U.S. patent application number 11/658361 was filed with the patent office on 2009-11-19 for binding molecules.
This patent application is currently assigned to Erasmus University Medical Centre Rotterdam Depart ment of Cell Biology and Genetics. Invention is credited to Roger Kingdon Craig, Dubravka Drabek, Franklin Gerardus Grosveld, Richard Wilhelm Janssens.
Application Number | 20090285805 11/658361 |
Document ID | / |
Family ID | 35431831 |
Filed Date | 2009-11-19 |
United States Patent
Application |
20090285805 |
Kind Code |
A1 |
Grosveld; Franklin Gerardus ;
et al. |
November 19, 2009 |
Binding molecules
Abstract
The present invention relates to the manufacture of a diverse
repertoire of functional heavy chain-only antibodies that undergo
affinity maturation, and uses thereof. The invention also relates
to the manufacture and use of a diverse repertoire of
class-specific heavy chain-only antibodies and to the manufacture
and use of multivalent polypeptide complexes with antibody heavy
chain functionality, preferably antibody heavy chain binding
functionality, constant region effector activity and, optionally,
additional effector functions. The present invention also relates
to a method of generation of fully functional heavy chain-only
antibodies in transgenic mice in response to antigen challenge. In
particular, the present invention relates to a method for the
generation of human antigen-specific, high affinity, heavy
chain-only antibodies of any class, or mixture of classes and the
isolation and expression of fully functional VH antigen-binding
domains.
Inventors: |
Grosveld; Franklin Gerardus;
(Rotterdam, NL) ; Janssens; Richard Wilhelm;
(Rotterdam, NL) ; Drabek; Dubravka; (Rotterdam,
NL) ; Craig; Roger Kingdon; (Cheshire, GB) |
Correspondence
Address: |
COZEN O'CONNOR, P.C.
1900 MARKET STREET
PHILADELPHIA
PA
19103-3508
US
|
Assignee: |
Erasmus University Medical Centre
Rotterdam Depart ment of Cell Biology and Genetics
DR Rotterdam
NL
|
Family ID: |
35431831 |
Appl. No.: |
11/658361 |
Filed: |
July 22, 2005 |
PCT Filed: |
July 22, 2005 |
PCT NO: |
PCT/GB2005/002892 |
371 Date: |
October 10, 2008 |
Current U.S.
Class: |
424/133.1 ;
424/184.1; 435/252.3; 435/254.2; 435/320.1; 435/325; 435/69.1;
530/387.1; 536/23.1; 800/14 |
Current CPC
Class: |
A61P 37/02 20180101;
A61P 25/28 20180101; C07K 2317/31 20130101; A61P 1/00 20180101;
A61P 15/00 20180101; A61P 35/00 20180101; C07K 16/1054 20130101;
A61P 7/02 20180101; A61P 9/10 20180101; C07K 2317/22 20130101; A61P
13/12 20180101; A61P 25/00 20180101; C07K 16/1063 20130101; C07K
2319/00 20130101; A61P 19/02 20180101; A61P 37/00 20180101; A61P
37/04 20180101; A61P 9/12 20180101; A61P 37/06 20180101; A61P 33/00
20180101; A61P 17/06 20180101; A61P 31/12 20180101; C07K 16/241
20130101; C07K 2317/64 20130101; A61P 3/04 20180101; A61P 31/18
20180101; A61P 11/06 20180101; C07K 16/1232 20130101; A61P 3/10
20180101; A61P 31/04 20180101; A61P 35/02 20180101; C07K 2317/569
20130101; C07K 16/00 20130101; C07K 2317/53 20130101; A61P 19/10
20180101; A61P 9/00 20180101 |
Class at
Publication: |
424/133.1 ;
424/184.1; 435/69.1; 435/325; 435/252.3; 435/254.2; 435/320.1;
530/387.1; 536/23.1; 800/14 |
International
Class: |
A61K 39/395 20060101
A61K039/395; A61K 39/00 20060101 A61K039/00; C12P 21/00 20060101
C12P021/00; C12N 5/10 20060101 C12N005/10; C12N 1/21 20060101
C12N001/21; C12N 1/19 20060101 C12N001/19; C12N 15/63 20060101
C12N015/63; C07K 16/00 20060101 C07K016/00; C07H 21/00 20060101
C07H021/00; A01K 67/027 20060101 A01K067/027 |
Foreign Application Data
Date |
Code |
Application Number |
Jul 22, 2004 |
GB |
0416392.9 |
Jun 10, 2005 |
GB |
0511881.5 |
Claims
1. A method for the production of a V.sub.H heavy chain-only
antibody in a non-human transgenic mammal comprising the step of
expressing a heterologous V.sub.H heavy chain locus in that mammal,
wherein the V.sub.H heavy chain locus comprises one or more V gene
segments selected or engineered to show improved solubility
characteristics and a heavy chain constant region which does not
encode a C.sub.H1 domain and which locus, when expressed, is
capable of forming heavy chain-only antibodies of defined class or
classes.
2-4. (canceled)
5. The method of claim 1 where each V gene segment is derived from
a human.
6-10. (canceled)
11. The method of claim 1 wherein the heavy chain constant region
comprises one or more of the following heavy chain constant
regions: C.alpha., C.epsilon., C.delta., C.gamma. C.mu., and
isotypes thereof.
12-17. (canceled)
18. The method of claim 12 wherein the D and J gene segments are
derived from a human.
19-23. (canceled)
24. The method of claim 1 wherein the heavy chain constant region
gene of the heterologous heavy chain locus is of human origin.
25-26. (canceled)
27. A heavy chain-only antibody, or a fragment thereof produced
according to the method of claim 1.
28-31. (canceled)
32. A vector comprising a heterologous heavy chain locus as in
claim 1.
33. A host cell transformed with a vector according to claim
32.
34. A non-human transgenic mammal expressing a heterologous heavy
chain locus as in claim 1.
35-37. (canceled)
38. A pharmaceutical composition comprising the heavy chain-only
antibody or fragment thereof according to claim 27 and a
pharmacologically appropriate carrier.
39. The method of claim 1, further comprising the steps of: (a)
injecting an antigen into the transgenic mammal; b) isolating a
cell or tissue expressing an antigen-specific, heavy chain-only
antibody of interest; c) producing a hybridoma from the cell or
tissue of step (b); d) optionally cloning the heavy chain-only
antibody mRNA from said hybridoma for subsequent production in a
heterologous expression system such as a mammalian, plant, insect,
microbial, fungal or alternative system.
40. A method of production and selection of a V.sub.H binding
domain comprising the steps of: (a) injecting an antigen into the
transgenic mammal of claim 34; b) isolating a cell or tissue
expressing an antigen-specific heavy chain-only antibody of
interest; c) cloning the V.sub.H locus from mRNA derived from the
isolated cell or tissue; d) displaying the encoded protein using a
phage or similar library; e) identifying antigen-specific V.sub.H
domain(s); and f) expressing the V.sub.H domain(s) alone or as a
fusion protein in bacterial, yeast or alternative expression
systems.
41. A binding polypeptide complex comprising a dimer of a first
heavy chain and a second heavy chain wherein: each heavy chain
comprises a binding domain, an effector moiety and a dimerisation
domain; the binding domain in the first heavy chain may be of the
same specificity as, or of a different specificity from, the
specificity of the binding domain in the second heavy chain; the
effector moiety in the first heavy chain may have the same or
different function from the effector moiety on the second heavy
chain.
42. The binding polypeptide complex of claim 41, wherein the
effector moiety on each heavy chain is a second binding domain,
which may be of the same specificity as, or of a different
specificity from, the binding domain of the heavy chain of which it
is a part, and may be of the same specificity as, or a different
specificity from, either one or both of the binding domains on the
other heavy chain.
43. The binding polypeptide complex of claim 41 wherein the or each
dimerisation domain comprises at least C.sub.H2, C.sub.H3 and,
optionally, C.sub.H4 antibody constant domains derived from the any
class of immunoglobulin heavy chain gene.
44. The polypeptide complex of claim 41, further comprising a pair
of effector (light) chains, wherein: one of the effector (light)
chains is associated with one of the heavy chains and the other of
the effector (light) chains is associated with the other of the
heavy chains; the effector (light) chain comprises a complementary
assembly domain having attached to it an effector moiety; and the
effector domain of the heavy chain and the complementary assembly
domain of the effector (light) chain associate with one another
through non-covalent interactions.
45. The binding polypeptide complex of claim 44 wherein the
dimerisation domain comprises at least C.sub.H2, C.sub.H3 and,
optionally, C.sub.H4 antibody constant regions derived from any
class of immunoglobulin heavy chain gene.
46. The polypeptide complex of claim 44, wherein at least one
effector moiety of the effector (light) chain is an enzyme, toxin,
binding domain, serum stabilising agent, cell or an imaging
agent.
47. The polypeptide complex of claim 41 or 44, wherein at least one
effector moiety of the heavy chain is an enzyme, toxin, binding
domain, a serum stabilising agent or an imaging agent.
48-51. (canceled)
52. A binding polypeptide complex comprising a plurality of heavy
chain dimers and a J chain, wherein: the plurality of heavy chain
dimers are assembled by the J chain; each heavy chain comprises a
soluble binding domain and identical .mu. C.sub.H2, C.sub.H3 and
C.sub.H4 domains; and there are at least two soluble binding
domains having different specificities in the binding polypeptide
complex.
53. The binding polypeptide complex of claim 52, wherein there are
only two binding domains of different specificity.
54. The binding polypeptide complex of claim 41, 44, or 52, wherein
each heavy chain further includes a hinge domain, or a flexible
hinge-like domain, at the carboxyl terminus of the C.sub.H3 domain
or, if present, the C.sub.H4 domain.
55. The polypeptide complex of claim 41, 44, or 52, wherein one or
more of the binding domains is a V.sub.HH domain.
56. The polypeptide complex of claim 41, 44, or 52, wherein one or
more of the binding domains is a V.sub.H domain from any organism
selected or engineered to show improved solubility
characteristics.
57. The polypeptide complex of claim 41, 44, or 52 wherein one or
more of the binding domains is a mammalian cell adhesion
polypeptide complex, a prokaryotic cell adhesion polypeptide
complex or a viral cell adhesion polypeptide complex.
58. The polypeptide complex of, claim 41, 44, or 52 wherein one or
more of the binding domains is a cytokine, a growth factor, a
receptor antagonist or agonist or a ligand.
59. An isolated polynucleotide encoding one of the chains of a
polypeptide complex according to claim 41, 44, or 52.
60. A cloning or expression vector comprising an isolated
polynucleotide of claim 59.
61-62. (canceled)
63. A host cell transformed with at least one expression vector of
claim 60.
64. A method for the production of a polypeptide complex,
comprising culturing the host cell of claim 63 and isolating the
polypeptide complex.
65. A method of producing a polypeptide complex of claim 41, 44, or
52, which comprises: transforming a host cell with a first
polynucleotide encoding a first heavy chain and a second
polynucleotide encoding a second heavy chain; growing the host cell
under conditions which allow for the expression of the coding
sequences of the two polynucleotides; and harvesting the
polypeptide complex from the host cell.
66. The method of claim 65 further comprising transforming the host
cell with a polynucleotide encoding a light chain.
67-68. (canceled)
69. A pharmaceutical composition comprising a polypeptide binding
complex according to claim 41, 44, or 52.
70-71. (canceled)
72. A method of treating a patient, comprising administering a
composition comprising the polypeptide binding complex of claim 41,
44, or 52.
73. (canceled)
74. The polypeptide complex of claim 41, 44, or 52, comprising a
flexible linker at the carboxyl terminus of the C.sub.H3 domain or,
if present, the C.sub.H4 domain.
75. The polypeptide complex of claim 54, wherein the cysteines in
the hinge are replaced with prolines.
Description
FIELD OF THE INVENTION
[0001] The present invention relates to the manufacture of a
diverse repertoire of functional heavy chain-only antibodies that
undergo affinity maturation, and uses thereof. The invention also
relates to the manufacture and use of a diverse repertoire of
class-specific heavy chain-only antibodies and to the manufacture
and use of multivalent polypeptide complexes with antibody heavy
chain functionality, preferably antibody heavy chain binding
functionality, constant region effector activity and, optionally,
additional effector functions.
[0002] The present invention also relates to a method of generation
of fully functional heavy chain-only antibodies in transgenic mice
in response to antigen challenge. In particular, the present
invention relates to a method for the generation of human
antigen-specific, high affinity, heavy chain-only antibodies of any
class, or mixture of classes and the isolation and expression of
fully functional VH antigen-binding domains.
[0003] The present invention also relates to the generation of
multivalent polypeptide complexes comprising heavy chain
functionality, preferably heavy chain effector activity and other
binding and effector functions.
[0004] Heavy chain-only antibodies and other multivalent binding
complexes generated using the methods of the present invention and
uses thereof are also described.
BACKGROUND TO THE INVENTION
[0005] Monoclonal antibodies or variants thereof will represent a
high proportion of new medicines launched in the 21.sup.st century.
Monoclonal antibody therapy is already accepted as a preferred
route for the treatment for rheumatoid arthritis and Crohn's
disease and there is impressive progress in the treatment of
cancer. Antibody-based products are also in development for the
treatment of cardiovascular and infectious diseases. Most marketed
monoclonal antibody products recognise and bind a single,
well-defined epitope on the target ligand (eg TNF.alpha.).
Manufacture of human monoclonal antibodies for therapy remains
dependent on mammalian cell culture. The assembly of a complex
consisting of two heavy chains and two light chains (the
H.sub.2L.sub.2 complex) and subsequent post-translational
glycosylation processes preclude the use of bacterial systems.
Production costs and capital costs for antibody manufacture by
mammalian cell culture are high and threaten to limit the potential
of antibody based therapies in the absence of acceptable
alternatives. A variety of transgenic organisms are capable of
expressing fully functional antibodies. These include plants,
insects, chickens, goats and cattle but none as yet has been used
to manufacture marketed therapeutic products.
[0006] Functional antibody fragments can be manufactured in E. coli
but the product generally has low serum stability unless pegylated
during the manufacturing process.
[0007] Bispecific antibody complexes are engineered Ig-based
molecules capable of binding two different epitopes on the either
the same or different antigens. Bispecific binding proteins
incorporating antibodies alone or in combination with other binding
agents show promise for treatment modalities where captured human
immune functions elicit a therapeutic effect, for example the
elimination of pathogens (Van Spriel et al., (1999) J. Infect.
Diseases, 179, 661-669; Tacken et al., (2004) J. Immunol., 172,
4934-4940; U.S. Pat. No. 5,487,890), the treatment of cancer
(Glennie and van der Winkel, (2003) Drug Discovery Today, 8,
503-5100); and immunotherapy (Van Spriel et al., (2000) Immunol.
Today, 21, 391-397; Segal et al., (2001) J. Immunol. Methods, 248,
1-6; Lyden et al., (2001) Nat. Med., 7, 1194-1201).
[0008] Manufacturing issues are compounded where a bi-specific
antibody product is based on two or more H.sub.2L.sub.2 complexes.
For example, co-expression of two or more sets of heavy and light
chain genes can result in the formation of up to 10 different
combinations, only one of which is the desired heterodimer (Suresh
et al., (1986) Methods Enzymol., 121, 210-228).
[0009] To address this issue, a number of strategies have been
developed for the production in mammalian cells of full length
bispecific IgG formats (BsIgG) which retain heavy chain effector
function. BsIgGs require engineered "knob and hole" heavy chains to
prevent heterodimer formation and utilise identical L-chains to
avoid L-chain mispairing (Carter, (2001) J. Immunol. Methods, 248,
7-15). Alternative chemical cross-linking strategies have also been
described for the production of complexes from antibody fragments
each recognising different antigens (Ferguson et al., (1995)
Arthritis and Rheumatism, 38, 190-200) or the cross-linking of
other binding proteins, for example collecting, to antibody
fragments (Tacken et al., (2004) J. Immunol., 172, 4934-4940).
[0010] The development of diabodies or mini antibodies (BsAb)
generally lacking heavy chain effector functions also overcomes
heterodimer redundancy. These comprise minimal single chain
antibodies incorporating VH and VL binding sites (scFv) which
subsequently fold and dimerise to form a divalent bispecific
antibody monovalent to each of their target antigens (Holliger et
al., (1993) PNAS, 90, 6444-6448; Muller et al., (1998) FEBS Lett.,
422, 259-264). In one instance, CH1 and L-constant domains have
been used as heterodimerisation domains for bi-specific
mini-antibody formation (Muller et al., (1998) FEBS Lett.,
259-264). A variety of recombinant methods based on E. coli
expression systems have been developed for the production of BsAbs
(Hudson, (1999) Curr. Opin. Immunol., 11, 548-557), though it would
appear that the cost and scale of production of clinical grade
multivalent antibody material remains the primary impediment to
clinical development (Segal et al., (2001) J. Immunol. Methods,
248, 1-6).
[0011] Recently, the BsAb concept has been extended to encompass
Di-diabodies, tetravalent bispecific antibodies where the V.sub.H
and V.sub.L domains on each H and L chain have been replaced by
engineered pairs of scFv binding domains. Such constructs, whilst
complex to engineer, can be assembled in mammalian cells in culture
in the absence of hetero-dimer redundancy (Lu et al., (2003) J.
Immunol. Methods, 279, 219-232).
[0012] The structure of immunoglobulins is well known in the art.
Most natural immunoglobulins comprise two heavy chains and two
light chains. The heavy chains are joined to each other via
disulphide bonds between hinge domains located approximately half
way along each heavy chain. A light chain is associated with each
heavy chain on the N-terminal side of the hinge domain. Each light
chain is normally bound to its respective heavy chain by a
disulphide bond close to the hinge domain.
[0013] When an Ig molecule is correctly folded, each chain folds
into a number of distinct globular domains joined by a more linear
polypeptide sequence. For example, the light chain folds into a
variable (V.sub.L) and a constant (C.sub.L) domain. Heavy chains
have a single variable domain V.sub.H, adjacent the variable domain
of the light chain, a first constant domain, a hinge domain and two
or three further constant domains. Interaction of the heavy
(V.sub.H) and light (V.sub.L) chain variable domains results in the
formation of an antigen binding region (Fv). Generally, both
V.sub.H and V.sub.L are required for antigen binding, although
heavy chain dimers and amino-terminal fragments have been shown to
retain activity in the absence of light chain (Jaton et al., (1968)
Biochemistry, 7, 4185-4195).
[0014] With the advent of new molecular biology techniques, the
presence of heavy chain-only antibody (devoid of light chain) was
identified in B-cell proliferative disorders in man (Heavy Chain
Disease) and in murine model systems. Analysis of heavy chain
disease at the molecular level showed that mutations and deletions
at the level of the genome could result in inappropriate expression
of the heavy chain C.sub.H1 domain, giving rise to the expression
of heavy chain-only antibody lacking the ability to bind light
chain (see Hendershot et al., (1987) J. Cell Biol., 104, 761-767;
Brandt et al., (1984) Mol. Cell. Biol., 4, 1270-1277).
[0015] Separate studies on isolated human V.sub.H domains derived
from phage libraries demonstrated antigen-specific binding of
V.sub.H domains but these V.sub.H domains proved to be of low
solubility. Furthermore, it was suggested that the selection of
human V.sub.H domains with specific binding characteristics
displayed on phage arrays could form the building blocks for
engineered antibodies (Ward et al., (1989) Nature, 341,
544-546).
[0016] Studies using other vertebrate species have shown that
camelids, as a result of natural gene mutations, produce functional
IgG2 and IgG3 heavy chain-only dimers which are unable to bind
light chain due to the absence of the C.sub.H1 light chain-binding
region (Hamers-Casterman et al., (1993) Nature, 363, 446-448) and
that species such as shark produce a heavy chain-only-like binding
protein family, probably related to the mammalian T-cell receptor
or immunoglobulin light chain (Stanfield et al., (2004) Science,
305, 1770-1773).
[0017] A characterising feature of the camelid heavy chain-only
antibody is the camelid V.sub.H domain, which provides improved
solubility relative to the human V.sub.H domain. Human V.sub.H may
be engineered for improved solubility characteristics (see Davies
and Riechmann, (1996) Protein Eng., 9 (6), 531-537; Lutz and
Muyldermans, (1999) J. Immuno. Methods, 231, 25-38) or solubility
maybe be acquired by natural selection in vivo (see Tanha et al.,
(2001) J. Biol. Chem., 276, 24774-24780). However, where V.sub.H
binding domains have been derived from phage libraries, intrinsic
affinities for antigen remain in the low micromolar to high
nanomolar range, in spite of the application of affinity
improvement strategies involving, for example, affinity hot spot
randomisation (Yau et al., (2005) J. Immunol. Methods, 297,
213-224).
[0018] Camelid V.sub.H antibodies are also characterised by a
modified CDR3 loop. This CDR3 loop is, on average, longer than
those found in non-camelid antibodies and is a feature considered
to be a major influence on overall antigen affinity and
specificity, which compensates for the absence of a V.sub.L domain
in the camelid heavy chain-only antibody species (Desmyter et al.,
(1996) Nat. Struct. Biol., 3, 803-811, Riechmann and Muyldermans,
(1999) J. Immunol. Methods, 23, 25-28).
[0019] Recent structural studies on camelid antibody suggests that
antibody diversity is largely driven by in vivo maturation
processes with dependency on V(D)J recombination events and somatic
mutation, (De Genst et al., (2005) J. Biol. Chem., 280 (14),
14114-14121).
[0020] Recently, methods for the production of heavy-chain-only
antibodies in transgenic mammals have been developed (see
WO02/085945 and WO02/085944). Functional heavy chain-only antibody
of potentially any class (IgM, IgG, IgD, IgA or IgE) and derived
from any mammal (including man) can be produced from transgenic
mammals (preferably mice) as a result of antigen challenge.
[0021] The normal immunoglobulin heavy chain locus comprises a
plurality of V gene segments, a number of D gene segments and a
number of J gene segments. Each V gene segment encodes from the N
terminal almost to the C terminal of a V domain. The C terminal end
of each V domain is encoded by a D gene segment and a J gene
segment. VDJ rearrangement in B-cells followed by affinity
maturation provides V.sub.H binding domains which then, with
V.sub.L binding domains, form an antigen recognition or binding
site. Interaction of the heavy and light chains is facilitated by
the C.sub.H1 region of the heavy chain and the .kappa. or .lamda.
region of the light chain.
[0022] For the production of heavy chain-only antibody, the heavy
chain locus in the germline comprises gene segments encoding some
or all of the possible constant regions. During maturation, a
re-arranged V.sub.H binding domain is spliced onto the C.sub.H2
constant region-encoding segment, to provide a re-arranged gene
encoding a heavy chain which lacks a C.sub.H1 domain and is
therefore unable to associate with an immunoglobulin light
chain.
[0023] Heavy chain-only monoclonal antibodies can be recovered from
B-cells of the spleen by standard cloning technology or recovered
from B-cell mRNA by phage display technology (Ward et al., (1989)
Nature, 341, 544-546). Heavy chain-only antibodies derived from
camelids or transgenic animals are of high affinity. Sequence
analysis of normal H.sub.2L.sub.2 tetramers demonstrates that
diversity results primarily from a combination of VDJ rearrangement
and somatic hypermutation (Xu and Davies, (2000) Immunity, 13,
37-45). Sequence analysis of expressed heavy chain-only mRNA,
whether produced in camelids or transgenic animals, supports this
observation (De Genst et al., (2005) J. Biol. Chem., 280,
14114-14121).
[0024] An important and common feature of natural camelid and human
V.sub.H regions is that each region binds as a monomer with no
dependency on dimerisation with a V.sub.L region for optimal
solubility and binding affinity. These features have previously
been recognised as particularly suited to the production of
blocking agents and tissue penetration agents.
[0025] Homo- or hetero-dimers can also be generated by enzymatic
cleavage of heavy chain-only antibodies or by synthetic routes
(Jaton et al., (1968) Biochemistry, 7, 41854195 and US2003/0058074
A1). However the benefits of a monomeric antibody binding domain
have yet to be used to advantage in design of multimeric proteins
as reagents, therapeutics and diagnostics.
[0026] Human V.sub.H or camelid V.sub.HH produced by phage display
technology lacks the advantage of improved characteristics as a
result of somatic mutations and the additional diversity provided
by D and J region recombination in the CDR3 region of the normal
antibody binding site (Xu and Davies, (2000) Immunity, 13, 37-45).
Camelid V.sub.HH, whilst showing benefits in solubility relative to
human V.sub.H, is antigenic in man and must be generated by
immunisation of camelids or by phage display technology.
[0027] The incorporation of V.sub.H binding domains has clear
advantage over the use of scFvs which must be engineered from
V.sub.H and V.sub.L domains with the associated potential of loss
of specificity and avidity. V.sub.H binding domains derived from
related gene families such as T-cell receptors or the shark
immunogloblin family also provide alternatives to scFv for the
generation of bi- or multi-specific binding molecules. Other
naturally occurring binding proteins and domains thereof including,
for example, soluble receptor fragments may also be used.
[0028] Antibody classes differ in their physiological function. For
example, IgG plays a dominant role in a mature immune response. IgM
is involved in complement fixing and agglutination. IgA is the
major class of Ig in secretions--tears, saliva, colostrum,
mucus--and thus plays a role in local immunity. The inclusion of
class-specific heavy chain constant regions when engineering
multivalent binding complexes provides the therapeutic benefits of
effector function in vivo dependent on the functionality required.
Engineering of individual effector regions can also result in the
addition or deletion of functionality (Van Dijk and van der Winkel,
Curr. Opin. Chem. Biol., (2001) August 5 (4), 368-374). It seems
likely that the optimal production and selection of heavy
chain-only antibodies comprising high affinity V.sub.H binding
domains (whether of human or camelid or other origin) will benefit
from alternative approaches to those dependent on selection from
randomised phage libraries which do not facilitate in vivo
recombination and affinity maturation.
[0029] Thus, the inclusion of IgA constant region functionality
would provide improved mucosal function against pathogens (Leher et
al., (1999) Exp. Eye. Res., 69, 75-84), whilst the presence of IgG1
constant region functionality provides enhanced serum stability in
vivo. The presence of heavy chain C.sub.H2 and C.sub.H3 constant
domains provides the basis for stable dimerisation as seen in
natural antibodies, and provides recognition sites for
post-translational glycosylation. The presence of C.sub.H2 and
C.sub.H3 also allows for secondary antibody recognition when
bispecific and multivalent complexes are used as reagents and
diagnostics.
[0030] Isolated, pre-rearranged camelid heavy chain-only variable
region sequences have previously been cloned in front of a hinge
region and human IgG1 effector domain, inserted into vectors and
expressed in COS cells to generate antibody. The antibodies
expressed in this in vitro environment have already undergone the
processes of class (isotype) switching and affinity maturation
(hypermutation) in vivo in the camel and can bind to antigen
(Riechmann and Muyldermans, (1999) J. Immunol. Methods, 231,
25-38).
[0031] There remains a need in the art to maximise heavy chain-only
antibody diversity and B-cell response in vivo and, in particular,
to generate a functional repertoire of class specific human heavy
chain-only antibodies and functional V.sub.H heavy chain-only
binding domains which retain maximum antigen-binding potential for
use in diverse clinical, industrial and research applications.
[0032] There also remains a need in the art to produce a soluble,
bi-valent or multi-valent polypeptide binding complex comprising at
least part of an antibody heavy chain, alone or in combination with
an effector (light) chain, which is physiologically stable and has
effector function.
BRIEF SUMMARY OF THE INVENTION
[0033] The present invention provides a method for the production
of a VH heavy chain-only or a camelid V.sub.H (V.sub.HH) heavy
chain-only antibody in a transgenic mammal comprising the step of
expressing a heterologous V.sub.H or camelid V.sub.H (V.sub.HH)
heavy chain locus in that mammal, wherein the V.sub.H or camelid
V.sub.H (V.sub.HH) heavy chain locus comprises a heavy chain
constant region which does not encode a C.sub.H1 domain and which
locus, when expressed, is capable of forming heavy chain-only
antibodies of defined class or classes.
[0034] The V.sub.H or camelid V.sub.H (V.sub.HH) heavy chain locus
may comprise one or more camelid or non-camelid V gene segments.
Preferably, the V gene segment has been selected or engineered to
show improved solubility characteristics. Preferably the V gene
segment is derived from a human.
[0035] The heavy chain constant region of the heavy chain locus may
comprise a C.alpha..sub.1 and/or a C.alpha..sub.2, a C.epsilon., a
C.delta., a C.gamma. and/or a C.mu. heavy chain constant region
gene. Furthermore, the heavy chain constant region of the heavy
chain locus may comprise more than one of the following heavy chain
constant regions: C.alpha..sub.1, C.alpha..sub.2, C.epsilon.,
C.delta., C.gamma. C.mu..
[0036] Preferably, the V.sub.H heavy chain locus comprises a
variable region comprising at least one human or camelid V gene
segment, at least one D segment and at least one J segment wherein
a human or camelid V gene segment, a D gene segment and a J gene
segment are capable of recombining to form a VDJ coding sequence.
The heavy chain locus preferably comprises twenty or more D gene
segments and/or five or more J gene segments. Preferably, D and J
segments are of vertebrate origin, preferably human. The CDR3 loop
may be derived using D and J gene segments derived from any
vertebrate and are preferably human D and J gene segments.
[0037] The V.sub.H heavy chain locus may also comprise a
recombination sequence (rss) capable of recombining a J gene
segment directly with a heavy chain constant region gene.
[0038] The heavy chain constant region of the heterologous heavy
chain locus is of human origin or vertebrate origin e.g. of camelid
origin. Alternatively the constant region may not be of
immunoglobulin heavy chain origin.
[0039] Preferably, the methods of the invention result in
essentially normal B-cell maturation. The present invention also
provides a heavy chain-only antibody, or a fragment thereof, or a
mixture of classes of heavy chain-only antibodies obtained or
obtainable according to a method of the invention. This heavy
chain-only antibody may be a monoclonal antibody, or fragment
thereof, such as a human or camelid V.sub.H binding domain. The
V.sub.H binding domain of the invention may lack an extended
camelid-like CDR3 loop or, alternatively, may comprise an extended
camelid-like CDR3 loop.
[0040] The present invention also provides a vector comprising a
heterologous heavy chain locus of the invention and a host cell
transformed with such a vector.
[0041] The invention also provides a transgenic mammal expressing a
heterologous heavy chain locus described herein. Preferably, the
transgenic mammal of the invention has a reduced capacity to
produce antibodies that include light chains.
[0042] Also provided is the use of a heavy chain-only antibody, or
fragment thereof, according to the invention, in the preparation of
a medicament for immunotherapy. The heavy chain-only antibodies of
the invention may also be used as diagnostics, reagents, abzymes or
inhibitory agents. Also provided is a pharmaceutical composition
comprising the heavy chain-only antibody or fragment thereof
according to the invention, and a pharmacologically appropriate
carrier.
[0043] The invention also provides a method of production and
selection of heavy chain-only antibodies comprising the steps of:
[0044] (a) injecting an antigen into the transgenic mammal as
described herein; [0045] b) isolating a cell or tissue expressing
an antigen-specific, heavy chain-only antibody of interest; and
[0046] c) producing a hybridoma from the cell or tissue of step (b)
and [0047] d) optionally cloning the heavy chain-only antibody mRNA
from said hybridoma for subsequent production in a heterologous
expression system such as a mammalian, plant, insect, microbial,
fungal or alternative system.
[0048] V.sub.H binding domains may then be produced by identifying
and isolating an antigen-specific V.sub.H domain from the cloned
mRNA of step c).
[0049] V.sub.H binding domains of the invention may also be
produced by: [0050] (a) injecting an antigen into the transgenic
mammal described herein; [0051] b) isolating a cell or tissue
expressing an antigen-specific, heavy chain-only antibody of
interest; [0052] c) cloning the V.sub.H locus from mRNA derived
from the isolated cell or tissue; [0053] d) displaying the encoded
protein using a phage or similar library; [0054] e) identifying
antigen-specific V.sub.H domain(s); and [0055] f) expressing the
V.sub.H domain(s) alone or as a fusion protein in bacterial, yeast
or alternative expression systems.
DETAILED DESCRIPTION OF THE INVENTION
[0056] The present inventors have overcome the limitations of the
prior art and shown that transgenic animals, in particular mice,
can be generated using "micro loci" to produce class-specific,
heavy chain-only antibodies, or a mixture of different classes of
heavy chain-only antibodies which are secreted by plasma or B
cells. These can then be used either to generate a reliable supply
of class-specific, heavy chain-only antibody using established
hybridoma technology or as a source of functional camelid V.sub.H
(V.sub.HH) binding domains or V.sub.H heavy chain-only binding
domains, preferably a soluble V.sub.H heavy chain-only binding
domains of human origin, which are free of effector functions but
which retain binding function.
[0057] Heavy chain-only antibodies (including camelid antibodies)
that can be generated by the methods of the invention show high
binding affinity, resulting from V, D and J gene segment
rearrangements and somatic mutations, generally in the absence of
an enlarged CDR3 loop. Essentially normal B-cell maturation is
observed with high levels of heavy chain-only antibody present in
isolated plasma (provided that the C.sub.H1 domain has been
eliminated from all antibody classes present in the recombinant
locus). B-cell maturation and the secretion of assembled dimers (eg
IgG) or multimers (eg IgM) has no dependency on the presence or
expression of light chain genes.
[0058] Nucleotide sequence analysis of antigen-specific mRNA
encoding an antigen-specific heavy chain isolated from hybridomas
derived from transgenic mice has demonstrated that heavy chain
antibody diversity is primarily a function of VDJ recombination.
Furthermore, the present inventors have shown that antibody
diversity is generated in the CDR3 region of the functional
antigen-binding domain of the heavy chain-only antibody with a more
limited contribution from somatic mutations in the V.sub.H domains.
Using the methods described herein, functional V.sub.H domains can
be cloned and expressed in bacterial systems to generate V.sub.H
binding domains with full retention of antigen binding, specificity
and affinity. In addition, class-specific heavy chain dimers and
multimers can be secreted by hybridoma cell lines in culture.
[0059] The invention also teaches that transgenic mice can be
programmed to produce preferred classes of heavy chain-only
antibody in response to antigen challenge, eg only IgG as opposed
to only IgM or, for example, mixtures of IgA, IgG and IgM.
[0060] The inventors have previously described (see WO02/085945 and
WO02/085944) the generation of transgenic mice expressing a minimal
human IgG heavy chain constant region locus devoid of the C.sub.H1
exon and linked by human D and J segments with two llama VHH genes.
These produce functional, high affinity, antigen-specific IgG heavy
chain-only antibody when challenged with antigen. Mixtures of heavy
chain-only antibody classes (IgM and IgG) can be obtained by class
switching in vivo through utilisation of gene constructs
incorporating heavy chain constant regions in tandem (provided that
all constant region genes lack a C.sub.H1 domain and, when present,
a C.sub.H4 domain).
[0061] The improvements described herein show that a mouse
constructed with the same IgG constant region locus linked by human
D and J segments with two llama V.sub.HH genes and a human IgM
constant region locus devoid of a C.sub.H1 exon linked by the same
human D and J gene segments with two llama V.sub.HH genes, also
produces high molecular weight (multimeric) IgM heavy chain-only
antibody and IgG (dimer) heavy chain-only antibody. Surprisingly,
essentially normal B-cell maturation and antibody production is
dependent on the complete absence of C.sub.H1 sequences from each
heavy chain constant region present in the transgenic locus.
Moreover, there is no requirement for the removal of the C.sub.H4
exon if present.
[0062] Thus, for example, a transgenic animal carrying a human IgM
heavy chain locus with a functional C.sub.H1 exon linked by the
same human D and J gene segments to two llama V gene segments, and
IgG constant heavy chain region locus devoid of the C.sub.H1 exon
linked by the same human D and J gene segments to two llama V gene
segments, produces very low levels of heavy chain-only antibody and
shows no evidence for B-cell maturation.
[0063] Other effector domains, including the C.sub.H4 domain, may
be incorporated or not, as desired, to introduce to, or eliminate
from, the resultant heavy chain-only antibody, effector
features.
[0064] The inventors have found that productive expression of
antibody (ie B-cell maturation) can result from the use of any V
gene segment present in the construct. Isolation and sequencing of
antibody mRNA derived from B-cells shows that D and J gene segment
recombination occurs to generate CDR3 diversity. Sequence
comparison of resultant V.sub.H domains reveals somatic mutations,
indicating that affinity maturation events have occurred in the
recombined D and J gene segments and also in the V.sub.H domain of
the resultant expressed antibody mRNA.
[0065] Preferred constructs incorporate V gene segments selected or
engineered for improved solubility and linked to a D and J chain
cluster for recombination and CDR3 generation. Preferably, the VDJ
sequences are linked to constant effector domain(s) of choice in
tandem, each devoid of a C.sub.H1 exon.
[0066] The invention is not limited to the derivation and
production of human or camelid class-specific, heavy chain-only
antibody or human V.sub.H binding domains (preferably soluble
V.sub.H binding domains) (alone or linked to the effector domain of
choice), but encompasses the production of chaemeric combinations
of any V gene segment of vertebrate origin (optionally engineered
to improve solubility characteristics) linked to D and J gene
segments. Preferably, the V gene segments are of human origin and
are not V gene segments derived from a camelid. The resultant
V.sub.H domains may not comprise an enlarged camelid-like CDR3 loop
unless the D and J segments have been derived from a camelid. This
results in a V.sub.H domain exhibiting CDR3 diversity and affinity
maturation operationally linked to an effector constant region. The
latter ensures functional secretion and optionally assembly in the
parent transgenic vertebrate of choice and also provides subsequent
selectable effector function should this be required.
[0067] These observations have important implications for the
improved and simplified engineering of class-specific, heavy
chain-only antibodies and the derivation of high affinity, soluble
V.sub.H domains which incorporate affinity maturation via somatic
mutation. Incorporation of select heavy chain constant region
effector functions (devoid of C.sub.H1) or mixtures thereof permits
the production of any class of heavy chain-only antibodies or any
mixture of heavy chain-only antibodies without the requirement of
additional antibody engineering. V.sub.H domains can be expressed
alone in bacterial or other micro-organism systems or as functional
heavy chain-only antibody incorporating effector domains secreted
by hybridomas or transfected cells in culture. Antibodies and
V.sub.H binding domains of human origin have wide ranging
applications in the field of healthcare as medicines, diagnostics
and reagents, with parallel agricultural, environmental and
industrial applications.
[0068] Thus, in a first aspect, the present invention provides a
method for the production of a V.sub.H heavy chain-only antibody in
a transgenic mammal comprising the step of expressing a
heterologous V.sub.H heavy chain locus in that mammal. Preferably,
the V.sub.H heavy chain locus comprises a heavy chain constant
region which does not encode a CH1 domain and which locus is
capable of forming a diverse repertoire of complete heavy
chain-only antibodies when expressed.
[0069] The first aspect of the present invention also provides a
method for the production of a camelid V.sub.H heavy chain-only
antibody in a transgenic mammal comprising the step of expressing a
camelid V.sub.H heavy chain locus in that mammal, wherein the
V.sub.H heavy chain locus comprises a heavy chain constant region
which does not encode a C.sub.H1 domain and which locus, when
expressed, is capable of forming a diverse repertoire of complete
heavy chain-only antibodies incorporating VDJ rearrangement and
affinity maturation in response to antigen challenge.
[0070] Heavy chain effector molecules may be engineered to be free
of functional domains, for example the carboxy-terminal C.sub.H4
domains, provided that engineering does not affect secretory
mechanisms preventing cell surface assembly and consequently B-cell
maturation. The C.sub.H1 exons alone are deleted from the
heterologous locus or are absent from the locus. Additional
features maybe engineered into the locus, for example to improve
glycosylation, or add function.
[0071] Preferably, the heterologous locus, when expressed, is
capable of forming functional IgA, IgE, IgG, IgD or IgM molecules
or isotypes thereof. Individual antibody classes or mixtures of
antibody classes or isotypes thereof may also be produced.
[0072] Accordingly, the heterologous heavy chain locus is designed
to produce preferred classes or mixtures of heavy chain-only
antibody depending on the antibody class(es) required, with
essentially normal B-cell maturation. The utilisation of camelid V,
D and J gene segments and camelid effector regions will produce
camelid antibodies with features peculiar to camelids, such as
enlarged CDR3 loops. The use of human V, D and J gene segments
comprising V gene segments randomly selected, or selected or
engineered for enhanced solubility, will produce functional human
heavy chain-only antibodies.
[0073] Antibodies obtained according to the invention have the
advantage over those of the prior art in that they are of
substantially any single or known class and preferably of human
origin. Antibodies are of high affinity resulting from a
combination of VDJ recombination and affinity maturation in vivo.
Antibodies and fragments thereof may be may be isolated,
characterised and manufactured using well-established methods known
to those skilled in the art.
The Heterologous Heavy Chain Locus
[0074] In the context of the present invention, the term
`heterologous` means a nucleotide sequence or a locus as herein
described which is not endogenous to the mammal in which it is
located.
[0075] A "V.sub.H heavy chain locus" in the context of the present
invention relates to a minimal micro-locus encoding a V.sub.H
domain comprising one or more V gene segments, one or more D gene
segments and one or more J gene segments, operationally linked to
one or more heavy chain effector regions (each devoid of a C.sub.H1
domain). Preferably, the primary source of antibody repertoire
variability is the CDR3 region formed by the selection of D and J
gene segments by the V-D and D-J junctions.
[0076] The advantage of the present invention is that antibody
repertoire and diversity obtained in the rearranged V.sub.H gene
sequences can be maximised through the use of multiple D and J gene
segments. Subsequent somatic mutation is achieved whilst using a
minimal locus (micro-locus) without the need for a large number of
V gene segments or the V.sub.L and L.sub.C (light chain)
immunoglobulin loci.
[0077] Preferably, the V.sub.H heavy chain locus comprises from two
to five V (2, 3, 4 or 5) gene segments derived from any vertebrate
species.
[0078] Preferably, the V gene segments are of human origin,
optionally selected or engineered for improved solubility.
[0079] Preferably, the V.sub.H heavy chain locus comprises from two
to forty (2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, 20, 30 or 40)
or more D gene segments. The D gene segments may be derived from
any vertebrate species but, most preferably, the D gene segments
are human D gene segments (normally 25 functional D gene
segments).
[0080] Preferably, the V.sub.H heavy chain locus comprises from two
to twenty (2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18 or 20) or
more J gene segments. The J gene segments may be derived from any
vertebrate species but, most preferably, the J gene segments are
human J gene segments (normally 6 J gene segments).
[0081] Preferably, the V.sub.H heavy chain locus comprises two or
more V gene segments, twenty-five functional human D gene segments
and 6 human J gene segments.
[0082] The term `V gene segment` encompasses a naturally occurring
V gene segment derived from a vertebrate, including camelids and
human, which have optionally been selected, mutated, or engineered
for improved characteristics, such as solubility. V gene segments
are also found in other species such as shark (see Kokubu et al.,
(1988) EMBO. J, 7, 3413-3422) or have evolved to provide diverse
V.sub.H-like families of binding proteins exemplified, for example,
in the evolution of the immunoglobulin light chain V.sub.L
repertoire or the T-cell receptor V.sub.H repertoire.
[0083] Preferred methods of improving solubility of a V.sub.H
domain incorporate rational, as opposed to only random, means and
are exemplified in Davies and Reichmann, (1996) Protein Eng., 9
(6), 531-537 and Riechmann and Muyldermans, (1999) J. Immunol.
Methods, 231, 25-38. Natural selection can also occur in vivo
through affinity maturation and the incorporation of favourable
mutations in the V.sub.H gene following VDJ re-arrangement.
[0084] The V gene segment must be capable of recombining with a D
gene segment, a J gene segment and a heavy chain constant
(effector) region (which may comprise several exons but excludes a
C.sub.H1 exon) according to the present invention to generate a
V.sub.H heavy chain-only antibody when the nucleic acid is
expressed.
[0085] A V gene segment according to the present invention also
includes within its scope any gene sequence encoding a homologue,
derivative or protein fragment, which is capable of recombining
with a D gene segment, a J gene segment and a heavy chain constant
region (comprising one or more exons but not a C.sub.H1 exon)
according to the present invention to generate a heavy chain-only
antibody as defined herein.
[0086] Thus V.sub.H coding sequences may be derived from a
naturally occurring source or they may be synthesised using methods
familiar to those skilled in the art.
[0087] A "V.sub.H domain" in the context of the present invention
refers to an expression product of a V gene segment when recombined
with a D gene segment and a J gene segment as defined above.
Preferably, the V.sub.H domain as used herein remains in solution
and is active in a physiological medium without the need for any
other factor to maintain solubility. Preferably, the ability of the
soluble V.sub.H domain to bind antigen has been improved by VDJ
recombination and somatic mutation. There is no dependency on the
presence or absence of the enlarged CDR3 loop peculiar to the
camelid species. The V.sub.H domain is able to bind antigen as a
monomer and, when combined with effector constant regions, may be
produced in mono-specific, bi-specific, multi-specific, bi-valent
or multivalent forms, dependent on the choice and engineering of
the effector molecules used (eg IgG, IgA IgM etc.) or alternative
mechanisms of dimerisation and multimerisation. Any likelihood of
binding with a V.sub.L domain when expressed as part of a soluble
heavy chain-only antibody complex has been eliminated by removal of
the C.sub.H1 exon (see Sitia et al., (1990) Cell, 60, 781-790). The
V.sub.H domain alone can also be engineered with diverse protein
domains to produce fusion proteins for targeted therapeutic and
diagnostic purpose, for example with toxins, enzymes and imaging
agents.
[0088] In the context of the present invention the terms `a D gene
segment` and `a J gene segment` includes naturally occurring
sequences of D and J gene segments. Preferably, the D and J gene
segments are derived from the same vertebrate from which the V gene
segment is derived. For example, if a V gene segment is derived
from a human and then solubilised or engineered, the D and J gene
segments are preferably also derived from a human. Alternatively
the V gene segments maybe derived, for example, from camel and the
D and J gene segments from human or vice versa.
[0089] The terms D gene segment and J gene segment also include
within their scope derivatives, homologues and fragments thereof as
long as the resultant segment can recombine with the remaining
components of a heavy chain antibody locus as herein described to
generate a heavy chain-only antibody as herein described. D and J
gene segments may be derived from naturally occurring sources or
they may be synthesised using methods familiar to those skilled in
the art and described herein. The V, D and J gene segments are
capable of recombination and preferably undergo somatic
mutation.
[0090] The V, D and J gene segments are preferably derived from a
single vertebrate species. This may be any vertebrate species but
is preferably a human.
[0091] In addition, a heterologous heavy chain locus according to
the present invention comprises a region of DNA encoding a heavy
chain constant region providing effector functions in vivo (eg IgG,
IgM, IgA, IgE, IgD or isotypes thereof).
[0092] The invention also provides an antigen-specific, heavy
chain-only antibody obtained or obtainable by the methods of the
present invention.
The Heavy Chain Constant Region
[0093] Operationally, a heavy chain constant region is encoded by a
naturally occurring or engineered gene segment that is capable of
recombining with a V gene segment, a D gene segment and a J gene
segment in a B cell. Preferably the heavy chain constant region is
derived from an immunoglobulin locus.
[0094] According to this aspect of the invention, each heavy chain
constant region essentially comprises at least one heavy chain
constant region gene, which is expressed without a functional
C.sub.H1 domain so that generation of heavy chain-only antibody can
occur. Each heavy chain constant region may also comprise one or
more additional heavy chain constant region exons, which are
selected from the group consisting of C.delta., C.gamma..sub.1-4,
C.mu., C.epsilon. and C.alpha..sub.1-2 with the proviso that the
additional heavy chain constant region genes also do not express a
functional C.sub.H1 domain. The heavy chain constant region gene
segments are selected depending on the preferred class or mixture
of antibody classes required. Optionally, the heterologous heavy
chain locus is C.mu.- and C.delta.-deficient.
[0095] For instance, Ig molecules of class M are known to play an
important role in the activation of macrophages and the complement
pathway. Due to the close proximity of its binding sites, IgM has a
high avidity for pathogens, including viruses. However, IgM is also
known to be difficult for use in rapid immunoassay techniques
whereas Ig of class G can be readily used in these techniques. For
such uses, it would be useful to select for the preferred antibody
class, ie IgG or IgM.
[0096] The expression of all or part of a heterologous heavy chain
C.gamma. locus devoid of C.sub.H1 will produce optionally some or
all IgG isotypes, dependent on the IgG1, IgG2, IgG3 and IgG4
isotypes present in the heterologous IgG locus. Alternatively the
heavy chains may comprise C.epsilon. genes. The resulting IgE
molecule might also be used in therapy.
[0097] Alternatively, selected mixtures of antibodies may be
obtained. For example, IgA and IgM may be obtained when the heavy
chain constant region comprises a C.alpha. and a C.mu. gene.
[0098] Preferably, the heavy chain constant region according to the
present invention is of human origin, in particular when the heavy
chain antibody is to be used for therapeutic applications in
humans. Where the heavy chain antibodies are to be used for
diagnostic or veterinary purposes, the heavy chain constant region
is preferably derived from the target organism, vertebrate or
mammal in or on which diagnosis or veterinary therapy is to be
performed.
[0099] When expressed, the heavy chain constant region lacks a
functional C.sub.H1 domain. The C.sub.H1 exon and, optionally,
C.mu. and C.delta. constant regions, may be mutated, deleted or
substituted. Preferably, the C.sub.H1 exon is deleted. The
presence, for example, of IgM with a functional C.sub.H1 domain
inhibits B-cell maturation and consequently limits the productive
expression of heavy chain only IgG (devoid of C.sub.H1) within the
same locus, as B-cell maturation is inhibited.
[0100] A `heavy chain constant region exon` (`C.sub.H exon`) as
herein defined includes the sequences of naturally occurring
vertebrate, but especially mammalian, C.sub.H exons. This varies in
a class specific manner. For example, IgG and IgA are naturally
devoid of a C.sub.H4 domain. The term `C.sub.H exon` also includes
within its scope derivatives, homologues and fragments thereof in
so far as the C.sub.H exon is able to form a functional heavy
chain-only antibody as herein defined when it is a component of a
heavy chain constant region.
[0101] Optionally, when present, the C.sub.H4 or other functional
domains maybe engineered or deleted within the transgene provided
such a process does not inhibit the intracellular secretory
process, B-cell maturation or the binding activity of the resultant
antibody polypeptide.
Mammals
[0102] The transgenic mammal used in the methods of the invention
is not a human. The transgenic mammal is preferably a rodent such
as a rabbit, guinea pig, rat or mouse. Mice are especially
preferred. Alternative mammals such as goats, sheep, cats, dogs or
other animals may also be employed.
[0103] Preferably transgenic animals are generated using
established oocyte injection technology and, where established, ES
cell technology or cloning.
[0104] Advantageously, immunoglobulin heavy and optionally light
chain loci endogenous to the mammal are deleted or silenced when a
heavy chain-only antibody is expressed according to the methods of
the invention.
[0105] This approach of generating heavy chain-only antibodies as
described above maybe of particular use in the generation of
antibodies for human therapeutic use as often the administration of
antibodies to a species of vertebrate which is of different origin
from the source of the antibodies results in the onset of an immune
response against those administered antibodies.
[0106] Therefore, in a further aspect, the present invention
provides a transgenic mammal expressing a heterologous heavy chain
locus according to the present invention.
[0107] The transgenic mammal may be engineered to have a reduced
capacity to produce antibodies that include light chains.
[0108] Antibody-producing cells may be derived from transgenic
animals according to the present invention and used, for example,
in the preparation of hybridomas for the production of heavy
chain-only antibodies as herein defined. In addition or
alternatively, nucleic acid sequences may be isolated from
transgenic mammals according to the present invention and used to
produce V.sub.H domain heavy chain-only chain antibodies or
bi-specific/bi-functional complexes thereof, using recombinant DNA
techniques which are familiar to those skilled in the art.
[0109] Alternatively or in addition, antigen-specific heavy
chain-only antibodies may be generated by immunisation of a
transgenic animal according to the present invention.
[0110] Thus in a further aspect, the present invention provides a
method for the production of heavy chain-only antibodies by
immunising a transgenic mammal according to the present invention
with an antigen.
[0111] In a preferred embodiment of this aspect of the invention,
the mammal is a mouse.
Heavy Chain-Only Antibodies and Fragments Thereof
[0112] In a further aspect, the present invention provides a heavy
chain-only antibody obtainable according to a method of the present
invention and functional fragments and derivatives thereof.
Fragments encompassing the VH binding domain can be derived by
enzymic cleavage or cyanogen bromide cleavage of a heavy chain-only
antibody of the invention ie devoid of light chains (Jaton et al.,
(1968) Biochemistry, 7, 41854195).
[0113] A preferred functional fragment is an antigen-specific,
heavy chain-only binding domain, ie a V.sub.H binding domain, as
expressed by the V.sub.H locus as a result of recombination between
single V, D and J gene segments followed subsequently by somatic
mutation. According to this aspect of the invention V.sub.H loci
can be cloned from, eg, mRNA isolated from an antibody-producing
cell of an immunised transgenic animal as described above. Cloned
sequences can then be displayed using a phage (Ward et al., (1989)
Nature, 341, 544-546) or similar display libraries, for example
using yeast-based systems (Boder and Wittrup, (1997) Nat.
Biotechnol., 15, 553-7) and antigen-specific V.sub.H binding
domains identified. Antigen-specific heavy chain binding domains
can then be manufactured either alone or as fusion proteins in
scalable bacterial, yeast or alternative expression systems.
Sequences encoding V.sub.H binding domains can also be cloned from
characterised hybridomas derived by classical procedures from
immunised transgenic mice. These can then be used for the
production of V.sub.H binding domains and derivatives thereof
including the engineering of defined antibody classes (eg IgE or
IgA) and variants thereof with differing effector functions.
[0114] Accordingly, the invention also provides a method of
producing a V.sub.H binding domain comprising the steps of: [0115]
a) isolating a cell or tissue expressing an antigen-specific heavy
chain-only antibody of interest (preferably a soluble,
antigen-specific heavy chain-only antibody of interest); [0116] b)
cloning the sequence encoding the V.sub.H binding domain from mRNA
derived from the isolated cell or tissue; [0117] c) displaying the
encoded protein using a phage or similar library; [0118] d)
identifying antigen-specific V.sub.H binding domains, and [0119] e)
expressing the V.sub.H binding domains alone or as a fusion protein
in bacterial, yeast, mammalian or alternative expression
systems.
[0120] Alternatively, V.sub.H domain-containing fragments can be
generated from heavy chain-only antibodies of the invention using
enzymic or chemical cleavage technology and subsequent separation
of the V.sub.H domain-containing fragment from the other cleavage
products.
[0121] Where the V.sub.H binding domain is isolated from a
characterised hybridoma, the cloned V.sub.H binding domain sequence
derived from mRNA can be directly cloned into an expression vector
without recourse to additional selection steps using phage and
other display systems.
[0122] Production systems for heavy chain only-antibody
incorporating effector regions include mammalian cells in culture
(eg CHO cells), plants (eg maize), transgenic goats, rabbits,
cattle, sheep, chickens and insect larvae suited to mass rearing
technology. Other production systems, including virus infection (eg
baculovirus in insect larvae and cell-lines) are alternatives to
cell culture and germline approaches. Other production methods will
also be familiar to those skilled in the art. Where there is a
requirement for heavy chain-only IgA or IgM assembly, the
co-expression of a "J chain" is beneficial. Suitable methods for
the production of camelid heavy chain-only antibody or V.sub.H
binding domains alone are known in the art. For example camelid
V.sub.H binding domains have been produced in bacterial systems and
camelid heavy chain-only homodimers have been produced in
hybridomas and transfected mammalian cells (see Reichmann and
Muyldermans, (1999) J. Immunol. Methods, 231, 25-38).
[0123] Methods are also well established for the expression of
engineered human V.sub.H binding domains derived using phage
display technology (Tanha et al., (2001) J. Biol. Chem., 276,
24774-24780 and references therein).
[0124] Insect larvae from transgenic fly lines have been shown to
produce functional heavy chain-only antibody fragments in
haemolymph with characteristics indistinguishable from the same
antibody produced by mammalian cells (PCT/GB2003/0003319). The
present invention also provides an antigen-specific monomeric or
dimeric V.sub.H binding domain obtainable according to the method
of this aspect of present invention.
[0125] The present invention also provides a polynucleotide
sequence consisting of the heterologous heavy chain locus, an
isolated polynucleotide encoding a heavy chain-only antibody of the
invention and a vector comprising a heterologous heavy chain locus,
or fragment thereof, or isolated polynucleotide encoding a heavy
chain-only antibody according to the present invention.
[0126] The present invention also provides a host cell transformed
with a heterologous heavy chain locus, or fragment thereof, or
isolated polynucleotide encoding the heavy chain-only antibody or
antibody fragment, according to the present invention.
[0127] In a second aspect, the present invention provides a
polypeptide complex comprising an antigen-specific V.sub.H binding
domain according to the present invention having attached to it an
effector moiety which provides effector activity. This effector
activity may be in addition to that provided by the heavy chain
constant region and may be situated at the amino or carboxy
terminus of the molecule. These polypeptide complexes retain the
physiological function conferred by the antigen-specific V.sub.H
binding domain in combination with additional targeting or effector
functions of the effector moieties. Such polypeptide complexes may
be in the form of functional monomers or, dependent on the design
and interaction of the effector moieties, dimers, tetramers,
pentamers, multimers or other complexes incorporating different
V.sub.H binding domains, so imparting multi-valency and
multi-specificity. V.sub.H binding domains may be present at the
amino or carboxy terminus of the binding molecule (see FIG. 1 for
dimeric example).
[0128] If the effector moiety comprises a binding domain, it may
have a different specificity from the antigen-specific V.sub.H
binding domain. The advantage of this arrangement is that the
polypeptide complex can facilitate cross-linking of different
targets. For example, a bispecific polypeptide complex may be
utilised to enhance cell-cell interactions and cell/pathogen
interactions. In this embodiment, the polypeptide complexes of the
invention can be utilised, for example, to bridge between two cell
types such as a pathogen and a macrophage (see Biburger et al.,
(2005) J. Mol. Biol., 346, 1299-1311). The use of V.sub.H binding
domains is preferable to the use of scFV binding domains in such
bi-specific designs. V.sub.H binding domains have high binding
affinity and can be incorporated into such polypeptide complexes
with minimal vector construction and in the absence of design
considerations necessary to maintain the specificity and affinity
of scFVs relative to their tetrameric parental molecule. Where
dimers or multimeric polypeptide complexes are envisaged
dimerisation domains are incorporated, for example the inclusion of
C.sub.H2 and C.sub.H3 domains derived from immunoglobulin heavy
chain constant regions (see FIG. 2).
[0129] The term `effector moiety` as used herein includes any
moiety that mediates a desired biological effect on a cell. The
effector moiety is preferably soluble and may be a peptide,
polypeptide or protein or may be a non-peptidic structure. For
example, the effector moiety may be an enzyme, hormone, cytokine,
drug, pro-drug, toxin, in particular a protein toxin, a
radionuclide in a chelating structure, a binding domain, a
dimerising or interaction domain, an imaging agent, albumin or an
inhibitory agent.
[0130] Albumin may be utilised as an effector moiety to increase
the stability or pharmacokinetic and/or pharmacodynamic properties
of the antigen-specific V.sub.H binding domain (Sung et al., (2003)
J Interferon Cytokine Res., 23 (1): 25-36). Alternatively, the
effector moiety may be a PEGylated structure or a naturally
glycosylated structure so as to improve pharmacodynamic
properties.
[0131] The effector moiety may be peptide bonded to the
antigen-specific V.sub.H binding domain or it may be chemically
bonded to the antigen-specific heavy V.sub.H domain, for example by
using a chemical linking structure such as a maleimide linker.
Alternatively, the polypeptide complexes of the invention may be
expressed as fusion proteins. As such, the present invention also
encompasses a polynucleotide sequence consisting of the
heterologous heavy chain locus, or an isolated polynucleotide
encoding the heavy chain-only antibody, of the present invention
wherein the polynucleotide further comprises, in reading frame, one
or more exon(s) encoding an effector moiety. This exon may be at
the 5' or 3' end of the polynucleotide. For example, the
polynucleotide may comprise, in the following order and in reading
frame, a V.sub.H and a binding domain\effector moiety gene segment.
In the case of genetic fusions, the attachment of the various
domains may be achieved using a recombinant DNA construct that
encodes the amino acid sequence of the fusion protein, with the DNA
encoding the various domains placed in the same reading frame. Such
constructs are of value as diagnostics and therapeutics. As
diagnostics, the effector domain can be a fluorescent protein (eg
GFP) or enzyme (eg .beta.-gal). Alternatively, the effector domain
can be a tag for enhanced binding to a substrate (eg polyhistidine
or a biotin), an antigen to provide a site of attachment for
secondary antibodies or a leucine zipper or similar binding motif
which may serve as a site for the attachment of fluorescent
markers.
Polypeptide Complexes
[0132] The present inventors have also realised that it is possible
to produce a bi-valent or multi-valent polypeptide complex
comprising at least part of an antibody heavy chain, alone or in
combination with a separate effector (light) chain comprising a
complementary assembly domain and having additional effector
activity. Polypeptide complexes according to the present invention
retain the physiological function conferred by the heavy chain
constant region in combination with additional effector moiety
functions associated with the effector chain (FIG. 3).
[0133] As such, in a third aspect, the polypeptide complex
comprises heavy chains in combination with one or more effector
chains (light chains). The second aspect of the present invention
provides a polypeptide complex comprising a pair of heavy chains
and a pair of effector chains, wherein: [0134] the pair of heavy
chains are associated With each other; [0135] one of the effector
chains is associated with one of the heavy chains and the other of
the effector chains is associated with the other of the heavy
chains; [0136] each heavy chain comprises a binding domain, a
dimerization domain, preferably comprising at least C.sub.H2,
C.sub.H3 and, optionally, C.sub.H4 constant region domains, and an
effector moiety capable of binding to a complementary assembly
domain of the effector chain; and [0137] the effector chain
comprises a complementary assembly domain having attached to it an
effector moiety, [0138] wherein the assembly domain and the
complementary assembly domain associate with one another through
non-covalent interactions.
[0139] Preferably, the effector moiety in the heavy chain is
different to the effector moiety in the effector chain.
[0140] Optionally, the polypeptide complex includes a flexible
hinge-like domain at the carboxyl terminus of the C.sub.H3 domain
(or C.sub.H4 domain, if present) linking it to the assembly domain.
Preferably, the polypeptide complex includes a natural hinge domain
or a flexible engineered hinge-like domain between the binding
domain and the C.sub.H2 domain. The presence of hinge regions
facilitates the independent function of binding domains and
effector moieties in the resultant polypeptide complexes.
[0141] The effector moiety in the first polypeptide heavy chain
optionally has a specificity different from the specificity of the
effector moiety in the second polypeptide heavy chain. According to
the present invention, the effector moiety of the polypeptide
complex may be replaced by a binding domain. Preferably, the
binding domain comprises a V.sub.H domain (as defined in the first
aspect of the invention) or a cell receptor binding domain. The
resulting tetravalent dimeric binding protein (polypeptide complex)
can comprise up to four different effector moieties. Preferably the
effector moieties at the amino terminal end of the heavy chain are
identical, and those at the carboxyl terminal end are identical
(but recognise a different antigen or epitope to that at the amino
terminal end), facilitating the assembly of a single homodimer.
Such a molecule may prove advantageous for the capture of
pathogens, effector functionality being provided by the inclusion
of appropriate heavy chain functional domains (eg IgA or IgM).
[0142] An exemplary polypeptide complex according to the third
aspect of the invention is useful for cytochemical labelling,
targeting methods or therapy. For example if the effector molecule
comprises an antigen-specific V.sub.H binding domain which targets
a cancer cell surface marker and the effector moiety comprises a
binding domain specific for a pro-drug converting enzyme (the
effector chain). The antigen-specific V.sub.H binding domain binds
to the target and brings the effector moiety into close proximity
with the target such that on binding the effector chain it can
exert a biological effect on the target in the presence of the
pro-drug (eg nitroreductase with CB1954). The inclusion of
immunoglobulin heavy chain effector function as the dimerisation
domain may also be beneficial in elimination of the target
cell.
The Effector Chain
[0143] The effector chain comprises a complementary binding domain
and an effector moiety, which associates with a heavy chain through
the heavy chain effector moiety to form the assembled polypeptide
binding complex. The effector chain complementary assembly domain
may be an integral component of the effector moiety or a protein or
alternative ligand fused or chemically linked to the effector
moiety. The heavy chains of the assembled polypeptide binding
complex bind to the target and bring the effector (light) chain
moiety into close proximity with the target such that it can exert
a biological effect of the target.
The Effector Moiety
[0144] The term `effector moiety` as used herein includes any
moiety that mediates a desired biological effect on a cell. The
effector domain may be a cell, for example a T-cell, a peptide,
polypeptide or protein or may be a non-peptidic structure. For
example, the effector domain may be an enzyme, drug, pro-drug,
toxin, in particular a protein toxin, a radionuclide in a chelating
structure or binding domain. The effector moiety associated with
the complementary assembly domain maybe cellular, proteinaceous,
organic or inorganic in nature, dependent on the desired
effect.
[0145] The term `binding domain` as used herein in respect of all
the above aspects of the present invention includes any polypeptide
domain that is active in a physiological medium. Such a binding
domain must also have the ability to bind to a target under
physiological conditions.
[0146] Such binding domains include domains that can mediate
binding or adhesion to a cell surface. Suitable domains which may
be used in the polypeptide complexes of the invention are
mammalian, prokaryotic and viral cell adhesion molecules,
cytokines, growth factors, receptor antagonists or agonists,
ligands, cell surface receptors, regulatory factors, structural
proteins and peptides, serum proteins, secreted proteins, plasma
lemma-associated proteins, viral antigens, bacterial antigens,
protozoal antigens, parasitic antigens, lipoproteins,
glycoproteins, hormones, neurotransmitters, clotting factors,
engineered single chain Fvs and the like. Preferably the binding
domain is a vertebrate V.sub.H domain, more preferably a mammalian
V.sub.H domain such as a human V.sub.H domain.
[0147] A binding domain may comprise a camelid V.sub.H (V.sub.HH)
domain or may comprise a V.sub.H domain obtained from a
non-camelid. Preferably, the binding domain is a human V.sub.H
domain. V.sub.H binding domains are preferably of B-cell origin
derived from transgenic animals or camelids (as described above) as
opposed to V.sub.H domains derived from synthetic phage libraries,
since the former will be of higher affinity due to their generation
in response to antigen challenge in vivo via VDJ rearrangement and
somatic mutation.
[0148] If the effector moiety comprises a binding domain, it
preferably has different specificity from the binding domain in the
heavy chain. The advantage of this arrangement is that polypeptide
complex can facilitate cross-linking of different targets or bind
different antigens on a target cell (eg pathogen).
[0149] The binding domain in the first heavy chain may have a
specificity different from that of the binding domain in the second
heavy chain. In this way, the polypeptide complex will be at least
bivalent and will be able to crosslink different targets and the
effector domain will be able to exert its effect on both targets. A
multivalent polypeptide complex can be created through the
association of these tetravalent heavy chains with effector chains
comprising effector domains with yet different specificity(ies) and
functionality. Also, the effector moiety in the first heavy chain
may have a different specificity from the effector moiety in the
second heavy chain, permitting the capture of more than one
effector chain, each carrying a different functionality.
The Complementary Assembly Domain Binds to an Effector Moiety
[0150] When a heavy chain associates with an effector chain, the
terms `effector moiety` and `complementary assembly domain` as used
herein include any moieties that can form at least a non-covalent
attachment to each other. For example, the effector moiety and the
complementary assembly domain may be a protein, peptide fragment or
consensus sequence capable of forming a protein-protein
interaction, such as that seen between: the C.sub.H1 domain of an
immunoglobulin heavy chain and the constant region of an
immunoglobulin light chain; leucine zippers; VCAM and VLA-4;
integrins and extracellular matrix proteins; integrins and cell
surface molecules such as CD54 or CD102; ALCAMs and SRCR domains;
an scFv and antigen or V.sub.H binding domain and antigen.
The Heavy Chains
[0151] Where the dimerization domains of the heavy chains comprise
immunoglobulin heavy chain constant regions, the constant regions
(C.sub.H exons) may give further physiological functionality to the
polypeptide binding complex. In particular, the immunoglobulin
heavy chain constant domains may provide for, inter alia,
complement fixation, macrophage activation and binding to Fc
receptors, depending on the class or subclass of the antibody
constant domains.
[0152] As discussed above, it is well documented that the class of
heavy chain expressed has a major role in effector function in
vivo. An established cell line may produce a polypeptide complex
having a useful targeting and biological effect but the heavy chain
constant region may be of a class which is diagnostically or
therapeutically undesirable, or it may not be secreted in useful
quantities. Accordingly, the heavy chain constant domains of the
polypeptide complexes of the invention may be specifically altered
or partially or completely omitted to introduce or remove
components of immunoglobulin heavy chains.
[0153] For instance, Ig molecules of class M are known to play an
important role in the activation of macrophages and the complement
pathway. Due to the close proximity of its binding sites, IgM has a
high avidity for pathogens, including viruses. However, IgM is also
known to be difficult for use in rapid immunoassay techniques
whereas Ig of class G can be readily used in these techniques. For
such uses, it would be useful to switch the class of the heavy
chain from .mu. to .gamma. domains.
[0154] The expression of the heavy chain C.gamma. locus alone will
produce IgG, including IgG1, IgG2, IgG3 and IgG4 isotypes, some of
which will also activate complement. IgG antibodies bind and
activate macrophages and granulocytes, and can cross the
placenta.
[0155] Additional applications of various antibody classes have
been discussed previously.
[0156] The constant regions of the heavy chains of the polypeptide
complexes of the present invention may be of human, rabbit, rat or
mouse origin as herein defined. Preferably, they are of human
origin.
[0157] The polypeptide complexes of the present invention can also
be used solely to block binding of ligands to their receptors by
using dimerisation domains which provide no effector functions.
Multiple receptors can be blocked by a multi-specific polypeptide
complex.
[0158] In a fourth aspect of the invention, the effector molecule
may comprise a dimerization domain such that the effector molecule
can associate with a separate effector molecule. This dimerization
domain may comprise one or more of C.sub.H2, C.sub.H3 or C.sub.H4
antibody constant region domains and/or a J chain. In this
embodiment of the invention, two or more effector molecules may
associate to produce an effector molecule dimer or multimer. The
effector molecules may be the same (enabling the production of an
effector molecule homodimer or homomultimer) or different (enabling
the production of an effector molecule heterodimer or
heteromultimer). Preferably, the effector molecule dimer or
multimer is bi-valent or multi-valent. Preferably, the constant
regions for the two or more effector molecules (ie the dimerization
domains) are identical, thus reducing the possibility of product
heterogeneity.
[0159] According to the fourth aspect of the present invention,
there is provided a polypeptide complex comprising a dimer
consisting of a first polypeptide heavy chain and a second
polypeptide heavy chain wherein: [0160] each polypeptide heavy
chain comprises a binding domain and a dimerization domain which
optionally comprises at least C.sub.H2, C.sub.H3 and, optionally,
C.sub.H4 antibody constant region domains; and, optionally, an
effector moiety, wherein, preferably: [0161] the binding domain in
the first polypeptide heavy chain has the same specificity as the
binding domain in the second polypeptide heavy chain; and [0162]
the constant regions (dimerization domains) for the two polypeptide
heavy chains are identical.
[0163] Preferably, the first and second chains have the same
effector moiety.
[0164] Preferably, the dimerization domain comprises at least
C.sub.H2, C.sub.H3 and, optionally, C.sub.H4 antibody constant
region domains
[0165] The fourth aspect of the present invention also provides a
polypeptide complex comprising a plurality of polypeptide heavy
chain dimers and a J chain, wherein: [0166] the plurality of
polypeptide heavy chain dimers are assembled by the J chain; [0167]
each polypeptide heavy chain comprises a binding domain and
identical .mu., .epsilon., .alpha. or .gamma. C.sub.H2, C.sub.H3
and, optionally, C.sub.H4 domains; and [0168] there are at least
two binding domains having different specificities in the
polypeptide complex (see FIGS. 4 and 5).
[0169] As defined for the first aspect of the invention above, each
heavy chain constant region preferably comprises at least one heavy
chain constant region gene, which is expressed without a functional
C.sub.H1 domain so that generation of heavy chain-only antibody can
occur. Each heavy chain constant region may also comprise one or
more additional heavy chain constant region genes, which are
selected from the group consisting of C.delta., C.gamma..sub.1-4,
C.mu., C.epsilon. and C.alpha..sub.1-2 with the proviso that the
additional heavy chain constant region genes also do not express a
functional C.sub.H1 domain. The heavy chain constant region genes
are selected depending on the preferred class or mixture of
antibody classes required.
[0170] Preferably, there are only two binding domains of different
specificities in expressed IgA and IgM.
[0171] In one embodiment, the heavy chains each include a C.sub.H4
domain, the constant domains are .alpha. domains and the
polypeptide complex includes a J chain.
[0172] In another embodiment, the heavy chains each include a
C.sub.H4 domain, the constant domains are .mu. domains and the
antibody includes a J chain.
Assembly of the Polypeptide Complex
[0173] The modular domain arrangement of the polypeptide complexes
of the present invention enables them to be constructed in a large
number of possible permutations. Such alterations in the domain
architecture and amino acid sequence of the polypeptide complex may
be achieved by suitable mutation or partial synthesis and
replacement of appropriate regions of the corresponding DNA coding
sequences. Substitute or additional domains may be obtained from
compatible recombinant DNA sequences. For example, the heavy chains
may include a natural hinge or engineered flexible polypeptide
domain both between the binding domain and the amino terminus of
the C.sub.H2 domain and between the effector domain and the
C-terminal end of the heavy chain (C.sub.H3 or C.sub.H4).
[0174] The heavy chains in the polypeptide complex of the invention
are expressed as fusion proteins. The effector chains in the
polypeptide complex of this aspect of the invention may be
expressed as fusion proteins or may be assembled by chemical means
or, if cellular in nature, may be isolated from blood or tissue, or
captured in vivo (for example albumin).
[0175] In the case of genetic fusions, the attachment of the
various domains may be achieved using a recombinant DNA construct
that encodes the amino acid sequence of the fusion protein, with
the DNA encoding the various domains placed in the same reading
frame.
[0176] The effector moiety, if present as part of a fusion protein,
may be located at either the amino or carboxy terminus of the
complementary assembly domain.
[0177] Alternatively, the domains in the effector chain may be
assembled by normal peptide chemical methods, as already known in
the art, rather than by being synthesised as a fusion protein.
[0178] Linkage may be through a peptide bond or through chemical
linkage. For example, the effector moiety may be peptide bonded to
the complementary assembly domain or it may be chemically bonded to
the complementary assembly domain, for example by using a chemical
linking structure such as a maleimide linker.
[0179] The effector moiety may be positioned at any location in the
heavy chain. For example, the effector moiety may be situated at
the C terminal end of the heavy chain or between the binding domain
and either the C.sub.H2 domain or the hinge domain of the
polypeptide complex. It is preferred that the assembly domain is
not situated between the C.sub.H2 and C.sub.H3 domains as this
might interfere with an effector function and the dimerization
domains. Preferably the effector moiety is attached to the amino
terminal or carboxy end of the heavy chain via a peptidic flexible
linker or hinge like region so as to facilitate independent
binding/function of effector moieties.
Polynucleotide Sequences, Vectors and Host Cells
[0180] The present invention also provides a polynucleotide
sequence encoding a heavy chain of any one of the polypeptide
complexes of the present invention, a vector comprising one or more
of the polynucleotide sequences referred to above and a host cell
transformed with a vector encoding the heavy chain of a polypeptide
complex of the present invention. The polynucleotides preferably
include sequences which allow the expressed heavy chains to be
secreted as homodimers into the medium in which the host cell is
growing. The host cell may be of any origin, including bacterial
and yeast cells, but is preferably a vertebrate host cell, more
preferable a mammalian host cell.
[0181] Transfection of the same host cell with a second vector
encoding a heavy chain comprising a binding domain with specificity
for a different target results in co-expression of the two
constructs and the assembly of a mixture of homodimers and
heterodimers. Homodimers will show specificity to the cognate
antigen and heterodimers will bind both antigens.
[0182] The present invention also provides a host cell transformed
with a vector encoding at least one effector chain of a polypeptide
complex of the present invention. The host cell may be of any
origin, including a bacterial or yeast cell, but is preferably a
vertebrate host cell, more preferably a mammalian host cell.
Alternatively the effector chain may be synthesised using methods
which are known in the art.
[0183] The present invention also provides a host cell transformed
with a vector encoding at least one heavy chain of a polypeptide
complex of the present invention. The host cell may be of any
origin, including a bacterial or yeast cell, but is preferably a
vertebrate host cell, more preferable a mammalian host cell.
Alternatively the heavy chain may be synthesised using methods
which are known in the art.
[0184] The present invention also provides a host cell transformed
with a vector encoding at least one heavy chain and at least one
effector chain of a polypeptide complex of the present invention.
The host cell may be of any origin, including a bacterial or yeast
cell, but is preferably a vertebrate host cell, more preferable a
mammalian host cell. Alternatively the chains may be synthesised
independently and assembled using methods which are known in the
art.
[0185] Furthermore, the present invention provides a transgenic
organism expressing at least one heavy chain homo- or hetero-dimer
polypeptide complex of the present invention. The transgenic
organism maybe a non-human vertebrate or mammal, a plant or an
insect.
[0186] The present invention also provides a method for the
production of class-specific heavy chain-only antibodies and VH
domains thereof, according to the first aspect of the invention, by
immunising a transgenic organism of the present invention with an
antigen.
[0187] In a preferred embodiment of this aspect of the invention,
the organism is a mouse.
[0188] The production of antibodies and polypeptide complexes for
healthcare applications requires large scale manufacturing systems,
examples of which are discussed in detail above. Such systems
include plants (e.g. maize), transgenic cattle and sheep, chickens
and insect larvae suitable for mass rearing technology. Other
production systems, including virus infection (eg baculovirus in
insect larvae and cell-lines) as an alternative to cell culture and
germline approaches will also be familiar to those skilled in the
art.
[0189] These methods, and other suitable methods known in the art,
can be used for the production of the polypeptide binding complexes
of the invention. Production of homodimers and/or of heterodimers
can be achieved using these methods.
Uses of the Heavy chain-Only Antibodies and Polypeptide Complexes
of the Invention
[0190] The heavy chain-only antibodies and polypeptide binding
complexes of the invention have a great number of applications.
[0191] For example, the heavy chain-only antibodies and polypeptide
complexes of the invention comprise bi- and multi-specific
polypeptide complexes. These complexes are particularly
advantageous, eg as therapeutics for the treatment and prevention
of infectious diseases.
[0192] The heavy chain-only antibodies and polypeptide binding
complexes of the invention are useful for cytochemical labelling,
targeting methods, therapy and diagnostics.
[0193] In mono-antibody therapy, pathogen escape, for example due
to a mutation leading to loss of a single binding site, will
abolish the therapeutic effect of the antibody. The production of
heterodimer polypeptide complexes recognising different antigens on
the same pathogen can overcome this problem. The use of at least
two binding domains having different specificities in the
polypeptide complexes of the invention can also be utilised to
enhance both cell-cell interactions and cell/pathogen
interactions.
[0194] In this embodiment, the polypeptide complexes of the
invention can be utilised, for example, to bridge polypeptide
complexes between two cell types such as a pathogen and a
macrophage, or a tumour cell and a T-cell. Alternatively the
polypeptide complex may recognise two or more epitopes on the same
pathogen with effector function being provided by the heavy chain
constant region alone.
[0195] Alternatively, bi-specific polypeptide binding complexes may
be used to target cells and tissues in vivo, then subsequently to
capture circulating effector molecules or imaging agents. For
example bi-specific tumour targeting agents can be used to capture
pro-drug converting complexes for the subsequent localised
conversion of pro-drug to reactive agent. Bi- and multi-specific
binding complexes in combination with effector agents may also be
used to bind and destroy one or more pathogens dependent on the
selection of binding domains. Alternatively the presence of two or
more binding domains which recognise different antigens on the same
pathogen provide clinical advantages and reduce the likelihood of
pathogen escape and drug redundancy as a result of mutation within
the pathogen.
[0196] The present invention provides heavy chain-only antibodies
or fragments thereof according to the first aspect of the
invention, polypeptide chains and complexes according to the second
aspect of the invention; and effector chains and polypeptide
complexes according to the third aspect of the invention. All are
suitable for pharmaceutical use in humans, and so the invention
provides a pharmaceutical composition comprising a heavy chain-only
antibody, polypeptide chain, effector chain or polypeptide complex
of the present invention. The invention also provides the use of a
heavy chain-only antibody, a polypeptide chain, an effector chain
or a polypeptide complex of the present invention in the
preparation of a medicament for the prophylaxis and/or treatment of
disease. Heavy and effector chains may be formulated together or
separately, dependent on the manner of administration and action of
the medicament.
[0197] The pharmaceutical compositions and medicaments will
typically be formulated before administration to patients.
[0198] For example, the heavy chain-only antibodies or polypeptide
complexes may be mixed with stabilisers, particularly if they are
to be lyophilised. Addition of sugars (eg mannitol, sucrose, or
trehalose) is typical to give stability during lyophilisation, and
a preferred stabiliser is mannitol. Human serum albumin (preferably
recombinant) can also be added as a stabiliser. Mixtures of sugars
can also be used, eg sucrose and mannitol, trehalose and mannitol,
etc.
[0199] Buffer may be added to the composition, eg a Tris buffer, a
histidine buffer, a glycine buffer or, preferably, a phosphate
buffer (eg containing sodium dihydrogen phosphate and disodium
hydrogen phosphate). Addition of buffer to give a pH between 7.2
and 7.8 is preferred, and in particular a pH of about 7.5.
[0200] For reconstitution after lyophilisation, sterile water for
injection may be used. It is also possible to reconstitute a
lyophilised cake with an aqueous composition comprising human serum
albumin (preferably recombinant).
[0201] Generally, the heavy chain-only antibodies and polypeptide
complexes will be utilised in purified form together with
pharmacologically appropriate carriers.
[0202] The invention thus provides a method for treating a patient,
comprising administering a pharmaceutical composition of the
invention to the patient. The patient is preferably a human, and
may be a child (eg a toddler or infant), a teenager or an adult,
but will generally be an adult.
[0203] The invention also provides heavy chain-only antibodies,
polypeptide chains, effector chains or a polypeptide complex of the
invention for use as a medicament.
[0204] The invention also provides the use of the heavy chain-only
antibodies, polypeptide chains, effector chains or chain
polypeptide complexes of the invention in the manufacture of a
medicament for treating a patient.
[0205] These uses, methods and medicaments are preferably for the
treatment of one of the following diseases or disorders: wound
healing, cell proliferative disorders, including neoplasm,
melanoma, lung, colorectal, osteosarcoma, rectal, ovarian, sarcoma,
cervical, oesophageal, breast, pancreas, bladder, head and neck and
other solid tumours; myeloproliferative disorders, such as
leukemia, non-Hodgkin lymphoma, leukopenia, thrombocytopenia,
angiogenesis disorder, Kaposis' sarcoma; autoimmune/inflammatory
disorders, including allergy, inflammatory bowel disease,
arthritis, psoriasis and respiratory tract inflammation, asthma,
immunodisorders and organ transplant rejection; cardiovascular and
vascular disorders, including hypertension, oedema, angina,
atherosclerosis, thrombosis, sepsis, shock, reperfusion injury, and
ischemia; neurological disorders including central nervous system
disease, Alzheimer's disease, brain injury, amyotrophic lateral
sclerosis, and pain; developmental disorders; metabolic disorders
including diabetes mellitus, osteoporosis, and obesity, AIDS and
renal disease; infections including viral infection, bacterial
infection, fungal infection and parasitic infection, pathological
conditions associated with the placenta and other pathological
conditions and for use in immunotherapy.
[0206] In a further aspect still, the present invention provides
the use of a heavy chain-only antibody or polypeptide binding
complex of the present invention as a diagnostic, prognostic, or
therapeutic imaging agent. Furthermore, the present invention
provides the use of a heavy chain homo- or hetero-dimer of the
present invention alone or in combination with one or more effector
(light) chains of the present invention as a therapeutic imaging
agent, a cytochemical reagent or diagnostic agent.
[0207] The present invention provides the use of a heavy chain-only
antibody or a fragment thereof as herein described as an
intracellular binding reagent, or an abzyme. Preferred heavy
chain-only antibody fragments are soluble antigen-specific VH
binding domains.
[0208] The present invention also provides, the use of an
antigen-specific single chain antibody or VH binding domain
according to the present invention as an enzyme inhibitor or
receptor blocker. Preferred heavy chain-only antibody fragments are
soluble antigen-specific VH binding domains.
[0209] The present invention also provides the use of a V.sub.H
domain fused to an effector molecule for use as a therapeutic,
imaging agent, diagnostic, abzyme or reagent.
BRIEF DESCRIPTION OF THE DRAWINGS
[0210] FIGS. 1A and 1B: shows a polypeptide complex comprising a
binding domain (V.sub.H) dimerization domain (optionally C.sub.H2,
C.sub.H3 and C.sub.H4) and a effector moiety (EM). Binding domains
and effector moieties may be positioned at the amino or carboxy
terminal ends of the dimerization domains. [0211] Flexible linkers
(<-) and hinge () regions are indicated.
[0212] FIGS. 2A and 2B: shows different configurations of binding
domains and the replacement of the effector moiety by further
binding domains. A. Preferred option since homodimers are produced.
No separation of products required. B. Mixture of homodimers and
heterodimers are produced. Separation of products required.
[0213] FIG. 3: shows a heavy chain polypeptide complex in
association with an effector chain. The effector chain comprises a
complementary binding domain (CBD) and an effector moiety (EM). CBD
is recognised by EM of heavy chain. CBD is fused to or part of
effector, e.g. enzyme, toxin, chelator, imaging agent. Effector
chain can be synthesized separately from heavy chain.
[0214] FIG. 4 shows a bivalent secretory IgA in association with a
J chain.
[0215] FIG. 5 shows a multivalent heavy chain-only IgM-like
polypeptide complex assembled via a J chain.
[0216] FIG. 6: shows the strategy for the generation of transgenic
mice expressing an IgG locus and the functional generation of heavy
chain-only antibodies and V.sub.H domains as a result of antigen
challenge.
[0217] FIG. 7: shows the strategy for the generation of transgenic
mice expressing an IgM locus and the functional generation of heavy
chain-only antibodies and VH domains as a result of antigen
challenge.
[0218] FIG. 8: shows the strategy for the generation of transgenic
mice expressing an IgA locus and the functional generation of heavy
chain-only antibodies and VH domains as a result of antigen
challenge.
[0219] FIG. 9: Sequence alignment of the PCR products obtained from
bone marrow cDNA using V.sub.HH1 and V.sub.HH2 primers in
combination with human C.gamma.2 primer from mice containing a
locus with constant regions that have a camelid splice mutation to
remove CH1. The results show that CH1 is not removed.
[0220] FIGS. 10-13: Structure of VH/camelid VH (VHH) constructs.
1-n stands for any number of VH genes, or D or J segments. The
normal complement of the human locus is 51 V genes, 25 functional D
segments (plus 2 non functional ones) and 6 J segments. In case of
a C.mu. (for IgM) or C.epsilon. (for IgE) region there is no H
region and there is an additional CH4 exon between CH3 and M1. The
VH genes(s) have been mutated to provide solubility as described in
the public domain
[0221] The VH genes, D and J segments and C exons are preferably
human, but could be from any other species including camelids. In
the latter case the camelid VH (VHH) genes would not be mutated as
they are naturally soluble.
[0222] FIG. 14: Mouse immunization schedule and antibody assay for
the generation of heavy chain-only IgG against E. Coli HSP70.
[0223] FIG. 15: Flow cytometric analysis and immunohistochemistry
results for spleen cells derived from transgenic mice.
[0224] FIG. 16: Results of ELISA analysis of DKTP immunized
transgenic mice and sequence analysis of resulting antibody
library.
[0225] FIG. 17: Examples of somatic mutations and VDJ rearrangement
seen in immunized transgenic mice.
[0226] FIG. 18: Results of immunostaining assay on Tet-on cell line
transfected with response plasmid containing A5 antibody.
[0227] FIG. 19: Results of Western bolt analysis of sera of
transgenic mouse lines.
[0228] FIG. 20: Size fractionation of human IgM mixed with human
single chain IgM produced by the IgM plus IgG locus mice.
[0229] FIG. 21: Results of ELISA analysis of single chain IgM and
IgG antibodies raised against human TNF.alpha..
[0230] FIG. 22: shows a strategy for the generation of a homodimer
plasmid with binding affinity for HSP70 and .alpha.GAG.
[0231] FIG. 23: Functional expression of homodimer polypeptide
complex in CHO cells.
[0232] FIG. 24: demonstrates functional binding and simultaneous of
homodimer polypeptide complex to alpha .alpha.GAG and HSP70.
Schematic representation of a bivalent, bi-specific antibody. A
second variable region (VHH2 directed against gag) is cloned onto
the carboxyterminal end of a heavy chain only antibody containing
the other specificity (VHH1 directed against HSP70). The hinge
region between CH3 and VHH2 has been replaced by a linker region
where all cysteines have been replaced by prolines (arrows). Coat
ELISA plate with Gag, block with 1% milk/1% BSA in PBS, incubate
first with diabody medium (1:2 dil.) and then with BI21 cell lysate
(contains HSP70) (1:2 dil.). Elute bound proteins with sample
buffer=2-mercaptoethanol and run on 8% gel. Stain with
poly/monoclonal antibodies against Gag, diabody and HSP70. .alpha.
Gag: Rabbit polyclonal/Swine .alpha. rabbit-AP (blue). .alpha.
HSP70: monoclonal/Goat .alpha. Human IgG-HRP (brown). .alpha.
Diabody: Goat .alpha. Human IgG-HRP (brown). Lane 1:
Gag/Diabody/BI21 cell lysate. Lane 2: Gag/culture medium (is
Diabody negative control)/BI21. Lane 3: -milk-BSA/Diabody/BI21.
Lane 4: -milk-BSA/culture medium/BI21. Lane 5:
Gag/Diabody/-milk-BSA. Lane 6: Gag/culture medium/-milk-BSA
[0233] FIG. 25: shows the strategy for the generation of homodimer
polypeptide complexes, optionally in association with effector
chains carrying IgA effector function
[0234] FIG. 26: shows the strategy for the generation of homodimer
polypeptide complexes, optionally in association with effector
chains carrying IgA effector function.
GENERAL TECHNIQUES
[0235] Unless defined otherwise, all technical and scientific terms
used herein have the same meaning as commonly understood by one of
ordinary skill in the art (e.g. in cell culture, molecular
genetics, nucleic acid chemistry, hybridisation techniques and
biochemistry). Standard techniques are used for molecular, genetic
and biochemical methods (see generally, Sambrook et al., Molecular
Cloning: A Laboratory Manual, 2nd Ed. (1989) Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y. and Ausubel et al.,
Short Protocols in Molecular Biology (1999) 4th Ed., John Wiley
& Sons, Inc.) and chemical methods. In addition Harlow &
Lane, A Laboratory Manual, Cold Spring Harbor, N.Y., is referred to
for standard Immunological Techniques.
[0236] Any suitable recombinant DNA technique may be used in the
production of the bi- and multi-valent polypeptide complexes,
single heavy chain antibodies, and fragments thereof, of the
present invention. Typical expression vectors, such as plasmids,
are constructed comprising DNA sequences coding for each of the
chains of the polypeptide complex or antibody. Any suitable
established techniques for enzymic and chemical fragmentation of
immunoglobulins and separation of resultant fragments may be
used.
[0237] The present invention also provides vectors including
constructs for the expression of heavy chain-only antibodies in
transgenic mice and the construction and expression of polypeptide
complaxes of the present invention.
[0238] It will be appreciated that a single vector may be
constructed which contains the DNA sequences coding for more than
polypeptide chain. For instance, the DNA sequences encoding two
different heavy chains may be inserted at different positions on
the same plasmid.
[0239] Alternatively, the DNA sequence coding for each polypeptide
chain, may be inserted individually into a plasmid, thus producing
a number of constructed plasmids, each coding for a particular
polypeptide chain. Preferably, the plasmids into which the
sequences are inserted are compatible.
[0240] Each plasmid is then used to transform a host cell so that
each host cell contains DNA sequences coding for each of the
polypeptide chains in the polypeptide complex.
[0241] Suitable expression vectors which may be used for cloning in
bacterial systems include plasmids, such as Co1 E1, pcR1, pBR322,
pACYC 184 and RP4, phage DNA or derivatives of any of these.
[0242] For use in cloning in yeast systems, suitable expression
vectors include plasmids based on a 2 micron origin.
[0243] Any plasmid containing an appropriate mammalian gene
promoter sequence may be used in cloning in mammalian systems.
Insect or bacculoviral promoter sequences may be used fir insect
cell gene expression. Such vectors include plasmids derived from,
for instance, pBR322, bovine papilloma virus, retroviruses, DNA
viruses and vaccinia viruses.
[0244] Suitable host cells which may be used for expression of the
polypeptide complex or antibody include bacteria, yeasts and
eukaryotic cells, such as insect or mammalian cell lines,
transgenic plants, insects, mammalian and other invertebrate or
vertebrate expression systems.
Polypeptide Complexes and Single Heavy Chain Antibodies of the
Present Invention
[0245] It will be understood that term `polypeptide complex`, `a
single heavy chain antibody` and `heterlogous heavy chain locus` of
the present invention also include homologous polypeptide and
nucleic acid sequences obtained from any source, for example
related cellular homologues, homologues from other species and
variants or derivatives thereof.
[0246] Thus, the present invention encompasses variants, homologues
or derivatives of the polypeptide complexes and antibodies as
herein described.
[0247] In the context of the present invention, a homologous
sequence is taken to include an amino acid sequence which is at
least 80, 85, 90, 95, 96, 97, 98, 99, 99.5, 99.6, 99.7, 99.8, 99.9%
identical, preferably at least 98 or 99%, identical, at the amino
acid level over at least 30, preferably 50, 70, 90 or 100 amino
acids. Although homology can also be considered in terms of
similarity (i.e. amino acid residues having similar chemical
properties/functions), in the context of the present invention it
is preferred to express homology in terms of sequence identity.
[0248] The present invention also includes constructed expression
vectors and transformed host cells for use in producing the
polypeptide complexes and antibodies of the present invention.
[0249] After expression of the individual chains in the same host
cell, they may be recovered to provide the complete polypeptide
complex or heavy chain-only antibody in active form.
[0250] It is envisaged that, in preferred forms of the invention,
the individual heavy chains will be processed by the host cell to
form the complete polypeptide complex or antibody which
advantageously is secreted therefrom. Preferably, the effector
chain is produced separately either by a host cell or by synthetic
means.
[0251] Techniques for the preparation of recombinant antibody
polypeptide complexes is described in the above references and also
in, for example, EP-A-0 623 679; EP-A-0 368 684 and EP-A-0 436
597.
Immunisation of a Transgenic Organism
[0252] In a further aspect, the present invention provides a method
for the production of the antibodies of the present invention
comprising administering an antigen to a transgenic organism of the
present invention.
[0253] The antibodies and polypeptide complexes produced from
transgenic animals of the present invention include polyclonal and
monoclonal antibodies and fragments thereof. If polyclonal
antibodies are desired, the transgenic animal (e.g. mouse, rabbit,
goat, horse, etc.) may be immunised with an antigen and serum from
the immunised animal, collected and treated by known procedures. If
serum containing polyclonal antibodies contains antibodies to other
antigens, the polyclonal antibodies of interest can be purified by
immunoaffinity chromatography and such like techniques which will
be familiar to those skilled in the art. Techniques for producing
and processing polyclonal antisera are also known in the art.
Uses of the Polypeptide Binding Complexes and Antibodies of the
Present Invention
[0254] The polypeptide complexes and antibodies including fragments
thereof of the present invention may be employed in: in vivo
therapeutic and prophylactic applications, in vitro and in vivo
diagnostic applications, in vitro assay and reagent applications,
and the like.
[0255] Therapeutic and prophylactic uses of the polypeptide
complexes and antibodies of the invention involve the
administration of the above to a recipient mammal, such as a
human.
[0256] Substantially pure polypeptide complexes and antibodies
including fragments thereof of at least 90 to 95% homogeneity are
preferred for administration to a mammal, and 98 to 99% or more
homogeneity is most preferred for pharmaceutical uses, especially
when the mammal is a human. Once purified, partially or to
homogeneity as desired, the polypeptide complexes and
heavy-chain-only antibodies as herein described may be used
diagnostically or therapeutically (including extracorporeally) or
in developing and performing assay procedures using methods known
to those skilled in the art.
[0257] Generally, the polypeptide complexes and antibodies of the
present invention will be utilised in purified form together with
pharmacologically appropriate carriers. Typically, these carriers
include aqueous or alcoholic/aqueous solutions, emulsions or
suspensions, which may include saline and/or buffered media.
Parenteral vehicles include sodium chloride solution, Ringer's
dextrose, dextrose and sodium chloride and lactated Ringer's.
[0258] Suitable physiologically-acceptable adjuvants, if necessary
to keep a polypeptide complex in suspension, may be chosen from
thickeners such as carboxymethylcellulose, polyvinylpyrrolidone,
gelatin and alginates.
[0259] Intravenous vehicles include fluid and nutrient replenishers
and electrolyte replenishers, such as those based on Ringer's
dextrose. Preservatives and other additives, such as
antimicrobials, antioxidants, chelating agents and inert gases, may
also be present (Mack (1982) Remington's Pharmaceutical Sciences,
16th Edition).
[0260] The polypeptide complexes and antibodies, including
fragments thereof, of the present invention may be used as
separately administered compositions or in conjunction with other
agents. These can include various immunotherapeutic drugs, such as
cyclosporine, methotrexate, adriamycin, cisplatinum or an
immunotoxin. Alternatively, the polypeptide complexes can be used
in conjunction with enzymes for the conversion of pro-drugs at
their site of action.
[0261] Pharmaceutical compositions can include "cocktails" of
various cytotoxic or other agents in conjunction with the selected
antibodies of the present invention or even combinations of the
selected antibodies of the present invention.
[0262] The route of administration of pharmaceutical compositions
of the invention may be any of those commonly known to those of
ordinary skill in the art. For therapy, including without
limitation immunotherapy, the polypeptide complexes or antibodies
of the invention can be administered to any patient in accordance
with standard techniques. The administration can be by any
appropriate mode, including parenterally, intravenously,
intramuscularly, intraperitoneally, transdermally, via the
pulmonary route, or also, appropriately, by direct infusion with a
catheter. The dosage and frequency of administration will depend on
the age, sex and condition of the patient, concurrent
administration of other drugs, counter-indications and other
parameters to be taken into account by the clinician.
[0263] The polypeptide complexes and antibodies of this invention
can be lyophilised for storage and reconstituted in a suitable
carrier prior to use. Known lyophilisation and reconstitution
techniques can be employed. It will be appreciated by those skilled
in the art that lyophilisation and reconstitution can lead to
varying degrees of functional activity loss and that use levels may
have to be adjusted upward to compensate.
[0264] In addition, the polypeptide complexes and antibodies of the
present invention may be used for diagnostic purposes. For example,
antibodies as herein described may be generated or raised against
antigens which are specifically expressed during disease states or
whose levels change during a given disease states.
[0265] For certain purposes, such as diagnostic or tracing
purposes, labels may be added. Suitable labels include, but are not
limited to, any of the following: radioactive labels, NMR spin
labels and fluorescent labels. Means for the detection of the
labels will be familiar to those skilled in the art.
[0266] The compositions containing the polypeptide complexes and
antibodies of the present invention or a cocktail thereof can be
administered for prophylactic and/or therapeutic treatments.
[0267] A composition containing one or more polypeptide complexes
or antibodies of the present invention may be utilised in
prophylactic and therapeutic settings to aid in the alteration,
inactivation, killing or removal of a select target cell population
in a mammal. In addition, the selected repertoires of polypeptide
complexes and antibodies described herein may be used
extracorporeally or in vitro selectively to kill, deplete or
otherwise effectively remove a target cell population from a
heterogeneous collection of cells.
Example 1
[0268] In preliminary experiments, transgenic mice were prepared to
express a heavy chain locus wherein two llama VHH exons were linked
to the human heavy chain diversity (D) and joining (J) segments,
followed by the C.mu., C.delta., C.gamma.2, C.gamma.3 human
constant region genes and human heavy chain immunoglobulin 3' LCR.
The human C.gamma.2 and C.gamma.3 genes contained a G to A splice
mutation. The presence of the Frt site enabled the generation of a
single copy transgenic mouse from a multi-copy transgene array by
Flp mediated recombination. However, sequences from the transgenic
locus with a G to A splice mutation, showed aberrant splicing but
incomplete CH1 removal (FIG. 9).
Constructs
[0269] To overcome this problem, a genomic cosmid library was
screened for clones containing the VH genes using standard methods.
One (or more) different germline VHs were randomly chosen based on
their sequence (five genera classes in the case of human VH's).
Hydrophilic amino acid codons were introduced at positions 42, 49,
50 and 52 according to IMGT numbering (Lefranc et al. (1999)). The
VH genes were combined into a BAC vector by standard procedures
such as direct cloning using custom made linkers or homologous
recombination.
[0270] Two clones were selected from the human genomic Pac library
RPCI-11 (BACPAC Recource Center, USA): clone 1065 N8 containing
human heavy chain D and J segments, C.mu. (IgM) and C.delta. (IgD)
and clone 1115 N15 containing the C.gamma.3 (IgG3) genes. Bac clone
11771 from a different human genomic library (Incyte Genomics,
Calif., USA) was used as a source of C.gamma.2 (IgG2) gene and the
immunoglobulin heavy chain LCR (Mills et al. (1997) J. Exp Med.,
15; 186(6):845-58).
[0271] Using standard techniques, the C.gamma.3 and C.gamma.2 genes
were subcloned separately into pFastBac vector (Invitrogen).
Similarly any of the other Ig constant regions can be cloned from
these BACs (IgA, IgE). A complete deletion of CH1 exon was achieved
by homologous recombination (Imam et al. (2001)) using sequences
that flank the CH1 exon of each constant region. An frt site could
optionally be introduced in front of the C.mu. switch region to
allow the generation of single copy loci from multicopy loci by
treatment with flp recombinase in vivo by standard means e.g. by
breeding to rosa-flp mice (FIG. 10).
[0272] The separate VH genes, D and J segments and C and LCR exons
were cloned into one BAC either by conventional restriction
digestion and ligations or by homologous recombination (or a
mixture of both) or any other cloning technique.
[0273] Further constructs could then be created.
IgM-Only Locus
[0274] In order to obtain the IgM construct (FIG. 11), one or more
VHs genes (preferably engineered human V.sub.H genes to provide
solubility or camelid VHH genes), followed by human D and J heavy
chain segments and C.mu., were cloned into a BAC. For the
methodology see above. In this case only the C.mu. region was
cloned into the final BAC.
IgM Plus IgG Locus, (C.delta. is Optional)
[0275] In order to obtain the IgM plus IgG construct (FIG. 12), one
or more VHs genes (preferably engineered human VH segments to
provide solubility or camelid VHH genes), followed by human D and J
heavy chain segments, C.mu. (without CH1 but with CH4 exon),
(optional C.delta.) and the modified human C.gamma.2 and C.gamma.3
genes and 3' LCR were cloned into a BAC. In order to generate an
IgG only locus loxP sites were introduced during the standard
cloning steps (described above) and the BAC is grown in 294 Cre E.
coli strain (Buscholz et al.) and cre mediated recombination yields
bacteria producing an IgG only locus. For further construction
details see above.
IgM Plus IgG Locus (C.delta. is Optional)
[0276] In order to obtain the IgM plus IgG construct (FIG. 13), one
or more VHs genes (preferably engineered human VH genes to provide
solubility or camelid VHH genes), followed by human D and J heavy
chain segments, C.mu. (with CH1 and CH4), (optional C.delta.) and
the modified human C.gamma.2 and C.gamma.3 genes and 3' LCR were
cloned into a BAC. In order to generate an IgG only locus loxp
sites were introduced during the standard cloning steps (described
above) and the BAC was grown in 294 Cre E. coli strain (Buscholz et
al.) and cre mediated recombination yielded bacteria producing an
IgG only locus.
Transgenic Mice, Breeding and Genotyping
[0277] The final BAC was introduced into transgenic mice by
standard microinjection of fertilized eggs or via embryonic stem
cell transfection technology.
[0278] Transgenic loci were checked for integrity and number of
copies by Southern blot analysis of tail DNA (Southern 1975) using
5' and 3' end locus probes. Founders were bred as lines in the
.mu.MT-/- background. Genotyping was done by standard PCR analysis
using primers for each of the different regions of the locus.
Sequence analysis of the RT-PCR products derived from BM cDNA of
transgenic mice where the entire CH.sub.1 exon from both the
C.gamma.2 and the C.gamma.3 was been deleted (one with (HLL lines)
and one without the C.mu. and C.delta. genes, showed that the
transgenic loci are not only capable of VDJ recombination, but that
the IgG transcripts resemble those found in llama and camel
HCAbs.
Immunohistochemistry
[0279] Spleens were embedded in OCT compound. Frozen 5 .mu.m
cryostat sections were fixed in acetone and single or double
labeled as previously described (Leenen et al. 1998). Monoclonal
antibodies anti B220/RA3-6B2, anti-CD11c/N418 (Steinman et al.,
1997), were applied as hybridoma culture supernatants. Peroxidase
coupled goat anti-human IgG and anti-human IgM were from Sigma.
Second-step reagents were peroxidase labeled goat anti-rat Ig
(DAKO, Glostrup, Denmark) or anti-hamster Ig (Jackson
ImmunoResearch Laboratories, West Grove, Pa.) and goat anti-rat Ig
alkaline phosphatase (Southern Biotechnology, Birmingham, Ala.,
USA).
[0280] FIG. 15 shows the immunohistochemical analysis of 5 .mu.m
frozen sections of spleens from .mu.MT.sup.-/-, WT and HLL and
HLL-MD transgenic mice in the .mu.MT.sup.-/- background. Sections
were stained with anti B220 (blue) for B cells and anti-CD 11c/N418
(brown) for dendritic cells. Arrows indicate the location of small
clusters of B cells.
Flow Cytometric Analyses
[0281] Single cell suspensions were prepared from lymphoid organs
in PBS, as described previously (Slieker et al. 1993).
Approximately 1.times.10.sup.6 cells were incubated with antibodies
in PBS/0.5% bovine serum albumin (BSA) in 96 well plates for 30 min
at 4.degree. C. Cells were washed twice in PBS/0.5% BSA. For each
sample, 3.times.10.sup.4 events were scored using a FACScan
analyzer (Becton Dickinson, Sunnyvale, Calif.). FACS data were
analyzed using CellQuest version 1.0 computer software. Four-color
analysis was performed on a Becton Dickinson FACS Calibur. The
following mAbs were obtained from BD Pharmingen (San Diego,
Calif.): FITC conjugated anti B220-RA3-6B2, PE conjugated anti
CD19. FACS scan data of spleen cells, stained with anti-CD19 and
anti-B220 are displayed in the bottom panel of FIG. 15.
[0282] On the left of the figure is a representation of Flp
recombination in vivo by breeding HLL lines to a FlpeR transgenic
line and supporting FACS scan data on spleen cells of the
recombinant, showing B cell rescue as seen in the directly
generated original HLL-MD lines. On the right is a representation
of Cre recombination in vivo by breeding to Cag Cre transgenic line
and FACS data on spleen cells of the single copy recombinant.
Immunization and Hybridoma Production (FIG. 14)
[0283] Transgenic mice containing a heavy chain only antibody locus
consisting of two llama VHH domains, human D and J regions and IgG2
and 3 constant regions (without a CH1 domain) were created.
[0284] 8 week old mice were immunized with either E. Coli heat
shock protein 70 (hsp70). 20 .mu.g or 5 .mu.g of antigen with
Specol adjuvant (IDDLO, Lelystadt, NL) was injected respectively
s.c. on days 0, 14, 28, 42 and i.p. on day 50. Blood was taken on
day 0, 14 and 45. After three boosts a low titer of antigen
specific antibodies was detected in 1 out of 3 Hsp70 immunized
HLL-MD1 mice (FIG. 14).
[0285] A standard spleen cell fusion with a myeloma cell line was
performed to generate a monoclonal antibody resulting in a
monoclonal hybridoma cell line against the hsp70 protein. The
anti-HSP 70 HCAb consists of the llama VHH segment closest to the D
region (VHH 2) recombined to the human IgHD3-10 segment
(acc.num.X13972) and the human IgHJ4-02 segment (acc.num.X86355).
Although not at high frequency, the VHHs has a few mutations that
give rise to the amino acid alterations seen in FIG. 9A when
compared to the germ line configuration. The RT-PCR analysis also
showed only one productive IgH transcript in the hybridoma,
suggesting that there are no other transcripts made. The
.alpha.HSP70 IgG2 antibody is secreted as heavy chain only dimer
(Western blots under denaturing gel (dimer) and non denaturing gel
(monomer) conditions FIG. 14). Spleen cells were fused with
Sp2-O-Ag14 myeloma cells (gift from R. Haperen) on day 56 using a
ClonalCell.TM.-HY kit (StemCell Technologies, UK) according to the
manufacturer's instructions.
[0286] Transgenic mice containing a heavy chain only antibody locus
consisting of two llama VHH domains, human D and J regions, a human
IgM and IgG2 and 3 constant regions (all without a CH1 domain, FIG.
12) were immunized with TNF.alpha. to obtain HC-IgM antibodies. One
out of three mice showed positive sera in standard ELISA assays. A
standard myeloma fusion yielded a positive IgM hybridoma (FIG. 16).
After gel filtration on Sepharose 6B under non-reduced conditions
each fraction was of the column was loaded to a gel under reducing
conditions and detected by .alpha.human IgM-HRP (FIG. 20).
Fractionation under non reducing conditions showed that the HC-IgM
is secreted as a multimeric antibody with the same size as a human
control IgM (after subtraction of the molecular weight of light
chains and the CH1 domain that are absent from the HC-IgM). The gel
fractionation of each column fraction under reducing conditions
showed the expected monomer of (FIG. 20).
Serum Ig ELISA
[0287] Blood from 15-25 weeks old mice was collected in EDTA coated
tubes, spun for 15' at room temperature (RT) and the supernatant
diluted 1:5 in PBS. A 96 well plate was coated for 2 h with 5 mg/ml
of a goat anti human IgG (YES Biotechnology) or a goat anti human
IgM (Sigma), washed with PBS, blocked for 1 h at RT with blocking
solution (1.5% BSA/1.5% powder milk/0.1% tween 20/PBS) and washed
three times with PBS. Dilution series of serum samples and
standards (human IgG2 or human IgM (Sigma, Zwijndrecht, NL)) were
loaded and incubated for 2-4-h and the plates washed 6 times with
PBS before addition of a secondary antibody (1:2000 diluted goat
anti human IgG or goat anti human IgM coupled to HRP (Sigma,
Zwijndrecht, NL)). All dilutions were done in a blocking solution.
After 1-2 h incubation at RT and washing in PBS, POD substrate
(Roche) was added.
[0288] The ELISA for the detection of antigen specific soluble
sdAbs from the IgG2 phage library is shown in FIG. 16. Soluble
sdAbs were used as primary antibodies on antigen-coated plates,
followed by mouse .alpha.-myc antibody and HRP conjugated goat
.alpha.-mouse antibody. POD was used as a substrate. The bottom
panel shows fingerprinting of clones with restriction enzyme Hinf
I, showing 5 different inserts coding for sdAb against B.
Pertusis.
Antibody Library Construction and Screening
[0289] Total RNA was isolated from spleens of DKTP immunized single
copy IgG only mice (FIG. 12 after cre treatment) using an Ultraspec
RNA isolation system (Biotecx Laboratories Inc, Houston, Tex.,
USA). cDNA was made using oligo dT. DNA fragments encoding VHHDJ
fragments were amplified by PCR using specific primers: vh1 back
Sfi I primer (Dekker et al 2003) in combination with hIgG2hingrev
primer (5'-AATCTGGGCAGCGGCCGCCTCGACACAACATTTGCGCTC-3'). The
amplified VHHDJs (.about.400 bp) were Sfi I/Not I digested, gel
purified and cloned into Sfi I/NotI digested phagemid vector
pHEN-1.
[0290] Transformation into TG1 electro-competent cells yielded in a
human single domain antibody library. Two rounds of selection were
performed using panning on vaccine antigens adsorbed onto plastic
(immunotubes coated with undiluted vaccine). Restriction analysis
and sequencing were standard.
RT-PCR of Heavy Chain-Only Locus
[0291] It was then investigated whether HLL-MD locus functions as a
normal locus in producing a diverse antibody repertoire by
sequencing the RT PCR products obtained using IgG2 and IgG3
specific primers on cDNA from Peyer's patches. FIG. 17 shows some
examples of somatic mutations of clones from non immunized mice
(left panel) and immunized mice (right panel). The mice were IgG
only loci, immunized E. Coli hsp70, Pertussis lysate, tetanus
toxoid. In grey shade is the IgG2 hinge region starting with
ERKCCV
[0292] Although, the RT-PCR analysis on Peyer's patches showed that
both VH are used, all the antibodies sequenced rearranged the VH2.
The source of repertoire variability is the CDR3 region formed by
the selection of D and J segments and by the V-D and D-J junctions.
The use of human J segments is similar to that seen in human
rearrangements, with the JH4 and JH6 segments being used most
often.
[0293] This analysis showed that both VHs, different human D and
all of the human J segments are used, to contribute to a diverse
antibody repertoire. It also showed the presence of IgG3 switched B
cells and the occurrence of somatic mutations by comparison of each
rearranged gene with its germline counterpart i.e. the original VH
in the transgenic construct (see FIG. 17). Therefore, the human
heavy chain-only IgG antigen receptor can provide the necessary
signals for B cell maturation.
Immunostaining
[0294] FIG. 18 shows immunostaining results of one of Tet-on cell
line additionally transfected with the response plasmid containing
A5 antibody (Dekker et al. 2003). The upper panel shows doxycicline
induced production of A5 antibody (red) in cytoplasm and nuclear
staining of the cells with DAPI (blue). Lower panel shows that
cells expressing rtTA in nucleus are the ones producing the A5 upon
induction (upper panel). Staining was done with one of the human
HCAb against rtTA (green) with the sequence shown below. The FITC
conjugated goat anti human IgG was used as a secondary step. A5 was
detected as previously described by Dekker et al 2003. The rTTA
antibody was an IgG3 with the following sequence:
TABLE-US-00001 241 AGACTCT 80 R L 301
CCTGTGCAGCCTCTGGAAGCATCTTCAGTATCAATGCCATGGGCTGGTACCGCCAGGCTC 100 S
C A A S G S I F S I N A M G W Y R Q A 361
CAGGGAAGCAGCGCGAGTTGGTCGCAGCTATTACTAGTGGTGGTAGCACAAGGTATGCAG 120 P
G K Q R E L V A A I T S G G S T R Y A 421
ACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACACGGTGTATCTGC 140 D
S V K G R F T I S R D N A K N T V Y L 481
AAATGAACAGCCTGAAACCTGAGGACACGGCCGTCTATTACTGTTTGATCTCTATGGTTC 160 Q
M N S L K P E D T A V Y Y C L I S M V 541
GGGGAGCCCGTTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCAGAGCTCA 180 R
G A R F D Y W G Q G T L V T V S S E L 601 AAACCCCACTT 200 K T P
L
[0295] The IgG3 hinge starts at amino acid 198 ELKTPL. For
comparison see the IgG2 hinge region in FIG. 17.
Western Blot Analyses
[0296] FIG. 19 shows Western blots of sera of different transgenic
mouse lines containing the IgM plus IgG locus (FIG. 10) after cre
treatment (ie IgM deleted, only IgG left). Sera were purified by
prot G and gel fractionated under reducing (FIG. 19 right panel)
and non reducing (FIG. 19, left panel) conditions. The controls
were the background KO mice and a normal human serum sample. Note
the size difference between the two gels showing that the human
heavy chain only IgG is a dimer.
[0297] The signal shown in FIG. 19 was detected with an anti-human
IgG antibody by standard procedures.
Size Fractionation of Human IgM Produced by the IgM Plus IgG Locus
Mouse
[0298] The serum from the IgM plus IgG mice (FIG. 13) was
fractionated by gel filtration under non reducing conditions after
mixing with a human serum sample as a control. Results are shown in
FIG. 20. Molecular weights of the complexes on the column decrease
with each lane (representing each fraction) from left to right. The
fractions (each lane) were analysed by gel electrophoresis under
reducing conditions.
[0299] ELISA analysis was performed on a number of hybridomas made
from mice containing the IgM plus IgG (FIG. 13) locus immunized
with human TNF.alpha.. Results are shown in FIG. 21. The top two
rows in FIG. 21 were analysed with an anti-human IgG, the next two
rows with an anti human IgM. The serum samples (arrows) show that
the mouse has generated both IgG and IgM anti-TNF.alpha.
antibodies. The single arrow shows a positive IgM hybridoma. The
wells were coated with commercially available human TNF.alpha.. All
procedures were standard.
Example 2
[0300] The bi-specific bi-valent antibody was generated by
combining two heavy chain only mono-specific antibodies. The first
antibody forms the backbone bringing in the first specificity and
the effector functions (variable region and constant region
respectively). This was combined with the second antibody with the
second specificity via a newly designed hinge. This hinge was
similar to the existing IgG2 hinge sequence but was altered by
replacing the cysteins with prolines to prevent crosslinking of the
cysteins in the antibody dimer and providing extra flexibility via
the prolines to prevent the second antibody being spatially
constrained, which otherwise may have inhibited its function.
[0301] The starting backbone antibody was an antibody raised
against the E. coli HSP70 protein. The HSP70 antigen was injected
into transgenic mice that contained a heavy chain only antibody
locus as described in (see above FIG. 14). A monoclonal antibody
was raised from these animals by standard hybridoma fusion
technology (see above). The cDNA coding for the
.alpha.LHSP-antibody was subsequently cloned by standard RT-PCR
recombinant DNA methods resulting in a plasmid containing a full
length cDNA that included from the 5' end to the 3' end (in the
protein from the N terminus to COOH terminus) the start codon ATG,
the signal peptide sequence, the variable domain VHH1 (see Janssens
et al.), the recombined D and J region and the constant region of
C.gamma.2 (lacking a CH1 region), but including the stop codon and
the polyA site (FIG. 22 upper left). The cDNA coding for the
.alpha.HSP70 antibody was amplified by PCR for cloning using a
forward primer and a reverse primer.
[0302] The forward primer was:
##STR00001##
providing an EcoRI site for cloning purposes (underlined) an
efficient translation start sequence (bold) and the normal start
codon (greyshade).
[0303] The reverse primer was: GACAAGCTTTACCCGGAGACAGGGAGAGGC
providing a HindIII cloning site (underlined) and remaining the
normal stop codon.
[0304] The amplification therefore leads to a EcoRI/HindIII
fragment containing an EcoRI site (underlined), an efficient
translation start sequence (bold) and the normal start codon of the
.alpha.HSP antibody gene (greyshade, see also FIG. 22).
[0305] The reverse 3' end primer was:
GACAAGCTTTACCCGGAGACAGGGAGAGGC providing a HindIII cloning site
(underlined) and removing the normal stop codon. This resulted in a
fragment (FIG. 22 left second from top) with an EcoRI site to clone
onto a promoter sequence and a HindIII site for cloning the 5' end
onto the expression plasmid and the 3' end onto a novel hinge
sequence (see below). Lastly the fragment was cut with EcoRI and
HindIII to provide the appropriate single stranded ends for
cloning.
[0306] The second cloned antibody bringing in the second
specificity comprised the VHH domain of a llama antibody against
the pig retrovirus (PERV) gag antigen (Dekker et al., (2003) J.
Virol., 77 (22): 12132-9, FIG. 22 top right). The .alpha.gag was
amplified via standard PCR amplification using the following
primers:
[0307] Forward:
##STR00002##
and the reverse primer GTCGAATTCTCATTCCGAGGAGACGGTGACCTGGGTC. This
provides the amplified fragment (FIG. 22 right second from top)
with a XhoI site (greyshade) to clone the 5' end in frame with the
novel hinge (see below) and an EcoRI site (underlined) for cloning
the 3' end into the expression plasmid (FIG. 22, right middle).
Lastly the fragment was cut with EcoRI and XhoI to generate single
stranded ends for cloning.
[0308] The two antibody sequences were combined into one diabody
sequence via the novel hinge. The novel hinge was generated from
two oligonucleotides that together form a double strand
oligonucleotide with 5' and 3' overhangs (respectively HindIII and
XhoI compatible) for cloning purposes. It was designed to be in
frame with the end of the .alpha.HSP70 sequence and the start of
the .alpha.gag sequence. Formation of the sulphide bridges normally
present in the human IgG2 hinge, was prevented by replacing the
cysteins (greyshade) with prolines (underlined). The prolines add
extra flexibility to the hinge to allow the proper functioning of
the second antibody domain that becomes connected to COOH terminus
of the first antibody via the hinge.
[0309] The normal IgG hinge sequence (cysteine codons in greyshade,
proline codons underlined)
##STR00003##
and its complement were replaced by
AGCTTCTGAGCGCAAACCACCAGTCGAGCCACCACCGCCACCAC and its complement
TCGAGTGGTGGCGGTGGTGGCTCGACTGGTGGTTTGCGCTCAGA). This also provided
the fragment (white box hinge, FIG. 22, center) with two single
strand ends compatible with HindIII (bold) and XhoI (italic) sites
for cloning purposes.
[0310] The three fragments (.alpha.HSP70 IgG2, hinge and
.alpha.gag) were subsequently ligated into a bluescript
(Pbluescript11 sk+) expression plasmid that contains a chicken
actin promoter and a CMV enhancer sequence (FIG. 22, expression
plasmid) by standard recombinant DNA technology. When this plasmid
is expressed (see below) it results in the diabody shown at the
bottom of FIG. 22.
[0311] The diabody expression plasmid was grown and cotransfected
with the plasmid pGK-hygro (to allow the selection of transfected
cells) by standard methods (Superfect) into CHO cells (FIG. 23).
Positive clones were selected in hygromycin containing medium and
positively identified as expressing the diabody by performing a
standard a gag ELISA (Dekker et al., J. Virol. 2003) of the growth
medium containing secreted diabody by the CHO cells using an
.alpha.human IgG-HRP detection. Positively testing for the
.alpha.-gag activity makes it most likely that a given clone
expresses the entire diabody, because the gag specificity is at the
back-end (COOH terminus) of the diabody. A subsequent ELISA for
HSP70 was also positive. Western blots of these ELISA selected
clones under non-reducing and reducing conditions were performed in
order to show that the protein expressed from the plasmid was a
dimer of 110 kD (as shown at the bottom of FIG. 23), compared to
the monomer of 55 kD (non reducing and reducing conditions and
Western blots, FIG. 23 right). Thus the ELISA and the Western blot
together show that the diabody is expressed and secreted into the
medium as a dimer by the transfected CHO cells (at >70 ng/ml)
and that the antibody can bind the HSP70 and gag antigens. However
it does not show that the same dimer diabody molecule can bind both
antigens at the same time.
[0312] Therefore, a follow-up experiment was carried out. First the
gag antigen was fixed to the bottom of a plastic well (first well
FIG. 24 center). The diabody (FIG. 24 top) was subsequently
captured by the first antigen (gag) after application of the CHO
cell supernatant of clone 1 (second well FIG. 24 center). This was
followed by extensive washing and then application of the second
antigen (HSP 70, FIG. 24 center third well), again followed by
extensive washing. If a diabody molecule could bind both antigens
at the same time, it should be captured to the bottom of the well
by binding the first antigen (gag) and then capture the second
antigen (HSP70). When the entire complex was subsequently eluted
form the well (FIG. 24 center, right well) both the diabody and the
antigens were visible on a Western blot (FIG. 24 bottom).
[0313] In order to collect the secreted diabody the CHO clones were
grown under the same standard conditions and in media (SIGMA
hybridoma medium, serum-free) used for the collection of antibodies
from hybridomas.
[0314] Methods: Wells of a Nunc-Immuno plate (Maxisorp) were coated
with purified recombinant gag protein (12.5 .mu.g/ul in PBS) O/N
4C. Blocked for two hrs with 1% milk/1% BSA in PBS. CHO-DB clone-1
medium 1/2 diluted in PBS-Milk-BSA (or controls) were incubated for
3 hrs at room temperature (RT). Bacterial B121 cell lysate
(containing HSP70 protein) 1/2 diluted in PBS-Milk-BSA was
incubated for 3 hrs at RT and washed. Bound proteins were eluted
with Laemmli sample buffer containing 2-Mercaptoethanol. The
samples were analysed by Western blot and therefore run on a 10%
SDS-PAGE and blotted on nitrocellulose membrane. The blot was
blocked for two hrs with PBS-Milk-BSA and incubated with primary
antibodies. The products were visualized by standard methods using
secondary antibodies coupled to enzymes that allow visual staining.
The reagent used were:
.alpha. Gag: Rabbit polyclonal (1:2000) 2 hrs RT .alpha. Diabody:
Goat a human IgG-HRP (1:2500) 2 hrs RT .alpha. HSP70: Monoclonal
G20-380 medium (1:2) 2 hrs RT.
[0315] Secondary antibodies were: Goat .alpha. Rabbit-AP (1:2000) 2
hrs RT and Goat .alpha. Human IgG-HRP (1:2500) 2 hrs RT against the
HSP70 monoclonal.
[0316] To visualize the protein bands first NBT/BCIP substrate
(purple) reacting with alkaline phosphatase (AP) and second DAB
substrate (brown) reacting with horseradish peroxidase (HRP) was
used.
[0317] All washing steps were done with PBS-0.05% Tween-20.
[0318] Controls were carried out by leaving out one of the
components or adding medium from CHO cells not producing diabodies
(FIG. 24), i.e; lacking no diabody application (medium from non
transfected CO cells) and has therefore only gag (lane 2); lacking
gag at the bottom of the well (replaced by milk protein) and should
therefore have none of the products (lane 3); lacking gag and
diabody and should have none of the products (lane 4); lacking
HSP70 antigen (replaced by milk antigen) and should therefore have
only the diabody and gag (lane 5); lacking HSP70 and diabody and
should have only gag (lane 6).
[0319] The fact that all three components (the diabody plus both
antigens) were only present in the well of lane 1 that received all
three components (see also legend bottom of FIG. 24) shows that the
single diabody binds both antigens at the same time.
Generation of Bispecific IgA or Multi-Specific IgM
[0320] The generation of bispecific IgA is essentially as described
for IgG (above), but using in addition to the Vhsol, D and J, the
constant region C.alpha. leading to the generation of IgA (FIG.
25).
[0321] The generation of IgM is largely similar, but offers an
additional possibility because IgM molecules can form large
multimers (with or without J chains). Thus in addition to molecules
similar to those described above (FIG. 26 right bottom, after
elimination of the multimerisation sequences), one can also
generate multimers simply by co-expressing IgM's with different
specificities (FIG. 26 left bottom).
Example 3
[0322] An expression vector encoding a polypeptide complex
comprising: a heavy chain including a binding domain which binds to
PSCA (prostate stem cell antigen), an assembly domain consisting
the leucine zipper motif of Jun and antibody hinge, CH2 and CH3
domains; and a light chain including a complementary assembly
domain consisting of the leucine zipper motif of Fos is constructed
using molecular biology techniques as described in Sambrook et al
((1989) Molecular Cloning--A Laboratory Manual, Cold Spring Harbor
Laboratory Press).
[0323] The expression vector is then transferred to a suitable host
cell by conventional techniques to produce a transfected host cell
for optimized expression of the vector. The transfected or
transformed host cell is then cultured using any suitable technique
known to these skilled in the art to produce the polypeptide
complex of the invention.
[0324] Once produced, the polypeptide complexes are purified by
standard procedures of the art, including cross-flow filtration,
ammonium sulphate precipitation and affinity column chromatography
(e.g., protein A).
[0325] The soluble effector domain consisting of
3,3'-diindolylmethane (DIM) is then fused to the complementary
assembly domain using techniques known to those skilled in the
art.
Example 4
[0326] An expression vector encoding the heavy chain of the
polypeptide complex of the present invention comprising; a soluble
VHH binding domain which binds to AFP (Alpha-Fetoprotein) and an
assembly domain consisting the leucine zipper motif of Jun, and
antibody hinge, CH2 and CH3 domains is constructed using molecular
biology techniques as described in Sambrook et al.
[0327] A second expression vector encoding the light chain of the
polypeptide complex of the present invention is also constructed.
This comprises a complementary assembly domain consisting of the
leucine zipper motif of Fos.
[0328] The expression vectors are then transferred to a suitable
host cell by conventional techniques to produce a co-transfected
host cell for optimized expression of the vector. The transfected
or transformed host cell is then cultured using any suitable
technique known to these skilled in the art to produce the
polypeptide complex of the invention.
[0329] Once produced, the polypeptide complexes are purified by
standard procedures of the art, including cross-flow filtration,
ammonium sulphate precipitation and affinity column chromatography
(e.g., protein A).
[0330] The soluble effector domain consisting of
3,3'-diindolylmethane (DIM) is then fused to the complementary
assembly domain using techniques known to those skilled in the
art.
Example 5
VCAM and VLA-4
[0331] An expression vector encoding a polypeptide complex
comprising: a heavy chain including a binding domain which binds to
PSCA (prostate stem cell antigen), an assembly domain consisting
VCAM and antibody hinge, CH2 and CH3 domains; and a light chain
including a complementary assembly domain consisting of VLA-4 fused
to ricin A toxin is constructed using molecular biology techniques
as described in Sambrook et al.
[0332] The expression vector is then transferred to a suitable host
cell by conventional techniques to produce a transfected host cell
for optimized expression of the vector. The transfected or
transformed host cell is then cultured using any suitable technique
known to these skilled in the art to produce the polypeptide
complex of the invention.
[0333] Once produced, the polypeptide complexes are purified by
standard procedures of the art, including cross-flow filtration,
ammonium sulphate precipitation and affinity column chromatography
(e.g., protein A).
Example 6
[0334] An expression vector encoding a polypeptide complex
comprising: a heavy chain including a binding domain which binds to
PSCA (prostate stem cell antigen), an assembly domain consisting
the leucine zipper motif of Jun and antibody hinge, CH2 and CH3
domains; and a light chain including a complementary assembly
domain consisting of the leucine zipper motif of Fos and a soluble
effector domain encoding purine nucleoside phosphorylase (PNP) is
constructed using molecular biology techniques as described in
Sambrook et al.
[0335] The expression vector is then transferred to a suitable host
cell by conventional techniques to produce a transfected host cell
for optimized expression of the vector. The transfected or
transformed host cell is then cultured using any suitable technique
known to these skilled in the art to produce the polypeptide
complex of the invention.
[0336] Once produced, the polypeptide complexes are purified by
standard procedures of the art, including cross-flow filtration,
ammonium sulphate precipitation and affinity column chromatography
(e.g., protein A).
[0337] PNP converts fludarabine to the toxic metabolite
2-fluoroadenine which kills the cells that comprise the PNP enzyme
and in addition diffuses to kill surrounding uninfected cells, a
local bystander effect.
Example 7
[0338] An expression vector encoding a first heavy chain of the
polypeptide complex of the present invention comprising; a soluble
VHH binding domain which binds to V3-PND region of glycoprotein
antigen gp120 and an assembly domain consisting the leucine zipper
motif of Jun and antibody hinge, CH2 and CH3 domains is constructed
using molecular biology techniques as described in Sambrook et
al.
[0339] A second expression vector encoding a second heavy chain of
the polypeptide complex of the present invention is also
constructed comprising: a soluble VHH binding domain which binds to
GP-41, an assembly domain consisting of the leucine zipper motif of
Jun and antibody hinge, CH2 and CH3 domains.
[0340] A third expression vector encoding the light chain of the
polypeptide complex of the present invention is also constructed.
This comprises a complementary assembly domain consisting of the
leucine zipper motif of Fos.
[0341] The expression vectors are then transferred to a suitable
host cell by conventional techniques to produce a co-transfected
host cell for optimized expression of the vector. The transfected
or transformed host cell is then cultured using any suitable
technique known to these skilled in the art to produce the
polypeptide complex of the invention.
[0342] Once produced, the polypeptide complexes are purified by
standard procedures of the art, including cross-flow filtration,
ammonium sulphate precipitation and affinity column chromatography
(e.g., protein A).
[0343] The soluble effector domain consisting of HIV-1 MN V3 (PND)
peptide immunogen is then fused to the complementary assembly
domain using techniques known to those skilled in the art.
Example 8
[0344] An expression vector encoding a first heavy chain of the
polypeptide complex of the present invention comprising: a soluble
VHH binding domain which binds to V3-PND region of glycoprotein
antigen constructed using molecular biology techniques as described
in Sambrook et al ((1989) Molecular Cloning--A Laboratory Manual,
Cold Spring Harbor Laboratory Press).
[0345] A second expression vector encoding a second heavy chain of
the polypeptide complex of the present invention is also
constructed comprising: a soluble VHH binding domain which binds to
GP-41.
[0346] The two heavy chains are characterised in that the constant
regions for the two heavy chains comprise identical .mu., CH2, CH3
and CH4 domains.
[0347] The expression vectors are then transferred a host cell
which constitutively expresses a J chain by conventional techniques
to produce a co-transfected host cell for optimized expression of
the vector. The transfected or transformed host cell is then
cultured using any suitable technique known to these skilled in the
art to produce the polypeptide complex of the invention.
[0348] Once produced, the polypeptide complexes are purified by
standard procedures of the art, including cross-flow filtration,
ammonium sulphate precipitation and affinity column chromatography
(e.g., protein A).
[0349] The soluble effector domain consisting of HIV-1 MN V3 (PND)
peptide immunogen is then fused to the complementary assembly
domain using techniques known to those skilled in the art.
[0350] All publications mentioned in the above specification are
herein incorporated by reference.
[0351] Various modifications and variations of the described
methods and system of the present invention will be apparent to
those skilled in the art without departing from the scope and
spirit of the present invention. Although the present invention has
been described in connection with specific preferred embodiments,
it should be understood that the invention as claimed should not be
unduly limited to such specific embodiments. Indeed, various
modifications of the described modes for carrying out the invention
which are obvious to those skilled in biochemistry, molecular
biology and biotechnology or related fields are intended to be
within the scope of the following claims.
Sequence CWU 1
1
35139DNAArtificial SequencePCR primer 1aatctgggca gcggccgcct
cgacacaaca tttgcgctc 392318DNAHomo sapiens 2agactctcct gtgcagcctc
tggaagcatc ttcagtatca atgccatggg ctggtaccgc 60caggctccag ggaagcagcg
cgagttggtc gcagctatta ctagtggtgg tagcacaagg 120tatgcagact
ccgtgaaggg ccgattcacc atctccagag acaacgccaa gaacacggtg
180tatctgcaaa tgaacagcct gaaacctgag gacacggccg tctattactg
tttgatctct 240atggttcggg gagcccgttt tgactactgg ggccagggaa
ccctggtcac cgtctcctca 300gagctcaaaa ccccactt 3183106PRTHomo sapiens
3Arg Leu Ser Cys Ala Ala Ser Gly Ser Ile Phe Ser Ile Asn Ala Met1 5
10 15Gly Trp Tyr Arg Gln Ala Pro Gly Lys Gln Arg Glu Leu Val Ala
Ala 20 25 30Ile Thr Ser Gly Gly Ser Thr Arg Tyr Ala Asp Ser Val Lys
Gly Arg 35 40 45Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Val Tyr
Leu Gln Met 50 55 60Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr
Cys Leu Ile Ser65 70 75 80Met Val Arg Gly Ala Arg Phe Asp Tyr Trp
Gly Gln Gly Thr Leu Val 85 90 95Thr Val Ser Ser Glu Leu Lys Thr Pro
Leu 100 105433DNAArtificial SequencePCR primer 4ctggaattct
caaccatgga gctggggctg agc 33530DNAArtificial SequencePCR primer
5gacaagcttt acccggagac agggagaggc 30630DNAArtificial SequencePCR
primer 6gacaagcttt acccggagac agggagaggc 30734DNAArtificial
SequencePCR primer 7gtcctcgagg cccaggtcca actgcaggag tctg
34837DNAArtificial SequencePCR primer 8gtcgaattct cattccgagg
agacggtgac ctgggtc 37936DNAHomo sapiens 9gagcgcaaat gttgtgtcga
gtgcccaccg tgccca 361044DNAHomo sapiens 10agcttctgag cgcaaaccac
cagtcgagcc accaccgcca ccac 441144DNAHomo sapiens 11tcgagtggtg
gcggtggtgg ctcgactggt ggtttgcgct caga 4412404DNAHomo sapiens
12gacacggccg tgtagtatct gtaaggcaga tggggtagta ctatggttcg gggagtccac
60cactgcggct agaggggcca gggaacactg gtcgcggtgt catcagcctc caccaagggc
120ccatcggtct tccccctggc gccctgctcc aggagcacct ccgagagcac
agcggccctg 180ggctgcctgg tcaaggacta cttccccgaa ccggtgacgg
tgtcgtggaa ctcaggcgct 240ctgaccagcg gcgtgcacac cttcccagct
gtcctacagt cctcaggact ctactccctc 300agcagcgtgg tgaccgtgcc
ctccagcaac ttcggcaccc agacctacac ctgcaacgta 360gatcacaagc
ccagcaacac caagagcgca aatgttgtgt cgag 40413352DNAHomo sapiens
13gacattccca cttcgatctc tggggccgtg gcaccctggt cactgtctcc tcagcctcca
60ccaagggccc atcggtcttc cccctggcgc cctgctccag gagcacctcc gagagcacag
120cggccctggg ctgcctggtc aaggactact tccccgaacc ggtgacggtg
tcgtggaact 180caggcgctct gaccagcggc gtgcacacct tcccagctgt
cctacagtcc tcaggactct 240actccctcag cagcgtggtg accgtgccct
ccagcaactt cggcacccag acctacacct 300gcaacgtaga tcacaagccc
agcaacacca agagcgcaaa tgttgtgtcg ag 35214394DNAHomo sapiens
14gacacggccg tctattactg taatgccact acgatatttt gactggttat tatagacgct
60actggggcca gggaaccctg gtcaccgtct cctcagcctc cgccaagggc ccatcggtct
120tccccctggc gccctgctcc aggagcacct ccgagagcac agcggccctg
ggctgcctgg 180tcaaggacta cttccccgaa ccggtgacgg tgtcgtggaa
ctcaggcgct ctgaccagcg 240gcgtgcacac cttcccagct gtcctacagt
cctcaggact ctactccctc agcagcgtgg 300tgaccgtgcc ctccagcaac
ttcggcaccc agacctacac ctgcaacgta gatcacaagc 360ccagcaacac
caagagcgca aatgttgtgt cgag 39415380DNAHomo sapiens 15gacacggccg
tccaatcgga tacagctatg gttacgtact ttgactactg gggccaggga 60accctggtca
ccgtctcctc agcctccacc aagggcccat cggtcttccc cctggcgccc
120tgctccagga gcacctccga gagcacagcg gccctgggct gcctggtcaa
ggactacttc 180cccgaaccgg tgacggtgtc gtggaactca ggcgctctga
ccagcggcgt gcacaccttc 240ccagctgtcc tacagtcctc aggactctac
tccctcagca gcgtggtgac cgtgccctcc 300agcaacttcg gcacccagac
ctacacctgc aacgtagatc acaagcccag caacaccaag 360agcgcaaatg
ttgtgtcgag 38016417DNAHomo sapiens 16gacacggccg tctattactg
taatgcagat gtattactat ggttcgggga gcctatagcc 60ttactactac tacggtatgg
acgtctgggg ccaagggacc acggtcaccg tctcctcagc 120ctccaccaag
ggcccatcgg tcttccccct ggcgccctgc tccaggagca cctccgagag
180cacagcggcc ctgggctgcc tggtcaagga ctacttcccc gaaccggtga
cggtgtcgtg 240gaactcaggc gctctgacca gcggcgtgca caccttccca
gctgtcctac agtcctcagg 300actctactcc ctcagcagcg tggtgaccgt
gccctccagc aacttcggca cccagaccta 360cacctgcaac gtagatcaca
agcccagcaa caccaagagc gcaaatgttg tgtcgag 41717108PRTHomo sapiens
17Arg Leu Ser Cys Ala Ala Ser Gly Ser Ile Phe Ser Ile Asn Ala Met1
5 10 15Gly Trp Tyr Arg Gln Ala Pro Gly Lys Gln Arg Glu Leu Val Ala
Ala 20 25 30Ile Thr Ser Gly Gly Ser Thr Asn Tyr Ala Asp Ser Val Lys
Gly Arg 35 40 45Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Val Tyr
Leu Gln Met 50 55 60Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr
Cys Asn Ala Lys65 70 75 80Gly Pro Ile Thr His Val Arg Gly Val His
Tyr Trp Gly Gln Gly Thr 85 90 95Leu Val Thr Val Ser Ser Glu Arg Lys
Cys Cys Val 100 10518108PRTHomo sapiens 18Arg Leu Ser Cys Ala Ala
Ser Gly Ser Ile Phe Ser Ile Asn Ala Met1 5 10 15Gly Trp Tyr Arg Gln
Ala Pro Gly Lys Gln Arg Glu Leu Val Ala Ala 20 25 30Ile Thr Ser Gly
Gly Ser Thr Asn Tyr Ala Asp Ser Val Lys Gly Arg 35 40 45Phe Thr Ile
Ser Arg Asp Asn Ala Lys Asn Thr Val Tyr Leu Gln Met 50 55 60Asn Ser
Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys Asn Ala Lys65 70 75
80Thr Pro Ile Thr His Ile Arg Gly Val His His Trp Gly Gln Gly Thr
85 90 95Leu Val Thr Val Ser Ser Glu Arg Lys Cys Cys Val 100
10519108PRTHomo sapiens 19Arg Leu Ser Cys Ala Ala Ser Gly Ser Ile
Phe Ser Ile Asn Ala Met1 5 10 15Gly Trp Tyr Arg Gln Ala Pro Gly Lys
Gln Arg Glu Leu Val Ala Ala 20 25 30Ile Thr Ser Gly Gly Ser Thr Asn
Tyr Ala Asp Ser Val Lys Gly Arg 35 40 45Phe Thr Ile Ser Arg Asp Asn
Ala Lys Asn Thr Val Tyr Leu Gln Met 50 55 60Asn Ser Leu Lys Pro Glu
Asp Thr Ala Val Tyr Tyr Cys Asn Ala Arg65 70 75 80Thr Pro Ile Thr
Val Val Arg Gly Val His Tyr Trp Gly Gln Gly Thr 85 90 95Leu Val Thr
Val Ser Ser Glu Arg Lys Cys Cys Val 100 10520108PRTHomo sapiens
20Arg Leu Ser Cys Ala Ala Ser Gly Ser Ile Phe Ser Ile Asn Ala Met1
5 10 15Gly Trp Tyr Arg Gln Ala Pro Gly Lys Gln Arg Glu Leu Val Ala
Ala 20 25 30Ile Thr Ser Gly Gly Ser Thr Asn Tyr Ala Asp Ser Val Lys
Gly Arg 35 40 45Phe Thr Ile Ser Arg Asp Lys Ala Lys Asn Thr Val Tyr
Leu Gln Met 50 55 60Asn Ser Leu Lys Pro Glu Asp Ser Ala Val Tyr Tyr
Cys Asn Arg Thr65 70 75 80Gly Pro Ile Thr His Val Arg Gly Val Asp
Tyr Trp Gly Arg Gly Thr 85 90 95Leu Val Thr Val Ser Ser Glu Arg Lys
Cys Cys Val 100 10521108PRTHomo sapiens 21Arg Leu Ser Cys Ala Ala
Ser Gly Ser Ile Phe Ser Ile Asn Ala Met1 5 10 15Gly Trp Tyr Arg Gln
Ala Pro Gly Lys Gln Arg Glu Leu Val Ala Ala 20 25 30Ile Thr Ser Gly
Gly Ser Thr Asn His Ala Asp Ser Val Lys Gly Arg 35 40 45Phe Thr Ile
Ser Arg Asp Asn Ala Lys Asn Thr Val Tyr Leu Gln Met 50 55 60Asn Ser
Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys Asn Ala Glu65 70 75
80Ser Pro Ile Thr Lys Val Arg Gly Val Ser Tyr Trp Gly Gln Gly Thr
85 90 95Leu Val Thr Val Ser Ser Glu Arg Lys Cys Cys Val 100
1052259PRTHomo sapiens 22Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr
Leu Asp Tyr Tyr Ala Ile1 5 10 15Gly Trp Phe Arg Gln Ala Glu Gly Lys
Glu Arg Glu Gly Val Ser Cys20 25 30Ile Ser Ser Ser Asp Gly Ser Thr
Tyr Tyr Ala Asp Ser Val Lys Gly35 40 45Arg Phe Thr Ile Ser Arg Asp
Asn Ala Lys Asn50 552359PRTHomo sapiens 23Arg Leu Ser Cys Ala Ala
Ser Gly Phe Thr Leu Asp Tyr Tyr Ala Ile1 5 10 15Gly Trp Phe Arg Gln
Ala Glu Gly Lys Glu Arg Glu Gly Val Ser Cys 20 25 30Ile Ser Ser Ser
Asp Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys Gly 35 40 45Arg Phe Thr
Ile Ser Arg Asp Asn Ala Lys Asn 50 552459PRTHomo sapiens 24Arg Leu
Ser Cys Ala Ala Ser Gly Phe Thr Leu Asp Tyr Tyr Val Ile1 5 10 15Gly
Trp Phe Arg Gln Ala Glu Gly Lys Glu Arg Glu Gly Val Ser Cys 20 25
30Ile Ser Ser Ser Asp Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys Gly
35 40 45Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn 50
552559PRTHomo sapiens 25Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Leu
Asp Tyr Tyr Ala Ile1 5 10 15Gly Trp Phe Arg Gln Ala Glu Gly Lys Glu
Arg Glu Gly Val Ser Cys 20 25 30Ile Ser Ser Ser Asp Gly Ser Thr Tyr
Tyr Gly Asp Ser Val Lys Gly 35 40 45Arg Phe Thr Ile Ser Arg Asp Lys
Ala Lys Asn 50 552658PRTHomo sapiens 26Arg Leu Ser Cys Ala Ala Ser
Gly Ser Ile Phe Ser Ile Asn Ala Met1 5 10 15Gly Trp Tyr Arg Gln Ala
Pro Gly Lys Gln Arg Glu Leu Val Ala Ala 20 25 30Ile Thr Ser Gly Gly
Ser Thr Asn Tyr Ala Asp Ser Val Lys Gly Arg 35 40 45Phe Thr Ile Ser
Arg Asp Asn Ala Lys Asn 50 552758PRTHomo sapiens 27Arg Leu Ser Cys
Ala Ala Ser Gly Ser Ile Phe Ser Ile Asn Ala Met1 5 10 15Gly Trp Tyr
Arg Gln Ala Pro Gly Lys Gln Arg Glu Leu Val Ala Ala 20 25 30Ile Thr
Ser Gly Gly Ser Thr Lys Tyr Ala Asp Ser Val Lys Gly Arg 35 40 45Phe
Thr Ile Ser Arg Asp Asn Ala Lys Asn 50 552858PRTHomo sapiens 28Arg
Leu Ser Cys Ala Ala Ser Gly Ser Ile Phe Ser Ile Asn Val Met1 5 10
15Gly Trp Tyr Arg Gln Pro Pro Gly Lys Gln Arg Glu Leu Val Ala Gly
20 25 30Val Thr Ser Gly Gly Ser Thr Ser Tyr Ala Asp Ser Val Lys Gly
Arg 35 40 45Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn 50
552958PRTHomo sapiens 29Arg Leu Ser Cys Ala Ala Ser Gly Ser Ile Phe
Ser Ile Asn Ala Met1 5 10 15Gly Trp Tyr Arg Gln Ala Pro Gly Lys Gln
Arg Glu Leu Val Ala Pro 20 25 30Ile Thr Ser Gly Gly Ser Thr Asn Tyr
Ala Asp Ser Val Lys Gly Arg 35 40 45Phe Thr Ile Ser Arg Asp Asn Ala
Lys Asn 50 553078PRTHomo sapiens 30Arg Leu Ser Cys Ala Ala Ser Gly
Ser Ile Phe Ser Ile Asn Ala Met1 5 10 15Gly Trp Tyr Arg Gln Ala Pro
Gly Lys Gln Arg Glu Leu Val Ala Ala 20 25 30Ile Thr Ser Gly Gly Ser
Thr Asn Tyr Ala Asp Ser Val Lys Gly Arg 35 40 45Phe Thr Ile Ser Arg
Asp Asn Ala Lys Asn Thr Val Tyr Leu Gln Met 50 55 60Asn Ser Leu Lys
Pro Glu Asp Thr Ala Val Tyr Tyr Cys Asn65 70 7531105PRTHomo sapiens
31Arg Leu Ser Cys Ala Ala Ser Gly Ser Ile Phe Ser Ile Asn Ala Met1
5 10 15Gly Trp Tyr Arg Gln Ala Pro Gly Lys Gln Arg Glu Leu Val Ala
Ala 20 25 30Ile Thr Ser Gly Gly Ser Thr Asn Tyr Ala Asp Ser Val Lys
Gly Arg 35 40 45Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Val Tyr
Leu Gln Met 50 55 60Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr
Cys Asn Ala Glu65 70 75 80Arg Ala Gly Asp Pro Phe Asp Tyr Trp Gly
Gln Gly Thr Leu Val Thr 85 90 95Val Ser Ser Glu Arg Lys Cys Cys Val
100 10532108PRTHomo sapiens 32Arg Leu Ser Cys Ala Ala Ser Gly Ser
Ile Phe Ser Ile Asn Ala Met1 5 10 15Gly Trp Tyr Arg Gln Ala Pro Gly
Lys Gln Arg Glu Leu Val Ala Ala 20 25 30Ile Thr Ser Gly Gly Ser Thr
Asn Tyr Ala Asp Ser Val Lys Gly Arg 35 40 45Phe Thr Ile Ser Arg Asp
Asn Ala Lys Asn Thr Val Tyr Leu Gln Met 50 55 60Asn Ser Leu Lys Pro
Glu Asp Thr Ala Val Tyr Tyr Cys Gly Val Leu65 70 75 80Trp Phe Gly
Glu Leu Ser Asp Trp Phe Asp Tyr Trp Gly Gln Gly Thr 85 90 95Leu Val
Thr Val Ser Ser Glu Arg Lys Cys Cys Val 100 10533108PRTHomo sapiens
33Arg Leu Ser Cys Ala Ala Ser Gly Ser Ile Phe Ser Ile Asn Ala Met1
5 10 15Gly Trp Tyr Arg Gln Ala Pro Gly Lys Gln Arg Glu Leu Val Ala
Ala 20 25 30Ile Thr Ser Gly Gly Ser Thr Asn Tyr Ala Asp Ser Val Lys
Gly Arg 35 40 45Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Val Tyr
Leu Gln Met 50 55 60Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr
Cys Asn Ala Asp65 70 75 80Cys Trp Gly Ser Arg Trp Tyr Phe Asp His
Tyr Trp Gly Arg Gly Thr 85 90 95Leu Val Thr Val Ser Ser Glu Arg Lys
Cys Cys Val 100 10534111PRTHomo sapiens 34Arg Leu Ser Cys Ala Ala
Ser Gly Ser Ile Phe Ser Ile Asn Ala Met1 5 10 15Gly Trp Tyr Arg Gln
Ala Pro Gly Lys Gln Arg Glu Leu Val Ala Ala 20 25 30Ile Thr Ser Gly
Gly Ser Thr Asn Tyr Ala Asp Ser Val Lys Gly Arg 35 40 45Phe Thr Ile
Ser Arg Asp Asn Ala Lys Asn Thr Val Tyr Leu Gln Met 50 55 60Asn Ser
Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys Asn Ala Asp65 70 75
80Thr Ser Pro Pro Arg Tyr Phe Asp Trp Leu Pro Phe Asp Tyr Trp Gly
85 90 95Gln Gly Thr Leu Val Thr Val Ser Ser Glu Arg Lys Cys Cys Val
100 105 11035112PRTHomo sapiens 35Arg Leu Ser Cys Ala Ala Ser Gly
Ser Ile Phe Ser Ser Asn Ala Met1 5 10 15Gly Trp Ser Arg Gln Ala Pro
Gly Lys Gln Arg Glu Leu Val Ala Ala 20 25 30Ile Thr Ser Gly Gly Ser
Thr Asn Tyr Ala Asp Ser Val Lys Gly Arg 35 40 45Phe Thr Ile Ser Arg
Asp Asn Ala Lys Asn Thr Val His Leu Gln Met 50 55 60Asn Ser Leu Lys
Pro Glu Asp Thr Ala Val Tyr Tyr Cys Asn Ala Gly65 70 75 80Asn Thr
Met Val Arg Gly Val Ile Ile Lys Tyr Arg Phe Asp Tyr Trp 85 90 95Gly
Gln Gly Thr Leu Val Thr Val Ser Ser Glu Arg Lys Cys Cys Val 100 105
110
* * * * *