U.S. patent application number 12/307045 was filed with the patent office on 2009-12-24 for use of bacterial polysaccharides for biofilm inhibition.
This patent application is currently assigned to INSTITUT PASTEUR. Invention is credited to Sandra Da Re, Jean-Marc Ghigo, Jaione Valle.
Application Number | 20090318382 12/307045 |
Document ID | / |
Family ID | 37668091 |
Filed Date | 2009-12-24 |
United States Patent
Application |
20090318382 |
Kind Code |
A1 |
Ghigo; Jean-Marc ; et
al. |
December 24, 2009 |
USE OF BACTERIAL POLYSACCHARIDES FOR BIOFILM INHIBITION
Abstract
A method comprises preventing or inhibiting bacterial adhesion
and/or bacterial biofilm development by treating a substrate with a
composition of a soluble group II capsular polysaccharide obtained
from a bacterial strain.
Inventors: |
Ghigo; Jean-Marc;
(Fontenay-Aux-Roses, FR) ; Valle; Jaione; (Paris,
FR) ; Da Re; Sandra; (Limoges, FR) |
Correspondence
Address: |
OBLON, SPIVAK, MCCLELLAND MAIER & NEUSTADT, L.L.P.
1940 DUKE STREET
ALEXANDRIA
VA
22314
US
|
Assignee: |
INSTITUT PASTEUR
Paris
FR
CENTRE NATIONAL DE LA RECHERCHE SCIENTIFIQUE
Paris
FR
|
Family ID: |
37668091 |
Appl. No.: |
12/307045 |
Filed: |
June 25, 2007 |
PCT Filed: |
June 25, 2007 |
PCT NO: |
PCT/IB07/02875 |
371 Date: |
April 17, 2009 |
Current U.S.
Class: |
514/54 ; 435/274;
536/123.1; 604/265 |
Current CPC
Class: |
A61P 31/00 20180101;
Y02A 50/473 20180101; A61L 29/14 20130101; A61L 31/10 20130101;
A61L 2420/00 20130101; A61L 2/232 20130101; A61L 31/14 20130101;
A61L 2420/02 20130101; B05D 1/18 20130101; A61L 2/18 20130101; A01N
25/08 20130101; A61L 29/085 20130101; A01N 63/10 20200101; A61K
31/715 20130101; A61P 31/04 20180101; A61L 2300/232 20130101; A01N
43/16 20130101; A61L 2300/404 20130101 |
Class at
Publication: |
514/54 ; 435/274;
536/123.1; 604/265 |
International
Class: |
A01N 43/04 20060101
A01N043/04; C08B 37/00 20060101 C08B037/00; C07H 1/00 20060101
C07H001/00; A61L 29/16 20060101 A61L029/16 |
Foreign Application Data
Date |
Code |
Application Number |
Jun 30, 2006 |
EP |
06291080.7 |
Claims
1. A method for preventing or inhibiting bacterial adhesion and/or
bacterial biofilm development on a substrate, comprising: treating
said substrate with a composition of a soluble group II-like
capsular polysaccharide obtained from a bacterial strain.
2. The method of claim 1, wherein said soluble group II-like
capsular polysaccharide is obtained from the supernatant of a
culture of bacteria selected from the group consisting of
Escherichia coli, Hemophilus influenzae and Neisseria
meningitidis.
3. The method of claim 1, wherein said soluble group II-like
capsular polysaccharide is obtained as a purified fraction.
4. A composition, comprising: a soluble group II-like capsular
polysaccharide obtained from a bacterial strain, wherein said
composition inhibits bacterial adhesion and/or bacterial biofilm
development.
5. The composition of claim 4, which comprises a purified fraction
of the supernatant of a culture of bacteria selected from the group
consisting of E. coli, H. influenzae and N. meningitidis.
6. A process for purifying an anti-biofilm group II-like capsular
polysaccharide obtained from a bacterial strain, comprising the
following steps: (i) separating the supernatant of a culture of a
bacterial strain expressing a group II-like capsule from the
bacterial cells, (ii) precipitating the polysaccharides present in
the obtained supernatant, and (iii) optionally resuspending the
precipitate.
7. The process of claim 6, wherein said bacterial strain expressing
a group II-like capsule is selected from the group consisting of E.
coli, H. influenzae and N. meningitidis.
8. The process of claim 7, wherein said bacterial strain is a
uropathogenic E. coli.
9. The process of any of claim 6, wherein the separation step (i)
is performed by filter-sterilization and/or by centrifugation of
the culture.
10. The process of any of claim 6, wherein the precipitation in
step (ii) is performed with three volumes of ethanol for one volume
of supernatant.
11. The process of any of claim 6, wherein the precipitate obtained
in step (ii) is resuspended in water, dialyzed against deionised
water, and then lyophilized before step (iii).
12. The process of any of claim 6, further comprising an additional
step (iv) of purification by ion exchange chromatography.
13. The process of claim 12, wherein step (iv) is performed with a
DEAE-Sepharose column.
14. The process of claim 12, wherein the resuspension in step (iii)
is done in TrisHCl 20 mM, pH 7.5, with 25% propanol-1, and the
column of step (iv) is equilibrated with the same buffer.
15. The process of claim 12, wherein a centrifugation step is
performed between step (iii) and step (iv) to discard an insoluble
fraction.
16. The process of claim 12, wherein said group II-like capsular
polysaccharide is eluted with 300 mM NaCl in TrisHCl 20 mM, pH 7.5,
25% propanol-1.
17. A method for preventing or inhibiting bacterial adhesion and/or
bacterial biofilm development on a substrate, comprising: treating
said substrate with a composition of a soluble group II capsular
polysaccharide obtained from a bacterial strain as prepared by the
process according to claim 6.
18. The composition of claim 4, which is formulated for preventive
or therapeutic administration to a subject in need thereof.
19. An anti-biofilm coating, comprising: a group II-like capsular
polysaccharide obtained from a bacterial strain.
20. The anti-biofilm coating of claim 19, wherein said group
II-like capsular polysaccharide is obtained from a bacterial strain
selected from the group consisting of Escherichia coli, Hemophilus
influenzae and Neisseria meningitidis.
21. An anti-biofilm coating, comprising: an applied film of the
composition of claim 4.
22. A medical or industrial device which is at least partly coated
with the anti-biofilm coating according to claim 19.
23. A composition, comprising: a soluble group II capsular
polysaccharide obtained from a bacterial strain obtained through
the process according to claim 6.
24. The composition of claim 23, which is formulated for preventive
or therapeutic administration to a subject in need thereof.
Description
[0001] The present invention pertains to the field of biofilm
prevention. More particularly, the invention provides novel
components which can prevent and/or inhibit bacterial biofilm
formation on various surfaces.
[0002] A biofilm is an accumulation of microorganisms embedded in a
polysaccharide matrix and adherent to a biological or a non-biotic
surface. Diverse microorganisms (bacteria, fungi, and/or protozoa,
with associated bacteriophages and other viruses) can be found in
these biofilms. Biofilms are ubiquitous in nature and are commonly
found in a wide range of environments, including domestic and
industrial water systems.
[0003] Biofilms are also etiologic agents for a number of disease
states in mammals. Examples include infections of the oral soft
tissues, teeth, middle ear, gastrointestinal tract, urogenital
tract, airway/lung tissue, peritoneal membrane and eye. Biofilms
also develop on medical indwelling devices, such as dental
implants, urinary tract prostheses, peritoneal dialysis catheters,
indwelling catheters for hemodialysis and for chronic
administration of chemotherapeutic agents (Hickman catheters),
cardiac implants such as pacemakers, prosthetic heart valves,
ventricular assist devices (VAD), synthetic vascular grafts and
stents, prostheses, internal fixation devices, percutaneous
sutures, and tracheal and ventilator tubing.
[0004] Biofilm development in industrial devices such as water
systems or agri-food plants also raises safety problems.
[0005] Planktonic bacteria (i.e., single-celled bacteria suspended
in liquid media) are usually used as models for research and
antibiotics design. However, bacteria in biofilms are far more
resistant to antibiotics than their planktonic counterparts, and
less accessible to the immune system. Moreover, conjugation occurs
at a greater rate between cells in biofilms than between planktonic
cells. This increased opportunity for gene transfer among bacteria
is important, since bacteria resistant to antimicrobials or
chemical biocides can transfer the genes for resistance to
neighboring susceptible bacteria. Gene transfer can also convert a
previous avirulent commensal organism into a highly virulent
pathogen.
[0006] Biofilm formation is not limited to the attachment of
bacteria to a surface. Indeed, when growing in depth, biofilm
bacteria interact more between each other than with the actual
physical substratum on which the biofilm initially developed. In a
biofilm, bacteria can communicate through chemical signalling
mechanisms, so that the community undergoes phenotypic changes when
a minimum density (the quorum) is reached in the biofilm. This
phenomenon, called "quorum sensing", can be responsible for the
expression of virulence factors.
[0007] Besides E. coli biofilm-related polysaccharides such as
colanic acid polymer, cellulose and (1-6)
.beta.-N-acetyl-glucosamine, E. coli isolates also produce two
serotype-specific surface polysaccharides: the lipopolysaccharide
(LPS) O antigen and capsular polysaceharide K antigen. These two
classes of surface exposed polysaccharidic polymers have been shown
to play indirect roles in biofilms by shielding of bacterial
surface adhesin (Schembri et al., 2004).
[0008] The strategies described to date for preventing and/or
disrupting biofilms are mainly based on quorum sensing inhibitors
(Schachter, 2003).
[0009] The present invention provides a novel strategy for
inhibiting biofilm formation, since the inventors have
demonstrated, using in vitro mixed-species bacterial biofilm, that
some bacteria release in the culture supernatant a soluble group II
capsular polysaccharide that prevents biofilm formation by a wide
range of Gram-negative and Gram-positive bacteria. As described in
the experimental part below, these capsule components induce
physico-chemical alterations of surface, leading to a reduction of
cell-surface and cell-cell contacts that limits both initial
adhesion and bacterial biofilm development.
[0010] A first object of the present invention is hence the use of
a soluble group II-like capsular polysaccharide from a bacterial
strain, for the preparation of a composition which prevents or
inhibits adhesion of micro-organisms and/or biofilm development, in
particular bacterial adhesion and/or bacterial biofilm development.
In what follows, the term "polysaccharide", although used in the
singular, can designate a mixture of different polysaccharides. The
capsular polysaccharides produced by the bacteria are indeed of
various sizes. In fact, E. coli capsules, which constitute the
outermost protective layer of the cell surface, are classified into
four groups based on genetic and biosynthetic criteria. Group II
capsule is one of the 4 capsular types described in E. coli, and is
constituted of high molecular weight and charged polysaccharidic
polymers produced by most uropathogenic Escherichia coli (UPEC) and
other extra-intestinal E. coli. Group II capsule displays a
conserved modular genetic organization characterized by 3
functional regions. Region 1 (kpsFEDCUS) and region 3 (kpsMT) are
conserved in all group II capsulated bacteria and encode proteins
required for ABC-dependent export. Region 2 encodes a diversity of
polysaccharidic structural components such as K1, K2 (CFT073), K5
and K96 capsular serotypes (Whitfield, 2006; Whitfield and Roberts,
1999). Group II-like capsules have also been described in
Hemophilus influenzae and in Neisseria meningitides (Roberts,
1996).
[0011] In a preferred embodiment of the invention, a soluble group
II-like capsular polysaccharide is obtained in the supernatant of a
culture of bacteria selected amongst Escherichia coli, Hemophilus
influenzae and Neisseria meningitidis. However, in the present
text, the phrase "group II-like capsular polysaccharides" can
designate capsular polysaccharides which are produced by other
bacteria, provided they retain the anti-biofilm properties observed
for the capsular polysaccharides produced by the above-mentioned
strains. For example, capsular polysaccharides produced by the
strain 47 of the ECOR collection (Ochman and Selander, 1984) are
herein considered as a "group II-like capsular polysaccharide",
although this strain apparently produces a hybrid group II/group
III capsule.
[0012] The present invention can be performed with polysaccharides
having different purification levels. For example, the crude
supernatant of a bacterial culture (separated from the bacteria by
filter-sterilizing or centrifugation) can be used according to the
invention as a composition comprising soluble group II-like
capsular polysaccharides. However, in order to increase the
anti-biofilm activity of the composition, as well as its safety,
the soluble group II-like capsular polysaccharide can be obtained
as a purified fraction. Three levels of purification are described
in the experimental part below, as non-limitative examples.
Alternatively, a composition according to the invention can be
obtained directly from the bacterial culture, for example after
lysis of the bacteria.
[0013] Another object of the present invention is a composition for
inhibiting bacterial adhesion and/or bacterial biofilm development,
which comprises a soluble group II-like capsular polysaccharide
from a bacterial strain. Such a composition can comprise
polysaccharides having different purification levels. In a
preferred embodiment, such a composition comprises a purified
fraction of the supernatant of a culture of bacteria selected
amongst E. coli, H. influenzae and N. meningitidis, comprising
soluble group II-like capsular polysaccharides.
[0014] The present invention also relates to a process for
purifying an anti-biofilm group II-like capsular polysaccharide
from a bacterial strain, comprising the following steps:
[0015] (i) separating the supernatant of a culture of a bacterial
strain expressing a group II-like capsule from the bacterial
cells,
[0016] (ii) precipitating the polysaccharides present in the
obtained supernatant, and
[0017] (iii) optionally, resuspending the precipitate.
[0018] The above process is preferably performed with a bacterial
strain selected amongst E. coli, H. influenzae and N. meningitidis,
more preferably with an uropathogenic E. coli.
[0019] In this process, step (i) can be carried out by centrifuging
and/or filter-sterilizing the bacterial culture, in order to
eliminate the bacterial cells. For example, in industrial
processes, tangential filtration can be performed without any
preliminary centrifugation. Tangential filtration can be performed
continuously.
[0020] The skilled artisan can use any precipitation process known
in the art to perform the second step of the above-described
process. For example, the precipitation in step (ii) can be
performed with three volumes of ethanol for one volume of
supernatant.
[0021] In an advantageous variant of the process according to the
invention, the precipitate obtained in step (ii) is first
resuspended in water, dialyzed against deionised water, and then
lyophilized before step (iii).
[0022] The resuspension in step (iii) can be done in water or in
any buffer suitable for the intended use. An example of buffer
which can be used is TrisHCl 20 mM, pH 7.5, with 25%
propanol-1.
[0023] At the end of step (iii), the anti-biofilm polysaccharides
are obtained as a semi-purified product, which can be used as such
according to the invention, especially in applications which do not
need medical-grade products.
[0024] In order to further purify the polysaccharides, the
purification process can comprise an additional step (iv) of
purification by chromatography, especially ion exchange
chromatography, for example using a DEAE-Sepharose column. In this
embodiment of the invention, an optional centrifugation step can be
performed between step (iii) and step (iv), to discard the
insoluble fraction.
[0025] The skilled artisan can choose any appropriate buffer for
performing step (iv). An example of buffer which can be used is
TrisHCl 20 mM, pH 7.5, with 25% propanol-1. According to an
advantageous embodiment of the process, the precipitate is
resuspended in TrisHCl 20 mM, pH 7.5, with 25% propanol-1 in step
(iii), and the column used in step (iv) is equilibrated with the
same buffer.
[0026] When performing a step of purification by ion-exchange
chromatography, the group II-like capsular polysaccharides can be
eluted using a salt gradient, for example a NaCl gradient. In an
efficient embodiment of the process, described in the experimental
part, the group II-like capsular polysaccharides are eluted with
300 mM NaCl in TrisHCl 20 mM, pH 7.5, 25% propanol-1.
[0027] Of course, the soluble group II-like capsular
polysaccharides obtained through a process as above-described can
be used, according to the invention, for the preparation of a
composition which prevents or inhibits bacterial adhesion and/or
bacterial biofilm development. An anti-biofilm composition
comprising such purified polysaccharides is also part of the
present invention.
[0028] In a particular embodiment, the composition of the present
invention is formulated for preventive or therapeutic
administration to a subject in need thereof. Non-limitative
examples of compositions according to this aspect of the invention
are oral solutions, solutions for infusion into the ear, collyrium,
toothpaste or therapeutic dentifrice, etc. These compositions can
be used, for example, to prevent the (re)-colonization of the gut,
the lung, the ear, the sinus or any other organ or cavity, by
pathogenic bacteria.
[0029] In another embodiment, the composition according to the
invention is a liquid or a paste, for example a paint, which can be
applied on any kind surfaces in order to prevent biofilm formation
on these surfaces.
[0030] Another aspect of the present invention is an anti-biofilm
coating, comprising a group II-like capsular polysaccharide from a
bacterial strain. In such a coating, the group II-like capsular
polysaccharide can have different purification levels, as described
above. In a preferred embodiment of the coating according to the
invention, the group II-like capsular polysaccharide is from a
bacterial strain selected amongst Escherichia coli, Hemophilus
influenzae and Neisseria meningitidis. This coating can be
obtained, for example, by application of a composition as
above-described. It can also be in the form of sheets which can be
applied on any kind of device on which biofilm formation must be
avoided.
[0031] Accordingly, a medical or industrial device, which is at
least partly coated with an anti-biofilm coating comprising a group
II-like capsular polysaccharide from a bacterial strain, is also
part of the present invention. Such an object can be obtained, for
example, by dipping part of the device or the whole device, into a
liquid composition as described above. The skilled artisan can
choose the incubation duration, depending on the material, the
concentration of the composition in group II-like capsular
polysaccharide, the intended use, and the like. Typically, said
incubation can last from 10 seconds to 30 minutes. Short
incubations (.ltoreq.1 to 5 minutes) are usually sufficient. If
necessary, the coated device can then be sterilized by a variety of
treatments, without damaging the coating. For example, it can be
intensively washed and/or autoclaved. Any kind of device made of
glass, pyrex, PVC, polycarbonate, polypropylene and the like, can
advantageously be coated according to this aspect of the
invention.
[0032] Non-limitative medical devices which can advantageously be
coated according to this aspect of the invention are scalpels, burs
and other non-disposable surgery and/or dentistry tools, and
indwelling devices, such as dental implants, urinary tract
prostheses, peritoneal dialysis catheters, indwelling catheters for
hemodialysis and for chronic administration of chemotherapeutic
agents (Hickman catheters), cardiac implants such as pacemakers,
prosthetic heart valves, ventricular assist devices (VAD),
synthetic vascular grafts and stents, prostheses, internal fixation
devices, percutaneous sutures, and tracheal and ventilator
tubing.
[0033] Non-limitative examples of industrial devices which can
advantageously be coated according to this aspect of the invention
are plumbing materials, such as pipes, tubes, valves and the like,
air-cooled towers, warm water systems, coolant circuits of nuclear
power plant, especially secondary and tertiary circuits, agri-food
materials, such as silos, fermenters, colanders, etc., furniture
elements such as lab tables, counter tops and the like, especially
for clean rooms, etc.
[0034] The invention is further illustrated by the following
figures and examples.
FIGURE LEGENDS
[0035] FIG. 1: Biofilm inhibitory effect of CFT073. A, Biofilm
formation of MG1655 F' in microfermentors inoculated with 1 or 10
OD.sub.600nm, equivalent of KS272 (grey) or CFT073 (black) cells.
MG1655F' biofilm alone (O, white). Results are average of 6
replicates .+-.s.d. P<0.001 compared with MG1655F' biofilm. B,
Microtiter plate MG1655F' biofilm alone (O), or in the presence of
KS272 or CFT073 supernatant, (S.KS272 and S.CFT073, respectively).
C, MG1655F' biofilm in microfermentors perfused with medium without
supernatant (O) or with S.KS272 or S.CFT073. D, Growth curves of
MG1655F' alone (O) or with S.KS272 or S.CFT073. E, MG1655F' cell
viability alone (O) or with S.KS272 or S.CFT073 visualized with
BacLight staining. F, Qualitative analysis of the biofilm formation
in microtiter plate by different bacteria in the presence of CFT073
supernatant (S. CFT).
[0036] FIG. 2: Effect of CFT073 supernatant on Gram-positive and
Gram-negative bacterial biofilm formation. A, Quantification of the
microtiter plate biofilm formation of different bacteria, alone
(O), with KS272 (S.KS) or CFT073 (S.CFT) supernatant. Levels of
crystal violet retained were measured spectrophotometrically
(OD.sub.570nm). B, Quantification of biofilm formed by several
pathogenic bacteria in microfermentors using media not supplemented
(O), or supplemented with S.CFT or S.KS. Error bars represent
standard deviation of two independent experiments. C, Effect of
CFT073 supernatant (S.CFT073) in mix biofilms of E. coli (MG1655F')
with P. aeruginosa (PAK), K. pneumoniae (KP21), S. epidermidis
(O-47), S. aureus (15981) and S. epidermidis (O-47) with S. aureus
(15981) and E. faecalis (54). Supernatant of E. coli
CFT073.DELTA.kpsD strain (S. .DELTA.kpsD) that do not secrete any
group II capsule is used as negative control. D, Qualitative
analysis of biofilm formation of S. aureus and P. aeruginosa, in a
microfermentor using media not supplemented, or supplemented with
CFT073 supernatant.
[0037] FIG. 3: Relationship between capsule production and
anti-biofilm activity of the CFT073 supernatant. A, Genetic
organization of the CFT073 capsule R1, R2 and R3 regions. Genes
with transposon insertions are marked with an asterisk. B, Biofilm
formation of MG1655F' cultivated in the presence of the capsule
mutant supernatants. C, Hexose levels in the supernatants. kpsF,
kpsU, c3692 and c3693 correspond to mutants that do not impair
capsule production. D, Stationary phase CFT073 or CFT073.DELTA.
bacterial cell capsules stained with ferritin and examined by
transmission electron microscopy (X100000; bar=0.2 .mu.m) (left
panel); 125 and 105 cells were observed respectively. Stained
CFT073 capsule is indicated by an arrow. On the right panel:
scanning electron micrographs of stationary-phase CFT073 or
CFT073.DELTA.kpsD (X50,000; bar=0.5 .mu.m); 45 and 37 cells were
observed respectively.
[0038] FIG. 4. Correlation between anti-biofilm activity and group
II capsule. Biofilm formation of E. coli MG1655F' and 1091 strains,
and of the S. aureus 15981 strain cultured with: (A) supernatants
of E. coli exhibiting anti-biofilm activity (see Table 1) (beside
strain 47, all the strains tested produce group II capsule) (B)
supernatants of CFT073, U-9, U-15 strains and their respective kpsD
mutants. (C) Biofilm formation in microfermentor of UPEC strains
CFT073, U-9, U-15 (black) and their respective kpsD mutants (grey)
grown in M63B1glu, and kpsD mutants grown in media supplemented
with their corresponding wild-type supernatant (white). Biofilms
were grown for 36 h at 37.degree. C. Error bars represent standard
deviation of the mean. Strains identified by simple numbers
correspond to those of the EcoR collection (Ochman and Selander,
1984).
[0039] FIG. 5. Anti-biofilm effect of Neisseria meningitides
supernatant. Quantification of the microtiter plate biofilm
formation of MG1655F' in the presence of S. Neisseria. OD.sub.570nm
nm of the crystal violet dye was determined as described in
(O'Toole and Kolter, 1998).
[0040] FIG. 6: Physico-chemical properties of the CFT073
supernatant. a, .zeta. potential of cationic colloids incubated
with the dialyzed supernatants from: CFT073 (CFT), U-9, IHE3034
(IHE), EcoR72 (E-72) (dark grey) and their respective capsule
mutants (light grey). (O) correspond to M63B1glu treatment. b,
Water droplet contact angle on surface incubated with CFT, U-9,
IHE, E-72 (dark grey) and the capsule mutants (light grey). c,
Propidium iodide adsorption onto cationic particles incubated with
CFT, U-9, IHE, E-72, FR2 (CFT073 supernatant purified fraction),
(dark grey) and their respective capsule mutants (light grey). The
extent of the adsorption is given by the fluorescent intensity
(>670 nm). d, Fluorescence microscopy of cationic particles
incubated with CFT, S.CFT073 .mu.l (.DELTA.R1), FR2 and not
incubated (O). Error bars represent the standard deviation of the
mean.
[0041] FIG. 7: Biofilm inhibition effect of CFT073 supernatant on
coated surfaces. Biofilm formation in microfermentors by several
bacteria using: untreated glass slides (upper panel), glass slides
treated with CFT073 supernatant (middle panel) and glass slides
treated with CFT073.DELTA.kpsD supernatant (lower panel).
[0042] FIG. 8. Impact of the treatment of spatula coated with
S.CFT073 supernatant (S.CFT). Biofilm formation in microfermentors
by MG1655F' using untreated glass slides and glass slides treated
with S.CFT or with boiled S.CFT, and then autoclaved or submitted
to intensive wash.
[0043] FIG. 9: CFT073 supernatant affects cell-cell interaction. A,
MG1655F' biofilm formation in microfermentors with media
supplemented with CFT073 supernatant (S.CFT) at times 0 h, 1 h, 6 h
(24 h of culture) and 24 h (48 h of culture). O: no addition of
S.CFT. B, GFP-tagged MG1655F' inoculated in a flow-cell and
monitored by confocal microscopy. CFT073 or KS272 supernatants were
supplemented after 3 h of culture and biofilms were grown for 12 h
total. C, Autoaggregation assay with strains that aggregate via
different mechanisms: MG1655F' (F conjugative pilus expression);
MG1655ompR234 (curli overexpression); MG1655.DELTA.oxyR (Ag43
autotransporter adhesin overexpression); 1094 (cellulose
production). Cells were diluted to OD.sub.600 of 2 in 3 ml of M63B1
(triangle), CFT073 supernatant (circle) and .DELTA.kpsD supernatant
(rectangle).
[0044] FIG. 10. Anti-biofilm activity of the FR2 fraction. CFT073
supernatant purified fraction (FR2) was added to the MG 1655F'
culture in concentrations ranging from 0.5 to 500 .mu.g/ml. Biofilm
formation of MG1655F' was visualized after 24 h. Concentration of
50-100 .mu.g/ml inhibited MG1655 F' biofilm.
[0045] FIG. 11. Intestinal colonization by CFT073 and
CFT073.DELTA.R1. a, Bars represent the standard error of the log 10
mean number of CFU per gram of feces; a Mann-Whitney test was used
for statistical analysis, the level of statistical significance (*)
was set at P values of <0.016. b, Colon and caecium colonization
by CFT073 (circles) and CFT073.DELTA.R1 (triangles). DL: Detection
limit.
[0046] FIG. 12. Effect of growth phase and quorum-sensing in the
anti-biofilm properties of CFT073 supernatant. Biofilm formation of
MG1655F' in microtiter plate in presence of supernatants purified
from cells in exponential phase, stationary phase and .DELTA.luxS
mutant. 10.sup.10 cells in exponential phase (OD.sub.600nm=0.4) and
in stationary phase (OD.sub.600nm=2) were centrifuged and
supernatants were precipitated with 3 volumes of ethanol. The
supernatant of .DELTA.luxS mutant was purified from an overnight
culture.
EXAMPLES
Example 1
Methods
[0047] Bacterial Strains, Growth Conditions and Microscopy
Analysis
[0048] Bacterial strains are listed in Table 1 below. Gram-negative
bacteria were grown at 37.degree. C. in M63B1 minimal medium with
0.4% glucose (M63B1glu) or in LB rich medium. Gram-positive
bacteria were grown in TSB with 0.25% glucose (TSBglu) at
37.degree. C. The effect of CFT073 supernatant on bacterial growth
and viability rate was evaluated using growth curve determination,
colony forming unit count on LB plate and BacLight Live/Dead
viability stain (Molecular Probes). Ferritin-staining and Scanning
Electronic Microscopy was performed as described in
(Bahrani-Mougeot et al., 2002). Epifluorescence and transmitted
light microscopy were acquired using a Nikon E400 microscope.
Autoaggregation assays were performed as described in (Beloin et
al., 2006).
TABLE-US-00001 TABLE 1 Strains used in this study Strains Relevant
characteristics References E. coli strains CFT073 UPEC group II
capsule (K2) (Mobley et al., 1990) MG1655F' MG1655 F'
tet-.DELTA.traD plasmid (Ghigo, 2001) KS272 Commensal E. coli K-12
(Strauch and Beckwith, 1988) 1091 Commensal E. coli C. Le Bouguenec
1092 Commensal E. coli C. Le Bouguenec 1094 Commensal E. coli (Da
Re and Ghigo, 2006) 1096 Commensal E. coli C. Le Bouguenec 1097
Commensal E. coli C. Le Bouguenec 1102 Commensal E. coli C. Le
Bouguenec 1103 Commensal E. coli C. Le Bouguenec 1110 Commensal E.
coli C. Le Bouguenec 1125 Commensal E. coli C. Le Bouguenec 1127
Commensal E. coli C. Le Bouguenec U-1 UPEC group II capsule C.
Forestier U-2 UPEC group II capsule (K2) C. Forestier U-3 UPEC
non-group II capsule C. Forestier U-4 UPEC group II capsule C.
Forestier U-5 UPEC group II capsule C. Forestier U-6 UPEC group II
capsule (K2) C. Forestier U-7 UPEC non-group II capsule C.
Forestier U-8 UPEC group II capsule C. Forestier U-9 UPEC group II
capsule C. Forestier U-10 UPEC group II capsule C. Forestier U-11
UPEC non-group II capsule C. Forestier U-12 UPEC group II capsule
C. Forestier U-13 UPEC group II capsule C. Forestier U-14 UPEC
non-group II capsule C. Forestier U-15 UPEC group II capsule C.
Forestier U-16 UPEC group II capsule C. Forestier U-17 UPEC
non-group II capsule C. Forestier U-18 UPEC non-group II capsule C.
Forestier U-19 UPEC group II capsule C. Forestier U-20 UPEC group
II capsule C. Forestier U-21 UPEC group II capsule (K2) C.
Forestier 984 Commensal E. coli group II capsule (K1) M. C. Ploy
988 Commensal E. coli group II capsule (K1) M. C. Ploy 999
Commensal E. coli group II capsule (K1) M. C. Ploy 1007 Commensal
E. coli group II capsule (K1) M. C. Ploy 1014 Commensal E. coli
group II capsule (K1) M. C. Ploy IHE3034 E. coli causing meningitis
group II capsule (K1) (Meier et al., 1996) EcoR strains E. coli
Reference Collection (72 strains) (Ochman and Selander, 1984) Other
bacteria 15981 S. aureus clinical strain (Valle et al., 2003) V329
S. aureus bovine mastitis subclinical isolate (Cucarella et al.,
2001) O-47 S. epidermidis clinical strain (Heilmann et al., 1996)
CH845 S. epidermidis clinical strain BM94314 (Galdbart et al.,
2000) 54 E. faecalis clinical strain (Toledo-Arana et al., 2001)
11279 E. faecalis clinical strain (Toledo-Arana et al., 2001) KP21
Klebsiella pneumoniae strain C. Forestier PAK Pseudomonas
aeruginosa (Vasseur et al., 2005) 8013 Neisseria meningitidis
strain, serogroup C, class 1 (Deghmane et al., 2002) Mutants 44H3
CFT073 kpsD::TnSC189 This study 25F11 CFT073 kpsD::TnSC189 This
study 23D5 CFT073 kpsU::TnSC189 This study 16B9 CFT073
kpsU::TnSC189 This study 14E12 CFT073 kpsC::TnSC189 This study
76H11 CFT073 kpsS::TnSC189 This study 30H8 CFT073 kpsM::TnSC189
This study .DELTA.kpsD CFT073 kpsD::km This study .DELTA.kpsC
CFT073 kpsC::km This study .DELTA.kpsU CFT073 kpsU::km This study
.DELTA.kpsS CFT073 kpsD::km This study .DELTA.kpsM CFT073 kpsM::km
This study .DELTA.3692 CFT073 .DELTA.3692::km This study
.DELTA.3693 CFT073 .DELTA.3693::km This study .DELTA.3694 CFT073
.DELTA.3694::km This study .DELTA.3695-96 CFT073
.DELTA.3695.DELTA.3696::km This study .DELTA.R1 CFT073 with a
deletion from kpsD to kpsS This study .DELTA.R2 CFT073 with a
deletion from c3692 to c3696 This study .DELTA.R3 CFT073 with a
deletion from kpsT to kpsM This study U-9 .DELTA.kpsD U-9 kpsD::km
This study U-15 .DELTA.kpsD U-15 kpsD::km This study IHE3034
.DELTA.kpsD IHE3034 kpsD::km This study .DELTA.luxS CFT073
.DELTA.luxS This study CFT073gfp CFT073.lamda.ATTgfp This study
.DELTA.R1gfp .DELTA.R1.lamda.ATTgfp This study .DELTA.oxyR MG1655
oxyR::km (Beloin et al., 2006) ompR234 MG1655 ompR234 malA::km
(Vidal et al., 1998)
[0049] Biofilm Formation Procedures
[0050] Microfermentors experiments: Biofilm was performed as
described previously (Ghigo, 2001). Mixed biofilm cultures: an 8
hours MG1655F' biofilm formed in the internal microfermentors glass
slide was infected with 1 OD.sub.600nm equivalent of CFT073-gfp
overnight culture. After 24 hours of continuous culture in
M63B1glu, pictures of the glass slides were taken. Biofilm biomass
was estimated by determining the OD.sub.600nm of the resuspension
of the biofilm formed on the internal glass slide (Ghigo, 2001).
Biofilm inhibition assays: the incoming medium was mixed in a 1:1
ratio with filtered supernatants and brought into the
microferrnentors at different time after bacteria inoculation (0,
1, 6 or 24 hours). The biofilm was further cultivated for an
additional 24 hours before biomass determination. Analysis of
bacterial interaction with treated surfaces: the glass slides were
incubated 1 min with filtered CFT073 supernatant and rinsed once in
deionised water prior to inoculation in microfermentors. Biofilm
formation on the slide was determined after 24 hours.
[0051] Microtiter plate experiments. Static biofilm formation assay
were performed in 96-well PVC microtiter plates (Falcon) as
described in (O'Toole and Kolter, 1998). Biofilm inhibition assays:
overnight cultures were adjusted to OD.sub.600=0.04 before
inoculating 100 .mu.l in 96-well plates in the presence or absence
of 50 .mu.l of supernatant. Flow-chamber experiments. Biofilms were
performed in M63B1glu at 37.degree. C. in 3.times. channels
flow-cells (1.times.4.times.40 mm). The flow system was assembled
and prepared as described in (Christensen et al., 1999). Inocula
were prepared as follows: 16-20 hours old overnight cultures in
M63B1glu were harvested and resuspended as normalized dilutions
(OD.sub.600=0.005). 300 .mu.l were injected into each flow channel.
Input medium was mixed in a 1:1 ratio with filtered supernatant.
Flow was started 1 h after inoculation at a constant rate of 3 ml
h.sup.-1 using a Watson Marlow 205S peristaltic pump. All Assays
were at least performed in triplicate.
[0052] Purification of CFT073 or Other Group II Capsulated Strain
Supernatants Displaying Anti-Biofilm Activity
[0053] Three levels of purification have been tested:
[0054] (i) Filtration (sterilization) of the active supernatants
(S.CFT, used in all the experiments on microtiter plates or in
microfermentors) [0055] Overnight cultures in M63B1glucose 0.4%
were centrifuged for 30 min at 5000 rpm at 4.degree. C. and
filtered through 0.25 .mu.m filter to eliminate bacteria.
[0056] (ii) Precipitation of polysaccharides contained in active
supernatants [0057] The polysaccharides contained in the filtered
supernatant were precipitated with 3 volumes of ethanol,
resuspended in deionized water and dialyzed against deionized water
in 10 kDa cut-off dialysis cassettes (Pierce biochemical).
[0058] (iii) purification of the capsular polysaccharides active
fraction (capsular active fraction FR2) [0059] the partially
purified supernatant active fraction obtained in step (ii) was
lyophilized and resuspended in 80 ml of buffer Tris HCl 20 mM pH
7.5 containing 25% de propanol-1. [0060] This resuspension was
centrifuged for 10 minutes at 3000 rpm to eliminate the insoluble
particles. [0061] the soluble supernatant was loaded on a
DEAE-Sepharose column (30 ml, 2.6.times.6 cm, Amersham) and
equilibrated with Tris HCl 20 mM pH 7.5, 25% de propanol-1 buffer.
[0062] the column was washed with Tris HCl 20 mM pH 7.5, 25%
propanol-1 buffer at the rate of 20 ml/h. [0063] After the wash,
the column was eluted with a NaCl gradient (0 to 1 M in 400 ml) and
the polysaccharide concentration of each eluted fractions (4.5 ml)
was tested by the Dubois method (Dubois et al., 1956): 100 .mu.l of
phenol at 5% and 500 .mu.l of concentrated sulfuric acid followed
by vortex agitation and read at 492 nm) [0064] The positive
fractions (about 10 fractions of 4.5 ml) were pooled together and
dialyzed against deionized water and lyophilized [0065] 1 mg of the
lyophilysate was resuspended in 1 ml of deionized water
[0066] Handling of Culture Supernatants and Polysaccharide
Analysis
[0067] Overnight cultures in M63B1glu at 37.degree. C. were
centrifuged 30 minutes at 5000 rpm at 4.degree. C. After filtration
of the supernatant with a 0.2 .mu.m filter, macromolecules were
precipitated with 3 volumes of ethanol and dialysed against
deionised water using 10 kDa cassettes (Pierce). Total amounts of
phosphate and neutral sugars were determined by ammonium
molybdate/ascorbic acid and phenol/sulfuric acid methods,
respectively. Polysaccharide composition was determined by HPLC
(ion-exclusion column) and by gas liquid chromatography as in
(d'Enfert and Fontaine, 1997; Fontaine et al., 2000). CFT073
supernatant active fraction, FR2, was purified using a
DEAE-Sepharose column (Amersham) and eluted with 300 mM NaCl in 25%
propanol-1, 20 mM TrisHCl pH7.5. Molecular weight of the polymer
was estimated by gel filtration chromatography on Superdex-200
(Amersham) using dextran as standard. Polysaccharide degradations
were done by total acid hydrolysis (trifluoroacetic acid, 4N, 4H,
100.degree. C.) or by aqueous hydrofluoric acid (48% aq. HF, 2 days
on water-ice).
[0068] Mutagenesis and Molecular Techniques
[0069] Mariner transposon mutagenesis of E. coli CFT073 was
performed as described in (Da Re and Ghigo, 2006). The supernatants
of 10,000 transposon mutants incubated 24 h, in LB at 37.degree. C.
in 96-well microtiter plates were extracted after centrifugation of
the plates 15 min at 10000 rpm and their effect on MG1655F' biofilm
formation was analysed. Transposon insertion sites were determined
as described in (Da Re and Ghigo, 2006). Homology searches were
performed using Blast 2.0. Deletion mutants were generated as
detailed at
http://www.pasteur.fr/recherche/unites/Ggb/3SPCRprotocol.html,
using primers presented in Table 2.
TABLE-US-00002 TABLE 2 Primers used in this study. Target SEQ ID
gene Primer name Sequence No: Primers used to generate deletion
mutants kpsD KpsD.500-5 gaccagcttgcctttgcagaaacg 1 KpsD.500-3
ctttttcagcattacgcggatagg 2 KpsD.GB.L-5
TGCTCGATGAGTTTTTCTAAGGAGTTGAAatgagcaa 3 KpsD.GB.L-3
gattttgagacacaacgtggctttCATcacAAACTCATTCAGCGACA 4 KpsD.ext-5
ttgcgcttaagtttaaccaaaccg 5 KpsD.ext-3 gctctggcatggactccggtaact 6
kpsU KpsU.500-5 atgaacgcagttcagctttatcgcc 7 KpsU.500-3
ccaaatttcggcttgaggattttc 8 KpsU.GB.L-5
TGCTCGATGAGTTTTTCTAAcaggaactggctgaaaacgcatga 9 KpsU.GB.L-3
gattttgagacacaacgtggctttCATTTCAACTCCttacaaagacaga 10 KpsU.ext-5
tgcagaacggcgataccttaatcg 11 KpsU.ext-3 ctcggcaatcaaacgtactcgttg 12
kpsC KpsC.500-5 gaggcagatatcaacattaacc 13 KpsC.500-3
gttgaaggttttaagttctcaac 14 KpsC.GB.L-5
TGCTCGATGAGTTTTTCTAAACAATTTCATAGTTGACTATTAC 15 KpsC.GB.L-3
gattttgagacacaacgtggctttgagtaaatgccaatcatgcgttttc 16 KpsC.ext-5
cgactcacattacgattatgcg 17 KpsC.ext-3 gaaaatgatttgtggtggcggtagc 18
kpsS KpsS.500-5 agagcaaccttgagttattacg 19 KpsS.500-3
aaagacaagggatagctttagg 20 KpsS.GB.L-5
TGCTCGATGAGTTTTTCTAATTTATTCTAAATTATCAACG 21 KpsS.GB.L-3
gattttgagacacaacgtggctttCATAAATAATCTGTGTAATAGTCAA 22 KpsS.ext-5
agcgactggttgaaagcaaactg 23 KpsS.ext-3 ttcgatgagtcaagactattgg 24
kpsM KpsM.500-5 TTACTACGCATAAAATTCATGG 25 KpsM.500-3
aatgccatgcttaaaccaaagcc 26 KpsM.GB.L-5
TGCTCGATGAGTTTTTCTAAcaatgctgacatcatgattaagattg 27 KpsM.GB.L-3
gattttgagacacaacgtggctttcttgccatTTGGTGATGTGATCCT 28 KpsM.ext-5
TCGCATGCGTTCTGGTTTGAG 29 KpsM.ext-3 cacatcacaaaactctttcaatg 30 Kps
KpsD.500-5 gaccagcttgcctttgcagaaacg 31 KpsS.500-3
aaagacaagggatagctttagg 32 KpsD.GB.L-3
gattttgagacacaacgtggctttCATcacAAACTCATTCAGCGACA 33 KpsS.GB.L-3
gattttgagacacaacgtggctttCATAAATAATCTGTGTAATAGTCAA 34 KpsD.ext-5
ttgcgcttaagtttaaccaaaccg 35 KpsS.ext-3 ttcgatgagtcaagactattgg 36
Kps KpsR2.500-5 atataggagtatggagcgaaac 37 KpsR2.500-3
ttgagtaaggaatatggcttag 38 KpsR2.GB-L5
TGCTCGATGAGTTTTTCTAAGAAATCAGACGAGTTTTC 39 KpsR2.GB-L3
gattttgagacacaacgtggctttcataacatACTATGTCCCCATGATTATT 40 KpsR2.ext-5
catgtactcattttcacgtaaag 41 KpsR2.ext-3 tgctaaaattgcattattaggtc 42
Kps KpsM.500-5 TTACTACGCATAAAATTCATGG 43 KpsR3.500-3
AATTAACCATATCTTTTGATTTGAG 44 KpsR3.GB-L5
TGCTCGATGAGTTTTTCTAAatcagacttgtctttatcag 45 KpsM.GB.L-3
gattttgagacacaacgtggctttcttgccatTTGGTGATGTGATCCT 46 KpsM.ext-5
TCGCATGCGTTCTGGTTTGAG 47 KpsR3.ext-3 cctagcaacaaaatatttagcgac 48
Kp95- Kps95-96.500- aaacaatatcatggccagtcgg 49 Kps95-96.500-
aataacgttcaggtattgaagg 50 Kps95-96.GB-
TGCTCGATGAGTTTTTCTAAccttgaGGTCTATATAACTGAA 51 Kps95-96.GB-
gattttgagacacaacgtggctttcatcaaatgtaccaaaggtgataac 52 Kps95-96.ext-
taaatcaacgttactgagaatg 53 Kps95-96.ext- gaatatccgagtgcataatacc 54
Kps95-96.500- aaacaatatcatggccagtcgg 55 C3694 c3694.500-5
aagcattagaattggaaccc 56 c3694.500-3 ctttccatgtattcctctccaag 57
c3694.GB.L-5 TGCTCGATGAGTTTTTCTAAgtgcaagtatttcttgtaaccc 58
c3694.GB.L-3 GATTTTGAGACACAACGTGGCTTTCATatacgcatcaatagccttagccc 59
c3694.ext-5 gcggagagctattttaaagcagg 60 c3694.ext-3
cggaaaacgatatgacaatcctg 61 C3693 c3693.500-5
gtttattgttgcaggcatccaag 62 c3693.500-3 atgccgttagatagttttattcc 63
c3693.GB.L-5 TGCTCGATGAGTTTTTCTAAatggatgctcaaaaggaggtacg 64
c3693.GB.L-3 GATTTTGAGACACAACGTGGCTTTCATcagcattggttggtaatgcatttg 65
c3693.ext-5 acatattaacagtaatataacc 66 c3693.ext-3
ctacaaatttggatactgcaaatc 67 C3692 c3692.500-5
ttatacttgcggtgatttgcag 68 c3692.500-3 ATGACTCATAAAAATATATTCC 69
c3692.GB.L-5 TGCTCGATGAGTTTTTCTAAtatttacagaataattattctgg 70
c3692.GB.L-3 GATTTTGAGACACAAGGTGGCTTTCATtaagccaatagtcttgactcatcg 71
c3692.ext-5 aattcatatgattgtagcaatg 72 c3692.ext-3
CAACGTAGAATAAAAGCATTACC 73 luxS LuxS.500-5 AAACTGCGCAGTTCCCGTTACC
74 LuxS.500-3 CCTGATTTTGTTCCCTGGGAGG 75 LuxS.GB-L5
TGCTCGATGAGTTTTTCTAATCAGTGGAACAAAAGAAG 76 LuxS.GB-L3
gattttgagacacaacgtggctttcatTTAGCCACCTCCGGTAATTT 77 LuxS.ext-5
CTGGAACCGGGTGATCCTCGAAG 78 LuxS.ext-3 AGCAACAATGCTGGGGAAAAATGC 79
Primers used for Kps95-F aacgaaaattgcttgctctggc 80 Kps94-R
cggtgccaagtttgaaataacg 81 Kps94-F gaaaatagtgtagacggtctcttc 82
Kps92-R tttggatactgcaaatcaccgc 83 KpsI1f GCGCATTTGCTGATACTGTTG 84
KpsK2r AGGTAGTTCAGACTCACACCT 85 Primers used to check KmGB.verif-5
TGGCTCCCTCACTTTCTGGC 86 KmGB.verif-3 ATATGGCTCATAACACCCCTTG 87
Primers used for ARB1 ggCCACgCgTCgACTAgTACNNNNNNNNNNgATAT 88 ARB6
ggCCACgCgTCgACTAgTACNNNNNNNNNNACgCC 89 ARB2 ggCCACgCgTCgACTAgTAC 90
IR2 CTgACCgCTTCCTCgTgCTTTACgg 91 IR2-60-5 TTCTGAgcgggactctggggtacg
92
[0070] Analysis of the Physico-Chemical Properties of the Active
Fractions
[0071] Zeta potential was measured as in (Caruso et al., 1999)
after 20 minutes of incubation of 10 .mu.m in diameter cationic
colloids latex particles with dialyzed precipitated supernatants
(i.e., the level (ii) of purification indicated above). The latex
particles bear permanent net positive charge due to their
polyethylenimine (PEI) coating. The layer of PEI is a branched 6400
dalton molecular weight polymer bearing approximately 50% of
methylated quaternary functions which confer a stable positive
charge to the molecule. This polymer was deposited in aqueous phase
on the initially carboxylated particles (Decher, 1997). Hydrophilic
properties of the supernatants were investigated by determining the
contact angle formed by a 2.5 .mu.l ultrapure water droplet with a
glass plane surface previously incubated in the supernatants for 20
minutes. Surface interactions were analyzed by monitoring the
adsorption of propidium iodide on supernatant-treated cationic
colloids. The affinity of the treated surfaces for the fluorescent
probe was tested using flow cytometry (Leboeuf and Henry, 2006) and
fluorescence microscopy. All incubations of particles with
supernatant were performed at low particle/volume fraction (ca.
0.2%) likely leading to surface saturation by the active
species.
[0072] In Vivo Mice Experiments
[0073] CFT073 and CFT073.DELTA.R1 in vivo colonization were
performed as described previously (Maroncle et al., 2006). Mice
were intragastrically fed with 1010 CFU. Bacteria contained in
fecal samples were numbered on agar plates. For examination of
bacterial growth in the host, mice were sacrificed at various times
after inoculation; colon and caecum were homogenized in
physiological water, and plated to determine cfu per gram of
tissue.
Example 2
Anti-Biofilm Activity of CFT073 Supernatant
[0074] In order to study UPEC interactions within multicellular
biofilm (Hall-Stoodley et al., 2004) bacterial communities, an in
vitro mixed bacterial biofilm model in microfermentors was
developed (Ghigo, 2001). Using this model, a 8 hours biofilm formed
by the commensal strain of E. coli K12 MG1655 F' was inoculated
with different titers of the UPEC strain CFT073, and further
cultivated for 24 hours. Upon increasing titers of CFT073, a strong
reduction of the E. coli K12 MG1655 F' biofilm development was
observed, which was not observed when the commensal E. coli strain
KS272 was used (FIG. 1A). This suggested that CFT073 could prevent
MG1655 F' biofilm formation either by direct contact or by
secretion of an inhibitory molecule. To distinguish between these
two possibilities, the supernatant of CFT073 stationary phase
culture was filter-sterilized and its effect on E. coli biofilm
formation was tested. In the presence of CFT073 supernatant, MG1655
F' biofilm was severely affected (FIGS. 1B,C). This biofilm
inhibition did not result from a growth defect due to a
bactericidal or bacteriostatic activity, since MG1655 F' growth
rate and cell viability were not affected by the CFT073 supernatant
(FIG. 1D,E).
[0075] In order to determine the spectrum of the anti-biofilm
activity of CFT073 supernatant, its effect was tested on several
adherent bacteria (E. coli, Klebsiella pneumoniae, Pseudomonas
aeruginosa, Staphylococcus aureus, S. epidermidis and Enterococcus
faecalis). This analysis showed that CFT073 supernatant was active
against a surprisingly wide range of bacteria, even in mixed
cultures (FIG. 1F and FIG. 2).
Example 3
Correlation between Anti-Biofilm Activity and Type-II Capsule
[0076] To elucidate the genetic basis of the anti-biofilm effect,
the supernatant activity of ca. 10,000 CFT073 random mariner
transposon insertion mutants was tested. The inventors identified
seven candidates impaired in their ability to inhibit MG1655 F'
biofilm formation. All these mutants mapped in genes involved in
the expression of the group II capsular polysaccharide, the
outermost bacterial cell surface structure (Whitfield and Roberts,
1999). Group II capsule displays a conserved modular genetic
organization characterized by 3 functional regions (Roberts, 1996)
(FIG. 3A). Region 1 (kpsFEDCUS) and region 3 (kpsMT) are conserved
in all group II capsulated bacteria and encode proteins required
for the ABC-dependent polysaccharide export. Region 2 is variable
and encodes polysaccharide serotypes such as K1, K2 (CFT073), K5,
K96 (Roberts, 1996). The R1, R2 or R3 region, or each individual
kps gene was deleted and it was observed that, except for kpsU,
c3692 and c3693, all the mutants lost the ability to inhibit E.
coli biofilm formation, which correlated with a reduced amount of
precipitated sugars in the supernatant (FIGS. 3B, 3C). While a
ferritin-stained capsule could still be detected around CFT073
cells (FIG. 3D), these results indicated that the CFT073 capsule
nevertheless undergoes a significant release into the medium
supernatant that is responsible for the observed anti-biofilm
effect.
[0077] In order to determine whether biofilm inhibition was an
exclusive property of E. coli CFT073 supernatant, the inventors
screened several clinical uropathogenic bacterial isolates of
Klebsiella, Proteus, Enterobacter, Morganella, Citrobacter and
Serratia, as well as a collection of 110 E. coli strains of diverse
origins. They found that only the filtered supernatant of 40 E.
coli, including 17 UPEC, inhibited biofilm formation on a wide
range of bacteria without affecting growth rate (FIG. 4A).
Moreover, as CFT073 E. coli strain, all active strains are able to
inhibit biofilm formation of adherent bacteria other than E. coli
(in FIG. 4A see 15981 S. aureus biofilm data). Using specific PCR
probes (Johnson and O'Bryan, 2004), they showed that 39 of the 40
active E. coli strains carried group II capsule genes. The
40.sup.th bacterium, EcoR47, seems in fact to produce a hybrid
group II/group III capsule. This strain has been shown to carry
group II KPS genes (Boyd and Hartl, 1998). Consistently, the
introduction of a kpsD mutation into the clinical UPEC isolates U-9
and U-15 abolished the biofilm-inhibitory effect of their
supernatants (FIG. 4B). Interestingly, although CFT073, U-9 and
U-15 strains displayed a very limited ability to form biofilm in
the microfermentor biofilm model, their respective kpsD mutants
displayed an increased biofilm phenotype. This phenotype could be
reverted upon the addition of CFT073 supernatant, suggesting that
these strains could also self-inhibit their own adhesion (FIG.
4C).
[0078] A biofilm formation inhibition test was also performed with
a strain of Neisseria meningitidis, the capsule of which is
biochemically very similar to the group II capsule of E. coli.
Interestingly, the results show that the supernatant of N.
meningitidis also inhibits the biofilm formation of E. coli
MG1655F' (FIG. 5), demonstrating that anti-biofilm activity is a
property not only of the group II capsule from E. coli but also of
capsules known to be similar to the latter (i.e., group II-like
capsules).
Example 4
Physico-Chemical Properties of the CFT073 Supernatant
[0079] When the inventors analyzed the composition of the
polysaccharidic fractions precipitated from the active supernatants
of different group II capsule E. coli serotypes, including CFT073
(K2), U-9 (non-K2) and IHE3034 (K1), they observed, in agreement
with previous studies (Jann et al., 1980; Silver and Vimr, 1984),
that these fractions displayed significantly different compositions
(data not shown). This suggested that, although biochemically
distinct, group II capsules released by these strains could share a
similar mode of action leading to biofilm inhibition. To further
study the mechanisms by which group II capsule inhibit bacterial
biofilm formation, these fractions were brought into contact with
cationic colloids composed of 10 .mu.m in diameter latex particles
bearing permanent net positive charge due to their polyethylenimine
coating. The determination of the interface .zeta. (Zeta) potential
showed that the wild-type supernatants induced a strong charge
inversion of the cationic colloids, indicative of their highly
anionic nature as compared to the supernatants of their respective
capsule mutants (FIG. 6a). Moreover, the treatment of acid-cleaned
glass slides with active supernatant lowered the water-slide
interfacial energy, which is indicative of their hydrophilic nature
(FIG. 6b).
[0080] To analyze whether group II capsule could induce surface
modifications and affect intermolecular forces on the treated
surfaces, the inventors monitored the adsorption of propidium
iodide, a fluorescent amphiphillic cationic ion, on colloids coated
with active or inactive supernatants. They first showed that
anionic but inactive supernatant of the non-group II capsulated E.
coli EcoR72 displayed strong affinity for the cationic fluorescent
probe (FIG. 6c). Despite their high negative charge, active
supernatants displayed significantly lower probe affinity than
inactive but less negatively charged capsule mutant supernatants
(FIGS. 6c and 6d). This effect was even more pronounced with the
500 kDa K2 capsular active fraction (FR2) purified from CFT073 by
anion exchange-chromatography containing galactose, glycerol,
phosphate and acetate in the molar ratio of 1:2:1:1 (Jann et al.,
1980) (FIGS. 6c and 6d). Therefore, these results showed that,
besides strong electrostatic modifications, active supernatants
also induced a profound remodelling of the colloid surface
properties, possibly including surface hydration and steric
repulsion. These analyses confirm that the surface modifications
induced by group II capsule are more critical for the biofilm
inhibition activity than the capsule primary composition.
Example 5
Prevention of Biofilm Development
[0081] The physico-chemical properties displayed by group II
capsule might deeply alter bacterial ability to interact with
surfaces and therefore drastically reduce adhesion (Neu, 1996). To
test this hypothesis, the capacity of both MG1655 F' and S. aureus
to adhere to glass surfaces pre-treated with CFT073 supernatant was
analysed. After 1 hour of incubation, E. coli MG1655 F' and S.
aureus 15981 exhibited a 3-fold reduction in their initial adhesion
on treated surface (data not shown). Consistently, pre-treatment of
the internal microfermentor glass slide with CFT073 supernatant
drastically reduced biofilm formation by E. coli and a wide range
of Gram-positive and Gram-negative bacteria (FIG. 7). The same
effect was observed when CFT073 supernatant was perfused in the
microfermentor (FIG. 2B). No effect was observed when a similar
treatment was performed with CFT073.DELTA.kpsD supernatant (FIG.
7). These results therefore suggested that the surface
modifications induced by capsular polysaccharides released in the
CFT073 supernatant could interfere with biofilm formation by
impairing initial bacterial-surface interactions.
[0082] Remarkably, the anti-biofilm effect of the CFT073
supernatant persisted even after drastic treatments of the glass
slide (FIG. 8), which suggests that the group II capsule could be
used in applications which necessitate a sterilisation step (such
as agro-industrial or medical applications).
[0083] In order to investigate the effect of CFT073 supernatant on
already existing biofilms, microfermentors inoculated with MG1655
F' at different stages of biofilm maturation were supplemented with
filtered CFT073 supernatant. This analysis showed that, whereas the
treatment of a mature 24 h biofilm did not induce biofilm
dispersal, addition of the CFT073 supernatant at 0, 1 and 6 h after
MG1655 F' biofilm initiation blocked its further development (FIG.
9A). The inventors then examined the in vitro biofilm
characteristics of a GFP-tagged MG1655F' after addition of CFT073
supernatant and confocal laser scanning microscopy (CLSM). After 3
h post initial inoculation, the addition of active CFT073 exogenous
supernatant on a regularly covered surface profoundly affected
MG1655F' mature biofilm structure development (FIG. 9B). This
effect was not observed upon control KS272 supernatant
treatment.
[0084] The direct contribution of bacterial surface structures to
the tri-dimensional E. coli biofilm structure has been amply
demonstrated (Beloin et al., 2005). These structures have also been
shown to mediate bacterial aggregation and clumping in standing
cultures. To further characterize the role of group II capsule in
biofilm maturation, the inventors tested its effects on bacterial
aggregation mediated by several different surface-exposed factors
also involved in biofilm formation. It was shown that CFT073
supernatant prevents formation of bacterial aggregates induced by
different types of bacterial surface structures (FIG. 9C).
[0085] The anti-biofilm activity of different concentrations of the
FR2 fraction was tested in microtiter plate assays. This showed
that the purified FR2 fraction is active at concentrations starting
from 50 .mu.g/ml (FIG. 10).
[0086] Taken together, these results suggest that the
physico-chemical properties of the group II capsular
polysaccharides affect biofilm formation by weakening cell-surface
contacts (initial adhesion) but also by reducing cell-cell
interactions (biofilm maturation).
[0087] In conclusion, the inventors demonstrated that group II-like
capsular polysaccharides are released in the culture supernatant
and display anti-adhesion properties against a wide range of
bacteria, including important nosocomial pathogens. This study
reveals a novel property of the group II capsular polysaccharides
that are commonly expressed by extra-intestinal E. coli, but also
by other pathogens such as Neisseria meningitides (Kaijser, 1973;
Sandberg et al., 1988), which supernatant could also inhibit E.
coli biofilm formation (data not shown). Group II capsule has been
shown to be involved in UPEC virulence by increasing their
resistance to phagocytosis and to the bactericidal effects of human
serum (Cross et al., 1986; Kaper et al., 2004; Pluschke et al.,
1983; Russo et al., 1995). Capsule could also play an important
biological role in UPEC interactions with living and inert
surfaces. In particular, besides bacterial competition, the
inhibition of UPEC own adhesion by group II capsule secretion may
contribute to gastrointestinal tract colonisation by reducing
bacteria-bacteria interactions (Schembri et al., 2004), thus
avoiding bacterial clearance due to clump formation (Favre-Bonte et
al., 1999). Consistently, it was observed that an uncapsulated
CFT073.DELTA.R1 mutant is unable to colonize the mouse intestine
(FIG. 11).
[0088] The in vitro analyses indicate that group II capsule can
induce surface modifications such as charge inversion of cationic
surface, increased surface wettability and molecular repulsion,
leading to non-specific anti-adhesion properties. Since this
inhibitory effect was observed in both exponential and stationary
growth phase supernatants as well as in a quorum-sensing
.DELTA.luxS mutant of CFT073 (FIG. 12), this suggests that the
anti-biofilm effect does not involve cell-signaling (Waters and
Bassler, 2005), but rather acts through physico-chemical
alteration, of either abiotic or bacterial surfaces. Polymers
assembling on surfaces are known to cause strong physical repulsion
depending on their density, size, solvation and structure (de
Gennes, 1987). Such repulsive forces created by capsule polymers
could limit initial bacterial adhesion and biofilm development by
interfering with subsequent cell-cell contacts. Finally, the
inventors showed that the application of group II capsular
polysaccharides on abiotic surfaces reduces bacterial initial
adhesion, and has enough long-lasting effect to significantly
inhibit mature biofilm development of a broad-spectrum of bacteria.
This finding may have far reaching implications in the design of
therapeutic strategies to limit the formation of pathogenic
biofilms, for example, on medical implants.
REFERENCES
[0089] Bahrani-Mougeot, F. K., Buckles, E. L., Lockatell, C. V.,
Hebel, J. R., Johnson, D. E., Tang, C. M., and Donnenberg, M. S.
(2002). Type 1 fimbriae and extracellular polysaccharides are
preeminent uropathogenic Escherichia coli virulence determinants in
the murine urinary tract. Mol Microbiol 45, 1079-1093. [0090]
Beloin, C., Da Re, S. & Ghigo, J. M. (2005) in Escherichia coli
and Salmonella. Cellular and Molecular Biology, eds. Curtiss III,
R., Bock, A., Ingraham, J. L., Kaper, J. B., Neidhardt, F. C.,
Riley, M. & Squires, C. L. (ASM Press, Washington, D.C.), pp.
Chapter 8.3.1.3. [0091] Beloin, C., Michaelis, K., Lindner, K.,
Landini, P., Hacker, J., Ghigo, J. M., and Dobrindt, U. (2006). The
Transcriptional Antiterminator RfaH Represses Biofilm Formation in
Escherichia coli. J Bacteriol 188, 1316-1331. [0092] Boyd, E. F.,
and Hartl, D. L. (1998). Chromosomal regions specific to pathogenic
isolates of Escherichia coli have a phylogenetically clustered
distribution. J Bacteriol 180, 1159-1165. [0093] Caruso, F.,
Lichtenfeld, H., Donath, E., and Mohwald, H. (1999). Investigation
of electrostatic interactions in polyelectrolyte multilayer films:
binding of anionic fluorescent probes to layers assembled onto
colloids. Macromolecules 32, 2317-2328. [0094] Christensen, B. B.,
Sternberg, C., Andersen, J. B., Palmer, R. J., Jr., Nielsen, A. T.,
Givskov, M., and Molin, S. (1999). Molecular tools for study of
biofilm physiology. Methods Enzymol 310, 20-42. [0095] Cross, A.
S., Kim, K. S., Wright, D.C., Sadoff, J. C., and Gemski, P. (1986).
Role of lipopolysaccharide and capsule in the serum resistance of
bacteremic strains of Escherichia coli. J Infect Dis 154, 497-503.
[0096] Cucarella, C., Solano, C., Valle, J., Amorena, B., Lasa, I.
I., and Penades, J. R. (2001). Bap, a Staphylococcus aureus Surface
Protein Involved in Biofilm Formation. J Bacteriol 183, 2888-2896.
[0097] Da Re, S., and Ghigo, J. M. (2006). A CsgD-independent
pathway for cellulose production and biofilm formation in
Escherichia coli. J Bacteriol 188, in press. [0098] de Gennes, P.
G. (1987). Polymers at an interface: a simplified view. Adv Colloid
Interface Sci 27, 189-209. [0099] Decher, G. (1997). Fuzzy
Nanoassemblies: Toward Layered Polymeric Multicomposites. Science
277, 1232-1237. [0100] Deghmane, A. E., Giorgini, D., Larribe, M.,
Alonso, J. M., and Taha, M. K. (2002). Down-regulation of pili and
capsule of Neisseria meningitidis upon contact with epithelial
cells is mediated by CrgA regulatory protein. Mol Microbiol 43,
1555-1564. [0101] d'Enfert, C., and Fontaine, T. (1997). Molecular
characterization of the Aspergillus nidulans treA gene encoding an
acid trehalase required for growth on trehalose. Mol Microbiol 24,
203-216. [0102] Dubois, M., Gilles, K. A., Hamilton, J. K., Rebers,
P. A., and Smith, F. (1956). Colorimetric method for determination
of sugars and related substances. Anal Chem 28, 350-356. [0103]
Favre-Bonte, S., Licht, T. R., Forestier, C., and Krogfelt, K. A.
(1999). Klebsiella pneumoniae capsule expression is necessary for
colonization of large intestines of streptomycin-treated mice.
Infect Immun 67, 6152-6156. [0104] Fontaine, T., Simenel, C.,
Dubreucq, G., Adam, O., Delepierre, M., Lemoine, J., Vorgias, C.
E., Diaquin, M., and Latge, J. P. (2000). Molecular organization of
the alkali-insoluble fraction of aspergillus fumigatus cell wall. J
Biol Chem 275, 41528. [0105] Galdbart, J. O., Allignet, J., Tung,
H. S., Ryden, C., and El Solh, N. (2000). Screening for
Staphylococcus epidermidis markers discriminating between
skin-flora strains and those responsible for infections of joint
prostheses. J Infect Dis 182, 351-355. [0106] Ghigo, J. M. (2001).
Natural conjugative plasmids induce bacterial biofilm development.
Nature 412, 442-445. [0107] Hall-Stoodley, L., Costerton, J. W.,
and Stoodley, P. (2004). Bacterial biofilms: from the natural
environment to infectious diseases. Nat Rev Microbiol 2, 95-108.
[0108] Heilmann, C., Gerke, C., Perdreau-Remington, F., and Gotz,
F. (1996). Characterization of Tn917 insertion mutants of
Staphylococcus epidermidis affected in biofilm formation. Infect
Immun 64, 277-282. [0109] Jann, K., Jann, B., Schmidt, M. A., and
Vann, W. F. (1980). Structure of the Escherichia coli K2 capsular
antigen, a teichoic acid-like polymer. J Bacteriol 143, 1108-1115.
[0110] Johnson, J. R., and O'Bryan, T. T. (2004). Detection of the
Escherichia coli group 2 polysaccharide capsule synthesis Gene kpsM
by a rapid and specific PCR-based assay. J Clin Microbiol 42,
1773-1776. [0111] Kaijser, B. (1973). Immunology of Escherichia
coli: K antigen and its relation to urinary-tract infection. J
Infect Dis 127, 670-677. [0112] Kaper, J. B., Nataro, J. P., and
Mobley, H. L. (2004). Pathogenic Escherichia coli. Nat Rev
Microbiol 2, 123-140. [0113] Leboeuf, D., and Henry, N. (2006).
Molecular bond formation between surfaces: anchoring and shearing
effects. Langmuir 22, 127-133. [0114] Maroncle, N., Rich, C., and
Forestier, C. (2006). The role of Klebsiella pneumoniae urease in
intestinal colonization and resistance to gastrointestinal stress.
Res Microbiol 157, 184-193. [0115] Meier, C., Oelschlaeger, T. A.,
Merkert, H., Korhonen, T. K., and Hacker, J. (1996). Ability of
Escherichia coli isolates that cause meningitis in newborns to
invade epithelial and endothelial cells. Infect Immun 64,
2391-2399. [0116] Mobley, H. L., Green, D. M., Trifillis, A. L.,
Johnson, D. E., Chippendale, G. R., Lockatell, C. V., Jones, B. D.,
and Warren, J. W. (1990). Pyelonephritogenic Escherichia coli and
killing of cultured human renal proximal tubular epithelial cells:
role of hemolysin in some strains. Infect Immun 58, 1281-1289.
[0117] Neu, T. R. (1996). Significance of bacterial surface-active
compounds in interaction of bacteria with interfaces. Microbiol.
Rev 60, 151-166. [0118] Ochman, H., and Selander, R. K. (1984).
Standard reference strains of Escherichia coli from natural
populations. J Bacteriol 157, 690-693. [0119] O'Toole, G. A., and
Kolter, R. (1998). Initiation of biofilm formation in Pseudomonas
fluorescens WCS365 proceeds via multiple, convergent signalling
pathways: a genetic analysis. Mol Microbiol 28, 449-461. [0120]
Pluschke, G., Mayden, J., Achtman, M., and Levine, R. P. (1983).
Role of the capsule and the O antigen in resistance of O18:K1
Escherichia coli to complement-mediated killing. Infect Immun 42,
907-913. [0121] Roberts, I. S. (1996). The biochemistry and
genetics of capsular polysaccharide production in bacteria. Annu
Rev Microbiol 50, 285-315. [0122] Russo, T. A., Sharma, G., Weiss,
J., and Brown, C. (1995). The construction and characterization of
colanic acid deficient mutants in an extraintestinal isolate of
Escherichia coli (O4/K54/H5). Microb Pathog 18, 269-278. [0123]
Sandberg, T., Kaijser, B., Lidin-Janson, G., Lincoln, K., Orskov,
F., Orskov, I., Stokland, E., and Svanborg-Eden, C. (1988).
Virulence of Escherichia coli in relation to host factors in women
with symptomatic urinary tract infection. J Clin Microbiol 26,
1471-1476. [0124] Schachter, B. (2003). Slimy business--the
biotechnology of biofilms. Nat Biotechnol 21, 361-365. [0125]
Schembri, M. A., Dalsgaard, D., and Klemm, P. (2004). Capsule
shields the function of short bacterial adhesins. J Bacteriol 186,
1249-1257. [0126] Silver, R. P., and Vimr, E. R. (1984). Polysialic
acid capsule of Escherichia coli K1. In Molecular Basis of
Bacterial Pathogenesis (Academic Press, Inc., New York), pp. 39-60.
[0127] Strauch, K. L., and Beckwith, J. (1988). An Escherichia coli
mutation preventing degradation of abnormal periplasmic proteins.
Proc Natl Acad Sci USA 85, 1576-1580. [0128] Toledo-Arana, A.,
Valle, J., Solano, C., Arrizubieta, M. J., Cucarella, C., Lamata,
M., Amorena, B., Leiva, J., Penades, J. R., and Lasa, I. (2001).
The Enterococcal Surface Protein, Esp, Is Involved in Enterococcus
faecalis Biofilm Formation. Appl Environ Microbiol 67, 4538-4545.
[0129] Valle, J., Toledo-Arana, A., Berasain, C., Ghigo, J. M.,
Amorena, B., Penades, J. R., and Lasa, I. (2003). SarA and not
sigmaB is essential for biofilm development by Staphylococcus
aureus. Mol Microbiol 48, 1075-1087. [0130] Vasseur, P.,
Vallet-Gely, I., Soscia, C., Genin, S., and Filloux, A. (2005). The
pel genes of the Pseudomonas aeruginosa PAK strain are involved at
early and late stages of biofilm formation. Microbiology 151,
985-997. [0131] Vidal, O., Longin, R., Prigent-Combaret, C., Dorel,
C., Hooreman, M., and Lejeune, P. (1998). Isolation of an
Escherichia coli K-12 mutant strain able to form biofilms on inert
surfaces: involvement of a new omnpR allele that increases curli
expression. J Bacteriol 180, 2442-2449. [0132] Waters, C. M., and
Bassler, B. L. (2005). Quorum sensing: cell-to-cell communication
in bacteria. Annu Rev Cell Dev Biol 21, 319-346. [0133] Whitfield,
C. (2006). Biosynthesis and assembly of capsular polysaceharides in
Escherichia coli. Annu Rev Biochem 75, 39-68. [0134] Whitfield, C.,
and Roberts, I. S. (1999). Structure, assembly and regulation of
expression of capsules in Escherichia coli. Mol Microbiol 31,
1307-1319.
* * * * *
References