U.S. patent application number 11/664865 was filed with the patent office on 2009-11-19 for methods and compositions for improving recombinant protein production.
Invention is credited to Jason Rouse, Martin Sinacore.
Application Number | 20090285806 11/664865 |
Document ID | / |
Family ID | 35710394 |
Filed Date | 2009-11-19 |
United States Patent
Application |
20090285806 |
Kind Code |
A1 |
Sinacore; Martin ; et
al. |
November 19, 2009 |
Methods and compositions for improving recombinant protein
production
Abstract
Nucleic acid molecules modified to enhance recombinant protein
expression, e.g., that of A.beta. peptide binding antibodies,
and/or to reduce or eliminate mis-spliced and/or intron
read-through (IRT) by-products are disclosed. The invention also
provides methods for producing A.beta. peptide binding antibodies
devoid of mis-spliced and/or intron read-through by-products by
expression of such nucleic acid molecules under cell culture
conditions suitable for recombinant A.beta. peptide binding
antibody expression.
Inventors: |
Sinacore; Martin; (Andover,
MA) ; Rouse; Jason; (Londonderry, NH) |
Correspondence
Address: |
TOWNSEND AND TOWNSEND AND CREW, LLP
TWO EMBARCADERO CENTER, EIGHTH FLOOR
SAN FRANCISCO
CA
94111-3834
US
|
Family ID: |
35710394 |
Appl. No.: |
11/664865 |
Filed: |
October 5, 2005 |
PCT Filed: |
October 5, 2005 |
PCT NO: |
PCT/US2005/035854 |
371 Date: |
January 15, 2009 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
60616474 |
Oct 5, 2004 |
|
|
|
Current U.S.
Class: |
424/133.1 ;
435/320.1; 435/325; 435/358; 435/6.11; 435/69.6; 530/387.3;
536/23.53 |
Current CPC
Class: |
C07K 2317/24 20130101;
A61P 25/28 20180101; C07K 16/00 20130101; A61P 25/00 20180101; C12N
15/63 20130101; C07K 16/18 20130101; C07K 2317/53 20130101; C07K
2317/56 20130101; C07K 2317/52 20130101; C07K 2317/565 20130101;
C12N 2810/859 20130101 |
Class at
Publication: |
424/133.1 ;
536/23.53; 435/320.1; 435/358; 435/69.6; 435/6; 530/387.3;
435/325 |
International
Class: |
A61K 39/395 20060101
A61K039/395; C12N 15/11 20060101 C12N015/11; C12N 15/00 20060101
C12N015/00; C12N 5/06 20060101 C12N005/06; C12P 21/08 20060101
C12P021/08; C12Q 1/68 20060101 C12Q001/68; C07K 16/18 20060101
C07K016/18 |
Claims
1. A nucleic acid molecule encoding an A.beta.-antibody chain,
comprising a nucleotide sequence having one or more intron and exon
sequences, wherein at least one intron sequence is deleted compared
to the naturally-occurring genomic sequence to reduce a mis-spliced
or an intron read-through (IRT) by-product.
2. A nucleic acid molecule encoding an A.beta.-antibody chain,
comprising a nucleotide sequence comprising one or more intron and
exon sequences, wherein at least one intron sequence is deleted
compared to the naturally-occurring genomic sequence to enhance
protein expression.
3. The nucleic acid molecule of claim 1 or 2, wherein at least
three intron sequences are deleted.
4. The nucleic acid molecule of claim 3, wherein the antibody chain
is a heavy chain or a fragment thereof.
5. The nucleic acid molecule of claim 4, wherein the antibody heavy
chain or fragment thereof comprises a heavy chain variable region,
a hinge region, a first constant region (CH1), a second constant
region (CH2), and third constant region (CH3) of a human
immunoglobulin G subtype.
6. The nucleic acid molecule of claim 5, wherein the immunoglobulin
G subtype is a human IgG1 or human IgG4.
7. The nucleic acid molecule of claim 6, wherein the human IgG1 or
human IgG4 is mutated.
8. The nucleic acid molecule of claim 5, wherein an intron between
the CH2 region and the CH3 region of the immunoglobulin heavy chain
constant region is deleted.
9. The nucleic acid molecule of claim 8, further comprising a
deletion of an intron between the CH1 region and the hinge
region.
10. The nucleic acid molecule of claim 8, further comprising a
deletion of an intron between the hinge region and the CH2
region.
11. The nucleic acid molecule of claim 5, having a heavy chain that
comprises one intron between the heavy chain variable region and
the CH1 region.
12. The nucleic acid molecule of claim 5, wherein the nucleotide
sequence encoding the heavy chain hinge region, and the first,
second and third constant regions comprises a sequence at least 95%
identical to the nucleotide sequence shown in FIG. 8 (SEQ ID
NO:1).
13. The nucleic acid molecule of claim 5, wherein the nucleotide
sequence encoding the heavy chain hinge region, and a first,
second, and third constant region comprises a sequence at least 95%
identical to the nucleotide sequence shown in FIG. 9 (SEQ ID
NO:3).
14. The nucleic acid molecule of claim 8, wherein the deletion of
the intron between CH2 and CH3 corresponds to about nucleotides
1409 to 1505 of human IgG1 as shown in FIG. 8 (SEQ ID NO:1).
15. The nucleic acid molecule of claim 8, wherein the deletion of
the intron between CH2 and CH3 corresponds to about nucleotides
1401 to 1497 of human IgG4 as shown in FIG. 9 (SEQ ID NO:3).
16. The nucleic acid molecule of claim 9, wherein the deletion of
the intron between CH1 and the hinge region corresponds to about
nucleotides 525 to 915 of human IgG1 as shown in FIG. 8 (SEQ ID
NO:1).
17. The nucleic acid molecule of claim 9, wherein the deletion of
the intron between CH1 and the hinge region corresponds to about
nucleotides 525 to 916 of human IgG4 as shown in FIG. 9 (SEQ ID
NO:3).
18. The nucleic acid molecule of claim 10, wherein the deletion of
the intron between the hinge region and CH2 corresponds to about
nucleotides 961 to 1078 of human IgG1 as shown in FIG. 8 (SEQ ID
NO:1).
19. The nucleic acid molecule of claim 10, wherein the deletion of
the intron between the hinge region and CH2 corresponds to about
nucleotides 953 to 1070 of human IgG4 as shown in FIG. 9 (SEQ ID
NO:3).
20. A nucleic acid molecule comprising a nucleotide sequence
encoding human IgG1, wherein said nucleotide sequence is at least
90% identical to the sequence shown in FIG. 10 (SEQ ID NO:5).
21. A nucleic acid molecule comprising a nucleotide sequence
encoding human IgG4, wherein said nucleotide sequence is at least
90% identical to the sequence shown in FIG. 11 (SEQ ID NO:6).
22. A genomic nucleotide sequence encoding a human heavy chain
constant region, or a mutated form thereof, wherein said nucleotide
sequence lacks at least one intron present in the
naturally-occurring genomic sequence, and wherein said intron
facilitates intron-read through.
23. A genomic nucleotide sequence encoding a human IgG1, or a
mutated form thereof, wherein said nucleotide sequence lacks at
least one intron present in the naturally-occurring genomic
sequence, and wherein said intron facilitates intron-read
through.
24. The nucleotide sequence of either of claims 22 or 23, wherein
the at least one intron is the intron between CH2 and CH3 of the
constant region.
25. A genomic nucleotide sequence encoding a human IgG4, or a
mutated form thereof, wherein said genomic sequence lacks three
introns present in the naturally-occurring genomic sequence.
26. The nucleotide sequence of claim 25, wherein the introns are
the intron between CH1 and hinge region, the intron between the
hinge region and CH2, and the intron between CH2 and CH3.
27. A nucleic acid molecule encoding an antibody which selectively
binds an A.beta. peptide, comprising a nucleotide sequence
represented by the formula:
V.sub.H-Int1-C.sub.H1-Int2-Hinge-Int3-C.sub.H2-C.sub.H3, wherein
V.sub.H is a nucleotide sequence encoding a heavy chain variable
region; C.sub.H1, C.sub.H2, and C.sub.H3 are nucleotide sequences
encoding the corresponding heavy chain constant region; Hinge is a
nucleotide sequence encoding a hinge region of a heavy chain
constant region; and Int1, Int2 and Int3 are introns from the heavy
chain genomic sequence.
28. The nucleic acid molecule of claim 27, wherein the nucleotide
sequence encodes a human immunoglobulin G heavy chain.
29. A nucleic acid molecule encoding an antibody which selectively
binds an A.beta. peptide, comprising a nucleotide sequence
represented by the formula:
V.sub.H-Int1-C.sub.H1-Hinge-C.sub.H2-C.sub.H3, wherein V.sub.H is a
nucleotide sequence encoding a heavy chain variable region;
C.sub.H1, C.sub.H2, and C.sub.H3 are nucleotide sequences encoding
the corresponding heavy chain constant region; Hinge is a
nucleotide sequence encoding a hinge region of a heavy chain
constant region; and Int1 is an intron from the heavy chain genomic
sequence.
30. The nucleic acid molecule of claim 29, wherein the nucleotide
sequence encodes a human immunoglobulin G heavy chain.
31. An expression cassette comprising the nucleic acid molecule of
claim 5.
32. An expression vector comprising the nucleic acid molecule of
claim 5.
33. The expression vector of claim 32, further comprising one or
more nucleotide sequences that enhance replication, selection, mRNA
transcription, mRNA stability, protein expression or protein
secretion in a host cell.
34. A host cell comprising the nucleic acid molecule of claim
5.
35. A host cell comprising the expression cassette of claim 31.
36. A host cell comprising the expression vector of claim 32.
37. The host cell of claim 36, which is a Chinese Hamster Ovary
(CHO) cell.
38. A method of expressing a recombinant antibody or fragment
thereof which selectively binds an A.beta. peptide and is
substantially free of an intron read-through (IRT) product,
comprising: introducing the nucleic acid molecule of claim 5 into a
mammalian host cell; culturing said host cell under conditions that
allow expression of the recombinant antibody or fragment thereof,
thereby producing a culture of host cells; and obtaining the
recombinant antibody or fragment thereof from the culture of host
cells.
39. The method of claim 38, further comprising the step of
identifying an IRT product in a nucleic acid sample from the host
cell.
40. The method of claim 39, wherein the identification step
comprises: obtaining a nucleic acid sample from the culture of host
cells; contacting said nucleic acid sample with nucleic acid probes
complementary to an intron and adjacent exon sequence, under
conditions that allow hybridization between the nucleic acid sample
and the probes; detecting the resulting complex, wherein detection
in said sample of a complex, using the nucleic acid probe
complementary to the intron sequence is indicative of the presence
of the IRT product.
41. The method of claim 38, wherein said host cell comprises a
nucleotide sequence encoding a light chain variable region and a
constant region.
42. A method for enhancing expression of a recombinant antibody or
fragment thereof which selectively binds an A.beta. peptide,
comprising: introducing the nucleic acid molecule of claim 5 into a
mammalian host cell; culturing said host cell under conditions that
allow expression of the recombinant antibody, thereby producing a
culture of host cells; and obtaining the recombinant antibody from
the culture of host cells.
43. The method of claim 42, wherein said host cell comprises a
nucleotide sequence encoding a light chain variable region and a
constant region.
44. A method for producing a recombinant antibody or fragment
thereof which selectively binds a A.beta. peptide and is
substantially devoid of intron read-through (IRT) heavy chain
by-product, comprising: culturing a mammalian host cell comprising
the nucleic acid molecule of claim 5 and a nucleic acid encoding an
antibody light chain of an antibody which selectively binds an
A.beta. peptide, under conditions such that the heavy and light
chains are expressed.
45. The method of claim 44, further comprising purifying the heavy
and light chains form the culture.
46. A method for enhancing expression of a recombinant antibody or
fragment thereof which selectively binds an A.beta. peptide,
comprising: culturing a mammalian host cell comprising the nucleic
acid molecule of claim 5, and a nucleic acid encoding an antibody
light chain of an antibody which selectively binds an A.beta.
peptide, under conditions such that the heavy and light chains are
expressed.
47. The method of claim 46, further comprising purifying the heavy
and light chains form the culture.
48. A method for detecting an IRT product, in a sample, comprising:
obtaining a nucleic acid sample from a recombinant cell; contacting
said nucleic acid sample with nucleic acid probes complementary to
an intron and adjacent exon sequence, under conditions that allow
hybridization of the nucleic acid sample and the probes; detecting
the resulting complex, wherein detection in said sample of a
complex, using the nucleic acid probe complementary to the intron
sequence is indicative of the presence of the IRT product.
49. An antibody or antigen-binding fragment thereof which
selectively bind an A.beta. peptide, made by the method comprising
the steps of claim 40 under suitable conditions to allow expression
and assembly of the antibody or fragment.
50. The antibody of claim 49, which is a chimeric, humanized,
CDR-grafted or an in vitro generated antibody.
51. The antibody of claim 50, which is a humanized antibody.
52. The antibody of claim 51, which binds to human 5T4.
53. A pharmaceutical composition comprising the antibody of claim
49, and a pharmaceutically acceptable carrier.
54. An isolated nucleic acid molecule encoding an antibody heavy
chain which selectively binds a A.beta. peptide, comprising human
genomic intron and exon sequences in a modified operative
association, wherein modification of the natural operative
association of the intron and exon sequences reduces or eliminates
expression of an intron read-through heavy chain by-product.
55. The isolated nucleic acid molecule of claim 54, wherein
expression of said heavy chain is enhanced relative to a nucleic
acid molecule comprising human genomic intron and exon sequences in
natural operative association.
56. The nucleic acid molecule of claim 55, wherein the genomic exon
sequences encode a variable region, a hinge region, and a first,
second and third constant region.
57. The nucleic acid molecule of claim 56, wherein the first,
second and third constant regions are IgG1 constant regions.
58. The nucleic acid molecule of claim 56, wherein the first,
second and third constant regions are IgG4 constant regions.
59. The nucleic acid molecule of claim 56, wherein the variable
region is a humanized variable region.
60. The nucleic acid molecule of claims 56-59, wherein the variable
region specifically binds to an A.beta. peptide.
61. The nucleic acid molecule of claim 56-59, wherein the variable
region comprises complementarity determining regions (CDRs) from
the from the mouse 3D6 antibody.
62. The nucleic acid molecule of claim 54, comprising one intron
sequence.
63. The nucleic acid molecule of claim 54, comprising two intron
sequences.
64. The nucleic acid molecule of claim 54, comprising three intron
sequences.
65. An A.beta. peptide binding antibody heavy chain-encoding
nucleic acid molecule, comprising a variable region-encoding exon
operably linked to a first, second and third constant
region-encoding exon, said nucleic acid molecule further comprising
at least one intron sequence, wherein said intron sequence enhances
said heavy chain expression from said nucleic acid molecule
relative to an A.beta. peptide binding antibody heavy
chain-encoding nucleic acid molecule not comprising said intron and
wherein said nucleic acid molecule does not lead to the translation
of an intron read-through (IRT) heavy chain by-product.
66. An expression cassette comprising the nucleic acid molecule of
any one of the proceeding claims.
67. An expression vector comprising the nucleic acid molecule of
any one of the proceeding claims.
68. The expression vector of claim 67, further comprising a gene
encoding a selectable marker and an internal ribosomal entry site
sequence (IRES).
69. A cell comprising the nucleic acid molecule of any one of
claims 54-68.
70. A mammalian cell comprising the cassette of claim 66.
71. A mammalian cell comprising the vector of claim 67.
72. The cell of claim 70, which is a Chinese Hamster Ovary (CHO)
cell.
73. A IgG1 heavy chain-encoding nucleotide sequence having the
following formula:
V.sub.H-Int1-C.sub.H1-Int2-Hinge-Int3-C.sub.H2-C.sub.H3 wherein
V.sub.H is any heavy chain variable region-encoding exon; C.sub.H1,
C.sub.H2 and C.sub.H3 are human heavy chain constant
region-encoding exons derived from a naturally-occurring IgG1 heavy
chain gene; Int1, Int2 and Int3 are corresponding introns derived
from said gene and Int2 and Int 3 are optionally present; and Hinge
is a hinge-encoding exon derived from said gene.
74. The sequence of claim 73, wherein Int2 and Int3 are
present.
75. A method for producing an antibody preparation substantially
devoid of intron read-through (IRT) heavy chain by-product,
comprising: culturing a cell of any one of claims 70, 71 or 82,
further comprising an A.beta. peptide binding antibody light
chain-encoding nucleic acid molecule, under conditions such that
the heavy and light chains are expressed and operatively associate
in the absence of intron read-through (IRT) heavy chain
by-product.
76. The nucleic acid molecule of claim 1 or 2, wherein the antibody
chain has the sequence set forth as SEQ ID NO: 12.
77. The nucleic acid molecule of claim 1 or 2, wherein the antibody
chain has the sequence set forth as SEQ ID NO:13.
78. An A.beta.-antibody comprising a heavy chain comprising
constant regions encoded by the nucleic acid of any one of SEQ ID
NOs: 6-11 and a variable region encoded by the nucleic acid of SEQ
ID NO:2.
79. An A.beta.-antibody comprising a heavy chain comprising
constant regions encoded by the nucleic acid of any one of SEQ ID
NOs: 6-11 and a variable region encoded by the nucleic acid of SEQ
ID NO:4.
80. An A.beta.-antibody comprising a heavy chain comprising
constant regions encoded by the nucleic acid of any one of SEQ ID
NOs: 6-11 and a variable region having the amino acid sequence set
forth in any of FIG. 12-14 or 16C-16D.
81. The antibody of any one of claims 77-80, further comprising a
corresponding light chain as set forth in one of FIG. 15 or
16A-16B.
82. The cell of claim 71, which is a Chinese Hamster Ovary (CHO)
cell.
83. A mammalian cell comprising the vector of claim 68.
Description
CROSS-REFERENCE TO RELATED APPLICATION
[0001] This application claims priority to U.S. Patent Application
Ser. No. 60/616,474, filed on Oct. 5, 2004, the entire contents of
which are hereby incorporated by reference.
BACKGROUND OF THE INVENTION
[0002] Expression vectors for the production of recombinant
proteins have existed since at least the mid 1980s. Typically,
vector-based strategies for recombinant protein expression have
largely been employed in basic research and for small-scale
experimentation where the absolute purity of a protein preparation
is not critical. In contrast, when recombinant proteins are used
for therapeutic applications, even minor contaminants, for example,
the presence of mis-spliced or intron read-through by-products can
diminish the activity and yield of the resultant therapeutic
proteins. Administration of therapeutic proteins having mis-spliced
or read-through protein sequences to patients may increase the
possibility of undesirable side effects.
[0003] Such by-products are also troublesome for manufacturing. The
presence of by-products can compromise the purification process
because such by-products are typically similar to the desired
proteins in terms of size, affinity, or bioactivity. Still further,
it has been observed that scaling up protein expression using
recombinant host cells typically results in increasing amounts of
by-products as compared to the desired product, particularly if the
cells are cultured under less than optimal cell culture conditions.
Such sub-optimal cell culture conditions frequently occur in large
scale protein production, for example, at the end of a biofermenter
run or when, for other reasons, where the health of the large scale
culture deteriorates.
[0004] Accordingly, there exists a need for methods for improving
recombinant protein production, particularly, for the large-scale
production of therapeutic proteins.
SUMMARY OF THE INVENTION
[0005] The present invention provides methods and compositions for
improving recombinant protein or peptide expression and/or
production. In one embodiment, nucleic acid molecules are provided
that are modified to reduce or eliminate mis-spliced and/or intron
read-through by-products, and/or to enhance recombinant protein
expression. In certain embodiments, the nucleic acids encode
recombinant antibodies (also referred to herein as
immunoglobulins), or fragments thereof.
[0006] The invention further includes vectors (e.g., expression
vectors) modified to reduce or eliminate mis-spliced and/or intron
read-through by-products and/or to enhance recombinant protein
expression; host cells, e.g., mammalian host cells, including such
nucleic acid molecules and vectors; and methods for culturing such
cells to produce the recombinant proteins or peptides, e.g., in
large-scale. Compositions, e.g., pharmaceutical compositions, of
recombinant proteins or peptides, e.g., antibodies, substantially
free of mis-spliced and/or intron read-through products, are also
disclosed. These compositions are suitable for therapeutic use,
including, for example, the treatment of neurodegenerative and
malignant disorders.
[0007] In particular, the invention provides compositions and
methods for expressing a therapeutic antibody for use in the
treatment of a neurodegenerative disease. The integrity of such
antibodies is especially important such that, for example,
therapeutic activity of the molecule per unit dose is maintained
and purification is improved. There is an acute desire to improve
the purity of such proteins intended for specialized functions, for
delivery and use in certain biological indications, for example,
treating neurodegenerative conditions, where therapeutic
polypeptides traverse the blood-brain-barrier (BBB) and bind a
target antigen in the brain. An exemplary antibody produced
according the invention is an antibody produced at high purity for
binding a neurodegenerative disease target, for example, the
amyloid protein of Alzheimer's disease, i.e., the amyloid-beta
peptide (A.beta.).
[0008] Accordingly, in one aspect, the invention features a nucleic
acid molecule (e.g., a modified or recombinant nucleic acid
molecule) that includes a nucleotide sequence having one or more
intron and exon sequences, wherein at least one intron sequence has
been modified compared to the naturally-occurring sequence to
enhance protein expression and/or reduce or eliminate mis-spliced
or intron read-through (IRT) by-product(s). In one embodiment, the
nucleic acid molecule directs enhanced expression and/or reduces or
eliminates intron read-through (IRT) by-product(s) of a desired
protein or peptide, for example, an antibody or a fragment thereof
(e.g., an immunoglobulin heavy chain) relative to a naturally
occurring sequence (e.g., a genomic sequence). The protein or
peptide can be of mammalian origin, e.g., human or murine,
typically, of human origin. The nucleic acid molecule described
herein is understood to refer to a modified form from the
naturally-occurring sequence. In some embodiments, the nucleic acid
molecule is isolated or purified. In other embodiments, it is a
recombinant molecule.
[0009] In one embodiment, the nucleic acid molecule has at least
one, two, three introns, or up to all but one intron, deleted
compared to the naturally-occurring sequence (e.g., the genomic
sequence). For example, an intron that facilitates intron
read-through (IRT) can be deleted from the naturally-occurring
sequence. In other embodiments, the nucleic acid molecule is
modified by one or more of: re-arranging the intron/exon
configuration (e.g., intron/exon 5' to 3' order); deleting a
portion of one or more introns; or replacing an intron or portion
thereof with a heterologous intron sequence, such that enhanced
protein expression and/or reduction or elimination of mis-spliced
or intron read-through (IRT) by-product(s) occurs.
[0010] In a related embodiment, the nucleic acid molecule includes
a nucleotide sequence (e.g., a human genomic sequence) encoding an
antibody heavy chain or a fragment thereof. For example, the
nucleotide sequence can include one or more nucleotide (e.g., exon)
sequences encoding a heavy chain variable region, a hinge region,
and a first, second, and third constant regions (e.g., C.sub.H1,
C.sub.H2, C.sub.H3) of an immunoglobulin subtype, e.g., an
immunoglobulin G subtype (e.g., an IgG1, IgG2, IgG3, or IgG4
antibody subtype). Typically, the immunoglobulin subtype is from
mammalian origin, e.g., murine or human. In one embodiment, a human
IgG1 or IgG4, or a mutated version thereof is chosen. For example,
the constant region of an immunoglobulin can be mutated to result
in one or more of: increased stability, reduced effector function,
or reduced complement fixation. In one embodiment, human IgG4 is
mutated to increase stability, e.g., having a replacement at
residue 241 from serine to proline to increase stability of the
hinge region. In other embodiments, the constant region is mutated
to reduce glycosylation.
[0011] In one embodiment, the nucleic acid molecule is modified to
delete at least one intron that facilitates intron-read through of
the sequence. For example, an intron between C.sub.H2 and C.sub.H3
of the immunoglobulin heavy chain constant region can be deleted.
Examples of other heavy chain immunoglobulin introns that can be
deleted individually or in combination include an intron between
the heavy chain variable region and C.sub.H1, an intron between
C.sub.H1 and the hinge region, and an intron between the hinge
region and C.sub.H2, of the immunoglobulin heavy chain constant
region. Any combination of the preceding introns can be deleted,
including a combination of two, three introns, or up to all but one
intron, of the aforesaid introns. In some embodiments, three
introns of the heavy chain constant region are deleted, for
example, the intron between C.sub.H1 and the hinge region, the
intron between the hinge region and C.sub.H2, and the intron
between C.sub.H2 and C.sub.H3. The following exemplary combinations
of intron deletions of a heavy chain immunoglobulin are also within
the scope of the present invention: an intron between C.sub.H1 and
the hinge region, and an intron between C.sub.H2 and C.sub.H3; an
intron between C.sub.H1 and the hinge region, and an intron between
the hinge region and C.sub.H2; an intron between the hinge region
and C.sub.H2 and an intron between C.sub.H2 and C.sub.H3 of the
immunoglobulin heavy chain constant region.
[0012] In some embodiments, the nucleic acid molecule includes a
nucleotide sequence represented by the formula:
V.sub.H-Int1-C.sub.H1-Int2-Hinge-Int3-C.sub.H2-Int4-C.sub.H3,
[0013] wherein V.sub.H is a nucleotide sequence encoding a heavy
chain variable region;
[0014] C.sub.H1, C.sub.H2, and C.sub.H3 are nucleotide sequences
encoding the corresponding heavy chain constant region, e.g., a
naturally-occurring or a mutated form of human IgG1 or IgG4 heavy
chain gene;
[0015] Hinge is a nucleotide sequence encoding a hinge region of a
heavy chain constant region, e.g., a naturally-occurring or a
mutated form of human IgG1 or IgG4 heavy chain gene; and
[0016] Int1, Int2, Int3 and Int4 are introns from the heavy chain
genomic sequence. In one embodiment, the intron between C.sub.H2
and C.sub.H3, represented herein as Int4 is deleted. In other
embodiments, one, two, or typically three of the introns between
C.sub.H1 and the hinge region, between the hinge region and
C.sub.H2, and/or between C.sub.H2 and C.sub.H3, represented herein
as Int2, Int3 and Int4, are deleted. Additional schematic
representations of the intron/exon arrangements of the heavy chain
genomic sequence are shown in FIGS. 1, 5, and 7.
[0017] Typically, at least one intron is present in the nucleic
acid molecule, for example, the intron between the heavy chain
variable region and C.sub.H1, represented herein as Int1. Examples
of other heavy chain immunoglobulin introns that can be present
individually or in combination include an intron between C.sub.H1
and the hinge region; an intron between the hinge region and
C.sub.H2; and an intron between C.sub.H2 and C.sub.H3 of the
immunoglobulin heavy chain constant region. It is often desirable
to include at least one intron in the modified nucleic acid
molecule. Without being bound by theory, introns are believed to
influence a number of events in the protein production process,
including transcription rate, polyadenylation, mRNA export,
translational efficiency, and mRNA decay.
[0018] In one embodiment, the nucleic acid molecule includes a
nucleotide sequence represented by the formula:
V.sub.H-Int1-C.sub.H1-Int2-Hinge-Int3-C.sub.H2-C.sub.H3,
[0019] wherein V.sub.H is a nucleotide sequence encoding a heavy
chain variable region;
[0020] C.sub.H1, C.sub.H2, and C.sub.H3 are nucleotide sequences
encoding the corresponding heavy chain constant region, e.g., a
naturally-occurring or mutated form of human IgG1 or IgG4 heavy
chain gene;
[0021] Hinge is a nucleotide sequence encoding a hinge region of a
heavy chain constant region, e.g., a naturally-occurring or mutated
form of human IgG1 or IgG4 heavy chain gene; and
[0022] Int1, Int2 and Int3 are introns from the heavy chain genomic
sequence. In one embodiment, the nucleotide sequence consists
essentially of the constituents depicted above, e.g., without an
intervening sequence that alters the structure or function.
[0023] In other embodiments, the nucleic acid molecule includes a
nucleotide sequence represented by the formula:
V.sub.H-Int1-C.sub.H1-Hinge-C.sub.H2-C.sub.H3,
[0024] wherein V.sub.H is a nucleotide sequence encoding a heavy
chain variable region;
[0025] C.sub.H1, C.sub.H2, and C.sub.H3 are nucleotide sequences
encoding the corresponding heavy chain constant region, e.g., a
naturally-occurring or mutated form of human IgG1 or IgG4 heavy
chain gene;
[0026] Hinge is a nucleotide sequence encoding a hinge region of a
heavy chain constant region, e.g., a naturally-occurring or mutated
form of human IgG1 or IgG4 heavy chain gene; and
[0027] Int1 is an intron from the heavy chain genomic sequence. In
one embodiment, the nucleotide sequence consists essentially of the
constituents depicted above, e.g., without an intervening sequence
that alters the structure or function.
[0028] The genomic nucleotide and corresponding amino acid
sequences for human IgG1 are shown in FIG. 8 (SEQ ID NO:1 and 2,
respectively). Exons encoding C.sub.H1, the hinge region, C.sub.H2,
and C.sub.H3 are located at about nucleotides 231 to 524, 916 to
960, 1079 to 1408, and 1506 to 1829, of FIG. 8 (SEQ ID NO:1),
respectively. The Int1, Int2, Int3 and Int4 correspond to introns
from the human IgG1 heavy chain genomic sequence located from about
nucleotides 1 to 230, about nucleotides 525 to 915, about
nucleotides 961 to 1078, and about nucleotides 1409 to 1505, of
FIG. 8 (SEQ ID NO:1), respectively.
[0029] The genomic nucleotide and corresponding amino acid
sequences for mutated human IgG4 are shown in FIG. 9 (SEQ ID NO:3
and 4 respectively). Exons encoding C.sub.H1, the hinge region,
C.sub.H2, and C.sub.H3 are located at about nucleotides 231 to 524,
916 to 952, 1071 to 1400, and 1498 to 1820, of FIG. 9 (SEQ ID
NO:3), respectively. Int1, Int2, Int3, and Int4 correspond to
introns from the human IgG4 heavy chain genomic sequence located
from about nucleotides 1 to 230, about nucleotides 525 to 916,
about nucleotides 953 to 1070, and about nucleotides 1401 to 1497,
of FIG. 9 (SEQ ID NO:3), respectively.
[0030] Examples of modified nucleic acid molecules of the present
invention include a human genomic heavy chain constant region
sequence having a deletion of the intron between CH2 and CH3 of,
human IgG1, corresponding to about nucleotides 1409 to 1505 of FIG.
8 (SEQ ID NO:1), or of mutated human IgG4, corresponding to about
nucleotides 1401 to 1497 of FIG. 9 (SEQ ID NO:3). Examples of other
heavy chain immunoglobulin introns that can be deleted individually
or in combination include an intron between the heavy chain
variable region and CH1 of, human IgG1, corresponding to about
nucleotides 1 to 230 of FIG. 8 (SEQ ID NO: 1), or mutated human
IgG4, corresponding to about nucleotides 1 to 230 of FIG. 9 (SEQ ID
NO:3); an intron between CH1 and the hinge region of, human IgG1,
corresponding to about nucleotides 525 to 915 of FIG. 8 (SEQ ID
NO:1), or mutated human IgG4, corresponding to about nucleotides
525 to 916 of FIG. 9 (SEQ ID NO:3); and an intron between the hinge
region and CH2, of human IgG1, corresponding to about nucleotides
961 to 1078 of FIG. 8 (SEQ ID NO:1), or mutated human IgG4,
corresponding to about nucleotides 953 to 1070 of FIG. 9 (SEQ ID
NO:3). Any combination of the preceding introns can be deleted,
including a combination of two, three, four introns, or up to all
but one intron, of the aforesaid introns can be deleted. In some
embodiments, three introns of the heavy chain constant region are
deleted, for example, the intron between CH1 and the hinge region,
between the hinge region and CH2, and between CH2 and CH3. In some
embodiments, the nucleic acid molecule includes one or more of the
exonic nucleotide sequences, and one or more (but not all) of the
intronic nucleotide sequences, for human IgG1 or IgG4 disclosed
herein, or a sequence substantially identical thereto. In a related
embodiment, the nucleic acid molecule has a deletion in one or more
(but not all) of the intronic nucleotide sequences, for human IgG1
or IgG4 disclosed herein, or a sequence substantially identical
thereto.
[0031] In one embodiment, the modified nucleic acid molecule
includes the nucleotide sequence encoding human IgG1 shown as FIG.
10 (SEQ ID NO:5) or a sequence substantially identical thereto
(e.g., a sequence at least 85%, 90%, 95%, or 99% identical to SEQ
ID NO:5, or having one, five, ten, fifty or more nucleotide changes
compared to the nucleotide sequence of SEQ ID NO:5).
[0032] In another embodiment, the modified nucleic acid molecule
includes the nucleotide sequence of modified human IgG4 shown as
FIG. 11 (SEQ ID NO:6) or a sequence substantially identical thereto
(e.g., a sequence at least 85%, 90%, 95%, or 99% identical to SEQ
ID NO:6, or having one, five, ten, fifty or more nucleotide changes
compared to the nucleotide sequence of SEQ ID NO:6).
[0033] The modified nucleic acid molecule can include a nucleotide
sequences encoding a light and heavy chain antibody or
immunoglobulin sequence. Such sequences can be present in the same
nucleic acid molecule (e.g., the same expression vector) or
alternatively, can be expressed from separate nucleic acid
molecules (e.g., separate expression vectors). Typically, the
encoded antibody or immunoglobulins or fragments thereof can
include at least one, and preferably two full-length heavy chains,
and at least one, and preferably two light chains. Alternatively,
the encoded immunoglobulins or fragments thereof can include only
an antigen-binding fragment (e.g., an Fab, F(ab').sub.2, Fv or a
single chain Fv fragment). The antibody or fragment thereof can be
a monoclonal or single specificity antibody. The antibody or
fragment thereof can also be a human, humanized, chimeric,
CDR-grafted, or in vitro generated antibody. In yet other
embodiments, the antibody has a heavy chain constant region chosen
from, e.g., IgG1, IgG2, IgG3, IgG4, IgM, IgA1, IgA2, IgD, and IgE;
more particularly, chosen from, e.g., IgG1, IgG2, IgG3, and IgG4.
In another embodiment, the antibody has a light chain chosen from,
e.g., kappa or lambda.
[0034] In another embodiment, the nucleic acid molecule includes a
variable region, for example a humanized, chimeric, CDR-grafted, or
in vitro generated variable region. Typically, the variable region
specifically binds to a predetermined antigen, e.g., an antigen
associated with a disorder, e.g., a neurodegenerative or a
malignant disorder.
[0035] In one embodiment, the disorder is a neurodegenerative
disorder and the antibody binds to an amyloid protein, for example,
an A.beta. peptide (e.g., a human A.beta. peptide). For example,
the antibody can be a humanized antibody against an A.beta. peptide
having a heavy chain and light chain variable regions containing
one or more complementarity determining regions (CDRs) from a
murine antibody, e.g., the mouse anti-A.beta. 3D6 antibody, or the
mouse anti-A.beta. 12A11 antibody, or the mouse anti-A.beta. 10D5
antibody, or the mouse anti-A.beta. 12B4 antibody. The variable
region of the humanized antibody typically includes a human or
substantially human framework region. In one embodiment, the
nucleic acid molecule includes the heavy and light chain variable
regions of the humanized anti-A.beta. peptide antibody.
[0036] In another aspect, the invention features a vector (e.g., an
expression vector) including one or more of the foregoing modified
nucleic acid molecules. The vector can additionally include a
nucleotide sequence that enhances one or more of: replication,
selection, mRNA transcription, mRNA stability, protein expression
or protein secretion, in a host cell. For example, the vector may
include nucleotide sequences responsible for replication or
enhancer expression, enhancer promoter elements, nucleotide
sequences encoding a leader sequence, a gene encoding a selectable
marker (e.g., DHFR), an internal ribosomal entry site sequence
(IRES), and polyadenylation sequences).
[0037] In another aspect, the invention provides a cell, for
example, a eukaryotic host cell, e.g., a mammalian host cell (e.g.,
a Chinese Hamster Ovary (CHO) cell), including one of the foregoing
nucleic acid molecules and/or vectors, e.g., expression vectors.
The cell can be transiently or stably transfected with the nucleic
acid sequences of the invention.
[0038] In another aspect, the invention provides a method for
enhancing expression of recombinant proteins or peptides, e g.,
antibodies, or expressing recombinant proteins or peptides, e.g.,
antibodies having reduced levels of (e.g., substantially free of)
mis-spliced and/or intron read-through products, compared to a
reference, e.g., a naturally occurring genomic sequence. The method
includes introducing a nucleic acid molecule as described herein
into a host cell, e.g., a mammalian host cell (e.g., a CHO cell);
culturing said host cell under conditions that allow expression of
the recombinant protein or peptide to produce a culture of host
cells; and optionally, obtaining, e.g., purifying, the recombinant
protein or peptide, from the culture of host cells (e.g., host cell
supernatants).
[0039] The method can further include the steps of identifying
(e.g., detecting and/or determining the level of) IRT or an IRT
product, in a nucleic acid sample, e.g., an mRNA sample from the
host cell, by contacting said sample with nucleic acid probes
complementary to an intron and an adjacent exon sequence, or
alternatively, complementary to adjacent exon sequences, under
conditions that allow hybridization of the nucleic acid sample and
the probes; detecting the resulting complex, e.g., by PCR
amplification of the probe sequences. Detection of a complex, e.g.,
a PCR amplified product, in the sample containing the nucleic acid
probe complementary to the intron sequence is indicative of the
occurrence IRT or the IRT product. The level of an IRT product can
be quantified as described, e.g., in Example 1.
[0040] In another aspect, a method for producing an antibody or
fragment thereof having reduced (e.g., substantially devoid of)
intron read-through (IRT) heavy chain by-product, compared to a
standard reference, e.g., a naturally occurring genomic sequence,
is provided. The method includes culturing a cell, e.g., a
mammalian cell (e.g., a CHO cell) containing a nucleic acid
molecule as described herein and, optionally, a nucleic acid
encoding an antibody light chain, under conditions such that the
heavy and light chains are expressed and, optionally, operatively
associate. The antibody or fragment thereof are, optionally,
purified from the cell culture. Typically, the antibody, or
fragment thereof, has reduced mis-spliced or intron read-through
(IRT) heavy chain by-product.
[0041] The method can further include the steps of detecting and/or
determining the level of IRT, or an IRT product, in a sample, e.g.,
an MRNA sample from the host cell; contacting said sample with
nucleic acid probes complementary to an intron and an adjacent exon
sequence, or alternatively, complementary to adjacent exon
sequences, under conditions that allow hybridization of the nucleic
acid sample and the probes; detecting the resulting complex, e.g.,
by PCR amplification of the probe sequences. Detection of a
complex, e.g., a PCR amplified product, in the sample containing
the nucleic acid probe complementary to the intron sequence is
indicative of the occurrence IRT, or the IRT product. The level of
an IRT product can be quantified as described, e.g., in Example
1.
[0042] In another aspect, the invention provides a method of
reducing intron read-through (IRT) antibody heavy chain by-product
expressed from a genomic heavy chain sequence, by deleting at least
one intron from said sequence, wherein said intron facilitates
IRT.
[0043] In another aspect, the invention features a method of
identifying (e.g., detecting and/or determining the level of) IRT
or an IRT product, in a sample, e.g., a nucleic acid sample. The
method includes: obtaining a nucleic acid sample, e.g., an mRNA
sample from a cell, e.g., a recombinant cell (e.g., a host cell as
described herein); contacting said nucleic acid sample with nucleic
acid probes complementary to an intron and an adjacent exon
sequence, or alternatively, complementary to adjacent exon
sequences, under conditions that allow hybridization of the nucleic
acid sample and the probes; detecting the resulting complex, e.g.,
by PCR amplification of the probe sequences. Detection of a
complex, e.g., a PCR amplified product, in the sample containing
the nucleic acid probe complementary to the intron sequence is
indicative of the occurrence IRT, or the IRT product. The level of
an IRT product can be quantified as described, e.g., in Example
1.
[0044] In another aspect, the invention features an antibody (e.g.,
a recombinant antibody), or fragment thereof, having reduced (e.g.,
substantially free of) mis-spliced and/or intron read-through
products, compared to a reference, e.g., a naturally occurring
genomic sequence, produced according to the methods disclosed
herein. In one embodiment, the antibody or fragment thereof is a
chimeric, humanized, CDR-grafted or an in vitro generated antibody.
Typically, the antibody or fragment thereof has a variable region
that specifically binds to a predetermined antigen, e.g., an
antigen associated with a disorder, e.g., a neurodegenerative
disorder.
[0045] In another aspect, the invention provides a composition,
e.g., a pharmaceutical composition, containing recombinant proteins
or peptides, e.g., antibodies, having reduced (e.g., substantially
free of) mis-spliced and/or intron read-through products, compared
to a reference, e.g., a naturally occurring genomic sequence, and a
pharmaceutically acceptable carrier. These compositions are
suitable for therapeutic use, including, for example, treatment of
neurodegenerative disorders.
[0046] Other features and advantages of the invention will be
apparent from the following detailed description and claims.
BRIEF DESCRIPTION OF THE DRAWINGS
[0047] FIG. 1 depicts the expected pre-mRNA transcribed from the
expression vector containing the 3D6 IgG gene (top) as well as the
correctly spliced mRNA (middle) and intron-read through mRNA
(bottom).
[0048] FIG. 2 shows the nucleic acid sequence spanning the intron
between the CH2 and CH3 constant regions (referred to as the fourth
intron) of the 3D6 heavy-chain expression vector indicating genomic
5' and 3' splice junctions (SEQ ID NO:7). Also shown is the
predicted partial amino acid sequence of the polypeptides derived
from correctly (SEQ ID NO:8) and incorrectly (SEQ ID NO:9) spliced
mRNA. The RNA splice junctions are indicated by a solid double
line.
[0049] FIG. 3 is a schematic representation of the
quantitative-polymerase chain reaction (Q-PCR) probes used to
evaluate total levels of 3D6 heavy chain gene transcription (levels
of CH2 containing mRNA transcript) and levels of intron 4
read-through transcription.
[0050] FIG. 4 is a bar graph demonstrating the increased
accumulation of intron 4 containing transcripts in response to time
in culture and protein expression induction.
[0051] FIG. 5 provides drawings of the genomic arrangement of 3D6
introns and exons and the modified arrangement used in an
expression vector developed to resolve intron read through
transcription.
[0052] FIG. 6 shows reverse-phase high-performance liquid
chromatography (RP-HPLC) chromatograms demonstrating the lack of
intron read through heavy chain by-products in a cell line
transformed with modified expression vectors.
[0053] FIG. 7 depicts the arrangement of introns and exons in a
heavy chain genomic construct, a construct, the construct with the
last three intronic sequences deleted, and the cDNA construct
containing no introns.
[0054] FIG. 8 shows the genomic nucleotide and corresponding amino
acid sequences for human IgG1 are shown in (SEQ ID NO:1 and 2,
respectively). Exons encoding C.sub.H1, the hinge region, C.sub.H2,
and C.sub.H3 are located at about nucleotides 231 to 524, 916 to
960, 1079 to 1408, and 1506 to 1829, respectively (SEQ ID NO:1).
The Int1, Int2, Int3 and Int4 correspond to introns from the human
IgG1 heavy chain genomic sequence located from about nucleotides 1
to 230, about nucleotides 525 to 915, about nucleotides 961 to
1078, and about nucleotides 1409 to 1505, respectively (SEQ ID
NO:1).
[0055] FIG. 9 shows the genomic nucleotide and corresponding amino
acid sequences for human IgG4 are shown in (SEQ ID NO:3 and 4,
respectively). Exons encoding C.sub.H1, the hinge region, C.sub.H2,
and C.sub.H3 are located at about nucleotides 231 to 524, 916 to
952, 1071 to 1400, and 1498 to 1820, respectively, (SEQ ID NO:3).
Int1, Int2, Int3, and Int4 correspond to introns from the human
IgG4 heavy chain genomic sequence located from about nucleotides 1
to 230, about nucleotides 525 to 916, about nucleotides 953 to
1070, and about nucleotides 1401 to 1497, respectively (SEQ ID
NO:3);
[0056] FIG. 10 shows the genomic nucleotide sequence of human IgG1
(SEQ ID NO:5) having the intron between CH2 and CH3 of the constant
region deleted.
[0057] FIG. 11 shows the genomic nucleotide sequence of modified
human IgG4 (SEQ ID NO:6) having the following intron deletions:
intron between CH1 and hinge, intron between hinge and CH2, and
intron between CH2 and CH3.
[0058] FIGS. 12 to set forth the heavy chain amino acid sequences
for various additional 3D6, 10D5, 12B4 and 266 antibodies.
[0059] FIGS. to set forth the heavy chain amino acid sequences for
various additional 3D6, 10D5, 12B4 and 266 antibodies.
DETAILED DESCRIPTION OF THE INVENTION
[0060] A number of approaches may be taken in the design and
construction of expression vectors, and the process typically
requires substantial trial and error experimentation before
reasonable levels of a protein are produced. A significant
consideration in the design process concerns the use of intron
sequences in the construction of the vector. In one approach, an
entire gene sequence may be utilized as it occurs
naturally--containing the full complement of both intronic and
exonic sequences. In such a case, it is expected that
post-transcriptional splicing machinery within the cell will excise
intronic sequences to yield a mature mRNA containing only exonic
sequences of the gene. A second approach is to utilize sequence
corresponding to the cDNA of the gene only. In this case, it is
predicted that no splicing events occur and the pre-mRNA sequence
is substantially the same as the mRNA sequence in protein coding
content. In yet a third case, vector construction involves the
selection and placement of introns not normally associated with the
original gene sequence.
[0061] The effect of intronic sequences on the expression of genes
within the context of a vector is incompletely understood. It has
been reported that introns may effect a number of events in the
process of protein production including transcription rate,
polyadenylation, mRNA export, translational efficiency, and mRNA
decay (Nott et al (2003) RNA 9:607-617). Within the context of mRNA
expression, there has been no bright line of predictability
regarding the result of an intron on the yield of protein from a
vector. For example, it has been variously reported that including
various intronic sequences can cause large increases in expression,
have no effect, or reduce mRNA expression (Berg et al. (1988) Mol.
Cell Biol. 8:4395-4405; Bourdon et al. (2001) EMBO Rep. 2:394-398).
Since most higher eukaryotic genes contain introns, the development
of a system which may be used to predictably express
intron-containing genes at high levels and with close fidelity to
the exonic sequences of the gene in the absence of unwanted
read-through by products is obviously an aid to the predictable
development of protein expression systems.
[0062] While the unpredictability associated with intronic
sequences poses a hurdle to reliable expression vector design, a
significant design benefit can be realized when the protein of
interest has a modular form which is amenable to genetic
engineering techniques. Antibodies provide one such example wherein
the inclusion of intronic sequences facilitates expression vector
design.
[0063] Certain terms used in the specification and claims are
defined below.
[0064] As used herein, the term "intron" includes a segment of DNA
that is transcribed, but removed from the RNA transcript by
splicing together the sequences (exons) on either side of it.
Introns are considered to be intervening sequences within the
protein coding region of a gene and generally do not contain
information represented in the protein produced from the gene.
[0065] The term "exon" includes any segment of a gene containing
intervening sequences that is represented in the mature RNA
product. Exons comprise the information within a gene which are
translated into proteins.
[0066] The term "pre-mRNA" includes the initial RNA product
resulting from the transcription of a gene by RNA polymerase. RNA
designated as pre-mRNA contains both intronic and exonic sequences
and, hence, has not been processed by the splicing machinery of the
cell.
[0067] The term "mRNA" includes an RNA transcript that has been
processed to remove introns and is capable of being translated into
a polypeptide.
[0068] The term "splicing" includes the cellular event occurring in
the nuclei of eukaryotic cells wherein introns are removed from
pre-mRNA species. Generally the process requires the formation of a
spliceosome complex in which a 5' splice donor site is brought into
proximity with a 3' splice acceptor site and the intervening
intronic sequence removed from the transcript.
[0069] The term "vector" includes a nucleic acid construct often
comprising a gene or genes of interest and further comprising
minimal elements requisite for the nucleic acid to replicate and/or
be transcribed in a host cell. Such constructs may exist as
extrachromasomal elements or may be integrated into the genome of a
host cell.
[0070] The phrase "intron read-through" ("IRT") denotes the process
whereby aberrant splicing of a pre-mRNA transcript yields a protein
or peptide of alternate size or amino acid constituency. Varying
results may occur concerning the ultimate protein produced from the
mis-spliced transcript. For example, a larger than predicted
protein or a protein with an incorrect stop codon may occur, in
which case the protein may be longer or shorter than predicted,
respectively. Further, the protein may also have incorrect or
additional residues facilitating protein modification for
glycosylation, myristoylation, phosphorylation, ubiquitination, or
other post-translational modifications.
[0071] The term "intron read-through by-product" refers to proteins
or peptides that are translated from aberrantly-spliced MRNA
resulting from intron read-through, e.g., proteins of unpredicted
size or amino acid constituency. Intron read-through by products
may be shorter or longer than the polypeptides predicted by the
genes known amino acid sequence and/or predicted by the cDNA of the
gene. Intron read-through by products may also have apparent
molecular weights differing from the accepted molecular weight of
proteins arising from the correctly spliced mRNA of the gene.
Further, the term "intron read-through by-products" includes
proteins that occur from proteolytic processing events not normally
associated with the protein of interest, said proteolytic
processing arising potentially from frame shifted protein products
due to read through of an intron-exon-junction.
[0072] The term "heavy chain by-product" refers to polypeptides
that are translated from aberrantly spliced immunoglobulin heavy
chain mRNA resulting from intron read-through, e.g. a heavy chain
protein of unpredicted size or amino acid constituency. Heavy chain
byproducts may be shorter or longer than the polypeptide predicted
by the immunoglobulin gene's known amino acid sequence and/or
predicted by the cDNA of the gene. Heavy chain by-products may also
have apparent molecular weights differing from the accepted
molecular weight of proteins arising from the correctly spliced
mRNA of the heavy chain gene. Further, the term "heavy chain
by-products" includes polypeptides that occur from proteolytic
processing events not normally associated with the protein.
[0073] The phrase "naturally-occurring sequence" or
"naturally-occurring genomic sequence" refers to the intronic and
exonic organization of a gene found in its natural or native state.
The naturally-occurring sequence can be found in, e.g., its natural
chromosomal location or cloned into a vector, so long as the
intronic and exonic organization of the sequence is retained.
[0074] The term "immunoglobulin" or "antibody" (used
interchangeably herein) refers to a protein having a
four-polypeptide chain structure consisting of two heavy and two
light chains, said chains being stabilized, for example, by
interchain disulfide bonds, wherein the immunoglobulin or antibody
has the ability to selectively or specifically bind an antigen.
[0075] The term A.beta.-immunoglobulin of A.beta.-antibody refers
to an antibody which selectively or specifically binds an A.beta.
peptide.
[0076] The term "single-chain immunoglobulin" or "single-chain
antibody" (used interchangeably herein) refers to a protein having
a two-polypeptide chain structure consisting of a heavy and a light
chain, said chains being stabilized, for example, by interchain
peptide linkers, wherein the immunoglobulin or antibody has the
ability to specifically bind antigen.
[0077] The term "immunoglobulin or antibody domain" refers to a
globular region within a heavy or light chain polypeptide including
peptide loops (e.g., including 3 to 4 peptide loops) stabilized,
for example, by .beta.-pleated sheet and/or intrachain disulfide
bond. Domains are further referred to herein as "constant" or
"variable" wherein the term "constant" refers to the relative lack
of sequence variation within the domains of various class members
in the case of a "constant" domain and wherein the term "variable"
refers to the significant variation within the domains of various
class members in the case of a "variable" domain. Antibody or
polypeptide "domains" are often referred to interchangeably in the
art as antibody or polypeptide "regions." The "constant" domains of
an antibody light chain are referred to interchangeably as "light
chain constant regions," "light chain constant domains," "CL"
regions or "CL" domains. The "constant" domains of an antibody
heavy chain are referred to interchangeably as "heavy chain
constant regions," "heavy chain constant domains," "CH" regions or
"CH" domains. The "variable" domains of an antibody light chain are
referred to interchangeably as "light chain variable regions,"
"light chain variable domains," "VL" regions or "VL" domains. The
"variable" domains of an antibody heavy chain are referred to
interchangeably as "heavy chain constant regions," "heavy chain
constant domains," "VH" regions or "VH" domains.
[0078] The term "region" can also refer to a part or portion of an
antibody chain or antibody chain domain (e.g., a part or portion of
a heavy or light chain or a part or portion of a constant or
variable domain, as defined herein), as well as more discrete parts
or portions of said chains or domains. For example, light and heavy
chains or light and heavy chain variable domains include
"complementarity determining regions" or "CDRs" interspersed among
"framework regions" or "FRs", as defined herein.
[0079] Immunoglobulins or antibodies can exist in monomeric or
polymeric form, for example, IgM antibodies, which exist in
pentameric form, and/or IgA antibodies, which exist in monomeric,
dimeric or multimeric form. The term "fragment" refers to a part or
portion of an antibody or antibody chain including fewer amino acid
residues than an intact or complete antibody or antibody chain.
Fragments can be obtained via chemical or enzymatic treatment of an
intact or complete antibody or antibody chain. Fragments can also
be obtained by recombinant means. Exemplary fragments include Fab,
Fab', F(ab').sub.2, Fabc, and/or Fv fragments. The term
"antigen-binding fragment" refers to a polypeptide fragment of an
immunoglobulin or antibody that binds antigen or competes with
intact antibody (i.e., with the intact antibody from which they
were derived) for antigen binding (i.e., specific binding).
[0080] The term "conformation" refers to the tertiary structure of
a protein or polypeptide (e.g., an antibody, antibody chain, domain
or region thereof). For example, the phrase "light (or heavy) chain
conformation" refers to the tertiary structure of a light (or
heavy) chain variable region, and the phrase "antibody
conformation" or "antibody fragment conformation" refers to the
tertiary structure of an antibody or fragment thereof. The tern
"conformation" may also refer to quaternary structures resulting
from the three dimensional relationship of one or several proteins
or peptide chains. In relation to antigenic determinants, the
phrase "conformational epitope" refers to an antigenic determinant
including a specific spatial arrangement of amino acids within one
or several proteins existing in close apposition. Considering the
multifunctional nature of antibodies (i.e. the ability of IgG
molecules to bind several epitopes concominantly on more than one
protein molecule), antibodies can be considered as having the
innate ability to bind conformational epitopes comprised by several
amino acid chains. For example, the deposition of A.beta. to form
plaques provides a conformational epitope in which one antibody may
bind several closely positioned A.beta. peptides.
[0081] Binding fragments are produced by recombinant DNA
techniques, or by enzymatic or chemical cleavage of intact
inmmunoglobulins. Binding fragments include Fab, Fab',
F(ab').sub.2, Fabc, Fv, single chains, and single-chain antibodies.
Other than "bispecific" or "bifunctional" immunoglobulins or
antibodies, an immunoglobulin or antibody is understood to have
each of its binding sites identical. A "bispecific" or
"bifunctional antibody" is an artificial hybrid antibody having two
different heavy/light chain pairs and two different binding sites.
Bispecific antibodies can be produced by a variety of methods
including fusion of hybridomas or linking of Fab' fragments. See,
e.g., Songsivilai & Lachmann, Clin. Exp. Immunol. 79:315-321
(1990); Kostelny et al., J. Immunol. 148, 1547-1553 (1992).
[0082] "Specific binding" or "selective binding," of an antibody
means that the antibody exhibits appreciable affinity for a
particular antigen or epitope and, generally, does not exhibit
significant crossreactivity. "Appreciable" or preferred binding
includes binding with an affinity of at least 10.sup.6, 10.sup.7,
10.sup.8, 10.sup.9 M.sup.-1, or 10.sup.10 M.sup.-1. Affinities
greater than 10.sup.7 M.sup.-1, preferably greater than 10.sup.8
M.sup.-1 are more preferred. Values intermediate of those set forth
herein are also intended to be within the scope of the present
invention and a preferred binding affinity can be indicated as a
range of affinities, for example, 10.sup.6 to 10.sup.10 M.sup.-1,
preferably 10.sup.7 to 10.sup.10 M.sup.-1, more preferably 10.sup.8
to 10.sup.10 M.sup.-1. An antibody that "does not exhibit
significant crossreactivity" is one that will not appreciably bind
to an undesirable entity (e.g., an undesirable proteinaceous
entity). For example, an antibody that specifically binds to
A.beta. will appreciably bind A.beta. but will not significantly
react with non-A.beta. proteins or peptides (e.g., non-A.beta.
proteins or peptides included in plaques). An antibody specific for
a particular epitope will, for example, not significantly
crossreact with remote epitopes on the same protein or peptide. In
exemplary embodiments, the antibody exhibits no crossreactivity
(e.g., does not crossreact with non-A.beta. peptides or with remote
epitopes on A.beta.). Specific binding can be determined according
to any art-recognized means for determining such binding.
Preferably, specific binding is determined according to Scatchard
analysis and/or competitive binding assays.
[0083] The term "significant identity" means that two sequences,
e.g., two polypeptide sequences, when optimally aligned, such as by
the programs GAP or BESTFIT using default gap weights, share at
least 50-60% sequence identity, preferably at least 60-70% sequence
identity, more preferably at least 70-80% sequence identity, more
preferably at least 80-90% identity, even more preferably at least
90-95% identity, and even more preferably at least 95% sequence
identity or more (e.g., 99% sequence identity or more). The term
"substantial identity" or "substantially identical" means that two
sequences, e.g., two polypeptide sequences, when optimally aligned,
such as by the programs GAP or BESTFIT using default gap weights,
share at least 80-90% sequence identity, preferably at least 90-95%
sequence identity, and more preferably at least 95% sequence
identity or more (e.g., 99% sequence identity or more). For
sequence comparison, typically one sequence acts as a reference
sequence, to which test sequences are compared. When using a
sequence comparison algorithm, test and reference sequences are
input into a computer, subsequence coordinates are designated, if
necessary, and sequence algorithm program parameters are
designated. The sequence comparison algorithm then calculates the
percent sequence identity for the test sequence(s) relative to the
reference sequence, based on the designated program parameters.
[0084] Optimal alignment of sequences for comparison can be
conducted, e.g., by the local homology algorithm of Smith &
Waterman, Adv. Appl. Math. 2:482 (1981), by the homology alignment
algorithm of Needleman & Wunsch, J. Mol. Biol. 48:443 (1970),
by the search for similarity method of Pearson & Lipman, Proc.
Natl. Acad. Sci. USA 85:2444 (1988), by computerized
implementations of these algorithms (GAP, BESTFIT, FASTA, and
TFASTA in the Wisconsin Genetics Software Package, Genetics
Computer Group, 575 Science Dr., Madison, Wis.), or by visual
inspection (see generally Ausubel et al., Current Protocols in
Molecular Biology). One example of algorithm that is suitable for
determining percent sequence identity and sequence similarity is
the BLAST algorithm, which is described in Altschul et al., J. Mol.
Biol. 215:403 (1990). Software for performing BLAST analyses is
publicly available through the National Center for Biotechnology
Information (publicly accessible through the National Institutes of
Health NCBI internet server). Typically, default program parameters
can be used to perform the sequence comparison, although customized
parameters can also be used. For amino acid sequences, the BLASTP
program uses as defaults a wordlength (W) of 3, an expectation (E)
of 10, and the BLOSUM62 scoring matrix (see Henikoff &
Henikoff, Proc. Natl. Acad. Sci. USA 89:10915 (1989)).
[0085] Preferably, residue positions which are not identical differ
by conservative amino acid substitutions. For purposes of
classifying amino acids substitutions as conservative or
nonconservative, amino acids are grouped as follows: Group I
(hydrophobic sidechains): leu, met, ala, val, leu, ile; Group II
(neutral hydrophilic side chains): cys, ser, thr; Group III (acidic
side chains): asp, glu; Group IV (basic side chains): asn, gln,
his, lys, arg; Group V (residues influencing chain orientation):
gly, pro; and Group VI (aromatic side chains): trp, tyr, phe.
Conservative substitutions involve substitutions between amino
acids in the same class. Non-conservative substitutions constitute
exchanging a member of one of these classes for a member of
another.
Antibodies
[0086] The methodologies of the present invention are applicable in
a variety of antibody production processes where unwanted or
undesirable by-products are detected. In particular, the
methodologies are applicable in production of recombinant
antibodies, such as chimeric and humanized monoclonal antibodies,
where the sequence of the antibody being produced is known.
[0087] The term "humanized immunoglobulin" or "humanized antibody"
refers to an immunoglobulin or antibody that includes at least one
humanized immunoglobulin or antibody chain (i.e., at least one
humanized light or heavy chain). The term "humanized immunoglobulin
chain" or "humanized antibody chain" (i.e., a "humanized
immunoglobulin light chain" or "humanized immunoglobulin heavy
chain") refers to an immunoglobulin or antibody chain (i.e., a
light or heavy chain, respectively) having a variable region that
includes a variable framework region substantially from a human
immunoglobulin or antibody and complementarity determining regions
(CDRs) (e.g. at least one CDR, preferably two CDRs, more preferably
three CDRs) substantially from a non-human immunoglobulin or
antibody, and further includes constant regions (e.g., at least one
constant region or portion thereof, in the case of a light chain,
and preferably three constant regions in the case of a heavy
chain). The term "humanized variable region" (e.g., "humanized
light chain variable region" or "humanized heavy chain variable
region") refers to a variable region that includes a variable
framework region substantially from a human immunoglobulin or
antibody and complementarity determining regions (CDRs)
substantially from a non-human immunoglobulin or antibody.
[0088] The phrase "substantially from a human immunoglobulin or
antibody" or "substantially human" means that, when aligned to a
human immunoglobulin or antibody amino sequence for comparison
purposes, the region shares at least 80-90%, 90-95%, or 95-99%
identity (i.e., local sequence identity) with the human framework
or constant region sequence, allowing, for example, for
conservative substitutions, consensus sequence substitutions,
germline substitutions, back-mutations, and the like. The
introduction of conservative substitutions, consensus sequence
substitutions, germline substitutions, back-mutations, and the
like, is often referred to as "optimization" of a humanized
antibody or chain. The phrase "substantially from a non-human
immunoglobulin or antibody" or "substantially non-human" means
having an immunoglobulin or antibody sequence at least 80-95%,
preferably at least 90-95%, more preferably, 96%, 97%, 98%, or 99%
identical to that of a non-human organism, e.g., a non-human
mammal.
[0089] Accordingly, all regions or residues of a humanized
immunoglobulin or antibody, or of a humanized immunoglobulin or
antibody chain, except possibly the CDRs, are substantially
identical to the corresponding regions or residues of one or more
native human immunoglobulin sequences. The term "corresponding
region" or "corresponding residue" refers to a region or residue on
a second amino acid or nucleotide sequence which occupies the same
(i.e., equivalent) position as a region or residue on a first amino
acid or nucleotide sequence, when the first and second sequences
are optimally aligned for comparison purposes.
[0090] Preferably, humanized immunoglobulins or antibodies bind
antigen with an affinity that is within a factor of three, four, or
five of that of the corresponding non-humanized antibody. For
example, if the non-humanized antibody has a binding affinity of
10.sup.9 M.sup.-1, humanized antibodies will have a binding
affinity of at least 3.times.10.sup.9 M.sup.-1, 4.times.10.sup.9
M.sup.-1, or 5.times.10.sup.9 M.sup.-1. When describing the binding
properties of an immunoglobulin or antibody chain, the chain can be
described based on its ability to "direct antigen (e.g., A.beta. or
5T4) binding." A chain is said to "direct antigen binding" when it
confers upon an intact immunoglobulin or antibody (or antigen
binding fragment thereof) a specific binding property or binding
affinity. A mutation (e.g., a back-mutation) is said to
substantially affect the ability of a heavy or light chain to
direct antigen binding if it affects (e.g., decreases) the binding
affinity of an intact immunoglobulin or antibody (or antigen
binding fragment thereof) comprising said chain by at least an
order of magnitude compared to that of the antibody (or antigen
binding fragment thereof) comprising an equivalent chain lacking
said mutation. A mutation "does not substantially affect (e.g.,
decrease) the ability of a chain to direct antigen binding" if it
affects (e.g., decreases) the binding affinity of an intact
immunoglobulin or antibody (or antigen binding fragment thereof)
comprising said chain by only a factor of two, three, or four of
that of the antibody (or antigen binding fragment thereof)
comprising an equivalent chain lacking said mutation.
[0091] The term "chimeric immunoglobulin" or antibody refers to an
immunoglobulin or antibody whose variable regions derive from a
first species and whose constant regions derive from a second
species. Chimeric immunoglobulins or antibodies can be constructed,
for example by genetic engineering, from immunoglobulin gene
segments belonging to different species. The terms "humanized
immunoglobulin" or "humanized antibody" are not intended to
encompass chimeric immunoglobulins or antibodies, as defined
herein. Although humanized immunoglobulins or antibodies are
chimeric in their construction (i.e., comprise regions from more
than one species of protein), they include additional features
(i.e., variable regions comprising donor CDR residues and acceptor
framework residues) not found in chimeric immunoglobulins or
antibodies, as defined herein.
[0092] Such chimeric and humanized monoclonal antibodies can be
produced by recombinant DNA techniques known in the art, for
example using methods described in Robinson et al. International
Application No. PCT/US86/02269; Akira, et al. European Patent
Application 184,187; Taniguchi, M., European Patent Application
171,496; Morrison et al. European Patent Application 173,494;
Neuberger et al. PCT International Publication No. WO 86/01533;
Cabilly et al. U.S. Pat. No. 4,816,567; Cabilly et al. European
Patent Application 125,023; Better et al. (1988) Science
240:1041-1043; Liu et al. (1987) Proc. Natl. Acad. Sci. USA
84:3439-3443; Liu et al. (1987) J. Immunol. 139:3521-3526; Sun et
al. (1987) Proc. Natl. Acad. Sci. USA 84:214-218; Nishimura et al.
(1987) Canc. Res. 47:999-1005; Wood et al. (1985) Nature
314:446-449; and Shaw. et al. (1988) J. Natl. Cancer Inst.
80:1553-1559); Morrison, S. L. (1985) Science 229:1202-1207; Oi et
al. (1986) BioTechniques 4:214; Winter U.S. Pat. No. 5,225,539;
Jones et al. (1986) Nature 321:552-525; Verhoeyan et al. (1988)
Science 239:1534; and Beidler et al. (1988) J. Immunol.
141:4053-4060.
[0093] Monoclonal, chimeric and humanized antibodies, which have
been modified, e.g., by deleting, adding, or substituting other
portions of the antibody, e.g., the constant region, are also
within the scope of the invention. For example, an antibody can be
modified as follows: (i) by replacing the constant region with
another constant region, e.g., a constant region meant to increase
half-life, stability or affinity of the antibody, or a constant
region from another species or antibody class; or (ii) by modifying
one or more amino acids in the constant region to alter, for
example, the number of glycosylation sites, effector cell function,
Fc receptor (FcR) binding, complement fixation, among others.
Methods for altering an antibody constant region are known in the
art. Antibodies with altered function, e.g. altered affinity for an
effector ligand, such as FcR on a cell, or the C1 component of
complement can be produced by replacing at least one amino acid
residue in the constant portion of the antibody with a different
residue (see e.g., EP 388,151 A1, U.S. Pat. No. 5,624,821 and U.S.
Pat. No. 5,648,260, the contents of all of which are hereby
incorporated by reference). Similar type of alterations could be
described which if applied to the murine, or other species
immunoglobulin would reduce or eliminate these functions.
[0094] For example, it is possible to alter the affinity of an Fc
region of an antibody (e.g., an IgG, such as a human IgG) for an
FcR (e.g., Fc gamma R1), or for C1q binding by replacing the
specified residue(s) with a residue(s) having an appropriate
functionality on its side chain, or by introducing a charged
functional group, such as glutamate or aspartate, or perhaps an
aromatic non-polar residue such as phenylalanine, tyrosine,
tryptophan or alanine (see e.g., U.S. Pat. No. 5,624,821).
Human Antibodies from Transgenic Animals and Phage Display
[0095] Alternatively, it is now possible to produce transgenic
animals (e.g., mice) that are capable, upon immunization, of
producing a full repertoire of human antibodies in the absence of
endogenous immunoglobulin production. For example, it has been
described that the homozygous deletion of the antibody heavy-chain
joining region (J.sub.H) gene in chimeric and germ-line mutant mice
results in complete inhibition of endogenous antibody production.
Transfer of the human germ-line immunoglobulin gene array in such
germ-line mutant mice results in the production of human antibodies
upon antigen challenge. See, e.g., U.S. Pat. Nos. 6,150,584;
6,114,598; and 5,770,429.
[0096] Fully human antibodies can also be derived from
phage-display libraries (Hoogenboom et al., J. Mol. Biol., 227:381
(1991); Marks et al., J. Mol. Biol., 222:581-597 (1991)).
Bispecific Antibodies, Antibody Fusion Polypeptides, and
Single-Chain Antibodies
[0097] Bispecific antibodies (BsAbs) are antibodies that have
binding specificities for at least two different epitopes. Such
antibodies can be derived from full length antibodies or antibody
fragments (e.g. F(ab)'.sub.2 bispecific antibodies). Methods for
making bispecific antibodies are known in the art. Traditional
production of full length bispecific antibodies is based on the
coexpression of two immunoglobulin heavy chain-light chain pairs,
where the two chains have different specificities (Millstein et
al., Nature, 305:537-539 (1983)). Because of the random assortment
of immunoglobulin heavy and light chains, these hybridomas
(quadromas) produce a potential mixture of different antibody
molecules (see, WO 93/08829 and in Traunecker et al., EMBO J.,
10:3655-3659 (1991)).
[0098] Bispecific antibodies also include cross-linked or
"heteroconjugate" antibodies. For example, one of the antibodies in
the heteroconjugate can be coupled to avidin, the other to biotin
or other payload. Heteroconjugate antibodies may be made using any
convenient cross-linking methods. Suitable cross-linking agents are
well known in the art, and are disclosed in U.S. Pat. No.
4,676,980, along with a number of cross-linking techniques.
[0099] In yet another embodiment, the antibody can be fused,
chemically or genetically, to a payload domain, for example, an
immunotoxin to produce an antibody fusion polypeptide. Such
payloads include, for example, immunotoxins, chemotherapeutics, and
radioisotopes, all of which are well-known in the art.
[0100] Single chain antibodies are also suitable for stabilization
according to the invention. The fragments comprise a heavy-chain
variable domain (VH) connected to a light-chain variable domain
(VL) with a linker, which allows each variable region to interface
with each other and recreate the antigen binding pocket of the
parent antibody from which the VL and VH regions are derived. See
Gruber et al., J. Immunol., 152:5368 (1994).
Anti-A.beta. Antibodies
[0101] Generally, the antibodies of the present invention include
antibodies for treating amyloidogenic diseases, in particular,
Alzheimer's Disease, by targeting A.beta. peptide.
[0102] The term "amyloidogenic disease" includes any disease
associated with (or caused by) the formation or deposition of
insoluble amyloid fibrils. Exemplary amyloidogenic diseases
include, but are not limited to, systemic amyloidosis, Alzheimer's
disease, mature onset diabetes, Parkinson's disease, Huntington's
disease, fronto-temporal dementia, and the prion-related
transmissible spongiform encephalopathies (kuru and
Creutzfeldt-Jacob disease in humans and scrapie and BSE in sheep
and cattle, respectively). Different amyloidogenic diseases are
defined or characterized by the nature of the polypeptide component
of the fibrils deposited. For example, in subjects or patients
having Alzheimer's disease, .beta.-amyloid protein (e.g.,
wild-type, variant, or truncated .beta.-amyloid protein) is the
characterizing polypeptide component of the amyloid deposit.
Accordingly, Alzheimer's disease is an example of a "disease
characterized by deposits of A.beta." or a "disease associated with
deposits of A.beta.," e.g., in the brain of a subject or patient.
The terms ".beta.-amyloid protein," ".beta.-amyloid peptide,"
".beta.-amyloid," "A.beta.," and "A.beta. peptide" are used
interchangeably herein. An "immunogenic agent" or "immunogen" is
capable of inducing an immunological response against itself on
administration to a mammal, optionally in conjunction with an
adjuvant.
[0103] The terms "A.beta. antibody", "anti A.beta. antibody" and
"anti A.beta." are used interchangeably herein to refer to an
antibody that binds to one or more epitopes or antigenic
determinants of APP, A.beta. protein, or both. Exemplary epitopes
or antigenic determinants can be found within the human amyloid
precursor protein (APP), but are preferably found within the
A.beta. peptide of APP. Multiple isoforms of APP exist, for example
APP.sup.695, APP.sup.751, and APP.sup.770. Amino acids within APP
are assigned numbers according to the sequence of the APP.sup.770
isoform (see e.g., GenBank Accession No. P05067). A.beta. (also
referred to herein as beta amyloid peptide and A beta) peptide is a
.about.4-4-kDa internal fragment of 39-43, amino acids of APP
(A.beta.39, A.beta.40, A.beta.41, A.beta.42, and A.beta.43).
A.beta.40, for example, consists of residues 672-711 of APP and
A.beta.42 consists of residues 672-713 of APP. As a result of
proteolytic processing of APP by different secretase enzymes iv
vivo or in situ, A.beta. is found in both a "short form," 40 amino
acids in length, and a "long form," ranging from 42-43 amino acids
in length. Epitopes or antigenic determinants can be located within
the N-terminus of the A.beta. peptide and include residues within
amino acids 1-10 of A.beta., preferably from residues 1-3, 1-4,
1-5, 1-6, 1-7, 2-7, 3-6, or 3-7 of A.beta.42 or within residues
2-4, 5, 6, 7, or 8 of A.beta., residues 3-5, 6, 7, 8, or 9 of
A.beta., or residues 4-7, 8, 9, or 10 of A.beta.42. "Central"
epitopes or antigenic determinants are located within the central
or mid-portion of the A.beta. peptide and include residues within
amino acids 16-24, 16-23, 16-22, 16-21, 19-21, 19-22, 19-23, or
19-24 of A.beta.. "C-terminal" epitopes or antigenic determinants
are located within the C-terminus of the A.beta. peptide and
include residues within amino acids 33-40, 33-41, or 33-42 of
A.beta..
[0104] In various embodiments, an A.beta. antibody is end-specific.
As used herein, the term "end-specific" refers to an antibody which
specifically binds to the N-terminal or C-terminal residues of an
A.beta. peptide but that does not recognize the same residues when
present in a longer A.beta. species comprising the residues or in
APP.
[0105] In various embodiments, an A.beta. antibody is
"C-terminus-specific." As used herein, the term "C
terminus-specific" means that the antibody specifically recognizes
a free C-terminus of an A.beta. peptide. Examples of C
terminus-specific A.beta. antibodies include those that: recognize
an A.beta. peptide ending at residue 40, but do not recognize an
A.beta. peptide ending at residue 41, 42, and/or 43; recognize an
A.beta. peptide ending at residue 42, but do not recognize an
A.beta. peptide ending at residue 40, 41, and/or 43; etc.
[0106] In one embodiment, the antibody may be a 3D6 antibody or
variant thereof, or a 10D5 antibody or variant thereof, both of
which are described in U.S. Patent Publication No. 2003/0165496A1,
U.S. Patent Publication No. 2004/0087777A1, International Patent
Publication No. WO02/46237A3. Description of 3D6, and 10D5 can also
be found, for example, in International Patent Publication No.
WO02/088306A2 and International Patent Publication No.
WO02/088307A2. 3D6 is a monoclonal antibody (mAb) that specifically
binds to an N-terminal epitope located in the human .beta.-amyloid
peptide, specifically, residues 1-5. By comparison, 10D5 is a mAb
that specifically binds to an N-terminal epitope located in the
human .beta.-amyloid peptide, specifically, residues 3-6. In
another embodiment, the antibody may be a 12B4 antibody or variant
thereof, as described in U.S. Patent Publication No. 20040082762A1
and International Patent Publication No. WO03/077858A2. 12B4 is a
mAb that specifically binds to an N-terminal epitope located in the
human .beta.-amyloid peptide, specifically, residues 3-7. In yet
another embodiment, the antibody may be a 12A11 antibody or a
variant thereof, as described in U.S. patent application Ser. No.
10/858,855 and International Patent Application No. PCT/US04/17514.
12A11 is a mAb that specifically binds to an N-terminal epitope
located in the human .beta.-amyloid peptide, specifically, residues
3-7. In yet another embodiment, the antibody may be a 266 antibody
as described in U.S. patent application Ser. No. 10/789,273, and
International Patent Application No. WO01/62801A2. Antibodies
designed to specifically bind to C-terminal epitopes located in
human .beta.-amyloid peptide, for use in the present invention
include, but are not limited to, 369.2B, as described in U.S. Pat.
No. 5,786,160.
[0107] In exemplary embodiments, the antibody is chosen from a
humanized anti A.beta. peptide 3D6 antibody, a humanized anti
A.beta. peptide 12A11 antibody, a humanized anti A.beta. peptide
10D5 antibody, a humanized anti A.beta. peptide 12B4 antibody and a
humanized anti A.beta. peptide 266 antibody, that selectively binds
A.beta. peptide. More specifically, the humanized anti A.beta.
peptide 3D6 antibody is designed to specifically bind to an
NH.sub.2-terminal epitope located in the human .beta.-amyloid 1-40
or 1-42 peptide found in plaque deposits in the brain (e.g., in
patients suffering from Alzheimer's disease).
Fc Fusions
[0108] In some embodiments, the nucleic acid molecules of the
invention encode a fusion or a chimeric protein. The fusion protein
can include a targeting moiety, e.g., a soluble receptor fragment
or a ligand, and an immunoglobulin chain, an Pc fragment, a heavy
chain constant regions of the various isotypes, including: IgG1,
IgG2, IgG3, IgG4, IgM, IgA1, IgA2, IgD, and IgE). For example, the
fusion protein can include the extracellular domain of a receptor,
and, e.g., fused to, a human immunoglobulin Fc chain (e.g., human
IgG, e.g., human IgG1 or human IgG4, or a mutated form thereof). In
one embodiment, the human Fc sequence has been mutated at one or
more amino acids, e.g., mutated at residues 254 and 257 from the
wild type sequence to reduce Fc receptor binding The fusion
proteins may additionally include a linker sequence joining the
first moiety to the second moiety, e.g., the immunoglobulin
fragment. For example, the fusion protein can include a peptide
linker, e.g., a peptide linker of about 4 to 20, more preferably, 5
to 10, amino acids in length; the peptide linker is 8 amino acids
in length. For example, the fusion protein can include a peptide
linker having the formula (Ser-Gly-Gly-Gly-Gly)y wherein y is 1, 2,
3, 4, 5, 6, 7, or 8. In other embodiments, additional amino acid
sequences can be added to the N- or C-terminus of the fusion
protein to facilitate expression, steric flexibility, detection
and/or isolation or purification.
[0109] A chimeric or fusion protein of the invention can be
produced by standard recombinant DNA techniques. For example, DNA
fragments coding for the different polypeptide sequences are
ligated together in-frame in accordance with conventional
techniques, e.g., by employing blunt-ended or stagger-ended termini
for ligation, restriction enzyme digestion to provide for
appropriate termini, filling-in of cohesive ends as appropriate,
alkaline phosphatase treatment to avoid undesirable joining, and
enzymatic ligation. In another embodiment, the fusion gene can be
synthesized by conventional techniques including automated DNA
synthesizers. Alternatively, PCR amplification of gene fragments
can be carried out using anchor primers that give rise to
complementary overhangs between two consecutive gene fragments that
can subsequently be annealed and reamplified to generate a chimeric
gene sequence (see, for example, Ausubel et al. (eds.) Current
Protocols in Molecular Biology, John Wiley & Sons, 1992).
Moreover, many expression vectors are commercially available that
encode a fusion moiety (e.g., an Fc region of an immunoglobulin
heavy chain). Immunoglobulin fusion polypeptide are known in the
art and are described in e.g., U.S. Pat. Nos. 5,516,964; 5,225,538;
5,428,130; 5,514,582; 5,714,147; and 5,455,165.
Nucleic Acid Molecules, Constructs and Vectors
[0110] Exemplary embodiments of the instant invention feature
engineered constructs designed to eliminate unwanted or undesirable
by-products, in particular, unwanted or undesirable antibody (or
immunoglobulin) by-products. In certain aspects, the constructs
include components of naturally-occurring antibody gene sequences,
wherein the components have been genetically altered, modified ,or
engineered (e.g., genetically engineered) such that the resultant
construct expresses the desired protein (e.g., antibody) of
interest in the absence of the unwanted or undesired by-product.
Constructs can be generated using art-recognized techniques for
producing recombinant nucleic acid molecules (e.g., comprising
components of immunoglobulin chain genes) as described in detail
below.
[0111] Antibody gene sequences encode antibodies of the various
isotypes, including: IgG (e.g., IgG1, IgG2, IgG3, IgG4), IgM, IgA1,
IgA2, IgD, or IgE. Preferably, the antibody gene sequences encodes
an antibody of the antibody is an IgG isotype. The encoded
immunoglobulin or antibody molecules can include full-length (e.g.,
an IgG1 or IgG4 immunoglobulin) or alternatively can include only a
fragment (e.g., a Fc fragment).
[0112] It will be appreciated by the skilled artisan that
nucleotide sequences encoding the antibodies of the instant
invention can be derived from the nucleotide and amino acid
sequences described in the present application or from additional
sources of sequences of immunoglobulin genes known in the art using
the genetic code and standard molecular biology techniques. The
nucleic acid compositions of the present invention may be derived
from known immunoglobulin DNA (e.g., cDNA sequences). In
particular, nucleotide sequences may be substantially identical to
or derived from native V, D, J, or constant cDNA sequences. The
sequences of heavy and light chain constant region genes are known
in the art. Preferably, the constant region is human, but constant
regions from other species, e.g., rodent (e.g., mouse or rat),
primate (macaque), camel, or rabbit, can also be used. Constant
regions from these species are known in the art (see e.g., Kabat,
E. A., et al. (1991) Sequences of Proteins of Immunological
Interest, Fifth Edition, U.S. Department of Health and Human
Services, NIH Publication No. 91-3242) and DNA fragments
encompassing these regions can be obtained by standard PCR
amplification. The heavy chain constant region can be an IgG1,
IgG2, IgG3, IgG4, IgA, IgE, IgM or IgD constant region. Sequences
for heavy chain constant regions are known in the art and can be
found in, e.g., NCBI NG.sub.--001019. In some embodiments, the
constant region is an IgG1 or IgG4 constant region. For an Fc
fragment heavy chain gene, the Fc-encoding DNA can be operatively
linked to a heavy chain leader sequence (e.g., a heavy chain
variable chain leader sequence) for direct expression.
[0113] Additional aspects of the invention include assembled
immunoglobulin DNA cassette sequences. Assembled immunoglobulin
cassette sequences include nucleotide sequences as well as amino
acid sequences encoded by an immunoglobulin DNA cassette nucleotide
sequence.
[0114] An exemplary human IgG1 constant region genomic sequence is
hereby provided:
TABLE-US-00001 (SEQ ID NO: 1)
GTGAGTCCTGTCGACTCTAGAGCTTTCTGGGGCAGGCCAGGCCTGACTTT
GGCTGGGGGCAGGGAGGGGGCTAAGGTGACGCAGGTGGCGCCAGCCAGGC
GCACACCCAATGCCCATGAGCCCAGACACTGGACGCTGAACCTCGCGGAC
AGTTAAGAACCCAGGGGCCTCTGCGCCCTGGGCCCAGCTCTGTCCCACAC
CGCGGTCACATGGCACCACCTCTCTTGCAGCCTCCACCAAGGGCCCATCG
GTCTTCCCCCTGGCACCCTCCTCCAAGAGCACCTCTGGGGGCACAGCGGC
CCTGGGCTGCCTGGTCAAGGACTACTTCCCCGAACCGGTGACGGTGTCGT
GGAACTCAGGCGCCCTGACCAGCGGCGTGCACACCTTCCCGGCTGTCCTA
CAGTCCTCAGGACTCTACTCCCTCAGCAGCGTGGTGACCGTGCCCTCCAG
CAGCTTGGGCACCCAGACCTACATCTGCAACGTGAATCACAAGCCCAGCA
ACACCAAGGTGGACAAGAAAGTTGGTGAGAGGCCAGCACAGGGAGGGAGG
GTGTCTGCTGGAAGCCAGGCTCAGCGCTCCTGCCTGGACGCATCCCGGCT
ATGCAGTCCCAGTCCAGGGCAGCAAGGCAGGCCCCGTCTGCCTCTTCACC
CGGAGGCCTCTGCCCGCCCCACTCATGCTCAGGGAGAGGGTCTTCTGGCT
TTTTCCCCAGGCTCTGGGCAGGCACAGGCTAGGTGCCCCTAACCCAGGCC
CTGCACACAAAGGGGCAGGTGCTGGGCTCAGACCTGCCAAGAGCCATATC
CGGGAGGACCCTGCCCCTGACCTAAGCCCACCCCAAAGGCCAAACTCTCC
ACTCCCTCAGCTCGGACACCTTCTCTCCTCCCAGATTCCAGTAACTCCCA
ATCTTCTCTCTGCAGAGCCCAAATCTTGTGACAAAACTCACACATGCCCA
CCGTGCCCAGGTAAGCCAGCCCAGGCCTCGCCCTCCAGCTCAAGGCGGGA
CAGGTGCCCTAGAGTAGCCTGCATCCAGGGACAGGCCCCAGCCGGGTGCT
GACACGTCCACCTCCATCTCTTCCTCAGCACCTGAACTCCTGGGGGGACC
GTCAGTCTTCCTCTTCCCCCCAAAACCCAAGGACACCCTCATGATCTCCC
GGACCCCTGAGGTCACATGCGTGGTGGTGGACGTGAGCCACGAAGACCCT
GAGGTCAAGTTCAACTGGTACGTGGACGGCGTGGAGGTGCATAATGCCAA
GACAAAGCCGCGGGAGGAGCAGTACAACAGCACGTACCGTGTGGTCAGCG
TCCTCACCGTCCTGCACCAGGACTGGCTGAATGGCAAGGAGTACAAGTGC
AAGGTCTCCAACAAAGCCCTCCCAGCCCCCATCGAGAAAACCATCTCCAA
AGCCAAAGGTGGGACCCGTGGGGTGCGAGGGCCACATGGACAGAGGCCGG
CTCGGCCCACCCTCTGCCCTGAGAGTGACCGCTGTACCAACCTCTGTCCC
TACAGGGCAGCCCCGAGAACCACAGGTGTACACCCTGCCCCCATCCCGGG
AGGAGATGACCAAGAACCAGGTCAGCCTGACCTGCCTGGTCAAAGGCTTC
TATCCCAGCGACATCGCCGTGGAGTGGGAGAGCAATGGGCAGCCGGAGAA
CAACTACAAGACCACGCCTCCCGTGCTGGACTCCGACGGCTCCTTCTTCC
TCTATAGCCAAGCTCACCGTGGACAAGAGCAGGTGGCAGCAGGGGAACGT
CTTCTCATGCTCCGTGATGCATGAGGCTCTGCACAACCACTACACGCAGA
AGAGCCTCTCCCTGTCCCCGGGTAAATGA
[0115] An exemplary IgG4 constant region genomic sequence is hereby
provided:
TABLE-US-00002 (SEQ ID NO: 3)
GTGAGTCCTGTCGACTCTAGAGCTTTCTGGGGCAGGCCAGGCCTGACTTT
GGCTGGGGGCAGGGAGGGGGCTAAGGTGACGCAGGTGGCGCCAGCCAGGC
GCACACCCAATGCCCATGAGCCCAGACACTGGACGCTGAACCTCGCGGAC
AGTTAAGAACCCAGGGGCCTCTGCGCCCTGGGCCCAGCTCTGTCCCACAC
CGCGGTCACATGGCACCACCTCTCTTGCAGCCTCCACCAAGGGCCCATCG
GTCTTCCCCCTGGCGCCCTGCTCCAGGAGCACCTCCGAGAGCACAGCGGC
CCTGGGCTGCCTGGTCAAGGACTACTTCCCCGAACCGGTGACGGTGTCGT
GGAACTCAGGCGCCCTGACCAGCGGCGTGCACACCTTCCCGGCTGTCCTA
CAGTCCTCAGGACTCTACTCCCTCAGCAGCGTGGTGACCGTGCCCTCCAG
CAGCTTGGGCACGAAGACCTACACCTGCAATGTAGATCACAAGCCCAGCA
ACACCAAGGTGGACAAGAGAGTTGGTGAGAGGCCAGCACAGGGAGGGAGG
GTGTCTGCTGGAAGCCAGGCTCAGCCCTCCTGCCTGGACGCACCCCGGCT
GTGCAGCCCCAGCCCAGGGCAGCAAGGCAGGCCCCATCTGTCTCCTCACC
TGGAGGCCTGTGACCACCCCACTCATGCTCAGGGAGAGGGTCTTCTGGAT
TTTTCCACCAGGCTCCGGGCAGCCACAGGCTGGATGCCCCTACCCCAGGC
CCTGCGCATACAGGGGCAGGTGCTGCGCTCAGACCTGCCAAGAGCCATAT
CCGGGAGGACCCTGCCCCTGACCTAAGCCCACCCCAAAGGCCAAACTCTC
CACTCCCTCAGCTCAGACACCTTCTCTCCTCCCAGATTGAGTAACTCCCA
ATCTTCTCTCTGCAGAGTCCAAATATGGTCCCCCATGCCCACCATGCCCA
GGTAAGCCAACCCAGGCCTCGCCCTCCAGCTCAAGGCGGGACAGGTGCCC
TAGAGTAGCCTGCATCCAGGGACAGGCCCCAGCCGGGTGCTGACGCATCC
ACCTCCATCTCTTCCTCAGCACCTGAGTTCCTGGGGGGACCATCAGTCTT
CCTGTTCCCCCCAAAACCCAAGGACACTCTCATGATCTCCCGGACCCCTG
AGGTCACGTGCGTGGTGGTGGACGTGAGCCAGGAAGACCCCGAGGTCCAG
TTCAACTGGTACGTGGATGGCGTGGAGGTGCATAATGCCAAGACAAAGCC
GCGGGAGGAGCAGTTCAACAGCACGTACCGTGTGGTCAGCGTCCTCACCG
TCCTGCACCAGGACTGGCTGAACGGCAAGGAGTACAAGTGCAAGGTCTCC
AACAAAGGCCTCCCGTCCTCCATCGAGAAAACCATCTCCAAAGCCAAAGG
TGGGACCCACGGGGTGCGAGGGCCACATGGACAGAGGTCAGCTCGGCCCA
CCCTCTGCCCTGGGAGTGACCGCTGTGCCAACCTCTGTCCCTACAGGGCA
GCCCCGAGAGCCACAGGTGTACACCCTGCCCCCATCCCAGGAGGAGATGA
CCAAGAACCAGGTCAGCCTGACCTGCCTGGTCAAAGGCTTCTACCCCAGC
GACATCGCCGTGGAGTGGGAGAGCAATGGGCAGCCGGAGAACAACTACAA
GACCACGCCTCCCGTGCTGGACTCCGACGGCTCCTTCTTCCTCTACAGCA
GGGTAACCGTGGACAAGAGCAGGTGGCAGGAGGGGAATGTCTTCTCATGC
TCCGTGATGCATGAGGCTCTGCACAACCACTACACACAGAAGAGCCTCTC
CCTGTCTCTGGGTAAATGA
Antibody Production
[0116] Antibodies of the present invention are typically produced
by recombinant expression. Nucleic acids encoding light and heavy
chains can be inserted into expression vectors. The light and heavy
chains can be cloned in the same or different expression vectors.
The DNA segments encoding immunoglobulin chains are operably linked
to control sequences in the expression vector(s) that ensure the
expression of immunoglobulin polypeptides. Expression control
sequences include, but are not limited to, promoters (e.g.,
naturally-associated or heterologous promoters), signal sequences,
enhancer elements, and transcription termination sequences.
Preferably, the expression control sequences are eukaryotic
promoter systems in vectors capable of transforming or transfecting
eukaryotic host cells (e.g., COS or CHO cells).
[0117] Following manipulation of the isolated genetic material to
provide polypeptides of the invention as set forth above, the genes
are typically inserted in an expression vector for introduction
into host cells that may be used to produce the desired quantity of
modified antibody that, in turn, provides the claimed polypeptides.
The term "vector" includes a nucleic acid construct often including
a nucleic acid, e.g., a gene, and further including minimal
elements necessary for nucleic acid replication, transcription,
stability and/or protein expression or secretion from a host cell.
Such constructs may exist as extrachromosomal elements or may be
integrated into the genome of a host cell.
[0118] The term "expression vector" includes a specific type of
vector wherein the nucleic acid construct is optimized for the
high-level expression of a desired protein product. Expression
vectors often have transcriptional regulatory agents, such as
promoter and enhancer elements, optimized for high-levels of
transcription in specific cell types and/ or optimized such that
expression is constitutive based upon the use of a specific
inducing agent. Expression vectors further have sequences that
provide for proper and/or enhanced translation of the protein As
known to those skilled in the art, such vectors may easily be
selected from the group consisting of plasmids, phages, viruses,
and retroviruses. The term "expression cassette" includes a nucleic
acid construct containing a gene and having elements in addition to
the gene that allow for proper and or enhanced expression of that
gene in a host cell.
[0119] The term "operably linked" includes a juxtaposition wherein
the components are in a relationship permitting them to function in
their intended manner (e.g., functionally linked). As an example, a
promoter/enhancer operably linked to a polynucleotide of interest
is ligated to said polynucleotide such that expression of the
polynucleotide of interest is achieved under conditions which
activate expression directed by the promoter/enhancer. In regards
to the invention described herein, operably linked also encompasses
the relationship of splice donor and splice acceptor sites found in
the primary transcript (pre-mRNA) of a gene of interest. Normally,
splice acceptor and donor sites are operably linked in that the two
sequences are required and function together for splicing events to
occur resulting in a mature messenger RNA.
[0120] The phrase "natural operative association" refers to the
intronic and exonic organization of a gene found in it's natural or
native state. One approach to cloning a gene of interest involves
isolating the nucleic acid of the gene, both exons and introns, and
inserting the nucleic acid sequence into a vector for amplification
of the nucleic acid sequence. This entire gene sequence may also be
inserted into an expression vector useful for the expression of the
protein in the same or different species. When a gene is cloned
containing the introns and exons as they are found to exist in
their native state, the introns and exons are said to retain their
natural operative association.
[0121] Expression vectors are typically replicable in the host
organisms either as episomes or as an integral part of the host
chromosomal DNA. Commonly, expression vectors contain selection
markers (e.g., ampicillin-resistance, hygromycin-resistance,
tetracycline resistance, kanamycin resistance or neomycin
resistance) to permit detection of those cells transformed with the
desired DNA sequences (see, e.g., Itakura et al., U.S. Pat. No.
4,704,362). In addition to the immunoglobulin DNA cassette
sequences, insert sequences, and regulatory sequences, the
recombinant expression vectors of the invention may carry
additional sequences, such as sequences that regulate replication
of the vector in host cells (e.g., origins of replication) and
selectable marker genes. The selectable marker gene facilitates
selection of host cells into which the vector has been introduced
(see e.g., U.S. Pat. Nos. 4,399,216, 4,634,665 and 5,179,017, all
by Axel et al.). For example, typically the selectable marker gene
confers resistance to drugs, such as G418, hygromycin, or
methotrexate, on a host cell into which the vector has been
introduced. Preferred selectable marker genes include the
dihydrofolate reductase (DHFR) gene (for use in dhfr.sup.- host
cells with methotrexate selection/amplification) and the neo gene
(for G418 selection).
[0122] Once the vector has been incorporated into the appropriate
host, the host is maintained under conditions suitable for high
level expression of the nucleotide sequences, and the collection
and purification of the desired antibodies. Mammalian cells are
preferred for expression and production of the antibodies of the
present invention. See, e.g., Winnacker, From Genes to Clones, VCH
Publishers, N.Y., N.Y. (1987). Eukaryotic cells are preferred
because a number of suitable host cell lines capable of secreting
heterologous proteins (e.g., intact immunoglobulins) have been
developed in the art, and include CHO cell lines, various COS cell
lines, HeLa cells, preferably, myeloma cell lines, or transformed
B-cells or hybridomas. Preferably, the cells are non-human.
Preferred mammalian host cells for expressing the antibodies of the
invention include Chinese Hamster Ovary (CHO cells) (including dhfr
CHO cells, described in Urlaub and Chasin (1980) Proc. Natl. Acad.
Sci. USA 77:4216-4220, used with a DHFR selectable marker, e.g., as
described in Kaufman and Sharp (1982) Mol. Biol. 159:601-621),
lymphocytic cell lines, e.g., NSO myeloma cells and SP2 cells, COS
cells, and cells derived from a transgenic animal, e.g., mammary
epithelial cell. Other suitable host cells are known to those
skilled in the art.
[0123] Expression vectors for these cells can include expression
control sequences, such as an origin of replication, a promoter,
and an enhancer (Queen et al., Immunol. Rev. 89:49 (1986)), and
necessary processing information sites, such as ribosome binding
sites, RNA splice sites, polyadenylation sites, and transcriptional
terminator sequences. Preferred expression control sequences are
promoters derived from immunoglobulin genes, SV40, adenovirus,
bovine papilloma virus, cytomegalovirus and the like. See, e.g., Co
et al., (1992) J. Immunol. 148:1149. Preferred regulatory sequences
for mammalian host cell expression include viral elements that
direct high levels of protein expression in mammalian cells, such
as promoters and/or enhancers derived from FF-1a promoter and BGH
poly A, cytomegalovirus (CMV) (such as the CMV promoter/enhancer),
Simian Virus 40 (SV40) (such as the SV40 promoter/enhancer),
adenovirus (e.g., the adenovirus major late promoter (AdMLP)), and
polyoma. For further description of viral regulatory elements, and
sequences thereof, see, e.g., U.S. Pat. No. 5,168,062 by Stinski,
U.S. Pat. No. 4,510,245 by Bell et al. and U.S. Pat. No. 4,968,615
by Schaffner et al. In exemplary embodiments, the antibody heavy
and light chain genes are operatively linked to enhancer/promoter
regulatory elements (e.g., derived from SV40, CMV, adenovirus and
the like, such as a CMV enhancer/AdMLP promoter regulatory element
or an SV40 enhancer/AdMLP promoter regulatory element) to drive
high levels of transcription of the genes. In exemplary embodiments
of the invention, the construct include an internal ribosome entry
site (IRES) to provide relatively high levels of polypeptides of
the invention in eukaryotic host cells. Compatible IRES sequences
are disclosed in U.S. Pat. No. 6,193,980 that is also incorporated
herein.
[0124] Alternatively, antibody-coding sequences can be incorporated
in a transgene for introduction into the genome of a transgenic
animal and subsequent expression in the milk of the transgenic
animal (see, e.g., Deboer et al., U.S. Pat. No. 5,741,957, Rosen,
U.S. Pat. No. 5,304,489, and Meade et al., U.S. Pat. No.
5,849,992). Suitable transgenes include coding sequences for light
and/or heavy chains in operable linkage with a promoter and
enhancer from a mammary gland specific gene, such as casein or beta
lactoglobulin.
[0125] Prokaryotic host cells may also be suitable for producing
the antibodies of the invention. E. coli is one prokaryotic host
particularly useful for cloning the polynucleotides (e.g., DNA
sequences) of the present invention. Other microbial hosts suitable
for use include bacilli, such as Bacillus subtilis,
enterobacteriaceae, such as Escherichia, Salmonella, and Serratia,
and various Pseudomonas species. In these prokaryotic hosts, one
can also make expression vectors, which will typically contain
expression control sequences compatible with the host cell (e.g.,
an origin of replication). In addition, any number of a variety of
well-known promoters will be present, such as the lactose promoter
system, a tryptophan (trp) promoter system, a beta-lactamase
promoter system, or a promoter system from phage lambda. The
promoters will typically control expression, optionally with an
operator sequence, and have ribosome binding site sequences and the
like, for initiating and completing transcription and
translation.
[0126] Expression of proteins in prokaryotes is most often carried
out in E. coli with vectors containing constitutive or inducible
promoters directing the expression of either fusion or non-fusion
proteins. Fusion vectors add a number of amino acids to an antibody
encoded therein, often to the constant region of the recombinant
antibody, without affecting specificity or antigen recognition of
the antibody. Addition of the amino acids of the fusion peptide can
add additional function to the antibody, for example as a marker
(e.g., epitope tag such as myc or flag).
[0127] Other microbes, such as yeast, are also useful for
expression. Saccharomyces is a preferred yeast host, with suitable
vectors having expression control sequences (e.g., promoters), an
origin of replication, termination sequences, and the like as
desired. Typical promoters include 3-phosphoglycerate kinase and
other glycolytic enzymes. Inducible yeast promoters include, among
others, promoters from alcohol dehydrogenase, isocytochrome C, and
enzymes responsible for maltose and galactose utilization.
[0128] Alternatively, antibodies of the invention can be produced
in transgenic plants (e.g., tobacco, maize, soybean and alfalfa).
Improved `plantibody` vectors (Hendy et al. (1999) J. Immunol.
Methods 231:137-146) and purification strategies coupled with an
increase in transformable crop species render such methods a
practical and efficient means of producing recombinant
immunoglobulins not only for human and animal therapy, but for
industrial applications as well (e.g., catalytic antibodies).
Moreover, plant produced antibodies have been shown to be safe and
effective and avoid the use of animal-derived materials and
therefore the risk of contamination with a transmissible spongiform
encephalopathy (TSE) agent. Further, the differences in
glycosylation patterns of plant and mammalian cell-produced
antibodies have little or no effect on antigen binding or
specificity. In addition, no evidence of toxicity or HAMA has been
observed in patients receiving topical oral application of a
plant-derived secretory dimeric IgA antibody (see, e.g., Larrick et
al. (1998) Res. Immunol. 149:603-608).
[0129] Various methods may be used to express recombinant
antibodies in transgenic plants. For example, antibody heavy and
light chains can be independently cloned into expression vectors
(e.g., Agrobacterium tumefaciens vectors), followed by the
transformation of plant tissue in vitro with the recombinant
bacterium or direct transformation using, e.g., particles coated
with the vector which are then physically introduced into the plant
tissue using, e.g., ballistics. Subsequently, whole plants
expressing individual chains are reconstituted followed by their
sexual cross, ultimately resulting in the production of a fully
assembled and functional antibody. Similar protocols have been used
to express functional antibodies in tobacco plants (see, e.g.,
Hiatt et al. (1989) Nature 342:76-87). In various embodiments,
signal sequences may be utilized to promote the expression, binding
and folding of unassembled antibody chains by directing the chains
to the appropriate plant environment (e.g., the aqueous environment
of the apoplasm or other specific plant tissues including tubers,
fruit or seed) (see Fiedler et al. (1995) Bio/Technology
13:1090-1093). Plant bioreactors can also be used to increase
antibody yield and to significantly reduce costs.
[0130] Suitable host cells are discussed further in Goeddel (1990)
Gene Expression Technology: Methods in Enzymology 185, Academic
Press, San Diego, Calif. Alternatively, the recombinant expression
vector can be transcribed and translated in vitro, for example
using T7 promoter regulatory sequences and T7 polymerase.
[0131] The vectors containing the polynucleotide sequences of
interest (e.g., the heavy and light chain encoding sequences and
expression control sequences) can be transferred into the host cell
by well-known methods, which vary depending on the type of cellular
host. For example, calcium chloride transfection is commonly
utilized for prokaryotic cells, whereas calcium phosphate
treatment, electroporation, lipofection, biolistics or viral-based
transfection may be used for other cellular hosts. (See generally
Sambrook et al., Molecular Cloning: A Laboratory Manual (Cold
Spring Harbor Press, 2nd ed., 1989), incorporated by reference
herein in its entirety for all purposes.) Other methods used to
transform mammalian cells include the use of polybrene, protoplast
fusion, liposomes, electroporation, and microinjection (see
generally, Sambrook et al., supra). For production of transgenic
animals, transgenes can be microinjected into fertilized oocytes,
or can be incorporated into the genome of embryonic stem cells, and
the nuclei of such cells transferred into enucleated oocytes.
[0132] When heavy and light chains are cloned on separate
expression vectors, the vectors are co-transfected to obtain
expression and assembly of intact immunoglobulins. Once expressed,
the whole antibodies, their dimers, individual light and heavy
chains, or other immunoglobulin forms of the present invention can
be purified according to standard procedures of the art, including
ammonium sulfate precipitation, affinity columns, column
chromatography, HPLC purification, gel electrophoresis and the like
(see generally Scopes, Protein Purification (Springer-Verlag, N.Y.,
(1982)). Substantially pure immunoglobulins of at least about 90 to
95% homogeneity are preferred, and 98 to 99% or more homogeneity
most preferred, for pharmaceutical uses.
[0133] An immunoglobulin or antibody produced according to the
instant invention molecule can be derivatized or linked to another
functional molecule (e.g. another peptide or protein). Accordingly,
the antibodies and antibody portions or otherwise modified forms of
the antibodies of the invention described herein, may be further
derivatized for use in research, diagnostic and/or therapeutic
contexts. For example, an antibody or antibody portion of the
invention can be functionally linked (by chemical coupling, genetic
fusion, noncovalent association or otherwise) to one or more other
molecular entities, such as another antibody (e.g., a bispecific
antibody or a diabody), a detectable agent, a cytotoxic agent, a
pharmaceutical agent, and/or a protein or peptide that can mediate
associate of the antibody or antibody portion with another molecule
(such as a streptavidin core region or a polyhistidine tag).
[0134] One type of derivatized antibody is produced by crosslinking
two or more antibodies (of the same type or of different types,
e.g., to create bispecific antibodies). Suitable crosslinkers
include those that are heterobifinctional, having two distinctly
reactive groups separated by an appropriate spacer (e.g.
m-maleimidobenzoyl-N-hydroxysuccinimide ester) or homobifunctional
(e.g., disuccinimidyl suberate). Such linkers are available from
Pierce Chemical Company, Rockford, Ill.
[0135] Exemplary fluorescent detectable agents include fluorescein,
fluorescein isothiocyanate, rhodamine,
5-dimethylamine-1-napthalenesulfon-yl chloride, phycoerythrin and
the like. An antibody may also be derivatized with detectable
enzymes, such as alkaline phosphatase, horseradish peroxidase,
P-galactosidase, acetylcholinesterase, glucose oxidase and the
like. When an antibody is derivatized with a detectable enzyme, it
is detected by adding additional reagents that the enzyme uses to
produce a detectable reaction product. For example, when the
detectable agent horseradish peroxidase is present, the addition of
hydrogen peroxide and diaminobenzidine leads to a colored reaction
product, which is detectable. An antibody may also be derivatized
with a prosthetic group (e.g., streptavidin/biotin and
avidin/biotin). For example, an antibody may be derivatized with
biotin, and detected through indirect measurement of avidin or
streptavidin binding. Examples of suitable fluorescent materials
include umbelliferone, fluorescein, fluorescein isothiocyanate,
rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride or
phycoerythrin; an example of a luminescent material includes
luminol; examples of bioluminescent materials include luciferase,
luciferin, and aequorin, and examples of suitable radioactive
material include .sup.125I, .sup.131I, .sup.35S or .sup.3H. An
antibody (or fragment thereof) may also be conjugated to a
therapeutic moiety such as a cytotoxin or other therapeutic
protein. Alternatively, an antibody can be conjugated to a second
antibody to form an antibody heteroconjugate as described by Segal
in U.S. Pat. No. 4,676,980.
Expression Vectors for Decreasing or Eliminating Unwanted
Polypeptide By-Products
[0136] During the development of a protein expression system for
therapeutic proteins, HPLC analysis of purified target product
identified unexpected low molecular weight (LMW) species of
peptides. More specifically, undesired polypeptide by-products were
observed in a CHO (Chinese hamster ovary) cell line developed to
express the 3D6 antibody. This antibody has been described
elsewhere and is the result of efforts to develop an
immunotherapeutic agent useful for the treatment of Alzheimer's
disease. It has specificity for the A-beta peptide and has been
demonstrated to be efficacious in clearing A-beta plaques. The CHO
cell line was developed using art accepted methods and contained
copies of the heavy and light chain of the 3D6 antibody in addition
to genes for selective culture of expression cassette containing
cells.
[0137] Examination of a number of clonal isolates of the cell line
demonstrated that production of the LMW species was not a
phenomenon specific to the clone being utilized, i.e., a minor
fraction of the total protein produced in all of the cell lines
tested was of the unexpected LMW species. It was further observed
that the fraction of LMW species relative to total protein
increased when protein expression was induced. Further evaluation
of the polypeptides using mass spectrometry indicated that the LMW
species contained amino acids not predicted by the exonic sequences
of the gene.
[0138] The top panel of FIG. 1 schematically presents the 3D6 heavy
chain expression cassette showing the relation of introns and exons
as well as the position of the internal ribosomal entry site (RES)
and dihydrofolate reductase (DHFR) selectable marker gene. The
exons shown are variable heavy (V.sub.H1), hinge and constant heavy
1, 2 and 3 (C.sub.H1, C.sub.H2, C.sub.H3). The introns of the
expression cassette are denoted Int1, Int2, Int3 and Int4. FIG. 1
further illustrates the predicted correct splicing events for the
mRNA derived from the expression cassette. The middle panel shows
the correctly spliced mRNA containing only intronic sequences of
the bicistronic transcript.
[0139] Scrutiny of the intronic and exonic sequences in the
expression vector and mass spectrometry data pointed to RNA
polymerase intron read-through (IRT) of a specific splice site
junction. Since the organization of the introns and exons and
splice site donor and acceptor sites contained in the expression
vector were substantially identical to those as they existed in the
original genomic form of the gene, the missplicing event was not
predictable.
[0140] The bottom panel of FIG. 1 illustrates the predicted product
generated by intron read-through of the fourth intron. FIG. 2
provides sequence information showing the sense and anti-sense
strands of the DNA sequence in the region of the fourth intron of
the genomic sequence of the 3D6 antibody expression vector. The
splice junctions (splice donor and acceptor sites) are denoted by
vertical lines perpendicular to the nucleic acid sequence. DNA
corresponding to intronic sequence is shown underlined and in
italics. Predicted amino acids for desired and read-through
by-product polypeptides are shown below the anti-sense strand of
the genomic DNA. The amino acid sequence of polypeptide derived
from correctly spliced RNA is shown in bold uppercase lettering;
polypeptide by-products derived from incorrectly spliced RNA is
shown in lowercase font.
[0141] The present invention describes materials and methods for
designing protein expression cassettes and vectors such that intron
read-through (IRT) and unwanted polypeptide byproducts are
substantially reduced or eliminated entirely. In part, the
invention provides on the novel design of vectors wherein the
natural operative association of introns and exons in an isolated
nucleic acid coding for a protein of interest are altered such that
IRT is reduced or eliminated thereby reducing or eliminating
unwanted IRT polypeptide species. The unique alterations are
particularly suitable for IgG1 or IgG4 antibodies, but may be used
for any gene of interest. Moreover the vectors of the instant
invention having introns and exons with altered natural operative
associations demonstrate not only reduced or eliminated IRT
by-products but also increased protein expression levels relative
to vectors designed using standard art recognized techniques.
EXAMPLES
Materials and Methods
[0142] Throughout the examples, materials and methods as
exemplified in the following texts were used unless otherwise
stated:
[0143] In general, the practice of the present invention employs
art-recognized techniques in molecular biology, recombinant DNA
technology, and immunology especially, e.g. antibody technology.
See, e.g., Sambrook, Fritsch and Maniatis, Molecular Cloning: Cold
Spring Harbor laboratory Press (1989); Antibody Engineering
Protocols (Methods in Molecular Biology), 510, Paul, S., Human
Press (1996); Antibody Engineering: A Practical Approach (Practical
Approach Series, 169), McCafferty, Ed IRL Press (1996); Antibodies:
A Laboratory Manual, Harlow et al Cold Spring Harbor Press, (1999);
and Current Protocols in Molecular Biology eds. Ausubel et al John
Wiley & Sons (1992).
Example 1
Quantification of Intron Read-Through Transcription
[0144] In order to quantify the relative amount of aberrant
transcript formed due to intron read through, a quantitative PCR
assay was designed. The approach for evaluating IRT transcription
is graphically outlined in FIG. 3. Specifically, a quantitative PCR
assay was devised using a TaqMan3 system, in which PCR
amplification was employed to quantitate nucleic acid species of
interest. Three probe-primer sets were designed to determine the
fraction of intron read-through mRNA being produced. The first
probe-primer set was designed to quantitate the level of
transcription of sequence of an exon in natural operative
association with an intron of interest. In the case of the 3D6
heavy chain expression cassette, mRNA species containing the 3D6
second constant heavy chain (CH2) exon was targeted. This provided
a measure of total 3D6 mRNA production. The second probe primer set
bridged the intron and exon in operative association, here the CH2
exon--fourth intron interface of the 3D6 expression cassette.
Amplification derived from this probe primer set indicated the
presence of intron read-through transcript containing the 5' splice
donor sequence as well as sequence bridging the CH2 exon and intron
4. The third probe-primer set targeted sequence of the fourth
intron. This probe set provided quantification of the fraction of
incorrectly spliced RNA comprising internal intron 4 sequence.
[0145] FIG. 4 shows the results of the Q-PCR assay using the probe
primer sets as described. Briefly, CHO cells containing the stably
integrated expression vector were seeded and maintained in culture
for two weeks. At day seven the cultures were induced to increase
protein expression. During the course of the experiment, samples of
the cell culture were lysed and RNA content evaluated in assays
using probe and primer sets specific for the CH2 exon or specific
for intron as described in the preceding paragraph. The chart
demonstrates a low level of incorrectly spliced RNA product prior
to induction and an increasing percentage of intron 4 containing
RNA over time post-induction. This method of Q-PCR described here
predicts the likelihood that a particular expression cassette
containing introns and exons in naturally operative association
will yield intron read through by-products.
[0146] While details for quantifying IRT of the 3D6 antibody
expression system are explicitly provided, the technique can be
implemented in any protein expression system wherein the potential
of IRT exists. This novel approach is, therefore, especially useful
for evaluating whether the vectors of this invention (described in
detail below) should be adopted for a particular protein of
interest such that the production of unwanted IRT polypeptide
by-products are avoided. When IRT transcription is in an abundance
of greater than about 0.1% -1%, vectors employing altered natural
operative association can be employed to express the desired
protein. It will be readily apparent to one of skill in the art
that the methods for detecting intron-read through MRNA and, hence,
predicting intron read-through polypeptides is applicable to any
protein expression system wherein splicing events occur. For
example the system may be used with any eukaryotic cell system,
e.g. Saccharomyces, Drosophila, mouse, monkey, rabbit, rat, or
human cell based systems.
Example 2
Vectors with Introns and Exons Having Modified Natural Operative
Association
[0147] Expression vectors were devised wherein the natural
operative association of the introns and exons were modified. Two
exemplary vectors sequences are shown in FIG. 5. This figure
illustrates expression constructs developed to resolve the problem
of intron read-through by-products. The top panel graphically
depicts the genomic, intronic--exonic, organization of a generic
antibody heavy chain containing the exons for a variable region
(V.sub.H), three constant regions (C.sub.H1, C.sub.H2, C.sub.H3)
and a hinge region. The middle and bottom drawings describe
modifications to the genomic sequence incorporated into expression
vectors which eliminated intron read through heavy chain
by-products.
[0148] CHO cells expressing the 3D6 light chain were transformed
with either the complete genomic heavy chain sequence of the 3D6
antibody or transformed with modified 3D6 heavy chain expression
vectors wherein the natural operative association of introns and
exons were modified. The cells were cultured using standard
techniques for the purpose of protein expression as described in
the Materials and Methods. Antibodies were purified from
conditioned supernatant and subsequently fractionated using
denaturing reverse phase (RP) HPLC (FIG. 6). The columns were run
such that heavy and light chain constituents of the antibody were
resolved.
[0149] In the top trace, representing the fractionation of a 3D6
genomic clone protein preparation, the heavy and light chains peaks
are readily apparent. In addition, a small peak can be discerned
fractionating between the heavy and light chain corresponding to
heavy chain intron read-through product.
[0150] The bottom trace is an example of an expression system in
which the problem of intron read-through has been reduced. As in
the top trace, light chain and heavy chain peaks are clearly
present, however, the level of IRT has been reduced to below the
limit of detection. The finding has been extended to other vectors
in which the natural operative association of exons and introns
have been altered. For example, the HC.DELTA.Intron 4 sequence
described in FIG. 5 similarly reduces IRT to undetectable
levels.
[0151] Table 1 sets forth the detail of the HC.DELTA.Intron 4
sequence described in FIG. 5.
TABLE-US-00003 TABLE 1 hu3D6 v2 HC-.DELTA.4
ATGGAGTTTGGGCTGAGCTGGCTTTTTCTTGTGGCTATTTTAAAAGGTGT
CCAGTGTGAGGTGCAGCTGCTGGAGTCCGGCGGCGGCCTGGTGCAGCCCG
GCGGCTCCCTGCGCCTGTCCTGCGCCGCCTCCGGCTTCACCTTCTCCAAC
TACGGCATGTCCTGGGTGCGCCAGGCCCCCGGCAAGGGCCTGGAGTGGGT
GGCCTCCATCCGCTCCGGCGGCGGCCGCACCTACTACTCCGACAACGTGA
AGGGCCGCTTCACCATCTCCCGCGACAACTCCAAGAACACCCTGTACCTG
CAGATGAACTCCCTGCGCGCCGAGGACACCGCCGTGTACTACTGCGTGCG
CTACGACCACTACTCCGGCTCCTCCGACTACTGGGGCCAGGGCACCCTGG
TGACCGTGTCCTCCGGTGAGTCCTGTCGACTCTAGAGCTTTCTGGGGCAG
GCCAGGCCTGACTTTGGCTGGGGGCAGGGAGGGGGCTAAGGTGACGCAGG
TGGCGCCAGCCAGGCGCACACCCAATGCCCATGAGCCCAGACCTGGACGC
TGAACCTCGCGGACAGTTAAGAACCCAGGGGCCTCTGCGCCCTGGGCCCA
GCTCTGTCCCACACCGCGGTCACATGGCACCACCTCTCTTGCAGCCTCCA
CCAAGGGCCCATCGGTCTTCCCCTGGCACCCTCCTCCAAGAGCACCTCTG
GGGGCACAGCGGCCCTGGGCTGCCTGGTCAAGGACTACTTCCCCGAACCG
GTGACGGTGTCGTGGAACTCAGGCGCCCTGACCAGCGGCGTGCACACTTC
CCGGCTGTCCTACAGTCCTCAGGACTCTACTCCCTCAGCAGCGTGGTGAC
CGTGCCCTCCAGCAGCTTGGGCACCCAGACCTACATCTGCAACGTGAATC
ACAAGCCCAGCAACACCAAGGTGACAAGAAAGTTGGTGAGAGGCCAGCAC
AGGGAGGGAGGGTGTCTGCTGGAAGCCAGGCTCAGCGCTCCTGCCTGGAC
GCATCCCGGCTATGCAGTCCCAGTCCAGGGCAGCAAGGCAGGCCCCGTCT
CCTCTTCACCCGGAGGCCTCTGCCCGCCCCACTCATGCTCAGGGAGAGGG
TCTTCTGGCTTTTTCCCCAGGCTCTGGGCAGGCACAGGCTAGGTGCCCCT
AACCCAGGCCCTGCACACAAAGGGGCAGTGCTGGGCTCAGACCTGCCAAG
AGCCATATCCGGGAGGACCCTGCCCCTGACCTAAGCCCACCCCAAAGGCC
AAACTCTCCACTCCCTCAGCTCGGACACCTTCTCTCCTCCCAGATTCCAG
TAACCCCAATCTTCTCTCTGCAGAGCCCAAATCTTGTGACAAAACTCACA
CATGCCCACCGTGCCCAGGTAAGCCAGCCCAGGCCTCGCCCTCCAGCTCA
AGGCGGGACAGGTGCCCTAGAGTAGCCTGCACCAGGGACAGGCCCCAGCC
GGGTGCTGACACGTCCACCTCCATCTCTTCCTCAGCACCTGAACTCCTGG
GGGGACCGTCAGTCTTCCTCTTCCCCCCAAAACCCAAGGACACCCTCATG
ATCTCCCGACCCCTGAGGTCACATGCGTGGTGGTGGACGTGAGCCACGAA
GACCCTGAGGTCAAGTTCAACTGGTACGTGGACGGCGTGGAGGTGCATAA
TGCCAAGACAAAGCCGCGGGAGGAGCAGTACAACACACGTACCGTGTGGT
CAGCGTCCTCACCGTCCTGCACCAGGACTGGCTGAATGGCAAGGAGTACA
AGTGCAAGGTCTCCAACAAAGCCCTCCCAGCCCCCATCGAGAAAACCATC
TCCAAAGCCAAAGGGCAGCCCCGAGAACCACAGGTGTACACCCGCCCCCA
TCCCGGGAGGAGATGACCAAGAACCAGGTCAGCCTGACCTGCCTGGTCAA
AGGCTTCTATCCCAGCGACATCGCCGTGGAGTGGGAGAGCAATGGGCAGC
CGGAGAACAACTACAAGACCCGCCTCCCGTGCTGGACTCCGACGGCTCCT
TCTTCCTCTATAGCAAGCTCACCGTGGACAAGAGCAGGTGGCAGCAGGGG
AACGTCTTCTCATGCTCCGTGATGCATGAGGCTCTGCACAACCACTAACG
CAGAAGAGCCTCTCCCTGTCCCCGGGTAAATGA
Example 3
Intron Removal Increases Protein Expression
[0152] To determine the effect of intron removal on antibody
expression, expression constructs of an antibody was created with
differing numbers of introns. Variable regions of 12A11v3.1 was
stably expressed in CHO cells with three constant region expression
constructs containing genomic sequence, cDNA sequence, and genomic
sequence with three introns deleted (i.e., intron between CH1 and
hinge region, intron between the hinge region and CH2, and intron
between CH2 and CH3). For 12A11v3.1, removal of the introns gave a
significant increase in antibody expression. More specifically,
about a five-fold increase in expression was detected in the
three-intron deleted construct for 12A11v3.1 compared to the
genomic sequence. The 12A11v3.1 construct having the cDNA sequence
showed over a six-fold increase in expression relative to the
genomic sequence. Whereas, well expressed antibodies typically did
not show a significant change in CHO-cell expression between the
intron-deleted sequences and the genomic sequences.
[0153] Although the foregoing invention has been described in
detail for purposes of clarity of understanding, it will be obvious
that certain modifications may be practiced within the scope of the
appended claims. All publications and patent documents cited
herein, as well as text appearing in the figures and sequence
listing, are hereby incorporated by reference in their entirety for
all purposes to the same extent as if each were so individually
denoted.
[0154] The specification is most thoroughly understood in light of
the teachings of the references cited within the specification
which are hereby incorporated by reference. The embodiments within
the specification provide an illustration of embodiments in this
disclosure and should not be construed to limit its scope. The
skilled artisan readily recognizes that many other embodiments are
encompassed by this disclosure. All publications and patents cited
and sequences identified by accession or database reference numbers
in this disclosure are incorporated by reference in their entirety.
To the extent the material incorporated by reference contradicts or
is inconsistent with the present specification, the present
specification will supercede any such material. The citation of any
references herein is not an admission that such references are
prior art to the present disclosure.
[0155] Unless otherwise indicated, all numbers expressing
quantities of ingredients, cell culture, treatment conditions, and
so forth used in the specification, including claims, are to be
understood as being modified in all instances by the term "about."
Accordingly, unless otherwise indicated the contrary, the numerical
parameters are approximations and may very depending upon the
desired properties sought to be obtained by the present invention.
Unless otherwise indicated, the term "at least" preceding a series
of elements is to be understood to refer to every element in the
series. Those skilled in the art will recognize, or be able to
ascertain using no more than routine experimentation, many
equivalents to the specific embodiments of the invention described
herein. Such equivalents are intended to be encompassed by the
following claims.
Sequence CWU 1
1
5511828DNAHomo
sapiensCDS(230)..(523)CDS(915)..(959)CDS(1078)..(1407)CDS(1505)..(1825)
1gtgagtcctg tcgactctag agctttctgg ggcaggccag gcctgacttt ggctgggggc
60agggaggggg ctaaggtgac gcaggtggcg ccagccaggc gcacacccaa tgcccatgag
120cccagacact ggacgctgaa cctcgcggac agttaagaac ccaggggcct
ctgcgccctg 180ggcccagctc tgtcccacac cgcggtcaca tggcaccacc tctcttgca
gcc tcc acc 238 Ala Ser Thr 1aag ggc cca tcg gtc ttc ccc ctg gca
ccc tcc tcc aag agc acc tct 286Lys Gly Pro Ser Val Phe Pro Leu Ala
Pro Ser Ser Lys Ser Thr Ser 5 10 15ggg ggc aca gcg gcc ctg ggc tgc
ctg gtc aag gac tac ttc ccc gaa 334Gly Gly Thr Ala Ala Leu Gly Cys
Leu Val Lys Asp Tyr Phe Pro Glu 20 25 30 35ccg gtg acg gtg tcg tgg
aac tca ggc gcc ctg acc agc ggc gtg cac 382Pro Val Thr Val Ser Trp
Asn Ser Gly Ala Leu Thr Ser Gly Val His 40 45 50acc ttc ccg gct gtc
cta cag tcc tca gga ctc tac tcc ctc agc agc 430Thr Phe Pro Ala Val
Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser 55 60 65gtg gtg acc gtg
ccc tcc agc agc ttg ggc acc cag acc tac atc tgc 478Val Val Thr Val
Pro Ser Ser Ser Leu Gly Thr Gln Thr Tyr Ile Cys 70 75 80aac gtg aat
cac aag ccc agc aac acc aag gtg gac aag aaa gtt 523Asn Val Asn His
Lys Pro Ser Asn Thr Lys Val Asp Lys Lys Val 85 90 95ggtgagaggc
cagcacaggg agggagggtg tctgctggaa gccaggctca gcgctcctgc
583ctggacgcat cccggctatg cagtcccagt ccagggcagc aaggcaggcc
ccgtctgcct 643cttcacccgg aggcctctgc ccgccccact catgctcagg
gagagggtct tctggctttt 703tccccaggct ctgggcaggc acaggctagg
tgcccctaac ccaggccctg cacacaaagg 763ggcaggtgct gggctcagac
ctgccaagag ccatatccgg gaggaccctg cccctgacct 823aagcccaccc
caaaggccaa actctccact ccctcagctc ggacaccttc tctcctccca
883gattccagta actcccaatc ttctctctgc a gag ccc aaa tct tgt gac aaa
935 Glu Pro Lys Ser Cys Asp Lys 100 105act cac aca tgc cca ccg tgc
cca ggtaagccag cccaggcctc gccctccagc 989Thr His Thr Cys Pro Pro Cys
Pro 110tcaaggcggg acaggtgccc tagagtagcc tgcatccagg gacaggcccc
agccgggtgc 1049tgacacgtcc acctccatct cttcctca gca cct gaa ctc ctg
ggg gga ccg 1101 Ala Pro Glu Leu Leu Gly Gly Pro 115 120tca gtc ttc
ctc ttc ccc cca aaa ccc aag gac acc ctc atg atc tcc 1149Ser Val Phe
Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser 125 130 135cgg
acc cct gag gtc aca tgc gtg gtg gtg gac gtg agc cac gaa gac 1197Arg
Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser His Glu Asp 140 145
150cct gag gtc aag ttc aac tgg tac gtg gac ggc gtg gag gtg cat aat
1245Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn
155 160 165gcc aag aca aag ccg cgg gag gag cag tac aac agc acg tac
cgt gtg 1293Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr
Arg Val170 175 180 185gtc agc gtc ctc acc gtc ctg cac cag gac tgg
ctg aat ggc aag gag 1341Val Ser Val Leu Thr Val Leu His Gln Asp Trp
Leu Asn Gly Lys Glu 190 195 200tac aag tgc aag gtc tcc aac aaa gcc
ctc cca gcc ccc atc gag aaa 1389Tyr Lys Cys Lys Val Ser Asn Lys Ala
Leu Pro Ala Pro Ile Glu Lys 205 210 215acc atc tcc aaa gcc aaa
ggtgggaccc gtggggtgcg agggccacat 1437Thr Ile Ser Lys Ala Lys
220ggacagaggc cggctcggcc caccctctgc cctgagagtg accgctgtac
caacctctgt 1497ccctaca ggg cag ccc cga gaa cca cag gtg tac acc ctg
ccc cca tcc 1546 Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro
Pro Ser 225 230 235cgg gag gag atg acc aag aac cag gtc agc ctg acc
tgc ctg gtc aaa 1594Arg Glu Glu Met Thr Lys Asn Gln Val Ser Leu Thr
Cys Leu Val Lys 240 245 250ggc ttc tat ccc agc gac atc gcc gtg gag
tgg gag agc aat ggg cag 1642Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu
Trp Glu Ser Asn Gly Gln 255 260 265ccg gag aac aac tac aag acc acg
cct ccc gtg ctg gac tcc gac ggc 1690Pro Glu Asn Asn Tyr Lys Thr Thr
Pro Pro Val Leu Asp Ser Asp Gly270 275 280 285tcc ttc ttc ctc tat
agc aag ctc acc gtg gac aag agc agg tgg cag 1738Ser Phe Phe Leu Tyr
Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln 290 295 300cag ggg aac
gtc ttc tca tgc tcc gtg atg cat gag gct ctg cac aac 1786Gln Gly Asn
Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn 305 310 315cac
tac acg cag aag agc ctc tcc ctg tcc ccg ggt aaa tga 1828His Tyr Thr
Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys 320 325 3302330PRTHomo
sapiens 2Ala Ser Thr Lys Gly Pro Ser Val Phe Pro Leu Ala Pro Ser
Ser Lys 1 5 10 15Ser Thr Ser Gly Gly Thr Ala Ala Leu Gly Cys Leu
Val Lys Asp Tyr 20 25 30Phe Pro Glu Pro Val Thr Val Ser Trp Asn Ser
Gly Ala Leu Thr Ser 35 40 45Gly Val His Thr Phe Pro Ala Val Leu Gln
Ser Ser Gly Leu Tyr Ser 50 55 60Leu Ser Ser Val Val Thr Val Pro Ser
Ser Ser Leu Gly Thr Gln Thr 65 70 75 80Tyr Ile Cys Asn Val Asn His
Lys Pro Ser Asn Thr Lys Val Asp Lys 85 90 95Lys Val Glu Pro Lys Ser
Cys Asp Lys Thr His Thr Cys Pro Pro Cys 100 105 110Pro Ala Pro Glu
Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro 115 120 125Lys Pro
Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys 130 135
140Val Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn
Trp145 150 155 160Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr
Lys Pro Arg Glu 165 170 175Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val
Ser Val Leu Thr Val Leu 180 185 190His Gln Asp Trp Leu Asn Gly Lys
Glu Tyr Lys Cys Lys Val Ser Asn 195 200 205Lys Ala Leu Pro Ala Pro
Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly 210 215 220Gln Pro Arg Glu
Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg Glu Glu225 230 235 240Met
Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr 245 250
255Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn
260 265 270Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser
Phe Phe 275 280 285Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp
Gln Gln Gly Asn 290 295 300Val Phe Ser Cys Ser Val Met His Glu Ala
Leu His Asn His Tyr Thr305 310 315 320Gln Lys Ser Leu Ser Leu Ser
Pro Gly Lys 325 33031820DNAHomo
sapiensCDS(230)..(523)CDS(916)..(951)CDS(1070)..(1399)CDS(1497)..(1817)
3gtgagtcctg tcgactctag agctttctgg ggcaggccag gcctgacttt ggctgggggc
60agggaggggg ctaaggtgac gcaggtggcg ccagccaggc gcacacccaa tgcccatgag
120cccagacact ggacgctgaa cctcgcggac agttaagaac ccaggggcct
ctgcgccctg 180ggcccagctc tgtcccacac cgcggtcaca tggcaccacc tctcttgca
gcc tcc acc 238 Ala Ser Thr 1aag ggc cca tcg gtc ttc ccc ctg gcg
ccc tgc tcc agg agc acc tcc 286Lys Gly Pro Ser Val Phe Pro Leu Ala
Pro Cys Ser Arg Ser Thr Ser 5 10 15gag agc aca gcg gcc ctg ggc tgc
ctg gtc aag gac tac ttc ccc gaa 334Glu Ser Thr Ala Ala Leu Gly Cys
Leu Val Lys Asp Tyr Phe Pro Glu 20 25 30 35ccg gtg acg gtg tcg tgg
aac tca ggc gcc ctg acc agc ggc gtg cac 382Pro Val Thr Val Ser Trp
Asn Ser Gly Ala Leu Thr Ser Gly Val His 40 45 50acc ttc ccg gct gtc
cta cag tcc tca gga ctc tac tcc ctc agc agc 430Thr Phe Pro Ala Val
Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser 55 60 65gtg gtg acc gtg
ccc tcc agc agc ttg ggc acg aag acc tac acc tgc 478Val Val Thr Val
Pro Ser Ser Ser Leu Gly Thr Lys Thr Tyr Thr Cys 70 75 80aat gta gat
cac aag ccc agc aac acc aag gtg gac aag aga gtt 523Asn Val Asp His
Lys Pro Ser Asn Thr Lys Val Asp Lys Arg Val 85 90 95ggtgagaggc
cagcacaggg agggagggtg tctgctggaa gccaggctca gccctcctgc
583ctggacgcac cccggctgtg cagccccagc ccagggcagc aaggcaggcc
ccatctgtct 643cctcacctgg aggcctctga ccaccccact catgctcagg
gagagggtct tctggatttt 703tccaccaggc tccgggcagc cacaggctgg
atgcccctac cccaggccct gcgcatacag 763gggcaggtgc tgcgctcaga
cctgccaaga gccatatccg ggaggaccct gcccctgacc 823taagcccacc
ccaaaggcca aactctccac tccctcagct cagacacctt ctctcctccc
883agatctgagt aactcccaat cttctctctg ca gag tcc aaa tat ggt ccc cca
936 Glu Ser Lys Tyr Gly Pro Pro 100 105tgc cca cca tgc cca
ggtaagccaa cccaggcctc gccctccagc tcaaggcggg 991Cys Pro Pro Cys Pro
110acaggtgccc tagagtagcc tgcatccagg gacaggcccc agccgggtgc
tgacgcatcc 1051acctccatct cttcctca gca cct gag ttc ctg ggg gga cca
tca gtc ttc 1102 Ala Pro Glu Phe Leu Gly Gly Pro Ser Val Phe 115
120ctg ttc ccc cca aaa ccc aag gac act ctc atg atc tcc cgg acc cct
1150Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro
125 130 135gag gtc acg tgc gtg gtg gtg gac gtg agc cag gaa gac ccc
gag gtc 1198Glu Val Thr Cys Val Val Val Asp Val Ser Gln Glu Asp Pro
Glu Val 140 145 150cag ttc aac tgg tac gtg gat ggc gtg gag gtg cat
aat gcc aag aca 1246Gln Phe Asn Trp Tyr Val Asp Gly Val Glu Val His
Asn Ala Lys Thr 155 160 165aag ccg cgg gag gag cag ttc aac agc acg
tac cgt gtg gtc agc gtc 1294Lys Pro Arg Glu Glu Gln Phe Asn Ser Thr
Tyr Arg Val Val Ser Val170 175 180 185ctc acc gtc ctg cac cag gac
tgg ctg aac ggc aag gag tac aag tgc 1342Leu Thr Val Leu His Gln Asp
Trp Leu Asn Gly Lys Glu Tyr Lys Cys 190 195 200aag gtc tcc aac aaa
ggc ctc ccg tcc tcc atc gag aaa acc atc tcc 1390Lys Val Ser Asn Lys
Gly Leu Pro Ser Ser Ile Glu Lys Thr Ile Ser 205 210 215aaa gcc aaa
ggtgggaccc acggggtgcg agggccacat ggacagaggt 1439Lys Ala Lys
220cagctcggcc caccctctgc cctgggagtg accgctgtgc caacctctgt ccctaca
1496ggg cag ccc cga gag cca cag gtg tac acc ctg ccc cca tcc cag gag
1544Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Gln Glu
225 230 235gag atg acc aag aac cag gtc agc ctg acc tgc ctg gtc aaa
ggc ttc 1592Glu Met Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys
Gly Phe 240 245 250tac ccc agc gac atc gcc gtg gag tgg gag agc aat
ggg cag ccg gag 1640Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn
Gly Gln Pro Glu 255 260 265aac aac tac aag acc acg cct ccc gtg ctg
gac tcc gac ggc tcc ttc 1688Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu
Asp Ser Asp Gly Ser Phe 270 275 280ttc ctc tac agc agg cta acc gtg
gac aag agc agg tgg cag gag ggg 1736Phe Leu Tyr Ser Arg Leu Thr Val
Asp Lys Ser Arg Trp Gln Glu Gly285 290 295 300aat gtc ttc tca tgc
tcc gtg atg cat gag gct ctg cac aac cac tac 1784Asn Val Phe Ser Cys
Ser Val Met His Glu Ala Leu His Asn His Tyr 305 310 315aca cag aag
agc ctc tcc ctg tct ctg ggt aaa tga 1820Thr Gln Lys Ser Leu Ser Leu
Ser Leu Gly Lys 320 3254327PRTHomo sapiens 4Ala Ser Thr Lys Gly Pro
Ser Val Phe Pro Leu Ala Pro Cys Ser Arg 1 5 10 15Ser Thr Ser Glu
Ser Thr Ala Ala Leu Gly Cys Leu Val Lys Asp Tyr 20 25 30Phe Pro Glu
Pro Val Thr Val Ser Trp Asn Ser Gly Ala Leu Thr Ser 35 40 45Gly Val
His Thr Phe Pro Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser 50 55 60Leu
Ser Ser Val Val Thr Val Pro Ser Ser Ser Leu Gly Thr Lys Thr 65 70
75 80Tyr Thr Cys Asn Val Asp His Lys Pro Ser Asn Thr Lys Val Asp
Lys 85 90 95Arg Val Glu Ser Lys Tyr Gly Pro Pro Cys Pro Pro Cys Pro
Ala Pro 100 105 110Glu Phe Leu Gly Gly Pro Ser Val Phe Leu Phe Pro
Pro Lys Pro Lys 115 120 125Asp Thr Leu Met Ile Ser Arg Thr Pro Glu
Val Thr Cys Val Val Val 130 135 140Asp Val Ser Gln Glu Asp Pro Glu
Val Gln Phe Asn Trp Tyr Val Asp145 150 155 160Gly Val Glu Val His
Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Phe 165 170 175Asn Ser Thr
Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp 180 185 190Trp
Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Gly Leu 195 200
205Pro Ser Ser Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg
210 215 220Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Gln Glu Glu Met
Thr Lys225 230 235 240Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly
Phe Tyr Pro Ser Asp 245 250 255Ile Ala Val Glu Trp Glu Ser Asn Gly
Gln Pro Glu Asn Asn Tyr Lys 260 265 270Thr Thr Pro Pro Val Leu Asp
Ser Asp Gly Ser Phe Phe Leu Tyr Ser 275 280 285Arg Leu Thr Val Asp
Lys Ser Arg Trp Gln Glu Gly Asn Val Phe Ser 290 295 300Cys Ser Val
Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser305 310 315
320Leu Ser Leu Ser Leu Gly Lys 32551814DNAHomo sapiens 5gtgagtcctg
tcgactctag agctttctgg ggcaggccag gcctgacttt ggctgggggc 60agggaggggg
ctaaggtgac gcaggtggcg ccagccaggc gcacacccaa tgcccatgag
120cccagacctg gacgctgaac ctcgcggaca gttaagaacc caggggcctc
tgcgccctgg 180gcccagctct gtcccacacc gcggtcacat ggcaccacct
ctcttgcagc ctccaccaag 240ggcccatcgg tcttcccctg gcaccctcct
ccaagagcac ctctgggggc acagcggccc 300tgggctgcct ggtcaaggac
tacttccccg aaccggtgac ggtgtcgtgg aactcaggcg 360ccctgaccag
cggcgtgcac acttcccggc tgtcctacag tcctcaggac tctactccct
420cagcagcgtg gtgaccgtgc cctccagcag cttgggcacc cagacctaca
tctgcaacgt 480gaatcacaag cccagcaaca ccaaggtgac aagaaagttg
gtgagaggcc agcacaggga 540gggagggtgt ctgctggaag ccaggctcag
cgctcctgcc tggacgcatc ccggctatgc 600agtcccagtc cagggcagca
aggcaggccc cgtctcctct tcacccggag gcctctgccc 660gccccactca
tgctcaggga gagggtcttc tggctttttc cccaggctct gggcaggcac
720aggctaggtg cccctaaccc aggccctgca cacaaagggg cagtgctggg
ctcagacctg 780ccaagagcca tatccgggag gaccctgccc ctgacctaag
cccaccccaa aggccaaact 840ctccactccc tcagctcgga caccttctct
cctcccagat tccagtaacc ccaatcttct 900ctctgcagag cccaaatctt
gtgacaaaac tcacacatgc ccaccgtgcc caggtaagcc 960agcccaggcc
tcgccctcca gctcaaggcg ggacaggtgc cctagagtag cctgcaccag
1020ggacaggccc cagccgggtg ctgacacgtc cacctccatc tcttcctcag
cacctgaact 1080cctgggggga ccgtcagtct tcctcttccc cccaaaaccc
aaggacaccc tcatgatctc 1140ccgacccctg aggtcacatg cgtggtggtg
gacgtgagcc acgaagaccc tgaggtcaag 1200ttcaactggt acgtggacgg
cgtggaggtg cataatgcca agacaaagcc gcgggaggag 1260cagtacaaca
cacgtaccgt gtggtcagcg tcctcaccgt cctgcaccag gactggctga
1320atggcaagga gtacaagtgc aaggtctcca acaaagccct cccagccccc
atcgagaaaa 1380ccatctccaa agccaaagtg ggacccgtgg ggtgcgaggg
ccacatggac agaggccggc 1440tcggcccacc ctctgccctg agagtgaccg
ctgtaccaac ctctgtccct acagggcagc 1500cccgagaacc acaggtgtac
acccgccccc atcccgggag gagatgacca agaaccaggt 1560cagcctgacc
tgcctggtca aaggcttcta tcccagcgac atcgccgtgg agtgggagag
1620caatgggcag ccggagaaca actacaagac ccgcctcccg tgctggactc
cgacggctcc 1680ttcttcctct atagcaagct caccgtggac aagagcaggt
ggcagcaggg gaacgtcttc 1740tcatgctccg tgatgcatga ggctctgcac
aaccactaac gcagaagagc ctctccctgt 1800ccccgggtaa atga
181461213DNAHomo sapiens 6gtgagtcctg tcgactctag agctttctgg
ggcaggccag gcctgacttt ggctgggggc 60agggaggggg ctaaggtgac gcaggtggcg
ccagccaggc gcacacccaa tgcccatgag 120cccagacact ggacgctgaa
cctcgcggac agttaagaac ccaggggcct ctgcgccctg 180ggcccagctc
tgtcccacac cgcggtcaca tggcaccacc tctcttgcag cctccaccaa
240gggcccatcg gtcttccccc tggcgccctg ctccaggagc acctccgaga
gcacagcggc 300cctgggctgc ctggtcaagg actacttccc cgaaccggtg
acggtgtcgt
ggaactcagg 360cgccctgacc agcggcgtgc acaccttccc ggctgtccta
cagtcctcag gactctactc 420cctcagcagc gtggtgaccg tgccctccag
cagcttgggc acgaagacct acacctgcaa 480tgtagatcac aagcccagca
acaccaaggt ggacaagaga gttgagtcca aatatggtcc 540cccatgccca
ccatgcccag cacctgagtt cctgggggga ccatcagtct tcctgttccc
600cccaaaaccc aaggacactc tcatgatctc ccggacccct gaggtcacgt
gcgtggtggt 660ggacgtgagc caggaagacc ccgaggtcca gttcaactgg
tacgtggatg gcgtggaggt 720gcataatgcc aagacaaagc cgcgggagga
gcagttcaac agcacgtacc gtgtggtcag 780cgtcctcacc gtcctgcacc
aggactggct gaacggcaag gagtacaagt gcaaggtctc 840caacaaaggc
ctcccgtcct ccatcgagaa aaccatctcc aaagccaaag ggcagccccg
900agagccacag gtgtacaccc tgcccccatc ccaggaggag atgaccaaga
accaggtcag 960cctgacctgc ctggtcaaag gcttctaccc cagcgacatc
gccgtggagt gggagagcaa 1020tgggcagccg gagaacaact acaagaccac
gcctcccgtg ctggactccg acggctcctt 1080cttcctctac agcaggctaa
ccgtggacaa gagcaggtgg caggagggga atgtcttctc 1140atgctccgtg
atgcatgagg ctctgcacaa ccactacaca cagaagagcc tctccctgtc
1200tctgggtaaa tga 12137240DNAHomo sapiens 7ggcaaggagt acaagtgcaa
ggtctccaac aaagccctcc cagcccccat cgagaaaacc 60atctccaaag ccaaa ggt
ggg acc cgt ggg gtg cga ggg cca cat gga cag 111 Gly Gly Thr Arg Gly
Val Arg Gly Pro His Gly Gln 1 5 10agg ccg gct cgg ccc acc ctc tgc
cct gag agt gac cgc tgt acc aac 159Arg Pro Ala Arg Pro Thr Leu Cys
Pro Glu Ser Asp Arg Cys Thr Asn 15 20 25ctc tgt ccc tac agg gca gcc
ccg aga acc aca ggt gta cac cct gcc 207Leu Cys Pro Tyr Arg Ala Ala
Pro Arg Thr Thr Gly Val His Pro Ala 30 35 40ccc atc ccg gga gga gat
gac caa gaa cca ggt 240Pro Ile Pro Gly Gly Asp Asp Gln Glu Pro Gly
45 50 55855PRTHomo sapiens 8Gly Gly Thr Arg Gly Val Arg Gly Pro His
Gly Gln Arg Pro Ala Arg 1 5 10 15Pro Thr Leu Cys Pro Glu Ser Asp
Arg Cys Thr Asn Leu Cys Pro Tyr 20 25 30Arg Ala Ala Pro Arg Thr Thr
Gly Val His Pro Ala Pro Ile Pro Gly 35 40 45Gly Asp Asp Gln Glu Pro
Gly 50 55947PRTHomo sapiens 9Gly Lys Glu Tyr Lys Cys Lys Val Ser
Asn Lys Ala Leu Pro Ala Pro 1 5 10 15Ile Glu Lys Thr Ile Ser Lys
Ala Lys Gln Pro Arg Glu Pro Gln Val 20 25 30Tyr Thr Leu Pro Pro Ser
Arg Glu Glu Met Thr Lys Asn Gln Val 35 40 4510142PRTMus musculus
10Met Asp Arg Leu Thr Ser Ser Phe Leu Leu Leu Ile Val Pro Ala Tyr 1
5 10 15Val Leu Ser Gln Ala Thr Leu Lys Glu Ser Gly Pro Gly Ile Leu
Gln 20 25 30Ser Ser Gln Thr Leu Ser Leu Thr Cys Ser Phe Ser Gly Phe
Ser Leu 35 40 45Ser Thr Ser Gly Met Gly Val Ser Trp Ile Arg Gln Pro
Ser Gly Lys 50 55 60Gly Leu Glu Trp Leu Ala His Ile Tyr Trp Asp Asp
Asp Lys Arg Tyr 65 70 75 80Asn Pro Ser Leu Lys Ser Arg Leu Thr Ile
Ser Lys Asp Thr Ser Arg 85 90 95Lys Gln Val Phe Leu Lys Ile Thr Ser
Val Asp Pro Ala Asp Thr Ala 100 105 110Thr Tyr Tyr Cys Val Arg Arg
Pro Ile Thr Pro Val Leu Val Asp Ala 115 120 125Met Asp Tyr Trp Gly
Gln Gly Thr Ser Val Thr Val Ser Ser 130 135 14011138PRTMus musculus
11Met Asn Phe Gly Leu Ser Leu Ile Phe Leu Val Leu Val Leu Lys Gly 1
5 10 15Val Gln Cys Glu Val Lys Leu Val Glu Ser Gly Gly Gly Leu Val
Lys 20 25 30Pro Gly Ala Ser Leu Lys Leu Ser Cys Ala Ala Ser Gly Phe
Thr Phe 35 40 45Ser Asn Tyr Gly Met Ser Trp Val Arg Gln Asn Ser Asp
Lys Arg Leu 50 55 60Glu Trp Val Ala Ser Ile Arg Ser Gly Gly Gly Arg
Thr Tyr Tyr Ser 65 70 75 80Asp Asn Val Lys Gly Arg Phe Thr Ile Ser
Arg Glu Asn Ala Lys Asn 85 90 95Thr Leu Tyr Leu Gln Met Ser Ser Leu
Lys Ser Glu Asp Thr Ala Leu 100 105 110Tyr Tyr Cys Val Arg Tyr Asp
His Tyr Ser Gly Ser Ser Asp Tyr Trp 115 120 125Gly Gln Gly Thr Thr
Val Thr Val Ser Ser 130 13512119PRTArtificial SequenceDescription
of Artificial Sequence Synthetic humanized antibody hum3d6VHv1.aa
12Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1
5 10 15Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asn
Tyr 20 25 30Gly Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu
Trp Val 35 40 45Ala Ser Ile Arg Ser Gly Gly Gly Arg Thr Tyr Tyr Ser
Asp Asn Val 50 55 60Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys
Asn Ser Leu Tyr 65 70 75 80Leu Gln Met Asn Ser Leu Arg Ala Glu Asp
Thr Ala Leu Tyr Tyr Cys 85 90 95Val Arg Tyr Asp His Tyr Ser Gly Ser
Ser Asp Tyr Trp Gly Gln Gly 100 105 110Thr Leu Val Thr Val Ser Ser
11513112PRTMus musculus 13Glu Val Lys Leu Val Glu Ser Gly Gly Gly
Leu Val Gln Pro Gly Gly 1 5 10 15Ser Leu Lys Leu Ser Cys Ala Val
Ser Gly Phe Thr Phe Ser Arg Tyr 20 25 30Ser Met Ser Trp Val Arg Gln
Thr Pro Glu Lys Arg Leu Glu Leu Val 35 40 45Ala Gln Ile Asn Ser Val
Gly Asn Ser Thr Tyr Tyr Pro Asp Thr Val 50 55 60Lys Gly Arg Phe Thr
Ile Ser Arg Asp Asn Ala Glu Tyr Thr Leu Ser 65 70 75 80Leu Gln Met
Ser Gly Leu Arg Ser Asp Asp Thr Ala Thr Tyr Tyr Cys 85 90 95Ala Ser
Gly Asp Tyr Trp Gly Gln Gly Thr Thr Leu Thr Val Ser Ser 100 105
11014112PRTHomo sapiens 14Glu Val Gln Leu Val Glu Ser Gly Gly Gly
Leu Val Gln Pro Gly Gly 1 5 10 15Ser Leu Arg Leu Ser Cys Ala Ala
Ser Gly Phe Thr Phe Ser Arg Tyr 20 25 30Ser Met Ser Trp Val Arg Gln
Ala Pro Gly Lys Gly Leu Glu Leu Val 35 40 45Ala Gln Ile Asn Ser Val
Gly Asn Ser Thr Tyr Tyr Pro Asp Thr Val 50 55 60Lys Gly Arg Phe Thr
Ile Ser Arg Asp Asn Ala Lys Asn Thr Leu Tyr 65 70 75 80Leu Gln Met
Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95Ala Ser
Gly Asp Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser 100 105
11015120PRTMus musculus 15Gln Val Thr Leu Lys Glu Ser Gly Pro Gly
Ile Leu Lys Pro Ser Gln 1 5 10 15Thr Leu Ser Leu Thr Cys Ser Phe
Ser Gly Phe Ser Leu Ser Thr Ser 20 25 30Gly Met Ser Val Gly Trp Ile
Arg Gln Pro Ser Gly Lys Gly Leu Glu 35 40 45Trp Leu Ala His Ile Trp
Trp Asp Asp Asp Lys Tyr Tyr Asn Pro Ser 50 55 60Leu Lys Ser Arg Leu
Thr Ile Ser Lys Asp Thr Ser Arg Asn Gln Val 65 70 75 80Phe Leu Lys
Ile Thr Ser Val Asp Thr Ala Asp Thr Ala Thr Tyr Tyr 85 90 95Cys Ala
Arg Arg Thr Thr Thr Ala Asp Tyr Phe Ala Tyr Trp Gly Gln 100 105
110Gly Thr Thr Leu Thr Val Ser Ser 115 12016120PRTArtificial
SequenceDescription of Artificial Sequence Synthetic humanized
hu12A11 heavy chain v.1 16Gln Val Gln Leu Val Glu Ser Gly Gly Gly
Val Val Gln Pro Gly Arg 1 5 10 15Ser Leu Arg Leu Ser Cys Ala Phe
Ser Gly Phe Ser Leu Ser Thr Ser 20 25 30Gly Met Ser Val Gly Trp Ile
Arg Gln Ala Pro Gly Lys Gly Leu Glu 35 40 45Trp Leu Ala His Ile Trp
Trp Asp Asp Asp Lys Tyr Tyr Asn Pro Ser 50 55 60Leu Lys Ser Arg Leu
Thr Ile Ser Lys Asp Thr Ser Lys Asn Thr Val 65 70 75 80Tyr Leu Gln
Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr 85 90 95Cys Ala
Arg Arg Thr Thr Thr Ala Asp Tyr Phe Ala Tyr Trp Gly Gln 100 105
110Gly Thr Thr Val Thr Val Ser Ser 115 12017120PRTArtificial
SequenceDescription of Artificial Sequence Synthetic humanized
hu12A11 heavy chain v.2 17Gln Val Gln Leu Val Glu Ser Gly Gly Gly
Val Val Gln Pro Gly Arg 1 5 10 15Ser Leu Arg Leu Ser Cys Ala Phe
Ser Gly Phe Thr Leu Ser Thr Ser 20 25 30Gly Met Ser Val Gly Trp Ile
Arg Gln Ala Pro Gly Lys Gly Leu Glu 35 40 45Trp Val Ala His Ile Trp
Trp Asp Asp Asp Lys Tyr Tyr Asn Pro Ser 50 55 60Leu Lys Ser Arg Phe
Thr Ile Ser Lys Asp Thr Ser Lys Asn Thr Leu 65 70 75 80Tyr Leu Gln
Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr 85 90 95Cys Ala
Arg Arg Thr Thr Thr Ala Asp Tyr Phe Ala Tyr Trp Gly Gln 100 105
110Gly Thr Thr Val Thr Val Ser Ser 115 12018120PRTArtificial
SequenceDescription of Artificial Sequence Synthetic humanized
hu12A11 heavy chain v.2.1 18Gln Val Gln Leu Val Glu Ser Gly Gly Gly
Val Val Gln Pro Gly Arg 1 5 10 15Ser Leu Arg Leu Ser Cys Ala Phe
Ser Gly Phe Thr Leu Ser Thr Ser 20 25 30Gly Met Ser Val Gly Trp Ile
Arg Gln Ala Pro Gly Lys Gly Leu Glu 35 40 45Trp Val Ala His Ile Trp
Trp Asp Asp Asp Lys Tyr Tyr Asn Pro Ser 50 55 60Leu Lys Ser Arg Phe
Thr Ile Ser Lys Asp Asn Ser Lys Asn Thr Leu 65 70 75 80Tyr Leu Gln
Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr 85 90 95Cys Ala
Arg Arg Thr Thr Thr Ala Asp Tyr Phe Ala Tyr Trp Gly Gln 100 105
110Gly Thr Thr Val Thr Val Ser Ser 115 12019120PRTArtificial
SequenceDescription of Artificial Sequence Synthetic humanized
hu12A11 heavy chain v.3 19Gln Val Gln Leu Val Glu Ser Gly Gly Gly
Val Val Gln Pro Gly Arg 1 5 10 15Ser Leu Arg Leu Ser Cys Ala Phe
Ser Gly Phe Thr Leu Ser Thr Ser 20 25 30Gly Met Ser Val Gly Trp Ile
Arg Gln Ala Pro Gly Lys Gly Leu Glu 35 40 45Trp Val Ala His Ile Trp
Trp Asp Asp Asp Lys Tyr Tyr Asn Pro Ser 50 55 60Leu Lys Ser Arg Phe
Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu 65 70 75 80Tyr Leu Gln
Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr 85 90 95Cys Ala
Arg Arg Thr Thr Thr Ala Asp Tyr Phe Ala Tyr Trp Gly Gln 100 105
110Gly Thr Thr Val Thr Val Ser Ser 115 12020139PRTArtificial
SequenceDescription of Artificial Sequence Synthetic humanized
12A11 v3.1 heavy chain variable region 20Met Glu Phe Gly Leu Ser
Trp Val Phe Leu Val Ala Leu Leu Arg Gly 1 5 10 15Val Gln Cys Gln
Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln 20 25 30Pro Gly Arg
Ser Leu Arg Leu Ser Cys Ala Phe Ser Gly Phe Thr Leu 35 40 45Ser Thr
Ser Gly Met Ser Val Gly Trp Ile Arg Gln Ala Pro Gly Lys 50 55 60Gly
Leu Glu Trp Leu Ala His Ile Trp Trp Asp Asp Asp Lys Tyr Tyr 65 70
75 80Asn Pro Ser Leu Lys Ser Arg Phe Thr Ile Ser Lys Asp Asn Ser
Lys 85 90 95Asn Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp
Thr Ala 100 105 110Val Tyr Tyr Cys Ala Arg Arg Thr Thr Thr Ala Asp
Tyr Phe Ala Tyr 115 120 125Trp Gly Gln Gly Thr Thr Val Thr Val Ser
Ser 130 13521120PRTArtificial SequenceDescription of Artificial
Sequence Synthetic humanized hu12A11 heavy chain v.4.1 21Gln Val
Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg 1 5 10
15Ser Leu Arg Leu Ser Cys Ala Phe Ser Gly Phe Thr Leu Ser Thr Ser
20 25 30Gly Met Ser Val Gly Trp Ile Arg Gln Ala Pro Gly Lys Gly Leu
Glu 35 40 45Trp Leu Ala His Ile Trp Trp Asp Asp Asp Lys Tyr Tyr Asn
Pro Ser 50 55 60Leu Lys Ser Arg Leu Thr Ile Ser Lys Asp Thr Ser Lys
Asn Thr Val 65 70 75 80Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp
Thr Ala Val Tyr Tyr 85 90 95Cys Ala Arg Arg Thr Thr Thr Ala Asp Tyr
Phe Ala Tyr Trp Gly Gln 100 105 110Gly Thr Thr Val Thr Val Ser Ser
115 12022120PRTArtificial SequenceDescription of Artificial
Sequence Synthetic humanized hu12A11 heavy chain v.4.2 22Gln Val
Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg 1 5 10
15Ser Leu Arg Leu Ser Cys Ala Phe Ser Gly Phe Ser Leu Ser Thr Ser
20 25 30Gly Met Ser Val Gly Trp Ile Arg Gln Ala Pro Gly Lys Gly Leu
Glu 35 40 45Trp Val Ala His Ile Trp Trp Asp Asp Asp Lys Tyr Tyr Asn
Pro Ser 50 55 60Leu Lys Ser Arg Leu Thr Ile Ser Lys Asp Thr Ser Lys
Asn Thr Val 65 70 75 80Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp
Thr Ala Val Tyr Tyr 85 90 95Cys Ala Arg Arg Thr Thr Thr Ala Asp Tyr
Phe Ala Tyr Trp Gly Gln 100 105 110Gly Thr Thr Val Thr Val Ser Ser
115 12023120PRTArtificial SequenceDescription of Artificial
Sequence Synthetic humanized hu12A11 heavy chain v.4.3 23Gln Val
Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg 1 5 10
15Ser Leu Arg Leu Ser Cys Ala Phe Ser Gly Phe Ser Leu Ser Thr Ser
20 25 30Gly Met Ser Val Gly Trp Ile Arg Gln Ala Pro Gly Lys Gly Leu
Glu 35 40 45Trp Leu Ala His Ile Trp Trp Asp Asp Asp Lys Tyr Tyr Asn
Pro Ser 50 55 60Leu Lys Ser Arg Phe Thr Ile Ser Lys Asp Thr Ser Lys
Asn Thr Val 65 70 75 80Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp
Thr Ala Val Tyr Tyr 85 90 95Cys Ala Arg Arg Thr Thr Thr Ala Asp Tyr
Phe Ala Tyr Trp Gly Gln 100 105 110Gly Thr Thr Val Thr Val Ser Ser
115 12024120PRTArtificial SequenceDescription of Artificial
Sequence Synthetic humanized hu12A11 heavy chain v.4.4 24Gln Val
Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg 1 5 10
15Ser Leu Arg Leu Ser Cys Ala Phe Ser Gly Phe Ser Leu Ser Thr Ser
20 25 30Gly Met Ser Val Gly Trp Ile Arg Gln Ala Pro Gly Lys Gly Leu
Glu 35 40 45Trp Leu Ala His Ile Trp Trp Asp Asp Asp Lys Tyr Tyr Asn
Pro Ser 50 55 60Leu Lys Ser Arg Leu Thr Ile Ser Lys Asp Thr Ser Lys
Asn Thr Leu 65 70 75 80Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp
Thr Ala Val Tyr Tyr 85 90 95Cys Ala Arg Arg Thr Thr Thr Ala Asp Tyr
Phe Ala Tyr Trp Gly Gln 100 105 110Gly Thr Thr Val Thr Val Ser Ser
115 12025120PRTArtificial SequenceDescription of Artificial
Sequence Synthetic humanized hu12A11 heavy chain v.5.1 25Gln Val
Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg 1 5 10
15Ser Leu Arg Leu Ser Cys Ala Phe Ser Gly Phe Thr Leu Ser Thr Ser
20 25 30Gly Met Ser Val Gly Trp Ile Arg Gln Ala Pro Gly Lys Gly Leu
Glu 35 40 45Trp Val Ala His Ile Trp Trp Asp Asp Asp Lys Tyr Tyr Asn
Pro Ser 50 55
60Leu Lys Ser Arg Leu Thr Ile Ser Lys Asp Thr Ser Lys Asn Thr Val
65 70 75 80Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val
Tyr Tyr 85 90 95Cys Ala Arg Arg Thr Thr Thr Ala Asp Tyr Phe Ala Tyr
Trp Gly Gln 100 105 110Gly Thr Thr Val Thr Val Ser Ser 115
12026120PRTArtificial SequenceDescription of Artificial Sequence
Synthetic humanized hu12A11 heavy chain v.5.2 26Gln Val Gln Leu Val
Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg 1 5 10 15Ser Leu Arg
Leu Ser Cys Ala Phe Ser Gly Phe Thr Leu Ser Thr Ser 20 25 30Gly Met
Ser Val Gly Trp Ile Arg Gln Ala Pro Gly Lys Gly Leu Glu 35 40 45Trp
Leu Ala His Ile Trp Trp Asp Asp Asp Lys Tyr Tyr Asn Pro Ser 50 55
60Leu Lys Ser Arg Phe Thr Ile Ser Lys Asp Thr Ser Lys Asn Thr Val
65 70 75 80Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val
Tyr Tyr 85 90 95Cys Ala Arg Arg Thr Thr Thr Ala Asp Tyr Phe Ala Tyr
Trp Gly Gln 100 105 110Gly Thr Thr Val Thr Val Ser Ser 115
12027120PRTArtificial SequenceDescription of Artificial Sequence
Synthetic humanized hu12A11 heavy chain v.5.3 27Gln Val Gln Leu Val
Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg 1 5 10 15Ser Leu Arg
Leu Ser Cys Ala Phe Ser Gly Phe Thr Leu Ser Thr Ser 20 25 30Gly Met
Ser Val Gly Trp Ile Arg Gln Ala Pro Gly Lys Gly Leu Glu 35 40 45Trp
Leu Ala His Ile Trp Trp Asp Asp Asp Lys Tyr Tyr Asn Pro Ser 50 55
60Leu Lys Ser Arg Leu Thr Ile Ser Lys Asp Thr Ser Lys Asn Thr Leu
65 70 75 80Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val
Tyr Tyr 85 90 95Cys Ala Arg Arg Thr Thr Thr Ala Asp Tyr Phe Ala Tyr
Trp Gly Gln 100 105 110Gly Thr Thr Val Thr Val Ser Ser 115
12028120PRTArtificial SequenceDescription of Artificial Sequence
Synthetic humanized hu12A11 heavy chain v.5.4 28Gln Val Gln Leu Val
Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg 1 5 10 15Ser Leu Arg
Leu Ser Cys Ala Phe Ser Gly Phe Ser Leu Ser Thr Ser 20 25 30Gly Met
Ser Val Gly Trp Ile Arg Gln Ala Pro Gly Lys Gly Leu Glu 35 40 45Trp
Val Ala His Ile Trp Trp Asp Asp Asp Lys Tyr Tyr Asn Pro Ser 50 55
60Leu Lys Ser Arg Phe Thr Ile Ser Lys Asp Thr Ser Lys Asn Thr Val
65 70 75 80Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val
Tyr Tyr 85 90 95Cys Ala Arg Arg Thr Thr Thr Ala Asp Tyr Phe Ala Tyr
Trp Gly Gln 100 105 110Gly Thr Thr Val Thr Val Ser Ser 115
12029120PRTArtificial SequenceDescription of Artificial Sequence
Synthetic humanized hu12A11 heavy chain v.5.5 29Gln Val Gln Leu Val
Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg 1 5 10 15Ser Leu Arg
Leu Ser Cys Ala Phe Ser Gly Phe Ser Leu Ser Thr Ser 20 25 30Gly Met
Ser Val Gly Trp Ile Arg Gln Ala Pro Gly Lys Gly Leu Glu 35 40 45Trp
Val Ala His Ile Trp Trp Asp Asp Asp Lys Tyr Tyr Asn Pro Ser 50 55
60Leu Lys Ser Arg Leu Thr Ile Ser Lys Asp Thr Ser Lys Asn Thr Leu
65 70 75 80Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val
Tyr Tyr 85 90 95Cys Ala Arg Arg Thr Thr Thr Ala Asp Tyr Phe Ala Tyr
Trp Gly Gln 100 105 110Gly Thr Thr Val Thr Val Ser Ser 115
12030120PRTArtificial SequenceDescription of Artificial Sequence
Synthetic humanized hu12A11 heavy chain v.5.6 30Gln Val Gln Leu Val
Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg 1 5 10 15Ser Leu Arg
Leu Ser Cys Ala Phe Ser Gly Phe Ser Leu Ser Thr Ser 20 25 30Gly Met
Ser Val Gly Trp Ile Arg Gln Ala Pro Gly Lys Gly Leu Glu 35 40 45Trp
Leu Ala His Ile Trp Trp Asp Asp Asp Lys Tyr Tyr Asn Pro Ser 50 55
60Leu Lys Ser Arg Phe Thr Ile Ser Lys Asp Thr Ser Lys Asn Thr Leu
65 70 75 80Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val
Tyr Tyr 85 90 95Cys Ala Arg Arg Thr Thr Thr Ala Asp Tyr Phe Ala Tyr
Trp Gly Gln 100 105 110Gly Thr Thr Val Thr Val Ser Ser 115
12031120PRTArtificial SequenceDescription of Artificial Sequence
Synthetic humanized hu12A11 heavy chain v.6.1 31Gln Val Gln Leu Val
Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg 1 5 10 15Ser Leu Arg
Leu Ser Cys Ala Phe Ser Gly Phe Thr Leu Ser Thr Ser 20 25 30Gly Met
Ser Val Gly Trp Ile Arg Gln Ala Pro Gly Lys Gly Leu Glu 35 40 45Trp
Val Ala His Ile Trp Trp Asp Asp Asp Lys Tyr Tyr Asn Pro Ser 50 55
60Leu Lys Ser Arg Phe Thr Ile Ser Lys Asp Thr Ser Lys Asn Thr Val
65 70 75 80Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val
Tyr Tyr 85 90 95Cys Ala Arg Arg Thr Thr Thr Ala Asp Tyr Phe Ala Tyr
Trp Gly Gln 100 105 110Gly Thr Thr Val Thr Val Ser Ser 115
12032120PRTArtificial SequenceDescription of Artificial Sequence
Synthetic humanized hu12A11 heavy chain v.6.2 32Gln Val Gln Leu Val
Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg 1 5 10 15Ser Leu Arg
Leu Ser Cys Ala Phe Ser Gly Phe Thr Leu Ser Thr Ser 20 25 30Gly Met
Ser Val Gly Trp Ile Arg Gln Ala Pro Gly Lys Gly Leu Glu 35 40 45Trp
Val Ala His Ile Trp Trp Asp Asp Asp Lys Tyr Tyr Asn Pro Ser 50 55
60Leu Lys Ser Arg Leu Thr Ile Ser Lys Asp Thr Ser Lys Asn Thr Leu
65 70 75 80Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val
Tyr Tyr 85 90 95Cys Ala Arg Arg Thr Thr Thr Ala Asp Tyr Phe Ala Tyr
Trp Gly Gln 100 105 110Gly Thr Thr Val Thr Val Ser Ser 115
12033120PRTArtificial SequenceDescription of Artificial Sequence
Synthetic humanized hu12A11 heavy chain v.6.3 33Gln Val Gln Leu Val
Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg 1 5 10 15Ser Leu Arg
Leu Ser Cys Ala Phe Ser Gly Phe Thr Leu Ser Thr Ser 20 25 30Gly Met
Ser Val Gly Trp Ile Arg Gln Ala Pro Gly Lys Gly Leu Glu 35 40 45Trp
Leu Ala His Ile Trp Trp Asp Asp Asp Lys Tyr Tyr Asn Pro Ser 50 55
60Leu Lys Ser Arg Phe Thr Ile Ser Lys Asp Thr Ser Lys Asn Thr Leu
65 70 75 80Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val
Tyr Tyr 85 90 95Cys Ala Arg Arg Thr Thr Thr Ala Asp Tyr Phe Ala Tyr
Trp Gly Gln 100 105 110Gly Thr Thr Val Thr Val Ser Ser 115
12034120PRTArtificial SequenceDescription of Artificial Sequence
Synthetic humanized hu12A11 heavy chain v.6.4 34Gln Val Gln Leu Val
Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg 1 5 10 15Ser Leu Arg
Leu Ser Cys Ala Phe Ser Gly Phe Ser Leu Ser Thr Ser 20 25 30Gly Met
Ser Val Gly Trp Ile Arg Gln Ala Pro Gly Lys Gly Leu Glu 35 40 45Trp
Val Ala His Ile Trp Trp Asp Asp Asp Lys Tyr Tyr Asn Pro Ser 50 55
60Leu Lys Ser Arg Phe Thr Ile Ser Lys Asp Thr Ser Lys Asn Thr Leu
65 70 75 80Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val
Tyr Tyr 85 90 95Cys Ala Arg Arg Thr Thr Thr Ala Asp Tyr Phe Ala Tyr
Trp Gly Gln 100 105 110Gly Thr Thr Val Thr Val Ser Ser 115
12035120PRTArtificial SequenceDescription of Artificial Sequence
Synthetic humanized hu12A11 heavy chain v.7 35Gln Val Gln Leu Val
Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg 1 5 10 15Ser Leu Arg
Leu Ser Cys Ala Phe Ser Gly Phe Thr Leu Ser Thr Ser 20 25 30Gly Met
Ser Val Gly Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu 35 40 45Trp
Leu Ala His Ile Trp Trp Asp Asp Asp Lys Tyr Tyr Asn Pro Ser 50 55
60Leu Lys Ser Arg Leu Thr Ile Ser Lys Asp Thr Ser Lys Asn Thr Val
65 70 75 80Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val
Tyr Tyr 85 90 95Cys Ala Arg Arg Thr Thr Thr Ala Asp Tyr Phe Ala Tyr
Trp Gly Gln 100 105 110Gly Thr Thr Val Thr Val Ser Ser 115
12036120PRTArtificial SequenceDescription of Artificial Sequence
Synthetic humanized hu12A11 heavy chain v.8 36Gln Val Gln Leu Val
Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg 1 5 10 15Ser Leu Arg
Leu Ser Cys Ala Phe Ser Gly Phe Ser Leu Ser Thr Ser 20 25 30Gly Met
Ser Val Gly Trp Ile Arg Gln Ala Pro Gly Lys Gly Leu Glu 35 40 45Trp
Leu Ala His Ile Trp Trp Asp Asp Asp Lys Tyr Tyr Asn Pro Ser 50 55
60Leu Lys Ser Arg Leu Thr Ile Ser Lys Asp Asn Ser Lys Asn Thr Val
65 70 75 80Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val
Tyr Tyr 85 90 95Cys Ala Arg Arg Thr Thr Thr Ala Asp Tyr Phe Ala Tyr
Trp Gly Gln 100 105 110Gly Thr Thr Val Thr Val Ser Ser 115
12037138PRTArtificial SequenceDescription of Artificial Sequence
Synthetic humanized 3D6 v2 heavy chain variable region 37Met Asn
Phe Gly Leu Ser Leu Ile Phe Leu Val Leu Val Leu Lys Gly 1 5 10
15Val Gln Cys Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln
20 25 30Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr
Phe 35 40 45Ser Asn Tyr Gly Met Ser Trp Val Arg Gln Ala Pro Gly Lys
Gly Leu 50 55 60Glu Trp Val Ala Ser Ile Arg Ser Gly Gly Gly Arg Thr
Tyr Tyr Ser 65 70 75 80Asp Asn Val Lys Gly Arg Phe Thr Ile Ser Arg
Asp Asn Ser Lys Asn 85 90 95Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg
Ala Glu Asp Thr Ala Val 100 105 110Tyr Tyr Cys Val Arg Tyr Asp His
Tyr Ser Gly Ser Ser Asp Tyr Trp 115 120 125Gly Gln Gly Thr Leu Val
Thr Val Ser Ser 130 13538112PRTMus musculus 38Asp Val Val Met Thr
Gln Thr Pro Leu Ser Leu Pro Val Ser Leu Gly 1 5 10 15Asp Gln Ala
Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Ile Tyr Ser 20 25 30Asp Gly
Asn Ala Tyr Leu His Trp Phe Leu Gln Lys Pro Gly Gln Ser 35 40 45Pro
Lys Leu Leu Ile Tyr Lys Val Ser Asn Arg Phe Ser Gly Val Pro 50 55
60Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile
65 70 75 80Ser Arg Val Glu Thr Glu Asp Leu Gly Val Tyr Phe Cys Ser
Gln Ser 85 90 95Thr His Val Pro Trp Thr Phe Gly Gly Gly Thr Lys Leu
Glu Ile Lys 100 105 11039113PRTHomo sapiens 39Asp Val Val Met Thr
Gln Ser Pro Leu Ser Leu Pro Val Thr Leu Gly 1 5 10 15Gln Pro Ala
Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Ile Tyr Ser 20 25 30Asp Gly
Asn Ala Tyr Leu His Trp Phe Leu Gln Lys Pro Gly Gln Ser 35 40 45Pro
Arg Leu Leu Ile Tyr Lys Val Ser Asn Arg Phe Ser Gly Val Pro 50 55
60Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile
65 70 75 80Ser Arg Val Glu Ala Gln Asp Val Gly Val Tyr Tyr Cys Ser
Gln Ser 85 90 95Thr His Val Pro Trp Thr Phe Gly Gln Gly Thr Lys Val
Gln Ile Lys 100 105 110Arg40112PRTHomo sapiens 40Asp Val Val Met
Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly 1 5 10 15Glu Pro
Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Ile Val His Ser 20 25 30Asn
Gly Asn Thr Tyr Leu Glu Trp Tyr Leu Gln Lys Pro Gly Gln Ser 35 40
45Pro Gln Leu Leu Ile Tyr Lys Val Ser Asn Arg Phe Ser Gly Val Pro
50 55 60Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys
Ile 65 70 75 80Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys
Phe Gln Ser 85 90 95Ser His Val Pro Leu Thr Phe Gly Gln Gly Thr Lys
Leu Glu Ile Lys 100 105 1104196PRTArtificial SequenceDescription of
Artificial Sequence Synthetic mu12A11v1 VL region 41Asp Gln Ala Ser
Ile Ser Cys Arg Ser Ser Gln Ser Ile Val His Ser 1 5 10 15Asn Gly
Asn Thr Tyr Leu Glu Trp Tyr Leu Gln Lys Pro Gly Gln Ser 20 25 30Pro
Lys Leu Leu Ile Tyr Lys Val Ser Asn Arg Phe Ser Gly Val Pro 35 40
45Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile
50 55 60Ser Arg Val Glu Ala Glu Asp Leu Gly Ile Tyr Tyr Cys Phe Gln
Ser 65 70 75 80Ser His Val Pro Leu Thr Phe Gly Ala Gly Thr Lys Leu
Glu Leu Lys 85 90 9542112PRTArtificial SequenceDescription of
Artificial Sequence Synthetic humanized hu3D6 VL version 2 42Asp
Val Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly 1 5 10
15Glu Pro Ala Ser Ile Ser Cys Lys Ser Ser Gln Ser Leu Leu Asp Ser
20 25 30Asp Gly Lys Thr Tyr Leu Asn Trp Leu Leu Gln Lys Pro Gly Gln
Ser 35 40 45Pro Gln Arg Leu Ile Tyr Leu Val Ser Lys Leu Asp Ser Gly
Val Pro 50 55 60Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr
Leu Lys Ile 65 70 75 80Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr
Tyr Cys Trp Gln Gly 85 90 95Thr His Phe Pro Arg Thr Phe Gly Gln Gly
Thr Lys Val Glu Ile Lys 100 105 11043112PRTMus musculus 43Asp Val
Leu Met Thr Gln Thr Pro Leu Ser Leu Pro Val Ser Leu Gly 1 5 10
15Asp Gln Ala Ser Ile Ser Cys Arg Ser Ser Gln Asn Ile Val His Ser
20 25 30Asn Gly Asn Thr Tyr Leu Glu Trp Tyr Leu Gln Lys Pro Gly Gln
Ser 35 40 45Pro Lys Leu Leu Ile Tyr Lys Val Ser Asn Arg Phe Ser Gly
Val Pro 50 55 60Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr
Leu Lys Ile 65 70 75 80Ser Arg Val Glu Ala Glu Asp Leu Gly Val Tyr
Tyr Cys Phe Gln Gly 85 90 95Ser His Val Pro Leu Thr Phe Gly Ala Gly
Thr Lys Leu Glu Leu Lys 100 105 11044112PRTArtificial
SequenceDescription of Artificial Sequence Synthetic humanized
hum12B4 VL v.1 44Asp Val Val Met Thr Gln Ser Pro Leu Ser Leu Pro
Val Thr Pro Gly 1 5 10 15Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser
Gln Asn Ile Val His Ser 20
25 30Asn Gly Asn Thr Tyr Leu Glu Trp Tyr Leu Gln Lys Pro Gly Gln
Ser 35 40 45Pro Gln Leu Leu Ile Tyr Lys Val Ser Asn Arg Phe Ser Gly
Val Pro 50 55 60Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr
Leu Lys Ile 65 70 75 80Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr
Tyr Cys Phe Gln Gly 85 90 95Ser His Val Pro Leu Thr Phe Gly Gln Gly
Thr Lys Leu Glu Ile Lys 100 105 11045114PRTHomo sapiens 45Asp Ile
Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly 1 5 10
15Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Arg
20 25 30Tyr Gly Tyr Asn Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln
Ser 35 40 45Pro Gln Leu Leu Ile Tyr Leu Gly Ser Asn Arg Ala Ser Gly
Val Pro 50 55 60Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr
Leu Lys Ile 65 70 75 80Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr
Tyr Cys Met Gln Ala 85 90 95Leu Gln Thr Pro Tyr Thr Phe Gly Gln Gly
Thr Lys Leu Glu Ile Lys 100 105 110Arg Thr46100PRTHomo sapiens
46Asp Ile Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly 1
5 10 15Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His
Ser 20 25 30Asn Gly Tyr Asn Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly
Gln Ser 35 40 45Pro Gln Leu Leu Ile Tyr Leu Gly Ser Asn Arg Ala Ser
Gly Val Pro 50 55 60Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe
Thr Leu Lys Ile 65 70 75 80Ser Arg Val Glu Ala Glu Asp Val Gly Val
Tyr Tyr Cys Met Gln Ala 85 90 95Leu Gln Thr Pro 10047123PRTMus
musculus 47Gln Val Thr Leu Lys Glu Ser Gly Pro Gly Ile Leu Gln Pro
Ser Gln 1 5 10 15Thr Leu Ser Leu Thr Cys Ser Phe Ser Gly Phe Ser
Leu Ser Thr Asn 20 25 30Gly Met Gly Val Ser Trp Ile Arg Gln Pro Ser
Gly Lys Gly Leu Glu 35 40 45Trp Leu Ala His Ile Tyr Trp Asp Glu Asp
Lys Arg Tyr Asn Pro Ser 50 55 60Leu Lys Ser Arg Leu Thr Ile Ser Lys
Asp Thr Ser Asn Asn Gln Val 65 70 75 80Phe Leu Lys Ile Thr Asn Val
Asp Thr Ala Asp Thr Ala Thr Tyr Tyr 85 90 95Cys Ala Arg Arg Arg Ile
Ile Tyr Asp Val Glu Asp Tyr Phe Asp Tyr 100 105 110Trp Gly Gln Gly
Thr Thr Leu Thr Val Ser Ser 115 12048123PRTArtificial
SequenceDescription of Artificial Sequence Synthetic humanized
hum12B4 VH v.1 48Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val
Lys Pro Ser Glu 1 5 10 15Thr Leu Ser Leu Thr Cys Thr Phe Ser Gly
Phe Ser Leu Ser Thr Asn 20 25 30Gly Met Gly Val Ser Trp Ile Arg Gln
Pro Pro Gly Lys Gly Leu Glu 35 40 45Trp Leu Ala His Ile Tyr Trp Asp
Glu Asp Lys Arg Tyr Asn Pro Ser 50 55 60Leu Lys Ser Arg Leu Thr Ile
Ser Lys Asp Thr Ser Lys Asn Gln Val 65 70 75 80Ser Leu Lys Leu Ser
Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr 85 90 95Cys Ala Arg Arg
Arg Ile Ile Tyr Asp Val Glu Asp Tyr Phe Asp Tyr 100 105 110Trp Gly
Gln Gly Thr Thr Val Thr Val Ser Ser 115 12049123PRTHomo sapiens
49Gln Leu Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Glu 1
5 10 15Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Gly Ser Ile Ser Arg
Gly 20 25 30Ser His Tyr Trp Gly Trp Ile Arg Gln Pro Pro Gly Lys Gly
Leu Glu 35 40 45Trp Ile Gly Ser Ile Tyr Tyr Ser Gly Asn Thr Tyr Phe
Asn Pro Ser 50 55 60Leu Lys Ser Arg Val Thr Ile Ser Val Asp Thr Ser
Lys Asn Gln Phe 65 70 75 80Ser Leu Lys Leu Ser Ser Val Thr Ala Ala
Asp Thr Ala Val Tyr Tyr 85 90 95Cys Ala Arg Leu Gly Pro Asp Asp Tyr
Thr Leu Asp Gly Met Asp Val 100 105 110Trp Gly Gln Gly Thr Thr Val
Thr Val Ser Ser 115 1205099PRTHomo sapiens 50Gln Leu Gln Leu Gln
Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Glu 1 5 10 15Thr Leu Ser
Leu Thr Cys Thr Val Ser Gly Gly Ser Ile Ser Ser Ser 20 25 30Ser Tyr
Tyr Trp Gly Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu Glu 35 40 45Trp
Ile Gly Ser Ile Tyr Tyr Ser Gly Ser Thr Tyr Tyr Asn Pro Ser 50 55
60Leu Lys Ser Arg Val Thr Ile Ser Val Asp Thr Ser Lys Asn Gln Phe
65 70 75 80Ser Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val
Tyr Tyr 85 90 95Cys Ala Arg5199PRTHomo sapiens 51Gln Val Gln Leu
Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Glu 1 5 10 15Thr Leu
Ser Leu Thr Cys Thr Val Ser Gly Gly Ser Val Ser Ser Gly 20 25 30Gly
Tyr Tyr Trp Ser Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu Glu 35 40
45Trp Ile Gly Tyr Ile Tyr Tyr Ser Gly Ser Thr Asn Tyr Asn Pro Ser
50 55 60Leu Lys Ser Arg Val Thr Ile Ser Val Asp Thr Ser Lys Asn Gln
Phe 65 70 75 80Ser Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala
Val Tyr Tyr 85 90 95Cys Ala Arg52414DNAArtificial
SequenceDescription of Artificial Sequence Synthetic humanized 3D6
v2 heavy chain variable region 52atggagtttg ggctgagctg gctttttctt
gtggctattt taaaaggtgt ccagtgtgag 60gtgcagctgc tggagtccgg cggcggcctg
gtgcagcccg gcggctccct gcgcctgtcc 120tgcgccgcct ccggcttcac
cttctccaac tacggcatgt cctgggtgcg ccaggccccc 180ggcaagggcc
tggagtgggt ggcctccatc cgctccggcg gcggccgcac ctactactcc
240gacaacgtga agggccgctt caccatctcc cgcgacaact ccaagaacac
cctgtacctg 300cagatgaact ccctgcgcgc cgaggacacc gccgtgtact
actgcgtgcg ctacgaccac 360tactccggct cctccgacta ctggggccag
ggcaccctgg tgaccgtgtc ctcc 41453417DNAArtificial
SequenceDescription of Artificial Sequence Synthetic humanized
12A11 v3.1 VH sequence 53atggagtttg ggctgagctg ggttttcctc
gttgctcttc tgagaggtgt ccagtgtcaa 60gttcagctgg tggagtctgg cggcggggtg
gtgcagcccg gacggtccct caggctgtct 120tgtgctttct ctgggttcac
actgagcact tctggtatga gtgtgggctg gattcgtcag 180gctccaggga
agggtctgga gtggctggca cacatttggt gggatgatga taagtactat
240aacccatccc tgaagagccg attcacaatc tccagggaca actccaaaaa
cacgctgtac 300ctccagatga acagtctgcg ggctgaagat actgccgtgt
actactgtgc tcgaagaact 360actaccgctg actactttgc ctactggggc
caaggcacca ctgtcacagt ctcctca 417542133DNAArtificial
SequenceDescription of Artificial Sequence Synthetic humanized
hu3D6 v.2 HC delta4 54atggagtttg ggctgagctg gctttttctt gtggctattt
taaaaggtgt ccagtgtgag 60gtgcagctgc tggagtccgg cggcggcctg gtgcagcccg
gcggctccct gcgcctgtcc 120tgcgccgcct ccggcttcac cttctccaac
tacggcatgt cctgggtgcg ccaggccccc 180ggcaagggcc tggagtgggt
ggcctccatc cgctccggcg gcggccgcac ctactactcc 240gacaacgtga
agggccgctt caccatctcc cgcgacaact ccaagaacac cctgtacctg
300cagatgaact ccctgcgcgc cgaggacacc gccgtgtact actgcgtgcg
ctacgaccac 360tactccggct cctccgacta ctggggccag ggcaccctgg
tgaccgtgtc ctccggtgag 420tcctgtcgac tctagagctt tctggggcag
gccaggcctg actttggctg ggggcaggga 480gggggctaag gtgacgcagg
tggcgccagc caggcgcaca cccaatgccc atgagcccag 540acctggacgc
tgaacctcgc ggacagttaa gaacccaggg gcctctgcgc cctgggccca
600gctctgtccc acaccgcggt cacatggcac cacctctctt gcagcctcca
ccaagggccc 660atcggtcttc ccctggcacc ctcctccaag agcacctctg
ggggcacagc ggccctgggc 720tgcctggtca aggactactt ccccgaaccg
gtgacggtgt cgtggaactc aggcgccctg 780accagcggcg tgcacacttc
ccggctgtcc tacagtcctc aggactctac tccctcagca 840gcgtggtgac
cgtgccctcc agcagcttgg gcacccagac ctacatctgc aacgtgaatc
900acaagcccag caacaccaag gtgacaagaa agttggtgag aggccagcac
agggagggag 960ggtgtctgct ggaagccagg ctcagcgctc ctgcctggac
gcatcccggc tatgcagtcc 1020cagtccaggg cagcaaggca ggccccgtct
cctcttcacc cggaggcctc tgcccgcccc 1080actcatgctc agggagaggg
tcttctggct ttttccccag gctctgggca ggcacaggct 1140aggtgcccct
aacccaggcc ctgcacacaa aggggcagtg ctgggctcag acctgccaag
1200agccatatcc gggaggaccc tgcccctgac ctaagcccac cccaaaggcc
aaactctcca 1260ctccctcagc tcggacacct tctctcctcc cagattccag
taaccccaat cttctctctg 1320cagagcccaa atcttgtgac aaaactcaca
catgcccacc gtgcccaggt aagccagccc 1380aggcctcgcc ctccagctca
aggcgggaca ggtgccctag agtagcctgc accagggaca 1440ggccccagcc
gggtgctgac acgtccacct ccatctcttc ctcagcacct gaactcctgg
1500ggggaccgtc agtcttcctc ttccccccaa aacccaagga caccctcatg
atctcccgac 1560ccctgaggtc acatgcgtgg tggtggacgt gagccacgaa
gaccctgagg tcaagttcaa 1620ctggtacgtg gacggcgtgg aggtgcataa
tgccaagaca aagccgcggg aggagcagta 1680caacacacgt accgtgtggt
cagcgtcctc accgtcctgc accaggactg gctgaatggc 1740aaggagtaca
agtgcaaggt ctccaacaaa gccctcccag cccccatcga gaaaaccatc
1800tccaaagcca aagggcagcc ccgagaacca caggtgtaca cccgccccca
tcccgggagg 1860agatgaccaa gaaccaggtc agcctgacct gcctggtcaa
aggcttctat cccagcgaca 1920tcgccgtgga gtgggagagc aatgggcagc
cggagaacaa ctacaagacc cgcctcccgt 1980gctggactcc gacggctcct
tcttcctcta tagcaagctc accgtggaca agagcaggtg 2040gcagcagggg
aacgtcttct catgctccgt gatgcatgag gctctgcaca accactaacg
2100cagaagagcc tctccctgtc cccgggtaaa tga 21335540PRTArtificial
SequenceDescription of Artificial Sequence Synthetic peptide linker
55Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser 1
5 10 15Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser
Gly 20 25 30Gly Gly Gly Ser Gly Gly Gly Gly 35 40
* * * * *