U.S. patent application number 11/916025 was filed with the patent office on 2009-12-24 for analysis using microfluidic partitioning devices.
Invention is credited to Antoine Daridon, Christian A. Heid.
Application Number | 20090317798 11/916025 |
Document ID | / |
Family ID | 37943262 |
Filed Date | 2009-12-24 |
United States Patent
Application |
20090317798 |
Kind Code |
A1 |
Heid; Christian A. ; et
al. |
December 24, 2009 |
ANALYSIS USING MICROFLUIDIC PARTITIONING DEVICES
Abstract
The invention relates to methods, reagents and devices for
detection and characterization of nucleic acids, cells, and other
biological samples. Assay method are provided in which a sample is
partitioned into sub-samples, and analysis of the contents of the
sub-samples carried out. The invention also provides microfluidic
devices for conducting the assay. The invention also provides an
analysis method using a universal primers and probes for
amplification and detection.
Inventors: |
Heid; Christian A.; (Redwood
City, CA) ; Daridon; Antoine; (Mont-sur-Rolle,
CH) |
Correspondence
Address: |
TOWNSEND AND TOWNSEND AND CREW, LLP
TWO EMBARCADERO CENTER, EIGHTH FLOOR
SAN FRANCISCO
CA
94111-3834
US
|
Family ID: |
37943262 |
Appl. No.: |
11/916025 |
Filed: |
June 2, 2006 |
PCT Filed: |
June 2, 2006 |
PCT NO: |
PCT/US06/21416 |
371 Date: |
December 10, 2008 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60687010 |
Jun 2, 2005 |
|
|
|
Current U.S.
Class: |
435/6.12 |
Current CPC
Class: |
B01L 2300/0864 20130101;
C12Q 1/686 20130101; B01L 2300/0867 20130101; B01L 3/5027 20130101;
C12Q 1/686 20130101; B01L 2400/0487 20130101; B01L 2300/0874
20130101; B01L 2400/0655 20130101; B01L 7/52 20130101; C12Q
2525/301 20130101; C12Q 2525/155 20130101 |
Class at
Publication: |
435/6 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68 |
Claims
1. An assay method comprising: (a) partitioning a sample obtained
from the blood of a pregnant woman into a plurality of sub-samples,
wherein said sample comprises a plurality of nucleic acid
molecules, and wherein most of said sub-samples comprise either (i)
0 or 1 target nucleic acid sequences or (ii) 0 or 1 cells; (b)
providing sufficient reagents in each sub-sample to amplify at
least two different target sequences; (c) amplifying target
sequence(s) in the two sub-sample(s) thereby producing amplicon(s)
in the sub-sample(s); (d) querying the sub-samples for the presence
of an amplicon, or a property of an amplicon, to obtain an
indication of fetal disease or propensity to disease.
2-17. (canceled)
18. The method of claim 1, wherein nucleic acid molecules in the
sample are free in solution.
19. The method of claim 1, wherein the sample comprises fetal
cells.
20. The method of claim 1, wherein the indication of fetal disease
or propensity to disease comprises a genetic defect selected from
the group consisting of a substitution, an amplification, a
deletion, and a translocation.
21. The method of claim 1, wherein the sub-samples are queried for
a polymorphism.
22. The method of claim 21, wherein the polymorphism comprises a
single nucleotide polymorphism (SNP).
23. The method of claim 1, wherein the sub-samples are queried to
quantify a target sequence.
24. The method of claim 1, wherein the sub-samples are queried with
a fetal-specific probe.
25. The method of claim 1, wherein the sample is partitioned into
at least 10.sup.4 sub-samples.
26. The method of claim 25, wherein each sub-sample has a volume of
less than one nanoliter.
27. The method of claim 1, wherein said nucleic acid molecules
comprise DNA.
28. The method of claim 27, wherein said DNA comprises cDNA made
from RNA.
29. The method of claim 1, wherein sufficient reagents are provide
to amplify at least 10 target sequences, if present.
30. The method of claim 1, wherein said amplification is by PCR or
RT-PCR.
31. The method of claim 1, wherein the sample comprises a plurality
of cells comprising nucleic acid molecules, and wherein
partitioning the sample comprises partitioning intact cells into a
plurality of sub-samples.
32. The method of claim 1, wherein at least 99% of the sub-samples
comprise either (i) 0 or 1 target nucleic acid sequences or (ii) 0
or 1 cells.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims benefit of U.S. provisional
application No. 60/687,010, filed Jun. 2, 2005, the entire contents
of which are herein incorporated by reference.
FIELD OF THE INVENTION
[0002] The invention relates to methods, reagents and devices for
detecting and characterizing nucleic acids, cells, and other
biological samples.
BACKGROUND
[0003] A variety of nucleic acid amplification assays and
immunological assays are used for analysis of cells and nucleic
acids. These assays can be used to detect or characterize nucleic
acid sequences associated with particular diseases or genetic
disorders, for genotyping, for gene expression analyses, to detect
and identify pathogens such as viruses, bacteria and fungi), for
paternity and forensic identification, and for many other purposes.
However, in some applications the efficiency and sensitivity of
these assays is reduced, which may render the assays useless or at
minimum require that additional manipulations and/or significant
amounts of expensive reagents be used. For example, when a cell or
molecule to be analyzed is from a sample with a large excess of
non-target cells or molecules (e.g., as in genetic or phenotypic
analysis of a rare cell in a background of other cells)
conventional assay methods are inadequate. Similarly, when a number
of different targets must be detected in a single sample,
conventional approaches (e.g., multiplex PCR) are expensive,
inefficient or not sufficiently sensitive. Thus, new methods,
reagents and devices for detection and characterization of nucleic
acids, cells, and other biological molecules will find broad
application in biomedicine and other fields.
BRIEF SUMMARY
[0004] The invention relates to methods, reagents and devices for
detection and characterization of nucleic acids, cells, and other
biological samples. In one aspect, the invention provides an assay
method including the following steps (a) partitioning a sample into
a plurality of sub-samples, where said sample comprises a plurality
of nucleic acid molecules, and where at least two sub-samples
comprise at least one nucleic acid molecule; (b) providing
sufficient reagents in each sub-sample to amplify a target sequence
or sequences; (c) amplifying the target sequence(s) in the
sub-sample(s) containing target sequence(s) thereby producing
amplicons in the sub-sample; (d) distributing the amplicons into a
plurality of aliquots; and, (e) for each aliquot, determining a
property of amplicons in the aliquot.
[0005] In a related aspect, the invention provides an assay method
including the following steps (a) partitioning a sample into a
plurality of sub-samples, where said sample comprises a plurality
of nucleic acid molecules, and where at least two sub-samples
comprise at least one nucleic acid molecule; (b) providing
sufficient reagents in each sub-sample to amplify at least two
different target sequences; (c) amplifying target sequence(s) in at
least two sub-sample(s) thereby producing amplicons in the
sub-sample(s); (d) combining the amplicons from said at least two
sub-samples to create an amplicon pool; (d) dividing the amplicon
pool into a plurality of aliquots; and, (e) for each aliquot,
determining a property of amplicons in the aliquot. In one
embodiment, the sample is partitioned into at least 10.sup.4
sub-samples. In one embodiment, each subsample has a volume of less
than one nanoliter. In one embodiment, the nucleic acid molecules
comprise DNA and/or mRNA. In one embodiment, the amplification is
by PCR or RT-PCR. In one embodiment, sufficient reagents are
provided to amplify at least 10, 20, or 50 different target
sequences, if present. In one embodiment, the amplicon pool is
divided into at least 10, 20, 50 or 100 aliquiots. In one
embodiment, the sample contains a plurality of cells having nucleic
acid molecules, and partitioning the sample involves partitioning
intact cells into a plurality of sub-samples. In one embodiment,
the sample contains only one cell.
[0006] In another aspect, the invention provides an assay method
including the following steps (a) partitioning a sample comprising
a plurality of separable cells into at least 1000 separate reaction
chambers in a massively partitioning device (MPD), where after
partitioning at least two reaction chambers each comprise exactly
one cell; (b) providing in each reaction chamber one or more
reagents for determining a property or properties of a cell, where
the same reagents are provided in each chamber; and (c) determining
at least two different properties of a single cell in a chamber
and/or determining at least one property for at least two different
cells in different chambers. In one embodiment, at least 99% of the
reaction chambers contain zero or one cell. In one embodiment, the
cells are bacterial cells. In one embodiment, the reagents include
reagents for nucleic acid amplification. In one embodiment, at
least one property is the presence or absence in the cell of a
nucleic acid having a specified sequence. In one embodiment, at
least one property is other than the presence or absence in the
cell of a nucleic acid having a specified sequence.
[0007] In another aspect, the invention provides a method for
amplification and detection of multiple target DNA sequences in a
sample, including the following steps: (a) providing a sample
containing (i) multiple target DNA sequences, (ii) a primer pair
corresponding to each of said multiple target DNA sequences, each
pair consisting of a first primer comprising U.sub.1, B.sub.1 and F
domains in the order 5'-U.sub.1-B.sub.1-F-3' and a second primer
comprising U.sub.2 and R domains in the order 5'-U.sub.2-R-3',
where each pair of F and R primers is capable of annealing
specifically to a different target DNA sequence under stringent
annealing conditions; (iii) a universal primer pair capable of
amplifying a double stranded DNA molecule with the structure [0008]
5'-U.sub.1-U.sub.2'-3' [0009] 3'-U.sub.1-U.sub.2-3' where U.sub.1'
is the sequence complementary to U.sub.1 and U.sub.2' is the
sequence complementary to U.sub.2; (b) subjecting the sample to
multiple cycles of melting, reannealing, and DNA synthesis thereby
producing amplicons for each of said multiple target DNA sequences,
and (c) detecting the amplicons using a probe that anneals to
sequence of the amplicon having the sequence of the B.sub.1 domain
or its complement. In one embodiment, the sample also contains a
second set of multiple target sequences, a primer pair
corresponding to to each of the target sequences in the second set,
each pair consisting of a first primer comprising U.sub.1, B.sub.2
and F domains in the order 5'-U.sub.1-B.sub.2-F-3' and a second
primer comprising U.sub.2 and R domains in the order
5'-U.sub.2-R-3', where each pair of F and R oligonucleotides is
capable of annealing specifically to a different target DNA
sequence in the second set of multiple target sequences under
stringent annealing conditions; and where amplicons for each of the
multiple target DNA sequences of the second set are produced; and
detecting the amplicons for each of the multiple target DNA
sequences using a probe that anneals to sequence of the amplicon
having the sequence of the B.sub.2 domain or its complement. In one
embodiment, U.sub.1, B.sub.1, F.sub.1, U.sub.2 and R.sub.1 domains
are between 6 and 30 nucleotides in length. In one embodiment the
probe is a molecular beacon. In one embodiment, the probe is a a
Taqman.TM.-type probe.
[0010] In another aspect, the invention provides a microfluidic
device, having (a) a first region comprising (i) a flow channel
formed within an elastomeric material and having a first end and a
second end in fluid communication with each other through said
channel, where said channel may be branched or unbranched; (ii) an
inlet for introducing a sample fluid in communication with said
channel, said inlet; (iii) an outlet in communication with said
flow channel; (iv) a plurality of control channels overlaying the
flow channel(s), where an elastomeric membrane separates the
control channels from the flow channels at each intersection, the
elastomeric membrane disposed to be deflected into or withdrawn
from the flow channel in response to an actuation force, and where,
when the control channels are actuated the flow channel is
partitioned into at least 1000 reaction chambers not in fluidic
communication with each other; (b) a second region compromising a
channel or chamber interposed between and in communication with
said outlet in (a) and a flow channel in the third region; (c) a
third region comprising a plurality of flow channels (e.g., blind
flow channels), in fluidic communication with the channel or
chamber of the second region, with a region of each flow channel
defining a reaction site; (d) a control channel or channels that
when actuated separates the first and second regions; (e) a control
channel or channels that when actuated separates the second and
third regions; and (f) a control channel or channels that when
actuated separates the reaction sites of said flow channels from
the other portions of control channels.
BRIEF DESCRIPTION OF THE FIGURES
[0011] FIGS. 1A and 1B show an exemplary design of a massively
partitioning device (MPD) in valve off (FIG. 1A) and valve actuated
(FIG. 1B) states.
[0012] FIG. 2 shows an exemplary design of a MPD with two banks: a
first bank in which nucleic acids are partitioned and amplified in
individual chambers, and a second bank in which subsequent analysis
of the amplicon pool occurs.
[0013] FIGS. 3A-C are flow charts illustrating partition and
analysis of nucleic acids using methods of the invention. FIG. 3A
illustrates partition and analysis of nucleic acids in which
multiple target sequences are amplified. FIG. 3B illustrates
partition and analysis acids in which target sequences in only a
single chamber are amplified. FIG. 3C illustrates analysis of
nucleic acids of a single cell.
[0014] FIG. 4 is a flow chart illustrating partition of cells and
analysis of their properties.
[0015] FIG. 5 is an illustration of primers used in the universal
amplification method.
DETAILED DESCRIPTION
Definitions
[0016] The term "elastomer" has the general meaning used in the
art. Thus, for example, Allcock et al. (Contemporary Polymer
Chemistry, 2nd Ed.) describes elastomers in general as polymers
existing at a temperature between their glass transition
temperature and liquefaction temperature. Elastomeric materials
exhibit elastic properties because the polymer chains readily
undergo torsional motion to permit uncoiling of the backbone chains
in response to a force, with the backbone chains recoiling to
assume the prior shape in the absence of the force. In general,
elastomers deform when force is applied, but then return to their
original shape when the force is removed. The elasticity exhibited
by elastomeric materials can be characterized by a Young's modulus.
The elastomeric materials utilized in the microfluidic devices
disclosed herein typically have a Young's modulus of between about
1 Pa-1 TPa, in other instances between about 10 Pa-100 GPa, in
still other instances between about 20 Pa-1 GPa, in yet other
instances between about 50 Pa-10 MPa, and in certain instances
between about 100 Pa-1 MPa. Elastomeric materials having a Young's
modulus outside of these ranges can also be utilized depending upon
the needs of a particular application. Microfluidic devices can be
fabricated from an elastomeric polymer such as GE RTV 615
(formulation), a vinyl-silane crosslinked (type) silicone elastomer
(family). However, elastomeric microfluidic systems are not limited
to this one formulation, type or even this family of polymer;
rather, nearly any elastomeric polymer is suitable. Given the
tremendous diversity of polymer chemistries, precursors, synthetic
methods, reaction conditions, and potential additives, there are a
large number of possible elastomer systems that can be used to make
monolithic elastomeric microvalves and pumps (including, for
example, perfluoropolyethers, polyisoprene, polybutadiene,
polychloroprene, polyisobutylene, poly(styrene-butadiene-styrene),
polyurethanes, and silicones, for example, or
poly(bis(fluoroalkoxy)phosphazene) (PNF, Eypel-F),
poly(carborane-siloxanes) (Dexsil), poly(acrylonitrile-butadiene)
(nitrile rubber), poly(1-butene),
poly(chlorotrifluoroethylene-vinylidene fluoride) copolymers
(Kel-F), poly(ethyl vinyl ether), poly(vinylidene fluoride),
poly(vinylidene fluoride-hexafluoropropylene) copolymer (Viton),
elastomeric compositions of polyvinylchloride (PVC), polysulfone,
polycarbonate, polymethylmethacrylate (PMMA),
polytertrafluoroethylene (Teflon), polydimethylsiloxane,
polydimethylsiloxane copolymer, and aliphatic urethane diacrylate).
The choice of materials typically depends upon the particular
material properties (e.g., solvent resistance, stiffness, gas
permeability, and/or temperature stability) required for the
application being conducted. Additional details regarding the type
of elastomeric materials that can be used in the manufacture of the
components of the microfluidic devices disclosed herein are set
forth in Unger et al. (2000) Science 288:113-116, PCT Publications
WO 02/43615, WO 2005030822, WO 2005084191 and WO 01/01025; and U.S.
patent publication No. 20050072946.
[0017] A "reagent" refers broadly to any agent used in a reaction,
other than the analyte (e.g., cell or nucleic acid being analyzed).
Exemplary reagents for a nucleic acid amplification reaction
include, but are not limited to, buffer, metal ions, polymerase,
reverse transcriptase, primers, template nucleic acid, nucleotides,
labels, dyes, nucleases and the like. Reagents for enzyme reactions
include, for example, substrates, cofactors, buffer, metal ions,
inhibitors and activators. Reagents for cell-based reactions
include, but are not limited to, cells, cell specific dyes and
ligands (e.g., agonists and antagonists) that bind to cellular
receptors.
[0018] The terms "nucleic acid," "polynucleotide," and
"oligonucleotide" include a polymeric form of nucleotides of any
length, including, but not limited to, ribonucleotides or
deoxyribonucleotides. There is no intended distinction in length
between these terms. Further, these terms refer only to the primary
structure of the molecule. Thus, in certain embodiments these terms
can include triple-, double- and single-stranded DNA, as well as
triple-, double- and single-stranded RNA. They also include
modifications, such as by methylation and/or by capping, and
unmodified forms of the polynucleotide. More particularly, the
terms "nucleic acid," "polynucleotide," and "oligonucleotide,"
include polydeoxyribonucleotides (containing 2-deoxy-D-ribose),
polyribonucleotides (containing D-ribose), any other type of
polynucleotide which is an N- or C-glycoside of a purine or
pyrimidine base, and other polymers containing nonnucleotidic
backbones, for example, polyamide (e.g., peptide nucleic acids
(PNAs)) and polymorpholino (commercially available from the
Anti-Virals, Inc., Corvallis, Oreg., as Neugene) polymers, and
other synthetic sequence-specific nucleic acid polymers providing
that the polymers contain nucleobases in a configuration which
allows for base pairing and base stacking, such as is found in DNA
and RNA.
[0019] A "primer" is a single-stranded polynucleotide capable of
acting as a point of initiation of template-directed DNA or RNA
synthesis under appropriate conditions (i.e., in the presence of
four different nucleoside triphosphates and an agent for
polymerization, such as, DNA or RNA polymerase or reverse
transcriptase) in an appropriate buffer and at a suitable
temperature. The appropriate length of a primer depends on the
intended use of the primer but typically is at least 7 nucleotides
long and, more typically range from 10 to 30 nucleotides in length.
Other primers can be somewhat longer such as 30 to 50 nucleotides
long. In this context, primer "length" refers to the portion of an
oligo- or polynucleotide that hyrbidizes to a complementary
"target" sequence and primes synthesis. For example, in the primer
5'-U.sub.1-B.sub.1-F1-3' the length of F.sub.1 might be 20
nucleotides and the combined length of U, B and F1 could be 60
nucleotides or more (typically between 30 and 100 nucleotides).
Short primer molecules generally require cooler temperatures to
form sufficiently stable hybrid complexes with the template. A
primer need not reflect the exact sequence of the template but must
be sufficiently complementary to hybridize with a template. The
term "primer site" or "primer binding site" refers to the segment
of the target DNA to which a primer hybridizes. The term "primer
pair" means a set of primers including a 5' "upstream primer" that
hybridizes with the complement of the 5' end of the DNA sequence to
be amplified and a 3' "downstream primer" that hybridizes with the
3' end of the sequence to be amplified.
[0020] A primer or probe anneals or hybrdizes to a complementary
target sequence. The primer or probe may be exactly complementary
to the target sequence or can be less than perfectly complementary.
Typically the primer has at least 65% identity to the complement of
the target sequence over a region of at least 7 nucleotides, more
typically over a region in the range of 10-30 nucleotides, and
often over a region of at least 14-25 nucleotides, and more often
has at least 75% identity, at least 85% identity or 90% identity.
It will be understood that certain bases (e.g., the 3' base of a
primer) generally should be exactly complementary to corresponding
base of the target sequence. Primer and probes generally anneal to
the target sequence under stringent conditions. Stringent annealing
conditions refers to conditions in a range from about 5.degree. C.
to about 20.degree. C. or 25.degree. C. below the melting
temperature (T.sub.m) of the target sequence and a probe with exact
or nearly exact complementarity to the target. As used herein, the
melting temperature is the temperature at which a population of
double-stranded nucleic acid molecules becomes half-dissociated
into single strands. Methods for calculating the T.sub.m of nucleic
acids are well known in the art (see, e.g., Berger and Kimmel
(1987) METHODS IN ENZYMOLOGY, VOL. 152: GUIDE TO MOLECULAR CLONING
TECHNIQUES, San Diego: Academic Press, Inc. and Sambrook et al.
(1989) MOLECULAR CLONING: A LABORATORY MANUAL, 2ND ED., VOLS. 1-3,
Cold Spring Harbor Laboratory), both incorporated herein by
reference). As indicated by standard references, a simple estimate
of the T.sub.m value may be calculated by the equation:
T.sub.m=81.5+0.41(% G+C), when a nucleic acid is in aqueous
solution at 1 M NaCl (see e.g., Anderson and Young, Quantitative
Filter Hybridization in NUCLEIC ACID HYBRIDIZATION (1985)). The
melting temperature of a hybrid (and thus the conditions for
stringent hybridization) is affected by various factors such as the
length and nature (DNA, RNA, base composition) of the probe and
nature of the target (DNA, RNA, base composition, present in
solution or immobilized, and the like), and the concentration of
salts and other components (e.g., the presence or absence of
formamide, dextran sulfate, polyethylene glycol). The effects of
these factors are well known and are discussed in standard
references in the art
[0021] A "probe" is an nucleic acid capable of binding to a target
nucleic acid of complementary sequence through one or more types of
chemical bonds, usually through complementary base pairing, usually
through hydrogen bond formation, thus forming a duplex structure.
The probe binds or hybridizes to a "probe binding site." The probe
can be labeled with a detectable label to permit facile detection
of the probe, particularly once the probe has hybridized to its
complementary target. The label attached to the probe can include
any of a variety of different labels known in the art that can be
detected by chemical or physical means, for example. Suitable
labels that can be attached to probes include, but are not limited
to, radioisotopes, fluorophores, chromophores, mass labels,
electron dense particles, magnetic particles, spin labels,
molecules that emit chemiluminescence, electrochemically active
molecules, enzymes, cofactors, and enzyme substrates. Probes can
vary significantly in size. Some probes are relatively short.
Generally, probes are at least 7 to 15 nucleotides in length. Other
probes are at least 20, 30 or 40 nucleotides long. Still other
probes are somewhat longer, being at least 50, 60, 70, 80, 90
nucleotides long. Yet other probes are longer still, and are at
least 100, 150, 200 or more nucleotides long. Probes can be of any
specific length that falls within the foregoing ranges as well.
[0022] The term "label" refers to a molecule or an aspect of a
molecule that can be detected by physical, chemical,
electromagnetic and other related analytical techniques. Examples
of detectable labels that can be utilized include, but are not
limited to, radioisotopes, fluorophores, chromophores, mass labels,
electron dense particles, magnetic particles, spin labels,
molecules that emit chemiluminescence, electrochemically active
molecules, enzymes, cofactors, enzymes linked to nucleic acid
probes and enzyme substrates. The term "detectably labeled" means
that an agent has been conjugated with a label or that an agent has
some inherent characteristic (e.g., size, shape or color) that
allows it to be detected without having to be conjugated to a
separate label.
[0023] A "polymorphic marker" or "polymorphic site" is the locus at
which divergence occurs. Preferred markers have at least two
alleles, each occurring at frequency of greater than 1%, and more
preferably greater than 10% or 20% of a selected population. A
polymorphic locus may be as small as one base pair. Polymorphic
markers include restriction fragment length polymorphisms, variable
number of tandem repeats (VNTR's), hypervariable regions,
minisatellites, dinucleotide repeats, trinucleotide repeats,
tetranucleotide repeats, simple sequence repeats, and insertion
elements such as Alu. The first identified allelic form is
arbitrarily designated as the reference form and other allelic
forms are designated as alternative or variant alleles. The allelic
form occurring most frequently in a selected population is
sometimes referred to as the wildtype form. Diploid organisms may
be homozygous or heterozygous for allelic forms. A diallelic
polymorphism has two forms. A triallelic polymorphism has three
forms.
[0024] A "single nucleotide polymorphism" (SNP) occurs at a
polymorphic site occupied by a single nucleotide, which is the site
of variation between allelic sequences. The site is usually
preceded by and followed by highly conserved sequences of the
allele (e.g., sequences that vary in less than 1/100 or 1/1000
members of the populations). A single nucleotide polymorphism
usually arises due to substitution of one nucleotide for another at
the polymorphic site. A transition is the replacement of one purine
by another purine or one pyrimidine by another pyrimidine. A
transversion is the replacement of a purine by a pyrimidine or vice
versa. Single nucleotide polymorphisms can also arise from a
deletion of a nucleotide or an insertion of a nucleotide relative
to a reference allele.
[0025] The term "haplotype" refers to the designation of a set of
polymorphisms or alleles of polymorphic sites within a gene of an
individual.
[0026] A used herein, "plurality" means at least three. In general
a plurality of cells, nucleic acid molecules, etc., will contain at
least 10, at least about 10.sup.2, at least about 10.sup.3, or at
least about 10.sup.4 different cells, molecules, etc.
[0027] A used herein, "entities" refers to a plurality of
structurally similar biological molecules or structures (e.g.,
macromolecules such as nucleic acids, protein, carbohydrates and
lipids; cells or subcellular structures or components; viruses) or
nonbiological particles that are separate and distinct from each
other in the sense that they can be separated into separate
reaction chambers using a MPD. "Entity" refers to a single such
molecule or structure.
[0028] The term "biological sample", refers to a sample obtained
from an organism or from components of an organism, such as cells,
biological tissues and fluids. In some methods, the sample is from
a human patient. Such samples include sputum, blood, blood cells
(e.g., white cells), tissue or fine needle biopsy samples, urine,
peritoneal fluid, and fleural fluid, or cells therefrom.
A. Introduction
[0029] The invention relates generally to analysis of
macromolecules and small particles, and particularly to analysis of
nucleic acids, proteins, and individual cells. In certain aspects,
the invention relates to analysis methods involving massive
partitioning. Massive partitioning of liquid samples, i.e.,
dividing the sample into thousands of isolated reaction volumes,
has been made possible by the development of specially designed
elastomeric microfluidic devices. These devices can be referred to
as "massively partitioning devices" or MPDs and are sometimes
referred to as "chips" or Digital Isolation and Detection
Integrated Fluidic Circuits (DID IFCs). Exemplary devices are
described in McBride et al. (PCT publication WO 2004/089810,
published on Oct. 21, 2004; copending, commonly assigned U.S.
patent application Ser. No. 10/819,088 published as patent
publication No. 20050019792 on Jan. 27, 2005; and copending,
commonly assigned U.S. patent application Ser. No. 10/819,088
published as patent publication No. 20050252773 on Nov. 17, 2005,
each of which is incorporated by reference in its entirety for all
purposes and the specific purposes describe therein and herein;
hereinafter referred to together as "McBride et al. "). Using MPDs,
a sample can be partitioned into a multitude of isolated reaction
chambers, and reactions carried out simultaneously in each chamber.
For example, McBride et al., supra, describes the performance of
21,000 simultaneous PCR reactions in a single microfluidic chip, in
a volume of 90 picoliters per reaction and with single template
molecule sensitivity.
[0030] In a first broad aspect, the invention provides new methods
and devices for analysis of a sample containing nucleic acids,
proteins, other biomolecules, cells, microorganisms, viruses, and
other biological or nonbiological entities, in which the sample
undergoes massive partitioning as part of the analysis process.
[0031] In a second broad aspect, the invention provides methods and
reagents for amplification and/or detection of a nucleic acid.
These methods and reagents find particular application in the
analysis of nucleic acids partitioned using a MPD, but may be used
in amplification-based analysis of any nucleic acid.
[0032] These and other inventions are described in the following
sections.
B. Massively Partitioning Devices
[0033] Methods described in this disclosure can be, and in some
cases are necessarily, carried out using an elastomeric
microfluidic device. Methods for fabricating elastomeric
microfluidic devices capable of separating molecules or cells and
for carrying out reactions are known in the art (see, e.g., Unger
et al., 2000, Science 288:113-116, PCT Publications WO 01/01025 and
WO/02/43615; and U.S. patent application Ser. No. 10/306,798
published as Pat App. No. 20030138829 on Jul. 24, 2003). In
particular, exemplary elastomeric massively partitioning devices
(MPDs) are described in McBride et al., supra and references cited
therein. Based on these and other publications, one of ordinary
skill in the art guided by this disclosure will be able to practice
all aspects of the inventions described herein. Accordingly,
elastomeric microfluidic devices are described only briefly
below.
General Structure of Microfluidic Devices
[0034] Elastomeric microfluidic devices are characterized in part
by utilizing various components such as flow channels, control
channels, valves, pumps, vias, and/or guard channels from
elastomeric materials. FIGS. 1A and 1B show an exemplary design of
a massively partitioning device.
[0035] A "flow channel" refers generally to a flow path through
which a solution can flow. A "blind channel" refers to a flow
channel which has an entrance but not a separate exit. A "control
channel" is a channel separated from a flow channel by an
elastomeric membrane that can be deflected into or retracted from
the flow channel in response to an actuation force. The term
"valve" refers to a configuration in which a flow channel and a
control channel intersect and are separated by an elastomeric
membrane that can be deflected into or retracted from the flow
channel in response to an actuation force. An "isolated reaction
site" or "reaction chamber" refers to a reaction site that is not
in fluid communication with other reactions sites present on the
device, and which is created by the actuation of control channels
in the device. A "via" refers to a channel formed in an elastomeric
device to provide fluid access between an external port of the
device and one or more flow channels. Thus, a via can serve as a
sample input or output, for example. "Guard channels" may be
included in elastomeric microfluidic devices for use in heating
applications to minimize evaporation of sample from the reaction
sites. Guard channels are channels formed within the elastomeric
device through which water can be flowed to increase the water
vapor pressure within the elastomeric material from which the
device is formed, thereby reducing evaporation of sample from the
reaction sites. The guard channels are similar to the control
channels in that typically they are formed in a layer of elastomer
that overlays the flow channels and/or reaction site. Typically,
the guard channels are placed adjacent and over flow channels and
reaction sites as these are the primary locations at which
evaporation is the primary concern. Guard channels are typically
formed in the elastomer utilizing the MSL techniques and/or
sacrificial-layer encapsulation methods cited above. The solution
flowed through the guard channel includes any substance that can
reduce evaporation of water.
[0036] The devices incorporate flow channels, control channels and
valves to isolate selectively a reaction site at which reagents are
allowed to react. FIGS. 1A and 1B depict an exemplary design of a
partitioning microfluidic device 01 in a valve off and valve
actuated state. Referring to the figure, a sample is injected into
inlet 02 which is in communication with branched partitioning
channel system 03 of the device. Solution flow through flow
channels of the device is controlled, at least in part, with one or
more control channels that are separated from the flow channel by
an elastomeric membrane or segment. This membrane or segment can be
deflected into or retracted from the flow channel with which a
control channel is associated by applying an actuation force to the
control channels so that solution flow can be entirely blocked by
valves. Actuating the control valves creates isolated reaction
chambers 05 in which individual reactions can be conducted. The
reaction chambers can number from 10.sup.3 to 10.sup.5 or more be
at a density of at least 100 sites/cm.sup.2 and can range up to at
least 2000, 3000, 4000 or more than 4000 sites/cm.sup.2. Very small
wells or cavities can be formed within an elastomeric material to
increase the volume of the reaction chamber. Valves can be actuated
by injecting gases (e.g., air, nitrogen, and argon), liquids (e.g.,
water, silicon oils and other oils), solutions containing salts
and/or polymers (including but not limited to polyethylene glycol,
glycerol and carbohydrates), and the like into the port.
[0037] Although FIG. 1 illustrates a MPD with branched flow
channels, any channel configuration (flow channel path) that can be
partitioned by control channels can be used in accordance with the
invention, including, for example, square, spiral or serpentine
configurations.
[0038] The dimensions of flow channels in a MPD can vary widely.
Typically channels are from about 0.1 .mu.m to about 1000 .mu.m in
any dimension, sometimes from about 0.1 to about 100 .mu.m, and
sometimes from about 0.1 to about 10 .mu.m. In one embodiment the
channels have a high aspect ratio (e.g., a height to width ratio of
from about 2:1 to about 10:1) to increase channel density and/or to
increase signal collection from channels containing a detectably
labeled moiety. For example, in some embodiments the channel has a
columnar shape in which the dimensions of floor and ceiling are
smaller that the dimensions of the walls, and a signal (e.g.,
fluorescence, infra red or visible radiation) is detected through
the ceiling or floor. Appropriate channel dimensions will depend in
part on the nature of the entities being partitioned. For partition
of eukaryotic cells, for example, a dimension should be at least
sufficient for passage of the cell (e.g., 2-5 times the dimension
of the cell). However, for the purpose of restricting movement the
dimensions can be on the order of 0.75 times the smallest dimension
of the particle. Microfluidic manipulation and analysis of
particles is also described in U.S. Patent Pub. 20040229349
entitled "Microfluidic particle-analysis systems" and incorporated
herein by reference.
[0039] Reactions (e.g., nucleic acid amplification, protein
binding, etc.) are allowed to occur in each chamber. For example,
PCR reactions can be initiated by heating the chambers (e.g.,
placing the device on a suitably programmed flat plate
thermocycler.
[0040] The results or products of the reaction can be detected
using any of a number of different detection strategies. Because
the MPDs are usually made of elastomeric materials that are
relatively optically transparent, reactions can be readily
monitored using a variety of different detection systems at
essentially any location on the microfluidic device. Most
typically, however, detection occurs at the reaction site
itself.
[0041] The nature of the signal to be detected will, of course,
determine, to a large extent, the type of detector to be used. The
detectors can be designed to detect a number of different signal
types including, but not limited to, signals from radioisotopes,
fluorophores, chromophores, electron dense particles, magnetic
particles, spin labels, molecules that emit chemiluminescence,
electrochemically active molecules, enzymes, cofactors, enzymes
linked to nucleic acid probes and enzyme substrates. Illustrative
detection methodologies suitable for use with the present
microfluidic devices include, but are not limited to, light
scattering, multichannel fluorescence detection, infra-red, UV and
visible wavelength absorption, luminescence, differential
reflectivity, and confocal laser scanning. Additional detection
methods that can be used in certain application include
scintillation proximity assay techniques, radiochemical detection,
fluorescence polarization, fluorescence correlation spectroscopy
(FCS), time-resolved energy transfer (TRET), fluorescence resonance
energy transfer (FRET) and variations such as bioluminescence
resonance energy transfer (BRET). Additional detection options
include electrical resistance, resistivity, impedance, and voltage
sensing.
[0042] A detector can include a light source for stimulating a
reporter that generates a detectable signal. The type of light
source utilized depends in part on the nature of the reporter being
activated. Suitable light sources include, but are not limited to,
lasers, laser diodes and high intensity lamps. If a laser is
utilized, the laser can be utilized to scan across a set of
detection sections or a single detection section. Laser diodes can
be microfabricated into the microfluidic device itself.
Alternatively, laser diodes can be fabricated into another device
that is placed adjacent to the microfluidic device being utilized
to conduct a thermal cycling reaction such that the laser light
from the diode is directed into the detection section.
[0043] Detectors can be microfabricated within the microfluidic
device, or can be a separate element. A number of
commercially-available external detectors can be utilized. Many of
these are fluorescent detectors because of the ease in preparing
fluorescently labeled reagents. Specific examples of detectors that
are available include, but are not limited to, Applied Precision
ArrayWoRx (Applied Precision, Issaquah, Wash.) and the ABI 7700
(Applied Biosystems, Inc., Foster City, Calif.).
Fabrication
[0044] Microfluidic devices are generally constructed utilizing
single and multilayer soft lithography (MSL) techniques and/or
sacrificial-layer encapsulation methods. The basic MSL approach
involves casting a series of elastomeric layers on a micro-machined
mold, removing the layers from the mold and then fusing the layers
together. In the sacrificial-layer encapsulation approach, patterns
of photoresist are deposited wherever a channel is desired. These
techniques and their use in producing microfluidic devices is
discussed in detail, for example, by Unger et al., 2000, Science
288:113-116; by Chou, et al., 2000, "Integrated Elastomer Fluidic
Lab-on-a-chip-Surface Patterning and DNA Diagnostics, in
Proceedings of the Solid State Actuator and Sensor Workshop, Hilton
Head, S.C.; in PCT Publication WO 01/01025; and in published U.S.
patent application No. 20050072946 (each incorporated herein by
reference).
[0045] In one approach, the foregoing fabrication methods initially
involve fabricating mother molds for top layers (e.g., the
elastomeric layer with the control channels) and bottom layers
(e.g., the elastomeric layer with the flow channels) on silicon
wafers by photolithography with photoresist (Shipley SJR 5740).
Channel heights can be controlled precisely by the spin coating
rate. Photoresist channels are formed by exposing the photoresist
to UV light followed by development. Heat reflow process and
protection treatment is typically achieved as described by Unger et
al. supra. A mixed two-part-silicone elastomer (GE RTV 615) is then
spun into the bottom mold and poured onto the top mold,
respectively. Spin coating can be utilized to control the thickness
of bottom polymeric fluid layer. The partially cured top layer is
peeled off from its mold after baking in the oven at 80.degree. C.
for 25 minutes, aligned and assembled with the bottom layer. A
1.5-hour final bake at 80.degree. C. is used to bind these two
layers irreversibly. Once peeled off from the bottom silicon mother
mold, this RTV device is typically treated with HCL (0.1N, 30 min
at 80.degree. C.). This treatment acts to cleave some of the
Si--O--Si bonds, thereby exposing hydroxy groups that make the
channels more hydrophilic.
[0046] The device can then optionally be hermetically sealed to a
support. The support can be manufactured of essentially any
material, although the surface should be flat to ensure a good
seal, as the seal formed is primarily due to adhesive forces.
Examples of suitable supports include glass, plastics and the
like.
[0047] In certain devices, the devices formed according to the
foregoing method result in the substrate (e.g., glass slide)
forming one wall of the flow channel. Alternatively, the device
once removed from the mother mold is sealed to a thin elastomeric
membrane such that the flow channel is totally enclosed in
elastomeric material. For certain uses, e.g., PCR amplification,
flow channels and chambers enclosed in elastomeric material (i.e.,
without a glass wall) are preferred. The resulting elastomeric
device can then optionally be joined to a substrate support. In
some cases, the device is made as described in U.S. patent
publication No. 20050072946. In some cases, the device uses
"push-up valves" described in U.S. patent publication No.
20050072946 (e.g., FIG. 37B). "Push-up" refers to low actuation
pressure geometry in which the membrane deflects upwards to seal
off the upper fluid channel. In this geometry, the deflectable
membrane is featureless and exhibits a substantially constant
thickness.
[0048] Reagents can be deposited in reaction chambers before
addition of a sample to the MPD. A number of commercially available
reagent spotters and established spotting techniques can be used to
deposit the reagent(s). Microfluidic devices in which reagents are
deposited at the reaction sites during manufacture are typically
formed of three layers. The bottom layer is the layer upon which
reagents are deposited. The bottom layer can be formed from various
elastomeric materials as described in the references cited above on
MLS methods. Typically, the material is polydimethylsiloxane (PDMS)
elastomer. Based upon the arrangement and location of the reaction
sites that is desired for the particular device, one can determine
the locations on the bottom layer at which the appropriate reagents
should be spotted. Because PDMS is hydrophobic, the deposited
aqueous spot shrinks to form a very small spot. The deposited
reagents are deposited such that a covalent bond is not formed
between the reagent and the surface of the elastomer because, as
described earlier, the reagents are intended to dissolve in the
sample solution once it is introduced into the reaction site. In
some versions, the reagent is designed to be inactive or
unavailable to a reaction until a specified condition occurs (e.g.,
a polymerase not activated until heated or until the addition of a
necessary cofactor).
[0049] The other two layers of the device are the layer in which
the flow channels are formed and the layer in which the control and
optionally guard channels are formed. These two layers are prepared
according to the general methods set forth earlier in this section.
The resulting two layer structure is then placed on top of the
first layer onto which the reagents have been deposited. A specific
example of the composition of the three layers is as follows
(ration of component A to component B): first layer (sample layer)
30:1 (by weight); second layer (flow channel layer) 30:1; and third
layer (control layer) 4:1. It is anticipated, however, that other
compositions and ratios of the elastomeric components can be
utilized as well. During this process, the reaction sites are
aligned with the deposited reagents such that the reagents are
positioned within the appropriate reaction site.
C. Partitioning, Detection and Analysis of Nucleic Acids
[0050] In this section, methods for analysis of nucleic acids in a
sample are described. The methods involve massive partitioning of
the sample and any nucleic acid molecules it contains, and
amplification (as defined herein) of target sequences in the
partitioned nucleic acid molecules. Various versions of the methods
may also involve application of particular amplication strategies,
pooling of amplification products, analysis of pooled amplification
products and/or other features that will be apparent upon reading
this disclosure. This section also describes devices (i.e.,
massively partitioning devices, MPDs) useful in carrying out
analyses according to the method.
[0051] Analytical methods described in this section can be used for
deleting the presence or absence of a target sequence, detection of
polymorphisms; single polynucleotide polymorphism (SNP) analysis;
haplotype analysis; amplification of a segment for sequence
determination, gene expression analysis, quantification of nucleic
acids, analysis of cells (see Section D, below), as well as other
applications that will be apparent to one of skill guided by this
disclosure. Although this section focuses on analysis of nucleic
acids it will be appreciated by the reader that many aspects of the
description in this section will be applicable, with appropriate
modification, to analysis of other molecules and of cells. FIGS. 3A
and 3B are flow charts illustrating partition and analysis of
nucleic acids in which multiple targets are amplified in which
amplicons may be pooled. FIG. 3B illustrates partition and analysis
of nucleic acids in which, in one embodiment, target molecules in
only a single chamber are amplified.
[0052] i) Samples Containing Nucleic Acids
[0053] In one step of the assay method, a sample containing a
plurality of nucleic acid molecules is partitioned into a plurality
of sub-samples, at least two of which each comprise at least one
nucleic acid molecule.
[0054] Samples that may be analyzed according to the invention are
any fluid sample that contains nucleic acids. A variety of types of
samples can be used, so long as at least some nucleic acids can be
partitioned from each other by the MPD. The nucleic acids can be
free in solution or can be contained in particles or within cells
suspended in a fluid. Samples may be processed so that any nucleic
acids in the sample can be amplified. For example, in samples
containing cells or viruses, the cells or viruses can be lysed or
disrupted, using such routine methods as exposure to enzymes (such
as lysozyme), detergents, denaturants (such as guanidine salts)
and/or physical disruption) before the sample. Any method of
liberating nucleic acids that results in nucleic acid molecules
sufficiently intact and purified to amplify fragments is suitable.
Examples of samples containing nucleic acids are cell lysates or
cell fractions, water samples containing microorganisms, purified
DNA resuspended in an aqueous buffer, sputum, blood, nucleated
blood cells, tissue or fine needle biopsy samples, urine,
peritoneal fluid, fecal samples, and fleural fluid, or cells
therefrom. Exemplary samples include cells and cell lysates (e.g.,
eukaryotic cells, human cells, animal cells, plant cells, fetal
cells, embryonic cells, stem cells, blood cells, lymphocytes,
bacterial cells, recombinant cells and cells infected with a
pathogen tissue samples), viruses, purified or partially purified
DNA or RNA, environmental samples (e.g., water samples), food
samples, forensic samples, plant samples and the like. It will
apparent that the sample can contain other compounds and
macromolecules in addition to nucleic acids. If necessary for the
functioning of a microfluidic device non-nucleic acid components
and/or particulates can be removed by filtration, sedimentation or
other methods.
[0055] In one embodiment of the invention, the nucleic acids are
contained in cells, organelles, or viruses and the nucleic acids
are not released (e.g., the cells are not lysed) until at least
after a partitioning step. Particular aspects of this embodiment
are discussed in Section D, below.
[0056] Analysis of nucleic acids in a sample generally involves
determining whether the sample contains a nucleic acid having a
particular target sequence. A target sequence may be predefined
(i.e., known prior to analysis) or may be a sequence in a segment
of a nucleic acid defined by other parameters (e.g., defined as the
segment of a gene that can be amplified by a particular primer
pair).
[0057] A target sequence can be any nucleic acid sequence of
interest, such as a sequence associated with a gene, a sequence
that identifies a particular allele or polymorphism, a sequence
that, alone in combination with other genotypic or phenotypic
markers, identifies the presence in the sample of a particular
organism or strain, and the like. A target sequence can also
include sequences flanking a sequence of interest, such as the
sequences flanking a SNP. In addition, in some cases as will be
recognized from context, a "target sequence" is a sequence added
during an amplification step. For example, the B and U sequences
discussed below in the context of a Universal Amplification method
can be referred to as "target sequences" recognized by a probe or
amplification primer.
[0058] A target sequence can be found in DNA (including genomic,
mitochondrial DNA, viral DNA, recombinant DNA and complementary
cDNA made from RNA) or in RNA (including rRNA, mRNA and iRNA). If a
target sequence is detected in a sample it is possible to deduce
that the sample contains a nucleic acid molecule containing the
detected sequence or its complement. For example, a sample from a
human patient can be analyzed to determine whether a viral
nucleotide sequence (the target sequence) is detectable in the
sample, in order to diagnose (or rule out) viral infection. As
another example, genomic DNA from a human patient can be analyzed
to determine whether a particular polymorphism is or is not present
in a subject's genome.
[0059] In some cases, it will be advantageous to fragment the
nucleic acid molecules prior to the partitioning step. For example,
to characterize two genes on different regions of a eukaryotic
chromosome it may be useful to fragment the DNA to produce smaller
nucleic acid molecules so that the genes can be separately
partitioned (i.e., partitioned into different sub-samples).
Fragmentation can be accomplished enzymatically (e.g., using
restriction enzymes), mechanically or chemically. In one
embodiment, shearing is accomplished by passing the DNA through a
channel of a MPD with a diameter (bore size) that is sufficiently
small, or which varies in diameter along the length of the channel,
so as to sheer large nucleic acids as they pass through. A sample
containing a single DNA molecule (e.g., a single chromosome)
contains a plurality of nucleic acids upon fragmentation of the
single molecule.
[0060] ii) Partitioning of a Sample Containing Nucleic Acid
Molecules
[0061] Methods for partitioning a sample using a MPD are provided
in Section B, above. The terms "to partition," "partitioning,"
"partitioned," and grammatical equivalents refer to the process of
separating a sample into a plurality of sub-samples using a MPD. A
sample is partitioned by introducing the sample into the flow
channels and reaction sites with valves open and then closing the
valves to isolate each sub-sample. It will be recognized that each
sub-sample is contained (for at least a period of time) in a
separate reaction chamber such that the sample is isolated from
(not in fluidic communication with) other sub-samples. It is
sometimes convenient to refer to the "sample" even after it has
been partitioned into sub-samples. Thus, in some contexts "sample"
can refer to the aggregate contents of the sub-samples or chambers
after partition, as well as before partition.
[0062] When a sample containing a complex mixture of nucleic acid
molecules it is partitioned into very small-volume sub-samples, the
effective concentration of the target sequence in the sub-sample(s)
in which it is located is significantly increased. Effective
concentration of the target occurs because, while the number of
molecules of target in the sample does not change as a result of
the partitioning, the number of other molecules (including
molecules that can produce side reactions, e.g., primer-dimers and
non-complementary DNA sequences in the sample) is linearly
proportional to volume. For example, if a 30 microliter sample
containing one molecule of interest is partitioned into ten
thousand subsamples (each with a volume of 3 nanoliters) the
effective concentration of molecule of interest is enriched by a
factor of 10.sup.4 in the chamber in which it is located. Since the
ratio of target to side reactions is inversely proportional to
volume, partitioning into a small volume increases this ratio
(i.e., effectively concentrates). As noted by McBride et al., such
an increase in effective concentration results in remarkable
sensitivity and fidelity of PCR-based detection.
[0063] Typically the sample is partitioned into at least about
10.sup.3 different sub-samples or reaction chambers, sometimes at
least about 5.times.10.sup.3 different sub-samples or chambers,
sometimes 10.sup.4 different sub-samples or chambers, often at
least about 2.times.10.sup.4 different sub-samples or chambers,
sometimes at least about 3.times.10.sup.4 different sub-samples or
chambers, and sometimes at least about 10.sup.5 different
sub-samples or chambers. In certain embodiments the sample is
partitioned into between 100 and 100,000 sub-samples, more often
between 1000 and 50,000 sub-samples, and sometimes between 1000 and
20,000 sub-samples.
[0064] Typically the volume of each sub-sample is less than about
1000 picoliters (pL), often less than about 500 pL, sometimes less
than about 100 pL, and sometimes less than about 50 pL.
[0065] The relationship between the number of nucleic acid
molecules (or non-nucleic acid macromolecules, particles or cells)
in a sample, the number of chambers into which the sample is
partitioned, and the distribution of number of nucleic acid
molecules or other entities in each chamber can be estimated using
well know methods. For example, to determine the number of chambers
(C) into which the number (N) particles (e.g. cells, nucleic acid
molecules, etc.) would be partitioned so that most or essentially
all of the chambers contained either 0 or 1 particle can be
determined using a Poisson Distribution: [1]
P ( x , .lamda. ) = - .lamda. .lamda. x x ! . ##EQU00001##
P(x,.lamda.) is the probability of finding x particles if the
average number of particles in a box is .lamda.. We can get this by
setting the average number (.lamda.) such that
P ( 0 , .lamda. ) + P ( 1 , .lamda. ) .gtoreq. - .lamda. .lamda. 0
0 ! + - .lamda. .lamda. 1 1 ! .gtoreq. x ##EQU00002## - .lamda. + -
.lamda. .lamda. .gtoreq. x ##EQU00002.2## - .lamda. ( 1 + .lamda. )
.gtoreq. x ##EQU00002.3##
The average number of particles in a box is .lamda.=N/C, so if you
know .lamda. and N, you can find C:
C = N .lamda. ##EQU00003##
.lamda. is easily determined using eqn. [1] above. For instance, if
x is 0.99 (i.e. 99% chance of a chamber containing a 0 or 1
particle),
e.sup.-.lamda.(1-.lamda.).gtoreq.0.99
.lamda..ltoreq..about.0.1487
If N is 10,000, then
C .apprxeq. 10000 0.1487 ##EQU00004##
[0066] C.gtoreq.67250 chambers are required to have 99% likelihood
of 0 or 1 particles per chamber. Although this calculation is
provided for illustration it will be understood that any method
(emperical or analytical) may be used. In some applications it will
be useful to use such a calculation and adjust (e.g., dilute) the
sample and/or select a MPD with an appropriate number of chambers
for an increased likelihood there will be few, if any, chambers
with more than a predetermined number of target molecules (e.g., 1)
per chamber.
[0067] iii) Amplification of Partitioned Nucleic Acids
[0068] Following the partitioning step, any target sequences of
interest that are in the sample are amplified. As used herein,
nucleic acid "amplification" is a process that produces multiple
nucleic acid molecules (called "amplicons") based on the presence
of a particular target sequence. Most often the amplicons include a
base sequence that is the same as, or complementary to, the target
sequence so that amplification means that the number of copies of
the target sequence increases. These identical or complementary
amplicons are the products, for example and without limitation, of
the Polymerase Chain Reaction (PCR) [see, Dieffenbach and Dvksler,
1995, PCR Primer: A Laboratory Manual. CSHL press, Cold Spring
Harbor, USA]; Nucleic Acid Sequence Based Amplification (NASBA)
[see Sooknanan and Malek, 1995, BioTechnology 13:563-65] SPA.TM.
Isothermal Linear Amplification, Ribo-SPIA, X-SPIA.TM. [Nugen
Technologies, San Carlos Calif., see U.S. Pat. No. 6,251,639, WO
02/72772; US2003/0017591 A1]; the Ligase Chain Reaction (LCR) [Wu
and Wallace, 1989, Genomics 4:560; Landegren et al., 1988, Science
241:1077]; Transcription amplification [Kwoh et al., 1989, Proc.
Natl. Acad. Sci. USA 86:1173]; Self-sustained sequence replication
[Guatelli et al., 1990, Proc. Nat. Acad. Sci. USA 87:1874]. In some
embodiments, however, an amplicon is a nucleic acid with a sequence
different from the target sequence and the process of amplification
consists of increasing the number of amplicons if the target is
present in a chamber, but not in the absence of the target
sequence.
[0069] As noted above, typically the invention is used to
simultaneously assay for multiple different target sequences in the
same sample (e.g., sequences of multiple different genes or gene
segments, or alternative sequences of a single gene). For example,
provided with a patient blood sample, it may be useful to assay the
sample for the presence of several (e.g., 10, 20 or 100) different
sequences each characteristic of a different pathogen. In one
embodiment, the different sequences are amplified in different
reaction chambers. For example, an assay to detect the presence of
multiple mutations in different genes from an individual sample
will result in analysis of products in different reaction chambers
if the genes are on fragments distributed to different sub-samples.
In other embodiments, multiple different target sequences are
assayed for and/or detected in a single reaction chamber, such as,
for example, when the reaction chamber contains a single rare cell
and the assay is designed to analyse several genetic loci in the
cell genome. For example, an assay to determine which of several
possible polymorphisms (e.g. defining a haplotype) are represented
at a specific genomic site, multiple primers or probes may be used
to determine which of several possible target sequences are present
in a single reaction chamber. Very often both types of
amplification are used.
[0070] A variety of methods are known for "multiplex" analysis
(amplification of multiple sequences from one reaction) and can be
adapted for use in a single reaction chamber MPDs. In one
embodiment amplification is conducted using a universal primer
strategy in which each target sequence is initially amplified by a
pair of target sequence specific primers that include a 3-prime
domain with a gene-specific sequence and a 5-prime domain with a
universal (not target specific) sequence. For example, N different
target sequences can be detected using primers
5'-U.sub.1-F.sub.N-3' and 5'-U.sub.2-R.sub.N-3' where F.sub.N and
R.sub.N are forward and reverse PCR primers for each gene N, and
U.sub.1 and U.sub.2 are sequences common to all of the primer pairs
and U.sub.1 and U.sub.2 may be the same or different. Subsequent
rounds of amplification can be conducted using primers
5'-U.sub.1-3' and 5'-U.sub.2-3'. See, e.g., Zhenwu Lin et al.,
1996, "Multiplex genotype determination at a large number of gene
loci" Proc. Nat'l Acad. Sci USA 93: 2582-87. When used in an MPD
this strategy allows use of a low concentration of target specific
primers (thereby reducing expense and the chances of primer dimer
and other unintended side reactions) and a higher concentration of
universal primers.
[0071] In one embodiment, the multiplex amplification is carried
out in a MPD using the primers and strategy described below in
Section C(v).
[0072] Amplification reagents, including primers, can be provided
by prepositioning reagents in reaction chambers, by combining
reagents with the sample before partitioning, by a combination of
prepositioning and combining, or by any other suitable method.
Specific amplification reagents will depend on the amplification
method and sample, but can include primers, polymerase, reverse
transcriptase, nucleotides, cofactors, metal ions, buffers, and the
like. Methods for prepositioning reagents in a microfluidic device
have been described (see McBride et al., supra). In addition,
detection reagents such as labeled probes can be provided by
prepositioning and/or combining.
[0073] To produce amplicons the environment of the MPD reaction
chambers is manipulated as required to accomplish amplification by
the amplification method selected. For example, thermocycling
necessary for a PCR-type amplification reaction can be accomplished
by placing the device on a thermocycling plate and cycling the
device between the various required temperatures for melting of the
DNA duplex (either target or amplicon), annealing of primers, and
DNA synthesis. For example a protocol with an initial ramp to
95.degree. C. and maintain for 1 m; three step thermocycling for 40
cycles [92.degree. C. for 30 s, 54.degree. C. for 30 s, and
72.degree. C. for 1 m] or two step thermocycling for 40 cycles
[92.degree. C. for 30 s and 60.degree. C. for 60 s] can be used. A
variety of thermocycling plates are available from commercial
sources, including for example the ThermoHybaid Px2 (Franklin,
Mass.), MJ Research PTC-200 (South San Francisco, Calif.),
Eppendorf Part#E5331 (Westbury, N.Y.), Techne Part#205330
(Princeton, N.J.).
[0074] Although in some cases a single target sequence in the
sample is amplified, more often at least 2, at least 3, at least 5,
at least 10, at least 20, at least 30, at least 40, at least 50, or
at least 100 different target sequences are amplified. Thus, in
some embodiments, sufficient reagents are provided to amplify more
than one target sequence.
[0075] Thus, the amplification procedure can produce from zero (if
no target sequence is present) to 100 or more different amplicons.
Any particular chamber may have zero, one or more than one
amplicons species (where amplicons corresponding to the same target
sequence are of the same "species") depending on the nature of the
assay and sample.
[0076] Usually, at least about 10.sup.3, at least about 10.sup.4,
at least about 10.sup.5, at least about 10.sup.6, at least about
10.sup.7, or at least about 10.sup.8 amplicon molecules are
produced corresponding to some or all of the target sequences
present in the sample. Most typically, from about 10.sup.7 to about
10.sup.9 amplicon molecules are produced for each target sequence,
although the number may be lower when multiple reactions are
conducted in a single reaction chamber.
[0077] iv) Detection of Amplicons
[0078] The amplicon products can be detected in individual chambers
and/or they can be pooled for subsequent detection and analysis (as
described below in Section C(vi)). That is, amplicons can be
detected and then pooled, pooled without previously being detected,
or detected and not subsequently pooled.
[0079] Amplicons can be detected and distinguished (whether
isolated in a reaction chamber or at any subsequent time) using
routine methods for detecting nucleic acids. Amplicons comprising
double-stranded DNA can be detected using intercalation dyes such
as SYBRTM, Pico Green (Molecular Probes, Inc., Eugene, Oreg.),
ethidium bromide and the like (see Zhu et al., 1994, Anal. Chem.
66:1941-48) and/or gel electrophoresis. More often,
sequence-specific detection methods are used (i.e., amplicons are
detected based on their nucleotide sequence). Examples of detection
methods include hybridization to arrays of immobilized oligo or
polynucleotides, and use of differentially labeled molecular
beacons or other "fluorescence resonance energy transfer"
(FRET)-based detection systems. FRET-based detection is a preferred
method for detection. In FRET-based assays a change in fluorescence
from a donor (reporter) and/or acceptor (quencher) fluorophore in a
donor/acceptor fluorophore pair is detected. The donor and acceptor
fluorophore pair are selected such that the emission spectrum of
the donor overlaps the excitation spectrum of the acceptor. Thus,
when the pair of fluorophores are brought within sufficiently close
proximity to one another, energy transfer from the donor to the
acceptor can occur and can be detected. A variety of assays are
known including, for example and not limitation, template extension
reactions, quantitative RT-PCR, Molecular Beacons, and Invader
assays, these are described briefly below.
[0080] FRET and template extension reactions utilize a primer
labeled with one member of a donor/acceptor pair and a nucleotide
labeled with the other member of the donor/acceptor pair. Prior to
incorporation of the labeled nucleotide into the primer during an
template-dependent extension reaction, the donor and acceptor are
spaced far enough apart that energy transfer cannot occur. However,
if the labeled nucleotide is incorporated into the primer and the
spacing is sufficiently close, then energy transfer occurs and can
be detected. These methods are particularly useful in conducting
single base pair extension reactions in the detection of single
nucleotide polymorphisms and are described in U.S. Pat. No.
5,945,283 and PCT Publication WO 97/22719.
[0081] Quantitative Real Time PCR. A variety of so-called "real
time amplification" methods or "real time quantitative PCR" methods
can also be used to determine the quantity of a target nucleic acid
present in a sample by measuring the amount of amplification
product formed during or after the amplification process itself.
Fluorogenic nuclease assays are one specific example of a real time
quantitation method which can be used successfully with the devices
described herein. This method of monitoring the formation of
amplification product involves the continuous measurement of PCR
product accumulation using a dual-labeled fluorogenic
oligonucleotide probe--an approach frequently referred to in the
literature as the "TaqMan" method. See U.S. Pat. No. 5,723,591
[0082] Molecular Beacons: With molecular beacons, a change in
conformation of the probe as it hybridizes to a complementary
region of the amplified product results in the formation of a
detectable signal. The probe itself includes two sections: one
section at the 5' end and the other section at the 3' end. These
sections flank the section of the probe that anneals to the probe
binding site and are complementary to one another. One end section
is typically attached to a reporter dye and the other end section
is usually attached to a quencher dye. In solution, the two end
sections can hybridize with each other to form a hairpin loop. In
this conformation, the reporter and quencher dye are in
sufficiently close proximity that fluorescence from the reporter
dye is effectively quenched by the quencher dye. Hybridized probe,
in contrast, results in a linearized conformation in which the
extent of quenching is decreased. Thus, by monitoring emission
changes for the two dyes, it is possible to indirectly monitor the
formation of amplification product. Probes of this type and methods
of their use are described further, for example, by Piatek et al.,
1998, Nat. Biotechnol. 16:359-63; Tyagi, and Kramer, 1996, Nat.
Biotechnology 14:303-308; and Tyagi, et al., 1998, Nat. Biotechnol.
16:49-53 (1998).
[0083] Scorpion: The Scorpion detection method is described, for
example, by Thelwell et al. 2000, Nucleic Acids Research,
28:3752-3761 and Solinas et al., 2001, "Duplex Scorpion primers in
SNP analysis and FRET applications" Nucleic Acids Research 29:20.
Scorpion primers are fluorogenic PCR primers with a probe element
attached at the 5'-end via a PCR stopper. They are used in
real-time amplicon-specific detection of PCR products in
homogeneous solution. Two different formats are possible, the
`stem-loop` format and the `duplex` format. In both cases the
probing mechanism is intramolecular. The basic elements of
Scorpions in all formats are: (i) a PCR primer; (ii) a PCR stopper
to prevent PCR read-through of the probe element; (iii) a specific
probe sequence; and (iv) a fluorescence detection system containing
at least one fluorophore and quencher. After PCR extension of the
Scorpion primer, the resultant amplicon contains a sequence that is
complementary to the probe, which is rendered single-stranded
during the denaturation stage of each PCR cycle. On cooling, the
probe is free to bind to this complementary sequence, producing an
increase in fluorescence, as the quencher is no longer in the
vicinity of the fluorophore. The PCR stopper prevents undesirable
read-through of the probe by Taq DNA polymerase.
[0084] Invader: Invader assays (Third Wave Technologies, Madison,
Wis.) are used particularly for SNP genotyping and utilize an
oligonucleotide, designated the signal probe, that is complementary
to the target nucleic acid (DNA or RNA) or polymorphism site. A
second oligonucleotide, designated the Invader Oligo, contains the
same 5' nucleotide sequence, but the 3' nucleotide sequence
contains a nucleotide polymorphism. The Invader Oligo interferes
with the binding of the signal probe to the target nucleic acid
such that the 5' end of the signal probe forms a "flap" at the
nucleotide containing the polymorphism. This complex is recognized
by a structure specific endonuclease, called the Cleavase enzyme.
Cleavase cleaves the 5' flap of the nucleotides. The released flap
binds with a third probe bearing FRET labels, thereby forming
another duplex structure recognized by the Cleavase enzyme. This
time the Cleavase enzyme cleaves a fluorophore away from a quencher
and produces a fluorescent signal. For SNP genotyping, the signal
probe will be designed to hybridize with either the reference (wild
type) allele or the variant (mutant) allele. Unlike PCR, there is a
linear amplification of signal with no amplification of the nucleic
acid. Further details sufficient to guide one of ordinary skill in
the art are provided by, for example, Neri, B. P., et al., Advances
in Nucleic Acid and Protein Analysis 3826:117-125, 2000) and U.S.
Pat. No. 6,706,471.
[0085] Padlock probes: Padlock probes (PLPs) are long (e.g., about
100 bases) linear oligonucleotides. The sequences at the 3' and 5'
ends of the probe are complementary to adjacent sequences in the
target nucleic acid. In the central, noncomplementary region of the
PLP there is a "tag" sequence that can be used to identify the
specific PLP. The tag sequence is flanked by universal priming
sites, which allow PCR amplification of the tag. Upon hybridization
to the target, the two ends of the PLP oligonucleotide are brought
into close proximity and can be joined by enzymatic ligation. The
resulting product is a circular probe molecule catenated to the
target DNA strand. Any unligated probes (i.e., probes that did not
hybridize to a target) are removed by the action of an exonuclease
(which may be introduced before or after a pooling step).
Hybridization and ligation of a PLP requires that both end segments
recognize the target sequence. In this manner, PLPs provide
extremely specific target recognition.
[0086] Using universal primers, the tag regions of circularized
PLPs can be amplified and resulting amplicons detected. For
example, TaqMan real time PCR can be carried out to detect and
quantitate the amplicon. The presence and amount of amplicon can be
correlated with the presence and quantity of target sequence in the
sample. For descriptions of PLPs see, e.g., Landegren et al., 2003,
Padlock and proximity probes for in situ and array-based analyses:
tools for the post-genomic era, Comparative and Functional Genomics
4:525-30; Nilsson et al., 2006, Analyzing genes using closing and
replicating circles Trends Biotechnol. 24:83-8; Nilsson et al.,
1994, Padlock probes: circularizing oligonucleotides for localized
DNA detection, Science 265:2085-8.
[0087] v) Detection of Multiple Different Target Nucleic Acid
Sequences Using The "Universal Amplification" Method
[0088] As described above, a variety of multiplex amplification
systems can be used in conjunction with the present invention. In
one type, several different targets can be detected simultaneously
by using multiple differently labeled probes each of which is
designed to hybridize only to a particular target. Since each probe
has a different label, binding to each target to be detected based
on the fluorescence signals. By judicious choice of the different
labels that are utilized, analyses can be conducted in which the
different labels are excited and/or detected at different
wavelengths in a single reaction. See, e.g., Fluorescence
Spectroscopy (Pesce et al., Eds.) Marcel Dekker, New York, (1971);
White et al., Fluorescence Analysis: A Practical Approach, Marcel
Dekker, New York, (1970); Berlman, Handbook of Fluorescence Spectra
of Aromatic Molecules, 2nd ed., Academic Press, New York, (197 1);
Griffiths, Colour and Constitution of Organic Molecules, Academic
Press, New York, (1976); Indicators (Bishop, Ed.). Pergamon Press,
Oxford, 19723; and Haugland, Handbook of Fluorescent Probes and
Research Chemicals, Molecular Probes, Eugene (1992).
[0089] Conventional multiplex fluorescence detection using many
different probes is limited, however, by fluorescence background
because probe concentration must be high enough to allow detection
of many different probes (i.e., one for each sequence to be
detected). Combining many probes results in fluorescence that is
the sum of all the probes. This also results in a fluorescence
background that is the sum of the background from all of the
probes. This background may be so high as to interfere with
detection of the reaction product(s). An alternative approach,
referred to as the Universal Amplification ("UA") method uses
multiple sets of primer pairs, referred to here as "UA primer"
amplification in a PCR-type reaction. Universal amplification
allows many different sequences in a sample to be amplified using a
single reaction mixture, with lower background and cost than
conventional systems, and is particularly well suited for use with
an MPD.
[0090] UA primers can be used to determine whether or not any one
or more of a number of different target nucleic acid sequences are
present in a sample (without necessarily identifying which of the
several target sequences is present). If the assay indicates that
at least one of the different nucleic acid sequences is present in
the sample, subsequent analysis can be conducted to determine which
of the different sequences is present. Such two-step analysis is
advantageous in many applications. For example, using the present
invention, in a first step a sample can be assayed to determine
whether any of 100 (for example) different pathogenic agents is
present in the sample. If it is determined in the first step that
at least one pathogenic agent is present, the sample can be
subjected to further analysis to identify and characterize the
particular pathogen.
[0091] In one aspect the invention provides a method for detecting
multiple amplification products (i.e., amplicons) using the
Universal Amplification method. The total number of target
sequences detected is usually at least two, and is sometimes at
least 5, more often at least 10, at least 20 or at least 30. In
some embodiments the total number of target sequences is between 2
and 100, between 5 and 100, between 10 and 100, between 20 and 100,
or between 30 and 100. In some embodiments the total number of
target sequences is between 2 and 50, between 5 and 50, between 10
and 50, between 20 and 50, or between 30 and 50. In some
embodiments the total number of target sequences is more than 100.
The UA method makers use of three or more types of primers:
[0092] The Type 1 primer has the structure
5'-U.sub.F-B.sub.X-F.sub.N-3' where U.sub.F is a universal forward
primer sequence, B.sub.X is a sequence recognized by a detectable
(e.g., detectably labeled) labeled probe, Probe X, and F is a
forward primer sequence specific to a target sequence N so that
F.sub.1 is primer for a first target sequence, F.sub.2 is a primer
sequence for a second target sequence, and so on. Probe X can be a
molecular beacon, Taqman-type probe, or other probe (such as, but
not limited to, those described above) that specifically binds or
hybridizes to sequence B.sub.X.
[0093] The Type 2 primer has the structure 5'-U.sub.R-R.sub.N-3'
where U.sub.R is a universal reverse primer sequence and R.sub.N is
a primer specific to a target sequence N so that R.sub.1 is primer
for a first target sequence, R.sub.2 is a primer for a second
target sequence and so on. U.sub.R may or may not be the same
sequence as U.sub.F. In one embodiment, 5'-U.sub.R-3' has the same
sequence as 5'-U.sub.F-3'.
[0094] The Type 3 primer comprises the sequence 5'-U.sub.F-3' (or
5'-U.sub.1-3').
[0095] The Type 4 primer comprises the sequence 5'-U.sub.R-3' (or
5'-U.sub.2-3').
[0096] Each pair of Type 1 and Type 2 primers is specific to a
particular target. The cognate pair of primers that amplify the
same target is a "UA primer pair." Thus, if there are 20 target
sequences to be detected (for example, sequences corresponding to
20 different pathogens) twenty different primer pairs can be
prepared, i.e., 5'-U.sub.1-B.sub.X-F.sub.[1.sub..fwdarw..sub.2]-3'
and 5'-U.sub.2'-R.sub.[1.sub..fwdarw..sub.20]-3'. The various pairs
of Type 1 and Type 2 primers are combined at low concentrations
with the sample, and Type 3 and Type 4 primers are added at a
higher concentration. During the initial rounds of amplification,
the Type 1 and Type 2 primers will amplify any target sequences
present in a sample or sub-sample. It will be appreciated that
U.sub.1 and U.sub.2 sequences can be designed with sequences not
present (or unlikely to be present) in the initial sample nucleic
acid, to avoid amplification of non-target sequences in the sample.
For example, for analysis of human DNA, U.sub.1 and U.sub.2 can be
selected to have sequences not found on the human genome. During
subsequent rounds of amplification, the amplification products
generated in the first rounds of amplification are themselves
amplified by the Type 3 and Type 4 primers. The resulting double
stranded amplification products will have the structure (showing
one strand): [0097] 5'-U.sub.1-B.sub.X-F.sub.1-target
sequence1-R.sub.1'-U.sub.2'-3' [0098]
5'-U.sub.1-B.sub.X-F.sub.2-target sequence2-R.sub.2'-U.sub.2'-3'
[0099] 5'-U.sub.1-B.sub.X-F.sub.3-target
sequence3-R.sub.3'-U.sub.2'-3' [0100]
5'-U.sub.1-B.sub.X-F.sub.4-target sequence4-R.sub.4'-U.sub.2'-3'
[0101] 5'-U.sub.1-B.sub.X-F.sub.5-target
sequence5-R.sub.5'-U.sub.2'-3' [0102]
5'-U.sub.1-B.sub.X-F.sub.6-target sequence6-R.sub.6'-U.sub.2'-3'
[0103] etc. where U.sub.1' is the complement of U.sub.1 and
U.sub.2' is the complement of U.sub.2. Each of the amplification
products shown above can be detected by a probe (e.g., molecular
beacon, Invader probe, Scorpion probe) that hybridizes to B.sub.X.
Thus, using the UA universal probes described herein, a
multiplicity of target sequences can be detected using a single
probe. Most of the amplification steps involve amplification using
a single primer (if U.sub.1 and U.sub.2 are the same) or primer
pair. Methods for designing probes that recognize a specified
sequence (e.g., B.sub.X) are well known. For example, Molecular
Beacons can be designed as described in Marras et al., 2003,
Genotyping single nucleotide polymorphisms with molecular beacons.
In Kwok, P. Y. (ed.), Single nucleotide polymorphisms: methods and
protocols. The Humana Press Inc., Totowa, N.J., Vol. 212, pp.
11-128. Molecular Beacons can also be designed with the help of a
dedicated software package called `Beacon Designer,` which is
available from Premier Biosoft International
(www.premierbiosoft.com). However, it will be appreciated that the
sequence of B.sub.X can be, and generally is, an artificial
sequence (i.e., not found in the in the initial sample nucleic
acid) that can be recognized by the probe.
[0104] Primer concentration(s) will vary with the length,
composition, and nature of the sample and targets. Those primer
pairs with sequences specific to each of the targets (e.g., Type 1
and 2 primers) are required only in the first few rounds of
amplification and can be provided in very small quantities (for
example and not limitation, e.g., typically less than about 50 nM,
more often less than about 30 nM and sometimes less than about 20
nM). Type 3 and 4 primers can be provided at somewhat higher
concentration (for example and not limitation, e.g., typically from
about 100 nM to 1 uM, such as from about 200 nM to about 900 nM).
The practicioner guided by this disclosure will be able to select
appropriate concentration using routine methods.
[0105] The method can be modified in a variety of ways to achieve
particular results. In one version of the method, a relatively
small number of probe sequences can be used with a larger number of
unique target sequences, with different classes of target specific
sequences associated with differently labeled probes. For example,
if target sequences 1-20 are characteristic of a viral pathogen,
target sequences 21-40 are characteristic of a bacterial pathogen,
and target sequences 41-45 are positive control sequences (human
genes), amplification of a human patient sample could give zero,
one or more than one of the following 45 amplification
products:
[0106] Set 1: 20 products (from 5'-U.sub.F-B.sub.V-target
sequence1-U.sub.R'-3' to 5'-U.sub.F-B.sub.V-target
sequence20-U.sub.R'-3')
[0107] Set 2: 20 products (from 5'-U.sub.F-B.sub.B-target
sequence21-U.sub.R'-3' to 5'-U.sub.F-B.sub.B-target
sequence40-U.sub.R'-3')
[0108] Set 1: 5 products (from 5'-U.sub.F-B.sub.C-target
sequence41-U.sub.R'-3' to 5'-U.sub.F-B.sub.C-target
sequence45-U.sub.R'-3')
[0109] By using differently labeled probes B.sub.V (hybridizes to
Set 1 products), B.sub.B (hybridizes to Set 2 products), and
B.sub.C (hybridizes to Set 3 products) the classes of amplification
products can be detected and distinguished. Thus, if the human
sample produced any amplicon to which Probe B.sub.V hybridized and
emitted signal it would indicate that the patient was infected with
one of 20 viruses. If desired, the precise identity of the viral
pathogen could be determined in a second assay step. Similarly, if
the human sample produced any amplicon to which Probe B.sub.B
hybridized and emitted signal (different from the signal emitted by
Probe B.sub.V) it would indicate that the patient was infected with
one of 20 bacteria. Other types of samples, such as food or
agricultural sample can be screened for many different pathogens
simultaneously and if any hits are detected the sample can be
selected for further analysis to determine which of the many
pathogen(s) was responsible for the signal. If there is no signal,
the sample can be concluded to be pathogen free.
[0110] Numerous primer pairs are know for detection and analysis of
pathogens, and other primer combinations can be prepared using well
established methods. For illustration and not limitation see, e.g.,
U.S. Pat. No. 6,503,722 "Detection of toxigenic strains of
Clostridium difficile using a PCR-based assay" [e.g., 5'
CCCCAATAGAAGATTCAATATTAAG with 5'ATGTAGAAGTAAACTTACT TGGATG to
detect strains expressing toxin A; 5' GGTGGAGCTTCAATTGGAGAG with 5'
GTGTAACCTACTTTCATAACACCA to detect strains expressing toxin B; and
5' AAGTGTTCTGTAACAGGTATACC with 5' GGTCCATTAGCAGCCTCACA to detect
glutamate dehydrogenase (positive control for presence of
bacteria)]; U.S. Pat. No. 6,723,505 "Method for identification of
the indicators of contamination in liquid samples"; U.S. Pat. No.
6,632,642 "Genes for detecting bacteria and detection method by
using the same"; U.S. Pat. No. 6,387,652 "Method of identifying and
quantifying specific fungi and bacteria"; U.S. Pat. No. 6,013,435
"Drug resistance screening method using multiplex amplification";
U.S. Pat. No. 5,932,415 "Processes and agents for detecting
listerias"; U.S. Pat. No. 6,225,094 "Method for the genus-specific
or/and species-specific detection of bacteria in a sample liquid";
Di Pinto, 2005, A collagenase-targeted multiplex PCR assay for
identification of Vibrio alginolyticus, Vibrio cholerae, and Vibrio
parahaemolyticus", J Food Prot. 68(1):150-3; Maher et al., 2003,
"Use of PCR to detect Campylobacter species in samples" J. Clin.
Micro. 41(7):2980 [5' AGTCGTAACA AGGTAGCCG with 5'
CYRYTGCCAAGGCATCCACC]; Lim et al., "Use of PCR to detect
heliobacter pylori in gastric mucosa of patients" J. Clin. Micro.
41(7):3387 [5' ACTTTAAACGCATGAAGATAT with 5' ATATTTTGACCTTCTGGGGT];
and Wilson et al., 2003, "Use of PCR to detect Legionella
pneumophila" J. Clin. Micro. 41(7):3327 [5' GCAATGTCAACAGCAA with
5' CATAGCGTCTTGCATG].
[0111] Although the "Universal Amplification" method described
above is suited for use in MPD-based analyses, it will be
appreciated that this method can be used in a variety of formats
(both microfluidic and nonmicrofluidic).
[0112] vi) Pooling of Amplicons
[0113] In some embodiments of the invention, following
amplification and optional detection of amplicons, the contents of
the sub-samples, including any amplicons in them, are pooled (i.e.,
allowed to combine or mix at least partially). Pooling combines the
amplicons (if present) from multiple sub-samples. Pooling can be
accomplished by, for example, opening the valves of an elastomeric
microfluidic device in which partitioning and amplification
occurred such that the contents of multiple sub-samples (e.g., at
least about 10.sup.3, at least about 5.times.10.sup.3, at least
about 10.sup.4, at least about 2.times.10.sup.4, at least about
3.times.10.sup.4, or at least about 10.sup.5 sub-samples) are in
fluidic communication with each other, constituting a
"post-amplification sample" that consists of the contents of all of
the chambers. Amplicons can mix by diffusion, which can be
accelerated using thermal, mechanical, acoustic, or chemical
energy. In one embodiment, pooling occurs primarily as a result of
active mixing (e.g., by pumping the fluid through flow channels in
the device using a rotary peristaltic pump or other mechanism).
Alternatively or in combination with the methods above, a portion,
all or substantially all of the post-amplification sample can be
pumped out of or otherwise withdrawn from the device, thereby
pooling and mixing any amplicons present in the sample. Any method
that results in a distribution of amplicons sufficient to carry out
subsequent detection steps may be used.
[0114] It is not necessary that the various amplicons diffuse (or
are mixed) to equilibrium in the post-amplification sample, but it
is desirable that sufficient mixing occur so that an aliquot of
post-amplification sample contains a number of molecules of each
amplicon (e.g., at least 10, at least 100, at least 1000, or at
least 5000 molecules) from each sub-sample in which amplicons were
produced. For illustration, consider carrying out an amplification
reaction that produces 100,000 copies of each of three distinct
amplicons, i.e., amplicon A in chamber 1, amplicon B in chamber 2,
and amplicon C in chamber 3. The sub-samples are pooled (by
releasing valves) and one-fifth of the volume of the
post-amplification sample removed from the device or from the
partition region of the device (see Section C(viii), below). If the
amplicons had diffused to equilibrium in the post-amplification
sample, and assuming no loss of material, the one-fifth volume
would contain about 20,000 molecules of each of the three
amplicons. If diffusion was less than complete, the one-fifth
volume could contain unequal amounts of each amplicon, for example
50,000 molecules of amplicon A, 20,000 molecules of amplicon B and
15,000 molecules of amplicon C.
[0115] Alternatively, all or substantially all, of the
post-amplification sample (or substantially all of it) can be
withdrawn from the device, thereby mixing any amplicons present in
the sample.
[0116] vii) Subsequent Analysis of Amplicons
[0117] Following pooling (e.g., diffusion and/or mixing) all or a
portion of the amplicon pool can be used for subsequent analyses.
Typically the amplicon pool is divided into a plurality of aliquots
and each aliquot separately analyzed to determine a property (e.g.,
a nucleotide sequence or the presence or absence of a predetermined
nucleotide sequence) of an amplicon or amplicons in that aliquot.
If desired, the volume of the amplicon pool can be increased by
addition of a suitable solution such as aqueous buffer or a
reaction mixture containing amplification and/or detection
reagents. The amplicon pool can be divided into aliquots manually
or can be divided using an appropriately designed MPD (see Section
C(viii), below).
[0118] It will be apparent from the discussion above that each of
the aliquots from the amplicon pool will contain essentially the
same set of amplicons (i.e., the same amplicon species will be
represented in each aliquot). Each of the aliquots can be used for
a different analysis. For example, a first aliquot can be assayed
for the presence of a first target sequence (e.g., a first SNP in
an amplified gene sequence), a second aliquot can be assayed for
the presence of a second target sequence (e.g., a second SNP in the
same amplified gene sequence), a third aliquot can be assayed for
the presence of a third target sequence (e.g., a first SNP of a
different amplified gene) and so on. It will be appreciated that
target sequences of interest are not limited to SNPs.
[0119] The subsequent analysis of amplicons can be carried out
using any desired technique including, without limitation,
hybridization to a target nucleic acid or array of targets, PCR
amplification, FRET-assays, hybridization to probes, and the
like.
[0120] viii) Devices
[0121] As noted above, massive partitioning is accomplished using
an elastomeric MPD. Subsequent analyses can also be accomplished
using any suitable assay. In certain embodiments, an elastomeric
microfluidic device is used for subsequent analyses. In some
embodiments the initial partitioning and amplification, the
subsequent mixing of applications, and the subsequent analysis of
amplicons are carried out using different sections (i.e., different
banks) of the same the same device. For example, an elastomeric
device can be fabricated with three regions: a first region that is
a MPD in which target sequences, cells or molecules are amplified
in individual chambers to produce amplicons and then allowed to mix
to produce an amplicon pool, a second region (which can be as small
as a single flow channel) by which the amplicon pool is transferred
to the third region, and a third region having a plurality of flow
channels with a region of each flow channel defining a reaction
site in which subsequent analysis of the amplicon pool occurs. In
one embodiment, the flow channels in the third region are blind
flow channels with reaction sites near the channel terminus. A
schematic of an exemplary device is shown in FIG. 2. In this
schematic five control channels (1, 2, 3, 4 and 5) are shown in
black. A branched flow channel system is shown in gray. It will be
appreciated, as discussed above, that the flow channel
configuration need not be branched. In the device shown, a sample
containing an amplification mixture and nucleic acids is injected
into inlet A with the values formed by control channels 1 and 2
open, and control channel 3 actuated (closed). Control channel 2 is
then actuated to isolate the sample in multiple chambers (B). The
samples are then subject to thermocycling and optionally detection
of the amplification products (e.g., using a commercially available
fluorescence reader). Control channel 1 is then closed and control
channel 2 opened to allow mixing of amplicons in the various
chambers to produce an amplicon pool, a portion of which is then
pumped into blind channels (D) with control channels 3, 4 (if
present) and 5 open. Alternatively, control channels 2 and 3 are
both opened and a portion of the amplicon pool is pumped to a
mixing chamber (C) with control channel 4 closed. Control channel 3
is then closed and channels 4 and 5 are opened and portion of the
amplicon pool is pumped into blind channels (D). Control channel 5
is then closed isolating blind reaction chambers (E) and the
subsequent round of analysis takes place.
[0122] In one embodiment the device is configured so that reagents
can be added to the pooled amplicon sample; for example, the mixing
chamber (C) shown in FIG. 2 may be fluidically linked to a
reservoir containing reagents (e.g., nuclease, probes or primers)
that can be added prior to distributing the amplicon pool into a
reaction chambers.
[0123] ix) Systems
[0124] In one aspect, the invention provides a system for analysis
of nucleic acids, proteins or cells comprising a massively
partioning device and an external collection reservoir for
collection of an amplicon pool. The external reservoir can be any
type of container or tube that is fluidically connected to the MPD,
so that the contents of the MPD chambers can be transferred from
the MPD to the reservioir. Transfer can be by displacement of the
MPD contents using a displacement fluid, by active pumping, or by
other means.
[0125] In one aspect, the invention provides a system for analysis
of nucleic acids, proteins or cells comprising a massively
partitioning device, optionally including an integral or external
reservoir for collection of an amplicon pool, and an (additional)
external component. In one embodiment the MPD includes a region
with a plurality of flow channels defining a reaction sites for
subsequent analysis of the amplicon pool aliquots (e.g., the
"third" region of the device described above in Section (viii).
[0126] In one aspect, the invention provides a system for analysis
of nucleic acids, proteins or cells comprising a massively
partitioning device as described in Section (viii) above, where the
MPD has three regions: a first region that is a MPD in which target
sequences, cells or molecules are amplified in individual chambers
to produce amplicons and then allowed to mix to produce an amplicon
pool, a second region (which can be as small as a single flow
channel) by which the amplicon pool is transferred to the third
region, and a third region having a plurality of flow channels with
a region of each flow channel defining a reaction site in which
subsequent analysis of the amplicon pool occurs.
[0127] Additional external components of the system may include
sensors, actuators (e.g., pumps; see U.S. Pat. No. 6,408,878),
control systems for actuating valves, data storage systems, reagent
storage units (reservoirs), monitoring devices and signal detectors
Signal detectors may detect visible, fluorescent, and UV light
(intensity, scattering, absorption) luminescence, differential
reflectivity, electrical resistance, resistivity, impedance, or
voltage, in chambers or reaction sites. In one embodiment the
external component is a temperature control component such as a
thermocycler (e.g., Peltier device, resitive heaters, and heat
exchangers; see e.g., U.S. Pat. No. 6,960,437 B2).
[0128] In one aspect, the invention provides a system for analysis
of nucleic acids, proteins or cells comprising a massively
partitioning device, optionally including an integral or external
reservoir for collection of an amplicon pool, optionally including
a plurality of flow channels defining a reaction sites for
subsequent analysis of the amplicon pool aliquots, and optionally
including and an additional reagent positioned in the chambers of
the MPD and/or the reaction sites for subsequent analysis of the
amplicon pool aliquots. Exemplary additional reagents include
enzymes (e.g., nuclease, polymerase, or ligase); primers and probes
(PCR primers. molecular beacons, padlock probes, proximity ligation
probes, Universal Amplification primers), amplification reagents
and the like.
[0129] For illustration and not limitation, particular systems may
comprise an MPD and a heat source (e.g., thermocycler) positioned
to regulate the temperature of the contents of reaction chambers.
In one embodiment, heat is transmitted from the heat source to the
MPD by conduction (e.g., the heat source being adjacent and in
contact with the MPD). In one embodiment the MPD is fixed (e.g.,
clamped) to the heat source.
[0130] For illustration and not limitation, particular systems may
comprise an MPD and a signal detector positioned to detect signal
emanating from reaction chambers in the MPD system. In one
embodiment, a fluorescent signal is detected. In one embodiment the
system includes an appropriately programmed computer coupled to the
signal detector capable of storing information such as the
position, intensity and/or duration of a signal emanating from
reaction chambers in the MPD system.
[0131] For example, when the MPD comprises reaction chambers for
analysis of amplicon pool aliquots, the signal detector, heat
source, or other component of the system may be associated with
those reaction chambers, reaction chambers produced in the
partitioning step, or both. Other particular systems may comprise a
MPD comprising prepositioned reagents in one or more reaction
chambers or mixing chambers.
[0132] x) Illustrative Examples
[0133] The following prophetic examples are intended to illustrate
aspects of the invention. However, they are for illustration only
and are not intended to limit the invention in any fashion.
[0134] 1. SNP Analysis
[0135] In this illustration, 200 different genes of an individual
are screened for the presence of mutations.
[0136] A sample containing genomic DNA from the subject is
obtained. A small number of genome equivalents is sufficient for
analysis. Thus the sample may be from a small number of cells (for
example, fewer than 10 cells, and as few as one cell) which may be
treated to release and fragment genomic DNA. Alternatively isolated
or purified DNA may be used. Usually the DNA is fragmented by
shearing, enzymatic or chemical cleavage, or other methods known in
the art. In one embodiment the DNA is sheared by transport through
a channel with varying cross-dimensions.
[0137] The reagents for amplification of target sequences are added
to the sample. The amplification reagents include the
following:
[0138] a) Primer pairs for each of the 200 gene segments to be
analyzed. The primer pairs can be selected, for example, to (i)
amplify a target polymorphic site sequence only if site has a
particular sequence (i.e., a specified SNP allele is present) or
(ii) amplify the target polymorphic site sequence using primers
that flank the SNP site, so that the segment is amplified without
regard to what SNP is present. Each primer pair includes both a
target specific sequence and one of two 5' universal sequences
shared by all of the forward or all of the reverse primers,
allowing all of the amplicons produced using the target specific
primers to be amplified with the same universal primers.
[0139] b) A pair of universal primers capable of amplifying all of
the amplicons produced using the target specific primers.
[0140] Primers are selected so that all of the first round
amplifications (using target specific primers) can occur under the
same reaction conditions.
[0141] c) Amplification reagents (polymerase, cofactors,
nucleotides, metal ions, buffer, etc.). The reagents may be added
to the sample before partition, may be pre-positioned in the
reaction chambers, or some reagents may be added and others
pre-positioned.
[0142] The sample is injected into the partitioning channel system
of a MPD having 40,000 chambers. After injection of the sample,
valves are closed creating 40,000 isolated reaction chambers. Each
reaction chamber contains all of the probes described above, and
some of the chambers contain a nucleic acid molecule with a target
sequence of interest as a consequence of the partitioning. The MPD
is placed on a thermocycler and cycled using an appropriate
protocol (e.g., 2 min at 51.degree. C., 1 sec at 96.degree. C. and
59 sec at 95.degree. C., followed by 40 cycles of 1 min at
58.degree. C., 1 sec at 96.degree. C. and 59 sec at 95.degree. C.).
Following amplification, the values are opened and sub-samples
allowed to mix (e.g., by diffusion or active mixing) producing the
amplicon pool.
[0143] A portion of the resulting amplicon pool is withdrawn from
the MPD and distributed into two hundred (200) aliquots, and each
aliquot is subjected to a different SNP assay. Alternatively,
different sets of SNP assays can be conducted using multiplex
methods. The individual SNP assays can be carried out using, for
example, a Taqman.TM.-type probe, Molecular Beacon, Scorpion, or
other detection methods and detected using a fluorescence
detector.
[0144] 2. Analysis of Many Sequences Using Nucleic Acids from a
Single Cell or Very Few Cells
[0145] In one embodiment, a nucleic acid analysis is conducted on a
single cell. Such an analysis is useful for diagnostic or
prognostic methods when tissue is limited such as, for example,
genetic testing of a single blastocyst of a pre-implantation embryo
produced using in vitro fertilization techniques. Such testing is
also useful in the study or cloning of non-human animals. For
example, blastocyst cells obtained from a non-human animal can be
assayed for the presence, expression or characteristics of a
transgene or endogenous gene. It can be verified that the genotype
or expression profile of the embryo is consistent with the goals of
the researcher prior to implantation into a surrogate mother,
resulting in savings of time and resources. Such testing is also
useful in forensic analysis in which very few cells may be
available or in which cells must be analyzed individually because a
sample is contaminated with cells from multiple sources.
[0146] Analysis of nucleic acids of a single cell is illustrated by
the flow chart in FIG. 3C. It will be appreciated that the figure
is provided to assist the reader in understanding the invention,
and is not intended to limit the invention in any fashion.
[0147] In this method, the single cell (or small number of cells)
is provided in a solution or combined with a solution. The cell is
treated to release DNA. Any number of methods for cell lysis (e.g.,
using sonication, denaturants, etc.) are suitable. If genomic DNA
is being analyzed it is fragmented. The desired fragment size will
be based on the method of detection of the target sequence and the
number of reaction chambers on the chip. The goal is to end up with
large enough fragments so that target sequences can be amplified
(typically >300 bp) and enough fragments so that different
amplicons (i.e., amplicons corresponding to different sequences)
will be generated is separate reaction chambers. Thus, the intended
average size will depend on the number of target sequences to be
detected and the number of partitions available. Fragments can be
created by restriction digestion or other DNA fragmentation
methods. In one embodiment, DNA is sheared by driving it thorough a
narrow opening. Thus, a MPD can be designed with a via or flow
channel of sufficiently small diameter narrowness to shear DNA to
the desired fragment size. In an embodiment the diameter of the via
or flow channel varies across its length (e.g.,
narrow-wide-narrow-wide) to drive the fragmentation. The sample is
introduced into a WD and the MPD valves are actuated to partition
the DNA fragments, or RNA molecules, into separate reaction
chambers.
[0148] Reagents sufficient to amplify each of the target sequences
of interest are provided in each reaction chamber. For purposes of
this example, assume 50 different loci containing SNPs are of
interest, and at each of the 50 polymorphic loci there are two
different possible sequences at the SNP site, with the 100 total
different target sequences designated SNP 1A, 1B, 2A, 2B, . . .
50A, and 50B. As discussed above, the reagents can be added to the
solution containing the intact cell, can be prelocated in the
reaction chambers, or some combination of the two. In this example,
the amplification reagents include primers sufficient to amplify
gene segments spanning each of the 50 loci to produce the SNP site
and 40 basepairs of flanking sequence on each side. UA
amplification primers may be used. Amplification is then carried
out (e.g., by thermocycling if the amplification method is PCR or
reverse transcription-P CR). Amplicons are produced in those
reaction chambers that contain a nucleic acid molecule (i.e., DNA
fragment or RNA molecule) comprising one of the target
sequences.
[0149] As described above, following amplification the valves are
opened and amplicons allowed to mix to produce an amplicon pool.
The pool is than divided into 100 different aliquots (optionally
using a duel bank MPD as described in Section C(viii), above). In
each aliquot a single assay is carried out for an individual SNP
using, for example, a Taqman.TM.-type probe, Molecular Beacon,
Scorpion, or other detection methods known in the art.
[0150] 3. Detection of Pathogens Using the UA System
[0151] In this illustration, a sample is assayed for the presence
of 150 different pathogens. Exemplary samples for the method
include (i) a sample is obtained from a patient, (ii) an
environmental sample (e.g., from a pond or reservoir) and (iii) a
sample from a poultry processing facility.
[0152] The reagents for amplification of target sequences are added
to the sample. The amplification reagents include the
following:
[0153] a) Fifty UA primer pairs for gene segments found in fifty
different bacterial pathogens. The forward primer of these UA
primer pairs includes a recognition site for a molecular beacon
labeled with the blue fluorescing dye Cy 5.5.
[0154] b) Fifty UA primer pairs for gene segments found in fifty
different fungal pathogens. The forward primer of these UA primer
pairs includes a recognition site for a molecular beacon labeled
with the green fluorescing dye 6-FAM (Fluorescein).
[0155] c) Fifty UA primer pairs for gene segments found in fifty
different viral pathogens. The forward primer of these UA primer
pairs includes a recognition site for a molecular beacon labeled
with the red fluorescing dye Cy 3.
[0156] d) Type 3 and Type 4 primers corresponding to the UA primer
pairs Primers 5'-U.sub.A-3' and 5'-U.sub.B-3'.
[0157] Prinmer sequences are selected so that all of the UA primer
pairs produce amplicons that can be amplified using the same Type 3
and Type 4 primers; and all of the first round amplifications can
occur under the same reaction conditions.
[0158] e) Molecular beacons that recognize the recognition sites of
the three UA forward primers and are labeled as indicated
above.
[0159] f) Amplification reagents (polymerase, cofactors,
nucleotides, metal ions, buffer, etc.). The reagents may be added
to the sample before partition, may be prepositioned in the
reaction chambers, or some reagents may be added and others
prepositioned.
[0160] The sample is injected into the partitioning channel system
of a MPD having 40,000 chambers. After injection of the sample each
valves are closed creating 40,000 isolated reaction chambers. Each
reaction chamber contains all of the probes described above, and
some of the chambers contain a nucleic acid molecule with a target
sequence of interest. The MPD is placed on a thermocycler and
cycled using an appropriate protocol (e.g., 2 min at 51.degree. C.,
1 sec at 96.degree. C. and 59 sec at 95.degree. C., followed by 40
cycles of 1 min at 58.degree. C., 1 sec at 96.degree. C. and 59 sec
at 95.degree. C.). Following amplification, the device is imaged
using a commercially available, modified, or custom made
fluorescence reader.
[0161] The appearance of chambers fluorescening blue indicates that
there is at least one bacterial pathogen present in the sample. The
appearance of chambers fluorescening green indicates that there is
at least one fungal pathogen present in the sample. The appearance
of chambers fluorescesing red indicates that there is at least one
viral pathogen present in the sample.
[0162] If none of the chambers is emits blue, green or red
fluorescence when illuminated at the proper wavelengths this is an
indication that none of the pathogens tested for are present
(typically assays would also include a positive control). If,
however, red fluorescence was detected, this would be an indication
that a virus is present. Further testing could then be carried out
to identify the viral pathogen. For further testing, the values of
the MPD are opened and sub-samples allowed to pool by diffusion or
active mixing, producing the amplicon pool. A portion of the
resulting amplicon pool is withdrawn from the MPD and divided into
fifty (50) aliquots each containing reagents for identification of
one of the 50 viruses assayed for in the initial part of the
screen. An exemplary detection method uses 50 molecular beacons
(one in each aliquot) that each recognize a different virus
specific sequence in the amplicon. By determining which of the
molecular beacons bind a target sequence present in the amplicon
pool (or the portion contained in an aliquot) the identity of the
pathogen is determined.
[0163] 4. Additional Applications
[0164] It will be appreciated to the reader that the methods of the
invention can be used in many applications not specifically
described, including, for example and not limitation, detection of
gene mutations (substitutions, deletions, translocations,
amplifications, etc.) in samples from cancer patients and others.
Many of these assays can be carried out without using the optional
pooling step and subsequent analysis steps.
D. Partitioning, Detection and Analysis of Proteins and Other
Biomolecules
[0165] Proteins and other biomolecules can be partitioned in a
manner analogous to that described above for nucleic acid
molecules. Any suitable method can be used to produce an
amplification product indicative of the presence of a protein. In
one method, a proximity ligation procedure is used. The proximity
ligation procedure is analogous in certain respects to the use of
padlock probes, described above in Section C, but is used for
detecting proteins and other analytes. The proximity ligation
procedure uses specific protein binding agents linked to
oligonucleotides. Examples of specific protein binding agents
include, but are not limited to, antibodies (defined as any
specific binding agent comprising a CDR, including phage display
antibodies, single chain antibodies, monoclonal antibodies, and the
like) and nucleic acid aptamers. The proximity ligation procedure
is described in Landegren et al., 2003, supra; Landegren et al.,
2004, Molecular tools for a molecular medicine: analyzing genes,
transcripts and proteins using padlock and proximity probes, J Mol
Recognit. 7:194-7; Gullberg et al., 2004, Cytokine detection by
antibody-based proximity ligation, Proc Natl Acad Sci USA
101(22):8420-4; Fredriksson et al., 2002, Protein detection using
proximity-dependent DNA ligation assays, Nat Biotechnol. 20:448-9;
and Landegren, 2002, Methods and kits for proximity probing United
States Patent Application 20020064779. Briefly, a pair of protein
binding agents that recognize different epitopes of a target
protein are used. Each of the binding agents is attached (e.g., via
streptavidin-biotin linkage) to a synthetic DNA strand that
includes a PCR primer binding site. The synthetic DNA strands are
brought into proximity when both binding agents bind the same
target molecule. A connector oligonucleotide that hybridizes to
sequences at the ends of both of the synthetic DNAs is added in
excess, bringing termini of the DNA strands together so that they
can be joined by ligase. In the presence of PCR reagents and
primers that recognize the primer binding sites on the two DNA
strands, a region of the ligated sequence may be amplified and
detected by real time PCR. In contrast, unligated strands are not
amplified and therefore not detected in the assay.
[0166] It will be appreciated that the assay also may be used to
assay for non-protein molecules that are specifically bound by a
nucleic acid aptamer, antibody or other binding agent. Proximity
ligation methods can also be used to detect nucleic acid targets.
In this approach, nucleotide sequences complementary to the target
are used rather than protein binding agents.
E. Partitioning of Cells
[0167] In another aspect of the invention, individual cells are
isolated by partitioning using a MPD, and one or more properties of
one or more of the individual cells are determined. Using this
method, analysis of individual cells can be carried out without
background from other cells in a sample.
[0168] Virtually any property of an individual cell can be assayed.
For illustration, cell properties include
[0169] the presence or absence of a target nucleic acid sequence in
the cell (where the nucleic acid is RNA or DNA; recombinant or
naturally occurring; cellular or viral; nuclear, cytoplasmic or
from an organelle);
[0170] the presence or absence of a protein or epitope in the cell
or on the cell surface;
[0171] secretion by the cell of a protein or non-protein molecule,
for example in response to a stimulus;
[0172] metabolic reactions or changes in cell metabolism, for
example in response to a stimulus;
[0173] other properties of cells (which will be recognized by those
of skill in the art);
[0174] combinations of two, three, or more than three different
properties (e.g., the presence in a cell of two different target
nucleic acid sequences; the presence in a cell of a target nucleic
acid sequence and a protein epitope; a change in a metabolic
property of a cell and expression of a nucleic acid sequence in the
cell; a cell surface epitope and secretion of a cytokine by the
cell in response to a stimulus, etc.).
[0175] For this analysis, a liquid sample containing a plurality of
separable cells is introduced into the MPD and the cells
partitioned. A "separable cell" is a cell that is physically
separated from other cells and can be partitioned into a chamber
without other cells. In some cases (e.g., blood cells, lymphocytes,
spermatocytes, oocytes, yeast, certain bacteria or other
microorganisms) seperable cells can be obtained from a patient or
other source with little processing. In other cases (e.g., liver
biopsy, cultured cells, blastocyte) it will be necessary to disrupt
a tissue or aggregate mechanically, enzymatically, or using other
methods well known in the art. See, e.g., Ausubel et al., 2004,
Current Protocols In Molecular Biology, Greene Publishing and
Wiley-Interscience, New York; Chapter 25. Examples of cells that
can be assayed in this method include eukaryotic cells, human
cells, animal cells, plant cells, fetal cells, embryonic cells,
stem cells, blood cells, lymphocytes, bacterial cells, recombinant
cells and cells infected with a pathogen. Further, although this
section describes analysis of cells, the reader will appreciate
that the same methods can be used for analysis of other biological
entities, such as viruses and organelles.
[0176] In one aspect, the method includes partitioning a sample
comprising a plurality of seperable cells into at least 10.sup.3
separate reaction chambers in an MPD, where after partitioning at
least two chambers comprise exactly one cell each. Often the sample
is partitioned into at least 10.sup.4 separate reaction chambers,
at least 2.times.10.sup.4 separate reaction chambers or at least
3.times.10.sup.4 separate reaction chambers. The number of cells
introduced into the MPD and/or the number of chambers in the MPD
are selected so that most or virtually all of the chambers contain
either no cells or a single cell. This can be determined from the
Poisson distribution (based on the number of chambers in the device
and number of cells injected into the device) or empirically (e.g.,
by detecting the number of chambers that contain cells). Usually at
least 90% of the chambers contain zero or one cell, often at least
99% of the chambers contain zero or one cell, and in some cases
virtually all of the chambers contain zero or one cell.
[0177] Each of the plurality of chambers contains the same reagents
for conducting the analysis. All or some of these reagents can
added to the sample or cells prior to injection into the device
and/or can be prepositioned in the chambers and/or provided in
inactive form, as described above. Because the reagents are
constant, any chamber-to-chamber differences in analytical results
are due to the presence of different cells (or no cell) and reflect
differences in the properties of the cells. By detecting different
signals from different chambers, a property or properties of cells
in chambers can be determined and compared. This method finds a
variety of applications in which it is informative to determine
that a sample contains a cell having two or more properties
detectable in separate assays. This method also finds a variety of
applications in which the cell of interest is a rare cell in a
background of many other cells.
[0178] The nature or type of reagents used will depend on the type
of assay contemplated and specific properties to be detected.
Generally the properties that can be assayed can be divided into
two groups: properties determined based on the presence or absence
of a nucleic acid target sequence and properties determined based
on something other than the presence or absence of a nucleic acid
target sequence. In many applications both a nucleic acid analysis
and detection of a different type of property are carried out.
[0179] In embodiments in which the analysis of cell properties
includes a detecting a nucleic acid sequence (i. e., one, two or
more target sequences are detected for an isolated cell) reagents
suitable for nucleic acid analysis include those used for nucleic
acid amplification (including but not limited to the PCR, SPIA,
Invader, and other amplification methods described in this
disclosure or known in the art) and those used for detection
(including but not limited to, FRET based methods and other
detection methods described in this disclosure or known in the
art). In one embodiment the UA amplification/detection methods
described in Section C(v) are used.
[0180] Methods are known in the art for assay of a multitude of
cell properties other than or in addition to the characteristics of
nucleic acids. For example, proximity ligation and FRET-based
assays can be used to detect the presence of proteins or epitopes
in a cell; presence, activation or change in enzymatic activities;
intracellular organelle function; pathogen (e.g., viral) infection;
intracellular signaling; protein-protein interactions; protein-DNA
interactions; colocalization of proteins cell cycle; metabolic
reactions such as generation of reactive oxygen species;
mitochondrial membrane potential; apotosis; intracellular organelle
function; changes in representations of cell types in cell
populations; and subcellular localization of macromolecules.
[0181] In some embodiments of the invention the cell(s) is
destroyed in the course of the process of detecting the cell
property. Alternatively, numerous fluorescence based assays that
can be carried out on living cells can readily be adapted for use
in the present invention and/or reagents used in such assays may be
used in the methods of the present invention. See, e.g., Dirks et
al., 2003, Visualizing RNA molecules inside the nucleus of living
cells, Methods, 29:51-7; Santangelo et al., 2004, Dual FRET
molecular beacons for mRNA detection in living cells, Nucleic Acids
Res. 32:e57; Awais et al., 2004, A genetically encoded fluorescent
indicator capable of discriminating estrogen agonists from
antagonists in living cells, Anal Chem., 76:2181-6; Nohe et al.,
2004, Analyzing for co-localization of proteins at a cell membrane,
Curr Pharm Biotechnol., 5:213-20; Thoren et al., 2004, Membrane
binding and translocation of cell-penetrating peptides,
Biochemistry, 43:3471-89; Balaji et al., 2004, Live cell
ultraviolet microscopy: a comparison between two- and three-photon
excitation, Microsc Res Tech, 63:67-71; Gardiner, 2002, Spatial and
temporal analysis of Rac activation during live neutrophil
chemotaxis, Curr Biol. 12:2029-34; Moshinsky et al., 2003, A Widely
Applicable, High-Throughput TR-FRET Assay for the Measurement of
Kinase Autophosphorylation: VEGFR-2 as a Prototype Journal of
Biomolecular Screening, 8:447-452; U.S. Pat. Nos. 4,822,733,
5,622,821, 5,639,615, and 5,656,433 [describing the Invitrogen
LanthaScreen.TM. TR-FRET Kinase Assays for Tyrosine and
Serine/Threonine Kinases]; Zhang et al., (2004), Detection of
mitochondrial caspase activity in real time in situ in live cells,
Microsc Microanal., 10:442-8; Martin-Fernandez et al., 2004,
Adenovirus type-5 entry and disassembly followed in living cells by
FRET, fluorescence anisotropy, and FLIM, Biophys J., 87:1316-27;
Zorov et al., 2004, Examining intracellular organelle function
using fluorescent probes: from animalcules to quantum dots, Circ
Res., 95:239-52; Mongillo et al., 2004, Fluorescence resonance
energy transfer-based analysis of cAMP dynamics in live neonatal
rat cardiac myocytes reveals distinct functions of
compartmentalized phosphodiesterases, Circ Res., 95:67-75, Chigaev
et al., 2004, Conformational regulation of alpha 4 beta 1-integrin
affinity by reducing agents. "Inside-out" signaling is independent
of and additive to reduction-regulated integrin activation, J Biol
Chem., 279:32435-43; Zaccolo et al., 2004, Use of
chimericfluorescent proteins and fluorescence resonance energy
transfer to monitor cellular responses, Circ Res., 94:866-73; Nohe
et al., 2004, Analyzing for co-localization of proteins at a cell
membrane, Curr Pharm Biotechnol., 5:213-20; Thoren et al., 2004,
Membrane binding and translocation of cell-penetrating peptides,
Biochemistry, 43:3471-89; Balaji et al., 2004, Live cell
ultraviolet microscopy: a comparison between two- and three-photon
excitation, Microsc Res Tech., 63:67-71; Gardiner, 2002, Spatial
and temporal analysis of Rac activation during live neutrophil
chemotaxis, Curr Biol., 12:2029-34.
[0182] In addition, many cell-based assays developed for use in
Laser Scanning Cytometry technology (e.g., CompuCyte Corp.,
Cambridge, Mass.) can be readily adapted for use in the methods of
the invention and/or regents used in such assays may be used in the
methods of the present invention. See, e.g., Adams et al., 2004,
Increase of Circulating Endothelial Progenitor Cells in Patients
With Coronary Artery Disease After Exercise-Induced Ischemia,
Arterioscler. Thromb. Vasc. Biol.; Akimitsu et al., 2003, Enforced
cytokinesis without complete nuclear division in embryonic cells
depleting the activity of DNA topoisomerase IIalpha, Genes Cells,
8:393-402; Amirlak and Couldwell, 2003, Apoptosis in glioma cells:
review and analysis of techniques used for study with focus on the
laser scanning cytometer, J Neurooncol., 63:129-45; Balmer et al.,
2003, Elevated methyl-CpG-binding protein 2 expression is acquired
during postnatal human brain development and is correlated with
alternative polyadenylation, J Mol Med., 81:61-8; Baskin et al.,
2003, Thimerosal Induces DNA Breaks, Caspase-3 Activation, Membrane
Damage, and Cell Death in Cultured Human Neurons and Fibroblasts,
Toxicol. Sci., 74:361-368; Beliakoff et al., 2003,
Hormone-Refractory Breast Cancer Remains Sensitive to the Antitumor
Activity of Heat Shock Protein 90 Inhibitors, Clin Cancer Res.,
9:4961-4971; Bocsi et al., 2004, Scanning fluorescent microscopy
analysis is applicable for absolute and relative cell frequency
determinations, Cytometry, 61A:1-8; Bollmann et al., 2003,
Determination of features indicating progression in atypical
squamous cells with undetermined significance, Cancer, 99:113-7;
Bollmann, et al., 2003, Human papillomavirus typing and DNA ploidy
determination of squamous intraepithelial lesions in liquid-based
cytologic samples, Cancer, 99:57-62; Braunschweig et al., 2004,
X-chromosome inactivation ratios affect wild-type MeCP2 expression
within mosaic Rett syndrome and Mecp2.+-. mouse brain, Hum. Mol.
Genet., 13:1275-86; Brower, 2003, Evidence of Efficacy: Researchers
Investigating Markers for Angiogenesis Inhibitors, J Natl Cancer
Inst., 95:1425-1427; Cai et al., 2003, Toxicity of Acetaminophen,
Salicylic Acid, and Caffeine for First-Passage Rat Renal Inner
Medullary Collecting Duct Cells, J. Pharmacol. Exp. Ther.,
306:35-42; Cheng et al., 2003, Immunocytochemical analysis of
prostate stem cell antigen as adjunct marker for detection of
urothelial transitional cell carcinoma in voided urine specimens, J
Urol., 169:2094-100; Chung et al., 2003, Tea and Cancer Prevention:
Studies in Animals and Humans, J. Nutr., 133:3268S-3274S; Claytor
et al., 2003, The cleaved peptide of PAR1 is a more potent
stimulant of platelet-endothelial cell adhesion than is thrombin, J
Vasc Surg., 37:440-5; Crowder et al., 2004, PML mediates IFN{alpha}
induced apoptosis in myeloma by regulating TRAIL induction, Blood;
Cummins et al., 2003, Persistent Localization of Activated
Extracellular Signal-Regulated Kinases (ERK1/2) Is Epithelial
Cell-Specific in an Inhalation Model of Asbestosis, Am J Pathol.,
162:713-20; D'Amico et al., 2003, The Role of Ink4a/Arf in ErbB2
Mammary Gland Tumorigenesis, Cancer Res., 63:3395-3402; Davis et
al., 2003, Automated quantification of apoptosis after neoadjuvant
chemotherapy for breast cancer: early assessment predicts clinical
response, Clin Cancer Res., 9:955-60; Davis et al., 2003, Surrogate
markers in antiangiogenesis clinical trials, Br J Cancer, 89:8-14;
Davis, et al., 2003, Antiangiogenic tumor therapy, Biotechniques,
34:1048-50, 1052, 1054 passim; Davis et al., 2004, Quantitative
Analysis of Biomarkers Defines an Optimal Biological Dose for
Recombinant Human Endostatin in Primary Human Tumors, Clin. Cancer
Res., 10:33-42; Denmeade et al., 2003, Prostate-Specific
Antigen-Activated Thapsigargin Prodrug as Targeted Therapy for
Prostate Cancer, J Nat Cancer Inst., 95:990-1000; Dmitrieva et al.,
2003, High NaCl causes Mre11 to leave the nucleus, disrupting DNA
damage signaling and repair, Am J Physiol Renal Physiol.,
285:F266-274; Dmitrieva et al., 2004, Cells adapted to high NaCl
have many DNA breaks and impaired DNA repair both in cell culture
and in vivo, PNAS, 101:2317-2322; Doyle et al., 2004, Toll-like
Receptors Induce a Phagocytic Gene Program through p38, J. Exp.
Med., 199:81-90; Fortunel et al., 2003, Long-term expansion of
human functional epidermal precursor cells: promotion of extensive
amplification by low TGF-{beta}1 concentrations, J. Cell Sci.,
116:4043-4052; Foster et al., 2004, Laser scanning cytometry for
the detection of neoplasia in urologic cytology specimens, Cancer,
102:115-23; Furuta et al., 2003, Phosphorylation of Histone H2AX
and Activation of Mre11, Rad50, and Nbs1 in Response to
Replication-dependent DNA Double-strand Breaks Induced by Mammalian
DNA Topoisomerase I Cleavage Complexes, J. Biol. Chem.,
278:20303-20312; Furuya et al., 2004, A Novel Technology Allowing
Immunohistochemical Staining of a Tissue Section with 50 Different
Antibodies in a Single Experiment, J. Histochem. Cytochem.,
52:205-210; Gerstner et al., 2004, Eosinophilia in nasal polyposis:
its objective quantification and clinical relevance, Clin Exp
Allergy, 34:65-70; Gerstner et al., 2003, Analysis of ploidy in
hypopharyngeal cancer by laser scanning cytometry on fine needle
aspirate biopsies, Anal Cell Pathol., 25:51-62; Gerstner et al.,
2003, Slide-based cytometry for predicting malignancy in solid
salivary gland tumors by fine needle aspirate biopsies, Cytometry,
53B:20-5; Gerstner et al., 2004, Quantitative histology by
multicolor slide-based cytometry, Cytometry, 59A:210-9; Gniadecki,
and Bang, 2003, Flotillas of Lipid Rafts in Transit Amplifying
Cell-Like Keratinocytes, J. Invest. Dermatol., 121:522-528;
Gniadecki and Rossen, 2003, Expression of T-cell activation marker
CD134 (OX40) in lymphomatoid papulosis, Br J Dermatol., 148:885-91;
Greene et al., 2004, Secretory Leucoprotease Inhibitor Impairs
Toll-Like Receptor 2- and 4-Mediated Responses in Monocytic Cells,
Infect. Immun., 72:3684-3687; Griffin et al., 2003, Neutrophil
elastase up-regulates human beta-defensin-2 expression in human
bronchial epithelial cells, FEBS Lett., 546:233-6; Gui and Zheng,
2003, Epidermal Growth Factor Induction of Phenotype-dependent Cell
Cycle Arrest in Vascular Smooth Muscle Cells Is through the
Mitogen-activated Protein Kinase Pathway, J. Biol. Chem.,
278:53017-53025; Haider et al., 2003, Dual Functionality of
Cyclooxygenase-2 as a Regulator of Tumor Necrosis Factor-Mediated
G1 Shortening and Nitric Oxide-Mediated Inhibition of Vascular
Smooth Muscle Cell Proliferation, Circulation, 108:1015-1021;
Haider et al., 2003, In vitro model of "wound healing" analyzed by
laser scanning cytometry: Accelerated healing of epithelial cell
monolayers in the presence of hyaluronate, Cytometry, 53A:1-8;
Heitnann et al., 2003, Solution structure of the matrix attachment
region-binding domain of chicken MeCP2, Eur. J. Biochem.,
270:3263-3270; Hennerbichler et al., 2003, Fetal nucleated red
blood cells in peripheral blood of pregnant women: detection and
determination of location on a slide using laser-scanning
cytometry, Prenat Diagn., 23:710-5; Heymach et al., 2004, Phase II
study of the antiangiogenic agent SU5416 in patients with advanced
soft tissue sarcomas, Clin Cancer Res., 10:5732-40; Hirabayashi et
al., 2004, The Wnt/{beta}-catenin pathway directs neuronal
differentiation of cortical neural precursor cells, Development,
131:2791-181; Huang et al., 2004, Histone H2AX phosphorylation
induced by selective photolysis of BrdU-labeled DNA with UV light:
Relation to cell cycle phase, Cytometry, 62A:1-7; Huang et al.,
2004, Assessment of histone H2AX phosphorylation induced by DNA
topoisomerase I and II inhibitors topotecan and mitoxantrone and by
the DNA cross-linking agent cisplatin, Cytometry, 58A:99-110; Huang
et al., 2003, DNA Damage Induced by DNA Topoisomerase I- and
Topoisomerase IIInhibitors Detected by Histone H2AX Phosphorylation
in Relation to the Cell Cycle Phase and Apoptosis, Cell Cycle,
2:614-9; Isaka et al., 2003, Chromosomal Variations Within
Aneuploid Cancer Lines, J. Histochem. Cytochem., 51:1343-1353;
Johnson et al., 2004, Aluminum-Maltolate Induces Apoptosis and
Necrosis in Neuro-2a Cells: Potential Role for p53 Signaling,
Toxicol Sci., 83(2):329-39; Kamat et al., 2004, The proteasome
inhibitor bortezomib synergizes with gemcitabine to block the
growth of human 253JB-V bladder tumors in vivo, Mol. Cancer Ther.,
3:279-290; Kang et al., 2003, Analysis of tyrosine phosphorylation
in resident peritoneal cells during diet restriction by laser
scanning cytometry, Shock, 19:238-44; Kang et al., 2003, Brief
refeeding rapidly reverses dietary restriction-induced nuclear
factor-kappaB downregulation inperitoneal resident cells, JPEN J
Parenter Enteral Nutr, 27:193-7 and discussion, 197; Kawamura et
at, 2003, Centrosome hyperamplification and chromosomal instability
in bladder cancer, Eur Urol. 43:505-15; Kawasaki et al., 2003,
11q23-24 loss is associated with chromosomal instability in
endometrial cancer, Int J Mol Med., 12:727-31; Kobie et al., 2003,
Transforming Growth Factor {beta} Inhibits the Antigen-Presenting
Functions and Antitumor Activity of Dendritic Cell Vaccines, Cancer
Res., 63:1860-1864.; Kolek et al., 2003, Antiproliferative and
apoptotic effect of TGF-beta 1 in bovine mammary epithelial BME-UV1
cells, Comp Biochem Physiol C Toxicol Pharmacol., 134:417-30; Kolek
et al., 2003, Co-localization of apoptosis-regulating proteins in
mouse mammary epithelial HC11 cells exposed to TGF-beta1, Eur J
Cell Biol., 82:303-12; Kranc et al., 2003, Transcriptional
Coactivator Cited2 Induces Bmi1 and Mel18 and Controls Fibroblast
Proliferation via Ink4a/ARF, Mol. Cell. Biol., 23:7658-7666;
Kriaucionis and Bird, 2003, DNA methylation and Rett syndrome, Hum.
Mol. Genet., 12:221R-227R; Kulkarni et al., 2004, Micropatterning
of endothelial cells by guided stimulation with angiogenic factors,
Biosens Bioelectron., 19:1401-7; Lamas et al., 2003, Quantitative
Fluorescence Imaging Approach for the Study of Polyploidization in
Hepatocytes, J. Histochem. Cytochem., 51:319-330; Lima and Kultz,
2004, Laser scanning cytometry and tissue microarray analysis of
salinity effects on killifish chloride cells, J Exp Biol.,
207:1729-39; Lin et al., 2004, Evaluation of adipocyte apoptosis by
laser scanning cytometry, Int J Obes Relat Metab Disord.,
28:1535-40; Ma et al., 2003, E2FBP1/DRIL1, an AT-Rich Interaction
Domain-Family Transcription Factor, Is Regulated by p53, Mol.
Cancer Res., 1:438-444; Maruvada et al., 2004, Cell cycle-dependent
expression of thyroid hormone receptor-{beta} is a mechanism for
variable hormone sensitivity, Mol. Biol. Cell, 15:1895-903; Masiuk
et al., 2004, Simultaneous measurement of nucleolin and estrogen
receptor in breast cancer cells by laser scanning cytometry,
Anticancer Res., 24:963-6; Mazur et al., 2003, Induction of
apoptosis in bone marrow cells after treatment of mice with WR-2721
and gamma-rays: relationship to the cell cycle, Cell Biol Toxicol.,
19.13-27; Medina et al., 2003, LAV694, a new antiproliferative
agent showing improved skin tolerability vs. clinical standards for
the treatment of actinic keratosis, Biochem Pharmacol., 66:1885-95;
Megyeri et al., 2004, Laser Scanning Cytometry for selection of
green fluorescent protein transgenic mice using small number of
blood cells, J Biochem Biophys Methods, 61:183-7; Miyaji-Yamaguchi
et al., 2003, Involvement of Nucleocytoplasmic Shuttling of Yeast
Nap1 in Mitotic Progression, Mol. Cell. Biol., 23:6672-6684;
Mocellin et al., 2003, Use of laser scanning cytometry to study
tumor microenvironment, Histol Histopathol., 18:609-15; Moos et
al., 2004, Curcumin impairs tumor suppressor p53 function in colon
cancer cells, Carcinogenesis, 25:1611-7; Morales et al., 2003, Role
for the BRCA1 C-terminal Repeats (BRCT) Protein 53BP1 in
Maintaining Genomic Stability, J. Biol. Chem. 278:14971-14977.;
Nawrocki et al., 2004, The proteasome inhibitor bortezomib enhances
the activity of docetaxel in orthotopic human pancreatic tumor
xenografts, Mol. Cancer Ther., 3:59-70; Oleinik and Krupenko, 2003,
Ectopic Expression of 10-Formyltetrahydrofolate Dehydrogenase in
A549 Cells Induces G1 Cell Cycle Arrest and Apoptosis, Mol. Cancer
Res., 1:577-588; Oswald et al., 2004, Mesenchymal Stem Cells Can Be
Differentiated Into Endothelial Cells In Vitro, Stem Cells,
22:377-384; Oswald et al., 2004, Comparison of flow cytometry and
laser scanning cytometry for the analysis of CD34+ hematopoietic
stein cells, Cytometry, 57A: 100-7; Pfau et al., 2004,
Environmental oxygen tension affects phenotype in cultured bone
marrow-derived macrophages, Am J Physiol Lung Cell Mol Physiol.,
286:L354-62; Pina-Vaz et al., 2004, Novel Method Using a Laser
Scanning Cytometer for Detection of Mycobacteria in Clinical
Samples, J. Clin. Microbiol., 42:906-908; Pozarowski et al., 2003,
Cell Cycle Effects and Caspase-Dependent and Independent Death of
HL-60 and Jurkat Cells Treated with the Inhibitor of NF-kappaB
Parthenolide, Cell Cycle, 2:377-83; Pozarowski et al., 2004,
Simple, semiautomatic assay of cytostatic and cytotoxic effects of
antitumor drugs by laser scanning cytometry: Effects of the
bis-intercalator WP631 on growth and cell cycle of T-24 cells,
Cytomet, 57A:113-9; Pullen et al., 2003, The flame retardants
tetrabromobisphenol A and tetrabromobisphenol A-bisallylether
suppress the induction of interleukin-2 receptor alpha chain (CD25)
in murine splenocytes, Toxicology, 184:11-22; Reed et al., 2004,
Mutation of hCDC4 Leads to Cell Cycle Deregulation of Cyclin E in
Cancer, Cancer Res., 64:795-800; Roth et al., 2003, Effects of
epithelial growth factor receptor (EGFR) kinase inhibitors on
genetically reconstituted mouse mammary glands, Exp Toxicol
Pathol., 55:237-45; Samaco et al., 2004, Multiple pathways regulate
MeCP2 expression in normal brain development and exhibit defects in
autism-spectrum disorders, Hum. Mol. Genet., 13:629-39; Schumann et
al., 2003, Parenchymal, But Not Leukocyte, TNF Receptor 2 Mediates
T Cell-Dependent Hepatitis in Mice, J. Immunol., 170:2129-2137;
Schwartz et al., 2004, Inhibition of experimental tobacco
carcinogen induced head and neck carcinogenesis, Oral Oncol.,
40:611-23; Schwartz et al., 2003, Oral cytology assessment by flow
cytometry of DNA adducts, aneuploidy, proliferation and apoptosis
shows differences between smokers and non-smokers, Oral Oncol.,
39:842-54; Shackney et al., 2004, A suitable method for identifying
cell aggregates in laser scanning cytometry listmode data for
analyzing disaggregated cell suspensions obtained from human
cancers, Cytomery, 59B:10-23; Shackney et al., 2004, Intracellular
Patterns of Her-2/neu, ras, and Ploidy Abnormalities in Primary
Human Breast Cancers Predict Postoperative Clinical Disease-Free
Survival, Clin. Cancer Res., 10:3042-3052; Shakhman et al.,
2003,
Induction by {beta}-bungarotoxin of apoptosis in cultured
hippocampal neurons is mediated by Ca2+-dependent formation of
reactive oxygen species, J. Neurochem., 87:598-608; Shibata et al.,
2004, Lovastatin inhibits tumor growth and lung metastasis in mouse
mammary carcinoma model: a p53-independent mitochondrial-mediated
apoptotic mechanism. Carcinogenesis 25:1887-98; Smith et al., 2003,
LFA-1-induced T cell migration on ICAM-1 involves regulation of
MCK-mediated attachment and ROCK-dependent detachment, J. Cell
Sci., 116:3123-3133; Smolewska et al., 2003, Apoptosis of
peripheral blood lymphocytes in patients with juvenile idiopathic
arthritis, Ann. Rheum. Dis., 62:761-763; Smolewski et a., 2003,
Caspase-mediated cell death in hematological malignancies:
theoretical considerations, methods of assessment, and clinical
implications, Leuk Lymphoma, 44:1089-104; Strasberg Rieber et a.,
2004, Tumor apoptosis induced by ruthenium(II)-ketoconazole is
enhanced in nonsusceptible carcinoma by monoclonal antibody to EGF
receptor, Int J Cancer 112:376-84; Strife et al., 2003, Direct
Evidence That Bcr-Abl Tyrosine Kinase Activity Disrupts Normal
Synergistic Interactions Between Kit Ligand and Cytokines in
Primary Primitive Progenitor Cells, Mol. Cancer Res., 1:176-185;
Szodoray et al., 2003, Programmed cell death in rheumatoid
arthritis peripheral blood T-cell subpopulations determined by
laser scanning cytometry, Lab Invest., 83:1839-48; Takemoto et al.,
2004, Cell Cycle-dependent Phosphorylation, Nuclear Localization,
and Activation of Human Condensin, J. Biol. Chem., 279:4551-4559;
Takita et al., 2003, An analysis of changes in the expression of
cyclins A and B1 by the cell array system during the cell cycle:
Comparison between cell synchronization methods, Cytometry,
55A:24-9; Tamamori-Adachi et al., 2003, Critical Role of Cyclin D1
Nuclear Import in Cardiomyocyte Proliferation, Circ. Res.,
92:12e-19; Tamamori-Adachi et al., 2004, Down-regulation of p27Kip1
promotes cellproliferation of rat neonatal cardiomyocytes induced
by nuclear expression of cyclin D1 and CDK4. Evidence for impaired
Skp2-dependent degradation of p27 in terminal differentiation, J
Biol Chem., 279:50429-36; Valet et al., 2004, Cytomics--new
technologies: towards a human cytome project. Cytometry,
59A:167-71; Vieyra et al., 2003, Altered Subcellular Localization
and Low Frequency of Mutations of ING1 in Human Brain Tumors, Clin.
Cancer Res., 9:5952-5961; Villamarin et al., 2003, A comparative
analysis of the time-dependent antiproliferative effects of
daunorubicin and WP631, Eur. J. Biochem., 270:764-770; Walker et
al., 2003, Phenotype versus Genotype in Gliomas Displaying Inter-
or Intratumoral Histological Heterogeneity, Clin. Cancer Res.,
9:4841-4851; Wang et al., 2003, Loss of 13q14-q21 and Gain of
5p14-pter in the Progression of Leiomyosarcoma, Mod. Pathol.,
16:778-785; Wang et al., 2003, Genomic instability and
endoreduplication triggered by RAD17 deletion, Genes & Dev.,
17:965-970; Williams et al., 2003, Differential effects of the
proteasome inhibitor bortezomib on apoptosis and angiogenesis in
human prostate tumor xenografts, Mol. Cancer Ther., 2:835-843; Wu
et al., 2003, Telomere dysfunction: a potential cancer
predisposition factor. J Natl Cancer Inst., 95:1211-8; Yellon et
al., 2003, The role of leukocyte traffic and activation
inparturition, J Soc Gynecol Investig., 10:323-38; Yuan et al.,
2004, The duration of nuclear extracellular signal-regulated kinase
1 and 2 signaling during cell cycle reentry distinguishes
proliferation from apoptosis in response to asbestos, Cancer Res.,
64:6530-6, Zabaglo et al., 2003, Measurement of proliferation
marker Ki67 in breast tumour FNAs using laser scanning cytometry in
comparison to conventional immunocytochemistry. Cytometry,
56B:55-61; Zabaglo et al., 2003, Cell filtration-laser scanning
cytometry for the characterisation of circulating breast cancer
cells, Cytometry, 55A:102-108; Zhang et al., 2004, From The Cover:
High urea and NaCl carbonylate proteins in renal cells in culture
and in vivo, and high urea causes 8-oxoguanine lesions in their
DNA, PNAS, 101:9491-9496; Zheng et al., 2004, Calphostin-C
Induction of Yascular Smooth Muscle Cell Apoptosis Proceeds through
Phospholipase D and Microtubule Inhibition, J. Biol. Chem.,
279:7112-18.
[0183] Many other assay methods are known or can be developed.
Reagents appropriate for each reaction type will be provided in the
sample and/or propositioned in the reaction chamber. Exemplary
reagents include antibodies, ligands, enzyme substrates, effectors
and the like.
Exemplary Applications
[0184] The following prophetic examples are intended to illustrate
aspects of the invention. However, these examples are for
illustration only and are not intended to limit the invention in
any fashion.
[0185] 1. Detection and Characterization of Pathogens
[0186] The methods of the invention may be used for detection,
identification and characterization of pathogens. There are many
situations in which a sample contains a heterogeneous mixture of
microorganisms (e.g., various bacterial species or strains,
viruses, fungi) for which rapid detection and identification would
be advantageous. For example, clinical (patient) samples often
contain small numbers of microorganisms (e.g., bacteria, fungi) or
viruses. Rapid characterization would permit earlier administration
of appropriate drugs, if necessary. Similarly, the ability to
rapidly detect and identify cellular and viral pathogens would be
of value in the medical, veterinary, and agricultural fields, as
well as in response to actual or suspected bioterrorism and for
rapid detection water or food contaminants. In many cases a
relatively small number of cells are available to work with, and,
as noted, the cells are often available as a heterogeneous mixture
with other cells.
[0187] In one illustrative embodiment, the method is used to
determine whether a patient is infected with methicillin-resistance
S. aureus. S. aureus can be identified using a bacteria-specific
probe (e.g. to a rRNA gene). An methicillin resistant strain is
distinguished from non-resistant strains based on a characteristic
genetic sequence such as an open reading frame (gene or gene
segment) or single polynucleotide polymorphism. A sample containing
bacteria cells is obtained from a patient (e.g., a nose swab
containing about 100 bacterial cells) and diluted into a reaction
mixture containing nucleic acid primers and other reagents for
amplification and detection of target sequences (e.g., PCR
reagents, molecular beacons, polymerase, nucleotides, agents that
lyse cells for nucleic acid release, etc.). Exemplary PCR primers
are described in Huletsky et al., 2004, "New real-time PCR assay
for rapid detection of methicillin-resistant Staphylococcus aureus
directly from specimens containing a mixture of staphylococci." J
Clin Microbiol. 42:1875-84. One primer/probe set in the reaction
mixture emits a red fluorescence signal in the presence of a S.
aureus target sequence found in both resistant and non-resistant
stains while the second primer/probe set emits a green fluorescence
signal only in the presence of a S. aureus target sequence found in
the resistant strain. The cells are injected into a MPD and control
channels actuated to create separate reaction chambers (e.g., a
sample containing about 100 bacterial cells is partitioned into
2000 chambers) all or most of which contain zero or one cell. The
device is placed on the thermocycler or amplification is otherwise
initiated. Detection in a chamber of only a red signal indicates
the presence in the sample of non-resistant S. aureus; detection in
a chamber of both a red and green signal indicates the presence in
the sample of drug resistant S. aureus; detection or no signal
indicates no S. aureus bacteria are present in the sample.
[0188] 2. Quantitation of Cells in a Population Having Specific
Properties
[0189] In one aspect, the method is used for quantization of cells
in a heterogeneous population having specific properties. For
illustration, a cell population (e.g., peripheral blood mononuclear
cells (PBMC)) containing cytotoxic T lymphocytes (CTL) (effector
cells) can be partitioned and the ability of the cells to be
stimulated by an antigen tested. The antigen reagent can be
prepositioned in chambers or combined with cells immediately before
partition. The proportion or type of cells activated in the
presence can be assayed using any of a variety of assays for
effector cell activation. For example, by performing in vitro
stimulation after limiting dilution of circulating CTLs with the
gag antigens of human immunodeficiency virus (HIV), the precursor
population of gag-specific CTL can be quantitated and/or
characterized. See, e.g., Koup "Limiting dilution analysis of
cytotoxic T lymphocytes to human immunodeficiency virus gag
antigens in infected persons: in vitro quantitation of effector
cell populations with p17 and p24 specificities" J Exp Med. Dec. 1,
1991;174(6):1593-600.
[0190] 3. Characterization of a Rare Cell in a Background of Other
Cells
[0191] It is often advantageous to quantitate and/or characterize
rare cells in a background of other cells. For example, in cancer,
individual disseminated cancer cells may be found in blood.
Further, biopsies may recover only a few malignant cells in a
background of normal cells. The methods of the present invention
allow the malignant cells to be isolated, identified based on a
property (e.g., antigen, mutation or expression pattern) unique to
the cancer cell, and then a different property of the cell
determined.
[0192] In another example, nucleated fetal red blood cells are
found at low levels in the blood of pregnant women and are a
potential source of information about the fetal genome including
any sequences associated with disease or propensity to disease.
However, even enriched 10,000-fold fetal cells may be less than
0.1% of a sample making analysis by conventional methods difficult.
Cells from a sample enriched for fetal NRBCs can be partitioned
using the methods disclosed herein. Chambers containing fetal cells
can be identified using a fetal-specific probe (e.g., a probe
specific for the Y chromosome; abundance of RNA encoding fetal
forms of hemoglobin) and assayed for several genetic
characteristics using a multiplex assay. Other examples of rare
cells in a background of different cells include, for example, a
virally infected cell in a background of uninfected cells, a cell
expressing a gene in a background of cells not expressing the gene;
and the like.
[0193] In one embodiment, the MPD is used to partition a mixed
population of cells to detect a property characteristic of a rare
cell type in the population, i.e., cells comprising less than about
1%, more often less than about 0.1%, and very often less than about
0.01% of the cells in the population. There are many cases in which
it advantageous to determine the properties of a rare cell in a
population of other cells. The methods of the present invention
enable analysis of a rare cell without background or interference
for other cells. In general, the method involves partitioning cells
and assaying individual cells for at least two properties at least
one of which identifies the rare cell.
[0194] 4. Expression Analysis of Individual Cells
[0195] In one embodiment the nucleic acid being analyzed is or
includes RNA, and the expression level of specified genes in an
individual cell is determined. Again using the example of a
virus-infected cell, the expression profile for several host genes
in a single cell can be correlated with the presence or absence of
virus or with viral load. Gene expression profiles can also be
correlated with cell identity (e.g., different expression profiles
for different cells in a sample containing a heterogeneous mixture
of cells) or cell response to a stimulus (e.g., the presence of a
ligand that binds a cell receptor).
[0196] Because expression analysis typically involves a
quantitative analysis, detection is typically achieved using one of
the quantitative real time reverse transcriptase PCR methods
described above. Thus, if a TaqMan approach is utilized, the
reagents that are introduced (or previously spotted) in the
reaction sites can include one or all of the following: primer,
labeled probe, nucleotides and polymerase. Another approach is
Ribo-SPIA (see above).
[0197] While the present invention has been described with
reference to the specific embodiments thereof, it should be
understood by those skilled in the art that various changes can be
made and equivalents can be substituted without departing from the
scope of the invention. In addition, many modifications can be made
to adapt a particular situation, material, composition of matter,
process, process step or steps, to achieve the benefits provided by
the present invention without departing from the scope of the
present invention. All such modifications are intended to be within
the scope of the claims appended hereto.
[0198] All publications and patent documents cited herein are
incorporated herein by reference as if each such publication or
document was specifically and individually indicated to be
incorporated herein by reference. Citation of publications and
patent documents is not intended as an indication that any such
document is pertinent prior art, nor does it constitute any
admission as to the contents or date of the same.
* * * * *