U.S. patent application number 12/229202 was filed with the patent office on 2009-10-29 for b7-h2 molecules, novel members of the b7 family and uses thereof.
Invention is credited to Anthony J. Coyle, Christopher C. Fraser, Stephen Manning.
Application Number | 20090269783 12/229202 |
Document ID | / |
Family ID | 24486045 |
Filed Date | 2009-10-29 |
United States Patent
Application |
20090269783 |
Kind Code |
A1 |
Coyle; Anthony J. ; et
al. |
October 29, 2009 |
B7-H2 molecules, novel members of the B7 family and uses
thereof
Abstract
Novel B7-like polypeptides, proteins, and nucleic acid molecules
are disclosed. In addition to isolated, full-length B7-like
proteins, the invention further provides isolated B7-like fusion
proteins, antigenic peptides, and anti-B7-like antibodies. The
invention also provides B7-like nucleic acid molecules, recombinant
expression vectors containing a nucleic acid molecule of the
invention, host cells into which the expression vectors have been
introduced, and nonhuman transgenic animals in which a B7-like gene
has been introduced or disrupted. Diagnostic, screening, and
therapeutic methods utilizing compositions of the invention are
also provided.
Inventors: |
Coyle; Anthony J.; (Boston,
MA) ; Fraser; Christopher C.; (Lexington, MA)
; Manning; Stephen; (Arlington, MA) |
Correspondence
Address: |
MILLENNIUM PHARMACEUTICALS, INC.
40 Landsdowne Street
CAMBRIDGE
MA
02139
US
|
Family ID: |
24486045 |
Appl. No.: |
12/229202 |
Filed: |
August 20, 2008 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10644671 |
Aug 20, 2003 |
7432062 |
|
|
12229202 |
|
|
|
|
09910174 |
Jul 20, 2001 |
6630575 |
|
|
10644671 |
|
|
|
|
09620461 |
Jul 20, 2000 |
6635750 |
|
|
09910174 |
|
|
|
|
Current U.S.
Class: |
435/7.2 ;
435/320.1; 435/325; 435/375; 435/69.1; 435/7.93; 436/501; 436/536;
530/350; 530/387.9; 536/23.5 |
Current CPC
Class: |
Y10S 435/81 20130101;
C07K 14/70532 20130101 |
Class at
Publication: |
435/7.2 ;
435/7.93; 435/69.1; 435/325; 435/375; 435/320.1; 436/501; 436/536;
530/350; 530/387.9; 536/23.5 |
International
Class: |
G01N 33/567 20060101
G01N033/567; C12P 21/02 20060101 C12P021/02; C12N 5/10 20060101
C12N005/10; C12N 5/06 20060101 C12N005/06; C12N 15/63 20060101
C12N015/63; G01N 33/53 20060101 G01N033/53; G01N 33/536 20060101
G01N033/536; C07K 14/47 20060101 C07K014/47; C07K 16/18 20060101
C07K016/18; C07H 21/04 20060101 C07H021/04 |
Claims
1. An isolated nucleic acid molecule selected from the group
consisting of: a) a nucleic acid molecule comprising a nucleotide
sequence which is at least 70% identical to the nucleotide sequence
of SEQ ID NO:1, SEQ ID NO:3, or SEQ ID NO:30, the cDNA insert of
the plasmid deposited with ATCC as Accession Number 2084, the cDNA
insert of the plasmid deposited with ATCC as Accession Number 2085,
or a complement thereof; b) a nucleic acid molecule comprising a
fragment of at least 25 nucleotides of the nucleotide sequence of
SEQ ID NO:1, SEQ ID NO:3, or SEQ ID NO:30, the cDNA insert of the
plasmid deposited with ATCC as Accession Number 2084, the cDNA
insert of the plasmid deposited with ATCC as Accession Number 2085,
or a complement thereof; c) a nucleic acid molecule which encodes a
polypeptide comprising the amino acid sequence of SEQ ID NO:2, SEQ
ID NO:4, or SEQ ID NO:31, an amino acid sequence encoded by the
cDNA insert of the plasmid deposited with ATCC as Accession Number
2084, or an amino acid sequence encoded by the cDNA insert of the
plasmid deposited with ATCC as Accession Number 2085; d) a nucleic
acid molecule which encodes a fragment of a polypeptide comprising
the amino acid sequence of SEQ ID NO:2, SEQ ID NO:4, or SEQ ID
NO:31, an amino acid sequence encoded by the cDNA insert of the
plasmid deposited with ATCC as Accession Number 2084, or an amino
acid sequence encoded by the cDNA insert of the plasmid deposited
with ATCC as Accession Number 2085, wherein the fragment comprises
at least 17 contiguous amino acids of SEQ ID NO:2, SEQ ID NO:4, or
SEQ ID NO:31, the polypeptide encoded by the cDNA insert of the
plasmid deposited with ATCC as Accession Number 2084, or the
polypeptide encoded by the cDNA insert of the plasmid deposited
with ATCC as Accession Number 2085; and e) a nucleic acid molecule
which encodes a naturally occurring allelic variant of a
polypeptide comprising the amino acid sequence of SEQ ID NO:2, SEQ
ID NO:4, or SEQ ID NO:31, an amino acid sequence encoded by the
cDNA insert of the plasmid deposited with ATCC as Accession Number
2084, or an amino acid sequence encoded by the cDNA insert of the
plasmid deposited with ATCC as Accession Number 2085, wherein the
nucleic acid molecule hybridizes to a nucleic acid molecule
comprising SEQ ID NO:1, SEQ ID NO:3, or SEQ ID NO:30, or a
complement thereof under stringent conditions.
2. The isolated nucleic acid molecule of claim 1, which is selected
from the group consisting of: a) a nucleic acid comprising the
nucleotide sequence of SEQ ID NO:1, SEQ ID NO:3, or SEQ ID NO:30,
the cDNA insert of the plasmid deposited with ATCC as Accession
Number 2084, the cDNA insert of the plasmid deposited with ATCC as
Accession Number 2085, or a complement thereof; and b) a nucleic
acid molecule which encodes a polypeptide comprising the amino acid
sequence of SEQ ID NO:2, SEQ ID NO:4, or SEQ ID NO:31, an amino
acid sequence encoded by the cDNA insert of the plasmid deposited
with ATCC as Accession Number 2084, or an amino acid sequence
encoded by the cDNA insert of the plasmid deposited with ATCC as
Accession Number 2085.
3. The nucleic acid molecule of claim 1 further comprising vector
nucleic acid sequences.
4. The nucleic acid molecule of claim 1 further comprising nucleic
acid sequences encoding a heterologous polypeptide.
5. A host cell which contains the nucleic acid molecule of claim
1.
6. The host cell of claim 5 which is a mammalian host cell.
7. A nonhuman mammalian host cell containing the nucleic acid
molecule of claim 1.
8. An isolated polypeptide selected from the group consisting of:
a) a fragment of a polypeptide comprising the amino acid sequence
of SEQ ID NO:2, SEQ ID NO:4, or SEQ ID NO:31, an amino acid
sequence encoded by the cDNA insert of the plasmid deposited with
ATCC as Accession Number 2084, or an amino acid sequence encoded by
the cDNA insert of the plasmid deposited with ATCC as Accession
Number 2085, wherein the fragment comprises at least 17 contiguous
amino acids of SEQ ID NO:2, SEQ ID NO:4, or SEQ ID NO:31, an amino
acid sequence encoded by the cDNA insert of the plasmid deposited
with ATCC as Accession Number 2084, or an amino acid sequence
encoded by the cDNA insert of the plasmid deposited with ATCC as
Accession Number 2085; b) a naturally occurring allelic variant of
a polypeptide comprising the amino acid sequence of SEQ ID NO:2,
SEQ ID NO:4, or SEQ ID NO:31, an amino acid sequence encoded by the
cDNA insert of the plasmid deposited with ATCC as Accession Number
2084, or an amino acid sequence encoded by the cDNA insert of the
plasmid deposited with ATCC as Accession Number 2085, wherein the
polypeptide is encoded by a nucleic acid molecule which hybridizes
to a nucleic acid molecule comprising SEQ ID NO:1, SEQ ID NO:3, or
SEQ ID NO:30, or a complement thereof under stringent conditions;
and c) a polypeptide which is encoded by a nucleic acid molecule
comprising a nucleotide sequence which is at least 70% identical to
a nucleic acid comprising the nucleotide sequence of SEQ ID NO:1,
SEQ ID NO:3, or SEQ ID NO:30, or a complement thereof.
9. The isolated polypeptide of claim 8 comprising the amino acid
sequence of SEQ ID NO:2, SEQ ID NO:4, or SEQ ID NO:31, an amino
acid sequence encoded by the cDNA insert of the plasmid deposited
with ATCC as Accession Number 2084, or an amino acid sequence
encoded by the cDNA insert of the plasmid deposited with ATCC as
Accession Number 2085.
10. The polypeptide of claim 8 further comprising heterologous
amino acid sequences.
11. An antibody which selectively binds to a polypeptide of claim
8.
12. A method for producing a polypeptide selected from the group
consisting of: a) a polypeptide comprising the amino acid sequence
of SEQ ID NO:2, SEQ ID NO:4, or SEQ ID NO:31, an amino acid
sequence encoded by the cDNA insert of the plasmid deposited with
ATCC as Accession Number 2084, or an amino acid sequence encoded by
the cDNA insert of the plasmid deposited with ATCC as Accession
Number 2085; b) a polypeptide comprising a fragment of the amino
acid sequence of SEQ ID NO:2, SEQ ID NO:4, or SEQ ID NO:31, an
amino acid sequence encoded by the cDNA insert of the plasmid
deposited with ATCC as Accession Number 2084, or an amino acid
sequence encoded by the cDNA insert of the plasmid deposited with
ATCC as Accession Number 2085, wherein the fragment comprises at
least 17 contiguous amino acids of SEQ ID NO:2, SEQ ID NO:4, or SEQ
ID NO:31, an amino acid sequence encoded by the cDNA insert of the
plasmid deposited with ATCC as Accession Number 2084, or an amino
acid sequence encoded by the cDNA insert of the plasmid deposited
with ATCC as Accession Number 2085; and c) a naturally occurring
allelic variant of a polypeptide comprising the amino acid sequence
of SEQ ID NO:2, SEQ ID NO:4, or SEQ ID NO:31, an amino acid
sequence encoded by the cDNA insert of the plasmid deposited with
ATCC as Accession Number 2084, or an amino acid sequence encoded by
the cDNA insert of the plasmid deposited with ATCC as Accession
Number 2085, wherein the polypeptide is encoded by a nucleic acid
molecule which hybridizes to a nucleic acid molecule comprising SEQ
ID NO:1, SEQ ID NO:3, or SEQ ID NO:30, or a complement thereof
under stringent conditions; comprising culturing the host cell of
claim 5 under conditions in which the nucleic acid molecule is
expressed.
13. The method of claim 12 wherein said polypeptide comprises the
amino acid sequence of SEQ ID NO:2, SEQ ID NO:4, or SEQ ID NO:31,
an amino acid sequence encoded by the cDNA insert of the plasmid
deposited with ATCC as Accession Number 2084, or an amino acid
sequence encoded by the cDNA insert of the plasmid deposited with
ATCC as Accession Number 2085.
14. A method for detecting the presence of a polypeptide of claim 8
in a sample, comprising: a) contacting the sample with a compound
which selectively binds to a polypeptide of claim 8; and b)
determining whether the compound binds to the polypeptide in the
sample.
15. The method of claim 14, wherein the compound which binds to the
polypeptide is an antibody.
16. A kit comprising a compound which selectively binds to a
polypeptide of claim 8 and instructions for use.
17. A method for detecting the presence of a nucleic acid molecule
of claim 1 in a sample, comprising the steps of: a) contacting the
sample with a nucleic acid probe or primer which selectively
hybridizes to the nucleic acid molecule; and b) determining whether
the nucleic acid probe or primer binds to a nucleic acid molecule
in the sample.
18. The method of claim 17, wherein the sample comprises mRNA
molecules and is contacted with a nucleic acid probe.
19. A kit comprising a compound which selectively hybridizes to a
nucleic acid molecule of claim 1 and instructions for use.
20. A method for identifying a compound which binds to a
polypeptide of claim 8 comprising the steps of: a) contacting a
polypeptide, or a cell expressing a polypeptide of claim 8 with a
test compound; and b) determining whether the polypeptide binds to
the test compound.
21. The method of claim 20, wherein the binding of the test
compound to the polypeptide is detected by a method selected from
the group consisting of: a) detection of binding by direct
detecting of test compound/polypeptide binding; and b) detection of
binding using a competition binding assay.
22. A method for modulating the activity of a polypeptide of claim
8 comprising contacting a polypeptide or a cell expressing a
polypeptide of claim 8 with a compound which binds to the
polypeptide in a sufficient concentration to modulate the activity
of the polypeptide.
23. A method for identifying a compound which modulates the
activity of a polypeptide of claim 8, comprising: a) contacting a
polypeptide of claim 8 with a test compound; and b) determining the
effect of the test compound on the activity of the polypeptide to
thereby identify a compound which modulates the activity of the
polypeptide.
Description
CROSS-REFERENCE TO RELATED APPLICATION
[0001] This application is a divisional of U.S. patent application
Ser. No. 10/644,671, filed Aug. 20, 2003 (pending), which is a
continuation of U.S. patent application Ser. No. 09/910,174, filed
Jul. 20, 2001, now U.S. Pat. No. 6,630,575, which is a
continuation-in-part of U.S. patent application Ser. No.
09/620,461, filed Jul. 20, 2000, now U.S. Pat. No. 6,635,750. The
contents of these patent applications are incorporated herein by
reference in their entirety.
FIELD OF THE INVENTION
[0002] The invention relates to the field of immunology and the
development of adaptive immunity. More specifically the invention
involves B7-related co-stimulatory molecules that are involved in
the T lymphocyte response.
BACKGROUND OF THE INVENTION
[0003] Induction of a T lymphocyte response is a critical initial
step in a host's immune response. Activation of T cells results in
cytokine production by T cells, T cell proliferation, and
generation of T-cell-mediated effector functions.
[0004] The cytokines are a diverse group of structurally dissimilar
and genetically unrelated molecules. Cytokines serve as crucial
intercellular-signaling molecules that are responsible for the
multidirectional communication among immune and inflammatory cells
engaged in host defense, repair, and restoration of homeostasis, as
well as among other somatic cells in the connective tissues, skin,
nervous system, and other organs. More particularly, this diverse
group of intercellular-signaling proteins regulates local and
systemic immune and inflammatory responses as well as wound
healing, hematopoiesis, and many other biological processes.
[0005] Each cytokine is secreted by particular cell types in
response to a variety of stimuli and produces a characteristic
constellation of effects on the growth, motility, differentiation,
or function of its target cells. In fact, cytokines regulate one
another's production and activities. Other types of biological
mediators, such as corticosteroids and prostaglandins, have
agonistic or antagonistic effects on cytokine activities.
[0006] Interleukin-2 (IL-2) is an autocrine and paracrine growth
factor that is secreted by activated T lymphocytes. IL-2 is a
critical immunoregulatory cytokine as it is essential for clonal
T-cell proliferation, is involved in cytokine production, and
influences the functional properties of B cells, macrophages, and
NK cells. IL-2 enhances proliferation and antibody secretion by
normal B cells. However, the concentration required for the B-cell
response is two- to three-fold higher than is required to obtain
T-cell responses. Higher concentrations of IL-2 can also activate
neutrophils. IL-2 exhibits a short half-life in the circulation.
Thus, it generally acts only on the cell that secreted it or on
cells in the immediate vicinity.
[0007] The IL-2 receptor is not expressed in resting T cells but is
induced to maximal levels within two or three days after the cells
become activated. A decline in receptor expression occurs up to
6-10 days after activation. This transient nature of IL-2 receptor
expression maintains the cyclical, self-limiting pattern of normal
T-cell growth in vivo.
[0008] During the course of an immune response, T cells
differentiate into Th phenotypes defined by their pattern of
cytokine secretion and immunomodulatory properties (Abbas et al.
(1996) Nature 383:787). Th cells are composed of at least two
distinct subpopulations, termed Th1 and Th2 cell subpopulations
(Mosmann et al. (1989) Ann. Rev. Immunol. 7:145; Del Prete et al.
(1991) J. Clin. Invest. 88:346; Wiernenga et al. (1990) J. Immunol.
144:4651; Yamamura et al. (1991) Science 254:277; Robinson et al.
(1993) J. Allergy Clin. Immunol. 92:313). Th1 and Th2 cells appear
to function as part of the different effector functions of the
immune system (Mosmann et al. (1989) Ann. Rev. Immunol. 7:145).
Specifically, Th1 cells direct the development of cell-mediated
immunity, triggering phagocyte-mediated host defenses, and are
associated with delayed hypersensitivity. Accordingly, infections
with intracellular microbes tend to induce Th1-type responses. Th2
cells drive humoral immune responses, which are associated with,
for example, defenses against certain helminthic parasites, and are
involved in antibody and allergic responses.
[0009] Th1 cells secrete interleukin-2 (IL-2), interferon-.gamma.
(IFN-.gamma.), and tumor neucrosis factor-.alpha. (TNF-.alpha.).
These cytokines enhance inflammatory cell-mediated responses and
have a pathogenic role in the development of autoimmune disease.
Th2 cells secrete interleukin-4 (IL-4), interleukin-5 (IL-5),
interleukin-10 (IL-10), and interleukin-13 (IL-13). These cytokines
suppress inflammatory responses while potentiating humoral immunity
and control and reverse disease evolution (Scott et al. (1994)
Immunity 1:73; Smith et al. (1998) J. Immunol. 160:4841; Abbas et
al. (1996) Nature 383:787). The different type of cytokines
released upon stimulation has been demonstrated to be central to
disease evolution (Chu and Londei (1996) J. Immunol. 157:2685;
Hsieh et al. (1993) Science 260:547).
[0010] T-cell activation requires two signals. The first is an
antigen-specific signal, often called a primary activation signal,
which results from stimulation of a T-cell receptor present on the
surface of the T cell. This antigen-specific signal is usually in
the form of an antigenic peptide bound either to a major
histocompatibility complex (hereafter MHC) class I protein or an
MHC class II protein present on the surface of an antigen
presenting cell (hereafter APC). For a review see Germain (1986)
Nature 322:687-691.
[0011] In addition to an antigen-specific primary activation
signal, T cells also require a second, non-antigen specific signal,
to induce T-cell proliferation and/or cytokine production. This
phenomenon has been termed co-stimulation (Mueller et al. (1989)
Annu. Rev. Immunol. 7:445-480). This "two signal" concept explains
why adaptive immunity is elicited by microbes and not by
self-antigens, which do not induce second signals.
[0012] Like the antigen-specific signal, the co-stimulatory signal
is triggered by a molecule on the surface of the antigen presenting
cell (APC). The B7 molecules are an emerging family of
immunoglobulin co-stimulatory molecules, first identified on B
lymphocytes (Linsley et al. (1990) Proc. Natl. Acad. Sci.
87:5031-5035). Both B7-1 (CD80) and B7-2 (CD86) bind to the T cell
receptors CD28 and CTLA4, resulting in co-stimulation of the T cell
(Peach et al. (1995) J. Biol. Chem. 270:21181-21187; Fargeas et al.
(1995) J. Exp. Med. 182:667-675; Bajorath et al. (1994) Protein
Sci. 3:2148-2150; U.S. Pat. No. 5,942,607; and PCT Application No.
WO 96/40915). Depending upon which receptor is bound, the activated
T-cell immune response is enhanced (CD28) or inhibited (CTLA4) in a
negative feedback loop. Additional B7 homologs have been identified
including B7-H1, and B7RP-1 and its mouse ortholog B7h (Swallow et
al. (1999) Immunity 11:423-432; Dong et al. (1999) Nature Med.
5:1365-1369; Yoshinaga et al. (1999) Nature 402:827-832). Although
both B7RP-1 and B7-H1 co-stimulate T-cell proliferation, neither of
these molecules binds to either CD28 or CTLA4 (Abbas and Sharpe
(1999) Nature Med. 5:1345-1346; Yoshinaga et al. (1999) Nature
402:827-832). Unlike B7-1 and B7-2, B7-H1 has little effect on IL-2
production, but considerably increases T-cell production of IL-10,
a B-cell differentiation factor that inhibits macrophages and
cell-mediated immunity.
[0013] Ligation of the CD28 family member ICOS (inducible
co-stimulator) increases IL-10 production. B7RP-1 has been shown to
bind to this receptor (Yoshinaga et al. (1999) Nature 402:827-832)
while B7-H1 does not appear to bind to ICOS (Dong et al. (1999)
Nature Med. 5:1365-1369), although this result is not definitive.
Like CD28, ICOS enhances all basic T-cell responses to a foreign
antigen, namely, proliferation, secretion of lymphokines,
up-regulation of molecules that mediate cell-cell interaction, and
effective help for antibody secretion by B-cells. Unlike the
constitutively expressed CD28, ICOS has to be de novo induced on
the T-cell surface, does not up-regulate the production of IL-2,
but superinduces the synthesis of IL-10 (Hutloff et al. (1999)
Nature 397:263-266). The inducible expression of ICOS shortly after
T-cell activation indicates that ICOS may be particularly important
in providing co-stimulatory signals to activated T cells, in
contrast to CD28, which is essential in the activation and
differentiation of naive T cells (McAdam et al. (1998) Immunol.
Rev. 165:231-247). ICOS may down-regulate immune responses by
stimulating development of regulatory T cells, which normally
function to control the injurious side effects of cell-mediated
immunity. As ICOS signaling induces IL-10, which can also
down-regulate B7-1 and B7-2 expression (Ding et al. (1993) J.
Immunol. 151:1224-1234), ICOS co-stimulation may indirectly reduce
or inhibit B7 expression and thereby inhibit B7-mediated CD28
co-stimulation. Therefore, whereas B7-1 and B7-2 function in the
initiation and development of immune responses, B7RP-1 and B7-H1
may function to return the immune system to its resting state.
[0014] Another receptor belonging to the immunoglobulin gene
superfamily, designated PD-1, also appears to be involved in the
negative regulation of certain immune responses. PD-1 knockout mice
develop Lupus-like autoimmune diseases (Nishimura et al. (1999)
Immunity 11:141-151). In addition, the identification of a novel
member of the B7 family (PD-L) that binds to the PD-1 receptor but
not CD28, CTLA4, or ICOS has been reported (Freeman et al. (2000)
FASEB J. 14(6):Abstract 153.34).
[0015] The profile of the natural immune response, specifically
cytokine production, may determine the phenotype of the subsequent
immune response. Therefore, methods are needed to regulate an
immune response. There is great interest in the possibility that in
disease situations in which antigens are either unknown or
difficult to manipulate, immune responses may be either enhanced or
terminated by manipulating the co-stimulation signals such as those
signals affected by the B7 family of proteins. For example,
modulating the co-stimulation signals may promote tumor immunity
and reduce graft rejection, autoimmune, inflammatory, and
infectious diseases (Abbas and Sharpe (1999) Nature Med.
5:1345-1346; Schweiter and Sharpe (1998) J. Immunol. 161:2762-2771;
Wallace et al. (1994) Transplantation 58:602; Sayegh (1995) J. Exp.
Med. 181:1869; Lenschow et al. (1995) J. Exp. Med. 181:1145; Finck
et al. (1994) Science 265:1225; Cross et al. (1995) J. Clin.
Invest. 95:2783; Perrin et al. (1995) J. Immunol. 154:1481; Corry
et al. (1994) J. Immunol. 153:4142; U.S. Pat. Nos. 5,968,510,
5,861,310, and 5,521,288; and PCT Application No. WO 90/05541 and
European Patent No. EP445228B1).
SUMMARY OF THE INVENTION
[0016] Isolated nucleic acid molecules, hB7-H2 long (hB7-H21),
hB7-H2 short (hB7-H2s), and the murine ortholog of hB7-H2 (mB7-H2),
corresponding to B7-like nucleic acid sequences are provided.
Additionally, amino acid sequences corresponding to the
polynucleotides are encompassed. In particular, the present
invention provides for isolated nucleic acid molecules comprising
nucleotide sequences encoding the amino acid sequences shown in SEQ
ID NO:2, SEQ ID NO:4, and SEQ ID NO:31, the nucleotide sequence
encoding the DNA sequence deposited in a bacterial host as ATCC
Accession Number PTA-2084, or the nucleotide sequence encoding the
DNA sequence deposited in a bacterial host as ATCC Accession Number
PTA-2085. Further provided are B7-like polypeptides having amino
acid sequences encoded by the nucleic acid molecules described
herein.
[0017] The present invention also provides vectors and host cells
for recombinant expression of the nucleic acid molecules described
herein, as well as methods of making such vectors and host cells
and for using them for production of the polypeptides or peptides
of the invention by recombinant techniques.
[0018] Another aspect of this invention features isolated or
recombinant B7-like proteins and polypeptides. Preferred B7-like
proteins and polypeptides possess at least one biological activity
possessed by naturally occurring B7-like proteins.
[0019] Variant nucleic acid molecules and polypeptides
substantially homologous to the nucleotide and amino acid sequences
set forth in the Sequence Listing are encompassed by the present
invention. Additionally, fragments and substantially homologous
fragments of the nucleotide and amino acid sequences are
provided.
[0020] Antibodies and antibody fragments that selectively bind
B7-like polypeptides and fragments are provided. Such antibodies
are useful in detecting B7-like polypeptides as well as in
regulating the T-cell immune response and cellular activity.
[0021] The B7-like molecules of the present invention are useful
for modulating immune responses. The molecules of the invention are
useful for the treatment and diagnosis of T-lymphocyte-related
disorders, including, but not limited to, atopic conditions, such
as asthma and allergy, including allergic rhinitis, psoriasis, the
effects of pathogen infection, chronic inflammatory diseases,
autoimmune diseases, graft rejection, graft versus host disease and
neoplasia. Compositions of the invention are useful in the
treatment and diagnosis of disorders related to bone-metabolism,
and in the treatment and diagnosis of cancers such as B7 lymphomas,
carcinomas, and T cell leukemias, and useful for treatment of viral
diseases and cancers such as herpes, Kaposi's sarcoma, genital
warts, hairy cell leukemia, melanoma, and renal cell carcinoma.
[0022] In addition, the molecules of the invention are useful as
modulating agents in a variety of cellular processes including
growth promoting activity, particularly the antigen-independent
proliferation of T helper cell clones, and direct effects on normal
hemopoietic progenitors, human T cells, B cells, thymocytes, thymic
lymphomas, and neuronal cell lines.
[0023] This invention provides isolated nucleic acid molecules
encoding B7-like proteins or biologically active portions thereof,
as well as nucleic acid fragments suitable as primers or
hybridization probes for the detection of B7-like-encoding nucleic
acids.
[0024] In another aspect, the present invention provides a method
for detecting the presence of B7-like activity or expression in a
biological sample by contacting the biological sample with an agent
capable of detecting an indicator of B7-like activity such that the
presence of B7-like activity is detected in the biological
sample.
[0025] In yet another aspect, the invention provides a method for
modulating B7-like activity comprising contacting a cell with an
agent that modulates (inhibits or stimulates) B7-like activity or
expression such that B7-like activity or expression in the cell is
modulated. In one embodiment, the agent is an antibody that
specifically binds to a B7-like protein. In another embodiment, the
agent modulates expression of B7-like proteins by modulating
transcription of a B7-like gene, splicing of a B7-like mRNA, or
translation of a B7-like mRNA. In yet another embodiment, the agent
is a nucleic acid molecule having a nucleotide sequence that is
antisense to the coding strand, or to a portion thereof, of the
B7-like mRNA or the B7-like gene.
[0026] In another aspect, the invention provides a method for
identifying a compound that binds to or modulates the activity of a
B7-like protein and/or its binding partner. In general, such
methods entail measuring a biological activity of a B7-like protein
in the presence and absence of a test compound and identifying
those compounds that alter the activity of the B7-like protein.
[0027] In one embodiment, the methods of the present invention are
used to treat a subject having a disorder that involves B7-like
protein activity or nucleic acid expression by administering an
agent that is a B7-like modulator to the subject. In one
embodiment, the B7-like modulator is a B7-like protein. In another
embodiment, the B7-like modulator is a B7-like nucleic acid
molecule. In other embodiments, the B7-like modulator is a peptide,
peptidomimetic, or other small molecule. In another embodiment the
B7-like modulator is an antibody specific for B7-like proteins.
[0028] The present invention also provides a diagnostic assay for
identifying the presence or absence of a genetic lesion or mutation
characterized by at least one of the following: (1) aberrant
modification or mutation of a gene encoding a B7-like protein; (2)
misregulation of a gene encoding a B7-like protein; and (3)
aberrant post-translational modification of a B7-like protein,
wherein a wild-type form of the gene encodes a protein with a
B7-like activity.
[0029] The invention also features methods for identifying a
compound that modulates the expression of B7-like genes by
measuring the expression of the B7-like sequences in the presence
and absence of the compound.
[0030] Other features and advantages of the invention will be
apparent from the following detailed description and claims.
BRIEF DESCRIPTION OF THE DRAWINGS
[0031] FIG. 1 shows the amino acid sequence alignment for the human
protein B7-H2 long (hB7-H2 long; SEQ ID NO:2) encoded by SEQ ID
NO:1 and the human protein B7-H2 short (hB7-H2 short; SEQ ID NO:4)
encoded by SEQ ID NO:3 with human B7-1 (hB7-1; SP Accession Number
P33681; SEQ ID NO:5), human B7-2 (hB7-2; SP Accession Number
P42081; SEQ ID NO:6), human B7RP-1 (hB7RP-1; Accession Number
AAF34739; SEQ ID NO:7), human B7RP-2 (hB7RP-2; SEQ ID NO:24), human
B7-H1 (hB7-H1; Accession Number AF177937; SEQ ID NO:8), human
butyrophilin precursor (hBTN prot; SP Accession Number Q13410; SEQ
ID NO:9), human butyrophilin, subfamily 2, member A1 (hBTN2A1 prot;
Accession Number NP.sub.--008980; SEQ ID NO:10), human
butyrophilin, subfamily 2, member A2 (hBTN2A2 prot; Accession
Number NP.sub.--008926; SEQ ID NO:11), human butyrophilin,
subfamily 3, member A2 (hBTN3A2 prot; Accession Number
NP.sub.--008978; SEQ ID NO:12), human BT2.1 similar to butyrophilin
protein (hBT2.1 prot; Accession Number AAC02650; SEQ ID NO:13),
human butyrophilin BT3.2 (hBT3.2 prot; Accession Number AAC02655;
SEQ ID NO:14), human butyrophilin BT3.3 (hBT3.3 prot; Accession
Number AAC02656; SEQ ID NO:15), human butyrophilin BTN3a3 (hBTN3A3
prot (B7-3); Accession Number AAB53426; SEQ ID NO:16), human
butyrophilin, subfamily 3, member A1 (hBTN3A1 prot; Accession
Number NP.sub.--008979; SEQ ID NO:17), human butyrophilin BTF5
(hBTF5 prot; Accession Number AAB53430; SEQ ID NO:18), and human
B7.3 molecule of CD80-CD86 (hB7.3; EMBL Accession Number CAA69164;
SEQ ID NO:19). The sequence alignment was generated using the
Clustal method with PAM 250 residue weight table. hB7-1 and hB7-2
share approximately 33.6% similarity and 22.9% identity; hB7-1 and
hB7RP-1 share approximately 30.3% similarity and 24.1% identity;
hB7-1 and hB7RP-2 share approximately 32.7% similarity and 24.8%
identity; hB7-2 and hB7RP-1 share approximately 31.3% similarity
and 21.2% identity; hB7-2 and hB7RP-2 share approximately 31.2%
similarity and 21.7% identity; hB7-H1 and hB7-H2 share
approximately 46.8% similarity and 37.4% identity; hB7-1 and hB7-H1
share approximately 31.1% similarity and 19.5% identity; hB7-1 and
hB7-H2 share approximately 30.1% similarity and 20.8% identity;
hB7-2 and hB7-H1 share approximately 28.8% similarity and 19.1%
identity; hB7RP-1 and hB7-H1 share approximately 31.4% similarity
and 22.3% identity; hB7RP-2 and hB7-H1 share approximately 37.5%
similarity and 28.8% identity; and hB7RP-2 and hB7-H2 share
approximately 30.5% similarity and 21.7% identity.
[0032] FIG. 2 shows the alignment of the open reading frame for
hB7-H2 long (SEQ ID NO:20) and hB7-H2 short (SEQ ID NO:21) with the
open reading frame for human B7-H1 (hB7-H1; Accession Number
AF177937; SEQ ID NO:22). The sequence alignment was generated using
the Clustal method noted above.
[0033] FIG. 3 shows a GAP alignment of the open reading frame of
hB7-H1 (SEQ ID NO:22) with the open reading frame of hB7-H2 long
(SEQ ID NO:20). The sequences share approximately 58.3% identity
over the open reading frame of hB7-H2 long. The Pairwise sequence
alignment was generated with the following parameters: Gap Weight:
12; Average Match: 10.000; Length Weight: 4; Average Mismatch:
0.000; Quality: 4018; Length: 901; Ratio: 4.888; Gaps: 21. The
following represent match display thresholds for the alignment(s):
|=Identity; :=5; .=1.
[0034] FIG. 4 shows a GAP alignment of the open reading frame of
hB7-H1 (SEQ ID NO:22) with the open reading frame of hB7-H2 short
(SEQ ID NO:21). The sequences share approximately 59.8% identity
over the open reading frame of hB7-H2 short. The Pairwise sequence
alignment was generated with the following parameters: Gap Weight:
12; Average Match: 10.000; Length Weight: 4; Average Mismatch:
0.000; Quality: 2714; Length: 895; Ratio: 4.917; Gaps: 15. The
following represent match display thresholds for the alignment(s):
|=Identity; :=5; .=1.
[0035] FIG. 5 shows a GAP alignment of the amino acid sequence of
hB7-H2 long (SEQ ID NO:2) with the amino acid sequence of hB7-H1
(SEQ ID NO:8). The sequences share approximately 46.8% similarity
and 37.4% identity over the 273 amino acid residues of hB7-H2 long.
The Pairwise sequence alignment was generated using BLOSUM62 with
the following parameters: Gap Weight: 12; Average Match: 2.778;
Length Weight: 4; Average Mismatch: -2.248; Quality: 277; Length:
298; Ratio: 1.015; Gaps: 6. The following represent match display
thresholds for the alignment(s): |=Identity; :=2; .=1.
[0036] FIG. 6 shows a GAP alignment of the amino acid sequence of
hB7-H2 short (SEQ ID NO:4) with the amino acid sequence of hB7-H1
(SEQ ID NO:8). The sequences share approximately 41.2% similarity
and 28.2% identity over the 183 amino acid residues of hB7-H2
short. The Pairwise sequence alignment was generated using BLOSUM62
with the following parameters: Gap Weight: 12; Average Match:
2.778; Length Weight: 4; Average Mismatch: -2.248; Quality: 113;
Length: 296; Ratio: 0.617; Gaps: 3. The following represent match
display thresholds for the alignment(s): |Identity; :=2; .=1.
[0037] FIG. 7 shows a GAP alignment of the open reading frame for
hB7-H2 long (SEQ ID NO:20) with the open reading frame for hB7-H2
short (SEQ ID NO:21). The sequences share 100% identity over the
open reading frame of the hB7-H2 short sequence. The Pairwise
sequence alignment was generated with the following parameters: Gap
Weight: 12; Average Match: 10.000; Length Weight: 4; Average
Mismatch: 0.000; Quality: 4428; Length: 822; Ratio: 8.022; Gaps: 1.
The following represent match display thresholds for the
alignment(s): |=Identity; :=5; .=1.
[0038] FIG. 8 shows a GAP alignment of the amino acid sequence of
hB7-H2 long (SEQ ID NO:2) with the amino acid sequence of hB7-H2
short (SEQ ID NO:4). The Pairwise sequence alignment was generated
using BLOSUM62 with the following parameters: Gap Weight: 12;
Average Match: 2.778; Length Weight: 4; Average Mismatch: -2.248;
Quality: 579; Length: 276; Ratio: 3.164; Gaps: 2. The following
represent match display thresholds for the alignment(s):
|=Identity; :=2; .=1.
[0039] FIG. 9 shows the amino acid sequence alignment for hB7-H2
long (SEQ ID NO:2) and hB7-H2 short (SEQ ID NO:4) with hB7-H1 (SEQ
ID NO:8). The sequence alignment was generated using the Clustal
method. Residues that match hB7-H1 exactly are shaded. The hB7-H2
long (hB7-H21) and short (hB7-H2s) proteins are different splice
variants of the same gene. The hB7-H2 long protein shares
approximately 37.4% identity with the hB7-H1 protein, and
approximately 71.7% identity with the hB7-H2 short protein, while
the hB7-H2 short protein shares approximately 28.2% identity with
the hB7-H1 protein. The proteins are type 1 transmembrane proteins
and belong to the immunoglobulin superfamily (the major protein
structural domains are blocked off in the figure). These proteins
contain the conserved cysteine residues of immunoglobulins (marked
with an asterisk) and have the highest homology in the
extracellular domain. Signal sequences, extracellular domains,
transmembrane regions, and intracellular domains are denoted by the
boxes as described in the legend. The signal sequences consist of
the first approximately 17 amino acids in hB7-H1 and approximately
19 amino acids in hB7-H2 long and short; the extracellular portion
ranges from about amino acid (aa) 18-240 in hB7-H1, from about aa
20-218 in hB7-H2 long, and from about aa 20-128 in hB7-H2 short;
the transmembrane region spans the next approximately 18 amino acid
residues in hB7-H1 and the next approximately 19 amino acid
residues in hB7-H2 long and hB7-H2 short; and the intracellular
domain consists of the remaining residues. The extracellular domain
of the hB7-H1 and hB7-H2 long proteins comprises an immunoglobulin
V(variable)-like domain and an immunoglobulin C(constant)-like
domain, while the extracellular domain of the hB7-H2 short protein
comprises only the immunoglobulin V(variable)-like domain.
[0040] FIG. 10 shows the phylogenetic tree of the hB7 family of
molecules. The hB7-H2 long and short proteins are most closely
related to the hB7-H1 member of this family.
[0041] FIG. 11 shows the amino acid sequence alignment for the
human protein B7-H2 long (hB7-H2 long; SEQ ID NO:2) and the human
protein B7-H2 short (hB7-H2 short; SEQ ID NO:4) with human B7-1
(hB7-1; SEQ ID NO:5), human B7-2 (hB7-2; SEQ ID NO:6), human B7RP-1
(hB7RP-1; SEQ ID NO:7), human B7RP-2 (hB7RP-2; SEQ ID NO:24), and
human B7-H1 (hB7-H1; SEQ ID NO:8). The sequence alignment was
generated using the Clustal method with PAM 250 residue weight
table. Residues that match the consensus sequence exactly are
shaded. hB7-1 and hB7RP-2 share approximately 32.7% similarity and
24.8% identity; hB7-2 and hB7RP-2 share approximately 31.2%
similarity and 21.7% identity; hB7RP-1 and hB7RP-2 share
approximately 35.8% similarity and 30.8% identity; hB7RP-2 and
hB7-H1 share approximately 37.5% similarity and 28.8% identity; and
hB7RP-2 and hB7-H2 share approximately 30.5% similarity and 21.7%
identity. Percent identities were determined using the scoring
matrix BLOSUM62 with a gap open penalty of 12 and a gap extend
penalty of 4.
[0042] FIG. 12 shows the amino acid sequence alignment for hB7RP-1
(SEQ ID NO:7) with hB7RP-2 (SEQ ID NO:24), hB7-1 (SEQ ID NO:5), and
hB7-2 (SEQ ID NO:6). The alignment was generated using the Clustal
method with PAM 250 residue weight table. Signal sequences,
extracellular domains, transmembrane regions, and intracellular
domains are denoted by the boxes as described in the legend. The
signal sequence consists of the first approximately 19 amino acids
in hB7RP-1, approximately 33 amino acids in hB7RP-2, approximately
34 amino acids in hB7-1, and approximately 17 amino acids in hB7-2.
The extracellular portion ranges from about amino acid (aa) 20-257
in hB7RP-1, about aa 34-246 in hB7RP-2, about aa 35-242 in hB7-1,
and about aa 18-241 in hB7-2. The transmembrane region spans
approximately aa 258-277 in hB7RP-1, approximately aa 247-272 in
hB7RP-2, approximately aa 243-262 in hB7-1, and approximately aa
242-263 in aa hB7-2. For each protein, the remaining residues
represent the intracellular domain.
[0043] FIG. 13 shows the amino acid sequence alignment for hB7-1
(SEQ ID NO:5), hB7-2 (SEQ ID NO:6), hB7RP-1 (SEQ ID NO:7), and
hB7RP-2 (SEQ ID NO:24). The alignment is based on the MegAlign
program. Residues that match the consensus sequence exactly are
shaded.
[0044] FIG. 14 shows a GAP alignment of the amino acid sequence of
hB7RP-2 (SEQ ID NO:24) with the amino acid sequence of hB7-1 (SEQ
ID NO:5). The sequences share approximately 32.7% similarity and
24.8% identity over the 288 amino acid residues of hB7-1. The
Pairwise sequence alignment was generated using BLOSUM62 with the
following parameters: Gap Weight: 12; Average Match: 2.778; Length
Weight: 4; Average Mismatch: -2.248; Quality: 18; Length: 326;
Ratio: 0.062; Gaps: 9. The following represent match display
thresholds for the alignment(s): |=Identity; :=2; .=1.
[0045] FIG. 15 shows a GAP alignment of the amino acid sequence of
hB7RP-2 (SEQ ID NO:24) with the amino acid sequence of hB7-2 (SEQ
ID NO:6). The sequences share approximately 31.2% similarity and
21.7% identity over the 323 amino acid residues of hB7-2. The
Pairwise sequence alignment was generated using BLOSUM62 with the
following parameters: Gap Weight: 12; Average Match: 2.778; Length
Weight: 4; Average Mismatch: -2.248; Quality: 53; Length: 344;
Ratio: 0.168; Gaps: 8. The following represent match display
thresholds for the alignment(s): |=Identity; :=2; .=1.
[0046] FIG. 16 shows a GAP alignment of the amino acid sequence of
hB7RP-1 (SEQ ID NO:7) with the amino acid sequence of hB7-2 (SEQ ID
NO:6). The sequences share approximately 31.2% similarity and 21.2%
identity over the 323 amino acid residues of hB7-2. The Pairwise
sequence alignment was generated using BLOSUM62 with the following
parameters: Gap Weight: 12; Average Match: 2.778; Length Weight: 4;
Average Mismatch: -2.248; Quality: 55; Length: 337; Ratio: 0.182;
Gaps: 8. The following represent match display thresholds for the
alignment(s): |=Identity; :=2; .=1.
[0047] FIG. 17 shows a GAP alignment of the amino acid sequence of
hB7RP-1 (SEQ ID NO:7) with the amino acid sequence of hB7-1 (SEQ ID
NO:5). The sequences share approximately 30.3% similarity and 24.1%
identity over the 288 amino acid residues of hB7-1. The Pairwise
sequence alignment was generated using BLOSUM62 with the following
parameters: Gap Weight: 12; Average Match: 2.778; Length Weight: 4;
Average Mismatch: -2.248; Quality: 29; Length: 316; Ratio: 0.101;
Gaps: 7. The following represent match display thresholds for the
alignment(s): |=Identity; :=2; .=1.
[0048] FIG. 18 shows a GAP alignment of the amino acid sequence of
hB7RP-1 (SEQ ID NO:7) with the amino acid sequence of hB7RP-2 (SEQ
ID NO:24). The sequences share approximately 35.8% similarity and
30.8% identity over the 316 amino acid residues of hB7RP-2. The
Pairwise sequence alignment was generated using BLOSUM62 with the
following parameters: Gap Weight: 12; Average Match: 2.778; Length
Weight: 4; Average Mismatch: -2.248; Quality: 145; Length: 339;
Ratio: 0.480; Gaps: 8. The following represent match display
thresholds for the alignment(s): |=Identity; :=2; .=1.
[0049] FIG. 19 shows a GAP alignment of the amino acid sequence of
hB7-1 (SEQ ID NO:5) with the amino acid sequence of hB7-2 (SEQ ID
NO:6). The sequences share approximately 33.6% similarity and 22.9%
identity over the 323 amino acid residues of hB7-2. The Pairwise
sequence alignment was generated using BLOSUM62 with the following
parameters: Gap Weight: 12; Average Match: 2.778; Length Weight: 4;
Average Mismatch: -2.248; Quality: 86; Length: 340; Ratio: 0.299;
Gaps: 7. The following represent match display thresholds for the
alignment(s): |=Identity; :=2; .=1.
[0050] FIG. 20 sets forth the open reading frame for the murine
ortholog of hB7RP-2 (mB7RP-2; SEQ ID NO:27).
[0051] FIG. 21 sets forth the amino acid sequence of the murine
B7RP-2 protein (mB7RP-2; SEQ ID NO:28) encoded by SEQ ID NO:27.
[0052] FIG. 22 shows a GAP alignment of the amino acid sequence of
mB7RP-2 (SEQ ID NO:28) with the amino acid sequence of hB7RP-2 (SEQ
ID NO:24). The sequences share approximately 89.8% similarity and
88.3% identity. The Pairwise sequence alignment was generated using
BLOSUM62 with the following parameters: Gap Weight: 12; Average
Match: 2.778; Length Weight: 4; Average Mismatch: -2.248; Quality:
1430; Length: 316; Ratio: 4.540; Gaps: 1. The following represent
match display thresholds for the alignment(s): |=Identity; :=2;
.=1.
[0053] FIG. 23 shows a GAP alignment of the amino acid sequence of
murine B7RP-1 (mB7RP-1; GenBank Accession No. AAF45149; SEQ ID
NO:29) with the amino acid sequence of mB7RP-2 (SEQ ID NO:28). The
sequences share approximately 32.2% similarity and 27.7% identity.
The Pairwise sequence alignment was generated using BLOSUM62 with
the following parameters: Gap Weight: 12; Average Match: 2.778;
Length Weight: 4; Average Mismatch: -2.248; Quality: 118; Length:
345; Ratio: 0.375; Gaps: 7. The following represent match display
thresholds for the alignment(s): |=Identity; :=2; .=1.
[0054] FIG. 24 sets forth the open reading frame for the murine
ortholog of hB7-H2 (mB7H2; SEQ ID NO:30).
[0055] FIG. 25 sets forth the amino acid sequence of the murine
B7H2 protein (mB7H2; SEQ ID NO:31) encoded by SEQ ID NO:30.
[0056] FIG. 26 shows a GAP alignment of the open reading frame of
mB7-H2 (SEQ ID NO:30) with the open reading frame of hB7-H2 long
(hB7-H21; SEQ ID NO:1). The sequences share approximately 78.3%
identity. The Pairwise sequence alignment was generated with the
following parameters: Gap Weight: 12; Average Match: 10.000; Length
Weight: 4; Average Mismatch: 0.000; Quality: 5788; Length: 823;
Ratio: 7.780; Gaps: 2. The following represent match display
thresholds for the alignment(s): |=Identity; :=5; .=1.
[0057] FIG. 27 shows a GAP alignment of the amino acid sequence of
mB7-H2 (SEQ ID NO:31) with the amino acid sequence of hB7-H2 long
(SEQ ID NO:2). The sequences share approximately 74.9% similarity
and 69.6% identity. The Pairwise sequence alignment was generated
using BLOSUM62 with the following parameters: Gap Weight: 12;
Average Match: 2.778; Length Weight: 4; Average Mismatch: -2.248;
Quality: 898; Length: 273; Ratio: 3.636; Gaps: 0. The following
represent match display thresholds for the alignment(s):
|=Identity; :=2; .=1.
[0058] FIG. 28 shows a GAP alignment of the amino acid sequence of
mB7-H2 (SEQ ID NO:31) with murine B7-H1 (mB7-H1; SEQ ID NO:32). The
sequences share approximately 44.3% similarity and 34% identity.
The Pairwise sequence alignment was generated using BLOSUM62 with
the following parameters: Gap Weight: 12; Average Match: 2.778;
Length Weight: 4; Average Mismatch: -2.248; Quality: 198; Length:
293; Ratio: 0.802; Gaps: 6. The following represent match display
thresholds for the alignment(s): |=Identity; :=2; .=1.
[0059] FIG. 29 shows a GAP alignment of the amino acid sequence of
1B7-H2 (SEQ ID NO:31) with the amino acid sequence of mB7RP-2 (SEQ
ID NO:28). The sequences share approximately 32.2% similarity and
24.5% identity. The Pairwise sequence alignment was generated using
BLOSUM62 with the following parameters: Gap Weight: 12; Average
Match: 2.778; Length Weight: 4; Average Mismatch: -2.248; Quality:
80; Length: 317; Ratio: 0.324; Gaps: 6. The following represent
match display thresholds for the alignment(s): |=Identity; :=2;
.=1.
DETAILED DESCRIPTION OF THE INVENTION
[0060] The present invention provides methods and compositions for
the use of novel B7-like family members. The B7-like proteins
function as co-stimulators of T-cells and have the important
function of regulating the adaptive immune response. While some B7
family members enhance the T-cell functions that are essential for
an effective antigen-specific immune response, others
counterbalance the CD28-mediated signals, and thus prevent an
otherwise fatal over-stimulation of the lymphoid system. There is
great interest in the possibility that, in disease situations in
which antigens are either unknown or difficult to manipulate,
immune responses may be either enhanced or terminated by
manipulating the co-stimulation signals such as those signals
affected by the B7 family of proteins. For example, modulating the
co-stimulation signals can promote tumor immunity and reduce graft
rejection, autoimmune, inflammatory, and infectious diseases.
[0061] The B7 molecules are an emerging family of immunoglobulin
co-stimulatory molecules, first identified on B lymphocytes. They
do not share high levels of homology with each other (see FIGS. 1,
9, and 13). For example, human and mouse B7-1 have 45% identity and
mouse and human B7-2 have 51% identity, which is less than normally
observed for such orthologs. However, as members of the
immunoglobulin superfamily, the B7 proteins share the general
structural properties of immunoglobulin-like domains, for example,
residues conserved throughout the immunoglobulin superfamily that
are important to the immunoglobulin fold. Characteristic conserved
residues can include the cysteines in the B and F strands, the
tryptophane in the C strand, or the hydrophobic residues two
positions ahead of the cysteines, as well as conserved patterns
characteristic of immunoglobulin V(variable)-like or
C(constant)-like domains (Williams and Barclay (1988) Annu. Rev.
Immunol. 6:381-405, as cited in Fargeas (1995) J. Exp. Med.
182:667-675).
[0062] Generally, B7 family members have the most homology
occurring within their extracellular region, which consists of one
amino-terminal immunoglobulin V-like domain and one
membrane-proximal immunoglobulin C-like domain (Peach et al. (1995)
J. Biol. Chem. 270:21181-21187; Dong et al. (1999) Nature Medicine
5(12): 1365-1369; Fargeas et al. (1995) J. Exp. Med. 182:667-675).
For example, hB7-1 (SEQ ID NO:5) has its V-like domain at
approximately amino acid (aa) residues 34-139 and its C-like domain
at approximately aa 140-240 (Peach et al. (1995) J. Biol. Chem.
270:21181-21187). hB7-2 (SEQ ID NO:6) has its V-like domain at
approximately aa 18-127 and its C-like domain at approximately aa
128-235 (Peach et al. (1995) J. Biol. Chem. 270:21181-21187).
hB7RP-1 (SEQ ID NO:7) has its V-like domain at approximately aa
20-135 and its C-like domain at approximately aa 136-246. hB7-H1
(SEQ ID NO:8) has its V-like domain at approximately aa 26-131 and
its C-like domain at approximately aa 132-234 (Dong et al. (1999)
Nature Medicine 5(12):1365-1369). These immunoglobulin-like domains
may be involved in protein-protein and protein-ligand
interactions.
[0063] Another common structural feature of the B7 family members
is the presence of four structural cysteines within the
extracellular region (see FIG. 11, where asterisks denote these
conserved residues in all human B7 family members). These conserved
residues are apparently involved in forming the disulfide bonds of
the immunoglobulin V-like and C-like domains (see, for example,
Freeman et al. (1993) Science 262:909-911; Azuma et al. (1993)
Nature 366:76-79; Fargeas et al. (1995) J. Exp. Med. 182:667-675;
Bajorath et al. (1994) Protein Sci. 3:2148-2150).
[0064] The B7 family members are integral proteins, and hence also
comprise a signal peptide, transmembrane region, and an
intracellular domain. The intracellular domain of the B7 family
members tends to be quite diverse in contrast to the extracellular
domain (Freeman et al. (1993) Science 262:909-911; Azuma et al.
(1993) Nature 366:76-79).
[0065] The B7 molecules, which are expressed on antigen presenting
cells (APCs), bind to their natural receptor or binding partner on
T-cells. When bound to their natural receptors, the B7 molecules
send a co-stimulatory signal to the T-cell that results in either
amplification (i.e., stimulation) or blockage (i.e., inhibition) of
the activated-T-cell-mediated immune response. By
"activated-T-cell-mediated immune response" is intended any or all
of the immune response-related activities including, but not
limited to, T-cell proliferation and/or cytokine production and/or
release by T-cells that have received a primary activation
signal.
[0066] Previously identified members of the B7 family include the
human proteins B7-1, B7-2, B7RP-1, B7-H1, and a recently reported
novel member designated PD-L, as well as their mouse orthologs,
such as mB7RP-1. These B7 family members also share homology with
members of the butyrophilin family, a class of Type-I membrane
proteins belonging to the immunoglobulin superfamily and which also
contain a V-like domain.
[0067] Both B7-1 and B7-2 bind to the T cell receptors CD28 and
CTLA4, thereby up-regulating (CD28) or down-regulating (CTLA4) the
activated-T-cell-mediated immune response. B7RP-1 binds to the
T-cell receptor ICOS, and PD-L binds to T-cell receptor PD-1. The
binding partner for B7-H1, the closest homolog of the B7 molecules
of the present invention, is not known. However, B7-H1 has been
shown to increase production of the cytokine IL-10, which is also
produced upon ligation of ICOS and PD-1 with their binding
partners, making these receptors potential binding partners for
B7-H2 long and B7-H2 short. ICOS and PD-1 may be involved in the
negative regulation of various effector functions in the immune
response. For example, PD-1 knockout mice develop Lupus-like
autoimmune diseases (Nishimura et al. (1999) Immunity
11:141-151).
[0068] The present invention provides novel B7-like molecules,
which are most homologous to the B7-H1 family member. By "B7-like
molecules" is intended novel human sequences referred to as human
B7-H2 long (hB7-H21) and human B7-H2 short (hB7-H2s), as well as
the murine ortholog of hB7-H2, designated herein as mB7-H2, and
variants and fragments thereof. The murine B7-H2 nucleotide and
amino acid sequences share approximately 78.3% and 69.6% identity,
respectively, with the corresponding sequences for hB7-H2 long. See
FIGS. 26 and 27.
[0069] Also provided is the B7-like molecule referred to herein as
human B7RP-2 (hB7RP-2; amino acid sequence set forth in SEQ ID
NO:24, encoded by the nucleotide sequence set forth in SEQ ID
NO:23). This protein, previously identified as PRO352 and
classified as a member of the butyrophilin family of
immunoglobulins (see PCT Publication No. WO 99/46281, FIG. 50
(nucleotide sequence) and FIG. 51 (amino acid sequence), herein
incorporated by reference), is recognized herein as a new member of
the B7 family of molecules. Further provided is the novel murine
sequence referred to herein as mB7RP-2, the murine ortholog of
hB7RP-2. The open-reading frame nucleotide and amino acid sequences
for mB7RP-2 are set forth in FIG. 20 (SEQ ID NO:27) and FIG. 21
(SEQ ID NO:28), respectively. These novel sequences, the hB7RP-2
sequences, or variants or fragments thereof, are referred to as
"B7-like" sequences, indicating they share sequence similarity with
B7 genes of the B7 family of immunoglobulins. The novel human and
mouse B7-like sequences, the human B7-like sequences designated
hB7RP-2 herein, and variants and fragments thereof are useful in
the methods of the invention described elsewhere herein.
[0070] Specifically, isolated nucleic acid molecules comprising
nucleotide sequences encoding the polypeptides whose amino acid
sequences are given in SEQ ID NO:2, SEQ ID NO:4, and SEQ ID NO:31
or variants or fragments thereof, are provided. The nucleotide
sequences encoding these polypeptides are set forth in SEQ ID NO:1,
SEQ ID NO:3, and SEQ ID NO: 30. hB7-H2 long (SEQ ID NO:1) and
hB7-H2 short (SEQ ID NO:3) are different splice variants of the
same gene as shown in GAP alignments (see FIGS. 7 and 8). The
sequences of the present invention are members of the B7 family of
immunoglobulins. The hB7-H2 long and hB7-H2 short proteins are most
homologous to the family member human B7-H1 (hB7-H1; SEQ ID NO:8).
The hB7-H2 long protein displays approximately 37.4% amino acid
sequence identity with hB7-H1 (see FIG. 5), while the hB7-H2 short
protein shares approximately 28.2% identity with hB7-H1 (see FIG.
6). The novel murine ortholog mB7-H2 (SEQ ID NO:31) also displays a
similar relationship with the corresponding murine B7 family
member, as mB7-H2 protein shares approximately 44.3% similarity and
34% identity with murine B7-H1 protein (SEQ ID NO:32; see FIG.
28).
[0071] The B7-like genes, hB7-H2 long and hB7-H2 short, were
identified in a human osteoblast library. Clone hB7-H2 long encodes
an approximately 2.23 Kb transcript having the corresponding cDNA
set forth in SEQ ID NO:1. This transcript has an 819 nucleotide
open reading frame (SEQ ID NO:20), which encodes a 273 amino acid
protein (SEQ ID NO:2) having a molecular weight of approximately
30.9 kDa. An analysis of the polypeptide predicts that the
N-terminal 19 amino acids represent a signal peptide. A
transmembrane segment for the presumed mature peptide was predicted
for amino acids (aa) 202-224 by MEMSAT. Prosite program analysis
was used to predict various sites within the protein.
N-glycosylation sites were predicted at aa 37-40, 64-67, 157-160,
163-166, and 189-192. Protein kinase C phosphorylation sites were
predicted at aa 116-118, 122-124, 253-255, 257-259, and 264-266.
Casein kinase II phosphorylation sites were predicted at aa 74-77,
211-214, 253-256, and 265-268. A tyrosine kinase phosphorylation
site was predicted at aa 168-174. N-myristoylation sites were
predicted at aa 35-40, 47-52, 53-58, and 98-103.
[0072] The hB7-H2 long protein possesses two immunoglobulin
domains, from aa 35-104 and 136-194, as predicted by HMMer, Version
2. The predicted immunoglobulin domains reside within the
extracellular domain of this protein (i.e., about aa 20-218 with
respect to SEQ ID NO:2; see FIG. 9) and occupy relative positions
within this region that are similar to the positions identified for
the immunoglobulin V-like (approximately aa 26-131 of SEQ ID NO:8)
and C-like (approximately aa 132-234 of SEQ ID NO:8) domains of
hB7-H1, the most homologous B7 family member. For a description of
these V-like and C-like regions of hB7-H1, see particularly Dong et
al. (1999) Nature Medicine 5(12): 1365-1369, herein incorporated by
reference. An amino acid sequence alignment of hB7-H2 long with
other previously known B7 family members indicates the V-like and
C-like domains of this novel protein are located at approximately
aa 28-120 and aa 121-215, respectively (FIG. 11; aa residues
correspond to those set forth in SEQ ID NO:2). In addition, the
extracellular domain of hB7-H2 long comprises the four conserved
structural cysteine residues characteristic of other B7 family
members (see FIG. 11, where conserved cysteine residues are denoted
by asterisks), with two of these residues occurring within the
V-like domain, and two occurring within the C-like domain.
[0073] An alignment of this protein with other B7 family members
shows other similar structural features within hB7-H2 long and
these B7 family members, including a signal sequence, transmembrane
region, and intracellular region (see FIG. 9; cross-reference FIG.
12 for an alignment of additional B7 family members showing these
features). Human B7-H21 shares approximately 69.6% identity with
murine B7-H2 at the amino acid sequence level (see FIG. 27) and
approximately 78.3% identity at the nucleotide sequence level (see
FIG. 26).
[0074] A plasmid containing the hB7-H2 long cDNA insert was
deposited with American Type Culture Collection (ATCC), 10801
University Boulevard, Manassas, Va., on Jun. 14, 2000, and assigned
Accession Number PTA-2084. This deposit will be maintained under
the terms of the Budapest Treaty on the International Recognition
of the Deposit of Microorganisms for the Purposes of Patent
Procedure. This deposit was made merely as a convenience for those
of skill in the art and is not an admission that a deposit is
required under 35 U.S.C. .sctn. 112.
[0075] Clone hB7-H2 short encodes an approximately 1.98 Kb
transcript having the corresponding cDNA set forth in SEQ ID NO:3.
This transcript has a 549 nucleotide open reading frame (SEQ ID
NO:21), which encodes a 183 amino acid protein (SEQ ID NO:4) having
a molecular weight of approximately 20.8 kDa. An analysis of the
polypeptide predicts that the N-terminal 19 amino acids represent a
signal peptide. A transmembrane segment for the presumed mature
peptide was predicted for amino acids (aa) 112-134 by MEMSAT.
Prosite program analysis was used to predict various sites within
the protein. N-glycosylation sites were predicted at aa 37-40 and
64-67. Protein kinase C phosphorylation sites were predicted at aa
116-118, 163-165, 167-169, and 174-176. Casein kinase II
phosphorylation sites were predicted at aa 74-77, 163-166, and
175-178. N-myristoylation sites were predicted at aa 35-40, 47-52,
53-58, and 98-103.
[0076] The hB7-H2 short protein possesses an immunoglobulin domain
from aa 35-104 as predicted by HMMer, Version 2. The predicted
immunoglobulin domain resides within the extracellular domain of
this protein (i.e., about aa 20-128 with respect to SEQ ID NO:4;
see FIG. 9). As for hB7-H2 long, an alignment of hB7-H2 short with
other B7 family members indicates the immunoglobulin V-like domain
in this protein resides at approximately aa 28-120 (see FIG. 11; aa
residues correspond to those set forth in SEQ ID NO:4). However,
unlike hB7-H2 long and other B7 family members, hB7-H2 short is
missing the immunoglobulin C-like domain. The two conserved
cysteine residues within the V-like domain of other B7 family
members are also present within the V-like domain of hB7-H2 short
(FIG. 11). As for the other B7 family members, hB7-H2 short
possesses a signal sequence, transmembrane region, and an
intracellular domain (see FIG. 9; cross-reference FIG. 12).
[0077] A plasmid containing the hB7-H2 short cDNA insert was
deposited with American Type Culture Collection (ATCC), 10801
University Boulevard, Manassas, Va., on Jun. 14, 2000, and assigned
Accession Number PTA-2085. This deposit will be maintained under
the terms of the Budapest Treaty on the International Recognition
of the Deposit of Microorganisms for the Purposes of Patent
Procedure. This deposit was made merely as a convenience for those
of skill in the art and is not an admission that a deposit is
required under 35 U.S.C. .sctn. 112.
[0078] Isolated sequences and modulators thereof for use in methods
of the present invention further encompass the human B7RP-2
(hB7RP-2) amino acid sequence set forth in SEQ ID NO:24, the novel
murine B7RP-2 (mB7RP-2) amino acid sequence set forth in SEQ ID
NO:28, and variants or fragments thereof, as well as nucleotide
sequences encoding these polypeptides, or variants or fragments
thereof. Such nucleotide sequences include the hB7RP-2 nucleotide
sequence set forth as SEQ ID NO:23 and the mB7RP-2 nucleotide
sequence set forth as SEQ ID NO:27. The hB7RP-2 protein shares
closest homology with the previously identified B7 family member
hB7RP-1 (approximately 30.8% identity; see FIG. 18).
[0079] The hB7RP-2 protein (SEQ ID NO:24) possesses two
immunoglobulin domains, the first from about aa 43-124, and the
second from about aa 158-222 as predicted by HMMer, Version 2. The
predicted immunoglobulin domains reside within the extracellular
domain of this protein (i.e., about amino acids 34-246 with respect
to SEQ ID NO:24; see FIG. 12) and occupy relative positions within
this region that are similar to those identified for the
immunoglobulin V-like (approximately aa 20-135 of SEQ ID NO:7) and
C-like (approximately aa 136-246 of SEQ ID NO:7) domains of
hB7RP-1, the most homologous B7 family member. An amino acid
sequence alignment of hB7RP-2 with other previously known B7 family
members indicates the V-like and C-like domains of this protein are
located at approximately aa 33-139 and aa 140-241, respectively
(FIG. 11; aa residues correspond to those set forth in SEQ ID
NO:24). In addition, the extracellular domain of hB7RP-2 also
comprises the four conserved structural cysteine residues
characteristic of other B7 family members (see FIG. 11, where
conserved cysteine residues are denoted by asterisks), with two of
these residues occurring within the V-like domain, and two
occurring within the C-like domain.
[0080] An alignment of this protein with other B7 family members
shows other similar structural features within hB7RP-2 and these B7
family members, including a signal sequence, transmembrane region,
and intracellular region (see FIG. 12; cross-reference FIG. 9 for
an alignment of additional B7 family members showing these
features).
[0081] The novel murine ortholog mB7RP-2 (SEQ ID NO:28) shares
approximately 89.8% similarity and 88.3% identity with hB7RP-2 (see
FIG. 22). This B7 family member shares approximately 32.3%
similarity and approximately 27.7% identity with murine B7RP-1 (see
FIG. 23). This B7 family member shares approximately 32.2%
similarity and 24.5% identity with mB7-H2 (SEQ ID NO:31; see FIG.
29).
[0082] The B7-like sequences of the invention are members of a
family of molecules "B7 immunoglobulins" having conserved
structural and/or functional features. For example, when the term
"family" is used to refer to the proteins and nucleic acid
molecules of the invention, it is intended to mean two or more
proteins or nucleic acid molecules having sufficient amino acid or
nucleotide sequence identity over their full length or within
selected domains (e.g., the extracellular domain, immunoglobulin
domain, immunoglobulin V-like and/or C-like domains) as defined
herein. Such family members can be naturally occurring and can be
from either the same or different species. For example, a family
can contain a first protein of murine origin and a homologue of
that protein of human origin, as well as a second, distinct protein
of human origin and a murine homologue of that protein. Common
functional features of the molecules of the invention include, for
example, the ability to modulate (i.e., increase or decrease) the
activated-T-cell-mediated immune response following binding with
their native or naturally occurring binding partners on activated T
cells. Such binding partners include, but are not limited to, CD28,
CTLA4, ICOS, PD-1, and other related activated T-cell receptors
expressed following exposure of a T cell to a primary activation
signal.
[0083] Preferred B7-like polypeptides of the present invention have
an amino acid sequence sufficiently identical to the amino acid
sequences of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:28, and SEQ ID
NO:31. The term "sufficiently identical" is used herein to refer to
a first amino acid or nucleotide sequence that contains a
sufficient or minimum number of identical or equivalent (e.g., with
a similar side chain) amino acid residues or nucleotides to a
second amino acid or nucleotide sequence such that the first and
second amino acid or nucleotide sequences have a common structural
domain (e.g., the extracellular domain, immunoglobulin domain,
immunoglobulin V-like and/or C-like domains) and/or common
functional activity. For example, amino acid or nucleotide
sequences that contain a common structural domain having at least
about 45%, 55%, or 65% identity, preferably 75% or 80% identity,
more preferably 85% or 90%, and most preferably 91%, 92%, 93%, 94%,
95%, 96%, 97%, 98%, or 99% identity are defined herein as
sufficiently identical.
[0084] To determine the percent identity of two amino acid
sequences or of two nucleic acids, the sequences are aligned for
optimal comparison purposes. The percent identity between the two
sequences is a function of the number of identical positions shared
by the sequences (i.e., percent identity=number of identical
positions/total number of positions (e.g., overlapping
positions).times.100). In one embodiment, the two sequences are the
same length. The percent identity between two sequences can be
determined using techniques similar to those described below, with
or without allowing gaps. In calculating percent identity,
typically exact matches are counted.
[0085] The determination of percent identity between two sequences
can be accomplished using a mathematical algorithm. A preferred,
nonlimiting example of a mathematical algorithm utilized for the
comparison of two sequences is the algorithm of Karlin and Altschul
(1990) Proc. Natl. Acad. Sci. USA 87:2264, modified as in Karlin
and Altschul (1993) Proc. Natl. Acad. Sci. USA 90:5873-5877. Such
an algorithm is incorporated into the NBLAST and XBLAST programs of
Altschul et al. (1990) J. Mol. Biol. 215:403. BLAST nucleotide
searches can be performed with the NBLAST program, score=100,
wordlength=12, to obtain nucleotide sequences homologous to B7-like
nucleic acid molecules of the invention. BLAST protein searches can
be performed with the XBLAST program, score=50, wordlength=3, to
obtain amino acid sequences homologous to B7-like protein molecules
of the invention. To obtain gapped alignments for comparison
purposes, Gapped BLAST can be utilized as described in Altschul et
al. (1997) Nucleic Acids Res. 25:3389. Alternatively, PSI-Blast can
be used to perform an iterated search that detects distant
relationships between molecules. See Altschul et al. (1997) supra.
When utilizing BLAST, Gapped BLAST, and PSI-Blast programs, the
default parameters of the respective programs (e.g., XBLAST and
NBLAST) can be used. See www.ncbi.nlm.nih.gov. Another preferred,
non-limiting example of a mathematical algorithm utilized for the
comparison of sequences is the algorithm of Myers and Miller (1988)
CABIOS 4:11-17. Such an algorithm is incorporated into the ALIGN
program (version 2.0), which is part of the GCG sequence alignment
software package. When utilizing the ALIGN program for comparing
amino acid sequences, a PAM120 weight residue table, a gap length
penalty of 12, and a gap penalty of 4 can be used.
[0086] The novel human B7-like gene sequences hB7-H21 and hB7-H2s
and variants and fragments thereof are encompassed by the term
"B7-like" molecules or sequences as used herein. The B7-like
sequences find use in modulating T cell response. By "modulating"
is intended the up-regulating or down-regulating of a response.
That is, the compositions of the invention can affect the targeted
activity in either a positive or negative fashion. The activation
of T cells is manifested by, for example, cytokine production,
cellular proliferation, signaling events, and other effector
functions.
[0087] The function of T-cells is defined by the type of cytokines
released upon antigenic challenge. Such cytokines are central to
disease evolution in animal models of autoimmunity and infection.
Proteins and/or antibodies of the invention are also useful in
modulating immune and inflammatory responses.
[0088] Accordingly, another embodiment of the invention features
isolated B7-like proteins and polypeptides having a B7-like protein
activity. As used interchangeably herein, a "B7-like protein
activity," "biological activity of a B7-like protein," or
"functional activity of a B7-like protein" refers to an activity
exerted by a B7-like protein, polypeptide, or nucleic acid molecule
on a B7-like responsive cell as determined in vivo, or in vitro,
according to standard assay techniques. A B7-like activity can be a
direct activity, such as an association with or an enzymatic
activity on a second protein, or an indirect activity, such as a
cellular signaling activity mediated by interaction of the B7-like
protein with a second protein.
[0089] In one embodiment, a B7-like activity includes the ability
to provide a co-stimulatory signal to T-cells and to modulate
(stimulate and/or enhance or inhibit) cellular proliferation,
differentiation, morphology, and/or function, particularly that of
immune cells, for example lymphocytes, such as B cells, plasma
cells, T cells, and null cells, macrophages, histiocytes, dendritic
cells, and granulocytes, such as neutrophils, eosinophils,
basophils, and tissue mast cells. A B7-like molecule of the
invention can bind to and/or modulate the function of ICOS, PD-1,
CD28, CTLA-4, or a related known or unknown receptor molecule. This
binding to and/or modulating of these molecules can lead to
modulation of the activity of a T-cell. Examples of modulation of
immune cell function through such receptors include, but are not
limited to, T-cell proliferation, modulation of cytokine production
and/or release (such as IL-2, IL-4, IL-5, IL-10, interferon-gamma,
tumor necrosis factor-alpha, or granulocyte/macrophage colony
stimulating factor production and/or release), up-regulation of
molecules such as LFA-3, ICAM-1, CD154, CD69, CD25, or CD71 that
mediate cell-cell interaction, and modulation of antibody secretion
by B-cells.
[0090] Methods for measuring the effects resulting from interaction
of a B7-like molecule with ICOS, PD-1, CD28, CTLA-4, or other
related receptor are well known in the art. For example, a method
for in vitro T-cell co-stimulation consists of providing purified
T-cells that express ICOS, PD-1, CD28, CTLA-4, or a related
receptor with a first or primary activation signal by anti-T3
monoclonal antibody (e.g., anti-CD3) or phorbol ester, or by
antigen in association with class II MHC. The ability of an agent,
such as the B7-like molecules of the present invention, to provide
the secondary or co-stimulatory signal, necessary to modulate
immune function, to these T-cells can then be assayed by any one of
the several conventional assays well known in the art.
[0091] For example, with this in vitro co-stimulation assay,
thymidine incorporation can be used to measure T-cell proliferation
(Dong et al (1999) Nature 5:1365-1369). In this particular assay,
T-cell growth is monitored by culturing the purified T-cells
expressing ICOS, PD-1, DC28, CTLA-4, or a related receptor with the
B7-like protein of the invention, a primary activation signal as
described above, and .sup.3H-thymidine. The level of T-cell
proliferation is determined by measuring thymidine
incorporation.
[0092] Cytokine production can be measured using a similar
approach. Purified T-cells are cultured in the presence of the
B7-like protein and a primary activation signal. The level of
various cytokines in the supernatant can be determined by sandwich
enzyme-linked immunosorbent assays or other conventional assays.
See, for example, Dong et al (1999) Nature 5:1365-1369.
[0093] Up-regulation of molecules such as LFA-3, ICAM-1, CD154,
CD25, CD69, or CD71 that mediate cell-cell interaction can also be
measured with this co-stimulation assay as described in Hutloff et
al. (1999) Nature 397:263-266. In this case, stimulated CD4.sup.+
T-cells are incubated in the presence of a control monoclonal
antibody such as MOPC-21 or an antibody to the receptor molecule
being studied (ICOS, PD-1, DC28, CTLA-4, or a related receptor) and
in the presence of the B7-like protein of the invention. The level
of expression of the cell surface molecule of interest is measured
by flow cytometry with an FITC-labeled antibody specific for this
antigen (Kroczek et al. (1994) Immunol. Rev. 138:39-59).
[0094] Modulation of antibody secretion by B-cells as a result of
B7-like interaction with an ICOS, PD-1, CD28, CTLA-4, or other
related receptor can be measured using the co-stimulation assay.
For example, CD4.sup.+ T-cells can be cultured with tonsillar
B-cells and provided with a primary signal as described and a
secondary B7-like molecule of the invention for co-stimulation. IgM
and IgG levels in the supernatant at subsequent points in time are
then determined by ELISA (Hutloff et al. (1999) Nature
397:263-266).
[0095] In view of the biological function of the B7-like molecules
of the invention, these molecules and modulators thereof can be
used to monitor, detect, modulate, and/or act as targets for
identifying agents that modulate T-cell function, and are thus
useful in methods directed to modulation, diagnosis, and treatment
of T-cell-related or T-lymphocyte-related disorders, including, but
not limited to, atopic conditions, such as asthma and allergy,
including allergic rhinitis, psoriasis, the effects of pathogen
infection, chronic inflammatory diseases, chronic obstructive
pulmonary diseases, autoimmune diseases, graft rejection, graft
versus host disease and neoplasia.
[0096] Other diseases and disorders that can be treated using the
molecules of the invention include, but are not limited to, such
immune disorders as inflammatory bowel diseases such as Crohn's
disease and ulcerative colitis, reactive arthritis, including Lyme
disease, rheumatoid arthritis, insulin-dependent diabetes,
organ-specific autoimmunity, including multiple sclerosis,
Hashimoto's thyroiditis and Grave's disease, Lupus-erythematosus,
contact dermatitis, psoriasis, graft rejection, graft versus host
disease, sarcoidosis, atopic conditions, such as asthma and
allergy, including allergic rhinitis, gastrointestinal allergies,
including food allergies, eosinophilia, conjunctivitis, and
glomerular nephritis and certain pathogen susceptibilities such as
helminthic (e.g., leishmaniasis), certain viral infections,
including HIV, and bacterial infections, including tuberculosis and
lepromatous leprosy.
[0097] Compositions of the invention are useful to inhibit the
function of malignant B- and T-cells in cancers such as B
lymphoblastic leukemia/lymphoma and carcinomas, and T lymphoblastic
leukemia/lymphoma and are useful for treatment of viral diseases
and cancers such as herpes, Kaposi's sarcoma, genital warts, hairy
cell leukemia, melanoma, and renal cell carcinoma.
[0098] In addition, compositions of the invention are useful in the
modulation, diagnosis, and treatment of disorders associated with
bone metabolism. "Bone metabolism" refers to direct or indirect
effects in the formation or degeneration of bone structures, e.g.,
bone formation, bone resorption, etc., which may ultimately affect
the concentrations in serum of calcium and phosphate. This term
also includes activities mediated by the effects of B7-like
molecule activity in bone cells, e.g., osteoclasts and osteoblasts,
that may in turn result in bone formation and degeneration. For
example, B7-like molecules may support different activities of bone
resorbing osteoclasts such as the stimulation of differentiation of
monocytes and mononuclear phagocytes into osteoclasts. Accordingly,
B7-like molecules that modulate the production of bone cells can
influence bone formation and degeneration, and thus may be used to
treat bone disorders. Examples of such disorders include, but are
not limited to, osteoporosis, osteodystrophy, osteomalacia,
rickets, osteitis fibrosa cystica, renal osteodystrophy,
osteosclerosis, anti-convulsant treatment, osteopenia,
fibrogenesis-imperfecta ossium, secondary hyperparathyrodism,
hypoparathyroidism, hyperparathyroidism, cirrhosis, obstructive
jaundice, drug induced metabolism, medullary carcinoma, chronic
renal disease, rickets, sarcoidosis, glucocorticoid antagonism,
malabsorption syndrome, steatorrhea, tropical sprue, idiopathic
hypercalcemia and milk fever.
[0099] An "isolated" or "purified" B7-like nucleic acid molecule or
protein, or biologically active portion thereof, is substantially
free of other cellular material, or culture medium when produced by
recombinant techniques, or substantially free of chemical
precursors or other chemicals when chemically synthesized.
Preferably, an "isolated" nucleic acid is free of sequences
(preferably protein encoding sequences) that naturally flank the
nucleic acid (i.e., sequences located at the 5N and 3N ends of the
nucleic acid) in the genomic DNA of the organism from which the
nucleic acid is derived. For purposes of the invention, "isolated"
when used to refer to nucleic acid molecules excludes isolated
chromosomes. For example, in various embodiments, the isolated
B7-like nucleic acid molecule can contain less than about 5 kb, 4
kb, 3 kb, 2 kb, 1 kb, 0.5 kb, or 0.1 kb of nucleotide sequences
that naturally flank the nucleic acid molecule in genomic DNA of
the cell from which the nucleic acid is derived. A B7-like protein
that is substantially free of cellular material includes
preparations of B7-like protein having less than about 30%, 20%,
10%, or 5% (by dry weight) of non-B7-like protein (also referred to
herein as a "contaminating protein"). When the B7-like protein or
biologically active portion thereof is recombinantly produced,
preferably, culture medium represents less than about 30%, 20%,
10%, or 5% of the volume of the protein preparation. When B7-like
protein is produced by chemical synthesis, preferably the protein
preparations have less than about 30%, 20%, 10%, or 5% (by dry
weight) of chemical precursors or non-B7-like chemicals.
[0100] Various aspects of the invention are described in further
detail in the following subsections.
I. Isolated Nucleic Acid Molecules
[0101] One aspect of the invention pertains to isolated nucleic
acid molecules comprising nucleotide sequences encoding B7-like
proteins and polypeptides or biologically active portions thereof,
as well as nucleic acid molecules sufficient for use as
hybridization probes to identify B7-like-encoding nucleic acids
(e.g., B7-like mRNA) and fragments for use as PCR primers for the
amplification or mutation of B7-like nucleic acid molecules. As
used herein, the term "nucleic acid molecule" is intended to
include DNA molecules (e.g., cDNA or genomic DNA) and RNA molecules
(e.g., mRNA) and analogs of the DNA or RNA generated using
nucleotide analogs. The nucleic acid molecule can be
single-stranded or double-stranded, but preferably is
double-stranded DNA.
[0102] Nucleotide sequences encoding the human B7-like proteins of
the present invention include sequences set forth in SEQ ID NO:1
and SEQ ID NO:3, the nucleotide sequence of the cDNA insert of the
plasmid deposited with the ATCC as Accession Number PTA-2084 (the
"cDNA of ATCC 2084"), the nucleotide sequence of the cDNA insert of
the plasmid deposited with the ATCC as Accession Number PTA-2085
(the "cDNA of ATCC 2085"), and complements thereof. By "complement"
is intended a nucleotide sequence that is sufficiently
complementary to a given nucleotide sequence such that it can
hybridize to the given nucleotide sequence to thereby form a stable
duplex. The corresponding amino acid sequences for the B7-like
proteins encoded by these nucleotide sequences are set forth in SEQ
ID NO:2 and SEQ ID NO:4. Further provided are nucleotide sequences
encoding novel murine B7-like proteins designated mB7RP-2 and
mB7-H2, herein, including the sequence set forth in SEQ ID NO:27 or
SEQ ID NO:30, respectively, and complements thereof. The
corresponding amino acid sequence for the B7-like protein encoded
by SEQ ID NO:27 is set forth in SEQ ID NO:28, and the corresponding
amino acid sequence for the B7-like protein encoded by SEQ ID NO:30
is set forth in SEQ ID NO:31.
[0103] Nucleic acid molecules that are fragments of these B7-like
nucleotide sequences are also encompassed by the present invention.
By "fragment" is intended a portion of the nucleotide sequence
encoding a B7-like protein. A fragment of a B7-like nucleotide
sequence may encode a biologically active portion of a B7-like
protein, or it may be a fragment that can be used as a
hybridization probe or PCR primer using methods disclosed below. A
biologically active portion of a B7-like protein can be prepared by
isolating a portion of one of the nucleotide sequences of the
invention, expressing the encoded portion of the B7-like protein
(e.g., by recombinant expression in vitro), and assessing the
activity of the encoded portion of the B7-like protein. Nucleic
acid molecules that are fragments of a B7-like nucleotide sequence
comprise at least about 15, 20, 50, 75, 100, 200, 300, 350, 400,
450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050,
1100, 1150, 1200, 1250, 1300, 1350, 1400, 1450, 1500, 1550, 1600,
1650, 1700, 1750, 1800, 1850, 1900, 1950 nucleotides, or up to the
number of nucleotides present in a full-length B7-like nucleotide
sequence disclosed herein (for example, up to 2229, 1975, 948, or
744 nucleotides for SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:27, or SEQ
ID NO:30, respectively), depending upon the intended use.
[0104] It is understood that isolated fragments include any
contiguous sequence not disclosed prior to the invention as well as
sequences that are substantially the same and which are not
disclosed. Accordingly, if an isolated fragment is disclosed prior
to the present invention, that fragment is not intended to be
encompassed by the invention. When a sequence is not disclosed
prior to the present invention, an isolated nucleic acid fragment
is at least about 12, 15, 20, 25, or 30 contiguous nucleotides.
Other regions of the nucleotide sequence may comprise fragments of
various sizes, depending upon potential homology with previously
disclosed sequences.
[0105] A fragment of a B7-like nucleotide sequence that encodes a
biologically active portion of a B7-like protein of the invention
will encode at least about 20, 25, 30, 50, 75, 100, 125, 150, or
175 contiguous amino acids, or up to the total number of amino
acids present in a full-length B7-like protein of the invention
(for example, 273 amino acids for SEQ ID NO:2, 183 amino acids for
SEQ ID NO:4, 315 amino acids for SEQ ID NO:28, and 247 amino acids
for SEQ ID NO:31). Fragments of a B7-like nucleotide sequence that
are useful as hybridization probes for PCR primers generally need
not encode a biologically active portion of a B7-like protein.
[0106] Nucleic acid molecules that are variants of the B7-like
nucleotide sequences disclosed herein are also encompassed by the
present invention. "Variants" of the B7-like nucleotide sequences
include those sequences that encode the B7-like proteins disclosed
herein but that differ conservatively because of the degeneracy of
the genetic code. These naturally occurring allelic variants can be
identified with the use of well-known molecular biology techniques,
such as polymerase chain reaction (PCR) and hybridization
techniques as outlined below. Variant nucleotide sequences also
include synthetically derived nucleotide sequences that have been
generated, for example, by using site-directed mutagenesis but
which still encode the B7-like proteins disclosed in the present
invention as discussed below. Generally, nucleotide sequence
variants of the invention will have at least about 45%, 55%, 65%,
70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or
99% identity to a particular nucleotide sequence disclosed herein.
A variant B7-like nucleotide sequence will encode a B7-like protein
that has an amino acid sequence having at least about 45%, 55%,
65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%,
98%, or 99% identity to the amino acid sequence of a B7-like
protein disclosed herein.
[0107] In addition to the B7-like nucleotide sequences shown in SEQ
ID NOs:1, 3, 27, and 30, the nucleotide sequence of the cDNA of
ATCC 2084, and the nucleotide sequence of the cDNA of ATCC 2085, it
will be appreciated by those skilled in the art that DNA sequence
polymorphisms that lead to changes in the amino acid sequences of
B7-like proteins may exist within a population (e.g., the human
population). Such genetic polymorphism in a B7-like gene may exist
among individuals within a population due to natural allelic
variation. An allele is one of a group of genes that occur
alternatively at a given genetic locus. As used herein, the terms
"gene" and "recombinant gene" refer to nucleic acid molecules
comprising an open reading frame encoding a B7-like protein,
preferably a mammalian B7-like protein. As used herein, the phrase
"allelic variant" refers to a nucleotide sequence that occurs at a
B7-like locus or to a polypeptide encoded by the nucleotide
sequence. Such natural allelic variations can typically result in
1-5% variance in the nucleotide sequence of the B7-like gene. Any
and all such nucleotide variations and resulting amino acid
polymorphisms or variations in a B7-like sequence that are the
result of natural allelic variation and that do not alter the
functional activity of B7-like proteins are intended to be within
the scope of the invention.
[0108] Moreover, nucleic acid molecules encoding B7-like proteins
from other species (B7-like homologues), which have a nucleotide
sequence differing from that of the B7-like sequences disclosed
herein, are intended to be within the scope of the invention. For
example, nucleic acid molecules corresponding to natural allelic
variants and homologues of the human B7-like cDNA of the invention
can be isolated based on their identity to the human B7-like
nucleic acid disclosed herein using the human cDNA, or a portion
thereof, as a hybridization probe according to standard
hybridization techniques under stringent hybridization conditions
as disclosed below.
[0109] In addition to naturally occurring allelic variants of the
B7-like sequences that may exist in the population, the skilled
artisan will further appreciate that changes can be introduced by
mutation into the nucleotide sequences of the invention thereby
leading to changes in the amino acid sequence of the encoded
B7-like proteins, without altering the biological activity of the
B7-like proteins. Thus, an isolated nucleic acid molecule encoding
a B7-like protein having a sequence that differs from that of SEQ
ID NO:2, SEQ ID NO:4, SEQ ID NO:28, or SEQ ID NO:31 can be created
by introducing one or more nucleotide substitutions, additions, or
deletions into the corresponding nucleotide sequence disclosed
herein (i.e., SEQ ID NO:1, 3, 27, or 30, respectively), such that
one or more amino acid substitutions, additions or deletions are
introduced into the encoded protein. Mutations can be introduced by
standard techniques, such as site-directed mutagenesis and
PCR-mediated mutagenesis. Such variant nucleotide sequences are
also encompassed by the present invention.
[0110] For example, preferably, conservative amino acid
substitutions may be made at one or more predicted, preferably
nonessential amino acid residues. A "nonessential" amino acid
residue is a residue that can be altered from the wild-type
sequence of a B7-like protein (e.g., the sequence of SEQ ID NO:2,
SEQ ID NO:4, SEQ ID NO:28, or SEQ ID NO:31) without altering the
biological activity, whereas an "essential" amino acid residue is
required for biological activity. A "conservative amino acid
substitution" is one in which the amino acid residue is replaced
with an amino acid residue having a similar side chain. Families of
amino acid residues having similar side chains have been defined in
the art. These families include amino acids with basic side chains
(e.g., lysine, arginine, histidine), acidic side chains (e.g.,
aspartic acid, glutamic acid), uncharged polar side chains (e.g.,
glycine, asparagine, glutamine, serine, threonine, tyrosine,
cysteine), nonpolar side chains (e.g., alanine, valine, leucine,
isoleucine, proline, phenylalanine, methionine, tryptophan),
beta-branched side chains (e.g., threonine, valine, isoleucine) and
aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan,
histidine). Such substitutions would not be made for conserved
amino acid residues, or for amino acid residues residing within a
conserved motif, such as the four structural cysteines (FIG. 1,
stars), which are apparently involved in forming the disulfide
bonds of the immunoglobulin V and C domains (Freeman et al. (1993)
Science 262:909-911; Azuma et al. (1993) Nature 366:76-79; Peach et
al. (1995) J. Biol. Chem. 270:21181-21187; Fargeas et al. (1995) J.
Exp. Med. 182:667-675; Bajorath et al. (1994) Protein Sci.
3:2148-2150), and are well conserved in all B7 family members.
[0111] Alternatively, variant B7-like nucleotide sequences can be
made by introducing mutations randomly along all or part of a
B7-like coding sequence, such as by saturation mutagenesis, and the
resultant mutants can be screened for B7-like biological activity
to identify mutants that retain activity. Following mutagenesis,
the encoded protein can be expressed recombinantly, and the
activity of the protein can be determined using standard assay
techniques.
[0112] Thus the nucleotide sequences of the invention include the
sequences disclosed herein as well as fragments and variants
thereof. The B7-like nucleotide sequences of the invention, and
fragments and variants thereof, can be used as probes and/or
primers to identify and/or clone B7-like homologues in other cell
types, e.g., from other tissues, as well as B7-like homologues from
other mammals. Such probes can be used to detect transcripts or
genomic sequences encoding the same or identical proteins. These
probes can be used as part of a diagnostic test kit for identifying
cells or tissues that misexpress a B7-like protein, such as by
measuring levels of a B7-like-encoding nucleic acid in a sample of
cells from a subject, e.g., detecting B7-like mRNA levels or
determining whether a genomic B7-like gene has been mutated or
deleted.
[0113] In this manner, methods such as PCR, hybridization, and the
like can be used to identify such sequences having substantial
identity to the sequences of the invention. See, for example,
Sambrook et al. (1989) Molecular Cloning: Laboratory Manual (2d
ed., Cold Spring Harbor Laboratory Press, Plainview, N.Y.) and
Innis, et al. (1990) PCR Protocols: A Guide to Methods and
Applications (Academic Press, NY). B7-like nucleotide sequences
isolated based on their sequence identity to the B7-like nucleotide
sequences set forth herein or to fragments and variants thereof are
encompassed by the present invention.
[0114] In a hybridization method, all or part of a known B7-like
nucleotide sequence can be used to screen cDNA or genomic
libraries. Methods for construction of such cDNA and genomic
libraries are generally known in the art and are disclosed in
Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual (2d
ed., Cold Spring Harbor Laboratory Press, Plainview, N.Y.). The
so-called hybridization probes may be genomic DNA fragments, cDNA
fragments, RNA fragments, or other oligonucleotides, and may be
labeled with a detectable group such as .sup.32P, or any other
detectable marker, such as other radioisotopes, a fluorescent
compound, an enzyme, or an enzyme co-factor. Probes for
hybridization can be made by labeling synthetic oligonucleotides
based on the known B7-like nucleotide sequence disclosed herein.
Degenerate primers designed on the basis of conserved nucleotides
or amino acid residues in a known B7-like nucleotide sequence or
encoded amino acid sequence can additionally be used. The probe
typically comprises a region of nucleotide sequence that hybridizes
under stringent conditions to at least about 12, preferably about
25, more preferably about 50, 75, 100, 125, 150, 175, 200, 250,
300, 350, or 400 consecutive nucleotides of a B7-like nucleotide
sequence of the invention or a fragment or variant thereof.
Preparation of probes for hybridization is generally known in the
art and is disclosed in Sambrook et al. (1989) Molecular Cloning: A
Laboratory Manual (2d ed., Cold Spring Harbor Laboratory Press,
Plainview, N.Y.), herein incorporated by reference.
[0115] For example, in one embodiment, a previously unidentified
B7-like nucleic acid molecule hybridizes under stringent conditions
to a probe that is a nucleic acid molecule comprising one of the
B7-like nucleotide sequences of the invention or a fragment
thereof. In another embodiment, the previously unknown B7-like
nucleic acid molecule is at least about 300, 325, 350, 375, 400,
425, 450, 500, 550, 600, 650, 700, 800, 900, 1000, 2,000, 3,000,
4,000 or 5,000 nucleotides in length and hybridizes under stringent
conditions to a probe that is a nucleic acid molecule comprising
one of the B7-like nucleotide sequences disclosed herein or a
fragment thereof.
[0116] Accordingly, in another embodiment, an isolated previously
unknown B7-like nucleic acid molecule of the invention is at least
about 300, 325, 350, 375, 400, 425, 450, 500, 550, 600, 650, 700,
800, 900, 1000, 1,100, 1,200, 1,300, or 1,400 nucleotides in length
and hybridizes under stringent conditions to a probe that is a
nucleic acid molecule comprising one of the nucleotide sequences of
the invention, preferably the coding sequence set forth in SEQ ID
NO:1, SEQ ID NO:3, SEQ ID NO:27, or SEQ ID NO:30, the cDNA of ATCC
2084, the cDNA of ATCC 2085, or a complement, fragment, or variant
thereof.
[0117] As used herein, the term "hybridizes under stringent
conditions" is intended to describe conditions for hybridization
and washing under which nucleotide sequences having at least about
60%, 65%, 70%, preferably 75% identity to each other typically
remain hybridized to each other. Such stringent conditions are
known to those skilled in the art and can be found in Current
Protocols in Molecular Biology (John Wiley & Sons, New York
(1989)), 6.3.1-6.3.6. A preferred, non-limiting example of
stringent hybridization conditions is hybridization in 6.times.
sodium chloride/sodium citrate (SSC) at about 45.degree. C.,
followed by one or more washes in 0.2.times.SSC, 0.1% SDS at
50-65.degree. C. In another preferred embodiment, stringent
conditions comprise hybridization in 6.times.SSC at 42.degree. C.,
followed by washing with 1.times.SSC at 55.degree. C. Preferably,
an isolated nucleic acid molecule that hybridizes under stringent
conditions to a B7-like sequence of the invention corresponds to a
naturally occurring nucleic acid molecule. As used herein, a
"naturally occurring" nucleic acid molecule refers to an RNA or DNA
molecule having a nucleotide sequence that occurs in nature (e.g.,
encodes a natural protein).
[0118] Thus, in addition to the B7-like nucleotide sequences
disclosed herein and fragments and variants thereof, the isolated
nucleic acid molecules of the invention also encompass homologous
DNA sequences identified and isolated from other cells and/or
organisms by hybridization with entire or partial sequences
obtained from the B7-like nucleotide sequences disclosed herein or
variants and fragments thereof.
[0119] The present invention also encompasses antisense nucleic
acid molecules, i.e., molecules that are complementary to a sense
nucleic acid encoding a protein, e.g., complementary to the coding
strand of a double-stranded cDNA molecule, or complementary to an
mRNA sequence. Accordingly, an antisense nucleic acid can hydrogen
bond to a sense nucleic acid. The antisense nucleic acid can be
complementary to an entire B7-like coding strand, or to only a
portion thereof, e.g., all or part of the protein coding region (or
open reading frame). An antisense nucleic acid molecule can be
antisense to a noncoding region of the coding strand of a
nucleotide sequence encoding a B7-like protein. The noncoding
regions are the 5N and 3N sequences that flank the coding region
and are not translated into amino acids.
[0120] Given the coding-strand sequence encoding a B7-like protein
disclosed herein (e.g., SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:27, and
SEQ ID NO:30), antisense nucleic acids of the invention can be
designed according to the rules of Watson and Crick base pairing.
The antisense nucleic acid molecule can be complementary to the
entire coding region of B7-like mRNA, but more preferably is an
oligonucleotide that is antisense to only a portion of the coding
or noncoding region of B7-like mRNA. For example, the antisense
oligonucleotide can be complementary to the region surrounding the
translation start site of B7-like mRNA. An antisense
oligonucleotide can be, for example, about 5, 10, 15, 20, 25, 30,
35, 40, 45, or 50 nucleotides in length. An antisense nucleic acid
of the invention can be constructed using chemical synthesis and
enzymatic ligation procedures known in the art.
[0121] For example, an antisense nucleic acid (e.g., an antisense
oligonucleotide) can be chemically synthesized using naturally
occurring nucleotides or variously modified nucleotides designed to
increase the biological stability of the molecules or to increase
the physical stability of the duplex formed between the antisense
and sense nucleic acids, including, but not limited to, for example
e.g., phosphorothioate derivatives and acridine substituted
nucleotides. Alternatively, the antisense nucleic acid can be
produced biologically using an expression vector into which a
nucleic acid has been subcloned in an antisense orientation (i.e.,
RNA transcribed from the inserted nucleic acid will be of an
antisense orientation to a target nucleic acid of interest,
described further in the following subsection).
[0122] When used therapeutically, the antisense nucleic acid
molecules of the invention are typically administered to a subject
or generated in situ such that they hybridize with or bind to
cellular mRNA and/or genomic DNA encoding a B7-like protein to
thereby inhibit expression of the protein, e.g., by inhibiting
transcription and/or translation. An example of a route of
administration of antisense nucleic acid molecules of the invention
includes direct injection at a tissue site. Alternatively,
antisense nucleic acid molecules can be modified to target selected
cells and then administered systemically. For example, antisense
molecules can be linked to peptides or antibodies to form a complex
that specifically binds to receptors or antigens expressed on a
selected cell surface. The antisense nucleic acid molecules can
also be delivered to cells using the vectors described herein. To
achieve sufficient intracellular concentrations of the antisense
molecules, vector constructs in which the antisense nucleic acid
molecule is placed under the control of a strong pol II or pol III
promoter are preferred.
[0123] An antisense nucleic acid molecule of the invention can be
an .alpha.-anomeric nucleic acid molecule. An .alpha.-anomeric
nucleic acid molecule forms specific double-stranded hybrids with
complementary RNA in which, contrary to the usual .beta.-units, the
strands run parallel to each other (Gaultier et al. (1987) Nucleic
Acids Res. 15:6625-6641). The antisense nucleic acid molecule can
also comprise a 2'-o-methylribonucleotide (Inoue et al. (1987)
Nucleic Acids Res. 15:6131-6148) or a chimeric RNA-DNA analogue
(Inoue et al. (1987) FEBS Lett. 215:327-330).
[0124] The invention also encompasses ribozymes, which are
catalytic RNA molecules with ribonuclease activity that are capable
of cleaving a single-stranded nucleic acid, such as an mRNA, to
which they have a complementary region. Ribozymes (e.g., hammerhead
ribozymes (described in Haselhoff and Gerlach (1988) Nature
334:585-591)) can be used to catalytically cleave B7-like mRNA
transcripts to thereby inhibit translation of B7-like mRNA. A
ribozyme having specificity for a B7-like-encoding nucleic acid can
be designed based upon the nucleotide sequence of a B7-like cDNA
disclosed herein (e.g., SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:27, and
SEQ ID NO:30). See, e.g., Cech et al., U.S. Pat. No. 4,987,071; and
Cech et al., U.S. Pat. No. 5,116,742. Alternatively, B7-like mRNA
can be used to select a catalytic RNA having a specific
ribonuclease activity from a pool of RNA molecules. See, e.g.,
Bartel and Szostak (1993) Science 261:1411-1418.
[0125] The invention also encompasses nucleic acid molecules that
form triple helical structures. For example, B7-like gene
expression can be inhibited by targeting nucleotide sequences
complementary to the regulatory region of the B7-like protein
(e.g., the B7-like promoter and/or enhancers) to form triple
helical structures that prevent transcription of the B7-like gene
in target cells. See generally Helene (1991) Anticancer Drug Des.
6(6):569; Helene (1992) Ann. N.Y. Acad. Sci. 660:27; and Maher
(1992) Bioassays 14(12):807.
[0126] In preferred embodiments, the nucleic acid molecules of the
invention can be modified at the base moiety, sugar moiety, or
phosphate backbone to improve, e.g., the stability, hybridization,
or solubility of the molecule. For example, the deoxyribose
phosphate backbone of the nucleic acids can be modified to generate
peptide nucleic acids (see Hyrup et al. (1996) Bioorganic &
Medicinal Chemistry 4:5). As used herein, the terms "peptide
nucleic acids" or "PNAs" refer to nucleic acid mimics, e.g., DNA
mimics, in which the deoxyribose phosphate backbone is replaced by
a pseudopeptide backbone and only the four natural nucleobases are
retained. The neutral backbone of PNAs has been shown to allow for
specific hybridization to DNA and RNA under conditions of low ionic
strength. The synthesis of PNA oligomers can be performed using
standard solid-phase peptide synthesis protocols as described, for
example, in Hyrup et al. (1996), supra; Perry-O'Keefe et al. (1996)
Proc. Natl. Acad. Sci. USA 93:14670.
[0127] PNAs of a B7-like molecule can be used in therapeutic and
diagnostic applications. For example, PNAs can be used as antisense
or antigene agents for sequence-specific modulation of gene
expression by, e.g., inducing transcription or translation arrest
or inhibiting replication. PNAs of the invention can also be used,
e.g., in the analysis of single base pair mutations in a gene by,
e.g., PNA-directed PCR clamping; as artificial restriction enzymes
when used in combination with other enzymes, e.g., S1 nucleases
(Hyrup (1996), supra); or as probes or primers for DNA sequence and
hybridization (Hyrup (1996), supra; Perry-O'Keefe et al. (1996),
supra).
[0128] In another embodiment, PNAs of a B7-like molecule can be
modified, e.g., to enhance their stability, specificity, or
cellular uptake, by attaching lipophilic or other helper groups to
PNA, by the formation of PNA-DNA chimeras, or by the use of
liposomes or other techniques of drug delivery known in the art.
The synthesis of PNA-DNA chimeras can be performed as described in
Hyrup (1996), supra; Finn et al. (1996) Nucleic Acids Res.
24(17):3357-63; Mag et al. (1989) Nucleic Acids Res. 17:5973; and
Peterson et al. (1975) Bioorganic Med. Chem. Lett. 5:1119.
II. Isolated B7-Like Proteins and Anti-B7-Like Antibodies
[0129] B7-like proteins are also encompassed within the present
invention. By "B7-like protein" is intended a protein having the
amino acid sequence set forth in SEQ ID NO:2, SEQ ID NO:4, SEQ ID
NO:28, or SEQ ID NO:31, as well as fragments, biologically active
portions, and variants thereof.
[0130] "Fragments" or "biologically active portions" include
polypeptide fragments suitable for use as immunogens to raise
anti-B7-like antibodies. Fragments include peptides comprising
amino acid sequences sufficiently identical to or derived from the
amino acid sequence of a B7-like protein, or partial-length
protein, of the invention and exhibiting at least one activity of a
B7-like protein, but which include fewer amino acids than the
full-length SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:28, or SEQ ID NO:31
B7-like proteins disclosed herein. Typically, biologically active
portions comprise a domain or motif with at least one activity of
the B7-like protein. A biologically active portion of a B7-like
protein can be a polypeptide which is, for example, 17, 25, 50, 100
or more amino acids in length. Such biologically active portions
can be prepared by recombinant techniques and evaluated for one or
more of the functional activities of a native B7-like protein. As
used here, a fragment comprises at least 17 contiguous amino acids
of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:28, or SEQ ID NO:31. The
invention encompasses other fragments, however, such as any
fragment in the protein greater than 17, 18, 19, or 20 amino
acids.
[0131] By "variants" is intended proteins or polypeptides having an
amino acid sequence that is at least about 45%, 55%, 65%, 70%, 75%,
80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%
identical to the amino acid sequence of SEQ ID NO:2, SEQ ID NO:4,
SEQ ID NO:28, or SEQ ID NO:31. Variants also include polypeptides
encoded by the cDNA insert of the plasmid deposited with ATCC as
Accession Number 2084, the cdna insert of the plasmid deposited
with ATCC as Accession Number 2085, or polypeptides encoded by a
nucleic acid molecule that hybridizes to the nucleic acid molecule
of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:27, or SEQ ID NO:30, or a
complement thereof, under stringent conditions. Such variants
generally retain the functional activity of the B7-like proteins of
the invention. Variants include polypeptides that differ in amino
acid sequence due to natural allelic variation or mutagenesis.
[0132] The invention also provides B7-like chimeric or fusion
proteins. As used herein, a B7-like "chimeric protein" or "fusion
protein" comprises a B7-like polypeptide operably linked to a
non-B7-like polypeptide. A "B7-like polypeptide" refers to a
polypeptide having an amino acid sequence corresponding to a
B7-like protein, whereas a "non-B7-like polypeptide" refers to a
polypeptide having an amino acid sequence corresponding to a
protein that is not substantially identical to the B7-like protein,
e.g., a protein that is different from the B7-like protein and
which is derived from the same or a different organism. Within a
B7-like fusion protein, the B7-like polypeptide can correspond to
all or a portion of a B7-like protein, preferably at least one
biologically active portion of a B7-like protein. Within the fusion
protein, the term "operably linked" is intended to indicate that
the B7-like polypeptide and the non-B7-like polypeptide are fused
in-frame to each other. The non-B7-like polypeptide can be fused to
the N-terminus or C-terminus of the B7-like polypeptide.
[0133] One useful fusion protein is a GST-B7-like fusion protein in
which the B7-like sequences are fused to the C-terminus of the GST
sequences. Such fusion proteins can facilitate the purification of
recombinant B7-like proteins.
[0134] In yet another embodiment, the fusion protein is a
B7-like-immunoglobulin fusion protein in which all or part of a
B7-like protein is fused to sequences derived from a member of the
immunoglobulin protein family. For example, a fusion protein
comprising a first peptide that includes the B7-like protein fused
to a second peptide, such as an immunoglobulin constant region,
that alters the solubility, binding affinity, stability and/or
valency of the first peptide are provided. In one embodiment, a
fusion protein is produced comprising a first peptide having the
amino acid residues of the extracellular region of the B7-like
protein joined to a second peptide that includes an immunoglobulin
constant region. Such immunoglobulin constant regions include, for
example, a human C.gamma.1 domain or C.gamma.4 domain (e.g., the
hinge, CH2 and CH3 regions of human IgC.gamma.1, or human
IgC.gamma.4, see e.g., Capon et al. U.S. Pat. No. 5,116,964,
incorporated herein by reference). Fusion proteins and peptides
produced by recombinant technique may be secreted and isolated from
a mixture of cells and medium containing the protein or peptide.
Alternatively, the protein or peptide may be retained
cytoplasmically and the cells harvested, lysed and the protein
isolated.
[0135] The B7-like-immunoglobulin fusion proteins of the invention
can be incorporated into pharmaceutical compositions and
administered to a subject to modulate B7-like-activity in vivo. The
B7-like-immunoglobulin fusion proteins can be used to either
up-regulate or inhibit the expression of one or more B7-like
proteins, or to increase or block binding of one or more B7-like
proteins to their natural target molecules on T cells, to thereby
provide enhancement or suppression of cell-mediated immune
responses in vivo. Modulation of the B7-like protein/B7-like target
molecule interaction may be useful therapeutically, both for
treating proliferative and differentiative disorders and for
modulating (e.g., promoting or inhibiting) cell survival. Moreover,
the B7-like-immunoglobulin fusion proteins of the invention can be
used as immunogens to produce anti-B7-like antibodies in a subject,
to purify B7-like ligands including the B7-like natural target
molecules, and in screening assays to identify molecules that
inhibit the interaction of a B7-like protein with a B7-like ligand
and/or natural target molecule.
[0136] Preferably, a B7-like chimeric or fusion protein of the
invention is produced by standard recombinant DNA techniques. For
example, DNA fragments coding for the different polypeptide
sequences may be ligated together in-frame, or the fusion gene can
be synthesized, such as with automated DNA synthesizers.
Alternatively, PCR amplification of gene fragments can be carried
out using anchor primers that give rise to complementary overhangs
between two consecutive gene fragments, which can subsequently be
annealed and reamplified to generate a chimeric gene sequence (see,
e.g., Ausubel et al., eds. (1995) Current Protocols in Molecular
Biology) (Greene Publishing and Wiley-Interscience, NY). Moreover,
a B7-like-encoding nucleic acid can be cloned into a commercially
available expression vector such that it is linked in-frame to an
existing fusion moiety.
[0137] Variants of the B7-like proteins can function as either
B7-like agonists (mimetics) or as B7-like antagonists. Variants of
the B7-like protein can be generated by mutagenesis, e.g., discrete
point mutation or truncation of the B7-like protein. An agonist of
the B7-like protein can retain substantially the same, or a subset,
of the biological activities of the naturally occurring form of the
B7-like protein. An antagonist of the B7-like protein can inhibit
one or more of the activities of the naturally occurring form of
the B7-like protein by, for example, competitively binding to a
downstream or upstream member of a cellular signaling cascade that
includes the B7-like protein. Thus, specific biological effects can
be elicited by treatment with a variant of limited function.
Treatment of a subject with a variant having a subset of the
biological activities of the naturally occurring form of the
protein can have fewer side effects in a subject relative to
treatment with the naturally occurring form of the B7-like
proteins.
[0138] Variants of a B7-like protein that function as either
B7-like agonists or as B7-like antagonists can be identified by
screening combinatorial libraries of mutants, e.g., truncation
mutants, of a B7-like protein for B7-like protein agonist or
antagonist activity. In one embodiment, a variegated library of
B7-like variants is generated by combinatorial mutagenesis at the
nucleic acid level and is encoded by a variegated gene library. A
variegated library of B7-like variants can be produced by, for
example, enzymatically ligating a mixture of synthetic
oligonucleotides into gene sequences such that a degenerate set of
potential B7-like sequences is expressible as individual
polypeptides, or alternatively, as a set of larger fusion proteins
(e.g., for phage display) containing the set of B7-like sequences
therein. There are a variety of methods that can be used to produce
libraries of potential B7-like variants from a degenerate
oligonucleotide sequence. Chemical synthesis of a degenerate gene
sequence can be performed in an automatic DNA synthesizer, and the
synthetic gene then ligated into an appropriate expression vector.
Use of a degenerate set of genes allows for the provision, in one
mixture, of all of the sequences encoding the desired set of
potential B7-like sequences. Methods for synthesizing degenerate
oligonucleotides are known in the art (see, e.g., Narang (1983)
Tetrahedron 39:3; Itakura et al. (1984) Annu. Rev. Biochem. 53:323;
Itakura et al. (1984) Science 198:1056; Ike et al. (1983) Nucleic
Acid Res. 11:477).
[0139] In addition, libraries of fragments of a B7-like protein
coding sequence can be used to generate a variegated population of
B7-like fragments for screening and subsequent selection of
variants of a B7-like protein. In one embodiment, a library of
coding sequence fragments can be generated by treating a
double-stranded PCR fragment of a B7-like coding sequence with a
nuclease under conditions wherein nicking occurs only about once
per molecule, denaturing the double-stranded DNA, renaturing the
DNA to form double-stranded DNA which can include sense/antisense
pairs from different nicked products, removing single-stranded
portions from reformed duplexes by treatment with S1 nuclease, and
ligating the resulting fragment library into an expression vector.
By this method, one can derive an expression library that encodes
N-terminal and internal fragments of various sizes of the B7-like
protein.
[0140] Several techniques are known in the art for screening gene
products of combinatorial libraries made by point mutations or
truncation and for screening cDNA libraries for gene products
having a selected property. Such techniques are adaptable for rapid
screening of the gene libraries generated by the combinatorial
mutagenesis of B7-like proteins. The most widely used techniques,
which are amenable to high through-put analysis, for screening
large gene libraries typically include cloning the gene library
into replicable expression vectors, transforming appropriate cells
with the resulting library of vectors, and expressing the
combinatorial genes under conditions in which detection of a
desired activity facilitates isolation of the vector encoding the
gene whose product was detected. Recursive ensemble mutagenesis
(REM), a technique that enhances the frequency of functional
mutants in the libraries, can be used in combination with the
screening assays to identify B7-like variants (Arkin and Yourvan
(1992) Proc. Natl. Acad. Sci. USA 89:7811-7815; Delgrave et al.
(1993) Protein Engineering 6(3):327-331).
[0141] An isolated B7-like polypeptide of the invention can be used
as an immunogen to generate antibodies that bind B7-like proteins
using standard techniques for polyclonal and monoclonal antibody
preparation. The full-length B7-like protein can be used or,
alternatively, the invention provides antigenic peptide fragments
of B7-like proteins for use as immunogens. The antigenic peptide of
a B7-like protein comprises at least 8, preferably 10, 15, 20, 25,
or 30 amino acid residues of the amino acid sequence shown in SEQ
ID NO:2, SEQ ID NO:4, SEQ ID NO:28, or SEQ ID NO:31, and
encompasses an epitope of a B7-like protein such that an antibody
raised against the peptide forms a specific immune complex with the
B7-like protein. Preferred epitopes encompassed by the antigenic
peptide are regions of a B7-like protein that are located on the
surface of the protein, e.g., hydrophilic regions. For example, an
analysis of a hydropathy plot of the open reading frame of hB7-H21
indicates that the regions corresponding to amino acids 60-75,
95-105, 165-175, and 210-220 may be useful antigenic peptides for
the generation of antibodies.
[0142] Accordingly, another aspect of the invention pertains to
anti-B7-like polyclonal and monoclonal antibodies that bind a
B7-like protein. Polyclonal anti-B7-like antibodies can be prepared
by immunizing a suitable subject (e.g., rabbit, goat, mouse, or
other mammal) with a B7-like immunogen. The anti-B7-like antibody
titer in the immunized subject can be monitored over time by
standard techniques, such as with an enzyme linked immunosorbent
assay (ELISA) using immobilized B7-like protein. At an appropriate
time after immunization, e.g., when the anti-B7-like antibody
titers are highest, antibody-producing cells can be obtained from
the subject and used to prepare monoclonal antibodies by standard
techniques, such as the hybridoma technique originally described by
Kohler and Milstein (1975) Nature 256:495-497, the human B cell
hybridoma technique (Kozbor et al. (1983) Immunol. Today 4:72), the
EBV-hybridoma technique (Cole et al. (1985) in Monoclonal
Antibodies and Cancer Therapy, ed. Reisfeld and Sell (Alan R. Liss,
Inc., New York, N.Y.), pp. 77-96) or trioma techniques. The
technology for producing hybridomas is well known (see generally
Coligan et al., eds. (1994) Current Protocols in Immunology (John
Wiley & Sons, Inc., New York, N.Y.); Galfre et al. (1977)
Nature 266:55052; Kenneth (1980) in Monoclonal Antibodies: A New
Dimension In Biological Analyses (Plenum Publishing Corp., NY; and
Lerner (1981) Yale J. Biol. Med., 54:387-402).
[0143] Alternative to preparing monoclonal antibody-secreting
hybridomas, a monoclonal anti-B7-like antibody can be identified
and isolated by screening a recombinant combinatorial
immunoglobulin library (e.g., an antibody phage display library)
with a B7-like protein to thereby isolate immunoglobulin library
members that bind the B7-like protein. Kits for generating and
screening phage display libraries are commercially available (e.g.,
the Pharmacia Recombinant Phage Antibody System, Catalog No.
27-9400-01; and the Stratagene SurjZAP.TM. Phage Display Kit,
Catalog No. 240612). Additionally, examples of methods and reagents
particularly amenable for use in generating and screening antibody
display library can be found in, for example, U.S. Pat. No.
5,223,409; PCT Publication Nos. WO 92/18619; WO 91/17271; WO
92/20791; WO 92/15679; 93/01288; WO 92/01047; 92/09690; and
90/02809; Fuchs et al. (1991) Bio/Technology 9:1370-1372; Hay et
al. (1992) Hum. Antibod. Hybridomas 3:81-85; Huse et al. (1989)
Science 246:1275-1281; Griffiths et al. (1993) EMBO J.
12:725-734.
[0144] Additionally, recombinant anti-B7-like antibodies, such as
chimeric and humanized monoclonal antibodies, comprising both human
and nonhuman portions, which can be made using standard recombinant
DNA techniques, are within the scope of the invention. Such
chimeric and humanized monoclonal antibodies can be produced by
recombinant DNA techniques known in the art, for example using
methods described in PCT Publication Nos. WO 86/101533 and WO
87/02671; European Patent Application Nos. 184,187, 171,496,
125,023, and 173,494; U.S. Pat. Nos. 4,816,567 and 5,225,539;
European Patent Application 125,023; Better et al. (1988) Science
240:1041-1043; Liu et al. (1987) Proc. Natl. Acad. Sci. USA
84:3439-3443; Liu et al. (1987) J. Immunol. 139:3521-3526; Sun et
al. (1987) Proc. Natl. Acad. Sci. USA 84:214-218; Nishimura et al.
(1987) Canc. Res. 47:999-1005; Wood et al. (1985) Nature
314:446-449; Shaw et al. (1988) J. Natl. Cancer Inst.
80:1553-1559); Morrison (1985) Science 229:1202-1207; Oi et al.
(1986) Bio/Techniques 4:214; Jones et al. (1986) Nature
321:552-525; Verhoeyan et al. (1988) Science 239:1534; and Beidler
et al. (1988) J. Immunol. 141:4053-4060.
[0145] Completely human antibodies are particularly desirable for
therapeutic treatment of human patients. Such antibodies can be
produced using transgenic mice that are incapable of expressing
endogenous immunoglobulin heavy and light chains genes, but which
can express human heavy and light chain genes. See, for example,
Lonberg and Huszar (1995) Int. Rev. Immunol. 13:65-93); and U.S.
Pat. Nos. 5,625,126; 5,633,425; 5,569,825; 5,661,016; and
5,545,806. In addition, companies such as Abgenix, Inc. (Fremont,
Calif.), can be engaged to provide human antibodies directed
against a selected antigen using technology similar to that
described above.
[0146] Completely human antibodies that recognize a selected
epitope can be generated using a technique referred to as "guided
selection." In this approach a selected non-human monoclonal
antibody, e.g., a murine antibody, is used to guide the selection
of a completely human antibody recognizing the same epitope. This
technology is described by Jespers et al. (1994) Bio/Technology
12:899-903).
[0147] An anti-B7-like antibody (e.g., monoclonal antibody) can be
used to isolate B7-like proteins by standard techniques, such as
affinity chromatography or immunoprecipitation. An anti-B7-like
antibody can facilitate the purification of natural B7-like protein
from cells and of recombinantly produced B7-like protein expressed
in host cells. Moreover, an anti-B7-like antibody can be used to
detect B7-like protein (e.g., in a cellular lysate or cell
supernatant) in order to evaluate the abundance and pattern of
expression of the B7-like protein. Anti-B7-like antibodies can be
used diagnostically to monitor protein levels in tissue as part of
a clinical testing procedure, e.g., to, for example, determine the
efficacy of a given treatment regimen. Detection can be facilitated
by coupling the antibody to a detectable substance. Examples of
detectable substances include various enzymes, prosthetic groups,
fluorescent materials, luminescent materials, bioluminescent
materials, and radioactive materials. Examples of suitable enzymes
include horseradish peroxidase, alkaline phosphatase,
.beta.-galactosidase, or acetylcholinesterase; examples of suitable
prosthetic group complexes include streptavidin/biotin and
avidin/biotin; examples of suitable fluorescent materials include
umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine,
dichlorotriazinylamine fluorescein, dansyl chloride or
phycoerythrin; an example of a luminescent material includes
luminol; examples of bioluminescent materials include luciferase,
luciferin, and aequorin; and examples of suitable radioactive
material include .sup.125I, .sup.131I, .sup.35S, or .sup.3H.
[0148] Further, an antibody (or fragment thereof) may be conjugated
to a therapeutic moiety such as a cytotoxin, a therapeutic agent or
a radioactive metal ion. A cytotoxin or cytotoxic agent includes
any agent that is detrimental to cells. Examples include taxol,
cytochalasin B, gramicidin D, ethidium bromide, emetine, mitomycin,
etoposide, tenoposide, vincristine, vinblastine, colchicin,
doxorubicin, daunorubicin, dihydroxy anthracin dione, mitoxantrone,
mithramycin, actinomycin D, 1-dehydrotestosterone, glucocorticoids,
procaine, tetracaine, lidocaine, propranolol, and puromycin and
analogs or homologs thereof. Therapeutic agents include, but are
not limited to, antimetabolites (e.g., methotrexate,
6-mercaptopurine, 6-thioguanine, cytarabine, 5-fluorouracil
decarbazine), alkylating agents (e.g., mechlorethamine, thioepa
chlorambucil, melphalan, carmustine (BSNU) and lomustine (CCNU),
cyclothosphamide, busulfan, dibromomannitol, streptozotocin,
mitomycin C, and cis-dichlorodiamine platinum (II) (DDP)
cisplatin), anthracyclines (e.g., daunorubicin (formerly
daunomycin) and doxorubicin), antibiotics (e.g., dactinomycin
(formerly actinomycin), bleomycin, mithramycin, and anthramycin
(AMC)), and anti-mitotic agents (e.g., vincristine and
vinblastine). The conjugates of the invention can be used for
modifying a given biological response, the drug moiety is not to be
construed as limited to classical chemical therapeutic agents. For
example, the drug moiety may be a protein or polypeptide possessing
a desired biological activity. Such proteins may include, for
example, a toxin such as abrin, ricin A, pseudomonas exotoxin, or
diphtheria toxin; a protein such as tumor necrosis factor,
alpha-interferon, beta-interferon, nerve growth factor, platelet
derived growth factor, tissue plasminogen activator; or, biological
response modifiers such as, for example, lymphokines, interleukin-1
("IL-1"), interleukin-2 ("IL-2"), interleukin-6 ("IL-6"),
granulocyte macrophase colony stimulating factor ("GM-CSF"),
granulocyte colony stimulating factor ("G-CSF"), or other growth
factors.
[0149] Techniques for conjugating such therapeutic moiety to
antibodies are well known, see, e.g., Arnon et al. (1985)
"Monoclonal Antibodies for Immunotargeting of Drugs in Cancer
Therapy," in Monoclonal Antibodies and Cancer Therapy, ed. Reisfeld
et al. (Alan R. Liss, Inc.), pp. 243-56; Hellstrom et al. (1987)
"Antibodies for Drug Delivery," in Controlled Drug Delivery
(2.sup.nd Ed.), ed. Robinson et al. (Marcel Dekker, Inc.), pp.
623-53; Thorpe (1985) "Antibody Carriers of Cytotoxic Agents in
Cancer Therapy: A Review," in Monoclonal Antibodies '84: Biological
and Clinical Applications, ed. Pinchera et al., pp. 475-506;
"Analysis, Results, and Future Prospective of the Therapeutic Use
of Radiolabeled Antibody in Cancer Therapy," in Monoclonal
Antibodies for Cancer Detection and Therapy, Baldwin et al.,
(Academic Press, NY, 1985), pp. 303-16, and Thorpe et al. (1982)
"The Preparation and Cytotoxic Properties of Antibody-Toxin
Conjugates," Immunol. Rev. 62:119-58. Alternatively, an antibody
can be conjugated to a second antibody to form an antibody
heteroconjugate as described by Segal in U.S. Pat. No.
4,676,980.
III. Recombinant Expression Vectors and Host Cells
[0150] Another aspect of the invention pertains to vectors,
preferably expression vectors, containing a nucleic acid encoding a
B7-like protein (or a portion thereof). "Vector" refers to a
nucleic acid molecule capable of transporting another nucleic acid
to which it has been linked, such as a "plasmid," a circular
double-stranded DNA loop into which additional DNA segments can be
ligated, or a viral vector, where additional DNA segments can be
ligated into the viral genome. The vectors are useful for
autonomous replication in a host cell or may be integrated into the
genome of a host cell upon introduction into the host cell, and
thereby are replicated along with the host genome (e.g.,
nonepisomal mammalian vectors). Expression vectors are capable of
directing the expression of genes to which they are operably
linked. In general, expression vectors of utility in recombinant
DNA techniques are often in the form of plasmids (vectors).
However, the invention is intended to include such other forms of
expression vectors, such as viral vectors (e.g., replication
defective retroviruses, adenoviruses, and adeno-associated
viruses), that serve equivalent functions.
[0151] The recombinant expression vectors of the invention comprise
a nucleic acid of the invention in a form suitable for expression
of the nucleic acid in a host cell. This means that the recombinant
expression vectors include one or more regulatory sequences,
selected on the basis of the host cells to be used for expression,
operably linked to the nucleic acid sequence to be expressed.
"Operably linked" is intended to mean that the nucleotide sequence
of interest is linked to the regulatory sequence(s) in a manner
that allows for expression of the nucleotide sequence (e.g., in an
in vitro transcription/translation system or in a host cell when
the vector is introduced into the host cell). The term "regulatory
sequence" is intended to include promoters, enhancers, and other
expression control elements (e.g., polyadenylation signals). See,
for example, Goeddel (1990) in Gene Expression Technology: Methods
in Enzymology 185 (Academic Press, San Diego, Calif.). Regulatory
sequences include those that direct constitutive expression of a
nucleotide sequence in many types of host cell and those that
direct expression of the nucleotide sequence only in certain host
cells (e.g., tissue-specific regulatory sequences). It will be
appreciated by those skilled in the art that the design of the
expression vector can depend on such factors as the choice of the
host cell to be transformed, the level of expression of protein
desired, etc. The expression vectors of the invention can be
introduced into host cells to thereby produce proteins or peptides,
including fusion proteins or peptides, encoded by nucleic acids as
described herein (e.g., B7-like proteins, mutant forms of B7-like
proteins, fusion proteins, etc.).
[0152] The recombinant expression vectors of the invention can be
designed for expression of B7-like protein in prokaryotic or
eukaryotic host cells. Expression of proteins in prokaryotes is
most often carried out in E. coli with vectors containing
constitutive or inducible promoters directing the expression of
either fusion or nonfusion proteins. Fusion vectors add a number of
amino acids to a protein encoded therein, usually to the amino
terminus of the recombinant protein. Typical fusion expression
vectors include pGEX (Pharmacia Biotech Inc; Smith and Johnson
(1988) Gene 67:31-40), pMAL (New England Biolabs, Beverly, Mass.),
and pRIT5 (Pharmacia, Piscataway, N.J.) which fuse glutathione
S-transferase (GST), maltose E binding protein, or protein A,
respectively, to the target recombinant protein. Examples of
suitable inducible nonfusion E. coli expression vectors include
pTrc (Amann et al. (1988) Gene 69:301-315) and pET 11d (Studier et
al. (1990) in Gene Expression Technology: Methods in Enzymology 185
(Academic Press, San Diego, Calif.), pp. 60-89). Strategies to
maximize recombinant protein expression in E. coli can be found in
Gottesman (1990) in Gene Expression Technology: Methods in
Enzymology 185 (Academic Press, Calif.), pp. 119-128 and Wada et
al. (1992) Nucleic Acids Res. 20:2111-2118. Target gene expression
from the pTrc vector relies on host RNA polymerase transcription
from a hybrid trp-lac fusion promoter.
[0153] Suitable eukaryotic host cells include insect cells
(examples of Baculovirus vectors available for expression of
proteins in cultured insect cells (e.g., Sf 9 cells) include the
pAc series (Smith et al. (1983) Mol. Cell. Biol. 3:2156-2165) and
the pVL series (Lucklow and Summers (1989) Virology 170:31-39));
yeast cells (examples of vectors for expression in yeast S.
cerevisiae include pYepSec1 (Baldari et al. (1987) EMBO J.
6:229-234), pMFa (Kurjan and Herskowitz (1982) Cell 30:933-943),
pJRY88 (Schultz et al. (1987) Gene 54:113-123), pYES2 (Invitrogen
Corporation, San Diego, Calif.), and pPicZ (Invitrogen Corporation,
San Diego, Calif.)); or mammalian cells (mammalian expression
vectors include pCDM8 (Seed (1987) Nature 329:840) and pMT2PC
(Kaufman et al. (1987) EMBO J. 6:187:195)). Suitable mammalian
cells include Chinese hamster ovary cells (CHO) or COS cells. In
mammalian cells, the expression vector's control functions are
often provided by viral regulatory elements. For example, commonly
used promoters are derived from polyoma, Adenovirus 2,
cytomegalovirus, and Simian Virus 40. For other suitable expression
systems for both prokaryotic and eukaryotic cells, see chapters 16
and 17 of Sambrook et al. (1989) Molecular cloning: A Laboratory
Manual (2d ed., Cold Spring Harbor Laboratory Press, Plainview,
N.Y.). See, Goeddel (1990) in Gene Expression Technology: Methods
in Enzymology 185 (Academic Press, San Diego, Calif.).
Alternatively, the recombinant expression vector can be transcribed
and translated in vitro, for example using T7 promoter regulatory
sequences and T7 polymerase.
[0154] The terms "host cell" and "recombinant host cell" are used
interchangeably herein. It is understood that such terms refer not
only to the particular subject cell but to the progeny or potential
progeny of such a cell. Because certain modifications may occur in
succeeding generations due to either mutation or environmental
influences, such progeny may not, in fact, be identical to the
parent cell but are still included within the scope of the term as
used herein.
[0155] In one embodiment, the expression vector is a recombinant
mammalian expression vector that comprises tissue-specific
regulatory elements that direct expression of the nucleic acid
preferentially in a particular cell type. Suitable tissue-specific
promoters include the albumin promoter (e.g., liver-specific
promoter; Pinkert et al. (1987) Genes Dev. 1:268-277),
lymphoid-specific promoters (Calame and Eaton (1988) Adv. Immunol.
43:235-275), in particular promoters of T cell receptors (Winoto
and Baltimore (1989) EMBO J. 8:729-733) and immunoglobulins
(Banerji et al. (1983) Cell 33:729-740; Queen and Baltimore (1983)
Cell 33:741-748), neuron-specific promoters (e.g., the
neurofilament promoter; Byrne and Ruddle (1989) Proc. Natl. Acad.
Sci. USA 86:5473-5477), pancreas-specific promoters (Edlund et al.
(1985) Science 230:912-916), and mammary gland-specific promoters
(e.g., milk whey promoter; U.S. Pat. No. 4,873,316 and European
Application Patent Publication No. 264,166).
Developmentally-regulated promoters are also encompassed, for
example the murine hox homeobox promoters (Kessel and Gruss (1990)
Science 249:374-379), the .alpha.-fetoprotein promoter (Campes and
Tilghman (1989) Genes Dev. 3:537-546), and the like.
[0156] The invention further provides a recombinant expression
vector comprising a DNA molecule of the invention cloned into the
expression vector in an antisense orientation. That is, the DNA
molecule is operably linked to a regulatory sequence in a manner
that allows for expression (by transcription of the DNA molecule)
of an RNA molecule that is antisense to B7-like mRNA. Regulatory
sequences operably linked to a nucleic acid cloned in the antisense
orientation can be chosen to direct the continuous expression of
the antisense RNA molecule in a variety of cell types, for instance
viral promoters and/or enhancers, or regulatory sequences can be
chosen to direct constitutive, tissue-specific, or
cell-type-specific expression of antisense RNA. The antisense
expression vector can be in the form of a recombinant plasmid,
phagemid, or attenuated virus in which antisense nucleic acids are
produced under the control of a high efficiency regulatory region,
the activity of which can be determined by the cell type into which
the vector is introduced. For a discussion of the regulation of
gene expression using antisense genes see Weintraub et al. (1986)
Reviews--Trends in Genetics, Vol. 1(1).
[0157] Vector DNA can be introduced into prokaryotic or eukaryotic
cells via conventional transformation or transfection techniques.
As used herein, the terms "transformation" and "transfection" are
intended to refer to a variety of art-recognized techniques for
introducing foreign nucleic acid (e.g., DNA) into a host cell,
including calcium phosphate or calcium chloride co-precipitation,
DEAE-dextran-mediated transfection, lipofection, or
electroporation. Suitable methods for transforming or transfecting
host cells can be found in Sambrook et al. (1989) Molecular
Cloning: A Laboraty Manual (2d ed., Cold Spring Harbor Laboratory
Press, Plainview, N.Y.) and other laboratory manuals.
[0158] For stable transfection of mammalian cells, it is known
that, depending upon the expression vector and transfection
technique used, only a small fraction of cells may integrate the
foreign DNA into their genome. In order to identify and select
these integrants, a gene that encodes a selectable marker (e.g.,
for resistance to antibiotics) is generally introduced into the
host cells along with the gene of interest. Preferred selectable
markers include those which confer resistance to drugs, such as
G418, hygromycin, and methotrexate. Nucleic acid encoding a
selectable marker can be introduced into a host cell on the same
vector as that encoding a B7-like protein or can be introduced on a
separate vector. Cells stably transfected with the introduced
nucleic acid can be identified by drug selection (e.g., cells that
have incorporated the selectable marker gene will survive, while
the other cells die).
[0159] A host cell of the invention, such as a prokaryotic or
eukaryotic host cell in culture, can be used to produce (i.e.,
express) B7-like protein. Accordingly, the invention further
provides methods for producing B7-like protein using the host cells
of the invention. In one embodiment, the method comprises culturing
the host cell of the invention, into which a recombinant expression
vector encoding a B7-like protein has been introduced, in a
suitable medium such that B7-like protein is produced. In another
embodiment, the method further comprises isolating B7-like protein
from the medium or the host cell.
[0160] The host cells of the invention can also be used to produce
nonhuman transgenic animals. For example, in one embodiment, a host
cell of the invention is a fertilized oocyte or an embryonic stem
cell into which B7-like-coding sequences have been introduced. Such
host cells can then be used to create nonhuman transgenic animals
in which exogenous B7-like sequences have been introduced into
their genome or homologous recombinant animals in which endogenous
B7-like sequences have been altered. Such animals are useful for
studying the function and/or activity of B7-like genes and proteins
and for identifying and/or evaluating modulators of B7-like
activity. As used herein, a "transgenic animal" is a nonhuman
animal, preferably a mammal, more preferably a rodent such as a rat
or mouse, in which one or more of the cells of the animal includes
a transgene. Other examples of transgenic animals include nonhuman
primates, sheep, dogs, cows, goats, chickens, amphibians, etc. A
transgene is exogenous DNA that is integrated into the genome of a
cell from which a transgenic animal develops and which remains in
the genome of the mature animal, thereby directing the expression
of an encoded gene product in one or more cell types or tissues of
the transgenic animal. As used herein, a "homologous recombinant
animal" is a nonhuman animal, preferably a mammal, more preferably
a mouse, in which an endogenous B7-like gene has been altered by
homologous recombination between the endogenous gene and an
exogenous DNA molecule introduced into a cell of the animal, e.g.,
an embryonic cell of the animal, prior to development of the
animal.
[0161] A transgenic animal of the invention can be created by
introducing B7-like-encoding nucleic acid into the male pronuclei
of a fertilized oocyte, e.g., by microinjection, retroviral
infection, and allowing the oocyte to develop in a pseudopregnant
female foster animal. The B7-like cDNA sequence can be introduced
as a transgene into the genome of a nonhuman animal. Alternatively,
a homologue of the mouse B7-like gene can be isolated based on
hybridization and used as a transgene. Intronic sequences and
polyadenylation signals can also be included in the transgene to
increase the efficiency of expression of the transgene. A
tissue-specific regulatory sequence(s) can be operably linked to
the B7-like transgene to direct expression of B7-like protein to
particular cells. Methods for generating transgenic animals via
embryo manipulation and microinjection, particularly animals such
as mice, have become conventional in the art and are described, for
example, in U.S. Pat. Nos. 4,736,866, 4,870,009, and 4,873,191 and
in Hogan (1986) Manipulating the Mouse Embryo (Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, N.Y., 1986). Similar methods
are used for production of other transgenic animals. A transgenic
founder animal can be identified based upon the presence of the
B7-like transgene in its genome and/or expression of B7-like mRNA
in tissues or cells of the animals. A transgenic founder animal can
then be used to breed additional animals carrying the transgene.
Moreover, transgenic animals carrying a transgene encoding B7-like
gene can further be bred to other transgenic animals carrying other
transgenes.
[0162] To create a homologous recombinant animal, one prepares a
vector containing at least a portion of a B7-like gene or a homolog
of the gene into which a deletion, addition, or substitution has
been introduced to thereby alter, e.g., functionally disrupt, the
B7-like gene. In a preferred embodiment, the vector is designed
such that, upon homologous recombination, the endogenous B7-like
gene is functionally disrupted (i.e., no longer encodes a
functional protein; also referred to as a "knock out" vector).
Alternatively, the vector can be designed such that, upon
homologous recombination, the endogenous B7-like gene is mutated or
otherwise altered but still encodes functional protein (e.g., the
upstream regulatory region can be altered to thereby alter the
expression of the endogenous B7-like protein). In the homologous
recombination vector, the altered portion of the B7-like gene is
flanked at its 5' and 3' ends by additional nucleic acid of the
B7-like gene to allow for homologous recombination to occur between
the exogenous B7-like gene carried by the vector and an endogenous
B7-like gene in an embryonic stem cell. The additional flanking
B7-like nucleic acid is of sufficient length for successful
homologous recombination with the endogenous gene. Typically,
several kilobases of flanking DNA (at both the 5' and 3' ends) are
included in the vector (see, e.g., Thomas and Capecchi (1987) Cell
51:503 for a description of homologous recombination vectors). The
vector is introduced into an embryonic stem cell line (e.g., by
electroporation), and cells in which the introduced B7-like gene
has homologously recombined with the endogenous B7-like gene are
selected (see, e.g., Li et al. (1992) Cell 69:915). The selected
cells are then injected into a blastocyst of an animal (e.g., a
mouse) to form aggregation chimeras (see, e.g., Bradley (1987) in
Teratocarcinomas and Embryonic Stem Cells: A Practical Approach,
ed. Robertson (IRL, Oxford), pp. 113-152). A chimeric embryo can
then be implanted into a suitable pseudopregnant female foster
animal and the embryo brought to term. Progeny harboring the
homologously recombined DNA in their germ cells can be used to
breed animals in which all cells of the animal contain the
homologously recombined DNA by germline transmission of the
transgene. Methods for constructing homologous recombination
vectors and homologous recombinant animals are described further in
Bradley (1991) Current Opinion in Bio/Technology 2:823-829 and in
PCT Publication Nos. WO 90/11354, WO 91/01140, WO 92/0968, and WO
93/04169.
[0163] In another embodiment, transgenic nonhuman animals
containing selected systems that allow for regulated expression of
the transgene can be produced. One example of such a system is the
cre/loxP recombinase system of bacteriophage P1. For a description
of the cre/loxP recombinase system, see, e.g., Lakso et al. (1992)
Proc. Natl. Acad. Sci. USA 89:6232-6236. Another example of a
recombinase system is the FLP recombinase system of Saccharomyces
cerevisiae (O'Gorman et al. (1991) Science 251:1351-1355). If a
cre/loxP recombinase system is used to regulate expression of the
transgene, animals containing transgenes encoding both the Cre
recombinase and a selected protein are required. Such animals can
be provided through the construction of "double" transgenic
animals, e.g., by mating two transgenic animals, one containing a
transgene encoding a selected protein and the other containing a
transgene encoding a recombinase.
[0164] Clones of the nonhuman transgenic animals described herein
can also be produced according to the methods described in Wilmut
et al. (1997) Nature 385:810-813 and PCT Publication Nos. WO
97/07668 and WO 97/07669.
IV. Pharmaceutical Compositions
[0165] The B7-like nucleic acid molecules, B7-like proteins, and
modulators thereof, e.g., anti-B7-like antibodies (also referred to
herein as "active compounds") of the invention can be incorporated
into pharmaceutical compositions suitable for administration. Such
compositions typically comprise the nucleic acid molecule, protein,
or modulators thereof, e.g., antibody or small molecule, and a
pharmaceutically acceptable carrier. As used herein the language
"pharmaceutically acceptable carrier" is intended to include any
and all solvents, dispersion media, coatings, antibacterial and
antifungal agents, isotonic and absorption delaying agents, and the
like, compatible with pharmaceutical administration. The use of
such media and agents for pharmaceutically active substances is
well known in the art. Except insofar as any conventional media or
agent is incompatible with the active compound, use thereof in the
compositions is contemplated. Supplementary active compounds can
also be incorporated into the compositions.
[0166] The compositions of the invention are useful to treat any of
the disorders discussed herein. The compositions are provided in
therapeutically effective amounts. By "therapeutically effective
amounts" is intended an amount sufficient to modulate the desired
response. As defined herein, a therapeutically effective amount of
protein or polypeptide (i.e., an effective dosage) ranges from
about 0.001 to 30 mg/kg body weight, preferably about 0.01 to 25
mg/kg body weight, more preferably about 0.1 to 20 mg/kg body
weight, and even more preferably about 1 to 10 mg/kg, 2 to 9 mg/kg,
3 to 8 mg/kg, 4 to 7 mg/kg, or 5 to 6 mg/kg body weight.
[0167] The skilled artisan will appreciate that certain factors may
influence the dosage required to effectively treat a subject,
including but not limited to the severity of the disease or
disorder, previous treatments, the general health and/or age of the
subject, and other diseases present. Moreover, treatment of a
subject with a therapeutically effective amount of a protein,
polypeptide, or antibody can include a single treatment or,
preferably, can include a series of treatments. In a preferred
example, a subject is treated with antibody, protein, or
polypeptide in the range of between about 0.1 to 20 mg/kg body
weight, one time per week for between about 1 to 10 weeks,
preferably between 2 to 8 weeks, more preferably between about 3 to
7 weeks, and even more preferably for about 4, 5, or 6 weeks. It
will also be appreciated that the effective dosage of antibody,
protein, or polypeptide used for treatment may increase or decrease
over the course of a particular treatment. Changes in dosage may
result and become apparent from the results of diagnostic assays as
described herein.
[0168] The present invention encompasses agents which modulate
expression or activity. An agent may, for example, be a small
molecule. For example, such small molecules include, but are not
limited to, peptides, peptidomimetics, amino acids, amino acid
analogs, polynucleotides, polynucleotide analogs, nucleotides,
nucleotide analogs, organic or inorganic compounds (i.e., including
heteroorganic and organometallic compounds) having a molecular
weight less than about 10,000 grams per mole, organic or inorganic
compounds having a molecular weight less than about 5,000 grams per
mole, organic or inorganic compounds having a molecular weight less
than about 1,000 grams per mole, organic or inorganic compounds
having a molecular weight less than about 500 grams per mole, and
salts, esters, and other pharmaceutically acceptable forms of such
compounds.
[0169] It is understood that appropriate doses of small molecule
agents depends upon a number of factors within the knowledge of the
ordinarily skilled physician, veterinarian, or researcher. The
dose(s) of the small molecule will vary, for example, depending
upon the identity, size, and condition of the subject or sample
being treated, further depending upon the route by which the
composition is to be administered, if applicable, and the effect
which the practitioner desires the small molecule to have upon the
nucleic acid or polypeptide of the invention. Exemplary doses
include milligram or microgram amounts of the small molecule per
kilogram of subject or sample weight (e.g., about 1 microgram per
kilogram to about 500 milligrams per kilogram, about 100 micrograms
per kilogram to about 5 milligrams per kilogram, or about 1
microgram per kilogram to about 50 micrograms per kilogram. It is
furthermore understood that appropriate doses of a small molecule
depend upon the potency of the small molecule with respect to the
expression or activity to be modulated. Such appropriate doses may
be determined using the assays described herein. When one or more
of these small molecules is to be administered to an animal (e.g.,
a human) in order to modulate expression or activity of a
polypeptide or nucleic acid of the invention, a physician,
veterinarian, or researcher may, for example, prescribe a
relatively low dose at first, subsequently increasing the dose
until an appropriate response is obtained. In addition, it is
understood that the specific dose level for any particular animal
subject will depend upon a variety of factors including the
activity of the specific compound employed, the age, body weight,
general health, gender, and diet of the subject, the time of
administration, the route of administration, the rate of excretion,
any drug combination, and the degree of expression or activity to
be modulated.
[0170] A pharmaceutical composition of the invention is formulated
to be compatible with its intended route of administration.
Examples of routes of administration include parenteral, e.g.,
intravenous, intradermal, subcutaneous, oral (e.g., inhalation),
transdermal (topical), transmucosal, and rectal administration.
Solutions or suspensions used for parenteral, intradermal, or
subcutaneous application can include the following components: a
sterile diluent such as water for injection, saline solution, fixed
oils, polyethylene glycols, glycerine, propylene glycol or other
synthetic solvents; antibacterial agents such as benzyl alcohol or
methyl parabens; antioxidants such as ascorbic acid or sodium
bisulfite; chelating agents such as ethylenediaminetetraacetic
acid; buffers such as acetates, citrates or phosphates and agents
for the adjustment of tonicity such as sodium chloride or dextrose.
pH can be adjusted with acids or bases, such as hydrochloric acid
or sodium hydroxide. The parenteral preparation can be enclosed in
ampoules, disposable syringes, or multiple dose vials made of glass
or plastic.
[0171] Pharmaceutical compositions suitable for injectable use
include sterile aqueous solutions (where water soluble) or
dispersions and sterile powders for the extemporaneous preparation
of sterile injectable solutions or dispersions. For intravenous
administration, suitable carriers include physiological saline,
bacteriostatic water, Cremophor EL.theta. (BASF; Parsippany, N.J.),
or phosphate buffered saline (PBS). In all cases, the composition
must be sterile and should be fluid to the extent that easy
syringability exists. It must be stable under the conditions of
manufacture and storage and must be preserved against the
contaminating action of microorganisms such as bacteria and fungi.
The carrier can be a solvent or dispersion medium containing, for
example, water, ethanol, polyol (for example, glycerol, propylene
glycol, and liquid polyetheylene glycol, and the like), and
suitable mixtures thereof. The proper fluidity can be maintained,
for example, by the use of a coating such as lecithin, by the
maintenance of the required particle size in the case of
dispersion, and by the use of surfactants. Prevention of the action
of microorganisms can be achieved by various antibacterial and
antifungal agents, for example, parabens, chlorobutanol, phenol,
ascorbic acid, thimerosal, and the like. In many cases, it will be
preferable to include isotonic agents, for example, sugars,
polyalcohols such as mannitol, sorbitol, sodium chloride, in the
composition. Prolonged absorption of the injectable compositions
can be brought about by including in the composition an agent that
delays absorption, for example, aluminum monostearate and
gelatin.
[0172] Sterile injectable solutions can be prepared by
incorporating the active compound (e.g., a B7-like protein or
anti-B7-like antibody) in the required amount in an appropriate
solvent with one or a combination of ingredients enumerated above,
as required, followed by filtered sterilization. Generally,
dispersions are prepared by incorporating the active compound into
a sterile vehicle that contains a basic dispersion medium and the
required other ingredients from those enumerated above. In the case
of sterile powders for the preparation of sterile injectable
solutions, the preferred methods of preparation are vacuum drying
and freeze-drying, which yields a powder of the active ingredient
plus any additional desired ingredient from a previously
sterile-filtered solution thereof.
[0173] Oral compositions generally include an inert diluent or an
edible carrier. They can be enclosed in gelatin capsules or
compressed into tablets. For the purpose of oral therapeutic
administration, the active compound can be incorporated with
excipients and used in the form of tablets, troches, or capsules.
Oral compositions can also be prepared using a fluid carrier for
use as a mouthwash, wherein the compound in the fluid carrier is
applied orally and swished and expectorated or swallowed.
Pharmaceutically compatible binding agents, and/or adjuvant
materials can be included as part of the composition. The tablets,
pills, capsules, troches and the like can contain any of the
following ingredients, or compounds of a similar nature: a binder
such as microcrystalline cellulose, gum tragacanth, or gelatin; an
excipient such as starch or lactose, a disintegrating agent such as
alginic acid, Primogel, or corn starch; a lubricant such as
magnesium stearate or Sterotes; a glidant such as colloidal silicon
dioxide; a sweetening agent such as sucrose or saccharin; or a
flavoring agent such as peppermint, methyl salicylate, or orange
flavoring. For administration by inhalation, the compounds are
delivered in the form of an aerosol spray from a pressurized
container or dispenser that contains a suitable propellant, e.g., a
gas such as carbon dioxide, or a nebulizer.
[0174] Systemic administration can also be by transmucosal or
transdermal means. For transmucosal or transdermal administration,
penetrants appropriate to the barrier to be permeated are used in
the formulation. Such penetrants are generally known in the art,
and include, for example, for transmucosal administration,
detergents, bile salts, and fusidic acid derivatives. Transmucosal
administration can be accomplished through the use of nasal sprays
or suppositories. For transdermal administration, the active
compounds are formulated into ointments, salves, gels, or creams as
generally known in the art. The compounds can also be prepared in
the form of suppositories (e.g., with conventional suppository
bases such as cocoa butter and other glycerides) or retention
enemas for rectal delivery.
[0175] In one embodiment, the active compounds are prepared with
carriers that will protect the compound against rapid elimination
from the body, such as a controlled release formulation, including
implants and microencapsulated delivery systems. Biodegradable,
biocompatible polymers can be used, such as ethylene vinyl acetate,
polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and
polylactic acid. Methods for preparation of such formulations will
be apparent to those skilled in the art. The materials can also be
obtained commercially from Alza Corporation and Nova
Pharmaceuticals, Inc. Liposomal suspensions (including liposomes
targeted to infected cells with monoclonal antibodies to viral
antigens) can also be used as pharmaceutically acceptable carriers.
These can be prepared according to methods known to those skilled
in the art, for example, as described in U.S. Pat. No.
4,522,811.
[0176] It is especially advantageous to formulate oral or
parenteral compositions in dosage unit form for ease of
administration and uniformity of dosage. Dosage unit form as used
herein refers to physically discrete units suited as unitary
dosages for the subject to be treated with each unit containing a
predetermined quantity of active compound calculated to produce the
desired therapeutic effect in association with the required
pharmaceutical carrier. Depending on the type and severity of the
disease, about 1 .mu.g/kg to about 15 mg/kg (e.g., 0.1 to 20 mg/kg)
of antibody is an initial candidate dosage for administration to
the patient, whether, for example, by one or more separate
administrations, or by continuous infusion. A typical daily dosage
might range from about 1 .mu.g/kg to about 100 mg/kg or more,
depending on the factors mentioned above. For repeated
administrations over several days or longer, depending on the
condition, the treatment is sustained until a desired suppression
of disease symptoms occurs. However, other dosage regimens may be
useful. The progress of this therapy is easily monitored by
conventional techniques and assays. An exemplary dosing regimen is
disclosed in PCT Publication No. WO 94/04188. The specification for
the dosage unit forms of the invention are dictated by and directly
dependent on the unique characteristics of the active compound and
the particular therapeutic effect to be achieved, and the
limitations inherent in the art of compounding such an active
compound for the treatment of individuals.
[0177] The nucleic acid molecules of the invention can be inserted
into vectors and used as gene therapy vectors. Gene therapy vectors
can be delivered to a subject by, for example, intravenous
injection, local administration (U.S. Pat. No. 5,328,470), or by
stereotactic injection (see, e.g., Chen et al. (1994) Proc. Natl.
Acad. Sci. USA 91:3054-3057). The pharmaceutical preparation of the
gene therapy vector can include the gene therapy vector in an
acceptable diluent, or can comprise a slow release matrix in which
the gene delivery vehicle is imbedded. Alternatively, where the
complete gene delivery vector can be produced intact from
recombinant cells, e.g., retroviral vectors, the pharmaceutical
preparation can include one or more cells which produce the gene
delivery system.
[0178] The pharmaceutical compositions can be included in a
container, pack, or dispenser together with instructions for
administration.
V. Uses and Methods of the Invention
[0179] The nucleic acid molecules, proteins, protein homologues,
and antibodies described herein can be used in one or more of the
following methods: (a) screening assays; (b) detection assays
(e.g., chromosomal mapping, tissue typing, forensic biology); (c)
predictive medicine (e.g., diagnostic assays, prognostic assays,
monitoring clinical trials, and pharmacogenomics); and (d) methods
of treatment (e.g., therapeutic and prophylactic). The isolated
nucleic acid molecules of the invention can be used to express
B7-like protein (e.g., via a recombinant expression vector in a
host cell in gene therapy applications), to detect B7-like mRNA
(e.g., in a biological sample) or a genetic lesion in a B7-like
gene, and to modulate B7-like activity. In addition, the B7-like
proteins can be used to screen drugs or compounds that modulate
immune response as well as to treat disorders characterized by
insufficient or excessive production of B7-like protein or
production of B7-like protein forms that have decreased or aberrant
activity compared to B7-like wild type protein. In addition, the
anti-B7-like antibodies of the invention can be used to detect and
isolate B7-like proteins and modulate B7-like activity.
[0180] A. Screening Assays
[0181] The invention provides a method (also referred to herein as
a "screening assay") for identifying modulators, i.e., candidate or
test compounds or agents (e.g., peptides, peptidomimetics, small
molecules, or other drugs) that bind to B7-like proteins or have a
stimulatory or inhibitory effect on, for example, B7-like
expression or B7-like activity.
[0182] The test compounds of the present invention can be obtained
using any of the numerous approaches in combinatorial library
methods known in the art, including biological libraries, spatially
addressable parallel solid phase or solution phase libraries,
synthetic library methods requiring deconvolution, the "one-bead
one-compound" library method, and synthetic library methods using
affinity chromatography selection. The biological library approach
is limited to peptide libraries, while the other four approaches
are applicable to peptide, nonpeptide oligomer, or small molecule
libraries of compounds (Lam (1997) Anticancer Drug Des.
12:145).
[0183] Examples of methods for the synthesis of molecular libraries
can be found in the art, for example in: DeWitt et al. (1993) Proc.
Natl. Acad. Sci. USA 90:6909; Erb et al. (1994) Proc. Natl. Acad.
Sci. USA 91:11422; Zuckermann et al. (1994). J. Med. Chem. 37:2678;
Cho et al. (1993) Science 261:1303; Carrell et al. (1994) Angew.
Chem. Int. Ed. Engl. 33:2059; Carell et al. (1994) Angew. Chem.
Int. Ed. Engl. 33:2061; and Gallop et al. (1994) J. Med. Chem.
37:1233.
[0184] Libraries of compounds may be presented in solution (e.g.,
Houghten (1992) Bio/Techniques 13:412-421), or on beads (Lam (1991)
Nature 354:82-84), chips (Fodor (1993) Nature 364:555-556),
bacteria (U.S. Pat. No. 5,223,409), spores (U.S. Pat. Nos.
5,571,698; 5,403,484; and 5,223,409), plasmids (Cull et al. (1992)
Proc. Natl. Acad. Sci. USA 89:1865-1869), or phage (Scott and Smith
(1990) Science 249:386-390; Devlin (1990) Science 249:404-406;
Cwirla et al. (1990) Proc. Natl. Acad. Sci. USA 87:6378-6382; and
Felici (1991) J. Mol. Biol. 222:301-310).
[0185] Determining the ability of the test compound to bind to a
B7-like protein of the invention or to a B7-like binding partner
can be accomplished, for example, by coupling the test compound
with a radioisotope or enzymatic label such that binding of the
test compound to the B7-like protein or biologically active portion
thereof can be determined by detecting the labeled compound in a
complex. For example, test compounds can be labeled with .sup.125I,
.sup.35S, .sup.14C, or .sup.3H, either directly or indirectly, and
the radioisotope detected by direct counting of radioemmission or
by scintillation counting. Alternatively, test compounds can be
enzymatically labeled with, for example, horseradish peroxidase,
alkaline phosphatase, or luciferase, and the enzymatic label
detected by determination of conversion of an appropriate substrate
to product.
[0186] The invention also features methods of identifying the
natural binding partner(s) of the novel B7-like molecules of the
invention. Methods of identifying a binding partner for a novel
ligand are known in the art. A B7-like molecule of the invention
modulates the activity of a T-cell through the interaction with
(i.e., co-stimulation) such a receptor molecule. The measurement of
this activity can be used to determine whether the B7-like molecule
of the invention interacts with such a receptor. Examples of
modulation of immune cell function through receptors such as ICOS,
PD-1, CD28, CTLA-4, or other related receptors include, but are not
limited to, T-cell proliferation, modulation of cytokine production
and/or release (such as IL-2, IL-4, IL-5, IL-10, interferon-gamma,
tumor necrosis factor-alpha, or granulocyte/macrophage colony
stimulating factor production and/or release), up-regulation of
molecules such as LFA-3, ICAM-1, CD154, CD69, CD25, or CD71 that
mediate cell-cell interaction, and modulation of antibody secretion
by B-cells. Assays for measuring these activities are well known in
the art and have been described elsewhere herein.
[0187] In another embodiment of the invention methods are provided
for identifying modulators of B7-like activity. The molecules that
are identified can either inhibit the interaction of the B7-like
molecules of the invention with their binding partners or interfere
with intracellular signaling through their binding partners. These
methods can be used once the known binding partner is identified as
well as if its identity is unknown. In this manner new molecules
can be identified that can modulate the activity of B7-like
molecules of the invention, and are thus potentially useful as
therapeutic agents for the diseases associated with B7-like
activity as described elsewhere herein.
[0188] The methods of this embodiment of the invention take
advantage of the biological activity of the B7-like molecules of
the invention. As previously described herein, the ability of
T-cells to synthesize cytokines depends not only on the primary
activation signal provided by, for example, anti-CD3, phorbol
ester, or by antigen in association with class II MHC to produce an
activated T-cell, but also on the induction of a co-stimulatory
signal, in this case, by interaction with a B7-like molecule of the
invention. The binding of the B7-like molecules of the present
invention to their natural binding partner (ICOS, PD-1, CD28,
CTLA-4, or a related receptor) on, for example, an ICOS.sup.+
T-cell, co-stimulates the T-cell and induces the production of
increased levels of cytokines, particularly likely the production
of interleukin-10 in this case, but may also include production of
IL-2, IL-4, IL-5, interferon-gamma, tumor necrosis factor-alpha, or
macrophage/granulocyte colony stimulating factor or other known or
unknown cytokines. Cytokine production stimulates effects such as
increased T-cell response to antigen, T-cell proliferation, T-cell
differentiation, and T-cell and B-cell interactions. Assays for
cytokines and T cell proliferation are known in the art and have
been described elsewhere herein. Any of these assays can be
utilized in this embodiment of the invention.
[0189] In this embodiment of the invention, the ability of a test
molecule to inhibit the B7-like molecule's co-stimulatory activity
is measured. B7-like co-stimulatory activity is measured as
follows: T-cells expressing ICOS, PD-1, CD28, CTLA-4, or a related
receptor are provided in vitro with a first or primary activation
signal by anti-T3 monoclonal antibody (e.g. anti-CD3) or phorbol
ester or, by antigen in association with class II MHC. B7-like
molecule function is assayed by adding a source of B7-like protein
of the invention (e.g., cells expressing a B7-like molecule or a
fragment or variant thereof or a soluble form of a B7-like molecule
such as a fusion protein as described herein). The B7-like activity
that can be measured includes, but is not limited to, T-cell
proliferation, modulation of cytokine production and/or release
(such as IL-2, IL-4, IL-5, IL-10, interferon-gamma, tumor necrosis
factor-alpha, or granulocyte/macrophage colony stimulating factor
production and/or release), up-regulation of molecules such as
LFA-3, ICAM-1, CD154, CD69, CD25, or CD71 that mediate cell-cell
interaction, and modulation of antibody secretion by B-cells. A
test molecule is included in this assay and its ability to decrease
or inhibit any of the B7-activities described above is measured. In
this manner, novel molecules with B7-like modulating activity can
be identified.
[0190] In another embodiment, the above-described assay is modified
such that the interference of a B7-like molecule binding to its
binding partner is measured directly, rather than through
measurement of a biological response as described above. As
described in the previous embodiment, the source of the B7-like
molecule can be cells expressing a B7-like molecule or a fragment
or variant thereof, or a soluble form of a B7-like molecule such as
a fusion protein as described elsewhere herein. The binding partner
could also be provided in a soluble form such as in the form of a
fusion protein, expressed on the surface of a cell, or bound to
another matrix of choice. The ability of a test molecule to inhibit
binding of the B7-like molecule to its binding partner is
determined. Binding of the above-described molecules can be
determined by a variety of methods, as such binding assays are well
known in the art.
[0191] In one embodiment, the B7-like molecule of the invention is
labeled with a radioisotope (methods for which are described
elsewhere herein) and incubated with a binding partner provided in
a soluble form such as in the form of a fusion protein, expressed
on the surface of a cell, or bound to another matrix of choice.
Quantification of the amount of complexed B7-like molecule of the
invention and binding partner is measured by any number of standard
assays known in the art. The ability of a test molecule to reduce
the binding complex between the B7-like molecule of the invention
and the binding partner is then measured by its inclusion in the
assay.
[0192] In these assays it may be desirable to immobilize either a
B7-like protein or its target molecule to facilitate separation of
complexed from uncomplexed forms of one or both of the proteins, as
well as to accommodate automation of the assay. In one embodiment,
a fusion protein can be provided that adds a domain that allows one
or both of the proteins to be bound to a matrix. For example,
glutathione-S-transferase/B7-like fusion proteins or
glutathione-S-transferase/target fusion proteins can be adsorbed
onto glutathione sepharose beads (Sigma Chemical, St. Louis, Mo.)
or glutathione-derivatized microtitre plates, which are then
combined with the test compound or the test compound and either the
non-adsorbed binding partner or B7-like protein, and the mixture
incubated under conditions conducive to complex formation (e.g., at
physiological conditions for salt and pH). Following incubation,
the beads or microtitre plate wells are washed to remove any
unbound components and complex formation is measured either
directly or indirectly, for example, as described above.
Alternatively, the complexes can be dissociated from the matrix,
and the level of B7-like binding or activity determined using
standard techniques.
[0193] Other techniques for immobilizing proteins on matrices can
also be used in the screening assays of the invention. For example,
either B7-like protein or its target molecule can be immobilized
utilizing conjugation of biotin and streptavidin. Biotinylated
B7-like molecules or target molecules can be prepared from
biotin-NHS (N-hydroxy-succinimide) using techniques well known in
the art (e.g., biotinylation kit, Pierce Chemicals, Rockford,
Ill.), and immobilized in the wells of streptavidin-coated 96-well
plates (Pierce Chemicals). Alternatively, antibodies reactive with
a B7-like protein or target molecules but which do not interfere
with binding of the B7-like protein to its target molecule can be
derivatized to the wells of the plate, and unbound target or
B7-like protein trapped in the wells by antibody conjugation.
Methods for detecting such complexes, in addition to those
described above for the GST-immobilized complexes, include
immunodetection of complexes using antibodies reactive with the
B7-like protein or binding partner, as well as enzyme-linked assays
that rely on detecting an enzymatic activity associated with the
B7-like protein or binding partner.
[0194] Once other natural binding partner(s) of the B7-like
molecules of the present invention have been identified, the
co-stimulation assay described previously herein can be used to
screen for other molecules that possess B7-like activity. In this
embodiment, T-cells that express the binding partner of a B7-like
molecule are provided with a primary activation signal. These cells
are then contacted with test molecules and the ability of the test
molecule to provide a B7-like co-stimulatory signal is determined
with an assay as described previously herein for any of the
following activities: T-cell proliferation, modulation of cytokine
production and/or release (such as IL-2, IL-4, IL-5, IL-10,
interferon-gamma, tumor necrosis factor-alpha, or
granulocyte/macrophage colony stimulating factor production and/or
release), up-regulation of molecules such as LFA-3, ICAM-1, CD154,
CD69, CD25, or CD71 that mediate cell-cell interaction, and
modulation of antibody secretion by B-cells.
[0195] Confirmation that the B7-like activity elicited by a test
molecule is due to interaction with the binding partner of the
B7-like molecule of the invention can be obtained using a binding
assay described previously herein. In this assay the B7-like
molecule of the invention is labeled with a radioisotope for
detection and the ability of the test molecule to reduce the level
of complexed B7-like protein and binding partner is measured.
Specificity of the test molecule for a B7-like binding partner is
indicated when the concentrations of test molecule necessary to
elicit the measured biological response and to disrupt B7-like
binding to its partner are similar.
[0196] In another embodiment, modulators of B7-like expression are
identified in a method in which a cell that expresses a B7-like
molecule is contacted with a candidate compound and the expression
of B7-like mRNA or protein in the cell is determined relative to
expression of B7-like mRNA or protein in a cell in the absence of
the candidate compound. When expression is greater (statistically
significantly greater) in the presence of the candidate compound
than in its absence, the candidate compound is identified as a
stimulator of B7-like mRNA or protein expression. Alternatively,
when expression is less (statistically significantly less) in the
presence of the candidate compound than in its absence, the
candidate compound is identified as an inhibitor of B7-like mRNA or
protein expression. The level of B7-like mRNA or protein expression
in the cells can be determined by methods described herein for
detecting B7-like mRNA or protein.
[0197] In yet another aspect of the invention, the B7-like proteins
can be used as "bait proteins" in a two-hybrid assay or
three-hybrid assay (see, e.g., U.S. Pat. No. 5,283,317; Zervos et
al. (1993) Cell 72:223-232; Madura et al. (1993) J. Biol. Chem.
268:12046-12054; Bartel et al. (1993) Bio/Techniques 14:920-924;
Iwabuchi et al. (1993) Oncogene 8:1693-1696; and PCT Publication
No. WO 94/10300), to identify other proteins, which bind to or
interact with B7-like protein ("B7-like-binding proteins" or
"B7-like-bp") and modulate B7-like activity. Such B7-like-binding
proteins are also likely to be involved in the propagation of
signals by the B7-like proteins as, for example, upstream or
downstream elements of the B7-like pathway.
[0198] B. Detection Assays
[0199] Portions or fragments of the cDNA sequences identified
herein (and the corresponding complete gene sequences) can be used
in numerous ways as polynucleotide reagents. For example, these
sequences can be used to: (1) map their respective genes on a
chromosome; (2) identify an individual from a minute biological
sample (tissue typing); and (3) aid in forensic identification of a
biological sample. These applications are described in the
subsections below.
[0200] 1. Chromosome Mapping
[0201] The isolated complete or partial B7-like gene sequences of
the invention can be used to map their respective B7-like genes on
a chromosome, thereby facilitating the location of gene regions
associated with genetic disease. Computer analysis of B7-like
sequences can be used to rapidly select PCR primers (preferably
15-25 bp in length) that do not span more than one exon in the
genomic DNA, thereby simplifying the amplification process. These
primers can then be used for PCR screening of somatic cell hybrids
containing individual human chromosomes. Only those hybrids
containing the human gene corresponding to the B7-like sequences
will yield an amplified fragment.
[0202] Somatic cell hybrids are prepared by fusing somatic cells
from different mammals (e.g., human and mouse cells). As hybrids of
human and mouse cells grow and divide, they gradually lose human
chromosomes in random order, but retain the mouse chromosomes. By
using media in which mouse cells cannot grow (because they lack a
particular enzyme), but in which human cells can, the one human
chromosome that contains the gene encoding the needed enzyme will
be retained. By using various media, panels of hybrid cell lines
can be established. Each cell line in a panel contains either a
single human chromosome or a small number of human chromosomes, and
a full set of mouse chromosomes, allowing easy mapping of
individual genes to specific human chromosomes (D'Eustachio et al.
(1983) Science 220:919-924). Somatic cell hybrids containing only
fragments of human chromosomes can also be produced by using human
chromosomes with translocations and deletions.
[0203] Other mapping strategies that can similarly be used to map a
B7-like sequence to its chromosome include in situ hybridization
(described in Fan et al. (1990) Proc. Natl. Acad. Sci. USA
87:6223-27), pre-screening with labeled flow-sorted chromosomes,
and pre-selection by hybridization to chromosome specific cDNA
libraries. Furthermore, fluorescence in situ hybridization (FISH)
of a DNA sequence to a metaphase chromosomal spread can be used to
provide a precise chromosomal location in one step. For a review of
this technique, see Verma et al. (1988) Human Chromosomes: A Manual
of Basic Techniques (Pergamon Press, NY). The FISH technique can be
used with a DNA sequence as short as 500 or 600 bases. However,
clones larger than 1,000 bases have a higher likelihood of binding
to a unique chromosomal location with sufficient signal intensity
for simple detection. Preferably 1,000 bases, and more preferably
2,000 bases will suffice to get good results in a reasonable amount
of time.
[0204] Reagents for chromosome mapping can be used individually to
mark a single chromosome or a single site on that chromosome, or
panels of reagents can be used for marking multiple sites and/or
multiple chromosomes. Reagents corresponding to noncoding regions
of the genes actually are preferred for mapping purposes. Coding
sequences are more likely to be conserved within gene families,
thus increasing the chance of cross hybridizations during
chromosomal mapping.
[0205] Another strategy to map the chromosomal location of B7-like
genes uses B7-like polypeptides and fragments and sequences of the
present invention and antibodies specific thereto. This mapping can
be carried out by specifically detecting the presence of a B7-like
polypeptide in members of a panel of somatic cell hybrids between
cells of a first species of animal from which the protein
originates and cells from a second species of animal, and then
determining which somatic cell hybrid(s) expresses the polypeptide
and noting the chromosomes(s) from the first species of animal that
it contains. For examples of this technique, see Pajunen et al.
(1988) Cytogenet. Cell. Genet. 47:3741 and Van Keuren et al. (1986)
Hum. Genet. 74:34-40. Alternatively, the presence of a B7-like
polypeptide in the somatic cell hybrids can be determined by
assaying an activity or property of the polypeptide, for example,
enzymatic activity, as described in Bordelon-Riser et al. (1979)
Somatic Cell Genetics 5:597-613 and Owerbach et al. (1978) Proc.
Natl. Acad. Sci. USA 75:5640-5644.
[0206] Once a sequence has been mapped to a precise chromosomal
location, the physical position of the sequence on the chromosome
can be correlated with genetic map data. (Such data are found, for
example, in V. McKusick, Mendelian Inheritance in Man, available
on-line through Johns Hopkins University Welch Medical Library).
The relationship between genes and disease, mapped to the same
chromosomal region, can then be identified through linkage analysis
(co-inheritance of physically adjacent genes), described in, e.g.,
Egeland et al. (1987) Nature 325:783-787.
[0207] Moreover, differences in the DNA sequences between
individuals affected and unaffected with a disease associated with
the B7-like gene can be determined. If a mutation is observed in
some or all of the affected individuals but not in any unaffected
individuals, then the mutation is likely to be the causative agent
of the particular disease. Comparison of affected and unaffected
individuals generally involves first looking for structural
alterations in the chromosomes such as deletions or translocations
that are visible from chromosome spreads or detectable using PCR
based on that DNA sequence. Ultimately, complete sequencing of
genes from several individuals can be performed to confirm the
presence of a mutation and to distinguish mutations from
polymorphisms.
[0208] 2. Tissue Typing
[0209] The B7-like sequences of the present invention can also be
used to identify individuals from minute biological samples. The
United States military, for example, is considering the use of
restriction fragment length polymorphism (RFLP) for identification
of its personnel. In this technique, an individual's genomic DNA is
digested with one or more restriction enzymes and probed on a
Southern blot to yield unique bands for identification. The
sequences of the present invention are useful as additional DNA
markers for RFLP (described, e.g., in U.S. Pat. No. 5,272,057).
[0210] Furthermore, the sequences of the present invention can be
used to provide an alternative technique for determining the actual
base-by-base DNA sequence of selected portions of an individual's
genome. Thus, the B7-like sequences of the invention can be used to
prepare two PCR primers from the 5' and 3' ends of the sequences.
These primers can then be used to amplify an individual's DNA and
subsequently sequence it.
[0211] Panels of corresponding DNA sequences from individuals,
prepared in this manner, can provide unique individual
identifications, as each individual will have a unique set of such
DNA sequences due to allelic differences. The B7-like sequences of
the invention uniquely represent portions of the human genome.
Allelic variation occurs to some degree in the coding regions of
these sequences, and to a greater degree in the noncoding regions.
It is estimated that allelic variation between individual humans
occurs with a frequency of about once per each 500 bases. Each of
the sequences described herein can, to some degree, be used as a
standard against which DNA from an individual can be compared for
identification purposes. The noncoding sequences of SEQ ID NO:1 or
SEQ ID NO:3 can comfortably provide positive individual
identification with a panel of perhaps 10 to 1,000 primers that
each yield a noncoding amplified sequence of 100 bases. If a
predicted coding sequence, such as that in SEQ ID NO:1 or SEQ ID
NO:3, is used, a more appropriate number of primers for positive
individual identification would be 500 to 2,000.
[0212] 3. Use of Partial B7-like Sequences in Forensic Biology
[0213] DNA-based identification techniques can also be used in
forensic biology. In this manner, PCR technology can be used to
amplify DNA sequences taken from very small biological samples such
as tissues, e.g., hair or skin, or body fluids, e.g., blood,
saliva, or semen found at a crime scene. The amplified sequence can
then be compared to a standard, thereby allowing identification of
the origin of the biological sample.
[0214] The sequences of the present invention can be used to
provide polynucleotide reagents, e.g., PCR primers, targeted to
specific loci in the human genome, which can enhance the
reliability of DNA-based forensic identifications by, for example,
providing another "identification marker" that is unique to a
particular individual. As mentioned above, actual base sequence
information can be used for identification as an accurate
alternative to patterns formed by restriction enzyme generated
fragments. Sequences targeted to noncoding regions of SEQ ID NO:1
or SEQ ID NO:3 are particularly appropriate for this use as greater
numbers of polymorphisms occur in the noncoding regions, making it
easier to differentiate individuals using this technique. Examples
of polynucleotide reagents include the B7-like sequences or
portions thereof, e.g., fragments derived from the noncoding
regions of SEQ ID NO:1 or SEQ ID NO:3 having a length of at least
20 or 30 bases.
[0215] The B7-like sequences described herein can further be used
to provide polynucleotide reagents, e.g., labeled or labelable
probes that can be used in, for example, an in situ hybridization
technique, to identify a specific tissue. This can be very useful
in cases where a forensic pathologist is presented with a tissue of
unknown origin. Panels of such B7-like probes, can be used to
identify tissue by species and/or by organ type.
[0216] In a similar fashion, these reagents, e.g., B7-like primers
or probes can be used to screen tissue culture for contamination
(i.e., screen for the presence of a mixture of different types of
cells in a culture).
[0217] C. Predictive Medicine
[0218] The present invention also pertains to the field of
predictive medicine in which diagnostic assays, prognostic assays,
pharmacogenomics, and monitoring clinical trails are used for
prognostic (predictive) purposes to thereby treat an individual
prophylactically. These applications are described in the
subsections below.
[0219] 1. Diagnostic Assays
[0220] One aspect of the present invention relates to diagnostic
assays for detecting B7-like protein and/or nucleic acid expression
as well as B7-like activity, in the context of a biological sample.
An exemplary method for detecting the presence or absence of
B7-like proteins in a biological sample involves obtaining a
biological sample from a test subject and contacting the biological
sample with a compound or an agent capable of detecting B7-like
protein or nucleic acid (e.g., mRNA, genomic DNA) that encodes
B7-like protein such that the presence of B7-like protein is
detected in the biological sample. Results obtained with a
biological sample from the test subject may be compared to results
obtained with a biological sample from a control subject.
[0221] A preferred agent for detecting B7-like mRNA or genomic DNA
is a labeled nucleic acid probe capable of hybridizing to B7-like
mRNA or genomic DNA. The nucleic acid probe can be, for example, a
full-length B7-like nucleic acid, such as the nucleic acid of SEQ
ID NO:1, SEQ ID NO:3, SEQ ID NO:27, SEQ ID NO:30, or a portion
thereof, such as a nucleic acid molecule of at least 25, 30, 50,
100, 250, or 500 nucleotides in length and sufficient to
specifically hybridize under stringent conditions to B7-like mRNA
or genomic DNA. Other suitable probes for use in the diagnostic
assays of the invention are described herein.
[0222] A preferred agent for detecting B7-like protein is an
antibody capable of binding to B7-like protein, preferably an
antibody with a detectable label. Antibodies can be polyclonal, or
more preferably, monoclonal. An intact antibody, or a fragment
thereof (e.g., Fab or F(abN).sub.2) can be used. The term
"labeled," with regard to the probe or antibody, is intended to
encompass direct labeling of the probe or antibody by coupling
(i.e., physically linking) a detectable substance to the probe or
antibody, as well as indirect labeling of the probe or antibody by
reactivity with another reagent that is directly labeled. Examples
of indirect labeling include detection of a primary antibody using
a fluorescently labeled secondary antibody and end-labeling of a
DNA probe with biotin such that it can be detected with
fluorescently labeled streptavidin.
[0223] The term "biological sample" is intended to include tissues,
cells, and biological fluids isolated from a subject, as well as
tissues, cells, and fluids present within a subject. That is, the
detection method of the invention can be used to detect B7-like
mRNA, protein, or genomic DNA in a biological sample in vitro as
well as in vivo. For example, in vitro techniques for detection of
B7-like mRNA include Northern hybridizations and in situ
hybridizations. In vitro techniques for detection of B7-like
protein include enzyme linked immunosorbent assays (ELISAs),
Western blots, immunoprecipitations, and immunofluorescence. In
vitro techniques for detection of B7-like genomic DNA include
Southern hybridizations. Furthermore, in vivo techniques for
detection of B7-like protein include introducing into a subject a
labeled anti-B7-like antibody. For example, the antibody can be
labeled with a radioactive marker whose presence and location in a
subject can be detected by standard imaging techniques.
[0224] In one embodiment, the biological sample contains protein
molecules from the test subject. Alternatively, the biological
sample can contain mRNA molecules from the test subject or genomic
DNA molecules from the test subject. A preferred biological sample
is one containing lymphocytes isolated from the affected tissue(s)
and/or organ(s) of the test subject.
[0225] The invention also encompasses kits for detecting the
presence of B7-like proteins in a biological sample (a test
sample). Such kits can be used to determine if a subject is
suffering from or is at increased risk of developing a disorder
associated with aberrant expression of B7-like protein (e.g., an
immunological or cell proliferative disorder). For example, the kit
can comprise a labeled compound or agent capable of detecting
B7-like protein or mRNA in a biological sample and means for
determining the amount of a B7-like protein in the sample (e.g., an
anti-B7-like antibody or an oligonucleotide probe that binds to DNA
encoding a B7-like protein, e.g., SEQ ID NO:1, SEQ ID NO:3, SEQ ID
NO:27, or SEQ ID NO:30). Kits can also include instructions for
observing that the tested subject is suffering from or is at risk
of developing a disorder associated with aberrant expression of
B7-like sequences if the amount of B7-like protein or mRNA is above
or below a normal level.
[0226] For antibody-based kits, the kit can comprise, for example:
(1) a first antibody (e.g., attached to a solid support) that binds
to B7-like protein; and, optionally, (2) a second, different
antibody that binds to B7-like protein or the first antibody and is
conjugated to a detectable agent. For oligonucleotide-based kits,
the kit can comprise, for example: (1) an oligonucleotide, e.g., a
detectably labeled oligonucleotide, that hybridizes to a B7-like
nucleic acid sequence or (2) a pair of primers useful for
amplifying a B7-like nucleic acid molecule.
[0227] The kit can also comprise, e.g., a buffering agent, a
preservative, or a protein stabilizing agent. The kit can also
comprise components necessary for detecting the detectable agent
(e.g., an enzyme or a substrate). The kit can also contain a
control sample or a series of control samples that can be assayed
and compared to the test sample contained. Each component of the
kit is usually enclosed within an individual container, and all of
the various containers are within a single package along with
instructions for observing whether the tested subject is suffering
from or is at risk of developing a disorder associated with
aberrant expression of B7-like proteins.
[0228] 2. Other Diagnostic Assays
[0229] In another aspect, the invention features a method of
analyzing a plurality of capture probes. The method can be used,
e.g., to analyze gene expression. The method includes: providing a
two dimensional array having a plurality of addresses, each address
of the plurality being positionally distinguishable from each other
address of the plurality, and each address of the plurality having
a unique capture probe, e.g., a nucleic acid or peptide sequence;
contacting the array with a B7-like nucleic acid, preferably
purified, polypeptide, preferably purified, or antibody, and
thereby evaluating the plurality of capture probes. Binding (e.g.,
in the case of a nucleic acid, hybridization) with a capture probe
at an address of the plurality, is detected, e.g., by a signal
generated from a label attached to the B7-like nucleic acid,
polypeptide, or antibody. The capture probes can be a set of
nucleic acids from a selected sample, e.g., a sample of nucleic
acids derived from a control or non-stimulated tissue or cell.
[0230] The method can include contacting the B7-like nucleic acid,
polypeptide, or antibody with a first array having a plurality of
capture probes and a second array having a different plurality of
capture probes. The results of each hybridization can be compared,
e.g., to analyze differences in expression between a first and
second sample. The first plurality of capture probes can be from a
control sample, e.g., a wild type, normal, or non-diseased,
non-stimulated, sample, e.g., a biological fluid, tissue, or cell
sample. The second plurality of capture probes can be from an
experimental sample, e.g., a mutant type, at risk, disease-state or
disorder-state, or stimulated, sample, e.g., a biological fluid,
tissue, or cell sample.
[0231] The plurality of capture probes can be a plurality of
nucleic acid probes each of which specifically hybridizes, with an
allele of a B7-like sequence of the invention. Such methods can be
used to diagnose a subject, e.g., to evaluate risk for a disease or
disorder, to evaluate suitability of a selected treatment for a
subject, to evaluate whether a subject has a disease or disorder.
Thus, for example, the sequences set forth in SEQ ID NO:1, SEQ ID
NO:3, SEQ ID NO:27 and SEQ ID NO:30 encode B7-like polypeptides
that are associated with the T cell response and, therefore, are
useful for evaluating immune response disorders.
[0232] The method can be used to detect single nucleotide
polymorphisms (SNPs), as described below.
[0233] In another aspect, the invention features a method of
analyzing a plurality of probes. The method is useful, e.g., for
analyzing gene expression. The method includes: providing a two
dimensional array having a plurality of addresses, each address of
the plurality being positionally distinguishable from each other
address of the plurality having a unique capture probe, e.g.,
wherein the capture probes are from a cell or subject which express
a B7-like polypeptide of the invention or from a cell or subject in
which a B7-like-mediated response has been elicited, e.g., by
contact of the cell with a B7-like nucleic acid or protein of the
invention, or administration to the cell or subject a B7-like
nucleic acid or protein of the invention; contacting the array with
one or more inquiry probes, wherein an inquiry probe can be a
nucleic acid, polypeptide, or antibody (which is preferably other
than a B7-like nucleic acid, polypeptide, or antibody of the
invention); providing a two dimensional array having a plurality of
addresses, each address of the plurality being positionally
distinguishable from each other address of the plurality, and each
address of the plurality having a unique capture probe, e.g.,
wherein the capture probes are from a cell or subject which does
not express a B7-like sequence of the invention (or does not
express as highly as in the case of the B7-like positive plurality
of capture probes) or from a cell or subject in which a
B7-like-mediated response has not been elicited (or has been
elicited to a lesser extent than in the first sample); contacting
the array with one or more inquiry probes (which is preferably
other than a B7-like nucleic acid, polypeptide, or antibody of the
invention), and thereby evaluating the plurality of capture probes.
Binding, e.g., in the case of a nucleic acid, hybridization, with a
capture probe at an address of the plurality, is detected, e.g., by
signal generated from a label attached to the nucleic acid,
polypeptide, or antibody.
[0234] In another aspect, the invention features a method of
analyzing a B7-like sequence of the invention, e.g., analyzing
structure, function, or relatedness to other nucleic acid or amino
acid sequences. The method includes: providing a B7-like nucleic
acid or amino acid sequence, e.g., the sequence set forth in SEQ ID
NO:1, SEQ ID NO:3, SEQ ID NO:27, or SEQ ID NO:30, or a portion
thereof; comparing the B7-like sequence with one or more preferably
a plurality of sequences from a collection of sequences, e.g., a
nucleic acid or protein sequence database; to thereby analyze the
B7-like sequence of the invention.
[0235] The method can include evaluating the sequence identity
between a B7-like sequence of the invention, e.g., the sequence,
and a database sequence. The method can be performed by accessing
the database at a second site, e.g., over the internet.
[0236] In another aspect, the invention features, a set of
oligonucleotides, useful, e.g., for identifying SNP's, or
identifying specific alleles of a B7-like sequence of the
invention, e.g., the sequence. The set includes a plurality of
oligonucleotides, each of which has a different nucleotide at an
interrogation position, e.g., an SNP or the site of a mutation. In
a preferred embodiment, the oligonucleotides of the plurality
identical in sequence with one another (except for differences in
length). The oligonucleotides can be provided with differential
labels, such that an oligonucleotides which hybridizes to one
allele provides a signal that is distinguishable from an
oligonucleotides which hybridizes to a second allele.
[0237] 3. Prognostic Assays
[0238] The methods described herein can furthermore be utilized as
diagnostic or prognostic assays to identify subjects having or at
risk of developing a disease or disorder associated with B7-like
protein, B7-like nucleic acid expression, or B7-like activity.
Prognostic assays can be used for prognostic or predictive purposes
to thereby prophylactically treat an individual prior to the onset
of a disorder characterized by or associated with B7-like protein,
B7-like nucleic acid expression, or B7-like activity.
[0239] Thus, the present invention provides a method in which a
test sample is obtained from a subject, and B7-like protein or
nucleic acid (e.g., mRNA, genomic DNA) is detected, wherein the
presence of B7-like protein or nucleic acid is diagnostic for a
subject having or at risk of developing a disease or disorder
associated with aberrant B7-like expression or activity. As used
herein, a "test sample" refers to a biological sample obtained from
a subject of interest. For example, a test sample can be a
biological fluid (e.g., serum), cell sample, or tissue.
[0240] Furthermore, using the prognostic assays described herein,
the present invention provides methods for determining whether a
subject can be administered a specific agent (e.g., an agonist,
antagonist, peptidomimetic, protein, peptide, nucleic acid, small
molecule, or other drug candidate) or class of agents (e.g., agents
of a type that decrease B7-like activity) to effectively treat a
disease or disorder associated with aberrant B7-like expression or
activity. In this manner, a test sample is obtained and B7-like
protein or nucleic acid is detected. The presence of B7-like
protein or nucleic acid is diagnostic for a subject that can be
administered the agent to treat a disorder associated with aberrant
B7-like expression or activity.
[0241] The methods of the invention can also be used to detect
genetic lesions or mutations in a B7-like gene, thereby determining
if a subject with the lesioned gene is at risk for a disorder
characterized by aberrant immune response or cell proliferation. In
preferred embodiments, the methods include detecting, in a sample
of cells from the subject, the presence or absence of a genetic
lesion or mutation characterized by at least one of an alteration
affecting the integrity of a gene encoding a B7-like-protein, or
the misexpression of the B7-like gene. For example, such genetic
lesions or mutations can be detected by ascertaining the existence
of at least one of: (1) a deletion of one or more nucleotides from
a B7-like gene; (2) an addition of one or more nucleotides to a
B7-like gene; (3) a substitution of one or more nucleotides of a
B7-like gene; (4) a chromosomal rearrangement of a B7-like gene;
(5) an alteration in the level of a messenger RNA transcript of a
B7-like gene; (6) an aberrant modification of a B7-like gene, such
as of the methylation pattern of the genomic DNA; (7) the presence
of a non-wild-type splicing pattern of a messenger RNA transcript
of a B7-like gene; (8) a non-wild-type level of a B7-like-protein;
(9) an allelic loss of a B7-like gene; and (10) an inappropriate
post-translational modification of a B7-like-protein. As described
herein, there are a large number of assay techniques known in the
art that can be used for detecting lesions in a B7-like gene. Any
cell type or tissue, in which B7-like proteins are expressed may be
utilized in the prognostic assays described herein.
[0242] In certain embodiments, detection of the lesion involves the
use of a probe/primer in a polymerase chain reaction (PCR) (see,
e.g., U.S. Pat. Nos. 4,683,195 and 4,683,202), such as anchor PCR
or RACE PCR, or, alternatively, in a ligation chain reaction (LCR)
(see, e.g., Landegran et al. (1988) Science 241:1077-1080; and
Nakazawa et al. (1994) Proc. Natl. Acad. Sci. USA 91:360-364), the
latter of which can be particularly useful for detecting point
mutations in the B7-like-gene (see, e.g., Abravaya et al. (1995)
Nucleic Acids Res. 23:675-682). It is anticipated that PCR and/or
LCR may be desirable to use as a preliminary amplification step in
conjunction with any of the techniques used for detecting mutations
described herein.
[0243] Alternative amplification methods include self sustained
sequence replication (Guatelli et al. (1990) Proc. Natl. Acad. Sci.
USA 87:1874-1878), transcriptional amplification system (Kwoh et
al. (1989) Proc. Natl. Acad. Sci. USA 86:1173-1177), Q-Beta
Replicase (Lizardi et al. (1988) Bio/Technology 6:1197), or any
other nucleic acid amplification method, followed by the detection
of the amplified molecules using techniques well known to those of
skill in the art. These detection schemes are especially useful for
the detection of nucleic acid molecules if such molecules are
present in very low numbers.
[0244] In an alternative embodiment, mutations in a B7-like gene
from a sample cell can be identified by alterations in restriction
enzyme cleavage patterns of isolated test sample and control DNA
digested with one or more restriction endonucleases. Moreover, the
use of sequence specific ribozymes (see, e.g., U.S. Pat. No.
5,498,531) can be used to score for the presence of specific
mutations by development or loss of a ribozyme cleavage site.
[0245] In other embodiments, genetic mutations in a B7-like
molecule can be identified by hybridizing a sample and control
nucleic acids, e.g., DNA or RNA, to high density arrays containing
hundreds or thousands of oligonucleotides probes (Cronin et al.
(1996) Human Mutation 7:244-255; Kozal et al. (1996) Nature
Medicine 2:753-759). In yet another embodiment, any of a variety of
sequencing reactions known in the art can be used to directly
sequence the B7-like gene and detect mutations by comparing the
sequence of the sample B7-like gene with the corresponding
wild-type (control) sequence. Examples of sequencing reactions
include those based on techniques developed by Maxim and Gilbert
((1977) Proc. Natl. Acad. Sci. USA 74:560) or Sanger ((1977) Proc.
Natl. Acad. Sci. USA 74:5463). It is also contemplated that any of
a variety of automated sequencing procedures can be utilized when
performing the diagnostic assays ((1995) Bio/Techniques 19:448),
including sequencing by mass spectrometry (see, e.g., PCT
Publication No. WO 94/16101; Cohen et al. (1996) Adv. Chromatogr.
36:127-162; and Griffin et al. (1993) Appl. Biochem. Biotechnol.
38:147-159).
[0246] Other methods for detecting mutations in the B7-like gene
include methods in which protection from cleavage agents is used to
detect mismatched bases in RNA/RNA or RNA/DNA heteroduplexes (Myers
et al. (1985) Science 230:1242). See, also Cotton et al. (1988)
Proc. Natl. Acad. Sci. USA 85:4397; Saleeba et al. (1992) Methods
Enzymol. 217:286-295. In a preferred embodiment, the control DNA or
RNA can be labeled for detection.
[0247] In still another embodiment, the mismatch cleavage reaction
employs one or more "DNA mismatch repair" enzymes that recognize
mismatched base pairs in double-stranded DNA in defined systems for
detecting and mapping point mutations in B7-like cDNAs obtained
from samples of cells. See, e.g., Hsu et al. (1994) Carcinogenesis
15:1657-1662. According to an exemplary embodiment, a probe based
on a B7-like sequence, e.g., a wild-type B7-like sequence, is
hybridized to a cDNA or other DNA product from a test cell(s). The
duplex is treated with a DNA mismatch repair enzyme, and the
cleavage products, if any, can be detected from electrophoresis
protocols or the like. See, e.g., U.S. Pat. No. 5,459,039.
[0248] In other embodiments, alterations in electrophoretic
mobility will be used to identify mutations in B7-like genes. For
example, single-strand conformation polymorphism (SSCP) may be used
to detect differences in electrophoretic mobility between mutant
and wild-type nucleic acids (Orita et al. (1989) Proc. Natl. Acad.
Sci. USA 86:2766; see also Cotton (1993) Mutat. Res. 285:125-144;
Hayashi (1992) Genet. Anal. Tech. Appl. 9:73-79). The sensitivity
of the assay may be enhanced by using RNA (rather than DNA), in
which the secondary structure is more sensitive to a change in
sequence. In a preferred embodiment, the subject method utilizes
heteroduplex analysis to separate double-stranded heteroduplex
molecules on the basis of changes in electrophoretic mobility (Keen
et al. (1991) Trends Genet. 7:5).
[0249] In yet another embodiment, the movement of mutant or
wild-type fragments in polyacrylamide gels containing a gradient of
denaturant is assayed using denaturing gradient gel electrophoresis
(DGGE) (Myers et al. (1985) Nature 313:495). When DGGE is used as
the method of analysis, DNA will be modified to insure that it does
not completely denature, for example by adding a GC clamp of
approximately 40 bp of high-melting GC-rich DNA by PCR. In a
further embodiment, a temperature gradient is used in place of a
denaturing gradient to identify differences in the mobility of
control and sample DNA (Rosenbaum and Reissner (1987) Biophys.
Chem. 265:12753).
[0250] Examples of other techniques for detecting point mutations
include, but are not limited to, selective oligonucleotide
hybridization, selective amplification, or selective primer
extension. For example, oligonucleotide primers may be prepared in
which the known mutation is placed centrally and then hybridized to
target DNA under conditions that permit hybridization only if a
perfect match is found (Saiki et al. (1986) Nature 324:163); Saiki
et al. (1989) Proc. Natl. Acad. Sci. USA 86:6230). Such
allele-specific oligonucleotides are hybridized to PCR-amplified
target DNA or a number of different mutations when the
oligonucleotides are attached to the hybridizing membrane and
hybridized with labeled target DNA.
[0251] Alternatively, allele-specific amplification technology,
which depends on selective PCR amplification, may be used in
conjunction with the instant invention. Oligonucleotides used as
primers for specific amplification may carry the mutation of
interest in the center of the molecule so that amplification
depends on differential hybridization (Gibbs et al. (1989) Nucleic
Acids Res. 17:2437-2448) or at the extreme 3' end of one primer
where, under appropriate conditions, mismatch can prevent or reduce
polymerase extension (Prossner (1993) Tibtech 11:238). In addition,
it may be desirable to introduce a novel restriction site in the
region of the mutation to create cleavage-based detection
(Gasparini et al. (1992) Mol. Cell. Probes 6:1). It is anticipated
that in certain embodiments amplification may also be performed
using Taq ligase for amplification (Barany (1991) Proc. Natl. Acad.
Sci. USA 88:189). In such cases, ligation will occur only if there
is a perfect match at the 3' end of the 5' sequence making it
possible to detect the presence of a known mutation at a specific
site by looking for the presence or absence of amplification.
[0252] The methods described herein may be performed, for example,
by utilizing prepackaged diagnostic kits comprising at least one
probe nucleic acid or antibody reagent described herein, which may
be conveniently used, e.g., in clinical settings to diagnosed
patients exhibiting symptoms or family history of a disease or
illness involving a B7-like gene.
[0253] 4. Pharmacogenomics
[0254] Agents, or modulators that have a stimulatory or inhibitory
effect on B7-like activity (e.g., B7-like gene expression) as
identified by a screening assay described herein, can be
administered to individuals to treat (prophylactically or
therapeutically) disorders associated with aberrant B7-like
activity as well as to modulate the phenotype of an immune
response. In conjunction with such treatment, the pharmacogenomics
(i.e., the study of the relationship between an individual's
genotype and that individual's response to a foreign compound or
drug) of the individual may be considered. Differences in
metabolism of therapeutics can lead to severe toxicity or
therapeutic failure by altering the relation between dose and blood
concentration of the pharmacologically active drug. Thus, the
pharmacogenomics of the individual permits the selection of
effective agents (e.g., drugs) for prophylactic or therapeutic
treatments based on a consideration of the individual's genotype.
Such pharmacogenomics can further be used to determine appropriate
dosages and therapeutic regimens. Accordingly, the activity of
B7-like protein, expression of B7-like nucleic acid, or mutation
content of B7-like genes in an individual can be determined to
thereby select appropriate agent(s) for therapeutic or prophylactic
treatment of the individual.
[0255] Pharmacogenomics deals with clinically significant
hereditary variations in the response to drugs due to altered drug
disposition and abnormal action in affected persons. See, e.g.,
Linder (1997) Clin. Chem. 43(2):254-266. In general, two types of
pharmacogenetic conditions can be differentiated. Genetic
conditions transmitted as a single factor altering the way drugs
act on the body are referred to as "altered drug action." Genetic
conditions transmitted as single factors altering the way the body
acts on drugs are referred to as "altered drug metabolism". These
pharmacogenetic conditions can occur either as rare defects or as
polymorphisms. For example, glucose-6-phosphate dehydrogenase
deficiency (G6PD) is a common inherited enzymopathy in which the
main clinical complication is haemolysis after ingestion of oxidant
drugs (antimalarials, sulfonamides, analgesics, nitrofurans) and
consumption of fava beans.
[0256] One pharmacogenomics approach to identifying genes that
predict drug response, known as "a genome-wide association," relies
primarily on a high-resolution map of the human genome consisting
of already known gene-related markers (e.g., a "bi-allelic" gene
marker map which consists of 60,000-100,000 polymorphic or variable
sites on the human genome, each of which has two variants.) Such a
high-resolution genetic map can be compared to a map of the genome
of each of a statistically significant number of patients taking
part in a Phase II/III drug trial to identify markers associated
with a particular observed drug response or side effect.
Alternatively, such a high resolution map can be generated from a
combination of some ten-million known single nucleotide
polymorphisms (SNPs) in the human genome. As used herein, an "SNP"
is a common alteration that occurs in a single nucleotide base in a
stretch of DNA. For example, a SNP may occur once per every 1000
bases of DNA. A SNP may be involved in a disease process, however,
the vast majority may not be disease-associated. Given a genetic
map based on the occurrence of such SNPs, individuals can be
grouped into genetic categories depending on a particular pattern
of SNPs in their individual genome. In such a manner, treatment
regimens can be tailored to groups of genetically similar
individuals, taking into account traits that may be common among
such genetically similar individuals.
[0257] Alternatively, a method termed the "candidate gene
approach," can be utilized to identify genes that predict drug
response. According to this method, if a gene that encodes a drug's
target is known (e.g., a B7-like protein of the present invention),
all common variants of that gene can be fairly easily identified in
the population and it can be determined if having one version of
the gene versus another is associated with a particular drug
response.
[0258] Alternatively, a method termed the "gene expression
profiling," can be utilized to identify genes that predict drug
response. For example, the gene expression of an animal dosed with
a drug (e.g., a B7-like molecule or B7-like modulator of the
present invention) can give an indication whether gene pathways
related to toxicity have been turned on.
[0259] Information generated from more than one of the above
pharmacogenomics approaches can be used to determine appropriate
dosage and treatment regimens for prophylactic or therapeutic
treatment of an individual. This knowledge, when applied to dosing
or drug selection, can avoid adverse reactions or therapeutic
failure and thus enhance therapeutic or prophylactic efficiency
when treating a subject with a B7-like molecule or B7-like
modulator of the invention, such as a modulator identified by one
of the exemplary screening assays described herein.
[0260] The present invention further provides methods for
identifying new agents, or combinations, that are based on
identifying agents that modulate the activity of one or more of the
gene products encoded by one or more of the B7-like genes of the
present invention, wherein these products may be associated with
resistance of the cells to a therapeutic agent. Specifically, the
activity of the proteins encoded by the B7-like genes of the
present invention can be used as a basis for identifying agents for
overcoming agent resistance. By blocking the activity of one or
more of the resistance proteins, target cells will become sensitive
to treatment with an agent that the unmodified target cells were
resistant to.
[0261] Monitoring the influence of agents (e.g., drugs) on the
expression or activity of a B7-like protein can be applied in
clinical trials. For example, the effectiveness of an agent
determined by a screening assay as described herein to increase
B7-like gene expression, protein levels, or up-regulate B7-like
activity, can be monitored in clinical trials of subjects
exhibiting decreased B7-like gene expression, protein levels, or
down-regulated B7-like activity. Alternatively, the effectiveness
of an agent determined by a screening assay to decrease B7-like
gene expression, protein levels, or down-regulate B7-like activity,
can be monitored in clinical trials of subjects exhibiting
increased B7-like gene expression, protein levels, or up-regulated
B7-like activity. In such clinical trials, the expression or
activity of a B7-like gene, and preferably, other genes that have
been implicated in, for example, a B7-like-associated disorder can
be used as a "read out" or markers of the phenotype of a particular
cell.
[0262] As an illustrative embodiment, the activity of drug
metabolizing enzymes is a major determinant of both the intensity
and duration of drug action. The discovery of genetic polymorphisms
of drug metabolizing enzymes (e.g., N-acetyltransferase 2 (NAT 2)
and cytochrome P450 enzymes CYP2D6 and CYP2C19) has provided an
explanation as to why some patients do not obtain the expected drug
effects or show exaggerated drug response and serious toxicity
after taking the standard and safe dose of a drug. These
polymorphisms are expressed in two phenotypes in the population,
the extensive metabolizer (EM) and poor metabolizer (PM). The
prevalence of PM is different among different populations. For
example, the gene coding for CYP2D6 is highly polymorphic and
several mutations have been identified in PM, which all lead to the
absence of functional CYP2D6. Poor metabolizers of CYP2D6 and
CYP2C19 quite frequently experience exaggerated drug response and
side effects when they receive standard doses. If a metabolite is
the active therapeutic moiety, a PM will show no therapeutic
response, as demonstrated for the analgesic effect of codeine
mediated by its CYP2D6-formed metabolite morphine. The other
extreme are the so called ultra-rapid metabolizers who do not
respond to standard doses. Recently, the molecular basis of
ultra-rapid metabolism has been identified to be due to CYP2D6 gene
amplification.
[0263] Thus, the activity of B7-like protein, expression of B7-like
nucleic acid, or mutation content of B7-like genes in an individual
can be determined to thereby select appropriate agent(s) for
therapeutic or prophylactic treatment of the individual. In
addition, pharmacogenetic studies can be used to apply genotyping
of polymorphic alleles encoding drug-metabolizing enzymes to the
identification of an individual's drug responsiveness phenotype.
This knowledge, when applied to dosing or drug selection, can avoid
adverse reactions or therapeutic failure and thus enhance
therapeutic or prophylactic efficiency when treating a subject with
a B7-like modulator, such as a modulator identified by one of the
exemplary screening assays described herein.
[0264] 5. Monitoring of Effects During Clinical Trials
[0265] Monitoring the influence of agents (e.g., drugs, compounds)
on the expression or activity of B7-like genes (e.g., the ability
to modulate aberrant immune response or cell proliferation) can be
applied not only in basic drug screening but also in clinical
trials. For example, the effectiveness of an agent, as determined
by a screening assay as described herein, to increase or decrease
B7-like gene expression, protein levels, or protein activity, can
be monitored in clinical trials of subjects exhibiting decreased or
increased B7-like gene expression, protein levels, or protein
activity. In such clinical trials, B7-like expression or activity
and preferably that of other genes that have been implicated in for
example, a cellular proliferation disorder, can be used as a marker
of the immune responsiveness of a particular cell.
[0266] For example, and not by way of limitation, genes that are
modulated in cells by treatment with an agent (e.g., compound,
drug, or small molecule) that modulates B7-like activity (e.g., as
identified in a screening assay described herein) can be
identified. Thus, to study the effect of agents on immune
disorders, for example, in a clinical trial, cells can be isolated
and RNA prepared and analyzed for the levels of expression of
B7-like genes and other genes implicated in the disorder. The
levels of gene expression (i.e., a gene expression pattern) can be
quantified by Northern blot analysis or RT-PCR, as described
herein, or alternatively by measuring the amount of protein
produced, by one of the methods as described herein, or by
measuring the levels of activity of B7-like genes or other genes.
In this way, the gene expression pattern can serve as a marker,
indicative of the physiological response of the cells to the agent.
Accordingly, this response state may be determined before, and at
various points during, treatment of the individual with the
agent.
[0267] In a preferred embodiment, the present invention provides a
method for monitoring the effectiveness of treatment of a subject
with an agent (e.g., an agonist, antagonist, peptidomimetic,
protein, peptide, nucleic acid, small molecule, or other drug
candidate identified by the screening assays described herein)
comprising the steps of (1) obtaining a preadministration sample
from a subject prior to administration of the agent; (2) detecting
the level of expression of a B7-like protein, mRNA, or genomic DNA
in the preadministration sample; (3) obtaining one or more
postadministration samples from the subject; (4) detecting the
level of expression or activity of the B7-like protein, mRNA, or
genomic DNA in the postadministration samples; (5) comparing the
level of expression or activity of the B7-like protein, mRNA, or
genomic DNA in the preadministration sample with the B7-like
protein, mRNA, or genomic DNA in the postadministration sample or
samples; and (vi) altering the administration of the agent to the
subject accordingly to bring about the desired effect, i.e., for
example, an increase or a decrease in the expression or activity of
a B7-like protein.
[0268] C. Methods of Treatment
[0269] The present invention provides for both prophylactic and
therapeutic methods of treating a subject at risk of (or
susceptible to) a disorder or having a disorder associated with
aberrant B7-like expression or activity. Additionally, the
compositions of the invention find use in the treatment of
disorders described herein. Thus, therapies for disorders
associated with B7-like molecules are encompassed herein.
[0270] 1. Prophylactic Methods
[0271] In one aspect, the invention provides a method for
preventing in a subject a disease or condition associated with an
aberrant B7-like expression or activity by administering to the
subject an agent that modulates B7-like expression or at least one
B7-like gene activity, and/or modulates the interaction of the
abberrant B7-like molecule with its natural ligand, such as by
administering an antibody that binds to the aberrant B7-like
molecule thereby altering the binding of its natural ligand.
Subjects at risk for a disease that is caused, or contributed to,
by aberrant B7-like expression or activity can be identified by,
for example, any or a combination of diagnostic or prognostic
assays as described herein. Administration of a prophylactic agent
can occur prior to the manifestation of symptoms characteristic of
the B7-like aberrancy, such that a disease or disorder is prevented
or, alternatively, delayed in its progression. Depending on the
type of B7-like aberrancy, for example, a B7-like agonist or
B7-like antagonist agent can be used for treating the subject. The
appropriate agent can be determined based on screening assays
described herein.
[0272] 2. Therapeutic Methods
[0273] Another aspect of the invention pertains to methods of
modulating B7-like expression or activity for therapeutic purposes.
The modulatory method of the invention involves contacting a cell
with an agent that modulates one or more of the activities of
B7-like protein activity associated with the cell. An agent that
modulates B7-like protein activity can be an agent as described
herein, such as a nucleic acid or a protein, a naturally occurring
cognate ligand of a B7-like protein, a peptide, a B7-like
peptidomimetic, or other small molecule. In one embodiment, the
agent stimulates one or more of the biological activities of
B7-like protein. Examples of such stimulatory agents include active
B7-like protein and a nucleic acid molecule encoding a B7-like
protein that has been introduced into the cell. In another
embodiment, the agent inhibits one or more of the biological
activities of B7-like protein. Examples of such inhibitory agents
include antisense B7-like nucleic acid molecules and anti-B7-like
antibodies.
[0274] These modulatory methods can be performed in vitro (e.g., by
culturing the cell with the agent) or, alternatively, in vivo (e.g,
by administering the agent to a subject). As such, the present
invention provides methods of treating an individual afflicted with
a disease or disorder characterized by aberrant expression or
activity of a B7-like protein or nucleic acid molecule, or a
disease or disorder described herein. In one embodiment, the method
involves administering an agent (e.g., an agent identified by a
screening assay described herein), or a combination of agents, that
modulates (e.g., up-regulates or down-regulates) B7-like expression
or activity. In another embodiment, the method involves
administering a B7-like protein or nucleic acid molecule as therapy
to compensate for reduced or aberrant B7-like expression or
activity.
[0275] Stimulation of B7-like activity is desirable in situations
in which a B7-like protein is abnormally down-regulated and/or in
which increased B7-like activity is likely to have a beneficial
effect. For example, stimulation of PD-L activity in patients with
Lupus-erythematosus is desirable, as transgenic mice in which
expression of the receptor to which PD-L binds, PD-1, has been
knocked out develop Lupus-like symptoms (Nishimura et al. (1999)
Immunity 11:141-151). Conversely, inhibition of B7-like activity is
desirable in situations in which B7-like activity is abnormally
up-regulated and/or in which decreased B7-like activity is likely
to have a beneficial effect. For example, interference of B7-like
T-cell co-stimulation through CD28-like and/or CTLA-4-like
receptors may be useful for the treatment of antibody-mediated
autoimmune disease such as collagen-induced arthritis, dermatitis,
and psoriasis vulgaris (Takiguchi et al. (1999) Lab. Invest.
79:317-326, Linsley et al. (1992) Science 257:792-795, Tada et al.
(1999) J. Immunol. 162:203-208, Tang et al. (1996) J. Immunol.
157:117-125, Abrams et al. (1999) J. Clin. Invest.
103:1243-1252).
[0276] This invention is further illustrated by the following
examples, which should not be construed as limiting.
EXPERIMENTAL
Example 1
Isolation of hB7-H2 long and hB7-H2 short
[0277] The hB7-H2 long and hB7-H2 short sequences were identified
in a human osteoblast library. The identified clones hB7-H21 and
hB7-H2s encode transcripts of approximately 2.23 Kb and 1.98 Kb,
and the corresponding cDNA's are set forth in SEQ ID NO:1 and SEQ
ID NO:3, respectively. The open reading frames (nt 78-896 and
70-618) of these transcripts encode a predicted 273 amino acid
protein (SEQ ID NO:2) and a 183 amino acid protein (SEQ ID NO:4)
having a molecular weights of approximately 30.9 kDa and 20.8 kDa,
respectively. The cDNA's, SEQ ID NO:1 and SEQ ID NO:3, are two
different splice variants of the same gene. A search of the
nucleotide and protein databases revealed that these cDNA's encode
proteins belonging to the B7 family of immunoglobulins. The highest
scoring blast hit that represented a human protein with known
function at that time was human B7-H1 (Accession Number AAF25807.1;
SEQ ID NO:8). The polypeptides set forth in SEQ ID NO:2 and SEQ ID
NO:4, encoded by SEQ ID NO:1 and SEQ ID NO:3, respectively, were
designated hB7-H2 long (hB7-H21) and hB7-H2 short (hB7-H2s) based
on this homology. An alignment of all three of these protein
sequences is shown in FIG. 9. The hB7-H21 protein (SEQ ID NO:2)
shares approximately 37.4% identity to human B7-H1 (SEQ ID NO:8)
(see FIG. 5), while hB7-H2s shares approximately 28.2% identity to
hB7-H1 (see FIG. 6). The alignment was generated using the Clustal
method with PAM250 residue weight table.
Example 2
mRNA Expression of hB7-H2 long
[0278] Northern blot analysis was performed for hB7-H2 long.
Standard PCR protocol (i.e., (1) 95.degree. C. for 1 min, (2)
95.degree. C. for 1 min, (3) 55.degree. C. for 1 min, (4)
72.degree. C. for 1 min, (5) 72.degree. C. for 5 min, (6)
14.degree. C. forever, steps 2-4: 35 cycles) and the following
primers were used to amplify the full-length open reading frame for
hB7-H21:
TABLE-US-00001 hB7-H21 5' primer (SEQ ID NO: 25): 5'
CTCGAGGAATTCGCCGCCATGATCTTCCTCCTGCTAAT 3' hB7-H21 3' primer (SEQ ID
NO: 26): 3' GGGAAGTGAACAGTGCTATCGCGGCCGCAAAAAA 5'
PCR products were run on a 1% agarose gel and bands were purified
using the QIAEX-II kit. Sequence in bold is restriction enzyme
sites. Sequence in italics is Kozak sequence. Sequence underlined
represents those bases that match the ORF of the hB7-H2 gene of
interest.
[0279] The Northern blot was done as follows. The probe was
radiolabeled using .sup.32PdCTP using standard procedures and
hybridized to a Clonetech (Palo Alto, Calif.) human immune system
multiple tissue northern (Catalogue #7768-1). This immune blot
contains RNA from human spleen, lymph node, thymus, peripheral
blood leukocyte, bone marrow and fetal liver. The hybridization and
wash conditions used were as described in the Clontech Multiple
Tissue Northern (MTN) Blot User Manual (Catalogue number PT1200-1).
Kodak biomax film was exposed to the Northern blot membrane for 72
hours, which was then developed. An approximately 2.4 kb band was
observed in all RNAs on the blot, the highest being in spleen and
the lowest, which was nearly undetectable, in the peripheral blood
leukocytes.
[0280] All publications and patent applications mentioned in the
specification are indicative of the level of those skilled in the
art to which this invention pertains. All publications and patent
applications are herein incorporated by reference to the same
extent as if each individual publication or patent application was
specifically and individually indicated to be incorporated by
reference.
[0281] Those skilled in the art will recognize, or be able to
ascertain using no more than routine experimentation, many
equivalents to the specific embodiments of the invention described
herein. Such equivalents are intended to be encompassed by the
following claims.
Sequence CWU 1
1
3212229DNAHomo sapiensmisc_feature(1)...(2229)n = A,T,C or G
1tagggagtcg acccacgcgt ccgcttttgc atctttactt gtggagctgt ggcaagtcct
60catatcaaat acagaac atg atc ttc ctc ctg cta atg ttg agc ctg gaa
110 Met Ile Phe Leu Leu Leu Met Leu Ser Leu Glu 1 5 10ttg cag ctt
cac cag ata gca gct tta ttc aca gtg aca gtc cct aag 158Leu Gln Leu
His Gln Ile Ala Ala Leu Phe Thr Val Thr Val Pro Lys 15 20 25gaa ctg
tac ata ata gag cat ggc agc aat gtg acc ctg gaa tgc aac 206Glu Leu
Tyr Ile Ile Glu His Gly Ser Asn Val Thr Leu Glu Cys Asn 30 35 40ttt
gac act gga agt cat gtg aac ctt gga gca ata aca gcc agt ttg 254Phe
Asp Thr Gly Ser His Val Asn Leu Gly Ala Ile Thr Ala Ser Leu 45 50
55caa aag gtg gaa aat gat aca tcc cca cac cgt gaa aga gcc act ttg
302Gln Lys Val Glu Asn Asp Thr Ser Pro His Arg Glu Arg Ala Thr Leu
60 65 70 75ctg gag gag cag ctg ccc cta ggg aag gcc tcg ttc cac ata
cct caa 350Leu Glu Glu Gln Leu Pro Leu Gly Lys Ala Ser Phe His Ile
Pro Gln 80 85 90gtc caa gtg agg gac gaa gga cag tac caa tgc ata atc
atc tat ggg 398Val Gln Val Arg Asp Glu Gly Gln Tyr Gln Cys Ile Ile
Ile Tyr Gly 95 100 105gtc gcc tgg gac tac aag tac ctg act ctg aaa
gtc aaa gct tcc tac 446Val Ala Trp Asp Tyr Lys Tyr Leu Thr Leu Lys
Val Lys Ala Ser Tyr 110 115 120agg aaa ata aac act cac atc cta aag
gtt cca gaa aca gat gag gta 494Arg Lys Ile Asn Thr His Ile Leu Lys
Val Pro Glu Thr Asp Glu Val 125 130 135gag ctc acc tgc cag gct aca
ggt tat cct ctg gca gaa gta tcc tgg 542Glu Leu Thr Cys Gln Ala Thr
Gly Tyr Pro Leu Ala Glu Val Ser Trp140 145 150 155cca aac gtc agc
gtt cct gcc aac acc agc cac tcc agg acc cct gaa 590Pro Asn Val Ser
Val Pro Ala Asn Thr Ser His Ser Arg Thr Pro Glu 160 165 170ggc ctc
tac cag gtc acc agt gtt ctg cgc cta aag cca ccc cct ggc 638Gly Leu
Tyr Gln Val Thr Ser Val Leu Arg Leu Lys Pro Pro Pro Gly 175 180
185aga aac ttc agc tgt gtg ttc tgg aat act cac gtg agg gaa ctt act
686Arg Asn Phe Ser Cys Val Phe Trp Asn Thr His Val Arg Glu Leu Thr
190 195 200ttg gcc agc att gac ctt caa agt cag atg gaa ccc agg acc
cat cca 734Leu Ala Ser Ile Asp Leu Gln Ser Gln Met Glu Pro Arg Thr
His Pro 205 210 215act tgg ctg ctt cac att ttc atc ccc tcc tgc atc
att gct ttc att 782Thr Trp Leu Leu His Ile Phe Ile Pro Ser Cys Ile
Ile Ala Phe Ile220 225 230 235ttc ata gcc aca gtg ata gcc cta aga
aaa caa ctc tgt caa aag ctg 830Phe Ile Ala Thr Val Ile Ala Leu Arg
Lys Gln Leu Cys Gln Lys Leu 240 245 250tat tct tca aaa gac aca aca
aaa aga cct gtc acc aca aca aag agg 878Tyr Ser Ser Lys Asp Thr Thr
Lys Arg Pro Val Thr Thr Thr Lys Arg 255 260 265gaa gtg aac agt gct
atc tgaacctgtg gtcttgggag ccagggtgac 926Glu Val Asn Ser Ala Ile
270ctgatatgac atctaaagaa gcttctggac tctgaacaag aattcggtgg
cctgcagagc 986ttgccatttg cacttttcaa atgcctttgg atgacccagc
actttaatct gaaacctgca 1046acaagactag ccaacacctg gccatgaaac
ttgccccttc actgatctgg actcacctct 1106ggagcctatg gctttaagca
agcactactg cactttacag aattacccca ctggatcctg 1166gacccacaga
attccttcag gatccttctt gctgccagac tgaaagcaaa aggaattatt
1226tcccctcaag ttttctaagt gatttccaaa agcagaggtg tgtggaaatt
tccagtaaca 1286gaaacagatg ggttgccaat agagttattt tttatctata
gcttcctctg ggtactagaa 1346gaggctattg agactatgag ctcacagaca
gggcttcgca caaactcaaa tcataattga 1406catgttttat ggattactgg
aatcttgata gcataatgaa gttgttctaa ttaacagaga 1466gcatttaaat
atacactaag tgcacaaatt gtggagtaaa gtcatcaagc tctgtttttg
1526aggtctaagt cacaaagcat ttgttttaac ctgtaatggc accatgttta
atggtggttt 1586tttttttgaa cgacatcttt cctttaaaaa ttattggttt
ctttttattt gtttttacct 1646tagaaatcaa ttatatacag tcaaaaatat
ttgatatgct catacgttgt atctgcagca 1706atttcagata agtagctaaa
atggccaaag ccccaaacta agcctccttt tctggccctc 1766aatatgactt
taaatttgac ttttcagtgc ctcagtttgc acatctgtaa tacagcaatg
1826ctaagtagtc aaggcctttg ataattggca ctatggaaat cctgcaagat
cccactacat 1886atgtgtggag cagaagggta actcggctac agtaacagct
taattttgtt aaatttgttc 1946tttatactgg agccatgaag ctcagagcat
tagctgaccc ttgaactatt caaatgggca 2006cattagctag tataacagac
ttacataggt gggcctaaag caagctcctt aactgagcaa 2066aatttggggc
ttatgagaat gaaagggtgt gaaattgact aacagacaaa tcatacatct
2126cagtttctca attctcatgt aaatcagaga atgcctttaa agaataaaac
tcaattgtta 2186ttcttcaaaa aaaaaaaaaa aaaaaaaaaa aaaaaggggn ggc
22292273PRTHomo sapiens 2Met Ile Phe Leu Leu Leu Met Leu Ser Leu
Glu Leu Gln Leu His Gln 1 5 10 15Ile Ala Ala Leu Phe Thr Val Thr
Val Pro Lys Glu Leu Tyr Ile Ile 20 25 30Glu His Gly Ser Asn Val Thr
Leu Glu Cys Asn Phe Asp Thr Gly Ser 35 40 45His Val Asn Leu Gly Ala
Ile Thr Ala Ser Leu Gln Lys Val Glu Asn 50 55 60Asp Thr Ser Pro His
Arg Glu Arg Ala Thr Leu Leu Glu Glu Gln Leu65 70 75 80Pro Leu Gly
Lys Ala Ser Phe His Ile Pro Gln Val Gln Val Arg Asp 85 90 95Glu Gly
Gln Tyr Gln Cys Ile Ile Ile Tyr Gly Val Ala Trp Asp Tyr 100 105
110Lys Tyr Leu Thr Leu Lys Val Lys Ala Ser Tyr Arg Lys Ile Asn Thr
115 120 125His Ile Leu Lys Val Pro Glu Thr Asp Glu Val Glu Leu Thr
Cys Gln 130 135 140Ala Thr Gly Tyr Pro Leu Ala Glu Val Ser Trp Pro
Asn Val Ser Val145 150 155 160Pro Ala Asn Thr Ser His Ser Arg Thr
Pro Glu Gly Leu Tyr Gln Val 165 170 175Thr Ser Val Leu Arg Leu Lys
Pro Pro Pro Gly Arg Asn Phe Ser Cys 180 185 190Val Phe Trp Asn Thr
His Val Arg Glu Leu Thr Leu Ala Ser Ile Asp 195 200 205Leu Gln Ser
Gln Met Glu Pro Arg Thr His Pro Thr Trp Leu Leu His 210 215 220Ile
Phe Ile Pro Ser Cys Ile Ile Ala Phe Ile Phe Ile Ala Thr Val225 230
235 240Ile Ala Leu Arg Lys Gln Leu Cys Gln Lys Leu Tyr Ser Ser Lys
Asp 245 250 255Thr Thr Lys Arg Pro Val Thr Thr Thr Lys Arg Glu Val
Asn Ser Ala 260 265 270Ile31975DNAHomo
sapiensCDS(70)...(618)misc_feature(1)...(1975)B7-H2 Short
3atagggagtc gacccacgcg tccgctttac ttgtggagct gtggcaagtc ctcatatcaa
60atacagaac atg atc ttc ctc ctg cta atg ttg agc ctg gaa ttg cag ctt
111 Met Ile Phe Leu Leu Leu Met Leu Ser Leu Glu Leu Gln Leu 1 5
10cac cag ata gca gct tta ttc aca gtg aca gtc cct aag gaa ctg tac
159His Gln Ile Ala Ala Leu Phe Thr Val Thr Val Pro Lys Glu Leu Tyr
15 20 25 30ata ata gag cat ggc agc aat gtg acc ctg gaa tgc aac ttt
gac act 207Ile Ile Glu His Gly Ser Asn Val Thr Leu Glu Cys Asn Phe
Asp Thr 35 40 45gga agt cat gtg aac ctt gga gca ata aca gcc agt ttg
caa aag gtg 255Gly Ser His Val Asn Leu Gly Ala Ile Thr Ala Ser Leu
Gln Lys Val 50 55 60gaa aat gat aca tcc cca cac cgt gaa aga gcc act
ttg ctg gag gag 303Glu Asn Asp Thr Ser Pro His Arg Glu Arg Ala Thr
Leu Leu Glu Glu 65 70 75cag ctg ccc cta ggg aag gcc tcg ttc cac ata
cct caa gtc caa gtg 351Gln Leu Pro Leu Gly Lys Ala Ser Phe His Ile
Pro Gln Val Gln Val 80 85 90agg gac gaa gga cag tac caa tgc ata atc
atc tat ggg gtc gcc tgg 399Arg Asp Glu Gly Gln Tyr Gln Cys Ile Ile
Ile Tyr Gly Val Ala Trp 95 100 105 110gac tac aag tac ctg act ctg
aaa gtc aaa ggt cag atg gaa ccc agg 447Asp Tyr Lys Tyr Leu Thr Leu
Lys Val Lys Gly Gln Met Glu Pro Arg 115 120 125acc cat cca act tgg
ctg ctt cac att ttc atc ccc tcc tgc atc att 495Thr His Pro Thr Trp
Leu Leu His Ile Phe Ile Pro Ser Cys Ile Ile 130 135 140gct ttc att
ttc ata gcc aca gtg ata gcc cta aga aaa caa ctc tgt 543Ala Phe Ile
Phe Ile Ala Thr Val Ile Ala Leu Arg Lys Gln Leu Cys 145 150 155caa
aag ctg tat tct tca aaa gac aca aca aaa aga cct gtc acc aca 591Gln
Lys Leu Tyr Ser Ser Lys Asp Thr Thr Lys Arg Pro Val Thr Thr 160 165
170aca aag agg gaa gtg aac agt gct atc tgaacctgtg gtcttgggag 638Thr
Lys Arg Glu Val Asn Ser Ala Ile175 180ccagggtgac ctgatatgac
atctaaagaa gcttctggac tctgaacaag aattcggtgg 698cctgcagagc
ttgccatttg cacttttcaa atgcctttgg atgacccagc actttaatct
758gaaacctgca acaagactag ccaacacctg gccatgaaac ttgccccttc
actgatctgg 818actcacctct ggagcctatg gctttaagca agcactactg
cactttacag aattacccca 878ctggatcctg gacccacaga attccttcag
gatccttctt gctgccagac tgaaagcaaa 938aggaattatt tcccctcaag
ttttctaagt gatttccaaa agcagaggtg tgtggaaatt 998tccagtaaca
gaaacagatg ggttgccaat agagttattt tttatctata gcttcctctg
1058ggtactagaa gaggctattg agactatgag ctcacagaca gggcttcgca
caaactcaaa 1118tcataattga catgttttat ggattactgg aatcttgata
gcataatgaa gttgttctaa 1178ttaacagaga gcatttaaat atacactaag
tgcacaaatt gtggagtaaa gtcatcaagc 1238tctgtttttg aggtctaagt
cacaaagcat ttgttttaac ctgtaatggc accatgttta 1298atggtggttt
tttttttgaa ctacatcttt cctttaaaaa ttattggttt ctttttattt
1358gtttttacct tagaaatcaa ttatatacag tcaaaaatat ttgatatgct
catacgttgt 1418atctgcagca atttcagata agtagctaaa atggccaaag
ccccaaacta agcctccttt 1478tctggccctc aatatgactt taaatttgac
ttttcagtgc ctcagtttgc acatctgtaa 1538tacagcaatg ctaagtagtc
aaggcctttg ataattggca ctatggaaat cctgcaagat 1598cccactacat
atgtgtggag cagaagggta actcggctac agtaacagct taattttgtt
1658aaatttgttc tttatactgg agccatgaag ctcagagcat tagctgaccc
ttgaactatt 1718caaatgggca cattagctag tataacagac ttacataggt
gggcctaaag caagctcctt 1778aactgagcaa aatttggggc ttatgagaat
gaaagggtgt gaaattgact aacagacaaa 1838tcatacatct cagtttctca
attctcatgt aaatcagaga atgcctttaa agaataaaac 1898tcaattgtta
ttcttcaaaa aaaaaaaaaa aaaaaaaaaa aaagggcggc cgctagacta
1958gtctagagaa aaaacct 19754183PRTHomo sapiens 4Met Ile Phe Leu Leu
Leu Met Leu Ser Leu Glu Leu Gln Leu His Gln 1 5 10 15Ile Ala Ala
Leu Phe Thr Val Thr Val Pro Lys Glu Leu Tyr Ile Ile 20 25 30Glu His
Gly Ser Asn Val Thr Leu Glu Cys Asn Phe Asp Thr Gly Ser 35 40 45His
Val Asn Leu Gly Ala Ile Thr Ala Ser Leu Gln Lys Val Glu Asn 50 55
60Asp Thr Ser Pro His Arg Glu Arg Ala Thr Leu Leu Glu Glu Gln Leu65
70 75 80Pro Leu Gly Lys Ala Ser Phe His Ile Pro Gln Val Gln Val Arg
Asp 85 90 95Glu Gly Gln Tyr Gln Cys Ile Ile Ile Tyr Gly Val Ala Trp
Asp Tyr 100 105 110Lys Tyr Leu Thr Leu Lys Val Lys Gly Gln Met Glu
Pro Arg Thr His 115 120 125Pro Thr Trp Leu Leu His Ile Phe Ile Pro
Ser Cys Ile Ile Ala Phe 130 135 140Ile Phe Ile Ala Thr Val Ile Ala
Leu Arg Lys Gln Leu Cys Gln Lys145 150 155 160Leu Tyr Ser Ser Lys
Asp Thr Thr Lys Arg Pro Val Thr Thr Thr Lys 165 170 175Arg Glu Val
Asn Ser Ala Ile 1805288PRTHomo sapiens 5Met Gly His Thr Arg Arg Gln
Gly Thr Ser Pro Ser Lys Cys Pro Tyr 1 5 10 15Leu Asn Phe Phe Gln
Leu Leu Val Leu Ala Gly Leu Ser His Phe Cys 20 25 30Ser Gly Val Ile
His Val Thr Lys Glu Val Lys Glu Val Ala Thr Leu 35 40 45Ser Cys Gly
His Asn Val Ser Val Glu Glu Leu Ala Gln Thr Arg Ile 50 55 60Tyr Trp
Gln Lys Glu Lys Lys Met Val Leu Thr Met Met Ser Gly Asp65 70 75
80Met Asn Ile Trp Pro Glu Tyr Lys Asn Arg Thr Ile Phe Asp Ile Thr
85 90 95Asn Asn Leu Ser Ile Val Ile Leu Ala Leu Arg Pro Ser Asp Glu
Gly 100 105 110Thr Tyr Glu Cys Val Val Leu Lys Tyr Glu Lys Asp Ala
Phe Lys Arg 115 120 125Glu His Leu Ala Glu Val Thr Leu Ser Val Lys
Ala Asp Phe Pro Thr 130 135 140Pro Ser Ile Ser Asp Phe Glu Ile Pro
Thr Ser Asn Ile Arg Arg Ile145 150 155 160Ile Cys Ser Thr Ser Gly
Gly Phe Pro Glu Pro His Leu Ser Trp Leu 165 170 175Glu Asn Gly Glu
Glu Leu Asn Ala Ile Asn Thr Thr Val Ser Gln Asp 180 185 190Pro Glu
Thr Glu Leu Tyr Ala Val Ser Ser Lys Leu Asp Phe Asn Met 195 200
205Thr Thr Asn His Ser Phe Met Cys Leu Ile Lys Tyr Gly His Leu Arg
210 215 220Val Asn Gln Thr Phe Asn Trp Asn Thr Thr Lys Gln Glu His
Phe Pro225 230 235 240Asp Asn Leu Leu Pro Ser Trp Ala Ile Thr Leu
Ile Ser Val Asn Gly 245 250 255Ile Phe Val Ile Cys Cys Leu Thr Tyr
Cys Phe Ala Pro Arg Cys Arg 260 265 270Glu Arg Arg Arg Asn Glu Arg
Leu Arg Arg Glu Ser Val Arg Pro Val 275 280 2856324PRTHomo sapiens
6Met Gly Leu Ser Asn Ile Leu Phe Val Met Ala Phe Leu Leu Ser Gly 1
5 10 15Ala Ala Pro Leu Lys Ile Gln Ala Tyr Phe Asn Glu Thr Ala Asp
Leu 20 25 30Pro Cys Gln Phe Ala Asn Ser Gln Asn Gln Ser Leu Ser Glu
Leu Val 35 40 45Val Phe Trp Gln Asp Gln Glu Asn Leu Val Leu Asn Glu
Val Tyr Leu 50 55 60Gly Lys Glu Lys Phe Asp Ser Val His Ser Lys Tyr
Met Gly Arg Thr65 70 75 80Ser Phe Asp Ser Asp Ser Trp Thr Leu Arg
Leu His Asn Leu Gln Ile 85 90 95Lys Asp Lys Gly Leu Tyr Gln Cys Ile
Ile His His Lys Lys Pro Thr 100 105 110Gly Met Ile Arg Ile His Gln
Met Asn Ser Glu Leu Ser Val Leu Ala 115 120 125Asn Phe Ser Gln Pro
Glu Ile Val Pro Ile Ser Asn Ile Thr Glu Asn 130 135 140Val Tyr Ile
Asn Leu Thr Cys Ser Ser Ile His Gly Tyr Pro Glu Pro145 150 155
160Lys Lys Met Ser Val Leu Leu Arg Thr Lys Asn Ser Thr Ile Glu Tyr
165 170 175Asp Gly Ile Met Gln Lys Ser Gln Asp Asn Val Thr Glu Leu
Tyr Asp 180 185 190Val Ser Ile Ser Leu Ser Val Ser Phe Pro Asp Val
Thr Ser Asn Met 195 200 205Thr Ile Phe Cys Ile Leu Glu Thr Asp Lys
Thr Arg Leu Leu Ser Ser 210 215 220Pro Phe Ser Ile Glu Leu Glu Asp
Pro Gln Pro Pro Pro Asp His Ile225 230 235 240Pro Trp Ile Thr Ala
Val Leu Pro Thr Val Ile Ile Cys Val Met Val 245 250 255Phe Pro Cys
Leu Ile Leu Trp Lys Trp Lys Lys Lys Lys Arg Pro Arg 260 265 270Asn
Ser Tyr Lys Cys Gly Thr Asn Thr Met Glu Arg Glu Glu Ser Glu 275 280
285Gln Thr Lys Lys Arg Glu Lys Ile His Ile Pro Glu Arg Ser Asp Glu
290 295 300Ala Gln Arg Val Phe Lys Ser Ser Lys Thr Ser Ser Cys Asp
Lys Ser305 310 315 320Asp Thr Cys Phe7309PRTHomo sapiens 7Met Arg
Leu Gly Ser Pro Gly Leu Leu Phe Leu Leu Phe Ser Ser Leu 1 5 10
15Arg Ala Asp Thr Gln Glu Lys Glu Val Arg Ala Met Val Gly Ser Asp
20 25 30Val Glu Leu Ser Cys Ala Cys Pro Glu Gly Ser Arg Phe Asp Leu
Asn 35 40 45Asp Val Tyr Val Tyr Trp Gln Thr Ser Glu Ser Lys Thr Val
Val Thr 50 55 60Tyr His Ile Pro Gln Asn Ser Ser Leu Glu Asn Val Asp
Ser Arg Tyr65 70 75 80Arg Asn Arg Ala Leu Met Ser Pro Ala Gly Met
Leu Arg Gly Asp Phe 85 90 95Ser Leu Arg Leu Phe Asn Val Thr Pro Gln
Asp Glu Gln Lys Phe His 100 105 110Cys Leu Val Leu Ser Gln Ser Leu
Gly Phe Gln Glu Val Leu Ser Val 115 120 125Glu Val Thr Leu His Val
Ala Ala Asn Phe Ser Val Pro Val Val Ser 130 135 140Ala Pro His Ser
Pro Ser Gln Asp Glu Leu Thr Phe Thr Cys Thr Ser145 150 155 160Ile
Asn
Gly Tyr Pro Arg Pro Asn Val Tyr Trp Ile Asn Lys Thr Asp 165 170
175Asn Ser Leu Leu Asp Gln Ala Leu Gln Asn Asp Thr Val Phe Leu Asn
180 185 190Met Arg Gly Leu Tyr Asp Val Val Ser Val Leu Arg Ile Ala
Arg Thr 195 200 205Pro Ser Val Asn Ile Gly Cys Cys Ile Glu Asn Val
Leu Leu Gln Gln 210 215 220Asn Leu Thr Val Gly Ser Gln Thr Gly Asn
Asp Ile Gly Glu Arg Asp225 230 235 240Lys Ile Thr Glu Asn Pro Val
Ser Thr Gly Glu Lys Asn Ala Ala Thr 245 250 255Trp Ser Ile Leu Ala
Val Leu Cys Leu Leu Val Val Val Ala Val Ala 260 265 270Ile Gly Trp
Val Cys Arg Asp Arg Cys Leu Gln His Ser Tyr Ala Gly 275 280 285Ala
Trp Ala Val Ser Pro Glu Thr Glu Leu Thr Glu Ser Trp Asn Leu 290 295
300Leu Leu Leu Leu Ser3058290PRTHomo sapiens 8Met Arg Ile Phe Ala
Val Phe Ile Phe Met Thr Tyr Trp His Leu Leu 1 5 10 15Asn Ala Phe
Thr Val Thr Val Pro Lys Asp Leu Tyr Val Val Glu Tyr 20 25 30Gly Ser
Asn Met Thr Ile Glu Cys Lys Phe Pro Val Glu Lys Gln Leu 35 40 45Asp
Leu Ala Ala Leu Ile Val Tyr Trp Glu Met Glu Asp Lys Asn Ile 50 55
60Ile Gln Phe Val His Gly Glu Glu Asp Leu Lys Val Gln His Ser Ser65
70 75 80Tyr Arg Gln Arg Ala Arg Leu Leu Lys Asp Gln Leu Ser Leu Gly
Asn 85 90 95Ala Ala Leu Gln Ile Thr Asp Val Lys Leu Gln Asp Ala Gly
Val Tyr 100 105 110Arg Cys Met Ile Ser Tyr Gly Gly Ala Asp Tyr Lys
Arg Ile Thr Val 115 120 125Lys Val Asn Ala Pro Tyr Asn Lys Ile Asn
Gln Arg Ile Leu Val Val 130 135 140Asp Pro Val Thr Ser Glu His Glu
Leu Thr Cys Gln Ala Glu Gly Tyr145 150 155 160Pro Lys Ala Glu Val
Ile Trp Thr Ser Ser Asp His Gln Val Leu Ser 165 170 175Gly Lys Thr
Thr Thr Thr Asn Ser Lys Arg Glu Glu Lys Leu Phe Asn 180 185 190Val
Thr Ser Thr Leu Arg Ile Asn Thr Thr Thr Asn Glu Ile Phe Tyr 195 200
205Cys Thr Phe Arg Arg Leu Asp Pro Glu Glu Asn His Thr Ala Glu Leu
210 215 220Val Ile Pro Glu Leu Pro Leu Ala His Pro Pro Asn Glu Arg
Thr His225 230 235 240Leu Val Ile Leu Gly Ala Ile Leu Leu Cys Leu
Gly Val Ala Leu Thr 245 250 255Phe Ile Phe Arg Leu Arg Lys Gly Arg
Met Met Asp Val Lys Lys Cys 260 265 270Gly Ile Gln Asp Thr Asn Ser
Lys Lys Gln Ser Asp Thr His Leu Glu 275 280 285Glu Thr
2909526PRTHomo sapiens 9Met Ala Val Phe Pro Ser Ser Gly Leu Pro Arg
Cys Leu Leu Thr Leu 1 5 10 15Ile Leu Leu Gln Leu Pro Lys Leu Asp
Ser Ala Pro Phe Asp Val Ile 20 25 30Gly Pro Pro Glu Pro Ile Leu Ala
Val Val Gly Glu Asp Ala Glu Leu 35 40 45Pro Cys Arg Leu Ser Pro Asn
Ala Ser Ala Glu His Leu Glu Leu Arg 50 55 60Trp Phe Arg Lys Lys Val
Ser Pro Ala Val Leu Val His Arg Asp Gly65 70 75 80Arg Glu Gln Glu
Ala Glu Gln Met Pro Glu Tyr Arg Gly Arg Ala Thr 85 90 95Leu Val Gln
Asp Gly Ile Ala Lys Gly Arg Val Ala Leu Arg Ile Arg 100 105 110Gly
Val Arg Val Ser Asp Asp Gly Glu Tyr Thr Cys Phe Phe Arg Glu 115 120
125Asp Gly Ser Tyr Glu Glu Ala Leu Val His Leu Lys Val Ala Ala Leu
130 135 140Gly Ser Asp Pro His Ile Ser Met Gln Val Gln Glu Asn Gly
Glu Ile145 150 155 160Cys Leu Glu Cys Thr Ser Val Gly Trp Tyr Pro
Glu Pro Gln Val Gln 165 170 175Trp Arg Thr Ser Lys Gly Glu Lys Phe
Pro Ser Thr Ser Glu Ser Arg 180 185 190Asn Pro Asp Glu Glu Gly Leu
Phe Thr Val Ala Ala Ser Val Ile Ile 195 200 205Arg Asp Thr Ser Thr
Lys Asn Val Ser Cys Tyr Ile Gln Asn Leu Leu 210 215 220Leu Gly Gln
Glu Lys Lys Val Glu Ile Ser Ile Pro Ala Ser Ser Leu225 230 235
240Pro Arg Leu Thr Pro Trp Ile Val Ala Val Ala Val Ile Leu Met Val
245 250 255Leu Gly Leu Leu Thr Ile Gly Ser Ile Phe Phe Thr Trp Arg
Leu Tyr 260 265 270Asn Glu Arg Pro Arg Glu Arg Arg Asn Glu Phe Ser
Ser Lys Glu Arg 275 280 285Leu Leu Glu Glu Leu Lys Trp Lys Lys Ala
Thr Leu His Ala Val Asp 290 295 300Val Thr Leu Asp Pro Asp Thr Ala
His Pro His Leu Phe Leu Tyr Glu305 310 315 320Asp Ser Lys Ser Val
Arg Leu Glu Asp Ser Arg Gln Lys Leu Pro Glu 325 330 335Lys Thr Glu
Arg Phe Asp Ser Trp Pro Cys Val Leu Gly Arg Glu Thr 340 345 350Phe
Thr Ser Gly Arg His Tyr Trp Glu Val Glu Val Gly Asp Arg Thr 355 360
365Asp Trp Ala Ile Gly Val Cys Arg Glu Asn Val Met Lys Lys Gly Phe
370 375 380Asp Pro Met Thr Pro Glu Asn Gly Phe Trp Ala Val Glu Leu
Tyr Gly385 390 395 400Asn Gly Tyr Trp Ala Leu Thr Pro Leu Arg Thr
Pro Leu Pro Leu Ala 405 410 415Gly Pro Pro Arg Arg Val Gly Ile Phe
Leu Asp Tyr Glu Ser Gly Asp 420 425 430Ile Ser Phe Tyr Asn Met Asn
Asp Gly Ser Asp Ile Tyr Thr Phe Ser 435 440 445Asn Val Thr Phe Ser
Gly Pro Leu Arg Pro Phe Phe Cys Leu Trp Ser 450 455 460Ser Gly Lys
Lys Pro Leu Thr Ile Cys Pro Ile Ala Asp Gly Pro Glu465 470 475
480Arg Val Thr Val Ile Ala Asn Ala Gln Asp Leu Ser Lys Glu Ile Pro
485 490 495Leu Ser Pro Met Gly Glu Glu Ser Ala Pro Arg Asp Ala Asp
Thr Leu 500 505 510His Ser Lys Leu Ile Pro Thr Gln Pro Ser Gln Gly
Ala Pro 515 520 52510527PRTHomo sapiens 10Met Glu Ser Ala Ala Ala
Leu His Phe Ser Arg Pro Ala Ser Leu Leu 1 5 10 15Leu Leu Leu Leu
Ser Leu Cys Ala Leu Val Ser Ala Gln Phe Ile Val 20 25 30Val Gly Pro
Thr Asp Pro Ile Leu Ala Thr Val Gly Glu Asn Thr Thr 35 40 45Leu Arg
Cys His Leu Ser Pro Glu Lys Asn Ala Glu Asp Met Glu Val 50 55 60Arg
Trp Phe Arg Ser Gln Phe Ser Pro Ala Val Phe Val Tyr Lys Gly65 70 75
80Gly Arg Glu Arg Thr Glu Glu Gln Met Glu Glu Tyr Arg Gly Arg Thr
85 90 95Thr Phe Val Ser Lys Asp Ile Ser Arg Gly Ser Val Ala Leu Val
Ile 100 105 110His Asn Ile Thr Ala Gln Glu Asn Gly Thr Tyr Arg Cys
Tyr Phe Gln 115 120 125Glu Gly Arg Ser Tyr Asp Glu Ala Ile Leu His
Leu Val Val Ala Gly 130 135 140Leu Gly Ser Lys Pro Leu Ile Ser Met
Arg Gly His Glu Asp Gly Gly145 150 155 160Ile Arg Leu Glu Cys Ile
Ser Arg Gly Trp Tyr Pro Lys Pro Leu Thr 165 170 175Val Trp Arg Asp
Pro Tyr Gly Gly Val Ala Pro Ala Leu Lys Glu Val 180 185 190Ser Met
Pro Asp Ala Asp Gly Leu Phe Met Val Thr Thr Ala Val Ile 195 200
205Ile Arg Asp Lys Ser Val Arg Asn Met Ser Cys Ser Ile Asn Asn Thr
210 215 220Leu Leu Gly Gln Lys Lys Glu Ser Val Ile Phe Ile Pro Glu
Ser Phe225 230 235 240Met Pro Ser Val Ser Pro Cys Ala Val Ala Leu
Pro Ile Ile Val Val 245 250 255Ile Leu Met Ile Pro Ile Ala Val Cys
Ile Tyr Trp Ile Asn Lys Leu 260 265 270Gln Lys Glu Lys Lys Ile Leu
Ser Gly Glu Lys Glu Phe Glu Arg Glu 275 280 285Thr Arg Glu Ile Ala
Leu Lys Glu Leu Glu Lys Glu Arg Val Gln Lys 290 295 300Glu Glu Glu
Leu Gln Val Lys Glu Lys Leu Gln Glu Glu Leu Arg Trp305 310 315
320Arg Arg Thr Phe Leu His Ala Val Asp Val Val Leu Asp Pro Asp Thr
325 330 335Ala His Pro Asp Leu Phe Leu Ser Glu Asp Arg Arg Ser Val
Arg Arg 340 345 350Cys Pro Phe Arg His Leu Gly Glu Ser Val Pro Asp
Asn Pro Glu Arg 355 360 365Phe Asp Ser Gln Pro Cys Val Leu Gly Arg
Glu Ser Phe Ala Ser Gly 370 375 380Lys His Tyr Trp Glu Val Glu Val
Glu Asn Val Ile Glu Trp Thr Val385 390 395 400Gly Val Cys Arg Asp
Ser Val Glu Arg Lys Gly Glu Val Leu Leu Ile 405 410 415Pro Gln Asn
Gly Phe Trp Thr Leu Glu Met His Lys Gly Gln Tyr Arg 420 425 430Ala
Val Ser Ser Pro Asp Arg Ile Leu Pro Leu Lys Glu Ser Leu Cys 435 440
445Arg Val Gly Val Phe Leu Asp Tyr Glu Ala Gly Asp Val Ser Phe Tyr
450 455 460Asn Met Arg Asp Arg Ser His Ile Tyr Thr Cys Pro Arg Ser
Ala Phe465 470 475 480Ser Val Pro Val Arg Pro Phe Phe Arg Leu Gly
Cys Glu Asp Ser Pro 485 490 495Ile Phe Ile Cys Pro Ala Leu Thr Gly
Ala Asn Gly Val Thr Val Pro 500 505 510Glu Glu Gly Leu Thr Leu His
Arg Val Gly Thr His Gln Ser Leu 515 520 52511523PRTHomo sapiens
11Met Glu Pro Ala Ala Ala Leu His Phe Ser Leu Pro Ala Ser Leu Leu 1
5 10 15Leu Leu Leu Leu Leu Leu Leu Leu Ser Leu Cys Ala Leu Val Ser
Ala 20 25 30Gln Phe Thr Val Val Gly Pro Ala Asn Pro Ile Leu Ala Met
Val Gly 35 40 45Glu Asn Thr Thr Leu Arg Cys His Leu Ser Pro Glu Lys
Asn Ala Glu 50 55 60Asp Met Glu Val Arg Trp Phe Arg Ser Gln Phe Ser
Pro Ala Val Phe65 70 75 80Val Tyr Lys Gly Gly Arg Glu Arg Thr Glu
Glu Gln Met Glu Glu Tyr 85 90 95Arg Gly Arg Ile Thr Phe Val Ser Lys
Asp Ile Asn Arg Gly Ser Val 100 105 110Ala Leu Val Ile His Asn Val
Thr Ala Gln Glu Asn Gly Ile Tyr Arg 115 120 125Cys Tyr Phe Gln Glu
Gly Arg Ser Tyr Asp Glu Ala Ile Leu Arg Leu 130 135 140Val Val Ala
Gly Leu Gly Ser Lys Pro Leu Ile Glu Ile Lys Ala Gln145 150 155
160Glu Asp Gly Ser Ile Trp Leu Glu Cys Ile Ser Gly Gly Trp Tyr Pro
165 170 175Glu Pro Leu Thr Val Trp Arg Asp Pro Tyr Gly Glu Val Val
Pro Ala 180 185 190Leu Lys Glu Val Ser Ile Ala Asp Ala Asp Gly Leu
Phe Met Val Thr 195 200 205Thr Ala Val Ile Ile Arg Asp Lys Tyr Val
Arg Asn Val Ser Cys Ser 210 215 220Val Asn Asn Thr Leu Leu Gly Gln
Glu Lys Glu Thr Val Ile Phe Ile225 230 235 240Pro Glu Ser Phe Met
Pro Ser Ala Ser Pro Trp Met Val Ala Leu Ala 245 250 255Val Ile Leu
Thr Ala Ser Pro Trp Met Val Ser Met Thr Val Ile Leu 260 265 270Ala
Val Phe Ile Ile Phe Met Ala Val Ser Ile Cys Cys Ile Lys Lys 275 280
285Leu Gln Arg Glu Lys Lys Ile Leu Ser Gly Glu Lys Lys Val Glu Gln
290 295 300Glu Glu Lys Glu Ile Ala Gln Gln Leu Gln Glu Glu Leu Arg
Trp Arg305 310 315 320Arg Thr Phe Leu His Ala Ala Asp Val Val Leu
Asp Pro Asp Thr Ala 325 330 335His Pro Glu Leu Phe Leu Ser Glu Asp
Arg Arg Ser Val Arg Arg Gly 340 345 350Pro Tyr Arg Gln Arg Val Pro
Asp Asn Pro Glu Arg Phe Asp Ser Gln 355 360 365Pro Cys Val Leu Gly
Trp Glu Ser Phe Ala Ser Gly Lys His Tyr Trp 370 375 380Glu Val Glu
Val Glu Asn Val Met Val Trp Thr Val Gly Val Cys Arg385 390 395
400His Ser Val Glu Arg Lys Gly Glu Val Leu Leu Ile Pro Gln Asn Gly
405 410 415Phe Trp Thr Leu Glu Met Phe Gly Asn Gln Tyr Arg Ala Leu
Ser Ser 420 425 430Pro Glu Arg Ile Leu Pro Leu Lys Glu Ser Leu Cys
Arg Val Gly Val 435 440 445Phe Leu Asp Tyr Glu Ala Gly Asp Val Ser
Phe Tyr Asn Met Arg Asp 450 455 460Arg Ser His Ile Tyr Thr Cys Pro
Arg Ser Ala Phe Thr Val Pro Val465 470 475 480Arg Pro Phe Phe Arg
Leu Gly Ser Asp Asp Ser Pro Ile Phe Ile Cys 485 490 495Pro Ala Leu
Thr Gly Ala Ser Gly Val Met Val Pro Glu Glu Gly Leu 500 505 510Lys
Leu His Arg Val Gly Thr His Gln Ser Leu 515 52012319PRTHomo sapiens
12Met Lys Met Ala Ser Ser Leu Ala Phe Leu Leu Leu Asn Phe His Val 1
5 10 15Ser Leu Leu Leu Val Gln Leu Leu Thr Pro Cys Ser Ala Gln Phe
Ser 20 25 30Val Leu Gly Pro Ser Gly Pro Ile Leu Ala Met Val Gly Glu
Asp Ala 35 40 45Asp Leu Pro Cys His Leu Phe Pro Thr Met Ser Ala Glu
Thr Met Glu 50 55 60Leu Lys Trp Val Ser Ser Ser Leu Arg Gln Val Val
Asn Val Tyr Ala65 70 75 80Asp Gly Lys Glu Val Glu Asp Arg Gln Ser
Ala Pro Tyr Arg Gly Arg 85 90 95Thr Ser Ile Leu Arg Asp Gly Ile Thr
Ala Gly Lys Ala Ala Leu Arg 100 105 110Ile His Asn Val Thr Ala Ser
Asp Ser Gly Lys Tyr Leu Cys Tyr Phe 115 120 125Gln Asp Gly Asp Phe
Tyr Glu Lys Ala Leu Val Glu Leu Lys Val Ala 130 135 140Ala Leu Gly
Ser Asn Leu His Val Glu Val Lys Gly Tyr Glu Asp Gly145 150 155
160Gly Ile His Leu Glu Cys Arg Ser Thr Gly Trp Tyr Pro Gln Pro Gln
165 170 175Ile Gln Trp Ser Asn Ala Lys Gly Glu Asn Ile Pro Ala Val
Glu Ala 180 185 190Pro Val Val Ala Asp Gly Val Gly Leu Tyr Glu Val
Ala Ala Ser Val 195 200 205Ile Met Arg Gly Gly Ser Gly Glu Gly Val
Ser Cys Ile Ile Arg Asn 210 215 220Ser Leu Leu Gly Leu Glu Lys Thr
Ala Ser Ile Ser Ile Ala Asp Pro225 230 235 240Phe Phe Arg Ser Ala
Gln Pro Trp Ile Ala Ala Leu Ala Gly Thr Leu 245 250 255Pro Ile Leu
Leu Leu Leu Leu Ala Gly Ala Ser Tyr Phe Leu Trp Arg 260 265 270Gln
Gln Lys Glu Ile Thr Ala Leu Ser Ser Glu Ile Glu Ser Glu Gln 275 280
285Glu Met Lys Glu Met Gly Tyr Ala Ala Thr Glu Arg Glu Ile Ser Leu
290 295 300Arg Glu Ser Leu Gln Glu Glu Leu Lys Arg Lys Lys Ser Ser
Thr305 310 31513529PRTHomo sapiens 13Met Glu Ser Ala Ala Ala Leu
His Phe Ser Arg Pro Ala Ser Leu Leu 1 5 10 15Leu Leu Leu Leu Ser
Leu Cys Ala Leu Val Ser Ala His Phe Ile Val 20 25 30Val Gly Pro Thr
Asp Pro Ile Leu Ala Thr Val Gly Glu Asn Thr Thr 35 40 45Leu Arg Cys
His Leu Ser Pro Glu Lys Asn Ala Glu Asp Met Glu Val 50 55 60Arg Trp
Phe Arg Ser Gln Phe Ser Pro Ala Val Phe Val Tyr Lys Gly65 70 75
80Gly Arg Glu Arg Thr Glu Glu Gln Met Glu Glu Tyr Arg Gly Arg Thr
85 90 95Thr Phe Val Ser Lys Asp Ile Ser Arg Gly Ser Val Ala Leu Val
Ile 100 105 110His Asn Ile Thr Ala Gln Gly Asn Gly Thr Tyr Arg Cys
Tyr Phe Gln 115 120
125Glu Gly Arg Ser Tyr Asp Glu Ala Ile Leu His Leu Val Val Ala Glu
130 135 140Arg Leu Gly Ser Lys Pro Leu Ile Ser Met Arg Gly His Glu
Asp Gly145 150 155 160Gly Ile Arg Leu Glu Cys Ile Ser Arg Gly Trp
Tyr Pro Lys Pro Leu 165 170 175Thr Val Trp Arg Asp Pro Tyr Gly Gly
Val Ala Pro Ala Leu Lys Glu 180 185 190Val Ser Met Pro Asp Ala Asp
Gly Leu Phe Met Val Thr Thr Ala Val 195 200 205Ile Ile Arg Asp Lys
Ser Val Arg Asn Met Ser Cys Ser Ile Asn Asn 210 215 220Thr Leu Leu
Gly Gln Lys Lys Glu Ser Val Ile Phe Ile Pro Glu Ser225 230 235
240Phe Met Pro Ser Val Ser Pro Leu Ala Val Cys Ile Tyr Trp Ile Asn
245 250 255Lys Leu Gln Lys Glu Lys Lys Ile Leu Ser Gly Glu Lys Glu
Phe Glu 260 265 270Arg Glu Thr Arg Glu Ile Ala Leu Lys Glu Leu Glu
Lys Glu Arg Val 275 280 285Gln Lys Glu Glu Glu Leu Gln Val Lys Glu
Lys Leu Gln Glu Glu Leu 290 295 300Arg Trp Arg Arg Thr Phe Leu His
Ala Val Asp Val Val Leu Asp Pro305 310 315 320Asp Thr Ala His Pro
Asp Leu Phe Leu Ser Glu Asp Arg Arg Ser Val 325 330 335Arg Arg Cys
Pro Phe Arg His Leu Gly Glu Ser Val Pro Asp Asn Pro 340 345 350Glu
Arg Phe Asp Ser Gln Pro Cys Val Leu Gly Arg Glu Ser Phe Ala 355 360
365Ser Gly Lys His Tyr Trp Glu Val Glu Val Glu Asn Val Ile Glu Trp
370 375 380Thr Val Gly Val Cys Arg Asp Ser Val Glu Arg Lys Gly Glu
Val Leu385 390 395 400Leu Ile Pro Gln Asn Gly Phe Trp Thr Leu Glu
Met His Lys Gly Gln 405 410 415Tyr Arg Ala Val Ser Ser Pro Asp Arg
Ile Leu Pro Leu Lys Glu Ser 420 425 430Leu Cys Arg Val Gly Val Phe
Leu Asp Tyr Glu Ala Gly Asp Val Ser 435 440 445Phe Tyr Asn Met Arg
Asp Arg Ser His Ile Tyr Thr Cys Pro Arg Ser 450 455 460Ala Phe Ser
Gly Pro Asp Thr Ser Gln Ser Gly Asp Pro Pro Glu Pro465 470 475
480Ile Glu Ser Ile Pro Trp Ser His Ser His Val Asp Lys Pro Trp Ser
485 490 495Phe Gln Gln Pro Pro His Asn Thr His Leu Pro Ala Ala Ser
Phe Thr 500 505 510Pro Thr Thr Asp Leu Ser Pro Ser Phe Leu Leu Leu
Thr Arg Leu Cys 515 520 525Phe14357PRTHomo sapiens 14Met Ala Ser
Ser Leu Ala Phe Leu Leu Leu Asn Phe His Val Ser Leu 1 5 10 15Leu
Leu Val Gln Leu Leu Thr Pro Cys Ser Ala Gln Phe Ser Val Leu 20 25
30Gly Pro Ser Gly Pro Ile Leu Ala Met Val Gly Glu Asp Ala Asp Leu
35 40 45Pro Cys His Leu Phe Pro Thr Met Ser Ala Glu Thr Met Glu Leu
Lys 50 55 60Trp Val Ser Ser Ser Leu Arg Gln Val Val Asn Val Tyr Ala
Asp Gly65 70 75 80Lys Glu Val Glu Asp Arg Gln Ser Ala Pro Tyr Arg
Gly Arg Thr Ser 85 90 95Ile Leu Arg Asp Gly Ile Thr Ala Gly Lys Ala
Ala Leu Arg Ile His 100 105 110Asn Val Thr Ala Ser Asp Ser Gly Lys
Tyr Leu Cys Tyr Phe Gln Asp 115 120 125Gly Asp Phe Tyr Glu Lys Ala
Leu Val Glu Leu Lys Val Ala Ala Leu 130 135 140Gly Ser Asn Leu His
Val Glu Val Lys Gly Tyr Glu Asp Gly Gly Ile145 150 155 160His Leu
Glu Cys Arg Ser Thr Gly Trp Tyr Pro Gln Pro Gln Ile Gln 165 170
175Trp Ser Asn Ala Lys Gly Glu Asn Ile Pro Ala Val Glu Ala Pro Val
180 185 190Val Ala Asp Gly Val Gly Leu Tyr Glu Val Ala Ala Ser Val
Ile Met 195 200 205Arg Gly Gly Ser Gly Glu Gly Val Ser Cys Ile Ile
Arg Asn Ser Leu 210 215 220Leu Gly Leu Glu Lys Thr Ala Ser Ile Ser
Ile Ala Asp Pro Phe Phe225 230 235 240Arg Ser Ala Gln Pro Trp Ile
Ala Ala Leu Ala Gly Thr Leu Pro Ile 245 250 255Leu Leu Leu Leu Leu
Ala Gly Ala Ser Tyr Phe Leu Trp Arg Gln Gln 260 265 270Lys Glu Ile
Thr Ala Leu Ser Ser Glu Ile Glu Ser Glu Gln Glu Met 275 280 285Lys
Glu Met Gly Tyr Ala Ala Thr Glu Arg Glu Ile Ser Leu Arg Glu 290 295
300Ser Leu Gln Glu Glu Leu Lys Arg Lys Lys Ile Gln Tyr Leu Thr
Arg305 310 315 320Gly Glu Glu Ser Leu Ser Asp Thr Asn Lys Ser Ala
Leu Met Leu Lys 325 330 335Trp Lys Lys Ala Leu Phe Lys Pro Gly Glu
Glu Met Leu Gln Met Arg 340 345 350Leu His Leu Val Lys
35515731PRTHomo sapiensVARIANT(1)...(731)Xaa = Any Amino Acid 15Met
Ala Ser Ser Leu Ala Phe Leu Leu Leu Asn Phe His Val Ser Leu 1 5 10
15Phe Leu Val Gln Leu Leu Thr Pro Cys Ser Ala Gln Phe Ser Val Leu
20 25 30Gly Pro Ser Gly Pro Ile Leu Ala Met Val Gly Glu Asp Ala Asp
Leu 35 40 45Pro Cys His Leu Phe Pro Thr Met Ser Ala Glu Thr Met Glu
Leu Arg 50 55 60Trp Val Ser Ser Ser Leu Arg Gln Val Val Asn Val Tyr
Ala Asp Gly65 70 75 80Lys Glu Val Glu Tyr Arg Gln Ser Ala Pro Tyr
Arg Gly Arg Thr Ser 85 90 95Ile Leu Arg Asp Gly Ile Thr Ala Gly Lys
Ala Ala Leu Arg Ile His 100 105 110Asn Val Thr Ala Ser Asp Ser Gly
Lys Tyr Leu Cys Tyr Phe Gln His 115 120 125Gly Asp Phe Tyr Glu Lys
Ala Pro Val Glu Leu Lys Val Ala Ala Leu 130 135 140Gly Ser Asp Leu
His Ile Glu Val Lys Gly Tyr Asp Asp Gly Gly Ile145 150 155 160His
Leu Glu Cys Arg Ser Thr Gly Trp Tyr Pro Gln Pro Gln Ile Asn 165 170
175Trp Ser Asp Ser Lys Gly Glu Asn Ile Pro Ala Val Glu Gly Pro Val
180 185 190Asn Val Tyr Gly Val Gly Leu Tyr Ala Val Pro Pro Pro Val
Ile Met 195 200 205Thr Gly Thr Ser Gly Gly Gly Val Ser Cys Ile Ile
Thr Asn Ser Leu 210 215 220Leu Gly Leu Glu Lys Thr Ala Ser Ile Ser
Ile Ala Asp Pro Phe Ile225 230 235 240Gln Gly Gly Ala Pro Ala Arg
Xaa Xaa Xaa Gly Pro Gly Xaa Gly Thr 245 250 255Leu Ala Tyr Phe Xaa
Val Ala Xaa Ser Trp Gln Gly Ala Ser Tyr Phe 260 265 270Leu Trp Arg
Gln Gln Lys Glu Xaa Ile Gly Leu Ser Arg Glu Thr Glu 275 280 285Arg
Glu Arg Glu Met Lys Glu Met Gly Tyr Xaa Ala Thr Glu Gln Glu 290 295
300Ile Ser Ala Lys Arg Ser Leu Gln Glu Glu Leu Lys Trp Arg Lys
Ile305 310 315 320Gln Tyr Met Ala Arg Gly Glu Glu Ser Ser Ser Asp
Thr Lys Lys Ser 325 330 335Ala Leu Met Leu Lys Trp Lys Lys Ala Leu
Phe Lys Pro Gly Asp Lys 340 345 350Met Leu Gln Met Arg Val Ser Pro
Cys Lys Ile Asn Trp Met Tyr Ser 355 360 365Lys Ile Tyr Cys Arg Lys
Gly Glu Leu Ile Lys Phe Ile Ser Gly Arg 370 375 380Val Lys Ile Glu
Asn Lys Pro Leu Ser Ile Lys His Gln Trp Ala Xaa385 390 395 400Ser
Met Trp Gly Gly Lys Gln Gln Lys Cys Xaa Lys Arg Ile Leu Val 405 410
415Ala Ser Trp Gly Arg Ile Arg Val Leu Gly Lys Ala Xaa Thr Asp Leu
420 425 430Thr Phe Ile Ser Pro Leu Val Thr Arg Pro Leu Gly Leu Ser
Pro Met 435 440 445Thr Leu Met Arg Glu Ser His Ser Gly Gln Ala Arg
Asp Thr Gly Phe 450 455 460Trp Lys Asp Leu Leu Ser Met Ala Gln Ala
Leu His Ala Val Ala Leu465 470 475 480Lys Ser Arg Lys Asn Gly Arg
Pro His Gly His Leu Leu Lys Leu Ser 485 490 495Ala Ala Asp Val Ile
Leu Tyr Pro Asp Met Ala Asn Ala Ile Leu Leu 500 505 510Val Ser Glu
Asp Gln Arg Ser Val Gln Arg Ala Glu Glu Pro His Asp 515 520 525Leu
Pro Asp Asn Pro Glu Arg Phe Glu Trp Arg Tyr Cys Val Leu Gly 530 535
540Cys Glu Ser Phe Met Ser Glu Arg His Tyr Trp Glu Val Glu Val
Gly545 550 555 560Asp Arg Lys Glu Trp His Ile Gly Val Cys Ser Lys
Asn Val Glu Arg 565 570 575Lys Lys Val Trp Val Lys Met Thr Pro Glu
Asn Gly Tyr Trp Thr Met 580 585 590Gly Leu Thr Asp Gly Asn Lys Tyr
Arg Ala Leu Thr Glu Pro Arg Thr 595 600 605Asn Leu Lys Leu Pro Glu
Pro Pro Arg Lys Val Gly Val Ile Leu Asp 610 615 620Tyr Glu Thr Gly
His Ile Ser Phe Tyr Asn Ala Thr Asp Gly Ser His625 630 635 640Ile
Tyr Thr Phe Leu His Ala Ser Ser Ser Glu Pro Leu Tyr Pro Val 645 650
655Phe Arg Ile Leu Thr Leu Glu Pro Thr Ala Leu Thr Val Cys Pro Ile
660 665 670Pro Lys Val Glu Ser Ser Pro Asp Pro Asp Leu Val Pro Asp
His Ser 675 680 685Leu Glu Ile Pro Leu Thr Pro Gly Leu Ala Asn Glu
Ser Gly Glu Pro 690 695 700Gln Ala Glu Val Thr Ser Leu Leu Leu Pro
Ala Gln Pro Gly Ala Lys705 710 715 720Gly Leu Thr Leu His Asn Ser
Gln Ser Glu Pro 725 73016584PRTHomo sapiens 16Met Lys Met Ala Ser
Ser Leu Ala Phe Leu Leu Leu Asn Phe His Val 1 5 10 15Ser Leu Phe
Leu Val Gln Leu Leu Thr Pro Cys Ser Ala Gln Phe Ser 20 25 30Val Leu
Gly Pro Ser Gly Pro Ile Leu Ala Met Val Gly Glu Asp Ala 35 40 45Asp
Leu Pro Cys His Leu Phe Pro Thr Met Ser Ala Glu Thr Met Glu 50 55
60Leu Arg Trp Val Ser Ser Ser Leu Arg Gln Val Val Asn Val Tyr Ala65
70 75 80Asp Gly Lys Glu Val Glu Asp Arg Gln Ser Ala Pro Tyr Arg Gly
Arg 85 90 95Thr Ser Ile Leu Arg Asp Gly Ile Thr Ala Gly Lys Ala Ala
Leu Arg 100 105 110Ile His Asn Val Thr Ala Ser Asp Ser Gly Lys Tyr
Leu Cys Tyr Phe 115 120 125Gln Asp Gly Asp Phe Tyr Glu Lys Ala Leu
Val Glu Leu Lys Val Ala 130 135 140Ala Leu Gly Ser Asp Leu His Ile
Glu Val Lys Gly Tyr Glu Asp Gly145 150 155 160Gly Ile His Leu Glu
Cys Arg Ser Thr Gly Trp Tyr Pro Gln Pro Gln 165 170 175Ile Lys Trp
Ser Asp Thr Lys Gly Glu Asn Ile Pro Ala Val Glu Ala 180 185 190Pro
Val Val Ala Asp Gly Val Gly Leu Tyr Ala Val Ala Ala Ser Val 195 200
205Ile Met Arg Gly Ser Ser Gly Gly Gly Val Ser Cys Ile Ile Arg Asn
210 215 220Ser Leu Leu Gly Leu Glu Lys Thr Ala Ser Ile Ser Ile Ala
Asp Pro225 230 235 240Phe Phe Arg Ser Ala Gln Pro Trp Ile Ala Ala
Leu Ala Gly Thr Leu 245 250 255Pro Ile Ser Leu Leu Leu Leu Ala Gly
Ala Ser Tyr Phe Leu Trp Arg 260 265 270Gln Gln Lys Glu Lys Ile Ala
Leu Ser Arg Glu Thr Glu Arg Glu Arg 275 280 285Glu Met Lys Glu Met
Gly Tyr Ala Ala Thr Glu Gln Glu Ile Ser Leu 290 295 300Arg Glu Lys
Leu Gln Glu Glu Leu Lys Trp Arg Lys Ile Gln Tyr Met305 310 315
320Ala Arg Gly Glu Lys Ser Leu Ala Tyr His Glu Trp Lys Met Ala Leu
325 330 335Phe Lys Pro Ala Asp Val Ile Leu Asp Pro Asp Thr Ala Asn
Ala Ile 340 345 350Leu Leu Val Ser Glu Asp Gln Arg Ser Val Gln Arg
Ala Glu Glu Pro 355 360 365Arg Asp Leu Pro Asp Asn Pro Glu Arg Phe
Glu Trp Arg Tyr Cys Val 370 375 380Leu Gly Cys Glu Asn Phe Thr Ser
Gly Arg His Tyr Trp Glu Val Glu385 390 395 400Val Gly Asp Arg Lys
Glu Trp His Ile Gly Val Cys Ser Lys Asn Val 405 410 415Glu Arg Lys
Lys Gly Trp Val Lys Met Thr Pro Glu Asn Gly Tyr Trp 420 425 430Thr
Met Gly Leu Thr Asp Gly Asn Lys Tyr Arg Ala Leu Thr Glu Pro 435 440
445Arg Thr Asn Leu Lys Leu Pro Glu Pro Pro Arg Lys Val Gly Ile Phe
450 455 460Leu Asp Tyr Glu Thr Gly Glu Ile Ser Phe Tyr Asn Ala Thr
Asp Gly465 470 475 480Ser His Ile Tyr Thr Phe Pro His Ala Ser Phe
Ser Glu Pro Leu Tyr 485 490 495Pro Val Phe Arg Ile Leu Thr Leu Glu
Pro Thr Ala Leu Thr Ile Cys 500 505 510Pro Ile Pro Lys Glu Val Glu
Ser Ser Pro Asp Pro Asp Leu Val Pro 515 520 525Asp His Ser Leu Glu
Thr Pro Leu Thr Pro Gly Leu Ala Asn Glu Ser 530 535 540Gly Glu Pro
Gln Ala Glu Val Thr Ser Leu Leu Leu Pro Ala His Pro545 550 555
560Gly Ala Glu Val Ser Pro Ser Ala Thr Thr Asn Gln Asn His Lys Leu
565 570 575Gln Ala Arg Thr Glu Ala Leu Tyr 58017350PRTHomo sapiens
17Met Ala Ser Phe Leu Ala Phe Leu Leu Leu Asn Phe Arg Val Cys Leu 1
5 10 15Leu Leu Leu Gln Leu Leu Met Pro His Ser Ala Gln Phe Ser Val
Leu 20 25 30Gly Pro Ser Gly Pro Ile Leu Ala Met Val Gly Glu Asp Ala
Asp Leu 35 40 45Pro Cys His Leu Phe Pro Thr Met Ser Ala Glu Thr Met
Glu Leu Lys 50 55 60Trp Val Ser Ser Ser Leu Arg Gln Val Val Asn Val
Tyr Ala Asp Gly65 70 75 80Lys Glu Val Glu Asp Arg Gln Ser Ala Pro
Tyr Arg Gly Arg Thr Ser 85 90 95Ile Leu Arg Asp Gly Ile Thr Ala Gly
Lys Ala Ala Phe Arg Ile His 100 105 110Asn Val Thr Gly Ser Asp Arg
Trp Lys Tyr Leu Cys Tyr Phe Gln Asp 115 120 125Gly Asp Phe Tyr Glu
Lys Ala Leu Val Glu Leu Lys Val Ala Ala Leu 130 135 140Gly Ser Asp
Leu His Val Asp Val Lys Gly Tyr Lys Asp Gly Gly Ile145 150 155
160His Leu Glu Cys Arg Ser Thr Gly Trp Tyr Pro Gln Pro Gln Ile Gln
165 170 175Trp Ser Asn Asn Lys Gly Glu Asn Ile Pro Thr Val Glu Ala
Pro Val 180 185 190Val Ala Asp Gly Val Gly Leu Tyr Ala Val Ala Ala
Ser Val Ile Met 195 200 205Arg Gly Ser Ser Gly Glu Gly Val Ser Cys
Thr Ile Arg Asn Ser Leu 210 215 220Leu Gly Leu Glu Lys Thr Ala Ser
Ile Ser Ile Ala Arg Pro Phe Phe225 230 235 240Arg Ser Ala Gln Arg
Trp Ile Ala Ala Leu Ala Gly Thr Leu Pro Val 245 250 255Leu Leu Leu
Leu Leu Gly Gly Ala Gly Tyr Phe Leu Trp Gln Gln Gln 260 265 270Glu
Glu Lys Lys Thr Gln Phe Arg Lys Lys Lys Arg Glu Gln Glu Leu 275 280
285Arg Glu Met Ala Trp Ser Thr Met Lys Gln Glu Gln Ser Thr Arg Val
290 295 300Lys Leu Leu Glu Glu Leu Arg Trp Arg Ser Ile Gln Tyr Ala
Ser Arg305 310 315 320Gly Glu Arg His Ser Ala Tyr Asn Glu Trp Lys
Lys Ala Leu Phe Lys 325 330 335Pro Gly Glu Glu Met Leu Gln Met Arg
Leu His Phe Val Lys 340 345 35018513PRTHomo sapiens 18Met Lys Met
Ala Ser Phe Leu Ala Phe Leu Leu Leu Asn Phe Arg Val 1 5 10 15Cys
Leu Leu Leu Leu Gln Leu Leu Met Pro His Ser Ala Gln Phe Ser 20
25
30Val Leu Gly Pro Ser Gly Pro Ile Leu Ala Met Val Gly Glu Asp Ala
35 40 45Asp Leu Pro Cys His Leu Phe Pro Thr Met Ser Ala Glu Thr Met
Glu 50 55 60Leu Lys Trp Val Ser Ser Ser Leu Arg Gln Val Val Asn Val
Tyr Ala65 70 75 80Asp Gly Lys Glu Val Glu Asp Arg Gln Ser Ala Pro
Tyr Arg Gly Arg 85 90 95Thr Ser Ile Leu Arg Asp Gly Ile Thr Ala Gly
Lys Ala Ala Leu Arg 100 105 110Ile His Asn Val Thr Ala Ser Asp Ser
Gly Lys Tyr Leu Cys Tyr Phe 115 120 125Gln Asp Gly Asp Phe Tyr Glu
Lys Ala Leu Val Glu Leu Lys Val Ala 130 135 140Ala Leu Gly Ser Asp
Leu His Val Asp Val Lys Gly Tyr Lys Asp Gly145 150 155 160Gly Ile
His Leu Glu Cys Arg Ser Thr Gly Trp Tyr Pro Gln Pro Gln 165 170
175Ile Gln Trp Ser Asn Asn Lys Gly Glu Asn Ile Pro Thr Val Glu Ala
180 185 190Pro Val Val Ala Asp Gly Val Gly Leu Tyr Ala Val Ala Ala
Ser Val 195 200 205Ile Met Arg Gly Ser Ser Gly Glu Gly Val Ser Cys
Thr Ile Arg Ser 210 215 220Ser Leu Leu Gly Leu Glu Lys Thr Ala Ser
Ile Ser Ile Ala Asp Pro225 230 235 240Phe Phe Arg Ser Ala Gln Arg
Trp Ile Ala Ala Leu Ala Arg Thr Leu 245 250 255Pro Val Leu Leu Leu
Leu Leu Gly Gly Ala Gly Tyr Phe Leu Trp Gln 260 265 270Gln Gln Glu
Glu Lys Lys Thr Gln Phe Arg Lys Lys Lys Arg Glu Gln 275 280 285Glu
Leu Arg Glu Met Ala Trp Ser Thr Met Lys Gln Glu Gln Ser Thr 290 295
300Arg Val Lys Leu Leu Glu Glu Leu Arg Trp Arg Ser Ile Gln Tyr
Ala305 310 315 320Ser Arg Gly Glu Arg His Ser Ala Tyr Asn Glu Trp
Lys Lys Ala Leu 325 330 335Phe Lys Pro Ala Asp Val Ile Leu Asp Pro
Lys Thr Ala Asn Pro Ile 340 345 350Leu Leu Val Ser Glu Asp Gln Arg
Ser Val Gln Arg Ala Lys Glu Pro 355 360 365Gln Asp Leu Pro Asp Asn
Pro Glu Arg Phe Asn Trp His Tyr Cys Val 370 375 380Leu Gly Cys Glu
Ser Phe Ile Ser Gly Arg His Tyr Trp Glu Val Glu385 390 395 400Val
Gly Asp Arg Lys Glu Trp His Ile Gly Val Cys Ser Lys Asn Val 405 410
415Gln Arg Lys Gly Trp Val Lys Met Thr Pro Glu Asn Gly Phe Trp Thr
420 425 430Met Gly Leu Thr Asp Gly Asn Lys Tyr Arg Thr Leu Thr Glu
Pro Arg 435 440 445Thr Asn Leu Lys Leu Pro Lys Pro Pro Lys Lys Val
Gly Val Phe Leu 450 455 460Asp Tyr Glu Thr Gly Asp Ile Ser Phe Tyr
Asn Ala Val Asp Gly Ser465 470 475 480His Ile His Thr Phe Leu Asp
Val Ser Phe Ser Glu Ala Leu Tyr Pro 485 490 495Val Phe Arg Ile Leu
Thr Leu Glu Pro Thr Ala Leu Ser Ile Cys Pro 500 505
510Ala19290PRTHomo sapiens 19Met Ala Ser Phe Leu Ala Phe Leu Leu
Leu Asn Phe Arg Val Cys Leu 1 5 10 15Leu Leu Leu Gln Leu Leu Met
Pro His Ser Ala Gln Phe Ser Val Leu 20 25 30Gly Pro Ser Gly Pro Ile
Leu Ala Met Val Gly Glu Asp Ala Asp Leu 35 40 45Pro Cys His Leu Phe
Pro Thr Met Ser Ala Glu Thr Met Glu Leu Lys 50 55 60Trp Val Ser Ser
Ser Leu Arg Gln Val Val Asn Val Tyr Ala Asp Gly65 70 75 80Lys Glu
Val Glu Asp Arg Gln Ser Ala Pro Tyr Arg Gly Arg Thr Ser 85 90 95Ile
Leu Arg Asp Gly Ile Thr Ala Gly Lys Ala Ala Phe Arg Ile His 100 105
110Asn Val Thr Gly Ser Asp Arg Trp Lys Tyr Leu Cys Tyr Phe Gln Asp
115 120 125Gly Asp Phe Tyr Glu Lys Ala Leu Val Glu Leu Lys Val Ala
Ala Leu 130 135 140Gly Ser Asp Leu His Val Asp Val Lys Gly Tyr Lys
Asp Gly Gly Ile145 150 155 160His Leu Glu Cys Arg Ser Thr Gly Trp
Tyr Pro Gln Pro Gln Ile Gln 165 170 175Trp Ser Asn Asn Lys Gly Glu
Asn Ile Pro Thr Val Glu Ala Pro Val 180 185 190Val Ala Asp Gly Val
Gly Leu Tyr Ala Val Ala Ala Ser Val Ile Met 195 200 205Arg Gly Ser
Ser Gly Glu Gly Val Ser Cys Thr Ile Arg Asn Ser Leu 210 215 220Leu
Gly Leu Glu Lys Thr Ala Ser Ile Ser Ile Ala Arg Pro Phe Phe225 230
235 240Arg Ser Ala Gln Arg Trp Ile Ala Ala Leu Ala Gly Thr Leu Pro
Val 245 250 255Leu Leu Leu Leu Leu Gly Gly Ala Gly Tyr Phe Leu Trp
Gln Gln Gln 260 265 270Glu Glu Lys Lys Thr Gln Phe Arg Lys Lys Lys
Arg Glu Gln Glu Leu 275 280 285Arg Glu 29020819DNAHomo sapiens
20atgatcttcc tcctgctaat gttgagcctg gaattgcagc ttcaccagat agcagcttta
60ttcacagtga cagtccctaa ggaactgtac ataatagagc atggcagcaa tgtgaccctg
120gaatgcaact ttgacactgg aagtcatgtg aaccttggag caataacagc
cagtttgcaa 180aaggtggaaa atgatacatc cccacaccgt gaaagagcca
ctttgctgga ggagcagctg 240cccctaggga aggcctcgtt ccacatacct
caagtccaag tgagggacga aggacagtac 300caatgcataa tcatctatgg
ggtcgcctgg gactacaagt acctgactct gaaagtcaaa 360gcttcctaca
ggaaaataaa cactcacatc ctaaaggttc cagaaacaga tgaggtagag
420ctcacctgcc aggctacagg ttatcctctg gcagaagtat cctggccaaa
cgtcagcgtt 480cctgccaaca ccagccactc caggacccct gaaggcctct
accaggtcac cagtgttctg 540cgcctaaagc caccccctgg cagaaacttc
agctgtgtgt tctggaatac tcacgtgagg 600gaacttactt tggccagcat
tgaccttcaa agtcagatgg aacccaggac ccatccaact 660tggctgcttc
acattttcat cccctcctgc atcattgctt tcattttcat agccacagtg
720atagccctaa gaaaacaact ctgtcaaaag ctgtattctt caaaagacac
aacaaaaaga 780cctgtcacca caacaaagag ggaagtgaac agtgctatc
81921549DNAHomo sapiens 21atgatcttcc tcctgctaat gttgagcctg
gaattgcagc ttcaccagat agcagcttta 60ttcacagtga cagtccctaa ggaactgtac
ataatagagc atggcagcaa tgtgaccctg 120gaatgcaact ttgacactgg
aagtcatgtg aaccttggag caataacagc cagtttgcaa 180aaggtggaaa
atgatacatc cccacaccgt gaaagagcca ctttgctgga ggagcagctg
240cccctaggga aggcctcgtt ccacatacct caagtccaag tgagggacga
aggacagtac 300caatgcataa tcatctatgg ggtcgcctgg gactacaagt
acctgactct gaaagtcaaa 360ggtcagatgg aacccaggac ccatccaact
tggctgcttc acattttcat cccctcctgc 420atcattgctt tcattttcat
agccacagtg atagccctaa gaaaacaact ctgtcaaaag 480ctgtattctt
caaaagacac aacaaaaaga cctgtcacca caacaaagag ggaagtgaac 540agtgctatc
54922873DNAHomo sapiens 22atgaggatat ttgctgtctt tatattcatg
acctactggc atttgctgaa cgcatttact 60gtcacggttc ccaaggacct atatgtggta
gagtatggta gcaatatgac aattgaatgc 120aaattcccag tagaaaaaca
attagacctg gctgcactaa ttgtctattg ggaaatggag 180gataagaaca
ttattcaatt tgtgcatgga gaggaagacc tgaaggttca gcatagtagc
240tacagacaga gggcccggct gttgaaggac cagctctccc tgggaaatgc
tgcacttcag 300atcacagatg tgaaattgca ggatgcaggg gtgtaccgct
gcatgatcag ctatggtggt 360gccgactaca agcgaattac tgtgaaagtc
aatgccccat acaacaaaat caaccaaaga 420attttggttg tggatccagt
cacctctgaa catgaactga catgtcaggc tgagggctac 480cccaaggccg
aagtcatctg gacaagcagt gaccatcaag tcctgagtgg taagaccacc
540accaccaatt ccaagagaga ggagaagctt ttcaatgtga ccagcacact
gagaatcaac 600acaacaacta atgagatttt ctactgcact tttaggagat
tagatcctga ggaaaaccat 660acagctgaat tggtcatccc agaactacct
ctggcacatc ctccaaatga aaggactcac 720ttggtaattc tgggagccat
cttattatgc cttggtgtag cactgacatt catcttccgt 780ttaagaaaag
ggagaatgat ggatgtgaaa aaatgtggca tccaagatac aaactcaaag
840aagcaaagtg atacacattt ggaggagacg taa 87323951DNAHomo sapiens
23atgctgcgtc ggcggggcag ccctggcatg ggtgtgcatg tgggtgcagc cctgggagca
60ctgtggttct gcctcacagg agccctggag gtccaggtcc ctgaagaccc agtggtggca
120ctggtgggca ccgatgccac cctgtgctgc tccttctccc ctgagcctgg
cttcagcctg 180gcacagctca acctcatctg gcagctgaca gacaccaaac
agctggtgca cagctttgct 240gagggccagg accagggcag cgcctatgcc
aaccgcacgg ccctcttccc ggacctgctg 300gcacagggca atgcatccct
gaggctgcag cgcgtgcgtg tggcggacga gggcagcttc 360acctgcttcg
tgagcatccg ggatttcggc agcgctgccg tcagcctgca ggtggccgct
420ccctactcga agcccagcat gaccctggag cccaacaagg acctgcggcc
aggggacacg 480gtgaccatca cgtgctccag ctaccagggc taccctgagg
ctgaggtgtt ctggcaggat 540gggcagggtg tgcccctgac tggcaacgtg
accacgtcgc agatggccaa cgagcagggc 600ttgtttgatg tgcacagcgt
cctgcgggtg gtgctgggtg caaatggcac ctacagctgc 660ctggtgcgca
accccgtgct gcagcaggat gcgcacggct ctgtcaccat cacagggcag
720cctatgacat tccccccaga ggccctgtgg gtgaccgtgg ggctgtctgt
ctgtctcatt 780gcactgctgg tggccctggc tttcgtgtgc tggagaaaga
tcaaacagag ctgtgaggag 840gagaatgcag gagctgagga ccaggatggg
gagggagaag gctccaagac agccctgcag 900cctctgaaac actctgacag
caaagaagat gatggacaag aaatagcctg a 95124316PRTHomo sapiens 24Met
Leu Arg Arg Arg Gly Ser Pro Gly Met Gly Val His Val Gly Ala 1 5 10
15Ala Leu Gly Ala Leu Trp Phe Cys Leu Thr Gly Ala Leu Glu Val Gln
20 25 30Val Pro Glu Asp Pro Val Val Ala Leu Val Gly Thr Asp Ala Thr
Leu 35 40 45Cys Cys Ser Phe Ser Pro Glu Pro Gly Phe Ser Leu Ala Gln
Leu Asn 50 55 60Leu Ile Trp Gln Leu Thr Asp Thr Lys Gln Leu Val His
Ser Phe Ala65 70 75 80Glu Gly Gln Asp Gln Gly Ser Ala Tyr Ala Asn
Arg Thr Ala Leu Phe 85 90 95Pro Asp Leu Leu Ala Gln Gly Asn Ala Ser
Leu Arg Leu Gln Arg Val 100 105 110Arg Val Ala Asp Glu Gly Ser Phe
Thr Cys Phe Val Ser Ile Arg Asp 115 120 125Phe Gly Ser Ala Ala Val
Ser Leu Gln Val Ala Ala Pro Tyr Ser Lys 130 135 140Pro Ser Met Thr
Leu Glu Pro Asn Lys Asp Leu Arg Pro Gly Asp Thr145 150 155 160Val
Thr Ile Thr Cys Ser Ser Tyr Arg Gly Tyr Pro Glu Ala Glu Val 165 170
175Phe Trp Gln Asp Gly Gln Gly Val Pro Leu Thr Gly Asn Val Thr Thr
180 185 190Ser Gln Met Ala Asn Glu Gln Gly Leu Phe Asp Val His Ser
Val Leu 195 200 205Arg Val Val Leu Gly Ala Asn Gly Thr Tyr Ser Cys
Leu Val Arg Asn 210 215 220Pro Val Leu Gln Gln Asp Ala His Gly Ser
Val Thr Ile Thr Gly Gln225 230 235 240Pro Met Thr Phe Pro Pro Glu
Ala Leu Trp Val Thr Val Gly Leu Ser 245 250 255Val Cys Leu Ile Ala
Leu Leu Val Ala Leu Ala Phe Val Cys Trp Arg 260 265 270Lys Ile Lys
Gln Ser Cys Glu Glu Glu Asn Ala Gly Ala Glu Asp Gln 275 280 285Asp
Gly Glu Gly Glu Gly Ser Lys Thr Ala Leu Gln Pro Leu Lys His 290 295
300Ser Asp Ser Lys Glu Asp Asp Gly Gln Glu Ile Ala305 310
3152538DNAArtificial SequenceOligonucleotide primer 25ctcgaggaat
tcgccgccat gatcttcctc ctgctaat 382634DNAArtificial
SequenceOligonucleotide primer 26gggaagtgaa cagtgctatc gcggccgcaa
aaaa 3427948DNAMus musculus 27atgcttcgag gatggggtgg ccccagtgtg
ggtgtgtgtg tgcgcacagc gctgggggtg 60ctgtgcctct gcctcacagg agctgtggaa
gtccaggtct ctgaagaccc cgtggtggcc 120ctggtggaca cggatgccac
cctacgctgc tccttttccc cagagcctgg cttcagtctg 180gcacagctca
acctcatctg gcagctgaca gacaccaaac agctggtgca cagcttcacg
240gagggccggg accaaggcag tgcctactcc aaccgcacag cgctcttccc
tgacctgttg 300gtgcaaggca atgcgtcctt gaggctgcag cgcgtccgag
taaccgacga gggcagctac 360acctgctttg tgagcattca ggactttgac
agcgctgctg ttagcctgca ggtggccgcc 420ccctactcga agcccagcat
gaccctggag cccaacaagg acctacgtcc agggaacatg 480gtgaccatca
cgtgctctag ctaccagggc tatccggagg ccgaggtgtt ctggaaggat
540ggacagggag tgcccttgac tggcaatgtg acatcccaga tggccaacga
gcggggcttg 600ttcgatgttc acagcgtgct gagggtggtg ctgggtgcta
acggcaccta cagctgcctg 660gtacgcaacc cggtgttgca gcaagatgct
cacggctcag tcaccatcac agggcagccc 720ctgacattcc cccctgaggc
tctgtgggta accgtggggc tctctgtctg tcttgtggta 780ctactggtgg
ccctggcttt cgtgtgctgg agaaagatca agcagagctg cgaggaggag
840aatgcaggtg ccaaggacca ggatggagat ggagaaggat ccaagacagc
tctacggcct 900ctgaaaccct ctgaaaacaa agaagatgac ggacaagaaa ttgcttga
94828315PRTMus musculus 28Met Leu Arg Gly Trp Gly Gly Pro Ser Val
Gly Val Cys Val Arg Thr 1 5 10 15Ala Leu Gly Val Leu Cys Leu Cys
Leu Thr Gly Ala Val Glu Val Gln 20 25 30Val Ser Glu Asp Pro Val Val
Ala Leu Val Asp Thr Asp Ala Thr Leu 35 40 45Arg Cys Ser Phe Ser Pro
Glu Pro Gly Phe Ser Leu Ala Gln Leu Asn 50 55 60Leu Ile Trp Gln Leu
Thr Asp Thr Lys Gln Leu Val His Ser Phe Thr65 70 75 80Glu Gly Arg
Asp Gln Gly Ser Ala Tyr Ser Asn Arg Thr Ala Leu Phe 85 90 95Pro Asp
Leu Leu Val Gln Gly Asn Ala Ser Leu Arg Leu Gln Arg Val 100 105
110Arg Val Thr Asp Glu Gly Ser Tyr Thr Cys Phe Val Ser Ile Gln Asp
115 120 125Phe Asp Ser Ala Ala Val Ser Leu Gln Val Ala Ala Pro Tyr
Ser Lys 130 135 140Pro Ser Met Thr Leu Glu Pro Asn Lys Asp Leu Arg
Pro Gly Asn Met145 150 155 160Val Thr Ile Thr Cys Ser Ser Tyr Gln
Gly Tyr Pro Glu Ala Glu Val 165 170 175Phe Trp Lys Asp Gly Gln Gly
Val Pro Leu Thr Gly Asn Val Thr Ser 180 185 190Gln Met Ala Asn Glu
Arg Gly Leu Phe Asp Val His Ser Val Leu Arg 195 200 205Val Val Leu
Gly Ala Asn Gly Thr Tyr Ser Cys Leu Val Arg Asn Pro 210 215 220Val
Leu Gln Gln Asp Ala His Gly Ser Val Thr Ile Thr Gly Gln Pro225 230
235 240Leu Thr Phe Pro Pro Glu Ala Leu Trp Val Thr Val Gly Leu Ser
Val 245 250 255Cys Leu Val Val Leu Leu Val Ala Leu Ala Phe Val Cys
Trp Arg Lys 260 265 270Ile Lys Gln Ser Cys Glu Glu Glu Asn Ala Gly
Ala Lys Asp Gln Asp 275 280 285Gly Asp Gly Glu Gly Ser Lys Thr Ala
Leu Arg Pro Leu Lys Pro Ser 290 295 300Glu Asn Lys Glu Asp Asp Gly
Gln Glu Ile Ala305 310 31529322PRTMus musculus 29Met Gln Leu Lys
Cys Pro Cys Phe Val Ser Leu Gly Thr Arg Gln Pro 1 5 10 15Val Trp
Lys Lys Leu His Val Ser Ser Gly Phe Phe Ser Gly Leu Gly 20 25 30Leu
Phe Leu Leu Leu Leu Ser Ser Leu Cys Ala Ala Ser Ala Glu Thr 35 40
45Glu Val Gly Ala Met Val Gly Ser Asn Val Val Leu Ser Cys Ile Asp
50 55 60Pro His Arg Arg His Phe Asn Leu Ser Gly Leu Tyr Val Tyr Trp
Gln65 70 75 80Ile Glu Asn Pro Glu Val Ser Val Thr Tyr Tyr Leu Pro
Tyr Lys Ser 85 90 95Pro Gly Ile Asn Val Asp Ser Ser Tyr Lys Asn Arg
Gly His Leu Ser 100 105 110Leu Asp Ser Met Lys Gln Gly Asn Phe Ser
Leu Tyr Leu Lys Asn Val 115 120 125Thr Pro Gln Asp Thr Gln Glu Phe
Thr Cys Arg Val Phe Met Asn Thr 130 135 140Ala Thr Glu Leu Val Lys
Ile Leu Glu Glu Val Val Arg Leu Arg Val145 150 155 160Ala Ala Asn
Phe Ser Thr Pro Val Ile Ser Thr Ser Asp Ser Ser Asn 165 170 175Pro
Gly Gln Glu Arg Thr Tyr Thr Cys Met Ser Lys Asn Gly Tyr Pro 180 185
190Glu Pro Asn Leu Tyr Trp Ile Asn Thr Thr Asp Asn Ser Leu Ile Asp
195 200 205Thr Ala Leu Gln Asn Asn Thr Val Tyr Leu Asn Lys Leu Gly
Leu Tyr 210 215 220Asp Val Ile Ser Thr Leu Arg Leu Pro Trp Thr Ser
Arg Gly Asp Val225 230 235 240Leu Cys Cys Val Glu Asn Val Ala Leu
His Gln Asn Ile Thr Ser Ile 245 250 255Ser Gln Ala Glu Ser Phe Thr
Gly Asn Asn Thr Lys Asn Pro Gln Glu 260 265 270Thr His Asn Asn Glu
Leu Lys Val Leu Val Pro Val Leu Ala Val Leu 275 280 285Ala Ala Ala
Ala Phe Val Ser Phe Ile Ile Tyr Arg Arg Thr Arg Pro 290 295 300His
Arg Ser Tyr Thr Gly Pro Lys Thr Val Gln Leu Glu Leu Thr Asp305
310 315 320His Ala30744DNAMus musculusmisc_feature(1)...(744)mB7-H2
30atg ctg ctc ctg ctg ccg ata ctg aac ctg agc tta caa ctt cat cct
48Met Leu Leu Leu Leu Pro Ile Leu Asn Leu Ser Leu Gln Leu His Pro 1
5 10 15gta gca gct tta ttc acc gtg aca gcc cct aaa gaa gtg tac acc
gta 96Val Ala Ala Leu Phe Thr Val Thr Ala Pro Lys Glu Val Tyr Thr
Val 20 25 30gac gtc ggc agc agt gtg agc ctg gag tgc gat ttt gac cgc
aga gaa 144Asp Val Gly Ser Ser Val Ser Leu Glu Cys Asp Phe Asp Arg
Arg Glu 35 40 45tgc act gaa ctg gaa ggg ata aga gcc agt ttg cag aag
gta gaa aat 192Cys Thr Glu Leu Glu Gly Ile Arg Ala Ser Leu Gln Lys
Val Glu Asn 50 55 60gat acg tct ctg caa agt gaa aga gcc acc ctg ctg
gag gag cag ctg 240Asp Thr Ser Leu Gln Ser Glu Arg Ala Thr Leu Leu
Glu Glu Gln Leu 65 70 75 80ccc ctg gga aag gct ttg ttc cac atc cct
agt gtc caa gtg aga gat 288Pro Leu Gly Lys Ala Leu Phe His Ile Pro
Ser Val Gln Val Arg Asp 85 90 95tcc ggg cag tac cgt tgc ctg gtc atc
tgc ggg gcc gcc tgg gac tac 336Ser Gly Gln Tyr Arg Cys Leu Val Ile
Cys Gly Ala Ala Trp Asp Tyr 100 105 110aag tac ctg acg gtg aaa gtc
aaa gct tct tac atg agg ata gac act 384Lys Tyr Leu Thr Val Lys Val
Lys Ala Ser Tyr Met Arg Ile Asp Thr 115 120 125agg atc ctg gag gtt
cca ggt aca ggg gag gtg cag ctt acc tgc cag 432Arg Ile Leu Glu Val
Pro Gly Thr Gly Glu Val Gln Leu Thr Cys Gln 130 135 140gct aga ggt
tat ccc cta gca gaa gtg tcc tgg caa aat gtc agt gtt 480Ala Arg Gly
Tyr Pro Leu Ala Glu Val Ser Trp Gln Asn Val Ser Val145 150 155
160cct gcc aac acc agc cac atc agg acc ccc gaa ggc ctc tac cag gtc
528Pro Ala Asn Thr Ser His Ile Arg Thr Pro Glu Gly Leu Tyr Gln Val
165 170 175acc agt gtt ctg cgc ctc aag cct cag cct agc aga aac ttc
agc tgc 576Thr Ser Val Leu Arg Leu Lys Pro Gln Pro Ser Arg Asn Phe
Ser Cys 180 185 190atg ttc tgg aat gct cac atg aag gag ctg act tca
gcc atc att gac 624Met Phe Trp Asn Ala His Met Lys Glu Leu Thr Ser
Ala Ile Ile Asp 195 200 205cct ctg agt cgg atg gaa ccc aaa gtc ccc
aga acg tgg cca ctt cat 672Pro Leu Ser Arg Met Glu Pro Lys Val Pro
Arg Thr Trp Pro Leu His 210 215 220gtt ttc atc ccg gcc tgc acc atc
gct ttg atc ttc ctg gcc ata gtg 720Val Phe Ile Pro Ala Cys Thr Ile
Ala Leu Ile Phe Leu Ala Ile Val225 230 235 240ata atc cag aga aag
agg atc tag 744Ile Ile Gln Arg Lys Arg Ile * 245 31247PRTMus
musculus 31Met Leu Leu Leu Leu Pro Ile Leu Asn Leu Ser Leu Gln Leu
His Pro 1 5 10 15Val Ala Ala Leu Phe Thr Val Thr Ala Pro Lys Glu
Val Tyr Thr Val 20 25 30Asp Val Gly Ser Ser Val Ser Leu Glu Cys Asp
Phe Asp Arg Arg Glu 35 40 45Cys Thr Glu Leu Glu Gly Ile Arg Ala Ser
Leu Gln Lys Val Glu Asn 50 55 60Asp Thr Ser Leu Gln Ser Glu Arg Ala
Thr Leu Leu Glu Glu Gln Leu65 70 75 80Pro Leu Gly Lys Ala Leu Phe
His Ile Pro Ser Val Gln Val Arg Asp 85 90 95Ser Gly Gln Tyr Arg Cys
Leu Val Ile Cys Gly Ala Ala Trp Asp Tyr 100 105 110Lys Tyr Leu Thr
Val Lys Val Lys Ala Ser Tyr Met Arg Ile Asp Thr 115 120 125Arg Ile
Leu Glu Val Pro Gly Thr Gly Glu Val Gln Leu Thr Cys Gln 130 135
140Ala Arg Gly Tyr Pro Leu Ala Glu Val Ser Trp Gln Asn Val Ser
Val145 150 155 160Pro Ala Asn Thr Ser His Ile Arg Thr Pro Glu Gly
Leu Tyr Gln Val 165 170 175Thr Ser Val Leu Arg Leu Lys Pro Gln Pro
Ser Arg Asn Phe Ser Cys 180 185 190Met Phe Trp Asn Ala His Met Lys
Glu Leu Thr Ser Ala Ile Ile Asp 195 200 205Pro Leu Ser Arg Met Glu
Pro Lys Val Pro Arg Thr Trp Pro Leu His 210 215 220Val Phe Ile Pro
Ala Cys Thr Ile Ala Leu Ile Phe Leu Ala Ile Val225 230 235 240Ile
Ile Gln Arg Lys Arg Ile 24532290PRTMus musculus 32Met Arg Ile Phe
Ala Gly Ile Ile Phe Thr Ala Cys Cys His Leu Leu 1 5 10 15Arg Ala
Phe Thr Ile Thr Ala Pro Lys Asp Leu Tyr Val Val Glu Tyr 20 25 30Gly
Ser Asn Val Thr Met Glu Cys Arg Phe Pro Val Glu Arg Glu Leu 35 40
45Asp Leu Leu Ala Leu Val Val Tyr Trp Glu Lys Glu Asp Glu Gln Val
50 55 60Ile Gln Phe Val Ala Gly Glu Glu Asp Leu Lys Pro Gln His Ser
Asn65 70 75 80Phe Arg Gly Arg Ala Ser Leu Pro Lys Asp Gln Leu Leu
Lys Gly Asn 85 90 95Ala Ala Leu Gln Ile Thr Asp Val Lys Leu Gln Asp
Ala Gly Val Tyr 100 105 110Cys Cys Ile Ile Ser Tyr Gly Gly Ala Asp
Tyr Lys Arg Ile Thr Leu 115 120 125Lys Val Asn Ala Pro Tyr Arg Lys
Ile Asn Gln Arg Ile Ser Val Asp 130 135 140Pro Ala Thr Ser Glu His
Glu Leu Ile Cys Gln Ala Glu Gly Tyr Pro145 150 155 160Glu Ala Glu
Val Ile Trp Thr Asn Ser Asp His Gln Pro Val Ser Gly 165 170 175Lys
Arg Ser Val Thr Thr Ser Arg Thr Glu Gly Met Leu Leu Asn Val 180 185
190Thr Ser Ser Leu Arg Val Asn Ala Thr Ala Asn Asp Val Phe Tyr Cys
195 200 205Thr Phe Trp Arg Ser Gln Pro Gly Gln Asn His Thr Ala Glu
Leu Ile 210 215 220Ile Pro Glu Leu Pro Ala Thr His Pro Pro Gln Asn
Arg Thr His Trp225 230 235 240Val Leu Leu Gly Ser Ile Leu Leu Phe
Leu Ile Val Val Ser Thr Val 245 250 255Leu Leu Phe Leu Arg Lys Gln
Val Arg Met Leu Asp Val Glu Lys Cys 260 265 270Gly Val Glu Asp Thr
Ser Ser Lys Asn Arg Asn Asp Thr Gln Phe Glu 275 280 285Glu Thr
290
* * * * *
References