U.S. patent application number 12/498274 was filed with the patent office on 2009-11-19 for methods and compositions for immunizing against pseudomonas infection.
This patent application is currently assigned to Trinity Biosystems, Inc.. Invention is credited to Randall J. Mrsny.
Application Number | 20090285848 12/498274 |
Document ID | / |
Family ID | 36148868 |
Filed Date | 2009-11-19 |
United States Patent
Application |
20090285848 |
Kind Code |
A1 |
Mrsny; Randall J. |
November 19, 2009 |
METHODS AND COMPOSITIONS FOR IMMUNIZING AGAINST PSEUDOMONAS
INFECTION
Abstract
Methods and compositions for inducing an immune response against
Pseudomonas aeruginosa are provided herein. In one aspect, the
invention provides a chimeric immunogen, comprising a receptor
binding domain, a translocation domain, and a Pseudomonas pilin
peptide comprising an amino acid sequence that is
TAADGLWKCTSDQDEQFIPKGCSK (SEQ ID NO.:1), wherein the chimeric
immunogen, when administered to a subject, induces an immune
response in said subject that is effective to reduce adherence of a
microorganism that expresses said Pseudomonas pilin peptide to
epithelial cells of said subject. In other aspects, the invention
provides nucleic acids encoding chimeric immunogens of the
invention, kits comprising chimeric immunogens of the invention,
cells expressing chimeric immunogens of the invention, and methods
of using chimeric immunogens of the invention.
Inventors: |
Mrsny; Randall J.; (Los
Altos, CA) |
Correspondence
Address: |
JONES DAY
222 EAST 41ST ST
NEW YORK
NY
10017
US
|
Assignee: |
Trinity Biosystems, Inc.
Menlo Park
CA
|
Family ID: |
36148868 |
Appl. No.: |
12/498274 |
Filed: |
July 6, 2009 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11244348 |
Oct 4, 2005 |
|
|
|
12498274 |
|
|
|
|
60616125 |
Oct 4, 2004 |
|
|
|
Current U.S.
Class: |
424/190.1 ;
435/252.33; 435/320.1; 530/300; 536/23.7 |
Current CPC
Class: |
C07K 2319/40 20130101;
C07K 2319/55 20130101; A61K 39/104 20130101; C07K 14/21
20130101 |
Class at
Publication: |
424/190.1 ;
530/300; 536/23.7; 435/320.1; 435/252.33 |
International
Class: |
A61K 39/104 20060101
A61K039/104; C07K 14/195 20060101 C07K014/195; C07H 21/04 20060101
C07H021/04; C12N 15/63 20060101 C12N015/63; C12N 1/21 20060101
C12N001/21 |
Claims
1. A chimeric immunogen, comprising a)--a receptor binding domain,
b)--a translocation domain, and c)--a Pseudomonas pilin peptide
comprising an amino acid sequence that is TAADGLWKCTSDQDEQFIPKGCSK
(SEQ ID NO.:1), wherein said chimeric immunogen, when administered
to a subject, induces an immune response in said subject that is
effective to reduce adherence of a microorganism that expresses
said Pseudomonas pilin peptide to epithelial cells of said
subject.
2. The chimeric immunogen of claim 1, wherein said chimeric
immunogen, when administered to said subject, generates an immune
response in said subject that reduces the cytotoxicity of
Pseudomonas exotoxin A to the subject.
3. The chimeric immunogen of claim 1, wherein said chimeric
immunogen further comprises an endoplasmic reticulum retention
domain.
4. The chimeric immunogen of claim 3, wherein said Pseudomonas
pilin peptide is located between said translocation domain and said
endoplasmic reticulum retention domain.
5. The chimeric immunogen of claim 3, wherein said endoplasmic
reticulum retention domain is an enzymatically inactive domain III
of Pseudomonas exotoxin A.
6. The chimeric immunogen of claim 5, wherein said enzymatically
inactive domain III of Pseudomonas exotoxin A is inactivated by
deleting a glutamate at position 553.
7. The chimeric immunogen of claim 3 wherein said endoplasmic
reticulum retention domain comprises an amino acid sequence that is
selected from the group of RDEL (SEQ ID NO.:2) or KDEL (SEQ ID
NO.:3).
8. The chimeric immunogen of claim 1, wherein said translocation
domain is selected from the group consisting translocation domains
from Pseudomonas exotoxin A, diptheria toxin, pertussis toxin,
cholera toxin, heat-labile E. coli enterotoxin, shiga toxin, and
shiga-like toxin.
9. The chimeric immunogen of claim 5, wherein said translocation
domain is domain II of Pseudomonas exotoxin A.
10. The chimeric immunogen of claim 1, wherein said translocation
domain comprises amino acids 280 to 364 of domain II of Pseudomonas
exotoxin A.
11. The chimeric immunogen of claim 1, wherein said chimeric
immunogen comprises more than one of said Pseudomonas pilin
peptides.
12. The chimeric immunogen of claim 1, wherein said receptor
binding domain is selected from the group consisting of domain Ia
of Pseudomonas exotoxin A; a receptor binding domains from cholera
toxin, diptheria toxin, shiga toxin, or shiga-like toxin; a
monoclonal antibody, a polyclonal antibody, or a single-chain
antibody; TGF.alpha., TGF.beta., EGF, PDGF, IGF, or FGF; IL-1,
IL-2, IL-3, or IL-6; and MIP-1a, MIP-1b, MCAF, or IL-8.
13. The chimeric immunogen of claim 12, wherein said receptor
binding domain is domain Ia of Pseudomonas exotoxin A.
14. The chimeric immunogen of claim 13, wherein said domain Ia of
Pseudomonas exotoxin A has an amino acid sequence that is SEQ ID
NO.:4.
15. The chimeric immunogen of claim 1, wherein said receptor
binding domain binds to .alpha.2-macroglobulin receptor, epidermal
growth factor receptor, transferrin receptor, interleukin-2
receptor, interleukin-6 receptor, interleukin-8 receptor, Fc
receptor, poly-IgG receptor, asialoglycopolypeptide receptor, CD3,
CD4, CD8, chemokine receptor, CD25, CD11B, CD11C, CD80, CD86,
TNF.alpha. receptor, TOLL receptor, M-CSF receptor, GM-CSF
receptor, scavenger receptor, or VEGF receptor.
16. The chimeric immunogen of claim 15, wherein said receptor
binding domain binds to .alpha.2-macroglobulin receptor.
17. The chimeric immunogen of claim 1, wherein said chimeric
immunogen has an amino acid sequence that is SEQ ID NO.:5.
18. A polynucleotide that encodes a chimeric immunogen, said
chimeric immunogen comprising: a)--a receptor binding domain, b)--a
translocation domain, and c)--a Pseudomonas pilin peptide that
comprises an amino acid sequence that is TAADGLWKCTSDQDEQFIPKGCSK
(SEQ ID NO.:1), wherein said chimeric immunogen, when administered
to a subject, induces an immune response in said subject that is
effective to reduce adherence of a microorganism that expresses
said Pseudomonas pilin peptide to epithelial cells of said
subject.
19.-34. (canceled)
35. An expression vector comprising the polynucleotide of claim
18.
36. A cell comprising the expression vector of claim 35.
37. A composition comprising a chimeric immunogen, wherein said
chimeric immunogen comprises: a)--a receptor binding domain, b)--a
translocation domain, and c)--a Pseudomonas pilin peptide that has
an amino acid sequence that is TAADGLWKCTSDQDEQFIPKGCSK (SEQ ID
NO.:1) wherein said chimeric immunogen, when administered to a
subject, induces an immune response in said subject that is
effective to reduce adherence of a microorganism that expresses
said Pseudomonas pilin peptide to epithelial cells of said
subject.
38. The composition of claim 37, wherein said composition further
comprises a pharmaceutically acceptable diluent, excipient,
vehicle, or carrier.
39-41. (canceled)
42. A kit comprising the composition of claim 37, wherein said
composition is in a single-unit dosage form.
43. (canceled)
44. A method for inducing an immune response in a subject,
comprising administering to said subject an effective amount of a
chimeric immunogen comprising a receptor binding domain, a
translocation domain, and a Pseudomonas pilin peptide that
comprises an amino acid sequence that is TAADGLWKCTSDQDEQFIPKGCSK
(SEQ ID NO.:1), wherein said chimeric immunogen induces an immune
response in said subject that is effective to reduce adherence of a
microorganism expressing the Pseudomonas pilin peptide to
epithelial cells of said subject when said chimeric immunogen is
administered to said subject.
45-49. (canceled)
50. A method for generating in a subject antibodies specific for a
Pseudomonas pilin peptide having an amino acid sequence that is
TAADGLWKCTSDQDEQFIPKGCSK (SEQ ID NO.:1), comprising administering
to said subject an effective amount of a chimeric immunogen
comprising a receptor binding domain, a translocation domain, and a
Pseudomonas pilin peptide that comprises an amino acid sequence
that is TAADGLWKCTSDQDEQFIPKGCSK (SEQ ID NO.:1), thereby generating
antibodies specific for said Pseudomonas pilin peptide.
51-54. (canceled)
Description
[0001] This application is entitled to and claims benefit of U.S.
Provisional Application No. 60/616,125, file Oct. 4, 2004, which is
hereby incorporated by reference in its entirety.
1. FIELD OF THE INVENTION
[0002] The present invention relates, in part, to methods and
compositions for immunizing against infection by Pseudomonas ssp.
The methods and compositions rely, in part, on administering a
chimeric immunogen comprising certain Pseudomonas pilin peptides to
a subject to be immunized.
2. BACKGROUND
[0003] Immunization against bacterial or viral infection has
greatly contributed to relief from infectious disease. Generally,
immunization relies on administering an inactivated or attenuated
pathogen to the subject to be immunized. For example, hepatitis B
vaccines can be made by inactivating viral particles with
formaldehyde, while some polio vaccines consist of attenuated polio
strains that cannot mount a full-scale infection. In either case,
the subject's immune system is stimulated to mount a protective
immune response by interacting with the inactivated or attenuated
pathogen. See, e.g., Kuby, 1997, Immunology W.H. Freeman and
Company, New York.
[0004] This approach has proved successful for immunizing against a
number of pathogens. Indeed, many afflictions that plagued mankind
for recorded history have been essentially eliminated by
immunization with attenuated or inactivated pathogens. See id.
Nonetheless, this approach is not effective to immunize against
infection by many pathogens that continue to pose significant
public health problems. In particular, no vaccine presently exists
that has been approved for immunization against Pseudomonas ssp.
infection. The absence of such a vaccine presents significant
public health problems.
[0005] For example, Pseudomonas aeruginosa infections account for
between 10% and 20% of all infections acquired in most hospitals.
Pseudomonas commonly infects patients with a variety of other
afflictions, such as cystic fibrosis, burns, organ transplants, and
intravenous-drug addiction. Such infections can lead to serious
conditions, including endophthalmitis, endocarditis, meningitis,
pneumonia, and septicemia. In subjects with cystic fibrosis,
Pseudomonas aeruginosa colonization of the lungs represents a
significant negative milestone in the progression of this disease.
See, for example, Ratgen, 2001, Int J Antimicrob Agents 17:93-96.
Once colonized, such subjects suffer both the damaging effects of
virulence factors secreted by the bacteria and the inflammatory
response of the host immune system.
[0006] Initially, Pseudomonas colonization of the lungs requires
adhesion of the bacteria to the lung epithelium. Such adhesion is
mediated, in part, by an interaction between the Pseudomonas pilus
and extracellular glycoproteins present on lung epithelial cells.
The Pseudomonas pilus is composed of many subunits of Type IV pilin
protein that polymerize to form the pilus. See, e.g., Forest et
al., 1997, Gene 192(1): 165-9 and Parge, 1995, Nature
378(6552):32-8.
[0007] More specifically, Pseudomonas aeruginosa Type IV pilin
proteins bind to asialoGM1 receptors on epithelial cells. See,
e.g., Saiman et al., 1993, J. Clin. Invest. 92 (4): 1875-80; Sheth
et al., 1994, Mol. Microbiol. 11(4):715-23; Imundo et al., 1995,
Proc. Natl. Acad. Sci. USA 92(7):3019-23; and Hahn, 1997, Gene
192(1):99-108. The portion of pilin responsible for this
interaction has been mapped to a C-terminal loop present in the tip
of the bacterial pilus. See Lee et al., 1994, Mol. Microbiol.
11(4):705-13. This C-terminal loop is formed by amino acids 122-148
of the pilin protein in a .beta.-turn loop subtended from a
disulfide bond. See, e.g., Campbell et al., 1997, Biochemistry
36(42):12791-80; Campbell et al., 1997, J. Mol. Biol.
267(2):382-402; Hazes et al., 2000, J. Mol. Biol. 299(4):1005-1017;
and McInnes et al., 1993, Biochemistry 32(49):13432-40. Disruption
of the interaction between this region of Type IV pilin and
asialoGM1 receptors prevents adherence of the bacteria to the
epithelial cell and prevents effective bacterial colonization. See
Hertle et al., 2001, Infect. Immun. 69:6962-6969.
[0008] Previous efforts to vaccinate against Pseudomonas infection
by immunizing with Pseudomonas pilin protein or derivatives thereof
have yielded lackluster results. Immunization with whole pilin
protein, with or without adjuvant, is not effective to prevent
Pseudomonas infection because the most immunogenic portion of the
pilin protein is not the loop that mediates adherence to epithelial
cells. See, e.g., Sastry et al., 1985, Ca. J. Biochem. Cell Biol.
63:284-291. Thus, antibodies raised against the entire pilin
protein are principally specific for another region of the pilin
protein and thus do not disrupt the interaction that mediates
bacterial adherence.
[0009] Vaccine compositions that comprise only the C-terminal loop
(residues 128-144) of the pilin protein have also been tested for
the ability to protect against Pseudomonas infection. See, e.g.,
U.S. Pat. Nos. 5,612,036 and 5,445,818. These vaccines induce a
humoral immune response specific for the C-terminal loop, and
antibodies produced in the response can prevent Pseudomonas
adherence to epithelial cells in vitro. Experiments by these
researchers showed that pilin vaccine compositions that comprise
the same adjuvant and peptides that correspond to amino acids
121-148 of Type IV pilin were not effective to induce a protective
immune response.
[0010] Further, chimeric proteins constructed from Pseudomonas
exotoxin A ("PE") derivatives and peptides corresponding to amino
acids 128-144 of Type IV pilin protein have also been tested for
their ability to induce a protective immune response. See Hertle et
al., 2001, Infect. Immun. 69:6962-6969. Nonetheless, none of these
attempts has to date resulted in a vaccine that has been approved
as effective to immunize against Pseudomonas infection. Thus, there
remains an unmet need for methods and compositions for immunizing
against Pseudomonas infection.
3. SUMMARY OF THE INVENTION
[0011] The chimeric immunogens of the invention comprise a
heterologous antigen and can elicit humoral, cell-mediated and
secretory immune responses against the heterologous antigen. Such
chimeras are useful, for example, in vaccines against infection by
organisms for which conventional vaccines are not practical.
[0012] Accordingly, in certain aspects, the invention provides a
chimeric immunogen that comprises a receptor binding domain, a
translocation domain, and a Pseudomonas pilin peptide comprising an
amino acid sequence that is TAADGLWKCTSDQDEQFIPKGCSK (SEQ ID
NO.:1). In certain embodiments, the chimeric immunogen, when
administered to a subject, induces an immune response in the
subject that is effective to reduce adherence of a microorganism
that expresses the Pseudomonas pilin peptide to epithelial cells of
the subject.
[0013] In another aspect, the invention provides a method for
inducing an immune response in a subject that comprises
administering to the subject an effective amount of a chimeric
immunogen comprising a receptor binding domain, a translocation
domain, and a Pseudomonas pilin peptide that comprises an amino
acid sequence that is TAADGLWKCTSDQDEQFIPKGCSK (SEQ ID NO.:1).
Administration of the chimeric immunogen induces an immune response
in the subject that is effective to reduce adherence of a
microorganism expressing the Pseudomonas pilin peptide to
epithelial cells of the subject when the chimeric immunogen is
administered to the subject.
[0014] In yet another aspect, the invention provides a method for
generating in a subject antibodies specific for a Pseudomonas pilin
peptide having an amino acid sequence that is
TAADGLWKCTSDQDEQFIPKGCSK (SEQ ID NO.:1). The method comprises
administering to said subject an effective amount of a chimeric
immunogen comprising a receptor binding domain, a translocation
domain, and a Pseudomonas pilin peptide that comprises an amino
acid sequence that is TAADGLWKCTSDQDEQFIPKGCSK (SEQ ID NO.:1).
[0015] In still another aspect, the invention provides a
polynucleotide that encodes a chimeric immunogen that comprises a
receptor binding domain, a translocation domain, and a Pseudomonas
pilin peptide that comprises an amino acid sequence that is
TAADGLWKCTSDQDEQFIPKGCSK (SEQ ID NO.:1).
[0016] In yet another aspect, the invention provides expression
vectors that comprise a polynucleotide of the invention.
[0017] In still another aspect, the invention provides cells
comprising an expression vector of the invention.
[0018] In yet another aspect, the invention provides a composition
comprising a chimeric immunogen that comprises a receptor binding
domain, a translocation domain, and a Pseudomonas pilin peptide
that has an amino acid sequence that is TAADGLWKCTSDQDEQFIPKGCSK
(SEQ ID NO.:1) In certain embodiments, the composition further
comprises a pharmaceutically acceptable diluent, excipient,
vehicle, or carrier.
4. BRIEF DESCRIPTION OF THE DRAWINGS
[0019] FIG. 1 presents a diagram of a chimeric immunogen. The gene
encoding Ps. aeruginosa exotoxin A (PE) where a glutamic acid in
the 553 position has been deleted (.DELTA.E553) to produce a
nontoxic form of the enzyme (ntPE) was cut to remove twenty amino
acid that included the Ib loop domain. This segment was replaced by
ligation with an oligonucleotide duplex encoding 24 amino acids of
the C-terminal domain sequence of the PAK strain of Ps. aeruginosa.
Cysteine residues available for cross-linking are underlined. Three
amino acids not derived from either ntPE or Ps. aeruginosa that
were introduced by the cloning strategy are italicized.
[0020] FIG. 2 presents the results of SDS-PAGE (FIG. 2A) and
Western blot (FIG. 2B) analysis of ntPE, ntPEpilinPAK and pilin
protein purified from the PAK strain of Ps. aeruginosa. The
monoclonal antibody used in the Western blot presented in FIG. 2B,
1D10, was produced at A&G Pharmaceutical, Inc. (Columbia, Md.)
in BALB/c mice following immunization with a chimeric immunogen
comprising amino acids 128-144 of Ps. aeruginosa PAK pilin protein
short insert and was shown by ELISA to react with this chimeric
immunogen and ntPEpilinPAK but not ntPE.
[0021] FIG. 3 demonstrates the ability of a toxic form of the
chimeric immunogen (PEpilinPAK) and of native PE to induce
apoptosis in L929 (ATCC CLL-1) cells in vitro. The assay also
demonstrates the absence of toxicity for the chimeric immunogen
ntPEpilinPAK. This assay was performed as described in Ogata et
al., 1990, J. Biol. Chem. 265:20678-85.
[0022] FIG. 4 presents pictures showing the cellular distribution
of CD91 and uptake of biotin-labeled ntPEpilinPAK in mouse nasal
mucosa. FIG. 4A shows isolated naive nasal tissue demonstrated
extensive labeling in epithelial cells and specific cells in
submucosal region consistent with phagocytic cell distribution.
FIG. 4B illustrates negative control tissue, which was handled
identically except that an irrelevant primary isotype antibody was
used and the same detection format using colorimetric substrate
conversion by horseradish peroxidase coupled to streptavidin
(HRP-strep). FIG. 4C shows distribution of biotin detected by
HRP-strep 30 min following intranasal application of biotin-labeled
ntPEpilinPAK.
[0023] FIG. 5 presents anti-immunogen antibody responses in serum
and saliva. Standard format ELISA protocols were used to measure
anti-ntPEpilinPAK serum IgG, salivary IgG, salivary IgA and serum
IgA antibody levels for mice dosed intranasally (IN) with 1, 10 or
100 .mu.g ntPEpilinPAK (n=8 per group). Negative controls received
an equal volume of carrier buffer (PBS) by IN instillation and
positive controls received 10 .mu.g ntPEpilinPAK injected
subcutaneously in a regime of complete and incomplete Freund's
adjuvant. Statistical assessment was performed using one-way ANOVA
and data is expressed as mean.+-.SEM; (P<0.001, ***) compared to
PBS IN values.
[0024] FIG. 6 demonstrates induction of anti-pilin antibody
responses following administration of a chimeric immunogen. Serum
IgG antibodies specific for the PAK pilin loop sequence was
determined using a standard ELISA format for mice dosed
intranasally with 1, 10 or 100 .mu.g ntPEpilinPAK. Negative control
animals received an equal volume of carrier buffer (PBS) by
intranasal instillation and positive controls received 10 .mu.g
ntPEpilinPAK injected subcutaneously in a regime of complete and
incomplete Freund's adjuvant (n=8 per group). Statistical
assessment was performed using one-way ANOVA and data is expressed
as mean.+-.SEM; (P<0.001, ***) compared to PBS IN values.
[0025] FIG. 7 demonstrates that saliva from mice immunized with a
pilin peptide-containing chimeric immunogen blocks pilin-mediated
bacteria binding. A549 cell lawns, grown to near confluent
densities on Lab-Tek II 8-chamber slides were exposed to 50 Ps.
aeruginosa PAK strain bacteria for 2 hr prior to washing, mild
fixation and Geimsa staining. Fifty cells in each well were
visually inspected using a light microscope to determine the
average number of bacteria associated with each A549 cell. FIG. 7A
shows that adherence of bacteria was selectively inhibited by
increasing concentrations of ntPEpilinPAK but not by ntPE lacking
the pilin loop insert (n=4). FIG. 7B indicates that saliva obtained
from mice immunized with ntPEpilinPAK by intranasal (IN)
instillation or by subcutaneous injection with a cocktail of
compete/incomplete Freund's adjuvant (SubQ+Freund's) and diluted
1:100 reduced bacteria adherence relative to mice dosed IN with PBS
(n=4). FIG. 7C shows amount of unbound Ps. aeruginosa found in
A549-bacteria media following 2 hr incubation with PAK strain of
Ps. aeruginosa with saliva samples (diluted 1:100 in cell culture
media) obtained from mice immunized IN with 1, 10 or 100 .mu.g
ntPEpilinPAK. Unbound bacteria were quantitated by real-time
polymerase chain reaction performed in duplicate. Statistical
assessment was performed using one-way ANOVA and data is expressed
as mean.+-.SEM; (P<0.001, ***) compared to PBS IN values.
[0026] FIG. 8 demonstrates that saliva from mice immunized with a
pilin peptide containing-chimeric immunogen blocks pilin-mediated
cytotoxicity. FIG. 8 presents a time course of resistance
(normalized to values at the time of bacterial addition) following
the introduction of .about.50 Ps. aeruginosa PAK strain bacteria
per A549 cell grown in electrode chambers to perform electric
cell-substrate impedance sensing. Saliva obtained from mice
following subcutaneous injection of 10 .mu.g ntPEpilinPAK with a
complete/incomplete Freund's adjuvant cocktail (SubQ+Freund's) or
intranasal (IN) immunization with 100 .mu.g ntPEpilinPAK or IN
instillation of an equal volume of PBS was added in a dilution of
1:100 with antibiotic-free medium. Decline in resistance, derived
from original impedance measurements, demonstrates rounding and
lifting of A549 from substrate.
[0027] FIG. 9 demonstrates that saliva from mice immunized with a
pilin peptide-containing chimeric immunogen attenuates exotoxin
A-induced caspase-3 activation. Saliva obtained from mice following
intranasal (IN) immunization with 100 .mu.g ntPEpilinPAK was added
to confluent A549 cells at a dilution of 1:100, 1:500, 1:1,000, and
1:5,000 in the presence of 10 .mu.g/ml exotoxin A for 24 hrs at
37.degree. C. in a 5% CO.sub.2/95% air atmosphere. Caspase-3
activity was assayed by measuring p-nitroaniline (pNA). Data is
presented as % control.
[0028] FIG. 10 presents the results of ELISA assays comparing
amounts of salivary IgA induced following administration of a
chimeric immunogen comprising a pilin peptide corresponding to
residues 128-144 of the Ps. aeruginosa strain PAK pilin protein
(the "short" chimeric immunogen) and a chimeric immunogen
comprising a pilin peptide corresponding to residues 121-144 of Ps.
aeruginosa pilin peptide (the "long" chimeric immunogen).
[0029] FIG. 11 presents the results of ELISA assays comparing
amounts of serum IgG induced following administration of a chimeric
immunogen comprising a pilin peptide corresponding to residues
128-144 of the Ps. aeruginosa strain PAK pilin protein (the "short"
chimeric immunogen) and a chimeric immunogen comprising a pilin
peptide corresponding to residues 121-144 of Ps. aeruginosa pilin
peptide (the "long" chimeric immunogen).
[0030] FIG. 12 demonstrates that saliva obtained from mice
immunized with an immunogen that contains a pilin peptide from
Pseudomonas aeruginosa strain K can also prevent adherence of other
strains of Pseudomonas to A549 cells in an assay performed
according to the protocol presented in the description of FIG.
7.
[0031] FIG. 13 presents an exemplary amino acid sequence of
Pseudomonas aeruginosa exotoxin A.
5. DETAILED DESCRIPTION OF THE INVENTION
5.1. Definitions
[0032] Unless defined otherwise, all technical and scientific terms
used herein have the meaning commonly understood by a person
skilled in the art to which this invention belongs. As used herein,
the following terms have the meanings ascribed to them unless
specified otherwise.
[0033] A "ligand" is a compound that specifically binds to a target
molecule. Exemplary ligands include, but are not limited to, an
antibody, a cytokine, a substrate, a signaling molecule, and the
like.
[0034] A "receptor" is compound that specifically binds to a
ligand.
[0035] A ligand or a receptor (e.g., an antibody) "specifically
binds to" or "is specifically immunoreactive with" another molecule
when the ligand or receptor functions in a binding reaction that
indicates the presence of the molecule in a sample of heterogeneous
compounds. Thus, under designated assay (e.g., immunoassay)
conditions, the ligand or receptor binds preferentially to a
particular compound and does not bind in a significant amount to
other compounds present in the sample. For example, a
polynucleotide specifically binds under hybridization conditions to
another polynucleotide comprising a complementary sequence and an
antibody specifically binds under immunoassay conditions to an
antigen bearing an epitope used to induce the antibody.
[0036] "Immunoassay" refers to a method of detecting an analyte in
a sample involving contacting the sample with an antibody that
specifically binds to the analyte and detecting binding between the
antibody and the analyte. A variety of immunoassay formats may be
used to select antibodies specifically immunoreactive with a
particular protein. For example, solid-phase ELISA immunoassays are
routinely used to select monoclonal antibodies specifically
immunoreactive with a protein. See Harlow and Lane (1988)
Antibodies, A Laboratory Manual, Cold Spring Harbor Publications,
New York, for a description of immunoassay formats and conditions
that can be used to determine specific immunoreactivity. In one
example, an antibody that binds a particular antigen with an
affinity (K.sub.m) of about 10 .mu.M specifically binds the
antigen.
[0037] "Vaccine" refers to an agent or composition containing an
agent effective to confer an at least partially prophylactic or
therapeutic degree of immunity on an organism while causing only
very low levels of morbidity or mortality. Methods of making
vaccines are, of course, useful in the study of the immune system
and in preventing and treating animal or human disease.
[0038] An "immune response" refers to one or more biological
activities mediated by cells of the immune system in a subject.
Such biological activities include, but are not limited to,
production of antibodies; activation and proliferation of immune
cells, such as, e.g., B cells, T cells, macrophages, leukocytes,
lymphocytes, etc.; release of messenger molecules, such as
cytokines, chemokines, interleukins, tumor necrosis factors, growth
factors, etc.; and the like. An immune response is typically
mounted when a cell of the immune system encounters non-self
antigen that is recognized by a receptor present on the surface of
the immune cell. The immune response preferably protects the
subject to some degree against infection by a pathogen that bears
the antigen against which the immune response is mounted.
[0039] An immune response may be "elicited," "induced," or "induced
against" a particular antigen. Each of these terms is intended to
be synonymous as used herein and refers to the ability of the
chimeric immunogen to generate an immune response upon
administration to a subject.
[0040] An "immunogen" is a molecule or combination of molecules
that can induce an immune response in a subject when the immunogen
is administered to the subject.
[0041] "Immunizing" refers to administering an immunogen to a
subject.
[0042] An "immunogenic amount" of a compound is an amount of the
compound effective to elicit an immune response in a subject.
[0043] "Linker" refers to a molecule that joins two other
molecules, either covalently, or through ionic, van der Waals or
hydrogen bonds, e.g., a nucleic acid molecule that hybridizes to
one complementary sequence at the 5' end and to another
complementary sequence at the 3' end, thus joining two
non-complementary sequences.
[0044] "Pharmaceutical composition" refers to a composition
suitable for pharmaceutical use in a mammal. A pharmaceutical
composition comprises a pharmacologically effective amount of an
active agent and a pharmaceutically acceptable carrier.
"Pharmacologically effective amount" refers to that amount of an
agent effective to produce the intended pharmacological result.
"Pharmaceutically acceptable carrier" refers to any of the standard
pharmaceutical carriers, vehicles, buffers, and excipients, such as
a phosphate buffered saline solution, 5% aqueous solution of
dextrose, and emulsions, such as an oil/water or water/oil
emulsion, and various types of wetting agents and/or adjuvants.
Suitable pharmaceutical carriers and formulations are described in
Remington's Pharmaceutical Sciences, 19th Ed. 1995. Mack Publishing
Co., Easton. A "pharmaceutically acceptable salt" is a salt that
can be formulated into a compound for pharmaceutical use including,
e.g., metal salts (sodium, potassium, magnesium, calcium, etc.) and
salts of ammonia or organic amines.
[0045] Preferred pharmaceutical carriers depend upon the intended
mode of administration of the active agent. Typical modes of
administration include enteral (e.g., oral, intranasal, rectal, or
vaginal) or parenteral (e.g., subcutaneous, intramuscular,
intravenous or intraperitoneal injection; or topical, transdermal,
or transmucosal administration).
[0046] "Small organic molecule" refers to organic molecules of a
size comparable to those organic molecules generally used in
pharmaceuticals. The term excludes organic biopolymers (e.g.,
proteins, nucleic acids, etc.). Preferred small organic molecules
range in size up to about 5000 Da, up to about 2000 Da, or up to
about 1000 Da.
[0047] A "subject" of diagnosis, treatment, or administration is a
human or non-human animal, including a mammal, such as a rodent
(e.g., a mouse or rat), a lagomorph (e.g., a rabbit), or a primate.
A subject of diagnosis, treatment, or administration is preferably
a primate, and more preferably a human.
[0048] "Treatment" refers to prophylactic treatment or therapeutic
treatment. A "prophylactic" treatment is a treatment administered
to a subject who does not exhibit signs of a disease or exhibits
only early signs for the purpose of decreasing the risk of
developing pathology. A "therapeutic" treatment is a treatment
administered to a subject who exhibits signs of pathology for the
purpose of diminishing, slowing the progression, eliminating, or
halting those signs.
[0049] "Pseudomonas exotoxin A" or "PE" is secreted by Pseudomonas
aeruginosa as a 67 kD protein composed of three prominent globular
domains (Ia, II, and III) and one small subdomain (Ib) that
connects domains II and III. See A. S. Allured et al., 1986, Proc.
Natl. Acad. Sci. 83: 1320-1324, and FIG. 1, which presents the
amino acid sequence of native PE. Without intending to be bound to
any particular theory or mechanism of action, domain Ia of PE is
believed to mediate cell binding because domain Ia specifically
binds to the low density lipoprotein receptor-related protein
("LRP"), also known as the .alpha.2-macroglobulin receptor
(".alpha.2-MR") and CD-91. See M. Z. Kounnas et al., 1992, J. Biol.
Chem. 267:12420-23. Domain Ia spans amino acids 1-252. Domain II of
PE is believed to mediate translocation to the interior of a cell
following binding of domain Ia to the .beta.2-MR. Domain II spans
amino acids 253-364. Domain Ib has no known function and spans
amino acids 365-399. Domain III mediates cytotoxicity of PE and
includes an endoplasmic reticulum retention sequence. PE
cytotoxicity is believed to result from ADP ribosylation of
elongation factor 2, which inactivates protein synthesis. Domain
III spans amino acids 400-613 of PE. Deleting amino acid E553
(".DELTA.E553") from domain III eliminates EF2 ADP ribosylation
activity and detoxifies PE. PE having the mutation .DELTA.E553 is
referred to herein as "PE.DELTA.E553." Genetically modified forms
of PE are described in, e.g., U.S. Pat. Nos. 5,602,095; 5,512,658
and 5,458,878. Pseudomonas exotoxin, as used herein, also includes
genetically modified, allelic, and chemically inactivated forms of
PE within this definition. See, e.g., Vasil et al., 1986, Infect.
Immunol. 52:538-48. Further, reference to the various domains of PE
is made herein to the reference PE sequence presented as FIG. 13.
However, one or more domain from modified PE, e.g., genetically or
chemically modified PE, or a portion of such domains, can also be
used in the chimeric immunogens of the invention so long as the
domains retain functional activity. One of skill in the art can
readily identify such domains of such modified PE based on, for
example, homology to the PE sequence exemplified in FIG. 2 and test
for functional activity using, for example, the assays described
below.
[0050] "Polynucleotide" refers to a polymer composed of nucleotide
units. Polynucleotides include naturally occurring nucleic acids,
such as deoxyribonucleic acid ("DNA") and ribonucleic acid ("RNA")
as well as nucleic acid analogs. Nucleic acid analogs include those
which include non-naturally occurring bases, nucleotides that
engage in linkages with other nucleotides other than the naturally
occurring phosphodiester bond or which include bases attached
through linkages other than phosphodiester bonds. Thus, nucleotide
analogs include, for example and without limitation,
phosphorothioates, phosphorodithioates, phosphorotriesters,
phosphoramidates, boranophosphates, methylphosphonates,
chiral-methyl phosphonates, 2-O-methyl ribonucleotides,
peptide-nucleic acids (PNAs), and the like. Such polynucleotides
can be synthesized, for example, using an automated DNA
synthesizer. The term "nucleic acid" typically refers to large
polynucleotides. The term "oligonucleotide" typically refers to
short polynucleotides, generally no greater than about 50
nucleotides. It will be understood that when a nucleotide sequence
is represented by a DNA sequence (i.e., A, T, G, C), this also
includes an RNA sequence (i.e., A, U, G, C) in which "U" replaces
"T."
[0051] Conventional notation is used herein to describe
polynucleotide sequences: the left-hand end of a single-stranded
polynucleotide sequence is the 5'-end; the left-hand direction of a
double-stranded polynucleotide sequence is referred to as the
5'-direction.
[0052] The direction of 5' to 3' addition of nucleotides to nascent
RNA transcripts is referred to as the transcription direction. The
DNA strand having the same sequence as an mRNA is referred to as
the "coding strand"; sequences on the DNA strand having the same
sequence as an mRNA transcribed from that DNA and which are located
5' to the 5'-end of the RNA transcript are referred to as "upstream
sequences"; sequences on the DNA strand having the same sequence as
the RNA and which are 3' to the 3' end of the coding RNA transcript
are referred to as "downstream sequences."
[0053] "Complementary" refers to the topological compatibility or
matching together of interacting surfaces of two polynucleotides.
Thus, the two molecules can be described as complementary, and
furthermore, the contact surface characteristics are complementary
to each other. A first polynucleotide is complementary to a second
polynucleotide if the nucleotide sequence of the first
polynucleotide is substantially identical to the nucleotide
sequence of the polynucleotide binding partner of the second
polynucleotide, or if the first polynucleotide can hybridize to the
second polynucleotide under stringent hybridization conditions.
Thus, the polynucleotide whose sequence 5'-TATAC-3' is
complementary to a polynucleotide whose sequence is
5'-GTATA-3'.
[0054] The term "% sequence identity" is used interchangeably
herein with the term "% identity" and refers to the level of amino
acid sequence identity between two or more peptide sequences or the
level of nucleotide sequence identity between two or more
nucleotide sequences, when aligned using a sequence alignment
program. For example, as used herein, 80% identity means the same
thing as 80% sequence identity determined by a defined algorithm,
and means that a given sequence is at least 80% identical to
another length of another sequence. Exemplary levels of sequence
identity include, but are not limited to, 60, 70, 80, 85, 90, 95,
98% or more sequence identity to a given sequence.
[0055] The term "% sequence homology" is used interchangeably
herein with the term "% homology" and refers to the level of amino
acid sequence homology between two or more peptide sequences or the
level of nucleotide sequence homology between two or more
nucleotide sequences, when aligned using a sequence alignment
program. For example, as used herein, 80% homology means the same
thing as 80% sequence homology determined by a defined algorithm,
and accordingly a homologue of a given sequence has greater than
80% sequence homology over a length of the given sequence.
Exemplary levels of sequence homology include, but are not limited
to, 60, 70, 80, 85, 90, 95, 98% or more sequence homology to a
given sequence.
[0056] Exemplary computer programs which can be used to determine
identity between two sequences include, but are not limited to, the
suite of BLAST programs, e.g., BLASTN, BLASTX, and TBLASTX, BLASTP
and TBLASTN, publicly available on the Internet at the NCBI
website. See also Altschul et al., 1990, J. Mol. Biol. 215:403-10
(with special reference to the published default setting, i.e.,
parameters w=4, t=17) and Altschul et al., 1997, Nucleic Acids
Res., 25:3389-3402. Sequence searches are typically carried out
using the BLASTP program when evaluating a given amino acid
sequence relative to amino acid sequences in the GenBank Protein
Sequences and other public databases. The BLASTX program is
preferred for searching nucleic acid sequences that have been
translated in all reading frames against amino acid sequences in
the GenBank Protein Sequences and other public databases. Both
BLASTP and BLASTX are run using default parameters of an open gap
penalty of 11.0, and an extended gap penalty of 1.0, and utilize
the BLOSUM-62 matrix. See id.
[0057] A preferred alignment of selected sequences in order to
determine "% identity" between two or more sequences, is performed
using for example, the CLUSTAL-W program in MacVector version 6.5,
operated with default parameters, including an open gap penalty of
10.0, an extended gap penalty of 0.1, and a BLOSUM 30 similarity
matrix.
[0058] "Polar Amino Acid" refers to a hydrophilic amino acid having
a side chain that is uncharged at physiological pH, but which has
at least one bond in which the pair of electrons shared in common
by two atoms is held more closely by one of the atoms. Genetically
encoded polar amino acids include Asn (N), Gln (Q) Ser (S) and Thr
(T).
[0059] "Nonpolar Amino Acid" refers to a hydrophobic amino acid
having a side chain that is uncharged at physiological pH and which
has bonds in which the pair of electrons shared in common by two
atoms is generally held equally by each of the two atoms (i.e., the
side chain is not polar). Genetically encoded nonpolar amino acids
include Ala (A), Gly (G), Ile (I), Leu (L), Met (M) and Val
(V).
[0060] "Hydrophilic Amino Acid" refers to an amino acid exhibiting
a hydrophobicity of less than zero according to the normalized
consensus hydrophobicity scale of Eisenberg et al., 1984, J. Mol.
Biol. 179:125-142. Genetically encoded hydrophilic amino acids
include Arg (R), Asn (N), Asp (D), Glu (E), Gln (Q), His (H), Lys
(K), Ser (S) and Thr (T).
[0061] "Hydrophobic Amino Acid" refers to an amino acid exhibiting
a hydrophobicity of greater than zero according to the normalized
consensus hydrophobicity scale of Eisenberg et al., 1984, J. Mol.
Biol. 179:125-142. Genetically encoded hydrophobic amino acids
include Ala (A), Gly (G), Ile (I), Leu (L), Met (M), Phe (F), Pro
(P), Trp (W), Tyr (Y) and Val (V).
[0062] "Acidic Amino Acid" refers to a hydrophilic amino acid
having a side chain pK value of less than 7. Acidic amino acids
typically have negatively charged side chains at physiological pH
due to loss of a hydrogen ion. Genetically encoded acidic amino
acids include Asp (D) and Glu (E).
[0063] "Basic Amino Acid" refers to a hydrophilic amino acid having
a side chain pK value of greater than 7. Basic amino acids
typically have positively charged side chains at physiological pH
due to association with a hydrogen ion. Genetically encoded basic
amino acids include Arg (R), His (H) and Lys (K).
[0064] "Encoding" refers to the inherent property of specific
sequences of nucleotides in a polynucleotide, such as a gene, a
cDNA, or an mRNA, to serve as templates for synthesis of other
polymers and macromolecules in biological processes having either a
defined sequence of nucleotides (i.e., rRNA, tRNA and RNA) or a
defined sequence of amino acids and the biological properties
resulting therefrom. Thus, a gene encodes a protein if
transcription and translation of mRNA produced by that gene
produces the protein in a cell or other biological system. Both the
coding strand, the nucleotide sequence of which is identical to the
mRNA sequence and is usually provided in sequence listings, and
non-coding strand, used as the template for transcription, of a
gene or cDNA can be referred to as encoding the protein or other
product of that gene or cDNA. Unless otherwise specified, a
"nucleotide sequence encoding an amino acid sequence" includes all
nucleotide sequences that are degenerate versions of each other and
that encode the same amino acid sequence. Nucleotide sequences that
encode proteins and RNA may include introns.
[0065] "Amplification" refers to any means by which a
polynucleotide sequence is copied and thus expanded into a larger
number of polynucleotide molecules, e.g., by reverse transcription,
polymerase chain reaction, ligase chain reaction, and the like.
[0066] "Primer" refers to a polynucleotide that is capable of
specifically hybridizing to a designated polynucleotide template
and providing a point of initiation for synthesis of a
complementary polynucleotide. Such synthesis occurs when the
polynucleotide primer is placed under conditions in which synthesis
is induced, i.e., in the presence of nucleotides, a complementary
polynucleotide template, and an agent for polymerization such as
DNA polymerase. A primer is typically single-stranded, but may be
double-stranded. Primers are typically deoxyribonucleic acids, but
a wide variety of synthetic and naturally occurring primers are
useful for many applications. A primer is complementary to the
template to which it is designed to hybridize to serve as a site
for the initiation of synthesis, but need not reflect the exact
sequence of the template. In such a case, specific hybridization of
the primer to the template depends on the stringency of the
hybridization conditions. Primers can be labeled with, e.g.,
chromogenic, radioactive, or fluorescent moieties and used as
detectable moieties.
[0067] "Probe," when used in reference to a polynucleotide, refers
to a polynucleotide that is capable of specifically hybridizing to
a designated sequence of another polynucleotide. A probe
specifically hybridizes to a target complementary polynucleotide,
but need not reflect the exact complementary sequence of the
template. In such a case, specific hybridization of the probe to
the target depends on the stringency of the hybridization
conditions. Probes can be labeled with, e.g., chromogenic,
radioactive, or fluorescent moieties and used as detectable
moieties. In instances where a probe provides a point of initiation
for synthesis of a complementary polynucleotide, a probe can also
be a primer.
[0068] "Hybridizing specifically to" or "specific hybridization" or
"selectively hybridize to", refers to the binding, duplexing, or
hybridizing of a nucleic acid molecule preferentially to a
particular nucleotide sequence under stringent conditions when that
sequence is present in a complex mixture (e.g., total cellular) DNA
or RNA.
[0069] The term "stringent conditions" refers to conditions under
which a probe will hybridize preferentially to its target
subsequence, and to a lesser extent to, or not at all to, other
sequences. "Stringent hybridization" and "stringent hybridization
wash conditions" in the context of nucleic acid hybridization
experiments such as Southern and northern hybridizations are
sequence dependent, and are different under different environmental
parameters. An extensive guide to the hybridization of nucleic
acids can be found in Tijssen, 1993, Laboratory Techniques in
Biochemistry and Molecular Biology--Hybridization with Nucleic Acid
Probes, part I, chapter 2, "Overview of principles of hybridization
and the strategy of nucleic acid probe assays", Elsevier, N.Y.;
Sambrook et al., 2001, Molecular Cloning: A Laboratory Manual, Cold
Spring Harbor Laboratory, 3.sup.rd ed., NY; and Ausubel et al.,
eds., Current Edition, Current Protocols in Molecular Biology,
Greene Publishing Associates and Wiley Interscience, NY.
[0070] Generally, highly stringent hybridization and wash
conditions are selected to be about 5.degree. C. lower than the
thermal melting point (Tm) for the specific sequence at a defined
ionic strength and pH. The Tm is the temperature (under defined
ionic strength and pH) at which 50% of the target sequence
hybridizes to a perfectly matched probe. Very stringent conditions
are selected to be equal to the Tm for a particular probe.
[0071] One example of stringent hybridization conditions for
hybridization of complementary nucleic acids which have more than
about 100 complementary residues on a filter in a Southern or
northern blot is 50% formalin with 1 mg of heparin at 42.degree.
C., with the hybridization being carried out overnight. An example
of highly stringent wash conditions is 0.15 M NaCl at 72.degree. C.
for about 15 minutes. An example of stringent wash conditions is a
0.2.times.SSC wash at 65.degree. C. for 15 minutes. See Sambrook et
al. for a description of SSC buffer. A high stringency wash can be
preceded by a low stringency wash to remove background probe
signal. An exemplary medium stringency wash for a duplex of, e.g.,
more than about 100 nucleotides, is 1.times.SSC at 45.degree. C.
for 15 minutes. An exemplary low stringency wash for a duplex of,
e.g., more than about 100 nucleotides, is 4-6.times.SSC at
40.degree. C. for 15 minutes. In general, a signal to noise ratio
of 2.times. (or higher) than that observed for an unrelated probe
in the particular hybridization assay indicates detection of a
specific hybridization.
[0072] "Polypeptide" refers to a polymer composed of amino acid
residues, related naturally occurring structural variants, and
synthetic non-naturally occurring analogs thereof linked via
peptide bonds, related naturally occurring structural variants, and
synthetic non-naturally occurring analogs thereof. Synthetic
polypeptides can be synthesized, for example, using an automated
polypeptide synthesizer. Conventional notation is used herein to
portray polypeptide sequences; the beginning of a polypeptide
sequence is the amino-terminus, while the end of a polypeptide
sequence is the carboxyl-terminus.
[0073] The term "protein" typically refers to large polypeptides,
for example, polypeptides comprising more than about 50 amino
acids. The term "protein" can also refer to dimers, trimers, and
multimers that comprise more than one polypeptide.
[0074] The term "peptide" typically refers to short polypeptides,
for example, polypeptides comprising about 50 or less amino
acids.
[0075] "Conservative substitution" refers to the substitution in a
polypeptide of an amino acid with a functionally similar amino
acid. The following six groups each contain amino acids that are
conservative substitutions for one another: [0076] Alanine (A),
Serine (S), and Threonine (T) [0077] Aspartic acid (D) and Glutamic
acid (E) [0078] Asparagine (N) and Glutamine (Q) [0079] Arginine
(R) and Lysine (K) [0080] Isoleucine (I), Leucine (L), Methionine
(M), and Valine (V) [0081] Phenylalanine (F), Tyrosine (Y), and
Tryptophan (W).
5.2. Chimeric Immunogens
[0082] Generally, the chimeric immunogens of the present invention
are polypeptides that comprise structural domains corresponding to
domains Ia and II of PE. The chimeric immunogens can optionally
comprise structural domains corresponding to the other domains of
PE, domains Ib and III. These structural domains perform certain
functions, including, but not limited to, cell recognition,
translocation and endoplasmic reticulum retention, that correspond
to the functions of the domains of PE. By including or omitting the
optional domains of PE, the character of the induced immune
response can be modulated, as described below.
[0083] In addition to the portions of the molecule that correspond
to PE functional domains, the chimeric immunogens of this invention
further comprise a heterologous antigen. The heterologous antigen
can be introduced into or replace some or all of the Ib domain of
PE, or the heterologous antigen can be introduced into or replace
any other portion of the molecule that does not disrupt a
cell-binding or translocation activity. An immune response specific
for the heterologous antigen is elicited upon administration of the
chimeric immunogen to a subject.
[0084] Accordingly, the chimeric immunogens of the invention
generally comprise the following structural elements, each element
imparting particular functions to the chimeric immunogen: (1) a
"receptor binding domain" that functions as a ligand for a cell
surface receptor and that mediates binding of the protein to a
cell; (2) a "translocation domain" that mediates translocation from
the exterior of the cell to the interior of the cell; (3) the
heterologous antigen; and, optionally, (4) an "endoplasmic
reticulum ("ER") retention domain" that translocates the chimeric
immunogen from the endosome to the endoplasmic reticulum, from
which it enters the cytosol. The chimeric immunogen can still
induce an immune response in the absence of the ER retention
domain, though this absence changes the nature of the induced
immune response, as described below.
[0085] The domains of the chimeric immunogens other than the
heterologous antigen can be present in the order set forth above,
i.e., domain Ia is closest to the N-terminus, then the
translocation domain, then the ER retention domain. In fact, this
arrangement is preferred. However, the domains of the chimeric
immunogen can be in any order as long as the domains retain their
functional activities. Several representative assays to test such
functional activities are set forth below.
[0086] Such chimeric immunogens offer several advantages over
conventional immunogens. To begin with, certain embodiments of the
chimeric immunogens can be constructed and expressed in recombinant
systems. These systems eliminate any requirement to crosslink the
heterologous antigen to a carrier protein. Recombinant technology
also allows one to make a chimeric immunogen having an insertion
site designed for introduction of any desired heterologous antigen.
Such insertion sites allow the skilled artisan to quickly and
easily produce chimeric immunogens that comprise either known
variants of a heterologous antigen or emerging variants of evolving
heterologous antigens.
[0087] Further, the chimeric immunogens can be engineered to alter
the function of their domains in order to tailor the activity of
the immunogen to its intended use. For example, by selecting the
appropriate receptor binding domain, the skilled artisan can target
the chimeric immunogen to bind to a desired cell or cell line.
[0088] In addition, because certain embodiments of the chimeric
immunogens include a constrained cysteine-cysteine loop,
heterologous antigens that are so constrained in nature can be
presented in native or near-native conformation. By doing so, the
induced immune response is specific for antigen in its native
conformation, and can more effectively protect the subject from
infection by the pathogen. For example, a turn-turn-helix motif can
be observed in peptides constrained by a disulfide bond, but not in
linear peptides. See Ogata et al., 1990, Biol. Chem.
265:20678-85.
[0089] Moreover, the chimeric immunogens can be used to elicit a
humoral, a cell-mediated or a secretory immune response. Depending
on the pathway by which the chimeric immunogen is processed in an
antigen-presenting cell, the chimeric immunogen can induce an
immune response mediated by either class I or class II MHC. See
Becerrra et al., 2003, Surgery 133:404-410 and Lippolis et al.,
2000, Cell. Immunol. 203:75-83. Further, if the PE chimeras are
administered to a mucosal surface of the subject, a secretory
immune response involving IgA can be induced. See, e.g., Mrsny et
al., 1999, Vaccine 17:1425-1433 and Mrsny et al., 2002, Drug
Discovery Today 7:247-258.
[0090] The chimeric immunogens of the invention can also be used to
elicit a protective immune response without using attenuated or
inactivated pathogens. The inactivation or attenuation of such
pathogens can sometimes be incomplete, or the pathogen can revert
to be fully infectious, leading to infection by the pathogen upon
administration of the vaccine. For example, administration of
attenuated polio vaccine actually results in paralytic polio in
about 1 in 4 million subjects receiving the vaccine. See Kuby,
1997, Immunology Ch. 18, W.H. Freeman and Company, New York.
[0091] Thus, in certain aspects, the invention provides a chimeric
immunogen that comprises a receptor binding domain, a translocation
domain, and a Pseudomonas pilin peptide comprising an amino acid
sequence that is TAADGLWKCTSDQDEQFIPKGCSK (SEQ ID NO.:1). This
particular pilin peptide corresponds to residues 121-144 of Ps.
aeruginosa PAK pilin protein. In certain embodiments, the chimeric
immunogen, when administered to a subject, can induce an immune
response in the subject that is effective to reduce adherence of a
microorganism that expresses said Pseudomonas pilin peptide to
epithelial cells of the subject. In other embodiments, the chimeric
immunogen, when administered to a subject, generates an immune
response in the subject that reduces the cytotoxicity of
Pseudomonas exotoxin A to the subject. In certain embodiments, the
chimeric immunogen, when administered to a subject, can induce an
immune response in the subject that is effective to reduce the
incidence of infection by a microorganism that expresses said
Pseudomonas pilin peptide in the subject. In certain embodiments,
the chimeric immunogen, when administered to a subject, can induce
an immune response in the subject that is effective to prevent
infection by a microorganism that expresses said Pseudomonas pilin
peptide in the subject. In certain embodiments, the chimeric
immunogen, when administered to a subject, can induce an immune
response in the subject that is effective to treat infection by a
microorganism that expresses said Pseudomonas pilin peptide in the
subject.
[0092] In certain embodiments, the chimeric immunogen further
comprises an endoplasmic reticulum retention domain. In certain
embodiments, the Pseudomonas pilin peptide is located between said
translocation domain and said endoplasmic reticulum retention
domain. In certain embodiments, the endoplasmic reticulum retention
domain is an enzymatically inactive domain III of Pseudomonas
exotoxin A. In certain embodiments, the enzymatically inactive
domain III of Pseudomonas exotoxin A is inactivated by deleting a
glutamate at position 553.
[0093] In certain embodiments, the endoplasmic reticulum retention
domain comprises an ER retention signal that has an amino acid
sequence selected from the group of RDEL (SEQ ID NO.:2) or KDEL
(SEQ ID NO.:3). In certain embodiments, the ER retention signal is
sufficiently near the C-terminus of said endoplasmic reticulum
retention domain to result in retention of the chimeric immunogen
in the endoplasmic reticulum.
[0094] In certain embodiments, the chimeric immunogen comprises a
translocation domain that is selected from the group consisting
translocation domains from Pseudomonas exotoxin A, diptheria toxin,
pertussis toxin, cholera toxin, heat-labile E. coli enterotoxin,
shiga toxin, and shiga-like toxin. In further embodiments, the
translocation domain is domain II of Pseudomonas exotoxin A. In yet
further embodiments, the translocation domain comprises amino acids
280 to 364 of domain II of Pseudomonas exotoxin A.
[0095] In certain embodiments, the chimeric immunogen comprises
more than one of said Pseudomonas pilin peptides.
[0096] In certain embodiments, the chimeric immunogen comprises a
receptor binding domain that is selected from the group consisting
of domain Ia of Pseudomonas exotoxin A; a receptor binding domains
from cholera toxin, diptheria toxin, shiga toxin, or shiga-like
toxin; a monoclonal antibody, a polyclonal antibody, or a
single-chain antibody; TGF.alpha., TGF.beta., EGF, PDGF, IGF, or
FGF; IL-1, IL-2, IL-3, or IL-6; and MIP-1a, MIP-1b, MCAF, or IL-8.
In further embodiments, the receptor binding domain is domain Ia of
Pseudomonas exotoxin A. In vet further embodiments, the domain Ia
of Pseudomonas exotoxin A has an amino acid sequence that is SEQ ID
NO.:4.
[0097] In certain embodiments, the receptor binding domain binds to
.alpha.2-macroglobulin receptor, epidermal growth factor receptor,
transferrin receptor, interleukin-2 receptor, interleukin-6
receptor, interleukin-8 receptor, Fc receptor, poly-IgG receptor,
asialoglycopolypeptide receptor, CD3, CD4, CD8, chemokine receptor,
CD25, CD11B, CD11C, CD80, CD86, TNF.alpha. receptor, TOLL receptor,
M-CSF receptor, GM-CSF receptor, scavenger receptor, or VEGF
receptor. In further embodiments, the receptor binding domain binds
to .alpha.2-macroglobulin receptor.
[0098] In certain embodiments, the chimeric immunogen has an amino
acid sequence that is SEQ ID NO:5.
[0099] 5.2.1. Receptor Binding Domain
[0100] The chimeric immunogens of the invention generally comprise
a receptor binding domain. The receptor binding domain can be any
receptor binding domain that binds to a cell surface receptor
without limitation. Such receptor binding domains are well-known to
those of skill in the art. Preferably, the receptor binding domain
binds specifically to the cell surface receptor. The receptor
binding domain should bind to the cell surface receptor with
sufficient affinity to hold the chimeric immunogen in proximity to
the cell surface to allow endocytosis of the chimeric immunogen.
Representative assays that can routinely be used by the skilled
artisan to assess binding of the receptor binding domain to a cell
surface receptor are described below.
[0101] In certain embodiments, the receptor binding domain can
comprise a polypeptide, a peptide, a protein, a lipid, a
carbohydrate, or a small organic molecule, or a combination
thereof. Examples of each of these molecules that bind to cell
surface receptors are well known to those of skill in the art.
Suitable peptides, polypeptides, or proteins include, but are not
limited to, bacterial toxin receptor binding domains, such as the
receptor binding domains from PE, cholera toxin, diptheria toxin,
shiga toxin, shiga-like toxin, etc.; antibodies, including
monoclonal, polyclonal, and single-chain antibodies, or derivatives
thereof, growth factors, such as TGF.alpha., TGF.beta., EGF, PDGF,
IGF, FGF, etc.; cytokines, such as IL-1, IL-2, IL-3, IL-6, etc;
chemokines, such as MIP-1a, MIP-1b, MCAF, IL-8, etc.; and other
ligands, such as CD4, cell adhesion molecules from the
immunoglobulin superfamily, integrins, ligands specific for the IgA
receptor, etc. See, e.g., Pastan et al., 1992, Annu. Rev. Biochem.
61:331-54; and U.S. Pat. Nos. 5,668,255, 5,696,237, 5,863,745,
5,965,406, 6,022,950, 6,051,405, 6,251,392, 6,440,419, and
6,488,926. The skilled artisan can select the appropriate receptor
binding domain based upon the expression pattern of the receptor to
which the receptor binding domain binds.
[0102] Lipids suitable for receptor binding domains include, but
are not limited to, lipids that themselves bind cell surface
receptors, such as sphingosine-1-phosphate, lysophosphatidic acid,
sphingosylphosphorylcholine, retinoic acid, etc.; lipoproteins such
as apolipoprotein E, apolipoprotein A, etc., and glycolipids such
as lipopolysaccharide, etc.; glycosphingolipids such as
globotriaosylceramide and galabiosylceramide; and the like.
Carbohydrates suitable for receptor binding domains include, but
are not limited to, monosaccharides, disaccharides, and
polysaccharides that comprise simple sugars such as glucose,
fructose, galactose, etc.; and glycoproteins such as mucins,
selectins, and the like. Suitable small organic molecules for
receptor binding domains include, but are not limited to, vitamins,
such as vitamin A, B.sub.1, B.sub.2, B.sub.3, B.sub.6, B.sub.9,
B.sub.12, C, D, E, and K, amino acids, and other small molecules
that are recognized and/or taken up by receptors present on the
surface of epithelial cells.
[0103] In certain embodiments, the receptor binding domain can bind
to a receptor found on an epithelial cell. In further embodiments,
the receptor binding domain can bind to a receptor found on the
apical membrane of an epithelial cell. In still further
embodiments, the receptor binding domain can bind to a receptor
found on the apical membrane of a mucosal epithelial cell. The
receptor binding domain can bind to any receptor known to be
present on the apical membrane of an epithelial cell by one of
skill in the art without limitation. For example, the receptor
binding domain can bind to .alpha.2-MR. An example of a receptor
binding domain that can bind to .alpha.2-MR is domain Ia of PE.
Accordingly, in certain embodiments, the receptor binding domain is
domain Ia of PE. In other embodiments, the receptor binding domain
is a portion of domain Ia of PE that can bind to .alpha.2-MR.
[0104] In certain embodiments, the receptor binding domain can bind
to a receptor present on an antigen presenting cell, such as, for
example, a dendritic cell or a macrophage. The receptor binding
domain can bind to any receptor present on an antigen presenting
cell without limitation. For example, the receptor binding domain
can bind to any receptor identified as present on a dendritic or
other antigen presenting cell identified in Figdor, 2003, Pathol.
Biol. (Paris). 51(2):61-3; Coombes et al., 2001, Immunol Lett. 3;
78(2):103-11; Shortman K et al., 1997, Ciba Found Symp. 204:130-8;
discussion 138-41; Katz, 1998, Curr Opin Immunol. 1(2):213-9; and
Goldsby et al., 2003, Immunology, 5th Edition W.H. Freeman &
Company, New York, N.Y. In particular, the receptor binding domain
can bind to .alpha.2-MR, which is also expressed on the surface of
antigen presenting cells. Thus, in certain embodiments, the
receptor binding domain can bind to a receptor that is present on
both an epithelial cell and on an antigen presenting cell.
[0105] In certain embodiments, the receptor binding domains can
bind to a cell surface receptor that is selected from the group
consisting of .alpha.2-macroglobulin receptor, epidermal growth
factor receptor, transferrin receptor, interleukin-2 receptor,
interleukin-6 receptor, interleukin-8 receptor, Fc receptor,
poly-IgG receptor, asialoglycopolypeptide receptor, CD3, CD4, CD8,
chemokine receptor, CD25, CD11B, CD11C, CD80, CD86, TNF.alpha.
receptor, TOLL receptor, M-CSF receptor, GM-CSF receptor, scavenger
receptor, and VEGF receptor.
[0106] In certain embodiments, the chimeric immunogens of the
invention comprise more than one domain that can function as a
receptor binding domain. For example, the chimeric immunogen could
comprise PE domain Ia in addition to another receptor binding
domain.
[0107] The receptor binding domain can be attached to the remainder
of the chimeric immunogen by any method or means known by one of
skill in the art to be useful for attaching such molecules, without
limitation. In certain embodiments, the receptor binding domain is
expressed together with the remainder of the chimeric immunogen as
a fusion protein. Such embodiments are particularly useful when the
receptor binding domain and the remainder of the immunogen are
formed from peptides or polypeptides.
[0108] In other embodiments, the receptor binding domain is
connected with the remainder of the chimeric immunogen with a
linker. In yet other embodiments, the receptor binding domain is
connected with the remainder of the chimeric immunogen without a
linker. Either of these embodiments are useful when the receptor
binding domain comprises a peptide, polypeptide, protein, lipid,
carbohydrate, nucleic acid, or small organic molecule.
[0109] In certain embodiments, the linker can form a covalent bond
between the receptor binding domain and the remainder of the
chimeric immunogen. In other embodiments, the linker can link the
receptor binding domain to the remainder of the chimeric immunogen
with one or more non-covalent interactions of sufficient affinity.
One of skill in the art can readily recognize linkers that interact
with each other with sufficient affinity to be useful in the
chimeric immunogens of the invention. For example, biotin can be
attached to the receptor binding domain, and streptavidin can be
attached to the remainder of the molecule. In certain embodiments,
the linker can directly link the receptor binding domain to the
remainder of the molecule. In other embodiments, the linker itself
comprises two or more molecules that associate in order to link the
receptor binding domain to the remainder of the molecule. Exemplary
linkers include, but are not limited to, straight or branched-chain
carbon linkers, heterocyclic carbon linkers, substituted carbon
linkers, unsaturated carbon linkers, aromatic carbon linkers,
peptide linkers, etc.
[0110] In embodiments where a linker is used to connect the
receptor binding domain to the remainder of the chimeric immunogen,
the linkers can be attached to the receptor binding domain and/or
the remainder of the chimeric immunogen by any means or method
known by one of skill in the art without limitation. For example,
the linker can be attached to the receptor binding domain and/or
the remainder of the chimeric immunogen with an ether, ester,
thioether, thioester, amide, imide, disulfide or other suitable
moiety. The skilled artisan can select the appropriate linker and
means for attaching the linker based on the physical and chemical
properties of the chosen receptor binding domain and the linker.
The linker can be attached to any suitable functional group on the
receptor binding domain or the remainder of the molecule. For
example, the linker can be attached to sulfhydryl (--S), carboxylic
acid (COOH) or free amine (--NH2) groups, which are available for
reaction with a suitable functional group on a linker. These groups
can also be used to connect the receptor binding domain directly
connected with the remainder of the molecule in the absence of a
linker.
[0111] Further, the receptor binding domain and/or the remainder of
the chimeric immunogen can be derivatized in order to facilitate
attachment of a linker to these moieties. For example, such
derivatization can be accomplished by attaching suitable derivative
such as those available from Pierce Chemical Company, Rockford,
Ill. Alternatively, derivatization may involve chemical treatment
of the receptor binding domain and/or the remainder of the
molecule. For example, glycol cleavage of the sugar moiety of a
carbohydrate or glycoprotein receptor binding domain with periodate
generates free aldehyde groups. These free aldehyde groups may be
reacted with free amine or hydrazine groups on the remainder of the
molecule in order to connect these portions of the molecule. See
U.S. Pat. No. 4,671,958. Further, the skilled artisan can generate
free sulfhydryl groups on proteins to provide a reactive moiety for
making a disulfide, thioether, theioester, etc. linkage. See U.S.
Pat. No. 4,659,839.
[0112] Any of these methods for attaching a linker to a receptor
binding domain and/or the remainder of a chimeric immunogen can
also be used to connect a receptor binding domain with the
remainder of the chimeric immunogen in the absence of a linker. In
such embodiments, the receptor binding domain is coupled with the
remainder of the immunogen using a method suitable for the
particular receptor binding domain. Thus, any method suitable for
connecting a protein, peptide, polypeptide, nucleic acid,
carbohydrate, lipid, or small organic molecule to the remainder of
the chimeric immunogen known to one of skill in the art, without
limitation, can be used to connect the receptor binding domain to
the remainder of the immunogen. In addition to the methods for
attaching a linker to a receptor binding domain or the remainder of
an immunogen, as described above, the receptor binding domain can
be connected with the remainder of the immunogen as described in
U.S. Pat. Nos. 6,673,905; 6,585,973; 6,596,475; 5,856,090;
5,663,312; 5,391,723; 6,171,614; 5,366,958; and 5,614,503.
[0113] In certain embodiments, the receptor binding domain can be a
monoclonal antibody or antigen-binding portion of an antibody. In
some of these embodiments, the chimeric immunogen is expressed as a
fusion protein that comprises an immunoglobulin heavy chain from an
immunoglobulin specific for a receptor on a cell to which the
chimeric immunogen is intended to bind, or antigen-binding portion
thereof. The light chain of the immunoglobulin, or antigen-binding
portion thereof, then can be co-expressed with the chimeric
immunogen, thereby forming an antigen-binding light chain-heavy
chain dimer. In other embodiments, the antibody, or antigen-binding
portion thereof, can be expressed and assembled separately from the
remainder of the chimeric immunogen and chemically linked
thereto.
[0114] 5.2.2. Translocation Domain
[0115] The chimeric immunogens of the invention also comprise a
translocation domain. The translocation domain can be any
translocation domain known by one of skill in the art to effect
translocation of chimeric proteins that have bound to a cell
surface receptor from outside the cell to inside the cell, e.g.,
the outside of an epithelial cell, such as, for example, a
polarized epithelial cell. In certain embodiments, the
translocation domain is a translocation domain from PE, diptheria
toxin, pertussis toxin, cholera toxin, heat-labile E. coli
enterotoxin, shiga toxin, or shiga-like toxin. See, for example,
U.S. Pat. Nos. 5,965,406, and 6,022,950. In preferred embodiments,
the translocation domain is domain II of PE. In certain
embodiments, the translocation domain of domain II of PE has an
amino acid sequence that is SEQ ID NO:6.
[0116] The translocation domain need not, though it may, comprise
the entire amino acid sequence of domain II of native PE, which
spans residues 253-364 of PE. For example, the translocation domain
can comprise a portion of PE that spans residues 280-344 of domain
II of PE. The amino acids at positions 339 and 343 appear to be
necessary for translocation. See Siegall et al., 1991, Biochemistry
30:7154-59. Further, conservative or nonconservative substitutions
can be made to the amino acid sequence of the translocation domain,
as long as translocation activity is not substantially eliminated.
A representative assay that can routinely be used by one of skill
in the art to determine whether a translocation domain has
translocation activity is described below.
[0117] Without intending to be limited to any particular theory or
mechanism of action, the translocation domain is believed to
perform at least two important functions in the chimeric immunogens
of the invention. First, the translocation domain permits the
trafficking of the chimeric immunogen through a polarized
epithelial cell into the bloodstream after the immunogen binds to a
receptor present on the apical surface of the polarized epithelial
cell. This trafficking results in the release of the chimeric
immunogen from the basal-lateral membrane of the polarized
epithelial cell. Second, the translocation domain facilitates
endocytosis of the chimeric immunogen into an antigen presenting
cell after the immunogen binds to a receptor present on the surface
of the antigen presenting cell.
[0118] 5.2.3. Heterologous Antigen
[0119] The chimeric immunogens of the invention also comprise a
heterologous antigen. The antigen is "heterologous" because it is
heterologous to a portion of the remainder of the immunogen; i.e.,
not ordinarily found in a molecule from which one of the other
domains of the chimeric immunogen is derived. The heterologous
antigen can be any molecule, macromolecule, combination of
molecules, etc. against which an immune response is desired. Thus,
the heterologous antigen can be any peptide, polypeptide, protein,
nucleic acid, lipid, carbohydrate, or small organic molecule, or
any combination thereof, against which the skilled artisan wishes
to induce an immune response. Preferably, the heterologous antigen
is an antigen that is present on a pathogen. More preferably, the
heterologous antigen is an antigen that, when administered to a
subject as part of a chimeric immunogen, results in an immune
response against the heterologous antigen that protects the subject
from infection by a pathogen from which the heterologous antigen is
derived.
[0120] The heterologous antigen can be attached to the remainder of
the chimeric immunogen by any method known by one of skill in the
art without limitation. In certain, embodiments, the heterologous
antigen is expressed together with the remainder of the chimeric
immunogen as a fusion protein. In such embodiments, the
heterologous antigen can be inserted into or replace any portion of
the chimeric immunogen, so long as the receptor binding domain, the
translocation domain, and the optional ER retention signal domain
retain their activities, and the immune response induced against
the heterologous antigen retains specificity. Methods for assessing
the specificity of the immune response against the heterologous
antigen are extensively described below. The heterologous antigen
is preferably inserted into or replaces all or a portion of the Ib
loop of PE, into the ER retention domain, or attached to or near
the C-terminal end of the translocation domain.
[0121] In native PE, the Ib loop (domain Ib) spans amino acids 365
to 399, and is structurally characterized by a disulfide bond
between two cysteines at positions 372 and 379. This portion of PE
is not essential for any known activity of PE, including cell
binding, translocation, ER retention or ADP ribosylation activity.
Accordingly, domain Ib can be deleted entirely, or modified to
contain a heterologous antigen.
[0122] Thus, in certain embodiments, the heterologous antigen can
be inserted into domain Ib. If desirable, the heterologous antigen
can be inserted into domain Ib wherein the cysteines at positions
372 and 379 are not crosslinked. This can be accomplished by
reducing the disulfide linkage between the cysteines, by deleting
one or both of the cysteines entirely from the Ib domain, by
mutating one or both of the cysteines to other residues, such as,
for example, serine, or by other similar techniques. Alternatively,
the heterologous antigen can be inserted into the Ib loop between
the cysteines at positions 372 and 379. In such embodiments, the
disulfide linkage between the cysteines can be used to constrain
the heterologous antigen domain.
[0123] This arrangement offers several advantages. The chimeric
immunogens can be used in this manner to present heterologous
antigens that naturally comprise a cysteine-cysteine disulfide bond
in native or near-native conformation. Further, without intending
to be bound to any particular theory or mechanism of action, it is
believed that charged amino acid residues in the native Ib domain
result in a hydrophilic structure that protrudes from the molecule
and into the solvent. Thus, inserting the heterologous antigen into
the Ib loop gives immune system components unfettered access to the
antigen, resulting in more effective antigen presentation. Such
access is particularly useful the heterologous antigen is a B cell
antigen for inducing a humoral immune responses. Further, changes,
including mutations or insertions, to domain Ib do not appear to
affect activity of the other PE domains. Accordingly, although
native Ib domain has only six amino acids between the cysteine
residues, much longer sequences can be inserted into the loop
without disrupting the other functions of the chimeric
immunogen.
[0124] In other embodiments, the heterologous antigen can be
inserted into the optional ER retention domain of the chimeric
immunogen. Without intending to be bound to any particular theory
or mechanism of action, it is believed that the nature of the
immune response against the heterologous antigen varies depending
on the degree of separation between the antigen and the ER
retention signal. In particular, the degree to which the
heterologous antigen is processed by the Class I or II MHC pathways
can vary depending on this degree of separation. By placing the
heterologous antigen close to the ER retention signal, e.g.,
inserting the heterologous antigen into the ER retention domain of
the chimeric immunogen near the ER retention signal, more of the
heterologous antigen can be directed into the Class I MHC
processing pathway, thereby inducing a cellular immune response.
Conversely, when the heterologous antigen is further from the ER
retention signal, more of the antigen is directed into the Class II
MHC processing pathway, thereby facilitating induction of a humoral
immune response. If the immune response is intended to be primarily
humoral, with essentially no Class I MHC cell mediated response,
the ER retention domain can be deleted entirely, and the
heterologous antigen attached to the immunogen in another location,
such as, for example, to the C terminus of the translocation
domain. Thus, by controlling the spatial relationship between the
heterologous antigen and the ER retention signal, the skilled
artisan can modulate the immune response that is induced against
the heterologous antigen.
[0125] In embodiments where the heterologous antigen is expressed
together with another portion of the chimeric immunogen as a fusion
protein, the heterologous antigen can be can be inserted into the
chimeric immunogen by any method known to one of skill in the art
without limitation. For example, amino acids corresponding to the
heterologous antigen can be directly into the chimeric immunogen,
with or without deletion of native amino acid sequences. In certain
embodiments, all or part of the Ib domain of PE can be deleted and
replaced with the heterologous antigen. In certain embodiments, the
cysteine residues of the Ib loop are deleted so that the
heterologous antigen remains unconstrained. In other embodiments,
the cysteine residues of the Ib loop are linked with a disulfide
bond and constrain the heterologous antigen.
[0126] In embodiments where the heterologous antigen is not
expressed together with the remainder of the chimeric immunogen as
a fusion protein, the heterologous antigen can be connected with
the remainder of the chimeric immunogen by any suitable method
known by one of skill in the art, without limitation. More
specifically, the exemplary methods described above for connecting
a receptor binding domain to the remainder of the molecule are
equally applicable for connecting the heterologous antigen to the
remainder of the molecule.
[0127] In certain embodiments, the heterologous antigen is a
peptide, polypeptide, or protein. The heterologous antigen can be
any peptide, polypeptide, or protein against which an immune
response is desired to be induced. In certain embodiments, the
heterologous antigen is a peptide that comprises about 5, about 8,
about 10, about 12, about 15, about 17, about 20, about 25, about
30, about 40, about 50, or about 60, about 70, about 80, about 90,
about 100, about 200, about 400, about 600, about 800, or about
1000 amino acids. In certain embodiments, the heterologous antigen
is a polypeptide derived from Pseudomonas aeruginosa. In certain
embodiments, the heterologous antigen is Pseudomonas pilin protein,
or a portion thereof. In further embodiments, the heterologous
antigen is a peptide derived from Pseudomonas pilin protein. In
certain embodiments, the peptide derived from Pseudomonas pilin
peptide is not a peptide that is amino acid residues 128-144 of a
type IV pilin protein. In certain embodiments, the peptide derived
from Pseudomonas pilin peptide does not have an amino acid sequence
that is KCTSDQDEQFIPKGCSK (SEQ ID NO.:7). In a preferred
embodiment, the heterologous antigen is a peptide that has an amino
acid sequence that is TAADGLWKCTSDQDEQFIPKGCSK (SEQ ID NO.:1.)
[0128] In certain embodiments, the heterologous antigen is a
carbohydrate. The heterologous antigen can be any carbohydrate
against which an immune response is desired to be induced. In
certain embodiments, the heterologous antigen is a carbohydrate
that comprises about 1, about 2, about 3, about 4, about 5, about
8, about 10, about 12, about 15, about 17, about 20, about 25,
about 30, about 40, about 50, or about 60, about 70, about 80,
about 90, or about 100 sugar monomers. In certain embodiments, the
heterologous antigen is a carbohydrate derived from Pseudomonas
aeruginosa.
[0129] In other embodiments, the heterologous antigen can be a
glycoprotein, or a portion thereof. The heterologous antigen can be
any glycoprotein, or portion of a glycoprotein, against which an
immune response is desired to be induced. In certain embodiments,
the heterologous antigen is a glycoprotein or glycoprotein portion
that comprises about 5, about 8, about 10, about 12, about 15,
about 17, about 20, about 25, about 30, about 40, about 50, or
about 60, about 70, about 80, about 90, about 100, about 200, about
400, about 600, about 800, or about 1000 amino acids. In certain
embodiments, the heterologous antigen is a glycoprotein or
glycoprotein portion derived from Pseudomonas aeruginosa.
[0130] In addition to the protein component, the glycoprotein or
glycoprotein portion also comprises a carbohydrate moiety. The
carbohydrate moiety of the glycoprotein or glycoprotein portion
comprises about 1, about 2, about 3, about 4, about 5, about 8,
about 10, about 12, about 15, about 17, about 20, about 25, about
30, about 40, about 50, or about 60, about 70, about 80, about 90,
or about 100 sugar monomers.
[0131] In general, the skilled artisan may select the heterologous
antigen at her discretion, guided by the following discussion. One
important factor in selecting the heterologous antigen is the type
of immune response that is to be induced. For example, when a
humoral immune response is desired, the heterologous antigen should
be selected to be recognizable by a B-cell receptor and to be
antigenically similar to a region of the source molecule that is
available for antibody binding.
[0132] Important factors to consider when selecting a B-cell
antigen include, but are not limited to, the size and conformation
of the antigenic determinant to be recognized, both in the context
of the chimeric immunogen and in the native molecule from which the
heterologous antigen is derived; the hydrophobicity or
hydrophilicity of the heterologous antigen; the topographical
accessibility of the antigen in the native molecule from which the
heterologous antigen is derived; and the flexibility or mobility of
the portion of the native molecule from which the heterologous
antigen is derived. See, e.g., Kuby, 1997, Immunology Chapter 4,
W.H. Freeman and Company, New York. Based on these criteria, the
skilled artisan can, when appropriate, select a portion of a large
molecule, such as a protein, to be the heterologous antigen. If the
source of the heterologous antigen cannot be effectively
represented by selecting a portion of it, then the skilled artisan
can select the entire molecule to be the heterologous antigen. Such
embodiments are particularly useful in the cases of B-cell antigens
that are formed by non-sequential amino acids, i.e., antigens
formed by amino acids that are not adjacent in the primary
structure of the source protein.
[0133] Similarly, if the skilled artisan wishes to deliver a
heterologous antigen to activate T cells, several factors must be
considered in the selection of the heterologous antigen. Principle
among such factors is whether helper T cells or cytotoxic T cells
are to be stimulated. As described below, helper T cells recognize
antigen presented by Class II MHC molecules, while cytotoxic T
cells recognize antigen present by Class I MHC. Accordingly, in
order to selectively activate these populations, the skilled
artisan should select the heterologous antigen to be presentable by
the appropriate type of MHC. For example, the skilled artisan can
select the heterologous antigen to be a peptide that is presented
by Class I MHC when a response mediated by cytotoxic T cells is
desired. Similarly, the skilled artisan can select the heterologous
antigen to be a peptide that is presented by Class II MHC when a
response mediated by helper T cells is desired.
[0134] Further, both Class I and Class II MHC exhibit significant
allelic variation in studied populations. Much is known about Class
I and II MHC alleles and the effects of allelic variation on
antigens that can be presented by the different alleles. For
example, rules for interactions between Class I MHC haplotype and
antigens that can be effectively presented by these molecules are
reviewed in Stevanovic, 2002, Transpl Immunol 10:133-136. Further
guidance on selection of appropriate peptide antigens for Class I
and II MHC molecules may be found in U.S. Pat. Nos. 5,824,315 and
5,747,269, and in Germain et al., 1993, Annu. Rev. Immunol.
11:403-450; Sinigaglia et al., 1994, Curr. Opin. Immunol. 6:52-56;
Margalit et al., 2003, Novartis Found Symp. 254:77-101, 216-22, and
250-252; Takahashi, 2003, Comp Immunol Microbiol Infect Dis.
26:309-328; Yang, 2003, Microbes Infect. 5:39-47; and Browning et
al., 1996. HLA and MHC: Genes, Molecules and Function (Davenport
and Hill, eds.) A BIOS Scientific Publishers, Oxford. An empirical
system for identifying peptide antigens for presentation on Class
II MHC, and that can be adapted for identifying peptide antigens
for presentation on Class I MHC, is presented in U.S. Pat. No.
6,500,641.
[0135] Further, the chimeric immunogen can comprise one or more
antigens in addition to the antigen from Pseudomonas pilin protein
that can be a molecule that potentiates an immune response. Any
antigen that can act as immune stimulant known by one of skill in
the art without limitation can be used as an antigen in such
embodiments. For example, the heterologous antigen can be a nucleic
acid with an unmethylated CpG motif, with a methylated CpG motif,
or without any CpG motifs, as described in U.S. Pat. Nos. 6,653,292
and 6,239,116 and Published U.S. Application 20040152649,
lipopolysaccharide (LPS) or an LPS derivative such as mono- or
diphosphoryl lipid A, or any of the LPS derivatives or other
adjuvants described in U.S. Pat. Nos. 6,716,623, 6,720,146, and
6,759,241.
[0136] 5.2.4. Endoplasmic Reticulum Retention Domain
[0137] The chimeric immunogens of the invention can optionally
comprise an endoplasmic reticulum retention domain. This domain
comprises an endoplasmic reticulum signal sequence, which functions
in translocating the chimeric immunogen from the endosome to the
endoplasmic reticulum, and from thence into the cytosol. Native PE
comprises an ER retention domain in domain III. The ER retention
domain comprises an ER retention signal sequence at its carboxy
terminus. In native PE, this ER retention signal is REDLK (SEQ ID
NO.:8). The terminal lysine can be eliminated (i.e., REDL (SEQ ID
NO.:2)) without an appreciable decrease in activity. However, any
ER retention signal sequence known to one of skill in the art
without limitation can be used in the chimeric immunogens of the
invention. Other suitable ER retention signal sequences include,
but are not limited to, KDEL (SEQ ID NO.:3), or dimers or multimers
of these sequences. See Ogata et al., 1990, J. Biol. Chem.
265:20678-85; U.S. Pat. No. 5,458,878; and Pastan et al., 1992,
Annu. Rev. Biochem. 61:331-54.
[0138] In certain embodiments, the chimeric immunogen comprises
domain III of native PE, or a portion thereof. Preferably, the
chimeric immunogen comprises domain III of .DELTA.E553 PE. In
certain embodiments, domain III, including the ER retention signal,
can be entirely eliminated from the chimeric immunogen. In other
embodiments, the chimeric immunogen comprises an ER retention
signal sequence and comprises a portion or none of the remainder of
PE domain III. In certain embodiments, the portion of PE domain III
other than the ER retention signal can be replaced by another amino
acid sequence. This amino acid sequence can itself be non
immunogenic, slightly immunogenic, or highly immunogenic. A highly
immunogenic ER retention domain is preferable for use in eliciting
a humoral immune response. For example, PE domain III is itself
highly immunogenic and can be used in chimeric immunogens where a
robust humoral immune response is desired. Chimeras in which the ER
retention domain is only slightly immunogenic will be more useful
when an Class I MHC-dependent cell-mediated immune response is
desired.
[0139] ER retention domain activity can routinely be assessed by
those of skill in the art by testing for translocation of the
protein into the target cell cytosol using the assays described
below.
[0140] In native PE, the ER retention sequence is located at the
C-terminus of domain III. Native PE domain III has at least two
observable activities. Domain III mediates ADP-ribosylation and
therefore toxicity. Further, the ER retention signal present at the
C-terminus directs endocytosed toxin into the endoplasmic reticulum
and from thence, into the cytosol. Eliminating the ER retention
sequence from the chimeric immunogens does not alter the activity
of Pseudomonas exotoxin as a superantigen, but does prevent it from
eliciting an MHC Class I-dependent cell-mediated immune
response.
[0141] The PE domain that mediates ADP-ribosylation is located
between about amino acids 400 and 600 of PE. This toxic activity of
native PE is preferably eliminated in the chimeric immunogens of
the invention. By doing so, the chimeric immunogen can be used as a
vehicle for delivering heterologous antigens to be processed by the
cell and presented on the cell surface with MHC Class I or Class II
molecules, as desired, rather than as a toxin. ADP ribosylation
activity can be eliminated by, for example, deleting amino acid
E553. See, e.g., Lukac et al., 1988, Infect. and Immun.
56:3095-3098. Alternatively, the amino acid sequence of domain III,
or portions of it, can be deleted from the protein. Of course, an
ER retention sequence should be included at the C-terminus if a
Class I MHC-mediated immune response is to be induced.
[0142] In certain embodiments, the ER retention domain is
substantially identical to the native amino acid sequences of PE
domain III, or a fragment thereof. In certain embodiments, the ER
retention domain is domain III of PE. In other embodiments, the ER
retention domain is domain III of .DELTA.E553 PE. In still other
embodiments, the ER retention domain comprises an amino acid
sequence that is selected from the group consisting of RDELK, RDEL,
and KDEL.
5.3. Methods for Inducing an Immune Response
[0143] In another aspect, the invention provides methods of
inducing an immune response against an antigen. The methods allow
one of skill in the art to induce a cellular, humoral, or secretory
immune response. These methods generally rely on administration of
a chimeric immunogen of the invention to a subject in whom the
immune response is to be induced. As described above, the chimeric
immunogens can be used to induce an immune response that is
specific for a heterologous antigen. In certain embodiments, the
immune response that is induced is a prophylactic immune response,
i.e., the subject is not already afflicted with a disease from
which the heterologous antigen is derived. In other embodiments,
the immune response that is induced is therapeutic, i.e., the
subject is already afflicted with a disease from which the
heterologous antigen is derived.
[0144] Accordingly, the invention provides methods for inducing an
immune response against a heterologous antigen. In certain
embodiments, the methods comprise administering to a subject in
whom the immune response is to be induced a chimeric immunogen
bearing the heterologous antigen. The chimeric immunogen can be
administered as a vaccine composition, as described below. The
resultant immune responses protect against infection by a pathogen
bearing the heterologous antigen or against cells that express the
heterologous antigen. For example, if the pathology results from
bacterial or parasitic protozoan infection, the immune response is
mounted against the pathogens, themselves. If the pathogen is a
virus, infected cells will express the heterologous antigens on
their surface and become the target of a cell mediated immune
response, though there can also be an immune response mounted
against viral particles. Aberrant cells, such as cancer cells, that
express antigens not present on the surface of normal cells also
can be subject to a cell mediated immune response.
[0145] Accordingly, in certain aspects, the invention provides a
method for inducing an immune response in a subject that comprising
administering to the subject an effective amount of a chimeric
immunogen comprising a receptor binding domain, a translocation
domain, and a Pseudomonas pilin peptide that comprises an amino
acid sequence that is TAADGLWKCTSDQDEQFIPKGCSK (SEQ ID NO.:1). In
certain embodiments, administration of the chimeric immunogen
induces an immune response in the subject that is effective to
reduce adherence of a microorganism expressing the Pseudomonas
pilin peptide to epithelial cells of the subject when the chimeric
immunogen is administered to the subject. In certain embodiments,
administration of the chimeric immunogen to the subject induces an
immune response in the subject that reduces cytotoxicity of
Pseudomonas exotoxin A.
[0146] In certain embodiments, the subject is a human. In certain
embodiments, the chimeric immunogen is administered to said subject
nasally or orally.
[0147] In certain embodiments, the chimeric immunogen is
administered in the form of a pharmaceutical composition that
comprises the chimeric immunogen and a pharmaceutically acceptable
diluent, excipient, vehicle, or carrier. In certain embodiments,
the pharmaceutical composition is formulated for nasal or oral
administration.
[0148] In other embodiments, the invention provides a method for
generating in a subject antibodies specific for a Pseudomonas pilin
peptide having an amino acid sequence that is
TAADGLWKCTSDQDEQFIPKGCSK (SEQ ID NO.:1). The method comprises
administering to the subject an effective amount of a chimeric
immunogen that comprises a receptor binding domain, a translocation
domain, and a Pseudomonas pilin peptide that comprises an amino
acid sequence that is TAADGLWKCTSDQDEQFIPKGCSK (SEQ ID NO.:1).
Administration of such chimeric immunogens generates antibodies
specific for the Pseudomonas pilin peptide. In certain embodiments,
administration of the chimeric immunogen to the subject induces an
immune response in the subject that reduces the cytotoxicity of
Pseudomonas exotoxin A.
[0149] In certain embodiments, the subject is a mammal. In further
embodiments, the subject is a rodent, lagomorph or primate. In a
preferred embodiments, the subject is a human.
[0150] 5.3.1. Humoral Immune Responses
[0151] In certain embodiments, the invention provides a method for
inducing a humoral immune response against the heterologous antigen
in a subject. The methods generally comprise administering to a
subject a chimeric immunogen that is configured to produce a
humoral immune response. Such immune responses generally involve
the production of antibodies specific for the antigen. Certain
embodiments of the chimeric immunogens have properties that allow
the skilled artisan to induce a humoral immune response against the
heterologous antigens. For example, when the heterologous antigen
is inserted into PE domain Ib, the flanking cysteines cause the
heterologous antigen to be extended from the remainder of the
immunogen and facilitate recognition of the antigen by a B cell
through an interaction with a B-cell receptor. Interaction between
the heterologous antigen and the B cell receptor stimulates clonal
expansion of the B cell bearing the receptor, eventually resulting
in a population of plasma cells that secrete antibodies specific
for the antigen.
[0152] In most circumstances, B cell recognition of antigen is
necessary, but not sufficient, to induce a robust humoral immune
response. The humoral response is greatly potentiated by CD4.sup.+
(helper) T cell signaling to B cells primed by antigen recognition.
Helper T cells are activated to provide such signals to B cells by
recognition of antigen processed through the Class II MHC pathway.
The antigen recognized by the T cell can, but need not, be the same
antigen recognized by the B cell. The chimeric immunogens of the
invention can be targeted to such antigen presenting cells for
processing in the Class II MHC pathway in order to stimulate helper
T cells to activate B cells. By doing so, the chimeric immunogens
can be used to stimulate a robust humoral immune response that is
specific for the heterologous antigen.
[0153] Further, the chimeric immunogens are attractive vehicles for
inducing a humoral immune response against heterologous antigens
that are constrained within their native environment. By inserting
the heterologous antigen into the Ib loop of PE antigens, the
antigen can be presented to immune cells in near-native
conformation. The resulting antibodies generally recognize the
native antigen better than those raised against unconstrained
versions of the heterologous antigen. The Ib loop can also be used
to present B cell antigens that are not constrained in their native
environment. In such embodiments, the antigen inserted into the Ib
loop should be flanked by a sufficient number of amino acids that
give conformational flexibility, such as, e.g., glycine, serine,
etc., to allow the antigen to fold into its native form and avoid
constraint by the disulfide linkage between the cysteines of the Ib
loop.
[0154] The humoral immune response induced by the chimeric
immunogens can be assessed using any method known by one of skill
in the art without limitation. For example, an animal's immune
response against the heterologous antigen can be monitored by
taking test bleeds and determining the titer of antibody reactivity
to the heterologous antigen. When appropriately high titers of
antibody to the heterologous antigen are obtained, blood can be
collected from the animal and antisera prepared. The antisera can
be further enriched for antibodies reactive to the heterologous
antigen, when desired. See, e.g., Coligan, 1991, Current Protocols
in Immunology, Greene Publishing Associates and Wiley Interscience,
NY; and Harlow and Lane, 1989, Antibodies: A Laboratory Manual,
Cold Spring Harbor Press, NY.
[0155] Antibodies produced in response to administration of the
chimeric immunogens can then be used for any purpose known by one
of skill in the art, without limitation. The antibodies are
believed to be equivalent to antibodies induced using conventional
techniques, such as coupling peptides to an immunogen. For example,
the antibodies can be used to make monoclonal antibodies, humanized
antibodies, chimeric antibodies or antibody fragments. Techniques
for producing such antibody derivatives may be found in, for
example, Stites et al. eds., 1997, Medical Immunology (9th ed.),
McGraw-Hill/Appleton & Lange, CA; Harlow and Lane, 1989,
Antibodies: A Laboratory Manual, Cold Spring Harbor Press, NY;
Goding, 1986, Monoclonal Antibodies: Principles and Practice (2d
ed.), Academic Press, NY; Kohler and Milstein, 1975, Nature 256:
495-497; and U.S. Pat. No. 5,585,089.
[0156] 5.3.2. Cell-Mediated Immune Responses
[0157] In other embodiments, the invention provides methods for
eliciting a cell-mediated immune response against cells expressing
the heterologous antigen. The methods generally comprise
administering to a subject a chimeric immunogen that comprises the
heterologous antigen that is configured to produce a cell-mediated
immune response. Such immune responses generally involve the
activation of cytotoxic T lymphocytes that can recognize and kill
cells that display the antigen on their surfaces. However, certain
aspects of humoral immune responses give rise to cell-mediated
effects as well, as described below. Certain embodiments of the
chimeric immunogens have properties that allow the skilled artisan
to induce a cell-mediated immune response against the heterologous
antigens.
[0158] In particular, heterologous antigens that are inserted into
a chimeric immunogen near a ER retention signal tend to induce a
cell-mediated immune response. Without intending to be bound to any
particular theory or mechanism of action, it is believed that the
ER retention signal causes the chimeric immunogen to be trafficked
from an endosome to the ER, and from thence into the cytosol. Once
in the cytosol, peptides from the immunogen, including the
heterologous antigen, enter the Class I MHC processing pathway. The
peptides associate with Class I MHC and are presented on the
surface of the cell into which the immunogen has been introduced.
CD8.sup.+ (cytotoxic) T lymphocytes then recognize the heterologous
antigen in association with Class I MHC and thereby become
activated and primed to kill cells that similarly have the
heterologous antigen associated with Class I MHC on their
surfaces.
[0159] Part of the processing that occurs during presentation on
Class I MHC is believed to result in degradation of the chimeric
immunogen into peptides that can associate with the MHC molecule.
This proteolysis is believed to begin in the endosome and to
continue in the cytosol. If, in the course of this process, the
heterologous antigen is separated from the ER retention signal
before the heterologous antigen is trafficked to the cytosol, it is
believed that the heterologous antigen cannot associate with Class
I MHC. In such circumstances, the heterologous antigen can remain
in the endosome, and can be directed to the Class II MHC processing
pathway. Accordingly, it is believed that the distance, e.g., the
number of amino acids, between the heterologous antigen and the ER
retention signal can affect the degree to which the antigen is
presented in association with Class I or Class II MHC.
[0160] Features of peptides that associate with the various allelic
forms of Class I MHC have been well characterized. For example,
peptides bound by HLA-A1 generally comprise a first conserved
residue of T, S or M, a second conserved residue of D or E, and a
third conserved residue of Y, wherein the first and second residues
are adjacent, and both are separated from the third residue by six
or seven amino acids. Peptides that bind to other alleles of Class
I MHC have also been characterized. Using this knowledge, the
skilled artisan can select heterologous antigens that can associate
with a Class I MHC allele that is expressed in the subject. By
administering chimeric immunogens comprising such antigens near the
ER retention signal, a cell-mediated immune response can be
induced.
[0161] Cell-mediated immune responses can also arise as a
consequence of humoral immune responses. Antibodies produced in the
course of the humoral immune response bind to their cognate
antigen; if this antigen is present on the surface of a cell, the
antibody binds to the cell surface. Cells bound by antibodies in
this manner are subject to antibody-dependent cell-mediated
cytotoxicity, in which immune cells that bear Fc receptors attack
the marked cells. For example, natural killer cells and macrophages
have Fc receptors and can participate in this phenomenon.
[0162] 5.3.3. Secretory Immune Response
[0163] In other embodiments, the invention provides methods for
eliciting a secretory immune response against the heterologous
antigen. The methods generally comprise administering to a mucous
membrane of the subject a chimeric immunogen that comprises the
heterologous antigen that is configured to bind to a receptor
present on the mucous membrane. The mucous membrane can be any
mucous membrane known by one of skill in the art to be present in
the subject, without limitation. For example, the mucous membrane
can be present in the eye, nose, mouth, trachea, lungs, esophagus,
stomach, small intestine, large intestine, rectum, anus, sweat
glands, vulva, vagina, or penis of the subject. Certain embodiments
of the chimeric immunogens have properties that allow the skilled
artisan to induce a secretory immune response against the
heterologous antigens.
[0164] In particular, chimeric immunogens that comprise receptor
binding domains that can bind to a receptor present on the apical
membrane of an epithelial cell can be used to induce a secretory
immune response. Such receptor binding domains are extensively
described above. Without intending to be bound by any particular
theory or mechanism of action, it is believed that the original
encounter with the antigen at the mucosal surface directs the
immune system to produce a secretory rather than humoral immune
response.
[0165] Secretory immune responses are desirable for protecting
against any pathogen that enters the body through a mucous
membrane. Mucous membranes are primary entryways for many
infectious pathogens, including, for example, HIV, herpes,
vaccinia, cytomegalovirus, yersinia, vibrio, and Pseudomonas spp.
Mucous membranes can be found in the mouth, nose, throat, lung,
vagina, rectum and colon. As one defense against entry by these
pathogens, the body secretes secretory IgA from mucosal epithelial
membranes that can bind the pathogens and prevent or deter
pathogenesis. Furthermore, antigens presented at one mucosal
surface can trigger responses at other mucosal surfaces due to
trafficking of antibody-secreting cells between the mucous
membranes. The structure of secretory IgA appears to be crucial for
its sustained residence and effective function at the luminal
surface of a mucous membrane. "Secretory IgA" or "sIgA" generally
refers to a polymeric molecule comprising two IgA immunoglobulins
joined by a J chain and further bound to a secretory component.
While mucosal administration of antigens can generate an IgG
response, parenteral administration of immunogens rarely produces
strong sIgA responses.
[0166] The chimeric immunogens can be administered to the mucous
membrane of the subject by any suitable method or in any suitable
formulation known to one of skill in the art without limitation.
For example, the chimeric immunogens can be administered in the
form of liquids or solids, e.g., sprays, ointments, suppositories
or erodible polymers impregnated with the immunogen. Administration
can involve applying the immunogen to a one or more different
mucosal surfaces. Further, in certain embodiments, the chimeric
immunogen can be administered in a single dose. In other
embodiments, the chimeric immunogen can be administered in a series
of two or more administrations. In certain embodiments, the second
or subsequent administration of the chimeric immunogen is
administered parenterally, e.g., subcutaneously or
intramuscularly.
[0167] The sIgA response is strongest on mucosal surfaces exposed
to the immunogen. Therefore, in certain embodiment, the immunogen
is applied to a mucosal surface that is likely to be a site of
exposure to the pathogen. Accordingly, chimeric immunogens against
pathogens encountered on vaginal, anal, or oral mucous membranes
are preferably administered to vaginal, anal or oral mucosal
surfaces, respectively. However, nasal administration of the
chimeric immunogens can also induce robust secretory immune
responses from other mucous membranes. See, for example, Boyaka et
al., 2003, Cur. Pharm. Des. 9:1965-1972.
[0168] Mucosal administration of the chimeric immunogens of this
invention result in strong memory responses, both for IgA and IgG.
These memory responses can advantageously be boosted by
re-administering the chimeric immunogen after a period of time.
Such booster administrations can be administered either mucosally
or parenterally. The memory response can be elicited by
administering a booster dose more than a year after the initial
dose. For example, a booster dose can be administered about 12,
about 16, about 20 or about 24 months after the initial dose.
5.4. Polynucleotides Encoding Chimeric Immunogens
[0169] In another aspect, the invention provides polynucleotides
comprising a nucleotide sequence encoding a chimeric immunogen of
the invention. These polynucleotides are useful, for example, for
making the chimeric immunogens. In yet another aspect, the
invention provides an expression system that comprises a
recombinant polynucleotide sequence encoding a receptor binding
domain, a translocation domain, an optional ER retention domain,
and an insertion site for a polynucleotide sequence encoding a
heterologous antigen. The insertion site can be anywhere in the
polynucleotide sequence so long as the insertion does not disrupt
the receptor binding domain, the translocation domain, or the
optional ER retention domain. Preferably, the insertion site is
between the translocation domain and the ER retention domain. In
other equally preferred embodiments, the insertion site is in the
ER retention domain.
[0170] In certain embodiments, the recombinant polynucleotides are
based on polynucleotides encoding PE, or portions or derivatives
thereof. In other embodiments, the recombinant polynucleotides are
based on polynucleotides that hybridize to a polynucleotide that
encodes PE under stringent hybridization conditions. A nucleotide
sequence encoding PE is presented as SEQ ID NO.:9. This sequence
can be used to prepare PCR primers for isolating a nucleic acid
that encodes any portion of this sequence that is desired. For
example, PCR can be used to isolate a nucleic acid that encodes one
or more of the functional domains of PE. A nucleic acid so isolated
can then be joined to nucleic acids encoding other functional
domains of the chimeric immunogens using standard recombinant
techniques.
[0171] Other in vitro methods that can be used to prepare a
polynucleotide encoding PE, PE domains, or any other functional
domain useful in the chimeric immunogens of the invention include,
but are not limited to, reverse transcription, the polymerase chain
reaction (PCR), the ligase chain reaction (LCR), the
transcription-based amplification system (TAS), the self-sustained
sequence replication system (3SR) and the QP replicase
amplification system (QB). Any such technique known by one of skill
in the art to be useful in construction of recombinant nucleic
acids can be used. For example, a polynucleotide encoding the
protein or a portion thereof can be isolated by polymerase chain
reaction of cDNA using primers based on the DNA sequence of PE or
another polynucleotide encoding a receptor binding domain.
[0172] Guidance for using these cloning and in vitro amplification
methodologies are described in, for example, U.S. Pat. No.
4,683,195; Mullis et al., 1987, Cold Spring Harbor Symp. Quant.
Biol. 51:263; and Erlich, ed., 1989, PCR Technology, Stockton
Press, NY. Polynucleotides encoding a chimeric immunogen or a
portion thereof also can be isolated by screening genomic or cDNA
libraries with probes selected from the sequences of the desired
polynucleotide under stringent, moderately stringent, or highly
stringent hybridization conditions.
[0173] Construction of nucleic acids encoding the chimeric
immunogens of the invention can be facilitated by introducing an
insertion site for a nucleic acid encoding the heterologous antigen
into the construct. In certain embodiments, an insertion site for
the heterologous antigen can be introduced between the nucleotides
encoding the cysteine residues of domain Ib. In other embodiments,
the insertion site can be introduced anywhere in the nucleic acid
encoding the immunogen so long as the insertion does not disrupt
the functional domains encoded thereby. In certain embodiments, the
insertion site can be in the ER retention domain. In certain
embodiments, the insertion site is introduced into the nucleic acid
encoding the chimeric immunogen. In other embodiments, the nucleic
acid comprising the insertion site can replace a portion of the
nucleic acid encoding the immunogen, as long as the replacement
does not disrupt the receptor binding domain or the translocation
domain.
[0174] In more specific embodiments, the insertion site comprises
that includes a cloning site cleaved by a restriction enzyme. In
certain embodiments, the cloning site can be recognized and cleaved
by a single restriction enzyme, for example, by PstI. In such
examples, a polynucleotide encoding heterologous antigen that is
flanked by PstI sequences can be inserted into the vector. In other
embodiments, the insertion site comprises a polylinker that
comprises about one, about two, about three, about four, about
five, about ten, about twenty or more cloning sites, each of which
can be cleaved by one or more restriction enzymes.
[0175] Further, the polynucleotides can also encode a secretory
sequence at the amino terminus of the encoded chimeric immunogen.
Such constructs are useful for producing the chimeric immunogens in
mammalian cells as they simplify isolation of the immunogen.
[0176] Furthermore, the polynucleotides of the invention also
encompass derivative versions of polynucleotides encoding a
chimeric immunogen. Such derivatives can be made by any method
known by one of skill in the art without limitation. For example,
derivatives can be made by site-specific mutagenesis, including
substitution, insertion, or deletion of one, two, three, five, ten
or more nucleotides, of polynucleotides encoding the chimeric
immunogen. Alternatively, derivatives can be made by random
mutagenesis. One method for randomly mutagenizing a nucleic acid
comprises amplifying the nucleic acid in a PCR reaction in the
presence of 0.1 mM MnCl.sub.2 and unbalanced nucleotide
concentrations. These conditions increase the misincorporation rate
of the polymerase used in the PCR reaction and result in random
mutagenesis of the amplified nucleic acid.
[0177] Several site-specific mutations and deletions in chimeric
molecules derived from PE have been made and characterized. For
example, deletion of nucleotides encoding amino acids 1-252 of PE
yields a construct referred to as "PE40." Deleting nucleotides
encoding amino acids 1-279 of PE yields a construct referred to as
"PE37." See U.S. Pat. No. 5,602,095. In both of these constructs,
the receptor binding domain of PE, i.e., domain Ia, has been
deleted. Nucleic acids encoding a receptor binding domain can be
ligated to these constructs to produce chimeric immunogens that are
targeted to the cell surface receptor recognized by the receptor
binding domain. Of course, these constructs are particularly useful
for expressing chimeric immunogens that have a receptor binding
domain that is not domain Ia of PE. The constructs can optionally
encode an amino-terminal methionine to assist in expression of the
construct. In certain embodiments, the receptor binding domain can
be ligated to the 5' end of the polynucleotide encoding the
translocation domain and optional ER retention domain. In other
embodiments, the polynucleotide can be inserted into the constructs
in the nucleotide sequence encoding the ER retention domain.
[0178] Other nucleic acids encoding mutant forms of PE that can be
used as a source of nucleic acids for constructing the chimeric
immunogens of the invention include, but are not limited to,
PE.DELTA.553 and those described in U.S. Pat. Nos. 5,602,095;
5,512,658 and 5,458,878, and in Vasil et al., 1986, Infect.
Immunol. 52:538-48.
[0179] Accordingly, in certain aspects, the invention provides a
polynucleotide that encodes a chimeric immunogen that comprises a
receptor binding domain, a translocation domain, and a Pseudomonas
pilin peptide that comprises an amino acid sequence that is
TAADGLWKCTSDQDEQFIPKGCSK (SEQ ID NO.:1). In certain embodiments,
the chimeric immunogen, when administered to a subject, induces an
immune response in the subject that is effective to reduce
adherence of a microorganism that expresses the Pseudomonas pilin
peptide to epithelial cells of the subject. In certain embodiments,
the chimeric immunogen, when administered to the subject, generates
an immune response in the subject that reduces the cytotoxicity of
Pseudomonas exotoxin A.
[0180] In certain embodiments, polynucleotide encodes a chimeric
immunogen further comprising an endoplasmic reticulum retention
domain. In further embodiments, the Pseudomonas pilin peptide is
located between the translocation domain and the endoplasmic
reticulum retention domain. In certain embodiments, the endoplasmic
reticulum retention domain is an enzymatically-inactive domain III
of Pseudomonas exotoxin A. In certain embodiments, the
enzymatically inactive domain III of Pseudomonas exotoxin A is
inactivated by deleting a glutamate at position 553. In certain
embodiments, the endoplasmic reticulum retention domain comprises
an amino acid sequence that is selected from the group of RDEL (SEQ
ID NO.:2) or KDEL (SEQ ID NO.:3) that is sufficiently near the
C-terminus of said endoplasmic reticulum retention domain to result
in retention of said chimeric immunogen in the endoplasmic
reticulum.
[0181] In certain embodiments, the polynucleotide encodes a
translocation domain that is selected from the group consisting
translocation domains from Pseudomonas exotoxin A, diptheria toxin,
pertussis toxin, cholera toxin, heat-labile E. coli enterotoxin,
shiga toxin, and shiga-like toxin. In certain embodiments, the
translocation domain is domain II of Pseudomonas exotoxin A. In
further embodiments, the translocation domain comprises amino acids
280 to 364 of domain II of Pseudomonas exotoxin A.
[0182] In certain embodiments, the polynucleotide encodes a
chimeric immunogen that comprises more than one of the Pseudomonas
pilin peptides.
[0183] In certain embodiments, the polynucleotide encodes a
receptor binding domain that is selected from the group consisting
of domain Ia of Pseudomonas exotoxin A; a receptor binding domains
from cholera toxin, diptheria toxin, shiga toxin, or shiga-like
toxin; a monoclonal antibody, a polyclonal antibody, or a
single-chain antibody; TGF.alpha., TGF.beta., EGF, PDGF, IGF, or
FGF; IL-1, IL-2, IL-3, or IL-6; and MIP-1a, MIP-1b, MCAF, or IL-8.
In certain embodiments, the receptor binding domain is domain Ia of
Pseudomonas exotoxin A. In further embodiments, the domain Ia of
Pseudomonas exotoxin A has an amino acid sequence that is SEQ ID
NO.:4.
[0184] In certain embodiments, the receptor binding domain binds to
.alpha.2-macroglobulin receptor, epidermal growth factor receptor,
transferrin receptor, interleukin-2 receptor, interleukin-6
receptor, interleukin-8 receptor, Fc receptor, poly-IgG receptor,
asialoglycopolypeptide receptor, CD3, CD4, CD8, chemokine receptor,
CD25, CD11B, CD11C, CD80, CD86, TNF.alpha. receptor, TOLL receptor,
M-CSF receptor, GM-CSF receptor, scavenger receptor, or VEGF
receptor. In certain embodiments, the receptor binding domain binds
to .alpha.2-macroglobulin receptor.
[0185] In certain embodiments, the polynucleotide encodes a
chimeric immunogen that has an amino acid sequence that is SEQ ID
NO.:5. In other embodiments, the polynucleotide hybridizes under
stringent hybridization conditions to a polynucleotide that encodes
a chimeric immunogen has an amino acid sequence that is SEQ ID
NO.:5
5.5. Expression Vectors
[0186] In still another aspect, the invention provides expression
vectors for expressing the chimeric immunogens. Generally,
expression vectors are recombinant polynucleotide molecules
comprising expression control sequences operatively linked to a
nucleotide sequence encoding a polypeptide. Expression vectors can
readily be adapted for function in prokaryotes or eukaryotes by
inclusion of appropriate promoters, replication sequences,
selectable markers, etc. to result in stable transcription and
translation of mRNA. Techniques for construction of expression
vectors and expression of genes in cells comprising the expression
vectors are well known in the art. See, e.g. Sambrook et al., 2001,
Molecular Cloning--A Laboratory Manual, 3.sup.rd edition, Cold
Spring Harbor Laboratory, Cold Spring Harbor, N.Y., and Ausubel et
al., eds., Current Edition, Current Protocols in Molecular Biology,
Greene Publishing Associates and Wiley Interscience, NY.
[0187] Useful promoters for use in expression vectors include, but
are not limited to, a metallothionein promoter, a constitutive
adenovirus major late promoter, a dexamethasone-inducible MMTV
promoter, a SV40 promoter, a MRP pol III promoter, a constitutive
MPSV promoter, a tetracycline-inducible CMV promoter (such as the
human immediate-early CMV promoter), and a constitutive CMV
promoter.
[0188] The expression vectors should contain expression and
replication signals compatible with the cell in which the chimeric
immunogens are expressed. Expression vectors useful for expressing
chimeric immunogens include viral vectors such as retroviruses,
adenoviruses and adenoassociated viruses, plasmid vectors, cosmids,
and the like. Viral and plasmid vectors are preferred for
transfecting the expression vectors into mammalian cells. For
example, the expression vector pcDNA1 (Invitrogen, San Diego,
Calif.), in which the expression control sequence comprises the CMV
promoter, provides good rates of transfection and expression into
such cells.
[0189] The expression vectors can be introduced into the cell for
expression of the chimeric immunogens by any method known to one of
skill in the art without limitation. Such methods include, but are
not limited to, e.g., direct uptake of the molecule by a cell from
solution; facilitated uptake through lipofection using, e.g.,
liposomes or immunoliposomes; particle-mediated transfection; etc.
See, e.g., U.S. Pat. No. 5,272,065; Goeddel et al., eds, 1990,
Methods in Enzymology, vol. 185, Academic Press, Inc., CA; Krieger,
1990, Gene Transfer and Expression--A Laboratory Manual, Stockton
Press, NY; Sambrook et al., 1989, Molecular Cloning--A Laboratory
Manual, Cold Spring Harbor Laboratory, NY; and Ausubel et al.,
eds., Current Edition, Current Protocols in Molecular Biology,
Greene Publishing Associates and Wiley Interscience, NY.
[0190] The expression vectors can also contain a purification
moiety that simplifies isolation of the protein. For example, a
polyhistidine moiety of, e.g., six histidine residues, can be
incorporated at the amino terminal end of the protein. The
polyhistidine moiety allows convenient isolation of the protein in
a single step by nickel-chelate chromatography. In certain
embodiments, the purification moiety can be cleaved from the
remainder of the chimeric immunogen following purification. In
other embodiments, the moiety does not interfere with the function
of the functional domains of the chimeric immunogen and thus need
not be cleaved.
5.6. Cell for Expressing a Chimeric Immunogen
[0191] In yet another aspect, the invention provides a cell
comprising an expression vector for expression of the chimeric
immunogens, or portions thereof. The cell is preferably selected
for its ability to express high concentrations of the chimeric
immunogen to facilitate purification of the protein. In certain
embodiments, the cell is a prokaryotic cell, for example, E. coli.
As described in the examples, the chimeric immunogens are properly
folded and comprise the appropriate disulfide linkages when
expressed in E. coli.
[0192] In other embodiments, the cell is a eukaryotic cell. Useful
eukaryotic cells include yeast and mammalian cells. Any mammalian
cell known by one of skill in the art to be useful for expressing a
recombinant polypeptide, without limitation, can be used to express
the chimeric immunogens. For example, Chinese hamster ovary (CHO)
cells can be used to express the chimeric immunogens.
5.7. Vaccines Comprising Chimeric Immunogens
[0193] In yet another aspect, the invention provides vaccines
comprising one or more chimeric immunogens. The vaccines are useful
for eliciting a protective immune response against the heterologous
antigen, particularly against pathogens or cells bearing the
heterologous antigen. A vaccine can include one or a plurality of
chimeric immunogens. For example, a vaccine can include chimeric
immunogens with heterologous antigens from several circulating
strains of a pathogen. As the pathogen changes, additional chimeric
immunogens can be constructed that include the altered antigens,
for example, from breakthrough viruses.
[0194] 5.7.1. Vaccine Compositions
[0195] The vaccines of the invention can be formulated as
compositions. The compositions are generally formulated
appropriately for the immediate use intended for the vaccine. For
example, if the vaccine is not to be administered immediately, the
vaccine can be formulated in a composition suitable for storage.
One such composition is a lyophilized preparation of the vaccine
together with a suitable stabilizer. Alternatively, the vaccine
composition can be formulated for storage in a solution with one or
more suitable stabilizers. Any such stabilizer known to one of
skill in the art without limitation can be used. For example,
stabilizers suitable for lyophilized preparations include, but are
not limited to, sugars, salts, surfactants, proteins, chaotropic
agents, lipids, and amino acids. Stabilizers suitable for liquid
preparations include, but are not limited to, sugars, salts,
surfactants, proteins, chaotropic agents, lipids, and amino acids.
Specific stabilizers than can be used in the compositions include,
but are not limited to trehalose, serum albumin,
phosphatidylcholine, lecithin, and arginine. Other compounds,
compositions, and methods for stabilizing a lyophilized or liquid
preparation of the delivery constructs may be found, for example,
in U.S. Pat. Nos. 6,573,237, 6,525,102, 6,391,296, 6,255,284,
6,133,229, 6,007,791, 5,997,856, and 5,917,021.
[0196] Further, the vaccine compositions of the invention can be
formulated for administration to a subject. The formulation can be
suitable for administration to a nasal, oral, vaginal, rectal, or
other mucosal surface. Such vaccine compositions generally comprise
one or more chimeric immunogens of the invention and a
pharmaceutically acceptable excipient, diluent, carrier, or
vehicle. Any such pharmaceutically acceptable excipient, diluent,
carrier, or vehicle known to one of skill in the art without
limitation can be used. Examples of a suitable excipient, diluent,
carrier, or vehicle can be found in Remington's Pharmaceutical
Sciences, 19th Ed. 1995, Mack Publishing Co., Easton.
[0197] In certain embodiments, the vaccine compositions comprise
about 1, about 5, about 10, about 20, about 30, about 40, or about
50 mM sodium chloride. Pseudomonas appears to bind epithelial cells
via the pilin-asialo-GM1 interaction more efficiently in
environments comprising 100 mM NaCl. By reducing the salt
concentration, the chimeric immunogen is believed to be more likely
to bind to an epithelial cell through its receptor binding domain
rather through a pilin-asialo-GM1 interaction. By increasing the
proportion bound via the receptor binding domain, a higher
concentration of immunogen is delivered to the bloodstream of the
subject.
[0198] The vaccine compositions can also include an adjuvant that
potentiates an immune response when used in administered in
conjunction with the chimeric immunogen. Useful adjuvants,
particularly for administration to human subjects, include, but are
not limited to, alum, aluminum hydroxide, aluminum phosphate,
CpG-containing oligonucleotides (both methylated and unmethylated),
bacterial nucleic acids, lipopolysaccharide and lipopolysaccharide
derivatives such as monophosphoryl lipid A, oil-in-water emulsions,
etc. Other suitable adjuvants are described in Sheikh et al., 2000,
Cur. Opin. Mol. Ther. 2:37-54. Adjuvants are most useful when the
vaccine composition is to be injected rather than administered to a
mucosal membrane of the subject. However, certain of the above
adjuvants are also known in the art to be useful in compositions to
be administered to mucosal surface.
[0199] In certain embodiments, the vaccine compositions are
formulated for oral administration. In such embodiments, the
vaccine compositions are formulated to protect the chimeric
immunogen from acid and/or enzymatic degradation in the stomach.
Upon passage to the neutral to alkaline environment of the
duodenum, the chimeric immunogen then contacts a mucous membrane
and is transported across the polarized epithelial membrane. The
delivery constructs may be formulated in such compositions by any
method known by one of skill in the art, without limitation.
[0200] In certain embodiments, the oral formulation comprises a
chimeric immunogen and one or more compounds that can protect the
chimeric immunogen while it is in the stomach. For example, the
protective compound should be able to prevent acid and/or enzymatic
hydrolysis of the chimeric immunogen. In certain embodiments, the
oral formulation comprises a chimeric immunogen and one or more
compounds that can facilitate transit of the immunogen from the
stomach to the small intestine. In certain embodiments, the one or
more compounds that can protect the chimeric immunogen from
degradation in the stomach can also facilitate transit of the
immunogen from the stomach to the small intestine. Preferably, the
oral formulation comprises one or more compounds that can protect
the chimeric immunogen from degradation in the stomach and
facilitate transit of the immunogen from the stomach to the small
intestine. For example, inclusion of sodium bicarbonate can be
useful in facilitating the rapid movement of intra-gastric
delivered materials from the stomach to the duodenum as described
in Mrsny et al., 1999, Vaccine 17:1425-1433.
[0201] Other methods for formulating compositions so that the
chimeric immunogens can pass through the stomach and contact
polarized epithelial membranes in the small intestine include, but
are not limited to, enteric-coating technologies as described in
DeYoung, 1989, Int J Pancreatol. 5 Suppl:31-6, and the methods
provided in U.S. Pat. Nos. 6,613,332, 6,174,529, 6,086,918,
5,922,680, and 5,807,832.
[0202] Accordingly, in certain aspects, the invention provides a
composition comprising a chimeric immunogen that comprises a
receptor binding domain, a translocation domain, and a Pseudomonas
pilin peptide that has an amino acid sequence that is
TAADGLWKCTSDQDEQFIPKGCSK (SEQ ID NO.:1). In certain embodiments,
the chimeric immunogen, when administered to a subject, induces an
immune response in the subject that is effective to reduce
adherence of a microorganism that expresses the Pseudomonas pilin
peptide to epithelial cells of the subject. In certain embodiments,
the chimeric immunogen, when administered to a subject, induces an
immune response in the subject that reduces cytotoxicity of
Pseudomonas exotoxin A.
[0203] In certain embodiments, the composition further comprises a
pharmaceutically acceptable diluent, excipient, vehicle, or
carrier. In certain embodiments, the composition is formulated for
nasal or oral administration.
[0204] 5.7.2. Dosage
[0205] Generally, a pharmaceutically effective amount of the
vaccine compositions of the invention is administered to a subject.
The skilled artisan can readily determine if the dosage of the
vaccine composition is sufficient to elicit an immune response by
monitoring the immune response so elicited, as described below. In
certain embodiments, an amount of vaccine composition corresponding
to between about 1 .mu.g and about 1000 .mu.g of chimeric immunogen
is administered. In other embodiments, an amount of vaccine
composition corresponding to between about 10 .mu.g and about 500
.mu.g of chimeric immunogen is administered. In still other
embodiments, an amount of vaccine composition corresponding to
between about 10 .mu.g and about 250 .mu.g of chimeric immunogen is
administered. In yet other embodiments, an amount of vaccine
composition corresponding to between about 10 .mu.g and about 100
.mu.g of chimeric immunogen is administered. In still other
embodiments, an amount of vaccine composition corresponding to
about 40 .mu.g of chimeric immunogen is administered. In still
other embodiments, an amount of vaccine composition corresponding
to about 200 .mu.g of chimeric immunogen is administered. In still
other embodiments, an amount of vaccine composition corresponding
to about 1000 .mu.g of chimeric immunogen is administered.
Preferably, an amount of vaccine composition corresponding to
between about 10 .mu.g and about 50 .mu.g of chimeric immunogen is
administered. Further guidance on selecting an effective dose of
the vaccine compositions may be found, for example, in Rose and
Friedman, 1980, Manual of Clinical Immunology, American Society for
Microbiology, Washington, D.C.
[0206] The volume of vaccine composition administered will
generally depend on the concentration of chimeric immunogen and the
formulation of the composition. In certain embodiments, a unit dose
of the vaccine is between about 0.05 ml and about 1 ml, preferably
about 0.5 ml. The vaccine compositions can be prepared in dosage
forms containing between 1 and 50 doses (e.g., 0.5 ml to 25 ml),
more usually between 1 and 10 doses (e.g., 0.5 ml to 5 ml)
[0207] The vaccine compositions of the invention can be
administered in one dose or in multiple doses. A dose can be
followed by one or more doses spaced by about 4 to about 8 weeks,
by about 1 to about 3 months, or by about 1 to about 6 months.
Additional booster doses can be administered as needed. In certain
embodiments, booster doses are administered in about 1 to about 10
years.
[0208] 5.7.3. Administration of Vaccine Compositions
[0209] The vaccine compositions of the invention can be
administered to a subject by any method known to one of skill in
the art. In certain embodiments, the vaccine compositions are
contacted to a mucosal membrane of the subject. In other
embodiments, the vaccine compositions are injected into the
subject. By selecting one of these methods of administering the
vaccine compositions, a skilled artisan can modulate the immune
response that is elicited. These methods are described extensively
below.
[0210] Thus, in certain embodiments, the vaccine compositions are
contacted to a mucosal membrane of a subject. Any mucosal membrane
known by one of skill in the art, without limitation, can be the
target of such administration. For example, the mucosal membrane
can be present in the eye, nose, mouth, lungs, esophagus, stomach,
small intestine, large intestine, rectum, anus, vagina, or penis of
the subject. Preferably, the mucosal membrane is a nasal mucous
membrane.
[0211] In other embodiments, the vaccine composition is delivered
by injection. The vaccine composition can be injected
subcutaneously or intramuscularly. In such embodiments, the vaccine
composition preferably comprises an adjuvant, as described
above.
[0212] 5.7.4. Kits Comprising Vaccine Compositions
[0213] In yet another aspect, the invention provides a kit
comprising a vaccine composition of the invention. In certain
embodiments, the kit further comprises instructions directing a
medical professional to administer the vaccine composition to a
subject to be vaccinated. In further embodiments, the instructions
direct the medical professional to administer the vaccine
composition of a mucous membrane of the subject to be
vaccinated.
5.8. Making and Testing the Chimeric Immunogens
[0214] The chimeric immunogens of the invention are preferably
produced recombinantly, as described below. However, the chimeric
immunogens may also be produced by chemical synthesis using methods
known to those of skill in the art. Alternatively, the chimeric
immunogens can be produced using a combination of recombinant and
synthetic methods.
[0215] 5.8.1. Manufacture of Chimeric Immunogens
[0216] Methods for expressing and purifying the chimeric immunogens
of the invention are described extensively in the examples below.
Generally, the methods comprise introducing an expression vector
encoding the chimeric immunogen into a cell that can express the
chimeric immunogen from the vector. The chimeric immunogen can then
be purified for administration to a subject following expression of
the immunogen.
[0217] 5.8.2. Verification of Chimeric Immunogens
[0218] Having selected the domains of the chimeric immunogen, the
function of these domains, and of the chimeric immunogens as a
whole, can routinely be tested to ensure that the immunogens can
induce the desired immune response. For example, the chimeric
immunogens can be tested for cell recognition, cytosolic
translocation and immunogenicity using routine assays. The entire
chimeric protein can be tested, or, the function of various domains
can be tested by substituting them for native domains of the
wild-type toxin.
[0219] 5.8.2.1. Receptor Binding/Cell Recognition
[0220] Receptor binding domain function can be tested by monitoring
the chimeric immunogen's ability to bind to the target receptor.
Such testing can be accomplished using cell-based assays, with the
target receptor present on a cell surface, or in cell-free assays.
For example, chimeric immunogen binding to a target can be assessed
with affinity chromatography. The chimera can be attached to a
matrix in an affinity column, and binding of the receptor to the
matrix detected, or vice versa. Alternatively, if antibodies have
been identified that bind to either the receptor binding domain or
its cognate receptor, the antibodies can be used, for example, to
detect the receptor binding domain in the chimeric immunogen by
immunoassay, or in a competition assay for the cognate receptor. An
exemplary cell-based assay that detects chimeric immunogen binding
to receptors on cells comprises labeling the chimera and detecting
its binding to cells by, e.g., fluorescent cell sorting,
autoradiography, etc.
[0221] 5.8.2.2. Translocation
[0222] The function of the translocation domain can be tested as a
function of the chimeric immunogen's ability to gain access to the
interior of a cell. Because access first requires binding to the
cell, these assays can also be used to assess the function of the
cell recognition domain.
[0223] The chimeric immunogen's ability to enter the cell can be
assessed, for example, by detecting the physical presence of the
chimera in the interior of the cell. For example, the chimeric
immunogen can be labeled with, for example, a fluorescent marker,
and the chimeric immunogen exposed to the cell. Then, the cells can
be washed, removing any chimeric immunogen that has not entered the
cell, and the amount of label remaining determined. Detecting the
label in this fraction indicates that the chimeric immunogen has
entered the cell.
[0224] 5.8.2.3. ER Retention and Translocation to the Cytosol
[0225] A related assay can be used to assess the ability of the
chimeric immunogen to traffic to the ER and from there into the
cytosol of a cell. In such assays, the chimeric immunogen can be
labeled with, for example, a fluorescent marker, and the chimeric
immunogen exposed to the cell. The cells can then be washed and
treated to liberate the cellular contents. The cytosolic fraction
of this preparation can then be isolated and assayed for the
presence of the label. Detecting the label in this fraction
indicates that the chimeric immunogen has entered the cytosol.
[0226] In another method, the ability of the translocation domain
and ER retention domain to effect translocation to the cytosol can
be tested with a construct containing a domain III having ADP
ribosylation activity. Briefly, cells expressing a receptor to
which the construct binds are seeded in tissue culture plates and
exposed to the chimeric protein or to an engineered PE exotoxin
containing the modified translocation domain or ER retention
sequence in place of the native domains. ADP ribosylation activity
can be determined as a function of inhibition of protein synthesis
by, e.g., monitoring the incorporation of 3H-leucine.
[0227] 5.8.2.4. Immunogen
[0228] The ability of the chimeric immunogens to elicit an immune
response against the heterologous antigen can be assessed by
determining the chimeric immunogen's immunogenicity. Both humoral
and cell-mediated immunogenicity can be assessed. For example, a
humoral immune response can tested by inoculating an animal with
the chimeric immunogen and detecting the production of antibodies
specific for the heterologous immunogen with a suitable
immunoassay. Such detection is well within the ordinary skill of
those in the art.
[0229] In addition, cell-mediated immunogenicity can be tested by
immunizing an animal with the chimeric immunogen, isolating
cytotoxic T cells from the animal, and detecting their ability to
kill cells whose MHC Class I molecules bear peptides sharing amino
acid sequences with the heterologous antigen. This assay can also
be used to test the activity of the cell recognition domain, the
translocation domain and the ER retention domain because generation
of a cell mediated response requires binding of the chimera to the
cell, trafficking to the ER, and translocation to the cytosol.
6. EXAMPLES
[0230] The following examples merely illustrate the invention, and
are not intended to limit the invention in any way.
6.1. Construction of a Chimeric Immunogen Expression Vector
[0231] A chimeric immunogen expression vector, ntPEpilinPAK was
generated in a multistep process. A 78-bp DNA oligonucleotide
duplex encoding the desired 24 amino acids of the PAK strain pilin
protein of Ps. aeruginosa was digested with SpeI and ApaI and gel
purified (Qiagen Inc., Valencia, Calif.). A DNA fragment of PE
encoding amino acids 1-360 was generated by PCR using
pPE64pST.DELTA.553 as a template. See Hertle et al., 2001, Infect.
Immun. 69(15): 6962-6969. The PCR fragment was digested with
HindIII and SpeI and gel purified (Qiagen Inc., Valencia, Calif.).
The two purified fragments, the pilin oligoduplex and PCR-fragment,
were ligated into the HindIII-ApaI site of pPF64pST.DELTA.553.
Incorporation of this DNA resulted in the destruction of the PstI
restriction site and introduction of a unique SpeI site. The final
construct, termed pPilinovax-A, and its correct orientation of the
insert were verified by restriction enzyme digestion.
[0232] In addition, a toxic form of this chimera, PEpilinPAK, was
constructed by ligating the pilin oligonucleotide duplex and PCR
fragment in to the HindIII-ApaI site of pPE64-PstI, and was
verified by restriction enzyme digestion.
6.2. Expression of a Chimeric Immunogen
[0233] E. coli DH5.alpha. cells (Gibco/BRL) were transformed using
a standard heat-shock method in the presence of the appropriate
plasmid to generate ntPEpilinPAK, PEpilinPAK or native Ps.
aeruginosa exotoxin A (PE). Transformed cells, selected on
antibiotic-containing media, were isolated and grown in
Luria-Bertani broth (Difco: Becton Dickinson, Franklin Lakes, N.J.)
with antibiotic and induced for protein expression by the addition
of 1 mM isopropyl-D-thiogalactopyranoside (IPTG). Two hours
following IPTG induction, cells were harvested by centrifugation at
5000 rpm. Inclusion bodies were isolated following cell lysis and
proteins were solubilized in 6M guanidine HCl and 2 mM EDTA (pH
8.0) plus 65 mM dithioerythreitol. Following refolding and
purification, as previously described (Buchner et al., 1992, Anal.
Biochem. 205:263-70; Hertle et al., 2001. Infect. Immun. 69(15):
6962-6969), proteins were stored in PBS (pH 7.4) lacking Ca.sup.2+
and Mg.sup.2+ at -80.degree. C.
6.3. Expression and Purification of Pseudomonas Pilin Protein
[0234] Pilin protein was isolated from PAK strain Ps. aeruginosa
grown overnight in Luria-Bertani broth (Difco) at 37.degree. C. at
75 rpm in a rotary shaker to an optical density at 600 nm (OD600)
of 0.6. Bacteria were pelleted at 6,000 rpm for 10 min at room
temperature, resuspended in PBS and vortexed aggressively 6 times
for 15 sec with 10 sec rests. Bacteria were pelleted at
12,000.times.g for 10 min and the supernatant containing sheared
pili was overnight against 10 mM sodium acetate (pH 4.5) and
isolated using SP ion exchange column (HiTrap.TM. SP HP; Amersham
Biosciences, USA) and eluted with 200 mM NaCl.
6.4. Characterization of a Chimeric Immunogen
[0235] The chimeric immunogen ntPEpilinPAK was prepared by
genetically grafting the terminal 24 amino acids of the Ps.
aeruginosa PAK strain pilin protein in place of 20 amino acids
normally present in ntPE (FIG. 1) as described above. Purified
proteins used in these studies were assessed by size-exclusion
chromatography using a ZORBAX.RTM. GF-450 column (Agilent
Technologies, Palo Alto, Calif.) and demonstrated to be greater
than 95% monomeric. Purified ntPEpilinPAK, isolated from inclusion
bodies and renatured in a redox shuffling buffer protocol as
described above, had the anticipated molecular weight of .about.68
kDa, similar to that observed for similarly purified and refolded
ntPE (FIG. 2A). Additionally, isolated ntPEpilinPAK used in the
experiments described herein was determined to have the anticipated
mass and composition using amino acid analysis and SDS-PAGE, an
isoelectric point of .about.5.1, the correct N-terminal sequence,
6.5 ng host cell protein/mg ntPEpilinPAK, <2 pg host cell DNA/mg
ntPEpilinPAK, and .about.6.3 EU endotoxin/mg ntPEpilinPAK. A
monoclonal antibody that recognized the C-terminal loop of PAK
pilin also recognized ntPEpilin PAK (FIG. 2B) suggesting a
near-native conformational form of the inserted C-terminal pilin
loop.
[0236] Cytotoxicity due to inhibition of protein synthesis was
examined by exposing L929 (ATCC CCL-1) cells to PE as described
previously. See Ogata et al., 1990, J. Biol. Chem. 265:20678-85.
Incubation of PE-sensitive L929 cells with either PE or PEpilinPAK
produced similar toxicity profiles (FIG. 3), suggesting that
modifications made in the ntPE framework to accommodate pilin PAK
sequence elements did not produce untoward perturbation of native
toxin structure and function related to cellular uptake and
intracellular processing. This assay was also used to demonstrate a
complete lack of cytotoxicity by ntPEpilinPAK (FIG. 3).
6.5. Vaccination Using a Chimeric Immunogen
[0237] Eight/group BALB/c mice (Charles River Laboratories,
Wilmington, Mass.), 6-8 weeks at initial dosing, were used in these
studies since age-related suppression of immune function has been
demonstrated in this species. See Linton & Dorshkind, 2004,
Nat. Immunol. 5:133-9. Intranasal inoculation was performed to mice
lightly anesthetized with isoflurane. All intranasal (IN)
administrations were performed under mild anesthesia since fluid
introduced into the nares of awake mice that is in excess of its
cavity volume is rapidly ingested while suppression of this reflex
occurs under anesthesia. Thus, administration to anesthetized mice
results in preferential delivery to the trachea rather than the
esophagus following IN administration. See Janakova et al., 2002,
Infect. Immun. 70:5479-84. Mice received 10 .mu.l of ntPE-pilin (5
.mu.l/nares) in PBS for each immunization. Variations in
concentration from 100 .mu.g/ml to 10 mg/ml were prepared for
dosing studies to assess immune responses over the range of 1 to
100 .mu.g of ntPE-pilin.
[0238] Mice receiving an IN inoculation dose schedule of 0, 7, 14,
and 28 days with 1, 10 or 100 .mu.g ntPEpilinPAK were evaluated for
mucosal and systemic humoral immune responses, with similar IN
delivery of PBS to mice serving as a negative control. Animals
receiving a subcutaneous (SubQ) injection of 10 .mu.g ntPEpilinPAK
in a standard protocol using Freund's complete/incomplete adjuvant
materials served as a positive control.
[0239] IN administration of ntPEpilinPAK resulted in anti-vaccine
serum IgG responses at the lowest dose examined of 1 .mu.g (FIG.
5). Serum IgG responses achieved with 100 .mu.g IN were comparable
to that obtained by subQ injection of 10 .mu.g vaccine with a
Freund's adjuvant cocktail. Although in this particular study the
10 .mu.g group was not consistent with a dose-dependent immune
response, a dose-dependent response was typically observed.
Assessment of anti-vaccine IgG antibodies present in saliva samples
demonstrated detectable levels only in the 100 .mu.g IN and 10
.mu.g/Freund's subQ groups. These results suggest that IN
administration of ntPEpilinPAK can generate a potent anti-vaccine
systemic immune response that compare closely to those observed
using a subQ injection protocol involving a regime of
complete/incomplete Freund's adjuvant. Thus, IN dosing of
ntPEpilinPAK stimulated both mucosal (as demonstrated by
antigen-specific salivary IgA antibodies) and systemic immunity (as
demonstrated by antigen-specific serum IgG antibodies) in a
dose-dependent fashion and potent induction of immune outcomes was
achieved in mice with IN doses in the range of 10-100 .mu.g.
[0240] Efforts to measure anti-vaccine IgA antibodies in saliva
were compromised by the lack of an antibody that selectively
recognized mouse secretory IgA (sIgA) rather than serum IgA (FIG.
6). Using the secondary antibody determined to have the greatest
capacity to cross-react with sigA, salivary IgA antibodies specific
for ntPEpilinPAK could be observed only in the 100 .mu.g IN dosed
mouse group. No similar responses could be detected in either the 1
or 10 .mu.g IN dose groups or in the 10 .mu.g subQ group
administered with Freund's adjuvant. Assessment of anti-vaccine IgA
antibodies in serum similarly showed that only the 100 .mu.g IN
dose group generated detectable antibodies with these
characteristics. A detailed study of immune responses to Chlamydia
pneumoniae demonstrated that active infection resulted in
approximately 40-fold less pathogen-specific serum IgA antibodies
than serum IgG antibodies. See Wald et al., 2000, BMJ 321:204-7.
Although the ELISA assays used in our studies can not be directly
compared, mucosal immunization with 100 .mu.g ntPEpilinPAK produced
a similar relationship of observed serum IgG and serum IgA
responses.
[0241] Mucosal immunization with ntPEpilinPAK is believed to
provide immunity against both exotoxin A and the terminal pilin
loop domain of Ps. aeruginosa. Immune responses to ntPEpilinPAK
chimera should be dominated by antigenic epitopes present on ntPE
relative to the engrafted 24 amino acid domain from pilin. However,
much of the potential effectiveness of this vaccine approach
relates to blocking pilin-mediated bacteria-host cell interactions
that could occur at epithelial surfaces of the oral-pharyngeal
cavity and trachea. While the dominant IgA isotype in saliva was
assumed to represent sIgA resulting from active transport of
dimeric IgA following interaction with the poly Ig receptor, IgG
present in the saliva is presumed to exude from the serum. See Song
et al., 1994, Proc. Natl. Acad. Sci. U.S.A. 91:163-6 and Forrest et
al., 1991, Infect. Immun. 59:1206-9. Pilin-specific serum IgG
responses were detectable in both 100 .mu.g IN and 10 .mu.g
subQ/Freund's adjuvant groups, although the immune response
generated by injection also demonstrated a non-specific immune
response as demonstrated by increased recognition of a control
(scrambled) peptide used for this assay (FIG. 6).
[0242] The level of insert-specific systemic immunity demonstrated
in these studies was comparable to that previously observed using
an ntPE-based mucosal vaccine that incorporated the V3 loop of HIV
gp120 protein. See Mrsny et al., 1999, Vaccine 17:1425-33.
Additionally, anti-vaccine salivary IgA response was significantly
increased after three exposures but was not dramatically increased
by a fourth IN exposure, while increased serum IgG responses
recognizing synthetic PAK pilin peptide increased from the third to
the fourth IN dose. These results suggest that specific mucosal and
systemic immune responses can be achieved with ntPEpilinPAK after
only a few (e.g., one, two, three or four) IN exposures.
6.6. Isolation of Secreted Antibodies
[0243] Mouse saliva (typically 50-100 .mu.l) was collected over a
10 min period using a polypropylene Pasteur pipette following the
induction of hyper-salivation by an intra-peritoneal injection of
0.1 mg pilocarpine per animal. Serum samples (100 .mu.l) were
obtained using serum separators with blood collected from
periorbital bleeds. Serum and saliva samples were then aliquoted in
10 .mu.l volumes and stored at -70.degree. C. until analysis.
Secreted antibodies thus obtained were characterized in the assays
described below.
6.7. ELISA Assays
[0244] Antibodies against ntPEpilinPAK vaccine candidate were
measured by enzyme-linked immunosorbent assay (ELISA). Costar 9018
E.I.A./R.I.A. 96-well plates were coated overnight with 0.6
.mu.g/well of ntPEpilinPAK in 0.2M NaHCO.sub.3--Na.sub.2CO.sub.3,
pH 9.4. Each 96-well plate was washed four times with PBS
containing 0.05% Tween 20-0.01% thimerosal (wash buffer); and then
blocked for 1 h with PBS/Tween 20 containing 0.5% BSA-0.01%
thimerosal (assay buffer). Serum and saliva samples were diluted
with assay buffer, loaded onto a 96-well plate, and incubated for 2
h for serum IgG and overnight for saliva and serum IgA. Each
96-well plate was then washed four times with wash buffer, and
horseradish peroxidase ("HRP") conjugated goat anti-mouse serum IgG
(Pierce Chemical Company, Rockford, Ill.) or serum IgA (Kirkegaard
& Perry Laboratories, Gaithersburg, Md.) was added, then the
plates were incubated for 1 and 4 h, respectively. All incubation
and coating steps were performed at room temperature covered with
parafilm on a shaker at 4 rpm for the specified times. TMB
(3,3',5,5'tetramethylbenzidine), substrate for HRP, was used to
quantify bound antibody at 450 nm.
[0245] Specific immune responses against biotinylated pilin PAK
peptide were assessed by coating each plate overnight with 1
.mu.g/well of streptavidin. Pilin PAK peptide
(Biotin-KCTSDQDEQFIPKGCSK-NH.sub.2 SEQ ID NO:7) and scrambled
control peptide (Biotin-KCDDFKQGTQEPISCSK-NH.sub.2; SEQ ID NO:12)
were manufactured at SynPep (Dublin, Calif.). Each plate was then
blocked with assay buffer for 1 h, and 1 .mu.g/well of pilin PAK
and scrambled control peptides were added and incubated for 1 h.
The remainder of the ELISA procedure was performed as described
immediately above.
6.8. Pseudomonas Attachment Assays
[0246] PAK strain Pseudomonas aeruginosa (ATCC 53308) used for
adherence and detachment studies was carefully cultured to late log
phase to retain pili on bacterium. Briefly, PAK was grown overnight
in Luria Bertani broth (Difco; Becton Dickinson, Franklin Lakes,
N.J.) at 37.degree. C., 75 rpm rotary shaking to an optical density
at 600 nm (OD.sub.600) of 0.6, approximately 1.times.10.sup.9
colony forming units (Cfu) per ml. Bacteria was collected via
microfuge centrifugation at 6000 rpm for 10 min at room temperature
and resuspended in antibiotic-free Ham's F-12 media.
[0247] PAK was opsonized for 30 min at room temperature with rotary
shaking before adding to confluent layers of A549 cells at a
multiplicity of infection of 50. IN-immunized sera samples were
diluted to 1:100 or to various dose-dependent dilutions to assess
prophylactic abilities. Final volumes in each well were 200 .mu.l
following addition of bacteria and all reagents.
[0248] A549 (human lung epithelial-like carcinoma cells; ATCC
CCL-185) cells were maintained in Ham's F-12 medium (Ham's F12)
supplemented with 10% heat-inactivated fetal bovine serum (HI-FBS),
2.5 mM glutamine, 100 U/ml penicillin, and 100 .mu.g/ml
streptomycin in 5% CO.sub.2 at 37.degree. C. Cells were transferred
to antibiotic-free Ham's F-12 medium to seed in chamber slides or
electrode arrays for assays.
[0249] Ps. aeruginosa adherence to A549 cells was quantified as
follows. A549 cells were grown in Lab-Tek II 8-chamber slides
(Lab-Tek, USA) in antibiotic-free medium to a density of
approximately 1.times.10.sup.5 cells per chamber using culture
conditions described in Ogata et al., 1990, J. Biol. Chem.
265:20678-85. Spent media was removed before adding bacteria
opsonized with test samples. Chamber slides were incubated for 2 h
at 37.degree. C. and 5% CO.sub.2.
[0250] Cells were gently washed three times with Hanks' balanced
salt solution to remove unbound bacteria, fixed for 1 h in 3.7%
paraformaldehyde in phosphate buffered saline (PBS), pH 7.2, washed
twice with saline and stained with 10% Giemsa stain for 10 min.
After washing to remove excess Giemsa stain, adherent bacteria were
determined by counting cell-associated bacteria per 50 A549 cells
under light microscopy at 1000.times. magnification. All samples
were tested in duplicate.
[0251] In addition, quantitative real-time PCR was used to detect
and quantitate the presence of PAK bacteria adhering to A549 cells.
Supernatants were spun @5000.times.g for 5 min and aspirated. The
bacterial pellet was saved @-70.degree. C. until further
processing. Real-time detection of PCR was performed using the
Applied Biosystems 7300 Real Time PCR system (Applied Biosystems,
Foster City, Calif.). The differential displays of mRNAs for PAK
pilin was determined. Total RNA from bacteria was isolated
according to the RNeasy Protect Mini Kit (Qiagen). Total RNA was
used to generate cDNA for oligo dT oligodeoxynucleotide primer
(T12-18) following the protocol for Omniscript Reverse
Transcriptase (Qiagen). The following primers were designed using
Primer Express software (Applied Biosystems) and synthesized by
Operon (Alameda, Calif.): PAK pilin (forward):
AGGTACAGAGGACGCTACTAAGAAAGA (SEQ ID NO.:10); PAK pilin (reverse):
TCAGCAGGATCGGGTTTGA (SEQ ID NO:11). Equal amounts of cDNA were used
in duplicates and amplified with the SYBR Green I Master Mix
(Applied Biosystems). The thermal cycling parameters were as
follows: thermal activation for 10 min at 95.degree. C., and 40
cycles of PCR (melting for 15 s at 95.degree. C. and
annealing/extension for 1 min at 60.degree. C.). A standard curve
was constructed with a dilution curve (1:5, 1:10, 1:20, 1:40, 1:80,
1:160, 1:320, 1:640) of total RNA from PAK for PAK pilin. A "no
template control" was included with each PCR.
[0252] Cell-substrate detachment was measured using a non-invasive
electric cell-substrate impedance sensing (ECIS) method. See
Wegener et al., 2000, Exp. Cell. Res. 259:158-66. A549s were seeded
onto 8-well one electrode culture arrays (8W1E) (Applied
Biophysics, Troy, N.Y.), with a working electrode area of
5.times.10.sup.-4 cm.sup.2 and a counter electrode area of 0.15
cm.sup.2, in a humidified incubator at 37.degree. C. in 5%
CO.sub.2.
[0253] Cell attachment was monitored for 22 h to ensure confluent
lawns of approximately 1.times.10.sup.5 cells/well with a
resistance reading of 2-3 kOhms. Cells were further stabilized by
replenishing with fresh media for 2-3 h prior to introduction of
bacteria preparations and initiation of detachment monitored at 0.5
min timepoints, 40 kHz. Detachment assays were followed for 24 h
and values normalized to electrode check values at the start of the
experiment to 1.0.
[0254] Using these protocols, interaction of PAK strain Ps.
aeruginosa with A549 cell lawns through pilin-specific contacts was
assessed using increasing amounts of ntPEpilinPAK and a monoclonal
antibody (1D10) that recognizes the C-terminal pilin loop as a
control. Such increasing amounts of ntPEpilinPAK were able to
reduce the interaction of PAK strain Ps. aeruginosa with A549 cells
in this in vitro assay (FIG. 7A). Since this interaction was not
significantly disrupted by ntPE (lacking the pilin loop insert),
this assay described a pilin-dependent interaction between PAK
strain Ps. aeruginosa and A549 cells.
[0255] Saliva samples collected from ntPEpilinPAK-immunized mice
and diluted 1:100 in PBS were able to significantly decrease the
number of PAK strain Ps. aeruginosa that attached to A549 cell
lawns in vitro (FIG. 7B) and these data correlated with monoclonal
antibody-mediated disruption of these interactions. Inhibition of
binding exhibited a dose-dependency not only based upon the amount
of ntPEpilinPAK used for IN vaccination but also for dilution of
saliva samples obtained from IN immunized mice as evidenced by the
amount of bacteria not adhering to A549 cell lawns (FIG. 7C).
Importantly, a 1:100 dilution with PBS of saliva from mice in the
10 .mu.g subQ group administered with Freund's adjuvant also
blocked A549-Ps. aeruginosa interactions. Based upon measured
anti-vaccine and anti-pilin loop responses, it is believed that a
sIgA response was primarily responsible for protection elicited by
the IN dosed mice although this could not be verified due to
insufficient sIgA ELISA sensitivity. Similarly, while IgG exudates
from serum into saliva may have provided protective actions for the
subQ/Freund's adjuvant group, it is believed that sIgA in saliva
from these animals also participated in these observed
outcomes.
[0256] Also, an in vitro system that relies upon the tendency of
A549 to cells round up and lift from their substrate following
several hours of contact with a piliated PAK strain of Ps.
aeruginosa was used to assess the ability of saliva-samples from IN
immunized mice to prevent Ps. aeruginosa adherence to A549 cells.
In order to monitor this event we employed electric cell-substrate
impedance sensing (ECIS). This technique uses an electrode array to
continuously monitor cell-substrate interactions as described in
Wegener et al., 2000, Exp. Cell. Res. 259:158-66. Increasing
amounts of Ps. aeruginosa PAK strain, from 20-200 bacteria per A549
cell, demonstrated accelerated rates of cell lifting as
demonstrated by ECIS and corroborated by microscopic assessment.
Four hours following inoculation with 50 bacteria per A549 cell
there was extensive rounding of A549 cells and loss of epithelial
cell-substrate association characterized by reduction of resistive
properties of the system (FIG. 8). Simultaneous introduction of
saliva samples (diluted 1:100 with PBS) obtained from
ntPEpilinPAK-immunized mice blocked this Ps. aeruginosa-induced
A549 cell rounding and lifting event (FIG. 8). Although the exact
mechanism(s) involved in the lifting response observed in A549
cells remains obscure, such a morphological outcome is generally
associated with cytotoxic events and results obtained with saliva
from immunized mice suggests that disruption of pilin-mediated
interactions can reduce this detrimental event.
6.9. Exotoxin A Neutralization Assays
[0257] The ability of the secreted and serum antibodies induced as
described above to neutralize the protein synthesis inhibitory
activity of Pseudomonas exotoxin A was tested according to the
following protocol. A549 cells were grown in Dulbecco's modified
Eagle's medium F12 (DMEM F12) supplemented with 10% HI-FBS, 2.5 mM
glutamine, 100 U/ml penicillin, and 100 .mu.g/ml streptomycin in 5%
CO.sub.2 at 37.degree. C. Cell toxicity assays using A549 cells
were performed essentially as previously performed using L929
cells. Apoptosis was assessed by measuring caspase-3 activity
according to manufacturer's instructions. (ApoAlert Caspase-3
Colorimetric Assay Kit, BD, Frankin Lakes, N.J.).
[0258] Expression of some Ps. aeruginosa virulence factors might be
induced following pili-mediated adherence as is seen with
uropathogenic E. coli. See, e.g., Zhang & Normark, 1996,
Science 273:1234-6. PE secreted from Ps. aeruginosa, considered one
of the most potent virulence factors secreted by Ps. aeruginosa
infection, can be highly cytotoxic. See Fogle et al., 2002, J.
Surg. Res. 106:86-98. PAK strain-induced A549 cell lifting, as
described above, did not appear to involve actions of this enzyme
since no PE was ever detected in any incubation, consistent with an
observation that PE is secreted by Ps. aeruginosa under times of
iron-deficient stress and culture media used in A549 lifting assays
was not iron-deficient. See Sokol et al., 1982, J. Bacteriol.
151:783-7. PE, however, still represents a potent virulence factor
for Ps. aeruginosa infection and previous studies, where
ntPEpilinPAK vaccine with an abbreviated pilin sequence was
injected into rabbits, demonstrated serum immune responses capable
of neutralizing the toxicity of PE in vitro. See Hertle et al.,
2001, Infect. Immun. 69:6962-6969.
[0259] A549 cells challenged with PE had increased caspase-3
expression after 24 hr in vitro (FIG. 9), indicating induction of
apoptosis--the mechanism by which PE kill cells. See Morimoto &
Bonavida, 1992, J. Immunol. 149:2089-94. Introduction of saliva
from IN immunized mice neutralized the toxicity of PE in vitro
(FIG. 9). Interestingly, saliva from mice immunized with 10 .mu.g
subQ group administered with Freund's adjuvant failed to neutralize
under the same conditions, which could be due, for example, to
variations in antibody isotypes or affinities.
6.10. Comparison of Immune Response Induced by Chimeric Immunogens
Comprising Short and Long Pilin Peptides
[0260] The ELISA assay described in Section 6.7, above, was used to
assess the immune responses induced by chimeric immunogens
comprising residues 128-144 (the "short" pilin peptide;
KCTSDQDEQFIPKGCSK; SEQ ID NO.:7) or residues 121-144 (the "long"
pilin peptide, TAADGLWKCTSDQDEQFIPKGCSK SEQ ID NO.1) of Ps.
aeruginosa PAK pilin protein. Briefly, 100 .mu.g chimeric immunogen
comprising the short or the long peptide were administered IN in
phosphate buffered saline (PBS) or PBS plus 0.05% carboxymethyl
cellulose (CMC). PBS or PBS plus 0.05% CMC were administered IN as
negative controls, while 10 .mu.g chimeric immunogen comprising the
long peptide with 0.05% CMC and Freund's complete/incomplete
adjuvant cocktail was administered subcutaneously as a positive
control. Both salivary IgA and serum IgG immune responses were
assessed.
[0261] FIG. 10 demonstrates that a chimeric immunogen comprising
the long pilin peptide was surprisingly more effective than a
chimeric immunogen comprising the short pilin peptide at inducing a
salivary IgA response specific for ntPEpilinPAK. Specifically mice
in groups C and D, administered a chimeric immunogen comprising the
long pilin peptide, secreted more IgA specific for ntPEpilinPAK
into saliva than mice administered a chimeric immunogen comprising
the short pilin peptide. Similarly, FIG. 11 demonstrates that
chimeric immunogen comprising the long pilin peptide also more
effectively induced a serum IgG response specific for ntPEpilinPAK
than the chimeric immunogen comprising the short pilin peptide.
Taken together, these results demonstrate that chimeric immunogens
comprising the long pilin peptide more effectively induce immune
responses against ntPEpilinPAK than chimeric immunogens comprising
the short pilin peptide.
6.11. Clinical Evaluation of ntPEpilinPAK
[0262] This example describes clinical evaluation of the safety and
immunogenicity of ntPEpilinPAK in a Phase I, randomized,
double-blind, placebo-controlled, dose-escalation study in healthy
adult subjects. In the trial, each volunteer receives three
intranasal administrations of ntPEpilinPAK at a single dose level
with 28 days between immunizations.
[0263] In this human study, ntPEpilinPAK is evaluated according to
three criteria: safety and tolerability of the three escalating
doses of immunogen; absorption of the immunogen as determined by
serum concentration of ntPEpilinPAK from a pharmacokinetic
assessment (following the first vaccination in each dose cohort);
and the immune response to ntPEpilinPAK prior to dosing and at
various times after administration. In regard to measuring
immunogenicity, serum, saliva and nasal wash samples obtained from
healthy subjects are analyzed for antibodies against the C-terminal
pilin loop and against PE. All immunological assessments will be
performed using a standard ELISA assay
[0264] 6.11.1. Study Design and Cohort Selection
[0265] Three sequential cohorts of 12 subjects each are enrolled,
for a total of 36 subjects. Randomization within each cohort of 12
subjects assures that nine individuals receive ntPEpilinPAK and
three individuals receive a placebo that is indistinguishable from
the chimeric immunogen. Each subject receives three intranasal
immunizations of ntPEpilinPAK or control at one of three dose
levels, beginning with the lowest dose cohort. The three study
immunizations are administered at 28 day intervals on Days 0, 28,
and 56.
[0266] Subjects for this study are healthy adults, aged 18 to 45
years. Subjects are evaluated prior to administration of
ntPEpilinPAK to assure that they are in good general health, free
from significant illness or disease as indicated by history,
physical examination (PE), and laboratory tests. In particular,
subjects undergo a medical history, physical examination, and
laboratory evaluation (urinalysis, clinical chemistry and
hematology). Blood is obtained for assessment of serologic status
for HBV, HCV, and HIV and immune responses directed against P.
aeruginosa. An oropharyngeal (OP) culture is obtained for P.
aeruginosa. Serum, saliva and nasal secretions are collected for
assessment of the presence of antibodies directed against P.
aeruginosa antigens.
[0267] 6.11.2. Clinical Administration of a Chimeric Immunogen
[0268] Either ntPEpilinPAK or placebo formulated in Phosphate
Buffered Saline (PBS) is administered to the subject. Subjects are
administered 40, 200 or 100 .mu.g/administration for the Low,
Intermediate and High Dose cohorts, respectively. The study dose of
0.2 ml administered to each subject is delivered as a spray, and
administered as two doses of 0.1 ml in each nostril using a single
BD Accuspray.TM. device (BD Medical--Pharmaceutical Systems,
Franklin Lakes, N.J.).
[0269] Four subjects from each dose cohort receive the first
administration of study product in a blinded manner on the same
day. Provided there are no clinically significant adverse events in
this initial cohort, the remaining eight subjects from the same
dose cohort receive the first administration at least 7 days after
the initial cohort has received their first dose.
[0270] Subjects remain in the clinical research unit for at least 6
hours following immunization during which time frequent vital signs
will be obtained and subjects are questioned regarding local
symptoms (e.g., nasal pain, nasal congestion, nasal irritation,
rhinorrhea, bloody or blood-tinged nasal secretions, sinus pain,
ear pain and sore throat) and systemic symptoms (e.g., fever,
chills, shortness of breath, wheezing, cough, malaise, headache,
nausea, myalgia, arthralgia, and rash). Interim cranial nerve exam
(including olfactory exam) is performed prior to discharge from the
study site. A diary card is dispensed and instructions given on its
daily completion through Day 7 following administration.
[0271] Provided there are no clinically significant adverse events
in this initial cohort, the remaining eight subjects are scheduled
for attendance no less than 7 days later and within 14 days of
their screening visit. These subjects will undergo the same
assessment and dosing procedures as for the first four subjects in
the initial Low Dose cohort.
[0272] All subjects in each dose cohort have blood drawn
immediately prior to vaccination (0 minutes) and at 10, 20, 30, 45,
90 minutes and 2, 4 and 6 hours following administration of the
first vaccination to measure serum concentration of ntPEpilinPAK.
Samples are processed (see Section 6.11.4: Determination of
Pharmacokinetics and Immunogen Absorption Profile, below.), stored
at -70.degree. C. on site and shipped on dry ice for analysis.
Serum, saliva and nasal wash samples for immunogenicity testing are
obtained at baseline and processed on site (see Section 6.11.5:
Sample Collection, below.), stored at -70.degree. C. until shipped
on dry ice to for immunogenicity analysis. In addition, blood
samples for hematology and chemistry laboratories, and urine for
urinalysis are obtained at baseline (as well as Days 2, 14 and 28)
and analyzed on site.
[0273] Interim outpatient visits occur on Days 2, 7, 14 and 28
after immunization for evaluation of local and systemic adverse
events and/or immune response to the intranasal immunization (see
Schedule of Study Procedures). Samples for immunogenicity analysis
will be collected, processed and shipped as described above and
below.
[0274] The Low Dose cohort return on Day 28+/-2 days, at which time
they are evaluated for adverse events, health status and continued
study eligibility. If the first administration does not result in
immunogen-associated clinically significant adverse events, then
subjects in the Low Dose cohort receive their second intranasal
administration with the same dose level as that received at their
first administration (placebo or Low Dose of the chimeric
immunogen). Subjects remain in the clinical research unit for at
least 2 hours following immunization and have interim follow-up
visits on Days 30, 35, 42 and 56 for evaluation of local and
systemic reactions and/or immune response.
[0275] Subjects in the Low Dose cohort then return on Day 56, at
which time they are evaluated for adverse events, health status and
continued study eligibility. If there are no clinically significant
safety concerns, they receive their third intranasal administration
with the same dose level as administered at the first two
administrations (placebo or Low Dose of chimeric immunogen).
Subjects remain in the clinical research unit for at least 2 hours
following immunization and have interim follow-up visits on Days
58, 63, 70, and 84 for evaluation of local and systemic reactions
and/or immune response.
[0276] A final telephone follow-up occurs at Day 180 (Days 168-195)
for the Low Dose cohort and subjects are queried regarding
persistent symptoms since Day 84 (Visit 14), hospitalizations, new
diagnoses or major medical problems.
[0277] Enrollment of the Intermediate Dose cohort proceeds once the
Low Dose cohort has completed the Day 14 visit. Safety data
(adverse events, use of concomitant medications and results of
safety laboratory testing) obtained during the first two weeks
after the first intranasal administration in the Low Dose cohort
are evaluated in a blinded manner by the principal investigator and
medical monitor. If the Low Dose cohort is without clinically
significant safety concerns, then the first four subjects in the
Intermediate Dose cohort will be admitted to the study center and
undergo the same admission process and study product administration
as for the Low Dose cohort. Subjects in the Intermediate Dose
cohort are randomized to receive either placebo or the Intermediate
Dose of ntPEpilinPAK. Provided there are no clinically significant
adverse events for this initial cohort, the remaining eight
subjects are scheduled for attendance no less than 7 days later and
within 14 days of their screening. These subjects undergo the same
assessment and dosing procedures as the first four subjects in the
initial Intermediate Dose cohort.
[0278] Safety evaluation of the Intermediate Dose cohort through
the first two weeks after first administration occurs in a manner
identical to the Low Dose cohort, with subsequent admission and
administration of the High Dose cohort so long as there are no
clinically significant safety concerns in the Intermediate Dose
cohort. Individuals randomized to receive ntPEpilinPAK in the High
Dose cohort receive the highest study dose of ntPEpilinPAK.
[0279] The evaluation of safety data following the second and third
intranasal immunizations are performed in a manner identical to
that of the first immunization. The second and third immunizations
for the Intermediate and High Dose cohorts proceed only if there
are no clinically significant safety concerns identified during the
first two weeks after the second and third administrations of the
preceding cohort.
[0280] 6.11.3. Safety Evaluation
[0281] All safety data from Days 0-14, including adverse events and
laboratory safety parameters, are reviewed prior to enrolling the
next dose cohort. The following events result in a temporary halt
to dose escalation to determine whether the protocol should
proceed, be modified, or be terminated 1). Any serious adverse
event (SAE) possibly related to the Study Product (without a clear
alternative etiology); and (2) Any severe adverse event (including
laboratory parameters), as defined in the draft FDA guidance
entitled "Grading Scales for Monitored Clinical Parameters:
Guidelines for Vaccine Clinical Trials Enrolling Healthy Adults,
age 18-40 years" (August 2003).
[0282] 6.11.4. Determination of Pharmacokinetics and Immunogen
Absorption Profile.
[0283] Subjects in each dose cohort provide blood samples following
the first administration for the analysis of ntPEpilinPAK
absorption from the nasal mucosa into the systemic circulation.
Blood is collected from a venous catheter from either forearm prior
to administration, (0 minutes), and at 10, 20, 30, 45, 90 minutes
and 2, 4 and 6 hours after the first administration only (for each
of the three dose levels). An approximate volume of 4-6 ml of blood
is collected to give a minimum serum volume of 2-3 ml at each of
these time points.
[0284] The samples are processed by first collecting blood into
standard serum collecting tubes, allowing clotting for 30-60
minutes at room temperature and then centrifuging at 4.degree. C.
to separate the serum. A minimum of 2-3 ml of serum is transferred
(split) into 1-1.5 ml aliquots each into two duplicate
polypropylene tubes, snap frozen and stored at -70.degree. C. in a
freezer with a temperature recording device until shipped on dry
ice in batch shipments (of the first for each duplicate sample) for
analysis. There are three batch shipments, each corresponding to
the completion of the first administration for all subjects in each
of the dose cohorts. This will be followed by the final shipment of
the remaining duplicate samples for all subjects.
[0285] Standard pharmacokinetic analysis of the audited tabulated
data is analyzed by determining standard pharmacokinetic parameters
(e.g., half life, Cmax, etc.).
[0286] 6.11.5. Sample Collection and Processing
[0287] Sample collection for the immune assays and the P.
aeruginosa culture takes place prior to the first administration
and 14 and 28 days after each study product administration, i.e. on
Days 14, 28, 42, 56, 70 and 84. Samples are collected in the
following order: (1) Nasal wash; (2) Saliva; and (3) Blood.
[0288] 6.11.5.1. Nasal Wash Collection
[0289] The first 5.0 ml of a 10 ml sterile lactated ringers or
normal saline solution, supplied by the study site, is aspirated
into a sterile bulb syringe and the volunteer is asked to hold
their breath while the solution is gently sprayed into the nostril
of the volunteer (to avoid swallowing). The tip of the syringe is
inserted about 1 cm into the nostril. A sterile 12 cc syringe with
a sterile rubber tip may be substituted for the bulb syringe. The
subject then blows the nasal fluid into a plastic cup without
swallowing. The remaining 5.0 ml of sterile saline solution is then
sprayed into the nostril that has not previously been washed and
the sample collected into the same collection container. Thus, the
samples from each nostril are collected in a single container. The
sample is then transferred as equal aliquots (.about.1.5 ml) into
two 15 ml conical tubes each containing 50 .mu.l of protease
inhibitor. The sample is then processed as described below in
Section 6.5.11.5: "Processing of Collected Saliva and Nasal
Washes."
[0290] 6.11.5.2. Saliva Collection
[0291] Approximately 3 ml of free-running saliva is obtained by
having the subject pool saliva in the mouth and then spit into a 50
ml sterile plastic specimen container or collection cup until the
minimum volume is obtained. The sample is not an expectorated
sample from the throat or lower respiratory tract. This volume of
saliva is immediately transferred from the 50 ml sterile plastic
specimen container or collection cup into the protease inhibitor
containing tube (50 .mu.l of protease inhibitor previously
aliquoted into a 15 ml sterile conical tube). The tube is briefly
finger-vortexed (mixed or swirled) and placed on ice for processing
as described in Section 6.11.5.6: "Processing of Collected Saliva
and Nasal Washes," below.
[0292] 6.11.5.3. Serum Collection
[0293] Blood is collected by placing a venous catheter in either
arm (or according to normal blood collect practice at the site) and
withdrawing a volume of at least 20 ml that would give a minimum of
10 ml of serum after processing. Blood is collected into two or
more .about.10 ml serum separating tubes routinely used for this
purpose. Blood collected is placed on ice and processed within 30
minutes of collection. The sample is processed as described in
Section 6.11.5.5: "Processing of Collected Blood samples" as
described below.
[0294] 6.11.5.4. Swabbing Nasopharyngeal Cavity for Culture
[0295] Oropharyngeal cultures are obtained by swabbing the
posterior oropharyngeal wall and tonsillar pillars with a
cotton-tipped swab. The sample collection is documented on the
standard site form available for this purpose and the information
that the sample was collected and the subsequent results recorded
on the appropriate CRF.
[0296] 6.11.5.5. Processing of Collected Blood Samples
[0297] Samples are centrifuged at 5,000.times.g at 4.degree. C. for
15 min. The supernatant is aspirated and equal volumes transferred
to four duplicate labeled cryovials and placed on ice until snap
frozen using liquid N.sub.2.
[0298] 6.11.5.6. Processing of Collected Saliva and Nasal
Washes
[0299] A minimum of 2 ml of saliva and 3 ml of nasal wash is
collected. Each sample is centrifuged at 5000 g at 4.degree. C. for
15 minutes to sediment any particulate matter. The supernatant is
then aliquoted. From each sample collected, half of the volume
collected (i.e., each of .about.1 ml for saliva and .about.1.5 ml
for nasal wash) is aliquoted to each of two 5 ml cryovials Once the
samples have been split equally into duplicate tubes, they are
immediately flash frozen using liquid N.sub.2. Flash frozen
duplicate samples are stored at in -70.degree. C. freezer with a
temperature monitoring chart.
[0300] 6.11.6. Clinical Criteria for Evaluation
[0301] The clinical and laboratory endpoints measured and analyzed
for safety and tolerability include: (1) adverse events (AEs) and
serious adverse events (SAEs); (2) concomitant medication use; (3)
changes over time in renal function as measured by urinalysis, BUN
and creatinine (Cr); (4) changes over time in hepatic function as
measured by alkaline phosphatase, ALT and AST; (5) changes over
time in hematology parameters including red blood cell (RBC)
counts, white blood cell (WBC) counts with differential, and
platelets; (6) changes over time in clinical chemistries
(electrolytes, glucose etc.); and (7) changes in vital signs (blood
pressure (BP) and heart rate (HR)).
[0302] The laboratory endpoints to be measured and analyzed for
assessment of P. aeruginosa status and immunogenicity of include:
(1) serum concentration of ntPEpilinPAK over a 6 hour period
following administration; (2) immune response as measured by
anti-pilin and anti-exotoxin A serum IgG and IgA and anti-pilin and
anti-exotoxin A mucosal (nasal wash and saliva) IgA and IgG; and
(3) culture of nasal secretions for P. aeruginosa.
[0303] 6.11.7. Immunological Assessment of Serum, Saliva and Nasal
Wash Samples
[0304] To assess the immune responses to ntPEpilinPAK, the
following anti-ntPEpilinPAK antibodies are measured by
Enzyme-Linked Immunosorbant Assay (ELISA): (1) serum IgG and IgA to
the pilin peptide; serum IgG and IgA to the PE; (3) salivary IgA
and IgG to the pilin peptide; salivary IgA and IgG to PE; (5) nasal
wash IgA and IgG to the pilin peptide; (6) nasal wash IgA and IgG
to PE; and (7) total secretory saliva and nasal wash IgA.
Representative ELISA protocols for evaluating such antibody
responses are extensively described above.
[0305] The present invention provides, inter alia, chimeric
immunogens and methods of inducing an immune response in a subject.
While many specific examples have been provided, the above
description is intended to illustrate rather than limit the
invention. Many variations of the invention will become apparent to
those skilled in the art upon review of this specification. The
scope of the invention should, therefore, be determined not with
reference to the above description, but instead should be
determined with reference to the appended claims along with their
full scope of equivalents.
[0306] All publications and patent documents cited in this
application are incorporated by reference in their entirety for all
purposes to the same extent as if each individual publication or
patent document were so individually denoted. Citation of these
documents is not an admission that any particular reference is
"prior art" to this invention.
Sequence CWU 1
1
13124PRTPseudomonas sp. 1Thr Ala Ala Asp Gly Leu Trp Lys Cys Thr
Ser Asp Gln Asp Glu Gln1 5 10 15Phe Ile Pro Lys Gly Cys Ser Lys
2024PRTPseudomonas sp. 2Arg Asp Glu Leu134PRTPseudomonas sp. 3Lys
Asp Glu Leu14266PRTPseudomonas sp. 4Met His Leu Ile Pro His Trp Ile
Pro Leu Val Ala Ser Leu Gly Leu1 5 10 15Leu Ala Gly Gly Ser Ser Ala
Ser Ala Ala Glu Glu Ala Phe Asp Leu 20 25 30Trp Asn Glu Cys Ala Lys
Ala Cys Val Leu Asp Leu Lys Asp Gly Val 35 40 45Arg Ser Ser Arg Met
Ser Val Asp Pro Ala Ile Ala Asp Thr Asn Gly 50 55 60Gln Gly Val Leu
His Tyr Ser Met Val Leu Glu Gly Gly Asn Asp Ala65 70 75 80Leu Lys
Leu Ala Ile Asp Asn Ala Leu Ser Ile Thr Ser Asp Gly Leu 85 90 95Thr
Ile Arg Leu Glu Gly Gly Val Glu Pro Asn Lys Pro Val Arg Tyr 100 105
110Ser Tyr Thr Arg Gln Ala Arg Gly Ser Trp Ser Leu Asn Trp Leu Val
115 120 125Pro Ile Gly His Glu Lys Pro Ser Asn Ile Lys Val Phe Ile
His Glu 130 135 140Leu Asn Ala Gly Asn Gln Leu Ser His Met Ser Pro
Ile Tyr Thr Ile145 150 155 160Glu Met Gly Asp Glu Leu Leu Ala Lys
Leu Ala Arg Asp Ala Thr Phe 165 170 175Phe Val Arg Ala His Glu Ser
Asn Glu Met Gln Pro Thr Leu Ala Ile 180 185 190Ser His Ala Gly Val
Ser Val Val Met Ala Gln Thr Gln Pro Arg Arg 195 200 205Glu Lys Arg
Trp Ser Glu Trp Ala Ser Gly Lys Val Leu Cys Leu Leu 210 215 220Asp
Pro Leu Asp Gly Val Tyr Asn Tyr Leu Ala Gln Gln Arg Cys Asn225 230
235 240Leu Asp Asp Thr Trp Glu Gly Lys Ile Tyr Arg Val Leu Ala Gly
Asn 245 250 255Pro Ala Lys His Asp Leu Asp Ile Lys Pro 260
2655644PRTPseudomonas sp. 5Met His Leu Ile Pro His Trp Ile Pro Leu
Val Ala Ser Leu Gly Leu1 5 10 15Leu Ala Gly Gly Ser Ser Ala Ser Ala
Ala Glu Glu Ala Phe Asp Leu 20 25 30Trp Asn Glu Cys Ala Lys Ala Cys
Val Leu Asp Leu Lys Asp Gly Val 35 40 45Arg Ser Ser Arg Met Ser Val
Asp Pro Ala Ile Ala Asp Thr Asn Gly 50 55 60Gln Gly Val Leu His Tyr
Ser Met Val Leu Glu Gly Gly Asn Asp Ala65 70 75 80Leu Lys Leu Ala
Ile Asp Asn Ala Leu Ser Ile Thr Ser Asp Gly Leu 85 90 95Thr Ile Arg
Leu Glu Gly Gly Val Glu Pro Asn Lys Pro Val Arg Tyr 100 105 110Ser
Tyr Thr Arg Gln Ala Arg Gly Ser Trp Ser Leu Asn Trp Leu Val 115 120
125Pro Ile Gly His Glu Lys Pro Ser Asn Ile Lys Val Phe Ile His Glu
130 135 140Leu Asn Ala Gly Asn Gln Leu Ser His Met Ser Pro Ile Tyr
Thr Ile145 150 155 160Glu Met Gly Asp Glu Leu Leu Ala Lys Leu Ala
Arg Asp Ala Thr Phe 165 170 175Phe Val Arg Ala His Glu Ser Asn Glu
Met Gln Pro Thr Leu Ala Ile 180 185 190Ser His Ala Gly Val Ser Val
Val Met Ala Gln Thr Gln Pro Arg Arg 195 200 205Glu Lys Arg Trp Ser
Glu Trp Ala Ser Gly Lys Val Leu Cys Leu Leu 210 215 220Asp Pro Leu
Asp Gly Val Tyr Asn Tyr Leu Ala Gln Gln Arg Cys Asn225 230 235
240Leu Asp Asp Thr Trp Glu Gly Lys Ile Tyr Arg Val Leu Ala Gly Asn
245 250 255Pro Ala Lys His Asp Leu Asp Ile Lys Pro Thr Val Ile Ser
His Arg 260 265 270Leu His Phe Pro Glu Gly Gly Ser Leu Ala Ala Leu
Thr Ala His Gln 275 280 285Ala Cys His Leu Pro Leu Glu Thr Phe Thr
Arg His Arg Gln Pro Arg 290 295 300Gly Trp Glu Gln Leu Glu Gln Cys
Gly Tyr Pro Val Gln Arg Leu Val305 310 315 320Ala Leu Tyr Leu Ala
Ala Arg Leu Ser Trp Asn Gln Val Asp Gln Val 325 330 335Ile Arg Asn
Ala Leu Ala Ser Pro Gly Ser Gly Gly Asp Leu Gly Glu 340 345 350Ala
Ile Arg Glu Gln Pro Glu Gln Ala Arg Leu Ala Leu Thr Leu Ala 355 360
365Ala Ala Glu Ser Glu Arg Phe Val Arg Gln Gly Thr Gly Asn Asp Glu
370 375 380Ala Thr Ser Thr Ala Ala Asp Gly Leu Trp Lys Cys Thr Ser
Asp Gln385 390 395 400Asp Glu Gln Phe Ile Pro Lys Gly Cys Ser Lys
Gln Gly Pro Ala Asp 405 410 415Ser Gly Asp Ala Leu Leu Glu Arg Asn
Tyr Pro Thr Gly Ala Glu Phe 420 425 430Leu Gly Asp Gly Gly Asp Val
Ser Phe Ser Thr Arg Gly Thr Gln Asn 435 440 445Trp Thr Val Glu Arg
Leu Leu Gln Ala His Arg Gln Leu Glu Glu Arg 450 455 460Gly Tyr Val
Phe Val Gly Tyr His Gly Thr Phe Leu Glu Ala Ala Gln465 470 475
480Ser Ile Val Phe Gly Gly Val Arg Ala Arg Ser Gln Asp Leu Asp Ala
485 490 495Ile Trp Arg Gly Phe Tyr Ile Ala Gly Asp Pro Ala Leu Ala
Tyr Gly 500 505 510Tyr Ala Gln Asp Gln Glu Pro Asp Ala Arg Gly Arg
Ile Arg Asn Gly 515 520 525Ala Leu Leu Arg Val Tyr Val Pro Arg Ser
Ser Leu Pro Gly Phe Tyr 530 535 540Arg Thr Ser Leu Thr Leu Ala Ala
Pro Glu Ala Ala Gly Glu Val Arg545 550 555 560Leu Ile Gly His Pro
Leu Pro Leu Arg Leu Asp Ala Ile Thr Gly Pro 565 570 575Glu Glu Glu
Gly Gly Arg Leu Glu Thr Ile Leu Gly Trp Pro Leu Ala 580 585 590Glu
Arg Thr Val Val Ile Pro Ser Ala Ile Pro Thr Asp Pro Arg Asn 595 600
605Val Gly Gly Asp Leu Asp Pro Ser Ser Ile Pro Asp Lys Glu Gln Ala
610 615 620Ile Ser Ala Leu Pro Asp Tyr Ala Ser Gln Pro Gly Lys Pro
Pro Arg625 630 635 640Glu Asp Leu Lys6153PRTPseudomonas sp. 6Thr
Val Ile Ser His Arg Leu His Phe Pro Glu Gly Gly Ser Leu Ala1 5 10
15Ala Leu Thr Ala His Gln Ala Cys His Leu Pro Leu Glu Thr Phe Thr
20 25 30Arg His Arg Gln Pro Arg Gly Trp Glu Gln Leu Glu Gln Cys Gly
Tyr 35 40 45Pro Val Gln Arg Leu Val Ala Leu Tyr Leu Ala Ala Arg Leu
Ser Trp 50 55 60Asn Gln Val Asp Gln Val Ile Arg Asn Ala Leu Ala Ser
Pro Gly Ser65 70 75 80Gly Gly Asp Leu Gly Glu Ala Ile Arg Glu Gln
Pro Glu Gln Ala Arg 85 90 95Leu Ala Leu Thr Leu Ala Ala Ala Glu Ser
Glu Arg Phe Val Arg Gln 100 105 110Gly Thr Gly Asn Asp Glu Ala Gly
Ala Ala Asn Ala Asp Val Val Ser 115 120 125Leu Thr Cys Pro Val Ala
Ala Gly Glu Cys Ala Gly Pro Ala Asp Ser 130 135 140Gly Asp Ala Leu
Leu Glu Arg Asn Tyr145 150717PRTPseudomonas sp. 7Lys Cys Thr Ser
Asp Gln Asp Glu Gln Phe Ile Pro Lys Gly Cys Ser1 5 10
15Lys85PRTPseudomonas sp. 8Arg Asp Glu Leu Lys1
591839DNAPseudomonas sp. 9gccgaagaag ctttcgacct ctggaacgaa
tgcgccaaag cctgcgtgct cgacctcaag 60gacggcgtgc gttccagccg catgagcgtc
gacccggcca tcgccgacac caacggccag 120ggcgtgctgc actactccat
ggtcctggag ggcggcaacg acgcgctcaa gctggccatc 180gacaacgccc
tcagcatcac cagcgacggc ctgaccatcc gcctcgaagg cggcgtcgag
240ccgaacaagc cggtgcgcta cagctacacg cgccaggcgc gcggcagttg
gtcgctgaac 300tggctggtac cgatcggcca cgagaagccc tcgaacatca
aggtgttcat ccacgaactg 360aacgccggca accagctcag ccacatgtcg
ccgatctaca ccatcgagat gggcgacgag 420ttgctggcga agctggcgcg
cgatgccacc ttcttcgtca gggcgcacga gagcaacgag 480atgcagccga
cgctcgccat cagccatgcc ggggtcagcg tggtcatggc ccagacccag
540ccgcgccggg aaaagcgctg gagcgaatgg gccagcggca aggtgttgtg
cctgctcgac 600ccgctggacg gggtctacaa ctacctcgcc cagcaacgct
gcaacctcga cgatacctgg 660gaaggcaaga tctaccgggt gctcgccggc
aacccggcga agcatgacct ggacatcaaa 720cccacggtca tcagtcatcg
cctgcacttt cccgagggcg gcagcctggc cgcgctgacc 780gcgcaccagg
cttgccacct gccgctggag actttcaccc gtcatcgcca gccgcgcggc
840tgggaacaac tggagcagtg cggctatccg gtgcagcggc tggtcgccct
ctacctggcg 900gcgcggctgt cgtggaacca ggtcgaccag gtgatccgca
acgccctggc cagccccggc 960agcggcggcg acctgggcga agcgatccgc
gagcagccgg agcaggcccg tctggccctg 1020accctggccg ccgccgagag
cgagcgcttc gtccggcagg gcaccggcaa cgacgaggcc 1080ggcgcggcca
acgccgacgt ggtgagcctg acctgcccgg tcgccgccgg tgaatgcgcg
1140ggcccggcgg acagcggcga cgccctgctg gagcgcaact atcccactgg
cgcggagttc 1200ctcggcgacg gcggcgacgt cagcttcagc acccgcggca
cgcagaactg gacggtggag 1260cggctgctcc aggcgcaccg ccaactggag
gagcgcggct atgtgttcgt cggctaccac 1320ggcaccttcc tcgaagcggc
gcaaagcatc gtcttcggcg gggtgcgcgc gcgcagccag 1380gacctcgacg
cgatctggcg cggtttctat atcgccggcg atccggcgct ggcctacggc
1440tacgcccagg accaggaacc cgacgcacgc ggccggatcc gcaacggtgc
cctgctgcgg 1500gtctatgtgc cgcgctcgag cctgccgggc ttctaccgca
ccagcctgac cctggccgcg 1560ccggaggcgg cgggcgaggt cgaacggctg
atcggccatc cgctgccgct gcgcctggac 1620gccatcaccg gccccgagga
ggaaggcggg cgcctggaga ccattctcgg ctggccgctg 1680gccgagcgca
ccgtggtgat tccctcggcg atccccaccg acccgcgcaa cgtcggcggc
1740gacctcgacc cgtccagcat ccccgacaag gaacaggcga tcagcgccct
gccggactac 1800gccagccagc ccggcaaacc gccgcgcgag gacctgaag
18391027DNAPseudomonas sp. 10aggtacagag gacgctacta agaaaga
271119DNAPseudomonas sp. 11tcagcaggat cgggtttga 191217PRTArtificial
Sequencescrambled control peptide manufactured by SynPep (Dublin,
CA) for use as control in ELISA assay 12Lys Cys Asp Asp Phe Lys Gln
Gly Thr Gln Glu Pro Ile Ser Cys Ser1 5 10 15Lys13638PRTPseudomonas
Aeruginosa Exotoxin A 13Met His Leu Ile Pro His Trp Ile Pro Leu Val
Ala Ser Leu Gly Leu1 5 10 15Leu Ala Gly Gly Ser Ser Ala Ser Ala Ala
Glu Glu Ala Phe Asp Leu 20 25 30Trp Asn Glu Cys Ala Lys Ala Cys Val
Leu Asp Leu Lys Asp Gly Val 35 40 45Arg Ser Ser Arg Met Ser Val Asp
Pro Ala Ile Ala Asp Thr Asn Gly 50 55 60Gln Gly Val Leu His Tyr Ser
Met Val Leu Glu Gly Gly Asn Asp Ala65 70 75 80Leu Lys Leu Ala Ile
Asp Asn Ala Leu Ser Ile Thr Ser Asp Gly Leu 85 90 95Thr Ile Arg Leu
Glu Gly Gly Val Glu Pro Asn Lys Pro Val Arg Tyr 100 105 110Ser Tyr
Thr Arg Gln Ala Arg Gly Ser Trp Ser Leu Asn Trp Leu Val 115 120
125Pro Ile Gly His Glu Lys Pro Ser Asn Ile Lys Val Phe Ile His Glu
130 135 140Leu Asn Ala Gly Asn Gln Leu Ser His Met Ser Pro Ile Tyr
Thr Ile145 150 155 160Glu Met Gly Asp Glu Leu Leu Ala Lys Leu Ala
Arg Asp Ala Thr Phe 165 170 175Phe Val Arg Ala His Glu Ser Asn Glu
Met Gln Pro Thr Leu Ala Ile 180 185 190Ser His Ala Gly Val Ser Val
Val Met Ala Gln Thr Gln Pro Arg Arg 195 200 205Glu Lys Arg Trp Ser
Glu Trp Ala Ser Gly Lys Val Leu Cys Leu Leu 210 215 220Asp Pro Leu
Asp Gly Val Tyr Asn Tyr Leu Ala Gln Gln Arg Cys Asn225 230 235
240Leu Asp Asp Thr Trp Glu Gly Lys Ile Tyr Arg Val Leu Ala Gly Asn
245 250 255Pro Ala Lys His Asp Leu Asp Ile Lys Pro Thr Val Ile Ser
His Arg 260 265 270Leu His Phe Pro Glu Gly Gly Ser Leu Ala Ala Leu
Thr Ala His Gln 275 280 285Ala Cys His Leu Pro Leu Glu Thr Phe Thr
Arg His Arg Gln Pro Arg 290 295 300Gly Trp Glu Gln Leu Glu Gln Cys
Gly Tyr Pro Val Gln Arg Leu Val305 310 315 320Ala Leu Tyr Leu Ala
Ala Arg Leu Ser Trp Asn Gln Val Asp Gln Val 325 330 335Ile Arg Asn
Ala Leu Ala Ser Pro Gly Ser Gly Gly Asp Leu Gly Glu 340 345 350Ala
Ile Arg Glu Gln Pro Glu Gln Ala Arg Leu Ala Leu Thr Leu Ala 355 360
365Ala Ala Glu Ser Glu Arg Phe Val Arg Gln Gly Thr Gly Asn Asp Glu
370 375 380Ala Gly Ala Ala Asn Ala Asp Val Val Ser Leu Thr Cys Pro
Val Ala385 390 395 400Ala Gly Glu Cys Ala Gly Pro Ala Asp Ser Gly
Asp Ala Leu Leu Glu 405 410 415Arg Asn Tyr Pro Thr Gly Ala Glu Phe
Leu Gly Asp Gly Gly Asp Val 420 425 430Ser Phe Ser Thr Arg Gly Thr
Gln Asn Trp Thr Val Glu Arg Leu Leu 435 440 445Gln Ala His Arg Gln
Leu Glu Glu Arg Gly Tyr Val Phe Val Gly Tyr 450 455 460His Gly Thr
Phe Leu Glu Ala Ala Gln Ser Ile Val Phe Gly Gly Val465 470 475
480Arg Ala Arg Ser Gln Asp Leu Asp Ala Ile Trp Arg Gly Phe Tyr Ile
485 490 495Ala Gly Asp Pro Ala Leu Ala Tyr Gly Tyr Ala Gln Asp Gln
Glu Pro 500 505 510Asp Ala Arg Gly Arg Ile Arg Asn Gly Ala Leu Leu
Arg Val Tyr Val 515 520 525Pro Arg Ser Ser Leu Pro Gly Phe Tyr Arg
Thr Ser Leu Thr Leu Ala 530 535 540Ala Pro Glu Ala Ala Gly Glu Val
Glu Arg Leu Ile Gly His Pro Leu545 550 555 560Pro Leu Arg Leu Asp
Ala Ile Thr Gly Pro Glu Glu Glu Gly Gly Arg 565 570 575Leu Glu Thr
Ile Leu Gly Trp Pro Leu Ala Glu Arg Thr Val Val Ile 580 585 590Pro
Ser Ala Ile Pro Thr Asp Pro Arg Asn Val Gly Gly Asp Leu Asp 595 600
605Pro Ser Ser Ile Pro Asp Lys Glu Gln Ala Ile Ser Ala Leu Pro Asp
610 615 620Tyr Ala Ser Gln Pro Gly Lys Pro Pro Arg Glu Asp Leu
Lys625 630 635
* * * * *