U.S. patent application number 12/501821 was filed with the patent office on 2009-11-05 for mast cell-derived membrane proteins.
Invention is credited to Toshio Kitamura, Hidetoshi Kumagai.
Application Number | 20090275082 12/501821 |
Document ID | / |
Family ID | 32232657 |
Filed Date | 2009-11-05 |
United States Patent
Application |
20090275082 |
Kind Code |
A1 |
Kitamura; Toshio ; et
al. |
November 5, 2009 |
Mast Cell-Derived Membrane Proteins
Abstract
An originally developed efficient signal sequence trapping
method was used to screen a cDNA library prepared from cultured
mast cells derived from mouse bone marrow. As a result, genes
encoding type I membrane proteins and comprising a single
immunoglobulin domain in the extracellular domain and a motif for
transmitting an inhibitory signal into cells were successfully
isolated.
Inventors: |
Kitamura; Toshio; (Tokyo,
JP) ; Kumagai; Hidetoshi; (Coppell, TX) |
Correspondence
Address: |
FISH & RICHARDSON PC
P.O. BOX 1022
MINNEAPOLIS
MN
55440-1022
US
|
Family ID: |
32232657 |
Appl. No.: |
12/501821 |
Filed: |
July 13, 2009 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10531973 |
Nov 18, 2005 |
|
|
|
PCT/JP2003/013921 |
Oct 30, 2003 |
|
|
|
12501821 |
|
|
|
|
Current U.S.
Class: |
435/69.1 ;
435/320.1; 435/325; 536/23.5 |
Current CPC
Class: |
C07K 14/70503
20130101 |
Class at
Publication: |
435/69.1 ;
536/23.5; 435/320.1; 435/325 |
International
Class: |
C12P 21/00 20060101
C12P021/00; C07H 21/04 20060101 C07H021/04; C12N 15/63 20060101
C12N015/63; C12N 5/00 20060101 C12N005/00 |
Foreign Application Data
Date |
Code |
Application Number |
Oct 30, 2002 |
JP |
2002-316680 |
Dec 5, 2002 |
JP |
2002-354165 |
Claims
1. An isolated DNA encoding a protein comprising an amino acid
sequence in which up to thirty amino acids in the amino acid
sequence of SEQ ID NO:4 have been replaced, deleted, inserted,
and/or added.
2. The DNA of claim 1, wherein the protein comprises an amino acid
sequence in which up to ten amino acids in the amino acid sequence
of SEQ ID NO:4 have been replaced, deleted, inserted, and/or
added.
3. The DNA of claim 1, wherein the protein comprises an amino acid
sequence in which up to five amino acids in the amino acid sequence
of SEQ ID NO:4 have been replaced, deleted, inserted, and/or
added.
4. The DNA of claim 1, wherein the protein is capable of binding to
a second protein selected from the group consisting of DAP10
protein, DAP12 protein, and FcR.quadrature. protein.
5. The DNA of claim 1, wherein the amino acid sequence of the
protein comprises SEQ ID NO:4.
6. The DNA of claim 1, wherein the amino acid sequence of the
protein consists of SEQ ID NO:4.
7. The DNA of claim 1, wherein the DNA comprises the coding region
of the nucleotide sequence of SEQ ID NO:3.
8. A vector comprising the DNA of claim 1.
9. A host cell carrying (i) the DNA of claim 1 or (ii) a vector
comprising the DNA of claim 1.
10. A method for producing a protein comprising an amino acid
sequence in which up to thirty amino acids in the amino acid
sequence of SEQ ID NO:4 have been replaced, deleted, inserted,
and/or added, the method comprising the steps of culturing the host
cell of claim 9, and recovering the protein from said host cell or
the culture supernatant thereof.
11. An isolated polynucleotide comprising a segment of SEQ ID NO:3
or of the complement of SEQ ID NO:3, the segment being at least 15
nucleotides in length.
12. An isolated DNA that specifically hybridizes with a probe
consisting of the complement of SEQ ID NO:3 under highly stringent
conditions.
13. The DNA of claim 12, wherein said highly stringent conditions
include a post-hybridization wash in 5.times.SSC, 0.1% SDS at
65.degree. C.
14. An isolated DNA that encodes a protein that is 85% or more
identical to SEQ ID NO:4.
15. The DNA of claim 14, wherein the DNA encodes a protein that is
95% or more identical to SEQ ID NO:4.
16. The DNA of claim 14, wherein the DNA encodes a protein that is
96% or more identical to SEQ ID NO:4.
17. The DNA of claim 14, wherein the DNA encodes a protein that is
97% or more identical to SEQ ID NO:4.
18. The DNA of claim 14 wherein the DNA encodes a protein that is
98% or more identical to SEQ ID NO:4.
19. The DNA of claim 14, wherein the DNA encodes a protein that is
99% or more identical to SEQ ID NO:4.
20. The DNA of claim 14, wherein the protein is capable of binding
to a second protein selected from the group consisting of DAP10
protein, DAP12 protein, and FcR.gamma. protein.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a divisional application of and claims
priority to U.S. application Ser. No. 10/531,973, filed on Nov. 18,
2005, which is the National Stage of International Application No.
PCT/JP2003/013921, filed Oct. 30, 2003, which claims the benefit of
Japanese Patent Applications Serial No. 2002-316680, filed on Oct.
30, 2002, and 2002-354165, filed on Dec. 5, 2002. The contents of
all of the foregoing applications are incorporated herein by
reference in their entireties.
TECHNICAL FIELD
[0002] The present invention relates to novel membrane proteins
derived from mast cells and genes encoding them, as well as methods
for producing them and uses thereof.
BACKGROUND
[0003] Mast cells are known to act as effector cells in allergic
diseases such as atopic dermatitis, rhinitis, and asthma by
releasing inflammation-associated substances such as histamine upon
antigen stimulation. Antihistamines or steroids that suppress the
production or release of inflammation-associated substances from
mast cells, or drugs that antagonize the effect of such substances,
are currently being used for the treatment of these allergic
diseases. However, the development of effective drugs with higher
selectivity is being anticipated.
[0004] Molecules such as Fc.gamma.RIIB, gp49B, and SIRP.alpha. have
been known as candidates of membrane proteins participating in the
regulation of mast cell signal transduction. However, the whole
picture of the mechanism that regulates responses to antigen
stimulation associated with allergic diseases remains unclear.
SUMMARY
[0005] The present invention provides novel membrane proteins
thought to play a role in the regulation of mast cell signal
transduction, genes encoding them, as well as methods for producing
them and uses thereof. The membrane proteins of this invention
would be useful for elucidating the mechanisms that regulate
responses to antigen stimulation, or transduction of survival or
proliferation signals in mast cells.
[0006] In order to solve the above problems, the present inventors
prepared a cDNA library from mouse bone marrow-derived cultured
mast cells, a well characterized mast cell model. They then
screened this library for molecules containing signal peptides (von
Heijne J. Mol. Biol. 184: 99-105 (1985)) using an efficient signal
sequence trapping system (the SST-REX method) (Kojima T. and
Kitamura T. Nature Biotechnol. 17: 487-490 (1999)), which was
developed by the inventors themselves using a retrovirus-mediated
expression cloning system (Kitamura T. et al. Proc. Natl. Acad.
Sci. USA 92: 9146-9150 (1995)). In the SST-REX method, a library
expressing fusion proteins with the constitutively active form of
cytokine receptor MPL is screened to look for a cDNA(s) encoding a
protein(s) capable of inducing the cell surface expression of the
MPL. As the index used in the method is the acquisition of
autonomous proliferation capability in IL-3 dependent cell lines as
a result of MPL expression on the cell surface, a clone of interest
can be easily selected.
[0007] After screening 2.0.times.10.sup.6 clones, a gene encoding a
type I membrane protein and having a single immunoglobulin domain
in the extracellular domain and a motif for transmitting an
inhibitory signal into cells was identified. The protein was named
MC-PIR1 (later renamed as LMIR1). In addition, a molecule whose
amino acid sequence showed approximately 90% homology with the
immunoglobulin domain of MC-PIR1 was isolated from the same
library, and named MC-PIR2 (later renamed as LMIR2).
[0008] These genes had an expression profile specific to mast
cells. Furthermore, MC-PIR1 was phosphorylated upon cross-linking,
and was capable of binding to the phosphotyrosine phosphatases
SHP-1 and SHP-2, and phosphoinositide phosphatase SHIP, which are
adaptor proteins involved in the regulation of signal transduction.
MC-PIR2 was found to form a complex with DAP10, DAP12, and
FcR.gamma., ITAM-comprising signaling molecules. Therefore, these
proteins are likely to be membrane proteins participating in the
regulation of mast cell signal transduction.
[0009] MC-PIR1 and MC-PIR2 genes are derived from mouse. A DNA
search using their nucleotide sequences identified human gene
homologues CMRF-35H, Irp60, and CMRF-35A. Since these human genes
were not known to participate in the regulation of mast cell signal
transduction, the information obtained through MC-PIR1 and MC-PIR2
provides novel uses for the gene products of these human genes.
[0010] Natural ligands for MC-PIR1, MC-PIR2, and the human
homologues thereof have not been identified, but the use of these
gene products would facilitate the discovery of these natural
ligands. Similarly, the gene products may also be useful in
screenings for compounds that mimic the function of natural
ligands, or antibodies. Such compounds or antibodies, obtained by
the above screenings, have the potential to inhibit the
transduction of the mast cell activation signal, and thus be
anti-allergy drugs with a new mechanism of action.
[0011] The present invention relates to mast cell-derived membrane
proteins, gene encoding them, and molecules functionally equivalent
to these, as well as methods for producing them, and uses thereof.
More specifically, the present invention provides:
(1) a DNA according to any one of the following (a) to (d):
[0012] (a) a DNA encoding a protein comprising the amino acid
sequence of SEQ ID NO: 2 or 4,
[0013] (b) a DNA comprising the coding region of the nucleotide
sequence of SEQ ID NO: 1 or 3,
[0014] (c) a DNA encoding a protein comprising an amino acid
sequence in which one or more amino acids in the amino acid
sequence of SEQ ID NO: 2 or 4 have been replaced, deleted,
inserted, and/or added,
[0015] (d) a DNA capable of hybridizing with a DNA comprising the
nucleotide sequence of SEQ ID NO: 1 or 3 under stringent
conditions;
(2) the DNA of (1) encoding a protein capable of binding to a
protein selected from the group consisting of SHP-1 protein, SHP-2
protein, SHIP protein, DAP10 protein, DAP12 protein, and FcR.gamma.
protein; (3) a protein encoded by the DNA of (1); (4) a vector into
which the DNA of (1) has been inserted; (5) a host cell carrying
the DNA of (1), or the vector of (4); (6) a method for producing
the protein of (3), which comprises the steps of culturing the host
cell of (5), and recovering an expressed protein from said host
cell or the culture supernatant thereof; (7) an antibody that binds
to the protein of (3); (8) a polynucleotide comprising at least 15
nucleotides that is complementary to a DNA comprising the
nucleotide sequence of SEQ ID NO: 1 or 3, or the complementary
strand thereof; (9) a method of screening for a compound that binds
to the protein of (3), which comprises the following steps of:
[0016] (a) contacting said protein with a test sample,
[0017] (b) detecting the binding activity between said protein and
said test sample, and
[0018] (c) selecting a compound capable of binding to said
protein;
(10) a method of screening for a compound capable of inhibiting the
binding between the protein of (3) and a protein selected from the
group consisting of SHP-1 protein, SHP-2 protein, SHIP protein,
DAP10 protein, DAP12 protein, and FcR.gamma. protein, which
comprises the following steps of: [0019] (a) contacting the protein
of (3) with a protein selected from said group in the presence of a
test sample, [0020] (b) detecting the binding activity between said
proteins, and [0021] (c) selecting a compound capable of reducing
the binding activity between said proteins compared to that
detected in the absence of said test sample; (11) a method for
producing an anti-allergy drug, which comprises the step of mixing
the antibody of (7), or a compound obtained using the method of (9)
or (10), with a pharmacologically acceptable carrier or
vehicle.
DETAILED DESCRIPTION
[0022] The present invention provides DNAs encoding novel membrane
proteins derived from mast cells, which are thought to participate
in the regulation of the signal transduction in mast cells.
[0023] Using a recently established novel signal sequence trapping
method (the ST-REX method), the present inventors searched a cDNA
library prepared from mouse bone marrow-derived cultured mast
cells, and identified two genes, each of which encodes a type I
membrane protein and comprises a single immunoglobulin domain in
the extracellular domain and a motif for transmitting an inhibitory
signal into cells. The nucleotide sequence of the gene named
MC-PIR1 is shown in SEQ ID NO: 1. The amino acid sequence of a
protein encoded by the gene is shown in SEQ ID NO: 2. In addition,
the nucleotide sequence of the gene named MC-PIR2, having
approximately 90% homology at the amino acid level with the
immunoglobulin domain of MC-PIR1, is shown in SEQ ID NO: 3, and the
amino acid sequence of a protein encoded by the gene is shown in
SEQ ID NO: 4. These genes are expressed specifically in mast cells.
In addition, MC-PIR1 is phosphorylated in response to antigen
stimulation, and is capable of binding to phosphotyrosine
phosphatases SHP-1 and SHP-2 and phosphoinositide phosphatase SHIP,
which are adaptor proteins participating in the regulation of
signal transduction. On the other hand, MC-PIR2 is capable of
forming a complex with DAP10, DAP12, and FcR.gamma., which are
signaling molecules comprising ITAM. Thus, these proteins of the
present invention are considered to be membrane proteins
participating in the regulation of mast cell signal transduction.
Such proteins are expected to be useful, for example, for the
development of anti-allergy drugs having a novel mechanism of
action through inhibiting the transduction of the activation signal
in mast cells.
[0024] In addition, the present invention comprises a protein
functionally equivalent to a protein encoded by MC-PIR1 DNA or
MC-PIR2 DNA (comprising the nucleotide sequence according to SEQ ID
NO: 1 or 3). Such proteins include, for example, mutants of these
proteins, their homologues in organisms other than mouse, and so
on. Herein, the phrase "functionally equivalent" means that the
protein of interest has a biological or biochemical activity
similar to the MC-PIR1 and MC-PIR2 proteins. For example, such an
activity may be the ability to undergo phosphorylation in response
to antigen stimulation and bind to adaptor proteins involved in the
regulation of signal transduction such as phosphotyrosine
phosphatase SHP-1 and SHP-2 and phosphoinositide phosphatase SHIP,
or the ability to bind to signaling molecules comprising ITAM such
as DAP10, DAP12, and FcR.gamma..
[0025] To prepare a protein functionally equivalent to another
protein, methods for introducing mutations into proteins are well
known to those skilled in the art. For example, those skilled in
the art can prepare a protein functionally equivalent to the
MC-PIR1 or MC-PIR2 protein (comprising the amino acid sequence of
SEQ ID NO: 2 or 4) by introducing an appropriate mutation into an
amino acid(s) of the protein using site-directed mutagenesis
(Hashimoto-Gotoh T. et al. Gene 152: 271-275 (1995); Zoller M. J.
and Smith M. Methods Enzymol. 100: 468-500 (1983); Kramer W. et al.
Nucleic Acids Res. 12: 9441-9456 (1984); Kramer W. and Fritz H. J.
Methods Enzymol. 154: 350-367 (1987); Kunkel T. A. Proc. Natl.
Acad. Sci. USA 82: 488-492 (1985); Kunkel T. A. Methods Enzymol.
85: 2763-2766 (1988)). Amino acids mutations may also occur in
nature. Thus, such a protein comprising an amino acid sequence in
which one or more amino acids in the sequence of the MC-PIR1 or
MC-PIR2 protein are mutated, and which is functionally equivalent
to the MC-PIR1 or MC-PIR2 protein, is also included in the present
invention. In such a mutant protein, the number of mutated amino
acids is usually 50 or less, preferably 30 or less, and more
preferably 10 or less (for example, five amino acids or less).
[0026] In mutating an amino acid, it is preferable to change it
into another amino acid that allows the properties of the amino
acid side chain to be conserved. Based on the properties of side
chains, amino acids can be divided into, for example, the following
groups: hydrophobic amino acids (A, I, L, M, F, P, W, Y, V),
hydrophilic amino acids (R, D, N, C, E, Q, G, H, K, S, T), amino
acids with an aliphatic side chain (G, A, V, L, I, P), amino acids
with a side chain comprising a hydroxyl group (S, T, Y), amino
acids with a side chain comprising sulfur (C, M), amino acids with
a side chain comprising a carboxylic acid and an amide group (D, N,
E, Q), basic amino acids (R, K, H), and aromatic amino acids (H, F,
Y, W) (in the parentheses, amino acids are shown using the one
letter code).
[0027] It is already known that a protein having a modified amino
acid sequence, in which one or more amino acids are deleted, added,
and/or substituted with another amino acid, can maintain the
original biological activity (Mark D. F. et al. Proc. Natl. Acad.
Sci. USA 81: 5662-5666 (1984); Zoller M. J. and Smith M. Nucleic
Acids Res. 10: 6487-6500 (1982); Wang A. et al. Science 224:
1431-1433 (1984); Dalbadie-McFarland G. et al. Proc. Natl. Acad.
Sci. USA 79: 6409-6413 (1982)).
[0028] A protein comprising an amino acid sequence in which
multiple amino acid residues are added to the sequence of MC-PIR1
or MC-PIR2 protein includes fusion proteins comprising these
proteins. Fusion proteins such as those between the proteins of
this invention and other peptides or proteins are included in the
present invention. To produce a fusion protein, a DNA encoding the
MC-PIR1 or MC-PIR2 protein (comprising the amino acid sequence
according to SEQ ID NO: 2 or 4) and a DNA encoding another peptide
or protein are ligated so that their frames match, and introduced
into an expression vector to express in a host. Any method commonly
known to those skilled in the art can be used. Any peptide or
protein may be used for making a fusion protein with a protein of
this invention.
[0029] Known peptides that can be used as peptides that are fused
to the proteins of the present invention include, for example, FLAG
(Hopp, T. P. et al., Biotechnology (1988) 6, 1204-1210),
6.times.His containing six histidine (HIS) residues, 10.times.His,
HA (Influenza agglutinin), human c-myc fragment, VSP-GP fragment,
p18HIV fragment, T7-tag, HSV-tag, E-tag, SV40T antigen fragment,
lck tag, .alpha.-tubulin fragment, B-tag, Protein C fragment, and
the like. Examples of proteins that may be fused to proteins of the
invention include GST (glutathione-S-transferase), HA (Influenza
agglutinin), immunoglobulin constant region, .beta.-galactosidase,
MBP (maltose-binding protein), and such.
[0030] Fusion proteins can be prepared by fusing commercially
available DNA encoding the fusion peptides or proteins discussed
above, with the DNA encoding the proteins of the present invention,
and expressing the prepared fused DNA.
[0031] An alternative method known in the art to isolate
functionally equivalent proteins is, for example, the method using
hybridization (Sambrook, J. et al., Molecular Cloning 2nd ed.
9.47-9.58, Cold Spring Harbor Lab. Press, 1989). One skilled in the
art can readily isolate a DNA having high homology with an entire
or partial DNA sequence (SEQ ID NOs: 1 and 3) that encodes the
MC-PIR1 and MC-PIR2 proteins, and isolate proteins functionally
equivalent to the MC-PIR1 or MC-PIR2 protein using the isolated
DNA.
[0032] The present invention includes proteins encoded by DNA that
hybridize with DNA encoding the MC-PIR1 or MC-PIR2 protein, and
which are functionally equivalent to the MC-PIR1 or MC-PIR2
protein. Such proteins include, for example, homologues in mice or
other mammals (for example, a protein encoded by a human, rat,
rabbit, or bovine homologous gene).
[0033] The conditions for hybridization used for isolating a DNA
encoding a protein functionally equivalent to the MC-PIR1 or
MC-PIR2 protein can be appropriately selected by those skilled in
the art. For example, low stringent conditions may be used for
hybridization. Low stringent conditions are post-hybridization
washing in 0.1.times.SSC, 0.1% SDS at 42.degree. C., for example,
and preferably in 0.1.times.SSC, 0.1% SDS at 50.degree. C. Highly
stringent conditions are more preferable, which are washing in
5.times.SSC, 0.1% SDS at 65.degree. C., for example. Under these
conditions, a DNA having a higher homology can be efficiently
obtained by increasing the temperature. Multiple factors including
the temperature, salt concentration, and such are considered to
affect the stringency of hybridization; one skilled in the art can
achieve similar stringencies by appropriately selecting these
factors.
[0034] In addition to hybridization, a gene amplification method
such as the polymerase chain reaction (PCR) may be used for gene
isolation using synthesized primers based on the nucleotide
sequence of the DNA encoding the MC-PIR1 or MC-PIR2 protein (SEQ ID
NO: 1 or 3).
[0035] Normally, such a protein encoded by the DNA isolated using
the above hybridization techniques or gene amplification, and which
is functionally equivalent to the MC-PIR1 or MC-PIR2 protein, has a
high homology with these proteins (comprising the amino acid
sequence of SEQ ID NO: 2 or 4) at the amino acid level. The
proteins of this invention include proteins functionally equivalent
to the MC-PIR1 or MC-PIR2 protein, and having a high homology with
these proteins at the amino acid level. High homology normally
means an identity of at least 50% or more at the amino acid level,
preferably 75% or more, more preferably 85% or more, and most
preferably 95% or more (96% or more, 97% or more, 98% or more, or
99% or more). Homology between proteins can be determined according
to the algorithm described in literature (Wilbur W. J. and Lipman
D. J. Proc. Natl. Acad. Sci. USA 80: 726-730 (1983)).
[0036] The proteins of the present invention may have variations in
the amino acid sequence, molecular weight, isoelectric point, or
presence or composition of sugar chains, depending on the cell or
host used for producing it, or the method of purification, as
described later on. Nevertheless, such proteins are included in the
present invention as long as they are functionally equivalent to
the MC-PIR1 or MC-PIR2 protein. For example, if a protein of the
present invention is expressed in a prokaryotic cell such as E.
coli, a methionine may be attached to the N-terminus of the
original protein. Such proteins are also included in the present
invention.
[0037] The proteins of the present invention can be prepared as
recombinant proteins or natural proteins, by methods well known to
those skilled in the art. A recombinant protein can be prepared by:
inserting a DNA that encodes a protein of the present invention
(for example, the DNA comprising the nucleotide sequence of SEQ ID
NO: 1 or 3), into an appropriate expression vector; introducing the
vector into an appropriate host cell; collecting thus obtained
recombinants; obtaining an extract thereof; and purifying the
protein by subjecting the extract to a chromatography. Examples of
chromatographies are ion exchange chromatography, reverse phase
chromatography, gel filtration, or affinity chromatography
utilizing a column to which an antibody against a protein of the
present invention is immobilized, or combinations of more than one
of the aforementioned columns.
[0038] When the protein of the present invention is expressed
within host cells (for example, animal cells or E. coli) as a
fusion protein with the glutathione-S-transferase protein, or as a
recombinant protein supplemented with multiple histidines, the
expressed recombinant protein can be purified using a glutathione
column or nickel column. After purifying the fusion protein, it is
also possible to exclude regions other than the objective protein
by cutting with thrombin or factor-Xa as required.
[0039] A natural protein may be isolated by a method known to those
skilled in the art, for example, through purification by applying a
tissue or cell extract expressing a protein of this invention onto
an affinity column in which an antibody (described below) capable
of binding to the protein has been immobilized. Both monoclonal and
polyclonal antibodies can be used.
[0040] In addition, the present invention comprises partial
peptides of the proteins of this invention. A partial peptide of
this invention comprises an amino acid sequence of at least seven
residues or more, preferably eight residues or more, and more
preferably nine residues or more. The partial peptides may be
useful, for example, for preparing antibodies against the proteins
of this invention, in screenings for compounds capable of binding
to the proteins, and in screenings for activators or inhibitors of
the proteins. In addition, the peptides may be useful by themselves
as antagonists or competitors of the proteins of this invention.
The partial peptides of this invention can be produced using
genetic engineering, by commonly known peptide synthesis methods,
or digesting a protein of this invention with an appropriate
peptidase. Peptide synthesis may be performed, for example, by
either solid phase synthesis or liquid phase synthesis.
[0041] A DNA encoding a protein of the present invention would be
useful not only for producing the protein in vivo or in vitro as
described above, but also for applications in gene therapy of a
disease caused by an abnormal function of the gene encoding the
protein or a disease that can be treated with the protein, DNA
diagnostics, etc. A DNA of this invention can take any form as long
as it encodes a protein of this invention. It can be a cDNA
synthesized from mRNA, genomic DNA, or chemically-synthesized DNA.
In addition, it includes a DNA comprising any nucleotide sequence
based on the degeneracy of genetic code as long as it encodes a
protein of this invention.
[0042] A DNA of this invention can be prepared by methods commonly
known to those skilled in the art. For example, it may be prepared
by making a cDNA library from cells expressing a protein of this
invention, and performing hybridization using a partial nucleotide
sequence of the DNA (for example, SEQ ID NO: 1 or 3) as a probe.
The cDNA library may be prepared, for example, according to the
method described in literature (Sambrook J. et al. Molecular
Cloning, Cold Spring Harbor Laboratory Press (1989)), or obtained
from a commercial source. Alternatively the DNA of this invention
may be prepared as follows: RNA is prepared from cells expressing a
protein of this invention, from which cDNA is synthesized using
reverse transcriptase. Then, oligo DNA is synthesized based on the
sequence of the DNA (for example, SEQ ID NO: 1 or 3), and used as a
primer in a PCR reaction to amplify a cDNA encoding a protein of
this invention.
[0043] Furthermore, the coding region of the cDNA can be determined
by determining the nucleotide sequence of the obtained cDNA, and
the amino acid sequence of a protein of this invention can be thus
obtained. In addition, the obtained cDNA may be used as a probe for
screening a genomic DNA library to isolate a genomic DNA.
[0044] Specific procedures are as follows: First, mRNA is isolated
from a cell, tissue, or organ expressing a protein of this
invention (for example, mast cells or tissues in which expression
was detected by RT-PCR in the Example below). mRNA may be isolated
by preparing total RNA using a commonly known method such as
guanidine ultracentrifugation (Chirgwin J. M. et al. Biochemistry
18: 5294-5299 (1979)), or AGPC method (Chomczynski P. and Sacchi N.
Anal. Biochem. 162: 156-159 (1987)), and then purifying mRNA from
total RNA using an mRNA Purification Kit (Pharmacia), etc.
Alternatively, mRNA may be directly prepared using the QuickPrep
mRNA Purification Kit (Pharmacia).
[0045] The obtained mRNA is used to synthesize cDNA using reverse
transcriptase. cDNA may be synthesized by using a commercially
available kit such as the AMV Reverse Transcriptase First-strand
cDNA Synthesis Kit (Seikagaku Kogyo). Alternatively, using a primer
described herein, or such, cDNA may be synthesized and amplified
following the 5'-RACE method (Frohman M. A. et al. Proc. Natl.
Acad. Sci. U.S.A. 85:8998-9002 (1988); Belyavsky A. et al. Nucleic
Acids Res. 17:2919-2932 (1989)) using the 5'-Ampli FINDER RACE Kit
(Clontech) and the polymerase chain reaction (PCR).
[0046] A desired DNA fragment is prepared from PCR products and
ligated with a vector DNA to produce a recombinant vector
construct. This construct is used to transform E. coli or such, and
desired recombinant vectors are prepared from a selected
colony/colonies. The nucleotide sequence of the desired DNA can be
verified by conventional methods such as dideoxynucleotide chain
termination.
[0047] The nucleotide sequence of a DNA of the invention may be
designed to be expressed more efficiently by taking into account
the frequency of codon usage in the host used for the expression
(Grantham R. et al. Nucleic Acids Res. 9:43-74 (1981)). The DNA of
the present invention may be altered by a commercially available
kit or a conventional method. For instance, the DNA may be altered
by digestion with restriction enzymes, insertion of a synthetic
oligonucleotide or an appropriate DNA fragment, addition of a
linker, or insertion of an initiation codon (ATG) and/or a stop
codon (TAA, TGA, or TAG).
[0048] The DNA of this invention specifically includes a DNA
comprising the nucleotide sequence starting from "a" at 148 through
"g" at 1101 in the nucleotide sequence of SEQ ID NO: 1, or a DNA
comprising the nucleotide sequence from "a" at 1 through "g" at 684
in the sequence of SEQ ID NO: 3.
[0049] In addition, the DNA of this invention includes a DNA that
hybridizes with a DNA comprising the nucleotide sequence shown as
SEQ ID NO: 1 or 3 and encodes a protein functionally equivalent to
an above-described protein of this invention. Hybridization
conditions may be appropriately chosen by one skilled in the art.
Specifically, the above-described specific conditions may be used.
Under these conditions, the higher the temperature, the higher the
homology of the obtained DNA would be. The above hybridizing DNA is
preferably a naturally-occurring DNA, for example, a cDNA or
chromosomal DNA.
[0050] The present invention also provides a vector into which a
DNA of the present invention has been inserted. A vector of the
present invention is useful to maintain a DNA of the present
invention in a host cell, or to express a protein of the present
invention.
[0051] When E. coli is a host cell and the vector is amplified and
produced in a large amount in E. coli (e.g., JM109, DH5.alpha.,
HB101, or XL1Blue), the vector should have "ori" to be amplified in
E. coli and a marker gene for selecting transformed E. coli (e.g.,
a drug-resistance gene selected by a drug such as ampicillin,
tetracycline, kanamycin, chloramphenicol, or the like). For
example, M13-series vectors, pUC-series vectors, pBR322,
pBluescript, pCR-Script, etc. can be used. In addition, pGEM-T,
pDIRECT, and pT7 can also be used for subcloning and extracting
cDNA as well as the vectors described above. When a vector is used
to produce a protein of the present invention, an expression vector
is especially useful. For example, an expression vector to be
expressed in E. coli should have the above characteristics to be
amplified in E. coli. When E. coli such as JM109, DH5.alpha.,
HB101, or XL1 Blue are used as a host cell, the vector should have
a promoter, for example, the lacZ promoter (Ward et al., Nature
(1989) 341, 544-546; FASEB J (1992) 6, 2422-2427), araB promoter
(Better et al., Science (1988) 240, 1041-1043), or T7 promoter or
the like, that can efficiently express the desired gene in E. coli.
In this respect, pGEX-5.times.-1 (Pharmacia), "QIAexpress system"
(Qiagen), pEGFP and pET (in this case, the host is preferably BL21
which expresses T7 RNA polymerase), for example, can be used in
addition to the above vectors.
[0052] Additionally, the vector may also contain a signal sequence
for polypeptide secretion. An example of a signal sequence that
directs the protein to be secreted to the periplasm of the E. coli
is the pelB signal sequence (Lei, S. P. et al J. Bacteriol. (1987)
169, 4379). Means for introducing the vectors into target host
cells include, for example, the calcium chloride method and the
electroporation method.
[0053] In addition to E. coli, for example, expression vectors
derived from mammals (for example, pcDNA3 (Invitrogen) and pEGF-BOS
(Nucleic Acids. Res. 1990, 18 (17), p5322), pEF, pCDM8), expression
vectors derived from insect cells (for example, "Bac-to-BAC
baculovirus expression system" (GIBCO BRL), pBacPAK8), expression
vectors derived from plants (for example pMH1, pMH2), expression
vectors derived from animal viruses (for example, pHSV, pMV,
pAdexLcw), expression vectors derived from retroviruses (for
example, pZIPneo), expression vector derived from yeast (for
example, "Pichia Expression Kit" (Invitrogen), pNV11, SP-Q01), and
expression vectors derived from Bacillus subtilis (for example,
pPL608, pKTH50) can be used as vectors for producing a protein of
the present invention.
[0054] In order to express the vector in animal cells such as CHO,
COS, or NIH3T3 cells, the vector should have a promoter necessary
for expression in such cells, for example, the SV40 promoter
(Mulligan et al., Nature (1979) 277, 108), the MMLV-LTR promoter,
the EF1.alpha. promoter (Mizushima et al., Nucleic Acids Res.
(1990) 18, 5322), the CMV promoter, and the like, and preferably a
marker gene for selecting transformants (for example, a drug
resistance gene selected by a drug (e.g., neomycin, G418)).
Examples of known vectors with these characteristics include, for
example, pMAM, pDR2, pBK-RSV, PBK-CMV, pOPRSV, and pOP13.
[0055] In addition, when the aim is to stably express a gene and at
the same time increase the copy number of the gene in cells, one
can use the method of introducing, into CHO cells in which the
nucleic acid synthesizing pathway is deleted, a vector comprising
the complementary DHFR gene (for example pCHO I) and then
amplifying this by methotrexate (MTX). Furthermore, when the aim is
to transiently express a gene, one can use the method of
transfecting a vector comprising a replication origin of SV40 (pcD,
etc.) into COS cells comprising the SV40 T antigen expressing gene
on the chromosome. The replication origin may also be derived from
the polyoma virus, adenovirus, bovine papilloma virus (BPV), and
the like. Furthermore, the expression vector may carry, as a
selection marker, the aminoglycoside transferase (APH) gene,
thymidine kinase (TK) gene, E. coli xanthine-guanine-phosphoribosyl
transferase (Ecogpt) gene, dihydrofolate reductase (dhfr) gene, and
such, for increasing the copy number in the host cell system.
[0056] A DNA of the present invention can further be expressed in
vivo in animals, for example, by inserting the DNA into an
appropriate vector and introducing it into living bodies by methods
such as the retrovirus method, the liposome method, the cationic
liposome method, and the adenovirus method. Gene therapy against
diseases attributed to mutation of a gene encoding a protein of the
present invention can be thus accomplished. An adenovirus vector
(for example pAdexlcw) or retrovirus vector (for example, pZIPneo)
can be given as an example of a vector, but the vector is not
restricted thereto. General gene manipulations, such as insertion
of a DNA of the present invention to a vector, can be performed
according to conventional methods (Molecular Cloning, 5.61-5. 63).
Administration into a living body can be either an ex vivo method,
or in vivo method.
[0057] The present invention further provides a host cell into
which a vector of the present invention has been transfected. The
host cell into which a vector of the invention is transfected is
not particularly limited. For example, E. coli, various animal
cells and such can be used. The host cells of the present invention
can be used, for example, as a production system for producing or
expressing a protein of the present invention. The present
invention provides methods of producing a protein of the invention
both in vitro and in vivo. For in vitro production, eukaryotic
cells or prokaryotic cells can be used as host cells.
[0058] Useful eukaryotic cells may be animal, plant, or fungi
cells. Animal cells include, for example, mammalian cells such as
CHO (J. Exp. Med. 108:945 (1995)), COS, 3T3, myeloma, baby hamster
kidney (BHK), HeLa, or Vero cells; amphibian cells such as Xenopus
oocytes (Valle et al. Nature 291:340-358 (1981)); or insect cells
such as Sf9, Sf21, or Tn5 cells. CHO cells lacking the DHFR gene
(dhfr-CHO) (Proc. Natl. Acad. Sci. U.S.A. 77:4216-4220 (1980)) or
CHO K-1 (Proc. Natl. Acad. Sci. U.S.A. 60:1275 (1968)) may also be
used. Of animal cells, CHO cells are particularly preferable for
mass expression. A vector can be transfected into host cells by,
for example, the calcium phosphate method, the DEAE-dextran method,
the cationic liposome DOTAP (Boehringer Mannheim), the
electroporation method, the lipofection method, and so on.
[0059] As plant cells, plant cells derived from Nicotiana tabacum
are known as protein-production systems, and may be used as callus
cultures. As fungi cells, yeast cells such as Saccharomyces,
including Saccharomyces cerevisiae, or filamentous fungi such as
Aspergillus, including Aspergillus niger, are known and may be used
herein.
[0060] Useful prokaryotic cells include bacterial cells such as E.
coli, for example, JM109, DH5.alpha., and HB101. Other bacterial
systems include Bacillus subtilis.
[0061] These cells are transformed by a desired DNA, and the
resulting transformants are cultured in vitro to obtain the
protein. Transformants can be cultured using known methods. Culture
medium for animal cells include, for example, DMEM, MEM, RPMI 1640,
and IMDM. These may be used with or without a serum supplement such
as the fetal calf serum (FCS). The pH of the culture medium is
preferably between about 6 and 8. Such cells are typically cultured
at about 30 to 40.degree. C. for about 15 to 200 hr, and the
culture medium may be replaced, aerated, or stirred if
necessary.
[0062] Animal or plant hosts may be used for the in vivo
production. For example, a desired DNA can be transfected into an
animal or plant host. Encoded proteins are produced in vivo, and
then recovered. These animal and plant hosts are included in the
host cells of the present invention.
[0063] Animals used for the production system described above
include, but are not limited to, mammals and insects. Mammals, such
as goats, pigs, sheep, mice and cows, may be used (Vicki Glaser,
SPECTRUM Biotechnology Applications (1993)). Alternatively, the
mammals may be transgenic animals.
[0064] For instance, a desired DNA may be prepared as a fusion
gene, by fusing it with a gene such as the goat .beta. casein gene
which encodes a protein specifically produced into milk. DNA
fragments comprising the fusion gene are injected into goat
embryos, which are then implanted in female goats. Proteins are
recovered from milk produced by the transgenic goats (i.e., those
born from the goats that had received the embryos) or from their
offspring. To increase the amount of milk containing the proteins
produced by the transgenic goats, appropriate hormones may be
administered to them (Ebert K. M. et al. Bio/Technology 12:699-702
(1994)).
[0065] Alternatively, insects, such as the silkworm, may be used. A
DNA encoding a desired protein inserted into baculovirus can be
used to transfect silkworms, and the desired protein may be
recovered from their body fluid (Susumu M. et al. Nature 315:
592-594 (1985)).
[0066] As plants, for example, tobacco can be used. When using
tobacco, a DNA encoding a desired protein may be inserted into a
plant expression vector such as pMON530, which is introduced into
bacteria such as Agrobacterium tumefaciens. Then, the bacteria are
used to transfect a tobacco plant such as Nicotiana tabacum, and a
desired polypeptide is recovered from the leaves (Julian K.-C. Ma
et al., Eur. J. Immunol. 24: 131-138 (1994)).
[0067] A protein of the present invention obtained as above may be
isolated from the inside or outside (such as culture medium) of
host cells, and purified as a substantially pure homogeneous
protein. The method for protein isolation and purification is not
limited to any specific method, and any standard method may be
used. For instance, column chromatography, filter, ultrafiltration,
salt precipitation, solvent precipitation, solvent extraction,
distillation, immunoprecipitation, SDS-polyacrylamide gel
electrophoresis, isoelectric point electrophoresis, dialysis, and
recrystallization may be appropriately selected and combined to
isolate and purify the protein.
[0068] Examples of chromatographies include, for example, affinity
chromatography, ion-exchange chromatography, hydrophobic
chromatography, gel filtration, reverse phase chromatography,
adsorption chromatography, and such (Strategies for Protein
Purification and Characterization: A Laboratory Course Manual. Ed.
Daniel R. Marshak et al., Cold Spring Harbor Laboratory Press
(1996)). These chromatographies may be performed by a liquid
chromatography such as HPLC and FPLC. Thus, the present invention
provides highly purified proteins prepared by the above
methods.
[0069] A protein of the present invention may be optionally
modified or partially deleted by treating it with an appropriate
protein modification enzyme before or after purification. Useful
protein modification enzymes include, but are not limited to,
trypsin, chymotrypsin, lysylendopeptidase, protein kinase,
glucosidase and so on.
[0070] The present invention provides antibodies that bind to the
proteins of the invention. The antibodies can take any form such as
monoclonal or polyclonal antibodies, and includes antiserum
obtained by immunizing an animal such as a rabbit with a protein of
the invention, all classes of polyclonal and monoclonal antibodies,
human antibodies, and humanized antibodies produced by genetic
recombination.
[0071] A protein of the invention used as an antigen to obtain an
antibody may be derived from any animal species, but is preferably
derived from a mammal such as a human, mouse, or rat, more
preferably a human. A human-derived protein may be obtained from
the nucleotide or amino acid sequences disclosed herein.
[0072] According to the present invention, the protein to be used
as an immunization antigen may be a complete protein or a partial
peptide of the protein. A partial peptide may comprise, for
example, the amino (N)-terminal or carboxy (C)-terminal fragment of
a protein of the present invention. Herein, an antibody is defined
as a protein that reacts with either the whole protein of the
present invention, or a fragment of the protein.
[0073] A gene encoding a protein of the invention or its fragment
may be inserted into a known expression vector, which is then used
to transform a host cell as described herein. The desired protein
or its fragment may be recovered from the outside or inside of host
cells by any standard method, and may subsequently be used as an
antigen. Alternatively, cells expressing the protein or their
lysates, or a chemically synthesized protein may be used as the
antigen. In the case of a short peptide, it is preferably bound to
an appropriate carrier protein such as keyhole limpet hemocyanin,
bovine serum albumin, and ovalbumin before using as antigen.
[0074] Any mammalian animal may be immunized with the antigen, but
preferably, the compatibility with parental cells used for cell
fusion is taken into account. In general, animals of Rodentia,
Lagomorpha, or Primates are used.
[0075] Animals of Rodentia include, for example, mice, rats, and
hamsters. Animals of Lagomorpha include, for example, rabbits.
Animals of Primates include, for example, monkeys of Catarrhini
(old world monkeys) such as Macaca fascicularis, rhesus monkeys,
sacred baboons, and chimpanzees.
[0076] Methods for immunizing animals with antigens are known in
the art. Intraperitoneal injection or subcutaneous injection of
antigens is a standard method of immunization for mammals. More
specifically, antigens may be diluted and suspended in an
appropriate amount of phosphate buffered saline (PBS),
physiological saline, etc. If desired, the antigen suspension may
be mixed with an appropriate amount of a standard adjuvant such as
Freund's complete adjuvant, made into an emulsion, and then
administered to mammalian animals. Preferably, this is followed by
several administrations of antigen mixed with an appropriately
amount of Freund's incomplete adjuvant every 4 to 21 days. An
appropriate carrier may also be used for immunization. After
immunizing as above, serum is examined by a standard method for an
increase in the amount of desired antibodies.
[0077] Polyclonal antibodies against the proteins of the present
invention may be prepared by collecting blood from the immunized
mammal after verifying an increase of desired antibodies in the
serum, and by separating serum from the blood by any conventional
method. Polyclonal antibodies include serum containing polyclonal
antibodies, as well as fractions containing the polyclonal
antibodies isolated from the serum. Immunoglobulin G or M can be
prepared from a fraction which recognizes only the protein of the
present invention using, for example, an affinity column coupled
with a protein of the present invention, and further purifying this
fraction using a protein A or protein G column.
[0078] To prepare monoclonal antibodies, immunocytes are collected
from the mammal immunized with the antigen and checked for an
increase in the level of desired antibodies in the serum as
described above, and are subjected to cell fusion. The immune cells
used for cell fusion are preferably obtained from the spleen. Other
preferred parental cells to be fused with the above immunocytes
include, for example, mammalian myeloma cells, and more preferably
myeloma cells having an acquired property for the selection of
fused cells by drugs.
[0079] The above immunocytes and myeloma cells can be fused
according to known methods, for example, the method of Milstein et
al. (Galfre, G. and Milstein, C., Methods Enzymol. (1981) 73,
3-46).
[0080] Resulting hybridomas obtained by the cell fusion may be
selected by cultivating them in a standard selection medium such as
the HAT medium (hypoxanthine, aminopterin, and thymidine containing
medium). The cell culture is typically continued in the HAT medium
for several days to several weeks, which is sufficient to allow all
the other cells, with the exception of the desired hybridoma
(non-fused cells), to die. Then, standard limiting dilution is
performed to screen and clone a hybridoma producing the desired
antibody.
[0081] In addition to the above method in which a non-human animal
is immunized with an antigen for preparing a hybridoma, a hybridoma
producing a desired human antibody that is able to bind to a
protein can be obtained by the following method. First, human
lymphocytes such as those infected by the EB virus may be immunized
with a protein, protein expressing cells, or their lysates in
vitro. Then, the immunized lymphocytes are fused with human-derived
myeloma cells that are capable of indefinite division, such as
U266, to yield the desired hybridoma (Unexamined Published Japanese
Patent Application No. (JP-A) Sho 63-17688).
[0082] The obtained hybridomas are subsequently transplanted into
the abdominal cavity of a mouse and the ascites are harvested. The
obtained monoclonal antibodies can be purified by, for example,
ammonium sulfate precipitation, a protein A or protein G column,
DEAE ion exchange chromatography, or an affinity column to which a
protein of the present invention is coupled. The antibodies of the
present invention can be used not only for purification and
detection of the proteins of the present invention, but also as
candidates for agonists and antagonists of the proteins. In
addition, these antibodies can be applied to the antibody treatment
for diseases related to the proteins of the present invention. When
an obtained antibody is to be administered to the human body
(antibody treatment), a human antibody or a humanized antibody is
preferable to reduce immunogenicity.
[0083] For example, transgenic animals having a repertoire of human
antibody genes may be immunized with an antigen selected from a
protein, cells expressing the protein or their lysates. Antibody
producing cells are then collected from the animals and fused with
myeloma cells to obtain hybridomas, from which human antibodies
against the protein can be prepared (see WO92-03918, WO93-2227,
WO94-02602, WO94-25585, WO96-33735, and WO96-34096).
[0084] Alternatively, an immunocyte that produces antibodies, such
as an immunized lymphocyte, may be immortalized by an oncogene and
used for preparing monoclonal antibodies.
[0085] Monoclonal antibodies thus obtained can also be
recombinantly prepared using genetic engineering techniques (see,
for example, Borrebaeck C. A. K. and Larrick J. W. Therapeutic
Monoclonal Antibodies, published in the United Kingdom by MacMillan
Publishers LTD (1990)). A DNA encoding an antibody may be cloned
from an immunocyte, such as a hybridoma or an immunized lymphocyte
producing the antibody, inserted into an appropriate vector, and
introduced into host cells to prepare a recombinant antibody. The
present invention also provides recombinant antibodies prepared as
described above.
[0086] Furthermore, an antibody of the present invention may be a
fragment of an antibody or modified antibody, so long as it binds
to one or more of the proteins of the invention. For instance, the
antibody fragment may be Fab, F(ab').sub.2, Fv, or single chain Fv
(scFv), in which Fv fragments from H and L chains are ligated by an
appropriate linker (Huston J. S. et al. Proc. Natl. Acad. Sci.
U.S.A. 85:5879-5883 (1988)). More specifically, an antibody
fragment may be generated by treating an antibody with an enzyme
such as papain or pepsin. Alternatively, a gene encoding the
antibody fragment may be constructed, inserted into an expression
vector, and expressed in an appropriate host cell (see, for
example, Co M. S. et al. J. Immunol. 152:2968-2976 (1994); Better
M. and Horwitz A. H. Methods Enzymol. 178:476-496 (1989); Pluckthun
A. and Skerra A. Methods Enzymol. 178:497-515 (1989); Lamoyi E.
Methods Enzymol. 121:652-663 (1986); Rousseaux J. et al. Methods
Enzymol. 121:663-669 (1986); Bird R. E. and Walker B. W. Trends
Biotechnol. 9:132-137 (1991)).
[0087] An antibody may be modified by conjugation with a variety of
molecules, such as polyethylene glycol (PEG). The present invention
provides such modified antibodies. The modified antibody can be
obtained by chemically modifying an antibody. These modification
methods are conventional in the field.
[0088] Alternatively, an antibody of the present invention may be
obtained as a chimeric antibody between a variable region derived
from a nonhuman antibody and a constant region derived from a human
antibody. It can also be obtained as a humanized antibody
comprising a complementarity-determining region (CDR) derived from
a nonhuman antibody, a frame work region (FR) and a constant region
derived from a human antibody. Such antibodies can be prepared
using a known technology.
[0089] Antibodies obtained as above may be purified to homogeneity.
For example, the separation and purification of the antibody can be
performed according to separation and purification methods used for
general proteins. For example, the antibody may be separated and
isolated by appropriately selecting and combining column
chromatographies such as affinity chromatography, filter,
ultrafiltration, salting-out, dialysis, SDS polyacrylamide gel
electrophoresis, isoelectric focusing, and others (Antibodies: A
Laboratory Manual. Ed Harlow and David Lane, Cold Spring Harbor
Laboratory, 1988), but the chromatographies are not limited
thereto. The concentration of the thus obtained antibodies can be
determined by measuring the absorbance, by an enzyme-linked
immunosorbent assay (ELISA), and so on.
[0090] A protein A column or protein G column can be used as the
affinity column. Examples of protein A columns include, for
example, Hyper D, POROS, and Sepharose F.F. (Pharmacia).
[0091] Examples of chromatographies other than affinity
chromatography includes, for example, ion-exchange chromatography,
hydrophobic chromatography, gel filtration, reverse-phase
chromatography, adsorption chromatography, and the like (Strategies
for Protein Purification and Characterization: A Laboratory Course
Manual. Ed Daniel R. Marshak et al., Cold Spring Harbor Laboratory
Press, 1996). The chromatographies can be carried out by a
liquid-phase chromatography, such as HPLC, FPLC.
[0092] For example, measurement of absorbance, enzyme-linked
immunosorbent assay (ELISA), enzyme immunoassay (EIA),
radioimmunoassay (RIA), and/or immunofluorescence may be used to
measure the antigen binding activity of an antibody of the
invention. In ELISA, an antibody of the present invention is
immobilized on a plate, a protein of the invention is applied to
the plate, and then a sample containing a desired antibody, such as
a culture supernatant of antibody producing cells or purified
antibodies, is applied. Then, a secondary antibody that recognizes
the primary antibody and is labeled with an enzyme such as alkaline
phosphatase is applied, and the plate is incubated. Next, after
washing, an enzyme substrate such as p-nitrophenyl phosphate is
added to the plate, and the absorbance is measured to evaluate the
antigen binding activity of the sample. A fragment of the protein,
such as a C-terminal fragment may be used as the protein. BIAcore
(Pharmacia) may be used to evaluate the activity of an antibody
according to the present invention.
[0093] These methods allow the detection or measurement of a
protein of the invention by exposing an antibody of the invention
to a sample assumed to contain the protein of the invention, and
detecting or measuring the immune complex formed by the antibody
and the protein. Because the method of detection or measurement of
the protein according to the invention can specifically detect or
measure a protein, the method may be useful in a variety of
experiments in which the protein is used.
[0094] Furthermore, the present invention provides a polynucleotide
comprising at least 15 nucleotides, which is complementary to a DNA
encoding the MC-PIR1 or MC-PIR2 protein (comprising the nucleotide
sequence according to SEQ ID NO: 1 or 3) or a complementary strand
thereof.
[0095] Herein, "complementary strand" means a strand that is
opposite relative to the other strand in a double-stranded nucleic
acid composed of A:T (U in the case of RNA) and G:C base pairs. In
addition, being "complementary" is not limited to having completely
complementarity in a continuous region of at least 15 nucleotides,
but it can also mean having a homology of at least 70%, preferably
at least 80%, more preferably 90%, and most preferably 95% or
higher at the nucleotide level. Homology can be determined using
the algorithm described herein.
[0096] Such nucleic acids include: probes or primers used for
detecting or amplifying a DNA encoding a protein of this invention;
probes or primers used for detecting DNA expression; or nucleotides
or nucleotide derivatives (for example, antisense oligonucleotides
or ribozymes, or DNA encoding them) used for regulating the
expression of a protein of this invention. Such nucleic acids may
also be useful for preparing DNA chips.
[0097] When using as a primer, the 3'-region can be made
complementary and a recognition site for a restriction enzyme, or a
tag can be attached to the 5'-region.
[0098] Antisense oligonucleotides include, for example, those that
hybridize with any site in the nucleotide sequence of SEQ ID NO: 1
or 3. Such antisense oligonucleotides are preferably complementary
to at least 15 or more continuous nucleotides in the sequence of
SEQ ID NO: 1 or 3. More preferably, they are complementary to at
least 15 or more continuous nucleotides comprising the translation
initiation codon in the sequence.
[0099] Derivatives or modified forms of antisense oligonucleotides
can be used as antisense oligonucleotides. For example, modified
antisense oligonucleotides include lower alkylphosphonate modified
forms such as the methylphosphonate type or ethylphosphonate type,
or phosphorothioate modified forms, phosphoroamidate modified
forms, or the like.
[0100] Antisense oligonucleotides are not limited to those in which
the entire nucleotide sequence corresponding to a nucleotide
sequence composing a certain DNA or mRNA region is completely
complementary. One or more nucleotide mismatches may be contained
as long as the antisense oligonucleotide specifically hybridizes
with the nucleotide sequence shown in SEQ ID NO: 1 or 3.
[0101] The antisense oligonucleotide derivatives or modified forms
of the present invention act upon cells producing a protein of the
invention by binding to the DNA or mRNA encoding the protein,
inhibiting its transcription or translation, promoting the
degradation of the mRNA, and inhibiting the expression of the
protein, thereby resulting in the inhibition of the protein's
function.
[0102] An antisense oligonucleotide derivative or modified form of
the present invention can be made into an external preparation,
such as a liniment or a poultice, by mixing with a suitable base
material which is inactive against the derivative or modified
form.
[0103] Also, as needed, the derivatives or modified forms can be
formulated into tablets, powders, granules, capsules, liposome
capsules, injections, solutions, nose-drops, and freeze-drying
agents by adding excipients, isotonic agents, solubilizers,
stabilizers, preservatives, pain-killers, and such. These can be
prepared by following usual methods.
[0104] The antisense oligonucleotide derivatives or modified forms
are given to a patient by directly applying them onto the ailing
site or by injecting them into a blood vessel so that they will
reach the site of ailment. An antisense-mounting medium can also be
used to increase durability and membrane-permeability. Examples
are, liposomes, poly-L-lysine, lipids, cholesterol, lipofectin or
derivatives of these.
[0105] The dosage of an antisense oligonucleotide derivative or
modified form of the present invention can be suitably adjusted
according to the patient's condition and used in desired amounts.
For example, a dose range of 0.1 to 100 mg/kg, preferably 0.1 to 50
mg/kg can be administered.
[0106] The antisense oligonucleotides of the invention inhibits the
expression of a protein of the invention and is thereby useful for
suppressing the biological activity of the protein. Also,
expression-inhibitors comprising an antisense oligonucleotide of
the invention are useful in that they can inhibit the biological
activity of a protein of the invention.
[0107] The proteins of this invention may be useful for screening
compounds capable of binding to the proteins. Specifically, the
proteins can be used in methods of screening for compounds capable
of binding to the proteins, comprising the steps of contacting a
protein of the invention and a test sample that is expected to
contain such a compound, and then selecting the compound.
[0108] The protein of the invention used for the screening may be a
recombinant protein or naturally-occurring protein. It may also be
a partial peptide. It can be expressed on the cell surface, or
contained in the membrane fraction. The test sample is not limited
to any particular sample; it can be, for example, a cell extract, a
cell culture supernatant, a product of a fermentation
microorganism, a marine organism extract, a plant extract, a
purified or crude protein, a peptide, a non-peptide compound, a
synthetic low molecular weight compound, or a natural compound. The
protein of this invention can be contacted with the test sample as
a purified protein, soluble protein, in a form bound to a carrier,
as a fusion protein with another protein, in a form expressed on
the cell surface, or as a form contained in the membrane
fraction.
[0109] As a method of screening for proteins that, for example,
bind to a protein of the present invention using a protein of the
present invention, many methods well known to those skilled in the
art can be used. Such a screening can be conducted by, for example,
the immunoprecipitation method, specifically, in the following
manner. A gene encoding a protein of the present invention is
expressed in animal cells, or such, by inserting the gene into an
expression vector for foreign genes, such as pSV2neo, pcDNA I, and
pCD8. The promoter to be used for the expression may be any
promoter that can generally be used and include, for example, the
SV40 early promoter (Rigby in Williamson (ed.), Genetic
Engineering, vol. 3. Academic Press, London, p. 83-141 (1982)), the
EF-1.alpha. promoter (Kim et al., Gene 91, p 217-223 (1990)), the
CAG promoter (Niwa et al. Gene 108, p. 193-200 (1991)), the RSV LTR
promoter (Cullen Methods in Enzymology 152, p. 684-704 (1987)) the
SR.alpha. promoter (Takebe et al., Mol. Cell. Biol. 8, p. 466
(1988), the CMV immediate early promoter (Seed and Aruffo Proc.
Natl. Acad. Sci. USA 84, p. 3365-3369 (1987)), the SV40 late
promoter (Gheysen and Fiers J. Mol. Appl. Genet. 1, p. 385-394
(1982)), the Adenovirus late promoter (Kaufman et al., Mol. Cell.
Biol. 9, p. 946 (1989)), the HSV TK promoter and so on.
[0110] The introduction of the gene into animal cells to express a
foreign gene can be performed according to any method, for example,
the electroporation method (Chu G et al. Nucl. Acids Res. 15,
1311-1326 (1987)), the calcium phosphate method (Chen, C. and
Okayama, H. Mol. Cell. Biol. 7, 2745-2752 (1987)), the DEAE dextran
method (Lopata, M. A. et al. Nucl. Acids Res. 12, 5707-5717
(1984)), Sussman, D. J. and Milman, G Mol. Cell. Biol. 4, 1642-1643
(1985)), the Lipofectin method (Derijard, B. Cell 7, 1025-1037
(1994); Lamb, B. T. et al. Nature Genetics 5, 22-30 (1993):
Rabindran, S. K. et al. Science 259, 230-234 (1993)), and so
on.
[0111] A protein of the present invention can be expressed as a
fusion protein comprising a recognition site (epitope) of a
monoclonal antibody by introducing, to the N- or C-terminus of the
protein, an epitope of a monoclonal antibody whose specificity has
been revealed. A commercially available epitope-antibody system can
be used (Experimental Medicine 13, 85-90 (1995)). Vectors that can
express a fusion protein with, for example, .beta.-galactosidase,
maltose-binding protein, glutathione S-transferase, green
florescence protein (GFP) and so on through multiple cloning sites
are commercially available.
[0112] A method of preparing a fusion protein by introducing only a
small epitope portion consisting of several to a dozen amino acids
so as to not change, as much as possible, the property of the
protein of the present invention by the fusion, has also been
reported. Epitopes, such as polyhistidine (His-tag), influenza
aggregate HA, human c-myc, FLAG, Vesicular stomatitis virus
glycoprotein (VSV-GP), T7 gene 10 protein (T7-tag), human simple
herpes virus glycoprotein (HSV-tag), E-tag (an epitope on
monoclonal phage), and such, and monoclonal antibodies recognizing
them can be used as epitope-antibody systems for screening proteins
binding to the proteins of the present invention (Experimental
Medicine 13, 85-90 (1995)).
[0113] In immunoprecipitation, an immune complex is formed by
adding these antibodies to a cell lysate prepared by using an
appropriate detergent. The immune complex consists of a protein of
the present invention, a protein that can bind with the protein,
and an antibody. Immunoprecipitation can also be conducted by using
antibodies against a protein of the present invention, besides
using antibodies against the above epitopes. An antibody against a
protein of the present invention can be prepared, for example, by
introducing a gene encoding the protein into an appropriate E. coli
expression vector, expressing the gene in E. coli, purifying the
expressed protein, and immunizing rabbits, mice, rats, goats,
chicken and such with the protein. The antibody can be also
prepared by immunizing an animal of above with a synthesized
partial peptide of the protein of the present invention.
[0114] An immune complex can be precipitated, for example by
Protein A Sepharose or Protein G sepharose when the antibody is a
mouse IgG antibody. If the proteins of the present invention are
prepared as fusion proteins with an epitope such as GST, an immune
complex can be formed in the same manner as when using the antibody
against a protein of the present invention, by using a substance
that specifically binds to the epitope, such as
glutathione-Sepharose 4B.
[0115] Immunoprecipitation can be performed by following or
according to, for example, methods in literature (Harlow, E. and
Lane, D.: Antibodies pp. 511-552, Cold Spring Harbor Laboratory
publications, New York (1988)).
[0116] SDS-PAGE is commonly used for analyzing immunoprecipitated
proteins. The bound protein can be analyzed by the molecular weight
of the protein using a gel with an appropriate concentration. Since
the protein bound to the protein of the present invention is
difficult to detect by a common staining method such as Coomassie
staining or silver staining, the detection sensitivity of the
protein can be improved by culturing cells in a culture medium
containing the radioactive isotope .sup.35S-methionine or
.sup.35S-cysteine, labeling proteins within the cells, and
detecting the proteins. Once the molecular weight of the protein
has been revealed, the target protein can be purified directly from
the SDS-polyacrylamide gel and its sequence can be determined.
[0117] In addition, as a method for isolating a protein capable of
binding to the protein using a protein of this invention, western
blotting may be used (Skolnik E. Y. et al. Cell 65:83-90 (1991)).
Specifically, a cDNA library using a phage vector (.lamda.gt11,
ZAP, and the like) can be prepared using a cell, tissue, or organ
expected to express a protein capable of binding to the protein of
this invention (for example, adipocytes or tissues where the
expression is detected by northern blotting in the Examples). Then,
the cDNA library can be expressed on LB-agarose, expressed protein
immobilized onto a filter, the protein of this invention, which is
purified and labeled, incubated with the above filter, and the
plaque expressing the protein capable of binding to the protein of
this invention detected by the label. For labeling the protein of
this invention, methods that make use of: the binding between
biotin and avidin; an antibody specifically binding to the protein
of this invention, or a peptide or polypeptide fused to the protein
(for example, GST); radioisotopes; or fluorescence, or the like,
can be used.
[0118] In another embodiment of the screening methods of this
invention, the two-hybrid system using cells may be used (Fields S,
and Sternglanz R. Trends Genet. 10: 286-292 (1994); Dalton S, and
Treisman R. Characterization of SAP-1, a protein recruited by serum
response factor to the c-fos serum response element. Cell 68:
597-612 (1992); "MATCHMAKER Two-Hybrid System"; "Mammalian
MATCHMAKER Two-Hybrid Assay Kit"; "MATCHMAKER One-Hybrid System"
(all from Clontech); and "HybriZAP Two-Hybrid Vector System"
(Stratagene)). In the two-hybrid system, a protein of this
invention or a partial peptide may be expressed in yeast cells as a
fusion protein with the SRF DNA binding domain, or GAL4 DNA binding
domain. A cDNA library in which the protein is expressed as a
fusion between the VP16 or GAL4 transcription activation domain is
prepared from cells in which a protein capable of binding to a
protein of this invention is expected to be present. The library is
transfected into yeast cells, and cDNA derived from the library is
isolated from a positive clone detected (when a protein capable of
binding to the protein of this invention is expressed in yeast
cells, binding of the two proteins activates a reporter gene, which
is used to detect a positive clone). Isolated cDNA may be
introduced and expressed in E. coli to obtain a protein encoded by
the cDNA. The reporter gene used in the two-hybrid system may be,
for example, a gene such as HIS3, Ade2, LacZ, CAT, luciferase, and
PAI-1 (plasminogen activator inhibitor type I), but is not limited
thereto. Such a screening using the two-hybrid system may be
performed using a mammalian cell other than yeast.
[0119] A compound binding to a protein of the present invention can
be screened using affinity chromatography. For example, the protein
of the invention may be immobilized on a carrier of an affinity
column, and a test sample presumed to express a protein capable of
binding to the protein of the invention, is applied to the column.
Herein, a test sample may be, for example, a cell extract, cell
lysate, etc. After loading the test sample, the column is washed,
and proteins bound to the protein of the invention can be
prepared.
[0120] The amino acid sequence of the obtained protein is analyzed,
an oligo DNA is synthesized based on the sequence, and cDNA
libraries are screened using the oligo DNA as a probe to obtain a
DNA encoding the protein.
[0121] A biosensor using the surface plasmon resonance phenomenon
may be used as a means for detecting or quantifying the bound
compound in the present invention. When such a biosensor is used,
the interaction between the protein of the invention and a test
compound can be observed real-time as a surface plasmon resonance
signal, using only a minute amount of protein and without labeling
(for example, BIAcore, Pharmacia). Therefore, it is possible to
evaluate the binding between the protein of the invention and a
test compound using a biosensor such as BIAcore.
[0122] The methods of screening for molecules that bind when the
immobilized protein of the present invention is exposed to
synthetic chemical compounds, or natural substance banks, or a
random phage peptide display library, or the methods of screening
using high-throughput based on combinatorial chemistry techniques
(Wrighton Nc, Farrel F X, Chang R, Kashyap A K, Barbone F P,
Mulcahy L S, Johnson D L, Barret R W, Jolliffe L K, Dower W J;
Small peptides as potent mimetics of the protein hormone
erythropoietin, Science (UNITED STATES) Jul. 26, 1996, 273 p
458-64, Verdine G L., The combinatorial chemistry of nature. Nature
(ENGLAND) Nov. 7, 1996, 384, p 11-13, Hogan J C Jr., Directed
combinatorial chemistry. Nature (ENGLAND) Nov. 7, 1996, 384 p 17-9)
to isolate not only proteins but chemical compounds that bind to a
protein of the present invention (including agonists and
antagonists) are well known to those skilled in the art.
[0123] In addition, the present inventors demonstrated that the
proteins of this invention are capable of binding to SHP-1, SHP-2,
SHIP, DAP10, DAP12, or FcR.gamma. protein. Thus, using the above
described immunoprecipitation or the two-hybrid system, the binding
ability between a protein of this invention and SHP-1, SHP-2, SHIP,
DAP10, DAP12, or FcR.gamma. protein in the presence of a test
sample can be detected, and a substance with the ability to reduce
the binding may be selected to screen for a candidate for a
medicinal compound. Thus, the present invention provides a
screening method comprising the steps of contacting a protein of
this invention with a protein selected from the group consisting of
SHP-1, SHP-2, SHIP, DAP10, DAP12, and FcR.gamma. proteins in the
presence of a test sample, detecting the binding activity, and
selecting a substance capable of reducing the binding activity by
comparing with the activity detected in the absence of the test
sample.
[0124] Such compounds isolated using the screening methods of this
invention can be candidates of therapeutic agents for regulating
the activity of a protein of this invention. They may be useful in
applications such as treatment of diseases caused by abnormal
function or abnormal expression of the protein, or diseases that
can be treated by regulating the activity of the protein. Such
diseases include allergic diseases such as atopic dermatitis,
rhinitis, and asthma. Also included in the compounds capable of
binding to proteins of this invention are substances in which a
part of the structure of a compound isolated using a screening
method is modified by addition, deletion, and/or substitution.
[0125] When administrating a protein of this invention or a
compound isolated by a screening method of the invention as a
pharmaceutical for humans and other mammals such as mice, rats,
guinea-pigs, rabbits, chicken, cats, dogs, sheep, pigs, cattle,
monkeys, baboons and chimpanzees, the protein or the isolated
compound can be directly administered or formulated into a dosage
form using known pharmaceutical preparation methods. For example,
according to the need, the pharmaceutical can be taken orally, as a
sugar-coated tablet, capsule, elixir or microcapsule, or
non-orally, in the form of an injection of a sterile solution or
suspension with water or any other pharmaceutically acceptable
liquid. For example, the compounds can be mixed with
pharmacologically acceptable carriers or medium, specifically,
sterilized water, physiological saline, plant oils, emulsifiers,
suspending agents, surfactants, stabilizers, flavoring agents,
excipients, vehicles, preservatives, binders and such, in a unit
dose form required for generally accepted drug implementation. The
amount of active ingredient in these preparations facilitates the
acquisition of a suitable dosage within the indicated range.
[0126] Examples of additives that can be mixed to tablets and
capsules are, binders such as gelatin, corn starch, tragacanth gum
and arabic gum; excipients such as crystalline cellulose; swelling
agents such as corn starch, gelatin and alginic acid; lubricants
such as magnesium stearate; sweeteners such as sucrose, lactose or
saccharin; flavoring agents such as peppermint, Gaultheria
adenothrix oil and cherry. When the unit dosage form is a capsule,
a liquid carrier such as oil can also be included in the above
ingredients. Sterile composites for injections can be formulated
following normal drug implementations using vehicles such as
distilled water used for injections.
[0127] Physiological saline, glucose, and other isotonic liquids
including adjuvants such as D-sorbitol, D-mannose, D-mannitol, and
sodium chloride, can be used as aqueous solutions for injections.
These can be used in conjunction with suitable solubilizers such as
alcohol, specifically ethanol, polyalcohols such as propylene
glycol and polyethylene glycol, and non-ionic surfactants such as
Polysorbate 80 (TM) and HCO-50.
[0128] Sesame oil or Soy-bean oil can be used as a oleaginous
liquid and may be used in conjunction with benzyl benzoate or
benzyl alcohol as a solubilizer and may be formulated with a buffer
such as phosphate buffer and sodium acetate buffer; a pain-killer,
such as procaine hydrochloride; a stabilizer, such as benzyl
alcohol, phenol; and an anti-oxidant. The prepared injection may be
filled into a suitable ampule.
[0129] Methods well known to those skilled in the art may be used
to administer the inventive pharmaceutical to patients, for example
as intraarterial, intravenous, percutaneous injections and also as
intranasal, transbronchial, intramuscular, percutaneous, or oral
administrations. The dosage and method of administration vary
according to the body weight and age of the patient and the
administration method; however, these can be routinely selected by
one skilled in the art. If said compound is encodable by a DNA, the
DNA can be inserted into a vector for gene therapy and the vector
administered to perform the therapy. The dosage and method of
administration vary according to the body weight, age, and symptoms
of the patient, but one skilled in the art can select them
suitably.
[0130] The dose per time of a protein of this invention may vary
depending on the type of recipient, target organ, disease
condition, and administration method. For example, when injecting
into a normal adult (body weight: 60 kg), it may be administered at
about 100 .mu.g to 20 mg per day.
[0131] The dose of a compound that binds to a protein of this
invention, or that of a compound that regulates the activity of a
protein of this invention vary depending on the type of disease.
For example, the compound may be administered orally into a normal
adult (body weight: 60 kg) at about 0.1 to 100 mg per day,
preferably at about 1.0 to 50 mg per day, and more preferably at
about 1.0 to 20 mg per day.
[0132] When administered parenterally, the dose per time may vary
depending on the recipient, target organ, disease condition, and
administration method. For example, an appropriate dose can be, as
an intravenous injection into a normal adult (body weight: 60 kg),
usually about 0.01 to 30 mg per day, preferably about 0.1 to 20 mg
per day, and more preferably about 0.1 to 10 mg per day. For other
animals, an amount converted to dose per 60 kg body weight, or dose
per body surface area may be applied.
BRIEF DESCRIPTION OF THE DRAWINGS
[0133] FIG. 1 shows the nucleotide sequence of the MC-PIR1 cDNA
(SEQ ID NO:1) and its deduced amino acid sequence (SEQ ID NO:2).
Dotted line under the nucleotide sequence indicates the DNA
fragment isolated by the SST-REX method. Poly-A signal is shown by
the underline at the bottom. The signal sequence is indicated by
lower case letters. Thickened underline shows the transmembrane
domain. The ITIM sequences are shown by doubled underlines.
Cysteines participating in S--S bond formation are boxed. The
binding sequence for the asparagine-linked sugar chain is also
boxed.
[0134] FIG. 2 shows the open-reading frame of MC-PIR2 (SEQ ID NO:3)
and its deduced amino acid sequence (SEQ ID NO:4). The signal
sequence is shown by lower case letters. The transmembrane domain
is indicated by thickened underline. The lysine residue critical
for binding to other cofactor molecule containing the ITAM sequence
in the transmembrane domain is boxed. Cysteines participating in
S--S bond formation are also boxed. The binding sequence for the
asparagine-linked sugar chain is also boxed.
[0135] FIG. 3 is a photograph showing the result of a PCR analysis
of MC-PIR1 and MC-PIR2 expression in different tissues. GAPDH was
used as a control.
[0136] FIG. 4 is a photograph showing the result of an RT-PCR
analysis of MC-PIR1 and MC-PIR2 expression in different cell types.
GAPDH was used as a control.
[0137] FIG. 5 shows the result of a FACS analysis indicating the
presence of MC-PIR1 and MC-PIR2 on mast cell surface.
[0138] FIG. 6 is an electrophoresis photograph showing the result
of tyrosine phosphorylation of a chimeric protein induced by
cross-linking with anti-mouse IgG antibody.
[0139] FIG. 7 an electrophoresis photograph showing the result of
complex formation with phosphotyrosine phosphatase SHP-1 and SHP-2,
and phosphoinositide phosphatase SHIP.
[0140] FIG. 8 is an electrophoresis photograph showing that MC-PIR2
forms a complex with ITAM-comprising signaling molecules DAP10,
DAP12, and FcR.gamma..
[0141] FIG. 9 schematically shows the signal transduction of
Fc.epsilon.RI and the inhibitory function of MC-PIR1.
EXAMPLES
[0142] This invention will be explained in detail below with
reference to Examples, but it is not to be construed as being
limited thereto.
Example 1
Construction of a cDNA Library and Screening
[0143] A cDNA library was constructed and expressed using the
retrovirus vector pMX-SST (Kojima T. and Kitamura T. Nature
Biotechnol. 17: 487-490 (1999)).
[0144] Poly-A(+) RNA was extracted from mast cells derived from
mouse bone marrow, stimulated with antigen using the Fast track 2.0
mRNA extraction kit (Invitrogen, Carlsbad, Calif.) according to the
manufacturer's protocol.
[0145] cDNA was synthesized from poly-A(+) RNA using the
SuperScript Choice System (Invitrogen) and random hexamers, and
inserted into the BstXI site of pMX-SST vector using a BstXI
adaptor (Invitrogen). To construct a SST-REX library, ligated DNA
was amplified in DH10B cells (ElectroMax, Invitrogen), and library
DNA was prepared using the Qiagen plasmid kit (Qiagen Inc.,
Valencia, Calif.). The size of the cDNA library was
2.0.times.10.sup.6 clones.
[0146] High titer retroviruses presenting the SST-REX library was
produced using the Plat-E packaging cell line (Morita S. et al.
Gene Therapy 7: 1063-1066 (2000)), and used for infection of Ba/F3
cells as described. The day following infection, cells were washed
three times, seeded in 96-well multi titer plates (10.sup.3
cells/well), and clones were selected in the absence of IL-3.
[0147] After twelve days, genomic DNA was extracted from factor
independent Ba/F3 clones, and subjected to genomic PCR using vector
primers to recover inserted cDNA (GGGGGTGGACCATCCTCTA/SEQ ID NO: 5;
and CGCGCAGCTGTAAACGGTAG/SEQ ID NO: 6). PCR was performed on
GeneAmp PCR system 480 (Perkin Elmer, Norfolk, Conn.) using LA Taq
polymerase (TaKaRa, Kyoto, Japan) in 30 cycles (each cycle
consisting of denaturation at 98.degree. C. for 20 seconds,
followed by annealing and extension at 68.degree. C. for 2
minutes). The obtained PCR fragment was processed for sequencing
using the Taq Dye-Terminator Cycle Sequencing kit (Applied
Biosystems Inc., Foster City, Calif.), and analyzed using an
automated DNA sequencer (377 DNA analyzer; Applied Biosystems
Inc.).
[0148] Differentiated cultured mast cells used in the experiment,
which were derived from mouse bone marrow, were prepared as
follows. Bone marrow cells were prepared from the thigh bone of
CBA/JN mice, and cultured in RPMI 1640 supplemented with 10% FCS,
100 unit/ml of penicillin, 100 .mu.g/ml of streptomycin, and 10
ng/ml of mouse IL-3 at 37.degree. C., 5% CO.sub.2. Cells were
passaged every couple of days at a density of 5.times.10.sup.5
cells, and maintained for four weeks to allow differentiation.
Ba/F3 cells, a mouse IL-3 dependent pro B-cell line, were cultured
in RPMI 1640 supplemented with 10% FCS, and 1 ng/ml of mouse IL-3
(R&D Systems).
[0149] Antigen stimulation of mast cells was performed as follows
(Kawakami T. et al. J. Immunol. 148: 3513-3519 (1992)). Mast cells
were challenged with 0.5 .mu.g/ml of anti-DNP-IgE antibody (Sigma)
overnight, and the next day, with 100 ng/ml of DNP-BSA (CosmoBio)
for two hours.
Example 2
Analysis of Isolated cDNA Clones
[0150] From the cDNA clones, a DNA fragment containing a signal
sequence and encoding a single immunoglobulin domain was
isolated.
[0151] A cDNA library was constructed using an oligo-dT primer.
cDNA was synthesized from poly-A(+) RNA using the SuperScript
Choice System (Invitrogen) and oligo-dT primer, and inserted into
the BstXI site of pME18S vector using a BstXI adaptor (Invitrogen).
To construct an oligo-dT cDNA library ligated DNA was amplified in
DH10B cells, and library DNA was prepared using the Qiagen plasmid
purification kit (Qiagen Inc.). The size of the cDNA library was
1.5.times.10.sup.8 clones.
[0152] Full-length cDNA was isolated by hybridization using RecA
(Daiichi Kagaku Yakuhin, Tokyo, Japan). Using the isolated cDNA
fragment as a template, PCR reaction was performed to synthesize a
probe of approximately 500 bp, in which biotin 21-dUTP was
incorporated (Clontech). The probe was hybridized with the oligo-dT
cDNA library in the presence of RecA. DNA recovered using
streptavidin magnetic beads (Promega) was amplified in DH10B cells
(ElectroMax, Invitrogen), and E. coli clones were obtained. The E.
coli clones were grown in a large scale, and DNA was prepared using
the Qiagen plasmid kit (Qiagen Inc.). Purified DNA was processed
for sequencing using the Taq Dye-Terminator Cycle Sequencing kit
(Applied Biosystems Inc., Foster City, Calif.), and analyzed on an
automated DNA sequencer (377 DNA analyzer; Applied Biosystems
Inc.).
[0153] The obtained cDNA had a full length of 1752 bp, of which 957
nucleotides composed an open reading frame. The 3'-region, spanning
648 nucleotides, contained the poly-A-attaching signal. The deduced
amino acid sequence contained 318 residues, in which a signal
sequence of 27 amino acids, an extracellular domain of 156 amino
acids, a transmembrane domain of 23 amino acids, and an
intracellular domain of 112 amino acids were found. The
extracellular domain had a single immunoglobulin domain of a
variable type. The intracellular domain contained four ITIM-like
sequences (FIG. 1). This gene was named MC-PIR1.
[0154] Genes having homology with this novel mouse gene are
CMRF-35-H9 (CMRF-35H) (Green B. J. et al. Int. Immunol. 10: 891-899
(1998); Accession No. AF020314), and IRp60 (Cantoni C. et al. Eur.
J. Immunol. 29: 3148-3159 (1999); Accession No. AJ224864). It is
unknown, however, whether CMRF-35H or IRp60 is expressed in mast
cells. According to the structural similarities, these genes are
considered to be the human homologues of MC-PIR1.
[0155] The MC-PIR1 sequence was used to search EMBL/GenBank/DDBJ
DNA databases. As a result, a DNA sequence (Accession No. BC006801)
having approximately 90% homology with the immunoglobulin domain of
MC-PIR1 was found. The sequence information was used to design
primers, and RT-PCR was performed using total RNA prepared from
mast cells. As a result, expression of a similar gene product was
detected. Furthermore, the DNA fragment was recovered for sequence
analysis.
[0156] As a result, a DNA having a sequence almost identical to
that deposited in the DNA database (with two different bases at two
sites compared to the sequence of Accession No. BC006801, resulting
in two amino acid substitutions) was obtained, and named MC-PIR2
(FIG. 2). Later, it turned out that MC-PIR2 encodes exactly the
same protein as DIgR1 (Luo K. et al. Biochem. Biophys. Res. Commun.
287: 35-41 (2001); Accession No. AY048685). The human gene CMRF-35A
(Clark G. J. et al. Tissue Antigens 57: 415-423 (2001); Accession
No. BC022279) is homologous to this mouse gene. However it is not
known whether or not DIgR1 or CMRF-35A is expressed in mast cells,
or what functions they have therein.
Example 3
Expression Profile of MC-PIR1 and MC-PIR2
[0157] Expression profile of the genes was analyzed by PCR. A
commercial DNA, a cDNA synthesized from mRNA derived from different
mouse tissues (Clontech), was used as a template for the PCR to
amplify the DNA fragment. In addition, total RNA was prepared from
a variety of hematopoietic lineage cell lines using the Trizol
reagent (Invitrogen), and used to prepare cDNA using a reverse
transcriptase (Qiagen). The cDNA was used as a template for PCR to
amplify DNA fragment. Amplified DNA fragment was separated by
electrophoresis on a 1% agarose gel.
[0158] Both MC-PIR1 and MC-PIR2 were expressed abundantly in the
spleen and liver. For both, amplification of a specific DNA
fragment was detected in mouse bone marrow-derived cultured mast
cells (BMMC). Amplification of MC-PIR1 was not detected in other
cell lines including Ba/F3, A20, EL4, CTLL-2, FDC-P1, L-G, 32Dc13,
J774.1, and P815. Expression of MC-PIR2 was detected in J774.1 and
FDC-P1 as well (FIGS. 3 and 4). The result suggests that MC-PIR1
and MC-PIR2 is directly involved in the regulation of mast cell
function.
Example 4
Expression of MC-PIR1 and MC-PIR2 on the Cell Surface of Mouse Bone
Marrow-Derived Mast Cells
[0159] Mast cells, prepared by the method in Example 1, were
incubated with PE-labeled anti-CD117 monoclonal antibody (BD
Pharmingen), and then with anti-MC-PIR1 mouse monoclonal antibody
(custom made by R&D Systems) or anti-MC-PIR2 rabbit polyclonal
antibody (custom made by Sigma Genosys). After washing, cells were
incubated with FITC-labeled anti-mouse immunoglobulin antibody (BD
Pharmingen), or FITC-labeled anti-rabbit immunoglobulin antibody
(BD Pharmingen), respectively. After washing, cells were analyzed
by FACSCalibur (Becton Dickinson).
[0160] About 90% to 95% of prepared cells were positive for CD117,
and almost all the cells were induced to become mast cells. In
CD117 positive cells, 90% were MC-PIR1 positive, and 25% was
MC-PIR2 positive (FIG. 5). The result indicates that both MC-PIR1
and MC-PIR2 are present on the mast cell surface.
Example 5
Analysis of the Intracellular Domain of MC-PIR1
[0161] A chimeric gene between Fc.gamma.RIIB and MC-PIR1 was
constructed. A DNA fragment encoding the extracellular and
transmembrane domains of Fc.gamma.RIIB was amplified by PCR.
Similarly, a DNA fragment encoding the intracellular domain of
MC-PIR1 was amplified by PCR. The two fragments were mixed and used
as a template for PCR to amplify a DNA fragment and construct a
chimeric gene. Then, a chimeric DNA fragment was digested with
EcoRI and NotI, and inserted into pMX-IRES-puro vector to construct
pMX-IRES-puro-Fc-PIR1.
[0162] A high titer stock of retroviruses presenting
pMX-IRES-puro-Fc-PIR1 was produced in the Plat-E packaging cell
line and used to infect IIA1.6 cells, an Fc.gamma.RIIB deficient
cell line, as described (Jones B. et al. J. Immunol. 136: 348-356
(1986)). A day after infection, the medium was supplemented with 1
.mu.g/ml of puromycin (Clontech), and the culture was continued for
an additional week to obtain a cell line expressing the chimeric
gene.
[0163] The cell line expressing the chimeric gene was incubated
with an anti-mouse IgG antibody (Zymed) to cross-link B-cell
receptor and the chimeric gene product expressed on the cell
surface, harvested over a time course, and lysed in cell lysis
buffer. 2.4 G monoclonal antibody (Becton Dickinson) was added to
the cell lysate and anti-rat IgG antibody-Sepharose beads, and an
immune complex was precipitated. The pellet was treated with
peptide N-glycosidase F (Daiichi Kagaku Yakuhin), and subjected to
electrophoresis on a 10% polyacrylamide gel (PAGE).
[0164] The immune complex separated by PAGE was electrically
transferred onto an Immobilon-P membrane (Millipore). The membrane
was blocked with buffer containing 10% FCS, and then incubated
successively with the 4G10 monoclonal antibody (UpState
Biotechnology) and HRP-conjugated anti-mouse immunoglobulin
antibody (Sigma). The signal was detected using chemiluminescence
reagents (Pharmacia).
[0165] Similarly, cells expressing the chimeric gene were
cross-linked, and a membrane was prepared as described. The
membrane was incubated with an anti-SHP-1 antibody (Santa Cruz),
anti-SHP-2 antibody (Santa Cruz), or anti-SHIP antibody. The
detection was performed as described above.
[0166] Tyrosine phosphorylation of the chimeric protein was
detected 0.5 minutes after cross-linking. Furthermore, an immune
complex containing the chimeric protein was found containing SHP-1,
SHP-2, and SHIP. The complex formation was dependent on tyrosine
phosphorylation of the chimeric protein (FIGS. 6 and 7).
Example 6
Complex Formation Between MC-PIR2 and ITAM-Comprising Signaling
Molecules
[0167] MC-PIR2 was amplified by PCR using a primer attached with an
HA tag at the C-terminal end. The obtained fragment was digested
with EcoRI and NotI, and inserted into the pMKIT vector to
construct pMKIT-MC-PIR2-HA.
[0168] The DNA fragment encoding a mature protein of ITAM
sequence-comprising proteins DAP10, DAP12, or FcR.gamma. was
amplified by PCR. The amplified DNA fragment was digested with
HindIII and NotI, and inserted into the downstream of the FLAG tag
in the pMKIT-FLAG vector.
[0169] PMKIT-MC-PIR2-HA and either the pMKIT mock vector,
FLAG-DAP10 vector, FLAG-DAP12 vector, or FLAG-FcR.gamma. vector
were transfected into COS1 cells. After two days, cells were
harvested, and lysed in a cell lysis buffer. An anti-HA monoclonal
antibody (12CA5, Roche Diagnostics), and Protein A-Sepharose beads
were added to the cell lysate, and an immune complex was
precipitated. The pellet was subjected to electrophoresis on a 15%
polyacrylamide gel (PAGE). The immune complex separated by PAGE was
electrically transferred onto an Immobilon-P membrane (Millipore).
The membrane was blocked with a buffer containing 10% FCS, and then
incubated successively with an anti-FLAG-M2 monoclonal antibody
(Sigma), and an HRP-conjugated anti-mouse immunoglobulin antibody
(Sigma). The signal was detected using chemiluminescence reagents
(Pharmacia).
[0170] In the lane containing the lysate of cells transfected with
MC-PIR2 and pMKIT mock vector, no band was detected with the
anti-FLAG antibody. In contrast, the same anti-FLAG antibody
detected a band in the lanes containing the lysates of cells
transfected with MC-PIR2 and FLAG-DAP10, or FLAG-DAP12, or
FLAG-FcR.gamma.. Thus, MC-PIR2 was shown to interact with
ITAM-comprising signaling molecules, DAP10 (Wu J. et al. Science
285: 730-732 (1999)), DAP12 (Lanier L. L. et al. Nature 391: 03-707
(1998)), or FcR.gamma. (Vivier E. et al. Int. Immunol. 4: 313-1323
(1992)) (FIG. 8). The result suggests that MC-PIR2 participates in
the regulation of activation signal transduction.
INDUSTRIAL APPLICABILITY
[0171] The present invention provides genes encoding novel mast
cell-derived membrane proteins considered to be involved in the
regulation of signal transduction in mast cells. These gene
products are expected to inhibit or activate the signal
transduction in mast cells following antigen stimulation through
the following working hypothesis based on their expression profile
and their ability to bind to proteins participating in signal
transduction.
[0172] When Fc.epsilon.RI is cross-linked by IgE and antigens in
mast cells, the activity of protein kinases increases in the cells,
followed by increase in phosphatidylinositol turnover, which then
results in an increase of intracellular calcium ion concentration
and induction of degranulation. In addition, because PI3K is also
activated, the level of PIP3 is increased on the plasma membrane,
which leads to activation of Btk and the like (Kawakami Y. et al.
Mol. Cell. Biol. 14: 5108-5113 (1994)). The inhibitory signal
transduction pathways generally known are the SHIP dependent
pathway (Muta T. et al. Nature 368: 70-73 (1994)) observed for
Fc.gamma.RIIB, and the SHP dependent pathway mediated by tyrosine
phosphatases (Binstadt B. A. et al. Immunity 5: 629-638 (1996)).
Because MC-PIR1 is capable of activating both pathways together, it
is expected to inhibit the signaling from Fc.epsilon.RI more
strongly (FIG. 9).
[0173] On the other hand, MC-PIR2 is capable of making a complex
with ITAM-comprising signaling molecules DAP10, DAP12, and
FcR.gamma., and thus, are expected to induce activation through
kinases such as the Src family kinases, or PI3 kinase, or the like
(Wu J. et al. Science 285: 730-732 (1999); Lanier L. L. et al.
Nature 391: 703-707 (1998); Vivier E. et al. Int. Immunol. 4:
1313-1323 (1992)). Therefore, inhibition of complex formation
between MC-PIR2 and these ITAM-comprising signaling molecules is
expected to inhibit the transduction of the activation signal, for
example. Thus, it is possible that MC-PIR2 itself is a target
molecule of suppressors of mast cell activation signal
transduction.
[0174] Products of MC-PIR1 and MC-PIR2 genes, and their human
homologues will be useful for screening natural ligands, compounds
mimicking their effects, or antibodies. Such ligands, compounds, or
antibodies obtained by the above screenings, could inhibit mast
cell activation signal transduction, and can be used as
anti-allergy agents that function through a novel mechanism.
Sequence CWU 1
1
611752DNAMus musculusCDS(148)..(1104) 1acagaactga ggaaagtcag
aagcaaaaca gctagacaca aagaaaagca gaagtgggct 60gtctcagaga ctggccgtcc
cctagcggga ctgaaccgtg gagcgtccag ccgtggcctg 120cctgccggtg
acccgtgtgt gggagaa atg acc caa ctg gcc tca gct gtg tgg 174 Met Thr
Gln Leu Ala Ser Ala Val Trp 1 5ctg ccc acg ctg ttg ctg ctg ctg ctg
ctt ttt tgg ctt cca ggc tgt 222Leu Pro Thr Leu Leu Leu Leu Leu Leu
Leu Phe Trp Leu Pro Gly Cys10 15 20 25gtc cct ctg cat ggt ccc agc
acc atg aca gga agt gtg ggt caa tcc 270Val Pro Leu His Gly Pro Ser
Thr Met Thr Gly Ser Val Gly Gln Ser 30 35 40ctg agt gtg tcg tgt cag
tat gag gag aaa ttt aag act aag gac aaa 318Leu Ser Val Ser Cys Gln
Tyr Glu Glu Lys Phe Lys Thr Lys Asp Lys 45 50 55tac tgg tgc aga ggg
tca ctt aag gta ctg tgc aaa gat att gtc aag 366Tyr Trp Cys Arg Gly
Ser Leu Lys Val Leu Cys Lys Asp Ile Val Lys 60 65 70acc agc agc tca
gaa gaa gct agg agt ggc aga gtg acc atc agg gac 414Thr Ser Ser Ser
Glu Glu Ala Arg Ser Gly Arg Val Thr Ile Arg Asp 75 80 85cat cca gac
aac ctc acc ttc aca gtg acc tat gag agc ctc acc ctg 462His Pro Asp
Asn Leu Thr Phe Thr Val Thr Tyr Glu Ser Leu Thr Leu90 95 100 105gat
gat gca gac acc tac atg tgt gcg gtg gat ata cca ttt ttc aat 510Asp
Asp Ala Asp Thr Tyr Met Cys Ala Val Asp Ile Pro Phe Phe Asn 110 115
120gcc ccc ttg ggg ctc gat aag tac ttc aag att gaa ttg tct gtg gtt
558Ala Pro Leu Gly Leu Asp Lys Tyr Phe Lys Ile Glu Leu Ser Val Val
125 130 135cca agt gag gac cca gtt tca tct cca gga cca aca cta gag
aca cct 606Pro Ser Glu Asp Pro Val Ser Ser Pro Gly Pro Thr Leu Glu
Thr Pro 140 145 150gtg gtg tcc acc agt ctg cct acc aag ggt ccc gcc
cta gga tcc aac 654Val Val Ser Thr Ser Leu Pro Thr Lys Gly Pro Ala
Leu Gly Ser Asn 155 160 165aca gag gac cgc cgt gag cat gac tat tcc
cag ggc ttg agg ctc cca 702Thr Glu Asp Arg Arg Glu His Asp Tyr Ser
Gln Gly Leu Arg Leu Pro170 175 180 185gcg ctg ttg tct gtg tta gct
ctc ctg ctg ttt ctg ttg gtg ggg aca 750Ala Leu Leu Ser Val Leu Ala
Leu Leu Leu Phe Leu Leu Val Gly Thr 190 195 200tct ctg ctg gcc tgg
agg atg ttc cag aag cgg ctg gtc aaa gct gat 798Ser Leu Leu Ala Trp
Arg Met Phe Gln Lys Arg Leu Val Lys Ala Asp 205 210 215agg cat cca
gag ctg tcc cag aac ctc aga cag gct tct gag cag aat 846Arg His Pro
Glu Leu Ser Gln Asn Leu Arg Gln Ala Ser Glu Gln Asn 220 225 230gag
tgc cag tat gtg aat ttg cag ctg cac acg tgg tct ctg agg gaa 894Glu
Cys Gln Tyr Val Asn Leu Gln Leu His Thr Trp Ser Leu Arg Glu 235 240
245gag ccg gtg cta cca agt cag gta gaa gtg gtg gaa tat agc aca ttg
942Glu Pro Val Leu Pro Ser Gln Val Glu Val Val Glu Tyr Ser Thr
Leu250 255 260 265gca tta ccc cag gaa gag ctt cac tat tca tcc gtg
gca ttc aac tcc 990Ala Leu Pro Gln Glu Glu Leu His Tyr Ser Ser Val
Ala Phe Asn Ser 270 275 280cag agg cag gat tct cac gcc aat gga gat
tct ctt cat caa cct cag 1038Gln Arg Gln Asp Ser His Ala Asn Gly Asp
Ser Leu His Gln Pro Gln 285 290 295gac cag aaa gca gag tac agt gag
atc cag aag ccc aga aaa gga ctc 1086Asp Gln Lys Ala Glu Tyr Ser Glu
Ile Gln Lys Pro Arg Lys Gly Leu 300 305 310tct gac ctt tac ctg tga
ctccttgtca cctgatcctc tcagtggtga 1134Ser Asp Leu Tyr Leu
315ctaccaggtt ccaaggctcc ctgctggctg ctgccctcaa tgtcatgagc
ctcagtggct 1194tcactaaaga tgagcaggag ccagggctct gtgggcacag
tctcatccca ctggctctct 1254cctcttagcc tgtattttgt tctgcctctg
ggtgtggaag acatcgatgc tgctcttttg 1314gggctctggg aattgacatg
gttcgtatag aacggtactt gtgttagtta gctttgtagt 1374gtcagtccag
gaagaacatc tgtggtcact gggaaagtgg gggacccatg agactacaaa
1434ggaaggggag tcatggaggt actaaacacc aactccttca tctcacagag
aaaaaaacct 1494aagctctgag gacaaaagcc tggcccgtgg caccaaggtc
aggggcaaat tcctctggac 1554tcatttttat ttttattttt tgttttttga
gacagggtct ctctgtgtag ctttggctgt 1614cctggaactc actctgtaaa
ccagaatggc ctcagactca caaagatctg cctgcctctg 1674cctccaaagg
tgtgtgccac aatgcctggc ttctctgaat tcttaagtaa aagatgaaat
1734aaagtttata atatcttt 17522318PRTMus musculus 2Met Thr Gln Leu
Ala Ser Ala Val Trp Leu Pro Thr Leu Leu Leu Leu1 5 10 15Leu Leu Leu
Phe Trp Leu Pro Gly Cys Val Pro Leu His Gly Pro Ser 20 25 30Thr Met
Thr Gly Ser Val Gly Gln Ser Leu Ser Val Ser Cys Gln Tyr 35 40 45Glu
Glu Lys Phe Lys Thr Lys Asp Lys Tyr Trp Cys Arg Gly Ser Leu 50 55
60Lys Val Leu Cys Lys Asp Ile Val Lys Thr Ser Ser Ser Glu Glu Ala65
70 75 80Arg Ser Gly Arg Val Thr Ile Arg Asp His Pro Asp Asn Leu Thr
Phe 85 90 95Thr Val Thr Tyr Glu Ser Leu Thr Leu Asp Asp Ala Asp Thr
Tyr Met 100 105 110Cys Ala Val Asp Ile Pro Phe Phe Asn Ala Pro Leu
Gly Leu Asp Lys 115 120 125Tyr Phe Lys Ile Glu Leu Ser Val Val Pro
Ser Glu Asp Pro Val Ser 130 135 140Ser Pro Gly Pro Thr Leu Glu Thr
Pro Val Val Ser Thr Ser Leu Pro145 150 155 160Thr Lys Gly Pro Ala
Leu Gly Ser Asn Thr Glu Asp Arg Arg Glu His 165 170 175Asp Tyr Ser
Gln Gly Leu Arg Leu Pro Ala Leu Leu Ser Val Leu Ala 180 185 190Leu
Leu Leu Phe Leu Leu Val Gly Thr Ser Leu Leu Ala Trp Arg Met 195 200
205Phe Gln Lys Arg Leu Val Lys Ala Asp Arg His Pro Glu Leu Ser Gln
210 215 220Asn Leu Arg Gln Ala Ser Glu Gln Asn Glu Cys Gln Tyr Val
Asn Leu225 230 235 240Gln Leu His Thr Trp Ser Leu Arg Glu Glu Pro
Val Leu Pro Ser Gln 245 250 255Val Glu Val Val Glu Tyr Ser Thr Leu
Ala Leu Pro Gln Glu Glu Leu 260 265 270His Tyr Ser Ser Val Ala Phe
Asn Ser Gln Arg Gln Asp Ser His Ala 275 280 285Asn Gly Asp Ser Leu
His Gln Pro Gln Asp Gln Lys Ala Glu Tyr Ser 290 295 300Glu Ile Gln
Lys Pro Arg Lys Gly Leu Ser Asp Leu Tyr Leu305 310 3153687DNAMus
musculusCDS(1)..(687) 3atg att ccc aga gta ata aga ttg tgg ctg cct
tca gct ctg ttc ctc 48Met Ile Pro Arg Val Ile Arg Leu Trp Leu Pro
Ser Ala Leu Phe Leu1 5 10 15tct cag gtc cca ggc tgt gtc cca ctg cat
ggc ccc agc act atc aca 96Ser Gln Val Pro Gly Cys Val Pro Leu His
Gly Pro Ser Thr Ile Thr 20 25 30ggc gct gtt ggg gaa tcg ctc agt gtg
tca tgt caa tac gag gag aaa 144Gly Ala Val Gly Glu Ser Leu Ser Val
Ser Cys Gln Tyr Glu Glu Lys 35 40 45ttc aag act aag gac aaa ttc tgg
tgc aga ggg tca ctg aag gta ctc 192Phe Lys Thr Lys Asp Lys Phe Trp
Cys Arg Gly Ser Leu Lys Val Leu 50 55 60tgt aaa gat att gtc aag acc
agc agc tca gaa gaa gtt agg aat ggc 240Cys Lys Asp Ile Val Lys Thr
Ser Ser Ser Glu Glu Val Arg Asn Gly65 70 75 80cga gtg acc atc agg
gac cat cca gac aac ctc acc ttc aca gtg acc 288Arg Val Thr Ile Arg
Asp His Pro Asp Asn Leu Thr Phe Thr Val Thr 85 90 95tat gag agc ctc
acc ctg gag gat gca gac acc tac atg tgt gcg gtg 336Tyr Glu Ser Leu
Thr Leu Glu Asp Ala Asp Thr Tyr Met Cys Ala Val 100 105 110gat ata
tca ctt ttt gat ggc tcc ttg ggg ttc gat aag tac ttc aag 384Asp Ile
Ser Leu Phe Asp Gly Ser Leu Gly Phe Asp Lys Tyr Phe Lys 115 120
125att gag ttg tct gtg gtt cca agt gag gac cca gtc aca ggt tcg agc
432Ile Glu Leu Ser Val Val Pro Ser Glu Asp Pro Val Thr Gly Ser Ser
130 135 140ctt gag agt ggt aga gat atc ctg gaa tcc ccc aca tcc tca
gtt ggg 480Leu Glu Ser Gly Arg Asp Ile Leu Glu Ser Pro Thr Ser Ser
Val Gly145 150 155 160cac act cat ccc agt gtg acc aca gat gac aca
att cct gct ccc tgc 528His Thr His Pro Ser Val Thr Thr Asp Asp Thr
Ile Pro Ala Pro Cys 165 170 175cct cag cct cgg tct ctt cgg agc agc
ctc tac ttc tgg gtc ctg gtg 576Pro Gln Pro Arg Ser Leu Arg Ser Ser
Leu Tyr Phe Trp Val Leu Val 180 185 190tct ctg aag ttg ttc ctg ttc
ctg agc atg ctt ggt gct gtc ctc tgg 624Ser Leu Lys Leu Phe Leu Phe
Leu Ser Met Leu Gly Ala Val Leu Trp 195 200 205gtg aac agg cct cag
agg tgc tct ggg gga agc agc act cag ccc tgt 672Val Asn Arg Pro Gln
Arg Cys Ser Gly Gly Ser Ser Thr Gln Pro Cys 210 215 220tat gag aac
cag tga 687Tyr Glu Asn Gln2254228PRTMus musculus 4Met Ile Pro Arg
Val Ile Arg Leu Trp Leu Pro Ser Ala Leu Phe Leu1 5 10 15Ser Gln Val
Pro Gly Cys Val Pro Leu His Gly Pro Ser Thr Ile Thr 20 25 30Gly Ala
Val Gly Glu Ser Leu Ser Val Ser Cys Gln Tyr Glu Glu Lys 35 40 45Phe
Lys Thr Lys Asp Lys Phe Trp Cys Arg Gly Ser Leu Lys Val Leu 50 55
60Cys Lys Asp Ile Val Lys Thr Ser Ser Ser Glu Glu Val Arg Asn Gly65
70 75 80Arg Val Thr Ile Arg Asp His Pro Asp Asn Leu Thr Phe Thr Val
Thr 85 90 95Tyr Glu Ser Leu Thr Leu Glu Asp Ala Asp Thr Tyr Met Cys
Ala Val 100 105 110Asp Ile Ser Leu Phe Asp Gly Ser Leu Gly Phe Asp
Lys Tyr Phe Lys 115 120 125Ile Glu Leu Ser Val Val Pro Ser Glu Asp
Pro Val Thr Gly Ser Ser 130 135 140Leu Glu Ser Gly Arg Asp Ile Leu
Glu Ser Pro Thr Ser Ser Val Gly145 150 155 160His Thr His Pro Ser
Val Thr Thr Asp Asp Thr Ile Pro Ala Pro Cys 165 170 175Pro Gln Pro
Arg Ser Leu Arg Ser Ser Leu Tyr Phe Trp Val Leu Val 180 185 190Ser
Leu Lys Leu Phe Leu Phe Leu Ser Met Leu Gly Ala Val Leu Trp 195 200
205Val Asn Arg Pro Gln Arg Cys Ser Gly Gly Ser Ser Thr Gln Pro Cys
210 215 220Tyr Glu Asn Gln225519DNAArtificialArtificially
Synthesized Primer Sequence 5gggggtggac catcctcta
19620DNAArtificialArtificially Synthesized Primer Sequence
6cgcgcagctg taaacggtag 20
* * * * *