U.S. patent application number 12/459794 was filed with the patent office on 2009-11-19 for novel nucleic acid base pair.
This patent application is currently assigned to Japan Science and Technology Agency. Invention is credited to Tsuyoshi Fujihara, Ichiro Hirao, Masahide Ishikawa, Shigeyuki Yokoyama.
Application Number | 20090286247 12/459794 |
Document ID | / |
Family ID | 26512797 |
Filed Date | 2009-11-19 |
United States Patent
Application |
20090286247 |
Kind Code |
A1 |
Hirao; Ichiro ; et
al. |
November 19, 2009 |
Novel nucleic acid base pair
Abstract
A novel artificial nucleic acid base pair which is obtained by
forming a selective base pair by introducing a group having steric
hindrance (preferably a group having steric hindrance and static
repulsion and a stacking effect) and can be recognized by a
polymerase such as DNA polymerase; a novel artificial gene; and a
method of designing nucleic acid bases so as to form a selective
base pair with the use of steric hindrance, static repulsion and
stacking effect at the base moiety of the nucleic acid. An
artificial nucleic acid comprising these bases; a process for
producing the same; a codon containing the same; a nucleic acid
molecule containing the same; a process for producing a non-natural
gene by using the same; a process for producing a novel protein by
using the above nucleic acid molecule or non-natural gene, and the
like.
Inventors: |
Hirao; Ichiro; (Saitama,
JP) ; Ishikawa; Masahide; (Saitama, JP) ;
Fujihara; Tsuyoshi; (Saitama, JP) ; Yokoyama;
Shigeyuki; (Tokyo, JP) |
Correspondence
Address: |
EDWARDS ANGELL PALMER & DODGE LLP
P.O. BOX 55874
BOSTON
MA
02205
US
|
Assignee: |
Japan Science and Technology
Agency
Kawaguchi-Shi
JP
|
Family ID: |
26512797 |
Appl. No.: |
12/459794 |
Filed: |
July 7, 2009 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11078607 |
Mar 10, 2005 |
|
|
|
12459794 |
|
|
|
|
09787196 |
Apr 26, 2001 |
7101992 |
|
|
PCT/JP00/04720 |
Jul 14, 2000 |
|
|
|
11078607 |
|
|
|
|
Current U.S.
Class: |
435/6.12 ;
435/243; 435/6.1; 435/91.5; 530/333; 536/23.1; 536/25.3 |
Current CPC
Class: |
C07H 11/04 20130101;
C12N 15/11 20130101; C12P 21/02 20130101; C07H 21/00 20130101; C07H
19/207 20130101 |
Class at
Publication: |
435/6 ; 536/23.1;
435/91.5; 536/25.3; 530/333; 435/243 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68; C07H 21/00 20060101 C07H021/00; C12P 19/34 20060101
C12P019/34; C07K 1/00 20060101 C07K001/00; C12N 1/00 20060101
C12N001/00 |
Foreign Application Data
Date |
Code |
Application Number |
Jul 15, 1999 |
JP |
11-201450 |
May 2, 2000 |
JP |
2000/133519 |
Claims
1.-26. (canceled)
27. A codon comprising one or more nucleic acid comprising a
structure to hinder base pair formation with a natural nucleic acid
due to stearic hindrance and electrostatic repulsion, without
decreasing base stacking.
28.-40. (canceled)
41. A codon according to claim 27, wherein the nucleic acid base
comprises a purine derivative having a group at position-6 which
can generate stearic hindrance.
42. The codon according to claim 27, wherein the nucleic acid base
is 2-amino-6-N,N-dimethylamino-purine.
43. The codon according to claim 27, wherein the nucleic acid base
is 2-amino-6-thienyl-purine or derivatives thereof.
44. The codon according to claim 27, wherein the nucleic acid has
base containing pyridine having hydroxyl group or keto group at
position-2.
45. The codon according to claim 27, wherein the nucleic acid base
is pyridine-2-one or tautomer thereof.
46. The codon according to claim 27, wherein the nucleic acid is a
nucleic acid constructing base pair with its complementary nucleic
acid.
47. The codon according to claim 27, wherein the codon encodes an
amino acid.
48. The codon according to claim 47, wherein the amino acid
comprises a non-natural amino acid.
49. A nucleic acid molecule comprising nucleic acid comprising a
structure to hinder base pair formation with a natural nucleic acid
due to stearic hindrance and electrostatic repulsion, without
decreasing base stacking.
50. The nucleic acid molecule according to claim 49 wherein the
nucleic acid molecule has whole or part of genetic information of
the natural gene.
51. A process for production of nucleic acid having complementary
strand thereof comprising reacting the polymerase with the nucleic
acid molecule comprising a structure to hinder base pair formation
with a natural nucleic acid due to stearic hindrance and
electrostatic repulsion, without decreasing base stacking.
52. The process according to claim 51 wherein the polymerase is DNA
polymerase or RNA polymerase.
53. A process for production of non-natural nucleic acid comprising
inserting or substituting one or more nucleic acid comprising a
structure to hinder base pair formation with a natural nucleic acid
due to stearic hindrance and electrostatic repulsion, without
decreasing base stacking.
54. The process for production of non-natural nucleic acid
according to claim 51 wherein a position, to which the nucleic acid
comprising a structure to hinder base pair formation with a natural
nucleic acid due to stearic hindrance and electrostatic repulsion
without decreasing base stacking is inserted or substituted; and
has a codon unit portion and has a base sequence portion encoding
natural amino acid sequence.
55. A process for production of protein having amino acid sequence
based on codons of the nucleic acid according to claim 49 or the
non-natural nucleic acid obtained by the method according to claim
53.
56. The process for production of protein according to claim 55
comprising being inserted or substituted by the non-natural amino
acid in the part or whole of amino acid sequence of natural
protein.
57. A microorganism which is transformed by non-natural gene which
can be produced by the process according to claim 53.
58. A method for screening functions of amino acids coded by
natural gene comprising using the non-natural gene which can be
produced by the method according to claim 53.
Description
FIELD OF INVENTION
[0001] The present invention relates to formation of selective
novel artificial nucleic acid base pair by utilizing steric
hindrance.
[0002] The present invention further relates to replication and
transcription of nucleic acid using the novel artificial nucleic
acid base pair of the present invention, and a system for protein
synthesis or functional nucleic acid. More particularly, the
present invention pertains the novel artificial nucleic acid having
properties to form selective base pair by applying steric
hindrance, preferably to form selective base pair by applying
steric hindrance, electrostatic repulsive force or stacking action,
a process for production thereof, codon containing the same,
nucleic acid molecule containing the same, a process for production
of novel protein using the above nucleic acid molecules or
non-natural gene.
BACKGROUND ART
[0003] Genetic information of organisms in the earth are
transferred by using nucleic acids comprising of four bases
consisting of adenine (A), guanine (G), cytosine (C) and thymine
(T) as a gene. Proteins are synthesized according to genetic
informations of mRNA which is transcribed from DNA of gene. In that
occasion, 64 types of codon consisting of 3 bases (4.sup.3=64)
correspond to 20 types of amino acids.
[0004] If novel nucleic acid base (X and Y, in which X and Y form
specific base pair) can be created in addition to already known for
bases (A, G, C, T), numbers of codon can be increased greatly
(6.sup.3=216). As a result, proteins containing non-natural amino
acids can possibly be synthesized by matching the newly created
codons with non-natural amino acids [J. D. Bain, et al. Nature,
356, 537-539 (1992)].
[0005] Heretofore, a pair of isocytosine and isoguanine has been
reported as an artificial base pair except for A-T and G-C.
Isoguanine tends to form base pair with thymine due to tautomerism
of isoguanine [C. Switzer, et al. J. Am. Chem. Soc. 111, 8322-8323
(1989); C. Y. Switzer, et al. Biochemistry 32, 10489-10496 (1993)].
Several novel base pairs have been reported, but there were
problems on recognition by polymerase and no practical use has
known [J. A. Piccirilli, et al., Nature, 343, 33-37 (1990); J.
Horlacher, et al. Proc. Natl. Acad. Sci. USA, 92, 6329-6333 (1995);
J. C. Morales, et al., Nature struct. biol., 5, 954-959
(1998)].
[0006] Nucleic acid molecules having various functions were found
by in vitro selection method [A. D. Ellington, et al. Nature 346,
818-822 (1990); C. Tuerk, et al. Science 249, 505-510 (1990)]. If
the novel base pair X-Y hereinabove can be recognized by
polymerases such as DNA polymerase, RNA polymerase and reverse
transcriptase, the present in vitro selection method using 4 bases
can be performed by using 6 bases, then possibility to create
nucleic acid molecules having novel function, which could not be
practically realized by using 4 bases, can be expected.
[0007] Further, creation of novel base pair has expected for
treatment of hereditary diseases caused by gene abnormality, in
which one or more base in the gene is replaced by different
base.
[0008] We have studied extensively to created novel artificial
nucleic acid base pairs, which could not form base pair with
natural nucleic acid, but could selectively form base pair by
themselves and could be recognized by various polymerases. We have
found that formation of nucleic acid base pair could be inhibited
by applying steric hindrance of nucleic acid base, and formation of
selective base pair between newly designed nucleic acid bases could
be made. Further, we have found that such the newly designed
nucleic acids could be recognized by various natural
polymerases.
[0009] For example, in order not to form base pair with thymine but
to form steric hindrance with keto group at position-6 of thymine,
2-amino-6-(N,N-dimethylamino) purine (hereinafter designates as X),
in which two bulky methyl groups are introduced in amino group at
position-6 of 2,6-diaminopurine, is designed. As a result, the X
does not form base pair with thymine, but bases such as
pyridine-2-one (hereinafter designates as Y), an analog of thymine,
in which oxo group at position-6 is replaced by hydrogen atom, can
form base pair with X (refer to FIG. 1).
[0010] Further, we have synthesized DNA oligomer containing
2-amino-6-(N,N-dimethylamino)-9-(2'-deoxy-.beta.-D-ribofuranosyl)
purine (hereinafter designates as dX) and
3-(2'-deoxy-5'-triphosphoro-.beta.-D-ribofuranosyl)pyridine-2-one
(hereinafter designates as dYTP), and found that dYTP or its
ribonucleotide (rYTP) could be incorporated selectively into DNA or
RNA as a complementary strand of the above dX.
[0011] This compound could hinder base pairing with natural base
such as thymine (or uridine) (refer to FIG. 2 b) and cytosine in
some extent due to steric bulkiness of dimethylamino group in the
base (dx in FIG. 2 a). However, this steric hindrance could affect
to the neighboring bases, and simultaneously could give inferior
effect on stacking between bases, and resulted low rate of
incorporation of dYTP by Klenow fragment as well as insufficient
suppression for incorporation of thymidine triphosphate (dTTP) to
dx.
[0012] We have examined novel artificial base pair by considering
not only steric hindrance but also electrostatic repulsion between
bases and stacking action with the neighboring bases, and could
obtain artificial base pair with superior selectivity.
DISCLOSURE OF INVENTION
[0013] The present invention provides ideas for selective formation
of novel artificial nucleic acid base pair as a result of
recognition of base pairing by polymerase such as DNA polymerase by
utilizing steric hindrance between base pairs, preferably be
generating steric hindrance between only base pair plane without
giving deterioration for stacking between bases and more preferably
by selecting bases utilizing electrostatic repulsion against
natural bases.
[0014] An aspect of the present invention is to provide novel
artificial nucleic acid base pair which does not form base pair
with natural nucleic acid and forms selective base pair in
themselves as well as being recognized by various polymerases.
Further aspect of the present invention is to provide artificial
nucleic acid, codon containing the same, nucleic acid molecule,
non-natural gene and application thereof.
[0015] The present invention relates to a method for constructing
selective base pair comprising introducing a group having ability
to form steric hindrance, preferably a group having ability to form
steric hindrance and electrostatic repulsion, and stacking action
in nucleic acid base. More particularly, the present invention
relates to a method for constructing selective base pair wherein
the said group having ability to form steric hindrance is a group
to hinder formation of base pair with base part of natural nucleic
acid, to hinder formation of base pair with base part of natural
nucleic acid by an action of said steric hindrance and
electrostatic repulsion, and to form stable structure with
neighboring bases by the stacking action, and the said base pair
can be recognized by polymerase.
[0016] Further, the present invention relates to a method for
designing nucleic acid to construct selective base pair comprising
utilizing steric hindrance in the nucleic acid base part,
preferably utilizing steric hindrance and electrostatic repulsion,
and stacking action in the nucleic acid base part. More
particularly, the present invention relates to a method for
designing nucleic acid to construct selective base pair comprising
utilizing steric hindrance, preferably hindering to construct base
pair with the natural nucleic acid base part by utilizing steric
hindrance and electrostatic repulsion and stabilizing with the
neighboring bases by the stacking action, and the said base pair
can be recognized by polymerase.
[0017] The present invention relates to a nucleic acid, which can
construct selective base pair, prepared by introducing a group
having ability to form steric hindrance, preferably a group having
ability to form steric hindrance and electrostatic repulsion, and
stacking action in nucleic acid base. More particularly, the
present invention relates to a nucleic acid for constructing
selective base pair wherein the said group having ability to form
steric hindrance, preferably having ability to form steric
hindrance and electrostatic repulsion is to hinder formation of
base pair with base part of natural nucleic acid, and more
preferably to stabilize with the neighboring bases by the stacking
action, and the said base pair can be recognized by polymerase.
[0018] The present invention discloses novel artificial nucleic
acid which have similar behavior with nucleic acids containing
natural bases and a method for designing such the nucleic acid. The
nucleic acid of the present invention can be applied in the similar
manner as the natural nucleic acid.
[0019] Consequently, the present invention relates to various
applications using the nucleic acid of the present invention or
nucleic acid designed by the method of the present invention.
[0020] More particularly, the present invention relates to a codon
comprising one or more nucleic acid designed by the nucleic acid of
the present invention or nucleic acid designed by the method of the
present invention. The said codon can encode amino acids in the
similar manner as the natural nucleic acid. The said amino acids
can be non-natural amino acids. Further, the present invention
relates to a nucleic acid molecule containing the nucleic acid of
the present invention, the nucleic acid designed by the method of
the present invention or the nucleic acid of the natural origin.
The said nucleic acid molecule can encode proteins in the similar
manner as the natural nucleic acid. Further the said nucleic acid
molecule can maintain whole or part of genetic informations of the
natural gene. Nucleic acid having complementary strand can be
prepared by an action of various polymerases on such the nucleic
acid molecule. The present invention also relates to such the
process for production of complementary strands.
[0021] In addition, the nucleic acid of the present invention or
the nucleic acid designed by the method of the present invention
can be introduced or substituted to a part of natural gene.
Consequently, the present invention relates to a process for
production of non-natural gene comprising introducing or
substituting one or more nucleic acid of the present invention or
the nucleic acid designed by the method of the present invention
into the natural gene. The introduction or substitution can be
performed with the codon unit of the present invention as described
hereinbefore.
[0022] Further, the present invention relates to a process for
production of protein having amino acid sequence based on codons of
the non-natural gene or the nucleic acid of the present invention.
Protein to which non-natural amino acid is introduced or
substituted in the part of natural protein can be produced in case
that codon containing the nucleic acid of the present invention or
the nucleic acid designed by the method of the present invention
encodes non-natural amino acid.
[0023] Consequently, the present invention provides a process for
production of novel protein comprising substituting or introducing
other natural or non-natural amino acid, preferably non-natural
amino acid in a part of natural protein by the method of the
present invention. According to this method, functions of amino
acids in the protein coded by natural gene can be screened. The
present invention also relates to a method for screening function
of each amino acid of protein encoded by natural gene.
[0024] The present invention also relates to a microorganism
transformed by non-natural gene containing the nucleic acid of the
present invention or nucleic acid designed by the method of the
present invention (hereinafter simply designates as the nucleic
acid of the present invention).
[0025] Further, since the novel base pair of the present invention
does not constitute base pairing with the natural bases, it is
useful for treatment of hereditary diseases caused by gene in which
one or more base is replaced by other base. The present invention
provides pharmaceutical composition comprising novel base pair or a
base in the said base pair.
[0026] An object of the present invention is to provide artificial
nucleic acid which does not form base pair with a base of the
natural nucleic acid and can be recognized by polymerase. The
conventional artificial nucleic acid has produced by attempting to
change at the position of hydrogen bond, as a result, base pairing
with a base of the natural nucleic acid could not be hindered
substantially as well as showing insufficient base pair
selectivity. We have solved such the problem by introducing a group
forming the steric hindrance, preferably by introducing a group
forming steric hindrance and electrostatic repulsion and having
stacking action. The present invention provides novel artificial
nucleic acid which can form selective base pairing with artificial
nucleic acids themselves.
[0027] Consequently, the present invention will be explained more
concretely by referring examples hereinbelow, but these examples
are illustrated only for the purpose of better understanding of the
present invention, and the fact that the present invention is not
limited by these examples is obvious according to the technical
idea of the present invention explained hereinbefore.
[0028] A group which forms steric hindrance in the base part of the
nucleic acid of the present invention can be a group only hinder
hydrogen bonding with deteriorated base, and is not limited if it
does not deteriorate for the properties as a base of nucleic acid.
Preferably, the size thereof may be not to hinder formation of base
pairs of other bases in the nucleic acid sequence. In addition, it
is preferable not to have polar group and activated hydrogen atom,
but is not necessary to consider if these polar group and activated
hydrogen atom are located in the positions having distance
impossible to form hydrogen bonding
[0029] Examples of group which forms steric hindrance are, for
example, lower alkyl group such as ethyl, isopropyl, isobutyl or
t-butyl group, preferably branched lower alkyl group, lower alkoxy
group consisting of methyl or these lower alkyl groups, di-lower
alkylamino group substituted by methyl or these lower alkyl groups
and silyl group substituted by methyl or these lower alkyl
groups.
[0030] Conventional chemical synthesis can be applied for methods
of introducing groups to form steric hindrance in the base.
[0031] Examples of groups having actions for steric hindrance,
electrostatic repulsion and stacking action on base part of the
nucleic acid are group having steric hindrance which hinders
hydrogen bonding having deteriorated action between bases, having
electrostatic repulsive force and having .pi. electron for stacking
action. These groups are not limited if they have deteriorating
actions as a nucleic acid base. More preferably, a group having
size not to hinder base pairing for other nucleic acid is
preferable. Further, groups without having polar site for hydrogen
bond and activated hydrogen atom are preferable, however if these
polar site or activated hydrogen is located at distal position
where hydrogen bonding may be impossible, it may not necessary to
consider.
[0032] Examples of groups having steric hindrance, electrostatic
repulsion and stacking action in the base pair of the present
invention are preferably aromatic heterocyclic group having planar
structure. Such aromatic heterocyclic group has sufficient size for
steric hindrance on the planar direction of molecule, and can
generate electrostatic repulsion by different atoms, and also is
expected to show stacking action by .pi. electron of aromatic
heterocyclic group.
[0033] Examples of such the aromatic heterocyclic group are,
concretely, five membered or six membered aromatic heterocyclic
group having one or two sulfur atom, oxygen atom or nitrogen atom.
These aromatic heterocyclic groups can be condensed-ring,
polycyclic or monocyclic group. Among them, monocyclic group is
preferable due to steric size. These aromatic heterocyclic groups
can have any substituents, but a group without having large
substituent is preferable due to possibility to cause
stereospecific limitation or generation of deteriorative hydrogen
bonding. Examples of substituents are hydroxyl, amino, carbonyl,
lower alkyl of carbon 1-5, lower alkoxy, lower alkylamino or
nitro.
[0034] Conventional chemical synthesis can be applied for methods
of introducing groups to form steric hindrance, electrostatic
repulsion or stacking action in the base.
[0035] Nucleic acid of the present invention is artificial nucleic
acid which can be recognized by polymerase. Examples of polymerase
can be any polymerase, preferably DNA polymerase and RNA
polymerase. Recent studies on structural analysis of polymerase
indicates that interaction of polymerase and nucleic acid is
essentially identical with each other. Formation of base pair of
the present invention relates to essential nature of polymerase,
consequently, the base pair formation of the present invention can
be utilized not only for DNA polymerase and RNA polymerase but also
for all polymerase including reverse transcriptase.
[0036] Further, configuration of nucleic acid can be calculated by
analysis of molecular configuration or precise determination of
distance between atoms. Consequently, by applying these results,
chemical structure, which causes steric hindrance in one side and
provides one or more hydrogen bonds, preferably two hydrogen bonds
in other side, can be designed. Consequently, the present invention
includes a method for designing artificial nucleic acid based on
steric hindrance of the nucleic acid, preferably steric hindrance
in the base part of nucleic acid, preferably in addition thereto,
electrostatic repulsion and stacking action. In the designing base
pair of the present invention, designing based on Watson-Crick type
base pair is conventional, but Hoogsteen base pairing may also be
applicable.
[0037] Nucleic acid of the present invention can be a nucleic acid
designed by steric hindrance of nucleic acid, preferably designed
by steric hindrance in the base part of the nucleic acid, and is
preferable to form selective base pairing with each of artificial
nucleic acid. Preferably, base pairing of artificial nucleic acid
can be recognized by polymerase and more preferably the
complementary strand can be constructed similar to the natural
nucleic acid by and action of polymerase.
[0038] Nucleic acid of the present invention can be synthesized by
conventional chemical synthesis but is not limited to that method.
Chemical synthesis is exemplified in FIG. 3, FIG. 4 and FIG. 5.
[0039] Method for incorporating nucleic acid of the present
invention into the nucleic acid sequence can be performed by
applying conventional method for incorporation of natural nucleic
acid or by applying similar method thereof. For example, a method
using DNA synthesizer, method for using polymerase and point
mutation technology can be mentioned. Labeling can also be possible
made as same as in the natural nucleic acid.
[0040] The present invention also includes nucleic acid which can
be used for gene fragment or probe, and include nucleic acid
molecule containing the nucleic acid of the present invention. The
nucleic acid molecule of the present invention contains one or more
nucleic acid of the present invention, and can be a single strand
or double strands. Non-natural gene of the present invention
includes natural gene in which whole of part of it is replaced by
nucleic acid of the present invention, natural gene to which one or
more nucleic acid of the present invention is added, or combination
thereof. Such the non-natural gene of the present invention can be
modified by the same or similar method used for the conventional
modification of natural gene.
[0041] Consequently, nucleic acid molecule or non-natural gene of
the present invention can be used for transformation of
microorganisms by the same way as in the conventional natural gene
by inserting suitable vector or phage and inserted into
microorganisms to produce transformant containing the artificial
nucleic acid of the present invention.
[0042] Further, new codon containing nucleic acid of the present
invention can be designed. For example, the present novel
artificial nucleic acid base is set as X and Y, combination thereof
such as XXY, XYX, YXX, a combination by themselves, and AXA, TYT,
CGX, ATX, which are combination of base of natural nucleic acid and
artificial base of the present invention. Such codons can be
designed. New codons can code natural amino acid, or non-natural
amino acid. Further, functions such as transcription, transfer can
be coded. Accordingly, the present invention not only provide novel
artificial nucleic acid, but also providing possibility of
designing completely new genetic code by designing new codon
containing nucleic acid of the present invention.
As a result of designing t-RNA corresponding to new codon of the
present invention. New protein synthesis system can be designed by
which large number of amino acid can be utilized. Usable amino acid
can be amino acid utilized on protein synthesis on liposome.
Consequently, the present invention provides novel protein
synthetic system using codon of the present invention.
[0043] Heretofore, some amino acids in the natural protein are very
difficult to substitute non-natural amino acid, or insertion of
non-natural amino acid into the natural protein is also very
difficult. According to the protein synthesis system of the present
invention, proteins containing desired non-natural amino acid can
be produced by substituting or inserting the nucleic acid having
codon of desired position into the nucleic acid of the present
invention. And such the conversion of amino acid resulted to make
screening functions of amino acid in the protein.
BRIEF DESCRIPTION OF DRAWINGS
[0044] FIG. 1 shows novel artificial nucleic acid base pair (X-Y)
by utilizing steric hindrance of the present invention. R in FIG. 1
indicates 2-deoxy-.beta.-D-ribofuranosyl.
[0045] FIG. 2 shows novel artificial nucleic acid base pair (X2-Y)
by utilizing base pairing caused by steric hindrance (FIGS. 2 a and
b) and steric hindrance, electrostatic repulsion and stacking
action.
[0046] FIG. 3 shows synthetic scheme for amidite reagent for dX of
nucleic acid having base X of the present invention.
[0047] FIG. 4 shows synthetic scheme of dYTP of nucleic acid having
base Y of the present invention.
[0048] FIG. 5 shows synthetic scheme of amidite reagent of dx2 of
nucleic acid having base X2 of the present invention.
[0049] FIG. 6 shows 20% polyacrylamide 7M urea gel electrophoresis
of primer extension reaction by Klenow fragment using 5'-terminal
.sup.32P labeled primer 1 (0.5 .mu.M) and template 1, 3 (1 .mu.M)
and various dNTP (150 .mu.M). Reaction was performed at 17.degree.
C. for 30 minutes. B is a graph of the result.
[0050] FIG. 7 shows 20% polyacrylamide 7M urea gel electrophoresis
of single nucleotide insertion reaction by Klenow fragment using
5'-terminal .sup.32P labeled primer 2 (1 .mu.M) and template 1, 2,
3 (2 .mu.M) and various dNTP (150 .mu.M). Reaction was performed at
17.degree. C. for 30 minutes. A is electrophoretic pattern with 29%
polyacrylamide 7M urea electrophoresis and B is a graph of the
result.
[0051] FIG. 8 shows inhibitory experiment by dYTP on primer
extension reaction by Klenow fragment using primer 2, template 1,
2, 3 and [.alpha.-.sup.32P]TTP or [.alpha.-.sup.32P]dCTP.
A: Primer extension reaction by Klenow fragment was performed at
17.degree. C. for 30 minutes. Primer 2 (1 .mu.M), template 3 (2
.mu.M) and [.alpha.-.sup.32P]TTP (150 .mu.M) are used. dYTP, 0, 50,
150, 300 and 500 .mu.M are added. Right lane 5: same experiment was
performed by adding dATP (300 .mu.M) B: Primer extension reaction
by Klenow fragment was performed at 17.degree. C. for 10 minutes.
Primer 2 (1 .mu.M), template 1 (2 .mu.M) and [.alpha.-.sup.32P]TTP
(50 .mu.M) are used. dYTP, 0, 20, 100, 500 and 1000 .mu.M are
added. Right lane 5: same experiment was performed by adding dATP
(300 .mu.M) C: Primer extension reaction by Klenow fragment was
performed at 17.degree. C. for 30 minutes. Primer 2 (1 .mu.M),
template 2 (2 .mu.M) and [.alpha.-.sup.32P]TTP (50 .mu.M) are used.
dYTP, 0, 20, 100, 500 and 1000 .mu.M are added. Right lane 5: same
experiment was performed by adding dATP (300 .mu.M)
[0052] FIG. 9 shows primer extension reaction by Klenow fragment
using 5'-terminal .sup.32P labeled primer 3 (0.33 .mu.M) and
template 4, 5, 6, 7, 8, and 9 (1 .mu.M) and various dNTP (150
.mu.M). Reaction was performed at 17.degree. C. for 60 minutes.
[0053] FIG. 10 Electrophoresis of RNA generated by transcription of
T7 RNA polymerase using various rNTPs and template 1-3 and
[.alpha.-.sup.32P]ATP.
[0054] FIG. 11: Transcription was performed similar to the case in
FIG. 10 with rNTP and generated RNA was purified by electrophoresis
and digested by RNase T2. Resulted product was analyzed by
2-dimension TLC.
[0055] FIG. 12: Incorporation of various base against X2 of the
present invention. Drawing is replaced by photograph.
[0056] FIG. 13: Template containing X2 and rNTP were used.
Generated RNA was purified by electrophoresis, then digested with
RNase T2 and analyzed by 2-dimension TLC.
BEST MODE FOR CARRYING OUT THE INVENTION
[0057] The present invention will be explained by the following
examples in detail.
[0058] One of artificial base, 2,6-diaminopurine, could form base
pairing with thymine by hydrogen bonding at position-6 of thymine.
In order not to form base pairing 2,6-diaminopurine with thymine,
two bulky methyl groups were introduced into the amino group at
position-6 of 2,6-diaminopurine for colliding with this group and
keto group of thymine at position-6 by steric hindrance, and
synthesized to design 2-amino-6-(N,N-dimethylamino) purine
(hereinafter a base of which is designated as X) of the
formulae:
##STR00001##
[0059] Accordingly, X could not form base pairing with thymine an
analogous base in which oxo group at position-6 of thymine is
replaced by hydrogen, pyridine-2-one (hereinafter the base of which
is designated as Y) could for base pairing with X (refer to FIG.
1). Lower part of FIG. 1 illustrates binding not to form base
pairing these bases X and Y with other bases.
[0060] In order to examine formation of selective novel nucleic
acid base pair by utilizing steric hindrance in the base pair X-Y,
primer extension method of DNA and transcriptional reaction
synthesizing RNA from DNA were applied. The primer extension method
includes annealing template DNA oligomer with a primer oligomer,
and adding DNA polymerase and 2'-deoxynucleotide-5'-triphosphate
(dNTP) to extend complementary sequence of the template at
3'-terminal of the primer. Klenow fragment, which is deleted
5'-exonuclease from DNA polymerase I, one of DNA polymerase
originated from E. coli, and T7 RNA polymerase, RNA polymerase
originated from T7 phage, were herein used. Both enzymes are
commonly used at present.
[0061] In order to incorporate X into the template DNA, amidite
reagent of dX was synthesized. Also template DNA containing dX
having base sequences hereinbelow (Template 3, 5, 6, 7, 8 and 9)
and template DNA (Template 1, 2 and 4) and their primer (Primer 1,
2 and 3) for use of control experiments were synthesized.
[0062] Template DNA containing dX (Template 3, 5, 6, 7, 8 and
9):
TABLE-US-00001 Template 3: dtgctctxtcttcctccctatagtgagtcgtattat
Template 5: dagctxtgtgtgtctccggtacaactaggc Template 6:
dagctxxgtgtgtctccggtacaactaggc Template 7:
dagctxtxtgtgtctccggtacaactaggc Template 8:
dagctxtgxgtgtctccggtacaactaggc Template 9:
dagctxtgtxtgtctccggtacaactaggc
[0063] Template for using control experiment (Template 1, 2 and
4)
TABLE-US-00002 Template 1: dtgctctatcttcctccctatagtgagtcgtattat
Template 2: dtgctctgtcttcctccctatagtgagtcgtattat Template 4:
dagctgtgtgtgtctccggtacaactaggc
[0064] Primer (Primer 1, 2 and 3)
TABLE-US-00003 Primer (Primer 1, 2 and 3) Primer 1:
dcgactcactataggg Primer 2: dctatagggaggaga Primer 3:
dgcctagttgtaccg
[0065] Substrates, dYTP and rYTP, were also synthesized (refer to
FIG. 4)
[0066] 5'-terminal of the primer was labeled with .sup.32P using T4
polynucleotide kinase and [.alpha.-.sup.32P] ATP. Primer labeled
with .sup.32P (0.5 .mu.M) and template 1 and 3 (1 .mu.M) and
various dNTP (150 .mu.M), wherein N means base, were used for
primer extension by Klenow fragment (0.2 unit/.mu.l) at 17.degree.
C. for 30 minutes.
[0067] A combination of primer and template used in the experiment
is shown hereinbelow.
[0068] A case using template 1:
TABLE-US-00004 Primer 1: 5'-.sup.32pCGACTCACTATAGGG Template 1:
3'-TATTATGCTGAGTGATATCCCTCCTTCTATCTCGT
[0069] A case using template 3:
TABLE-US-00005 Primer 1: 5'-.sup.32pCGACTCACTATAGGG Template 3:
3'-TATTATGCTGAGTGATATCCCTCCTTCTXTCTCGT
[0070] The thus obtained product was electrophoresed using 20%
polyacrylamide 7M urea gel and analyzed by using imaging plate
(Phosphoroimager analysis). Result is shown in FIG. 6. In FIG. 6,
left five, i.e. AG, AGC, AGT, AGY and AGCT, indicates cases using
template 1, and right five indicates cases using template 3.
Results indicate that a base y was incorporated into complementary
strands of A, G and X. To the complementary strand X was
incorporated also C and T in addition to Y (refer to FIG. 6).
[0071] For quantitative analysis of the incorporation, same
experiments were conducted by adding only dNTP (159 .mu.M) using
primer 2 (1 .mu.M) labeled with p32 at 5'-terminal and template 1,
2 and 3 (2 .mu.M).
[0072] Primer and template used in the experiments are shown
below.
[0073] A case using template 1:
TABLE-US-00006 Primer 2: 5'-.sup.32pCTATAGGGAGGAGA Template 1:
3'-TATTATGCTGAGTGATATCCCTCCTTCTATCTCGT
[0074] A case using template 2:
TABLE-US-00007 Primer 2: 5'-.sup.32pCTATAGGGAGGAGA Template 2:
3'-TATTATGCTGAGTGATATCCCTCCTTCTGTCTCGT
[0075] A case using template 3:
TABLE-US-00008 Primer 2: 5'-.sup.32pCTATAGGGAGGAGA Template 3:
3'-TATTATGCTGAGTGATATCCCTCCTTCTXTCTCGT
[0076] Results are shown in FIGS. 7 A and B. As a result, Y was
incorporated into complementary strands of A, G and X at 78%, 48%
and 42%, respectively, and Y, C and T were incorporated into
complementary strand of X, at 41%, 9.5% and 13%, respectively.
(Refer to FIG. 7)
[0077] Since Y was incorporated independently into not only X but
also A and G, the following experiments were conducted in order to
find out to what strands Y was incorporated when T and C were
coexisted.
[0078] Primer 2 without labeling and template 2 were annealed, and
[.alpha.-.sup.32P]TTP and various amounts of dYTP were added
thereto to find out ratio of inhibition of incorporation of
[.alpha.-.sup.32P] TTP into X by dYTP was investigated.
Simultaneously with addition of dATP, effect of the said inhibition
on incorporation of A into complementary strand of T next to X was
investigated (refer to FIG. 8 A). As a result, when dYTP was added
almost equivalent level of [.alpha.-.sup.32P] TTP, incorporation of
[.alpha.-.sup.32P] TTP into X was inhibited at 50%. Same
experiments were conducted by using template 1 and 2 for A and G.
dYTP did not inhibit incorporation of [.alpha.-.sup.32P] TTP into
the complementary strand of A and the incorporation of
[.alpha.-.sup.32P] CTP into the complementary strand of G. (Refer
to FIG. 8 B for template 1 and C for template 2). Consequently,
incorporation of dYTP into A and G was suppressed by coexisting TTP
and dCTP.
[0079] In order to search effect of incorporation of Y, C and T
into the complementary strand of X, when two X are presented on the
template, .sup.32P labeled primer 3 at 5'-terminal and template 4,
5, 6, 7, 8 and 9 were used for primer extension method. As a
result, when two X were continued on the template, polymerase
reaction was terminated at the position where two continuous X were
existed whenever using any bases. In only the case where another
base was incorporated between two X, only Y was incorporated into
the complementary strand of the second X in the two X and continued
synthesis of complementary strand (refer to FIG. 9).
[0080] Similarly, a transcription reaction by RNA polymerase using
DNA containing X as template was examined. Using template 1-3,
promoter region on this strand was duplicated, and the
transcription reaction was examined using T7 RNA polymerase by
adding [.alpha.-.sup.32P] ATP.
[0081] A combination of primer region and template used in this
experiment is shown as follows.
[0082] A case using template 1-3
TABLE-US-00009 Coding strand: 5'-ATAATACGACTCACTATAGGG Template
1-3: 3'-TATTATGCTGAGTGATATCCCTCCTTCTNT CTCGT
[0083] (template 1: N=A [0084] template 2: N=G [0085] template 3:
N=X)
[0086] Result is shown in FIG. 10. In case of using template 3
(N=X), a band corresponding to a product as a result of selective
incorporation of Y to X is observed. Trace amount of U was
incorporated. In the case of template 1 (N=A), not only U but also
Y was found to incorporated into the complementary strand of A. In
the case of the template 2 (N=G), only C was incorporated, and
almost no production as a result of incorporation of Y was
observed.
[0087] Transcription reaction in the presence of rNTP was
conducted. Using the template 1 (N=A) and the template 3 (N=X), the
same as in the previous experiments, the transcription reaction was
examined using T7 RNA polymerase by adding [.alpha.-.sup.32P] ATP
under the condition of rATP 2 mM, rGTP 2 mM, rCTP 2 mM, UTP 2 mM,
and rYTP 1 mM, then generated full length of RNA was digested
completely by RNase T2, nucleotide labeled at 3'-terminal was
analyzed by 2-dimension TLC. Outline of this experiment is shown as
follows.
##STR00002##
[0088] Results are shown in FIG. 11. In FIG. 11, spots encircled
are indicated as spots observed by UV. In FIG. 11, A indicates the
case of template 3 (N=X) and B in FIG. 11 indicates the case of
template 1 (N=A). Theoretical values and experimental values in
each case are shown in Table 1 as follows.
TABLE-US-00010 TABLE 1 Theoretical and measured values of the base
for each template Template 3 (N = X) Template 1 (N = A) Theoretical
Measured Theoretical Measured Base Value Value Value Value Gp 4 4 4
4 Ap 1 1.05 1 0.92 Cp 1 0.94 1 0.78 Up 0 0.08 1 0.98 Yp 1 0.82 0
0.04
[0089] Result indicates that Y is almost selectively incorporated
in case of transcription reaction using the template 3 (N=X) and
trace amount of U is detected. In the case of template 1 (N=A), no
incorporation of Y is observed.
[0090] As explained hereinabove, the base X designed as such does
not form base pairing with thymine, but the base such as analogous
pyridine-2-one (base X) in which oxo at position-6 of thymine is
replaced by hydrogen is able to form base pair with X (refer to
FIGS. 2 a and b). Consequently, formation of selective nucleic base
pair of X-Y has detected.
[0091] Although formation of base pair of natural base thymine (or
uridine) (refer to FIG. 2 b) could be excluded, simultaneously low
rate of incorporation of dYTP by Klenow fragment was observed due
to disadvantageous effect on stacking between bases as well as
insufficient suppression of incorporation of thymidine triphosphate
(dTTP) to dx.
[0092] Consequently, attempts were performed to incorporate
aromatic substituents, which have no deteriorating effect on
stacking between bases, to position-6 in dx as the replacement of
dimethylamino group.
[0093] In the experiments, an example of incorporation of thiophene
at position-6 is illustrated as follows.
##STR00003##
2-amino-6-(2-thienyl)-9-(2-deoxy-.beta.-D-ribofuranosyl) purine [dx
2: the new base of which is designated as X2, and the previously
synthesized
2-amino-6-(N,N-dimethylamino)-9-(2-deoxy-.beta.-D-ribofuranosyl)
purine is designated as dx] was synthesized. Incorporation of dYTP
and rYTP for templates including this base was examined.
[0094] Outline of preparation of amidite reagent for dx for
synthesis of template DNA is illustrated in FIG. 5. In detail,
refer to example 2. This amidite reagent could show similar
coupling rate as same as of the commercially available amidite
reagent.
[0095] Using Klenow fragment (exo.sup.+), incorporation of dYTP on
dx2 in the template (refer to example 10).
[0096] Following base sequences were used as template and
primer.
TABLE-US-00011 Primer 5'-.sup.32pACTCACTATAGGGAGGAAGA- Template
3'-TATTATGCTGAGTGATATCCCTCCTTCT-N-TCTCGT
[0097] In the template, a position indicated by N was bound with
base X or base X2 (for experimental) or base A (for control), and
incorporation experiments of various bases were conducted. Results
are shown in FIG. 12, in which lanes 1 and 2 indicate control
experiments for incorporation of cytosine (C) and thymine (M) on
adenine (A).
[0098] Results indicate that rate of incorporation of dYTP on dx is
21% (lane 3), and that on dx2 is increased up to 40% (lane 8). As
compared with the incorporation rate of 57% in the case of dTTP on
natural type dA under the same condition, some improvement of
incorporation was observed by using dx2. Although comparing with
the case of dx, incorporation of dCTP is increased by using dx2
(22%) (lane 11), it is not so improved value as compared with the
incorporation of dYTP (40%).
[0099] As a result of experiment using Klenow fragment (exo.sup.+),
incorporation rate of dCTP on dx2 was increased by using dx2 in
place of dx. This might be due to interaction of 4-amino group of
cytosine and sulfur atom in thiophene in dx2 (refer to FIG. 2 f).
As is the case that sulfur atom in thiophene of dx2 is directed to
a plane of base pair, electrostatic repulsion against 4-keto group
of thymine (T) will be expected. This indicates that electrostatic
repulsive force (refer to FIG. 2 e) can be used in addition to
steric hindrance as a factor for hinder formation of base pairing.
Accordingly, in thiophene in dx2, sulfur atom side might be
directed to the plane of base pair.
[0100] Incorporation of rYTP into RNA on dx2 in the template by T7
RNA polymerase was examined according to the reaction (example
11):
##STR00004##
[0101] RNA having a sequence of the formula:
GGG*AGG*A*AGAn*AG*AGC*A
wherein n is a base corresponding to a base N, asterisk of the
right shoulder means labeling, is digested by RNase T2, then ratio
of each nucleotide was calculated by 2-dimension TLC (cellulose
resin).
[0102] In FIG. 13, development of TLC is shown. Ratio of
composition of each nucleotide is shown in Table 2 hereinbelow.
TABLE-US-00012 TABLE 2 Template rGp* rAp* rCp* rUp* rYp* N =
x.sub.2 3.982(4) 1.052(1) 0.950(1) 0.047(0) 0.969(1) N = A 3.939(4)
1.035(1) 0.995(1) 1.032(1) not detected(0) A parenthesis in the
table indicates theoretical value.
[0103] Result indicates that using dx2, rYTP can be incorporated
against dx2 with high selectivity. Good result has been obtained in
case of using dx as a template in the previous experiment, and in
case of using dx2 as a template to perform transcription in the
similar condition, result of analysis on nucleotide incorporated in
RNA on dx2 indicated that the similar high selectivity of
incorporation of rYTP on dx2 was obtained.
[0104] As explained hereinabove, the present invention provides
selective formation of base pair which has never achieved in the
heretofore reported artificial base pair. Further, the present
invention demonstrates that such the selective formation of base
pair can be achieved by steric hindrance of base pair, preferably
by applying steric hindrance and electrostatic repulsion as well as
stacking action. Bases used in the above experiments are shown as
illustration only of the present invention. This fact proves
correctness of the idea of the present invention for achieving
selective formation of artificial nucleic acid base pair.
Consequently, the present invention is never limited within the
bases concrete illustrated hereinbefore, and all base pairs
generated according to the idea of the present invention are within
the scope of the present invention.
[0105] Further, the fact that base pairs of the present invention
could be recognized by natural synthetases has actually proved, and
the base pairs of the present invention could also be used in
synthetic and transcriptional systems of natural DNA and RNA as
similar to the natural base pairs. Consequently, the present
invention provides concept for formation of novel artificial base
pair which can be applied and achieved in the systems on functional
expression of natural gene. Such the artificial nucleic acid base
pair of the present invention can be applied not only on the
protein synthesis system or functional nucleic acid but also on the
solution of functions and elucidation of natural gene systems.
EXAMPLES
[0106] Following examples illustrate the present invention but are
not construed as limiting the present invention.
Example 1
Synthesis of
2-benzamino-6-(N,N-dimethylamino)-9-[5'-O-dimethoxytrityl-3'-O-[[(diisopr-
opylamino)-2-cyanoethoxy]phosphino]-2'-deoxy-.beta.D-ribofuranosyl]
purine (10) (refer to FIG. 3)
(A) Synthesis of
2-amino-6-(N,N-dimethylamino)-9-(2',3,5'-tri-O-acetyl-.beta.-D-ribofurano-
syl] purine (2)
[0107]
2-amino-6-chloro-9-(2',3',5'-tri-O-acetyl-.beta.-D-ribofuranosyl)
purine (1) [M. J. Robins and B. Uznanski, Can. J. Chem., 59,
2601-2607 (1981)](18.6 mmol, 7.96 g) was dehydrated three times
azeotropically with anhydrous pyridine, and dissolved in anhydrous
pyridine, then dimethylamine hydrochloride (55.8 mmol, 4.55 g) and
diisopropylethylamine (74.4 mmol) were added thereto with stirring
at room temperature. The mixture was stirred at room temperature
for 15 hours. After confirming completion of the reaction by TLC,
water was added to the reaction mixture and concentrated in vacuo.
Chloroform was added to the residue, and the organic layer was
washed 3 times with water, 2 times with 5% aqueous sodium hydrogen
carbonate, once with water and 2 times with 10% aqueous citrate
solution, then the organic layer was dried with magnesium sulfate,
and dried in vacuo after filtration. The residue was treated with
azeotropic distillation with toluene until no odor of pyridine was
noted, the product was purified by silica-gel chromatography
(dichloromethane-ethanol) to obtain the product (2) 5.42 g (12.4
mmol) (67%).
[0108] .sup.1H-NMR (500.13 MHz, CDCl.sub.3) .delta.: 7.56 (s, 1H,
H8), 6.02 (d, 1H, H1', J=5.0 Hz), 5.95 (dd, 1H, H2', J=5.0 Hz),
5.79 (t, 1H, H3', J=5.0 Hz), 4.69 (s, 2H, 2-NH.sub.2), 4.42-4.45
(m, 1H, H4'), 4.34-4.40 (m, 2H, H5', H5''), 3.43 (br, 6H,
N--CH.sub.21), 2.13, 2.10, 2.08 (s, 3H, Ac).
(B) Synthesis of
2-benzamino-6-(N,N-dimethylamino)-9-[2',3',5'-tri-O-acetyl-.beta.-D-ribof-
uranosyl] purine (3)
[0109] A compound (2) obtained in the above (A) (10 mmol, 4.36 g)
was azeotropically dehydrated three times and dissolved in
anhydrous pyridine (180 ml). Under stirring at room temperature,
benzoyl chloride (15 mmol, 1.74 ml) was added and the mixture was
stirred at room temperature for 14 hours. After confirming
completion of the reaction by TLC, water was added to the reaction
mixture and concentrated in vacuo. Chloroform was added to the
residue, and the organic layer was washed 2 times with 5% aqueous
sodium hydrogen carbonate and once with water. The organic layer
was dried with magnesium sulfate and filtered, then concentrated in
vacuo. The residue was treated by azeotropic distillation until the
residue showed no odor of pyridine. The residue was purified by
silica-gel column chromatography (hexane-dichloroethane) to obtain
the product (3) 3.53 g (6.53 mmol) (65%).
[0110] .sup.1H-NMR (500.13 MHz, CDCl.sub.3) .delta.: 8.46 (s, 1H,
H8), 7.96 (d, 2H, Bz-m, J=10.0 Hz), 7.75 (s, 1H, NHBz), 7.55 (dd,
1H, Bz-p, J=7.5 Hz), 7.48 (t, 2H, H Bz-o, J=7.5), 6.08 (d, 1H, H1',
J=3.0 Hz), 5.96-6.01 (m, 2H, H2', H3'), 4.39-4.50 (m, 3H, H4', H5',
H5''), 3.48 (br, 6H, N--CH.sub.3), 2.15 (s, 3H, Ac), 2.10 (s, 3H,
Ac), 2.08 (s, 3H, Ac).
(C) Synthesis of
2-benzamino-6-(N,N-dimethylamino)-9-(.beta.-D-ribofuranosyl) purine
(4)
[0111] To a compound (3) obtained hereinabove (6.53 mmol, 3.53 g)
pyridine-methanol-water (65:30:5) 50 ml was added and stirred in
the ice-water bath. 2M sodium hydroxide-pyridine-methanol-water
(65:30:5) 50 ml was added and stirred for 15 minutes in the
ice-water bath. After confirming completion of the reaction,
ammonium chloride (5.21 g) was added to the reaction mixture and
concentrated in vacuo until volume reached up to 40 ml. Chloroform
was added to the solution, and the organic layer was extracted.
Then the aqueous layer was extracted twice with
chloroform-pyridine. The organic layer was collected and dried with
magnesium sulfate. The filtrate was concentrated up to volume of 10
ml in vacuo. Toluene was added thereto and concentrated in vacuo to
precipitate crystals. Crystals were collected by filtration and
dried in vacuo at 90.degree. C. to obtain the product (4) 2.87
g.
[0112] .sup.1H-NMR (500.13 MHz, DMSO-d.sub.6) .delta.: 8.28 (s, 1H,
H8), 7.92 (dd, 2H, Bz-m, J=7.0 Hz), 7.57 (dd, 1H, Bz-p, J=7.3 Hz),
7.49 (t, 2H, H Bz-o, J=7.5), 5.91 (d, 1H, H1', J=4.0 Hz), 5.48 (d,
1H, OH, J=5.5 Hz), 5.15 (d, 1H, OH, J=4.0 Hz), 5.04 (t, 1H, OH,
J=1.0 Hz), 4.56 (t, 1H, H2', J=10.0 Hz), 4.17 (d, 1H, H3', J=3.0
Hz), 3.93 (d, 3H, H4', J=3.5 Hz), 3.63-3.65 (m, 1H, H5'), 3.52-3.56
(m, 1H, H5''), 3.48 (br, 6H, N--CH.sub.3).
(D) Synthesis of
2-benzamino-6-(N,N-dimethylamino)-9-(3',5'-O-tetraisopropyldisiloxanyl-.b-
eta.-D-ribofuranosyl) purine (5)
[0113] A compound (4) obtained in the above (4) (5.0 mmol, 2.07 g)
was dehydrated three times azeotropically with anhydrous pyridine
and dissolved in anhydrous pyridine (50 ml), then
1,3-dichloro-1,1,3,3-tetraisopropyldisiloxane (5.5 mmol, 1.76 ml)
was added and stirred at room temperature for 14 hours. After
confirming completion of the reaction by TLC, water was added to
the reaction mixture and concentrated in vacuo. Chloroform was
added to the residue. The organic layer was washed twice with 5%
aqueous sodium hydrogen carbonate and once with saturated sodium
chloride solution. The organic layer was dried with magnesium
sulfate, filtered and dried in vacuo. Azeotropic treatment was
repeated until no odor of pyridine in the residue was noted. Then
the residue was purified by silica-gel chromatography
(dichloromethane-methanol) to obtain the product (5) 2.63 g (4.0
mmol) (80%).
[0114] .sup.1H-NMR (500.13 MHz, CDCl.sub.3) .delta.: 8.22 (s, 1H,
H8), 7.89 (d, 2H, Bz-m, J=5.0 Hz), 7.80 (s, 1H, NHBz), 7.55 (dd,
1H, Bz-p, J=7.5 Hz), 7.48 (t, 2H, Bz-o, J=7.5 Hz), 5.91 (s, 1H,
H1'), 4.84 (dd, 1H, H3', J=5.5 Hz), 4.50 (d, 1H, H2', J=5.5 Hz),
4.07-4.20 (m, 2H, H4', H5'), 4.06 (d, 1H, H5'', J=13.0 Hz), 3.48
(br, 6H, N--CH.sub.3), 0.95-1.08 (m, 28H, iPr).
(E) Synthesis of
2-benzamino-6-(N,N-dimethylamino)-9-(2'-O-phenoxythiocarbonyl-3',5'-O-tet-
raisopropyldisiloxanyl-.beta.-D-ribofuranosyl) purine (6)
[0115] The compound (5) obtained in the above (D) was dehydrated
azeotropically three times with anhydrous toluene and dissolved in
anhydrous dichloromethane (40 ml). 1-methylmidazole (7.96 mmol,
0.64 ml) and chlorothio carbonate phenyl (5.57 mmol, 0.77 ml) were
added with stirring at room temperature, then stirred at room
temperature for 16 hours. After confirming completion of the
reaction by TLC, 5% aqueous sodium hydrogen carbonate was added to
the reaction mixture. After extracted the organic layer, the
organic layer was washed one with aqueous 5% sodium hydrogen
carbonate, once with water, twice with aqueous 10% citrate solution
and once with water, in this order, the organic layer was dried
with magnesium sulfate, filtered and dried in vacuo. The residue
was purified by silica-gel column chromatography
(dichloromethane-methanol) to obtain the product (6) 2.96 g (3.73
mmol) (94%).
[0116] .sup.1H-NMR (500.13 MHz, DMSO-d.sub.6) .delta.: 8.17 (s, 1H,
H8), 7.87 (d, 2H, Bz-m, J=3.0 Hz), 7.79 (s, 1H, NHBz), 7.55 (t, 1H,
Bz-p, J=7.5 Hz), 7.47 (t, 2H, H Bz-o, J=7.5 Hz), 7.41 (d, 2H,
PhO-o, J=7.5 Hz), 7.29 (t, 2H, PhO-m, J=7.5 Hz), 7.13 (d, 1H,
PhO-p, J=10.0 Hz), 6.39 (d, 1H, H2', J=5.0 Hz), 6.11 (s, 1H, H1'),
5.14-5.17 (m, 1H, H3'), 4.23-4.26 (m, 1H, H5'), 4.07-4.12 (m, 1H,
H4', H5''), 3.48 (br, 6H, N--CH.sub.3), 0.99-1.15 (m, 28H,
iPr).
(F) Synthesis of
2-benzamino-6-(N,N-dimethylamino)-9-(2'-deoxy-3',5'-O-tetraisopropyldisil-
oxanyl-.beta.-D-ribofuranosyl) purine (7)
[0117] The compound (6) obtained in the above (E) was dehydrated
azeotropically three times with anhydrous toluene, and dissolved in
anhydrous toluene (88 ml). 2,2'-azo-bis-isobutyronitrile (0.746
mmol, 122 mg) was added thereto with stirring at room temperature
and added argon gas with bubbling for 1 hours at room temperature.
Thereto was added tributyltin hydride (5.60 mmol, 1.51 ml) and
stirred at 75.degree. C. for 3.5 hours. After confirming completion
of the reaction by TLC, the reaction mixture was concentrated in
vacuo. The residue was purified by silica-gel column chromatography
(dichloromethane-methanol) to obtain the product (7) 2.27 g (3.55
mmol) (95%).
[0118] .sup.1H-NMR (500.13 MHz, CDCl.sub.3) .delta.: 8.24 (s, 1H,
H8), 7.90 (d, 2H, Bz-m, J=5.0 Hz), 7.83 (s, 1H, NHBz), 7.54 (t, 1H,
Bz-p, J=7.5 Hz), 7.48 (t, 2H, H Bz-o, J=7.5 Hz), 6.29 (dd, 1H, H1',
J=7.5 Hz), 4.80-4.83 (m, 1H, H3'), 3.97-4.07 (m, 2H, H5', H5''),
3.86-3.88 (m, 1H, H4'), 3.50 (br, 6H, N--CH.sub.3), 2.68-2.71 (m,
1H, H2'), 2.59-2.63 (m, 1H, H2''), 1.03-1.09 (m, 28H, iPr).
(G) Synthesis of
2-benzamino-6-(N,N-dimethylamino)-9-(2'-deoxy-.beta.-D-ribofuranosyl)
purine (8)
[0119] The compound (7) obtained in the above (F) (3.55 mmol, 2.27
g) was added to 1M solution of tetrabutylammonium
fluoride-tetrahydrofuran (14 ml) and stirred at room temperature
for 15 minutes. After confirming completion of the reaction by TLC,
the reaction mixture was concentrated in vacuo. The residue was
dissolved in chloroform, washed with small amount of water, and the
aqueous layer was extracted 4 times with chloroform. The organic
layer was dried with magnesium sulfate. The filtrate was
concentrated in vacuo and the residue was treated azeotropically
with toluene until no odor of pyridine was noted. The residue was
dissolved in methanol. Dichloromethane was added dropwise as little
as possible to crystallize the product. The crystals were collected
by filtration and dried in vacuo to obtain the product (8) 0.964 g
(2.42 mmol) (68%).
[0120] .sup.1H-NMR (500.13 MHz, DMSO-d.sub.6) .delta.: 8.23 (s, 1H,
H8), 7.84 (d, 2H, Bz-m, J=7.5 Hz), 7.50 (t, 1H, Bz-p, J=7.3 Hz),
7.42 (t, 2H, H Bz-o, J=7.5 Hz), 6.25 (t, 1H, H1', J=7.0 Hz), 5.21
(s, 1H, OH), 4.89 (s, 1H, OH), 4.33 (s, 1H, H3'), 3.77 (s, 1H,
H4'), 3.50-3.53 (m, 1H, H5'), 3.43-3.46 (m, 1H, H5''), 3.48 (br,
6H, N--CH.sub.3), 2.56-2.61 (m, 1H, H2'), 2.16-2.18 (m, 1H,
H2'').
(H) Synthesis of
2-benzamino-6-(N,N-dimethylamino)-9-(5'-O-dimethoxytrityl-2'-deoxy-.beta.-
-D-ribofuranosyl) purine (9)
[0121] The compound (8) (1.47 mmol, 0.585 g) was azeotropically
dehydrated three times with anhydrous pyridine and dissolved in
anhydride pyridine (10 ml). 4,4'-dimethoxy tritylchloride (1.61
mmol, 547 mg) was added with stirring at room temperature, then
stirred at room temperature for 1.5 hours. After confirming
completion of the reaction by TLC, water was added to the reaction
mixture and concentrated in vacuo. Chloroform was added to the
residue and the organic layer was washed twice with aqueous 5%
sodium hydrogen carbonate and once with water, then the organic
layer was dried with magnesium sulfate, filtered and concentrated
in vacuo. The residue was azeotropically distilled with toluene
until no odor of pyridine was noted, and was purified by silica-gel
column chromatography (dichloromethane-methanol-0.5% triethylamine)
to obtain the product (9) 0.99 g (1.41 mmol) (96%).
[0122] .sup.1H-NMR (270.16 MHz, CDCl.sub.3) .delta.: 8.20 (s, 1H,
H8), 7.79 (s, 1H, NHBz), 7.77 (d, 2H, Bz-m, J=1.4 Hz), 7.76 (d, 1H,
Bz-p, J=3.5 Hz), 7.14-7.51 (m, 11H, H Bz-o, DMTrI, 6.72 (dd, 4H,
DMTr), 6.45 (t, 1H, H1', J=6.5 Hz), 4.78 (m, 1H, H3'), 4.14 (m, 1H,
H4'), 3.74 (s, 6H, OCH.sub.3), 3.50 (br, 6H, N--CH.sub.3),
3.39-3.47 (m, 1H, --H5'), 3.30-3.33 (m, 1H, H5''), 2.80-2.85 (m,
2H, H2', H2'').
(I) Synthesis of
2-benzamino-6-(N,N-dimethylamino)-9-[5'-O-dimethoxytrityl-3'-O-[[(diisopr-
opylamino)-2-cyanoethoxy]phosphino]-2'-deoxy-.beta.-D-ribofuranosyl]
purine (10)
[0123] The compound (9) (0.864 mmol, 0.605 g) was azeotropically
distilled three times with anhydrous pyridine and twice with
anhydrous tetrahydrofuran and dissolved in anhydrous
tetrahydrofuran (6 ml). N,N-diisopropylethylamine (2.59 mmol, 0.452
ml) and chloro-2-cyanoethoxy-N,N-diisopropyl-aminophosphine (1.73
mmol, 0.385 ml) were added with stirring at room temperature and
further stirred at room temperature for 2 hours. After confirming
completion of the reaction by TLC, anhydrous methanol was added to
the reaction mixture to terminate the reaction. Ethyl acetate was
added to the reaction mixture, and the organic layer was washed
once with 5% aqueous sodium hydrogen carbonate and three times with
saturated aqueous sodium chloride solution. The organic layer was
dried with anhydrous sodium sulfate and concentrated in vacuo after
filtration. The residue was purified by silica-gel column
chromatography (dichloromethane-methanol-2% triethylamine), and
dissolved in small volume of chloroform, and reprecipitated by
adding hexane to obtain the product (10) 0.574 g (0.638 mmol)
(74%).
[0124] .sup.1H-NMR (270.16 MHz, CDCl.sub.3) .delta.: 8.14 (s, 1H,
H8), 8.13 (s, 1H, H8), 7.72 (s, 1H, NHBz), 7.65-7.70 (m, 2H, Bz-m),
7.16-7.47 (m, 12H, H Bz-p,o, DMTr), 6.70-6.75 (m, 4H, DMTr),
6.27-6.41 (m, 1H, H1'), 4.63-4.80 (m, 1H, H3'), 4.20-4.27 (m, 1H,
H4'), 3.74 (s, 6H, OCH.sub.3), 3.24-3.72 (m, 10H, H5', H5'',
NCH(CH.sub.3).sub.2, N--CH.sub.3), 2.83-3.00 (m, 1H, H2'),
2.40-2.64 (m, 5H, H2'', OCH.sub.2CH.sub.2CN), 1.06-1.19 (m, 12H,
NCH(CH.sub.3).sub.2).
[0125] 31P-NMR (109.36 MHz, CDCl.sub.3) .delta.: 149.25.
Example 2
Synthesis of
2-isobutyrylamino-6-(2-thienyl)-9-[2-deoxy-3-O-[diisopropylamino]-(2-cyan-
oethoxy)]phosphino-5-O-dimethoxytrityl-.beta.-D-ribofuranosyl]
purine (22) (Synthetic route is shown in FIG. 5)
(A) Synthesis of
2-isobutyrylamino-6-iodo-9-(2-deoxy-3,5-di-O-isobutyryl-.beta.-D-ribofura-
nosyl] purine (18)
[0126]
2-isobutyrylamino-6-amino-9-(2-deoxy-3,5-di-O-isobutyryl-.beta.-D-r-
ibofuranosyl] purine (17) [Babara L. Gaffney, Luis A. Marky and
Roger A. Jones, Tetrahedron, 40, 3-13 (1984)] 2.38 g (5 mmol) was
heated at 60.degree. C. under argon atmosphere. n-pentylnitrite
13.5 ml (0.10 mol) and diiodomethane 25 ml (0.31 mol) were rapidly
added and suspended. The mixture was irradiated by visible light
using 200 W halogen tungsten lump at the distance from light source
2 cm for 3 hours under well stirring at 60.degree. C. To the
reaction mixture, saturated aqueous sodium sulfite 30 ml was added
and stirred at room temperature for 3 hours. Thereafter, saturated
aqueous sodium sulfite 120 ml and chloroform 150 ml were added to
separate the layers. The aqueous layer was extracted twice with
chloroform. The thus obtained organic layer was dried with
anhydrous magnesium sulfate and concentrated. The residue was
purified by short column (developer:ethyl
acetate:dichloromethane=1:4) to obtain the product (18) 1.01 g
(1.72 mmol) (34.4%).
[0127] .sup.1H-NMR (270 MHz, CDCl.sub.3) .delta.: 8.19 (s, 1H),
8.14 (bs, 1H), 6.42 (dd, J=7.4, 6.4 Hz, 1H), 5.44 (m, 1H), 4.41 (m,
2H), 4.34 (m, 1H), 3.00 (m, 1H), 2.80 (m, 1H), 2.58 (m, 3H), 1.17
(m, 18H).
(B) Synthesis of
2-isobutyrylamino-6-(2-thienyl)-9-(2-deoxy-3,5-di-O-isobutyryl-.beta.-D-r-
ibofuranosyl) purine (19)
[0128] The compound (18) 294 mg (0.5 mmol) obtained in the above
(A) was dissolved in thiophene 80 ml under argon atmosphere and the
solution was transferred into the photochemical reaction vessel
(Pyrex). Ultraviolet ray was irradiated using 400 W mercury lamp
for 24 hours under argon atmosphere. The reaction mixture after
irradiation was concentrated, and the residue was purified using
short column (developer:isopropanol:dichloromethane 3:197) to
obtain the product (19) 212 mg (0.39 mmol) (78.0%).
[0129] .sup.1H-NMR (270 MHz, CDCl.sub.3) .delta.: 8.63 (dd, J=3.8,
1.2 Hz, 1H), 8.17 (s, 1H), 8.10 (bs, 1H), 7.64 (m, 1H), 7.25 (m,
1H), 6.47 (dd, J=7.9, 1.8 Hz, 1H), 5.44 (m, 1H), 4.43 (m, 2H), 4.37
(m, 1H), 3.18 (m, 1H), 3.00 (m, 1H), 2.61 (m, 3H), 1.24 (m,
18H).
(C) Synthesis of
2-isobutyrylamino-6-(2-thienyl)-9-(2-deoxy-.beta.-D-ribofuranosyl)
purine (20)
[0130] The compound (19) 212 mg (0.39 mmol) obtained by the above
(B) was dissolved in 1 M sodium hydroxide solution
(pyridine-methanol-water=13:6:1) 1.95 ml under ice-cooling and
stirred for 15 minutes. The reaction mixture was neutralized by
adding aqueous 5% ammonium chloride. Further added 1.2 g Celite to
the mixture and the solvent was removed completely under reduced
pressure. The residue was purified by short column (developer: 5-7%
ethanol-dichloromethane) to obtain the product (20) 147 mg (0.37
mmol) (93.6%).
[0131] .sup.1H-NMR (270 MHz, DMSO-d.sub.6) .delta.: 10.45 (bs, 1H),
8.69 (s, 1H1), 8.60 (d, J=3.5 Hz, 1H), 7.90 (d, J=4.6 Hz, 1H), 7.32
(dd, J=4.6, 3.5 Hz, 1H), 6.39 (t, J=6.6 Hz, 1H), 5.34 (d, J=3.8 Hz,
1H), 4.91 (t, J=5.3 Hz, 1H), 4.44 (m, 1H), 3.55 (m, 2H), 2.96 (m,
1H), 2.74 (m, 1H), 2.33 (m, 1H), 1.11 (m, 6H).
(D) Synthesis of
2-isobutyrylamino-6-(2-thienyl)-9-(2-deoxy-5-O-dimethoxytrityl-.beta.-D-r-
ibofuranosyl) purine (21)
[0132] The compound (20) 98 mg (0.24 mmol) obtained in the above
(C) was azeotropically distilled three times with anhydrous
pyridine. The residue was dissolved in anhydrous pyridine 2 ml,
added triethylamine 35 ml, dimethylaminopyridine 1.4 mg and
dimethoxytrityl chloride 85 mg were added thereto and stirred at
room temperature for overnight. Ethyl acetate 25 ml was added to
the reaction mixture. The mixture was treated with water for three
time for separation to obtain organic layer. Each aqueous layer was
washed with ethyl acetate. The organic layer was collected, dried
with anhydrous sodium sulfate and concentrated in vacuo. The
residue was purified by using short column (developer: 25-50% ethyl
acetate-dichloromethane) to obtain the product (21) 132 mg (0.19
mmol) (76.7%).
[0133] .sup.1H-NMR (270 MHz, CDCl.sub.3) .delta.: 8.64 (dd, J=3.6,
0.9 Hz, 1H), 8.14 (s, 1H), 7.92 (bs, 1H), 7.61 (dd, J=4.3, 0.9 Hz,
1H), 7.39 (m, 2H), 7.24 (m, 8H), 6.77 (m, 4H), 6.47 (t, J=6.2 Hz,
1H), 4.79 (m, 1H), 4.13 (m, 1H), 3.76 (s, 3H), 3.75 (s, 3H), 3.44
(dd, J=10.23, 5.8 Hz, 1H), 3.38 (dd, J=10.23, 4.4 Hz, 1H), 2.91 (m,
1H), 2.60 (m, 1H), 2.30 (m, 1H), 1.27 (m, 6H).
(E) Synthesis of
2-isobutyrylamino-6-(2-thienyl)-9-[2-deoxy-3-O-[(diisopropylamino)-(2-cya-
noethoxy)]phosphyno-5-O-dimethoxytrityl-.beta.-D-ribofuranosyl)
purine (22)
[0134] The compound (212) 125 mg (0.18 mmol) obtained in the above
(D) was azeotropically distilled three times with anhydrous
pyridine 0.5 ml and azeotropically distilled three times with
anhydrous tetrahydrofuran 0.5 ml. The residue was dissolved in
anhydrous tetrahydrofuran 1.2 ml under argon atmosphere, then added
further diisopropylethylamine 46 ml and (2-cyanoethoxy)
(N,N-diisopropylamino) phosphine chloride 59 ml and stirred at room
temperature for 1 hour. Remained chloride was decomposed by adding
methanol 50 ml. Ethyl acetate containing 3% triethylamine 25 ml was
added to the reaction mixture, and water 25 ml was added for three
times separation to obtain organic layer. Each aqueous layer was
washed with 3% triethylamine containing ethyl acetate. The organic
layer was collected, dried with anhydrous sodium sulfate and
concentrated in vacuo. The residue was purified by using short
column (developer: 3% triethylamine-32% ethyl acetate-65% hexane)
to obtain the product (22) 139 mg (0.16 mmol) (92.2%).
[0135] .sup.1H-NMR (270 MHz, CDCl.sub.3) .delta.: 8.64 (m, 1H),
8.16 (m, 1H), 7.86 (m, 1H), 7.61 (m, 1H), 7.26 (m, 2H), 7.24 (m,
8H), 6.78 (m, 4H), 6.45 (m, 1H9, 4.75 (m, 1H), 4.23 (m, 1H), 3.75
(m, 6H), 3.70 (m, 4H), 3.36 (m, 2H), 2.75 (m, 2H), 2.62 (m, 1H),
2.48 (m, 1H), 1.95 (m, 1H), 1.18 (m, 18H).
[0136] .sup.31P-NMR (270 MHz, CDCl.sub.3): 149.51, 148.43 ppm.
Example 3
Synthesis of
3-(2'-deoxy-5'-O-triphosphoryl-.beta.-D-ribofuranosyl)pyridine-2-one
(dYTP) (23) (refer to FIG. 4)
(A) Synthesis of
3-(3',5'-O-tetraisopropyldisiloxanyl-.beta.-D-ribofuranosyl)pyridine-2-on-
e (12)
[0137] 3-(.beta.-D-ribofuranosyl)pyridine-2-one (11) [J.
Matulic-Adamic and L. Beigelman, Tetrahedron Lett., 38, 203-206
(1997)] (2.29 mmol, 520 mg) was azeotropically dehydrated three
times with anhydrous pyridine and was dissolved in anhydrous
pyridine (23 ml). 1,3-dichloro-1,1,3,3-tetraisopropyldisiloxane
(2.52 mmol, 0.81 ml) was added with stirring at room temperature
and further stirred at room temperature for overnight. After
confirming completion of the reaction by TLC, water was added to
the reaction mixture to terminate the reaction and concentrated in
vacuo. The residue was dissolved in chloroform. The organic layer
was washed twice with aqueous 5% sodium hydrogen carbonate and once
with aqueous saturated sodium chloride solution. The organic layer
was dried with magnesium sulfate, and filtered. The filtrate was
concentrated in vacuo. The residue was purified by using silica-gel
chromatography (dichloromethane-methanol) to obtain the product
(12) 442 mg (0.94 mmol) (41%).
[0138] .sup.1H-NMR (270.06 MHz, CDCl.sub.3) .delta.: 13.07 (br, 1H,
NH), 7.78 (d, 1H, H4, J=6.8 Hz), 7.37 (d, 1H, H6, J=4.6 Hz), 6.29
(t, 1H, H5, J=6.6 Hz), 5.07 (s, 1H, H1'), 4.01-4.30 (m, 5H, H2',
H3', H4', H5', H5''), 0.83-1.10 (m, 28H, iPr).
(B) Synthesis of
3-(2'-O-imidazothiocarbonyl-3',5'-O-tetraisopropyldisiloxanyl-.beta.-ribo-
furanosyl)pyridine-2-one (13)
[0139] The compound (12) (0.94 mmol, 442 mg) obtained in the above
(A) was dehydrated azeotropically three times with anhydrous
toluene, dissolved in anhydrous DMF (9 ml). Thiocarbonylimidazolide
(2.24 mmol, 401 mg) was added under stirring at room temperature,
then the reaction mixture was stirred at room temperature for 7
hours. After confirming completion of the reaction by TLC, ethyl
acetate was added to the reaction mixture. The organic layer was
washed twice with water, dried with magnesium sulfate, and the
filtrate was concentrated in vacuo. The residue was purified by
using silica-gel column chromatography (dichloromethane methanol)
to obtain the product (13) 434 mg (0.749 mmol) (80%).
[0140] .sup.1H-NMR (270.06 MHz, CDCl.sub.3) .delta.: 13.40 (br, 1H,
NH), 8.44 (s, 1H, imidazolide), 7.84 (d, 1H, H4, J=6.8 Hz), 7.73
(s, 1H1 imidazolide), 7.33 (d, 1H, H6, J=6.5 Hz), 7.07 (s, 1H,
imidazolide), 6.34 (t, 1H, H5, J=6.8 Hz), 6.23 (d, 1H, H2', J=5.1
Hz), 5.25 (s, 1H, H1'), 4.46-4.52 (m, 1H, H3'), 4.25-4.29 (m, 1H,
H5'), 4.03-4.09 (m, 2H, H4', H5''), 0.87-1.09 (m, 28H, iPr).
(C) Synthesis of
3-(2'-deoxy-3',5'-O-tetraisopropyldisiloxanyl-.beta.-ribofuranosyl)pyridi-
ne-2-one (14)
[0141] The compound (13) (0.749 mmol, 434 mg) obtained in the above
(B) was dehydrated azeotropically three times with anhydrous
toluene, added ammonium sulfate (8.4 mg), dissolved in
hexamethyldisilazane (12.6 ml) and refluxed for 1 hour. The
reaction mixture was concentrated in vacuo, dehydrated
azeotropically three times with anhydrous toluene, added
azobisisobutyronitrile (83.5 mg) and dissolved in anhydrous toluene
(16.8 ml). Tributyltin hydride (0.821 ml) was added to the reaction
mixture and refluxed for 1 hour. After confirming completion of the
reaction by TLC, the reaction mixture was concentrated in vacuo.
The residue was purified by using silica-gel column chromatography
(dichloromethane-methanol) to obtain the product (14) 0.268 g
(0.591 mmol) (79%).
[0142] .sup.1H-NMR (270.06 MHz, CDCl.sub.3) .delta.: 13.07 (br, 1H,
NH), 7.72 (d, 1H, H4, J=7.0 Hz), 7.31 (d, 1H, H6, J=6.5 Hz), 6.29
(t, 1H, H5, J=6.6 Hz), 5.20-5.25 (m, 1H, H1'), 4.37-4.40 (m, 1H,
H3'), 3.97-4.12 (m, 2H, H5', H5''), 3.80-3.84 (m, 1H, H4'),
2.26-2.36 (m, 1H, H2'), 1.77-1.86 (m, 1H, H2''), 0.90-1.09 (m, 28H,
iPr).
(D) Synthesis of 3-(2'-deoxy-.beta.-D-ribofuranosyl)pyridine-2-one
(15)
[0143] The compound (14) (0.089 mmol, 42 mg) obtained in the above
(C) was dehydrated azeotropically three times with anhydrous
toluene, added 1 M tetramethyl ammoniumfluoride/THF solution (0.5
ml) and stirred at room temperature for 2 hours. After confirming
completion of the reaction by TLC, acetic acid (0.08 ml) was added
thereto and concentrated in vacuo. The residue was dissolved in
water, washed three times with ethyl acetate, and the aqueous layer
was concentrated in vacuo. The residue was purified by using
reverse phase silica-gel chromatography to obtain the product (15)
0.14 mg (0.047 mmol) (52%).
[0144] .sup.1H-NMR (270.06 MHz, CDCl.sub.3) .delta.: 7.77 (d, 1H,
H4, J=3.8 Hz), 7.36 (d, 1H, H6, J=3.5 Hz), 6.41 (t, 1H, H5, J=3.6
Hz), 5.01-5.17 (m, 1H, H1'), 4.29-4.31 (m, 1H, H3'), 3.93-3.95 (m,
1H, H4'), 3.62-3.70 (m, 2H, H5', H5''), 2.31-2.35 (m, 1H, H2'),
1.89-1.95 (m, 1H, H2'').
(E) Synthesis of
3-(2'-deoxy-5'-O-triphosphoryl-.beta.-D-ribofuranosyl)pyridine-2-one
(16)
[0145] The compound (15) (0.059 mmol, 13.4 mg) obtained in the
above (D) was dehydrated azeotropically three times with anhydrous
toluene, dissolved in trimethyl phosphate (0.2 ml), added
phosphorus oxychloride (0.065 mmol, 7.1 .mu.l) under ice-cooling
and stirred for 7 hours under ice-cooling. After confirming
completion of the reaction by TLC, well mixed solution of 0.5 M
bistributylammonium pyrophosphate-DMF solution and tributylamine
(70.2 .mu.l) was immediately added and stirred well under
ice-cooling for 30 minutes. 1 M triethylammonium bicarbonate (0.35
ml) was added to the reaction mixture to terminate the reaction and
concentrated in vacuo. The residue was dissolved in water and
charged on a column of DEAE-Sephadex chromatography (15.times.300
mm) and eluted by gradient elution with 50 mM-1 M triethylammonium
bicarbonate. A fraction eluted at 0.53-0.59 M was collected and
lyophilized. Structure was confirmed by MS (ESI-), .sup.1H-NMR and
.sup.31P-NMR. Sodium salt was prepared by treating with Dowex 50Wx8
column chromatography.
[0146] MS (ESI-): (M-H.sup.-) 449.9.
[0147] .sup.1H-NMR (270.06 MHz, CDCl.sub.3) .delta.: 7.83 (d, 1H,
H4, J=4.9 Hz), 7.35 (d, 1H, H6, J=4.9 Hz), 6.51 (t, 1H, H5, J=4.9
Hz), 5.17 (t, 1H, H1', J=5.0 Hz), 4.56 (br, 1H, H3'), 4.06 (br, 1H,
H4'), 3.99 (br, 2H, H5', H5''), 2.19-2.33 (m, 1H, H2'), 1.81-1.98
(m, 1H, H2'').
[0148] .sup.31P-NMR (109.36 MHz, D.sub.2O) .delta.: -10.3 (m, 2P,
P.sup.1, P.sup.3), -22.7 (m, 1P, P.sup.2).
[0149] UV (10 mM phosphate buffer pH 7.0): .lamda.max=298 nm
(.epsilon.=7.6.times.10.sup.3), 226 nm
(.epsilon.=7.0.times.10.sup.3), .lamda.min=247 nm, 211 nm.
Example 4
Synthesis of Primer and Template
[0150] Following primer and template were synthesized
conventionally by using DNA/RNA synthesizer Type 392, The
Perkin-Elmer, Applied Biosystems Div., and cyanoethylamidide
reagents of dA, dC, dG and dT, which were available from The
Perkin-Elmer, and dX of cyanoethylamidite reagent hereinbefore.
[0151] Proviso that in a synthesis of oligomer containing dX,
removal of protective group for amino group of dX, i.e. benzoyl
group, could not completely be performed by conventional condition
using conc. ammonia at 55.degree. C. for overnight, consequently,
treatment for removal of the protective group was performed under
the condition at 80.degree. C. with conc. ammonia for 10 hours.
TABLE-US-00013 Primer 1: dcgactcactataggg Primer 2: dctatagggaggaga
Primer 3: dgcctagttgtaccg Template 1:
dtgctctatcttcctccctatagtgagtcgtattat Template 2:
dtgctctgtcttcctccctatagtgagtcgtattat Template 3:
dtgctctxtcttcctccctatagtgagtcgtattat Template 4:
dagctgtgtgtgtctccggtacaactaggc Template 5:
dagctxtgtgtgtctccggtacaactaggc Template 6:
dagctxxgtgtgtctccggtacaactaggc Template 7:
dagctxtxtgtgtctccggtacaactaggc Template 8:
dagctxtgxgtgtctccggtacaactaggc Template 9:
dagctxtgtxtgtctccggtacaactaggc
Example 5
5'-.sup.32P Labeling of Primer
[0152] Primer 1-4 (ca. 1 mmol), 10.times. polynucleotide kinase
buffer (TAKARA) 2 .mu.l, [.gamma.-.sup.32P]-dATP (ca. 1.1 TBq/mmol)
2 .mu.l, and polynucleotide kinase (10 unit/.mu.l, TAKARA) 2 .mu.l
were added into a tube 0.5 ml. The mixture, total 20 .mu.l, was
incubated at 37.degree. C. for 40 minutes. The reaction was
terminated by adding 10 M urea BPB dye 10 .mu.l, treated at
75.degree. C. for 5 minutes, then electrophoresed using 20%
polyacrylamide 7M urea gel electrophoresis (10 cm.times.10 cm).
Main band detected by UV (254 nm) was cut out, transferred to 1.5
ml tube, adding 450 .mu.l of sterilized water ant stirred at
37.degree. C. for 12 hours. Supernatant obtained by light
centrifugation was transferred to the different tube, added
glycogen 1 .mu.l, 3M sodium acetate 40 .mu.l and ethanol 1 ml were
added. The mixture was shaken well, thereafter allowed to stand at
-30.degree. C. for 1 hour. Then it was centrifuged at -5.degree.
C., under 13,000 rpm for 1 hours. The thus obtained precipitate was
rinsed with 70% ethanol and dried by using centrifugal evaporator
for 30 minutes. Sterilized water 40 .mu.l was added and kept at
75.degree. C. for 5 minutes, thereafter quantitated at UV 260
nm.
Example 6
Single Nucleotide Insertion Reaction and Primer Extension Reaction
Using Klenow Fragment
[0153] 5'-.sup.32P labeled primer, template and 10.times. Klenow
fragment buffer (TAKARA) 1 .mu.l were added to the 0.5 ml tube,
adjusted total volume to 7 .mu.l, and annealed at 95.degree. C. for
3 minutes, at 40.degree. C. for 3 minutes and at 4.degree. C. for 7
minutes. dNTP 1 .mu.l, Klenow fragment (1 unit/ml, For Sequencing,
TAKARA) 2 .mu.l were added, adjusted to total volume to 10 .mu.l
and incubated for the fixed time at 17.degree. C. The reaction was
terminated by adding 10 M urea BPB dye 5 .mu.l, heated at
75.degree. C. for 5 minutes, and electrophoresed with 20%
polyacrylamide gel with 7M urea gel electrophoresis. The result was
analyzed using imaging plates (Phosphoroimager analysis). Results
are shown in FIG. 6, FIG. 7 and FIG. 9. Single nucleotide insertion
reaction is shown in FIG. 7 and primer extension reaction is shown
in FIG. 6 and FIG. 9, respectively.
Example 7
Inhibition Experiment for Primer Extension Reaction Using Klenow
Fragment
[0154] Primer, template and 10.times. Klenow fragment buffer
(TAKARA) 1 .mu.l were added to 0.5 ml tube, and total volume was
adjusted to 7 .mu.l, and annealed at 95.degree. C. for 3 minutes,
at 40.degree. C. for 3 minutes and at 4.degree. C. for 7 minutes.
[.alpha.-.sup.32P] TTP or [.alpha.-.sup.32P] dCTP and dYTP were
added to final concentration for each level, and Klenow fragment (1
unit/ml, For Sequencing, TAKARA) 2 .mu.l was added, adjusted to
total volume to 10 .mu.l and incubated for the fixed time at
17.degree. C. The reaction was terminated by adding 10 M urea BPB
dye 5 .mu.l, kept at 75.degree. C. for 5 minutes, and
electrophoresed with 20% polyacrylamide gel with 7M urea gel
electrophoresis. The result was analyzed using imaging plates
(Phosphoroimager analysis). Result is shown in FIG. 8.
Example 8
Transcription by T7 RNA Polymerase
[0155] Template DNA 1 .mu.M, in which promoter region has
duplicated strands, and T7 RNA polymerase 2.5 units were added to a
solution containing 2 mM rNTP, [.alpha.-.sup.32P] ATP 0.1
.mu.Ci/.mu.l [40 mM Tris-HCl (pH 8.0), 8 mM MgCl.sub.2, 2 mM
spermidine, 5 mM DTT, 0.01% Triton X-100, 10 mM rGMP], and
incubated for 3 hours. After the reaction, 10 M urea dye was added
and kept at 75.degree. C. for 3 minutes, then electrophoresed with
20% polyacrylamide gel. The product was analyzed. Result is shown
in FIG. 10.
Example 9
Transcription Using T7 RNA Polymerase
[0156] Reaction was performed as same as in example 8. The
generated RNA was isolated by gel electrophoresis. RNA was digested
by 0.75 units RNase T2. Each nucleotide was separated using
2-dimension TLC and each ratio was calculated.
[0157] Result is shown in FIG. 11. Ratio of composition of each
nucleotide is shown in Table 1 hereinbefore.
Example 10
Single Nucleotide Insertion Reaction Using Klenow Fragment
(exo.sup.+)
[0158] A solution containing [5'-.sup.32P] labeled primer DNA
(20-mer, 4 mM), template DNA (35-mer, 4 mM) and 2.times. Klenow
fragment buffer (TAKARA) were annealed at 95.degree. C. for 3
minutes, 40.degree. C. for 3 minutes and 4.degree. C. for 7
minutes. A solution of equimolar amount of 40 mM dNTP and Klenow
fragment (exo.sup.+) (2 unit/ml, For Sequencing, TAKARA) were added
thereto and incubated at 37.degree. C. for 3 minutes. Equimolar
amount of 10 M urea BPB dye solution was added and kept at
75.degree. C. for 5 minutes and electrophoresed with 20%
polyacrylamide -7M urea gel. Products were analyzed by using
Phosphoroimager plate. Result is shown in FIG. 12.
Example 11
Transcription by T7 RNA Polymerase
[0159] A solution containing template DNA 1 mM, in which promoter
region has duplicated strands, T7 RNA polymerase 2.5 units, 2 mM
rNTP, and [.alpha.-.sup.32P] rATP 0.1 mCi/ml [40 mM Tris-HCl (pH
8.0), 8 mM MgCl.sub.2, 2 mM spermidine, 5 mM DTT, 0.01% Triton
X-100, 10 mM rGMP] were prepared and incubated for 3 hours. 10 M
urea dye was added and kept at 75.degree. C. for 3 minutes to
terminate the reaction. The product RNA (16-mer) in this solution
was purified by using electrophoresis with 20% polyacrylamide gel.
RNA was digested by 0.75 units RNase T2. Ratio of each nucleotide
was determined by 2-dimension TLC (cellulose resin). In FIG. 13,
result of development of TLC is shown. Ratio of each nucleotide is
shown in Table 2 hereinbefore.
Example 12
Synthesis of Primer and Template Containing Base X2
[0160] Primer and template were synthesized conventionally by using
DNA/RNA synthesizer Type 392, The Perkin-Elmer, Applied Biosystems
Div., and cyanoethylamidide reagents of dA, dC, dG and dT, which
were distributed by The Perkin-Elmer, and dx2 of cyanoethylamidite
reagent prepared according to the method in example 1.
[0161] Proviso that in a synthesis of oligomer containing dx2,
removal of protective group for amino group of dx2, i.e. benzoyl
group, could not completely be performed, under the conventional
condition using conc. ammonia at 55.degree. C. for overnight,
consequently, treatment for removal of the protective group was
performed under the condition at 80.degree. C. with conc. ammonia
for 10 hours.
INDUSTRIAL APPLICABILITY
[0162] The present invention indicates that selective base pair
formation, which could never achieved by the heretofore reported
artificial base pair, can be realized by utilizing steric hindrance
and electrostatic repulsion as well as stacking action. By
utilizing the method of the present invention, artificial nucleic
acid base pair of the present invention can be applied on
replication and transcription of nucleic acid, and protein
synthetic system or functional nucleic acid. For example, by using
artificial base pair of the present invention, in vitro selection
method used by the natural base of 4 types can be performed by 6
types of bases. Creation of nucleic acid molecules having new
function which can not be realized by 4 natural bases. Further,
novel base pair of the present invention may be utilized for
treatment of hereditary diseases caused by replacement of one or
more bases to the other bases.
Sequence CWU 1
1
15135DNAArtificial SequenceDescription of Artificial Sequence
Synthetic DNA template 1tgctctntct tcctccctat agtgagtcgt attat
35229DNAArtificial SequenceDescription of Artificial Sequence
Synthetic DNA template 2agctntgtgt gtctccggta caactaggc
29329DNAArtificial SequenceDescription of Artificial Sequence
Synthetic DNAtemplate 3agctnngtgt gtctccggta caactaggc
29429DNAArtificial SequenceDescription of Artificial Sequence
Synthetic DNA template 4agctntntgt gtctccggta caactaggc
29529DNAArtificial SequenceDescription of Artificial Sequence
Synthetic DNA template 5agctntgngt gtctccggta caactaggc
29629DNAArtificial SequenceDescription of Artificial Sequence
Synthetic DNA template 6agctntgtnt gtctccggta caactaggc
29735DNAArtificial SequenceDescription of Artificial Sequence
Synthetic DNA template 7tgctctatct tcctccctat agtgagtcgt attat
35835DNAArtificial SequenceDescription of Artificial Sequence
Synthetic DNA template 8tgctctgtct tcctccctat agtgagtcgt attat
35929DNAArtificial SequenceDescription of Artificial Sequence
Synthetic DNA template 9agctgtgtgt gtctccggta caactaggc
291021DNAArtificial SequenceDescription of Artificial Sequence
synthetic coding strand 10ataatacgac tcactatagg g
211117RNAArtificial SequenceDescription of Artificial Sequence
Synthetic RNA oligonucleotide 11gggaggaaga nagagca
171220DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 12actcactata gggaggaaga 201315DNAArtificial
SequenceDescription of Artificial Sequence Synthetic primer
13cgactcacta taggg 151414DNAArtificial SequenceDescription of
Artificial Sequence Synthetic primer 14ctatagggag gaga
141514DNAArtificial SequenceDescription of Artificial Sequence
Synthetic primer 15gcctagttgt accg 14
* * * * *