U.S. patent application number 12/553061 was filed with the patent office on 2010-01-21 for thermostable reverse transcriptases and uses thereof.
This patent application is currently assigned to LIFE TECHNOLOGIES CORPORATION. Invention is credited to Gulsham Dhariwal, Gary F. Gerard, Robert Jason Potter, Kim Rosenthal, Michael D. Smith.
Application Number | 20100015683 12/553061 |
Document ID | / |
Family ID | 26902037 |
Filed Date | 2010-01-21 |
United States Patent
Application |
20100015683 |
Kind Code |
A1 |
Smith; Michael D. ; et
al. |
January 21, 2010 |
THERMOSTABLE REVERSE TRANSCRIPTASES AND USES THEREOF
Abstract
The present invention is in the fields of molecular and cellular
biology. The invention is generally related to reverse
transcriptase enzymes and methods for the reverse transcription of
nucleic acid molecules, especially messenger RNA molecules.
Specifically, the invention relates to reverse transcriptase
enzymes which have been mutated or modified to increase
thermostability, decrease terminal deoxynucleotidyl transferase
activity, and/or increase fidelity, and to methods of producing,
amplifying or sequencing nucleic acid molecules (particularly cDNA
molecules) using these reverse transcriptase enzymes or
compositions. The invention also relates to nucleic acid molecules
produced by these methods and to the use of such nucleic acid
molecules to produce desired polypeptides. The invention also
concerns kits comprising such enzymes or compositions.
Inventors: |
Smith; Michael D.;
(Rockville, MD) ; Potter; Robert Jason; (San
Marcos, CA) ; Dhariwal; Gulsham; (Potomac, MD)
; Gerard; Gary F.; (Frederick, MD) ; Rosenthal;
Kim; (Laytonsville, MD) |
Correspondence
Address: |
LIFE TECHNOLOGIES CORPORATION;C/O INTELLEVATE
P.O. BOX 52050
MINNEAPOLIS
MN
55402
US
|
Assignee: |
LIFE TECHNOLOGIES
CORPORATION
Carlsbad
CA
|
Family ID: |
26902037 |
Appl. No.: |
12/553061 |
Filed: |
September 2, 2009 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11437681 |
May 22, 2006 |
|
|
|
12553061 |
|
|
|
|
09845157 |
May 1, 2001 |
7078208 |
|
|
11437681 |
|
|
|
|
60207196 |
May 26, 2000 |
|
|
|
Current U.S.
Class: |
435/183 |
Current CPC
Class: |
C12N 9/1276
20130101 |
Class at
Publication: |
435/183 |
International
Class: |
C12N 9/00 20060101
C12N009/00 |
Claims
1. A retroviral reverse transcriptase which has been modified or
mutated to increase or enhance thermostability relative to the
corresponding wild type reverse transciptase.
2. The reverse transcriptase of claim 1, which retains at least 50%
of reverse transcriptase activity after heating to 50.degree. C.
for 5 minutes.
3. The reverse transcriptase of claim 1, which retains at least 70%
of reverse transcriptase activity after heating to 50.degree. C.
for 5 minutes.
4. The reverse transcriptase of claim 1, which retains at least 85%
of reverse transcriptase activity after heating to 50.degree. C.
for 5 minutes.
5. The reverse transcriptase of claim 1, which retains at least 95%
of reverse transcriptase activity after heating to 50.degree. C.
for 5 minutes.
6. The reverse transcriptase of claim 1, wherein the reverse
transcriptase exhibits increased fidelity relative to the
corresponding wild type reverse transcriptase.
7. The reverse transcriptase of claim 1, wherein the reverse
transcriptase exhibits reduced or substantially reduced terminal
deoxynucleotidyl transferase activity relative to the corresponding
wild type reverse transcriptase.
8. The reverse transcriptase of claim 1, wherein the reverse
transcriptase exhibits reduced or substantially reduced RNase H
activity relative to the corresponding wild type reverse
transcriptase.
9. The reverse transcriptase of claim 1, wherein the reverse
transcriptase is selected from the group consisting of M-MLV, RSV,
AMV, and HIV reverse transcriptases.
10. The reverse transcriptase of claim 9, which is M-MLV reverse
transcriptase.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] The present application is a continuation of U.S.
application Ser. No. 09/845,157, filed May 1, 2001, which claims
the benefit of U.S. Provisional Appl. No. 60/207,196, filed May 26,
2000, the entire disclosures of each of which are incorporated
herein by reference.
BACKGROUND OF THE INVENTION
[0002] 1. Field of the Invention
[0003] The present invention is in the fields of molecular and
cellular biology. The invention is generally related to reverse
transcriptase enzymes and methods for the reverse transcription of
nucleic acid molecules, especially messenger RNA molecules.
Specifically, the invention relates to reverse transcriptase
enzymes which have been mutated or modified to increase
thermostability, decrease terminal deoxynucleotidyl transferase
activity, and/or increase fidelity, and to methods of producing,
amplifying or sequencing nucleic acid molecules (particularly cDNA
molecules) using these reverse transcriptase enzymes or
compositions. The invention also relates to nucleic acid molecules
produced by these methods and to the use of such nucleic acid
molecules to produce desired polypeptides. The invention also
concerns kits or compositions comprising such enzymes.
[0004] 2. Related Art
cDNA and cDNA Libraries
[0005] In examining the structure and physiology of an organism,
tissue or cell, it is often desirable to determine its genetic
content. The genetic framework of an organism is encoded in the
double-stranded sequence of nucleotide bases in the
deoxyribonucleic acid (DNA) which is contained in the somatic and
germ cells of the organism. The genetic content of a particular
segment of DNA, or gene, is typically manifested upon production of
the protein which the gene encodes. In order to produce a protein,
a complementary copy of one strand of the DNA double helix is
produced by RNA polymerase enzymes, resulting in a specific
sequence of ribonucleic acid (RNA). This particular type of RNA,
since it contains the genetic message from the DNA for production
of a protein, is called messenger RNA (mRNA).
[0006] Within a given cell, tissue or organism, there exist myriad
mRNA species, each encoding a separate and specific protein. This
fact provides a powerful tool to investigators interested in
studying genetic expression in a tissue or cell. mRNA molecules may
be isolated and further manipulated by various molecular biological
techniques, thereby allowing the elucidation of the full functional
genetic content of a cell, tissue or organism.
[0007] One common approach to the study of gene expression is the
production of complementary DNA (cDNA) clones. In this technique,
the mRNA molecules from an organism are isolated from an extract of
the cells or tissues of the organism. This isolation often employs
solid chromatography matrices, such as cellulose or agarose, to
which oligomers of thymidine (T) have been complexed. Since the 3'
termini on most eukaryotic mRNA molecules contain a string of
adenosine (A) bases, and since A base pairs with T, the mRNA
molecules can be rapidly purified from other molecules and
substances in the tissue or cell extract. From these purified mRNA
molecules, cDNA copies may be made using the enzyme reverse
transcriptase (RT), which results in the production of
single-stranded cDNA molecules. This reaction is typically referred
to as the first strand reaction. The single-stranded cDNAs may then
be converted into a complete double-stranded DNA copy (i.e., a
double-stranded cDNA) of the original mRNA (and thus of the
original double-stranded DNA sequence, encoding this mRNA,
contained in the genome of the organism) by the action of a DNA
polymerase. The protein-specific double-stranded cDNAs can then be
inserted into a plasmid or viral vector; which is then introduced
into a host bacterial, yeast, animal or plant cell. The host cells
are then grown in culture media, resulting in a population of host
cells containing (or in many cases, expressing) the gene of
interest.
[0008] This entire process, from isolation of mRNA from a source
organism or tissue to insertion of the cDNA into a plasmid or
vector to growth of host cell populations containing the isolated
gene, is termed "cDNA cloning." The set of cDNAs prepared from a
given source of mRNAs is called a "cDNA library." The cDNA clones
in a cDNA library correspond to the genes transcribed in the source
tissue. Analysis of a cDNA library can yield much information on
the pattern of gene expression in the organism or tissue from which
it was derived.
Retroviral Reverse Transcriptase Enzymes
[0009] Three prototypical forms of retroviral reverse transcriptase
have been studied thoroughly. Moloney Murine Leukemia Virus (M-MLV)
reverse transcriptase contains a single subunit of 78 kDa with
RNA-dependent DNA polymerase and RNase H activity. This enzyme has
been cloned and expressed in a fully active form in E. coli
(reviewed in Prasad, V. R., Reverse Transcriptase, Cold Spring
Harbor, N.Y.: Cold Spring Harbor Laboratory Press, p. 135 (1993)).
Human Immunodeficiency Virus (HIV) reverse transcriptase is a
heterodimer of p66 and p51 subunits in which the smaller subunit is
derived from the larger by proteolytic cleavage. The p66 subunit
has both a RNA-dependent DNA polymerase and an RNase H domain,
while the p51 subunit has only a DNA polymerase domain. Active HIV
p66/p51s reverse transcriptase has been cloned and expressed
successfully in a number of expression hosts, including E. coli
(reviewed in Le Grice, S. F. J., Reverse Transcriptase, Cold Spring
Harbor, N.Y.: Cold Spring Harbor Laboratory press, p. 163 (1993)).
Within the HIV p66/p51 heterodimer, the 51-kD subunit is
catalytically inactive, and the 66-kD subunit has both DNA
polymerase and RNase H activity (Le Grice, S. F. J., et al., EMBO
Journal 10:3905 (1991); Hostomsky, Z., et al., J Virol. 66:3179
(1992)). Avian Sarcoma-Leukosis Virus (ASLV) reverse transcriptase,
which includes but is not limited to Rous Sarcoma Virus (RSV)
reverse transcriptase, Avian Myeloblastosis Virus (AMV) reverse
transcriptase, Avian Erythroblastosis Virus (AEV) Helper Virus MCAV
reverse transcriptase, Avian Myelocytomatosis Virus MC29 Helper
Virus MCAV reverse transcriptase, Avian Reticuloendotheliosis Virus
(REV-T) Helper Virus REV-A reverse transcriptase, Avian Sarcoma
Virus UR2 Helper Virus UR2AV reverse transcriptase, Avian Sarcoma
Virus Y73 Helper Virus YAV reverse transcriptase, Rous Associated
Virus (RAV) reverse transcriptase, and Myeloblastosis Associated
Virus (MAV) reverse transcriptase, is also a heterodimer of two
subunits, .alpha. (approximately 62 kDa) and .beta. (approximately
94 kDa), in which .alpha. is derived from .beta. by proteolytic
cleavage (reviewed in Prasad, V. R., Reverse Transcriptase, Cold
Spring Harbor, N.Y.: Cold Spring Harbor Laboratory Press (1993), p.
135). ASLV reverse transcriptase can exist in two additional
catalytically active structural forms, .beta..beta. and .alpha.
(Hizi, A. and Joklik, W. K., J. Biol. Chem. 252:2281 (1977)).
Sedimentation analysis suggests .alpha..beta. and .beta..beta. are
dimers and that the a form exists in an equilibrium between
monomeric and dimeric forms (Grandgenett, D. P., et al., Proc. Nat.
Acad. Sci. USA 70:230 (1973); Hizi, A. and Joklik, W. K., J. Biol.
Chem. 252:2281 (1977); and Soltis, D. A. and Skalka, A. M., Proc.
Nat. Acad. Sci. USA 85:3372 (1988)). The ASLV .alpha..beta. and
.beta..beta. reverse transcriptases are the only known examples of
retroviral reverse transcriptase that include three different
activities in the same protein complex: DNA polymerase, RNase H,
and DNA endonuclease (integrase) activities (reviewed in Skalka, A.
M., Reverse Transcriptase, Cold Spring Harbor, N.Y.: Cold Spring
Harbor Laboratory Press (1993), p. 193). The a form lacks the
integrase domain and activity.
[0010] Various forms of the individual subunits of ASLV reverse
transcriptase have been cloned and expressed. These include a
98-kDa precursor polypeptide that is normally processed
proteolytically to .beta. and a 4 kDa polypeptide removed from the
.beta. carboxy end (Alexander, F., et al., J. Virol. 61:534 (1987)
and Anderson, D. et al., Focus 17:53 (1995)), and the mature .beta.
subunit (Weis, J. H. and Salstrom, J. S., U.S. Pat. No. 4,663,290
(1987); and Soltis, D. A. and Skalka, A. M., Proc. Nat. Acad. Sci.
USA 85:3372 (1988)). (See also Wemer S. and Wohrl B. M., Eur. J.
Biochem. 267:4740-4744 (2000); Werner S. and Wohrl B. M., J. Virol.
74:3245-3252 (2000); Werner S. and Wohrl B. M., J. Biol. Chem.
274:26329-26336 (1999).) Heterodimeric RSV .alpha..beta. reverse
transcriptase has also been purified from E. coli cells expressing
a cloned RSV .beta. gene (Chemov, A. P., et al., Biomed. Sci. 2:49
(1991)).
Reverse Transcription Efficiency
[0011] As noted above, the conversion of mRNA into cDNA by reverse
transcriptase-mediated reverse transcription is an essential step
in the study of proteins expressed from cloned genes. However, the
use of unmodified reverse transcriptase to catalyze reverse
transcription is inefficient for a number of reasons. First,
reverse transcriptase sometimes degrades an RNA template before the
first strand reaction is initiated or completed, primarily due to
the intrinsic RNase H activity present in reverse transcriptase. In
addition, mis-priming of the mRNA template molecule can lead to the
introduction of errors in the cDNA first strand while secondary
structure of the mRNA molecule itself may make some mRNAs
refractory to first strand synthesis.
[0012] Removal of the RNase H activity of reverse transcriptase can
eliminate the first problem and improve the efficiency of reverse
transcription (Gerard, G. F., et al., FOCUS 11(4):60 (1989);
Gerard, G. F., et al., FOCUS 14(3):91 (1992)). However such reverse
transcriptases ("RNase H-" forms) do not address the additional
problems of mis-priming and mRNA secondary structure.
[0013] Another factor which influences the efficiency of reverse
transcription is the ability of RNA to form secondary structures.
Such secondary structures can form, for example, when regions of
RNA molecules have sufficient complementarity to hybridize and form
double stranded RNA. Generally, the formation of RNA secondary
structures can be reduced by raising the temperature of solutions
which contain the RNA molecules. Thus, in many instances, it is
desirable to reverse transcribe RNA at temperatures above
37.degree. C. However, art known reverse transcriptases generally
lose activity when incubated at temperatures much above 37.degree.
C. (e.g., 50.degree. C.).
SUMMARY OF THE INVENTION
[0014] The present invention provides reverse transcriptase
enzymes, compositions comprising such enzymes and methods useful in
overcoming limitations of reverse transcription discussed above. In
general, the invention provides compositions for use in reverse
transcription of a nucleic acid molecule comprising one or more
(e.g., one, two, three, four, five, ten, fifteen, etc.)
polypeptides having reverse transcriptase activity of the
invention. Such compositions may further comprise one or more
(e.g., one, two, three, four, five, etc.) nucleotides, a suitable
buffer, and/or one or more (e.g., one, two, three, four, five, ten,
fifteen, etc.) DNA polymerases. The compositions of the invention
may also comprise one or more (e.g., one, two, three, four, five,
ten, fifteen, etc.) oligonucleotide primers.
[0015] The reverse transcriptases of the invention are preferably
modified or mutated such that the thermostability of the enzyme is
increased or enhanced. In specific embodiments, the reverse
transcriptases of the invention may be single chained (single
subunit) or multi-chained (multi-subunit) and may be reduced or
substantially reduced in RNase H activity. Preferably enzymes of
the invention are enzymes selected from the group consisting of
Moloney Murine Leukemia Virus (M-MLV) RNase H- reverse
transcriptase, Rous Sarcoma Virus (RSV) RNase H- reverse
transcriptase, Avian Myeloblastosis Virus (AMV) RNase H- reverse
transcriptase, Rous Associated Virus (RAV) RNase H- reverse
transcriptase, Myeloblastosis Associated Virus (MAV) RNase H-
reverse transcriptase or other ASLV RNase H- reverse transcriptases
and Human Immunodeficiency Virus (HIV) RNase H- reverse
transcriptase and mutants thereof. In preferred compositions, the
reverse transcriptases are present at working concentrations.
[0016] In certain aspects, the invention includes reverse
transcriptases which have been modified or mutated to increase or
enhance thermostability. Examples of such reverse transcriptases
include enzymes having one or more modifications or mutations at
positions corresponding to amino acids selected from the group
consisting of:
[0017] (a) leucine 52 of M-MLV reverse transcriptase;
[0018] (b) tyrosine 64 of M-MLV reverse transcriptase;
[0019] (c) lysine 152 of M-MLV reverse transcriptase;
[0020] (d) histidine 204 of M-MLV reverse transcriptase;
[0021] (e) methionine 289 of M-MLV reverse transcriptase; and
[0022] (f) threonine 306 of M-MLV reverse transcriptase.
[0023] In specific embodiments, the invention is directed to M-MLV
reverse transcriptases wherein leucine 52 is replaced with proline,
tyrosine 64 is replaced with arginine, lysine 152 is replaced with
methionine, histidine 204 is replaced with arginine, methionine 289
is replaced with leucine, and/or threonine 306 is replaced with
either lysine or arginine. Further included within the scope of the
invention are reverse transcriptases, other than M-MLV reverse
transcriptase, which contain alterations corresponding to those set
out above.
[0024] In additional aspects, the invention also include
thermostable reverse transcriptases which retain at least about
50%, at least about 60%, at least about 70%, at least about 85%, at
least about 95%, at least about 97%, at least about 98%, at least
about 99%, or at least about 100% of reverse transcriptase activity
after heating to 50.degree. C. for 5 minutes.
[0025] As noted above, enzymes of the invention include reverse
transcriptases which exhibit reverse transcriptase activity either
upon the formation of multimers (e.g., dimers) or as individual
protein molecules (i.e., in monomeric form). Examples of reverse
transcriptases which exhibit reverse transcriptase activity upon
the formation of multimers include AMV, RSV and HIV reverse
transcriptases. One example of a reverse transcriptase which
exhibits reverse transcriptase activity as separate, individual
proteins (i.e., in monomeric form) is M-MLV reverse
transcriptase.
[0026] Multimeric reverse transcriptases of the invention may form
homo-multimers or hetero-multimers. In other words, the subunits of
the multimeric protein complex may be identical or different. One
example of a hetero-dimeric reverse transcriptase is AMV reverse
transcriptase, which is composed of two subunits that differ in
primary amino acid sequence. More specifically, as already
discussed, AMV reverse transcriptase may be composed of two
subunits wherein one of these subunits is generated by proteolytic
processing of the other. Thus, dimeric AMV reverse transcriptase
may be composed of subunits of differing size which share regions
of amino acid sequence identity.
[0027] The present invention relates in particular to mutant or
modified reverse transcriptases wherein one or more (e.g., one,
two, three, four, five, ten, twelve, fifteen, twenty, etc.) amino
acid changes have been made which renders the enzyme more
thermostable in nucleic acid synthesis, as compared to the
unmutated or unmodified reverse transcriptases. Sites for mutation
or modification to produce the thermostable reverse transcriptase
enzymes of the present invention and/or reverse transcriptases
which exhibit other characteristics (e.g., increased fidelity,
decreased TdT activity, etc.) are listed for some reverse
transcriptases in Table 1. The modifications described in Table 1
preferably produce thermostable reverse transcriptases of the
invention. Similar or equivalent sites or corresponding sites in
other reverse transcriptases can be mutated or modified to produce
additional thermostable reverse transcriptases, as well as reverse
transcriptases which exhibit other characteristics (e.g., increased
fidelity, decreased TdT activity, etc.).
TABLE-US-00001 TABLE 1 RT Amino Acids M-MLV L52, Y64, L135, H143,
K152, Q165, G181, H204, I218, N249, M289, T306, A517, D524, T544,
V546, W548, E562, H577, D583, L604, S606, G608, F625, L626, H629,
H631, H638, G641 AMV V2, L4, W12, P14, H16, T17, W20, I21, Q23,
W24, L26, P27, G29, V32, Q36, L42, Q43, L44, G45, H46, I47, P49,
S50, L51, S52, C53, W54, F59, I61, A64, S65, G66, S67, Y68, L70,
L71, A76, A79, P83, A86, V87, Q88, Q89, G90, A91, W101, P102, L108,
Q120, S131, V132, N133, N134, Q135, P137, A138, Q142, Q148, T151,
Y180, M181, S190, H191, G193, A196, I201, S202, P214, V217, Q218,
P221, G222, Q224, L226, G227, Y228, G231, T233, Y234, A236, P237,
G239, L240, P244, I246, T248, W250, Q252, G257, Q260, W261, P264,
L266, G267, L272, Y277, Q279, L280, G282, S283, P285, N286, A288,
N292, L293, M297, I302, V303, L305, S306, T308, L311, L320, I332,
G333, V334, G336, Q337, G338, P345, W348, L349, F350, S351, P354,
A357, F358, A360, W361, L362, V364, L365, T366, T370, A374, V377,
G381, C392, P400, G402, L405, G412, I414, F423, I425, A426, P428,
L433, H440, P441, V443, G444, P445, A451, S453, S454, T455, H456,
G458, V459, V460, W462, W468, I470, I473, A474, L476, G477, A478,
S479, V480, Q481, Q482, L483, A491, W495, P496, T497, T498, P499,
T500, A507, F508, M512, L513, G520, V521, P522, S523, T524, A525,
A527, F528, L534, S535, Q536, S538, V543, S548, H549, S550, V552,
P553, F556, T557, N560, A562 RSV V2, L4, W12, P14, H16, T17, W20,
I21, Q23, W24, L26, P27, G29, V32, Q36, L42, Q43, L44, G45, H46,
I47, P49, S50, L51, S52, C53, W54, F59, I61, A64, S65, G66, S67,
Y68, L70, L71, A76, A79, P83, A86, V87, Q88, Q89, G90, A91, W101,
P102, L108, Q120, S131, V132, N133, N134, Q135, P137, A138, Q142,
Q148, T151, Y180, M181, S190, H191, G193, A196, I201, S202, P214,
V217, Q218, P221, G222, Q224, L226, G227, Y228, G231, T233, Y234,
A236, P237, G239, L240, P244, I246, T248, W250, Q252, G257, Q260,
W261, P264, L266, G267, L272, Y277, Q279, L280, G282, S283, P285,
N286, A288, N292, L293, M297, I302, V303, L305, S306, T308, L311,
L320, I332, G333, V334, G336, Q337, G338, P345, W348, L349, F350,
S351, P354, A357, F358, A360, W361, L362, V364, L365, T366, T370,
A374, V377, G381, C392, P400, G402, L405, G412, I414, F423, I425,
A426, P428, L433, H440, P441, V443, G444, P445, A451, S453, S454,
T455, H456, G458, V459, V460, W462, W468, I470, I473, A474, L476,
G477, A478, S479, V480, Q481, Q482, L483, A491, W495, P496, T497,
T498, P499, T500, A507, F508, M512, L513, G520, V521, P522, S523,
T524, A525, A527, F528, L534, S535, Q536, S538, V543, S548, H549,
S550, V552, P553, F556, T557, N560, A562 HIV I1, P3, L11, P13, G14,
M15, Q22, W23, L25, T26, T38, G44, I46, S47, G50, P51, N53, P54,
Y55, F60, I62, S67, T68, W70, L73, V89, Q90L91, G92, I93, S104,
V110, G111, S133, I134, N135, N136, P139, G140, I141, Q144, N146,
Q150,, Y182, M183, I194, G195, Q196, T,199, Q206, L209, P216, Q221,
P224, P225, L227, M229, G230, Y231, H234, Q241, P242, V244, L245,
S250, T252, N254, Q257, G261, N264, W265, Q268, P271, G272, Q277,
C279, L281, L282, G284, T285, A287, L288, T289, V291, P293, L294,
T295, L300, A303, I308, L309, P312, H314, Y317, L324, I328, Q329,
G332, Q333, G334, Y341, P344, F345, Y353, M356, G358, A359, H360,
T361, Q372, T376, V380, Q392, W405, Q406, A407, F415, V416, N417,
T418, P419, P420, L424, W425, P432, V434, G435, A436, A444, A445,
N446, T449, L451, N459, G461, Q463, V465, V466, P467, L468, T469,
N470, T471, T472, N473, Q474, Y482, Q486, S488, G489, L490, Q499,
Y500, G503, I504, S512, S514, L516, N518, Q519, Q523, I525, W534,
P536, A537, H538, G540, I541, G542, Q546, L550, S552, A553, V554,
I555
[0028] Those skilled in the art will appreciate that a different
isolate of virus may encode a reverse transcriptase enzyme having a
different amino acid at the positions identified above. Such
isolates may be modified to produce the thermostable reverse
transcriptases of the present invention.
[0029] Thermostable reverse transcriptases of the invention may
also have one or more properties: (a) reduced or substantially
reduced RNase H activity, (b) reduced or substantially reduced
terminal deoxynucleotidyl transferase activity, and/or (c)
increased fidelity.
[0030] Enzymes of the invention which have reduced or substantially
reduced terminal deoxynucleotidyl transferase activity may have one
or more modifications or mutations at positions corresponding to
amino acids selected from the group consisting of:
[0031] (a) tyrosine 133 of M-MLV reverse transcriptase;
[0032] (b) threonine 197 of M-MLV reverse transcriptase; and
[0033] (c) phenylalanine 309 of M-MLV reverse transcriptase.
[0034] In specific embodiments, the invention is directed to M-MLV
reverse transcriptases wherein tyrosine 133 is replaced with
alanine, threonine 197 is replaced with glutamic acid, and/or
phenylalanine 309 is replaced with asparagine. Further included
within the scope of the invention are reverse transcriptases, other
than M-MLV reverse transcriptase, which contain alterations
corresponding to those set out above.
[0035] Additionally, enzymes which have exhibit increased fidelity
may have one or more modifications or mutations at positions
corresponding to amino acids selected from the group consisting
of:
[0036] (a) tyrosine 64 of M-MLV reverse transcriptase;
[0037] (b) arginine 116 of M-MLV reverse transcriptase;
[0038] (c) glutamine 190 of M-MLV reverse transcriptase; and
[0039] (d) valine 223 of M-MLV reverse transcriptase.
[0040] In specific embodiments, reverse transcriptases of the
invention may not include M-MLV reverse transcriptases, HIV reverse
transcriptases, AMV reverse transcriptases, and/or RSV reverse
transcriptases. Thus, for example, in certain embodiments, the
invention is directed to reverse transcriptases with increased
thermostability that are not a HIV reverse transcriptase. In other
embodiments, the invention is directed to reverse transcriptases
with increased thermostability that are not a M-MLV reverse
transcriptase. In yet other embodiments, the invention is directed
to reverse transcriptases with increased thermostability that are
not an AMV reverse transcriptase. In still other embodiments, the
invention is directed to reverse transcriptases with increased
thermostability that are not a RSV reverse transcriptase.
[0041] The present invention is also directed to nucleic acid
molecules (e.g., vectors) containing a gene or nucleic acid
encoding the mutant or modified reverse transcriptases of the
present invention and to host cells containing such DNA or other
nucleic acid molecules. Any number of hosts may be used to express
the gene or nucleic acid molecule of interest, including
prokaryotic and eukaryotic cells. In specific embodiments,
prokaryotic cells are used to express the reverse transcriptases of
the invention. One example of a prokaryotic host suitable for use
with the present invention is Escherichia coli. Examples of
eukaryotic hosts suitable for use with the present invention
include fungal cells (e.g., Saccharomyces cerevisiae cells, Pichia
pastoris cells, etc.), plant cells, and animal cells (e.g.,
Drosophila melanogaster cells, Spodoptera frugiperda Sf9 and Sf21
cells, Trichoplusa High-Five cells, C. elegans cells, Xenopus
laevis cells, CHO cells, COS cells, VERO cells, BHK cells,
etc.).
[0042] The invention also relates to a method of producing the
reverse transcriptases of the invention, said method
comprising:
[0043] (a) culturing a host cell comprising a gene or other nucleic
acid molecule encoding a reverse transcriptase of the invention
(preferably such reverse transcriptase gene or other nucleic acid
molecule is contained by a vector within the host cell);
[0044] (b) expressing the gene or nucleic acid molecule; and
[0045] (c) isolating said reverse transcriptase from the host
cell.
[0046] The invention is also directed to methods for making one or
more (e.g., one, two, three, four, five, ten, twelve, fifteen,
etc.) nucleic acid molecules, comprising mixing one or more (e.g.,
one, two, three, four, five, ten, twelve, fifteen, etc.) nucleic
acid templates (preferably one or more RNA templates and most
preferably one or more messenger RNA templates) with one or more
(e.g., one, two, three, four, five, ten, fifteen, etc.) reverse
transcriptases of the invention and incubating the mixture under
conditions sufficient to make a first nucleic acid molecule or
molecules complementary to all or a portion of the one or more
nucleic acid templates. In some embodiments, the mixture is
incubated at an elevated temperature. In specific embodiments, the
elevated temperature may be from about 40.degree. C. or greater,
from about 45.degree. C. or greater, from about 50.degree. C. or
greater, from about 51.degree. C. or greater, from about 52.degree.
C. or greater, from about 53.degree. C. or greater, from about
54.degree. C. or greater, from about 55.degree. C. or greater, from
about 56.degree. C. or greater, from about 57.degree. C. or
greater, from about 58.degree. C. or greater, from about 59.degree.
C. or greater, from about 60.degree. C. or greater, from about
61.degree. C. or greater, from about 62.degree. C. or greater, from
about 63.degree. C. or greater, from about 64.degree. C. or
greater, from about 65.degree. C. or greater, from about 66.degree.
C. or greater, from about 67.degree. C. or greater, from about
68.degree. C. or greater, from about 69.degree. C. or greater, from
about 70.degree. C. or greater, from about 71.degree. C. or
greater, from about 72.degree. C. or greater, from about 73.degree.
C. or greater, from about 74.degree. C. or greater, from about
75.degree. C. or greater, from about 76.degree. C. or greater, from
about 77.degree. C. or greater, or from about 78.degree. C. or
greater; or at a temperature range of from about 37.degree. C. to
about 75.degree. C., from about 40.degree. C. to about 75.degree.
C., from about 45.degree. C. to about 75.degree. C., from about
50.degree. C. to about 75.degree. C., from about 51.degree. C. to
about 75.degree. C., from about 52.degree. C. to about 75.degree.
C., from about 53.degree. C. to about 75.degree. C., from about
54.degree. C. to about 75.degree. C., from about 55.degree. C. to
about 75.degree. C. In other embodiments, the elevated temperature
is within the range of about 50.degree. C. to about 70.degree. C.,
from about 51.degree. C. to about 70.degree. C., from about
52.degree. C. to about 70.degree. C., from about 53.degree. C. to
about 70.degree. C., from about 54.degree. C. to about 70.degree.
C., from about 55.degree. C. to about 70.degree. C., from about
55.degree. C. to about 65.degree. C., from about 56.degree. C. to
about 65.degree. C., from about 56.degree. C. to about 64.degree.
C. or about 56.degree. C. to about 62.degree. C. In other
embodiments, the elevated temperature may be within the range of
about 45.degree. C. to about 60.degree. C., from about 46.degree.
C. to about 60.degree. C., from about 47.degree. C. to about
60.degree. C., from about 48.degree. C. to about 60.degree. C.,
from about 49.degree. C. to about 60.degree. C., from about
50.degree. C. to about 60.degree. C., from about 51.degree. C. to
about 60.degree. C., from about 52.degree. C. to about 60.degree.
C., from about 53.degree. C. to about 60.degree. C., or from about
54.degree. C. to about 60.degree. C. In additional specific
embodiments, the first nucleic acid molecule is a single-stranded
cDNA.
[0047] Nucleic acid templates suitable for reverse transcription
according to this aspect of the invention include any nucleic acid
molecule or population of nucleic acid molecules (preferably RNA
and most preferably mRNA), particularly those derived from a cell
or tissue. In a specific aspect, a population of mRNA molecules (a
number of different mRNA molecules, typically obtained from a
particular cell or tissue type) is used to make a cDNA library, in
accordance with the invention. Examples of cellular sources of
nucleic acid templates include bacterial cells, fungal cells, plant
cells and animal cells.
[0048] The invention also concerns methods for making one or more
(e.g., one, two, three, four, five, ten, twelve, fifteen, etc.)
double-stranded nucleic acid molecules. Such methods comprise (a)
mixing one or more nucleic acid templates (preferably RNA or mRNA,
and more preferably a population of mRNA templates) with one or
more (e.g., one, two, three, four, five, ten, fifteen, etc.)
reverse transcriptases of the invention; (b) incubating the mixture
under conditions sufficient to make a first nucleic acid molecule
or molecules complementary to all or a portion of the one or more
templates; and (c) incubating the first nucleic acid molecule or
molecules under conditions sufficient to make a second nucleic acid
molecule or molecules complementary to all or a portion of the
first nucleic acid molecule or molecules, thereby forming one or
more double-stranded nucleic acid molecules comprising the first
and second nucleic acid molecules. In some embodiments, the
incubation of step (b) is performed at an elevated temperature. In
specific embodiments, the elevated temperature may be from about
40.degree. C. or greater, from about 45.degree. C. or greater, from
about 50.degree. C. or greater, from about 51.degree. C. or
greater, from about 52.degree. C. or greater, from about 53.degree.
C. or greater, from about 54.degree. C. or greater, from about
55.degree. C. or greater, from about 56.degree. C. or greater, from
about 57.degree. C. or greater, from about 58.degree. C. or
greater, from about 59.degree. C. or greater, from about 60.degree.
C. or greater, from about 61.degree. C. or greater, from about
62.degree. C. or greater, from about 63.degree. C. or greater, from
about 64.degree. C. or greater, from about 65.degree. C. or
greater, from about 66.degree. C. or greater, from about 67.degree.
C. or greater, from about 68.degree. C. or greater, from about
69.degree. C. or greater, from about 70.degree. C. or greater, from
about 71.degree. C. or greater, from about 72.degree. C. or
greater, from about 73.degree. C. or greater, from about 74.degree.
C. or greater, from about 75.degree. C. or greater, from about
76.degree. C. or greater, from about 77.degree. C. or greater, or
from about 78.degree. C. or greater; or at a temperature range of
from about 37.degree. C. to about 75.degree. C., from about
40.degree. C. to about 75.degree. C., from about45.degree. C. to
about 75.degree. C., from about 50.degree. C. to about 75.degree.
C., from about 51.degree. C. to about 75.degree. C., from about
52.degree. C. to about 75.degree. C., from about 53.degree. C. to
about 75.degree. C., from about 54.degree. C. to about 75.degree.
C., or from about 55.degree. C. to about 75.degree. C. In some
embodiments, the elevated temperature is within the range of from
about 50.degree. C. to about 70.degree. C., from about 51.degree.
C. to about 70.degree. C., from about 52.degree. C. to about
70.degree. C., from about 53.degree. C. to about 70.degree. C.,
from about 54.degree. C. to about 70.degree. C., from about
55.degree. C. to about 70.degree. C., from about 55.degree. C. to
about 65.degree. C., from about 56.degree. C. to about 65.degree.
C., from about 56.degree. C. to about 64.degree. C., or from about
56.degree. C. to about 62.degree. C. In other embodiments, the
elevated temperature may be within the range of from about
45.degree. C. to about 60.degree. C., from about 46.degree. C. to
about 60.degree. C., from about 47.degree. C. to about 60.degree.
C., from about 48.degree. C. to about 60.degree. C., from about
49.degree. C. to about 60.degree. C., from about 50.degree. C. to
about 60.degree. C., from about 51.degree. C. to about 60.degree.
C., from about 52.degree. C. to about 60.degree. C., from about
53.degree. C. to about 60.degree. C., or from about 54.degree. C.
to about 60.degree. C. Such methods may include the use of one or
more (e.g., one, two, three, four, five, ten, twelve, fifteen,
etc.) DNA polymerases as part of the process of making the one or
more double-stranded nucleic acid molecules. Such DNA polymerases
are preferably thermostable DNA polymerases and most preferably the
nucleic acid synthesis accomplished with such DNA polymerases is
conducted at elevated temperatures, i.e., greater than 37.degree.
C. The invention also concerns compositions useful for making such
double-stranded nucleic acid molecules. Such compositions comprise
one or more (e.g., one, two, three, four, five, ten, twelve,
fifteen, twenty, etc.) reverse transcriptases of the invention and
optionally one or more DNA polymerases, a suitable buffer, one or
more (e.g., one, two, three, four, five, ten, twelve, fifteen,
etc.) primers, and/or one or more (e.g., one, two, three, four,
five, etc.) nucleotides.
[0049] The invention also relates to methods for amplifying a
nucleic acid molecule. Such amplification methods comprise mixing
the double-stranded nucleic acid molecule or molecules produced as
described above with one or more (e.g., one, two, three, four,
five, ten, twelve, fifteen, etc.) DNA polymerases (preferably
thermostable DNA polymerases) and incubating the mixture under
conditions sufficient to amplify the double-stranded nucleic acid
molecule. In a first embodiment, the invention concerns a method
for amplifying a nucleic acid molecule, the method comprising (a)
mixing one or more (e.g., one, two, three, four, five, ten, twelve,
fifteen, twenty, etc.) nucleic acid templates (preferably one or
more RNA or mRNA templates and more preferably a population of mRNA
templates) with one or more reverse transcriptases of the invention
and with one or more DNA polymerases and (b) incubating the mixture
under conditions sufficient to amplify nucleic acid molecules
complementary to all or a portion of the one or more templates. In
some embodiments, the incubation of step (b) is performed at an
elevated temperature. In specific embodiments, the elevated
temperature may be from about 40.degree. C. or greater, 45.degree.
C. or greater, 5.degree. C. or greater, 51.degree. C. or greater,
about 52.degree. C. or greater, about 53.degree. C. or greater,
about 54.degree. C. or greater, about 55.degree. C. or greater,
about 56.degree. C. or greater, about 57.degree. C. or greater,
about 58.degree. C. or greater, about 59.degree. C. or greater,
about 60.degree. C. or greater, about 61.degree. C. or greater,
about 62.degree. C. or greater, about 63.degree. C. or greater,
about 64.degree. C. or greater, about 65.degree. C. or greater,
about 66.degree. C. or greater, about 67.degree. C. or greater,
about 68.degree. C. or greater, about 69.degree. C. or greater,
about 70.degree. C. or greater, about 71.degree. C. or greater,
about 72.degree. C. or greater, about 73.degree. C. or greater,
about 74.degree. C. or greater, about 75.degree. C. or greater,
about 76.degree. C. or greater, about 77.degree. C. or greater, or
about 78.degree. C. or greater; or at a temperature range of from
about 37.degree. C. to about 75.degree. C., from about 40.degree.
C. to about 75.degree. C., from about 45.degree. C. to about
75.degree. C., from about 50.degree. C. to about 75.degree. C.,
from about 51.degree. C. to about 75.degree. C., from about
52.degree. C. to about 75.degree. C., from about 53.degree. C. to
about 75.degree. C., from about 54.degree. C. to about 75.degree.
C., from about 55.degree. C. to about 75.degree. C. In some
embodiments, the elevated temperature is within the range of about
50.degree. C. to about 70.degree. C., from about 51.degree. C. to
about 70.degree. C., from about 52.degree. C. to about 70.degree.
C., from about 53.degree. C. to about 70.degree. C., from about
54.degree. C. to about 70.degree. C., from about 55.degree. C. to
about 70.degree. C., from about 55.degree. C. to about 65.degree.
C., from about 56.degree. C. to about 65.degree. C., from about
56.degree. C. to about 64.degree. C. or about 56.degree. C. to
about 62.degree. C. In other embodiments, the elevated temperature
may be within the range of about 45.degree. C. to about 60.degree.
C., from about 46.degree. C. to about 60.degree. C., from about
47.degree. C. to about 60.degree. C., from about 48.degree. C. to
about 60.degree. C., from about 49.degree. C. to about 60.degree.
C., from about 50.degree. C. to about 60.degree. C., from about
51.degree. C. to about 60.degree. C., from about 52.degree. C. to
about 60.degree. C., from about 53.degree. C. to about 60.degree.
C., or from about 54.degree. C. to about 60.degree. C. Preferably,
the reverse transcriptases (1) are reduced or substantially reduced
in RNase H activity, (2) are reduced or substantially reduced in
TdT activity, and/or (3) exhibit increased fidelity. Preferably,
the DNA polymerases comprise a first DNA polymerase having 3'
exonuclease activity and a second DNA polymerase having
substantially reduced 3' exonuclease activity.
[0050] The invention also concerns compositions comprising one or
more reverse transcriptases of the invention and one or more DNA
polymerases for use in amplification reactions. Such compositions
may further comprise one or more nucleotides and/or a buffer
suitable for amplification. The compositions of the invention may
also comprise one or more oligonucleotide primers.
[0051] The invention is also directed to nucleic acid molecules
(particularly single- or double-stranded cDNA molecules) or
amplified nucleic acid molecules produced according to the
above-described methods and to vectors (particularly expression
vectors) comprising these nucleic acid molecules or amplified
nucleic acid molecules.
[0052] The invention is further directed to recombinant host cells
comprising the above-described nucleic acid molecules, amplified
nucleic acid molecules or vectors. Examples of such host cells
include bacterial cells, yeast cells, plant cells and animal cells
(including insect cells and mammalian cells).
[0053] The invention is additionally directed to methods of
producing polypeptides encoded by the nucleic acid molecules
produced by the methods of the invention. Such methods comprise
culturing the above-described recombinant host cells and isolating
the encoded polypeptides, and to polypeptides produced by such
methods.
[0054] The invention also concerns methods for sequencing one or
more (e.g., one, two, three, four, five, ten, twelve, fifteen,
etc.) nucleic acid molecules using the compositions or enzymes of
the invention. Such methods comprise (a) mixing one or more nucleic
acid molecules (e.g., one or more RNA or DNA molecules) to be
sequenced with one or more primers, one or more reverse
transcriptases of the invention, one or more nucleotides and one or
more terminating agents, such as one or more dideoxynucleoside
triphosphates; (b) incubating the mixture under conditions
sufficient to synthesize a population of nucleic acid molecules
complementary to all or a portion of the one or more (e.g., one,
two, three, four, five, ten, twelve, fifteen, twenty, thirty,
fifty, one hundred, two hundred, etc.) nucleic acid molecules to be
sequenced; and (c) separating the population of nucleic acid
molecules to determine the nucleotide sequence of all or a portion
of the one or more nucleic acid molecules to be sequenced. Such
methods may also comprise (a) mixing a nucleic acid molecule (e.g.,
one or more RNA or DNA molecules) to be sequenced with one or more
primers, one or more reverse transcriptases of the invention, one
or more nucleotides and one or more terminating agents, such as one
or more dideoxynucleoside triphosphates; (b) incubating the mixture
under conditions sufficient to synthesize a population of nucleic
acid molecules complementary to all or a portion of the nucleic
acid molecule to be sequenced; and (c) separating members of the
population of nucleic acid molecules to determine the nucleotide
sequence of all or a portion of the nucleic acid molecule to be
sequenced. In some embodiments, such incubation may be performed at
elevated temperatures as described herein.
[0055] The invention is also directed to kits for use in methods of
the invention. Such kits can be used for making, sequencing or
amplifying nucleic acid molecules (single- or double-stranded),
preferably at the elevated temperatures described herein. The kits
of the invention comprise a carrier, such as a box or carton,
having in close confinement therein one or more (e.g., one, two,
three, four, five, ten, twelve, fifteen, etc.) containers, such as
vials, tubes, bottles and the like. In the kits of the invention, a
first container contains one or more of the reverse transcriptase
enzymes of the present invention. The kits of the invention may
also comprise, in the same or different containers, one or more DNA
polymerases (preferably thermostable DNA polymerases), one or more
(e.g., one, two, three, four, five, ten, twelve, fifteen, etc.)
suitable buffers for nucleic acid synthesis, one or more
nucleotides and one or more (e.g., one, two, three, four, five,
ten, twelve, fifteen, etc.) oligonucleotide primers. Alternatively,
the components of the kit may be divided into separate containers
(e.g., one container for each enzyme and/or component). The kits of
the invention also may comprise instructions or protocols for
carrying out the methods of the invention. In preferred kits of the
invention, the reverse transcriptases are reduced or substantially
reduced in RNase H activity, and are most preferably selected from
the group consisting of M-MLV RNase H- reverse transcriptase, RSV
RNase H- reverse transcriptase, AMV RNase H- reverse transcriptase,
RAV RNase H- reverse transcriptase, MAV RNase H- reverse
transcriptase and HIV RNase H- reverse transcriptase. In other
preferred kits of the invention, the reverse transcriptases are
reduced or substantially reduced in TdT activity, and/or exhibit
increased fidelity, as described elsewhere herein.
[0056] In additional preferred kits of the invention, the enzymes
(reverse transcriptases and/or DNA polymerases) in the containers
are present at working concentrations.
[0057] Thus, the invention is further directed to kits for use in
reverse transcription, amplification or sequencing of a nucleic
acid molecule, the kit comprising one or more thermostable reverse
transcriptases.
[0058] In specific embodiments, reverse transcriptases of kits of
the invention may have one or more modifications or mutations at
positions corresponding to amino acids selected from the group
consisting of:
[0059] (a) leucine 52 of M-MLV reverse transcriptase;
[0060] (b) tyrosine 64 of M-MLV reverse transcriptase;
[0061] (c) lysine 152 of M-MLV reverse transcriptase;
[0062] (d) arginine 204 of M-MLV reverse transcriptase;
[0063] (e) methionine 289 of M-MLV reverse transcriptase; and
[0064] (f) threonine 306 of M-MLV reverse transcriptase.
[0065] Reverse transcriptases of the invention include any reverse
transcriptase having enhanced thermostability. Such reverse
transcriptases include retroviral reverse transcriptases, bacterial
reverse transcriptases, retrotransposon reverse transcriptases
(e.g., reverse transcriptases of the Ty1 and/or Ty3
retrotransposons), and DNA polymerases having reverse transcriptase
activity. Preferred reverse transcriptases of the invention include
a single and multi-subunit reverse transcriptase and preferably
retroviral reverse transcriptases. In particular, the invention
relates to M-MLV-reverse transcriptases and ASLV-reverse
transcriptases (such as AMV-RT and RSV-RT). Such reverse
transcriptases of the invention preferably have reduced or
substantially reduced RNase H activity.
[0066] Other embodiments of the present invention will be apparent
to one of ordinary skill in light of the following drawings and
description of the invention, and of the claims.
BRIEF DESCRIPTION OF THE DRAWINGS/FIGURES
[0067] FIG. 1 is a map of plasmid pBAD-6-His-M-MLV H- (F1).
[0068] FIG. 2 is a linear representation of the coding sequence of
the M-MLV reverse transcriptase showing the locations of the
restriction enzyme cleavage sites used to generate the segments of
the gene used to generate mutations.
[0069] FIG. 3 represents a scanned phosphoimage of an extension
assay using (1) SuperScript.TM.II reverse transcriptase, and (2)
F309N. The [.sup.32P]-labeled 18-mer primer annealed to a 47-mer
DNA template (5 nM) was extended by equal units of reverse
transcriptase at 37.degree. C. for 30 minutes as seen in the
extension reactions with all 4 nucleotides. The extension reactions
were analyzed by denaturing 6% gel electrophoresis. P, non-extended
primer.
[0070] FIG. 4 represents a scanned phosphoimage showing a TdT
extension assay of SuperScript.TM.II reverse transcriptase and the
mutants F309N, T197E, and Y133A. The [.sup.32P]-labeled 18-mer
primer annealed to a 47-mer DNA template (5 nM) was extended with
decreasing units of reverse transcriptase (lane (1) 646 units, lane
(2) 200 units, lane (3) 50 units, and lane (4) 20 units) at
37.degree. C. for 30 minutes with all four nucleotides (see the
Methods section below in Example 3). The extension reactions were
analyzed by denaturing 6% gel electrophoresis. In this assay,
extension past the 47 nucleotide templates is considered
non-template directed addition or TdT activity. P, non-extended
primer.
[0071] FIG. 5 represents a scanned phosphoimage showing
misinsertion assays of SuperScript.TM.II reverse transcriptase (1)
and mutant protein F309N reverse transcriptase (2) with DNA
template. The [.sup.32P]-labeled 18-mer primer annealed to a 47-mer
DNA template (5 nM) was extended by equal units of reverse
transcriptase protein at 37.degree. C. for 30 min. as seen in the
extension reactions with all four nucleotides. The extension
reactions were also performed in the presence of only 3
complementary dNTPs; minus dCTP, minus DATP, minus TTP, and minus
dGTP. The extension reactions were analyzed by denaturing 6% gel
electrophoresis. In this assay, the higher efficiency of elongation
of terminated primer with only three nucleotides will reflect the
lower fidelity of the SuperScript.TM.II reverse transcriptase
assayed. P, non-extended primer.
[0072] FIG. 6 represents a scanned phosphoimage showing a
misinsertion assay of SuperScript.TM.II reverse transcriptase (1)
and mutant protein T197A/F309N reverse transcriptase (2) and
V223H/F309N (3) with DNA template. The [.sup.32P]-labeled 18-mer
primer annealed to a 47-mer DNA template (5 nM) was extended by
equal units of reverse transcriptase protein at 37.degree. C. for
30 min. as seen in the extension reactions with all four
nucleotides. The extension reactions were also performed in the
presence of only 3 complementary dNTPs; minus dATP, and minus dCTP.
The extension reactions were analyzed by denaturing 6% gel
electrophoresis. In this assay, the higher efficiency of elongation
of terminated primer with only three nucleotides will reflect the
lower fidelity of the SuperScript.TM.II reverse transcriptase
assayed. P, non-extended primer.
[0073] FIGS. 7A-7C. This figure depicts the DNA sequence (SEQ ID
NO: 7), which encodes a wild type M-MLV reverse transcriptase
having DNA polymerase activity and substantially no RNase H
activity. Also shown is the corresponding amino acid sequence (SEQ
ID NO: 8). Position 0 of FIG. 7A is the codon ATG, which encodes a
methionine residue. The methionine residue is the initiation codon
for the recombinant DNA sequence. Thus, position 0 of this sequence
does not represent an amino acid reside present in the wild type
M-MLV reverse transcriptase having DNA polymerase activity and
substantially no RNase H activity.
DETAILED DESCRIPTION OF THE INVENTION
[0074] In the description that follows, a number of terms used in
recombinant DNA, virology and immunology are utilized. In order to
provide a clearer and consistent understanding of the specification
and claims, including the scope to be given such terms, the
following definitions are provided.
[0075] Cloning vector. As used herein "cloning vector" means a
nucleic acid molecule such as plasmid, cosmid, phage, phagemid or
other nucleic acid molecule which is able to replicate autonomously
in a host cell, and which is characterized by one or a small number
of restriction endonuclease recognition sites at which such nucleic
acid sequences may be cut in a determinable fashion, and into which
DNA may be inserted in order to bring about its replication and
cloning. The cloning vector may further contain a marker suitable
for use in the identification of cells transformed with the cloning
vector. Markers, for example, are genes that confer a recognizable
phenotype on host cells in which such markers are expressed.
Commonly used markers include, but are not limited to, antibiotic
resistance genes such as tetracycline resistance or ampicillin
resistance.
[0076] Expression vector. As used herein "expression vector" means
a nucleic acid molecule similar to a cloning vector but which may
additionally comprise nucleic acid sequences capable of enhancing
and/or controlling the expression of a gene or other nucleic acid
molecule which has been cloned into it, after transformation into a
host. The additional nucleic acid sequences may comprise promoter
sequences, repressor binding sequences and the like. The cloned
gene or nucleic acid molecule is usually operably linked to one or
more (e.g., one, two, three, four, etc.) of such control sequences
such as promoter sequences.
[0077] Recombinant host. As used herein "recombinant" means any
prokaryotic or eukaryotic or microorganism which contains the
desired cloned genes or nucleic acid molecules, for example, in an
expression vector, cloning vector or any nucleic acid molecule. The
term "recombinant host" is also meant to include those host cells
which have been genetically engineered to contain the desired gene
or other nucleic acid molecule on the host chromosome or
genome.
[0078] Host. As used herein "host" means any prokaryotic or
eukaryotic organism that is the recipient of a replicable
expression vector, cloning vector or any nucleic acid molecule. The
nucleic acid molecule may contain, but is not limited to, a
structural gene, a promoter and/or an origin of replication.
[0079] Promoter. As used herein "promoter" means a nucleic acid
sequence generally described as the 5' region of a gene, located
proximal to the start codon which is capable of directing the
transcription of a gene or other nucleic acid molecule. At the
promoter region, transcription of an adjacent gene(s) or nucleic
acid(s) is initiated.
[0080] Gene. As used herein "gene" means a nucleic acid sequence
that contains information necessary for expression of a polypeptide
or protein. It includes the promoter and the structural gene as
well as other sequences involved in expression of the protein.
[0081] Structural gene. As used herein "structural gene" means a
DNA or other nucleic acid sequence that is transcribed into
messenger RNA that is then translated into a sequence of amino
acids characteristic of a specific polypeptide.
[0082] Operably linked. As used herein "operably linked" means that
a nucleic acid element is positioned so as to influence the
initiation of expression of the polypeptide encoded by the
structural gene or other nucleic acid molecule.
[0083] Expression. As used herein "expression" refers to the
process by which a gene or other nucleic acid molecule produces a
polypeptide. It includes transcription of the gene or nucleic acid
molecule into messenger RNA (mRNA) and the translation of such mRNA
into polypeptide(s).
[0084] Substantially Pure. As used herein "substantially pure"
means that the desired material is essentially free from
contaminating cellular components which are associated with the
desired material in nature. Contaminating cellular components may
include, but are not limited to, enzymatic activities such as
phosphatases, exonucleases, endonucleases or undesirable DNA
polymerase enzymes. Preferably, reverse transcriptases of the
invention are substantially pure.
[0085] Primer. As used herein "primer" refers to a single-stranded
oligonucleotide that is extended by covalent bonding of nucleotide
monomers during amplification or polymerization of a DNA
molecule.
[0086] Template. The term "template" as used herein refers to a
double-stranded or single-stranded nucleic acid molecule which is
to be amplified, copied or sequenced. In the case of a
double-stranded DNA molecule, denaturation of its strands to form
single-stranded first and second strands may be performed before
these molecules are amplified, copied or sequenced. A primer
complementary to a portion of a nucleic acid template is hybridized
under appropriate conditions and a nucleic acid polymerase, such as
the reverse transcriptase enzymes of the invention, may then add
nucleotide monomers to the primer thereby synthesizing a nucleic
acid molecule complementary to said template or a portion thereof.
The newly synthesized nucleic acid molecule, according to the
invention, may be equal or shorter in length than the original
template. Mismatch incorporation during the synthesis or extension
of the newly synthesized nucleic acid molecule may result in one or
a number of mismatched base pairs. Thus, the synthesized nucleic
acid molecule need not be exactly complementary to the
template.
[0087] Incorporating. The term "incorporating" as used herein means
becoming a part of a nucleic acid molecule or primer.
[0088] Oligonucleotide. "Oligonucleotide" refers to a synthetic or
natural molecule comprising a covalently linked sequence of
nucleotides which are joined by a phosphodiester bond between the
3' position of the pentose of one nucleotide and the 5' position of
the pentose of the adjacent nucleotide.
[0089] Nucleotide. As used herein "nucleotide" refers to a
base-sugar-phosphate combination. Nucleotides are monomeric units
of a nucleic acid sequence (DNA and RNA) and deoxyribonucleotides
are incorporated into DNA by DNA polymerases. The term nucleotide
includes deoxyribonucleoside triphosphates such as dATP, dCTP,
dITP, dUTP, dGTP, dTTP, or derivatives thereof. Such derivatives
include, for example, [.alpha.S]dATP, 7-deaza-dGTP and
7-deaza-dATP. The term nucleotide as used herein also refers to
dideoxyribonucleoside triphosphates (ddNTPs) and their derivatives.
Illustrative examples of dideoxyribonucleoside triphosphates
include, but are not limited to, ddATP, ddCTP, ddGTP, ddITP, and
ddTTP. According to the present invention, a "nucleotide" may be
unlabeled or detectably labeled by well known techniques.
Detectable labels include, for example, radioactive isotopes,
fluorescent labels, chemiluminescent labels, bioluminescent labels
and enzyme labels.
[0090] Hybridization. As used herein, hybridization (hybridizing)
refers to the pairing of two complementary single-stranded nucleic
acid molecules (RNA and/or DNA) to give a double-stranded molecule.
As one skilled in the art will recognize, two nucleic acid
molecules may be hybridized, although the base pairing is not
completely complementary. Accordingly, mismatched bases do not
prevent hybridization of two nucleic acid molecules provided that
appropriate conditions, well known in the art, are used.
[0091] Thermostable Reverse Transcriptase. For the purposes of this
disclosure, a thermostable reverse transcriptase is defined as a
reverse transcriptase which retains a greater percentage of its
activity after a heat treatment than is retained by a reverse
transcriptase that has wild-type thermostability after an identical
treatment. Thus, a reverse transcriptase having increased/enhanced
thermostability is defined as a polymerase having any increase in
thermostability, preferably from about 1.2 to about 10,000 fold,
from about 1.5 to about 10,000 fold, from about 2 to about 5,000
fold, or from about 2 to about 2000 fold (preferably greater than
about 5 fold, more preferably greater than about 10 fold, still
more preferably greater than about 50 fold, still more preferably
greater than about 100 fold, still more preferably greater than
about 500 fold, and most preferably greater than about 1000 fold)
retention of activity after a heat treatment sufficient to cause a
reduction in the activity of a reverse transcriptase that is
wild-type for thermostability. Preferably, the mutant or modified
reverse transcriptase of the invention is compared to the
corresponding unmodified or wild-type reverse transcriptase to
determine the relative enhancement or increase in thermostability.
For example, after a heat treatment at 52.degree. C. for 5 minutes,
a thermostable reverse transcriptase may retain approximately 90%
of the activity present before the heat treatment, whereas a
reverse transcriptase that is wild-type for thermostability may
retain 10% of its original activity. Likewise, after a heat
treatment at 53.degree. C. for five minutes, a thermostable reverse
transcriptase may retain approximately 80% of its original
activity, whereas a reverse transcriptase that is wild-type for
thermostability may have no measurable activity. Similarly, after a
heat treatment at 50.degree. C. for five minutes, a thermostable
reverse transcriptase may retain approximately 50%, approximately
55%, approximately 60%, approximately 65%, approximately 70%,
approximately 75%, approximately 80%, approximately 85%,
approximately 90%, or approximately 95% of its original activity,
whereas a reverse transcriptase that is wild-type for
thermostability may have no measurable activity or may retain 10%,
15% or 20% of its original activity. In the first instance (i.e.,
after heat treatment at 52.degree. C. for 5 minutes), the
thermostable reverse transcriptase would be said to be 9-fold more
thermostable than the wild-type reverse transcriptase. Examples of
conditions which may be used to measure thermostability of reverse
transcriptases are set out below in Example 2.
[0092] The thermostability of a reverse transcriptase can be
determined by comparing the residual activity of a sample of the
reverse transcriptase that has been subjected to a heat treatment,
i.e., incubated at 52.degree. C. for a given period of time, for
example, five minutes, to a control sample of the same reverse
transcriptase that has been incubated at room temperature for the
same length of time as the heat treatment. Typically the residual
activity may be measured by following the incorporation of a
radiolabled deoxyribonucleotide into an oligodeoxyribonucleotide
primer using a complementary oligoribonucleotide template. For
example, the ability of the reverse transcriptase to incorporate
[.alpha..sup.32P]-dGTP into an oligo-dG primer using a poly(riboc)
template may be assayed to determine the residual activity of the
reverse transcriptase.
[0093] In another aspect, thermostable reverse transcriptases of
the invention are defined as any reverse transcriptase which is
inactivated at a higher temperature compared to the corresponding
wild-type, unmutated, or unmodified reverse transcriptase.
Preferably, the inactivation temperature for the thermostable
reverse transcriptases of the invention is from about 2.degree. C.
to about 50.degree. C. (e.g., about 2.degree. C., about 4.degree.
C., about 5.degree. C., about 8.degree. C., about 10.degree. C.,
about 12.degree. C., about 14.degree. C., about 16.degree. C.,
about 18.degree. C., about 20.degree. C., about 24.degree. C.,
about 26.degree. C., about 28.degree. C., about 30.degree. C.,
about 33.degree. C., about 35.degree. C., about 38.degree. C.,
about 40.degree. C., about 42.degree. C., about 44.degree. C.,
about 46.degree. C., about 48.degree. C., or about 50.degree. C.)
higher than the inactivation temperature for the corresponding
wild-type, unmutated, or unmodified reverse transcriptase. More
preferably, the inactivation temperature for the reverse
transcriptases of the invention is from about 5.degree. C. to about
50.degree. C., from about 5.degree. C. to about 40.degree. C., from
about 5.degree. C. to about 30.degree. C., or from about 5.degree.
C. to about 25.degree. C. greater than the inactivation temperature
for the corresponding wild-type, unmutated or unmodified reverse
transcriptase, when compared under the same conditions.
[0094] The difference in inactivation temperature for the reverse
transcriptase of the invention compared to its corresponding
wild-type, unmutated or unmodified reverse transcriptase can be
determined by treating samples of such reverse transcriptases at
different temperatures for a defined time period and then measuring
residual reverse transcriptase activity, if any, after the samples
have been heat treated. Determination of the difference or delta in
the inactivation temperature between the test reverse transcriptase
compared to the wild-type, unmutated or unmodified control is
determined by comparing the difference in temperature at which each
reverse transcriptase is inactivated (i.e., no residual reverse
transcriptase activity is measurable in the particular assay used).
As will be recognized, any number of reverse transcriptase assays
may be used to determine the different or delta of inactivation
temperatures for any reverse transcriptases tested.
[0095] Terminal extension activity. As used herein, terminal
extension activity refers to the ability of a reverse transcriptase
(RT) to add additional bases on to the 3' end of a newly
synthesized cDNA strand beyond the 5' end of the DNA or mRNA
template. Terminal extension activity may add bases specifically
(with a nucleotide bias) or randomly.
[0096] Terminal extension activity is also known as terminal
deoxynucleotidyl transferase (TdT) activity. A reverse
transcriptase having reduced, substantially reduced, or eliminated
TdT activity is defined as any reverse transcriptase having lower
TdT activity than the specific activity of the corresponding
wild-type, unmutated, or unmodified enzyme, particularly, less than
about 90% of the specific activity of the corresponding wild-type,
unmutated, or unmodified enzyme, less than about 85% of the
specific activity of the corresponding wild-type, unmutated, or
unmodified enzyme, less than about 80% of the specific activity of
the corresponding wild-type, unmutated, or unmodified enzyme, less
than about 75% of the specific activity of the corresponding
wild-type, unmutated, or unmodified enzyme, less than about 50% of
the specific activity of the corresponding wild-type, unmutated, or
unmodified enzyme, less than about 25% of the specific activity of
the corresponding wild-type, unmutated, or unmodified enzyme, less
than about 15% of the specific activity of the corresponding
wild-type, unmutated, or unmodified enzyme, less than 10% of the
specific activity of the corresponding wild-type, unmutated, or
unmodified enzyme, less than about 5% of the specific activity of
the corresponding wild-type, unmutated, or unmodified enzyme, or
less than about 1% of the specific activity of the corresponding
wild-type, unmutated, or unmodified enzyme. Eliminated TdT activity
is defined as a level of activity that is undetectable by the assay
methods set out herein in Example 3.
[0097] As noted below in Example 3, reverse transcriptases are
known in the art which extend nucleic acid molecules 2-3
nucleotides past the end of templates (e.g., RNA or DNA templates).
Further, in any one reaction mixture in which reverse transcription
occurs, mixtures of molecules may be present which contain
different numbers of nucleotides that extend beyond the end of the
template. TdT activity is determined herein in reference to the
number or percentage of molecules which contain one or more
nucleotides which extend beyond the end of the template. For
example, if a wild-type reverse transcriptase adds 1 or more
nucleotides past the end of a template to 90% of the molecules
generated during reverse transcription and a modified reverse
transcriptase adds 1 or more nucleotides past the end of a template
to 45% of the molecules under the same or similar conditions, then
the modified reverse transcriptase would be said to exhibit a 50%
decrease in TdT activity as compared to the wild-type enzyme.
Further, an F309N, T306K, H204R mutant of M-MLV SuperScript.TM.II
has been generated which exhibits about 0% of the TdT activity
exhibited by SuperScript.TM.II when DNA is used as a template and
about 10-20% of the TdT activity exhibited by SuperScript.TM.II
when RNA is used as a template.
[0098] Fidelity. Fidelity refers to the accuracy of polymerization,
or the ability of the reverse transcriptase to discriminate correct
from incorrect substrates, (e.g., nucleotides) when synthesizing
nucleic acid molecules which are complementary to a template. The
higher the fidelity of a reverse transcriptase, the less the
reverse transcriptase misincorporates nucleotides in the growing
strand during nucleic acid synthesis; that is, an increase or
enhancement in fidelity results in a more faithful reverse
transcriptase having decreased error rate or decreased
misincorporation rate.
[0099] A reverse transcriptase having increased/enhanced/higher
fidelity is defined as a polymerase having any increase in
fidelity, preferably about 1.2 to about 10,000 fold, about 1.5 to
about 10,000 fold, about 2 to about 5,000 fold, or about 2 to about
2000 fold (preferably greater than about 5 fold, more preferably
greater than about 10 fold, still more preferably greater than
about 50 fold, still more preferably greater than about 100 fold,
still more preferably greater than about 500 fold and most
preferably greater than about 100 fold) reduction in the number of
misincorporated nucleotides during synthesis of any given nucleic
acid molecule of a given length compared to the control reverse
trancriptase. Preferably, the mutant or modified reverse
transcriptase of the invention is compared to the corresponding
unmodified or wild-type reverse transcriptase to determine the
relative enhancement or increase in fidelity. For example, a
mutated reverse transcriptase may misincorporate one nucleotide in
the synthesis of a nucleic acid molecule segment of 1000 bases
compared to an unmutated reverse transcriptase misincorporating 10
nucleotides in the same size segment. Such a mutant reverse
transcriptase would be said to have an increase of fidelity of 10
fold.
[0100] Fidelity can also be measured by the decrease in the
incidence of frame shifting, as described below in Example 5. A
reverse transcriptase having increased fidelity is defined as a
polymerase or reverse transcriptase having any increase in fidelity
with respect to frame shifting, as compared to a control reverse
transcriptase (e.g., a wild-type reverse transcriptase), for
example, a reverse transcriptase having greater than about 1.2 fold
increased fidelity with respect to frame shifting, having greater
than about 1.5 fold increased fidelity with respect to frame
shifting, having greater than about 5 fold increased fidelity with
respect to frame shifting, having greater than about 10 fold
increased fidelity with respect to frame shifting, having greater
than about 20 fold increased fidelity with respect to frame
shifting, having greater than about 30 fold increased fidelity with
respect to frame shifting, or having greater than about 40 fold
increased fidelity with respect to frame shifting.
[0101] A reverse transcriptase having increasedlenhanced/higher
fidelity, with respect to frame shifting, can also be defined as a
reverse transcriptase or polymerase having any increase in
fidelity, such as from about 1.5 to about 10,000 fold, from about 2
to about 5,000 fold, from about 2 to about 2000 fold, from about
1.5 to about 40 fold, from about 5 to about 40 fold, from about 10
to about 40 fold, from about 20 to about 40 fold, from about 30 to
about 40 fold, from about 5 to about 30 fold, from about 10 to
about 30 fold, from about 15 to about 30 fold, from about 20 to
about 30 fold, from about 5 to about 20 fold, from about 10 to
about 20 fold, from about 15 to about 20 fold, from about 10 to
about 100 fold, from about 15 to about 100 fold, from about 20 to
about 100 fold, from about 30 to about 100 fold, or from about 50
to about 100 fold increased fidelity with respect to frame
shifting.
[0102] A reverse transcriptase having reduced misincorporation is
defined herein as either a mutated or modified reverse
transcriptase that has about or less than 90%, has about or less
than 85%, has about or less than 75%, has about or less than 70%,
has about or less than 60%, or preferably has about or less than
50%, preferably has about or less than 25%, more preferably has
about or less than 10%, and most preferably has about or less than
1% of relative misincorporation compared to the corresponding
wild-type, unmutated, or unmodified enzyme.
[0103] The fidelity or misincorporation rate of a reverse
transcriptase can be determined by sequencing or by other methods
known in the art (Eckert & Kunkel, 1990, Nucl. Acids Res.
18:3739-3744). In one example, the sequence of a DNA molecule
synthesized by the unmutated and mutated reverse transcriptases can
be compared to the expected (known) sequence. In this way, the
number of errors (misincorporation or frame shifts) can be
determined for each enzyme and compared. In another example, the
unmutated and mutated reverse transcriptases may be used to
sequence a DNA molecule having a known sequence. The number of
sequencing errors (misincorporation or frame shifts) can be
compared to determine the fidelity or misincorporation rate of the
enzymes. Other means of determining the fidelity or
misincorporation rate include a forward complementation assay using
an RNA template as described below and previously in Boyer J. C. et
al. Methods Enzymol. 275:523 (1996), and are set out in the
examples. Other methods of determining the fidelity or
misincorporation rate will be recognized by one of skill in the
art.
[0104] Strand jumping. Strand jumping, as used herein, refers to a
type of random mutation caused by an reverse transcriptase
"skipping" more than one (e.g., two, five, ten, fifty, one-hundred,
etc.) nucleotides on the mRNA template, resulting in a deletion of
the corresponding nucleotides in the resulting cDNA.
[0105] Hand domain. The hand domain, as used herein, refers to
those amino acids which are in the area or areas that control the
template, primer, or nucleotide interaction of the reverse
transcriptase. This domain is further characterized by a group of
three regions of secondary structure in a reverse transcriptase
enzyme, the thumb, fingers and palm regions. The thumb region is
defined as residing between amino acids 240-315 of HIV reverse
transcriptase, or between amino acids 280-355 of M-MLV reverse
transcriptase. The fingers region is defined as residing between
amino acids 1-85 and 120-154 of HIV reverse transcriptase, or
between 1-124 and 161-193 of M-MLV reverse transcriptase. The palm
region is defined as residing between amino acids 86-199 and
155-239 of HIV reverse transcriptase, or between amino acids
126-160 and 193-279 of M-MLV reverse transcriptase. These areas are
generally defined, and the amino acids defining the N-termini and
C-termini are approximate. Corresponding regions may also be
defined for other reverse transcriptases. Preferred reverse
transcriptases of the invention have one or more modifications or
mutations within the hand domain. More particularly, reverse
transcriptases of the invention comprise one or more mutations or
modifications within one or more regions, including the thumb,
finger, and palm regions.
[0106] In general, the invention provides compositions for use in
reverse transcription of a nucleic acid molecule comprising a
reverse transcriptase with one or more (e.g., one, two, three,
four, five, ten, twelve, fifteen, twenty, thirty, etc.) mutations
or modification which render the reverse transcriptase more
thermostable. The invention also provides compositions for use in
reverse transcription of a nucleic acid molecule comprising a
reverse transcriptase with one or more mutations or modification
which render the reverse transcriptase more efficient, that is
having higher fidelity, and/or has lower TdT activity. The
invention further provides compositions comprising a reverse
transcriptase with one or more mutations or modification which
render the reverse transcriptase more thermostable and more
efficient.
[0107] The enzymes in these compositions are preferably present in
working concentrations and are also preferably reduced or
substantially reduced in RNase H activity. Alternatively, the
reverse transcriptases used in the compositions of the invention
may have RNase H activity. Preferred reverse transcriptases include
retroviral reverse transcriptases such as M-MLV reverse
transcriptase, HIV reverse transcriptase, RSV reverse
transcriptase, AMV reverse transcriptase, RAV reverse
transcriptase, and MAV reverse transcriptase or other ASLV reverse
transcriptases or their corresponding RNase H- derivatives.
Additional reverse transcriptases which may be used to prepare
compositions of the invention include bacterial reverse
transcriptases (e.g., Escherichia coli reverse transcriptase) (see,
e.g., Mao et al., Biochem. Biophys. Res. Commun. 227:489-93 (1996))
and reverse transcriptases of Saccharomyces cerevisiae (e.g.,
reverse transcriptases of the Ty1 or Ty3 retrotransposons) (see,
e.g., Cristofari et al., Jour. Biol. Chem. 274:36643-36648 (1999);
Mules et al., Jour. Virol. 72:6490-6503 (1998)).
[0108] In accordance with the invention, any number of mutations
can be made to the reverse transcriptases and, in a preferred
aspect, multiple mutations can be made to result in an increased
thermostability. Such mutations include point mutations, frame
shift mutations, deletions and insertions, with one or more (e.g.,
one, two, three, four, five, ten, twelve, fifteen, twenty, thirty,
etc.) point mutations preferred. Mutations may be introduced into
the reverse transcriptases of the present invention using any
methodology known to those of skill in the art. Mutations may be
introduced randomly by, for example, conducting a PCR reaction in
the presence of manganese as a divalent metal ion cofactor.
Alternatively, oligonucleotide directed mutagenesis may be used to
create the mutant polymerases which allows for all possible classes
of base pair changes at any determined site along the encoding DNA
molecule. In general, this technique involves annealing an
oligonucleotide complementary (except for one or more mismatches)
to a single stranded nucleotide sequence coding for the reverse
transcriptase of interest. The mismatched oligonucleotide is then
extended by DNA polymerase, generating a double-stranded DNA
molecule which contains the desired change in sequence in one
strand. The changes in sequence can, for example, result in the
deletion, substitution, or insertion of an amino acid. The
double-stranded polynucleotide can then be inserted into an
appropriate expression vector, and a mutant or modified polypeptide
can thus be produced. The above-described oligonucleotide directed
mutagenesis can, for example, be carried out via PCR.
[0109] The invention is also directed to methods for reverse
transcription of one or more (e.g., one, two, three, four, five,
ten, twelve, fifteen, twenty, etc.) nucleic acid molecules
comprising mixing one or more (e.g., one, two, three, four, five,
ten, twelve, fifteen, twenty, etc.) nucleic acid templates, which
is preferably RNA or messenger RNA (mRNA) and more preferably a
population of mRNA molecules, with one or more reverse
transcriptase of the present invention and incubating the mixture
under conditions sufficient to make a nucleic acid molecule or
molecules complementary to all or a portion of the one or more
(e.g., one, two, three, four, five, ten, twelve, fifteen, twenty,
thirty, etc.) templates. To make the nucleic acid molecule or
molecules complementary to the one or more templates, a primer
(e.g., an oligo(dT) primer) and one or more nucleotides are
preferably used for nucleic acid synthesis in the 5' to 3'
direction. Nucleic acid molecules suitable for reverse
transcription according to this aspect of the invention include any
nucleic acid molecule, particularly those derived from a
prokaryotic or eukaryotic cell. Such cells may include normal
cells, diseased cells, transformed cells, established cells,
progenitor cells, precursor cells, fetal cells, embryonic cells,
bacterial cells, yeast cells, animal cells (including human cells),
avian cells, plant cells and the like, or tissue isolated from a
plant or an animal (e.g., human, cow, pig, mouse, sheep, horse,
monkey, canine, feline, rat, rabbit, bird, fish, insect, etc.).
Such nucleic acid molecules may also be isolated from viruses.
[0110] The invention fturther provides methods for amplifying or
sequencing a nucleic acid molecule comprising contacting the
nucleic acid molecule with a reverse transcriptase of the present
invention. Preferred such methods comprise one or more polymerase
chain reactions (PCRs).
Sources of Reverse Transcriptases
[0111] Enzymes for use in the compositions, methods and kits of the
invention include any enzyme having reverse transcriptase activity.
Such enzymes include, but are not limited to, retroviral reverse
transcriptase, retrotransposon reverse transcriptase, hepatitis B
reverse transcriptase, cauliflower mosaic virus reverse
transcriptase, bacterial reverse transcriptase, Tth DNA polymerase,
Taq DNA polymerase (Saiki, R. K., et al., Science 239:487-491
(1988); U.S. Pat. Nos. 4,889,818 and 4,965,188), Tne DNA polymerase
(PCT Publication No. WO 96/10640), Tma DNA polymerase (U.S. Pat.
No. 5,374,553) and mutants, fragments, variants or derivatives
thereof (see, e.g., commonly owned U.S. Pat. Nos. 5,948,614 and
6,015,668, which are incorporated by reference herein in their
entireties). Preferably, reverse transcriptases for use in the
invention include retroviral reverse transcriptases such as M-MLV
reverse transcriptase, AMV reverse transcriptase, RSV reverse
transcriptase, RAV reverse transcriptase, MAV reverse
transcriptase, and generally ASLV reverse transcriptases. As will
be understood by one of ordinary skill in the art, modified reverse
transcriptases may be obtained by recombinant or genetic
engineering techniques that are routine and well-known in the art.
Mutant reverse transcriptases can, for example, be obtained by
mutating the gene or genes encoding the reverse transcriptase of
interest by site-directed or random mutagenesis. Such mutations may
include point mutations, deletion mutations and insertional
mutations. For example, one or more point mutations (e.g.,
substitution of one or more amino acids with one or more different
amino acids) may be used to construct mutant reverse transcriptases
of the invention.
[0112] The invention further includes reverse transcriptases which
are 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical
at the amino acid level to a wild-type reverse transcriptase (e.g.,
M-MLV reverse transcriptase, AMV reverse transcriptase, RSV reverse
transcriptase, HIV reverse transcriptase, etc.) and exhibit
increased thermostability. Also included within the invention are
reverse transcriptases which are 70%, 75%, 80%, 85%, 90%, 95%, 96%,
97%, 98%, or 99% identical at the amino acid level to a reverse
transcriptase comprising the amino acid sequence set out below in
Table 3 (SEQ ID NO:2) and exhibit increased thermostability and/or
more efficient (e.g., having higher fidelity and/or having lower
TdT activity). The invention also includes nucleic acid molecules
which encode the above described reverse transcriptases.
[0113] The invention also includes fragments of reverse
transcriptases which comprise at least 200, 250, 300, 350, 400,
450, 500, 550, 600, 650, or 700 amino acid residues and retain one
or more activities associated with reverse transcriptases. Such
fragments may be obtained by deletion mutation, by recombinant
techniques that are routine and well-known in the art, or by
enzymatic digestion of the reverse transcriptase(s) of interest
using any of a number of well-known proteolytic enzymes. The
invention further includes nucleic acid molecules which encode the
above described mutant reverse transcriptases and reverse
transcriptase fragments.
[0114] Reverse transcriptase fragments of the invention also
comprise amino acids 1-355, 1-498, 1-500, and 1-550 of M-MLV
reverse transcriptase, as well as corresponding fragments of other
reverse transcriptases. Reverse transcriptase fragments of the
invention further comprise polypeptides which are 70%, 75%, 80%,
85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to one or more of
the fragments set out above.
[0115] By a protein or protein fragment having an amino acid
sequence at least, for example, 70% "identical" to a reference
amino acid sequence it is intended that the amino acid sequence of
the protein is identical to the reference sequence except that the
protein sequence may include up to 30 amino acid alterations per
each 100 amino acids of the amino acid sequence of the reference
protein. In other words, to obtain a protein having an amino acid
sequence at least 70% identical to a reference amino acid sequence,
up to 30% of the amino acid residues in the reference sequence may
be deleted or substituted with another amino acid, or a number of
amino acids up to 30% of the total amino acid residues in the
reference sequence may be inserted into the reference sequence.
These alterations of the reference sequence may occur at the amino
(N--) and/or carboxy (C--) terminal positions of the reference
amino acid sequence and/or anywhere between those terminal
positions, interspersed either individually among residues in the
reference sequence and/or in one or more contiguous groups within
the reference sequence. As a practical matter, whether a given
amino acid sequence is, for example, at least 70% identical to the
amino acid sequence of a reference protein can be determined
conventionally using known computer programs such as those
described above for nucleic acid sequence identity determinations,
or using the CLUSTAL W program (Thompson, J. D., et al., Nucleic
Acids Res. 22:4673-4680 (1994)).
[0116] Preferred enzymes for use in the invention include those
that are reduced or substantially reduced in RNase H activity. Such
enzymes that are reduced or substantially reduced in RNase H
activity may be obtained by mutating, for example, the RNase H
domain within the reverse transcriptase of interest, for example,
by introducing one or more (e.g., one, two, three, four, five, ten,
twelve, fifteen, twenty, thirty, etc.) point mutations, one or more
(e.g., one, two, three, four, five, ten, twelve, fifteen, twenty,
thirty, etc.) deletion mutations, and/or one or more (e.g., one,
two, three, four, five, ten, twelve, fifteen, twenty, thirty, etc.)
insertion mutations as described above.
[0117] By an enzyme "substantially reduced in RNase H activity" is
meant that the enzyme has less than about 30%, less than about 25%,
less than about 20%, more preferably less than about 15%, less than
about 10%, less than about 7.5%, or less than about 5%, and most
preferably less than about 5% or less than about 2%, of the RNase H
activity of the corresponding wild-type or RNase H.sup.+ enzyme,
such as wild-type Moloney Murine Leukemia Virus (M-MLV), Avian
Myeloblastosis Virus (AMV) or Rous Sarcoma Virus (RSV) reverse
transcriptases.
[0118] Reverse transcriptases having reduced or substantially
reduced RNase H activity have been previously described (see U.S.
Pat. No. 5,668,005, U.S. Pat. No. 6,063,608, and PCT Publication
No. WO 98/47912). The RNase H activity of any enzyme may be
determined by a variety of assays, such as those described, for
example, in U.S. Pat. No. 5,244,797, in Kotewicz, M. L., et al.,
Nucl. Acids Res. 16:265 (1988), in Gerard, G. F., et al., FOCUS
14(5):91 (1992), and in U.S. Pat. No. 5,668,005, the disclosures of
all of which are fully incorporated herein by reference.
[0119] Particularly preferred enzymes for use in the invention
include, but are not limited to, M-MLV RNase H- reverse
transcriptase, RSV RNase H- reverse transcriptase, AMV RNase H-
reverse transcriptase, RAV RNase H- reverse transcriptase, MAV
RNase H- reverse transcriptase and HIV RNase H- reverse
transcriptase. It will be understood by one of ordinary skill,
however, that any enzyme capable of producing a DNA molecule from a
ribonucleic acid molecule (i.e., having reverse transcriptase
activity) that is reduced or substantially reduced in RNase H
activity may be equivalently used in the compositions, methods and
kits of the invention.
[0120] Enzymes for use in the invention also include those in which
terminal deoxynucleotidyl transferase (TdT) activity has been
reduced, substantially reduced, or eliminated. Such enzymes that
are reduced or substantially reduced in terminal deoxynucleotidyl
transferase activity, or in which TdT activity has been eliminated,
may be obtained by mutating, for example, amino acid residues
within the reverse transcriptase of interest which are in close
proximity or in contact with the template-primer, for example, by
introducing one or more (e.g., one, two, three, four, five, ten,
twelve, fifteen, twenty, thirty, etc.) point mutations, one or more
deletion mutations, and/or one or more insertion mutations. Reverse
transcriptases which exhibit decreased TdT activity are described
in U.S. application Ser. No. 09/808,124, filed Mar. 15, 2001 (the
entire disclosure of which is incorporated herein by reference),
and include reverse transcriptases with one or more alterations at
amino acid positions equivalent or corresponding to Y64, M289,
F309, T197 and/or Y133 of M-MLV reverse transcriptase.
[0121] In one aspect, amino acid substitutions are made at one or
more of the above identified positions (i.e., amino acid positions
equivalent or corresponding to Y64, M289, F309, T197 or Y133 of
M-MLV reverse transcriptase). Thus, the amino acids at these
positions may be substituted with any other amino acid including
Ala, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe,
Pro, Ser, Thr, Trp, Tyr, and Val. Specific example of reverse
transcriptases which exhibit reduced or substantially reduced TdT
activity include M-MLV reverse transcriptases (e.g.,
SuperScript.TM.II) in which (1) the phenylalanine residue at
position 309 has been replaced with asparagine, (2) the threonine
residue at position 197 has been replaced with either alanine or
glutamic acid, and/or (3) the tyrosine residue at position 133 has
been replaced with alanine.
[0122] Enzymes for use in the invention also include those in which
exhibit increased fidelity. Reverse transcriptases which exhibit
increased fidelity are described in U.S. Appl. No. 60/189,454,
filed Mar. 15, 2000, and U.S. application Ser. No. 09/808,124,
filed Mar. 15, 2001 (the entire disclosures of each of which are
incorporated herein by reference), and include reverse
transcriptases with one or more alterations at positions equivalent
or corresponding to those set out below in Table 2.
TABLE-US-00002 TABLE 2 RT Amino Acid M-MLV Y64 (e.g., Y64W, Y64R),
R116 (e.g., R116M), K152 (e.g., K152R), Q190 (e.g., Q190F), T197
(e.g., T197A, T197E), V223 (e.g., V223H, V223I, V223F), D124, H126,
Y133 (e.g., Y133A, Y133H), F309 (e.g., F309N, F309R) AMV W25, R76,
K110, Q149, T156, M182 RSV W25, R76, K110, Q149, T156, M182 HIV
W24, R78, G112, Q151, A158, M184
[0123] In some embodiments of the invention, amino acid
substitutions are made at one or more of the above identified
positions. Thus, the amino acids at these positions may be
substituted with any other amino acid including Ala, Asn, Asp, Cys,
Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp,
Tyr, and Val. Specific example of reverse transcriptases which
exhibit increased fidelity include M-MLV reverse transcriptase in
which (1) the valine residue at position 223 has been replaced with
histidine, phenylalanine or isoleucine, (2) the arginine residue at
position 116 has been replaced with methionine, (3) the lysine
residue at position 152 has been replaced with arginine, (4) the
glutarnic acid residue at position 190 has been replaced with
phenylalanine, (5) the threonine residue at position 197 has been
replaced with alanine or glutamic acid, (6) the phenylalanine
residue at position 309 has been replaced with asparagine or
arginine, (7) the tyrosine residue at position 133 has been
replaced with histidine or alanine, and/or (8) the tyrosine residue
at position 64 has been replaced with tryptophan or arginine.
[0124] Thus, in specific embodiments, the invention includes
reverse transcriptases which exhibit increased thermostability and,
optionally, also exhibit one or more of the following
characteristics: (1) reduced or substantially reduced RNase H
activity, (2) reduced or substantially reduced TdT activity, and/or
(3) increased fidelity.
[0125] The invention also relates to reverse transcriptase mutants,
where the mutations or substitutions have been made in a recognized
region of the reverse transcriptase enzyme. Such regions include,
but are not limited to, the fingers, palm and thumb regions. Thus,
the invention includes reverse transcriptases which exhibit
increased thermostability (as well as other properties), as
described elsewhere herein, and have one or more (e.g., one, two,
three, four, five, ten, fifteen, etc.) mutations or modification in
the hand domain and, more specifically, in one or more regions
including the fingers, palm and/or thumb regions.
[0126] Polypeptides having reverse transcriptase activity for use
in the invention may be isolated from their natural viral or
bacterial sources according to standard procedures for isolating
and purifying natural proteins that are well-known to one of
ordinary skill in the art (see, e.g., Houts, G. E., et al., J.
Virol. 29:517 (1979)). In addition, polypeptides having reverse
transcriptase activity may be prepared by recombinant DNA
techniques that are familiar to one of ordinary skill in the art
(see, e.g., Kotewicz, M. L., et al., Nucl. Acids Res. 16:265
(1988); Soltis, D. A., and Skalka, A. M., Proc. Natl. Acad. Sci.
USA 85:3372-3376 (1988)).
[0127] In one aspect of the invention, mutant or modified reverse
transcriptases are made by recombinant techniques. A number of
cloned reverse transcriptase genes are available or may be obtained
using standard recombinant techniques (see U.S. Pat. No. 5,668,005
and PCT Publication No. WO 98/47912).
[0128] To clone a gene or other nucleic acid molecule encoding a
reverse transcriptase which will be modified in accordance with the
invention, isolated DNA which contains the reverse transcriptase
gene or open reading frame may be used to construct a recombinant
DNA library. Any vector, well known in the art, can be used to
clone the reverse transcriptase of interest. However, the vector
used must be compatible with the host in which the recombinant
vector will be transformed.
[0129] Prokaryotic vectors for constructing the plasmid library
include plasmids such as those capable of replication in E. coli
such as, for example, pBR322, ColE1, pSC101, pUC-vectors (pUC18,
pUC19, etc.: In: Molecular Cloning, A Laboratory Manual, Cold
Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1982);
and Sambrook et al., In: Molecular Cloning A Laboratory Manual (2d
ed.) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
(1989)). Bacillus plasmids include pC194, pUB110, pE194, pC221,
pC217, etc. Such plasmids are disclosed by Glyczan, T. In: The
Molecular Biology Bacilli, Academic Press, York (1982), 307-329.
Suitable Streptomyces plasmids include pIJ101 (Kendall et al., J.
Bacteriol. 169:4177-4183 (1987)). Pseudomonas plasmids are reviewed
by John et al., (Rad. Insec. Dis. 8:693-704 (1986)), and Igaki,
(Jpn. J. Bacteriol. 33:729-742 (1978)). Broad-host range plasmids
or cosmids, such as pCP13 (Darzins and Chakrabarty, J. Bacteriol.
159:9-18 (1984)) can also be used for the present invention.
Preferred vectors for cloning the genes and nucleic acid molecules
of the present invention are prokaryotic vectors. Preferably, pCP13
and pUC vectors are used to clone the genes of the present
invention.
[0130] Suitable host for cloning the reverse transcriptase genes
and nucleic acid molecules of interest are prokaryotic hosts. One
example of a prokaryotic host is E. coli. However, the desired
reverse transcriptase genes and nucleic acid molecules of the
present invention may be cloned in other prokaryotic hosts
including, but not limited to, hosts in the genera Escherichia,
Bacillus, Streptomyces, Pseudomonas, Salmonella, Serratia, and
Proteus. Bacterial hosts of particular interest include E. coli
DH10B, which may be obtained from Invitrogen Corp. (Carlsbad,
Calif.).
[0131] Eukaryotic hosts for cloning and expression of the reverse
transcriptase of interest include yeast, fungal, and mammalian
cells. Expression of the desired reverse transcriptase in such
eukaryotic cells may require the use of eukaryotic regulatory
regions which include eukaryotic promoters. Cloning and expressing
the reverse transcriptase gene or nucleic acid molecule in
eukaryotic cells may be accomplished by well known techniques using
well known eukaryotic vector systems.
[0132] Once a DNA library has been constructed in a particular
vector, an appropriate host is transformed by well known
techniques. Transformed cells are plated at a density to produce
approximately 200-300 transformed colonies per petri dish. For
selection of reverse transcriptase, colonies are then screened for
the expression of a thermostable reverse transcriptase as described
in the Examples below. Briefly, overnight cultures of individual
transformant colonies are assayed directly for thermostable reverse
transcriptase activity using a labeled deoxynucleotide and analyzed
for the presence of labeled product. If thermostable reverse
transcriptase activity is detected, the mutant is sequenced to
determine which amino acids maintained reverse transcriptase
activity. The gene or nucleic acid molecule encoding a reverse
transcriptase of the present invention can be cloned using
techniques known to those in the art.
Modifications or Mutations of Polymerases
[0133] In accordance with the invention, one or more mutations may
be made in any reverse transcriptase in order to increase the
thermostability of the enzyme, or confer other properties described
herein upon the enzyme, in accordance with the invention. Such
mutations include point mutations, frame shift mutations, deletions
and insertions. Preferably, one or more point mutations, resulting
in one or more amino acid substitutions, are used to produce
reverse transcriptases having enhanced or increased
thermostability. In a preferred aspect of the invention, one or
more mutations at positions equivalent or corresponding to position
H204 (e.g., H204R) and/or T306 (e.g., T306K or T306R) of M-MLV
reverse transcriptase may be made to produced the desired result in
other reverse transcriptases of interest.
[0134] In specific embodiments, one or more mutations at positions
equivalent or corresponding to position L52, Y64, R116, Y133, K152
Q190, T197, H204, V223, M289, T306 and/or F309 of M-MLV reverse
transcriptase may be made to produced a desired result (e.g.,
increased thermostability, increased fidelity, decreased TdT
activity, etc.). Thus, in specific embodiments, using amino acid
positions of M-MLV reverse transcriptase as a frame of reference,
proteins of the invention include reverse transcriptases (e.g.,
M-MLV reverse transcriptase, AMV reverse transcriptase, HIV reverse
transcriptase, RSV reverse transcriptase, etc.) having one or more
of the following alterations: L52P, Y64S, Y64W, Y64R, R116M, Y133A,
Y133H, K152R, K152M, Q190F, T197R, T197E, T197A, T197K, H204R,
V223H, V223F, V223I, M289L, T306K, T306R, F309R, and/or F309N, as
well as compositions containing these proteins, nucleic acid
molecules which encode these proteins, and host cells which contain
these nucleic acid molecules.
[0135] Mutations in reverse transcriptases which alter
thermostability properties of these proteins may be present in
conjunction with alterations which either have little or no effect
on activities normally associated with reverse transcriptases
(e.g., RNase H activity, reverse transcriptase activity, terminal
deoxynucleotidyl transferase (TdTase) activity, etc.) or
substantially alter one or more activities normally associated with
reverse transcriptases. One example of a reverse transcriptase
which has such a combination of mutations is a M-MLV reverse
transcriptase which has the following alterations: K152M,
V223H.
[0136] One mutation which has been shown to enhanced the fidelity
of SuperScript.TM.II (Invitrogen Corp. (Carlsbad, Calif.) Catalog
No. 18064-022) is V223H (see U.S. Appl. No. 60/189,454, filed Mar.
15, 2000, and U.S. application Ser. No. 09/808,124, filed Mar. 15,
2001, the entire disclosures of each of which are incorporated
herein by reference). However, the V223H alteration decreases the
thermostability of this enzyme. One mutant was identified, K152M,
which suppress the destabilizing effect of enzymes having the V223H
mutation. Thus, the invention includes M-MLV reverse transcriptase
which contain alterations at positions K152 and V223 and exhibit
both increased fidelity and increased thermostability. Specific
examples of such reverse transcriptases are those in which K152 is
replaced with methionine and V223 is replaced with histidine. Other
reverse transcriptases (e.g., AMV reverse transcriptase, HIV
reverse transcriptase, RSV reverse transcriptase, etc.) with
corresponding alterations are also included within the scope of the
invention.
[0137] SuperScript.TM.II is an RNase H- reverse transcriptase from
M-MLV which has the following substitutions: D524G, E562Q, and
D583N (see U.S. Pat. Nos. 5,017,492, 5,244,797, 5,405,776,
5,668,005, and 6,063,608, the entire disclosures of which are
incorporated herein by reference).
[0138] One or more amino acid substitutions are made at one or more
selected positions for any reverse transcriptase of interest. Thus,
the amino acids at the selected positions may be substituted with
any other amino acid including Ala, Asn, Asp, Cys, Gln, Glu, Gly,
His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, and Val. In
some preferred embodiments, the selected amino acid will be a
non-charged surface residue and will be replaced by a charged
residue. In some preferred embodiments, the non-charged surface
residue may be replaced by a positively charged amino acid (e.g.
lysine or arginine).
[0139] The corresponding positions of M-MLV reverse transcriptase
identified above may be readily identified for other reverse
transcriptases by one with skill in the art. Thus, given the
defined region and the assays described in the present application,
one with skill in the art can make one or a number of modifications
which would result in increased thermostability of any reverse
transcriptase of interest. Residues to be modified in accordance
with the present invention may include those listed in Table 1
above.
[0140] The nucleotide sequences for M-MLV reverse transcriptase
(Shinnick et al., 1981, Nature 293:543-548; Georgiadis et al.,
1995, Structure 3:879-892), AMV reverse transcriptase (Joliot et
al., 1993, Virology 195:812-819), RSV reverse transcriptase
(Schwartz et al., 1983, Cell 32:853-859), and HIV reverse
transcriptase (Wong-Staal et al., 1985, Nature 313:277-284) are
known.
[0141] Preferably, oligonucleotide directed mutagenesis is used to
create the mutant reverse transcriptases which allows for all
possible classes of base pair changes at any determined site along
the encoding DNA molecule.
Enhancing Expression of Reverse Transcriptases
[0142] To optimize expression of the reverse transcriptases of the
present invention, inducible or constitutive promoters are well
known and may be used to express high levels of a reverse
transcriptase structural gene in a recombinant host. Similarly,
high copy number vectors, well known in the art, may be used to
achieve high levels of expression. Vectors having an inducible high
copy number may also be useful to enhance expression of the reverse
transcriptases of the invention in a recombinant host.
[0143] To express the desired structural gene in a prokaryotic cell
(such as, E. coli, B. subtilis, Pseudomonas, etc.), it is necessary
to operably link the desired structural gene to a functional
prokaryotic promoter. However, the natural promoter of the reverse
transcriptase gene may function in prokaryotic hosts allowing
expression of the reverse transcriptase gene. Thus, the natural
promoter or other promoters may be used to express the reverse
transcriptase gene. Such other promoters that may be used to
enhance expression include constitutive or regulatable (i.e.,
inducible or derepressible) promoters. Examples of constitutive
promoters include the int promoter of bacteriophage .lamda., and
the bla promoter of the .beta.-lactamase gene of pBR322. Examples
of inducible prokaryotic promoters include the major right and left
promoters of bacteriophage .lamda. (P.sub.R and P.sub.L), trp,
recA, lacZ, lacI, tet, gal, trc, ara BAD (Guzman, et al., 1995, J.
Bacteriol. 177(14):4121-4130) and tac promoters of E. coli. The B.
subtilis promoters include .alpha.-amylase (Ulmanen et al., J.
Bacteriol 162:176-182 (1985)) and Bacillus bacteriophage promoters
(Gryczan, T., In: The Molecular Biology Of Bacilli, Academic Press,
New York (1982)). Streptomyces promoters are described by Ward et
al., Mol. Gen. Genet. 203:468478 (1986)). Prokaryotic promoters are
also reviewed by Glick, J. Ind. Microbiol. 1:277-282 (1987);
Cenatiempto, Y., Biochimie 68:505-516 (1986); and Gottesman, Ann.
Rev. Genet. 18:415-442 (1984). Expression in a prokaryotic cell
also requires the presence of a ribosomal binding site upstream of
the gene-encoding sequence. Such ribosomal binding sites are
disclosed, for example, by Gold et al., Ann. Rev. Microbiol.
35:365404 (1981).
[0144] To enhance the expression of polymerases of the invention in
a eukaryotic cell, well known eukaryotic promoters and hosts may be
used. Enhanced expression of the polymerases may be accomplished in
a prokaryotic host. One example of a prokaryotic host suitable for
use with the present invention is Escherichia coli.
Isolation and Purification of Reverse Transcriptases
[0145] The enzyme(s) of the present invention is preferably
produced by growth in culture of the recombinant host containing
and expressing the desired reverse transcriptase gene. However, the
reverse transcriptase of the present invention may be isolated from
any strain which produces the reverse transcriptase of the present
invention. Fragments of the reverse transcriptase are also included
in the present invention. Such fragments include proteolytic
fragments and fragments having reverse transcriptase activity.
[0146] Any nutrient that can be assimilated by a host containing
the cloned reverse transcriptase gene may be added to the culture
medium. Optimal culture conditions should be selected case by case
according to the strain used and the composition of the culture
medium. Antibiotics may also be added to the growth media to insure
maintenance of vector DNA containing the desired gene to be
expressed. Media formulations have been described in DSM or ATCC
Catalogs and Sambrook et al., In: Molecular Cloning, a Laboratory
Manual (2nd ed.), Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, N.Y. (1989).
[0147] Recombinant host cells producing the reverse transcriptases
of this invention can be separated from liquid culture, for
example, by centrifugation. In general, the collected microbial
cells are dispersed in a suitable buffer, and then broken open by
ultrasonic treatment or by other well known procedures to allow
extraction of the enzymes by the buffer solution. After removal of
cell debris by ultracentrifugation or centrifugation, the reverse
transcriptases can be purified by standard protein purification
techniques such as extraction, precipitation, chromatography,
affinity chromatography, electrophoresis or the like. Assays to
detect the presence of the reverse transcriptase during
purification are well known in the art and can be used during
conventional biochemical purification methods to determine the
presence of these enzymes.
[0148] In some embodiments, the reverse transcriptases of the
present invention may be modified to contain an affinity tag in
order to facilitate the purification of the reverse transcriptase.
Suitable affinity tags are well known to those skilled in the art
and include, but are not limited to, repeated sequences of amino
acids such as six histidines, epitopes such as the hemagluttinin
epitope and the myc epitope, and other amino acid sequences that
permit the simplified purification of the reverse
transcriptase.
[0149] The reverse transcriptases of the invention preferably have
specific activities greater than about 5 units/mg, more preferably
greater than about 50 units/mg, still more preferably greater than
about 100 units/mg, 250 units/mg, 500 units/mg, 1000 units/mg, 5000
units/mg or 10,000 units/mg, and most preferably greater than about
15,000 units/mg, greater than about 16,000 units/mg, greater than
about 17,000 units/mg, greater than about 18,000 units/mg, greater
than about 19,000 units/mg and greater than about 20,000 units/mg.
In some embodiments, the reverse transcriptases of the present
invention may have specific activities greater than about 50,000
units/mg, greater than about 100,000 units/mg, greater than about
150,000 units/mg, greater than about 200,000 units/mg, greater than
about 250,000 units/mg and greater than about 300,000 units/mg.
Preferred ranges of specific activities for the reverse
transcriptases of the invention include a specific activity from
about 5 units/mg to about 350,000 units/mg, a specific activity
from about 5 units/mg to about 300,000 units/mg, a specific
activity of from about 50 units/mg to about 300,000 units/mg, a
specific activity from about 100 units/mg to about 300,000
units/mg, a specific activity from about 250 units/mg to about
300,000 units/mg, a specific activity from about 500 units/mg to
about 300,000 units/mg, a specific activity from about 1000
units/mg to about 300,000 units/mg, a specific activity from about
5000 units/mg to about 300,000 units/mg, a specific activity from
about 10,000 units/mg to about 300,000 units/mg, a specific
activity from about 25,000 units/mg to about 300,000 units/mg, a
specific activity from about 100 units/mg to about 500 units/mg, a
specific activity from about 100 units/mg to about 400 units/mg,
and a specific activity from about 200 units/mg to about 500
units/mg. Other preferred ranges of specific activities include a
specific activity of from about 200,000 units/mg to about 350,000
units/mg, a specific activity from about 225,000 units/mg to about
300,000 units/mg, and a specific activity from about 250,000
units/mg to about 300,000 units/mg. Preferably, the lower end of
the specific activity range may vary from 50, 100, 200, 300, 400,
500, 700, 900, 1,000, 5,000, 10,000, 20,000, 30,000, 35,000,
40,000, 45,000, 50,000, 55,000, 60,000, 65,000, 70,000, 75,000, and
80,000 units/mg, while the upper end of the range may vary from
350,000, 300,000, 250,000, 200,000, 150,000, 140,000, 130,000,
120,000, 110,000, 100,000, and 90,000 units/mg. In some embodiments
of the present invention, the specific activity of the thermostable
reverse transcriptase prepared in accordance with the present
invention may be higher than the specific activity of a
non-thermostable reverse transcriptase. In some embodiments, the
specific activity of the thermostable reverse transcriptase may be
5%, 10,%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or
more higher than the specific activity of a corresponding
non-thermostable reverse transcriptase. In some preferred
embodiments, the specific activity of the thermostable reverse
transcriptase according to the present invention may be 30% or more
higher than the specific activity of a corresponding
non-thermostable reverse transcriptase. In accordance with the
invention, specific activity is a measurement of the enzymatic
activity (in units) of the protein or enzyme relative to the total
amount of protein or enzyme used in a reaction. The measurement of
a specific activity may be determined by standard techniques
well-known to one of ordinary skill in the art.
[0150] The reverse transcriptases of the invention may be used to
make nucleic acid molecules from one or more templates. Such
methods comprise mixing one or more nucleic acid templates (e.g.,
mRNA, and more preferably a population of mRNA molecules) with one
or more of the reverse transcriptases of the invention and
incubating the mixture under conditions sufficient to make one or
more nucleic acid molecules complementary to all or a portion of
the one or more nucleic acid templates.
[0151] The invention also relates to methods for the amplification
of one or more nucleic acid molecules comprising mixing one or more
nucleic acid templates with one of the reverse transcriptases of
the invention, and incubating the mixture under conditions
sufficient to amplify one or more nucleic acid molecules
complementary to all or a portion of the one or more nucleic acid
templates. Such amplification methods may further comprise the use
of one or more DNA polymerases and may be employed as in standard
RT-PCR reactions.
[0152] The invention also concerns methods for the sequencing of
one or more nucleic acid molecules comprising (a) mixing one or
more nucleic acid molecules to be sequenced with one or more primer
nucleic acid molecules, one or more reverse transcriptases of the
invention, one or more nucleotides and one or more terminating
agents; (b) incubating the mixture under conditions sufficient to
synthesize a population of nucleic acid molecules complementary to
all or a portion of the one or more nucleic acid molecules to be
sequenced; and (c) separating the population of nucleic acid
molecules to determine the nucleotide sequence of all or a portion
of the one or more nucleic acid molecules to be sequenced.
[0153] The invention also concerns nucleic acid molecules produced
by such methods (which may be full-length cDNA molecules), vectors
(particularly expression vectors) comprising these nucleic acid
molecules and host cells comprising these vectors and nucleic acid
molecules.
Sources of DNA Polymerase
[0154] A variety of DNA polymerases are useful in accordance with
the present invention. Such polymerases include, but are not
limited to, Thermus thermophilus (Tth) DNA polymerase, Thermus
aquaticus (Taq) DNA polymerase, Thermotoga neapolitana (Tne) DNA
polymerase, Thermotoga maritima (Tma) DNA polymerase, Thermococcus
litoralis (Tli or VENT.TM.) DNA polymerase, Pyrococcus furiosis
(Pfu) DNA polymerase, Pyrococcus species GB-D (DEEPVENT.TM.) DNA
polymerase, Pyrococcus woosii (Pwo) DNA polymerase, Bacillus
sterothermophilus (Bst) DNA polymerase, Bacillus caldophilus (Bca)
DNA polymerase, Sulfolobus acidocaldarius (Sac) DNA polymerase,
Thermoplasma acidophilum (Tac) DNA polymerase, Thermus flavus
(Tfl/Tub) DNA polymerase, Thermus ruber (Tru) DNA polymerase,
Thermus brockianus (DYNAZYME.TM.) DNA polymerase, Methanobacterium
thermoautotrophicum (Mth) DNA polymerase, Mycobacterium spp. DNA
polymerase (Mtb, Mlep), and mutants, variants and derivatives
thereof.
[0155] DNA polymerases used in accordance with the invention may be
any enzyme that can synthesize a DNA molecule from a nucleic acid
template, typically in the 5' to 3' direction. Such polymerases may
be mesophilic or thermophilic, but are preferably thermophilic.
Mesophilic polymerases include T5 DNA polymerase, T7 DNA
polymerase, Klenow fragment DNA polymerase, DNA polymerase III, and
the like. Preferred DNA polymerases are thermostable DNA
polymerases such as Taq, Tne, Tma, Pfu, VENT.TM., DEEPVENT.TM., Tth
and mutants, variants and derivatives thereof (U.S. Pat. No.
5,436,149; U.S. Pat. No. 5,512,462; PCT Publication No. WO
92/06188; PCT Publication No. WO 92/06200; PCT Publication No. WO
96/10640; Barnes, W. M., Gene 112:29-35 (1992); Lawyer, F. C., et
al., PCR Meth. Appl. 2:275-287 (1993); Flaman, J.-M., et al., Nucl.
Acids Res. 22(15):3259-3260 (1994)). For amplification of long
nucleic acid molecules (e.g., nucleic acid molecules longer than
about 3-5 Kb in length), at least two DNA polymerases (one
substantially lacking 3' exonuclease activity and the other having
3' exonuclease activity) are typically used. See U.S. Pat. No.
5,436,149; U.S. Pat. No. 5,512,462; Barnes, W. M., Gene 112:29-35
(1992); PCT Publication No. WO 98/06736; and commonly owned,
co-pending U.S. patent application Ser. No. 08/801,720, filed Feb.
14, 1997, the disclosures of all of which are incorporated herein
in their entireties. Examples of DNA polymerases substantially
lacking in 3' exonuclease activity include, but are not limited to,
Taq, Tne(exo.sup.-), Tma, Pfu(exo.sup.-), Pwo and Tth DNA
polymerases, and mutants, variants and derivatives thereof.
Nonlimiting examples of DNA polymerases having 3' exonuclease
activity include Pfu, DEEPVENT.TM. and Tli/VENT.TM. and mutants,
variants and derivatives thereof.
Formulation of Enzyme Compositions
[0156] To form the compositions of the present invention, one or
more reverse transcriptases are preferably admixed in a buffered
salt solution. One or more DNA polymerases and/or one or more
nucleotides, and/or one or more primers may optionally be added to
make the compositions of the invention. More preferably, the
enzymes are provided at working concentrations in stable buffered
salt solutions. The terms "stable" and "stability" as used herein
generally mean the retention by a composition, such as an enzyme
composition, of at least 70%, preferably at least 80%, and most
preferably at least 90%, of the original enzymatic activity (in
units) after the enzyme or composition containing the enzyme has
been stored for about one week at a temperature of about 4.degree.
C., about two to six months at a temperature of about -20.degree.
C., and about six months or longer at a temperature of about
-80.degree. C. As used herein, the term "working concentration"
means the concentration of an enzyme that is at or near the optimal
concentration used in a solution to perform a particular function
(such as reverse transcription of nucleic acids).
[0157] The water used in forming the compositions of the present
invention is preferably distilled, deionized and sterile filtered
(through a 0.1-0.2 micrometer filter), and is free of contamination
by DNase and RNase enzymes. Such water is available commercially,
for example from Sigma Chemical Company (Saint Louis, Mo.), or may
be made as needed according to methods well known to those skilled
in the art.
[0158] In addition to the enzyme components, the present
compositions preferably comprise one or more buffers and cofactors
necessary for synthesis of a nucleic acid molecule such as a cDNA
molecule. Particularly preferred buffers for use in forming the
present compositions are the acetate, sulfate, hydrochloride,
phosphate or free acid forms of Tris-(hydroxymethyl)aminomethane
(TRIS.RTM.), although alternative buffers of the same approximate
ionic strength and pKa as TRIS.RTM. may be used with equivalent
results. In addition to the buffer salts, cofactor salts such as
those of potassium (preferably potassium chloride or potassium
acetate) and magnesium (preferably magnesium chloride or magnesium
acetate) are included in the compositions. Addition of one or more
carbohydrates and/or sugars to the compositions and/or synthesis
reaction mixtures may also be advantageous, to support enhanced
stability of the compositions and/or reaction mixtures upon
storage. Preferred such carbohydrates or sugars for inclusion in
the compositions and/or synthesis reaction mixtures of the
invention include, but are not limited to, sucrose, trehalose,
glycerol, and the like. Furthermore, such carbohydrates and/or
sugars may be added to the storage buffers for the enzymes used in
the production of the enzyme compositions and kits of the
invention. Such carbohydrates and/or sugars are commercially
available from a number of sources, including Sigma (St. Louis,
Mo.).
[0159] It is often preferable to first dissolve the buffer salts,
cofactor salts and carbohydrates or sugars at working
concentrations in water and to adjust the pH of the solution prior
to addition of the enzymes. In this way, the pH-sensitive enzymes
will be less subject to acid- or alkaline-mediated inactivation
during formulation of the present compositions.
[0160] To formulate the buffered salts solution, a buffer salt
which is preferably a salt of Tris(hydroxymethyl)aminomethane
(TRIS.RTM.), and most preferably the hydrochloride salt thereof, is
combined with a sufficient quantity of water to yield a solution
having a TRIS.RTM. concentration of 5-150 millimolar, preferably
10-60 millimolar, and most preferably about 20-60 millimolar. To
this solution, a salt of magnesium (preferably either the chloride
or acetate salt thereof) may be added to provide a working
concentration thereof of 1-10 millimolar, preferably 1.5-8.0
millimolar, and most preferably about 3-7.5 millimolar. A salt of
potassium (preferably a chloride or acetate salt of potassium) may
also be added to the solution, at a working concentration of 10-100
millimolar and most preferably about 75 millimolar. A reducing
agent such as dithiothreitol may be added to the solution,
preferably at a final concentration of about 1-100 mM, more
preferably a concentration of about 5-50 mM or about 7.5-20 mM, and
most preferably at a concentration of about 10 mM. Preferred
concentrations of carbohydrates and/or sugars for inclusion in the
compositions of the invention range from about 5% (w/v) to about
30% (w/v), about 7.5% (w/v) to about 25% (w/v), about 10% (w/v) to
about 25% (w/v), about 10% (w/v) to about 20% (w/v), and preferably
about 10% (w/v) to about 15% (w/v). A small amount of a salt of
ethylenediaminetetraacetate (EDTA), such as disodium EDTA, may also
be added (preferably about 0.1 millimolar), although inclusion of
EDTA does not appear to be essential to the function or stability
of the compositions of the present invention. After addition of all
buffers and salts, this buffered salt solution is mixed well until
all salts are dissolved, and the pH is adjusted using methods known
in the art to a pH value of 7.4 to 9.2, preferably 8.0 to 9.0, and
most preferably about 8.4.
[0161] To these buffered salt solutions, the enzymes (reverse,
transcriptases and/or DNA polymerases) are added to produce the
compositions of the present invention. M-MLV reverse transcriptases
are preferably added at a working concentration in the solution of
about 1,000 to about 50,000 units per milliliter, about 2,000 to
about 30,000 units per milliliter, about 2,500 to about 25,000
units per milliliter, about 3,000 to about 22,500 units per
milliliter, about 4,000 to about 20,000 units per milliliter, and
most preferably at a working concentration of about 5,000 to about
20,000 units per milliliter. AMV reverse transcriptases, RSV
reverse transcriptases and HIV reverse transcriptases, including
those of the invention described above, are preferably added at a
working concentration in the solution of about 100 to about 5000
units per milliliter, about 125 to about 4000 units per milliliter,
about 150 to about 3000 units per milliliter, about 200 to about
2500 units per milliliter, about 225 to about 2000 units per
milliliter, and most preferably at a working concentration of about
250 to about 1000 units per milliliter. The enzymes in the
thermophilic DNA polymerase group (Taq, Tne, Tma, Pfu, VENT,
DEEPVENT, Tth and mutants, variants and derivatives thereof) are
preferably added at a working concentration in the solution of
about 100 to about 1000 units per milliliter, about 125 to about
750 units per milliliter, about 150 to about 700 units per
milliliter, about 200 to about 650 units per milliliter, about 225
to about 550 units per milliliter, and most preferably at a working
concentration of about 250 to about 500 units per milliliter. The
enzymes may be added to the solution in any order, or may be added
simultaneously.
[0162] The compositions of the invention may further comprise one
or more nucleotides, which are preferably deoxynucleoside
triphosphates (dNTPs) or dideoxynucleoside triphosphates (ddNTPs).
The dNTP components of the present compositions serve as the
"building blocks" for newly synthesized nucleic acids, being
incorporated therein by the action of the polymerases, and the
ddNTPs may be used in sequencing methods according to the
invention. Examples of nucleotides suitable for use in the present
compositions include, but are not limited to, dUTP, dATP, dTTP,
dCTP, dGTP, dITP, 7-deaza-dGTP, .alpha.-thio-dATP,
.alpha.-thio-dTTP, .alpha.-thio-dGTP, .alpha.-thio-dCTP, ddUTP,
ddATP, ddTTP, ddCTP, ddGTP, ddITP, 7-deaza-ddGTP,
.alpha.-thio-ddATP, .alpha.-thio-ddTTP, .alpha.-thio-ddGTP,
.alpha.-thio-ddCTP or derivatives thereof, all of which are
available commercially from sources including Invitrogen Corp.
(Carlsbad, Calif.), New England BioLabs (Beverly, Mass.) and Sigma
Chemical Company (Saint Louis, Mo.). The nucleotides may be
unlabeled, or they may be detectably labeled by coupling them by
methods known in the art with radioisotopes (e.g., .sup.3H,
.sup.14C, .sup.32P or .sup.35S), vitamins (e.g., biotin),
fluorescent moieties (e.g., fluorescein, rhodamine, Texas Red, or
phycoerythrin), chemiluminescent labels (e.g., using the
PHOTO-GENE.TM. or ACES.TM. chemiluminescence systems, available
commercially from Invitrogen Corp. (Carlsbad, Calif.)), dioxigenin
and the like. Labeled nucleotides may also be obtained
commercially, for example from Invitrogen Corp. (Carlsbad, Calif.)
or Sigma Chemical Company (Saint Louis, Mo.). In the present
compositions, the nucleotides are added to give a working
concentration of each nucleotide of about 10-4000 micromolar, about
50-2000 micromolar, about 100-1500 micromolar, or about 200-1200
micromolar, and most preferably a concentration of about 1000
micromolar.
[0163] To reduce component deterioration, storage of the reagent
compositions is preferably at about 4.degree. C. for up to one day,
or most preferably at -20.degree. C. for up to one year.
[0164] In another aspect, the compositions and reverse
transcriptases of the invention may be prepared and stored in dry
form in the presence of one or more carbohydrates, sugars, or
synthetic polymers. Preferred carbohydrates, sugars or polymers for
the preparation of dried compositions or reverse transcriptases
include, but are not limited to, sucrose, trehalose, and
polyvinylpyrrolidone (PVP) or combinations thereof. See, e.g., U.S.
Pat. Nos. 5,098,893, 4,891,319, and 5,556,771, the disclosures of
which are entirely incorporated herein by reference. Such dried
compositions and enzymes may be stored at various temperatures for
extended times without significant deterioration of enzymes or
components of the compositions of the invention. Preferably, the
dried reverse transcriptases or compositions are stored at
4.degree. C. or at -20.degree. C.
Production/Sources of cDNA Molecules
[0165] In accordance with the invention, cDNA molecules
(single-stranded or double-stranded) may be prepared from a variety
of nucleic acid template molecules. Preferred nucleic acid
molecules for use in the present invention include single-stranded
or double-stranded DNA and RNA molecules, as well as
double-stranded DNA:RNA hybrids. More preferred nucleic acid
molecules include messenger RNA (mRNA), transfer RNA (tRNA) and
ribosomal RNA (rRNA) molecules, although mRNA molecules are the
preferred template according to the invention.
[0166] The nucleic acid molecules that are used to prepare cDNA
molecules according to the methods of the present invention may be
prepared synthetically according to standard organic chemical
synthesis methods that will be familiar to one of ordinary skill.
More preferably, the nucleic acid molecules may be obtained from
natural sources, such as a variety of cells, tissues, organs or
organisms. Cells that may be used as sources of nucleic acid
molecules may be prokaryotic (bacterial cells, including but not
limited to those of species of the genera Escherichia, Bacillus,
Serratia, Salmonella, Staphylococcus, Streptococcus, Clostridium,
Chlamydia, Neisseria, Treponema, Mycoplasma, Borrelia, Legionella,
Pseudomonas, Mycobacterium, Helicobacter, Erwinia, Agrobacterium,
Rhizobium, Xanthomonas and Streptomyces) or eukaryotic (including
flingi (especially yeasts), plants, protozoans and other parasites,
and animals including insects (particularly Drosophila spp. cells),
nematodes (particularly Caenorhabditis elegans cells), and mammals
(particularly human cells)).
[0167] Mammalian somatic cells that may be used as sources of
nucleic acids include blood cells (reticulocytes and leukocytes),
endothelial cells, epithelial cells, neuronal cells (from the
central or peripheral nervous systems), muscle cells (including
myocytes and myoblasts from skeletal, smooth or cardiac muscle),
connective tissue cells (including fibroblasts, adipocytes,
chondrocytes, chondroblasts, osteocytes and osteoblasts) and other
stromal cells (e.g., macrophages, dendritic cells, Schwann cells).
Mammalian germ cells (spermatocytes and oocytes) may also be used
as sources of nucleic acids for use in the invention, as may the
progenitors, precursors and stem cells that give rise to the above
somatic and germ cells. Also suitable for use as nucleic acid
sources are mammalian tissues or organs such as those derived from
brain, kidney, liver, pancreas, blood, bone marrow, muscle,
nervous, skin, genitourinary, circulatory, lymphoid,
gastrointestinal and connective tissue sources, as well as those
derived from a mammalian (including human) embryo or fetus.
[0168] Any of the above prokaryotic or eukaryotic cells, tissues
and organs may be normal, diseased, transformed, established,
progenitors, precursors, fetal or embryonic. Diseased cells may,
for example, include those involved in infectious diseases (caused
by bacteria, flngi or yeast, viruses (including AIDS, HIV, HTLV,
herpes, hepatitis and the like) or parasites), in genetic or
biochemical pathologies (e.g., cystic fibrosis, hemophilia,
Alzheimer's disease, muscular dystrophy or multiple sclerosis) or
in cancerous processes. Transformed or established animal cell
lines may include, for example, COS cells, CHO cells, VERO cells,
BHK cells, HeLa cells, HepG2 cells, K562 cells, 293 cells, L929
cells, F9 cells, and the like. Other cells, cell lines, tissues,
organs and organisms suitable as sources of nucleic acids for use
in the present invention will be apparent to one of ordinary skill
in the art.
[0169] Once the starting cells, tissues, organs or other samples
are obtained, nucleic acid molecules (such as mRNA) may be isolated
therefrom by methods that are well-known in the art (See, e.g.,
Maniatis, T., et al., Cell 15:687-701 (1978); Okayama, H., and
Berg, P., Mol. Cell. Biol. 2:161-170 (1982); Gubler, U., and
Hoffman, B. J., Gene 25:263-269 (1983)). The nucleic acid molecules
thus isolated may then be used to prepare cDNA molecules and cDNA
libraries in accordance with the present invention.
[0170] In the practice of the invention, cDNA molecules or cDNA
libraries are produced by mixing one or more nucleic acid molecules
obtained as described above, which is preferably one or more mRNA
molecules such as a population of mRNA molecules, with a
polypeptide having reverse transcriptase activity of the present
invention, or with one or more of the compositions of the
invention, under conditions favoring the reverse transcription of
the nucleic acid molecule by the action of the enzymes or the
compositions to form one or more cDNA molecules (single-stranded or
double-stranded). Thus, the method of the invention comprises (a)
mixing one or more nucleic acid templates (preferably one or more
RNA or mRNA templates, such as a population of mRNA molecules) with
one or more reverse transcriptases of the invention and (b)
incubating the mixture under conditions sufficient to make one or
more nucleic acid molecules complementary to all or a portion of
the one or more templates. Such methods may include the use of one
or more DNA polymerases, one or more nucleotides, one or more
primers, one or more buffers, and the like. The invention may be
used in conjunction with methods of cDNA synthesis such as those
described in the Examples below, or others that are well-known in
the art (see, e.g., Gubler, U., and Hoffman, B. J., Gene 25:263-269
(1983); Krug, M. S., and Berger, S. L., Meth. Enzymol. 152:316-325
(1987); Sambrook, J., et al., Molecular Cloning: A Laboratory
Manual, 2nd ed., Cold Spring Harbor, N.Y.: Cold Spring Harbor
Laboratory Press, pp. 8.60-8.63 (1989); PCT Publication No. WO
99/15702; PCT Publication No. WO 98/47912; and PCT Publication No.
WO 98/51699), to produce cDNA molecules or libraries.
[0171] Other methods of cDNA synthesis which may advantageously use
the present invention will be readily apparent to one of ordinary
skill in the art.
[0172] Having obtained cDNA molecules or libraries according to the
present methods, these cDNAs may be isolated for further analysis
or manipulation. Detailed methodologies for purification of cDNAs
are taught in the GENETRAPPER.TM. manual (Invitrogen Corp.
(Carlsbad, Calif.)), which is incorporated herein by reference in
its entirety, although alternative standard techniques of cDNA
isolation that are known in the art (see, e.g., Sambrook, J., et
al., Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring
Harbor, N.Y.: Cold Spring Harbor Laboratory Press, pp. 8.60-8.63
(1989)) may also be used.
[0173] In other aspects of the invention, the invention may be used
in methods for amplifying and sequencing nucleic acid molecules.
Nucleic acid amplification methods according to this aspect of the
invention may be one- step (e.g., one-step RT-PCR) or two-step
(e.g., two-step RT-PCR) reactions. According to the invention,
one-step RT-PCR type reactions may be accomplished in one tube
thereby lowering the possibility of contamination. Such one-step
reactions comprise (a) mixing a nucleic acid template (e.g, mRNA)
with one or more reverse transcriptases of the present invention
and with one or more DNA polymerases and (b) incubating the mixture
under conditions sufficient to amplify a nucleic acid molecule
complementary to all or a portion of the template. Such
amplification may be accomplished by the reverse transcriptase
activity alone or in combination with the DNA polymerase activity.
Two-step RT-PCR reactions may be accomplished in two separate
steps. Such a method comprises (a) mixing a nucleic acid template
(e.g., mRNA) with a reverse transcriptase of the present invention,
(b) incubating the mixture under conditions sufficient to make a
nucleic acid molecule (e.g., a DNA molecule) complementary to all
or a portion of the template, (c) mixing the nucleic acid molecule
with one or more DNA polymerases and (d) incubating the mixture of
step (c) under conditions sufficient to amplify the nucleic acid
molecule. For amplification of long nucleic acid molecules (i.e.,
greater than about 3-5 Kb in length), a combination of DNA
polymerases may be used, such as one DNA polymerase having 3'
exonuclease activity and another DNA polymerase being substantially
reduced in 3' exonuclease activity.
[0174] Nucleic acid sequencing methods according to this aspect of
the invention may comprise both cycle sequencing (sequencing in
combination with amplification) and standard sequencing reactions.
The sequencing method of the invention thus comprises (a) mixing a
nucleic acid molecule to be sequenced with one or more primers, one
or more reverse transcriptases of the invention, one or more
nucleotides and one or more terminating agents, (b) incubating the
mixture under conditions sufficient to synthesize a population of
nucleic acid molecules complementary to all or a portion of the
molecule to be sequenced, and (c) separating the population to
determine the nucleotide sequence of all or a portion of the
molecule to be sequenced. According to the invention, one or more
DNA polymerases (preferably thermostable DNA polymerases) may be
used in combination with or separate from the reverse
transcriptases of the invention.
[0175] Amplification methods which may be used in accordance with
the present invention include PCR (U.S. Pat. Nos. 4,683,195 and
4,683,202), Strand Displacement Amplification (SDA; U.S. Pat. No.
5,455,166; EP 0 684 315), and Nucleic Acid Sequence-Based
Amplification (NASBA; U.S. Pat. No. 5,409,818; EP 0 329 822), as
well as more complex PCR-based nucleic acid fingerprinting
techniques such as Random Amplified Polymorphic DNA (RAPD) analysis
(Williams, J. G. K., et al., Nucl. Acids Res. 18(22):6531-6535,
1990), Arbitrarily Primed PCR (AP-PCR; Welsh, J., and McClelland,
M., Nucl. Acids Res. 18(24):7213-7218, 1990), DNA Amplification
Fingerprinting (DAF; Caetano-Anolles et al., Bio/Technology
9:553-557, 1991), microsatellite PCR or Directed Amplification of
Minisatellite-region DNA (DAMD; Heath, D. D., et al., Nucl. Acids
Res. 21(24): 5782-5785, 1993), and Amplification Fragment Length
Polymorphism (AFLP) analysis (EP 0 534 858; Vos, P., et al., Nucl.
Acids Res. 23(21):4407-4414, 1995; Lin, J. J., and Kuo, J., FOCUS
17(2):66-70, 1995). Nucleic acid sequencing techniques which may
employ the present compositions include dideoxy sequencing methods
such as those disclosed in U.S. Pat. Nos. 4,962,022 and 5,498,523.
In a particularly preferred aspects, the invention may be used in
methods of amplifying or sequencing a nucleic acid molecule
comprising one or more polymerase chain reactions (PCRs), such as
any of the PCR-based methods described above.
Kits
[0176] In another embodiment, the present invention may be
assembled into kits for use in reverse transcription or
amplification of a nucleic acid molecule, or into kits for use in
sequencing of a nucleic acid molecule. Kits according to this
aspect of the invention comprise a carrier means, such as a box,
carton, tube or the like, having in close confinement therein one
or more container means, such as vials, tubes, ampules, bottles and
the like, wherein a first container means contains one or more
polypeptides of the present invention having reverse transcriptase
activity. When more than one polypeptide having reverse
transcriptase activity is used, they may be in a single container
as mixtures of two or more polypeptides, or in separate containers.
The kits of the invention may also comprise (in the same or
separate containers) one or more DNA polymerases, a suitable
buffer, one or more nucleotides and/or one or more primers.
[0177] In a specific aspect of the invention, the reverse
transcription and amplification kits may comprise one or more
components (in mixtures or separately) including one or more
polypeptides having reverse transcriptase activity of the
invention, one or more nucleotides needed for synthesis of a
nucleic acid molecule, and/or one or more primers (e.g., oligo(dT)
for reverse transcription). Such reverse transcription and
amplification kits may further comprise one or more DNA
polymerases. Sequencing kits of the invention may comprise one or
more polypeptides having reverse transcriptase activity of the
invention, and optionally one or more DNA polymerases, one or more
terminating agents (e.g., dideoxynucleoside triphosphate molecules)
needed for sequencing of a nucleic acid molecule, one or more
nucleotides and/or one or more primers. Preferred polypeptides
having reverse transcriptase activity, DNA polymerases,
nucleotides, primers and other components suitable for use in the
reverse transcription, amplification and sequencing kits of the
invention include those described above. The kits encompassed by
this aspect of the present invention may further comprise
additional reagents and compounds necessary for carrying out
standard nucleic acid reverse transcription, amplification or
sequencing protocols. Such polypeptides having reverse
transcriptase activity of the invention, DNA polymerases,
nucleotides, primers, and additional reagents, components or
compounds may be contained in one or more containers, and may be
contained in such containers in a mixture of two or more of the
above-noted components or may be contained in the kits of the
invention in separate containers.
Use of Nucleic Acid Molecules
[0178] The nucleic acid molecules or cDNA libraries prepared by the
methods of the present invention may be further characterized, for
example by cloning and sequencing (i.e., determining the nucleotide
sequence of the nucleic acid molecule), by the sequencing methods
of the invention or by others that are standard in the art (see,
e.g., U.S. Pat. Nos. 4,962,022 and 5,498,523, which are directed to
methods of DNA sequencing). Alternatively, these nucleic acid
molecules may be used for the manufacture of various materials in
industrial processes, such as hybridization probes by methods that
are well-known in the art. Production of hybridization probes from
cDNAs will, for example, provide the ability for those in the
medical field to examine a patient's cells or tissues for the
presence of a particular genetic marker such as a marker of cancer,
of an infectious or genetic disease, or a marker of embryonic
development. Furthermore, such hybridization probes can be used to
isolate DNA fragments from genomic DNA or cDNA libraries prepared
from a different cell, tissue or organism for further
characterization.
[0179] The nucleic acid molecules of the present invention may also
be used to prepare compositions for use in recombinant DNA
methodologies. Accordingly, the present invention relates to
recombinant vectors which comprise the cDNA or amplified nucleic
acid molecules of the present invention, to host cells which are
genetically engineered with the recombinant vectors, to methods for
the production of a recombinant polypeptide using these vectors and
host cells, and to recombinant polypeptides produced using these
methods.
[0180] Recombinant vectors may be produced according to this aspect
of the invention by inserting, using methods that are well-known in
the art, one or more of the cDNA molecules or amplified nucleic
acid molecules prepared according to the present methods into a
vector. The vector used in this aspect of the invention may be, for
example, a phage or a plasmid, and is preferably a plasmid.
Preferred are vectors comprising cis-acting control regions to the
nucleic acid encoding the polypeptide of interest. Appropriate
trans-acting factors may be supplied by the host, supplied by a
complementing vector or supplied by the vector itself upon
introduction into the host. In certain preferred embodiments in
this regard, the vectors provide for specific expression (and are
therefore termed "expression vectors"), which may be inducible
and/or cell type-specific. Particularly preferred among such
vectors are those inducible by environmental factors that are easy
to manipulate, such as temperature and nutrient additives.
[0181] Expression vectors useful in the present invention include
chromosomal-, episomal- and virus-derived vectors, e.g., vectors
derived from bacterial plasmids or bacteriophages, and vectors
derived from combinations thereof, such as cosmids and phagemids,
and will preferably include at least one selectable marker such as
a tetracycline or ampicillin resistance gene for culturing in a
bacterial host cell. Prior to insertion into such an expression
vector, the cDNA or amplified nucleic acid molecules of the
invention should be operatively linked to an appropriate promoter,
such as the phage lambda P.sub.L promoter, the E. coli lac, trp and
tac promoters. Other suitable promoters will be known to the
skilled artisan.
[0182] Among vectors preferred for use in the present invention
include pQE70, pQE60 and pQE-9, available from Qiagen; pBS vectors,
Phagescript vectors, Bluescript vectors, pNH8A, pNH16a, pNH18A,
pNH46A, available from Stratagene; pcDNA3 available from
Invitrogen; pGEX, pTrxfus, pTrc99a, pET-5, pET-9, pKK223-3,
pKK233-3, pDR540, pRIT5 available from Pharmacia; and pSPORT1,
pSPORT2 and pSV.SPORT1, available from Invitrogen Corp. (Carlsbad,
Calif.). Other suitable vectors will be readily apparent to the
skilled artisan.
[0183] The invention also provides methods of producing a
recombinant host cell comprising the cDNA molecules, amplified
nucleic acid molecules or recombinant vectors of the invention, as
well as host cells produced by such methods. Representative host
cells (prokaryotic or eukaryotic) that may be produced according to
the invention include, but are not limited to, bacterial cells,
yeast cells, plant cells and animal cells. Preferred bacterial host
cells include Escherichia coli cells (most particularly E. coli
strains DH10B and Stb12, which are available commercially
(Invitrogen Corp. (Carlsbad, Calif.)), Bacillus subtilis cells,
Bacillus megaterium cells, Streptomyces spp. cells, Erwinia spp.
cells, Klebsiella spp. cells and Salmonella typhimurium cells.
Preferred animal host cells include insect cells (most particularly
Spodoptera frugiperda Sf9 and Sf21 cells and Trichoplusa HigH-Five
cells) and mammalian cells (most particularly CHO, COS, VERO, BHK
and human cells). Such host cells may be prepared by well-known
transformation, electroporation or transfection techniques that
will be familiar to one of ordinary skill in the art.
[0184] In addition, the invention provides methods for producing a
recombinant polypeptide, and polypeptides produced by these
methods. According to this aspect of the invention, a recombinant
polypeptide may be produced by culturing any of the above
recombinant host cells under conditions favoring production of a
polypeptide therefrom, and isolation of the polypeptide. Methods
for culturing recombinant host cells, and for production and
isolation of polypeptides therefrom, are well-known to one of
ordinary skill in the art.
[0185] It will be readily apparent to one of ordinary skill in the
relevant arts that other suitable modifications and adaptations to
the methods and applications described herein are obvious and may
be made without departing from the scope of the invention or any
embodiment thereof. Having now described the present invention in
detail, the same will be more clearly understood by reference to
the following examples, which are included herewith for purposes of
illustration only and are not intended to be limiting of the
invention.
Examples
Example 1
Preparation of Mutant Reverse Transcriptases
[0186] Plasmid pBAD was obtained from Invitrogen and the coding
sequence of M-MLV reverse transcriptase was inserted to produce
plasmid pBAD-6-His-M-MLV H-(F1). Plasmid pBAD-6-His-M-MLV H-(F1)
was used as both a cloning vector and as a target for PCR
mutagenesis (FIG. 1). pBAD-6-His-M-MLV H- (F1) replicates in E.
coli and confers ampicillin resistance to transformed cells. The
M-MLV reverse transcriptase gene is expressed from the ara BAD
promoter which is induced by the presence of arabinose. The
promoter is repressed by the product of the araC gene, which is
present on the plasmid. The host used, E. coli strain DH10B, is an
araD mutant and cannot metabolize arabinose, making arabinose a
gratuitous inducer in DH10B cells transformed with pBAD-6-His-M-MLV
H-(F1). The plasmid contains a 6 histidine containing leader
sequence in frame with the coding sequence of the M-MLV reverse
transcriptase gene. With reference to the sequence of this plasmid
provided in Table 3 (SEQ ID NOs: 1 and 2), nucleotides 1-96 encode
the leader sequence and nucleotides 97-99 encode a methionine.
Those skilled in the art will appreciate that the wild-type M-MLV
reverse transcriptase is derived by proteolysis from a precursor
polyprotein and thus the wild-type M-MLV reverse transcriptase does
not start with a methionine. Therefore, amino acid number 1 of the
M-MLV reverse transcriptase is the threonine following the
methionine encoded by nucleotides 97-99.
[0187] The sequence of the M-MLV reverse transcriptase gene in
pBAD-6-His-M-MLV H- (F1) which was used in these experiments was
derived from the sequence of plasmid pRT601. pRT601 is described in
U.S. Pat. Nos. 5,668,005 and 5,017,492, which are incorporated
herein by reference in their entireties.
TABLE-US-00003 TABLE 3 1 atggggggtt ctcatcatca tcatcatcat
ggtatggcta gcatgactgg tggacagcaa (SEQ ID NO: 1) m g g s h h h h h h
g m a s m t g g q q (SEQ ID NO: 2) 61 atgggtcggg atctgtacga
cgatgacgat aagcatatga ccctaaatat agaagatgag m g r d l y d d d d k h
m t l n i e d e 121 tatcggctac atgagacctc aaaagagcca gatgtttctc
tagggtccac atggctgtct y r l h e t s k e p d v s l g s t w l s 181
gattttcctc aggcctgggc ggaaaccggg ggcatgggac tggcagttcg ccaagctcct d
f p q a w a e t g g m g l a v r q a p 241 ctgatcatac ttctgaaagc
aacctctacc cccgtgtcca taaaacaata ccccatgtca l i i l l k a t s t p v
s i k q y p m s 301 caagaagcca gactggggat caagccccac atacagagac
tgttggacca gggaatactg q e a r l g i k p h i q r l l d q g i l 361
gtaccctgcc agtccccctg gaacacgccc ctgctacccg tcaagaaacc cgggactaat v
p c q s p w n t p l l p v k k p g t n 421 gattacaggc ctgtccaaga
tctgagagag gtcaacaaac gcgtagaaga catccacccc d y r p v q d l r e v n
k r v e d i h p 481 accgtaccca acccctacaa cctcttgagt gggctcccac
cgtcccacca gtggtacact t v p n p y n l l s g l p p s h q w y t 541
gttctagact taaaagatgc ctttttctgc ctgagactcc acccgacgtc tcagcctctc v
l d l k d a f f c l r l h p t s q p l 601 ttcgcctttg aatggagaga
cccagagatg ggaatctctg gccaactaac ctggaccaga f a f e w r d p e m g i
s g q l t w t r 661 ctcccacagg gattcaaaaa cagtcccacc ctgtttgatg
aggcactgcg cagagaccta l p q g f k n s p t l f d e a l r r d l 721
gcagacttcc ggatccagca cccagacttg atcctgctac agtacgtaga tgacttactg a
d f r i q h p d l i l l q y v d d l l 781 ctggccgcca cttctgagct
cgactgccaa caaggtactc gggccctgtt acaaacccta l a a t s e l d c q q g
t r a l l q t l 841 ggagacctcg ggtatcgggc ctcggccaag aaagcccaaa
tttgccagaa acaggtcaag g d l g y r a s a k k a q i c q k q v k 901
tatctggggt atcttctaaa agagggtcag agatggctga ctgaggccag aaaagagact y
l g y l l k e g q r w l t e a r k e t 961 gtgatggggc agcctactcc
gaagaccccg cggcaactaa gggagttcct agggacggca v m g q p t p k t p r q
l r e f l g t a 1021 ggcttctgtc gcctctggat ccctgggttt gcagaaatgg
cagccccctt gtaccctctc g f c r l w i p g f a e m a a p l y p l 1081
accaaaacgg ggactctgtt taattggggc ccagaccaac aaaaggccta tcaagaaatc t
k t g t l f n w g p d q q k a y q e i 1141 aagcaagctc ttctaactgc
cccagccctg gggttgccag atttgactaa gccctttgaa k q a l l t a p a l g l
p d l t k p f e 1201 ctctttgtcg acgagaagca gggctacgcc aaaggtgtcc
taacgcaaaa actgggacct l f v d e k q g y a k g v l t q k l g p 1261
tggcgtcggc cggtggccta cctgtccaaa aagctagacc cagtagcagc tgggtggccc w
r r p v a y l s k k l d p v a a g w p 1321 ccttgcctac ggatggtagc
agccattgcc gtactgacaa aggatgcagg caagctaacc p c l r m v a a i a v l
t k d a g k l t 1381 atgggacagc cactagtcat tctggccccc catgcagtag
aggcactagt caaacaaccc m g q p l v i l a p h a v e a l v k q p 1441
cccgatcgat ggctttccaa cgcccggatg actcactatc aggccttgct tttggacacg p
d r w l s n a r m t h y q a l l l d t 1501 gaccgggtcc agttcggacc
ggtggtagcc ctgaacccgg ctacactgct cccactgcct d r v q f g p v v a l n
p a t l l p l p 1561 gaggaagggc tgcagcacaa ctgccttgat atcctggccg
aagcccacgg aacccgaccc e e g l q h n c l d i l a e a h g t r p 1621
gacctaacgg accagccgct cccagacgcc gaccacacct ggtacacggg tggatccagt d
l t d q p l p d a d h t w y t g g s s 1681 ctcttgcaag agggacagcg
taaggcggga gctgcggtga ccaccgagac cgaggtaatc l l q e g q r k a g a a
v t t e t e v i 1741 tgggctaaag ccctgccagc cgggacatcc gctcagcggg
ctcagctgat agcactcacc w a k a l p a g t s a q r a q l i a l t 1801
caggccctaa ggatggcaga aggtaagaag ctaaatgttt atacgaattc ccgttatgct q
a l r m a e g k k l n v y t n s r y a 1861 tttgctactg cccatatcca
tggagaaata tacagaaggc gtgggttgct cacatcagaa f a t a h i h g e i y r
r r g l l t s e 1921 ggcaaagaga tcaaaaataa ggacgagata ttggccctac
taaaagccct ctttctgccc g k e i k n k d e i l a l l k a l f l p 1981
aaaagactta gcataatcca ttgtccagga catcaaaagg gacacagcgc cgaggctaga k
r l s i i h c p g h q k g h s a e a r 2041 ggcaaccgga tggctgacca
agcggcccga aaggcagcca tcacagagaa tccagacacc g n r m a d q a a r k a
a i t e n p d t 2101 tctaccctcc tcatagaaaa ttcatcaccc aattcccgct
taattaatta a s t l l i e n s s p n s r l i n -
[0188] Table 4 provides a list of the point mutations introduced in
the M-MLV reverse transcriptase coding sequence of pRT601 to
produce the plasmid used. The numbering of the point mutations
corresponds to the nucleotide sequence presented in Table 3.
TABLE-US-00004 TABLE 4 Nucleotide # in Table 3 change 411
a.sub..fwdarw.c 459 g.sub..fwdarw.a 462 g.sub..fwdarw.c 543
g.sub..fwdarw.t 546 t.sub..fwdarw.a 585 c.sub..fwdarw.g 588
c.sub..fwdarw.g 589 a.sub..fwdarw.t 590 g.sub..fwdarw.c 639
a.sub..fwdarw.t 642 a.sub..fwdarw.c 710 a.sub..fwdarw.g 801
a.sub..fwdarw.c 990 t.sub..fwdarw.g 993 a.sub..fwdarw.g 1446
c.sub..fwdarw.t 1449 c.sub..fwdarw.a 1670 a.sub..fwdarw.g 1675
a.sub..fwdarw.t 1676 g.sub..fwdarw.c 1783 g.sub..fwdarw.c 1785
a.sub..fwdarw.g 1845 t.sub..fwdarw.g 1846 g.sub..fwdarw.a 1849
a.sub..fwdarw.t 1850 g.sub..fwdarw.c 1950 c.sub..fwdarw.a
[0189] The mutations which were introduced to make RNAse H- mutants
of M-MLV reverse transcriptase are D524G, D583N, and E562Q. The
remaining mutations were introduced to insert or remove restriction
enzyme sites to facilitate the production of appropriately sized
segments for the random PCR mutagenesis. This RNase H- mutant is
referred to herein as SuperScript.TM.II or SuperScript.TM.II
gene.
[0190] The sequence of the M-MLV reverse transcriptase was
engineered to introduce restriction enzyme cleavage sites as shown
schematically in FIG. 2 without changing the amino acids encoded by
the sequence. The sequence was divided into 5 segments and
oligonucleotides were designed so that each segment could be
amplified.
[0191] Segments were prepared from pBAD-6-His-M-MLV H- (F1) by
restriction enzyme digests and the segments were gel purified away
from the vector backbone. Each segment was randomly mutagenized by
PCR in the presence of manganese. The PCR conditions were standard
except that 0.25 mM MnCl.sub.2 was present, and the nucleotide
triphosphate concentration was limited to 20 .mu.M of each dNTP (50
mM Tris.HCl pH 8.3, 50 mM KCl, 3 mM MgCl.sub.2, 20 .mu.M dGTP, 20
.mu.M dCTP, 20 .mu.M DATP, 20 .mu.M dTTP, 1 unit Taq DNA polymerase
per 100 .mu.l reaction). The PCR product was extracted with
phenol-chloroform, precipitated with ethanol and the mutated
segments were cloned into a vector from which the given segment had
been removed. Libraries of transformants for each mutated segment
were screened for thermostable variants.
Example 2
Screening for Thermostable Reverse Transcriptases
[0192] In this example the following solutions were used: [0193]
EG--per liter: 20 g bacto-tryptone, 10 g bacto yeast extract, 2 ml
glycerol, 0.54 g NaCl, 0.194 g KCl [0194] EG-arabinose--150 ml EG
plus 1.5 ml of 10 mg/ml ampicillin and 1.5 ml of 20% (w/v)
arabinose (if plates are to have arabinose) [0195] 20.times. PEB-I
Buffer--18% (w/v) glucose, 500 mM Tris-HCl (pH 8.0), 200 mM EDTA
[0196] Kinase Storage Buffer--50% (v/v) glycerol, 20 mM Tris-HCl
(pH 8.0), 100 mM KCl, 5 mM .beta.ME [0197] 100 mg/ml lysozyme--made
in Kinase Storage Buffer and stored at -20.degree. C. [0198]
2.times. PLD--5 ml of 20.times. PEB-I, 1 ml of 1 M DTT, 5 ml of 10%
(v/v) Triton X-100, 1 ml of 100 mg/ml lysozyme and 38 ml of water
[0199] 2.times. PZD--0.5 ml of 20.times. PEB-I, 100 .mu.l of 1 M
DTT, 0.5 ml of 10% (v/v) Triton X-100, 10 .mu.l of zymolase and 3.9
ml of water [0200] 10.times. Poly(C) Reaction Buffer--500 mM
Tris-HCl (pH 8.4), 500 mM KCl, 100 mM MgCl.sub.2 [0201] 1.25.times.
Reaction Mix--1 ml of 10.times. Poly(C) Reaction Buffer, 100 .mu.l
of 1 M DTT, 1 ml of poly(C)/oligo(dG) (30 mM/12 mM in nucleotide),
10 .mu.l of 100 mM dGTP, 5.87 ml of water and 20 .mu.l of
[.alpha.-.sup.32P] dGTP at 10 .mu.Ci/.mu.l
[0202] Individual transformant colonies were inoculated into single
wells of a 96 well culture plate. Each well contained 120 .mu.l of
EG-Ap medium (EG medium with 100 .mu.g/ml ampicillin) containing
0.2% arabinose. It is preferable to first inoculate a 96 well plate
with selective medium without the inducer, to grow that master
plate overnight, and then to make a replica of the master plate
into a 96-well plate with the inducer and grow that plate
overnight. The cultures were grown overnight (e.g., 15-20 hours) at
37.degree. C. without shaking. Overnight cultures were mixed with
an equal volume of 2.times. PLD at room temperature. These extracts
were sometimes assayed directly for reverse transcriptase before
the heating step. The extracts were heated by placing in a water
bath for 5 or 10 minutes at temperatures that ranged from
50.degree. C. to 60.degree. C. Preferably, the cultures were heated
for 5 minutes at 52.degree. C. After the heating step, 10 .mu.l of
the extract was mixed with 40 .mu.l of 1.25.times. RT reaction mix.
This reaction was placed in a 37.degree. C. water bath for 10
minutes. A small aliquot of the reaction mixture (5 .mu.l) was
spotted onto a charged nylon membrane (Genescreen+, NEN). The
membrane was washed twice with 10% TCA+1% sodium pyrophosphate,
rinsed with ethanol, dried, and placed next to a phosphor screen.
As an alternative, the membrane may be washed twice with 4% sodium
pyrophosphate (pH 8.0), rinsed with ethanol, dried, and then placed
next to a phosphor screen. Radioactive product that had been
trapped on the filter was detected by analyzing the screen in a
Posphorimager, using ImageQuant software (Molecular Devices).
[0203] Candidates were selected if they showed more reverse
transcriptase activity (radioactivity) after the heat inactivation
step. These candidates were screened a second time to confirm the
phenotype. Candidates which appeared to be thermostable after the
second screen were grown in small cultures and tested a third time
for thermostable reverse transcriptase activity. Candidates that
were reproducibly heat resistant were sequenced and the mutation in
each clone was determined. An oligonucleotide corresponding to the
mutagenized site was designed in which the codon for the
mutagenized amino acid was randomized (NNK or NNN). These
oligonucleotides were used in site-directed mutagenesis to generate
a library in which all possible substitutions at the mutagenized
site were made. This library was screened for thermostable reverse
transcriptase activity, and the most promising clones were
sequenced.
[0204] Screening of mutants in Segment 2 (see FIG. 2) resulted in
the identification of one mutant, H204R. Screening of a library
mutagenized at site H204 resulted in several mutants, but the only
one that was more thermostable than M-MLV reverse transcriptase was
another H204R mutant. H204R mutants of M-MLV reverse transcriptase
have enhanced thermostability. Screening of mutants in segment 3
(see FIG. 2) resulted in one mutant, T306K. Randomization of the
T306 position produced thermostable mutants which, when sequenced,
were T306R. Both T306K and T306R mutants of M-MLV reverse
transcriptase have about 1.5 fold enhanced thermostability.
Example 3
TdT Reverse Transcriptase Mutants
[0205] In checking fidelity mutants of reverse transcriptase (RT)
for misextension in a 3 dNTP assay, it was observed that
SuperScript.TM.II reverse transcriptase extended 2-3 bases past the
end of the template in the presence of 3 and 4 dNTPs. This
non-template directed extension or TdT activity is reduced in many
mutants, but in a few such as F309N and T197E it appears that this
activity is severely reduced or eliminated. These mutants are
probably in close proximity or in contact with the template-primer
as determined by homology to HIV reverse transcriptase and its
crystal structure with bound template-primer.
Methods
Mutagenesis
[0206] For F309N:
[0207] Primers were designed corresponding to the mutant position
F309 with the silent insertion of a NgoMIV restriction site at
amino acid positions 310-311. The primers encoded a random NNK
sequence for this position generating a random library of F309
mutants, where N is any of the four bases and K is T or G. The
primers along with internal SuperScript.TM.II reverse transcriptase
primers at an upstream SstI restriction site and a downstream SalI
restriction site were used in a standard PCR reaction (10 ng
SuperScript.TM.II reverse transcriptase template, 2 .mu.M of each
primer, 48 .mu.l SuperMix (Invitrogen Corp. (Carlsbad, Calif.)) for
20 cycles of 94.degree. C. 15 sec, 55.degree. C. 15 sec, 72.degree.
C. 30 sec) to generate two PCR fragments. These were a 240 base
pair SstI-NgoMIV fragment and a 200 base pair NgoMIV-SalI fragment.
The fragments were isolated and digested and ligated together and
then inserted into the original SuperScript.TM.II reverse
transcriptase clone cut with SstI and SalI. The resulting ligation
product was transformed in Max Efficiency DH10B (Invitrogen Corp.
(Carlsbad, Calif.)) competent cells to create the library of
mutants at site F309. This library was then plated overnight for
selection.
[0208] For T197E and Y133A:
[0209] The mutants T197E and Y133A were made by oligo-directed
mutagenesis as described in Kunkel, T. A. et al. Methods Enzymol.
204:125 (1991). Briefly, the SuperScript.TM.II reverse
transcriptase gene was inserted into pBADhisA (Invitrogen
Corporation) vector and named pBAD-SSII. This plasmid was
transformed into DH11S cells and the cells were infected with
M13K07 helper phage from which single strand DNA was isolated.
Oligos were designed corresponding to each mutation: T197E and
Y133A. Each oligo (100 .mu.M) was kinased with T4 polynucleotide
kinase (Invitrogen Corp. (Carlsbad, Calif.)) using the Forward
Reaction Buffer (Invitrogen Corp. (Carlsbad, Calif.)). The oligo
was annealed to single stranded pBAD-SSII DNA. Native T7 DNA
polymerase (USB) and T4 DNA ligase (Invitrogen Corp. (Carlsbad,
Calif.)) were added with synthesis buffer (0.4 mM dNTPs, 17.5 mM
Tris-HCl, pH 7.5, 5 mM MgCl.sub.2, 2.5 mM DTT, and 1 mM ATP) to the
annealed reaction on ice. The reactions were incubated at
37.degree. C. for 30 minutes and terminated by adding 1 .mu.l of
0.5 M EDTA. The reactions were transformed and plated with DH10B
cells. Colonies were picked and mutants were determined by
restriction enzyme analysis and sequenced for confirmation using an
ABI 377 instrument and ABI Big Dye Terminator Cycle Sequencing
Ready Reaction kit.
[0210] Selecting Colonies Containing Active Reverse
Transcriptase.
[0211] Individual transformant colonies were inoculated into single
wells of a 96 well culture plate. Each well contained 120 .mu.l of
media (EG-Ap) containing 0.2% arabinose. It is preferable to first
inoculate a 96 well plate with selective medium without the
inducer, to grow that master plate overnight, and then to make a
replica of the master plate into a 96-well plate with the inducer
and grow that plate overnight. The cultures were grown overnight at
37.degree. C. without shaking. Overnight cultures were mixed with
an equal volume of 2.times. PLD (1.8% glucose, 50 mM Tris-HCl, pH
8.0, 20 mM EDTA, 20 mM DTT, 1% Triton X-100, 2 mg/mL lysozyme) at
room temperature. These extracts were assayed directly for reverse
transcriptase activity by mixing 10 .mu.l of the extract with 40
.mu.l of 1.25.times. RT reaction mix (62.5 mM Tris-HCl, pH 8.4,
62.5 mM KCl, 12.5 mM MgCl.sub.2, 12.5 mM DTT, 1.25 mM dGTP,
polyC/oligo dG (3.75 mM/1.5 mM in nucleotide), [.sup.32P] dGTP).
This reaction was placed in a 37.degree. C. water bath for 10
minutes. A small aliquot of the reaction mixture (5 .mu.l) was
spotted onto a charged nylon membrane (Genescreen+, NEN). The
membrane was washed twice with 10% TCA+1% sodium pyrophosphate,
rinsed with ethanol, dried, and placed next to a phosphor screen.
Radioactive product that had been trapped on the filter was
detected by analyzing the screen in a Phosphorimager, using
ImageQuant software (Molecular Devices). Candidates were selected
if they showed reverse transcriptase activity (radioactivity).
These candidates were screened a second time to confirm the
phenotype. The confirmed candidates were then sequenced to
determine which amino acids maintained detectable reverse
transcriptase activity.
[0212] Purification of Reverse Transcriptase Mutants.
[0213] The cell pellet containing induced reverse transcriptase was
suspended in a ratio of 2 mL Lysis buffer (40 mM Tris-HCl, pH 8.0,
0.1 M KCl, mM PMSF)/1 gram of cell pellet. The suspension was
sonicated on ice and then centrifuged at 27,000 g for 30 minutes.
The cell-free extract was filtered through a 0.45.mu. syringe
filter. The cell-free extract was applied to a 5 mL Ni.sup.2+
HI-TRAP column (Pharmacia) pre-equilibrated with 5 volumes 5 mM
imidazole in buffer A (40 mM Tris HCl, pH 8.0, 10% glycerol, 0.01%
Triton X-100, 0.1 M KCl) at 1 mL/min. The column was washed with 10
volumes 5 mM imidazole in buffer A. The reverse transcriptase was
eluted by washing with 20 volumes of a gradient of 5 mM to 1M
imidazole in buffer A. The eluate containing reverse transcriptase
protein was applied to a 1 mL Mono-S column (Pharmacia)
pre-equilibrated with 10 column volumes 50 mM KCl in buffer B (40
mM Tris-HCl, pH 8.0, 10% glycerol, 0.01% Triton X-100, 0.1 mM EDTA,
1 mM DTT) at a flow rate of 1.0 mL/min. The column was washed with
10 volumes of 50 mM KCl in buffer B. Reverse transcriptase was
eluted with 20 volumes of a gradient from 50 mM to 1 M KCl in
buffer B. The individual fractions were analyzed for RT activity.
The fraction containing peak RT activity was dialyzed against
storage buffer (40 mM Tris-HCl, pH 8.0, 50% glycerol, 0.01% Triton
X-100, 0.1 mM EDTA, 1 mM DTT, 0.1 M KCl). The purified reverse
transcriptases were more than 95% pure, as judged by SDS-PAGE. The
protein concentrations were determined by using the Biorad
colorimetric kit.
[0214] 3 dNTP Assay Method.
[0215] Procedures were modified from those of Preston, B. D., et
al. Science 242:1168 (1988). The DNA template-primer was prepared
by annealing a 47-mer template
(5'-GAGTTACAGTGTTTTTGTTCCAGTCTGTAGCAGTGTGTGAATGGAAG-3') (SEQ ID
NO:3) to an 18-mer primer (5'-CTTCCATTCACACACTGC-3') (SEQ ID NO:4)
[.sup.32P]-labeled at the 5'-end with T4 polynucleotide kinase
(template:primer, 3:1). Assay mixture (10 .mu.l) contained 5 nM
template-primer, 50-200 nM reverse transcriptase as specified in
figure legends, 3 or 4 dNTPs (250 .mu.M each), 50 mM Tris-HCl (pH
8.3), 75 mM KCl, 3 mM MgCl.sub.2, 10 mM DTT. Reactions were
incubated at 37.degree. C. for 30 minutes and terminated by the
addition of 5 .mu.l of 40 mM EDTA, 99% formamide. Reaction products
were denatured by incubating at 95.degree. C. for 5 minutes and
analyzed by electrophoresis on urea 6% polyacrylamide gels.
[0216] To determine if any TdT activity was occurring in the
control reaction of the 3 dNTP assay, which uses all 4 dNTPs, the
control reaction was repeated with varying amounts of enzyme,
>600 units to 20 units, at 37.degree. C. for 30 minutes. For
SuperScript.TM.II, T197E, and Y133A, 200, 100, 50, and 20 units
were used. For F309N, 646, 200, 50, and 20 units were used.
Results
[0217] We carried out a misinsertion assay of F309N (H204R, T306K)
SuperScript.TM.II reverse transcriptase, hereafter referred to as
F309N, with DNA template. This assay was employed to compare the
misincorporation capability of the mutant to SuperScript.TM.II. The
assay is a primer extension assay using synthetic DNA
template-primer and biased dNTP pools containing only three of four
dNTPs. The reactions are displayed on a gel in FIG. 3. While
conducting this procedure to screen for mutants with lower
misensertion/misextension rates it was observed that
SuperScript.TM.II reverse transcriptase extended 2-3 nucleotides
past the template end and that some mutations reduced or appeared
to eliminate this non-template directed extension or TdT activity.
As shown in FIG. 4, in the presence of all 4 dNTPs,
SuperScript.TM.II reverse transcriptase and the mutant F309N were
able to extend the primer approximately equally, with
SuperScript.TM.II reverse transcriptase adding 2 nucleotides past
the template, and F309N adding none beyond the end of the template.
To further evaluate this non-templated directed extension the
control reaction for the 3 dNTP misextension assay containing all 4
dNTPs was carried out with SuperScript.TM.II, F309N, T197E, and
Y133A reverse transcriptase for 30 minutes with varying amounts of
enzyme. The three mutants had shown very reduced levels of TdT
activity in prior screens. Since it had been observed that 5
minutes with 20 units of enzyme was more than enough time for the
primer extension to be completed, a 30 minute incubation and 200 to
646 units of reverse transcriptase were both in large excess over
what was necessary for the reaction to be completed. As seen in
FIG. 4, all the reverse transcriptase reactions at the lowest
amount tested had similar extension products to the reactions at
the highest unit concentrations demonstrating that the reaction had
gone to completion. SuperScript.TM.II reverse transcriptase added 2
nucleotides past the end of the template, F309N and T197E did not
extend past the end of the template, and Y133A appears to have a
small amount of product that is 1 nucleotide past the end of the
template.
Example 4
Dual Thermostable and TdT Mutants
[0218] The F309 amino acid position in M-MLV reverse transcriptase
(RT) aligns with the W266 position in HIV reverse transcriptase.
This position is at the base of the thumb domain and is considered
part of the minor groove binding tract which interacts with the
minor groove of the template-primer. The mutations H204R and T306K
have been shown to increase the thermostability of the enzyme. The
F309N mutation in an H204R/T306K clone displays 2.3.times. lower
mutation frequency in a lacZ forward assay (Table 5) on RNA
template and shorter extension products in a 3 dNTP extension assay
than SuperScript.TM.II reverse transcriptase or H204R/T306K in
SuperScript.TM.II reverse transcriptase. Both findings support the
claim of an enzyme with higher fidelity (Table 6).
TABLE-US-00005 TABLE 5 Mutation Frequency of M-MLV Reverse
Transcriptase High Fidelity Mutants Construct total plaques mutant
plaques MF(.times.10.sup.-4) SSII 15689 87 39 SSII (H204R, T306K)
14410 83 41 SSII (H204R, T306K, 11623 39 17 F309N) SSII (H204R,
T306K, 11415 39 14 F309N, V223H) Table 5. The mutation frequency of
SuperScript .TM. II reverse transcriptase and point mutants.
Mutation frequency (MF) was determined by dividing the number of
mutant plaques (light blue or white) by the total number of
plaques. The background mutant frequency of the starting DNA was 17
.times. 10.sup.-4 for the first 3 constructs and 20 .times.
10.sup.-4 for the last construct.
TABLE-US-00006 TABLE 6 Error Rates of M-MLV Reverse Transcriptase
High Fidelity Mutants V223H/ M-MLV SuperScript .TM. II F309N F309N
Overall ER (oER) 1/17,000 1/15,000 1/34,000 1/41,000 Mismatch % of
total 46 35 68 72 ER (mER) 1/37,000 1/42,000 1/50,000 1/58,000
Frameshift % of total 46 60 21 22 ER (rER) 1/37,000 1/25,000
1/162,000 1/188,000 Strand Jump % of total 8 5 11 6 ER (jER)
1/213,000 1/297,000 1/324,000 1/690,000
Methods
[0219] Mutagenesis. Using a standard site directed mutagenesis
protocol, as described in Example 3, a primer containing the V223H
mutation was annealed to single strand DNA of SuperScript.TM.II
with the following mutations: H204R, T306K, F309N. The colonies
were sequenced to confirm the new combination of V223H, H204R,
T306K, and F309N.
[0220] Selecting Colonies Containing Active Reverse Transcriptase.
Colony selection was performed as in Example 3.
[0221] Purification of RT mutants. Purification was performed as in
Example 3.
[0222] Sequencing of plaques. The plaques from the lacZ forward
assay were transferred from the soft agar plate to Whatmann 3MM
paper and allowed to dry for at least 1 hour. The plaque was then
punched out and the plaque/paper disk was added directly to a
sequencing reaction mix containing 4-8 .mu.l ABI PRISM Dye
Terminator Cycle Sequencing Ready Reaction (Perkin Elmer), 1 .mu.l
primer (GAAGATCGCACTCCAGCCAGC) (SEQ ID NO:5), and distilled water
to 20 .mu.l total volume. The ABI cycle sequencing protocol was
used for 96.degree. C. 10 seconds, 50.degree. C. 5 seconds,
60.degree. C. 4 minutes for 25 cycles. The paper disks were removed
and the reactions were precipitated, then resuspended in loading
dye and run on an ABI 377 sequencing machine.
[0223] The sequences were compared to wild type lacZ alpha sequence
and then classified as frameshift (either 1 nucleotide insertion or
deletion), mismatch, or strand jump (an insertion or deletion
between repeated sequences). The overall error rate for each class
was determined by dividing the mutation frequency by the number of
detectable sites (i.e., sites the alteration of which results in a
phenotypic change) (116) multiplied by 0.5 (to exclude the original
single strand contribution) and then multiplied by the percentage
of mutants observed to be in each class. ER=MF/(detectable
sites*0.5)*(% in each class).
[0224] 3dNTP assay method. 3dNTP assays were performed as in
Example 3.
Results
[0225] We carried out a misinsertion assay of F309N (H204R T306K)
SuperScript.TM.II reverse transcriptase, hereafter referred to as
F309N, and V223H F309N (H204R T306K), hereafter referred to as
V223H/F309N with DNA template. This assay was employed to compare
the misincorporation capability of the mutant to SuperScript.TM.II.
The assay is a primer extension assay using synthetic DNA
template-primer and biased dNTP pools containing only three of the
four dNTPs. The reactions are displayed on a gel in FIG. 5 and FIG.
6. In this assay, higher efficiency of primer extension denotes
lower fidelity. As shown in FIGS. 5 and 6, in the presence of all 4
dNTPs, SuperScript.TM.II reverse transcriptase and the mutants
F309N and V223H/F309N were able to extend the primer approximately
equally, with some variance in the addition of non-template
directed nucleotides at the end of the primer. However when
incubated with biased pools of nucleotides, SuperScript.TM.II
reverse transcriptase was able to catalyze substantial extension
past template nucleotides for which a complementary dNTP was
missing, indicating use of incorrect nucleotides and lower
fidelity. In FIG. 5, the F309N (2) mutant showed shorter extension
products than SuperScript.TM.II reverse transcriptase in each of
the biased pools of three dNTPs, indicating less ability to
incorporate incorrect nucleotides and thus higher fidelity. In FIG.
6, the V223H/F309N mutant was extended with just the dATP and dCTP
pools. In each case V223H/F309N also had lower extension products
than SuperScript.TM.II. This corresponds with the results of the
lacZ.alpha. assay where the F309N and V223H/F309N mutants had a
lower mutation frequency than SuperScript.TM.II reverse
transcriptase (17.times.10.sup.-4 and 14.times.10.sup.-4 to
39.times.10.sup.-4). The reverse transcriptase with just the H204R
T306K mutations without F309N has a mutation frequency similar to
SuperScript.TM.II reverse transcriptase (41.times.10.sup.-4 to
39.times.10.sup.-4), suggesting that these mutations do not
influence fidelity. This data shows a correlation between the
misinsertion assay on DNA and the lacZ.alpha. assay on RNA wherein
higher fidelity mutants had both shorter extension products with
biased pools of dNTPs and lower mutation frequencies in the
lacZ.alpha. assay.
Example 5
Error Rate Determination
[0226] To determine Error Rates, mutant plaques from the lacZ
forward assay were sequenced using known methods. The mutations
were then classified into one of the following categories:
mismatches for misinsertion events, frameshifts for single
insertion or deletion events, or jumps for large insertions or
deletions caused by jumping between similar sequences. An overall
Error Rate was then determined for nucleic acid encoding the lacZ
alpha peptide using the following equation:
ER (error rate)=MF (mutation frequency)/(number of detectable
sites.times.0.5), where the number of detectable sites is 116.
[0227] Not all bases mutated in lacZ forward assays result in a
detectable phenotypic change. To determine specific error rates for
mismatch, frameshift and jumps, the mutation frequency was modified
by multiplying by the percent of the total of each mutant category,
and then used to determine the specific error rate. The following
is a sequence map of the lacZ.alpha. peptide in M13mp19 from
SuperScript.TM.II reverse transcriptase and the high fidelity
SuperScript.TM.II H203R T306K F309N reverse transcriptase assays.
Underlining indicates deletions; " " indicates insertions of the
base A, T, C, or G shown above; A, T, C, or G shown above the
complete sequence indicates mismatches.
TABLE-US-00007 Map of Mutations Introduced by SuperScript .TM.II T
C T T TC C AGCGCAACGC AATTAATGTG AGTTAGCTCA CTCATTAGGC ACCCCAGGCT
TTACACTTTA 1 1 4 CG C CC TGCTTCCGGC TCGTATGTTG TGTGGAATTG
TGAGCGGATA ACAATTTCAC ACACGAAACA 1 C CC CG C GCTATG ACC ATG ATT
ACG{circumflex over ( )}CCA AGC TTG CAT GCC TGC AGG TCG ACT CTA GAG
GAT CCC CGG 1 T AAAA T A AAA T T A A T T T A T A C GTA CCC AGC TCG
AAT TCA CTG GCC GTC GTT{circumflex over ( )}TTA CAA CGT CGT GAC TGG
GAA AAC CCT GGC 7 1 1 1 TTTTT TTTTT C TTTTT C TTT A T T GTT ACC CAA
CTT AAT CGC CTT GCA GCA CAT CCC{circumflex over ( )}CCT{circumflex
over ( )}TTC{circumflex over ( )}GCC AGC TGG CGT 1 4 (SEQ ID NO:
6)
TABLE-US-00008 TABLE 7 Insertions 40 38% 60% frameshift (insertion
or deletion) Deletions 23 22% Mismatches 36 35% 35% mismatch Jumps
5 5% 5% Jumps
TABLE-US-00009 TABLE 8 Overall Error Rate (oER) 1/15,000 .sup. (39
.times. 10.sup.-4)/(116 .times. 0.5) Mismatch Error Rate 1/42,500
(0.35 .times. 39 .times. 10.sup.-4)/(116 .times. 0.5) (mER)
Frameshift Error Rate 1/25,000 (0.60 .times. 39 .times.
10.sup.-4)/(116 .times. 0.5) (fER) Jumps Error Rate (jER) 1/297,000
(0.05 .times. 39 .times. 10.sup.-4)/(116 .times. 0.5)
[0228] All publications, patents and patent applications mentioned
in this specification are indicative of the level of skill of those
skilled in the art to which this invention pertains, and are herein
incorporated by reference to the same extent as if each individual
publication, patent or patent application was specifically and
individually indicated to be incorporate by reference.
Sequence CWU 1
1
812151DNAMoloney-Murine Leukemia VirusCDS(1)..(2151) 1atg ggg ggt
tct cat cat cat cat cat cat ggt atg gct agc atg act 48Met Gly Gly
Ser His His His His His His Gly Met Ala Ser Met Thr1 5 10 15ggt gga
cag caa atg ggt cgg gat ctg tac gac gat gac gat aag cat 96Gly Gly
Gln Gln Met Gly Arg Asp Leu Tyr Asp Asp Asp Asp Lys His 20 25 30atg
acc cta aat ata gaa gat gag tat cgg cta cat gag acc tca aaa 144Met
Thr Leu Asn Ile Glu Asp Glu Tyr Arg Leu His Glu Thr Ser Lys 35 40
45gag cca gat gtt tct cta ggg tcc aca tgg ctg tct gat ttt cct cag
192Glu Pro Asp Val Ser Leu Gly Ser Thr Trp Leu Ser Asp Phe Pro Gln
50 55 60gcc tgg gcg gaa acc ggg ggc atg gga ctg gca gtt cgc caa gct
cct 240Ala Trp Ala Glu Thr Gly Gly Met Gly Leu Ala Val Arg Gln Ala
Pro65 70 75 80ctg atc ata ctt ctg aaa gca acc tct acc ccc gtg tcc
ata aaa caa 288Leu Ile Ile Leu Leu Lys Ala Thr Ser Thr Pro Val Ser
Ile Lys Gln 85 90 95tac ccc atg tca caa gaa gcc aga ctg ggg atc aag
ccc cac ata cag 336Tyr Pro Met Ser Gln Glu Ala Arg Leu Gly Ile Lys
Pro His Ile Gln 100 105 110aga ctg ttg gac cag gga ata ctg gta ccc
tgc cag tcc ccc tgg aac 384Arg Leu Leu Asp Gln Gly Ile Leu Val Pro
Cys Gln Ser Pro Trp Asn 115 120 125acg ccc ctg cta ccc gtc aag aaa
ccc ggg act aat gat tac agg cct 432Thr Pro Leu Leu Pro Val Lys Lys
Pro Gly Thr Asn Asp Tyr Arg Pro 130 135 140gtc caa gat ctg aga gag
gtc aac aaa cgc gta gaa gac atc cac ccc 480Val Gln Asp Leu Arg Glu
Val Asn Lys Arg Val Glu Asp Ile His Pro145 150 155 160acc gta ccc
aac ccc tac aac ctc ttg agt ggg ctc cca ccg tcc cac 528Thr Val Pro
Asn Pro Tyr Asn Leu Leu Ser Gly Leu Pro Pro Ser His 165 170 175cag
tgg tac act gtt cta gac tta aaa gat gcc ttt ttc tgc ctg aga 576Gln
Trp Tyr Thr Val Leu Asp Leu Lys Asp Ala Phe Phe Cys Leu Arg 180 185
190ctc cac ccg acg tct cag cct ctc ttc gcc ttt gaa tgg aga gac cca
624Leu His Pro Thr Ser Gln Pro Leu Phe Ala Phe Glu Trp Arg Asp Pro
195 200 205gag atg gga atc tct ggc caa cta acc tgg acc aga ctc cca
cag gga 672Glu Met Gly Ile Ser Gly Gln Leu Thr Trp Thr Arg Leu Pro
Gln Gly 210 215 220ttc aaa aac agt ccc acc ctg ttt gat gag gca ctg
cgc aga gac cta 720Phe Lys Asn Ser Pro Thr Leu Phe Asp Glu Ala Leu
Arg Arg Asp Leu225 230 235 240gca gac ttc cgg atc cag cac cca gac
ttg atc ctg cta cag tac gta 768Ala Asp Phe Arg Ile Gln His Pro Asp
Leu Ile Leu Leu Gln Tyr Val 245 250 255gat gac tta ctg ctg gcc gcc
act tct gag ctc gac tgc caa caa ggt 816Asp Asp Leu Leu Leu Ala Ala
Thr Ser Glu Leu Asp Cys Gln Gln Gly 260 265 270act cgg gcc ctg tta
caa acc cta gga gac ctc ggg tat cgg gcc tcg 864Thr Arg Ala Leu Leu
Gln Thr Leu Gly Asp Leu Gly Tyr Arg Ala Ser 275 280 285gcc aag aaa
gcc caa att tgc cag aaa cag gtc aag tat ctg ggg tat 912Ala Lys Lys
Ala Gln Ile Cys Gln Lys Gln Val Lys Tyr Leu Gly Tyr 290 295 300ctt
cta aaa gag ggt cag aga tgg ctg act gag gcc aga aaa gag act 960Leu
Leu Lys Glu Gly Gln Arg Trp Leu Thr Glu Ala Arg Lys Glu Thr305 310
315 320gtg atg ggg cag cct act ccg aag acc ccg cgg caa cta agg gag
ttc 1008Val Met Gly Gln Pro Thr Pro Lys Thr Pro Arg Gln Leu Arg Glu
Phe 325 330 335cta ggg acg gca ggc ttc tgt cgc ctc tgg atc cct ggg
ttt gca gaa 1056Leu Gly Thr Ala Gly Phe Cys Arg Leu Trp Ile Pro Gly
Phe Ala Glu 340 345 350atg gca gcc ccc ttg tac cct ctc acc aaa acg
ggg act ctg ttt aat 1104Met Ala Ala Pro Leu Tyr Pro Leu Thr Lys Thr
Gly Thr Leu Phe Asn 355 360 365tgg ggc cca gac caa caa aag gcc tat
caa gaa atc aag caa gct ctt 1152Trp Gly Pro Asp Gln Gln Lys Ala Tyr
Gln Glu Ile Lys Gln Ala Leu 370 375 380cta act gcc cca gcc ctg ggg
ttg cca gat ttg act aag ccc ttt gaa 1200Leu Thr Ala Pro Ala Leu Gly
Leu Pro Asp Leu Thr Lys Pro Phe Glu385 390 395 400ctc ttt gtc gac
gag aag cag ggc tac gcc aaa ggt gtc cta acg caa 1248Leu Phe Val Asp
Glu Lys Gln Gly Tyr Ala Lys Gly Val Leu Thr Gln 405 410 415aaa ctg
gga cct tgg cgt cgg ccg gtg gcc tac ctg tcc aaa aag cta 1296Lys Leu
Gly Pro Trp Arg Arg Pro Val Ala Tyr Leu Ser Lys Lys Leu 420 425
430gac cca gta gca gct ggg tgg ccc cct tgc cta cgg atg gta gca gcc
1344Asp Pro Val Ala Ala Gly Trp Pro Pro Cys Leu Arg Met Val Ala Ala
435 440 445att gcc gta ctg aca aag gat gca ggc aag cta acc atg gga
cag cca 1392Ile Ala Val Leu Thr Lys Asp Ala Gly Lys Leu Thr Met Gly
Gln Pro 450 455 460cta gtc att ctg gcc ccc cat gca gta gag gca cta
gtc aaa caa ccc 1440Leu Val Ile Leu Ala Pro His Ala Val Glu Ala Leu
Val Lys Gln Pro465 470 475 480ccc gat cga tgg ctt tcc aac gcc cgg
atg act cac tat cag gcc ttg 1488Pro Asp Arg Trp Leu Ser Asn Ala Arg
Met Thr His Tyr Gln Ala Leu 485 490 495ctt ttg gac acg gac cgg gtc
cag ttc gga ccg gtg gta gcc ctg aac 1536Leu Leu Asp Thr Asp Arg Val
Gln Phe Gly Pro Val Val Ala Leu Asn 500 505 510ccg gct aca ctg ctc
cca ctg cct gag gaa ggg ctg cag cac aac tgc 1584Pro Ala Thr Leu Leu
Pro Leu Pro Glu Glu Gly Leu Gln His Asn Cys 515 520 525ctt gat atc
ctg gcc gaa gcc cac gga acc cga ccc gac cta acg gac 1632Leu Asp Ile
Leu Ala Glu Ala His Gly Thr Arg Pro Asp Leu Thr Asp 530 535 540cag
ccg ctc cca gac gcc gac cac acc tgg tac acg ggt gga tcc agt 1680Gln
Pro Leu Pro Asp Ala Asp His Thr Trp Tyr Thr Gly Gly Ser Ser545 550
555 560ctc ttg caa gag gga cag cgt aag gcg gga gct gcg gtg acc acc
gag 1728Leu Leu Gln Glu Gly Gln Arg Lys Ala Gly Ala Ala Val Thr Thr
Glu 565 570 575acc gag gta atc tgg gct aaa gcc ctg cca gcc ggg aca
tcc gct cag 1776Thr Glu Val Ile Trp Ala Lys Ala Leu Pro Ala Gly Thr
Ser Ala Gln 580 585 590cgg gct cag ctg ata gca ctc acc cag gcc cta
agg atg gca gaa ggt 1824Arg Ala Gln Leu Ile Ala Leu Thr Gln Ala Leu
Arg Met Ala Glu Gly 595 600 605aag aag cta aat gtt tat acg aat tcc
cgt tat gct ttt gct act gcc 1872Lys Lys Leu Asn Val Tyr Thr Asn Ser
Arg Tyr Ala Phe Ala Thr Ala 610 615 620cat atc cat gga gaa ata tac
aga agg cgt ggg ttg ctc aca tca gaa 1920His Ile His Gly Glu Ile Tyr
Arg Arg Arg Gly Leu Leu Thr Ser Glu625 630 635 640ggc aaa gag atc
aaa aat aag gac gag ata ttg gcc cta cta aaa gcc 1968Gly Lys Glu Ile
Lys Asn Lys Asp Glu Ile Leu Ala Leu Leu Lys Ala 645 650 655ctc ttt
ctg ccc aaa aga ctt agc ata atc cat tgt cca gga cat caa 2016Leu Phe
Leu Pro Lys Arg Leu Ser Ile Ile His Cys Pro Gly His Gln 660 665
670aag gga cac agc gcc gag gct aga ggc aac cgg atg gct gac caa gcg
2064Lys Gly His Ser Ala Glu Ala Arg Gly Asn Arg Met Ala Asp Gln Ala
675 680 685gcc cga aag gca gcc atc aca gag aat cca gac acc tct acc
ctc ctc 2112Ala Arg Lys Ala Ala Ile Thr Glu Asn Pro Asp Thr Ser Thr
Leu Leu 690 695 700ata gaa aat tca tca ccc aat tcc cgc tta att aat
taa 2151Ile Glu Asn Ser Ser Pro Asn Ser Arg Leu Ile Asn705 710
7152716PRTMoloney-Murine Leukemia Virus 2Met Gly Gly Ser His His
His His His His Gly Met Ala Ser Met Thr1 5 10 15Gly Gly Gln Gln Met
Gly Arg Asp Leu Tyr Asp Asp Asp Asp Lys His 20 25 30Met Thr Leu Asn
Ile Glu Asp Glu Tyr Arg Leu His Glu Thr Ser Lys 35 40 45Glu Pro Asp
Val Ser Leu Gly Ser Thr Trp Leu Ser Asp Phe Pro Gln 50 55 60Ala Trp
Ala Glu Thr Gly Gly Met Gly Leu Ala Val Arg Gln Ala Pro65 70 75
80Leu Ile Ile Leu Leu Lys Ala Thr Ser Thr Pro Val Ser Ile Lys Gln
85 90 95Tyr Pro Met Ser Gln Glu Ala Arg Leu Gly Ile Lys Pro His Ile
Gln 100 105 110Arg Leu Leu Asp Gln Gly Ile Leu Val Pro Cys Gln Ser
Pro Trp Asn 115 120 125Thr Pro Leu Leu Pro Val Lys Lys Pro Gly Thr
Asn Asp Tyr Arg Pro 130 135 140Val Gln Asp Leu Arg Glu Val Asn Lys
Arg Val Glu Asp Ile His Pro145 150 155 160Thr Val Pro Asn Pro Tyr
Asn Leu Leu Ser Gly Leu Pro Pro Ser His 165 170 175Gln Trp Tyr Thr
Val Leu Asp Leu Lys Asp Ala Phe Phe Cys Leu Arg 180 185 190Leu His
Pro Thr Ser Gln Pro Leu Phe Ala Phe Glu Trp Arg Asp Pro 195 200
205Glu Met Gly Ile Ser Gly Gln Leu Thr Trp Thr Arg Leu Pro Gln Gly
210 215 220Phe Lys Asn Ser Pro Thr Leu Phe Asp Glu Ala Leu Arg Arg
Asp Leu225 230 235 240Ala Asp Phe Arg Ile Gln His Pro Asp Leu Ile
Leu Leu Gln Tyr Val 245 250 255Asp Asp Leu Leu Leu Ala Ala Thr Ser
Glu Leu Asp Cys Gln Gln Gly 260 265 270Thr Arg Ala Leu Leu Gln Thr
Leu Gly Asp Leu Gly Tyr Arg Ala Ser 275 280 285Ala Lys Lys Ala Gln
Ile Cys Gln Lys Gln Val Lys Tyr Leu Gly Tyr 290 295 300Leu Leu Lys
Glu Gly Gln Arg Trp Leu Thr Glu Ala Arg Lys Glu Thr305 310 315
320Val Met Gly Gln Pro Thr Pro Lys Thr Pro Arg Gln Leu Arg Glu Phe
325 330 335Leu Gly Thr Ala Gly Phe Cys Arg Leu Trp Ile Pro Gly Phe
Ala Glu 340 345 350Met Ala Ala Pro Leu Tyr Pro Leu Thr Lys Thr Gly
Thr Leu Phe Asn 355 360 365Trp Gly Pro Asp Gln Gln Lys Ala Tyr Gln
Glu Ile Lys Gln Ala Leu 370 375 380Leu Thr Ala Pro Ala Leu Gly Leu
Pro Asp Leu Thr Lys Pro Phe Glu385 390 395 400Leu Phe Val Asp Glu
Lys Gln Gly Tyr Ala Lys Gly Val Leu Thr Gln 405 410 415Lys Leu Gly
Pro Trp Arg Arg Pro Val Ala Tyr Leu Ser Lys Lys Leu 420 425 430Asp
Pro Val Ala Ala Gly Trp Pro Pro Cys Leu Arg Met Val Ala Ala 435 440
445Ile Ala Val Leu Thr Lys Asp Ala Gly Lys Leu Thr Met Gly Gln Pro
450 455 460Leu Val Ile Leu Ala Pro His Ala Val Glu Ala Leu Val Lys
Gln Pro465 470 475 480Pro Asp Arg Trp Leu Ser Asn Ala Arg Met Thr
His Tyr Gln Ala Leu 485 490 495Leu Leu Asp Thr Asp Arg Val Gln Phe
Gly Pro Val Val Ala Leu Asn 500 505 510Pro Ala Thr Leu Leu Pro Leu
Pro Glu Glu Gly Leu Gln His Asn Cys 515 520 525Leu Asp Ile Leu Ala
Glu Ala His Gly Thr Arg Pro Asp Leu Thr Asp 530 535 540Gln Pro Leu
Pro Asp Ala Asp His Thr Trp Tyr Thr Gly Gly Ser Ser545 550 555
560Leu Leu Gln Glu Gly Gln Arg Lys Ala Gly Ala Ala Val Thr Thr Glu
565 570 575Thr Glu Val Ile Trp Ala Lys Ala Leu Pro Ala Gly Thr Ser
Ala Gln 580 585 590Arg Ala Gln Leu Ile Ala Leu Thr Gln Ala Leu Arg
Met Ala Glu Gly 595 600 605Lys Lys Leu Asn Val Tyr Thr Asn Ser Arg
Tyr Ala Phe Ala Thr Ala 610 615 620His Ile His Gly Glu Ile Tyr Arg
Arg Arg Gly Leu Leu Thr Ser Glu625 630 635 640Gly Lys Glu Ile Lys
Asn Lys Asp Glu Ile Leu Ala Leu Leu Lys Ala 645 650 655Leu Phe Leu
Pro Lys Arg Leu Ser Ile Ile His Cys Pro Gly His Gln 660 665 670Lys
Gly His Ser Ala Glu Ala Arg Gly Asn Arg Met Ala Asp Gln Ala 675 680
685Ala Arg Lys Ala Ala Ile Thr Glu Asn Pro Asp Thr Ser Thr Leu Leu
690 695 700Ile Glu Asn Ser Ser Pro Asn Ser Arg Leu Ile Asn705 710
715347DNAArtificialOligonucleotide template 3gagttacagt gtttttgttc
cagtctgtag cagtgtgtga atggaag 47418DNAArtificialOligonucleotide
primer 4cttccattca cacactgc 18521DNAArtificialOligonucleotide
primer 5gaagatcgca ctccagccag c 216298DNAEscherichia coli
6agcgcaacgc aattaatgtg agttagctca ctcattaggc accccaggct ttacacttta
60tgcttccggc tcgtatgttg tgtggaattg tgagcggata acaatttcac acaggaaaca
120gctatgacca tgattacgcc aagcttgcat gcctgcaggt cgactctaga
ggatccccgg 180gtaccgagct cgaattcact ggccgtcgtt ttacaacgtc
gtgactggga aaaccctggc 240gttacccaac ttaatcgcct tgcagcacat
ccccctttcg ccagctggcg taatagcg 29871515DNAMoloney-Murine Leukemia
VirusCDS(1)..(1515) 7atg acc cta aat ata gaa gat gag cat cgg cta
cat gag acc tca aaa 48Met Thr Leu Asn Ile Glu Asp Glu His Arg Leu
His Glu Thr Ser Lys1 5 10 15gag cca gat gtt tct cta ggg tcc aca tgg
ctg tct gat ttt cct cag 96Glu Pro Asp Val Ser Leu Gly Ser Thr Trp
Leu Ser Asp Phe Pro Gln 20 25 30gcc tgg gcg gaa acc ggg ggc atg gga
ctg gca gtt cgc caa gct cct 144Ala Trp Ala Glu Thr Gly Gly Met Gly
Leu Ala Val Arg Gln Ala Pro 35 40 45ctg atc ata cct ctg aaa gca acc
tct acc ccc gtg tcc ata aaa caa 192Leu Ile Ile Pro Leu Lys Ala Thr
Ser Thr Pro Val Ser Ile Lys Gln 50 55 60tac ccc atg tca caa gaa gcc
aga ctg ggg atc aag ccc cac ata cag 240Tyr Pro Met Ser Gln Glu Ala
Arg Leu Gly Ile Lys Pro His Ile Gln65 70 75 80aga ctg ttg gac cag
gga ata ctg gta ccc tgc cag tcc ccc tgg aac 288Arg Leu Leu Asp Gln
Gly Ile Leu Val Pro Cys Gln Ser Pro Trp Asn 85 90 95acg ccc ctg cta
ccc gtt aag aaa cca ggg act aat gat tat agg cct 336Thr Pro Leu Leu
Pro Val Lys Lys Pro Gly Thr Asn Asp Tyr Arg Pro 100 105 110gtc cag
gat ctg aga gaa gtc aac aag cgg gtg gaa gac atc cac ccc 384Val Gln
Asp Leu Arg Glu Val Asn Lys Arg Val Glu Asp Ile His Pro 115 120
125acc gtg ccc aac cct tac aac ctc ttg agc ggg ctc cca ccg tcc cac
432Thr Val Pro Asn Pro Tyr Asn Leu Leu Ser Gly Leu Pro Pro Ser His
130 135 140cag tgg tac act gtg ctt gat tta aag gat gcc ttt ttc tgc
ctg aga 480Gln Trp Tyr Thr Val Leu Asp Leu Lys Asp Ala Phe Phe Cys
Leu Arg145 150 155 160ctc cac ccc acc agt cag cct ctc ttc gcc ttt
gag tgg aga gat cca 528Leu His Pro Thr Ser Gln Pro Leu Phe Ala Phe
Glu Trp Arg Asp Pro 165 170 175gag atg gga atc tca gga caa ttg acc
tgg acc aga ctc cca cag ggt 576Glu Met Gly Ile Ser Gly Gln Leu Thr
Trp Thr Arg Leu Pro Gln Gly 180 185 190ttc aaa aac agt ccc acc ctg
ttt gat gag gca ctg cac aga gac cta 624Phe Lys Asn Ser Pro Thr Leu
Phe Asp Glu Ala Leu His Arg Asp Leu 195 200 205gca gac ttc cgg atc
cag cac cca gac ttg atc ctg cta cag tac gtg 672Ala Asp Phe Arg Ile
Gln His Pro Asp Leu Ile Leu Leu Gln Tyr Val 210 215 220gat gac tta
ctg ctg gcc gcc act tct gag cta gac tgc caa caa ggt 720Asp Asp Leu
Leu Leu Ala Ala Thr Ser Glu Leu Asp Cys Gln Gln Gly225 230 235
240act cgg gcc ctg tta caa acc cta ggg aac ctc ggg tat cgg gcc tcg
768Thr Arg Ala Leu Leu Gln Thr Leu Gly Asn Leu Gly Tyr Arg Ala Ser
245 250 255gcc aag aaa gcc caa att tgc cag aaa cag gtc aag tat ctg
ggg tat 816Ala Lys Lys Ala Gln Ile Cys Gln Lys Gln Val Lys Tyr Leu
Gly Tyr 260 265 270ctt cta aaa gag ggt cag aga tgg ctg act gag gcc
aga aaa gag act 864Leu Leu Lys Glu Gly Gln Arg Trp Leu Thr Glu Ala
Arg Lys Glu Thr 275 280 285gtg atg ggg cag cct act ccg aag acc cct
cga caa cta agg gag ttc 912Val Met Gly Gln Pro Thr Pro Lys Thr Pro
Arg Gln Leu Arg Glu Phe 290 295 300cta ggg acg gca ggc
ttc tgt cgc ctc tgg atc cct ggg ttt gca gaa 960Leu Gly Thr Ala Gly
Phe Cys Arg Leu Trp Ile Pro Gly Phe Ala Glu305 310 315 320atg gca
gcc ccc ttg tac cct ctc acc aaa acg ggg act ctg ttt aat 1008Met Ala
Ala Pro Leu Tyr Pro Leu Thr Lys Thr Gly Thr Leu Phe Asn 325 330
335tgg ggc cca gac caa caa aag gcc tat caa gaa atc aag caa gct ctt
1056Trp Gly Pro Asp Gln Gln Lys Ala Tyr Gln Glu Ile Lys Gln Ala Leu
340 345 350cta act gcc cca gcc ctg ggg ttg cca gat ttg act aag ccc
ttt gaa 1104Leu Thr Ala Pro Ala Leu Gly Leu Pro Asp Leu Thr Lys Pro
Phe Glu 355 360 365ctc ttt gtc gac gag aag cag ggc tac gcc aaa ggt
gtc cta acg caa 1152Leu Phe Val Asp Glu Lys Gln Gly Tyr Ala Lys Gly
Val Leu Thr Gln 370 375 380aaa ctg gga cct tgg cgt cgg ccg gtg gcc
tac ctg tcc aaa aag cta 1200Lys Leu Gly Pro Trp Arg Arg Pro Val Ala
Tyr Leu Ser Lys Lys Leu385 390 395 400gac cca gta gca gct ggg tgg
ccc cct tgc cta cgg atg gta gca gcc 1248Asp Pro Val Ala Ala Gly Trp
Pro Pro Cys Leu Arg Met Val Ala Ala 405 410 415att gcc gta ctg aca
aag gat gca ggc aag cta acc atg gga cag cca 1296Ile Ala Val Leu Thr
Lys Asp Ala Gly Lys Leu Thr Met Gly Gln Pro 420 425 430cta gtc att
ctg gcc ccc cat gca gta gag gca cta gtc aaa caa ccc 1344Leu Val Ile
Leu Ala Pro His Ala Val Glu Ala Leu Val Lys Gln Pro 435 440 445ccc
gac cgc tgg ctt tcc aac gcc cgg atg act cac tat cag gcc ttg 1392Pro
Asp Arg Trp Leu Ser Asn Ala Arg Met Thr His Tyr Gln Ala Leu 450 455
460ctt ttg gac acg gac cgg gtc cag ttc gga ccg gtg gta gcc ctg aac
1440Leu Leu Asp Thr Asp Arg Val Gln Phe Gly Pro Val Val Ala Leu
Asn465 470 475 480ccg gct acg ctg ctc cca ctg cct gag gaa ggg ctg
caa cac aac tgc 1488Pro Ala Thr Leu Leu Pro Leu Pro Glu Glu Gly Leu
Gln His Asn Cys 485 490 495ctt gat aat tcc cgc tta att aat taa
1515Leu Asp Asn Ser Arg Leu Ile Asn 5008504PRTMoloney-Murine
Leukemia Virus 8Met Thr Leu Asn Ile Glu Asp Glu His Arg Leu His Glu
Thr Ser Lys1 5 10 15Glu Pro Asp Val Ser Leu Gly Ser Thr Trp Leu Ser
Asp Phe Pro Gln 20 25 30Ala Trp Ala Glu Thr Gly Gly Met Gly Leu Ala
Val Arg Gln Ala Pro 35 40 45Leu Ile Ile Pro Leu Lys Ala Thr Ser Thr
Pro Val Ser Ile Lys Gln 50 55 60Tyr Pro Met Ser Gln Glu Ala Arg Leu
Gly Ile Lys Pro His Ile Gln65 70 75 80Arg Leu Leu Asp Gln Gly Ile
Leu Val Pro Cys Gln Ser Pro Trp Asn 85 90 95Thr Pro Leu Leu Pro Val
Lys Lys Pro Gly Thr Asn Asp Tyr Arg Pro 100 105 110Val Gln Asp Leu
Arg Glu Val Asn Lys Arg Val Glu Asp Ile His Pro 115 120 125Thr Val
Pro Asn Pro Tyr Asn Leu Leu Ser Gly Leu Pro Pro Ser His 130 135
140Gln Trp Tyr Thr Val Leu Asp Leu Lys Asp Ala Phe Phe Cys Leu
Arg145 150 155 160Leu His Pro Thr Ser Gln Pro Leu Phe Ala Phe Glu
Trp Arg Asp Pro 165 170 175Glu Met Gly Ile Ser Gly Gln Leu Thr Trp
Thr Arg Leu Pro Gln Gly 180 185 190Phe Lys Asn Ser Pro Thr Leu Phe
Asp Glu Ala Leu His Arg Asp Leu 195 200 205Ala Asp Phe Arg Ile Gln
His Pro Asp Leu Ile Leu Leu Gln Tyr Val 210 215 220Asp Asp Leu Leu
Leu Ala Ala Thr Ser Glu Leu Asp Cys Gln Gln Gly225 230 235 240Thr
Arg Ala Leu Leu Gln Thr Leu Gly Asn Leu Gly Tyr Arg Ala Ser 245 250
255Ala Lys Lys Ala Gln Ile Cys Gln Lys Gln Val Lys Tyr Leu Gly Tyr
260 265 270Leu Leu Lys Glu Gly Gln Arg Trp Leu Thr Glu Ala Arg Lys
Glu Thr 275 280 285Val Met Gly Gln Pro Thr Pro Lys Thr Pro Arg Gln
Leu Arg Glu Phe 290 295 300Leu Gly Thr Ala Gly Phe Cys Arg Leu Trp
Ile Pro Gly Phe Ala Glu305 310 315 320Met Ala Ala Pro Leu Tyr Pro
Leu Thr Lys Thr Gly Thr Leu Phe Asn 325 330 335Trp Gly Pro Asp Gln
Gln Lys Ala Tyr Gln Glu Ile Lys Gln Ala Leu 340 345 350Leu Thr Ala
Pro Ala Leu Gly Leu Pro Asp Leu Thr Lys Pro Phe Glu 355 360 365Leu
Phe Val Asp Glu Lys Gln Gly Tyr Ala Lys Gly Val Leu Thr Gln 370 375
380Lys Leu Gly Pro Trp Arg Arg Pro Val Ala Tyr Leu Ser Lys Lys
Leu385 390 395 400Asp Pro Val Ala Ala Gly Trp Pro Pro Cys Leu Arg
Met Val Ala Ala 405 410 415Ile Ala Val Leu Thr Lys Asp Ala Gly Lys
Leu Thr Met Gly Gln Pro 420 425 430Leu Val Ile Leu Ala Pro His Ala
Val Glu Ala Leu Val Lys Gln Pro 435 440 445Pro Asp Arg Trp Leu Ser
Asn Ala Arg Met Thr His Tyr Gln Ala Leu 450 455 460Leu Leu Asp Thr
Asp Arg Val Gln Phe Gly Pro Val Val Ala Leu Asn465 470 475 480Pro
Ala Thr Leu Leu Pro Leu Pro Glu Glu Gly Leu Gln His Asn Cys 485 490
495Leu Asp Asn Ser Arg Leu Ile Asn 500
* * * * *