U.S. patent application number 12/341442 was filed with the patent office on 2009-10-29 for human rnase iii and compositions and uses thereof.
This patent application is currently assigned to Isis Pharmaceuticals, Inc.. Invention is credited to Stanley T. Crooke.
Application Number | 20090270486 12/341442 |
Document ID | / |
Family ID | 27752735 |
Filed Date | 2009-10-29 |
United States Patent
Application |
20090270486 |
Kind Code |
A1 |
Crooke; Stanley T. |
October 29, 2009 |
HUMAN RNASE III AND COMPOSITIONS AND USES THEREOF
Abstract
The present invention provides polynucleotides encoding human
RNase III and polypeptides encoded thereby. Methods of using said
polynucleotides and polypeptides are also provided.
Inventors: |
Crooke; Stanley T.;
(Carlsbad, CA) |
Correspondence
Address: |
ISIS PHARMACEUTICALS INC
1896 RUTHERFORD RD.
CARLSBAD
CA
92008
US
|
Assignee: |
Isis Pharmaceuticals, Inc.
Carlsbad
CA
|
Family ID: |
27752735 |
Appl. No.: |
12/341442 |
Filed: |
December 22, 2008 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11001993 |
Dec 2, 2004 |
7491524 |
|
|
12341442 |
|
|
|
|
10079185 |
Feb 20, 2002 |
|
|
|
11001993 |
|
|
|
|
09900425 |
Jul 6, 2001 |
6737512 |
|
|
10079185 |
|
|
|
|
Current U.S.
Class: |
514/44R ;
435/375 |
Current CPC
Class: |
C12N 9/22 20130101; C12N
2310/3181 20130101; C12N 2310/316 20130101; C12N 2310/321 20130101;
Y02A 50/473 20180101; C12N 2310/314 20130101; C07H 21/00 20130101;
C12N 2310/341 20130101; C12Y 301/26003 20130101; C12N 15/1135
20130101; C12N 2310/335 20130101; C12N 2310/318 20130101; C12N
2310/315 20130101; C12N 2310/312 20130101; C12N 2310/322 20130101;
Y02A 50/30 20180101; C12N 2310/311 20130101; C12N 2310/3341
20130101; A61K 38/00 20130101; C12N 2310/346 20130101; C12N 15/113
20130101; C12N 2310/321 20130101; C12N 2310/3525 20130101; C12N
2310/321 20130101; C12N 2310/3527 20130101; C12N 2310/321 20130101;
C12N 2310/3521 20130101 |
Class at
Publication: |
514/44.R ;
435/375 |
International
Class: |
A61K 31/7088 20060101
A61K031/7088; C12N 5/06 20060101 C12N005/06 |
Claims
1-64. (canceled)
65. A method comprising contacting a cell with a modified
oligonucleotide wherein: the modified oligonucleotide is 12 to 30
nucleobases in length; the modified oligonucleotide is
complementary to nucleobases 3051 to 4004 of SEQ ID NO: 1 or to
nucleobases 4197 to 4397 of SEQ ID NO: 1.
66. The method of claim 65 wherein the modified oligonucleotide is
complementary to nucleobases 3051 to 4004 of SEQ ID NO: 1.
67. The method of claim 66 wherein in the modified oligonucleotide
comprises the nucleobase sequence of SEQ ID NO: 8 or 9.
68. The method of claim 65 wherein the modified oligonucleotide is
complementary to nucleobases 4197 to 4397 of SEQ ID NO: 1.
69. The method of claim 68 wherein the modified oligonucleotide
comprises the nucleobase sequence of SEQ ID NO: 12, 13, 14, or
15.
70. The method of claim 65, wherein the modified oligonucleotide
comprises at least one nucleoside comprising a modified sugar.
71. The method of claim 70, wherein at least one modified
nucleoside comprises a 2'-O-methoxyethyl.
72. The method of claim 65 wherein the modified oligonucleotide
comprises at least one modified internucleoside linkage.
73. The method of claim 65, wherein the modified oligonucleotide
comprises: a gap segment consisting of linked deoxynucleosides; a
5' wing segment consisting of linked modified nucleosides; and a 3'
wing segment consisting of linked modified nucleosides; wherein the
gap segment is positioned between the 5' wing segment and the 3'
wing segment and wherein each modified nucleoside of each wing
segment comprises a modified sugar.
74. The method of claim 73, wherein each modified sugar comprises a
2'-modification.
75. The method of claim 74, wherein each 2'-modification is a
2'-O-methoxyethyl modification.
76. The method of claim 65, wherein the cell is in an animal.
77. The method of claim 76, wherein the animal is a mammal.
78. The method of claim 77, wherein the animal is a human.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] The present application is a continuation of U.S.
application Ser. No. 11/001,993 filed Dec. 2, 2004, which is a
divisional of U.S. application Ser. No. 10/079,185 filed Feb. 20,
2002, which is a continuation-in-part of U.S. application Ser. No.
09/900,425 filed Jul. 6, 2001, U.S. Pat. No. 6,737,512. All of the
above are assigned to the assignee of the present invention and are
incorporated by reference herein in their entirety.
SEQUENCE LISTING
[0002] The present application is being filed along with a Sequence
Listing in electronic format. The Sequence Listing is provided as a
file entitled ISIS5030USC1SEQ.txt, created on Dec. 22, 2008 which
is 36 Kb in size. The information in the electronic format of the
sequence listing is incorporated herein by reference in its
entirety.
FIELD OF THE INVENTION
[0003] The present invention relates to a human RNase III, the gene
for which has now been cloned and characterized, and compositions
and uses thereof. Antisense inhibitors of human RNase III are also
described.
BACKGROUND OF THE INVENTION
[0004] Ribonuclease III (RNase III) is an endoribonuclease that
cleaves double stranded RNA. The enzyme is expressed in many
organisms and is highly conserved. I. S. Mian, Nucleic Acids Res.,
1997, 25, 3187-95. All RNase III species cloned to date contain an
RNase III signature sequence and vary in size from 25 to 50 kDa.
Multiple functions have been ascribed to RNase III. In both E. coli
and S. cerevisiae, RNase III has been reported to be involved in
the processing of pre-ribosomal RNA (pre-rRNA). Elela et al., Cell,
1996, 85, 115-24. RNase III has also been reported to be involved
in the processing of small molecular weight nuclear RNAs (snRNAs)
and small molecular weight nucleolar RNAs (snoRNAs) in S.
cerevisiae. Chanfreau et al., Genes Dev. 1996, 11, 2741-51; Qu et
al., Mol. Cell. Biol. 1996, 19, 1144-58. In E. coli, RNase III has
also been reported to be involved in the degradation of some mRNA
species. D. Court, in Control of messenger RVA stability, 1993,
Academic Press, Inc, pp. 71-116.
[0005] A human double strand RNase (dsRNase) activity has been
described. Wu et al., J. Biol. Chem., 1998, 273, 2532-2542; Crooke,
U.S. Pat. No. 5,898,031; U.S. Pat. No. 6,017,094. By the rational
design and testing of chemically modified antisense
oligonucleotides that contained oligoribonucleotide stretches of
varying length, a dsRNase activity was demonstrated in human T24
bladder carcinoma cells which produced 5'-phosphate and 3'-hydroxyl
termini upon cleavage of the complementary cellular RNA target.
This pattern of cleavage products is a feature of E. coli RNase
III. The cleavage activity in human cells required the formation of
a dsRNA region in the oligonucleotide. This human dsRNase activity
is believed to be useful as an alternative terminating mechanism to
RNase H for antisense therapeutics. Because it relies on "RNA-like"
oligonucleotides, which generally have higher potency than the
"DNA-like" oligonucleotides required for RNase H activity, it may
prove an attractive alternative to RNase H-based antisense
approaches.
[0006] RNA interference (RNAi) is a form of sequence-specific,
post-transcriptional gene silencing in animals and plants, elicited
by double-stranded RNA (dsRNA) that is homologous in sequence to
the silenced gene. Elbashir et al., Nature, 2001, 411, 494-498.
dsRNA triggers the specific degradation of homologous RNAs, only
within the region of homology. The dsRNA is processed to 21- to
23-nucleotide fragments, sometimes called short interfering RNAs
(siRNAs) which are believed to be the guide fragments for
sequence-specific mRNA degradation. The processing of longer dsRNA
to these short siRNA fragments is believed to be accomplished by
RNase III. Elbashir et al., ibid., Elbashir et al., Genes and
Devel., 2001, 15, 188-200. Thus it is believed that the human RNase
III of the present invention may be useful in further understanding
and exploiting the gene silencing mechanism, particularly in human
cells.
[0007] Despite the substantial information about members of the
RNase III family and the cloning of genes encoding proteins with
RNase III activity from a number of lower organisms (E. coli, yeast
and others), no human RNase III has previously been cloned. This
has hampered efforts to understand the structure of the enzyme(s),
its distribution and the functions it may serve. The present
application describes the cloning and characterization of a cDNA
that expresses a human RNase III. Cloning and sequencing of the
cDNA encoding human RNase III allowed characterization of this
nucleic acid as well as of the location and function of the RNase
III protein itself.
SUMMARY OF THE INVENTION
[0008] The present invention provides a polynucleotide sequence
(set forth herein as SEQ ID NO: 1) which has been identified as
encoding human RNase III by the homology of the calculated
expressed polypeptide (provided herein as SEQ ID NO: 2) with known
amino acid sequences of yeast and worm RNase III as well as by
functional analysis.
[0009] The present invention provides polynucleotides that encode
human RNase III, the human RNase III polypeptide, vectors
comprising nucleic acids encoding human RNase III, host cells
containing such vectors, antibodies targeted to human RNase III,
nucleic acid probes capable of hybridizing to a nucleic acid
encoding a human RNase III polypeptide, and antisense inhibitors of
RNase III expression. Methods of inhibiting RNase III expression or
activity are also provided, as are pharmaceutical compositions
which include a human RNase III polypeptide, an antisense inhibitor
of RNase III expression, or a vector containing a nucleic acid
encoding human RNase III.
[0010] Methods for identifying agents which modulate activity
and/or levels of human RNase III are also provided. Methods of
promoting inhibition of expression of a selected protein via
antisense, methods of screening oligonucleotides to identify active
antisense oligonucleotides against a particular target, methods of
prognosticating efficacy of antisense therapy, methods of promoting
RNA interference (RNAi) or other forms of gene silencing in a cell
and methods of eliciting cleavage or modification of a selected
cellular RNA target are also provided. All of these methods exploit
the RNA-binding and cleaving activity of RNase III polypeptides. In
preferred embodiments the polynucleotides used in these methods are
RNA-like oligonucleotides. Also provided are methods of identifying
agents which increase or decrease activity or levels of human RNase
III.
[0011] The compositions and methods of the present invention are
useful for research, biological and clinical purposes. For example,
the methods, polynucleotides and antisense oligonucleotides are
useful in defining the roles of RNase III and the interaction of
human RNase III and cellular RNA (including pre-mRNA or
pre-rRNA).
BRIEF DESCRIPTION OF THE DRAWINGS
[0012] FIG. 1 shows the amino acid sequence of human RNase III (SEQ
ID NO: 2) and a comparison of the sequence of the RNase III domain
of the human RNase III to RNase III domains of C. elegans (Worm;
SEQ ID NO: 3), S. pombe (PAC; SEQ ID NO: 4) and S. cerevisiae (RNT;
SEQ ID NO: 5) and E. coli (RNC; SEQ ID NO: 6). Bold letters:
identical amino acids of human RNase III to other species. @@@:
putative catalytic center. HHH: alpha helix; BBB: beta sheet (dsRNA
binding region at C-terminus). Amino acid identity of human RNase
III to Worm (41%), PAC (17%), RNT (15%) and RNC (16%). *: Potential
phosphorylation sites analyzed using OMIGA (Oxford Molecular
Ltd.).
DETAILED DESCRIPTION OF THE INVENTION
[0013] A cDNA encoding human RNase III has now been cloned and
characterized. The cloned sequence is provided herein as SEQ ID NO:
1. This cDNA encodes a protein of 160 kDa which is ubiquitously
expressed in human cell and tissue types, and is involved in
processing of preribosomal RNA (pre-rRNA).
[0014] Thus, in accordance with one aspect of the present
invention, there are provided isolated polynucleotides which encode
human RNase III polypeptides. By "polynucleotides" it is meant to
include any form of RNA or DNA such as mRNA, pre-mRNA or cDNA or
genomic DNA, respectively, obtained by cloning or produced
synthetically by well known chemical techniques. The term
"polynucleotide" is also meant to include oligonucleotides, e.g.
synthetic antisense oligonucleotides. DNA or RNA polynucleotides
may be double- or single-stranded. Single-stranded DNA or RNA
polynucleotides may comprise the coding or sense strand or the
non-coding or antisense strand.
[0015] Methods of isolating a polynucleotide of the present
invention via cloning techniques are well known. For example, to
obtain the polynucleotide sequence of SEQ ID NO: 1, a similarity
search of the yeast RNTI gene (RNase III, Genbank accession no.
AABO4172; SEQ ID NO: 5) and the Caenorhabditis elegans RNase III
gene (Genbank accession no. 001326; SEQ ID NO: 3) with the XREF
database (National Center for Biotechnology Information, NIH,
Rockville Md.) was performed. A 393 base pair (bp) human EST clone
(GenBank AA083888) was identified.
[0016] Using primers based on this EST sequence, a clone (U4)
corresponding to the COOH-terminal portion of the protein
(nucleotides 3569-4764 of full length cDNA) was cloned by 3' RACE.
Eight positive clones were isolated by screening a liver cDNA
library with this clone. With primers based on one of these clones,
5' RACE was performed to clone a cDNA of approximately 1 kb, which
corresponds to the middle part of the full length cDNA. In the same
way, a cDNA of the NH.sub.2-terminal portion was cloned. Primers
based on the NH.sub.2-terminal-most clone were used to perform
additional 5'-RACE to obtain the NH.sub.2-terminal portion of the
cDNA. The overlapping clones were sequenced and assembled to a full
length human RNase III cDNA with a total of 4764 nucleotides. This
human RNase III polynucleotide sequence is provided herein as SEQ
ID NO: 1 and has been deposited as GenBank accession no. AF189011.
The cDNA contained a coding sequence of 4125 nucleotides (from
246-4370 of SEQ ID NO:1) that was calculated to encode a 1374 amino
acid protein. This polypeptide sequence is provided herein as SEQ
ID NO: 2, shown in FIG. 1. The calculated molecular weight of the
protein is 160 kDa based on the prediction of the first translated
methionine as the translation initiation site. Northern
hybridization analyses demonstrated that the human RNase III mRNA
was approximately 5 kb in size. It was found to be ubiquitously
expressed in human tissues and cell lines. Compared to C. elegans,
yeast and bacterial RNase III, human RNase III is substantially
larger and contains multiple domains. The RNase III domain (amino
acids 949-1374) is located at the carboxy terminus of the protein
and is homologous to C. elegans, yeast and bacterial RNase III. The
human RNase also contains proline rich (amino acids 1-220) and
serine-arginine rich (amino acids 221-470) domains near the amino
terminus. The SR and RNase III domains are separated by 478 amino
acids.
[0017] The RNase III domain of human RNase III is conserved with
other species and is most homologous with C. elegans RNase III (41%
identity). Both the human RNase III domain and C. elegans RNase III
contain two RNase III signature sequences (HNERLEFLGDS; SEQ ID NO
7). Sequence identity was also compared with the yeasts S. pombe
(PAC gene)(17% homology) and S. cerevisiae (RNT gene) (15%
homology) and with E. coli RNase III (RNC gene) (16% homology).
Human RNase III also contains multiple phosphorylation sites. The
SR domain is usually present in SR or SR related proteins that play
crucial roles in mRNA splicing. The fusion of SR and RNase III
domains into a single protein suggests that human RNase III may be
involved in a number of RNA metabolic events. The presence of
multiple potential phosphorylation sites suggests that the enzyme
is regulated by phosphorylation.
[0018] As used herein, the phrase "homologous nucleotide sequence,"
or "homologous amino acid sequence," or variations thereof, refers
to sequences characterized by a homology, at the nucleotide level
or amino acid level, of at least the specified percentage.
Homologous nucleotide sequences include those sequences coding for
isoforms of proteins. Such isoforms can be expressed in different
tissues of the same organism as a result of, for example,
alternative splicing of RNA. Alternatively, isoforms can be encoded
by different genes. Homologous nucleotide sequences include
nucleotide sequences encoding for a protein of a species other than
humans, including, but not limited to, mammals. Homologous
nucleotide sequences also include, but are not limited to,
naturally occurring allelic variations and mutations of the
nucleotide sequences set forth herein. A homologous nucleotide
sequence does not, however, include the nucleotide sequence
encoding other known RNase IIIs. Homologous amino acid sequences
include those amino acid sequences which contain conservative amino
acid substitutions and which polypeptides have the same binding
and/or activity. A homologous amino acid sequence does not,
however, include the amino acid sequence encoding other known RNase
IIIs. Percent homology can be determined by, for example, the Gap
program (Wisconsin Sequence Analysis Package, Version 8 for Unix,
Genetics Computer Group, University Research Park, Madison Wis.),
using the default settings, which uses the algorithm of Smith and
Waterman (Adv. Appl. Math., 1981, 2, 482-489, which is incorporated
herein by reference in its entirety).
[0019] In a preferred embodiment, the polynucleotide of the present
invention comprises the nucleic acid sequence of SEQ ID NO: 1.
However, as will be obvious to those of skill in the art upon this
disclosure, due to the degeneracy of the genetic code,
polynucleotides of the present invention may comprise other nucleic
acid sequences encoding the polypeptide of SEQ ID NO: 2 and
derivatives, variants or active fragments thereof.
[0020] The invention further provides homologs of the human RNase
III DNA. Such homologs, in general, share at least 50%, at least
60%, at least 65%, at least 70%, at least 75%, at least 80%, at
least 85%, at least 90%, at least 95%, at least 98%, or at least
99% homology with the human RNase III DNA of the invention. Species
homologs, sometimes referred to as "orthologs," in general, share
at least 50%, at least 60%, at least 65%, at least 70%, at least
75%, at least 80%, at least 85%, at least 90%, at least 95%, at
least 98%, or at least 99% homology with the human RNase III DNA of
the invention. Generally, percent sequence "homology" with respect
to polynucleotides of the invention can be calculated as the
percentage of nucleotide bases in the candidate sequence that are
identical to nucleotides in the human RNase III sequence set forth
in the appended Sequence Listing, after aligning the sequences and
introducing gaps, if necessary, to achieve the maximum percent
sequence identity.
[0021] Another aspect of the present invention relates to the
polypeptides encoded by the polynucleotides of the present
invention. In a preferred embodiment, a polypeptide of the present
invention comprises the deduced amino acid sequence of human RNase
III provided in SEQ ID NO: 2. However, by "polypeptide" it is also
meant to include fragments, derivatives and analogs of SEQ ID NO: 2
which retain essentially the same biological activity and/or
function as human RNase III. Alternatively, polypeptides of the
present invention may retain their ability to bind to double
stranded RNA even though they do not function as active RNase III
enzymes in other capacities. Thus an enzyme may "modify" its RNA
substrate, e.g., bind and interfere with the function of the RNA
but not cleave it, or may bind and cleave. In some embodiments
cleavage is a preferred form of modification. In another
embodiment, polypeptides of the present invention may retain
nuclease activity but without specificity for an RNA/RNA duplex.
Polypeptides of the present invention include recombinant
polypeptides, isolated natural polypeptides and synthetic
polypeptides, and fragments thereof which retain one or more of the
activities described above.
[0022] The invention further provides homologs of the human RNase
III polypeptide. Such homologs, in general, share at least 50%, at
least 60%, at least 65%, at least 70%, at least 75%, at least 80%,
at least 85%, at least 90%, at least 95%, at least 98%, or at least
99% homology with the RNase III polypeptides of the invention.
Generally, percent sequence "homology" with respect to polypeptides
of the invention can be calculated as the percentage of amino acid
residues in the candidate sequence that are identical to amino acid
residues in the RNAse III sequences set forth in the appended
Sequence Listing, after aligning the sequences and introducing
gaps, if necessary, to achieve the maximum percent sequence
identity.
[0023] In some embodiments the present invention provides
recombinant polypeptides that comprise RNase III domains from one
or more organisms. Domains of RNase III that exhibit certain
functions can be replaced with RNase III domains from other
organisms that exhibit similar functions, while maintaining the
overall function of the polypeptide. As a non-limiting example, a
hybrid RNase III may comprise one or more E. coli RNase III domain,
one or more C. elegans RNase III domain, and one or more human
RNase III domain. As a non-limiting example, such hybrid RNase III
polypeptides can be produced by first designing and producing
recombinant DNA molecules encoding such polypeptides. Such
recombinant DNA molecules are produced, for example, by replacing
DNA sequences that encode individual domains in a polynucleotide
encoding RNase III with DNA sequences from other organisms that
encode RNase III domains that exhibit similar functions. The
recombinant DNA construct thus produced can then be expressed and
purified using means familiar to one of ordinary skill in the
art.
[0024] To confirm the expression of the human RNase III protein,
two anti-peptide antibodies were produced. The "anti-III" peptide
antibody was derived from a peptide corresponding to amino acids
1356-1374 within the RNase III domain present in the C-terminal
portion of the putative protein. The "anti-SR" peptide antibody was
derived from a peptide corresponding to amino acids 266-284 within
the SR-domain of the putative protein. Using these antibodies,
Western blot analyses were performed to determine the size and
localization of human RNase III. The anti-SR peptide antibody
recognized a band in HeLa whole cell lysate with a molecular weight
of approximately 160 kDa which is near the calculated protein size
confirming that the full coding region is expressed in HeLa cells.
Similar experiments were performed using different human cell lines
e.g. A549, T24 and HL60 with equivalent results. To determine the
localization of the protein, nuclear and non-nuclear fractions from
HeLa cells and other human cell lines were prepared and equal
amounts of proteins were analyzed by Western blots. RNase III was
present primarily in the nuclear fractions. Non-nuclear fractions
contained only trace amounts of protein, possibly due to the
contamination during sample preparation. The anti-III peptide
antibody gave results equivalent to those obtained with the anti-SR
peptide antibody. To better understand the localization of human
RNase III, the protein was identified in cells by indirect
immunofluorescence microscopy. The nuclei of HeLa cells were
stained by both anti-SR and anti-III antibodies, confirming that
human RNase III is present in the nucleus. RNase III is localized
extensively in nucleus and occasionally observed in nucleoli. This
localization suggests possible involvement in both pre-mRNA and
pre-rRNA processing. In E. coli, RNase III is associated with
ribosomes in the cytoplasm. Robertson et al., J. Biol. Chem., 1968,
243, 82-91. Eukaryotic RNase III has not previously been shown to
be localized in the nucleus.
[0025] The localization of human RNase III to nucleoli was found to
be cell cycle regulated. Double thymidine treatment was used to
synchronize HeLa cells to early-S phase. Two to four hours after
releasing the thymidine block, HeLa cells entered S phase as
determined by fluorescence activated cell sorting (FACS). Six to
eight hours after release, HeLa cells entered the G2/M phase. There
were no significant changes in the mRNA or protein levels of the
RNase III during pre-S, S or G2/M phases. However, the subcellular
localization of the protein changed during the cell cycle. When the
cells were treated with thymidine and synchronized in early S
phase, RNase III protein was present only in the nucleus and not
the nucleoli, as determined by immunofluorescent labeling. After
releasing from thymidine block, RNase III was translocated to
nucleoli, reaching a peak at 4 hours when cells were in S phase. At
that time, RNase III was present both in the nucleoli and the
nucleus. The protein was present in the nucleoli for approximately
8 hours, and then disappeared from nucleoli as cells entered M
phase. Localization of RNase III in the nucleoli was confirmed by
double staining with an anti-nucleolin monoclonal antibody (MBL,
Watertown, Mass.).
[0026] In human cells, nucleoli undergo phases of condensation and
dissociation as a function of the cell cycle. Nucleoli dissociate
upon entering prophase and disappear entirely during the late
prophase and metaphase periods of mitosis, then begin to reappear
during telophase and form dense organelles during the G1 phase.
Human RNase III was only translocated to and remained in the
nucleoli during S phase suggesting that RNase III may serve one or
more specific functions in nucleoli during S phase.
[0027] The present invention also provides antisense inhibitors of
RNase III expression, which may be used, for example,
therapeutically, prophylactically or as research reagents. The
modulation of function of a target nucleic acid (in this case a
nucleic acid encoding RNase III) by compounds which specifically
hybridize to it is generally referred to as "antisense". The
functions of DNA to be interfered with include replication and
transcription. The functions of RNA to be interfered with include
all vital functions such as, for example, translocation of the RNA
to the site of protein translation, translation of protein from the
RNA, splicing of the RNA to yield one or more mRNA species, and
catalytic activity which may be engaged in or facilitated by the
RNA. The overall effect of such interference with target nucleic
acid function is modulation of the expression of the target. In the
context of the present invention, "modulation" means either an
increase (stimulation) or a decrease (inhibition) in the expression
of a gene. In the context of the present invention, inhibition is
the preferred form of modulation of gene expression and mRNA is a
preferred target. In some embodiments gene silencing is a preferred
form of inhibition of gene expression and refers to a decrease in
gene expression mediated by a double-stranded RNA polynucleotide,
one strand of which is homologous to the RNA to be silenced.
[0028] It is preferred to target specific nucleic acids for
antisense. "Targeting" an antisense compound to a particular
nucleic acid, in the context of this invention, is a multistep
process. The process usually begins with the identification of a
nucleic acid sequence whose function is to be modulated. This may
be, for example, a cellular gene (or mRNA transcribed from the
gene) whose expression is associated with a particular disorder or
disease state, or a nucleic acid molecule from an infectious agent.
The targeting process also includes determination of a site or
sites within this gene for the antisense interaction to occur such
that the desired effect, e.g., detection or modulation of
expression of the protein, will result. Within the context of the
present invention, a preferred intragenic site is the region
encompassing the translation initiation or termination codon of the
open reading frame (ORF) of the gene. Since, as is known in the
art, the translation initiation codon is typically 5'-AUG (in
transcribed mRNA molecules; 5'-ATG in the corresponding DNA
molecule), the translation initiation codon is also referred to as
the "AUG codon," the "start codon" or the "AUG start codon". A
minority of genes have a translation initiation codon having the
RNA sequence 5'-GUG, 5'-UUG or 5'-CUG, and 5'-AUA, 5'-ACG and
5'-CUG have been shown to function in vivo. Thus, the terms
"translation initiation codon" and "start codon" can encompass many
codon sequences, even though the initiator amino acid in each
instance is typically methionine (in eukaryotes) or
formylmethionine (in prokaryotes). It is also known in the art that
eukaryotic and prokaryotic genes may have two or more alternative
start codons, any one of which may be preferentially utilized for
translation initiation in a particular cell type or tissue, or
under a particular set of conditions. In the context of the
invention, "start codon" and "translation initiation codon" refer
to the codon or codons that are used in vivo to initiate
translation of the target, regardless of the sequence(s) of such
codons.
[0029] It is also known in the art that a translation termination
codon (or "stop codon") of a gene may have one of three sequences,
i.e., 5'-UAA, 5'-UAG and 5'-UGA (the corresponding DNA sequences
are 5'-TAA, 5'-TAG and 5'-TGA, respectively). The terms "start
codon region" and "translation initiation codon region" refer to a
portion of such an mRNA or gene that encompasses from about 25 to
about 50 contiguous nucleotides in either direction (i.e., 5' or
3') from a translation initiation codon. Similarly, the terms "stop
codon region" and "translation termination codon region" refer to a
portion of such an mRNA or gene that encompasses from about 25 to
about 50 contiguous nucleotides in either direction (i.e., 5' or
3') from a translation termination codon.
[0030] The open reading frame (ORF) or "coding region," which is
known in the art to refer to the region between the translation
initiation codon and the translation termination codon, is also a
region which may be targeted effectively. Other target regions
include the 5' untranslated region (5'UTR), known in the art to
refer to the portion of an mRNA in the 5' direction from the
translation initiation codon, and thus including nucleotides
between the 5' cap site and the translation initiation codon of an
mRNA or corresponding nucleotides on the gene, and the 3'
untranslated region (3'UTR), known in the art to refer to the
portion of an mRNA in the 3' direction from the translation
termination codon, and thus including nucleotides between the
translation termination codon and 3' end of an mRNA or
corresponding nucleotides on the gene. The 5' cap of an mRNA
comprises an N7-methylated guanosine residue joined to the 5'-most
residue of the mRNA via a 5'-5' triphosphate linkage. The 5' cap
region of an mRNA is considered to include the 5' cap structure
itself as well as the first 50 nucleotides adjacent to the cap. The
5' cap region may also be a preferred target region.
[0031] Although some eukaryotic mRNA transcripts are directly
translated, many contain one or more regions, known as "introns,"
which are excised from a transcript before it is translated. The
remaining (and therefore translated) regions are known as "exons"
and are spliced together to form a continuous mRNA sequence. mRNA
splice sites, i.e., intron-exon junctions, may also be preferred
target regions, and are particularly useful in situations where
aberrant splicing is implicated in disease, or where an
overproduction of a particular mRNA splice product is implicated in
disease. Aberrant fusion junctions due to rearrangements or
deletions are also preferred targets. It has also been found that
introns can also be effective, and therefore preferred, target
regions for antisense compounds targeted, for example, to DNA or
pre-mRNA.
[0032] Once one or more target sites have been identified,
oligonucleotides are chosen which are sufficiently complementary to
the target, i.e., hybridize sufficiently well and with sufficient
specificity, to give the desired effect.
[0033] In the context of this invention, "hybridization" means
hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed
Hoogsteen hydrogen bonding, between complementary nucleoside or
nucleotide bases. For example, adenine and thymine are
complementary nucleobases which pair through the formation of
hydrogen bonds. "Complementary," as used herein, refers to the
capacity for precise pairing between two nucleotides. For example,
if a nucleotide at a certain position of an oligonucleotide is
capable of hydrogen bonding with a nucleotide at the same position
of a DNA or RNA molecule, then the oligonucleotide and the DNA or
RNA are considered to be complementary to each other at that
position. The oligonucleotide and the DNA or RNA are complementary
to each other when a sufficient number of corresponding positions
in each molecule are occupied by nucleotides which can hydrogen
bond with each other. Thus, "specifically hybridizable" and
"complementary" are terms which are used to indicate a sufficient
degree of complementarity or precise pairing such that stable and
specific binding occurs between the oligonucleotide and the DNA or
RNA target. It is understood in the art that the sequence of an
antisense compound need not be 100% complementary to that of its
target nucleic acid to be specifically hybridizable. An antisense
compound is specifically hybridizable when binding of the compound
to the target DNA or RNA molecule interferes with the normal
function of the target DNA or RNA to cause a loss of utility, and
there is a sufficient degree of complementarity to avoid
non-specific binding of the antisense compound to non-target
sequences under conditions in which specific binding is desired,
i.e., under physiological conditions in the case of in vivo assays
or therapeutic treatment, and in the case of in vitro assays, under
conditions in which the assays are performed.
[0034] Antisense and other compounds of the invention which
hybridize to the target and inhibit expression of the target are
identified through experimentation, and the sequences of these
compounds are hereinbelow identified as preferred embodiments of
the invention. The target sites to which these preferred sequences
are complementary are hereinbelow referred to as "active sites" and
are therefore preferred sites for targeting. Therefore another
embodiment of the invention encompasses compounds, including
primers, probes, siRNAs, other double stranded RNAs including RNAi
or gene silencing agents, ribozymes, external guide sequence (EGS)
oligonucleotides (oligozymes), and other short catalytic RNAs or
catalytic oligonucleotides which hybridize to these active
sites.
[0035] Antisense compounds are commonly used as research reagents
and diagnostics. For example, antisense oligonucleotides, which are
able to inhibit gene expression with exquisite specificity, are
often used by those of ordinary skill to elucidate the function of
particular genes. Antisense compounds are also used, for example,
to distinguish between functions of various members of a biological
pathway. Antisense modulation has, therefore, been harnessed for
research use.
[0036] The specificity and sensitivity of antisense is also
harnessed by those of skill in the art for therapeutic uses.
Antisense oligonucleotides have been employed as therapeutic
moieties in the treatment of disease states in animals and man.
Antisense oligonucleotide drugs, including ribozymes, have been
safely and effectively administered to humans and numerous clinical
trials are presently underway. It is thus established that
oligonucleotides can be useful therapeutic modalities that can be
configured to be useful in treatment regimes for treatment of
cells, tissues and animals, especially humans.
[0037] In the context of this invention, the term "polynucleotide",
which includes oligonucleotides, refers to an oligomer or polymer
of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) or
mimetics thereof. This term includes oligonucleotides composed of
naturally-occurring nucleobases, sugars and covalent
internucleoside (backbone) linkages as well as oligonucleotides
having non-naturally-occurring portions which function similarly.
Such modified or substituted oligonucleotides are often preferred
over native forms because of desirable properties such as, for
example, enhanced cellular uptake, enhanced affinity for nucleic
acid target and increased stability in the presence of
nucleases.
[0038] In general, nucleic acids or polynucleotides (including
oligonucleotides) may be described as "DNA-like" (i.e., having
2'-deoxy sugars and, generally, T rather than U bases) or
"RNA-like" (i.e., having 2'-hydroxyl or 2'-modified sugars and,
generally U rather than T bases). Nucleic acid helices can adopt
more than one type of structure, most commonly the A- and B-forms.
It is believed that, in general, oligonucleotides which have
B-form-like structure are "DNA-like" and those which have
A-form-like structure are "RNA-like".
[0039] While antisense oligonucleotides are a preferred form of
antisense compound, the present invention comprehends other
oligomeric antisense compounds, including but not limited to
oligonucleotide mimetics such as are described below. The antisense
compounds in accordance with this invention preferably comprise
from about 8 to about 50 nucleobases (i.e. from about 8 to about 50
linked nucleosides). Particularly preferred antisense compounds are
antisense oligonucleotides, even more preferably those comprising
from about 12 to about 30 nucleobases. Antisense compounds include
ribozymes, external guide sequence (EGS) oligonucleotides
(oligozymes), and other short catalytic RNAs or catalytic
oligonucleotides which hybridize to the target nucleic acid and
modulate its expression.
[0040] As is known in the art, a nucleoside is a base-sugar
combination. The base portion of the nucleoside is normally a
heterocyclic base. The two most common classes of such heterocyclic
bases are the purines and the pyrimidines. Nucleotides are
nucleosides that further include a phosphate group covalently
linked to the sugar portion of the nucleoside. For those
nucleosides that include a pentofuranosyl sugar, the phosphate
group can be linked to either the 2', 3' or 5' hydroxyl moiety of
the sugar. In forming oligonucleotides, the phosphate groups
covalently link adjacent nucleosides to one another to form a
linear polymeric compound. In turn, the respective ends of this
linear polymeric structure can be further joined to form a circular
structure, however, open linear structures are generally preferred.
Within the oligonucleotide structure, the phosphate groups are
commonly referred to as forming the internucleoside backbone of the
oligonucleotide. The normal linkage or backbone of RNA and DNA is a
3' to 5' phosphodiester linkage.
[0041] Specific examples of preferred antisense compounds useful in
this invention include oligonucleotides containing modified
backbones or non-natural internucleoside linkages. As defined in
this specification, oligonucleotides having modified backbones
include those that retain a phosphorus atom in the backbone and
those that do not have a phosphorus atom in the backbone. For the
purposes of this specification, and as sometimes referenced in the
art, modified oligonucleotides that do not have a phosphorus atom
in their internucleoside backbone can also be considered to be
oligonucleosides.
[0042] Preferred modified oligonucleotide backbones include, for
example, phosphorothioates, chiral phosphorothioates,
phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters,
methyl and other alkyl phosphonates including 3'-alkylene
phosphonates, 5'-alkylene phosphonates and chiral phosphonates,
phosphinates, phosphoramidates including 3'-amino phosphoramidate
and aminoalkylphosphoramidates, thionophosphoramidates,
thionoalkylphosphonates, thionoalkylphosphotriesters,
selenophosphates and boranophosphates having normal 3'-5' linkages,
2'-5' linked analogs of these, and those having inverted polarity
wherein one or more internucleotide linkages is a 3' to 3', 5' to
5' or 2' to 2' linkage. Preferred oligonucleotides having inverted
polarity comprise a single 3' to 3' linkage at the 3'-most
internucleotide linkage i.e. a single inverted nucleoside residue
which may be abasic (the nucleobase is missing or has a hydroxyl
group in place thereof). Various salts, mixed salts and free acid
forms are also included.
[0043] Representative United States patents that teach the
preparation of the above phosphorus-containing linkages include,
but are not limited to, U.S. Pat. Nos. 3,687,808; 4,469,863;
4,476,301; 5,023,243; 5,177,196; 5,188,897; 5,264,423; 5,276,019;
5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496;
5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,306;
5,550,111; 5,563,253; 5,571,799; 5,587,361; 5,194,599; 5,565,555;
5,527,899; 5,721,218; 5,672,697; and 5,625,050, certain of which
are commonly owned with this application, and each of which is
herein incorporated by reference.
[0044] Preferred modified oligonucleotide backbones that do not
include a phosphorus atom therein have backbones that are formed by
short chain alkyl or cycloalkyl internucleoside linkages, mixed
heteroatom and alkyl or cycloalkyl internucleoside linkages, or one
or more short chain heteroatomic or heterocyclic internucleoside
linkages. These include those having morpholino linkages (formed in
part from the sugar portion of a nucleoside); siloxane backbones;
sulfide, sulfoxide and sulfone backbones; formacetyl and
thioformacetyl backbones; methylene formacetyl and thioformacetyl
backbones; riboacetyl backbones; alkene containing backbones;
sulfamate backbones; methyleneimino and methylenehydrazino
backbones; sulfonate and sulfonamide backbones; amide backbones;
and others having mixed N, O, S and CH.sub.2 component parts.
[0045] Representative United States patents that teach the
preparation of the above oligonucleosides include, but are not
limited to, U.S. Pat. Nos. 5,034,506; 5,166,315; 5,185,444;
5,214,134; 5,216,141; 5,235,033; 5,264,562; 5,264,564; 5,405,938;
5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225;
5,596,086; 5,602,240; 5,610,289; 5,602,240; 5,608,046; 5,610,289;
5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; 5,792,608;
5,646,269 and 5,677,439, certain of which are commonly owned with
this application, and each of which is herein incorporated by
reference.
[0046] In other preferred oligonucleotide mimetics, both the sugar
and the internucleoside linkage, i.e., the backbone, of the
nucleotide units are replaced with novel groups. The base units are
maintained for hybridization with an appropriate nucleic acid
target compound. One such oligomeric compound, an oligonucleotide
mimetic that has been shown to have excellent hybridization
properties, is referred to as a peptide nucleic acid (PNA). In PNA
compounds, the sugar-backbone of an oligonucleotide is replaced
with an amide containing backbone, in particular an
aminoethylglycine backbone. The nucleobases are retained and are
bound directly or indirectly to aza nitrogen atoms of the amide
portion of the backbone. Representative United States patents that
teach the preparation of PNA compounds include, but are not limited
to, U.S. Pat. Nos. 5,539,082; 5,714,331; and 5,719,262, each of
which is herein incorporated by reference. Further teaching of PNA
compounds can be found in Nielsen et al., Science, 1991, 254,
1497-1500.
[0047] Most preferred embodiments of the invention are
oligonucleotides with phosphorothioate backbones and
oligonucleosides with heteroatom backbones, and in particular
--CH.sub.2--NH--O--CH.sub.2--,
--CH.sub.2--N(CH.sub.3)--O--CH.sub.2-- [known as a methylene
(methylimino) or MMI backbone],
--CH.sub.2--O--N(CH.sub.3)--CH.sub.2--,
--CH.sub.2--N(CH.sub.3)--N(CH.sub.3)--CH.sub.2-- and
--O--N(CH.sub.3)--CH.sub.2--CH.sub.2-- [wherein the native
phosphodiester backbone is represented as --O--P--O--CH.sub.2--] of
the above referenced U.S. Pat. No. 5,489,677, and the amide
backbones of the above referenced U.S. Pat. No. 5,602,240. Also
preferred are oligonucleotides having morpholino backbone
structures of the above-referenced U.S. Pat. No. 5,034,506.
[0048] Modified oligonucleotides may also contain one or more
substituted sugar moieties. Preferred oligonucleotides comprise one
of the following at the 2' position: OH; F; O-, S-, or N-alkyl; O-,
S-, or N-alkenyl; O-, S- or N-alkynyl; or O-alkyl-O-alkyl, wherein
the alkyl, alkenyl and alkynyl may be substituted or unsubstituted
C.sub.1 to C.sub.10 alkyl or C.sub.2 to C.sub.10 alkenyl and
alkynyl. Particularly preferred are
O[(CH.sub.2).sub.nO].sub.mCH.sub.3, O(CH.sub.2).sub.nOCH.sub.3,
O(CH.sub.2).sub.nNH.sub.2, O(CH.sub.2).sub.nCH.sub.3,
O(CH.sub.2).sub.nONH.sub.2, and
O(CH.sub.2).sub.nON[(CH.sub.2).sub.nCH.sub.3)].sub.2, where n and m
are from 1 to about 10. Other preferred oligonucleotides comprise
one of the following at the 2' position: C.sub.1 to C.sub.10 lower
alkyl, substituted lower alkyl, alkenyl, alkynyl, alkaryl, aralkyl,
O-alkaryl or O-aralkyl, SH, SCH.sub.3, OCN, Cl, Br, CN, CF.sub.3,
OCF.sub.3, SOCH.sub.3, SO.sub.2CH.sub.3, ONO.sub.2, NO.sub.2,
N.sub.3, NH.sub.2, heterocycloalkyl, heterocycloalkaryl,
aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving
group, a reporter group, an intercalator, a group for improving the
pharmacokinetic properties of an oligonucleotide, or a group for
improving the pharmacodynamic properties of an oligonucleotide, and
other substituents having similar properties. A preferred
modification includes 2'-methoxyethoxy
(2'-O--CH.sub.2CH.sub.2OCH.sub.3, also known as
2'-O-(2-methoxyethyl) or 2'-MOE) (Martin et al., Helv. Chim. Acta,
1995, 78, 486-504) i.e., an alkoxyalkoxy group. A further preferred
modification includes 2'-dimethylaminooxyethoxy, i.e., a
O(CH.sub.2).sub.2ON(CH.sub.3).sub.2 group, also known as 2'-DMAOE,
as described in examples hereinbelow, and
2'-dimethylaminoethoxyethoxy (also known in the art as
2'-O-dimethylaminoethoxyethyl or 2'-DMAEOE), i.e.,
2'-O--CH.sub.2--O--CH.sub.2--N(CH.sub.2).sub.2, also described in
examples hereinbelow.
[0049] A further preferred modification includes Locked Nucleic
Acids (LNAs) in which the 2'-hydroxyl group is linked to the 3' or
4' carbon atom of the sugar ring thereby forming a bicyclic sugar
moiety. The linkage is preferably a methelyne (--CH.sub.2--), group
bridging the 2' oxygen atom and the 3' or 4' carbon atom wherein n
is 1 or 2. LNAs and preparation thereof are described in WO
98/39352 and WO 99/14226.
[0050] Other preferred modifications include 2'-methoxy
(2'-O--CH.sub.3), 2'-aminopropoxy
(2'-OCH.sub.2CH.sub.2CH.sub.2NH.sub.2), 2'-allyl
(2'-CH.sub.2--CH.dbd.CH.sub.2), 2'-O-allyl
(2'-O--CH.sub.2--CH.dbd.CH.sub.2) and 2'-fluoro (2'-F). The
2'-modification may be in the arabino (up) position or ribo (down)
position. A preferred 2'-arabino modification is 2'-F. Similar
modifications may also be made at other positions on the
oligonucleotide, particularly the 3' position of the sugar on the
3' terminal nucleotide or in 2'-5' linked oligonucleotides and the
5' position of 5' terminal nucleotide. Oligonucleotides may also
have sugar mimetics such as cyclobutyl moieties in place of the
pentofuranosyl sugar. Representative United States patents that
teach the preparation of such modified sugar structures include,
but are not limited to, U.S. Pat. Nos. 4,981,957; 5,118,800;
5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785;
5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300;
5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; 5,792,747;
and 5,700,920, certain of which are commonly owned with the instant
application, and each of which is herein incorporated by reference
in its entirety.
[0051] Oligonucleotides may also include nucleobase (often referred
to in the art simply as "base") modifications or substitutions. As
used herein, "unmodified" or "natural" nucleobases include the
purine bases adenine (A) and guanine (G), and the pyrimidine bases
thymine (T), cytosine (C) and uracil (U). Modified nucleobases
include other synthetic and natural nucleobases such as
5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine,
hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives
of adenine and guanine, 2-propyl and other alkyl derivatives of
adenine and guanine, 2-thiouracil, 2-thiothymine and
2-thiocytosine, 5-halouracil and cytosine, 5-propynyl
(--C.ident.C--CH.sub.3) uracil and cytosine and other alkynyl
derivatives of pyrimidine bases, 6-azo uracil, cytosine and
thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino,
8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines
and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and
other 5-substituted uracils and cytosines, 7-methylguanine and
7-methyladenine, 2-F-adenine, 2-amino-adenine, 8-azaguanine and
8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3-deazaguanine
and 3-deazaadenine. Further modified nucleobases include tricyclic
pyrimidines such as phenoxazine
cytidine(1H-pyrimido[5,4-b][1,4]benzoxazin-2(3H)-one),
phenothiazine cytidine
(1H-pyrimido[5,4-b][1,4]benzothiazin-2(3H)-one), G-clamps such as a
substituted phenoxazine cytidine (e.g.
9-(2-aminoethoxy)-H-pyrimido[5,4-b][1,4]benzoxazin-2(3H)-one),
carbazole cytidine (2H-pyrimido[4,5-b]indol-2-one), pyridoindole
cytidine (H-pyrido[3',2':4,5]pyrrolo[2,3-d]pyrimidin-2-one).
[0052] Modified nucleobases may also include those in which the
purine or pyrimidine base is replaced with other heterocycles, for
example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and
2-pyridone. Further nucleobases include those disclosed in U.S.
Pat. No. 3,687,808, those disclosed in The Concise Encyclopedia Of
Polymer Science And Engineering, pages 858-859, Kroschwitz, J. I.,
ed. John Wiley & Sons, 1990, those disclosed by Englisch et
al., Angewandte Chemie, International Edition, 1991, 30, 613, and
those disclosed by Sanghvi, Y. S., Chapter 15, Antisense Research
and Applications, pages 289-302, Crooke, S. T. and Lebleu, B., ed.,
CRC Press, 1993. Certain of these nucleobases are particularly
useful for increasing the binding affinity of the oligomeric
compounds of the invention. These include 5-substituted
pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted
purines, including 2-aminopropyladenine, 5-propynyluracil and
5-propynylcytosine. 5-methylcytosine substitutions have been shown
to increase nucleic acid duplex stability by 0.6-1.2.degree. C.
(Sanghvi, Y. S., Crooke, S. T. and Lebleu, B., eds., Antisense
Research and Applications, CRC Press, Boca Raton, 1993, pp.
276-278) and are presently preferred base substitutions, even more
particularly when combined with 2'-O-methoxyethyl sugar
modifications.
[0053] Representative United States patents that teach the
preparation of certain of the above noted modified nucleobases as
well as other modified nucleobases include, but are not limited to,
the above noted U.S. Pat. No. 3,687,808, as well as U.S. Pat. Nos.
4,845,205; 5,130,302; 5,134,066; 5,175,273; 5,367,066; 5,432,272;
5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540;
5,587,469; 5,594,121, 5,596,091; 5,614,617; 5,645,985; 5,830,653;
5,763,588; 6,005,096; and 5,681,941, certain of which are commonly
owned with the instant application, and each of which is herein
incorporated by reference, and U.S. Pat. No. 5,750,692, which is
commonly owned with the instant application and also herein
incorporated by reference.
[0054] Another modification of the oligonucleotides of the
invention involves chemically linking to the oligonucleotide one or
more moieties or conjugates which enhance the activity, cellular
distribution or cellular uptake of the oligonucleotide. The
compounds of the invention can include conjugate groups covalently
bound to functional groups such as primary or secondary hydroxyl
groups. Conjugate groups of the invention include intercalators,
reporter molecules, polyamines, polyamides, polyethylene glycols,
polyethers, groups that enhance the pharmacodynamic properties of
oligomers, and groups that enhance the pharmacokinetic properties
of oligomers. Typical conjugates groups include cholesterols,
lipids, phospholipids, biotin, phenazine, folate, phenanthridine,
anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and
dyes. Groups that enhance the pharmacodynamic properties, in the
context of this invention, include groups that improve oligomer
uptake, enhance oligomer resistance to degradation, and/or
strengthen sequence-specific hybridization with RNA. Groups that
enhance the pharmacokinetic properties, in the context of this
invention, include groups that improve oligomer uptake,
distribution, metabolism or excretion. Representative conjugate
groups are disclosed in International Patent Application
PCT/US92/09196, filed Oct. 23, 1992 the entire disclosure of which
is incorporated herein by reference. Conjugate moieties include but
are not limited to lipid moieties such as a cholesterol moiety
(Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86,
6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Let.,
1994, 4, 1053-1060), a thioether, e.g., hexyl-5-tritylthiol
(Manoharan et al., Ann. NY. Acad. Sci., 1992, 660, 306-309;
Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3, 2765-2770), a
thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20,
533-538), an aliphatic chain, e.g., dodecandiol or undecyl residues
(Saison-Behmoaras et al., EMBO J, 1991, 10, 1111-1118; Kabanov et
al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie,
1993, 75, 49-54), a phospholipid, e.g., di-hexadecyl-rac-glycerol
or triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate
(Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et
al., Nucl. Acids Res., 1990, 18, 3777-3783), a polyamine or a
polyethylene glycol chain (Manoharan et al., Nucleosides &
Nucleotides, 1995, 14, 969-973), or adamantane acetic acid
(Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654), a
palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264,
229-237), or an octadecylamine or
hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J.
Pharmacol. Exp. Ther., 1996, 277, 923-937. Oligonucleotides of the
invention may also be conjugated to active drug substances, for
example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen,
fenbufen, ketoprofen, (S)-(+)-pranoprofen, carprofen,
dansylsarcosine, 2,3,5-triiodobenzoic acid, flufenamic acid,
folinic acid, a benzothiadiazide, chlorothiazide, a diazepine,
indomethicin, a barbiturate, a cephalosporin, a sulfa drug, an
antidiabetic, an antibacterial or an antibiotic.
Oligonucleotide-drug conjugates and their preparation are described
in U.S. patent application Ser. No. 09/334,130 (filed Jun. 15,
1999) which is incorporated herein by reference in its
entirety.
[0055] Representative United States patents that teach the
preparation of such oligonucleotide conjugates include, but are not
limited to, U.S. Pat. Nos. 4,828,979; 4,948,882; 5,218,105;
5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717, 5,580,731;
5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077;
5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735;
4,667,025; 4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335;
4,904,582; 4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830;
5,112,963; 5,214,136; 5,245,022; 5,254,469; 5,258,506; 5,262,536;
5,272,250; 5,292,873; 5,317,098; 5,371,241, 5,391,723; 5,416,203,
5,451,463; 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810;
5,574,142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923;
5,599,928 and 5,688,941, certain of which are commonly owned with
the instant application, and each of which is herein incorporated
by reference.
[0056] It is not necessary for all positions in a given compound to
be uniformly modified, and in fact more than one of the
aforementioned modifications may be incorporated in a single
compound or even at a single nucleoside within an oligonucleotide.
The present invention preferably includes antisense compounds which
are chimeric compounds. "Chimeric" antisense compounds or
"chimeras," in the context of this invention, are antisense
compounds, particularly oligonucleotides, which contain two or more
chemically distinct regions, each made up of at least one monomer
unit, i.e., a nucleotide in the case of an oligonucleotide
compound. These oligonucleotides typically contain at least one
region wherein the oligonucleotide is modified so as to confer upon
the oligonucleotide increased resistance to nuclease degradation,
increased cellular uptake, and/or increased binding affinity for
the target nucleic acid. An additional region of the
oligonucleotide may serve as a substrate for enzymes capable of
cleaving RNA:DNA or RNA:RNA hybrids.
[0057] By way of example, RNase H cleaves the RNA strand of an
RNA:DNA duplex. Activation of RNase H, therefore, results in
cleavage of the RNA target, thereby greatly enhancing the
efficiency of oligonucleotide inhibition of gene expression.
Consequently, comparable results can often be obtained with shorter
oligonucleotides when chimeric oligonucleotides are used, compared
to phosphorothioate deoxyoligonucleotides hybridizing to the same
target region. Oligonucleotides, particularly chimeric
oligonucleotides, designed to elicit target cleavage by RNase H,
thus are generally more potent than oligonucleotides of the same
base sequence which are not so optimized. Cleavage of the RNA
target can be routinely detected by, for example, gel
electrophoresis and, if necessary, associated nucleic acid
hybridization techniques known in the art.
[0058] Chimeric oligonucleotides may have one or more modifications
of the internucleoside (backbone) linkage, the sugar or the base.
In a preferred embodiment, the oligonucleotide is a chimeric
oligonucleotide having a modification at the 2' position of at
least one sugar moiety. Presently believed to be particularly
preferred are chimeric oligonucleotides which have approximately
four or more deoxynucleotides in a row, which provide an RNase H
cleavage site, flanked on one or both sides by a region of
2'-modified oligonucleotides.
[0059] Chimeric antisense compounds of the invention may be formed
as composite structures of two or more oligonucleotides, modified
oligonucleotides, oligonucleosides and/or oligonucleotide mimetics
as described above. Such compounds have also been referred to in
the art as hybrids or gapmers. Representative United States patents
that teach the preparation of such hybrid structures include, but
are not limited to, U.S. Pat. Nos. 5,013,830; 5,149,797; 5,220,007;
5,256,775; 5,366,878; 5,403,711; 5,491,133; 5,565,350; 5,623,065;
5,652,355; 5,652,356; and 5,700,922, certain of which are commonly
owned with the instant application, and each of which is herein
incorporated by reference in its entirety.
[0060] The antisense compounds used in accordance with this
invention may be conveniently and routinely made through the
well-known technique of solid phase synthesis. Equipment for such
synthesis is sold by several vendors including, for example,
Applied Biosystems (Foster City, Calif.). Any other means for such
synthesis known in the art may additionally or alternatively be
employed. It is well known to use similar techniques to prepare
oligonucleotides such as the phosphorothioates and alkylated
derivatives.
[0061] Antisense inhibition of human RNase III expression was used
to further evaluate the role(s) of RNase III. To identify optimal
sites in RNase III mRNA for antisense effects, 2'-O-methoxyethyl
chimeric antisense oligonucleotides targeted to 10 sites in the
mRNA were designed and screened for inhibition of RNase III. These
are shown in Table 1. These chimeric or "gapped" oligonucleotides
are designed to serve as substrates for RNase H when bound to RNA
resulting in degradation of the target RNA and oligonucleotides of
this type have been shown to be highly specific when used under the
described conditions.
TABLE-US-00001 TABLE 1 Antisense inhibition of human RNase III SEQ
Target % ID ISIS # Sequence (5'-->3') sites Inhib'n NO: 25690
ATCCCTTTCTTCCGCATGTG 3051-3070 79 8 25691 GCCAAGGCGTGACATGATAT
3085-4004 96 9 25692 CGGATCATTAAAGAGCAAGC 3442-3461 78 10 25693
TATTCACCAAAGAGCTTCGC 3776-3795 49 11 25694 CAATCGTGGAAAGAAGCAGA
3973-3992 50 12 25695 GCTCCCATTTCCGCTTGCTG 4197-4216 81 13 25696
ATGCTCTCTTTCCCACCTCA 4308-4327 70 14 25697 AAATACTCCACACTTGCATG
4378-4397 79 15 25698 TGCACATTCACCAAAGTCAA 4420-4439 44 16 25699
AGTCTAGGGTCACAATCTGG 4688-4707 31 17 27110 TTCAGTTGTAGTGGTCCGAC
3-mismatch N/D 18 of 25691
All oligonucleotides in Table 1 have phosphorothioate (P.dbd.S or
PS) backbones and 2'-methoxyethoxy (2'MOE) "wings" flanking a
2'deoxy gap. 2'MOE nucleotides are shown in bold. All cytosines are
5-methyl cytosines (5meC). Target site refers to nucleotide numbers
on the cloned RNase III cDNA (SEQ ID NO: 1) to which the
oligonucleotide binds. Oligonucleotide concentration was 200
nM.
[0062] Table 1 shows that ISIS 25690, 25691, 25692, 25693, 25694,
25695, 25696 and 25697 (SEQ ID NO: 8, 9, 10, 11, 12, 13, 14 and 15)
inhibited human RNase III expression by about 50% or more. These
compounds are therefore preferred. The most effective agent was
ISIS 25691 (SEQ ID NO: 9), targeted to nucleotides 3085-4004 in the
coding region of the mRNA. This compound was selected for further
studies.
[0063] Increasing concentrations of ISIS 25691 caused increasing
loss of RNase III mRNA, with 300 nM resulting in loss of more than
90% of the RNase III mRNA. The mismatch control oligonucleotide,
ISIS 27110 (SEQ ID NO: 18), at 300 nM had no effect on the RNase
III mRNA level. ISIS 25691 at 300 nM suppressed RNase III mRNA
levels in HeLa cells from 2 to 72 hours after a single treatment.
After treatment with ISIS 25691 at 100, 150 or 200 nM for 24 hours,
RNase III protein was reduced to 67%, 44% or 19% of control
respectively. The level of RNase III protein was slightly reduced
at 5 hours after treatment and reached a maximum reduction of about
70% at 18 hours.
[0064] Immunofluorescence staining showed that after treatment with
ISIS 25691 (150 nM, 24 hours), RNase III was dramatically reduced
or absent in the nucleus and nucleoli. After treatment of HeLa
cells with ISIS 25691 at 300 nM for 18 hours, the morphology of
HeLa cells changed from fusiform to oval. After 24 hours of
treatment, approximately 5-10% of the cells detached from the plate
and could be stained with trypan blue indicating cell death. The
cells that remained attached to the solid substrate grew much more
slowly than untreated cells and appeared unable to enter mitosis
(data not shown). After 48 hours, 40-50% of the cells treated with
300 nM ISIS 25691 were dead. These results were highly reproducible
and indicate that RNase III is required for HeLa cell survival. The
control oligonucleotide had no effect at any time or at any
concentration on cell morphology, RNase III mRNA or protein levels
demonstrating the antisense effect was highly specific.
[0065] One function that has been attributed to RNase III in lower
species is pre-ribosomal RNA (pre-rRNA) processing. Human pre-rRNA
processing is thought to involve cleavage of 45S pre-rRNA into 30S
and 32S fragments. The 32S RNA product of the cleavage of 45S
pre-rRNA contains 5.8S rRNA, ITS2 and 28S rRNA. Cleavage of the 32S
RNA results in 12S pre-rRNA and 28S rRNA products. The 12S pre-rRNA
is further cleaved to 5.8S rRNA. Because ribosomes are made in the
nucleolus, and the human RNase III protein appeared to be
translocated to and from the nucleolus during the cell cycle, its
potential role(s) in human pre-rRNA processing was evaluated. Two
hybridization probes for human pre-rRNA were synthesized, 5'ETS-1
(5'-CAA GGC ACG CCT CTC AGA TCG CTA GAG AAG GCT TTT CTC A-3'; SEQ
ID NO: 19), designed to bind to the 5' external transcribed spacer
(5'ETS) of human pre-rRNA and 5.8S-1 (5'-CAT TAA TTC TCG CAG CTA
GCG CTG CGT TCT TCA TCG ACG C-3'; SEQ ID NO: 20), designed to bind
to 5.8S rRNA. When total cellular RNA (15 .mu.g) from untreated
HeLa cells was fractionated by agarose gel electrophoresis,
transferred to a nylon membrane and probed with .sup.32P-5'ETS-1, a
band corresponding to 45S pre-rRNA and a very faint band
corresponding in mobility to 30S (5'ETS-18S-ITS1) pre-rRNA were
observed. When .sup.32P-5.8S-1 was used, bands corresponding to
45S, 32S (5.8S-ITS2-28S) and 12S (5.8S-ITS2) pre-rRNA and 5.8S rRNA
were observed. At concentrations at which the antisense
oligonucleotide ISIS 25691 dramatically reduced the RNase III
level, no effect on the 45S pre-rRNA level was observed. In
contrast, the 5.8S-1 probe demonstrated that antisense inhibition
of RNase III increased the levels of 32S and 12S pre-rRNAs.
[0066] To provide further confirmation that human RNase III is
involved in preribosomal RNA processing, the effects of ten
antisense oligonucleotides on RNase III mRNA levels were compared
to the effects of these oligonucleotides on accumulation of the two
pre-rRNA species (32S and 12S) that accumulated after treatment
with the most potent of the antisense inhibitors, ISIS 25691. The
potency of antisense inhibitors designed to bind to different sites
in RNase III mRNA varied. The correlation between the reduction of
RNase III RNA levels and the accumulation of both 32S and 12S
pre-rRNAs was excellent, thus confirming the conclusion derived
from the Northern blot analysis.
[0067] Antisense inhibition of RNase III resulted in substantial
accumulation of 12S pre-rRNA, less pronounced accumulation of 32S
pre-rRNA and no accumulation of 45S pre-rRNA. Thus this human RNase
III appears to be required for the processing of 12S pre-rRNA. It
may also be involved in the processing of 32S pre-rRNA. The
principal site of cleavage induced by human RNase III described
here is in the 5.8S-ITS2 region of pre-rRNA.
[0068] RNase III enzymes are double-strand RNA (dsRNA)
endoribonucleases. To test whether the human RNase III domain can
specifically cleave dsRNA, the RNase III domain-coding region was
subcloned into a glutathione S-transferase (GST) expression vector.
The GST-RNase III fusion protein and GST alone were expressed,
purified using glutathione agarose and analyzed by coomassie blue
staining of the SDS-PAGE and Western Blot analysis with anti-human
RNase III peptide antibody. These studies showed that the human
RNase III domain was greater than 85% pure, though there was
evidence of slight degradation during expression and purification.
When incubated with labeled dsRNA and ssRNA, the GST-RNase III
fusion protein preferentially digested the dsRNA without
significant cleavage of ssRNA, while GST alone cleaved neither
dsRNA nor ssDNA substrate. Thus, the cleavage observed was not due
to contamination with ssRNases or dsRNases from E. coli.
Ribonucleases V.sub.1 (dsRNase), and T.sub.1 and A (ssRNases) were
used as controls to confirm that the cleavage observed was dsRNA
cleavage.
[0069] RNase III is a double-strand RNA endonuclease, specifically
cleaving double-helical structures in cellular and viral RNAs. It
is believed that this cleavage can be exploited to promote cleavage
of a cellular RNA target, by providing "RNA-like" antisense
oligonucleotides which hybridize to the cellular RNA target to form
an RNA duplex, thus eliciting RNase III cleavage. Methods of
promoting inhibition of expression by antisense oligonucleotides,
and methods for screening oligonucleotides are thus provided. In
the context of this invention, "promoting antisense inhibition" or
"promoting inhibition of expression" of a selected RNA target, or
of its protein product, means inhibiting expression of the target
or enhancing the inhibition of expression of the target. In some
embodiments of these methods, the RNase III is present in an
enriched amount. In the context of this invention, "enriched" means
an amount greater than would naturally be found. RNase III may be
present in an enriched amount through, for example, addition of
exogenous RNase III, through selection of cells which overexpress
RNase III or through manipulation of cells to cause overexpression
of RNase III. The exogenously added RNase III may be added in the
form of, for example, a cellular or tissue extract, a biochemically
purified or partially purified preparation of RNase III, or a
cloned and expressed RNase III polypeptide.
[0070] The expression of large quantities of a cloned human RNase
III of the present invention has been shown to be useful in
characterizing the activities of this enzyme. In addition, the
polynucleotides and polypeptides of the present invention provide a
means for identifying agents, such as the antisense compounds
described herein, which modulate the function of this enzyme in
human cells and tissues. For example, a host cell can be
genetically engineered to incorporate polynucleotides and express
polypeptides of the present invention. Polynucleotides can be
introduced into a host cell using any number of well known
techniques such as infection, transduction, transfection or
transformation. The polynucleotide can be introduced alone or in
conjunction with a second polynucleotide encoding a selectable
marker. In a preferred embodiment, the host comprises a mammalian
cell. Such host cells can then be used not only for production of
human RNase III, but also to identify agents which increase or
decrease levels of expression or activity of human RNase III in the
cell. In these assays, the host cell would be exposed to an agent
suspected of altering levels of expression or activity of human
RNase III in the cells. The level or activity of human RNase III in
the cell would then be determined in the presence and absence of
the agent. Assays to determine levels of protein in a cell are well
known to those of skill in the art and include, but are not limited
to, radioimmunoassays, competitive binding assays, Western blot
analysis and enzyme linked immunosorbent assays (ELISAs). Methods
of determining increased activity of the enzyme, and in particular
increased cleavage of dsRNA substrate can be performed in
accordance with the teachings of the examples of the present
application. Agents identified as modulators of the level or
activity of this enzyme may be useful.
[0071] Antisense modulators of human RNase III are provided herein
and may be used diagnostically, therapeutically and for research
purposes.
[0072] The following nonlimiting examples are provided to further
illustrate the present invention.
EXAMPLES
Example 1
cDNA Cloning
[0073] An internet search of the XREF database in the National
Center of Biotechnology Information (NCBI) yielded a 393 base pair
(bp) human expressed sequenced tag (EST, GenBank accession
AA083888), homologous to the yeast RNase III (RNTI) gene (GenBank
accession #AAB04172; SEQ ID NO: 5) and the C. elegans RNase III
gene (GenBank accession 001326; SEQ ID NO: 3). Three sets of
oligonucleotide primers encoding the human RNase H EST sequence
were synthesized. Sequence-specific primer sets listed in Table 2
were designed based on the human expressed tag sequence or early
cloned cDNA fragments. These are shown in Table 2. These primers
were used in polymerase chain reaction for 3' and 5' RACE and/or
for detection on Southern blots.
TABLE-US-00002 TABLE 2 RNase III Oligonucleotide Primers Primer
Sequence Position in full SEQ ID Primer name source length cDNA NO
Sequence NIII-2 EST AA083888 3516-3550 21
CCAAATACTGATCGACAACTTATTGAAACTT CTCC NIII-4 EST AA083888 3569-3606
22 GAGTTTGAAGAAGCAATTGGAGTAATTTTT ACTCATG NIII-6 EST AA083888
3607-3634 23 TCGACTTCTGGCAAGGGCATTCACATT 3RACE3 Clone #3-4
2708-2683 24 CCTCTGTGCCAGCTTCTGTTTGTCAG 3RACE2 Clone #3-4 2688-2663
25 TGTCAGTTTGTTTGACTTTGGGACTA 3RACE1 Clone #3-4 2662-2637 26
TTTGCTAGGAGGTGGCGAAGTTTCAC RACE4 Clone #L40 1923-1894 27
GCTTGATGGCCTCTTCTCCAGGATAAATGC RACE5 Clone #L40 1898-1869 28
AATGCTGTGCCTAATTCCTGTGCGTCTTGC RACE Det Clone #L40 1723-1676 29
CAGGTGCTGTCCTCATCAGACTCACACTCGG ATTCACTGGAACTCTCT 33G Clone #25
831-806 30 CACTGGGCAGGAAAGAACTAGGGTTG 33H Clone #25 802-776 31
TGGAAACTATTAAAACTGGGAGGTGG 33 Det Clone #25 701-652 32
AGGCATGGAGGGAGGGGGCATCATGAAGG GGAAAGTGCCTTGTCCAGGAG
By 3' RACE (rapid amplification of 3'cDNA), the human RNase III
cDNA 3' from the expressed tag sequence was amplified by PCR using
human Marathon ready cDNA (Clontech, Palo Alto Calif.) as
templates, and NIII-2/AP1 (for the first amplification) and
NIII-4/AP2 (for the second amplification) as primers. AP1 and AP2
are primers provided with the Marathon ready cDNA by the
manufacturer. The standard DNA polymerase chain reaction (PCR)
procedure was performed using native pfu DNA polymerase
(Stratagene, San Diego Calif.) and its reaction buffer. The
annealing temperature was 55-60.degree. C. The elongation time was
approximately 6-8 min. The fragments were subjected to agarose gel
electrophoresis. The fragments were subjected to agarose gel
electrophoresis in the TAE buffer, denatured in 0.5 M NaOH and then
electronically transferred to a nitrocellulose membrane (Bio-Rad,
Hercules, Calif.) for confirmation by Southern blot. Southern blots
were performed using [.sup.32P]-end labeled NIII-6 oligonucleotide
as a probe in hybridization buffer (6.times.SSC, 5.times.Denhardts
solution) containing 100 .mu.g/ml sheared denatured salmon sperm
DNA, 0.5% SDS, 10 mM EDTA at 46.degree. C. for 4 hr, then washed
twice with 1.times.SSC and 0.1% SDS at 42-59.degree. C. for 20 min.
The confirmed fragments were excised from the agarose gel and
purified by gel extraction (Qiagen, Germany), then subcloned into a
zero-blunt vector (Invitrogen, Carlsbad, Calif.) and subjected to
DNA sequencing.
Example 2
Screening of the cDNA Libraries, DNA Sequencing and Sequence
Analysis
[0074] A human liver cDNA lambda phage Uni-ZAP library (Stratagene,
La Jolla, Calif.) was screened using the RACE products as specific
probes. Several positive clones were isolated. The two longest
clones, 3-1 and 3-4, correspond to the COOH-terminal region,
nucleotides 2636-3912 and 3350-4764, respectively, of the full
length cDNA. With primers (3RACE1, 3RACE2 and 3RACE3) based on the
NH.sub.2-terminal portion of the clone 3-4,5' RACE was performed to
clone a cDNA (clone L40) of approximately 1 kb, which encodes the
middle part (nucleotides 1661-2688) of the full length cDNA. In the
same way, a cDNA (clone 25) of the NH.sub.2-terminal portion
(nucleotides 645-1898) was cloned. Using clone 25 to screen the
liver library again, several clones were isolated, but none
included additional NH.sub.2-terminal sequence. The most
NH.sub.2-terminal clone (328) corresponded to nucleotides 799-2191.
The last 5' RACE was performed with primers 33G, 33H and 33Dec,
based on clone 25, and the NH.sub.2-terminal portion of the cDNA
(clone 81, corresponding to nucleotides 1-802) was generated.
[0075] The positive cDNA clones were excised into pBluescript
phagemid from lambda phage and subjected to DNA sequencing.
Sequencing of the positive clones was performed with an automatic
DNA sequencer by Retrogen Inc. (San Diego, Calif.). The overlapping
sequences were aligned and combined by the assembling program of
MacDNASISv3.0 (Hitachi Software Engineering Co., America, Ltd.) to
give the full length (4764 nucleotides) polynucleotide sequence
(SEQ ID NO: 1). Protein structure and analysis were performed by
the program MacVector v6.0 (Oxford Molecular Group, UK). A homology
search was performed on the NCBI database.
Example 3
Antisense Treatment
[0076] HeLa cells were transfected with oligonucleotide mixed with
Lipofectin (GIBCO BRL, Gaithersburg, Md.) at a concentration of
37.5-300 nM for 5 hours in Opti-MEM (GIBCO BRL). After removing the
medium containing oligonucleotide, cells were cultured in DMEM for
times indicated and harvested for analysis. Inhibition by antisense
oligonucleotides is expressed compared to control (without
oligonucleotide treatment).
Example 4
Northern Hybridization
[0077] Total RNA was isolated from HeLa cells using the guanidine
isothiocyanate method (R. E. Kingston, in Current protocols in
molecular biology, F. M. Ausubel, et al., Eds., John Wiley &
Sons Inc., New York, 1997, vol. 1, pp. 4.2.3-4.2.5.). Fifteen .mu.g
of total RNA was separated on a 1% agarose/formaldehyde gel and
transferred to Hybond-N+ (Amersham, Arlington Heights, Ill.)
followed by fixing using UV crosslinker (Stratagene, La Jolla,
Calif.). To detect RNase III mRNA, hybridization was performed by
using .sup.32P-labeled human RNase III cDNA in Quik-Hyb buffer
(Stratagene, La Jolla, Calif.) at 68.degree. C. for 2 hours. After
hybridization, membranes were washed in a final stringency of
0.1.times.SSC/0.1% SDS at 60.degree. C. for 30 minutes. Membranes
were analyzed using a PhosphorImager Storm 860 (Molecular Dynamics,
Sunnyvale, Calif.). The level of glyceraldehyde-3-phosphate
dehydrogenase (GAPDH) mRNA was used to normalize the amount of
total RNA loaded.
[0078] For Northern hybridization of pre-rRNAs, HeLa cells were
treated with ISIS 25691 and ISIS 27110 for 24 hours using
.sup.32P-end labeled oligo probes 5'ETS-1 (5'-CAA GGC ACG CCT CTC
AGA TCG CTA GAG AAG GCT TTT CTC A-3'; SEQ ID NO: 33), corresponding
to 5'ETS and 5.8S-1(5'-CAT TAA TTC TCG CAG CTA GCG CTG CGT TCT TCA
TCG ACG C-3'; SEQ ID NO: 34), corresponding to 5.8S rRNA.
Hybridizations were performed at 40.degree. C. for 2 hours and
washed in 2.times.SSC/0.1% SDS at 40.degree. C. for 1 hour. All
others were as described above. Data were mean.+-.SD of triplicate
determination of representative experiment.
Example 5
Western Blot Analysis of Human RNase III
[0079] Nuclear and non-nuclear fractions from HeLa cells were
prepared as described (Dignam et al., Nucleic Acids Res 1983, 11,
1475-89. Whole cell, non-nuclear and nuclear fractions were boiled
in SDS-sample buffer. Then the samples were separated by SDS-PAGE
using 4-20% Tris-glycine gels (NOVEX, San Diego, Calif.) under
reducing conditions. Molecular weight prestained markers were used
(NOVEX) to determine the protein sizes. The proteins were
electrophoretically transferred to a PVDF-membrane and processed
for immunoblotting using affinity purified anti-SR peptide antibody
at 5 .mu.g/ml. The immunoreactive bands were visualized using the
enhanced chemiluminescence method (Amersham, Arlington Heights,
Ill.) and analyzed using a PhosphorImager Storm 860 (Molecular
Dynamics, Sunnyvale, Calif.).
Example 6
Antibody Production
[0080] Antibodies were prepared to peptides synthesized having
amino acid sequences contained within the SR domain and the III
domain of human RNase III. The SR domain peptide
(H--CRSDYDRGRTPSRHRSYERS-OH, amino acids 226 to 284; SEQ ID NO: 35)
and the III region peptide (H--CRWEREHQEREPDETEDIKK-OH, amino acids
1356 to 1374; SEQ ID NO: 36) were synthesized, coupled to
diphtheria toxoid through maleimidocaproyl-N-hydroxysuccinamide
(MCS), mixed with Freund's adjuvant (complete for first
immunization, incomplete for remaining immunizations) and injected
intramuscularly into New Zealand White rabbits. Serum was collected
after the second immunization. Antibody titer was measured by
ELISA. Anti-SR and anti-III peptide IgGs were affinity purified
with SR and III peptides coupled to thiopropyl-Sepharose 6B,
respectively.
Example 7
Indirect Immunofluorescence Staining of Human RNase III
[0081] HeLa cells were cultured in chamber slides for
immunostaining. Cells were washed once with Dulbecco's Phosphate
Buffered Saline (D-PBS, pH7.0), and then fixed in 10%
neutral-buffered formalin for 10 minutes followed by washing three
times with D-PBS. Fixed cells were then blocked for 30 minutes with
20% fetal bovine serum plus 0.5% Tween 20. Cells were first stained
with anti-III peptide antibody (10 .mu.g/ml) for 1 hour at
37.degree. C., washed three times with D-PBS plus 0.1% NP-40, and
incubated for 1 hour at 37.degree. C. with the FITC goat
anti-rabbit IgG (Jackson ImmunoResearch Laboratory, Inc. West
Grove, Pa.). The cells were washed with D-PBS three times and
mounted in mounting medium (Vector, Burlingame, Calif.) for
examination under a fluorescence microscope. NR IgG: normal rabbit
IgG was used as control.
Example 8
Indirect Immunofluorescence Staining of Human RNase III in HeLa
Cells in Different Phases of the Cell Cycle
[0082] HeLa cells were synchronized at early-S phase using the
double thymidine method (Johnson et al., in The Cell Cycle: A
Practical Approach P. Fantes, R. Brooks, Eds., IRL Press, 1993, pp.
1-24). Briefly, cells were cultured in Dulbecco's Modified Eagle
Medium (DMEM, 10% fetal calf serum) containing 2 mM of thymidine
for 17 hours. After washing twice with D-PBS, cells were cultured
in DMEM for 9 hours followed by second thymidine treatment for 15
hours. Synchronized cells were then washed twice with D-PBS,
cultured and harvested at 0, 2, 4, 6, 8 and 24 hours for
immunofluorescence staining and FACS analysis. HeLa cells were
detached from culture flasks with trypsin-EDTA and washed once with
D-PBS containing 5 mM of EDTA. Cells were then fixed in 70% ethanol
for 1 to 24 hours at 4.degree. C. followed by propidium iodine (PI,
50 .mu.g/ml) staining for 1 hour at room temperature. Cell counts
(Y axis) and PI content (X axis) were determined by FACS analysis
(Becton Dickinson and Co., San Jose, Calif.).
Example 9
Expression of GST-RNase III Domain Fusion Protein
[0083] A cDNA fragment encoding the human RNase III-like domain
(C-terminal-most 466 amino acids) was amplified by PCR and
introduced into a BamH I site upstream and Not I site downstream.
This fragment was further subcloned into the sites of the
expression vector pGEX-4T-1 (Pharmacia Biotech, Piscataway, N.J.)
to produce the RNase III fusion protein with Glutathione
S-transferase (GST) at its N-terminus. The identity of the
construct was proven by DNA sequencing. The GST-RNase III fusion
protein was expressed in E. coli strain BL21 and purified using
glutathione agarose (Pharmacia Biotech, Piscataway, N.J.) under
native conditions with B-PER bacterial protein extraction reagent
(Pierce, Rockford, Ill.). Control GST protein was also prepared in
parallel from the pGEX-4T-1 plasmid. The purified products were
identified by Coomassie staining after 12% SDS-polyacrylamide gel
electrophoresis and Western blot analyses with anti-RNase III
peptide antibody (see examples above).
Example 10
In Vitro Cleavage of dsRNA
[0084] The dsRNA substrate was generated by hybridization of two
complementary strands of RNA produced with T7 and T3 polymerase
transcription of the polylinker region of the pBluscript II KS(-)
plasmid (Stratagen, San Diego, Calif.). The plasmid was digested
with either Sst I or Kpn I and further purified with
phenol/chloroform extraction and ethanol precipitation. The Sst I
or Kpn I-digested plasmids were then transcribed using T7 or T3 RNA
polymerase respectively (Stratagene, San Diego, Calif.) with or
without .sup.32P-.alpha.UTP. The resulting transcribed RNAs (about
100 nt) were purified by electrophoresis on 6% denaturing
polyacrylamide gel. The .sup.32P radiolabeled T7 transcript and
unlabeled T3 transcript fragments were mixed and heated for 5 min
at 90.degree. C. in a buffer containing 20 mM KCl, 50 mM Tris-HCl
(pH 7.5), 0.1 mM EDTA. MgCl, BSA and RNase inhibitor were added to
the mixture after heating (final concentrations were 10 mM. 100
ng/ml and 10 unit/ml respectively). The mixture was incubated at
37.degree. C. for 2 hr and the duplex RNA was purified on 6%
non-denaturing gels. The .sup.32P-labelled T7 transcript was also
used as the ssRNA control substrate. To evaluate cleavage, 0.4
.mu.g of GST protein or GST-RNase III (approximately 5-10 pmole of
purified GST-RNase III) fusion protein was incubated with labeled
dsRNA (250,000 cpm) (approximately 5-10 fmole) and ssRNA (250,000
cpm) at 37.degree. C. in a buffer containing 20 mM KCl, 50 mM
Tris-HCl (pH 7.5), 5 mM MgCl, 50 mM NaCl, 0.1 mM DTT, 0.1 mg/ml
yeast tRNA and 10 unit/ml RNase inhibitor in the total volume of 60
.mu.l. The digested samples were quenched at specific times and
analyzed using non-denaturing polyacrylamide gel electrophoresis
and PhosphorImager analysis.
Sequence CWU 1
1
3614764DNAHomo sapiens 1ctgtcttggt acctgcggta gtagcctggc tttgctctga
cggcgatctc gcggcccgag 60agccttttat aggttgcttt tcccggggat gtgaaggata
cagaaatgac tgtgaatcaa 120cccatatcat caaggagctg ataatctagt
ggaagagtta gacgtgtgca tacttcacta 180tgatatgagg cagtctctga
gcttatattc tctgtggaag atgtgacata tccaggcgga 240acatcatgat
gcagggaaac acatgtcaca gaatgtcgtt ccacccggga cgagggcgtc
300cccgaggacg aggaggacat ggagccagac cctcagcacc atcctttagg
ccccaaaatc 360tgaggctgct tcaccctcag cagcctcctg tgcaatatca
atatgaacct ccaagtgccc 420cttccaccac tttctcaaac tctccagccc
ccaattttct ccctccacga ccagactttg 480tacccttccc cccacccatg
cctccgtcag cgcaaggccc tcttcccccc tgcccaatca 540ggccgccttt
ccccaaccac cagatgaggc accccttccc agttcctcct tgttttcctc
600ccatgccacc accaatgcct tgtcctaata accccccagt ccctggggca
cctcctggac 660aaggcacttt ccccttcatg atgccccctc cctccatgcc
tcatcccccg ccccctccag 720tcatgccgca gcaggttaat tatcagtacc
ctccgggcta ttctcaccac aacttcccac 780ctcccagttt taatagtttc
cagaacaacc ctagttcttt cctgcccagt gctaataaca 840gcagtagtcc
tcatttcaga catctccctc catacccact cccaaaggct cccagtgaga
900gaaggtcccc agaaaggctg aaacactatg atgaccacag gcaccgagac
cacagtcatg 960ggcgaggtga gaggcatcgg tccctggatc ggcgggagcg
aggccgcagt cccgacagga 1020gaagacaaga cagccggtac agatctgatt
atgaccgagg gagaacacca tctcgccacc 1080gcagctacga acggagcaga
gagcgagaac gggagagaca caggcatcga gacaaccgaa 1140gatcaccatc
tctggaaagg tcctacaaaa aagagtataa gagatctgga aggagttacg
1200gtttatcggt tgttcctgaa cctgctggat gcacaccaga attacctggg
gagattatta 1260aaaatacaga ttcttgggcc ccacccctgg agattgtgaa
tcatcgctcc ccaagtaggg 1320agaagaagag agctcgttgg gaggaagaaa
aagaccgttg gagtgacaac cagagttctg 1380gcaaagacaa gaactatacc
tcaatcaagg aaaaagagcc cgaggagacc atgcctgaca 1440agaatgagga
ggaagaagaa gaacttctta agcctgtgtg gattcgatgc actcattcag
1500aaaactacta ctccagtgac cccatggatc aggtgggaga ttctacagtg
gttggaacga 1560gtaggcttcg tgacttatat gacaaatttg aggaggagtt
ggggagcagg caagaaaagg 1620ccaaagctgc tcggcctccg tgggaacctc
caaagacgaa gctcgatgaa gatttagaga 1680gttccagtga atccgagtgt
gagtctgatg aggacagcac ctgttctagc agctcagact 1740ctgaagtttt
tgacgttatt gcagaaatca aacgcaaaaa ggcccaccct gaccgacttc
1800atgatgaact ttggtacaac gatccaggcc agatgaatga tggaccactc
tgcaaatgca 1860gcgcaaaggc aagacgcaca ggaattaggc acagcattta
tcctggagaa gaggccatca 1920agccctgtcg tcctatgacc aacaatgctg
gcagactttt ccactaccgg atcacagtct 1980ccccgcctac gaacttttta
actgacaggc caactgttat agaatacgat gatcacgagt 2040atatctttga
aggattttct atgtttgcac atgcccccct gaccaatatt ccactgtgta
2100aagtaattag attcaacata gactacacga ttcatttcat tgaagagatg
atgccggaga 2160atttttgtgt gaaagggctt gaactctttt cactgttcct
attcagagat attttggaat 2220tatatgactg gaatcttaaa ggtcctttgt
ttgaagacag ccctccctgc tgcccaagat 2280ttcatttcat gccacgtttt
gtaagatttc ttccagatgg aggaaaggaa gtgctgtcca 2340tgcaccagat
tctcctgtac ttgttaaggt gcagcaaagc cctggtgcct gaggaggaga
2400ttgccaatat gcttcagtgg gaggagctgg agtggcagaa atatgcagaa
gaatgcaaag 2460gcatgattgt taccaaccct gggacgaaac caagctctgt
ccgtatcgat caactggatc 2520gtgaacagtt caaccccgat gtgattactt
ttccgattat cgtccacttt gggatacgcc 2580ctgcacagtt gagttatgca
ggagacccac agtaccaaaa actgtggaag agttatgtga 2640aacttcgcca
cctcctagca aatagtccca aagtcaaaca aactgacaaa cagaagctgg
2700cacagaggga ggaagccctc caaaaaatac ggcagaagaa tacaatgaga
cgagaagtaa 2760cggtggagct aagtagccaa ggattctgga aaactggcat
ccgttctgat gtctgtcagc 2820atgcaatgat gctacctgtt ctgacccatc
atatccgcta ccaccaatgc ctaatgcatt 2880tggacaagtt gataggatat
actttccaag atcgttgtct gttgcagctg gccatgactc 2940atccaagtca
tcatttaaat tttggaatga atcctgatca tgccaggaat tcattatcta
3000actgtggaat tcggcagccc aaatacggag acagaaaagt tcatcacatg
cacatgcgga 3060agaaagggat taacaccttg ataaatatca tgtcacgcct
tggccaagat gacccaactc 3120cctcgaggat taaccacaat gaacggttgg
aattcctggg tgatgctgtt gttgaatttc 3180tgaccagcgt ccatttgtac
tatttgtttc ctagtctgga agaaggagga ttagcaacct 3240atcggactgc
cattgttcag aatcagcacc ttgccatgct agcaaagaaa cttgaactgg
3300atccatttat gctgtatgct cacgggcctg acctttgtag agaatcggac
cttcgacatg 3360caatggccaa ttgttttgaa gcgttaatag gagctgttta
cttggaggga agcctggagg 3420aagccaagca gttatttgga cgcttgctct
ttaatgatcc ggacctgcgc gaagtctggc 3480tcaattatcc tctccaccca
ctccaactac aagagccaaa tactgatcga caacttattg 3540aaacttctcc
agttctacaa aaacttactg agtttgaaga agcaattgga gtaattttta
3600ctcatgttcg acttctggca agggcattca cattgagaac tgtgggattt
aaccatctga 3660ccctaggcca caatcagaga atggaattcc taggtgactc
cataatgcaa ctggtagcca 3720cagagtactt attcattcat ttcccagatc
atcatgaagg acacttaact ttgttgcgaa 3780gctctttggt gaataataga
actcaggcca aggtagcgga ggagctgggc atgcaggagt 3840acgccataac
caacgacaag accaagaggc ctgtggcgct tcgcaccaag accttggcgg
3900accttttgga atcatttatt gcagcgctgt acactgataa ggatttggaa
tatgttcata 3960ctttcatgaa tgtctgcttc tttccacgat tgaaagaatt
cattttgaat caggattgga 4020atgaccccaa atcccagctt cagcagtgtt
gcttgacact taggacagaa ggaaaagagc 4080cagacattcc tctgtacaag
actctgcaga cagtgggccc atcccatgcc cgaacctaca 4140ctgtggctgt
ttatttcaag ggagaaagaa taggctgtgg gaaaggacca agtattcagc
4200aagcggaaat gggagcagca atggatgcgc ttgaaaaata taattttccc
cagatggccc 4260atcagaagcg gttcatcgaa cggaagtaca gacaagagtt
aaaagaaatg aggtgggaaa 4320gagagcatca agagagagag ccagatgaga
ctgaagacat caagaaataa aggagggcat 4380gcaagtgtgg agtatttact
tgctcagtaa ctgtgactgt tgtctattga gacctagcct 4440agttttcctg
cagacaatga acgaagtgtg ctcattgaaa taaaatacag agtcaaatcg
4500ctattgttgt tttaatgatc tgtttttagc tggatggtct ttattacaaa
gtattagatt 4560tttcttctat ttaacggaaa acttgacttt ggtgaatgtg
cattacttcc ttttattttg 4620ctctttaaat aataaaattc aagaagcata
ttctatgtgg aatagatcct gtttttccat 4680ctgtgtccca gattgtgacc
ctagactttc aattgacaag taaaaaattg actttactag 4740taaaaaaaaa
aaaaaaaaaa aaaa 476421374PRTHomo sapiens 2Met Met Gln Gly Asn Thr
Cys His Arg Met Ser Phe His Pro Gly Arg1 5 10 15Gly Cys Pro Arg Gly
Arg Gly Gly His Gly Ala Arg Pro Ser Ala Pro20 25 30Ser Phe Arg Pro
Gln Asn Leu Arg Leu Leu His Pro Gln Gln Pro Pro35 40 45Val Gln Tyr
Gln Tyr Glu Pro Pro Ser Ala Pro Ser Thr Thr Phe Ser50 55 60Asn Ser
Pro Ala Pro Asn Phe Leu Pro Pro Arg Pro Asp Phe Val Pro65 70 75
80Phe Pro Pro Pro Met Pro Pro Ser Ala Gln Gly Pro Leu Pro Pro Cys85
90 95Pro Ile Arg Pro Pro Phe Pro Asn His Gln Met Arg His Pro Phe
Pro100 105 110Val Pro Pro Cys Phe Pro Pro Met Pro Pro Pro Met Pro
Cys Pro Asn115 120 125Asn Pro Pro Val Pro Gly Ala Pro Pro Gly Gln
Gly Thr Phe Pro Phe130 135 140Met Met Pro Pro Pro Ser Met Pro His
Pro Pro Pro Pro Pro Val Met145 150 155 160Pro Gln Gln Val Asn Tyr
Gln Tyr Pro Pro Gly Tyr Ser His His Asn165 170 175Phe Pro Pro Pro
Ser Phe Asn Ser Phe Gln Asn Asn Pro Ser Ser Phe180 185 190Leu Pro
Ser Ala Asn Asn Ser Ser Ser Pro His Phe Arg His Leu Pro195 200
205Pro Tyr Pro Leu Pro Lys Ala Pro Ser Glu Arg Arg Ser Pro Glu
Arg210 215 220Leu Lys His Tyr Asp Asp His Arg His Arg Asp His Ser
His Gly Arg225 230 235 240Gly Glu Arg His Arg Ser Leu Asp Arg Arg
Glu Arg Gly Arg Ser Pro245 250 255Asp Arg Arg Arg Gln Asp Ser Arg
Tyr Arg Ser Asp Tyr Asp Arg Gly260 265 270Arg Thr Pro Ser Arg His
Arg Ser Tyr Glu Arg Ser Arg Glu Arg Glu275 280 285Arg Glu Arg His
Arg His Arg Asp Asn Arg Arg Ser Pro Ser Leu Glu290 295 300Arg Ser
Tyr Lys Lys Glu Tyr Lys Arg Ser Gly Arg Ser Tyr Gly Leu305 310 315
320Ser Val Val Pro Glu Pro Ala Gly Cys Thr Pro Glu Leu Pro Gly
Glu325 330 335Ile Ile Lys Asn Thr Asp Ser Trp Ala Pro Pro Leu Glu
Ile Val Asn340 345 350His Arg Ser Pro Ser Arg Glu Lys Lys Arg Ala
Arg Trp Glu Glu Glu355 360 365Lys Asp Arg Trp Ser Asp Asn Gln Ser
Ser Gly Lys Asp Lys Asn Tyr370 375 380Thr Ser Ile Lys Glu Lys Glu
Pro Glu Glu Thr Met Pro Asp Lys Asn385 390 395 400Glu Glu Glu Glu
Glu Glu Leu Leu Lys Pro Val Trp Ile Arg Cys Thr405 410 415His Ser
Glu Asn Tyr Tyr Ser Ser Asp Pro Met Asp Gln Val Gly Asp420 425
430Ser Thr Val Val Gly Thr Ser Arg Leu Arg Asp Leu Tyr Asp Lys
Phe435 440 445Glu Glu Glu Leu Gly Ser Arg Gln Glu Lys Ala Lys Ala
Ala Arg Pro450 455 460Pro Trp Glu Pro Pro Lys Thr Lys Leu Asp Glu
Asp Leu Glu Ser Ser465 470 475 480Ser Glu Ser Glu Cys Glu Ser Asp
Glu Asp Ser Thr Cys Ser Ser Ser485 490 495Ser Asp Ser Glu Val Phe
Asp Val Ile Ala Glu Ile Lys Arg Lys Lys500 505 510Ala His Pro Asp
Arg Leu His Asp Glu Leu Trp Tyr Asn Asp Pro Gly515 520 525Gln Met
Asn Asp Gly Pro Leu Cys Lys Cys Ser Ala Lys Ala Arg Arg530 535
540Thr Gly Ile Arg His Ser Ile Tyr Pro Gly Glu Glu Ala Ile Lys
Pro545 550 555 560Cys Arg Pro Met Thr Asn Asn Ala Gly Arg Leu Phe
His Tyr Arg Ile565 570 575Thr Val Ser Pro Pro Thr Asn Phe Leu Thr
Asp Arg Pro Thr Val Ile580 585 590Glu Tyr Asp Asp His Glu Tyr Ile
Phe Glu Gly Phe Ser Met Phe Ala595 600 605His Ala Pro Leu Thr Asn
Ile Pro Leu Cys Lys Val Ile Arg Phe Asn610 615 620Ile Asp Tyr Thr
Ile His Phe Ile Glu Glu Met Met Pro Glu Asn Phe625 630 635 640Cys
Val Lys Gly Leu Glu Leu Phe Ser Leu Phe Leu Phe Arg Asp Ile645 650
655Leu Glu Leu Tyr Asp Trp Asn Leu Lys Gly Pro Leu Phe Glu Asp
Ser660 665 670Pro Pro Cys Cys Pro Arg Phe His Phe Met Pro Arg Phe
Val Arg Phe675 680 685Leu Pro Asp Gly Gly Lys Glu Val Leu Ser Met
His Gln Ile Leu Leu690 695 700Tyr Leu Leu Arg Cys Ser Lys Ala Leu
Val Pro Glu Glu Glu Ile Ala705 710 715 720Asn Met Leu Gln Trp Glu
Glu Leu Glu Trp Gln Lys Tyr Ala Glu Glu725 730 735Cys Lys Gly Met
Ile Val Thr Asn Pro Gly Thr Lys Pro Ser Ser Val740 745 750Arg Ile
Asp Gln Leu Asp Arg Glu Gln Phe Asn Pro Asp Val Ile Thr755 760
765Phe Pro Ile Ile Val His Phe Gly Ile Arg Pro Ala Gln Leu Ser
Tyr770 775 780Ala Gly Asp Pro Gln Tyr Gln Lys Leu Trp Lys Ser Tyr
Val Lys Leu785 790 795 800Arg His Leu Leu Ala Asn Ser Pro Lys Val
Lys Gln Thr Asp Lys Gln805 810 815Lys Leu Ala Gln Arg Glu Glu Ala
Leu Gln Lys Ile Arg Gln Lys Asn820 825 830Thr Met Arg Arg Glu Val
Thr Val Glu Leu Ser Ser Gln Gly Phe Trp835 840 845Lys Thr Gly Ile
Arg Ser Asp Val Cys Gln His Ala Met Met Leu Pro850 855 860Val Leu
Thr His His Ile Arg Tyr His Gln Cys Leu Met His Leu Asp865 870 875
880Lys Leu Ile Gly Tyr Thr Phe Gln Asp Arg Cys Leu Leu Gln Leu
Ala885 890 895Met Thr His Pro Ser His His Leu Asn Phe Gly Met Asn
Pro Asp His900 905 910Ala Arg Asn Ser Leu Ser Asn Cys Gly Ile Arg
Gln Pro Lys Tyr Gly915 920 925Asp Arg Lys Val His His Met His Met
Arg Lys Lys Gly Ile Asn Thr930 935 940Leu Ile Asn Ile Met Ser Arg
Leu Gly Gln Asp Asp Pro Thr Pro Ser945 950 955 960Arg Ile Asn His
Asn Glu Arg Leu Glu Phe Leu Gly Asp Ala Val Val965 970 975Glu Phe
Leu Thr Ser Val His Leu Tyr Tyr Leu Phe Pro Ser Leu Glu980 985
990Glu Gly Gly Leu Ala Thr Tyr Arg Thr Ala Ile Val Gln Asn Gln
His995 1000 1005Leu Ala Met Leu Ala Lys Lys Leu Glu Leu Asp Pro Phe
Met Leu1010 1015 1020Tyr Ala His Gly Pro Asp Leu Cys Arg Glu Ser
Asp Leu Arg His1025 1030 1035Ala Met Ala Asn Cys Phe Glu Ala Leu
Ile Gly Ala Val Tyr Leu1040 1045 1050Glu Gly Ser Leu Glu Glu Ala
Lys Gln Leu Phe Gly Arg Leu Leu1055 1060 1065Phe Asn Asp Pro Asp
Leu Arg Glu Val Trp Leu Asn Tyr Pro Leu1070 1075 1080His Pro Leu
Gln Leu Gln Glu Pro Asn Thr Asp Arg Gln Leu Ile1085 1090 1095Glu
Thr Ser Pro Val Leu Gln Lys Leu Thr Glu Phe Glu Glu Ala1100 1105
1110Ile Gly Val Ile Phe Thr His Val Arg Leu Leu Ala Arg Ala Phe1115
1120 1125Thr Leu Arg Thr Val Gly Phe Asn His Leu Thr Leu Gly His
Asn1130 1135 1140Gln Arg Met Glu Phe Leu Gly Asp Ser Ile Met Gln
Leu Val Ala1145 1150 1155Thr Glu Tyr Leu Phe Ile His Phe Pro Asp
His His Glu Gly His1160 1165 1170Leu Thr Leu Leu Arg Ser Ser Leu
Val Asn Asn Arg Thr Gln Ala1175 1180 1185Lys Val Ala Glu Glu Leu
Gly Met Gln Glu Tyr Ala Ile Thr Asn1190 1195 1200Asp Lys Thr Lys
Arg Pro Val Gly Leu Arg Thr Lys Thr Leu Ala1205 1210 1215Asp Leu
Leu Glu Ser Phe Ile Ala Ala Leu Tyr Thr Asp Lys Asp1220 1225
1230Leu Glu Tyr Val His Thr Phe Met Asn Val Cys Phe Phe Pro Arg1235
1240 1245Leu Lys Glu Phe Ile Leu Asn Gln Asp Trp Asn Asp Pro Lys
Ser1250 1255 1260Gln Leu Gln Gln Cys Cys Leu Thr Leu Arg Thr Glu
Gly Lys Glu1265 1270 1275Pro Asp Ile Pro Leu Tyr Lys Thr Leu Gln
Thr Val Gly Pro Ser1280 1285 1290His Ala Arg Thr Tyr Thr Val Ala
Val Tyr Phe Lys Gly Glu Arg1295 1300 1305Ile Gly Cys Gly Lys Gly
Pro Ser Ile Gln Gln Ala Glu Met Gly1310 1315 1320Ala Ala Met Asp
Ala Leu Glu Lys Tyr Asn Phe Pro Gln Met Ala1325 1330 1335His Gln
Lys Arg Phe Ile Gly Arg Lys Tyr Arg Gln Glu Leu Lys1340 1345
1350Glu Met Arg Trp Glu Arg Glu His Gln Glu Arg Glu Pro Asp Glu1355
1360 1365Thr Glu Asp Ile Lys Lys13703412PRTCaenorhabditis elegans
3Met Ser Leu Phe Asn Ile Met Lys Gly Thr Ser Gly Gly Glu Pro Ile1 5
10 15Leu His Asn Glu Arg Leu Glu Tyr Leu Gly Asp Ala Val Val Glu
Leu20 25 30Ile Val Ser His His Leu Tyr Phe Met Leu Thr His His Phe
Glu Gly35 40 45Gly Leu Ala Thr Tyr Arg Thr Ala Leu Val Gln Asn Arg
Asn Leu Ala50 55 60Thr Leu Ala Lys Asn Cys Arg Ile Asp Glu Met Leu
Gln Tyr Ser His65 70 75 80Gly Ala Asp Leu Ile Asn Val Ala Glu Phe
Lys His Ala Leu Ala Asn85 90 95Ala Phe Glu Ala Val Met Ala Ala Ile
Tyr Leu Asp Gly Gly Leu Ala100 105 110Pro Cys Asp Val Ile Phe Ser
Lys Ala Met Tyr Gly His Gln Pro Val115 120 125Leu Lys Glu Lys Trp
Asp His Ile Asn Glu His Glu Leu Lys Arg Glu130 135 140Asp Pro Gln
Gly Asp Arg Asp Leu Ser Phe Ile Thr Pro Thr Leu Ser145 150 155
160Thr Phe His Ala Leu Glu Glu Arg Leu Gly Ile Gln Phe Asn Asn
Ile165 170 175Arg Leu Leu Ala Lys Ala Phe Thr Arg Arg Asn Ile Pro
Asn Asn Asp180 185 190Leu Thr Lys Gly His Asn Gln Arg Leu Glu Trp
Leu Gly Asp Ser Val195 200 205Leu Gln Leu Ile Val Ser Asp Phe Leu
Tyr Arg Arg Phe Pro Tyr His210 215 220His Glu Gly His Met Ser Leu
Leu Arg Thr Ser Leu Val Ser Asn Gln225 230 235 240Thr Gln Ala Val
Val Cys Asp Asp Leu Gly Phe Thr Glu Phe Val Ile245 250 255Lys Ala
Pro Tyr Lys Thr Pro Glu Leu Lys Leu Lys Asp Lys Ala Asp260 265
270Leu Val Glu Ala Phe Ile Gly Ala Leu Tyr Val Asp Arg Gly Ile
Glu275 280 285His Cys Arg Ala Phe Ile Arg Ile Val Phe Cys Pro Arg
Leu Lys His290 295 300Phe Ile Glu Ser Glu Lys Trp Asn Asp Ala Lys
Ser His Leu Gln Gln305 310 315 320Trp Cys Leu Ala Met Arg Asp Pro
Ser Ser Ser Glu Pro Asp Met Pro325 330 335Glu Tyr Arg Val Leu Gly
Ile Glu Gly Pro Thr Asn Asn Arg Ile Phe340 345 350Lys Ile Ala Val
Tyr Tyr Lys Gly Lys Arg Leu Ala Ser Ala Ala Glu355 360 365Ser Asn
Val His Lys Ala Glu Leu Arg Val Ala Glu Leu Ala Leu Ala370 375
380Asn Leu Glu Ser Met Ser Phe Ser Lys Met Lys Ala Lys Asn Asn
Ser385 390 395 400Asn Met Arg Arg Arg Leu Glu
Gln Asp Thr Ser Asp405 4104366PRTSaccharomyces pombe 4Met Gly Arg
Phe Lys Arg His His Glu Gly Asp Ser Asp Ser Ser Ser1 5 10 15Ser Ala
Ser Asp Ser Leu Ser Arg Gly Arg Arg Ser Leu Gly His Lys20 25 30Arg
Ser Ser His Ile Lys Asn Arg Gln Tyr Tyr Ile Leu Glu Lys Lys35 40
45Ile Arg Lys Leu Met Phe Ala Met Lys Ala Leu Leu Glu Glu Thr Lys50
55 60His Ser Thr Lys Asp Asp Val Asn Leu Val Ile Pro Gly Ser Thr
Trp65 70 75 80Ser His Ile Glu Gly Val Tyr Glu Met Leu Lys Ser Arg
His Asp Arg85 90 95Gln Asn Glu Pro Val Ile Glu Glu Pro Ser Ser His
Pro Lys Asn Gln100 105 110Lys Asn Gln Glu Asn Asn Glu Pro Thr Ser
Glu Glu Phe Glu Glu Gly115 120 125Glu Tyr Pro Pro Pro Leu Pro Pro
Leu Arg Ser Glu Lys Leu Lys Glu130 135 140Gln Val Phe Met His Ile
Ser Arg Ala Tyr Glu Ile Tyr Pro Asn Gln145 150 155 160Ser Asn Pro
Asn Glu Leu Leu Asp Ile His Asn Glu Arg Leu Glu Phe165 170 175Leu
Gly Asp Ser Phe Phe Asn Leu Phe Thr Thr Arg Ile Ile Phe Ser180 185
190Lys Phe Pro Gln Met Asp Glu Gly Ser Leu Ser Lys Leu Arg Ala
Lys195 200 205Phe Val Gly Asn Glu Ser Ala Asp Lys Phe Ala Arg Leu
Tyr Gly Phe210 215 220Asp Lys Thr Leu Val Leu Ser Tyr Ser Ala Glu
Lys Asp Gln Leu Arg225 230 235 240Lys Ser Gln Lys Val Ile Ala Asp
Thr Phe Glu Ala Tyr Leu Gly Ala245 250 255Leu Ile Leu Asp Gly Gln
Glu Glu Thr Ala Phe Gln Trp Val Ser Arg260 265 270Leu Leu Gln Pro
Lys Ile Ala Asn Ile Thr Val Gln Arg Pro Ile Asp275 280 285Lys Leu
Ala Lys Ser Lys Leu Phe His Lys Tyr Ser Thr Leu Gly His290 295
300Ile Glu Tyr Arg Trp Pro Ala Cys Val Asp Gly Ala Gly Gly Ser
Ala305 310 315 320Glu Gly Tyr Val Ile Ala Cys Ile Phe Asn Gly Lys
Glu Val Ala Arg325 330 335Ala Trp Gly Ala Asn Gln Lys Asp Ala Gly
Ser Arg Ala Ala Met Gln340 345 350Ala Leu Glu Val Leu Ala Lys Asp
Tyr Ser Lys Phe Ala Arg355 360 3655471PRTSaccharomyces cerevisiae
5Met Gly Ser Lys Val Ala Gly Lys Lys Lys Thr Gln Asn Asp Asn Lys1 5
10 15Leu Asp Asn Glu Asn Gly Ser Gln Gln Arg Glu Asn Ile Asn Thr
Lys20 25 30Thr Leu Leu Lys Gly Asn Leu Lys Ile Ser Asn Tyr Lys Tyr
Leu Glu35 40 45Val Ile Gln Leu Glu His Ala Val Thr Lys Leu Val Glu
Ser Tyr Asn50 55 60Lys Ile Ile Glu Leu Ser Pro Asn Leu Val Ala Tyr
Asn Glu Ala Val65 70 75 80Asn Asn Gln Asp Arg Val Pro Val Gln Ile
Leu Pro Ser Leu Ser Arg85 90 95Tyr Gln Leu Lys Leu Ala Ala Glu Leu
Lys Thr Leu His Asp Leu Lys100 105 110Lys Asp Ala Ile Leu Thr Glu
Ile Thr Asp Tyr Glu Asn Glu Phe Asp115 120 125Thr Glu Gln Lys Gln
Pro Ile Leu Gln Glu Ile Ser Lys Ala Asp Met130 135 140Glu Lys Leu
Glu Lys Leu Glu Gln Val Lys Arg Glu Lys Arg Glu Lys145 150 155
160Ile Asp Val Asn Val Tyr Glu Asn Leu Asn Glu Lys Glu Asp Glu
Glu165 170 175Glu Asp Glu Gly Glu Asp Ser Tyr Asp Pro Thr Lys Ala
Gly Asp Ile180 185 190Val Lys Ala Thr Lys Trp Pro Pro Lys Leu Pro
Glu Ile Gln Asp Leu195 200 205Ala Ile Arg Ala Arg Val Phe Ile His
Lys Ser Thr Ile Lys Asp Lys210 215 220Val Tyr Leu Ser Gly Ser Glu
Met Ile Asn Ala His Asn Glu Arg Leu225 230 235 240Glu Phe Leu Gly
Asp Ser Ile Leu Asn Ser Val Met Thr Leu Ile Ile245 250 255Tyr Asn
Lys Phe Pro Asp Tyr Ser Glu Gly Gln Leu Ser Thr Leu Arg260 265
270Met Asn Leu Val Ser Asn Glu Gln Ile Lys Gln Trp Ser Ile Met
Tyr275 280 285Asn Phe His Glu Lys Leu Lys Thr Asn Phe Asp Leu Lys
Asp Glu Asn290 295 300Ser Asn Phe Gln Asn Gly Lys Leu Lys Leu Tyr
Ala Asp Val Phe Glu305 310 315 320Ala Tyr Ile Gly Gly Leu Met Glu
Asp Asp Pro Arg Asn Asn Leu Pro325 330 335Lys Ile Arg Lys Trp Leu
Arg Lys Leu Ala Lys Pro Val Ile Glu Glu340 345 350Ala Thr Arg Asn
Gln Val Ala Leu Glu Lys Thr Asp Lys Leu Asp Met355 360 365Asn Ala
Lys Arg Gln Leu Tyr Ser Leu Ile Gly Tyr Ala Ser Leu Arg370 375
380Leu His Tyr Val Thr Val Lys Lys Pro Thr Ala Val Asp Pro Asn
Ser385 390 395 400Ile Val Glu Cys Arg Val Gly Asp Gly Thr Val Leu
Gly Thr Gly Val405 410 415Gly Arg Asn Ile Lys Ile Ala Gly Ile Arg
Ala Ala Glu Asn Ala Leu420 425 430Arg Asp Lys Lys Met Leu Asp Phe
Tyr Ala Lys Gln Arg Ala Ala Ile435 440 445Pro Arg Ser Glu Ser Val
Leu Lys Asp Pro Ser Gln Lys Asn Lys Lys450 455 460Arg Lys Phe Ser
Asp Thr Ser465 4706226PRTEscherichia coli 6Met Asn Pro Ile Val Ile
Asn Arg Leu Gln Arg Lys Leu Gly Tyr Thr1 5 10 15Phe Asn His Gln Glu
Leu Leu Gln Gln Ala Leu Thr His Arg Ser Ala20 25 30Ser Ser Lys His
Asn Glu Arg Leu Glu Phe Leu Gly Asp Ser Ile Leu35 40 45Ser Tyr Val
Ile Ala Asn Ala Leu Tyr His Arg Phe Pro Arg Val Asp50 55 60Glu Gly
Asp Met Ser Arg Met Arg Ala Thr Leu Val Arg Gly Asn Thr65 70 75
80Leu Ala Glu Leu Ala Arg Glu Phe Glu Leu Gly Glu Cys Leu Arg Leu85
90 95Gly Pro Gly Glu Leu Lys Ser Gly Gly Phe Arg Arg Glu Ser Ile
Leu100 105 110Ala Asp Thr Val Glu Ala Leu Ile Gly Gly Val Phe Leu
Asp Ser Asp115 120 125Ile Gln Thr Val Glu Lys Leu Ile Leu Asn Trp
Tyr Gln Thr Arg Leu130 135 140Asp Glu Ile Ser Pro Gly Asp Lys Gln
Lys Asp Pro Lys Thr Arg Leu145 150 155 160Gln Glu Tyr Leu Gln Gly
Arg His Leu Pro Leu Pro Thr Tyr Leu Val165 170 175Val Gln Val Arg
Gly Glu Ala His Asp Gln Glu Phe Thr Ile His Cys180 185 190Gln Val
Ser Gly Leu Ser Glu Pro Val Val Gly Thr Gly Ser Ser Arg195 200
205Arg Lys Ala Glu Gln Ala Ala Ala Glu Gln Ala Leu Lys Lys Leu
Glu210 215 220Leu Glu225711PRTHomo sapiens 7His Asn Glu Arg Leu Glu
Phe Leu Gly Asp Ser1 5 10820DNAArtificial SequenceSynthetic
8atccctttct tccgcatgtg 20920DNAArtificial SequenceSynthetic
9gccaaggcgt gacatgatat 201020DNAArtificial SequenceSynthetic
10cggatcatta aagagcaagc 201120DNAArtificial SequenceSynthetic
11tattcaccaa agagcttcgc 201220DNAArtificial SequenceSynthetic
12caatcgtgga aagaagcaga 201320DNAArtificial SequenceSynthetic
13gctcccattt ccgcttgctg 201420DNAArtificial SequenceSynthetic
14atgctctctt tcccacctca 201520DNAArtificial SequenceSynthetic
15aaatactcca cacttgcatg 201620DNAArtificial SequenceSynthetic
16tgcacattca ccaaagtcaa 201720DNAArtificial SequenceSynthetic
17agtctagggt cacaatctgg 201820DNAArtificial SequenceSynthetic
18ttcagttgta gtggtccgac 201940DNAArtificial SequenceSynthetic
19caaggcacgc ctctcagatc gctagagaag gcttttctca 402040DNAArtificial
SequenceSynthetic 20cattaattct cgcagctagc gctgcgttct tcatcgacgc
402135DNAArtificial SequenceSynthetic 21ccaaatactg atcgacaact
tattgaaact tctcc 352237DNAArtificial SequenceSynthetic 22gagtttgaag
aagcaattgg agtaattttt actcatg 372327DNAArtificial SequenceSynthetic
23tcgacttctg gcaagggcat tcacatt 272426DNAArtificial
SequenceSynthetic 24cctctgtgcc agcttctgtt tgtcag
262526DNAArtificial SequenceSynthetic 25tgtcagtttg tttgactttg
ggacta 262626DNAArtificial SequenceSynthetic 26tttgctagga
ggtggcgaag tttcac 262730DNAArtificial SequenceSynthetic
27gcttgatggc ctcttctcca ggataaatgc 302830DNAArtificial
SequenceSynthetic 28aatgctgtgc ctaattcctg tgcgtcttgc
302948DNAArtificial SequenceSynthetic 29caggtgctgt cctcatcaga
ctcacactcg gattcactgg aactctct 483026DNAArtificial
SequenceSynthetic 30cactgggcag gaaagaacta gggttg
263126DNAArtificial SequenceSynthetic 31tggaaactat taaaactggg
aggtgg 263250DNAArtificial SequenceSynthetic 32aggcatggag
ggagggggca tcatgaaggg gaaagtgcct tgtccaggag 503340DNAArtificial
SequenceSynthetic 33caaggcacgc ctctcagatc gctagagaag gcttttctca
403440DNAArtificial SequenceSynthetic 34cattaattct cgcagctagc
gctgcgttct tcatcgacgc 403520PRTHomo sapiens 35Cys Arg Ser Asp Tyr
Asp Arg Gly Arg Thr Pro Ser Arg His Arg Ser1 5 10 15Tyr Glu Arg
Ser203620PRTHomo sapiens 36Cys Arg Trp Glu Arg Glu His Gln Glu Arg
Glu Pro Asp Glu Thr Glu1 5 10 15Asp Ile Lys Lys20
* * * * *