U.S. patent application number 11/666141 was filed with the patent office on 2009-12-03 for methods and compositions for treating nephrogenic diabetes and insipidus.
Invention is credited to Noel G. Carlson, Bellamkonda K. Kishore, Donald E. Kohan, Raoul D. Nelson.
Application Number | 20090297497 11/666141 |
Document ID | / |
Family ID | 36565481 |
Filed Date | 2009-12-03 |
United States Patent
Application |
20090297497 |
Kind Code |
A1 |
Kishore; Bellamkonda K. ; et
al. |
December 3, 2009 |
Methods and compositions for treating nephrogenic diabetes and
insipidus
Abstract
Disclosed are compositions and methods for treating nephrogenic
diabetes insipidus and for induction of diuretic effect.
Inventors: |
Kishore; Bellamkonda K.;
(Sandy, UT) ; Carlson; Noel G.; (Salt Lake City,
UT) ; Kohan; Donald E.; (Salt Lake City, UT) ;
Nelson; Raoul D.; (Salt Lake City, UT) |
Correspondence
Address: |
Ballard Spahr LLP
SUITE 1000, 999 PEACHTREE STREET
ATLANTA
GA
30309-3915
US
|
Family ID: |
36565481 |
Appl. No.: |
11/666141 |
Filed: |
October 21, 2005 |
PCT Filed: |
October 21, 2005 |
PCT NO: |
PCT/US05/38231 |
371 Date: |
August 6, 2008 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60621910 |
Oct 25, 2004 |
|
|
|
Current U.S.
Class: |
424/94.61 ;
514/224.2; 514/420; 514/473; 514/570 |
Current CPC
Class: |
A61K 31/7072 20130101;
A61K 38/46 20130101; A61K 31/675 20130101; A61K 31/7076 20130101;
A61K 31/00 20130101; A61K 31/192 20130101; A61K 31/7076 20130101;
A61K 31/675 20130101; A61K 31/185 20130101; A61K 31/4965 20130101;
C12Y 306/01005 20130101; A61K 31/405 20130101; A61K 31/185
20130101; A61K 31/53 20130101; A61K 31/192 20130101; A61K 31/5575
20130101; A61K 31/365 20130101; A61K 31/4965 20130101; A61K 31/549
20130101; A61K 31/7072 20130101; A61K 31/53 20130101; A61K 31/405
20130101; A61K 38/46 20130101; A61K 31/18 20130101; A61P 13/00
20180101; A61K 31/365 20130101; A61K 31/5575 20130101; A61K 45/06
20130101; A61K 2300/00 20130101; A61K 2300/00 20130101; A61K
2300/00 20130101; A61K 2300/00 20130101; A61K 2300/00 20130101;
A61K 2300/00 20130101; A61K 2300/00 20130101; A61K 2300/00
20130101; A61K 2300/00 20130101; A61K 2300/00 20130101; A61K
2300/00 20130101 |
Class at
Publication: |
424/94.61 ;
514/420; 514/473; 514/570; 514/224.2 |
International
Class: |
A61K 38/47 20060101
A61K038/47; A61K 31/405 20060101 A61K031/405; A61K 31/34 20060101
A61K031/34; A61K 31/192 20060101 A61K031/192; A61K 31/54 20060101
A61K031/54 |
Goverment Interests
STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH
[0002] This invention was made possible with the facilities and
resources at the VA Salt Lake City Health Care System. This
invention was also made with government support under federal
grants DK61183 DK58953, and 53990 awarded by the NIH. Therefore,
the United States Government may have certain rights in this
invention.
Claims
1. A method of treating nephrogenic diabetes insipidus (NDI) in a
subject, comprising administering a composition to the subject,
wherein the composition is an antagonist of a P2Y purinergic
receptor.
2. The method of claim 1, wherein the P2Y purinergic receptor is a
P2Y2 purinergic receptor.
3. The method of claim 1, wherein the antagonist is P2Y selective
antagonist.
4. The method of claim 1, wherein the antagonist decreases the
level of PGE2 in the kidney.
5. The method of claim 1, wherein the antagonist decreases the
interaction of the P2Y receptor and PGE2.
6. A method of modulating NDI in a subject, comprising
administering a composition to the subject, wherein the composition
is an antagonist of a P2Y purinergic receptor.
7. The method of claim 1, wherein the P2Y antagonist is used in
combination with inhibitors of prostaglandin synthesis.
8. The method of claim 7, wherein the inhibitor is a non-specific
one for cyclooxygenases.
9. The method of claim 8, wherein the inhibitor is indomethacin,
rofecoxib, or flurbiprofen.
10. The method of claim 8, wherein the inhibitor inhibits
cyclooxygenase-1.
11. The method of claim 8, wherein the inhibitor inhibits
cyclooxygenase-2.
12. The method of claim 7, wherein more than one inhibitor of
prostaglandin synthesis is used with the P2Y antagonist.
13. The method of claim 1, wherein the P2Y antagonist is used in
combination with inhibitors of arachidonic acid release.
14. The method of claim 1, wherein the P2Y antagonist is used in
combination
14. The method of claim 1, wherein the P2Y antagonist is used in
combination with a composition that increases cAMP.
15. The method of claim 14, wherein the composition that increases
cAMP is an inhibitor of phosphodiesterases (PDES).
16. The method of claim 14 wherein the composition that increases
cAMP is an enhancer of adenylyl cyclase (AC).
17. The method of claim 1, wherein the P2Y antagonist is used in
combination with a PKA activator.
18. The method of claim 1, wherein the P2Y antagonist is used in
combination with a composition that inhibits protein kinase
C(PKC).
19. The method of claim 1, wherein the P2Y antagonist is used in
combination with a composition that inhibits MAP kinase kinase.
20. The method of claim 1, wherein the P2Y antagonist is used in
combination with a diuretic.
21. The method of claim 20, wherein the diuretic is a thiazide.
22. The method of claim 20, wherein a potassium sparing diuretic is
also used.
23. The method of claim 22, wherein the potassium sparing diuretic
is amiloride.
24. The method of claim 1, wherein thiazide is used in combination
with a prostaglandin synthesis inhibitor.
25. The method of claim 1, wherein the P2Y antagonist is used in
combination with a non-specific blocker of prostanoid
receptors.
26. The method of claim 1, wherein the P2Y antagonist is used in
combination with a selective blocker of prostanoid receptors.
27. The method of claim 1, wherein the P2Y antagonist is used in
combination with a non-specific or specific blockers of
prostaglandin transporters (PGT).
28. The method of claim 1, wherein the P2Y antagonist is used in
combination with an agent that inhibits or blocks the release of
prostaglandins from cells.
29. The method of claim 1, wherein the P2Y receptor antagonist is
used in combination with agents that enhance the degradation or
inactivation of prostaglandins released from the cells.
30. A method of treating fluid retention comprising administering
to a subject in need thereof an effective amount of a P2Y
agonist.
31. A method of treating polyuria or hypematremia comprising
administering to a subject in need thereof an effective amount of
apyrase or any nucleotide hydrolyzing enzymes, such as
NTPDases.
32. The method of claim 1, wherein an effective amount of apyrase
is administered in combination with an antagonist of a P2Y
purinergic receptor.
33. A method of treatment where a P2Y2 receptor agonist is used
alone or in combination with another agent for the purpose of
achieving diuretic effect.
Description
CROSS REFERENCE TO RELATED APPLICATION
[0001] This application claims priority to U.S. Provisional
Application 60/621,910 filed on Oct. 25, 2004 by Bellamkonda K.
Kishore, Noel Carlson, Donald Kohan, and Raoul Nelson, and this
application is incorporated herein in its entirety by
reference.
SUMMARY
[0003] As embodied and broadly described herein, the disclosed
compositions and methods, in one aspect, relate to the treatment of
nephrogenic diabetes insipidus (NDI). This application also relates
to the use of P2Y2 agonists as diuretics. It is to be understood
that both the foregoing general description and the following
detailed description are exemplary and explanatory only and are not
restrictive.
BRIEF DESCRIPTION OF THE DRAWINGS
[0004] The accompanying drawings, which are incorporated in and
constitute a part of this specification, illustrate several
embodiments of the compositions and methods and together with the
description, serve to explain the principles of the compositions
and methods.
[0005] FIG. 1 shows water balance disorders associated with altered
expression of vasopressin-regulated collecting duct water channel
AQP2. As shown here, AQP2 protein expression is reduced, sometimes
dramatically, in a wide variety of hereditary and acquired forms of
diabetes insipidus characterized by varying degrees of polyuria. On
the other hand, water retention conditions like heart failure and
pregnancy are associated with increased expression of AQP2 protein.
(Nielsen et al, 1999).
[0006] FIG. 2 shows schematic representation of the two mutually
opposing signaling pathways and the corresponding membrane
receptors involved in the regulation of osmotic water permeability
of medullary collecting duct principal cell. The scheme also
illustrates the points where the two signaling pathways interact
(Schwiebert and Kishore, 2001).
[0007] FIG. 3 shows the release of PGE2 by the agonist stimulation
of P2Y2 receptor. FIG. 3A shows time-course of release of PGE2 by
the agonist stimulation of P2Y2 receptor in rat IMCD preparations
in vitro. Freshly prepared IMCD-enriched fractions were incubated
at 37.degree. C. under physiological conditions in the absence
(vehicle, .smallcircle.) or presence (.cndot.) of 100 .mu.M of
ATP.gamma.S for different periods of time. PGE2 released into the
medium was assayed by EIA and normalized to the protein content of
the incubations. Results are expressed as mean.+-.SEM of triplicate
incubations. *significantly different from the corresponding
vehicle alone incubations. **significantly different from the
corresponding 0, 5 and 10 min values. FIG. 3B shows
concentration-response curve for the release of PGE2 by the agonist
stimulation of P2Y2 receptor in rat IMCD preparations in vitro.
Freshly prepared IMCD-enriched fractions were incubated at
37.degree. C. for 10 min with increasing concentrations of
ATP.gamma.S (0-100 .mu.M). PGE2 released into the medium was
assayed by EIA and normalized to the protein content of the
incubations. Results are mean.+-.SEM of triplicate incubations.
*significantly different from the 0 .mu.M ATP.gamma.S
incubations.
[0008] FIG. 4 shows purinergic and prostanoid interactions in the
inner medulla of hydrated and dehydrated rats. Animal model:
Hydration and dehydration of rats was achieved by either adding
sucrose (600 mM) to drinking water or by depriving drinking water,
respectively, for 2 days prior to euthanasia. Control rats received
plain tap water. All rats had free access to standard rat chow.
Urine samples were collected from rats by housing them in
individual metabolic cages during the last 24 hours of experimental
period. Twenty-four hour urine volumes and osmolality were
determined. Hydrated rats had high urine output of very dilute
urine and dehydrated rats had low output of concentrated urine.
Panels A-C: Altered protein abundance of P2Y2 receptor in the inner
medulla of hydrated and dehydrated rat kidneys. Whole tissue
homogenates were prepared, solubilized and immunoblotted for P2Y2
protein. The P2Y2 receptor antibody identifies two sets of
immunoreactive bands in the kidney (Kishore et al, 2000a) (panels A
& B). Both 47 kDa and 105 kDa bands are specific, as these were
ablated by pre-adsorption of the antibody with the immunizing
peptide. Blots were digitized, band densities determined, and
expressed as percent of mean values in controls (panel C).
Numerical results are expressed as mean.+-.SEM. *significantly
different from the corresponding band in the other group. Panel D:
Urinary excretion of PGE2 metabolites in control, hydrated and
dehydrated rats. Groups of male rats (N=3 per group) were subjected
to hydration and dehydration. Twenty-four hour urine samples were
collected and assayed for PGE2 metabolite, using a commercial kit
(Cayman Chemical Co, Ann Arbor, Mich.). This assay converts all the
immediate PGE2 metabolites to a single, stable derivative that
could be easily quantified by EIA. Measured urinary excretion of
PGE2 metabolite values (ng/24 hours) are expressed as percent of
mean values in the control group. *significantly different from the
other two groups. ** significantly different from the control
group. Panel E: In vitro IMCD response to purinergic-stimulated
PGE2 release in control, hydrated and dehydrated rats. Groups of
rats (N=3 per group) were subjected to dehydration and hydration.
Inner medullae from each group were pooled, and fractions enriched
in IMCD were prepared from these pools by collagenase and
hyaluronidase digestion (Welch et al, 2003). The pooled IMCD
preparations from each group was divided into two sets of tubes
(N=4 per set). One set served as vehicle control (baseline value),
while the other set of preparations was challenged with 50 .mu.M of
ATP.gamma.S (a non-hydrolyzable agonist of P2Y2 receptor) for 20
min at 37.degree. C. The reaction was arrested by adding chilled
incubation buffer. Samples were centrifuged to pellet IMCD, and the
PGE2 concentration in the supernatants was assayed by a commercial
EIA kit and normalized to the protein content of the incubations
(ng/mg protein). ATP.gamma.S-stimulated release of PGE2 in each
group was computed as percent increase over the respective vehicle
controls (baseline values). Results are expressed as mean.+-.SEM.
*significantly different from the other two groups. The PGE2
release from the IMCD of dehydrated rats is significantly lower
than that of controls.
[0009] FIG. 5 shows characterization of rat model of
lithium-induced NDI. Panel A: Body weights of rats fed control or
lithium-added diets. Panel B: Water intake in rats fed control or
lithium-added diets. Panel C: Twenty-four hour urine volumes in
rats fed control or lithium-added diets. Panel D: Urine
osmolalities in rats fed control or lithium-added diets. Panel E:
Protein abundance of AQP2 water channel in the inner medulla of
rats fed control or lithium-added diets, as determined by Western
blotting. Panel F: Densitometry of AQP2 protein bands in rats fed
control or lithium-added diets. Results are expressed as
mean.+-.SEM. *significantly different from the corresponding value
in control diet group.
[0010] FIG. 6 shows protein abundance and mRNA expression of P2Y2
receptor in inner medulla (panel A & B), and in vitro IMCD
response to purinergic-stimulated PGE2 release (panel C) in rats
fed control or lithium-added diets for 21 days. Inner medullae from
control or lithium diet fed rats were pooled separately, and
fractions enriched in IMCD were prepared from these pools by
collagenase and hyaluronidase digestion. Experiments were carried
out as described for hydrated and dehydrated rats in FIG. 4.
ATP.gamma.S-stimulated release of PGE2 in each group was computed
as percent increase over the respective vehicle controls (baseline
values). The mean increase in P2Y2-stimulated release of PGE2 in
lithium group is .about.2-fold higher as compared to the mean
increase in controls. Results are expressed as mean.+-.SEM.
*significantly different from the control group.
[0011] FIG. 7 shows expression of cytosolic phospholipase A2
(cPLA2; panel A), cyclooxygenase-1 (COX-1; panel B) and
cyclooxygenase-2 (Cox-2; panel C) messenger RNA in the renal inner
medulla of rats fed control or lithium added diets for 21 days.
Messenger mRNA extraction, purification, reverse transcription,
real-time PCR amplifications and computation of results were
carried out as described for P2Y2 receptor in FIG. 6 legend. The
sequences of primer pairs used in these amplifications are shown in
Table 6. The expression of cPLA2, COX-1 and COX-2 genes was
normalized to the expression of housekeeping gene .beta.-actin
(Relative Expression), and computed as percent or mean values in
the control diet group. Results are mean.+-.SEM. *significantly
different from the control diet group. Lithium diet fed rats showed
approximately 2-, 3- and 1.5-fold increase in mRNA expression of
cPLA2, COX-1 and COX-2 as compared to the control diet fed
group.
[0012] FIG. 8 shows the characterization of rat model of NDI
induced by bilateral ureteral obstruction (BUO) and release. Panel
A: Twenty-four hour urine volumes in sham operated and BUO rats.
*significantly different from the corresponding sham operated
values by ANOVA followed by Tukey-Kramer Multiple Comparison Test;
**significantly different from the corresponding sham operated
values by unpaired t test. Panel B: Urine osmolalities in sham
operated and BUO rats. *significantly different from the
corresponding sham operated values. The decrease in mean urine
osmolality in BUO rats on day 12 did not attain statistical
significance (P=0.112) due to the large variation in sham operated
rats and small sample size. Panel C: Water intake in sham operated
rats (pooled values from day 0, 7 and 12) and BUO rats at day 0, 7
and 12. *significantly different from the values in BUO day 0 and
sham operated groups. Panel D: Urinary excretion of PGE2 metabolite
in sham operated and BUO rats measured on day 12 urine samples.
*significantly different from the sham operated values. Panel E:
Protein abundance of AQP2 water channel in the inner medulla of
sham operated and BUO rats euthanized on day 12. Panel F:
Densitometry of AQP2 protein bands in sham operated and BUO rats.
*significantly different from the corresponding band density in
sham operated group. Results are expressed as mean.+-.SEM. The
number in parenthesis indicates the number of animals examined.
Since the surgical procedures were performed on small batches of
animals on each time, some of the urine samples could not be
collected for analysis. Day 0 represents the period just prior to
the first surgical operation performed to obstruct the ureters.
[0013] FIG. 9 shows protein abundance (panel A) and mRNA expression
(panel B) of P2Y2 receptor in the inner medulla, and in vitro IMCD
response to purinergic-stimulated PGE2 release (panel C) in sham
operated and BUO rats. Sham operated (N=2) and BUO (N=3) rats were
euthanized on day 7. Inner medullae from sham operated and BUO rats
were pooled separately, and fractions enriched in IMCD were
prepared from these pools by collagenase and hyaluronidase
digestion. Experiments were carried out as described for hydrated
and dehydrated rats in FIG. 4. ATP.gamma.S-stimulated release of
PGE2 in group was computed as percent increase over the respective
vehicle controls (baseline values). Results are expressed as
mean.+-.SEM of four incubations from pooled IMCD in each group.
*significantly different from the sham operated group. The mean
increase in P2Y2-stimulated release of PGE2 in BUO rats is about
4.3-fold higher as compared to the mean increase in sham operated
controls.
[0014] FIG. 10 shows expression of cytosolic phospholipase A2
(cPLA2; panel A), cyclooxygenase-1 (COX-1; panel B) and
cyclooxygenase-2 (Cox-2; panel C) mRNA in the renal inner medulla
of sham operated and BUO rats. Messenger mRNA extraction,
purification, reverse transcription, real-time PCR amplifications
and computation of results are carried out as described for P2Y2
receptor in FIG. 6 legend. The sequences of primer pairs used in
these amplifications are shown in Table 6. The expression of cPLA2,
COX-1 and COX-2 genes was normalized to the expression of
housekeeping gene .beta.-actin (Relative Expression), and computed
as percent or mean values in the control diet group. Results are
mean.+-.SEM. *significantly different from the sham operated group.
BUO rats showed approx. 2-, and 3-fold increase in mRNA expression
of COX-1 and COX-2 as compared to the sham operated group.
[0015] FIG. 11 shows the sequence of intracellular events leading
from vasopressin V2 receptor on the basolateral membrane to the
insertion of AQP2 water channels into the apical membrane of
collecting duct principal cell. The potential pre-cAMP formation
sites that can be disrupted are (i) activation of inhibitory G
protein (Gi) by the increased activity of PKC brought about by
diacylglycerol (DAG) formed as a result of stimulation of the PI
signaling pathway by various autocrine and paracrine agents (PGE2,
ATP/UTP or endothelin), and (ii) decreased activity of adenylyl
cyclase (AC) isoforms 5 and 6 expressed in the medullary collecting
duct. The potential post-cAMP formation sites which can be
disrupted are (i) rapid hydrolysis of cAMP by phoshodiesteases
(isofoms III and IV) expressed in medullary collecting duct, and
(ii) decreased activity of PKA, resulting in decreased protein
phosphorylation and membrane insertion of AQP2
[0016] FIG. 12 shows the determination of the degree of
phosphorylation of cPLA2. It is achieved by prolonged low voltage
PAGE electrophoresis of solubilized tissue homogenates, so that the
native and phosphorylated species clearly separate, and then
transferring the separated proteins to a nitrocellulose membrane
and immunoblotting with a specific antibody to cPLA2. Figure shows
native (red arrow) and phoshorylated cPLA2 (blue arrow) in inner
medullary homogenates of 5 normal rats separated in our laboratory
using PAGE and immunoblotting.
[0017] FIG. 13 shows the effect of depletion of extracellular ATP
by apyrase treatment on the urine flow (left panel) and on and P2Y2
receptor-stimulated ex vivo PGE2 release by IMCD (right panel).
[0018] FIG. 14 shows dependency on the COX-2 activity of P2Y2
receptor-mediated PGE2 release by IMCD in lithium-induced NDI
(right panel) and the lack of such dependency on the activity of
COX-2 in sucrose-water induced polyuria (left panel).
[0019] FIG. 15 shows the proposed models for the interaction among
vasopressin (AVP), purinergic (ATP), and prostanoid (PGE2) systems
in medullary collecting duct principal cell under normal conditions
(left) and how they are deranged in acquired NDI (right). (-) and
(+) signs denote inhibition and stimulation respectively. X marks
indicate blocked pathways. Larger size of the arrows indicates
accentuation of pathways. The letters A, B, C, D and E are keyed to
the explanation in Example 9.
DETAILED DESCRIPTION
[0020] The present compositions and methods can be understood more
readily by reference to the following detailed description and the
Examples included therein and to the Figures and their previous and
following description.
[0021] Before the present compounds, compositions, articles,
devices, and/or methods are disclosed and described, it is to be
understood that the compositions and methods are not limited to
specific synthetic methods, specific recombinant biotechnology
methods unless otherwise specified, or to particular reagents
unless otherwise specified, as such can, of course, vary. It is
also to be understood that the terminology used herein is for the
purpose of describing particular embodiments only and is not
intended to be limiting.
A. DEFINITIONS
[0022] As used in the specification and the appended claims, the
singular forms "a," "an" and "the" include plural referents unless
the context clearly dictates otherwise. Thus, for example,
reference to "a pharmaceutical carrier" includes mixtures of two or
more such carriers, and the like.
[0023] Ranges can be expressed herein as from "about" one
particular value, and/or to "about" another particular value. When
such a range is expressed, another embodiment includes from the one
particular value and/or to the other particular value. Similarly,
when values are expressed as approximations, by use of the
antecedent "about," it will be understood that the particular value
forms another embodiment. It will be further understood that the
endpoints of each of the ranges are significant both in relation to
the other endpoint, and independently of the other endpoint. It is
also understood that there are a number of values disclosed herein,
and that each value is also herein disclosed as "about" that
particular value in addition to the value itself. For example, if
the value "10" is disclosed, then "about 10" is also disclosed. It
is also understood that when a value is disclosed that "less than
or equal to" the value, "greater than or equal to the value" and
possible ranges between values are also disclosed, as appropriately
understood by the skilled artisan. For example, if the value "10"
is disclosed then "less than or equal to 10" as well as "greater
than or equal to 10" is also disclosed.
[0024] "Optional" or "optionally" means that the subsequently
described event or circumstance may or may not occur, and that the
description includes instances where said event or circumstance
occurs and instances where it does not.
[0025] The terms "higher," "increases," "elevates," or "elevation"
refer to increases above basal levels, e.g., as compared to a
control. The terms "low," "lower," "reduces," or "reduction" refer
to decreases below basal levels, e.g., as compared to a control.
For example, basal levels are normal in vivo levels prior to, or in
the absence of, addition of an agent.
[0026] "Kidney cells" include all renal tubular epithelial cells,
renal cortical tubules, glomerular cells, mesangial cells,
interstitial cells, collecting duct prinicipal cells, and
intercalated cells of the kidney.
[0027] The term "diabetes insipidus" includes, but is not limited
to, any disease of the kidneys such as neurogenic, also known as
central, hypothalamic, pituitary, or neurohypophyseal diabetes;
nephrogenic, also known as vasopressin-resistant; gestanic; and
dipsogenic diabetes.
[0028] The term "test compound" is defined as any compound to be
tested for its ability to interact with a selected cell, e.g., a
P2Y antagonist. Examples of test compounds include, but are not
limited to, suramin, acid blue 129, and acid blue 80. Also, "test
components" include drugs, molecules, and compounds that come from
combinatorial libraries where thousands of such ligands are
screened by drug class.
[0029] The terms "control levels" or "control cells" are defined as
the standard by which a change is measured, for example, the
controls are not subjected to the experiment, but are instead
subjected to a defined set of parameters, or the controls are based
on pre- or post-treatment levels.
[0030] Throughout this application, various publications are
referenced. The disclosures of these publications in their
entireties are hereby incorporated by reference. The references
disclosed are also individually and specifically incorporated by
reference herein for the material contained in them that is
discussed in the sentence in which the reference is relied
upon.
[0031] Disclosed are the components to be used to prepare the
disclosed compositions as well as the compositions themselves to be
used within the methods disclosed herein. These and other materials
are disclosed herein, and it is understood that when combinations,
subsets, interactions, groups, etc. of these materials are
disclosed that while specific reference of each various individual
and collective combinations and permutation of these compounds may
not be explicitly disclosed, each is specifically contemplated and
described herein. Thus, if a class of molecules A, B, and C are
disclosed as well as a class of molecules D, E, and F and an
example of a combination molecule, A-D is disclosed, then even if
each is not individually recited each is individually and
collectively contemplated meaning combinations, A-E, A-F, B-D, B-E,
B-F, C-D, C-E, and C-F are considered disclosed. Likewise, any
subset or combination of these is also disclosed. Thus, for
example, the sub-group of A-E, B-F, and C-E would be considered
disclosed. This concept applies to all aspects of this application
including, but not limited to, steps in methods of making and using
the disclosed compositions. Thus, if there are a variety of
additional steps that can be performed it is understood that each
of these additional steps can be performed with any specific
embodiment or combination of embodiments of the disclosed
methods.
B. COMPOSITIONS AND METHODS
[0032] Acquired nephrogenic diabetes insipidus (NDI), which is
relatively common, comprises several clinical conditions, such as
lithium-induced nephropathy, hypokalemic nephropathy,
hypercalcemia, and post-obstructive uropathy. The hallmark of these
conditions is low protein levels of vasopressin-regulated water
channel AQP2 in the medullary collecting duct, in the presence of
normal or elevated circulating levels of arginine vasopressin
(AVP). In both human patients and in experimental animals with
acquired NDI, the production of renal prostaglandins such as PGE2,
is increased. PGE2, by virtue of its ability to antagonize
AVP-stimulated water permeability via retrieval of AQP2 water
channels from the apical membrane of inner medullary collecting
duct (IMCD), is involved in the development of polyuria of acquired
NDI. Accordingly, inhibition of PGE2 synthesis by the
administration of indomethacin was shown to ameliorate the polyuria
of acquired NDI. In rat IMCD, agonist stimulation of P2Y2
purinergic (nucleotide) receptor results in production and release
of PGE2 (Welch et al, 2003), and this response is markedly enhanced
in hydrated polyuric rats (Sun et al, 2004). It has been shown that
the purinergic-mediated PGE2 release in IMCD is also markedly
enhanced in acquired NDI induced by lithium (Li) administration or
by bilateral ureteral obstruction (BUO) and release. And this is
associated with significant increases in mRNA expression of
cyclooxygenases-1 and -2 in inner medulla of acquired NDI rats.
[0033] Diabetes insipidus (DI) causes considerable morbidity and
inconvenience to the patients. Patients with DI, especially those
critically ill, are at higher risk of dehydration, hypematremia,
alterations in the level of consciousness, and hemodynamic
instability from hypovolemia, for example (Bell, 1994). Acquired
nephrogenic diabetes insipidus (NDI), the more common form of NDI,
can occur at any age. The most common cause of acquired NDI is
lithium administration for the treatment of bipolar disorders.
Other drugs that are capable of inducing acquired NDI are
colchicine, methoxyflurane, amphotericin B, gentamicin, loop
diuretics, and demeclocycline, for example. In addition to drugs,
acquired NDI can also occur as a result of certain diseases. These
include, but are not limited to chronic kidney diseases,
hypokalemia, hypercalcemia, sickle cell disease, ureteral
obstruction (obstructive uropathy), and low protein diet. The
hallmark of these conditions, as documented in animal models, is
low protein abundance of AVP-regulated water channel AQP2 in the
medullary collecting duct in the face of normal or elevated
circulating levels of AVP (Nielsen et al, 1999; FIG. 1). Thus, in
these conditions, it appears that the inherent defect lies in the
collecting duct.
[0034] The collecting duct system, which expresses AQP2, AQP3 and
AQP4 water channels, accounts for the absorption of 15-20% of the
filtered water. This is precisely regulated by AVP, and thus it is
crucial for the conservation of body water and excretion of
concentrated urine. AQP2 water channel, expressed on the apical
plasma membrane and on sub-apical vesicles of collecting duct
principal cells, is regulated by AVP. AVP, acting through its V2
receptor, a G protein-coupled receptor, on the collecting duct
principal cells, activates membrane bound adenylyl cyclase (AC) to
produce cAMP as a second messenger (FIG. 2). The cellular effects
of cAMP are believed to be connected to the activation of protein
kinase A (PKA), which phosphorylates various key proteins. AVP has
both short- and long-term effects on the collecting duct water
permeability. As depicted in FIG. 2, the short-term regulation (in
the time frame of few to several minutes) of collecting duct water
permeability by AVP involves the translocation of AQP2 water
channels from a pool of subapical vesicles to the apical plasma
membrane (Nielsen et al, 1995). The apical plasma membrane is the
rate-limiting barrier for the transepithelial water movement, as
AQP3, AQP4 are constitutively expressed on the basolateral domain
of the collecting duct principal cells under normal conditions
(FIG. 2). The long term-regulation (within the time frame of
several hours to days) of collecting duct water permeability
involves a parallel increase in the absolute amount of AQP2 mRNA
and protein (Agre, 2000; Krane and Kishore, 2003). Water
deprivation and vasopressin stimulation both increase AQP2 protein
expression and apical membrane targeting (Nielsen et al, 1993;
DiGiovanni et al, 1994; Kishore et al, 1996). cAMP is capable of
stimulating AQP2 gene transcription by acting through CRE and AP1
sites in the AQP2 promoter (Hozawa et al, 1996; Yasui et al, 1997;
Matsumura et al, 1997). cAMP activation of AQP2 gene likely occurs
by phosphorylation of CREB (CRE binding protein) and the ability of
phosphorylated CREB to activate AQP2 gene transcription via binding
to CRE sites in the AQP2 promoter. cAMP activation of AQP2 gene
could also occur by the induction of c-Fos expression and c-Fos
activation of AQP2 transcription via the API site in the AQP2
promoter.
[0035] Apart from AVP, a variety of autocrine and paracrine agents,
such as PGE2, endothelin and extracellular nucleotides (ATP/UTP),
also regulate the collecting duct water permeability. Acting via
their respective receptors and the accompanying phosphoinositide
signaling pathway these agents decrease the osmotic water
permeability of the collecting duct (FIG. 2), even in the presence
of AVP (Nadler et al, 1992; Kohan and Hughe, 1993; Kishore et al,
1995; Roman and Lechene, 1981; Rouch and Kudo, 2000). Thus, in the
collecting duct, cyclic AMP and phosphoinositide systems are
mutually opposing signaling pathways (Teitelbaum, 1992).
Diacylglycerol (DAG) formed as a result of stimulation of PI
signaling pathway stimulates the activity of PKC, which in turn
induces the activity of G.sub.i (inhibitory G protein) associated
with the V2 receptor complex. Activation of G.sub.i uncouples the
signal from V2 receptor to adenylyl cyclase (AC), resulting in
decreased cellular cAMP levels. Activation of PI signaling pathway
also results in the stimulation of specific phoshodiesterases
(PDEs) through the calcium-calmodulin (CaM) pathway. These PDEs
rapidly hydrolyze cAMP and thus reduce the water permeability of
the collecting duct as demonstrated in DI+/+mice, which exhibit
constitutively active cAMP-PDE (PDE type IV) (Homma et al, 1991;
Froki.ae butted.r et al, 1999)
[0036] Both in human patients and in laboratory animals,
lithium-induced NDI and post-obstructive uropathy are associated
with increased production and excretion of PGE2 in urine. And
administration of indomethacin ameliorated these polyuric
conditions, indicating that PGE2 is involved in the genesis of
polyuria (Laszlo et al, 1980; Fradet et al, 1980, 1988; Sugawara et
al, 1998). PGE2 is a major prostanoid in the kidney and it
interacts with four G protein-coupled E-prostanoid receptors
designated EP1, EP2, EP3 and EP4. Through these receptors, PGE2
modulates renal hemodynamics and salt and water excretion (Breyer
and Breyer, 2000). PGE2 has an antagonistic effect on
AVP-stimulated collecting duct water permeability (Nadler et al,
1992; Han et al, 1994), and molecular mechanisms of this effect of
PGE2 on AVP-stimulated water permeability in renal collecting duct
have been shown. Using ex-vivo preparations of renal medulla,
Zelenina et al (2000) have demonstrated that agonist stimulation of
EP3 prostanoid receptor causes retrieval of AQP2 water channels
from the apical membrane, thus reducing the abundance of AQP2
protein in the apical membrane, the rate-limiting barrier in the
transepithelial water movement in the collecting duct.
[0037] P2Y2 receptor is a G protein-coupled nucleotide receptor,
linked to phosphoinositide signaling pathway. The agonist potency
order of P2Y2 receptor is typically
UTP=ATP>ATP.gamma.S>2MeS-ATP>.alpha.,.beta.-MeATP. Since
agonist activation of this receptor results in the mobilization of
intracellular Ca.sup.2+ (Ecelbarger et al., 1994), activation of
P2Y2 receptor in medullary collecting duct can result in the
down-regulation of AVP-stimulated water permeability. Using a model
of in vitro microperfused terminal inner medullary collecting duct
(IMCD) of rat, it was demonstrated that ATP or UTP, but not ADP (a
non-agonist), decreased the AVP-stimulated osmotic water
permeability (Pf) in a reversible fashion. Studies using a
non-hydrolyzable cAMP analog or forskolin or calphostin C(PKC
inhibitor) revealed that the mechanism of this inhibition involves
a pre-cAMP formation site, probably the inhibitory G protein (Gi)
(Kishore et al., 1995).
[0038] In order to establish the molecular expression in IMCD, and
to study its regulation in pathophysiological conditions, molecular
tools were developed (antibody, primers and cDNA probe) to detect
the protein and mRNA of P2Y2 receptor at cellular and tissular
levels in the kidney (Kishore et al., 2000a). The rat P2Y2 receptor
cDNA cloned from type II alveolar cells, which were used to design
an antibody, primers and cDNA probe, has an open reading frame of
1125 base pairs (359-1438 bp) with no introns (Rice et al, 1995).
The open reading frame encodes a putative protein of 374 amino acid
residues with a predicted molecular weight of 42,275 Daltons in the
unglycosylated state (Rice et al, 1995). The protein contains seven
transmembrane-spanning domains, characteristic of G protein-coupled
receptors. To authenticate the specificity and reliability of the
tools, they were also tested on lung tissue, where the expression
and function of P2Y2 receptor were well known. RT-PCR and Northern
analysis showed expression of P2Y2 mRNA in both lung and kidney.
RT-PCR on microdissected collecting duct segments demonstrated P2Y2
receptor mRNA expression in collecting ducts. Immunoblots using a
C-terminal peptide-derived polyclonal antibody to P2Y2 receptor
showed that IMCD expresses two distinct and specific products (47
and 105 kDa), and account for the majority of the receptor
expression in the inner medulla. Immunoperoxidase labeling on
cryosections showed localization of P2Y2 receptor protein in the
apical and basolateral domains of IMCD principal cells in the
kidney, and on Clara cells and goblet cells in terminal respiratory
bronchioles (Kishore et al, 2000a).
[0039] A rise in intracellular calcium, such as the one that occurs
following agonist stimulation of P2Y2 receptor, is known to be
frequently associated with release of arachidonic acid in several
tissues or cells. In most of these tissues or cells, especially
those of nonendothelial nature, the predominant prostanoid produced
was PGE2. Thus, it was hypothesized that the agonist stimulation of
P2Y2 receptor in IMCD should also result in production and release
of PGE2. To test this hypothesis, experiments were conducted on
freshly prepared rat IMCD fractions, and the effect of activation
of P2Y2 receptor on the release of PGE2 was examined. The results
show that unstimulated IMCD released significant, amounts of PGE2.
Agonist activation of P2Y2 receptor by ATP.gamma.S enhanced release
of PGE2 from IMCD in a time- and concentration-dependent fashion
(FIG. 3). Furthermore, purinergic-stimulated release of PGE2 was
completely blocked by non-specific COX inhibitors. Differential COX
inhibition studies revealed that purinergic-stimulated release of
PGE2 was more sensitive to a COX-1 specific inhibition than COX-2
specific inhibition (Welch et al. 2003). Because PGE2 is known to
affect transport of water, salt, and urea in IMCD (Nadler et al,
1992; Roman and Lechene, 1981; Rouche and Kudo, 2000), the observed
interaction of purinergic system with the prostanoid system in IMCD
can modulate handling of water, salt, and urea by IMCD and, thus
constitutes a complex AVP-independent regulatory mechanism. Thus,
the purinergic regulation of medullary collecting duct function
extends beyond the direct modulation of AVP-stimulated water
permeability.
[0040] Potato apyrase (EC 3.6.1.5) is a soluble NTPDase, exhibiting
both ATPase and ADPase activities. It is non-toxic and safe to
administer either intravenously or intraperitoneally. As documented
in FIG. 13, apyrase treatment from day 7 to 14 in lithium-fed rats
(i) prevented further increase in the urine flow induced by
lithium, and (ii) significantly decreased the P2Y2
receptor-stimulated PGE2 release by IMCD as compared to the
apyrase-untreated and lithium-fed rats. Apyrase treatment did not
change the urine output or P2Y2-mediated PGE2 release by IMCD in
control rats fed with regular diet. These observations showed that
apyrase has the ability to decrease the PGE2 formation in acquired
NDI by novel means other than the direct inhibition of the
activities of cyclooxygenases.
[0041] Apyrase can be used for blocking the purinergic signaling,
especially following xenograft. Apyrase can also be optimized for
administration alone or in combination with specific P2Y2 receptor
antagonists to achieve the best possible effect in controlling
polyuria and the ensuing hypernatremia.
[0042] 1. Purinergic Receptors
[0043] Several cell membrane receptors, which preferentially bind
extracellular nucleotides (ATP/UTP/ADP), and their analogues have
been identified, cloned and characterized. There receptors,
collectively known as extracellular nucleotide receptors or
purinergic receptors have been classified based on their molecular
biology, biological actions and pharmacology. Broadly they are
divided into P2Y and P2X families. (P1 receptors are not nucleotide
receptors; they are adenosine receptors). The P2X receptors are
ionotrophic ATP-gated channels that open up to allow small
molecules to enter into the cells. Purinergic regulation of renal
function encompasses glomerular hemodynamics, microvascular
function, tubuloglomerular feedback, tubular transport, renal cell
growth and apoptosis for example (Schwiebert and Kishore, 2001;
Inscho, 2001).
[0044] There are two main families of purine receptors, adenosine
or P1 receptors, and P2 receptors, recognizing primarily ATP, ADP,
UTP, and UDP (Table 1). Adenosine/P1 receptors couple to G proteins
and have been further subdivided, based on molecular, biochemical,
and pharmacological evidence into four subtypes, A.sub.1, A.sub.2A,
A.sub.B, and A.sub.3. In contrast, P2 receptors divide into two
families of ligand-gated ion channels and G protein-coupled
receptors termed P2X and P2Y receptors, respectively. For example,
Table 1 sets forth seven mammalian P2X receptors (P2.times.7) and
five mammalian P2Y receptors (P2Y.sub.1, P2Y.sub.2, P2Y.sub.4,
P2Y.sub.6, P2Y.sub.11) which have been cloned and
characterized.
TABLE-US-00001 Adenosine/P1 receptors P2 receptors Natural
Adenosine ATP, ADP, UTP, UDP, Adenine ligands dinucleotides
Subgroup -- P2X P2Y Type G protein-coupled Ion channel G
protein-coupled Nonselective pore Subtypes A.sub.1, A.sub.2A,
A.sub.2B, A.sub.3 P2X.sub.1-7, P2X.sub.n P2Y.sub.1, P2Y.sub.2,
P2Y.sub.4, P2Y.sub.6, P2Y.sub.11, P2Y.sub.ADP (or P.sub.2T) Uridine
nucleotide-specific
[0045] P2Y receptors are purine and pyrimidine nucleotide receptors
that are coupled to G proteins. Most P2Y receptors act via G
protein coupling to activate PLC leading to the formation of
IP.sub.3 and mobilization of intracellular Ca.sup.2+. Coupling to
adenylate cyclase by some P2Y receptors has also been described.
The response time of P2Y receptors is longer than that of the rapid
responses mediated by P2X receptors because it involves
second-messenger systems and down stream mediators mediated by G
protein coupling. Five mammalian P2Y receptors (P2Y.sub.1,
P2Y.sub.2, P2Y.sub.4, P2Y.sub.6, P2Y.sub.11) have been cloned, and
functionally characterized and show distinct pharmacological
profiles (Table 2).
TABLE-US-00002 TABLE 2 Cloned P2Y receptors Acession cDNA library
Receptor number source Agonist activity References P2Y.sub.1 Human
brain 2MeSATP > ATP UTP Schachter et al., 1996 (362 S81950 Human
prostate 2MeSATP > ATP = ADP Janssens et al., 1996 amino and
ovary acids Z49205 Human Leon et al., 1995, 1997 (aa)) placenta
U42030 Human HEL Ayyanathan et al., 1996 cells X87628 Bovine
2MeSATP = ADP > ATP UTP Henderson et al., 1995 endothelium
U22830 Rat insulinoma 2MeSATP > 2Cl-ATP > ATP Tokuyama et
al., 1995 cells ( .quadrature.-meATP inactive) Rat ileal 2MeSATP =
2ClATP > ADP > Pacaud et al., 1996 myocytes ATP (UTP
inactive) U22829 Mouse Tokuyama et al., 1995 insulinoma cells
U09842 Turkey brain 2MeSATP > ADP > ATP; (UTP Filtz et al.,
1994 inactive) X73268 Chick brain 2MeSATP > ATP > ADP; (UTP
Webb et al., 1993b inactive) P2Y.sub.2 U07225 Human CF/T43 ATP =
UTP 2MeSATP Parr et al., 1995 (373 aa) epithelial cells Bowler et
al., 1995 Human bone Rat Godecke et al., 1996 microvascular
coronary EC U09402 Rat alveolar ATP = UTP Rice et al., 1995 type II
cells L46865 Rat pituitary ATP = UTP > ADP = UDP > GTP Chen
et al., 1996b U56839 Wistar Kyoto Seye et al., 1996 rat.sup.a
NM_008773 Mouse NG108-15 ATP = UTP > ATP.quadrature.S Lustig et
al., 1993 neuroblastoma 2MeSATP cells P2y3.sup.b X98283 Chick brain
UDP > UTP > ADP > Webb et al., 1995, 1996a (328 aa)
2MeSATP > ATP P2Y.sub.4 X91852 Human UTP > ATP = ADP.sup.c
Communi et al., 1996b (352 aa) placenta Human Stam et al., 1996
placenta U40223 Human UTP > UDP (ATP inactive) Nguyen et al.,
1996 chromosome X Y14705 Rat heart ATP = UTP = ADP = ITP = Bogdanov
et al., 1998 ATP.quadrature.S = 2MeSATP = Ap.sub.4A > UDP
P2Y.sub.6 X97058 Human UDP > UTP > ADP > 2MeSATP Communi
et al., 1996b (379 aa) placenta and ATP spleen NM_057124 Rat aortic
UTP > ADP = 2MeSATP > ATP Chang et al., 1995 smooth muscle
U52464 Activated T- Southey et al., 1996 cells P2Y.sub.11 371 Human
ATP > 2MeSATP >>> ADP; Communi et al., 1997 (371 aa)
placenta (UTP, UDP inactive) .sup.aTissue not specified. .sup.bp2y3
may be the chick homologue of the mammalian P2Y.sub.6 receptor.
.sup.cThe reported activity of UDP at the P2Y.sub.4 receptor has
been shown to be caused by UTP present as a contaminant. Each of
the references herein is incorporated by reference at least for
material related to P2Y receptors Modified from Ralevic V,
Burnstock G. Pharmacol Rev 1998 September; 50(3): 413-92.
[0046] P2Y receptors are 308 to 377 amino acid proteins with a mass
of 41 to 53 kDa after glycosylation. A model of the P2Y receptor,
based on the primary sequence of the P2Y.sub.1 receptor and using
the structural homolog rhodopsin as a G protein-5 coupled receptor
template, has identified positively charged amino acid residues in
transmembrane regions 3, 6, and 7 that may be involved in ligand
binding by electrostatic interactions with the phosphates of ATP
(Van Rhee et al., 1995). Several of these amino acids are conserved
in other G protein-coupled receptors. Site-directed mutagenesis of
the P2Y.sub.2 receptor to convert positively charged amino acids in
transmembrane regions 6 and 7 to neutral amino acids causes a 100-
to 850-fold decrease in the potency of ATP and UTP, which suggests
a role for these amino acids in binding purines and pyrimidines
(Erb et al., 1995).
TABLE-US-00003 TABLE 3 Exemplary P2 receptor signal transduction
mechanisms, agonists, and antagonists Family P2X P2Y Receptor type
Ion channel: Nonselective G protein-coupled: G.sub.q/11,
G.sub.i.sup.b pore.sup.a Signaling Not applicable PLC, AC.sup.c ,
K.sup.+ channels.sup.d, PLC.sub.PC.sup.e, PLA.sub.2.sup.f, pathway
PLD.sup.f, PKC, MAPK.sup.g Effectors Ca.sup.2+ Na.sup.+ >
K.sup.+ .uparw.IP.sub.3, .uparw.Ca.sup.2+, .uparw.DAG
.dwnarw.cAMP.sup.c, Ca.sup.2+, Cl, K.sup.+ currents.sup.h
Nonselective ATP.sup.i, ATP.gamma.S, 2MeSATP, ATP.sup.i,
ATP.gamma.S, 2MeSATP, Ap.sub.4A.sup.j Agonists Ap.sub.4A.sup.j
P2X/P2Y- .alpha.,.beta.-meATP.sup.l, .beta.,.gamma.-meATP.sup.l,
BzATP.sup.a ADP.sup.c, UTP.sup.m, UTP.gamma.S.sup.j, UDP.sup.n,
2Cl-ADP.sup.c, selective 2MeSADP.sup.c, ADP.beta.S.sup.c,
ADP.beta.F.sup.c Agonists Nonselective Suramin, PPADS, Iso-
Suramin, PPADS, Iso-PPADS, P5P, Antagonists PPADS, P5P, Reactive
blue Reactive blue 2, Reactive Red, Trypan 2, Reactive Red, Trypan
Blue, Blue, Evans Blue, DIDS Evans Blue, DIDS P2X/P2Y- NF023,
NF279, KN-62.sup.a ARL 67085.sup.o, FPL 66096.sup.o, A3P5PS.sup.k,
selective MRS 2179.sup.k, 2-hexylthio-ATP.sup.p, 2- Antagonists
cyclohexylthio-ATP.sup.p .sup.aP2X.sub.7 and endogenous
P2X.sub.7-like receptor. .sup.bP2Y.sub.1 and endogenous
P2Y.sub.1-like receptors acting through PLC couple to G.sub.q/11
proteins; P2Y.sub.1 and endogenous P2Y.sub.1-like receptors acting
through adenylate cyclase couple to G.sub.i proteins; P2Y.sub.2 and
endogenous P2Y.sub.2-like receptors, P2Y.sub.4 and P2Y.sub.ADP
receptors couple to G.sub.q/11 and G.sub.i proteins; p2y3 and
P2Y.sub.6 receptors couple to G.sub.q/11 proteins. .sup.cP2Y.sub.1
and endogenous P2Y.sub.1-like receptors and P2Y.sub.ADP receptors.
.sup.dSome endogenous P2Y.sub.1-like receptors activate K.sup.+
channels via interactions with their G protein subunits.
.sup.eP2Y.sub.1 and endogenous P2Y.sub.1-like receptor signaling;
possibly downstream of PKC. .sup.fP2Y.sub.1 and P2Y.sub.2 receptors
and their endogenous counterparts; signaling possibly downstream of
PKC. .sup.gP2Y.sub.1 and P2Y.sub.2 receptors and their endogenous
counterparts; signaling downstream of PKC. .sup.hSecondary to
activation of PLC, although activation of K.sup.+ currents by some
endogenous P2Y.sub.1-like receptors is via direct interactions with
G protein subunits. .sup.iP2Y.sub.1 and P2Y.sub.2 receptors and
their endogenous counterparts; ATP is an antagonist at P2Y.sub.ADP
receptors. .sup.jP2Y.sub.2 and endogenous P2Y.sub.2-like receptors.
.sup.kP2Y.sub.1 and endogenous P2Y.sub.1-like receptors.
.sup.lP2X.sub.1, P2X.sub.3 and heteromeric P2X.sub.2P2X.sub.3
receptors. .sup.mP2Y.sub.2 and endogenous P2Y.sub.2-like receptors
and P2Y.sub.4 receptors. .sup.nP2Y.sub.6 receptor.
.sup.oP2Y.sub.ADP. .sup.pP2Y.sub.1 and endogenous P2Y.sub.1-like
receptors coupled to AC. Abbreviations: AC, adenylate cyclase;
ADP.quadrature.F, adenosine 5'-O-(2-fluoro)-diphosphate;
ADP.quadrature.S, adenosine 5'-O-(2-thio-diphosphate; cAMP,
adenosine 3',5'-cyclic monophosphate; A3P5PS, adenosine
3'-phosphate 5'-phosphosulfate; ARL 67085,6-N,N-diethyl-D-
.quadrature.-dibromomethylene ATP; ATP.quadrature.S, adenosine
5'-O-(3-thiotriphosphate); BzATP, 3'-O-(4-benzoyl)benzoyl ATP; DAG,
diacylglycerol; DIDS, 4,4'-diisothio-
cyanatostilbene-2,2'-disulfonate; FPL 66096, 2-propylthio-D-
.quadrature.-difluoromethylene ATP; IP.sub.3, inositol
1,4,5-trisphosphate; KN-62,
1-[N,O-bis(5-isoquinolinesulfonyl)-N-methyl-L-tyrosyl]-4-phenylpiperazine-
; Iso-PPADS, pyridoxal phosphate-6-azophenyl-2',5'-disulfonic acid;
MAPK, mitogen-activated protein kinase; .quadrature.-meATP,
.quadrature. -methylene ATP; .quadrature.-meATP,
.quadrature.-methylene ATP; 2MeSADP, 2-methylthio ADP; 2MeSATP,
2-methylthio ATP; MRS 2179, N.sup.6-methyl modification of
2'-deoxyadenosine 3',5'-bisphosphat; NF023, symmetrical 3'-urea of
8-(benzamido)naphthalene-1,3,5-trisulfonic acid; NF279,
8,8'-(carbonylbis(imino-4,1-phenylenecarbonylimino-4,1-phenylenecarbonyli-
mino))bis(1,3,5-naphthalenetrisulfonic acid); P5P,
pyridoxal-5-phosphate; PLC.sub.PC, phosphatidylcholine-specific
phospholipase C; PKC, protein kinase C; PLA.sub.2, phospholipase
A.sub.2; PLC, phospholipase C; PLD, phospholipase D; PPADS,
pyridoxal phosphate-6-azophenyl-2',4'-disulfonic acid; suramin,
8-(3-benzamido-4-methylbenzamido)-naphthalene-1,3,5-trisulfonic
acid; UTP.gamma.S, uridine 5'-O-(3-thiotriphosphate). Modified from
Ralevic V, Burnstock G. Pharmacol Rev 1998 September; 50(3):
413-92.
[0047] Just as P2Y2 agonists inhibit AVP-stimulated osmotic water
permeability, so too, antagonists of P2Y receptors can lead to an
enhancement of osmotic water permeability. P2Y antagonists, such as
those disclosed in Table 3, for example, act at P2Y receptors, and
thus can enhance AQP2 presence in the kidney tubule collecting
ducts. It is understood that the assays, measurements, and
functional limitations, as discussed, herein for agonists are
applicable for antagonists as well.
[0048] Disclosed are P2Y selective antagonists. Disclosed are P2Y
directed antagonists. In certain embodiments, a P2Y directed
antagonist is any antagonist that has a greater effect on a P2Y
receptor than on a P2X receptor. In other embodiments, P2Y
antagonist can be determined by comparing the activity to known
selective antagonists, such as those discussed herein. It is
understood that the level of activity of each selective antagonist
discussed herein, is disclosed. Also disclosed are P2 antagonists
that interact with any P2 receptor. It is understood that many P2Y
antagonists can be both a selective antagonist as well as a
directed antagonists. Also, specifically disclosed are P2Y2
antagonists.
[0049] Disclosed herein are methods of treating or modulating
diabetes insipidus in a subject, comprising administering a
composition to the subject, wherein the composition is an
antagonist of a P2Y purinergic receptor. In one example, the
diabetes insipidus is nephrogenic, however, any form of diabetes
insipidus can be treated with the methods disclosed herein. The
hallmark of aquired nephrogenic diabetes insipidus is low protein
levels of vasopressin-regulated water channel AQP2 in the medullary
collecting duct, in the presence of normal or elevated circulating
levels of arginine vasopressin (AVP). However, some other forms of
NDI are associated with inherited defects in the gene encoding for
vasopressin V2 receptor or AQP2 water channel. These conditions are
known as inherited NDI. Therefore, any disease that causes low
protein levels of vasopressin-regulated water channel in AQP2 in
the medullary collecting duct can be treated with the methods
disclosed herein.
[0050] Increased production of prostaglandin E2 (PGE2) plays a
critical role in the genesis of polyuria in diabetes insipidus. It
has been demonstrated that there is an accentuated interaction
between purinergic and prostanoid systems with markedly enhanced
purinergic-mediated PGE2 production and release from the medullary
collecting duct in diabetes insipidus. Puringeric system is related
to the actions of extracellular nucleotides, which act on the
collecting duct via specific P2Y2 receptor. Prostanoids, like PGE2.
act on the collecting duct via the EP3 prostanoid receptor.
Accentuated interaction between these two systems counteracts the
effect of arginine vasopressin, which conserves water and excretes
concentrated urine.
[0051] Because inhibiting the interaction of the P2Y receptor and
prostanoid system can restore normal function to the kidney and
ameliorate the symptoms of diabetes insipidus, there are several
ways that can be envisioned to treat diabetes insipidus. For
example, an antagonist of the P2Y receptor can be used to inhibit
the activity of this receptor. Such antagonists can be used alone,
or in combination with selective EP3 receptor blockers or low doses
of cyclooxygenase inhibitors, or thiazides. In one embodiment
described herein, use of the antagonist decreases the level of
PGE2. This decrease can be due to a lowered production of PGE2, or
due to a reduced amount of release of PGE2 from the medullary
collecting duct. In another embodiment, the antagonist can decrease
the interaction of the P2Y receptor and the prostanoid system, and
PGE2 in particular. Decreasing this interaction can result in less
PGE2 being present in the kidney. The antagonist can also work to
increase the level of AQP2 in the kidney tubule, which can be due
to a decreased amount of PGE2 in the kidney.
[0052] Any antagonist of P2Y that inhibits its function can be used
with the methods disclosed herein. Examples of such antagonists are
disclosed throughout. In one embodiment, the P2Y receptor
antagonist is specific for P2Y2. Antagonists such as suramin,
reactive blue 2, acid blue 129, acid blue 80, and
pyridoxalphosphate-6-azophenyl-2',4'-disulfonic acid (PPADS) can
antagonize P2Y2 (Schwiebert and Kishore, 2001). Other P2Y2
antagonists can be identified by methods described herein.
[0053] Also disclosed herein are combination therapies to be used
together with a P2Y antagonist. Any of the combination therapies
described herein can be used singly with the P2Y antagonist, or in
combination with each other as well as the P2Y antagonist.
[0054] For example, apyrase or other nucleotide hydrolyzing
enzymes, such as NTPDases (nucleoside triphosphate
diphosphohydrolases) can be used with the methods disclosed herein,
either alone or in combination with specific P2Y2 receptor
antagonists to achieve the best possible effect in controlling
polyuria and hypematremia.
[0055] Disclosed herein are methods wherein the P2Y antagonist is
used in combination with inhibitors of prostaglandin synthesis.
Inhibitors of prostaglandin sysnthesis, such as indomethacin
(non-specific) and specific inhibitors of cyclooxygenase-1 (COX-1)
and COX-2 (eg. rofecoxib), for example, have previously been used
in the treatment of NDI. The dose of inhibitors of prostaglandin
synthesis can be reduced by combining them with a P2Y2 receptor
antagonist. More than one inhibitor of prostaglandin synthesis can
be used with the P2Y antagonist.
[0056] Also disclosed are methods wherein the P2Y antagonist is
used in combination with inhibitors of arachidonic acid release.
Since the availability of "free" arachidonic acid is the
rate-limiting factor in the synthesis of prostaglandins by COX,
agents that reduce the availability of "free" arachidonic acid can
also limit the synthesis of prostaglandins such as PGE2. Examples
of such agents are those that inhibit phospholipases such as
cytosolic phospholipase A2 (cPLA2), calcium insensitive
phospholipase A2 (iPLA2), and phospholipase D (PLD), for example.
An agent that decreases the availability of free arachidonic acid
and an antagonist of P2Y receptor can be combined. More than one
inhibitor of arachidonic acid release can be used in combination
with a P2Y antagonist.
[0057] Disclosed herein are methods wherein a P2Y antagonist is
used in combination with a composition that increases cAMP.
Furthermore, since cellular cyclic AMP are critical for the
expression of AQP2 water channel, combination therapies can be used
wherein agents that increase cellular cAMP are used in combination
with a P2Y antagonist. These include, but are not limited to,
inhibitors of phosphodiesterases (PDEs) a group of enzymes that
hydrolyze cAMP. Inhibitors of PDEs increase the cellular cAMP
levels by preventing its degradation. In another example, the
cellular cAMP levels can be increased by activating adenylyl
cyclase (AC), the enzyme(s) that produce cAMP from ATP. One such
agent is Forskolin. Hence, included in the methods disclosed herein
are combination therapies that include agents which increase
cellular cAMP either by preventing its degradation (inhibitors of
PDEs) or increase its synthesis (activators of AC, such as
Forskolin). Since increased cellular cAMP acting through protein
kinase A (PKA) caused shuttling of AQP2 to apical membrane, a
combination therapy including PKA activator and P2Y2 receptor
antagonist can also be used.
[0058] Also disclosed are methods wherein a P2Y antagonist is used
in combination with a composition that inhibits protein kinase
C(PKC). PKC plays a critical role in the P2Y2 receptor-mediated
decrease in water transport in the collecting duct. Hence a
combination therapy including P2Y receptor antagonist and an
inhibitor of PKC can be used with the methods described herein.
Similarly, MAP kinases play critical role in the activation of some
phospholipases. Hence a combination therapy including a MAP kinase
kinase (MEK) inhibitor and a P2Y2 receptor antagonist can also be
used with the methods disclosed herein.
[0059] The methods disclosed herein also comprise a P2Y antagonist
used in combination with a diuretic. Since polyuria of NDI can be
ameliorated by dosing of a thiazide with a potassium sparing
diuretic like amiloride, combination therapies including either a
diuretic or amiloride or both along with a P2Y receptor antagonist
can be used with the method disclosed herein. Also, combinations of
thiazide with or without amiloride and prostangladin synthesis
inhibitors given along with P2Y2 receptor antagonists can be used
with the methods disclosed herein.
[0060] Also disclosed are methods wherein thiazide is used in
combination with a prostaglandin synthesis inhibitor. The P2Y
antagonist can be used in combination with a non-specific blocker
of prostanoid receptors or with a selective blocker of prostanoid
receptors. The selective blocker can involve an EP3 prostanoid
receptor, or a combination of EP3 and EP1 prostanoid receptors, or
any one or more other prostanoid receptors.
[0061] Also disclosed are methods wherein the P2Y antagonist is
used in combination with a non-specific or specific blockers of
prostaglandin transporters (PGT). Prostaglandin transporters (PGT)
are specific membrane proteins that facilitate the "rapid" release
of prostaglandins from the cells. (Prostaglandins, being lipid
derivatives, can diffuse through cell membranes even without PGTs,
albeit at a lesser rapidity). The release of PGE2 from cells,
including collecting duct principal cells, is dependent on specific
PGTs in the cell membranes (Bao et al, 2002). Several PGTs have
been cloned and characterized. These are broadly expressed in
COX-positive cells and are coordinately regulated by COX. However,
in Madin-Darby canine kidney cells (MDCK cells), it appears that
the PGTs are exocytotically inserted into the apical membrane,
where they control the concentration of luminal prostglandins (Endo
et al, 2002. Therefore, the P2Y antagonist can be used in
combination with an agent that inhibits or blocks the release of
prostaglandins from cells. Alternatively, the P2Y receptor
antagonist can be used in combination with agents that enhance the
degradation or inactivation of prostaglandins released from the
cells.
[0062] Also disclosed herein are P2Y agonists, as well as methods
for treating fluid retention by administering a P2Y agonist. For
example, agonists of P2Y2 receptor act as mild diuretics acting on
the medullary collecting duct. The currently available diuretic
agents act on either the medullary thick ascending limb (loop
diuretics such as furosemide) or on the distal nephron (thiazide
diuretics). These two classes of diuretics inhibit the water
reabsoprtion by essentially interfering with salt absorption.
Because of this, their clinical usage has to be carefully
monitored, failing which patients may suffer sodium and other
electrolyte imbalances. However, in the medullary collecting duct
the absorption of water is not linked to the absorption of salt
(free water absorption). Hence targeting the medullary collecting
duct for diuretic action, using P2Y2 receptor agonists can provide
better diuretic action without the associated complications of
electrolyte imbalances. Therefore, disclosed herein are methods of
administering to a subject a P2Y agonist, wherein the P2Y agonist
acts as a diuretic.
[0063] Diuretics are useful in the treatment of various medical
disorders which result in fluid retention, congestive heart
failure, and hypertension. As such these pharmaceutical compounds
can be useful in treating the fluid retention and dilutional
hyponatremia associated with a number of severe pathologies such as
congestive heart failure, chronic liver disease, hepato-renal
syndrome, benign and malignant tumors of the lung, liver and
central nervous system. Because diuretics are useful in such a
large variety of disorders, their use is widespread but complicated
by an associated loss of electrolytes such as potassium which is
important to carrying out nervous and cardiovascular systems
functions.
[0064] In therapeutic use for treating, or combatting, water
retentive states in warm-blooded animals, the compounds or
pharmaceutical compositions thereof can be administered orally
and/or parenterally at a dosage to obtain and maintain a
concentration, that is, an amount, or blood-level of active
component in the animal undergoing treatment which will be
effective as a diuretic. Generally, such diuretic effective dosage
of active component will be in the range of about 0.15 to about 30,
more preferably about 1 to about 10 mg/kg of body weight/day. It is
to be understood that the dosages may vary depending upon the
requirements of the patient, the severity of the water retention
being treated, and the particular compound being used. Also, it is
to be understood that the initial dosage administered may be
increased beyond the above upper level in order to rapidly achieve
the desired blood-level or the initial dosage may be smaller than
the optimum and the daily dosage may be progressively increased
during the course of treatment depending on the particular
situation. If desired, the daily dose may also be divided into
multiple doses for administration, e.g., two to four times per
day.
[0065] 2. General composition information
[0066] Disclosed herein are many types of compositions, including
the P2Y antagonists, as well as PGE2, AQP2, arginine vasopressin,
and the P2Y receptors. The information contained herein relates to
all of these compositions, as well as analogs, fragments, and
portions thereof.
[0067] a) Nucleic acids
[0068] There are a variety of molecules disclosed herein that are
nucleic acid based, including for example the nucleic acids that
encode, for example the purinergic receptors, as well as various
functional nucleic acids. The disclosed nucleic acids are made up
of, for example, nucleotides, nucleotide analogs, or nucleotide
substitutes. Non-limiting examples of these and other molecules are
discussed herein. It is understood that for example, when a vector
is expressed in a cell that the expressed mRNA will typically be
made up of A, C, G, and U. Likewise, it is understood that if, for
example, an antisense molecule is introduced into a cell or cell
environment through for example exogenous delivery, it is
advantagous that the antisense molecule be made up of nucleotide
analogs that reduce the degradation of the antisense molecule in
the cellular environment.
[0069] (1) Nucleotides and Related Molecules
[0070] A nucleotide is a molecule that contains a base moiety, a
sugar moiety and a phosphate moiety. Nucleotides can be linked
together through their phosphate moieties and sugar moieties
creating an internucleoside linkage. The base moiety of a
nucleotide can be adenin-9-yl (A), cytosin-1-yl (C), guanin-9-yl
(G), uracil-1-yl (U), and thymin-1-yl (T). The sugar moiety of a
nucleotide is a ribose or a deoxyribose. The phosphate moiety of a
nucleotide is pentavalent phosphate. A non-limiting example of a
nucleotide would be 3'-AMP (3'-adenosine monophosphate) or 5'-GMP
(5'-guanosine monophosphate).
[0071] A nucleotide analog is a nucleotide, which contains some
type of modification to the base, sugar, or phosphate moieties.
Modifications to nucleotides are well known in the art and would
include for example, 5-methylcytosine (5-me-C), 5-hydroxymethyl
cytosine, xanthine, hypoxanthine, and 2-aminoadenine as well as
modifications at the sugar or phosphate moieties.
[0072] Nucleotide substitutes are molecules having similar
functional properties to nucleotides, but which do not contain a
phosphate moiety, such as peptide nucleic acid (PNA). Nucleotide
substitutes are molecules that will recognize nucleic acids in a
Watson-Crick or Hoogsteen manner, but which are linked together
through a moiety other than a phosphate moiety. Nucleotide
substitutes are able to conform to a double helix type structure
when interacting with the appropriate target nucleic acid.
[0073] It is also possible to link other types of molecules
(conjugates) to nucleotides or nucleotide analogs to enhance for
example, cellular uptake. Conjugates can be chemically linked to
the nucleotide or nucleotide analogs. Such conjugates include but
are not limited to lipid moieties such as a cholesterol moiety.
(Letsinger et al., Proc. Natl. Acad. Sci. USA,
1989,86,6553-6556),
[0074] A Watson-Crick interaction is at least one interaction with
the Watson-Crick face of a nucleotide, nucleotide analog, or
nucleotide substitute. The Watson-Crick face of a nucleotide,
nucleotide analog, or nucleotide substitute includes the C2, N1,
and C6 positions of a purine based nucleotide, nucleotide analog,
or nucleotide substitute and the C2, N3, C4 positions of a
pyrimidine based nucleotide, nucleotide analog, or nucleotide
substitute.
[0075] A Hoogsteen interaction is the interaction that takes place
on the Hoogsteen face of a nucleotide or nucleotide analog, which
is exposed in the major groove of duplex DNA. The Hoogsteen face
includes the N7 position and reactive groups (NH2 or O) at the C6
position of purine nucleotides.
[0076] (2) Nucleotides and Related Molecules
[0077] A nucleotide analog is a nucleotide, which contains some
type of modification to the base, sugar, or phosphate moieties.
Modifications to the base moiety would include natural and
synthetic modifications of A, C, G, and T/U as well as different
purine or pyrimidine bases, such as uracil-5-yl (.psi.),
hypoxanthin-9-yl (I), and 2-aminoadenin-9-yl. A modified base
includes but is not limited to 5-methylcytosine (5-me-C),
5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine,
6-methyl and other alkyl derivatives of adenine and guanine,
2-propyl and other alkyl derivatives of adenine and guanine,
2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and
cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine
and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo,
8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted
adenines and guanines, 5-halo particularly 5-bromo,
5-trifluoromethyl and other 5-substituted uracils and cytosines,
7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine,
7-deazaguanine and 7-deazaadenine and 3-deazaguanine and
3-deazaadenine. Additional base modifications can be found for
example in U.S. Pat. No. 3,687,808, Englisch et al., Angewandte
Chemie, International Edition, 1991, 30, 613, and Sanghvi, Y. S.,
Chapter 15, Antisense Research and Applications, pages 289-302,
Crooke, S. T. and Lebleu, B. ed., CRC Press, 1993. Certain
nucleotide analogs, such as 5-substituted pyrimidines,
6-azapyrimidines and N-2, N-6 and O-6 substituted purines,
including 2-aminopropyladenine, 5-propynyluracil and
5-propynylcytosine. 5-methylcytosine can increase the stability of
duplex formation. Often time base modifications can be combined
with for example a sugar modification, such as 2'-O-methoxyethyl,
to achieve unique properties such as increased duplex stability.
There are numerous United States patents such as U.S. Pat. Nos.
4,845,205; 5,130,302; 5,134,066; 5,175,273; 5,367,066; 5,432,272;
5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540;
5,587,469; 5,594,121, 5,596,091; 5,614,617; and 5,681,941, which
detail and describe a range of base modifications. Each of these
patents is herein incorporated by reference.
[0078] Nucleotide analogs can also include modifications of the
sugar moiety. Modifications to the sugar moiety would include
natural modifications of the ribose and deoxy ribose as well as
synthetic modifications. Sugar modifications include but are not
limited to the following modifications at the 2' position: OH; F;
O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O- , S- or N-alkynyl; or
O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl can be
substituted or unsubstituted C.sub.1 to C.sub.10, alkyl or C.sub.2
to C.sub.10 alkenyl and alkynyl. 2' sugar modifications also
include but are not limited to --O[(CH.sub.2).sub.n O].sub.m
CH.sub.3, --O(CH.sub.2).sub.n OCH.sub.3, --O(CH.sub.2).sub.n
NH.sub.2, --O(CH.sub.2).sub.n, CH.sub.3,
--O(CH.sub.2).sub.n--ONH.sub.2, and
--O(CH.sub.2).sub.nON[(CH.sub.2).sub.n CH.sub.3)].sub.2, where n
and m are from 1 to about 10.
[0079] Other modifications at the 2' position include but are not
limited to: C.sub.1 to C.sub.10 lower alkyl, substituted lower
alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH.sub.3,
OCN, Cl, Br, CN, CF.sub.3, OCF.sub.3, SOCH.sub.3, SO.sub.2
CH.sub.3, ONO.sub.2, NO.sub.2, N3, NH.sub.2, heterocycloalkyl,
heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted
silyl, an RNA cleaving group, a reporter group, an intercalator, a
group for improving the pharmacokinetic properties of an
oligonucleotide, or a group for improving the pharmacodynamic
properties of an oligonucleotide, and other substituents having
similar properties. Similar modifications can also be made at other
positions on the sugar, particularly the 3' position of the sugar
on the 3' terminal nucleotide or in 2'-5' linked oligonucleotides
and the 5' position of 5' terminal nucleotide. Modified sugars
would also include those that contain modifications at the bridging
ring oxygen, such as CH.sub.2 and S, Nucleotide sugar analogs can
also have sugar mimetics such as cyclobutyl moieties in place of
the pentofuranosyl sugar. There are numerous United States patents
that teach the preparation of such modified sugar structures such
as U.S. Pat. Nos. 4,981,957; 5,118,800; 5,319,080; 5,359,044;
5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811;
5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873;
5,646,265; 5,658,873; 5,670,633; and 5,700,920, each of which is
herein incorporated by reference in its entirety.
[0080] Nucleotide analogs can also be modified at the phosphate
moiety. Modified phosphate moieties include but are not limited to
those that can be modified so that the linkage between two
nucleotides contains a phosphorothioate, chiral phosphorothioate,
phosphorodithioate, phosphotriester, aminoalkylphosphotriester,
methyl and other alkyl phosphonates including 3'-alkylene
phosphonate and chiral phosphonates, phosphinates, phosphoramidates
including 3'-amino phosphoramidate and aminoalkylphosphoramidates,
thionophosphoramidates, thionoalkylphosphonates,
thionoalkylphosphotriesters, and boranophosphates. It is understood
that these phosphate or modified phosphate linkage between two
nucleotides can be through a 3'-5' linkage or a 2'-5' linkage, and
the linkage can contain inverted polarity such as 3'-5' to 5'-3' or
2'-5' to 5'-2'. Various salts, mixed salts and free acid forms are
also included. Numerous United States patents teach how to make and
use nucleotides containing modified phosphates and include but are
not limited to, U.S. Pat. Nos. 3,687,808; 4,469,863; 4,476,301;
5,023,243; 5,177,196; 5,188,897; 5,264,423; 5,276,019; 5,278,302;
5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233;
5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,306; 5,550,111;
5,563,253; 5,571,799; 5,587,361; and 5,625,050, each of which is
herein incorporated by reference.
[0081] It is understood that nucleotide analogs need only contain a
single modification, but can also contain multiple modifications
within one of the moieties or between different moieties.
[0082] Nucleotide substitutes are molecules having similar
functional properties to nucleotides, but which do not contain a
phosphate moiety, such as peptide nucleic acid (PNA). Nucleotide
substitutes are molecules that will recognize nucleic acids in a
Watson-Crick or Hoogsteen manner, but which are linked together
through a moiety other than a phosphate moiety. Nucleotide
substitutes are able to conform to a double helix type structure
when interacting with the appropriate target nucleic acid.
[0083] Nucleotide substitutes are nucleotides or nucleotide analogs
that have had the phosphate moiety and/or sugar moieties replaced.
Nucleotide substitutes do not contain a standard phosphorus atom.
Substitutes for the phosphate can be for example, short chain alkyl
or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl
or cycloalkyl internucleoside linkages, or one or more short chain
heteroatomic or heterocyclic internucleoside linkages. These
include those having morpholino linkages (formed in part from the
sugar portion of a nucleoside); siloxane backbones; sulfide,
sulfoxide and sulfone backbones, formacetyl and thioformacetyl
backbones; methylene formacetyl and thioformacetyl backbones;
alkene containing backbones; sulfamate backbones; methyleneimino
and methylenehydrazino backbones; sulfonate and sulfonamide
backbones; amide backbones; and others having mixed N, O, S and
CH.sub.2 component parts. Numerous United States patents disclose
how to make and use these types of phosphate replacements and
include but are not limited to U.S. Pat. Nos. 5,034,506; 5,166,315;
5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,264,562; 5,264,564;
5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307;
5,561,225; 5,596,086; 5,602,240; 5,610,289; 5,602,240; 5,608,046;
5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437;
and 5,677,439, each of which is herein incorporated by
reference.
[0084] It is also understood in a nucleotide substitute that both
the sugar and the phosphate moieties of the nucleotide can be
replaced, by for example an amide type linkage (aminoethylglycine)
(PNA). U.S. Pat. Nos. 5,539,082; 5,714,331; and 5,719,262 teach how
to make and use PNA molecules, each of which is herein incorporated
by reference. (See also Nielsen et al., Science, 1991, 254,
1497-1500).
[0085] It is also possible to link other types of molecules
(conjugates) to nucleotides or nucleotide analogs to enhance for
example, cellular uptake. Conjugates can be chemically linked to
the nucleotide or nucleotide analogs. Such conjugates include but
are not limited to lipid moieties such as a cholesterol moiety
(Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86,6553-6556),
cholic acid (Manoharan et al., Bioorg. Med. Chem. Let., 1994, 4,
1053-1060), a thioether, e.g., hexyl-5-tritylthiol (Manoharan et
al., Ann. N.Y. Acad. Sci., 1992, 660, 306-309; Manoharan et al.,
Bioorg. Med. Chem. Let., 1993, 3, 2765-2770), a thiocholesterol
(Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), an
aliphatic chain, e.g., dodecandiol or undecyl residues
(Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et
al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie,
1993, 75, 49-54), a phospholipid, e.g., di-hexadecyl-rac-glycerol
or triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate
(Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et
al., Nucl. Acids Res., 1990, 18, 3777-3783), a polyamine or a
polyethylene glycol chain (Manoharan et al., Nucleosides &
Nucleotides, 1995, 14, 969-973), or adamantane acetic acid
(Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654), a
palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264,
229-237), or an octadecylamine or
hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J.
Pharmacol. Exp. Ther., 1996, 277, 923-937. Numerous United States
patents teach the preparation of such conjugates and include, but
are not limited to U.S. Pat. Nos. 4,828,979; 4,948,882; 5,218,105;
5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717, 5,580,731;
5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077;
5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735;
4,667,025; 4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335;
4,904,582; 4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830;
5,112,963; 5,214,136; 5,245,022; 5,254,469; 5,258,506; 5,262,536;
5,272,250; 5,292,873; 5,317,098; 5,371,241, 5,391,723; 5,416,203,
5,451,463; 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810;
5,574,142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923;
5,599,928 and 5,688,941, each of which is herein incorporated by
reference.
[0086] A Watson-Crick interaction is at least one interaction with
the Watson-Crick face of a nucleotide, nucleotide analog, or
nucleotide substitute. The Watson-Crick face of a nucleotide,
nucleotide analog, or nucleotide substitute includes the C2, N1,
and C6 positions of a purine based nucleotide, nucleotide analog,
or nucleotide substitute and the C2, N3, C4 positions of a
pyrimidine based nucleotide, nucleotide analog, or nucleotide
substitute.
[0087] A Hoogsteen interaction is the interaction that takes place
on the Hoogsteen face of a nucleotide or nucleotide analog, which
is exposed in the major groove of duplex DNA. The Hoogsteen face
includes the N7 position and reactive groups (NH.sub.2 or O) at the
C6 position of purine nucleotides.
[0088] (3) Sequences
[0089] There are a variety of sequences related to the purinergic
receptors having the following Genbank Accession Numbers and these
sequences and others are herein incorporated by reference in their
entireties as well as for individual subsequences contained
therein.
[0090] There are many sequences of the P2Y receptor, and
specifically the P2Y2 receptor, which can be found for example in
Genbank Accession Nos: AY620400, AY662405, AY620399, NM001004501,
NM183168, for example, all of which are herein incorporated by
reference. It is understood that the description related to this
sequence is applicable to any sequence related to purinergic
receptors, for example, unless specifically indicated otherwise.
Those of skill in the art understand how to resolve sequence
discrepancies and differences and to adjust the compositions and
methods relating to a particular sequence to other related
sequences. Primers and/or probes can be designed for any of the
purinergic receptor sequences given the information disclosed
herein and known in the art.
[0091] (4) Primers And Probes
[0092] Disclosed are compositions including primers and probes,
which are capable of interacting with the purinergic receptors as
disclosed herein. In certain embodiments the primers are used to
support DNA amplification reactions. Typically the primers will be
capable of being extended in a sequence specific manner. Extension
of a primer in a sequence specific manner includes any methods
wherein the sequence and/or composition of the nucleic acid
molecule to which the primer is hybridized or otherwise associated
directs or influences the composition or sequence of the product
produced by the extension of the primer. Extension of the primer in
a sequence specific manner therefore includes, but is not limited
to, PCR, DNA sequencing, DNA extension, DNA polymerization, RNA
transcription, or reverse transcription. Techniques and conditions
that amplify the primer in a sequence specific manner are
preferred. In certain embodiments the primers are used for the DNA
amplification reactions, such as PCR or direct sequencing. It is
understood that in certain embodiments the primers can also be
extended using non-enzymatic techniques, where for example, the
nucleotides or oligonucleotides used to extend the primer are
modified such that they will chemically react to extend the primer
in a sequence specific manner. Typically the disclosed primers
hybridize with a purinergic receptor nucleic acid or region of the
purinergic receptor nucleic acid or they hybridize with the
complement of the purinergic receptor nucleic acid or complement of
a region of the purinergic receptor nucleic acid.
[0093] b) Delivery of the Compositions to Cells
(1) Nucleic Acid Delivery
[0094] There are a number of compositions and methods which can be
used to deliver nucleic acids to cells, either in vitro or in vivo.
These methods and compositions can largely be broken down into two
classes: viral based delivery systems and non-viral based delivery
systems. For example, the nucleic acids can be delivered through a
number of direct delivery systems such as, electroporation,
lipofection, calcium phosphate precipitation, plasmids, viral
vectors, viral nucleic acids, phage nucleic acids, phages, cosmids,
or via transfer of genetic material in cells or carriers such as
cationic liposomes. Appropriate means for transfection, including
viral vectors, chemical transfectants, or physico-mechanical
methods such as electroporation and direct diffusion of DNA, are
described by, for example, Wolff, J. A., et al., Science, 247,
1465-1468, (1990); and Wolff, J. A. Nature, 352, 815-818, (1991)
Such methods are well known in the art and readily adaptable for
use with the compositions and methods described herein. In certain
cases, the methods will be modified to specifically function with
large DNA molecules. Further, these methods can be used to target
certain diseases and cell populations by using the targeting
characteristics of the carrier.
[0095] In the methods described herein, which include the
administration and uptake of exogenous DNA into the cells of a
subject (i.e., gene transduction or transfection), the disclosed
nucleic acids can be in the form of naked DNA or RNA, or the
nucleic acids can be in a vector for delivering the nucleic acids
to the cells, whereby the encoding DNA or DNA or fragment is under
the transcriptional regulation of a promoter, as would be well
understood by one of ordinary skill in the art as well as
enhancers. The vector can be a commercially available preparation,
such as an adenovirus vector (Quantum Biotechnologies, Inc. (Laval,
Quebec, Canada).
[0096] As one example, vector delivery can be via a viral system,
such as a retroviral vector system which can package a recombinant
retroviral genome (see e.g., Pastan et al., Proc. Natl. Acad. Sci.
U.S.A. 85:4486, 1988; Miller et al., Mol. Cell. Biol. 6:2895,
1986). The recombinant retrovirus can then be used to infect and
thereby deliver to the infected cells nucleic acid encoding a
broadly neutralizing antibody (or active fragment thereof). The
exact method of introducing the altered nucleic acid into mammalian
cells is, of course, not limited to the use of retroviral vectors.
Other techniques are widely available for this procedure including
the use of adenoviral vectors (Mitani et al., Hum. Gene Ther.
5:941-948, 1994), adeno-associated viral (AAV) vectors (Goodman et
al., Blood 84:1492-1500, 1994), lentiviral vectors (Naidini et al.,
Science 272:263-267, 1996), pseudotyped retroviral vectors (Agrawal
et al., Exper. Hematol. 24:738-747, 1996). Physical transduction
techniques can also be used, such as liposome delivery and
receptor-mediated and other endocytosis mechanisms (see, for
example, Schwartzenberger et al., Blood 87:472-478, 1996). The
disclosed compositions and methods can be used in conjunction with
any of these or other commonly used gene transfer methods.
[0097] As one example, if the antibody-encoding nucleic acid or
some other nucleic acid encoding a purinergic receptor interactions
is delivered to the cells of a subject in an adenovirus vector, the
dosage for administration of adenovirus to humans can range from
about 10.sup.7 to 10.sup.9 plaque forming units (pfu) per injection
but can be as high as 10.sup.12 pfu per injection (Crystal, Hum.
Gene Ther. 8:985-1001, 1997; Alvarez and Curiel, Hum. Gene Ther.
8:597-613, 1997). A subject can receive a single injection, or, if
additional injections are necessary, they can be repeated at
six-month intervals (or other appropriate time intervals, as
determined by the skilled practitioner) for an indefinite period
and/or until the efficacy of the treatment has been
established.
[0098] Parenteral administration of the nucleic acid or vector, if
used, is generally characterized by injection. Injectables can be
prepared in conventional forms, either as liquid solutions or
suspensions, solid forms suitable for solution of suspension in
liquid prior to injection, or as emulsions. A more recently revised
approach for parenteral administration involves use of a slow
release or sustained release system such that a constant dosage is
maintained. See, e.g., U.S. Pat. No. 3,610,795, which is
incorporated by reference herein. For additional discussion of
suitable formulations and various routes of administration of
therapeutic compounds, see, e.g., Remington: The Science and
Practice of Pharmacy (19th ed.) ed. A. R. Gennaro, Mack Publishing
Company, Easton, Pa. 1995.
[0099] Nucleic acids that are delivered to cells which are to be
integrated into the host cell genome, typically contain integration
sequences. These sequences are often viral related sequences,
particularly when viral based systems are used. These viral
integration systems can also be incorporated into nucleic acids
which are to be delivered using a non-nucleic acid based system of
deliver, such as a liposome, so that the nucleic acid contained in
the delivery system can be come integrated into the host
genome.
[0100] Other general techniques for integration into the host
genome include, for example, systems designed to promote homologous
recombination with the host genome. These systems typically rely on
sequence flanking the nucleic acid to be expressed that has enough
homology with a target sequence within the host cell genome that
recombination between the vector nucleic acid and the target
nucleic acid takes place, causing the delivered nucleic acid to be
integrated into the host genome. These systems and the methods
necessary to promote homologous recombination are known to those of
skill in the art.
[0101] (2) Non-Nucleic Acid Based Systems
[0102] The disclosed compositions can be delivered to the target
cells in a variety of ways. For example, the compositions can be
delivered through electroporation, or through lipofection, or
through calcium phosphate precipitation. The delivery mechanism
chosen will depend in part on the type of cell targeted and whether
the delivery is occurring for example in vivo or in vitro.
[0103] Thus, the compositions can comprise, in addition to the
disclosed compositions or vectors for example, lipids such as
liposomes, such as cationic liposomes (e.g., DOTMA, DOPE,
DC-cholesterol) or anionic liposomes. Liposomes can further
comprise proteins to facilitate targeting a particular cell, if
desired. Administration of a composition comprising a compound and
a cationic liposome can be administered to the blood afferent to a
target organ or inhaled into the respiratory tract to target cells
of the respiratory tract. Regarding liposomes, see, e.g., Brigham
et al. Am. J. Resp. Cell. Mol. Biol. 1:95-100 (1989); Felgner et
al. Proc. Natl. Acad. Sci. USA 84:7413-7417 (1987); U.S. Pat. No.
4,897,355. Furthermore, the compound can be administered as a
component of a microcapsule that can be targeted to specific cell
types, such as macrophages, or where the diffusion of the compound
or delivery of the compound from the microcapsule is designed for a
specific rate or dosage.
[0104] In the methods described above which include the
administration and uptake of exogenous DNA into the cells of a
subject (i.e., gene transduction or transfection), delivery of the
compositions to cells can be via a variety of mechanisms. As one
example, delivery can be via a liposome, using commercially
available liposome preparations such as LIPOFECTIN, LIPOFECTAMINE
(GIBCO-BRL, Inc., Gaithersburg, Md.), SUPERFECT (Qiagen, Inc.
Hilden, Germany) and TRANSFECTAM (Promega Biotec, Inc., Madison,
Wis.), as well as other liposomes developed according to procedures
standard in the art. In addition, the nucleic acid or vector can be
delivered in vivo by electroporation, the technology for which is
available from Genetronics, Inc. (San Diego, Calif.) as well as by
means of a SONOPORATION machine (ImaRx Pharmaceutical Corp.,
Tucson, Ariz.).
[0105] The materials can be in solution, suspension (for example,
incorporated into microparticles, liposomes, or cells). These can
be targeted to a particular cell type via antibodies, receptors, or
receptor ligands. The following references are examples of the use
of this technology to target specific proteins to tumor tissue
(Senter, et al., Bioconjugate Chem., 2:447-451, (1991); Bagshawe,
K. D., Br. J. Cancer, 60:275-281, (1989); Bagshawe, et al., Br. J.
Cancer, 58:700-703, (1988); Senter, et al., Bioconjugate Chem.,
4:3-9, (1993); Battelli, et al., Cancer Immunol. Immunother.,
35:421-425, (1992); Pietersz and McKenzie, Immunolog. Reviews,
129:57-80, (1992); and Roffler, et al., Biochem. Pharmacol,
42:2062-2065, (1991)). These techniques can be used for a variety
of other specific cell types. Vehicles such as "stealth" and other
antibody conjugated liposomes (including lipid mediated drug
targeting to colonic carcinoma), receptor mediated targeting of DNA
through cell specific ligands, lymphocyte directed tumor targeting,
and highly specific therapeutic retroviral targeting of murine
glioma cells in vivo. The following references are examples of the
use of this technology to target specific proteins to tumor tissue
(Hughes et al., Cancer Research, 49:6214-6220, (1989); and
Litzinger and Huang, Biochimica et Biophysica Acta, 1104:179-187,
(1992)). In general, receptors are involved in pathways of
endocytosis, either constitutive or ligand induced. These receptors
cluster in clathrin-coated pits, enter the cell via clathrin-coated
vesicles, pass through an acidified endosome in which the receptors
are sorted, and then either recycle to the cell surface, become
stored intracellularly, or are degraded in lysosomes. The
internalization pathways serve a variety of functions, such as
nutrient uptake, removal of activated proteins, clearance of
macromolecules, opportunistic entry of viruses and toxins,
dissociation and degradation of ligand, and receptor-level
regulation. Many receptors follow more than one intracellular
pathway, depending on the cell type, receptor concentration, type
of ligand, ligand valency, and ligand concentration. Molecular and
cellular mechanisms of receptor-mediated endocytosis have been
reviewed (Brown and Greene, DNA and Cell Biology 10:6, 399-409
(1991)).
[0106] (3) In Vivo/Ex Vivo
[0107] As described above, the compositions can be administered in
a pharmaceutically acceptable carrier and can be delivered to the
subjects cells in vivo and/or ex vivo by a variety of mechanisms
well known in the art (e.g., uptake of naked DNA, liposome fusion,
intramuscular injection of DNA via a gene gun, endocytosis and the
like).
[0108] If ex vivo methods are employed, cells or tissues can be
removed and maintained outside the body according to standard
protocols well known in the art. The compositions can be introduced
into the cells via any gene transfer mechanism, such as, for
example, calcium phosphate mediated gene delivery, electroporation,
microinjection or proteoliposomes. The transduced cells can then be
infused (e.g., in a pharmaceutically acceptable carrier) or
homotopically transplanted back into the subject per standard
methods for the cell or tissue type. Standard methods are known for
transplantation or infusion of various cells into a subject.
[0109] c) Expression Systems
[0110] The nucleic acids that are delivered to cells typically
contain expression-controlling systems. For example, the inserted
genes in viral and retroviral systems usually contain promoters,
and/or enhancers to help control the expression of the desired gene
product. A promoter is generally a sequence or sequences of DNA
that function when in a relatively fixed location in regard to the
transcription start site. A promoter contains core elements
required for basic interaction of RNA polymerase and transcription
factors, and can contain upstream elements and response
elements.
[0111] (1) Viral Promoters and Enhancers
[0112] Preferred promoters controlling transcription from vectors
in mammalian host cells can be obtained from various sources, for
example, the genomes of viruses such as: polyoma, Simian Virus 40
(SV40), adenovirus, retroviruses, hepatitis-B virus and most
preferably cytomegalovirus, or from heterologous mammalian
promoters, e.g. beta actin promoter. The early and late promoters
of the SV40 virus are conveniently obtained as an SV40 restriction
fragment which also contains the SV40 viral origin of replication
(Fiers et al., Nature, 273: 113 (1978)). The immediate early
promoter of the human cytomegalovirus is conveniently obtained as a
HindIII E restriction fragment (Greenway, P. J. et al., Gene 18:
355-360 (1982)). Of course, promoters from the host cell or related
species also are useful herein.
[0113] Enhancer generally refers to a sequence of DNA that
functions at no fixed distance from the transcription start site
and can be either 5' (Laimins, L. et al., Proc. Natl. Acad. Sci.
78: 993 (1981)) or 3' (Lusky, M. L., et al., Mol. Cell. Bio. 3:
1108 (1983)) to the transcription unit. Furthermore, enhancers can
be within an intron (Banerji, J. L. et al., Cell 33: 729 (1983)) as
well as within the coding sequence itself (Osborne, T. F., et al.,
Mol. Cell. Bio. 4: 1293 (1984)). They are usually between 10 and
300 bp in length, and they function in cis. Enhancers function to
increase transcription from nearby promoters. Enhancers also often
contain response elements that mediate the regulation of
transcription. Promoters can also contain response elements that
mediate the regulation of transcription. Enhancers often determine
the regulation of expression of a gene. While many enhancer
sequences are now known from mammalian genes (globin, elastase,
albumin, .alpha.-fetoprotein and insulin), typically one will use
an enhancer from a eukaryotic cell virus for general expression.
Examples are the SV40 enhancer on the late side of the replication
origin (bp 100-270), the cytomegalovirus early promoter enhancer,
the polyoma enhancer on the late side of the replication origin,
and adenovirus enhancers.
[0114] The promotor and/or enhancer can be specifically activated
either by light or specific chemical events which trigger their
function. Systems can be regulated by reagents such as tetracycline
and dexamethasone. There are also ways to enhance viral vector gene
expression by exposure to irradiation, such as gamma irradiation,
or alkylating chemotherapy drugs.
[0115] In certain embodiments the promoter and/or enhancer region
can act as a constitutive promoter and/or enhancer to maximize
expression of the region of the transcription unit to be
transcribed. In certain constructs the promoter and/or enhancer
region be active in all eukaryotic cell types, even if it is only
expressed in a particular type of cell at a particular time. A
preferred promoter of this type is the CMV promoter (650 bases).
Other preferred promoters are SV40 promoters, cytomegalovirus (full
length promoter), and retroviral vector LTF.
[0116] It has been shown that all specific regulatory elements can
be cloned and used to construct expression vectors that are
selectively expressed in specific cell types such as melanoma
cells. The glial fibrillary acetic protein (GFAP) promoter has been
used to selectively express genes in cells of glial origin.
[0117] Expression vectors used in eukaryotic host cells (yeast,
fungi, insect, plant, animal, human or nucleated cells) can also
contain sequences necessary for the termination of transcription
which can affect mRNA expression. These regions are transcribed as
polyadenylated segments in the untranslated portion of the mRNA
encoding tissue factor protein. The 3' untranslated regions also
include transcription termination sites. It is preferred that the
transcription unit also contains a polyadenylation region. One
benefit of this region is that it increases the likelihood that the
transcribed unit will be processed and transported like mRNA. The
identification and use of polyadenylation signals in expression
constructs is well established. It is preferred that homologous
polyadenylation signals be used in the transgene constructs. In
certain transcription units, the polyadenylation region is derived
from the SV40 early polyadenylation signal and consists of about
400 bases. It is also preferred that the transcribed units contain
other standard sequences alone or in combination with the above
sequences improve expression from, or stability of, the
construct.
[0118] (2) Markers
[0119] The vectors can include nucleic acid sequence encoding a
marker product. This marker product is used to determine if the
gene has been delivered to the cell and once delivered is being
expressed. Preferred marker genes are the E. Coli lacZ gene, which
encodes 13-galactosidase, and green fluorescent protein.
[0120] In some embodiments the marker can be a selectable marker.
Examples of suitable selectable markers for mammalian cells are
dihydrofolate reductase (DBFR), thymidine kinase, neomycin,
neomycin analog G418, hydromycin, and puromycin. When such
selectable markers are successfully transferred into a mammalian
host cell, the transformed mammalian host cell can survive if
placed under selective pressure. There are two widely used distinct
categories of selective regimes. The first category is based on a
cell's metabolism and the use of a mutant cell line which lacks the
ability to grow independent of a supplemented media. Two examples
are: CHO DHFR-cells and mouse LTK-cells. These cells lack the
ability to grow without the addition of such nutrients as thymidine
or hypoxanthine. Because these cells lack certain genes necessary
for a complete nucleotide synthesis pathway, they cannot survive
unless the missing nucleotides are provided in a supplemented
media. An alternative to supplementing the media is to introduce an
intact DHFR or TK gene into cells lacking the respective genes,
thus altering their growth requirements. Individual cells which
were not transformed with the DHFR or TK gene will not be capable
of survival in non-supplemented media.
[0121] The second category is dominant selection which refers to a
selection scheme used in any cell type and does not require the use
of a mutant cell line. These schemes typically use a drug to arrest
growth of a host cell. Those cells which have a novel gene would
express a protein conveying drug resistance and would survive the
selection. Examples of such dominant selection use the drugs
neomycin, (Southern P. and Berg, P., J. Molec. Appl. Genet. 1: 327
(1982)), mycophenolic acid, (Mulligan, R. C. and Berg, P. Science
209: 1422 (1980)) or hygromycin, (Sugden, B. et al., Mol. Cell.
Biol. 5: 410-413 (1985)). The three examples employ bacterial genes
under eukaryotic control to convey resistance to the appropriate
drug G418 or neomycin (geneticin), xgpt (mycophenolic acid) or
hygromycin, respectively. Others include the neomycin analog G418
and puromycin.
[0122] d) Peptides
[0123] (1) Protein Variants
[0124] As discussed herein there are numerous variants of the
purinergic receptor proteins and that are known and herein
contemplated. In addition, to the known functional purinergic
receptor species variants there are derivatives of the purinergic
receptor proteins which also function in the disclosed methods and
compositions. Protein variants and derivatives are well understood
to those of skill in the art and in can involve amino acid sequence
modifications. For example, amino acid sequence modifications
typically fall into one or more of three classes: substitutional,
insertional or deletional variants. Insertions include amino and/or
carboxyl terminal fusions as well as intrasequence insertions of
single or multiple amino acid residues. Insertions ordinarily will
be smaller insertions than those of amino or carboxyl terminal
fusions, for example, on the order of one to four residues.
Immunogenic fusion protein derivatives, such as those described in
the examples, are made by fusing a polypeptide sufficiently large
to confer immunogenicity to the target sequence by cross-linking in
vitro or by recombinant cell culture transformed with DNA encoding
the fusion. Deletions are characterized by the removal of one or
more amino acid residues from the protein sequence. Typically, no
more than about from 2 to 6 residues are deleted at any one site
within the protein molecule. These variants ordinarily are prepared
by site-specific mutagenesis of nucleotides in the DNA encoding the
protein, thereby producing DNA encoding the variant, and thereafter
expressing the DNA in recombinant cell culture. Techniques for
making substitution mutations at predetermined sites in DNA having
a known sequence are well known, for example M13 primer mutagenesis
and PCR mutagenesis. Amino acid substitutions are typically of
single residues, but can occur at a number of different locations
at once; insertions usually will be on the order of about from 1 to
10 amino acid residues; and deletions will range about from 1 to 30
residues. Deletions or insertions preferably are made in adjacent
pairs, i.e. a deletion of 2 residues or insertion of 2 residues.
Substitutions, deletions, insertions or any combination thereof can
be combined to arrive at a final construct. The mutations must not
place the sequence out of reading frame and preferably will not
create complementary regions that could produce secondary mRNA
structure. Substitutional variants are those in which at least one
residue has been removed and a different residue inserted in its
place. Such substitutions generally are made in accordance with the
following Tables 4 and 5 and are referred to as conservative
substitutions.
TABLE-US-00004 TABLE 4 Amino Acid Abbreviations Amino Acid
Abbreviations alanine Ala A allosoleucine AIle arginine Arg R
asparagine Asn N aspartic acid Asp D cysteine Cys C glutamic acid
Glu E glutamine Gln Q glycine Gly G histidine His H isolelucine Ile
I leucine Leu L lysine Lys K phenylalanine Phe F proline Pro P
pyroglutamic acid pGlu serine Ser S threonine Thr T tyrosine Tyr Y
tryptophan Trp W valine Val V
TABLE-US-00005 TABLE 5 Amino Acid Substitutions Original Exemplary
Conservative Substitutions, Residue others are known in the art.
Ala ser Arg lys, gln Asn gln; his Asp glu Cys ser Gln asn, lys Glu
asp Gly ala His asn; gln Ile leu; val Leu ile; val Lys arg; gln;
Met Leu; ile Phe met; leu; tyr Ser thr Thr ser Trp tyr Tyr trp; phe
Val ile; leu
[0125] Substantial changes in function or immunological identity
are made by selecting substitutions that are less conservative than
those in Table 5, i.e., selecting residues that differ more
significantly in their effect on maintaining (a) the structure of
the polypeptide backbone in the area of the substitution, for
example as a sheet or helical conformation, (b) the charge or
hydrophobicity of the molecule at the target site or (c) the bulk
of the side chain. The substitutions which in general are expected
to produce the greatest changes in the protein properties will be
those in which (a) a hydrophilic residue, e.g. seryl or threonyl,
is substituted for (or by) a hydrophobic residue, e.g. leucyl,
isoleucyl, phenylalanyl, valyl or alanyl; (b) a cysteine or proline
is substituted for (or by) any other residue; (c) a residue having
an electropositive side chain, e.g., lysyl, arginyl, or histidyl,
is substituted for (or by) an electronegative residue, e.g.,
glutamyl or aspartyl; or (d) a residue having a bulky side chain,
e.g., phenylalanine, is substituted for (or by) one not having a
side chain, e.g., glycine, in this case, (e) by increasing the
number of sites for sulfation and/or glycosylation.
[0126] For example, the replacement of one amino acid residue with
another that is biologically and/or chemically similar is known to
those skilled in the art as a conservative substitution. For
example, a conservative substitution would be replacing one
hydrophobic residue for another, or one polar residue for another.
The substitutions include combinations such as, for example, Gly,
Ala; Val, Ile, Leu; Asp, Glu; Asn, Gln; Ser, Thr; Lys, Arg; and
Phe, Tyr. Such conservatively substituted variations of each
explicitly disclosed sequence are included within the mosaic
polypeptides provided herein.
[0127] Substitutional or deletional mutagenesis can be employed to
insert sites for N-glycosylation (Asn-X-Thr/Ser) or O-glycosylation
(Ser or Thr). Deletions of cysteine or other labile residues also
can be desirable. Deletions or substitutions of potential
proteolysis sites, e.g. Arg, is accomplished for example by
deleting one of the basic residues or substituting one by
glutaminyl or histidyl residues.
[0128] Certain post-translational derivatizations are the result of
the action of recombinant host cells on the expressed polypeptide.
Glutaminyl and asparaginyl residues are frequently
post-translationally deamidated to the corresponding glutamyl and
asparyl residues. Alternatively, these residues are deamidated
under mildly acidic conditions. Other post-translational
modifications include hydroxylation of proline and lysine,
phosphorylation of hydroxyl groups of seryl or threonyl residues,
methylation of the o-amino groups of lysine, arginine, and
histidine side chains (T. E. Creighton, Proteins: Structure and
Molecular Properties, W. H. Freeman & Co., San Francisco pp
79-86 [1983]), acetylation of the N-terminal amine and, in some
instances, amidation of the C-terminal carboxyl.
[0129] It is understood that one way to define the variants and
derivatives of the disclosed proteins herein is through defining
the variants and derivatives in terms of homology/identity to
specific known sequences. Specifically disclosed are variants of
these and other proteins herein disclosed which have at least, 70%
or 75% or 80% or 85% or 90% or 95% homology to the stated sequence.
Those of skill in the art readily understand how to determine the
homology of two proteins. For example, the homology can be
calculated after aligning the two sequences so that the homology is
at its highest level.
[0130] Another way of calculating homology can be performed by
published algorithms. Optimal alignment of sequences for comparison
can be conducted by the local homology algorithm of Smith and
Waterman Adv. Appl. Math. 2: 482 (1981), by the homology alignment
algorithm of Needleman and Wunsch, J. Mol. Biol. 48: 443 (1970), by
the search for similarity method of Pearson and Lipman, Proc. Natl.
Acad. Sci. U.S.A. 85: 2444 (1988), by computerized implementations
of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the
Wisconsin Genetics Software Package, Genetics Computer Group, 575
Science Dr., Madison, Wis.), or by inspection.
[0131] The same types of homology can be obtained for nucleic acids
by for example the algorithms disclosed in Zuker, M. Science
244:48-52, 1989, Jaeger et al. Proc. Natl. Acad. Sci. USA
86:7706-7710, 1989, Jaeger et al. Methods Enzymol. 183:281-306,
1989 which are herein incorporated by reference for at least
material related to nucleic acid alignment.
[0132] It is understood that the description of conservative
mutations and homology can be combined together in any combination,
such as embodiments that have at least 70% homology to a particular
sequence wherein the variants are conservative mutations.
[0133] As this specification discusses various proteins and protein
sequences it is understood that the nucleic acids that can encode
those protein sequences are also disclosed. This would include all
degenerate sequences related to a specific protein sequence, i.e.
all nucleic acids having a sequence that encodes one particular
protein sequence as well as all nucleic acids, including degenerate
nucleic acids, encoding the disclosed variants and derivatives of
the protein sequences. Thus, while each particular nucleic acid
sequence cannot be written out herein, it is understood that each
and every sequence is in fact disclosed and described herein
through the disclosed protein sequence. It is also understood that
while no amino acid sequence indicates what particular DNA sequence
encodes that protein within an organism, where particular variants
of a disclosed protein are disclosed herein, the known nucleic acid
sequence that encodes that protein in the particular organism from
which that protein arises is also known and herein disclosed and
described.
[0134] e) Pharmaceutical Carriers/Delivery of Pharmaceutical
Products
[0135] As described herein, the compositions, such as the P2Y2
antagonists, can also be administered in vivo in a pharmaceutically
acceptable carrier. By "pharmaceutically acceptable" is meant a
material that is not biologically or otherwise undesirable, i.e.,
the material can be administered to a subject, along with the
nucleic acid or vector, without causing any undesirable biological
effects or interacting in a deleterious manner with any of the
other components of the pharmaceutical composition in which it is
contained. The carrier would naturally be selected to minimize any
degradation of the active ingredient and to minimize any adverse
side effects in the subject, as would be well known to one of skill
in the art.
[0136] The compositions can be administered orally, parenterally
(e.g., intravenously), by intramuscular injection, by
intraperitoneal injection, transdermally, extracorporeally,
topically or the like, including topical intranasal administration
or administration by inhalant. As used herein, "topical intranasal
administration" means delivery of the compositions into the nose
and nasal passages through one or both of the nares and can
comprise delivery by a spraying mechanism or droplet mechanism, or
through aerosolization of the composition. Administration of the
compositions by inhalant can be through the nose or mouth via
delivery by a spraying or droplet mechanism. Delivery can also be
directly to any area of the respiratory system (e.g., lungs) via
intubation. The exact amount of the compositions required will vary
from subject to subject, depending on the species, age, weight and
general condition of the subject, the severity of the allergic
disorder being treated, the particular nucleic acid or vector used,
its mode of administration and the like. Thus, it is not possible
to specify an exact amount for every composition. However, an
appropriate amount can be determined by one of ordinary skill in
the art using only routine experimentation given the teachings
herein.
[0137] Parenteral administration of the composition, if used, is
generally characterized by injection. Injectables can be prepared
in conventional forms, either as liquid solutions or suspensions,
solid forms suitable for solution of suspension in liquid prior to
injection, or as emulsions. A more recently revised approach for
parenteral administration involves use of a slow release or
sustained release system such that a constant dosage is maintained.
See, e.g., U.S. Pat. No. 3,610,795, which is incorporated by
reference herein.
[0138] The materials can be in solution, suspension (for example,
incorporated into microparticles, liposomes, or cells). These can
be targeted to a particular cell type via antibodies, receptors, or
receptor ligands. The following references are examples of the use
of this technology to target specific proteins to tumor tissue
(Senter, et al., Bioconjugate Chem., 2:447-451, (1991); Bagshawe,
K. D., Br. J. Cancer, 60:275-281, (1989); Bagshawe, et al., Br. J.
Cancer, 58:700-703, (1988); Senter, et al., Bioconjugate Chem.,
4:3-9, (1993); Battelli, et al., Cancer Immunol. Immunother.,
35:421-425, (1992); Pietersz and McKenzie, Immunolog. Reviews,
129:57-80, (1992); and Roffler, et al., Biochem. Pharmacol,
42:2062-2065, (1991)). Vehicles such as "stealth" and other
antibody conjugated liposomes (including lipid mediated drug
targeting to colonic carcinoma), receptor mediated targeting of DNA
through cell specific ligands, lymphocyte directed tumor targeting,
and highly specific therapeutic retroviral targeting of murine
glioma cells in vivo. The following references are examples of the
use of this technology to target specific proteins to tumor tissue
(Hughes et al., Cancer Research, 49:6214-6220, (1989); and
Litzinger and Huang, Biochimica et Biophysica Acta, 1104:179-187,
(1992)). In general, receptors are involved in pathways of
endocytosis, either constitutive or ligand induced. These receptors
cluster in clathrin-coated pits, enter the cell via clathrin-coated
vesicles, pass through an acidified endosome in which the receptors
are sorted, and then either recycle to the cell surface, become
stored intracellularly, or are degraded in lysosomes. The
internalization pathways serve a variety of functions, such as
nutrient uptake, removal of activated proteins, clearance of
macromolecules, opportunistic entry of viruses and toxins,
dissociation and degradation of ligand, and receptor-level
regulation. Many receptors follow more than one intracellular
pathway, depending on the cell type, receptor concentration, type
of ligand, ligand valency, and ligand concentration. Molecular and
cellular mechanisms of receptor-mediated endocytosis have been
reviewed (Brown and Greene, DNA and Cell Biology 10:6, 399-409
(1991)).
[0139] (1) Pharmaceutically Acceptable Carriers
[0140] Suitable carriers and their formulations are described in
Remington: The Science and Practice of Pharmacy (19th ed.) ed. A.
R. Gennaro, Mack Publishing Company, Easton, Pa. 1995. Typically,
an appropriate amount of a pharmaceutically-acceptable salt is used
in the formulation to render the formulation isotonic. Examples of
the pharmaceutically-acceptable carrier include, but are not
limited to, saline, Ringer's solution and dextrose solution. The pH
of the solution is preferably from about 5 to about 8, and more
preferably from about 7 to about 7.5. Further carriers include
sustained release preparations such as semipermeable matrices of
solid hydrophobic polymers containing the antagonist which matrices
are in the form of shaped articles, e.g., films, liposomes or
microparticles. It will be apparent to those persons skilled in the
art that certain carriers can be more preferable depending upon,
for instance, the route of administration and concentration of
composition being administered.
[0141] Pharmaceutical carriers are known to those skilled in the
art. These most typically would be standard carriers for
administration of drugs to humans, including solutions such as
sterile water, saline, and buffered solutions at physiological pH.
The compositions can be administered intramuscularly or
subcutaneously. Other compounds will be administered according to
standard procedures used by those skilled in the art.
[0142] Pharmaceutical compositions can include carriers,
thickeners, diluents, buffers, preservatives, surface-active agents
and the like in addition to the molecule of choice. Pharmaceutical
compositions can also include one or more active ingredients such
as antimicrobial agents, antiinflammatory agents, anesthetics, and
the like.
[0143] The pharmaceutical composition can be administered in a
number of ways depending on whether local or systemic treatment is
desired, and on the area to be treated. Administration can be
topically (including ophthalmically, vaginally, rectally,
intranasally), orally, by inhalation, or parenterally, for example
by intravenous drip, subcutaneous, intraperitoneal or intramuscular
injection. The disclosed antagonists can be administered
intravenously, intraperitoneally, intramuscularly, subcutaneously,
intracavity, or transdermally.
[0144] Preparations for parenteral administration include sterile
aqueous or non-aqueous solutions, suspensions, and emulsions.
Examples of non-aqueous solvents are propylene glycol, polyethylene
glycol, vegetable oils such as olive oil, and injectable organic
esters such as ethyl oleate. Aqueous carriers include water,
alcoholic/aqueous solutions, emulsions or suspensions, including
saline and buffered media. Parenteral vehicles include sodium
chloride solution, Ringer's dextrose, dextrose and sodium chloride,
lactated Ringer's, or fixed oils. Intravenous vehicles include
fluid and nutrient replenishers, electrolyte replenishers (such as
those based on Ringer's dextrose), and the like. Preservatives and
other additives can also be present such as, for example,
antimicrobials, anti-oxidants, chelating agents, and inert gases
and the like.
[0145] Formulations for topical administration can include
ointments, lotions, creams, gels, drops, suppositories, sprays,
liquids and powders. Conventional pharmaceutical carriers, aqueous,
powder or oily bases, thickeners and the like can be necessary or
desirable.
[0146] Compositions for oral administration include powders or
granules, suspensions or solutions in water or non-aqueous media,
capsules, sachets, or tablets. Thickeners, flavorings, diluents,
emulsifiers, dispersing aids or binders can be desirable.
[0147] Some of the compositions can potentially be administered as
a pharmaceutically acceptable acid--or base--addition salt, formed
by reaction with inorganic acids such as hydrochloric acid,
hydrobromic acid, perchloric acid, nitric acid, thiocyanic acid,
sulfuric acid, and phosphoric acid, and organic acids such as
formic acid, acetic acid, propionic acid, glycolic acid, lactic
acid, pyruvic acid, oxalic acid, malonic acid, succinic acid,
maleic acid, and fumaric acid, or by reaction with an inorganic
base such as sodium hydroxide, ammonium hydroxide, potassium
hydroxide, and organic bases such as mono-, di-, trialkyl and aryl
amines and substituted ethanolamines.
[0148] (2) Therapeutic Uses
[0149] Effective dosages and schedules for administering the
compositions can be determined empirically, and making such
determinations is within the skill in the art. The dosage ranges
for the administration of the compositions are those large enough
to produce the desired effect in which the symptoms of the disorder
are affected. The dosage should not be so large as to cause adverse
side effects, such as unwanted cross-reactions, anaphylactic
reactions, and the like. Generally, the dosage will vary with the
age, condition, sex and extent of the disease in the patient, route
of administration, or whether other drugs are included in the
regimen, and can be determined by one of skill in the art. The
dosage can be adjusted by the individual physician in the event of
any counterindications. Dosage can vary, and can be administered in
one or more dose administrations daily, for one or several days.
Guidance can be found in the literature for appropriate dosages for
given classes of pharmaceutical products. For example, guidance in
selecting appropriate doses for antagonist can be found in the
literature on therapeutic uses of antibodies, e.g., Handbook of
Monoclonal Antibodies, Ferrone et al., eds., Noges Publications,
Park Ridge, N.J., (1985) ch. 22 and pp. 303-357; Smith et al.,
Antibodies in Human Diagnosis and Therapy, Haber et al., eds.,
Raven Press, New York (1977) pp. 365-389. A typical daily dosage of
the P2Y2 antagonist used alone might range from about 1 .mu.g/kg to
up to 100 mg/kg of body weight or more per day, depending on the
factors mentioned above.
[0150] Following administration of a disclosed composition, such as
a P2Y antagonist, for the treatment of diabetes insipidus, the
efficacy of the therapeutic composition can be assessed in various
ways well known to the skilled practitioner. For instance, one of
ordinary skill in the art will understand that the compositions
disclosed herein are efficacious in modulating, such as reducing
PGE2 in the kidney, by observing that the composition reduces PGE2.
PGE2 can be measured by methods that are known in the art.
[0151] The compositions described herein can be used alone or in
combination with other therapies as disclosed herein.
[0152] The compositions disclosed herein, specifically P2Y
agonists, can be used as a diuretic.
[0153] The compositions that modulate PGE2 can be administered
prophylactically to patients or subjects who are at risk for
acquiring diabetes insipidus.
[0154] f) Computer Readable Mediums
[0155] It is understood that the disclosed nucleic acids and
proteins and compositions can be represented as a sequence
consisting of the nucleotides or amino acids. There are a variety
of ways to display these sequences, for example the nucleotide
guanosine can be represented by G or g. Likewise the amino acid
valine can be represented by Val or V. Those of skill in the art
understand how to display and express any nucleic acid or protein
sequence in any of the variety of ways that exist, each of which is
considered herein disclosed. Specifically contemplated herein is
the display of these sequences and ATP or ATP analogs on computer
readable mediums, such as, commercially available floppy disks,
tapes, chips, hard drives, compact disks, and videodisks, or other
computer readable mediums. Also disclosed are the binary code
representations of the disclosed sequences and ATP or ATP analogs.
Those of skill in the art understand what computer readable
mediums. Thus, computer readable mediums on which the nucleic acids
or protein sequences are recorded, stored, or saved are also
disclosed.
[0156] g) Chips and Micro Arrays
[0157] Disclosed are chips where at least one address is the
sequences or part of the sequences set forth in any of the nucleic
acid sequences disclosed herein. Also disclosed are chips where at
least one address is the sequences or portion of sequences set
forth in any of the peptide sequences disclosed herein. Disclosed
are chips where at least one address is the composition, such as a
P2Y2 antagonist, disclosed herein.
[0158] Also disclosed are chips where at least one address is a
variant of the sequences or part of the sequences set forth in any
of the nucleic acid sequences disclosed herein. Also disclosed are
chips where at least one address is a variant of the sequences or
portion of sequences set forth in any of the peptide sequences
disclosed herein.
[0159] h) Kits
[0160] Disclosed herein are kits that are drawn to reagents that
can be used in practicing the methods disclosed herein. The kits
can include any reagent or combination of reagent discussed herein
or that would be understood to be required or beneficial in the
practice of the disclosed methods. For example, the kits could
include a P2Y2 antagonist in a formulation for delivery to a
subject with NDI.
C. METHODS OF MAKING THE COMPOSITIONS
[0161] The compositions disclosed herein and the compositions
necessary to perform the disclosed methods can be made using any
method known to those of skill in the art for that particular
reagent or compound unless otherwise specifically noted.
D. METHODS OF SCREENING
[0162] Disclosed are methods of identifying an antagonist of P2Y2
receptors comprising the steps of contacting a kidney cell with an
agent to be tested and detecting a decrease in PGE2. A decrease in
PGE2 indicates a P2Y2 antagonist.
[0163] Also disclosed are methods of identifying an antagonist of
P2Y2 receptors comprising the steps of contacting a kidney cell
with an agent to be tested and detecting an increase in AQP2 in the
kidney collecting ducts. An increase in AQP2 indicates a P2Y2
antagonist.
[0164] Also disclosed are methods of screening for an antagonist of
P2Y2, comprising contacting a kidney cell with a test compound;
detecting PGE2 levels in the kidney cell; and screening for a
sustained reduction in PGE2 as compared to a control level,
indicating an antagonist of P2Y2.
[0165] Also disclosed are methods of screening for an antagonist of
P2Y2, comprising contacting a kidney cell with a test compound;
detecting AQP2 levels in the kidney tubule collecting ducts; and
screening for a sustained increase in AQP2 levels as compared to a
control level, indicating an antagonist of P2Y2.
[0166] The screening methods disclosed herein can take place in the
presence of arginine vasopressin (AVP). The collecting duct system
is precisely regulated by AVP, and thus it is crucial for the
conservation of body water and excretion of concentrated urine.
AQP2 water channel, expressed on the apical plasma membrane and on
sub-apical vesicles of collecting duct principal cells, is
regulated by AVP. AVP, acting through its V2 receptor, a G
protein-coupled receptor, on the collecting duct principal cells,
activates membrane bound adenylyl cyclase (AC) to produce cAMP as a
second messenger (FIG. 2). Therefore, cAMP can also be measured in
the screening claims described herein.
[0167] Also disclosed are methods of identifying an antagonist of
P2Y2 receptors comprising the steps of contacting a kidney cell
with an agent to be tested and detecting an increase in
intracellular calcium. An decrease in intracellular calcium
indicates a P2Y2 antagonist.
[0168] Screening can take place in multi-well plates. Multi-well
plates are standard in the art and come in a variety of sizes and
shapes. For example, the multi-well plate can be 24, 48, or 96 well
plates. Such screening assays can be automated or further modified
for high throughput analysis. For high throughput screening, each
well can include numerous test components. If a positive reaction
is detected in a well, the screening is repeated with one of the
test compounds contained in a single well.
[0169] The invention also provides methods of screening for P2Y2
receptor antagonist, comprising contacting a first kidney cell with
more than one test compound; detecting PGE2 levels in the first
kidney cell; selecting each of test compounds in the group that
contacted the first kidney cell, wherein the first kidney cell
showed a sustained decrease in PGE2; contacting a second kidney
cell with one test compound from the step of selecting each of the
test compounds; and detecting PGE2 levels in the second kidney
cell, a sustained decrease in PGE2 as compared to a control level,
indicating a P2Y2 antagonist.
[0170] The invention also provides methods of screening for a P2Y2
receptor antagonist, comprising contacting a first kidney cell with
more than one test compound; detecting AQP2 in the kidney tubules
of the first kidney cell; selecting each of test compounds in the
group that contacted the first kidney cell, wherein the first
kidney cell showed a sustained increase in AQP2 in the kidney
tubules; contacting a second kidney cell with one test compound
from the step of selecting each of the test compounds; and
detecting AQP2 levels in the kidney tubules of the second kidney
cell, a sustained increase in AQP2 levels in the kidney tubules as
compared to a control level, indicating a P2Y2 antagonist.
[0171] Also contemplated are agents identified by the screening
methods described herein, as well as methods of making those
agents. An example of a method of making an agent includes
identifying the agent using the methods provided herein, and
manufacturing the agent or manufacturing the agent in a
pharmaceutically acceptable carrier.
[0172] Also provided are methods of screening for a P2Y2
antagonist, comprising contacting a test compound with a cell that
expresses a heterologous nucleic acid that encodes a P2Y2 receptor;
and detecting PGE2 levels in the cell; a sustained reduction in
PGE2 as compared to a control level, indicating a P2Y2 antagonist.
Preferably, the cell is a cell that lacks the receptor prior to
introduction of the heterologous nucleic acid. The cell can be
transiently transfected with the heterologous nucleic acid.
[0173] By "heterologous nucleic acid" is meant that any
heterologous or exogenous nucleic acid can be inserted into a
vector for transfer into a cell, tissue or organism. The nucleic
acid can encode a polypeptide or protein or an antisense RNA, for
example. The nucleic acid can be functionally linked to a promoter.
By "functionally linked" is meant such that the promoter can
promote expression of the heterologous nucleic acid, as is known in
the art, such as appropriate orientation of the promoter relative
to the heterologous nucleic acid. Furthermore, the heterologous
nucleic acid preferably has all appropriate sequences for
expression of the nucleic acid, as known in the art, to
functionally encode, i.e., allow the nucleic acid to be expressed.
The nucleic acid can include, for example, expression control
sequences, such as an enhancer, and necessary information
processing sites, such as ribosome binding sites, RNA splice sites,
polyadenylation sites, and transcriptional terminator
sequences.
[0174] The heterologous nucleic acid introduced into the cell can
include, for example, one or more nucleic acids encoding one or
more subparts of the receptor. For example, four different subparts
of a P2Y receptor could be encoded in four different nucleic acids
or in three, two, or one nucleic acids. In various embodiments,
specific antagonists can be tested using different subparts for the
channel. These assays would thus identify antagonists for different
subtypes of P2Y channels (e.g., P2Y1, P2Y2, etc.) that complex
together to form the fully functional receptor channel present in
native kidney cells.
[0175] Also provided are methods of screening for an P2Y2
antagonist, further comprising screening for reversibility of
response by removing the antagonist during the assay and testing
PGE2 levels after the antagonist is removed. In one embodiment, the
antagonist identified by the methods described herein is a
reversible antagonist.
[0176] Optionally, the compound being screened can augment the
effects of other compounds such as ATP, zinc, or ionomycin, for
example. In this case, the compound being screened can be tested in
the presence of another compound that stimulates the receptor. For
example, the kidney cell can be in a solution containing an
effective amount of ATP. An "effective amount of ATP" is defined as
about 1 to about 500 mM of ATP or 10 to about 200 mM of ATP.
[0177] The above is generally applicable for measuring PGE2 levels
whether by fluorescence, luminescent or other detection techniques.
The invention has particular application to high throughput
screening and whole cell functional assays for compounds with
biological activity. In the most general premise, one can use any
type of compound that can affect the P2Y2 receptor.
[0178] The process is also applicable for screening compounds with
biological activity characterized by rapid and transient changes in
PGE2. Examples include the evaluation of receptor antagonists that
elicit changes in cellular PGE2 levels.
[0179] Glow luminescence assays have been readily adopted into high
throughput screening facilities because of their intrinsically high
sensitivities and long-lived signals. The signals for
chemiluminescence systems such as luciferase and beta-galactosidase
reporter genes or for alkaline phosphatase conjugates are often
stable for several hours.
[0180] Several commercial luminescence and fluorescence detectors
are available that can simultaneously inject liquid into single or
multiple wells such as the WALLAC VICTOR2 (single well), MICROBETA
RTM JET (six wells), or AURORA VIPR (eight wells). Typically, these
instruments require 12 to 96 minutes to read a 96-well plate in
flash luminescence or fluorescence mode (1 min/well). An
alternative method is to inject the inhibitor/antagonist into all
sample wells at the same time and measure the luminescence in the
whole plate by imaging with a CCD camera, similar to the way that
calcium responses are read by calcium-sensitive fluorescent dyes in
the FLIPR or FLIPR-384 instruments. Other luminescence or
fluorescence imaging systems include LEADSEEKER from AMERSHAM, the
WALLAC VIEWLUX.TM. ultraHTS microplate imager, and the MOLECULAR
DEVICES CLIPR imager.
[0181] PE BIOSYSTEMS TROPIX produces a CCD-based luminometer, the
NORTHSTAR.TM. HTS Workstation. This instrument is able to rapidly
dispense liquid into 96-well or 384-well microtiter plates by an
external 8 or 16-head dispenser and then can quickly transfer the
plate to a CCD camera that images the whole plate. The total time
for dispensing liquid into a plate and transferring it into the
reader is about 10 seconds.
E. EXAMPLES
[0182] Efforts have been made to ensure accuracy with respect to
numbers (e.g., amounts, temperature, etc.), but some errors and
deviations should be accounted for. Unless indicated otherwise,
parts are parts by weight, temperature is in .degree. C. or is at
ambient temperature, and pressure is at or near atmospheric.
1. Example 1
Altered P2Y2 Receptor Protein Abundance in Inner Medulae, and
Purinergic-Mediated PGE2 Release from IMCD Under Conditions of
Hydration and Dehydration
[0183] In rats subjected to water loading or hydration, the urine
osmolality and circulating levels of AVP are very low, similar to
the condition of compulsive water drinking seen in humans. This is
associated with a decreased protein abundance and altered
subcellular localization of AVP-regulated water channel AQP2 in
inner medulla. Conversely, water deprivation or thirsting results
in elevated urine osmolality and circulating levels of AVP, and is
associated with an increased protein abundance and apical membrane
targeting of AQP2 in inner medulla (Terris et al, 1996). It was
observed that expression and activity of P2Y2 receptor are markedly
altered in inner medullae under conditions of hydration and
dehydration (FIG. 4).
[0184] Specifically, the data show that the expression of P2Y2
receptor protein in inner medulla is affected by the hydration
status of the animals, with hydrated polyuric rats showing
significantly higher levels of protein as compared to dehydrated
oliguric rats. The changes in P2Y2 receptor protein are paralleled
by similar changes in its mRNA expression as determined by
real-time RT-PCR. Furthermore, observations (Sun et al, 2004) show
that when challenged with ATP.gamma.S, a non-hydrolyzable agonist
of P2Y2 receptor, freshly isolated IMCD from dehydrated rats showed
<10% increase in PGE2 production and release, as compared to a
.about.160% increase seen in hydrated rats. The corresponding
increase in IMCD of control rats was .about.37% (FIG. 4, panel E).
These observations are paralleled by urinary excretion of PGE2
metabolite, which was very low in dehydrated (11% of controls) and
high in hydrated (153% of controls) rats (FIG. 4, panel D). Thus,
the data clearly establish accentuated interactions between
purinergic and prostanoid systems in IMCD in hydrated polyuric
condition. This constitutes a novel AVP-independent regulatory
mechanism of medullary collecting duct function, which plays an
important role in pathophysiological conditions as well.
2. Example 2
Purinergic and Prostanoid Interactions in Lithium-Induced
Nephrogenic Diabetes Insipidus
[0185] Groups of male Sprague-Dawley rats (N=8 per group) were fed
with either a standard rat chow or standard rat chow with added
lithium chloride (40 mmol/kg; custom prepared by MP Biomedicals,
Aurora, Ohio) for 21 days. Urinary output and water intake were
monitored periodically. Rats were euthanized on day 21, and kidney
tissue and blood were collected and processed for molecular and
functional studies and serum lithium levels, respectively. The mean
(.+-.SEM) lithium level in the blood of rats on lithium diet was
1.18.+-.0.05 mmol/L (N=8), which is within the therapeutic range
seen in patients on lithium therapy (0.5 to 1.5 mmol/L). Thus this
model mimics the clinical condition of lithium therapy, and does
not result in overt lithium toxicity. FIG. 5 depicts the
characterization of the lithium model with respect to body weight,
water intake, urine parameters and protein abundance of AQP2 water
channel in inner medulla. FIG. 6 shows the protein abundance and
mRNA expression of P2Y2 receptor in inner medulla, and
purinergic-mediated PGE2 release from IMCD of control and lithium
diet fed rats. FIG. 7 shows the mRNA expression of cytosolic
phospholipase (cPLA2), the major phospholipase in the kidney for
the release of arachidonic acid, and the cyclooxygenases-1 and -2
(COX-1 and COX-2).
[0186] Lithium diet fed rats showed statistically significant
lesser increase in body weight as compared to the rats fed control
diet as determined at day 14 and 21; lithium feeding resulted in
approximately two-fold increase in water intake; lithium feeding
caused 2 to 3-fold increase in urine output associated with a
comparable 3-fold decrease in urine osmolality at day 14 and 21;
lithium feeding resulted in marked reduction in protein abundance
of AQP2 water channel in inner medulla, whose values were 15-20% of
the mean values seen in rats fed control diet. The urine parameters
and AQP2 protein abundance in lithium diet fed rats presented here
are quite comparable to those obtained by the groups of Soren
Nielsen and Mark Knepper on lithium model (Marples et al, 1995;
Kwon et al, 2000). Furthermore, it was observed that the rats
tolerated lithium in the diet well without any signs of
gastrointestinal disturbances or morbid condition.
TABLE-US-00006 TABLE 6 Primers for real-time RT-PCR An- Amp- neal-
licon ing Size, Temp. Gene Primer Pairs bp .degree. C. AQP2 F: 5'-
118 60 GGGTTGCCATGTCTCCTTTCCTTCG R: 5'-CCAGGTCCCCACGGATTTCT P2Y2-R
F: 5'-ACCCGCACCCTCTATTACTCCTT 129 60 C R: 5'-
AGTAGAGCACAGGGTCAAGGCAAC V2-R F: 5'-TTGCCTTGATGGTGTTTGTG 85 58 R:
5'-CACCAGACTGGCGCGTGTATCT cPLA2 F: 5'-GCACATAATAGTGGAACACC 410 58
R: 5'-ACACAGTGCCATGCTGAACC COX-1 F: 5'-TAAGTACCAGGTGCTGGATGG 244 58
R: 5'-GGTTTCCCCTATAAGGATGAG COX-2 F: 5'-TACAAGCAGTGGCAAAGGCC 283 62
R: 5'-CAGTATTGAGGAGAACAGATGGG EP3-R F: 5'-ACGTCCGTCTGCTGGTC 100 60
R: 5'-CCTTCTCCTTTCCCATCTG GAPDH F: 5'-CTACATGTTCCAGTATGACTCTA 421
57 R: 5'-GAGTGGCAGTGATGGCATGGACT .beta.-Actin F:
5'-CACTGTGTTGGCATAGAGGTC 275 66 R: 5'-AGAGGGAAATCGTTGCGTGACA
3. Example 3
Observations on the Purinergic and Prostanoid Interactions in
Bilateral Ureteral Obstruction (BUO)-Induced Nephrogenic Diabetes
Insipidus
[0187] In addition to the lithium-induced NDI model, the NDI model
induced by bilateral ureteral obstruction (BUO) and release has
been established. FIG. 8 depicts the characterization of the BUO
model. Male Sprague-Dawley rats were subjected to either BUO for 24
hours and release (N=8) or sham operation (N=7) following the
protocol published by the groups of Soren Nielsen and Mark Knepper
(Sonnenberg and Wilson, 1976; Froki.ae butted.r et al, 1996). Rats
were anesthetized with 3-5% Isofluorane using rodent anesthesia
machine, and placed on a heated pad to maintain body temperature
close to 37.degree. C., as monitored by an electronic rectal probe.
Hair on the abdomen was clipped and the skin was cleaned using a
preventive antiseptic. The following procedures were conducted
under aseptic conditions. A midline abdominal incision was made and
both ureters were exposed one after another. A 5 mm-long piece of
bisected polyethylene tubing (PE-50; Clay Adams) was placed around
the mid portion of each ureter. The ureter was then occluded by
gently tightening the tubing with 5-0 silk ligature. The abdominal
wall was closed in layers. The entire surgical procedure--skin to
skin--took about 30 to 40 min in our hands. Animals recovered
within 5 min of shutting off Isolfuorane flow. Sham operated rats
underwent similar procedure (laparatomy and handling of ureters),
but their ureters were not occluded with PE tubing and silk.
Twenty-four hours later, the abdomen was opened again under
Isofluorane anesthesia, and the obstructed ureters, which were
clearly enlarged proximal to the PE tubing ligature, were
decompressed by gently removing the silk ligature and PE tubing.
With this technique, the ureters were completely occluded for 24
hours and released, without any evidence of subsequent functional
impairment of ureters. Within a few minutes after recovery from
anesthesia, the BUO rats passed urine.
[0188] The sham operated rats also underwent a second laparatomy 24
hours later. During both surgical procedures, about 5 ml of warm
sterile normal saline (USP grade) was instilled into the abdominal
cavity before closure to compensate for loss of fluids due to
surgical procedure. On both occasions, morphine-derived pain
reliever (Buprenorphin 0.05 mg/kg subcutaneously) was administered
before the animals recovered from the anesthesia. Buprenorphine
dose was repeated at 12-hour intervals during the first two
post-operative days. Animals were monitored at frequent intervals
for signs of pain, distress and significant degree of weight loss
or gain. With this procedure, all animals completely recovered from
the post-surgical stress within a couple of days and remained
active and alive until euthanized. No significant differences in
the body weights of the BUO rats as compared to their age/batch
matched sham operated rats were noted. However, the kidneys of BUO
rats were enlarged and were approx. 1.5- to 2-fold larger than the
kidneys of age/batch matched sham operated rats, with cortex and
outer medulla accounting for most of the enlargement. Animals were
euthanized either on day 7 (for functional studies) or day 12 (for
molecular studies), counting from the day of second surgical
procedure when the ureteral obstruction was released.
4. Example 4
The Temporal Sequence and Nature of Molecular and Functional Events
that Reflect the Accentuated Interaction Between Purinergic and
Prostanoid systems, and their Relation to the Vasopressin System in
the Development of Acquired NDI.
[0189] Previous studies demonstrated increased production of renal
PGE2 in acquired NDI, which may play a critical role in the genesis
and maintenance of polyuria. Independent of these potent and
accentuated interactions, both PGE2 and extracellular nucleotides
(purinergic agonists) have been shown to antagonize AVP action on
the IMCD. In acquired NDI the circulating levels of AVP are either
normal or elevated, but the collecting duct does not respond to
AVP. A temporal sequence of molecular and functional events of
purinergic and prostanoid interactions can be constructed, and
examined to detect how these interactions oppose or neutralize the
vasopressin action on IMCD resulting in acquired NDI.
[0190] A comprehensive analysis of the status of purinergic,
prostanoid and vasopressin systems in acquired NDI models as a
function of time is shown, and thus construct a molecular and
functional correlation of interactions among these systems. The
relationship between purinergic and prostanoid interactions and
their relation to vasopressin system in acquired NDI can be studied
by measuring how they are affected or disrupted by the
administration of indomethacin, which is known to ameliorate
polyuria of NDI by inhibiting the synthesis of PGE2. Since
indomethacin has been shown to reverse the polyuria of acquired NDI
both in humans and in experimental animals, by performing these
reversal studies one can determine whether accentuated purinergic
and prostanoid interactions are responsible for the
vasopressin-resistant polyuria in acquired NDI. The reversal of
polyuria by indomethacin can be accompanied by reversal of
accentuated interactions between the purinergic and prostanoid
systems.
[0191] A determination of the expression of mRNA and/or protein of
P2Y2, V2 and EP3 receptors by real-time RT-PCR, in situ
hybridization, Western blotting and immunohistochemistry is made.
Determination of cellular cAMP and protein kinase A activity by
commercial assay kits is also made. Determination of in vitro ATP
release from microdisseced IMCD as described earlier (Schwiebert
and Kishore, 2001) is also carried out. NDI rats of lithium and BUO
model at all time points stated above are used.
[0192] Determination of the protein abundance and apical membrane
targeting of AQP2 water channel using semi-quantitative
immunoblotting and immunohistochemistry, respectively, is carried
out. Determination of cellular and subcellular distribution of P2Y2
receptor protein by immunohistochemistry and confocal microscopy is
done. For these studies, NDI rats of lithium and BUO models at all
time points are used.
[0193] Examination of expression, DNA binding activity and
phosphorylation of CREB (cAMP responsive element binding protein),
known to be involved in the transcriptional regulation of AQP2
gene, is carried out. The expression of CREB mRNA and protein is
determined by real-time RT-PCR and Western blotting, respectively.
The DNA binding activity of CREB to the Cre (cAMP responsive
element) site in the AQP2 promoter is determined by EMSA
(electromobility shift assay). The extent of CREB phosphorylation
at Ser.sup.133 can be determined by immunoblotting.
[0194] The effect of administration of indomethacin, a non-specific
inhibitor of cyclooxygenases, is examined for its role in the
purinerigic and prostanoid interactions, and their relation to
vasopressin system in lithium and BUO models at defined time
points. Groups of control or sham operated rats are also be
administered with indomethacin for comparative purpose.
Indomethacin is administered at a dose of 2 mg/kg/day by gavage in
two divided doses or in gel. Urine output and osmolality is
monitored daily, and the rats are euthanized when these parameters
in NDI rats are returned to their corresponding untreated control
or sham operated levels. Samples of kidney tissue and urine are
collected and processed as described above. In vitro microperfusion
of IMCD is performed to assess the basal and AVP-stimulated
response following indomethacin treatment. The data obtained from
the indomethacin-treated NDI rats is compared to the corresponding
data obtained from the untreated NDI rats and control or sham
operated rats with or without indomethacin treatment.
[0195] The NDI rats not subjected to indomethacin treatment, can
display accentuated interactions between purinergic and prostanoid
systems. A gradual decrease in cellular cAMP levels, associated
with increasing response of IMCD to purinergic-mediated in vitro
PGE2 release, can be seen. The declining cellular cAMP levels and
accentuating purinergic and prostanoid interactions can be
accompanied by decreased transcriptional activation of AQP2 gene,
decreased abundance and apical membrane targeting of AQP2 protein,
which directly correlates with decreased basal and AVP-stimulated
water transport in isolated microperfused IMCD. Changes in the
protein abundance and cellular/subcellular distribution of P2Y2
receptor protein during the development of NDI can also be
observed. As the NDI progresses, metabolic and structural
alterations can occur, accompanied by involvement of cytokines and
other mediators.
5. Example 5
Purinergic and Prostanoid Interaction with the Vasopressin
System
[0196] The expression, phosphorylation, apical membrane targeting
and retrieval of AVP-regulated AQP2 water channel in the collecting
duct principal cell are dependent on the cellular cAMP levels and
the activity of protein kinase A. In order to understand how the
accentuated interactions between purinergic and prostanoid systems
in acquired NDI translates into disruption of the AVP-mediated
functional effects, the intracellular signaling mechanisms whereby
these two systems interact with each other, and with the
vasopressin system in IMCD in reducing the cAMP levels to a
critical level so as to cause a marked decrease in the expression
of AQP2 protein and reduction in the water transport capability of
IMCD can be elucidated. Thus, the molecules play key roles either
directly or indirectly in the regulation of cellular cAMP levels,
which is a critical factor for the transcriptional regulation and
membrane targeting of vasopressin-regulated AQP2 water channel in
collecting duct principal cell, as schematically illustrated in
FIG. 10 and FIG. 2. As illustrated in FIG. 10, the two key sites
that can result in decreased cellular cAMP levels are: (i)
decreased production of cAMP by enhancement of the activity of Gi
(via an action of PKC), and/or inhibition of the activity or
decreased expression of a key form of adenylyl cyclase (AC), or
(ii) rapid hydrolysis of cAMP by the increased activity of
phosphodiesterases (PDEs).
[0197] Furthermore, inbred mice (Di +/+) with constitutively active
cAMP-PDE (type IV) are polyuric with low cellular cAMP levels and
AQP2 in inner medulla (Homma et al, 1991; Froki.ae butted.r et ak,
1999). While the Di +/+ mice can represent an inherited
abnormality, rats made polyuric due to hypercalcemia induced by
vitamin D can have this condition prevented by the administration
of specific inhibitors of PDE isoforms type III and IV, indicating
that increased activity of PDEs may also be involved in certain
forms of acquired NDI (Wang et al, 2002). Another potential pathway
for antagonizing the AVP action on medullary collecting duct is
enhanced release of arachidonic acid due to the stimulation of
phosphoinositide signaling pathway. As discussed above, the
availability of arachidonic acid is the rate-limiting step in the
synthesis of prostaglandins by cyclooxygenases (COX). It has been
shown that there are large and significant increases in the mRNA
expression of cPLA2 and/or COX-1 and COX-2 in NDI models.
[0198] The expression and/or activities of key molecules that cause
a decrease in cellular cAMP levels in the kidneys of NDI rats of
lithium and BUO models is assessed. NDI and control or sham
operated rats are then chronically infused with two different doses
of dDAVP, a V2 receptor-specific analogue of vasopressin, at 5 or
20 ng/h for 5 days via Alzet mini-osmotic pumps (Kishore et al,
1996, 2004), and then examined for how the expression and/or
activities of these molecules are modulated by increasing doses of
dDAVP in the face of accentuated interaction of purinergic and
prostanoid systems. This situation mimics several clinically
relevant acquired NDI conditions, where the circulating vasopressin
concentrations are either normal or high, and yet there is lack of
response of kidney to it.
[0199] mRNA expression and protein abundance of AC5 and AC6 are
assessed using real-time RT-PCR and Western blotting, respectively.
The total activity of AC and the activities of type III and IV PDEs
can be measured in renal medulla according to the methods described
by Murthy et al (2002) and Takeda et al (1991), respectively.
[0200] The mRNA and protein expression of cPLA2, iPLA2, COX-1 and
COX-2 by real-time RT-PCR and Western blotting, respectively, and
assay the activities of cPLA2 and iPLA2 in inner medulla by
commercial kits are carried out. The degree of phosphorylation of
cPLA2 is determined by Western analysis as shown in FIG. 12. In
vitro studies are also carried out on IMCD preparations to identify
which phospholipases are involved in the purinergic-mediated PGE2
release. For the generalized inhibition of phospholipases,
Aristolochic acid (100 and 200 .mu.M) and Quinacrine (10 or 30
.mu.M) are used. cPLA2 is inhibited by AACOCF.sub.3 (30 or 60
.mu.M) or Pyrrophenone (10, 20 or 50 nM). iPLA2 is inhibited by
Bromoenol lactone (BEL; 0.5 or 3 .mu.M) and PACOCF.sub.3 (10, 20 or
100 .mu.M). For the inhibition of cyclooxygenases in IMCD
preparations, Flurbiprofen (30 and 300 .mu.M) and APHS (10 and 20
.mu.M) are used, both non-specific COX inhibitors. COX-1 activity
is inhibited by Valeroyl salicylate (30 and 300 .mu.M). COX-2
activity is inhibited by NS-398 (10 and 30 .mu.M).
[0201] PKC is a family of isoforms--the classic, the novel, and the
atypical--depending on their sensitivity to Ca.sup.2+,
phospholipids and diacylglycerol (Nishizukha, 1992). Rat IMCD
expresses one classic isoform (.alpha.), three novel isoforms
(.delta., .epsilon., .eta.), and one atypical isoform (.zeta.)
(Chou et al, 1998). However, following the activation of PI
signaling pathway by the muscarinic cholinergic agent, carbachol,
only PKC isoform .eta. translocates to the membrane from cytosol,
indicating its specific activation (Chou et al, 1998). The specific
PKC isoform(s) is (are) activated in the inner medulla in NDI and
the effect of dDAVP infusion on it are identified. In vitro studies
on IMCD of NDI rats are also conducted with or without dDAVP
treatment to assess the effect of purinergic stimulation on the
expression and activity of PKC isoforms. These studies are achieved
by isolating membrane and soluble fractions by centrifugation, and
then immunoblotting them using commercially available specific
antibodies to PKC isoforms to determine their translocation from
cytosol to membrane, as described by Chou et al (1998). The
activities of JNK1, ERK and p38 MAP kinases are determined as
described (Sheikh-Hamad et al, 2004). The activities of MAP kinases
in vitro in IMCD suspensions are inhibited by PD98059 (10 .mu.M;
for MEK), SP600125 (10 .mu.M; for JNK1), U-0126 (10 .mu.M; for
ERK), and SB202190 (10 .mu.M; for p38).
[0202] A significant decrease in the cellular cAMP levels in NDI
rats can be seen. This is similar to what is seen in NDI patients
in the clinic. The decreased cellular cAMP levels can be due to
either decreased formation or increased breakdown of cAMP or both.
These changes can be in turn due to the increased expression and
activity of molecules that oppose the action of vasopressin on
collecting duct either directly or indirectly. In a rat model of
chronic dDAVP infusion it was observed that the mRNA expression and
protein abundance of P2Y2 receptor are significantly down-regulated
to 54% and 49%, respectively. On the other hand, the expression of
V2 receptor mRNA did not change significantly (Kishore et al,
2004). It appears that under normal conditions the AVP system can
override the purinergic system and decrease the P2Y2 receptor mRNA
and protein expression.
6. Example 6
Treating Acquired NDI by Blocking the Accentuated Interactions
Between the Purinergic and Prostanoid Systems in the IMCD
[0203] Prostaglandins appear to play a critical role in the genesis
of polyuria in acquired NDI. The targets for blocking the
accentuated interactions between purinergic and prostanoid systems
and the effects of these interactions are P2Y2 purinergic and/or
EP3 prostanoid receptors, both expressed in IMCD. Antagonists such
as suramin, reactive blue 2, and PPADS (pyrodoxal
phosphate-6-azophenyl 2',4'-disulfonic acid) can antagonize several
subtypes of P2Y receptor family (Schwiebert and Kishore, 2001).
Other P2Y2 antagonists can be identified by (i) testing their in
vitro efficacy in blocking the purinergic-mediated PGE2 release
from the IMCD of normal and hydrated rats; (ii) testing their in
vivo safety and toxicity; (ii) studying pharmacokinetics and
optimal dose response, regimen and route of administration, and
(iii) testing in vivo efficacy in blocking the purinergic and
prostanoid interactions as assessed ex-vivo, using IMCD
preparations freshly obtained from normal and hydrated rats that
had been previously treated with these agents. Selected agents are
then administered to NDI rats of lithium and BUO models to block
the accentuated interactions of purinergic and prostanoid systems.
Additional groups of control and sham operated rats also receive
these agents for comparative purpose. Following the administration
of P2Y2 receptor antagonists to NDI rats changes in urinary
parameters are monitored and the rats are euthanized when their
urine parameters are comparable to the untreated control or sham
operated rats, just as with indomethacin treatment. In addition to
determining the expression and activity of molecules in the kidney,
in vitro microperfusion of IMCD is performed to directly assess the
functional status and response to AVP in NDI rats following the
treatment with P2Y2 receptor antagonists. The effect of
administration of P2Y2 receptor "agonists" on the course of NDI in
rats using the same urine and kidney parameters as proposed for the
P2Y2 receptor antagonists is also established. These P2Y2 receptor
agonists can worsen the polyuric condition in NDI models.
Indomethacin can then be administered to these NDI rats with
worsened polyuric condition due to the administration of P2Y2
receptor agonists, and examined for whether indomethacin can
ameliorate the worsened polyuric condition.
[0204] The effect of blockade of EP3 prostanoid receptor in the NDI
rats as EP3 receptor is another target for the blockade of
purinergic and prostanoid interactions. ONO-8711, a combined EP3
and EP1 receptor antagonist, can be used in NDI rats to compare the
effects obtained with it to the effects seen in the NDI rats that
receive ONO-8712, a selective EP1 receptor antagonist. Thus, the
effects of selective blockade of EP 1 in NDI rats from effects of
the combined blockade of EP 1 and EP3 receptors can be seen.
[0205] Apart from the above protocols, combinations of P2Y2
receptor antagonist(s) with either EP 1 and EP3 receptor blockers
or low doses of COX-2 specific inhibitors (rofecoxib or celecoxib)
or phosphodiesterease inhibitors (rolipram and milrinone) or
thiazide and amiloride can be administered in combination therapy
with P2Y2 receptor antagonists.
7. Example 7
Apyrase Prevents Increase in Urine Flow Induced by Lithium
[0206] Potato apyrase (EC 3.6.1.5) is a soluble NTPDase, exhibiting
both ATPase and ADPase activities. It is non-toxic and safe to
administer either intravenously or intraperitoneally. Two
experiments were conducted. In one experiment Sprague-Dawley rats
were divided into two groups (N=4 per group). One group was fed
with regular rat chow, while the other was fed regular rat chow to
which Lithium Chloride was added to a concentration of 40 mmol/kg
wt of the food. Both groups were fed for 14 days without any other
treatment. The second experiment was similar to the first one,
except that potato apyrase (Sigma Chemical Co) was administered to
both regular and lithium-added diet fed rats from day 7 to day 14
at a dose of 100 units/kg body wt. intraperitoneally, three times a
day (.about.8 hourly intervals). All rats had free access to
drinking water. Twenty-four hour urine samples were collected from
all rats on day 7 and 14 prior to euthanasia, and analyzed. All
rats were euthanized on day 14, and IMCD suspensions were prepared.
Basal and ATP.gamma.S-stimulated ex vivo PGE2 release by IMCD was
determined as per the methods previously established. The results
are shown in FIG. 13.
[0207] As documented in FIG. 13, apyrase treatment from day 7 to 14
in lithium-fed rats (i) prevented further increase in the urine
flow induced by lithium, and (ii) significantly decreased the P2Y2
receptor-stimulated PGE2 release by IMCD as compared to the
apyrase-untreated and lithium-fed rats. Apyrase treatment did not
change the urine output or P2Y2-mediated PGE2 release by IMCD in
control rats fed with regular diet. These observations opened the
possibility to decrease the PGE2 formation in acquired NDI by novel
means other than the direct inhibition of the activities of
cyclooxygenases.
[0208] Apyrase has been successfully used for blocking the
purinergic signaling, especially following xenograft (Koyamada et
al, 1996). Apyrase can be optimized for administration alone or in
combination with specific P2Y2 receptor antagonists to achieve the
best possible effect in controlling polyuria and hypernatremia.
8. Example 8
Dependency on the COX-2 Activity of P2Y2 Receptor-Mediated PGE2
Release by IMCD
[0209] Freshly isolated IMCD preparations were stimulated with 50
.mu.M ATP.gamma.S alone or in the presence of a COX-2-specific
inhibitor, NS398 (10 or 30 .mu.M). PGE2 released into the medium
was assayed and normalized to the protein content. Results
(mean.+-.SE) of triplicate incubations were presented as percent of
values in vehicle control (no added agents). In both series of
experiments, PGE2 release from IMCD in incubations with only NS398
(10 or 30 .mu.M) was similar to the corresponding vehicle controls.
Data for sucrose-water induced polyuria in rats shown are adapted
from Sun et al, (2005). Data for lithium-induced polyuria were
generated by feeding rats with either regular diet or lithium-added
diet for 14 days. Lithium-fed rats developed polyuria associated
with marked decrease in AQP2 protein abundance in inner medulla.
These observations indicate that signaling through P2Y2 receptor is
dynamic, and depends on the underlying condition or
pathophysiology.
Example 9
The Interaction Among Vasopressin (AVP), Purinergic (ATP), and
Prostanoid (PGE2) Systems in Medullary Collecting Duct Principal
Cell Under Normal and NDI Conditions
[0210] The following explanations correspond with FIG. 15.
[0211] A. Acute Interaction of Purinergic System with AVP: In an
acute model of in vitro microperfused medullary collecting ducts
from normal animals, it was demonstrated that activation of P2Y2
receptor down regulates the AVP-stimulated water flow (Kishore et
al, 1995; Rouse et al, 1994). This interaction can remain intact or
accentuated in the acquired NDI.
[0212] B. Chronic Interaction of AVP with Purinergic System: It was
observed that chronically elevated circulating AVP levels arising
from subjecting normal rats to dehydration or dDAVP infusion, down
regulates the expression P2Y2 receptor (Kishore et al, 2005; Sun et
al, 2005b). This chronic effect of AVP is obviously blunted in
acquired NDI where collecting duct is resistant to vasopressin.
This is supported by data, where it was observed that the
expression of P2Y2 receptor did not change significantly in
acquired NDI models.
[0213] C. Purinergic-mediated Prostanoid Production: It was
observed that activation of P2Y2 receptor in ex vivo preparations
of medullary collecting ducts from normal rats results in
production and release of PGE2 (Welch et al, 2003). This response
is markedly accentuated in rats with physiological polyuria induced
by sucrose-water drinking (Sun et al, 2005a). This interaction is
also accentuated in acquired NDI, resulting in increased
purinergic-mediated PGE2 production by IMCD.
[0214] D. Interaction between PGE2 with AVP System: There exists an
inhibitory effect of PGE2 on AVP-induced water flow in the
collecting duct, and the AVP-induced trafficking of AQP2 water
channel to apical plasma membrane (Nadler et al, 1992; Han et al,
1994; Roman and Lechene, 1981; Rouch and Kudo, 2000; Zelenina et
al, 2000). Increased production of PGE2 in acquired NDI obviously
results in potent inhibition of AVP action leading to vasopressin
resistant state. This is further supported by the fact that
blocking the synthesis of PGE2 by indomethacin prevented the
polyuria of acquired NDI (Okshe and Rosenthal, 1998).
[0215] E. Chronic Effect of Elevated Circulating AVP Levels on
Purinergic-driven PGE2 Production: In normal rats chronically
infused with higher doses of dDAVP (20 ng/h) or in dehydrated rats
it was observed that the purinergic-driven PGE2 production by IMCD
is significantly decreased (Sun et al, 2005b). This effect is
obviously blunted in acquired NDI, as we documented that
purinergic-mediated prostanoid production is actually increased in
acquired NDI models, similar to the human patients. The circulating
AVP levels in acquired NDI are either normal or elevated.
TABLE-US-00007 F. Sequences AQP2 SEQ ID NO: 1 F:
5'-GGGTTGCCATGTCTCCTTTCCTTCG AQP2 SEQ ID NO: 2 R:
5'-CCAGGTCCCCACGGATTTCT P2Y2-R SEQ ID NO: 3 F:
5'-ACCCGCACCCTCTATTACTCCTTC P2Y2-R SEQ ID NO: 4 R:
5'-AGTAGAGCACAGGGTCAAGGCAAC V2-R SEQ ID NO: 5 F:
5'-TTGCCTTGATGGTGTTTGTG V2-R SEQ ID NO: 6
R:5'-CACCAGACTGGCGCGTGTATCT cPLA2 SEQ ID NO: 7 F:
5'-GCACATAATAGTGGAACACC cPLA2 SEQ ID NO: 8 R:
5'-ACACAGTGCCATGCTGAACC COX-1 SEQ ID NO: 9 F:
5'-TAAGTACCAGGTGCTGGATGG COX-1 SEQ ID NO: 10 R:
5'-GGTTTCCCCTATAAGGATGAG COX-2 SEQ ID NO: 11 F:
5'-TACAAGCAGTGGCAAAGGCC COX-2 SEQ ID NO: 12 R:
5'-CAGTATTGAGGAGAACAGATGGG EP3-R SEQ ID NO: 13 F:
5'-ACGTCCGTCTGCTGGTC EP3-R SEQ ID NO: 14 R: 5'-CCTTCTCCTTTCCCATCTG
GAPDH SEQ ID NO: 15 F: 5'-CTACATGTTCCAGTATGACTCTA GAPDH SEQ ID NO:
16 R: 5'-GAGTGGCAGTGATGGCATGGACT .beta.-Actin SEQ ID NO: 17 F:
5'-CACTGTGTTGGCATAGAGGTC .beta.-Actin SEQ ID NO: 17 R:
5'-AGAGGGAAATCGTTGCGTGACA
G. LITERATURE CITED
[0216] Agre P. Aquaporin water channels in kidney, J Am Soc Nephrol
11:764-777, 2000 [0217] Bao Y, Pucci M L, Chan B S, Lu R, Ito S and
Schuster V L. Prostaglandin transporter PGT is expressed in cell
types that synthesize and release prostanoids. Am J. Physiol. Renal
Physiol 282:F11103-F1110, 2002 [0218] Bell T N. Diabetes insipidus.
Crit. Care Nurs Clin North Am 6:675-685, 1994 [0219] Bonventre J V.
Phospholipase A2 and signal transduction. J Am Soc Nephrol
3:128-150, 1992 [0220] Bonventre J V, and Nemenoff R. Renal tubular
arachidonic acid metabolism. Kidney Int 39:438-449, 1991 [0221]
Breyer D B, and Breyer R M. Prostaglandin E receptors and the
kidney. Am J. Physiol. Renal Physiol 279:F12-F23, 2000 [0222] Chou
C-L, Rapko S I, and Knepper M A. Phosphoinositide signaling in rat
inner medullary collecting duct. Am J Physiol: Renal Physiol
274:f564-F572, 1998 [0223] Communi D, Janssens R, Suarez-Huerta N,
Robaye B, and Boeynaems J M. Advances in signaling by extracellular
nucleotides, the role and transduction mechanisms of P2Y receptors.
Cell Signal 12:351-360, 2000 [0224] DiGiovanni S R, Nielsen S,
Christensen E I, and Knepper M A. Regulation of collecting duct
water channel expression by vasopressin in Brattleboro rat. Proc
Natl Acad. Sci. USA 91:8984-8988, 1994 [0225] Di Renzo G C,
Johnston T M, Okazaki T, Okita J R, MacDonald P C and Bleasdale J
E. Phosphatidylinositol-specific phospholipase C in fetal membranes
and uterine deciduas. Clin Invest 67:847-856, 1981 [0226]
Ecelbarger C A, Maeda Y, Gibson C C and Knepper M A. Extracellular
ATP increases intracellular calcium in rat terminal collecting duct
via a nucleotide receptor. Am J Physiol (Renal) 267:
F998-F1006,1994 [0227] Ecelbarger C A, Yu S, Lee A J, Weinsten L S
and Knepper M A. Decreased renal Na--K-2Cl cotransporter abundance
in mice with heterozygous disruption of the Gs.alpha. gene. Am J.
Physiol. Renal Physiol 277:F235-F244, 1999 [0228] Ecelbarger C A,
Sands J M, Doran J J, Cacini W, and Kishore B K. Expression of salt
and urea transporters in rat kidney during cisplatin-induced
polyuria. Kidney Int 60:2274-2282, 2001 [0229] Endo S, Nomura T,
Chan B S, Lu R, Pucci M L, Bao Y and Schuster V L. Expression of
PGT in MDCK cell monolayers: Polarized apical localization and
induction of active PG transport. Am J. Physiol. Renal Physiol
282:F618-F622, 2002 [0230] Enjyoji K, Sevigny J, Lin Y, Frenette P
S, Christie P D, AM Esch II JS, Imai M, Edelberg J M, Rayburn H,
Lech M, Beeler D, Csizmadia E, Wagner D D, Robson S C, and
Rosenberg R D. Targeted disruption of cd39/ATP diphosphohydrolase
results in disordered hemostasis and thromboregulation. Nature Med
5:1010-1017, 1999 [0231] Fradet Y, Simard J, Grose J H, and Lebel
M. Enhanced urinary prostaglandin E2 in postobstructive diuresis in
humans. Prostaglan Med 5:29-30, 1980 [0232] Fradet Y, Lebel M,
Grose J H, Talbot J, and Charrois R. Renal prostaglandins in
postobstructive diuresis. Comparative study of unilateral and
bilateral obstruction in conscious dogs. Prosta Leukot Essen Fatty
Acids 31:123-129, 1988 [0233] Froki.ae butted.r J, Marples D,
Knepper M A, and Nielsen S. Bilateral ureteral obstruction
downregulates expression of vasopressin sensitive AQP-2 water
channel in rat kidney. Am J. Physiol. Renal Physiol 270:F657-F668,
1996 [0234] Froki.ae butted.r J, Marples D, Knepper M A, and
Nielsen S. Pathophysiology of aquaporin-2 in water balance
disorders. Am J Med Sci 316:291-299, 1998 [0235] Froki.ae butted.r
J, Marples D, Valtin H, Morris J F, Knepper M A and Nielsen S. Low
aquaporin-2 levels in DI +/+ sever mice with constitutively high
cAMP-phosphodiesteras activity. Am J Physiol; Renal Physio 276:
F179-F190, 1999 [0236] Garcia-Villalba P, Denkers N D, Wittwer C T,
Hoff C, Nelson R D, and Mauch T J. Real-time PCR quantification of
AT1 and AT2 angiotensin receptor mRNA expression in the developing
rat kidney. Nephron Exp Nephrol 94:154-159, 2003 [0237] Gitlin M.
Lithium and the kidney: an updated review. Drug Saf 20:231-243,
1999 [0238] Han J S, Maeda Y, Ecelbarger C, and Knepper M A.
Vasopressin-independent regulation of collecting duct water
permeability. Am J. Physiol. Renal Physiol 266:F139-F146, 1994
[0239] Homma S, Gapstur S M, Coffey A, Valtin H and Dousa T P. Role
of cAMP-phosphodiesterase isoenzymes in pathogenesis of murine
nephrogenic diabetes insipidus. Am J Physiol: Renal Physiol
261:F345-F353, 1991 [0240] Hozawa S, Holtzman E J and Ausiello D.
cAMP motifs regulating transcription in aquaporin-2 gene. Am J.
Physiol. Cell Physiol 270:C1695-C1702, 1996 [0241] Inscho E W.
Renal microvascular effects of P2 receptor stimulation. Clin Exp
Pharmacol Physiol 28:332-339, 2001 [0242] Ivanov A I, Pero R S,
Scheck A C and Romanovsky A A. Prostaglandin E2-synthesizing
enzymes in fever: differential transcriptional regulation. Am J
Physiol (Regul Integr Comp Physiol) 283:R1104-R1117, 2002 [0243]
Kishore B K, Chou C-L, and Knepper M A. Extracellular nucleotide
receptor inhibits AVP-stimulated water permeability in inner
medullary collecting duct. Am J. Physiol. Renal Physiol
269:F863-F869, 1995 [0244] Kishore B K, Ginns S M, Krane C M,
Nielsen S, and Knepper M A. Cellular localization of P2Y2
purinoceptor in rat renal inner medulla and lung. Am J. Physiol.
Renal Physiol. 278:F43-F51, 2000a [0245] Kishore B K, Krane C M,
Dilulio D, Menon A G, and Cacini W. Expression of renal aquaporins
1, 2 and 3 in a rat model of cisplatin-induced polyuria. Kidney Int
58:701-711, 2000b [0246] Kishore B K, Miller R L, Shi H, Zhang P
and Nelson R D. Chronic dDAVP infusion in rats causes decreased
expression of P2Y2 receptor mRNA and protein in inner medulla.
(Abstract) Annual Meeting of the American Society of Nephrology,
St. Louis, Mo., October-November, 2004 [0247] Kishore B K, Krane C
M, Miller R L, Shi H, Zhang P, Hemmert A, Sun R, and Nelson R D.
P2Y2 receptor mRNA and protein expression is altered in inner
medullae of hydrated and dehydrated rats: Relevance to
AVP-independent regulation of IMCD function. Am J Physiol Renal
Physiol 288:F1164-F1172, 2005 [0248] Kishore B K, Terris J M, and
Knepper M A. Quantitation of aquaporin-2 abundance in
microdissected collecting ducts: Axial distribution and control by
AVP. Am J Physiol: Renal Physiol 269:F62-F70, 1996 [0249] Kishore B
K, Chou C-L, and Knepper M A. Extracellular nucleotide receptor
inhibits AVP-stimulated water permeability in inner medullary
collecting duct. Am J Physiol: Renal Physiol 269:F863-F869, 1995
[0250] Kohan D E, and Hughe K. Autocrine role of endothelin in rat
IMCD: Inhibition of AVP-induced cAMP accumulation. Am J. Physiol.
Renal Physiol 265:F126-F129, 1993 [0251] Koyamada N, Miyatake T,
Candinas D, Hechenleitner P, Siegel J, Hancock W W, Bach F H, and
Robson S C. Apyrase administration prolongs discordant xenograft
survival. Transplantation 62:1739-1743, 1996 [0252] Krane C M, and
Kishore B K. Aquaporins: the membrane water channels of the
biological world. Biologist 50:81-86, 2003 [0253] Kwon T-H, Laursen
U H, Marples D, Maunsbach A B, Knepper M A, Froki.ae butted.er J,
and Nielsen S. Altered expression of renal AQPs and Na.sup.+
transporters in rats with lithium-induced NDI. Am J. Physiol. Renal
Physiol 279:F552-F564, 2000 [0254] Laszlo K, Juskzko J, and Balint
P. Prostaglandin-dependent changes in renal haemodynamics and
excretory patterns before and after release of 24 hours bilateral
ureteral ligation. Acta Physiol Acad Sci Hung 56:309-323, 1980
[0255] Laycock J F and Hanoune J. From vasopressin receptor to
water channel: intracellular traffic, constraints and by-pass. J
Endocrinol 159:361-372, 1998 [0256] Lenox R H, McNamara R K, Papke
R L, and Manji H K. Neurobiology of lithium. J Clin Psychiatry
58:37-47, 1998 [0257] Li C, Wang W, Kwon T-H, Knepper M A, Nielsen
S, and Froki.ae butted.r J. Altered expression of major renal Na
transporters in rats with bilateral ureteral obstruction and
release of obstruction. Am J. Physiol. Renal Physiol.
285:F889-F901, 2003 [0258] Li C, Klein J D, Wang W, Knepper M A,
Nielsen S, Sands J M, and Froki.ae butted.r J. Altered expression
of urea transporters in response to ureteral obstruction. Am J.
Physiol. Renal Physiol. Feb. 24, 2004 [Epub ahead of print] [0259]
Lin L-L, Wartmenn M, Lin A Y, Knopf J L, Seth A, and Davis R J.
cPLA2 is phosphorylated and activated by MAP kinase. Cell
72:269-278, 1993 [0260] Marples D, Christensen S, Christensen E I,
Ottosen P D, and Nielsen S. Lithium-induced downregulation of
aquaporin-2 water channel expression in rat kidney medulla. J Clin
Invest 95:1838-1845, 1995 [0261] Matsumura Y, Uchida S, Rai T,
Sasaki S, and Marumo F. Transcriptional regulation of aquaporin-2
water channel gene by cAMP. J Am Soc Nephrol 8:861-867, 1997 [0262]
McHowat J and Creer M H. Thrombin activates a membrane-associated
calcium-independent PLA2 in ventricular myocytes. Am J. Physiol.
Cell Physiol 274:C447-c454, 1998 [0263] Moses A M, Weinstock R S,
Levine M A and Breslau N A. Evidence for normal antidiuretic
response to endogenous and exogenous arginine vasopressin in
patients with guanine nucleotide-binding stimulatory
protein-deficient pseudohypo-parathyroiditis. J Clin Endocrinol
Metab 62:221-224, 1986 [0264] Murray M D, and Brater D C. Renal
toxicity of the nonsteroidal anti-inflammatory drugs. Annun Rev
Pharmacol Toxicol 32:435-465, 1993 [0265] Murthy K S, Zhou H and
Makhlouf G M. PKA-dependent activation of PDE3A and PDE4 and
inhibition of adenylyl cyclase V/VI in smooth muscle. Am J.
Physiol. Cell Physiol 282:C508-C517, 2002 [0266] Nadler S P,
Zimpelmann J A, and Hebert R L. PGE2 inhibits water permeability at
a post-cAMP site in rat terminal inner medullary collecting duct.
Am J. Physiol. Renal Physiol 262:F229-f235,1992 [0267] Nielsen S,
DiGiovanni S R, Christensen E1, Knepper M A, and Harris H W.
Cellular and subcellular immunolocalization of
vasopressin-regulated water channel in rat kidney. Proc Natl Acad.
Sci. USA 90:11663-11667, 1993 [0268] Nielsen S, Chou C-L, Marples
D, Chirstensen E I, Kishore B K, and Knepper M A. Vasopressin
increases water permeability of kidney collecting duct by inducing
translocation of aquaporin-CD water channels to plasma membrane.
Proc Natl Acad. Sci. USA 92:1013-1017, 1995 [0269] Nielsen S, Kwon
T H, Christensen B M, Promeneur D, Froki.ae butted.r J, and Marples
D. Physiology and pathophysiology of renal aquaporins. J Am Soc
Nephrol 10:647-663, 1999 [0270] Nishizukha Y. Intracellular
signaling by hydrolysis of phospholipids and activation of protein
kinase C. Science 258:607-614, 1992 [0271] Oksche A, and Rosenthal
W. The molecular basis of nephrogenic diabetes insipidus. J Mol Med
76:326-337, 1998 [0272] Ostrom R S, Pst S R and Insel P A.
Stoichiometry and compartmentation in G protein-coupled receptor
signaling: implications for therapeutic interventions involving
G(s). J Pharmacol Exp Ther 294:407-412, 2000 [0273] Phelan K M,
Mosholder A D and Lu S. Lithium interaction with the cyclooxygenase
2 inhibitors rofecoxib and celecoxib and other nonsteroids1
anti-inflammatory drugs. J Clin Psychiatry 64:1328-1334, 2003
[0274] Rice W R, Burton F M, and Fiedeldey D T. Cloning and
expression of the alveolar type II cell P2u-purinergic receptor. Am
J Respir Cell Mol Biol 12:27-32, 1995 [0275] Roman R J, and Lechene
C. Prostaglandin E2 and F2.alpha.-induced inhibition of AVP- and
cAMP-stimulated H.sub.2O, Na.sup.+, and urea transport in rat IMCD.
Am J. Physiol. Renal Physiol 279:F294-F301, 2000 [0276] Roman R J
and Lechene C. Prostaglandin E2 and F2.alpha. reduced urea
reabsorption from the rat collecting duct. Am J Physiol Renal Fluid
Electrolyte Physiol 241:F53-F60, 1981 [0277] Rouch A J, and Kudo L
H. Role of PGE2 in .alpha.2-induced inhibition of AVP- and
cAMP-stimulated H.sub.2O, Na.sup.+, and urea transport in rat IMCD.
Am J Physiol: Renal Physiol 279:F294-F301, 2000 [0278] Rouse D,
Leite M, and Suki W N. ATP inhibits the hydroosmotic effect of AVP
in rabbit CCT: evidence for a nucleotide P2u receptor. Am J
Physiol: Renal Physiol 267:F289-f295, 1994 [0279] Schwiebert E M,
and Kishore B K. Extracellular nucleotide signaling along the renal
epithelium. Am J. Physiol. Renal Physiol 280:F945-F963, 2001 [0280]
Sheikh-Hamad D, Cacini W, Buckley A R, Isaac J, Truong L D, Tsao C
C, and Kishore B K. Cellular and molecular studies on
cisplatin-induced apoptotic cell death in rat kidney. Arch Toxicol,
2003 [Epub] [0281] Shoji Y, Takahashi M, Kitamura T, Watanabe K,
Kawamori T, Maruyama T, Sugimoto Y, Negishi M, Narumiya S, Sugimura
T and Wakabayashi K. Downregulation of prostaglandin E receptor
subtype EP3 during colon cancer development. Gut 53: 1151-1158,
2004 [0282] Sonnenberg H, and Wilson D R. The role of the medullary
collecting ducts in postobstructive diuresis. J Clin Invest
57:1564-1574, 1976 [0283] Sugawara M, Hashimot K, and Ota Z.
Involvement of prostaglandin E2, cAMP, and vasopressin in
lithium-induced polyuria. Am J. Physiol. Regulatory Physiol
254:R863-R869, 1988 [0284] Sun R, Carlson N G, Hemmert A C, and
Kishore B K. P2Y2 receptor-mediated release of prostaglandin E2 by
IMCD is altered in hydrated and dehydrated rats: relevance to
AVP-independent regulation of IMCD function. Am J Physiol, Renal
Physiol 289:F585-F592, 2005a [0285] Sun R, Miller R L, Hemmert A C,
Zhang P, Shi H, Nelson R D, and Kishore B K. Chronic dDAVP infusion
in rats decreases the expression of P2Y2 receptor in inner medulla
and P2Y2 receptor-mediated PGE2 by IMCD. Am J Physiol: Renal
Physiol 289:F768-F776, 2005b [0286] Takeda S, Lin C-T, Morgano P G,
McIntyre S J, and Dousa T P. High activity of low-Michaelis-Menton
constant 3',5'-cyclic adenosine monophosphate-phosphodiesterase
isozymes in renal inner medulla of mice with hereditary nephrogenic
diabetes insipidus. Endocrinol 129:287-294, 1991 [0287] Teitelbaum
I. Hormone signaling systems in inner medullary collecting ducts.
Am J. Physiol. Renal Physiol. 263:F985-F990, 1992 [0288] Terris J,
Ecelberger C A, Nielsen S, and Knepper M A. Long-term regulation of
four renal aquaporins in rats. Am J. Physiol. Renal Physiol.
271:F414-F422, 1996 [0289] Timmer R T and Sands J M. Lithium
intoxication. J Am Soc Nephrol 10:666-674, 1999 [0290] Wang W, Li
C, kwon T-H, Knepper M A, Froki.ae butted.r J and Nielsen S. AQP3,
p-AQP2, and AQP2 expression is reduced in polyuric rats with
hypercalcemia: prevention by cAMP-PDE inhibitors. Am J. Physiol.
Renal Physiol 283:F1313-F1325, 2002 [0291] Welch B D, Carlson N G,
Shi H, Myatt L, and Kishore B K. P2Y2 receptor-stimulated release
of prostaglandin E2 by rat inner medullary collecting duct
preparations. Am J. Physiol. Renal Physiol. 285:F711-F721, 2003
[0292] William M. Purines: from premise to promise. J Auton Nerv
Syst 81:285-288, 2000 [0293] Yang T, Schnermalm J B and Briggs J P.
Regulation of cyclooxygenase-2 expression in renal medulla by
tonicity in vivo and in vitro. Am J Physiol 277:F1-F9, 1999 [0294]
Yasui M, Zelenin S M, Celsi G and Aperia A. Adenylyl
cyclase-coupled vasopressin receptor activates AQP2 promoter via a
dual effect on CRE and AP1 elements. Am J. Physiol. 272:F442-F450,
1997
[0295] Zelenina M, Christensen B M, Palmer J, Narin A C, Nielsen S,
and Aperia A. Prostaglandin E(2) interaction with AVP: effect of
AQP2 phosphorylation and distribution. Am J. Physiol. Renal Physiol
278:F388-F394, 2000
Sequence CWU 1
1
18125DNAArtificial SequenceDescription of Artificial Sequence =
Synthetic Construct 1gggttgccat gtctcctttc cttcg 25220DNAArtificial
SequenceDescription of Artificial Sequence = Synthetic Construct
2ccaggtcccc acggatttct 20324DNAArtificial SequenceDescription of
Artificial Sequence = Synthetic Construct 3acccgcaccc tctattactc
cttc 24424DNAArtificial SequenceDescription of Artificial Sequence
= Synthetic Construct 4agtagagcac agggtcaagg caac
24520DNAArtificial SequenceDescription of Artificial Sequence =
Synthetic Construct 5ttgccttgat ggtgtttgtg 20622DNAArtificial
SequenceDescription of Artificial Sequence = Synthetic Construct
6caccagactg gcgcgtgtat ct 22720DNAArtificial SequenceDescription of
Artificial Sequence = Synthetic Construct 7gcacataata gtggaacacc
20820DNAArtificial SequenceDescription of Artificial Sequence =
Synthetic Construct 8acacagtgcc atgctgaacc 20921DNAArtificial
SequenceDescription of Artificial Sequence = Synthetic Construct
9taagtaccag gtgctggatg g 211021DNAArtificial SequenceDescription of
Artificial Sequence = Synthetic Construct 10ggtttcccct ataaggatga g
211120DNAArtificial SequenceDescription of Artificial Sequence =
Synthetic Construct 11tacaagcagt ggcaaaggcc 201223DNAArtificial
SequenceDescription of Artificial Sequence = Synthetic Construct
12cagtattgag gagaacagat ggg 231317DNAArtificial SequenceDescription
of Artificial Sequence = Synthetic Construct 13acgtccgtct gctggtc
171419DNAArtificial SequenceDescription of Artificial Sequence =
Synthetic Construct 14ccttctcctt tcccatctg 191523DNAArtificial
SequenceDescription of Artificial Sequence = Synthetic Construct
15ctacatgttc cagtatgact cta 231623DNAArtificial SequenceDescription
of Artificial Sequence = Synthetic Construct 16gagtggcagt
gatggcatgg act 231721DNAArtificial SequenceDescription of
Artificial Sequence = Synthetic Construct 17cactgtgttg gcatagaggt c
211822DNAArtificial SequenceDescription of Artificial Sequence =
Synthetic Construct 18agagggaaat cgttgcgtga ca 22
* * * * *