Pharmaceutical Composition

Abstract

The invention provides pharmaceutical compositions comprising short single stranded oligonucleotides, of length of between 8 and 17 nucleobases which are complementary to human microRNAs. The short oligonucleotides are particularly effective at alleviating miRNA repression in vivo. It is found that the incorporation of high affinity nucleotide analogues into the oligonucleotides results in highly effective anti-microRNA molecules which appear to function via the formation of almost irreversible duplexes with the miRNA target, rather than RNA cleavage based mechanisms, such as mechanisms associated with RNaseH or RISC.

Description

FIELD OF THE INVENTION

[0001] The present invention concerns pharmaceutical compositions comprising LNA-containing single stranded oligonucleotides capable of inhibiting disease-inducing microRNAs.

BACKGROUND OF THE INVENTION

[0002] MicroRNAs--Novel Regulators of Gene Expression

[0003] MicroRNAs (miRNAs) are an abundant class of short endogenous RNAs that act as post-transcriptional regulators of gene expression by base-pairing with their target mRNAs. The mature miRNAs are processed sequentially from longer hairpin transcripts by the RNAse III ribonucleases Drosha (Lee et al. 2003) and Dicer (Hutvagner et al. 2001, Ketting et al. 2001). To date more than 3400 miRNAs have been annotated in vertebrates, invertebrates and plants according to the miRBase microRNA database release 7.1 in October 2005 (Griffith-Jones 2004, Griffith-Jones et al. 2006), and many miRNAs that correspond to putative genes have also been identified.

[0004] Most animal miRNAs recognize their target sites located in 3'-UTRs by incomplete base-pairing, resulting in translational repression of the target genes (Bartel 2004). An increasing body of research shows that animal miRNAs play fundamental biological roles in cell growth and apoptosis (Brennecke et al. 2003), hematopoietic lineage differentiation (Chen et al. 2004), life-span regulation (Boehm and Slack 2005), photoreceptor differentiation (Li and Carthew 2005), homeobox gene regulation (Yekta et al. 2004, Hornstein et al. 2005), neuronal asymmetry (Johnston et al. 2004), insulin secretion (Poy et al. 2004), brain morphogenesis (Giraldez et al. 2005), muscle proliferation and differentiation (Chen, Mandel et al. 2005, Kwon et al. 2005, Sokol and Ambros 2005), cardiogenesis (Zhao et al. 2005) and late embryonic development in vertebrates (Wienholds et al. 2005).

[0005] MicroRNAs in Human Diseases

[0006] miRNAs are involved in a wide variety of human diseases. One is spinal muscular atrophy (SMA), a paediatric neurodegenerative disease caused by reduced protein levels or loss-of-function mutations of the survival of motor neurons (SMN) gene (Paushkin et al. 2002). A mutation in the target site of miR-189 in the human SLITRK1 gene was recently shown to be associated with Tourette's syndrome (Abelson et al. 2005), while another recent study reported that the hepatitis C virus (HCV) RNA genome interacts with a host-cell microRNA, the liver-specific miR-122a, to facilitate its replication in the host (Jopling et al. 2005). Other diseases in which miRNAs or their processing machinery have been implicated, include frag-ile X mental retardation (FXMR) caused by absence of the fragile X mental retardation protein (FMRP) (Nelson et al. 2003, Jin et al. 2004) and DiGeorge syndrome (Landthaler et al. 2004).

[0007] In addition, perturbed miRNA expression patterns have been reported in many human cancers. For example, the human miRNA genes miR15a and miR16-1 are deleted or down-regulated in the majority of B-cell chronic lymphocytic leukemia (CLL) cases, where a unique signature of 13 miRNA genes was recently shown to associate with prognosis and progression (Calin et al. 2002, Calin et al. 2005). The role of miRNAs in cancer is further supported by the fact that more than 50% of the human miRNA genes are located in cancer-associated genomic regions or at fragile sites (Calin et al. 2004). Recently, systematic expression analysis of a diversity of human cancers revealed a general down-regulation of miRNAs in tumors compared to normal tissues (Lu et al. 2005). Interestingly, miRNA-based classification of poorly differentiated tumors was successful, whereas mRNA profiles were highly inaccurate when applied to the same samples. miRNAs have also been shown to be deregulated in breast cancer (Iorio et al. 2005), lung cancer (Johnson et al. 2005) and colon cancer (Michael et al. 2004), while the miR-17-92 cluster, which is amplified in human B-cell lymphomas and miR-155 which is upregulated in Burkitt's lymphoma have been reported as the first human miRNA oncogenes (Eis et al. 2005, He et al. 2005). Thus, human miRNAs would not only be highly useful as biomarkers for future cancer diagnostics, but are rapidly emerging as attractive targets for disease intervention by oligonucleotide technologies.

[0008] Inhibition of MicroRNAs Using Single Stranded oligonucleotides

[0009] Several oligonucleotide approaches have been reported for inhibition of miRNAs.

[0010] WO03/029459 (Tuschl) claims oligonucleotides which encode microRNAs and their complements of between 18-25 nucleotides in length which may comprise nucleotide analogues. LNA is suggested as a possible nucleotide analogue, although no LNA containing oligonucleotides are disclosed. Tuschl claims that miRNA oligonucleotides may be used in therapy.

[0011] US2005/0182005 discloses a 24mer 2'OMe RNA oligoribonucleotide complementary to the longest form of miR 21 which was found to reduce miR 21 induced repression, whereas an equivalent DNA containing oligonucleotide did not. The term 2'OMe-RNA refers to an RNA analogue where there is a substitution to methyl at the 2' position (2'OMethyl).

[0012] US2005/0227934 (Tuschl) refers to antimir molecules with upto 50% DNA residues. It also reports that antimirs containing 2' OMe RNA were used against pancreatic microRNAs but it appears that no actual oligonucleotide structures are disclosed.

[0013] US20050261218 (ISIS) claims an oligomeric compound comprising a first region and a second region, wherein at least one region comprises a modification and a portion of the oligomeric compound is targeted to a small non-coding RNA target nucleic acid, wherein the small non-coding RNA target nucleic acid is a miRNA. Oligomeric compounds of between 17 and 25 nucleotides in length are claimed. The examples refer to entirely 2' OMe PS compounds, 21mers and 20mer and 2'OMe gapmer oligonucleotides targeted against a range of pre-miRNA and mature miRNA targets.

[0014] Boutla et al. 2003 (Nucleic Acids Research 31: 4973-4980) describe the use of DNA antisense oligonucleotides complementary to 11 different miRNAs in Drosophila as well as their use to inactivate the miRNAs by injecting the DNA oligonucleotides into fly embryos. Of the 11 DNA antisense oligonucleotides, only 4 constructs showed severe interference with normal development, while the remaining 7 oligonucleotides didn't show any phenotypes presumably due to their inability to inhibit the miRNA in question.

[0015] An alternative approach to this has been reported by Hutvagner et al. (2004) and Leaman et al. (2005), in which 2'-O-methyl antisense oligonucleotides, complementary to the mature miRNA could be used as potent and irreversible inhibitors of short interfering RNA (siRNA) and miRNA function in vitro and in vivo in Drosophila and C. elegans, thereby inducing a loss-of-function phenotype. A drawback of this method is the need of high 2'-O-methyl oligonucleotide concentrations (100 micromolar) in transfection and injection experiments, which may be toxic to the animal. This method was recently applied to mice studies, by conjugating 2'-O-methyl antisense oligonucleotides complementary to four different miRNAs with cholesterol for silencing miRNAs in vivo (Krutzfedt et al. 2005). These so-called antagomirs were administered to mice by intravenous injections. Although these experiments resulted in effective silencing of endogenous miRNAs in vivo, which was found to be specific, efficient and long-lasting, a major drawback was the need of high dosage (80 mg/kg) of 2'-O-Me antagomir for efficient silencing.

[0016] Inhibition of microRNAs using LNA-modified oligonucleotides have previously been described by Chan et al. Cancer Research 2005, 65 (14) 6029-6033, Lecellier et al. Science 2005, 308, 557-560, Naguibneva et al. Nature Cell Biology 2006 8 (3), 278-84 and Orum et al. Gene 2006, (Available online 24 Feb. 2006). In all cases, the LNA-modified anti-mir oligonucleotides were complementary to the entire mature microRNA, i.e. 20-23 nucleotides in length, which hampers efficient in vivo uptake and wide biodistribution of the molecules.

[0017] Naguibneva (Naguibneva et al. Nature Cell Biology 2006 8 describes the use of mixmer DNA-LNA-DNA antisense oligonucleotide anti-mir to inhibit microRNA miR-181 function in vitro, in which a block of 8 LNA nucleotides is located at the center of the molecule flanked by 6 DNA nucleotides at the 5' end, and 9 DNA nucleotides at the 3' end, respectively. A major drawback of this antisense design is low in vivo stability due to low nuclease resistance of the flanking DNA ends.

[0018] While Chan et al. (Chan et al. Cancer Research 2005, 65 (14) 6029-6033), and Orum et al. (Orum et al. Gene 2006, (Available online 24 Feb. 2006) do not disclose the design of the LNA-modified anti-mir molecules used in their study, Lecellier et al. (Lecellier et al. Science 2005, 308, 557-560) describes the use of gapmer LNA-DNA-LNA antisense oligonucleotide anti-mir to inhibit microRNA function, in which a block of 4 LNA nucleotides is located both at the 5' end, and at the 3' end, respectively, with a window of 13 DNA nucleotides at the center of the molecule. A major drawback of this antisense design is low in vivo uptake, as well as low in vivo stability due to the 13 nucleotide DNA stretch in the anti-mir oligonucleotide.

[0019] Thus, there is a need in the field for improved oligonucleotides capable of inhibiting microRNAs.

SUMMARY OF THE INVENTION

[0020] The present invention is based upon the discovery that the use of short oligonucleotides designed to bind with high affinity to miRNA targets are highly effective in alleviating the repression of mRNA by microRNAs in vivo.

[0021] Whilst not wishing to be bound to any specific theory, the evidence disclosed herein indicates that the highly efficient targeting of miRNAs in vivo is achieved by designing oligonucleotides with the aim of forming a highly stable duplex with the miRNA target in vivo. This is achieved by the use of high affinity nucleotide analogues such as at least one LNA units and suitably further high affinity nucleotide analogues, such as LNA, 2'-MOE RNA of 2'-Fluoro nucleotide analogues, in a short, such as 10-17 or 10-16 nucleobase oligonucleotides. In one aspect the aim is to generate an oligonucleotide of a length which is unlikely to form a siRNA complex (i.e. a short oligonucleotide), and with sufficient loading of high affinity nucleotide analogues that the oligonucleotide sticks almost permanently to its miRNA target, effectively forming a stable and non-functional duplex with the miRNA target. We have found that such designs are considerably more effective than the prior art oligonucleotides, particularly gapmer and blockmer designs and oligonucleotides which have a long length, e.g. 20-23mers. The term 2'fluor-DNA refers to an DNA analogue where the is a substitution to fluor at the 2' position (2'F).

[0022] The invention provides a pharmaceutical composition comprising a single stranded oligonucleotide having a length of between 8 and 17, such as 10 and 17, such as 8-16 or 10-16 nucleobase units, a pharmaceutically acceptable diluent, carrier, or adjuvant, wherein at least one of the nucleobase units of the single stranded oligonucleotide is a high affinity nucleotide analogue, such as a Locked Nucleic Acid (LNA) nucleobase unit, and wherein the single stranded oligonucleotide is complementary to a human microRNA sequence.

[0023] The high affinity nucleotide analogues are nucleotide analogues which result in oligonucleotide which has a higher thermal duplex stability with a complementary RNA nucleotide than the binding affinity of an equivalent DNA nucleotide. This is typically determined by measuring the T.sub.m.

[0024] We have not identified any significant off-target effects when using these short, high affinity oligonucleotides targeted against specific miRNAs. Indeed, the evidence provided herein indicates the effects on mRNA expression are either due to the presence of a complementary sequence to the targeted miRNA (primary mRNA targets) within the mRNA or secondary effects on mRNAs which are regulated by primary mRNA targets (secondary mRNA targets). No toxicity effects were identified indicating no significant detrimental off-target effects.

[0025] The invention further provides a pharmaceutical composition comprising a single stranded oligonucleotide having a length of between 8 and 17 nucleobase units, such as between 10 and 17 nucleobase units, such as between 10 and 16 nucleobase units, and a pharmaceutically acceptable diluent, carrier, or adjuvant, wherein at least one of the nucleobase units of the single stranded oligonucleotide is a Locked Nucleic Acid (LNA) nucleobase unit, and wherein the single stranded oligonucleotide is complementary to a human microRNA sequence.

[0026] The invention further provides for the use of an oligonucleotide according to the invention, such as those which may form part of the pharmaceutical composition, for the manufacture of a medicament for the treatment of a disease or medical disorder associated with the presence or over-expression (upregulation) of the microRNA.

[0027] The invention further provides for a method for the treatment of a disease or medical disorder associated with the presence or over-expression of the microRNA, comprising the step of administering a composition (such as the pharmaceutical composition) according to the invention to a person in need of treatment.

[0028] The invention further provides for a method for reducing the effective amount of a miRNA in a cell or an organism, comprising administering a composition (such as the pharmaceutical composition) according to the invention or a single stranded oligonucleotide according to the invention to the cell or the organism. Reducing the effective amount in this context refers to the reduction of functional miRNA present in the cell or organism. It is recognised that the preferred oligonucleotides according to the invention may not always significantly reduce the actual amount of miRNA in the cell or organism as they typically form very stable duplexes with their miRNA targets.

[0029] The invention further provides for a method for de-repression of a target mRNA of a miRNA in a cell or an organism, comprising administering a composition (such as the pharmaceutical composition) or a single stranded oligonucleotide according to the invention to the cell or the organism.

[0030] The invention further provides for the use of a single stranded oligonucleotide of between 8-16 such as 10-16 nucleobases in length, for the manufacture of a medicament for the treatment of a disease or medical disorder associated with the presence or over-expression of the microRNA.

[0031] The invention further provides for a method for the treatment of a disease or medical disorder associated with the presence or over-expression of the microRNA, comprising the step of administering a composition (such as the pharmaceutical composition) comprising a single stranded oligonucleotide of between between 8-16 such as between 10-16 nucleobases in length to a person in need of treatment.

[0032] The invention further provides for a method for reducing the effective amount of a miRNA target (i.e. `available` miRNA) in a cell or an organism, comprising administering a composition (such as the pharmaceutical composition) comprising a single stranded oligonucleotide of between 8-16 such as between 10-16 nucleobases to the cell or the organism.

[0033] The invention further provides for a method for de-repression of a target mRNA of a miRNA in a cell or an organism, comprising a single stranded oligonucleotide of between 8-16 such as between 10-16 nucleobases or (or a composition comprising said oligonucleotide) to the cell or the organism.

[0034] The invention further provides for a method for the synthesis of a single stranded oligonucleotide targeted against a human microRNA, such as a single stranded oligonucleotide described herein, said method comprising the steps of: [0035] a. Optionally selecting a first nucleobase, counting from the 3' end, which is a nucleotide analogue, such as an LNA nucleobase. [0036] b. Optionally selecting a second nucleobase, counting from the 3' end, which is an nucleotide analogue, such as an LNA nucleobase. [0037] c. Selecting a region of the single stranded oligonucleotide which corresponds to the miRNA seed region, wherein said region is as defined herein. [0038] d. Optionally selecting a seventh and eight nucleobase is as defined herein. [0039] e. Optionally selecting a 5' region of the single stranded oligonucleotide is as defined herein. [0040] f. Optionally selecting a 5' terminal of the single stranded oligonucleotide is as defined herein.

[0041] Wherein the synthesis is performed by sequential synthesis of the regions defined in steps a-f, wherein said synthesis may be performed in either the 3'-5' (a to f) or 5'-3' (f to a) direction, and wherein said single stranded oligonucleotide is complementary to a sequence of the miRNA target.

[0042] In one embodiment the oligonucleotide of the invention is designed not to be recruited by RISC or to mediate RISC directed cleavage of the miRNA target. It has been considered that by using long oligonucleotides, e.g. 21 or 22mers, particularly RNA oligonucleotides, or RNA `analogue` oligonucleotide which are complementary to the miRNA target, the oligonucleotide can compete against the target mRNA in terms of RISC complex association, and thereby alleviate miRNA repression of miRNA target mRNAs via the introduction of an oligonucleotide which competes as a substrate for the miRNA.

[0043] However, the present invention seeks to prevent such undesirable target mRNA cleavage or translational inhibition by providing oligonucleotides capable of complementary, and apparently in some cases almost irreversible binding to the mature microRNA. This appears to result in a form of protection against degradation or cleavage (e.g. by RISC or RNAseH or other endo or exo-nucleases), which may not result in substantial or even significant reduction of the miRNA (e.g. as detected by northern blot using LNA probes) within a cell, but ensures that the effective amount of the miRNA, as measured by de-repression analysis is reduced considerably. Therefore, in one aspect, the invention provides oligonucleotides which are purposefully designed not to be compatible with the RISC complex, but to remove miRNA by titration by the oligonucleotide. Although not wishing to be bound to a specific theory of why the oligonucleotides of the present invention are so effective, in analogy with the RNA based oligonucleotides (or complete 2'OMe oligonucleotides), it appears that the oligonucleotides according to the present invention work through non-competitive inhibition of miRNA function as they effectively remove the available miRNA from the cytoplasm, where as the prior art oligonucleotides provide an alternative miRNA substrate, which may act as a competitor inhibitor, the effectiveness of which would be far more dependant upon the concentration of the oligonucleotide in the cytoplasm, as well as the concentration of the target mRNA and miRNA.

[0044] Again, whilst not wishing to be bound to any specific theory, one further possibility that may exist with the use of oligonucleotides of approximately similar length to the miRNA targets, is that the oligonucleotides could form a siRNA like duplex with the miRNA target, a situation which would reduce the effectiveness of the oligonucleotide. It is also possible that the oligonucleotides themselves could be used as the guiding strand within the RISC complex, thereby generating the possibility of RISC directed degradation of non-specific targets which just happen to have sufficient complementarity to the oligonucleotide guide.

[0045] By selecting short oligonucleotides for targeting miRNA sequences, such problems are avoided.

[0046] Short oligonucleotides which incorporate LNA are known from the reagents area, such as the LNA (see for example WO2005/098029 and WO 2006/069584). However the molecules designed for diagnostic or reagent use are very different in design than those for pharmaceutical use. For example, the terminal nucleobases of the reagent oligos are typically not LNA, but DNA, and the internucleoside linkages are typically other than phosphorothioate, the preferred linkage for use in the oligonucleotides of the present invention. The invention therefore provides for a novel class of oligonucleotide per se.

[0047] The invention further provides for a (single stranded) oligonucleotide as described in the context of the pharmaceutical composition of the invention, wherein said oligonucleotide comprises either [0048] i) at least one phosphorothioate linkage and/or [0049] ii) at least one 3' terminal LNA unit, and/or [0050] iii) at least one 5' terminal LNA unit.

[0051] It is preferable for most therapeutic uses that the oligonucleotide is fully phosphorothiolated--the exception being for therapeutic oligonucleotides for use in the CNS, such as in the brain or spine where phosphorothioation can be toxic, and due to the absence of nucleases, phosphodieater bonds may be used, even between consecutive DNA units. As referred to herein, other preferred aspects of the oligonucleotide according to the invention is that the second 3' nucleobase, and/or the 9.sup.th and 10.sup.th (from the 3' end), may also be LNA.

[0052] The inventors have found that other methods of avoiding RNA cleavage (such as exo-nuclease degradation in blood serum, or RISC associated cleavage of the oligonucleotide according to the invention are possible, and as such the invention also provides for a single stranded oligonucleotide which comprises of either: [0053] a. an LNA unit at position 1 and 2 counting from the 3' end and/or [0054] b. an LNA unit at position 9 and/or 10, also counting from the 3' end, and/or [0055] c. either one or two 5' LNA units.

[0056] Whilst the benefits of these other aspects may be seen with longer oligonucleotides, such as nucleotide of up to 26 nucleobase units in length, it is considered these features may also be used with the shorter oligonucleotides referred to herein, such as the oligonucleotides of between 10-17 or 10-16 nucleobases described herein. It is highly preferably that the oligonucleotides comprise high affinity nucleotide analogues, such as those referred to herein, most preferably LNA units.

[0057] The inventors have therefore surprisingly found that carefully designed single stranded oligonucleotides comprising locked nucleic acid (LNA) units in a particular order show significant silencing of microRNAs, resulting in reduced microRNA levels. It was found that tight binding of said oligonucleotides to the so-called seed sequence, nucleotides 2 to 8 or 2-7, counting from the 5' end, of the target microRNAs was important. Nucleotide 1 of the target microRNAs is a non-pairing base and is most likely hidden in a binding pocket in the Ago 2 protein. Whilst not wishing to be bound to a specific theory, the present inventors consider that by selecting the seed region sequences, particularly with oligonucleotides that comprise LNA, preferably LNA units in the region which is complementary to the seed region, the duplex between miRNA and oligonucleotide is particularly effective in targeting miRNAs, avoiding off target effects, and possibly providing a further feature which prevents RISC directed miRNA function.

[0058] The inventors have surprisingly found that microRNA silencing is even more enhanced when LNA-modified single stranded oligonucleotides do not contain a nucleotide at the 3' end corresponding to this non-paired nucleotide 1. It was further found that two LNA units in the 3' end of the oligonucleotides according to the present invention made said oligonucleotides highly nuclease resistant.

[0059] It was further found that the oligonucleotides of the invention which have at least one nucleotide analogue, such as an LNA nucleotide in the positions corresponding to positions 10 and 11, counting from the 5' end, of the target microRNA may prevent cleavage of the oligonucleotides of the invention

[0060] Accordingly, in one aspect of the invention relates to an oligonucleotide having a length of from 12 to 26 nucleotides, wherein [0061] i) the first nucleotide, counting from the 3' end, is a locked nucleic acid (LNA) unit; [0062] ii) the second nucleotide, counting from the 3' end, is an LNA unit; and [0063] iii) the ninth and/or the tenth nucleotide, counting from the 3' end, is an LNA unit.

[0064] The invention further provides for the oligonucleotides as defined herein for use as a medicament.

[0065] The invention further relates to compositions comprising the oligonucleotides defined herein and a pharmaceutically acceptable carrier.

[0066] As mentioned above, microRNAs are related to a number of diseases. Hence, a fourth aspect of the invention relates to the use of an oligonucleotide as defined herein for the manufacture of a medicament for the treatment of a disease associated with the expression of microRNAs selected from the group consisting of spinal muscular atrophy, Tourette's syndrome, hepatitis C virus, fragile X mental retardation, DiGeorge syndrome and cancer, such as chronic lymphocytic leukemia, breast cancer, lung cancer and colon cancer, in particular cancer.

[0067] A further aspect of the invention is a method to reduce the levels of target microRNA by contacting the target microRNA to an oligonucleotide as defined herein, wherein the oligonucleotide [0068] 1. is complementary to the target microRNA [0069] 2. does not contain a nucleotide at the 3' end that corresponds to the first 5' end nucleotide of the target microRNA.

[0070] The invention further provides for an oligonucleotide comprising a nucleobase sequence selected from the group consisting of SEQ IDs NO 1-534, SEQ ID NOs 539-544, SEQ ID NOs 549-554, SEQ ID NOs 559-564, SEQ ID NOs 569-574 and SEQ ID NOs 594-598, and SEQ ID NOs 579-584, or a pharmaceutical composition comprising said oligonucleotide. In one embodiment, the oligonucleotide may have a nucleobase sequence of between 1-17 nucleobases, such as 8, 9, 10, 11, 12, 13, 14, 15, 16 or 17 nucleobases, and as such the oligonucleobase in such an embodiment may be a contiguous subsequence within the oligonucleotides disclosed herein.

BRIEF DESCRIPTION OF THE DRAWINGS

[0071] FIG. 1. The effect of treatment with different LNA anti-miR oligonucleotides on target nucleic acid expression in the miR-122a expressing cell line Huh-7. Shown are amounts of miR-122a (arbitrary units) derived from miR-122a specific qRT-PCR as compared to untreated cells (mock). The LNA anti-miR oligonucleotides were used at two concentrations, 1 and 100 nM, respectively. Included is also a mismatch control (SPC3350) to SPC3349 (also referred to herein as SPC3549).

[0072] FIG. 2. Assessment of LNA anti-miR-122a knock-down dose-response for SPC3548 and SPC3549 in comparison with SPC3372 in vivo in mice livers using miR-122a real-time RT-PCR.

[0073] FIG. 2b miR-122 levels in the mouse liver after treatment with different LNA-antimiRs. The LNA-antimiR molecules SPC3372 and SPC3649 were administered into normal mice by three i.p. injections on every second day over a six-day-period at indicated doses and sacrificed 48 hours after last dose. Total RNA was extracted from the mice livers and miR-122 was measured by miR-122 specific qPCR.

[0074] FIG. 3. Assessment of plasma cholesterol levels in LNA-antimiR-122a treated mice compared to the control mice that received saline.

[0075] FIG. 4a. Assessment of relative Bckdk mRNA levels in LNA antimiR-122a treated mice in comparison with saline control mice using real-time quantitative RT-PCR.

[0076] FIG. 4b. Assessment of relative aldolase A mRNA levels in LNA antimiR-122a treated mice in comparison with saline control mice using real-time quantitative RT-PCR.

[0077] FIG. 4c. Assessment of GAPDH mRNA levels in LNA antimiR-122a treated mice (animals 4-30) in comparison with saline control mice (animals 1-3) using real-time quantitative RT-PCR.

[0078] FIG. 5. Assessment of LNA-antimiR.TM.-122a knock-down dose-response in vivo in mice livers using miR-122a real-time RT-PCR. Six groups of animals (5 mice per group) were treated in the following manner. Group 1 animals were injected with 0.2ml saline by i.v. on 3 successive days, Group 2 received 2.5mg/kg SPC3372, Group 3 received 6.25 mg/kg, Group 4 received 12.5 mg/kg and Group 5 received 25 mg/kg, while Group 6 received 25 mg/kg SPC 3373 (mismatch LNA-antimiR.TM. oligonucleotide), all in the same manner. The experiment was repeated (therefore n=10) and the combined results are shown.

[0079] FIG. 6. Northern blot comparing SPC3649 with SPC3372. Total RNA from one mouse in each group were subjected to miR-122 specific northern blot. Mature miR-122 and the duplex (blocked microRNA) formed between the LNA-antimiR and miR-122 is indicated.

[0080] FIG. 7. Mice were treated with 25 mg/kg/day LNA-antimiR or saline for three consecutive days and sacrificed 1, 2 or 3 weeks after last dose. Included are also the values from the animals sacrificed 24 hours after last dose (example 11 "old design"). miR-122 levels were assessed by qPCR and normalized to the mean of the saline group at each individual time point. Included are also the values from the animals sacrificed 24 hours after last dose (shown mean and SD, n=7, 24 h n=10). Sacrifice day 9, 16 or 23 corresponds to sacrifice 1, 2 or 3 weeks after last dose.).

[0081] FIG. 8. Mice were treated with 25 mg/kg/day LNA-antimiR or saline for three consecutive days and sacrificed 1, 2 or 3 weeks after last dose. Included are also the values from the animals sacrificed 24 hours after last dose (example 11 "old design"). Plasma cholesterol was measured and normalized to the saline group at each time point (shown mean and SD, n=7, 24 h n=10).

[0082] FIG. 9. Dose dependent miR-122a target mRNA induction by SPC3372 inhibition of miR-122a. Mice were treated with different SPC3372 doses for three consecutive days, as described above and sacrificed 24 hours after last dose. Total RNA extracted from liver was subjected to qPCR. Genes with predicted miR-122 target site and observed to be upregulated by microarray analysis were investigated for dose-dependent induction by increasing SPC3372 doses using qPCR. Total liver RNA from 2 to 3 mice per group sacrificed 24 hours after last dose were subjected to qPCR for the indicated genes. Shown in FIG. 9 is mRNA levels relative to Saline group, n=2-3 (2.5-12.5 mg/kg/day: n=2, no SD). Shown is also the mismatch control (mm, SPC3373)

[0083] FIG. 10. Transient induction of miR-122a target mRNAs following SPC3372 treatment. NMRI female mice were treated with 25 mg/kg/day SPC3372 along with saline control for three consecutive days and sacrificed 1, 2 or 3 weeks after last dose, respectively. RNA was extracted from livers and mRNA levels of predicted miR-122a target mRNAs, selected by microarray data were investigated by qPCR. Three animals from each group were analysed.

[0084] FIG. 11. Induction of Vldlr in liver by SPC3372 treatment. The same liver RNA samples as in previous example (FIG. 10) were investigated for Vldlr induction.

[0085] FIG. 12. Stability of miR-122a/SPC3372 duplex in mouse plasma. Stability of SPC3372 and SPC3372/miR-122a duplex were tested in mouse plasma at 37.degree. C. over 96 hours. Shown in FIG. 12 is a SYBR-Gold stained PAGE.

[0086] FIG. 13. Sequestering of mature miR-122a by SPC3372 leads to duplex formation. Shown in FIG. 13 is a membrane probed with a miR-122a specific probe (upper panel) and re-probed with a Let-7 specific probe (lower panel). With the miR-122 probe, two bands could be detected, one corresponding to mature miR-122 and one corresponding to a duplex between SPC3372 and miR-122.

[0087] FIG. 14. miR-122a sequestering by SPC3372 along with SPC3372 distribution assessed by in situ hybridization of liver sections. Liver cryo-sections from treated animals were

[0088] FIG. 15. Liver gene expression in miR-122 LNA-antimiR treated mice.

[0089] Saline and LNA-antimiR treated mice were compared by genome-wide expression profiling using Affymetrix Mouse Genome 430 2.0 arrays. (a,1) Shown is number of probes displaying differentially expression in liver samples of LNA-antimiR-122 treated and saline treated mice 24 hours post treatment. (b,2) The occurrence of miR-122 seed sequence in differentially expressed genes. The plot shows the percentage of transcripts with at least one miR-122 seed recognition sequence in their 3' UTR. Random: Random sequences were generated and searched for miR-122 seed recognition sequences.

[0090] Temporal liver gene expression profiles in LNA-antimiR treated mice. Mice were treated with 25 mg/kg/day LNA-antimiR or saline for three consecutive days and sacrificed 1, 2 or 3 weeks after last dose. Included are also the values from the animals sacrificed 24 hours after last dose. (c,3) RNA samples from different time points were also subjected to expression profiling. Hierarchical cluster analysis of expression profiles of genes identified as differentially expressed between LNA-antimiR and saline treated mice 24 hours, one week or three weeks post treatment. (d,4) Expression profiles of genes identified as differentially expressed between LNA-antimiR and saline treated mice 24 hours post treatment were followed over time. The expression ratios of up- and down-regulated genes in LNA-antimiR treated mice approach 1 over the time-course, indicating a reversible effect of the LNA-antimiR treatment.

[0091] FIG. 16. The effect of treatment with SPC3372 and 3595 on miR-122 levels in mice livers.

[0092] FIG. 17. The effect of treatment with SPC3372 and 3595 on Aldolase A levels in mice livers.

[0093] FIG. 18. The effect of treatment with SPC3372 and 3595 on Bckdk levels in mice livers.

[0094] FIG. 19. The effect of treatment with SPC3372 and 3595 on CD320 levels in mice livers.

[0095] FIG. 20. The effect of treatment with SPC3372 and 3595 on Ndrg3 levels in mice livers.

[0096] FIG. 21. The effect of long-term treatment with SPC3649 on total plasma cholesterol in hypercholesterolemic and normal mice. Weekly samples of blood plasma were obtained from the SPC3649 treated and saline control mice once weekly followed by assessment of total plasma cholesterol. The mice were treated with 5 mg/kg SPC3649, SPC3744 or saline twice weekly. Normal mice given were treated in parallel.

[0097] FIG. 22. The effect of long-term treatment with SPC3649 on miR-122 levels in hypercholesterolemic and normal mice.

[0098] FIG. 23. The effect of long-term treatment with SPC3649 on Aldolase A levels in hypercholesterolemic and normal mice.

[0099] FIG. 24. The effect of long-term treatment with SPC3649 on Bckdk levels in hypercholesterolemic and normal mice.

[0100] FIG. 25. The effect of long-term treatment with SPC3649 on AST levels in hypercholesterolemic and normal mice.

[0101] FIG. 26. The effect of long-term treatment with SPC3649 on ALT levels in hypercholesterolemic and normal mice.

[0102] FIG. 27. Functional de-repression of renilla luciferase with miR-155 target by miR-155 blocking oligonucleotides in an endogenously miR-155 expressing cell line, 518A2. "psiCheck2" is the plasmid without miR-155 target, i.e. full expression and "miR-155 target" is the corresponding plasmid with miR-155 target but not co-transfected with oligo blocking miR-155 and hence represent fully miR-155 repressed renilla luciferace expression.

[0103] FIG. 28. Functional de-repression of renilla luciferase with miR-19b target by miR-19b blocking oligonucleotides in an endogenously miR-19b expressing cell line, HeLa. "miR-19b target" is the plasmid with miR-19b target but not co-transfected with oligo blocking miR-19b and hence represent fully miR-19b repressed renilla luciferace expression.

[0104] FIG. 29. Functional de-repression of renilla luciferase with miR-122 target by miR-122 blocking oligonucleotides in an endogenously miR-122 expressing cell line, Huh-7. "miR-122 target" is the corresponding plasmid with miR-122 target but not co-transfected with oligo blocking miR-122 and hence represent fully miR-122 repressed renilla luciferace expression.

[0105] FIG. 30. Diagram illustrating the alignment of an oligonucleotide according to the invention and a microRNA target.

DETAILED DESCRIPTION OF THE INVENTION

[0106] The invention provides pharmaceutical compositions comprising short single stranded oligonucleotides, of length of between 8 and 17 such as between 10 and 17 nucleobases which are complementary to human microRNAs. The short oligonucleotides are particularly effective at alleviating miRNA repression in vivo. It is found that the incorporation of high affinity nucleotide analogues into the oligonucleotides results in highly effective anti-microRNA molecules which appear to function via the formation of almost irreversible duplexes with the miRNA target, rather than RNA cleavage based mechanisms, such as mechanisms associated with RNaseH or RISC.

[0107] It is highly preferable that the single stranded oligonucleotide according to the invention comprises a region of contiguous nucleobase sequence which is 100% complementary to the human microRNA seed region.

[0108] It is preferable that single stranded oligonucleotide according to the invention is complementary to the mature human microRNA sequence.

[0109] In one embodiment the single stranded oligonucleotide according to the invention is complementary to a microRNA sequence, such as a microRNA sequence selected from the group consisting of: hsa-let-7a, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f, hsa-miR-15a, hsa-miR-16, hsa-miR-17-5p, hsa-miR-17-3p, hsa-miR-18a, hsa-miR-19a, hsa-miR-19b, hsa-miR-20a, hsa-miR-21, hsa-miR-22, hsa-miR-23a, hsa-miR-189, hsa-miR-24, hsa-miR-25, hsa-miR-26a, hsa-miR-26b, hsa-miR-27a, hsa-miR-28, hsa-miR-29a, hsa-miR-30a-5p, hsa-miR-30a-3p, hsa-miR-31, hsa-miR-32, hsa-miR-33, hsa-miR-92, hsa-miR-93, hsa-miR-95, hsa-miR-96, hsa-miR-98, hsa-miR-99a, hsa-miR-100, hsa-miR-101, hsa-miR-29b, hsa-miR-103, hsa-miR-105, hsa-miR-106a, hsa-miR-107, hsa-miR-192, hsa-miR-196a, hsa-miR-197, hsa-miR-198, hsa-miR-199a, hsa-miR-199a*, hsa-miR-208, hsa-miR-129, hsa-miR-148a, hsa-miR-30c, hsa-miR-30d, hsa-miR-139, hsa-miR-147, hsa-miR-7, hsa-miR-10a, hsa-miR-10b, hsa-miR-34a, hsa-miR-181a, hsa-miR-181b, hsa-miR-181c, hsa-miR-182, hsa-miR-182*, hsa-miR-183, hsa-miR-187, hsa-miR-199b, hsa-miR-203, hsa-miR-204, hsa-miR-205, hsa-miR-210, hsa-miR-211, hsa-miR-212, hsa-miR-181a*, hsa-miR-214, hsa-miR-215, hsa-miR-216, hsa-miR-217, hsa-miR-218, hsa-miR-219, hsa-miR-220, hsa-miR-221, hsa-miR-222, hsa-miR-223, hsa-miR-224, hsa-miR-200b, hsa-let-7g, hsa-let-7i, hsa-miR-1, hsa-miR-15b, hsa-miR-23b, hsa-miR-27b, hsa-miR-30b, hsa-miR-122a, hsa-miR-124a, hsa-miR-125b, hsa-miR-128a, hsa-miR-130a, hsa-miR-132, hsa-miR-133a, hsa-miR-135a, hsa-miR-137, hsa-miR-138, hsa-miR-140, hsa-miR-141, hsa-miR-142-5p, hsa-miR-142-3p, hsa-miR-143, hsa-miR-144, hsa-miR-145, hsa-miR-152, hsa-miR-153, hsa-miR-191, hsa-miR-9, hsa-miR-9*, hsa-miR-125a, hsa-miR-126*, hsa-miR-126, hsa-miR-127, hsa-miR-134, hsa-miR-136, hsa-miR-146a, hsa-miR-149, hsa-miR-150, hsa-miR-154, hsa-miR-154*, hsa-miR-184, hsa-miR-185, hsa-miR-186, hsa-miR-188, hsa-miR-190, hsa-miR-193a, hsa-miR-194, hsa-miR-195, hsa-miR-206, hsa-miR-320, hsa-miR-200c, hsa-miR-155, hsa-miR-128b, hsa-miR-106b, hsa-miR-29c, hsa-miR-200a, hsa-miR-302a*, hsa-miR-302a, hsa-miR-34b, hsa-miR-34c, hsa-miR-299-3p, hsa-miR-301, hsa-miR-99b, hsa-miR-296, hsa-miR-130b, hsa-miR-30e-5p, hsa-miR-30e-3p, hsa-miR-361, hsa-miR-362, hsa-miR-363, hsa-miR-365, hsa-mir-302b*, hsa-miR-302b, hsa-miR-302c*, hsa-miR-302c, hsa-miR-302d, hsa-miR-367, hsa-miR-368, hsa-miR-369-3p, hsa-miR-370, hsa-miR-371, hsa-miR-372, hsa-miR-373*, hsa-miR-373, hsa-miR-374, hsa-miR-375, hsa-miR-376a, hsa-miR-377, hsa-miR-378, hsa-miR-422b, hsa-miR-379, hsa-miR-380-5p, hsa-miR-380-3p, hsa-miR-381, hsa-miR-382, hsa-miR-383, hsa-miR-340, hsa-miR-330, hsa-miR-328, hsa-miR-342, hsa-miR-337, hsa-miR-323, hsa-miR-326, hsa-miR-151, hsa-miR-135b, hsa-miR-148b, hsa-miR-331, hsa-miR-324-5p, hsa-miR-324-3p, hsa-miR-338, hsa-miR-339, hsa-miR-335, hsa-miR-133b, hsa-miR-325, hsa-miR-345, hsa-miR-346, ebv-miR-BHRF1-1, ebv-miR-BHRF1-2*, ebv-miR-BHRF1-2, ebv-miR-BHRF1-3, ebv-miR-BART1-5p, ebv-miR-BART2, hsa-miR-384, hsa-miR-196b, hsa-miR-422a, hsa-miR-423, hsa-miR-424, hsa-miR-425-3p, hsa-miR-18b, hsa-miR-20b, hsa-miR-448, hsa-miR-429, hsa-miR-449, hsa-miR-450, hcmv-miR-UL22A, hcmv-miR-UL22A*, hcmv-miR-UL36, hcmv-miR-UL112, hcmv-miR-UL148D, hcmv-miR-US5-1, hcmv-miR-US5-2, hcmv-miR-US25-1, hcmv-miR-US25-2-5p, hcmv-miR-US25-2-3p, hcmv-miR-US33, hsa-miR-191*, hsa-miR-200a*, hsa-miR-369-5p, hsa-miR-431, hsa-miR-433, hsa-miR-329, hsa-miR-453, hsa-miR-451, hsa-miR-452, hsa-miR-452*, hsa-miR-409-5p, hsa-miR-409-3p, hsa-miR-412, hsa-miR-410, hsa-miR-376b, hsa-miR-483, hsa-miR-484, hsa-miR-485-5p, hsa-miR-485-3p, hsa-miR-486, hsa-miR-487a, kshv-miR-K12-10a, kshv-miR-K12-10b, kshv-miR-K12-11, kshv-miR-K12-1, kshv-miR-K12-2, kshv-miR-K12-9*, kshv-miR-K12-9, kshv-miR-K12-8, kshv-miR-K12-7, kshv-miR-K12-6-5p, kshv-miR-K12-6-3p, kshv-miR-K12-5, kshv-miR-K12-4-5p, kshv-miR-K12-4-3p, kshv-miR-K12-3, kshv-miR-K12-3*, hsa-miR-488, hsa-miR-489, hsa-miR-490, hsa-miR-491, hsa-miR-511, hsa-miR-146b, hsa-miR-202*, hsa-miR-202, hsa-miR-492, hsa-miR-493-5p, hsa-miR-432, hsa-miR-432*, hsa-miR-494, hsa-miR-495, hsa-miR-496, hsa-miR-193b, hsa-miR-497, hsa-miR-181d, hsa-miR-512-5p, hsa-miR-512-3p, hsa-miR-498, hsa-miR-520e, hsa-miR-515-5p, hsa-miR-515-3p, hsa-miR-519e*, hsa-miR-519e, hsa-miR-520f, hsa-miR-526c, hsa-miR-519c, hsa-miR-520a*, hsa-miR-520a, hsa-miR-526b, hsa-miR-526b*, hsa-miR-519b, hsa-miR-525, hsa-miR-525*, hsa-miR-523, hsa-miR-518f*, hsa-miR-518f, hsa-miR-520b, hsa-miR-518b, hsa-miR-526a, hsa-miR-520c, hsa-miR-518c*, hsa-miR-518c, hsa-miR-524*, hsa-miR-524, hsa-miR-517*, hsa-miR-517a, hsa-miR-519d, hsa-miR-521, hsa-miR-520d*, hsa-miR-520d, hsa-miR-517b, hsa-miR-520g, hsa-miR-516-5p, hsa-miR-516-3p, hsa-miR-518e, hsa-miR-527, hsa-miR-518a, hsa-miR-518d, hsa-miR-517c, hsa-miR-520h, hsa-miR-522, hsa-miR-519a, hsa-miR-499, hsa-miR-500, hsa-miR-501, hsa-miR-502, hsa-miR-503, hsa-miR-504, hsa-miR-505, hsa-miR-513, hsa-miR-506, hsa-miR-507, hsa-miR-508, hsa-miR-509, hsa-miR-510, hsa-miR-514, hsa-miR-532, hsa-miR-299-5p, hsa-miR-18a*, hsa-miR-455, hsa-miR-493-3p, hsa-miR-539, hsa-miR-544, hsa-miR-545, hsa-miR-487b, hsa-miR-551a, hsa-miR-552, hsa-miR-553, hsa-miR-554, hsa-miR-92b, hsa-miR-555, hsa-miR-556, hsa-miR-557, hsa-miR-558, hsa-miR-559, hsa-miR-560, hsa-miR-561, hsa-miR-562, hsa-miR-563, hsa-miR-564, hsa-miR-565, hsa-miR-566, hsa-miR-567, hsa-miR-568, hsa-miR-551b, hsa-miR-569, hsa-miR-570, hsa-miR-571, hsa-miR-572, hsa-miR-573, hsa-miR-574, hsa-miR-575, hsa-miR-576, hsa-miR-577, hsa-miR-578, hsa-miR-579, hsa-miR-580, hsa-miR-581, hsa-miR-582, hsa-miR-583, hsa-miR-584, hsa-miR-585, hsa-miR-548a, hsa-miR-586, hsa-miR-587, hsa-miR-548b, hsa-miR-588, hsa-miR-589, hsa-miR-550, hsa-miR-590, hsa-miR-591, hsa-miR-592, hsa-miR-593, hsa-miR-595, hsa-miR-596, hsa-miR-597, hsa-miR-598, hsa-miR-599, hsa-miR-600, hsa-miR-601, hsa-miR-602, hsa-miR-603, hsa-miR-604, hsa-miR-605, hsa-miR-606, hsa-miR-607, hsa-miR-608, hsa-miR-609, hsa-miR-610, hsa-miR-611, hsa-miR-612, hsa-miR-613, hsa-miR-614, hsa-miR-615, hsa-miR-616, hsa-miR-548c, hsa-miR-617, hsa-miR-618, hsa-miR-619, hsa-miR-620, hsa-miR-621, hsa-miR-622, hsa-miR-623, hsa-miR-624, hsa-miR-625, hsa-miR-626, hsa-miR-627, hsa-miR-628, hsa-miR-629, hsa-miR-630, hsa-miR-631, hsa-miR-33b, hsa-miR-632, hsa-miR-633, hsa-miR-634, hsa-miR-635, hsa-miR-636, hsa-miR-637, hsa-miR-638, hsa-miR-639, hsa-miR-640, hsa-miR-641, hsa-miR-642, hsa-miR-643, hsa-miR-644, hsa-miR-645, hsa-miR-646, hsa-miR-647, hsa-miR-648, hsa-miR-649, hsa-miR-650, hsa-miR-651, hsa-miR-652, hsa-miR-548d, hsa-miR-661, hsa-miR-662, hsa-miR-663, hsa-miR-449b, hsa-miR-653, hsa-miR-411, hsa-miR-654, hsa-miR-655, hsa-miR-656, hsa-miR-549, hsa-miR-657, hsa-miR-658, hsa-miR-659, hsa-miR-660, hsa-miR-421, hsa-miR-542-5p, hcmv-miR-US4, hcmv-miR-UL70-5p, hcmv-miR-UL70-3p, hsa-miR-363*, hsa-miR-376a*, hsa-miR-542-3p, ebv-miR-BART1-3p, hsa-miR-425-5p, ebv-miR-BART3-5p, ebv-miR-BART3-3p, ebv-miR-BART4, ebv-miR-BART5, ebv-miR-BART6-5p, ebv-miR-BART6-3p, ebv-miR-BART7, ebv-miR-BART8-5p, ebv-miR-BART8-3p, ebv-miR-BART9, ebv-miR-BART10, ebv-miR-BART11-5p, ebv-miR-BART11-3p, ebv-miR-BART12, ebv-miR-BART13, ebv-miR-BART14-5p, ebv-miR-BART14-3p, kshv-miR-K12-12, ebv-miR-BART15, ebv-miR-BART16, ebv-miR-BART17-5p, ebv-miR-BART17-3p, ebv-miR-BART18, ebv-miR-BART19, ebv-miR-BART20-5p, ebv-miR-BART20-3p, hsv1-miR-H1, hsa-miR-758, hsa-miR-671, hsa-miR-668, hsa-miR-767-5p, hsa-miR-767-3p, hsa-miR-454-5p, hsa-miR-454-3p, hsa-miR-769-5p, hsa-miR-769-3p, hsa-miR-766, hsa-miR-765, hsa-miR-768-5p, hsa-miR-768-3p, hsa-miR-770-5p, hsa-miR-802, hsa-miR-801, hsa-miR-675.

[0110] In one embodiment the single stranded oligonucleotide according to the invention is complementary to a microRNA sequence, such as a microRNA sequence selected from the group consisting of: hsa-let-7a, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f, hsa-miR-15a, hsa-miR-16, hsa-miR-17-5p, hsa-miR-17-3p, hsa-miR-18a, hsa-miR-19a, hsa-miR-20a, hsa-miR-22, hsa-miR-23a, hsa-miR-189, hsa-miR-24, hsa-miR-25, hsa-miR-26a, hsa-miR-26b, hsa-miR-27a, hsa-miR-28, hsa-miR-29a, hsa-miR-30a-5p, hsa-miR-30a-3p, hsa-miR-31, hsa-miR-32, hsa-miR-33, hsa-miR-92, hsa-miR-93, hsa-miR-95, hsa-miR-96, hsa-miR-98, hsa-miR-99a, hsa-miR-100, hsa-miR-101, hsa-miR-29b, hsa-miR-103, hsa-miR-105, hsa-miR-106a, hsa-miR-107, hsa-miR-192, hsa-miR-196a, hsa-miR-197, hsa-miR-198, hsa-miR-199a, hsa-miR-199a*, hsa-miR-208, hsa-miR-129, hsa-miR-148a, hsa-miR-30c, hsa-miR-30d, hsa-miR-139, hsa-miR-147, hsa-miR-7, hsa-miR-10a, hsa-miR-10b, hsa-miR-34a, hsa-miR-181a, hsa-miR-181b, hsa-miR-181c, hsa-miR-182, hsa-miR-182*, hsa-miR-183, hsa-miR-187, hsa-miR-199b, hsa-miR-203, hsa-miR-204, hsa-miR-205, hsa-miR-210, hsa-miR-211, hsa-miR-212, hsa-miR-181a*, hsa-miR-214, hsa-miR-215, hsa-miR-216, hsa-miR-217, hsa-miR-218, hsa-miR-219, hsa-miR-220, hsa-miR-221, hsa-miR-222, hsa-miR-223, hsa-miR-224, hsa-miR-200b, hsa-let-7g, hsa-let-7i, hsa-miR-1, hsa-miR-15b, hsa-miR-23b, hsa-miR-27b, hsa-miR-30b, hsa-miR-124a, hsa-miR-125b, hsa-miR-128a, hsa-miR-130a, hsa-miR-132, hsa-miR-133a, hsa-miR-135a, hsa-miR-137, hsa-miR-138, hsa-miR-140, hsa-miR-141, hsa-miR-142-5p, hsa-miR-142-3p, hsa-miR-143, hsa-miR-144, hsa-miR-145, hsa-miR-152, hsa-miR-153, hsa-miR-191, hsa-miR-9, hsa-miR-9*, hsa-miR-125a, hsa-miR-126*, hsa-miR-126, hsa-miR-127, hsa-miR-134, hsa-miR-136, hsa-miR-146a, hsa-miR-149, hsa-miR-150, hsa-miR-154, hsa-miR-154*, hsa-miR-184, hsa-miR-185, hsa-miR-186, hsa-miR-188, hsa-miR-190, hsa-miR-193a, hsa-miR-194, hsa-miR-195, hsa-miR-206, hsa-miR-320, hsa-miR-200c, hsa-miR-128b, hsa-miR-106b, hsa-miR-29c, hsa-miR-200a, hsa-miR-302a*, hsa-miR-302a, hsa-miR-34b, hsa-miR-34c, hsa-miR-299-3p, hsa-miR-301, hsa-miR-99b, hsa-miR-296, hsa-miR-130b, hsa-miR-30e-5p, hsa-miR-30e-3p, hsa-miR-361, hsa-miR-362, hsa-miR-363, hsa-miR-365, hsa-miR-302b*, hsa-miR-302b, hsa-miR-302c*, hsa-miR-302c, hsa-miR-302d, hsa-miR-367, hsa-miR-368, hsa-miR-369-3p, hsa-miR-370, hsa-miR-371, hsa-miR-372, hsa-miR-373*, hsa-miR-373, hsa-miR-374, hsa-miR-376a, hsa-miR-377, hsa-miR-378, hsa-miR-422b, hsa-miR-379, hsa-miR-380-5p, hsa-miR-380-3p, hsa-miR-381, hsa-miR-382, hsa-miR-383, hsa-miR-340, hsa-miR-330, hsa-miR-328, hsa-miR-342, hsa-miR-337, hsa-miR-323, hsa-miR-326, hsa-miR-151, hsa-miR-135b, hsa-miR-148b, hsa-miR-331, hsa-miR-324-5p, hsa-miR-324-3p, hsa-miR-338, hsa-miR-339, hsa-miR-335, hsa-miR-133b, hsa-miR-325, hsa-miR-345, hsa-miR-346, ebv-miR-BHRF1-1, ebv-miR-BHRF1-2*, ebv-miR-BHRF1-2, ebv-miR-BHRF1-3, ebv-miR-BART1-5p, ebv-miR-BART2, hsa-miR-384, hsa-miR-196b, hsa-miR-422a, hsa-miR-423, hsa-miR-424, hsa-miR-425-3p, hsa-miR-18b, hsa-miR-20b, hsa-miR-448, hsa-miR-429, hsa-miR-449, hsa-miR-450, hcmv-miR-UL22A, hcmv-miR-UL22A*, hcmv-miR-UL36, hcmv-miR-UL112, hcmv-miR-UL148D, hcmv-miR-US5-1, hcmv-miR-US5-2, hcmv-miR-US25-1, hcmv-miR-US25-2-5p, hcmv-miR-US25-2-3p, hcmv-miR-US33, hsa-miR-191*, hsa-miR-200a*, hsa-miR-369-5p, hsa-miR-431, hsa-miR-433, hsa-miR-329, hsa-miR-453, hsa-miR-451, hsa-miR-452, hsa-miR-452*, hsa-miR-409-5p, hsa-miR-409-3p, hsa-miR-412, hsa-miR-410, hsa-miR-376b, hsa-miR-483, hsa-miR-484, hsa-miR-485-5p, hsa-miR-485-3p, hsa-miR-486, hsa-miR-487a, kshv-miR-K12-10a, kshv-miR-K12-10b, kshv-miR-K12-11, kshv-miR-K12-1, kshv-miR-K12-2, kshv-miR-K12-9*, kshv-miR-K12-9, kshv-miR-K12-8, kshv-miR-K12-7, kshv-miR-K12-6-5p, kshv-miR-K12-6-3p, kshv-miR-K12-5, kshv-miR-K12-4-5p, kshv-miR-K12-4-3p, kshv-miR-K12-3, kshv-miR-K12-3*, hsa-miR-488, hsa-miR-489, hsa-miR-490, hsa-miR-491, hsa-miR-511, hsa-miR-146b, hsa-miR-202*, hsa-miR-202, hsa-miR-492, hsa-miR-493-5p, hsa-miR-432, hsa-miR-432*, hsa-miR-494, hsa-miR-495, hsa-miR-496, hsa-miR-193b, hsa-miR-497, hsa-miR-181d, hsa-miR-512-5p, hsa-miR-512-3p, hsa-miR-498, hsa-miR-520e, hsa-miR-515-5p, hsa-miR-515-3p, hsa-miR-519e*, hsa-miR-519e, hsa-miR-520f, hsa-miR-526c, hsa-miR-519c, hsa-miR-520a*, hsa-miR-520a, hsa-miR-526b, hsa-miR-526b*, hsa-miR-519b, hsa-miR-525, hsa-miR-525*, hsa-miR-523, hsa-miR-518f*, hsa-miR-518f, hsa-miR-520b, hsa-miR-518b, hsa-miR-526a, hsa-miR-520c, hsa-miR-518c*, hsa-miR-518c, hsa-miR-524*, hsa-miR-524, hsa-miR-517*, hsa-miR-517a, hsa-miR-519d, hsa-miR-521, hsa-miR-520d*, hsa-miR-520d, hsa-miR-517b, hsa-miR-520g, hsa-miR-516-5p, hsa-miR-516-3p, hsa-miR-518e, hsa-miR-527, hsa-miR-518a, hsa-miR-518d, hsa-miR-517c, hsa-miR-520h, hsa-miR-522, hsa-miR-519a, hsa-miR-499, hsa-miR-500, hsa-miR-501, hsa-miR-502, hsa-miR-503, hsa-miR-504, hsa-miR-505, hsa-miR-513, hsa-miR-506, hsa-miR-507, hsa-miR-508, hsa-miR-509, hsa-miR-510, hsa-miR-514, hsa-miR-532, hsa-miR-299-5p, hsa-miR-18a*, hsa-miR-455, hsa-miR-493-3p, hsa-miR-539, hsa-miR-544, hsa-miR-545, hsa-miR-487b, hsa-miR-551a, hsa-miR-552, hsa-miR-553, hsa-miR-554, hsa-miR-92b, hsa-miR-555, hsa-miR-556, hsa-miR-557, hsa-miR-558, hsa-miR-559, hsa-miR-560, hsa-miR-561, hsa-miR-562, hsa-miR-563, hsa-miR-564, hsa-miR-565, hsa-miR-566, hsa-miR-567, hsa-miR-568, hsa-miR-551b, hsa-miR-569, hsa-miR-570, hsa-miR-571, hsa-miR-572, hsa-miR-573, hsa-miR-574, hsa-miR-575, hsa-miR-576, hsa-miR-577, hsa-miR-578, hsa-miR-579, hsa-miR-580, hsa-miR-581, hsa-miR-582, hsa-miR-583, hsa-miR-584, hsa-miR-585, hsa-miR-548a, hsa-miR-586, hsa-miR-587, hsa-miR-548b, hsa-miR-588, hsa-miR-589, hsa-miR-550, hsa-miR-590, hsa-miR-591, hsa-miR-592, hsa-miR-593, hsa-miR-595, hsa-miR-596, hsa-miR-597, hsa-miR-598, hsa-miR-599, hsa-miR-600, hsa-miR-601, hsa-miR-602, hsa-miR-603, hsa-miR-604, hsa-miR-605, hsa-miR-606, hsa-miR-607, hsa-miR-608, hsa-miR-609, hsa-miR-610, hsa-miR-611, hsa-miR-612, hsa-miR-613, hsa-miR-614, hsa-miR-615, hsa-miR-616, hsa-miR-548c, hsa-miR-617, hsa-miR-618, hsa-miR-619, hsa-miR-620, hsa-miR-621, hsa-miR-622, hsa-miR-623, hsa-miR-624, hsa-miR-625, hsa-miR-626, hsa-miR-627, hsa-miR-628, hsa-miR-629, hsa-miR-630, hsa-miR-631, hsa-miR-33b, hsa-miR-632, hsa-miR-633, hsa-miR-634, hsa-miR-635, hsa-miR-636, hsa-miR-637, hsa-miR-638, hsa-miR-639, hsa-miR-640, hsa-miR-641, hsa-miR-642, hsa-miR-643, hsa-miR-644, hsa-miR-645, hsa-miR-646, hsa-miR-647, hsa-miR-648, hsa-miR-649, hsa-miR-650, hsa-miR-651, hsa-miR-652, hsa-miR-548d, hsa-miR-661, hsa-miR-662, hsa-miR-663, hsa-miR-449b, hsa-miR-653, hsa-miR-411, hsa-miR-654, hsa-miR-655, hsa-miR-656, hsa-miR-549, hsa-miR-657, hsa-miR-658, hsa-miR-659, hsa-miR-660, hsa-miR-421, hsa-miR-542-5p, hcmv-miR-US4, hcmv-miR-UL70-5p, hcmv-miR-UL70-3p, hsa-miR-363*, hsa-miR-376a*, hsa-miR-542-3p, ebv-miR-BART1-3p, hsa-miR-425-5p, ebv-miR-BART3-5p, ebv-miR-BART3-3p, ebv-miR-BART4, ebv-miR-BART5, ebv-miR-BART6-5p, ebv-miR-BART6-3p, ebv-miR-BART7, ebv-miR-BART8-5p, ebv-miR-BART8-3p, ebv-miR-BART9, ebv-miR-BART10, ebv-miR-BART11-5p, ebv-miR-BART11-3p, ebv-miR-BART12, ebv-miR-BART13, ebv-miR-BART14-5p, ebv-miR-BART14-3p, kshv-miR-K12-12, ebv-miR-BART15, ebv-miR-BART16, ebv-miR-BART17-5p, ebv-miR-BART17-3p, ebv-miR-BART18, ebv-miR-BART19, ebv-miR-BART20-5p, ebv-miR-BART20-3p, hsv1-miR-H1, hsa-miR-758, hsa-miR-671, hsa-miR-668, hsa-miR-767-5p, hsa-miR-767-3p, hsa-miR-454-5p, hsa-miR-454-3p, hsa-miR-769-5p, hsa-miR-769-3p, hsa-miR-766, hsa-miR-765, hsa-miR-768-5p, hsa-miR-768-3p, hsa-miR-770-5p, hsa-miR-802, hsa-miR-801, hsa-miR-675

[0111] Preferred single stranded oligonucleotide according to the invention are complementary to a microRNA sequence selected from the group consisting of has-miR19b, hsa-miR21, hsa-miR 122, hsa-miR 142 a7b, hsa-miR 155, hsa-miR 375.

[0112] Preferred single stranded oligonucleotide according to the invention are complementary to a microRNA sequence selected from the group consisting of hsa-miR196b and has-181a.

[0113] In one embodiment, the oligonucleotide according to the invention does not comprise a nucleobase at the 3' end that corresponds to the first 5' end nucleotide of the target microRNA.

[0114] In one embodiment, the first nucleobase of the single stranded oligonucleotide according to the invention, counting from the 3' end, is a nucleotide analogue, such as an LNA unit.

[0115] In one embodiment, the second nucleobase of the single stranded oligonucleotide according to the invention, counting from the 3' end, is a nucleotide analogue, such as an LNA unit.

[0116] In one embodiment, the ninth and/or the tenth nucleotide of the single stranded oligonucleotide according to the invention, counting from the 3' end, is a nucleotide analogue, such as an LNA unit.

[0117] In one embodiment, the ninth nucleobase of the single stranded oligonucleotide according to the invention, counting from the 3' end is a nucleotide analogue, such as an LNA unit.

[0118] In one embodiment, the tenth nucleobase of the single stranded oligonucleotide according to the invention, counting from the 3' end is a nucleotide analogue, such as an LNA unit.

[0119] In one embodiment, both the ninth and the tenth nucleobase of the single stranded oligonucleotide according to the invention, calculated from the 3' end is a nucleotide analogue, such as an LNA unit.

[0120] In one embodiment, the single stranded oligonucleotide according to the invention does not comprise a region of more than 5 consecutive DNA nucleotide units. In one embodiment, the single stranded oligonucleotide according to the invention does not comprise a region of more than 6 consecutive DNA nucleotide units. In one embodiment, the single stranded oligonucleotide according to the invention does not comprise a region of more than 7 consecutive DNA nucleotide units. In one embodiment, the single stranded oligonucleotide according to the invention does not comprise a region of more than 8 consecutive DNA nucleotide units. In one embodiment, the single stranded oligonucleotide according to the invention does not comprise a region of more than 3 consecutive DNA nucleotide units. In one embodiment, the single stranded oligonucleotide according to the invention does not comprise a region of more than 2 consecutive DNA nucleotide units.

[0121] In one embodiment, the single stranded oligonucleotide comprises at least region consisting of at least two consecutive nucleotide analogue units, such as at least two consecutive LNA units.

[0122] In one embodiment, the single stranded oligonucleotide comprises at least region consisting of at least three consecutive nucleotide analogue units, such as at least three consecutive LNA units.

[0123] In one embodiment, the single stranded oligonucleotide of the invention does not comprise a region of more than 7 consecutive nucleotide analogue units, such as LNA units. In one embodiment, the single stranded oligonucleotide of the invention does not comprise a region of more than 6 consecutive nucleotide analogue units, such as LNA units. In one embodiment, the single stranded oligonucleotide of the invention does not comprise a region of more than 5 consecutive nucleotide analogue units, such as LNA units. In one embodiment, the single stranded oligonucleotide of the invention does not comprise a region of more than 4 consecutive nucleotide analogue units, such as LNA units. In one embodiment, the single stranded oligonucleotide of the invention does not comprise a region of more than 3 consecutive nucleotide analogue units, such as LNA units. In one embodiment, the single stranded oligonucleotide of the invention does not comprise a region of more than 2 consecutive nucleotide analogue units, such as LNA units.

[0124] In one embodiment, the first or second 3' nucleobase of the single stranded oligonucleotide corresponds to the second 5' nucleotide of the microRNA sequence.

[0125] In one embodiment, nucleobase units 1 to 6 (inclusive) of the single stranded oligonucleotide as measured from the 3' end the region of the single stranded oligonucleotide are complementary to the microRNA seed region sequence.

[0126] In one embodiment, nucleobase units 1 to 7 (inclusive) of the single stranded oligonucleotide as measured from the 3' end the region of the single stranded oligonucleotide are complementary to the microRNA seed region sequence.

[0127] In one embodiment, nucleobase units 2 to 7 (inclusive) of the single stranded oligonucleotide as measured from the 3' end the region of the single stranded oligonucleotide are complementary to the microRNA seed region sequence.

[0128] In one embodiment, the single stranded oligonucleotide comprises at least one nucleotide analogue unit, such as at least one LNA unit, in a position which is within the region complementary to the miRNA seed region. The single stranded oligonucleotide may, in one embodiment comprise at between one and 6 or between 1 and 7 nucleotide analogue units, such as between 1 and 6 and 1 and 7 LNA units, in a position which is within the region complementary to the miRNA seed region.

[0129] In one embodiment, the nucleobase sequence of the single stranded oligonucleotide which is complementary to the sequence of the microRNA seed region, is selected from the group consisting of (X)Xxxxxx, (X)xXxxxx, (X)xxXxxx, (X)xxxXxx, (X)xxxxXx and (X)xxxxxX, as read in a 3'-5'direction, wherein "X" denotes a nucleotide analogue, (X) denotes an optional nucleotide analogue, such as an LNA unit, and "x" denotes a DNA or RNA nucleotide unit.

[0130] In one embodiment, the single stranded oligonucleotide comprises at least two nucleotide analogue units, such as at least two LNA units, in positions which are complementary to the miRNA seed region.

[0131] In one embodiment, the nucleobase sequence of the single stranded oligonucleotide which is complementary to the sequence of the microRNA seed region, is selected from the group consisting of (X)XXxxxx, (X)XxXxxx, (X)XxxXxx, (X)XxxxXx, (X)XxxxxX, (X)xXXxxx, (X)xXxXxx, (X)xXxxXx, (X)xXxxxX, (X)xxXXxx, (X)xxXxXx, (X)xxXxxX, (X)xxxXXx, (X)xxxXxX and (X)xxxxXX, wherein "X" denotes a nucleotide analogue, such as an LNA unit, (X) denotes an optional nucleotide analogue, such as an LNA unit, and "x" denotes a DNA or RNA nucleotide unit.

[0132] In one embodiment, the single stranded oligonucleotide comprises at least three nucleotide analogue units, such as at least three LNA units, in positions which are complementary to the miRNA seed region.

[0133] In one embodiment, the nucleobase sequence of the single stranded oligonucleotide which is complementary to the sequence of the microRNA seed region, is selected from the group consisting of (X)XXXxxx, (X)xXXXxx, (X)xxXXXx, (X)xxxXXX, (X)XXxXxx, (X)XXxxXx, (X)XXxxxX, (X)xXXxXx, (X)xXXxxX, (X)xxXXxX, (X)XxXXxx, (X)XxxXXx, (X)XxxxXX, (X)xXxXXx, (X)xXxxXX, (X)xxXxXX, (X)xXxXxX and (X)XxXxXx, wherein "X" denotes a nucleotide analogue, such as an LNA unit, (X) denotes an optional nucleotide analogue, such as an LNA unit, and "x" denotes a DNA or RNA nucleotide unit.

[0134] In one embodiment, the single stranded oligonucleotide comprises at least four nucleotide analogue units, such as at least four LNA units, in positions which are complementary to the miRNA seed region.

[0135] In one embodiment the nucleobase sequence of the single stranded oligonucleotide which is complementary to the sequence of the microRNA seed region, is selected from the group consisting of (X)xxXXX, (X)xXxXXX, (X)xXXxXX, (X))xXXXxX, (X))xXXXXx, (X)XxxXXXX, (X)XxXxXX, (X)XxXXxX, (X)XxXXx, (X)XXxxXX, (X)XXxXxX, (X)XXxXXx, (X)XXXxxX, (X)XXXxXx, and (X)XXXXxx, wherein "X" denotes a nucleotide analogue, such as an LNA unit, (X) denotes an optional nucleotide analogue, such as an LNA unit, and "x" denotes a DNA or RNA nucleotide unit.

[0136] In one embodiment, the single stranded oligonucleotide comprises at least five nucleotide analogue units, such as at least five LNA units, in positions which are complementary to the miRNA seed region.

[0137] In one embodiment, the nucleobase sequence of the single stranded oligonucleotide which is complementary to the sequence of the microRNA seed region, is selected from the group consisting of (X)xXXXXX, (X)XxXXXX, (X)XXxXXX, (X)XXXxXX, (X)XXXXxX and (X)XXXXXx, wherein "X" denotes a nucleotide analogue, such as an LNA unit, (X) denotes an optional nucleotide analogue, such as an LNA unit, and "x" denotes a DNA or RNA nucleotide unit.

[0138] In one embodiment, the single stranded oligonucleotide comprises six or seven nucleotide analogue units, such as six or seven LNA units, in positions which are complementary to the miRNA seed region.

[0139] In one embodiment, the nucleobase sequence of the single stranded oligonucleotide which is complementary to the sequence of the microRNA seed region, is selected from the group consisting of XXXXXX, XxXXXXX, XXxXXXX, XXXxXXX, XXXXxXX, XXXXXxX and XXXXXXx, wherein "X" denotes a nucleotide analogue, such as an LNA unit, such as an LNA unit, and "x" denotes a DNA or RNA nucleotide unit.

[0140] In one embodiment, the two nucleobase motif at position 7 to 8, counting from the 3' end of the single stranded oligonucleotide is selected from the group consisting of xx, XX, xX and Xx, wherein "X" denotes a nucleotide analogue, such as an LNA unit, such as an LNA unit, and "x" denotes a DNA or RNA nucleotide unit.

[0141] In one embodiment, the two nucleobase motif at position 7 to 8, counting from the 3' end of the single stranded oligonucleotide is selected from the group consisting of XX, xX and Xx, wherein "X" denotes a nucleotide analogue, such as an LNA unit, such as an LNA unit, and "x" denotes a DNA or RNA nucleotide unit.

[0142] In one embodiment, the single stranded oligonucleotide comprises at least 12 nucleobases and wherein the two nucleobase motif at position 11 to 12, counting from the 3' end of the single stranded oligonucleotide is selected from the group consisting of xx, XX, xX and Xx, wherein "X" denotes a nucleotide analogue, such as an LNA unit, such as an LNA unit, and "x" denotes a DNA or RNA nucleotide unit.

[0143] In one embodiment, the single stranded oligonucleotide comprises at least 12 nucleobases and wherein the two nucleobase motif at position 11 to 12, counting from the 3' end of the single stranded oligonucleotide is selected from the group consisting of XX, xX and Xx, wherein "X" denotes a nucleotide analogue, such as an LNA unit, such as an LNA unit, and "x" denotes a DNA or RNA nucleotide unit.

[0144] In one embodiment, the single stranded oligonucleotide comprises at least 13 nucleobases and wherein the three nucleobase motif at position 11 to 13, counting from the 3' end, is selected from the group consisting of xxx, Xxx, xXx, xxX, XXx, XxX, xXX and XXX, wherein "X" denotes a nucleotide analogue, such as an LNA unit, such as an LNA unit, and "x" denotes a DNA or RNA nucleotide unit.

[0145] In one embodiment, the three nucleobase motif at position 11 to 13, counting from the 3' end of the single stranded oligonucleotide, is selected from the group consisting of Xxx, xXx, xxX, XXx, XxX, xXX and XXX, wherein "X" denotes a nucleotide analogue, such as an LNA unit, such as an LNA unit, and "x" denotes a DNA or RNA nucleotide unit.

[0146] In one embodiment, the single stranded oligonucleotide comprises at least 14 nucleobases and wherein the four nucleobase motif at positions 11 to 14, counting from the 3' end, is selected from the group consisting of xxxx, Xxxx, xXxx, xxXx, xxxX, XXxx, XxXx, XxxX, xXXx, xXxX, xxXX, XXXx, XxXX, xXXX, XXxX and XXXX wherein "X" denotes a nucleotide analogue, such as an LNA unit, such as an LNA unit, and "x" denotes a DNA or RNA nucleotide unit.

[0147] In one embodiment, the four nucleobase motif at position 11 to 14 of the single stranded oligonucleotide, counting from the 3' end, is selected from the group consisting of Xxxx, xXxx, xxXx, xxxX, XXxx, XxXx, XxxX, xXXx, xXxX, xxXX, XXXx, XxXX, xXXX, XXxX and XXXX, wherein "X" denotes a nucleotide analogue, such as an LNA unit, and "x" denotes a DNA or RNA nucleotide unit.

[0148] In one embodiment, the single stranded oligonucleotide comprises 15 nucleobases and the five nucleobase motif at position 11 to 15, counting from the 3' end, is selected from the group consisting of Xxxxx, xXxxx, xxXxx, xxxXx, xxxxX, XXxxx, XxXxx, XxxXx, XxxxX, xXXxx, xXxXx, xXxxX, xxXXx, xxXxX, xxxXX, XXXxx, XXxxX, XxxXX, xXXXx, xxXXX, XXxXX, XxXxX, XXXXx, XXXxX, XXxXX, XxXXXX, xXXXX, and XXXXX wherein "X" denotes a nucleotide analogue, such as an LNA unit, such as an LNA unit, and "x" denotes a DNA or RNA nucleotide unit.

[0149] In one embodiment, the single stranded oligonucleotide comprises 16 nucleobases and the six nucleobase motif at positions 11 to 16, counting from the 3' end, is selected from the group consisting of Xxxxxx, xXxxxx, xxXxxx, xxxXxx, xxxxXx, xxxxxX, XXxxxx, XxXxxx, XxxXxx, XxxxXx, XxxxxX, xXXxxx, xXxXxx, xXxxXx, xXxxxX, xxXXxx, xxXxXx, xxXxxX, xxxXXx, xxxXxX, xxxxXX, XXXxxx, XXxXxx, XXxxXx, XXxxxX, XxXXxx, XxXxXx, XxXxxX, XxxXXx, XxxXxX, XxxxXX, xXXXxx, xXXxXx, xXXxxX, xXxXXx, xXxXxX, xXxxXX, xxXXXx, xxXXxX, xxXxXX, xxxXXX, XXXXxx, XXXxxX, XXxxXX, XxxXXX, xxXXXX, xXxXXX, XxXxXX, XXxXxX, XXXxXx, xXXxXX, XxXXxX, XXxXXx, xXXXxX, XxXXXx, xXXXXx, xXXXXX, XxXXXX, XXxXXX, XXXxXX, XXXXxX, XXXXXx, and XXXXXX wherein "X" denotes a nucleotide analogue, such as an LNA unit, such as an LNA unit, and "x" denotes a DNA or RNA nucleotide unit.

[0150] In one embodiment, the six nucleobase motif at positions 11 to 16 of the single stranded oligonucleotide, counting from the 3' end, is xxXxxX, wherein "X" denotes a nucleotide analogue, such as an LNA unit, such as an LNA unit, and "x" denotes a DNA or RNA nucleotide unit.

[0151] In one embodiment, the three 5' most nucleobases, is selected from the group consisting of Xxx, xXx, xxX, XXx, XxX, xXX and XXX, wherein "X" denotes a nucleotide analogue, such as an LNA unit, such as an LNA unit, and "x" denotes a DNA or RNA nucleotide unit. In one embodiment, x" denotes a DNA unit.

[0152] In one embodiment, the single stranded oligonucleotide comprises a nucleotide analogue unit, such as an LNA unit, at the 5' end.

[0153] In one embodiment, the nucleotide analogue units, such as X, are independently selected form the group consisting of: 2'-O-alkyl-RNA unit, 2'-OMe-RNA unit, 2'-amino-DNA unit, 2'-fluoro-DNA unit, LNA unit, PNA unit, HNA unit, INA unit.

[0154] In one embodiment, all the nucleobases of the single stranded oligonucleotide of the invention are nucleotide analogue units.

[0155] In one embodiment, the nucleotide analogue units, such as X, are independently selected form the group consisting of: 2'-OMe-RNA units, 2'-fluoro-DNA units, and LNA units,

[0156] In one embodiment, the single stranded oligonucleotide comprises said at least one LNA analogue unit and at least one further nucleotide analogue unit other than LNA.

[0157] In one embodiment, the non-LNA nucleotide analogue unit or units are independently selected from 2'-OMe RNA units and 2'-fluoro DNA units.

[0158] In one embodiment, the single stranded oligonucleotide consists of at least one sequence XYX or YXY, wherein X is LNA and Y is either a 2'-OMe RNA unit and 2'-fluoro DNA unit.

[0159] In one embodiment, the sequence of nucleobases of the single stranded oligonucleotide consists of alternative X and Y units.

[0160] In one embodiment, the single stranded oligonucleotide comprises alternating LNA and DNA units (Xx) or (xX).

[0161] In one embodiment, the single stranded oligonucleotide comprises a motif of alternating LNA followed by 2 DNA units (Xxx), xXx or xxX.

[0162] In one embodiment, at least one of the DNA or non-LNA nucleotide analogue units are replaced with a LNA nucleobase in a position selected from the positions identified as LNA nucleobase units in any one of the embodiments referred to above.

[0163] In one embodiment, "X" donates an LNA unit.

[0164] In one embodiment, the single stranded oligonucleotide comprises at least 2 nucleotide analogue units, such as at least 3 nucleotide analogue units, such as at least 4 nucleotide analogue units, such as at least 5 nucleotide analogue units, such as at least 6 nucleotide analogue units, such as at least 7 nucleotide analogue units, such as at least 8 nucleotide analogue units, such as at least 9 nucleotide analogue units, such as at least 10 nucleotide analogue units.

[0165] In one embodiment, the single stranded oligonucleotide comprises at least 2 LNA units, such as at least 3 LNA units, such as at least 4 LNA units, such as at least 5 LNA units, such as at least 6 LNA units, such as at least 7 LNA units, such as at least 8 LNA units, such as at least 9 LNA units, such as at least 10 LNA units.

[0166] In one embodiment wherein at least one of the nucleotide analogues, such as LNA units, is either cytosine or guanine, such as between 1-10 of the of the nucleotide analogues, such as LNA units, is either cytosine or guanine, such as 2, 3, 4, 5, 6, 7, 8, or 9 of the of the nucleotide analogues, such as LNA units, is either cytosine or guanine.

[0167] In one embodiment at least two of the nucleotide analogues such as LNA units is either cytosine or guanine. In one embodiment at least three of the nucleotide analogues such as LNA units is either cytosine or guanine. In one embodiment at least four of the nucleotide analogues such as LNA units is either cytosine or guanine. In one embodiment at least five of the nucleotide analogues such as LNA units is either cytosine or guanine. In one embodiment at least six of the nucleotide analogues such as LNA units is either cytosine or guanine. In one embodiment at least seven of the nucleotide analogues such as LNA units is either cytosine or guanine. In one embodiment at least eight of the nucleotide analogues such as LNA units is either cytosine or guanine.

[0168] In a preferred embodiment the nucleotide analogues have a higher thermal duplex stability a complementary RNA nucleotide than the binding affinity of an equivalent DNA nucleotide to said complementary RNA nucleotide.

[0169] In one embodiment, the nucleotide analogues confer enhanced serum stability to the single stranded oligonucleotide.

[0170] In one embodiment, the single stranded oligonucleotide forms an A-helix conformation with a complementary single stranded RNA molecule.

[0171] A duplex between two RNA molecules typically exists in an A-form conformation, where as a duplex between two DNA molecules typically exits in a B-form conformation. A duplex between a DNA and RNA molecule typically exists in a intermediate conformation (A/B form). The use of nucleotide analogues, such as beta-D-oxy LNA can be used to promote a more A form like conformation. Standard circular dichromisms (CD) or NMR analysis is used to determine the form of duplexes between the oligonucleotides of the invention and complementary RNA molecules.

[0172] As recruitment by the RISC complex is thought to be dependant upon the specific structural conformation of the miRNA/mRNA target, the oligonucleotides according to the present invention may, in one embodiment form a A/B-form duplex with a complementary RNA molecule.

[0173] However, we have also determined that the use of nucleotide analogues which promote the A-form structure can also be effective, such as the alpha-L isomer of LNA.

[0174] In one embodiment, the single stranded oligonucleotide forms an A/B-form conformation with a complementary single stranded RNA molecule.

[0175] In one embodiment, the single stranded oligonucleotide forms an A-form conformation with a complementary single stranded RNA molecule.

[0176] In one embodiment, the single stranded oligonucleotide according to the invention does not mediate RNAseH based cleavage of a complementary single stranded RNA molecule. Typically a stretch of at least 5 (typically not effective for RNAse H recruitment), more preferably at least 6, more preferably at least 7 or 8 consecutive DNA nucleobases (or alternative nucleobases which can recruit RNAseH, such as alpha L-amino LNA) are required in order for an oligonucleotide to be effective in recruitment of RNAseH.

[0177] EP 1 222 309 provides in vitro methods for determining RNaseH activity, which may be used to determine the ability to recruit RNaseH. A compound is deemed capable of recruiting RNase H if, when provided with the complementary RNA target, it has an initial rate, as measured in pmol/l/min, of at least 1%, such as at least 5%, such as at least 10% or less than 20% of the equivalent DNA only oligonucleotide, with no 2' substitutions, with phosphorothiote linkage groups between all nucleotides in the oligonucleotide, using the methodology provided by Example 91-95 of EP 1 222 309.

[0178] A compound is deemed essentially incapable of recruiting RNaseH if, when provided with the complementary RNA target, and RNaseH, the RNaseH initial rate, as measured in pmol/l/min, is less than 1%, such as less than 5%, such as less than 10% or less than 20% of the initial rate determined using the equivalent DNA only oligonucleotide, with no 2' substitutions, with phosphiothiote linkage groups between all nucleotides in the oligonucleotide, using the methodology provided by Example 91-95 of EP 1 222 309.

[0179] In a highly preferred embodiment, the single stranded oligonucleotide of the invention is capable of forming a duplex with a complementary single stranded RNA nucleic acid molecule (typically of about the same length of said single stranded oligonucleotide) with phosphodiester internucleoside linkages, wherein the duplex has a T.sub.m of at least about 60.degree. C., indeed it is preferred that the single stranded oligonucleotide is capable of forming a duplex with a complementary single stranded RNA nucleic acid molecule with phosphodiester internucleoside linkages, wherein the duplex has a T.sub.m of between about 70.degree. C. to about 95.degree. C., such as a T.sub.m of between about 70.degree. C. to about 90.degree. C., such as between about 70.degree. C. and about 85.degree. C.

[0180] In one embodiment, the single stranded oligonucleotide is capable of forming a duplex with a complementary single stranded DNA nucleic acid molecule with phosphodiester internucleoside linkages, wherein the duplex has a T.sub.m of between about 50.degree. C. to about 95.degree. C., such as between about 50.degree. C. to about 90.degree. C., such as at least about 55.degree. C., such as at least about 60.degree. C., or no more than about 95.degree. C.

[0181] The single stranded oligonucleotide may, in one embodiment have a length of between 14-16 nucleobases, including 15 nucleobases.

[0182] In one embodiment, the LNA unit or units are independently selected from the group consisting of oxy-LNA, thio-LNA, and amino-LNA, in either of the D-.beta. and L-.alpha. configurations or combinations thereof.

[0183] In one specific embodiment the LNA units may be an ENA nucleobase.

[0184] In one the embodiment the LNA units are beta D oxy-LNA.

[0185] In one embodiment the LNA units are in alpha-L amino LNA.

[0186] In a preferable embodiment, the single stranded oligonucleotide comprises between 3 and 17 LNA units.

[0187] In one embodiment, the single stranded oligonucleotide comprises at least one internucleoside linkage group which differs from phosphate.

[0188] In one embodiment, the single stranded oligonucleotide comprises at least one phosphorothioate internucleoside linkage.

[0189] In one embodiment, the single stranded oligonucleotide comprises phosphodiester and phosphorothioate linkages.

[0190] In one embodiment, the all the internucleoside linkages are phosphorothioate linkages.

[0191] In one embodiment, the single stranded oligonucleotide comprises at least one phosphodiester internucleoside linkage.

[0192] In one embodiment, all the internucleoside linkages of the single stranded oligonucleotide of the invention are phosphodiester linkages.

[0193] In one embodiment, pharmaceutical composition according to the invention comprises a carrier such as saline or buffered saline.

[0194] In one embodiment, the method for the synthesis of a single stranded oligonucleotide targeted against a human microRNA, is performed in the 3' to 5' direction a-f.

[0195] The method for the synthesis of the single stranded oligonucleotide according to the invention may be performed using standard solid phase oligonucleotide synthesis.

[0196] Definitions

[0197] The term `nucleobase` refers to nucleotides, such as DNA and RNA, and nucleotide analogues.

[0198] The term "oligonucleotide" (or simply "oligo") refers, in the context of the present invention, to a molecule formed by covalent linkage of two or more nucleobases. When used in the context of the oligonucleotide of the invention (also referred to the single stranded oligonucleotide), the term "oligonucleotide" may have, in one embodiment, for example between 8-26 nucleobases, such as between 10 to 26 nucleobases such between 12 to 26 nucleobases. In a preferable embodiment, as detailed herein, the oligonucleotide of the invention has a length of between 8-17 nucleobases, such as between 20-27 nucleobases such as between 8-16 nucleobases, such as between 12-15 nucleobases,

[0199] In such an embodiment, the oligonucleotide of the invention may have a length of 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleobases.

[0200] It will be recognised that for shorter oligonucleotides it may be necessary to increase the proportion of (high affinity) nucleotide analogues, such as LNA. Therefore in one embodiment at least about 30% of the nucleobases are nucleotide analogues, such as at least about 33%, such as at least about 40%, or at least about 50% or at least about 60%, such as at least about 66%, such as at least about 70%, such as at least about 80%, or at least about 90%. It will also be apparent that the oligonucleotide may comprise of a nucleobase sequence which consists of only nucleotide analogue sequences.

[0201] Herein, the term "nitrogenous base" is intended to cover purines and pyrimidines, such as the DNA nucleobases A, C, T and G, the RNA nucleobases A, C, U and G, as well as non-DNA/RNA nucleobases, such as 5-methylcytosine (.sup.MeC), isocytosine, pseudoisocytosine, 5-bromouracil, 5-propynyluracil, 5-propyny-6-fluoroluracil, 5-methylthiazoleuracil, 6-aminopurine, 2-aminopurine, inosine, 2,6-diaminopurine, 7-propyne-7-deazaadenine, 7-propyne-7-deazaguanine and 2-chloro-6-aminopurine, in particular .sup.MeC. It will be understood that the actual selection of the non-DNA/RNA nucleobase will depend on the corresponding (or matching) nucleotide present in the microRNA strand which the oligonucleotide is intended to target. For example, in case the corresponding nucleotide is G it will normally be necessary to select a non-DNA/RNA nucleobase which is capable of establishing hydrogen bonds to G. In this specific case, where the corresponding nucleotide is G, a typical example of a preferred non-DNA/RNA nucleobase is .sup.MeC.

[0202] The term "internucleoside linkage group" is intended to mean a group capable of covalently coupling together two nucleobases, such as between DNA units, between DNA units and nucleotide analogues, between two non-LNA units, between a non-LNA unit and an LNA unit, and between two LNA units, etc. Preferred examples include phosphate, phosphodiester groups and phosphorothioate groups.

[0203] The internucleoside linkage may be selected form the group consisting of: --O--P(O).sub.2--O--, --O--P(O,S)--O--, --O--P(S).sub.2--O--, --S--P(O).sub.2--O--, --S--P(O,S)--O--, --S--P(S).sub.2--O--, --O--P(O).sub.2--S--, --O--P(O,S)--S--, --S--P(O).sub.2--S--, --O--PO(R.sup.H)--O--, O--PO(OCH.sub.3)--O--, --O--PO(NR.sup.H)--O--, --O--PO(OCH.sub.2CH.sub.2S--R)--O--, --O--PO(BH.sub.3)--O--, --O--PO(NHR.sup.H)--O--, --O--P(O).sub.2--NR.sup.H--, --NR.sup.H--P(O).sub.2--O--, --NR.sup.H--CO--O--, --NR.sup.H--CO--NR.sup.H, and/or the internucleoside linkage may be selected form the group consisting of: --O--CO--O--, --O--CO--NR.sup.H--, --NR.sup.H--CO--CH.sub.2--, --O--CH.sub.2--CO--NR.sup.H--, --O--CH.sub.2--CH.sub.2--NR.sup.H--, --CO--NR.sup.H--CH.sub.2--, --CH.sub.2--NR.sup.H--CO--, --O--CH.sub.2--CH.sub.2--S--, --S--CH.sub.2--CH.sub.2--O--, --S--CH.sub.2--CH.sub.2--S--, --CH.sub.2--SO.sub.2--CH.sub.2--, --CH.sub.2--CO--NR.sup.H--, --O--CH.sub.2--CH.sub.2--NR.sup.H--CO--, --CH.sub.2--NCH.sub.3--O--CH.sub.2--, where R.sup.H is selected from hydrogen and C.sub.1-4-alkyl. Suitably, in some embodiments, sulphur (S) containing internucleoside linkages as provided above may be preferred

[0204] The terms "corresponding to" and "corresponds to" as used in the context of oligonucleotides refers to the comparison between either a nucleobase sequence of the compound of the invention, and the reverse complement thereof, or in one embodiment between a nucleobase sequence and an equivalent (identical) nucleobase sequence which may for example comprise other nucleobases but retains the same base sequence, or complement thereof. Nucleotide analogues are compared directly to their equivalent or corresponding natural nucleotides. Sequences which form the reverse complement of a sequence are referred to as the complement sequence of the sequence.

[0205] When referring to the length of a nucleotide molecule as referred to herein, the length corresponds to the number of monomer units, i.e. nucleobases, irrespective as to whether those monomer units are nucleotides or nucleotide analogues. With respect to nucleobases, the terms monomer and unit are used interchangeably herein.

[0206] It should be understood that when the term "about" is used in the context of specific values or ranges of values, the disclosure should be read as to include the specific value or range referred to.

[0207] Preferred DNA analogues includes DNA analogues where the 2'-H group is substituted with a substitution other than --OH (RNA) e.g. by substitution with --O--CH.sub.3, --O--CH.sub.2--CH.sub.2--O--CH.sub.3, --O--CH.sub.2--CH.sub.2--CH.sub.2--NH.sub.2, --O--CH.sub.2--CH.sub.2--CH.sub.2--OH or --F.

[0208] Preferred RNA analogues includes RNA analogues which have been modified in its 2'-OH group, e.g. by substitution with a group other than --H (DNA), for example --O--CH.sub.3, --O--CH.sub.2--CH.sub.2--O--CH.sub.3, --O--CH.sub.2--CH.sub.2--CH.sub.2--NH.sub.2, --O--CH.sub.2--CH.sub.2--CH.sub.2--OH or --F.

[0209] In one embodiment the nucleotide analogue is "ENA".

[0210] When used in the present context, the terms "LNA unit", "LNA monomer", "LNA residue", "locked nucleic acid unit", "locked nucleic acid monomer" or "locked nucleic acid residue", refer to a bicyclic nucleoside analogue. LNA units are described in inter alia WO 99/14226, WO 00/56746, WO 00/56748, WO 01/25248, WO 02/28875, WO 03/006475 and WO 03/095467. The LNA unit may also be defined with respect to its chemical formula. Thus, an "LNA unit", as used herein, has the chemical structure shown in Scheme 1 below:

##STR00001##

[0211] wherein [0212] X is selected from the group consisting of O, S and NR.sup.H, where R.sup.H is H or C.sub.1-4-alkyl; [0213] Y is (--CH.sub.2).sub.r, where r is an integer of 1-4; and [0214] B is a nitrogenous base.

[0215] When referring to substituting a DNA unit by its corresponding LNA unit in the context of the present invention, the term "corresponding LNA unit" is intended to mean that the DNA unit has been replaced by an LNA unit containing the same nitrogenous base as the DNA unit that it has replaced, e.g. the corresponding LNA unit of a DNA unit containing the nitrogenous base A also contains the nitrogenous base A. The exception is that when a DNA unit contains the base C, the corresponding LNA unit may contain the base C or the base .sup.MeC, preferably .sup.MeC.

[0216] Herein, the term "non-LNA unit" refers to a nucleoside different from an LNA-unit, i.e. the term "non-LNA unit" includes a DNA unit as well as an RNA unit. A preferred non-LNA unit is a DNA unit.

[0217] The terms "unit", "residue" and "monomer" are used interchangeably herein.

[0218] The term "at least one" encompasses an integer larger than or equal to 1, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 and so forth.

[0219] The terms "a" and "an" as used about a nucleotide, an agent, an LNA unit, etc., is intended to mean one or more. In particular, the expression "a component (such as a nucleotide, an agent, an LNA unit, or the like) selected from the group consisting of . . . " is intended to mean that one or more of the cited components may be selected. Thus, expressions like "a component selected from the group consisting of A, B and C" is intended to include all combinations of A, B and C, i.e. A, B, C, A+B, A+C, B+C and A+B+C.

[0220] The term "thio-LNA unit" refers to an LNA unit in which X in Scheme 1 is S. A thio-LNA unit can be in both the beta-D form and in the alpha-L form. Generally, the beta-D form of the thio-LNA unit is preferred. The beta-D-form and alpha-L-form of a thio-LNA unit are shown in Scheme 3 as compounds 3A and 3B, respectively.

[0221] The term "amino-LNA unit" refers to an LNA unit in which X in Scheme 1 is NH or NR.sup.H, where R.sup.H is hydrogen or C.sub.1-4-alkyl. An amino-LNA unit can be in both the beta-D form and in the alpha-L form. Generally, the beta-D form of the amino-LNA unit is preferred. The beta-D-form and alpha-L-form of an amino-LNA unit are shown in Scheme 4 as compounds 4A and 4B, respectively.

[0222] The term "oxy-LNA unit" refers to an LNA unit in which X in Scheme 1 is O. An Oxy-LNA unit can be in both the beta-D form and in the alpha-L form. Generally, the beta-D form of the oxy-LNA unit is preferred. The beta-D form and the alpha-L form of an oxy-LNA unit are shown in Scheme 5 as compounds 5A and 5B, respectively.

[0223] In the present context, the term "C.sub.1-6-alkyl" is intended to mean a linear or branched saturated hydrocarbon chain wherein the longest chains has from one to six carbon atoms, such as methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, pentyl, isopentyl, neopentyl and hexyl. A branched hydrocarbon chain is intended to mean a C.sub.1-6-alkyl substituted at any carbon with a hydrocarbon chain.

[0224] In the present context, the term "C.sub.1-4-alkyl" is intended to mean a linear or branched saturated hydrocarbon chain wherein the longest chains has from one to four carbon atoms, such as methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl and tert-butyl. A branched hydrocarbon chain is intended to mean a C.sub.1-4-alkyl substituted at any carbon with a hydrocarbon chain.

[0225] When used herein the term "C.sub.1-6-alkoxy" is intended to mean C.sub.1-6-alkyl-oxy, such as methoxy, ethoxy, n-propoxy, isopropoxy, n-butoxy, isobutoxy, sec-butoxy, tert-butoxy, pentoxy, isopentoxy, neopentoxy and hexoxy.

[0226] In the present context, the term "C.sub.2-6-alkenyl" is intended to mean a linear or branched hydrocarbon group having from two to six carbon atoms and containing one or more double bonds. Illustrative examples of C.sub.2-6-alkenyl groups include allyl, homo-allyl, vinyl, crotyl, butenyl, butadienyl, pentenyl, pentadienyl, hexenyl and hexadienyl. The position of the unsaturation (the double bond) may be at any position along the carbon chain.

[0227] In the present context the term "C.sub.2-6-alkynyl" is intended to mean linear or branched hydrocarbon groups containing from two to six carbon atoms and containing one or more triple bonds. Illustrative examples of C.sub.2-6-alkynyl groups include acetylene, propynyl, butynyl, pentynyl and hexynyl. The position of unsaturation (the triple bond) may be at any position along the carbon chain. More than one bond may be unsaturated such that the "C.sub.2-6-alkynyl" is a di-yne or enedi-yne as is known to the person skilled in the art.

[0228] As used herein, "hybridisation" means hydrogen bonding, which may be Watson-Crick, Hoogsteen, reversed Hoogsteen hydrogen bonding, etc., between complementary nucleoside or nucleotide bases. The four nucleobases commonly found in DNA are G, A, T and C of which G pairs with C, and A pairs with T. In RNA T is replaced with uracil (U), which then pairs with A. The chemical groups in the nucleobases that participate in standard duplex formation constitute the Watson-Crick face. Hoogsteen showed a couple of years later that the purine nucleobases (G and A) in addition to their Watson-Crick face have a Hoogsteen face that can be recognised from the outside of a duplex, and used to bind pyrimidine oligonucleotides via hydrogen bonding, thereby forming a triple helix structure.

[0229] In the context of the present invention "complementary" refers to the capacity for precise pairing between two nucleotides sequences with one another. For example, if a nucleotide at a certain position of an oligonucleotide is capable of hydrogen bonding with a nucleotide at the corresponding position of a DNA or RNA molecule, then the oligonucleotide and the DNA or RNA are considered to be complementary to each other at that position. The DNA or RNA strand are considered complementary to each other when a sufficient number of nucleotides in the oligonucleotide can form hydrogen bonds with corresponding nucleotides in the target DNA or RNA to enable the formation of a stable complex. To be stable in vitro or in vivo the sequence of an oligonucleotide need not be 100% complementary to its target microRNA. The terms "complementary" and "specifically hybridisable" thus imply that the oligonucleotide binds sufficiently strong and specific to the target molecule to provide the desired interference with the normal function of the target whilst leaving the function of non-target RNAs unaffected.

[0230] In a preferred example the oligonucleotide of the invention is 100% complementary to a human microRNA sequence, such as one of the microRNA sequences referred to herein.

[0231] In a preferred example, the oligonucleotide of the invention comprises a contiguous sequence which is 100% complementary to the seed region of the human microRNA sequence.

[0232] MicroRNAs are short, non-coding RNAs derived from endogenous genes that act as post-transcriptional regulators of gene expression. They are processed from longer (ca 70-80 nt) hairpin-like precursors termed pre-miRNAs by the RNAse III enzyme Dicer. MicroRNAs assemble in ribonucleoprotein complexes termed miRNPs and recognize their target sites by antisense complementarity thereby mediating down-regulation of their target genes. Near-perfect or perfect complementarity between the miRNA and its target site results in target mRNA cleavage, whereas limited complementarity between the microRNA and the target site results in translational inhibition of the target gene.

[0233] The term "microRNA" or "miRNA", in the context of the present invention, means an RNA oligonucleotide consisting of between 18 to 25 nucleotides in length. In functional terms miRNAs are typically regulatory endogenous RNA molecules.

[0234] The terms "target microRNA" or "target miRNA" refer to a microRNA with a biological role in human disease, e.g. an upregulated, oncogenic miRNA or a tumor suppressor miRNA in cancer, thereby being a target for therapeutic intervention of the disease in question.

[0235] The terms "target gene" or "target mRNA" refer to regulatory mRNA targets of microRNAs, in which said "target gene" or "target mRNA" is regulated post-transcriptionally by the microRNA based on near-perfect or perfect complementarity between the miRNA and its target site resulting in target mRNA cleavage; or limited complementarity, often conferred to complementarity between the so-called seed sequence (nucleotides 2-7 of the miRNA) and the target site resulting in translational inhibition of the target mRNA.

[0236] In the context of the present invention the oligonucleotide is single stranded, this refers to the situation where the oligonucleotide is in the absence of a complementary oligonucleotide--i.e. it is not a double stranded oligonucleotide complex, such as an siRNA. In one embodiment, the composition according to the invention does not comprise a further oligonucleotide which has a region of complementarity with the single stranded oligonucleotide of five or more consecutive nucleobases, such as eight or more, or 12 or more of more consecutive nucleobases. It is considered that the further oligonucleotide is not covalently linked to the single stranded oligonucleotide.

[0237] Modification of Nucleotides in Positions 3 to 8, Counting from the 3' End

[0238] In the following embodiments which refer to the modification of nucleotides in positions 3 to 8, counting from the 3' end, the LNA units may be replaced with other nucleotide analogues, such as those referred to herein. "X" may, therefore be selected from the group consisting of 2'-O-alkyl-RNA unit, 2'-OMe-RNA unit, 2'-amino-DNA unit, 2'-fluoro-DNA unit, LNA unit, PNA unit, HNA unit, INA unit. "x" is preferably DNA or RNA, most preferably DNA.

[0239] In an interesting embodiment of the invention, the oligonucleotides of the invention are modified in positions 3 to 8, counting from the 3' end. The design of this sequence may be defined by the number of non-LNA units present or by the number of LNA units present. In a preferred embodiment of the former, at least one, such as one, of the nucleotides in positions three to eight, counting from the 3' end, is a non-LNA unit. In another embodiment, at least two, such as two, of the nucleotides in positions three to eight, counting from the 3' end, are non-LNA units. In yet another embodiment, at least three, such as three, of the nucleotides in positions three to eight, counting from the 3' end, are non-LNA units. In still another embodiment, at least four, such as four, of the nucleotides in positions three to eight, counting from the 3' end, are non-LNA units. In a further embodiment, at least five, such as five, of the nucleotides in positions three to eight, counting from the 3' end, are non-LNA units. In yet a further embodiment, all six nucleotides in positions three to eight, counting from the 3' end, are non-LNA units. In a preferred embodiment, said non-LNA unit is a DNA unit.

[0240] Alternatively defined, in a preferred embodiment, the oligonucleotide according to the invention comprises at least one LNA unit in positions three to eight, counting from the 3' end. In an embodiment thereof, the oligonucleotide according to the present invention comprises one LNA unit in positions three to eight, counting from the 3' end. The substitution pattern for the nucleotides in positions three to eight, counting from the 3' end, may be selected from the group consisting of Xxxxxx, xXxxxx, xxXxxx, xxxXxx, xxxxXx and xxxxxX, wherein "X" denotes an LNA unit and "x" denotes a non-LNA unit.

[0241] In another embodiment, the oligonucleotide according to the present invention comprises at least two LNA units in positions three to eight, counting from the 3' end. In an embodiment thereof, the oligonucleotide according to the present invention comprises two LNA units in positions three to eight, counting from the 3' end. The substitution pattern for the nucleotides in positions three to eight, counting from the 3' end, may be selected from the group consisting of XXxxxx, XxXxxx, XxxXxx, XxxxXx, XxxxxX, xXXxxx, xXxXxx, xXxxXx, xXxxxX, xxXXxx, xxXxXx, xxXxxX, xxxXXx, xxxXxX and xxxxXX, wherein "X" denotes an LNA unit and "x" denotes a non-LNA unit. In a preferred embodiment, the substitution pattern for the nucleotides in positions three to eight, counting from the 3' end, is selected from the group consisting of XxXxxx, XxxXxx, XxxxXx, XxxxxX, xXxXxx, xXxxXx, xXxxxX, xxXxXx, xxXxxX and xxxXxX, wherein "X" denotes an LNA unit and "x" denotes a non-LNA unit. In a more preferred embodiment, the substitution pattern for the nucleotides in positions three to eight, counting from the 3' end, is selected from the group consisting of xXxXxx, xXxxXx, xXxxxX, xxXxXx, xxXxxX and xxxXxX, wherein "X" denotes an LNA unit and "x" denotes a non-LNA unit. In an even more preferred embodiment, the substitution pattern for the nucleotides in positions three to eight, counting from the 3' end, is selected from the group consisting of xXxXxx, xXxxXx and xxXxXx, wherein "X" denotes an LNA unit and "x" denotes a non-LNA unit. In a most preferred embodiment, the substitution pattern for the nucleotides in positions three to eight, counting from the 3' end, is xXxXxx, wherein "X" denotes an LNA unit and "x" denotes a non-LNA unit.

[0242] In yet another embodiment, the oligonucleotide according to the present invention comprises at least three LNA units in positions three to eight, counting from the 3' end. In an embodiment thereof, the oligonucleotide according to the present invention comprises three LNA units in positions three to eight, counting from the 3' end. The substitution pattern for the nucleotides in positions three to eight, counting from the 3' end, may be selected from the group consisting of XXXxxx, xXXXxx, xxXXXx, xxxXXX, XXxXxx, XXxxXx, XXxxxX, xXXxXx, xXXxxX, xxXXxX, XxXXxx, XxxXXx, XxxxXX, xXxXXx, xXxxXX, xxXxXX, xXxXxX and XxXxXx, wherein "X" denotes an LNA unit and "x" denotes a non-LNA unit. In a preferred embodiment, the substitution pattern for the nucleotides in positions three to eight, counting from the 3' end, is selected from the group consisting of XXxXxx, XXxxXx, XXxxxX, xXXxXx, xXXxxX, xxXXxX, XxXXxx, XxxXXx, XxxxXX, xXxXXx, xXxxXX, xxXxXX, xXxXxX and XxXxXx, wherein "X" denotes an LNA unit and "x" denotes a non-LNA unit. In a more preferred embodiment, the substitution pattern for the nucleotides in positions three to eight, counting from the 3' end, is selected from the group consisting of xXXxXx, xXXxxX, xxXXxX, xXxXXx, xXxxXX, xxXxXX and xXxXxX, wherein "X" denotes an LNA unit and "x" denotes a non-LNA unit. In an even more preferred embodiment, the substitution pattern for the nucleotides in positions three to eight, counting from the 3' end, is xXxXxX or XxXxXx, wherein "X" denotes an LNA unit and "x" denotes a non-LNA unit. In a most preferred embodiment, the substitution pattern for the nucleotides in positions three to eight, counting from the 3' end, is xXxXxX, wherein "X" denotes an LNA unit and "x" denotes a non-LNA unit.

[0243] In a further embodiment, the oligonucleotide according to the present invention comprises at least four LNA units in positions three to eight, counting from the 3' end. In an embodiment thereof, the oligonucleotide according to the present invention comprises four LNA units in positions three to eight, counting from the 3' end. The substitution pattern for the nucleotides in positions three to eight, counting from the 3' end, may be selected from the group consisting of xxXXXX, xXxXXX, xXXxXX, xXXXxX, xXXXXx, XxxXXX, XxXxXX, XxXXxX, XxXXXx, XXxxXX, XXxXxX, XXxXXx, XXXxxX, XXXxXx and XXXXxx, wherein "X" denotes an LNA unit and "x" denotes a non-LNA unit.

[0244] In yet a further embodiment, the oligonucleotide according to the present invention comprises at least five LNA units in positions three to eight, counting from the 3' end. In an embodiment thereof, the oligonucleotide according to the present invention comprises five LNA units in positions three to eight, counting from the 3' end. The substitution pattern for the nucleotides in positions three to eight, counting from the 3' end, may be selected from the group consisting of xXXXXX, XxXXXX, XXxXXX, XXXxXX, XXXXxX and XXXXXx, wherein "X" denotes an LNA unit and "x" denotes a non-LNA unit.

[0245] Preferably, the oligonucleotide according to the present invention comprises one or two LNA units in positions three to eight, counting from the 3' end. This is considered advantageous for the stability of the A-helix formed by the oligo:microRNA duplex, a duplex resembling an RNA:RNA duplex in structure.

[0246] In a preferred embodiment, said non-LNA unit is a DNA unit.

[0247] Variation of the Length of the Oligonucleotides

[0248] The length of the oligonucleotides of the invention need not match the length of the target microRNAs exactly. Accordingly, the length of the oligonucleotides of the invention may vary. Indeed it is considered advantageous to have short oligonucleotides, such as between 10-17 or 10-16 nucleobases.

[0249] In one embodiment, the oligonucleotide according to the present has a length of from 8 to 24 nucleotides, such as 10 to 24, between 12 to 24 nucleotides, such as a length of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23 or 24 nucleotides, preferably a length of from 10-22, such as between 12 to 22 nucleotides, such as a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22 nucleotides, more preferably a length of from 10-20, such as between 12 to 20 nucleotides, such as a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 nucleotides, even more preferably a length of from 10 to 19, such as between 12 to 19 nucleotides, such as a length of 10, 11, 12, 13, 14, 15, 16, 17, 18 or 19 nucleotides, e.g. a length of from 10 to 18, such as between 12 to 18 nucleotides, such as a length of 10, 11, 12, 13, 14, 15, 16, 17 or 18 nucleotides, more preferably a length of from 10-17, such as from 12 to 17 nucleotides, such as a length of 10, 11, 12, 13, 14, 15, 16 or 17 nucleotides, most preferably a length of from 10 to 16, such as between 12 to 16 nucleotides, such as a length of 10, 11, 12, 13, 14, 15 or 16 nucleotides.

[0250] Modification of Nucleotides from Position 11, Counting from the 3' End, to the 5' End

[0251] The substitution pattern for the nucleotides from position 11, counting from the 3' end, to the 5' end may include nucleotide analogue units (such as LNA) or it may not. In a preferred embodiment, the oligonucleotide according to the present invention comprises at least one nucleotide analogue unit (such as LNA), such as one nucleotide analogue unit, from position 11, counting from the 3' end, to the 5' end. In another preferred embodiment, the oligonucleotide according to the present invention comprises at least two nucleotide analogue units, such as LNA units, such as two nucleotide analogue units, from position 11, counting from the 3' end, to the 5' end.

[0252] In the following embodiments which refer to the modification of nucleotides in the nucleobases from position 11 to the 5' end of the oligonucleotide, the LNA units may be replaced with other nucleotide analogues, such as those referred to herein. "X" may, therefore be selected from the group consisting of 2'-O-alkyl-RNA unit, 2'-OMe-RNA unit, 2'-amino-DNA unit, 2'-fluoro-DNA unit, LNA unit, PNA unit, HNA unit, INA unit. "x" is preferably DNA or RNA, most preferably DNA.

[0253] In one embodiment, the oligonucleotide according to the present invention has the following substitution pattern, which is repeated from nucleotide eleven, counting from the 3' end, to the 5' end: xXxX or XxXx, wherein "X" denotes an LNA unit and "x" denotes a non-LNA unit. In another embodiment, the oligonucleotide according to the present invention has the following substitution pattern, which is repeated from nucleotide eleven, counting from the 3' end, to the 5' end: XxxXxx, xXxxXx or xxXxxX, wherein "X" denotes an LNA unit and "x" denotes a non-LNA unit. In yet another embodiment, the oligonucleotide according to the present invention has the following substitution pattern, which is repeated from nucleotide eleven, counting from the 3' end, to the 5' end: XxxxXxxx, xXxxxXxx, xxXxxxXx or xxxXxxxX, wherein "X" denotes an LNA unit and "x" denotes a non-LNA unit.

[0254] The specific substitution pattern for the nucleotides from position 11, counting from the 3' end, to the 5' end depends on the number of nucleotides in the oligonucleotides according to the present invention. In a preferred embodiment, the oligonucleotide according to the present invention contains 12 nucleotides and the substitution pattern for positions 11 to 12, counting from the 3' end, is selected from the group consisting of xX and Xx, wherein "X" denotes an LNA unit and "x" denotes a non-LNA unit. In a more preferred embodiment thereof, the substitution pattern for positions 11 to 12, counting from the 3' end, is xX, wherein "X" denotes an LNA unit and "x" denotes a non-LNA unit. Alternatively, no LNA units are present in positions 11 to 12, counting from the 3' end, i.e. the substitution pattern is xx.

[0255] In another preferred embodiment, the oligonucleotide according to the present invention contains 13 nucleotides and the substitution pattern for positions 11 to 13, counting from the 3' end, is selected from the group consisting of Xxx, xXx, xxX, XXx, XxX, xXX and XXX, wherein "X" denotes an LNA unit and "x" denotes a non-LNA unit. In a more preferred embodiment thereof, the substitution pattern for positions 11 to 13, counting from the 3' end, is selected from the group consisting of xXx, xxX and xXX, wherein "X" denotes an LNA unit and "x" denotes a non-LNA unit. In a most preferred embodiment thereof, the substitution pattern for positions 11 to 13, counting from the 3' end, is xxX, wherein "X" denotes an LNA unit and "x" denotes a non-LNA unit. Alternatively, no LNA units are present in positions 11 to 13, counting from the 3' end, i.e. the substitution pattern is xxx.

[0256] In yet another preferred embodiment, the oligonucleotide according to the present invention contains 14 nucleotides and the substitution pattern for positions 11 to 14, counting from the 3' end, is selected from the group consisting of Xxxx, xXxx, xxXx, xxxX, XXxx, XxXx, XxxX, xXXx, xXxX and xxXX, wherein "X" denotes an LNA unit and "x" denotes a non-LNA unit. In a preferred embodiment thereof, the substitution pattern for positions 11 to 14, counting from the 3' end, is selected from the group consisting of xXxx, xxXx, xxxX, xXxX and xxXX, wherein "X" denotes an LNA unit and "x" denotes a non-LNA unit. In a more preferred embodiment thereof, the substitution pattern for positions 11 to 14, counting from the 3' end, is xXxX, wherein "X" denotes an LNA unit and "x" denotes a non-LNA unit. Alternatively, no LNA units are present in positions 11 to 14, counting from the 3' end, i.e. the substitution pattern is xxxx

[0257] In a further preferred embodiment, the oligonucleotide according to the present invention contains 15 nucleotides and the substitution pattern for positions 11 to 15, counting from the 3' end, is selected from the group consisting of Xxxxx, xXxxx, xxXxx, xxxXx, xxxxX, XXxxx, XxXxx, XxxXx, XxxxX, xXXxx, xXxXx, xXxxX, xxXXx, xxXxX, xxxXX and XxXxX, wherein "X" denotes an LNA unit and "x" denotes a non-LNA unit. In a preferred embodiment thereof, the substitution pattern for positions 11 to 15, counting from the 3' end, is selected from the group consisting of xxXxx, XxXxx, XxxXx, xXxXx, xXxxX and xxXxX, wherein "X" denotes an LNA unit and "x" denotes a non-LNA unit. In a more preferred embodiment thereof, the substitution pattern for positions 11 to 15, counting from the 3' end, is selected from the group consisting of xxXxx, xXxXx, xXxxX and xxXxX, wherein "X" denotes an LNA unit and "x" denotes a non-LNA unit. In an even more preferred embodiment thereof, the substitution pattern for positions 11 to 15, counting from the 3' end, is selected from the group consisting of xXxxX and xxXxX, wherein "X" denotes an LNA unit and "x" denotes a non-LNA unit. In a most preferred embodiment, the substitution pattern for positions 11 to 15, counting from the 3' end, is xxXxX, wherein "X" denotes an LNA unit and "x" denotes a non-LNA unit. Alternatively, no LNA units are present in positions 11 to 15, counting from the 3' end, i.e. the substitution pattern is xxxxx

[0258] In yet a further preferred embodiment, the oligonucleotide according to the present invention contains 16 nucleotides and the substitution pattern for positions 11 to 16, counting from the 3' end, is selected from the group consisting of Xxxxxx, xXxxxx, xxXxxx, xxxXxx, xxxxXx, xxxxxX, XXxxxx, XxXxxx, XxxXxx, XxxxXx, XxxxxX, xXXxxx, xXxXxx, xXxxXx, xXxxxX, xxXXxx, xxXxXx, xxXxxX, xxxXXx, xxxXxX, xxxxXX, XXXxxx, XXxXxx, XXxxXx, XXxxxX, XxXXxx, XxXxXx, XxXxxX, XxxXXx, XxxXxX, XxxxXX, xXXXxx, xXXxXx, xXXxxX, xXxXXx, xXxXxX, xXxxXX, xxXXXx, xxXXxX, xxXxXX and xxxXXX, wherein "X" denotes an LNA unit and "x" denotes a non-LNA unit. In a preferred embodiment thereof, the substitution pattern for positions 11 to 16, counting from the 3' end, is selected from the group consisting of XxxXxx, xXxXxx, xXxxXx, xxXxXx, xxXxxX, XxXxXx, XxXxxX, XxxXxX, xXxXxX, xXxxXX and xxXxXX, wherein "X" denotes an LNA unit and "x" denotes a non-LNA unit. In a more preferred embodiment thereof, the substitution pattern for positions 11 to 16, counting from the 3' end, is selected from the group consisting of xXxXxx, xXxxXx, xxXxXx, xxXxxX, xXxXxX, xXxxXX and xxXxXX, wherein "X" denotes an LNA unit and "x" denotes a non-LNA unit. In an even more preferred embodiment thereof, the substitution pattern for positions 11 to 16, counting from the 3' end, is selected from the group consisting of xxXxxX, xXxXxX, xXxxXX and xxXxXX, wherein "X" denotes an LNA unit and "x" denotes a non-LNA unit. In a still more preferred embodiment thereof, the substitution pattern for positions 11 to 16, counting from the 3' end, is selected from the group consisting of xxXxxX and xXxXxX, wherein "X" denotes an LNA unit and "x" denotes a non-LNA unit. In a most preferred embodiment thereof, the substitution pattern for positions 11 to 16, counting from the 3' end, is xxXxxX, wherein "X" denotes an LNA unit and "x" denotes a non-LNA unit. Alternatively, no LNA units are present in positions 11 to 16, counting from the 3' end, i.e. the substitution pattern is xxxxxx

[0259] In a preferred embodiment of the invention, the oligonucleotide according to the present invention contains an LNA unit at the 5' end. In another preferred embodiment, the oligonucleotide according to the present invention contains an LNA unit at the first two positions, counting from the 5' end.

[0260] In a particularly preferred embodiment, the oligonucleotide according to the present invention contains 13 nucleotides and the substitution pattern, starting from the 3' end, is XXxXxXxxXXxxX, wherein "X" denotes an LNA unit and "x" denotes a non-LNA unit. The preferred sequence for this embodiment, starting from the 3' end, is CCtCaCacTGttA, wherein a capital letter denotes a nitrogenous base in an LNA-unit and a small letter denotes a nitrogenous base in a non-LNA unit.

[0261] In another particularly preferred embodiment, the oligonucleotide according to the present invention contains 15 nucleotides and the substitution pattern, starting from the 3' end, is XXxXxXxxXXxxXxX, wherein "X" denotes an LNA unit and "x" denotes a non-LNA unit. The preferred sequence for this embodiment, starting from the 3' end, is CCtCaCacTGttAcC, wherein a capital letter denotes a nitrogenous base in an LNA-unit and a small letter denotes a nitrogenous base in a non-LNA unit.

[0262] Modification of the Internucleoside Linkage Group

[0263] Typical internucleoside linkage groups in oligonucleotides are phosphate groups, but these may be replaced by internucleoside linkage groups differing from phosphate. In a further interesting embodiment of the invention, the oligonucleotide of the invention is modified in its internucleoside linkage group structure, i.e. the modified oligonucleotide comprises an internucleoside linkage group which differs from phosphate. Accordingly, in a preferred embodiment, the oligonucleotide according to the present invention comprises at least one internucleoside linkage group which differs from phosphate.

[0264] Specific examples of internucleoside linkage groups which differ from phosphate (--O--P(O).sub.2--O--) include --O--P(O,S)--O--, --O--P(S).sub.2--O--, --S--P(O).sub.2--O--, --S--P(O,S)--O--, --S--P(S).sub.2--O--, --O--P(O).sub.2--S--, --O--P(O,S)--S--, --S--P(O).sub.2--S--, --O--PO(R.sup.H)--O--, O--PO(OCH.sub.3)--O--, --O--PO(NR.sup.H)--O--, --O--PO(OCH.sub.2CH.sub.2S--R)--O--, --O--PO(BH.sub.3)--O--, --O--PO(NHR.sup.H)--O--, --O--P(O).sub.2--NR.sup.H--, --NR.sup.H--P(O).sub.2--O--, --NR.sup.H--CO--O--, --NR.sup.H--CO--NR.sup.H--, --O--CO--O--, --O--CO--NR.sup.H--, --NR.sup.H--CO--CH.sub.2--, --O--CH.sub.2--CO--NR.sup.H--, --O--CH.sub.2--CH.sub.2--NR.sup.H--, --CO--NR.sup.H--CH.sub.2--, --CH.sub.2--NR.sup.H--CO--, --O--CH.sub.2--CH.sub.2--S--, --S--CH.sub.2--CH.sub.2--O--, --S--CH.sub.2--CH.sub.2--S--, --CH.sub.2--SO.sub.2--CH.sub.2--, --CH.sub.2--CO--NR.sup.H--, --O--CH.sub.2--CH.sub.2--NR.sup.H--CO--, --CH.sub.2NCH.sub.3--O--CH.sub.2--, where R.sup.H is hydrogen or C.sub.1-4-alkyl.

[0265] When the internucleoside linkage group is modified, the internucleoside linkage group is preferably a phosphorothioate group (--O--P(O,S)--O--). In a preferred embodiment, all internucleoside linkage groups of the oligonucleotides according to the present invention are phosphorothioate.

[0266] The LNA Unit

[0267] In a preferred embodiment, the LNA unit has the general chemical structure shown in Scheme 1 below:

##STR00002##

[0268] wherein [0269] X is selected from the group consisting of O, S and NR.sup.H, where R.sup.H is H or C.sub.1-4-alkyl; [0270] Y is (--CH.sub.2).sub.r, where r is an integer of 1-4; and [0271] B is a nitrogenous base.

[0272] In a preferred embodiment of the invention, r is 1 or 2, in particular 1, i.e. a preferred LNA unit has the chemical structure shown in Scheme 2 below:

##STR00003##

[0273] wherein X and B are as defined above.

[0274] In an interesting embodiment, the LNA units incorporated in the oligonucleotides of the invention are independently selected from the group consisting of thio-LNA units, amino-LNA units and oxy-LNA units.

[0275] Thus, the thio-LNA unit may have the chemical structure shown in Scheme 3 below:

##STR00004##

[0276] wherein B is as defined above.

[0277] Preferably, the thio-LNA unit is in its beta-D-form, i.e. having the structure shown in 3A above.

[0278] likewise, the amino-LNA unit may have the chemical structure shown in Scheme 4 below:

##STR00005##

[0279] wherein B and R.sup.H are as defined above.

[0280] Preferably, the amino-LNA unit is in its beta-D-form, i.e. having the structure shown in 4A above.

[0281] The oxy-LNA unit may have the chemical structure shown in Scheme 5 below:

##STR00006##

[0282] wherein B is as defined above.

[0283] Preferably, the oxy-LNA unit is in its beta-D-form, i.e. having the structure shown in 5A above.

[0284] As indicated above, B is a nitrogenous base which may be of natural or non-natural origin. Specific examples of nitrogenous bases include adenine (A), cytosine (C), 5-methylcytosine (.sup.MeC), isocytosine, pseudoisocytosine, guanine (G), thymine (T), uracil (U), 5-bromouracil, 5-propynyluracil, 5-propyny-6, 5-methylthiazoleuracil, 6-aminopurine, 2-aminopurine, inosine, 2,6-diaminopurine, 7-propyne-7-deazaadenine, 7-propyne-7-deazaguanine and 2-chloro-6-aminopurine.

[0285] Terminal Groups

[0286] Specific examples of terminal groups include terminal groups selected from the group consisting of hydrogen, azido, halogen, cyano, nitro, hydroxy, Prot-O--, mercapto, Prot-S--, C.sub.1-6-alkylthio, amino, Prot-N(R.sup.H)--, mono- or di(C.sub.1-6-alkyl)amino, optionally substituted C.sub.1-6-alkoxy, optionally substituted C.sub.1-6-alkyl, optionally substituted C.sub.2-6-alkenyl, optionally substituted C.sub.2-6-alkenyloxy, optionally substituted C.sub.2-6-alkynyl, optionally substituted C.sub.2-6-alkynyloxy, monophosphate including protected monophosphate, monothiophosphate including protected monothiophosphate, diphosphate including protected diphosphate, dithiophosphate including protected dithiophosphate, triphosphate including protected triphosphate, trithiophosphate including protected trithiophosphate, where Prot is a protection group for --OH, --SH and --NH(R.sup.H), and R.sup.H is hydrogen or C.sub.1-6-alkyl.

[0287] Examples of phosphate protection groups include S-acetylthioethyl (SATE) and S-pivaloylthioethyl (t-butyl-SATE).

[0288] Still further examples of terminal groups include DNA intercalators, photochemically active groups, thermochemically active groups, chelating groups, reporter groups, ligands, carboxy, sulphono, hydroxymethyl, Prot-O--CH.sub.2--, Act-O--CH.sub.2--, aminomethyl, Prot-N(R.sup.H)--CH.sub.2--, Act-N(R.sup.H)--CH.sub.2--, carboxymethyl, sulphonomethyl, where Prot is a protection group for --OH, --SH and --NH(R.sup.H), and Act is an activation group for --OH, --SH, and --NH(R.sup.H), and R.sup.H is hydrogen or C.sub.1-6-alkyl.

[0289] Examples of protection groups for --OH and --SH groups include substituted trityl, such as 4,4'-dimethoxytrityloxy (DMT), 4-monomethoxytrityloxy (MMT); trityloxy, optionally substituted 9-(9-phenyl)xanthenyloxy (pixyl), optionally substituted methoxytetrahydro-pyranyloxy (mthp); silyloxy, such as trimethylsilyloxy (TMS), triisopropylsilyloxy (TIPS), tert-butyldimethylsilyloxy (TBDMS), triethylsilyloxy, phenyldimethylsilyloxy; tert-butylethers; acetals (including two hydroxy groups); acyloxy, such as acetyl or halogen-substituted acetyls, e.g. chloroacetyloxy or fluoroacetyloxy, isobutyryloxy, pivaloyloxy, benzoyloxy and substituted benzoyls, methoxymethyloxy (MOM), benzyl ethers or substituted benzyl ethers such as 2,6-dichlorobenzyloxy (2,6-Cl.sub.2Bzl). Moreover, when Z or Z* is hydroxyl they may be protected by attachment to a solid support, optionally through a linker.

[0290] Examples of amine protection groups include fluorenylmethoxycarbonylamino (Fmoc), tert-butyloxycarbonylamino (BOC), trifluoroacetylamino, allyloxycarbonylamino (alloc, AOC), Z-benzyloxycarbonylamino (Cbz), substituted benzyloxycarbonylamino, such as 2-chloro benzyloxycarbonylamino (2-ClZ), monomethoxytritylamino (MMT), dimethoxytritylamino (DMT), phthaloylamino, and 9-(9-phenyl)xanthenylamino (pixyl).

[0291] In the present context, the term "phosphoramidite" means a group of the formula --P(OR.sup.x)--N(R.sup.y).sub.2, wherein R.sup.x designates an optionally substituted alkyl group, e.g. methyl, 2-cyanoethyl, or benzyl, and each of R.sup.y designates optionally substituted alkyl groups, e.g. 5 ethyl or isopropyl, or the group --N(R.sup.y).sub.2 forms a morpholino group (--N(CH.sub.2CH.sub.2).sub.2O). R.sup.x preferably designates 2-cyanoethyl and the two R.sup.y are preferably identical and designates isopropyl. Accordingly, a particularly preferred phosphoramidite is N,N-diisopropyl-O-(2-cyanoethyl)phosphoramidite.

[0292] The most preferred terminal groups are hydroxy, mercapto and amino, in particular hydroxy.

[0293] Designs for Specific MicroRNAs

[0294] The following table provides examples of oligonucleotide according to the present invention, such as those used in pharmaceutical compositions, as compared to prior art type of molecules.

TABLE-US-00001 Oligo #, target microRNA, oligo sequence Design SEQ ID target: hsa-miR-122a MIMAT0000421 uggagugugacaaugguguuugu SEQ ID NO 535 screened in HUH-7 cell line expressing miR-122 3962: miR-122 5'-ACAAacaccattgtcacacTCCA-3' Full complement, gap SEQ ID NO 536 3965: miR-122 5'-acaaacACCATTGTcacactcca-3' Full complement, block SEQ ID NO 537 3972: miR-122 5'-acAaaCacCatTgtCacActCca-3' Full complement, LNA_3 SEQ ID NO 538 3549 (3649): miR-122 5'-CcAttGTcaCaCtCC-3' New design SEQ ID NO 539 3975: miR-122 5'-CcAtTGTcaCACtCC-3' Enhanced new design SEQ ID NO 540 3975': miR-122 5'-ATTGTcACACtCC-3' ED - 13mer SEQ ID NO 541 3975'': miR-122 5'-TGTcACACtCC-3' ED - 11mer SEQ ID NO 542 3549'C3649): miR-122 5' New design - 2'MOE SEQ ID NO 543 CC.sup.MAT.sup.MT.sup.MGTC.sup.MA.sup.MCA.sup.MCT.sup.MCC-3' 3549'' (3649): miR-122 5' New design - 2'Fluoro SEQ ID NO 544 CC.sup.FAT.sup.FT.sup.FGTC.sup.FA.sup.FCA.sup.FCT.sup.FCC-3' target: hsa-miR-19b MIMAT0000074 ugugcaaauccaugcaaaacuga SEQ ID NO 545 screened HeLa cell line expressing miR-19b 3963: miR-19b 5'-TCAGttttgcatggatttgCACA-3' Full complement, gap SEQ ID NO 546 3967: miR-19b 5'-tcagttTTGCATGGatttgcaca-3' Full complement, block SEQ ID NO 547 3973: miR-19b 5'-tcAgtTttGcaTggAttTgcAca-3' Full complement, LNA_3 SEQ ID NO 548 3560: miR-19b 5'-TgCatGGatTtGcAC-3' New design SEQ ID NO 549 3976: miR-19b 5'-TgCaTGGatTTGcAC-3' Enhanced new design SEQ ID NO 550 3976': miR-19b 5'-CaTGGaTTTGcAC-3' ED - 13mer SEQ ID NO 551 3976'': miR-19b 5'-TGGaTTTGcAC-3' ED - 11mer SEQ ID NO 552 3560': miR-19b 5' TG.sup.MCA.sup.MT.sup.MGGA.sup.MT.sup.MTT.sup.MGC.sup.MAC-3' New design - 2'MOE SEQ ID NO 553 3560'': miR-19b 5'-TG.sup.FCA.sup.FT.sup.FGGA.sup.FT.sup.FTT.sup.FGC.sup.FAC-3' New design - 2'MOE SEQ ID NO 554 target: hsa-miR-155 MIMAT0000646 uuaaugcuaaucgugauagggg SEQ ID NO 555 screen in 518A2 cell line expressing miR-155 3964: miR-155 5'-CCCCtatcacgattagcaTTAA-3' Full complement, gap SEQ ID NO 556 3968: miR-155 5'-cccctaTCACGATTagcattaa-3' Full complement, block SEQ ID NO 557 3974: miR-155 5'-cCccTatCacGatTagCatTaa-3' Full complement, LNA_3 SEQ ID NO 558 3758: miR-155 5'-TcAcgATtaGcAtTA-3' New design SEQ ID NO 559 3818: miR-155 5'-TcAcGATtaGCAtTA-3' Enhanced new design SEQ ID NO 560 3818': miR-155 5'-ACGATtAGCAtTA-3' ED - 13mer SEQ ID NO 561 3818'': miR-155 5'-GATtAGCaTTA-3' ED - 11mer SEQ ID NO 562 3758': miR-155 5'-TC.sup.MAC.sup.MG.sup.MATTA.sup.MGC.sup.MAT.sup.MTA-3' New design - 2'MOE SEQ ID NO 563 3758'': miR-155 5'-TC.sup.FAC.sup.FG.sup.FATT.sup.FA.sup.FGC.sup.FAT.sup.FTA-3' New design - 2'Fluoro SEQ ID NO 564 target: hsa-miR-21 MIMAT0000076 uagcuuaucagacugauguuga SEQ ID NO 565 miR-21 5'- TCAAcatcagtctgataaGCTA -3' Full complement, gap SEQ ID NO 566 miR-21 5'- tcaacaTCAGTCTGataagcta -3' Full complement, block SEQ ID NO 567 miR-21 5'- tcAtcAtcAgtCtgAtaAGcTta -3' Full complement, LNA_3 SEQ ID NO 568 miR-21 5'- TcAgtCTgaTaAgCT -3' New design SEQ ID NO 569 miR-21 5'- TcAgTCTgaTAAgCT -3'- Enhanced new design SEQ ID NO 570 miR-21 5'- AGTCTgATAAgCT -3'- ED - 13mer SEQ ID NO 571 miR-21 5'- TCTgAtAAGCT -3'- ED - 11mer SEQ ID NO 572 miR-21 5'- TC.sup.MAG.sup.MT.sup.MCTG.sup.MA.sup.MTA.sup.MAG.sup.MCT - 3' New design - 2'MOE SEQ ID NO 573 miR-21 5'- TC.sup.FAG.sup.FT.sup.FCTG.sup.FA.sup.FTA.sup.FAG.sup.FCT-3' New design - 2'Fluoro SEQ ID NO 574 target: hsa-miR-375 MIMAT0000728 uuuguucguucggcucgcguga SEQ ID NO 575 miR- 375 5'- TCTCgcgtgccgttcgttCTTT -3' Full complement, gap SEQ ID NO 576 miR- 375 5'- tctcgcGTGCCGTTcgttcttt -3' Full complement, block SEQ ID NO 577 miR- 375 5'- tcTcgCgtGccGttCgtTctTt -3' Full complement, LNA_3 SEQ ID NO 578 miR- 375 5'- GtGccGTtcGtTcTT 3' New design SEQ ID NO 579 miR- 375 5'- GtGcCGTtcGTTcTT 3' Enhanced new design SEQ ID NO 580 miR- 375 5'- GCCGTtCgTTCTT 3' ED - 13mer SEQ ID NO 581 miR- 375 5'- CGTTcGTTCTT 3' ED - 11mer SEQ ID NO 582 miR- 375 5'- GT.sup.MGC.sup.MC.sup.MGTT.sup.MC.sup.MGT.sup.MTC.sup.MTT 3' New design - 2'MOE SEQ ID NO 583 miR- 375 5'- GT.sup.FGC.sup.FC.sup.FGTT.sup.FC.sup.FGT.sup.FTC.sup.FTT 3' New design - 2'Fluoro SEQ ID NO 584

[0295] Capital Letters without a superscript M or F, refer to LNA units. Lower case=DNA, except for lower case in bold=RNA. The LNA cytosines may optionally be methylated). Capital letters followed by a superscript M refer to 2'OME RNA units, Capital letters followed by a superscript F refer to 2'fluoro DNA units, lowercase letter refer to DNA. The above oligos may in one embodiment be entirely phosphorothioate, but other nucleobase linkages as herein described bay be used. In one embodiment the nucleobase linkages are all phosphodiester. It is considered that for use within the brain/spinal cord it is preferable to use phosphodiester linkages, for example for the use of antimiRs targeting miR21.

[0296] Table 2 below provides non-limiting examples of oligonucleotide designs against known human microRNA sequences in miRBase microRNA database version 8.1.

[0297] The oligonucleotides according to the invention, such as those disclosed in table 2 may, in one embodiment, have a sequence of nucleobases 5'-3' selected form the group consisting of:

[0298] LdLddLLddLdLdLL (New design)

[0299] LdLdLLLddLLLdLL (Enhanced new design)

[0300] LMLMMLLMMLMLMLL (New design--2'MOE)

[0301] LMLMLLLMMLLLMLL (Enhanced new design--2'MOE)

[0302] LFLFFLLFFLFLFLL (New design--2' Fluoro)

[0303] LFLFLLLFFLLLFLL (Enhanced new design--2' Fluoro)

[0304] LddLddLddL(d)(d)(L)(d)(d)(L)(d) `Every third`

[0305] dLddLddLdd(L)(d)(d)(L)(d)(d)(L) `Every third`

[0306] ddLddLddLd(d)(L)(d)(d)(L)(d)(d) `Every third`

[0307] LMMLMMLMML(M)(M)(L)(M)(M)(L)(M) `Every third`

[0308] MLMMLMMLMM(L)(M)(M)(L)(M)(M)(L) `Every third`

[0309] MMLMMLMMLM(M)(L)(M)(M)(L)(M)(M) `Every third`

[0310] LFFLFFLFFL(F)(F)(L)(F)(F)(L)(F) `Every third`

[0311] FLFFLFFLFF(L)(F)(F)(L)(F)(F)(L) `Every third`

[0312] FFLFFLFFLF(F)(L)(F)(F)(L)(F)(F) `Every third`

[0313] dLdLdLdLdL(d)(L)(d)(L)(d)(L)(d) `Every second`

[0314] LdLdLdLdL(d)(L)(d)(L)(d)(L)(d)(L) `Every second`

[0315] MLMLMLMLML(M)(L)(M)(L)(M)(L)(M) `Every second`

[0316] LMLMLMLML(M)(L)(M)(L)(M)(L)(M)(L) `Every second`

[0317] FLFLFLFLFL(F)(L)(F)(L)(F)(L)(F) `Every second`

[0318] LFLFLFLFL(F)(L)(F)(L)(F)(L)(F)(L) `Every second`

[0319] Wherein L=LNA unit, d=DNA units, M=2'MOE RNA, F=2'Fluoro and residues in brackets are optional

[0320] Conjugates

[0321] The invention also provides for conjugates comprising the oligonucleotide according to the invention.

[0322] In one embodiment of the invention the oligomeric compound is linked to ligands/conjugates, which may be used, e.g. to increase the cellular uptake of antisense oligonucleotides. This conjugation can take place at the terminal positions 5'/3'-OH but the ligands may also take place at the sugars and/or the bases. In particular, the growth factor to which the antisense oligonucleotide may be conjugated, may comprise transferrin or folate. Transferrin-polylysine-oligonucleotide complexes or folate-polylysine-oligonucleotide complexes may be prepared for uptake by cells expressing high levels of transferrin or folate receptor. Other examples of conjugates/ligands are cholesterol moieties, duplex intercalators such as acridine, poly-L-lysine, "end-capping" with one or more nuclease-resistant linkage groups such as phosphoromonothioate, and the like. The invention also provides for a conjugate comprising the compound according to the invention as herein described, and at least one non-nucleotide or non-polynucleotide moiety covalently attached to said compound. Therefore, in one embodiment where the compound of the invention consists of s specified nucleic acid, as herein disclosed, the compound may also comprise at least one non-nucleotide or non-polynucleotide moiety (e.g. not comprising one or more nucleotides or nucleotide analogues) covalently attached to said compound. The non-nucleobase moiety may for instance be or comprise a sterol such as cholesterol.

[0323] Therefore, it will be recognised that the oligonucleotide of the invention, such as the oligonucleotide used in pharmaceutical (therapeutic) formulations may comprise further non-nucleobase components, such as the conjugates herein defined.

[0324] Therapy and Pharmaceutical Compositions

[0325] As explained initially, the oligonucleotides of the invention will constitute suitable drugs with improved properties. The design of a potent and safe drug requires the fine-tuning of various parameters such as affinity/specificity, stability in biological fluids, cellular uptake, mode of action, pharmacokinetic properties and toxicity.

[0326] Accordingly, in a further aspect the present invention relates to a pharmaceutical composition comprising an oligonucleotide according to the invention and a pharmaceutically acceptable diluent, carrier or adjuvant. Preferably said carrier is saline of buffered saline.

[0327] In a still further aspect the present invention relates to an oligonucleotide according to the present invention for use as a medicament.

[0328] As will be understood, dosing is dependent on severity and responsiveness of the disease state to be treated, and the course of treatment lasting from several days to several months, or until a cure is effected or a diminution of the disease state is achieved. Optimal dosing schedules can be calculated from measurements of drug accumulation in the body of the patient. Optimum dosages may vary depending on the relative potency of individual oligonucleotides. Generally it can be estimated based on EC50s found to be effective in in vitro and in vivo animal models. In general, dosage is from 0.01 .mu.g to 1 g per kg of body weight, and may be given once or more daily, weekly, monthly or yearly, or even once every 2 to 10 years or by continuous infusion for hours up to several months. The repetition rates for dosing can be estimated based on measured residence times and concentrations of the drug in bodily fluids or tissues. Following successful treatment, it may be desirable to have the patient undergo maintenance therapy to prevent the recurrence of the disease state.

[0329] Pharmaceutical Compositions

[0330] As indicated above, the invention also relates to a pharmaceutical composition, which comprises at least one oligonucleotide of the invention as an active ingredient. It should be understood that the pharmaceutical composition according to the invention optionally comprises a pharmaceutical carrier, and that the pharmaceutical composition optionally comprises further compounds, such as chemotherapeutic compounds, anti-inflammatory compounds, antiviral compounds and/or immuno-modulating compounds.

[0331] The oligonucleotides of the invention can be used "as is" or in form of a variety of pharmaceutically acceptable salts. As used herein, the term "pharmaceutically acceptable salts" refers to salts that retain the desired biological activity of the herein-identified oligonucleotides and exhibit minimal undesired toxicological effects. Non-limiting examples of such salts can be formed with organic amino acid and base addition salts formed with metal cations such as zinc, calcium, bismuth, barium, magnesium, aluminum, copper, cobalt, nickel, cadmium, sodium, potassium, and the like, or with a cation formed from ammonia, N,N-dibenzylethylene-diamine, D-glucosamine, tetraethylammonium, or ethylenediamine.

[0332] In one embodiment of the invention, the oligonucleotide may be in the form of a pro-drug. Oligonucleotides are by virtue negatively charged ions. Due to the lipophilic nature of cell membranes the cellular uptake of oligonucleotides are reduced compared to neutral or lipophilic equivalents. This polarity "hindrance" can be avoided by using the pro-drug approach (see e.g. Crooke, R. M. (1998) in Crooke, S. T. Antisense research and Application. Springer-Verlag, Berlin, Germany, vol. 131, pp. 103-140). Pharmaceutically acceptable binding agents and adjuvants may comprise part of the formulated drug.

[0333] Examples of delivery methods for delivery of the therapeutic agents described herein, as well as details of pharmaceutical formulations, salts, may are well described elsewhere for example in U.S. provisional application 60/838,710 and 60/788,995, which are hereby incorporated by reference, and Danish applications, PA 2006 00615 which is also hereby incorporated by reference.

[0334] Pharmaceutical compositions of the present invention include, but are not limited to, solutions, emulsions, and liposome-containing formulations. These compositions may be generated from a variety of components that include, but are not limited to, preformed liquids, self-emulsifying solids and self-emulsifying semisolids. Delivery of drug to tumour tissue may be enhanced by carrier-mediated delivery including, but not limited to, cationic liposomes, cyclodextrins, porphyrin derivatives, branched chain dendrimers, polyethylen-imine polymers, nanoparticles and microspheres (Dass C R. J Pharm Pharmacol 2002; 54(1):3-27). The pharmaceutical formulations of the present invention, which may conveniently be presented in unit dosage form, may be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of bringing into association the active ingredients with the pharmaceutical carrier(s) or excipient(s). In general the formulations are prepared by uniformly and intimately bringing into association the active ingredients with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product. The compositions of the present invention may be formulated into any of many possible dosage forms such as, but not limited to, tablets, capsules, gel capsules, liquid syrups, soft gels and suppositories. The compositions of the present invention may also be formulated as suspensions in aqueous, non-aqueous or mixed media. Aqueous suspensions may further contain substances which increase the viscosity of the suspension including, for example, sodium carboxymethyl-cellulose, sorbitol and/or dextran. The suspension may also contain stabilizers. The compounds of the invention may also be conjugated to active drug substances, for example, aspirin, ibuprofen, a sulfa drug, an antidiabetic, an antibacterial or an antibiotic.

[0335] In another embodiment, compositions of the invention may contain one or more oligonucleotide compounds, targeted to a first microRNA and one or more additional oligonucleotide compounds targeted to a second microRNA target. Two or more combined compounds may be used together or sequentially.

[0336] The compounds disclosed herein are useful for a number of therapeutic applications as indicated above. In general, therapeutic methods of the invention include administration of a therapeutically effective amount of an oligonucleotide to a mammal, particularly a human. In a certain embodiment, the present invention provides pharmaceutical compositions containing (a) one or more compounds of the invention, and (b) one or more chemotherapeutic agents. When used with the compounds of the invention, such chemotherapeutic agents may be used individually, sequentially, or in combination with one or more other such chemotherapeutic agents or in combination with radiotherapy. All chemotherapeutic agents known to a person skilled in the art are here incorporated as combination treatments with compound according to the invention. Other active agents, such as anti-inflammatory drugs, including but not limited to nonsteroidal anti-inflammatory drugs and corticosteroids, antiviral drugs, and immuno-modulating drugs may also be combined in compositions of the invention. Two or more combined compounds may be used together or sequentially.

[0337] Examples of therapeutic indications which may be treated by the pharmaceutical compositions of the invention:

TABLE-US-00002 microRNA Possible medical indications miR-21 Glioblastoma, breast cancer miR-122 hypercholesterolemia, hepatitis C, hemochromatosis miR-19b lymphoma and other tumour types miR-155 lymphoma, breast and lung cancer miR-375 diabetes, metabolic disorders miR-181 myoblast differentiation, auto immune disorders

[0338] Tumor suppressor gene tropomysin 1 (TPM1) mRNA has been indicated as a target of miR-21. Myotrophin (mtpn) mRNA has been indicated as a target of miR 375.

[0339] In an even further aspect, the present invention relates to the use of an oligonucleotide according to the invention for the manufacture of a medicament for the treatment of a disease selected from the group consisting of: atherosclerosis, hypercholesterolemia and hyperlipidemia; cancer, glioblastoma, breast cancer, lymphoma, lung cancer; diabetes, metabolic disorders; myoblast differentiation; immune disorders.

[0340] The invention further refers to an oligonucleotides according to the invention for the use in the treatment of from a disease selected from the group consisting of: atherosclerosis, hypercholesterolemia and hyperlipidemia; cancer, glioblastoma, breast cancer, lymphoma, lung cancer; diabetes, metabolic disorders; myoblast differentiation; immune disorders.

[0341] The invention provides for a method of treating a subject suffering from a disease or condition selected from from the group consisting of: atherosclerosis, hypercholesterolemia and hyperlipidemia; cancer, glioblastoma, breast cancer, lymphoma, lung cancer; diabetes, metabolic disorders; myoblast differentiation; immune disorders, the method comprising the step of administering an oligonucleotide or pharmaceutical composition of the invention to the subject in need thereof.

[0342] Cancer

[0343] In an even further aspect, the present invention relates to the use of an oligonucleotide according to the invention for the manufacture of a medicament for the treatment of cancer. In another aspect, the present invention concerns a method for treatment of, or prophylaxis against, cancer, said method comprising administering an oligonucleotide of the invention or a pharmaceutical composition of the invention to a patient in need thereof.

[0344] Such cancers may include lymphoreticular neoplasia, lymphoblastic leukemia, brain tumors, gastric tumors, plasmacytomas, multiple myeloma, leukemia, connective tissue tumors, lymphomas, and solid tumors.

[0345] In the use of a compound of the invention for the manufacture of a medicament for the treatment of cancer, said cancer may suitably be in the form of a solid tumor. Analogously, in the method for treating cancer disclosed herein said cancer may suitably be in the form of a solid tumor.

[0346] Furthermore, said cancer is also suitably a carcinoma. The carcinoma is typically selected from the group consisting of malignant melanoma, basal cell carcinoma, ovarian carcinoma, breast carcinoma, non-small cell lung cancer, renal cell carcinoma, bladder carcinoma, recurrent superficial bladder cancer, stomach carcinoma, prostatic carcinoma, pancreatic carcinoma, lung carcinoma, cervical carcinoma, cervical dysplasia, laryngeal papillomatosis, colon carcinoma, colorectal carcinoma and carcinoid tumors. More typically, said carcinoma is selected from the group consisting of malignant melanoma, non-small cell lung cancer, breast carcinoma, colon carcinoma and renal cell carcinoma. The malignant melanoma is typically selected from the group consisting of superficial spreading melanoma, nodular melanoma, lentigo maligna melanoma, acral melagnoma, amelanotic melanoma and desmoplastic melanoma.

[0347] Alternatively, the cancer may suitably be a sarcoma. The sarcoma is typically in the form selected from the group consisting of osteosarcoma, Ewing's sarcoma, chondrosarcoma, malignant fibrous histiocytoma, fibrosarcoma and Kaposi's sarcoma.

[0348] Alternatively, the cancer may suitably be a glioma.

[0349] A further embodiment is directed to the use of an oligonucleotide according to the invention for the manufacture of a medicament for the treatment of cancer, wherein said medicament further comprises a chemotherapeutic agent selected from the group consisting of adrenocorticosteroids, such as prednisone, dexamethasone or decadron; altretamine (hexalen, hexamethylmelamine (HMM)); amifostine (ethyol); aminoglutethimide (cytadren); amsacrine (M-AMSA); anastrozole (arimidex); androgens, such as testosterone; asparaginase (elspar); bacillus calmette-gurin; bicalutamide (casodex); bleomycin (blenoxane); busulfan (myleran); carboplatin (paraplatin); carmustine (BCNU, BiCNU); chlorambucil (leukeran); chlorodeoxyadenosine (2-CDA, cladribine, leustatin); cisplatin (platinol); cytosine arabinoside (cytarabine); dacarbazine (DTIC); dactinomycin (actinomycin-D, cosmegen); daunorubicin (cerubidine); docetaxel (taxotere); doxorubicin (adriomycin); epirubicin; estramustine (emcyt); estrogens, such as diethylstilbestrol (DES); etopside (VP-16, VePesid, etopophos); fludarabine (fludara); flutamide (eulexin); 5-FUDR (floxuridine); 5-fluorouracil (5-FU); gemcitabine (gemzar); goserelin (zodalex); herceptin (trastuzumab); hydroxyurea (hydrea); idarubicin (idamycin); ifosfamide; IL-2 (proleukin, aldesleukin); interferon alpha (intron A, roferon A); irinotecan (camptosar); leuprolide (lupron); levamisole (ergamisole); lomustine (CCNU); mechlorathamine (mustargen, nitrogen mustard); melphalan (alkeran); mercaptopurine (purinethol, 6-MP); methotrexate (mexate); mitomycin-C (mutamucin); mitoxantrone (novantrone); octreotide (sandostatin); pentostatin (2-deoxycoformycin, nipent); plicamycin (mithramycin, mithracin); prorocarbazine (matulane); streptozocin; tamoxifin (nolvadex); taxol (paclitaxel); teniposide (vumon, VM-26); thiotepa; topotecan (hycamtin); tretinoin (vesanoid, all-trans retinoic acid); vinblastine (valban); vincristine (oncovin) and vinorelbine (navelbine). Suitably, the further chemotherapeutic agent is selected from taxanes such as Taxol, Paclitaxel or Docetaxel.

[0350] Similarly, the invention is further directed to the use of an oligonucleotide according to the invention for the manufacture of a medicament for the treatment of cancer, wherein said treatment further comprises the administration of a further chemotherapeutic agent selected from the group consisting of adrenocorticosteroids, such as prednisone, dexamethasone or decadron; altretamine (hexalen, hexamethylmelamine (HMM)); amifostine (ethyol); aminoglutethimide (cytadren); amsacrine (M-AMSA); anastrozole (arimidex); androgens, such as testosterone; asparaginase (elspar); bacillus calmette-gurin; bicalutamide (casodex); bleomycin (blenoxane); busulfan (myleran); carboplatin (paraplatin); carmustine (BCNU, BiCNU); chlorambucil (leukeran); chlorodeoxyadenosine (2-CDA, cladribine, leustatin); cisplatin (platinol); cytosine arabinoside (cytarabine); dacarbazine (DTIC); dactinomycin (actinomycin-D, cosmegen); daunorubicin (cerubidine); docetaxel (taxotere); doxorubicin (adriomycin); epirubicin; estramustine (emcyt); estrogens, such as diethylstilbestrol (DES); etopside (VP-16, VePesid, etopophos); fludarabine (fludara); flutamide (eulexin); 5-FUDR (floxuridine); 5-fluorouracil (5-FU); gemcitabine (gemzar); goserelin (zodalex); herceptin (trastuzumab); hydroxyurea (hydrea); idarubicin (idamycin); ifosfamide; IL-2 (proleukin, aldesleukin); interferon alpha (intron A, roferon A); irinotecan (camptosar); leuprolide (lupron); levamisole (ergamisole); lomustine (CCNU); mechlorathamine (mustargen, nitrogen mustard); melphalan (alkeran); mercaptopurine (purinethol, 6-MP); methotrexate (mexate); mitomycin-C (mutamucin); mitoxantrone (novantrone); octreotide (sandostatin); pentostatin (2-deoxycoformycin, nipent); plicamycin (mithramycin, mithracin); prorocarbazine (matulane); streptozocin; tamoxifin (nolvadex); taxol (paclitaxel); teniposide (vumon, VM-26); thiotepa; topotecan (hycamtin); tretinoin (vesanoid, all-trans retinoic acid); vinblastine (valban); vincristine (oncovin) and vinorelbine (navelbine). Suitably, said treatment further comprises the administration of a further chemotherapeutic agent selected from taxanes, such as Taxol, Paclitaxel or Docetaxel.

[0351] Alternatively stated, the invention is furthermore directed to a method for treating cancer, said method comprising administering an oligonucleotide of the invention or a pharmaceutical composition according to the invention to a patient in need thereof and further comprising the administration of a further chemotherapeutic agent. Said further administration may be such that the further chemotherapeutic agent is conjugated to the compound of the invention, is present in the pharmaceutical composition, or is administered in a separate formulation.

[0352] Infectious Diseases

[0353] It is contemplated that the compounds of the invention may be broadly applicable to a broad range of infectious diseases, such as diphtheria, tetanus, pertussis, polio, hepatitis B, hepatitis C, hemophilus influenza, measles, mumps, and rubella.

[0354] Hsa-miR122 is indicated in hepatitis C infection and as such oligonucleotides according to the invention which target miR-122 may be used to treat Hepatitis C infection.

[0355] Accordingly, in yet another aspect the present invention relates the use of an oligonucleotide according to the invention for the manufacture of a medicament for the treatment of an infectious disease, as well as to a method for treating an infectious disease, said method comprising administering an oligonucleotide according to the invention or a pharmaceutical composition according to the invention to a patient in need thereof.

[0356] Inflammatory Diseases

[0357] The inflammatory response is an essential mechanism of defense of the organism against the attack of infectious agents, and it is also implicated in the pathogenesis of many acute and chronic diseases, including autoimmune disorders. In spite of being needed to fight pathogens, the effects of an inflammatory burst can be devastating. It is therefore often necessary to restrict the symptomatology of inflammation with the use of anti-inflammatory drugs. Inflammation is a complex process normally triggered by tissue injury that includes activation of a large array of enzymes, the increase in vascular permeability and extravasation of blood fluids, cell migration and release of chemical mediators, all aimed to both destroy and repair the injured tissue.

[0358] In yet another aspect, the present invention relates to the use of an oligonucleotide according to the invention for the manufacture of a medicament for the treatment of an inflammatory disease, as well as to a method for treating an inflammatory disease, said method comprising administering an oligonucleotide according to the invention or a pharmaceutical composition according to the invention to a patient in need thereof.

[0359] In one preferred embodiment of the invention, the inflammatory disease is a rheumatic disease and/or a connective tissue diseases, such as rheumatoid arthritis, systemic lupus erythematous (SLE) or Lupus, scleroderma, polymyositis, inflammatory bowel disease, dermatomyositis, ulcerative colitis, Crohn's disease, vasculitis, psoriatic arthritis, exfoliative psoriatic dermatitis, pemphigus vulgaris and Sjorgren's syndrome, in particular inflammatory bowel disease and Crohn's disease.

[0360] Alternatively, the inflammatory disease may be a non-rheumatic inflammation, like bursitis, synovitis, capsulitis, tendinitis and/or other inflammatory lesions of traumatic and/or sportive origin.

[0361] Metabolic Diseases

[0362] A metabolic disease is a disorder caused by the accumulation of chemicals produced naturally in the body. These diseases are usually serious, some even life threatening. Others may slow physical development or cause mental retardation. Most infants with these disorders, at first, show no obvious signs of disease. Proper screening at birth can often discover these problems. With early diagnosis and treatment, metabolic diseases can often be managed effectively.

[0363] In yet another aspect, the present invention relates to the use of an oligonucleotide according to the invention or a conjugate thereof for the manufacture of a medicament for the treatment of a metabolic disease, as well as to a method for treating a metabolic disease, said method comprising administering an oligonucleotide according to the invention or a conjugate thereof, or a pharmaceutical composition according to the invention to a patient in need thereof.

[0364] In one preferred embodiment of the invention, the metabolic disease is selected from the group consisting of Amyloidosis, Biotinidase, OMIM (Online Mendelian Inheritance in Man), Crigler Najjar Syndrome, Diabetes, Fabry Support & Information Group, Fatty acid Oxidation Disorders, Galactosemia, Glucose-6-Phosphate Dehydrogenase (G6PD) deficiency, Glutaric aciduria, International Organization of Glutaric Acidemia, Glutaric Acidemia Type I, Glutaric Acidemia, Type II, Glutaric Acidemia Type I, Glutaric Acidemia Type-II, F-HYPDRR-Familial Hypophosphatemia, Vitamin D Resistant Rickets, Krabbe Disease, Long chain 3 hydroxyacyl CoA dehydrogenase deficiency (LCHAD), Mannosidosis Group, Maple Syrup Urine Disease, Mitochondrial disorders, Mucopolysaccharidosis Syndromes: Niemann Pick, Organic acidemias, PKU, Pompe disease, Porphyria, Metabolic Syndrome, Hyperlipidemia and inherited lipid disorders, Trimethylaminuria: the fish malodor syndrome, and Urea cycle disorders.

[0365] Liver Disorders

[0366] In yet another aspect, the present invention relates to the use of an oligonucleotide according to the invention or a conjugate thereof for the manufacture of a medicament for the treatment of a liver disorder, as well as to a method for treating a liver disorder, said method comprising administering an oligonucleotide according to the invention or a conjugate thereof, or a pharmaceutical composition according to the invention to a patient in need thereof.

[0367] In one preferred embodiment of the invention, the liver disorder is selected from the group consisting of Biliary Atresia, Alagille Syndrome, Alpha-1 Antitrypsin, Tyrosinemia, Neonatal Hepatitis, and Wilson Disease.

[0368] Other Uses

[0369] The oligonucleotides of the present invention can be utilized for as research reagents for diagnostics, therapeutics and prophylaxis. In research, the oligonucleotide may be used to specifically inhibit the synthesis of target genes in cells and experimental animals thereby facilitating functional analysis of the target or an appraisal of its usefulness as a target for therapeutic intervention. In diagnostics the oligonucleotides may be used to detect and quantitate target expression in cell and tissues by Northern blotting, in-situ hybridisation or similar techniques. For therapeutics, an animal or a human, suspected of having a disease or disorder, which can be treated by modulating the expression of target is treated by administering the oligonucleotide compounds in accordance with this invention. Further provided are methods of treating an animal particular mouse and rat and treating a human, suspected of having or being prone to a disease or condition, associated with expression of target by administering a therapeutically or prophylactically effective amount of one or more of the oligonucleotide compounds or compositions of the invention.

[0370] Therapeutic Use of Oligonucleotides Targeting miR-122a

[0371] In the examples section, it is demonstrated that a LNA-antimiR.TM., such as SPC3372, targeting miR-122a reduces plasma cholesterol levels. Therefore, another aspect of the invention is use of the above described oligonucleotides targeting miR-122a as medicine. Still another aspect of the invention is use of the above described oligonucleotides targeting miR-122a for the preparation of a medicament for treatment of increased plasma cholesterol levels. The skilled man will appreciate that increased plasma cholesterol levels is undesirable as it increases the risk of various conditions, e.g. atherosclerosis. Still another aspect of the invention is use of the above described oligonucleotides targeting miR-122a for upregulating the mRNA levels of Nrdg3, Aldo A, Bckdk or CD320.

Further Embodiments

[0372] The following embodiments may be combined with the other embodiments as described herein:

[0373] 1. An oligonucleotide having a length of from 12 to 26 nucleotides, wherein [0374] i) the first nucleotide, counting from the 3' end, is a locked nucleic acid (LNA) unit; [0375] ii) the second nucleotide, counting from the 3' end, is an LNA unit; and [0376] iii) the ninth and/or the tenth nucleotide, counting from the 3' end, is an LNA unit.

[0377] 2. The oligonucleotide according to claim 1, wherein the ninth nucleotide, counting from the 3' end, is an LNA unit.

[0378] 3. The oligonucleotide according to embodiment 1, wherein the tenth nucleotide, counting from the 3' end, is an LNA unit.

[0379] 4. The oligonucleotide according to embodiment 1, wherein both the ninth and the tenth nucleotide, calculated from the 3' end, are LNA units.

[0380] 5. The oligonucleotide according to any of embodiments 1-4, wherein said oligonucleotide comprises at least one LNA unit in positions three to eight, counting from the 3' end.

[0381] 6. The oligonucleotide according to embodiment 5, wherein said oligonucleotide comprises one LNA unit in positions three to eight, counting from the 3' end.

[0382] 7. The oligonucleotide according to embodiment 6, wherein the substitution pattern for the nucleotides in positions three to eight, counting from the 3' end, is selected from the group consisting of Xxxxxx, xXxxxx, xxXxxx, xxxXxx, xxxxXx and xxxxxX, wherein "X" denotes an LNA unit and "x" denotes a non-LNA unit.

[0383] 8. The oligonucleotide according to embodiment 5, wherein said oligonucleotide comprises at least two LNA units in positions three to eight, counting from the 3' end.

[0384] 9. The oligonucleotide according to embodiment 8, wherein said oligonucleotide comprises two LNA units in positions three to eight, counting from the 3' end.

[0385] 10. The oligonucleotide according to embodiment 9, wherein the substitution pattern for the nucleotides in positions three to eight, counting from the 3' end, is selected from the group consisting of XXxxxx, XxXxxx, XxxXxx, XxxxXx, XxxxxX, xXXxxx, xXxXxx, xXxxXx, xXxxxX, xxXXxx, xxXxXx, xxXxxX, xxxXXx, xxxXxX and xxxxXX, wherein "X" denotes an LNA unit and "x" denotes a non-LNA unit.

[0386] 11. The oligonucleotide according to embodiment 10, wherein the substitution pattern for the nucleotides in positions three to eight, counting from the 3' end, is selected from the group consisting of XxXxxx, XxxXxx, XxxxXx, XxxxxX, xXxXxx, xXxxXx, xXxxxX, xxXxXx, xxXxxX and xxxXxX, wherein "X" denotes an LNA unit and "x" denotes a non-LNA unit.

[0387] 12. The oligonucleotide according to embodiment 11, wherein the substitution pattern for the nucleotides in positions three to eight, counting from the 3' end, is selected from the group consisting of xXxXxx, xXxxXx, xXxxxX, xxXxXx, xxXxxX and xxxXxX, wherein "X" denotes an LNA unit and "x" denotes a non-LNA unit.

[0388] 13. The oligonucleotide according to embodiment 12, wherein the substitution pattern for the nucleotides in positions three to eight, counting from the 3' end, is selected from the group consisting of xXxXxx, xXxxXx and xxXxXx, wherein "X" denotes an LNA unit and "x" denotes a non-LNA unit.

[0389] 14. The oligonucleotide according to embodiment 13, wherein the substitution pattern for the nucleotides in positions three to eight, counting from the 3' end, is xXxXxx, wherein "X" denotes an LNA unit and "x" denotes a non-LNA unit.

[0390] 15. The oligonucleotide according to embodiment 5, wherein said oligonucleotide comprises at least three LNA units in positions three to eight, counting from the 3' end.

[0391] 16. The oligonucleotide according to embodiment 15, wherein said oligonucleotide comprises three LNA units in positions three to eight, counting from the 3' end.

[0392] 17. The oligonucleotide according to embodiment 16, wherein the substitution pattern for the nucleotides in positions three to eight, counting from the 3' end, is selected from the group consisting of XXXxxx, xXXXxx, xxXXXx, xxxXXX, XXxXxx, XXxxXx, XXxxxX, xXXxXx, xXXxxX, xxXXxX, XxXXxx, XxxXXx, XxxxXX, xXxXXx, xXxxXX, xxXxXX, xXxXxX and XxXxXx, wherein "X" denotes an LNA unit and "x" denotes a non-LNA unit.

[0393] 18. The oligonucleotide according to embodiment 17, wherein the substitution pattern for the nucleotides in positions three to eight, counting from the 3' end, is selected from the group consisting of XXxXxx, XXxxXx, XXxxxX, xXXxXx, xXXxxX, xxXXxX, XxXXxx, XxxXXx, XxxxXX, xXxXXx, xXxxXX, xxXxXX, xXxXxX and XxXxXx, wherein "X" denotes an LNA unit and "x" denotes a non-LNA unit.

[0394] 19. The oligonucleotide according to embodiment 18, wherein the substitution pattern for the nucleotides in positions three to eight, counting from the 3' end, is selected from the group consisting of xXXxXx, xXXxxX, xxXXxX, xXxXXx, xXxxXX, xxXxXX and xXxXxX, wherein "X" denotes an LNA unit and "x" denotes a non-LNA unit.

[0395] 20. The oligonucleotide according to embodiment 18, wherein the substitution pattern for the nucleotides in positions three to eight, counting from the 3' end, is xXxXxX or XxXxXx, wherein "X" denotes an LNA unit and "x" denotes a non-LNA unit.

[0396] 21. The oligonucleotide according to embodiment 20, wherein the substitution pattern for the nucleotides in positions three to eight, counting from the 3' end, is xXxXxX, wherein "X" denotes an LNA unit and "x" denotes a non-LNA unit.

[0397] 22. The oligonucleotide according to any of embodiment 7-21, wherein said non-LNA unit is a DNA unit.

[0398] 23. The oligonucleotide according to any of the preceding embodiments, wherein said nucleotide has a length of from 12 to 24 nucleotides, such as a length of from 12 to 22 nucleotides, preferably a length of from 12 to 20 nucleotides, such as a length of from 12 to 19 nucleotides, more preferably a length of from 12 to 18 nucleotides, such as a length of from 12 to 17 nucleotides, even more preferably a length of from 12 to 16 nucleotides.

[0399] 24. The oligonucleotide according to any of the preceding embodiments, wherein said oligonucleotide comprises at least one LNA unit, such as one LNA unit, from position 11, counting from the 3' end, to the 5' end.

[0400] 25. The oligonucleotide according to any of the preceding embodiments, wherein said oligonucleotide comprises at least two LNA units, such as two LNA units, from position 11, counting from the 3' end, to the 5' end.

[0401] 26. The oligonucleotide according to embodiment 24 or 25, wherein said oligonucleotide comprises 12 nucleotides and the substitution pattern for positions 11 to 12, counting from the 3' end, is selected from the group consisting of xX and Xx, wherein "X" denotes an LNA unit and "x" denotes a non-LNA unit.

[0402] 27. The oligonucleotide according to embodiment 26, wherein the substitution pattern for positions 11 to 12, counting from the 3' end, is xX, wherein "X" denotes an LNA unit and "x" denotes a non-LNA unit.

[0403] 28. The oligonucleotide according to embodiment 24 or 25, wherein said oligonucleotide comprises 13 nucleotides and the substitution pattern for positions 11 to 13, counting from the 3' end, is selected from the group consisting of Xxx, xXx, xxX, XXx, XxX, xXX and XXX, wherein "X" denotes an LNA unit and "x" denotes a non-LNA unit.

[0404] 29. The oligonucleotide according to embodiment 28, wherein the substitution pattern for positions 11 to 13, counting from the 3' end, is xxX, wherein "X" denotes an LNA unit and "x" denotes a non-LNA unit.

[0405] 30. The oligonucleotide according to embodiment 24 or 25, wherein said oligonucleotide comprises 14 nucleotides and the substitution pattern for positions 11 to 14, counting from the 3' end, is selected from the group consisting of Xxxx, xXxx, xxXx, xxxX, XXxx, XxXx, XxxX, xXXx, xXxX and xxXX, wherein "X" denotes an LNA unit and "x" denotes a non-LNA unit.

[0406] 31. The oligonucleotide according to embodiment 30, wherein the substitution pattern for positions 11 to 14, counting from the 3' end, is xXxX, wherein "X" denotes an LNA unit and "x" denotes a non-LNA unit.

[0407] 32. The oligonucleotide according to embodiment 24 or 25, wherein said oligonucleotide comprises 15 nucleotides and the substitution pattern for positions 11 to 15, counting from the 3' end, is selected from the group consisting of Xxxxx, xXxxx, xxXxx, xxxXx, xxxxX, XXxxx, XxXxx, XxxXx, XxxxX, xXXxx, xXxXx, xXxxX, xxXXx, xxXxX and xxxXX, wherein "X" denotes an LNA unit and "x" denotes a non-LNA unit.

[0408] 33. The oligonucleotide according to embodiment 32, wherein the substitution pattern for positions 11 to 15, counting from the 3' end, is xxXxX, wherein "X" denotes an LNA unit and "x" denotes a non-LNA unit.

[0409] 34. The oligonucleotide according to embodiment 24 or 25, wherein said oligonucleotide comprises 16 nucleotides and the substitution pattern for positions 11 to 16, counting from the 3' end, is selected from the group consisting of Xxxxxx, xXxxxx, xxXxxx, xxxXxx, xxxxXx, xxxxxX, XXxxxx, XxXxxx, XxxXxx, XxxxXx, XxxxxX, xXXxxx, xXxXxx, xXxxXx, xXxxxX, xxXXxx, xxXxXx, xxXxxX, xxxXXx, xxxXxX, xxxxXX, XXXxxx, XXxXxx, XXxxXx, XXxxxX, XxXXxx, XxXxXx, XxXxxX, XxxXXx, XxxXxX, XxxxXX, xXXXxx, xXXxX, xXXxxX, xXxXXx, xXxXxX, xXxxXX, xxXXXx, xxXXxX, xxXxXX and xxxXXX, wherein "X" denotes an LNA unit and "x" denotes a non-LNA unit.

[0410] 35. The oligonucleotide according to embodiment 34, wherein the substitution pattern for positions 11 to 16, counting from the 3' end, is xxXxxX, wherein "X" denotes an LNA unit and "x" denotes a non-LNA unit.

[0411] 36. The oligonucleotide according to embodiment 24 or 25, wherein said oligonucleotide comprises an LNA unit at the 5' end.

[0412] 37. The oligonucleotide according to embodiment 36 containing an LNA unit at the first two positions, counting from the 5' end.

[0413] 38. The oligonucleotide according to any of the preceding embodiments, wherein the oligonucleotide comprises at least one internucleoside linkage group which differs from phosphate.

[0414] 39. The oligonucleotide according to embodiment 38, wherein said internucleoside linkage group, which differs from phosphate, is phosphorothioate.

[0415] 40. The oligonucleotide according to embodiment 39, wherein all internucleoside linkage groups are phosphorothioate.

[0416] 41. The oligonucleotide according to any of the preceding embodiments, wherein said LNA units are independently selected from the group consisting of thio-LNA units, amino-LNA units and oxy-LNA units.

[0417] 42. The oligonucleotide according to embodiment 41, wherein said LNA units are in the beta-D-form.

[0418] 43. The oligonucleotide according to embodiment 41, wherein said LNA units are oxy-LNA units in the beta-D-form.

[0419] 44. The oligonucleotide according to any of the preceding embodiments for use as a medicament.

[0420] 45. A pharmaceutical composition comprising an oligonucleotide according to any of embodiments 1-43 and a pharmaceutically acceptable carrier.

[0421] 46. The composition according to embodiment 45, wherein said carrier is saline or buffered saline.

[0422] 47. Use of an oligonucleotide according to any of embodiments 1-43 for the manufacture of a medicament for the treatment of cancer.

[0423] 48. A method for the treatment of cancer, comprising the step of administering an oligonucleotide according to any of embodiments 1-43 or a composition according to embodiment 45.

REFERENCES

[0424] Abelson, J. F. et al. 2005. Science 310: 317-20.

[0425] Barrel, D. P. 2004. Cell 116: 281-297.

[0426] Boehm, M., Slack, F. 2005. Science. 310:1954-7.

[0427] Brennecke, J. et al. 2003 Cell 113: 25-36.

[0428] Calin, G. A. et al. 2002. Proc. Natl. Acad. Sci. USA 99: 15524-15529.

[0429] Calin, G. A. et al. 2004. Proc. Natl. Acad. Sci. U.S.A. 101: 2999-3004.

[0430] Calin, G. A. et al. 2005. N. Engl. J. Med. 353:1793-801

[0431] Chan, J. A. et al. 2005. Cancer Res. 65:6029-33.

[0432] Chen, C. Z., et al. 2004. Science 303: 83-86.

[0433] Chen, J. F., et al. 2005. Nat Genet. December 25, advance online publication.

[0434] Eis, P. S. et al. 2005. Proc Natl Acad Sci USA. 102: 3627-32.

[0435] Giraldez, A. J. et al. 2005. Science 308: 833-838.

[0436] Griffiths-Jones, S. et al. 2004. Nucleic Acids Res. 32: D109-D111.

[0437] Griffiths-Jones, S., et al. 2006. Nucleic Acids Res. 34: D140-4

[0438] He, L. et al. 2005. Nature 435: 828-833.

[0439] Hornstein, E. et al. 2005. Nature 438: 671-4.

[0440] Hutvagner, G. et al 2001. Science 293: 834-838.

[0441] Hutvagner, G. et al. 2004. PLoS Biology 2: 1-11.

[0442] Iorio, M. V. et al. 2005. Cancer Res. 65: 7065-70.

[0443] Jin, P. et al. 2004. Nat Cell Biol. 6: 1048-53.

[0444] Johnson, S. M. et al. 2005. Cell 120: 635-647.

[0445] Jopling, C. L. et al. 2005. Science 309:1577-81.

[0446] Ketting, R. F. et al. 2001. Genes Dev. 15: 2654-2659.

[0447] Kwon, C. et al. 2005. Proc Natl Acad Sci USA. 102: 18986-91.

[0448] Landthaler, M. et al. 2004. Curr. Biol. 14: 2162-2167.

[0449] Leaman, D. et al. 2005. Cell 121: 1097-108.

[0450] Lee, Y., et al. 2003. Nature 425: 415-419.

[0451] Li, X. and Carthew, R. W. 2005. Cell 123: 1267-77.

[0452] Lu. J. et al. 2005. Nature 435: 834-838.

[0453] Michael, M. Z. et al. 2003. Mol. Cancer Res. 1: 882-891.

[0454] Nelson, P. et al. 2003. TIBS 28: 534-540.

[0455] Paushkin, S., et al. 2002. Curr. Opin. Cell Biol. 14: 305-312.

[0456] Poy, M. N. et al. 2004. Nature 432: 226-230.

[0457] Wienholds, E. et al. 2005. Science 309: 310-311.

[0458] Yekta, S. et al. 2004. Science 304: 594-596.

[0459] Zhao, Y. et al. 2005. Nature 436: 214-220.

Experimental

Example 1

Monomer Synthesis

[0460] The LNA monomer building blocks and derivatives thereof were prepared following published procedures and references cited therein, see, e.g. WO 03/095467 A1 and D. S. Pedersen, C. Rosenbohm, T. Koch (2002) Preparation of LNA Phosphoramidites, Synthesis 6, 802-808.

Example 2

Oligonucleotide Synthesis

[0461] Oligonucleotides were synthesized using the phosphoramidite approach on an Expedite 8900/MOSS synthesizer (Multiple Oligonucleotide Synthesis System) at 1 .mu.mol or 15 .mu.mol scale. For larger scale synthesis an Akta Oligo Pilot (GE Healthcare) was used. At the end of the synthesis (DMT-on), the oligonucleotides were cleaved from the solid support using aqueous ammonia for 1-2 hours at room temperature, and further deprotected for 4 hours at 65.degree. C. The oligonucleotides were purified by reverse phase HPLC (RP-HPLC). After the removal of the DMT-group, the oligonucleotides were characterized by AE-HPLC, RP-HPLC, and CGE and the molecular mass was further confirmed by ESI-MS. See below for more details.

[0462] Preparation of the LNA-Solid Support:

[0463] Preparation of the LNA succinyl hemiester

[0464] 5'-O-Dmt-3'-hydroxy-LNA monomer (500 mg), succinic anhydride (1.2 eq.) and DMAP (1.2 eq.) were dissolved in DCM (35 mL). The reaction was stirred at room temperature overnight. After extractions with NaH.sub.2PO.sub.4 0.1 M pH 5.5 (2.times.) and brine (1.times.), the organic layer was further dried with anhydrous Na.sub.2SO.sub.4 filtered and evaporated. The hemiester derivative was obtained in 95% yield and was used without any further purification.

[0465] Preparation of the LNA-Support

[0466] The above prepared hemiester derivative (90 .mu.mol) was dissolved in a minimum amount of DMF, DIEA and pyBOP (90 .mu.mol) were added and mixed together for 1 min. This pre-activated mixture was combined with LCAA-CPG (500 .ANG., 80-120 mesh size, 300 mg) in a manual synthesizer and stirred. After 1.5 hours at room temperature, the support was filtered off and washed with DMF, DCM and MeOH. After drying, the loading was determined to be 57 .mu.mol/g (see Tom Brown, Dorcas J. S. Brown. Modern machine-aided methods of oligodeoxyribonucleotide synthesis. In: F. Eckstein, editor. Oligonucleotides and Analogues A Practical Approach. Oxford: IRL Press, 1991: 13-14).

[0467] Elongation of the Oligonucleotide

[0468] The coupling of phosphoramidites (A(bz), G(lbu), 5-methyl-C(bz)) or T-.beta.-cyanoethyl-phosphoramidite) is performed by using a solution of 0.1 M of the 5'-O-DMT-protected amidite in acetonitrile and DCI (4,5-dicyanoimidazole) in acetonitrile (0.25 M) as activator. The thiolation is carried out by using xanthane chloride (0.01 M in acetonitrile:pyridine 10%). The rest of the reagents are the ones typically used for oligonucleotide synthesis.

[0469] Purification by RP-HPLC:

[0470] Column: Xterra RP.sub.18

[0471] Flow rate: 3 mL/min

[0472] Buffers: 0.1 M ammonium acetate pH 8 and acetonitrile

[0473] Abbreviations:

[0474] DMT: Dimethoxytrityl

[0475] DCI: 4,5-Dicyanoimidazole

[0476] DMAP: 4-Dimethylaminopyridine

[0477] DCM: Dichloromethane

[0478] DMF: Dimethylformamide

[0479] THF: Tetrahydrofurane

[0480] DIEA: N,N-diisopropylethylamine

[0481] PyBOP:Benzotriazole-1-yl-oxy-tris-pyrrolidino-phosphonium hexafluorophosphate

[0482] Bz: Benzoyl

[0483] Ibu: Isobutyryl

Example 3

Design of the LNA Anti-miR Oligonucleotides and Melting Temperatures

TABLE-US-00003 [0484] Target microRNA: miR-122a: 5'-uggagugugacaaugguguuugu-3' SEQ ID NO: 535 miR-122a 3' to 5': 3'-uguuugugguaacagugugaggu-5' (SEQ ID NO: 535 reverse orientation)

TABLE-US-00004 TABLE 1 LNA anti-miR oligonucleotide sequences and T.sub.m: SEQ ID Tm NO: Oligo ID SED ID Sequence: (.degree. C.) 2 SPC3370 XxxX SEQ ID 585 5'-cCatTgtCacActCca- PS 75 design 3' backbone 3 SPC3372 XxxX SEQ ID 586 5'-ccAttGtcAcaCtcCa- PS 69 design 3' backbone 4 SPC3375 Gapmer SEQ ID 587 5'- PS 69 CCAttgtcacacTCCa-3' backbone 5 SPC3549 15-mer SEQ ID 588 5'-CcAttGTcaCaCtCC- PS 78 3' backbone 6 SPC3550 mismatch SEQ ID 589 5'-CcAttCTgaCcCtAC- PS 32 control 3' backbone 7 SPC3373 mismatch SEQ ID 590 5'-ccAttGtcTcaAtcCa- PS 46 control 3' backbone 8 SPC3548 13-mer SEQ ID 591 5'-AttGTcaCaCtCC-3' PS backbone

lower case: DNA, uppercase: LNA (all LNA C were methylated), underlined: mismatch

[0485] The melting temperatures were assessed towards the mature miR-122a sequence, using a synthetic miR-122a RNA oligonucleotide with phosphorothioate linkaged.

[0486] The LNA anti-miR/miR-122a oligo duplex was diluted to 3 .mu.M in 500 .mu.l RNase free H.sub.20, which was then mixed with 500 .mu.l 2.times. dimerization buffer (final oligo/duplex conc. 1.5 .mu.M, 2.times. Tm buffer: 200 mM NaCl, 0.2 mM EDTA, 20 mM NaP, pH 7.0, DEPC treated to remove RNases). The mix was first heated to 95 degrees for 3 minutes, then allowed to cool at room temperature (RT) for 30 minutes.

[0487] Following RT incubation T.sub.m was measured on Lambda 40 UV/VIS Spectrophotometer with peltier temperature programmer PTP6 using PE Templab software (Perkin Elmer). The Temperature was ramped up from 20.degree. C. to 95.degree. C. and then down again to 20.degree. C., continuously recording absorption at 260 nm. First derivative and local maximums of both the melting and annealing was used to assess melting/annealing point (T.sub.m), both should give similar/same T.sub.m values. For the first derivative 91 points was used to calculate the slope.

[0488] By substituting the antimir oligonucleotide and the complementary RNA molecule, the above assay can be used to determine the T.sub.m of other oligonucleotides such as the oligonucleotides according to the invention.

[0489] However, in one embodiment the T.sub.m may be made with a complementary DNA (phosphorothioate linkages) molecule. Typically the T.sub.m measured against a DNA complementary molecule is about 10.degree. C. lower than the T.sub.m with an equivalent RNA complement. The T.sub.m measured using the DNA complement may therefore be used in cases where the duplex has a very high T.sub.m.

[0490] Melting Temperature (T.sub.m) Measurements:

TABLE-US-00005 T.sub.m oligo to miR-122 RNA complement SPC3372 + miR-122a, RNA 69.degree. C. SPC3648 + miR-122a, RNA 74.degree. C. SPC3649 + miR-122a, RNA 79.degree. C. oligo to DNA complement SPC3372 + 122R, DNA 57.degree. C. SPC3649 + 122R, DNA 66.degree. C.

[0491] It is recognised that for oligonucleotides with very high T.sub.m, the above T.sub.m assays may be insufficient to determine the T.sub.m. In such an instance the use of a phosphorothioated DNA complementary molecule may further lower the T.sub.m.

[0492] The use of formamide is routine in the analysis of oligonucleotide hybridisation (see Hutton 1977, NAR 4 (10) 3537-3555). In the above assay the inclusion of 15% formamide typically lowers the T.sub.m by about 9.degree. C., and the inclusion of 50% formamide typically lowers the T.sub.m by about 30.degree. C. Using these ratios, it is therefore possible to determine the comparative T.sub.m of an oligonucleotide against its complementary RNA (phosphodiester) molecule, even when the T.sub.m of the duplex is, for example higher than 95.degree. C. (in the absence of formamide).

[0493] For oligonucleotides with a very high T.sub.m, an alternative method of determining the T.sub.m, is to make titrations and run it out on a gel to see single strand versus duplex and by those concentrations and ratios determine Kd (the dissociation constant) which is related to deltaG and also T.sub.m.

Example 4

Stability of LNA Oligonucleotides in Human or Rat Plasma

[0494] LNA oligonucleotide stability was tested in plasma from human or rats (it could also be mouse, monkey or dog plasma). In 45 .mu.l plasma, 5 .mu.l LNA oligonucleotide is added (at a final concentration of 20 .mu.M). The LNA oligonucleotides are incubated in plasma for times ranging from 0 to 96 hours at 37.degree. C. (the plasma is tested for nuclease activity up to 96 hours and shows no difference in nuclease cleavage-pattern).

[0495] At the indicated time the sample were snap frozen in liquid nitrogen. 2 .mu.L (equals 40 pmol) LNA oligonucleotide in plasma was diluted by adding 15 .mu.L of water and 3 .mu.L 6.times. loading dye (Invitrogen). As marker a 10 bp ladder (Invitrogen, USA 10821-015) is used. To 1 .mu.l ladder, 1 .mu.l 6.times. loading and 4 .mu.l water is added. The samples are mixed, heated to 65.degree. C. for 10 min and loaded to a pre-run gel (16% acrylamide, 7 M UREA, 1.times. TBE, pre-run at 50 Watt for 1 h) and run at 50-60 Watt for 21/2 hours. Subsequently, the gel is stained with 1.times. SyBR gold (molecular probes) in 1.times. TBE for 15 min. The bands were visualised using a phosphoimager from BioRad.

Example 5

In Vitro Model: Cell Culture

[0496] The effect of LNA oligonucleotides on target nucleic acid expression (amount) can be tested in any of a variety of cell types provided that the target nucleic acid is present at measurable levels. Target can be expressed endogenously or by transient or stable transfection of a nucleic acid encoding said nucleic acid.

[0497] The expression level of target nucleic acid can be routinely determined using, for example, Northern blot analysis (including microRNA northern), Quantitative PCR (including microRNA qPCR), Ribonuclease protection assays. The following cell types are provided for illustrative purposes, but other cell types can be routinely used, provided that the target is expressed in the cell type chosen.

[0498] Cells were cultured in the appropriate medium as described below and maintained at 37.degree. C. at 95-98% humidity and 5% CO.sub.2. Cells were routinely passaged 2-3 times weekly.

[0499] 15PC3: The human prostate cancer cell line 15PC3 was kindly donated by Dr. F. Baas, Neurozintuigen Laboratory, AMC, The Netherlands and was cultured in DMEM (Sigma)+10% fetal bovine serum (FBS)+Glutamax I+gentamicin.

[0500] PC3: The human prostate cancer cell line PC3 was purchased from ATCC and was cultured in F12 Coon's with glutamine (Gibco)+10% FBS+gentamicin.

[0501] 518A2: The human melanoma cancer cell line 518A2 was kindly donated by Dr. B. Jansen, Section of experimental Oncology, Molecular Pharmacology, Department of Clinical Pharmacology, University of Vienna and was cultured in DMEM (Sigma)+10% fetal bovine serum (FBS)+Glutamax I+gentamicin.

[0502] HeLa: The cervical carcinoma cell line HeLa was cultured in MEM (Sigma) containing 10% fetal bovine serum gentamicin at 37.degree. C., 95% humidity and 5% CO.sub.2.

[0503] MPC-11: The murine multiple myeloma cell line MPC-11 was purchased from ATCC and maintained in DMEM with 4 mM Glutamax+10% Horse Serum.

[0504] DU-145: The human prostate cancer cell line DU-145 was purchased from ATCC and maintained in RPMI with Glutamax+10% FBS.

[0505] RCC-4.+-.VHL: The human renal cancer cell line RCC4 stably transfected with plasmid expressing VHL or empty plasmid was purchased from ECACC and maintained according to manufacturers instructions.

[0506] 786-0: The human renal cell carcinoma cell line 786-0 was purchased from ATCC and maintained according to manufacturers instructions

[0507] HUVEC: The human umbilical vein endothelial cell line HUVEC was purchased from Camcrex and maintained in EGM-2 medium.

[0508] K562: The human chronic myelogenous leukaemia cell line K562 was purchased from ECACC and maintained in RPMI with Glutamax+10% FBS. U87MG: The human glioblastoma cell line U87MG was purchased from ATCC and maintained according to the manufacturers instructions.

[0509] B16: The murine melanoma cell line B16 was purchased from ATCC and maintained according to the manufacturers instructions.

[0510] LNCap: The human prostate cancer cell line LNCap was purchased from ATCC and maintained in RPMI with Glutamax+10% FBS

[0511] Huh-7: Human liver, epithelial like cultivated in Eagles MEM with 10% FBS, 2 mM Glutamax I, 1.times. non-essential amino acids, Gentamicin 25 .mu.g/ml

[0512] L428: (Deutsche Sammlung fur Mikroorganismen (DSM, Braunschwieg, Germany)): Human B cell lymphoma maintained in RPMI 1640 supplemented with 10% FCS, L-glutamine and antibiotics.

[0513] L1236: (Deutsche Sammlung fur Mikroorganismen (DSM, Braunschwieg, Germany)): Human B cell lymphoma maintained in RPMI 1640 supplemented with 10% FCS, L-glutamine and antibiotics.

Example 6

In Vitro Model: Treatment with LNA Anti-miR Antisense Oligonucleotide

[0514] The miR-122a expressing cell line Huh-7 was transfected with LNA anti-miRs at 1 and 100 nM concentrations according to optimized lipofectamine 2000 (LF2000, Invitrogen) protocol (as follows).

[0515] Huh-7 cells were cultivated in Eagles MEM with 10% FBS, 2mM Glutamax I, 1.times. non-essential amino acids, Gentamicin 25 .mu.g/ml. The cells were seeded in 6-well plates (300000 cells per well), in a total vol. of 2.5 ml the day before transfection. At the day of transfection a solution containing LF2000 diluted in Optimem (Invitrogen) was prepared (1.2 ml optimem+3.75 .mu.l LF2000 per well, final 2.5 pg LF2000/ml, final tot vol 1.5 ml).

[0516] LNA Oligonucleotides (LNA anti-miRs) were also diluted in optimem. 285 .mu.l optimem+15 .mu.l LNA oligonucleotide (10 .mu.M oligonucleotide stock for final concentration 100 nM and 0.1 .mu.M for final concentration 1 nM) Cells were washed once in optimem then the 1.2 ml optimem/LF2000 mix were added to each well. Cells were incubated 7 min at room temperature in the LF2000 mix where after the 300 .mu.l oligonucleotide optimem solution was added.

[0517] Cell were further incubated for four hours with oligonucleotide and lipofectamine2000 (in regular cell incubator at 37.degree. C., 5% CO2). After these four hours the medium/mix was removed and regular complete medium was added. Cells were allowed to grow for another 20 hours. Cells were harvested in Trizol (Invitrogen) 24 hours after transfection. RNA was extracted according to a standard Trizol protocol according to the manufacturer's instructions (Invitrogen), especially to retain the microRNA in the total RNA extraction.

Example 7

In Vitro and In Vivo Model: Analysis of Oligonucleotide Inhibition of miR Expression by microRNA Specific Quantitative PCR

[0518] miR-122a levels in the RNA samples were assessed on an ABI 7500 Fast real-time PCR instrument (Applied Biosystems, USA) using a miR-122a specific qRT-PCR kit, mirVana (Ambion, USA) and miR-122a primers (Ambion, USA). The procedure was conducted according to the manufacturers protocol.

[0519] Results:

[0520] The miR-122a -specific new LNA anti-miR oligonucleotide design (ie SPC3349 (also referred to as SPC 3549)), was more efficient in inhibiting miR-122a at 1 nM compared to previous design models, including "every-third" and "gap-mer" (SPC3370, SPC3372, SPC3375) motifs were at 100 nM. The mismatch control was not found to inhibit miR-122a (SPC3350). Results are shown in FIG. 1.

Example 8

Assessment of LNA antago-mir Knock-Down Specificity Using miRNA Microarray Expression Profiling

[0521] A) RNA Labeling for miRNA Microarray Profiling

[0522] Total RNA was extracted using Trizol reagent (Invitrogen) and 3'end labeled using T4 RNA ligase and Cy3- or Cy5-labeled RNA linker (5'-PO4-rUrUrU-Cy3/dT-3' or 5'-PO4-rUrUrU-Cy5/dT-3'). The labeling reactions contained 2-5 .mu.g total RNA, 15 .mu.M RNA linker, 50 mM Tris-HCl (pH 7.8), 10 mM MgCl2, 10 mM DTT, 1 mM ATP, 16% polyethylene glycol and 5 unit T4 RNA ligase (Ambion, USA) and were incubated at 30.degree. C. for 2 hours followed by heat inactivation of the T4 RNA ligase at 80.degree. C. for 5 minutes.

[0523] B) Microarray Hybridization and Post-Hybridization Washes

[0524] LNA-modified oligonucleotide capture probes comprising probes for all annotated miRNAs annotated from mouse (Mus musculus) and human (Homo sapiens) in the miRBase MicroRNA database Release 7.1 including a set of positive and negative control probes were purchased from Exiqon (Exiqon, Denmark) and used to print the microarrays for miRNA profiling. The capture probes contain a 5'-terminal C6-amino modified linker and were designed to have a Tm of 72.degree. C. against complementary target miRNAs by adjustment of the LNA content and length of the capture probes. The capture probes were diluted to a final concentration of 10 .mu.M in 150 mM sodium phosphate buffer (pH 8.5) and spotted in quadruplicate onto Codelink slides (Amersham Biosciences) using the MicroGrid II arrayer from BioRobotics at 45% humidity and at room temperature. Spotted slides were post-processed as recommended by the manufacturer.

[0525] Labeled RNA was hybridized to the LNA microarrays overnight at 65.degree. C. in a hybridization mixture containing 4.times.SSC, 0.1% SDS, 1 .mu.g/.mu.l Herring Sperm DNA and 38% formamide. The hybridized slides were washed three times in 2.times.SSC, 0.025% SDS at 65.degree. C., followed by three times in 0.08.times.SSC and finally three times in 0.4.times.SSC at room temperature.

[0526] C) Array Scanning, Image Analysis and Data Processing

[0527] The microarrays were scanned using the ArrayWorx scanner (Applied Precision, USA) according to the manufacturer's recommendations. The scanned images were imported into TIGR Spotfinder version 3.1 (Saeed et al., 2003) for the extraction of mean spot intensities and median local background intensities, excluding spots with intensities below median local background+4.times. standard deviations. Background-correlated intensities were normalized using variance stabilizing normalization package version 1.8.0 (Huber et al., 2002) for R (www.r-project.org). Intensities of replicate spots were averaged using Microsoft Excel. Probes displaying a coefficient of variance>100% were excluded from further data analysis.

Example 9

Detection of MicroRNAs by In Situ Hybridization Detection of MicroRNAs in Formalin-Fixed Paraffin-Embedded Tissue Sections by In Situ Hybridization

[0528] A) Preparation of the formalin-fixed, paraffin-embedded sections for in situ hybridization Archival paraffin-embedded samples are retrieved and sectioned at 5 to 10 mm sections and mounted in positively-charged slides using floatation technique. Slides are stored at 4.degree. C. until the in situ experiments are conducted.

[0529] B) In Situ Hybridization

[0530] Sections on slides are deparaffinized in xylene and then rehydrated through an ethanol dilution series (from 100% to 25%). Slides are submerged in DEPC-treated water and subject to HCl and 0.2% Glycine treatment, re-fixed in 4% paraformaldehyde and treated with acetic anhydride/triethanolamine; slides are rinsed in several washes of 1.times.PBS in-between treatments. Slides are pre-hybridized in hyb solution (50% formamide, 5.times.SSC, 500 mg/mL yeast tRNA, 1.times. Denhardt) at 50.degree. C. for 30 min. Then, 3 pmol of a FITC-labeled LNA probe (Exiqon, Denmark) complementary to each selected miRNA is added to the hyb. solution and hybridized for one hour at a temperature 20-25.degree. C. below the predicted Tm of the probe (typically between 45-55.degree. C. depending on the miRNA sequence). After washes in 0.1.times. and 0.5.times.SCC at 65.degree. C., a tyramide signal amplification reaction was carried out using the Genpoint Fluorescein (FITC) kit (DakoCytomation, Denmark) following the vendor's recommendations. Finally, slides are mounted with Prolong Gold solution. Fluorescence reaction is allowed to develop for 16-24 hr before documenting expression of the selected miRNA using an epifluorescence microscope.

[0531] Detection of MicroRNAs by Whole-Mount In Situ Hybridization of Zebrafish, Xenopus and Mouse Embryos.

[0532] All washing and incubation steps are performed in 2 ml eppendorf tubes. Embryos are fixed overnight at 4.degree. C. in 4% paraformaldehyde in PBS and subsequently transferred through a graded series (25% MeOH in PBST (PBS containing 0.1% Tween-20), 50% MeOH in PBST, 75% MeOH in PBST) to 100% methanol and stored at -20.degree. C. up to several months. At the first day of the in situ hybridization embryos are rehydrated by successive incubations for 5 min in 75% MeOH in PBST, 50% MeOH in PBST, 25% MeOH in PBST and 100% PBST (4.times.5 min).

[0533] Fish, mouse and Xenopus embryos are treated with proteinaseK (10 .mu.g/ml in PBST) for 45 min at 37.degree. C., refixed for 20 min in 4% paraformaldehyde in PBS and washed 3.times.5 min with PBST. After a short wash in water, endogenous alkaline phosphatase activity is blocked by incubation of the embryos in 0.1 M tri-ethanolamine and 2.5% acetic anhydride for 10 min, followed by a short wash in water and 5.times.5 min washing in PBST. The embryos are then transferred to hybridization buffer (50% Formamide, 5.times.SSC, 0.1% Tween, 9.2 mM citric acid, 50 ug/ml heparin, 500 ug/ml yeast RNA) for 2-3 hour at the hybridization temperature. Hybridization is performed in fresh pre-heated hybridization buffer containing 10 nM of 3' DIG-labeled LNA probe (Roche Diagnostics) complementary to each selected miRNA. Post-hybridization washes are done at the hybridization temperature by successive incubations for 15 min in HM-(hybridization buffer without heparin and yeast RNA), 75% HM-/25% 2.times.SSCT (SSC containing 0.1% Tween-20), 50% HM-/50% 2.times.SSCT, 25% HM-/75% 2.times.SSCT, 100% 2.times.SSCT and 2.times.30 min in 0.2.times.SSCT.

[0534] Subsequently, embryos are transferred to PBST through successive incubations for 10 min in 75% 0.2.times.SSCT/25% PBST, 50% 0.2.times.SSCT/50% PBST, 25% 0.2.times.SSCT/75% PBST and 100% PBST. After blocking for 1 hour in blocking buffer (2% sheep serum/2 mg:ml BSA in PBST), the embryos are incubated overnight at 4.degree. C. in blocking buffer containing anti-DIG-AP FAB fragments (Roche, 1/2000). The next day, zebrafish embryos are washed 6.times.15 min in PBST, mouse and X. tropicalis embryos are washed 6.times.1 hour in TBST containing 2 mM levamisole and then for 2 days at 4.degree. C. with regular refreshment of the wash buffer.

[0535] After the post-antibody washes, the embryos are washed 3.times.5 min in staining buffer (100 mM tris HCl pH9.5, 50 mM MgCl2, 100 mM NaCl, 0.1% tween 20). Staining was done in buffer supplied with 4.5 .mu.l/ml NBT (Roche, 50 mg/ml stock) and 3.5 .mu.l/ml BCIP (Roche, 50 mg/ml stock). The reaction is stopped with 1 mM EDTA in PBST and the embryos are stored at 4.degree. C. The embryos are mounted in Murray's solution (2:1 benzylbenzoate:benzylalcohol) via an increasing methanol series (25% MeOH in PBST, 50% MeOH in PBST, 75% MeOH in PBST, 100% MeOH) prior to imaging.

Example 10

In Vitro Model: Isolation and Analysis of mRNA Expression (Total RNA Isolation and cDNA Synthesis for mRNA Analysis)

[0536] Total RNA was isolated either using RNeasy mini kit (Qiagen) or using the Trizol reagent (Invitrogen). For total RNA isolation using RNeasy mini kit (Qiagen), cells were washed with PBS, and Cell Lysis Buffer (RTL, Qiagen) supplemented with 1% mercaptoethanol was added directly to the wells. After a few minutes, the samples were processed according to manufacturer's instructions.

[0537] For in vivo analysis of mRNA expression tissue samples were first homogenised using a Retsch 300MM homogeniser and total RNA was isolated using the Trizol reagent or the RNeasy mini kit as described by the manufacturer.

[0538] First strand synthesis (cDNA from mRNA) was performed using either OmniScript Reverse Transcriptase kit or M-MLV Reverse transcriptase (essentially described by manufacturer (Ambion)) according to the manufacturer's instructions (Qiagen). When using OmniScript Reverse Transcriptase 0.5 .mu.g total RNA each sample, was adjusted to 12 .mu.l and mixed with 0.2 .mu.l poly (dT).sub.12-18 (0.5 .mu.g/.mu.l) (Life Technologies), 2 .mu.l dNTP mix (5 mM each), 2 .mu.l 10.times. RT buffer, 0.5 .mu.l RNAguard.TM. RNase Inhibitor (33 units/ml, Amersham) and 1 .mu.l OmniScript Reverse Transcriptase followed by incubation at 37.degree. C. for 60 min. and heat inactivation at 93.degree. C. for 5 min.

[0539] When first strand synthesis was performed using random decamers and M-MLV-Reverse Transcriptase (essentially as described by manufacturer (Ambion)) 0.25 .mu.g total RNA of each sample was adjusted to 10.8 .mu.l in H.sub.2O. 2 .mu.l decamers and 2 .mu.l dNTP mix (2.5 mM each) was added. Samples were heated to 70.degree. C. for 3 min. and cooled immediately in ice water and added 3.25 .mu.l of a mix containing (2 .mu.l 10.times. RT buffer; 1 .mu.l M-MLV Reverse Transcriptase; 0.25 .mu.l RNAase inhibitor). cDNA is synthesized at 42.degree. C. for 60 min followed by heating inactivation step at 95.degree. C. for 10 min and finally cooled to 4.degree. C. The cDNA can further be used for mRNA quantification by for example Real-time quantitative PCR.

[0540] mRNA expression can be assayed in a variety of ways known in the art. For example, mRNA levels can be quantitated by, e.g., Northern blot analysis, competitive polymerase chain reaction (PCR), Ribonuclease protection assay (RPA) or real-time PCR. Real-time quantitative PCR is presently preferred. RNA analysis can be performed on total cellular RNA or mRNA.

[0541] Methods of RNA isolation and RNA analysis such as Northern blot analysis are routine in the art and is taught in, for example, Current Protocols in Molecular Biology, John Wiley and Sons.

[0542] Real-time quantitative (PCR) can be conveniently accomplished using the commercially available iQ Multi-Color Real Time PCR Detection System available from BioRAD. Real-time Quantitative PCR is a technique well-known in the art and is taught in for example Heid et al. Real time quantitative PCR, Genome Research (1996), 6: 986-994.

Example 11

LNA Oligonucleotide Uptake and Efficacy In Vivo

[0543] In vivo study: Six groups of animals (5 mice per group) were treated in the following manner. Group 1 animals were injected with 0.2 ml saline by i.v. on 3 successive days, Group 2 received 2.5 mg/kg SPC3372, Group 3 received 6.25 mg/kg, Group 4 received 12.5 mg/kg and Group 5 received 25 mg/kg, while Group 6 received 25 mg/kg SPC 3373 (mismatch LNA-antimiR.TM. oligonucleotide), all in the same manner. All doses were calculated from the Day 0 body weights of each animal.

[0544] Before dosing (Day 0) and 24 hour after last dose (Day 3), retro-orbital blood was collected in tubes containing EDTA and the plasma fraction harvested and stored frozen -80.degree. C. for cholesterol analysis. At sacrifice livers were dissected and one portion was cut into 5 mm cubes and immersed in 5 volumes of ice-cold RNAlater. A second portion was snap frozen in liquid nitrogen and stored for cryo-sectioning.

[0545] Total RNA was extracted from liver samples as described above and analysed for miR-122a levels by microRNA specific QPCR. FIG. 5 demonstrates a clear dose-response obtained with SPC3372 with an IC50 at ca 3-5 mg/kg, whereas no miR-122a inhibition was detected using the mismatch LNA antago-mir SPC 3373 for miR-122a.

Example 12

LNA-AntimiR-122a Dose-Response In Vivo in C57/BL/3 Female Mice

[0546] In vivo study: Ten groups of animals (female C57/BL6; 3 mice per group) were treated in the following manner. Group 1 animals were injected with 0.2 ml saline by i.p. on day 0, day 2 and day 4. Groups 2-10 were dosed by i.p. with three different conc. (25 mg/kg, 5 mg/kg and 1 mg/kg) of either LNA antimiR-122a/SPC3372 (group 2-4), LNA antimir-122a/SPC3548 (group 5-7) or LNA antimir-122a/SPC3549 (group 8-10); the LNA antimir-122a sequences are given in the Table 1. All three LNA antimiR-122a oligonucleotides target the liver-specific miR-122a. The doses were calculated from the Day 0 body weights of each animal.

[0547] The animals were sacrificed 48 hours after last dose (Day 6), retro-orbital blood was collected in tubes containing EDTA and the plasma fraction harvested and stored frozen -80.degree. C. for cholesterol analysis. At sacrifice livers were dissected and one portion was cut into 5 mm cubes and immersed in 5 volumes of ice-cold RNAlater. A second portion was snap frozen in liquid nitrogen and stored for cryo-sectioning.

[0548] Total RNA was extracted from liver samples using Trizol reagent according to the manufacturer's recommendations (Invitrogen, USA) and analysed for miR-122a levels by microRNA-specific QPCR according to the manufacturer's recommendations (Ambion, USA). FIG. 2 demonstrates a clear dose-response obtained with all three LNA antimir-122a molecules (SPC3372, SPC3548, SPC3549). Both SPC3548 and SPC3549 show significantly improved efficacy in vivo in miR-122a silencing (as seen from the reduced miR-122a levels) compared to SPC3372, with SPC3549 being most potent (IC.sub.50 ca 1 mg/kg).

[0549] The above example was repeated using SPC3372 and SPC 3649 using 5 mice per group and the data combined (total of eight mice per group) is shown in FIG. 2b.

Example 12a

Northern Blot

[0550] MicroRNA specific northern blot showing enhanced miR-122 blocking by SPC3649 compared to SPC3372 in LNA-antimiR treated mouse livers.

[0551] Oligos Used in This Example:

TABLE-US-00006 SPC3649: 5'-CcAttGTcaCaCtCC-3' (SEQ ID 539) New design SPC3372: 5'-CcAttGtcAcaCtcCa-3' (SEQ ID 586) Old design

[0552] We decided to assess the effect of SPC3649 on miR-122 miRNA levels in the livers of SPC3649-treated mice. The LNA-antimiRs SPC3649 and SPC3372 were administered into mice by three i.p. injections on every second day over a six-day-period at indicated doses followed by sacrificing the animals 48 hours after the last dose. Total RNA was extracted from the livers. miR-122 levels were assessed by microRNA specific northern blot (FIG. 6)

[0553] Treatment of normal mice with SPC3649 resulted in dramatically improved, dose-dependent reduction of miR-122. MicroRNA specific northern blot comparing SPC3649 with SPC3372 was performed (FIG. 6). SPC3649 completely blocked miR-122 at both 5 and 25 mg/kg as seen by the absence of mature single stranded miR-122 and only the presence of the duplex band between the LNA-antimiR and miR-122. Comparing duplex versus mature band on the northern blot SPC3649 seem equally efficient at 1 mg/kg as SPC3372 at 25 mg/kg.

Example 13

Assessment of Cholesterol Levels in Plasma in LNA Anti-miR122 Treated Mice

[0554] Total cholesterol level was measured in plasma using a colometric assay Cholesterol CP from ABX Pentra. Cholesterol was measured following enzymatic hydrolysis and oxidation (2.3). 21.5 .mu.l water was added to 1.5 .mu.l plasma. 250 .mu.l reagent was added and within 5 min the cholesterol content measured at a wavelength of 540 nM. Measurements on each animal were made in duplicate. The sensitivity and linearity was tested with 2-fold diluted control compound (ABX Pentra N control). The cholesterol level was determined by subtraction of the background and presented relative to the cholesterol levels in plasma of saline treated mice.

[0555] FIG. 3 demonstrates a markedly lowered level of plasma cholesterol in the mice that received SPC3548 and SPC3549 compared to the saline control at Day 6.

Example 14

Assessment of miR-122a Target mRNA Levels in LNA AntimiR-122a Treated Mice

[0556] The saline control and different LNA-antimiR-122a treated animals were sacrificed 48 hours after last dose (Day 6), and total RNA was extracted from liver samples as using Trizol reagent according to the manufacturer's recommendations (Invitrogen, USA). The mRNA levels were assessed by real-time quantitative RT-PCR for two miR-122a target genes, Bckdk (branched chain ketoacid dehydrogenase kinase, ENSMUSG0000030802) and aldolase A (aldoA, ENSMUSG00000030695), respectively, as well as for GAPDH as control, using Taqman assays according to the manufacturer's instructions (Applied biosystems, USA). FIGS. 4a and 4b demonstrate a clear dose-dependent upregulation of the two miR-122a target genes, Bckdk and AldoA, respectively, as a response to treatment with all three LNA antimiR-122a molecules (SPC3372, SPC3548, SPC3549). In contrast, the qPCR assays for GAPDH control did not reveal any differences in the GAPD mRNA levels in the LNA-antimiR-122a treated mice compared to the saline control animals (FIG. 4c). The Bckdk and AldoA mRNA levels were significantly higher in the SPC3548 and SPC3549 treated mice compared to the SPC3372 treated mice (FIGS. 4a and 4b), thereby demonstrating their improved in vivo efficacy.

Example 15

LNA Oligonucleotide Duration of Action In Vivo

[0557] In vivo study: Two groups of animals (21 mice per group) were treated in the following manner. Group 1 animals were injected with 0.2 ml saline by i.v. on 3 successive days, Group 2 received 25mg/kg SPC3372 in the same manner. All doses were calculated from the Day 0 body weights of each animal.

[0558] After last dose (Day 3), 7 animals from each group were sacrificed on Day 9, Day 16 and Day 23, respectively. Prior to this, on each day, retro-orbital blood was collected in tubes containing EDTA and the plasma fraction harvested and stored frozen -80.degree. C. for cholesterol analysis from each day. At sacrifice livers were dissected and one portion was cut into 5 mm cubes and immersed in 5 volumes of ice-cold RNAlater. A second portion was snap frozen in liquid nitrogen and stored for cryo-sectioning.

[0559] Total RNA was extracted from liver samples as described above and analysed for miR-122a levels by microRNA specific QPCR. FIG. 7 (Sacrifice day 9, 16 or 23 correspond to sacrifice 1, 2 or 3 weeks after last dose) demonstrates a two-fold inhibition in the mice that received SPC3372 compared to the saline control, and this inhibition could still be detected at Day 16, while by Day 23 the mi122a levels approached those of the saline group.

Example 16

LNA Oligonucleotide Duration of Action In Vivo

[0560] In vivo study: Two groups of animals (21 mice per group) were treated in the following manner. Group 1 animals were injected with 0.2 ml saline by i.v. on 3 successive days, Group 2 received 25 mg/kg SPC3372 in the same manner. All doses were calculated from the Day 0 body weights of each animal.

[0561] After last dose (Day 3), 7 animals from each group were sacrificed on Day 9, Day 16 and Day 23, respectively. Prior to this, on each day, retro-orbital blood was collected in tubes containing EDTA and the plasma fraction harvested and stored frozen -80.degree. C. for cholesterol analysis from each day. At sacrifice livers were dissected and one portion was cut into 5 mm cubes and immersed in 5 volumes of ice-cold RNAlater. A second portion was snap frozen in liquid nitrogen and stored for cryo-sectioning.

[0562] Total RNA was extracted from liver samples as described above and analysed for miR-122a levels by microRNA specific QPCR. FIG. 8 demonstrates a two-fold inhibition in the mice that received SPC3372 compared to the saline control, and this inhibition could still be detected at Day 16, while by Day23 the miR-122a levels approached those of the saline group.

As to Examples 17-22, the Following Procedures Apply

[0563] NMRI mice were administered intravenously with SPC3372 using daily doses ranging from 2.5 to 25 mg/kg for three consecutive days. Animals were sacrificed 24 hours, 1, 2 or 3 weeks after last dose. Livers were harvested divided into pieces and submerged in RNAlater (Ambion) or snap-frozen. RNA was extracted with Trizol reagent according to the manufacturer's instructions (Invitrogen) from the RNAlater tissue, except that the precipitated RNA was washed in 80% ethanol and not vortexed. The RNA was used for mRNA TaqMan qPCR according to manufacturer (Applied biosystems) or northern blot (see below). The snap-frozen pieces were cryo-sectioned for in situ hybridizations.

[0564] Further, as to FIGS. 9-14, SPC3372 is designated LNA-antimiR and SPC3373 (the mismatch control) is designated "mm" instead of using the SPC number.

Example 17

Dose Dependent miR-122a Target mRNA Induction by SPC3372 Inhibition of miR-122a

[0565] Mice were treated with different SPC3372 doses for three consecutive days, as described above and sacrificed 24 hours after last dose. Total RNA extracted from liver was subjected to qPCR. Genes with predicted miR-122 target site and observed to be upregulated by microarray analysis were investigated for dose-dependent induction by increasing SPC3372 doses using qPCR. Total liver RNA from 2 to 3 mice per group sacrificed 24 hours after last dose were subjected to qPCR for the indicated genes. Shown in FIG. 9 is mRNA levels relative to Saline group, n=2-3 (2.5-12.5 mg/kg/day: n=2, no SD). Shown is also the mismatch control (mm, SPC3373).

[0566] Assayed genes: Nrdg3 Aldo A, Bckdk, CD320 with predicted miR-122 target site. Aldo B and Gapdh do not have a predicted miR-122a target site.

[0567] A clear dose-dependent induction was seen of the miR-122a target genes after treatment with different doses of SPC3372.

Example 18

Transient Induction of miR-122a Target mRNAs Following SPC3372 Treatment

[0568] NMRI female mice were treated with 25 mg/kg/day SPC3372 along with saline control for three consecutive days and sacrificed 1, 2 or 3 weeks after last dose, respectively. RNA was extracted from livers and mRNA levels of predicted miR-122a target mRNAs, selected by microarray data were investigated by qPCR. Three animals from each group were analysed.

[0569] Assayed genes: Nrdg3 Aldo A, Bckdk, CD320 with predicted miR-122 target site. Gapdh does not have a predicted miR-122a target site.

[0570] A transient induction followed by a restoration of normal expression levels in analogy with the restoration of normal miR-122a levels was seen (FIG. 10).

[0571] mRNA levels are normalized to the individual GAPDH levels and to the mean of the Saline treated group at each individual time point. Included are also the values from the animals sacrificed 24 hours after last dose. Shown is mean and standard deviation, n=3 (24 h n=3)

Example 19

Induction of Vldlr in Liver by SPC3372 Treatment

[0572] The same liver RNA samples as in previous example were investigated for Vldlr induction.

[0573] A transient up-regulation was seen after SPC3372 treatment, as with the other predicted miR-122a target mRNAs (FIG. 11)

Example 20

Stability of miR-122a/SPC3372 Duplex in Mouse Plasma

[0574] Stability of SPC3372 and SPC3372/miR-122a duplex were tested in mouse plasma at 37.degree. C. over 96 hours. Shown in FIG. 12 is a SYBR-Gold stained PAGE.

[0575] SPC3372 was completely stable over 96 hours. The SPC3372/miR-122a duplex was immediately truncated (degradation of the single stranded miR-122a region not covered by SPC3372) but thereafter almost completely stable over 96 hours.

[0576] The fact that a preformed SPC3372/miR-122 duplex showed stability in serum over 96 hours together with the high thermal duplex stability of SPC3372 molecule supported our notion that inhibition of miR-122a by SPC3372 was due to stable duplex formation between the two molecules, which has also been reported in cell culture (Naguibneva et al. 2006).

Example 21

Sequestering of Mature miR-122a by SPC3372 Leads to Duplex Formation

[0577] The liver RNA was also subjected to microRNA Northern blot. Shown in FIG. 13 is a membrane probed with a miR-122a specific probe (upper panel) and re-probed with a Let-7 specific probe (lower panel). With the miR-122 probe, two bands could be detected, one corresponding to mature miR-122 and one corresponding to a duplex between SPC3372 and miR-122.

[0578] To confirm silencing of miR-122, liver RNA samples were subjected to small RNA northern blot analysis, which showed significantly reduced levels of detectable mature miR-122, in accordance with our real-time RT-PCR results. By comparison, the levels of the let-7a control were not altered. Interestingly, we observed dose-dependent accumulation of a shifted miR-122/SPC3372 heteroduplex band, suggesting that SPC3372 does not target miR-122 for degradation, but rather binds to the microRNA, thereby sterically hindering its function.

[0579] Northern Blot Analysis was Performed as Follows:

[0580] Preparation of northern membranes was done as described in Sempere et al. 2002, except for the following changes: Total RNA, 10 .mu.g per lane, in formamide loading buffer (47.5% formamide, 9 mM EDTA, 0.0125% Bromophenol Blue, 0.0125% Xylene Cyanol, 0.0125% SDS) was loaded onto a 15% denaturing Novex TBE-Urea polyacrylamide gel (Invitrogen) without preheating the RNA. The RNA was electrophoretically transferred to a GeneScreen plus Hybridization Transfer Membrane (PerkinElmer) at 200 mA for 35 min. Membranes were probed with 32P-labelled LNA-modified oligonucleotides complimentary to the mature microRNAs*. The LNA oligonucleotides were labelled and hybridized to the membrane as described in (Valoczi et al. 2004) except for the following changes: The prehybridization and hybridization solutions contained 50% formamide, 0.5% SDS, 5.times.SSC, 5.times. Denhardt's solution and 20 .mu.g/ml sheared denatured herring sperm DNA. Hybridizations were performed at 45.degree. C. The blots were visualized by scanning in a Storm 860 scanner. The signal of the background membrane was subtracted from the radioactive signals originating from the miRNA bands. The values of the miR-122 signals were corrected for loading differences based on the let-7a signal. To determine the size of the radioactive signals the Decade Marker System (Ambion) was used according to the suppliers' recommendations.

Example 22

miR-122a Sequestering by SPC3372 Along with SPC3372 Distribution Assessed by In Situ Hybridization of Liver Sections

[0581] Liver cryo-sections from treated animals were subjected to in situ hybridizations for detection and localization of miR-122 and SPC3372 (FIG. 14). A probe complementary to miR-122 could detect miR-122a. A second probe was complementary to SPC3372. Shown in FIG. 14 is an overlay, in green is distribution and apparent amounts of miR-122a and SPC3372 and blue is DAPI nuclear stain, at 10.times. magnification. 100.times. magnifications reveal the intracellular distribution of miR-122a and SPC3372 inside the mouse liver cells. The liver sections from saline control animals showed a strong miR-122 staining pattern over the entire liver section, whereas the sections from SPC3372 treated mice showed a significantly reduced patchy staining pattern. In contrast, SPC3372 molecule was readily detected in SPC3372 treated liver, but not in the untreated saline control liver. Higher magnification localized miR-122a to the cytoplasm in the hepatocytes, where the miR-122 in situ pattern was clearly compartmentalized, while SPC3372 molecule was evenly distributed in the entire cytoplasm.

Example 23

Micro Array Analysis

[0582] We carried out genome-wide expression profiling of total RNA samples from saline LNA-antimiR-122 treated and LNA mismatch control treated mice livers 24 hours after the last dose using Affymetrix Mouse Genome 430 2.0 arrays. Analysis of the array data revealed 455 transcripts that were upregulated in the LNA-antimiR treated mice livers compared to saline and LNA mismatch controls, while 54 transcripts were downregulated (FIG. 15a). A total of 415 of the upregulated and 53 downregulated transcripts could be identified in the Ensembl database. We subsequently examined the 3' untranslated regions (UTRs) of the differentially expressed mRNAs for the presence of the 6 nt sequence CACTCC, corresponding to the reverse complement of the nucleotide 2-7 seed region in mature miR-122. The number of transcripts having at least one miR-122 recognition sequence was 213 (51%) among the upregulated transcripts, and 10 (19%) within the downregulated transcripts, while the frequency in a random sequence population was 25%, implying that a significant pool of the upregulated mRNAs represent direct miR-122 targets in the liver (FIG. 15b).

[0583] The LNA-antimiR treatment showed maximal reduction of miR-122 levels at 24 hours, 50% reduction at one week and matched saline controls at three weeks after last LNA dose (Example 12 "old design"). This coincided with a markedly reduced number of differentially expressed genes between the two mice groups at the later time points. Compared to the 509 mRNAs 24 hours after the last LNA dose we identified 251 differentially expressed genes after one week, but only 18 genes after three weeks post treatment (FIGS. 15c and 15d). In general genes upregulated 24 hours after LNA-antimiR treatment then reverted towards control levels over the next two weeks (FIG. 15d).

[0584] In conclusion, a large portion of up-regulated/de-repressed genes after LNA-antimiR treatment are miR-122 targets, indicating a very specific effect for blocking miR-122. Also genes up-regulated/de-repressed approach normal levels 3 weeks after end of treatment, suggest a relative long therapeutic effect, but however not cause a permanent alteration, ie the effect is reversible.

[0585] Methods:

[0586] Gene Expression Profiling of LNA-AntimiR Treated Mice.

[0587] Expression profiles of livers of saline and LNA-antimiR treated mice were compared. NMRI female mice were treated with 25 mg/kg/day of LNA-antimiR along with saline control for three consecutive days and sacrificed 24 h, 1, 2 or 3 weeks after last dose. Additionally, expression profiles of livers of mice treated with the mismatch LNA control oligonucleotide 24 h after last dose were obtained. Three mice from each group were analyzed, yielding a total of 21 expression profiles. RNA quality and concentration was measured using an Agilent 2100 Bioanalyzer and Nanodrop ND-1000, respectively. Total RNA was processed following the GeneChip Expression 3'-Amplification Reagents One-cycle cDNA synthesis kit instructions (Affymetrix Inc, Santa Clara, Calif., USA) to produce double-stranded cDNA. This was used as a template to generate biotin-labeled cRNA following manufacturer's specifications. Fifteen micrograms of biotin-labeled cRNA was fragmented to strands between 35 and 200 bases in length, of which 10 micrograms were hybridised onto Affymetrix Mouse Genome 430 2.0 arrays overnight in the GeneChip Hybridisation oven 6400 using standard procedures. The arrays were washed and stained in a GeneChip Fluidics Station 450. Scanning was carried out using the GeneChip Scanner 3000 and image analysis was performed using GeneChip Operating Software. Normalization and statistical analysis were done using the LIMMA software package for the R programming environment27. Probes reported as absent by GCOS software in all hybridizations were removed from the dataset. Additionally, an intensity filter was applied to the dataset to remove probes displaying background-corrected intensities below 16. Data were normalized using quantile normalization28. Differential expression was assessed using a linear model method. P values were adjusted for multiple testing using the Benjamini and Hochberg. Tests were considered to be significant if the adjusted p values were p<0.05. Clustering and visualization of Affymetrix array data were done using the MultiExperiment Viewer software29.

[0588] Target Site Prediction

[0589] Transcripts with annotated 3' UTRs were extracted from the Ensembl database (Release 41) using the EnsMart data mining tool30 and searched for the presence of the CACTCC sequence which is the reverse complement of the nucleotide 2-7 seed in the mature miR-122 sequence. As a background control, a set of 1000 sequences with a length of 1200 nt, corresponding to the mean 3' UTR length of the up- and downregulated transcripts at 24 h after last LNA-antimiR dose, were searched for the 6 nucleotide miR-122 seed matches. This was carried out 500 times and the mean count was used for comparison

Example 24

Dose-Dependent Inhibition of miR-122 in Mouse Liver by LNA-AntimiR is Enhanced as Compared to antagomir Inhibition of miR-122

[0590] NMRI female mice were treated with indicated doses of LNA-antimiR (SPC3372) along with a mismatch control (mm, SPC3373), saline and antagomir (SPC3595) for three consecutive days and sacrificed 24 hours after last dose (as in example 11 "old design", n=5). miR-122 levels were analyzed by qPCR and normalized to the saline treated group. Genes with predicted miR-122 target site and up regulated in the expression profiling (AldoA, Nrdg3, Bckdk and CD320) showed dose-dependent de-repression by increasing LNA-antimiR doses measured by qPCR.

[0591] The de-repression was consistently higher on all tested miR-122 target mRNAs (AldoA, Bckdk, CD320 and Nrdg3 FIG. 17, 18, 19, 20) in LNA-antimiR treated mice compared to antagomir treated mice. This was also indicated when analysing the inhibition of miR-122 by miR-122 specific qPCR (FIG. 16). Hence LNA-antimiRs give a more potent functional inhibition of miR-122 than corresponding dose antagomir.

Example 25

Inhibition of miR-122 by LNA-AntimiR in Hypercholesterolemic Mice Along with Cholesterol Reduction and miR-122 Target mRNA De-Repression

[0592] C57BL/6J female mice were fed on high fat diet for 13 weeks before the initiation of the SPC3649 treatment. This resulted in increased weight to 30-35 g compared to the weight of normal mice, which was just under 20 g, as weighed at the start of the LNA-antimiR treatment. The high fat diet mice lead to significantly increased total plasma cholesterol level of about 130 mg/dl, thus rendering the mice hypercholesterolemic compared to the normal level of about 70 mg/dl. Both hypercholesterolemic and normal mice were treated i.p. twice weekly with 5 mg/kg SPC3649 and the corresponding mismatch control SPC3744 for a study period of 51/2 weeks. Blood samples were collected weekly and total plasma cholesterol was measured during the entire course of the study. Upon sacrificing the mice, liver and blood samples were prepared for total RNA extraction, miRNA and mRNA quantification, assessment of the serum transaminase levels, and liver histology.

[0593] Treatment of hypercholesterolemic mice with SPC3649 resulted in reduction of total plasma cholesterol of about 30% compared to saline control mice already after 10 days and sustained at this level during the entire study (FIG. 21). The effect was not as pronounced in the normal diet mice. By contrast, the mismatch control SPC3744 did not affect the plasma cholesterol levels in neither hypercholesterolemic nor normal mice.

[0594] Quantification of miR-122 inhibition and miR-122 target gene mRNA de-repression (AldoA and Bckdk) after the long-term treatment with SPC3649 revealed a comparable profile in both hypercholesterolemic and normal mice (FIG. 22, 23, 24), thereby demonstrating the potency of SPC3649 in miR-122 antagonism in both animal groups. The miR-122 qPCR assay indicated that also the mismatch control SPC3744 had an effect on miR-122 levels in the treated mice livers, albeit to a lesser extent compared to SPC3649. This might be a reduction associated with the stem-loop qPCR. Consistent with this notion, treatment of mice with the mismatch control SPC3744 did not result in any functional de-repression of the direct miR-122 target genes (FIGS. 23 and 24) nor reduction of plasma cholesterol (FIG. 21), implying that SPC3649-mediated antagonism of miR-122 is highly specific in vivo.

[0595] Liver enzymes in hypercholesterolemic and normal mice livers were assessed after long term SPC3649 treatment. No changes in the alanine and aspartate aminotransferase (ALT and AST) levels were detected in the SPC3649 treated hypercholesterolemic mice compared to saline control mice (FIGS. 25 and 26). A possibly elevated ALT level was observed in the normal mice after long-term treatment with SPC3649 (FIG. 26).

Example 26

Methods for Performing the LNA-AntimiR/Hypercholesterolemic Experiment and Analysis

[0596] Mice and Dosing.

[0597] C57BL/6J female mice (Taconic M&B Laboratory Animals, Ejby, Denmark) were used. All substances were formulated in physiological saline (0.9% NaCl) to final concentration allowing the mice to receive an intraperitoneal injection volume of 10 ml/kg.

[0598] In the diet induced obesity study, the mice received a high fat (60EN %) diet (D12492, Research Diets) for 13 weeks to increase their blood cholesterol level before the dosing started. The dose regimen was stretched out to 51/2 weeks of 5 mg/kg LNA-antimiR.TM. twice weekly. Blood plasma was collected once a week during the entire dosing period. After completion of the experiment the mice were sacrificed and RNA extracted from the livers for further analysis. Serum was also collected for analysis of liver enzymes.

[0599] Total RNA Extraction.

[0600] The dissected livers from sacrificed mice were immediately stored in RNA later (Ambion). Total RNA was extracted with Trizol reagent according to the manufacturer's instructions (Invitrogen), except that the precipitated RNA pellet was washed in 80% ethanol and not vortexed.

[0601] MicroRNA-Specific Quantitative RT-PCR.

[0602] The miR-122 and let-7a microRNA levels were quantified with TaqMan microRNA Assay (Applied Biosystems) following the manufacturer's instructions. The RT reaction was diluted ten times in water and subsequently used for real time PCR amplification according to the manufacturer's instructions. A two-fold cDNA dilution series from liver total RNA of a saline-treated animal or mock transfected cells cDNA reaction (using 2.5 times more total RNA than in samples) served as standard to ensure a linear range (Ct versus relative copy number) of the amplification. Applied Biosystems 7500 or 7900 real-time PCR instrument was used for amplification.

[0603] Quantitative RT-PCR

[0604] mRNA quantification of selected genes was done using standard TaqMan assays (Applied Biosystems). The reverse transcription reaction was carried out with random decamers, 0.5 .mu.g total RNA, and the M-MLV RT enzyme from Ambion according to a standard protocol. First strand cDNA was subsequently diluted 10 times in nuclease-free water before addition to the RT-PCR reaction mixture. A two-fold cDNA dilution series from liver total RNA of a saline-treated animal or mock transfected cells cDNA reaction (using 2.5 times more total RNA than in samples) served as standard to ensure a linear range (Ct versus relative copy number) of the amplification. Applied Biosystems 7500 or 7900 real-time PCR instrument was used for amplification.

[0605] Metabolic Measurements.

[0606] Immediately before sacrifice retro-orbital sinus blood was collected in EDTA-coated tubes followed by isolation of the plasma fraction. Total plasma cholesterol was analysed using ABX Pentra Cholesterol CP (Horiba Group, Horiba ABX Diagnostics) according to the manufacturer's instructions.

[0607] Liver Enzymes (ALT and AST) Measurement

[0608] Serum from each individual mouse was prepared as follows: Blood samples were stored at room temperature for 2 h before centrifugation (10 min, 3000 rpm at room temperature). After centrifugation, serum was harvested and frozen at -20.degree. C.

[0609] ALT and AST measurement was performed in 96-well plates using ALT and AST reagents from ABX Pentra according to the manufacturer's instructions. In short, serum samples were diluted 2.5 fold with H.sub.2O and each sample was assayed in duplicate. After addition of 50 .mu.l diluted sample or standard (multical from ABX Pentra) to each well, 200 .mu.l of 37.degree. C. AST or ALT reagent mix was added to each well. Kinetic measurements were performed for 5 min with an interval of 30 s at 340 nm and 37.degree. C. using a spectrophotometer.

Example 27

Modulation of Hepatitis C Replication by LNA-AntimiR (SPC3649)

[0610] Oligos used in this example (uppercase: LNA, lowercase DNA, LNA Cs are methyl-.sup.mc, and LNAs are preferably B-D-oxy (o subscript after LNA residue e.g. C.sub.s.sup.o):

TABLE-US-00007 SPC3649 (LNA-antimiR targeting miR-122, SEQ ID 558 was in the initial small scale synthesis designated SPC3549) 5'-.sup.mC.sub.s.sup.oc.sub.sA.sub.s.sup.ot.sub.st.sub.sG.sub.s.sup.oT.sub- .s.sup.oc.sub.sa.sub.s.sup.mC.sub.s.sup.oa.sub.s.sup.mC.sub.s.sup.ot.sub.s- .sup.mC.sub.s.sup.omC.sup.o-3' SPC3648 (LNA-antimiR targeting miR-122, was in the initial small scale synthesis designated SPC3548) 5'-A.sub.s.sup.o t.sub.s t.sub.s G.sub.s.sup.o T.sub.s.sup.o c.sub.s a.sub.s .sup.mC.sub.s.sup.o a.sub.s .sup.mC.sub.s.sup.o t.sub.s .sup.mC.sub.s.sup.o mC.sup.o-3' SPC3550 (4 nt mismatch control to SPC3649) SEQ ID 592 5'-.sup.mC.sub.s.sup.o c.sub.s A.sub.s.sup.o t.sub.s t.sub.s .sup.mC.sub.s.sup.o T.sub.s.sup.o g.sub.s a.sub.s .sup.mC.sub.s.sup.o c.sub.s .sup.mC.sub.s.sup.o t.sub.s A.sub.s.sup.o mC.sup.o-3' 2'OMe anti-122: full length (23 nt) 2'OMe modified oligo complementary to miR-122 2'OMe Ctrl: scrambled 2'OMe modified control

[0611] Hepatitis C (HCV) replication has been shown to be facilitated by miR-122 and consequently, antagonizing miR-122 has been demonstrated to affect HCV replication in a hepatoma cell model in vitro. We assess the efficacy of SPC3649 reducing HCV replication in the Huh-7 based cell model. The different LNA-antimiR molecules along with a 2' OMe antisense and scramble oligonucleotide are transfected into Huh-7 cells, HCV is allowed to replicate for 48 hours. Total RNA samples extracted from the Huh-7 cells are subjected to Northern blot analysis.

[0612] A significant reduction of HCV RNA was observed in cells treated with SPC3649 as compared to the mock and SPC3550 mismatch control. The inhibition was clearly dose-dependent with both SPC3649 and SPC3648. Interestingly, using a 2'OMe oligonucleotide fully complementary to miR-122 at 50 nM was much less efficient than SPC3649 at the same final concentration. Notably, the 13 nt SPC3648 LNA-antimiR showed comparable efficacy with SPC3649.

Example 28

Enhanced LNA-AntimiR.TM. Antisense Oligonucleotide Targeting miR-21

[0613] Mature miR-21 Sequence from Sanger Institute miRBase:

TABLE-US-00008 >hsa-miR-21 MIMAT0000076 UAGCUUAUCAGACUGAUGUUGA (SEQ ID NO 565) >mmu-miR-21 MIMAT0000530 UAGCUUAUCAGACUGAUGUUGA (SEQ ID NO 593)

[0614] Sequence of Compounds:

TABLE-US-00009 SPC3521 miR-21 5'-FAM TCAgtctgataaGCTa-3' (SEQ ID NO 594) (gap-mer design) SPC3870 miR-21(mm) 5'-FAM TCCgtcttagaaGATa-3' (SEQ ID NO 595) SPC3825 miR-21 5'-FAM TcTgtCAgaTaCgAT-3' (SEQ ID NO 596) (new design) SPC3826 miR-21(mm) 5'-FAM TcAgtCTgaTaAgCT-3' (SEQ ID NO 597) SPC3827 miR-21 5'-FAM TcAGtCTGaTaAgCT-3' (SEQ ID NO 598) (new, enhanced design)

[0615] All compounds preferably have a fully or almost fully thiolated backbone (preferably fully) and have here also a FAM label in the 5' end (optional).

[0616] miR-21 has been show to be up-regulated in both glioblastoma (Chan et al. Cancer Research 2005, 65 (14), p6029) and breast cancer (Iorio et al. Cancer Research 2005, 65 (16), p7065) and hence has been considered a potential `oncogenic` microRNA. Chan et al. also show induction of apoptosis in glioblastoma cells by antagonising miR-21 with 2'OMe or LNA modified antisense oligonucleotides. Hence, agents antagonising miR-21 have the potential to become therapeutics for treatment of glioblastoma and other solid tumours, such as breast cancer. We present an enhanced LNA modified oligonucleotide targeting miR-21, an LNA-antimiR.TM., with surprisingly good properties to inhibit miR-21 suited for the abovementioned therapeutic purposes.

[0617] Suitable therapeutic administration routes are, for example, intracranial injections in glioblastomas, intratumoural injections in glioblastoma and breast cancer, as well as systemic delivery in breast cancer

[0618] Inhibition of miR-21 in U373 Glioblastoma Cell Line and MCF-7 Breast Cancer Cell Line.

[0619] Efficacy of current LNA-antimiR.TM. is assessed by transfection at different concentrations, along with control oligonucleotides, into U373 and MCF-7 cell lines known to express miR-21 (or others miR-21 expressing cell lines as well). Transfection is performed using standard Lipofectamine2000 protocol (Invitrogen). 24 hours post transfection, the cells are harvested and total RNA extracted using the Trizol protocol (Invitrogen). Assessment of miR-21 levels, depending on treatment and concentration used is done by miR-21 specific, stem-loop real-time RT-PCR (Applied Biosystems), or alternatively by miR-21 specific non-radioactive northern blot analyses. The detected miR-21 levels compared to vehicle control reflects the inhibitory potential of the LNA-antimiR.TM..

[0620] Functional Inhibition of miR-21 by Assessment of miR-21 Target Gene Up-Regulation.

[0621] The effect of miR-21 antagonism is investigated through cloning of the perfect match miR-21 target sequence behind a standard Renilla luciferase reporter system (between coding sequence and 3' UTR, psiCHECK-2, Promega)--see Example 29. The reporter construct and LNA-antimiR.TM. will be co-transfected into miR-21 expressing cell lines (f. ex. U373, MCF-7). The cells are harvested 24 hours post transfection in passive lysis buffer and the luciferase activity is measured according to a standard protocol (Promega, Dual Luciferase Reporter Assay System). The induction of luciferase activity is used to demonstrate the functional effect of LNA-antimiR.TM. antagonising miR-21.

Example 29

Luciferase Reporter Assay for Assessing Functional Inhibition of MicroRNA by LNA-AntimiRs and Other MicroRNA Targeting Oligos: Generalisation of New and Enhanced New Design as Preferred Design for Blocking MicroRNA Function

[0622] Oligos used in this example (uppercase: LNA, lowercase: DNA) to assess LNA-antimiR de-repressing effect on luciferase reporter with microRNA target sequence cloned by blocking respective microRNA:

TABLE-US-00010 Oligo #, target microRNA, oligo sequence Design target: hsa-miR- 122a MIMAT0000421 uggagugugacaaugguguuugu screened in HUH-7 cell line expressing miR-122 3962: miR-122 5'-ACAAacaccattgtcacacTCCA-3' Full complement, gap 3965: miR-122 5'-acaaacACCATTGTcacactcca-3' Full complement, block 3972: miR-122 5'-acAaaCacCatTgtCacActCca-3' Full complement, LNA_3 3549 (3649): miR-122 5'-CcAttGTcaCaCtCC-3' New design 3975: miR-122 5'-CcAtTGTcaCACtCC-3' Enhanced new design target: hsa-miR-19b MIMAT0000074 ugugcaaauccaugcaaaacuga screened HeLa cell line expressing miR-19b 3963: miR-19b 5'-TCAGttttgcatggatttgCACA-3' Full complement, gap 3967: miR-19b 5'-tcagttTTGCATGGatttgcaca-3' Full complement, block 3973: miR-19b 5'-tcAgtTttGcaTggAttTgcAca-3' Full complement, LNA_3 3560: miR-19b 5'-TgCatGGatTtGcAC-3' New design 3976: miR-19b 5'-TgCaTGGatTTGcAC-3' Enhanced new design target: hsa-miR-155 MIMAT0000646 uuaaugcuaaucgugauagggg screen in 518A2 cell line expressing miR-155 3964: miR-155 5'-CCCCtatcacgattagcaTTAA-3' Full complement, gap 3968: miR-155 5'-cccctaTCACGATTagcattaa-3' Full complement, block 3974: miR-155 5'-cCccTatCacGatTagCatTaa-3' Full complement, LNA_3 3758: miR-155 5'-TcAcgATtaGcAtTA-3' New design 3818: miR-155 5'-TcAcGATtaGCAtTA-3' Enhanced new design SEQ ID NOs as before.

[0623] A reporter plasmid (psiCheck-2 Promega) encoding both the Renilla and the Firefly variants of luciferase was engineered so that the 3'UTR of the Renilla luciferase includes a single copy of a sequence fully complementary to the miRNA under investigation.

[0624] Cells endogenously expressing the investigated miRNAs (HuH-7 for miR-122a, HeLa for miR-19b, 518A2 for miR-155) were co-transfected with LNA-antimiRs or other miR binding oligonucleotides (the full complementary ie full length) and the corresponding microRNA target reporter plasmid using Lipofectamine 2000 (Invitrogen). The transfection and measurement of luciferase activity were carried out according to the manufacturer's instructions (Invitrogen Lipofectamine 2000/Promega Dual-luciferase kit) using 150 000 to 300 000 cells per well in 6-well plates. To compensate for varying cell densities and transfection efficiencies the Renilla luciferase signal was normalized with the Firefly luciferase signal. All experiments were done in triplicate.

[0625] Surprisingly, new design and new enhanced design were the best functional inhibitors for all three microRNA targets, miR-155, miR-19b and miR-122 (FIG. 27, 28, 29). The results are summarized in following table 3.

[0626] Result Summary:

TABLE-US-00011 TABLE 3 Degree of de-repression of endogenous miR-155, miR-19b and miR-122a function by various designs of LNA-antimiR's. Design miR-155 miR-19b miR-122a New enhanced design *** *** no data New design *** *** *** Full complement, LNA_3 ** *** ** Full complement, block ** ** ** Full complement, gap * not signif. not signif.

Example 30

Design of a LNA AntimiR Library for All Human MicroRNA Sequences in miRBase MicroRNA Database Version 8.1, Griffiths-Jones, S., Grocock, R. J., Van Dongen, S., Bateman, A., Enright, A. J. 2006. miRBase: MicroRNA Sequences, Targets and Gene Nomenclature. Nucleic Acids Res. 34: D140-4 (http://microrna.sanger.ac.uk/sequences/index.shtml).

[0627] LNA nucleotides are shown in uppercase letters, DNA nucleotides in lowercase letters, LNA C nucleotides denote LNA methyl-C (mC). The LNA-antimiR oligonucleotides can be conjugated with a variety of haptens or fluorochromes for monitoring uptake into cells and tissues using standard methods.

TABLE-US-00012 TABLE 2 (SEQ ID refers to Example antimiR) Accession Example LNA microRNA nr. SEQ ID NO antimiR 5'-3' hsa-let-7a MIMAT0000062 SEQ ID NO 1 AcAacCTacTaCcTC hsa-let-7b MIMAT0000063 SEQ ID NO 2 AcAaCCTacTaCcTC hsa-let-7c MIMAT0000064 SEQ ID NO 2 AcAacCTacTaCcTC hsa-let-7d MIMAT0000065 SEQ ID NO 4 GcAacCTacTaCcTC hsa-let-7e MIMAT0000066 SEQ ID NO 5 AcAacCTccTaCcTC hsa-let-7f MIMAT0000067 SEQ ID NO 6 AcAatCTacTaCcTC hsa-miR-15a MIMAT0000068 SEQ ID NO 7 CcAttATgtGcTgCT hsa-miR-16 MIMAT0000069 SEQ ID NO 8 TaTttACgtGcTgCT hsa-miR-17-5p MIMAT0000070 SEQ ID NO 9 CaCtgTAagCaCtTT hsa-miR-17-3p MIMAT0000071 1EQ ID NO 10 GtGccTTcaCtGcAG hsa-miR-18a MIMAT0000072 SEQ ID NO 11 CaCtaGAtgCaCcTT hsa-miR-19a MIMAT0000073 SEQ ID NO 12 TgCatAGatTtGcAC hsa-miR-19b MIMAT0000074 SEQ ID NO 13 TgCatGGatTtGcAC hsa-miR-20a MIMAT0000075 SEQ ID NO 14 CaCtaTAagCaCtTT hsa-miR-21 MIMAT0000076 SEQ ID NO 15 TcAgtCTgaTaAgCT hsa-miR-22 MIMAT0000077 SEQ ID NO 16 CtTcaACtgGcAgCT hsa-miR-23a MIMAT0000078 SEQ ID NO 17 TcCctGCcaAtGtGA hsa-miR-189 MIMAT0000079 SEQ ID NO 18 TcAgcTCagTaGgCA hsa-miR-24 MIMAT0000080 SEQ ID NO 19 CtGctGAacTgAgCC hsa-miR-25 MIMAT0000081 SEQ ID NO 20 CgAgaCAagTgCaAT hsa-miR-26a MIMAT0000082 SEQ ID NO 21 TcCtgGAttAcTtGA hsa-miR-26b MIMAT0000083 SEQ ID NO 22 TcCtgAAttAcTtGA hsa-miR-27a MIMAT0000084 SEQ ID NO 23 AcTtaGCcaCtGtGA hsa-miR-28 MIMAT0000085 SEQ ID NO 24 AgActGTgaGcTcCT hsa-miR-29a MIMAT0000086 SEQ ID NO 25 AtTtcAGatGgTgCT hsa-miR-30a-5p MIMAT0000087 SEQ ID NO 26 GtCgaGGatGtTtAC hsa-miR-30a-3p MIMAT0000088 SEQ ID NO 27 AaCatCCgaCtGaAA hsa-miR-31 MIMAT0000089 SEQ ID NO 28 AtGccAGcaTcTtGC hsa-miR-32 MIMAT0000090 SEQ ID NO 29 TtAgtAAtgTgCaAT hsa-miR-33 MIMAT0000091 SEQ ID NO 30 TgCaaCTacAaTgCA hsa-miR-92 MIMAT0000092 SEQ ID NO 31 CgGgaCAagTgCaAT hsa-miR-93 MIMAT0000093 SEQ ID NO 32 GcAcgAAcaGcAcTT hsa-miR-95 MIMAT0000094 SEQ ID NO 33 AtAaaTAccCgTtGA hsa-miR-96 MIMAT0000095 SEQ ID NO 34 AtGtgCTagTgCcAA hsa-miR-98 MIMAT0000096 SEQ ID NO 35 AcAacTTacTaCcTC hsa-miR-99a MIMAT0000097 SEQ ID NO 36 AtCggATctAcGgGT hsa-miR-100 MIMAT0000098 SEQ ID NO 37 TtCggATctAcGgCT hsa-miR-101 MIMAT0000099 SEQ ID NO 38 TtAtcACagTaCtGT hsa-miR-29b MIMAT0000100 SEQ ID NO 39 AtTtcAAatGgTgCT hsa-miR-103 MIMAT0000101 SEQ ID NO 40 CcTgtACaaTgCtGC hsa-miR-105 MIMAT0000102 SEQ ID NO 41 GaGtcTGagCaTtTG hsa-miR-106a MIMAT0000103 SEQ ID NO 42 CaCtgTAagCaCtTT hsa-miR-107 MIMAT0000104 SEQ ID NO 43 CcTgtACaaTgCtGC hsa-miR-192 MIMAT0000222 SEQ ID NO 44 TcAatTCatAgGtCA hsa-miR-196a MIMAT0000226 SEQ ID NO 45 AaCatGAaaCtAcCT hsa-miR-197 MIMAT0000227 SEQ ID NO 46 TgGagAAggTgGtGA hsa-miR-198 MIMAT0000228 SEQ ID NO 47 AtCtcCCctCtGgAC hsa-miR-199a MIMAT0000231 SEQ ID NO 48 TaGtcTGaaCaCtGG hsa-miR-199a* MIMAT0000232 SEQ ID NO 49 TgTgcAGacTaCtGT hsa-miR-208 MIMAT0000241 SEQ ID NO 50 TtTttGCtcGtCtTA hsa-miR-129 MIMAT0000242 SEQ ID NO 51 CcCagACcgCaAaAA hsa-miR-148a MIMAT0000243 SEQ ID NO 52 TtCtgTAgtGcAcTG hsa-miR-30c MIMAT0000244 SEQ ID NO 53 GtGtaGGatGtTtAC hsa-miR-30d MIMAT0000245 SEQ ID NO 54 GtCggGGatGtTtAC hsa-miR-139 MIMAT0000250 SEQ ID NO 55 AcAcgTGcaCtGtAG hsa-miR-147 MIMAT0000251 SEQ ID NO 56 AaGcaTTtcCaCaCA hsa-miR-7 MIMAT0000252 SEQ ID NO 57 AaTcaCTagTcTtCC hsa-miR-10a MIMAT0000253 SEQ ID NO 58 TcGgaTCtaCaGgGT hsa-miR-10b MIMAT0000254 SEQ ID NO 59 TcGgtTCtaCaGgGT hsa-miR-34a MIMAT0000255 SEQ ID NO 60 AgCtaAGacAcTgCC hsa-miR-181a MIMAT0000256 SEQ ID NO 61 GaCagCGttGaAtGT hsa-miR-181b MIMAT0000257 SEQ ID NO 62 GaCagCAatGaAtGT hsa-miR-181c MIMAT0000258 SEQ ID NO 63 CgAcaGGttGaAtGT hsa-miR-182 MIMAT0000259 SEQ ID NO 64 TtCtaCCatTgCcAA hsa-miR-182* MIMAT0000260 SEQ ID NO 65 GgCaaGTctAgAaCC hsa-miR-183 MIMAT0000261 SEQ ID NO 66 TtCtaCCagTgCcAT hsa-miR-187 MIMAT0000262 SEQ ID NO 67 GcAacACaaGaCaCG hsa-miR-199b MIMAT0000263 SEQ ID NO 68 TaGtcTAaaCaCtGG hsa-miR-203 MIMAT0000264 SEQ ID NO 69 GtCctAAacAtTtCA hsa-miR-204 MIMAT0000265 SEQ ID NO 70 AgGatGAcaAaGgGA hsa-miR-205 MIMAT0000266 SEQ ID NO 71 CcGgtGGaaTgAaGG hsa-miR-210 MIMAT0000267 SEQ ID NO 72 GcTgtCAcaCgCaCA hsa-miR-211 MIMAT0000268 SEQ ID NO 73 AgGatGAcaAaGgGA hsa-miR-212 MIMAT0000269 SEQ ID NO 74 TgActGGagAcTgTT hsa-miR-181a* MIMAT0000270 SEQ ID NO 75 AtCaaCGgtCgAtGG hsa-miR-214 MIMAT0000271 SEQ ID NO 76 TgTctGTgcCtGcTG hsa-miR-215 MIMAT0000272 SEQ ID NO 77 TcAatTCatAgGtCA hsa-miR-216 MIMAT0000273 SEQ ID NO 78 TtGccAGctGaGaTT hsa-miR-217 MIMAT0000274 SEQ ID NO 79 AgTtcCTgaTgCaGT hsa-miR-218 MIMAT0000275 SEQ ID NO 80 GtTagATcaAgCaCA hsa-miR-219 MIMAT0000276 SEQ ID NO 81 TgCgtTTggAcAaTC hsa-miR-220 MIMAT0000277 SEQ ID NO 82 GtCagATacGgTgTG hsa-miR-221 MIMAT0000278 SEQ ID NO 83 AgCagACaaTgTaGC hsa-miR-222 MIMAT0000279 SEQ ID NO 84 GtAgcCAgaTgTaGC hsa-miR-223 MIMAT0000280 SEQ ID NO 85 AtTtgACaaAcTgAC hsa-miR-224 MIMAT0000281 SEQ ID NO 86 AaCcaCTagTgAcTT hsa-miR-200b MIMAT0000318 SEQ ID NO 87 TtAccAGgcAgTaTT hsa-let-7g MIMAT0000414 SEQ ID NO 88 AcAaaCTacTaCcTC hsa-let-7i MIMAT0000415 SEQ ID NO 89 AcAaaCTacTaCcTC hsa-miR-1 MIMAT0000416 SEQ ID NO 90 AcTtcTTtaCaTtCC hsa-miR-15b MIMAT0000417 SEQ ID NO 91 CcAtgATgtGcTgCT hsa-miR-23b NIMAT0000418 SEQ ID NO 92 TcCctGGcaAtGtGA hsa-miR-27b MIMAT0000419 SEQ ID NO 93 AcTtaGCcaCtGtGA hsa-miR-30b MIMAT0000420 SEQ ID NO 94 GtGtaGGatGtTtAC hsa-miR-122a MIMAT0000421 SEQ ID NO 95 CcAttGTcaCaCtCC hsa-miR-124a MIMAT0000422 SEQ ID NO 96 TcAccGCgtGcCtTA hsa-miR-125b MIMAT0000423 SEQ ID NO 97 GtTagGGtcTcAgGG hsa-miR-128a MIMAT0000424 SEQ ID NO 98 GaCcgGTtcAcTgTG hsa-miR-130a MIMAT0000425 SEQ ID NO 99 TtTtaACatTgCaCT hsa-miR-132 MIMAT0000426 SEQ ID NO 100 TgGctGTagAcTgTT hsa-miR-133a MIMAT0000427 SEQ ID NO 101 GgTtgAAggGgAcCA hsa-miR-135a MIMAT0000428 SEQ ID NO 102 GgAatAAaaAgCcAT hsa-miR-137 MIMAT0000429 SEQ ID NO 103 GtAttCTtaAgCaAT hsa-miR-138 MIMAT0000430 SEQ ID NO 104 AtTcaCAacAcCaGC hsa-miR-140 MIMAT0000431 SEQ ID NO 105 AtAggGTaaAaCcAC hsa-miR-141 MIMAT0000432 SEQ ID NO 106 TtAccAGacAgTgTT hsa-miR-142-5p MIMAT0000433 SEQ ID NO 107 TgCttTCtaCtTtAT hsa-miR-142-3p MIMAT0000434 SEQ ID NO 108 AgTagGAaaCaCtAC hsa-miR-143 MIMAT0000435 SEQ ID NO 109 AcAgtGCttCaTcTC hsa-miR-144 MIMAT0000436 SEQ ID NO 110 CaTcaTCtaTaCtGT hsa-miR-145 MIMAT0000437 SEQ ID NO 111 CcTggGAaaAcTgGA hsa-miR-152 MIMAT0000438 SEQ ID NO 112 TtCtgTCatGcAcTG hsa-miR-153 MIMAT0000439 SEQ ID NO 113 TtTtgTGacTaTgCA hsa-miR-191 MIMAT0000440 SEQ ID NO 114 TtTtgGGatTcCgTT hsa-miR-9 MIMAT0000441 SEQ ID NO 115 GcTagATaaCcAaAG hsa-miR-9* MIMAT0000442 SEQ ID NO 116 CgGttATctAgCtTT hsa-miR-125a MIMAT0000443 SEQ ID NO 117 TaAagGGtcTcAgGG hsa.about.miR-126* MIMAT0000444 SEQ ID NO 118 AcCaaAAgtAaTaAT hsa-miR-126 MIMAT0000445 SEQ ID NO 119 AtTacTCacGgTaCG hsa-miR-127 MIMAT0000446 SEQ ID NO 120 GcTcaCAcgGaTcCG hsa-miR-134 MIMAT0000447 SEQ ID NO 121 TgGtcAAccAgTcAC hsa-miR-136 MIMAT0000448 SEQ ID NO 122 TcAaaACaaAtGgAG

hsa-miR-146a MIMAT0000449 SEQ ID NO 123 TgGaaTTcaGtTcTC hsa-miR-149 MIMAT0000450 SEQ ID NO 124 AaGacACggAgCcAG hsa-miR-150 MIMAT0000451 SEQ ID NO 125 TaCaaGGgtTgGgAG hsa-miR-154 MIMAT0000452 SEQ ID NO 126 CaAcaCGgaTaAcCT hsa-miR-154* MIMAT0000453 SEQ ID NO 127 TcAacCGtgTaTgAT hsa-miR-184 MIMAT0000454 SEQ ID NO 128 AtCagTTctCcGtCC hsa-miR-185 MIMAT0000455 SEQ ID NO 129 AcTgcCTttCtCtCC hsa-miR-186 MIMAT0000456 SEQ ID NO 130 AaAggAGaaTtCtTT hsa-miR-188 MIMAT0000457 SEQ ID NO 131 CaCcaTCcaAgGgAT hsa-miR-190 MIMAT0000458 SEQ ID NO 132 TaTatCAaaCaTaTC hsa-miR-193a MIMAT0000459 SEQ ID NO 133 AcTttGTagGcCaGT hsa-miR-194 MIMAT0000460 SEQ ID NO 134 TgGagTTgcTgTtAC hsa-miR-195 MIMAT0000461 SEQ ID NO 135 TaTttCTgtGcTgCT hsa-miR-206 MIMAT0000462 SEQ ID NO 136 AcTtcCTtaCaTtCC hsa-miR-320 MIMAT0000510 SEQ ID NO 137 TcTcaACccAgCtTT hsa-miR-200c MIMAT0000617 SEQ ID NO 138 TtAccCGgcAgTaTT hsa-miR-155 MIMAT0000646 SEQ ID NO 139 TcAcgATtaGcAtTA hsa-miR-128b MIMAT0000676 SEQ ID NO 140 GaCcgGTtcAcTgTG hsa-miR-106b MIMAT0000680 SEQ ID NO 141 CaCtgTCagCaCtTT hsa-miR-29c MIMAT0000681 SEQ ID NO 142 AtTtcAAatGgTgCT hsa-miR-200a MIMAT0000682 SEQ ID NO 143 TtAccAGacAgTgTT hsa-miR-302a* MIMAT0000683 SEQ ID NO 144 AgTacATccAcGtTT hsa-miR-302a MIMAT0000684 SEQ ID NO 145 AaCatGGaaGcAcTT hsa-miR-34b MIMAT0000685 SEQ ID NO 146 CtAatGAcaCtGcCT hsa-miR-34c MIMAT0000686 SEQ ID NO 147 GcTaaCTacAcTgCC hsa-miR-299-3p MIMAT0000687 SEQ ID NO 148 TtTacCAtcCcAcAT hsa-miR-301 MIMAT0000688 SEQ ID NO 149 CaAtaCTatTgCaCT hsa-miR-99b MIMAT0000689 SEQ ID NO 150 GtCggTTctAcGgGT hsa-miR-296 MIMAT0000690 SEQ ID NO 151 AtTgaGGggGgGcCC hsa-miR-130b MIMAT0000691 SEQ ID NO 152 TtTcaTCatTgCaCT hsa-miR-30e-5p MIMAT0000692 SEQ ID NO 153 GtCaaGGatGtTtAC hsa-miR-30e-3p MIMA10000693 SEQ ID NO 154 AaCatCCgaCtGaAA hsa-miR-361 MIMAT0000703 SEQ ID NO 155 CtGgaGAttCtGaTA hsa-miR-362 MIMAT0000705 SEQ ID NO 156 CtAggTTccAaGgAT hsa-miR-363 MIMAT0000707 SEQ ID NO 157 TgGatACcgTgCaAT hsa-miR-365 MIMAT0000710 SEQ ID NO 158 AtTttTAggGgCaTT hsa-miR-302b* MIMAT0000714 SEQ ID NO 159 AcTtcCAtgTtAaAG hsa-miR-302b MIMAT0000715 SEQ ID NO 160 AaCatGGaaGcAcTT hsa-miR-302c* MIMAT0000716 SEQ ID NO 161 GtAccCCcaTgTtAA hsa-miR-302c MIMAT0000717 SEQ ID NO 162 AaCatGGaaGcAcTT hsa-miR-302d MIMAT0000718 SEQ ID NO 163 AaCatGGaaGcAcTT hsa-miR-367 MIMAT0000719 SEQ ID NO 164 TtGctAAagTgCaAT hsa-miR-368 MIMAT0000720 SEQ ID NO 165 GgAatTTccTcTaTG hsa-miR-369-3p MIMAT0000721 SEQ ID NO 166 TcAacCAtgTaTtAT hsa-miR-370 MIMAT0000722 SEQ ID NO 167 TtCcaCCccAgCaGG hsa-miR-371 MIMAT0000723 SEQ ID NO 168 CaAaaGAtgGcGgCA hsa-miR-372 MIMAT0000724 SEQ ID NO 169 AaTgtCGcaGcAcTT hsa-miR-373* MIMAT0000725 SEQ ID NO 170 CgCccCCatTtTgAG hsa-miR-373 MIMAT0000726 SEQ ID NO 171 AaAatCGaaGcAcTT hsa-miR-374 MIMAT0000727 SEQ ID NO 172 TcAggTTgtAtTaTA hsa-miR-375 MIMAT0000728 SEQ ID NO 173 GaGccGAacGaAcAA hsa-miR-376a MIMAT0000729 SEQ ID NO 174 GaTttTCctCtAtGA hsa-miR-377 MIMAT0000730 SEQ ID NO 175 GtTgcCTttCtGtCA hsa-miR-378 MIMAT0000731 SEQ ID NO 176 GaCctGGagTcAgGA hsa-miR-422b MIMAT0000732 SEQ ID NO 177 CtGacTCcaAgTcCA hsa-miR-379 MIMAT0000733 SEQ ID NO 178 GtTccATagTcTaCC hsa-miR-380-5p MIMAT0000734 SEQ ID NO 179 GtTctATggTcAaCC hsa-miR-380-3p MIMAT0000735 SEQ ID NO 180 TgGacCAtaTtAcAT hsa-miR-381 MIMAT0000736 SEQ ID NO 181 AgCttGCccTtGtAT hsa-miR-382 MIMAT0000737 SEQ ID NO 182 CaCcaCGaaCaAcTT hsa-miR-383 MIMAT0000738 SEQ ID NO 183 AaTcaCCttCtGaTC hsa-miR-340 MIMAT0000750 SEQ ID NO 184 AaGtaACtgAgAcGG hsa-miR-330 MIMAT0000751 SEQ ID NO 185 AgGccGTgtGcTtTG hsa-miR-328 MIMAT0000752 SEQ ID NO 186 GgGcaGAgaGgGcCA hsa-miR-342 MTMAT0000753 SEQ ID NO 187 CgAttTCtgTgTgAG hsa-miR-337 MIMAT0000754 SEQ ID NO 188 TcAtaTAggAgCtGG hsa-miR-323 MIMAT0000755 SEQ ID NO 189 CgAccGTgtAaTgTG hsa-miR-326 MTMAT0000756 SEQ ID NO 190 AgGaaGGgcCcAgAG hsa-miR-151 MIMAT0000757 SEQ ID NO 191 GgAgcTTcaGtCtAG hsa-miR-135b MIMAT0000758 SEQ ID NO 192 GgAatGAaaAgCcAT hsa-miR-148b MIMAT0000759 SEQ ID NO 193 TtCtgTGatGcAcTG hsa-miR-331 MIMAT0000760 SEQ ID NO 194 GgAtaGGccCaGgGG hsa-miR-324-5p MIMAT0000761 SEQ ID NO 195 TgCccTAggGgAtGC hsa-miR-324-3p MIMAT0000762 SEQ ID NO 196 GcAccTGggGcAgTG hsa-miR-338 MIMAT0000763 SEQ ID NO 197 AaTcaCTgaTgCtGG hsa-miR-339 MTMAT0000764 SEQ ID NO 198 TcCtgGAggAcAgCG hsa-miR-335 MIMAT0000765 SEQ ID NO 199 TcGttATtgCtCtTG hsa-miR-133b MIMAT0000770 SEQ ID NO 200 GgTtgAAggGgAcCA hsa-miR-325 MIMAT0000771 SEQ ID NO 201 CtGgaCAccTaCtAG hsa-miR-345 MIMAT0000772 SEQ ID NO 202 GgActAGgaGtCaGC hsa-miR-346 MIMAT0000773 SEQ ID NO 203 GgCatGCggGcAgAC ebv-miR-BHRF1-1 MIMAT0000995 SEQ ID NO 204 GgGgcTGatCaGgTT ebv-miR-BHRF1-2* MIMAT0000996 SEQ ID NO 205 TgCtgCAacAgAaTT ebv-miR-BHRF1-2 MIMAT0000997 SEQ ID NO 206 TcTgcCGcaAaAgAT ebv-miR-BHRF1-3 MIMAT0000998 SEQ ID NO 207 TaCacACttCcCgTT ebv-miR-BART1-5p MIMAT0000999 SEQ ID NO 208 GtCacTTccAcTaAG ebv-miR-BART2 MIMAT0001000 SEQ ID NO 209 GcGaaTGcaGaAaAT hsa-miR-384 MIMAT0001075 SEQ ID NO 210 AaCaaTTtcTaGgAA hsa-miR-196b MIMAT0001080 SEQ ID NO 211 AaCagGAaaCtAcCT hsa-miR-422a MIMAT0001339 SEQ ID NO 212 CtGacCCtaAgTcCA hsa-miR-423 MIMAT0001340 SEQ ID NO 213 GgCctCAgaCcGaGC hsa-miR-424 MIMAT0001341 SEQ ID NO 214 AcAtgAAttGcTgCT hsa-miR-425-3p MIMAT0001343 SEQ ID NO 215 AcAcgACatTcCcGA hsa-miR-18b MIMAT0001412 SEQ ID NO 216 CaCtaGAtgCaCcTT hsa-miR-20b MIMAT0001413 SEQ ID NO 217 CaCtaTGagCaCtTT hsa-miR-448 MIMAT0001532 SEQ ID NO 218 CaTccTAcaTaTgCA hsa-miR-429 MIMAT0001536 SEQ ID NO 219 TtAccAGacAgTaTT hsa-miR-449 MIMATO001541 SEQ ID NO 220 TaAcaATacAcTgCC hsa-miR-450 MIMAT0001545 SEQ ID NO 221 GaAcaCAtcGcAaAA hcmv-miR-UL22A MIMAT0001574 SEQ ID NO 222 AcGggAAggCtAgTT hcmv-miR-UL22A* MIMAT0001575 SEQ ID NO 223 AcTagCAttCtGgTG hcmv-miR-UL36 MIMAT0001576 SEQ ID NO 224 CaGgtGTctTcAaCG hcmv-miR-UL112 MIMAT0001577 SEQ ID NO 225 GaTctCAccGtCaCT hcmv-miR-DL148D MIMAT0001578 SEQ ID NO 226 AaGaaGGggAgGaCG hcmv-miR-US5-1 MIMAT0001579 SEQ ID NO 227 CtCgtCAggCtTgTC hcmv-miR-US5-2 MIMAT0001580 SEQ ID NO 228 GtCacACctAtCaTA hcmv-miR-US25-1 MIMAT0001581 SEQ ID NO 229 GaGccACtgAgCgGT hcmv-miR-US25-2-5p MIMAT0001582 SEQ ID NO 230 AcCtgAAcaGaCcGC hcmv-miR-US25-2-3p MIMAT0001583 SEQ ID NO 231 AgCtcTCcaAgTgGA hcmv-miR-US33 MIMAT0001584 SEQ ID NO 232 CgGtcCGggCaCaAT hsa-miR-191* MIMAT0001618 SEQ ID NO 233 GaAatCCaaGcGcAG hsa-miR-200a* MIMAT0001620 SEQ ID NO 234 AcTgtCCggTaAgAT hsa-miR-369-5p MIMAT0001621 SEQ ID NO 235 AtAacACggTcGaTC hsa-miR-431 MIMAT0001625 SEQ ID NO 236 GaCggCCtgCaAgAC hsa-miR-433 MIMAT0001627 SEQ ID NO 237 AgGagCCcaTcAtGA hsa-miR-329 MIMAT0001629 SEQ ID NO 238 GtTaaCCagGtGtGT hsa-miR-453 MIMAT0001630 SEQ ID NO 239 CaCcaCGgaCaAcCT hsa-miR-451 MIMAT0001631 SEQ ID ND 240 GtAatGGtaAcGgTT hsa-miR-452 MIMAT0001635 SEQ ID NO 241 GtTtcCTctGcAaAC hsa-miR-452* MIMAT0001636 SEQ ID NO 242 TtGcaGAtgAgAcTG hsa-miR-409-5p MIMAT0001638 SEQ ID NO 243 GtTgcTCggGtAaCC hsa-miR-409-3p MIMAT0001639 SEQ ID NO 244 CaCcgAGcaAcAtTC hsa-miR-412 MIMAT0002170 SEQ ID NO 245 GtGgaCCagGtGaAG hsa-miR-410 MIMAT0002171 SEQ ID NO 246 CcAtcTGtgTtAtAT hsa-miR-376b MIMAT0002172 SEQ ID NO 247 GaTttTCctCtAtGA hsa-miR-483 MIMAT0002173 SEQ ID NO 248 GgGagGAgaGgAgTG

hsa-miR-484 MIMAT0002174 SEQ ID ND 249 AgGggACtgAgCcTG hsa-miR-485-5p MIMAT0002175 SEQ ID NO 250 AtCacGGccAgCcTC hsa-miR-485-3p MIMAT0002176 SEQ ID ND 251 GaGagCCgtGtAtGA hsa-miR-486 MIMAT0002177 SEQ ID NO 252 GcAgcTCagTaCaCG hsa-miR-487a MIMAT0002178 SEQ ID NO 253 AtGtcCCtgTaTgAT kshv-miR-K12-10a MIMAT0002179 SEQ ID NO 254 CgGggGGacAaCaCT kshv-miR-K12-10b MIMAT0002180 SEQ ID NO 255 CgGggGGacAaCaCC kshv-miR-K12-11 MIMAT0002181 SEQ ID NO 256 AcAggCTaaGcAtTA kshv-miR-K12-1 MIMAT0002182 SEQ ID NO 257 CcCagTTtcCtGtAA kshv-miR-K12-2 MIMAT0002183 SEQ ID NO 258 GaCccGGaCTaCaGT kshv-miR-K12-9* MIMAT0002184 SEQ ID NO 259 GtTtaCGcaGcTgGG kshv-miR-K12-9 MIMAT0002185 SEQ ID NO 260 AgCtgCGtaTaCcCA kshv-miR-K12-8 MIMAT0002186 SEQ ID NO 261 CtCtcAGtcGcGcCT kshv-miR-K12-7 MIMAT0002187 SEQ ID NO 262 CaGcaACatGgGaTC kshv-miR-K12-6-5p MIMAT0002188 SEQ ID NO 263 GaTtaGGtgCtGcTG kshv-miR-K12-6-3p MIMAT0002189 SEQ ID NO 264 AgCccGAaaAcCaTC kshv-miR-K12-5 MIMAT0002190 SEQ ID NO 265 AgTtcCAggCaTcCT kshv-miR-K12-4-5p MIMAT0002191 SEQ ID NO 266 GtActGCggTtTaGC kshv-miR-K12-4-3p MIMAT0002192 SEQ ID NO 267 AgGccTCagTaTtCT kshv-miR-K12-3 MIMAT0002193 SEQ ID NO 268 CgTccTCagAaTgTG kshv-miR-K12-3* MIMAT0002194 SEQ ID NO 269 CaTtcTGtgAcCgCG hsa-miR-488 MIMAT0002804 SEQ ID NO 270 AgTgcCAttAtCtGG hsa-miR-489 MIMAT0002805 SEQ ID NO 271 TaTatGTgaTgTcAC hsa-miR-490 MIMAT0002806 SEQ ID NO 272 GgAgtCCtcCaGgTT hsa-miR-491 MIMAT0002807 SEQ ID NO 273 GgAagGGttCcCcAC hsa-miR-511 MIMAT0002808 SEQ ID NO 274 GcAgaGCaaAaGaCA hsa-miR-146b NIMAT0002809 SEQ ID NO 275 TgGaaTTcaGtTcTC hsa-miR-202* MIMAT0002810 SEQ ID NO 276 GtAtaTGcaTaGgAA hsa-miR-202 MIMAT0002811 SEQ ID NO 277 CaTgcCCtaTaCcTC hsa-miR-492 MIMAT0002812 SEQ ID NO 278 TtGtcCCgcAgGtCC hsa-miR-493-5p MIMAT0002813 SEQ ID NO 279 AgCctACcaTgTaCA hsa-miR-432 MIMAT0002814 SEQ ID NO 280 AtGacCTacTcCaAG hsa-miR-432* MIMAT0002815 SEQ ID NO 281 TgGagGAgcCaTcCA hsa-miR-494 MIMAT0002816 SEQ ID NO 282 TcCcgTGtaTgTtTC hsa-miR-495 MIMAT0002817 SEQ ID NO 283 TgCacCAtgTtTgTT hsa-miR-496 MIMAT0002818 SEQ ID NO 284 AgAttGGccAtGtAA hsa-miR-193b MIMAT0002819 SEQ ID NO 285 AcTttGAggGcCaGT hsa-miR-497 MIMAT0002820 SEQ ID NO 286 CcAcaGTgtGcTgCT hsa-miR-181d MIMAT0002821 SEQ ID NO 287 GaCaaCAatGaAtGT hsa-miR-512-5p MIMAT0002822 SEQ ID NO 288 CcCtcAAggCtGaGT hsa-miR-512-3p MIMAT0002823 SEQ ID NO 289 AgCtaTGacAgCaCT hsa-miR-498 MIMAT0002824 SEQ ID NO 290 GcCccCTggCtTgAA hsa-miR-520e MIMAT0002825 SEQ ID NO 291 AaAaaGGaaGcAcTT hsa-miR-515-5p MIMAT0002826 SEQ ID NO 292 GcTttCTttTgGaGA hsa-miR-515-3p MIMAT0002827 SEQ ID NO 293 CcAaaAGaaGgCaCT hsa-miR-519e* MIMAT0002828 SEQ ID NO 294 GcTccCTttTgGaGA hsa-miR-519e MIMAT0002829 SEQ ID NO 295 TaAaaGGagGcAcTT hsa-miR-520f MIMAT0002830 SEQ ID NO 296 CtAaaAGgaAgCaCT hsa-miR-526c MIMAT0002831 SEQ ID NO 297 GcGctTCccTcTaGA hsa-miR-519c MIMAT0002832 SEQ ID NO 298 TaAaaAGatGcAcTT hsa-miR-520a* MIMAT0002833 SEQ ID NO 299 GtActTCccTcTgGA hsa-miR-520a MIMAT0002834 SEQ ID NO 300 CaAagGGaaGcAcTT hsa-miR-526b MIMAT0002835 SEQ ID NO 301 GtGctTCCcTcAaGA hsa-miR-526b* MIMAT0002836 SEQ ID NO 302 TaAaaGGaaGcAcTT hsa-miR-519b MIMAT0002837 SEQ ID NO 303 TaAaaGGatGcAcTT hsa-miR-525 MIMAT0002838 SEQ ID NO 304 GtGcaTCccTcTgGA hsa-miR-525* MIMAT0002839 SEQ ID NO 305 AaAggGAagCgCcTT hsa-miR-523 MIMAT0002840 SEQ ID NO 306 TaTagGGaaGcGcGT hsa-miR-518f* MIMAT0002841 SEQ ID NO 307 GtGctTCccTcTaGA hsa-miR-518f MIMAT0002842 SEQ ID NO 308 TaAagAGaaGcGcTT hsa-miR-520b MIMAT0002843 SEQ ID NO 309 TaAaaGGaaGcAcTT hsa-miR-518b MIMAT0002844 SEQ ID NO 310 AaAggGGagCgCtTT hsa-miR-526a MIMAT0002845 SEQ ID NO 311 GtGctTCccTcTaGA hsa-miR-520c MIMAT0002846 SEQ ID NO 312 TaAaaGGaaGcAcTT hsa-miR-518c* MIMAT0002847 SEQ ID NO 313 TgCttCCctCcAgAG hsa-miR-518c MIMAT0002848 SEQ ID NO 314 AaAgaGAagCgCtTT hsa-miR-524* MIMAT0002849 SEQ ID NO 315 GtGctTCccTtTgTA hsa-miR-524 MIMAT0002850 SEQ ID NO 316 AaAggGAagCgCcTT hsa-miR-517* MIMAT0002851 SEQ ID NO 317 TgCttCCatCtAgAG hsa-miR-517a MIMAT0002852 SEQ ID NO 318 TaAagGGatGcAcCA hsa-miR-519d MIMAT0002853 SEQ ID NO 319 AaAggGAggCaCtTT hsa-miR-521 MIMAT0002854 SEQ ID NO 320 TaAagGGaaGtGcGT hsa-miR-520d* MIMAT0002855 SEQ ID NO 321 GgCttCCctTtGtAG hsa-miR-520d MIMAT0002856 SEQ ID NO 322 CaAagAGaaGcAcTT hsa-miR-517b MIMAT0002857 SEQ ID NO 323 CtAaaGGgaTgCaCG hsa-miR-520g MIMAT0002858 SEQ ID NO 324 AaGggAAgcAcTtTG hsa-miR-516-5p MIMAT0002859 SEQ ID NO 325 TtCttACctCcAgAT hsa-miR-516-3p MIMAT0002860 SEQ ID NO 326 CcTctGAaaGgAaGC hsa-miR-518e MIMAT0002861 SEQ ID NO 327 TgAagGGaaGcGcTT hsa-miR-527 MIMAT0002862 SEQ ID NO 328 GgGctTCccTtTgCA hsa-miR-518a MIMAT0002863 SEQ ID NO 329 CaAagGGaaGcGcTT hsa-miR-518d MIMAT0002864 SEQ ID NO 330 AaAggGAagCgCtTT hsa-miR-517c MIMAT0002866 SEQ ID NO 331 TaAaaGGatGcAcGA hsa-miR-520h MIMAT0002867 SEQ ID NO 332 AaGggAAgcAcTtTG hsa-miR-522 MIMAT0002868 SEQ ID NO 333 TaAagGGaaCcAtTT hsa-miR-519a MIMAT0002869 SEQ ID NO 334 TaAaaGGatGcAcTT hsa-miR-499 MIMAT0002870 SEQ ID NO 335 TcActGCaaGtCtTA hsa-miR-500 MIMAT0002871 SEQ ID NO 336 CcTtgCCcaGgTgCA hsa-miR-501 MIMAT0002872 SEQ ID NO 337 CcAggGAcaAaGgAT hsa-miR-502 MIMAT0002873 SEQ ID NO 338 CcCagATagCaAgGA hsa-miR-503 MIMAT0002874 SEQ ID NO 339 AcTgtTCccGcTgCT hsa-miR-504 MIMAT0002875 SEQ ID NO 340 GtGcaGAccAgGgTC hsa-miR-505 MIMAT0002876 SEQ ID NO 341 AcCagCAagTgTtGA hsa-miR-513 MIMAT0002877 SEQ ID NO 342 GaCacCTccCtGtGA hsa-miR-506 MIMAT0002878 SEQ ID NO 343 TcAgaAGggTgCcTT hsa-miR-507 MIMAT0002879 SEQ ID NO 344 TcCaaAAggTgCaAA hsa-miR-508 MIMAT0002880 SEQ ID NO 345 CaAaaGGctAcAaTC hsa-miR-509 MIMAT0002881 SEQ ID NO 346 AcAgaCGtaCcAaTC hsa-miR-510 MIMAT0002882 SEQ ID NO 347 GcCacTCtcCtGaGT hsa-miR-514 MIMAT0002883 SEQ ID NO 348 TCAcaGAagTgTcAA hsa-miR-532 MIMAT0002888 SEQ ID NO 349 CtACaCTcaAgGcAT hsa-miR-299-5p MIMAT0002890 SEQ ID NO 350 GtGggACggTaAaCC hsa-miR-18a* MIMAT0002891 SEQ ID NO 351 GaGcaCTtaGgGcAG hsa-miR-455 MIMAT0003150 SEQ ID NO 352 AgTccAAagGcAcAT hsa-miR-493-3p MIMAT0003161 SEQ ID NO 353 AcAcaGTagAcCtTC hsa-miR-539 MIMAT0003163 SEQ ID NO 354 CaAggATaaTtTcTC hsa-miR-544 MIMAT0003164 SEQ ID NO 355 GcTaaAAatGcAgAA hsa-miR-545 MTMAT0003165 SEQ ID NO 356 AtAaaTGttTgCtGA hsa-miR-487b MIMAT0003180 SEQ ID NO 357 AtGacCCtgTaCgAT hsa-miR-551a MIMAT0003214 SEQ ID NO 358 AcCaaGAgtGgGtCG hsa-miR-552 MIMAT0003215 SEQ ID NO 359 TaAccAGtcAcCtGT hsa-miR-553 MIMAT0003216 SEQ ID NO 360 AaAatCTcaCcGtTT hsa-miR-554 MIMAT0003217 SEQ ID NO 361 CtGagTCagGaCtAG hsa-miR-92b MIMAT0003218 SEQ ID NO 362 CgGgaCGagTgCaAT hsa-miR-555 MIMAT0003219 SEQ ID NO 363 AgGttCAgcTtAcCC hsa-miR-556 MIMAT0003220 SEQ ID NO 364 TtAcaATgaGcTcAT hsa-miR-557 MIMAT0003221 SEQ ID NO 365 GcCcaCCcgTgCaAA hsa-miR-558 MIMAT0003222 SEQ ID NO 366 TtGgtACagCaGcTC hsa-miR-559 MIMAT0003223 SEQ ID NO 367 GtGcaTAttTaCtTT hsa-miR-560 MIMAT0003224 SEQ ID NO 368 GcCggCCggCgCaCG hsa-miR-561 MIMAT0003225 SEQ ID NO 369 AgGatCTtaAaCtTT hsa-miR-562 MIMAT0003226 SEQ ID NO 370 AtGgtACagCtAcTT hsa-miR-563 MIMAT0003227 SEQ ID NO 371 AaAcgTAtgTcAaCC hsa-miR-564 MIMAT0003228 SEQ ID NO 372 TgCtgACacCgTgCC hsa-miR-565 MIMAT0003229 SEQ ID NO 373 AcAtcGCgaGcCaGC

hsa-miR-566 MIMAT0003230 SEQ ID NO 374 GgGatCAcaGgCgCC hsa-miR-567 MIMAT0003231 SEQ ID NO 375 CcTggAAgaAcAtAC hsa-miR-568 MIMAT0003232 SEQ ID NO 376 GtAtaCAttTaTaCA hsa-miR-551b MIMAT0003233 SEQ ID NO 377 AcCaaGTatGgGtCG hsa-miR-569 MIMAT0003234 SEQ ID NO 378 CcAggATtcAtTaAC hsa-miR-570 MIMAT0003235 SEQ ID NO 379 GgTaaTTgcTgTtTT hsa-miR-571 MIMAT0003236 SEQ ID NO 380 TcAgaTGgcCaAcTC hsa-miR-572 MIMAT0003237 SEQ ID NO 381 CcAccGCcgAgCgGA hsa-miR-573 MIMAT0003238 SEQ ID NO 382 TtAcaCAtcAcTtCA hsa-miR-574 MIMAT0003239 SEQ ID NO 383 TgTgtCGatGaGcGT hsa-miR-575 MIMAT0003240 SEQ ID NO 384 CcTgtCCaaCtGgCT hsa-miR-576 MIMAT0003241 SEQ ID NO 385 GtGgaGAaaTtAgAA hsa-miR-577 MIMAT0003242 SEQ ID NO 386 AcCaaTAttTtAtCT hsa-miR-578 MIMAT0003243 SEQ ID NO 387 CcTagAGcaCaAgAA hsa-miR-579 MIMAT0003244 SEQ ID NO 388 TtTatACcaAaTgAA hsa-miR-580 MIMAT0003245 SEQ ID NO 389 GaTtcATcaTtCtCA hsa-miR-581 MIMAT0003246 SEQ ID NO 390 TcTagAGaaCaCaAG hsa-miR-582 MIMAT0003247 SEQ ID NO 391 GgTtgAAcaAcTgTA hsa-miR-583 MIMAT0003248 SEQ ID NO 392 GgGacCTtcCtCtTT hsa-miR-584 MIMAT0003249 SEQ ID NO 393 CcCagGCaaAcCaTA hsa-miR-585 MIMAT0003250 SEQ ID NO 394 CaTacAGatAcGcCC hsa-miR-548a MIMAT0003251 SEQ ID NO 395 GtAatTGccAgTtTT hsa-miR-586 MIMAT0003252 SEQ ID NO 396 AaAaaTAcaAtGcAT hsa-miR-587 MIMAT0003253 SEQ ID NO 397 TcAtcACctAtGgAA hsa-miR-548b MIMAT0003254 SEQ ID NO 398 GcAacTGagGtTcTT hsa-miR-588 MIMAT0003255 SEQ ID NO 399 AaCccATtgTgGcCA hsa-miR-589 MIMAT0003256 SEQ ID NO 400 CcGgcATttGtTcTG hsa-miR-550 MIMAT0003257 SEQ ID NO 401 CtGagGGagTaAgAC hsa-miR-590 MIMAT0003258 SEQ ID NO 402 TtTtaTGaaTaAgCT hsa-miR-591 MIMAT0003259 SEQ ID NO 403 TgAgaACccAtGgTC hsa-miR-592 MIMAT0003260 SEQ ID NO 404 TcGcaTAttGaCaCA hsa-miR-593 MIMAT0003261 SEQ ID NO 405 TgCctGGctGgTgCC hsa-miR-595 MIMAT0003263 SEQ ID NO 406 CaCcaCGgcAcAcTT hsa-miR-596 MIMAT0003264 SEQ ID NO 407 GgAgcCGggCaGgCT hsa-miR-597 MIMAT0003265 SEQ ID NO 408 GtCatCGagTgAcAC hsa-miR-598 MIMAT0003266 SEQ ID NO 409 TgAcaACgaTgAcGT hsa-miR-599 MIMAT0003267 SEQ ID NO 410 GaTaaACtgAcAcAA hsa-miR-600 MIMAT0003268 SEQ ID NO 411 GcTctTGtcTgTaAG hsa-miR-601 MIMAT0003269 SEQ ID NO 412 CaAcaATccTaGaCC hsa-miR-602 MIMAT0003270 SEQ ID NO 413 AgCtgTCgcCcGtGT hsa-miR-603 MIMAT0003271 SEQ ID NO 414 GtAatTGcaGtGtGT hsa-miR-604 MIMAT0003272 SEQ ID NO 415 CtGaaTTccGcAgCC hsa-miR-605 MIMAT0003273 SEQ ID NO 416 GgCacCAtgGgAtTT hsa-miR-606 MIMAT0003274 SEQ ID NO 417 TgAttTTcaGtAgTT hsa-miR-607 MIMAT0003275 SEQ ID NO 418 AgAtcTGgaTtTgAA hsa-miR-608 MIMAT0003276 SEQ ID NO 419 TcCcaACacCaCcCC hsa-miR-609 MIMAT0003277 SEQ ID NO 420 AtGagAGaaAcAcCC hsa-miR-610 MIMAT0003278 SEQ ID NO 421 GcAcaCAttTaGcTC hsa-miR-611 MIMAT0003279 SEQ ID NO 422 CcCgaGGggTcCtCG hsa-miR-612 MIMAT0003280 SEQ ID NO 423 AgAagCCctGcCcAG hsa-miR-613 MIMAT0003281 SEQ ID NO 424 AaGaaGGaaCaTtCC hsa-miR-614 MIMAT0003282 SEQ ID NO 425 GcAagAAcaGgCgTT hsa-miR-615 MIMAT0003283 SEQ ID NO 426 GaGacCCagGcTcGG hsa-miR-616 MIMAT0003284 SEQ ID NO 427 CtGaaGGgtTtTgAG hsa-miR-548c MIMAT0003285 SEQ ID NO 428 GtAatTGagAtTtTT hsa-miR-617 MIMAT0003286 SEQ ID NO 429 TtCaaATggGaAgTC hsa-miR-618 MIMAT0003287 SEQ ID NO 430 AgGacAAgtAgAgTT hsa-miR-619 MIMAT0003288 SEQ ID NO 431 CaAacATgtCcAgGT hsa-miR-620 MIMAT0003289 SEQ ID NO 432 CtAtaTCtaTcTcCA hsa-miR-621 MIMAT0003290 SEQ ID NO 433 AgCgcTGttGcTaGC hsa-miR-622 MIMAT0003291 SEQ ID NO 434 AaCctCAgcAgAcTG hsa-miR-623 MIMAT0003292 SEQ ID NO 435 AgCccCTgcAaGgGA hsa-miR-624 MIMAT0003293 SEQ ID NO 436 CaAggTACtGgTaCT hsa-miR-625 MIMAT0003294 SEQ ID NO 437 AtAgaACttTcCcCC hsa-miR-626 MIMAT0003295 SEQ ID NO 438 AcAttTTcaGaCaGC hsa-miR-627 MIMAT0003296 SEQ ID NO 439 TtTctTAgaGaCtCA hsa-miR-628 MIMAT0003297 SEQ ID NO 440 TgCcaCTctTaCtAG hsa-miR-629 MIMAT0003298 SEQ ID NO 441 CtTacGTtgGgAgAA hsa-miR-630 MIMAT0003299 SEQ ID NO 442 CcTggTAcaGaAtAC hsa-miR-631 MIMAT0003300 SEQ ID NO 443 GgTctGGgcCaGgTC hsa-miR-33b MIMAT0003301 SEQ ID NO 444 TgCaaCAgcAaTgCA hsa-miR-632 MIMAT0003302 SEQ ID NO 445 CaCagGAagCaGaCA hsa-miR-633 MIMAT0003303 SEQ ID NO 446 TgGtaGAtaCtAtTA hsa-miR-634 MIMAT0003304 SEQ ID NO 447 AgTtgGGgtGcTgGT hsa-miR-635 MIMAT0003305 SEQ ID NO 448 GtTtcAGtgCcCaAG hsa-miR-636 MIMAT0003306 SEQ ID NO 449 GgGacGAgcAaGcAC hsa-miR-637 MIMAT0003307 SEQ ID NO 450 CcCgaAAgcCcCcAG hsa-miR-638 MIMAT0003308 SEQ ID NO 451 CcCgcCCgcGaTcCC hsa-miR-639 MIMAT0003309 SEQ ID NO 452 TcGcaACcgCaGcGA hsa-miR-640 MIMAT0003310 SEQ ID NO 453 CaGgtTCctGgAtCA hsa-miR-641 MIMAT0003311 SEQ ID NO 454 TcTatCCtaTgTcTT hsa-miR-642 MIMAT0003312 SEQ ID NO 455 AcAttTGgaGaGgGA hsa-miR-643 MIMAT0003313 SEQ ID NO 456 GaGctAGcaTaCaAG hsa-miR-644 MIMAT0003314 SEQ ID NO 457 CtAagAAagCcAcAC hsa-miR-645 MIMAT0003315 SEQ ID NO 458 GcAgtACcaGcCtAG hsa-miR-646 MIMAT0003316 SEQ ID NO 459 TcAgaGGcaGcTgCT hsa-miR-647 MIMAT0003317 SEQ ID NO 460 AaGtgAGtgCaGcCA hsa-miR-648 MIMAT0003318 SEQ ID NO 461 AgTgcCCtgCaCaCT hsa-miR-649 MIMAT0003319 SEQ ID NO 462 TgAacAAcaCaGgTT hsa-miR-650 MIMAT0003320 SEQ ID NO 463 GaGagCGctGcCtCC hsa-miR-651 MIMAT0003321 SEQ ID NO 464 TcAagCTtaTcCtAA hsa-miR-652 MIMAT0003322 SEQ ID NO 465 CcCtaGTggCgCcAT hsa-miR-548d MIMAT0003323 SEQ ID NO 466 GaAacTGtgGtTtTT hsa-miR-661 MIMAT0003324 SEQ ID NO 467 GcCagAGacCcAgGC hsa-miR-662 MIMAT0003325 SEQ ID NO 468 GgGccACaaCgTgGG hsa-miR-663 MIMAT0003326 SEQ ID NO 469 CcGcgGCgcCcCgCC hsa-miR-449b MIMAT0003327 SEQ ID NO 470 TaAcaATacAcTgCC hsa-miR-653 MIMAT0003328 SEQ ID NO 471 GtAgaGAttGtTtCA hsa-miR-411 MIMAT0003329 SEQ ID NO 472 GcTatACggTcTaCT hsa-miR-654 MIMAT0003330 SEQ ID NO 473 GtTctGCggCcCaCC hsa-miR-655 MIMAT0003331 SEQ ID NO 474 GtTaaCCatGtAtTA hsa-miR-656 MIMAT0003332 SEQ ID NO 475 TtGacTGtaTaAtAT hsa-miR-549 MIMAT0003333 SEQ ID NO 476 TcAtcCAtaGtTgTC hsa-miR-657 MIMAT0003335 SEQ ID NO 477 AgGgtGAgaAcCtGC hsa-miR-658 MIMAT0003336 SEQ ID NO 478 CcTacTTccCtCcGC hsa-miR-659 MIMAT0003337 SEQ ID NO 479 CcCtcCCtgAaCcAA hsa-miR-660 MIMAT0003338 SEQ ID NO 480 CgAtaTGcaAtGgGT hsa-miR-421 MIMAT0003339 SEQ ID NO 481 AtTaaTGtcTgTtGA hsa-miR-542-5p MIMAT0003340 SEQ ID NO 482 AcAtgATgaTcCcCG hcmv-miR-US4 MIMAT0003341 SEQ ID NO 483 CtGcaCGtcCaTgTC hcmv-miR-UL70-5p MIMAT0003342 SEQ ID NO 484 AcGagGCcgAgAcGC hcmv-miR-UL70-3p MIMAT0003343 SEQ ID NO 485 GcGccAGccCaTcCC hsa-miR-363* MIMAT0003385 SEQ ID NO 486 CaTcgTGatCcAcCC hsa-miR-376a* MIMAT0003386 SEQ ID NO 487 AgAagGAgaAtCtAC hsa-miR-542-3p MIMAT0003389 SEQ ID NO 488 TtAtcAAtcTgTcAC ebv-miR-BART1-3p MIMAT0003390 SEQ ID NO 489 GtGgaTAgcGgTgCT hsa-miR-425-5p MIMAT0003393 SEQ ID NO 490 GaGtgATcgTgTcAT ebv-miR-BART3-5p MIMAT0003410 SEQ ID NO 491 AcActAAcaCtAgGT ebv-miR-BART3-3p MIMAT0003411 SEQ ID NO 492 GgTgaCTagTgGtGC ebv-miR-BART4 MIMAT0003412 SEQ ID NO 493 CcAgcAGcaTcAgGT ebv-miR-BART5 MIMAT0003413 SEQ ID NO 494 AgCtaTAttCaCcTT ebv-miR-BART6-5p MIMAT0003414 SEQ ID NO 495 AtGgaTTggAcCaAC ebv-miR-BART6-3p MIMAT0003415 SEQ ID NO 496 GcTagTCcgAtCcCC ebv-miR-BART7 MIMAT0003416 SEQ ID NO 497 AcActGGacTaTgAT ebv-miR-BART8-5p MIMAT0003417 SEQ ID NO 498 AaTctAGgaAaCcGT ebv-miR-BART8-3p MIMAT0003418 SEQ ID NO 499 CcCcaTAgaTtGtGA

ebv-miR-BART9 MIMAT0003419 SEQ ID NO 500 GaCccATgaAgTgTT ebv-miR-BART10 MIMAT0003420 SEQ ID NO 501 AaCtCCAtgGtTaTG ebv-miR-BART11-5p MIMAT0003421 SEQ ID NO 502 AgCgcACcaAaCtGT ebv-miR-BART11-3p MIMAT0003422 SEQ ID NO 503 TcAgcCTggTgTgCG ebv-miR-BART12 MIMAT0003423 SEQ ID NO 504 AcCaaACacCaCaGG ebv-miR-BART13 MIMAT0003424 SEQ ID NO 505 TcCctGGcaAgTtAC ebv-miR-BART14-5p MIMAT0003425 SEQ ID NO 506 TcGgcAGcgTaCgGT ebv-miR-BART14-3p MIMAT0003426 SEQ ID NO 507 AcTacTGcaGcAtTT kshv-miR-K12-12 MIMAT0003712 SEQ ID NO 508 GgAatGGtgGcCtGG ebv-miR-BART15 MIMAT0003713 SEQ ID NO 509 AgGaaACaaAaCcAC ebv-miR-BART16 MIMAT0003714 SEQ ID NO 510 CaCacACcCAcTcTA ebv-miR-BART17-5p MIMAT0003715 SEQ ID NO 511 AtGccTGcgTcCtCT ebv-miR-BART17-3p MIMAT0003716 SEQ ID NO 512 GaCacCAggCaTaCA ebv-miR-BART18 MIMAT0003717 SEQ ID NO 513 AgGaaGTgcGaAcTT ebv-miR-BART19 MIMAT0003718 SEQ ID NO 514 CcAagCAaaCaAaAC ebv-miR-BART20-5p MIMAT0003719 SEQ ID NO 515 AaGacATgcCtGcTA ebv-miR-BART20-3p MIMAT0003720 SEQ ID NO 516 AgGctGTgcCtTcAT hsvl-miR-H1 MIMAT0003744 SEQ ID NO 517 AcTtcCCgtCcTtCC hsa-miR-758 MIMAT0003879 SEQ ID NO 518 TgGacCAggTcAcAA hsa-miR-671 MIMAT0003880 SEQ ID NO 519 CcCtcCAggGcTtCC hsa-miR-668 MIMAT0003881 SEQ ID NO 520 GcCgaGCcgAgTgAC hsa-miR-767-5p MIMAT0003882 SEQ ID NO 521 AgAcaACcaTgGtGC hsa-miR-767-3p MIMAT0003883 SEQ ID NO 522 AtGggGTatGaGcAG hsa-miR-454-5p MIMAT0003884 SEQ ID NO 523 AcAatATtgAtAgGG hsa-miR-454-3p MIMAT0003885 SEQ ID NO 524 AaGcaATatTgCaCT hsa-miR-769-5p MIMAT0003886 SEQ ID NO 525 GaAccCAgaGgTcTC hsa-miR-769-3p MIMAT0003887 SEQ ID NO 526 AcCccGGagAtCcCA hsa-miR-766 MIMAT0003888 SEQ ID NO 527 GcTgtGGggCtGgAG hsa-miR-765 MIMAT0003945 SEQ ID NO 528 CcTtcCTtcTcCtCC hsa-miR-768-5p MIMAT0003946 SEQ ID NO 529 AcTttCAtcCtCcAA hsa-miR-768-3p MIMAT0003947 SEQ ID NO 530 AgTgtCAgcAtTgTG hsa-miR-770-5p MIMAT0003948 SEQ ID NO 531 GaCacGTggTaCtGG hsa-miR-802 MIMAT0004185 SEQ ID NO 532 TgAatCTttGtTaCT hsa-miR-801 MIMAT0004209 SEQ ID NO 533 CgCacGCagAgCaAT hsa-miR-675 MIMAT0004284 SEQ ID NO 534 GgCccTCtcCgCaCC

Sequence CWU 1

1

598115DNAartificialmiRNA Antimir oligonucleotide seqeunce 1acaacctact acctc 15215DNAartificialmiRNA Antimir oligonucleotide seqeunce 2acaacctact acctc 15315DNAartificialmiRNA Antimir oligonucleotide seqeunce 3acaacctact acctc 15415DNAartificialmiRNA Antimir oligonucleotide seqeunce 4gcaacctact acctc 15515DNAartificialmiRNA Antimir oligonucleotide seqeunce 5acaacctcct acctc 15615DNAartificialmiRNA Antimir oligonucleotide seqeunce 6acaatctact acctc 15715DNAartificialmiRNA Antimir oligonucleotide seqeunce 7ccattatgtg ctgct 15815DNAartificialmiRNA Antimir oligonucleotide seqeunce 8tatttacgtg ctgct 15915DNAartificialmiRNA Antimir oligonucleotide seqeunce 9cactgtaagc acttt 151015DNAartificialmiRNA Antimir oligonucleotide seqeunce 10gtgccttcac tgcag 151115DNAartificialmiRNA Antimir oligonucleotide seqeunce 11cactagatgc acctt 151215DNAartificialmiRNA Antimir oligonucleotide seqeunce 12tgcatagatt tgcac 151315DNAartificialmiRNA Antimir oligonucleotide seqeunce 13tgcatggatt tgcac 151415DNAartificialmiRNA Antimir oligonucleotide seqeunce 14cactataagc acttt 151515DNAartificialmiRNA Antimir oligonucleotide seqeunce 15tcagtctgat aagct 151615DNAartificialmiRNA Antimir oligonucleotide seqeunce 16cttcaactgg cagct 151715DNAartificialmiRNA Antimir oligonucleotide seqeunce 17tccctggcaa tgtga 151815DNAartificialmiRNA Antimir oligonucleotide seqeunce 18tcagctcagt aggca 151915DNAartificialmiRNA Antimir oligonucleotide seqeunce 19ctgctgaact gagcc 152015DNAartificialmiRNA Antimir oligonucleotide seqeunce 20cgagacaagt gcaat 152115DNAartificialmiRNA Antimir oligonucleotide seqeunce 21tcctggatta cttga 152215DNAartificialmiRNA Antimir oligonucleotide seqeunce 22tcctgaatta cttga 152315DNAartificialmiRNA Antimir oligonucleotide seqeunce 23acttagccac tgtga 152415DNAartificialmiRNA Antimir oligonucleotide seqeunce 24agactgtgag ctcct 152515DNAartificialmiRNA Antimir oligonucleotide seqeunce 25atttcagatg gtgct 152615DNAartificialmiRNA Antimir oligonucleotide seqeunce 26gtcgaggatg tttac 152715DNAartificialmiRNA Antimir oligonucleotide seqeunce 27aacatccgac tgaaa 152815DNAartificialmiRNA Antimir oligonucleotide seqeunce 28atgccagcat cttgc 152915DNAartificialmiRNA Antimir oligonucleotide seqeunce 29ttagtaatgt gcaat 153015DNAartificialmiRNA Antimir oligonucleotide seqeunce 30tgcaactaca atgca 153115DNAartificialmiRNA Antimir oligonucleotide seqeunce 31cgggacaagt gcaat 153215DNAartificialmiRNA Antimir oligonucleotide seqeunce 32gcacgaacag cactt 153315DNAartificialmiRNA Antimir oligonucleotide seqeunce 33ataaataccc gttga 153415DNAartificialmiRNA Antimir oligonucleotide seqeunce 34atgtgctagt gccaa 153515DNAartificialmiRNA Antimir oligonucleotide seqeunce 35acaacttact acctc 153615DNAartificialmiRNA Antimir oligonucleotide seqeunce 36atcggatcta cgggt 153715DNAartificialmiRNA Antimir oligonucleotide seqeunce 37ttcggatcta cgggt 153815DNAartificialmiRNA Antimir oligonucleotide seqeunce 38ttatcacagt actgt 153915DNAartificialmiRNA Antimir oligonucleotide seqeunce 39atttcaaatg gtgct 154015DNAartificialmiRNA Antimir oligonucleotide seqeunce 40cctgtacaat gctgc 154115DNAartificialmiRNA Antimir oligonucleotide seqeunce 41gagtctgagc atttg 154215DNAartificialmiRNA Antimir oligonucleotide seqeunce 42cactgtaagc acttt 154315DNAartificialmiRNA Antimir oligonucleotide seqeunce 43cctgtacaat gctgc 154415DNAartificialmiRNA Antimir oligonucleotide seqeunce 44tcaattcata ggtca 154515DNAartificialmiRNA Antimir oligonucleotide seqeunce 45aacatgaaac tacct 154615DNAartificialmiRNA Antimir oligonucleotide seqeunce 46tggagaaggt ggtga 154715DNAartificialmiRNA Antimir oligonucleotide seqeunce 47atctcccctc tggac 154815DNAartificialmiRNA Antimir oligonucleotide seqeunce 48tagtctgaac actgg 154915DNAartificialmiRNA Antimir oligonucleotide seqeunce 49tgtgcagact actgt 155015DNAartificialmiRNA Antimir oligonucleotide seqeunce 50tttttgctcg tctta 155115DNAartificialmiRNA Antimir oligonucleotide seqeunce 51cccagaccgc aaaaa 155215DNAartificialmiRNA Antimir oligonucleotide seqeunce 52ttctgtagtg cactg 155315DNAartificialmiRNA Antimir oligonucleotide seqeunce 53gtgtaggatg tttac 155415DNAartificialmiRNA Antimir oligonucleotide seqeunce 54gtcggggatg tttac 155515DNAartificialmiRNA Antimir oligonucleotide seqeunce 55acacgtgcac tgtag 155615DNAartificialmiRNA Antimir oligonucleotide seqeunce 56aagcatttcc acaca 155715DNAartificialmiRNA Antimir oligonucleotide seqeunce 57aatcactagt cttcc 155815DNAartificialmiRNA Antimir oligonucleotide seqeunce 58tcggatctac agggt 155915DNAartificialmiRNA Antimir oligonucleotide seqeunce 59tcggttctac agggt 156015DNAartificialmiRNA Antimir oligonucleotide seqeunce 60agctaagaca ctgcc 156115DNAartificialmiRNA Antimir oligonucleotide seqeunce 61gacagcgttg aatgt 156215DNAartificialmiRNA Antimir oligonucleotide seqeunce 62gacagcaatg aatgt 156315DNAartificialmiRNA Antimir oligonucleotide seqeunce 63cgacaggttg aatgt 156415DNAartificialmiRNA Antimir oligonucleotide seqeunce 64ttctaccatt gccaa 156515DNAartificialmiRNA Antimir oligonucleotide seqeunce 65ggcaagtcta gaacc 156615DNAartificialmiRNA Antimir oligonucleotide seqeunce 66ttctaccagt gccat 156715DNAartificialmiRNA Antimir oligonucleotide seqeunce 67gcaacacaag acacg 156815DNAartificialmiRNA Antimir oligonucleotide seqeunce 68tagtctaaac actgg 156915DNAartificialmiRNA Antimir oligonucleotide seqeunce 69gtcctaaaca tttca 157015DNAartificialmiRNA Antimir oligonucleotide seqeunce 70aggatgacaa aggga 157115DNAartificialmiRNA Antimir oligonucleotide seqeunce 71ccggtggaat gaagg 157215DNAartificialmiRNA Antimir oligonucleotide seqeunce 72gctgtcacac gcaca 157315DNAartificialmiRNA Antimir oligonucleotide seqeunce 73aggatgacaa aggga 157415DNAartificialmiRNA Antimir oligonucleotide seqeunce 74tgactggaga ctgtt 157515DNAartificialmiRNA Antimir oligonucleotide seqeunce 75atcaacggtc gatgg 157615DNAartificialmiRNA Antimir oligonucleotide seqeunce 76tgtctgtgcc tgctg 157715DNAartificialmiRNA Antimir oligonucleotide seqeunce 77tcaattcata ggtca 157815DNAartificialmiRNA Antimir oligonucleotide seqeunce 78ttgccagctg agatt 157915DNAartificialmiRNA Antimir oligonucleotide seqeunce 79agttcctgat gcagt 158015DNAartificialmiRNA Antimir oligonucleotide seqeunce 80gttagatcaa gcaca 158115DNAartificialmiRNA Antimir oligonucleotide seqeunce 81tgcgtttgga caatc 158215DNAartificialmiRNA Antimir oligonucleotide seqeunce 82gtcagatacg gtgtg 158315DNAartificialmiRNA Antimir oligonucleotide seqeunce 83agcagacaat gtagc 158415DNAartificialmiRNA Antimir oligonucleotide seqeunce 84gtagccagat gtagc 158515DNAartificialmiRNA Antimir oligonucleotide seqeunce 85atttgacaaa ctgac 158615DNAartificialmiRNA Antimir oligonucleotide seqeunce 86aaccactagt gactt 158715DNAartificialmiRNA Antimir oligonucleotide seqeunce 87ttaccaggca gtatt 158815DNAartificialmiRNA Antimir oligonucleotide seqeunce 88acaaactact acctc 158915DNAartificialmiRNA Antimir oligonucleotide seqeunce 89acaaactact acctc 159015DNAartificialmiRNA Antimir oligonucleotide seqeunce 90acttctttac attcc 159115DNAartificialmiRNA Antimir oligonucleotide seqeunce 91ccatgatgtg ctgct 159215DNAartificialmiRNA Antimir oligonucleotide seqeunce 92tccctggcaa tgtga 159315DNAartificialmiRNA Antimir oligonucleotide seqeunce 93acttagccac tgtga 159415DNAartificialmiRNA Antimir oligonucleotide seqeunce 94gtgtaggatg tttac 159515DNAartificialmiRNA Antimir oligonucleotide seqeunce 95ccattgtcac actcc 159615DNAartificialmiRNA Antimir oligonucleotide seqeunce 96tcaccgcgtg cctta 159715DNAartificialmiRNA Antimir oligonucleotide seqeunce 97gttagggtct caggg 159815DNAartificialmiRNA Antimir oligonucleotide seqeunce 98gaccggttca ctgtg 159915DNAartificialmiRNA Antimir oligonucleotide seqeunce 99ttttaacatt gcact 1510015DNAartificialmiRNA Antimir oligonucleotide seqeunce 100tggctgtaga ctgtt 1510115DNAartificialmiRNA Antimir oligonucleotide seqeunce 101ggttgaaggg gacca 1510215DNAartificialmiRNA Antimir oligonucleotide seqeunce 102ggaataaaaa gccat 1510315DNAartificialmiRNA Antimir oligonucleotide seqeunce 103gtattcttaa gcaat 1510415DNAartificialmiRNA Antimir oligonucleotide seqeunce 104attcacaaca ccagc 1510515DNAartificialmiRNA Antimir oligonucleotide seqeunce 105atagggtaaa accac 1510615DNAartificialmiRNA Antimir oligonucleotide seqeunce 106ttaccagaca gtgtt 1510715DNAartificialmiRNA Antimir oligonucleotide seqeunce 107tgctttctac tttat 1510815DNAartificialmiRNA Antimir oligonucleotide seqeunce 108agtaggaaac actac 1510915DNAartificialmiRNA Antimir oligonucleotide seqeunce 109acagtgcttc atctc 1511015DNAartificialmiRNA Antimir oligonucleotide seqeunce 110catcatctat actgt 1511115DNAartificialmiRNA Antimir oligonucleotide seqeunce 111cctgggaaaa ctgga 1511215DNAartificialmiRNA Antimir oligonucleotide seqeunce 112ttctgtcatg cactg 1511315DNAartificialmiRNA Antimir oligonucleotide seqeunce 113ttttgtgact atgca 1511415DNAartificialmiRNA Antimir oligonucleotide seqeunce 114ttttgggatt ccgtt 1511515DNAartificialmiRNA Antimir oligonucleotide seqeunce 115gctagataac caaag 1511615DNAartificialmiRNA Antimir oligonucleotide seqeunce 116cggttatcta gcttt 1511715DNAartificialmiRNA Antimir oligonucleotide seqeunce 117taaagggtct caggg 1511815DNAartificialmiRNA Antimir oligonucleotide seqeunce 118accaaaagta ataat 1511915DNAartificialmiRNA Antimir oligonucleotide seqeunce 119attactcacg gtacg 1512015DNAartificialmiRNA Antimir oligonucleotide seqeunce 120gctcagacgg atccg 1512115DNAartificialmiRNA Antimir oligonucleotide seqeunce 121tggtcaacca gtcac 1512215DNAartificialmiRNA Antimir oligonucleotide seqeunce 122tcaaaacaaa tggag 1512315DNAartificialmiRNA Antimir oligonucleotide seqeunce 123tggaattcag ttctc 1512415DNAartificialmiRNA Antimir oligonucleotide seqeunce 124aagacacgga gccag 1512515DNAartificialmiRNA Antimir oligonucleotide seqeunce 125tacaagggtt gggag 1512615DNAartificialmiRNA Antimir oligonucleotide seqeunce 126caacacggat

aacct 1512715DNAartificialmiRNA Antimir oligonucleotide seqeunce 127tcaaccgtgt atgat 1512815DNAartificialmiRNA Antimir oligonucleotide seqeunce 128atcagttctc cgtcc 1512915DNAartificialmiRNA Antimir oligonucleotide seqeunce 129actgcctttc tctcc 1513015DNAartificialmiRNA Antimir oligonucleotide seqeunce 130aaaggagaat tcttt 1513115DNAartificialmiRNA Antimir oligonucleotide seqeunce 131caccatgcaa gggat 1513215DNAartificialmiRNA Antimir oligonucleotide seqeunce 132tatatcaaac atatc 1513315DNAartificialmiRNA Antimir oligonucleotide seqeunce 133actttgtagg ccagt 1513415DNAartificialmiRNA Antimir oligonucleotide seqeunce 134tggagttgct gttac 1513515DNAartificialmiRNA Antimir oligonucleotide seqeunce 135tatttctgtg ctgct 1513615DNAartificialmiRNA Antimir oligonucleotide seqeunce 136acttccttac attcc 1513715DNAartificialmiRNA Antimir oligonucleotide seqeunce 137tctcaaccca gcttt 1513815DNAartificialmiRNA Antimir oligonucleotide seqeunce 138ttacccggca gtatt 1513915DNAartificialmiRNA Antimir oligonucleotide seqeunce 139tcacgattag catta 1514015DNAartificialmiRNA Antimir oligonucleotide seqeunce 140gaccggttca ctgtg 1514115DNAartificialmiRNA Antimir oligonucleotide seqeunce 141cactgtcagc acttt 1514215DNAartificialmiRNA Antimir oligonucleotide seqeunce 142atttcaaatg gtgct 1514315DNAartificialmiRNA Antimir oligonucleotide seqeunce 143ttaccagaca gtgtt 1514415DNAartificialmiRNA Antimir oligonucleotide seqeunce 144agtacatcca cgttt 1514515DNAartificialmiRNA Antimir oligonucleotide seqeunce 145aacatggaag cactt 1514615DNAartificialmiRNA Antimir oligonucleotide seqeunce 146ctaatgacac tgcct 1514715DNAartificialmiRNA Antimir oligonucleotide seqeunce 147gctaactaca ctgcc 1514815DNAartificialmiRNA Antimir oligonucleotide seqeunce 148tttaccatcc cacat 1514915DNAartificialmiRNA Antimir oligonucleotide seqeunce 149caatactatt gcact 1515015DNAartificialmiRNA Antimir oligonucleotide seqeunce 150gtcggttcta cgggt 1515115DNAartificialmiRNA Antimir oligonucleotide seqeunce 151attgaggggg ggccc 1515215DNAartificialmiRNA Antimir oligonucleotide seqeunce 152tttcatcatt gcact 1515315DNAartificialmiRNA Antimir oligonucleotide seqeunce 153gtcaaggatg tttac 1515415DNAartificialmiRNA Antimir oligonucleotide seqeunce 154aacatccgac tgaaa 1515515DNAartificialmiRNA Antimir oligonucleotide seqeunce 155ctggagattc tgata 1515615DNAartificialmiRNA Antimir oligonucleotide seqeunce 156ctaggttcca aggat 1515715DNAartificialmiRNA Antimir oligonucleotide seqeunce 157tggataccgt gcaat 1515815DNAartificialmiRNA Antimir oligonucleotide seqeunce 158atttttaggg gcatt 1515915DNAartificialmiRNA Antimir oligonucleotide seqeunce 159acttccatgt taaag 1516015DNAartificialmiRNA Antimir oligonucleotide seqeunce 160aacatggaag cactt 1516115DNAartificialmiRNA Antimir oligonucleotide seqeunce 161gtacccccat gttaa 1516215DNAartificialmiRNA Antimir oligonucleotide seqeunce 162aacatggaag cactt 1516315DNAartificialmiRNA Antimir oligonucleotide seqeunce 163aacatggaag cactt 1516415DNAartificialmiRNA Antimir oligonucleotide seqeunce 164ttgctaaagt gcaat 1516515DNAartificialmiRNA Antimir oligonucleotide seqeunce 165ggaatttcct ctatg 1516615DNAartificialmiRNA Antimir oligonucleotide seqeunce 166tcaaccatgt attat 1516715DNAartificialmiRNA Antimir oligonucleotide seqeunce 167ttccacccca gcagg 1516815DNAartificialmiRNA Antimir oligonucleotide seqeunce 168caaaagatgg cggca 1516915DNAartificialmiRNA Antimir oligonucleotide seqeunce 169aatgtcgcag cactt 1517015DNAartificialmiRNA Antimir oligonucleotide seqeunce 170cgcccccatt ttgag 1517115DNAartificialmiRNA Antimir oligonucleotide seqeunce 171aaaatcgaag cactt 1517215DNAartificialmiRNA Antimir oligonucleotide seqeunce 172tcaggttgta ttata 1517315DNAartificialmiRNA Antimir oligonucleotide seqeunce 173gagccgaacg aacaa 1517415DNAartificialmiRNA Antimir oligonucleotide seqeunce 174gattttcctc tatga 1517515DNAartificialmiRNA Antimir oligonucleotide seqeunce 175gttgcctttg tgtga 1517615DNAartificialmiRNA Antimir oligonucleotide seqeunce 176gacctggagt cagga 1517715DNAartificialmiRNA Antimir oligonucleotide seqeunce 177ctgactccaa gtcca 1517815DNAartificialmiRNA Antimir oligonucleotide seqeunce 178gttccatagt ctacc 1517915DNAartificialmiRNA Antimir oligonucleotide seqeunce 179gttctatggt caacc 1518015DNAartificialmiRNA Antimir oligonucleotide seqeunce 180tggaccatat tacat 1518115DNAartificialmiRNA Antimir oligonucleotide seqeunce 181agcttgccct tgtat 1518215DNAartificialmiRNA Antimir oligonucleotide seqeunce 182caccacgaac aactt 1518315DNAartificialmiRNA Antimir oligonucleotide seqeunce 183aatcaccttc tgatc 1518415DNAartificialmiRNA Antimir oligonucleotide seqeunce 184aagtaactga gacgg 1518515DNAartificialmiRNA Antimir oligonucleotide seqeunce 185aggccgtgtg ctttg 1518615DNAartificialmiRNA Antimir oligonucleotide seqeunce 186gggcagagag ggcca 1518715DNAartificialmiRNA Antimir oligonucleotide seqeunce 187cgatttctgt gtgag 1518815DNAartificialmiRNA Antimir oligonucleotide seqeunce 188tcatatagga gctgg 1518915DNAartificialmiRNA Antimir oligonucleotide seqeunce 189cgaccgtgta atgtg 1519015DNAartificialmiRNA Antimir oligonucleotide seqeunce 190aggaagggcc cagag 1519115DNAartificialmiRNA Antimir oligonucleotide seqeunce 191ggagcttcag tctag 1519215DNAartificialmiRNA Antimir oligonucleotide seqeunce 192ggaatgaaaa gccat 1519315DNAartificialmiRNA Antimir oligonucleotide seqeunce 193ttctgtgatg cactg 1519415DNAartificialmiRNA Antimir oligonucleotide seqeunce 194ggataggccc agggg 1519515DNAartificialmiRNA Antimir oligonucleotide seqeunce 195tgccctaggg gatgc 1519615DNAartificialmiRNA Antimir oligonucleotide seqeunce 196gcacctgggg cagtg 1519715DNAartificialmiRNA Antimir oligonucleotide seqeunce 197aatcactgat gctgg 1519815DNAartificialmiRNA Antimir oligonucleotide seqeunce 198tcctggagga caggg 1519915DNAartificialmiRNA Antimir oligonucleotide seqeunce 199tcgttattgc tcttg 1520015DNAartificialmiRNA Antimir oligonucleotide seqeunce 200ggttgaaggg gacca 1520115DNAartificialmiRNA Antimir oligonucleotide seqeunce 201ctggacacct actag 1520215DNAartificialmiRNA Antimir oligonucleotide seqeunce 202ggactaggag tcagc 1520315DNAartificialmiRNA Antimir oligonucleotide seqeunce 203ggcatgcggg cagac 1520415DNAartificialmiRNA Antimir oligonucleotide seqeunce 204ggggctgatc aggtt 1520515DNAartificialmiRNA Antimir oligonucleotide seqeunce 205tgctgcaaca gaatt 1520615DNAartificialmiRNA Antimir oligonucleotide seqeunce 206tctgccgcaa aagat 1520715DNAartificialmiRNA Antimir oligonucleotide seqeunce 207tacacacttc ccgtt 1520815DNAartificialmiRNA Antimir oligonucleotide seqeunce 208gtcacttcca ctaag 1520915DNAartificialmiRNA Antimir oligonucleotide seqeunce 209gcgaatgcag aaaat 1521015DNAartificialmiRNA Antimir oligonucleotide seqeunce 210aacaatttct aggaa 1521115DNAartificialmiRNA Antimir oligonucleotide seqeunce 211aacaggaaac tacct 1521215DNAartificialmiRNA Antimir oligonucleotide seqeunce 212ctgaccctaa gtcca 1521315DNAartificialmiRNA Antimir oligonucleotide seqeunce 213ggcctcagac cgagc 1521415DNAartificialmiRNA Antimir oligonucleotide seqeunce 214acatgaattg ctgct 1521515DNAartificialmiRNA Antimir oligonucleotide seqeunce 215acacgacatt cccga 1521615DNAartificialmiRNA Antimir oligonucleotide seqeunce 216cactagatgc acctt 1521715DNAartificialmiRNA Antimir oligonucleotide seqeunce 217cactatgagc acttt 1521815DNAartificialmiRNA Antimir oligonucleotide seqeunce 218catcctacat atgca 1521915DNAartificialmiRNA Antimir oligonucleotide seqeunce 219ttaccagaca gtatt 1522015DNAartificialmiRNA Antimir oligonucleotide seqeunce 220taacaataca ctgcc 1522115DNAartificialmiRNA Antimir oligonucleotide seqeunce 221gaacacatcg caaaa 1522215DNAartificialmiRNA Antimir oligonucleotide seqeunce 222acgggaaggc tagtt 1522315DNAartificialmiRNA Antimir oligonucleotide seqeunce 223actagcattc tggtg 1522415DNAartificialmiRNA Antimir oligonucleotide seqeunce 224caggtgtctt caacg 1522515DNAartificialmiRNA Antimir oligonucleotide seqeunce 225gatctcaccg tcact 1522615DNAartificialmiRNA Antimir oligonucleotide seqeunce 226aagaagggga ggacg 1522715DNAartificialmiRNA Antimir oligonucleotide seqeunce 227ctcgtcaggc ttgtc 1522815DNAartificialmiRNA Antimir oligonucleotide seqeunce 228gtcacaccta tcata 1522915DNAartificialmiRNA Antimir oligonucleotide seqeunce 229gagccactga gcggt 1523015DNAartificialmiRNA Antimir oligonucleotide seqeunce 230acctgaacag accgc 1523115DNAartificialmiRNA Antimir oligonucleotide seqeunce 231agctctccaa gtgga 1523215DNAartificialmiRNA Antimir oligonucleotide seqeunce 232cggtccgggc acaat 1523315DNAartificialmiRNA Antimir oligonucleotide seqeunce 233gaaatccaag cgcag 1523415DNAartificialmiRNA Antimir oligonucleotide seqeunce 234actgtccggt aagat 1523515DNAartificialmiRNA Antimir oligonucleotide seqeunce 235ataacacggt cgatc 1523615DNAartificialmiRNA Antimir oligonucleotide seqeunce 236gacggcctgc aagac 1523715DNAartificialmiRNA Antimir oligonucleotide seqeunce 237aggagcccat catga 1523815DNAartificialmiRNA Antimir oligonucleotide seqeunce 238gttaaccagg tgtgt 1523915DNAartificialmiRNA Antimir oligonucleotide seqeunce 239caccacggac aacct 1524015DNAartificialmiRNA Antimir oligonucleotide seqeunce 240gtaatggtaa cggtt 1524115DNAartificialmiRNA Antimir oligonucleotide seqeunce 241gtttcctctg caaac 1524215DNAartificialmiRNA Antimir oligonucleotide seqeunce 242ttgcagatga gactg 1524315DNAartificialmiRNA Antimir oligonucleotide seqeunce 243gttgctcggg taacc 1524415DNAartificialmiRNA Antimir oligonucleotide seqeunce 244caccgagcaa cattc 1524515DNAartificialmiRNA Antimir oligonucleotide seqeunce 245gtggaccagg tgaag 1524615DNAartificialmiRNA Antimir oligonucleotide seqeunce 246ccatctgtgt tatat 1524715DNAartificialmiRNA Antimir oligonucleotide seqeunce 247gattttcctc tatga 1524815DNAartificialmiRNA Antimir oligonucleotide seqeunce 248gggaggagag gagtg 1524915DNAartificialmiRNA Antimir oligonucleotide seqeunce 249aggggactga gcctg 1525015DNAartificialmiRNA Antimir oligonucleotide seqeunce 250atcacggcca gcctc 1525115DNAartificialmiRNA Antimir oligonucleotide seqeunce 251gagagccgtg tatga

1525215DNAartificialmiRNA Antimir oligonucleotide seqeunce 252gcagctcagt acagg 1525315DNAartificialmiRNA Antimir oligonucleotide seqeunce 253atgtccctgt atgat 1525415DNAartificialmiRNA Antimir oligonucleotide seqeunce 254cggggggaca acact 1525515DNAartificialmiRNA Antimir oligonucleotide seqeunce 255cggggggaca acacc 1525615DNAartificialmiRNA Antimir oligonucleotide seqeunce 256acaggctaag catta 1525715DNAartificialmiRNA Antimir oligonucleotide seqeunce 257cccagtttcc tgtaa 1525815DNAartificialmiRNA Antimir oligonucleotide seqeunce 258gacccggact acagt 1525915DNAartificialmiRNA Antimir oligonucleotide seqeunce 259gtttacgcag ctggg 1526015DNAartificialmiRNA Antimir oligonucleotide seqeunce 260agctgcgtat accca 1526115DNAartificialmiRNA Antimir oligonucleotide seqeunce 261ctctcagtcg cgcct 1526215DNAartificialmiRNA Antimir oligonucleotide seqeunce 262cagcaacatg ggatc 1526315DNAartificialmiRNA Antimir oligonucleotide seqeunce 263gattaggtgc tgctg 1526415DNAartificialmiRNA Antimir oligonucleotide seqeunce 264agcccgaaaa ccatc 1526515DNAartificialmiRNA Antimir oligonucleotide seqeunce 265agttccaggc atcct 1526615DNAartificialmiRNA Antimir oligonucleotide seqeunce 266gtactgcggt ttagc 1526715DNAartificialmiRNA Antimir oligonucleotide seqeunce 267aggcctcagt attct 1526815DNAartificialmiRNA Antimir oligonucleotide seqeunce 268cgtcctcaga atgtg 1526915DNAartificialmiRNA Antimir oligonucleotide seqeunce 269cattctgtga ccgcg 1527015DNAartificialmiRNA Antimir oligonucleotide seqeunce 270agtgccatta tctgg 1527115DNAartificialmiRNA Antimir oligonucleotide seqeunce 271tatatgtgat gtcac 1527215DNAartificialmiRNA Antimir oligonucleotide seqeunce 272ggagtcctcc aggtt 1527315DNAartificialmiRNA Antimir oligonucleotide seqeunce 273ggaagggttc cccac 1527415DNAartificialmiRNA Antimir oligonucleotide seqeunce 274gcagagcaaa agaca 1527515DNAartificialmiRNA Antimir oligonucleotide seqeunce 275tggaattcag ttctc 1527615DNAartificialmiRNA Antimir oligonucleotide seqeunce 276gtatatgcat aggaa 1527715DNAartificialmiRNA Antimir oligonucleotide seqeunce 277catgccctat acctc 1527815DNAartificialmiRNA Antimir oligonucleotide seqeunce 278ttgtcccgca ggtcc 1527915DNAartificialmiRNA Antimir oligonucleotide seqeunce 279agcctaccat gtaca 1528015DNAartificialmiRNA Antimir oligonucleotide seqeunce 280atgacctact ccaag 1528115DNAartificialmiRNA Antimir oligonucleotide seqeunce 281tggaggagcc atcca 1528215DNAartificialmiRNA Antimir oligonucleotide seqeunce 282tcccgtgtat gtttc 1528315DNAartificialmiRNA Antimir oligonucleotide seqeunce 283tgcaccatgt ttgtt 1528415DNAartificialmiRNA Antimir oligonucleotide seqeunce 284agattggcca tgtaa 1528515DNAartificialmiRNA Antimir oligonucleotide seqeunce 285actttgaggg ccagt 1528615DNAartificialmiRNA Antimir oligonucleotide seqeunce 286ccacagtgtg ctgct 1528715DNAartificialmiRNA Antimir oligonucleotide seqeunce 287gacaacaatg aatgt 1528815DNAartificialmiRNA Antimir oligonucleotide seqeunce 288ccctcaaggc tgagt 1528915DNAartificialmiRNA Antimir oligonucleotide seqeunce 289agctatgaca gcact 1529015DNAartificialmiRNA Antimir oligonucleotide seqeunce 290gccccctggc ttgaa 1529115DNAartificialmiRNA Antimir oligonucleotide seqeunce 291aaaaaggaag cactt 1529215DNAartificialmiRNA Antimir oligonucleotide seqeunce 292gctttctttt ggaga 1529315DNAartificialmiRNA Antimir oligonucleotide seqeunce 293ccaaaagaag gcact 1529415DNAartificialmiRNA Antimir oligonucleotide seqeunce 294gctccctttt ggaga 1529515DNAartificialmiRNA Antimir oligonucleotide seqeunce 295taaaaggagg cactt 1529615DNAartificialmiRNA Antimir oligonucleotide seqeunce 296ctaaaaggaa gcact 1529715DNAartificialmiRNA Antimir oligonucleotide seqeunce 297gcgcttccct ctaga 1529815DNAartificialmiRNA Antimir oligonucleotide seqeunce 298taaaaagatg cactt 1529915DNAartificialmiRNA Antimir oligonucleotide seqeunce 299gtacttccct ctgga 1530015DNAartificialmiRNA Antimir oligonucleotide seqeunce 300caaagggaag cactt 1530115DNAartificialmiRNA Antimir oligonucleotide seqeunce 301gtgcttccct caaga 1530215DNAartificialmiRNA Antimir oligonucleotide seqeunce 302taaaaggaag cactt 1530315DNAartificialmiRNA Antimir oligonucleotide seqeunce 303taaaaggatg cactt 1530415DNAartificialmiRNA Antimir oligonucleotide seqeunce 304gtgcatccct ctgga 1530515DNAartificialmiRNA Antimir oligonucleotide seqeunce 305aaagggaagc gcctt 1530615DNAartificialmiRNA Antimir oligonucleotide seqeunce 306tatagggaag cgcgt 1530715DNAartificialmiRNA Antimir oligonucleotide seqeunce 307gtgcttccct ctaga 1530815DNAartificialmiRNA Antimir oligonucleotide seqeunce 308taaagagaag cgctt 1530915DNAartificialmiRNA Antimir oligonucleotide seqeunce 309taaaaggaag cactt 1531015DNAartificialmiRNA Antimir oligonucleotide seqeunce 310aaaggggagc gcttt 1531115DNAartificialmiRNA Antimir oligonucleotide seqeunce 311gtgcttccct ctaga 1531215DNAartificialmiRNA Antimir oligonucleotide seqeunce 312taaaaggaag cactt 1531315DNAartificialmiRNA Antimir oligonucleotide seqeunce 313tgcttccctc cagag 1531415DNAartificialmiRNA Antimir oligonucleotide seqeunce 314aaagagaagc gcttt 1531515DNAartificialmiRNA Antimir oligonucleotide seqeunce 315gtgcttccct ttgta 1531615DNAartificialmiRNA Antimir oligonucleotide seqeunce 316aaagggaagc gcctt 1531715DNAartificialmiRNA Antimir oligonucleotide seqeunce 317tgcttccatc tagag 1531815DNAartificialmiRNA Antimir oligonucleotide seqeunce 318taaagggatg cacga 1531915DNAartificialmiRNA Antimir oligonucleotide seqeunce 319aaagggaggc acttt 1532015DNAartificialmiRNA Antimir oligonucleotide seqeunce 320taaagggaag tgcgt 1532115DNAartificialmiRNA Antimir oligonucleotide seqeunce 321ggcttccctt tgtag 1532215DNAartificialmiRNA Antimir oligonucleotide seqeunce 322caaagagaag cactt 1532315DNAartificialmiRNA Antimir oligonucleotide seqeunce 323ctaaagggat gcacg 1532415DNAartificialmiRNA Antimir oligonucleotide seqeunce 324aagggaagca ctttg 1532515DNAartificialmiRNA Antimir oligonucleotide seqeunce 325ttcttacctc cagat 1532615DNAartificialmiRNA Antimir oligonucleotide seqeunce 326cctctgaaag gaagc 1532715DNAartificialmiRNA Antimir oligonucleotide seqeunce 327tgaagggaag cgctt 1532815DNAartificialmiRNA Antimir oligonucleotide seqeunce 328gggcttccct ttgca 1532915DNAartificialmiRNA Antimir oligonucleotide seqeunce 329caaagggaag cgctt 1533015DNAartificialmiRNA Antimir oligonucleotide seqeunce 330aaagggaagc gcttt 1533115DNAartificialmiRNA Antimir oligonucleotide seqeunce 331taaaaggatg cacga 1533215DNAartificialmiRNA Antimir oligonucleotide seqeunce 332aagggaagca ctttg 1533315DNAartificialmiRNA Antimir oligonucleotide seqeunce 333taaagggaac cattt 1533415DNAartificialmiRNA Antimir oligonucleotide seqeunce 334taaaaggatg cactt 1533515DNAartificialmiRNA Antimir oligonucleotide seqeunce 335tcactgcaag tctta 1533615DNAartificialmiRNA Antimir oligonucleotide seqeunce 336ccttgcccag gtgca 1533715DNAartificialmiRNA Antimir oligonucleotide seqeunce 337ccagggacaa aggat 1533815DNAartificialmiRNA Antimir oligonucleotide seqeunce 338cccagatagc aagga 1533915DNAartificialmiRNA Antimir oligonucleotide seqeunce 339actgttcccg ctgct 1534015DNAartificialmiRNA Antimir oligonucleotide seqeunce 340gtgcagacca gggtc 1534115DNAartificialmiRNA Antimir oligonucleotide seqeunce 341accagcaagt gttga 1534215DNAartificialmiRNA Antimir oligonucleotide seqeunce 342gacacctccc tgtga 1534315DNAartificialmiRNA Antimir oligonucleotide seqeunce 343tcagaagggt gcctt 1534415DNAartificialmiRNA Antimir oligonucleotide seqeunce 344tccaaaaggt gcaaa 1534515DNAartificialmiRNA Antimir oligonucleotide seqeunce 345caaaaggcta caatc 1534615DNAartificialmiRNA Antimir oligonucleotide seqeunce 346acagacgtac caatc 1534715DNAartificialmiRNA Antimir oligonucleotide seqeunce 347gccactctcc tgagt 1534815DNAartificialmiRNA Antimir oligonucleotide seqeunce 348tcacagaagt gtcaa 1534915DNAartificialmiRNA Antimir oligonucleotide seqeunce 349ctacactcaa ggcat 1535015DNAartificialmiRNA Antimir oligonucleotide seqeunce 350gtgggacggt aaacc 1535115DNAartificialmiRNA Antimir oligonucleotide seqeunce 351gagcacttag ggcag 1535215DNAartificialmiRNA Antimir oligonucleotide seqeunce 352agtccaaagg cacat 1535315DNAartificialmiRNA Antimir oligonucleotide seqeunce 353acacagtaga ccttc 1535415DNAartificialmiRNA Antimir oligonucleotide seqeunce 354caaggataat ttctc 1535515DNAartificialmiRNA Antimir oligonucleotide seqeunce 355gctaaaaatg cagaa 1535615DNAartificialmiRNA Antimir oligonucleotide seqeunce 356ataaatgttt gctga 1535715DNAartificialmiRNA Antimir oligonucleotide seqeunce 357atgaccctgt acgat 1535815DNAartificialmiRNA Antimir oligonucleotide seqeunce 358accaagagtg ggtcg 1535915DNAartificialmiRNA Antimir oligonucleotide seqeunce 359taaccagtca cctgt 1536015DNAartificialmiRNA Antimir oligonucleotide seqeunce 360aaaatctcac cgttt 1536115DNAartificialmiRNA Antimir oligonucleotide seqeunce 361ctgagtcagg actag 1536215DNAartificialmiRNA Antimir oligonucleotide seqeunce 362cgggacgagt gcaat 1536315DNAartificialmiRNA Antimir oligonucleotide seqeunce 363aggttcagct taccc 1536415DNAartificialmiRNA Antimir oligonucleotide seqeunce 364ttacaatgag ctcat 1536515DNAartificialmiRNA Antimir oligonucleotide seqeunce 365gcccacccgt gcaaa 1536615DNAartificialmiRNA Antimir oligonucleotide seqeunce 366ttggtacagc agctc 1536715DNAartificialmiRNA Antimir oligonucleotide seqeunce 367gtgcatattt acttt 1536815DNAartificialmiRNA Antimir oligonucleotide seqeunce 368gccggccggc gcacg 1536915DNAartificialmiRNA Antimir oligonucleotide seqeunce 369aggatcttaa acttt 1537015DNAartificialmiRNA Antimir oligonucleotide seqeunce 370atggtacagc tactt 1537115DNAartificialmiRNA Antimir oligonucleotide seqeunce 371aaacgtatgt caacc 1537215DNAartificialmiRNA Antimir oligonucleotide seqeunce 372tgctgacacc gtgcc 1537315DNAartificialmiRNA Antimir oligonucleotide seqeunce 373acatcgcgag ccagc 1537415DNAartificialmiRNA Antimir oligonucleotide seqeunce 374gggatcacag gcgcc 1537515DNAartificialmiRNA Antimir oligonucleotide seqeunce 375cctggaagaa catac 1537615DNAartificialmiRNA Antimir oligonucleotide seqeunce 376gtatacattt ataca 1537715DNAartificialmiRNA Antimir oligonucleotide seqeunce 377accaagtatg

ggtcg 1537815DNAartificialmiRNA Antimir oligonucleotide seqeunce 378ccaggattca ttaac 1537915DNAartificialmiRNA Antimir oligonucleotide seqeunce 379ggtaattgct gtttt 1538015DNAartificialmiRNA Antimir oligonucleotide seqeunce 380tcagatggcc aactc 1538115DNAartificialmiRNA Antimir oligonucleotide seqeunce 381ccaccgccga gcgga 1538215DNAartificialmiRNA Antimir oligonucleotide seqeunce 382ttacacatca cttca 1538315DNAartificialmiRNA Antimir oligonucleotide seqeunce 383tgtgtgcatg agcgt 1538415DNAartificialmiRNA Antimir oligonucleotide seqeunce 384cctgtccaac tggct 1538515DNAartificialmiRNA Antimir oligonucleotide seqeunce 385gtggagaaat tagaa 1538615DNAartificialmiRNA Antimir oligonucleotide seqeunce 386accaatattt tatct 1538715DNAartificialmiRNA Antimir oligonucleotide seqeunce 387cctagagcac aagaa 1538815DNAartificialmiRNA Antimir oligonucleotide seqeunce 388tttataccaa atgaa 1538915DNAartificialmiRNA Antimir oligonucleotide seqeunce 389gattcatcat tctca 1539015DNAartificialmiRNA Antimir oligonucleotide seqeunce 390tctagagaac acaag 1539115DNAartificialmiRNA Antimir oligonucleotide seqeunce 391ggttgaacaa ctgta 1539215DNAartificialmiRNA Antimir oligonucleotide seqeunce 392gggaccttcc tcttt 1539315DNAartificialmiRNA Antimir oligonucleotide seqeunce 393cccaggcaaa ccata 1539415DNAartificialmiRNA Antimir oligonucleotide seqeunce 394catacagata cgccc 1539515DNAartificialmiRNA Antimir oligonucleotide seqeunce 395gtaattgcca gtttt 1539615DNAartificialmiRNA Antimir oligonucleotide seqeunce 396aaaaatacaa tgcat 1539715DNAartificialmiRNA Antimir oligonucleotide seqeunce 397tcatcaccta tggaa 1539815DNAartificialmiRNA Antimir oligonucleotide seqeunce 398gcaactgagg ttctt 1539915DNAartificialmiRNA Antimir oligonucleotide seqeunce 399aacccattgt ggcca 1540015DNAartificialmiRNA Antimir oligonucleotide seqeunce 400ccggcatttg ttctg 1540115DNAartificialmiRNA Antimir oligonucleotide seqeunce 401ctgagggagt aagac 1540215DNAartificialmiRNA Antimir oligonucleotide seqeunce 402ttttatgaat aagct 1540315DNAartificialmiRNA Antimir oligonucleotide seqeunce 403tgagaaccca tggtc 1540415DNAartificialmiRNA Antimir oligonucleotide seqeunce 404tcgcatattg acaca 1540515DNAartificialmiRNA Antimir oligonucleotide seqeunce 405tgcctggctg gtgcc 1540615DNAartificialmiRNA Antimir oligonucleotide seqeunce 406caccacggca cactt 1540715DNAartificialmiRNA Antimir oligonucleotide seqeunce 407ggagccgggc aggct 1540815DNAartificialmiRNA Antimir oligonucleotide seqeunce 408gtcatcgagt gacac 1540915DNAartificialmiRNA Antimir oligonucleotide seqeunce 409tgacaacgat gacgt 1541015DNAartificialmiRNA Antimir oligonucleotide seqeunce 410gataaactga cacaa 1541115DNAartificialmiRNA Antimir oligonucleotide seqeunce 411gctcttgtct gtaag 1541215DNAartificialmiRNA Antimir oligonucleotide seqeunce 412caacaatcct agacc 1541315DNAartificialmiRNA Antimir oligonucleotide seqeunce 413agctgtcgcc cgtgt 1541415DNAartificialmiRNA Antimir oligonucleotide seqeunce 414gtaattgcag tgtgt 1541515DNAartificialmiRNA Antimir oligonucleotide seqeunce 415ctgaattccg cagcc 1541615DNAartificialmiRNA Antimir oligonucleotide seqeunce 416ggcaccatgg gattt 1541715DNAartificialmiRNA Antimir oligonucleotide seqeunce 417tgattttcag tagtt 1541815DNAartificialmiRNA Antimir oligonucleotide seqeunce 418agatctggat ttgaa 1541915DNAartificialmiRNA Antimir oligonucleotide seqeunce 419tcccaacacc acccc 1542015DNAartificialmiRNA Antimir oligonucleotide seqeunce 420atgagagaaa caccc 1542115DNAartificialmiRNA Antimir oligonucleotide seqeunce 421gcacacattt agctc 1542215DNAartificialmiRNA Antimir oligonucleotide seqeunce 422cccgaggggt cctcg 1542315DNAartificialmiRNA Antimir oligonucleotide seqeunce 423agaagccctg cccag 1542415DNAartificialmiRNA Antimir oligonucleotide seqeunce 424aagaaggaac attcc 1542515DNAartificialmiRNA Antimir oligonucleotide seqeunce 425gcaagaacag gcgtt 1542615DNAartificialmiRNA Antimir oligonucleotide seqeunce 426gagacccagg ctcgg 1542715DNAartificialmiRNA Antimir oligonucleotide seqeunce 427ctgaagggtt ttgag 1542815DNAartificialmiRNA Antimir oligonucleotide seqeunce 428gtaattgaga ttttt 1542915DNAartificialmiRNA Antimir oligonucleotide seqeunce 429ttcaaatggg aagtc 1543015DNAartificialmiRNA Antimir oligonucleotide seqeunce 430aggacaagta gagtt 1543115DNAartificialmiRNA Antimir oligonucleotide seqeunce 431caaacatgtc caggt 1543215DNAartificialmiRNA Antimir oligonucleotide seqeunce 432ctatatctat ctcca 1543315DNAartificialmiRNA Antimir oligonucleotide seqeunce 433agcgctgttg ctagc 1543415DNAartificialmiRNA Antimir oligonucleotide seqeunce 434aacctcagca gactg 1543515DNAartificialmiRNA Antimir oligonucleotide seqeunce 435agcccctgca aggga 1543615DNAartificialmiRNA Antimir oligonucleotide seqeunce 436caaggtactg gtact 1543715DNAartificialmiRNA Antimir oligonucleotide seqeunce 437atagaacttt ccccc 1543815DNAartificialmiRNA Antimir oligonucleotide seqeunce 438acattttcag acagc 1543915DNAartificialmiRNA Antimir oligonucleotide seqeunce 439tttcttagag actca 1544015DNAartificialmiRNA Antimir oligonucleotide seqeunce 440tgccactctt actag 1544115DNAartificialmiRNA Antimir oligonucleotide seqeunce 441cttacgttgg gagaa 1544215DNAartificialmiRNA Antimir oligonucleotide seqeunce 442cctggtacag aatac 1544315DNAartificialmiRNA Antimir oligonucleotide seqeunce 443ggtctgggcc aggtc 1544415DNAartificialmiRNA Antimir oligonucleotide seqeunce 444tgcaacagca atgca 1544515DNAartificialmiRNA Antimir oligonucleotide seqeunce 445cacaggaagc agaca 1544615DNAartificialmiRNA Antimir oligonucleotide seqeunce 446tggtagatac tatta 1544715DNAartificialmiRNA Antimir oligonucleotide seqeunce 447agttggggtg ctggt 1544815DNAartificialmiRNA Antimir oligonucleotide seqeunce 448gtttcagtgc ccaag 1544915DNAartificialmiRNA Antimir oligonucleotide seqeunce 449gggacgagca agcac 1545015DNAartificialmiRNA Antimir oligonucleotide seqeunce 450cccgaaagcc cccag 1545115DNAartificialmiRNA Antimir oligonucleotide seqeunce 451cccgcccgcg atccc 1545215DNAartificialmiRNA Antimir oligonucleotide seqeunce 452tcgcaaccgc agcga 1545315DNAartificialmiRNA Antimir oligonucleotide seqeunce 453caggttcctg gatca 1545415DNAartificialmiRNA Antimir oligonucleotide seqeunce 454tctatcctat gtctt 1545515DNAartificialmiRNA Antimir oligonucleotide seqeunce 455acatttggag aggga 1545615DNAartificialmiRNA Antimir oligonucleotide seqeunce 456gagctagcat acaag 1545715DNAartificialmiRNA Antimir oligonucleotide seqeunce 457ctaagaaagc cacac 1545815DNAartificialmiRNA Antimir oligonucleotide seqeunce 458gcagtaccag cctag 1545915DNAartificialmiRNA Antimir oligonucleotide seqeunce 459tcagaggcag ctgct 1546015DNAartificialmiRNA Antimir oligonucleotide seqeunce 460aagtgagtgc agcca 1546115DNAartificialmiRNA Antimir oligonucleotide seqeunce 461agtgccctgc acact 1546215DNAartificialmiRNA Antimir oligonucleotide seqeunce 462tgaacaacac aggtt 1546315DNAartificialmiRNA Antimir oligonucleotide seqeunce 463gagagcgctg cctcc 1546415DNAartificialmiRNA Antimir oligonucleotide seqeunce 464tcaagcttat cctaa 1546515DNAartificialmiRNA Antimir oligonucleotide seqeunce 465ccctagtggc gccat 1546615DNAartificialmiRNA Antimir oligonucleotide seqeunce 466gaaactgtgg ttttt 1546715DNAartificialmiRNA Antimir oligonucleotide seqeunce 467gccagagacc caggc 1546815DNAartificialmiRNA Antimir oligonucleotide seqeunce 468gggccacaac gtggg 1546915DNAartificialmiRNA Antimir oligonucleotide seqeunce 469ccgcggcgcc ccgcc 1547015DNAartificialmiRNA Antimir oligonucleotide seqeunce 470taacaataca ctgcc 1547115DNAartificialmiRNA Antimir oligonucleotide seqeunce 471gtagagattg tttca 1547215DNAartificialmiRNA Antimir oligonucleotide seqeunce 472gctatacggt ctact 1547315DNAartificialmiRNA Antimir oligonucleotide seqeunce 473gttctgcggc ccacc 1547415DNAartificialmiRNA Antimir oligonucleotide seqeunce 474gttaaccatg tatta 1547515DNAartificialmiRNA Antimir oligonucleotide seqeunce 475ttgactgtat aatat 1547615DNAartificialmiRNA Antimir oligonucleotide seqeunce 476tcatccatag ttgtc 1547715DNAartificialmiRNA Antimir oligonucleotide seqeunce 477agggtgagaa cctgc 1547815DNAartificialmiRNA Antimir oligonucleotide seqeunce 478cctacttccc tccgc 1547915DNAartificialmiRNA Antimir oligonucleotide seqeunce 479ccctccctga accaa 1548015DNAartificialmiRNA Antimir oligonucleotide seqeunce 480cgatatgcaa tgggt 1548115DNAartificialmiRNA Antimir oligonucleotide seqeunce 481attaatgtct gttga 1548215DNAartificialmiRNA Antimir oligonucleotide seqeunce 482acatgatgat ccccg 1548315DNAartificialmiRNA Antimir oligonucleotide seqeunce 483ctgcacgtcc atgtc 1548415DNAartificialmiRNA Antimir oligonucleotide seqeunce 484acgaggccga gacgc 1548515DNAartificialmiRNA Antimir oligonucleotide seqeunce 485gcgccagccc atccc 1548615DNAartificialmiRNA Antimir oligonucleotide seqeunce 486catcgtgatc caccc 1548715DNAartificialmiRNA Antimir oligonucleotide seqeunce 487agaaggagaa tctac 1548815DNAartificialmiRNA Antimir oligonucleotide seqeunce 488ttatcaatct gtcac 1548915DNAartificialmiRNA Antimir oligonucleotide seqeunce 489gtggatagcg gtgct 1549015DNAartificialmiRNA Antimir oligonucleotide seqeunce 490gagtgatcgt gtcat 1549115DNAartificialmiRNA Antimir oligonucleotide seqeunce 491acactaacac taggt 1549215DNAartificialmiRNA Antimir oligonucleotide seqeunce 492ggtgactagt ggtgc 1549315DNAartificialmiRNA Antimir oligonucleotide seqeunce 493ccagcagcat caggt 1549415DNAartificialmiRNA Antimir oligonucleotide seqeunce 494agctatattc acctt 1549515DNAartificialmiRNA Antimir oligonucleotide seqeunce 495atggattgga ccaac 1549615DNAartificialmiRNA Antimir oligonucleotide seqeunce 496gctagtccga tcccc 1549715DNAartificialmiRNA Antimir oligonucleotide seqeunce 497acactggact atgat 1549815DNAartificialmiRNA Antimir oligonucleotide seqeunce 498aatctaggaa accgt 1549915DNAartificialmiRNA Antimir oligonucleotide seqeunce 499ccccatagat tgtga 1550015DNAartificialmiRNA Antimir oligonucleotide seqeunce 500gacccatgaa gtgtt 1550115DNAartificialmiRNA Antimir oligonucleotide seqeunce 501aactccatgg ttatg 1550215DNAartificialmiRNA Antimir oligonucleotide seqeunce 502agcgcaccaa actgt

1550315DNAartificialmiRNA Antimir oligonucleotide seqeunce 503tcagcctggt gtgcg 1550415DNAartificialmiRNA Antimir oligonucleotide seqeunce 504accaaacacc acagg 1550515DNAartificialmiRNA Antimir oligonucleotide seqeunce 505tccctggcaa gttac 1550615DNAartificialmiRNA Antimir oligonucleotide seqeunce 506tcggcagcgt agggt 1550715DNAartificialmiRNA Antimir oligonucleotide seqeunce 507actactgcag cattt 1550815DNAartificialmiRNA Antimir oligonucleotide seqeunce 508ggaatggtgg cctgg 1550915DNAartificialmiRNA Antimir oligonucleotide seqeunce 509aggaaacaaa accac 1551015DNAartificialmiRNA Antimir oligonucleotide seqeunce 510cacacaccca ctcta 1551115DNAartificialmiRNA Antimir oligonucleotide seqeunce 511atgcctgcgt cctct 1551215DNAartificialmiRNA Antimir oligonucleotide seqeunce 512gacaccaggc ataca 1551315DNAartificialmiRNA Antimir oligonucleotide seqeunce 513aggaagtgcg aactt 1551415DNAartificialmiRNA Antimir oligonucleotide seqeunce 514ccaagcaaac aaaac 1551515DNAartificialmiRNA Antimir oligonucleotide seqeunce 515aagacatgcc tgcta 1551615DNAartificialmiRNA Antimir oligonucleotide seqeunce 516aggctgtgcc ttcat 1551715DNAartificialmiRNA Antimir oligonucleotide seqeunce 517acttcccgtc cttcc 1551815DNAartificialmiRNA Antimir oligonucleotide seqeunce 518tggaccaggt cacaa 1551915DNAartificialmiRNA Antimir oligonucleotide seqeunce 519ccctccaggg cttcc 1552015DNAartificialmiRNA Antimir oligonucleotide seqeunce 520gccgagccga gtgac 1552115DNAartificialmiRNA Antimir oligonucleotide seqeunce 521agacaaccat ggtgc 1552215DNAartificialmiRNA Antimir oligonucleotide seqeunce 522atggggtatg agcag 1552315DNAartificialmiRNA Antimir oligonucleotide seqeunce 523acaatattga taggg 1552415DNAartificialmiRNA Antimir oligonucleotide seqeunce 524aagcaatatt gcact 1552515DNAartificialmiRNA Antimir oligonucleotide seqeunce 525gaacccagag gtctc 1552615DNAartificialmiRNA Antimir oligonucleotide seqeunce 526accccggaga tccca 1552715DNAartificialmiRNA Antimir oligonucleotide seqeunce 527gctgtggggc tggag 1552815DNAartificialmiRNA Antimir oligonucleotide seqeunce 528ccttccttct cctcc 1552915DNAartificialmiRNA Antimir oligonucleotide seqeunce 529actttcatcc tccaa 1553015DNAartificialmiRNA Antimir oligonucleotide seqeunce 530agtgtcagca ttgtg 1553115DNAartificialmiRNA Antimir oligonucleotide seqeunce 531gacacgtggt actgg 1553215DNAartificialmiRNA Antimir oligonucleotide seqeunce 532tgaatctttg ttact 1553315DNAartificialmiRNA Antimir oligonucleotide seqeunce 533cgcacgcaga gcaat 1553415DNAartificialmiRNA Antimir oligonucleotide seqeunce 534ggccctctcc gcacc 1553523RNAHomo sapiens 535uggaguguga caaugguguu ugu 2353623DNAartificialFull complement gapmer, LNA at positions 1-4 and 20-23 536acaaacacca ttgtcacact cca 2353723DNAartificialFull complement blockmer, LNA at positions 7-14 537acaaacacca ttgtcacact cca 2353823DNAartificialFull complement LNA mixmer- LNA at third position and every third position thereafter 538acaaacacca ttgtcacact cca 2353915DNAartificialLNA units at position 1, 3, 6, 7, 10, 12, 14 and 15 539ccattgtcac actcc 1554015DNAartificialLNA untis at positions 1, 3, 5, 6, 7, 10, 11, 12, 14, 15 540ccattgtcac actcc 1554113DNAartificialLNA untis at positions 1-5, 7-10, 12 & 13. 541attgtcacac tcc 1354211DNAartificialLNA untis at positions 1-3, 5-8, 10 & 11. 542tgtcacactc c 1154315DNAartificialAll residues LNA except at positions 2, 4, 5, 8, 9, 11, 13 which are 2'OME 543ccattgtcac actcc 1554415DNAartificialAll residues LNA except at positions 2, 4, 5, 8, 9, 11, 13 which are 2'fluoro 544ccattgtcac actcc 1554523RNAHomo sapiens 545ugugcaaauc caugcaaaac uga 2354623DNAartificialFull complement gapmer, LNA at positions 1-4 and 20-23 546tcagttttgc atggatttgc aca 2354723DNAartificialFull complement blockmer, LNA at positions 7-14 547tcagttttgc atggatttgc aca 2354823DNAartificialFull complement LNA mixmer- LNA at third position and every third position thereafter 548tcagttttgc atggatttgc aca 2354915DNAartificialLNA units at position 1, 3, 6, 7, 10, 12, 14 and 15 549tgcatggatt tgcac 1555015DNAartificialLNA untis at positions 1, 3, 5, 6, 7, 10, 11, 12, 14, 15 550tgcatggatt tgcac 1555113DNAartificialLNA untis at positions 1, 3-5, 7-10, 12 & 13. 551catggatttg cac 1355211DNAartificialLNA untis at positions 1-3, 5-8, 10 & 11. 552tggatttgca c 1155315DNAartificialAll residues LNA except at positions 2, 4, 5, 8, 9, 11, 13 which are 2'OME 553tgcatggatt tgcac 1555415DNAartificialAll residues LNA except at positions 2, 4, 5, 8, 9, 11, 13 which are 2'fluoro 554tgcatggatt tgcac 1555522RNAHomos sapiens 555uuaaugcuaa ucgugauagg gg 2255622DNAartificialFull complement gapmer, LNA at positions 1-4 and 20-23 556cccctatcac gattagcatt aa 2255722DNAartificialFull complement blockmer, LNA at positions 7-14 557cccctatcac gattagcatt aa 2255822DNAartificialFull complement LNA mixmer- LNA at third position and every third position thereafter 558cccctatcac gattagcatt aa 2255915DNAartificialLNA untis at positions 1, 3, 6, 7, 10, 12, 14, 15 559tcacgattag catta 1556015DNAartificialLNA untis at positions 1, 3, 5, 6, 7, 10, 11, 12, 14, 15 560tcacgattag catta 1556113DNAartificialLNA untis at positions 1-5, 8-11, 12 & 13. 561acgattagca tta 1356211DNAartificialLNA untis at positions 1-3, 5-7, and 9-11 562gattagcatt a 1156315DNAartificialAll residues LNA except at positions 2, 4, 5, 8, 9, 11, 13 which are 2'OME 563tcacgattag catta 1556415DNAartificialAll residues LNA except at positions 2, 4, 5, 8, 9, 11, 13 which are 2'fluoro 564tcacgattag catta 1556522RNAHomo sapiens 565uagcuuauca gacugauguu ga 2256623DNAartificialFull complement gapmer, LNA at positions 1-4 and 20-23 566tcatcatcag tctgataagc tta 2356723DNAartificialFull complement blockmer, LNA at positions 7-14 567tcatcatcag tctgataagc tta 2356823DNAartificialFull complement LNA mixmer- LNA at third position and every third position thereafter 568tcatcatcag tctgataagc tta 2356915DNAartificialLNA units at position 1, 3, 6, 7, 10, 12, 14 and 15 569tcagtctgat aagct 1557015DNAartificialLNA untis at positions 1, 3, 5, 6, 7, 10, 11, 12, 14, 15 570tcagtctgat aagct 1557113DNAartificialLNA untis at positions 1-5, 7-10, 12 & 13. 571agtctgataa gct 1357211DNAartificialLNA untis at positions 1-3, 5, 7-11 572tctgataagc t 1157315DNAartificialAll residues LNA except at positions 2, 4, 5, 8, 9, 11, 13 which are 2'OME 573tcagtctgat aagct 1557415DNAartificialAll residues LNA except at positions 2, 4, 5, 8, 9, 11, 13 which are 2'fluoro 574tcagtctgat aagct 1557522RNAhomo sapiens 575uuuguucguu cggcucgcgu ga 2257622DNAartificialFull complement gapmer, LNA at positions 1-4 and 20-23 576tctcgcgtgc cgttcgttct tt 2257722DNAartificialBlockmer, LNA at positions 7-14 577tctcgcgtgc cgttcgttct tt 2257822DNAartificialFull complement LNA mixmer- LNA at third position and every third position thereafter 578tctcgcgtgc cgttcgttct tt 2257915DNAartificialLNA at positions 1, 3, 6, 7, 10, 12, 14, 15 579gtgccgttcg ttctt 1558015DNAartificialLNA at positions 1, 3, 5-7, 10-12, 14 & 15 580gtgccgttcg ttctt 1558113DNAartificialLNA at positions 1-5, 7, 9-13 581gccgttcgtt ctt 1358211DNAartificialLNA at positions 1-4, 6-11 582cgttcgttct t 1158315DNAartificialAll residues LNA except at positions 2, 4, 5, 8, 9, 11, 13 which are 2'OME 583gtgccgttcg ttctt 1558415DNAartificialAll residues LNA except at positions 2, 4, 5, 8, 9, 11, 13 which are 2'fluoro 584gtgccgttcg ttctt 1558516DNAartificialPhosphorothioate backbone, LNA at positions 2 and every thirdtherafter. 585ccattgtcac actcca 1658616DNAartificialPhosphorothioate backbone, LNA at position 3 and every thirdtherafter. 586ccattgtcac actcca 1658716DNAartificialPhosphorothioate backbone - Gapmer design with LNA at positions1-3, & 13-15 587ccattgtcac actcca 1658815DNAartificialPhosphorothioate backbone, LNA at positions 1, 3, 6, 7, 10, 12, 14 &15 588ccattgtcac actcc 1558915DNAartificialPhosphorothioate backbone, LNA at positions 1, 3, 6, 7, 10, 12, 14 &15, LNA cytosines are methylated 589ccattctgac cctac 1559016DNAartificialPhosphorothioate backbone, LNA at positions 3 and every thirdthereafter 590ccattgtctc aatcca 1659113DNAartificialPhosphorothioate backbone, LNA at position 1, 4, 5, 8, 10, 12 & 13 591attgtcacac tcc 1359215DNAartificialFully phosphorothioate, LNA at positions 1, 3, 6, 7, 10, 12, 14 &16, all C LNAs are methylated. LNA is preferably Beta-D-oxy LNA. 592ccattctgac cctac 1559322RNAHomo sapiens 593uagcuuauca gacugauguu ga 2259416DNAartificialGapmer design, Optional FAM label at 5' end, LNA at positions 1-3 and 13-15. 594tcagtctgat aagcta 1659516DNAartificialGapmer design, Optional FAM label at 5' end, LNA at positions 1-3 and 13-15. 595tccgtcttag aagata 1659615DNAartificialOptional FAM label at 5' end, LNA at positions 1, 3, 6, 7, 10, 12, 13 & 15 596tctgtcagat acgat 1559715DNAartificialOptional FAM label at 5' end, LNA at positions 1, 3, 6, 7, 10, 12, 13 & 15 597tcagtctgat aagct 1559815DNAartificialOptional FAM label at 5' end, LNA at positions 1, 3, 4 6, 7, 8, 10, 12, 14 & 15 598tcagtctgat aagct 15

Claims

1. A pharmaceutical composition comprising a single stranded oligonucleotide, or a conjugate of said oligonucleotide, having a length of between 8 and 17 nucleobase units, and a pharmaceutically acceptable diluent, carrier, or adjuvant; wherein said oligonucleotide, or conjugate thereof, comprises a Locked Nucleic Acid nucleobase unit, and wherein said oligonucleotide, or conjugate thereof, is complementary to a human microRNA sequence.

2-3. (canceled)

4. A pharmaceutical composition according to claim 1, wherein the single stranded oligonucleotide is complementary to a microRNA sequence selected from the group consisting of: hsa-let-7a, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f, hsa-miR-15a, hsa-miR-16, hsa-miR-17-5p, hsa-miR-17-3p, hsa-miR-18a, hsa-miR-19a, hsa-miR-19b, hsa-miR-20a, hsa-miR-21, hsa-miR-22, hsa-miR-23a, hsa-miR-189, hsa-miR-24, hsa-miR-25, hsa-miR-26a, hsa-miR-26b, hsa-miR-27a, hsa-miR-28, hsa-miR-29a, hsa-miR-30a-5p, hsa-miR-30a-3p, hsa-miR-31, hsa-miR-32, hsa-miR-33, hsa-miR-92, hsa-miR-93, hsa-miR-95, hsa-miR-96, hsa-miR-98, hsa-miR-99a, hsa-miR-100, hsa-miR-101, hsa-miR-29b, hsa-miR-103, hsa-miR-105, hsa-miR-106a, hsa-miR-107, hsa-miR-192, hsa-miR-196a, hsa-miR-197, hsa-miR-198, hsa-miR-199a, hsa-miR-199a*, hsa-miR-208, hsa-miR-129, hsa-miR-148a, hsa-miR-30c, hsa-miR-30d, hsa-miR-139, hsa-miR-147, hsa-miR-7, hsa-miR-10a, hsa-miR-10b, hsa-miR-34a, hsa-miR-181a, hsa-miR-181b, hsa-miR-181c, hsa-miR-182, hsa-miR-182*, hsa-miR-183, hsa-miR-187, hsa-miR-199b, hsa-miR-203, hsa-miR-204, hsa-miR-205, hsa-miR-210, hsa-miR-211, hsa-miR-212, hsa-miR-181a*, hsa-miR-214, hsa-miR-215, hsa-miR-216, hsa-miR-217, hsa-miR-218, hsa-miR-219, hsa-miR-220, hsa-miR-221, hsa-miR-222, hsa-miR-223, hsa-miR-224, hsa-miR-200b, hsa-let-7g, hsa-let-7i, hsa-miR-1, hsa-miR-15b, hsa-miR-23b, hsa-miR-27b, hsa-miR-30b, hsa-miR-122a, hsa-miR-124a, hsa-miR-125b, hsa-miR-128a, hsa-miR-130a, hsa-miR-132, hsa-miR-133a, hsa-miR-135a, hsa-miR-137, hsa-miR-138, hsa-miR-140, hsa-miR-141, hsa-miR-142-5p, hsa-miR-142-3p, hsa-miR-143, hsa-miR-144, hsa-miR-145, hsa-miR-152, hsa-miR-153, hsa-miR-191, hsa-miR-9, hsa-miR-9*, hsa-miR-125a, hsa-miR-126*, hsa-miR-126, hsa-miR-127, hsa-miR-134, hsa-miR-136, hsa-miR-146a, hsa-miR-149, hsa-miR-150, hsa-miR-154, hsa-miR-154*, hsa-m'R-184, hsa-m'R-185, hsa-miR-186, hsa-miR-188, hsa-miR-190, hsa-miR-193a, hsa-miR-194, hsa-miR-195, hsa-miR-206, hsa-miR-320, hsa-miR-200c, hsa-miR-155, hsa-miR-128b, hsa-miR-106b, hsa-miR-29c, hsa-miR-200a, hsa-miR-302a*, hsa-miR-302a, hsa-miR-34b, hsa-miR-34c, hsa-miR-299-3p, hsa-miR-301, hsa-miR-99b, hsa-miR-296, hsa-miR-130b, hsa-miR-30e-5p, hsa-miR-30e-3p, hsa-miR-361, hsa-miR-362, hsa-miR-363, hsa-miR-365, hsa-miR-302b*, hsa-miR-302b, hsa-miR-302c*, hsa-miR-302c, hsa-miR-302d, hsa-miR-367, hsa-miR-368, hsa-miR-369-3p, hsa-miR-370, hsa-miR-371, hsa-miR-372, hsa-miR-373*, hsa-miR-373, hsa-miR-374, hsa-miR-375, hsa-miR-376a, hsa-miR-377, hsa-miR-378, hsa-miR-422b, hsa-miR-379, hsa-miR-380-5p, hsa-miR-380-3p, hsa-miR-381, hsa-miR-382, hsa-miR-383, hsa-miR-340, hsa-miR-330, hsa-miR-328, hsa-miR-342, hsa-miR-337, hsa-miR-323, hsa-miR-326, hsa-miR-151, hsa-miR-135b, hsa-miR-148b, hsa-miR-331, hsa-miR-324-5p, hsa-miR-324-3p, hsa-miR-338, hsa-miR-339, hsa-miR-335, hsa-miR-133b, hsa-miR-325, hsa-miR-345, hsa-miR-346, ebv-miR-BHRF1-1, ebv-miR-BHRF1-2*, ebv-miR-BHRF1-2, ebv-miR-BHRF1-3, ebv-miR-BART1-5p, ebv-miR-BART2, hsa-miR-384, hsa-miR-196b, hsa-miR-422a, hsa-miR-423, hsa-miR-424, hsa-miR-425-3p, hsa-miR-18b, hsa-miR-20b, hsa-miR-448, hsa-miR-429, hsa-miR-449, hsa-miR-450, hcmv-miR-UL22A, hcmv-miR-UL22A*, hcmv-miR-UL36, hcmv-miR-UL 112, hcmv-miR-UL148D, hcmv-miR-US5-1, hcmv-miR-US5-2, hcmv-miR-US25-1, hcmv-miR-US25-2-5p, hcmv-miR-US25-2-3p, hcmv-miR-US33, hsa-miR-191*, hsa-miR-200a*, hsa-miR-369-5p, hsa-miR-431, hsa-miR-433, hsa-miR-329, hsa-miR-453, hsa-miR-451, hsa-miR-452, hsa-miR-452*, hsa-miR-409-5p, hsa-miR-409-3p, hsa-miR-412, hsa-miR-410, hsa-miR-376b, hsa-miR-483, hsa-miR-484, hsa-miR-485-5p, hsa-miR-485-3p, hsa-miR-486, hsa-miR-487a, kshv-miR-K12-10a, kshv-miR-K12-10b, kshv-miR-K12-11, kshv-miR-K12-1, kshv-miR-K12-2, kshv-miR-K12-9*, kshv-miR-K12-9, kshv-miR-K12-8, kshv-miR-K12-7, kshv-miR-K12-6-5p, kshv-miR-K12-6-3p, kshv-miR-K12-5, kshv-miR-K12-4-5p, kshv-miR-K12-4-3p, kshv-miR-K12-3, kshv-miR-K12-3*, hsa-miR-488, hsa-miR-489, hsa-miR-490, hsa-miR-491, hsa-miR-51 1, hsa-miR-146b, hsa-miR-202*, hsa-miR-202, hsa-miR-492, hsa-miR-493-5p, hsa-miR-432, hsa-miR-432*, hsa-miR-494, hsa-miR-495, hsa-miR-496, hsa-miR-193b, hsa-miR-497, hsa-miR-181d, hsa-miR-512-5p, hsa-miR-512-3p, hsa-miR-498, hsa-miR-520e, hsa-miR-515-5p, hsa-miR-515-3p, hsa-miR-519e*, hsa-miR-519e, hsa-miR-520f, hsa-miR-526c, hsa-miR-519c, hsa-miR-520a*, hsa-miR-520a, hsa-miR-526b, hsa-miR-526b*, hsa-miR-519b, hsa-miR-525, hsa-miR-525*, hsa-miR-523, hsa-miR-518f*, hsa-miR-518f, hsa-miR-520b, hsa-miR-518b, hsa-miR-526a, hsa-miR-520c, hsa-miR-518c*, hsa-miR-518c, hsa-miR-524*, hsa-miR-524, hsa-miR-517*, hsa-miR-517a, hsa-miR-519d, hsa-miR-521, hsa-miR-520d*, hsa-miR-520d, hsa-miR-517b, hsa-miR-520g, hsa-miR-516-5p, hsa-miR-516-3p, hsa-miR-518e, hsa-miR-527, hsa-miR-518a, hsa-miR-518d, hsa-miR-517c, hsa-miR-520h, hsa-miR-522, hsa-miR-519a, hsa-miR-499, hsa-miR-500, hsa-miR-501, hsa-miR-502, hsa-miR-503, hsa-miR-504, hsa-miR-505, hsa-miR-513, hsa-miR-506, hsa-miR-507, hsa-miR-508, hsa-miR-509, hsa-miR-510, hsa-miR-514, hsa-miR-532, hsa-miR-299-5p, hsa-miR-18a*, hsa-miR-455, hsa-miR-493-3p, hsa-miR-539, hsa-miR-544, hsa-miR-545, hsa-miR-487b, hsa-miR-551a, hsa-miR-552, hsa-miR-553, hsa-miR-554, hsa-miR-92b, hsa-miR-555, hsa-miR-556, hsa-miR-557, hsa-miR-558, hsa-miR-559, hsa-miR-560, hsa-miR-561, hsa-miR-562, hsa-miR-563, hsa-miR-564, hsa-miR-565, hsa-miR-566, hsa-miR-567, hsa-miR-568, hsa-miR-551b, hsa-miR-569, hsa-miR-570, hsa-miR-571, hsa-miR-572, hsa-miR-573, hsa-miR-574, hsa-miR-575, hsa-miR-576, hsa-miR-577, hsa-miR-578, hsa-miR-579, hsa-miR-580, hsa-miR-581, hsa-miR-582, hsa-miR-583, hsa-miR-584, hsa-miR-585, hsa-miR-548a, hsa-miR-586, hsa-miR-587, hsa-miR-548b, hsa-miR-588, hsa-miR-589, hsa-miR-550, hsa-miR-590, hsa-miR-591, hsa-miR-592, hsa-miR-593, hsa-miR-595, hsa-miR-596, hsa-miR-597, hsa-miR-598, hsa-miR-599, hsa-miR-600, hsa-miR-601, hsa-miR-602, hsa-miR-603, hsa-miR-604, hsa-miR-605, hsa-miR-606, hsa-miR-607, hsa-miR-608, hsa-miR-609, hsa-miR-610, hsa-miR-611, hsa-miR-612, hsa-miR-613, hsa-miR-614, hsa-miR-615, hsa-miR-616, hsa-miR-548c, hsa-miR-617, hsa-tniR-618, hsa-miR-619, hsa-miR-620, hsa-miR-621, hsa-miR-622, hsa-miR-623, hsa-miR-624, hsa-miR-625, hsa-miR-626, hsa-miR-627, hsa-miR-628, hsa-miR-629, hsa-miR-630, hsa-miR-631, hsa-miR-33b, hsa-miR-632, hsa-miR-633, hsa-miR-634, hsa-miR-635, hsa-miR-636, hsa-miR-637, hsa-miR-638, hsa-miR-639, hsa-miR-640, hsa-miR-641, hsa-miR-642, hsa-miR-643, hsa-miR-644, hsa-miR-645, hsa-miR-646, hsa-miR-647, hsa-miR-648, hsa-miR-649, hsa-miR-650, hsa-miR-651, hsa-miR-652, hsa-miR-548d, hsa-miR-661, hsa-miR-662, hsa-miR-663, hsa-miR-449b, hsa-miR-653, hsa-miR-411, hsa-miR-654, hsa-miR-655, hsa-miR-656, hsa-miR-549, hsa-miR-657, hsa-miR-658, hsa-miR-659, hsa-miR-660, hsa-miR-421, hsa-miR-542-5p, hcmv-miR-US4, hcmv-miR-UL70-5p, hcmv-miR-UL70-3p, hsa-miR-363*, hsa-miR-376a*, hsa-miR-542-3p, ebv-miR-BART1-3p, hsa-miR-425-5p, ebv-miR-BART3-5p, ebv-miR-BART3-3p, ebv-miR-BART4, ebv-miR-BART5, ebv-miR-BART6-5p, ebv-miR-BART6-3p, ebv-miR-BART7, ebv-miR-BART8-5p, ebv-miR-BART8-3p, ebv-miR-BART9, ebv-miR-BARTIO, ebv-miR-BART11-5p, ebv-miR-BART11-3p, ebv-miR-BART12, ebv-miR-BART13, ebv-miR-BART14-5p, ebv-miR-BART14-3p, kshv-miR-K12-12, ebv-miR-BART15, ebv-miR-BART16, ebv-miR-BART17-5p, ebv-miR-BART17-3p, ebv-miR-BART18, ebv-miR-BART19, ebv-miR-BART20-5p, ebv-miR-BART20-3p, hsv1-miR-H1, hsa-miR-758, hsa-miR-671, hsa-miR-668, hsa-miR-767-5p, hsa-miR-767-3p, hsa-miR-454-5p, hsa-miR-454-3p, hsa-miR-769-5p, hsa-miR-769-3p, hsa-miR-766, hsa-miR-765, hsa-miR-768-5p, hsa-miR-768-3p, hsa-miR-770-5p, hsa-miR-802, hsa-miR-801, hsa-miR-675,

5. A pharmaceutical composition according to claim 1 wherein said oligonucleotide or said conjugate thereof comprises a nucleotide analog at a position selected from the following; the first nucleobase, counting from the 3' end, the second nucleobase, counting from the 3' end, the ninth based, counting from the 3' end, and the tenth base, counting from the 3' end.

6-18. (canceled)

19. A pharmaceutical composition according to claim 1, wherein the single stranded oligonucleotide comprises at least one nucleotide analogue unit, in a position which is within the region complementary to the miRNA seed region.

20. A pharmaceutical composition according to claim 19, wherein the nucleobase sequence of the single stranded oligonucleotide which is complementary to the sequence of the microRNA seed region, is selected from the group consisting of (a) (X)Xxxxxx, (X)xXxxxx, (X)xxXxxx, (X)xxxXxx, (X)xxxxXx and (X)xxxxxX, (b) (X)XXxxxx, (X)XxXxxx, (X)XxxXxx, (X)XxxxXx, (X)XxxxxX, (X)xXXxxx, (X)xXxXxx, (X)xXxxXx, (X)xXxxxX, (X)xxXXxx, (X)xxXxXx, (X)xxXxxX, (X)xxxXXx, (X)xxxXxX and (X)xxxxXX, (c) (X)XXXxxx, (X)xXXXxx, (X)xxXXXx, (X)xxxXXX, (X)XXxXxx, (X)XXxxXx, (X)XXxxxX, (X)xXXxXx, (X)xXXxxX, (X)xxXXxX, (X)XxXXxx, (X)XxxXXx (X)XxxxXX, (X)xXxXXx, (X)xXxxXX, (X)xxXxXX, (X)xXxXxX and (X)XxXxXx, (d) (X)xxXXX, (X)xXxXXX, (X)xXXxXX, (X)xXXX.chi.X, (X)xXXXXx, (X)XxxXXXX, (X)XxXxXX, (X)XxXXxX, (X)XxXXx, (X)XXxxXX, (X)XXxXxX, (X)XXxXXx, (X)XXXxxX, (X)XXXxXx, and (X)XXXXxx, (e) (X)xXXXXX, (X)XxXXXX, (X)XXxXXX, (X)XXXxXX, (X)XXXXxX and (X)XXXXXx, and (f) XXXXXX, XxXXXXX, XXxXXXX, XXXxXXX, XXXXxXX, XXXXXxX and XXXXXXx, as read in a 3'-5' direction, wherein "X" denotes a nucleotide analogue, (X) denotes an optional nucleotide analogue, and "x" denotes a DNA or RNA nucleotide unit,

21-44. (canceled)

45. A pharmaceutical composition according to claim 20, wherein the nucleotide analogue units are independently selected form the group consisting of: 2'-O-alkyl-RNA unit, 2'-OMe-RNA unit, 2'-amino-DNA unit, 2'-fluoro-DNA unit, LNA unit, PNA unit, HNA unit, INA unit.

46-59. (canceled)

60. A pharmaceutical composition according to claim 1, wherein the nucleotide analogues have a higher thermal duplex stability to a complementary RNA nucleotide than the thermal duplex stability of an equivalent DNA nucleotide to said complementary RNA nucleotide.

61. A pharmaceutical composition according to claim 1, wherein the nucleotide analogues confer enhanced serum stability to the single stranded oligonucleotide.

62. A pharmaceutical composition according to claim 1, wherein the single stranded oligonucleotide forms an A-helix conformation with a complementary single stranded RNA molecule.

63. A pharmaceutical composition according to claim 1, wherein the oligonucleotide does not mediate RNAseH based cleavage of a complementary single stranded RNA molecule.

64-66. (canceled)

67. The pharmaceutical composition according to any one of claims 1-66 wherein the single stranded oligonucleotide is capable of forming a duplex with a complementary single stranded DNA nucleic acid molecule with phosphodiester internucleoside linkages, wherein the duplex has a Tm of between about 50.degree. C. to about 95.degree. C.

68-69. (canceled)

70. A pharmaceutical composition according to claim 1, wherein the LNA unit are independently selected from the group consisting of oxy-LNA, thio-LNA, and amino-LNA, in either of the D-.beta. and L-.alpha. configurations or combinations thereof.

71-73. (canceled)

74. A pharmaceutical composition according to claim 1, wherein the oligonucleotide comprises at least one internucleoside linkage group which differs from phosphate.

75-82. (canceled)

83. A method for the treatment of a disease or medical disorder associated with the presence or over-expression of the microRNA, comprising the step of administering a composition comprising a single stranded oligonucleotide, or a conjugate of said oligonucleotide, having a length of between 8 and 17 nucleobase units, and a pharmaceutically acceptable diluent, carrier, or adjuvant; wherein said oligonucleotide, or conjugate thereof, comprises a Locked Nucleic Acid nucleobase unit, and wherein said oligonucleotide, or conjugate thereof, is complementary to a human microRNA sequence.

84. A method for reducing the effective amount of a miRNA target in a cell or an organism, comprising administering a composition comprising a single stranded oligonucleotide, or a conjugate of said oligonucleotide, having a length of between 8 and 17 nucleobase units, and a pharmaceutically acceptable diluent, carrier, or adjuvant; wherein said oligonucleotide, or conjugate thereof, comprises a Locked Nucleic Acid nucleobase unit, and wherein said oligonucleotide, or conjugate thereof, is complementary to a human microRNA sequence.

85-88. (canceled)

89. The method according to claim 87, wherein the miRNA target is selected from the group consisting of the miRNA targets shown in table 2.

90-95. (canceled)