U.S. patent application number 12/287274 was filed with the patent office on 2009-11-12 for antisense oligonucleotide against human acetylcholinesterase (ache) and uses thereof.
This patent application is currently assigned to Yissum Research Development Company of the Hebrew University. Invention is credited to Tama Evron, Jackiline Saidman, Shlomo Saidman, Hermona Soreq.
Application Number | 20090281165 12/287274 |
Document ID | / |
Family ID | 11075445 |
Filed Date | 2009-11-12 |
United States Patent
Application |
20090281165 |
Kind Code |
A1 |
Soreq; Hermona ; et
al. |
November 12, 2009 |
Antisense oligonucleotide against human acetylcholinesterase (AChE)
and uses thereof
Abstract
The invention relates to an antisense oligonucleotide targeted
to the coding region of the human acetylcholinesterase (AChE),
which selectively suppresses the AChE-R isoform of the enzyme. The
antisense oligonucleotide is intended for use in the treatment
and/or prevention of neuromuscular disorders, preferably myasthenia
gravis. In addition, it can penetrate the blood-brain barrier (BBB)
and destroy AChE-R within central nervous system neurons, while
also serving as a carrier to transport molecules across the
BBB.
Inventors: |
Soreq; Hermona; (Jerusalem,
IL) ; Saidman; Shlomo; (Gush Etzion, IL) ;
Saidman; Jackiline; (Gush Etzion, IL) ; Evron;
Tama; (Mevasseret Zion, IL) |
Correspondence
Address: |
John P. White;Cooper & Dunham LLP
1185 Avenue of the Americas
New York
NY
10036
US
|
Assignee: |
Yissum Research Development Company
of the Hebrew University
|
Family ID: |
11075445 |
Appl. No.: |
12/287274 |
Filed: |
October 7, 2008 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11346145 |
Feb 1, 2006 |
7456154 |
|
|
12287274 |
|
|
|
|
10402016 |
Mar 27, 2003 |
7074915 |
|
|
11346145 |
|
|
|
|
PCT/IL02/00411 |
May 23, 2002 |
|
|
|
10402016 |
|
|
|
|
Current U.S.
Class: |
514/44A ;
536/24.5 |
Current CPC
Class: |
A61P 21/04 20180101;
C12N 2310/53 20130101; C12N 2310/321 20130101; A61P 21/00 20180101;
C12N 2310/315 20130101; A61P 21/02 20180101; A61P 25/00 20180101;
C12Y 301/01007 20130101; C12N 15/1137 20130101; A61K 38/00
20130101; C12N 2310/321 20130101; C12N 2310/3521 20130101 |
Class at
Publication: |
514/44.A ;
536/24.5 |
International
Class: |
A61K 31/7088 20060101
A61K031/7088; C07H 21/04 20060101 C07H021/04; A61P 21/00 20060101
A61P021/00; A61P 21/04 20060101 A61P021/04; A61P 25/00 20060101
A61P025/00 |
Foreign Application Data
Date |
Code |
Application Number |
May 24, 2001 |
IL |
143379 |
Claims
1. A synthetic antisense oligodeoxynucleotide targeted against
human AChE mRNA having the nucleotide sequence: TABLE-US-00005 5'
CTGCCACGTTCTCCTGCACC 3'. (SEQ ID NO: 1)
2. A synthetic nuclease resistant antisense oligodeoxynucleotide
having the nucleotide sequence: TABLE-US-00006 5'
CTGCCACGTTCTCCTGCACC 3'. (SEQ ID NO: 1)
3. A synthetic antisense oligodeoxynucleotide of claim 2, which is
a modified oligodeoxynucleotide comprising partially unsaturated
aliphatic hydrocarbon chain and one or more polar or charged groups
including carboxylic acid groups, ester groups, and alcohol
groups.
4. A synthetic nuclease resistant antisense oligodeoxynucleotide of
claim 2 or 3, wherein at least one of the three 3'-terminus
nucleotides is 2'-O-methylated.
5. A synthetic nuclease resistant antisense oligodeoxynucleotide of
claim 4, in which the last three 3'-terminus nucleotides are
2'-O-methylated.
6. A synthetic nuclease resistant antisense oligodeoxynucleotide of
claim 2, wherein at least one nucleotide is fluoridated.
7. A synthetic nuclease resistant antisense oligodeoxynucleotide of
claim 2 or claim 3, having phosphorothioate bonds linking between
at least two of the last 3'-terminus nucleotide bases.
8. A synthetic nuclease resistant antisense oligodeoxynucleotide of
claim 7, having phosphorothioate bonds linking between the last
four 3'-terminus nucleotide bases.
9. A synthetic nuclease resistant antisense oligodeoxynucleotide of
claim 3, having a nucleotide loop forming sequence at the
3'-terminus.
10. A synthetic nuclease resistant antisense oligodeoxynucleotide
of claim 9, wherein said loop is a 9-nucleotide loop having the
nucleotide sequence CGCGAAGCG (SEQ ID NO:2).
11. A synthetic nuclease resistant antisense oligodeoxynucleotide
of any one of claims 1 to 10, capable of selectively modulating
human AChE production.
12. A synthetic nuclease resistant antisense oligodeoxynucleotide
of claim 11, capable of selectively modulating human AChE
production in the central nervous system.
13. A pharmaceutical composition comprising the antisense
oligonucleotide hEN101, defined by SEQ ID NO:1.
14. The pharmaceutical composition of claim 13, for the treatment
and/or prevention of a progressive neuromuscular disorder, for
improving stamina and/or for use in chronic muscle fatigue.
15. The pharmaceutical composition of claim 13 for use in treating
or preventing a progressive neuromuscular disorder, wherein said
disorder is selected from myasthenia gravis, Eaton-Lambert disease,
muscular dystrophy, amyotrophic lateral sclerosis, post-traumatic
stress disorder (PTSD), multiple sclerosis, dystonia, post-stroke
sclerosis, post-injury muscle damage, excessive re-innervation,
post-surgery paralysis of unknown origin, and post-exposure to AChE
inhibitors.
16. The pharmaceutical composition of claim 13, for the treatment
and/or prevention of myasthenia gravis.
17. The pharmaceutical composition of claim 13, for use in treating
or preventing a progressive neuromuscular disorder, wherein said
disorder is associated with an excess of AChE mRNA or protein.
18. The pharmaceutical composition of claim 13, for use in treating
or preventing a progressive neuromuscular disorder, wherein said
disorder is associated with an excess of AChE-R mRNA.
19. The pharmaceutical composition of claim 13, for use in treating
or preventing a progressive neuromuscular disorder, wherein said
disorder is associated with impairment of cholinergic
transmission.
20. The pharmaceutical composition of claim 13, for use in treating
or preventing a progressive neuromuscular disorder, wherein said
disorder involves muscle distortion, muscle re-innervation or
neuro-muscular junction (NMJ) abnormalities.
21. The pharmaceutical composition of any one of claims 13-20,
which is for daily use by a patient of a dosage of active
ingredient between about 0.001 .mu.g/g and about 50 .mu.g/g.
22. The pharmaceutical composition of anyone of claims 13-20,
wherein the treatment and/or prevention comprises administering a
dosage of active ingredient of about 0.01 to about 5.0 .mu.g/g.
23. The pharmaceutical composition of any one of claims 13-20,
wherein the treatment and/or prevention comprises administering a
dosage of active ingredient of about 0.15 to about 0.50% g/g.
24. The pharmaceutical composition of claim 13, optionally
comprising at least one additional active agent.
25. A pharmaceutical composition comprising an antisense
oligodeoxynucleotide as denoted by SEQ ID NO:1, for facilitating
passage of compounds through the BBB, optionally further comprising
additional pharmaceutically active agent to be transported through
the BBB, and/or pharmaceutically acceptable adjuvant, carrier or
diluent.
26. The pharmaceutical composition of claim 25, wherein said
additional pharmaceutically active agent is selected from any one
of contrast agents used for central nervous system imaging, agents
that function to block the effects of abused drugs, antibiotics,
chemotherapeutic drugs and vectors to be used in gene therapy.
27. A method of preparation of a pharmaceutical composition
comprising the step of admixing the antisense oligonucleotide
hEN101, defined by SEQ ID NO:1, with a pharmaceutically acceptable
adjuvant, carrier or diluent, and optionally with at least one
additional active agent.
28. The method of claim 27, wherein said composition is intended
for the treatment and/or prevention of a progressive neuromuscular
disorder, for improving stamina and/or for use in chronic muscle
fatigue.
Description
FIELD OF THE INVENTION
[0001] The present invention relates to a synthetic antisense
oligodeoxynucleotide targeted to the common coding domain of human
acetylcholinesterase (AChE) mRNA, and to pharmaceutical or medical
compositions comprising the same, particularly for the treatment
and/or prevention of a progressive neuromuscular disorder.
BACKGROUND OF THE INVENTION
[0002] All publications mentioned throughout this application are
fully incorporated herein by reference, including all references
cited therein.
[0003] Neuromuscular junctions (NMJ) are highly specialized,
morphologically distinct, and well-characterized cholinergic
synapses [Hall and Sanes (1993) Cell 72 Suppl., 99-121]. Chronic
impairments in NMJ activity induce neuromuscular disorders
characterized by progressive deterioration of muscle structure and
function. The molecular and cellular mechanisms leading from
compromised NMJ activity to muscle wasting have not been
elucidated.
[0004] One such disorder is myasthenia gravis (MG), caused by a
defect in neuromuscular transmission mediated by auto-antibodies
that severely reduce the number of functional post-synaptic muscle
nicotinic acetylcholine receptors (nAChR) [Drachman D. G. (1994) N.
Engl. J. Med. 330, 1797-1810; Vincent A. (1999) Curr. Opin. Neurol.
12, 545-551]. MG is characterized by fluctuating muscle weakness
that may be transiently improved by inhibitors of
acetylcholinesterase (AChE) [Penn A. S. and Rowland L. P. (1995)
Myasthenia Gravis In: Meritt's Textbook of Neurology, 9.sup.th
Edition, Williams and Wilkins, Baltimore, section XVII, 754-761].
The characteristic electrodiagnostic abnormality is a progressive,
rapid, decline in the amplitude of compound muscle action
potentials (CMAP) evoked by repetitive nerve stimulation at 3 or 5
Hz. To date, the standard treatment for MG includes
immunosuppressive therapy combined with chronic administration of
multiple daily doses of peripheral AChE inhibitors such as
pyridostigmine (Mestinon.TM.). While AChE inhibitors effectively
restore muscle performance in MG patients, their effects are
short-lived, calling for the development of additional effective
treatment.
[0005] Antisense technology offers an attractive, gene-based
alternative to conventional anti-cholinesterase therapeutics.
Antisense technology exploits the rules of Watson-Crick base
pairing to design short oligonucleotides, 15-25 residues in length,
whose sequence is complementary to that of a target mRNA [Agrawal
S, and Kandimalla E. R. (2000) Mol. Med. Today, 6, 72-81].
Stretches of double-stranded RNA, resulting from hybridization of
the antisense oligonucleotide (ASON) with its target, activate
RNAse H [Crooke S. T. (2000) Methods Enzymol. 313, 3-45] and
promote specific degradation of the duplex mRNA. As antisense
therapeutics target RNA rather than proteins, they offer the
potential to design highly specific drugs with effective
concentrations in the nanomolar range [Galyam N. et al. (2001)
Antisense Nucleic Acid Drug Dev. 11, 51-57]. Phosphorothioated and
3' terminally protected 2'-O-methyl antisense oligonucleotides
targeted to mouse AChE mRNA were shown to be effective in blocking
AChE expression in vitro in cultured human and rodent cells
[Koenigsberger C. et al. (1997) J. Neurochem. 69, 1389-1397; WO
98/26062; Grisaru D. et al. (2001) Mol. Med. 7, 93-105], and in
vivo in brain [Shohami E. et al. (2000) J. Mol. Med. 78, 278-236;
Cohen et al. (2002) Molecular Psychiatry, in press], muscle
[Lev-Lehman E. et al. (2000) J. Mol. Neurosci. 14, 93-105] and bone
marrow [Grisaru et al. (2001) ibid.].
[0006] The inventors have recently observed that treatment with the
irreversible cholinesterase inhibitor diisopropylfluorophosphonate
(DFP) induces overexpression of an otherwise rare, non-synaptic
alternative splicing variant of AChE, AChE-R, in brain [Kaufer D.
et al. (1998) Nature, 393, 373-377] and intestine [Shapira M. et
al. (2000) Hum. Mol. Genet. 9, 1273-1282]. Muscles from animals
treated with DFP also overexpressed AChE-R, accompanied by
exaggerated neurite branching, disorganized wasting fibers and
proliferation of NMJs. Partially protected 2'-O-methyl antisense
oligonucleotides targeted to mouse AChE mRNA suppressed feedback
upregulation of AChE and ameliorated DFP-induced NMJ proliferation
[Lev-Lehman et al. (2000) ibid.]. These observations demonstrated
that cholinergic stress elicits overexpression of AChE-R in muscle
and that antisense oligonucleotides can suppress such AChE-R excess
and prevent its deleterious outcome.
[0007] As mentioned above, the characteristic electrodiagnostic
abnormality is a progressive, rapid decline in the amplitude of
muscle action potentials evoked by repetitive nerve stimulation at
3 or 5 Hz. This myasthenic fatigue is caused by decrease in the
number of AChR molecules available at the post-synaptic site.
Inhibiting anti-AChR antibodies are present in 85% to 90% of
patients [Vincent, A. (1999) id ibid].
[0008] Patients with MG, but not with congenital myasthenias due to
other causes [Triggs et al. (1992) Muscle Nerve 15, 267-72],
display a transient clinical response to AChE inhibitors such as
edrophonium. The available anti-AChE drugs are the first line of
treatment, but most patients require further help. This includes
drastic measures, such as plasma exchange, thymectomy and
immunosuppression. Unfortunately, all of the currently employed MG
drug regimens. are associated with deleterious long-term
consequences. These include disturbance of neuromuscular
transmission, exacerbation and induction of MG symptoms. Also, the
otherwise safe use of common drugs such as anti-infectives,
cardiovascular drugs, anticholinergics, anticonvulsants,
antirheumatics and others has been reported to worsen the symptoms
of MG patients [Wittbrodt (1997) Arch. Intern. Med., 157,
399-408].
[0009] While the neuromuscular malfunctioning associated with MG
can be transiently alleviated by systemic chronic administration of
carbamate acetylcholinesterase (AChE) inhibitors (e.g.
pyridostigmine), the inventors have found that pyridostigmine
induces a feedback response leading to excess AChE accumulation
[Friedman et al. (1996) Nature Medicine 2, 1382-1385; Kaufer et al.
(1998) id ibid; Meshorer, E. et al. (2002) Science 295, 508-12].
This suggested that the chronic use of such inhibitors would modify
the cholinergic balance in the patients' neuromuscular system and
would require increased doses of these drugs; it also provided an
explanation of the highly variable dose regimen employed in MG
patients; and it called for the development of an alternative
approach to suppress acetylcholine hydrolysis.
[0010] AChE-encoding RNA is subject to 3' alternative splicing
yielding mRNAs encoding a "synaptic" (S) isoform, containing exons
1-4 and 6, also designated E6 mRNA herein, an "erythrocytic" (E)
isoform, containing exons 1-6, also designated E5 mRNA herein, and
the "readthrough" AChE-R derived from the 3'-unspliced transcript,
containing exons 1-6 and the pseudo-intron I4, also designated I4
mRNA herein.
[0011] Transgenic mice overexpressing human AChE-S in spinal cord
motoneurons, but not in muscle, displayed progressive neuromotor
impairments that were associated with changes in NMJ ultrastructure
[Andres, C. et al. (1997) Proc. Natl. Acad. Sci. USA 94,
8173-8178]. However, it was not clear whether the moderate extent
of overexpressed AChE in muscle was itself sufficient to mediate
this severe myopathology. In rodent brain, the inventors found
previously that both traumatic stress and cholinesterase inhibitors
induce dramatic calcium-dependent overexpression of AChE-R [Kaufer,
et al. (1998) id ibid.], associated with neuronal hypersensitivity
to both cholinergic agonists and antagonists [Meshorer et al.
(2002) id ibid].
[0012] Chronic AChE excess was found to cause progressive
neuromotor deterioration in transgenic mice and amphibian embryos
[Ben Aziz-Aloya et al. (1993) Proc. Natl. Acad. Sci. USA, 90,
2471-2475; Seidman et al. (1994) J. Neurochem. 62, 1670-1681;
Seidman, et al. (1995) Mol. Cell. Biol. 15, 2993-3002; Andres, C.
et al. (1997) Proc. Natl. Acad. Sci. USA 94, 8173-8178; Sternfeld
et al. (1998) J. Neurosci. 18, 1240-1249]. Also, myasthenic
patients suffer acute crisis events, with a reported average annual
incidence of 2.5% [Berrouschot et al. (1997) Crit. Care Med. 25,
1228-35] associated with respiratory failure reminiscent of
anti-AChE intoxications.
[0013] In one approach, the prior art teaches that chemically
protected RNA aptamers capable of blocking the autoantibodies to
the nicotinic Acetylcholine Receptor (nAChR) may be developed and
used to treat MG. This approach has several drawbacks in that the
RNA aptamers do not have the amplification power characteristic of
the RNAse-inducing antisense agents and in that it fails to address
the problem of the feedback responses in MG.
[0014] The present inventors have previously found that antisense
oligonucleotides against the common coding region of AChE are
useful for suppressing AChE production [WO 98/26062]. This
publication also teaches that antisense oligonucleotides against
the human AChE are useful in the treatment of memory deficiencies
as observed in transgenic mice that expressed human AChE in their
brain. The observed effects (see Table 4-5 in WO 98/26062) are
similar in their effect, yet considerably longer in the duration of
their action than the prior art AChE inhibitor tacrine (see FIG. 9B
in WO 98/26062).
[0015] In view of the above, it is desirable to further improve the
treatment approaches for MG and other diseases involving impairment
in neuromuscular transmission. The prior art treatment involving
the use of AChE inhibitors is afflicted with undesirable side
effects because of the induction of AChE and neuromuscular
impairments by such inhibitors; and because it is subject to
variable efficacy under altered mental state (stress).
[0016] WO01/36627 teaches that morphological and functional changes
in the NMJ correlate with overexpression of a specific isoform of
AChE mRNA, viz., the "readthrough" isoform containing the
pseudo-intron 14 in the mature mRNA. Said PCT application also
shows that antisense oligonucleotides directed to the common coding
region of AChE may be used to specifically destroy AChE-R mRNA, and
that AChE antisense agents are by far superior to conventional AChE
enzyme inhibitor drugs in the treatment of neuromuscular disorders.
The superiority of these antisense agents may be due to the fact
that conventional enzyme inhibitors actively induce I4 AChE mRNA
overexpression. According to the teachings of WO01/36627, this may
lead to detrimental changes in the NMJ. This consequence of
treatment may be entirely avoided by using the antisense agents of
WO01/36627.
[0017] The Blood-Brain Barrier (BBB) maintains a homeostatic
environment in the central nervous system (CNS). The capillaries
that supply the blood to the brain have tight junctions which block
the passage of most molecules through the capillary endothelial
membranes. While the membranes do allow passage of lipid soluble
materials, water soluble materials do not generally pass through
the BBB. Mediated transport mechanisms exist to transport the water
soluble glucose and essential amino acids through the BBB. Active
support mechanisms remove molecules which become in excess, such as
potassium, from the brain [for general review see Betz et al.,
Blood-Brain-Cerebrospinal Fluid Barriers, Chapter 32, in Basic
Neurochemistry, 5.sup.th ed., Eds Siegel, Albers Agranoff,
Molinoff, pp. 681-701; Goldstein and Betz (1986) Scientific
American, September, pp. 74-83].
[0018] The BBB impedes the delivery of drugs to the CNS. Methods
have been designed to deliver needed drugs such as direct delivery
within the CNS by intrathecal delivery can be used with, for
example, an Omaya reservoir. U.S. Pat. No. 5,455,044 provides for
the use of a dispersion system for CNS delivery [for description of
other CNS delivery mechanisms, see U.S. Pat. No. 5,558,852, Betz et
al., ibid., and Goldstein and Betz, ibid.]. Tavitan et al. [Tavitan
et al. (1998) Nat Med 4(4): 467-71] observed that 2'-O-methyl
oligonucleotides are able to penetrate into the brain. Other
systems make use of specially designed drugs that utilize the
structure and function of the BBB itself to deliver the drugs, for
example by designing lipid soluble drugs or by coupling to peptides
that can penetrate the BBB.
[0019] It has been shown that stress affects the permeability of
the BBB [Sharma H. S. et al. (1992) Prog. Brain Res. 91, 189-196;
Ben-Nathan D. et al. (1991) Life. Sci. 489, 1493-1500]. Further, in
mammals, acute stress elicits a rapid, transient increase in
released acetylcholine with a corresponding phase of increased
neuronal excitability [Imperato A. et al. (1991) Brain Res. 538,
111-117]. It has been previously observed by the present inventors
that the AChE-R isoform and the 14 peptide of AChE can act as
stress mimicking agents and rupture the BBB. These findings formed
the basis for PCT application WO98/22132, the contents of which are
fully incorporated herein by reference. WO98/22132 relates to
compositions for facilitating the passage of compounds through the
BBB, comprising the AChE-R splice variant and/or the peptide
I4.
[0020] In search for an antisense oligonucleotide targeted against
a domain of the human AChE, which may be particularly acceptable in
human therapy, the inventors have now found, and this is an object
of the present invention, that a synthetic antisense
oligodeoxynucleotide having the nucleotide sequence:
5'-CTGCCACGTTCTCCTGCACC-3', herein designated SEQ ID NO:1, is not
only useful in selectively suppressing the production of the AChE-R
isoform, but also possesses cross-species specificity, which
enables its use in rodent animal models of various diseases and,
moreover, remarkably appears to penetrate the BBB, and may thus be
useful in treatment of diseases of the central nervous system,
alone or in combination with other therapeutic agents. The finding
that the novel antisense of the invention can penetrate the BBB was
unexpected, particularly in view of the expectation that the BBB
would be impermeable to large polar molecules.
[0021] The application of antisense technology to the treatment of
nervous system disorders has, until recently, been considered to be
limited by the lack of adequate systems for delivering
oligonucleotides to the brain. Nevertheless, several attempts have
been made to circumvent this difficulty [reviewed in Seidman S. et
al. (1999) Antisense Nucl. Acid Drug Devel, 9, 333-340]. Access of
chemical agents circulating in the blood to the interstitial spaces
of the brain is restricted by the biomechanical barrier known as
the BBB. The strong anionic character of the phosphodiester
backbone makes oligonucleotides especially poor at crossing the
BBB. In vivo pharmacokinetic studies have demonstrated that less
than 0.01% of a systemically injected dose of a phosphorothioate
antisense oligonucleotide may reach the brain, where its residence
time may be as little as 60 min. A research solution to this
problem in the laboratory is direct bypass of the BBB by
intracranial injection of oligonucleotides. Using published
stereotactic coordinates for both rats and mice, oligonucleotides
can be delivered by single injections, by repeated administration
through an implanted cannula, or by continuous infusion using an
osmotic mini-pump such as Alzet (Alza, Palo Alto, Calif.).
Oligonucleotides can either be delivered into the CSF or directly
into the brain region of interest. In general, oligonucleotides are
considered to remain relatively localized following
intraparenchymal administration. Thus, a single injection of 24
.mu.g of an antisense oligonucleotide targeted to the cAMP-response
element (CREB) into rat amygdala was reported to diffuse only
0.72.+-.0.04 .mu.l around the injection site, exerting
region-specific effects on conditioned taste aversion (CTA).
Injection of the same oligonucleotide into the basal ganglia 2 mm
above the amygdala had no effect on CTA. Similarly, specific
effects on behavior were reported following the injection of
antisense oligonucleotides against the stress-associated
transcription factor c-fos into the medial frontal cortex (single
administration; 10 .mu.g), following delivery of oligonucleotides
against the neurotransmitter-synthesizing enzyme glutamate
decarboxylase into the ventromedial hypothalamus (single
administration; 1 .mu.g), and following 5 days continuous infusion
of oligonucleotides targeted to mRNA encoding the cAMP-responsive
transcription factor CREB into the locus coeruleus (20 .mu.g/day).
It was further reported that wide distribution of oligonucleotides
in the brain (up to 443 .mu.l around the site of injection after 48
hrs) could be achieved by direct, high-flow intraparenchymal
microinfusion. In that case, the average tissue concentration of
oligonucleotide was calculated to be between 3-15 .mu.M--well
within what is considered physiologically significant. Regarding
uptake into neurons, it was shown that neurons in the striatum of
rats preferentially take up oligonucleotides compared to glia.
Despite the general retention of oligonucleotides around the
injection site reported in that study, some signal was observed to
be transported along projection pathways to distant sites. However,
to be effective therapeutically, oligonucleotides should be
prepared in a way that would enable their stability and free
penetrance into the central nervous system following intravenous
injection, or yet more preferably, following oral administration.
Thus, the present invention is aimed at a novel, preferably
nuclease protected antisense oligodeoxynucleotide targeted to the
common coding domain of human AChE, which selectively suppresses
the production of AChE-R, with rapid and long-lasting clinical
improvements in muscle function, which possesses cross-species
specificity and can penetrate the BBB and destroy AChE-R mRNA
within central nervous system neurons.
SUMMARY OF THE INVENTION
[0022] The invention relates to a pharmaceutical or medical
composition for the treatment and/or prevention of a progressive
neuromuscular disorder, comprising as active ingredient a synthetic
antisense oligodeoxynucleotide targeted against human AChE mRNA
having the nucleotide sequence:
TABLE-US-00001 5' CTGCCACGTTCTCCTGCACC 3'. (SEQ ID NO: 1)
[0023] The antisense oligonucleotide preferably causes preferential
destruction of AChE-R mRNA, possesses cross-species specificity,
was demonstrated to cause no toxicity in rodents or primates, and
can penetrate the BBB in primates (monkeys) via both i.v. and p.o.
administration routes.
[0024] In a preferred embodiment, the synthetic antisense
oligodeoxynucleotide having the nucleotide sequence designated SEQ
ID NO:1 is nuclease resistant. The nuclease resistance may be
achieved by modifying the antisense oligodeoxynucleotide of the
invention so that it comprises partially unsaturated aliphatic
hydrocarbon chain and one or more polar or charged groups including
carboxylic acid groups, ester groups, and alcohol groups.
[0025] In particular embodiments, the nuclease resistant antisense
oligodeoxynucleotide of the invention has at least one of the last
three 3'-terminus nucleotides is 2'-O-methylated, preferably the
last three 3'-terminus nucleotides are 2'-O-methylated.
Alternatively, the nuclease resistant antisense
oligodeoxynucleotide of the invention may have at least one of the
last 3'-terminus nucleotides fluoridated. Still alternatively, the
nuclease resistant antisense oligodeoxynucleotide of the invention
has phosphorothioate bonds linking between at least two of the last
3'-terminus nucleotide bases, preferably has phosphorothioate bonds
linking between the last four 3'-terminal nucleotide bases. Still
alternatively, nuclease resistance may be achieved by the synthetic
nuclease resistant antisense oligodeoxynucleotide of the invention
having a nucleotide loop forming sequence at the 3'-terminus, for
example a 9-nucleotide loop having the nucleotide sequence
CGCGAAGCG (SEQ ID NO:2).
[0026] The synthetic nuclease resistant antisense
oligodeoxynucleotide of the invention is capable of selectively
modulating mammalian AChE production, particularly selectively
modulating primate AChE production in neurons residing in the
central nervous system, including human AChE of interneurons.
[0027] In a further aspect, the invention relates to a
pharmaceutical composition comprising an antisense
oligodeoxynucleotide of the invention, and optionally further
comprising pharmaceutically acceptable adjuvant, carrier or
diluent.
[0028] In a preferred embodiment, the pharmaceutical composition of
the invention comprises an antisense oligodeoxynucleotide of SEQ ID
NO:1, which is 2'-O-methylated on at least one, preferably the
three last 3'-terminus nucleotides.
[0029] The pharmaceutical composition of the invention is useful in
the treatment and/or prevention of a progressive neuromuscular
disorder, for improving stamina and/or for use in decreasing
chronic muscle fatigue.
[0030] The pharmaceutical composition of the invention may be for a
once daily use by a patient of a dosage between about 0.001 .mu.g/g
and about 50 .mu.g/g of active ingredient, preferably a dosage of
active ingredient of about 0.01 to about 5.0 g/g, more preferably a
dosage of active ingredient of about 0.15 to about 0.5 .mu.g/g.
[0031] The pharmaceutical composition of the invention is
particularly intended for use in treating or preventing a
progressive neuromuscular disorder, wherein said disorder is
associated with an excess of AChE mRNA or protein. Such a disorder
may be, for example, a progressive neuromuscular disorder, wherein
said disorder is associated with an excess of AChE-R mRNA.
[0032] The pharmaceutical composition of the invention is thus
particularly suitable for treating or preventing a progressive
neuromuscular disorder, wherein said disorder is associated with
impairment of cholinergic transmission.
[0033] Of particular interest are pharmaceutical compositions for
the treatment of a progressive neuromuscular disorder, wherein said
disorder involves muscle distortion, muscle re-innervation or NMJ
abnormalities, for example myasthenia gravis, Eaton-Lambert
disease, muscular dystrophy, amyotrophic lateral sclerosis,
post-traumatic stress disorder (PTSD), multiple sclerosis,
dystonia, post-stroke sclerosis, post-injury muscle damage,
post-surgery paralysis, excessive re-innervation, and post-exposure
to AChE inhibitors.
[0034] The pharmaceutical composition of the invention is also
useful in improving stamina in physical exercise or in decreasing
muscle fatigue.
[0035] In addition, the invention relates to a pharmaceutical
composition comprising an antisense oligodeoxynucleotide as denoted
by SEQ ID NO:1, for facilitating passage of compounds through the
BBB, optionally further comprising additional pharmaceutically
active agent and/or pharmaceutically acceptable adjuvant, carrier
or diluent. The additional pharmaceutically active agent is a
compound to be transported through the BBB, wherein said compound
may be contrast agents used for central nervous system imaging,
agents that function to block the effects of abused drugs,
antibiotics, chemotherapeutic drugs and vectors to be used in gene
therapy. This composition would function primarily by suppressing
the production of AChE-R, which is apparently involved in BBB
maintenance.
[0036] The invention will be described in more detail in the
following detailed description and on hand of the following
figures.
BRIEF DESCRIPTION OF THE FIGURES
[0037] FIG. 1 Human AChE mRNA [GenBank Accession No. M55040; Soreq
et al., Proc. Natl. Acad. Sci. USA 87(24), 9688-9692 (1990)], and
human EN 101 (hEN101, SEQ ID NO:1), targeted at nucleotides 795-5'
to 3'-814 (shaded) of the coding sequence.
[0038] FIG. 2A-B Representation of various physical and chemical
properties of the human EN101 (SEQ ID NO:1).
[0039] FIG. 2A: Internal structure that is expected for the
oligonucleotide, and an estimate of the energy (in kcal/mol)
required to disrupt that structure.
[0040] FIG. 2B: Base composition and the predicted melting
temperature of its hybrid with the complementary mRNA.
[0041] FIG. 3 Mouse AChE mRNA [GenBank Accession No. X56518;
Rachinsky et al. (1990) Neuron 5(3), 317-327], and mouse EN101
(mEN101, SEQ ID NO:3), targeted at nucleotides 639-5' to 3'-658
(shaded) of the coding sequence.
[0042] FIG. 4A-B Representation of various physical and chemical
properties of the mouse EN101 (SEQ ID NO:3).
[0043] FIG. 4A: Internal structure that is expected for the
oligonucleotide, and an estimate of the energy (in kcal/mol)
required to disrupt that structure.
[0044] FIG. 4B: Base composition and the predicted melting
temperature of its hybrid with the complementary mRNA.
[0045] FIG. 5 Rat AChE mRNA (partial, 2066 nucleotides) [GenBank
Accession No. S50879; Legay et al. (1993), J. Neurochem. 60(1),
337-346], and the rat EN102 (rEN102, SEQ ID NO:5), targeted at
nucleotides 51-5' to 3'-70 (shaded) and rat EN101 (rEN101, SEQ ID
NO:4), targeted at nucleotides 639-5' to 3'-658 (shaded) of the
coding sequence.
[0046] FIG. 6A-B Representation of various physical and chemical
properties of the rat EN101 (SEQ ID NO:4).
[0047] FIG. 6A: Internal structure that is expected for the
oligonucleotide, and an estimate of the energy (in kcal/mol)
required to disrupt that structure.
[0048] FIG. 6B: Base composition and the predicted melting
temperature of its hybrid with the complementary mRNA.
[0049] FIG. 7 Immunoreactive AChE-R in EAMG rats.
[0050] Separation of rat serum was performed in non-denaturing
polyacrylamide gel, and the gel tested for immunoreactive AChE-R.
An EAMG rat had considerably higher level of the rapidly migrating
rR variant than a control rat.
[0051] Abbreviations: electroph., electrophoresis; cont.,
control.
[0052] FIG. 8A-C Excess AChE-R expression in muscles of EAMG
rats.
[0053] FIG. 8A: AChE mRNA transcripts expressed in muscle. Shown is
the stress-responding mammalian ACHE gene, with a functional
glucocorticoid response element (GRE) in its distal enhancer, and
its two mRNA transcripts expressed in muscle. Note that exon 6 is
unique to the synaptic transcript AChE-S, whereas, pseudo-intron 4'
is expressed only in the stress induced AChE-R mRNA.
[0054] Antibodies targeted to the pseudo-intron 4'-derived
C-terminal peptide served to detect the AChE-R protein, and cRNA
probes to exon 6 and pseudo-intron 4' label the two transcripts
(asterisks).
[0055] FIG. 8B: Depleted nAChR and excess AChE-R in EAMG muscles.
Shown is immunohistochemical staining of paraffin-embedded sections
of triceps muscle from normal or EAMG rats treated with the inert
inverse (r-invEN102) oligonucleotides, similar to those of
untreated rats. Staining was with polyclonal rabbit antibodies to
nAChR (1,2) and AChE-R (3,4). Immunopositive areas are stained red.
Note that the AChE-R protein was prominently elevated and nAChR
dramatically reduced in EAMG. In situ hybridization with probes
specific for AChE-R or -S mRNAs yielded red stained RNA, with DAPI
(white) used to visualize cell nuclei. Note the prominent
sub-nuclear accumulation of AChE-R mRNA in preparations from EAMG,
but not control animals (5,6). AChE-S mRNA displayed punctuated
expression in subnuclear areas in both control and EAMG rats
(7,8).
[0056] FIG. 8C: rEN101 treatment. In EAMG rats, EN101 reduced
levels of AChE-R (1,2) and AChE-R mRNA (5,6), but did not affect
nAChR (3,4) or AChE-S mRNA (7,8), as compared to rats treated with
the inverse sequence (see FIG. 8B, above.).
[0057] Abbreviations: healt., healthy; r., rat; prot., protein.
[0058] FIG. 9A-D Normalized EAMG muscle electrophysiology under
suppression of AChE-R.
[0059] FIG. 9A: Immunoreactive AChE-R was detected, as in FIG. 7B,
in the serum of healthy and severely affected EAMG rats, treated
with rEN101 or r-invEN102, and the densities of the bands are
represented in the bar graph.
[0060] FIG. 9B: Animals (at least 6 rats in each group) were
treated with a single i.p. injection (75 .mu.g/kg) of the AChE
inhibitor neostigmine, and the CMAP ratio relative to the baseline
was measured. The average CMAP ratio of EAMG rats included in the
study prior to treatment was 87.+-.2.5% of first depolarization,
and average CMAP ratio in rEN101-treated animals was 107.4.+-.3.8%
(inset).
[0061] FIG. 9C: Animals (at least 6 rats in each group) were
treated with various doses of rEN101. The treatment (doses between
10-500 .mu.g/Kg) restored the CMAP decline for up to 72 h. Note
that higher doses conferred increasingly longer-lasting relief.
[0062] FIG. 9D: Dose response curse. CMAP responses at each time
were plotted as a function of EN101 concentration. Note that at 1
and 5 h there are clearly two effects, a steep increase dependent
on a low EN101 concentration (IC.sub.50<10 .mu.g/kg),
superimposed on a much lower-affinity effect that persists much
longer.
[0063] Abbreviations: ser., serum; t., time; dep., dependence;
neostig., neostigmine; resp., response; h., hours; perc., percent;
cont., control; rat., ratio; bas., baseline.
[0064] FIG. 10 Rat EN101 (SEQ ID NO:4) improves stamina in
myasthenic rats.
[0065] Experimental autoimmune myasthenic gravis (EAMG) rats with
varying severity of clinical symptoms and healthy Lewis rats were
prodded to run on an electrically powered treadmill (25 m/min,
inset) until visibly fatigued. Presented is the average time
(sec..+-.SEM) rats were able to run before and 24 h following i.v.
administration of 250 .mu.g/kg rEN101. Note that running time for
EAMG rats decreased with disease severity, and increased for each
group treated with rEN101.
[0066] Abbreviations: trml., treadmill; treat., treatment; h.,
hour; clin., clinical; stat., status; run., running; t., time;
sec., seconds.
[0067] FIG. 11A-B Stable reversal of declining CMAP response in
EAMG rats treated orally with rEN101.
[0068] EAMG rats received rEN101 once daily for up to 4 days by
intravenous injection (25 .mu.g/kg) or via oral gavage (50
.mu.g/kg), or pyridostigmine (1000 .mu.g/kg) by oral gavage. The
CMAP ratio was determined 1 and 5 h following the first drug
administration and then every 24 h, prior to the administration of
the subsequent dose.
[0069] FIG. 11A: Single dose. Orally administered pyridostigmine
(n=4) and rEN101 (n=8) relieved the declining CMAP responses within
1 h. 24 h following administration of pyridostigmine, CMAP ratios
in muscles of treated rats returned to the declining baseline. In
contrast, no decline was detected in rats treated with rEN101.
[0070] FIG. 11B: Repeated daily doses. The graph depicts the
equivalent improvement in muscle function elicited by oral (50
.mu.g/kg, n=8) as compared to i.v. (25 .mu.g/kg, n=4)
administration of rEN101. Note that repeated administration of
rEN101 conferred stable, long-term alleviation of CMAP declines.
Repeated daily administration of pyridostigmine at 24 h intervals
yielded considerably shorter CMAP improvements than those obtained
with EN101, decreasing back to the declining baseline prior to the
next dose.
[0071] Abbreviations: sing., single; dos., dose; rep., repeated;
d., daily; pyridostig., pyridostigmine; h., hours; rat., ratio;
bas., baseline; ab., above.
[0072] FIG. 12A-C: Long-term rEN101 treatment changes the course of
EAMG.
[0073] FIG. 12A: Survival. A greater fraction of animals treated
once daily with rEN101 (50 .mu.g/Kg, daily, p.o.) survived than
those treated with pyridostigmine (1000 .mu.g/Kg) despite their
similarly poor initial status and initial number of animals in each
group.
[0074] FIG. 12B: Clinical status. Shown are average values for the
clinical status (as defined in Experimental Procedures) of
surviving animals from each of the treated groups. Note increasing
severity of disease in saline- and pyridostigmine-treated animals,
as compared to the improved status of rEN 101-treated animals.
[0075] FIG. 12C: Stamina. Shown are average running times in sec.
for rEN101- and pyridostigmine-treated animals. Note that before
treatment, EAMG rats performed as severely sick animals (clinical
status 4).
[0076] Abbreviations: surv., survival; clin., clinical; stat.,
status; stam., stamina; an., animals; al., alive; sc., score; run.,
running; t., time; sec., seconds; w., weeks; sal., saline;
pyridostig., pyridostigmine.
[0077] FIG. 13 Proposed model for EN101 activity
[0078] At the neuromuscular junction, acetylcholine (ACh) released
from the motoneuron terminal (top) into the synaptic cleft travels
towards the muscle postsynaptic membrane (below). There, it
interacts with nAChR to initiate an inward ion current and elicit
muscle action potentials. ACh is subsequently hydrolyzed by
synapse-bound AChE-S. Subsynaptic muscle nuclei (ellipses) produce,
in addition to the primary AChE-S mRNA transcript, the normally
rare AChE-R mRNA with its alternative 3'-end. This transcript
translates into soluble, secretory AChE-R monomers. Myasthenic
autoimmune antibodies toward nAChR block the initiation of action
potentials, mimicking an ACh-deficient state. The cholinergic
imbalance results in AChE-R accumulation that enhances ACh
destruction, leading to muscle fatigue. Chemical
anticholinesterases (indented circles) non-selectively block both
AChE-S and AChE-R, which transiently increases ACh levels, yet
further intensifies AChE-R overproduction. In contrast, the
antisense agent EN101 selectively induces AChE-R mRNA destruction,
preventing AChE-R synthesis while maintaining AChE-S and sustaining
normal neuromuscular transmission.
[0079] FIG. 14 Dose-dependent hEN101 suppression of neuronal AChE-R
mRNA, but not of AChE-S mRNA.
[0080] Shown are representative fields from spinal cord sections of
hEN101-treated monkeys following in situ hybridization with AChE-R
or AChE-S cRNA probes. Note that AChE-R mRNA labeling decreased,
but AChE-S mRNA levels appeared unchanged. An increasing dose of
o.g.-administered hEN101 suppressed AChE-R mRNA more effectively,
suggesting dose-dependence. Administration of the higher dose via
i.v. appeared more effective than the o.g. route.
[0081] Abbreviations: d., day.
[0082] FIG. 15 hEN101-suppression of neuronal AChE-R mRNA levels is
cell type-specific.
[0083] Spinal cord neurons from hematoxylin-eosin stained monkey
sections were divided by size into cells with perikaryal diameters
of <40, 40 to 70 and >70 .mu.m. The percent of cells within
each size group that were positively labeled for AChE-R mRNA was
recorded in 5 different fields of 1 mm.sup.2 each, for each hEN101
treatment. Note that hEN101 effectiveness was apparently highest in
the relatively small interneurons, and lowest in the largest
motoneurons.
[0084] Abbreviations: pos., positive; cel., cell; siz., size; gr.,
group; bo., body; diam., diameter; nv., naive.
[0085] FIG. 16 Shown are levels of hydrolyzed acetylthiocholine,
indicating acetycholinesterase activity in the plasma of
cynomolgous monkeys treated i.v. for two consecutive days with 150
or 500 .mu.g/kg hEN101 or with orally administered 500 .mu.g/kg hEN
101.
[0086] FIG. 16A: Total activity.
[0087] FIG. 16B: Activity under 5.times.10.sup.-5 M of iso-OMPA
(AChE). Note injection-induced increases in enzyme activity and
AS-ON reductions.
[0088] Abbreviations: t., time; fol., following; treat., treatment;
hrs., hours.
[0089] FIG. 17 Effect of rEN101 on AChE-R mRNA in rat spinal cord
neurons. The presence of AChE-R mRNA-positive cells was determined
in spinal cord section of rats that had been treated for 7 days
with rEN101 (500 .mu.g/kg, i.v., daily).
[0090] Abbreviations: cont., control.
[0091] FIG. 18 hEN101 alleviates ptosis in MG patients. Photographs
show: before hEN101 treatment (upper panel), on 10
Mestinon.RTM./day, 600 mg; during hEN101 treatment (middle panel),
500 .mu.g/kg, 2-day treatment; and 4 weeks after hEN101 treatment
(lower panel), back to Mestinon.RTM. treatment.
[0092] FIG. 19 Efficacy of oral hEN101 in MG patients. Graph shows
mean change from baseline of one patient in total grade. This
patient was a 56 year old male, myasthenic for 29 years, who was
treated with pyridostigmine and had a baseline of QMG=6. He
returned to the pyridostigmine treatment 72 hours after the last
hEN101 dose.
[0093] FIG. 20 Improvement in Total QMG Score. Graph shows the mean
percentage improvement (plus standard deviation) in total QMG score
of all patients, from the baseline value until day 6 of
treatment.
[0094] FIG. 21A-B hEN101 improves myasthenic status.
[0095] FIG. 21A Graph shows QMG score of all the patients included
in the clinical trial.
[0096] FIG. 21B Graph shows mean change from baseline in QMG
score.
DETAILED DESCRIPTION OF THE INVENTION
[0097] For the purposes of clarity, the following abbreviations and
terms are defined herein: [0098] AChE: acetylcholinesterase [0099]
AChE-R: acetylcholinesterase, "readthrough" variant or isoform, its
mRNA includes pseudo-intron 14 [0100] AChE-S: acetylcholinesterase,
synaptic variant or isoform [0101] AS-ON: antisense oligonucleotide
[0102] BBB: blood-brain barrier [0103] CMAP: compound muscle action
potential [0104] CNS: central nervous system [0105] EAMG rat: rats
wherein experimental autoimmune myasthenia gravis has been induced
[0106] EN101: may also be referred as AS3; antisense
oligonucleotide targeted against human, rat or mouse (hEN101,
rEN101 or mEN101, respectively) AChE mRNA [0107] EN102: may also be
referred as -AS1, antisense oligonucleotide targeted against AChE
mRNA, at a different region than EN101 [0108] MG: myasthenia
gravis, a neuromuscular junction disease [0109] i.v.: intravenous
[0110] o.g.: oral gavage [0111] p.o.: per os Antisense
oligonucleotide: A nucleotide comprising essentially a reverse
complementary sequence to a sequence of AChE mRNA. The nucleotide
is preferably an oligodeoxynucleotide, but also ribonucleotides or
nucleotide analogues, or mixtures thereof, are contemplated by the
invention. The antisense oligonucleotide may be modified in order
to enhance the nuclease resistance thereof, to improve its membrane
crossing capability, or both. The antisense oligonucleotide may be
linear, or may comprise a secondary structure. It may also comprise
enzymatic activity, such as ribozyme activity.
[0112] Progressive neuromuscular disorder: A disorder or condition
associated with excess AChE mRNA or protein production,
characterized by changes in the morphology of the NMJ and
impairment in neuromuscular transmission. The neuromuscular
disorder may involve muscle distortion, muscle re-innervation or
NMJ abnormalities. More preferably, the progressive neuromuscular
disorder is myasthenia gravis, muscular dystrophy, multiple
sclerosis, amyotrophic lateral sclerosis, post-traumatic stress
disorder (PTSD), or dystonia.
[0113] The present invention relates to a novel antisense
oligodeoxynucleotide substantially as denoted by SEQ ID NO:1, also
designated herein as hEN101.
[0114] In addition to the part of the sequence which is
complementary to AChE sequence, the antisense oligonucleotide of
the invention may also comprise RNA sequences with enzymatic
nucleolytic activity, or may be linked to such sequences. Preferred
nucleolytic sequences are ribozyme sequences, which were shown to
specifically interact with mRNA transcripts. They are ribonucleic
acid sequences, including RNase active sites flanked by antisense
oligonucleotides [Haseloff and Gerlach (1988) Nature 3, p. 585,
Sarver et al. (1990) Science 247, p. 1222]. Preferred ribozymes are
hammerhead ribozymes [Conaty et al. (1999) Nucleic Acids Res. 27,
2400-2407; and Xu et al. (1999) Endocrinology, 140, 2134-44].
Another preferred ribozyme is the hairpin ribozyme structure, e.g.,
as derived from tobacco ringspot virus satellite RNA [see
Perez-Ruiz (1999) Antisense Nucleic Acid Drug Dev., 9, 33-42].
[0115] The novel antisense oligodeoxynucleotide of the invention
corresponds to the reverse complement of human AChE mRNA sequence,
from nucleotide 795-5' to nucleotide 3'-814 (FIG. 1). Prior work by
the present inventors has demonstrated the usefulness of antisense
oligonucleotide in suppressing AChE production and in the treatment
of memory deficiency. In said prior work, a number of AChE
antisense oligonucleotides have been disclosed. Said prior work
further discloses desirable features of such antisense
oligonucleotides and possible modifications thereof, such as
nuclease resistance, modifications to enhance membrane transport of
oligonucleotides, and the like. Said prior work, e.g. WO 98/26026,
is therefore incorporated herein in its entirety by reference. In
another publication, the present inventors describe the role of
antisense oligonucleotides in the treatment of a variety of
neurodegenerative diseases [Seidman, S. et al., Antisense Res.
Nucl. Acids Drug Devel. 9, 333-340 (1999)].
[0116] The antisense oligodeoxynucleotide of the invention is
preferably nuclease resistant. There are a number of modifications
that impart nuclease resistance to a given oligonucleotide.
Reference is made to WO 98/26062, which publication discloses that
oligonucleotides may be made nuclease resistant e.g., by replacing
phosphodiester internucleotide bonds with phosphorothioate bonds,
replacing the 2'-hydroxy group of one or more nucleotides by
2'-O-methyl groups, or adding a nucleotide sequence capable of
forming a loop structure under physiological conditions to the 3'
end of the antisense oligonucleotide sequence. An example for a
loop forming structure is the sequence 5' CGCGAAGCG (SEQ ID NO:2),
which may be added to the 3' end of a given antisense
oligonucleotide to impart nuclease resistance thereon.
[0117] The cells on which the antisense oligonucleotide of the
invention exerts its effects are preferably muscle cells and cells
of the NMJ, including the nerve axons and endplate structures.
[0118] Using the antisense oligonucleotides according to the
invention, it is expected that AChE-R amount and AChE-R mRNA levels
are reduced in central nervous system neurons by at least about
30%, preferably by at least about 40%, and more preferably by at
least about 50%, within 24 hr of the treatment, and by about 80%
under repeated treatment. This reduction was shown by fluorescent
in situ hybridization (FISH) and immune labeling and its
effectiveness was confirmed by electrophysiology and tread mill
tests. It exceeded by far all previous reports of AS-ON destruction
of AChE-R mRNA in other cells and tissues.
[0119] In yet another embodiment of the invention, the preferred
treatment window of candidate oligonucleotides is evaluated by
FISH. The technique of in situ hybridization is well known to the
man of skill in the art, and is described e.g., In situ
Hybridization, Wilkinson, D. G. (Ed.) ISBN: 0199633274; In situ
Hybridization for the Brain, Wisden W., Morris B. J. (Eds.), ISBN:
0127599207, PCR in situ Hybridization: A Practical Approach
(Practical Approach Series 186), Herrington C. S., John O'Leary J.,
(Eds.) ISBN:019963632X. Detailed protocols relating to in situ
hybridization using non-radioactively labeled probes are available
from Microsynth GmbH (Balgach, Switzerland).
[0120] Labeled AChE-R cRNA sequences may be used as probes for in
situ hybridization. The ACHE cRNA probe preferably comprises I4
pseudo-intron sequences.
[0121] In a preferred embodiment of the invention, the AChE mRNA
determination is carried out by using in situ RT-PCR, which
technique is described, e.g., in the above-mentioned references,
see also PCR in situ hybridization: Protocols and Applications, 3rd
ed., by Nuovo, G. J. Lippincott, Raven Press, New York (1996).
[0122] Phosphorothioate-modified oligonucleotides are generally
regarded as safe and free of side effects. Peng et al. teach that
undesired in vivo side effects of phosphorothioate antisense
oligonucleotides may be reduced when using a mixed
phosphodiester-phosphorothioate backbone. The antisense
oligonucleotides of the present invention have been found to be
effective as partially phosphorothioates and yet more effective as
partially 2'-O-methyl protected oligonucleotides. WO 98/26062
teaches that AChE antisense oligonucleotides containing three
phosphorothioate bonds out of about twenty internucleotide bonds
are generally safe to use in concentrations of between about 1 and
10 .mu.M. However, for long-term applications, oligonucleotides
that do not release toxic groups when degraded may be preferred.
These include 2'-O-methyl protected oligonucleotides, but not
phosphorothioate oligonucleotides. A further advantage of
2'-O-methyl protection over phosphorothioate protection is the
reduced amount of oligonucleotide that is required for AChE
suppression. This difference is thought to be related to the
improved stability of the duplexes obtained when the 2'-O-methyl
protected oligonucleotides are used [Lesnik, E. A. & Freier, S.
M., Biochemistry 37, 6991-7, (1998)]. An alternative explanation
for the greater potency of the 2'-O-methyl oligonucleotides is that
this modification may facilitate penetration of the oligonucleotide
chain through the cell membrane. A further advantage of 2'-O-methyl
protection is the better protection against nuclease-mediated
degradation that it confers, thus extending the useful life time of
antisense oligonucleotides protected in this way.
[0123] In accordance with the invention, the dosage of the
antisense oligodeoxynucleotide is about 0.001 to 50 .mu.g
oligonucleotide per gram of body weight of the treated animal.
Preferably, the dosage is about 0.01 to about 5.0 .mu.g/g. More
preferably, the dosage is between about 0.05 to about 0.7 .mu.g/g.
Thus, the optimal dose range is between 50-500 g/kg of body weight
of the treated subject, for rats, monkeys and also humans.
[0124] The antisense oligonucleotide of the invention is provided
for use in the treatment of a disorder that involves excessive AChE
mRNA production.
[0125] The disorder is preferably a disorder involving functional
and morphological changes in the NMJ.
[0126] The progressive neuromuscular disorder preferably involves
overexpression of AChE-R mRNA.
[0127] More preferably, the disorder is selected from, but not
limited to, multiple sclerosis, PTSD, myasthenia gravis, muscular
dystrophy, amyotrophic lateral sclerosis, dystonia, muscle
distortion, muscle re-innervation or excessive muscle
innervation.
[0128] The excessive muscle innervation is selected preferably
from, but not limited to, excessive innervation after trauma,
preferably after amputation.
[0129] In one aspect, the invention relates to a pharmaceutical
composition for the treatment and/or prevention of a progressive
neuromuscular disorder, for improving stamina in physical exercise
and/or for use in decreasing chronic muscle fatigue, comprising as
active ingredient the synthetic antisense oligodeoxynucleotide
hEN101, as denoted by SEQ ID NO:1, and optionally further
comprising additional therapeutic agents and/or pharmaceutically
acceptable carriers, excipients and/or diluents. Preferably, said
pharmaceutical composition is for the treatment and/or prevention
of myasthenia gravis.
[0130] The progressive neuromuscular disorder to be treated and/or
prevented by the pharmaceutical composition of the invention is
associated with an excess of AChE or protein. Usually, said
excessive AChE will be the AChE-R variant or isoform.
[0131] In addition, said progressive neuromuscular disorder to be
treated and/or prevented by the pharmaceutical composition of the
invention is associated with impairment of the cholinergic
transmission. Said disorder may involve muscle distortion, muscle
re-innervation, or neuromuscular junction (NMJ) abnormalities.
[0132] The pharmaceutical composition of the invention is for use
in the treatment and/or prevention of a disorder such as myasthenia
gravis (MG), Eaton-Lambert disease, muscular dystrophy, amyotrophic
lateral sclerosis (ALS), post-traumatic stress disorder (PTSD),
multiple sclerosis (MS), dystonia, post-stroke sclerosis,
post-injury muscle damage, excessive re-innervation, post-surgery
paralysis of unknown origin and post-exposure to AChE
inhibitors.
[0133] In one embodiment, the pharmaceutical composition of the
invention is for daily use by a patient in need of such treatment,
at a dosage of active ingredient between about 0.001 .mu.g/g and
about 50 .mu.g/g. Preferably, the treatment and/or prevention
comprises administering a dosage of active ingredient of about 0.01
to about 5.0 .mu.g/g. Most preferably, said dosage of active
ingredient is of between about 0.05 to about 0.70 .mu.g/g, and even
most preferably, the dosage is from 0.15 to 0.50 .mu.g/g of body
weight of the patient.
[0134] As may be seen in Example 11 and FIGS. 18-21, treatment of
MG patients with hEN101 resulted in significant improvement of the
clinical symptoms. As an example of such improvements, FIG. 18
shows how patients were capable of better opening their eyes
(lifting their eye lids), and their QMG scores improved
significantly (FIG. 19-21). Thus, hEN101 has proved to be effective
in reversing the symptoms in human MG patients.
[0135] The pharmaceutical composition of the invention may
optionally comprise at least one additional active agent. Said
active agent may be, for example, AChE inhibitors used for the
treatment of neuromuscular disorders.
[0136] In a further aspect, the invention relates to a
pharmaceutical composition comprising an antisense
oligodeoxynucleotide as denoted by SEQ ID NO:1, for facilitating
passage of compounds through the BBB, optionally further comprising
additional pharmaceutically active agent and/or pharmaceutically
acceptable adjuvant, carrier or diluent. The additional
pharmaceutically active agent is a compound to be transported
through the BBB. These pharmaceutical compositions of the invention
may be used for treatment of disorders associated with the central
nervous system, particularly such disorders that require
administration of an active agent into the CNS, for example, for
the treatment of brain tumors. Conventional chemotherapeutic agents
do not pass the BBB, and are therefore ineffective [de Angelis, L.
M., N. Engl. J. Med. 433, 114-123 (2001)]. As the antisense
oligonucleotide of the invention has been shown to penetrate the
BBB, brain tumors could be treated by injection or oral
administration of the antisense oligonucleotide of the invention,
preventing or reducing the need for methods requiring invasion of
the CNS. Antisense oligonucleotides can be made tumor-specific
[Ratajczak M. Z. et al. Proc. Natl. Acad. Sci. USA 89, 11823-11827
(1992)]; therefore should they be found to pass the BBB, they may
be both specific and effective. Thus, the additional pharmaceutical
agents comprised in these compositions of the invention may be, for
example carcinostatic and metastatic drugs.
[0137] A number of compounds are needed for the diagnostic or
treatment of conditions affecting the central nervous system,
wherein the BBB would normally impede their delivery. These
conditions can include any disease or pathology, which include but
are not limited to infections, neurochemical disorders, brain
tumors and gliomas, demyelination, other neuropathies,
encephlopathies, coma, ischemia, hypoxia, epilepsy, dementias,
cognitive disorders, neuropsychiatric disorders (as for example
depression, anxiety, schizofrenia and the like), as well as genetic
disorders. Thus, said compounds or additional pharmaceutically
active agent to be transported across the BBB may be, for example,
contrast agents (dyes) used for central nervous system imaging,
drugs such as antibiotics or chemotherapeutics, gene therapy
vectors, or even agents that function to block the effects of
abused drugs. The administration and dosage of these compounds
shall be according to what is known in medical practice, which
generally should take into account the clinical condition of the
patient in need of such treatment, as well as said patient's age,
sex, body weight and other factors known to be important in the
medical practice. The site and method of administration should also
be chosen accordingly. The pharmaceutically effective amount for
purposes herein is thus determined by such considerations as are
known in the art. The compound can be administered in several ways
as described for the delivery of the composition (see below).
[0138] The compound to be transported through the BBB may be
administered simultaneously with the composition of the invention
or can be administered at some point during the biologically
effective period of the action of the composition. In other words,
the composition of the invention facilitates the disruption of the
BBB, i.e. it opens the BBB, for a period of time depending on its
dose and the compound can then be administered during this "open"
period.
[0139] In order to be effective, the antisense oligonucleotide of
the invention, also when comprised in a pharmaceutical composition
of the invention, must travel across cell membranes. In general,
antisense oligonucleotides have the ability to cross cell
membranes, apparently by a saturable uptake mechanism linked to
specific receptors. As antisense oligonucleotides are
single-stranded molecules, they are to a degree hydrophobic, which
enhances passive diffusion through membranes. Modifications may be
introduced to an antisense oligonucleotide to improve its ability
to cross membranes. For instance, the oligonucleotide molecule may
be linked to a group comprising optionally partially unsaturated
aliphatic hydrocarbon chain and one or more polar or charged groups
such as carboxylic acid groups, ester groups, and alcohol groups.
Alternatively, oligonucleotides may be linked to peptide
structures, which are preferably membranotropic peptides. Such
modified oligonucleotides penetrate membranes more easily, which is
critical for their function and may therefore significantly enhance
their activity. Palmityl-linked oligonucleotides have been
described by Gerster et al. [Anal. Biochem. 262, 177-84 (1998)].
Geraniol-linked oligonucleotides have been described by Shoji et
al. [J. Drug Target 5, 261-73 (1998)]. Oligonucleotides linked to
peptides, e.g., membranotropic peptides, and their preparation have
been described by Soukchareun et al. [Bioconjug. Chem. 9, 466-75
(1998)]. Modifications of antisense molecules or other drugs that
target the molecule to certain cells and enhance uptake of the
oligonucleotide by said cells are described by Wang, J. [Controlled
Release 53, 39-48 (1998)].
[0140] Any of the compositions of the invention are for use by
injection, topical administration or oral uptake. Preferred uses of
the pharmaceutical compositions of the invention by injection are
subcutaneous injection, intraperitoneal injection, and
intramuscular injection. As shown in the following Examples, oral
administration proved very effective, it is much easier to
prescribe and meet patient compliance, and it involves more easy
handling.
[0141] The compositions of the present invention suitable for oral
administration may be presented as discrete units such as capsules,
sachets or tablets, each containing a predetermined amount of the
active ingredient; as a powder or granules; as a solution or
suspension in an aqueous or non-aqueous liquid; or as an
oil-in-water liquid emulsion or a water-in-oil liquid emulsion. The
active ingredient may also be presented as a bolus, electuary or
paste. A tablet may be made by compression or molding, optionally
with one or more accessory ingredients. Compressed tablets may be
prepared by compressing in a suitable machine the active ingredient
in a free-flowing form such as a powder or granules, optionally
mixed with a binder (e.g., povidone, gelatin, hydroxypropylmethyl
cellulose), lubricant, inert diluent, preservative, disintegrant
(e.g., sodium starch glycolate, cross-linked povidone, cross-linked
sodium carboxymethyl cellulose) surface-active or dispersing agent.
Molded tablets may be made by molding in a suitable machine a
mixture of the powdered compound moistened with an inert liquid
diluent. The tablets may optionally be coated or scored and may be
formulated so as to provide slow or controlled release of the
active ingredient therein using, for example, hydroxypropylmethyl
cellulose in varying proportions to provide the desired release
profile. Tablets may optionally be provided with an enteric
coating, to provide release in parts of the gut other than the
stomach.
[0142] The pharmaceutical compositions of the invention generally
comprise a buffering agent, an agent which adjusts the osmolarity
thereof, and optionally, one or more carriers, excipients and/or
additives as known in the art, e.g., for the purposes of adding
flavors, colors, lubrication, or the like to the pharmaceutical
composition. A preferred buffering agent is phosphate-buffered
saline solution (PBS), which solution is also adjusted for
osmolarity.
[0143] Carriers may include starch and derivatives thereof,
cellulose and derivatives thereof, e.g., microcrystalline
cellulose, xantham gum, and the like. Lubricants may include
hydrogenated castor oil and the like.
[0144] A preferred pharmaceutical formulation is one lacking a
carrier. Such formulations are preferably used for administration
by injection, including intravenous injection.
[0145] The preparation of pharmaceutical compositions is well known
in the art and has been described in many articles and textbooks,
see e.g., Remington's Pharmaceutical Sciences, Gennaro A. R. ed.,
Mack Publishing Co., Easton, Pa., 1990, and especially pp.
1521-1712 therein.
[0146] Additives may also be designed to enhance uptake of the
antisense oligonucleotide across cell membranes. Such agents are
generally agents that will enhance cellular uptake of
double-stranded DNA molecules. For instance, certain lipid
molecules have been developed for this purpose, including the
transfection reagents DOTAP (Roche Diagnostics), Lipofectin,
Lipofectam, and Transfectam, which are available commercially. For
a comparison of various of these reagents in enhancing antisense
oligonucleotide uptake see e.g., Quattrone et al. [Biochemica 1,
25, (1995)] and Capaccioli et al. [Biochem. Biophys. Res. Comm.
197, 818 (1993). The antisense oligonucleotide of the invention may
also be enclosed within liposomes. The preparation and use of
liposomes, e.g., using the above mentioned transfection reagents,
is well known in the art. Other methods of obtaining liposomes
include the use of Sendai virus or of other viruses. Examples of
publications disclosing oligonucleotide transfer into cells using
the liposome technique are e.g., Meyer et al. [J. Biol. Chem. 273,
15621-7 (1998)], Kita and Saito [Int. J. Cancer 80, 553-8 (1999)],
Nakamura et al. [Gene Ther. 5, 1455-61 (1998)] Abe et al. [Antivir.
Chem. Chentother. 9, 253-62 (1998)], Soni et al. [Hepatologv, 28,
1402-10 (1998)], Bai et al. [Ann. Thorac. Surg. 66, 814-9 (1998)
and see also discussion in the same journal p. 819-20], Bochot et
al. [Pharm. Res. 15, 1364-9 (1998)], Noguchi et al. [FEBS Lett.
433, 169-73 (1998)], Yang et al. [Circ. Res. 83, 552-9 (1998)],
Kanamaru et al. [J. Drug Target. 5, 235-46 (1998)] and references
therein. The use of Lipofectin in liposome-mediated oligonucleotide
uptake is described in Sugawa et al. [J. Neurooncol. 39, 237-44
(1998)]. The use of fusogenic cationic-lipid-reconstituted
influenza virus envelopes (cationic virosomes) is described in
Waelti et al. [Int. J. Cancer, 77, 728-33 (1998)].
[0147] The above-mentioned cationic or nonionic lipid agents not
only serve to enhance uptake of oligonucleotides into cells, but
also improve the stability of oligonucleotides that have been taken
up by the cell.
[0148] The invention also relates to a method for the treatment or
prevention of a progressive neuromuscular disorder or other disease
involving excessive production of AChE-R mRNA, comprising
administering the oligodeoxynucleotide of the invention or a
pharmaceutical composition of the invention or of any of the
preferred embodiments thereof, to a patient in need thereof.
[0149] Lastly, the invention relates to a method of administering
to a patient in need of such treatment a therapeutic agent for
treatment of a disorder or disease of the CNS, comprising the steps
of administering to said patient the antisense oligodeoxynucleotide
of the invention and said therapeutic agent. The administration of
the therapeutic agent may be simultaneous with the administration
of that of the antisense oligodeoxynucleotide of the invention, or
preceding or following the same. Rupture of the BBB by the
antisense oligodeoxynucleotide of the invention will facilitate the
passage of the therapeutic agent across the BBB and into the CNS,
where its effect is required.
[0150] Disclosed and described, it is to be understood that this
invention is not limited to the particular examples, process steps,
and materials disclosed herein as such process steps and materials
may vary somewhat. It is also to be understood that the terminology
used herein is used for the purpose of describing particular
embodiments only and not intended to be limiting since the scope of
the present invention will be limited only by the appended claims
and equivalents thereof.
[0151] It must be noted that, as used in this specification and the
appended claims, the singular forms "a", "an" and "the" include
plural referents unless the content clearly dictates otherwise.
[0152] Throughout this specification and the claims which follow,
unless the context requires otherwise, the word "comprise", and
variations such as "comprises" and "comprising", will be understood
to imply the inclusion of a stated integer or step or group of
integers or steps but not the exclusion of any other integer or
step or group of integers or steps.
[0153] The following Examples are representative of techniques
employed by the inventors in carrying out aspects of the present
invention. It should be appreciated that while these techniques are
exemplary of preferred embodiments for the practice of the
invention, those of skill in the art, in light of the present
disclosure, will recognize that numerous modifications can be made
without departing from the spirit and intended scope of the
invention.
EXAMPLES
Experimental Procedures
Animals:
[0154] Rats: EAMG was induced in female Lewis rats (120-150 g)
purchased from the Jackson Laboratory (Bar Harbor, Me.), and housed
in the Animal Facility at the Hebrew University Faculty of
Medicine, in accordance with NIH guidelines. Control FVB/N mice
were subjected to confined swim stress as described [Kaufer et al.,
1998 id ibid.]. Transgenic FVB/N mice overexpressing AChE-R were as
detailed [Sternfeld et al. (2000) Proc. Natl. Acad. Sci. USA 97,
8647-8652].
[0155] Monkeys: Purpose-bred female and male 15 month-old
Cynomolgus monkeys were used.
[0156] Oligonucleotides: HPLC-purified, GLP grade oligonucleotides
(purity >90% as verified by capillary electrophoresis) were
purchased from Hybridon, Inc. (Worchester, USA). Lyophilized
oligonucleotides were resuspended in sterile double distilled water
(24 mg/ml), and stored at -20.degree. C. The oligonucleotides were
prepared with phosphodiester linkages at all but the three terminal
3' positions at which 2'-O-methyl ribonucleotide substitutions were
made. The primary sequences used in this study were:
TABLE-US-00002 (human AS3, SEQ ID NO: 1) hEN 101
5'-CTGCCACGTTCTCCTGCACC-3' 2'-O-methylated
5'-CTGCCACGTTCTCCTGCA*C*C*-3' hEN101 (methylated nucleotides marked
with *) (mouse AS3, SEQ ID NO: 3) mEN101 5'-CTGCAATATTTTCTTGCACC-3'
[Grifman, M., and Soreq. H. (1997) Antisense Nucleic Acid Drug Dev
7, 351-9] (rat AS3, SEQ ID NO: 4) rEN101 5'-CTGCGATATTTTCTTGTACC-3'
[WO98/26062] (SEQ ID NO: 5) rEN102 5'-GGGAGAGGAGGAGGAAGAGG-3'
[WO98/26062] (SEQ ID NO: 6) r-invEN102 5'-GGAGAAGGAGGAGGAGAGGG-3'
[Meshorer, E. et al. (2002) id ibid]
[0157] Stability of hEN101: hEN101 was found to be stable (>90%
of original concentration) after storage for 2 h in human plasma
with EDTA at room temperature, following three freeze/thawing
cycles, or after 1 month at -20.degree. C. Exposure at room
temperature to Li-heparin-treated blood caused a decay of hEN101
with a half-life in the order of 30 min.
[0158] Antibodies: Rabbit polyclonal antibodies against the
C-terminal AChE-R were prepared and purified as described
[Sternfeld et al. (2000) ibid.]. Goat polyclonal anti-AChR (C-20,
S.C.-1448) antibodies were from Santa Cruz, (Santa Cruz,
Calif.).
[0159] Induction of EAMG: Torpedo acetylcholine receptor (T-AChR)
was purified from T. californica electroplax by affinity
chromatography on neurotoxin-Sepharose resin, as previously
described [Boneva, N. et al. (2000) Muscle & Nerve 23, 1204-8].
Rats were immunized with 40 .mu.g of purified T-AChR emulsified in
complete Freund's adjuvant supplemented with 1 mg of M.
tuberculosis H37Ra (Difco, Detroit Mich.). The animals were
injected subcutaneously in the hind footpads and a booster
injection of the same amount was given after 30 days. A third
injection was administered to animals that did not develop EAMG
after the second injection. Animals were weighed and inspected
weekly during the first month and daily after the booster
immunization, for evaluation of muscle weakness. The clinical
status of the rats was graded according to: 0--Without definite
weakness (treadmill running time, 23.+-.3 min); mild (1)--weight
loss >3% during a week, >10 min. running time on treadmill;
moderate (2)--moderate weakness accompanied by weak grip or cry
with fatigue, weight loss of 5-10%, 3-5 min. running on treadmill;
moderate-severe (3)-moderate to severe weakness, hunched back
posture at rest, head down and forelimb digit flexed, tremulous
ambulation, 10% body weight loss, 1-2 min. run on treadmill);
severe (4)--severe general weakness, no cry or grip, treadmill
running time <1 min, weight loss >10%; (5)--death.
[0160] Anti-AChR antibody determination: Serum was assayed by
direct radioimmunoassay, using .sup.125I-.alpha. bungarotoxin (BgT)
bound to T-AChR and to rat (R) AChR [Boneva et al. (2000) id ibid].
All the EAMG rats displayed high anti-T-AChR or anti-R-AChR titers,
with serum mean.+-.standard error (SE) values of 82.1.+-.16.0 nM
for anti-T-AChR antibodies and 19.9.+-.1.8 nM for anti-R-AChR.
Human serum was tested for the level of anti-AChR antibodies as
previously described [Drachman, D. B. (1994) N Engl J Med 330,
1797-810].
[0161] Quantification of nAChR: AChR concentration in the
gastrocnemius and tibialis muscles was determined using
.sup.125I-.alpha.-BgT binding followed by precipitation by
saturated ammonium sulfate as described previously [Boneva et al.
(2000) id ibid].
[0162] Immunocytochemistry: Muscle sections were deparaffinized
with xylene and were re-hydrated in graded ethanol solutions (100%,
90%, 70%) and PBS. Heat-induced antigen retrieval was performed by
microwave treatment (850 W for rapid boil following 10 min in
reduced intensity) in 500 ml of 0.01M citrate buffer pH 6.0. Slides
were cooled to room temperature and rinsed in double distilled
water. Non-specific binding was blocked by 4% normal donkey serum
in PBS with 0.3% Triton X-100 and 0.05% Tween 20 (1 hr at room
temperature). Biotinylated primary antibody was diluted (1:100 and
1:30 for rabbit anti-AChE-R [Sternfeld et al. (2000) id ibid] and
goat anti-nAChR, respectively) in the same buffer and slides were
incubated 1 hr at room temperature following overnight incubation
at 4.degree. C. Sections were rinsed and incubated with alkaline
phosphatase-conjugated secondary antibody, diluted in the same
blocking buffer 1 hr at room temperature and then overnight at
4.degree. C. Detection was with the alkaline phosphatase substrate
Fast Red (Roche Diagnostics, Mannheim, Germany). Slides were
simultaneously transferred to a stop solution (25 mM EDTA, 0.05%
Triton X-100, 1 mM levamisole in PBS, pH 7.2), rinsed in PBS and
cover-slipped with Immunomount (Shandon).
[0163] For spinal cord sections, primary mouse anti-SC35 antibody
was diluted (1:100) in the same buffer as the previous primary
antibodies, and slides were incubated 1 h at room temperature
following overnight incubation at 4.degree. C. Sections were rinsed
and incubated with peroxidase conjugated goat anti-mouse secondary
antibody, diluted in the same blocking buffer, for 1 h at room
temperature and then overnight at 4.degree. C. Detection was
performed with DAB substrate (Sigma). Slides were cover-slipped
with Immunomount (Shandon, Pittsburgh, Pa.).
[0164] Electromyography: Rats were anesthetized by i.p. injection
of 2.5 mg/Kg pentobarbital, immobilized, and subjected to
repetitive sciatic nerve stimulation, using a pair of concentric
needle electrodes at 3 Hz. Baseline compound muscle action
potential (CMAP) was recorded by a concentric needle electrode
placed in the gastrocnemius muscle, following a train of repetitive
nerve stimulations at supramaximal intensity. Decrease (percent) in
the amplitude of the fifth vs. the first muscle action potential
was determined in two sets of repetitive stimulations for each
animal. A reduction of 10% or more was considered indicative of
neuromuscular transmission dysfunction.
[0165] Drug administration: Intravenous injections and blood
sampling for anti-AChR antibodies testing were via the right
jugular vein under anesthesia. For oral administration, a special
needle for oral gavage feeding was used, which is curved with a
ball end (Stoelting, Wood Dale Ill.). Mestinon.RTM. was
administered in a dose of 1 mg/kg/day, and purchased from Hoffmann
La-Roche, Basel, Switzerland.
[0166] Exercise training on treadmill: To establish a clinical
measure of neuromuscular performance in EAMG rats, a treadmill
assay was performed. Animals were placed on an electrically powered
treadmill [Moran et al. (1996) J Therm Biol 21, 171-181] at 25
m/min (a physical effort of moderate intensity) until visibly
fatigued. The amount of time the rats were able to run was recorded
before and after anti-sense or Mestinon.RTM. treatment.
[0167] In situ hybridization: Tissues were fixed in 4%
paraformaldehyde and cut into 7 Lm paraffin embedded sections.
Spinal cord sections were deparaffinized, rehydrated using serial
ethanol dilutions and permeabilized with proteinase K (10 .mu.g/ml
at room temp.). Slides were exposed to 5' biotinylated, fully
2'-oxymethylated AChE-R or AChE-S-specific 50-mer cRNA probes
complementary to human ACHE pseudo-intron 4 or exon 6, respectively
[Grisaru et al. (2001) id ibid.]. Hybridization was performed
overnight at 52.degree. C. in hybridization mixture containing 10
.mu.g/ml probe, 50 .mu.g/ml yeast tRNA, 50 .mu.g/ml heparin and 50%
formamide in 375 mM Na chloride, 37.5 mM Na citrate, pH 4.5. For
monkey sections, the probe was constructed according to the human
AChE-R sequence; for rat sections, according to the mouse sequence.
Slides were washed to remove non-hybridized probe, blocked with 1%
skim milk containing 0.01% Tween-20 and 2 mM levamisole, an
alkaline phosphatase inhibitor used to suppress non-specific
staining and incubate with streptavidin-alkaline phosphatase
(Amersham Pharmacia). Fast Red.TM.substrate (Roche Diagnostics) was
used for detection. DAPI staining (Sigma Chemical Co., St. Louis,
Mo., USA) served to visualize nuclei. Microscope images were
analyzed with Image Pro Plus 4.0 (Media Cybernetics) software.
[0168] Serum analyses: Blood samples drawn from EAMG rats and MG
patients were subjected to non-denaturing gel electrophoresis as
described [Kaufer et al. (1998) id ibid], as well as to catalytic
activity measurements of AChE [Shapira et al. (2000) id ibid].
Iso-OMPA (tetraisopropylpyrophosphoramide, 5.times.10-5 .mu.M), was
used to block butyrylcholinesterase activity in the serum samples.
For activity staining on polyacrylamide gels [Kaufer et al. (1998)
id ibid] we used 510-6 M iso-OMPA.
[0169] Protocol for Phase Ib Clinical Trial of MG patients using
hEN101: Patients were hospitalized and pyridostigmine was
discontinued for 12-18 hours before EN101 testing. Assessment of MG
status was performed first at entry, then after pyridostigmine
stoppage, and regularly after EN101 treatment using a Quantitative
MG (QMG) score. Escalating oral doses of EN101 (10-150 g/kg) were
given in the first day (day 1), followed by a daily dose of 500
.mu.g/kg for 3 days (days 2-4). Days 5 and 6 were washout period
without pyridostigmine, and restitution of pyridostigmine occurred
when it became necessary. Patients were monitored for 1 month
thereafter, with three visits as out-patients.
[0170] The following parameters were used as inclusion criteria:
[0171] Class II and above, according to MGFA classification
(myasthenia gravis standard clinical classification of the disease
severity score); [0172] Age 18-70; [0173] Seropositive for AChR
antibodies; [0174] Patients under pyridostigmine (180 mg/day)
treatment without concomitant immunosuppressants; [0175] Stable for
3 months, with no PE (plasma exchange) for 6 months; [0176] No
other major or active diseases.
[0177] Evaluation of the MG status of each patient was based on the
following parameters: [0178] (a) QMG scoring (maximum value of 9),
based on the measurements of: [0179] Fatigue in each limb (4);
[0180] Fatigue of the neck (1); [0181] Swallowing rate (1); [0182]
Power in the hands (2); [0183] Respirometry (1). [0184] These
measurements were taken daily, 4 times per day, and averaged for
days 2-6. [0185] (b) Patient's subjective report; [0186] (c) Vital
signs, clinical chemistry, hematology, urinalysis, ECG and physical
examination, recorded daily.
Example 1
AChE-R Accumulate in Blood and Muscle of EAMG Rats
[0187] As previously shown by the inventors, the AChE-R variant
migrates on non-denaturing polyacrylamide gels faster than the
tetrameric synaptic enzyme, AChE-S [Kaufer et al. (1998) id ibid.],
and it is present in the serum of MG patients [WO01/36627].
Similarly, immunoblot analysis confirmed that in EAMG rats, as
compared with healthy rats, there was a massive increase in serum
AChE-R (FIG. 7).
[0188] Expression of alternative AChE variants (FIG. 8A), as well
as of the nicotinic acetylcholine receptor (nAChR), was tested in
control and EAMG rats. Depletion of nAChR in muscle sections from
EAMG rats was detected, as evidenced by a quantitative immunoassay
using antibodies against nAChR (FIG. 8B, 1 and 2). The
immunostaining showed that muscle nAChR was reduced by 48.+-.7%
from normal values in 10 mildly affected animals (disease grade
1-2, see Experimental Procedures) and by 75.+-.5% in 10 severely
affected rats (grade 4) compared to controls (FIG. 8B, 1 and 2),
attesting to the myasthenic nature of this animal model.
Immunohistochemical staining with a polyclonal antiserum that
selectively detects AChE-R [Sternfeld et al. (2000) id ibid]
revealed positive signals in some, but not all muscle fibers of
control rats. Similar patterns appeared under treatment with the
inert, inversely oriented oligonucleotide r-invEN102 (see FIG. 8B,
3). In EAMG rats (FIG. 8B, 4), staining of AChE-R showed it as more
generally distributed, with the dispersed cytoplasmic localization
that is characteristic of this isoform [Soreq, H., and Seidman, S.
(2001) Reviews Neuroscience 2, 294-302], contrasting with the
sub-synaptic cluster distribution of the synaptic variant [Rossi,
S. G. and Rotundo, R. L. (1993) J Biol Chem 268, 19152-9]. Both the
level of expression and the cellular distribution of muscle AChE-S
were similar in EAMG and healthy, untreated and r-invEN102-treated
rats.
[0189] In situ hybridization using variant-selective probes showed
that AChE-S mRNA was sub-synaptically located in muscles from both
untreated and r-invEN102-treated, healthy and EAMG rats (FIG. 8B, 5
and 6). In contrast, healthy rats displayed weaker and diffuse
labeling of the AChE-R mRNA transcript, whereas a more pronounced
punctuate labeling of AChE-R mRNA appeared in triceps muscles of
EAMG rats, unaffected by r-invEN102 treatment (FIG. 8B, 7 and 8).
This accumulation in regions rich in densely clustered nuclei was
consistent with previous observations of sub-synaptic regions
[Rossi and Rotundo (1993) id ibid]. These data indicate a selective
over-expression of AChE-R in muscles of EAMG rats and strengthened
the idea of a role for this enzyme variant in MG
pathophysiology.
Example 2
AChE-R and AChE-R mRNA Levels in Muscle Respond to rEN101
[0190] The soluble and secretory nature of AChE-R predicted that it
would degrade acetylcholine before it reaches the post-synaptic
membrane, limiting receptor activation. To test this hypothesis,
rEN101 antisense oligonucleotide was used, which is capable of
selective suppression of AChE-R production [Galyam, N. et al.
(2001) Antisense Nucl Acid Drug Dev 11, 51-57]. AChE-R suppression
was tested in healthy and EAMG rats with reduced muscle nAChR
levels (FIG. 8B, 1 and 2) 24 h after a single i.v. injection of 250
g/Kg rEN101. Immunohistochemical staining demonstrated that AChE-R,
but not AChE-S, was significantly reduced in muscles from both
healthy and EAMG rats (FIG. 8C, 3 and 4 and data not shown).
Receptor labeling patterns remained high in healthy rats and low in
EAMG animals, similar to those of untreated animals and animals
treated with r-invEN102 (compare FIG. 8B, 1 and 2 to FIG. 8C, 1 and
2). In situ hybridization indicated that AChE-S mRNA labeling,
limited to the sites of subsynaptic clusters of nuclei, was only
nominally affected by rEN101, suggesting that neuromuscular
transmission would be unaffected by this treatment (FIG. 8C, 5 and
6). In contrast, rEN101 reduced AChE-R mRNA labeling almost to the
limit of detection in both healthy and myasthenic rats (FIG. 8C, 7
and 8).
Example 3
Suppression of AChE-R Restores Normal CMAP in EAMG Rats
[0191] Quantification by densitometry of an immunoblot analysis
confirmed the increase of serum AChE-R in EAMG and the efficacy of
a single i.v. injection of 250 .mu.g/Kg rEN101, but not r-invEN102,
in reducing its serum level 24 h later (FIG. 9A). To evaluate the
physiological outcome of this suppression, compound muscle action
potentials (CMAPs) from the gastrocnemius muscle were recorded.
EAMG rats, but never healthy animals, displayed a decline in CMAP
during repeated stimulation at 3 Hz. The baseline decline, the
percent difference in the heights of the fifth and the first evoked
potentials, ranged from 10% to 36% (mean.+-.SEM=13.0.+-.2.5%, FIG.
9B, inset) as compared to 4.0.+-.0.9% among healthy rats. The
standard therapy for MG patients is administration of
anti-cholinesterases, which elevate ACh levels to a threshold that
enables receptor activation. Accordingly, neostigmine bromide
(Prostigmine.TM., 75 .mu.g/kg) was administered via i.p. This
rapidly and effectively corrected the CMAP decline in EAMG rats,
from 87.6% of the first evoked potential in untreated animals to
over 120% of this level (i.e. 107.4%) of the first evoked
potential). The effects of the cholinesterase blockade were evident
starting 15 min after the injection and lasted 2 h, after which
time the CMAP value returned to the baseline (FIG. 9B).
[0192] Unlike anticholinesterases, which block all AChE variants,
rEN101 was shown to selectively suppress muscle AChE-R production
[Lev-Lehman et al. (2000) id ibid]. Therefore, retrieval of stable
CMAP in rEN101-treated EAMG rats may attest to the causal role of
AChE-R in the neuromuscular malfunctioning that is characteristic
of the myasthenic phenotype. To test this concept, rEN101 was
injected i.v. at doses ranging from 10-500 .mu.g/Kg (2 to 20
nmol/rat). rEN101 did not affect CMAP in healthy animals, but
retrieved stable CMAP ratios within 1 h (FIG. 9B, inset, 9C and
Table 1). CMAP normalization was accompanied by increased mobility,
upright posture, stronger grip, and reduced tremulousness of
ambulation.
TABLE-US-00003 TABLE 1 Post-treatment CMAP ratios.sup.a Oral.sup.b
Intravenous.sup.b Phenotype EAMG EAMG Naive EAMG EAMG EAMG
Treatment Naive EN101 EAMG EN101 EAMG EN102 invEN102 pyridostigmine
EN101 EN101 EN102 invEN102 0 h 1.01 .+-. 0.01 0.84 .+-. 0.03 0.82
.+-. 0.02 0.78 .+-. 0.06 0.90 .+-. 0.01 1.00 .+-. 0.0 0.87 .+-.
0.01 0.85 .+-. 0.06 0.89 .+-. 0.02 (4) (8) (4) (4) (6) (6) (6) (4)
(5) .sup. 1 h.sup.c 1.0 .+-. 0.02 0.97 .+-. 0.02 0.86 .+-. 0.04
0.86 .+-. 0.05 0.98 .+-. 0.01 0.02 .+-. 0.01 1.00 .+-. 0.01 1.04
.+-. 0.01 0.89 .+-. 0.03 (4) (8) (3) (4) (6) (7) (4) (4) (5) 5 h
1.03 .+-. 0.02 0.97 .+-. 0.03 0.96 .+-. 0.02 0.86 .+-. 0.05 0.96
.+-. 0.02 1.00 .+-. 0.01 0.98 .+-. 0.02 0.98 .+-. 0.03 0.89 .+-.
0.02 (4) (7) (4) (4) (6) (6) (4) (4) (5) 24 h 1.01 .+-. 0.00 1.01
.+-. 0.01 0.95 .+-. 0.03 0.81 .+-. 0.08 0.87 .+-. 0.02 1.02 .+-.
0.01 1.00 .+-. 0.00 1.00 .+-. 0.01 0.90 .+-. 0.02 (7) (6) (5) (4)
(6) (6) (4) (4) (5) .sup.aCMAP ratios (5.sup.th vs. 1.sup.st
amplitude) were determined at the noted times following treatment.
The averages .+-. SEM are presented. Each treatment represents
similarly, although not simultaneously treated rats, the numbers of
which are shown in parentheses. .sup.bDrug doses were 50 .mu.g/Kg
for rEN101, rEN102 or r-invEN102 and 1000 .mu.g/Kg for
pyridostigmine (Mestinon Bromide), for both administration routes.
.sup.cNote the apparently delayed effect of orally administered
rEN102 as compared to rEN101 or pyridostigmine.
[0193] Both the extent and the duration of CMAP correction were
dose dependent. For example, 500 .mu.g/Kg conferred 72 h
rectification of CMAP up to 125% of baseline, while 50 .mu.g/Kg was
effective for only 24 h. rEN102, a 3' protected AS-ON targeting a
sequence unique to rAChE-R mRNA (previously referred to as AS1)
[Grifman and Soreq (1997) id ibid], induced similar rectification
of CMAP decline in EAMG rats, confirming the relevance of AChE-R as
a contributing element to this effect. Comparable amounts of
r-invEN102, did not improve muscle function, attesting to the
sequence specificity of the AS-ON treatment (Table 1). Dose
response curves revealed that up to 5 h following an injection,
rEN101 produced a saturable response with IC.sub.50 of <10
.mu.g/Kg. This effect appeared to be superimposed on a longer
lasting and less concentration-dependent effect, which showed no
saturation in the range studied (FIG. 9D). This phenomenon possibly
reflected the altered muscle and/or neuromuscular junction
properties under the stable CMAP retrieval afforded by rEN101.
Example 4
Antisense Prevention of AChE-R Accumulation Promotes Stamina in
EAMG Rats
[0194] Placed on a treadmill at 25 m/min, healthy rats ran for
23.0.+-.3.0 min, after which time they displayed visible signs of
fatigue. Starting at 5 h, and for at least 24 h following
administration of 250 .mu.g/Kg rEN101, EAMG rats demonstrated
improved performance on the treadmill. Running time increased from
247.+-.35, 179.+-.21 and 32.+-.6 sec to 488.+-.58, 500.+-.193 and
212.+-.59 sec for animals at disease grades 2, 3 and 4,
respectively (average values for 6-9 animals per group.) Healthy
animals, in contrast, were not significantly affected by rEN101
injection (FIG. 10).
[0195] Others have demonstrated efficacy of orally administered
2'-oxymethyl protected AS-ON agents [Monia, B. P. (1997) Ciba
Found. Symp. 209, 107-119]. Therefore, the inventors tested this
mode in the EAMG model. Based on their own findings, the inventors
selected the dose of 50 .mu.g/Kg of rEN101, which was administered
to EAMG rats once a day via oral gavage, and CMAP was measured 1,
5, and 24 h later. This dose was as effective as 25 .mu.g/Kg
administered i.v. (Table 1 and FIGS. 9 and 13). Orally administered
rEN102 was also active in reversing CMAP decline, but its effects
appeared somewhat delayed compared to rEN101. Oral pyridostigmine
(1000 .mu.g/kg) restored CMAP for up to several hours, while
r-invEN102 had no significant effect (Table 1).
Example 5
Oral Administration of Human EN101 to EAMG Rats
[0196] Human EN 101 (hEN101) (0.25 .mu.g/g, single dose) was
administered orally to rats with EAMG of medium severity (score
2.5-3.5), which implied the symptoms defined as "moderate"
hereunder. The results are summarized in Table 1. Time from
treatment is noted above; together with the treadmill running time
in sec. Animals were inspected at each time point for evaluation of
muscle weakness. The clinical status of the rats was graded
according to: (0)--Without definite weakness (treadmill running
time, 23.+-.3 min); Mild (1)--weight loss >3% during a week,
>10 min. running time on treadmill; Moderate (2)--moderate
weakness accompanied by weak grip or cry with fatigue, weight loss
of 5-10%, 3-5 min. running on treadmill; Moderate-severe
(3)-moderate to severe weakness, hunched back posture at rest, head
down and forelimb digit flexed, tremulous ambulation, 10% body
weight loss, 1-2 min. run on treadmill); Severe (4)--severe general
weakness, no cry or grip, treadmill running time <1 min, weight
loss >10%; Death (5). Each line represents an individual rat. It
is to be noted that the clinical score (in parentheses) was reduced
in all of the treated animals, which reflects time improvement, and
that running time was significantly increased for over and 24 hr
for most of the animals and for two of the tested animals also at
48 h.
TABLE-US-00004 TABLE 2 Treadmill Performance Time (Clinical score)
before Animal (basal) 5 h 24 h 48 h Effect 1 110 sec 150 sec 360
sec ND ++ (3) (1) 2 0 (3.5) 70 sec 30 sec ND +- (3) 3 210 sec 300
sec 345 sec ND ++ (2.5) (1) 4 80 (3) ND 170 sec 85 (2.5) +- (2) 5
180 (2.5) |||| 380 290 (2) ++ (1) 6 30 (3.5) 120 |||| (3) || (5)
+
These results show that like the rat EN101 (see treadmill example,
above), the human EN101 antisense oligodeoxynucleotide of the
invention promoted muscle stamina in EAMG induced rats.
Example 6
Comparative Analysis of hEN101 and rEN101 in a Rat Animal Model
[0197] A study of the potential efficacy as well as toxicity of
hEN101 was conducted on 4 week-old Crl:CD rats. To groups of 12
animals (6 males, 6 females) were administered 0.0 (saline only),
0.50 or 2.50 .mu.g/g/day of hEN101 by oral gavage (o.g.), 0.50
.mu.g/g/day of rEN101 by o. g., or 0.50 .mu.g/g/day of rEN101 or
hEN101 by i.v. injection. Additionally, there was a control group
that was not injected. For 7 days the animals were checked for
gross signs of toxicity: mortality, body weight, food consumption,
ophtalmology, hematology (peripheral blood), and blood chemistry.
At 7 days they were sacrificed and examined post mortem for
macroscopic pathology and organ weight. Fixed sections of brain
(cerebellum, cerebrum, midbrain, medulla), heart (auricular and
ventricular regions), kidneys (cortex, medulla, papilla regions),
liver (all main lobes), lungs (two major lobes, including bronchi),
lymph nodes (mandibular and mesenteric), spinal cord (transverse
and longitudinal sections at cervical, lumbar and thoracic levels),
caecum, colon, duodenum, ileum, jejunum, esophagus, rectum, spleen
and stomach (keratinized, glandular and antrum) were stained with
hematoxylin/eosin to reveal necrosis or cell death.
[0198] Mandibular lymph nodes were examined for the effect of EN101
on AChE-R mRNA. Compared to the saline-injected control, rEN101
(oral or i.v.) or hEN101 (i.v.) were inconsistent in depressing
AChE-R mRNA levels within these lymph nodes (data not shown). In
contrast, the administration of rEN101 (oral or i.v.) or hEN101
(i.v.) did not affect the expression of the AChE-S synaptic variant
of AChE in these mandibular lymph nodes (data not shown). Thus, the
antisense oligodeoxynucleotide of the invention may be used to
suppress the AChE-R variant without affecting the expression of the
synaptic variant, i.e. without adversely affecting cholinergic
transmission.
Example 7
AChE-R Suppression Modifies the Course of EAMG Pathophysiology
[0199] As shown in Example 5, unlike anti-cholinesterases, rEN101
afforded long-term maintenance of stable CMAP. This further enabled
the inventors to test whether the cholinergic imbalance contributes
to the physiological deterioration that is characteristic of EAMG.
Rats were first treated with rEN101 once a day for 5 days, CMAPs
being determined prior to each treatment. Both the efficacy of
rEN101 in retrieving normal CMAP and its capacity to reduce the
inter-animal variability in CMAP values reached similar levels to
those of pyridostigmine (FIGS. 11A and 11B). However, the onset of
response to pyridostigmine was more rapid (Table 1), while that
observed with rEN101 was longer-lasting. Daily oral or i.v
administration of rEN101 stabilized CMAPs over the entire course of
treatment (FIG. 11B). In contrast, the effect of pyridostigmine
wore off within several hours, causing pronounced fluctuations in
muscle status (Table 1 and FIG. 11). Among the animals treated
daily with pyridostigmine, 5 out of 6 died within the 5 day
experimental course. In contrast, 6 out of 8 animals treated
once-a-day with rEN101 via o.g. survived the full 5 day period.
This conspicuous difference might reflect the susceptibility of
EAMG rats to repeated anesthesia and CMAP measurements. In order to
avoid these additional stresses and evaluate the effect of the
antisense treatment on EAMG pathophysiology, the inventors
subjected groups of moderately sick animals to 1 month of daily
oral treatment with minimal interference. EAMG rats receiving oral
doses of rEN101 daily, presented significant improvement in
survival, clinical status and treadmill performance, as compared
with pyridostigmine- and saline-treated animals (FIG. 12;
P<0.041 for 4 weeks survival incidence, Fisher exact test, AS-ON
vs. other treatments). One way repeated measures ANOVA yielded
P<0.05 for all other measures (AS vs. other treatments at 4
weeks). The effect of rEN101 on clinical symptoms was also
corroborated by body weight changes. Rats treated with saline and
Mestinon treated groups lost 13.5 and 11 g/animal, respectively,
whereas animals treated with rEN101 gained, on average, 13 g during
the treatment period. Thus, daily rEN101 administration promoted
long-term change in the course of EAMG in rats with moderate to
severe symptoms, under the same conditions in which untreated or
pyridostigmine-treated animals deteriorated.
[0200] By using MG and EAMG as case studies for evaluating the
consequences of chronic neuromuscular imbalance at the level of
gene expression, the inventors confirmed that the AChE-R variant is
systemically elevated in MG and EAMG. Moreover, the inventors
showed that antisense suppression of AChE-R normalized NMJ
responses to repeated nerve stimulation, promoting muscle strength,
and recuperating a healthier status in animals otherwise too weak
even to eat. These observations support the idea that AChE-R plays
a direct role in MG pathophysiology and call for evaluation of the
rationale of long-term mRNA-targeted therapy for imbalanced
cholinergic function at NMJs.
Example 8
Oral Administration of hEN101 to Cynomolgus Monkeys
[0201] This experiment was conducted with six (3 males and 3
females) purpose-bred 15 month-old (young adult) Cynomolgus
monkeys, divided in three groups (1, 2 and 3) of one male and one
female each. Groups 1 and 2 received hEN101 daily by o.g. for a
period of 7 days, at a concentration of 0.15 and 0.50 .mu.g/g/day,
respectively. Group 3 received daily i.v. injections of hEN101 for
a period of 7 days at a dosage of 0.50 .mu.g/g/day.
[0202] Over a 12 hour period, plasma samples were obtained during
the second treatment day to investigate the toxicokinetic profile
at each dosage. The toxicology study consisted of checking the
animals during the 7 days of treatment for gross signs of toxicity
by the following parameters: mortality, body weight, food
consumption, electrocardiography, blood pressure, hematology
(peripheral blood), and blood chemistry. At 7 days the monkeys were
sacrificed and examined post-mortem for macroscopic pathology and
organ weight. Fixed sections of brain (cerebellum, cerebrum,
midbrain, medulla), caecum, colon, duodenum, heart (auricular and
ventriclar regions), ileum, jejunum, kidneys (cortex, medulla.
papilla regions), liver (two main lobes), lungs (two major lobes,
including bronchi), lymph nodes (mandibular and mesenteric),
esophagus, rectum, sciatic nerve, skeletal muscle (thigh), spinal
cord (transverse and longitudinal sections at cervical level),
spleen and stomach (body and antrum) were stained with
hematoxylin/eosin to reveal necrosis or cell death.
[0203] These clinical investigations revealed no toxicological
effects by any of the treatment protocols. Post-mortem there were
no treatment-related effects other than slight healing erosions in
the body of the stomach, which are possibly associated with
treatment, in 1 of 2 animals in each group, and some irritation of
the perivascular tissue at the site of intravenous injection.
[0204] Paraffin-embedded 7 .mu.m spinal cord sections were examined
by in situ hybridization for the levels of AChE-R and AChE-S mRNA.
Under all three regimens (oral 0.15 and 0.50, and i.v. 0.50
.mu.g/g/day), there was no apparent reduction in AChE-S mRNA (FIG.
14). However, there was a significant reduction in AChE-R mRNA in
increasing hEN101 daily dose from 0.15 (oral) to 0.50 (oral or
i.v.) with i.v. dosage being more effective.
[0205] AChE-R-positive sections from monkey spinal cords were
analyzed for the relation between cell body diameter and percentage
of AChE-R positive cells (FIG. 15). Cells were divided into three
categories according to their body diameter, and the percentage of
AChE-R-positive cells from each category was evaluated. Treatment
with the lower concentration of EN101 (150 .mu.g/kg/day) caused an
increase in the percent of small AChE-R-positive cells (<70
.mu.m diameter) as compared to naive monkeys, probably due to the
injection stress response, which is known to raise AChE-R mRNA
levels (Kaufer et al, 1998). Either i.v. or p.o. administration of
the higher EN101 concentration (500 .mu.g/kg/day) reduced the
percentage of AChE-R-positive neurons, compared to the lower
concentration (p<0.05, Student's t test). The decrease was more
remarkable in small neurons (23-40 .mu.m) than in neurons with cell
body diameter of 40-70 .mu.m, and no decrease was observed in large
neurons (>70 .mu.m diameter) (FIG. 15). The percentage of small-
(23 to 40 .mu.m-diameter) and medium-sized (40 to 70 .mu.m) neurons
that were labeled decreased significantly in moving from the lower
to the higher hEN101 oral dose, and even further with the i.v.
administration. Among the larger neurons (>70 .mu.m), there was
not discernable effect of hEN101. We have yet to discover the
functional correlate of cell size that determines the efficacy of
antisense suppression of AChE-R expression. This suggests that
EN101 will prevent the stress-induced impairment in interneurons
input to motoneurons, thus preventing paralysis--e.g.
post-surgery.
Example 9
hEN101 Suppression of AChE Activity in Monkey Plasma
[0206] In the 12 hr following the second day administration of
hEN101, monkey plasma samples were collected and stored. Plasma
cholinesterase activities were measured by spectrophotometry
assessing the rate of hydrolysis of acetylthiocholine (measured by
the Ellman assay, which quantifies the hydrolysis of
acetylthiocholine) [Ellman, G. L., et al. (1961), Biochem.
Pharmacol. 7, 88-95], in the absence or presence of iso-OMPA (a
selective butyrylcholinesterase, BChE, inhibitor). Total activity,
largely due to serum BChE, was generally unchanged (FIG. 16A). When
measured in the presence of 1.times.10.sup.-5 M iso-OMPA, AChE
activity increased within the 5 hr post-injection. This increase,
observed under 150 .mu.g/kg was effectively suppressed or
attenuated by the higher dose of 500 .mu.g/kg hEN101, and even more
effective when this dose was i.v. administered (FIG. 16B).
Example 10
Effect of rEN101 on Expression AChE-R mRNA in Rat Spinal Cord
Neurons
[0207] Contrary to the effect of hEN101 on monkey spinal cord
neurons, rEN101 does not suppress AChE-R mRNA in the rat spinal
cord (FIG. 17), when assessed by in situ hybridization using a
mouse probe. Neither the number of positive cells nor the staining
intensity were significantly changed. One explanation for this
result would be that the blood-brain barrier that isolates the CNS
is more permeable in monkeys than rats, at least under the chosen
experimental conditions.
Example 11
hEN101 Phase Ib Clinical Trial
[0208] 16 patients with stable generalized MG requiring constant
AChE inhibitors (pyridostigmine) for daily function were recruited,
after approval by human ethics committees of the respective
hospitals involved in the present trial (Hadassah Medical Center,
Jerusalem, Israel and Greater Manchester Neurosciences Center, Hope
Hospital, Salford, England).
[0209] Analysis of the results obtained from the Clinical trial
showed that in 15 out of 16 patients, the initial deterioration in
MG status after stopping pyridostigmine was followed by a clear
symptomatic improvement due to hEN101. As an example, FIG. 18 shows
the improvement in ptosis in one of the MG patients. Analysis of
the mean daily QMG scores showed a continuous decrease in each of
the study days (decrease in QMG means improvement in disease
status) (FIGS. 21A and 21B)., The baseline (entry) mean total score
was 13.2. The score decreased for days 2 through 6 in the amounts
of 3.0, 4.8, 5.7, 5.5 and 6.0 (p<0.001). The mean percent
improvement of total QMG for these days ranged from 27.8% to 53.4%
(FIG. 20) (p<0.01). All individual test item scores, except for
vital capacity and left arm out stretched time, had statistically
significant change from entry for days 2-6 (p<0.05). Improved
QCG scores following the final dose of hEN101 were sustained for up
to 72 hours. No serious adverse effects were observed. Vital signs,
chemical chemistry, hematology, urinalysis, ECG and physical
examination remained unchanged throughout the experimental period
and in the month following discharge. Cholinergic side effects were
not reported.
[0210] Thus, hEN101 appears to be powerfully effective in reversing
symptoms in patients with stable MG. The present study showed that
hEN101 has potential advantages over conventional cholinesterase
inhibitors with respect to dosing, specificity, side-effect
profile, duration of efficacy and treatment regimen.
Sequence CWU 1
1
13120DNAArtificial Sequencehuman EN101 1ctgccacgtt ctcctgcacc
2029DNAArtificial Sequenceloop in EN101 2cgcgaagcg
9320DNAArtificial Sequencemouse EN101 3ctgcaatatt ttcttgcacc
20420DNAArtificial Sequencerat EN101 4ctgcgatatt ttcttgtacc
20519DNAArtificial Sequencerat EN102 5gggagaggag gaggagagg
19620DNAArtificial Sequencerat inverse EN102 6ggagaaggag gaggagaggg
2072218DNAHomo sapiens 7ctctcccctc atctttgcca acctgcccca cctcctctgc
agctgagcga taacccttgg 60gccgacagtg ccctaatctc ctccctcctg gcttctcgac
cgacccttca ccctttccct 120ttctttctcc cagcagacgc cgcctgccct
gcagccatga ggcccccgca gtgtctgctg 180cacacgcctt ccctggcttc
cccactcctt ctcctcctcc tctggctcct gggtggagga 240gtgggggctg
agggccggga ggatgcagag ctgctggtga cggtgcgtgg gggccggctg
300cggggcattc gcctgaagac ccccgggggc cctgtctctg ctttcctggg
catccccttt 360gcggagccac ccatgggacc ccgtcgcttt ctgccaccgg
agcccaagca gccttggtca 420ggggtggtag acgctacaac cttccagagt
gtctgctacc aatatgtgga caccctatac 480ccaggttttg agggcaccga
gatgtggaac cccaaccgtg agctgagcga ggactgcctg 540tacctcaacg
tgtggacacc atacccccgg cctacatccc ccacccctgt cctcgtctgg
600atctatgggg gtggcttcta cagtggggcc tcctccttgg acgtgtacga
tggccgcttc 660ttggtacagg ccgagaggac tgtgctggtg tccatgaact
accgggtggg agcctttggc 720ttcctggccc tgccggggag ccgagaggcc
ccgggcaatg tgggtctcct ggatcagagg 780ctggccctgc agtgggtgca
ggagaacgtg gcagccttcg ggggtgaccc gacatcagtg 840acgctgtttg
gggagagcgc gggagccgcc tcggtgggca tgcacctgct gtccccgccc
900agccggggcc tgttccacag ggccgtgctg cagagcggtg cccccaatgg
accctgggcc 960acggtgggca tgggagaggc ccgtcgcagg gccacgcagc
tggcccacct tgtgggctgt 1020cctccaggcg gcactggtgg gaatgacaca
gagctggtag cctgccttcg gacacgacca 1080gcgcaggtcc tggtgaacca
cgaatggcac gtgctgcctc aagaaagcgt cttccggttc 1140tccttcgtgc
ctgtggtaga tggagacttc ctcagtgaca ccccagaggc cctcatcaac
1200gcgggagact tccacggcct gcaggtgctg gtgggtgtgg tgaaggatga
gggctcgtat 1260tttctggttt acggggcccc aggcttcagc aaagacaacg
agtctctcat cagccgggcc 1320gagttcctgg ccggggtgcg ggtcggggtt
ccccaggtaa gtgacctggc agccgaggct 1380gtggtcctgc attacacaga
ctggctgcat cccgaggacc cggcacgcct gagggaggcc 1440ctgagcgatg
tggtgggcga ccacaatgtc gtgtgccccg tggcccagct ggctgggcga
1500ctggctgccc agggtgcccg ggtctacgcc tacgtctttg aacaccgtgc
ttccacgctc 1560tcctggcccc tgtggatggg ggtgccccac ggctacgaga
tcgagttcat ctttgggatc 1620cccctggacc cctctcgaaa ctacacggca
gaggagaaaa tcttcgccca gcgactgatg 1680cgatactggg ccaactttgc
ccgcacaggg gatcccaatg agccccgaga ccccaaggcc 1740ccacaatggc
ccccgtacac ggcgggggct cagcagtacg ttagtctgga cctgcggccg
1800ctggaggtgc ggcgggggct gcgcgcccag gcctgcgcct tctggaaccg
cttcctcccc 1860aaattgctca gcgccaccga cacgctcgac gaggcggagc
gccagtggaa ggccgagttc 1920caccgctgga gctcctacat ggtgcactgg
aagaaccagt tcgaccacta cagcaagcag 1980gatcgctgct cagacctgtg
accccggcgg gacccccatg tcctccgctc cgcccggccc 2040cctagctgta
tatactattt atttcagggc tgggctataa cacagacgag ccccagactc
2100tgcccatccc caccccaccc cgacgtcccc cggggctccc ggtcctctgg
catgtcttca 2160ggctgagctc ctccccgcgt gccttcgccc tctggctgca
aataaactgt tacaggcc 221882089DNAMus musculus 8atgaggcctc cctggtatcc
cctgcataca ccttccctgg cttttccact cctcttcctc 60ctcctctccc tcctgggagg
aggggcaagg gctgagggcc gggaagaccc gcagctgctg 120gtgagggttc
gagggggcca gctgaggggc atccgcctga aggcccctgg aggcccagtc
180tcagcttttc tgggcatccc ctttgcagag ccacctgtgg gctcacgtag
atttatgcca 240ccagagccca agcggccctg gtcaggagtg ttggatgcta
ccaccttcca aaatgtctgc 300taccagtacg tggacaccct gtaccctggg
tttgagggta ctgagatgtg gaaccccaac 360cgagagttga gtgaagactg
cctgtatctt aatgtgtgga caccataccc cagacctgct 420tctcccacac
ctgtcctcat ctggatctat gggggtggtt tctacagcgg agcggcctcc
480ttggatgtgt atgacggccg tttcctggcc caggttgagg gagctgtgtt
ggtatctatg 540aactaccgag tgggaacctt tggcttcttg gccctaccag
gaagcagaga agcccctggc 600aatgtaggtc tgctggatca acggcttgcc
ttgcaatggg tgcaagaaaa tattgcagcc 660tttgggggcg acccgatgtc
agtgactctg tttggggaga gtgcgggtgc agcctccgtg 720ggcatgcaca
tactgtccct gcccagcagg agcctcttcc acagggctgt cctccagagt
780ggcacaccca atgggccctg ggccactgtg agtgctggag aggccaggcg
cagggccaca 840ctgctggccc gccttgtggg ctgtccccca ggtggcgctg
gtggcaatga caccgagctg 900atagcctgct tgaggacaag gcccgctcag
gacctggtgg accacgagtg gcacgtcctg 960cctcaagaaa gtatcttccg
attttccttc gtgcctgtgg tagacgggga cttcctcagt 1020gacacaccgg
aggctctcat caatactgga gattttcaag acctgcaggt gctggtgggt
1080gtggtgaagg acgagggctc ctactttctg gtttacgggg tcccaggctt
cagcaaagac 1140aatgaatctc tcatcagccg ggcccagttc ctggctgggg
tgcggatcgg tgtaccccaa 1200gcaagtgacc tggcggccga ggctgtggtc
ctgcattaca cagactggtt gcaccctgag 1260gaccctactc acctgagaga
tgccatgagt gcagtggtag gcgaccacaa cgttgtgtgc 1320cctgtggccc
agctggctgg gcgactggct gcccaagggg cccgggtcta tgcctacatc
1380tttgaacacc gtgcctccac actgacttgg cccctctgga tgggggtgcc
ccatggctat 1440gaaatcgagt tcatctttgg gctccccctg gatccctcgc
tgaactacac cacggaggag 1500aggatctttg ctcagcgact tatgaaatac
tggaccaatt ttgcccgcac aggggacccc 1560aatgaccctc gagactccaa
atctccacag tggccaccgt acaccactgc cgcgcagcaa 1620tatgtgagcc
tgaacctgaa gcccttagag gtgcggcggg gactgcgcgc ccagacctgc
1680gccttctgga atcgctttct ccccaaattg ctcagcgcca ccgatactct
ggacgaggcg 1740gagcgccagt ggaaggccga gttccaccgc tggagctcct
acatggtgca ctggaagaac 1800cagttcgacc actatagcaa gcaggagcgc
tgctcagacc tgtgacccct tggggacccc 1860aggtcctgcc gccctgcccg
agcccctagc tgtatataca ctatttattt aagggctggg 1920atataatacg
accgagcccc caggccctgt ccactcctcc ccgacttcct cccactaggg
1980gctccccatc ttctgcatgt cttgggctaa gctcccctcc ccgcggtgcc
ttcgcccctc 2040tgggccgcca ataaactgtt acagccacca aaaaaaaaaa
aaaaaaaaa 208992066DNARattus sp. 9atgaggcctc cctggtatcc cctgcataca
ccctccctgg cttctccact cctcttcctc 60ctcctctccc tcctgggagg aggggcaagg
gctgagggcc gggaagaccc tcagctgctg 120gtgagggttc gagggggcca
gctgaggggc atccgcctga aggcccctgg aggcccagtc 180tcagcttttc
tgggcatccc ctttgcagag ccacctgtgg gctcacgtag atttatgcca
240ccagagccca agcgcccctg gtcaggaata ttggatgcta ccaccttcca
aaatgtctgc 300taccaatacg tggacaccct gtaccctggg tttgagggta
ccgagatgtg gaaccccaat 360cgagagctga gtgaagactg cctttatctt
aatgtgtgga caccataccc caggcctact 420tctcccacac ctgtcctcat
ctggatctat gggggtggtt tctacagtgg agcatcctcc 480ttggacgtgt
atgacggccg tttcctggcc caggttgagg gaaccgtgtt ggtatctatg
540aactaccgag tgggaacctt tggcttcttg gctctaccag gaagcagaga
agcccctggc 600aatgtaggcc tgctggatca acggcttgcc ttgcaatggg
tacaagaaaa tatcgcagcc 660tttgggggag acccaatgtc agtgactctg
tttggggaga gtgcaggtgc agcctcagtg 720ggcatgcaca ttctgtccct
gcccagcagg agcctcttcc acagggctgt cctgcagagt 780ggcacaccca
atgggccctg ggccactgtg agtgcgggag aggccaggcg cagggccaca
840ctgctggccc gccttgtggg ctgtccccca ggtggcgctg gtggcaatga
caccgagctg 900atatcctgct tgaggacaag gcccgctcag gacctggtgg
accacgagtg gcatgtgctg 960cctcaagaaa gtatcttccg gttttccttc
gtgcctgtgg tggacgggga tttcctcagt 1020gacacgccgg acgctctcat
caatactgga gattttcaag acctgcaggt gctggtgggt 1080gtggtgaagg
acgagggctc ctactttctg gtttacgggg tcccaggctt cagcaaagac
1140aatgaatctc tcatcagccg ggcccagttc ctggctgggg tgcggatcgg
tgtaccccaa 1200gcgagtgacc tggcggccga ggctgtggtc ctgcattata
cagactggct gcaccctgag 1260gaccctgccc acctgagaga tgccatgagt
gcggtggtag gcgaccacaa cgttgtgtgc 1320cctgtggccc agctggctgg
gcgactggct gcccaagggg ctcgggtcta tgcctacatc 1380tttgaacacc
gtgcctccac attgacttgg cccctctgga tgggggtgcc ccatggctat
1440gaaatcgagt tcatctttgg gctccccctg gatccctcac tgaactacac
cgtggaggag 1500agaatctttg ctcagcgact tatgcaatac tggaccaatt
ttgcccgcac aggggacccc 1560aatgaccctc gagactctaa gtctccacgg
tggccaccgt acaccactgc cgcgcagcaa 1620tacgtgagcc tgaacctgaa
gcctttggag gtgcggcggg gactgcgcgc ccagacctgc 1680gccttctgga
atcgttttct ccccaaattg ctcagcgcca cagacacgct ggacgaggcg
1740gagcgccagt ggaaggccga gttccaccgc tggagctcct acatggtgca
ctggaagaac 1800cagttcgacc actatagcaa gcaggaacgc tgctcagacc
tgtgacccct tggggaccca 1860ggtcctgccg tcctgcccga gcccctgatt
gtatatacac tatttattta agggctggga 1920tataatacaa ccgagccccc
aggccctgtc cacccctccc cgacttcctc ccactagggg 1980atcctcatct
tctgcatgtt ttaaactgag ctcccctccc cgcggtgcct tgccccctct
2040gggccgccaa taaactgtta cagctc 20661020DNAHomo sapiens
10ggtgcaggag aacgtggcag 201120DNAMus musculus 11ggtgcaagaa
aatattgcag 201220DNARattus sp. 12ggtacaagaa aatatcgcag
201320DNARattus sp. 13cctcttcctc ctcctctccc 20
* * * * *