U.S. patent application number 12/334036 was filed with the patent office on 2009-11-05 for systems and methods to quantify and amplify both signaling and probes for cdna chips and gene expression microarrays.
This patent application is currently assigned to GENETAG TECHNOLOGY, INC.. Invention is credited to David A. Shafer.
Application Number | 20090275029 12/334036 |
Document ID | / |
Family ID | 46299068 |
Filed Date | 2009-11-05 |
United States Patent
Application |
20090275029 |
Kind Code |
A1 |
Shafer; David A. |
November 5, 2009 |
Systems and Methods to Quantify and Amplify Both Signaling and
Probes for CDNA Chips and Gene Expression Microarrays
Abstract
The invention provides a series of reagent compositions and
methods for making and amplifying novel cDNA based probe sets from
RNA samples to improve analysis with gene expression arrays. The
methods globally produce probe sets with common universal linkers
at one or both ends, called WRAP-Probes, wherein the linkers do not
bind to the target sequences and they can efficiently bind added
reporters to the probes. The universal linkers are also designed as
primer binding sites for copying and amplifying the probes, either
linearly with one linker, or exponentially with double linkers. The
capacity to globally and exponentially amplify the probe set by PCR
is a primary advantage. Adding reporters by terminal linkers also
improves quantification since each probe gets equivalent signaling.
The invention allows expression analysis of small research,
clinical and forensic samples to enable improved diagnostics, drug
discovery, therapeutic monitoring, and medical, agricultural and
general research.
Inventors: |
Shafer; David A.; (Atlanta,
GA) |
Correspondence
Address: |
FISH & RICHARDSON P.C.
P.O BOX 1022
Minneapolis
MN
55440-1022
US
|
Assignee: |
GENETAG TECHNOLOGY, INC.
Atlanta
GA
|
Family ID: |
46299068 |
Appl. No.: |
12/334036 |
Filed: |
December 12, 2008 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10380596 |
Mar 17, 2003 |
7482443 |
|
|
PCT/US01/07508 |
Mar 9, 2001 |
|
|
|
12334036 |
|
|
|
|
09744097 |
Jan 16, 2001 |
|
|
|
PCT/US99/16242 |
Jul 16, 1999 |
|
|
|
10380596 |
|
|
|
|
60187982 |
Mar 9, 2000 |
|
|
|
Current U.S.
Class: |
435/6.14 ;
536/24.3; 536/24.33 |
Current CPC
Class: |
C07H 21/04 20130101;
C12Q 1/68 20130101; C12Q 1/68 20130101; C12Q 2525/155 20130101;
C12Q 2525/161 20130101; C12Q 2521/107 20130101 |
Class at
Publication: |
435/6 ; 536/24.3;
536/24.33 |
International
Class: |
C12Q 1/68 20060101
C12Q001/68; C07H 21/04 20060101 C07H021/04 |
Claims
1.-49. (canceled)
50. A method of gene expression analysis, the method comprising:
(a) providing mRNA transcripts from a sample; (b) making cDNA
probes from the mRNA transcripts, wherein the cDNA probes comprise
a universal linker; (c) hybridizing the cDNA probes to an array;
(d) providing labeled reporter molecules, wherein the reporter
molecules bind to the universal linkers of the probes; and (e)
detecting the labeled reporter molecules to determine gene
expression in the sample.
51. The method of claim 50, wherein the cDNA probe comprises one
universal linker.
52. The method of claim 51, wherein the step of making the cDNA
probes comprise using a modified poly-T primer comprising a
universal linker at the 5'-end of the primer.
53. The method of claim 52, wherein the modified poly-T-primer
comprises a poly-thymidine sequence at a 3'-end of the primer, a
universal linker at the 5'-end of the primer, wherein the
poly-thymidine sequence comprises about 12 to about 20 thymidine
bases.
54. The method of claim 53, wherein the modified poly-T primer
further comprises an anchor sequence at the 3'-end of the
primer.
55. The method of claim 54, wherein the anchor sequence comprises
the sequence 5'-poly-T, V, N-3', wherein V is a variable base
selected from the group consisting of adenine, guanine, or
cytosine, and wherein N is randomly any base selected from the
group consisting of adenine, guanine, cytosine, or thymidine.
56. The method of claim 53, wherein the modified poly-T primer
comprises a capture moiety.
57. The method of claim 56, wherein the capture moiety is
biotin.
58. The method of claim 50, wherein the universal linker comprises
the sequence of SEQ ID NO:1, 2, 3, or 4.
59. The method of claim 50, wherein the cDNA probes comprise two
universal linkers.
60. The method of claim 59, wherein the step of making the cDNA
probes comprise using a modified poly-T primer comprising a
universal linker at the 5'-end of the primer.
61. The method of claim 60, wherein the modified poly-T-primer
comprises a poly-thymidine sequence at a 3'-end of the primer, a
universal linker at the 5'-end of the primer, wherein the
poly-thymidine sequence comprises about 12 to about 20 thymidine
bases.
62. The method of claim 61, wherein the modified poly-T primer
further comprises an anchor sequence at the 3'-end of the
primer.
63. The method of claim 62, wherein the anchor sequence comprises
the sequence 5'-poly-T, V, N-3', wherein V is a variable base
selected from the group consisting of adenine, guanine, or
cytosine, and wherein N is randomly any base selected from the
group consisting of adenine, guanine, cytosine, or thymidine.
64. The method of claim 61, wherein the modified poly-T primer
comprises a capture moiety.
65. The method of claim 64, wherein the capture moiety is
biotin.
66. The method of claim 59, wherein the two universal linker
sequences comprise the sequence of SEQ ID NO:1, 2, 3, or 4.
67. The method of claim 66, wherein the two universal linker
sequences comprise the same sequence or different sequences.
68. A probe set comprising a pool of cDNA probes, wherein each
probe comprises a universal linker sequence at one or both ends of
the probe, and wherein the universal linker sequence comprises the
sequence of SEQ ID NO:1, 2, 3, or 4.
69. A modified poly-T primer composition comprising a
poly-thymidine sequence at the 3'-end of the primer and a universal
linker at the 5'-end of the primer, wherein the universal linker
comprises the sequence of SEQ ID NO:1, 2, 3, or 4.
70. The modified poly T-primer of claim 69, wherein the
poly-thymidine sequence comprises about 12 to about 20 thymidine
bases.
71. The modified poly T-primer of claim 70, further comprising an
anchor sequence at the 3'-end of the primer.
72. The modified poly T-primer of claim 71, wherein the anchor
sequence comprises the sequence 5'-poly-T, V, N-3', wherein V is a
variable base selected from the group consisting of adenine,
guanine, or cytosine, and wherein N is randomly any base selected
from the group consisting of adenine, guanine, cytosine, or
thymidine.
73. The modified poly T-primer of claim 70, further comprising a
capture moiety.
74. The modified poly T-primer of claim 73, wherein the capture
moiety is biotin.
75. An adapter composition for providing a second universal linker
to a cDNA probe set, the composition comprising a first and second
polynucleotide sequence, wherein the first polynucleotide sequence
is a universal linker sequence comprising the sequence of SEQ ID
NO:1, 2, 3, or 4 and the second polynucleotide sequence is
complimentary to the first polynucleotide sequence, and wherein the
first or second polynucleotide sequence comprises an additional
single-strand overhang.
76. The adapter composition of claim 75, wherein the single-strand
overhang comprises about 1 to about 6 nucleotides, and wherein the
single-strand overhang is complimentary to a specific restriction
enzyme cut site.
77. The adapter composition of claim 75, wherein the single-strand
overhang comprises about 1 to about 6 nucleotides, and wherein the
nucleotides are randomly and alternatively selected from the group
consisting of an adenine (A), a thymidine (T), a cytosine (C), and
a guanine (G).
78. The adapter composition of claim 75, wherein single-strand
overhang comprises a poly-cytosine (poly-C) or a poly-guanine
(poly-G) sequence.
79. An extender composition for providing a second universal linker
to a cDNA probe set, the composition comprising a single-stranded
polynucleotide sequence comprising a universal linker sequence at
the 5'-end, wherein the universal linker sequence comprises the
sequence of SEQ ID NO:1, 2, 3, or 4.
80. The extender composition of claim 79, wherein the
polynucleotide sequence comprises a random sequence at the 3'-end,
wherein the random sequence comprises about 4 to about 10
nucleotides.
81. The extender composition of claim 80, wherein the 3'-end
comprises a block to prevent polymerase extension.
82. The extender composition of claim 79, wherein the
polynucleotide sequence comprises a poly-C or a poly-G sequence,
wherein the poly-C or poly-G sequences comprise about 5 to about 15
nucleotides.
Description
CROSS-REFERENCE TO RELATED PATENT APPLICATION
[0001] This application claims the benefit, pursuant to 35 U.S.C.
.sctn.119(e), of applicant's provisional U.S. Patent Application
Ser. No. 60/187,982, filed Mar. 9, 2000, entitled "Methods to
Quantify and Amplify Both Signaling and Probes for DNA Chips and
Gene Expression Microarrays", which is hereby incorporate by
reference herein for all purposes. This application further is a
continuation-in-part of, and claims the benefit, pursuant to 35
U.S.C. .sctn.120, of, applicant's U.S. patent application Ser. No.
09/744,097 filed Jan. 16, 2001 entitled "Methods for Detecting and
Mapping Genes, Mutations and Variant Polynucleotide Sequences,"
which is hereby incorporated by reference herein for all purposes
and which is a National Stage Application of International Patent
Application Serial No. PCT/US99/16242 filed Jul. 16, 1999.
BACKGROUND OF INVENTION
[0002] 1. Field of Invention
[0003] The present invention relates generally to the field of
detecting genes and gene expression from biological and medical
samples and more particularly it relates to improving both
sensitivity and quantification in comparative multi-analyte
detection formats such as cDNA chips and expression
microarrays.
[0004] 2. Description of Related Art
[0005] Genetic analysis of an organism or tissue involves two major
fields of study, the determination of existing genes and mutations
as reflected in genomic DNA sequences and the evaluation of
functional gene activity as reflected in the expression of
messenger RNA (mRNA) transcripts or resulting protein byproducts.
Since there are no reasonable means to separately detect all or
most protein products simultaneously, global comparisons of gene
expression have generally focused on mRNA analysis because such
transcripts can be isolated and detected more simply--either by
virtue of their specific sequences and or by virtue of the common
presence of a poly-A tail on their 3' end. These poly-A tails allow
the entire pool of mRNAs to be simultaneously copied with a single
poly-T primer and the enzyme reverse transcriptase (RT) to make a
single antisense strand of cDNA from each mRNA transcript in a
sample. Consequently, most methods for gene expression analysis
have primarily been based on assessing the relative number of RNA
transcripts being produced by different genes and on comparing the
timing of such gene activity. The most important goal of these
methods is therefore to determine the comparative frequency of each
transcript in different cells and tissues, as well as detecting any
expression changes that occur in response to various stimuli,
physiological conditions and pathologic states. Furthermore, such
quantitative methods should have broad utility for genetics
research in general and for a variety of biomedical applications
including tissue typing and forensic analysis, the diagnosis and
prognosis of various pathologies, conditions, and responses to
therapy, and the identification of new or refined targets for
pharmaceutical therapy or gene therapy.
[0006] Current art has provided few methods to globally explore
gene expression differences between cells and tissues and most
studies have employed differential display or cDNA subtraction
analysis which provide partial non-quantitative information
[Hedrick et al., Nature 308: 149 (1984); Liang et. al., Science
257: 967, (1992)]. Similarly, expression analysis by Northern
blotting, RNase protection assays, or reverse transcriptase
polymerase chain reaction (RT-PCR) are generally only useful for
evaluating a very limited number of genes per analysis [Alwine, et
al., Proc. Natl. Acad. Sci., 74: 5350, (1977); Zinn, et al., Cell,
34: 865 (1983); Veres, et al., Science, 237: 415 (1987)]. Several
methods have been devised to extract cDNA copies of the 3' ends of
mRNA transcripts and then characterize those fragments by
restriction digests [Ivanova et. al., Nucleic Acids Res. 23: 2954
(1995); Prashar et. al., Proc. Natl. Acad. Sci., 93: 659 (1996);
Kato, Nucleic Acids Res. 23: 3685 (1995); Kato, U.S. Pat. No.
5,707,807 (1998); Weissman et al., U.S. Pat. No. 5,712,126 (1998)].
While these methods expand the number of expression products that
can be studied, they also remain limited in scope. Taking a
different approach, Kinzler, et al. [U.S. Pat. No. 5,695,937
(1998)] have devised a more comprehensive method for measuring
messenger RNA (mRNA) transcripts quantitatively by extracting and
slicing out a tiny segment of the cDNAs copied from the 3'end of
each mRNA transcript and then creating composite concatemers of
those segments from different transcripts. The representative 9 or
10 base segments are then counted by sequencing analysis to
determine the frequency of the original transcripts. However, this
method involves considerable complexity and the sequencing steps
are very time consuming and expensive.
[0007] The development of cDNA based gene expression microarrays
provides a ready means to simultaneously assess the relative
expression of hundreds or thousands of different genes from tissue
or cellular samples. [Schena et al., Science, 270: 467-470 (1995);
Schena, et al., Proc. Natl. Acad. Sci., 93:10614-9 (1996); Shalon
et al., Genome Res., 6: 639-45 (1996); DeRisi et al., Nature
Genetics, 14: 457-60, (1996); Heller et al., Proc. Natl. Acad.
Sci., 94: 2150-5, (1997); Khan et al., Cancer Res., 58: 5009-13
(1998); Khan et al., Electrophoresis, 20: 223-9 (1999)] These
analyses are accomplished by first preparing miniature grids or
arrays on membranes or coated glass substrates wherein small but
dense cDNA samples of individual genes are robotically spotted in a
two dimensional pattern. Then, a total RNA or mRNA sample is copied
and labeled using reverse transcriptase and a poly-T primer to
create a pool of cDNA probes that reflect the mRNA expression
transcripts. These labeled probes are then hybridized to their
respective gene spots in the microarray in order to detect and
determine the relative frequency of each transcript in the original
sample. These gene expression arrays, which are commonly called
expression microarrays, DNA chips, cDNA chips, or biochips, were
first manufactured from gene specific synthetic oligonucleotides
that likewise are created or distributed on the array in a two
dimensional pattern and that can capture and detect labeled
expression products in a somewhat similar manner if they are
fragmented into smaller pieces [Fodor et al., U.S. Pat. No.
5,445,934 (1995); Fodor et al., U.S. Pat. No. 5,800,992 (1998)].
These commercial oligo-based DNA chips are called GENECHIPS. It
should be noted that microarrays generally refer to miniature
arrays on coated glass substrates, however, larger scale arrays on
membrane formats employ similar chemistries and target
configurations and thus are suitable for and similarly improved by
the application of the present invention.
[0008] While the development of expression microarrays allows a
greatly expanded overview and assessment of the relative frequency
of different gene transcripts in a sample, current methods are
limited by significant deficiencies in both quantification and
sensitivity [Duggan et al., Nature Genetics, 21: 10-14 (1999);
DiRisi et al., Nature Genetics, 14: 457-460 (1996); Rajeevan et
al., Jour. Histochem. Cytochem., 47: 337-42 (1999)]. Firstly,
quantification is falsely biased since labeling is proportional to
probe length, and thus, short genes give less signaling per probe
than long genes. Secondly, even long genes provide limited
signaling with cDNA chips when compared to the signaling provided
by the far longer segments that are typically used for mapping
genes to chromosomes or nuclei. In addition, labeling is also
limited for expression microarrays because fluorescent compounds,
such as Cy3 and Cy5, which are commonly employed for comparative
two color labeling, are poorly incorporated by reverse
transcriptase. Moreover, current methods are especially limited in
sensitivity when individual genes of interest have been
down-regulated or are weakly expressed or when the total sample
available for study is quite small. In either case, specific or
multiple gene transcripts of interest may produce an insufficient
number of labeled probes to be detected. Thus, current cDNA chip
methods are generally poor or inadequate for detecting specific
mRNA transcripts that are expressed in frequencies of less than 10
copies per cell or for analyzing samples comprised of: a) less than
0.5 milligrams of tissue, b) less than 50 micrograms of total RNA,
b) less than 0.5 micrograms of poly-A mRNA, or c) less than 5
million cells [Duggan et al., Nature Genetics, 21: 10-14 (1999)].
The conjunction of these deficiencies in both quantification and
sensitivity additionally creates further problems. Thus, short
genes may falsely appear inactive or weakly expressed relative to
longer genes in the same sample, and longer genes will falsely
appear to be expressed more abundantly relative to shorter genes.
Consequently, more accurate and sensitive detection methods are
needed.
[0009] One approach to improve chip detection would be to amplify
mRNA derived probes by the polymerase chain reaction (PCR) or
related enzymatic methods. However, commonly available PCR
procedures such as RT-PCR and multiplex PCR, have only been used
successfully to amplify a limited number of the gene products in a
sample since effective multi-analyte amplification typically
requires the provision of at least one unique primer for each type
of gene product amplified [Sutcliffe et al., U.S. Pat. No.
5,807,680 (1998)]. In related art such as differential display or
other older procedures to explore expression differences, global
amplification methods have been employed based upon using simple
arbitrary primers, hexamers or various random primer constructs
instead of unique primers to amplify DNA or RNA. The inconsistency
of such methods, however, have only made them useful for
identifying unusual or novel gene expression products, and they
have not been devised or employed for use with expression
microarrays or DNA chip analyses [Welsh et al., Nucleic Acids Res.,
18: 7213-18 (1990); Pardee et. al., U.S. Pat. No. 5,262,311 (1993)
and 5,665,547 (1997); Liang et al., Nucleic Acids Res., 21: 3269
(1993); Mou et al., Biochem. Biophys. Res. Comm., 199: 564-569
(1994); Villeponteau et al., U.S. Pat. No. 5,580,726, (1996);
Silver et. al., U.S. Pat. No. 5,104,792 (1992); Tavtigian et al.,
U.S. Pat. No. 5,789,206 (1998); Shuber, U.S. Pat. No. 5,882,856
(1999)]. The prime difficulty with many of these methods derives
from the use of short arbitrary or random primers that can give
variable results with different temperature and hybridization
conditions such that they are unsuitable for diagnostic analyses.
Even RT-PCR or multiplex PCR methods, which employ unique primers,
can produce semi-quantitative rather than quantitative results
since different primer sets vary considerably in efficiency and
since kinetic factors favor copying the smaller and more abundant
products with those methods. Therefore, some products may not
amplify well, and rare or down-regulated transcripts may be
under-represented [Khan et al., Electrophoresis, 20: 223-9 (1999)].
Additionally, mammalian mRNA samples include very large gene
transcripts 6 to 12 thousand nucleotides long that cannot be
amplified reliably by routine PCR methods. Consequently, global PCR
amplification of a pool of mRNA-derived cDNA probes has not been
attempted or successfully accomplished for DNA chip or expression
microarray analyses, and based on the above reasons, it has been
scientific dogma that exponential amplification methods cannot be
validly applied to multi-analyte gene expression arrays.
Nonetheless, less robust linear amplification has been developed
and employed for chip analyses by adding a RNA polymerase promoter
to the end of the poly-T primer used for RT. However, such
amplification is incremental and finite, with a typical duplication
of 20-60 copies, and the amplified products it produces are
antisense RNAs which are degradable [Phillips et. al., Methods, 10:
283-288 (1996); Kondo et al., U.S. Pat. No. 5,972,607; VanGelder et
al., U.S. Pat. No. 5,716,785 (1998)]. In related art, Wang et al.,
[U.S. Pat. No. 5,932,451 (1999)] refined such methods to allow
asymmetrical PCR amplification of ds cDNA made from an mRNA sample.
However, this amplification method is similarly limited in the
number of copies that can reasonably be made from the original
sample (68 fold duplication demonstrated). More importantly, by
copying full length probes, the signaling bias of current methods
cannot be overcome since the number of labels incorporated per
probe is a large variable dictated by the transcript size of
different genes, and in common mammalian species including humans,
transcripts vary from several hundred bases to twelve thousand
bases or more. These problems therefore suggested that improved
detection might be better achieved by amplifying signaling rather
than the target sample.
[0010] As described in PCT/US99/16242 (WIPO Publication WO
00-04192), corresponding to U.S. patent application Ser. No.
09/744,097 filed Jan. 16, 2001 entitled "Methods for Detecting and
Mapping Genes, Mutations and Variant Polynucleotide Sequences,"
which is hereby incorporated by reference herein for all purposes,
methods and compositions for modular probe and reporter systems
that improve the specific detection of genes and mutations and that
amplify signaling were disclosed. These disclosed compositions and
methods include: [0011] 1. Probe methods, known as WRAP-PROBEs,
that are manufactured from synthetic DNAs, from PCR (polymerase
chain reaction) products, or from cloning products, wherein the
probes have a central, target-specific sequence that is helically
wrapped around the target strand, and wherein they have one or more
generic linkers at one or both ends that bind one or more
reporters. By binding separate reporters to the ends of the probes
after coiling the probes around the target, the reporters are more
effectively tethered, and they thereby provide far more effective
signaling than is achieved with simple labeled probes. Indeed, this
method can provide multi-fold signal amplification if dual chains
or arrays of long labeled reporters are bound to a short WRAP-PROBE
of this configuration. This WRAP-PROBE composition also provides an
economic advantage in being able to use generic linkers to
interchangeably bind either different reporters to the same probe
or different probes to the same reporter, wherein a series of
generic reporters may be applied that vary in both the type of
signaling and in signaling intensity. [0012] 2. Generic reporter
methods and compositions such as GENE-TAGs and TINKER-TAGs, these
reporters include liner segments of double stranded DNA or chained
and joined polynucleotides with single stranded linkers at one or
both ends that can join together in arrays and can join to the
linkers of WRAP-PROBEs or related probes to provide amplified
signaling. [0013] 3. DNA-based connectors called Multi-LINKERs,
including singular or composite polynucleotide structures that join
to the linker of a probe and provide two or more secondary linkers
in order to bind multiple reporters to a probe.
[0014] The related WRAP-PROBE methods and compositions are suitable
for making targeted probes that amplify signaling and that more
efficiently map or detect a specific gene sequence in a variety of
detection formats such as in situ gene mapping, dot blots, etc. In
those formats, the target or targets are on the substrate and a
small number of labeled probes are individually manufactured in
excess quantity to find and label those specific targets. The
object is simply to put label on the target, thereby mapping or
counting the targets. However, those methods are not suited for DNA
chip or microarray gene expression formats where the chip substrate
is in fact a set of capture probes and where the probes applied to
the chip are the true targets of the assay. Thus the object of an
expression assay is to determine the relative frequency of the mRNA
transcripts in the original tissue sample, and the array is just a
device to capture and count a labeled probe set derived from the
sample. Thus this probe set must maintain its relative
frequencies--accurately representing the thousands of different
gene transcripts in the original tissue. Consequently, WRAP-PROBEs
for expression array analysis cannot be individually manufactured
in the same way as prior WRAP-PROBEs were separately tailored to
specific genes.
SUMMARY OF THE INVENTION
[0015] The present invention provides methods and compositions of
matter that allow quantitative, sensitive and rapid analysis of
gene expression patterns in different cells and tissues as a means
to detect functional changes associated with development and
physiology, to diagnose abnormal variations related to disease, and
to discover and assess pharmaceutical agents. The invention is
designed for and particularly suited to multiple analyte formats
such as cDNA chips and expression microarrays where the diagnostic
value would be improved by increased signaling and by determining
the true frequency of different mRNA transcripts in a sample and
not just their approximate frequency--a standard poorly addressed
by current methods. The invention is complementary to prior
inventions of the applicant which provide a probe construction,
known as WRAP probes, for detecting genes and nucleotide sequences,
which employ generic reporters such as GeneTAGs or TinkerTAGs that
are linked to terminal linkers of the probes, and which may employ
multi-linker components to join multiple reporters to each
probe.
[0016] The present invention employs novel primer, linker, adapter,
extender and reporter compositions and molecular processing methods
to globally transform a mixed pool of mRNAs into a pool of modified
cDNA-based probes, called WRAP-Probes, that have common universal
linkers at one or both ends for joining reporters, to thereby
provide more defined signaling as well as greater signaling
potential. The basic principle of these methods is to achieve
signaling by affixing generic reporters to the ends of the probe,
either directly or via terminal linkers, rather than by labeling
the target specific segment which varies in size for each gene.
This invention thus allows quantitative analysis of expression
since the signaling element is effectively equalized for each
transcript detected, and it improves sensitivity since reporters
can be affixed that have greater signaling potential than a labeled
probe. Alternate embodiments of the probes, the multi-linking
units, and the generic reporters have been devised and these
components can be used together in a modular manner to achieve
different detection and signaling objectives.
[0017] When the set of WRAP-Probes is constructed with common
universal linkers on both ends, this configuration creates an
opportunity to use these linker sequences as global primers,
thereby allowing the duplication of the entire pool of probes by
exponential amplification procedures such as PCR. Alternate
amplification methods were invented that produce either singular
WRAP-Probes from each mRNA transcript or a fragment series of
smaller WRAP-Probes from each transcript. These methods include
novel compositions and procedures to create truncated probes and to
affix double-linker/primer sites so that they can be reliably
amplified by exponential methods. The probes are then globally
amplified and labeled during PCR with a single primer set. These
amplified probes can also achieve signaling quite simply and
inexpensively with new compositions called ChipTAGs that are
composed of one or more labeled polynucleotides which additionally
serve both linker and primer functions. Thus effective methods were
devised that transform a mRNA pool into a set of smaller probe
subunits which are globally amplified and suitable for the analysis
of gene expression with cDNA chips or microarrays. These methods
and compositions improve the quantification of gene expression and
allow highly improved detection of rare transcripts and or very
small samples.
[0018] To overcome the difficulties of current compositions and
methods and to still obtain the signaling advantages of the
WRAP-PROBE invention, in the present invention, reagents and probe
systems that extend the WRAP-PROBE design to expression array
applications by globally converting a complex pool of mRNA
transcripts into a pool of probes having common universal linkers
on one or both ends have been developed. However, the present
invention differs compositionally from the prior invention because
the functional product of this invention is not a solitary
WRAP-PROBE, but in fact a composite set of WRAP-PROBEs that
necessarily contains multiple probes of considerable diversity with
important differences in relative frequency. While it would be
possible to make individual WRAP-PROBEs from single genes in a pool
of mRNA products in the same manner as RT-PCR is applied to
individually copy and amplify a single mRNA gene product and
determine its presence, such an approach would be costly,
inefficient and would introduce bias. (This approach would require
the manufacture of gene specific primers for each gene target
wherein the primers would additionally have a universal linker on
their 5' end.) Therefore, the present invention devises and
discovers a composite probe set of WRAP-PROBEs wherein the probe
set shares common universal linkers that enable the joining of
common reporters and that enable the global exponential
amplification of the probe set. Because of the high number of
diverse probes involved, it is important that the universal linkers
applied to the probes do not bind non-specifically to target
sequences on the chip. The present invention adds an important
second function, exponential amplification, to the universal
linkers of the WRAP-PROBE configuration, and it additionally
provides methods to globally create and amplify the probe set as a
collection of probes. To distinguish this probe set composition,
these new probes were intentionally called REX-WRAP probes in the
applicant's U.S. Provisional Patent Application Ser. No.
60/187,982, filed Mar. 9, 2000, entitled "Methods to Quantify and
Amplify Both Signaling and Probes for DNA Chips and Gene Expression
Microarrays", which is hereby incorporate by reference herein for
all purposes, to indicate their different source, form and function
as a collection or set of RNA-derived gene expression probes.
However, for linguistic fluidity in this present description, this
probe set devised for expression arrays will simply be termed
WRAP-Probes.
[0019] A basic principle of the present WRAP-Probes invention is to
achieve more sensitive and quantitative results with expression
arrays by adding equivalent reporter signaling to the terminal
linkers of the probe set. This approach contrasts with the current
practice of labeling the probes internally--a method causing
length-related bias in signaling. This end labeling approach
equalizes signaling per probe and provides a truer count of
transcript frequency, and it also allows far greater signaling per
probe by adding multiple reporters. Additionally, the dynamic range
of linear signaling is improved since the standard method can
saturate signaling early for those genes that are both long and
abundant. Moreover, other advantages can accrue from not labeling
the target specific segment with bulky signaling molecules that are
poorly incorporated, such as Cy3 and Cy5. And finally, it is known
that the target strands of cDNA spotted arrays lie side by side in
tight clusters making probe hybridization more difficult with large
signaling molecules attached to the bases [Duggan et al., Nature
Genetics, 21: 10-14 (1999]. Notwithstanding these considerations,
labeling can still be applied to the probes directly to provide
additional signaling.
[0020] Applicant has devised alternate embodiments of the
WRAP-probes method as well as alternate embodiments wherein probe
sets are combined with different reporters or intermediate linkers.
To this end, applicant has devised and discovered different
universal linkers that provide probe sets that will bind different
reporters, thereby enabling comparative analysis of different probe
sets from different samples on the same expression array.
[0021] The most elemental version of the WRAP-Probes method is to
create probes with a single universal linker on one end to enable
the binding of a generic reporter, such as a GeneTAG or TinkerTAG
reporter (previously described as GENE-TAGs and TINKER-TAGs in more
detail in International Patent Application Serial No.
PCT/US99/16242). Applicant has devised and discovered a preferred
embodiment of this method by copying the mRNA from the 3' poly-A
end by reverse transcriptase (RT) using a modified poly-T primer
with universal linker sequences added to the 5' end. The terminal
linker thus created provides a binding site to attach reporters
either before or after the probe is hybridized to the expression
array. The resulting probes are called One-Linker WRAP-Probes. A
variety of such modified poly-T primers are devised to allow a
multiplicity of reporter attachments.
[0022] Applicant has devised alternate methods that produce a probe
set with two linkers, known as Double-Linker WRAP-Probes. These
methods similarly create single-stranded or double-stranded cDNA
probe components with a modified poly-T primer having a 5'
universal linker, and then a second linker is added to the opposite
end so that reporters can bind to two linkers--pulling on the
helically bound probe from both ends as with a prior WRAP-PROBE.
This double-linker configuration provides a structural advantage
for tethering longer or multiple reporters, and it additionally
enables the amplification of the probe set. Applicant has devised
and discovered several methods and compositions for creating such
Double-Linker WRAP-Probes based on joining novel adapter
compositions to the 3' end or based on applying novel extender
compositions to extend the 3' end and form a second universal
linker.
[0023] Several types of adapters and extenders have been devised
and discovered. Adapters consist of paired polynucleotides joined
together but with a single stranded overhang, wherein the overhang
provides a binding site to join the adapter to a DNA segment with a
complementary cohesive end, and wherein the paired segment provides
appended sequences that serve a recognition, joining or primer
function. The adapters of the present invention have universal
linker sequences in the paired segment, and they differ in the
overhang. One type of adapter of the present invention, called a
Specific Adapter, has a small overhang specific to a restriction
cut site. Another type, called a Random Adapter, has an overhang of
a few random bases. A third type, called a Homopolymeric Adapter,
has an overhang of poly-C or poly-G sequences. These adapters are
designed to join and ligate onto the 3' end of a cut or modified
probe segment to form a second universal linker. The extenders of
the present invention consist of a polynucleotide with universal
linker sequences on their 5' end and a 3' end with either random or
homopolymeric sequences. The homopolymeric extender of the present
invention has 3' poly-C or poly-G sequences and is joined to a 3'
probe end of complementary poly-G or poly-C sequences formed with
terminal transferase, whereupon the 3' end of the probe may be
further extended with the universal linker sequences using the
extender product as a template. Alternatively, the present
invention provides a novel extender with a random 3' end that is
used in a similar manner except that it can join anywhere along the
probe. It only functions as an extender in the present invention
when it joins to the 3' end of the probe via the random sequences,
whereupon the universal linker sequence provides a template for
polymerizing a 3' extension of the probe to provide a second linker
end. In the present invention this special extender, called a
Random End-Linker, is employed with a novel procedure of the
invention, called Back-Tagging, whereupon repeated thermal cycling
steps similar to PCR are employed to make many attempts at putting
the Random End-Linker at the far 3' end of the probe to extend it,
wherein the Random End-Linker is preferentially modified at the 3'
end to block forward polymerization on the probe template.
Consequently, the Random End-Linker preferentially back-extends the
3' end of the probe to form a second universal linker and it avoids
making partial copies of the probe itself by forward
polymerization.
[0024] The above adapter and extender compositions and related
procedures of the present invention enable the simultaneous global
application of a second universal linker to the 3' ends of the
probe set to form Double-Linker WRAP-Probes. While such
Double-Linker probes can bind at least twice as many reporters as
One-Linker probes, either version gives equivalent signaling per
transcript within a sample, and thus true counting of gene
expression frequencies. Where true transcript counting may be
sacrificed for greater sensitivity, applicant has also devised
secondary embodiments of the Double-Linker WRAP-Probe methods
described above, wherein multiple short probes are created from
each mRNA transcript, either by fragmenting the RT products or
cutting them with restriction enzymes, and by employing various
adapters or extenders to construct a series of short WRAP-Probes
from them. Applicant has also devised alternate embodiments of
these probe variants wherein the linkers are pre-attached to
labeling agents, multi-linkers, or reporter constructs.
[0025] Applicant has also devised variations of these fragmented
probe procedures to apply to the original WRAP-PROBEs method for
detecting single genes or sequences in several in situ
hybridization formats such as RNA arrays, single tissue preps or
tissue arrays, [Kononen et al., Nature Medicine 4: 844-47 (1998)]
as well as for the mapping of particular gene sequences in genomic
DNAs, nuclei and chromosomes; e.g. FISH mapping (fluorescent in
situ hybridization). In such cases, cloned or PCR copies of
specific genomic DNA or mRNA targets are transformed into a subset
of mini-WRAP-Probes with linkers at one or both ends. Applicant has
devised several embodiments by cutting the full length probe
components into smaller segments with restriction enzymes,
shearing, RNase enzymes and the like and then universal GeneTAG
linkers are applied to one or both ends by modifications of the
above mentioned procedures for putting the second universal linker
on the 3' end of Double-linker WRAP-Probes. The hybridization of
these fragment probes to target tissues provides multiple adjacent
probes along a target, and thus highly amplified signaling since
each probe can bind one or more generic reporters (e.g. GeneTAGs)
with greater signaling capacity than a simple labeled probe.
[0026] Applicant has also devised WRAP-Probes that are created with
multiple linkers and or multiple reporters pre-attached to one or
both ends. These configurations are achieved by attaching generic
reporters such as GeneTAGs or TinkerTAGs to a Multi-Linker or by
attaching smaller signaling elements directly to the distal linkers
of a Multi-Linker unit.
[0027] Applicant has devised and discovered signaling compositions,
called ChipTAGs, which are short polynucleotides conjugated to one
or more labeling agents, that serve as a reporter joined to a
universal linker and that additionally serve a primer function.
Similar short reporter compositions called OligoTAGs, that only
served a linker and labeling function, were previously described in
International Patent Application Serial No. PCT/US99/16242 as
end-labeled oligonucleotides that were secondarily joined to a
Multi-LINKER unit. The advantages of using these ChipTAG components
as linkers, primers and reporters are improved cost and efficiency.
When bulky fluorescent compounds such as Cy3 or Cy5 are joined to
nucleotide reagents for enzymatic incorporation, they are extremely
expensive and they are poorly incorporated into probe or reporter
units (1-2% efficiency). In contrast, the same or similar labeling
agents can be chemically conjugated to an oligonucleotide or
polynucleotide more reliably (98-99% efficient) and both reagent
cost and manufacturing are relatively inexpensive.
[0028] Applicant has also devised two or more sets of GeneTAG,
TinkerTAG, ChipTAG and Multi-Linkers, with different linkers and
different labeling, so that two or more samples can be labeled
differently and simultaneously compared on an array to determine
relative differences in expression levels between samples.
[0029] Applicant has also devised modified poly-T primers to
generate WRAP-Probes that are pre-attached to one or more direct or
indirect signaling elements, that are pre-attached to
Multi-LINKERs, with or without signaling elements attached, and/or
that are pre-attached to labeled GeneTAGs, TinkerTAGs or other
generic reporters. The most elemental of these dual function
compositions are a modified poly-T primer with a label agent such
as Cy3 or Cy5 conjugated to the 5' end of the primer, with a
preferred embodiment having a universal linker sequence on the 5'
labeled end to add further reporters. The advantage of these
methods is that by joining probes and reporters beforehand, one or
more hybridization step can be eliminated.
[0030] Applicant has also devised WRAP-Probes that employ either
modified poly-T primers, Multi-LINKERs, GeneTAGs, TinkerTAGs or
ChipTAGs, that are not based on fluorescent or radioactive
labeling, but rather, they are labeled with refractory or light
scattering particles or with metallic or semiconductor based
signaling elements--alternatively allowing the detection of
microarrays or DNA chips with novel optical or photonic sensors or
with micro-electronic circuits or sensors.
[0031] The above-described Double-Linker WRAP-Probe methods also
allow a major methodological departure from the general principle
of creating labeled cDNA probes from each mRNA transcript. Namely,
when a universal linker sequence is created on both ends of each
probe, those sequences can be designed and used as generic primer
sites for globally copying and amplifying the entire pool of probes
with a single primer set or even with a single primer using common
PCR methods or related processes. Applicant has devised and
discovered methods to make such globally amplified WRAP-Probe probe
sets. These methods employ in part one of the above described
double-linker compositions and procedures (based on the ligation of
adapters or the annealing of extender templates) to apply a second
linker to the first strand cDNA copy which already has a first
linker created by the modified RT primer. However, these copying
methods are modified for global amplification since exponential PCR
of full length copies, particularly of the longer transcripts, may
produce bias and deficiencies in the amplification products as
described above. Therefore, two preferred WRAP-Probe amplification
procedures have been devised; 1) to make a single WRAP-Probe from a
shortened 3' end of each transcript, or 2) to cut and transform
full length or near full length cDNA copies into a set of multiple
short probes called Mini-WRAP-Probes. Either of these procedures
produce a pool of short probes all having generic linker/primer
sequences at each end so that they are suitable for exponential
amplification.
[0032] Therefore, the basic principle of the amplified WRAP-Probe
method is to construct or reconstruct RT generated cDNA probes as
short or shortened probes of similar length, with generic linkers
on both ends that provide universal primer binding sites
independent of gene specific sequences, so that the entire set of
mRNA derived probes can be globally amplified by PCR in a unbiased
manner. This invention provides several important advantages.
First, expression analyses can be conducted on very small RNA or
tissue samples. Second, quantitative signaling can be preserved
either by attaching generic reporters to the ends of the amplified
probes or by shortening the probes to approximately the same length
so that internal labeling becomes more equalized between genes.
Third, since all products are amplified with a single primer set,
all templates have essentially equalized access to primers, and
thus any bias towards amplification of the more abundant
transcripts is reduced or eliminated. Fourth, by amplifying the
probes, more limited or economic signaling methods can be employed
such as ChipTAGs since the number of labeled probes can be
exponentially increased. And finally, the amplified probe set
effectively increases the concentration of the sample thus allowing
larger chip formats--that is the same tissue or RNA sample can
produce sufficient probes to cover a larger chip hybridization area
enabling simpler, less miniaturized, and less expensive chip
manufacturing processes.
[0033] Applicant has devised and discovered three primary new
methods to globally achieve short double-linker probes from mRNA
that are suitable for PCR amplification: 1) restriction cutting and
adapter ligation, 2) globally truncated RT and probe extension with
a random end-linker, and 3) globally truncated RT and random
adapter binding. These methods are based upon and modified from the
Double-Linker WRAP-Probe methods described above.
[0034] For the first sub-method, applicant has devised and
discovered procedures to achieve short probes by cutting the
initial cDNA products with one or more restriction enzymes;
capturing the cut fragments from the poly-A end; and ligating a
matching adapter to the opposite end to provide the second
linker/primer sequence needed for PCR amplification. Since the cut
sites vary for different genes, enzyme selection is significant,
and thus it is preferred that two enzymes are employed in separate
samples to ensure that no gene lacks representation in the
probes.
[0035] For the other sub-methods, applicant has devised and
discovered procedures to globally achieve short probes of similar
length by dramatically truncating the RT protocol, from the typical
exposure time of one or two hours, down to brief exposures of a few
minutes or less. Standard RT protocols, including manufacture of
probes for DNA chips, are typically based on one or two hour RT
exposures to ensure that the full length of all transcripts is
copied since prior work had established that 95% of RT copying is
completed in about 50 minutes [Verma et al., Nature New Biology,
235: 163-169 (1972); Verma et al., Biochem. Biophys. Acta, 473:
1-38 (1977); Gubler et al., Gene, 25: 263 (1983)]. However, by
radically cutting the RT enzyme extension time down to a period of
minutes or seconds, applicant has discovered that the RT products
are truncated prematurely in relatively equivalent
lengths--producing a pool of cDNA probes that are randomly and
arbitrarily short--regardless of the gene length of the original
mRNA transcripts. This novel protocol, called Short-RT, in effect
equalizes the length of all probes to a narrow size range dictated
somewhat randomly by when each transcript starts the copying
process relative to the instant that RT enzyme exposure begins. The
resulting pool of randomly short products, that are mostly hundreds
of bases long vs. thousands of bases long, are easily amplified by
PCR. More importantly, the known bias that occurs in amplifying
different gene products of different length is effectively overcome
by this random length sampling method. This key modification,
Short-RT, provides a simple, economic method to remove an important
barrier to unbiased exponential amplification, gene length
variation, which has inhibited the prior development and use of
PCR-based protocols for DNA chip applications as well as other
global mRNA comparisons.
[0036] Therefore, for the second sub-method, globally truncated,
Short-RT products are prepared with a first universal linker, and
then the extender reagents described above as Random End-Linkers
are applied to create a second universal linker. While these
extenders can bind anywhere along a probe, a significant result
only occurs when they bind at the 3' end, wherein that 3' probe end
is back extended with a linker sequence that forms a primer binding
site. Therefore, the protocol called Back-Tagging described above
was devised and discovered to increase the opportunity for such an
end extension to occur. This novel protocol commonly employs rapid
thermal cycling for approximately 100 to 200 cycles that mimic the
steps of PCR (1. denaturing at high temperature, 2. annealing at
low temperature, and 3. briefly extending at moderate temperature)
but do not practice PCR since the 3' end of the Random End-Linker
is typically blocked. Whereupon, the extenders are repeatedly
hybridized to the probe to extend it with a universal linker,
thereby providing the second linker/primer site needed for
subsequent PCR amplification of the probes. Moreover, since the
probes are of randomly truncated length, they can also be
internally labeled, during or subsequent to PCR amplification,
instead of or in addition to end labeled, without reintroducing
signaling bias between different genes.
[0037] For the third sub-method, globally truncated, Short-RT
products are again prepared with a first universal linker, and the
second linker is then applied to the 3' end of the probes with the
novel Random Adapter described above which has a short random
overhang. The random segment provides a random binding mechanism to
anchor the adapter on the 3' end of any probe so that probe and
adapter components can be ligated together. After ligation, the
adapter-probe complex is denatured and purified to release the
unbound half of the adapter--thus providing probes containing
linker/primer sites on both ends suitable for PCR amplification.
For the same reasons as above, this sub-method also allows the
probes to be internally labeled, instead of or in addition to end
labeled, without reintroducing signaling bias between different
genes.
[0038] Elements of the above sub-methods can also be combined
together in different ways or combined with pre-existing
technologies to alternatively produce double-linker probes from
single or double stranded cDNA probes made with a 5' first linker.
For example, globally truncated, Short-RT products can be prepared
with a modified RT primer, converted to double stranded cDNA
probes, and joined to commercial adapter/linker products, e.g.
Clontech's Smart or Marathon adapter products, to create a 3'
second linker site on the probes. Alternatively, globally truncated
Short-RT products can be prepared with a first universal linker
using the Modified Poly-T primer, and then, a homopolymeric 3' tail
of poly-C or poly-G sequences is provided [Ivanova et. al., Nucleic
Acids Res. 23: 2954 (1995)]. Thereafter, an extender polynucleotide
with a 3' matching homopolymeric segment is applied to create a
second universal linker. Alternatively, an adapter could be made
with a 5' universal linker and a homopolymeric 3' end that would
allow this product to be ligated to the 3' end of the probe
creating a second universal linker. These alternate procedures
provide additional methods to affix the second linker/primer
sequence required for global PCR amplification of the probe
set.
[0039] Finally, the applicant has devised adapters and extenders
applicable to the above methods that provide second linkers on the
3' end that mirror the first linker sequences of the 5' end
whereupon the probes can be linked similarly via each end as well
as amplified by PCR with a single primer rather than a pair of
primers.
[0040] With these new methods, the primers used for global
amplification of the WRAP-Probe probe set or the Mini WRAP-Probe
probe set can employ simple ChipTAG compositions to generate probes
with pre-attached terminal labels. Due to exponential amplification
of the probes, such limited signaling can be quite sufficient.
Alternatively, the primers can be pre-attached to multi-linkers or
reporters such as GeneTAGs that provide greater signaling per
probe. Either approach will allow a single hybridization step to
apply both probes and reporters.
[0041] Current art has not been able to employ exponential
amplification methods for expression arrays because of one or more
of the following: 1) the need for multiple unique primers, 2) the
variability's and deficiencies of employing hexamers or random
primers as a substitute for unique primers, and 3) the great
variation in gene transcript size which can alter amplification
characteristics. The amplified WRAP-Probes and Mini-WRAP-Probes
devised and discovered here set a new precedent in signaling
potential for expression arrays. By creating one or multiple short
probes from each transcript and by using one universal primer set
for the entire pool of probes, the bias of global amplification is
avoided. Moreover, the creation of globally short probes provides
considerable advantages for application to DNA chips or microarrays
since short probes improve both the kinetics of hybridization and
access to small target opportunities on the chips. The WRAP-Probe
method produces one amplified probe product per transcript and thus
preserves the principle of generating equivalent signaling per
transcript as with non-amplified WRAP-Probes. The Mini-WRAP-Probe
method relaxes that principle for the sake of simplicity and
greater signaling, and yet it still does not depart further from
the signaling differences per transcript that are inherent in the
current art of labeling probes along their length. This
Mini-WRAP-Probe method is also well suited to expression arrays
based on specific oligonucleotides on the chip vs. spotted cDNA,
and in that case the multiple products from each transcript does
not bias signaling since each oligonucleotide segment on the chip
is known and accounted for separately. In any case, these new
methods provide the first global procedures to amplify mRNA derived
probes for gene expression arrays in an exponential manner.
Consequently, these methods are highly advantageous over current
art that requires large amounts of mRNA per each microarray assay.
In contrast, these exponential amplification methods allow the
analysis of very minute samples that may be available from micro
dissections, needle biopsies, small blood samples, forensic traces
or archived tissue as well as repeated analysis of the same sample.
These advantages are particularly relevant for clinical or forensic
specimens where only a single, small sample may be available.
Finally, these global probe amplification procedures will allow the
repeated testing of gene expression changes over time due to
development, disease, or induced responses to drugs or
therapies.
[0042] Additional advantages of the invention will be set forth in
part in the description which follows, and in part will be obvious
from the description, or may be learned by practice of the
invention. The advantages of the invention will be realized and
attained by means of the elements and combinations particularly
pointed out in the appended claims. It is to be understood that
both the foregoing general description and the following detailed
description are exemplary and explanatory only and are not
restrictive of the invention, as claimed.
BRIEF DESCRIPTION OF THE DRAWINGS
[0043] The accompanying drawings, which are incorporated in and
constitute a part of this specification, illustrate one embodiment
of the invention and together with the description, serve to
explain the principles of the invention.
[0044] FIG. 1: One Linker WRAP-Probe method. FIG. 1 depicts the
creation of cDNA probes with a universal linker from mRNA
transcripts and applying them to provide amplified and quantified
signaling. Step 1 depicts binding the modified poly-T primer with a
universal linker to the poly-A tail of mRNA and polymerizing first
strand cDNA probes with a universal linker; Step 2 depicts binding
the probes to a cDNA chip; Step 3 depicts binding labeled GeneTAG
reporters to the universal linkers of the probes.
[0045] FIG. 2: Amplified WRAP-Probe method. Sub method One:
Restriction cutting and adapter ligation. Step 1 depicts the
conversion of mRNA into double stranded cDNA with one universal
linker by copying the mRNA with RT and a modified poly-T primer,
and by polymerizing a second strand with DNA polymerase and RnaseH.
Step 2 depicts cutting the probes with a restriction enzyme and
capturing them with magnetic beads via the capture moiety, such as
biotin. Step 3 depicts ligating the Specific Adapter to the cut
ends of the probe to provide a second universal linker and to form
double-linker probes. Step 4 depicts PCR amplification of the
probes, wherein the probes are either labeled internally with
labeled bases or labeled on the end using labeled primers eg.
ChipTAGs. Additionally, GeneTAG or TinkerTAG reporters can be added
to the probes after they are bound to the cDNA chips.
[0046] FIG. 3: Amplified WRAP-Probe method. Sub method Two:
Applying Short RT and the Random End-Linker to make Double-Linker
cDNA probes. Step 1 depicts how the mRNA is converted to first
strand cDNA probes with one universal linker and it further depicts
the short RT procedure where different transcripts of different
lengths are stopped short at approximately the same length. Step 2
depicts binding of the random extender, called the Random
End-Linker, to the probes during multi-cycle thermal cycling where
the extender binds but does not prime if it binds anywhere along
the probes except the 3' end, and where it extends the 3' end with
a universal linker when it binds to the 3' end. Step 3 depicts the
further step of amplifying the double linker probes by PCR with
labeling incorporated either in the bases or by using ChipTAG
primers. Labeling can be applied in both ways to the probes, and
additional labeling can also be provided by adding GeneTAGs or
TinkerTAGs to the universal linkers of the probes.
[0047] FIG. 4: Amplified WRAP-Probe method. Sub method Three:
Applying Short RT and Random Adapter to create double-linker
probes. Step 1 depicts how the mRNA is converted to first strand
cDNA probes with a 5' universal linker by polymerizing cDNA with a
modified poly-T primer, and it further depicts the short RT
procedure where different transcripts of different lengths are
stopped short at approximately the same length. Step 2 depicts
binding of the random adapter by ligation to the 3' end of the
probes to form double linker probes. Step 3 depicts amplifying
these double linker probes by PCR with labeling incorporated either
in the bases or on the ends by using ChipTAG primers.
[0048] FIG. 5: Amplified WRAP-Probe method. Sub method Four: Short
RT and homopolymeric. These methods use either homopolymeric
adapters or extenders. Step 1 depicts how the mRNA is converted to
first strand cDNA probes with one universal linker, and it
additionally depicts the short RT procedure where the first strand
copy is stopped short for all transcripts. Step 2 depicts
alternatively either the binding of the homopolymeric extender on
the left or the homopolymeric adapter on the right to extend or
append the second universal linker unto the 3' end of the probes to
form double linker probes. Step 3 depicts the further step of
amplifying these double linker probes by PCR with labeling
incorporated either in the bases or on the ends by using ChipTAG
primers.
[0049] FIGS. 6A-6B: Images from Example 2. FIG. 6A depicts the
probes hybridized to the chip that are internally labeled with Cy3
(green). FIG. 6B, the lower portion, depicts the GeneTAGs
hybridized to the probes of 6A above wherein the GeneTAGs are
labeled with Cy5 (red) and showing increased signaling with
GeneTAGs. In this document, the color array images were converted
to black and white and inverted since the array images are
artificial, scanned pseudocolor images not true photographic
images.
[0050] FIG. 7: Image from Example 3. FIG. 7 depicts PCR amplified
probes hybridized to the chip that are internally labeled with Cy3
(green). This image is also converted to black and white and
inverted from a pseudocolor green image.
[0051] FIG. 8: Image from Example 3. FIG. 8 depicts GeneTAGs
hybridized to the probes of FIG. 7. wherein two layers of GeneTAGs
are applied and the GeneTAGs are labeled with Cy5 (red) showing
increased signaling. This image is also converted to black and
white and inverted from a pseudocolor red image.
[0052] FIG. 9: Image from Example 4. FIG. 9 depicts a small sample
of the probes from Example 2 above that were re-amplified by PCR
and applied to another expression microarray. In this case a "Red"
ChipTAG primer was employed as a single primer to globally amplify
and label all the probe products. Thus labeling was achieved from a
single Cy5 fluor that is conjugated to the 5' end of the ChipTAG
primer. Additional ChipTAG primer was added back to the probe
sample after PCR amplification to increase signaling. This image is
also converted to black and white and inverted from the red
pseudocolor image.
[0053] FIG. 10: Images from Example 6. These images demonstrate the
use of Amplified WRAP-Probe Sub method Two which employs the Short
RT and Random End-Linker procedures followed by PCR amplification
of the probes. In this case, gene expression analysis is shown with
P-32 labeled probes that are hybridized to membrane-based arrays.
Expression profiling is demonstrated that distinguishes between
control and IL-13 treated monocyte samples based upon starting with
only 1 microgram of total RNA per sample.
[0054] FIG. 11: Images from Example 7. These images shows P-32
labeled probes hybridized to membrane-based arrays using the
Amplified WRAP-Probe Sub method Three that employs the Short RT
procedure, the ligation of Random Adapters, and then PCR
amplification of the probes. Expression profiling is depicted for
Short RT using different RT exposure times of 2 min, 5 min, 10 min
and 20 min. The shorter RT exposure times give better results than
longer exposures.
DETAILED DESCRIPTION OF THE INVENTION
[0055] Preferred embodiments of the invention are now described in
detail. Referring to the drawings, like numbers indicate like parts
throughout the views. As used in the description herein and
throughout the claims that follow, the meaning of "a," "an," and
"the" includes plural reference unless the context clearly dictates
otherwise. Also, as used in the description herein and throughout
the claims that follow, the meaning of "in" includes "in" and "on"
unless the context clearly dictates otherwise. In the foregoing
discussion, the following terms will have the same meaning as
provided in International Patent Application Serial No.
PCT/US99/16242 except as modified and/or expanded herein unless the
context clearly dictates otherwise. [0056] WRAP-Probe: a single DNA
based probe affixed with universal linkers on one or both ends to
bind generic reporters. [0057] WRAP-Probe probe set: a pool of
WRAP-Probes made from a pool of mRNA species to represent and
detect relative RNA transcript frequencies with gene expression
arrays. [0058] One-Linker probes: WRAP-Probes with one universal
linker. [0059] Double-Linker probes: WRAP-Probes with universal
linkers on both ends. [0060] Amplified WRAP-Probes: a pool of
WRAP-Probes exponentially amplified by PCR or related processes.
[0061] Mini-WRAP-Probes: a series of small WRAP-Probes made from
fragmenting first strand cDNAs from a pool of mRNAs. [0062]
GeneTAG: linear generic reporter molecules with terminal universal
linkers. [0063] TinkerTAG: GeneTAGs constructed of partially
overlapping polynucleotides that self assemble, with or without
single stranded arms for binding labeled oligonucleotides. [0064]
ChipTAG: small multi-function labeled universal linker that also
serves as a primer. [0065] Universal Linker: a single stranded
nucleotide sequence that allows the joining of two probe and or
reporter elements by complementary nucleotides while the linker
sequences are not complementary to the target sequence. [0066]
Multi-Linker: a polynucleotide or complex of polynucleotides that
self assemble and that provide a probe linker and two or more
reporter linkers. [0067] Modified Poly-T Primer: a global poly-T
primer for RT reactions modified on the 5' end typically with a
universal linker and/or a capture moiety, label, reporter or
multi-linker. [0068] Adapter: paired polynucleotides with blunt or
cohesive ends for joining to DNA fragments and providing added
functions such as a linker, primer or reporter binding functions.
[0069] Specific Adapter: a composite of paired polynucleotides with
an overhang of specific sequences that can be joined to restriction
cut ends of DNA fragments and that provide a universal linker.
[0070] Random Adapter: paired polynucleotides with an overhang of
random sequences that can be joined to any DNA fragment and that
provide universal linker sequences. [0071] Homopolymeric Adapter:
paired polynucleotides with a Poly-C or Poly-G overhang that can be
joined to a Poly-G or Poly-C sequence and that provide universal
linker sequences. [0072] Homopolymeric Extender: extender
polynucleotide with a 5' universal linker end and a 3' Poly-C or
Poly-G end that can join to a 3' Poly-G or Poly-C end of a probe
and serve as a template to extend the probe with a universal linker
sequence. [0073] Random End-Linker: extender polynucleotide with a
universal linker region on the 5' end and a random sequence region
on the 3' end that can join to the 3' end of a DNA segment and
serve as a template to extend that DNA segment with a universal
linker sequence, said extender being preferably modified on the 3'
end to block capacity for polymerase extension. [0074] Probe
Modifier: a category representing any of the above adapters and
extenders that apply a universal linker to the 5' or 3' end of a
probe, including the random adapter and extender, the homopolymeric
adapter and extender and the modified poly-T primer, as well as
including the ChipTAG labeled primers which add label directly onto
to the end of probe when used to amplify a double linker probe.
[0075] Short-RT: modified RT protocol in which all products are
stopped short during RT extension to produce similarly short cDNA
probes suitable for PCR amplification. [0076] Back-Tagging:
modified thermal cycling protocol for applying Random End-Linkers
to back-extend probes using multiple thermal cycling steps with
short extension times. [0077] mRNA: messenger RNA transcripts which
are a subset of total RNA. [0078] cDNA: DNA copies of mRNA [0079]
Microarray: a miniaturized grid of nucleic acid targets to detect a
pool of probes. [0080] cDNA chip: a cDNA based microarray. [0081]
Expression Array: a grid of nucleic acid targets based on cDNA or
cDNA sequences [0082] PCR: polymerase chain reaction to amplify DNA
exponentially. [0083] RT: reverse transcriptase enzyme method to
copy RNA. [0084] RT-PCR: reverse transcriptase plus PCR to copy and
amplify a specific mRNA transcript. [0085] Hybridize: formation of
specific hydrogen bonding interactions between complementary
strands of nucleic acids. [0086] Cross-link: covalent linkage
between hybridized nucleic acid strands. [0087] PUVA: psoralen plus
UVA crosslinking procedure. [0088] TA site: nucleotide sequence
reading 5'-3': thymidine, adenine. [0089] C9: a spacer that is 9
carbon atoms long. [0090] C18: a spacer that is 18 carbon atoms
long. [0091] UNG: Uracil-Nucleotide-Glycosylase procedure where
Uracil bases are incorporated into DNA to make them labile to
glycosylase digestion.
[0092] Ranges may be expressed herein as from "about" one
particular value, and/or to "about" another particular value. When
such a range is expressed, another embodiment includes from the one
particular value and/or to the other particular value. Similarly,
when values are expressed as approximations, by use of the
antecedent "about," it will be understood that the particular value
forms another embodiment. It will be further understood that the
endpoints of each of the ranges are significant both in relation to
the other endpoint, and independently of the other endpoint.
[0093] The present invention relates to a number of probe
compositions, manufacturing compositions, and signaling
compositions and associated methods that improve the preparation,
application and detection of probes and reporters for gene
expression arrays and related multi-analyte hybridization assays,
including but not limited to cDNA chips, oligonucleotide chips,
biochips and other microarray formats. The present invention is in
part based upon or incorporates prior inventions of the applicant,
described in International Patent Application Serial No.
PCT/US99/16242 (WIPO Publication WO 00-04192), the disclosure of
which is hereby incorporated by reference in its entirety.
Composition of Matter:
[0094] The present invention relates to a universal linker
composition suitable for gene expression arrays and related
hybridization assays, including a nucleotide linking sequence which
can be globally appended to the ends of a set of probes derived
from mRNA transcripts of an analyte sample to produce a probe set
where the probes have a common linker at one or both ends. These
universal linker sequences are not complementary to the target
sequences of the assay, and they provide binding sites to join the
members of the probe set to common reporters. The universal linkers
are also suitable for chemical cross-linking between bound linkers,
so that probes, reporters, and any intermediate linking elements,
can be pre-attached together and covalently bonded. The universal
linkers additionally serve as universal primer binding sites for
copying or amplifying the probe set.
[0095] The universal linkers of the present invention are suited to
binding a variety of reporters that may have complementary linkers,
particularly reporters such as the GeneTAG and TinkerTAG reporters,
and arrays thereof, as referenced and described previously, where
the GeneTAG reporters include linear labeled segments of duplex DNA
that terminate in single stranded universal linkers and the
TinkerTAG reporters that contain a structurally similar linear
complex of labeled polynucleotides and that also terminate in
single stranded universal linkers. These reporters can also form
arrays of reporters joined end to end. The universal linkers are
additionally suited to binding multi-linker elements, as referenced
and described previously, may include one or more joined
polynucleotides that form a probe linker at one end and two or more
reporter linkers at the opposite end. The probes of the present
invention may employ the universal linkers to bind reporters
directly or indirectly, by virtue of binding multi-linkers to the
probes, and binding reporters such as GeneTAGs or TinkerTAGs to the
linkers of the multi-linkers.
[0096] The present invention additionally relates to a set of two
or more universal linkers containing linker sequences which can
bind two or more sets of probes to two or more different common
reporters, either directly or via intermediate linkers, to provide
different labeling to different sets of probes. These universal
linker compositions include but are not limited to:
[0097] a. A first linker sequence 5'CTACGATACGATAGCGCCTAAGAGTAG
(Seq. ID. No. 1) and its complement, known as the Red universal
linker;
[0098] b. A second linker sequence 5'CCTAGACCTACGACATAGGTACCCTAC
(Seq. ID. No. 2) and its complement, known as the Green universal
linker;
[0099] c. A third linker sequence 5'CGTAGAACTAGCACGCTACGTACTAGG
(Seq. ID. No. 3) and its complement, known as the Blue universal
linker;
[0100] d. A fourth linker sequence 5'GGCTATCGCTACGTAGACTAGACCTAC
(Seq. ID. No. 4) and its complement, known as the Orange universal
linker.
[0101] The present invention relates to a probe set composition,
called WRAP-Probes, for gene expression arrays and related
hybridization assays, to provide common equivalent signaling per
probe regardless of length, as contrasted with signaling bias which
results from incorporating label along the length of each probe.
This probe set includes a pool of modified cDNA probes copied in
part from a sample of mRNA transcripts, but appended with terminal
universal linkers, as in the prior WRAP-PROBE invention referenced
and described previously, where each single stranded probe of the
probe set contains a central target specific segment copied from a
single mRNA transcript, and a universal linker located on a
terminal end of the probe. The universal linkers provide binding
sites to join common reporters to each probe, and they also provide
primer binding sites to copy and amplify the probes. In a primary
embodiment, to allow exponential amplification of the probes, probe
sets are also made with universal linker sequences at both terminal
ends. The universal linker sequences at both ends may be different
or they may mirror one another, in which case the probe set has a
common primer binding site and may be amplified with a single
primer.
[0102] In another embodiment of the WRAP-Probe probe set, called
Mini-WRAP-Probes, the probes are fragmented to provide multiple
probes per mRNA transcript. Initially, the probe set of first
strand cDNA probes is fragmented and then universal linkers are
applied to one or both ends of the fragments to create a final
probe set of multiple short probes having universal linkers. Thus,
each transcript becomes a series of short or Mini WRAP-Probes with
one or two terminal linkers, that provide greater signaling in two
ways, by amplifying the multiple probe fragments, and by binding
reporters to the linkers of the multiple probe fragments. Such
fragmentation may be induced randomly by shearing, sonication,
RNase, RNase-H, UNG, single strand cutting enzymes, and like
treatments, or alternatively at specific sequences with restriction
enzymes.
[0103] In other embodiments, two or more probe sets of WRAP-Probes
or Mini-WRAP-Probes are provided, having probe sets that can be
compared in the same assay, where the probes of each set have
different universal linkers, and where the linkers provide binding
sites for different multi-linkers, reporters or labeling that
distinguish the probe sets from one another.
[0104] The present invention relates to a series of modified Poly-T
Primer compositions for globally initiating the copying and
conversion of mRNA transcripts into a set of WRAP-Probes. In the
primary embodiment, the modified Poly-T Primer composition contains
a polynucleotide in which the 3' end provides a poly-T primer
segment to initiate RT polymerization and the 5' end provides a
universal linker, wherein the linker can bind reporters to the
probe. Alternatively, the Poly-T Primer composition has a poly-T
end that also contains an anchor sequence to preferentially bind to
the forward end of the poly-A segment of mRNA transcripts. In a
primary embodiment, the anchor sequence takes the form 5'-poly-T,
V, N-3', where poly-T is a series of thymidine bases, V is a
variable base of adenine, cytosine or guanine, but not thymidine,
and N is randomly any base. Other anchor sequences can be employed
including the sequence 5'-poly-T, V. The Poly-T Primers are
preferably made with about 12 to 20 thymidines in the poly-T
segment.
[0105] In an additional embodiment, a Poly-T Primer composition is
manufactured with a capture moiety such as biotin on the 5' end so
that the probe units can be captured with magnetic beads or other
methods and retained, purified, treated, or re-used to copy the
original probe set. In other embodiments, the modified Poly-T
Primer is manufactured with labeling elements attached, or
alternatively, one or more reporters are pre-attached prior to use.
Alternatively, the modified Poly-T Primer is constructed with a
multi-linker pre-attached, wherein reporters can be attached or
pre-attached to the multi-linker. Such reporters can include
GeneTAGs, TinkerTAGs or arrays of such reporters. Additionally, a
set of two or more Poly-T Primer compositions are provided, that
include different universal linkers, multi-linkers, reporters and
label or labeling precursor so that each resulting probe subset can
be distinguished by different signaling.
[0106] The present invention also relates to a series of adapter
compositions for providing a second universal linker to the probe
sets. One product embodiment is a sequence specific adapter
composition, called a Specific Adapter that is typically ligated to
the 3' end of a DNA probe segment. This adapter product contains
two polynucleotides joined together by complementary bases, where
the complementary bases are a set of universal linker sequences,
and where one end contains an additional single-stranded overhang,
typically of 1 to about 6 bases, that can specifically bind to the
terminal end of a probe that has been cut with a specific
restriction enzyme. These Specific Adapters are also manufactured
as a set of two or more such adapter products to allow sample
comparisons, where each adapter in the set has a different
universal linker sequence that can bind different reporters or
multi-linkers.
[0107] The present invention also relates to a series of random
adapter compositions for providing a second universal linker to the
probe sets. One embodiment is a Random Adapter product that is
typically ligated to the end of a DNA probe segment. The Random
Adapter composition contains two polynucleotides joined together by
complementary bases, where the complementary bases are a set of
universal linker sequences, and where one end has an additional
single-stranded overhang of random bases, typically of 1 to about 6
random bases. Such random sequences, which are also called
degenerate sequences, are typically represented as an "N" in
sequence descriptions and are chemically synthesized by providing
alternatively and randomly: an adenine (A), thymidine (T), cytosine
(C) or guanine (G), at each position in the random sequence. A set
of two or more Random Adapters are also provided by the invention
to allow sample comparisons, where each adapter in the set has a
different universal linker sequence. Another product embodiment is
a homopolymeric adapter composition that is also typically ligated
to the end of a DNA probe segment, but in this case, the 3' end of
the probes are first extended with a poly-C or poly-G sequence. The
homopolymeric adapter product contains two polynucleotides joined
together by complementary bases, where the complementary bases are
a set of universal linker sequences, and where one end contains an
additional single-stranded overhang of poly-C or poly-G bases. The
homopolymeric adapter binds to a complementary tail of poly-G or
poly-C sequences that is previously appended to the probes using
terminal transferase and a sole nucleotide. A set of two or more
homopolymeric adapters is also provided to allow sample
comparisons, where each adapter in the set has a different
universal linker sequence. In alternate product embodiments, the
Specific Adapter, the Random Adapter or the Homopolymeric Adapter
is labeled.
[0108] The present invention also relates to a series of extender
products for providing a second universal linker to the probe sets.
One random extender composition, called a Random End-Linker, binds
to the end of a probe at random and extends its sequences as a copy
of the linker sequences of the extender. This extender includes a
single-stranded polynucleotide with a 5' end containing universal
linker sequences, and a 3' end containing random sequences,
preferably about 4 to about 10 random sequences (also called
degenerate sequences). In a preferred embodiment, the Random
End-Linker is chemically modified on the 3' end to block or prevent
polymerase extension of that end, where one modification practiced
is to add a carbon spacer to the 3' end. Consequently, this product
will not forward copy. The present invention provides a set of two
or more Random End-Linker products to allow sample comparisons,
where each composition in the set has a different universal linker
sequence. An alternate extender product of the present invention is
a homopolymeric extender that includes a single-stranded
polynucleotide with a 5' end containing universal linker sequences,
and a 3' end containing poly-C or poly-G sequences, preferably of
about 5 to about 15 poly-C or poly-G sequences. The homopolymeric
extender binds to a tail of poly-G or poly-C sequences that is
previously added to the 3' end of a probe by terminal transferase.
The present invention provides a set of two or more homopolymeric
extender products to allow sample comparisons, where each
composition in the set has a different universal linker
sequence.
[0109] The present invention relates to a universal
linker-primer-reporter composition, called a ChipTAG, which
includes a single-stranded polynucleotide with universal linker
sequences that is manufactured with a label or labeling precursors
attached and where the linker sequences provide both a primer
function for DNA polymerase activity and a linker function to bind
the labeled ChipTAG as a reporter to a probe. Additionally, two or
more sets of ChipTAG compositions are provided to allow sample
comparisons, where the ChipTAGs may differ from one another in both
their linker sequences and in their pre-attached label or labeling
precursors, and where different labeling is provided to different
probe sets.
Method:
[0110] The present invention relates to a series of methods for
gene expression arrays and related assays that enable the
manufacture and application of the related composition of matter
inventions described above. These methods attach common reporters
to the ends of a probe set, typically by virtue of universal
linkers created at one or both ends of the probes, to give each
probe in the set an essentially equivalent signaling level, thereby
enabling a more effective count of the number of different
transcripts in the original RNA sample. However, these methods also
allow internal labeling of the probes by standard methods, either
additionally or alternatively. Since some of the methods truncate
the lengths of the probes so that their size variation is reduced
or eliminated, these methods can additional enable the
normalization of signaling between probes even when they are
internally labeled. These methods can additionally amplify the
probe sets globally by virtue of the terminal universal linkers so
that exponential amplification procedures such as PCR or related
methods can be practiced if the probes have linkers at both ends,
and so that linear amplification procedures can be practiced if the
probes have one linker.
[0111] The present invention relates to a general method to make
and apply WRAP-Probe probe sets for gene expression analysis, where
more accurate quantitative detection is achieved by attaching
common reporters to one or both ends of each probe, this method
comprising:
[0112] a. Providing RNA from a tissue sample;
[0113] b. Making cDNA probes from the RNA transcripts with
universal linkers at one or both ends;
[0114] c. Hybridizing the cDNA probes to an array or series of gene
specific targets;
[0115] d. Joining reporters to the cDNA probes; and
[0116] e. Detecting reporters to determine the expression of genes
in the tissue sample.
[0117] In its most elementary embodiment, the WRAP-Probe method
produces a probe set with a single linker or reporter end,
comprising:
[0118] a. Hybridizing a modified poly-T primer with a universal
linker to the mRNA transcripts;
[0119] b. Polymerizing full or partial first strand cDNA copies of
the transcripts to form one linker probes with a common 5'
signaling end.
[0120] This method is illustrated in FIG. 1 where step 1 shows the
use of the poly-T primer to make a first strand cDNA probe with a
5' universal linker, step 2 shows the binding of the probes to the
cDNA chip, and step 3 shows the binding of GeneTAGs to the linkers
of the probes.
[0121] This one-linker WRAP-Probe method can bind multi-linkers and
or reporters to the 5' universal linker affixed to the probes,
including but not limited to GeneTAGs, TinkerTAGs or reporter
arrays thereof, as well as ChipTAGs or commercially available
reporters such as the bDNA reporters of Chiron Corp. [Urdea et al.
(U.S. Pat. No. 5,124,246)] or the Dendrimer reporters of Polyprobe,
Inc. [Nilsen and Prensky, (U.S. Pat. No. 5,487,973)], if such
reporters were re-manufactured with nucleotide linking sequences
that corresponded to the universal linkers of the WRAP-Probes of
the present invention. Alternatively, poly-T primer compositions
are provided that have multi-linkers and or reporters and or label
pre-attached, where a second step is not required to hybridize
these signaling elements to the probes after the probes are
hybridized to the targets of the expression assay. The present
invention also provides different one-linker probe sets, based upon
differences in linker sequence, labeling and reporter attachment so
that probe set comparisons can be performed on the same assay.
[0122] The most common form of the WRAP-Probe method is
double-linker probes and the general method to make and apply
double-linker WRAP-Probe probe sets comprises:
[0123] a. Hybridizing the poly-T primercomposition with a universal
linker to the mRNA transcripts;
[0124] b. Polymerizing full or partial first strand cDNA copies of
the transcripts to form an initial probe set with a common 5' first
universal linker;
[0125] c. Affixing a second universal linker to the 3' end of the
probes to make a final double-linker probe set.
[0126] In the above and subsequent double-linker WRAP-Probe
methods, each probe strand has a 5' and a 3' universal linker,
wherein the 5' end is already suitable for effective end-to-end
binding to the complementary 5' single stranded linker end of a
typical GeneTAG, TinkerTAG or multi-linker. However, the 3' end is
less suitable for such end to end binding. Therefore, based on
procedures of the WRAP-PROBE method of the prior invention, the 3'
ends of the probe set of the present invention are optionally
modified by applying and cross-linking an additional polynucleotide
linker that reverses the polarity of the probe end to provide a 5'
universal linker end. (See Example 3) To achieve this, the
universal linker sequences are typically designed with one or more
5'TA sequences to enable the application of PUVA cross-linking,
wherein free psoralen plus UV blacklight treatment covalently joins
contra-lateral thymidine bases. Alternatively, a subset of GeneTAG
reporters can be pre-made with 3' vs. 5' end linkers in a similar
manner, or TinkerTAGs can be made directly with 3' end linkers.
[0127] The double-linker WRAP-Probe method provides several
sub-methods to alternatively apply the second universal linker to
the 3' ends of the first strand cDNA probes.
[0128] The first primary double-linker sub-method of the WRAP-Probe
method employs restriction enzyme cutting and ligation of the
Specific Adapter product to shorten the probes and form universal
linkers at both ends, wherein the modifications comprise:
[0129] a. Providing the Poly-T Primer composition with a capture
moiety, such as biotin, at the 5' end;
[0130] b. Polymerizing first strand cDNA and then second strand
cDNA to form double stranded cDNA with a 5' first strand universal
linker and a capture moiety.
[0131] c. Cutting the double stranded cDNA products with a
restriction enzyme;
[0132] d. Selectively capturing the terminal 5' probe fragments of
first strand cDNA by virtue of the capture moiety, using
strepavidin-coated magnetic beads or similar capture
techniques;
[0133] e. Joining a Specific Adapter to the cut 3' end of the
captured probe fragments to append a 3' second universal linker and
create a final double-linker WRAP-Probe probe set, wherein the
probe set is denatured and applied to gene expression assays.
[0134] This method was used to create the double linker probes of
FIGS. 7, 8 and 9 although those probes were amplified by PCR as
well. FIG. 2 illustrates this method in step 1, where the mRNA is
converted to double stranded cDNA with one universal linker by
copying the mRNA with RT and a modified poly-T primer, and by then
polymerizing a second strand with DNA polymerase and RNase H. Step
2 depicts cutting the probes with a restriction enzyme and
capturing them with magnetic beads. Step 3 depicts ligating the
Specific Adapter to the 3' cut ends of the captured probes to
append a second universal linker and to form double-linker probes.
This figure also depicts a further step in Step 4 that is not a
part of the above method. In Step 4 the probes are amplified by PCR
amplification and either labeled internally with labeled bases or
labeled on their ends using a ChipTAG labeled primer.
[0135] In a preferred embodiment of the above method, two or more
restriction enzymes are employed in separate probe aliquots using
Specific Adapters matched to the cut sites. This modification is
provided to ensure that no gene is unrepresented in a detection
sample since the use of one restriction enzyme may cause a
particular gene to always be cut at a site too close to the poly-A
end of the transcript to produce a viable probe. With this
modification, the separate probe aliquots are then mixed and
applied together for analysis.
[0136] The second primary double-linker sub-method of the
WRAP-Probe method employs the new random extender product, called a
Random End-Linker, to form a second universal linker on the 3' end
of the probes, where the extender is applied with a new thermal
cycling procedure called Back-Tagging. This method comprises the
following modifications: [0137] a. Providing first strand cDNA
probes with a 5' universal linker; [0138] b. Denaturing and
removing the RNA; [0139] c. Repeatedly hybridizing the random
extender to the probes under rapid thermal cycling conditions
similar to PCR, wherein high temperature DNA polymerase and
nucleotides are provided along with repeat cycles of high
temperature denaturing, low temperature annealing, and moderate
temperature but brief extension, to bind the random extender to the
3' ends of the probes via the random segment and to selectively
extend the 3' ends of the probes using the universal linker segment
of the random extender as a sequence template, to create a second
universal linker on the 3' ends of the probes, to form a final
double-linker probe set.
[0140] This method was employed to create the double linker probes
of FIG. 10 although those probes were also amplified by PCR. FIG. 3
illustrates this method in step 1 and step 2, where step 1 depicts
how the mRNA is converted to first strand cDNA probes with one
universal linker, although this illustration also depicts the short
RT procedure where the first strand copy is stopped short. Step 2
depicts binding of the random extender composition, called the
Random End-Linker, to the probes during multi-cycle thermal cycling
where the extender binds but does not prime if it binds anywhere
along the probes except the 3' end, and where it extends the 3' end
with a universal linker when it binds to the 3' end. Step 3 of FIG.
3 depicts a further step, not a part of this specific method, where
the double linker probes are amplified by PCR with labeling
incorporated in the bases or by using ChipTAG primers.
[0141] Although the Back-Tagging procedure employs thermal cycling
and high temperature polymerase reagents common to the PCR method,
it does not practice the PCR procedure to copy or exponentially
amplify the products since the 3' end of the Random End-Linker is
preferably blocked and cannot serve as a primer. Consequently, when
the temperature is lowered each cycle to anneal the Random
End-Linker products to the probes, these extenders will bind at
random but will not function unless they happen to bind to the 3'
end of the probe fragment. Indeed, the annealing step can be
practiced at lower temperatures than would be employed for PCR
since the goal is to force as many Random End-Linkers onto the
probe strand as possible to increase the chances that one will bind
to the 3' end. Since, the extenders will come off again each high
temperature cycle in an unmodified state they will be reused on the
next annealing cycle whereupon they might again bind to the 3' end.
Once they do bind to the end of the probe fragment, it will extend
3' by polymerization using the linker sequences of the Random
End-Linker as a template to form a 3' universal linker. When it
binds anywhere else along the probe, the blocked end of the random
end-linker prevents copying any portion of the first strand
fragments. Thus, the formation of spurious fragments is avoided and
the rapid use of nucleotides and enzyme is prevented. Therefore,
thermal cycling can be continued for hundreds of cycles to
effectively apply second universal linkers to the first strand
probes. This principle and method has multiple uses in the present
invention and for other applications.
[0142] The third double-linker sub-method of the WRAP-Probe method
employs the Random Adapter product to append the second universal
linker, comprising the following modifications:
[0143] a. Providing first strand cDNA probes with a 5' universal
linker;
[0144] b. Denaturing and removing the RNA;
[0145] c. Joining the random adapter to the 3' end of the probes to
append a second universal linker, to create a final double-linker
probe set.
[0146] This method was used to create the double linker probes of
FIG. 11 although those probes were amplified by PCR as well. This
method is illustrated in step 1 and 2 of FIG. 4 where step 1
depicts how the mRNA is converted to first strand cDNA probes with
one universal linker, although this illustration also depicts the
short RT procedure where the first strand copy is stopped short.
Step 2 depicts binding of the random adapter by ligation to the 3'
end of the probes to form double linker probes. Step 3 of FIG. 4
depicts a further step, not a part of this specific method, where
the double linker probes are amplified by PCR with labeling
incorporated either in the bases or on the ends by using ChipTAG
primers.
[0147] The fourth double-linker sub method of the WRAP-Probe method
employs homopolymeric tailing and application of the homopolymeric
adapter product to append the second universal linker, comprising
the following modifications:
[0148] a. Providing first strand cDNA probes with a 5' universal
linker;
[0149] b. Denaturing and removing the RNA;
[0150] c. Extending the 3' end of the probe fragments with a
homopolymeric tail of poly-C or poly-G sequences using terminal
transferase and one nucleotide;
[0151] d. joining a matching homopolymeric adapter to the
homopolymeric tail on the 3' ends of the probes to append a second
universal linker and to create a final double-linker probe set.
[0152] Alternatively the homopolymeric extender can be substituted
in the above procedure wherein this modification comprises the
steps of: [0153] a. providing first strand cDNA probes with a 5'
universal linker and a 3' homopolymeric tail of poly-C or poly-G
sequences; [0154] b. joining a matching homopolymeric extender to
the homopolymeric tail on the 3' ends of the probes and
polymerizing a 3' extension, wherein the universal linker segment
of the extender provides a sequence template for extending the 3'
end of the probes with a second universal linker sequence, to
create a final double-linker probe set.
[0155] These methods using homopolymeric adapters or extenders are
illustrated in step 1 and 2 of FIG. 5 where step 1 depicts how the
mRNA is converted to first strand cDNA probes with one universal
linker, although this illustration also depicts the short RT
procedure where the first strand copy is stopped short. Step 2
depicts alternatively either the binding of the homopolymeric
extender on the left or the homopolymeric adapter on the right to
extend or append the second universal linker unto the 3' end of the
probes to form double linker probes. Step 3 of FIG. 3 depicts the
further step of amplifying these double linker probes by PCR with
labeling incorporated either in the bases or on the ends by using
ChipTAG primers.
[0156] In preferred embodiments of the WRAP-Probe method, the RT
copying of the mRNAs is intentionally truncated by greatly reducing
the duration of exposure to the enzyme to purposefully produce very
short RT products, generally less than 1000 bases in length and
preferably less than 500 bases. Brief RT exposure times of several
minutes or seconds are herein employed as contrasted with one hour
or more of RT exposure by standard cDNA chip labeling methods. This
radical modification of the RT protocol, called Short-RT, results
in first strand cDNA probe components that are randomly and
arbitrarily short such that pre-existing size differences between
genes and gene transcripts are effectively eliminated, wherein the
method normalizes the lengths of the probes, improves the ability
to affix random end-linkers to the probe components, improves the
kinetics of probe binding to the expression assay, and allows the
internal labeling of the probes as a supplement to reporter binding
without reintroducing bias in signaling between genes due to
inherent differences in transcript length. Short probes also
provide more efficient amplification of the double-linker probes by
exponential procedures such as PCR.
[0157] The Short RT procedure is generally employed in conjunction
with the double-linker WRAP-Probe methods described above that
don't require a specific cut site to apply a second linker, wherein
the modified steps comprise:
[0158] a. Hybridizing a modified poly-T primer with a universal
linker to the mRNA transcripts;
[0159] b. Polymerizing truncated first strand cDNA copies of the
transcripts by abruptly terminating RT polymerase progression by
time, to form an initial set of shortened probe fragments with a 5'
universal linker;
[0160] c. Applying a second universal linker to the 3' ends of the
shortened probes to create a final double-linker probe set.
[0161] In preferred embodiments, the Short RT procedure is improved
or augmented by additional treatments, including but not limited to
cold, heat, alkali, enzymes such as RNase and RnaseH, single
stranded cutting enzymes, UNG, shearing, sonication or like
treatments.
Amplified WRAP-Probes Methods:
[0162] The present invention also relates to a modification of the
double-linker WRAP-Probes method, called the Amplified WRAP-Probes
method, to provide improved assay sensitivity, wherein the
universal linkers affixed to both ends of the probes are used as
primer sites to globally and exponentially amplify the probe set,
the amplification method comprising:
[0163] a. Providing a double-linker probe set with universal
linker-primer sites on both ends;
[0164] b. Providing primers that match or complement the universal
linker-primer sequences of the probes;
[0165] c. Amplifying the set of probes exponentially by PCR or
related processes;
[0166] d. Denaturing and hybridizing the probes to an array or
series of gene specific targets.
[0167] In the Amplified WRAP-Probes methods, probe labeling may be
incorporated enzymatically during PCR either by using bases
conjugated directly with labeling agents, such as Cy3 or Cy5
fluorescent compounds, or by incorporating bases with labeling
haptens such as amines, biotin or digoxygenin, whereupon labeling
is added to the haptens in a second processing step. In Examples 2,
3 and 5 below such probe labeling employed direct labeling with
Cy3-dCTP or Cy5-dCTP, or indirect labeling with amino-allyl dUTP
(Sigma) to make amino-conjugated bases, whereupon the probes are
then coupled to Cy dyes using Cy3 or Cy5 mono-functional reactive
dye packs (AP Biotech).
[0168] In further embodiments of the Amplified WRAP-Probes method,
the probe sets are alternatively or additionally labeled via the
primers, such as the linker-primer-reporter products called
ChipTAGs that comprise labeled universal linkers. In Example 4
below the ChipTAG primers are manufactured with Cy5 on their 5'
ends and provide the sole labeling for the probes. Since ChipTAGs
can be labeled more efficiently than probes can be labeled
internally, ChipTAG labeling can fully substitute for internal
enzymatic labeling with just a few steps of probe amplification. By
labeling the ends of the probes, ChipTAGs also improve
quantification of signaling per probe.
[0169] Alternatively or additionally, the probes may be labeled by
binding GeneTAG or TinkerTAG reporters to the universal linkers of
the probes, generally after the probes are hybridized to the
targets on the expression assay, such as in the Examples 2 and 3
below which employ GeneTAGs labeled directly with Cy5-dCTP bases.
Additionally, multi-linkers as described previously could be
applied to the probes to increase the number of reporters bound,
and furthermore, the labeled primers, called ChipTAGs can be added
to the probes before or after the probes are hybridized to the
targets, so that any matching linker ends not having label will
bind ChipTAGs and add label. This was practiced in Example 4 where
an aliquot of ChipTAGs was added back to the probes denatured and
applied to the expression arrays, thereby adding a second ChipTAG
to the 3' end of each single stranded probe.
[0170] In a further embodiment of the Amplified WRAP-Probes method,
the modified poly-T primer product with a 5' capture moiety is
employed to allow high fidelity re-amplification of the probe set.
In this embodiment, the original double-linker probe products have
a 5' capture moiety and they are then captured, separated and
retained, so that these original copies may be selectively reused
for additional amplifications of the probe set, such as in Examples
3 and 4 below. This procedure can be applied to any of the
double-linker probe methods to selectively capture, retain and
reuse the first strand cDNA probes with linkers on both ends to
amplify and re-amplify the first copy of the probes from the mRNA
transcripts. This procedure inhibits or prevents any bias that may
be introduced by sequence copying errors during amplification or by
any random "Monte Carlo" variations in relative amplification that
may occur in the very low frequency transcripts.
[0171] To improve amplification efficiency and to reduce or
eliminate amplification bias, additional embodiments of the
Amplified WRAP-Probes methods are further modified by creating
shortened double-linker WRAP-Probes, generally by employing the
restriction cutting or the Short RT procedures describe above,
wherein the probes are generally reduced to less than 1000 bases
and preferably to less than 500 bases. Examples 3 and 4 below
employ restriction cutting to reduce the probe size for more
effective amplification. Examples 5, 6 and 7 employ Short RT to
reduce probe length, wherein Examples 5 and 6 additionally employ
the Random End-Linker and rapid thermal cycling with the
Back-Tagging procedure to provide the second linker needed for PCR
amplification, and wherein Example 7 additionally employs the
Random Adapter to provide the second universal linker needed for
amplification. Run on a gel, these amplified products form smears
of shortened probes in the size ranges described above.
[0172] Additional embodiments of the Amplified WRAP-Probes method
create and employ two or more sets of double-linker WRAP-Probes
which differ in labeling, wherein multiple probe sets may be
compared in the same assay.
[0173] The various WRAP-Probe methods described above, including
the single and double-linker methods, the amplified methods, and
the fragmented probes methods are additionally or alternatively
provided direct signal amplification by applying various reporters
to the universal linkers of the probe sets, wherein such reporters
include, but are not limited to, GeneTAGs, TinkerTAGs, arrays
thereof, and multi-linker and reporter constructs thereof as
previously described. In Examples 2 and 3 below the probes labeled
with Cy3 fluorescence are applied to the expression arrays and then
one or more GeneTAGs labeled with Cy5 fluorescence are added to
each probe in a second hybridization. Therefore, the labeling
provided by the probes and the added labeling provided by the
GeneTAGs is evident since the two dyes are separately excited,
scanned and detected in different channels as independent
signals.
[0174] Other commercial labeling products may also be applied to
the universal linkers of the probe sets such as the bDNA products
of Chiron Corp., or the dendrimer products of Polyprobe, Inc. if
such products can be prepared with complementary universal linker
ends. The present invention also embodies the application of
commercial labeling agents, such as fluorescent reagents, electron
transfer dyes, radioactive isotopes, the color emitting quantum dot
products of Quantum Dot Corp., gold, Nanogold, or other metallic
labeling agents, as well as various labeling haptens such as
amines, thiols, biotin, digoxygenin, dinitrophenol, FITC, etc.,
wherein such products may be attached to the reagents of the
present invention including the modified poly-T primers, the
various adapters and extenders and the ChipTAGs, GeneTAGs,
TinkerTAGs, and reporter arrays thereof as previously
described.
[0175] Oligonucleotide based expression arrays, such as the
GENECHIPs of Affymetrix, Inc., have different capabilities and
limitations relative to cDNA based chips. Reflecting these
differences, oligonucleotide-based arrays are less suited for
probes made primarily from the poly-A end of gene transcripts since
such oligo-based arrays frequently target upstream as well as
downstream gene regions and fail to score expression for a gene if
all the oligonucleotides on the chip representing that gene do not
show labeling. Therefore, the present invention alternatively
provides methods to generate probes that better represent the
entire gene transcript. The principle of this approach is to copy
all or most of the entire transcripts, fragment the cDNA copies to
make multiple probe fragments, and then use the methods and
compositions developed and described here to append universal
linkers to all the fragments so that the fragment set can be
globally amplified and applied to expression arrays.
[0176] The present invention thus relates to a method for gene
expression analysis that is devised for oligonucleotide-based
arrays, called the Mini-WRAP-Probes method, wherein multiple
double-linker probes are made from each transcript, the method
comprising the steps of: [0177] a. making first strand cDNA probes
from a RNA sample; [0178] b. fragmenting the probes with a
fragmenting agent, the fragmenting agent selected from the group
consisting of restriction enzymes, RNase, RNase-H, UNG, single
stranded cutting enzymes, shearing, and sonication; [0179] c.
applying a random probe modifier to the 3' end of the probe
fragments to append a common universal linker, the random probe
modifier selected from the group consisting of the random adapter
composition and the random extender composition; [0180] d.
polymerizing a second strand cDNA copy of the fragments with a
primer comprising the universal linker sequence; and [0181] e.
applying the random extender comprising the same universal linker
sequence and the blocked 3' end to the probe fragments, wherein
repeated thermal cycling is performed as described above to
preferentially extend the 3' end of the second strand cDNA probe
copies with a second universal linker sequence, to form
double-linker probes from each probe fragment suitable for PCR
amplification, labeling and application to expression assays,
particularly oligonucleotide-based arrays.
[0182] Other embodiments of the Mini-WRAP-Probes methods employ
these same procedures and reagents to create universal linkers on
fragmented probes or fragmented DNA thus enabling either the
amplification of the probes or fragments or the use of GeneTAGs and
other reporters to increase probe signaling from small
fragments.
[0183] One such application is the identification of small DNA
fragments. DNA in preserved or frozen tissues, such as clinical,
pathological or forensic specimens, are commonly degraded making it
difficult to extract, amplify and identify the sequences. DNA
fragments also appear in clinical specimens of blood and bodily
fluids that are important indicators of disease or cancer but are
difficult to concentrate or identify. Identifying degraded DNA is a
particularly acute problem in studying Ancient DNA samples such as
Egyptian and Etruscan mummies or biological samples preserved in
glaciers, bogs, amber, etc. The present invention provides
additional modifications of the Mini-WRAP-Probe method to amplify
and identify any DNA fragment or set of fragments, wherein the
following steps are applied to make and analyze the sample: [0184]
a. providing a sample of unknown DNA fragments; [0185] b. applying
a random probe modifier to the 3' end of the fragments to append a
common universal linker, the random probe modifier selected from
the group consisting of the random adapter composition and the
random extender composition; [0186] c. polymerizing a second strand
cDNA copy of the fragments with a primer comprising the universal
linker sequence; [0187] d. applying the random extender
composition, further comprising the same universal linker sequence
and the blocked 3' end, to the fragments with repeated thermal
cycling to preferentially extend the 3' end of the second strand
cDNA copies with a second universal linker sequence, to form
double-linker fragments suitable for PCR amplification; and [0188]
e. amplifying the fragments and sequencing them to determine their
sequence identity.
[0189] In this method, the probe modifier used to append the first
universal linker is less critical, since there is only one
potential 3' target for each probe fragment. Thus for this first
step, the random adapter is the simplest approach. However, once
the second strand copies of the fragments are polymerized, the
random extender composition provides an important advantage since
it will favor extending a 3' end which lacks a universal linker.
Once a universal linker has been applied to a 3' end, another
random extender attempting to anneal to that end will preferential
bind the universal linker end of the random extender to the
matching universal linker sequence already there--thus inactivating
that extender molecule for that cycle. Consequently, the random
extender composition will preferentially apply only one universal
linker to each 3' end.
[0190] Other embodiments of the Mini-WRAP-Probes methods enable
improved sensitivity with tissue microarrays or RNA arrays, wherein
a cDNA probe prepared for such applications are modified by the
above methods to append universal linkers to the probes, wherein
the steps to make the probes comprise the following steps: [0191]
a. providing a fragmented cDNA probe; [0192] b. applying a random
probe modifier to append a first universal linker to the 3' end of
the fragments; [0193] c. polymerizing a second strand cDNA copy of
the fragments; [0194] d. applying the random extender composition,
further comprising the same universal linker sequence and the
blocked 3' end, to the fragments with repeated thermal cycling to
preferentially extend the 3' end of the second strand cDNA copies
with a second universal linker sequence, to form double-linker
probe fragments; [0195] e. hybridizing the probes to an array of
RNA targets; [0196] f. hybridizing reporter units to the linkers of
the probes, the reporter units selected from the group of
linker-primer-reporter compositions, multi-linkers, and reporters,
the reporter comprising linear segments of label DNA or joined
polynucleotides with a single stranded universal linker end; and
[0197] g. detecting the reporter units to detect the RNA
targets.
[0198] The purpose of this method is to maximize signaling by
creating a fractured set of probes, each of which can be labeled
internally during PCR amplification or by binding reporters to the
universal linkers of the probes, wherein such reporters could
include multi-linkers, GeneTAGs and GeneTAG arrays.
[0199] A very important need of molecular biology and drug
discovery research is the necessity of determining the sequences at
the 5' end of gene transcripts which are frequently
under-represented or lost in common procedures (some of these
procedures are called 5' RACE). Such information is needed to
determine the functional full-length sequences of a gene for drug
discovery and patenting issues. The present invention provides a
modified Mini-WRAP-Probe method wherein the Random Extender and the
Back-Tagging procedure are employed to find and duplicate the
absolute 3' end of first strand cDNA copies of a specific gene,
wherein the steps of this procedure comprise the steps of: [0200]
i) providing a set of mRNA transcripts wherein the 5' end of the
gene of interest has been copied as first strand antisense cDNA by
reverse transcriptase using a gene specific primer, wherein the
gene specific primer additionally comprises a universal linker
sequence and a capture moiety; [0201] ii) capturing and purifying
the first strand cDNA copies of the targeted transcript; [0202]
iii) applying the random extender composition with rapid thermal
cycling to extend the 3' end of the cDNA product with a universal
linker sequence, wherein a double-linker product is formed suitable
for PCR amplification; and [0203] iv) amplifying and sequencing the
double-linker cDNA product to determine the sequences of the 5' end
of the gene.
[0204] The practice of the present invention employs, unless
otherwise indicated, conventional techniques of molecular biology,
microbiology and recombinant DNA techniques, which are within the
skill of the art. Such techniques are explained fully in the
literature. See, e.g., Sambrook, J. et al., Molecular Cloning; A
Laboratory Manual, Second Edition (1989); Oligonucleotide Synthesis
(M. J. Gait, ed., 1984); Nucleic Acid Hybridization (B. D. Hames
& S. J. Higgins, eds., 1984) A Practical Guide to Molecular
Cloning (B. Perbal, 1984); and the series Methods in Enzymology
(Academic Press, Inc.).
[0205] The synthesis of some of the probe and reporter components
of the present invention may be accomplished by conventional
polymerase chain reaction (PCR) process. The protocol for PCR is
set forth in Saiki et al., Science 230: 1350 (1985) and U.S. Pat.
Nos. 4,683,195 and 4,683,202. A PCR adapter-linker method is set
forth in Saunders et al. (1990); Johnson (1990) and PCT 90/00434.
Another PCR method employing a mixture of primers is described in
Meltzer et al., Nature--Genetics, 1 (1): 24-28 (April 1992).
[0206] Probe and reporter components of the present invention are
also synthesized by conventional methods on a commercially
available automated DNA synthesizer, e.g. an Applied Biosystems
(Foster City, Calif.) model 380B, 392 or 394 DNA/RNA synthesizer.
Preferably, phosphoramidite chemistry is employed according to,
e.g., Beaucage et al., Tetrahedron, 48:2223-2311 (1992); Molko et
al., U.S. Pat. No. 4,980,460; Koster et al., U.S. Pat. No.
4,725,677; Caruthers et al., U.S. Pat. Nos. 4,415,732; 4,458,066;
and 4,973,679. In preferred embodiments of the present invention,
the probe has a nuclease resistant backbone. Many types of modified
oligonucleotides are available that confer nuclease resistance,
e.g. phosphorothioate, phosphorodithioate, phosphoramidate. For
phosphorothioates, see, e.g., Stec et al., U.S. Pat. No. 5,151,510;
Hirschbein, U.S. Pat. No. 5,166,387; or Bergot, U.S. Pat. No.
5,183,885. For phosphoramidates, see, e.g., Froehler et al.,
International application PCT/US90/03138. In some embodiments it
may be desirable to employ P-chiral linkages, e.g., Stec et al, EPO
92301950.9.
[0207] In several embodiments of the present invention, modified
oligonucleotides are synthesized with internal spacers, commonly
composed of carbon chains, which separate different functional
regions of the oligonucleotide. Generally, spacers derived from
phosphoramidite precursors, such as the carbon chain Spacer
Phosphoramidites C9 or C18 from Glen Research, Inc. (Sterling,
Va.), are preferred so that the modified oligonucleotides of the
invention can be conveniently synthesized with commercial automated
DNA synthesizers, e.g. Applied Biosystems, Inc. (Foster City,
Calif.) model 394.
[0208] Spacer length may vary significantly depending on the nature
of the probe and primer sequence. Preferably, spacer moieties are
synthesized using conventional phosphoramidite and/or hydrogen
phosphonate chemistries. Several phosphoramidite or hydrogen
phosphonate monomers suitable for use in the present invention are
set forth in Newton et al., Nucleic Acid Research, 21:1155-1162
(1993); Griffin et al., J. Am. Chem. Sot., 114:7976-7982 (1992)
Jaschke et al., Tetrahedron Letters, 34:301-304 (1992); Ma et al,
International application PCT/CA92/00423; Zon et al., International
application PCT/US90/06630; Durand et al., Nucleic Acids Research,
18:6353-6359 (1990); and Salunkhe et al., J. Am. Chem. Soc.,
114:8768-8772 (1992).
[0209] There is extensive background literature relating to the
selection of hybridization conditions, labeling procedures, and the
like, which is applicable to the principles and practice of the
present invention. See, e.g. Wallace et al. Nucleic Acids Research
6:3543-3557 (1979); Crothers et al., J. Mol. Biol. 9:1-9 (1964);
Gotoh, Adv. Biophys. 16:1-52 (1983) Wetruer, Critical Reviews in
Biochemistry and Molecular Biology 26:227-259 (1991); Breslauer et
al., Proc. Natl. Acad. Sci. 83:374-3750 (1986); Wolf et al.,
Nucleic Acids Research, 15:2911-2926 (1987); McGraw et al.,
Biotechniques, 8:674-678 (1990).
[0210] Conditions for annealing DNA based probes to DNA or RNA
targets are well known, e.g., Nucleic Acid Hybridization, A
Practical Approach (B. D. Homes, eds.), IRL Press, Washington, D.C.
(1985). In general, whether such annealing or hybridization takes
place is influenced by the length of the probes and the test
substances, the pH, the temperature, the concentration of mono- and
divalent cations, the proportion of G and C nucleotides in the
hybridizing region, the viscosity of the medium and the possible
presence of denaturants. Such variables also influence the time
required for hybridization. The preferred conditions will therefore
depend upon the particular application. Such conditions, however,
can be routinely determined without undue experimentation.
[0211] For the joining of Adapters to probes, the preferred linking
agent is a ligase, such as T4 DNA ligase, using well-known
procedures (Maniatis, T. in Molecular Cloning, Cold Spring Harbor
Laboratory (1982)). Other DNA ligases are also suitable. T4 DNA
ligase may also be used when the test substance is RNA [Engler, M.
J. et al., The Enzymes, Vol. 15, pp. 16-17 (1982), Higgins, N. P.
et al., Methods in Enzymology, Vol. 68, pp. 54-56 (1979)]. Ligases
from thermophilic organisms, e.g. Tth DNA ligase, Gene, Vol. 109,
pp. 1-11 (1991), New England Biolabs, (Beverly, Mass.), and
Ampligase, Epcentre Technologies, Inc. (Madison, Wis.) are
preferred, so that ligation at higher temperatures may be carried
out. The ligation, however, need not be an enzyme and, accordingly,
the linking agent may be a chemical agent which will cause the
probe components to link together. The invention is described using
T4 DNA ligase as the linking agent. This enzyme requires the
presence of a phosphate group on the 5' end of one polynucleotide
and a 3' OH group on the neighboring polynucleotide.
[0212] For covalent joining of probe or reporter components of the
present invention, the preferred cross linking agent is a bi- or
tri-functional psoralen compound such as 4, 5', 8-trimethylpsoralen
which intercalates the bases of hybridized DNA strands and causes
covalent cross linking between them when treated with long wave
ultraviolet light, preferably in the range of 312 to 360
nanometers. Site specific cross-linking can also be facilitated by
synthesizing an oligonucleotide probe component with a terminal
psoralen molecule tethered by a carbon chain. Commercial reagents,
such as C2 psoralen and C6 psoralen from Glen Research, Inc. (San
Diego, Calif.), allow the termination of a synthetic
oligonucleotide with an attached psoralen suitable for inducing
crosslinking with double or triple strand configurations,
respectively, using standard phosphoramidite chemistry on a
automated DNA synthesizer, e.g. Applied Biosystems, Inc. (Foster
City, Calif.) model 394. The durability of complementary
hybridization between probe and reporter components may also be
increased by employing artificial nucleotides; e.g. pdC-CE, pdU-CE,
5-Me-dC, Glen Research, Inc. (Sterling, Va.), which can
significantly raise melt temperature (Tm) by several degrees, and
can diminish non-specific binding of these components.
[0213] The probe and reporter molecules of this invention can be
labeled during PCR amplification in the presence of appropriately
modified dNTPs, or they can be labeled after completion of the PCR
reaction by chemical or enzymatic modification of the PCR products.
When the reporters are constructed of synthetic oligonucleotides,
they can be labeled directly or indirectly by incorporating
modified bases that either carry labeling agents or provide
chemical or immunological means for the attachment of labeling
agents. Alternatively, such reporters may contain secondary linkers
for binding short oligonucleotides that are conjugated to labeling
agents--usually at one end.
[0214] Any of the various labeling techniques, direct or indirect,
may be used to label probes or reporters, including but not limited
to fluorescent chemicals, radioactive materials, chemical haptens,
or enzymatic modifiers. More than one label can be used. Preferred
modified dNTPs include but are not limited to Cy3 or Cy5 labeled
derivatives of dUTP or dCTP, biotin-16-dUTP; digoxigenin-11-dUTP;
biotin derivatives of dATP; fluoresceinated-dUTP; rhodamine labeled
derivatives of dUTP or dCTP; hydroxy coumarin-labeled derivatives
of dUTP; resorufin-11-2'-dUTP, and thiol or amine modified dNTPs,
e.g. amino-allyl-dUTP, Sigma Chemical Co. (St. Louis, Mo.),
Amino-Modifier C6-dT, Glen Research, Inc. (Sterling, Va.). Other
potential labels that may be attached or conjugated to probe or
reporter components include but are not limited to: (1) gold and
silver particles; e.g. monomaleimido Nanogold, LI Silver, etc.,
Nanoprobes, Inc., (Stony Brook, N.Y.); Colloidal Gold, Sigma
Chemical Co. (Saint Louis, Mo.); (2) chemiluminescent or
bioluminescent molecules such as aequorin, e.g. Aqualite, Sealite
Sciences, Inc., (Norcross, Ga.); and (3) agents which can provide
Raman spectrometry signaling such as DNA and histological dyes;
e.g. Methyl green, Cresyl fast violet, Acridine orange, Ponceus S,
Malachite green oxalate, Luxol fast blue, Cresyl violet acetate and
Bromophenol blue; double and or triple bonded chemical labels; e.g.
Chloracetonitrile, Propargyl chloride, 3'Methoxybenzyl chloride and
alpha Bromo p-tolunitrile, Aldrich Chemical Company, Inc.
(Milwaukee, Wis.); and propyne or methyl modified phosphoramidite
nucleosides; e.g. pdC-CE, pdU-CE, 5-Me-dC, Glen Research, Inc.
(Sterling, Va.). The staining intensity achieved with probes or
reporters may be amplified with a variety of systems, including but
not limited to fluorochrome conjugated avidin and/or labeled
antibodies. Similarly, other known detection schemes such as
labeling of probe molecules with enzymes, sulfur or mercury may be
applied in order to suit special experimental conditions.
[0215] Methods for introducing oligonucleotide functionalizing
reagents or to introduce one or more sulfhydryl, amino or hydroxyl
moieties into probe or reporter sequences are described in U.S.
Pat. No. 4,914,210. Such modified nucleotides can provide multiple
signaling sites by incorporating them along the length of the probe
or reporter molecule or at the ends of attached oligonucleotides. A
5' phosphate group can be introduced as a radioisotope by using
polynucleotide kinase and gamma 32P-ATP to provide a reporter
group. Biotin can be added to the 5' end by reacting an
aminothymidine residue, or a 6-amino hexyl residue, introduced
during synthesis, with an N-hydroxysuccinimide ester of biotin.
Labels at the 3' terminus may employ polynucleotide terminal
transferase to add the desired moiety, such as for example,
cordycepin 35S-dATP, and biotinylated dUTP.
[0216] The present invention provides and contemplates the
combination of the novel compositions of matters describe above,
such as the Modified poly-T primers the various adapters and
extenders, and the probe set compositions, wherein different
variations may be created that are not specifically describe
herein. These potential variations and combinations include
modifications of the WRAP-Probe, Amplified-WRAP-Probe, and
Mini-WRAP-Probe methods and their various manifestations thereof,
with various GeneTAG, TinkerTAG or ChipTAG signal amplification
systems. Alternatively, the compositions of matter and methods of
the present invention are contemplated to be employed in
combination with other commercial probe and signaling systems such
as the dendrimers of Polyprobe, Inc. (Media, Pa.) [U.S. Pat. No.
5,487,973] and the branch DNA (bDNA) components of Chiron Corp.
(Emeryville, Calif.) [U.S. Pat. No. 5,124,246].
[0217] The probes and reporters of the present invention can be
employed as diagnostic or drug discovery assays for a wide range of
biomedical samples, including detection of nucleic acids and gene
expression profiles in human diagnostics, forensics, and genomic
analyses. See, e.g., Schena et al., Science, 270: 467-470 (1995);
Schena, et al., Proc. Natl. Acad. Sci., 93:10614-9 (1996); Shalon
et al., Genome Res., 6: 639-45 (1996); DeRisi et al., Nature
Genetics, 14: 457-60, (1996); Heller et al., Proc. Natl. Acad.
Sci., 94: 2150-5, (1997); Khan et al., Cancer Res., 58: 5009-13
(1998); Khan et al., Electrophoresis, 20: 223-9 (1999); Caskey,
Science 236:1223-1228 (1987); Landegren et al. Science, 242:229 237
(1988); and Arnheim et al., Ann. Rev. Biochem., 61:131-156 (1992).
Other diagnostic applications of the present invention include
samples from the environment, e.g. from public water supplies,
samples from foodstuffs, and from other biological or clinical
samples, such as blood, saliva, lung sputum, semen, buccal smears,
urine or fecal waste, cell and tissue biopsies and micro
dissections, amniotic fluid, or tissue homogenates of plants,
animals, or human patients, and the like.
[0218] The compositions and methods of the present invention can be
readily employed in a variety of membrane formats such as
expression macro and microarrays, dot blots, and Northern blots; in
gels such as agar or polyacrylamide; in a variety of in situ
formats to detect or map genes or RNA transcripts in sectioned
tissue and tissue microarrays; in cultures or microwell plates to
detect infectious microorganisms or unbound DNA fragments extracted
from bodily fluids or wastes; and in various solid substrate chip
formats that detect genes, mutations or mRNA expression levels,
including but not limited to oligonucleotide microarrays, cDNA
microarrays, and molecular detection chips employing fluorescence,
radioactivity, optical interferometry, Raman spectometry or
semi-conductor electronics.
EXAMPLES
Example 1
Sample Molecular Compositions of the Present Invention
[0219] Universal GeneTAG Linkers:
[0220] 1. Red 5'CTACGATACGATAGCGCCTAAGAGTAG (Seq. ID. No. 1) and
its complement.
[0221] 2. Green 5'CCTAGACCTACGACATAGGTACCCTAC (Seq. ID. No. 2) and
its complement.
[0222] 3. Blue 5'CGTAGAACTAGCACGCTACGTACTAGG (Seq. ID. No. 3) and
its complement.
[0223] 4. Orange 5'GGCTATCGCTACGTAGACTAGACCTAC (Seq. ID. No. 4) and
its complement.
[0224] Modified Poly-T Primer with red or green universal linker
and anchor end:
TABLE-US-00001 (Seq. ID. No. 1, 5) 1.
5'CTACGATACGATAGCGCCTAAGAGTAG-TTTTTTTTTTTTTTTVN (Seq. ID. No. 2, 5)
2. 5'CCTAGACCTACGACATAGGTACCCTAC-TTTTTTTTTTTTTTTVN
[0225] Double-Linker WRAP-Probe Set 1: Showing one probe strand
with Red and Blue Universal Linkers, and with the variable target
sequence indicated by S1 . . . Sn (Seq. ID. No. 1, 6)
[0226] 5'CTACGATACGATAGCGCCTAAGAGTAG-S1 . . .
Sn-CCTAGTACGTAGCGTGCTAGTTCTACG
[0227] Double-Linker WRAP-Probe Set 2: Showing one probe strand
with Green and Orange Universal Linkers, and with the variable
target sequence indicated by S1 . . . Sn (Seq. ID. No. 2, 7)
[0228] 5'CCTAGACCTACGACATAGGTACCCTAC-S1 . . .
Sn-GTAGGTCTAGTCTACGTAGCGATAGCC
[0229] Specific Adapter:
[0230] Version with Blue Universal Linker: a first polynucleotide
with blue linker, an overhang specific to a restriction enzyme cut
site (indicated by S1 . . . Sn), and a second complementary
polynucleotide preferably 5'phosphorylated: (Seq. ID. No. 3, 6)
[0231] 5'CGTAGAACTAGCACGCTACGTACTAGG-S1 . . . Sn
[0232] 5'P-CCTAGTACGTAGCGTGCTAGTTCTACG
[0233] Version with Orange Universal Linker and label: (Seq. ID.
No. 4, 7)
[0234] 5'GGCTATCGCTACGTAGACTAGACCTAC-S1 . . . Sn
[0235] 5'P-GTAGGTCTAGTCTACGTAGCGATAGCC-LABEL
[0236] Random Adapter: Version with Blue Universal Linker: a first
polynucleotide with blue linker, a random overhang sequence,
typically of 2N's (indicated by N1 . . . Nn), and a second
complementary polynucleotide preferably 5' phosphorylated:
TABLE-US-00002 (Seq. ID. No. 3, 6) 5'CGTAGAACTAGCACGCTACGTACTAGG-N1
. . . Nn 5'P-CCTAGTACGTAGCGTGCTAGTTCTACG
[0237] Random End-Linker (random extender): Version with Blue
Universal Linker: Showing a polynucleotide with Blue linker
sequences, a random overhang sequence, typically of 6 to 9N's
(indicated by N 1 . . . Nn), and a blocked 3' end. (Seq. ID. No.
3)
[0238] 5'CTACGATACGATAGCGCCTAAGAGTAG-N1 . . . Nn-block
[0239] Homopolymeric Adapter Version with Blue Universal Linker:
Showing a first polynucleotide with Blue linker sequences and a
poly-C or poly-G sequence (indicated by C1 . . . Cn), and a second
polynucleotide which is complementary to the first nucleotide and
preferably 5' phosphorylated: (Seq. ID. No. 3, 6)
[0240] 5'CGTAGAACTAGCACGCTACGTACTAGG-C1 . . . Cn
[0241] 5'P-CCTAGTACGTAGCGTGCTAGTTCTACG
[0242] Homopolymeric extender: Version with Blue Universal Linker:
Showing a polynucleotide with Blue linker sequences and a poly-C or
poly-G sequence (indicated by C1 . . . Cn): (Seq. ID. No. 3)
[0243] 5'CGTAGAACTAGCACGCTACGTACTAGG-C1 . . . Cn
[0244] Labeled ChipTAG Primers:
[0245] Red and Blue Linker/Primers with Cy5 fluor.
TABLE-US-00003 (Seq. ID. No.1) Red
5'-cy5-CTACGATACGATAGCGCCTAAGAGTAG (Seq. ID. No.3) Blue
5'-cy5-CGTAGAACTAGCACGCTACGTACTAGG
[0246] Green and Orange Linker/Primers with Cy3 fluor.
TABLE-US-00004 (Seq. ID. No.2) Green
5'-cy3-CCTAGACCTACGACATAGGTACCCTAC (Seq. ID. No.4) Orange
5'-cy3-GGCTATCGCTACGTAGACTAGACCTAC
Example 2
One-Linker WRAP-Probe Method
[0247] Total RNA is extracted from A549 lung cancer cells by
standard methods. Reverse transcriptase (RT) is then employed to
copy the mRNA transcripts to cDNA using a Modified poly-T Primer
known as R-GT-RTP (Seq. ID. No. 8) having a 3' end of 15 poly-T's
and a 5' end with a universal linker sequence that is similar to
but differing in part from the Red Universal Linker of Example 1.
For a comparative sample an alternative Modified poly-T Primer,
known as G-GT-RTP (Seq. ID. No. 9) is used for the RT reaction to
provide a second universal linker sequence wherein those sequences
are also similar to but differing in part from the Green universal
linker of Example 1.
[0248] The Examples 2 through 7 use these earlier versions of the
red and green universal linkers in all their products, and thus the
text of those Examples identifies them differently with the terms
First-RED and First-GREEN in the descriptions to identify these
sequence differences.
[0249] For a 25 ul reaction, 40 micrograms of A549 RNA was combined
with 2 ul of 100 picomol/ul R-GT-RTP (Seq. ID. No. 8), 10.times.PCR
buffer II, 25 mm MgCl.sub.2, 1 ul each of 10 mM dATP, dGTP and
dTTP, 6 ul of 1 mM dCTP, 3 ml of 1 mM Cy3 dCTP (AP Biotech), and
dH2O, and the mixture was placed in a 70 degrees C. waterbath for
10 min and allowed to cool at room temperature for 5 min. Then 50
units of MuVL reverse transcriptase enzyme (Perkin Elmer) was added
along with 20 units of RNase inhibitor (Perkin Elmer) and the
mixture was incubated at 42 degrees C. for 1 hour. The product was
purified with a Centri-Sep spin column (Princeton Separations).
[0250] Type I GeneTAGs with a First-RED linker on the proximal end
and Type II GeneTAGs with a First-GREEN linker on the proximal end
were made and both types were labeled "red" with Cy5-dCTP by PCR
amplification of an arbitrary MTB template, 600 bp long, using 2 ul
of 0.25 ug/ul of template. The primers employed for Type I GeneTAGs
are RR-SPC-F (SEQ ID NO. 10, 11) and GR-SPC-R: (SEQ ID NO. 12, 13)
using 2 ul each at 10 pmol/ul. The primers employed for Type II
GeneTAGs are GR-SPC-F: (SEQ ID NO. 14, 11) and RR-SPC-R: (SEQ ID
NO. 15, 13) using 2 ul each at 10 pmol/ul. The internal spacers are
identified as 99 indicating two C9 phosphoramidite spacers (Glen
Research). Fluorescent labeling is accomplished during PCR
amplification of the reporters wherein nucleotides are added with
low dCTP (6 ul of 1 mM) plus normal dATP, dTTP and dGTP (1 ul each
of 10 mM) plus 3 ul of 25 uM Cy5-dCTP. Taq, 10.times. buffer and
dist. H2O were added and the mixture cycled 40 times at 94 degrees
C., 55 degrees C. and 72 degrees C. for about 1 min per step. The
products were purified twice with a Centri-Sep spin column.
[0251] The probes were hybridized overnight at 65 degrees C. to
cDNA chips arrayed on poly-L-lysine coated glass slides with a
Genetic Microsystems spotter using 5 ul of probe mixed with 7 ul of
hybridization buffer, said buffer consisting of 3.5.times.SSC and
0.2% SDS and containing Cot 1 DNA, poly-A RNA, and tRNA. Each gene
location on these chips are duplicated 5 times in vertical columns.
After a brief wash with hybridization buffer, GeneTAGs were
hybridized for an additional 2 hours under the same conditions. The
chips were gently washed for 5 min each in three steps: 1)
2.times.SSC, 0.1% SDS, 2) 1.times.SSC, and 3) 0.1.times.SSC.
TABLE-US-00005 GeneTAG Modified Poly-T Primers: a) First-RED Linker
version R-GT-RTP (Seq. ID. No. 8) 5'
CTACGATACGATAGGGCCTAAGAGTAG-TTTTTTTTTTTTTTT b) First-GREEN Linker
version G-GT-RTP (Seq. ID. No. 9) 5'
GCCTAGACCTAGGGGTAGCTAGGCTAC-TTTTTTTTTTTTTTT Type I GeneTAG Spacer
Oligomers: a) Proximal Spacer Oligomer RR-SPC-F: (SEQ ID NO. 10,
11) 5' CTACTCTTAGGCCCTATCGTATCGTAG--99-- CCAGGGTTTTCCCAGTCACGAC b)
Distal Spacer Oligomer GR-SPC-R: (SEQ ID NO. 12, 13) 5'
GCCTAGACCTAGGGGTAGCTAGGCTAC--99-- GAGCGGATAACAATTTCACACAGG Type II
GeneTAG Spacer Oligomers: a) Proximal Spacer Oligomer GR-SPC-F:
(SEQ ID NO. 14, 11) 5' GTAGCCTAGCTACCCCTAGGTCTAGGC--99--
CCAGGGTTTTCCCAGTCACGAC b) Distal Spacer Oligomer RR-SPC-R: (SEQ ID
NO. 15, 13) 5' CTACGATACGATAGGGCCTAAGAGTAG--99--
GAGCGGATAACAATTTGACACAGG
[0252] The chips are scanned with a Genetic Microsystems laser
scanner and produce two gene expression profiles from the "green"
channel and the "red" channel showing, respectively, differential
signaling with both the labeled probes and with the labeled
GeneTAGs bound to the probes. Since each gene target arrayed on
these chips is duplicated in vertical columns five times, it is
easy to see and confirm true differences in gene expression between
genes. Approximately 20 gene locations on the chip show highly
significant "green" labeling indicating specific gene expression
levels for these cells, and approximately 200 gene locations showed
significant "red" labeling indicating additional gene expression
labeling provided by the GeneTAGs bound to the probes. Labeling
intensity varies per each vertical set of gene targets for both the
green and red channels indicating gene expression monitoring. See
FIGS. 6A and B.
Example 3
Double-linker WRAP-Probe Method with Restriction Cutting and
Adapter Ligation
[0253] Total RNA was extracted from A549 lung cancer cells by
standard methods. A 40 ug sample was treated with reverse
transcriptase (RT) and a Modified Poly-T Primer to make ds cDNA
copies of the mRNAs with a first linker, to cut and capture the end
fragments, and to add a second linker by ligating an adapter. The
following steps were employed to make the probes and perform a chip
analysis:
[0254] 1. Full length first strand cDNAs were made with one hour
exposure to MuVL RT (Gibco) at 37 degrees C. using a Modified
Poly-T Primer (Seq. ID. No. 16) having a 5' biotin capture moiety,
an overlap linker sequence and a poly-T segment. Nucleotides
including Cy3-dCTP (AP Biotech) were incorporated as described
above to provide "green" labeling.
[0255] 2. Double stranded cDNA was made with E. coli DNA polymerase
I, Rnase H and DNA ligase (Gibco kit) with a two hour exposure at
16 degrees C.
[0256] 3. The ds cDNAs were treated with the restriction enzyme Nla
III (New England Nuclear) for 7 hours at 37 degrees C. and purified
twice with Centi-Sep spin columns.
[0257] 4. The end fragments were captured with 10 mg
strepavidin-coated magnetic beads (Dynal).
[0258] 5. A pre-annealed First-RED Specific Adapter (Seq. ID. No.
17, 18) was prepared and ligated to the fragments with T4 DNA
ligase (Boehringer Mannheim) for 30 min. at 37 degrees C. providing
a first 5'First-RED Linker sequence.
[0259] 6. The adapter modified fragments were again captured on
magnetic beads, denatured with 0.2 M NaOH, and the eluted probes
retained and neutralized.
[0260] 7a. In part of the sample, a two part overlap linker (Seq.
ID. No. 19) was annealed and cross linked to the ss probes to form
a second 5'First-RED-Linker. Such probes are double-linker WRAP
probes.
[0261] 7b. Another part of the sample was instead used as templates
for amplifying and labeling the probes by PCR. In this case,
amplification was initially accomplished with a set of primers
consisting of a first primer, which is the First-RED version of
GeneTAG Modified Poly-T Primer used above (Seq. ID. No. 8), (this
binds to the poly-A segment of the sense cDNA), and of a second
primer, which is the First-RED Linker-primer (Seq. ID. No. 20)
which contains the same sequences as the 5' end of the first
primer. PCR is conducted for 10 cycles at 94 degrees 30', 48
degrees 30' and 72 degrees 45'. Then PCR amplification is repeated
for 30 cycles using only the GeneTAG First-RED primer.
Alternatively, in step 5 above a pre-annealed First-GREEN Specific
Adapter (Seq. ID. No. 21, 22) could be employed for ligation to the
cut sites, and thus, the resulting probes could be PCR amplified
with the First-GREEN Modified Poly-T Primer (Seq. ID. No. 9). and a
First-GREEN primer (Seq. ID. No. 23) in the same manner as
described above using the First-RED compositions. Furthermore, the
above GeneTAG First-GREEN or First-RED compositions could be
employed together such that one primer would employ the First-GREEN
linker/primer sequence and the other would employ the First-RED
linker/primer sequence.
[0262] The resulting WRAP-Probes from step 7b. above were
hybridized to cDNA chips overnight and then treated for 2 hours
with Type III GeneTAGs previously labeled "red" with Cy5-dCTP (AP
Biotech) as described in Example 2. Type III GeneTAGs have a
proximal linker which binds to the First-RED Linker sequences of
the WRAP-Probes and two distal linkers that bind to the proximal
linker of Type IV GeneTAGs. The chips are washed once and then Type
IV GeneTAGs are applied for two additional hours. The chips are
then washed three times as described in Example 2 above. These
chips are similarly prepared with vertical duplications of
different gene targets, but in this case, four sets of targets vs.
five sets of targets are represented in the vertical columns. The
chips are scanned with a Genetic Microsystems scanner showing
differential labeling with the probes and the GeneTAGs as described
above. See FIGS. 7 and 8. This approach produces more extensive
labeling with two layers of GeneTAGs.
TABLE-US-00006 GeneTAG Components: Modified RT primer (Seq. ID. No.
16) 5' biotin-CGACTACCTATCTAC-TTTTTTTTTTTTTTT First-RED GeneTAG
Adapter part 1: (Seq. ID. No. 17) 5'
CTACGATACGATAGGGCCTAAGAGTAG-CATG First-RED GeneTAG Adapter part 2:
(Seq. ID. No. 18) 5' CTACTCTTAGGCCCTATCGTATCGTAG Overlap Linker
(Seq. ID. No. 19) 5' CTACGATACGATAGGGCCTAAGAGTAG-CGACTACCTATCTAC
GeneTAG First-RED Primer: (Seq. ID. No. 20) 5'
CTACGATACGATAGGGCCTAAGAGTAG First-GREEN Specific Adapter part 1:
(Seq. ID. No. 21) 5' GCCTAGACCTAGGGGTAGCTAGGCTAC-CATG First-GREEN
Specific Adapter part 2: (Seq. ID. No. 22) 5'
GTAGCCTAGCTACCCCTAGGTCTAGGC GeneTAG First-GREEN Primer: (Seq. ID.
No. 23) 5' GCCTAGACCTAGGGGTAGCTAGGCTAC b) First-GREEN Linker
version G-GT-RTP (Seq. ID. No. 9) 5'
GCCTAGACCTAGGGGTAGCTAGGCTAC-TTTTTTTTTTTTTTT Type III GeneTAG Spacer
Oligomers: a) Proximal Spacer Oligomer RR-SPC-F: (SEQ ID NO. 10,
11) 5' CTACTCTTAGGCCCTATCGTATCGTAG--99-- CCAGGGTTTTCCCAGTCACGAC b)
Distal Spacer Oligomer GR-SPC-R: (SEQ ID NO. 12, 12, 13) 5'
GCCTAGACCTAGGGGTAGCTAGGCTAC-- GCCTAGACCTAGGGGTAGCTAGGCTAC--99--
GAGCGGATAACAATTTCACACAGG Type IV GeneTAG Spacer Oligomers: a)
Proximal Spacer Oligomer GR-SPC-F: (SEQ ID NO. 14, 11) 5'
GTAGCCTAGCTACCCCTAGGTCTAGGC--99-- CCAGGGTTTTCCCAGTCACGAC b) Distal
Spacer Oligomer RR-SPC-R: (SEQ ID NO. 15, 15, 13) 5'
CTACGATACGATAGGGCCTAAGAGTAG-- CTACGATACGATAGGGCCTAAGAGTAG--99--
GAGCGGATAACAATTTCACACAGG
Example 4
WRAP-Probe Method with Restriction Cutting, Adapter Ligation and
ChipTAG Labeling
[0263] A 10 microliter probe sample from Step 7b. of Example 3
above was re-amplified by PCR and applied to chips as described in
Examples 2 and 3 above. However, in this case the First-RED ChipTAG
primer (Seq. ID. No. 24) was employed as a single primer to
globally amplify all probe products. Furthermore, internal labeling
was not employed, and thus bound labeling was achieved from a
single Cy5 fluor being attached to the 5' end of each single
stranded probe component. Additionally, after PCR and before
hybridization was conducted, an additional 0.2 microliter aliquot
of First-RED ChipTAG primer at a concentration of 100
picomoles/microliter was added to the sample of purified probes.
Since these added primers are labeled and they are capable of
binding to the 3' linker end of each bound probe, they can provide
additional signaling per probe. For two color comparisons, an
additional ChipTAG with the First-GREEN sequences (Seq. ID. No. 25)
can be employed to provide PCR amplified probes with a single Cy3
label per amplified product. These chips also used vertical
duplications of the gene targets arrayed, and in this case, four
duplications were again employed for each column of targets. See
FIG. 9.
TABLE-US-00007 First-RED ChipTAG Primer (Seq. ID. No. 24) 5'
Cy5-CTACGATACGATAGGGCCTAAGAGTAG First-GREEN ChipTAG Primer (Seq.
ID. No. 25) 5' Cy3-GCCTAGACCTAGGGGTAGCTAGGCTAC
Example 5
WRAP-Probe Method with Short RT and Random End-Linker
[0264] Step 1: Samples of poly-A mRNA from mouse liver of controls
and ANT-1 knockouts were employed to prepare probes for expression
microarrays or chips. In each case 50 nanograms of poly-A mRNA were
treated with GeneTAG RT primers in a brief RT reaction of 30
seconds using 1 ug of G-GT-RTP at 100 pmol/ul added to a 20 ul
reaction. These RT reactions used Superscript II RT and 5.times. RT
buffer (Gibco kit), dNTPs, and 0.1 M DTT and no labeling reagents.
First the template and primer were combined in H2O for 5 min at 72
degrees C. and then placed on ice for 10 min. Thereafter, the
enzyme, buffer, dNTPs and DTT were added, maintained at 42 degrees
C. for 30 sec, and the reaction was stopped again on ice. The
product was treated for 15 min at 75 degrees C. to inactivate the
enzyme. The products were purified by Centri-Sep spin columns. This
sub-procedure adds a first linker/primer site to the 5' ends of the
cDNA probes and terminates RT copying prematurely to normalize the
lengths of the probes.
[0265] Step 2: The above Control and ANT-1 samples were added to
separate 30 ul reactions containing 100 picomoles of the
First-GREEN version GeneTAG Random End-Linker (Seq. ID. No. 26),
plus 10.times.PCR buffer, dNTPs, Taq polymerase and dH2O. The
GeneTAG End-Linkers are 3' modified to prevent forward copying.
Because of this modification, they are only effective in this
reaction if they bind partially to the 3' end of the probes via the
random segment and serve as a template to back extend the probes
with a GeneTAG linker/primer sequence. PCR thermal cycling is then
performed at 94 degrees C. for 10 sec, 42 degrees C. for 30 sec,
and 72 degrees for 10 sec, for a total of 198 cycles. The products
are purified with spin columns. This sub-procedure commonly extends
the 3' ends of the probes with the First-GREEN GeneTAG linker
sequence providing a second linker/primer site. In alternate
preparations, the First-RED version GeneTAG End-Linker (Seq. ID.
No. 27) is employed to put a First-RED GeneTAG linker sequence on
the 3' end. The N's listed in the End-Linker sequences below
indicate bases which are randomly incorporated during
oligonucleotide synthesis as either A, T, G, or C.
[0266] Step 3: The above Control and ANT-1 samples are again
subjected to PCR cycling, but this time with conditions allowing
the exponential amplification and labeling of the probes using the
double-linker sites as primer sites. The samples are added to 100
ul PCR reactions containing 100 picomoles of the GeneTAG
First-GREEN primer (Seq. ID. No. 23), 10.times.PCR buffer, Taq
polymerase, and 16 ul of a mix of dNTPs with amino-allyl dUTP
(Sigma) [wherein the stock mix contains 4 ul 100 mM AA-dUTP, 6 ul
100 mM dTTP, 10 ul 100 mM dATP, 10 ul 100mM dCTP, 10 ul 100 mM dGTP
and 760 ul dH2O]. PCR thermal-cycling is performed at 94 degrees C.
for 30 sec, 48 degrees C. for 1 min, and 72 degrees for 30 sec, for
a total of 40 cycles.
[0267] The probes are purified with Microcon-30 columns and dried
in a SpeedVAC. The amino-conjugated bases of the Control probes are
then coupled to Cy3 dye and the amino-conjugated bases of the ANT-1
probes are coupled to Cy5 dye using Cy3 or Cy5 monofunctional
reactive dye packs from APBiotech. Before mixing the samples, the
reactions are quenched with hydroxylamine to prevent cross
coupling. Unincorporated or quenched Cy dyes are removed by
purification with QiaQuick columns (Qiagen) and the labeled probes
are concentrated by drying with a SpeedVAC. The probes were
combined and one fifth the resulting sample was hybridized to mouse
expression microarrays at 65 degrees C. for 16 hrs in 3.5.times.SSC
plus 2% SDS and washed as described above. This sampling is
essentially equivalent to starting with 10 nanograms of poly-A mRNA
per sample. This procedure gave very short probes with limited chip
signaling suggesting the need to reduce hybridization temperature
and increase RT timing.
TABLE-US-00008 "First-GREEN" GeneTAG Random End-Linker (Seq. ID.
No. 26) 5' GCCTAGACCTAGGGGTAGCTAGGCTAC--NNNNNNNNN--99 "First-RED"
GeneTAG Random End-Linker (Seq. ID. No. 27) 5'
CTACGATACGATAGGGCCTAAGAGTAG--NNNNNNNNN--99
Example 6
WRAP-Probe Method with Short RT and Random End-Linker (Membrane
Arrays)
[0268] The Short RT and Random End-Linker method was more effective
with longer RT extension periods. The following examples were
prepared from experiments with human monocytes (derived from Red
Cross buffy coat preps) to compare Control monocytes and IL-13
Treated monocytes.
[0269] Step 1: Essentially the same procedures from Step 1 of
Example 5 above were employed except that the starting samples
consisted of 1 microgram of total RNA per sample and the RT
reaction for the Control RNA used the First-GREEN Modified Poly-T
Primer (Seq. ID. No. 9) while the RT reaction for the IL-13 Treated
RNA used the First-RED Modified Poly-T Primer (Seq. ID. No. 8). The
RT reactions of 20 microliters contained 100 picomoles of GeneTAG
Modified Poly-T Primer, 1 ul RT enzyme (SuperScript II) and 4 ul
5.times.buffer (Gibco kit), 1 ul dNTPs, 2 ul 0.1 M DTT and dH2O.
The primers and RNA templates were mixed at 72 degrees C. for 5
min, and then the enzyme and other components were added and
maintained at 42 degrees C. for various Short RT times of either 2,
5, 10 or 20 minutes, followed by 75 degree C. treatment for 15 min
to stop the cDNA copying reaction prematurely from all transcripts
regardless of gene specific differences in transcript length. The
products were purified with Bio-Spin P-30 chromatography columns
(Bio-Rad).
[0270] Step 2: This multi-cycle step was performed essentially the
same as in Example 5 above except that the Control samples employed
the First-GREEN Random End-Linker (Seq. ID. No. 26) while the IL-13
Treated samples employed the First-RED Random End-Linker (Seq. ID.
No. 27). Thus the Control probes would have First-GREEN
linker/primer sites at both ends while the IL-13 Treated probes
would have First-RED linker/primer sites at both ends.
[0271] Step 3: This step was performed essentially the same as in
Example 5 above except that the probes from the 20 min Short RT
procedure were labeled with P-32 dCTP vs. fluorescence, and
furthermore, the Control probes were amplified by PCR using the
GeneTAG First-GREEN primer (Seq. ID. No. 20), and the IL-13 Treated
probes were PCR amplified with the GeneTAG First-RED primer (Seq.
ID. No. 23). For 100 ul reactions, 30 ul of probe template was
employed with 100 picomoles of First-GREEN or First-RED for a total
of 30 PCR cycles. Both products were purified, counted and adjusted
to yield probes with an activity of one million cpm/ml.
[0272] Nylon membranes were arrayed with 10 gene target samples
that were arranged in vertical columns of five slot blots per
column. Each membrane of approximately 6 by 10 cm duplicated this
10 gene array pattern twice in a side by side arrangement. Each dot
contained 200 nanograms each of plasmid cDNA from 6 candidate and 4
control targets: candidates: 5-LO, 12-LO, FLAP, COX-1, COX-2,
15-LO, controls: Leptin, TNF-alpha, yeast and h-Actin. The target
samples were denatured with 0.1 N NaOH, neutralized with Tris-HCl
buffer, and UV crosslinked. Membranes were prehybridized for 4
hours in rotating roller bottles with 20 ml of hybridization
solution (Rapid-hyb buffer, Amersham Life Science). The labeled and
amplified probes were then added for overnight hybridization at 48
degrees C. with the same solutions, and then they were washed
sequentially with 2.times.SSC and 0.1% SDS for 15 min,
0.2.times.SSC for 15 min 2 times, and 0.1.times.SSC for 15 min also
at 48 degrees C. Expression profiling was obtained by exposing
x-ray film for 12 hours. The repeated patterns evident within
membranes also differed slightly between control and IL-13 treated
monocytes, and as expected, IL-13 treatment up-regulated the
expression activity of 15-LO. See FIG. 10.
Example 7
Amplified Wrap-Probe Method with Short RT and Random Adapter (on
Membrane Arrays)
[0273] The same samples prepared for Example 6 above were also
employed for an alternate method of attaching the second
linker/primer sequence with a ligated GeneTAG Adapter. In these
experiments, the PCR extension time was also increased from 30 sec
to 1.5 min to allow more representation of the longer RT products
in the sample of amplified probes. This change also shifts the
sampling that will appear on the chip. Since all prior methods for
expression microarrays are biased in signaling relative to probe
length, further study is needed to determine which profiling
pattern will prove to be more accurate.
[0274] Step 1: Essentially the same procedures from Step 1 of
Example 6 were employed with starting samples consisting of 1
microgram of total RNA per sample. All samples were from monocyte
controls and the RT reactions used the First-GREEN Modified Poly-T
Primer (Seq. ID. No. 9) to produce the first linker/primer site.
Alternatively, the First-RED Modified Poly-T Primer (Seq. ID. No.
8) could be employed for other comparisons. Short RT was conducted
as described above with reduced RT exposure times of 2, 5, 10 or 20
minutes.
[0275] Step 2: This step was performed quite differently from that
of Example 4 above since, in this case, the second linker/primer
site was affixed to the 3' ends of the probes by direct ligation of
First-GREEN Random Adapters. These random Adapters are composed of
two oligonucleotides that are annealed together and of which one
component provides a two base overhang of random sequences. These
Random Adapters consist of a first oligonucleotide with First-GREEN
linker sequences on the 5`end and two N`s on the 3' end (Seq. ID.
No. 28), and of a second oligonucleotide (Seq. ID. No. 29) with
sequences complementary to the First-GREEN linker sequences and
with the 5' end phosphorylated during synthesis to facilitate
ligation. In alternate preparations, a First-RED version of such
Adapters could be employed which is made of a first oligonucleotide
with First-RED linker sequences on the 5' end and two N's on the 3'
end (Seq. ID. No. 30), and of a second oligonucleotide (Seq. ID.
No. 31) with sequences complementary to the First-RED linker
sequences. For this preparation, the two Random Adapter
oligonucleotides were mixed together at a concentration of 100
picomoles/ul per product and then annealed for 2 hours at 37
degrees C. with 10 percent 10.times.PCR buffer and dH2O. This
product was chilled on ice and stored at -20 degrees C. Samples
treated by Step 1 above were combined with said Random Adapters in
a 30 ul reaction consisting of 20 ul of probe template, 1 ul of
Adapter, then 2 ul of T4 ligase and 6 ul of 5.times. Ligation
buffer (Gibco kit) and dH2O. This ligation was conducted at 16
degrees C. overnight, but alternatively could be accomplished at 37
degrees C. for one hour. This reaction joins the Random Adapter to
the 3' end of the probes creating a second linker/primer site.
[0276] Step 3: The probes can be amplified and labeled by PCR with
standard methods. However, in this case two stages of amplification
were employed. First, a 100 ul reaction of 20 cycles is conducted
with 10 ul of probe product (after Adapter ligation), 1 ul of
First-GREEN Linker (Seq. ID. No. 23) at 100 pmols/ul, 10 ul of
10.times.PCR buffer, 8 ul of dNTPs, 1 ul of Taq polymerase and
dH2O. Then 10 ul of the above reaction is again amplified in a
second PCR reaction of 100 ul for 30 cycles using 5 ul of P-32 dCTP
(NEN Dupont) plus 1 ul of 1 mM dCTP, and 1 ul each of 10 mM DATP,
dTTP and dGTP. Both reactions are thermocycled at 94 degrees C. 30
sec, 55 degrees C. 1 min, and 72 degrees C. for 1.5 min. The probes
are purified by Centri-Sep spin column and applied to the membranes
as described in Example 5 using pre-hybridization, hybridization
and washing as indicated above. This procedure labels the probes
internally. See FIG. 11. These results show that 2 min, 5 min and
10 min Short RT yield effective and relatively similar probe
products and expression profiles while 20 min Short RT yields a
relatively weaker set of products.
TABLE-US-00009 First-GREEN Random Adapter part 1 (Seq. ID. No. 28)
5' GCCTAGACCTAGGGGTAGCTAGGCTAC--NN First-GREEN Random Adapter part
2 (Seq. ID. No. 29) 5' GTAGCCTAGCTACCCCTAGGTCTAGGC First-RED Random
Adapter part 1 (Seq. ID. No. 30) 5' CTACGATACGATAGGGCCTAGAGTAG--NN
First-RED Random Adapter part 2 (Seq. ID. No. 31) 5'
CTACTCTTAGGCCCTATCGTATCGTAG
[0277] Throughout this application, various publications may have
been referenced. The disclosures of these publications in their
entireties are hereby incorporated by reference into this
application in order to more fully describe the state of the art to
which this invention pertains.
[0278] The embodiments described above are given as illustrative
examples only. It will be readily appreciated that many deviations
may be made from the specific embodiments disclosed in this
specification without departing from the invention. Accordingly,
the scope of the invention is to be determined by the claims below
rather than being limited to the specifically described embodiments
above.
Sequence CWU 1
1
31127DNAArtificial sequenceNucleotide sequence of a red universal
linker 1ctacgatacg atagcgccta agagtag 27227DNAArtificial
sequenceNucleotide sequence of a blue universal linker 2cctagaccta
cgacataggt accctac 27327DNAArtificial sequenceNucleotide sequence
of a green universal linker 3cgtagaacta gcacgctacg tactagg
27427DNAArtificial sequenceNucleotide sequence of an orange
universal linker 4ggctatcgct acgtagacta gacctac 27517DNAArtificial
sequencerandom_base16...17Modified poly-T primer; v=a, c, or g at
position 16; n=a, c, g, or t at position 17 5tttttttttt tttttvn
17627DNAArtificial sequenceNucleotide sequence of a blue universal
linker 6cctagtacgt agcgtgctag ttctacg 27727DNAArtificial
sequenceNucleotide sequence of an orange universal linker
7gtaggtctag tctacgtagc gatagcc 27842DNAArtificial
sequenceNucleotide sequence of a red universal linker modified with
a Poly-T primer 8ctacgatacg atagggccta agagtagttt tttttttttt tt
42942DNAArtificial sequenceNucleotide sequence of a green universal
linker modified with a Poly-T primer 9gcctagacct aggggtagct
aggctacttt tttttttttt tt 421027DNAArtificial sequenceprimerProximal
spacer oligomer RR-SPC-F 10ctactcttag gccctatcgt atcgtag
271122DNAArtificial sequenceprimerProximal spacer oligomer RR-SPC-F
11ccagggtttt cccagtcacg ac 221227DNAArtificial sequenceprimerDistal
spacer oligomer GR-SPC-F 12gcctagacct aggggtagct aggctac
271324DNAArtificial sequenceprimerDistal spacer oligomer GR-SPC-F
13gagcggataa caatttcaca cagg 241427DNAArtificial
sequenceprimerProximal spacer oligomer GR-SPC-F 14gtagcctagc
tacccctagg tctaggc 271527DNAArtificial sequenceprimerDistal spacer
oligomer RR-SPC-R 15ctacgatacg atagggccta agagtag
271630DNAArtificial sequenceprimerModified RT primer 16cgactaccta
tctacttttt tttttttttt 301731DNAArtificial sequenceNucleotide
sequence of a first-red primer with GeneTAG adapter part 1
17ctacgatacg atagggccta agagtagcat g 311827DNAArtificial
sequenceNucleotide sequence of a first-red primer with GeneTAG
adapter part 2 18ctactcttag gccctatcgt atcgtag 271942DNAArtificial
sequenceNucleotide sequence of an overlap linker 19ctacgatacg
atagggccta agagtagcga ctacctatct ac 422027DNAArtificial
sequenceprimerNucleotide sequence of a GeneTAG first-red primer
20ctacgatacg atagggccta agagtag 272131DNAArtificial
sequenceNucleotide sequence of a first-green primer with specific
adapter part 1 21gcctagacct aggggtagct aggctaccat g
312227DNAArtificial sequenceNucleotide sequence of a first-green
primer with specific adapter part 2 22gtagcctagc tacccctagg tctaggc
272327DNAArtificial sequenceprimerNucleotide sequence of a GeneTAG
first-green primer 23gcctagacct aggggtagct aggctac
272427DNAArtificial sequenceprimerNucleotide sequence of a ChipTAG
first-red primer 24ctacgatacg atagggccta agagtag
272527DNAArtificial sequenceprimerNucleotide sequence of a ChipTAG
first-green primer 25gcctagacct aggggtagct aggctac
272636DNAArtificial sequencerandom_base28...36Nucleotide sequence
of a first-green GeneTAG random end linker; n=a, c, g, or t
26gcctagacct aggggtagct aggctacnnn nnnnnn 362736DNAArtificial
sequencerandom_base28...36Nucleotide sequence of a first-red
GeneTAG random end linker; n=a, c, g, or t 27ctacgatacg atagggccta
agagtagnnn nnnnnn 362829DNAArtificial
sequencerandom_base28...29Nucleotide sequence of a first-green
random adaptor part 1; n=a, c, g, or t 28gcctagacct aggggtagct
aggctacnn 292927DNAArtificial sequenceNucleotide sequence of a
first-green random adaptor part 2 29gtagcctagc tacccctagg tctaggc
273029DNAArtificial sequencerandom_base28...29Nucleotide sequence
of a first-red random adaptor part 1; n=a, c, g, or t 30ctacgatacg
atagggccta agagtagnn 293127DNAArtificial sequenceNucleotide
sequence of a first-red random adaptor part 2 31ctactcttag
gccctatcgt atcgtag 27
* * * * *