be monitored. If a more accurate result is
necessary, the stage 21 on which the substrate 1 is placed may be
moved with the drive unit 23 to measure the sizes of all the
droplets to obtain the average, minimum, and maximum diameters of
the droplets for controlling the temperature. In this step, if it
is expected that droplets having the maximum or minimum diameters
are not covered within the control range, the temperature may be
controlled so that the droplets having the maximum or minimum
diameter are included within the control range even if the droplets
having the other diameter go out of the control range.
[0403] Since fluctuation in the temperature of a droplet may affect
the chemical reaction rate on the droplet, it is preferable that
the temperature fluctuation in the droplets should be controlled
within about .+-.3.degree. C. at the maximum. Even when the
temperature fluctuation is controlled within this range, the
chemical reaction rate may fluctuate by tens percent, but even in
this case, a better result can be obtained as compared to a case
where a diameter of a droplet changes while cell culture is
performed in the droplet and a concentration of salt changes by
tens percent. A temperature change rate can easily and freely be
controlled in either heating or cooling by using the Peltier device
as the temperature regulator 15. But since the Peltier device is
not transparent, it is impossible to build up an optical system
allowing for transmission of light.
[0404] An example of the practical data is described below. For
instance, the space enclosed by the vessel 22 is filled with steam
and the temperature is kept at 25.degree. C. A sufficient quantity
of water is stored in the water tanks 19,20 for hydration. Assuming
that the capacity enclosed with the vessel 22 is 100 mm.times.100
mm.times.50 mm (height), the volume is 5.times.10.sup.-4 m.sup.3.
Therefore, the saturated steam pressure and the volume of saturated
steam are 31.7 hPa and 23.1 g/m.sup.3 respectively. Therefore, 11.6
mg of water exists as the steam in the space enclosed by the vessel
22. When the temperature of the space enclosed by the vessel 22 is
23.degree. C., the values of saturated steam pressure and the
volume of saturated steam are 28.1 hPa and 20.6 g/m.sup.3
respectively. Therefore, When the temperature in the space enclosed
by the vessel lowers from 25.degree. C. to 23.degree. C. within a
short period of time, 1.25 mg of water is vaporized due to the
difference in the saturated steam pressure between 25.degree. C.
and 23.degree. C. (because (23.1-20.6)
g/m.sup.3.times.5.times.10.sup.-4 m=1.25 mg). As a result, the size
of the droplets will shrink.
[0405] As an example, the temperature of the substrate 1 is set to
25.degree. C., and four pieces of 1 .mu.l droplets 14 are placed on
the substrate. In this situation, it is assumed that also the
temperature of the space enclosed by the vessel 22 is at 25.degree.
C. Also it is assumed that the droplet is in the stable condition
under the saturated steam pressure at 25 degrees Celsius and also
the size of the droplet 14 is stable. Next the temperature of the
substrate 1 is changed to 23.degree. C. The temperature of the
droplet 14 changes rapidly because the droplet 14 contacts the
substrate 1, but there is no substantial change in the temperature
of the space enclosed by the vessel 22 because the thermal
conductivity of the air is substantially low. As the result,
because of the temperature change of the droplet 14 due to the
temperature change of the substrate 1, the diameter of the droplet
14 changes from 1.24 mm to 1.31 mm within a few minutes (it becomes
larger because the surrounding water is agglutinated into the
droplet 14 as the temperature declines) and then the equilibrium is
achieved.
[0406] In other words, when the temperature of the substrate 1 is
controlled, the temperatures of the droplet 14 contacting thereto
can also be changed within a short period of time, and therefore,
also the size of the droplet 14 can be changed flexibly. On the
other hand, as described above, if the temperatures in the space
enclosed by the vessel 22 is changed rapidly, the size of the
droplet 14 will also be changed due to the subsequent change of the
saturated steam pressure. But the temperature of the space enclosed
by the vessel 22 is not changed rapidly unless an external large
influence is loaded to the space. On the contrary, when the
temperature in the space enclosed by the vessel 22 gradually
changes according to changes in the external conditions and any
change in the size of the droplet 14 is observed, it is possible to
suppress the changing rate of the size of the droplet 14 by
controlling the temperature of the substrate 1 so that the
temperature of the droplet 14 changes in the direction reverse to
the direction of size change of the droplet 14.
[0407] Therefore, to keep the size of a droplet constant, when the
growing trend of the droplet 14 in the size is detected with a
camera 31 by monitoring the diameter of the droplet 14, the
temperature of the board is raised by 1 or 2.degree. C. so as to
vaporize the water so that the droplet 14 will shrink. This means
that, by raising the temperature of the space enclosed by the
vessel 22, it is possible to cancel the growing trend of the
droplet in the size so that the size of the droplet should not
exceed the predetermined size. On the contrary, if the shrinking
trend of the droplet in the size is observed, the temperature of
the substrate is lowered so as to help the growth of the droplet.
That is to say, the data relevant to the droplet size can be used
as the feedback data to control the temperature of the substrate 1
so as to keep the diameter of the droplet 14 substantially
constant.
[0408] In a humidity control device for a microscope, generally
temperature of the atmosphere in which the test sample is placed is
controlled. But in this case, the response of the response to
control of the atmospheric temperature is rather low. On the
contrary, in the system in which an extremely small quantity of
droplets is used and temperature of the droplets is directly
controlled as described above, real time control of the droplet
size is possible.
Example 2
[0409] FIG. 38 is a schematic diagram illustrating Example 2 in
which the size of one droplet among a plurality of droplets on the
substrate 1 is controlled discretely. The configuration employed in
Example 2 is the same as that employed in Example 1 described above
excluding the points that independent temperature regulators 15 are
placed on each hydrophilic regions on the substrate 1 respectively
and also independent temperature sensors 18 are placed at the
positions where droplets 14 are placed, and that temperature
control signals are sent from the personal computer 41 to each
temperature regulator respectively. In FIG. 38, however, the
surface of the hydrophilic regions 4 is lower than the surface of
the substrate 1. All the surrounding are of the hydrophilic region
4 are the hydrophobic region 3. An appropriate spacer having a low
thermal conductance is provided between adjoining temperature
regulators 15.
[0410] In Example 2, the size of each droplet is always monitored
concurrently by a camera 7. The personal computer 41 then
calculates the diameter of each droplet from the images sent from
the camera 7, and the data is used to give feedback data to control
each temperature regulator 15 for the relevant droplet
respectively. With this method, it is possible to limit a
fluctuation range of the diameter of each droplet within 10
percents.
Example 3
[0411] FIG. 39 is a schematic diagram illustrating Example 3 in
which such operations as, for instance, forming two types of
droplets, mixing them, and then transporting the mixture droplet to
a predefined position can easily be performed.
[0412] In FIG. 39, the entire surface of a substrate 50 has the
hydrophobic property. On this surface, two hydrophilic regions
51,52 for forming two types of droplets, one hydrophilic region 55
for mixing the two types of droplets, one hydrophilic region 57 for
holding the mixture droplet in a position after the droplet is
moved are provided, and further the hydrophilic lines 53, 54, 56
connecting those hydrophilic regions to each other are provided.
The substrate 50 has a super water-shedding property with the size
of 20 mm.times.20 mm. The sizes of the hydrophilic regions
51,52,55,57 are decided according to the size of a droplet formed
in each of the regions and are about 200 .mu.m.times.200 .mu.m
square. The width of the hydrophilic lines 53,54, 56 is 2 .mu.m.
The substrate 50 is provided on the temperature regulator 15 placed
on the stage 59. The stage 59 is driven in both X-axial and Y-axial
directions with a drive unit 23 operating according to a drive
signal from a personal computer 41. The temperature regulator 15 is
provided to control the temperature of the substrate 50 like in
example 1 and 2. In this example as well, the temperature sensor is
necessary to monitor the temperature of the substrate 50, and the
sensor is placed on the contact surface between the substrate 50
and the temperature regulator 15, but is not shown in the figure
for simplification. Also the signal transactions with personal
computer 41 are not shown.
[0413] The reference numeral 31 denotes a camera such as, for
instance, a CCD camera, for taking pictures of the droplet 14
formed on the hydrophilic regions 51, 52 via lenses 32, 33. In this
case, a light source 34 is used to illuminate in the direction
indicated by the arrow 36 through a half mirror 35 placed between
the lenses 32 and 33. The light may directly be illuminated from
above the substrate 50 without using the half mirror 35. The
reference numeral 41 denotes the so-called personal computer with
necessary software stored therein and capable of receiving the size
information relevant to the droplet 14' from the camera 31 and
operation-related signals from a user. The personal computer 41 has
a display device (not shown in the figure), and an image of the
droplet 14' inputted from the camera 31 is displayed thereon.
[0414] The reference numeral 46 denotes a pipet for forming a
droplet 14'. The pipet 46 contains therein the solution used for
forming as the droplet sucked therein in advance. At the root
section of the pipet 46, a syringe pump 44 is provided via a tube
45, and a drive unit 43 is attached to the syringe pump 44. When a
user gives an instruction to prepare a droplet to the personal
computer 41, the drive 43 unit starts operating, the syringe pump
44 is driven by the drive unit 43, and then the solution inside the
pipet 46 is pushed out to form a droplet at the tip of the pipet
46. While optically monitoring the droplet at the tip of the pipet
46, the user stops forming the droplet when the droplet is grown to
a prespecified size.
[0415] When the droplet 14' is formed in the state where the pipet
46 is contacted to the substrate 50, if a user gives an instruction
to the personal computer 41 to lift the pipet 46, the instruction
to lift the pipet 46 is given to a lift up/down drive unit 47, and
then the pipet 46 goes up and separates from the droplet. A dashed
line 48 shows coordination between the lift up/down drive unit 47
and the pipet 46. When the droplet 14' is formed with the pipet 46,
a user lowers the pipet 46 once and moves the droplet to a
hydrophilic region on the substrate 50, and raises the pipet 46 to
separate the pipet form the droplet.
[0416] Next, to form a new droplet, the user gives an instruction
to the personal computer 41 to move the stage. In response to this
instruction, the personal computer 41 gives a drive signal to the
drive unit 23 to move the stage 59. While monitoring the header
portion of the pipet 46, the user stops movement of the stage when
the header of the pipet 46 reaches the hydrophilic region where the
droplet is formed. At the new position, as described above, a
droplet is formed at the tip of the pipet and then on a hydrophilic
region on the substrate 50. It is needless to say that, in this
step, the pipet 46 has been already replaced by a new pipet
containing a new solution for forming a new droplet.
[0417] Next, the user moves the droplets on the hydrophilic regions
51, 52 to the hydrophilic region 55 to mix them up. In this step,
each droplet is moved on the hydrophilic line 53 or 54 which
connects the hydrophilic regions 51 and 55 and hydrophilic region
52 and 55 to each other. In other words, the droplet is moved in a
manner that they are dragged on the hydrophilic line with the tip
of the pipet 46 contacting the droplet 14. As a result, the droplet
can be moved smoothly on the hydrophilic line to a new hydrophilic
region.
[0418] After each droplet formed on the hydrophilic regions 51, 52
is moved to the hydrophilic region 55, a specific chemical reaction
occurs. In some cases, the chemical reaction may take a longer
period of time as compared the time required forming or moving the
droplets. Therefore the moisture content of the droplet may
vaporize because of the circumstances as described above. So, like
in Examples 1 and 2 described above, while the size of a droplet is
monitored, the temperature of the substrate 50 is controlled so
that the diameter of the droplet is kept at the substantially
constant level by controlling the temperature regulator 15. This
control is also applicable when a droplet is formed. In addition,
although not shown, like in Examples 1 and 2 described above, it is
preferable to install water tanks 19,20 for hydration and an upper
cover 22 having a shape like a reversed transparent vessel to
prevent the change in environments for the droplet during the
chemical reactions.
[0419] When the two droplets are DNA and fluorochrome SYBR Green I
for intercalating to the DNA, for instance, the droplets are moved
to the hydrophilic region 55 and merged with each other and left at
the position for two minutes. During this process, the diameter is
monitored for controlling the temperature of substrate 50 so that
the diameter of the droplet is kept substantially constant. Then
the droplet is moved from the hydrophilic region 55 to the
hydrophilic region 57 on the hydrophilic line 56. Light is
illuminated from the laser source 61 through the half mirror 62 to
the droplets which has been merged and finished the chemical
reaction on the hydrophilic line 56 or on the hydrophilic region
57. The fluorescence from the reactants in the droplet can be
measured by detecting the fluorescence emitted from the droplet
with a detector unit 66. The reference numerals 63, 64 denote
lenses constituting the optical system. Also in this case, it is
preferable to move and slide a droplet on the hydrophilic line with
the tip of the pipet 46 contacting the droplet with the chemical
reactions already finished therein. However, since it is not
possible to provide both the optical system for monitoring the
diameter of the droplet and the other optical system for measuring
the fluorescence volume from reactants in the droplet at the same
place, and therefore it is preferable to use the lift up/down drive
unit 47 capable of moving the pipet 46 also in the X-axial and
Y-axial directions.
[0420] In FIG. 39, there are two hydrophilic regions 51, 52 to form
two types of droplets. But a single hydrophilic may be enough when
the following procedure is employed. In this case, a first droplet
formed on a hydrophilic region is moved to the hydrophilic region
55 for merging the two types of droplet later, and then another
droplet is formed on the same hydrophilic region and, in the same
manner, moved to the hydrophilic region 55 to be merged with the
first droplet there.
[0421] If three types of droplets needs to be merged with each
other, it is allowable to prepare three hydrophilic regions instead
of two hydrophilic regions 51,52, or to form droplet one by one on
a single hydrophilic region and to move the droplets to the next
hydrophilic region one by one to merge the droplets each other
there.
[VIII] Eighth Embodiment
[0422] In an eighth embodiment of the present invention,
descriptions are provided below for a structure allowing for long
term electric measurement of changes in responses of a cell network
to stimulus while completely controlling a shape of the
intercellular network shape to clarify functions of the cells. This
structure has a plurality of cell culture zones each to confine the
cell in the specific space arrangement and each zone is
interconnected with a groove that the cell may not pass through
reciprocally, and a plurality of electrode patterns to measure the
change in the electric potential of the cell are provided in the
groove. The electrode pattern is provided in the groove between
adjoining cell culture zones, and has a structure suited for
measurement of the difference of intercellular potential. When the
measured cell is a neurocyte, the cell extends the axon. Therefore
the change in the electric potential of an intercellular axon
itself which is coupled with adjoining cell at synapse is
measured.
Example 1
[0423] FIG. 40 is a plan view schematically illustrating an example
of a structure of cell culture micro-array with electrode in
Example 1 of the eighth embodiment of the present invention, and
FIG. 41 is a cross-sectional view showing the cell culture
micro-array shown in FIG. 40 taken along the line A-A and viewed in
the direction of indicated by the arrow. The reference numeral 1
indicates a substrate, and all the structures are constructed on
substrate 1. The reference numeral 2 indicates a cell culture zone,
and a plurality of cell culture zones 2 are regularly constructed
with a prespecified interval. The reference numeral 3 indicates a
groove which interconnects the adjoining cell culture zones. The
reference numeral 10 indicates a resin layer formed on substrate 1,
and the cell culture zones 2 and the groove 3 interconnecting the
cell culture zones 2 are formed by removing the resin layer 10. The
reference numeral 4 indicates an electrode for measuring the
electric potential, and is installed in each of the grooves 3.
Electrode 4 is gold deposited with the thickness of 100 nm onto the
surface of substrate 1. The reference numeral 5 indicates an
external terminal, and is installed near substrate 1 at a position
corresponding to the electrode 4. The reference numeral 6 indicates
wiring and the wiring connects the electrode 4 to the external
terminal 5.
[0424] The reference numeral 9 indicates a semipermeable membrane,
and is formed tightly on the upper surface of the resin layer 10
with the grooves 3 each interconnecting the adjoining cell culture
zones 2 formed thereon. The reference numeral 22 indicates an upper
housing which covers the entire area of the resin layer 10 with an
appropriate space on the semipermeable membrane 9. The reference
numeral 22-1 indicates a falling section of the upper housing 22.
The reference numeral 21 indicates a culture fluid bath formed
between the semipermeable membrane 9 and the upper housing 22. The
reference numeral 23 indicates an opening 23 provided on the upper
housing 22, and the culture fluid is provided to the bath 21
therethrough. The reference numeral 14 indicates a common
electrode, which is provided in the culture fluid bath 21.
[0425] In Example 1, each cell culture zone 2 has an edge of 30
.mu.m and depth of 25 .mu.m for the purpose of measuring a human
cell while culturing the cell. The groove 3 has the width of 5
.mu.m and depth of 25 .mu.m. The distance between each cell zone is
in the range from 30 to 200 .mu.m.
[0426] Descriptions are provided below for a method of preparing
the substrate 1. The substrate 1 is made of non-luminescent glass
with the thickness of 0.18 mm, which enables the observation with
an object lens having the resolution of 100 times, and at first,
layers for the electrode 4, wiring 6 and terminal 5 are formed by
deposition. Secondly the areas of the electrode 4 and terminal 5
are masked, and the insulating layer is formed to cover the areas.
Then, the surface of electrode 4, insulating layer, and terminal 5
is covered with photo-curing resin SU-8 (an epoxy type photoresist
material, produced by Micro Chem. Inc., U.S. Pat. No. 4,882,245)
having the degree of viscosity adjusted so that the thickness of
the layer may become 25 .mu.m and resin layer 10 is formed. Then
portions of the resin layer 10 corresponding to cell culture zones
2 and grooves 3 are locally eliminated. As a result, the cell
culture zone 2 and grooves 3 are formed. The electrode 4 is
provided in the groove 3 in the exposed state, but the wiring 6
crossing the groove 3 is isolated with the insulating layer. Also
the terminal 5 is exposed.
[0427] A cytophilic substance such as laminin and collagen is
applied on the surfaces of the cell culture zone 2 and groove 3,
and further the cell culture zone 2 and groove 3 are filled with a
buffer fluid buffer, and then a cell is put into the cell culture
zone 2. After that, a lid made of semipermeable membrane 9 is
placed on the upper surface of the area for the cell culture zone 2
and groove 3 in order to confine the cell within the cell culture
zone 2. Then, the upper housing 22 is set to completely cover the
lid made of semipermeable membrane 9 (the entire area of resin
layer 10). In this step, the upper housing 22 has a suitable
falling section 22-1, and covers the semipermeable membrane 9 with
an appropriate space to form the culture liquid bath 21. The common
electrode 14 is formed with a light-transmissible electrode such as
ITO on an inner wall of upper housing 22 of culture fluid bath 21.
The reference numeral 23 indicates an opening of the culture fluid
bath, and a fresh culture fluid is constantly supplied to the
culture liquid bath 21 through this opening 23, and also the used
culture fluid is exhausted therethrough.
[0428] For the aforementioned semipermeable membrane 9, a
transparent cellulose film is used so as not to interrupt optical
observations. Cellulose with the molecular weight cut off of 30,000
Daltons is used in this example. The upper housing 22 is also made
of a transparent material, such as plastics to avoid interruption
of the optical observation by the upper housing 22.
[0429] The cell culture micro-array accommodating a plurality of
cells discretely is prepared as described above. A number of
methods are conceivable for putting a cell in each cell culture
zone 2. For instance, there is a method in which a micro capillary
is inserted into the liquid solution including the cells, a cell is
captured with the distal end thereof and put into the cell culture
zone 2. Alternatively, when the size of the cell culture zone 2 is
substantially the same as that of a cell, the cell can be set in
the cell culture zone 2 by dripping a droplet including the cell
onto a top surface of the area with the cell culture zone 2 and
groove 3 formed thereon and sliding the micro-capillary along the
surface of the area to push out the surplus liquid.
[0430] The independent bonding formation based the biotin-avidin
reaction is used to stabilize the cell in the cell culture zone 2.
Since the photo-curing resin SU-8 possesses a reactive epoxy group,
the photo-curing resin SU-8 is subjected to pre-baking before
irradiation of light thereto to form the base SU-8 layer, and then
immediately a solution containing biotin hydrazide is applied to
the layer to react the epoxy group to the hydrazide group for
fixing biotin. By exposing to light to solidify the resin and
forming a structural body, the SU-8 pattern with biotin introduced
on the surface thereof is obtained.
[0431] Extension of axon in the groove 3 can be detected by
measuring an impedance between terminal 5 connected to electrode 4
and provided in the groove 3 and the common electrode 14, or by
measuring an electromotive force by the cell itself detected in the
terminal 5 that is connected to electrode 4 by referring to an
electric potential in the common electrode 14 as a reference
value.
[0432] All of the operations described above can be performed
observing the cell with a microscope. Further, in the cell culture
micro-array with electrodes according to the eighth embodiment, it
is possible to provide the stimulus to the specific cells with the
same electrode or to measure a response of the cell to the stimulus
by selecting a desired electrode among the plurality of electrodes
provided therein.
[0433] For instance, as a result of incubation of a rat cerebellar
granule cell in the cell culturing micro-array with the electrode
according to the eighth embodiment, the cell confined in the cell
culture zone 2 was observed to form a network without cutting
itself free from the cell culture zone 2. It is also confirmed that
the electromotive force is generated, before and after the axon
extends and cells are contacted to each other, in the electrode 4
provided in the groove 3 between the cell culture zones 2 where the
axon extends and the cells are connected to each other, and also in
the electrode 4 provided in the groove 3 that the axon in the
opposite side of the cell does not extend. It is understood based
on a result of these observations that the structure of the cell
culturing micro-array with an electrode according to the eighth
embodiment has the expected performance.
[0434] Furthermore, it is possible to measure responses of the
cells by checking a change in electrical potential by adding a
biological material, such as peptide or amino acid, and a chemical
substance having suspected endocrine disrupting or toxic
property.
Example 2
[0435] Example 2 are described below with reference to a case where
the cell culture zone 2 or groove 3 is formed by using agarose gel
100 in place of the photo-curing resin SU-8.
[0436] FIG. 42 is a plan view showing Example 2 of the eighth
embodiment, and FIG. 43 is a cross-sectional view illustrating the
cell culture micro-array shown in FIG. 42 taken along the line B-B
position and viewed in the direction indicated by the arrow. As
clearly understood from comparison of FIG. 40 and FIG. 41 to FIG.
42 and FIG. 43, the structure in Example 2 is the same as that in
Example 1 excluding the points that that the groove 3
interconnecting the cell culture zones 2 is changed to a tunnel 3,
that a plurality of electrodes 4 are provided in the tunnel 3, and
that the tunnel 3 is provided only on the bottom surface of agarose
gel 100. The reference numeral 1-1 indicates a wall provided on the
substrate 1, and an area surrounding agarose gel 100 is formed with
and sustained by this wall.
[0437] In Example 2, the electrode 4, wiring 6, and terminal 5 are
formed on the substrate like in Example 1, and then the wall 1-1 is
adhered to the upper face of the substrate 1 and agarose gel 100 is
put inside the wall 1-1. The 2% agarose gel (with the melting
temperature of 65.degree. C.) is heated with a microwave oven and
melted therein. The melted agarose solution is added to inside the
external wall of the lower part of the substrate 1 heated to
65.degree. C., and immediately spread homogeneously with a spin
coater. An amount of added agarose gel and a rotational speed of
the spin coater are adjusted so that the agarose gel membrane will
have the thickness of 1 mm. The thickness differs according to
devices used and lots of agarose gel, but a good result has been
obtained with the rotational speed of 50 rpm for 15 seconds, and
followed by 200 rpm for 10 seconds. The agarose gel membrane 100 is
formed with leaving the melted agarose solution in the moistening
box for one hour at 25.degree. C. At this point, the agarose gel
membrane is formed on the inner side of the external wall of the
substrate 1. Next, after the agarose gel 100 is formed, a portion
corresponding to the cell culture zone 2 is removed to form the
cell culture zone 2 with agarose gel 100.
[0438] FIG. 43 is a cross-sectional view illustrating an agarose
made cell culturing micro-array with electrodes when the cell
culture zone 2 prepared thereon and an optical system and a control
system using for preparing the tunnel 3 in the agarose gel 100. A
cellulose membrane is adhered to the upper surface of agarose gel
like in Example 1. For instance, the heated and melted agarose is
applied on the cellulose membrane with a spin coater to prepare a
cellulose membrane with the agarose membrane formed on one surface
thereof. Then the cellulose membrane is placed, after a cell is put
in the zone 2, on the agarose gel 100 so that the agarose-applied
surface thereof contacts the agarose gel 100. Alternatively, while
the agarose gel 100 is formed, a small amount of
streptoavidin-conjugated agarose may be added and solidified. The
streptoavidin is exposed on the surface of this agarose gel
derivative. Separately, in the same way like in Example 1, the
cellulose membrane with an aldehyde group introduced by oxidization
with periodic acid is reacted with biotin hydrazide, and the
biotin-modified cellulose membrane obtained from reducing by the
hydroboration reaction is prepared. By using the biotin-avidin
reaction to fix the agarose gel derivatives and biotin-modified
cellulose membrane, a structural body with a cell confined therein
can be formed.
[0439] A laser 141 is used to irradiate a beam with the wavelength
of 1480 nm which is absorbed by water. A laser beam 142 passes
through an expander 143, and also passes through a filter 144
reflecting rays with the wavelength of 740 nm or more but allowing
transmission of light with the wavelength of 1480 (.+-.20 nm), and
further passes through a deposition filter 145 that transmits the
light with the wavelength of 700 nm or more, and is focused by a
condenser 146 onto the surface of substrate 1. The converging light
with the wavelength of 1480 nm is absorbed by water contained in
the agarose layer, and the temperature in the neighboring area
rises to a level close to the boiling point. When the laser power
is at 20 mW, agarose is melted with approx 20 .mu.m of the line
width in the neighboring area where the convergent light is
irradiated and removed by thermal convection. The problem is that
the amplitude of the convergent light absorbed by agarose changes
depending upon the presence of an electrode on the substrate 1. To
solve this problem, there has been introduced in the present
invention a contrivance enabling constant temperature control with
irradiation of converging light by estimating a temperature of the
agarose gel and feeding back the expected temperature value. The
converging light having reached the agarose portion is converted to
heat and simultaneously irradiates infrared rays. The infrared rays
pass through the filter 145 is reflected by the filter 144, and
reaches the infrared ray camera 160-1. The image data picked by the
infrared ray camera 160-1 is fetched into a computing device 161
with a video recorder, the temperature is estimated from the
detected amplitude, and power of the laser 141 is adjusted. In the
case when it is difficult to control temperature only by adjusting
the laser power, the moving speed of stage 164 is controlled
according to an output from computing device, so that the agarose
temperature in the portion exposed to the converging light is
constantly maintained at the same level. More specifically,
rotation of stepping motor 162 is controlled by the computing
device 161, and rotation of the stepping motor is delivered by
power transmission device 163 to move the state 164.
[0440] The substrate 1 is set on the stage 164, and the tunnel 3
can freely be formed in the agarose gel. An ITO transparent
electrode is previously formed in the tunnel 3. Moreover, also the
optical system for detecting the transmitted light from the light
source 170 is incorporated to monitor the progress of the cell
observation as well as of agarose processing. Light from the light
source 170 transmits the transparent upper housing 22, transmits
the objective lens 146 scattering in the agarose section, and is
fetched as an image with the CCD camera 160-2 through the
deposition filter (mirror) reflecting visible light. The image data
is sent to the computing device 161, overlapped with images taken
the infrared ray camera 160-1, and used, for instance, for
confirmation of the portions heated by laser beam irradiation and
the structure pattern.
[0441] On the upper surface of the agarose gel, the culturing
solution that is supplied and discharged through the opening 23 is
constantly circulating. Alternatively, stimulating substances to
the cell or various chemicals including endocrine disrupting
chemicals and the like are added through the opening 23, and the
state of the cell can be monitored by the electrodes by observation
with a microscope.
[0442] In Example 2, two electrodes are provided in one tunnel 3,
so that it is easy to capture fluctuation in impedance or
inductance in the tunnel 3. Each electrode is connected to the
terminal 5 respectively with the wiring 6, and therefore it is
possible to measure a single electrode or a pair of electrodes. For
instance, when an axon of the neurocyte extends and the cell
couples with the neighboring cell, an electrical potential of
electrode 5 can be measured by referring to that in another
electrode as a reference potential.
[0443] Moreover, in Example 2, since it is possible to additionally
engrave the tunnel 3, activities of a cell can be assessed by
monitoring the current situation and changing the tunnel
configuration.
Example 3
[0444] FIG. 44 is a plan view illustrating Example 3 in which a
plurality of cell culture zones 2, which is most important in
practical use, are connected each other for form a one-dimensional
array. As it is clearly understood from comparison of FIG. 44 to
FIG. 42, configuration in Example 3 is the same as that in Example
2 excluding the point that the cell culture zones 2 formed with the
agarose gel 100 and the tunnel 3 interconnecting the cell culture
zones 2 are formed in the lateral direction. Also in Example 3, the
tunnel 3 interconnecting the cell culture zones 2 is not always
required to be formed previously, and may be opened, for instance,
only in the direction in which the axon of the neurocyte is
required to extend at a point of time when the axon is formed. All
electrodes 4 should be made in the tunnels or at positions where
tunnels are to be formed when practically used.
[0445] The cross-section of the device in Example 3 is the same as
that in Example 2, and descriptions thereof are omitted
herefrom.
(Others)
[0446] The aforementioned examples are all described as completed
cell culturing micro-array. However, a researcher as a user of the
cell culture micro-array is required to put in a cell or the like
in the cell culture zone 2. Accordingly, it is practical to
provides the substrate 1 with the electrode 4, external terminal 5,
wiring 6, cell culture zone 2 and groove 3 formed thereon,
semipermeable membrane 9, and upper housing 22 as a cell culturing
micro-array kit. In this case the researcher having purchased the
kit prepares a culture fluid, puts a cell or the like in the cell
culture zone 2, sets the semipermeable membrane 9 and upper housing
thereon to complete the kit. Also in Examples 2 and 3, it is
practical to use the cell culturing micro-array kit depending on
the purposes of researches. The kit includes, as in Example 1, the
substrate 1 on which the agarose gel is placed and such as
electrode, the cell culture zone 2 and a necessary tunnel are
formed on the agarose gel, the semipermeable membrane 9, and the
upper housing 22.
[IX] Ninth Embodiment
[0447] A ninth embodiment of the present invention discloses a
structure for configuring a network consisting of the minimum
number of cells in which a plurality of heterogeneous cells are
interacted, on a chip, for measuring a change in responses to
stimulus in the cell network, by controlling a few heterogeneous
intercellular network. Namely a plurality of cell culture zones are
formed for keeping heterogeneous cells in the state where the cells
adjoin each other within a specific space, and adjoining zones are
communicated to each other with a groove or a tunnel through which
the cells can not pass through. If required, a collective cell
micro-array (bioassay chip) having a plurality of electrode
patterns for measuring an electric potential in a cell is provided
in the groove or tunnel, or in the cell culture zone.
Example 1
[0448] FIG. 45 is a plan view schematically showing an example of a
structure of a cell reconstituting device having a circuit among
heterogeneous cells according to the ninth embodiment of the
present invention. FIG. 46 is a view schematically showing a cross
section of the cell reconstituting device taken along the line A-A
and viewed in the direction indicated by the arrow, and an optical
system for forming a tunnel communicating adjoining cell holding
zones in the device as well as a control system for the same.
[0449] The reference numeral 1 indicates a substrate and all of the
constructions are provided on the substrate 1. The reference
numerals 2, 3 indicate cell holding zones respectively, which are
provided at a prespecified gap in-between and are communicated to
each other via a groove 4. The reference numeral 100 indicates an
agarose gel formed on the substrate 1, and the cell holding zones
2, 3 and the tunnel 4 communicating the zones to each other are
formed by removing a portion of the agarose gel 100. The reference
numerals 2-2, 3-2 indicates electrodes respectively, which are
provided in the cell holding zones 2, 3. If required, plural
electrodes 5 are provided on the tunnel 4. The electrodes 2-2, 3-2,
and 5 are formed each with a transparent electrode (indium-tin
oxide: ITO) and is deposited on a surface of the substrate 1 with
the thickness of 100 nm. The reference numeral 6 indicates an
external terminal, and is provided around the substrate 1 at a
position corresponding and adjacent to the electrode. The reference
numeral 7 indicates wiring, which connects the electrode to the
external terminal. Both the external terminal 6 and wiring 7 have
the thickness of about 100 nm and are made from transparent ITO.
The wiring 7 is complicated and is not shown in FIG. 46. The
reference numeral 101 is a bank for holding the agarose gel and is
made from SU8 or glass. When the bank is made from SU8, the SU8 is
coated on the substrate 1 with the thickness of 100 .mu.m, and UV
ray is irradiated onto the SU8 for curing. When the bank is made
from glass, a glass sheet with the thickness of 100 .mu.m is
adhered to the substrate 1. The bank 101 is made after the
electrodes are prepared.
[0450] The reference numeral 9 indicates a semipermeable membrane
and is provided in adhesion to a top surface of the agarose gel 100
with the cell holding zones 2, 3 and the tunnel 4 connecting the
zones 2, 3 to each other formed thereon. The reference numeral 22
indicates an upper housing, which is provided on the semipermeable
membrane 9 with a proper space and entirely covers the top face of
the agarose gel 100. When the cells are not floating ones, the
cells tend to be deposited on a bottom surface of the substrate,
and therefore the diffusion shell is not necessarily required. The
reference numeral 22-1 indicates a fall section of the upper
housing 22. The reference numeral 21 indicates a culture fluid bath
formed between the semipermeable membrane 9 and the upper housing
22. The reference numeral 23 indicates an opening provided on the
upper housing 22, and the culture fluid is supplied through this
opening 23 into the culture fluid bath 21. The reference numeral 14
in FIG. 45 is a common electrode. Because the culture fluid is
supplied through the diffusion shell to cells held on the cell
holding zones 2, 3, change of conditions during culture is
prevented. In Example 1, a pulsating myocardial cell 2-1 is held in
the cell holding zone 2 and a neurocyte 3-1 in the cell holding
zone 3. The two cells are coupled to each other to form a
gap-junction via the tunnel 4 between the heterogeneous cells.
[0451] As for the procedure for preparation, after the electrodes
2-2, 3-2, 5, wiring 7, and terminal 6 are formed on the substrate
1, the bank 101 is formed on a top surface of the substrate 1, and
thermal-melted agarose 100 is poured into the bank 101. A 2%
agarose gel (with the melting point of 65.degree. C.) is heated and
melted in a microwave oven. The melted agarose gel solution heated
to 65.degree. C. is added to inside of the bank 101 on the
substrate 1, and is immediately spread to a coat with the
homogeneous thickness by a spin coater. In this step, by adjusting
a quantity of added agarose solution and the rotational speed of
the spin coater so that the agarose gel coating film has the
thickness in the range from 0.005 mm to 0.5 mm, an agarose solution
layer having the same height as that of the bank 101 is formed. A
good result is obtained by operating the spin coater at the
rotational speed of 50 rpm for 15 seconds, and then at the
rotational speed of 200 rpm for 10 seconds. When the agarose layer
is left in a moist box for one hour at 25.degree. C., an agarose
gel film 100 is formed. At this point of time, the agarose gel film
is formed on the entire inner surface of the bank 101 on the
substrate 1.
[0452] Then for forming the cell holding zones 2,3 with the agarose
gel 100, at first the agarose gel 100 is formed, and then portions
corresponding to the cell holding zones 2, 3 and tunnel 4 are
removed. This operation can easily be performed by using a laser
141 in the wavelength band (for instance, 1480 nm) which can be
absorbed by water. A laser beam 142 passes through an expander 143,
then passes through a filter 144 which reflects the IR rays with
the wavelength of 740 nm or more but allows transmission of the IR
rays with the wavelength of 1480 nm (+20 nm), further passes
through a deposition filter 145 which allows transmission of the
light with the wavelength of 700 nm or more, and is focused onto a
top face of the substrate 1 by a converging lens 146. The
converging light with the wavelength of 1480 nm is absorbed by
water contained in the agarose gel 100, and the temperature of the
adjacent area goes up to that close to the boiling point. When the
laser power is 20 mW, the agarose gel 100 is melted in the area
irradiated by the converging light with the width of about 20
.mu.m, and is removed by thermal convection. The problem is that
intensity of the converging light absorbed by the agarose gel 100
changes according to the presence of an electrode on the substrate
1. Therefore, the temperature in the area irradiated by the
converging light can be adjusted by controlling a laser power by
means of feedback control based on estimation of the temperature of
the agarose gel 100. The converging light having reached the
agarose gel 100 is converted to heat and generates the IR rays. The
IR ray passing through the filter 145, is reflected by the filter
144, and reaches an IR camera 160-1. Image data picked by the IR
camera 160-1 are fetched into a computing device 161 with a video
recording mechanism, and the temperature is estimated from the
detected intensity of the light to adjust a required power of the
laser 141. When it is difficult to control the temperature only by
adjusting the laser power, a moving velocity of a stage 164 is
controlled according to an output from the computing device so that
the temperature of agarose gel in the irradiated section is kept
within the prespecified range. Namely, a rotational speed of a
stepping motor 162 is controlled by the computing device 161 so
that a stage 164 is moved according to rotation of the stepping
motor transferred through a driving force transfer device 163. When
the tunnel 4 is to be formed, it is necessary to control the laser
power to keep the agarose gel from being penetrated.
[0453] As the dispersion shell 9 provided on a top surface of the
agarose gel 100, for instance, a cellulose membrane (with the
molecular cutoff of 30000 Daltons) is used. Streptoadivin is
previously fixed on the bank 101. When the bank 101 is made from
SU8, the surface is oxidized by an oxygen plasma or ozone. Then an
activated silane solution prepared by leaving a 1%
3-glycidoxypropyltrimethoxysilane (0.5% acetic acid aqueous
solution) for 30 minutes in the atmosphere is applied on the
surface of the agarose gel for making the activated silane and
agarose react to each other for one hour, and the product of the
reaction is heated and dried in the atmosphere for 30 minutes at
105.degree. C. with the glycidoxy group introduced onto the surface
thereof. When the material is made from glass, it is not necessary
to carry out the surface oxidization processing, and it is required
only to directly apply the 3-glycidoxypropyltrimethoxysilane on the
surface. Then 50 mM boric acid buffer liquid with streptoavidin
dissolved therein (pH 10) is coated and fixed on the surface.
Separately, a biotin-modified cellulose membrane is prepared by
reacting biotin hydrazide to a cellulose membrane with aldehyde
group introduced by oxidization with periodic acid and reducing the
reaction product by means of hydroboration.
[0454] The culture fluid is filled in the cell holding zones 2, 3
and tunnel 4 formed on the agarose gel 100, and one pulsating
myocardial cell 2-1 and one neurocyte 3-1 are inserted into the
cell holding zones 2 and 3 respectively with a micro-pipet under
observation with a microscope. Then the entire top faces of the
bank 101 and agarose gel 100 are covered with the biotin-modified
cellulose membrane 9. By fixing the agarose gel derivative and the
biotin-modified cellulose membrane to each other by biotin-avidin
reaction, a structure, in which a cell is kept in the agarose gel
structure, can be formed.
[0455] ITO-permeable electrodes 2-2, 3-2 and ITO-permeable
electrode 5 are previously formed in the cell holding zones 2, 3
and in the tunnel 4 respectively. Further to observe beating of
cells or to monitor progression of agarose machining, also an
optical system for detecting transmitted light from a light source
170 is incorporated. The light from the light source 170 transmits
the upper housing 22, further transmits an object lens 146 being
scattered by the agarose gel 100, and is picked up as an image by a
deposition filter (mirror) reflecting visible light and with a CCD
camera 160-2. The image data is transmitted to the computing device
161 and is overlapped with the image taken by the IR camera 160-1,
and the synthesized image is used, for instance, for checking a
portion heated by laser beam irradiation and a pattern of a
structure. In other words, with this system, electric potentials of
the pulsating myocardial cell 2-1 and neurocyte 3-1 kept in the
cell holding zones 2, 3 respectively can be measured with the
electrodes 2-2, 2-3, and also the beating state of the pulsating
myocardial cell can be picked up as an image by observing with a
microscope. Further by using the electrode 5 provided in the tunnel
4, signal transaction between the two cells can be measured.
[0456] A top surface of the agarose gel 100 functions as a culture
fluid bath 21, and the culture fluid supplied from the opening 23
always circulates therein. Further various types of chemical
substances such as a cell-stimulating material or an endocrine
disrupter are added in the culture fluid from the opening 23, for
instance, to monitor the beating state of the pulsating myocardial
cell or changes of electric potentials in the pulsating myocardial
cell or neurocyte by using any of the electrodes or by means of
observation with a microscope. In this step, for bioassay of an
ionic material affecting measurement with an electrode, observation
with a microscope is employed, and for bioassay of materials not
suited to observation with a microscope such as a coloring matter,
an electrode may be used.
[0457] Main dimensions of a structure of the heterogeneous cell
bioassay chip in Example 1 shown in FIG. 45 are as described below.
The size of the cell holding zone 2 is 30 .mu.m.times.30 .mu.m, and
the depth is 0.1 mm, which is equal to that of the agarose gel 100.
There is no specific restriction over the thickness of the cell
holding zone, and in a case where a cell is set on a surface of the
substrate, the thickness is required to be in the range from 0.005
to 0.5 mm. A distance between adjoining cell holding zones 2, 3 is
generally 50 .mu.m, and the tunnel 4 communicating to the cell
holding zones 2, 3 to each other has the height in the range from
50 .mu.m to 300 .mu.m, and the width of 5 .mu.m. When the tunnel 4
has the height of 100 .mu.m and the thickness of the agarose gel
100 is 0.1 mm, not a tunnel but a groove is provided.
Example 2
[0458] Example 2 proposes a heterogeneous cell bioassay chip having
the basically same structure as that described in Example 1, but
allowing for independent modification of an environment for each of
the cell holding zones 2 and 3.
[0459] FIG. 47 is a view schematically showing a structure of a
cell reconstituting device having a circuit between heterogeneous
cells in Example 2 of the ninth embodiment of the present
invention. FIG. 48 is a view schematically showing a cross section
of the cell-reconstituting-device shown in FIG. 47 taken along the
line A-A and viewed in the direction indicated by the arrow, and
also showing an optical system and a control system for forming a
tunnel communicating adjoining cell holding zones in the
device.
[0460] As easily understood by comparing FIG. 45 to FIG. 47, in
Example 2, a projection section 101-1 which is a protrusion of the
bank 101 is provided not only around the agarose gel 100, but also
in a central portion of the agarose gel 100 to device in half the
agarose gel 100 and reaches a point close to the tunnel 4. As
easily understood by comparing FIG. 46 to FIG. 48, a partition 22-2
is provided to divide in half the culture fluid bath 21 to a
section 21-1 and a section 21-2. Further, as shown in FIG. 47, an
opening 23 for supplying a culture fluid into the culture fluid
baths 21-1 and 21-2 is additionally provided.
[0461] In Example 2, even though the cell holding zones 2, 3 are
communicated to each other with the tunnel 4, the culture fluid
bath includes the two culture fluid baths 21-1 and 21-2 partitioned
by the projection section 101-1 of the bank 101 and the partition
22-2 of the housing 22. Two openings for supplying a culture fluid
are provided in the culture fluid baths 21-2, 21-2, so that a
culture fluid can independently be supplied into each of the
culture fluid baths 21-2, 21-2. In other words, bioassay of
heterogeneous cells can be performed by culturing cells kept in the
cell holding zones 2, 3 in the different environments
respectively.
Example 3
[0462] In Example 3, a network consisting of a pulsating myocardial
cell and a neurocyte is formed by using the heterogeneous cell
bioassay chip described in Example 2, and assessment is made for
influence when an electric impact is given to the neurocyte. FIG.
49(A) and FIG. 49(B) are waveform diagrams each showing a result of
the assessment for the influence when an electric stimulus is given
to the neurocyte.
[0463] In Example 3, examination is made for whether a beat cycle
of the pulsating myocardial cell 2-1 kept in the cell holding zone
2 changes when potassium or glucose, or suspected endocrine
disrupter is added to the culture fluid of the neurocyte 3-2 in the
cell holding zone 3, or the content is increased.
[0464] At first, the same culture fluid is filled in the culture
fluid baths 21-1, 21-2, and a beat cycle of the pulsating
myocardial cell 2-1 is checked to obtain a myocardial pulsation
pattern showing the substantially same cycle as shown in FIG.
49(A). Then, for instance, when dopamine is added to the culture
fluid in the culture fluid bath 21-2 in the cell holding zone 3
without changing the culture fluid in the culture fluid bath 21-1
in the cell holding zone 2, the disturbance in the beat cycle as
shown FIG. 49(B) is expected to be observed. This phenomenon occurs
because a chemical substance give influences to the neurocyte and a
beat cycle of the pulsating myocardial cell is fluctuated when an
electric potential on a surface of the neuron changes.
[0465] In this experiment, the number of object cells for
measurement is only one, so that the dispersion is around 50%. To
suppress this dispersion, four or more cells and more preferably
eight cells should be put in each of the cell holding zones 2 and 3
to suppress the dispersion of observed beat cycles of the cells to
around 10%.
Example 4
[0466] FIG. 50 is a plan view showing an example of the
heterogeneous cell bioassay chip in which cell holding zones each
communicated to adjoining ones with a tunnel or a groove are placed
side by side like an array, in place of a block of cells in each
cell holding zone, and this array of cell holding zones functions
like a block of cells. In FIG. 50, the number of cells in each
species is five. The same reference numerals are assigned to the
same or equivalent components as those in Examples 1 and 2. The
reference numerals 61 and 62 each indicates five arrays, which
house heterogeneous cells, in the cell holding zone. Electrodes are
provided in each of the cell holding zones in the heterogeneous
cell arrays 61, 62 and also in the tunnel 4 between the
heterogeneous cell arrays 61, 62. In this case, only one tunnel 4
is provided between the heterogeneous cell arrays 61, 62. AS
described in Example 2, the heterogeneous cell arrays 61, 62 are
divided by cell type by the projecting section 101-1 of the bank
101, and naturally the culture layers (not shown) corresponding to
the heterogeneous cell arrays 61, 62 are divided by the partition
22-2 (not shown) of the housing 22 as described in Example 2, so
that different culture fluids can be used for different types of
cells respectively.
[0467] Examples 2 and 3, combination of a pulsating myocardial cell
and a neurocyte is described, but the combination may be changed
according to an application, and for instance, a sensor cell such
as an olfactory cell or a taste receptor cell or a cell with
various types of receptors incorporated therein may be used to
communicate with the pulsating myocardial cell or an epithelial
cell of small intestine to perform a heterogeneous cell bioassay.
Therefore, with this technique, there is provided the possibility
of measuring influence of even a substance lethal to a particular
cell and not allowing for measuring influence thereof to other
cells with the conventional technique by communicating a cell
having the durability to the substance and a cell not having the
durability to the substance.
[0468] As described above, in the ninth embodiment of the present
invention, various influences which a cell receives from the
environment can objectively be examined by making use of the
community effect between heterogeneous cells. Therefore the
influence of medicaments, which have been expressed with the
subjective words such as "feeling bad or good when a medicament is
administered", or effects of environmental conditions to a human
body may be expressed digitally.
[0469] As described above, a groove may be provided in place of the
tunnel 4 in this example. Instead of measuring an electrical
response of a cell, change of a form of the cell may be observed by
adding a specific testing sample in a culture fluid of the cell.
Further, instead of measuring an electrical response of a cell, a
specific cell is stimulated using electrodes to measure a response
of the cell by adding a specific testing sample in a culture fluid
of the cell.
[0470] As for the industrial utilization of the heterogeneous cell
bioassay chip according to the ninth embodiment of the present
invention and bioassays with the bioassay chip, there are the
possibilities that researches in academic research organizations or
drug manufacturing companies utilize the heterogeneous cell
bioassay chip, and also that people concerned in manufactures of
heterogeneous cell bioassay chips use the chip. From the user's
view point, the chip should preferably be provided in the state in
which heterogeneous cells are accommodated in the heterogeneous
cell holding zones respectively. However, a cell accommodated in
the heterogeneous cell holding zone of the chip can not live for a
long period of time, the chip manufactures are required to supply
chips clearly showing the expiration date, or to supply a kit
including the substrate 1, electrodes, wiring, banks and agarose
gel on the substrate 1, dispersion shell 9, and upper housing 22.
When a chip is supplied as a kit, the user is required to perform
accommodation of heterogeneous cells in heterogeneous cell holding
zones and assemble the kit components for building up the bioassay
chip.
[X] Tenth Embodiment
[0471] A tenth embodiment of the present invention discloses a
method allowing for easy exchange of a medium for cell culture and
separation of cell culture from a vessel wall without giving any
damage to the cultured cell. A cellulose membrane is used as a
material for the vessel, and a cell is attached to the cell
membrane for culturing. After culturing, the vessel is processed
with cellulose to dissolve, melt, and remove the cellulose
membrane, so that damages to the cultured cell can be reduced.
[0472] In the ninth embodiment, a cell to be cultured is attached
to the cellulose membrane for cell culturing. The cellulose
membrane may previously be coated with an extra-cell matrix such as
gelatin or laminin. After culturing, the cellulose membrane is
processed with cellulose to decompose the cellulose membrane and
the cultured cell is recovered. The cell membrane is spread on an
ordinary dish and culturing is performed on the cellulose membrane.
Finally cellulase is slowly poured along a rim of the dish so that
the cellulase is spread over the dish. By decomposing the cellulose
as described above, it is possible to recover, for instance, an
epithelial cells in the sheet state, namely with the inter-cellular
adhesion intact.
[0473] Further, by spreading the cellulose membrane on a substrate
having fine flow paths, the cellulose membrane is preserved, and by
feeding a cellulose solution into the fine flow path structure
between the cells and the substrate, the cellulose membrane can
selectively be decomposed and removed. What is important in this
step is that cellulase does not decompose animal cells. For, an
animal cell does not have a cell wall like that in cellulose. This
fine flow path structure may be used not only for adding cellulose,
but also for exchanging a medium during cell culture. Because of
this feature, by using a cellulose filter with the molecular weight
cut off of 10,000 to 100,000 Daltons as the cellulose membrane
according to the necessity, proliferating factors in serum or
metabolic decomposition products from cells can be exchanged and
removed.
Example 1
[0474] FIG. 51(A) to (D) are views schematically showing a case in
which cell culture is performed on a cellulose membrane in Example
1 of the ninth embodiment of the present invention, cultured cells
are recovered in the sheet state, and further a multi-layered cell
sheet is formed.
[0475] As shown in FIG. 51(A), a cellulose membrane 2 (with the
molecular weight cut off of 30,000 Daltons, and having the diameter
of 55 mm.phi.) with gelatin coated thereon is spread on a dish (60
mm) 5 storing therein 5 ml of a medium 1 with serum. Preincubation
is performed for 30 minutes in 5% CO.sub.2 at 37.degree. C. for
assimilating the cellulose membrane 2 to the medium 1. A suspension
of pulsating myocardial cell is added to the medium by 0.5 ml, and
incubation is performed in a CO.sub.2 incubator at 37.degree. C.
During this incubation, the medium 1 may be exchanged with a new
one, if necessary. When the incubation proceeds, the pulsating
myocardial cells spread over the substantially entire cell membrane
2 in the sheet form. The reference numeral 3 indicates the
pulsating myocardial cells spread in the sheet form.
[0476] When the pulsating myocardial cells are spread into the
sheet form, the medium 1 is sucked and removed with an aspirator,
and immediately a 10 mg/ml cellulase solution 4 (1 ml) is spread
along a rim of the dish 5 with a pipet 6. Then the dish is tilted
mildly to spread the cellulose solution to the entire bottom
surface of the dish for rinsing the cells 3 in the sheet form. Then
the cellulase solution is removed with the aspirator, and again the
cellulase solution is added by 1 ml. Processing with the cellulase
solution is performed twice, because it is assumed that some
cellulose inhibitors may be present in the medium. The cells in the
sheet form is put in a CO.sub.2 incubator at 37.degree. C. to
incubate the cells until the cellulose membrane 2 is decomposed and
the cell sheet 3 floats. Decomposition of the cellulose membrane
can easily be observed with a microscope.
[0477] FIG. 51(B) shows the mono-layered cell sheet 3 separated
from the cellulose membrane 2 as described above.
[0478] FIG. 51(C) shows the state in which the cell sheet 3 already
prepared is overlaid on a cell sheet 3' newly prepared as described
in relation to FIG. 51(A).
[0479] In FIG. 51(C), after the cell sheet 3' is formed, it is
important to overlay the cell sheet 3 already prepared and continue
incubation before a cellulase solution 4 is added. Incubation after
the already prepared cell sheet 3 is overlaid should be performed
under the same conditions as those described above. After the
incubation is continued, the cellulase solution 4 is added as
described in relation to FIG. 51(A) to process the cell sheet with
cellulose, a two-layered cell sheet 12 as described in FIG. 51(D)
can be obtained.
[0480] By repeating the operation steps described above, the cell
layers can be laminated up to about four layers. Further, by
overlaying the four-layered cell sheets on each other, it is
possible to prepare an 8-layered cell sheet. Specifically, at first
the four-layered cell sheet is prepared according to the procedure
described above and is processed with cellulase to obtain a
four-layered cell sheet. Then a four-layered sheet is prepared
according to the procedure described above, and the four-layered
cell sheet is overlaid on the four-layered cell sheet newly
prepared, and incubation is continued. Then the cellulase solution
is added as described above to process the cell sheet with
cellulose, thus an 8-layered cell sheet being obtained.
Example 2
[0481] FIG. 52(A) is a plan view showing a cell culture support
body having a structure for preventing cellulose from contacting
the entire surface of the cell sheet. FIG. 52(B) is a
cross-sectional view showing the cell culture support body shown in
FIG. 52(A) taken along the line A-A and viewed in the direction
indicated by the arrow. FIG. 52(C) is a cross-sectional view
showing the cell culture support body shown in FIG. 52(A) taken
along the line B-B and viewed in the direction indicated by the
arrow.
[0482] A substrate 100 is a vessel with the diameter of 60 mm.phi.,
and has two-staged bottom surfaces 101, 102 on the internal
surface. A depth of the higher bottom surface 101 from a top
surface of the vessel is about 10 mm, and that of the lower bottom
surface 102 from the top surface of the vessel is about 12 mm.
Beams 105 each with the width of 1 mm are provided on the lower
bottom surface 102. As for a height of the beam 105, a top of the
beam is at the same level as the bottom surface 101, so that the
beam 105 is located at a relatively lower position. A space between
the adjoining beams 105 is about 1 mm. Recesses 103 for sucking or
pouring a culture fluid or the like are provided on the bottom
surface 102. Further, diffusion plates 106 are provided between the
recesses 103 and beams 105 respectively so that the fluid is
homogeneously spread into spaces between the beams when a liquid is
distributed from the recesses 103. A height of the diffusion plate
is about 3/4 of that of the beam so that the liquid is leaked over
the plate and is spread homogeneously. If the diffusion plate is
not provided, a liquid flows only in the shortest flow path, for
instance, when a solution such as a culture medium is exchanged,
and sometimes the liquid does not homogeneously flow into spaces
between the beams.
[0483] FIG. 53(A) is a cross-sectional view illustrating the
situation in which the cell sheet described in Example 1 is
prepared by using the substrate 100 described with reference to
FIG. 52, and is a cross-sectional view showing the substrate shown
in FIG. 52 taken along the line A-A and viewed in the direction
indicated by the arrow. FIG. 53(B) is a cross-sectional view
showing the substrate shown in FIG. 52 taken along the line B-B and
viewed in the direction indicated by the arrow. The cellulose
membrane 104 is placed on a top face of the face formed with the
beams 105 and the bottom surface 101. A cover 110 is placed on a
top face of the substrate 100, and tubes 111-1, 111-2 extending to
bottom surfaces of the recesses 103 are attached to the cover. When
the cover 110 is set, tips of the tubes descend into spaces inside
the recesses 103.
[0484] The procedure for culturing cells using the substrate 100 in
Example 2 is described below. At first, a medium is added up to a
top edge of each beam on the substrate 100. In other words, the
medium is added until a surface of the higher bottom surface 101 is
wetted by the medium. Then the cellulose membrane assimilated to
the medium is sunk and is placed on the beams 105 and the higher
bottom surface 101. Then the cover 110 is set, and the medium is
fed from the tube 111-1 and is exhausted from the tube 111-2. The
medium is previously heated to 37.degree. C. Then preincubation is
performed for 30 minutes in a CO.sub.2 incubator (5% CO.sub.2,
37.degree. C.).
[0485] Then the substrate 100 is taken out from the CO.sub.2
incubator, the cover is opened, the pulsating myocardial cells are
spread as described in Example 1, the cover 110 is set, and the
medium is exchanged with a new one to continue incubation. When the
pulsating myocardial cells are spread to the substantially entire
surface of the cellulose membrane, a 10 mg/ml cellulose solution is
continuously supplied from the tube 111-1 in place of the medium
until top faces of the beams 105 are wetted by the solution. As the
cellulose membrane 4 and top faces of the beams 105 are not adhered
tightly, the cellulase solution is spread into recesses sections
between the beams 105. When the incubation is continuously
performed at 37.degree. C., the cellulose membrane 104 is
decomposed, and the cultured cells are peeled off in the sheet-like
state.
[XI] Eleventh Embodiment
[0486] An eleventh embodiment of the present invention discloses a
method of constructing a cell network by controlling a small number
of heterogeneous cells to form a network for clarifying functions
of discrete cells, for examining responses of discrete cells to a
medical agent or the like (for bioassay), or for forming an
assembly of cells.
[0487] For achieving the object as described above, the various
types of micro-chambers as described below are required:
1) a cell culture micro-chamber in which homogeneous or
heterogeneous cells are arrayed at any positions according to any
order, 2) a culture micro-chamber based on a structure enabling
free and easy administration of medical agents, induction of
physiological activities of each cell, and easy exchange of a
culture fluid with a fresh one and including a mechanism for adding
a given material during cell culture, 3) a culture micro-chamber
including a mechanism enabling easy administration of a medical
agent and control for cultural environment, 4) a micro-chamber for
cell culture including a recovery mechanism, with which an
operation can recover, after a cell network is formed, the formed
cell network by removing the culture chamber used for cell culture,
and also a method of constructing a cellular structure with the
micro-chambers as described above is required.
[0488] In the eleventh embodiment, a support body having the
structure in which an agarose gel membrane is formed on a cellulose
membrane is used as a material for the cell culture chamber. The
agarose gel can be melded by heating, and a space for cell culture
is formed by making use of this property. For instance, an agarose
membrane is provided in a sufficient quantity of aqueous solution,
and a converging beam from a laser having the wavelength allowing
for absorption by water, for instance, with the wavelength of 1480
nm is irradiated, the converging laser light is absorbed by the
agarose gel, generates heat, and melts the agarose gel. The melted
agarose gel is dispersed in the solution and the concentration
drops to the level below a threshold value required for
gelatinization, so that the agarose gel once melted never be
gelatinized.
[0489] By using this technique, a cell holding well having the
resolution of about 1 .mu.m or a connection flow path between the
wells can be formed. What is important in this technique is that,
when a specified number of specified cells are cultured in each
well and a portion of the cell membrane extends to form a junction
with an adjoining cell, a direction in which the cell membrane
extends and an order of cells with which the junction is to be
formed can be controlled. In other words, it is important that a
form of a micro-chamber for cell culture can freely be changed
during cell culture. With the availability of this kind of
technique as described above, for instance, when three types of
cells, namely types A, B, and C of cells are cultured in
independent wells and the number of cells belonging to each type is
four, for instance, such as an operations are possible in which at
first four cells belonging to type A are conjugated to four cells
belonging to type B independently, then one of the four cells
belonging to type A is conjugated to one of the four cells
belonging to type B, and then one of the four cells belonging to
type A is conjugated to one of the four cells belonging to type C.
With the operations as described above, the objective 1) described
is achieved.
[0490] The agarose gel membrane can easily be processed by heating
the gel with converging light when the agarose gel is formed on a
cellulose membrane and is present in a solution, or when the
agarose gel is placed on a transparent substrate such as a glass
sheet. When the agarose gel is placed on an opaque structural body,
another technique according to the present invention is required.
The opaque structure is, for instance, one made from a material
which absorbs or scatters the converging laser beam having the
wavelength employed for processing the agarose gel membrane.
[0491] When there is an opaque structural body, a flow path having
a desired pattern is formed on the agarose gel by contacting a tip
of a light-absorbing needle to the agarose gel and focusing the
converging light beam not to the opaque structural body but to a
portion of the needle. With this operation, regardless of the type
of the substrate on which the agarose gel is placed, it is possible
to form a desired cell circuit by linking specified cell culture
wells according to a desired order. The silicon or SU8 is a
structural body which is not completely transparent is
disadvantageous for being irradiated by a converging laser beam,
but still the materials are used because application of the
micro-fabrication technique is advantageous for addition of a
reagent or for formation of a micro-structural body for medium
exchange.
[0492] The objectives 2) and 3) can easily be achieved by not only
using a cellulose membrane and but also placing the cellulose
membrane on a micro-structure made from silicon or SU8. In cell
culture, it is necessary to employ a semipermeable membrane which
structurally separates inside of a well accommodating cells therein
from a cell fluid bath and also allows for transmission of a cell
fluid. When irradiating a converging light beam onto an agarose gel
membrane through this semipermeable membrane, it is necessary to
make the semipermeable membrane with a material which can hardly be
damaged by the converging light beam. As this material, for
instance, a cellulose membrane may be used.
[0493] The micro-chamber for cell culture in the eleventh
embodiment is formed on a semipermeable membrane, and further a
micro flow path prepared by the micro fabrication technique
contacts the semipermeable membrane, so that it is possible to
exchange a culture fluid with a new one via the semipermeable
membrane from the micro flow path, to add any additive for
bioassay, or to recover molecules released from a cell in response
to addition of the additive. Because of this configuration, the
objectives 2) and 3) are achieved.
[0494] Finally the cell circuit formed as described above is
separated from the substrate. Adhesion between cells is not so
strong, so that cell circuits can not be mechanically separated
from the substrate. It may be considered that a cell bites into a
cellulose membrane. Taking into considerations the fact that a
volume of the agarose gel is larger and the cells are damaged when
heated, the agarose gel is used as a support body as it is. It is
necessary to remove the cellulose membrane and separate the cells
together with the agarose gel, but the cellulose itself can be
decomposed by cellulase. In this state, the cell circuit is held by
the agarose gel, and therefore by laminating a plurality of agarose
gel sheets prepared as described above, it is possible to
three-dimensionally form a cell network structure.
Example 1
[0495] FIG. 54(A) is a perspective view showing a micro-chamber for
cell culture in Example 1, while FIG. 54(B) is a cross-sectional
view showing the micro-chamber in FIG. 54(A) taken along the line
A-A and viewed in the direction indicated by the arrow. An agarose
gel membrane 1 is integrally formed on a cellulose membrane 2, and
is placed on a glass substrate 3. A plurality of wells 5 each for
holding a cell thereon are formed on the agarose gel membrane 1.
The micro-chamber for cell culture 1 is placed in a vessel 6. A
culture medium 7 is present in the vessel, and the micro-chamber 1
is immersed in the culture medium. In FIG. 51(A), the agarose gel
membrane 1, cellulose membrane 2, and glass substrate 3 are
separated from each other for the purpose of simplification, but
actually the components are closely attached to each other as shown
in FIG. 54(B).
[0496] The agarose gel 1 is made as described below. At first, the
water-swelling cellulose membrane 2 (with the molecular weight cut
off of 100000 Daltons) is placed on the glass substrate 3 with the
dimensions of 20 mm.times.20 mm.times.1.1 mm(t), and is provided on
a chuck of a spin coater. Size of the cellulose membrane 2 must be
larger than that of the glass substrate 3, and the peripheral
portions are cut off after the agarose is gelatinized. Then 0.5 ml
of 50 mM sodium phosphate buffer liquid with pH of 7.4 containing
0.15 M NaCl in 1.5% agarose gel (previously heated in a microwave
oven to dissolve the agarose and then cooled to about 60.degree.
C.) is applied to the agarose gel, and the agarose gel is rotated
for 10 seconds at 100 rpm. Then the agarose is left in a moisture
box for 30 minutes to gelatinize the agarose. With this operation,
an agarose gel membrane with the thickness of about 100 .mu.m is
formed. Thickness of the gel membrane is decided by conditions for
forming the membrane, so that the thickness is adjusted by changing
the rotational speed and a temperature of the gel.
[0497] In this state, wells 5 for accommodating cells therein,
grooves each connecting adjoining wells 5 to each other, and the
like have not been formed yet. Size of the well 5 as expressed by a
diameter thereof is, for instance, 30 .mu.m, and the agarose gel is
removed only in portions corresponding to the well 5. For forming
the well 5, the agarose gel is heated, melted, and removed by
irradiating a converging laser beam with the wavelength adapted for
absorption by water, for instance, 1480 nm to the agarose gel
membrane 1. Because a sufficient quantity of culture medium 7 is
present in the vessel 6, the melted agarose gel is diffused, and
therefore the agarose gel is not again gelatinized because the
concentration is lower than the threshold value for gelatinization
of the agarose gel. A desired number of wells 5 are formed at
desired positions by the method.
[0498] FIG. 55 is a plan view showing an example of the
micro-chamber for cell culture with a cell circuit formed thereon.
The reference numeral 10 indicates the micro-chamber for cell
culture with a cell circuit formed thereon. A cell is put in the
well 5 with a micro pipet (not shown). For instance, of 8.times.2
wells (with the clearance between adjoining wells of 100 .mu.m), a
neurocyte is inserted into each of the wells. A pulsating
myocardial cell is put in each of the remaining eight wells. The
reference numeral 12 indicates a group of wells 5 each with a
neurocyte inserted therein, and the reference numeral 13 indicates
a group of wells 5 each with a pulsating myocardial cell put
therein. When cell culture is continued for a prespecified period
of time, the neurocyte and the pulsating myocardial cell generate
projections respectively. The projections start extending in random
directions, but at this point of time, generation of junctions
between cells is prevented by the agarose gel membrane 1.
[0499] At first, like in the case in which a well is prepared on
the agarose gel membrane 1 between the wells 5 in the group 12 of
eight wells each containing a neurocyte therein, a converging laser
beam having the wavelength of 1480 nm is irradiated to link the
wells 5 with a groove 11-1 for guiding the projections generated on
each neurocyte into the groove 11-1 formed on the agarose gel
membrane 1. With this operation, gap junctions between neurocytes
are formed. Likely, the agarose gel membrane between each well 5 in
the group 13 of 8 wells each containing a pulsating myocardial cell
therein are linked to each other by a group 11-2 to form a circuit
between pulsating myocardial cells. Cell culture is started, only
before the grooves are formed between the cells, to prevent the
cells from generating projections in random directions with one
cell jointing to a plurality of cells, and also for forming a
series of cell circuit. If the grooves 11-1, 11-2 are previously
formed, projections generated on the cell extend over the well 5
and the cell may be jointed to the adjoining cell. Namely, when a
cell has the high activity, the cell generates projections in
random directions. On the other hand, when the cell in the
adjoining well has the low activity, the cell does not
substantially extend the projections. In this case, a cell having
the high activity may be jointed to a plurality of cells. To
prevent the phenomena as described above, the grooves are not
prepared previously, and the grooves should be prepared when the
cells are jointed to each other. Further, for instance, when
different types of neurocytes are put in the wells 5 in the well
group 12, it is necessary to strictly manage an order of linkage
between the cells. Therefore, it is more effective to dig a groove
after projections are generated on the cells.
[0500] Finally, for forming a circuit between the neurocytes in the
well group 12 and the pulsating myocardial cells in the well group
13, a converging laser beam is irradiated onto the agarose gel
between the two groups. With this operation, the eight neurocytes
and eight pulsating myocardial cells are connected with the groove
11-3 to form a cell circuit. In this example, for testing, in a
case where a signal flows one-dimensionally, namely in a case a
signal from a neurocyte in the well 5 in the well group 12 goes
into a pulsating myocardial cell in the well 5 in the well group
13, to check how the signal is transferred to the pulsating
myocardial cell in the well 5 in the well group 13, data analysis
is easier by connecting the wells 5 at edges of the well groups 12
and 13. When it is necessary to analyze signal transfer in a more
complicated circuit between a neurocyte in the well 5 in the well
group 12 and a pulsating myocardial cell in the well 5 in the well
group 13, any selected wells 5 may be connected according to the
object.
[0501] In the cell circuit network as described above, for
instance, when an electric stimulus is given to or the ionic state
is changed in any of the neurocytes, it is observed that a change
occurs in a cyclic beat of the pulsating myocardial cells. In other
words, this cell circuit may be used in bioassay of various types
of medical agents. Each group contains eight cells, because, in a
pulsating myocardial cell or a neurocyte, the cooperativeness
between cells can be obtained when four or more cells are linked to
each other with the projections as compared to the phenomenon
observed in a single cell. Especially, when there are eight cells
or more, dispersion of myocardial pulsation is suppressed to about
10% (in contrast to about 50% in a test with a single cell).
[0502] In Example 1, a top face of the well 5 formed on the agarose
gel membrane 1 is open, and with this configuration no problem
occurs, because generally an animal cell can not move over a wall
with the height of even several .mu.m. Further unnecessary
migration of cells can be prevented by placing a cellulose membrane
on the entire opening of the well, if necessary.
[0503] Finally descriptions are provided for a method of removing
the cellulose membrane 2 and adhering fibroblast over the section
with the cellulose membrane 2 having been removed.
[0504] FIG. 56 is a cross-sectional view showing an example of a
cell structure construct 20 in which a circuit consisting of a
neurone 23 and a pulsating myocardial cell 24 is fixed on a
fibroblast sheet 22 on the cellulose membrane 21 taken along the
line B-B in FIG. 55 and viewed in the direction indicated by the
arrow.
[0505] At first, the cellulose membrane 2 formed on the glass
substrate 3 described with reference to FIG. 54 and a structural
body based on the agarose gel 1 are separated from the glass
substrate 3 and are floated in the vessel 6. For this purpose,
cellulose is added in the culture medium 7 in the vessel 6
accommodating therein the cell culture micro-chamber 10 on which
the cell circuit has been prepared, and a quantity of cellulose is
adjusted to 50 mg/ml as expressed by the final concentration. When
the sample is incubated at 37.degree. C., the cellulose membrane 2
on the glass substrate 3 is gradually decomposed.
[0506] Separately, fibroblast cultured into a sheet form is
prepared, and a surface of the agarose gel membrane 1 with the
cellulose membrane 2 melted thereof is contacted to the fibroblast.
When the cell culture is continued in this state, the cell
structure construct 20, in which the agarose gel membrane 1 is
directly adhered to the fibroblast layer 22, is obtained. A
neurocyte 23 is put in the left well 5, and a pulsating myocardial
cell 24 is put in the right well 5, and the two cells extend
projections to joint to each other with the groove 11-3. In FIG.
56, the reference numeral 21 indicates a cellulose membrane, and as
understood from the following description concerning construction
of the sheet-formed fibroblast, the cellulose membrane 21 is
different from the cellulose membrane 2 used for forming the
agarose gel membrane 1.
[0507] As described above, in the eleventh embodiment, a groove is
formed between wells containing cells to be conjugated to each
other during cell culture, and therefore after a structural body in
which the cellulose membrane 2 and the agarose gel membrane 1 are
placed on the glass substrate 1 is formed, the wells 5 are formed
on the agarose gel membrane 1 with cells put therein respectively,
and then grooves each connecting adjoining wells 5 to each other
are formed. In other words, cell network containing cells is formed
at first, and then the cellulose membrane 2 is melted with
cellulose, and the cellulose membrane 2 is contacted to the
fibroblast sheet 22. The neurocyte 23 and the pulsating myocardial
cell 24 extend projections to the fibroblast sheets 22 and are
attached thereto.
[0508] To culture the fibroblast into the sheet state, a cellulose
membrane 21 (with the molecular weight cut off of 30,000 Daltons,
55 mm.phi.) with gelatin applied thereof is spread on a dish (60
mm) with 5 ml medium 1 including serum accommodated thereon.
Incubation is performed for 30 minutes in 5% CO.sub.2 atmosphere at
37.degree. C. to assimilate the cellulose membrane to the medium.
0.5 ml suspension of fibroblast cells is added to the medium, and
incubation is further continued in the CO.sub.2 incubator at
37.degree. C. During this incubation, the medium is exchanged with
a new one, if necessary. When the cell culture proceeds, the
fibroblast pulsating myocardial cells spread like a sheet on the
entire surface of the cellulose membrane 21. FIG. 22 schematically
shows the state in which the fibroblast has spread into the sheet
state on the cellulose membrane 21.
Example 2
[0509] In Example 1, the cellulose membrane 2 is placed on a top
surface of the flat glass substrate 3, but in Example 2, a support
body for supporting the cellulose membrane 2 is more improved, and
a cell can more easily be controlled during incubation in the state
in which the cell is placed in the well 5 formed on the agarose gel
membrane 1.
[0510] FIG. 57(A) is a perspective view showing a micro-chamber for
cell culture, while FIG. 57(B) is a cross-sectional view showing
the micro-chamber shown in FIG. 57(A) taken along the line A-A and
viewed in the direction indicated by the arrow. The substrate 100
is based on a structural body 101 with the thickness of 2 mm placed
on a top surface of the glass plate 3 with the size of 60.times.60
mm. The structural body 101 may be shaped into a specific form at
first with polydimethylsiloxane polymerized. Alternatively the
structural body may be cut off from a plastic sheet employed in
place of the glass plate 3. Also the structural body 101 may be
made with SU 8. A rhombus pool 102 with the depth of 2 mm, in which
a solution such as a culture medium flows, is formed, and then a
plurality of beams 103 with the width of 1 mm and height of 2 mm
are formed in the pool 2. Space between the adjoining beams 103 is
about 1 mm. End sections of each beam are off from the periphery of
the pool 102. Spaces 104, through which a solution is introduced or
exhausted, are formed at positions opposite to the pool 102. A
dispersion plate 105 with the height of 1.5 mm is formed between
the space 104 and beam 101 so that the solution is homogeneously
spread into spaces between the means 103.
[0511] The reference numeral 2 indicates a cellulose membrane,
which has the size sufficiently covering the top surface of the
structural body 101, and the thickness varies from product to
product, but is generally in the range from 30 to 100 .mu.m. The
reference numeral 111 indicates an opening, which is provided at a
position corresponding to the space 104 through which a solution is
introduced or exhausted.
[0512] The reference numeral 115 indicates a thin plastic plate
with the thickness of about 100 .mu.m. The thickness of the thin
plastic plate 115 is preferably the same as that of the agarose gel
membrane. The thin plastic plate 115 is used as a support body for
the cellulose membrane 2, and is also used as a wall material for
forming the agarose gel membrane 1. The agarose gel membrane 1 is
formed at a position corresponding to the rhombus pool 102 at a
central portion of the thin plastic plate 115 (which hereinafter
described). Further openings are formed at positions corresponding
to the spaces 104, through which a solution is introduced or
exhausted, provided at two edge sections of the thin plastic plate
115. In FIG. 57(A), the cellulose membrane 2 and the thin plastic
plate 115 are separated from each other, and also are off from a
top surface of the structural body 101, but actually the components
are overlaid on each other as shown in FIG. 57(B).
[0513] The cellulose membrane 2 may be adhered to the thin plastic
plate 115 with an adhesive before the agarose gel membrane 1 is
formed, and also may simply be placed on the structural body 101
made from SU8 with the thin plastic plate 115 overlaid thereon. In
any case, the cellulose membrane 2 and thin plastic plate 115 are
placed and assembled in the integrated state on a top surface of
the structural body 101 before the agarose gel membrane 1 is
formed.
[0514] In this process, agarose with the melting temperature of
about 65.degree. C. and a concentration of 1.5% is used. The
agarose is melded in a microwave oven and is coated on a region for
forming the cellulose membrane 2 integrated with the thin plastic
plate 115, and is left for 30 minutes in the wet state at the room
temperature. As a result, the thin plastic plate 115 with the
agarose gel membrane 1 adhered on the cellulose membrane 2 can be
obtained.
[0515] Next descriptions are provided for a method of forming a
groove 11 between adjoining wells 5. Different from Example 1, in
this example, the substrate 100 is not always required to be
transparent to the converging light beams with the wavelength of
1480 nm. Therefore, in this example, the groove 11 between the
adjoining wells 5 can not be formed by irradiating the converging
light beam.
[0516] When the cellulose membrane 2 is adhered to the thin plastic
plate 115 with an adhesive before the agarose gem membrane 1 is
formed, the wells 5 can be formed on the glass substrate
transparent to the converging light beam by removing the thin
plastic plate 115 with the agarose gem membrane 1 formed thereon
from the substrate 100. However, another technique is required when
the cellulose membrane 2 is placed on a top surface of the
structural body 101 and held by the thin plastic plate 115. Also
another technique is required for forming a groove to be prepared
after the cell culture is started.
[0517] As described above, when wells 5 can not be formed on the
glass substrate transparent to the converging light beams, a
converging light beams with the wavelength, absorption of which by
water can substantially be ignored, (for instance a converging
light beam with the wavelength of 1064 nm) is used. When the
converging light beams with the wavelength, absorption of which by
water can substantially be ignored, is employed, even if the light
beams is irradiated onto the agarose gel membrane 1, the agarose
gel membrane 1 can not absorb the light beams and convert the
energy to heat, so that the agarose gel membrane 1 can not be
processed. To overcome this problem, the light beam is irradiated
to a micro needle functioning as a transducer to convert energy of
the converging light beam to heat, and the agarose gel membrane 1
is processed by making use of this heat.
[0518] FIG. 58 is a schematic view illustrating an outline of the
system for converting a converging light beam to heat with a
micro-needle and processing the agarose gel membrane 1 with the
heat. A micro-chamber for cell culture integrated with a thin
plastic plate 115 having a glass substrate 3, the structural body
101, the cellulose membrane 2 and the agarose gel membrane 1 formed
thereon is put in a chamber (not shown) containing a culture medium
and is placed on a stage 59. The stage 59 is driven in any of
directions X and Y by a driving device 35 operating according to a
drive signal from the personal computer 41. The reference numeral
31 indicates camera which is, for instance, a CCD camera, and picks
up images of a processed surface of the agarose gel membrane 1 via
lenses 32, 33. In this step, a light source 34 is prepared, a light
beam is introduced through a half mirror 35 provided between the
lenses 32, 33 and irradiated in the direction indicated by an arrow
36. The light beam may directly be irradiated from above the
micro-chamber for cell culture without using the half mirror 35.
The reference numeral 41 indicates a so-called personal computer,
which stores therein necessary programs, receives information
concerning a surface to be processed from the camera 31, and also
receives an operation-related signal 42 from a user. Although not
shown in the figure, a display unit is provided on the personal
computer 41, and an image of the surface to be processed from the
camera 31 is displayed thereon.
[0519] The reference numeral 120 indicates a micro-needle used to
process the agarose gel membrane 1. A laser beam 121 is focused by
a lens 122 and irradiated as a converging light beam to the
micro-needle 120. The micro-needle 120 is made from, for instance,
silicon or carbon, and a diameter of a tip section thereof should
preferably 2 .mu.m. The laser beam 121 with the wavelength of 1064
nm is irradiated through the lens 122 onto a tip section of the
micro-needle. Then a temperature of the tip portion of the
micro-needle 120 rises, so that the agarose gel membrane 1 can be
melted. An agarose gel in a necessary range can be melted and
removed by moving the stage 59 in the directions X and Y, while
monitoring the processed surface of the agarose gel membrane 1.
[0520] The micro-needle 120 can be separated upward from the
processed surface of the agarose gel membrane 1 according to a
user's instruction via the personal computer 41. When the
micro-needle 120 is separated in the upward direction, irradiation
of the converging light beam 121 should preferably be stopped. When
a user forms one well 5 monitoring the processed surface of the
agarose gel membrane 1 with the micro-needle 120 and converging
light beam 121, the user gives an instruction to move the
micro-needle 120 in the upward direction to the personal computer
41, when the instruction to move the micro-needle 120 in the upward
direction is given to an up-down driving device 47 of the
micro-needle 120, so that the micro-needle 120 moves in the upward
direction and goes off from the processed surface of the agarose
gel membrane 1. A chain line 48 indicates coordination between an
up/down movement device 47 and the micro-needle 120. In the state
where the micro-needle 120 has been separated from the processed
surface of the agarose gel membrane 1, the user gives an
instruction for movement of the stage 59 to the personal computer
41 to form the next well 5. In response to this instruction, the
personal computer 41 gives a drive signal to the driving device 37,
thus the stage 59 being driven.
[0521] The user monitors a tip of the micro-needle 120 and stops
the stage 59 when the tip of the micro-needle 120 reaches a
position at which the next well 5 is to be formed. At the new
position, the micro-needle 120 is moved downward as described
above, and the converging light beam 121 is irradiated to form the
next well 5.
[0522] FIG. 59 is a schematic view showing an outline of the
situation in which a groove between the wells 5 on the agarose gel
membrane 1 is formed during cell culture. FIG. 59 schematically
shows the situation in which a groove 11-3 between the wells 5
shown in FIG. 55 is being formed. The micro-chamber for cell
culture integrated with the thin plastic plate 115 with the glass
substrate 3, the structural body 101 made from SU8, the cellulose
membrane 2, and the agarose gel membrane 1 formed thereon is
described with reference to FIG. 57 (B). An operator is required
only to engrave the groove 11-3 from one side of the adjoining well
5 with the micro-needle 120 and converting light beam 121. With the
method as described above, regardless of a type of the substrate on
which the agarose gel is placed, a desired cell circuit can be
formed by connected selected cell culture wells according to a
specified order.
[0523] In Example 2, as understood from FIG. 57(A), tubes 117, 118
of the micro-chamber for cell culture integrated with the thin
plastic plate 115 with the glass substrate 3, the structural body
101 made from SU8, the cellulose membrane, and agarose gel membrane
1 formed thereon can be inserted into the space 104 through which a
solution can be introduced into or exhausted from the rhombus pool
102 formed in the structural body 101 made from SU8 through
openings 116, 111. Therefore, the cellulose membrane 2 can
efficiently be decomposed by pouring cellulose from the contrary
side of the agarose gel membrane 1 via the tubes 117, 118 and
directly contacting the cellulose to the cellulose membrane 2, and
also the culture medium can easily be exchanged with a new one or
any additive can be added to or removed from the medium during cell
culture.
(Others)
[0524] In the examples above, the micro-chamber for cell culture is
described as a completed one in any case. However, the
micro-chamber for cell culture is required only to allow for
placement of a cell or the like in the cell culture zone 5 and
formation of a groove or grooves by a researcher using the
micro-chamber. Therefore, for instance, in Example 1, it is
practical to provide the gel membrane 1 formed with the
semipermeable membrane (cellulose membrane) 2 and agarose or
agarose derivative formed thereon, or the gel membrane with cell
culture zones 5 formed thereof is provided as a market product. In
this case, a researcher or other persons having purchased the
product places the product on an appropriate glass substrate,
prepares a culture fluid, puts in a cell or the like in each of the
cell culture zones 5, and forms a groove during cell culture.
[0525] Also in Example 2, it is practical to provide an assembly
prepared by adhering the cellulose membrane 2 to the thin plastic
plate 115 with adhesive and also forming a agarose gel membrane in
an area of the thin plastic plate 115 for forming the agarose gel
membrane 1, or an assembly prepared by forming cell culture zones 5
on the gel membrane as a market product. Further a structural body
101 with a plurality of beams 103 for forming a rhombus pool 102
through which a solution such as a culture medium flows and also
functioning support materials for the agarose gel membrane 1 and
the tubes 117, 118 may be provided as a kit for cell culture
micro-chamber. In this case, a researcher or other persons prepares
a culture fluid, puts a cell or the like in the cell culture zone
5, and forms a groove between wells during cell culture.
[XII] Twelfth Embodiment
[0526] A twelfth embodiment of the present invention discloses,
like in the ninth embodiment, a structure in which a network
consisting of a minimum number of cells with a plurality of
heterogeneous cells interacting therein on a chip for measuring
change in responses of the cell network to a stimulus controlling
the network consisting of a small number of heterogeneous cell.
Example 1
[0527] FIG. 60 is a plan view schematically showing an example of a
cardiac muscle cell bioassay chip in Example 1 of the twelfth
embodiment of the present invention. FIG. 61 is a cross-sectional
view showing the bioassay chip shown in FIG. 60 taken along the
line A-A and viewed in the direction indicated by the arrow. The
cardiac muscle cell is not shown now. The reference numeral 1
indicates a substrate, and all constructs are provided on the
substrate 1. The reference numeral 2 indicates a cardiac muscle
cell holding zone, and a plurality of zones 2 are regularly formed
thereon. The reference numeral 3 indicates a groove or a tunnel,
which connected adjoining cardiac muscle cell holding zones 2 to
each other. The cardiac muscle cells extend the projections through
the groove or tunnel 3 to contact each other and form a gap
junction. The reference numeral 100 indicates an agarose gel, which
is formed on the substrate 1, and the cardiac muscle cell holding
zones 2, the groove or tunnel 3 connecting the zones 2 to each
other are formed by partially removing the agarose gel 100. The
reference numerals 4-1, 4-2 indicate electrodes respectively, and
the electrode 4-1 is provided in all of the groove or tunnel 3,
while the electrode 4-2 is provided in all of the cardiac muscle
cell holding zones 2. The electrode 4 comprises a transparent
electrode (ITO) and is adhered by deposition on a surface of the
substrate 1. The reference numeral 5 indicates an external
terminal, and is provided around the substrate 1 at a position
corresponding to and close to the electrode 4. The reference
numeral 6 indicates wiring, which connects the electrode 4 to the
external terminal 5. The wiring 6 is not shown in FIG. 61 for
simplification. The electrode 4 and wiring 6 have the thickness of
about 100 nm, and is made from transparent ITO. The reference
numeral 1-1 indicates a wall provided on the substrate 1, which
defines and holds a peripheral section of the agarose gel 100. The
reference numeral 9 indicates a semipermeable membrane, which is
provided and adhered to a top surface of the agarose gel 100 with
the cardiac muscle cell holding zones 2 and the groove or tunnel 3
communicating the zones 2 to each other formed thereon. The
reference numeral 22 is an upper housing, which covers the entire
top surface of the agarose gel 100 and is provided on the
semipermeable membrane 9 with a proper space in-between. The
reference numeral 22-1 indicates a fall section of the upper
housing 22. The reference numeral 21 is a culture fluid bath formed
between the semipermeable membrane 9 and the upper housing 22. The
reference numeral 23 indicates an opening provided on the upper
housing 22, and a culture fluid is supplied through this opening
into the culture fluid bath 21. The reference numeral 14 indicates
a common electrode, which is provided in the culture fluid bath 21.
Because the culture fluid is supplied to cells held in the cardiac
muscle cell holding zones 2 through the semipermeable membrane 9,
which prevents change in conditions during culturing.
[0528] As for the procedure for preparing the structure, at first
the electrode 4, wiring 6, and terminal 5 are formed on the
substrate 1, and then the wall 1-1 is adhered to the substrate 1,
and hot-melted agarose 100 is poured into the wall 1-1. The 2%
agarose gel (with the melting point of 65.degree. C.) is heated and
melted in an microwave oven. The melted agarose solution is added
to inside of the external wall 1-1 of the substrate 1 heated to
65.degree. C., and is immediately spread into a sheet with the
homogeneous thickness with a spin coater. An addition rate of the
agarose gel and a rotational speed of the spin coater are added so
that the agarose gel membrane with the thickness in the range from
0.05 mm to 0.5 mm will be obtained. Although the required thickness
varies according to a device or a lot of the agarose gel, a good
result is obtained with the operating conditions of 50 rpm for 15
seconds, and 200 rpm for 10 seconds. When left in a moistening box
for 1 hour at 25.degree. C. At this point of time, the agarose gel
membrane is formed on the entire inner surface of the external wall
1-1 of the substrate 1. Then, for forming the cardiac muscle cell
holding zones 2 on the agarose gel 100, the agarose gel 100 is
formed, and then portions corresponding to the cardiac muscle cell
holding zones 2 are removed. The portions can easily be removed by
using a laser beams in the wavelength band adapted for absorption
by water (for instance, 1480 nm).
[0529] FIG. 61 is a cross-sectional view showing a cardiac muscle
cell bioassay chip with an agarose-made electrode on which the
cardiac muscle cell holding zones 2 have been formed, and this
cross-sectional view also schematically shows an optical system and
a control system used for preparing the groove or tunnel on the
agarose gel 100. A cellulose membrane (with the molecular weight
cut off of 30,000 Daltons) is used as the semipermeable membrane 9
on a top surface of the agarose gel 100. For instance, heated and
melted agarose gel is applied on a surface of the cellulose
membrane with a spin coater, and an agarose film is formed on one
surface thereof. After cells are put in the cardiac muscle cell
holding zone 2 respectively, the cellulose membrane previously
prepared as described above is placed the agarose gel 100 so that a
surface of the cellulose membrane with agarose applied thereon
contacts the agarose gel 100. Alternatively, when the agarose gel
100 is formed, a small quantity of streptoavidin conjugated agarose
is added for solidification. Streptoavidin is exposed on a surface
of the agarose gel derivative. Further alternatively, biotin
hydradide is reacted to a cellulose membrane with an aldehyde group
introduced therein by oxidization with periodic acid, and a
biotin-modified cellulose membrane is prepared by reducing the
reaction product above by hydroboration reaction. By fixing the
agarose gel derivative and biotin-modified cellulose membrane to
each other with the biotin-avidin reaction, a structural body with
a cell shielded in the agarose-made structural body can be formed.
The peripheral portion of the cellulose membrane may also be
adhered outside the wall 1-1 and on the substrate 1 by the
biotin-avidin reaction. Namely, because the cellulose membrane is
biotin-modified, streptoavidin may be fixed to the wall 1-1 and to
a surface of the substrate 1 at an outer side from the wall 1-1.
For fixing streptoavidin, for instance, a glycidoxy group is
introduced into the substrate by the silane coupling reaction so
that the glycidoxy group will directly react with an amino group of
streptavidin, or aminosilane is introduced into the substrate and a
the aminosilane and an amino group of streptoavidin is bridged with
a bifunctional reagent. Further the fall section 22-1 of the upper
housing 22 may be adhered thereto.
[0530] A Laser 141 with the wavelength of 1480 nm adapted to
absorption by water is used for irradiation. The laser beam 142
passes through an expander 143, and passes through a filter 144
which reflects IR rays with the wavelength of 740 nm or more but
allows for transmission of the light with the wavelength of 1480 nm
(.+-.20 nm), further passes through a deposition filter which
allows for passage of light with the wavelength of 700 nm or more,
and is focused by a conversing lens 146 on a top surface of the
substrate 1. The converged light beam with the wavelength of 1480
nm is absorbed by water contained in the agarose layer, and the
temperature rises up to a degree near the boiling point. With the
laser power is 20 mW, the agarose is melted with a line width of
about 20 .mu.m near the section irradiated by the converging light
beam, and is removed by thermal convection. The problem is that
amplitude of the converging light beam changes absorbed by agarose
according to whether the electrode is present on the substrate 1 or
not. To solve the problem as described above, in the present
embodiment, a contrivance is introduced so that a temperature
caused by irradiation of a converging light beams can be controlled
by controlling a laser power by means of feedback control based on
estimation of a temperature of the agarose gel. The converging
light beam having reached the agarose section is converted to heat
and generates IR rays. The IR rays pass through the filter 145, are
reflected by the filter 144, and reach an IR ray camera 160-1.
Image data picked up by the IR camera 160-1 is fetched into a
computing device with a video recording mechanism 161, and the
temperature is estimated based on amplitude of detected light,
which is used for adjusting a power of the laser 141. When it is
difficult to control the temperature only by adjusting the laser
power, a moving velocity of the stage 164 is controlled according
to an output from the computing device so that a temperature of
agarose in the section irradiated by the converging light beam is
kept at a constant level. Namely, a rotational speed of the
stepping motor 162 is controlled by the computing device 161, and a
torque of the stepping motor is delivered by the driving force
delivering device 163 to the stage 164.
[0531] The substrate 1 is set on the stage 164, and the groove or
tunnel 3 can freely be formed on the agarose gel. An ITO-made
transparent electrode 4-1 is previously formed in each groove or
tunnel 3. Further to monitor beat of the cardiac muscle or the
progress of agarose engineering, also an optical system for
detecting transmitted light from a light source 170 is also
incorporated therein. The light from the light source 170 passes
through the transparent upper housing 22, also passes through the
object lens 146 being scattered in the agarose section, and is
fetched by a deposition filter (mirror) reflecting visible light
and a CCD camera 160-2 as an image. The image data is sent to the
computing device 161, overlapped with the image taken by the IR
camera 160-1, and the synthesized image is used for checking
temperature-raised portions by laser irradiation and a pattern on
the structural body. Namely the system can measure beat of cardiac
muscle using both or either one of a microscope and the
electrode.
[0532] A top surface of the agarose gel 100 forms the culture fluid
bath 21, and a culture fluid fed from the opening 23 is always
circulating therein. Further by adding various types of chemical
substances such as those stimulating cells or endocrine disrupting
chemicals can be added from the opening 23, and a beating state of
the cardiac muscle can be monitored with the electrode or with a
microscope. In this step, observation with a microscope is employed
for bioassay of an ionic substance which may affect a result of
measurement with the electrode, while observation with the
electrode is employed for bioassay of a substance such as a
coloring matter not suited to observation with a microscope.
[0533] Main dimensions of the cardiac muscle cell bioassay shown in
FIG. 60 are as shown below. The size of the cardiac muscle cell
holding zone 2 is 30 .mu.m.times.30 .mu.m with the depth in the
range from 0.05 mm to 0.5 mm which is the same as that of the
agarose gel 100. A distance between the adjoining cardiac muscle
cell holding zones 2 is 50 .mu.m, and the tunnel 3 communicating
the adjoining cardiac muscle cell holding zones 2 has the height in
the range from 50 .mu.m to 300 .mu.m and the depth of 5 .mu.m. When
the height of the tunnel 3 is 50 .mu.m and thickness of the agarose
gel 100 is 0.05 mm, the tunnel is not a tunnel, but a groove. There
are several methods available for placing a cell in each of the
cardiac muscle cell holding zones 2. For instance, there is the
method in which a micro-capillary is inserted to capture a cell
with a tip thereof and the cell is removed into the cardiac muscle
cell holding zone 2. There is another method available for the same
purpose in which a droplet containing cells is dropped onto a top
surface of a region for the cardiac muscle cell holding zone 2 and
agarose gel 100, and the top surface of the region is slid so that
an odd liquid is extruded therefrom to set the cell in the cardiac
muscle cell holding zone 2. In the latter case, the size of the
cardiac muscle cell holding zone 2 is required to be substantially
the same as that of the cell.
[0534] Because two electrodes are provided in each cardiac muscle
cell holding zone and in one groove or tunnel 3, so that
fluctuation of an electric potential in the cardiac muscle cell can
easily be captured. Each electrode is connected with the wiring 6
to the terminal 5, so that electric measurement can be carried out
by each single electrode or a pair of the electrodes.
[0535] FIG. 62 is a view showing an image taken by a transmission
microscope and showing the state where cardiac muscle cells are
accommodated in all zones on the cardiac muscle cell chip in
Example 1. This microscopic image shown in FIG. 61 shows a result
of observation of light irradiated from the cardiac muscle cell
chip and transmitting therethrough with the CCD camera 160-2. The
IR laser 140 or IR camera 160-1 is not used in this observation. It
is needless to say that the observation can be made with an
assembly in which the CCD camera 160-2 is attached to an inverted
microscope. The reference numeral 32 indicates the cardiac muscle
cell holding zone 2, which is the same as that indicated by the
reference numeral 2 in FIG. 60. The reference numeral 33 indicates
a groove or a tunnel, which corresponds to the tunnel 3 shown in
FIG. 60 and FIG. 61. In FIG. 62 (photograph), cardiac muscle cells
34 are previously set in all of the cardiac muscle cell holding
zones 32, and the cells extend the projections through the tunnel
33 to contact each other and form a gap junction. Namely the cells
contact each other in this state.
Example 2
[0536] In Example 2 of this embodiment, descriptions are provided
for a result of examination on a number of cells required for
configuring a network of pulsating myocardial cells as a cardiac
muscle cell bioassay chip.
[0537] With the cardiac muscle cell bioassay chip shown in FIG. 60
and FIG. 61, a network consisting of up to nine oscillating
myocardial cells can be formed by placing a oscillating myocardial
cell in each of the cardiac muscle cell holding zones. In this
case, an electric potential or transfer imaging of a cardiac muscle
cell while beating, which was described with reference to FIG.
49(A) and FIG. 49(B), are obtained, and a similar analysis result
can be obtained.
[0538] FIG. 63 is a view plotted by accommodating a oscillating
myocardial cell in each of 1, 3, 4, 8 and 9 cardiac muscle cell
holding zones respectively, measuring a beat interval of each cell
64 times to obtain CV (a value obtained by dividing the standard
deviation by the average value). Plots 61, 62, 63, 64, and 65 are
CVs for beat interval measurement values measured with 1, 3, 4, 8
and 9 pulsating myocardial cells respectively, and the curve 62 is
a curve obtained by supplementing sections between the plots. It
was found that sometimes dispersion of beat may reach even 50% in a
case of a single oscillating myocardial cell, but that the beat
dispersion lowers when the oscillating myocardial cells form a
network. When a number of oscillating myocardial cells forming a
network is eight or more, the dispersion in beat drops to about
10%, which indicates that the cells beat in the stable state.
[0539] This result suggests that bioassay data with high
reproducibility can be obtained by performing a bioassay with a
network consisting of eight or more pulsating myocardial cells. A
number of cells at a cross point between a string passing through
dispersed points obtained with one and three cells and those
obtained with eight and ten cells is four. From this point, it can
be guessed that, when a network consists of four or more cells,
dispersion of beat intervals drops to a substantially constant
value.
[0540] When the number of cells is too large, dispersion in beat
interval is more stabilized, but other negative factors increase in
association with increase of a number of cells, which is not
preferable. For instance, it is possible to prepare a bioassay chip
consisting of 1000 cells, but the obtained result indicates only an
average as described in the description of the background
technology, and responses of each cell to a medical agent can not
be obtained accurately, which is disadvantageous. Further when the
number of cells forming network increases, also the number of
electrodes and other components increase, which disadvantageously
leads to increase in cost for preparing a chip or cost for a
measuring device, and further a longer time is required for
preparing the bioassay chip, which is also disadvantageous. Up to
32 cells are sufficient for bioassay.
[0541] As for arrangement of pulsating myocardial cells in the
cardiac muscle cell bioassay chip and the number of cells therein,
when viewed from the view point of the necessity to build up an
environment similar to that for cells in a living organism, the
space should be as compact as possible, or should be as close to a
square as possible. Therefore, when the number of cells is four,
the number of cardiac muscle cell holding zones should be
2.times.2, and when the number of cells is 32, the number of
cardiac muscle cell holding zones should be 6.times.6 with four
cells at four corners removed. Namely it is preferable that the
number of cells for forming a cardiac muscle cell network is in the
range from 4 to 32. For obtaining more accurate data with small
dispersion, it is preferable to form a cardiac muscle cell network
with cells in the range from 8 to 32.
[0542] Descriptions are provides below for a procedure to carry out
bioassay with a cardiac muscle cell bioassay chip with a cardiac
muscle cell accommodated in each of eight cardiac muscle cell
holding zones.
[0543] An additive to be measured is put in the culture fluid bath
21 shown in FIG. 61, monitoring an electric signal between each
electrode 4-1 or 4-2 and the common electrode 14 shown in FIG. 61,
or measuring change in brightness of each oscillating myocardial
cell by monitoring the microscopic images. An interval 52 between
beat signals 51 generated in each cell is measured as a beat cycle.
With an additive not affecting a cell, no change is observed in the
beat cycle. With an additive affecting a cell, the beat cycle
fluctuates. An electrode used for monitoring the electric signal
may be either the electrode 4-1 or the electrode 4-2 in the cardiac
muscle cell holding zone, but when it is necessary to monitor beat
of each cell, it is better to use the electrode in the cardiac
muscle cell holding zone 2.
[0544] The beat cycle data obtained with the cardiac muscle cell
bioassay chip according to the twelfth embodiment has a dispersion
of 10% or below, and therefore, if the data values fluctuate by 20%
or more as 2SD (a value indicating a range of twice of standard
deviation), it can be determined that there are actual influences.
With a single cell, the dispersion is 50%, unless the beat cycle
fluctuates, it can not be determined that there is any influence by
the additive. Therefore, when the cardiac muscle cell bioassay chip
based on a cardiac muscle cell network consisting of eight or more
cells, there is provided the merit that influences by the additive
can be measured with high precision. On the other hand, in a
bioassay using a large number of cells, a concentration of an
additive against each discrete cell drops, and dispersion due to
differences in the characteristics between cell groups becomes
larger, which is disadvantageous.
Example 3
[0545] Example 3 shows a case where a cardiac muscle cell bioassay
chip is formed with a glass substrate. In this case, size of each
cardiac muscle cell holding zone has a diameter of 30 .mu.m and the
depth of 20 .mu.m, and the cardiac muscle cell holding zones are
prepared with a pitch of 50 .mu.m on the glass substrate 1 by
etching, and also a groove with the width of 5 .mu.m and depth of
10 .mu.m is formed between adjoining cardiac muscle cell holding
zones. An amino group is introduced into a surface of the glass
substrate by means of the silane coupling reaction, and further a
carboxylic group is introduced into the amino group by reacting
succinic anhydride, and this carboxylic group and streptoavidin are
bonded to each other by condensation with water-soluble
carbodiimide. A cell is inserted into each cardiac muscle cell
holding zone 2 with a capillary pipet, and each zone may be covered
with biotinated cellulose membrane. An upper circulation bath 21
similar to that shown in FIG. 61 is attached thereon to prepare a
structure in which a fluid in the upper circulation bath is always
circulated or a reagent for assay is added therein.
Example 4
[0546] FIG. 64 is a cross-sectional view showing the cardiac muscle
cell bioassay chip in Example 4 and shown in FIG. 61. As clearly
understood by comparing FIG. 64 to FIG. 61, the cardiac muscle cell
bioassay chip in Example 4 is the same as that in Example 1
excluding the point that the circulation bath 21 is divided to
three sections by setting a partition for three cardiac muscle cell
holding zones which are perpendicular to a view plane. As described
above, the circulation bath 21 is divided to three sections each
consisting of three cardiac muscle cell holding zones. In this
configuration, different solutions may be circulated in the three
sections respectively, and therefore measurement of myocardial
oscillation may be performed, for instance, by adding a bioassay
reagent only in the middle circulation zone and filling an ordinary
buffer liquid (culture fluid) in other upper circulation zones. In
this figure, the opening 23 provided on the upper housing 22 are
shown side by side for convenience, but it is needless to say that
the openings should be provided in the three cardiac muscle cell
holding zones perpendicular to the view plane respectively so that
each solution can be circulated more smoothly.
[0547] By measuring oscillation of cardiac muscle by adding a
reagent for bioassay only in the middle circulation bath and also
flowing an ordinary buffer liquid (culture fluid) in other upper
circulation baths, disturbance of a beat synchronization signals
from the adjoining cells can easily be measured. Namely, in
addition to the direct cytotoxity when a medical chemical is
administered, the effect over the inter-cellular community can be
measured, and therefore the effects which have been expressed with
subjective expressions such as "physical conditions are good or not
good when a medicine is drunk" may be expressed with digital
values.
(Others)
[0548] As described in Example 3, a communication route between
adjoining cardiac muscle cell holding zones in the cardiac muscle
cell bioassay chip according to the twelfth embodiment is not
limited to a tunnel, and may be a groove.
[0549] As for the potentials in industrial utilization of the
cardiac muscle cell bioassay chip according to the twelfth
embodiment, various possibilities are conceivable from the
viewpoint of utilization thereof by researchers or in
pharmaceutical companies and from the viewpoints of utilization by
manufacturers supplying cardiac muscle cell bioassay chips. From
the user's point of view, the chip should preferably be supplied in
the state where cardiac muscle cells have been accommodated in the
cardiac muscle cell holding zones respectively to form a cardiac
muscle cell network. However, the cardiac muscle cells accommodated
in the cardiac muscle cell holding zones can not live for a long
time in the state as described above, a manufacturer/supplier of
bioassay chips preferably supplies chips each with the duration of
effective use limited to a short period of time. Alternatively the
bioassay may be separated to a portion including the substrate 1,
electrodes and related portions 4, terminals 5, wiring 6 and
agarose gel 100 on the substrate 1, and to a portion including the
semipermeable membrane 9 and upper housing 22, and a set comprising
these two portions may be supplied as a kit. When the bioassay chip
is supplied as a set (kit), the user must be responsible for
accommodation of a cardiac muscle cell into a cardiac muscle cell
holding zone and assembly of the kit.
[0550] (E) Now descriptions are provided for a device and a method
for obtaining information from cultured cells and those formed into
a network.
[XIII] Thirteenth Embodiment
[0551] In a thirteenth embodiment of the present invention, a
method is described in which mRNA or proteins present in cytoplasm
are recovered without killing the cell and in-vitro analysis is
performed for the purpose to successively obtain information over
time from a single cell. In this method, a tip portion of a living
organism sampling chip with the tip diameter of 2 nm or below is
inserted into a cell to recover the contents. An oligo T for
hanging up the mRNA is fixed to the tip portion of the living
organism sampling chip. Alternatively, a tip portion of the living
organism sampling chip is partitioned into several areas in the
sagittal direction, and the oligo based on two to four different
sequences is fixed to the 3' terminal side of the oligo T, and the
mRNA is preparatively isolated being classified by the two to four
bases adjoining the poly A.
[0552] As a probe used in this step, PNA or synthetic
polynucleotide not having any minus electric charge like PNA is
used. For the ordinary polynucleotide based on the phosphodiester
bond is easily decomposed by endonuclease in a cell and the proving
sequence portion of the mRNA is easily blocked due to holding. When
a specific protein is to be analyzed, the RNA aptomer or DNA
aptomer to specific protein groups described in the third
embodiment is fixed to a tip of the living organism sampling chip,
and the conjugate is used to hang up the specific protein.
[0553] When a tip of the living organism sampling chip is inserted
into a cell, for reducing physical damages to the cell, a diameter
of the tip portion (inserted into the cell) should be 1/5 of the
cell size or below. Further the tip portion should previously be
coated with titanium oxide TiO.sub.2. Alternatively the entire tip
portion inserted into the cell may be coated with arginine in place
of titanium oxide TiO.sub.2 to facilitate interactions with
phospholipids in the cell membrane on a surface of a cell and also
to facilitate smooth insertion of the tip portion of the living
organism sampling chip. If necessary, the entire portion inserted
into a cell is coated with arginine, and only the tip portion is
coated with titanium oxide TiO.sub.2.
[0554] In this embodiment, a tip portion of the living organism
sampling chip is inserted into a cell, and then the tip portion of
the living organism sampling chip with an object for measurement on
a surface of the prove tip is pulled off from the cell, and a
quantity of the specified substance captured on a surface thereof
is measured. In this step, at first the specific substance is
bonded to nanoparticles by using the so-called sandwich reaction.
By scanning the nanoparticles remaining on a surface of the tip
portion of the living organism sampling chip with a scanning
microscope, an amount of the recovered substance is quantitatively
measured. Alternatively, the nanoparticles remaining on a surface
of the tip portion of the living organism sampling chip is measured
with an atomic force microscope.
Example 1
[0555] FIG. 65 is a flow chart showing an operation flow in the
method of recovering and analyzing organic substances in a cell
according to the thirteen embodiment shown in FIG. 65, while FIG.
66(A) is an enlarged view schematically showing a living organism
sampling chip tip portion 3, and FIG. 66(B) is a perspective view
schematically showing the entire image of the living organism
sampling chip according to the thirteenth embodiment.
[0556] In FIG. 65, the reference numeral 1 indicates a cell, while
the reference numeral 2 is a nucleus of the cell 1. The reference
numeral 3 is a tip portion of the living organism sampling chip
according to the thirteenth embodiment. The living organism
sampling chip tip portion 3 has a diameter with the size of about
1/5 of the size of cell 1, and is a sharp needle. The reference
numeral 5 is titanium oxide TiO.sub.2 coated on the living organism
sampling chip tip portion 3, while the reference numeral 6 is
ultra-violet rays with the wavelength of 335 nm, and irradiated to
the living organism sampling chip tip portion 3 when inserted into
the cell 1. By irradiating the ultra-violet rays with the
wavelength of 335 nm to the living organism sampling chip tip
portion 3 when inserting into the cell 1, the tip portion 3 can
easily be inserted into the cell 1 due to the organic material
decomposing action of the titanium oxide TiO.sub.2 use for coating.
When prematured mRNA or core protein is to be analyzed, the living
organism sampling chip tip portion 3 is inserted into a core 2 of
the cell 1.
[0557] The living organism sample obtained with the living sample
chip tip portion 3 is washed after the living organism sampling
chip tip portion 3 is pulled off from the cell 1, and is labeled
with gold nanoparticles. Then the sample is again washed and dried,
and then measurement is performed. The arrow 4 indicates that the
living organism sampling chip tip portion 3 is moved up and down
against the cell during the operation.
[0558] As shown in FIG. 66(A), the probe 21 is fixed to the probe
area 22 of the living organism sampling chip tip portion 3. The
probe 21 is a substance having affinity to an intracellular
biological material to be recovered. Size of the probe area 22 may
be decided by taking into consideration the cell's size, and is at
most 10 .mu.m, and 4 .mu.m at the root of the probe area 22. The
living organism sampling chip tip portion 3 is coated with titanium
oxide TiO.sub.2 5. As described above, the living organism sampling
chip tip portion 3 is extremely small. To make treatment thereof
easier, as shown in FIG. 66(B), the living organism sampling chip
tip portion 3 according to the thirteenth embodiment has a living
organism sampling chip tip portion holder 8, and the holder 8 is
connected to the operation board 7. A diameter of the holder 8 is,
for instance, 1 m m.phi., while size of the operation board 7 is 4
mm.times.5 mm. The cell 1 is placed under an object lens of a
microscope and the living organism sampling chip tip portion 3 is
inserted into the cell by operating the operating section
supporting the operation board 7, so that the operation can be
performed in the stable condition with safety. Further, even when
measurement is performed with an SEM or an AMF, the living organism
sampling chip tip portion 3 can be operation with the operating
section supporting the operation board 7.
[0559] In Example 1, descriptions are provided for a case in which
the living organism sampling chip tip portion 3 is inserted into a
cell from a tissue sample of colon cancer and a specific mRNA
present in the cell is analyzed. A 5-base random sequence oligo DNA
conjugated to the 3' terminal of a 26-base poly T is used as the
probe 21. This conjugate is used as the probe, because only the
poly T is insufficient for achieving stability in mRNA
hybridization. The probe 21 is made of PNA (peptide nucleic acid)
for easy interaction with the mRNA in the cell. Different from the
ordinary DNA, the PNA does not have a minus electric charge
originated from the phosphodiester bond, and therefore an
electrostatic repelling force does not work with a DNA as a
target.
[0560] Because of the feature, when the probe area 22 of the living
organism sampling chip tip portion 3 is inserted into a cell, the
probe 21 efficiently hybridizes the specific mRNA present in the
cell, which is advantageous. Also, repulsion force is not generated
between phospholipid and the living organism sampling chip tip
portion 3, the tip portion 3 can be inserted into the cell membrane
smoothly. In a case where the probe 21 is tightly fixed to a solid
phase surface of the probe area 22 like in Example 1, if an
ordinary DNA is used as the probe 21, the target DNA is required to
move toward the probe 21 overcoming a barrier of minus electric
charge generated by the probe area 22, which is disadvantageous
from the both viewpoints of chemical kinetics and thermodynamics.
Also the target mRNA is required to be a single chain, but is
actually three-dimensionally held in a molecule, and therefore
sometimes a probing site, to which the probe conjugates, may be
blocked.
[0561] When a probe not having minus electric charge like PNA is
used, an electric charge of the probe itself can be eliminated, so
that a barrier of minus electric charge is not generated by the
probe area 22, and because of the feature, the speed and yield in
hybridization can be improved. Further the PNA having no electric
charge does not generate an electrostatic repelling force, so that
the prove can competitively creep into the target DNA even when the
target DNA is double-stranded to achieve competitive
hybridization.
[0562] Further also the cell membrane is covered with negatively
charged phospholipids, and therefore if a surface of the living
organism sampling chip tip portion is negatively charged, a
repulsion force works between the living organism sampling chip tip
portion and the cell, so that insertion of the living organism
sampling chip tip portion into the cell becomes difficult. In
contrast, the living organism sampling chip tip portion with a PNA
probe fixed thereto can easily be inserted into a cell.
[0563] The living organism sampling chip tip portion 3 is inserted
into the cell 1, and the probe area 22 is left in the cell for 30
seconds. Then the living organism sampling chip tip portion 3 is
pulled off from the cell 1, and is immediately washed with
2.times.SSC. Then a second probe labeled with gold nanoparticles
with the diameter of 8.3 nm is hybridized with the mRNA hybridized
to the probe 21 in the probe area 22. In this step, an oligo PNA
having a specific sequence is used as the second probe. PNA is used
for the same reason as that described above. For instance, the
28-base sequence specific to EpCAM, which is reportedly expressed a
lot in epithelial cell cancer, is used. The conjugate is again
washed and cleaned with deionized water. In Example 1, because the
PNA probe is used, the hybridized probe is never de-hybridized even
when washed with deionized water.
[0564] When the ordinary DNA is used as the second probe, the
hybridization is substantially affected by a dielectric constant of
a solvent due to the repulsion force between the molecules
generated by minus charge in the phosphodiester bond. Therefore,
hybridization can not be achieved unless decreasing the repulsion
force between the phosphoric acid groups at a high concentration of
salt. The double-stranded bond becomes lose in deionized water, and
when the ordinary oligonucleotide structure is used in a complex of
oligo A and oligo T like in Example 1, it is difficult to maintain
a stable double-stranded structure. In Example 1, PNA is used as
the second probe, the electrostatic repelling force does not work
between the probe and the mRNA as a sample. Because of the feature,
the double-stranded structure of RNA and PNA hybridized to each
other can be preserved in the stable state even in deionized
water.
[0565] Then the gold nanoparticles labeling the second probe are
dried to fix the particles on a surface of the probe area 22 of the
living organism sampling chip tip portion 3. Because the Brownian
motion of the gold nanoparticles occurs in the liquid phase state,
and in that case, for instance, precision of measurement with an
AFM drops, and observation by an SEM is impossible. By observing
the probe area 22 of the dried living organism sampling chip tip
portion 3 with an SEM or an AFM, the number of gold nanoparticles
captured on a surface of the probe area 22 is counted. The number
of gold nanoparticles captured on a surface of the probe 22 depends
on a quantity of mRNAs captured on the surface of the probe area
22, and the quantity of mRNAs captured on the surface of the probe
area 22 depends on a quantity of mRNAs hanged up from inside of the
cell with the probe 21 in the probe area 22, and therefore the
quantity correlates to a quantity of mRNAs present around a
position of the cell into which the living organism sampling chip
tip portion 3 is inserted.
[0566] With the method described above, a quantity of mRNAs of
EpCAM in a cell can be measured without killing the cell.
[0567] FIG. 67 is a view showing quantitative comparison among
quantities of EpCAM which can be obtained from the cell in a cancer
focus in a colon cancer tissue sample and from each of adjoining
cells. In this case, the living organism sampling chip tip portion
3 is inserted into the colon cancer tissue sample changing the
inserting positions by and by and also exchanging the living
organism sampling chip tip portion 3 with a new one to assess a
quantity of EpCAM expressed at each position. From this assessment,
it can be understood that there are a highly EpCAM-expressing cell
group 31 and a not-highly EpCAM-expressing cell group 32, and that
the two groups are bordered by a specific cell. It can be guessed
that the portion with a high EpCAM expression rate is a group of
cancer cells and the portion with a low EpCAM expression rate is a
group of noncancerous cells.
Example 2
[0568] In Example 2, descriptions are provided for a case in which
PNA having different sequences labeled with gold nanoparticles
having different diameters is used as the second probe in Example
1, and a plurality of different mRNAs captured on a surface of the
probe area 22 are simultaneously detected.
[0569] FIG. 68 is a schematic view showing the situation in which a
plurality of PNAs each having a different sequence respectively and
labeled with gold nanoparticles having different diameters are
being hybridized to the probe 21 fixed on a surface of the probe
area 22 of the living organism sampling chip tip portion 3.
[0570] Like in Example 1, the 5-base random sequence DNA probe 21
is fixed to the 3' terminal of the 26-base poly T on the surface of
the probe are 22 of the living organism sampling chip top portion
3. Also line in Example 1, the living organism sampling chip tip
portion 3 is inserted to the cell 1 to hand up the mRNA with the
probe 21 of the probe area 22 from a cell in a tissue sample of
colon cancer, and the mRNA is cleaned.
[0571] As shown in FIG. 68, second probes having different
sequences respectively and labeled with the gold nanoparticles 26,
27, and 28 having different diameters respectively are being
hybridized to the plurality of mRNAs 25-1, 25-2, and 25-3
hybridized to the probe 21 on the probe area 22 of the living
organism sampling chip tip portion 3. The reference numeral 25 in
FIG. 68 indicates a plurality of mRNAs being hybridized to the
probe 21, but has not been hybridized to the second probe. Gold
nanoparticles 26 with the diameter of 8.3 nm and gold nanoparticles
27 with the diameter of 11 nm, and gold nanoparticles 28 with the
diameter of 17 nm are conjugated to 5' terminal of oligo PNA
(28-base) having the EpCAM sequence and PNA probe sequences
including 26 bases and 29 bases corresponding to the CD 44 and CEA
mRNA sequences which are reportedly expressed a lot in a cancer
cell, and the conjugates are used each as the second probe. The
reference numerals 25-1, 25-2, and 25-3 are the captured mRNA
sample pieces for EpCAM, CD44, and CEA.
[0572] Like in Example 1, measurement of quantities of the three
types of mRNAs included in the cells near the cancer focus cell
provides the result as shown in FIG. 67 for EpCAM and CEA, but all
of the sample cells give values of about 250 molecules/living
organism sampling chip tip portion for CD44, and therefore a
substantial difference is not observed. There is a report in
relation to the CD44 that splicing variants are generated in the
colon cancer, but a total quantity of mRNA for the CD44 may not
change. The probe sequence used for CD44 is that in exon present at
the closest position to the poly-A tail, and there is the
possibility that the exon is used in any splicing variant, the
detail is still unknown.
Example 3
[0573] In Example 3, the probe area 22 of the living organism
sampling chip tip portion 3 is divided to a plurality of areas in
the longitudinal direction, and different probes are fixed to the
areas respectively.
[0574] FIG. 69(A) is a schematic view showing the state in which
the probe 22 of the living organism sampling chip tip portion 3 is
divided to five areas 41, 42, 43, 49, and 50 along the longitudinal
direction (the areas 49 and 50 are present in the rear side and
therefore are not shown in FIG. 69(A)) and the probes 44, 45, and
46 are fixed to the surfaces of the areas. FIG. 69(B) is a
cross-sectional view showing the living organism sampling chip tip
portion 3 shown in FIG. 69(A) taken along the line A-A and viewed
in the direction indicated by the arrow.
[0575] Complementary sequences extending over a final exon and that
just ahead in each of EpCAM, CD44, and CEA (having the lengths of
28, 26, and 29 bases respectively) is fixed to each of the areas
41, 42, and 43. The area 49 is used as a negative control, and
nothing is fixed thereto. The area 50 is used as a positive
control, and TTTT-T and base T each having the 26-base length are
fixed thereto. For fixing the sequences, a glycidoxy group is
introduced into a surface of the living organism sampling chip tip
portion 3 by means of the silane coupling reaction, and PNA having
an amino group is fixed to the 5' terminal. The probe area is
divided to a plurality of subareas and different types of PNA are
fixed to the subareas by suspending the PNAs to be fixed in DMSO,
applying the suspension onto a support piece having a sharp tip
like that of the living organism sampling chip tip portion 3, and
smoothly sliding a tip portion of the support piece only a surface
of each discrete zone of the probe area 22 of the living organism
sampling chip tip portion 3. By setting the living organism
sampling chip tip portion 3 with the surface having the suspension
applied thereon downward and heating the surface for five minutes
at 50.degree. C., the probes can be fixed. After drying, another
probe is fixed to another surface thereof. With the operations as
described above, different probes can be fixed to the four
different surfaces respectively.
[0576] When there are provided a plurality of surfaces to which
different probes are fixed thereon as in Example 3, specific living
biological materials are captured on each surface respectively,
which ensures higher precision in measurement.
Example 4
[0577] In Example 4, arginine is fixed to the probe area 22 of the
living organism sampling chip tip portion 3.
[0578] FIG. 70 is a view schematically showing the living organism
sampling chip tip portion 3 in Example 4. Arginine 48 is fixed, in
addition to the probe 21, to a surface of the probe area 22. The
fixed arginine may be a single amino acid, and also the length of
up to an octamer is allowable. The arginine is added to a solution
to which the PNA is fixed at the molar ratio of 1/40, and the
solution is homogeneously applied on the entire living organism
sampling chip tip portion 3.
[0579] The method of fixing the probe is as described below. At
first 0.5% aqueous solution of
.gamma.-glycidoxypropyltrimethoxysilane (with acetic acid added
therein by 0.5% or until the silane coupling agent is dissolved) is
left for 30 minutes at the room temperature (25.degree. C.) to
hydrolyze the methoxy group, thus active silanol group being
generated.
[0580] The living organism sampling chip tip portion 3 made from
silicon and having an oxide film on a surface thereof is immersed
into the activated silane coupling agent, and left in the state for
one hour. Then rinsing is performed with deionized water for five
seconds. At this point of time, a silanole group in the silane
coupling agent reacts to a silanole group on a surface of the
silicon oxide to form a partially dehydrated compound. Further a
silanole group in the silane coupling agent and oxygen on a surface
of the silicon oxide form a compound by hydrogen bond. The compound
formed through the hydrogen bond is in the metastable state. This
mixture is heated for 30 minutes in the air at the temperature in
the range from 105 to 110.degree. C. With this operation,
dehydrating condensation between the silanol group in the silane
coupling agent and oxygen molecules on a surface of silicon is
completed. Further dehydrating condensation proceeds between the
silane coupling agents present on the silicon surface. Finally the
glycidoxypropyl group is introduced into the silicon surface. A
portion of the atomic group constituting the glycidoxy group is an
epoxy group having high reactivity to an amino group. PNA having
the amino group with the concentration of 50 pmol/.mu.l is reacted
to 1.25 .mu.M L-Arg or arginine oligomer ((L-Arg) (n: 2 to 8)) (SEQ
ID NO: 15) are reacted to each other in the aqueous solution with
pH 10 for one hour at 50.degree. C. With this reaction, the PNC
fixed living organism sampling chip tip portion with arginine
partially fixed thereto can be obtained.
[0581] The living organism sampling chip tip portion 3 prepared in
Example 4 can be inserted into a cell with a slight force
substantially not requiring support of the cell. Because of this
feature, the living organism sampling chip tip portion 3 can
relatively easily be inserted into not only the tissue cells
described in Examples 1 to 3, but to a floating cell under
incubation. By using a sequence originated from the mRNA of EpCAM
is used to PNA, the substantially same result as that obtained in
Example 1 can be obtained.
[0582] In Example 4, no comment is provided for the necessity that
the living organism sampling chip tip portion 3 is coated with
titanium oxide TiO.sub.2 5, and when the coating with titanium
oxide TiO.sub.2 5, the living organism sampling chip tip portion 3
can be inserted into the cell 1 more easily.
[XIV] Fourteenth Embodiment
[0583] In a fourteenth embodiment of the present invention, a
method is disclosed in which mRNAs, DNA or proteins can easily and
instantly be taken out from a living cell several times for
analysis without killing the cell. In this method, in order to
obtain contents of a cell keeping the cell alive, a needle having a
tip diameter substantially smaller than a cell is inserted into the
cell to have the contents deposited on the needle's tip for
sampling the contents.
[0584] To obtain mRNA, an oligo T is fixed as a probe to the
needle's tip for sampling mRNA. Alternatively, an oligo including
two to about four different sequences is fixed to the 3' terminal
of the oligo T to ensure stability in hybridization between the
mRNA and poly A, and the conjugate is used as a probe. Because
polynucleotide having the phosphodiester bond is easily decomposed
by endonuclease in a cell, and also for the purpose to prevent the
probing sequence portion of mRNA, which easily causes holding, from
being blocked, PNA or synthetic polynucleotide not having minus
electric charge like the PNA is used as a probe in this step.
[0585] To obtain a particular protein, an antibody fixed on the
needle's tip is used for sampling the particular protein. The Fc
moiety of the antibody may non-selectively absorb substances other
than a target substance, so F (ab').sub.2 not including the Fc
moiety is used as a probe. Alternatively, a molecule having the
avidity such as the RNA aptamer or DNA aptamer like an antibody is
used.
[0586] When a needle is inserted into a cell, to minimize physical
damages to the cell, a diameter of the needle's tip (a portion
inserted into a cell) should be 1/5 of the cell size or below.
Further a region 5 coated with titanium oxide TiO.sub.2 is provided
on the living organism sampling chip tip portion 3. Alternatively,
a tip portion of the needle is coated with arginine to facilitate
interactions with phospholipids in a cell membrane of a surface of
the cell so that the needle can smoothly be inserted into the cell.
In a case of arginine, about 6 arginine monomer molecules should
preferably be present in a narrow area. Alternatively, oligo
arginine may be used in the fixed state.
[0587] The particular biological material captured on a surface of
the needle is sampled by pulling off the needle from the cell, and
when the sample is mRNA, the needle is immersed in the PCR reaction
solution as it is to amplify and obtain a specific sequence portion
of the particular mRNA. Alternatively, the mRNA is once reversely
transcribed to obtain the cDNA, and then the particular gene may be
subjected to PCR amplification. In a case of a protein,
amplification is impossible, so that the sample is used as it is,
and in this case measurement of q quantity of a particular
substance in a cell can be made most effectively.
Example 1
[0588] FIG. 71 is a view showing outline of a flow of operations
for sampling mRNA which is an intracellular biological material in
Example 1. Configuration of a tip portion of a needle used in
Example 1 is the same as that shown in FIG. 66.
[0589] In FIG. 71, designated at the reference numeral 1 is a cell,
at 2 a cell core, at 3 a tip portion of the needle, at 4 a vessel,
and at 5 a reaction liquid for PCR method. As shown in FIG. 66(A),
the probe 21 is fixed to the tip portion 22 of the needle 3. The
needle 3 is supported by the base section 7 via the support section
8 as shown in FIG. 66(B). The tip portion of the needle 3 is
extremely small. To facilitate treatment of this needle, the tip
portion of the needle 3 has a holder 8, and the holder 8 is
connected to an operation board 7. A diameter of the holder 8 is,
for instance, 1 mm.phi., and size of the operation board 7 is 4
mm.times.5 mm.
[0590] In Example 1, descriptions are made for a method of
inserting a needle into a colon cancer cell for sampling particular
mRNA present in the cell. 5-base length random sequence oligo DNA
conjugated to the 3'-terminal of 26-base length poly T is used as
the probe 21. The probe 21 is made of PNA (peptide nucleic acid) to
facilitate interactions with mRNA in a cell. Further, there is
provided a region 5 with TiO.sub.2 coated thereon, and therefore
when the living organism sampling chip tip portion 3 is inserted
into the cell 1, UV ray with the wavelength of 335 nm is irradiated
so that the living organism sampling chip tip portion 3 can easily
be inserted into the cell 1 because of organic material decomposing
reaction of the titanium oxide 5 coated thereon.
[0591] As shown in step 1), the needle 3 with the tip portion
having a diameter of 1/5 or below of size of a cell is inserted
into the cell 1 as a target from which an intracellular biological
material is sampled. For sampling premature mRNA or a nucleic
protein, the needle 3 is inserted into the core 2. The needle 3 is
kept in the state for 30 seconds.
[0592] In step 2), the needle 3 is pulled off from the cell 1.
[0593] In step 3), the tip portion 22 of the needle 3 is washed
with 2.times.SSC immediately.
[0594] In step 4), particular mRNA among those capture by the probe
21 on the tip portion 22 of the needle 3 is amplified. A 2 .mu.l
reaction liquid 5 including a primer pair corresponding to the
particular mRNA, heat-resistant DNA polymerase, dNTP which is a
matrix for polymerase, Mg, and pH9 Tris buffer solution is
contained in a vessel 4. 2 .mu.l mineral oil is poured onto a top
surface of the reaction liquid to prevent evaporation thereof
during the operation.
[0595] In Example 1, the sequence segment specific to the Homo
sapiences tumor-associated calcium signal transducer 1 (TACSTD1) is
amplified. TACSTD1 is mRNA with the full length of 1528 bp which is
reportedly expressed a lot when an epithelial cell cancer occurs.
As for the mRNA sequence of human TACSTD1, refer to HUGO Gene
Normenclature Committee, "SLC new solute carrier superfamily
proposed members (SLC) HGNC approved", "HGNC Gene Grouping/Family
Nomenclature", [online], HUGO [searched on Aug. 1, 2004], Internet
<URL:
http://www.gene.ucl.ac.uk/nomenclature/genefamily.shtml>.
[0596] Synthetic oligo DNAs having the sequences SEQ No. 1 and SEQ
No. 2 respectively (concentration: 0.2 pmol/.mu.l) are employed as
primers, and PCR amplification is formed by the known method. PCR
is repeated 35 times with the cycle of denaturing for 5 seconds at
94.degree. C., annealing for 10 seconds at 55.degree. C. and then
for 10 seconds at 72.degree. C. A quantity of reaction liquid is 2
.mu.l as described above. The solution obtained by PCR
amplification is analyzed with Hitach i-chip (micro electrophoresis
chip) and Cosmo-i chip electrophoresis device. As a result, a
substantially single electrophoresis separation band is obtained at
the position of 230 bp. The base length of the PCR product
estimated from the database is 233 bp.
TABLE-US-00007 CTGAGCGAGT GAGAACCTAC TG (SEQ ID NO: 1) AGCCACATCA
GCTATGTCCA (SEQ ID NO: 2)
[0597] Then the steps 1) to 4) are repeated in 16 hours to the cell
into which the needle is inserted first for sampling mRNA and
amplifying the mRNA by PCR. When the needle is inserted into the
same cell, the needle 3 used first is to be exchanged with a new
one, for preventing contamination.
[0598] The mRNA obtained by the second insertion of needle is
subjected to amplification with a primer having another sequence
segment from the same human TACSTD1. This primer is formed with the
sequences SEQ No. 3 and SEQ No. 4 respectively.
TABLE-US-00008 GTATGAGAAG GCTGAGATAA AGG: (SEQ ID NO: 3) AGCTGCTTAT
ATTTTGAGTA CAGG: SEQ ID NO: 4)
[0599] To carry out PCR amplification, a cycle of denaturing for 5
seconds at 94.degree. C., annealing for 10 seconds at 52.degree. C.
and then 10 seconds at 72.degree. C. is repeated 35 times.
[0600] Like in a case of the mRNA obtained by the first insertion
of needle, the solution obtained by the PCR amplification is
analyzed with Hitach i-chip (micro electrophoresis chip) and
Cosmo-i chip electrophoresis device. As a result, a single
electrophoresis separation band of 215 bp is obtained. The base
length computed from the sequence is 216 bp. Any band is not
observed at the position of 230 bp of the solution obtained by PCR
amplification of the mRNA obtained by the first insertion of
needle.
[0601] This fact indicates that the cell is still alive in 16 hours
after the first needle insertion. In other words, if the cell 1 is
killed when the needle is inserted first, mRNA is immediately
decomposed by RNase in cytoplasm, and therefore the mRNA can not be
amplified. In this Example 1, the mRNA sampled by the second needle
insertion can be amplified by PCR, which indicates that the cell 1
is not killed when the needle is inserted first into the cell
1.
Example 2
[0602] In Example 2, descriptions are provided for a case in which
mRNA is taken out from a living cell by inserting a needle into the
cell once, and then a plurality of cDNAs are obtained from the
mRNA. In this example, mRNA is sampled with the needle 3 with the
PNA-made probe 21 like in Example 1.
[0603] FIG. 72 is a view showing an example of a needle 43 used in
Example 2. Like in Example 1, in addition to the probe 21,
TiO.sub.2 is fixed to a region 9 at a tip portion of the needle 43,
and further arginine 48 is added thereto. The fixed arginine may be
one amino acid molecule, or an amino acid sequence with the length
of up to an octamer. Arginine is added to a solution to be fixed to
PNA at the molar ratio of 1/40, and is homogeneously coated on the
entire needle. Configuration of a support section of the needle 43
is not shown, but is the same as that shown in FIG. 66(B).
[0604] The method of fixing the probe 21 and arginine is the same
as that described in Example 4 of the thirteenth embodiment.
[0605] When the needle 43 prepared in Example 2 is used, the needle
43 can be inserted into the cell 1 with a force requiring
substantially no force for supporting the cell 1. Because of the
feature, the needle can relatively easily be inserted, not only
into a tissue cell, but also into a floating cell.
[0606] FIG. 73 is a view showing outline of a method of sampling
mRNA which is an intracellular biological material in Example
2.
[0607] In step 1), the needle 43 is inserted into the living cell
1, and is kept in this state for 30 seconds.
[0608] In step 2), the needle 43 is pulled off from the cell 1.
[0609] In step 3), the needle 43 is immediately washed in a
solution with RNase inhibitor contained therein. The matter having
been hybridized to a surface of the needle 43 is conceivably poly
A-RNA.
[0610] Step 4) is a step of obtaining a 1.sup.st strand cDNA.
Because the complementary poly T, which is the probe 21, is fixed
to a surface of the needle 43, when a complementary chain is
synthesized with a reverse transcriptase in this state, the
complementary chain is synthesized at poly T as the base. Then
RNase H is reacted to decompose the RNA chain, thus the 1.sup.st
strand cDNA being obtained.
[0611] In step 5), the first PCR amplification is carried out. In
Example 2, a first pair of primers having the sequence SEQ No. 1
and sequence SEQ No. 2 corresponding to the human TACSTD1 used in
Example 1 respectively and a second pair of primers having the
sequence SEQ No. 3 and sequence SEQ No. 4 are prepared in vessels
44-1 and 44-2.
[0612] In the first PCR amplification, the needle 43 is inserted
into a vessel 44-1 containing a PCR solution 45 including a first
pair of primers having the sequence SEQ No. 1 and sequence SEQ No.
2 respectively, and PCR is carried out. The conditions for reaction
are the same as those in Example 1.
[0613] In step 6), the needle 43 is pulled off from the vessel
44-1, and is fully washed.
[0614] In step 7), the second PCR amplification is carried out. In
the second PCR amplification, the needle 43 is inserted into a
vessel 44-2 containing a PCR solution 46 including a second pair of
primers having the sequence SEQ No. 3 and sequence SEQ No. 4
respectively, and PCR is carried out. The conditions for reaction
are the same as those in Example 1.
[0615] After completion of the second PCR, the solutions obtained
by the respective PCR amplifications and stored in the vessels 44-1
and 44-2 are analyzed with Hitachi i-chip (micro electrophoresis
chip) and Cosmo-i chip electrophoresis device. A signal
electrophoresis separation band with 230 bp length is detected from
the solution obtained after the first PCR amplification and stored
in the vessel 44-1, while a single band with 215 bp length is
detected from the solution obtained after the second PCR
amplification and stored in the vessel 44-2.
[0616] The process 50 from the steps 5 to 7 can be carried out in
repetition to the 1.sup.st strand cDNA obtained in the step 4 and
stored in the vessel containing a PCR solution prepared
properly.
[0617] In Example 2, mRNA can easily be sampled from a living cell,
and cDNA from the mRNA hybridized to the needle tip can be
synthesized in the fixed state. Because the mRNA is preserved as a
library on a surface of the needle, and therefore a target sequence
segment of a target gene can be obtained by means of PCR. The
needle with the mRNA library fixed in the form of cDNA can be
preserved for a long time, and therefore a transcription product
obtained when the needle is inserted into the cell can be preserved
as a master library.
Example 3
[0618] In Example 3, descriptions are provided for a case in which
a needle with an antibody having affinity to a particular protein
fixed thereon is used to sample the particular substance. FIG.
74(A) is a view showing a needle tip portion 53 which can be
employed in Example 3, while FIG. 74(B) is a perspective view
illustrating general configuration of a needle which may be
employed in Example 3.
[0619] The polyclonal anti-mitochondria antibody separated from the
human mitochondria membrane and having sensitivity to rabbit is
used as an antibody in this example. This antibody reacts to a
plurality of proteins or sugar chain antigens in mitochondria.
[0620] The needle with the anti-human mitochondria body fixed on
the needle tip portion 53 is prepared as described below. At first,
an SH group is introduced into the F(ab').sub.2 fragment obtained
by subjecting the antibody to papain decomposition. A number of SH
groups introduced as described above is 3 to 4 molecules per one
F(ab').sub.2 molecule. Then the needle tip portion 53 is subjected
to silane coupling processing to previously introduce an amino
group into the surface thereof. Then 0.5%
N-(.beta.-aminoethyl)-.gamma.-aminopropyltrimethoxysilane aqueous
solution is left for 30 minutes at the room temperature to obtain
an activated silane coupling solution. A silicon-made needle with
the surface oxidized is immersed in the solution and left in the
state for one hour. After the needle tip portion 53 is rinsed with
deionized water, the needle tip portion 53 is dried in the air at a
temperature in the range from 105 to 110.degree. C. With this
operation, an amino group fixed by covalent bond to a surface of
the needle tip portion 53 is obtained.
[0621] Then N-(maleimidoundecanoyl)sulfosuccinimide, which is a
bivalent reagent having a succinimide residue in on side and a
maleimide residue in the other side, is reacted to the sample above
for 30 minutes at the room temperature at pH 8. 0.1 M
anti-oxidation buffer solution, pH 8.5 is used. After rinsing,
F(ab').sub.2 with SH group having been introduced therein is
reacted for one hour at the room temperature at pH 6.5. 0.1M sodium
phosphate buffer solution, pH 6.5 is used as a buffer solution. The
obtained needle with F(ab').sub.2 fixed thereon is preserved in PBS
containing 5% trehalose (pH 7.4). FIG. 74(A) schematically shows
the situation in which the F(ab').sub.2 is fixed on an area 52 of a
surface of the needle tip portion 53. As shown in FIG. 74(B), the
needle tip portion 53 with the F(ab').sub.2 fixed thereon is
supported by the support section 8 and is jointed to the based
section 7.
[0622] In the state where the needle tip portion 53 is jointed to
the base section 7, the needle tip portion 53 with the F(ab').sub.2
fixed thereon is inserted into cytoplasm and then the needle tip
portion 53 is pulled off. When the needle is pulled off observing
the situation with an object lens with the resolution of 100 times,
sometimes the situation is observed in which mitochondria comes
near the needle and moves together with the needle. The needle tip
portion 53 is mildly rinsed. The substances remaining on the
surface is eluted with 3M guanidine, and the eluate may be used for
analysis of proteins or mRNAs included therein.
[XV] Fifteenth Embodiment
[0623] A fifteenth embodiment of the present invention discloses a
method and a device for sampling matured mRNA from a living cell
without giving substantial damages.
[0624] FIG. 75 is a schematic diagram showing a processing flow for
sampling matured mRNA in Example 1 of the fifteenth embodiment.
Example 1
[0625] Step 1 in the figure is a preparation process, and the
figure shows the situation in which a living cell as a target from
which mRNA is to be sampled and a capillary of an mRNA sampling
device are set in a view field of a microscope. Designated at the
reference numeral 1 is a cell (herein a cell having a nuclear like
that of a human, a mouse, or a plant), at 2 a cytoplasm, at 3 a
cell nuclear, and at 4 a nuclear membrane separating the cytoplasm
from the nuclear. The reference numeral 5 indicates a capillary,
and a diameter of a tip 7 (a portion to be inserted into a cell) is
1/5 of the cell size or below to reduce physical damages to the
cell. The capillary 5 is set to a tool 8 allowing for movement
thereof in the X- and Y-axial directions and also allowing for
change of an angle of the tip. Further a buffer generally used for
cell culture is filled inside the capillary. The tool 8 is attached
to a driving device 9 driven by water pressure. Water pressure is
used for delivery of a driving force from the driving device 9 to
the tool 8. Further a micro syringe pump 10 is attached to the
capillary 5, and a positive pressure state or a negative pressure
state can be realized inside the capillary.
[0626] Although not shown, to prevent damages to the cell 1, the
cell 1 and a tip portion of the capillary 5 are placed in a droplet
of a buffer generally used for cell culture and formed on an
observation glass plate provided in the view field of the
microscope. Therefore all of the operations described below are
performed in the droplet.
[0627] As shown in step 2 in the figure, a cell membrane of the
target cell 1 is broken with the tip 7 of the capillary 5 visually
checking with a microscope.
[0628] Then in step 3, the capillary tip 7 is contacted to the cell
membrane 4 visually checking the situation with a microscope. As
indicated by the reference numeral 11, when it is recognized that
capillary tip 7 has contacted the nuclear membrane 4, the capillary
tip 7 is tightly pressed to the nuclear membrane 4. In this step,
the driving device 9 should be operated carefully not to break the
nuclear membrane 4. Then the micro syringe pump is driven to
generate a negative pressure in the capillary 5. What is important
in this step is a degree of negative pressure generated by the
micro syringe pump. Sucking is performed with a pressure not
breaking the nuclear membrane 4, but the operation should be
performed carefully taking into consideration a type of a state of
the cell monitoring with a microscope. With the careful operations
as described above, tight contact between the capillary tip and the
nuclear membrane is preserved. In this state, the capillary tip is
kept in contact to the nuclear membrane for a prespecified period
of time (for instance for 5 minutes) and sucking is performed. Then
inside of the capillary 5 is restored to the normal pressure, and
the capillary is quietly pulled off from the cell 1.
[0629] Then in step 4, a peripheral surface of the capillary is
quickly washed with 15 mM NaOH and then with water to remove
nucleic acid components or protein components deposited on the
peripheral surface of the capillary 5.
[0630] Then an internal fluid in the capillary 5 conceivably
containing mRNA having passed through the nuclear membrane 4 is
exhausted into a well 12 on a 384 well micro plate.
[0631] With the operations described above, the mRNA having passed
through the nuclear membrane 4 can be obtained.
[0632] FIG. 76 is a view showing outline of a process for
converting, of the mRNAs obtained through the steps 1 to 5 shown in
FIG. 75, those having the substantially full length to cDNA. The
reaction employed for this process is that described in Y. Suzuki,
K. Y. Nagayama, K. Murayama, A. Suyama, and S. Sugano, Gene 200,
146-156 (1997), and the reaction was slightly modified. Namely, in
Example 1, it is conceivable that an amount of sampled mRNA is
sub-picograms or below, a protocol for treating the ordinary mRNA
at the scale of micrograms is not applicable to this process.
Therefore, it is effective to minimize the reaction volume to the
limit, and the process is performed based on this concept.
[0633] At first, shown in step A in the figure is a structure of
mRAN 14 contained in the internal fluid of the capillary 5 obtained
in step 5 and poured into the well 12 on the micro plate.
Immediately 0.1 unit tobacco acid pyrophosphatase is reacted to the
internal fluid in the capillary 5 (step B). The reaction is
continued for 30 minutes in a 50 mM sodium acetate buffer solution
(pH 5.5) containing 1 mM EDTA, 5 mM 2-melcaptoethanol and 1 unit of
RNase which is a RNase inhibitor. The reaction volume is 0.5 .mu.l
In this processing, a cap structure 15 of mRNA 14 is removed, and
mRNA 17 with the 5' terminal phosphorylated is obtained.
[0634] Then RNA ligase (10 units) is used against the mRNA 17 to
obtain modified mRNA 19 with adaptor sequence 18 having been
introduced therein (step C). The adaptor sequence is, for
instance,
TABLE-US-00009 (SEQ ID NO: 5)
5'-AGCAUCGAGUCGGCCUUGUUGGCCUACUGG-3':.
The reaction is performed in 5 mM 50 mM tris hydrochloric acid
(Tris-HCl) buffer solution (pH 7.5) containing 5 mM MGCl.sub.2 and
2-melcaptoethanol, 2 mM ATP, 25% PRG8000, and 1 unit of RNasin for
16 hours. The reaction volume is 5 .mu.l. Then oligo DNA
primer-added magnetic beads including 5-base length random sequence
conjugated to 3' terminal of 26-base length poly T (T.sub.26)
(particle diameter: 2.1 .mu.m, amount of execution primer: 2 pml)
and a reverse transcription enzyme are added to execute reverse
transcription for 2 hours at 42.degree. C., thus a 1.sup.st strand
cDNA being synthesized (step D). The random sequence is used in
this step, because only poly T is insufficient for ensuring
stability in hybridization of mRNA.
[0635] Then the reaction products are washed with 15 mM NaOH, and
further the products are reacted in 15 mM NaOH for 10 minutes at
65.degree. C. to remove RNA. With the operations described above,
the 1.sup.st strand cDNA 20 is obtained. 2 pmol adaptor sequence
and 2 pmol random sequence-added poly T (T.sub.26) are added
according to the necessity to carry out PCR at 10 .mu.l scale to
obtain a double-stranded cDNA. When the random sequence poly T
(T.sub.26) without the magnetic beads added thereto is used, a
large amount of cDNA-amplified products can be obtained in the
solution. The cDNA obtained as described above is, in most cases, a
full length cDNA including the cap structure up to the poly A
sequence.
[0636] More specifically, in Example 1, mRNA passing through the
nuclear membrane of a colon cancer cell is obtained as described
below.
[0637] PCR amplification is carried out by using a portion of the
adaptor sequence:
TABLE-US-00010 (SEQ ID NO: 6) 5'-AGCATCGAGTCGGCCTTGTTG-3' (Tm =
69.degree. C.):
and a sequence specific to Homo sapiens tumor-associated calcium
signal transducer 1 (TACSTD1):
TABLE-US-00011 (SEQ ID NO: 16) 5'-AAGCCACATCAGCTATGTCCACA-3' (Tm =
66.degree. C.):
16) are used as primers against a mixture of single-stranded cDNA
conceivably having the substantially full length. When full-length
mRNA originated from TACSTD1 is included, it can be expected that a
PCR product having the length of about 850 bp is obtained.
[0638] The Tm was computed using the Internet site; Tm
Determination, Virtual Genome Center, prepared on 7 Aug. 1995,
http://alces.med.umn.edu/rawtm.html programmed according to the
method described in Breslauer et al., Proc. Nat. Acad. Sci. 83,
3746-50 (1986) and assuming the primer concentration of 200 nM and
salt concentration of 50 mM. The sequence information for the
TACSTD1 was searched using the mRNA code name NM.sub.--002354 from
a web side of National Center for Biotechnology Information
prepared by National Institute of Health (Revised: Jul. 16, 2004).
The actual PCR is performed at the initial scale of 10 .mu.l as
described above and at the primer concentration of 200 nM 15 times
with a reaction cycle of denaturing for 30 seconds at 94.degree.
C., annealing for 30 seconds at 60.degree. C. and polymerase
reaction for 2 minutes at 72.degree. C.
[0639] Then 1 .mu.l sample containing the amplification products is
added to 50 .mu.l of PCR reaction solution, and the mixture
solution is subjected to 2-stage PCR amplification 35 times under
the same conditions for reaction as those described above. The
solution obtained through the PCR amplification is analyzed with
i-chip (micro electrophoresis chip) obtainable from Hitachi
Hi-Technology and Cosmo-i chip electrophoresis unit.
[0640] As a result, a plurality of bands are detected, and the
electrophoretic separation band is observed at the position of 850
bp on one of the bands. This is the substantially same as the
base-length of mRNA estimated from the database. The position of
the primer on the sequence is complementary to the adaptor sequence
introduced to the 5' terminal of the full length mRNA as well as to
the segment from 796 to 818 bp on the mRNA sequence described in
the code name NM.sub.--002354. This segmental sequence is in exon
6. From the NCBI data base described above, it is known that mRNA
of the TACSTD1 has 1528-base length, which indicates that the
sequence segment covers a half or more of the mRNA closer to the 5'
terminal. A protocol for preparing a composition containing
polyether when subjected to reverse transcription is used, so that,
if the segment near the 5' terminal can be amplified like in
Example 1, it may be considered that the substantially full-length
cDNA has been obtained.
[0641] When contaminated with a precursor mRNA or a genome in the
nuclear, PCR should be performed with a primer corresponding to the
intron portion for determination. In this case, the amplification
is tried with the primer SEQ No. 7 and the intron sequence:
TABLE-US-00012 (SEQ ID NO: 8) AAGGAACAGTGATGCATGTAGATT (Tm =
61.degree. C.):
positioned between the exon 5 and exon 6. The two-stage
amplification was performed under the same conditions for PCR as
described above, any peak was not detected at a position around 211
bp expected from the database.
[0642] Based on the result as described above, it may be said that
the full length mRNA can efficiently be obtained by directly
recovering the mRNA passing through the nuclear membrane 4
according to the method in Example 1. When a nuclear as a whole is
grated, also precursor mRNA contained in the nuclear is recovered
simultaneously, but with the method in Example 1, the problem can
be evaded. Further, because the tip 7 of the capillary 5 only
contacts (is pressed to) the nuclear membrane 4, so that the cell
can be kept alive as it is. Further it is possible to pull off the
capillary 5 once from the cell and to again insert the capillary 5
into the cell after a prespecified period of time for obtaining
mRNA. The capability of obtaining mRNA without killing the cell is
advantageous.
Example 2
[0643] FIG. 77 is a schematic diagram showing the initial state
(step 1) of the process for obtaining matured mRNA in Example 2 of
this embodiment. FIG. 77 corresponds to step 1 shown in FIG. 75,
and as it is clearly understood from comparison between the two
figures, the cell 1 and capillary 5 are placed on an observation
glass plate 39 and also are included in a droplet 40. Further an
electrode 41 is provided in the capillary 5, and a conductor 42 is
connected to the electrode 41, and also an electrode 43 is placed
in cytoplasm 2 of the cell 1. A conductor 44 is electrically
insulated from the buffer droplet 40. Other steps in Example 2
corresponding to those in Example 1 are different only in addition
of electrodes and conductors, and therefore the steps are steps are
not shown.
[0644] In Example 2, the electrodes and conductors newly introduced
are very effective in step 3 described in Example 1. Namely, in
Example 1, the capillary tip 7 is only contacted to the nuclear
membrane 4 visually monitoring with a microscope, but in Example 2,
the electric conductivity between the electrode 41 and electrode 43
can be utilized, and therefore the electric conductivity can be
monitored during the steps of contacting and pressing the capillary
tip 7 to the nuclear membrane 4. Namely, while the tip 7 of the
capillary 5 is within the cytoplasm 2, the electric conductivity
between the electrode 41 and electrode 43 is extremely high (like
short-circuited), but when the tip 7 of the capillary 5 contacts
the nuclear membrane 4 of the cell 1, the electric conductivity
between the electrode 41 and electrode 43 becomes larger. When the
capillary tip 7 is tightly pressed to the nuclear membrane 4, the
electric conductivity becomes further larger.
[0645] Therefore, in Example 2, contact and adhesion of the tip 7
of the capillary 5 to the nuclear membrane 4 of the cell 1 can be
managed more easily by visually monitoring and controlling contact
of the tip 7 of the capillary 5 to the nuclear 4 of the cell 1 and
checking electric conductivity between the electrode 41 and
electrode 43.
[0646] Further the electrodes 41 and 43 can also be used for
sucking matured mRNA into the capillary 5. Namely, by setting the
electrode 41 in the positive state and electrode 43 in the negative
state and loading a voltage of about 10 V/cm to a section between
the two electrodes 41 and 43, the mRNA originally having a negative
charger can electrophoretically be sucked into the capillary 5. A
voltage of about several tens mV is loaded to the cell, and
sometimes the cell may be influenced, but mRNA can advantageously
be recovered within a short period of time.
Example 3
[0647] FIG. 78(a) to FIG. 78(c) are views each illustrating
configuration of a tip portion of the capillary 5 which may be used
in Example 1 or Example 2.
[0648] FIG. 78(a) shows a case where a partition 21 is provided
inside the capillary 5 up to a position near a tip of the capillary
5. With this configuration, a flow path 22-1 and a flow path 22-2
separated from each other with the partition 21 are formed in the
capillary 5. Therefore, when the micro syringe pump 10 is driven to
generate a negative pressure in the capillary 5 in step 3 for
sampling mRNA in the nuclear 3, the mRNA can be sampled by flowing
a solution in the capillary 5 from one flow path to another flow
path as indicated by the reference numeral 23. FIG. 78(b) shows a
case in which a second capillary 26 is inserted up to a position
near a tip of the capillary 5 to form a flow path 27-1 and a flow
path 27-2. In step 3, the micro syringe pump is driven to generate
a negative pressure in the capillary 5 for sampling mRNA in the
nuclear 3. In this case the mRNA can be sampled by flowing a
solution within the capillary from the outer flow oath to the inner
flow path as indicated by the reference numeral 28 using a gap in
the tip portion. The second capillary 26 is required only to be
inserted into the capillary 5, and is not required to be fixed. In
this state the effect as described is achieved.
[0649] The FIG. 78(c) is similar to FIG. 78(b), and shows a case in
which 5 capillaries 32-1 to 32-5 are provided in the capillary 5.
In this case, for instance, during a sucking operation for 5
minutes, each of the capillaries 32-2 to 32-4 is set in the
negative pressure state for one minute respectively for sucking,
and a buffer solution is supplied form the capillary 32-1. Other
capillaries are kept in the weak negative pressure state to
substantially suppress migration of the fluid. With this
configuration, mRNAs at different points of time are sucked into
the four capillaries respectively.
[0650] FIG. 79 is a view illustrating a contrivance for reducing
damages given to a cell during an operation of inserting the
capillary 5 into the cell.
[0651] FIG. 79(a) shows a case where a region 50 with titanium
oxide TiO.sub.2 fixed thereto is provided at a tip portion of the
capillary 5. With this configuration, when 335 nm UV ray is
irradiated during an operation for inserting the tip portion of the
capillary 5 into the cell 1, because of organic material
decomposing activity of the titanium oxide coated thereon, the tip
portion of the capillary 5 can easily be inserted into the cell 1
and damages given to the cell 1 are few. More specifically, the tip
of the capillary 5 is passed through the cell membrane irradiating
the US ray thereto. When the tip of the capillary 5 has passed
through the cell membrane and reached the cytoplasm, irradiation of
UV ray is stopped. Then the capillary tip is contacted to the
nuclear membrane. When the capillary tip is contacted to the
nuclear membrane, UV ray is not irradiated to prevent damages to
the nuclear membrane. When the tip has reached the nuclear
membrane, sucking is performed carefully as described in Example 1,
and the capillary tip is tightly pressed to the nuclear membrane.
The capillary tip is left in the state for 5 minutes to diffuse and
recover the mRNA passing through the nuclear membrane inside the
capillary 5.
[0652] FIG. 79(b) shows a case in which the region 50 with titanium
oxide TiO.sub.2 fixed thereto is provided at a tip portion of the
capillary 5 and further arginine 48 is fixed thereto. The arginine
fixed thereto may be one amino acid, or that having the length of
an octamer. For fixing arginine thereon, PNA (peptide nucleic acid)
is added to the solution to be fixed at the molar ratio of 1/40,
and the mixture solution is coated on the entire tip portion of the
capillary 5. Also in this case, 335 nm UV ray is irradiated when
the tip portion with TiO.sub.2 thereto passed through the cell
membrane. Then irradiation of UV ray is stopped, and the capillary
is further inserted into the cell until the tip portion reaches the
nuclear membrane. Because of the mutual reaction between the
arginine 48 and a phosphate base section in the lipid dual layer of
the cell membrane, the capillary can smoothly be inserted into the
cell.
[0653] It is needless to say that the tip portion of the capillary
5 described with reference to FIG. 79 may have the structure shown
in FIG. 78(a) to FIG. 78(c).
[0654] The effect is provided also when only arginine is fixed to
the tip portion of the capillary 5.
[XVI] Sixteenth Embodiment
[0655] A sixteenth embodiment discloses a novel technical means for
separating an extremely small number of molecules having activity
against a cell in a manner allowing a function of the cell to be
traced from the viewpoint of not only separating a biochemical
substance but also making the function of a cell clear.
[0656] The sixteenth embodiment is made by focusing on an
analytical means known as the patch clamping method originally
developed for researching a transporter and not having been related
to the separation of a biochemical material so far, and by
developing the means into a technique for separating a biochemical
material.
[0657] As the patch clamping method, the following three types are
generally used:
(1) the inside-out (the cytoplasm side of a cell membrane facing to
the outside of a glass tubule) type in which a glass tubule having
an opening with a tip thereof about 1 .mu.m in diameter is pressed
on a cell until electric resistance of the inside and outside of
the glass tubule reaches a level of giga ohm to prepare a desired
biochemical material; (2) the whole-cell type in which a glass
tubule sucks in while pressing a cell, and pierces a lipid bilayer
formed in the glass tubule to obtain the whole cell attached onto
the tip of the glass tubule; and (3) the outside-out (the outside
of cytoplasm facing to the outside of a glass tubule) type in
which, after forming the whole-cell type of a cell, the cell is
removed, leaving behind a lipid bilayer in the proximity of a glass
tubule, and an opening of the tubule is sealed making use of the
lipid bilayer remaining in the periphery of the tubule opening to
prepare a desired biochemical material.
[0658] The patch clamping method is a technique originally
developed to research a transporter and measuring mobility of ion
via a transporter as change in an electric current. Of the three
types of the patch claming method developed as an analytical means,
either type is means for preparation of a transporter itself with
an operation using a glass tubule, and thus, has not been at all
recognized as a device or technique for separating and preparation
a biochemical material.
[0659] The sixteenth embodiment is made to solve the problems
described above focusing attention on the patch clamping method. A
transporter present in a cell membrane, a nuclear membrane or a
mitochondrial membrane employed in the patch clamping method is
used for separating a biochemical material. A transporter refers to
a particular channel by which a specific chemical material passes
through a cell membrane or the like. Such a transporter generally
transports an amino acid including glutamic acid, oligopeptide
including dipeptide and tripeptide, and various low molecule
organic matters by making the materials pass through a cell
membrane.
[0660] Examples of a transporter suited for applying to the
sixteenth embodiment may be those listed in Table 1 described
above. Nevertheless, not all transporters present in all cells are
known, and actually, there is an orphan transporter whose existence
is predicted from a genome sequence, there is a case where a
transporter is unknown, and there are some substances capable of
climbing over a cell membrane to transfer in and out of the cell
without using a channel based on a concept as a specific
transporter such as arginine oligomer described in the
aforementioned Table 2. Therefore, the sixteenth embodiment can be
implemented, like the second embodiment described above, if it is
confirmed that there exists a function for transporting various
substances.
[0661] Samples actually contain a diversified range of substances,
and the types of the substances to be separated vary in many cases.
Separation can be achieved by using a functional separation
membrane including a transporter and employing a device with the
transporter fixed thereon for collecting a separated materials.
Alternatively, separation with a higher precision can be achieved
by using a plurality of transporters to separate biochemical
materials from a mixture sample, and more specifically, by
connecting in series the membranes with the transporters embedded
therein and separating biochemical material in stages. Medium in
the sample is transferred by dispersion, electrophoresis or
electro-osmotic flow, and a substance(s) having passed through the
membranes is collected. In a case when membranes with the
transporters embedded therein are connected in series to separate
biochemical material in stages, biochemical materials captured
between the adjoining membranes is collected. Alternatively, in the
configuration where an outlet is provided each between the
adjoining membranes, separation can be achieved by individually
collecting a solution at each of the outlets.
[0662] Separation at a molecular level can be achieved by limiting
an area of a membrane with a transporter embedded therein to
several hundreds of nm.sup.2 or less. Further, in this case, how
many molecules pass through a transporter can be confirmed by
measuring an electrical change in front and behind the
membrane.
Example 1
[0663] FIG. 80(a) is a cross-sectional view showing outline of a
method of preparing a biological material separation chip which can
be used for a biochemical material separator related to Example 1
of a sixteenth embodiment, and FIG. 80(b) is a cross-sectional view
schematically showing an example of a structure of the completed
biological material separation chip.
[0664] In FIG. 80, reference numeral 100 indicates a biological
material separation chip. Reference numeral 1 indicates a substrate
for a biological material separation chip, for instance, a silicon
substrate. Size of the substrate is, for instance, 5 mm in the
height direction in the figure, and 500 .mu.m in the vertical
direction in the same. Thickness of the substrate is, for instance,
100 .mu.m. Height of a projection 2 formed on an end of the
substrate 1 is, for instance, 5 .mu.m, while the thickness thereof
is, for instance, 2 .mu.m. On the top of the projection is formed a
pore 3. Size of the pore 3 is, for instance, 1.about.2 .mu.m.phi..
On the both sides of a lower portion of the substrate are formed
electrode layers 4, 5, and an insulating layer 6 is formed for
covering all over the electrode layer 4, after which an electrode
layer 7 is further formed thereon. The substrate 1 is created
making use of the semiconductor technology, outline of creating the
substrate 1 is described hereinafter with reference to FIG. 81.
[0665] The biological material separation chip 100 is completed
after taking a transporter of a cell in a portion of the pore 3
thereon. Processing of taking a transporter of a cell in a portion
of the pore 3 is described below.
[0666] Though not shown in the figure to avoid complications, the
substrate 1 and a cell 11 are provided opposing to each other in a
droplet of a buffer suitable for cell culture dropped down on an
observation glass plate for a microscope. In this step, while
observing with a microscope, a transporter 12 of the cell 11 is
positioned to face to the pore 3 on the projecting side of the
projection 2. It is to be noted that reference numeral 13 denotes a
lipid bilayer of the cell 11. Further, a capillary connected to a
microsyringe pump is temporarily attached to the concave portion
side of the projection 2, so that inside of the capillary can be in
the state of negative pressure. The buffer described above is
filled inside the capillary. In addition, an electrode is provided
inside the capillary, so that a lead wire connected to the
electrode is drawn out, while another electrode is provided in a
droplet portion, so that another lead wire connected to the
electrode is drawn out. The latter lead wire is electrically
isolated from the droplet of a buffer.
[0667] While observing with a microscope, a portion of the
transporter 12 of the cell 11 is contacted to the pore 3 on the
projection 2. In this step, while monitoring electrical
conductivity between the two electrodes described above, before a
portion of the transporter 12 of the cell 11 is contacted to the
pore 3, an electrode in the capillary and another electrode in the
droplet portion are short-circuited owing to a buffer, and by
contrast, after the contact, the two electrodes are substantially
isolated because the pore 3 is blocked off with the transporter 12
and the lipid bilayer 13 of the cell 11.
[0668] When it is confirmed by a visual observation with a
microscope and a sharp decline in electrical conductivity between
the two electrodes described above, a microsyringe pump connected
to a capillary temporarily attached to the concave portion side of
the projection 2 is operated, so that the inside of the capillary
turns into the state of negative pressure. The cell 11 is kept
being sucked at such a pressure as not piercing the lipid bilayer
13, and when the cell 11 is finally peeled off, a portion of the
lipid bilayer 13 including the transporter 12 is left behind, being
fixed onto the pore 3 on the projection 2. With this step, the
biological material separation chip 100 is completed with a
transporter of a cell taken in a portion of the pore 3 thereon, as
shown in FIG. 80(b). The chip having a transporter thereon shown in
FIG. 80(b) fixes the transporter in the form of inside-out.
Descriptions are provided later for the electrode layers 4, 5 and
electrode layer 7.
[0669] It should be understood that the completed biological
material separation chip 100 is preserved in a buffer suitable for
cell culture to avoid damages of the transporter fixed onto the
pore 3.
[0670] FIG. 81(a) to FIG. 81(g) are views each illustrating outline
of a process of forming a substrate 1 for a biological material
separation chip 100. In each of FIG. 81(a) to FIG. 81(g) are shown
a cross section on the left side and a plan view corresponding to
the cross section on the right side.
[0671] Firstly, as shown in FIG. 81(a), a silicon substrate having
a specified crystal axis is prepared, on one face of which is
provided a mask 21, and a window 22 is formed by removing the mask
22 in a position where a projection 3 is to be created. As shown in
FIG. 81(b), a portion corresponding to a quadrangular pyramid 23 is
removed with etching. Next, as shown in FIG. 81(c), the mask 21 is
removed, and a mask 24 is provided on another face of the silicon
substrate 1 to form a window by removing the mask 24 in a position
where a projection 3 is to be created, thereby concave sections 25,
26 each having a triangular cross section being formed. The concave
sections 25, 26 are, as seen from the plane view, concaved and
uninterrupted portions corresponding to the quadrangular pyramid
23. Then, as shown in FIG. 81(d), a window 28 is opened in a
position surrounded by the concave sections 25, 26 by providing a
mask 27. Next, as shown in FIG. 81(e), a pore 3 is opened in a
position corresponding to the substrate 1 making use of the window
28. In this step, a projection 2 is also formed in the periphery of
the concave sections 25, 26 on the substrate 1 by etching. Then, as
shown in FIG. 81(f), an electrode 4 is formed on a face having a
projection 2 on the substrate 1. The electrode 4 is made of an
aluminum-deposited layer. Next, as shown in FIG. 81(g), the whole
surface of the electrode 4 is covered with a polyimide insulating
layer 6, on which an electrode 7 is formed. The electrode 7 is made
of a platinum-deposited layer. After that, an electrode 5 is formed
on another face of the substrate 1. The electrode 5 is also made of
a platinum-deposited layer. Thus the formation of the substrate 1
for the biological material separation chip 100 is completed.
Though detailed data on the semiconductor technology is omitted
herein, those skilled in the art can easily implement the steps
described above.
[0672] FIG. 82 is a view illustrating an example of biological
material separation by a biological material separation chip 100
with a glucose transporter 12 fixed onto a pore 3 thereon. In this
case, a cell derived from cardiac muscle is employed as the cell 11
described in FIG. 80(a), and a lipid bilayer including a
transporter capable of transporting glucose is fixed onto the pore
3. The use of cardiac muscle enables to obtain the chip 100 with a
glucose transporter fixed thereon with a substantially high
probability by means of the method described above. When the
biological material separation chip 100 having a glucose
transporter is created by means of the method described above, a
number of other transporters are naturally fixed onto the pore
3.
[0673] The biological material separation chip 100 is provided
turning a rear face thereof having the electrode 5 and a front face
thereof having the electrode 7 to a space 501 and a space 502,
respectively, each discretely provided in a vessel 500. The
electrode 4 is earthed. The electrodes 5 and 7 are attached to a
power source 505 and an ammeter 506 according to the necessity.
[0674] The spaces 501 and 502 are firstly filled with a solution of
an M9 culture medium (pH 7.1) containing a 2 mM of calcium.
Although the spaces 501 and 502 are seemingly large in the figure,
there is actually a gap of several tens of .mu.m between the
spaces, so that the solution is put into the spaces using a
capillary tube. At this point in time, the value indicated by the
ammeter 506 is monitored. Next, the electric current value
fluctuates when the M9 culture medium containing a 2% of glucose as
a sample solution is added to the space 501 through the use of the
capillary phenomenon. This demonstrates that glucose and some other
ion are coupled to pass through a membrane. After a prespecified
period of time, the solution on the side of the space 502 is
collected.
[0675] The solutions collected from the space 502 and the original
M9 culture medium are collected with a capillary, into which
Escherichia coli bacteria suspended in an M9 culture medium is
sucked one bacterium at a time. E. coli cultured in a solution
collected from the space 502 divide after a lapse of 50 to 60
minutes, while in turn, E. coli cultured in a fresh M9 culture
medium do not divide even after a lapse of 120 minutes and more.
This shows that at least glucose is collected after passing through
a transporter.
Example 2
[0676] FIG. 83 is a cross-sectional view showing outline of a
biological material separator in Example 2 in which three sheets of
the biological material separation chips 100 preserved in a buffer
suited to cell culture are combined with each other. The biological
material separator according to Example 2 is assembled in a buffer
suited to cell culture to avoid damages of a transporter 12 fixed
onto a pore 3. More specifically, it is practical to assemble the
separator under visual observation in droplets of a buffer dropped
on an observation glass plate for a microscope and suited to cell
culture. Herein, each of the biological material separation chips
100 fixes onto each pore 3 transporters from a plurality of types
of cells present in a cell membrane, a nuclear membrane or the like
and transporting a specific biological material.
[0677] In FIG. 83, reference numeral 100 indicates a biological
material separation chip 100 shown in FIG. 80(b). Three sheets of
the biological material separation chips 100 are arrayed at
intervals of 100 to 500 .mu.m, and sidewalls 101, 102 manufactured
through the use of a silicon substrate are provided on both sides
of the arranyed chips 100. On the side of the inner face of the
sidewalls 101, 102 are provided an electrode 4' and an insulating
layer 6' corresponding to the electrode 4 and the insulating layer
6 provided on the biological material separation chip 100,
respectively. The sidewalls 101, 102 can be manufactured with the
semiconductor technology, like the biological material separation
chip 100. The biological material separation chips 100 herein are
fixed with a clamp 600 whose external appearance is as shown in
FIG. 84. In this step, a suitable spacer is inserted between the
biological material separation chips 100 or between the biological
material separation chip 100 and the sidewalls 101, 102, or the
clamp 600 itself has a suitable spacer.
[0678] In FIG. 83, curved lines each drawn on the upper and lower
ends between the biological material separation chips 100 as well
as between the biological material separation chip 100 and the
sidewalls 101, 102 indicate that a liquid filled in each space is
maintained therein with the surface tension.
[0679] FIG. 84 is a perspective view showing an appearance of the
biological material separator in Example 2 in which three sheets of
the biological material separation chips 100 are combined with each
other. As shown in the figure, each chip 100 and the sidewalls 101,
102 are fixed with a clamp 600. Clearances between each chip 100
are opened as 30-1, 30-2, 30-3 and 30-4 in FIG. 83. Gaps between
each chip 100 are several tens of .mu.m in distance, so that a
liquid can be filled in or discharged from the gaps with a
capillary tube using a capillary pipet 601. With the configuration
as described above, different solutions can be filled in or
discharged from each gap between the chips 100.
[0680] As shown in FIG. 83, a biological material separator
assembled under visual observation in droplets of a buffer dropped
on an observation glass plate for a microscope and suited to cell
culture has the buffer between the biological material separation
chips 100 and between the biological material separation chip 100
and the sidewalls 101, 102 when the assemble is completed.
[0681] In this state, a sample is fed in or taken out of the space
between the biological material separation chips 100 and between
the biological material separation chip 100 and the sidewalls 101,
102 using a capillary pipet 601, after both the electrodes 4 and 4'
are earthed. This is for the purpose of shielding static
electricity generated when a solution flows on the surface of the
biological material separation chip 100 and the sidewalls 101, 102,
and preventing current noise from being generated. A power source
31 and a current flowing therefrom are designed to be monitored so
as to apply a specified voltage between the electrodes 5 and 7 on
both sides of the biological material separation chip 100. When a
transporter 12 is fixed onto a pore 3 in a stable manner, the
current flowing from the power source 31 is substantially null,
while in turn, when the transporter 12 is dropped off, a heavy
electric current flows, which enables an easy detection of the
state of the transporter 12.
[0682] Reference numerals 12-1, 12-2 and 12-3 indicate each of
transporters 12 for each biological material separation chip 100
viewed from the side of the sidewall 101, and herein the
transporter 12-1 is a transporter prepared from a neuron-derived
cell membrane, the transporter 12-2 is a transporter prepared from
a testicular cell membrane, and the transporter 12-3 is a lipid
bilayer derived from a pulmonary cell membrane.
[0683] Firstly, a buffer at pH 6.5 is filled in all clearances of
the separator, and an amino acid mixed solution including glutamic
acid, aspartic acid, alanine and glutamine is fed in the clearance
30-1. Then a current at an about 100 nA is observed with an ammeter
32 and an ammeter 33, demonstrating that some kind of substrate
transport takes place. A current flowing through an ammeter 34 is
about one third of those observed with the other ammeters.
Solutions in the clearances 30-2 to 30-4 are collected with the
capillary phenomenon for amino-acid analysis using nano LC to find
that glutamic acid and aspartic acid passes through the lipid
bilayers 12-1 and 12-3 and are accumulated in the clearances 30-2
and 30-3. Glutamic acid and aspartic acid observed in the clearance
30-4 is at a level below the detection limit. Alanine and glutamine
is detected in all of the clearances.
[0684] In fact, a transporter in the SLC 1 family related to amino
acid transport is generally expressed in the cells described above
according to the SLC new solute carrier superfamily proposed
members (http://www.bioparadigms.org/slc/menu.asp) described in
HGNC Gene Grouping/Family Nomenclature (updated in June 2004),
http://www.gene.ucl.ac.uk/nomenclature/genefamily.shtml in the
transporter database (official website of HUGO), and acidic amino
acid is expressed in neurons, testis, kidney, liver, heart and the
like in large quantity, while alanine and glutamine, which is
neutral amino acid, is expressed in a wide range of organs, these
findings are consistent with the result described above.
[0685] Thus, by using the biological material separator and the
method of separating biological material according to the sixteenth
embodiment, an extremely trace quantity of biological material can
be roughly classified depending on its property, and the difference
analysis in which comparison of material transport among fixed
cells is analyzed through the use of difference in material to be
transported can be conducted by observing what kind of material is
accumulated in each clearance.
Example 3
[0686] In Example 3, a biological material separation chip having
configuration in which a nuclear membrane is fixed onto the tip
section of a capillary chip is described. FIG. 85(a) to FIG. 85(f)
are views illustrating a procedure for preparing a biological
material separation chip with a nucleic membrane fixed onto the tip
section of a capillary chip thereof in Example 3. Herein is
described an example of preparing an mRNA purified chip using a
nuclear membrane of an oocyte of a xenopus.
[0687] FIG. 85(a) is a view showing a preparatory step and
illustrating the outline when an oocyte of a xenopus for obtaining
a nuclear membrane thereof and a capillary chip are provided within
the field of a microscope for a visual observation. Designated at
the reference numeral 41 is an oocyte of a xenopus, at 42
cytoplasm, at 43 a cell nucleus, at 44 a nuclear membrane
partitioning cytoplasm from a nucleus, and at 45 a cell membrane.
Reference numeral 46 indicates a capillary chip, whose tip 48 (a
portion inserted into a cell) is about 400 .mu.m in diameter and 20
mm in length in order to reduce a physical damage on a cell. The
capillary 46 is attached to a fixture 49 capable of shifting the X,
Y and Z axes thereof and changing the degree of the tip angle
thereof. A buffer of the type used for cell culture is filled
inside the capillary 46. The fixture 49 is attached to a drive unit
50 driven by hydraulic pressure. The driveline from the drive unit
50 to the fixture 49 utilizes hydraulic pressure. Further a
microsyringe pump 51 is attached to the capillary 46, and the
inside of the capillary 46 can be transformed between the states of
positive and negative pressure with complete control. Reference
numeral 47 indicates a tube for connecting the capillary 46 and the
microsyringe pump 51.
[0688] To avoid damages to a cell 41, the cell 41 and the tip
section of the capillary 46 are made to be always in droplets 53 of
a buffer of a type used for culturing a cell formed on an
observation glass plate 52 provided within the field of a
microscope, and all of the following steps are taken in the
droplets. Further, an electrode 54 is temporarily provided in the
capillary 46, so that a lead wire 55 connected the electrode 54 is
drawn out, while another electrode 56 is temporarily provided in
the cytoplasm 42 of the cell 41, so that another lead wire 57
connected to the electrode 56 is drawn out. To avoid complications
in the figure, representation of the observation glass plate 52,
droplets 53, electrodes 54, 56 and lead lines 55, 57 are omitted in
the following FIG. 85(b) to FIG. 85(e).
[0689] FIG. 85(b) shows a state where the cell membrane 45 of the
cell 41 is pierced with the capillary 46, while visually observing
with a microscope.
[0690] FIG. 85(c) shows a state where the tip 48 of the capillary
46 is contacted to the nuclear membrane 44, the microsrynge pump 51
is operated to obtain negative pressure inside the capillary 46,
and thereby the tip 48 of the capillary 46 is closely adhered to
the nuclear membrane 44. Then the degree of negative pressure by
the microsrynge pump 51 is properly adjusted, and the capillary 46
is pulled out of the cell 41 keeping the state where the nuclear
membrane 44 is adhered to the tip of the capillary chip, and, while
sucking the nuclear membrane 44 at such pressure as not piercing
the same. Thus a capillary chip 46 can be obtained having
configuration in which the nuclear membrane 44 with the inside
thereof facing to the outside of the chip is fixed onto the tip
section 48 of the chip.
[0691] In addition to the contact of the capillary tip 48 to the
nuclear membrane 44 while visually observing with a microscope,
electrical conductivity between the electrode 54 and the electrode
56 can be utilized herein. Namely, the step of contacting and
closely adhering the capillary tip 48 to the nuclear membrane 44
can be monitored with electrical conductivity. During the period
when the tip 48 of the capillary 46 is in the cytoplasm 42,
electrical conductivity between the electrode 54 and the electrode
56 is extremely high (short-circuited), however, when the tip 48 of
the capillary 46 contacts the nuclear membrane 44 of the cell 41,
the electrical conductivity drops (electric resistance increases),
and moreover, the electrical conductivity further decreases when
the contact becomes somewhat tighter.
[0692] Thus the contact and adhesion of the tip 48 of the capillary
46 to the nuclear membrane 44 of the cell 41 can be controlled more
easily by controlling a contact of the tip 48 of the capillary 46
to the nuclear membrane 44 of the cell 41 under visual observation,
and by checking electrical conductivity between the electrode 54
and the electrode 56.
[0693] After the tip 48 of the capillary 46 is closely adhered to
the nuclear membrane 44 of the cell 41, while keeping nuclear
membrane 44 onto the tip of the chip 48, the capillary 46 is pulled
out from the cell 41.
[0694] FIG. 85(d) shows the step of cleaning the periphery of the
capillary 46 having been pulled out from the cell 41 to remove
nucleic acid ingredients and protein ingredients adhering to the
periphery of the capillary 46.
[0695] FIG. 85(e) shows a state where a biological material
separation chip with a nuclear membrane fixed onto the tip of a
capillary chip thereof is completed. In this state, a buffer used
for cell culture still remains in the capillary 46, though, it is
desired that the entire chip is put in a buffer to preserve the
nuclear membrane fixed on the tip of the capillary chip.
[0696] FIG. 86 is a view illustrating a specific example in which
mRNAs are prepared by using the biological material separation chip
in Example 3.
[0697] For instance, liver tissue obtained from a xenopus is
frozen, and is added to a phenol chloroform solution, and the
mixture is immediately homogenized. After ethanol precipitation, a
mixed pellet of the total RNAs and genome fragments is obtained.
The mixed pellet is dissolved in 5 mM of a 50 mM Tris-HCl buffer
solution (pH 7.5) to obtain a sample solution. The sample solution
211 is poured into a vessel 212. A configuration similar to that
for preparing the biological material separation chip is used in
which the biological material separation chip 46 is attached onto
the tip of a tube 47 for a device comprising a fixture 49, a drive
unit 50, a microsyringe pump 51 and a tube 47. In this step, the
electrode 54 is provided in the biological material separation chip
46, and is connected to the positive pole of a direct current power
source via the lead wire 55. In the meantime, the electrode 56 is
immersed in the vessel 212 with the sample solution 211 put
therein, and is connected to the negative pole of the direct
current power source via the lead wire 57.
[0698] The tip of the biological material separation chip 46 is
dipped in the vessel 212 with the sample solution 211 put therein,
and electric field by 5 V/cm of direct current voltage is applied
to a portion between the inside and the outside of the capillary
chip 46 using the direct current power source described above. With
this operation, mRNAs passing through the nuclear membrane fixed
onto the tip of the biological material separation chip 46 and
transferring to the inside of the capillary are collected.
[0699] The mRNAs obtained as described above and mRNAs in the
solution remaining outside of the capillary chip are apparently
different in size, that is, the mRNAs obtained from the solution in
the capillary chip are mainly 1 k to 3 kb in size, while the mRNAs
obtained from the solution outside of the capillary chip shows a
smear band in a wide range up to several tens of kb. With the use
of a device with a nuclear membrane fixed thereon employing the
chip according to the sixteenth embodiment, mature mRNAs having a
reduced size thereof by splicing with an mRNA mixture solution can
be obtained.
[0700] The capillary chip having a nuclear membrane and used for
Example 3 can use a configuration example described in the
fifteenth embodiment with reference to FIG. 78, hence the
description is omitted herein.
Example 4
[0701] FIG. 87 is a view illustrating a simple method of realizing
the triple structure in Example 2 (Refer to FIG. 83) with the glass
capillary shown in FIG. 78. The glass capillary is drawn out with a
high frequency, and is tapered as shown in 346-1, 346-2 and 346-3
in FIG. 87. Electrodes 364-1, 364-2 and 364-3 are inserted between
each capillary. As described with reference to FIG. 80, the tip of
a capillary is pressed onto each cell membrane, and is then
detached from a cell while lightly sucking the cell membrane. With
this operation, the tip of the capillary with a portion of the cell
membrane (lipid bilayer) 394-1, 394-2 and 394-3 attached thereon
can be obtained. In this state, the lipid bilayer including
transporters is fixed onto each capillary tip. The lipid bilayer
having the same cell as that in Example 2 is fixed onto each
capillary. Three capillaries are piled up in a buffer.
[0702] FIG. 87 is a cross-sectional view showing outline of
biological material separation chips prepared as described above
and arrayed in three cascades. Reference numerals 346-1 to 346-3
indicate biological material separation chips, on the tip of which
are fixed nuclear membranes 394-1 to 394-3 respectively. The three
biological material separation chips are connected with a slight
clearance remained therebetween. As shown in FIG. 87, the tip of
the chip is dipped in a sample solution 361 in a vessel 360.
Electric field is herein applied to a portion between an electrode
364-1 and an electrode 364-4 provided in the sample solution in
order to accelerate transfer of the substrate. Naturally, material
transfer may be carried out in stages by switching the electrode
364-3, 364-2 and 364-1, and the electrode 364-4 in this order.
After the lapse of a specified period of time, the capillaries are
separated out, pressure is applied from the side of a capillary
having a larger taper to pierce a lipid bilayer on the tip, and the
solution inside can be collected.
[XVII] Seventeenth Embodiment
[0703] A seventeenth embodiment of the present invention discloses
a method of establishing a technique for preventing outflow of
contents in a cell, enabling insertion of a target substance into
the cell, and recovering materials in the cell to facilitate an
assay of a particular substance or production of a useful material.
With this method, only a portion of cell membrane is made
semipermeable. To make a portion of cell semipermeable, a chip
based on a partition wall structure with small pores each smaller
than an external diameter of a cell provided thereon is used. A
cell is fixed on a face of this chip at a position where a pore is
provided, and a cell membrane toxin such as streptolysin O is
reacted from the other face through the pore to a portion of the
cell to make the cell membrane at the pore position semipermeable.
A substance is inserted into or taken out from the cell through
this semipermeable membrane portion. Further by providing
electrodes at both sides of the partition wall, ions passing
through the cell membrane can be measured, or a substance can
forcibly be inserted into or taken out from a cell by loading a
voltage to the electrodes.
Example 1
[0704] FIG. 88 is a cross-sectional view showing general relations
between a cell chip in Example 1 and a cell fixed to a pore section
thereof.
[0705] In FIG. 88, the reference numeral 100 indicates a cell chip.
Reference numeral 20 indicates a cell. As described below, the cell
20 is fixed to a portion of a pore 3 on the cell chip 100.
[0706] Reference numeral 1 indicates a cell fixing substrate of the
cell chip 100, and is made of, for instance, silicon. The size is 5
mm in the height and 500 .mu.m in the vertical direction in the
figure respectively. The thickness is, for instance, 100 .mu.m. A
projection 2 is provided at one edge portion of the cell fixing
substrate 1. The height is, for instance, 5 .mu.m, and thickness of
the projection is, for instance, 2 .mu.m. A pore 3 is formed at a
top of the projection 2. The size is, for instance, in the range
from 2 to 5 .mu.m.phi.. Electrode layers 4, 5 are formed on both
faces of a lower section of the cell fixing substrate 1. The
electrodes 4, 5 are substantially covered with insulating layers,
but portions near the projection 2 and near an edge of the cell
fixing substrate 1 are exposed.
[0707] The reference numeral 10 is a rear plate, and is adhered to
an entire portion of the rear surface of the projection 2 to form a
buffer chamber 8 on the rear surface of the projection 2 of the
cell fixing substrate 1. Thickness of the rear plate 10 is, for
instance, 100 .mu.m, but as shown in the figure, a projection 11 is
formed at a position corresponding to the pore 3 on a surface of
the cell fixing substrate 1, and further projections 12, 13 each
having a throughhole are provided in both sides of the projection
11 on the external side face. Capillaries 14, are attached to the
projections 12, 13 respectively, and a micro syringe pump (not
shown) can be communicated to each of the capillaries 14, 15. By
circulating a buffer solution in the buffer chamber 8 making use of
the capillaries 14, 15 as indicated by a bold line in the figure or
sucking a buffer solution at a rate higher than a feed rate
thereof, a negative pressure state can be generated inside the
buffer chamber 8. The projection 11 disturbs a buffer solution
supplied thereto and guides a flow of the buffer solution toward
the pore 3.
[0708] Although portions relating to a microscope are not shown for
simplification of the figure, a droplet of a buffer solution suited
to cell culture is dripped onto an observation glass plate of the
microscope, and the projection 2 of the cell fixing substrate 1 and
the cell 20 are placed at positions opposite to each other in this
droplet. In this step, the cell 20 is set at a position opposite to
the pore 3 on the projection 2. Reference numeral 21 is a lipid
dual layer of the cell 20, and reference numeral 22 indicates
cytoplasm. In FIG. 88, a broken line surrounding the projection 2
of the cell fixing substrate 1 and the cell 20 indicates an image
of a region immersed in the droplet. The buffer chamber 8 is
included in the region surrounded by the broken line, but as
described later, in the state where the cell 20 is fixed on the
cell fixing substrate 1, the buffer chamber 8 is not communicated
to the droplet. On the other hand, conductors are connected to the
electrode layers 4, 5 exposed on edge portions of the cell fixing
substrate 1 outside the droplet, and the conductors are also
connected to a measuring instrument or a computer not shown in the
figure.
[0709] The cell 20 is contacted to the pore 3 of the projection 2
observing the situation with the microscope. In this step, by
monitoring the electric conductivity between the electrode layers
4, 5, it is observed that the electrode layer 5 exposed in the
buffer chamber 8 and the electrode layer 4 exposed in the droplet
are communicated to each other through the buffer solution before
the cell is contacted to the pore 3 of the projection 2, but that,
as the pore 3 is blocked with the lipid dual layer 21 of the cell
20 after the cell is contacted to the pore 3 of the projection 2,
and therefore the two electrode layers 4,5 are insulated against
each other, thus contact to the cell 20 being confirmed. When
contact of the cell 20 to the pore 3, by controlling a buffer
solution through the capillaries 14, 15 connected to the
projections 12, 13 to suck the buffer solution at a rate higher
than a feed rage of the buffer solution, a negative pressure is
generated in the buffer chamber 8, and therefore the cell 20 is
tightly fixed to the pore 3.
[0710] Then streptolysin O is injected with the micro syringe pump
communicated to the capillaries 14, 15 attached to the projections
12, 13 on the rear plate 10. The streptolysin O acts to a portion
contacting the pore 3 of the lipid dual layer 21 of the cell 20 via
the pore 3, so that only the portion is made semipermeable. In the
semipermeable state, although the cell frame still remains, pores
are opened in the lipid dual layer 21. Conditions for reaction of
streptolysin, for instance, the technique disclosed in Kano, Y.
Sako et al, Reconstraction of Brefeldin A-induced Golgi Tabulation
and Fusion with the Endoplasmic Reticulum in Semi-Intact Chinese
Hamster, Molecular Biology of the Cell 11, 3073-3087 (2000) may be
modified according to a type of a cell. For instance, in a case of
an ovarian cell, the cell is exposed to 25 mM HEPES buffer solution
(pH 7.4) containing streptolysin O (60 ng/ml), 115 mM potassium
acetate, 2.5 mM MgCl.sub.2, 1 mM dithiothreitol, 2 mM EGTA for 10
minutes at 4.degree. C. Then the cell is washed with the 25 mM
HEPES buffer solution (pH 7.4) containing 115 mM potassium acetate,
2.5 mM MgCl.sub.2, 1 mM dithiothreitol, 2 mM EGTA at 32.degree. C.
The cell 20 is kept in the droplet buffer during this step, so that
the cell 20 is damaged little.
[0711] Descriptions are provided below for a method of using the
cell chip 100 with a cell having a partially semipermeable membrane
fixed thereto.
[0712] A short chain RNA which is a portion of a specific mRNA is
led into the buffer chamber 8 from the capillary 14. A portion of
this RNA is introduced into the cell 20 through the pore 3 on the
semipermeable membrane. Usually, when RNA is introduced into the
cell 20, the RNA is attacked by RNase and quickly disappears. In
the cell chip 100 in Example 1, however, fresh RNA is constantly
supplied through the capillary 14 into the buffer chamber 8, so
that RNA in the cell 20 achieves equilibrium with those in the
buffer chamber 8 through the semipermeable membrane as indicated by
the thin arrow at the pore 3. Therefore, a constant volume of RNAs
is always preserved in the cell. This phenomenon is not limited to
the case of RNA, and also occurs in a case of DNA or a derivative
of RNA.
[0713] Current value between the electrodes 4 and 5 is monitored
before and after the RNA is introduced into the cell 20. If the RNA
introduced into a cell gives influences to a transporter of the
cell dual membrane 21, ion channels present in the cell dual
membrane 21 couple to each other, so that fluctuation appears in
ion transfer between the membrane, and a current flows between the
electrode 4 and electrode 5. Namely, it is possible to introduce a
substance into a cell and monitor influences by the substance over
the cell. This technique is applicable also for measurement of
influences by any chemical substance or a protein.
[0714] Further, it is possible to add various types of chemical
substances in the side not exposed to streptolysin O in which the
cell dual membrane 21 of the droplet side is present and introduce
the chemical substances via a transporter into the cell 20, and
possible to check influences of the introduced materials to the
cell, for instance, by monitoring difference in electric potential
between the electrodes 4 and 5. Namely a bioassay can be performed
by making use of this technique.
[0715] FIG. 89(a) to FIG. 89(g) are views each illustrating an
outline of the processing for preparing the cell fixing substrate 1
in Example 1 by making use of the semiconductor technology. Each of
FIG. 89(a) to FIG. 89(g) provides a cross-sectional view in the
left side and a plan view corresponding to the cross-sectional view
above in the right side.
[0716] At first, as shown in FIG. 89(a), a silicon substrate 1
having a prespecified crystal axis is prepared, and a mask 31 is
provided on a surface thereof. Further a window 32 is formed by
removing the mask 31 at a position where a projection 3 is to be
formed. As shown in FIG. 89(b), etching is performed to remove a
portion corresponding to a quadrangular pyramid 33. Then, as shown
in FIG. 89(c), the mask 31 is removed and a mask 34 is provided on
another surface of the silicon substrate 1. Then a window is formed
by removing the mask 34 at a position where the projection 3 is to
be formed, and with this operation, recesses 35 and 36 each having
a triangular cross section are formed. The recesses 35, 36 are
continuous ones corresponding to the quadrangular pyramid 33 as
understood from the plan view. Then, as shown in FIG. 89(d), a mask
37 is provided at a position surrounded by the recesses 35, 36 to
open a window 38. Then as shown in FIG. 89(e), the pore 3 is opened
at a corresponding position on the substrate 1 by making use of
this window 38. In this step, also the projection 2 is formed by
etching on the substrate 1 around the recesses 35, 36. Then as
shown in FIG. 89(f), the electrode 4 is formed on a surface of the
substrate 1 with the projection 2 provided thereon. This electrode
4 is a deposition layer of aluminum. Then as shown in FIG. 89(g),
the substantially entire surface excluding both edge sections of
the electrode 4 is covered with a polyimide insulating layer 6.
Then the electrode 5 is formed on another surface of the substrate
1. The electrode 5 is a platinum deposition layer, and the
substantially entire surface excluding both edge sections of the
electrode 5 is covered with a polyimide insulating layer 7. Thus
the cell fixing substrate 1 of the cell chip 100 is formed.
Detailed data concerning the semiconductor technology is not
provided here, but those skilled in the art can easily carry out
the technology.
[0717] Likely, also the rear plate 10 can be formed by machining a
silicon substrate. By adhering the cell fixing substrate 1 to the
rear plate 10, the cell chip 100 is assembled.
Example 2
[0718] In Example 1, description was made for the cell chip
allowing for a bioassay by fixing a single cell on a pore portion
thereof and making the cell membrane semipermeable only at the pore
portion. In a multicellular organisms, it is a rare case that a
single cell functions by itself, and a cell generally functions in
correlation with peripheral cells. It is conceivable that cells in
the multicellular system transact information using various types
of chemical substances. In most cases, a quantity of the chemical
substance is extremely minute, and actually real time analysis of
the chemical substance in a living cell is extremely difficult. In
Example 2, there is proposed a cell chip enabling a simulated
bioassay for a group of cells functioning with harmonization with
peripheral cells. Example 2 is the same as Example 1 in the point
that a cell is fixed to a pore portion and the cell membrane only
at the pore portion is made semipermeable for carry out a
bioassay.
[0719] FIG. 90 is a cross-sectional view showing an outline of a
relation between the cell chip and a cell fixed to the pore portion
thereof in Example 2.
[0720] In FIG. 90, reference numeral 200 indicates a cell chip in
Example 2, and the cell chip 200 includes a cell fixing substrate
41, a rear plate 51, and side wall plates 61, 62. The side wall
plates are also provided behind and in front of the view plane. The
space surrounded by the side wall plates forms a buffer chamber 71
like in Example 1. A pore 43 is formed on the cell fixing substrate
41. The cell fixing substrate 41 and the pore 43 correspond to the
cell fixing substrate 1 and pore 3 in Example 1. Different from the
cell fixing substrate 1 in Example 1, the projection 2 is not
formed in the cell fixing substrate 41 in Example 2, and a number
of pores 3 are provided thereon. A number of cells are arrayed on a
surface of the cell fixing substrate 41 to form a group of cells
functioning as a whole in harmonization with each other. In the
case shown in the figure, four pores 43 are formed, but more pores
may be provided. Size of the cell fixing substrate 41 is, for
instance, about 10.times.10 mm. The thickness is, for instance, 100
.mu.m. Diameter of the pore 43 is in the range from 2 to 5
.mu.m.phi., and the pores are arrayed with a pitch of 8 .mu.m
inbetween. The cells 20 are fixed to positions corresponding to the
pores 3 on the cell fixing substrate 41. Namely the cells are
arrayed with a pitch of 8 .mu.m inbetween.
[0721] The rear plate 51 has the substantially same size as the
cell fixing substrate 41, and is placed away from the cell fixing
substrate 41 with a space of, for instance, 1 mm therefrom. The
cell fixing substrate 41 and rear plate 51 are supported at the
prespecified positions by the side wall plate behind and in front
of the view plane, and the space surrounded with the side wall
plates is a buffer 71. Like in Example 1, projections 63, 64 each
having a throughhole are formed on the side wall plates 61, 62.
Capillaries (not shown) can be attached to the projections 63, 64,
and the capillaries are connected to a syringe pump respectively
for feeding a buffer solution or the like. A projection 52 is
formed at a position corresponding to the pore 43 on the rear plate
51. This projection 52 is provided to disturb a buffer solution
supplied into the buffer chamber 71 to make it flow toward the pore
43, like the projection 11 in Example 1. An electrode 53 is
provided on a surface of the rear plate 51 in the buffer chamber
71. An outgoing line from the electrode 52 is an insulated line,
and is connected to outside of the buffer chamber 71.
[0722] FIG. 91(a) to FIG. 91(d) are views each illustrating an
outline of the processing for forming the cell fixing substrate 41
in Example 2 by making use of the semiconductor technology. Each of
the FIG. 91(a) to FIG. 91(c) shows a cross-sectional view in the
left side and a plan view corresponding to the cross-sectional view
in the right side. A plan view for FIG. 91(d) is the same as FIG.
4(c), and is omitted herefrom.
[0723] At first, as shown in FIG. 9(a), a silicon substrate 1
having a prespecified crystal axis is prepared, and a mask 31 is
provided on a surface thereof. Further a window 32 is formed by
removing the mask 31 at a position where a projection 3 is to be
formed. As shown in FIG. 91B, etching is performed to remove a
portion corresponding to a quadrangular pyramid. Then, as shown in
FIG. 91(c), the mask 31 is removed and a mask 34 is provided on
another surface of the silicon substrate 1. Then a window 35 is
formed by removing the mask 34 at a position where the pore 43 is
to be formed. Then pores 43 are formed by etching as shown in FIG.
91(d). With the operation, the cell fixing substrate 41 of the cell
chip 200 is formed. Herein detail data for the semiconductor
technology is not provided, but those skilled in the art can easily
use the technology.
[0724] Similarly, also the rear plate 51, side wall plates 61, 62
can be formed by machining a silicon substrate with the
semiconductor technology. Then the cell fixing substrate 41, rear
plate 51, and side wall plates 61, 62 are adhered to each other,
thus the cell chip 200 being assembled.
[0725] As clearly understood from comparison of the plan view in
FIG. 89(g) to that in FIG. 91(c), the cell chip 100 in Example 1 is
used to perform a bioassay for a single cell, but the cell chip 200
in Example 2 enables a bioassay for 4.times.4 cells arrayed in a
square form. The cell chip 200 is set on a culture plate and is
immersed in a proper culture fluid. When the epithelial cells 20
are cultured on the cell fixing substrate 41 of the cell chip 200
in this state, a single-layered cell sheet is inevitably formed on
the cell fixing substrate 41. FIG. 90 shows an image in which the
cell chip 200 and a cultured cell sheet are within a region of a
culture fluid indicated by the broken like and also shows the state
with a cross-sectional view in which a monolayer cell sheet is
formed on the cell fixing substrate 41 of the cell chip 200. The
pores 43 are provided in correspondence to a pitch in a cell array,
but when the pores 43 are provided at a sufficient density against
a pitch between cells (such as, for instance, 8 .mu.m) such as, for
instance, 5 .mu.m, the pores are allocated to substantially all of
the cells in the monolayer cell sheet formed on the cell fixing
substrate 41 regardless of the cell size. It is needless to say
that cells may be fixed on a constant pitch and cultured on the
cell fixing substrate 41 with the pores 43 each corresponding to
the cell size arrayed thereon, for instance, with an agarose micro
chamber arrays. Further any cell may be arrayed to form the cell
sheet. It is to be noted that, in the cell 20 shown in FIG. 90,
designated at reference numeral 22 is a cell dual membrane, at 22
cytoplasm, and at 23 a transporter present in the cell dual
membrane.
[0726] Also in Example 2, at first, a buffer solution is supplied
via the projections 63, 64 on the side wall plates 61, 62 into the
buffer chamber 71 like in Example 1. In this state, electric
conductivity between the electrode 55 immersed in a culture fluid
on the culture plate and the electrode 53 in the buffer chamber 71
is monitored. When the cell sheet formed with the cells 20 is not
tightly fixed on the cell fixing substrate 41, the electric
conductivity between the electrode 55 immersed in the culture fluid
on the culture plate and the electrode 54 exposed inside the buffer
chamber 8 is relatively low due to the buffer solution. In this
state, when a buffer solution supplied via the throughholes on the
projections 61, 62 is controlled and sucked at a rate higher than a
feed rate of the buffer solution as indicated by a bold line, a
negative pressure is generated inside the buffer chamber 71 and the
cell sheet is fixed to the cell fixing substrate 41.
[0727] Then streptolysin O is injected into the buffer chamber 71
like in Example 1. The streptolysin O acts via the pore 43 to a
portion contacting the pore 43 on the lipid dual layer 21 of the
cell 20 to make only the portion semipermeable. With this
operation, a cell chip containing a cell having a semipermeable
cell membrane only in the portion corresponding to the pore 43 is
obtained.
[0728] Not descriptions are provided for a method of using the cell
chip 200 with a cell having a partial semipermeable cell membrane
fixed thereto prepared as described thereto.
[0729] Short chain RNA each as a portion of a specific mRNA is
flown into the buffer chamber 71 as indicated by the bold line. A
portion of the RNA is fetched through the semipermeable membrane
into the cell 20. Generally, when introduced into the cell 20, RNA
is attacked by RNase and quickly disappears. However, in the cell
chip 200 in Example 2, fresh RNAs are sequentially supplied through
the throughholes on the projections 61, 62, so that the RNAs inside
the cell 20 achieve equilibrium via the semipermeable membrane with
those in the buffer chamber 71 as indicated by a thin arrow in the
figure. Therefore, a constant volume of RNAs is always preserved in
the cell.
[0730] A current value between the electrode 54 and electrode 55 is
monitored before and after the RNAs are introduced into the cell
20. If the RNA introduced into the cell constituting the cell sheet
give influences to the transporter 23 for the cell dual membrane 21
ion channels in the cell dual membrane 21 couple to each other, so
that fluctuations occur in transport of ions through the cell
membrane, and therefore a current flows between the electrodes 54
and 55. Namely a substance can be introduced into a cell, and
influences caused by the substance over the cell can be monitored.
This technique can be used for measurement of influences not only
by RNA, but also chemical substances and proteins. Further it is
possible to add various types of chemical substances in a cell
fluid in the side not exposed to streptolysin O where the cell dual
membrane 21 in the culture plate side, introduce the chemical
substance via a transporter into the cell 20, and check influences
of the chemical substances over the cell, for instance, by
detecting a different in electric potentials between the electrodes
54, 55. Namely a bioassay can be performed.
[0731] When a chemical substance indicated by a white triangle is
added on the culture dish, the chemical substance is fetched into
the cell via the transporter 23 as indicated by the solid black
triangles in the figure. An arrow mark penetrating the transporter
23 indicates that the chemical substances passe therethrough. The
fetched chemical substance passes through the semipermeable section
of the cell membrane, and is eluted through the pore 43 into the
buffer chamber 71 as indicated by the solid black triangle. By
recovering the eluate via the through hole on the projection 62,
reactions of the cell to the chemical substance can be
assessed.
[0732] The biochemical substances as used in this specification
include, but not limited to, amino acids, dipeptides, oligo
peptides such as tripeptides, polypeptides such as proteins,
nucleic acids, RNAs such as mRNAs, monosaccharide, disaccharide or
oligosaccharide, sugers such as polysaccharide, hormones such as
steroids, neurotransmitters such as noradrenaline, dopamine, and
serotonin, other endocrine disrupters, various types of drugs, and
other materials involving in the life phenomenon such as potassium,
sodium, chloride ions, hydrogen ion. The biochemical substances
have various types of characteristics. Therefore the possibility of
assessing the influences of these materials through direction
reactions with cells is extremely useful.
[0733] For instance, the aforementioned chip is prepared with a
cell in which the SLC6A1 as a transporter is forcefully expressed,
the chip is useful for detection on .gamma.-amino butyric acid. The
cell in which SLC6A2 is forcefully expressed may be used for
noradrenaline, and that in which SLC6A4 may be used for measurement
of serotonin. Further a cell in which SLCO3A1 can be used for
measurement of prostaglandin, and a cell in which SLC6A5 is
forcefully expressed can be used for measurement of glycine.
[0734] Further by using the chip according to the seventeenth
embodiment, a material can be refined. For instance, cells each
containing a transporter for dopamine forcefully expressed therein
with the technique described above are arrayed on the chip 200 as
shown in FIG. 90. Each of the cells has semipermeable cell membrane
only at a portion thereof contacting the pore. In this state, a
sample solution containing dopamine or a derivative thereof is
added in the chip, and a voltage is loaded to the electrodes 54 and
55. Then dopamine as a target or homologues can be recovered
through the cell membrane. A material having a completely different
structure does not pass through the cell membrane. It is needless
to say that other materials are recovered via the respective
transporters, but a number of a transporter for the target material
is substantially larger than those for other materials, so that the
target material can substantially be recovered. The same refinement
can also be performed for amino acids or sugars. Especially, by
forcefully expressing a stereoisomer capable of being recognized by
a transporter in a cell, for instance, only L-isomer can be refined
from a synthetic amino acid (a mixture of D- and L-isomers) with
small amount of energy.
[0735] As described above, the cell chip according to the
seventeenth embodiment can be used not only for assay of chemical
materials, but also for production of specific materials including
refinement thereof.
[XVIII] Eighteenth Embodiment
[0736] An eighteenth embodiment of the present invention discloses
a method of accurately counting a number of biomolecules, not only
for separating the biological material, but also for separating an
extremely small number of molecules having activity to a cell in
the function traceable state to clarify functions of a cell. When a
biomolecule moves, the biomolecule is always guided so that the
biomolecule passes through a region with the space covered with the
evanescent wave having a prespecified wavelength. As a result, when
the molecule passes through the region, scattering of light occurs,
and the scattered evanescent light goes out from the space, and
therefore, by detecting this scattered light, a number of
biomolecules can accurately be counted.
Example 1
[0737] FIG. 92 is a conceptual diagram showing an example of a
molecule counter based on detection of scattered light by making
use of resonant plasmon. Reference numeral 1 indicates a fine tube,
and the material is fused silica with low light attenuation. The
fine tube 1 is a detector. A diameter of an opening at a tip
portion of the fine tune is in the range from 200 to 300 nm, and
also the wall thickness is small. Inner and outer surfaces of the
tip portion of the fine tune 1 at a portion near the opening are
covered with a metal foil layer 2 to cause plasmon resonance when
the evanescent waves go out of the opening at the tip portion of
the fine tube. The best material for the metal foil layer 2 is
gold. Wavelength of light introduced into the fine tube 1 should
preferably be slightly larger than a diameter of the opening at the
tip portion of the fine tube. Portions of fine tube other than the
tip section may be thick, and when the wall thickness is
sufficiently larger as compared to the wavelength of light
described above, the light can be propagated by total reflection
from the inlet portion to the opening of the tip portion of the
fine tube. A diameter of the opening at the other edge of the tine
tune is sufficiently larger as compared to the wavelength of light
introduced into the fine tube 1.
[0738] The tip portion of the fine tube 1 can be thinned with any
known method. For instance, by extending the fused silica tube by
means of high-frequency heating, the tip portion can be thinned,
and also the wall thickness of the tip portion can be reduced.
[0739] A sample solution containing a biomolecule 4 as a target for
detection is put in a vessel 8 with a buffer solution filled
therein, and the buffer solution is also introduced into the fine
tube 1, and then the tip portion of the fine tube 1 is inserted
into the vessel 8. When visible laser light 3 is irradiated from
the thick wall section of the fine tube 1, the light propagates
from the thick wall portion toward the tip portion by total
reflection, and light having a prespecified wavelength goes out as
evanescent light wave from a balled portion of the tip section to
form a evanescent wave region 3-2. When the biomolecule 4 passes
through the evanescent wave region 3-2, the resonant plasmon
phenomenon occurs, and photons 3-3 springs out to outside of the
evanescent region 3-3. The photons are focused with a lens 5 and
counted with a photon counter 6, a number of biomolecules passing
through the opening at the tip portion can be detected. The lens 5
is a water-submerged lens and is approached as much as possible to
the evanescent wave region 3-2 at the tip portion of the fine tube
1 from which the scattered light goes out.
[0740] Electrophoresis is used for transport of a biological
material. Namely electrodes 7-1 and 7-2 are placed inside the fine
tube 1 functioning as a light guide and in a sample solution in
which biomolecules are dispersed, and only a specified material can
be introduced into the fine tube by loading a voltage on the
electrodes 7-1 and 7-2. What is important in this step is a voltage
applied to the electrodes 7-1 and 7-2. When a quantity of
biological material is large, the photon counter 6 is saturated,
and the photon pulses can not accurately be counted. In the
situation as described above, the voltage is lowered so that a
biomolecule passes through the evanescent wave regions 3-2 at the
tip of the fine tube at a speed allowing for photon counting.
[0741] FIG. 93 is a conceptual view showing a result obtained by
the photon counter 6. The horizontal axis indicates time, and the
vertical axis indicates amplitude of light introduced into the
photon counter 6. In the eighteenth embodiment, basically photon
detection is performed, so that the background light should be
removed as much as possible. When an electric field is loaded to
the electrodes 7-1 and 7-2 so that the voltage at the electrode 7-1
is set to +15 V, a signal 22 is obtained. It is conceivable that
this signal is generated by impurities contained in the buffer
solution or by electric noises. Then transferrin, which is a type
of protein, is added to outside of the fine tube 1 so that the
concentration is 1 fM. Signals 21-1 and 22-2 having a clearly
stronger amplitude than the signal 22, are detected. Namely, it is
conceivable that the signal 22 is generated by noises and also that
the signal 21-1 is generated by scattered light generated when
transferrin passes through the evanescent wave region 3-2 at the
tip of the fine tube. It is conceivable that the signal 21-2
indicates presence of other protein component contained in the
transferrin solution, but the contents is unknown. Frequencies of
the signals 21-1 and 21-2 increases when a quantity of added
transferrin increases, and the frequencies drop when the quantity
is reduced.
[0742] When a sample refined by chromatography using the DEAC
cellulose column for transferring is used, a frequency of
appearance of the signal 21-1 becomes higher as compared to that of
the signal 21-2, and therefore the signal 21-1 is conceivably
originated from the transferrin. The signal 21-2 can be considered
as originated from other component contained in the transferring
solution, but the substance is still unknown. Because an amplitude
of scattered light indicated by the signal 21-2 is lower than that
indicated by the signal 21-1, and therefore it may be guessed that
this unknown substance has smaller size than transferrin.
Example 2
[0743] FIG. 94(A) is a cross-sectional view showing a case where a
measurement device described in Example 1 is formed with a
substrate, and a chip-like detector placed on the substrate, while
FIG. 94(B) is a plan view showing general relation between a
substrate of the measurement device and the chip-like detector
placed on the substrate. In this case, a pore for forming the
evanescent wave region is provided on the chip.
[0744] Reference numeral 31 indicates the chip-like detector, and
the chip has the width of 3 mm, length of 3 mm, and thickness of
200 .mu.m. An opening with the diameter in the range from 200 to
300 nm is formed at a central portion thereof. A tip section 32 of
the fine tube is curved and expanded by 100 .mu.m, and a metal foil
33 is deposited on this curved section. An optical coupler 40 is
fixed to an edge face of the chip-like detector 31. The optical
coupler 40 is connected to an optical fiber 41, and a laser source
42 is set at a tip of the optical fiber 41. The laser light
introduced from the laser source 42 into the chip-like detector 31
is totally reflected inside the chip-like detector, and reaches the
tip portion 32 of the fine tube. The evanescent waves go out from
the tip portion 32 of the fine tube to form the evanescent wave
region 34. Electrodes 36-1 and 36-2 are provided on both surfaces
of the chip at an edge section of the chip-like detector 31.
[0745] The chip-like detector 31 is attached to the substrate 30. A
vessel 37 containing a buffer solution is formed on a top face of
the substrate 30 at a position corresponding to the tip section 32
of the fine tube in the detector 31. The substrate 30 has the
thickness of, for instance, 0.4 mm, and the thickness of the bottom
section of the vessel 37 is 0.1 mm. When the detector 31 is
attached to the substrate 30, the tip portion 32 of the curved fine
tube is approached as much as possible to the bottom surface of the
vessel 37. A buffer solution is put in the vessel 37.
[0746] A sample solution 35 is added through the opening into the
chip-like detector 31 from the upper position. If there is a
particle with the size of 10 nm in the sample droplet 35, when the
particle passes through the evanescent wave region, scattering of
light occurs, ad photons passes through a focusing lens 43 and
reaches a photomultiplier 44 to provide a signal pattern as shown
in FIG. 93 in Example 1. The electrode 36-1 in the detector 31
contacts the droplet 35, while the electrode 36-2 in the detector
31 contacts the buffer solution in the vessel 37, so that a
molecule can be electrophoresed with a power source 505 to control
a direction of the particle passing through the opening of the
chip-like detector 31.
[0747] As indicated by the relation between the substrate and the
chip-like detector placed on the substrate shown in FIG. 94(B), a
hole 47 is provided on the substrate 30 at a position adjoining the
chip-like detector 31. The hole 47 is communicated to the vessel 47
through a groove 48. Therefore, after the sample droplet is added
from the top through the opening of the chip-like detector 31 and a
prespecified measurement is performed, by sucking the buffer
solution from the hole 47 with a dropping pipet, the buffer
solution containing the particle moved into the buffer solution in
the vessel 37 through the opening of the chip-like detector 31 can
be taken out.
Example 3
[0748] Further, in the eighteenth embodiment, a specific
biomolecule can be screen off and detected by attaching a chip 46
with a cell membrane including a transporter 45 selecting a
biomolecule adhered to a top of the chip-like detector 31 described
in Example 2. In this case, only he materials capable of passing
through a transporter can advantageously be detected in the
evanescent wave region 34. The transporter used in this case is,
for instance, oocyte of xenopus (immature egg) in which a gene for
a specific transporter is forcefully expressed. For instance, an
mRNA sequence for a specific membrane protein is incorporated in an
immature egg of xenopus, and a membrane is formed with cells in
which the specific membrane protein is forcefully expressed. Then
the cell membrane is cut off by patch clamping, and the cell
membrane cut off as described may be adhered to the chip for use.
More specifically, for instance, the transporter chip illustrated
especially in FIG. 1 in Japanese Patent Application No. 2004-264866
filed by the present inventors may be used for this purpose.
[0749] FIG. 95 is a cross-sectional view showing a measurement
device in Example 3 in which a chip with a cell membrane containing
a transporter adhered thereon is placed on the chip-like detector
of the measurement device described in Example 1. The plan view of
the measurement device in Example 3 is the same as that in FIG.
94(B), and is omitted herefrom.
[0750] As clearly understood from comparison between FIG. 95 and
FIG. 94, FIG. 95 is the same as FIG. 94 excluding the points that a
chip 46 with a cell membrane containing the transporter 45
selecting a biomolecule adhered thereon is placed on the chip-like
detector 31, and that the electrode 36-1 is provided on the chip 46
with the cell membrane adhered thereon. Therefore, when the sample
droplet 35 is dripped on a top surface of the chip 46 for
measurement, only biomolecules capable of passing through the
transporter 45 are introduced into the chip-like detector 31, so
that passage of the biomolecules can be detected. Namely, in a case
of the sample droplet 35 for a tissue piece containing a plurality
of cells, or in a case of the sample droplet 35 containing a signal
transmitter substance released from a particular cell in the cell
chip on which cells are arrayed systematically, it is possible to
previously select and measure the chip 46 with the cell membrane
containing the transporter 45 selecting the biomolecule, which
enables analysis of the state of each discrete cell in a multiple
cell system.
Example 4
[0751] In Example 3, the structure shown in FIG. 95 is employed for
measurement with a droplet and improvement in productivity by
employment of a chip, but this chip is not always convenient in use
when it is difficult to make a droplet of a sample. Example 4
proposes a measurement device which can advantageously be used when
it is difficult to make a droplet of a sample, or when a molecule
released from a region where specific cells gather is to be
detected. FIG. 96 is a cross-sectional view showing a measurement
device in which a fine tube with a cell membrane containing a
transporter is provided outside the chip-formed detector of the
measurement device described in Example 1.
[0752] Also in Example 4, the fine tube with a cell membrane
containing a transporter adhered thereon can be used in the
transporter chip proposed by the present inventor and disclosed
especially in FIG. 9 in Japanese Patent Application No.
2004-264866. Reference numeral 51 indicates a fine tube of the
measurement device described in Example 1. An evanescent region 58
is formed at the tip section. Reference numeral 52 indicates a fine
tube with a cell membrane containing a transporter adhered thereon.
The fine tube 52 with a cell membrane containing a transporter
covers the fine tube 51. Reference numeral 50 is a block of cells
to be measured. A specific cell as a target for measurement is
present in the block 50. The block 50 of cells is placed in the
buffer solution in the vessel 53. An electrode 54-1 is set in the
buffer solution in the vessel 53, while an electrode 54-2 is
attached to inside of the fine tune 51 of the measurement device. A
tip of the fine tube 52 is approached to the specific cell 55 in
the cell block 50. A substance 56 released from the cell 55 is
selectively fetched into the fine tube 52 via the transporter 57
attached to a tip portion of the fine tube 52 when an electric
field is loaded to the electrode 54-1 and electrode 54-2. Materials
not capable of passing through the transporter 57 are not fetched
into the fine tube 52. A laser 60 as a light source is attached to
the other edge of the fine tube 51. As described in Example 1, an
evanescent region 84 is formed at the tip portion of the fine tube
51 as described in Example 1. Because of the configuration, cells
having passed through the evanescent wave region 84 of the fine
tube 51 are fetched into the fine tube one by one due to the
electric field loaded to the electrode 54-1 and electrode 54-2, and
the cells generate photons in this step. The photons are captured
by a focusing lens 59 and counted with a photon counter (not
shown).
[0753] In Example 4, as a tip of the measurement device is sharp,
access to a specific region of a solid block of cells is easy.
[XIX] Nineteenth Embodiment
[0754] As a nineteenth embodiment, a method is described in which a
polynucleotide chip and a protein chip both higher in density and
better defined quantitatively and reproducibility than conventional
chips are used, and also in which an atomic force microscope is
used in detecting a shape of substance by tracing atomic force, in
place of an optical detection which has a limitation in resolution
in detecting captured DNA molecules. Although the atomic force
microscope has a resolution fine enough for identifying DNA
molecules in a state of a single-chain or a double-chain
(approximately 3 nm in diameter), nanoparticles, which are easy to
detect, are used as a marker for fast scanning.
Example 1
[0755] FIG. 97 is a conceptual oblique perspective view showing
part of a DNA chip according to a first example of the nineteenth
embodiment. A chip 100 is formed on a silicon substrate 101 with
oxidized film on the surface. Each element 1 has a form of a
cylindrical column 700 nm in diameter. A spacing 2 between each
element is 300 nm. This means that the elements are lined up at a
distance of 1 .mu.m. A group of 50.times.50 elements, as enclosed
with a single-dotted line 3, forms an element group, and there are
provided 20.times.20 element groups lined up on the chip. Between
each element group 3 is a groove 5 40 nm in width and 20 nm in
depth, and on each of four corners of each element is provided a
pillar 4 for indexing. The pillar 4 between 2 elements is shared by
both elements. The pillar 4 has a form of cylindrical column, with
17 different diameters starting from 50 nm at an increment of 10
nm, and with 17 different heights starting from 5 nm at an
increment of 10 nm, and a combination of four pillars 4 at the four
corners of each element is used for indexing, just like a bar code.
There are therefore nine pillars 4 of the same shape in an element
group 3, and the pillars are placed so that no adjoining pillars
are of the same shape, and that the sizes of pillars are as
randomly placed as possible.
[0756] FIG. 98 is a pattern diagram showing more detailed
relationship between the elements 1 each and the pillars 4 on the
substrate 101 shown in FIG. 97, and relationship among DNA probes
21, 22, . . . , DNA fragments 201, 202 and 203 hybridized to the
DNA probes, and an AFM probe 60 for detecting the DNA fragments.
Each element 1 on the substrate 101 is provided at a raised level
from the substrate surface. This means that there are grooves
between each element, forming boundaries between each element. The
element 1 is raised by 20 nm. DNA probes and others are described
hereinafter.
[0757] The pillars 4, provided at the four corners of each element,
are used, in addition for indexation, for accelerating
hybridization. FIGS. 99 (a), (b) and (C) are an overall view
describing the effect of the pillars 4 for accelerating
hybridization, and FIG. 100 is a detailed explanatory diagram
showing the effect described in FIG. 99.
[0758] As shown in FIG. 99 (a), above the upper surface of the
element 1 on the substrate 101 of the DNA chip 100 is provided an
upper plate 102, at a gap of 100 .mu.m, movable back and forth, as
shown in an arrow 103, and between the upper plate 102 and the
substrate 101 is sandwiched 1 .mu.l of sample solution. As shown in
FIG. 99 (b), the upper plate 102 is moved to the direction
indicated by an arrow relative to the substrate 101. Thereafter the
upper plate 102 is moved to the reverse direction relative to the
substrate 101 indicated by an arrow as shown in FIG. 99(c). The
upper plate 102 is moved back and forth at 1 Hz. Generally, in a
micro device like the DNA chip, the solution tends to develop a
laminar flow, resulting in poor agitation efficiency; the
back-and-forth movement of the upper plate 102 over the substrate
101 disturbs the laminar flow, accelerating the hybridization. FIG.
100 is a cross-sectional view at a center position of two adjoining
elements 1, with a pillar 4 visible beyond the center position. The
back-and-forth movement of the upper plate 102 in the direction
shown by an arrow 103 relative to the substrate 101 forces
surface-direction movement of the solution as marked by reference
numerals 105 and 106, and diffusion of the dissolved substance (DNA
samples and marker probes in the example) in the direction of
thickness only is known to be a determinant of hybridization speed
(refer, for instance, to Japanese Patent Laid-Open No.
2004-144521). Hence, the sample solution is always altering on the
surface of the elements 1 each, accelerating the hybridization.
Further, in the 19th embodiment, as there are provided pillars
effectively random in form between each of the elements 1, the
solution forced to move in the surface direction is disturbed more
effectively by the obstacle pillars 4, further accelerating the
hybridization. As a result, the hybridization speed in the micro
device is effectively close to the speed in a solution layer.
[0759] With reference to FIG. 98 again, on the upper surface of the
elements 1 in the form of a cylindrical column 700 nm in diameter
and 20 nm in height are each fixed mutually different DNA probes
21, 22, . . . . The DNA probes used here are of type PNA. The PNAs,
unlike regular DNAs, do not have a negative charge originating from
a phosphodiester bond, and hence there does not work an
electrostatic repulsive force with target DNAs. This improves
efficiency of the hybridization. In particular, in a micro device
like a DNA chip in which probes are fixed on the solid phase of the
elements in high density, if regular DNA probes are used, the
target DNAs need to approach the probes through the barrier of the
negative charge, which is disadvantageous in terms of reaction
kinetics as well as thermodynamics. Also the DNA sample must be of
single chain. The use of the PNA and the like without the negative
charge results in lack of charges on the surface of the element,
leading to a speedier hybridization speed and a better yield.
Further, due to the characteristic of lack of the charge, an
electrostatic repulsive force is not generated, so that PNAs can
competitively enter between the two chains of DNAs and can
competitively hybridize, even if the target DNAs are of double
chain.
[0760] In the example 1, to the elements 1 each are fixed the DNA
probes 21, 22, . . . , which are each a sequence of between 45 and
60 bases in length between a first exon and a second exon of human
cDNA. This prevents false positive results and lower hybridization
efficiency caused by hybridization of residual genomes. A commonly
known method of fixing probes is used: probes are fixed with a
silane coupling reaction. In the example, conditions of the
hybridization such as composition of buffer fluid and the sample
DNA probes are in accordance to a hybridization method described in
Nucleic Acid Research (2002) 30, No. 16 e87. As a probe fixing
method, a method described in the above document is employed, in
which amino groups are introduced to an oxidized surface of the
silicone substrate 101 processed with
3-aminopropyltrimethoxysilane. The amino group introduced on the
surface and an SH group of the probe is bridged with
N-(11-maleimidoundecanoxyloxy)succinimide. If probes about 50 bases
in length are fixed with this method, the concentration of the
probes is about a molecule per 15 nm.sup.2. This means that there
are some 25,000 probe molecules fixed on an element.
[0761] As the sample, 1.sup.st strand cDNA is used, obtained by
reverse-transcribing once mRNA originating from human leucocyte.
Generally such a method as oligo-capping is employed to obtain
full-length cDNA, but in the example, since it is desired to
identify the quantity of mRNA in a cell, a method is used in which
the cells are dripped into liquid helium little by little,
resultant quick-frozen cells are drip-suspended in
ultrasonic-agitated phenol together with the liquid helium, and the
cells are destructed in an instant. Total RNAs are purified with a
commonly known method. A reverse-transcription enzyme is worked on
RNAs obtained from about 10 cells to produce the 1.sup.st strand
cDNAs.
[0762] The 1.sup.st strand cDNAs obtained in the above-described
manner are dissolved in 1 .mu.l of 2.times.SSC and dripped on the
DNA chip. At this state, there are included about 10.sup.2
molecules of rare 1.sup.st strand DNAs and about 1 molecules of
abundant 1.sup.st strand DNAs, and this matches the number of
probes on the chip surface in terms of order.
[0763] The DNA chip is agitated for an hour at 45.degree. C., as
shown in FIGS. 99 and 100, to complete the hybridization process.
Thereafter the upper plate 102 used for agitation as described in
FIGS. 99 and 100 are removed and dried. In the example 1, since the
PNA probes are used, it is not necessarily required to arrange a
condition with high salt concentration as is the case with regular
DNA chips. This is because it is not necessary to block the
negative charges of the DNA probes and the sample DNAs with salt.
On the contrary the results are usually better with low ionic
strength.
[0764] In the example 1, single-chain 1.sup.st strand cDNAs are
used, but the hybridization can equally work with double-chain DNAs
without first uncoiling them. In this case, the ironic strength
should not be very high, as in this way, the sample double-chain
DNAs are easier to uncoil due to the very own negative charges of
the DNAs; the probes do not have negative charges and the
hybridization process can proceed without problems. In this case,
however, there is a competition between recoiling of the
double-chain DNAs and hybridization with the probes, and the
hybridization yield is inferior to the yield obtained with the
hybridization of the 1.sup.st strand cDNAs.
[0765] In the example 1, the hybridization process completes very
fast even on the solid phase, due to the use of the PNA probes and
sufficient agitation. With DNA probes according to the conventional
technology, reaction efficiency is poor with the sample
concentration and the probe quantity as described above, and the
reaction does not complete even after 24 hours, due mainly to the
electrostatic repulsion force.
[0766] FIG. 98 illustrates a state in which a sample DNA fragment
201 is hybridized with the probe 21 on the element 1.
[0767] Next, in order to identify different portion in complement
sequences of the sample DNA fragments 201, 202 and 203 hybridized
to the probes 21, second probes marked with gold nanoparticles 23',
24' and 25', the particles are to be hybridized with the sample DNA
fragments 201, 202 and 203, is used. For the second probe, an exon
different from the exon used in the capture probe 21 on the element
1 is employed. For instance, PNA probes corresponding to exon 3,
exon 4 and exon 5 are prepared in advance. Each probe is about 30
to 50 bases in length. Each probe is introduced with a sulphide
group (an SH group) at the 5' end at the time of synthesis. For
probes corresponding to the exon 3, exon 4 and exon 5 each, gold
nanoparticles with diameters 8.3 nm, 11 nm and 17 nm are mixed,
respectively, and PNA probes marked with gold nanoparticles with
different diameters are obtained. Each of the three gold
nanoparticles-marked probes (23', 24' and 25') is mixed at 10
pmol/.mu.l, each of the mixture is dripped on the DNA chip with
hybridized sample DNAs, and the DNA chip is agitated for 15 minutes
again with the method described in FIGS. 99 and 100.
[0768] After washing the chip with 2.times.SSC, the upper plate 102
for agitation described in FIGS. 99 and 100 are removed and dried.
Thereafter, the surface of the chip 100 is scanned
two-dimensionally while tapping an AFM probe 60 at 10 Hz, as shown
with an arrow 61.
[0769] FIG. 101 is a pattern diagram showing the position signal of
the AFM probe 60 when the chip 100 as shown in FIG. 97 is scanned
in lateral direction with the AFM probe 60. From the position
signal of the AFM probe 60, it is known that the element 1 is
located at a position shown with a dotted line 41, and the gap 2
between the elements 1 is located at an adjoining area 45. It is
also known that the pillars with different sizes are located at
positions indicated with dotted lines 51 and 52. Position signals
corresponding to reference numerals 47, 48 and 49 indicate that the
gold nanoparticles-marked PNA probes are hybridized to the second
probes (23', 24' and 25' in FIG. 98) corresponding to the exon 3,
exon 4 and exon 5, respectively, which are further hybridized to
the PNA probes fixed on the element 1. Therefore, from the position
signal of the AFM probe 60, the positions of elements and the
markers can be identified.
Example 2
[0770] FIGS. 102 (a), (b) and (c) are an overall view showing
another example of illustrating the effect of the pillars 4 for
accelerating the probe hybridization, and FIG. 103 is a detailed
explanatory diagram illustrating the effect described in FIG.
102.
[0771] It is known from comparison of FIGS. 102 (a), (b) and (c)
with FIGS. 99 (a), (b) and (c) that there is a singular difference
between the DNA chip 100 in the example 2 and the DNA chip 100 in
the example 1, in that in place of the upper plate 102 located over
the substrate 101, there is provided a rotating rod 120 with 100
.mu.m in diameter. The rod 120 can be rotated at 200 rpm, touching
the sample solution 122 on the substrate 101. There is a gap of 100
.mu.m between the rod 120 and the chip element. While the rod 120
is rotated with a spindle motor, the stage on which is placed the
chip is moved right and left once every 10 seconds. After 1 .mu.l
of sample solution or nanoparticles-marked probe solution is
dripped on the substrate 101, the substrate 101 is moved from left
to right while the rod 120 is rotated as illustrated in FIGS. 102
(a), (b) and (c), and from right to left if necessary (arrow
129:FIG. 103). The rotation of the rod 120 forces surface-direction
movement of the solution as marked by heavy lines 115 and 125, and
the solution is agitated well on the substrate 101. Hence, the
sample solution is always altering on the surface of the elements 1
each, accelerating the hybridization. Further, also in the example
2, as there are provided pillars effectively random in form between
each of the elements 1, the solution forced to move in the surface
direction is disturbed more effectively due to solution turbulence
by the obstacle pillars 4, further accelerating the hybridization.
In the example 2, due to interaction of the rotation of the rod 120
and the surface direction movement, the reaction liquid for
hybridization is agitated well on the elements on the chip.
[0772] The size of the chip according to the nineteenth embodiment
is described hereinafter. Generally, if optical means is used to
identify substances, substances less than 400 to 500 nm cannot be
identified with a numerical aperture of 0.8, as shown by the
formula I. If the size is smaller, even the existence of the
substances cannot be identified. Practically, the minimum size is
about 700 nm.
Resolution = 0.61 .lamda. n sin .theta. Formula 1 ##EQU00001##
(where n.sin .theta. is the numerical aperture) . . . (1)
[0773] In the nineteenth embodiment, substances are identified by
measuring the atomic force, and therefore substances can be
identified without regard to wavelength. For this reason, the
element 1 and the groove between the elements 1 can be identified
even if the diameter of the element or the spacing between the
elements are less than 700 nm. In the example 1, the element 1 has
a diameter of 700 nm, and the spacing between the elements 1 is 300
nm, but the element 1 can be minuter, and the spacing between the
elements can be shorter. For instance, if the element 1 has a
diameter of less than 500 nm and the spacing is less than 300 nm,
gold nanoparticles 8.3 nm in diameter and captured on the element 1
with the hybridization reaction can be quantitatively determined
with the use of the atomic force microscope.
[0774] As for the minimum size of the element 1 or the spacing
between the elements 1, about 70 nm is the minimum for reasons
described hereinafter. Namely, it is described above that the
concentration of the fixed probes is about a molecule per 15
nm.sup.2, if probes of about 50 bases in length are used. On the
other hand, a smallest size of nanoparticles generally available
with the current technology is about 5 nm, which is about the same
size with the concentration of the probes and serves as a decision
standard for the minimum size. In practice, there must be at least
1,000 particles on an element 1 for quantitative determination.
Hence, the minimum size of the element 1 is 15.times.1,000
nm.sup.2. This means that the minimum diameter of the element 1 is
about 70 nm. If the quantitative determination is not required,
smaller elements may be used, and the area occupied by a probe
molecule when fixed is the minimum. This means that the smallest
possible diameter is 3 nm.
Example 3
[0775] Protein chips are prepared in which affinity-purified
anti-AFP antibody and anti-CEA antibody are fixed to different
elements. Separately, SH groups are introduced to F(ab').sub.2
fragment obtained by papain-degradating the anti-AFP antibody and
anti-CEA antibody. About 3 to 4 molecules of the SH group are
introduced to a molecule of the F(ab').sub.2 fragment. Gold
nanoparticles 20 nm in diameter is mixed, and particles with the
F(ab').sub.2 fragment bonded on the surface is obtained. As
samples, solution with AFP only with 1 zmol/.mu.l in concentration,
solution with CEA only with 5 zmol/.mu.l in concentration, and a
control without any substance are prepared. A PBS at pH 7.4
including 0.1% Tween 20 and 0.5% BAS is used as solvent. The
protein chips are reacted with the solutions, and then with the
gold nanoparticles-marked F(ab').sub.2. The reaction time is five
minutes for the reaction with the samples, and another 5 minutes
for the reaction with the gold nanoparticles-marked F(ab').sub.2.
After the reaction is completed, the chip is washed with buffer
solution including 0.1% Tween 20 and 0.5% BAS, and scanned with the
AFM.
[0776] The chip reacted with the AFP has 120 particles per element
fixed with the anti-AFP antibody and 6 particles per element fixed
with the anti-CEA antibody. The chip reacted with the CEA has 7
particles per element fixed with the anti-AFP antibody and 1,340
particles per element fixed with the anti-CEA antibody.
[0777] The chip reacted with the control has only 2 to 4 gold
nanoparticles per element fixed with either of the antibodies.
[0778] The nineteenth embodiment may be applied in several forms as
described above as examples, but in any of the forms, the
hybridized sample DNAs and others are detected practically on a
molecular basis and the embodiment offers a sensitivity far
exceeding the conventional method. As an ultra small amount of DNAs
or RNAs with an ultra small bulk can be detected, target DNAs or
RNAs can be detected without PCR amplification as a pretreatment,
which is not possible with the conventional method. Further, as the
size and form of marker particles can be changed for
identification, some 6 to 10 different samples can be
multi-analyzed on the same element. This technique can be applied
to conventional differential hybridization, as well as to the
detection with different marker probes after sample polynucleotides
are captured to the element with a single type of probe. The
multi-analysis technology of the nineteenth embodiment offers an
advantage of detecting alternative splicing and of typing a
plurality of SNPs with a single element.
[0779] FIG. 104 is an oblique perspective view illustrating
construction of an AFM cantilever suitable for use with the
nineteenth embodiment. The AFM cantilever 130 can be formed to have
a plurality of needles 131-134 lined up in array. The needles
131-134 are independently fit to levers 141-144, each attached with
a piezoelectric element 151-154, and with the up-and-down movement
of the needles, electromotive force of the piezoelectric elements
changes and can be detected. By using a cantilever with an array
structure, a plurality of lines can be scanned at a time. Therefore
nanoparticles captured on the chip can be detected very fast.
Further, it is possible to take advantage of the speedy scan by
scanning the same part a plurality of times, in order to reduce
tracing errors of figuration. Specifically, by scanning N times,
the measurement error in the direction of height can be reduced to
1/ N. In the embodiment according to the present invention, a
cantilever with 10 needles is used and the scans are repeated 16
times to calculate values in the direction of depth. With this
method, a 1 mm.times.1 mm chip with 10,000 elements can be scanned
in 30 minutes.
[XX] Twentieth Embodiment
[0780] A twentieth embodiment of the present invention describes a
method for detecting a DNA molecular captured by a chip with high
resolution like the nineteenth embodiment, but using a scanning
electron microscope which detects a shape of a substance by tracing
with an electric beam instead of the atom force microscope employed
in the nineteenth embodiment. Though the scanning electron
microscope can resolve and discriminate between a single-stranded
DNA and a double-stranded DNA (with around 3 nm in diameter), the
scanning electron microscope uses a nanoparticle as a marker which
is easier to detect for enabling scanning at a higher speed.
[0781] FIG. 105 is a view schematically showing a more detailed
relation between the element 1 and the pillar 4 on the substrate
101 illustrated in FIG. 97, and also the relations among DNA probes
21, 22, . . . fixed on each element 1, DNA pieces 201, 202, and 203
obtained by hybridizing the DNA probes above, and a scanning
electron microscope 300. The scanning electron microscope 300
includes an electron gun 300-1, a condenser lens 300-2, a scanning
coil 300-3, a detector 300-6, and the like. Electrons of an
electron beam 300-4 irradiated from the electron gun collide with
specimens (gold particles coupled to the DNA pieces 201, 202, or
203), then the specimens release secondary electrons 300-5, and
then the detector 300-6 captures the secondary electrons. Each
element 1 on the substrate 101 is at a higher position than a
surface level of the substrate 101. Namely the elements 1 each with
the height of 20 nm are divided and bordered by a groove.
[0782] As understood from comparison of FIG. 105 to FIG. 98, the
twentieth embodiment is equal to the nineteenth embodiment except
for the tracing method for which the twentieth embodiment uses the
electron beam 300-4 in place of the exploring needle 60 of the atom
force microscope employed in the nineteenth embodiment. Therefore
the DNA chip preferable to the twentieth embodiment is the same DNA
chip used in the nineteenth embodiment shown in FIG. 97. Similarly
the same method described in the nineteenth embodiment is
applicable to the twentieth embodiment in the preparation for DNA
probe and specimen.
[0783] FIG. 106 is a view schematically showing a scanning electron
microscope image obtained by two-dimensionally scanning with the
electron beam 300-4 of the scanning electron microscope 300.
Reference numerals 11 and 12 indicate elements corresponding to the
element 1 shown in FIG. 105. Reference numerals 41, 42, . . . , 46
indicate pillars arranged at the four corners of the elements 11
and 12, corresponding to the pillar 4 described in FIG. 105,
different from each other in size. Reference numerals 51, 52, and
53 indicate gold nanoparticles, with 8.3 nm, 11 nm, and 17 nm in
size respectively. Although there are other gold particles without
any reference numeral, in the figures only the gold particles each
with a reference numeral are shown. The scanning electron
microscope used in the twentieth embodiment builds up an image only
from substances emitting secondary electrons when exposed to the
electron beam, and substances not emitting secondary electrons do
not appear in the image. Therefore the pillar, the element, and the
gold nanoparticles appear in the image built up by the electron
microscope in the twentieth embodiment, while the probe, the DNA
pieces hybridized thereto, and a polymer molecule or salt contained
in the hybridization buffer do not appear in the image.
[0784] With the twentieth embodiment, substances can be detected by
detecting the secondary electron due to exposure to the electron
beam, so that the substances can be measured independent of the
wavelength. Therefore in a case where the element 1 or the gap
between elements is 700 nm or bellow, the microscope can detect the
element and the edge thereof. Though in Example 1, the element 1 is
700 nm .phi. and the gap between the elements is 300 nm, a
structure with the finer element 1 or gap therebetween is
acceptable. For instance even in a case where the element 1 is 500
nm or bellow or the gap therebetween is 300 nm or bellow, the gold
particles with 8.3 nm in size on the element 1 captured through the
hybridization reaction can be detected by the scanning electron
microscope with a fixed quantity.
[0785] The lower limit of the element 1 and the gap therebetween is
70 nm because of the reason described bellow. As described above in
a case where a probe with around 50 bases is fixed, the probe
fixing density is around one molecule in 15 nm.sup.2. While a lower
limit of a nanoparticle used for detection is 5 nm in size, based
on the lower limit in size to be available in common under the
current state of the art, which is approximately equal to the value
of the probe fixing density. This value is recognized to be a
criterion for the lower limit. Though in an actual case, in the
light of the fixed quantity detection, at least 1000 particles are
required to be placed on the element 1. Namely, the lower limit of
the element 1 is 15.times.1000 nm.sup.2 in size, and the diameter
of the round element 1 is at least 70 nm. Needless to say in a case
not considering the fixed quantity detection, the smaller element
can be used. In this case the lower limit becomes an area where one
molecule of the probe to be fixed occupies, indicating that the
smallest unit of the element is 3 nm.
[XXI] Twenty-First Embodiment
[0786] A twenty-first embodiment discloses a DNA probe chip
speeding up hybridization on the surface of a solid chip, capable
of measurement in a short time, highly sensitive, and having less
pseudopositive hybridization, a method of making the same, and a
method of hybridization on the DNA probe chip.
[0787] Specifically, this embodiment suggests;
1) The probe should be fixed on the surface of the electrode
configured to concentrate the target polynucleotide adjacent to the
electrode on which the probe is fixed, and 2) The probe should be
configured to have negatively dissociated residues on the free end
so that the probe rises quickly when the target polynucleotide
concentrated adjacent to the electrode is diffused.
[0788] In addition to the above, as a further improved
embodiment;
3) By making the fixed end of the probe to be GC-rich, the probe
allows the hybridization of the target polynucleotide to the risen
probe to advance from the board side to the free end side. This
restrains steric hindrance by adjacent probes and solid surfaces,
and 4) In order for the target polynucleotide easily to hybridize
the probe by using a probe removed of the negative charge from the
principal chain, The probe speeds up hybridization on the surface
of a solid chip, is capable of measurement in a short time and
highly sensitive, and having less pseudopositive hybridization.
[0789] With consideration of the hybridization process of the probe
and the target polynucleotide, in order to implement the
hybridization effectively, the following points must be
considered.
[0790] 1) According to the DNA probe chip, the probe is fixed on
the solid surface and the hybridization of the probe and the target
polynucleotide is substantially a complementary strand coupling
reaction on the solid-liquid interface. For this reason, in order
for the target polynucleotide in solution to collide the probe, the
target polynucleotide must be diffused to reach the solid-liquid
interface.
[0791] It is necessary to sufficiently stir the solution or to add
a concentration gradient to the target polynucleotide to increase
the concentration in the area adjacent to the solid-liquid
interface until the target polynucleotide reaches the diffusion
zone on the surface of the solid. Nevertheless, because simply
stirring the solution depends on the diffusion coefficient of the
target polynucleotide, it takes much time to attain thorough
diffusion.
[0792] According to the twenty-first embodiment, the surface of the
DNA probe chip (the solid surface where the probe is fixed) has the
positive charge to electrostatically draw the target polynucleotide
having negative charge to the surface of the DNA probe chip. This
results in the concentration gradient of the target polynucleotide
directing from the solid-liquid interface between the surface of
the DNA probe chip and the sample solution including the target
polynucleotide to the sample solution. Namely, the closer it is to
the surface of the DNA probe chip, the higher the concentration of
the target polynucleotide is. The positive charge of the surface of
the DNA probe chip can be achieved by either preparation by
introducing the positively dissociating residue (positive charge)
to the surface of the DNA chip or providing electrodes on the
surface of the DNA probe chip and in a portion of the sample
solution away from the surface of the DNA probe chip and applying
voltage thereto so that the surface of the DNA chip has the
positive charge.
[0793] 2) The probe on the DNA probe chip and the target
polynucleotide are both negatively charged polymers. It is
considered that, in the process of forming the hybridization, a
portion of the probe and target polynucleotide most easily
hybridized becomes a core to form the hybridization, and that full
hybridization is completed by spreading the region. What must be
considered in this case are the effect by the surface of the DNA
probe chip and the steric hindrance by the probe.
[0794] For instance, comparing known Nucleic Acids Research, 29,
5163-5168 (2001) and Langmuir, 16, 4984-4992 (2000), it can be
understood that having more probes is thermally advantageous for
hybridization under the condition where the probes are sufficiently
non-dense, but that the repulsive force of the charge on the
adjacent probe reduces the efficiency of hybridization where the
density is 7 nm or lower. Also, though not described therein, the
steric hindrance reduces the efficiency of hybridization.
[0795] From a macro viewpoint, there will be an optimal probe
density. However, according to the twenty-first embodiment, since
the target polynucleotide is forced to exist in a high density
adjacent to the probe to hit the probe, there will not exist the
optimal probe density as observed from the macro viewpoint. Namely,
in the twenty-first embodiment, the hybridization starts from the
state where the target polynucleotide has reached the probe on the
surface of the chip. Therefore, it is noticeable that the
hybridization efficiency varies depending on whether the tip of the
probe becomes the core of hybridization or the foot of the probe
(surface of the chip) becomes the core.
[0796] Namely, in the case where the tip (free end) of the probe
becomes the core of the hybridization, a huge molecule of the
target polynucleotide may sterically disadvantageously collide an
adjacent probe or surface of the chip in the process of looping
around the probe DNA (forming a double strand) to slow down
looping. On the contrary, in the case where the foot of the probe
(surface of the chip) becomes the core of the hybridization, the
target polynucleotide loops around the probe (forming a double
strand) away from the chip surface. In this case, there is little
steric hindrance because the hybridization advances in the
direction away from the surface of the chip. Further, because an
adjacent probe does not have the target polynucleotide looped
around the tip, there is little hindrance.
[0797] With reference to drawings, the embodiment is described more
specifically below.
Example 1
[0798] FIG. 107A is a plan view showing a DNA probe chip 100
advantageously applicable to a twenty-first embodiment of the
present invention, and FIG. 107B is a cross-sectional view showing
the DNA probe chip 100 shown in FIG. 107A taken along the line A-A
and viewed in the direction indicated by the arrow.
[0799] The reference numeral 1 is a float glass (20.times.40 mm)
used as a DNA probe chip substrate. The reference numeral 2 is an
electrode deposited on the surface of the substrate 1. The
electrode is made of ITO (Indium-Tin Oxide) with the size of
10.times.10 mm and 10 nm thick. The reference numeral 3 is a 10-nm
thick fluorinated surface coating formed on the surface of the ITO
electrode 2. The reference numeral 4 is a probe-fixing region where
the surface of the electrode 2 is exposed by periodically removing
the fluorinated surface coating. While the probe-fixing region 4 is
indicated by 4.times.4 pieces of large circles on FIG. 107A, the
actual size of the probe-fixing region 4 is regarded to be about 30
.mu.m.phi. diameter and, for instance, 100.times.100 regions are
provided. Two adjacent probe-fixing regions 4 are spaced from each
other by about 60 .mu.m and the fluorinated surface coating is
provided between the adjacent probe-fixing regions 4 to establish
independency of each probe-fixing region 4.
[0800] The fluorinated surface coating 3 provided on the surface of
the electrode 2 is introduced in order to prevent a
cross-contamination between the adjacent probe-fixing regions 4.
Since prespecified probe solution is applied to each probe-fixing
region 4 by a pin array device in the order of several hundred pl,
the fluorinated surface coating must be water repellent so that the
probe solution will not run off from the region. The probe-fixing
region 4 can be produced by ashing by oxygen plasma using a mask
and removing the fluorinated surface coating from the surface
having the fluorinated surface coating 3 applied thereto by the
printing technique. The probe-fixing region 4 is produced by the
oxygen plasma ashing, and the ITO electrode 2 exposed in the region
is hydrophilic.
[0801] There is described below a method of fixing the probe on the
surface of the ITO electrode 2 in the probe-fixing region 4. Since
the surface of the ITO electrode 2 is in the oxidation state, the
DNA probe is fixed using the silane coupling reaction. The
condition for implementation of the DNA probe fixing, or the
composition of the buffering solution and the sample DNA probe
follows a method of hybridization described in Nucleic Acids
Research (2002) 30, No. 16 e87. For the method of fixing the probe,
based on the reference described above, the ITO electrode 2 is
processed by 3-aminopropyl-trimethoxysilane and the amino group is
introduced to the surface. The amino group introduced to the
surface is bridged to the SH group on the probe using
N-(11-maleimidoundecanoxyloxy)succinimide. When a probe of about 50
bases is fixed by this method, the probe fixing density is about
one molecule per 15 nm.sup.2.
[0802] Otherwise, according to another method by A. Kumar, et al.
as described in (Nucleic Acids Research (2000) 28, No. 14 e71), the
probe may be fixed by applying the silanized DNA probe having the
trimetoxysilane residue introduced in advance to the 5' end of
synthetic oligonucleotide to the surface of the ITO electrode 2 in
the probe-fixing region 4.
Example 2
[0803] FIG. 108A is a view showing the state in which a sample
liquid including a target polynucleotide is introduced on a surface
of the DNA probe chip 100 described with reference to FIGS. 107A
and 107B, FIG. 108B is a view showing the state in a first step of
a process for forming a concentration gradient of the target
polynucleotide from a solid-liquid interface between a surface of
the DNA probe chip 100 and of a sample liquid toward a sample
liquid, and FIG. 108C is a view showing the state in the next step
for forming the concentration gradient as a cross-sectional
view.
[0804] A suitable spacer (not shown) is inserted onto the surface
of the DNA probe chip 100 to provide a 0.1-mm gap and a cover glass
11 is placed thereon. A 100-nm thick ITO electrode 15 is provided
on the internal surface of the cover glass 11. 40 microliter of
mRNA sample solution 50 is applied to the gap between the surface
of the DNA probe chip 100 and the cover glass 11. The sample
solution 50 allows a slide glass to reciprocate at a constant speed
to be stirred thereby. FIG. 108A shows such a state, and each
reference numeral 12-1, 12-2 and 12-3 is a probe fixed on the
probe-fixing region 4. The reference numeral 14 is a target
polynucleotide diffused in the sample solution 50. In this state,
the target polynucleotide only diffuses based on the diffusion
coefficient of the target polynucleotide.
[0805] FIG. 108B is a view showing the state where the electric
field is applied between the electrode 2 on the DNA probe chip 100
and the electrode 15 on the cover glass 11 by a power supply 25
achieve +15 V/cm (substantially 0.15 V between the electrodes) so
that the electrode 2 is positive. As a result, by achieving the
positive charge on the surface side of the DNA probe chip, the
target polynucleotide 14 and probes 12-1, 12-2 and 12-3 having the
negative charge are electrostatically attracted to the surface of
the DNA probe chip. The electrode 15 does not have to be stuck on
the cover glass 11 but has only to be located apart from the
surface side of the DNA probe chip in the sample solution 50.
[0806] FIG. 108C is a view showing the state where the electric
field is applied between the electrode 2 on the DNA probe chip 100
and the electrode 15 on the cover glass 11 by a power supply 26 to
achieve +15 V/cm (substantially 0.15 V between the electrodes) 30
seconds after the power supply 25 applies voltage so that the
electrode 2 is negative and stirring is continued 0 to 30 minutes.
Since the electrode 2 becomes negative, the target polynucleotide
14 and probes 12-1, 12-2 and 12-3 having the negative charge and
electrostatically attracted to the surface of the DNA probe chip
leave from the surface of the DNA probe chip. The probes 12 leave
in a short time due to the shortness, and the target polynucleotide
14 takes time to leave, and therefore the concentration of the
target polynucleotide 14 in the sample solution 50 is higher on the
side of the surface of the DNA probe chip.
[0807] Namely, as shown in FIG. 108C, when the electric field
inverts, there occurs a repulsive force against the negative charge
in the probe 12 and the negative charge in the target
polynucleotide 14, which works in the direction away from the
surface of the DNA probe chip. The probe 12 tries to move away
faster because of the shortness (smallness) compared with the
target 14, but, being fixed on one end, the probe molecule quickly
rises from the chip surface as a straight chain. On the contrary,
the target polynucleotide has so large a molecule that the motion
is slow and the target polynucleotide stays on the surface of the
DNA probe chip for a longer time. Namely, the concentration of the
target polynucleotide is higher in an area adjacent to the fixed
end of the probe than in an area adjacent to the tip.
[0808] Namely, FIG. 108C shows the state before the hybridization
starts, where the probability of the hybridization of the target
polynucleotide with the probe is higher at the root of the probe
than at the tip. Thus it is more likely to randomly form the core
of the hybridization in a portion of the probe close to the chip
surface, the hybridization advances in the direction from a portion
of the probe close to the substrate to the tip, and the target
polynucleotide effectively hybridizes with the probe on the surface
of the DNA probe chip.
[0809] FIG. 109 is a view showing the effect in Example 2. In order
to evaluate the target polynucleotide captured by the probe 12 as
described with reference to FIGS. 108A, 108B and 108C, the target
polynucleotide is coupled with gold particles and observed varying
the time to capture the target polynucleotide using a condition of
the electric field applied to the DNA probe chip as a parameter.
After cleaning and drying the chip, the number of the gold
particles left on the surface was counted using a scanning electron
microscope. A lateral axis indicates the time of applying the
electric field, and the longitudinal axis indicates the counted
number of the gold particles.
[0810] A characteristic curve 101 indicates the result of the DNA
probe chip capturing the target polynucleotide when -15 V/cm
electric field is applied between the electrodes 2 and 15 by the
power supply 26 after +15 V/cm electric field is applied by the
power supply 25, a characteristic curve 102 indicates the result of
the DNA probe chip capturing the target polynucleotide when no
electric field is applied as a control, and a characteristic curve
103 indicates the result of the DNA probe chip capturing the target
polynucleotide when +15 V/cm is applied by the power supply 25 but
-15 V/cm is not applied by the power supply 26, respectively. The
time of applying the first +15 V/cm in the cases of 101 and 103
herein are the same.
[0811] As clarified by the characteristic curve 101, firstly the
+15 V/cm electric field is applied between the electrodes 2 and 15
by the power supply 25 to electrostatically attract the target
polynucleotide 14 and probes 12-1, 12-2 and 12-3 having negative
charge to the surface of the DNA probe chip. Next, -15 V/cm
electric field is applied between the electrodes 2 and 15 by the
power supply 26 to detach the target polynucleotide 14 and probes
12-1, 12-2 and 12-3 having negative charge from the surface of the
DNA probe chip. By this procedure, the concentration of the target
polynucleotide 14 in the sample solution 50 is higher on the side
of the surface of the DNA probe chip, which results in indicating
that the target polynucleotide has been efficiently captured. As
also seen from the drawing, since the capturable target
polynucleotide becomes saturated as the hybridization advances to a
certain degree, it is unworthy to continue the hybridization
reaction for a long time.
[0812] While this embodiment uses gold nanoparticles as a marker, a
sequence code 11 labeled by Cy3 fluorescent material may be used as
a sample to result in the similar tendency. Namely, in the case the
fluorescent marker is used, the longitudinal axis in FIG. 109 may
be replaced by the relative fluorescence intensity.
[0813] By only applying +15 V/cm electric field between the
electrodes 2 and 15 by the power supply 25 to electrostatically
attract the target polynucleotide 14 and probes 12-1, 12-2 and 12-3
having negative charge to the surface of the DNA probe chip, even
if the electric field is removed, the attracted probes do not line
up in order as shown in FIG. 108C, therefore it is difficult to
advance the hybridization reaction.
[0814] When no voltage is applied, since there does not occur the
concentration gradient of the target polynucleotide 14 in the
sample solution 50, the capture rate of the target polynucleotide
14 is naturally low.
[0815] In order to charge the surface of the DNA probe chip
positive, it is achievable not only by disposing the electrodes on
the surface of the DNA probe chip and in a portion of the sample
solution away from the surface of the DNA probe chip and applying
voltage to charge the surface of the DNA probe chip positive as
described above, but also by preparation by introducing the
positively dissociated residue (positive charge) to the surface of
the DNA probe chip. A reference numeral 6 in FIG. 108B (an
indication of + and a surrounding circle) indicates the positively
dissociated residue (positive charge). In the case where the
surface of the DNA probe is charged positively by introducing the
positively dissociated residue (positive charge) to the surface of
the DNA probe chip, the electric field applied from the outside may
be only an electric field for inversion as shown in FIG. 108C.
Example 3
[0816] In Example 3, hybridization of a probe with a target
polynucleotide is illustrated. In this example hybridization is
performed taking into consideration an effect of a nuclear for
hybridization and a direction of the hybridization.
[0817] FIG. 110A is a view schematically showing the situation in
which a probe 12-3 and a target polynucleotide 14 hybridize with
each other using a root portion of the probe 12-3 (a portion close
to a surface of the DNA probe chip) as a nuclear for hybridization,
and FIG. 110B is a view schematically showing the situation in
which the probe 12-3 and the target polynucleotide 14 hybridize
with each other using a tip portion of the probe 12-3 (a portion
close to a free terminal of the DNA probe chip) as a nuclear for
hybridization.
[0818] In FIG. 110A and FIG. 110B, reference numerals 21 and 22
indicates a portion which functions as a nuclear for hybridization.
With reference to FIG. 110A, when a side where the probe is fixed,
namely a root portion (a surface of the tip) of the probe is used
as a nuclear for hybridization, the target polynucleotide twists
around the probe (forming a double strand) at a direction of
spacing away from the surface of the tip. In this case, there is
little steric interruption since hybridization is developed to the
direction of spacing away from the surface of the tip. Further, it
could be well understood that there is little interruption also
from a situation that the target polynucleotide is not twisted
around a tip portion of nearest-neighbor prove. On the other hand,
with reference to FIG. 110B, when the tip portion (a free terminal)
is used as a nuclear for hybridization, macromolecule of the target
polynucleotide collides with a nearest-neighbor probe or the
surface of the tip under a process of twisting around the probe DNA
(forming a double strand) and it could be well understood that
twisting speed becomes slow due to this steric interruption.
[0819] For making a root portion (a surface of the tip) of the
probe function as a nuclear for hybridization, it is useful to draw
the target polynucleotide 14 in the sample liquid 50 to the surface
of the DNA probe tip, and also to make larger the concentration
gradient of the target polynucleotide 14 in the sample liquid 50
near the surface of the DNA probe tip as described. In this
example, descriptions are provided for an example in which the root
portion (a surface of the tip) of the probe is used as a nuclear
for hybridization by devising a sequence of the probe.
[0820] As a probe, a sequence of 50-base length from human mRNA
sequence is extracted for use. The 20-base segment near a substrate
and another sequence segment having more than 15% GC content
different from the remaining portion are used preferentially.
Namely GC content near the 20-base segment is made higher. If this
kind of modification is impossible in the sequence, the probe
sequence is designed with a sequence mismatching the cDNA sequence
forming a template from a position around the 10th base up to a
position around the 30th base each from the free terminal or a
blank sequence not forming a stable complementary strand with any
ACGT is used for designing the probe sequence. But the mismatch
sequence and the blank sequence can be inserted at maximum two
places in this range because excessive insertion lowers the
stability. It is important to control the stability of
hybridization in the manner as described above for forming a
nuclear for hybridization near a fixed terminal of the probe.
[0821] As a specific example, a complementary sequence (SEQ No. 10)
for the segment sequence of bases 918 to 967 of mRNA of PON1 (Homo
sapiens paraoxonase 1) is used as a probe sequence:
TABLE-US-00013 (SEQ ID NO: 9) 5'-AAAAUCUUCU UCUAUGACUC AGAGAAUCCU
CCUGCAUCAG AGGUGCUUCG-3': (SEQ ID NO: 10) 5'-CGAAGCACCT CTGATGCAGG
AGGATTCTCT GAGTCATAGA AGAAGATTTT-3':
[0822] In this example, in order to compare a case in which a
nuclear for hybridization is formed near a surface of the substrate
to a case in which a nuclear for hybridization is formed far from a
surface of the substrate, a probe having the base sequence of SEQ
No. 10 is fixed at the 5' terminal thereof to the probe fixed
domain 4 of one DNA probe chip using any of the methods described
above. At the same time, a probe having a base sequence of the same
SEQ No. 10 is fixed at the 3' terminal to the probe fixed area 4 of
other DNA probe chip. When a sequence of the probe 2 is divided to
units each including 10 bases and GC % in each unit including 10
bases is calculated, it is observed that the CG % is 60%, 60%, 40%,
40% and 20% from the side of 5' terminal. Namely, when this probe
is fixed at the 5' terminal thereof and is used for hybridization,
20 mer in the side of the 5' terminal is hybridized first, and the
hybridization area extends from the portion above as a nuclear for
hybridization to the 3' terminal of the probe. On the other hand,
this probe is fixed at the 3' terminal and is used for
hybridization, 20 mer in the 5' terminal, namely in the free
terminal of the probe hybridizes first, and hybridization area
extends to the side of the 3' terminal (a surface of the tip) of
the probe using this area as a nuclear.
[0823] A method for preparing a sample for hybridization will be
described below. A synthetic single-stranded DNA is used as a
sample. The model employed in this example has the full length of
90 bases and has a complementary sequence for SEQ No. 2 at the core
portion and the core portion is conjugated at both terminals
thereof to poly A (indicating as A.sub.20) including 20 bases.
TABLE-US-00014 (SEQ ID NO: 11) 5'-A.sub.20-AAAATCTTCT TCTATGACTC
AGAGAATCCT CCTGCATCAG AGGTGCTTCG-A.sub.20-3':
[0824] Gold nanoparticle having a diameter of 10 nm is conjugated
to either the 5' terminal or 3' terminal. The gold nanoparticle can
be labeled by introducing alkane SH into either the 5' terminal or
3' terminal when a sample is synthesized.
[0825] FIG. 111 is a view showing a comparison between a result
obtained when a sample with SEQ No. 11 is processed with the DNA
probe chip with the probe with SEQ No. 10 fixed at the 5' terminal
thereof (as indicated by a characteristic curve 111) and a result
obtained when the sample with SEQ No. 10 is fixed at the 3'
terminal thereof (as indicated by a characteristic curve 113). The
conditions employed in this comparison are the same as those in
FIG. 109 showing a result of Example 2 excluding the conditions for
applying an electric field.
[0826] Namely, when the probe with SEQ No. 10 is fixed at the 5'
terminal thereof, 20 mer at side of 5' terminal (a surface of DNA
probe chip) is hybridized first, and then the hybridization area
extends a side of probe 3' terminal using this area as a nuclear,
thus hybridization being developed rapidly as described in FIG.
110A. On the other hand, when this probe is fixed at the 3'
terminal thereof and is used for hybridization, the 5' terminal,
namely the free terminal of the probe of 20 mer is hybridized
first, and then using this point as a nuclear, the hybridization
area extends to the side of the 3' terminal of the probe (a surface
of the tip), thus hybridization being developed slowly as described
in FIG. 110B.
[0827] FIG. 111 specifically illustrates the above statement.
[0828] In this example, gold nanoparticle is used for a labelling,
but when the SEQ No. 11 labeled with Cy3 fluorescent material is
used as a sample, a result indicating the same tendency can be
obtained.
Example 4
[0829] For forming a nuclear for hybridization in the neighborhood
of the substrate more easily, as described in the Example 2, it is
one of the important items to make a probe act quickly. Example 4
relates to the probe which is designed based on this viewpoint.
[0830] FIG. 112 is a view schematically showing a case of where the
probe in Example 4 is used in the case shown in FIG. 110A showing
the situation in which a probe 12-3 and a target polynucleotide 14
hybridize with each other using a root portion of the probe 12-3 (a
portion close to a surface of the DNA probe chip) as a nuclear for
hybridization.
[0831] In Example 4, an excessive amount of dissociation group 24
is introduced into the terminal in the opposite side (free
terminal) against to the fixed terminal where the probe 12-3 is
fixed on the surface of the DNA probe chip. As the dissociation
group 24, a negatively charged group such as sulfuric acid group or
phosphoric acid group may be used. A larger effect can be obtained
by using molecules or particles containing a large amount of minus
residue of the dissociation group 24. Because the free terminal of
the probe 12-3 has a minus charge, as described in FIG. 108B, after
attracting the target polynucleotide 14 and the probe 12-3 to the
surface portion of the DNA probe chip electrostatically by the
surface portion of the DNA probe chip positively charged, an
electric field is reversed by the power source 26, and then a
stronger repelling force acts with the negative charge 24 at the
probe tip, so that the probe 12-3 acts quickly.
[0832] Also when the positively charged residue 6 is constantly
introduced to the surface portion of the DNA probe, the same effect
is obtained. So long as any specific operation is not performed to
the surface portion of the chip, as the surface portion is always
kept with a positive charge because of the introduced positive
static charge, the probe and the target polynucleotide 14 are
absorbed on the surface portion as described in FIG. 108B. In this
situation, by adding minus charge that is more than that enough for
canceling the positive charge on the surface of the electrode 2 as
well as the opposite electrode 15 on the chip surface, the probe
with an excessive amount of minus charge introduced to the fee
terminal side quickly acts. The target oligonucleotide 14 has the
larger size than the probe 12-3 and moves more slowly, so that a
nuclear for hybridization is formed at a position closer to the
probe substrate, and hybridization develops towards the probe tip.
For making the system described above act effectively, it is
preferable that the probe should preferably have the 30 to 50-base
length.
Example 5
[0833] In order to make the twenty-first embodiment of the present
invention more effective, it is preferable to eliminate a charge of
probe itself and introduce a large amount of minus charge to the
free terminal of the probe. For instance, PNA (Peptide Nucleic
Acid) in which a phosphodiester bond of synthetic oligonucleotide
is changed to a peptide bond, or CAS (Cysteine Antiesnse Compound)
which includes S-carboxydimethyl-L-cysteine as a base frame may be
used as a non-charged probe.
[0834] Since main chains of the polymer PNA and CAS have no charge,
an electrostatic repelling force does not work with the target
polynucleotide. As they have amino group and carboxyl group on the
terminals thereof respectively, when an amino group is used at the
fixed terminal, the fee terminal is naturally changed to a
negatively charged carboxyl group. Further it is possible to make
the probe act quickly in response to the electrode on the surface
of the substrate by introducing a large amount of minus charge with
residues having minus charge like in Example 4. As the PNA and CAS
do not have an electric charge in the main chain, a repelling force
does not work with the target polynucleotide. When a space for
hybridization is provided by making the probe act, the probe is
quickly hybridized with the target polynucleotide 14.
[0835] When the PNA and CAS are fixed as a probe, the following
process is employed. An activate silanol group is formed by
hydrolysis of a methoxy group by keeping 0.5% solution of
3-glycidoxypropyltrimethoxysilane for 30 minutes at the room
temperature (25.degree. C.) (0.5% of acetic acid is included as a
catalyst. When the silane coupling agent cannot be dissolved,
acetic acid is added until the silane coupling agent is dissolved).
This activate silanol solution is coated on the substrate surface
and keep at the room temperature for 45 minutes. A substrate having
an ITO-electrode with glycidoxypropyl group introduced therein with
covalent bond is obtained by blowing off remained solution on the
substrate after washing it with pure water and then heating the
substrate at 105.degree. C. for 30 minutes in the air. A part of
the atomic group constituting the introduced glycidoxypropyl group
is epoxy group with high reactivity with an amino group. A mixed
solution containing 10 pmol/.mu.l of PNA or CAS having the amino
group and 25 to 100 .mu.M of Lys, pH 10 is coated on the substrate.
Lys is mixed in the solution for the purpose to fix the PNA or the
CAS on the substrate uniformly and also to prevent the fixing
density of the PNA or the CAS from being too high (when only the
PNA or the CAS is mixed in the solution without Lys, the substance
attacks a surface of ITO, and places with high mixing density and
low mixing density are generated as islands). The solution is
reacted for one hour at 50.degree. C. With the reaction described
above, a probe chip with the PNA or the CAS fixed thereon can be
obtained.
[0836] A substrate surface obtained from the above probe fixation
is electrically neutral. Next, a method for preparing a positively
charged is described below. 25 to 100 .mu.M arginine oligomer
(L-Arg).sub.6 (SEQ ID NO: 17) is mixed in and reacted to the DNA
probe used in the method described above. When the probe is the PNA
or the CAS, arginine oligomer is added in place of Lys. Thereby, a
probe chip having a positively charged substrate surface can be
obtained.
[0837] Even when controlling the electrode by applying an electric
field thereto like in Example 2, an effect of the electric field is
not remarkable since a probe to be fixed has no electric charge.
However, when a sulfonic acid group is introduced to the free
terminal of probe, the same effect is obtained as that obtained by
introduction of an excessive mount of dissociation group 24
described in Example 4, and an extremely high speed hybridization
can be carried out. When a sample liquid is added, the target
polynucleotide having minus charge in the sample liquid is
condensed on the ITO-electrode surface with the probe fixed thereon
because of the plus charge on the substrate surface. When the
electric field is reversed, minus charge of the sulfonic acid group
introduced into the fee terminal of the probe repels the electric
field, so that the probe acts quickly. Also in this example, like
in Example 3, when the probe is fixed to be GC rich near the
substrate, hybridization progresses faster with the yield
higher.
[XXII] Twenty-Second Embodiment
[0838] A twenty-second embodiment of the present invention provides
a device of and a method of preparing a DNA probe chip having the
features of improved hybridization rate performed on a surface of a
solid-state chip, as described in a twenty-first embodiment above,
being measured in a shorter time, having higher sensitivity, and
having less possibility of performing pseudo-positive
hybridization, and a method of performing hybridization in the DNA
probe chip thereof. In the twenty-first embodiment, the improvement
can be achieved mainly by adding dissociation groups each having
negative charge to one end of the DNA probe which is the opposite
to the other end fixed to the probe fixed area of the DNA probe. In
this twenty-second embodiment, an improvement can be achieved by
dividing a whole DNA probe area into three areas and modifying the
base sequence of the area closest to a fixed end of the DNA probe
thereof so that the base sequence thereof becomes complementary to
the base sequence of the target polynucleotide thereof. Apart from
this feature, the twenty-second embodiment is the same as the
twenty-first embodiment.
[0839] FIG. 113 is a view schematically illustrating a status that
one end of probe 12-1 is fixed to a probe fixed area 4 according to
the twenty-second embodiment. The DNA probe 12-1 is divided into
areas in order from the probe fixed area 4. The sequence of the
probe is divided into at least three areas, and the hybridization
stability of each area is independently controlled. More
specifically, modifications are made so that the hybridization
stability of the area closest to the probe fixed 4 should be higher
than that of any other areas. The length of a first area 33-1 which
is closest to the probe fixed area 4 is approximately 15 to 20
bases long, and the sequence of the area is substantially
complementary to the base sequence of the target polynucleotide
thereof. The length of a second area 33-2 is 15 to 20 bases long,
and at least one third of this area included therein are base
sequence, indicated by the reference numeral 27, that would not
form any complementary hydrogen bonding with any of A, C, G, and T
base sequence or should be non-complementary to the target
polynucleotide thereof. The base sequence of a third area 33-3 is
substantially complementary to the target polynucleotide thereof.
But it is important that the hybridization stability of the third
area should be lowered than that of the first area, for instance,
by making the length of the third area shorter than that of the
first area.
[0840] In the probe 12-1 that has been modified as described above,
the hybridization stability of the first area is higher than that
of the second and third areas. The base sequence in the third area
33-3 is substantially complementary to the target polynucleotide
thereof, so hybridization is to be performed there. But, as
mentioned above, the hybridization stability of the first area is
higher than that of the third area, eventually, the hybridization
is to be started in the first area first.
[0841] Because of this feature, in general, the hybridization with
the target polynucleotide thereof can be started in the probe fixed
area 4 of the probe first. But when the probe specificity and probe
stability are taken into consideration, it is noted that the
appropriate length of such probes should be in the range between 40
to 60 bases long. When the length of the first area is too long, it
might become difficult to perform hybridization in or around the
probe fixed area 4 first. And there is another problem when the
length of the second area is too long. It is still acceptable if
the sequence of the second area is more AT-rich than that of the
first area. But otherwise, it is then necessary to introduce some
bases that would not perform hybridization with the target
polynucleotide thereof or the other mismatch bases into the second
area. This modification might affect the hybridization specificity
thereof. It might be important to limit the number of bases to be
modified to 1 to 3 bases out of every 9 bases. Because of this
feature, the base length of the second area should be approximately
20 bases long at the maximum. The third area 33-3 has the role to
increase the hybridization stability of the first area higher than
that of any other areas while the whole base length of the probe is
to be adjusted as previously determined. Namely, it is most
preferable that the hybridization stability level of each area
should be arranged as follows: the first area>the third
are>the second area. The length of the base sequence of the
probe as a whole should be in the range between 30 to 50 bases
long.
[0842] In one example, the sequence of 940 through 989 base portion
(SEQ. ID. NO. 12) of the mRNA of PON1 (Homo sapiens paraoxonase 1)
is used as the probe sequence. Obviously, the probe should be
prepared chemically.
TABLE-US-00015 (SEQ ID NO: 12) 5'-AGAATCCTCC TGCATCAGAG GTGCTTCGAA
TCCAGAACAT TCTAACAGAA -3':.
[0843] The 5' end of the probe having the SEQ. ID. NO. 12 is fixed
to the probe fixed area 4. The sequence of the probe is divided
into sections every 10 bases, and the GC-percent of each section is
calculated. The results of the GC-percent of those sections from
the 5' end are 50%, 50%, 50%, 40%, and 30% respectively. Therein,
the first 20 bases at the 5' end, the next 21 to 30 bases, and 31
to 50 bases are defined herein as the first area 33-1, the second
area 33-2, and the third area 33-3 respectively. The GC-amount in
the second area is so large that the possibility that the
hybridization performed in the first area first may be decreased
and the possibility that the hybridization performed in the second
are first may be then increased. To correct it, the bases thereof
are changed to lower the hybridization stability in the range
between 20.sup.th and 30.sup.th bases thereof. In addition, the
bases in the second area are apt to have a palindrome structure, so
the bases are changed so as not to constitute such palindrome
structure. The probe sequence after being changed as described
above is given below as SEQ. ID. NO. 13.
TABLE-US-00016 (SEQ ID NO: 13) 5'-AGAATCCTCC TGCATCAGAG GTGBTTBGAA
TCCAGAACAT TCTAACAGAA-3':
[0844] Therein, the base "B" should be either a pseudo-base that
would not form a stable complimentary chain with any bases or a
base non-complementary to the target polynucleotide thereof. For
instance, either a spacer consisting of only sugar chains without
having any base section therein or a pseudo-base with atoms having
large atomic radius in the base section introduced therein such as
2-thiouracil is to be used. The 2-thiouracil would not be able to
form a stable hydrogen bonding with Cytosine which lies in the
opposite base in the sequence of the target polynucleotide thereof.
The atomic radius of sulfur atoms introduced in the bases thereof
is so large that it may be impossible to form hydrogen bonding with
Guanine. When base "A" is introduced as the base "B", it may cause
mis-hybridization with base "C", so base "A" can not be used. In
this case, however, it is practical to change the base into "T" or
2-Thiouracil as the base "B". To prepare mismatch bases, change the
bases in the probe so that the A-G, A-A, C-C, or T-T mismatching
should be prepared.
[0845] The sequence of the probe having modified sequence of SEQ.
ID. NO. 13 is divided into sections every 10 bases in order, and
the GC-percent of each section is calculated. The results of the
GC-percent of those sections from the 5' end are 50%, 50%, 30%,
40%, and 30% respectively. When the hybridization is to be
performed with the modified probe, the hybridization starts in the
20 bases at 5' end, and then the hybridization expands its range to
the 3' end of the probe thereof.
[0846] A method of preparing a sample for the hybridization is
provided below. A synthetic single-stranded DNA is used as the
sample. As a model, the sequence complementary to SEQ. ID. NO. 12
is used as the core section thereof, and Poly A (referred to as
A.sub.20 hereinafter) consisting of 20 bases are bonded before and
after the sequence thereof to prepare 90 bases long sequence as a
whole.
TABLE-US-00017 (SEQ ID NO: 11) 5'-A.sub.20-TTCTGTTAGA ATGTTCTGGA
TTCGAAGCAC CTCTGATGCA GGAGGATTCT-A.sub.20-3'
[0847] Therein, the 5' end of the probe is coupled with the
Sulforhodamine 101, the fluorescent dye, which used to assay the
hybridization.
[0848] Therein, two cases are prepared: one case is that the
hybridization start on or around the surface of the probe fixed
area 4, and the other case is that the hybridization start far from
the surface of the probe fixed area 4. To compare the effects of
hybridization between two DNA probe chips, two different DNA probe
chips are prepared. Namely, the 5' end of the probe with the base
sequence of SEQ. ID. NO. 13 included therein is fixed at the probe
fixed area 4 of one DNA probe chip is prepared by one of the
above-mentioned methods. Simultaneously, the 5' end of the probe
with the base sequence of SEQ. ID. NO. 12 included therein is fixed
at the probe fixed area 4 of the other DNA probe chip is also
prepared.
[0849] With above two different DNA probe chip, the following
experiment is conducted. 0.1 mm gap is created with a spacer and a
cover glass is put on the chip, and 40 micro litter of DNA for
fluorescent labeling according to the SEQ. ID. NO. 11 is added
thereto. The sample is stirred by pumping the slide glass with the
sample included therein with a constant rate. Then the electric
field is applied so that the electric field at electrode 4-1
between the electrode 2 and the opposite electrode 3 becomes
+15V/cm (effectively 0.15 V between those electrodes). The mRNA in
the sample solution is swiftly pulled to the ITO electrode section
on a substrate. After 30 seconds, -15V/cm of electric field is
applied to the electrode 4-1, and the mixing continues for the
period between 0 and 30 min. It is cleaned and the fluorescence
(excited 545 nm, fluorescent 520 nm or more) intensity from the
element surface is measured.
[0850] FIG. 114 is a view illustrating the comparison of results
between two cases; one case is that the sample with the sequence of
SEQ. ID. NO. 11 included therein is processed with the DNA probe
chip with the probe having the sequence of SEQ. ID. NO. 13 fixed at
the 5' thereof (shown in the characteristic curve 111), and the
other case is that the same sample is processed with the DNA probe
chip with the probe having the sequence of SEQ. ID. NO. 12 fixed at
the 5' thereof (shown in the characteristic curve 113). Therein,
other conditions such as applied electron field are the same as
those in FIG. 109 showing the results of Example 2. Obviously, the
fluorescent intensity 111 from the element with the probe with the
sequence of SEQ. ID. No. 13 fixed thereto can increase faster than
the fluorescent intensity 113 from the element with the probe with
the sequence of SEQ. ID. NO. 12 fixed thereto. This result also
shows that, when stable hybridization could be performed at the 5'
end with the probe fixed thereto more easily than any other areas,
the rate of the hybridization thereof would become faster. In other
words, when the bases on and around the 5' end fixed to the probe
fixed area 4 is more GC-rich than bases on and around 3' end, the
hybridization can start in the bases around the substrate and
proceeds to the free end without being largely affected by the
steric hindrance or the solid surface. And this is important when
the DNA probe chips are designed.
[XXIII] Twenty-Third Embodiment
[0851] A twenty-third embodiment of the present invention
discloses, like in twenty-first embodiment and twenty-second
embodiment, a DNA chip enabling a higher speed hybridization on a
solid chip surface and measurement within a short period of time
and also rarely inducing quasi-positive hybridization, a method of
preparing the DNA chip, and a method of inducing hybridization on
the DNA probe chip. In the twenty-first embodiment, improvement is
provided mainly by adding an dissociation group having a negative
charge to a terminal different from that fixed to a probe fixing
area on the DNA probe, and in the twenty-second embodiment,
improvement is provided by using a DNA probe consisting of three
areas and providing a sequence substantially complementary to the
target polynucleotide at the area closest to the fixed edge of the
DNA probe. In contrast, in the twenty-third embodiment, the
improvement is provided mainly by making larger a probe fixing area
of the DNA probe. Other features are the same as those in the
twenty-first and twenty-second embodiments.
[0852] The twenty-third embodiment is described in detailed with
reference to the related drawings.
Example 1
[0853] FIG. 115A is a plan view showing outline of a DNA probe chip
advantageously available for carrying out the twenty-third
embodiment; FIG. 115B is a cross-sectional view showing the outline
shown in FIG. 115A taken along the line A-A and viewed in the
direction indicated by the arrow; and FIG. 115C is a
cross-sectional view showing details of a probe fixing area of the
DNA probe chip advantageously available for carrying out the
twenty-third embodiment.
[0854] Reference numeral 1 indicates a fused quartz-glass sheet
(20.times.40 mm) as a DNA probe chip. Reference numeral 2 indicates
and electrode, which is deposited on a surface of the substrate 1.
The electrode is ITO (Indium-Tin Oxide) having the size of
10.times.10 mm and the thickness of 300 nm. Reference numeral 3 is
a fluorine surface coating with the thickness of 10 nm formed on a
surface of the ITO electrode 2. The fluorine surface coating 3 is
provided to prevent cross contamination between the adjoining probe
fixing areas 4. A prespecified probe solution is applied on each of
the probe fixing areas 4 with a pin array device with the order of
several hundreds pl, and therefore the water-repulsive
characteristic is required for the fluorine surface coating 3 to
prevent the probe solution from overflooding from the area. The
probe fixing area 4 can be prepared by ashing a surface of the
fluorine surface coating 3 applied by printing using a mask with
oxygen plasma to remove the fluorine surface coating. For preparing
the probe fixing area 4 by means of oxygen plasma ashing, the ITO
electrode 2 exposed in this area is required to be hydrophilic.
[0855] FIG. 115A shows a large disk consisting of 4.times.4 probe
fixing areas 4, but the actual probe fixing area 4 has a diameter
of around 30 .mu.m.phi., so that, for instance, 100.times.100 probe
fixing areas 4 may be provided. A space between the adjoining probe
fixing areas 4 is about 60 .mu.m, and further the adjoining probe
fixing areas 4 are separated from each other by the fluorine
surface coating.
[0856] Reference numeral 7 indicates a pillar. To raise the
reaction speed or reaction yield, it is preferable to use as many
probes as possible in the probe fixing area 4, but when the probe
density is raised, the hybridization efficiency drops due to the
electrostatic repulsive force. In Example 1, probes are fixed with
the average space inbetween of 10 to 30 nm. A density higher than
this level is not preferable in use of the ordinary polynucleotide
probe, and when a probe length is as long as 50-bases
polynucleotide, the density is preferably in the range from 10 to
60 nm. In the twenty-third embodiment, the probe density is not
made higher, but the pillar 7 is provided on a surface of the
electrode 2 forming the probe fixing area 4 to enlarge the
substantial area of the probe fixing area 4, and with this
configuration, it is possible to increase a number of probes fixed
thereon.
[0857] The pillar 7 is formed on a surface of the ITO electrode in
the probe fixing area 4 by applying the epoxy-based rein SU8 with a
spinner on a surface of the substrate 1 having the fluorine surface
coating 3 thereon and irradiating light thereon with a mask. Height
of the pillar 7 is 50 .mu.m and a diameter of the base section is
10 .mu.m. A space between the pillars 7 is 15 .mu.m. As compared to
the case in which probes are fixed without providing the pillars,
the probe fixing area can be increased about 7 times. Reference
numerals 5-1, 5-2 are elements each indicating a group of pillars 7
formed on the probe fixing area 4.
[0858] It is conceivable to employ the sand blast method to
increase a surface of the probe fixing area 4 in stead of providing
the pillars 7, but in this case the aspect ratio can not be made
larger, and the can be increased at most two times.
[0859] Two methods of fixing probes on a surface of the ITO
electrode 2 in the probe fixing area 4 are described below. In the
first method, oxygen plasma is irradiated, and then polylysine is
coated with UV rays irradiated thereto to introduce an amino group
into a surface of the pillar 7. For fixing the DNA probe, a
bivalent reagent is used. For instance, when
N-(8-maleimidocapryloxy) sulfosuccinimide is reacted, the
sulfosuccinimide at pH 8 ester portion reacts to an amino group in
lysine, so that a maleimido group is introduced into a surface of
the pillar 7. When a synthetic DNA probe with an SH group
introduced to the 5' terminal is added at pH 6.5, the SH group
present in the DNA probe reacts the maleimido group, and therefore
the DNA probe is fixed on a surface of the pillar 7. Alternatively,
after polylysine is coated, the surface is modified with succinic
acid anhydride to introduce a carboxylic group into the amino
group. N-hydroxysuccinimide is ester-bonded thereto to convert the
carboxylic group to an active ester. A synthetic DNA probe having
an amino group at the 5' terminal may be added to fix the probes on
a surface of the pillars by means of peptide bond. In the second
method, the pillars formed with SU8 are processed with oxygen
plasma, and then a functional group is introduced by making use of
the silane coupling reaction. When SU8 is subjected to processing
with oxygen plasma, an OH group or radial oxygen is generated on
the surface. These are unstable residues and decrease with elapse
of time, so that the chip is immediately immersed in 0.5%
N-(.beta.-aminoethyl)-.gamma.-aminopropyltrimethoxysilane
(previously kept at the room temperature for 30 minutes to provide
an activated silane coupling solution) and left in the state for
one hour. After rinsed with deionized water, the reaction product
is dried at a temperature in the range from 105 to 110.degree. C.
With this operation, an amino group is introduced also to the
pillar section coated with SU8. The amino group is modified with
succinic acid anhydride to introduce a carboxyl group into the
amino group. N-hydroxysuccinimide is conjugated thereto by ester
bond to convert the carboxyl group to an active ester. A synthetic
DNA probe having an amino group at the 5' terminal is added to fix
the probes to a surface of the pillar by peptide bond.
Example 2
[0860] FIG. 116A shows the state in which a sample solution
containing a target polypeptide therein is introduced into a
surface of the DNA probe chip 100 described with reference to FIG.
115A to FIG. 115C; FIG. 116B shows the state in which the first
step for forming the concentration gradient of the target
polypeptide from an solid-liquid interface between a surface of the
DNA probe chip 100 and the sample solution toward the sample
solution; and FIG. 116C shows the state in which the next step for
forming the concentration gradient of the target polypeptide is
executed. Each state shown in the figures above is shown as a
cross-sectional view.
[0861] A proper spacer (not shown) is set on a surface of the DNA
probe chip 100 and a glass cover is placed over the spacer with a
gap of 0.1 mm. An ITO electrode 15 with the thickness of 100 nm is
provided on an inner surface of the cover glass 11. 40 .mu.l of
mRNA sample solution 50 is added between a gap between the surface
of the DNA probe chip 100 and the cover glass 11. The sample
solution 50 is agitated by reciprocally moving the slide glass at a
constant speed. FIG. 116A is a cross-sectional view showing the
state, and reference numerals 12-1, 12-2, and 12-3 indicate probes
fixed on a surface of the pillar 7 on the probe fixing area 4.
Reference numeral 14 indicates target polypeptide distributed in
the sample solution 50. In this state, the target polypeptide is
diffused according to a diffusion coefficient of the target
polypeptide.
[0862] FIG. 116B is a cross-sectional view showing the state an
electric field (actually 0.15 V between the electrodes) is applied
by the power source 25 to a section between the electrode 2 on the
DNA probe chip 100 and the electrode 15 on the cover glass 11 so
that the electrode 2 is positively charged with +15 V/cm. As a
result, the surface of the DNA probe chip 100 is positively
charged, so that also the probes 12-1, 12-2, and 12-3 attracting
the negatively charged target polypeptide 14 electrostatically to a
recess between pillars 7 on the probe fixing area 4 (on a surface
of DNA probe chip) are attracted to the electrode, and therefore it
is conceivable that, as one terminal of a probe molecule is sized,
a free terminal thereof is attracted to the electrode and the probe
molecule extends along a side face of the pillar. The electrode 15
is not always required to be adhered to the cover glass 11, and is
required only to be off from a surface of the DNA probe chip in the
sample solution 50.
[0863] FIG. 116C is a cross-sectional view showing the state in
which an electric field (actually 0.15 V between electrodes) is
applied, in 30 seconds after a voltage is applied by the power
source 25, to a section between the electrode 2 on the DNA probe
chip 100 and the electrode 15 on the cover glass 11 by the power
source 26 so that the electrode 2 is charged with -15 V/cm and
agitation is performed for 0 to 30 minutes. Because the electrode 2
is negatively charged, the negatively charged target polypeptide 14
having been electrostatically attracted to recess between the
pillars 7 on the probe fixing area 4 (on the surface of the DNA
probe chip) starts moving from the recess between the pillars 7 (on
the surface of the DNA probe chip) toward the electrode 15.
[0864] In other words, as shown in FIG. 116C, when the electric
field is reversed, a repulsive force works between a negative
charge of the electrode 2 and that of the target polypeptide 14,
and therefore the target polypeptide 14 moves away from the surface
of the DNA probe chip. In this step, the target polypeptide is
larger and moves slowly, so that the provability of hybridization
between the target polypeptide and the DNA probe fixed on a surface
around a recess between the pillars 7 becomes higher.
[0865] FIG. 117 is a view showing the effects provided in Example
2. For assessing the target polypeptide captured by the probe 12 as
described with reference to FIG. 116A, FIG. 116B, and FIG. 116C, a
fluorescent coloring matter is used for labeling the target
polypeptide to detect the fluorescence. Also nanoparticles such as
gold colloid may be used for labeling and a number of particles is
directly counted, and in this case, the tomographic technique may
be used for reorganizing a plurality of images with a scan
electronic microscope.
[0866] Changing a period of time for capturing the target
polypeptide, amplitude of fluorescence emitted from the substrate
after cleaning is examined with reference to conditions of an
electric field applied to the DNA probe chip as a parameter. This
figure is plotted with the horizontal axis for a period of time for
application of an electric field and with the vertical axis for
fluorescence amplitude.
[0867] The characteristic curve 101 in FIG. 117 shows a result of
capturing of target polypeptide by the DNA probe chip when an
electric field of +15V/cm is applied by the power source 25 to a
section between the electrodes 2 and 15 and then an electric field
of -15V/cm is applied by the power source 26 to the section between
the electrode 2 and electrode 15; the characteristic curve 102
shows a result of capturing of target polypeptide by the DNA probe
chip when no electric field is applied as a control; and the
characteristic curve 103 shows a result of capturing of target
polypeptide by the DNA probe chip when an electric field of +15V/cm
is applied by the power source 25 to a section between the
electrodes 2 and 15 and but an electric field of -15V/cm is not
applied by the power source 26 to the section between the
electrodes 2 and 15. In the cases indicated by the characteristics
curves 101 and 103, the +15V/cm is applied for the same period of
time.
[0868] As clearly indicated by the characteristic curve 101, at
first an electric field of +15V/cm is applied by the power source
25 to a section between the electrodes 2 and 15 to
electrostatically attract the negative charged target polypeptide
14 to the recess between pillars 7 (on a surface of the DNA probe
chip). Then an electric field of -15V/cm is applied by the power
source 26 to the section between the electrodes 2 and 15 to
electrostatically separated the negatively charged target
polypeptide 14 having been attracted to the recess between the
pillars 7 (on a surface of the DNA probe chip) from the recess
between the pillars 7 (on a surface of the DNA probe chip). By
carrying out the steps above, the target polypeptide 14 in the
sample solution 50 has the density gradient higher at a position
closer to the recess between the pillars 7 (on a surface of the DNA
probe chip). This result indicates that the target polypeptide is
captured efficiently. Also as understood from the figures, at a
point of time when hybridization proceeds to some extent, the DNA
probe chip is saturated with captured target polypeptide, so that
the hybridization reaction is not required to be executed for a
long time.
[0869] When the negatively charged target polypeptide 14 is
electrostatically attracted to the recess between the pillars 7 (on
a surface of the DNA probe) by applying the electric field of
+15V/cm to the section between the electrodes 2 and 15 with the
power source 25, even if the electric field is removed, the
attracted target polypeptide 14 is not distributed on a surface of
the pillar 7 as shown in FIG. 116C, and in this case the
hybridization reaction does not smoothly proceed.
[0870] When no voltage is applied, the density gradient of the
target polypeptide 14 is not generated in the sample solution 50,
and naturally the target polypeptide 14 is not captured so
well.
[0871] In the example described above, a direction in which an
electric field is applied is reversed only once, but may be
reversed several times. In this case the states shown in FIG. 116B
and FIG. 116C are repeatedly reproduced, and the target polypeptide
14 not hybridized yet is distributed at a higher density around the
DNA probe on the surface of the pillar 7, so that the provability
of capturing the target polypeptide 14 can be improved.
Example 3
[0872] In Example 2, there is provided no comment on with which
form the DNA probe and target polypeptide should preferably
hybridize with each other, but also in the twenty-third embodiment,
hybridization proceeds more smoothly when a root portion of the DNA
probe is used as a nuclear for hybridization. In this example,
descriptions are provided for contrivance for utilization of a root
portion of the DNA probe as a nuclear for hybridization.
[0873] To utilize a root (chip surface) of a probe as a nuclear for
hybridization, it is effective, as described above, to attract the
target polypeptide 14 in the sample solution 50 to the surface of
the DNA probe chip to realize the density gradient of the target
polypeptide 14 in the sample solution 50 higher at position closer
to a surface of the DNA probe chip. In this example, descriptions
are provided for contrivance for utilization of a root portion
(chip surface) of the DNA probe as a nuclear for hybridization.
[0874] A sequence with 50-base length is extracted from human mRNA
and used as a probe. The segment of 20 based near the substrate and
other sequence segments with the GC rate of 15% higher than other
portions are preferentially used. Namely the GC content is made
higher at a position closer to the substrate. When this is
impossible on the sequence, a probe sequence is designed by
inserting a sequence mismatching the cDNA sequence functioning as a
template or a blank sequence not forming a stable complementary
chained at any of ACGT in a section from about 10th base up to
about 30th base from a free edge thereof. However, when the
mismatch sequence or blank sequence is inserted, the stability
lowers, so that the places for insertion are at most two in this
range. It is important to control stability of hybridization with
the methods as described above for forming a nuclear for
hybridization near a fixed edge of a probe.
[0875] FIG. 118 is a view schematically showing the state in which
a terminal of the probe 12-1 is constructed based on the concept
according to the twenty-third embodiment and is fixed on a surface
of the pillar 7. When the probe having the construction as
described above is used, the same effects as those provided in the
twenty-second embodiment can be obtained.
[XXIV] Twenty-Fourth Embodiment
[0876] A twenty-fourth embodiment of the present invention, just
like the twenty-third embodiment, discloses a DNA-probe chip which
improves the hybridizing rate on the surface of a solid chip, is
capable of measuring in a short time, has a high sensitivity, and
has only a small amount of pseudopositive hybridization, and a
method of manufacturing the same; and the twenty-fourth embodiment
discloses a hybridization method of the DNA probe chip. As is the
case with the twenty-third embodiment, the twenty-fourth embodiment
improves a probe fixing region mainly by enlarging it. The other
points are the same as those of the twenty-first embodiment and the
twenty-second embodiment.
[0877] While referring to the views, more specific descriptions
will be given below.
Example 1
[0878] The same kind of DNA probe chip illustrated in FIG. 107
describing DNA probe chip can be adopted as a chip suitable to the
twenty-fourth embodiment.
[0879] FIG. 119 (A), (B) and FIG. 120 (A), (B) each shows a plan
view or a cross-sectional view by focusing on and enlarging one of
the probes in the probe fixing region 4 described in FIG. 107. In
this embodiment, the probe fixing region 4 has a square shape of
100.times.100 .mu.m. The reference numeral 7 indicates a pillar
having a square shape with its bottom surface measuring 10.times.10
.mu.m or a cone shape with a diameter of 10 .mu.m.phi.. There are
7.times.7 pillars formed in the probe fixing region 4 with a pitch
of 15 .mu.m. The pillar 7 has a top face of 7' and a height of 50
.mu.m. In FIG. 119, the pillar 7 is a truncated cone; in FIG. 120,
the pillar 7 is a truncated square pyramid. In both FIG. 119 and
FIG. 120, two cross sections of the pillar are the same. There is
no need to form a top face of the pillar 7; the top face of the
pillar 7 may be left sharp. When the top face of the pillar 7 is
left sharp, the pillar 7 becomes a cone in FIG. 119, and a square
pyramid in FIG. 120. According to the examples of the size
described here, compared with the case in which the probe fixing
region 4 is a simple flat face, the truncated cone can obtain about
3.5 to 8 times the area of the probe fixing region and the
truncated square pyramid can obtain about 4.4 to 10 times the area
of the probe fixing region. These figures are calculated assuming
that no probes are joined to the polar zone at the bottom of the
pillar.
[0880] The number of probes fixed on the probe fixing region 4 may
be increased in order to raise reaction rate or reaction yield;
however, as described above, when the probe density is raised,
hybridization efficiency goes down by electrostatic repulsion.
Fixing probes at high density is no good as long as ordinary
polynucleotide probes are used; when a probe length is as long as
50-bases polynucleotide, it is better to have a probe length of as
sparse as 10 to 40 nm. In the twenty-fourth embodiment, the probe
density itself is not raised, but the area of the probe fixing
region 4 is enlarged to increase the number of the probes fixed to
the probe fixing region 4. Therefore, the probe fixing density
doesn't have to be raised, but by fixing probes, for example, with
a pitch of 10 to 20 nm on average, more probes can be fixed.
[0881] There are several methods of producing the pillar 7. First,
a method of using glass or silicon is to be described. A glass or
silicon piece with a thickness of 100 .mu.m is put together on the
substrate 1 with an electrode 2 formed with vacuum evaporation and
abraded to its prescribed thickness with spattering or etching.
Alternatively, spattering is used to form a glass or a silicon
layer with a thickness of 20 nm. After that, existing techniques
are made full use of to produce a pyramid or a truncated pyramid
depending on the convergence conditions of spattering electrons,
while using a plurality of masks. An object of the twenty-fourth
embodiment is just to enlarge an area of the probe fixing region 4;
therefore, the pillar 7 does not have to be a complete cone, the
pillar 7 may be curled on the side a little. Even when a micro
array producing method, a known technique, is used to produce a
mountain with a high aspect ratio, the effect of the twenty-fourth
embodiment can be obtained.
[0882] A method of producing a pillar made of plastic is described
hereinafter. The surface of the electrode 2, coated with a fluorine
surface coating 3, is coated with an epoxy resin with a spinner to
a thickness of 50 to 100 .mu.m, pressed with a quartz mold into the
shape of FIG. 119 or FIG. 120 and irradiated with ultraviolet rays
for polymerization.
[0883] The quartz mold is removed after polymerization. At this
point, due to poor adhesiveness between the mold and the electrode
2, a thin resin layer still remains on the bottom of the pillar 7,
that is, on the electrode surface 2. Due to this resin layer, when
the mold is removed, the molded pillar 7 remains on the electrode 2
together with this thin resin layer. The electrode is exposed to
oxygen plasma for exposure in order to remove the thin resin layer
on the electrode. At this time, the tip of the pillar becomes a
little round and the pillar becomes short; however, there is no
problem in carrying out the twenty-fourth embodiment.
Alternatively, by contriving so that the plasma is intensively
irradiated on the valley portion of the pillar using the mask, a
more precise circular cone, truncated cone, pyramid and truncated
pyramid can be formed.
[0884] From the perspective of the concentration of the sample DNA
and the contact on the pillar sides, it doesn't matter whether the
side of the cone of the pillar 7 is round or the tip thereof is
round; rather, it reduces the problems of sample DNA particles
getting stuck on the tip.
[0885] On the other hand, measurement is performed by projecting
the pillar 7 vertically from the top surface to the bottom face;
from the perspective of measurement, it is advantageous for the
side of the cone to be inclined to a certain degree. For example,
assuming the pillar 7 is in a shape of a hemisphere with its bottom
placed upward, the side close to the bottom face of the cone is
nearly vertical; when projected in the vertical direction, a large
number of DNA molecules are overlapped. On the other hand, the side
of the cone gently describes an arc at the tip of the cone;
therefore, only a small number of DNA molecules are overlapped.
Considering fluorescence detection in such a cone, even when DNA
molecules are caught at a certain density, the foot of the pillar
and the tip thereof each has a different fluorescent density;
therefore it is better that the side of the cone is not round.
However, either case has both advantages and disadvantages;
therefore, the detailed structure of the pillar is not taken into
consideration in this embodiment.
[0886] A method of fixing the probe on the surface of the pillar 7
is to be described. First, when a pillar material is glass or
silicon, the method disclosed by T. Pastinen et al., Genome
Research (1997)7, 606-614 is revised to be used in this embodiment.
With NN-disopropylethylamine used as a catalyst,
3-glycidoxypropyltrimetoxysilane is reacted at 80.degree. C. for 16
hours in xylene solvent to introduce a glycidoxy group on the
pillar surface. Alternatively, about 0.5% of acetic acid is added
into a 2% solution of 3-glycidoxypropyltrimetoxysilane as a
catalyst and left for thirty minutes; after activating a silanol
group, the activated silanol group is applied on the surface of the
pillar 7, left for thirty minutes, rinsed with pure water and dried
at 105.degree. C. for thirty minutes so that a glycidoxy group can
be introduced on the surface of the pillar 7. Next, a
fifty-base-long probe DNA having an amino group at 5' end is
reacted at pH 9 to 10 for two hours with a thickness of 50 .mu.M.
The probe DNA is then rinsed to obtain a DNA chip with the probe
fixed on the surface of the pillar 7.
[0887] When the surface of the pillar 7 is made of an epoxy resin,
oxygen plasma or UV ozone is used to treat the surface. An OH group
or oxygen radical is generated on the surface of the pillar 7.
Because the OH group and oxygen radical are unstable residues, they
are reduced over time; therefore, the surface of the pillar 7 is
immediately dipped in a 0.5%
N-(.beta.-aminoethyl)-.gamma.-aminopropyltrimethoxy silane solution
(left at room temperature for thirty minutes to become an activated
silane coupling solution) and left for one hour. After rinsing in
pure water, the surface of the pillar 7 is dried in the air at 105
to 110.degree. C. In this way, the amino group can be obtained on
the surface of the pillar 7 made of an epoxy resin. The amino group
is modified with succinic anhyride to introduce a carboxyl group to
the amino group. N-hydroxysuccinimide is esterified in order to
make the carboxyl group an activated ester. A synthetic DNA probe
with the amino group at 5' end is added, and the probe is fixed on
the surface of the pillar 7 with peptide binding.
Example 2
[0888] The following figures each shows the state thereof in a
cross-sectional view: FIG. 121A shows the state in which a sample
solution including a target polynucleotide is introduced on the
surface of a DNA probe chip 100; FIG. 121B shows the state in which
a first step is taken for forming a concentration gradient of the
target polynucleotide from the solid-liquid interface between the
surface of the DNA probe chip 100 and the sample solution toward
the sample solution; FIG. 121C shows the next step for forming the
concentration gradient. Hatching of the pillar 7 in the sense of a
cross section is omitted because hatching makes it hard to see the
views.
[0889] On the surface of the DNA probe chip 100, a gap of 0.1 mm is
made by putting an appropriate spacer (not shown) and a cover glass
11 is placed on it. An ITO electrode 15 with a thickness of 100 nm
is provided on the inner face of the cover glass 11. Forty micro
liters of an mRNA sample solution 50 is added into the space
between the surface of the DNA probe chip 100 and the cover glass
11. The sample solution 50 is agitated by moving the slide glass
back and forth at a certain rate. FIG. 121A is a view showing this
state; the reference numeral 12 indicates a probe fixed on the
surface of the pillar 7 in the probe fixing region 4. The reference
numeral 14 indicates the target polynucleotide dispersed in the
sample solution 50. In this state the target polynucleotide 14 only
diffuses corresponding to a diffusion coefficient of the target
polynucleotide.
[0890] FIG. 121B is a view showing a state in which an electric
field (effectively 0.15 V between the electrodes) is applied so
that, between an electrode 2 of the DNA probe chip 100 and the
electrode 15 of the cover glass 11, the electrode 2 turns positive
+15V/cm with a power source 25. As a result, by making the surface
of the DNA probe chip have a positive potential, the target
polynucleotide 14 having a negative charge is electrostatically
drawn to the valley of the pillar 7 (the surface of the DNA probe
chip) in the probe fixing region 4. At this time, a probe 12 is
also drawn to the electrode; therefore, because one end of the
probe 12 is fixed, a free end of the probe 12 is drawn to the
electrode; the probe 12 is supposed to extend along the surface of
the pillar 7. The surface of the pillar 7 is electrically neural or
slightly has a negative charging; therefore, the probe 12 is not
adsorbed in the surface of the pillar 7, but has a certain freedom.
Because of that, the probe 12 has a capability of causing
hybridization when the target polynucleotide 14 clashes. In fact,
when the target polynucleotide 14 is attracted by the electrode 2,
as an arrow with the reference mark 17 shows, the target
polynucleotide 14 collides on the surface of the pillar 7. Because
of that, as the reference mark 18 shows, some target polynucleotide
14 is hybridized with the probe 12 even at this step.
[0891] An electrode 15 does not have to be attached to a cover
glass 11; it may be placed away from the surface of an electrode 12
of the DNA probe chip 100 inside the sample solution 50.
[0892] FIG. 121C is a view showing the state in which, thirty
seconds after a voltage is applied from a power source 25, the
electric field of -15V/cm (effectively 0.15 V between the
electrodes) is impressed between an electrode 2 of the DNA probe
chip 10 and the electrode 15 of the cover glass 11 from a power
source 26 so that the electrode 2 turns negative. Because the
electrode 2 turns negative, the target polynucleotide 14, having a
negative charging and electrostatically drawn to the valley of the
pillar 7 (the surface of the DNA probe chip) in the probe fixing
region 4, starts to move toward the electrode 15 from the valley of
the pillar 7 (the surface of the DNA probe chip).
[0893] In other words, as shown in FIG. 121C, when the electric
field is inverted, repulsion between the electrode 2 and a negative
charging of the target polynucleotide 14 works; therefore, the
electrode 2 and the target polynucleotide 14 move in the direction
away from the surface of the DNA probe chip. In this case, because
a molecule of the target polynucleotide is big, it is slow to move;
therefore, there is a high probability of the target polynucleotide
hybridizing with the DNA probe fixed on the surface surrounding the
valley of the pillar 7. Further, the hybridization efficiency can
be raised by turning on and off of the power source repeatedly.
[0894] A series of views of FIGS. (A) to (F) describe the effect of
Example 2. In order to assay the target polynucleotide caught by
the probe 12 according to the way described in FIGS. 121A, 121B and
121C, the target polynucleotide is made a label by using a
fluorescent dye. The fluorescence of the fluorescent dye is to be
detected. A nanoparticle like a gold colloid may be made a label to
count particles directly; this case can be realized by using a
tomography method which reconstructs a plurality of images with a
scanning electron microscope.
[0895] FIG. 122 (A) is a view showing a probe fixing position 31,
hybridized with the target polynucleotide with a fluorescent label,
on the conventional flat type DNA probe chip. An incident-light
fluorescence microscope is used for capturing a fluorescent image;
and image processing software is used for fluorescent profiling.
FIG. 122 (B) indicates a fluorescence profile 32 obtained at this
time. It can be seen that the fluorescence intensity of the probe
fixing position rises a little above the background level.
[0896] The fluorescence profiles, the detection results with the
DNA chip provided with the pillar on the cone of the twenty-fourth
embodiment, are described hereinafter.
[0897] FIG. 122 (C) is a view showing the position of the pillar
for fixing the probe. Both FIG. 122 (A) and FIG. 122(C) have the
same scale size. As shown in FIG. 122 (D), a strong fluorescence is
observed at the pillar position of a fluorescence profile 34
obtained with the DNA chip provided with the pillar on the cone.
Because no probe is fixed on the electrode portion, the fluorescent
intensity is almost on the background level. Compared with fixing
the probe simply on a flat surface, the high strength can be
obtained, the hybridization efficiency goes up, and the high
sensitivity is realized. The strength of the apex of the pillar
decreases compared with that of the side of the pillar.
[0898] FIG. 122 (E) is a view showing the position of a cylinder
pillar for comparing with the pillar of the twenty-fourth
embodiment. Both FIG. 122 (C) and FIG. 122(E) have the same scale
size. As shown in FIG. 122 (E), the pillar is of a cylindrical
form; therefore, the hybridization caused by colliding of the
target polynucleotide and the probe occurred when the sample
polynucleotide is drawn to the bottom face of the pillar in the
electric field, as described in FIG. 121 B, is unlikely to happen:
and because each side of the pillar is juxtaposed vertically, the
optical stacking takes place. Such phenomena, compared with the
pillar with a taper, make the hybridization efficiency decrease, or
handicap the optical characteristics at the time of measurement;
therefore, the fluorescence intensity of the obtained fluorescence
profile 35 remarkably decreases compared with that of FIG. 122 (D).
The fluorescence intensity drop of the cylinder apex is
striking.
[0899] FIG. 123 is a view showing an example of the result obtained
by checking the fluorescence intensity by variously changing the
time to capture the target polynucleotide, using the condition of
the electric field for applying on the DNA probe chip as a
parameter. The horizontal axis indicates the time to apply the
electric field, while the vertical axis indicates the fluorescence
intensity.
[0900] A characteristic curve 101 shows a result of capturing the
target polynucleotide of the DNA probe chip when the electric field
of -15V/cm is applied between the electrodes 2 and 15 from the
power source 26, after the electric field of +15V/cm is applied
between the electrodes 2 and 15 from the power source 25, with the
chip provided with the truncated cone pillar. A characteristic
curve 102 shows a result of capturing the target polynucleotide of
the DNA probe chip with the chip provided with the same truncated
cone pillar when no electric field is applied, as a control. A
characteristic curve 103 shows a result of capturing the target
polynucleotide of the DNA probe chip when the electric field of
-15V/cm is applied from the power source 26 after the electric
field of +15V/cm is applied from the power source 25, with the chip
provided with the cylindrical pillar. The time to apply the first
+15V/cm in the characteristic curves 101 and 103 is the same. Both
characteristic curves show an average fluorescence value in the
probe fixing region.
[0901] As evidently shown in the characteristic curves 101, first,
the electric field of +15V/cm is applied between the electrodes 2
and 15 from the power source 25 to electrostatically draw the
target polynucleotide 14 having a negative charge to the valley of
the pillar 7 (the surface of the DNA chip). At this time, the
hybridization has already started, so the fluorescence intensity
increases over time. After that, the electric field of -15V/cm is
applied between the electrodes 2 and 15 from the power source 26 to
release the target polynucleotide 14 with a negative charge,
electrostatically drawn to the valley of the pillar 7 (the surface
of the DNA chip), from the valley of the pillar 7 (the surface of
the DNA chip). By following this step, the closer to the valley of
the pillar 7 (the surface of the DNA chip), the higher gradient the
density of the target polynucleotide 14 inside the sample 50 has;
therefore, the target polynucleotide can be captured efficiently.
As can be seen from the view, after the prescribed time has passed,
the target polynucleotide moves away from the pillar; therefore it
is no use applying more voltage.
[0902] A fluorescence intensity 103 obtained with the cylindrical
pillar is low due to the reasons described above.
[0903] When no voltage is applied, there occurs no density gradient
of the target polynucleotide 14 inside the sample 50; therefore, it
is natural that a capturing rate of the target polynucleotide 14 is
low.
[0904] In this example, the direction of the electric field is
changed once; however, this step may be repeated several times.
When it is repeated several times, the states in FIGS. 121 B, 121C
are to be repeated; because many of the unhybridized target
polynucleotides 14 are distributed near the DNA probe on the
surface of the pillar 7, the capturing rate of the target
polynucleotide 14 can be increased.
Example 3
[0905] FIG. 124 is a cross-sectional view showing the DNA chip of
Example 3 for enlarging the surface area by producing many wells on
the substrate; like Examples 1, 2, the side of the well has a taper
so that more reaction efficiency can be obtained and the optical
measurement can be easily performed. A silicon substrate 51 is
provided with the electrode 52 thereon, on the electrode 52 exists
a component 54 made of a well 53. The electrode of the well 53 is
exposed on the bottom surface thereof. Chromium is evaporated on
the surface of the silicon substrate 51 to turn it to be the
electrode 52. Platinum is evaporated on the electrode 52. Just like
Example 1, the epoxy layer is formed on the platinum to form a well
using plasma processing. An amino group is introduced on the
surface with silane processing; and following the method of Example
1, the probe DNA is fixed. By combining the DNA chip, with an
electrode, composed of the probe fixing area having many wells,
produced as described above, and the fluorescence detection, the
detection sensitivity at least ten times as strong as that of the
conventional flat DNA probe chip can be obtained.
[0906] Further, it is possible to hybridize the target
polynucleotide with a 5 nm-gold particle labeled and to detect a
fixed quantity of gold particles with a scanning electron
microscope. This case has an advantage which makes it possible to
measure on the single molecular level in about one minute of the
measuring time. On the side of the cylindrical well, the gold
particles bound with the hybridization reaction vertically overlap;
therefore, detection is hard even with the scanner electron
microscope because the particles each overlaps on top of each
other. According to the twenty-fourth embodiment for making the
well have a taper, the particles each bound on the side of the well
can be measured without overlapping on top of each other so much.
Therefore, the twenty-fourth embodiment is useful as a DNA probe
chip of a single molecule measuring type which uses nanoparticles
and the scanner electron microscope.
[XXV] Twenty-Fifth Embodiment
[0907] A twenty-fifth embodiment of the present invention discloses
a multi-detection method of a labeling substance for labeling
dozens or thousands of sample molecules in the same probe section
divided into a minimum size, and a biological material using this
labeling substance, in a wide-ranging biological material detection
method including DNA probe array.
[0908] The twenty-fifth embodiment uses a nanoparticle made by
changing a ratio of different elements of a labeling substance as a
label. For example, a gold based substance blended with a trace of
palladium and chromium is used below to describe this label. When a
composition ratio of palladium and chromium is changed eight
gradations, sixty-four kinds of nanoparticles of gold can be
obtained. When three kinds of elements are added to gold, 512 kinds
of nanoparticles of gold can be obtained. When a particle diameter
is changed into about five kinds between 10 nm and 50 nm each every
10 nm stage, about 2500 kinds of nanoparticles of gold with
different composition and size can be obtained.
[0909] Because this particle is a conductor, the location and the
size thereof can be easily detected by irradiating electrons on the
particles using a scanning electronic microscope, measuring the
energy distribution of secondary electron beams, and obtaining the
SEM image with the location and the size of the particle
identified. Further, the location and the size of the particle can
be obtained by using an energy dispersive character X-ray detector
to obtain the element analyzed images of character X-rays generated
when electrons are irradiated on the particles using the scanning
electronic microscope. This method makes it possible to detect the
size of a nanoparticle, the kind of element included therein and
the location of the particle on the substrate section. By making
the particles each with different composition and diameter become
the structures each having a probe DNA binding to each different
DNA sequence, it is possible to detect thousands of target DNA
pieces on the same level.
[0910] Because nanoparticles are mainly composed of gold, the probe
can be fixed on the particle surface by using a DNA probe with
alkylsulphide group.
[0911] The twenty-fifth embodiment is basically based on the alloy
manufacturing technique, so various kinds of elements can be
blended; further, it is possible to combine four or more kinds of
elements. For example, combining five elements makes it possible to
obtain thirty some thousand nanoparticles of different composition
equivalent to the number of sections of the existing DNA chips. Or,
putting 250 kinds of combination of three elements into one group,
and preparing a plurality of groups composed of the combination of
the other elements enable distinction and detection of several
thousand kinds of DNA. To change composition thereof, three to five
elements are selected from the combination of elements consisting
of gallium, aluminum, yttrium, erbium, horonium, cesium, cobalt,
titan, nickel, iron and the like. In order to fix the probe, in
addition to the gold and the SH group reaction, a functional group
is introduced using a silane coupling reaction when the probe has
an oxidized surface.
[0912] As described above, the twenty-fifth embodiment of the
present invention overturns the conventional concept of DNA chips
which have to fix different types of probes on a great many number
of section elements. It is possible to analyze the mRNA expression
in a short time simply by trapping mRNA on the chip with poly T
fixed thereon, hybridizing each mRNA with the synthetic DNA probe
having complementary sequences with nanoparticles each having
different composition labeled thereon, and by analyzing with the
scanning electronic microscope.
[0913] An analyzing method of analyzing thousands of different
kinds of epitopes at once is to be established by using an antibody
instead of the DNA probe and using it on a biological substance
(for instance, protein) fixed on the substrate.
Example 1
[0914] FIG. 125 is a conceptual drawing showing a portion of the
DNA chip according to an example 1 of the twenty-fifth embodiment
in a diagrammatic perspective view. Chip 1 is formed on a silicon
substrate 101 having an oxidized membrane surface. The chip 1 has a
size of 20.times.20 mm. A probe fixing region 102 is the only one
for fixing the DNA probe and has 10 mm.phi.. The surrounding
portion thereof is coated with a water shedding resin 103, a kind
of Teflon (registered trademark). The coating is about 50 .mu.m
thick. In a probe fixing region 102, the 3' end of poly T with
26-base lengths is bound together with the 5' end of random
sequence oligo-DNA with 5-base lengths. It is because the Poly T
alone cannot fully secure the stability of mRNA hybridization. The
probe is made of PNA, peptide nucleic acid, so that the probe can
be easily interacted with the intracellular mRNA. Similar to
ordinary DNA, PNA does not have any negative charging originated
from phosphodiester bond; therefore, electrostatic repulsion does
not occur between the target DNA and PNA, which improves the
efficiency of hybridization.
[0915] Further, using PNA for the probe to have a property without
the charging does not generate electrostatic repulsion; therefore,
hybridization proceeds without performing denaturation because even
if a poly A portion of the target mRNA forms a partial duplex with
another site in the cell, the probe can competitively get inside
the duplex, and hybridize the duplex competitively.
[0916] A method disclosed by A. Kumar et al. (Nucleic Acids
Research (2000) 28, No. 14 e71) is revised to make the probe fixing
method used here. In this method, a silanized DNA probe, with the
trimethoxysilane residue introduced to the amino end of synthetic
PNA in advance, is coated on the element portion of the chip
substrate to fix the probe. The silanized DNA probe, for example,
can be obtained by binding a glycidoxy group of
3-glycidoxypropyltrimethoxysilane to the amino end of PNA.
[0917] For example, a 50 .mu.l of total RNA solution extracted from
the tissue pieces of intestinal cancer removed in accordance with
the known method is blended with a 0.1% (w/v) solution of gold
based nanoparticles (10 .mu.m) with a ratio of gallium, aluminum,
yttrium and chromium altered so that about forty base sequences
complementary to each mRNA can be distinguished; and then the
solution is added to the probe fixing region 102 of the chip 1
without performing any special treatment. The chip is preheated at
45.degree. C. About 1-mm gap is provided, and a 40 mm.phi. of glass
plate is placed on the top surface of the probe fixing region; the
glass plate, while being decentered, is moved in circles so that
the edge of the probe fixing region 102 matches that of the glass
plate. The glass plate is moved once every five seconds, which
makes it possible to hybridize at a high rate. In the probe fixing
region 102 of the chip 1, a probe fixed on the chip 1, an mRNA and
a particle labeling probe are bound in that order in a sandwich
structure. An unreacted particle labeling probe or RNA is washed
and removed.
[0918] FIG. 126 is a conceptual view illustrating how the probe
chip 1 described in FIG. 125 is observed using the scanning
electron microscope.
[0919] Many probes are fixed on the surface of the probe fixing
region 102 of the chip 1; this example is performed using a
simplified method in which DNA pieces 201-204 are hybridized on
each of the fixed probes 11-14; and these DNA pieces are labeled
with gold particles 21-24. Each of the gold particles 21, 22, 23
and 24 is to have a ratio of (1:1:1:0), (1:1:0:1), (1:0:1:1),
(1:1:1:1) for gallium, aluminum, yttrium and chromium,
respectively. A maximum ratio of each metal blended into gold is
20% because binding between gold and alkanethiol introduced at a 5'
end of the probe is to be used in order to fix an mRNA specific
probe on the surfaces of nanoparticles. Gold and thiol are
vulnerable to oxidative conditions or exposure to UV rays, but
under ordinary hybridization conditions gold and thiol can obtain
very stable binding force. Therefore, in Example 1 the alkanethiol
previously introduced at the 5' end of the probe and the gold are
blended at a ratio of 10 to 1 to obtain a string of gold
nanoparticles with mRNA specific probes fixed on the surfaces
thereof.
[0920] An electron gun 300-1, a convergent lens 300-2 and a scanner
coil 300-3 of a scanning electron microscope 300 for detecting the
gold particles are provided on the surface of the probe fixing
region 102 of the chip 1. The electron of an electron ray 300-4
shot from the electron gun 300-1 clashes against the gold particles
21, 22, 23 and 24, and then the gold particles emit an electron ray
300-5. This secondary electron is captured by a detector 300-6.
Based on the secondary electrons captured by the detector 300-6, so
called SEM images can be obtained to identify the location and the
size of the gold particles.
[0921] On the other hand, the twenty-fifth embodiment is provided
with an energy dispersive character X-ray detector 300-8 for
detecting an X-ray 300-7 with a wavelength specific to elements
constituting the gold nanoparticles emitted from the gold particles
21, 22, 23 and 24 when the electron of the electron ray 300-4
clashes against the gold particles 21, 22, 23 and 24. Thus,
analyzed images of elements can be obtained from wavelength signals
corresponding to the structural elements detected by the energy
dispersive character X-ray detector 300-8.
[0922] The analyzed images of elements obtained by the
energy-dispersive-character X-ray detector 300-8 is to have the
data of locations and structural elements of the gold particles.
Therefore, when the SEM image and the analyzed image of elements
are matched, mRNA particles hybridized by the gold particle
labeling probe can be identified.
[0923] FIG. 127 is a conceptual view illustrating a method of
identifying the mRNA particles hybridized by the gold particle
labeling probe by comparing the SEM image with the analyzed image
of elements.
[0924] As an example, oligo PNA (28 bases) having a sequence
corresponding to an mRNA sequence of EpCAM, oligo PNA (26 bases)
having a sequence corresponding to an mRNA sequence of CD44, an
expression which is also said to increase in a cancer cell, and
oligo PNA (29 bases) having a sequence corresponding to an mRNA
sequence of CEA, each of them is fixed on the surface of the probe
fixing region as a probe. A method of adding a gold particle (with
a diameter of 10 nm), as a label, each including gallium, aluminum,
yttrium and chromium with a ratio of (1:1:1:0), (1:1:0:1),
(1:0:1:1), (1:1:1:1) respectively to the amino end hybridizing to
these probes is described below.
[0925] In FIG. 127, the reference numeral 30 indicates the SEM
image. The SEM image has all the particles images. The reference
numeral 31, 32, 33, 34 each indicates a gallium image, an aluminum
image, an yttrium image and a chromium image respectively.
Comparing a SEM image 30 with the gallium image 31, aluminum image
32, yttrium image 33 and chromium image 34 shows that the SEM image
30 is the same with the gallium image 31, but the aluminum image
32, yttrium image 33 and chromium image 34 each fails to display a
location particle by dotted lines shown against the SEM image 30.
In other words, because gallium is included in all of the particles
used as labels, the gallium image 31, like the SEM image 30, shows
all the particles. The aluminum image 32 does not show a location
particle shown by dotted lines. It means that an mRNA hybridized to
the probe in this location indicates a CEA molecule labeled by a
gold nanoparticle including no aluminum. This indicates a gold
particle shown as the reference numeral 37 in the SEM image 30.
Similarly, the yttrium image 33 does not display two particles in
the location shown by dotted lines. In other words, an mRNA
hybridized to the probe in this location indicates a CD 44 molecule
labeled by a gold particle including no yttrium. This is a gold
particle shown as the reference numeral 36 in the SEM image 30.
Further, the chromium image 34 does not display three particles in
the location shown by dotted lines. In other words, an mRNA
hybridized to the probe in this location indicates an EpCAM
molecule labeled by a gold particle including no chromium. This
indicates a gold particle shown as the reference numeral 35 in the
SEM image 30.
[0926] In FIG. 127, all the particles were regarded to have the
same size in order to simplify the description; however, when the
particles of different sizes are used together with the particles
of the same size, more substances can be identified. Of course it
is needless to say that this identification can be performed with
an image processing of a calculator.
[0927] Using the twenty-fifth embodiment makes it possible to
distinguish and quantitatively measure a plurality of mRNAs on the
DNA chip with an mRNA having a poli-A tail simply captured. Because
the energy dispersive X-ray detector attached to SEM can identify
an element ratio of a few percent, it can identify the same element
by about eight gradations. When four kinds of elements are used, it
is possible to identify 4096 kinds of particles. When five kinds of
elements are used, 32768 kinds of particles can be identified by
shooting only five images.
[0928] As described above, using the particles with the element
ratio altered according to the twenty-fifth embodiment enables the
mRNA profiling of a single molecule level without using a probe
chip made with a conventional section separation method but with
using a particle counting method. The probe chip made with a
conventional section separation method has such a complicated
structure that it is troublesome to manufacture the probe chip.
Example 2
[0929] An example 2 describes the multi-detection method of a
biological substance with an antigen-antibody reaction. In this
example, the same substrate described by referring to FIG. 25 is
used. In the example 2, the probe fixing region 102 is used as a
reaction portion; an IgG fraction with antihuman antiserum affinity
purified is fixed in a reaction portion 102. The serum to be
measured contains a large amount of human albumin or human IgG;
therefore it is necessary to remove an antibody to human albumin
and an antibody to human IgG from the reaction portion 102 in
advance so that they may not react. Therefore, the IgG fraction
with an affinity purified antihuman antiserum IgG fraction absorbed
by human albumin and human IgG is prepared; the IgG fraction is
fixed in the reaction portion 102 and a surplus absorption place is
masked with phosphatidylcholine compound. Next, the reaction
portion 102 is washed with 0.15M NaCl, 50 mM sodium phosphate
buffer (PBS: pH7.4) including 10 mg/ml of bovine serum albumin to
remove unreacted human IgG.
[0930] When 100 .mu.l of human serum sample is added to the
reaction portion 102, and agitated for ten minutes just like the
process in Example 1, the protein existing inside the serum causes
an antigen antibody reaction, and the protein is trapped by the
antibody on the reaction portion 102.
[0931] Aside from this, a nanoparticle labeling antibody is
prepared. For example, an SH group is introduced to an F(ab').sub.2
fragment obtained with papain degradation of affinity purified
polyclonal anti-AFP antibody and anti-CEA antibody. The SH group to
be inserted has 3 to 4 molecules per one F(ab').sub.2 molecule.
Gold (20 nm.phi.))-based palladium and chromium with a ratio of
(20:80) and gold particles with a ratio of (30:70) are blended with
F(ab').sub.2 derived from the anti-AFP antibody and anti-CEA
antibody including the SH group prepared as described above to
obtain gold particles with F(ab').sub.2 bound on the surface
thereof.
[0932] AFP alone with a concentration of 1 zmol/.mu.l, CEA alone
with a concentration of 5 zmol/.mu.l and a control with nothing
therein are prepared to make a sample. PBS (pH 7.4) including 0.1%
Tween 20 and 0.5% BAS is used as a solvent.
[0933] Each solution is reacted with the protein chip, and then the
gold nanoparticle labeling F(ab').sub.2 is reacted with the protein
chip. The reaction time for the first sample reaction is five
minutes, and the reaction time for the gold nanoparticle labeling
F(ab').sub.2 is five minutes. After the reaction ends, the chip is
washed with the buffer solution including 0.1% Tween 20 and 0.5%
BAS; the gold nanoparticles are detected using the scanning
electronic microscope and the energy dispersive character X-ray
detector, and then AFP and CEA molecules are counted from the
abundance ratio of palladium and chromium.
[0934] When AFP alone is reacted with the protein trapped by the
antibody on the above mentioned reaction portion 102, 120
particles/.mu.m.sup.2 of gold nanoparticles which can recognize the
AFP bound with protein and two particles/.mu.m.sup.2 of the other
gold nanoparticles are detected. Similarly, when CEA alone is
reacted, 1580 particles/.mu.m.sup.2 of gold nanoparticles which can
recognize the CEA bound with protein and six particles/.mu.m.sup.2
of the other gold nanoparticles are detected. Only two to four
particles/.mu.m.sup.2 of gold nanoparticles can be detected from
the control solution.
[0935] In the twenty-fifth embodiment, the metal or semiconductor
constituting an alloy particle which is to be a label is selected
from either one of transition metals with any atomic number up to
79 of the periodic table excluding atomic number 43, either one of
metals with atomic numbers 13, 31, 32, 49, 50, 51, 81, 82, 83, and
either one of semiconductors with atomic numbers 14, 33, 34,
52.
[0936] As described above, the twenty-fifth embodiment can be
carried out in several examples; in any example, a hybridized DNA
sample and the like are detected practically by every molecule;
therefore, the sensitivity obtained using this method far exceeds
the sensitivity obtained using a conventional method. An
infinitesimal DNA (RNA) can be detected by an infinitesimal volume;
therefore, it is now possible to detect a target DNA (RNA) without
carrying out any pretreated amplifications, which was impossible
using a conventional method. Because a labeling particle size or
form for detection can be changed, it is now possible to perform
multi analysis of different samples from about six to ten kinds on
the same element. In addition to using this technique to the
conventional differential hybridization, this technique makes it
possible to trap a sample polynucleotide in an element using the
same probe and perform detection using a different label probe. The
multi-analysis technique according to the twenty-fifth embodiment
has the advantages of detecting alternative splicing or performing
typing of a plurality of SNPs using one element.
[XXVI] Twenty-Sixth Embodiment
[0937] As with the twenty-fifth embodiment, a twenty-sixth
embodiment of the present invention discloses a labeling material
capable of identifying, in a minimized probe zone, several tens to
several thousands sample molecules in the same zone and a multiplex
examination method for examining biological materials with the
labeling material. In the twenty-sixth embodiment, different from
the twenty-fifth embodiment in which a probe is fixed to a probe
zone, indexing particles each with a probe fixed thereto are
prepared. In other points, the twenty-sixth embodiment is the same
as the twenty-fifth embodiment.
[0938] In a first aspect of the twenty-sixth embodiment,
nanoparticles having different elemental compositions respectively
are used as labeling materials. Descriptions are provided below for
a case in which nanoparticles of gold with minute quantities of
palladium and chromium mixed therein are used as labeling
materials. Sixty-four types of gold nanoparticles can be obtained
by changing a content of palladium and that of chromium with 8
steps respectively. If three elements are added in the
nanoparticles of gold, 512 types of gold nanoparticles can be
obtained. If the particle diameter is changed by 5 stages with a
10-nm step in the range from 10 nm to 50 nm, about 2500 types of
nanoparticles of gold having different compositions and sizes can
be obtained.
[0939] The particles are conductive, the position and size of each
particle can easily be detected by irradiating the particles with
electrons under a scanning electron microscope and measuring an
energy distribution of secondary electron beam to obtain a SEM
image identifying positions and sizes of the particles. Further a
position and size of each particle can be detected by irradiating
electrons with a scanning electron microscope to the particles to
obtain an elemental analysis image for the characteristic X-ray
generated by each particle with an energy-dispersive-characteristic
X-ray detector. With the operations above, a position of each
nanoparticle on the substrate can be detected, and at the same time
the elements contained in the particle and size thereof can be
detected. With a structure having a number of different probe DNAs
to which particles having different compositions and sizes
conjugate respectively, even several thousands target DNA fragments
can be detected on the same plane.
[0940] The main ingredient of the nanoparticle is gold, so that the
probe cab be sided to a surface of the particle by using a DNA
probe having an alkyl sulfide group.
[0941] The twenty-sixth embodiment is basically dependent on the
alloy manufacturing technology, and various types of elements may
be mixed in the particle. If necessary, four or more types of
elements may be mixed in the particle. For instance, when five
types of elements, nanoparticles based on thirty thousands or more
compositions equivalent to a number of the existing DNA chips can
be obtained. Alternatively, by preparing 250 types of compositions
with three types of elements and then preparing other several
elements to be mixed in each of the 250 types of compositions,
several thousands of DNA probes can be discriminated and
detected.
[0942] As elements available for preparing various compositions,
three to five types of elements may be selected from the group
including gallium, aluminum, yttrium, erbium, polonium, cesium,
cobalt, titanium, nickel, and iron. To fix a probe, in addition to
a reaction between gold and an SH group, in a case of an alloy
having an oxidized surface, the probe DNA can be fixed by
introducing a functional group using the silane coupling
reaction.
[0943] As described above, a concept of the twenty-sixth embodiment
of the present invention is completely different from the ordinary
concept for a DNA chip in which different probes are required to be
fixed in an extremely large number of zone elements. An expression
of mRNA can be analyzed within a short period of time by simply
trapping mRNAs on a chip with poly T fixed thereon, hybridizing
synthetic DNA probes with nanoparticles having different
compositions respectively labeled thereon to the mRNAs, and
analyzing the reaction products with a scanning electron
microscope.
[0944] Using the chip with DNA probes changed to antibodies for
biological materials (such as proteins) fixed on the substrate,
several thousand epitopes can be analyzed all at once.
[0945] In a second aspect of the twenty-sixth embodiment as a
development of the configuration in the first embodiment, particles
prepared with differential elemental compositions respectively are
prepared and used for fixing specific probes. That is, a particle
having a specific elemental composition can be used for fixing a
specific probe. On the other hand, target DNA fragments to be
hybridized to probes fixed on the particles are labeled with
particles of gold for counting. The probes are hybridized to the
target DNA fragments by mixing the particles with the probed fixed
thereon and the target DNA fragments in a solution. This processing
is performed in a specified zone in a vessel or in a specified
zone, and then the particles are washed and recovered. To wash and
recover the particles, centrifugation may be employed, or the
supernatant may be replaced. When the particles contain any
magnetic material, the particles may be recovered with a magnet
with the supernatant replaced. After the processing, the particles
are dried and fixed on a prespecified zone on the substrate. As a
result, the target DNA fragments can be assessed by indexing the
particles and counting the gold particles used for labeling.
[0946] In this second aspect, hybridization of probes fixed on
particles and target DNA fragments can be performed in the state
where the particles are suspended in a solution, so that such
problems associated with hybridization occurring on an interface
between a solid phase and a liquid phase as heterogeneous
reactions, low reaction speed due to dispersion of molecules, and
low reaction rate are substantially alleviated. As treated as a
suspension, specific vessels and pipets and any special technique
are not required, which is advantageous. The technique used to the
labels for the target object materials may be applied to this
particle indexing. In other words, by directing electrodes to the
particles under a scanning electron microscope to obtain an SEM
image identifying positions and sizes of the particles, and also by
sensing the characteristic X ray generated when the particles are
irradiated by electrons with an energy dispersive X ray detector to
obtain an elemental analysis image, and particles fixed on a zone
on the substrate are indexed by comparing the two images above with
each other. The particles are fixed on the zone on the substrate.
Descriptions of this example above assume use of the
energy-dispersive X-ray detector, but a method with high
sensitivity such as the wavelength dispersive X-ray spectroscopy
(WDX) may be employed. Rather the wavelength dispersive X-ray
spectroscopy may be more adapted to the twenty-sixth embodiment
because the method is excellent in X-ray wavelength resolution.
[0947] When an object for measurement is a protein or a sugar
chain, the immunoassay technique is employed. In other words,
indexing particles each with an antibody molecule reactive to a
particular epitope and antibodies fixed to nanoparticles of gold
for labeling are used. In this case, both of the antibodies fixed
to the indexing particles and particles for labeling contain an
antigen molecule sandwiched with an antibody specific to an object
for measurement and form hybrids of indexing particle, antigen, and
gold nanoparticle for labeling. Alternatively the antigen is
sandwiched with a second antibody universally reacting to the
indexing particle with a specific antibody fixed thereon and an
antibody not labeled. In any method, a number of antigens are
indexed in use for quantitative detection.
[0948] To fix the hybrids of indexing particle, mRNA, and gold
nanoparticles for labeling or the indexing particle-antigen-gold
nanoparticles for labeling hybrid onto the substrate, a suspension
of each hybrid may be dripped and dried thereon, or more reasonably
a magnetic substance is used for the indexing particle, and the
indexing particle is attracted onto the substrate with a magnet,
and then the solution is scattered off with a blower or the like
for drying.
[0949] As described above, the concept of this embodiment is
completely different from the concept for ordinary DNA probe chip
that different probes must be fixed in a number of zone elements.
The concept of this embodiment provides a analyzing technique
capable of analyzing types and quantities of several thousands to
several tens of thousands of mRNAs or proteins all at once by
making the indexing particles, samples, and labeling particles
reacting to each other and observing the reacting situation with a
scanning electron temperature.
[0950] The DNA chip 1 according to the twenty-fifth embodiment
shown in FIG. 125 may be employed as the DNA chip in the
twenty-sixth embodiment.
[0951] An aspect in which probes are fixed on the DNA chip
according to the twenty-sixth embodiment and indexing particles
conjugated to the samples captured by the probes are observed with
a scanning electron microscope is the same as that of the
twenty-fifth embodiment shown in FIG. 126 and FIG. 127, and
therefore description thereof is omitted here.
[0952] An SEM with low resolution or an X-ray detector with the
resolution of about 0.1 .mu.m may be used as a simple version for
detection when indexing particles conjugated to the captured
samples are observed under a scanning electron microscope. The
device with low resolution as described above is so compact that
the device can be installed on a desk, and in addition, the price
is lower than an SEM with the ordinary X-ray detector.
Alternatively, en electron probe X-ray microanalyser (EPMA) based
on an electron beam microprobe capable of performing elemental
analysis within a range of 1 .mu.m.sup.2 may be used, and the
method is described below. With the resolution of about 0.1 .mu.m,
nanoparticles of gold can not be counted, nor can be obtained an
elemental analysis image thereof. In this case, an elemental
analysis value for each element within the range irradiated by X
ray is obtained. In this example, too many types of elements can
not be used for labeling each DNA probe, and only two to three
elements may be used for labeling one particle, and allowable
elemental compositions are about three types. When a particle is
labeled with one element, variation in labeling is allowable
according to a number of used elements, and in this case, several
tens of DNAs or biological materials can be analyzed
simultaneously.
Example 1
[0953] FIG. 128 is a diagram showing a concept for measurement of a
biological sample in the twenty-sixth embodiment. This measurement
is characterized by using indexing particles. No probe is fixed on
the silicon substrate 101. The silicon substrate 101 is a vessel
for measurement only having a prespecified area, and is used for
fixing indexing particles in measurement. The size is 20.times.20
mm. There is only one indexing particle fixing area 102, and the
diameter is 3 mm. SU8 is applied on the silicon substrate 101, and
a bank 103 is formed by curing SU8 with UV ray. Needless to say,
the bank 103 may be formed by directly engraving the base. There is
not restriction over a structure of the bank 103 so long as a
liquid is contained therein, but because sometimes an aqueous
solution containing 70% alcohol may be contained therein, and in
this case the height should preferably be 150 .mu.m or more.
[0954] Reference numerals 41 to 44 are indexing particles composed
with elemental compositions different from one another. The
indexing particles correspond to the nanoparticles of gold 21-24
for labeling with different elemental compositions respectively in
the first aspect, but are different from the latter in the
following points. In the first aspect, the gold nanoparticles 21-24
for labeling have different elemental compositions respectively,
and specific biological materials (such as, for instance, target
DNA fragments) are detected by directing electrons to the gold
nanoparticles to check X-rays having different wavelengths specific
to elemental compositions of the gold nanoparticles for identifying
each discrete nanoparticles of gold. In contrast, in the second
aspect, the indexing particles 41 to 44 are directly used each for
fixing a probe thereon, and in addition, particles for labeling are
used for counting specific biological materials captured by the
probe. That is, in the second aspect, positions of indexing
particles are identified by making use of the fact the indexing
particles 41 to 44 irradiated with electron beams generate X-rays
having different wavelengths specific to elemental compositions of
the particles 41 to 44 respectively and then specific biological
materials captured by the indexing particles are detected.
Particles including, in addition to gold, a plurality of elements
are used for indexing, and gold nanoparticles are used for
counting.
[0955] A particle as a base for the indexing particle is made of
polystyrene not to prevent detection of elements for labeling in
the indexing particles during the process of elemental analysis.
Alternatively, polystyrene magnetic particles with a paramagnetic
material such as iron or cobalt embedded therein may be used. In
this case an element for labeling is deposited and fixed on a
surface of the particle. There are variable methods available for
preparing particles for labeling in addition to deposition of an
element. For instance, a prespecified number of elements may be
kneaded in a polystyrene sphere as a nanoparticle. In this case, an
element signal from each particle can be obtained by raising energy
of the emitted electron beam so that the electron beam reaches
inside the polystyrene sphere.
[0956] When magnetic particles are used, there is provided the
advantage that operations for reactions and those for detecting
particles can advantageously be performed with a magnet. In a case
of the ordinary polystyrene, operations can smoothly be performed
by recovering particles by centrifugation or with a filter.
[0957] The solid black circle attached to each of the indexing
particles 41 to 44 is a labeling particle for counting. As
described below, this is a labeling particle for a specific
biological material captured by a probe fixed on each of the
indexing particles 41 to 44. The indexing particles 41 to 44 are
fixed on the indexing particle fixing area 102 (with a diameter of
3 mm) on the silicon substrate 101. After the specific biological
materials are captured by the probes fixed to the indexing
particles 41 to 44 by mixing the indexing particles 41 to 44 and a
sample containing the target biological material labeled with a
labeling particle in a solution, and then the mixture solution is
dripped by a prespecified volume onto the probe fixing area 102 and
dried to fix the indexing particles to the indexing particle fixing
area 102.
[0958] When a base for the indexing particle is a polystyrene
particle, after 1 .mu.l of the mixture solution is dripped onto the
probe fixing area 102 and dried in the depressurized state to fix
the indexing particles. For this purpose, it is necessary to add a
mechanism for holding a droplet in the indexing particle fixing
area 102, and in Example 3, SU8 is applied on the substrate 101 and
then the bank 103 is prepared by curing with UV ray. Needless to
say, the bank 103 may directly be formed on the substrate 101 by
etching. There is no specific restriction over a structure of the
bank 103 so long as a liquid can be preserved therein, but as
described below, sometimes an aqueous solution containing 70%
alcohol must be preserved therein, and in this case the height is
required to be at least 150 .mu.m.
[0959] In the state where the indexing particles have been fixed on
the indexing particle fixing area 102, like in Example 1, the
substrate 101 is set in a scanning electron microscope 300 having
an energy dispersive X-ray detector or a wavelength dispersive
X-ray spectrometer. The scanning electron microscope 300 has an
electron gun 300-1, a focusing lens 300-2, and a scanning coil
300-3, and electrons emitted from the electron gun 300-1 collide
against the indexing particles 41-44, which emit the second
electrons 300-5. The secondary electrons are captured by the
detector 300-6. The so-called SEM image is made based on the
secondary electrons detected by the detector 300-6, so that
positions and sizes of the indexing particles 41 to 44 are
identified. Further, the labeling particles coupled to surfaces of
the indexing particles 41 to 44 are detected. There is also
provided an energy dispersive X-ray detector or a wavelength
dispersive X-ray spectrometer 300-8 for detecting X-ray 300-7
having wavelength specific to elements constituting each indexing
particle. That is, an elemental analysis image is obtained from the
wavelength signals corresponding to the constituent elements
detected by the energy dispersive X-ray detector or a wavelength
dispersive X-ray spectrometer 300-8. With this configuration, the
indexing particles can indicate types of probes fixed on the
surfaces thereof with the size and constituent element.
[0960] FIG. 129 is a diagram illustrating the operations for
identifying positions and sizes of the indexing particles 41 to 44
from an SEM image obtained with the detector 300-6 as well as from
an elemental analysis image obtained by the energy dispersive X-ray
detector 300-8 and assessment of the specific biological materials
with the labeling particles hybridized to the indexing particles 41
to 44 added thereto. In the following descriptions, the elemental
compositions (gallium:aluminum:yttrium:chromium) of the indexing
particles 41 to 44 are (1:1:1:0) in the indexing particle 41,
((1:1:0:1) in the indexing particle 42, ((1:0:1:1) in the indexing
particles 43, and (0:1:1:1) in the indexing particle 44, and also
it is assumed in the following descriptions that diameters of the
particles are in the range from 0.5 to 5 .mu.m.
[0961] In FIG. 129, reference numeral 50 indicates an SEM image.
All of the indexing particles 41 to 44 and labeling particles for
the specific biological materials captured on the indexing
particles 41 to 44 are shown in the SEM image. Reference numerals
51, 52, 53, and 54 are elemental analysis images for a chromium
image, an yttrium image, an aluminum image, and a gallium image
respectively. Comparing the SEM image 50 to the chromium image 51,
yttrium image 52, aluminum image 53, and gallium image 54, it is
understood that an particle image at a position corresponding the
indexing particle 41 indicated by a broken line is not shown in the
chromium image 51. Likewise, particles image at positions
corresponding to the indexing particles 42, 43, and 44 shown in the
SEM image 30 are not shown in the yttrium image 52, aluminum image
53, and gallium image 54. That is, the indexing particles 41, 42,
43, and 44 do not include chromium, yttrium, aluminum, and gallium
each as a constituent element for each particle respectively, so
that the images are not shown in the elemental analysis image. When
the labeling particles are gold nanoparticles, the particle image
is principally not shown in the elemental analysis image. When the
labeling particles is irradiated with electron beams and emit
X-rays having the specific wavelength close to that emitted from
the constituent elements in the indexing particles, the particle
images are shown in the elemental analysis image. Therefore, noise
is included more as compared to the SEM image 50, but the noise
does not substantially spoil execution of the elemental
analysis.
[0962] Therefore the indexing particles 41 to 44 are discriminated
and identified by comparing the SEM image 50 to the elemental
analysis images 51 to 54. Further, because the labeling particles
are shown in the SEM image 50, by counting the particles and
integrating the counts with a result of identification of the
indexing particles 41 to 44 for assessment, how many labeling
particles are included in each of the indexing particles, in other
words, which specific biological material is present in the sample
can be accessed. For simplification, the descriptions above assume
a case in which four particles each having the same size are used
for checking whether a particular element is present in a particle
or not, but by preparing indexing particles having different
diameters at a level where the sizes can be identified in an SEM
image and also changing the elemental compositions of the indexing
particles to various values at a level where the indexing particles
can be recognized in the elemental analysis images, a number of
types of indexing particles can be increased according to a product
of a particle diameter.times.a number of elemental
compositions.times.a quantity of each constituent element. For
instance, when indexing particles with different diameters in four
stages in the range from 0.5 to 5 .mu.m and also with different
elemental compositions in 10 stages, 40,000 types of indexing
particles can be obtained.
[0963] Descriptions are provided below of elements that may be used
as indexing particles. Elements that can be analyzed with the
energy dispersive characteristic X-ray detector 300-8 ranges from
B, a fifth element up to U, a 92.sup.nd element in the periodic
table. Any element in this range can be detected if the element is
contained by 1% or more. Resolution of a device or spectrum
ascription can be classified to about 10 grades in the range from
1% to about 20% in the determination characteristic analysis. When
a magnetic particle is used as a base particle, elements involving
in magnetism cannot be employed for indexing. Therefore, Fe, Co,
and Ni cannot be used for indexing. C, N, and O are also contained
in polystyrene, so that the elements cannot be used. The elements
Fe, Co, Ni, C, N, and O exist a lot in the nature, and the elements
may be introduced as a result of contamination from the outside, so
that the elements should not be used. For the same reason, alkali
metals (group I) and alkali earth metals (group II), and other
metals in groups, 15, 16, and 17 up to As should be excluded, and
elements belonging to group 18 are gases, so that the elements
should be excluded. Al, Si, Mo, Sn exist a lot in the ordinary
environment. V belong to family 5 is excluded because the element
existing in living organisms relatively a lot. Also Tc, Pm, Ac, Pa,
and U having no or few stable isotopes should be excluded. Hg
itself exists as a liquid. Elements other those listed above may be
used for indexing. That is, the elements available for indexing are
Sc, Ti, Ga, Ge, Y, Zr, Nb, Ru, Rh, Pd, Ag, Cd, In, Sb, La, Ce, Pr,
Nd, Sm, Eu, Gd, Tb, Dy, Ho, Er, Tm, Yb, Lu, Hf, Ta, W, Re, Os, Ir,
Pt, Au, Tl, Bi, and Th.
[0964] FIG. 130(A) is a diagram schematically showing the indexing
particles 41 to 44 and probes 41a, 42a, 43a, and 44a fixed on
surfaces of the indexing particles 41 to 44, FIG. 130(B) is a view
schematically showing specific biological materials 41b, 42b, 43b,
and 44b hybridized to the probes 41a, 42a, 43a, and 44a each with a
labeling particle added thereto, and FIG. 130(C) is a diagram
schematically showing the situation in which the probes and
specific biological materials hybridize with each other. The
following descriptions assume a case in which a DNA probe is used
as a probe.
[0965] As shown in FIG. 130(A), specific probes are fixed to
surfaces of the indexing particles 41 to 44 respectively. Any known
method may be used for fixing the probes to the indexing particles.
For instance, oxygen plasma is directed to the indexing particles
to generate an active group on the surface thereof, then
3-aminoethyl aminopropyl trimethoxysilane is reacted to the
indexing particles to introduce an amino group into the surface,
the amino group is converted to a carboxylic group with succinic
acid anhydride, this carboxylic group is changed to succinimid
ester, and a probe DNA having an amino group at the 5' terminal may
be fixed thereto. When PNA is used as a probe DNA, the amino
terminal of the probe DNA is used to fix the probe on the surface
as above. Needless to say, the specific biological materials 41b,
42b, 3b and 44b hybridized to the probes 41a, 42a, 43a, and 44a
shown in FIG. 130(B) have sequences complementary to the probes
41a, 42a, 43a, and 44a. The specific biological materials with
labeling particles such as nanoparticles of gold (20 nm) fixed
thereon are prepared by preparing a sequence having an SH group at
the 5' terminal and mixing the sequence with the nanoparticles of
gold. The indexing particles 41 to 44 are mixed with a sample
solution containing the specific biological materials to hybridize
the specific biological materials to the probes 41b, 42b, 3b and
44b. Then the hybrid is dripped at a certain amount onto the
indexing particle fixing area on the substrate 101, dried and
scanned under the scanning electron microscope 300 as described
above to obtain an SEM image and elemental analysis images as
described above. The assessment is performed with the method
described with reference to FIG. 129.
Example 2
[0966] Descriptions are provided for a case in which the technique
described in Example 1 is applied for quantitatively detecting
specific biological materials directly from a mixture of mRNA or by
cDNA converted.
[0967] FIG. 131(A) is a view schematically showing the indexing
particles 41 to 44 and probes 41a, 42a, 43a, and 44a fixed onto
surfaces of the indexing particles 41 to 44; FIG. 131(B) is a view
schematically showing a specific biological material with poly A
hybridizing to each of the probes 41a, 42a, 43a, and 44a; and FIG.
131(C) is a view schematically showing the poly T hybridizing to
the poly A.
[0968] As shown in FIG. 131(A), also in Example 4, configuration of
each of the indexing particles 41 to 44 is the same as that
described in Example 3. Namely specific probes 41a, 42a, 43a, and
44a are fixed to the indexing particles 41 to 44 respectively. As
shown in FIG. 131(B), poly A is added to the specific biological
materials 41b, 42b, 43b, and 44b. It is needless to say that the
probes 41a, 42a, 43a, and 44a are complementary to the specific
biological materials 41b, 42b, 43b, and 44b respectively, but when
mRNA is directly detected, 1) a sequence complementary to a 30- to
50-base sequence ranging from the exon closest the poly-A terminal
of mRNA to the second exon thereof is used as a probe. 2) When
measuring as a cDNA, if a single-stranded cDNA (prepared by
removing mRNA sequence, after cDNA is synthesized, with RNase, and
complementary to the mRNA) is used as a sample, the 30- to 50-base
sequence ranging from the exon closest the poly-A terminal of mRNA
to the second exon thereof in the same side as the mRNA is used as
a probe. In this case, a probe based on a sequence complementary to
cDNA is used in the probes in place of probes 41a, 42a, 43a, and
44a shown in FIG. 131(A); a single-stranded cDNA is used in place
of the specific biological materials 41b, 42b, 43b, and 44b shown
in FIG. 131(B); and a poly A is used in place of the poly T
conjugated to the labeling particle shown in FIG. 131(C) each as a
probe. 3) When a double-stranded dDNA is used as a sample, a
portion of the sequence close to the 3' terminal (30 to 50 bases)
from the poly-A terminal of human mRNA sequence to the site where
the first MboI sequence appears is used as a probe. In this case, a
combination of a probe having the same sequence as that of the mRNA
and poly T conjugated to the labeling particle shown in FIG. 131(C)
is used in places of the probes 41a, 42a, 43a shown in FIG. 131(A),
or a combination of a probe having the sequence complementary to
that of the mRNA and poly A conjugated to the labeling particle
shown in FIG. 131(C) is used in places of the probes 41a, 42a, 43a
shown in FIG. 131(A). When a double-stranded dDNA is used, any
desired synthetic DNA can be introduced to the
MboI-cut-off-terminal of the dDNA by a ligation reaction using the
DNA ligase. In the case, a sequence complementary to the synthetic
DNA in place of the poly T is conjugated to a labeling particle
shown in FIG. 131(C).
[0969] Descriptions are provided below for the case 1) as a
representative case. For fixing probes to the indexing particles
shown in FIG. 131(A), any known method may be used. For instance,
oxygen plasma is irradiated to the indexing particles to generate
an active group on a surface thereof, then an amino group is
introduced to the surface by reacting 3-aminoethyl aminopropyl
trimethoxysilane thereto, then the amino group is converted to a
calboxylic group with a succinic acid anhydride, the carboxylic
group is converted to succinimid ester, and a probe DNA having an
amino group may be added to the 5' terminal of the ester. When PNA
is used as a probe DNA, the amino terminal of the probe DNA is
processed according to the same procedure.
[0970] As shown in FIG. 131(C), poly T-gold nanoparticles with poly
T (T30) (SEQ ID NO: 18) fixed thereto (with the size of 20 nm) is
prepared. For fixing poly T to the gold nanoparticles, a sequence
having an SH group at the 5' terminal is synthesized, and the
sequence is mixed with the gold nanoparticles.
[0971] The mixture solution containing the sample mRNA shown in
FIG. 131(B) (containing the RNase inhibitor), a suspension of
indexing particles shown in FIG. 131(A), and a suspension of the
poly T-gold nanoparticles shown in FIG. 131(C) are mixed and a
mixture solution is heated to 70.degree. C. 0.1 to 1-M NaCl and
50-mM citric acid (pH 7) containing a surface active agent as a
dispersant are used as the reaction liquid. The reaction liquid is
mildly agitated for one hour at 45.degree. C. to always keep the
particles in the suspended state. In this step, the mRNAs 41b, 42b,
43b, and 44b are captured by the indexing particles 41 to 44 having
the complementary probes 41a, 42a, 43a, and 44a, and the poly
T-gold nanoparticles are conjugated to the poly A portions of the
captured mRNAs.
[0972] FIG. 132 is a view schematically showing a result of
operations for mixing particles, a sample, and labeling particles
to obtain hybrids among the DNA probes 41a, 42a, 43a, and 44a,
mRNAs 41b, 42b, 43b, and 44b, and poly T-gold nanoparticles. In
each hybrid, the indexing particle correspond to a probe on the
surface, and further the probe corresponds to each mRNA. In this
case, poly T in some poly T-gold nanoparticles may be conjugated to
poly A in mRNA in the reverse direction, or off by one base, but
these phenomena do not give substantial damages to the effect
provided in the twenty-sixth embodiment. In FIG. 132, the probes
41a, 42a, 43a, and 44a fixed to the indexing particles 41 to 44
respectively at the 3' terminal thereof and gold nanoparticles with
poly T fixed at the 5' terminal are used. For the reason described
above, the complex structure as shown in FIG. 132 is provided, but
also indexing particles 41 to 44 with the probes 41a, 42a, 43a, and
44a fixed thereto at the 5' terminal may be used.
[0973] The substrate having the hybrids obtained in Example 2 can
be assessed by irradiating an electron beam to the substrate with
the scanning electron microscope 300 for scanning to obtain an SEM
image and an elemental analysis image, and according to the method
described with reference to FIG. 129.
[0974] FIG. 133 is a view showing the situation during processing
expected to provide an assessment result with higher precision as
compared to the result provided by the homogeneous reaction
described with reference to FIG. 132 in which the indexing
particles, sample mRNAs, and poly T-gold nanoparticles are
simultaneously reacted. At first, the DNA probes 41a, 42a, 43a, and
44a fixed on the indexing particles 41 to 44 are reacted to the
mRNAs 41b, 42b, 43b, and 44b to prepare hybrids between the
indexing particles and the sample mRNAs and unnecessary components
are washed away. Then the hybrids may be reacted to the poly T-gold
nanoparticles shown in FIG. 132.
[0975] In Examples 1 and 2, a plurality of biological materials
contained in the sample can simultaneously be discriminated and
detected by the indexing particles with specific probes fixed
thereto. In this step, the reaction between the samples and
indexing particles can be performed in batch in the suspended
state, so that, different from the DNA microarrays or protein
arrays in which a reaction is performed on a surface of the
substrate, the reaction can be carried out homogeneously and the
reaction speed is faster because the particles are dispersed in the
solvent, which advantageously enables simultaneous measurement for
multiple items.
[0976] For instance, a colon cancer tissue piece cut off from the
affected area is frozen with liquid nitrogen, and the frozen piece
is directly added to phenol chloroform and homogenized, and then
the total RNA is extracted in the examples described above, but in
this example, 0.1% (W/V) solution of magnetic particles (2.8 .mu.m)
containing gallium, yttrium, cesium, osmium, and platinum with
various probes fixed thereto at 8 different contents mixed in 50
.mu.l of total RNA solution is added as indexing particles for
discriminating sequences having about 40-base length complementary
to various mRNAs. Under the conditions of salt concentration of 1 M
and citric acid concentration of 50 mM, the reactants are left for
one minutes at 70.degree. C. and mildly agitated at 45.degree. C.
for hybridization. Then a magnet is approached from outside of the
vessel to attract magnetic particles with the supernatant removed,
and then the reaction products are washed with 1M NaCl and 50 mM
citric acid buffer solution (pH 7). The gold nanoparticles are
suspended in the buffer solution and the mixture solution is
agitated for one hour at the room temperature.
[0977] The indexing particle-mRNA-gold nanoparticle-labeled poly T
complex produced through the hybridization reaction is collected on
a wall of the vessel using a magnet and washed with 1-M Na Cl and
50-mM citric acid buffer solution (pH 7), and then is washed with a
70% ethanol aqueous solution, and is suspended in 100 .mu.l of 70%
ethanol. 1 .mu.l of the mixture solution is dripped onto the vessel
102 (See FIG. 128) in Example 1, and is dried for 3 hours in the
depressurized state. A substantially long period is consumed for
drying in the depressurized state so that high vacuum in the
scanning electron microscope will not be affected.
[0978] The particle hybrids prepared as described above are
observed with a scanning electron microscope. In this step, the
number of gold colloidal particles captured on surfaces of the
magnetic particles can be counted. Then the operating mode is
switched to the detection mode with the energy dispersive
characteristic X-ray detector. When the electron beam 300-4
collides the indexing particles, X-rays having various wavelengths
specific to elements on the surfaces of the indexing particles are
generated. The X-rays with specific wavelengths are detected with
the energy dispersive characteristic X-ray detector or wavelength
dispersive characteristic X-ray detector 300-8 to perform elemental
analysis. With this operation, the magnetic particles coupled to
the gold nanoparticles can be indexed, and quantities of mRNA
molecules with the corresponding gold nanoparticle-labeled probes
hybridized thereto can be identified. In this state, one gold
nanoparticle corresponds to one mRNA molecule.
[0979] When the indexing particles with different concentrations of
gallium, cesium, osmium, and platinum each as an element for
indexing at 8 grades are used, 25000 types of human mRNAs can be
measured in batch.
[0980] As described above, by using particles with various contents
of various elements according to the twenty-sixth embodiment, it is
possible to profile each mRNA at a single molecule level without
using the prior art-based probe chips having a complicated
structure and very difficult to be manufactured and also by using
the particle counting technique.
Example 3
[0981] In Examples 1 and 2, particles for detection and
quantification having the poly T having the same sequence as that
of the indexing particles each with a discrete probe DNA fixed
thereto are used. But in Example 3, for further raising the
specificity, it is possible to develop a system in which the
indexing particles 41 to 44 having discrete sequence probes 41a,
42a, 43a, and 44a respectively and labeling particles having the
probes 41d to 41d corresponding to the indexing particles 41 to 44
respectively are used. Descriptions are provided below for this
system.
[0982] FIG. 134(A) is a view schematically showing the discrete
probes 41a, 42a, 43a, 44a and 45a similar to examples 1, 2; FIG.
134(B) is a view schematically showing the state in which the
probes 41c, 42c, 43c, and 44c are further added to the specific
biological materials 41b, 42b, 43b, and 44b each having poly A
hybridizing to the probes 41a, 42a, 43a, and 44a respectively as
samples having mRNA sequences to be measured; and FIG. 134(C) is a
view schematically showing a case in which the synthetic
oligonucleotides (with the 20- to 50-base length) 41d, 42d, 43d,
and 44d complementary to the probes 41c, 42c, 43c, 44c, and 45c
having the sequence described above (the specific material 45c is
not included in the samples shown in FIG. 134(B) are labeled with
gold nanoparticles (20 nm). FIG. 134(D) is a view showing the state
of the indexing particles, samples, and oligonucleotides labeled
with gold nanoparticles after hybridization.
[0983] The indexing particles 41 to 45 with the probes 41a, 42a,
43a, 44a, and 45a fixed thereon are reacted to the samples with
mRNA mixed in shown in FIG. 134(B) to selectively capture the
probes with the probes 41b, 42b, 43b, and 44b of the sample mRNAs
onto the indexing particles, and then gold nanoparticles (20 nm)
having synthetic oligonucleotides 41d, 42d, 43d, and 44d (with the
20 to 50 base length) having sequences complementary to the
sequences corresponding to the indexing particles, namely to other
portions 41c, 42c, 43c, and 44c of the same mRNAs are reacted
thereto. Magnetic particles are used as the indexing particles. At
first, indexing particles for the mRNA existing a lot such as
.beta.-globin or .beta.-actin included in the mRNA are added, and
only the reacted ones are attracted with a magnet to remove it. In
this step, only unnecessary mRNAs are removed, and therefore the
time required for hybridization may be short, for instance, 15
minutes. Then indexing particles for mRNA to be measured are added
and reacted for 30 minutes, and then particles not reacted yet are
removed by washing. Further gold nanoparticles having probes for
the mRNAs are added and reacted for 30 minutes. What is important
in this step is that the synthetic oligonucleotides 41d, 42d, 43d,
44d, and 44d labeled with gold nanoparticles are mixture materials.
Therefore, gold nanoparticles 46 are detected only in the hybrids
41e, 42e, 43e, and 44e among the obtained particle hybrids, and the
gold nanoparticles are actually not detected in the 45e not
including a target material therein.
[0984] Merits provided in Example 3 are as described below. Assume,
for instance, that mRNA has a similar sequence. Also assumes a case
in which the mRNA 41b shown in FIG. 134(B) hybridizes not only to
the probe 41a fixed on the indexing particles, but also the probe
42a. This types of phenomenon often occurs in DNA hybridization. In
other words, in addition to the mRNA having the target sequence
42b, also mRNA having the sequence 41b is sometimes captured as an
artifact on a surface of the indexing particle 42. In this step, by
reacting a group of probes containing the sequence 41d and a group
of probes containing the sequence 42d shown in FIG. 134(C)
discretely, it is possible to separate and count even the mRNA
which can not be separated and identified with the probe sequence
on the indexing particles by remarking the difference in the probe
sequences as shown in FIG. 134(C). In a group of indexing particles
each having a sequence corresponding to an indexing bead with gold
nanoparticle not added thereto, the gold nanoparticles are not
coupled to the surface of the indexing particle 42a, so that the
gold nanoparticle is not detected.
Example 4
[0985] In Example 4, detection of multiple biological materials
through the antigen-antibody reaction is described with reference
to FIG. 135.
[0986] At first the F(ab').sub.2 fragment is prepared by
decomposing various types of monoclonal antibodies with papain.
Magnetic particles (3 .mu.m) coated with polystyrene containing Hf,
Pt, and Ce each at the concentrations of 0, 1, 2, 3, 4, 6, 8, and
10 weight percents respectively are prepared as indexing particles.
Different F(ab').sub.2 fragments 91a, 92a, 93a, and 94a are fixed
to the indexing particles 91, 92, 93, and 94 to obtain the
F(ab').sub.2 fragment-labeled indexing particles. Any known method
may be employed for fixing the F(ab').sub.2 fragment. For instance,
a minute quantity of a monomer with a functional group introduced
therein is mixed in polystyrene and the functional monomer exposed
on the surface may be used for fixing the F(ab').sub.2 fragment, or
the surface is oxidized by oxygen plasma so that 3-aminoethyl
aminopropyl trimethoxysilane is reacted with the amino group
introduced into the surface thereof, then the amino group is
converted to a carboxylic group with succinic acid anhydride, then
the carboxylic group is changed to a form of succinimido ester.
Then a probe DNA having an amino group at the 5' terminal can be
fixed thereto. As the F(ab').sub.2 fragment, for instance,
antibodies to AFP91b, CEA92b, EpCAM93b and the like may be used.
The F(ab').sub.2 fragment mixture is coated with sphingolipids.
Serums (from healthy people and those suffering from liver cancer)
doubly diluted with 2.times.PBS (1.times.PBS: 0.15M NaCl, 50 mM
sodium phosphate buffer solution (pH 7.4)) containing 0.2% Tween 20
is added to the F(ab').sub.2-labeled indexing particle mixture.
After agitated for 10 minutes at 37.degree. C., the indexing
particles are attracted with a magnet to the vessel wall, and the
supernatant is discarded. The reaction product is washed with PBS
containing 0.1% Tween 20. Monoclonal antibodies labeled with gold
nanoparticles 91c, 92c, 93c, and 94c are added to the monoclonal
antibodies for antigens to be measured (those having different
epitopes from the F(ab').sub.2 fragments fixed on the indexing
particles). Also the monoclonal antibodies are labeled with the
F(ab').sub.2 fragment respectively, and about three SH groups are
introduced for molecule with iminothiolan, and the SH group is
labeled with the gold nanoparticles (20 nm.phi.). Reference numeral
91c indicates a gold nanoparticles-labeled antibody to AFP,
reference numeral 92c indicates a gold nanoparticles-labeled
antibody to CEA, reference numeral 93c indicates a gold
nanoparticles-labeled antibody to EpCAM, and reference numeral 94c
indicates a gold nanoparticles-labeled antibody to other antigens.
The reacting materials are left for 10 minutes at 37.degree. C. to
obtain indexing particle-antigen-gold nanoparticle particle hybrids
91d, 92d, 93d, and 94d with the supernatant discarded, and the
hybrids is washed with PBS containing 0.1% Tween 20, and is then
washed with 50% ethanol dissolved in deionized water. In this step,
proteins are denatured, but the indexing particle-antigen-gold
nanoparticle particle hybrids do not collapse. 1 .mu.l of the
solution is added on the vessel 102 shown in FIG. 128 and dried in
the depressurized state. Then recognition of the forms and
elemental analysis are performed with a scanning electron
microscope.
[0987] As a result, 64 gold nanoparticles are found on a surface of
the indexing bead for AFP in a serum from healthy people, and 3200
gold nanoparticles in a serum from people suffering from cancer,
which indicates that more gold nanoparticles are found in serums
from people suffering from cancer. There is no substantial
fluctuation in CEA or EpCAM, and in any of the samples, only about
30 to about 100 gold nanoparticles are obtained on surfaces of
indexing beads to the antigens.
[0988] As described, the twenty-sixth embodiment of the present
invention can be carried out in various forms, and in any case,
hybridized sample DNA molecules or the like are detected one by
one, so that the sensitivity substantially higher than that
provided by the conventional methods is provided. An extremely
minute quantity of DNA (RNA) can be detected with an extremely
small volume of samples, and therefore a target DNA (RNA) can be
detected without performing pre-amplification with PCR as required
in the conventional techniques. Further labeling particle used for
detection can be changed in its size and form, so that 6 to about
10 different types of samples can be analyzed in batch with the
same element. This technique can be applied not only to the
differential hybridization, but also to a method in which sample
nucleotides are captured with the same probe and detected with
different labeling probes. With the multiplex analysis method
according to the twenty-sixth embodiment of the present invention,
detection of alternative splicing or typing of a plurality of SNPs
can advantageously be performed with one element.
[XXVII] Twenty-Seventh Embodiment
[0989] A twenty-seventh embodiment discloses a gel plate having the
shape designed to reliably collect a separated substance of high
purity from a separation gel spot for two-dimensional
electrophoresis gel after the separation by electrophoresis, an
electrophoretic separated substance collecting device, and a method
of collecting an electrophoretic separated substance for collecting
the separation gel spot while observing the same.
[0990] Considering the technique for collecting an electrophoretic
separated substance to date, one will find that there is a problem
in cutting out gel after separation. When the technique is
automated, a separated band is recognized to cut out a position
corresponding to the band; however, it is often difficult to cut it
out while observing because a cut-out jig obstructs the view.
Though it is typical to capture images and conduct a cut-out based
on the image data, a delicate cut-out is difficult to cut out
tender gel. When an electrophoretic separated substance is
collected using an electrode, the electrode is moved to a spot
position referring to captured images, as the electrode forms an
obstacle.
[0991] In the twenty seventh embodiment, an electrophoretic
separated substance included in a gel spot is collected while
confirming the position and shape of the gel spot. For this
purpose, gel is collected after being melted with the photothermal
conversion using light. It is desirable that gel turns to be a thin
layer with the thickness of 0.5 mm or less, preferably 0.2 mm or
less, and is configured to contact a substrate in order to prevent
a melted range from broadening owing to thermal diffusion.
Convergence light is employed because the irradiated light is
required to be sufficiently small as compared to a spot. In
addition, as light needs to convert into heat, laser at 1480 nm is
employed. Laser is absorbed into water in gel to generate heat. As
it is necessary for gel to be melted by heat, gel used herein
includes agarose, linear polyacrylamide, dimethylcellulose and the
like including agarose, copolymers of agarose and linear
polyacrylamide, dimethylcellulose and the like. When protein is to
be separated, in particular, the aforementioned gel including low
melting point agarose having a melting point of 60.degree. C. or
less is used.
Example 1
[0992] FIG. 136 is a view schematically showing the situation in
which a separated band is formed by electrophoresis in Example 1.
FIGS. 137(A), 137(B) and 137(C) are views schematically showing
melting and collection of the separated band with heat described in
FIG. 136. Herein descriptions are provided for an example of
separating a PCR product with the one-dimensional
electrophoresis.
[0993] A sample used herein is amplified products form cDNA of
human mRNA prepared by PCR amplification using synthetic oligo DNAs
(concentration: 0.2 pmol/.mu.l) having the sequence identification
No. 1 and No. 2 as primers respectively, which is according to the
conventional technology. In the PCR, a cycle of denaturation at
94.degree. C. for 5 seconds, and annealing at 55.degree. C. for 10
seconds and at 72.degree. C. for 10 seconds is repeated 35 times.
The quantity of a reaction solution is 2 .mu.l. The base length of
the PCR product predicted from the database is 233 bp.
TABLE-US-00018 CTGAGCGAGT GAGAACCTAC TG: (SEQ ID NO: 1) AGCCACATCA
GCTATGTCCA: (SEQ ID NO: 2)
[0994] In FIG. 136, reference numeral 1 indicates a glass
substrate. On the glass substrate 1 is applied 2% agarose gel 2, 10
cm square and 0.1 mm thick. The agarose gel has a thickness of 0.2
mm and a size of 90.times.90 mm. On the agarose gel is provided a
slit 3 allowing addition of a sample. The size of the slit 3 is 5
mm in width and 0.5 mm in the electrophoretic direction. In the
figure, though a plane view is omitted, a plurality of the slits 3
is provided at suitable regular intervals, for instance, at an
interval of 10 mm, so that a plurality of samples can be subjected
to electrophoresis.
[0995] Gel is configured to connect a negative electrode 5-1 and a
positive electrode 5-2 via sponges 4-1 and 4-2 containing a buffer
also serving as an electrolysis solution of Tris-acetic acid (pH
8.2). 0.5 .mu.l of a sample solution is filled in the slit 3 with
capillary phenomenon, and is put in a wet box, to which is
impressed electric field by immediately connecting the electrodes
5-1 and 5-2 to a power source. Of course, electrophoresis may be
conducted, like the conventional submarine electrophoresis, by
immersing gel in an electrolysis solution. The electrophoresis is
carried out with the electric field intensity of 15 V/cm, and, for
instance, for 30 minutes.
[0996] At this point of time, a prespecified amount of ethidium
bromide is put in the gel, in addition to the electrolysis
solution. Ethidium bromide is put in a sample; however, the
electrolysis solution is not. Ideally, a PCR product dissolved in
water is preferable, but a PCR solution diluted with water twofold
or more may be used. This intends the stacking effect when a PCR
product in a sample solution penetrates the gel. Ethidium bromide
produces fluorescence when intercalated in a duplex DNA and excited
with YAG laser at 545 nm, so that existence of ethidium bromide can
be easily confirmed. Reference numerals 6-1 to 6-4 in the figure
indicate separated bands separated with electrophoresis as
described above. Herein the band 6-3 is the target band to be
melted and collected.
[0997] As shown in FIG. 137(A), laser light 7 at a wavelength of
1480 nm is irradiated. Laser beams thereof are narrowed down to 50
.mu.m.phi.. If the diameter of a spot for an electrophoretic
separated band is smaller than this, laser beams are needed to be
further narrowed down, and in this case, an objective lens for a
microscope of about 10 magnifications may be used. Reference
numeral 13 indicates a lens when such an objective lens is
inserted. It is to be noted that a fluorescent observation of gel
in a wide range is not possible in this case, because the objective
lens is inserted. Only a portion of an electrophoretic separated
band targeted to be cut out can be confirmed; nevertheless, laser
irradiation can be executed while moving a stage and confirming a
target spot, not causing any problem. Generally, it is often the
case that the objective lens 13 is not used.
[0998] When laser beams 7 are irradiated, temperature of the gel in
the band 6-3 portion of the gel 3 rises within an extremely short
period of time, and the gel is melted. Reference numeral 9 is a
pipet, which interlocks a syringe pump 14 to allow sucking of the
melted gel. As shown in FIG. 137(B), this operation opens a hole 8,
in which the separated band 6-3 has once existed, and the separated
band 6-3 is sucked in the pipet as shown with reference numeral
6-3'.
[0999] Then, as shown in FIG. 137(C), the pipet 9 is moved, and the
syringe pump 14 is operated to discharge the separated band 6-3'
from the pipet 9 to a plate 10, so that the resultant separated
band 6-3' can be collected as a dot of separated band as indicated
at reference numeral 11.
[1000] FIGS. 138(A) and 138(B) are waveform diagrams each showing a
dot 11 of the separated band obtained as described above and the
result of analysis of a solution obtained by PCR amplification
before separation. Herein the figures are the waveform diagrams
demonstrating the result analyzed with an i-chip (micro
electrophoretic chip) and a cosmo i-chip electrophoresis device
produced by Hitachi, Ltd.
[1001] As shown in FIG. 138(A), the result of analyzing the dot 11
of the separated band provides a substantially single
electrophoretic separated band at a position of 230 bp. When the
result of analyzing the dot 11 of the separated band is examined in
comparison with the database, it can be understood that a predicted
base length of the PCR product does not represent any band other
than the peak 20-3' at 233 bp. Peaks 20-1, 20-2, 20-3 and 20-4
corresponding to a plurality of bands are detected from the PCR
product before separation.
Example 2
[1002] In Example 2, descriptions are provided for an example of
separating and collecting a protein separation spot separated by
the two-dimensional electrophoresis with the device according to
the twenty seventh embodiment.
[1003] Electrophoresis in one dimension is the isoelectric focusing
electrophoresis. In the isoelectric focusing electrophoresis, 0.5%
agarose gel containing carry ampholyte (pH 4-7) in a glass tube 1
mm in diameter and 8 cm long is used for migration at 400 V for 8
hours. After finishing the migration, the gel is pushed out from
the glass tube, and is placed at a position 10 mm from the negative
pole side of the gel of the second dimension 90.times.90.times.0.2
mm in size. The gel of the second dimension is 2% agarose.
Tris-acetic acid buffer (pH 8.5) is used as a buffer solution in
the second dimension. Staining is conducted with Coomassie
brilliant blue R250 in compliance with appropriate information to
find that a protein separated band is stained blue.
[1004] FIG. 139 is a schematic view showing configuration of a
device for recovering a specific band separated by two-dimensional
electrophoresis.
[1005] The present device has a general observation optical system
200 on the upper surface of separation gel 100 and a laser heating
optical system 300 on the under surface of separation gel 100, in
order to heat with convergence light while observing a protein spot
separated on the two-dimensional electrophoretic separation gel
100.
[1006] Firstly, the general observation optical system 200 is
configured as described below. Light irradiated from a light source
170 is irradiated to the electrophoretic separation gel 100. The
irradiated light passes through an objective lens 205 and a filter
206 to reach a CCD camera 207. Image data obtained in the CCD
camera 207 is sent to an image processing analysis device 161 and
is used for detecting and aligning a spot and monitoring the state
of laser heating.
[1007] In the laser heating optical system 300, light irradiated
from a laser light source 141 is selected based on a wavelength,
according to, for instance, a laser irradiation signal given by a
user upon viewing a monitor screen, and then, the irradiated light
is induced to an objective lens 305 by a dichroic mirror 310 to
converge on the gel 100. When a converging point is needed to
shift, the dichroic mirror 310 is moved accordingly to shift the
convergence position of laser within a plane surface of the gel
100. Gel present at the site where laser convergence light is
irradiated is melted, which is observable as a light emitting point
with the optical system 200. Laser irradiation by the objective
lens 305 is sent to the image processing analysis device 161 via
the dichroic mirror 310, mirror 144, lens 145 and filter 146. The
image processing analysis device 161 sends a signal for stopping
laser irradiation to the laser light source 141 upon information on
laser irradiation.
[1008] Image data obtained in the camera 207 is analyzed with the
image processing analysis device 161. The movable dichroic mirror
310, and a motor for moving stage 162 for freely moving in the X-Y
direction in order to control the position of a movable XY stage
304 with the gel substrate mounted thereon having a temperature
regulating plate 101 can be controlled based on various results of
analysis. This enables recognition of the shape of a protein
separated spot or tracking of laser irradiation after the
recognition. Alternatively, it is possible to continually recognize
a spot to subject the same to laser heating in sequence, or
shifting a position of the pipet 9 to collect melted agarose by
moving the syringe 14.
[1009] After finishing the laser irradiation, the pipet 9
immediately shifts to the position where a spot has once existed to
suck the melted agarose. A heater is attached to the pipet 9, so
that the temperature thereof can be maintained in a range from
30.degree. C. to 65.degree. C. if necessary. As the melted agarose
is re-solidified over time, access to the pipet 9 should be made
without delay. The pipet 9 accesses the proximity of the laser
irradiation optical axis during laser irradiation, and immediately
after finishing the laser irradiation, shifts to a portion where
agarose is melted to suck the melted agarose. Though not shown in
the figure, the pipet 9 is attached to an arm capable of moving in
the X-Y direction as well as in the vertical direction, and quickly
shifts to a spot position following the directions from the image
processing analysis device 161, as indicated with the arrows
210.
[1010] Agarose sucked in the pipet is analyzed similarly as
described in Example 1.
Example 2
[1011] FIG. 140 is a view showing a collecting method in Example 2
which is different from the method of collecting thermally melted
gel of the electrophoretic spot portion melted by being heated with
converged light, as described in Example 1 and a structure of a
pipet used in the method. The present method is described as a
method in which a pipet used herein substitutes the pipet 14 for
the device of collecting a specific band separated with the
two-dimensional electrophoresis, and protein is collected from a
protein separation spot two-dimensionally developed by the
electrophoresis.
[1012] A chip 401 is attached to a pipet 400. The chip 401 is used
as disposable. Firstly, a cylinder 400' of the pipet is operated to
fill the pipet with an electrolysis solution 440. A first electrode
402 is attached to the inside of the pipet 400. The pipet 400 sucks
gel melted with convergence light in the same way as Example 1. At
this point of time, temperature of the gel drops, and the gel is
gelated again in the pipet chip 401. Then the tip of the chip 401
is immersed in a prespecified amount of an electrolysis solution in
a vessel 406. A second electrode 403 is attached to the vessel 406.
Electric field is impressed between the first electrode 402 as
negative pole and the second electrode 403 as positive pole at 15
V/cm. Thus separated protein contained in the gel 405 solidified in
the chip 401 is eluted in the electrolysis solution by
electrophoresis. This operation enables to collect a target protein
in the vessel 406.
[XXVIII] Twenty-Eighth Embodiment
[1013] As a twenty-eighth embodiment, a new technique is described
which, expanding on the scope of a conventional method of simply
isolating biochemical substances, isolates molecules active to a
cell and found only in very small quantity in a functionally
traceable manner, in order to clarify functionality of a cell. For
this purpose, a solution including a small number of cells or cell
masses are placed on a basal plate as a liquid droplet, and a
focused light beam is irradiated on the liquid droplet on the basal
plate.
[1014] FIG. 141 (A) is a plan view of a cell-holding basal plate
100 suitable for the 28th embodiment of the present invention, and
FIG. 141 (B) is a cross-sectional view of the plan view viewed at
the A-A line on the plan view to the direction of the arrow. A
reference numeral 1 indicates a silicon basal plate with, for
example, a size of 20 mm.times.20 mm and a thickness of 1 mm. On
the surface of the basal plate 1 is a hydrophobic area 2, and in
the hydrophobic area 2 are provided an array of hydrophilic areas
3. A size of a hydrophilic area 3 is small enough in comparison to
a size of a diameter of the liquid droplet to be placed on the
hydrophilic area 3. A reference numeral 4 refers to a marker for
positioning, and is formed on a side of the silicon basal plate
1.
[1015] For the creation of the hydrophilic area and the hydrophobic
areas, an upper surface of the silicon basal plate may, for
example, first be oxidized, generating a hydrophilic SiO.sub.2 thin
film on the entire surface. Thereafter, the SiO.sub.2 thin film is
dissolved and removed from areas intended to be hydrophobic with
hydrofluoric acid. Alternatively, if on the surface of the material
for the basal plate 1 is formed the SiO.sub.2 thin film in advance
and the surface is therefore hydrophilic, the hydrophobic area may
be formed by placing hydrophobic material such as fluorine resin or
silicon resin thereon. In this case, the hydrophilic areas in the
hydrophobic area are depressed by a thickness of the hydrophobic
material. FIG. 141 is an example in which the hydrophobic area 2 is
formed with the latter method.
[1016] FIG. 142 (A) is a conceptual diagram illustrating an example
of a system configuration for forming a liquid droplet containing a
cell on the hydrophilic area 3 on the cell-holding basal plate 100
suitable for the 28th embodiment of the present invention, and FIG.
142 (B) is a cross-sectional view showing a liquid droplet
containing a cell formed on a hydrophilic area 3 of the
cell-holding basal plate 100.
[1017] In FIG. 142 (A), a liquid droplet containing a cell 12 is
formed on the hydrophilic area 3 on the cell-holding basal plate
100 while a liquid droplet at a tip of a pipette 11 for forming a
liquid droplet containing a cell 12 is being monitored optically. A
reference numeral 19 indicates a stage driven in the X-Y direction,
and a reference numeral 27 is a driving device for the stage 19. On
an upper surface of the stage 19 is placed the cell-holding basal
plate 100. Over the cell-holding basal plate 100 is provided the
pipette 11 having sucked up and contained suspension 13 containing
the cell 12 for containment in the liquid droplet. To a base of the
pipette 11 is connected a syringe pump 31 via a tube 30, and to the
syringe pump 31 is connected a driving device 32. When the syringe
pump 31 is driven by the driving device 32, the suspension 13
contained in the pipette 11 is squeezed out together with the cell
12. In the FIG. 142 (A), the base of the pipette 11 and the
connection part of the tube 30 are illustrated as not contacting
each other, but this is simply for the purpose of showing the
pipette 11 enlarged.
[1018] At the tip of the pipette 11 is placed a tip of another
pipette 20 for supplying culture fluid to the tip of the pipette
11. To a base of the pipette 20 is connected a syringe pump 35 via
a tube 34, and to the syringe pump 35 is connected a driving device
36. When the syringe pump 35 is driven by the driving device 36,
the culture fluid contained in the pipette 20 is squeezed out.
[1019] There is also provided a vertical driving device 37 for
driving the pipette up and down for transferring the liquid droplet
formed at the tip of the pipette 11 to the hydrophilic area 3 on
the cell-holding basal plate 100. In this example, the vertical
driving device is connected to the pipette 11. If a user issues an
instruction for lowering the pipette 11 to the vertical driving
device 37, the pipette 11 moves downward, and the liquid droplet
formed at the tip of the pipette 11 is transferred to the
hydrophilic area 3 on the cell-holding basal plate 100. If the user
issues an instruction for restoring a position of the pipette 11 to
the vertical driving device 37, the pipette 11 returns to the
original position as shown in FIG. 142 (B). The restoring of the
pipette 11 to the position shown in FIG. 142 (B) may be controlled
with a personal computer 26 sequentially from the time of the
lowering operation. A dot-dash line 39 indicates that the vertical
driving device 37 is connected to the pipette 11.
[1020] Further, a light source 16 and a light-condensing lens 17
are provided, forming an optical system for monitoring a size of
the liquid droplet to be formed inside the pipette 11 near the tip
or at the tip thereof, and a collimate lens 18 and a monitor 25 are
provided below the cell-holding basal plate 100 facing the light
source 16 and the light-condensing lens 17. For this reason, the
cell-holding basal plate 100 and the stage 19 need to be
transparent optically. The reference numeral 26 indicates a
so-called personal computer, and supplies an appropriate control
signal to the driving devices 27, 32, 36 and 37, generated from a
program stored in advance in response to an input signal from the
monitor 25, or based on an input-operation signal 28 of the user
watching the image on the screen of the monitor 25. It is not shown
in the FIG. 142 (A), but it is convenient if an identical image
detected and shown by the monitor 25 is also shown on the monitor
of the personal computer 26. In this configuration, a small CCD
camera may be used as the monitor 25. The input-operation signal 28
is given with an input device of the personal computer 26.
[1021] If the cell-holding basal plate 100 and the stage 19 are not
transparent optically, the light may be irradiated from above, and
reflected light may be monitored. This means that the collimate
lens 18 and the monitor 25 are provided on the same side as the
light source 16 above the basal plate, and the reflected image is
observed. For example, the light may be irradiated diagonally, and
the image is observed from the right angle.
[1022] A size of the pipette 11 is described hereinafter. It is
necessary that the pipette 11 is such that a liquid droplet can be
formed at the tip thereof with an appropriate size for containing a
required number of cells. The pipette 11 is used after sucking the
suspension 13 containing the cells into inside the pipette 11 with
the functionality of the pipette 11, and upon forming a liquid
droplet 21, the cells passing through the tip of the pipette 11
must be detected without error with the monitor 25. Therefore the
diameter of the pipette 11 at the tip thereof must be large enough
to allow a cell, or a cell mass containing a prespecified number of
cells to pass, but not too large to allow too many cells exceeding
the counting capability to pass at once. This means that the
pipette must not be culture pipettes generally used at present with
a large diameter, but a transparent pipette with a diameter of 20
to 100 .mu.m for general animal cells and one with a diameter of
about 5 .mu.m for bacteria and other microorganisms.
[1023] An operation for forming the liquid droplet 21 containing
the cell 12 on the hydrophilic area 3 on the cell-holding basal
plate 100 is described hereinafter. Upon start-up of the system,
the user positions the cell-holding basal plate 100 for a
prespecified start-up position with the help of the marker 4
described in FIG. 141 (A). Next, the stage 19 is moved with the
driving device 27 based on the input-operation signal 28 for moving
the point on the cell-holding basal plate 100 for forming the
liquid droplet 21 containing the cells 12 to a position
corresponding to the tips of the pipettes 11 and 20. When the
cell-holding basal plate 100 is moved to the prespecified position,
an operation is performed for squeezing out the cell suspension
liquid 13 in the pipette 11 together with the cells 12. At the time
of the operation, the outside of the tip of the pipette 11 and the
inside near the tip thereof are monitored with the optical system
consisting of the light source 16 and the monitor 25. Output from
the monitor 25 is fed to the personal computer 26, and, based on a
picture image calculation result of the personal computer 26, the
driving device 32 may be operated for controlling liquid sent by
the syringe pump 31.
[1024] While monitoring the tip of the pipette 11 with the monitor
25, the driving device 32 is operated, the syringe pump 31 is
driven, the suspension 13 containing the cells 12 is squeezed out
of the tip of the pipette 11, and the liquid droplet 21 is formed
at the tip of the pipette. When the personal computer 26 recognizes
through the monitor 25 that a prespecified number of cells are
inserted into the liquid droplet 21, the personal computer 26
issues a halt instruction to the driving device 32 and the syringe
pump 31 is stopped.
[1025] In order to make a description simpler, the number of cells
12 inserted into the liquid droplet 21 is assumed to be one
hereinafter, although the number of cells may be set at the
discretion of the user. For instance, it may be set that 10 cells
are inserted to the liquid droplet 21. The cell 12 may be
recognized directly in the liquid droplet 21 at the tip of the
pipette 11, but more effectively, the cell 12 moving inside the
pipette 11 may be monitored with the monitor 25, the position and
the moving speed of the cell inside the pipette may be calculated
with the personal computer 26, the timing that the cell is squeezed
out to the liquid droplet 21 from the tip of the pipette 11 may be
forecast, and the syringe pump 31 may be controlled accordingly.
The latter recognition method is advantageous if, for instance, a
plurality of cells are moving inside the pipette with a short
interval and only one cell is to be inserted into the liquid
droplet.
[1026] If the cell concentration in the cell suspension 13 is low,
it is possible to start forming the liquid droplet 21 just prior to
the cell is squeezed out of the tip of the pipette 11 and stop
forming the liquid droplet after a prespecified time, for forming
the liquid droplet 21 of a desired size. When it is not desired to
form the liquid droplet, the liquid squeezed from the tip of the
pipette 11 can be, for example, blown away with a blower.
Alternatively, the liquid may be discharged to a drain formed
outside the basal plate 1.
[1027] If, on the other hand, the cell concentration in the cell
suspension 13 is high, the volume of liquid squeezed out of the
pipette 11 varies. Namely, the frequency with which the cell 12 is
squeezed out from the pipette rises, and if the time for squeezing
out the liquid is fixed at a prespecified length, there is a
possibility that a next cell is inserted into the liquid droplet
21. The pipette 20 is used in this case. The pipette 20 and the
syringe pump 35 connected thereto are filled with culture fluid or
cell diluting fluid only. When the personal computer 26 recognizes
through the monitor 25 that a cell 12 is squeezed out into the
liquid droplet 21, the personal computer 26 issues a halt
instruction to the driving device 32 and the syringe pump 31 is
stopped, and the personal computer 26 further calculates a cubic
volume of the liquid droplet 21 at that time from a movement
distance of the syringe pump 31 for forming the liquid droplet 21.
The personal computer 26 further calculates a difference between
the cubic volume of the liquid droplet 21 and a desired cubic
volume. Based on a result of the calculation, the culture fluid or
the cell diluting fluid is added from the pipette 20 to the liquid
droplet 21 already formed by that time with a signal sent from the
personal computer 26 to the driving device 36, driving the syringe
pump 35 and adding the fluid with the pipette 20 until the cubic
volume of the liquid droplet 21 reaches the prespecified
volume.
[1028] It is desired that the tip of the pipette 20 is thin enough
for the cell not to pass, for instance 0.2 .mu.m.phi. in diameter,
so that the cell in the liquid droplet does not flow upstream to
the pipette 20. Alternatively, the pipette 20 may be formed to have
a filtering structure of 0.2 .mu.m in diameter at the tip.
[1029] The liquid droplet 21 containing a cell formed in the manner
described above is brought in contact with the hydrophilic area 3
on the basal plate 1 placed on the stage 19 by the vertical driving
device 37 of the pipette 11, and the liquid droplet 21 is
transferred to the hydrophilic area 3 on the basal plate 1. The
liquid droplet 21 is shed by the hydrophobic area 2, and is fixed
to the energy-stable position at the hydrophilic area 3 in a
self-forming manner. The operator finishes the operation when it is
confirmed that the liquid droplet 21 containing the cell 12 is
transferred to the hydrophilic area 3 on the basal plate 1, that
is, the hydrophilic area 3 on the cell-holding basal plate 100.
[1030] FIG. 142 (B) is a cross-sectional view of the liquid droplet
containing a cell placed in the hydrophilic area 3 on the
cell-holding basal plate 100, formed with the system for forming a
liquid droplet containing a cell on the cell-holding basal plate
100 as described with reference to FIG. 142 (A). On the hydrophilic
area 3 of the basal plate 1 is placed a cell 12, and a liquid
droplet 15 is formed, enclosing the cell.
[1031] FIG. 143 is a oblique perspective view illustrating an
outline of an example device for destroying a cell in a liquid
droplet, targeting the liquid droplet 15 formed on the basal plate
as described above with reference to FIGS. 141 and 142. The device
described in FIG. 143 is an independent device, but it is
convenient if the device is formed combined with the system for
forming the liquid droplet as described with reference to FIG. 142
above and placed next to each other, and the personal computer 26
controls the movement of the cell-holding basal plate 100 by
controlling the stage 19, and irradiation of a laser beam.
[1032] In FIG. 143, the liquid droplet on the cell-holding basal
plate 100 can be irradiated with light from both above and below.
The light from the light source 41 placed above is first adjusted
to a specific wavelength with a filter 42, concentrated with a
condenser lens 43, and irradiated to the liquid droplet 15. The
irradiated light is led through an objective lens 47, a dichroic
mirror 48, a mirror 49 and a filter 51 to a camera 52 as
transmitted light, and the transmitted light image of inside the
liquid droplet 15 is formed on a light receiving surface of the
camera 52. For this reason, it is desirable that the cell-holding
basal plate 100 and the stage 19 are made of optically transparent
material, as with the system for forming the liquid droplet.
Specifically, glass such as borosilicate glass or silica glass, or
resin such as polystyrene or plastic, or a solid basal plate such
as a silicon basal plate, is suitable. If a silicon basal plate is
used for the basal plate 1 of the cell-holding basal plate 100, the
wavelength of the light from the light source 41 described above
should be 900 nm or longer.
[1033] Light irradiated from a light source 47 placed below is
first wavelength-selected with the filter 46, then led to the
objective lens 47 through the dichroic mirror 48, and is used as
excitation light for fluorescence for observing inside the liquid
droplet 15. The fluorescent light generated inside the liquid
droplet is observed with the objective lens 47 again, and the
fluorescent light after the excitation light is removed with the
filter 51 can be observed with the camera 52.
[1034] By adjusting a combination of the filters 42, 46 and 51, it
is possible to observe just the transmitted light with the camera
52, just the fluorescent light, or both the transmitted light image
and the fluorescent light image at the same time with the camera
52.
[1035] The picture image data obtained with the camera are analyzed
with the personal computer 26, and the stage 19 can be controlled
accordingly so that laser beam 63 may be focused on the liquid
droplet 15. If the laser beam 63 is of type ultraviolet laser, it
is dangerous to observe the light directly, and the CCD camera 52
is used for observation. Again, although it is not illustrated in
FIG. 143, it is convenient to display the picture image data being
detected with the CCD camera 52 on the monitor of the personal
computer 26.
[1036] A reference numeral 61 indicates a laser beam source and a
reference numeral 62 refers to a filter for wavelength selection:
in an example 1, the laser can irradiate a third harmonic component
of a YAG laser at 355 nm in wavelength. Intensity of the laser beam
63 is over around 200 .mu.J, and the beam is concentrated for
radiation to the cell. In FIG. 143, the laser beam 63 is irradiated
from the laser beam source 61 directly to the liquid droplet 15; it
is also possible to place mirrors in the path of the laser beam 63
as appropriate for leading the laser beam, if structural
constraints make it impossible to irradiate the liquid droplet 15
directly. The irradiation from the laser beam source 61 may be
controlled with the personal computer 26. The user can also control
the irradiation from the laser beam source 61 by inputting an
operation signal 28 to the personal computer.
[1037] When the laser beam 63 is focused on the cell 12 in the
liquid droplet 15 and a laser pulse of 200 .mu.J is irradiated to
the cell under observation with a microscope, it is observed that
membrane of the cell is destroyed instantaneously and cell contents
are splashed. Since the laser in the example is an ultraviolet
laser, all the optical components in the laser irradiation system
are compatible with ultraviolet. If the size of the liquid droplet
is large, or if there are many cells in the liquid droplet, the
intensity of the laser beam 63 may be strengthened. It is easy to
attain an output power of around 5 mJ.
[1038] The selection of the wavelength of the light and the way to
irradiate the light are important. If a wavelength is used for
which the water has light absorptivity, the water, or the solvent
itself, is evaporated. A wavelength should therefore be selected
which is absorbed by the cell but absorptivity of which by water is
ignorable. Specifically, one method is to use a wavelength in an
ultraviolet band, which biochemical substances, proteins and
nucleic acids absorb for conversion to heat. Alternatively, certain
visible light can destroy the cell, although the mechanism is not
known. It is known that the cell can be killed and destroyed
instantaneously if the light is irradiated to the cell as converged
light.
[1039] The purpose of the twenty-eighth embodiment of the present
invention is to destroy a very small number of cells, such as a
single cell, effectively and analyze or collect the contents
efficiently thereafter, and for this purpose the cell is contained
in a liquid droplet, so that dilution and splash of cell contents
at the time of cell destruction are prevented by containing them in
the liquid droplet. Generally, the cell and the water used as
solution have slightly different light-absorptivity
characteristics, and therefore, light with a wavelength, which is
little adsorped by water but is absorbed well by cell organs, is
irradiated on the liquid droplet, thereby heating and destroying
the cell only and retaining the contents of the destroyed cell in
the liquid droplet. If the light absorption and temperature
increase are slow, the temperature of the water, a component of the
solution, rises as well. It is therefore important to irradiate a
strong light for an instance, thereby realizing a faster
temperature increase for the cell with light absorptivity than the
temperature increase for the solution, and solubilizing the
cell.
[1040] FIG. 144 is a conceptual diagram illustrating a concrete
example of collecting biological substances directly from
suspension containing fragments of the destroyed cell in the liquid
droplet 15 according to the method described in the embodiment
above. A prespecified quantity (0.1 .mu.l) of fluorescent
intercalator CYBR Green II for RNA is added to the suspension
containing fragments of the destroyed cell in the liquid droplet
15. This is directly infused to the liquid droplet 15 with a
capillary tube. To the liquid droplet 15 are contacted a platinum
electrode 71 and a capillary 72 with an inner diameter of 50 .mu.m
filled with electrophoretic separation medium containing linear
dimethylpolyacrylamide as a main ingredient. The other end of the
capillary 72 is dipped into buffer fluid in a container 73. One end
of a platinum electrode 74 is also dipped into the buffer fluid. An
electric field of 50 v/cm is applied to the capillary 72 for 10
seconds between the platinum electrode 71 as a negative electrode
and the platinum electrode 74 as a positive electrode. Thereafter,
50 .mu.l of electrophoretic buffer fluid (Tris-HCl) is added to the
liquid droplet 15, and an electric field of 200 v/cm this time is
applied, continuing the process of electrophoresis. Aragon laser
from an argon laser source 75 of 488 nm, located at 10 cm from the
liquid droplet 15, is irradiated to the liquid droplet 15, and
resulted fluorescence is monitored with a detector 76.
[1041] It is omitted in FIG. 144, but it is desired that the
electrode 71 and the capillary 72 are held in an arm manipulator
with the tip thereof movable to a desired position, like the
vertical driving device 37 described with reference to FIG. 142,
which is controlled with the personal computer 26.
[1042] FIG. 145 is a electropherogram illustrating an example of an
electrophoretic pattern observed in the electrophoresis. The
horizontal axis represents the electrophoretic time, while the
vertical axis represents fluorescence intensity. Two sharp peaks 81
and 82 represents two types of rRNAs, a broad band 83 originates
from mRNA, and a reference numeral 84 corresponds to a polymer
genome. As is observable from FIG. 145, the biological substances
as described above are discharged from the other end of the
capillary 72 to the container 73 after a period corresponding to
the electrophoresis time. This means that biological substances can
be collected from a very small number of cells with a method
according to the twenty-eighth embodiment of the present invention.
Furthermore, as these biological substances are obtained by
destroying the cell in the liquid droplet, it is obvious that
conditions of the biological substances in the cell at the time of
cell destruction are stably fixed.
[XXIX] Twenty-Ninth Embodiment
[1043] A twenty-ninth embodiment discloses a reaction tracking
device of extremely small amount which enables rapid reaction
tracking using a different principle from a conventional
stopped-flow principle. This embodiment utilizes a phenomenon in
which a solvent mainly composed of water becomes a liquid droplet
and rolls on a water-repellent substrate. The liquid droplet can
move to any position by a slight external force. Making use of this
phenomenon, a plurality of extremely small amount of liquids
including dissolved substances for reaction are arranged on the
substrate as liquid droplets in order to start a rapid reaction by
making each of the liquid droplets colliding against one another.
The liquid droplet weighs basically between a submicroliter and
several microliters, making it possible to start the reaction
instantly.
Example 1
[1044] Example 1 uses the twenty-ninth embodiment in order to track
a DNA hybridization process.
[1045] FIG. 146 (A) is a flat view of a reaction substrate 100
suitable for implementing the twenty-ninth embodiment; FIG. 146 (B)
is a cross-sectional view of the flat view taken along the line A-A
and viewed in the direction indicated by the arrow. The reference
numeral 1 indicates a silicon substrate, for example, with a
thickness of 1 mm and a size of 20 mm.times.20 mm. The surface of
the substrate 1 is a hydrophobic region 2, in which three
hydrophilic regions 3.sub.1, 3.sub.2 and 3.sub.3 are arrayed. The
dimension of the hydrophilic region 3 is small enough compared with
a diameter of the liquid droplet to be held in this hydrophilic
region, for example, a dimension of 0.01 mm.sup.2. Three
hydrophilic regions 3.sub.1, 3.sub.2 and 3.sub.3 are connected by
narrow hydrophilic grooves 4.sub.1 and 4.sub.2, for example with a
width of 2 .mu.m. The reference numeral 5 is a marker for
positioning, and formed all over the silicon substrate 1.
[1046] In FIG. 146 (B) the entire central portion of the substrate
1 has become a hydrophilic region, because the cross-sectional
surface thereof is positioned in three hydrophilic regions 3.sub.1,
3.sub.2 and 3.sub.3 and the hydrophilic grooves 4.sub.1 and 4.sub.2
for connecting these hydrophilic regions. A method of producing the
hydrophilic region and the hydrophobic region is, for example,
oxidizing a top surface of the hydrophobic silicon substrate 1 to
make the entire region a hydrophilic thin film of SiO.sub.2 once.
After that, the SiO.sub.2 thin film in the region to become
hydrophobic is dissolved and removed using fluorine to produce a
hydrophobic region. Alternatively, when the surface of the
substrate 1 is hydrophilic with the SiO.sub.2 thin film formed
thereon in advance, the hydrophobic region is formed by arraying a
hydrophobic substance such as a fluoride resin and a silicon resin
thereon. In this case, the hydrophilic region existing in the
hydrophobic region has become low in accordance with a thickness of
the hydrophobic substance. FIG. 146 shows an example of using the
latter method to form the hydrophobic region 2.
[1047] In Example 1, the liquid droplets including substances for
reaction to the hydrophilic regions 3.sub.1 and 3.sub.3 are formed
in advance; and each of the liquid droplets is guided through the
hydrophilic grooves 4.sub.1 and 4.sub.2 to move each droplet to the
hydrophilic region 3.sub.2 and to collide in the hydrophilic region
3.sub.2.
[1048] FIG. 147 (A) is a conceptual diagram describing an example
of a system construction for constructing the liquid droplet
including the substance for reaction to the hydrophilic regions
3.sub.1 and 3.sub.3 of the reaction substrate 100 suitable for
implementing the twenty-ninth embodiment; FIG. 147 (B) is a plan
view showing a portion of the reaction substrate 100 on which the
liquid droplet including the substance for reaction to the
hydrophilic regions 3.sub.1 and 3.sub.3 is formed in the
hydrophilic region 3 of the reaction substrate 100.
[1049] In FIG. 147 (A), while optically monitoring the liquid
droplet at the end of a pipette 11 for forming the liquid droplet
including the substance for reaction, the liquid droplet including
the substance for reaction to the hydrophilic regions 3.sub.1 and
3.sub.3 of the reaction substrate 100 is formed. The reference
numeral 19 indicates a stage driven in the direction of XY; and the
reference numeral 27 is a drive unit of the stage 19. The reaction
substrate 100 is placed on the top surface of the stage 19. The
pipette 11 with a suspension 13, which is to be included in the
liquid droplet and includes the substance for reaction, siphoned up
and maintained beforehand is placed on top of the reaction
substrate 100. A syringe pump 31 is provided at the bottom of the
pipette 11 through a tube 30; and a drive unit 32 is installed on
the syringe pump 31. When the syringe pump 31 is driven with the
drive unit 32, the suspension 13 inside the pipette 11 is pushed
out together with the substance for reaction. In the figure, the
joint of the base of the pipette 11 and the tube 30 looks apart,
because the pipette 11 is enlarged for display; therefore the joint
is not separated.
[1050] A pipette vertical drive unit 37 is provided for
transferring the liquid droplet formed at the end of the pipette 11
to the hydrophilic regions 3.sub.1 and 3.sub.3 of the reaction
substrate 100. In this example, the vertical drive unit 37 is
linked to the pipette 11. When a signal to lower the pipette 11 is
given to the vertical drive unit 37 by a user, the pipette 11 moves
down, transferring the liquid droplet formed at the end of the
pipette 11 to the hydrophilic regions 3.sub.1 and 3.sub.3 of the
reaction substrate 100. When a signal to restore the pipette 11 is
given to the vertical drive unit 37 by a user, the pipette 11
returns to the position shown in the figure. Restoring the pipette
11 to the position shown in the figure may be performed time
sequentially using a personal computer 26 starting from the
downward operation. A dashed line 39 indicates the link between the
vertical drive unit 37 and the pipette 11.
[1051] A light source 16 and a collective lens 17 constituting an
optical system are provided to monitor the dimension of the liquid
droplet formed inside the neighborhood of and at the end of the
pipette 11; and in the opposite position, a collimate lens 18 and a
monitor 25 are provided in the lower part of the reaction substrate
100. Therefore, the reaction substrate 100 and the stage 19 need to
be optically transparent. The reference numeral 26 indicates a
personal computer for giving a control signal obtained from a
prescribed program stored beforehand in accordance with an input
signal from the monitor 25 and a personal computer for giving a
necessary signal to the drive units 27, 32 and 37 in accordance
with an operation input signal 28 given by the user while watching
the display of the monitor 25. Although not shown here, it is
convenient to display the same screen as the screen detected by the
monitor 25 on the monitor of the personal computer 26. By doing
this, the monitor 25 can become a small size CCD camera. The
operation signal 28 is given through the input device of the
personal computer 26.
[1052] When the reaction substrate 100 and the stage 19 are not
optically transparent, the reflection of the light illuminated from
the top surface is used as a monitor.
[1053] The size of the pipette 11 is described hereinafter. The
pipette 11 needs to construct, at the end thereof, a liquid droplet
with a suitable size including the substance for reaction. On the
other hand, the suspension 13 including the substance for reaction
is siphoned up with the pipette 11 before using the suspension 13;
therefore, the pipette 11 needs to be big enough to be able to hold
the suspension 13 with a volume necessary to construct a liquid
droplet 21.
[1054] A method of forming the liquid droplet 21 including the
substance for reaction to the hydrophilic region 3 of the reaction
substrate 100 is described herein after. First, when the system
starts, the user chooses a position so that the reaction substrate
100 is in the prescribed start position, focusing attention on the
marker 5 described in FIG. 146 (A). Next, in accordance with the
operation input signal 28 for transferring the position of the
liquid droplet 21 including the substance for reaction to the
position corresponding to the end of the pipette 11, the stage 19
is operated using the drive unit 27. When the reaction substrate
100 comes to the prescribed position, an operation for discharging
the suspension 13 including the substance for reaction inside the
pipette 11 is performed. At this time, the outside of the end of
the pipette 11 and the inside of the neighborhood of the end of the
pipette 11 are monitored with the optical system consisting of the
light source 16 and the monitor 25. The liquid pumping with the
syringe pump 31 can be controlled by inputting the output of the
monitor 25 into the personal computer 26 and by operating the drive
unit 32 based on the image computing result of the personal
computer 26.
[1055] While the tip of the pipette 11 is monitored with the
monitor 25, the liquid droplet 21 is formed at the tip of the
pipette by operating the drive unit 32, activating the syringe pump
31, discharging the suspension 13 including the substance for
reaction from the tip of the pipette 11. At this time the personal
computer 26 recognizes that the liquid droplet has reached the
prescribed size through the monitor 25 and gives the stop command
to the drive unit 32 to stop the syringe pump 31.
[1056] The liquid droplet 21 of the suspension including the
substance for reaction, which is produced according to the
above-mentioned method, is contacted with the hydrophilic region
3.sub.3 on the substrate 1 placed on the stage 19 using the
vertical drive unit 37 on the pipette 11, and transferred to the
hydrophilic region 3.sub.3 of the reaction substrate 100. The
liquid droplet 21 is repelled by the hydrophobic region 2 and is
fixed, in a self-generated manner, in the position of hydrophilic
region 3.sub.3 which is energetically stable. When it is confirmed
that the liquid droplet 21 including the substance for reaction is
transferred to the hydrophilic region 3.sub.3 of the reaction
substrate 100, the user transfers the stage 19, going on to the
next operation of placing the liquid droplet 21 on the hydrophilic
region 3.sub.1 of the reaction substrate 100. This operation can be
performed by exchanging the pipette 11, suctioning the suspension
including other substances for reaction therein and repeating the
above-mentioned operations.
[1057] FIG. 147 (B) is a plan view showing the result in which the
liquid droplet including the substance which is to be reacted to
the hydrophilic region 3.sub.1 and 3.sub.3 of the reaction
substrate 100 is placed by using the system for forming the liquid
droplet including the substance reacted to the reaction substrate
100, as described referring to the FIG. 147 (A). Droplets 15.sub.1
and 15.sub.2 including the substance to be reacted to the
hydrophilic region 3.sub.1 and 3.sub.3 of the reaction substrate
100 are arranged.
[1058] FIG. 148 (A), as shown in FIG. 147 (B), is a perspective
view showing an outline of the example of the device for reacting
the two droplets 15.sub.1 and 15.sub.2 formed on the reaction
substrate 100 by making each of the two droplets collide against
each other; and FIG. 148 (B) is a view showing a frame format of an
aspect in which the two droplets 15.sub.1 and 15.sub.2 have turned
into one droplet after colliding against each other. The device
described in FIG. 148 is in the independent form; however, it is
advantageous to be in the form which is unified with and adjacent
to the system constituting the liquid droplet described in FIG.
147, so that the device can control the transfer of the reaction
substrate 100 with the stage 19, the gas injection for moving the
two droplets 15.sub.1 and 15.sub.2 and the like using the personal
computer 26.
[1059] In FIG. 148 (A), each of the top and the bottom of the
reaction substrate 100 is provided with the optical system for
monitoring the liquid droplet and the reaction thereof. Gas
injection nozzles 22.sub.1 and 22.sub.2 are provided on an
extension of hydrophilic grooves 4.sub.1 and 4.sub.2 for connecting
the two liquid droplets 15.sub.1 and 15.sub.2 with these. Each of
the gas injection nozzles 22.sub.1 and 22.sub.2 is connected to
tubes 24.sub.1 and 24.sub.2 which are connected to a gas pressure
tank, so that the gas injection with the gas injection nozzles
22.sub.1 and 22.sub.2 can be controlled by opening or closing
valves 23.sub.1 and 23.sub.2. When gas is injected from the gas
injection nozzles 22.sub.1 and 22.sub.2, the liquid droplets
15.sub.1 and 15.sub.2 are guided by the hydrophilic grooves 4.sub.1
and 4.sub.2 and move to the hydrophilic region 3.sub.2, colliding
on the hydrophilic region 3.sub.2.
[1060] FIG. 148 (B) shows a state in which the two liquid droplets
15.sub.1 and 15.sub.2 move on the hydrophilic grooves 4.sub.1 and
4.sub.2, collide on the hydrophilic region 3.sub.2 and is
unified.
[1061] In FIG. 148 (A), the light irradiated from a light source 41
on top is modulated to the prescribed wavelength with a filter 42,
condensed with a condenser lens 43 and irradiated on the
hydrophilic region 3.sub.2. The irradiated light is led to a camera
52, as transmitted light, through an objective lens 47, a dichroic
mirror 48, a mirror 49 and a filter 51; and a transmitted light
image on the hydrophilic region 3.sub.2 is focused onto the
acceptance surface of the camera 52. In other words, it can be
confirmed that the hydrophilic region 3.sub.2 is in the prescribed
position. Therefore, as is the case with forming liquid droplets,
it is preferable that the reaction substrate 100 and the stage 19
are made of optically transparent materials. More specifically, it
is suitable to use glass like borosilicate glass and quartz glass,
resin and plastic like polyethylene, or a solid substrate like a
silicon substrate. When a silicon substrate is used for the
substrate 1 of the reaction substrate 100, a light source 41 on top
may emit light with a wavelength of 900 nm or more.
[1062] When it is confirmed that the hydrophilic region 3.sub.2 is
in the prescribed position; namely, the two liquid droplets
15.sub.1 and 15.sub.2 and the gas injection nozzles 22.sub.1 and
22.sub.2 are aligned on the line, the user gives the operation
signal 28 to the personal computer 26, pulse-opens the valves
23.sub.1 and 23.sub.2 to inject gas from the gas injection nozzles
22.sub.1 and 22.sub.2. When gas is injected from the gas injection
nozzles 22.sub.1 and 22.sub.2, the liquid droplets 15.sub.1 and
15.sub.2 are guided through the grooves 4.sub.1 and 4.sub.2 to move
to the hydrophilic region 3.sub.2 and collide on the hydrophilic
region 32.
[1063] In this example, the liquid droplets 15.sub.1 and 15.sub.2
are supposed to be of the same size; however, depending on the
reaction of the measurement thereof, each size may be different. In
this case, gas injected from the gas injection nozzles 22.sub.1 and
22.sub.2 must be controlled, so that the two liquid droplets
15.sub.1 and 15.sub.2 collide on the hydrophilic region 3.sub.2.
For this reason, it is natural for the personal computer to have a
suitable program so that when the sizes of the two liquid droplets
15.sub.1 and 15.sub.2 are inputted into the personal computer 26,
the personal computer 26 gives a suitable signal. This issue is not
limited to the size; there can be a possibility that this issue
needs to be considered depending on the substance which is included
in the liquid droplet and which needs to be reacted.
[1064] The case of the reaction on the hydrophilic region 32 in
which the two liquid droplets 15.sub.1 and 15.sub.2 collide on the
hydrophilic region 3.sub.2, turning into the liquid droplet
15.sub.3 can be measured not only by the above-mentioned optical
system but also by the optical system described below.
[1065] After the wavelength of the light irradiated from a light
source 45 at the lower side is selected with the filter 46, the
light irradiated from a light source 45 is led to the objective
lens 47 with the dichroic mirror 48 and is used for excitation
light for observing the reaction inside the liquid droplet
15.sub.3. Fluorescence emitted from inside the liquid droplet
15.sub.3 is observed with the objective lens 47 again; and
fluorescence emitted after excitation light is cut with the
dichroic mirror 48 and a filter 51 can be observed with a camera
52.
[1066] At this time, by adjusting a combination of the dichroic
mirror 48, the filters 42, 46 and 51, transmitted light alone can
be observed with the camera 52; or fluorescence alone is observed;
or transmitted light image and fluorescence image can be observed
with the camera 52 at the same time.
[1067] Image data obtained with a camera are analyzed with the
personal computer 26. The CCD camera 52 carries out observation.
Although not shown here, it is convenient to display the image
signal detected by the CCD camera 52 on the monitor of the personal
computer 26.
[1068] Specific examples are described below regarding tracking of
the DNA hybridization process. Liquid A and liquid B each is a
28-base-long synthetic single-stranded DNA complementary to each
other with a concentration of 0.2 pmol/.mu.l. A solvent thereof is
10 mM of Tris-HCl (pH 8.0) including 500 mM of NaCl.
Ethidiumhomodimer intercalated specifically to the double-stranded
DNA is added in either of the liquid A and the liquid B. 1 .mu.l of
the liquid A is put on the hydrophilic region 3.sub.1 on the
reaction substrate 100 to form the liquid droplet 15.sub.1. 1 .mu.l
of the liquid B is put on the hydrophilic region 3.sub.3 to form
the liquid droplet 15.sub.2. Two of the liquid droplets are made to
roll and collide against each other on the hydrophilic region. The
two collided liquid droplets turn into one liquid droplet 15.sub.3;
the liquid droplet 15.sub.3 is anchored to the hydrophilic region
3.sub.2 and stays in that position stably; therefore, the
hybridization process with the liquid A and the liquid B
proceeds.
[1069] The aspect in which the two liquid droplets 15.sub.1 and
15.sub.2 collide on the hydrophilic region 3.sub.2 can be monitored
and detected with the optical system on the upper side;
hybridization by the liquid A and the liquid B coalesced into one
liquid droplet 15.sub.3 can be monitored with the optical system on
the lower side; and fluorescence intensity in the neighborhood of
560 nm can be dispersed and measured.
[1070] FIG. 149 is a waveform diagram showing change over time of
the fluorescence intensity obtained by monitoring the fluorescence
intensity of the liquid droplet 15.sub.3. After a threshold 61 of
several dozen milliseconds after the collision of the liquid
droplets, the fluorescence intensity rapidly increases. The
fluorescence intensity increases because each of the
single-stranded DNAs hybridizes with one another to become a
double-stranded DNA to which ethidiumhomodimer is intercalated. The
reaction takes place in at least three steps of 62, 63 and 64; it
is considered that hybridization takes place with the portion of a
single-stranded DNA as a core in which it is easier for each
single-stranded DNA to hybridize with one another; and sequentially
hybridization proceeds within a molecule.
[1071] Example 1 uses a reaction system similar to a stopped flow
system in which flow is stopped for measurement by blending
reaction liquid with collision; therefore, the data similar to
those from the existing stopped flow system can be easily obtained.
Because very small amount of liquid is used, the use of a precious
sample can be reduced. In respect to reaction, spectroscopic change
on the collision face of the liquid droplets may be tracked using
microspectroscopy; similarly, spectroscopic change on the collision
face of the liquid droplets may be tracked by driving a small
droplet into a big droplet. It is effective to disperse light of
the entire liquid droplet by irradiating ultrasonic waves for just
a moment, agitating and blending to start the reaction, although
this technique has a problem of promoting the reaction by giving
energy from outside.
Other Examples
[1072] FIG. 150 is a plan view showing an example of the reaction
substrate 100 suitable for spectroscopic measurement using a
microspectroscopic device. As can be seen easily in contrast with
FIG. 146 (A), in this example, there are many combinations of the
hydrophilic regions 3.sub.1, 3.sub.2 and 3.sub.3 and the
hydrophilic grooves 4.sub.1 and 4.sub.2 on the substrate 1.
Therefore, a variety of liquid droplets including reactants of the
A group are arrayed on the hydrophilic regions 3.sub.1; a variety
of liquid droplets including reaction medium of the B group
reacting to a variety of liquid droplets including reactants of the
A group are arrayed on the hydrophilic region 3.sub.3; by making
the liquid droplets of the liquid droplet array of the B group
sequentially collide against the liquid droplets of the A group
array, a variety of reactions start by time interval to perform
measurement. For that purpose, the number of the pairs of the gas
injection nozzles 22.sub.1 and 22.sub.2 should be the same as that
of the pairs of the hydrophilic regions 3.sub.1, 3.sub.2 and
3.sub.3 and the hydrophilic grooves 4.sub.1 and 4.sub.2; and it is
necessary to operate controls in which each valve is sequentially
opened or closed with the personal computer 26, or by moving the
stage 19 bit by bit with the personal computer 26, the valve is
opened or closed every time the stage 19 reaches the prescribed
position.
[1073] In Example 1, two liquid droplets are collided with the pair
of the hydrophilic regions 3.sub.1, 3.sub.2 and 3.sub.3 and the
hydrophilic grooves 4.sub.1 and 4.sub.2; however, for example, when
a pair having the same construction with the pair of the
hydrophilic regions 3.sub.1, 3.sub.2 and 3.sub.3 and the
hydrophilic grooves 4.sub.1 and 4.sub.2 is formed with the
hydrophilic region 3.sub.2 overlapped, and the gas injection
nozzles 22.sub.1 and 22.sub.2 are provided corresponding to it, it
is possible to observe the reaction caused by the collision of the
four liquid droplets.
[1074] It is also possible to observe an influence on a cell by
dissolving a plurality of reactive precursors for causing reaction
in each of the different liquid droplets, making it collide or
react, or by dissolving a liquid droplet with a cell inserted
therein and a liquid droplet including an active substance of a
different cell into a different liquid droplet, making it collide
or react.
[XXX] A Thirtieth Embodiment
[1075] A thirtieth embodiment of the present invention disclosed
herein provides a spectroscopic system and a spectroscopic method
capable of advantageously testing even a very small amount of
sample without any cuvette device to solve the problem associated
with the needs for measuring a minute amount of sample. This
embodiment uses the known phenomenon that a solvent containing
water as a main ingredient is apt to form a droplet having the form
of substantially perfect circle on a water-repelling substrate. In
this embodiment, a droplet is formed on a substrate having the
water-repelling property. On the substrate, a hydrophilic line on
which the droplet can be moved along is formed. The droplets are
transferred on this line successively. A detection system is
provided so that the direction of the system intersects the
direction of the hydrophilic line, and the absorbance and
fluorescence intensity of the droplet is measured when the droplet
moves across the detector direction of the system. White light or
excitation light is projected to the droplet on the hydrophilic
line, and the absorbance is measured by the spectroscopy
measurement with the light transmitted through the droplet, or the
fluorescence level is measured. The light path length necessary for
measurement of the absorbance and fluorescence can be obtained by
measuring the size of the droplet.
Example 1
[1076] Detailed descriptions are provided below by referring to
measurement of a concentration of a protein as an example. Herein,
a quantification of a protein is performed using 280-nm wavelength
known as a typical protein absorption band. As the protein, chicken
egg white lysozyme is used and the molecular extinction coefficient
E.sup.1%.sub.280 is 26.6. The concentration of the protein is
previously adjusted in the range between 0.05 mg/ml and 10 mg/ml
and the sample solution is used as a diluted solution.
[1077] FIG. 151 (A) is a plan view illustrating a measuring
substrate 100 advantageously applicable to the Example 1, and is
also a conceptual view illustrating the measurement system with the
measuring substrate configured therein as a fundamental component.
FIG. 151 (B) is a cross-sectional view of the measuring substrate
100 taken at the line A-A and viewed in the direction indicated by
the arrow. Reference numeral 1 denotes a silicon substrate with,
for instance, 1 mm thickness and the size of 40 nm.times.40 nm. The
surface of the silicon substrate 1 is regarded as a hydrophobic
region 2. On the region, a hydrophilic line 4 is formed. The length
of the hydrophilic line 4 may be, for instance, 20 mm with 0.01 mm
wide. At the terminal point of the hydrophilic line 4, a droplet
stopper 3 is formed. Numeral reference 5 denotes an alignment
marker formed on one surface of the silicon substrate 1. As
described below, a droplet is formed on the left end of the
hydrophilic line 4 and is moved on the hydrophilic line 4 to the
droplet stopper 3 at the predefined velocity. The size in the
figure is shown in the deformed state for simplifying for
convenience of illustration.
[1078] A measurement system 50 is provided approximately at an
intermediate position of the both ends of the hydrophilic lines 4
so that the measurement system intersects the hydrophilic line. The
measurement system 50 includes a wide range light source 10 capable
of emitting lights in the ultraviolet to visible regions, an
optical fiber 11 for guiding the white light outputted from the
wide range light source 10 and irradiating the white light to a
droplet moving on a hydrophilic line 4 in parallel to a surface of
the measuring substrate 100, an optical fiber 12 provided at a
position opposite to the optical fiber 11 across the hydrophilic
line 4 and capable of receiving the white light transmitted though
the droplet, and a detector 13 receiving the white light
transmitted through the droplet and guided though the optical fiber
12. It is needless to say that the headers of both the optical
fibers 11 and 12 are placed opposite to each other across the
hydrophilic line 4 so that the headers do not contact with any
droplet moving on the hydrophilic line 4. The detector 13 includes
a spectroscope 14 and a CCD line sensor 15.
[1079] A laser beam 20 is projected in parallel to the surface of
the measuring substrate 100 and passes across the hydrophilic line
4 to the left side of the measurement system 50. Numeral reference
21 denotes a laser source. Numeral reference 22 and 23 denote
reflection mirrors for reflecting the laser beam 20, and numeral
reference 24 denotes a detector for detecting the laser beam 20.
This laser beam 20 is used for measuring a diameter of the droplet
moving on the hydrophilic line 4. Because of this feature, the
laser beam 20 may be projected to the right side of the measurement
system 50.
[1080] In FIG. 151 (B), the cross section is taken at the position
of the hydrophilic line 4, and therefore the entire central portion
on the substrate 1 are indicated as a hydrophilic region. The
droplet stopper 3 is provided at the right edge section of the
hydrophilic line 4.
[1081] For forming the hydrophilic line 4 (hydrophilic region) and
the hydrophobic region, the top surface of a hydrophilic silicon
substrate 1 is once oxidized to create a hydrophilic SiO.sub.2 thin
film across the whole region once. Then the SiO.sub.2 thin film of
the region is removed by melting the SiO.sub.2 thin film with a
fluorinated acid to form a hydrophobic region. Alternatively, when
the hydrophilic material is previously used on the surface of the
substrate 1 with the SiO.sub.2 thin film formed thereon, a
hydrophobic material such as fluorinated resin and silicon resin
can be placed on the hydrophilic surface to form a hydrophobic
region. In this case, the height of the hydrophilic region provided
in the hydrophobic region becomes shorter than the height of the
hydrophobic region by the height of the hydrophilic region thereof.
FIGS. 151 (A) and (B) show an example where the hydrophobic region
3 and the hydrophilic line 4 are formed by the latter method
described above.
[1082] In Example 1, a droplet of a fluid to be measured can be
formed at the left end of the hydrophilic line 4 once. Then the
droplet is moved to the right on the hydrophilic line 4 with
predefined speed. In the moving process, the size of the droplet
can be measured to analyze the droplet.
[1083] FIG. 152 is a schematic diagram illustrating a sample of a
system configuration preferable to the thirty embodiment of the
present invention capable of forming a droplet at the left end of
the hydrophilic line 4 on the measuring substrate 100.
[1084] First, descriptions are provided below for operations of
forming a droplet 36 at the left end of the hydrophilic line 4 on
the measuring substrate 100. When the system is started up, a user
checks the position of the alignment marker 5 described with
reference to FIG. 151(A), and gives an operation signal 28 to a
personal computer 26 to control a driving unit 27 to position the
stage 19 so that the measuring unit 100 can be placed in the
predetermined start-up position. The stage 19 can be moved in X and
Y directions in response to the signal inputted thereto. Next, for
adjusting the position that the droplet 36 is located (the position
at the end of the hydrophilic line 4) to the position that the
header portion of the Pipet 33, the user gives an operation signal
28 to the personal computer 26 to control the driving unit 27,
thereby the stage 19 is positioned. In this case, if necessary, the
user can adjust the position more accurately by sending a feedback
signal for positioning to the personal computer 26 while monitoring
the header portion of a Pipet 33. Then a fluid to be measured is
aspirated into the Pipet 33.
[1085] When the measuring substrate 100 is moved to the predefined
position, in other words, when the position of the header portion
of the Pipet 33 corresponds to the left end of the hydrophilic line
4, this event can be detected or the user may give a direction to
the personal computer 26 to send a signal to the driving unit 32 so
as to eject a fluid 34 to be measured. And then a syringe pump 31
is driven so as to eject the fluid to be measured from the inside
of the Pipet 33 to form a droplet 36 at the header portion of the
Pipet 33. The size of the droplet 36 formed at the header portion
of the Pipet 33 can be determined according to the conditions such
as the density and gravity of the fluid to be measured and the size
of the header portion of the Pipet 33. And after the droplet grows
to have a certain size, the droplet can be dropped off to the left
end of the hydrophilic line 4. It is not always necessary to
control to stop the syringe pump 31 and it is allowable if a
program to stop the syringe pump 31 is stored in the personal
computer.
[1086] When the user would prefer the method including the control
of the syringe pump, it is allowable to monitor the droplet 36
formed at the header portion of the Pipet 33 with an optical
device. And either in response to the signal outputted from the
device, the driving unit 32 is controlled so that the status that
the droplet grows to have predefined size could be detected, or in
response to the operator's instruction, the operation of the
syringe pump 31 can be stopped, and the Pipet 33 can be held down
(it is not shown but it is necessary to have a driving unit here
like the driving unit 37 to control the Rod 41 as described
hereinafter) so that the droplet 36 formed at the header portion of
the Pipet 33 could be contacted with the left end of the
hydrophilic line 4 on the measuring substrate 100 to be placed on
the hydrophilic line 4. The reason why it is illustrated as the
elementary part of the Pipet 33 is separated from a tube 30 herein
is to enlarge the scale of the Pipet 33 for illustrative purpose
only.
[1087] Next, the descriptions are provided below for the
measurement of the droplet 35 of the fluid to be measured placed on
the left end of the hydrophilic line on the measuring substrate
100. In this case, 1 .mu.l of solution including protein (50 mM of
phosphoric acid buffer solution with pH 7.4 including 150 mM of
NaCl) is used as the fluid to be measured. Next, a Rod 41 with
0.1-mm diameter having a header made of hydrophilic glass and side
surface made of hydrophobic Polyimide is contacted with the top
surface of the droplet 35. Therein, it is regarded that the Rod 41
could work with the driving unit 37 capable of moving the Rod 41 in
the vertical and horizontal directions on the hydrophilic line 4.
When the Rod 41 is placed on the left end of the hydrophilic line
4, if the user gives a signal to the personal computer 26 to lower
the position of the Rod 41, the Rod 41 is moved downward by the
driving unit 37. When the header portion of the Rod 41 touches the
droplet 35, the downward movement of the driving unit 37 is
stopped. Then the Rod 37 is moved to the right over the hydrophilic
line 4 with the predefined speed. Accordingly, the droplet 35 on
the hydrophilic line 4 on the measuring substrate 100 can be moved
on the hydrophilic line 4 horizontally to the right side with the
predefined speed to drop into the droplet stopper 3.
[1088] In the moving process on the hydrophilic line 4 horizontally
to the right side with the predefined speed, the droplet 35 can be
passed through the laser beam 20 to be measured the diameter of the
droplet 35 thereof. For instance, if the Rod 41 is moved at the
speed of 2 mm/sec, the droplet 35 can stick to the header of the
Rod 41, and move at the same speed. Namely, the droplet 35 can also
be moved at 2 mm/sec, the same moving speed of the Rod 41. When the
droplet 35 passes through the laser beam 20, the laser light is
refracted on the boundary surface on the droplet 35, changing the
amount of light that reaches the detection unit 24. After the
droplet 35 passes through the laser beam 20, the amount of light
can be restored to the previous level. If it would take 1.22 sec
for the droplet to pass through the laser beam, the diameter of the
droplet 35 could be obtained by the calculation of 0.61 (=1.22/2)
mm at the crossing position of the laser beam. This method assumes
that the height of the laser beam 20 from the measuring substrate
100 is previously adjusted to the half of the diameter of the
droplet 35 before the measurement. Because of this feature, it
might be necessary to adjust the height of the laser beam 20 from
the measuring substrate 100 if the diameter of the droplet 35
changes largely.
[1089] Next, the droplet 35 passes through the position where the
optical fibers 11 and 12 of the detection device placed opposite
each other. In this case, since the height of the optical fibers 11
and 12 from the measuring substrate 100 is adjusted to the same
height of the laser beam 20 from the measuring substrate 100, the
light pass length of fluid to be measured becomes 0.61 mm. The
maximum absorbance when the droplet passes through the position
between the optical fibers 11 and 12 of the detection device can be
measured and then converted into the value when the light pass
length is 1 cm.
[1090] The FIG. 153 is a characteristic drawing in which the
measured absorbance values according to the Example 1 are plotted
thereon. The characteristics having a linear portion 21 and
non-linear portion 22 can be obtained as shown in this FIG. 153.
The non-linear portion 22 can be described as a typical phenomenon
caused by too high lysozyme concentration level. When the values of
the measurement result can be compared to the values in the public
domain of the well-known protein concentration, they can be well
matched each other.
[1091] In the measurements according to Example 1, the droplet 35
dropped into the droplet stopper 3 would be just passed through the
laser beam 20 and then while light projected from the optical fiber
11 of the detection unit without receiving any operations that
could induce any chemical changes of the droplet therein. Because
of this feature, it is allowable to aspirate the droplet 35 dropped
into the droplet stopper 3 and use it in the other measurement.
[1092] Further, in the measurement according to Example 1, what
might be contaminated by the measurements is just the hydrophilic
line 4 on the measuring substrate 100. Because of this feature,
even if the droplet of a new sample is dropped on the left end of
the hydrophilic line 4 and then the measurements are to be
repeated, the droplet of the new sample would not be contaminated
by the sample previously measured. Accordingly, it is allowable to
place all the series of sample droplets sequentially on the
hydrophilic line 4 on the measuring substrate 100 to measure them
sequentially to improve the throughput thereof.
[1093] According to the thirty embodiment of the present invention,
the requirements of the measurements described above would be the
possibility of measuring the spectral instantly and the property of
the laser light to be projected to the samples that should have
fairly constant intensity in terms of the wavelength component over
time. Because of the limited requirements above, the measurement
can be done even in an open space. Obviously, it is also allowable
to use a light having a single wavelength after the spectroscopy to
project to the droplet and use a conventional spectroscopy optical
system to measure the absorbance. But in this case, it may not be
allowable to use in an open space and, instead, the measurement may
have to be done inside a dark box.
[1094] Further, since a cuvette is not substantially used in the
above-mentioned measurements, the light used therein passes
thorough the droplet and air only. Because of this feature, the
spectroscopy measurements even using a waveform that could be
absorbed by a cuvette can be advantageously performed. For
instance, when the amount of protein is measured by using the
absorbance method with 210 nm wavelength light, it is not practical
to use a typical glass cuvette or plastic cuvette. It might be
practical if a cuvette made of expensive fused silica could be
used. But, with the thirty embodiment of the present invention, it
would be possible to exclude such an expensive fused silica
cuvette.
Example 2
[1095] Example 2 in the 30th embodiment of the present invention
describes an example to conduct a fluorescence measurement. This
example includes the preprocessing to mix the reagent with a liquid
to be measured and make a reaction before the measurement.
[1096] FIG. 154 (A) is a plan view of the measuring substrate 200
preferred for the Example 2, and a schematic diagram of the
measuring system comprising the components based on the measuring
system. FIG. 154 (B) is a cross-sectional diagram of the measuring
substrate 100, viewed in the direction of indicated by the arrow,
at the position of A-A in the plan view of measuring substrate 200.
The sizes of the drawings are deformed for the purpose of
explanation.
[1097] The measuring substrate 200 is similar to the measuring
substrate 100 in the Example 1. Reference numeral 1 indicates a
silicon substrate, for instance, having the thickness of 1 mm and
the size of 40 mm.times.40 mm. The surface of silicon substrate 1
is made to a hydrophobic region, and hydrophilic regions 52 to 54
and hydrophilic lines 56 to 59 are set up therein to retain
droplets. The liquid receiver 3 has been formed on the end edge (at
the far right) of the hydrophilic line 59. The size of the
hydrophilic regions 52 to 55 are decided depending on the size of
the retained droplet in this region, for instance, however, it is
approximately 400 .mu.m.times.400 .mu.m. The width of hydrophilic
lines 56 to 59 is approximately 0.1 mm. The reference numeral 5
indicates the marker for positioning, and which is formed on one
side of silicon substrate 1. The reference numeral 8 indicates a
temperature control plate, and which is formed on the back side of
silicon substrate 1. The sizes of the drawings are deformed for the
purpose of explanation.
[1098] A measuring system 51 is installed with the shape that
intersects with hydrophilic line 59. The measurement system 51 is
comprised optical fiber 11, optical fiber 12 and detector 13.
Optical fiber 11 guides laser source 10' for fluorescent excitation
and laser beam of the laser source 10', and the laser beam is
exposed to the droplet in parallel to the surface of measuring
substrate 100, neighboring the droplet moving on the hydrophilic
line 59. Optical fiber 12 is installed across the hydrophilic line
59, and opposing position with optical fiber 12 to receive
fluorescent exposed by the droplet. Detector 13' has an input of
fluorescent exposed by the droplet guided by optical fiber 12.
Optical fiber 12 is set up to have a 120 degree of angle with
optical fiber 11, so that the reflected light on the surface of the
droplet of the laser beam, which is exposed on the droplet, will
not be entered into the optical fiber 12. Optical fiber 12 here is
also set up at opposing position with optical fiber 11, having a
certain distance that the tips do not contact with the droplet
which moves on the hydrophilic line 59.
[1099] In the same way as the description referring to FIG. 152 in
the Example 1 in the 30th embodiment of the present invention, each
droplet is formed in the hydrophilic regions 52 to 54. A droplet
containing a single stranded cDNA mixture, which is
reverse-transcribed from mRNA, is formed in the hydrophilic region
54. A droplet comprising 60 base probe solution, which hybridizes
to specific cDNA, in the hydrophilic region 53. A droplet
comprising cyber green I solution, which intercalates specifically
to the double stranded, is formed in the hydrophilic region 52.
Each droplet is 0.5 .mu.l. Examine 5 pmol/.mu.l of complementary
probe and non-complementary probe per cDNA 0.2 pmol/.mu.l here as a
model system. The solvent is 10 mM of Tris-HCl (pH 8.0) containing
50 mM of NaCl.
[1100] Firstly, the droplets formed both in hydrophilic region 53
and 54 are transported in the same method as Example 1 in the 30th
embodiment of the present invention, and mixed here. Rod 41 used
for transporting droplets can mix the droplets by rotating for the
axial direction. Of course, a piezoelectric element should be
formed in advance on the back face of the silicon substrate 1,
which is located at the position that hydrophilic region 55 is
formed, and the droplets may be stirred by contact-free after
reaction of the ultrasonic wave caused by the piezoelectric element
with the droplet placed in the hydrophilic region 55. After
stirring the droplets for 30 seconds, the droplet formed in the
hydrophilic region 52 is added in the droplets stirred in the
hydrophilic region 55, and then the mixed droplets are stirred
again. After 30 seconds, the droplets comprising three different
liquid droplets stirred in the hydrophilic region 55, are
transported with the prespecified speed, for instance, 2 mm/second,
on the hydrophilic line 59. The droplet transporting on the
hydrophilic line 59 produces fluorescence in receipt of the laser
beam of the laser source 21', when the droplet transporting on the
hydrophilic line 29 passes through the betweenness of the tips of
the optical fiber 12, which is set up opposing to optical fiber 11.
The fluorescence intensity at this point is measured by detector
13' through optical fiber 12.
[1101] When the complementary cDNA with probe exists in the liquid
for the sample, the strength of fluorescence is obtained in
accordance with the amount of cDNA. If there is no complementary
cDNA at all, the fluorescence strength is less or equal to
1/20.
[1102] Since it is better to manage the size of the droplet in a
rigorous manner in the Example 2 than the Example 1 in the 30th
embodiment of the present invention, it is better to measure with a
CCD camera using the optical system (not shown in the drawing), to
input the data in the personal computer 26, to make a prespecified
process and to control driving device 32 of the syringe pump 31
when the droplet is formed described for FIG. 152.
[1103] This optical system may be, to be short, the system which
can monitor the fore-end part of the pipet 33. Moreover, the
optical system should control the temperature control plate 8 that
is set up on the back surface of the measuring substrate 200, and
operate the system in the state that the temperature of the
measuring substrate 200 ranges 42.degree. C. to 46.degree. C. and
in the wet condition that the ambient atmosphere of 45.degree. C.
Since the fluctuation of the size of the droplet will change the
inclusive concentration of cDNA, it is better to control by
monitoring the movement of the droplet or size of the droplet after
stirring with an optical system CCD camera that the diameter of the
droplet will not fluctuate 10% and above by feedback control on the
temperature control plate 8 in the case there is a fluctuation in
size of the droplet diameter.
[1104] In the Example 2 in the 30th embodiment of the present
invention, because the droplet formed in the hydrophilic region 54
and the droplet formed in the hydrophilic region 53 are transported
to the hydrophilic region 55 in the same method as the Example 1 in
the 30th embodiment of the present invention, and preprocessing
before the reaction is carried out by mixing the droplets at this
point, and then the processes are integrated by a reaction of the
droplet formed in the hydrophilic region 52 with the mixed
droplets, it is possible to avoid the above-mentioned human error.
In addition, this process is made on one measuring substrate 200,
it is better to make the measuring substrate 200 as a chip, which
measures immediately after the reaction and is disposable type used
only for one time, in order to prevent from any contamination.
[1105] It can be used for the purpose of detecting reaction
products by combining with various reactions, and can resolve the
problem by making it as system-on-chip, that the sample reaction
and detection is integrated. The reactive precursor should be
divided by several droplets, and each droplet on the hydrophilic
line is reacted by collision and coalition in the predefined order.
The reaction time is that, for instance, a hydrophilic region with
approximately 2 to 4 times of line width diameter may be set up on
the hydrophilic line so that the droplet can stay therein, or it is
possible to solve by making a slightly bent part so that the
droplet can stay therein for a predefined time.
Other Examples
[1106] Example 30 can be performed in various systems not limited
to a configuration of the aforementioned examples.
[1107] For instance, a migration of droplet by the rod 41 described
with reference to FIG. 152 can be replaced to by gas injection. As
an example, a gas injection nozzle is provided on an extension of
the hydrophilic line 4 and the gas injection nozzle has a tube
connected to a gas pressure tank and a valve, and then a migration
of the droplet 35 may be controlled with gas injection using the
gas injection nozzle by opening and closing the valve. Assuming
that a size and weight of the droplet is considered to gas
injection, the droplet 35 migrates on the hydrophilic line 4 with
prespecified speed guided by the hydrophilic line 4, and drops into
a liquid tank 3. A migration from the hydrophilic area 55 to the
liquid tank 3 in Example 2 can be also performed in the same
manner. When using gas injection for migration of the droplet,
since physical facilities migrating on the upper side of the
measuring substrate 200 is reduced, a configuration of device
becomes simpler.
[1108] A surface elastic wave can be used for migrating a droplet.
FIG. 155 is a conceptual diagram illustrating an example of
configuration of a system for preparing a droplet at a left edge of
the hydrophilic line 4, migrating the droplet with surface elastic
wave, and measuring the migration. A surface elastic wave generator
comprising of the piezoelectric element 205 and the comb electrodes
206 is provided under the hydrophobic line 4 on which the droplet
of the substrate 1 migrates. As the comb electrodes, lithium
compounds such as lithium 4-borale, lithium tantalate or lithium
niobate can be used. Surfaces of the piezoelectric element 205 and
the comb electrodes 206 are coated with hydrophobic coating, and
the hydrophilic line 4 is provided to a direction of transporting
droplet as described in the aforementioned Example 1. By applying a
voltage between the comb electrodes 206 facing each other, a
surface electric wave having uniform phases can be generated along
the hydrophilic line 4. The droplet 202 migrates on the surface
electric wave. Then, the comb device is provided at the upper
section of the hydrophilic line 4 generating a droplet. A
piezoelectric substrate section may be provided at all over the
hydrophilic line 4 of the substrate 1 or may be provided only close
to areas in which the droplet 202 is dropped as illustrated in FIG.
155. By applying a voltage between the comb electrodes, a surface
elastic wave is generated and a droplet flies and migrates to a
direction of the arrow 204.
[1109] Conventionally, a sample used for measuring absorbance is
generally abandoned. If a volume of liquids for the measurement is
large, samples will become wastes.
[1110] For example, a high through-put can be achieved by the
system described in FIG. 151; a plurality of the systems for the
hydrophilic line 4 and the liquid tank 3 are provided in parallel,
a droplet made from a sample liquid to be measured is provided at a
left edge of each hydrophilic line 4, and each droplet is
sequentially rolled to a detecting section for measurement by gas
injection. In this case, it is practical that only one system of
gas injection is provided and the stage 19 is moved.
[1111] A force for migrating a droplet is, in another system, that
one miniature magnet is put into a droplet and the droplet is
migrated by moving the miniature magnet from a back side of a
substrate to a magnetic field. In this case, the miniature magnet
should have hydrophilic property for clinging the droplet thereto.
A size of the miniature magnet makes less than half of a diameter
of the droplet so that measuring absorbance in later can not be
interrupted.
[1112] The present invention can be realized with the following
configurations in accordance with each embodiment as described
previously besides the configurations described in the claims.
First Embodiment
[1113] 1. A centrifugal separator comprising:
[1114] a motor for rotating a rotating plate;
[1115] a rotating plate rotating about a shaft rotated by the
motor; and
[1116] a chip for centrifugal separation attached to a face of the
rotating plate;
[1117] the chip for centrifugal separation including:
[1118] flow paths fed with a plurality of solutions each having
different specific gravity;
[1119] a separation chamber with the flow path converged thereon;
and
[1120] a plurality of flow paths branching out from the separation
chamber;
[1121] wherein reservoirs are provided at each end of the flow
paths for feeding solutions to the separation chamber and the
plurality of flow paths branching out from the separation chamber,
a solution having prespecified specific gravity is reserved in the
reservoir communicating to the flow path for feeding solutions to
the separation chamber, and a sample to be separated is supplied in
one of the reservoirs.
[1122] 2. The centrifugal separator according to paragraph 1,
wherein the centrifugal separator has configuration in which the
reservoir communicating to the flow path fed with a plurality of
solutions each having different specific gravity is positioned at
an equal distance from the rotational shaft, and the reservoir
communicating to the plurality of flow path branching out from the
separation chamber is positioned at an equal distance from the
rotational shaft.
[1123] 3. A method of separation performed by a centrifugal
separator comprising:
[1124] a motor for rotating a rotating plate;
[1125] a rotating plate rotating about a shaft rotated by the
motor; and
[1126] a chip for centrifugal separation attached to a face of the
rotating plate;
[1127] the chip for centrifugal separation including:
[1128] flow paths fed with a plurality of solutions each having
different specific gravity;
[1129] a separation chamber with the flow path converged thereon;
and
[1130] a plurality of flow paths branching out from the separation
chamber;
[1131] wherein reservoirs are provided at each end of the flow
paths for feeding solutions to the separation chamber and the
plurality of flow paths branching out from the separation chamber,
a solution having prespecified specific gravity is reserved in the
reservoir communicating to the flow path for feeding solutions to
the separation chamber, a sample to be separated is supplied in one
of the reservoirs, and a solution transferred from the reservoir to
the separation chamber by centrifugal separation forms layers
corresponding to the specific gravity to separate the sample to be
separated according to the specific gravity.
[1132] 4. A chip for centrifugal separation applicable to a
centrifugal separator comprising:
[1133] a motor for rotating a rotating plate;
[1134] a rotating plate rotating on an axis rotated by the motor;
and
[1135] a chip for centrifugal separation attached to a face of the
rotating plate;
[1136] the chip for centrifugal separation including:
[1137] flow paths fed with a plurality of solutions each having
different specific gravity;
[1138] a separation chamber with the flow path converged thereon;
and
[1139] a plurality of flow paths branching out from the separation
chamber;
[1140] wherein reservoirs are provided at each end of the flow
paths feeding solutions to the separation chamber and the plurality
of flow paths branching out from the separation chamber.
[1141] 5. A chip for centrifugal separation, the centrifugal
separator configured to have a position of the reservoir
communicating to the flow paths feeding solutions to the separation
chamber at an equal distance from the rotational shaft, and to have
a position of the reservoir communicating to each end portion of
the plurality of flow paths branching out from the separation
chamber at an equal distance from the rotational shaft.
[1142] 6. The chip for centrifugal separation according to
paragraph 3, wherein the reservoir is provided on a face opposite
to a substrate with the flow path for the chip for centrifugal
separation and the separation chamber provided thereon, and an end
of the reservoir and an end of the flow path are communicated by a
hole penetrating the substrate.
[1143] 7. The chip for centrifugal separation according to
paragraph 3, wherein the reservoir communicating to one end of the
flow path fed with a plurality of solutions each having a different
specific gravity has a partly cut out separation wall for
separating a plurality of reservoirs in a position opposite to the
communicating hole.
Second Embodiment
[1144] 1. A cell separation chip comprising:
[1145] a flow path introducing a fluid containing a target cell
with a specific substance for labeling identification intaked into
a cell separation area via a transporter, and a sample hole
connected to the flow path for feeding a fluid containing a target
cell;
[1146] a buffer flow path provided in parallel with the flow path
with a fluid containing a target cell in the cell separation area
introduced therein, and a buffer hole connected to the flow path
for feeding a buffer;
[1147] a flow path located on the downstream side from the position
in which the flow path introducing a fluid containing a target cell
in the cell separation area and the buffer flow path converge, for
observing a cell in the fluid in which the liquid containing a
target cell and a buffer-combined fluid flow as a laminar flow;
[1148] the cell separation area comprising: two openings for gel
electrodes formed on the downstream side of the flow path for
observing a cell, facing to each other on both sides of the flow
path, and placed in a position slightly deviated from the flow
direction; a target cell collecting flow path located in an
imaginary line extended from the flow path; and a cell discharge
flow path branching out from the flow path;
[1149] a hole for feeding the gel electrodes with a gel electrode
material;
[1150] a hole connected to the cell discharging flow path for
accommodating a liquid containing a discharged cell;
[1151] a cell dialysis section provided on the downstream side of
the target cell collecting flow path; and
[1152] a collecting flow path passing therethrough a fluid
containing a target cell having passed through the cell dialysis
section and a hole connected to the collecting flow path for
accommodating a fluid containing the collected cell;
[1153] the cell separation chip including:
[1154] a buffer retention bath for feeding a buffer provided in a
common communication with the sample hole for feeding a fluid
containing a target cell and a buffer hole for feeding a
buffer;
[1155] a buffer retention bath provided in communication with the
hole for accommodating a fluid containing a fluid containing a
discharged cell, for accommodating a discharged cell and a buffer;
and
[1156] a buffer retention bath provided in communication with the
hole for accommodating a fluid containing a collected cell, for
accommodating a target cell and a buffer;
[1157] the cell dialysis section including:
[1158] a dialysis area for dialyzing the collected cell via a
prespecified porous membrane to discharge a specific material for
labeling identification;
[1159] a buffer retention bath for feeding a buffer not containing
a specific material for labeling identification in the dialysis
area; and
[1160] a buffer retention bath for collecting a buffer after
dialysis.
[1161] 2. The cell separation chip according to paragraph 1,
comprising:
[1162] a substrate having a prespecified thickness and size;
[1163] each of the flow paths and the gel electrodes formed on the
bottom face of the substrate;
[1164] a hole communicating with each of the flow paths and the gel
electrodes formed the bottom face of the substrate and penetrating
the substrate;
[1165] a translucent thin film attached onto the bottom face of the
substrate,
[1166] a retention bath communicating with the flow path provided
on the top face of the substrate;
[1167] the cell dialysis section including a flow path provided
between a flow path in the downstream region of the cell separation
area and the hole, and communicating from the bottom face to the
top face of the substrate; and
[1168] a porous membrane provided on the top face of the substrate
in the cell dialysis section, a space for circulating a buffer not
containing a specific material for labeling identification for
dialyzing the collected cell, and a retention bath for feeding the
space with buffer.
[1169] 3. A cell separator comprising:
[1170] a flow path with introduced in a cell separation area a
fluid containing a target cell with a specific material for
labeling identification intaked therein via a transporter, and a
sample hole connected to the flow path for feeding a fluid
containing a target cell;
[1171] a buffer flow path provided in parallel with the flow path
with a fluid containing a target cell introduced into the cell
separation area, and a buffer hole connected to the flow path for
feeding a buffer;
[1172] a flow path located on the downstream side from a position
in which the flow path with a fluid containing a target cell
introduced into the cell separation area and the buffer flow path
converge, for observing a cell in the fluid in which the fluid
containing a target cell and a buffer are combined to flow as a
laminar flow;
[1173] the cell separation area comprising: two openings for gel
electrodes formed on the downstream side of the flow path for
observing a cell, facing to each other on both sides of the flow
path, and provided in a position deviated from the flow; a target
cell collecting flow path located in an imaginary line extended
from the flow path; and a cell discharging flow path branching out
from the flow path;
[1174] a hole for feeding the gel electrodes with a gel electrode
material;
[1175] a hole connected to the cell discharging flow path for
accommodating a fluid containing a discharged cell;
[1176] a cell dialysis section provided on the downstream side of
the target cell collecting flow path;
[1177] a collecting flow path passing therethrough a fluid
containing a target cell having passed through the cell dialysis
section and a hole connected to the collecting flow path for
accommodating a fluid containing a collected cell;
[1178] a buffer retention bath provided in a common communication
with the sample hole for feeding a fluid containing a target cell
and a buffer hole for feeding buffer;
[1179] a buffer retention bath provided in communication with the
hole for accommodating a fluid containing the discharged cell, for
accommodating a discharged cell and a buffer; and
[1180] a buffer retention bath provided in communication with the
hole for accommodating a fluid containing the collected cell, for
accommodating a target cell and a buffer;
[1181] the cell dialysis section including: a dialysis area for
dialyzing the collected cell via a prespecified porous membrane to
discharge a specific material for labeling identification via a
transporter; a buffer retention bath for feeding the dialysis area
with a buffer not containing a specific material for labeling
identification; and a buffer retention bath for collecting the
buffer after dialysis, in addition to a cell separation chip;
and
[1182] an optical system for detecting a cell flowing down in the
flow path for observing a cell on the cell separation chip, the
optical system determining whether a cell flowing down in the flow
path is a target cell or not, and determining according to the
result of determination whether voltage is applied to the gel
electrodes or not.
[1183] 4. The cell separator according to paragraph 3, wherein
voltage is applied to the gel electrodes when it is determined that
a cell flowing down in the flow path is not a target cell.
[1184] 5. The cell separator according to paragraph 3, wherein a
plurality of the cell separation chips are arrayed on the same
plane; and a certain number of the cell separation chips are
commonly provided with plumbing for feeding a buffer not containing
a specific material for labeling identification and with plumbing
for collecting a buffer after dialysis to feed a buffer to transit
the buffers via each retention; and each buffer is relayed by
respective detention baths to feed the dialysis area of the cell
dialysis section with a buffer not containing a specific material
for labeling identification.
Third Embodiment
[1185] 1. A method of cytotechnology comprising the steps of:
[1186] binding for identification, polynucleotide specifically
binding to a surface antigen expressed in a cancer-derived cell and
having a structure binding to a labeled substance with covalent
bonding, to the surface antigen expressed in the cancer-derived
cell in a group of sample cells to separate the cells; and
[1187] subjecting the separated cells to action of nuclease for
decomposing the polynucleotide binding to the surface antigen
expressed in the cancer-derived cell to obtain the cancer-derived
cell, thereby determining the presence of cancer.
[1188] 2. A method of cytotechnology comprising the steps of:
[1189] binding for identification, polynucleotide specifically
having EpCAM bound to a surface antigen in a cancer-derived cell
and having a structure binding to a labeled substance with covalent
bonding, to a EpCAM bound surface antigen in the cancer-derived
cell in a group of sample cells to separate the cells; and
[1190] subjecting the separated cell to action of nuclease for
decomposing the polynucleotide having EpCAM bound to the surface
antigen with the cancer-derived cell to obtain the cancer-derived
cell, thereby determining the presence of cancer.
[1191] 3. A method of identifying a cell comprising the steps
of:
[1192] preparing an identification element having a configuration
in which a labeled substance is bonded to an identification
substance with covalent bonding, the labeled substance being
polynucleotide specifically binding to a specific antigen present
on a surface of a specific cell;
[1193] mixing a group of sample cells and the identification
element to bind the polynucleotide to the antigen in the specific
cell in the group of sample cells; and
[1194] employing the identification substance to identify the
specific cell having the specific antigen;
[1195] wherein nuclease discomposing the polynucleotide is used as
a reagent.
[1196] 4. A method of cytotechnique or cell identification
according to any of paragraphs 1 to 3, wherein the identification
substance of the identification element is a fluorescent substance,
and fluorescent detection is used for identifying a cell with the
labeled substance in the identification element bonded thereto.
[1197] 5. A method of cytotechnique or cell identification
according to any of paragraphs 1 to 3, wherein the identification
substance of the identification element is a particle or a magnetic
particle, and particle imaging, scattered light detection or
magnetic detection is used for identifying a cell with the labeled
substance in the identification element bonded thereto.
Fourth Embodiment
[1198] 1. A sample freezing device comprising: a pressure-resistant
vessel having a cylinder with a solution containing a sample
accommodated therein; a piston capable of engaging with the
cylinder; a pressurizing unit capable of pushing the piston into
the cylinder; and a control unit for controlling the pressurizing
unit to control the rate of pushing the piston into the cylinder,
the control unit applying pressure to a solution while keeping a
temperature of the solution in the cylinder within a range from the
phase transition point between the ice-I area and the liquid water
area up to plus 4.degree. C., and releasing pressure when the
temperature reaching the state of almost the lowest temperature in
the relationship between the ice-I area and the liquid water
area.
[1199] 2. The sample freezing method according to paragraph 1,
wherein the cylinder is tapered on an end face of the
pressure-resistance vessel, and an operation of engaging the piston
with the cylinder is conducted in the state where a solution
containing a sample to be accommodated in the cylinder overflows
from the top of the cylinder.
[1200] 3. A sample freezing device comprising the steps of:
[1201] cooling a sample at high pressure keeping the state of a
solution thereof; and
[1202] flash-freezing the sample by rapid pressure reduction.
[1203] 4. The sample freezing method according to paragraph 3,
wherein a solution containing a sample is pressurized in the range
from 0.1 to 0.2 GPa while keeping a temperature thereof in the
range from the phase transition point between the ice-I area and
the liquid water area up to plus 4.degree. C. in the state where a
gas phase the solution is not present, and is then subjected to a
rapid pressure reduction.
Fifth Embodiment
[1204] 1. A cell aliquoting device comprising:
[1205] a pipet capable of retaining a solution containing a
plurality of cells and having a diameter of a tip opening thereof
suited for passing through a prespecified size of a cell or a cell
agglomerate;
[1206] a means for observing a cell on the tip of the pipet;
[1207] a means for pushing out a solution containing cells on the
tip of the pipet to form a liquid droplet; and
[1208] a means for determining that a prespecified cell is
contained in the liquid droplet to become a prespecified size of
the liquid drop;
[1209] wherein each of the liquid droplets formed on the tip of the
pipet is dropped and arrayed in a prespecified position on a
substrate.
[1210] 2. A cell culture system comprising: a means for forming a
liquid droplet containing a prespecified number of cells; a means
for controlling the size of the liquid droplet; a substrate for
setting each of the liquid droplets in array; and a solvent layer
formed on the substrate, having specific gravity smaller than a
solvent of the liquid droplet, and being substantially unfused with
the liquid droplet.
[1211] 3. A cell culture system comprising: a means for forming a
liquid droplet containing a prespecified number of cells; a means
for controlling the size of the liquid droplet; a substrate for
setting the liquid droplet in array; and a solvent layer formed on
the substrate, having specific gravity smaller than a solvent of
the liquid droplet, and being substantially unfused with the liquid
droplet; a means for replacing a solvent of a liquid droplet on the
substrate; a means for controlling a temperature of the liquid
droplet during cultivating the cell; a means for observing a cell
in a liquid droplet set in array on the substrate; and a means for
collecting the cell after cultivating for a prespecified period of
time.
[1212] 4. A cell culture chip comprising: a substrate with a face
thereof having a prespecified size provided as a hydrophobic area,
the hydrophobic area being formed thereon a plurality of discrete
hydrophilic areas with a prespecified clearance; and a wall formed
on the substrate surrounding the plurality of hydrophilic areas,
the cells contained in prespecified droplets being arrayed in the
hydrophilic areas, and being covered with a solvent layer having
specific gravity smaller than the solvent of the liquid droplet and
being substantially unfused with the solvent of the liquid
droplet.
[1213] 5. A cell culture chip according to paragraph 4, wherein the
solvent layer is previously provided, and then each cell included
in a prespecified liquid droplet is arrayed in the plurality of
hydrophilic areas on the substrate.
[1214] 6. The cell aliquoting device according to paragraph 1,
wherein the means of forming a liquid droplet containing a
prespecified number of cells is arranged in such a way that a tip
of a pipet for feeding a suspension containing the cells and a tip
of a pipet for feeding a culture solution are faced to each other,
and the size of a liquid droplet is controlled by controlling a
quantity of each liquid.
[1215] 7. The cell culture system according to paragraph 2 or
paragraph 3, wherein the means of forming a liquid droplet
containing a prespecified number of cells is arranged in such a way
that a tip of a pipet for feeding a suspension containing the cells
and a tip of pipet for feeding a culture solution are faced to each
other, and the size of a liquid droplet is controlled by
controlling a quantity of each liquid.
[1216] 8. The cell aliquoting device according to paragraph 6,
wherein the flow path associated with the two pipets is formed in a
single pipet.
[1217] 9. The cell culture system according to paragraph 7, wherein
the flow path associated with the two pipets is formed in a single
pipet.
Sixth Embodiment
[1218] 1. A droplet operation device comprising:
[1219] an insulating substrate with one surface thereof being
water-repellent;
[1220] a plurality of hydrophilic droplet retention areas formed on
the water-repellent surface of the substrate;
[1221] a hydrophilic droplet transfer line formed by extending the
hydrophilic droplet retention areas on the substrate;
[1222] a droplet forming device for forming a droplet in the
hydrophilic drop retention areas on the substrate;
[1223] a charging device for selectively charging a droplet
retained in the hydrophilic drop retention area on the substrate;
and
[1224] a joy stick for making a charge having the same polarity as
that of the charged droplet act to cause repulsion force against a
charge of the charged droplet;
[1225] wherein the specific droplet retention area in the
hydrophilic droplet retention area on the substrate is configured
to allow a droplet to be subjected to charging and discharging.
[1226] 2. The droplet operation device according to paragraph 1,
wherein the charging device for selectively charging a droplet
retained in the hydrophilic droplet retention area on the substrate
comprises: a first electrostatic electrode not directly contacting
to the droplet on an insulating substrate with a droplet contacted
thereto; and a second electrode configured to directly contact an
in-capillary liquid with a capillary for retaining a liquid capable
of contacting the solution; wherein the portion of a droplet is
charged by polarizing a droplet and a liquid in the capillary.
[1227] 3. The droplet operation device according to paragraph 1,
wherein the configuration of the specific droplet retention area in
the hydrophilic drop retention area on the substrate capable of
discharging a charge of a droplet is by earthing an electrode
provided in the drop earth retention area.
[1228] 4. The droplet operation device according to paragraph 2 or
paragraph 3, wherein further provided is a switchboard placed in
the lower portion of the substrate for earthing the electrode
provided in the hydrophilic droplet retention area, when the
substrate is set up on the switchboard.
[1229] 5. The droplet operation device according to paragraph 1,
wherein the charging device for selectively charging a droplet
retained in the hydrophilic droplet retention area on the substrate
is a device for selectively launching charged particles into the
droplet.
[1230] 6. A droplet operation method comprising the steps of:
charging a plurality of droplets formed on a hydrophilic pattern on
an insulating substrate with water repellency; and making a movable
stick charged and having the same polarity as that of the droplet
come close to the charged droplet to move the droplet along the
pattern by means of repulsing force between the two.
[1231] 7. The droplet operation method according to paragraph 6,
wherein the moved drop is discharged in a prespecified position,
and is incorporated with other drops moved to the prespecified
position.
[1232] 8. A substrate for a droplet operation comprising:
[1233] an insulating substrate with one surface thereof being
water-repellent;
[1234] a plurality of hydrophilic droplet retention areas formed on
the water-repellent surface on the substrate;
[1235] a hydrophilic droplet transfer line for hydrophilic liquid
formed by extending the hydrophilic droplet retention area on the
substrate;
[1236] an electrostatic electrode provided in the hydrophilic
droplet retention area on the substrate via an insulating layer;
and
[1237] an electrode formed on another surface on the substrate,
associated with the electrode provided in the hydrophilic droplet
retention area, and electrically connected to the latter
electrode.
[1238] 9. A switchboard used by placing a substrate for a droplet
operation, the substrate comprising:
[1239] an insulating substrate with one surface thereof being
water-repellent;
[1240] a plurality of hydrophilic droplet retention areas formed on
the water-repellent surface on the substrate;
[1241] a hydrophilic droplet transfer line formed by extending the
hydrophilic drop retention areas on the substrate;
[1242] an electrostatic electrode provided in the hydrophilic
droplet retention area on the substrate via an insulating layer;
and
[1243] an electrode formed on another surface on the substrate,
associated with the electrode provided in the hydrophilic droplet
retention area, and electrically connected to the electrode;
[1244] wherein the electrode provided in the hydrophilic droplet
retention area on the substrate is earthed.
Seventh Embodiment
[1245] 1. A controller for the size of a droplet comprising: a
means for generating a droplet; a substrate with a pattern of a
hydrophilic area retaining the generated droplet on a
water-repellent surface thereof provided thereon; a temperature
regulator contacting the substrate; a means for measuring the size
of a droplet formed on the substrate; and a control unit for
controlling a temperature of the temperature regulator based on the
size of the measured droplet.
[1246] 2. The controller for the size of a droplet according to
paragraph 1, wherein the temperature regulator is discretely
provided for each of a plurality of drops, and is capable of
discretely regulating the temperature of each drop.
[1247] 3. A controller for the size of a droplet comprising: a
means for generating a droplet; a substrate with a pattern of a
hydrophilic area retaining the generated droplet on a
water-repellent surface thereof provided thereon; a means for
transferring a droplet from one hydrophilic area to another
hydrophilic area on the hydrophilic pattern; a temperature
regulator contacting the substrate; a means for measuring the size
of a droplet formed on the substrate; and a control unit for
controlling a temperature of the temperature regulator based on the
size of the measured droplet.
[1248] 4. The controller for the size of a droplet according to
paragraph 3, wherein the hydrophilic pattern includes at least a
hydrophilic line segment, and comprises a hydrophilic line segment
on the substrate.
[1249] 5. The controller for the size of a droplet according to
paragraph 3, wherein the temperature regulator is capable of
discretely regulating a temperature with respect to each
hydrophilic area on the substrate on which the droplet can
stay.
[1250] 6. The controller for the size of a drop according to
paragraph 3, wherein the means of transferring a droplet is a means
for generating a droplet to which another droplet is contacted.
[1251] 7. A method of controlling the size of a droplet comprising
the steps of:
[1252] placing a droplet formed in a hydrophilic area on a
substrate, in an environment humidified at a prespecified humidity;
and controlling a temperature of the substrate with the droplet
retained thereon to control the size of the droplet.
Eighth Embodiment
[1253] 1. A cell culture microarray having an electrode in a groove
or a tunnel for connecting a plurality of minute compartments
capable of retaining a cell one by one.
[1254] 2. A neuron culture microchamber having on a substrate a
plurality of compartment walls for keeping a cell in a specific
spatial configuration, a plurality of electrode patterns for
measuring an electrical change in a cell being provided between
each cell, and an optically-transparent semipermeable membrane and
a culture solution bath being provided on the compartment
walls.
[1255] 3. A cell culture microarray on a substrate, made of
agarose, having a plurality of compartments for keeping a cell in a
specific spatial configuration, and provided with an electrode in a
tunnel for connecting each compartment.
[1256] 4. A cell culture microarray provided on a substrate, made
of agarose or its derivative, having a plurality of compartments
for keeping a cell in a specific spatial configuration, and having
a configuration in which a cell is retained substantially one by
one in each compartment; in order to obtain interaction between the
cells, agarose is locally overheated with convergence light in a
given direction to form a tunnel; and one or more electrodes are
always provided in each tunnel.
[1257] 5. A cell culture microarray according to paragraph 3 or
paragraph 4, wherein a culture solution bath capable of replacing a
solution therein is provided on the top face of agarose.
[1258] 6. A method of electrically measuring a cell comprising the
steps of: providing on a substrate a plurality of compartments made
of agarose or its derivative for keeping a cell in a specific
spatial configuration; retaining substantially a single cell in
each compartment; locally overheating the agarose with convergence
light for the purpose of discretionally prescribing the direction
in which each cell extends axon or the like for securing
intercellular interaction, to form a tunnel to connect each
compartment with respect to one another; and measuring an
electrical change caused by the intercellular interaction employing
an electrode provided in each tunnel.
[1259] 7. A method of electrically measuring a cell comprising the
steps of: providing on a substrate a plurality of compartments made
of agarose for keeping a cell in a specific spatial configuration;
retaining substantially a single cell in each compartment; locally
overheating the agarose with convergence light for the purpose of
discretionally prescribing the direction in which each cell extends
axon or the like for securing intercellular interaction, to form a
tunnel to connect each compartment with respect to one another;
giving electric stimulation to intercellular space using an
electrode provided in each tunnel; and measuring an electrical
change caused by a response from a cell.
[1260] 8. The method of electrically measuring a cell employing a
cell culture microarray according to paragraph 6 or paragraph 7
comprising the steps of: adding to a cell a biological material
such as peptide and amino acid or a chemical material suspected of
being an endocrine disrupting chemical or having toxicity; and
measuring an electrical change caused by a response from the
cell.
[1261] 9. A method of electrically measuring a cell comprising the
steps of: employing a neuron culture microchamber having a
plurality of compartment walls and tunnels for connecting the
compartment walls on a substrate for keeping a cell in a specific
spatial configuration, a plurality of electrode patterns for
measuring an electrical change in a cell being provided in each of
the tunnels, and an optically transparent semipermeable membrane
and a culture solution bath being provided on the compartment
walls; giving electric stimulation to intercellular space using an
electrode provided in each tunnel; and measuring an electrical
change caused by a response from the cell.
Ninth Embodiment
[1262] 1. A cell reconstruction device comprising: a plurality of
microchambers each having an electrode for incubating a
prespecified number of cells; and a tunnel or a groove
communicating between the plurality of microchambers with the cell
not capable of passing therethrough but with a culture solution
capable of passing therethrough, a cell provided in the
microchambers on both sides of the tunnel or groove being a
heterogeneous cell.
[1263] 2. A cell reconstruction device comprising: a plurality of
microchambers each having an electrode for incubating a
prespecified number of cells; a tunnel or a groove communicating
between the plurality of microchambers with the cell not capable of
passing therethrough but with a culture solution capable of passing
therethrough; and a culture solution bath in which a culture
solution for a cell provided in the microchambers on both sides of
the tunnel or groove is discretely replaceable.
[1264] 3. A cell reconstruction device having on a substrate a
plurality of compartments for keeping a cell in a specific spatial
configuration; a tunnel or a groove communicating between the
plurality of compartments with the cell not capable of passing
therethrough but with a culture solution capable of passing
therethrough; a plurality of electrode patterns for measuring an
electrical change in a cell; and an optically transparent
semipermeable membrane and a culture solution bath being placed on
the compartments; wherein a culture solution bath is designed so
that a culture solution for the cell provided in the compartments
on both sides of the tunnel or groove can be discretely
replaced.
[1265] 4. A cell reconstruction device having on a substrate a
plurality of compartments for keeping a different cell in a
specific spatial configuration; a tunnel or a groove communicating
between the plurality of microchambers with the cell not capable of
passing therethrough but with a culture solution capable of passing
therethrough; a plurality of electrode patterns for measuring an
electrical change in a cell; and an optically transparent
semipermeable membrane and a culture solution bath being placed on
the compartments; wherein a culture solution bath is designed so
that a culture solution for the cell provided in the compartments
on both sides of the tunnel or groove can be discretely
replaced.
[1266] 5. A bioassay chip comprising:
[1267] a plurality of microcompartments each retaining a
prespecified number of heterogeneous cells;
[1268] a groove or a tunnel for connecting between the plurality of
microcompartments and those adjacent thereto; and
[1269] a means for feeding a different culture solution to each
cell in a microcompartment connected with the groove or tunnel.
[1270] 6. A cell bioassay chip comprising:
[1271] a plurality of microcompartments each retaining a single
cell of heterogeneous cells one by one;
[1272] a group of microcompartments for retaining homogenous cells
in the plurality of microcompartments and for retaining homogenous
cells connected with a groove or a tunnel to each other between the
adjoining microcompartments;
[1273] a groove or a tunnel for connecting groups for connecting
between the microcompartments groups for retaining homogenous
cells; and
[1274] a means for feeding different culture solutions to each of
microcompartment groups.
[1275] 7. A bioassay: employing a cell reconstruction device
comprising, a plurality of microchambers each having an electrode
for incubating a prespecified number of cells, a tunnel or a groove
communicating between the plurality of microchambers with the cell
not capable of passing therethrough but with a culture solution
capable of passing therethrough, and a culture solution bath
capable of discretely replacing a culture solution for a cell
provided in the microchambers on both sides of the tunnel or
groove; adding a testing sample to the culture solution for a cell
in a microchamber on one of the tunnel or groove side; and
observing a change in electrical potential or shape of a cell in a
microchamber on the other of the tunnel or groove.
[1276] 8. A bioassay: employing a cell reconstruction device
provided with a plurality of compartments having a substrate,
agarose gel provided on the substrate, and an electrode for keeping
two or more types of heterogeneous cells formed on the agarose gel
in a specific spatial configuration; locally overheating the
agarose gel with convergence light for the purpose of
discretionally prescribing the direction in which a substantially
single cell retained in each of the compartment extends a portion
thereof for securing intercellular interaction, to form a tunnel or
a groove; giving stimulation to a specific cell using the
electrode; and measuring a response of a different cell.
Tenth Embodiment
[1277] 1. A cell culture method comprising the steps of: incubating
a cell on a cellulose membrane; and, after the incubation,
decomposing the cellulose membrane using cellulose to collect a
cultured cell.
[1278] 2. A cell culture method comprising the steps of: incubating
a cell on the cellulose membrane of a cell culture support having a
bottom face inside thereof, forming a plurality of beams with the
upper portion thereof opened on the bottom face, and configured to
have a cellulose medium attached to the upper edge of the beams;
and, after the incubation, injecting cellulose into a flow path
formed in a portion of the beams to decompose the cellulose
membrane.
[1279] 3. A cell culture method comprising the steps of: in order
to incubate a cell on a cellulose membrane on a cell culture
support having a bottom face inside thereof, forming a plurality of
beams with the upper portion thereof opened on the bottom face, and
configured to have a cellulose membrane attached to the upper edge
of the beams; circulating a culture solution in a flow path formed
in a portion of the beams; injecting, after the incubation,
cellulase in the flow path formed in a portion of the beams;
decomposing the cellulose membrane by making cellulase act on the
cellulose membrane; and collecting a cell or a sheet of cells.
[1280] 4. A cell culture method comprising the steps of: in order
to incubate a cell on a cellulose membrane on a cell culture
support having a bottom face inside thereof, forming a plurality of
beams with the upper portion thereof opened on the bottom face, and
configured to have a cellulose membrane attached to the upper edge
of the beams; circulating a culture solution in a flow path formed
in a portion of the beams; injecting, after the incubation,
cellulase in the flow path formed in a portion of the beams;
decomposing the cellulose membrane by making cellulose act on the
cellulose membrane; collecting a cell or a sheet of cells; and
further, putting a previously-collected sheet of cells on top
of
[1281] another sheet of cells newly formed with the procedure to
incubate the cells; decomposing the cellulose membrane
[1282] by making cellulose act on the cellulose membrane; and
collecting the two-ply sheet of cells.
[1283] 5. The cell culture method according to paragraph 4 further
comprising the step of: putting the two-ply sheet of cells on top
of another newly formed sheet of cells.
[1284] 6. A cell culture support having a bottom face inside
thereof, forming a plurality of beams with the upper portion
thereof opened on the bottom face, and configured to have a
cellulose membrane attached to the upper edge of the beams.
[1285] 7. The cell culture support according to paragraph 6, having
a cover used by putting on top of the culture support, wherein the
cover is provided with a tube for supplying or sucking a solution
supplied to between the plurality of beams or sucked from between
the same.
[1286] 8. The cell culture support according to paragraph 6, having
a cover used by putting on top of the culture support, wherein the
cover provided with a tube for supplying or sucking a solution
supplied to between the plurality of beams or sucked from between
the same; and a plate adjoining the tube for blocking a flow of the
solution is provided.
Eleventh Embodiment
[1287] 1. A microchamber for cell culture comprising:
[1288] a semipermeable membrane;
[1289] a gel membrane formed on the semipermeable membrane and made
of agarose or a derivative thereof; and
[1290] a plurality of compartments formed on the gel membrane for
keeping a cell in a specific spatial configuration.
[1291] 2. A microchamber for cell culture comprising:
[1292] a semipermeable membrane;
[1293] a gel membrane formed on the semipermeable membrane and made
of agarose or a derivative thereof; and
[1294] a plurality of compartments formed on the gel membrane for
keeping a cell in a specific spatial configuration, spaces between
the plurality of compartments being capable of forming a groove by
locally heating an agarose gel membrane with convergence light in
the discretional direction.
[1295] 3. The microchamber for cell culture according to paragraph
1 or paragraph 2, wherein the semipermeable membrane is a cellulose
membrane.
[1296] 4. A method of building the structure of a cell comprising
the steps of:
[1297] placing a microchamber for cell culture configured to form
an agarose gel membrane on a semipermeable membrane;
[1298] forming a prespecified number of cell compartments on the
agarose gel membrane by means of convergence light heating;
[1299] inserting a cell into the cell compartment to incubate the
same;
[1300] irradiating, during the cell culture, laser convergence
light at a wavelength absorbable by water to the agarose gel
membrane present between the cell compartments in a prespecified
order in the direction desirable for binding the cells to one
another to link any cell compartments to one another with a groove;
and
[1301] making cellulose act on the semipermeable membrane, after a
cell assembly with the cells conjugated therein is formed, to
remove the semipermeable membrane.
[1302] 5. A microchamber for cell culture comprising:
[1303] a semipermeable membrane;
[1304] a thin plate attached to the semipermeable membrane and
having an opening in the center thereof;
[1305] a gel membrane formed on the opening on the thin plate and
made of agarose or a derivative thereof supported by the
semipermeable membrane; and
[1306] a plurality of compartments formed on the gel membrane for
keeping a cell in a specific spatial configuration.
[1307] 6. A microchamber kit for cell culture comprising:
[1308] a pool having an upper portion thereof opened and capable of
retaining a solution;
[1309] a fine structure substrate having a plurality of beams
formed in the pool at prespecified intervals; and
[1310] a microchamber for cell culture comprising: a semipermeable
membrane; a thin plate attached to the semipermeable membrane and
having an opening corresponding to the pool in the center thereof;
a gel membrane formed on the opening on the thin plate and made of
agarose or a derivative thereof supported by the semipermeable
membrane; and a plurality of compartments formed on the gel
membrane for keeping a cell in a specific spatial
configuration.
[1311] 7. The microchamber kit for cell culture according to
paragraph 6, wherein the microchamber for cell culture is provided
with an opening communicating with the pool at both ends of the
opening.
[1312] 8. A cell culture device comprising:
[1313] a pool having an upper portion thereof opened and capable of
retaining a solution;
[1314] a fine structure substrate having a plurality of beams
formed in the pool at prespecified intervals; and
[1315] a microchamber for cell culture comprising: a semipermeable
membrane; a thin plate attached to the semipermeable membrane and
having an opening corresponding to the pool in the center thereof;
a gel membrane formed on the opening on the thin plate and made of
agarose or a derivative thereof supported by the semipermeable
membrane; and a plurality of compartments formed on the gel
membrane for keeping a cell in a specific spatial configuration,
the microchamber for cell culture being provided with an opening
communicating to the pool at both ends of the opening to supply or
discharge a culture solution to the pool via a tube communicating
with the pool through the opening.
[1316] 9. The cell culture device according to paragraph 8,
wherein, when the cell culture reaches a prespecified stage,
cellulose at a prespecified concentration is supplied to the pool
via a tube communicating with the pool through the opening to
dissolve and remove the semipermeable membrane.
[1317] 10. The cell culture device according to paragraph 4,
wherein the formation of a groove on the agarose gel membrane is
conducted by, in the step of cell culture, irradiating laser
convergence light to a portion of a microneedle contacting the
agarose gel membrane to locally heat a portion of the
microneedle.
Twelfth Embodiment
[1318] 1. A cardiac muscle cell bioassay chip comprising:
[1319] a means for arranging a network constituting four or more
pulsating myocardial cells in the state where each cell is
observable;
[1320] a means for controlling and measuring electrical stimulation
or response of each cell one by one; and
[1321] a means for preventing conditions during incubation from
changing by means of spatial configuration of each cell.
[1322] 2. A cardiac muscle cell bioassay chip comprising:
[1323] a means for arranging a network constituting not fewer than
4 nor more than 32 pulsating myocardial cells in the state where
each cell is observable;
[1324] a means for controlling and measuring electrical stimulation
or response of each cell one by one; and
[1325] a means for preventing conditions during incubation from
changing by means of spatial configuration of each cell.
[1326] 3. A cardiac muscle cell bioassay chip comprising:
[1327] a plurality of microcompartments each capable of retaining a
single pulsating myocardial cell one by one;
[1328] a groove or a tunnel for connecting between the plurality of
microcompartments and those adjacent thereto;
[1329] not fewer than 4 adjoining microcompartments each with a
single cell having been inserted therein in advance; and
[1330] a means for supplying each of the microcompartments with a
culture solution for pulsating myocardial cells.
[1331] 4. A cardiac muscle cell bioassay chip comprising:
[1332] a substrate;
[1333] a plurality of microcompartments provided with four or more
pulsating myocardial cells arranged to adjoin one another on the
substrate;
[1334] a groove or a tunnel for connecting each of the
microcompartments; and
[1335] a means for supplying each of the microcompartments with a
culture solution for pulsating myocardial cells.
[1336] 5. A cardiac muscle cell bioassay chip comprising:
[1337] a plurality of microcompartments each capable of retaining a
single pulsating myocardial cell one by one;
[1338] a groove or a tunnel for connecting between the plurality of
microcompartments and those adjacent thereto;
[1339] not fewer than 4 nor more than 32 adjoining
microcompartments each with a single cell having been inserted
therein in advance; and
[1340] a means for supplying each of the microcompartments with a
culture solution for pulsating myocardial cells.
[1341] 6. A cardiac muscle cell bioassay chip comprising:
[1342] a substrate;
[1343] a plurality of microcompartments provided with not fewer
than 4 nor more than 32 pulsating myocardial cells arranged to
adjoin one another on the substrate;
[1344] a groove or a tunnel for connecting each of the plurality of
microcompartments; and
[1345] a means for supplying each of the microcompartments with a
culture solution for pulsating myocardial cells.
[1346] 7. A cardiac muscle cell bioassay chip according to any of
paragraphs 1 to 6, wherein the material forming the plurality of
microcompartments is agarose.
[1347] 8. An aggregated cell microarray having on a substrate a
groove or a tunnel for connecting between a plurality of
microcompartment walls in order to adjoin four or more pulsating
myocardial cells one another and to keep the cells in a specific
spatial configuration, and a plurality of electrical patterns for
measuring an electrical change of a cell in each groove or tunnel,
and an optically transparent semipermeable membrane and a culture
solution bath being provided on the microcompartment walls.
[1348] 9. A bioassay accommodating a single pulsating myocardial
cell in each of a plurality of microcompartments formed on a
substrate and connected with a groove or a tunnel to one another,
adding a testing sample to each of eight or more microcompartments
adjacent to the plurality of microcompartments, and observing a
change in electrical potential or shape of the cell each
accommodated in the microcompartments.
[1349] 10. The bioassay according to paragraph 9, wherein the
testing sample is a biological material such as peptide and amino
acid or a chemical material suspected of being a endocrine
disrupting chemical or having toxicity.
[1350] 11. A bioassay: employing an aggregated cell microarray
having on a substrate a groove or a tunnel for connecting between a
plurality of microcompartment walls in order to adjoin four or more
pulsating myocardial cells one another and to keep the cells in a
specific spatial configuration, and a plurality of electrical
patterns for measuring an electrical change of a cell in each
groove or tunnel, and an optically transparent semipermeable
membrane and a culture solution bath being provided on the
microcompartment walls; giving electric stimulation to
intercellular space using an electrode provided in each groove or
tunnel; and measuring a change in electrical potential or shape
caused by a response from a cell.
Thirteenth Embodiment
[1351] 1. A biological sample chip for collecting a specific
biological material in a cell, the biological sample chip having a
biological sample chip tip section with a needle configuration
having a sharp-pointed tip, and fixed thereto a material having an
affinity to the specific biological material in a probe area
inserted into a cell in the biological sample chip tip section.
[1352] 2. The biological sample chip according to paragraph 1,
wherein TiO.sub.2 is fixed onto a portion where a cell is inserted
into the endmost portion of the biological sample chip tip
section.
[1353] 3. The biological sample chip according to paragraph 1,
wherein, in addition to the material having an affinity to the
specific biological material, (Arg).sub.n (n:1.about.8) is fixed to
a probe area inserted into a cell in the biological sample chip tip
section.
[1354] 4. The biological sample chip according to paragraphs 1 to
3, wherein the biological sample chip tip section has a holder in a
root portion thereof, and the holder is connected to an operation
substrate.
[1355] 5. A method of measuring a specific material in a cell
comprising the steps of:
[1356] sticking into a cell a probe area in the biological sample
chip tip section with a material having an affinity to the specific
biological material fixed thereon;
[1357] capturing in the probe area a material having an affinity to
the material fixed to the probe area on the biological sample
chip;
[1358] making a nanoparticle labeled probe react to the biological
material in the cell captured in the probe area for hybridization;
and
[1359] counting the number of nanoparticles of the probe hybridized
with the biological material in the cell captured in the probe
area.
[1360] 6. A method of measuring a specific material in a cell
comprising the steps of:
[1361] sticking into a cell a probe area in a biological sample
chip tip section with a material having an affinity to the specific
biological material and (Arg), (n:1.about.8) fixed thereon;
[1362] capturing in the probe area a material having an affinity to
the material fixed to the probe area on the biological sample
chip;
[1363] making a nanoparticle labeled probe react to the biological
material in the cell captured in the probe area for hybridization;
and
[1364] counting the number of nanoparticles of the probe hybridized
with the biological material in the cell captured in the probe
area.
[1365] 7. The method of measuring a specific material in a cell
according to paragraph 5 or paragraph 6, wherein the specific
biological material is mRNA.
[1366] 8. The method of measuring a specific material in a cell
according to paragraph 5 or paragraph 6, wherein the specific
biological material is protein.
[1367] 9. The method of measuring a specific material in a cell
according to any of paragraphs 5 to 8, wherein a position for
sticking the biological sample chip tip section is the nucleus of a
cell.
[1368] 10. The method of measuring a specific material in a cell
according to any of paragraphs 5 to 8, wherein a position for
sticking the biological sample chip tip section is cytoplasm of a
cell.
Fourteenth Embodiment
[1369] 1. A method of collecting a biological material comprising
the steps of:
[1370] sticking into a living cell a needle with a material having
an affinity to a specific biological material fixed on a tip
section thereof;
[1371] pulling out the needle from the living cell after a
prespecified period of time; and
[1372] collecting the specific biological material from the tip
section.
[1373] 2. A method of collecting a biological material comprising
the steps of:
[1374] sticking into a living cell a needle with a material having
an affinity to a specific biological material and (Arg),
(n:1.about.8) fixed onto a tip section thereof;
[1375] capturing the material having an affinity in the tip section
of the needle; and
[1376] collecting the specific biological material contained in the
cell as the cell remains alive.
[1377] 3. A method of collecting a biological material comprising
the steps of:
[1378] sticking into a living cell a needle with a material having
an affinity to a specific biological material and TiO.sub.2 fixed
onto a tip section thereof;
[1379] capturing the material having an affinity in the tip section
of the needle; and
[1380] collecting the specific biological material contained in the
cell as the cell remains alive.
[1381] 4. The method of collecting a biological material according
to paragraph 1 or paragraph 2, wherein the specific biological
material is mRNA.
[1382] 5. A method of collecting a biological material comprising
the steps of:
[1383] sticking into a living cell a needle with a probe having a
derivative with a poly T sequence having an affinity to a poly A
portion of mRNA fixed onto a tip section thereof;
[1384] pulling out the needle from the cell after a prespecified
period of time;
[1385] collecting the mRNA captured in the tip section of the
needle; and
[1386] amplifying the collected mRNA with the PCR to obtain cDNA of
a specific gene.
[1387] 6. The method of collecting a biological material according
to paragraph 1 or paragraph 2, wherein the specific biological
material is protein.
[1388] 7. A method of collecting a biological material comprising
the steps of:
[1389] sticking into a living cell a needle with a material having
an affinity to a specific biological material fixed onto a tip
section thereof;
[1390] pulling out the needle from the living cell after a
prespecified period of time;
[1391] collecting the specific biological material from the tip
section;
[1392] further sticking, after a prespecified period of time, into
the cell a needle with a material having an affinity to a specific
biological material fixed onto a tip section thereof;
[1393] pulling out the needle from the cell after a prespecified
period of time; and
[1394] collecting the specific biological material from the tip
section.
Fifteenth Embodiment
[1395] 1. An mRNA aliquotting device for collecting mature mRNA
comprising:
[1396] a chip tip section having a hollow capillary structure with
a tip section thereof contacted to the nuclear membrane of a
cell;
[1397] a means for applying negative pressure to the inside of the
chip;
[1398] a means for visually observing a contact state between the
nuclear membrane of a cell and the chip tip section having a hollow
capillary structure; and
[1399] a means for regulating a position of the chip tip section
having a hollow capillary structure under the control of visual
observation of the contact state between the nuclear membrane of a
cell and the chip tip section having a hollow capillary
structure.
[1400] 2. An mRNA aliquotting device for collecting mature mRNA
according to paragraph 1 further comprising:
[1401] a means for measuring electric conductivity between a buffer
retained in the chip tip section having a hollow capillary
structure and a portion of the cell.
[1402] 3. A method of aliquotting mRNA comprising the steps of:
[1403] sticking a hollow capillary into a cell with mRNA thereof to
be collected;
[1404] making a tip of the hollow capillary firmly adhere to the
nuclear membrane in the cell; and
[1405] collecting mRNA passing through the nuclear membrane of the
cell into the hollow capillary.
[1406] 4. The method of aliquotting for collecting mature mRNA of a
cell according to paragraph 3 comprising the step of:
[1407] filling the hallow capillary with a buffer before sticking a
hollow capillary into a cell with mRNA thereof to be collected.
[1408] 5. A hollow capillary employed in the method of aliquotting
mRNA comprising the steps of: sticking a hollow capillary into a
cell with mRNA thereof to be collected; making a tip of the hollow
capillary firmly adhere to the nuclear membrane in the cell; and
collecting mRNA passing through the nuclear membrane of the cell
into the hollow capillary, the tip section of the hollow capillary
having an (Arg), (n:1.about.8) fixed onto an outer wall
thereof.
[1409] 6. A hollow capillary with TiO.sub.2, in place of the (Arg),
(n:1.about.8), fixed onto the tip section thereof according to
paragraph 5.
[1410] 7. A hollow capillary with TiO.sub.2, in addition to the
(Arg), (n:1.about.8), fixed onto the tip section thereof according
to paragraph 5.
[1411] 8. A hollow capillary according to paragraphs 5 to 7,
wherein the hollow capillary has a chip tip section configured to
have inside thereof at least two systems of hollows separated with
the same axle or partition; a buffer is flown from one or more of
at least two systems of the hollows separated with the partition;
and mRNA is continuously collected from the other hollow(s).
[1412] 9. A method of aliquotting mRNA according to paragraph 3 or
paragraph 4, wherein the collected mRNA is amplified with the PCR
to obtain cDNA of a specific gene.
[1413] 10. A method of aliquotting mRNA to collect mRNA passing
through the nuclear membrane of the cell into hollow capillary
by:
[1414] sticking a hollow capillary into a cell with mRNA thereof to
be collected;
[1415] making a tip of the hollow capillary firmly adhere to the
nuclear membrane in the cell; and
[1416] making mRNA transfer by applying positive voltage to an
electrode provided in the hollow capillary and applying negative
voltage to an electrode provided in the cell nucleus outside the
hollow capillary.
Sixteenth Embodiment
[1417] 1. A biochemical material separator comprising:
[1418] a member with a lipid bilayer containing a transporter fixed
in a micropore thereof;
[1419] a mechanism provided on one side of the micropore for adding
a sample; and
[1420] a mechanism provided on the other side of the micropore for
collecting a biochemical material passing the micropore.
[1421] 2. A biochemical material separator providing with a
plurality types of separation members comprising a lipid bilayer
having a transporter present in a cell membrane, nuclear membrane
and the like, configured to hierarchically arrange the separation
members each for partitioning an anterior vessel thereof, and
having a means for collecting the separated biochemical material
from between each of the separation members.
[1422] 3. A biochemical material separator configured to fix a
lipid bilayer having a transporter present in a cell membrane,
nuclear membrane and the like and passing through a different
biological material, onto an inlet of each collecting port of a
vessel comprising one sample adding port and a plurality of
collecting ports.
[1423] 4. A biochemical material separator configured to fix a
plurality types of lipid bilayers discretely having a plurality
types of transporters present in a cell membrane, nuclear membrane
and the like and passing through a specific biochemical material,
onto an inlet of each collecting port of a vessel comprising one
sample adding port and a plurality of collecting ports; and having
a means for collecting a specific biochemical material passing
through each transporter.
[1424] 5. A biochemical material separator having the element
configuration of fixing a lipid bilayer discretely having a
plurality types of transporters present in a cell membrane, nuclear
membrane and the like and passing through a specific biochemical
material, onto an inlet of each collecting port of a vessel
comprising one sample adding port and a plurality of collecting
ports; and having a mechanism for collecting a transporter present
in an element making a specific biochemical material pass
through.
[1425] 6. The separator according to paragraphs 1 to 5, having a
mechanism of making a biochemical material transfer with the
electrophorensis or electroosmosis and pass through a
transporter.
[1426] 7. A method of separating a biochemical material to separate
a plurality of biochemical materials comprising the steps of:
[1427] adding a biological sample solution to a front portion of a
micropore in a biochemical material separation comprising: a member
with a plurality of transporters and lipid bilayers discretely
fixed onto a micropore thereof; a mechanism for adding a sample to
one of a front portion or a rear portion of each micropore; and a
mechanism for collecting a biochemical material passing through
each micropore on the other portion; and
[1428] making a biochemical material transfer to separate the same
into a material passing through a micropore and that not passing
through a micropore.
[1429] 8. A method of separating a transporter comprising the steps
of:
[1430] adding a specific biological sample solution to a front
portion of a micropore in a biochemical material separation
comprising: a member with a plurality of transporters and lipid
bilayers discretely fixed onto a micropore thereof; a mechanism for
adding a sample to one of a front portion or a rear portion of each
micropore; and a mechanism for collecting a biochemical material
passing through each pore on the other portion;
[1431] detecting an element in which a specific biochemical
material passes through a micropore; and
[1432] collecting a transporter present in the element in which a
specific biochemical material passes through a micropore.
[1433] 9. The separation method according to paragraph 7 or
paragraph 8, wherein a means for making a biochemical material
transfer is the electrophorensis or electroosmosis.
[1434] 10. An mRNA alquiotting chip, the chip being a biological
material chip for collecting mature mRNA, having a chip tip section
with a hollow capillary structure, and configured to fix a nuclear
membrane onto the biological material chip tip section with the
inside of the nuclear membrane turned to the outside of the
chip.
[1435] 11. An mRNA separation method comprising the steps of:
immersing the biological material chip tip section for collecting
the mature mRNA according to paragraph 10, in a sample solution;
and collecting the mRNA passing through a nuclear membrane fixed
onto the chip tip section, in the biological material chip.
Seventeenth Embodiment
[1436] 1. A cell chip comprising: a cell fixing substrate having
one face thereof as a face for fixing a cell; a micropore provided
in a cell fixing portion of the substrate and having a diameter
smaller than the cell; and a buffer chamber configured on the
reverse of the face for fixing a cell at a position of the
micropore on the cell fixing substrate, liquid such as a buffer
capable of continuously being fed to the buffer chamber.
[1437] 2. The cell chip according to paragraph 1, wherein, when a
cell is fixed by adding a droplet in a position of the micropore on
the face for fixing a cell on the cell fixing substrate, an
electrode for measuring electrical conductivity or current passing
between the droplet and the buffer chamber is provided.
[1438] 3. The cell chip according to paragraph 2, wherein the
electrode is formed each on both sides of the cell fixing
substrate.
[1439] 4. The cell chip according to paragraph 1 or 2, having a
plurality of the micropores, and having clearances between the
micropores smaller than those between the cells fixed on the cell
fixing substrate.
[1440] 5. A method of altering a cell comprising the steps of:
[1441] placing in a buffer solution a cell fixed onto a cell fixing
substrate of a cell chip, the cell chip comprising: a cell fixing
substrate having one face thereof as a face for fixing a cell; a
micropore provided in a cell fixing portion of the substrate and
having a diameter smaller than the cell; and a buffer chamber
configured on the reverse of the face for fixing a cell at a
position of the micropore on the cell fixing substrate, liquid such
as a buffer capable of continuously being fed to the buffer
chamber; and
[1442] feeding streptolysin O into the buffer chamber to make a
lipid bilayer of a cell in a position of the micropore into a
semipermeable membrane.
[1443] 6. The method of altering a cell according to paragraph 5,
further comprising the step of: after the feed of streptolysin O,
adding any DNA or RNA or a derivative thereof to the buffer
chamber.
[1444] 7. A method of collecting a chemical material comprising the
steps of:
[1445] placing in a buffer solution a cell fixed onto a cell fixing
substrate of a cell chip, the cell chip comprising: the cell fixing
substrate having one face thereof as a face for fixing a cell; a
micropore provided in a cell fixing portion of the substrate and
having a diameter smaller than the cell; and a buffer chamber
configured on the reverse of the face for fixing a cell in a
position of the micropore on the cell fixing substrate, liquid such
as a buffer capable of continuously being fed to the buffer
chamber;
[1446] altering a cell by feeding streptolysin O to the buffer
chamber to make a lipid bilayer of a cell in a position of the
micropore into a semipermeable membrane;
[1447] adding any chemical material to a buffer surrounding the
altered cell; and
[1448] collecting a chemical material passing through a lipid
bilayer of the cell from the semipermeable membrane-turned lipid
bilayer into the buffer chamber.
[1449] 8. A cell chip comprising: a cell fixing substrate having
one face thereof as a face for fixing a cell; a micropore provided
in a cell fixing portion of the substrate and having a diameter
smaller than the cell; and a buffer chamber configured on the
reverse of the face for fixing a cell at a position of the
micropore on the cell fixing substrate, electrodes being provided
in the buffer chamber and on the side of the face for fixing the
cell, and liquid such as a buffer capable of continuously being fed
to the buffer chamber, a cell fixed onto the cell fixing substrate
of the cell chip being placed in a buffer solution, streptolysin O
being fed to the buffer chamber to alter the cell by making a lipid
bilayer of the cell at a position of the micropore into a
semipermeable membrane, a cell chip with a given peptide expressed
therein being prepared by adding mRNA encoding any membrane protein
or a vector encoding the mRNA sequence into the cell, any chemical
material being added to a buffer surrounding the altered cell, and
a chemical material having an affinity to the membrane protein
being detected by means of the electrodes.
[1450] 9. A cell chip comprising: a cell fixing substrate having
one face thereof as a face for fixing a cell; a micropore provided
in a cell fixing portion of the substrate and having a diameter
smaller than the cell; and a buffer chamber configured on the
reverse of the face for fixing a cell at a position of the
micropore on the cell fixing substrate, electrodes being provided
in the buffer chamber and on the side of the face for fixing the
cell, and liquid such as a buffer capable of continuously being fed
to the buffer chamber, a cell fixed onto the cell fixing substrate
of the cell chip being placed in a buffer solution, streptolysin O
being fed to the buffer chamber to alter the cell by making a lipid
bilayer of the cell at a position of the micropore into a
semipermeable membrane, voltage being applied between the
electrodes, and a chemical material passing through the fixed cell
continuously being collected from the buffer chamber.
Eighteenth Embodiment
[1451] 1. A biomolecule detecting tubule, being a tubule having one
end thereof for an opening in diameter smaller than a prespecified
wavelength of light and the other end thereof for another opening
in diameter sufficiently larger than the prespecified wavelength of
light, and forming a light guide configured to deposit metal on at
least an inner wall and an outer wall in the proximity of the tip
section opening of the tubule.
[1452] 2. A biomolecule detector comprising:
[1453] a biomolecule detecting tubule, being a tubule having a tip
section thereof for an opening in diameter smaller than a
prespecified wavelength of light and the other end thereof for
another opening in diameter sufficiently larger than the
prespecified wavelength of light, and forming a light guide
configured to deposit metal on at least an inner wall and an outer
wall in the proximity of the tip section opening of the tubule;
[1454] two electrodes for applying prespecified voltage;
[1455] a laser light source for irradiating light at the
prespecified wavelength from the sufficiently large opening of the
biomolecule detecting tubule forming the light guide; and
[1456] a photon counter provided in the tip section of the tubule
for counting light, an evanescence wave area being formed in the
proximity of the tip section opening of the tubule by irradiating
the laser light, the tip section of the biomolecule detecting
tubule being placed in a solution containing a biomolecule, and,
when the biomolecule traverses the evanescence wave area and passes
the tip section opening of the tubule due to an electric field by
the two electrodes, scattered wave generated by the biomolecule
being detected with the counter.
[1457] 3. A biomolecule detector comprising:
[1458] a biomolecule detecting chip with a curved and projecting
opening in diameter smaller than a prespecified wavelength of light
formed in the center portion thereof to form a light guide
configured to deposit metal on both faces in the proximity of the
opening in the center portion thereof;
[1459] two electrodes for applying prespecified voltage;
[1460] a laser light source for irradiating light at the
prespecified wavelength from one edge face of a chip forming the
light guide;
[1461] a substrate having a vessel provided on the side of a face
with the chip opening being curved and projecting thereon;
[1462] a photon counter provided outside a bottom face of the
vessel on the substrate, an evanescence wave area being formed in
the proximity of the central section opening of the chip by
irradiating the laser light; a buffer being put into the vessel; a
droplet containing a biomolecule being placed on the opposite side
to the side of the vessel of the biomolecule detecting chip; and,
when the biomolecule traverses the evanescence wave area and passes
the tip section opening of the chip due to electric field generated
by the two electrodes, scattered wave caused by the biomolecule
being detected with the counter.
[1463] 4. The biomolecule detector according to paragraph 2,
further comprising: a second tubule with a tip section of the
biomolecule detector included therein and with a membrane passing a
prespecified material provided in the tip opening section
thereof.
[1464] 5. The biomolecule detector according to paragraph 4,
wherein the membrane provided in the tip opening section of the
second opening and passing a prespecified material includes a
transporter passing a prespecified material.
[1465] 6. The biomolecule detector according to paragraph 3,
further comprising: a second chip with an opening section having a
membrane passing a prespecified material on a top face of the
biomolecule detector.
[1466] 7. The biomolecule detector according to paragraph 4,
wherein the membrane provided in the opening section of the second
chip and passing a prespecified material includes a transporter
passing a prespecified material.
[1467] 8. The biomolecule detector according to paragraph 2 or 3,
wherein the metal is gold.
[1468] 9. The biomolecule detector according to paragraph 4,
wherein the membrane passing a specific biomolecule is a membrane
in which an mRNA sequence of a specific membrane protein is
incorporated into an immature ovum of a platanna, and thereby the
specific membrane protein is forced to be expressed.
[1469] 10. The biomolecule detector according to paragraph 6,
wherein the membrane passing a specific biomolecule through is a
membrane in which an mRNA sequence of a specific membrane protein
is incorporated into an immature ovum of a platanna, and thereby
the specific membrane protein is forced to be expressed.
[1470] 11. A method of detecting a biomolecule comprising the steps
of:
[1471] forming an evanescence wave area in the opening section in
diameter smaller than a prespecified wavelength of light;
[1472] passing a biomolecule to be detected through the evanescence
wave area; and
[1473] detecting a scattered wave caused by passage of the
biomolecule.
[1474] 12. The method of detecting a biomolecule according to
paragraph 11, wherein the biomolecule to be detected is supplied
through a membrane allowing passage of a prespecified material.
[1475] 13. The method of detecting a biomolecule according to
paragraph 12, wherein the membrane allowing passage of a
prespecified material is a membrane in which an mRNA sequence of a
specific membrane protein is incorporated into an immature ovum of
a platanna, and thereby the specific membrane protein is forced to
be expressed.
Nineteenth Embodiment
[1476] 1. A biological sample analysis chip with a different probe
fixed on each area of a plurality of areas discretely provided on a
substrate thereof, each of the plurality of discrete areas having
an area not more than that of a circle 700 nm.phi. and not less
than that of a circle 3 nm.phi..
[1477] 2. A biological sample analysis chip with a different probe
fixed on each area of a plurality of areas discretely provided on a
substrate thereof, providing structures each having a specific
shape on the four corners in each of the plurality of discrete
areas, and each of the structures having a specific shape provided
on the four corners being different from one another in each of the
plurality of discrete areas respectively.
[1478] 3. The biological sample analysis chip according to
paragraph 1 or 2, wherein the areas having as a unit a prespecified
number of the plurality of discrete areas are each provided via a
groove formed between the areas.
[1479] 4. The biological sample analysis chip according to
paragraph 1 or 2, wherein the areas having as a unit a prespecified
number of the plurality of discrete areas are provided at a
prespecified distance or farther.
[1480] 5. An analysis method by means of a biological sample
analysis chip comprising the steps of:
[1481] dropping a sample solution on a biological sample analysis
chip with a different probe fixed on each of a plurality of areas
discretely provided on a substrate thereof, each of the plurality
of discrete areas having an area not more than that of a circle 700
nm.phi. and not less than that of a circle 3 nm.phi.;
[1482] placing a thin plate or a rod rotating at a prespecified
speed on the top face of the biological sample analysis chip;
and
[1483] moving the plate or rod from side to side on the substrate
to accelerate hybridization between the probe and a sample in the
sample solution.
[1484] 6. An analysis method by means of a biological sample
analysis chip comprising the steps of:
[1485] dropping a sample solution on a biological sample analysis
chip with a different probe fixed on each area of a plurality of
areas discretely provided on a substrate thereof, a structure
having a specific shape being provided on each of the four corners
in the plurality of discrete areas, and each of the structures
having a specific shape provided on the four corners being
different from one another with respect to each of the plurality of
discrete areas;
[1486] placing a thin plate or a rod rotating at a prespecified
speed on the top face of the biological sample analysis chip;
and
[1487] moving the plate or rod from side to side on the substrate
to accelerate hybridization between the probe and a sample in the
sample solution.
[1488] 7. A method of analyzing a biological sample comprising the
steps of:
[1489] tracing with a probe for an atomic force microscope a
biological sample analysis chip with a different probe fixed on
each area of a plurality of areas discretely provided on a
substrate thereof, each of the plurality of discrete areas having
an area not more than that of a circle 700 nm.phi. and not less
than that of a circle 3 nm.phi.; and
[1490] detecting a sample hybridized with the probe.
[1491] 8. A method of analyzing a biological sample comprising the
steps of:
[1492] tracing with a probe for an atomic force microscope a
biological sample analysis chip with a different probe fixed on
each area of a plurality of areas discretely provided on a
substrate thereof, a structure having a specific shape being
provided on each of the four corners in the plurality of discrete
areas, and each of the structures having a specific shape provided
on the four corners being different from one another with respect
to each of the plurality of discrete areas; and
[1493] detecting a sample hybridized with the probe.
[1494] 9. The method of analyzing a biological sample according to
paragraph 7 or 8, wherein the sample hybridized with the probe
reacts to a labeling probe labeling particles each having a
different particle diameter to an oligo probe hybridized with a
sequence portion complementary to and different from a DNA fragment
having been hybridized.
Twentieth Embodiment
[1495] 1. An analysis method by means of a biological sample
analysis chip comprising the steps of:
[1496] labeling by means of conductive microparticles a DNA
fragment hybridized with a probe of a biological sample analysis
chip with a different probe fixed on each area of a plurality of
areas discretely provided on a substrate thereof, a structure
having a specific shape being provided on each of the four corners
in the plurality of discrete areas, each of the structures having a
specific shape provided on the four corners being different from
one another with respect to each of the plurality of discrete
areas, and areas having as a unit a prespecified number of the
plurality of discrete areas being provided via a groove formed
between the areas; and
[1497] detecting the conductive microparticle with a scanning
electron microscope.
[1498] 2. The analysis method by means of a biological sample
analysis chip according to paragraph 1 further comprising the steps
of:
[1499] dropping a sample solution on the biological sample analysis
chip;
[1500] placing a thin plate or a rod rotating at a prespecified
speed on the top face of the biological sample analysis chip;
and
[1501] moving the plate or rod from side to side on the substrate
to accelerate hybridization between the probe and a sample in the
sample solution.
[1502] 3. An analysis method by means of a biological sample
analysis chip comprising the steps of:
[1503] labeling by means of conductive microparticles a DNA
fragment hybridized with a probe of a biological sample analysis
chip with a different probe fixed on each area of a plurality of
areas discretely provided on a substrate thereof, each of the
plurality of discrete areas having an area not more than that of a
circle 700 nm.phi. and not less than that of a circle 3 nm.phi.;
and
[1504] detecting the conductive microparticles with a scanning
electron microscope.
[1505] 4. An analysis method by means of a biological sample
analysis chip comprising the steps of:
[1506] labeling by means of conductive microparticles a DNA
fragment hybridized with a probe of a biological sample analysis
chip with a different probe fixed on each area of a plurality of
areas discretely provided on a substrate thereof, a structure
having a specific shape being provided on each of the four corners
in the plurality of discrete areas, and each of the structures
having a specific shape provided on the four corners being
different from one another with respect to each of the plurality of
discrete areas; and
[1507] detecting the conductive microparticles with a scanning
electron microscope.
Twenty-First Embodiment
[1508] 1. A DNA probe chip comprising:
[1509] a substrate;
[1510] an electrode formed on the substrate and having a plurality
of discrete probe fixing areas formed thereon; and
[1511] prespecified DNA probes each fixed on respective probe
fixing areas with covalent bonding,
[1512] wherein the DNA probe being configured to cause
hybridization with a complementary strand DNA from the terminus
side fixed onto the probe fixing area.
[1513] 2. A DNA probe chip comprising:
[1514] a substrate;
[1515] an electrode formed on the substrate and having a plurality
of discrete probe fixing areas formed thereon; and
[1516] prespecified DNA probes each fixed on respective probe
fixing areas with covalent bonding,
[1517] wherein a dissociative group having a negative charge on the
terminus different from that fixed on the probe fixing area being
added to each of the DNA probes.
[1518] 3. The DNA probe chip according to paragraph 1, wherein the
electrode with a plurality of discrete probes formed thereon is an
ITO electrode, and a water repellent surface coating is applied to
the area other than the probe fixing areas.
[1519] 4. The DNA probe chip according to paragraph 1, wherein an
electrode surface in the plurality of discrete probe fixing areas
is prepared by introducing a residue dissociating positive.
[1520] 5. The DNA probe chip according to paragraph 1, wherein the
DNA probe is a PNA whose main chain is composed with the peptide
bond, or a CAS having S-carboxymethyl-L-cysteine as a basic
skeleton.
[1521] 6. The DNA probe chip according to paragraph 1, wherein the
DNA probe is designed to have a sequence complementary to that
having a prespecified base length starting from an mRNA sequence
having a sequence to be hybridized with the DNA probe, and the DNA
probe is selected from an area in which the quantity of GC fixed
onto the plurality of discrete probe fixing areas on the terminus
side is higher than that on the free end side.
[1522] 7. The DNA probe chip according to paragraph 1, wherein the
DNA probe has a sequence complementary to that having a
prespecified base length starting from an mRNA sequence having a
sequence to be hybridized with the DNA probe, and the DNA probe has
a configuration in which, between the terminus side fixed onto the
plurality of discrete probe fixing areas and the free end side is
inserted a sequence mismatched with a sequence to be hybridized
with the DNA probe between the position about 10 bases and that
about 30 bases from the free end, or a blank sequence not forming a
stable complementary strand with any of ACGT.
[1523] 8. A method of controlling DNA hybridization comprising the
steps of:
[1524] adding a sample solution containing a target polynucleotide
to between a DNA probe chip comprising: a substrate; an electrode
with a plurality of discrete probe fixing areas formed on the
substrate formed thereon; and prespecified DNA probes each fixed on
respective probe fixing areas with covalent bonding, a dissociative
group having a negative charge on the terminus different from that
fixed on the probe fixing area being added to the DNA probe: and a
member provided opposing to a surface of the DNA probe chip;
[1525] applying prespecified electric field to between the
electrode and the sample solution site to condense the
polynucleotide in the proximity of the surface of the DNA probe
chip; and
[1526] inverting the electric field for applying to between the
electrode and the sample solution site to start hybridization in
the state where the probe is stretched.
[1527] 9. The method of controlling DNA hybridization according to
paragraph 7, wherein a DNA probe chip is employed in which the
electrode formed thereon a plurality of discrete probe is an ITO
electrode, and a water repellent surface coating is applied to the
area other than the probe fixing areas.
[1528] 10. The method of controlling DNA hybridization according to
paragraph 7, wherein a DNA probe chip is employed in which an
electrode surface in the plurality of discrete probe fixing areas
is prepared by introducing a residue dissociating positive.
[1529] 11. The method of controlling DNA hybridization according to
paragraph 7, wherein a DNA probe chip is employed in which the DNA
probe is a PNA whose main chain is composed with the peptide bond,
or a CAS having S-carboxymethyl-L-cysteine as a basic skeleton.
[1530] 12. A DNA probe chip comprising:
[1531] a substrate;
[1532] an electrode with a plurality of discrete probe fixing areas
formed on the substrate formed thereon; and
[1533] prespecified DNA probes each fixed on respective probe
fixing areas with covalent bonding,
[1534] wherein the DNA probe being configured to form more stable
hybridization on the terminus side fixed onto the probe fixing area
than on the free end side.
[1535] 13. The DNA probe chip according to paragraph 1, wherein the
DNA probe with one end thereof fixed on a substrate has a sequence
complementary to that having a prespecified base length starting
from an mRNA sequence having a sequence to be hybridized with the
DNA probe, and the DNA probe is selected from an area in which the
quantity of GC fixed onto the plurality of discrete probe fixing
areas on the terminus side is higher than that on the free end
side.
Twenty-Second Embodiment
[1536] 1. A DNA probe chip comprising: a substrate; an electrode
with a plurality of discrete probe fixing areas formed on the
substrate formed thereon; and prespecified DNA probes each fixed on
respective probe fixing areas with covalent bonding, the DNA probe
constituting at least three areas in the order viewed from the side
of the probe fixing area with the DNA probe fixed thereon: a first
area being a base sequence substantially complementary to a target
polynucleotide; a second area being a base sequence including a
base not forming the hydrogen bond complementary to any base among
ACGT in the target polynucleotide; and a third area being a base
sequence substantially complementary to the target polynucleotide
and having a base length thereof equal to or shorter than that of
the first area.
[1537] 2. The DNA probe chip according to paragraph 1, wherein the
second area includes at least one third or more base sequence
noncomplementary to a target polynucleotide.
[1538] 3. The DNA probe chip according to paragraph 1, wherein the
second area includes a base sequence capable of forming the
hydrogen bonding with a target polynucleotide, though unstable in
terms of energy as compared to AG or CT base pair.
[1539] 4. The DNA probe chip according to any of paragraphs 1 to 3,
wherein stability of hybridization with a target polynucleotide in
the first area, second area and third area declines in the order of
the first area, third area and second area.
[1540] 5. The DNA probe chip according to paragraph 1, wherein a
dissociative group having a negative charge on the terminus
different from that fixed on the probe fixing area is added to the
DNA probe.
[1541] 6. A method of controlling DNA hybridization comprising the
steps of:
[1542] adding a sample solution containing a target polynucleotide
to between: a DNA probe chip comprising: a substrate; an electrode
with a plurality of discrete probe fixing areas formed on the
substrate formed thereon; and prespecified DNA probes each fixed on
respective probe fixing areas with covalent bonding, the DNA probe
constituting at least three areas in the order viewed from the side
of the probe fixing area with the DNA probe fixed thereon, a first
area being a base sequence substantially complementary to a target
polynucleotide; a second area being a base sequence including a
base not forming the hydrogen bond complementary to any base among
ACGT in the target polynucleotide; and a third area being a base
sequence substantially complementary to the target polynucleotide
and having a base length thereof equal to or shorter than that of
the first area: and a member provided opposing to a surface of the
DNA probe chip;
[1543] applying prespecified voltage to between the electrode and
the sample solution site to condense the polynucleotide in the
proximity of a surface of the DNA probe chip; and
[1544] inverting electric field for applying to between the
electrode and the sample solution site to start hybridization in
the state where the probe is stretched.
Twenty-Third Embodiment
[1545] 1. A DNA probe chip comprising: a substrate; an electrode
with a plurality of discrete probe fixing areas formed on the
substrate formed thereon; and prespecified DNA probes each fixed
with covalent bonding on respective faces of a plurality of pillars
in array formed on the electrode face.
[1546] 2. A DNA hybridization chip having: a structure having probe
fixing areas each with a plurality of different DNA probes fixed on
the substrate; a structure in which pillars in array are present on
each of the probe fixing areas, and space between the pillars forms
a valley; a structure of an electrode forming each of the probe
fixing areas; and a structure with one end of the DNA probe fixed
on a surface of the pillar with covalent bonding.
[1547] 3. The DNA probe chip according to paragraph 1 or 2, wherein
the DNA probe constitutes at least 3 areas in the order viewed from
the pillar surface side with the DNA probe fixed thereon, a first
area being a base sequence substantially complementary to a target
polynucleotide; a second area being a base sequence including a
base not forming the hydrogen bond complementary to any base among
ACGT in the target polynucleotide; and a third area being a base
sequence substantially complementary to the target polynucleotide
with a base length thereof and having equal to or shorter than that
of the first area.
[1548] 4. The DNA probe chip according to paragraph 3, wherein the
second area includes at least one third or more base sequence
noncomplementary to a target polynucleotide.
[1549] 5. The DNA probe chip according to paragraph 4, wherein the
second area includes a base sequence capable of forming the
hydrogen bonding with a target polynucleotide, though unstable in
terms of energy as compared to AG or CT base pair.
[1550] 6. The DNA probe chip according to any of paragraphs 3 to 5,
wherein stability of hybridization with a target polynucleotide in
the first area, second area and third area declines in the order of
the first area, third area and second area.
[1551] 7. A method of controlling DNA hybridization comprising the
steps of:
[1552] adding a sample solution containing a target polynucleotide
to between: a DNA probe chip comprising: a substrate; an electrode
with a plurality of discrete probe fixing areas formed on the
substrate formed thereon; and prespecified DNA probes each fixed
with covalent bonding on respective faces of a plurality of pillars
in array formed on the electrode face: and member provided opposing
to a surface of the DNA probe chip;
[1553] applying prespecified voltage to between the electrode and
the sample solution site to condense the polynucleotide into a
valley of the pillar on a surface of on the DNA probe chip; and
[1554] inverting electric field applied to between the electrode
and the sample solution site to start hybridization of the target
polynucleotide with a probe on the surface of the pillar.
Twenty-Fourth Embodiment
[1555] 1. A DNA probe chip having a prespecified DNA probe fixed
onto a surface of each of the pillars with covalent bonding; a
multitude of the pillars being shaped like a cone, truncated cone,
or pyramid or truncated prism, and formed on a separate probe
fixing area on a substrate; and having an electrode in a valley of
the bottom face of each pillar.
[1556] 2. A DNA probe chip having a prespecified DNA probe fixed
onto a surface of each of wells with covalent bonding, a multitude
of the wells being shaped like a cone, truncated cone, or pyramid
or truncated prism, and formed on a separate probe fixing area on a
substrate; and having an electrode on the bottom face of each
well.
[1557] 3. A method of DNA hybridization comprising the steps
of:
[1558] adding a sample solution containing a target polynucleotide
to between: a DNA probe chip having a substrate forming a plurality
of pillars shaped like a cone, truncated cone, or pyramid or
truncated prism on a plurality of separate probe fixing areas
formed on the substrate, having an electrode in a valley formed
with each pillar, and also having a prespecified DNA probe fixed
onto a surface of each of the pillars with covalent bonding; and a
member provided opposing to a surface of the DNA probe chip;
[1559] applying prespecified electric field to between the
electrode and the sample solution site to condense the
polynucleotide into a valley of the pillar on a surface of the DNA
probe chip; and
[1560] inverting the electric field applied to between the
electrode and the sample solution site to conduct hybridization of
the target polynucleotide with a probe on a surface of the
pillar.
[1561] 4. A method of DNA hybridization comprising the steps
of:
[1562] adding a sample solution containing a target polynucleotide
to between: a DNA probe chip having a substrate, forming a
plurality of wells shaped like a cone, truncated cone, or pyramid
or truncated prism on a plurality of separate probe fixing areas
formed on the substrate configured to provide an electrode on the
bottom face of each well, and also having a prespecified DNA probe
fixed onto a surface of each of the wells with covalent bonding;
and a member provided opposing to a surface of the DNA probe
chip;
[1563] applying prespecified electric field to between the
electrode and the sample solution site to condense the
polynucleotide into a well on the DNA probe chip; and
[1564] inverting the electric field applied to between the
electrode and the sample solution site to conduct hybridization of
the target polynucleotide with a probe on a surface of the
pillar.
Twenty-Fifth Embodiment
[1565] 1. A biological sample labeling substance being particles
for labeling DNA or protein, and made of an alloy of at least two
types of transition metal or semiconductor.
[1566] 2. The biological sample labeling substance according to
paragraph 1, wherein each of the particles has a size in a range
from 10 nm.phi. to 50 nm.phi..
[1567] 3. The biological sample labeling substance according to
paragraph 1, wherein each of the particles has a size in a range
from 10 nm.phi. to 50 nm.phi.; and the ratio of elemental
composition of the alloy constituting the particles varies, thereby
enabling the particles to be classified into a number of different
labeling substances in combination with the size thereof.
[1568] 4. A biological sample labeling substance, being particles
for labeling DNA, made of an alloy of at least two types of metal
or semiconductor alloy, being a set of particles each having a
varied ratio of elemental composition of the alloy, and used by
one-to-one correspondence with respect to each sequence of a DNA
probe.
[1569] 5. A biological sample labeling substance, being particles
for labeling DNA, made of an alloy of at least two types of metal
or semiconductor alloy, being a set of particles each having a
varied ratio of elemental composition of the alloy, being used by
one-to-one correspondence with respect to an antigen reactive to a
prespecified epitope.
[1570] 6. A method of labeling a biological substance comprising
the step of: labeling a biological substance capable of bonding to
a biological sample fixed onto a substrate with particles made of
an alloy of at least two types of transition metal or
semiconductor.
[1571] 7. A method of testing a biological substance comprising the
steps of:
[1572] fixing a biological sample on a substrate;
[1573] labeling a biological substance capable of bonding to the
biological sample with particles made of an alloy of at least two
types of transition metal or semiconductor;
[1574] subjecting the biological substance labeled with the alloy
particles to a reaction with the biological sample; and
[1575] conducting elemental analysis with respect to each of the
alloy particles labeling the biological substance bonding to the
biological sample on the substrate.
[1576] 8. A method of testing a biological substance comprising the
steps of:
[1577] fixing a biological sample on a substrate;
[1578] labeling a biological substance capable of bonding to the
biological sample with particles made of an alloy of at least two
types of transition metal or semiconductor;
[1579] subjecting the biological substance labeled with the alloy
particles to a reaction with the biological sample;
[1580] scanning the alloy particles labeling the biological
substance bonding to the biological sample on the substrate by
means of electron beams of a scanning electron microscope for
measuring an energy distribution of secondary electron beams
derived from a specific element to identify the position and size
of the particles; and
[1581] detecting characteristic X-ray radiated by the particles
subjected to the electron beam scanning with a energy dispersive
characteristic X-ray detector to obtain the result of elemental
analysis.
[1582] 9. The biological sample labeling substance according to any
of paragraphs 1 to 5, wherein the metal or semiconductor is any of
transition metal with the atomic number up to 79 other than 43 in
the periodic table, metal with the atomic number 13, 31, 32, 49,
50, 51, 81, 82 and 83, and semiconductor with the atomic number 14,
33, 34 and 52.
[1583] 10. The method of labeling a biological substance according
to paragraph 6 to paragraph 7, wherein the metal or semiconductor
is any of transition metal with the atomic number up to 79 other
than 43 in the periodic table, metal with the atomic number 13, 31,
32, 49, 50, 51, 81, 82 and 83, and semiconductor with the atomic
number 14, 33, 34 and 52.
[1584] 11. The method of testing a biological substance according
to paragraph 8, wherein the metal or semiconductor is any of
transition metal with the atomic number up to 79 other than 43 in
the periodic table, metal with the atomic number 13, 31, 32, 49,
50, 51, 81, 82 and 83, and semiconductor with the atomic number 14,
33, 34 and 52.
Twenty-Sixth Embodiment
[1585] 1. A method of testing a biological substance comprising the
steps of:
[1586] obtaining a secondary electron by scanning with electron
beams a plurality of particles with a plurality of elements
contained therein to obtain an electron beam scanning line image of
the particles from the obtained secondary electron;
[1587] obtaining an elemental analysis image from the secondary
electron obtained by scanning with electron beams a plurality of
particles with a plurality of elements contained therein, based on
X-ray at a specific wavelength depending on composition element of
the particles;
[1588] comparing the electron beam scanning image and the elemental
analysis image to identify each of the plurality of particles and a
position thereof.
[1589] 2. A biological sample labeling substance using particles
with a plurality of elements contained therein as particles for
labeling DNA or protein, the plurality of elements being at least
two types of transition metal or semiconductor.
[1590] 3. The biological sample labeling substance according to
paragraph 2, wherein each of the particles has a size in a range
from 10 nm.phi. to 50 nm.phi..
[1591] 4. The biological sample labeling substance according to
paragraph 2, wherein each of the particle has a size in a range
from 10 nm.phi. to 50 nm.phi., the ratio of element composition of
the alloy constituting the particles varies, thereby enabling
particles to be classified into a number of different labeling
substances in combination with the size thereof.
[1592] 5. A biological sample labeling substance having particles
for labeling DNA, the particles containing at least two types of
transition metal or semiconductor, having a varied ratio of the
element composition, and used by one-to-one correspondence with
respect to each sequence of a DNA probe.
[1593] 6. A biological sample labeling substance having particles
for labeling DNA, the particles containing at least two types of
transition metal or semiconductor, having a varied ratio of the
element composition, and used by one-to-one with respect to each
sequence of a specific epitope.
[1594] 7. A method of labeling a biological substance, a biological
substance capable of bonding a biological sample fixed on a
substrate being labeled with particles containing at least two
types of transition metal or semiconductor.
[1595] 8. A method of testing a biological substance comprising the
steps of:
[1596] fixing a biological sample on a substrate;
[1597] labeling a biological substance capable of bonding the
biological sample with particles containing at least two types of
transition metal or semiconductor;
[1598] subjecting the biological substance labeled with the alloy
particles to a reaction with the biological sample; and
[1599] conducting elemental analysis of the particles labeling the
biological substance bonded to the biological sample on the
substrate with respect to each particle.
[1600] 9. A method of testing a biological substance comprising the
steps of:
[1601] fixing a biological sample on a substrate;
[1602] labeling a biological substance capable of bonding the
biological sample with particles containing at least two types of
transition metal or semiconductor;
[1603] subjecting the biological substance labeled with the alloy
particles to a reaction with the biological sample;
[1604] scanning the particles labeling the biological substance
bonded to the biological sample on the substrate with electron
beams of a scanning electron microscope for measuring an energy
distribution of a secondary electron beam derived from a specific
element to identify the position and size of the particles; and
[1605] detecting characteristic X-ray generated by the particles
scanned with the electron beams utilizing an energy dispersive
characteristic X-ray spectrometer to obtain the result of elemental
analysis.
[1606] 10. The biological sample labeled substance according to any
of paragraphs 2 to 6, wherein the metal or semiconductor is any of
transition metal with the atomic number up to 79 other than 43 in
the periodic table, metal with the atomic number 13, 31, 32, 49,
50, 51, 81, 82 and 83, and semiconductor with the atomic number 14,
33, 34 and 52.
[1607] 11. The method of labeling a biological substance according
to paragraph 7 or paragraph 8, wherein the metal or semiconductor
is any of transition metal with the atomic number up to 79 other
than 43 in the periodic table, metal with the atomic number 13, 31,
32, 49, 50, 51, 81, 82 and 83, and semiconductor with the atomic
number 14, 33, 34 and 52.
[1608] 12. The method of testing a biological substance according
to paragraph 9, wherein the metal or semiconductor is any of
transition metal with the atomic number up to 79 other than 43 in
the periodic table, metal with the atomic number 13, 31, 32, 49,
50, 51, 81, 82 and 83, and semiconductor with the atomic number 14,
33, 34 and 52.
[1609] 13. Particles for testing a biological substance, the
particles having a prespecified size, including a mixture of at
least two types of transition metal or semiconductor, and having a
surface thereof with a probe having a base sequence complementarily
bonded to a biological sample to be detected fixed thereon.
[1610] 14. The particles for testing a biological substance
according to paragraph 13, wherein different probes are fixed onto
each of a plurality of the particles having different ratio of
elemental composition respectively.
[1611] 15. The particles for testing a biological substance
according to paragraph 13 or paragraph 14, wherein the size of the
particles is in a range from 0.5 .mu.m to 5 .mu.mm.
[1612] 16. The particles for testing a biological substance
according to paragraph 14, wherein each of a plurality of the
particles is in one-to-one correspondence with respect to an
antibody reactive to a specific epitope in a biological sample.
[1613] 17. A method of testing a biological substance comprising
the steps of:
[1614] labeling, with respect to each of a plurality of particles
having different ratio of elemental composition composed of a
prespecified size of a particle including a mixture of at least two
types of transition metal or semiconductor, a first group of
particles fixed in one-to-one correspondence to various types of
ligands having affinity to different biological substance depending
on each of the particles, and the biological substance with a
second group of particles to complementarily bond each ligand;
[1615] scanning each particle of the first group of particles with
electron beams to obtain an electron beam scanning line image of
the particles from the obtained secondary electron;
[1616] obtaining an elemental analysis image from the secondary
electron obtained by scanning the first group of particles with
electron beams, based on X-ray at a specific wavelength depending
on composition element of the particles;
[1617] comparing the electron beam scanning image and the elemental
analysis image to identify each of the first group of particles and
a position thereof; and
[1618] counting the number of the second group of particles to
evaluate the quantity of the biological substance being in the
state of ligand to each of the first group of a plurality of
particles.
[1619] 18. Particles for testing a biological substance according
to paragraph 13, wherein a plurality types of elements used for a
prespecified size of the particles including a mixture of at least
two types of transition metal or semiconductor are any of Sc, Ti,
Ga, Ge, Y, Zr, Nb, Ru, Rh, Pd, Ag, Cd, In, Sb, La, Ce, Pr, Nd, Sm,
Eu, Gd, Tb, Dy, Ho, Er, Tm, Yb, Lu, Hf, Ta, W, Re, Os, Ir, Pt, Au,
Tl, Bi and Th.
[1620] 19. A method of testing a biological substance comprising
the steps of:
[1621] labeling, with respect to each of a plurality of particles
having different ratio of elemental composition composed of a
prespecified size of particles including a mixture of at least two
types of transition metal or semiconductor, a first group of
particles fixed in one-to-one correspondence to various types of
ligands having affinity to different biological substance depending
on each of the particles, and the biological substance with a
second group of particles to complementarily bond each ligand to
thereby remove the biological substance together with the first
group of particles;
[1622] labeling, with respect to each of a plurality of particles
having different ratio of elemental composition of a prespecified
size of particles including a mixture of at least two types of
transition metal or semiconductor, a second group of particles
fixed in one-to-one correspondence to various types of ligands
having affinity to biological substances different from the various
types of ligands having affinity to biological substances for the
first group of particles, and the biological substance with a third
group of particles to complementarily bond each ligand;
[1623] scanning each particle of the first group of particles with
electron beams to obtain an electron beam scanning image of the
particles from the obtained secondary electron;
[1624] obtaining an elemental analysis image from the secondary
electron obtained by scanning the second group of particles with
electron beams, based on X-ray at a specific wavelength depending
on composition element of the particles;
[1625] comparing the electron beam scanning image and the elemental
analysis image to identify each of the second group of a plurality
of particles and a position thereof; and
[1626] counting the number of the third group of particles to
evaluate the quantity of the biological substance being in the
state of ligand to each of the second group of a plurality of
particles.
Twenty-Seventh Embodiment
[1627] 1. A method of collecting an electrophoretic separated
substance comprising the steps of:
[1628] irradiating convergence light to a specific electrophoretic
separation band portion of the electrophoretic separation band
developed on heat-melting gel; and
[1629] melting the electrophoretic separation band portion to
collect the same.
[1630] 2. A device for collecting an electrophoretic separated
substance comprising: a means for holding an electrophoretic
separation gel substrate having a electrophoretic separation band
developed on heat-melting gel; a means for detecting a specific
electrophoretic separation band portion of the electrophoretic
separation band; a means for irradiating convergence light to the
detected electrophoretic separation band portion to heat the same;
and a means for sucking gel melted by the heating.
[1631] 3. The device for collecting an electrophoretic separated
substance according to paragraph 2, wherein the means for holding
an electrophoretic separation gel substrate holds a means for
regulating temperature.
[1632] 4. The device for collecting an electrophoretic separated
substance according to paragraph 2, wherein the means for sucking
gel melted by the heating is provided with a means for accessing a
pipet and a specific electrophoretic separation band portion with
the pipet melted thereon.
[1633] 5. The device for collecting an electrophoretic separated
substance according to paragraph 2, wherein the heat-melting gel
contains agarose in a quantity at least sufficient to maintain a
gel structure thereof.
[1634] 6. The device for collecting an electrophoretic separated
substance according to paragraph 2, wherein the melting point of
agarose for the heat-melting gel is 60.degree. C. or below.
[1635] 7. A heat-melting gel substrate applied to a method of
collecting an electrophoretic separated substance comprising the
steps of: irradiating convergence light to a specific
electrophoretic separation band portion of the electrophoretic
separation band developed on heat-melting gel; and melting the
electrophoretic separation band portion to collect the same, the
heat-melting gel being fixed onto a glass substrate with a
thickness of the heat-melting gel not less than 0.02 mm nor more
than 0.2 mm.
[1636] 8. A device for collecting an electrophoretic separated
substance configured to have the means for sucking gel melted by
heating capable of impressing electric field with a pipet with a
first electrode attached to the inside thereof between the first
electrode and another electrode provided in a vessel outside.
[1637] 9. A method of collecting an electrophoretic separated
substance comprising the steps of:
[1638] filling the pipet with an electrolysis solution in
advance;
[1639] sucking gel melted by convergence light;
[1640] lowering the temperature of the gel sucked in the pipet to
turn the same into gel again;
[1641] contacting a pipet chip tip section with a vessel filled
with an electrolysis solution;
[1642] impressing electric field between a first electrode
contacting the electrolysis solution in the pipet and a second
electrode in the vessel, taking the second electrode as positive
pole, to subject an electrophoretic separated substance contained
in the gel solidifying in the pipet chip to electrophoresis to
elute the same in the electrolysis solution in the vessel.
Twenty-Eighth Embodiment
[1643] 1. A cell crushing device comprising: a substrate for
holding a droplet including a prespecified cell on a surface
thereof; and an optical system for irradiating convergence light
including a band absorbed by the cell to the droplet.
[1644] 2. The cell crushing device according to paragraph 1,
wherein the substrate for holding a droplet including a
prespecified cell in a hydrophilic area thereof is configured to
have a hydrophilic area surrounded by a water-repellent area and
having a range smaller than the size of the droplet.
[1645] 3. A cell crushing device comprising: a pipet capable of
holding a solution with a plurality of cells included therein, and
having a tip opening in a diameter suited for a prespecified size
of a cell or a cell mass to pass therethrough; a means for
observing a cell on the pipet tip; a means for pressing out the
solution including a plurality of cells on the pipet tip section
from the inside of the pipet to form a droplet; a means for
determining the formation of a droplet including a prespecified
cell and having a prespecified size; a unit for dropping the
droplet formed on the pipet chip section to a prespecified position
on the substrate; and an optical system irradiating convergence
light including a band absorbed by the cell to the droplet.
[1646] 4. A method of crushing a cell comprising the steps of:
[1647] holding a droplet including a cell in a hydrophilic area on
a substrate, the hydrophilic area surrounded by a water repellent
area and having an area smaller than the size of the cell; and
[1648] irradiating convergence light including a band optically
absorbed by a cell in the droplet.
Twenty-Ninth Embodiment
[1649] 1. A high speed trace quantity reactor comprising: a means
for transferring droplets each containing different reaction
precursors respectively to collide to one another; and a detecting
means for tracking reaction of the collided droplets.
[1650] 2. A high speed trace quantity reactor comprising: a means
for transferring droplets each containing different reaction
precursors respectively to collide to one another; a means for
stirring the collided droplets; and a detecting means for tracking
reaction of the collided droplets.
[1651] 3. A method of trace quantity reaction comprising the steps
of:
[1652] dissolving a plurality of reaction precursors targeted to be
reacted, in respective different droplets;
[1653] putting each of the droplets in different positions on a
substrate; and
[1654] making each of the droplets collide to one another on the
substrate to cause reactions.
[1655] 4. A method of trace quantity reaction comprising the steps
of:
[1656] putting each of a droplet with a cell inserted therein and a
droplet including a heterologous cell active substance in different
positions on a substrate; and
[1657] making each of the droplets collide to one another on the
substrate to observe effects on the cell.
Thirtieth Embodiment
[1658] 1. An absorption spectroscopy system comprising: a means for
forming a droplet containing solute on a substrate; a means for
transferring the droplet as crossing a beam of light; a source of
the beam of light; and a light detector for detecting a signal
obtained when the droplet crosses the beam of light.
[1659] 2. An absorption spectroscopy system comprising: a means for
forming a droplet containing solute on a substrate; a means for
focusing a beam of light on the droplet; and a light detector for
detecting intensity of light passing through the droplet.
[1660] 3. A fluorescence spectroscopy system comprising: a means
for forming a droplet containing solute on a substrate; a means for
transferring the droplet as crossing a beam of light; a source of
the beam of light; and a light detector for detecting a signal
obtained when the droplet crosses the beam of light.
[1661] 4. An absorption spectroscopy system comprising: a substrate
with hydrophilic patterns for holding a droplet on a water
repellent face provided thereon; a means for transferring the
droplet formed on the substrate as the droplet crosses a beam of
light on the hydrophilic patterns; a source of the beam of light; a
light detector for detecting a signal obtained when the droplet
crosses the beam of light; a measuring means for measuring the size
of the droplet transferring as crossing the beam of light on the
hydrophilic patterns; and a computing device for computing the
light path length based on the measured size of the droplet.
[1662] 5. An spectroscopy system comprising: an absorption
spectroscopy system comprising; a substrate with hydrophilic
patterns for holding a droplet on a water repellent face provided
thereon, a means for transferring the droplet formed on the
substrate utilizing a surface acoustic wave as the droplet crosses
a beam of light on the hydrophilic patterns, a source of the beam
of light, and a light detector for detecting a signal obtained when
the droplet crosses the beam of light; and a computing device for
estimating the size of the droplet by a temporal change of a
position of the droplet to compute the light path length.
[1663] 6. The spectroscopy system according to paragraph 5, wherein
a means for generating the surface acoustic wave is a piezoelectric
substrate provided in a droplet transfer path, and a comb-shaped
electrode made of lithium tetraborate or lithium tantarate or
lithium niobate.
[1664] 7. The absorption spectroscopy system according to paragraph
4, wherein the substrate is equipped with a temperature control
plate contacting thereto.
[1665] 8. A spectroscopic method comprising the steps of:
[1666] providing a droplet on a line of a substrate with
hydrophilic line patterns for holding a droplet on a water
repellent face provided thereon;
[1667] transferring the droplet along the hydrophilic line
patterns; detecting a signal including information on the droplet
obtained when the droplet is transferred as crossing a beam of
light irradiated from a light source; measuring the size of the
droplet from the signal; computing the light path length of the
light passing through the droplet based on the seize of the
measured droplet; and
[1668] measuring light absorption or fluorescence of the
droplet.
[1669] 9. The spectroscopy system for measuring light absorption or
fluorescence of a droplet according to paragraph 5, wherein the
hydrophilic line patterns have a pattern with a plurality of
hydrophilic lines converge thereon, and each droplet held on a
plurality of the hydrophilic lines are mixed at a convergent point
of the pattern.
[1670] 10. The spectroscopic method for measuring light absorption
or fluorescence of a droplet according to paragraph 6, wherein the
hydrophilic line patterns have a pattern with a plurality of
hydrophilic lines converge thereon, have another convergent point
downstream of the convergent point described above, and have
patterns allowing a plurality of times of time-series mixing at a
convergent point of each of the droplets held in the plurality of
hydrophilic lines.
Sequence CWU 1
1
18122DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 1ctgagcgagt gagaacctac tg
22220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 2agccacatca gctatgtcca 20323DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 3gtatgagaag gctgagataa agg 23424DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 4agctgcttat attttgagta cagg 24530RNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 5agcaucgagu cggccuuguu ggccuacugg
30621DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 6agcatcgagt cggccttgtt g
21723DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 7aagccacatc agctatgtcc aca
23824DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 8aaggaacagt gatgcatgta gatt
24950RNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 9aaaaucuucu ucuaugacuc agagaauccu
ccugcaucag aggugcuucg 501050DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 10cgaagcacct
ctgatgcagg aggattctct gagtcataga agaagatttt 501190DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 11aaaaaaaaaa aaaaaaaaaa aaaatcttct tctatgactc
agagaatcct cctgcatcag 60aggtgcttcg aaaaaaaaaa aaaaaaaaaa
901250DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 12agaatcctcc tgcatcagag gtgcttcgaa
tccagaacat tctaacagaa 501350DNAArtificial SequenceDescription of
Artificial Sequence Synthetic oligonucleotide 13agaatcctcc
tgcatcagag gtgbttbgaa tccagaacat tctaacagaa 501489DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 14taatacgact cactataggg agacaannnn nnnnnnnnnn
nnnnnnnnnn nnnnnnnnnn 60nnnnnnttcg acaggaggct cacaacagg
89158PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 15Arg Arg Arg Arg Arg Arg Arg Arg1
51623DNAArtificial SequenceDescription of Artificial Sequence
Synthetic oligonucleotide 16aagccacatc agctatgtcc aca
23176PRTArtificial SequenceDescription of Artificial Sequence
Synthetic peptide 17Arg Arg Arg Arg Arg Arg1 51830DNAArtificial
SequenceDescription of Artificial Sequence Synthetic
oligonucleotide 18tttttttttt tttttttttt tttttttttt 30
* * * * *
References