U.S. patent application number 12/493140 was filed with the patent office on 2010-01-21 for compound and method for treating myotonic dystrophy.
This patent application is currently assigned to AVI BioPharma, Inc.. Invention is credited to Ryszard Kole, Hong M. Moulton.
Application Number | 20100016215 12/493140 |
Document ID | / |
Family ID | 41530816 |
Filed Date | 2010-01-21 |
United States Patent
Application |
20100016215 |
Kind Code |
A1 |
Moulton; Hong M. ; et
al. |
January 21, 2010 |
COMPOUND AND METHOD FOR TREATING MYOTONIC DYSTROPHY
Abstract
An antisense compound for use in treating myotonic dystrophy DM1
or DM2, a method of enhancing antisense targeting to heart and
quadricep muscles, and a method for treating DM1 or DM2 in a
mammalian subject are disclosed. The oligonucleotide has 8-30
bases, with at least 8 contiguous bases being complementary to the
polyCUG or polyCCUG repeats in the 3'UTR region of dystrophia
myotonica protein kinase (DMPK) mRNA in DM1 or DM2, respectively.
Conjugated to the oligonucleotide is a cell-penetrating peptide
having the sequence (RXRR(B/X)R).sub.2XB, where R is arginine; B is
.beta.-alanine; and each X is --C(O)--(CH.sub.2).sub.n--NH--, where
n is 4-6. The antisense compound is effective to selectively block
the sequestration of muscleblind-like 1 protein (MBNL1) and/or
CUGBP, in heart and quadricep muscle in a myotonic dystrophy animal
model.
Inventors: |
Moulton; Hong M.;
(Corvallis, OR) ; Kole; Ryszard; (Corvallis,
OR) |
Correspondence
Address: |
King & Spalding LLP
P.O. Box 889
Belmont
CA
94002-0889
US
|
Assignee: |
AVI BioPharma, Inc.
Corvallis
OR
|
Family ID: |
41530816 |
Appl. No.: |
12/493140 |
Filed: |
June 26, 2009 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
12217040 |
Jun 30, 2008 |
|
|
|
12493140 |
|
|
|
|
60937725 |
Jun 29, 2007 |
|
|
|
Current U.S.
Class: |
514/1.1 ;
530/322 |
Current CPC
Class: |
C12N 15/113 20130101;
A61P 21/00 20180101; C12N 2310/11 20130101; C12N 2810/40 20130101;
C12N 15/87 20130101; C07K 2319/33 20130101; A61K 31/7088 20130101;
A61K 47/64 20170801 |
Class at
Publication: |
514/7 ; 530/322;
514/8 |
International
Class: |
A61K 38/14 20060101
A61K038/14; C07K 9/00 20060101 C07K009/00; A61P 21/00 20060101
A61P021/00 |
Claims
1. An antisense compound for use in treating myotonic dystrophy DM1
or DM2, comprising an antisense oligonucleotide having 8-30 bases,
with at least 8 contiguous bases being complementary to the polyCUG
or polyCCUG repeats in the 3'UTR region of dystrophia myotonica
protein kinase (DMPK) mRNA in DM1 or DM2, respectively, and
conjugated to the oligonucleotide, a cell-penetrating peptide
having the sequence (RXRR(B/X)R).sub.2XB, where R is arginine; B is
.beta.-alanine; and each X is --C(O)--(CH.sub.2).sub.n--NH--, where
n is 4-6. where the compound is effective to selectively block the
sequestration of at least one of muscleblind-like 1 protein (MBNL1)
and CUGBP in heart and quadricep muscle in a myotonic dystrophy
animal model.
2. The antisense compound of claim 1, wherein the cell penetrating
peptide has the form (RXRRBR).sub.2XB and X is
--C(O)--(CH.sub.2).sub.6--NH--,
3. The antisense compound of claim 2, wherein the oligonucleotide
is a phosphorodiamidate oligonucleotide (PMO) having between 12-30
bases, and at least 12 contiguous bases that are complementary to
the polyCUG repeats in the 3'UTR region of dystrophia myotonica
protein kinase (DMPK) mRNA in DM1.
4. The antisense compound of claim 2, 2, wherein the
oligonucleotide is a phosphorodiamidate oligonucleotide (PMO)
having between 12-30 bases, and at least 12 contiguous bases that
are complementary to the polyCCUG repeats in the 3'UTR region of
dystrophia myotonica protein kinase (DMPK) mRNA in DM2.
5. The antisense compound of claim 1, wherein the cell penetrating
peptide has the form (RXRRXR).sub.2XB and X is
--C(O)--(CH.sub.2).sub.6--NH--.
6. The antisense compound of claim 5, wherein the oligonucleotide
is a phosphorodiamidate oligonucleotide (PMO) having between 12-30
bases, and at least 12 contiguous bases that are complementary to
the polyCUG repeats in the 3'UTR region of dystrophia myotonica
protein kinase (DMPK) mRNA in DM1.
7. The antisense compound of claim 5, wherein the oligonucleotide
is a phosphorodiamidate oligonucleotide (PMO) having between 12-30
bases, and at least 12 contiguous bases that are complementary to
the polyCCUG repeats in the 3'UTR region of dystrophia myotonica
protein kinase (DMPK) mRNA in DM2.
8. A method of targeting a systemically administered antisense
oligonucleotide to heart muscle tissue in a mammalian subject,
where the oligonucleotide is directed against the polyCUG or
polyCCUG repeats in the 3'UTR region of dystrophia myotonica
protein kinase (DMPK) mRNA in DM1 or DM2, respectively, comprising
conjugating to the oligonucleotide, a cell-penetrating peptide
having the sequence (RXRR(B/X)R).sub.2XB, where R is arginine; B is
.beta.-alanine; and each X is independently a neutral linear amino
acid --C(O)--(CH.sub.2).sub.n--NH--, where n is 4-6.
9. The method of claim 8, wherein the selective targeting of the
oligonucleotide to heart and quadracep muscle is evidenced by the
reversal of sequestration of muscleblind-like 1 protein (MBNL1) in
the heart and quadricep muscle tissue in a PMO-treated animal model
having known MBNL1 sequestration.
10. The method of claim 8, wherein the cell penetrating peptide has
the form (RXRRBR).sub.2XB and X is
--C(O)--(CH.sub.2).sub.6--NH--.
11. The method of claim 10, wherein the oligonucleotide is a
phosphorodiamidate oligonucleotide (PMO) having between 12-30
bases, and at least 12 contiguous bases that are complementary to
(i) the polyCUG repeats in the 3'UTR region of dystrophia myotonica
protein kinase (DMPK) mRNA in DM1, or (ii) the polyCCUG repeats in
the 3'UTR region of dystrophia myotonica protein kinase (DMPK) mRNA
in DM2.
12. The method of claim 8, wherein the cell penetrating peptide has
the form (RXRRXR).sub.2XB and X is
--C(O)--(CH.sub.2).sub.6--NH--.
13. The method of claim 12, wherein the oligonucleotide is a
phosphorodiamidate oligonucleotide (PMO) having between 12-30
bases, and at least 12 contiguous bases that are complementary to
(i) the polyCUG repeats in the 3'UTR region of dystrophia myotonica
protein kinase (DMPK) mRNA in DM1, or (ii) the polyCCUG repeats in
the 3'UTR region of dystrophia myotonica protein kinase (DMPK) mRNA
in DM2.
14. A method of treating mytonic dystrophy DM1 or DM2 in a
mammalian subject, comprising administering to the subject, an
antisense compound comprising an antisense oligonucleotide having
8-30 bases, with at least 8 contiguous bases being complementary to
the polyCUG or polyCCUG repeats in the 3'UTR region of dystrophia
myotonica protein kinase (DMPK) mRNA in DM1 or DM2, respectively,
and conjugated to the oligonucleotide, a cell-penetrating peptide
having the sequence (RXRR(B/X)R).sub.2XB, where R is arginine; B is
.beta.-alanine; and each X is --C(O)--(CH.sub.2).sub.n--NH--, where
n is 4-6, and repeating said administering at least once every one
week to 3 months.
15. The method of claim 14, for treating DM1 in a mammalian
subject, wherein the cell penetrating peptide has the form
(RXRRBR).sub.2XB, X is --C(O)--(CH.sub.2).sub.6--NH--, and the
oligonucleotide is a phosphorodiamidate oligonucleotide (PMO)
having between 12-30 bases, and at least 12 contiguous bases that
are complementary to the polyCUG repeats in the 3'UTR region of
dystrophia myotonica protein kinase (DMPK) mRNA in DM1.
16. The method of claim 14, for treating DM2 in a mammalian
subject, wherein the cell penetrating peptide has the form
(RXRRBR).sub.2XB, X is --C(O)--(CH.sub.2).sub.6--NH--, and the
oligonucleotide is a phosphorodiamidate oligonucleotide (PMO)
having between 12-30 bases, and at least 12 contiguous bases that
are complementary to the polyCCUG repeats in the 3'UTR region of
dystrophia myotonica protein kinase (DMPK) mRNA in DM2.
17. The method of claim 14, for treating DM1 in a mammalian
subject, wherein the cell penetrating peptide has the form
(RXRRXR).sub.2XB, X is --C(O)--(CH.sub.2).sub.6--NH--, and the
oligonucleotide is a phosphorodiamidate oligonucleotide (PMO)
having between 12-30 bases, and at least 12 contiguous bases that
are complementary to the polyCUG repeats in the 3'UTR region of
dystrophia myotonica protein kinase (DMPK) mRNA in DM1.
18. The method of claim 14, for treating DM2 in a mammalian
subject, wherein the cell penetrating peptide has the form
(RXRRXR).sub.2XB, X is --C(O)--(CH.sub.2).sub.6--NH--, and the
oligonucleotide is a phosphorodiamidate oligonucleotide (PMO)
having between 12-30 bases, and at least 12 contiguous bases that
are complementary to the polyCCUG repeats in the 3'UTR region of
dystrophia myotonica protein kinase (DMPK) mRNA in DM2.
19. The method of claim 14, wherein said administering is by
intravenous or subcutaneous injection to the subject, at a dose
between 1-5 mg/kg body weight antisense compound.
20. The method of claim 14, wherein said administering is repeated
repeating step is continued at regular intervals of every one to
three months, and further includes monitoring the patient during
the treatment period for improvement in skeletal or heart muscle
performance.
21. The method of claim 14, wherein said administering is repeated
repeating step is continued at regular intervals of every one to
three months, and further includes monitoring the patient during
the treatment period for improvement in heart conduction
properties.
22. The method of claim 20, wherein said administering is repeated
repeating step is continued at regular intervals of every one to
three months, and further includes monitoring the patient during
the treatment period for reduction in serum creatine kinase.
Description
[0001] This application claims priority to U.S. provisional
application Ser. No. 60/937,725, filed Jun. 29, 2007, and to U.S.
patent application Ser. No. 12/217,040, filed Jun. 30, 2008, both
of which are incorporated by reference herein in their
entirety.
FIELD OF THE INVENTION
[0002] The invention relates to an antisense compound and method
for treating myotonic dystrophy DM1 and DM2.
REFERENCES
[0003] Abes, S., H. M. Moulton et al. (2006). "Vectorization of
morpholino oligomers by the (R-Ahx-R).sub.4 peptide allows
efficient splicing correction in the absence of endosomolytic
agents." J Control Release 116(3): 304-13.
[0004] Arap, W. et al. (2004). "Human and mouse targeting peptides
identified by phage display." U.S. Appn. Pubn. No. 20040170955.
[0005] Behlke, M. A. (2006). "Progress towards in vivo use of
siRNAs." Mol Ther 13(4): 644-70.
[0006] Alter, J., F. Lou et al. (2006). "Systemic delivery of
morpholino oligonucleotide restores dystrophin expression bodywide
and improves dystrophic pathology." Nat Med 12(2): 175-7.
[0007] Chen, C. P., L. R. Zhang et al. (2003). "A concise method
for the preparation of peptide and arginine-rich peptide-conjugated
antisense oligonucleotide." Bioconjug Chem 14(3): 532-8.
[0008] Gebski, B. L., C. J. Mann et al. (2003). "Morpholino
antisense oligonucleotide induced dystrophin exon 23 skipping in
mdx mouse muscle." Hum Mol Genet 12(15): 1801-11.
[0009] Jearawiriyapaisarn, Moulton et al. (2008). "Sustained
Dystrophin Expression Induced by Peptide-conjugated Morpholino
Oligomers in the Muscles of mdx Mice." Mol Therapy, Jun. 10, 2008
(advance online publication).
[0010] Kang, S. H., M. J. Cho et al. (1998). "Up-regulation of
luciferase gene expression with antisense oligonucleotides:
implications and applications in functional assay development."
Biochemistry 37(18): 6235-9.
[0011] Kolonin, M. G., J. Sun et al. (2006). "Synchronous selection
of homing peptides for multiple tissues by in vivo phage display."
FASEB J 20(7): 979-81.
[0012] Meade, B. R. and S. F. Dowdy (2007). "Exogenous siRNA
delivery using peptide transduction domains/cell penetrating
peptides." Adv Drug Deliv Rev 59(2-3): 134-40.
[0013] Richard, J. P., K. Melikov et al. (2003). "Cell-penetrating
peptides. A reevaluation of the mechanism of cellular uptake." J
Biol Chem 278(1): 585-90.
[0014] Rothbard, J. B., E. Kreider et al. (2002). "Arginine-rich
molecular transporters for drug delivery: role of backbone spacing
in cellular uptake." J Med Chem 45(17): 3612-8.
[0015] Samoylova, T. I. and B. F. Smith (1999). "Elucidation of
muscle-binding peptides by phage display screening." Muscle Nerve
22(4): 460-6.
[0016] Sazani, P., F. Gemignani et al. (2002). "Systemically
delivered antisense oligomers upregulate gene expression in mouse
tissues." Nat Biotechnol 20(12): 1228-33.
[0017] Sontheimer, E. J. (2005). "Assembly and function of RNA
silencing complexes." Nat Rev Mol Cell Biol 6(2): 127-38.
[0018] Vodyanoy, V. et al. (2003). "Ligand sensor devices and uses
thereof." U.S. Appn. Pubn. No. 20030640466.
[0019] Wu, R. P., D. S. Youngblood et al. (2007). "Cell-penetrating
peptides as transporters for morpholino oligomers: effects of amino
acid composition on intracellular delivery and cytotoxicity."
Nucleic Acids Res. 35(15):5182-91. (Epub 2007 Aug 1.)
[0020] Youngblood, D. S., S. A. Hatlevig et al. (2007). "Stability
of cell-penetrating peptide-morpholino oligomer conjugates in human
serum and in cells." Bioconjug Chem 18(1): 50-60.
BACKGROUND OF THE INVENTION
[0021] The practical utility of many drugs having potentially
useful biological activity is often hindered by problems in
delivering such drugs to their targets. The delivery of drugs and
other compounds into cells generally occurs from an aqueous
cellular environment and entails penetration of a lipophilic cell
membrane to gain cell entry.
[0022] Oligonucleotides and their analogs are one class of
potentially useful drugs whose practical utility has been impeded
due to insufficient cellular uptake, and it has been proposed
heretofore to enhance uptake of oligonucleotides through
conjugation of arginine-rich peptides containing non-.alpha. amino
acids (see, for example, Chen, Zhang et al. 2003; Abes, Moulton et
al. 2006; Youngblood, Hatlevig et al. 2007; and Wu et al. 2007).
The use of arginine-rich peptides has been reported for the
transport of therapeutic drugs, more generally (see, for example,
Rothbard, Kreider et al. 2002).
[0023] Studies by the inventors and others (Chen, Zhang et al.
2003; Abes, Moulton et al. 2006; Youngblood, Hatlevig et al. 2007)
have established that incorporation of unnatural amino acids can
confer enhanced stability to peptide carriers and enhanced
antisense activity to conjugated oligomers, and therefore improve
the potential of CPPs (cell penetrating peptides) to deliver
therapeutic macromolecules.
[0024] Parent U.S. application Ser. No. 12/217,040 discloses
studies showing that two of the CPPs reported in the application
are effective in selectively targeting oligonucleotides to muscle
tissue, particularly heart muscle, but also including quadricep
(skeletal) muscle. These two peptides have the generic sequence
(RXRR(B/X)R).sub.2XB, where R is arginine; B is .beta.-alanine; and
each X is --C(O)--(CH.sub.2).sub.n--NH--, where n is 4-6.
Additional studies reported herein confirm the ability of these two
CPPs to enhance the uptake and functioning in muscles of
oligonucleotide antisense compounds conjugated to one of the
CCPs.
[0025] The parent application disclosed and claimed the use of
these two CPPs for targeting antisense oligonucleotides to muscle
tissue, in treating certain muscle pathologies. For example, in
treating Duchenne muscular dystrophy (DMD), an oligonucleotide
designed to promote exon skipping in a mutated dystrophin pre-mRNA
(for purposes of restoring the proper reading frame in a mutated
dystrophin mRNA), is conjugated to one of the CPPs, for enhanced
uptake and functioning the oligonucleotide in muscle tissue,
including both skeletal and heart muscle. In treating DMD, it is
advantageous to effectively target and treat heart muscle, since
improvement in skeletal muscle function alone can place a
DMD-compromised heart under even greater stress.
[0026] The present invention applies this strategy additionally to
the treatment of myotonic dystrophy MD1 and MD2 in muscle tissue,
including skeletal and heart muscle tissue. This condition is
associated with long polyCUG (MD1) and polyCCUG (MD2) repeats in
the 3'-UTR regions of the transcript dystrophia myotonica protein
kinase (DMPK). While normal individuals have as many as 30 CTG
repeats, DM1 patients carry a larger number of repeats ranging from
50 to thousands. The severity of the disease and the age of onset
correlates with the number of repeats. Patients with adult onsets
show milder symptoms and have less than 100 repeats, juvenile onset
DM1 patients carry as many as 500 repeats and congenital cases
usually have around a thousand CTG repeats. The expanded
transcripts containing CUG repeats form a secondary structure,
accumulate in the nucleus in the form of nuclear foci and sequester
RNA-binding proteins (RNA-BP). Several RNA-BP have been implicated
in the disease, including muscleblind-like (MBNL) proteins and
CUG-binding protein (CUGBP). MBNL proteins are homologous to
Drosophila muscleblind (Mb1) proteins necessary for photoreceptor
and muscle differentiation. MBNL and CUGBP have been identified as
antagonistic splicing regulators of transcripts affected in DM1
such as cardiac troponin T (cTNT), insulin receptor (IR) and
muscle-specific chloride channel (ClC-1).
[0027] MD1 and MD2 are associated with a variety of serious
pathologies including muscle abnormalities and weakness, and in the
heart, conduction abnormalities.
SUMMARY OF THE INVENTION
[0028] The invention includes, in one aspect, an antisense compound
for use in treating myotonic dystrophy DM1 or DM2. The compound is
composed of an antisense oligonucleotide having 8-30 bases, with at
least 8 contiguous bases being complementary to polyCUG or polyCCUG
repeats, e.g., SEQ ID NOS: 83 and 84, respectively, in the 3'UTR
region of dystrophia myotonica protein kinase (DMPK) mRNA in DM1 or
DM2, respectively, and conjugated to the oligonucleotide, a
cell-penetrating peptide having the sequence (RXRR(B/X)R).sub.2XB,
where R is arginine; B is .beta.-alanine; and each X is
--C(O)--(CH.sub.2).sub.n--NH--, where n is 4-6. The compound is
effective to selectively block the sequestration of
muscleblind-like 1 protein (MBNL1) and/or CUGBP in heart and
quadricep muscle in a myotonic dystrophy animal model. Exemplary
oligonucleotide sequences for MD1 include SEQ ID NOS: 44-47. An
exemplary oligonucleotide sequence for MD2 includes SEQ ID NO:
48.
[0029] In one general embodiment, the cell penetrating peptide has
the form (RXRRBR).sub.2XB (SEQ ID NO: 19) and X is
--C(O)--(CH.sub.2).sub.6--NH--, and the oligonucleotide is a
phosphorodiamidate oligonucleotide (PMO) having between 12-30
bases, and at least 12 contiguous bases that are complementary to
(i) the polyCUG repeats in the 3'UTR region of dystrophia myotonica
protein kinase (DMPK) mRNA in DM1, or (ii) the polyCCUG repeats in
the 3'UTR region of dystrophia myotonica protein kinase (DMPK) mRNA
in DM2.
[0030] In another general embodiment, the cell penetrating peptide
has the form (RXRRXR).sub.2XB (SEQ ID NO: 11) and X is
--C(O)--(CH.sub.2).sub.6--NH--, and the oligonucleotide is a
phosphorodiamidate oligonucleotide (PMO) having between 12-30
bases, and at least 12 contiguous bases that are complementary to
(i) the polyCUG repeats in the 3'UTR region of dystrophia myotonica
protein kinase (DMPK) mRNA in DM1, or (ii) the polyCCUG repeats in
the 3'UTR region of dystrophia myotonica protein kinase (DMPK) mRNA
in DM2.
[0031] The compound may further include a homing peptide which is
selective for muscle tissue, conjugated to the cell-penetrating
peptide. Exemplary homing peptides have one of the sequences
identified as SEQ ID NOS: 51-60, particularly SEQ ID NPO:51. The
compound preferably has the form cell-penetrating peptide-homing
peptide-antisense oligomer.
[0032] In another aspect, the invention includes a method of
targeting a systemically administered antisense oligonucleotide to
heart tissue in a mammalian subject, where the oligonucleotide is
directed against the polyCUG or polyCCUG repeats in the 3'UTR
region of dystrophia myotonica protein kinase (DMPK) mRNA in DM1 or
DM2, respectively. The method includes conjugating to the
oligonucleotide, a cell-penetrating peptide having the sequence
(RXRR(B/X)R).sub.2XB, where R is arginine; B is .beta.-alanine; and
each X is independently a neutral linear amino acid
--C(O)--(CH.sub.2).sub.n--NH--, where n is 4-6. In various general
embodiments, preferred compounds formed by the conjugation are as
given above.
[0033] In still another aspect, the invention includes a method of
treating mytonic dystrophy DM1 or DM2 in a mammalian subject. The
method includes, administering to the subject, an antisense
compound comprising an antisense oligonucleotide having 8-30 bases,
with at least 8 contiguous bases being complementary to the polyCUG
or polyCCUG repeats in the 3'UTR region of dystrophia myotonica
protein kinase (DMPK) mRNA in DM1 or DM2, respectively, and
conjugated to the oligonucleotide, a cell-penetrating peptide
having the sequence (RXRR(B/X)R).sub.2XB, where R is arginine; B is
.beta.-alanine; and each X is --C(O)--(CH.sub.2).sub.n--NH--, where
n is 4-6, and repeating said administering at least once every week
to once every 3 months.
[0034] The cell penetrating peptide may have the form
(RXRRBR).sub.2XB, or (RXRRXR).sub.2XB, where X is
--C(O)--(CH.sub.2).sub.6--NH--, and the oligonucleotide may be a
phosphorodiamidate oligonucleotide (PMO) having between 12-30
bases, and at least 12 contiguous bases that are complementary to
the polyCUG or polyCCUG repeats in the 3'UTR region of dystrophia
myotonica protein kinase (DMPK) mRNA in DM1 or DM2,
respectively.
[0035] The compound may be administered by intravenous or
subcutaneous injection to the subject, at a dose between 1-5 mg/kg
body weight antisense compound, and the administering step may be
continued at regular intervals of every two weeks to three months.
The subject may be monitored during the treatment for improvement
in muscle performance, heart conduction properties, and/or for a
reduction in serum creatine kinase.
[0036] In still other aspects, the inventions includes methods and
compounds for treating DMD and muscle atrophy, in accordance with
methods and compositions detailed below.
[0037] These and other objects and features of the invention will
become more fully apparent when the following detailed description
of the invention is read in conjunction with the accompanying
drawings.
BRIEF DESCRIPTION OF THE FIGURES
[0038] FIGS. 1A-C show exemplary structures of a
phosphorodiamidate-linked morpholino oligomer (PMO), a
peptide-conjugated PMO (PPMO), and a peptide-conjugated PMO having
cationic intersubunit linkages (PPMO+), respectively. (Though
multiple cationic linkage types are illustrated in FIG. 1C, a PMO+
or PPMO+ oligomer will typically include just one type of cationic
linkage.)
[0039] FIGS. 2A-B show the cellular uptake of conjugates of various
cell penetrating peptides (CPPs) with carboxyfluorescein-labeled
morpholino oligomers (PMOF) in pLuc705 cells.
[0040] FIGS. 3A-D show the nuclear antisense activity of carrier
peptide-PMO conjugates in the presence or absence of 10% serum
(A-C) or in the presence of up to 60% serum (D).
[0041] FIG. 4 shows the nuclear antisense activity of carrier
peptide-PMO conjugates as a function of the number and position of
6-aminohexanoic acid (Ahx) residues in the peptides.
[0042] The peptides 0, 2, 3a, 3b, 3c, 3d, 4a, 4b, 4c, 5 and 8,
corresponding to the number of X residues in the peptide, are shown
in Table 1 as SEQ ID NOs: 14, 20, 22, 19, 21, 25, 24, 23, 26, 11
and 3, respectively.
[0043] FIGS. 5A-F show the relative toxicity of carrier peptide-PMO
conjugates, as measured by MTT assay.
[0044] FIGS. 6A-D show the relative toxicity of carrier peptide-PMO
conjugates as measured by PI exclusion (A-C) and hemolysis (D)
assays.
[0045] FIGS. 7A-P show the splice-correction activity in various
organs from EGFP-654 transgenic mice treated with various
EGFP-654-targeted cell penetrating peptide-PMO conjugates (SEQ ID
NOs: 2, 6, 11, 13, 14 and 19-27) as measured in diaphragm (FIG.
7A), mammalian gland (FIG. 7B), ovary and prostate (FIG. 7C), brain
(FIG. 7D), kidney (FIG. 7E), bone marrow (FIG. 7F), colon (FIG.
7G), muscle (FIG. 7H), skin (FIG. 7I), spleen (FIG. 7J), stomach
(FIG. 7K), thymus (FIG. 7L), heart (FIG. 7M), lungs (FIG. 7N),
small intestine (FIG. 7O), and liver (FIG. 7P).
[0046] FIG. 8 shows the effect of conjugating an antisense oligomer
with a muscle-specific cell penetrating peptide (SEQ ID NO: 19;
referred to herein as peptide "B" and also designated CP06062) in
combination with a muscle specific homing peptide (MSP), as
measured by restoration of full-length dystrophin in the MDX mouse
model.
[0047] FIG. 9 shows a comparison of dystrophin induction in TA
muscles with M23d PMO (SEQ ID NO: 37) and M23d-CP06062 PPMO (SEQ ID
NO: 37 conjugated to SEQ ID NO: 19) by intramuscular injections.
The muscles of adult MDX mice were injected with 2 micrograms of
each antisense composition and examined by immunohistochemistry
with rabbit polyclonal antibody P7 against dystrophin 2 weeks after
the injection. Muscle from normal C57BL mouse (b) and mdx mouse
injected with 2 micrograms M23d PMO (c), 2 micrograms M23d-CP06062
PPMO (d), and 2 micrograms scrambled PPMO (e). Eighty-five percent
of the muscle fibers were induced to express dystrophin after
M23d-CP06062 PPMO treatment (d), compared with only 14% of fibers
after M23d PMO treatment (c). Only a few revertant fibers were
detected in the muscle treated with the scrambled PPMO (e). Blue
nuclear staining with DAPI. (Scale bar, 50 m.)
[0048] FIG. 10 shows the structures of PMO and PPMO (A) and
restoration of dystrophin in muscles of mdx mice (aged 4-5 weeks)
after a single i.v. injection of 30 mg/kg of M23d-CP06062 PPMO. The
muscles were examined 2 weeks after injection. (B-D) Detection of
dystrophin by immunohistochemistry with rabbit polyclonal antibody
P7 against dystrophin. Blue nuclear staining with DAPI. (Scale bar,
100 .mu.M.) Muscles from normal C57BL mice (B), scrambled
PPMO-treated mdx mice (C), and M23d-CP06062 PPMO-treated mdx mice
(D). Dystrophin was homogenously expressed in all muscle fibers
from the M23d-CP06062 PPMO-treated mice. (E) Western blot
demonstrated dystrophin in all muscles detected with the NCL-DYS1
monoclonal antibody. C57-TA, tibialis anterior muscle from normal
C57BL; Gastro, gastrocnemius; Control-TA, muscle from the scrambled
PPMO-treated mdx mouse. (F) Western blot for .alpha.-actin as
protein loading control. (G) Detection of exon 23-skipped
dystrophin mRNA by RT-PCR. The upper 1,093-bp bands (indicated by
E22-E23-E24) correspond to the normal mRNA, and the lower 880-bp
bands (indicated by E22-E24) correspond to the mRNA with exon 23
skipped. Sequencing of the 880-bp RT-PCR product confirmed the
skipping of the exon 23 (H).
[0049] FIG. 11 shows the restoration of dystrophin in bodywide
muscles of mdx mice (age 4-5 weeks) after six i.v. injections of 30
mg/kg of M23d-CP06062 PPMO at biweekly intervals. Muscles were
examined 2 weeks after the last injection. Muscles from normal
C57BL mice (A), scrambled PPMO-treated mdx mice (B), and
M23d-CP06062 PPMO-treated mdx mice (C). Blue nuclear staining with
DAPI. Dystrophin was expressed homogenously in all muscle fibers
from the M23d-CP06062 PPMO-treated mdx mice. (Scale bar, 100
.mu.m.) (D) Western blot demonstrated near-normal levels of
dystrophin in all muscles detected with the NCL-DYS1 monoclonal
antibody. C57-TA, TA muscle from normal C57BL mouse; Control-TA, TA
muscle from scrambled PPMO-treated mdx mouse; Gastro,
gastrocnemius. (E) Western blot for .alpha.-actin as protein
loading control. (F) Detection of exon 23 skipping by RT-PCR. Total
RNA of 100 ng from each sample was used for amplification of
dystrophin mRNA from exon 20 to exon 26. Control-TA, TA muscle from
scrambled PPMO-treated mdx mouse. The upper 1,093-bp bands
(indicated by E22-E23-E24) correspond to the normal dystrophin
mRNA, and the lower 880-bp bands (indicated by E22-E24) correspond
to the mRNA with exon 23 skipped.
[0050] FIG. 12 shows the restoration of dystrophin in skeletal and
smooth muscles after six cycles of 30-mg/kg M23d-CP06062 PPMO
injection. Back thoracic and lumbar muscle (A), digital muscle (B),
flexor muscle (C). Smooth muscles (layers between the two arrows)
in small intestine of untreated mdx mouse (D) and M23d-CP06062
PPMO-treated mdx mouse (E). Arrowhead indicates a revertant fiber.
Dystrophin expression in the smooth muscle of aorta and vena cava
(F) and arteries and other vessels in the lung (G). Dystrophin was
detected by immunostaining with rabbit polyclonal antibody P7. Blue
nuclear staining with DAPI. (Scale bars: A-E, 50 .mu.m; F and G,
120 .mu.m.)
[0051] FIGS. 13A-13D shows shows restoration of muscle and cardiac
dystrophin expression in mdx mice. Restoration of dystrophin
expression following single 25 mg/kg intravenous injections of the
P007-M23d PPMO (SEQ ID NO: 37 conjugated to SEQ ID NO: 11)
conjugate in adult mdx mice. (A) Immunostaining of muscle tissue
cross-sections to detect dystrophin protein expression and
localization in C57BL6 normal control mice (top panel), untreated
mdx mice (middle panel) and P007-M23d PPMO-treated mdx mice (lower
panel), showing near normal levels of dystrophin expression in the
treated mice. Muscle tissues analysed were from tibialis anterior
(TA), gastrocnemius, quadriceps, biceps, abdominal wall, diaphragm
and heart muscles (scale bar=200 microns). (B) RT-PCR to detect
exon skipping efficiency at the RNA level demonstrated almost
complete exon 23 skipping in the peripheral skeletal muscles
indicated and 50% exon skipping in heart in treated mdx mice. This
is shown by shorter exon-skipped bands (indicated by the boxed
numbered 22-24--for exon 23 skipping). Truncated transcripts
deleted for both exons 22 and 23 were also seen as indicated by the
box 21-24. (C) Western blot for dystrophin expression in peripheral
skeletal muscles showed 100% dystrophin restoration in all skeletal
muscles except the diaphragm and with P007-M23d PPMO conjugate
treatment compared with levels found in normal C57BL6 mice. Equal
loading of 10 .mu.g protein is shown for each sample with -actinin
expression detected as a loading control. (D) Western blot to
detect dystrophin expression in heart tissue from normal C57BL6
heart (20, 10 and 5% of normal levels shown), untreated mdx heart
and P007-M23d PPMO treated heart. Data shows dystrophin protein
restoration to 15% of normal levels in P007-M23d PPMO treated mdx
heart tissue.
DETAILED DESCRIPTION
1. Definitions
[0052] The terms below, as used herein, have the following
meanings, unless indicated otherwise:
[0053] The terms "cell penetrating peptide" or "CPP" are used
interchangeably and refer to cationic cell penetrating peptides,
also called transport peptides, carrier peptides, or peptide
transduction domains. The peptides, as shown herein, have the
capability of inducing cell penetration within 100% of cells of a
given cell culture population and allow macromolecular
translocation within multiple tissues in vivo upon systemic
administration.
[0054] The terms "antisense oligomer" or "antisense
oligonucleotide" or "oligonucleotide" are used interchangeably and
refer to a sequence of cyclic subunits, each bearing a base-pairing
moiety, linked by intersubunit linkages that allow the base-pairing
moieties to hybridize to a target sequence in a nucleic acid
(typically an RNA) by Watson-Crick base pairing, to form a nucleic
acid:oligomer heteroduplex within the target sequence. The cyclic
subunits are based on ribose or another pentose sugar or, in a
preferred embodiment, a morpholino group (see description of
morpholino oligomers below). The oligomer may have exact or near
sequence complementarity to the target sequence; variations in
sequence near the termini of an oligomer are generally preferable
to variations in the interior.
[0055] In one aspect of the invention, for the treatment of MD1 or
MD2, the antisense oligonucleotide is complementary to at least 8,
typically 9-12 or more, e.g., 15-30 contiguous bases in polyCUG
repeats or polyCCUG repeats within the 3' UTR regions of the
transcript for dystrophia myotonica protein kinase (DMPK) in muscle
cells, and is designed to bind by hybridization to these repeats,
blocking binding of splice-associated proteins, such as one or more
muscleblind family proteins, e.g., MBNL1, or CUGBP to the
transcript. The oligonucleotide may be said to be "directed to" or
"targeted against" 3'UTR polyCUG or polyCCUG repeats with which it
hybridizes. The target sequence may include a polyCUG or polyCCUG
region of at least 8 contiguous bases, preferably at least 9-25,
and up to 40 bases or more. SEQ ID NOS: 49, 50 define polyCUG and
polyCCUG repeat sequences of 39 and 40 bases, respectively.
[0056] In another aspect, for the treatment of DMD, the antisense
oligonucleotide is complementary to at least 8, typically 9-12 or
more e.g., 15-30 contiguous bases in a splice-junction site or exon
recognition sequence of a dystrophin pre-MRNA, where binding of the
oligonucleotide to the target pre-mRNA sequence is effective to
promote skipping of one or more exons in a mutated dystrophin gene,
with the result that the normal reading frame of the processed mRNA
is restored. Exemplary targeting sequences includes one from SEQ ID
NOS: 28-38.
[0057] In still another aspect, for treatment of muscle atrophy,
the antisense oligonucleotide is complementary to at least 8,
typically 9-12 or more, e.g., 15-30 bases, in an AUG region of
myostatin mRNA or a splice-junction site of a myostatin pre-mRNA,
effective to inhibit expression of a functional myostatin protein
in muscle cells. Exemplary targeting sequences includes one from
SEQ ID NOS: 39-43.
[0058] The terms "morpholino oligomer" or "PMO" (phosphoramidate-
or phosphorodiamidate morpholino oligomer) refer to an
oligonucleotide composed of morpholino subunit structures, where
(i) the structures are linked together by phosphorus-containing
linkages, one to three atoms long, preferably two atoms long, and
preferably uncharged or cationic, joining the morpholino nitrogen
of one subunit to a 5' exocyclic carbon of an adjacent subunit, and
(ii) each morpholino ring bears a purine or pyrimidine base-pairing
moiety effective to bind, by base specific hydrogen bonding, to a
base in a polynucleotide. See, for example, the structure in FIG.
1A, which shows a preferred phosphorodiamidate linkage type.
Variations can be made to this linkage as long as they do not
interfere with binding or activity. For example, the oxygen
attached to phosphorus may be substituted with sulfur
(thiophosphorodiamidate). The 5' oxygen may be substituted with
amino or lower alkyl substituted amino. The pendant nitrogen
attached to phosphorus may be unsubstituted, monosubstituted, or
disubstituted with (optionally substituted) lower alkyl. See also
the discussion of cationic linkages below. The purine or pyrimidine
base pairing moiety is typically adenine, cytosine, guanine,
uracil, thymine or inosine. The synthesis, structures, and binding
characteristics of morpholino oligomers are detailed in U.S. Pat.
Nos. 5,698,685, 5,217,866, 5,142,047, 5,034,506, 5,166,315,
5,521,063, and 5,506,337, and PCT Pubn. No. WO 2008036127 (cationic
linkages), all of which are incorporated herein by reference.
[0059] An "amino acid subunit" or "amino acid residue" can refer to
an .alpha.-amino acid residue (--CO--CHR--NH--) or a .beta.- or
other amino acid residue (e.g.--CO--(CH.sub.2).sub.nCHR--NH--),
where R is a side chain (which may include hydrogen) and n is 1 to
6, preferably 1 to 4.
[0060] The term "naturally occurring amino acid" refers to an amino
acid present in proteins found in nature. The term "non-natural
amino acids" refers to those amino acids not present in proteins
found in nature, examples include beta-alanine (.beta.-Ala),
6-aminohexanoic acid (Ahx) and 6-aminopentanoic acid.
[0061] A "marker compound" refers to a detectable compound attached
to a transport peptide for evaluation of transport of the resulting
conjugate into a cell. The compound may be visually or
spectrophotometrically detected, e.g. a fluorescent compound or
fluorescently labeled compound, which may include a fluorescently
labeled oligomer. Preferably, the marker compound is a labeled or
unlabeled antisense oligomer. In this case, detection of transport
involves detection of a product resulting from modulation of
splicing and/or transcription of a nucleic acid by an antisense
oligomeric compound. Exemplary methods, such as a splice correction
assay or exon skipping assay, are described in Materials and
Methods below.
[0062] An "effective amount" or "therapeutically effective amount"
refers to an amount of therapeutic compound, such as an antisense
oligomer, administered to a mammalian subject, either as a single
dose or as part of a series of doses, which is effective to produce
a desired therapeutic effect.
[0063] "Treatment" of an individual (e.g. a mammal, such as a
human) or a cell is any type of intervention used in an attempt to
alter the natural course of the individual or cell. Treatment
includes, but is not limited to, administration of a pharmaceutical
composition, and may be performed either prophylactically or
subsequent to the initiation of a pathologic event or contact with
an etiologic agent.
[0064] An "antisense compound" or "compound" or "conjugate
compound" refers to a compound formed by conjugating the
(RXRR(X/B)R).sub.2XB cell-penetrating peptides to an
oligonucleotide targeted against a muscle-protein gene, e.g., a
region of polyCUG or polyCCUG repeats.
[0065] "Systemic administration" of a compound refers to
administration, such as intravenous (iv) subcutaneous (subQ),
intramuscular (IM), and intraperitoneal (IP) that delivers the
compound directly into the bloodstream.
[0066] A systemically administered antisense oligonucleotide is
targeted to heart muscle tissue by conjugation to the CPP
(RXRRBR).sub.2XB, if the compound, when administered systemically
to a MD1 or MD2 subject in accordance with the method herein,
produces a measurable improvement in heart muscle performance
and/or improvement in conduction properties of the heart, as
measured by known methods.
II. Structural Features of Transport Peptides
[0067] The two cell-penetrating peptides employed in the invention
are in a class of a transport peptide having 8 to 30 amino acid
residues in length and consisting of subsequences selected from the
group consisting of RXR, RX, RB, and RBR; where R is arginine
(which may include D-arginine, represented in the sequences herein
by r), B is .beta.-alanine, and each X is independently
--C(O)--(CHR.sup.1).sub.n--NH--, where n is 4-6 and each R.sup.1 is
independently H or methyl, such that at most two R.sup.1's are
methyl. Preferably, each R.sup.1 is hydrogen. The two peptides have
the generic formula (RXRR(B/X)R).sub.2XB, where R is arginine; B is
.beta.-alanine; and each X is --C(O)--(CH.sub.2).sub.n--NH--, where
n is 4-6, preferably 6, and include both (RXRRBR).sub.2XB (SEQ ID
NO: 19) and (RXRRXR).sub.2XB (SEQ ID NO: 11) and where R is
arginine; B is .beta.-alanine; and each X is
--C(O)--(CH.sub.2).sub.n--NH--, where n is 4-6. As discussed in
Section V below, these two peptides have been discovered to
selectively target an oligonucleotide, including a PMO, to muscle
tissue, including, importantly, heart muscle tissue.
[0068] Table 1 below shows the sequences of various transport
peptides in this class that were evaluated, in conjugation with
suitable antisense oligonucleotides, for their ability to
selectively target various tissues, including heart and skeletal
muscle. The peptides were evaluated for cellular uptake (Section
III), as determined by flow cytometry; for antisense activity
(Section IV), as determined by a splice correction assay (Kang, Cho
et al. 1998); and for cellular toxicity, as determined by MTT cell
viability, propidium iodide membrane integrity and hemolysis
assays, and microscopic imaging, and their uptake and functional
activity in muscle tissue relative to a variety of non-muscle
tissue were compared (Section V). As will be seen in Section IV,
the (RXRRXR).sub.2XB peptide was among the most active in antisense
activity, as determined by the splice correction assay (the
(RXRRBR).sub.2XB peptide was not tested in this assay), both in the
presence and absence of added serum. As will seen in Section V,
both (RXRR(B/X)R).sub.2XB peptides were effective in selectively
targeting oligonucleotides to heart and skeletal tissue, while
showing relatively low-level targeting to a variety of other
tissues, including mammary gland tissue, ovary/prostate
(particularly (RXRRXR).sub.2XB), and brain.
TABLE-US-00001 TABLE 1 Cell-Penetrating Peptides SEQ ID Name
(Designation) Sequence No..sup.a Oligoarginines R.sub.8-XB(A; 8)
RRRRRRRR-XB 3 r.sub.8-XB rrrrrrrr-XB 4 R.sub.9-XB RRRRRRRRR-XB 5
Oligo (RX), (RXR), and (RB) series, including D-arginine
(RX).sub.8-B RXRXRXRXRXRXRXRX-B 6 (rX).sub.8-B rXrXrXrXrXrXrXrX-B 7
(RX).sub.7-B RXRXRXRXRXRXRX-B 8 (RX).sub.5-B RXRXRXRXRX-B 9
(RX).sub.3-B RXRXRX-B 10 (RXR).sub.4-XB (P007; 5) RXRRXRRXRRXR-XB
11 (rXR).sub.4-XB rXRrXRrXRrXR-XB 12 (rXr).sub.4-XB (D-P007)
rXrrXrrXrrXr-XB 13 (RB).sub.8-B (0) RBRBRBRBRBRBRBRB-B 14
(rB).sub.8-B rBrBrBrBrBrBrBrB-B 15 (RB).sub.7-B RBRBRBRBRBRBRB-B 16
(RB).sub.5-B RBRBRBRBRB-B 17 (RB).sub.3-B RBRBRB-B 18 (RX), (RXR),
(RB), and (RBR) mixed series (RXRRBR).sub.2-XB (B; 3b;
RXRRBRRXRRBR-XB 19 CP06062) (RXR).sub.3RBR-XB (C; 4c)
RXRRXRRXRRBR-XB 26 (RB).sub.5RXRBR-XB (D; 2 RBRBRBRBRBRXRBR-XB 20
(RBRBRBRX).sub.2-X (E; 3c) RBRBRBRXRBRBRBRX-X 21
X(RB).sub.3RX(RB).sub.3R-X (F; 3a) XRBRBRBRXRBRBRBR-B 22
(RBRX).sub.4-B (G; 4b) RBRXRBRXRBRXRBRX-B 23 (RB).sub.4(RX).sub.4-B
(H; 4a) RBRBRBRBRXRXRXRX-B 24 RX(RB).sub.2RX(RB).sub.3R-X
RXRBRBRXRBRBRBRX-X 25 (I; 3d) (RB).sub.7RX-B RBRBRBRBRBRBRBRX-B 27
.sup.aSequences assigned to SEQ ID NOs do not include the linkage
portion (X, B, or XB).
III. Cellular Uptake of Peptide-Oligomer Conjugates
[0069] Cellular uptake of peptide-PMO conjugates, where the PMO was
a 3'-carboxy fluorescein-tagged PMO (PMOF), was investigated using
flow cytometry. A treatment concentration of 2 .mu.M was used
because none of the conjugates caused any detectable cytotoxicity
at this concentration, as demonstrated by MTT and PI uptake assays
(below). After incubation with conjugate, cells were treated with
trypsin (Richard, Melikov et al. 2003) to remove membrane-bound
conjugate. To determine the effect of serum on cellular uptake of
the various conjugates, uptake evaluation assays were carried out
in medium containing various concentrations of serum.
[0070] As shown in FIGS. 2A-B, cellular uptake of the conjugates
increased with the number of arginine residues in the transport
peptide and generally decreased with X and/or B residue insertion.
For example, the oligoarginine R.sub.9-PMOF conjugate had a mean
fluorescence (MF) value of 662, nearly 3-fold higher than that of
R.sub.8-PMOF. Insertion of an X or B residue in the R.sub.8
sequence reduced uptake of the respective conjugates, as shown by
MF values for conjugates of R.sub.8 (234), (RX).sub.8 (42),
(RXR).sub.4 (70), and (RB).sub.8 (60) (FIG. 2A). The number of RX
or RB repeats also affected cellular uptake, with conjugates having
fewer RX or RB repeats generating lower MF values (FIG. 2B).
[0071] While the addition of 10% serum to the medium caused a
decrease in the uptake of the oligoarginine R.sub.8-or R.sub.9-PMOF
conjugates, it increased uptake of conjugates containing RX, RB or
RXR motifs (FIGS. 2A and 2C). For example, the presence of serum
reduced the MF of R.sub.9-and R.sub.8-PMOF from 662 and 234 to 354
and 158, respectively, but it increased the MF of (RX).sub.8-,
(RXR).sub.4-, and (RB).sub.8-PMOF from 41, 70 and 60 to 92, 92, and
111, respectively. These differences were statically significant
(FIG. 2A). However, higher serum concentrations (30% and 60%)
decreased the uptake of both (RXR).sub.4-PMOF and
oligoarginine-PMOF.
[0072] Arginine stereochemistry (D vs. L) had little effect on
uptake of the peptide-PMOF conjugates. Uptake as shown by MF values
of R.sub.8-, (RB).sub.8- and (RX).sub.8-PMOF conjugates was not
significantly different from their respective D-isomer conjugates,
r.sub.8-, (rB).sub.8- and (rX).sub.8-PMOF (data not shown).
IV. In Vitro Nuclear Antisense Activity
[0073] The effectiveness of the subject peptides in transporting an
attached molecule to the nucleus of a cell was determined in a
splicing correction assay (Kang, Cho et al. 1998), where the
attached compound is a steric-blocking antisense oligomer (AO), in
this case a PMO. This assay utilizes the ability of the oligomer to
block a splice site created by a mutation in order to restore
normal splicing. Specifically, the luciferase coding sequence is
interrupted by the human .beta.-globin thalassemic intron 2, which
carries a mutated splice site at nucleotide 705. HeLa cells were
stably transected with the resulting plasmid and designated pLuc705
cells. In the pLuc705 system, the oligomer must be present in the
cell nucleus for splicing correction to occur. Advantages of this
system include the positive readout and high signal-to-noise ratio.
With this system, the relative efficiencies of various transport
peptides to deliver an AO with sequence appropriate for
splice-correction to cell nuclei can be easily compared.
[0074] As described below, the subject carrier peptide-PMO
conjugates display higher activity in cell nuclei, and are less
affected by serum and more stable in blood, than oligoarginine-PMO
conjugates.
[0075] Oligoarginine, RX, RXR and RB Panels (see Table 1). The
peptide-PMO conjugates with the highest nuclear antisense
activities in this series were found to be (RXR).sub.4- and
(RX).sub.8-PMO (where, as noted above, R is arginine, and X in
these peptides is 6-aminohexanoic acid). FIGS. 3A and 3B show
luciferase activity normalized to protein of cells treated with
various conjugates at 1 .mu.M and 5 .mu.M for 24 hr. At both
concentrations, (RX).sub.8- and (RXR).sub.4-PMO were more effective
than the other conjugates tested, with the difference more
prominent in serum-containing medium at 1 .mu.M than at 5 .mu.M.
Cells treated with 1 .mu.M of either conjugate exhibited luciferase
activity at a level 10-15 fold over background, while the remaining
conjugates yielded about a 2-4 fold increase over background (FIG.
3A). At 5 .mu.M, all conjugates generated higher luciferase
activity than at 1 .mu.M, with (RX).sub.8-PMO and (RXR).sub.4-PMO
again the most effective, followed by (RB).sub.8-PMO (FIG. 3B).
[0076] FIG. 3C shows that, at 10 .mu.M, the activity of RX or RB
conjugates decreased as the number of RX or RB repeats (i.e.
length) in the transport peptide decreased. The peptides with three
or five RX or RB repeats generated much lower luciferase activity
than those with seven or eight repeats.
[0077] Number and Position of X Residues. In order to investigate
the effect of the number and position of X residues on the activity
of conjugates, eleven peptide-PMO conjugates, where the peptide
component contained 0, 2, 3, 4, 5, or 8 X (6-aminohexanoic acid)
residues, were compared (SEQ ID NOs: 14, 20, 22, 19, 21, 25, 24,
23, 26, 11 and 3 as shown in Table 1). The data (shown as lucifrase
activity in the assay described above) is presented in FIG. 4.
[0078] Generally, peptides containing a higher number of X residues
had higher transport activities. At 2 .mu.M, (RX).sub.8-PMO (eight
X residues) had the highest activity, followed by (RXR).sub.4-PMO
(five X residues), and the conjugates with fewer X residues had
lower activities.
[0079] At 5 .mu.M, three conjugates containing three (I; SEQ ID NO:
25), four (C; SEQ ID NO: 26) and eight ((RX).sub.8) 6-aminohexanoic
acid residues had the highest activities, suggesting that the
position of X residues affects activity.
[0080] Serum Effect on Activity. The effect of serum on the
antisense activity of the conjugates was dependent on the peptide
sequences, as shown in FIGS. 3A-3D. Addition of 10% serum to the
medium decreased the activity of oligoarginine-PMO conjugates
(R.sub.8-PMO and R.sub.9-PMO) but increased activity of conjugates
containing RXR, RX and RB repeats. The addition of 10% serum nearly
doubled the luciferase activity of (RXR).sub.4-, (RX).sub.8- and
(RB).sub.8-PMO at 5 .mu.M (FIG. 3B). This effect was further
investigated for (RXR).sub.4-PMO up to 60% serum (see FIG. 3D).
While the activity almost doubled as the serum concentration
increased from 0% to 10%, it gradually decreased as the serum
concentration increased to 60%, at which activity was similar to
that in 0% serum (which was still significantly above background).
This "up and down" profile was also observed with the 1 .mu.M
(RXR).sub.4-PMO treatment. Unlike (RXR).sub.4-PMO, the luciferase
activity of R.sub.8-PMO or R.sub.9-PMO consistently decreased as
the serum concentration increased, with an approximately 30%
reduction in 10% serum and no activity in 60% serum (FIG. 3D).
R.sub.8-PMO or R.sub.9-PMO did not display any detectable activity
at 1 .mu.M, regardless of the serum concentration (FIG. 3A).
V. Tissue Selectivity for in vivo Nuclear Antisense Activity
[0081] Various transport peptides were conjugated to PMO, and the
resulting conjugates (P-PMOs) were tested for their ability to
transport the PMO into various tissues, in accordance with the
invention, as described further in Materials and Methods, below.
Briefly, conjugates were administered for four consecutive days.
The in vivo uptake of the P-PMOs was determined by targeting the
PMO (SEQ ID NO: 1) to an aberrantly spliced mutated intron in the
EGFP-654 gene in an EGFP-654 transgenic mouse model (Sazani,
Gemignani et al. 2002). In this model, cellular uptake of the
EGFP-654 targeted P-PMOs can be evaluated by RT-PCR detection of
restored EGFP-654 mRNA splice product and functionally restored
EGFP in tissues harvested after IP administration of P-PMO. As
shown in FIGS. 7A-P, P-PMOs containing various transport peptides
displayed selective uptake by specific tissues. In particular, a
conjugate containing the transport peptide (RXRRBR).sub.2-XB (SEQ
ID NO: 19) displayed selective uptake into heart, and skeletal
muscle, as well as lungs, lungs, small intestine, colon, stomach,
skin, and bone marrow, while uptake into other organs, including
mammary gland, ovary/prostate and brain, was greatly reduced in
comparison. Similarly, the conjugate containing the peptide or
(RXRRXR).sub.2-XB (SEQ ID NO: 11) displayed selective uptake into
heart, muscle, liver, small intestine, stomach, and mammary gland,
while uptake into other organs, including mammary gland,
ovary/prostate and brain, was greatly reduced in comparison.
VI. Cellular Toxicity of Carrier Peptide-PMO Conjugates
[0082] The cellular toxicity of the various peptide-PMO conjugates
was determined by MTT-survival, propidium iodine (PI) exclusion,
hemolysis assays, and microscopic imaging. The MTT and PI exclusion
assays measure metabolic activity and membrane integrity of cells,
respectively. The hemolysis assay determines compatibility with
blood. Microscopic images were used to verify the MTT results and
observe the general health of the cells. As detailed below, the
conjugates generally showed low toxicity, with those containing
(RX).sub.8 and (RXR).sub.4 having the highest levels of
toxicity.
[0083] MTT assay (FIGS. 5A-F). pLuc 705 cells were treated at
concentrations ranging from 2-60 .mu.M for 24 hr. As shown in FIG.
4, all conjugates, with the exception of those containing
(RX).sub.8 and (RXR).sub.4, had no toxicity at up to 60 .mu.M. The
(RX).sub.8 and (RXR).sub.4 conjugates exhibited no toxicity up to
10 .mu.M, while at higher concentrations they reduced cell
viability in a concentration-dependent manner, with (RX).sub.8
being more toxic than (RXR).sub.4 (FIGS. 5C-D).
[0084] Replacement of L-arginine with D-arginine in R.sub.8-,
(RB).sub.8- and (RXR).sub.4-PMO did not change the viability
profiles of these conjugates (FIGS. 5A-C). Surprisingly, the
L.fwdarw.D replacement in (RX).sub.8-PMO decreased the toxicity
(FIG. 5D).
[0085] The eight conjugates containing peptides with fewer than
five X residues did not inhibit cell proliferation up to 60 .mu.M
(FIG. 5E). Monomers of R or X, individually or in combination, at
500 .mu.M each, produced no inhibition of cell proliferation (FIG.
5F).
[0086] The toxicities of the conjugates (RXR).sub.4-PMO,
RX(RB).sub.2RX(RB).sub.3RX-PMO (peptide SEQ ID NO: 25) and
(RXR).sub.3RBR-PMO (peptide SEQ ID NO: 26) were also evaluated in a
human liver HepG2 cells. Of these, only (RXR).sub.4-PMO caused
dose-dependent inhibition of cell proliferation, while the other
two conjugates had no toxicity up to 60 .mu.M, the highest
concentration tested in this study.
[0087] Microscopic Images. Images of cells treated with 60 .mu.M of
the conjugates correlated well with the MTT cell viability data.
Cells treated with (RX).sub.8-PMO and (RXR).sub.4-PMO appeared
rounded and detached from the culture well, and appeared to have
fewer live cells. Interestingly, cells treated with (rX).sub.8-PMO
appeared to have normal morphology and cell density. The
replacement of one X of (RXR).sub.4-PMO with one B reduced toxicity
significantly; i.e., cells treated with (RXR).sub.3RBR-PMO (peptide
SEQ ID NO: 26) had similar density and morphology to the
vehicle-treated cells.
[0088] Propidium Iodine Exclusion Assay. The effect of the
conjugates on integrity of cell membranes was investigated by a
propidium iodine (PI) exclusion assay. PI can permeate only
unhealthy/damaged membranes; therefore, positive PI fluorescence
indicates compromised cell membranes. Only (RXR).sub.4-PMO and
(RX).sub.8-PMO conjugates were found to significantly affect
membrane integrity at higher concentrations (up to 60 .mu.M
tested).
[0089] FIG. 6A shows the histograms of pLuc705 cells treated with
(RXR).sub.4-PMO at 60 .mu.M for 0.5, 5 and 24 hr. The PI positive
(PI+) region was defined by the cells permeabilized with ethanol
(positive control) as indicated by the gate in the histogram. The
PI histogram shifts from the PI-negative region to PI-positive
region in the longer incubations, indicating the conjugate caused
membrane leakage in a time-dependent manner. The 0.5 hr- and 5
hr-treatments caused a slight shift towards the PI+ region, while
the 24 hr-treatment produced a distinct peak which corresponds to
57% of cells that were in the PI+ region.
[0090] FIG. 6B shows the histograms of cells treated with
(RXR).sub.4-PMO at concentrations of 2, 10, 20, 40 and 60 .mu.M for
24 hr. There was no significant PI uptake at concentrations up to
20 .mu.M. At higher concentrations, the PI+ population appeared,
and the percentage of PI+ cells increased as the treatment
concentration increased, indicating that there were more leaking
cells at the higher treatment concentration. Similar concentration-
and time-dependent PI uptake profiles were observed for
(RX).sub.8-PMO, but not for (RB).sub.8-PMO and the remaining
conjugates. Addition of 10% serum to the treatment medium
significantly reduced membrane toxicity for the (RXR).sub.4-(FIG.
6C) and (RX).sub.8-PMO conjugates.
[0091] Hemolysis Assay. The (RXR).sub.4- and (RX).sub.8-PMO
conjugates were tested in a hemolysis assay and found to be
compatible with red blood cells. Fresh rat red blood cells were
treated with the conjugates at 60 .mu.M, PBS (background) or 0.005%
TX-100 (positive control). The supernatants of conjugate- and
PBS-treated samples had small and similar amounts of free
hemoglobin released, far lower than that of the TX-100-treated
samples (FIG. 6D).
[0092] Animal studies on compounds containing both (RXRRXR).sub.2XB
and (RXRRBR).sub.2XB peptides show that the conjugate compounds are
well tolerated, with little or no observable toxicity effects at
therapeutically effective doses, and with the (RXRRBR).sub.2XB
peptide showing lower toxicity than the (RXRRXR).sub.2XB peptide at
elevated compound doses.
VII. Therapeutic Applications
[0093] The carrier peptides and conjugate compounds of the present
invention are useful for targeting and delivering an antisense
oligomer, such as a PMO, across both the cell and nuclear membranes
to the nucleus of muscle cells in skeletal and heart muscle tissue,
by exposing the cell to a conjugate comprising the oligomer
covalently linked to a carrier peptide as described above.
[0094] (A1) Treatment of Duchenne Muscular Dystrophy. In one
embodiment, an antisense oligomer conjugated to a muscle-specific
carrier peptide as described herein is used in an improved method
for treating Duchenne muscular dystrophy (DMD). Mutations in the
human dystrophin gene can be removed from the processed mRNA by
antisense oligomers that cause exon skipping of the exon containing
the mutation. The resulting processed dystrophin mRNA can encode a
functional dystrophin protein. An exemplary antisense oligomer
targeted to exon 51 of the human dystrophin gene (SEQ ID NO: 38)
induces skipping of exon 51. Other suitable antisense oligomers
include those having SEQ ID NOs: 28-36 for human treatment and SEQ
ID NO:37 used in the mouse MDX model.
[0095] This therapeutic strategy can benefit greatly from the use
of muscle-specific carrier peptides (RXRR(B/X)R).sub.2XB, as
detailed in Examples 2-4 below. Treatment of the MDX mouse using
the M23d-CP06062 PPMO (SEQ ID NO 37 conjugated to SEQ ID NO: 19)
compound demonstrated superior delivery of the PPMO to all muscle
tissues including cardiac tissues as described in Example 3 and
shown in FIGS. 9-12.
[0096] Treatment of DMD, in accordance with the invention,
comprises:
[0097] (i) administering to the subject, an antisense compound
comprising a therapeutic oligonucleotide of the type indicated
above for restoring the normal reading frame in a mutated
dystrophin mRNA, and conjugated to the oligonucleotide, a
cell-penetrating peptide having the sequence (RXRR(B/X)R).sub.2XB,
where R is arginine; B is .beta.-alanine; and each X is
--C(O)--(CH.sub.2).sub.n--NH--, where n is 4-6, and
[0098] (ii) repeating compound administration at least once every
one week to once every three months or longer.
[0099] Exemplary oligonucleotide sequences include SEQ ID NOS:
28-38. The compound is preferably administered by intravenous or
subcutaneous injection to the subject, at a dose between 1-5 mg/kg
body weight antisense compound, at a dosing schedule of once a
month to once every 2-3 months. For subQ administration, the dose
required may be roughly twice that for IV administration. During
the course of treatment, the patient is monitored for improvement
or stabilization of muscle performance and heart function,
according to established procedures. Because muscular dystrophy is
a chronic disease, the treatment method will be applied over the
subject's lifetime, with dose adjustments being made during the
treatment period to achieve a desired level of muscle function and
to accommodate patient growth.
[0100] As can be seen from the findings in Examples 3 and 4, the
treatment method offers a number of important advantages over
earlier proposed antisense methods of treating DMD. First,
targeting, uptake and antisense activity of the antisense compound
into and in both skeletal and heart muscle is efficient, leading to
a high percentage of muscle fibers in skeletal and heart muscle
showing dystrophin expression. This allows effective treatment with
relatively modest compound doses, e.g., in the range 1-5 mg/kg
subject weight. Secondly, little or no compound toxicity is
observed, as evidenced by no observable increases in muscle damage,
inflammatory cellular infiltrates, or necrotic fibers were observed
microscopically in the muscles injected with any of the PPMOs and
PMO. Finally, the effect of a single dose may be effective for up
to three months or more, allowing the patient to be effectively
treated by dosing at intervals of no less than one month, and up to
3 months or more between successive treatments.
[0101] (A2) Treatment of Myotonic Dystrophy. As the name of the
disorder implies the characteristic clinical manifestation in DM is
myotonia (muscle hyperexcitability) and muscle degeneration.
Affected individuals will also develop insulin resistance,
cataracts, heart conduction defects, testicular atrophy,
hypogammaglobulinemia and sleep disorders. Symptoms of DM can
manifest in the adult or in childhood. The childhood onset form of
the disease is often associated with mental retardation. In
addition, there is a form of the disease referred to as congenital
myotonic dystrophy. This latter form of the disease is frequently
fatal and is seen almost exclusively in children born of mothers
who themselves are mildly affected by the disease. In congenital DM
the facial manifestations are distinctive due to bilateral facial
palsy and marked jaw weakness. Many infants with congenital DM die
due to respiratory insufficiency before a proper diagnosis of the
disease is made.
[0102] DM1 initially involves the distal muscles of the extremities
and only as the disease progresses do proximal muscles become
affected. In addition, muscles of the head and neck are affected
early in the course of the disease. Weakness in eyelid closure,
limited extraocular movement and ptosis results from involvement of
the extraocular muscles. Many individuals with DM1 exhibit a
characteristic "haggard" appearance that is the result of atrophy
of the masseters (large muscles that raise and lower the jaw),
sternocleidomastoids (large, thick muscles that pass obliquely
across each side of the neck and contribute to arm movement) and
the temporalis muscle (muscle involved in chewing).
[0103] Treatment of MD1 comprises or MD2, in accordance with the
invention,:
[0104] (i) administering to the subject, an antisense compound
comprising an antisense oligonucleotide having 8-30 bases, with at
least 8 contiguous bases being complementary to the polyCUG or
polyCCUG repeats in the 3'UTR region of dystrophia myotonica
protein kinase (DMPK) mRNA in DM1 or DM2, respectively, and
conjugated to the oligonucleotide, a cell-penetrating peptide
having the sequence (RXRR(B/X)R).sub.2XB, where R is arginine; B is
.beta.-alanine; and each X is --C(O)--(CH.sub.2).sub.n--NH--, where
n is 4-6, and
[0105] (ii) repeating the compound administration at least once
every one week to once every three months or longer.
[0106] As with DMD treatment, the compound is preferably
administered by intravenous or subcutaneous injection to the
subject, at a dose between 1-5 mg/kg body weight antisense
compound, at a dosing schedule of once a month to once every 2-3
months. For subQ administration, the dose required may be roughly
twice that for IV administration. During the course of treatment,
the patient is monitored for improvement or stabilization of muscle
performance, improvement in heart conduction properties and/or
reduction in serum reduction in serum creatine kinase. Because
myotonic dystrophy is a chronic disease, the treatment method will
be applied over the subject's lifetime, with dose adjustments being
made during the treatment period to achieve a desired level of
muscle function and to accommodate patient growth.
[0107] As discussed above for DMD treatment, the treatment method
offers a number of important advantages over earlier proposed
antisense methods of treating MD1 or MD2. First, targeting, uptake
and antisense activity of the antisense compound into and in both
skeletal and heart muscle is efficient, as demonstrated for
antisense oligonucleotide targeted against muscle dystrophin
protein. This allows effective treatment with relatively modest
compound doses, e.g., in the range 1-5 mg/kg subject weight.
Secondly, little or no compound toxicity is observed, as evidenced
by no observable increases in muscle damage, inflammatory cellular
infiltrates, or necrotic fibers were observed microscopically in
the muscles injected with any of the PPMOs and PMO. Finally, as in
the DMD treatment method, the effect of a single dose may be
effective for up to three months or more, allowing the patient to
be effectively treated by dosing at intervals of no less than one
month, and up to 3 months or more between successive
treatments.
[0108] (A3) Treatment of Muscle Atrophy. In another embodiment, an
antisense oligomer as described herein can be used in a method for
treating loss of skeletal muscle mass in a human subject. The steps
in the method entail:
[0109] (a) measuring blood or tissue levels of myostatin in the
subject,
[0110] (b) administering to the subject, a
myostatin-expression-inhibiting amount of an oligomer as described
herein, conjugated to (RXRR(B/X)R).sub.2XB, where R is arginine; B
is .beta.-alanine; and each X is --C(O)--(CH.sub.2).sub.n--NH--,
where n is 4-6, and having a base sequence effective to hybridize
to an expression-sensitive region of processed or preprocessed
human myostatin RNA transcript;
[0111] (c) by this administering, forming within target muscle
cells in the subject, a base-paired heteroduplex structure composed
of human myostatin RNA transcript and the antisense compound and
having a Tm of dissociation of at least 45.degree. C., thereby
inhibiting expression of myostatin in said cells;
[0112] (d) at a selected time following administering the antisense
compound, measuring a blood or tissue level of myostatin in the
subject; and
[0113] (e) repeating the administering, using the myostatin levels
measured in (d) to adjust the dose or dosing schedule of the amount
of antisense compound administered, if necessary, so as to reduce
measured levels of myostatin over those initially measured and
maintain such levels of myostatin measured in step (d) within a
range determined for normal, healthy individuals.
[0114] Where the antisense oligomer is effective to hybridize to a
splice site of preprocessed human myostatin transcript, it has a
base sequence that is complementary to at least 12 contiguous bases
of a splice site in a preprocessed human myostatin transcript, and
formation of the heteroduplex in step (c) is effective to block
processing of a preprocessed myostatin transcript to produce a
full-length, processed myostatin transcript. Exemplary antisense
sequences are those identified by SEQ ID NOs: 39-43.
[0115] Compound doses and dose schedules are similar to those
described above for DMD treatment and MD treatment, as are the
advantages achievable by the treatment method.
VIII. Combination with Homing Peptides
[0116] The oligonucleotide-(RXRR(B/X)R).sub.2XB conjugate compounds
of the invention may be used in conjunction with homing peptides
selective for the target tissue, to further enhance muscle-specific
delivery. An example of this approach can be found in the
application of muscle-binding peptides (Samoylova and Smith, 1999;
Vodyanoy et al., U.S. Appn. Pubn. No. 20030640466) coupled to
antisense oligomers designed to be therapeutic treatments for
Duchenne muscular dystrophy (DMD) (Gebski, Mann et al. 2003; Alter,
Lou et al. 2006) (PCT Pubn. No. WO2006000057). The heptapeptide
sequence ASSLNIA has enhanced in vivo skeletal and cardiac muscle
binding properties, as described by Samoylova and Smith. As a
further example, a pancreas-homing peptide, CRVASVLPC, mimics the
natural prolactin receptor ligand (Kolonin, Sun et al. 2006).
[0117] An exemplary dual peptide molecule has a cell penetrating
peptide to one terminus, e.g. at the 5' end of the antisense
oligomer, as described herein, and a homing peptide coupled to the
other terminus, i.e. the 3' terminus. The homing peptide localizes
the peptide-conjugated PMO to the target tissue, where the
cell-penetrating peptide moiety effects transport into the cells of
the tissue.
[0118] Alternatively, a preferred exemplary dual peptide molecule
would have both a homing peptide (HP) and cell-penetrating peptide
(CPP) conjugated to one end, e.g. the 5' terminus of the antisense
oligomer, in either a HP-CPP-PMO configuration or, more preferably,
a CPP-HP-PMO configuration.
[0119] For example, a PMO designed to induce therapeutic exon
skipping of the dystrophin gene, as described by Wilton et al. (PCT
Publication WO2006/000057), conjugated at the 3' terminus to the
muscle-binding peptide ASSLNIA, and further coupled at the 5'
terminus to a cell penetrating peptide of the present invention,
preferably having enhanced selectivity for muscle tissue, will
provide enhanced therapeutic potential in the treatment of DMD.
This is exemplified in Example 2, below.
TABLE-US-00002 TABLE 2 Examples of Muscle-specific Homing Peptides
(HP) Peptide Sequence Target Tissue (NH.sub.2 to COHH) SEQ. ID NO.
Skeletal Muscle- ASSLNIA 51 SMP1 SMP2 SLGSFP 52 SMP3 SGASAV 53 SMP4
GRSGAR 54 SMP5 TARGEHKEEELI 55 Cardiac Muscle- WLSEAGPVVTVRALRGTGSW
56 CMP1 CMP2 VTVRALRGTSW 57 CMP3 VVTVRALRGTGSW 58 CMP4 CRPPR 59
CMP5 SKTFNTHPQSTP 60
IX. Peptide-Antisense Oligomer Conjugate Compositions
A. Conjugates for Specific Muscle Treatments
[0120] Therapeutic conjugates comprising selected transport peptide
sequences are also provided by the invention. These include
conjugates comprising a carrier peptide (RXRR(B/X)R).sub.2XB, as
described herein, conjugated to an oligonucleotide, e.g., PMO,
designed for therapeutic action within muscle tissue.
[0121] The conjugates may further comprise a targeting moiety
effective to bind to tissue specific receptors of a target tissue
type, linked to the therapeutic compound or, preferably, to another
terminus of the carrier peptide. In particularly preferred
embodiments, a homing peptide such as described above is conjugated
to therapeutic compound or to the cell-penetrating peptide.
[0122] For use in treating Duchenne muscular dystrophy, the
conjugate compound comprises a (RXRR(B/X)R).sub.2XB, and conjugated
to a terminus of the peptide, an antisense oligonucleotide capable
of producing exon skipping in the DMD protein, such as a PMO having
SEQ ID NO: 44, to restore partial activity of the DMD protein.
[0123] For use in treating myotonic dystrophy DM1 or DM2, the
conjugate compound comprises an antisense oligonucleotide having
8-30 bases, with at least 8 contiguous bases being complementary to
the polyCUG or polyCCUG repeats in the 3'UTR region of dystrophia
myotonica protein kinase (DMPK) mRNA in DM1 or DM2, respectively,
and conjugated to the oligonucleotide, a cell-penetrating peptide
having the sequence (RXRR(B/X)R).sub.2XB, where R is arginine; B is
.beta.-alanine; and each X is --C(O)--(CH.sub.2).sub.n--NH--, where
n is 4-6. The compound is effective to selectively block the
sequestration of muscleblind-like 1 protein (MBNL1) and/or CUGBP in
heart and quadricep muscle in a myotonic dystrophy animal
model.
[0124] For use in treating muscle atrophy, the conjugate compound
comprises an antisense oligonucleotide effective to inhibit
myostatin expression in a subject, and conjugated to the
oligonucleotide, a cell-penetrating peptide having the sequence
(RXRR(B/X)R).sub.2XB, where R is arginine; B is .beta.-alanine; and
each X is --C(O)--(CH.sub.2).sub.n--NH--, where n is 4-6. The
compound is effective to inhibit myostatin expression in muscle
tissues.
B. Morpholino Oligomers having Cationic Intersubunit Linkages
[0125] In preferred embodiments, as noted above, the antisense
oligomer is a phosphorodiamidate morpholino oligonucleotide (PMO).
The PMO may include between about 20-50% positively charged
backbone linkages, as described below and further in PCT Pubn. No.
WO 2008036127, which is incorporated herein by reference.
[0126] The cationic PMOs (PMO+) are morpholino oligomers in which
at least one intersubunit linkage between two consecutive
morpholino ring structures contains a pendant cationic group. The
pendant group bears a distal nitrogen atom that can bear a positive
charge at neutral or near-neutral (e.g. physiological) pH. Examples
are shown in FIGS. 1B-C.
[0127] The intersubunit linkages in these oligomers are preferably
phosphorus-containing linkages, having the structure:
##STR00001##
where W is S or O, and is preferably O,
X=NR.sup.1R.sup.2 or OR.sup.6,
Y=O or NR.sup.7,
[0128] and each said linkage in the oligomer is selected from:
[0129] (a) uncharged linkage (a), where each of R.sup.1, R.sup.2,
R.sup.6 and R.sup.7 is independently selected from hydrogen and
lower alkyl;
[0130] (b1) cationic linkage (b1), where X=NR.sup.1R.sup.2 and Y=O,
and NR.sup.1R.sup.2 represents an optionally substituted piperazino
group, such that
R.sup.1R.sup.2=--CHRCHRN(R.sup.3)(R.sup.4)CHRCHR--, where
[0131] each R is independently H or CH.sub.3,
[0132] R.sup.4 is H, CH.sub.3, or an electron pair, and
[0133] R.sup.3 is selected from H, lower alkyl, e.g. CH.sub.3,
C(.dbd.NH)NH.sub.2, Z-L-NHC(.dbd.NH)NH.sub.2, and
{C(O)CHR'NH}.sub.mH, where: Z is C(O) or a direct bond, L is an
optional linker up to 18 atoms in length, preferably up to 12
atoms, and more preferably up to 8 atoms in length, having bonds
selected from alkyl, alkoxy, and alkylamino, R' is a side chain of
a naturally occurring amino acid or a one- or two-carbon homolog
thereof, and m is 1 to 6, preferably 1 to 4;
[0134] (b2) cationic linkage (b2), where X.dbd.NR.sup.1R.sup.2 and
Y.dbd.O, R.sup.1.dbd.H or CH.sub.3, and
R.sup.2=LNR.sup.3R.sup.4R.sup.5, where L, R.sup.3, and R.sup.4 are
as defined above, and R.sup.5 is H, lower alkyl, or lower
(alkoxy)alkyl; and
[0135] (b3) cationic linkage (b3), where Y.dbd.NR.sup.7 and
X.dbd.OR.sup.6, and R.sup.7=LNR.sup.3R.sup.4R.sup.5, where L,
R.sup.3, R.sup.4 and R.sup.5 are as defined above, and R.sup.6 is H
or lower alkyl;
[0136] and at least one said linkage is selected from cationic
linkages (b1), (b2), and (b3).
[0137] Preferably, the oligomer includes at least two consecutive
linkages of type (a) (i.e. uncharged linkages). In further
embodiments, at least 5% of the linkages in the oligomer are
cationic linkages (i.e. type (b1), (b2), or (b3)); for example, 10%
to 80%, 10% to 50%, or 10% to 35% of the linkages may be cationic
linkages.
[0138] In one embodiment, at least one linkage is of type (b1),
where, preferably, each R is H, R.sup.4 is H, CH.sub.3, or an
electron pair, and R.sup.3 is selected from H, lower alkyl, e.g.
CH.sub.3, C(.dbd.NH)NH.sub.2, and C(O)-L-NHC(=NH)NH.sub.2. The
latter two embodiments of R.sup.3 provide a guanidino moiety,
either attached directly to the piperazine ring, or pendant to a
linker group L, respectively. For ease of synthesis, the variable Z
in R.sup.3 is preferably C(O) (carbonyl), as shown.
[0139] The linker group L, as noted above, contains bonds in its
backbone selected from alkyl (e.g. --CH.sub.2--CH.sub.2--), alkoxy
(--C--O--), and alkylamino (e.g. --CH.sub.2--NH--), with the
proviso that the terminal atoms in L (e.g., those adjacent to
carbonyl or nitrogen) are carbon atoms. Although branched linkages
(e.g. --CH.sub.2--CHCH.sub.3--) are possible, the linker is
preferably unbranched. In one embodiment, the linker is a
hydrocarbon linker. Such a linker may have the structure
--(CH.sub.2).sub.n--, where n is 1-12, preferably 2-8, and more
preferably 2-6.
[0140] The use of embodiments of linkage types (b1), (b2) and (b3)
above to link morpholino subunits may be illustrated graphically as
follows:
##STR00002##
[0141] Preferably, all cationic linkages in the oligomer are of the
same type; i.e. all of type (b1), all of type (b2), or all of type
(b3). The base-pairing moieties Pi may be the same or different,
and are generally designed to provide a sequence which binds to a
target nucleic acid.
[0142] In further embodiments, the cationic linkages are selected
from linkages (b1') and (b1'') as shown below, where (b1') is
referred to herein as a "Pip" linkage and (b1'') is referred to
herein as a "GuX" linkage:
##STR00003##
[0143] In the structures above, W is S or O, and is preferably O;
each of R.sup.1 and R.sup.2 is independently selected from hydrogen
and lower alkyl, and is preferably methyl; and A represents
hydrogen or a non-interfering substituent on one or more carbon
atoms in (b1') and (b1''). Preferably, the ring carbons in the
piperazine ring are unsubstituted; however, they may include
non-interfering substituents, such as methyl or fluorine.
Preferably, at most one or two carbon atoms is so substituted.
[0144] In further embodiments, at least 10% of the linkages are of
type (b1') or (b1''); for example, 20% to 80%, 20% to 50%, or 20%
to 30% of the linkages may be of type (b1') or (b1'').
[0145] In other embodiments, the oligomer contains no linkages of
the type (b1') above. Alternatively, the oligomer contains no
linkages of type (b1) where each R is H, R.sup.3 is H or CH.sub.3,
and R.sup.4 is H, CH.sub.3, or an electron pair.
[0146] Oligomers having any number of cationic linkages can be
used, including fully cationic-linked oligomers. Preferably,
however, the oligomers are partially charged, having, for example,
5, 10, 20, 30, 40, 50, 60, 70, 80 or 90 percent cationic linkages.
In selected embodiments, about 10 to 80, 20 to 80, 20 to 60, 20 to
50, 20 to 40, or about 20 to 35 percent of the linkages are
cationic.
[0147] In one embodiment, the cationic linkages are interspersed
along the backbone. The partially charged oligomers preferably
contain at least two consecutive uncharged linkages; that is, the
oligomer preferably does not have a strictly alternating pattern
along its entire length.
[0148] Also considered are oligomers having blocks of cationic
linkages and blocks of uncharged linkages; for example, a central
block of uncharged linkages may be flanked by blocks of cationic
linkages, or vice versa. In one embodiment, the oligomer has
approximately equal-length 5'', 3'' and center regions, and the
percentage of cationic linkages in the center region is greater
than about 50%, preferably greater than about 70%.
[0149] Oligomers for use in antisense applications generally range
in length from about 10 to about 40 subunits, more preferably about
15 to 25 subunits. For example, a cationic oligomer having 19-20
subunits, a useful length for an antisense oligomer, may ideally
have two to seven, e.g. four to six, or three to five, cationic
linkages, and the remainder uncharged linkages. An oligomer having
14-15 subunits may ideally have two to five, e.g. 3 or 4, cationic
linkages and the remainder uncharged linkages.
[0150] Each morpholino ring structure supports a base pairing
moiety, to form a sequence of base pairing moieties which is
typically designed to hybridize to a selected antisense target in a
cell or in a subject being treated. The base pairing moiety may be
a purine or pyrimidine found in native DNA or RNA (A, G, C, T, or
U) or an analog, such as hypoxanthine (the base component of the
nucleoside inosine) or 5-methyl cytosine.
[0151] As noted above, the substantially uncharged oligonucleotide
may be modified to include one or more charged linkages, e.g. up to
about 1 per every 2-5 uncharged linkages, typically 3-5 per every
10 uncharged linkages. Optimal improvement in antisense activity is
seen where up to about half of the backbone linkages are cationic.
Some, but not maximum enhancement is typically seen with a small
number e.g., 10-20% cationic linkages; where the number of cationic
linkages exceeds 50-60%, the sequence specificity of the antisense
binding to its target may be compromised or lost.
[0152] The enhancement seen with added cationic backbone charges
may, in some case, be further enhanced by distributing the bulk of
the charges close of the "center-region" backbone linkages of the
antisense oligonucleotide, e.g., in a 20-mer oligonucleotide with 8
cationic backbone linkages, having 70%-100% of these charged
linkages localized in the 10 centermost linkages.
C. Other Oligomer Types
[0153] Delivery of alternative antisense chemistries can also
benefit from the disclosed carrier peptide. Specific examples of
other antisense compounds useful in this invention include those in
which at least one, or all, of the internucleotide bridging
phosphate residues are modified phosphates, such as methyl
phosphonates, phosphorothioates, or phosphoramidates. Also included
are molecules wherein at least one, or all, of the nucleotides
contains a 2' lower alkyl moiety (e.g., C1-C4, linear or branched,
saturated or unsaturated alkyl, such as methyl, ethyl, ethenyl,
propyl, 1-propenyl, 2-propenyl, or isopropyl).
[0154] In other oligonucleotide mimetics, both the sugar and the
internucleoside linkage, i.e., the backbone, of the nucleotide
units are modified. The base units are maintained for hybridization
with an appropriate nucleic acid target compound. One such
oligomeric compound, an oligonucleotide mimetic that has been shown
to have excellent hybridization properties, is referred to as a
peptide nucleic acid (PNA). In PNA compounds, the sugar-phosphate
backbone of an oligonucleotide is replaced with an amide containing
backbone, in particular an aminoethylglycine backbone.
[0155] Modified oligonucleotides may be classified as "chimeric",
e.g. containing at least one region wherein the oligonucleotide is
modified so as to confer increased resistance to nuclease
degradation or increased cellular uptake, and an additional region
for increased binding affinity for the target nucleic acid.
EXAMPLES
[0156] The following examples are intended to illustrate but not to
limit the invention.
Materials and Methods
[0157] In Vitro and In Vivo Assays
[0158] Nuclear Activity Assay. The effectiveness of each P-PMO
conjugate was determined in a splice-correction assay to assess
nuclear activity which utilizes a P-PMO targeted splice site in a
plasmid created by an interruption in the luciferase coding
sequence by the human .beta.-globin thalassemic intron 2 which
carries a mutated splice site at nucleotide 705 (pLuc705). The
plasmid is stably transfected in HeLa S3 cells, allowing for easy
comparison of the relative efficiency of various carrier peptides
to deliver PMO (705; 5'-CCT CTT ACC TCA GTT ACA-3'; SEQ ID NO: 1)
capable of restoring splice-correction in cell nuclei. Cells were
cultured in RPMI 1640 medium supplemented with 2 mM L-Glutamine,
100 U/mL penicillin, and 10% fetal bovine serum (FBS) at 37.degree.
C. in a humidified atmosphere containing 5% CO.sub.2, and seeded
for 20 hours prior to 2 .mu.M P-PMO treatment. All cell treatments
with P-PMO were carried out in OptiMEM medium with or without FBS
for 24 hours. After cell treatment, restoration of correct
splice-correction was measured by positive readout of luciferase
expression in cell lysates on an Flx 800 microplate
fluorescence-luminescence reader with excitation at 485 nm and
emission at 524 nm.
[0159] Cell Uptake Assay. The cellular uptake of P-PMO in HeLa
pLuc705 cells was determined using 3'-carboxyfluorescein-tagged
P-PMO (P-PMOF) and flow cytometry. Cells were seeded for 20 hours
prior to 2 .mu.M P-PMOF treatment. After treatment, cells were
trypsinized to remove any cell membrane-bound P-PMOF, and washed
and resuspended in PBS (Hyclone, Ogden, Utah) containing 1% FBS and
0.2% NaN.sub.3. Cell uptake of P-PMOF was then determined by flow
cytometry on a FC-500 Beckman Coulter (Fullerton, Calif.) cytometer
and data was processed using FCS Express 2 software (De Novo
Software, Thornhill, Ontario, Canada).
[0160] RNA Extraction. Tissue RNA was extracted using Qiagen's
RNeasy Mini Kit (Qiagen USA, Valencia, Calif.) per manufacturer's
protocol. All isolated RNA was stored at -80.degree. C.
[0161] RT-PCR. Restoration of splice-correction was determined by
RT-PCR amplification of EGFP mRNA extracted from tissues harvested
from P-PMO treated EGFP-654 transgenic mice using the Invitrogen
SuperScript.TM. III One-Step RT-PCR System.
[0162] Toxicity Assays
[0163] The cellular toxicity of P-PMOs was determined by
methylthiazoletetrazolium-survival (MTT), propidium iodine (PI)
exclusion, and hemolysis assays, which measured the effects of the
P-PMOs on cellular metabolic activity, membrane integrity, and red
blood cell compatibility, respectively.
[0164] MTT Analysis. For MTT analysis, cells were seeded at a
concentration of 9000 cells/well in 96 well plates for 20 hours
then treated with P-PMO ranging in concentration from 2-60 .mu.M.
MTT solution was then added to the cells for 4 hours and cellular
metabolic activity was measured by reading the absorbance of the
treatment medium and normalizing the absorbance of the P-PMO
treated samples to the absorbance mean of untreated samples.
Microscopic images of P-PMO treated cells were visualized on a
Nikon Diaphot inverted microscope (Melville, N.Y.) and processed by
Magnafire software (Optronics, Goleta, Calif.) for correlation with
MTT results. All assays were done using HeLa pLuc705 cells.
Microscopic images of P-PMO treated cells were visualized on a
Nikon Diaphot inverted microscope (Melville, N.Y.) and processed by
Magnafire software (Optronics, Goleta, Calif.) for correlation with
MTT results. All assays were done using HeLa pLuc705 cells.
[0165] Propidium Iodine-Exclusion. For PI-exclusion analysis, cells
were seeded at a concentration of 100,000 cells/well in 12-well
plates for 20 hours then treated with P-PMO ranging in
concentration from 2-60 .mu.M. Cells were then trypsinized, washed
in PBS, and resuspended in PBS containing PI for 15 minutes.
Detection of unhealthy or damaged cellular membranes was done by
analyzing cells for PI uptake by flow cytometry.
[0166] Red Blood Cell Compatibility. Hemolytic activities in red
blood cells exposed to P-PMO ranging in concentration from 2-60
.mu.M was determined using fresh rat blood according to an
established method (Fischer, Li et al. 2003).
[0167] MDX Mouse Experiments. Experiments using the MDX mouse
strain were performed essentially as described by
Jearawiriyapaisarn, Moulton et al., 2008.
Example 1
Evaluation of Cell Penetrating Peptide Conjugated PMOs in the
EGFP-654 Transgenic Mouse Model
[0168] A PMO (designated 654; 5'-GCT ATT ACC TTA ACC CAG-3'; SEQ ID
NO: 2) designed to restore correct splicing in the enhanced green
fluorescent protein (EGFP) gene was conjugated to various cell
penetrating peptides (SEQ ID NOS: 2, 3, 6, 11, 13-14, 19, 20-27) to
produce P-PMOs (peptide-conjugated PMOs), which were evaluated in
vivo for their splice-correction activity and toxicity in the
EGFP-654 transgenic mouse model (Sazani, Gemignani et al. 2002). In
this model, the EGFP-654 gene encoding for functional EGFP is
interrupted by an aberrantly-spliced mutated intron, and cellular
uptake of EGFP-654 targeted P-PMOs can be evaluated by RT-PCR
detection of the restored EGFP-654 splice product in tissues.
[0169] Female EGFP-654 transgenic mice were injected IP once daily
for 4 consecutive days with saline or a 12.5 mg/kg dose of P-PMO.
Post treatment on day 4, the heart, muscles, liver, kidney, lungs,
small intestine, colon, stomach, mammary gland, thymus, spleen,
ovary, skin, bone marrow, and brain were harvested, and extracted
RNA was evaluated by RT-PCR and densitometry of PCR products to
determine % correction. Toxicity of P-PMOs was evaluated by
measurement of mouse weights over the course of treatments and
immediately prior to necropsy.
[0170] Restoration of functional EGFP splice products post
treatment with various P-PMOs based on RT-PCR analysis of tissues
is shown in FIGS. 7A-P. Analysis of toxicity based on weights from
P-PMO treated mice indicated minimal toxicity (not shown). Optimal
carrier peptide uptake for each tissue (indicated by a *) based on
these results is summarized in Table 2 (see above).
Example 2
Evaluation of PMOs Conjugated to a Cell Penetrating Peptide (CPP)
and/or a Muscle Specific Homing Peptide (HP) in the MDX Murine
Model of Duschenes Muscular Dystrophy
[0171] MDX mice were treated with a series of P-PMO
(peptide-conjugated PMOs) containing various combinations of
muscle-specific CPPs and HPs conjugated to the M23d antisense PMO.
The muscle specific CPP used was the "B peptide", also designated
CP06062 (SEQ ID NO: 19), and the muscle specific homing peptide,
designated SMP1, was SEQ ID NO: 51. Four combinations were tested
including CP06062-PMO, MSP-PMO, CP06062-MSP-PMO and
MSP-CP06062-PMO, whose compositions are shown in the appended
Sequence Table. The M23d antisense PMO (SEQ ID NO: 77) has a
sequence targeted to induce an exon 23 skip in the murine
dystrophin gene and restores functional dystrophin.
[0172] The mice received six weekly intravenous injections of a 3
mg/kg dose. The treated mice were sacrificed and various muscle
tissues were removed and stained for full-length dystrophin using a
dystrophin-specific fluorescent antibody stain.
[0173] The results for the CP06062-PMO, MSP-CP06062-PMO and
CP06062-MSP-PMO conjugates in five different muscle tissues are
shown in FIG. 8. As can be seen, the dystrophin-specific stain is
in much greater evidence for the MSP-CP06062-PMO compound than for
the other two conjugates, with the exception of heart muscle, where
the CP06062-MSP-PMO conjugate appeared to have the greatest
activity. The observation that the CP06062-MSP-PMO compound was
more effective than the CP06062-PMO conjugate was confirmed by
immunoblot and PCR assays (data not shown). In separate experiments
(data not shown), an MSP-PMO conjugate induced full-length
dystrophin at a level less than the CP06062-PMO conjugate.
[0174] Additional examples of muscle-specific delivery of the
CP06062-M23d conjugate to tissues of the MDX mouse can be found in
Jearawiriyapaisarn, Moulton et al., 2008, cited above, which is
incorporated herein by reference.
[0175] In summary, the combination of the muscle specific homing
peptide and muscle specific cell penetrating peptide significantly
improved the delivery of the M23d antisense peptide as measured in
this in vivo system. The MSP-CP06062-PMO ordering of the peptide
moieties was observed to induce the highest level of full-length
dystrophin and is a preferred embodiment.
Example 3
Improved Cardiac Function in Dystrophin-Deficient Mice by a
(RXRRBR).sub.2XB-Conjugated PMO
[0176] It has been demonstrated that a PMO (M23d; SEQ ID NO: 37)
targeting the junction of exon 23 and intron 23 of mouse dystrophin
(referred to as M23d hereafter), was able to induce up to
functional levels of dystrophin expression in some skeletal muscles
by regular i.v. injections in mdx mice (Alter, J., F. Lou et al.
(2006)). However, dystrophin expression induced by PMO required
high doses and was highly variable between muscles and myofibers in
terms of observed efficacy. Of greater concern, cardiac muscle
seemed to be refractory to the antisense therapy, failing to
produce detectable dystrophin even after repeated treatment (seven
times at .apprxeq.60 mg/kg PMO per injection; Alter, J., F. Lou et
al. (2006)). Both potency and cardiac delivery represent major
limitations to antisense therapy as an effective treatment for
muscle-specific diseases such like DMD, DM1 and DM2. Because DMD
patients live longer owing to improved multidisciplinary patient
care, rescuing dystrophin expression in cardiac muscle becomes more
critical for their longevity and quality of life. More importantly,
restoration of dystrophin only in skeletal muscles may exacerbate
the failure of heart function if dystrophin expression cannot be
effectively restored in cardiac muscle. It is not understood why
PMO does not induce dystrophin expression effectively in cardiac
muscle even at high doses but low delivery efficiency seems to be
the most important contributing factor (Alter, J., F. Lou et al.
(2006)). This example describes experiments using a
cell-penetrating peptide-conjugated PMO (SEQ ID NO: 62,
M23d-CP06062 (SEQ ID NO:37, SEQ ID NO:19); in the MDX mouse model.
The results demonstrate the restoration of almost normal levels of
dystrophin in cardiac and other types of muscles bodywide in
dystrophic mdx mice, with improvement in muscle strength and
cardiac function. The latter prevents heart failure under increased
workload conditions induced by dobutamine. Repeated treatment
maintains levels of dystrophin and ameliorates pathology, with
significant reduction in levels of serum creatine kinase without
immune response.
[0177] To improve the efficiency of exon skipping in muscles,
particularly in cardiac muscle, several arginine-rich
cell-penetrating peptides conjugated to the same M23d PMO (SEQ ID
NO: 62) were tested in the MDX mouse model. The M23d-PMO conjugated
to the (RXRRBR).sub.2XB (SEQ ID NO: 19) (also referred to herein as
CP06062 peptide) showed the highest efficiency for skipping exon 23
by i.m. injection in the adult (age 4-5 weeks) MDX mouse (FIG.
9).
[0178] Strong dystrophin expression was induced in 85% of the
fibers in the entire tibialis anterior (TA) muscle after injection
of 2 micrograms of M23d-CP06062 PPMO (FIG. 9). The same amount of
unconjugated M23d PMO produced only 14% dystrophin-positive fibers.
A sequence-scrambled PPMO (with the antisense oligomer sequence not
complementary to the dystrophin gene but the same base composition
as M23d) showed no effect on dystrophin production (not shown).
Specific skipping of exon 23 was confirmed by RT-PCR and subsequent
sequencing. No increases in muscle damage, inflammatory cellular
infiltrates, or necrotic fibers were observed microscopically in
the muscles injected with any of the PPMOs and PMO.
[0179] Systemic treatment was investigated by administration of a
single dose of 30 mg/kg of M23d-CP06062 PPMO i.v. into adult MDX
mice. Administration of this amount of unmodified M23d PMO induced
dystrophin expression in 5% or less of muscle fibers of all
skeletal muscles and no detectable dystrophin in cardiac muscle
when examined 2 weeks after injection (Alter, J., F. Lou et al.
(2006)). In striking contrast, treatment with M23d-CP06062 PPMO
produced strong dystrophin expression in 100% of fibers of all
skeletal muscles examined, including the TA, quadriceps,
gastrocnemius, abdominal, intercostals, diaphragm, and biceps
(FIGS. 10, B-D). Expression of dystrophin was highly homogeneous
throughout the entire length of the muscles (from tendon to
tendon). In fact, the levels of dystrophin expression in the
muscles of the M23d-CP06062 PPMO-treated mice were difficult to
distinguish from that in the muscles of normal C57BL mice by
immunohistochemical analysis (FIGS. 10, B-D). However, variation in
fiber size and specifically the presence of central nucleation in
most muscle fibers were the unmistakable remaining pathology of the
mdx mouse. Consistently, near-normal levels (91-100%) of dystrophin
were detected by Western blot (FIG. 10, E). The size of the
M23d-CP06062 PPMO-induced dystrophin was indistinguishable from
that of the normal dystrophin. Similarly, dystrophin mRNA with exon
23 skipped accounted for 80-86% of RT-PCR products in all skeletal
muscles (FIG. 10, G). No off-target skipping of the neighboring
exons was observed. Precise skipping of exon 23 was confirmed by
sequencing (FIG. 10, H). Restoration of dystrophin expression also
restored the a dystroglycan, a sarcoglycan, and .beta. sarcoglycan
on fiber membrane (not shown). Dystrophin expression was not
observed in the muscles of the mdx mice treated with scrambled PPMO
(FIGS. 10, B-G).
[0180] Importantly, immunohistochemistry demonstrated
membrane-localized dystrophin in 94% of cardiac muscle fibers of
mdx mice treated with the single dose of M23d-CP06062 PPMO,
although the levels of dystrophin varied (FIG. 10, D). Dystrophin
was expressed at near-normal levels in most areas of the cardiac
muscle. A 58% normal dystrophin level was demonstrated by Western
blot (FIG. 10, E). Consistently, dystrophin mRNA with exon 23
skipped accounted for 63% of the dystrophin transcript by RT-PCR
(FIG. 10, G).
[0181] Regular injections of the arginine-rich peptide to maintain
or further enhance dystrophin expression was investigated. A group
of five adult mdx mice received a 3-month treatment with repeated
(six times) i.v. injections of 30 mg/kg of M23d-CP06062 PPMO at
biweekly intervals. Two weeks after the last injection, dystrophin
expression remained in 100% of muscle fibers in all skeletal
muscles, including the diaphragm and smooth muscles in the small
intestine (FIGS. 11, A-C, FIG. 12). The levels of dystrophin
expression detected by both immunohistochemistry and Western blot
in the M23d-CP06062 PPMO-treated mdx mice were again
indistinguishable from those in normal C57BL mouse (FIG. 11, D).
The dystrophin mRNA with exon 23 skipped accounted for nearly 90%
(85-92%) of total dystrophin mRNA by RT-PCR in all skeletal muscles
(FIG. 11, F).
Example 4
Single Low-Dose (RXRRXR).sub.2XB PPMO Conjugates Restore Dystrophin
Expression in Muscle and Cardiac Tissue
[0182] Single intravenous injections of PPMO conjugates to restore
dystrophin expression systemically was investigated. A 25 mg/kg
single injection administration protocol was tested with the
(RXRRXR).sub.2XB-M23d PPMO conjugate (SEQ ID NO: 77 conjugated to
SEQ ID NO: 11) administered via the mouse tail vein. Three weeks
following single injections, all skeletal muscle fibres
immunostained positive for sarcolemmal dystrophin. The intensity of
dystrophin expression was near normal in most skeletal muscle
groups analysed, although slightly lower in biceps as shown (FIG.
13A). Widespread, uniform expression of dystrophin protein over
multiple tissue sections within each muscle group was detected in
hind limb, fore limb, abdominal wall and diaphragm muscles.
Surprisingly, no obvious area-to-area variation was found within
individual muscle groups as previously reported with the systemic
delivery of naked PMO AOs (Alter, J., F. Lou et al. (2006)). RT-PCR
results revealed almost total exon skipping of the mutated
transcript with highly effective skipping of mdx dystrophin exon 23
(FIG. 13B) in all skeletal muscles analysed including the
diaphragm. Less efficient molecular correction was observed in
heart, where 50% of the mutated transcript was found to be exon
skipped by RT-PCR. A shorter band was also detected in the RT-PCR
assay in many analysed tissues, which was likely to correspond to a
skipped transcript lacking exons 22 and 23. Subsequent sequencing
of this PCR fragment confirmed that the minor transcript product
contained exon 22 and 23 deletions.
[0183] To quantify the levels of dystrophin protein restored,
western blot analysis was undertaken, using total protein extracted
from all muscle groups including heart, and from normal C57 TA and
heart muscle tissues as positive controls. This indicated that
between 25 and 100% of normal dystrophin protein levels had been
restored in body-wide skeletal muscles following the single
systemic AO injection. Of particular significance were the levels
approaching 100% restoration of dystrophin protein that were
detected in distal muscle groups, i.e. TA and biceps, while even in
the diaphragm almost 25% of normal dystrophin protein was restored
(FIG. 13C).
[0184] Although the invention has been described with respect to
certain embodiments and examples, it will be appreciated that
various changes, modifications, and additions may be made without
departing from the claimed invention.
TABLE-US-00003 Sequence Table SEQ ID Designation(s) Sequence
NO..sup.a Antisense Oligomers 705 5'-CCT CTT ACC TCA GTT 1 ACA-3'
654 5'-GCT ATT ACC TTA ACC 2 CAG-3' Cell-Penetrating Peptides (CPP)
R.sub.8 RRRRRRRR-XB 3 r.sub.8 rrrrrrrr-XB 4 R.sub.9 RRRRRRRR-XB 5
(RX).sub.8 RXRXRXRXRXRXRXRX-B 6 (rX).sub.8 rXrXrXrXrXrXrXrX-B 7
(RX).sub.7 RXRXRXRXRXRXRX-B 8 (RX).sub.5 RXRXRXRXRX-B 9 (RX).sub.3
RXRXRX-B 10 (RXR).sub.4 RXRRXRRXRRXRX-B 11 (rXR).sub.4
rXRrXRrXRrXR-B 12 (rXr).sub.4 rXrrXrrXrrXr-XB 13 (RB).sub.8
RBRBRBRBRBRBRBRB-B 14 (rB).sub.8 rBrBrBrBrBrBrBrB-B 15 (RB).sub.7
RBRBRBRBRBRBRB-B 16 (RB).sub.5 RBRBRBRBRB-B 17 (RB).sub.3 RBRBRB-B
18 B(3b); CP06062; RXRRBRRXRRBR-XB 19 (RXRRBR).sub.2XB D(2):
RBRBRBRBRBRXRBRX-B 20 (RB).sub.5RXRBRX-B E(3c); RBRBRBRXRBRBRBRX-X
21 (RBRBRBRX).sub.2X F(3a); X-RBRBRBRXRBRBRBRX 22
X-RB).sub.3RX(RB).sub.3RX G(4b); (RBRX).sub.4B RBRXRBRXRBRXRBRX-B
23 H(4a); RBRBRBRBRXRXRXRX-B 24 (RB).sub.4(RX).sub.4B I(3d);
RXR3RBRXRBRBRRBRX-X 25 RX(RB).sub.2RX(RB).sub.3 RX-X C(4c);
RXRRXRRXRRBR-XB 26 (RXR).sub.3RBR-XB (RB).sub.7RX-B
RBRBRBRBRBRBRBRX-B 27 Oligonucleotide sequences H53A(+39+69)
CATTCAACTGTTGCCTCCGGTTCT 28 GAAGGTG H53A(+39+62)
CTGTTGCCTCCGGTTCTGAAGGTG 29 H53A(+45+69) CATTCAACTGTTGCCTCCGGTTCT
30 G H44A(+85+104) TTTGTGTCTTTCTGAGAAAC 31 H44A(-06+14)
ATCTGTCAAATCGCCTGCAG 32 H44D (+10-10) AAAGACTTACCTTAAGATAC 33
AVI-4657 (hu-exon51) CTT ACA GGC TCC AAT AGT 34 GGT CAG T
Hu.DMD.Exon51.010 ATT TCT AGT TTG GAG ATG 35 GCA GTT TC
Hu.DMD.Exon51.012 GAG CAG GTA CCT CCA ACA 36 TCA AGG AA M23d PMO
GGCCAAACCTCGGCTTACCTGAAA 37 T AVI-465 8 CTCCAACATCAAGGAAGATGGCAT 38
(hu-exon 51) TTCTAG Human Myostatin ACTCTGTAGGCATGGTAATG 39 SD1
Human Myostatin CAGCCCATCTTCTCCTGG 40 SD2 Human Myostatin
CACTTGCATTAGAAAATCAG 41 SA2 Human Myostatin CTTGACCTCTAAAAACGGATT
42 SA3 Human Mysostatin-AUG GAGTTGCAGTTTTTGCATG 43 CAG25
AGCAGCAGCAGCAGCAGCAGCAGC 44 A CAG22 AGCAGCAGCAGCAGCAGCAGCA 45 CAG19
AGCAGCAGCAGCAGCAGCA 46 CAG12 AGCAGCAGCAGC 47 CCAG24
AGCCAGCCAGCCAGCCAGCCAGCC 48 CUG39 CUGCUGCUGCUGCUGCUGCUGCUG 49
CUGCUGCUGCUGCUG CCUG40 CCUGCCUGCCUGCCUGCCUGCCUG 50 CCUGCCUGCCUGCCUG
SEQ Peptide Sequence ID Homing peptides (NH.sub.2 to COOH) NO.
Skeletal Muscle- ASSLNIA 51 SMP1 SMP2 SLGSFP 52 SMP3 SGASAV 53 SMP4
GRSGAR 54 SMPS TARGEHKEEELI 55 Cardiac Muscle- WLSEAGPVVTVRALRGTGSW
56 CMP1 CMP2 VTVRALRGTSW 57 CMP3 VVTVRALRGTGSW 58 CMP4 CRPPR 59
CMP5 SKTFNTHPQSTP 60 Conjugate compounds (RXRRBR).sub.2XB-
RXRRBRRXRRBR-XB-G 61 4658 GCCAAACCTCGGCTTACCTGAAAT
(RXRRBR).sub.2XB- RXRRBRRXRRBR-XB-G 62 M23d PMO
GCCAAACCTCGGCTTACCTGAAAT (RXRR(B/X)R).sub.2X RXRRBRRXRRBR-B-G 63
B-myo GCCAAACCTCGGCTTACCTGAAAT (RXRR(B/X)R).sub.2X
RXRRBRRXRRBR-XB-G 64 Bmyo GCCAAACCTCGGCTTACCTGAAAT
(RXRR(B/X)R).sub.2X RXRRBRRXRRBR-XB-A 65 B CAG25
GCAGCAGCAGCAGCAGCAGCAGCA (RXRR(B/X)R).sub.2X RXRRBRRXRRBR-XB- 66 B
CCAG24 AGCCAGCCAGCCAGCCAGCCAGCC .sup.aIn SEQ ID Nos. 3-27,
sequences assigned to SEQ ID NO. do not include the linkage portion
(X, B, or XB).
Sequence CWU 1
1
66118DNAArtificial SequenceSynthetic antisense oligomer 1cctcttacct
cagttaca 18218DNAArtificial SequenceSynthetic antisense oligomer
2gctattacct taacccag 18310PRTArtificial SequenceSynthetic cell
penetrating peptide 3Arg Arg Arg Arg Arg Arg Arg Arg Xaa Xaa1 5
10410PRTArtificial SequenceSynthetic cell penetrating peptide 4Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa1 5 10511PRTArtificial
SequenceSynthetic cell penetrating peptide 5Arg Arg Arg Arg Arg Arg
Arg Arg Arg Xaa Xaa1 5 10617PRTArtificial SequenceSynthetic cell
penetrating peptide 6Arg Xaa Arg Xaa Arg Xaa Arg Xaa Arg Xaa Arg
Xaa Arg Xaa Arg Xaa Xaa1 5 10 15717PRTArtificial SequenceSynthetic
cell penetrating peptide 7Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa Xaa Xaa Xaa Xaa1 5 10 15815PRTArtificial
SequenceSynthetic cell penetrating peptide 8Arg Xaa Arg Xaa Arg Xaa
Arg Xaa Arg Xaa Arg Xaa Arg Xaa Xaa1 5 10 15911PRTArtificial
SequenceSynthetic cell penetrating peptide 9Arg Xaa Arg Xaa Arg Xaa
Arg Xaa Arg Xaa Xaa1 5 10107PRTArtificial SequenceSynthetic cell
penetrating peptide 10Arg Xaa Arg Xaa Arg Xaa Xaa1
51114PRTArtificial SequenceSynthetic cell penetrating peptide 11Arg
Xaa Arg Arg Xaa Arg Arg Xaa Arg Arg Xaa Arg Xaa Xaa1 5
101213PRTArtificial SequenceSynthetic cell penetrating peptide
12Xaa Xaa Arg Xaa Xaa Arg Xaa Xaa Arg Xaa Xaa Arg Xaa1 5
101314PRTArtificial SequenceSynthetic cell penetrating peptide
13Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa1 5
101417PRTArtificial SequenceSynthetic cell penetrating peptide
14Arg Xaa Arg Xaa Arg Xaa Arg Xaa Arg Xaa Arg Xaa Arg Xaa Arg Xaa
Xaa1 5 10 151517PRTArtificial SequenceSynthetic cell penetrating
peptide 15Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
Xaa Xaa Xaa1 5 10 151615PRTArtificial SequenceSynthetic cell
penetrating peptide 16Arg Xaa Arg Xaa Arg Xaa Arg Xaa Arg Xaa Arg
Xaa Arg Xaa Xaa1 5 10 151711PRTArtificial SequenceSynthetic cell
penetrating peptide 17Arg Xaa Arg Xaa Arg Xaa Arg Xaa Arg Xaa Xaa1
5 10187PRTArtificial SequenceSynthetic cell penetrating peptide
18Arg Xaa Arg Xaa Arg Xaa Xaa1 51914PRTArtificial SequenceSynthetic
cell penetrating peptide 19Arg Xaa Arg Arg Xaa Arg Arg Xaa Arg Arg
Xaa Arg Xaa Xaa1 5 102017PRTArtificial SequenceSynthetic cell
penetrating peptide 20Arg Xaa Arg Xaa Arg Xaa Arg Xaa Arg Xaa Arg
Xaa Arg Xaa Arg Xaa Xaa1 5 10 152117PRTArtificial SequenceSynthetic
cell penetrating peptide 21Arg Xaa Arg Xaa Arg Xaa Arg Xaa Arg Xaa
Arg Xaa Arg Xaa Arg Xaa Xaa1 5 10 152217PRTArtificial
SequenceSynthetic cell penetrating peptide 22Xaa Arg Xaa Arg Xaa
Arg Xaa Arg Xaa Arg Xaa Arg Xaa Arg Xaa Arg Xaa1 5 10
152317PRTArtificial SequenceSynthetic cell penetrating peptide
23Arg Xaa Arg Xaa Arg Xaa Arg Xaa Arg Xaa Arg Xaa Arg Xaa Arg Xaa
Xaa1 5 10 152417PRTArtificial SequenceSynthetic cell penetrating
peptide 24Arg Xaa Arg Xaa Arg Xaa Arg Xaa Arg Xaa Arg Xaa Arg Xaa
Arg Xaa Xaa1 5 10 152517PRTArtificial SequenceSynthetic cell
penetrating peptide 25Arg Xaa Arg Xaa Arg Xaa Arg Xaa Arg Xaa Arg
Xaa Arg Xaa Arg Xaa Xaa1 5 10 152614PRTArtificial SequenceSynthetic
cell penetrating peptide 220> 26Arg Xaa Arg Arg Xaa Arg Arg Xaa
Arg Arg Xaa Arg Xaa Xaa1 5 102717PRTArtificial SequenceSynthetic
cell penetrating peptide 27Arg Xaa Arg Xaa Arg Xaa Arg Xaa Arg Xaa
Arg Xaa Arg Xaa Arg Xaa Xaa1 5 10 152831DNAArtificial
SequenceSynthetic antisense oligomer 28cattcaactg ttgcctccgg
ttctgaaggt g 312924DNAArtificial SequenceSynthetic antisense
oligomer 29ctgttgcctc cggttctgaa ggtg 243025DNAArtificial
SequenceSynthetic antisense oligomer 30cattcaactg ttgcctccgg ttctg
253120DNAArtificial SequenceSynthetic antisense oligomer
31tttgtgtctt tctgagaaac 203220DNAArtificial SequenceSynthetic
antisense oligomer 32atctgtcaaa tcgcctgcag 203320DNAArtificial
SequenceSynthetic antisense oligomer 33aaagacttac cttaagatac
203425DNAArtificial SequenceSynthetic antisense oligomer
34cttacaggct ccaatagtgg tcagt 253526DNAArtificial SequenceSynthetic
antisense oligomer 35atttctagtt tggagatggc agtttc
263626DNAArtificial SequenceSynthetic antisense oligomer
36gagcaggtac ctccaacatc aaggaa 263725DNAArtificial
SequenceSynthetic antisense oligomer 37ggccaaacct cggcttacct gaaat
253830DNAArtificial SequenceSynthetic antisense oligomer
38ctccaacatc aaggaagatg gcatttctag 303920DNAArtificial
SequenceSynthetic antisense oligomer 39actctgtagg catggtaatg
204018DNAArtificial SequenceSynthetic antisense oligomer
40cagcccatct tctcctgg 184120DNAArtificial SequenceSynthetic
antisense oligomer 41cacttgcatt agaaaatcag 204221DNAArtificial
SequenceSynthetic antisense oligomer 42cttgacctct aaaaacggat t
214319DNAArtificial SequenceSynthetic antisense oligomer
43gagttgcagt ttttgcatg 194425DNAArtificial SequenceSynthetic
antisense oligomer 44agcagcagca gcagcagcag cagca
254522DNAArtificial SequenceSynthetic antisense oligomer
45agcagcagca gcagcagcag ca 224619DNAArtificial SequenceSynthetic
antisense oligomer 46agcagcagca gcagcagca 194712DNAArtificial
SequenceSynthetic antisense oligomer 47agcagcagca gc
124824DNAArtificial SequenceSynthetic antisense oligomer
48agccagccag ccagccagcc agcc 244939DNAArtificial SequenceSynthetic
antisense oligomer 49cugcugcugc ugcugcugcu gcugcugcug cugcugcug
395040DNAArtificial SequenceSynthetic antisense oligomer
50ccugccugcc ugccugccug ccugccugcc ugccugccug 40517PRTArtificial
SequenceSynthetic homing peptides 51Ala Ser Ser Leu Asn Ile Ala1
5526PRTArtificial SequenceSynthetic homing peptide 52Ser Leu Gly
Ser Phe Pro1 5536PRTArtificial SequenceSynthetic homing peptide
53Ser Gly Ala Ser Ala Val1 5546PRTArtificial SequenceSynthetic
homing peptides 54Gly Arg Ser Gly Ala Arg1 55512PRTArtificial
SequenceSynthetic homing peptide 55Thr Ala Arg Gly Glu His Lys Glu
Glu Glu Leu Ile1 5 105620PRTArtificial SequenceSynthetic homing
peptide 56Trp Leu Ser Glu Ala Gly Pro Val Val Thr Val Arg Ala Leu
Arg Gly1 5 10 15Thr Gly Ser Trp 20 5711PRTArtificial
SequenceSynthetic homing peptide 57Val Thr Val Arg Ala Leu Arg Gly
Thr Ser Trp1 5 105813PRTArtificial SequenceSynthetic homing peptide
58Val Val Thr Val Arg Ala Leu Arg Gly Thr Gly Ser Trp1 5
10595PRTArtificial SequenceSynthetic homing peptide 59Cys Arg Pro
Pro Arg1 56012PRTArtificial SequenceSynthetic homing peptide 60Ser
Lys Thr Phe Asn Thr His Pro Gln Ser Thr Pro1 5 106125DNAArtificial
SequenceSynthetic antisense oligomer 61ggccaaacct cggcttacct gaaat
256225DNAArtificial SequenceSynthetic antisense oligomer
62ggccaaacct cggcttacct gaaat 256325DNAArtificial SequenceSynthetic
antisense oligomer 63ggccaaacct cggcttacct gaaat
256425DNAArtificial SequenceSynthetic antisense oligomer
64ggccaaacct cggcttacct gaaat 256525DNAArtificial SequenceSynthetic
antisense oligomer 65agcagcagca gcagcagcag cagca
256624DNAArtificial SequenceSynthetic antisense oligomer
66agccagccag ccagccagcc agcc 24
* * * * *