U.S. patent application number 11/801550 was filed with the patent office on 2009-10-22 for cd30 ligand.
This patent application is currently assigned to Immunex Corporation. Invention is credited to Richard J. Armitage, Raymond G. Goodwin, Hans-Juergen Gruss, Craig A. Smith.
Application Number | 20090264349 11/801550 |
Document ID | / |
Family ID | 27542285 |
Filed Date | 2009-10-22 |
United States Patent
Application |
20090264349 |
Kind Code |
A1 |
Goodwin; Raymond G. ; et
al. |
October 22, 2009 |
CD30 Ligand
Abstract
There is disclosed a polypeptide (CD30-L) and DNA sequences,
vectors and transformed host cells useful in providing CD30-L
polypeptides. The CD30-L polypeptide binds to the receptor known as
CD30, which is expressed on a number of cell types, among which are
Hodgkin's Disease tumor cells, large cell anaplastic lymphoma
cells, adult T-cell leukemia (T-ALL) cells, and a number of other
malignant cell types. CD30-L polypeptides find use as carriers for
delivering diagnostic and cytotoxic agents to cells expressing the
CD30 receptor.
Inventors: |
Goodwin; Raymond G.;
(Seattle, WA) ; Smith; Craig A.; (Seattle, WA)
; Armitage; Richard J.; (Bainbridge Island, WA) ;
Gruss; Hans-Juergen; (Oxon, GB) |
Correspondence
Address: |
IMMUNEX CORPORATION;LAW DEPARTMENT
1201 AMGEN COURT WEST
SEATTLE
WA
98119
US
|
Assignee: |
Immunex Corporation
Thousand Oaks
CA
|
Family ID: |
27542285 |
Appl. No.: |
11/801550 |
Filed: |
May 9, 2007 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10677593 |
Oct 2, 2003 |
7232660 |
|
|
11801550 |
|
|
|
|
09628126 |
Jul 28, 2000 |
6667039 |
|
|
10677593 |
|
|
|
|
09079785 |
May 15, 1998 |
6143869 |
|
|
09628126 |
|
|
|
|
08580014 |
Dec 20, 1995 |
5753203 |
|
|
09079785 |
|
|
|
|
08225989 |
Apr 12, 1994 |
5480981 |
|
|
08580014 |
|
|
|
|
07966775 |
Oct 27, 1992 |
|
|
|
08225989 |
|
|
|
|
07907224 |
Jul 1, 1992 |
|
|
|
07966775 |
|
|
|
|
07899660 |
Jun 15, 1992 |
|
|
|
07907224 |
|
|
|
|
07892459 |
Jun 2, 1992 |
|
|
|
07899660 |
|
|
|
|
07889717 |
May 26, 1992 |
|
|
|
07892459 |
|
|
|
|
Current U.S.
Class: |
514/1.1 ;
435/320.1; 435/69.1; 530/350; 530/387.9; 536/23.53 |
Current CPC
Class: |
C07K 2317/73 20130101;
A61K 38/00 20130101; C07K 16/00 20130101; C07K 16/2875 20130101;
C07K 2319/30 20130101; C07K 14/70575 20130101; C07K 14/70578
20130101; C07K 16/2878 20130101; C07K 2319/036 20130101; C07K
2319/32 20130101; A61P 35/00 20180101; C07K 2317/74 20130101; Y10S
514/883 20130101; C07K 2319/00 20130101 |
Class at
Publication: |
514/12 ;
536/23.53; 435/320.1; 435/69.1; 530/350; 530/387.9 |
International
Class: |
A61K 38/16 20060101
A61K038/16; C07H 21/00 20060101 C07H021/00; C12N 15/74 20060101
C12N015/74; C12P 21/02 20060101 C12P021/02; C07K 14/00 20060101
C07K014/00; C07K 16/18 20060101 C07K016/18; A61P 35/00 20060101
A61P035/00 |
Foreign Application Data
Date |
Code |
Application Number |
May 25, 1993 |
US |
PCT/US93/04926 |
Claims
1. An isolated DNA sequence encoding a CD30-L polypeptide, wherein
said CD30-L comprises an amino acid sequence selected from the
group consisting of amino acids 1-220 of SEQ ID NO:19, amino acids
1-215 of SEQ ID NO:23, amino acids 1-239 of SEQ ID NO:6, and amino
acids 1-234 of SEQ ID NO:8.
2. An isolated DNA sequence encoding a soluble CD30-L polypeptide
capable of binding CD30, wherein said CD30-L comprises an amino
acid sequence selected from the group consisting of amino acids
49-220 of SEQ ID NO:19 and amino acids z-215 of SEQ ID NO:23,
wherein z is selected from the group consisting of 44, 45, 46, and
47.
3. An isolated DNA comprising a DNA sequence that encodes an Fc
polypeptide derived from an antibody, fused directly or through a
peptide linker-encoding sequence to the 5' end of a soluble
CD30-L-encoding DNA according to claim 2.
4. A DNA sequence according to claim 2, wherein said DNA sequence
comprises a nucleotide sequence selected from the group consisting
of nucleotides 130-645, 133-645, 136-645, and 139-645 of SEQ ID
NO:22.
5. An isolated DNA capable of hybridizing to a DNA sequence of
claim 1 under highly stringent conditions, wherein said isolated
DNA encodes a CD30-L polypeptide capable of binding CD30.
6. An isolated DNA sequence encoding a CD30-L polypeptide capable
of binding CD30, wherein said CD30-L comprises an amino acid
sequence selected from the group consisting of amino acids x to 239
of SEQ ID NO:6, wherein x is 1-19, and amino acids y to 234 of SEQ
ID NO:8, wherein y is 1-19.
7. An expression vector comprising a DNA sequence according to
claim 1.
8. An expression vector comprising a DNA sequence according to
claim 2.
9. An expression vector comprising a DNA sequence according to
claim 3.
10. An expression vector comprising a DNA sequence according to
claim 5.
11. A process for preparing a CD30-L polypeptide, comprising
culturing a host cell transformed with a vector according to claim
7 under conditions promoting expression of CD30-L, and recovering
the CD30-L polypeptide.
12. A process for preparing a CD30-L polypeptide, comprising
culturing a host cell transformed with a vector according to claim
8 under conditions promoting expression of CD30-L and recovering
the CD30-L polypeptide.
13. A process for preparing a soluble CD30-L/Fc fusion protein,
comprising culturing a host cell transformed with a vector
according to claim 9 under conditions promoting expression of
CD30-L/Fc, and recovering the CD30-L/Fc polypeptide.
14. A process for preparing a CD30-L polypeptide, comprising
culturing a host cell transformed with a vector according to claim
10 under conditions promoting expression of CD30-L, and recovering
the CD30-L polypeptide.
15. A substantially homogeneous purified biologically active CD30-L
protein, wherein said CD30-L is selected from the group consisting
of murine CD30-L comprising the N-terminal amino acid sequence
Met-Gln-Val-Gln-Pro-Gly-Ser-Val-Ala-Ser-Pro-Trp or
Met-Glu-Pro-Gly-Leu-Gln-Gln-Ala-Gly-Ser-Cys-Gly, and human CD30-L
comprising the N-terminal amino acid sequence
Met-His-Val-Pro-Ala-Gly-Ser-Val-Ala-Ser-His-Leu or Met-Asp
Pro-Gly-Leu-Gln-Gln-Ala-Leu-Asn-Gly-Met.
16. A purified CD30-L according to claim 15, wherein said CD30-L
comprises an amino acid sequence selected from the group consisting
of amino acids 1-220 of SEQ ID NO:19, amino acids 1-215 of SEQ ID
NO:23, amino acids 1-239 of SEQ ID NO:6, and amino acids 1-234 of
SEQ ID NO:8.
17. A substantially homogeneous soluble CD30-L polypeptide, wherein
said soluble CD30-L comprises an amino acid sequence selected from
the group consisting of amino acids 49-220 of SEQ ID NO:19 and
amino acids z-215 of SEQ ID NO:23, wherein z is selected from the
group consisting of 44, 45, 46, and 47.
18. A substantially homogeneous purified CD30-L protein capable of
binding CD30, wherein said CD30-L is encoded by a DNA sequence that
will hybridize to the nucleotide sequence presented in SEQ ID NO:19
or SEQ ID NO:23 under severely stringent conditions.
19. A CD30-L protein according to claim 18, wherein said protein is
a soluble human CD30-L protein.
20. Purified CD30-L according to claim 18, wherein said CD30-L
comprises an amino acid sequence selected from the group consisting
of amino acids x to 239 of SEQ ID NO:6, wherein x is 1-19, and
amino acids y to 234 of SEQ ID NO:8, wherein y is 1-19.
21. A fusion protein comprising a soluble human CD30-L according to
claim 19 and an Fc polypeptide derived from an antibody.
22. An antibody immunoreactive with a CD30-L polypeptide according
to claim 18.
23. An antibody according to claim 22 wherein said antibody is a
monoclonal antibody.
24. An isolated nucleic acid molecule comprising a sequence of at
least about 14 nucleotides of the DNA sequence of SEQ ID NO:5 or
SEQ ID NO:7, or the DNA or RNA complement thereof.
25. A conjugate comprising a diagnostic or therapeutic agent
attached to a CD30-L polypeptide according to claim 18.
26. A conjugate comprising a diagnostic or therapeutic agent
attached to a soluble CD30-L polypeptide according to claim 19.
27. A method of delivering a diagnostic or therapeutic agent to
CD30.sup.+ cells, comprising contacting said cells with a conjugate
according to claim 25.
28. A method of delivering a diagnostic or therapeutic agent to
CD30.sup.+ cells, comprising contacting said cells with a conjugate
according to claim 26.
29. A method according to claim 28, wherein said cells are
malignant and said conjugate is administered in an effective amount
to a human afflicted with said malignant cells.
30. A method according to claim 29, wherein said cells are
CD30.sup.+ lymphoma cells.
31. A method of treating large cell anaplastic lymphoma (LCAL),
comprising administering an effective amount of a soluble CD30-L
according to claim 19 to a human afflicted with LCAL.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a divisional of U.S. application Ser.
No. 10/677,593, filed Oct. 2, 2003, now allowed; which is a
divisional of U.S. application Ser. No. 09/628,126, filed Jul. 28,
2000, and issued as U.S. Pat. No. 6,667,039 on Dec. 23, 2003; which
is a divisional of Ser. No. 09/079,785, filed May 15, 1998, and
issued as U.S. Pat. No. 6,143,869 on Nov. 7, 2000; which is a
divisional 08/580,014, filed Dec. 20, 1995, and issued as U.S. Pat.
No. 5,753,203 on May 19, 1998; which is a divisional of Ser. No.
08/225,989, filed Apr. 12, 1994, and issued as U.S. Pat. No.
5,480,981 on Jan. 2, 1996; which is a continuation-in-part of U.S.
application Ser. No. 07/966,775, filed Oct. 27, 1992, now
abandoned; which is a continuation-in-part of U.S. application Ser.
No. 07/907,224, filed Jul. 1, 1992, now abandoned; which is a
continuation-in-part of U.S. application Ser. No. 07/899,660, filed
Jun. 15, 1992, now abandoned; which is a continuation-in-part of
U.S. application Ser. No. 07/892,459, filed Jun. 2, 1992, now
abandoned; which is a continuation-in-part of U.S. application Ser.
No. 07/889,717, filed May 26, 1992, now abandoned. Priority is also
claimed from International Application PCT/US93/04926, filed May
25, 1993.
BACKGROUND OF THE INVENTION
[0002] Hodgkin's Disease is a human lymphoma, the etiology of which
is still not well understood. The neoplastic cells of Hodgkin's
Disease are known as Hodgkin and Reed-Sternberg (H-RS) cells. CD30
is a 120 kd surface antigen widely used as a clinical marker for
Hodgkin's lymphoma and related hematologic malignancies (Froese et
al., J. Immunol. 139:2081 (1987); Pfreundschuh et al., Onkologie
12:30 (1989); Carde et al., Eur. J. Cancer 26:474 (1990)).
Originally identified by the monoclonal antibody Ki-1, which is
reactive with H-RS cells (Schwab et al., Nature (London) 299:65
(1982)), CD30 was subsequently shown to be expressed on a subset of
non-Hodgkin's lymphomas (NHL), including Burkitt's lymphoma, as
well as several virally-transformed lines (human T-Cell
Lymphotrophic Virus I or II transformed T-cells, and Epstein-Barr
Virus transformed B-cells (Stein et al., Blood 66:848 (1985);
Andreesen et al., Blood 63:1299 (1984)). That CD30 plays a role in
normal lymphoid interactions is suggested by its histological
detection on a small population of lymphoid cells in reactive lymph
nodes, and by induced expression on purified T- and B-cells
following lectin activation (Stein et al., Int. J. Cancer 30:445
(1982) and Stein et al., 1985, supra).
[0003] CD30 expression has also been detected on various
non-Hodgkin's lymphomas (NHL), such as large-cell anaplastic
lymphomas (LCAL), cutaneous T-cell lymphomas, nodular small
cleaved-cell lymphomas, lymphocytic lymphomas, peripheral T-cell
lymphomas, Lennert's lymphomas, immunoblastic lymphomas, T-cell
leukemia/lymphomas (ATLL), adult T-cell leukemia (T-ALL), and
centroblastic/centrocytic (cb/cc) follicular lymphomas (Stein et
al., Blood 66:848 (1985); Miettinen, Arch. Pathol. Lab. Med.
116:1197 (1992); Piris et al., Histopathology 17:211 (1990); Burns
et al., Am. J. Clin. Pathol. 93:327 (1990); Piris et al.,
Histopathology 18:25 (1991); Eckert et al., Am. J. Dermatopathol.
11:345 (1989); Gianotti et al., Am. J. Dermatopathol. 13:503
(1991); Maeda et al., Br. J. Dermatol. 121:603 (1989)). The
association of the CD30 antigen with lymphoid malignancies has
proven to be a useful marker for the identification of malignant
cells within lymphoid tissues, particularly lymph nodes. However,
expression of CD30 has also been reported on a portion of embryonal
carcinomas, nonembryonal carcinomas, malignant melanomas,
mesenchymal tumors, and myeloid cell lines and macrophages at late
stages of differentiation (Schwarting et al., Blood 74:1678 (1989);
Pallesen et al., Am J. Pathol. 133:446 (1988); Mechtersheimer et
al., Cancer 66:1732 (1990); Andreesen et al., Am. J. Pathol.
134:187 (1989)).
[0004] Cloning and expression of a gene encoding CD30 has been
reported and CD30 has been characterized as a transmembrane protein
that possesses substantial homology to the nerve growth factor
receptor superfamily (Durkop et al., Cell 68:421, 1992). Durkop et
al. suggest that CD30 is the receptor for one or more as yet
unidentified growth factors, and recognize the importance of
investigating the existence and nature of such growth factors in
order to achieve insight into the etiology of Hodgkin's
Disease.
[0005] Prior to the present invention, however, no such growth
factors or other molecules that bind to the CD30 receptor were
known. A need thus remained for identification and characterization
of a ligand for CD30.
SUMMARY OF THE INVENTION
[0006] The present invention provides a novel cytokine designated
CD30-L, as well as isolated DNA encoding CD30-L protein, expression
vectors comprising the isolated DNA, and a method for producing
CD30-L by cultivating host cells containing the expression vectors
under conditions appropriate for expression of the CD30-L protein.
CD30-L is a ligand that binds to the Hodgkin's disease-associated
antigen CD30 (a cell surface receptor). Antibodies directed against
the CD30-L protein or an immunogenic fragment thereof are also
provided. Uses of CD30-L in diagnostic and therapeutic procedures
are also disclosed.
DETAILED DESCRIPTION OF THE INVENTION
[0007] cDNA encoding a novel polypeptide that can act as a ligand
for the Hodgkin's Disease-associated receptor known as CD30 has
been isolated in accordance with the present invention. Also
provided are expression vectors comprising the CD30 ligand (CD30-L)
cDNA and methods for producing recombinant CD30-L polypeptides by
cultivating host cells containing the expression vectors under
conditions appropriate for expression of CD30-L, and recovering the
expressed CD30-L. Purified CD30-L protein is also encompassed by
the present invention.
[0008] The present invention also provides CD30-L or antigenic
fragments thereof that can act as immunogens to generate antibodies
specific to the CD30-L immunogens. Monoclonal antibodies specific
for CD30-L or antigenic fragments thereof thus can be prepared.
[0009] The novel cytokine disclosed herein is a ligand for CD30, a
receptor that is a member of the TNF/NGF receptor superfamily.
Therefore, CD30-L is likely to be responsible for transducing a
biological signal via CD30, which is known to be expressed on the
surface of Hodgkin's Disease tumor cells.
[0010] One use of the CD30 ligand of the present invention is as a
research tool for studying the pathogenesis of Hodgkin's Disease.
As described in examples 8 and 13, CD30-L enhances the
proliferation of the CD30.sup.+ neoplastic Hodgkin's
Disease-derived lymphoma cell lines HDLM-2 and L-540, which are
phenotypically T-cell-like. CD30-L did not produce a detectable
effect on proliferation or viability of the B-cell-like, CD30.sup.+
Hodgkin's Disease-derived lymphoma cell lines KM-H2 and L-428. The
CD30-L of the present invention provides a means for investigating
the roles that CD30-L and the cognate receptor may play in the
etiology of Hodgkin's Disease.
[0011] CD30-L reduced proliferation of CD30.sup.+ large cell
anaplastic lymphoma cell lines (one type of non-Hodgkin's lymphoma)
(see examples 8 and 13). Thus, CD30-L has potential use as a
therapeutic agent. CD30-L also finds use in delivering diagnostic
or therapeutic agents attached thereto to cells (e.g., malignant
cells) that express the CD30 antigen.
[0012] The CD30 ligand also induces proliferation of T cells in the
presence of an anti-CD3 co-stimulus. The CD30-L of the present
invention thus is also useful as a research tool for elucidating
the roles that CD30 and CD30-L may play in the immune system. The
inducible expression of CD30-L on normal T cells and macrophages,
and the presence of its receptor on activated T and B cells, is
consistent with both autocrine and paracrine effects.
[0013] Upregulation of CD30 accompanying EBV, HTLVI and HTLVII
transformation also warrants further investigation, and the CD30-L
provided herein is useful in such studies. HTLVI is the proximal
cause of adult T cell Leukemia/Lymphoma. EBV has long been
associated with Burkitt's lymphoma and nasopharyngeal carcinoma,
and, overall, 50% of Hodgkin's lymphomas are EBV.sup.+ (reviewed in
Klein, Blood 80:299 (1992).
[0014] The CD30-L polypeptides of the present invention also may be
employed in in vitro assays for detection of CD30 or CD30-L or the
interactions thereof. Additional cell types expressing CD30 may be
identified, for example.
[0015] The term "CD30-L" as used herein refers to a genus of
polypeptides which are capable of binding CD30. Human CD30-L is
within the scope of the present invention, as are CD30-L proteins
derived from other mammalian species. As used herein, the term
"CD30-L" includes membrane-bound proteins (comprising a cytoplasmic
domain, a transmembrane region, and an extracellular domain) as
well as truncated proteins that retain the CD30-binding property.
Such truncated proteins include, for example, soluble CD30-L
comprising only the extracellular (receptor binding) domain.
[0016] Isolation of a cDNA encoding murine CD30-L is described in
examples 1-4 below. A human CD30-Fc fusion protein was prepared as
described in example 1 for use in screening clones in a direct
expression cloning procedure, to identify those expressing a
protein that binds CD30.
[0017] Briefly, total RNA was isolated from a virally transformed
human T-cell line designated HUT-102, which has been described by
Durkop et al., supra, and Poiesz et al. (PNAS USA 77:7415-19,
1980). First strand cDNA was prepared using the total RNA as
template. DNA encoding the extracellular domain of human CD30 was
amplified by polymerase chain reaction (PCR) using primers based on
the human CD30 sequence published by Durkop et al., supra., and the
amplified DNA fragment was isolated. An expression vector
comprising the CD30 extracellular domain DNA fused in-frame to the
N-terminus of a human IgG1 Fc region DNA sequence was constructed
and transfected into mammalian cells. The expressed protein was
purified by a procedure that involved use of a protein G column (to
which the Fc portion of the fusion protein binds).
[0018] Three activated murine helper T-cell lines were screened
using a fluorescence activated cell sorting technique, and all
three were found to bind a fluorescent derivative of the CD30-Fc
protein. A cDNA library was prepared from one of the murine helper
T-cell lines. cDNA from this library (in a mammalian expression
vector that also replicates in E. coli) was transfected into COS-7
(mammalian) cells, for isolation of clones expressing a
CD30-binding protein by using a direct expression cloning
technique. The clones were screened for ability to bind
.sup.125I-CD30/Fc, and a positive clone was isolated. The
recombinant vector isolated from the positive clone (murine CD30-L
cDNA in plasmid pDC202) was transformed into E. coli cells,
deposited with the American Type Culture Collection on May 28,
1992, and assigned accession no. ATCC 69004. The deposit was made
under the terms of the Budapest Treaty.
[0019] The murine CD30-L cDNA was radiolabeled and used as a probe
to isolate human CD30-L cDNA by cross-species hybridization.
Briefly, a cDNA library prepared from activated human peripheral
blood lymphocytes was screened with .sup.32P-labeled murine cDNA
and a positive clone was isolated as described in Example 6. Human
CD30-L DNA isolated from the positive clone was inserted into
plasmid pGEMBL and then transformed into E. coli cells as described
in Example 6. Samples of E. coli cells transformed with the
recombinant vector were deposited with the American Type Culture
Collection on Jun. 24, 1992, and assigned accession no. ATCC 69020.
The deposit was made under the terms of the Budapest Treaty.
[0020] Additional murine and human CD30-L DNA sequences were
isolated as described in example 7. The proteins encoded by the
clones of example 7 comprise additional amino acids at the
N-terminus, compared to the clones isolated in examples 4 and
6.
[0021] CD30-L proteins of the present invention thus include, but
are not limited to, murine CD30-L proteins characterized by the
N-terminal amino acid sequence
Met-Gln-Val-Gln-Pro-Gly-Ser-Val-Ala-Ser-Pro-Trp (amino acids 1-12
of SEQ ID NO:19) or Met-Glu-Pro-Gly-Leu-Gln-Gln-Ala-Gly-Ser-Cys-Gly
(amino acids 1-12 of SEQ ID NO:6). Human CD30-L proteins
characterized by the N-terminal amino acid sequence
Met-His-Val-Pro-Ala-Gly-Ser-Val-Ala-Ser-His-Leu (amino acids 1-12
of SEQ ID NO:23) or Met-Asp-Pro-Gly-Leu-Gln-Gln-Ala-Leu-Asn-Gly-Met
(amino acids 1-12 of SEQ ID NO:8) also are provided.
[0022] While a CD30/Fc fusion protein was employed in the screening
procedure described in example 4 below, labeled CD30 could be used
to screen clones and candidate cell lines for expression of CD30-L
proteins. The CD30/Fc fusion protein offers the advantage of being
easily purified. In addition, disulfide bonds form between the Fc
regions of two separate fusion protein chains, creating dimers. The
dimeric CD30/Fc receptor was chosen for the potential advantage of
higher affinity binding of the CD30 ligand, in view of the
possibility that the ligand being sought would be multimeric.
[0023] Further, other suitable fusion proteins comprising CD30 may
be substituted for CD30/Fc in the screening procedures. Other
fusion proteins can be made by fusing a DNA sequence for the ligand
binding domain of CD30 to a DNA sequence encoding another
polypeptide that is capable of affinity purification, for example,
avidin or streptavidin. The resultant gene construct can be
introduced into mammalian cells to express a fusion protein.
Receptor/avidin fusion proteins can be purified by biotin affinity
chromatography. The fusion protein can later be recovered from the
column by eluting with a high salt solution or another appropriate
buffer. Other antibody Fc regions may be substituted for the human
IgG1 Fc region described in example 1. Other suitable Fc regions
are defined as any region that can bind with high affinity to
protein A or protein G, and include the Fc region of murine IgG1 or
fragments of the human IgG1 Fc region, e.g., fragments comprising
at least the hinge region so that interchain disulfide bonds will
form.
[0024] cDNA encoding a CD30-L polypeptide may be isolated from
other mammalian species by procedures analogous to those employed
in isolating the murine CD30-L clone. For example, a cDNA library
derived from a different mammalian species may be substituted for
the murine cDNA library that was screened for binding of
radioiodinated human CD30/Fc fusion protein in the direct
expression cloning procedure described in example 4. Cell types
from which cDNA libraries may be prepared may be chosen by the FACS
selection procedure described in example 2, or any other suitable
technique. As one alternative, mRNAs isolated from various cell
lines can be screened by Northern hybridization to determine a
suitable source of mammalian CD30-L mRNA for use in cloning a
CD30-L gene.
[0025] Alternatively, one can utilize the murine or human CD30-L
cDNAs described herein to screen cDNA derived from other mammalian
sources for CD30-L cDNA using cross-species hybridization
techniques. Briefly, an oligonucleotide based on the nucleotide
sequence of the coding region (preferably the extracellular region)
of the murine or human clone, or, preferably, the full length
CD30-L cDNA, is prepared by standard techniques for use as a probe.
The murine or human probe is used to screen a mammalian cDNA
library or genomic library, generally under moderately stringent
conditions.
[0026] CD30-L proteins of the present invention include, but are
not limited to, murine CD30-L comprising amino acids 1-220 of SEQ
ID NO:19 or 1-239 of SEQ ID NO:6; human CD30-L comprising amino
acids 1-215 of SEQ ID NO:23 or 1-234 of SEQ ID NO:8; and proteins
that comprise N-terminal, C-terminal, or internal truncations of
the foregoing sequences, but retain the desired biological
activity. Examples include murine CD30-L proteins comprising amino
acids x to 239 of SEQ ID NO:6, wherein x is 1-19 (i.e., the
N-terminal amino acid is selected from amino acids 1-19 of SEQ ID
NO:6, and the C-terminal amino acid is amino acid 239 of SEQ ID
NO:6.) As described in example 7, amino acids 1-19 of the SEQ ID
NO:6 sequence are not essential for binding of murine CD30-L to the
CD30 receptor. Also provided by the present invention are human
CD30-L proteins comprising amino acids y to 234 of SEQ ID NO:8
wherein y is 1-19 (i.e., the N-terminal amino acid is any one of
amino acids 1-19 of SEQ ID NO:8, and amino acid 234 is the
C-terminal amino acid. Such proteins, truncated at the N-terminus,
are capable of binding CD30, as discussed in example 7.
[0027] One embodiment of the present invention provides soluble
CD30-L polypeptides. Soluble CD30-L polypeptides comprise all or
part of the extracellular domain of a native CD30-L but lack the
transmembrane region that would cause retention of the polypeptide
on a cell membrane. Since the CD30-L protein lacks a signal
peptide, a heterologous signal peptide is fused to the N-terminus
of a soluble CD30-L protein to promote secretion thereof, as
described in more detail below. The signal peptide is cleaved from
the CD30-L protein upon secretion from the host cell. The soluble
CD30-L polypeptides that may be employed retain the ability to bind
the CD30 receptor. Soluble CD30-L may also include part of the
transmembrane region or part of the cytoplasmic domain or other
sequences, provided that the soluble CD30-L protein is capable of
being secreted.
[0028] Soluble CD30-L may be identified (and distinguished from its
non-soluble membrane-bound counterparts) by separating intact cells
which express the desired protein from the culture medium, e.g., by
centrifugation, and assaying the medium (supernatant) for the
presence of the desired protein. The culture medium may be assayed
using procedures which are similar or identical to those described
in the examples below. The presence of CD30-L in the medium
indicates that the protein was secreted from the cells and thus is
a soluble form of the desired protein.
[0029] The use of soluble forms of CD30-L is advantageous for
certain applications. Purification of the proteins from recombinant
host cells is facilitated, since the soluble proteins are secreted
from the cells.
[0030] Examples of soluble CD30-L polypeptides include those
comprising the entire extracellular domain of a native CD30-L
protein or a fragment of said extracellular domain that is capable
of binding CD30. One such soluble CD30-L comprises amino acids 49
(Gln) through 220 (Asp) of the murine CD30-L sequence of SEQ ID
NO:19. Other soluble CD30-L polypeptides comprise amino acids z to
215 (Asp) of the human CD30-L sequence of SEQ ID NO:23, wherein z
is 44, 45, 46, or 47. In other words, the N-terminal amino acid of
the soluble human CD30-L is selected from the amino acids in
positions 44-47 of SEQ ID NO:23. DNA sequences encoding such
soluble human CD30-L polypeptides include, but are not limited to,
DNA sequences comprising a nucleotide sequence selected from the
group consisting of nucleotides 130-645, 133-645, 136-645, and
139-645 of SEQ ID NO:22. Such sequences encode polypeptides
comprising amino acids 44-215, 45-215, 46-215, and 47-215,
respectively, of SEQ ID NO:23. Production of one such soluble human
CD30-L protein, in the form of a fusion protein comprising amino
acids 47-215 of SEQ ID NO:23 and an antibody Fc polypeptide, is
illustrated in example 11.
[0031] Truncated CD30-L, including soluble polypeptides, may be
prepared by any of a number of conventional techniques. In the case
of recombinant proteins, a DNA fragment encoding a desired fragment
may be subcloned into an expression vector. Alternatively, a
desired DNA sequence may be chemically synthesized using known
techniques. DNA fragments also may be produced by restriction
endonuclease digestion of a full length cloned DNA sequence, and
isolated by electrophoresis on agarose gels. Linkers containing
restriction endonuclease cleavage site(s) may be employed to insert
the desired DNA fragment into an expression vector, or the fragment
may be digested at cleavage sites naturally present therein. The
well known polymerase chain reaction procedure also may be employed
to isolate a DNA sequence encoding a desired protein fragment.
[0032] In another approach, enzymatic treatment (e.g., using Bal 31
exonuclease) may be employed to delete terminal nucleotides from a
DNA fragment to obtain a fragment having a particular desired
terminus. Among the commercially available linkers are those that
can be ligated to the blunt ends produced by Bal 31 digestion, and
which contain restriction endonuclease cleavage site(s).
Alternatively, oligonucleotides that reconstruct the N- or
C-terminus of a DNA fragment to a desired point may be synthesized.
The oligonucleotide may contain a restriction endonuclease cleavage
site upstream of the desired coding sequence and position an
initiation codon (ATG) at the N-terminus of the coding
sequence.
[0033] The present invention provides purified CD30-L polypeptides,
both recombinant and non-recombinant. Variants and derivatives of
native CD30-L proteins that retain the desired biological activity
are also within the scope of the present invention. CD30-L variants
may be obtained by mutations of nucleotide sequences coding for
native CD30-L polypeptides. A CD30-L variant, as referred to
herein, is a polypeptide substantially homologous to a native
CD30-L, but which has an amino acid sequence different from that of
native CD30-L (human, murine or other mammalian species) because of
one or a plurality of deletions, insertions or substitutions.
[0034] The variant amino acid sequence preferably is at least 80%
identical to a native CD30-L amino acid sequence, most preferably
at least 90% identical. The degree of homology (percent identity)
may be determined, for example, by comparing sequence information
using the GAP computer program, version 6.0 described by Devereux
et al. (Nucl. Acids Res. 12:387, 1984) and available from the
University of Wisconsin Genetics Computer Group (UWGCG). The GAP
program utilizes the alignment method of Needleman and Wunsch (J.
Mol. Biol. 48:443, 1970), as revised by Smith and Waterman (Adv.
Appl. Math 2:482, 1981). The preferred default parameters for the
GAP program include: (1) a unary comparison matrix (containing a
value of 1 for identities and 0 for non-identities) for
nucleotides, and the weighted comparison matrix of Gribskov and
Burgess, Nucl. Acids Res. 14:6745, 1986, as described by Schwartz
and Dayhoff, eds., Atlas of Protein Sequence and Structure,
National Biomedical Research Foundation, pp. 353-358, 1979; (2) a
penalty of 3.0 for each gap and an additional 0.10 penalty for each
symbol in each gap; and (3) no penalty for end gaps.
[0035] Alterations of the native amino acid sequence may be
accomplished by any of a number of known techniques. Mutations can
be introduced at particular loci by synthesizing oligonucleotides
containing a mutant sequence, flanked by restriction sites enabling
ligation to fragments of the native sequence. Following ligation,
the resulting reconstructed sequence encodes an analog having the
desired amino acid insertion, substitution, or deletion.
[0036] Alternatively, oligonucleotide-directed site-specific
mutagenesis procedures can be employed to provide an altered gene
having particular codons altered according to the substitution,
deletion, or insertion required. Exemplary methods of making such
alterations are disclosed by Walder et al. (Gene 42:133, 1986);
Bauer et al. (Gene 37:73, 1985); Craik (BioTechniques, Jan. 1985,
12-19); Smith et al. (Genetic Engineering: Principles and Methods,
Plenum Press, 1981); and U.S. Pat. Nos. 4,518,584 and 4,737,462,
which are incorporated by reference herein.
[0037] Variants may comprise conservatively substituted sequences,
meaning that a given amino acid residue is replaced by a residue
having similar physiochemical characteristics. Examples of
conservative substitutions include substitution of one aliphatic
residue for another, such as Ile, Val, Leu, or Ala for one another,
or substitutions of one polar residue for another, such as between
Lys and Arg; Glu and Asp; or Gln and Asn. Other such conservative
substitutions, for example, substitutions of entire regions having
similar hydrophobicity characteristics, are well known.
[0038] CD30-L also may be modified to create CD30-L derivatives by
forming covalent or aggregative conjugates with other chemical
moieties, such as glycosyl groups, lipids, phosphate, acetyl groups
and the like. Covalent derivatives of CD30-L may be prepared by
linking the chemical moieties to functional groups on CD30-L amino
acid side chains or at the N-terminus or C-terminus of a CD30-L
polypeptide or the extracellular domain thereof. Other derivatives
of CD30-L within the scope of this invention include covalent or
aggregative conjugates of CD30-L or its fragments with other
proteins or polypeptides, such as by synthesis in recombinant
culture as N-terminal or C-terminal fusions. For example, the
conjugate may comprise a signal or leader polypeptide sequence
(e.g. the .alpha.-factor leader of Saccharomyces) at the N-terminus
of a soluble CD30-L polypeptide. The signal or leader peptide
co-translationally or post-translationally directs transfer of the
conjugate from its site of synthesis to a site inside or outside of
the cell membrane or cell wall.
[0039] CD30-L polypeptide fusions can comprise peptides added to
facilitate purification and identification of CD30-L. Such peptides
include, for example, poly-His or the antigenic identification
peptides described in U.S. Pat. No. 5,011,912 and in Hopp et al.,
Bio/Technology 6:1204, 1988. One such peptide is the FLAG.RTM.
peptide, Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys (DYKDDDDK) (SEQ ID NO:15),
which is highly antigenic and provides an epitope reversibly bound
by a specific monoclonal antibody enabling rapid assay and facile
purification of expressed recombinant protein. This sequence is
also specifically cleaved by bovine mucosal enterokinase at the
residue immediately following the Asp-Lys pairing. Fusion proteins
capped with this peptide may also be resistant to intracellular
degradation in E. coli. A murine hybridoma designated 4E11 produces
a monoclonal antibody that binds the peptide DYKDDDDK (SEQ ID
NO:15) in the presence of certain divalent metal cations (as
described in U.S. Pat. No. 5,011,912) and has been deposited with
the American Type Culture Collection under accession no HB
9259.
[0040] The present invention further includes CD30-L polypeptides
with or without associated native-pattern glycosylation. CD30-L
expressed in yeast or mammalian expression systems (e.g., COS-7
cells) may be similar to or significantly different from a native
CD30-L polypeptide in molecular weight and glycosylation pattern,
depending upon the choice of expression system. Expression of
CD30-L polypeptides in bacterial expression systems, such as E.
coli, provides non-glycosylated molecules.
[0041] DNA constructs that encode various additions or
substitutions of amino acid residues or sequences, or deletions of
terminal or internal residues or sequences not needed for
biological activity or binding can be prepared. For example,
N-glycosylation sites in the CD30-L extracellular domain can be
modified to preclude glycosylation while allowing expression of a
homogeneous, reduced carbohydrate analog using yeast or mammalian
expression systems. N-glycosylation sites in eukaryotic
polypeptides are characterized by an amino acid triplet Asn-X-Y,
wherein X is any amino acid except Pro and Y is Ser or Thr.
Appropriate modifications to the nucleotide sequence encoding this
triplet will result in substitutions, additions or deletions that
prevent attachment of carbohydrate residues at the Asn side chain.
Alteration of a single nucleotide, chosen so that Asn is replaced
by a different amino acid, for example, is sufficient to inactivate
an N-glycosylation site. Known procedures for inactivating
N-glycosylation sites in proteins include those described in U.S.
Pat. No. 5,071,972 and EP 276,846.
[0042] In another example, sequences encoding Cys residues that are
not essential for biological activity can be altered to cause the
Cys residues to be deleted or replaced with other amino acids,
preventing formation of incorrect intramolecular disulfide bridges
upon renaturation. Other variants are prepared by modification of
adjacent dibasic amino acid residues to enhance expression in yeast
systems in which KEX2 protease activity is present. EP 212,914
discloses the use of site-specific mutagenesis to inactivate KEX2
protease processing sites in a protein. KEX2 protease processing
sites are inactivated by deleting, adding or substituting residues
to alter Arg-Arg, Arg-Lys, and Lys-Arg pairs to eliminate the
occurrence of these adjacent basic residues. Lys-Lys pairings are
considerably less susceptible to KEX2 cleavage, and conversion of
Arg-Lys or Lys-Arg to Lys-Lys represents a conservative and
preferred approach to inactivating KEX2 sites. The resulting
muteins are less susceptible to cleavage by the KEX2 protease at
locations other than the yeast .alpha.-factor leader sequence,
where cleavage upon secretion is intended.
[0043] Naturally occurring CD30-L variants are also encompassed by
the present invention. Examples of such variants are proteins that
result from alternative mRNA splicing events (since CD30-L
presumably is encoded by a multi-exon gene) or from proteolytic
cleavage of the CD30-L protein, wherein the CD30-binding property
is retained. Alternative splicing of mRNA may yield a truncated but
biologically active CD30-L protein, such as a naturally occurring
soluble form of the protein, for example. Variations attributable
to proteolysis include, for example, differences in the N- or
C-termini upon expression in different types of host cells, due to
proteolytic removal of one or more terminal amino acids from the
CD30-L protein (generally from 1-5 terminal amino acids).
[0044] Nucleic acid sequences within the scope of the present
invention include isolated DNA and RNA sequences that hybridize to
the CD30-L nucleotide sequences disclosed herein under conditions
of moderate or severe stringency, and which encode biologically
active CD30-L. Moderate stringency hybridization conditions refer
to conditions described in, for example, Sambrook et al. Molecular
Cloning: A Laboratory Manual, 2 ed. Vol. 1, pp. 1.101-104, Cold
Spring Harbor Laboratory Press, (1989). Conditions of moderate
stringency, as defined by Sambrook et al., include use of a
prewashing solution of 5.times.SSC, 0.5% SDS, 1.0 mM EDTA (pH 8.0)
and hybridization conditions of about 55.degree. C., 5.times.SSC,
overnight. Conditions of severe stringency include higher
temperatures of hybridization and washing. The skilled artisan will
recognize that the temperature and wash solution salt concentration
may be adjusted as necessary according to factors such as the
length of the probe. One embodiment of the invention is directed to
DNA sequences that will hybridize under severely stringent
conditions to a DNA sequence comprising the coding region of a
CD30-L clone disclosed herein. The severely stringent conditions
include hybridization at 68.degree. C. followed by washing in
0.1.times.SSC/0.1% SDS at 63-68.degree. C.
[0045] The present invention thus provides isolated DNA sequences
encoding biologically active CD30-L, selected from: (a) DNA derived
from the coding region of a native mammalian CD30-L gene (e.g., DNA
comprising the nucleotide sequence presented in SEQ ID NOS: 5, 7,
18, or 22; (b) DNA capable of hybridization to a DNA of (a) under
moderately (or severely) stringent conditions and which encodes
biologically active CD30-L; and (c) DNA which is degenerate as a
result of the genetic code to a DNA defined in (a) or (b) and which
encodes biologically active CD30-L. CD30-L proteins encoded by the
DNA sequences of (a), (b) and (c) are encompassed by the present
invention.
[0046] Examples of CD30-L proteins encoded by DNA that varies from
the native DNA sequences of SEQ ID NOS: 5, 7, 18, or 22, wherein
the variant DNA will hybridize to a native DNA sequence under
moderately stringent conditions, include, but are not limited to,
CD30-L fragments (soluble or membrane-bound) and CD30-L proteins
comprising inactivated N-glycosylation site(s), inactivated KEX2
protease processing site(s), or conservative amino acid
substitution(s), as described above. CD30-L proteins encoded by DNA
derived from other mammalian species, wherein the DNA will
hybridize to the human or murine DNA of SEQ ID NOS: 5, 7, 18, or
22, are also encompassed.
[0047] Variants possessing the requisite ability to bind CD30 may
be identified by any suitable assay. Biological activity of CD30-L
may be determined, for example, by competition for binding to the
ligand binding domain of CD30 (i.e. competitive binding
assays).
[0048] One type of a competitive binding assay for CD30-L
polypeptide uses a radiolabeled, soluble human or murine CD30-L and
intact cells expressing cell surface CD30 (e.g., cell lines such as
HUT102, described by Durkop et al., supra). Instead of intact
cells, one could substitute soluble CD30 bound to a solid phase
(such as a CD30/Fc fusion protein bound to a Protein A or Protein G
column through interaction with the Fc region of the fusion
protein). Another type of competitive binding assay utilizes
radiolabeled soluble CD30 such as a CD30/Fc fusion protein, and
intact cells expressing CD30-L. Alternatively, soluble CD30-L could
be bound to a solid phase.
[0049] Competitive binding assays can be performed using standard
methodology. For example, radiolabeled murine CD30-L can be used to
compete with a putative CD30-L homolog to assay for binding
activity against surface-bound CD30. Qualitative results can be
obtained by competitive autoradiographic plate binding assays, or
Scatchard plots may be utilized to generate quantitative
results.
[0050] Competitive binding assays with intact cells expressing CD30
can be performed by two methods. In a first method, cells
expressing cell surface CD30 are grown either in suspension or by
adherence to tissue culture plates. Adherent cells can be removed
by treatment with 5 mM EDTA treatment for ten minutes at 37.degree.
C. In a second method, transfected COS cells expressing
membrane-bound CD30 can be used. COS cells or another mammalian
cell can be transfected with human CD30 cDNA in an appropriate
vector to express full length CD30 with an extracellular
region.
[0051] Alternatively, soluble CD30 can be bound to a solid phase
such as a column chromatography matrix or a similar substrate
suitable for analysis for the presence of a detectable moiety such
as .sup.125I. Binding to a solid phase can be accomplished, for
example, by obtaining a CD30/Fc fusion protein and binding it to a
protein A or protein G-containing matrix.
[0052] Another means to measure the biological activity of CD30-L
(including variants) is to utilize conjugated, soluble CD30 (for
example, .sup.125I-CD30/Fc) in competition assays similar to those
described above. In this case, however, intact cells expressing
CD30-L, or soluble CD30-L bound to a solid substrate, are used to
measure competition for binding of labeled, soluble CD30 to CD30-L
by a sample containing a putative CD30-L variant.
[0053] The CD30-L of the present invention can be used in a binding
assay to detect cells expressing CD30. For example, CD30-L or an
extracellular domain or a fragment thereof can be conjugated to a
detectable moiety such as .sup.125I. Radiolabeling with .sup.125I
can be performed by any of several standard methodologies that
yield a functional .sup.125I-CD30-L molecule labeled to high
specific activity. Alternatively, another detectable moiety such as
an enzyme that can catalyze a colorometric or fluorometric
reaction, biotin or avidin may be used. Cells to be tested for CD30
expression can be contacted with conjugated CD30-L. After
incubation, unbound conjugated CD30-L is removed and binding is
measured using the detectable moiety.
[0054] The CD30 ligand proteins disclosed herein also may be
employed to measure the biological activity of CD30 protein in
terms of binding affinity for CD30-L. To illustrate, CD30-L may be
employed in a binding affinity study to measure the biological
activity of a CD30 protein that has been stored at different
temperatures, or produced in different cell types. The biological
activity of a CD30 protein thus can be ascertained before it is
used in a research study, for example.
[0055] CD30-L proteins find use as reagents that may be employed by
those conducting "quality assurance" studies, e.g., to monitor
shelf life and stability of CD30 protein under different
conditions. CD30 ligands may be used in determining whether
biological activity is retained after modification of a CD30
protein (e.g., chemical modification, truncation, mutation, etc.).
The binding affinity of the modified CD30 protein for a CD30-L is
compared to that of an unmodified CD30 protein to detect any
adverse impact of the modifications on biological activity of
CD30.
[0056] A different use of a CD30 ligand is as a reagent in protein
purification procedures. CD30-L or CD30-L/Fc fusion proteins may be
attached to a solid support material by conventional techniques and
used to purify CD30 by affinity chromatography.
[0057] CD30-L polypeptides also find use as carriers for delivering
agents attached thereto to cells bearing the CD30 cell surface
antigen. As discussed above, CD30 has been detected on cells that
include, but are not limited to, cells associated with various
lymphoid malignancies, e.g., Hodgkin's Disease tumor cells and
certain non-Hodgkin's lymphoma cells, e.g., large cell anaplastic
lymphoma (LCAL) cells. CD30.sup.+ LCALs are characterized by the
presence of strong CD30 surface expression on the anaplastic
lymphoma cells (Stein et al., Blood 66:848, 1985). CD30-L
polypeptides thus can be used to deliver diagnostic or therapeutic
agents to these cells (or to other cell types found to express CD30
on the cell surface) in in vitro or in vivo procedures. CD30.sup.+
cells are contacted with a conjugate comprising a diagnostic or
therapeutic agent attached to a CD30-L polypeptide. The CD30-L
binds to the target cells, thus allowing detection thereof (in the
case of diagnostic agents) or treatment thereof (with therapeutic
agents).
[0058] One example of such use is to expose a CD30.sup.+ lymphoma
cell line to a therapeutic agent/CD30-L conjugate to assess whether
the agent exhibits cytotoxicity toward the lymphoma cells. A number
of different therapeutic agents attached to CD30-L may be included
in an assay to detect and compare the cytotoxic effects of the
agents on the lymphoma cells. CD30-L/diagnostic agent conjugates
may be employed to detect the presence of CD30.sup.+ cells in vitro
or in vivo.
[0059] Diagnostic and therapeutic agents that may be attached to a
CD30-L polypeptide include, but are not limited to, drugs, toxins,
radionuclides, chromophores, enzymes that catalyze a colorimetric
or fluorometric reaction, and the like, with the particular agent
being chosen according to the intended application. Examples of
drugs include those used in treating various forms of cancer, e.g.,
mechlorethamine, procarbazine, prednisone, dacarbazine, nitrogen
mustards such as L-phenylalanine nitrogen mustard or
cyclophosphamide, intercalating agents such as
cis-diaminodichloroplatinum, antimetabolites such as
5-fluorouracil, vinca alkaloids such as vincristine or vinblastine,
and antibiotics such as calicheamycin, bleomycin, doxorubicin,
daunorubicin, and derivatives thereof. Combinations of such drugs,
attached to CD30-L, may be employed. Among the toxins are ricin,
abrin, saporin toxin, diptheria toxin, Pseudomonas aeruginosa
exotoxin A, ribosomal inactivating proteins, mycotoxins such as
trichothecenes, and derivatives and fragments (e.g., single chains)
thereof. Radionuclides suitable for diagnostic use include, but are
not limited to, .sup.123I, .sup.131I, .sup.99mTc, .sup.111In, and
.sup.76Br. Radionuclides suitable for therapeutic use include, but
are not limited to, .sup.131I, .sup.211At, .sup.77Br, .sup.186Re,
.sup.188Re, .sup.212Pb, .sup.212Bi, .sup.109Pd, .sup.64Cu, and
.sup.67Cu.
[0060] Such agents may be attached to the CD30-L by any suitable
conventional procedure. CD30-L, being a protein, comprises
functional groups on amino acid side chains that can be reacted
with functional groups on a desired agent to form covalent bonds,
for example. The agent may be covalently linked to CD30-L via an
amide bond, hindered disulfide bond, acid-cleavable linkage, and
the like, which are among the conventional linkages chosen
according to such factors as the structure of the desired agent.
Alternatively, CD30-L or the agent to be linked thereto may be
derivatized to generate or attach a desired reactive functional
group. The derivatization may involve attachment of one of the
bifunctional coupling reagents available for linking various
molecules to proteins (Pierce Chemical Company, Rockford, Ill.). A
number of techniques for radiolabeling proteins are known. One such
method involves use of the IODO-GEN reagent (Pierce Chemical
Company) to radioiodinate a CD30-L polypeptide. Radionuclide metals
may be attached to CD30-L by using a suitable bifunctional
chelating agent, examples of which are described in U.S. Pat. Nos.
4,897,255 and 4,965,392.
[0061] Conjugates comprising CD30-L and a suitable diagnostic or
therapeutic agent (preferably covalently linked) are thus prepared.
The conjugates are administered or otherwise employed in an amount
appropriate for the particular application.
[0062] Preferred therapeutic agents are radionuclides and drugs. In
one embodiment of the invention, the anti-tumor drug calicheamycin
is attached to a soluble human CD30 ligand polypeptide.
[0063] As illustrated in examples 8 and 13, CD30 ligand
polypeptides of the present invention have been found to reduce
proliferation of LCAL cell lines. The CD30-L was employed in
unlabeled form, i.e., did not have any therapeutic agent attached
thereto. Thus, one embodiment of the present invention is directed
to a method for inhibiting proliferation of CD30.sup.+ LCAL cells
by contacting said cells with a CD30-L polypeptide. The present
invention further provides a method for treating LCAL, involving
administering a therapeutically effective amount of a CD30-L
polypeptide to a patient afflicted with LCAL.
[0064] Hybridoma cell lines that produce two monoclonal antibodies
(MAbs) designated M44 and M67 were generated as described in
example 12, using a soluble human CD30/Fc fusion protein as the
immunogen. The M44 and M67 MAbs exhibited certain biological
activities in common with CD30-L, one of which is reduction of
proliferation of LCAL cells. Thus, the present invention also
provides a method of inhibiting proliferation of CD30.sup.+ LCAL
cells by contacting said cells with M44, M67, or a combination
thereof. The M44 or M67 antibodies may be substituted for CD30-L in
the above-described method for treating LCAL patients. M44 and M67
are also useful for delivering diagnostic or cytotoxic agents
attached thereto to any CD30.sup.+ cells. "Humanized" or chimeric
versions of these antibodies (e.g., comprising a human constant
region), may be produced by known techniques and employed in the
foregoing methods. Antigen-binding antibody fragments (e.g., Fab,
Fab', or F(ab').sub.2 fragments) also may be employed.
Oligomeric Forms of CD30-L
[0065] CD30-L polypeptides may exist as oligomers, such as dimers
or trimers. Oligomers may be linked by disulfide bonds formed
between cysteine residues on different CD30-L polypeptides. In one
embodiment of the invention, a CD30-L dimer is created by fusing
CD30-L to the Fc region of an antibody (IgG1) in a manner that does
not interfere with binding of CD30-L to the CD30 ligand binding
domain. The Fc polypeptide preferably is fused to the N-terminus of
a soluble CD30-L (comprising only the extracellular domain). A
procedure for isolating DNA encoding an IgG1 Fc region for use in
preparing fusion proteins is presented in example 1 below. A gene
fusion encoding the CD30-L/Fc fusion protein is inserted into an
appropriate expression vector. The CD30-L/Fc fusion proteins are
allowed to assemble much like antibody molecules, whereupon
interchain disulfide bonds form between Fc polypeptides, yielding
divalent CD30-L. If fusion proteins are made with both heavy and
light chains of an antibody, it is possible to form a CD30-L
oligomer with as many as four CD30-L extracellular regions.
[0066] Alternatively, one can link multiple copies of CD30-L via
peptide linkers. A fusion protein comprising two or more copies of
CD30-L (preferably soluble CD30-L polypeptides), separated by
peptide linkers, may be produced by recombinant DNA technology.
Among the peptide linkers that may be employed are amino acid
chains that are from 5 to 100 amino acids in length, preferably
comprising amino acids selected from the group consisting of
glycine, asparagine, serine, threonine, and alanine. The production
of recombinant fusion proteins comprising peptide linkers is
illustrated in U.S. Pat. No. 5,073,627, for example, which is
hereby incorporated by reference.
[0067] The present invention provides oligomers of CD30-L
extracellular domains or fragments thereof, linked by disulfide
bonds, or expressed as fusion proteins with or without spacer amino
acid linking groups. For example, a dimer CD30-L molecule can be
linked by an IgG Fc region linking group. Analysis of expressed
recombinant CD30-L of the present invention by SDS-PAGE revealed
both monomeric and oligomeric forms of the protein. The CD30-L
proteins of the present invention are believed to form oligomers
(disulfide-bonded dimers, trimers and higher oligomers)
intracellularly. The oligomers then become attached to the cell
surface via the transmembrane region of the protein.
Expression Systems
[0068] The present invention provides recombinant expression
vectors for expression of CD30-L, and host cells transformed with
the expression vectors. Any suitable expression system may be
employed. The vectors include a CD30-L DNA sequence (e.g., a
synthetic or cDNA-derived DNA sequence encoding a CD30-L
polypeptide) operably linked to suitable transcriptional or
translational regulatory nucleotide sequences, such as those
derived from a mammalian, microbial, viral, or insect gene.
Examples of regulatory sequences include transcriptional promoters,
operators, or enhancers, an mRNA ribosomal binding site, and
appropriate sequences which control transcription and translation
initiation and termination. Nucleotide sequences are operably
linked when the regulatory sequence functionally relates to the
CD30-L DNA sequence. Thus, a promoter nucleotide sequence is
operably linked to a CD30-L DNA sequence if the promoter nucleotide
sequence controls the transcription of the CD30-L DNA sequence. The
ability to replicate in the desired host cells, usually conferred
by an origin of replication, and a selection gene by which
transformants are identified, may additionally be incorporated into
the expression vector.
[0069] In addition, sequences encoding appropriate signal peptides
that are not native to the CD30-L gene can be incorporated into
expression vectors. For example, a DNA sequence for a signal
peptide (secretory leader) may be fused in frame to the CD30-L
sequence so that the CD30-L is initially translated as a fusion
protein comprising the signal peptide. A signal peptide fused to
the N-terminus of a soluble CD30-L protein promotes extracellular
secretion of the CD30-L. The signal peptide is cleaved from the
CD30-L polypeptide upon secretion of CD30-L from the cell. Signal
peptides are chosen according to the intended host cells, and
representative examples are described below.
[0070] Suitable host cells for expression of CD30-L polypeptides
include prokaryotes, yeast or higher eukaryotic cells. Appropriate
cloning and expression vectors for use with bacterial, fungal,
yeast, and mammalian cellular hosts are described, for example, in
Pouwels et al. Cloning Vectors: A Laboratory Manual, Elsevier,
N.Y., (1985). Cell-free translation systems could also be employed
to produce CD30-L polypeptides using RNAs derived from DNA
constructs disclosed herein.
[0071] Prokaryotes include gram negative or gram positive
organisms, for example, E. coli or Bacilli. Suitable prokaryotic
host cells for transformation include, for example, E. coli,
Bacillus subtilis, Salmonella typhimurium, and various other
species within the genera Pseudomonas, Streptomyces, and
Staphylococcus. In a prokaryotic host cell, such as E. coli, a
CD30-L polypeptide may include an N-terminal methionine residue to
facilitate expression of the recombinant polypeptide in the
prokaryotic host cell. The N-terminal Met may be cleaved from the
expressed recombinant CD30-L polypeptide.
[0072] Expression vectors for use in prokaryotic host cells
generally comprise one or more phenotypic selectable marker genes.
A phenotypic selectable marker gene is, for example, a gene
encoding a protein that confers antibiotic resistance or that
supplies an autotrophic requirement. Examples of useful expression
vectors for prokaryotic host cells include those derived from
commercially available plasmids such as the cloning vector pBR322
(ATCC 37017). pBR322 contains genes for ampicillin and tetracycline
resistance and thus provides simple means for identifying
transformed cells. An appropriate promoter and a CD30-L DNA
sequence are inserted into the pBR322 vector. Other commercially
available vectors include, for example, pKK223-3 (Pharmacia Fine
Chemicals, Uppsala, Sweden) and pGEM1 (Promega Biotec, Madison,
Wis., USA).
[0073] Promoter sequences commonly used for recombinant prokaryotic
host cell expression vectors include .beta.-lactamase
(penicillinase), lactose promoter system (Chang et al., Nature
275:615, 1978; and Goeddel et al., Nature 281:544, 1979),
tryptophan (trp) promoter system (Goeddel et al., Nucl. Acids Res.
8:4057, 1980; and EP-A-36776) and tac promoter (Maniatis, Molecular
Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, p.
412, 1982). A particularly useful prokaryotic host cell expression
system employs a phage .lamda. P.sub.L promoter and a cI857ts
thermolabile repressor sequence. Plasmid vectors available from the
American Type Culture Collection which incorporate derivatives of
the .lamda. P.sub.L promoter include plasmid pHUB2 (resident in E.
coli strain JMB9 (ATCC 37092)) and pPLc28 (resident in E. coli RR1
(ATCC 53082)).
[0074] CD30-L alternatively may be expressed in yeast host cells,
preferably from the Saccharomyces genus (e.g., S. cerevisiae).
Other genera of yeast, such as Pichia or Kluyveromyces, may also be
employed. Yeast vectors will often contain an origin of replication
sequence from a 2.mu. yeast plasmid, an autonomously replicating
sequence (ARS), a promoter region, sequences for polyadenylation,
sequences for transcription termination, and a selectable marker
gene. Suitable promoter sequences for yeast vectors include, among
others, promoters for metallothionein, 3-phosphoglycerate kinase
(Hitzeman et al., J. Biol. Chem. 255:2073, 1980) or other
glycolytic enzymes (Hess et al., J. Adv. Enzyme Reg. 7:149, 1968;
and Holland et al., Biochem. 17:4900, 1978), such as enolase,
glyceraldehyde-3-phosphate dehydrogenase, hexokinase, pyruvate
decarboxylase, phosphofructokinase, glucose-6-phosphate isomerase,
3-phosphoglycerate mutase, pyruvate kinase, triosephosphate
isomerase, phosphoglucose isomerase, and glucokinase. Other
suitable vectors and promoters for use in yeast expression are
further described in Hitzeman, EPA-73,657. Another alternative is
the glucose-repressible ADH2 promoter described by Russell et al.
(J. Biol. Chem. 258:2674, 1982) and Beier et al. (Nature 300:724,
1982). Shuttle vectors replicable in both yeast and E. coli may be
constructed by inserting DNA sequences from pBR322 for selection
and replication in E. coli (Amp.sup.r gene and origin of
replication) into the above-described yeast vectors.
[0075] The yeast .alpha.-factor leader sequence may be employed to
direct secretion of the CD30-L polypeptide. The .alpha.-factor
leader sequence is often inserted between the promoter sequence and
the structural gene sequence. See, e.g., Kurjan et al., Cell
30:933, 1982; Bitter et al., Proc. Natl. Acad. Sci. USA 81:5330,
1984; U.S. Pat. No. 4,546,082; and EP 324,274. Other leader
sequences suitable for facilitating secretion of recombinant
polypeptides from yeast hosts are known to those of skill in the
art. A leader sequence may be modified near its 3' end to contain
one or more restriction sites. This will facilitate fusion of the
leader sequence to the structural gene.
[0076] Yeast transformation protocols are known to those of skill
in the art. One such protocol is described by Hinnen et al., Proc.
Natl. Acad. Sci. USA 75:1929, 1978. The Hinnen et al. protocol
selects for Trp.sup.+ transformants in a selective medium, wherein
the selective medium consists of 0.67% yeast nitrogen base, 0.5%
casamino acids, 2% glucose, 10 .mu.g/ml adenine and 20 .mu.g/ml
uracil.
[0077] Yeast host cells transformed by vectors containing ADH2
promoter sequence may be grown for inducing expression in a "rich"
medium. An example of a rich medium is one consisting of 1% yeast
extract, 2% peptone, and 1% glucose supplemented with 80 .mu.g/ml
adenine and 80 .mu.g/ml uracil. Derepression of the ADH2 promoter
occurs when glucose is exhausted from the medium.
[0078] Mammalian or insect host cell culture systems could also be
employed to express recombinant CD30-L polypeptides. Baculovirus
systems for production of heterologous proteins in insect cells are
reviewed by Luckow and Summers, Bio/Technology 6:47 (1988).
Established cell lines of mammalian origin also may be employed.
Examples of suitable mammalian host cell lines include the COS-7
line of monkey kidney cells (ATCC CRL 1651) (Gluzman et al., Cell
23:175, 1981), L cells, C127 cells, 3T3 cells (ATCC CCL 163),
Chinese hamster ovary (CHO) cells, HeLa cells, and BHK (ATCC CRL
10) cell lines, and the CV1/EBNA cell line derived from the African
green monkey kidney cell line CV1 (ATCC CCL 70) as described by
McMahan et al. (EMBO J. 10: 2821, 1991).
[0079] Transcriptional and translational control sequences for
mammalian host cell expression vectors may be excised from viral
genomes. Commonly used promoter sequences and enhancer sequences
are derived from Polyoma virus, Adenovirus 2, Simian Virus 40
(SV40), and human cytomegalovirus. DNA sequences derived from the
SV40 viral genome, for example, SV40 origin, early and late
promoter, enhancer, splice, and polyadenylation sites may be used
to provide other genetic elements for expression of a structural
gene sequence in a mammalian host cell. Viral early and late
promoters are particularly useful because both are easily obtained
from a viral genome as a fragment which may also contain a viral
origin of replication (Fiers et al., Nature 273:113, 1978). Smaller
or larger SV40 fragments may also be used, provided the
approximately 250 bp sequence extending from the Hind III site
toward the Bgl I site located in the SV40 viral origin of
replication site is included.
[0080] Expression vectors for use in mammalian host cells can be
constructed as disclosed by Okayama and Berg (Mol. Cell. Biol.
3:280, 1983). A useful system for stable high level expression of
mammalian cDNAs in C127 murine mammary epithelial cells can be
constructed substantially as described by Cosman et al. (Mol.
Immunol. 23:935, 1986). A useful high expression vector, PMLSV
N1/N4, described by Cosman et al., Nature 312:768, 1984 has been
deposited as ATCC 39890. Additional useful mammalian expression
vectors are described in EP-A-0367566, and PCT Application WO
91/18982, incorporated by reference herein. The vectors may be
derived from retroviruses. To achieve secretion of CD30-L (a type
II protein lacking a native signal sequence), a heterologous signal
sequence may be added. Examples of signal peptides useful in
mammalian expression systems are the signal sequence for
interleukin-7 (IL-7) described in U.S. Pat. No. 4,965,195; the
signal sequence for interleukin-2 receptor described in Cosman et
al., Nature 312:768 (1984); the interleukin-4 signal peptide
described in EP 367,566; the type I interleukin-1 receptor signal
peptide described in U.S. Pat. No. 4,968,607; and the type II
interleukin-1 receptor signal peptide described in EP 460,846. Each
of these references describing signal peptides is hereby
incorporated by reference.
CD30 Ligand Protein
[0081] The present invention provides substantially homogeneous
CD30-L protein, which may be produced by recombinant expression
systems as described above or purified from naturally occurring
cells. The CD30-L is purified to substantial homogeneity, as
indicated by a single protein band upon analysis by
SDS-polyacrylamide gel electrophoresis (SDS-PAGE).
[0082] In one embodiment of the present invention, CD30-L is
purified from a cellular source using any suitable protein
purification technique. The cells may, for example, be activated
T-lymphocytes from a mammalian species of interest, such as the
murine cell line 7B9 described in examples 2 and 3 or induced human
peripheral blood T-cells.
[0083] An alternative process for producing the CD30-L protein
comprises culturing a host cell transformed with an expression
vector comprising a DNA sequence that encodes CD30-L under
conditions such that CD30-L is expressed. The CD30-L protein is
then recovered from culture medium or cell extracts, depending upon
the expression system employed. As the skilled artisan will
recognize, procedures for purifying the recombinant CD30-L will
vary according to such factors as the type of host cells employed
and whether or not the CD-30-L is secreted into the culture
medium.
[0084] For example, when expression systems that secrete the
recombinant protein are employed, the culture medium first may be
concentrated using a commercially available protein concentration
filter, for example, an Amicon or Millipore Pellicon
ultrafiltration unit. Following the concentration step, the
concentrate can be applied to a purification matrix such as a gel
filtration medium. Alternatively, an anion exchange resin can be
employed, for example, a matrix or substrate having pendant
diethylaminoethyl (DEAE) groups. The matrices can be acrylamide,
agarose, dextran, cellulose or other types commonly employed in
protein purification. Alternatively, a cation exchange step can be
employed. Suitable cation exchangers include various insoluble
matrices comprising sulfopropyl or carboxymethyl groups.
Sulfopropyl groups are preferred. Finally, one or more
reversed-phase high performance liquid chromatography (RP-HPLC)
steps employing hydrophobic RP-HPLC media, (e.g., silica gel having
pendant methyl or other aliphatic groups) can be employed to
further purify CD30-L. Some or all of the foregoing purification
steps, in various combinations, can be employed to provide a
substantially homogeneous recombinant protein.
[0085] It is also possible to utilize an affinity column comprising
the ligand binding domain of CD30 to affinity-purify expressed
CD30-L polypeptides. CD30-L polypeptides can be removed from an
affinity column in a high salt elution buffer and then dialyzed
into a lower salt buffer for use. Alternatively, the affinity
column may comprise an antibody that binds CD30-L. Example 5
describes a procedure for employing the CD30-L protein of the
present invention to generate monoclonal antibodies directed
against CD30-L.
[0086] Recombinant protein produced in bacterial culture is usually
isolated by initial disruption of the host cells, centrifugation,
extraction from cell pellets if an insoluble polypeptide, or from
the supernatant fluid if a soluble polypeptide, followed by one or
more concentration, salting-out, ion exchange, affinity
purification or size exclusion chromatography steps. Finally,
RP-HPLC can be employed for final purification steps. Microbial
cells can be disrupted by any convenient method, including
freeze-thaw cycling, sonication, mechanical disruption, or use of
cell lysing agents.
[0087] Transformed yeast host cells are preferably employed to
express CD30-L as a secreted polypeptide. This simplifies
purification. Secreted recombinant polypeptide from a yeast host
cell fermentation can be purified by methods analogous to those
disclosed by Urdal et al. (J. Chromatog. 296:171, 1984). Urdal et
al. describe two sequential, reversed-phase HPLC steps for
purification of recombinant human IL-2 on a preparative HPLC
column.
[0088] The present invention provides pharmaceutical compositions
comprising an effective amount of a purified CD30-L polypeptide and
a suitable diluent, excipient, or carrier. Such carriers will be
nontoxic to patients at the dosages and concentrations employed.
Ordinarily, the preparation of such compositions entails combining
a mammalian CD30-L polypeptide or derivative thereof with buffers,
antioxidants such as ascorbic acid, low molecular weight (less than
about 10 residues) peptides, proteins, amino acids, carbohydrates
including glucose, sucrose, or dextrans, chelating agents such as
EDTA, glutathione, or other stabilizers and excipients. Neutral
buffered saline is one appropriate diluent.
[0089] For therapeutic use, the compositions are administered in a
manner and dosage appropriate to the indication and the patient. As
will be understood by one skilled in the pertinent field, a
therapeutically effective dosage will vary according to such
factors as the nature and severity of the disorder to be treated
and the age, condition, and size of the patient. Administration may
be by any suitable route, including but not limited to intravenous
injection, continuous infusion, local infusion during surgery, or
sustained release from implants (gels, membranes, and the
like).
[0090] The compositions of the present invention may contain a
CD30-L protein in any form described above, including variants,
derivatives, biologically active fragments, and oligomeric forms
thereof. CD30-L derived from the same mammalian species as the
patient is generally preferred for use in pharmaceutical
compositions. In one embodiment of the invention, the composition
comprises a soluble human CD30-L protein. Such protein may be in
the form of dimers comprising the extracellular domain of human
CD30-L fused to an Fc polypeptide, as described above. In another
embodiment of the invention, the pharmaceutical composition
comprises a CD30-L polypeptide having a diagnostic or therapeutic
agent attached thereto. Such compositions may be administered to
diagnose or treat conditions characterized by CD30.sup.+ cells,
e.g., Hodgkin's Disease or large cell anaplastic lymphomas, as
discussed above. A composition comprising unlabeled CD30-L may be
used in treating LCAL. The foregoing compositions may additionally
contain, or be co-administered with, additional agents effective in
treating malignancies characterized by CD30.sup.+ cells.
Nucleic Acid Fragments
[0091] The present invention further provides fragments of the
CD30-L nucleotide sequences presented herein. Such fragments
desirably comprise at least about 14 nucleotides of the sequence
presented in SEQ ID NO:5 or SEQ ID NO:7. DNA and RNA complements of
said fragments are provided herein, along with both single-stranded
and double-stranded forms of the CD30-L DNA
[0092] Among the uses of such CD30-L nucleic acid fragments is use
as a probe. Such probes may be employed in cross-species
hybridization procedures to isolate CD30-L DNA from additional
mammalian species. As one example, a probe corresponding to the
extracellular domain of CD30-L may be employed. The probes also
find use in detecting the presence of CD30-L nucleic acids in in
vitro assays and in such procedures as Northern and Southern blots.
Cell types expressing CD30-L can be identified. Such procedures are
well known, and the skilled artisan can choose a probe of suitable
length, depending on the particular intended application.
[0093] Other useful fragments of the CD30-L nucleic acids are
antisense or sense oligonucleotides comprising a single-stranded
nucleic acid sequence (either RNA or DNA) capable of binding to
target CD30-L mRNA (sense) or CD30-L DNA (antisense) sequences.
Antisense or sense oligonucleotides, according to the present
invention, comprise a fragment of the coding region of CD30-L cDNA.
Such a fragment generally comprises at least about 14 nucleotides,
preferably from about 14 to about 30 nucleotides. The ability to
create an antisense or a sense oligonucleotide, based upon a cDNA
sequence for a given protein is described in, for example, Stein
and Cohen, Cancer Res. 48:2659, 1988 and van der Krol et al.,
BioTechniques 6:958, 1988.
[0094] Binding of antisense or sense oligonucleotides to target
nucleic acid sequences results in the formation of duplexes that
block translation (RNA) or transcription (DNA) by one of several
means, including enhanced degradation of the duplexes, premature
termination of transcription or translation, or by other means. The
antisense oligonucleotides thus may be used to block expression of
CD30-L proteins.
[0095] Antisense or sense oligonucleotides further comprise
oligonucleotides having modified sugar-phosphodiester backbones (or
other sugar linkages, such as those described in WO 91/06629) and
wherein such sugar linkages are resistant to endogenous nucleases.
Such oligonucleotides with resistant sugar linkages are stable in
vivo (i.e., capable of resisting enzymatic degradation) but retain
sequence specificity to be able to bind to target nucleotide
sequences. Other examples of sense or antisense oligonucleotides
include those oligonucleotides which are covalently linked to
organic moieties, such as those described in WO 90/10448, and other
moieties that increases affinity of the oligonucleotide for a
target nucleic acid sequence, such as poly-(L-lysine). Further
still, intercalating agents, such as ellipticine, and alkylating
agents or metal complexes may be attached to sense or antisense
oligonucleotides to modify binding specificities of the antisense
or sense olignucleotide for the target nucleotide sequence.
Antisense or sense oligonucleotides may be introduced into a cell
containing the target nucleic acid sequence by any gene transfer
method, including, for example, CaPO.sub.4-mediated DNA
transfection, electroporation, or other gene transfer vectors such
as Epstein-Barr virus. Antisense or sense oligonucleotides are
preferably introduced into a cell containing the target nucleic
acid sequence by insertion of the antisense or sense
oligonucleotide into a suitable retroviral vector, then contacting
the cell with the retrovirus vector containing the inserted
sequence, either in vivo or ex vivo. Suitable retroviral vectors
include, but are not limited to, those derived from the murine
retrovirus M-MuLV, N2 (a retrovirus derived from M-MuLV), or the
double copy vectors designated DCT5A, DCT5B and DCT5C (see PCT
Application US 90/02656).
[0096] Sense or antisense oligonucleotides may also be introduced
into a cell containing the target nucleotide sequence by formation
of a conjugate with a ligand binding molecule, as described in WO
91/04753. Suitable ligand binding molecules include, but are not
limited to, cell surface receptors, growth factors, other
cytokines, or other ligands that bind to cell surface receptors.
Preferably, conjugation of the ligand binding molecule does not
substantially interfere with the ability of the ligand binding
molecule to bind to its corresponding molecule or receptor, or
block entry of the sense or antisense oligonucleotide or its
conjugated version into the cell.
[0097] Alternatively, a sense or an antisense oligonucleotide may
be introduced into a cell containing the target nucleic acid
sequence by formation of an oligonucleotide-lipid complex, as
described in WO 90/10448. The sense or antisense
oligonucleotide-lipid complex is preferably dissociated within the
cell by an endogenous lipase.
[0098] The following examples are provided to illustrate particular
embodiments and not to limit the scope of the invention.
Example 1
Preparation of Soluble CD30/Fc Fusion Protein
[0099] This example describes construction of a CD30/Fc-encoding
vector to express a soluble CD30/Fc fusion protein for use in
detecting cDNA clones encoding a CD30 ligand. A cDNA fragment
encoding the extracellular region (ligand binding domain) of the
CD30 human receptor was obtained using polymerase chain reaction
(PCR) techniques, and is based upon the sequence published by
Durkop et al. (Cell 68:421, 1992). The CD30 nucleotide sequence
reported in Durkop et al. supra is presented in SEQ ID NO:1, and
the amino acid sequence encoded thereby is presented in SEQ ID
NO:2. The signal sequence comprises amino acids 1-18, and the
transmembrane region comprises amino acids 391-407, of SEQ ID
NO:2.
[0100] The CD30 cDNA used as a template in the PCR reaction was
prepared as follows. Total RNA was isolated from a virally
transformed human T-cell line designated HUT 102E. This cell line
was derived by transforming T-cells with human T-cell lymphotropic
virus 1 (HTLV-1) as described by Poiesz et al. (PNAS USA
77:7415-19, 1980). First strand cDNA was prepared using a
SuperScript.TM. cDNA synthesis kit available from GIBCO/BRL
(Gaithersburg, Md.). The resulting single-stranded cDNA was
employed as the template in a PCR reaction.
[0101] The 5' primer employed in the PCR reaction was a
single-stranded oligonucleotide (39-mer) of the sequence:
TABLE-US-00001 5' ATAGCGGCCGCCACCATGCGCGTCCTCCTCGCCGCGCTG 3'
[0102] This primer (SEQ ID NO:9) comprises a recognition site for
the restriction endonuclease NotI (underlined) upstream of a
sequence (double underline) encoding the first (N-terminal) eight
amino acids of the CD30 sequence shown in SEQ ID NO:1, from
methionine (encoded by the translation initiation codon ATG)
through leucine at position eight.
[0103] The 3' primer employed in the PCR reaction was a
single-stranded oligonucleotide (39-mer) of the sequence:
TABLE-US-00002 3' CAGCGAGAGAGGAGGTGCCCCTTCCTCGGGTCTAGAACA 5'
[0104] This primer (SEQ ID NO:10) comprises a sequence (double
underline) that is complementary to the sequence that encodes the
last eight amino acids of the CD30 extracellular domain, i.e.,
amino acids 372 (Val) through 379 (Lys) shown in SEQ ID NO:1. The
sequence CTCGGG that follows the CD30 sequence is complementary to
codons for Glu and Pro. Glu and Pro are the first two amino acids
of an antibody Fc fragment that is fused to the C-terminus of the
CD30 fragment as described below. The primer also positions a
recognition site for the restriction endonuclease BglII
(underlined) downstream, for use in attaching a DNA sequence
encoding the remainder of the Fc-encoding gene.
[0105] The PCR reaction may be conducted using any suitable
procedure, such as those described in Sarki et al., Science 239:487
(1988); in Recombinant DNA Methodology, Wu et al., eds., Academic
Press Inc., San Diego (1989), pp. 189-196; and in PCR Protocols: A
Guide to Methods and Applications, Innis et al., eds., Academic
Press, Inc. (1990). An example of a suitable PCR procedure is as
follows. All temperatures are in degrees centigrade. The following
PCR reagents are added to a 0.5 ml Eppendorf microfuge tube: 10
.mu.l of 10.times.PCR buffer (500 mM KCl, 100 mM Tris-HCl, pH 8.3
at 25.degree. C., 25 mM MgCl.sub.2, and 1 mg/ml gelatin)
(Perkins-Elmer Cetus, Norwalk, Conn.), 8 .mu.l of a 2.5 mM solution
containing each dNTP (2 mM dATP, 2 mM dCTP, 2 mM dGTP and 2 mM
dTTP), 2.5 units (0.5 .mu.l of standard 5000 units/ml solution) of
Taq DNA polymerase (Perkins-Elmer Cetus), 1 ng of template DNA, 100
picomoles of each of the oligonucleotide primers, and water to a
final volume of 100 .mu.l. The final mixture is then overlaid with
100 .mu.l paraffin oil. PCR is carried out using a DNA thermal
cycler (Ericomp, San Diego, Calif.).
[0106] In a preferred procedure, the template was denatured at
94.degree. for 5 minutes, followed by 5 cycles of 94.degree. for 1
minute (denaturation), 48.degree. for 1 min. (annealing), and
72.degree. for 1 min. (extension); followed by 30 cycles of
94.degree. for 1 min., 68.degree. for 1 min., and 72.degree. for 1
min., with the last cycle being followed by a final extension at
72.degree. for 5 mins. An aliquot of the products of this PCR
reaction was reamplified in a second PCR reaction, using the same
conditions.
[0107] The desired DNA fragment amplified by this PCR reaction
comprised a NotI site upstream of a sequence encoding the entire
extracellular domain of CD30, followed by a BglII site. The PCR
reaction products were digested with NotI and BglII, and the
desired fragment was purified by gel electrophoresis.
[0108] A DNA sequence encoding an antibody Fc fragment, to be fused
to the CD30-encoding DNA fragment, was prepared as follows. DNA
encoding a single chain polypeptide derived from the Fc region of a
human IgG1 antibody has been cloned into the SpeI site of the
pBLUESCRIPT SK.RTM. vector, which is available from Stratagene
Cloning Systems, La Jolla, Calif. This plasmid vector is replicable
in E. coli and contains a polylinker segment that includes 21
unique restriction sites. The DNA and encoded amino acid sequences
of the cloned Fc cDNA coding region are presented in FIG. 2. A
unique BglII site has been introduced near the 5' end of the
inserted Fc encoding sequence. Nucleotides 7-12 of SEQ ID NO:1
constitute the BglII recognition sequence.
[0109] The Fc polypeptide encoded by the DNA extends from the
N-terminal hinge region to the native C-terminus, i.e., is an
essentially full-length antibody Fc region. Fragments of Fc
regions, e.g., those that are truncated at the C-terminal end, also
may be employed. The fragments preferably contain multiple cysteine
residues (at least the cysteine residues in the hinge reaction) to
permit interchain disulfide bonds to form between the Fc
polypeptide portions of two separate CD30/Fc fusion proteins,
forming dimers as discussed above.
[0110] The recombinant vector containing the Fc sequence is
digested with BglII (which cleaves only at the site shown in FIG.
2) and NotI (which cleaves the vector in the multiple cloning site
downstream of the Fc cDNA insert. The Fc-encoding fragment (about
720 bp in length) was isolated by conventional procedures using LMT
agarose gel electrophoresis.
[0111] The NotI/BglII CD30-encoding DNA fragment and the BglII/NotI
Fc-encoding DNA fragment prepared above were ligated into an
expression vector designated pDC406 as follows. Plasmid pDC406,
which has been described by McMahan et al. (EMBO J. 10:2821, 1991),
is an expression vector for use in mammalian cells, but is also
replicable in E. coli cells.
[0112] pDC406 contains origins of replication derived from SV40,
Epstein-Barr virus and pBR322 and is a derivative of HAV-EO
described by Dower et al., J. Immunol. 142:4314 (1989). pDC406
differs from HAV-EO by the deletion of the intron present in the
adenovirus 2 tripartite leader sequence in HAV-EO. pDC406 was
digested with NotI, which cleaves the plasmid in a multiple cloning
site just 3' of the SalI site, then treated with calf intestine
alkaline phosphatase (CIAP) to prevent self ligation.
[0113] A three-way ligation to join the vector, Fc, and CD30 DNA
fragments was conducted under conventional conditions, and E. coli
cells were transformed with the ligation mixture. A plasmid of the
desired size that was recovered from the E. coli cells was found to
comprise the CD30/Fc gene fusion insert, but in the wrong
orientation for expression. The CD30/Fc gene fusion was excised
from this recombinant plasmid by NotI digestion and ligated to
NotI-digested and CIAP-treated pDC406. E. coli cells were
transformed with the ligation mixture. A recombinant plasmid
containing the insert in the desired orientation was isolated. The
CD30 sequence was fused (in the same reading frame) to the
downstream Fc sequence.
[0114] CD30/Fc fusion molecules preferably are synthesized in
recombinant mammalian cell culture because they are generally too
large and complex to be synthesized by prokaryotic expression
methods. Examples of suitable mammalian cells for expressing a
receptor/Fc fusion protein include CV-1 cells (ATCC CCL 70) and
COS-7 cells (ATCC CRL 1651), both derived from monkey kidney.
[0115] The DNA construct pDC406/CD30/Fc was transfected into the
monkey kidney cell line CV-1/EBNA (ATCC CRL 10478). In mammalian
host cells such as CV1/EBNA, the CD30/Fc fusion protein is
expressed off the HIV transactivating region (TAR) promoter. The
CV-1/EBNA cell line was derived by transfection of the CV-1 cell
line (ATCC CCL 70) with a gene encoding Epstein-Barr virus nuclear
antigen-1 (EBNA-1) that constitutively expresses EBNA-1 driven from
the human CMV intermediate-early enhancer/promoter as described by
McMahan et al., supra. The EBNA-1 gene allows for episomal
replication of expression vectors, such as pDC406, that contain the
EBV origin of replication.
[0116] CV1-EBNA cells transfected with the pDC406/CD30/Fc vector
were cultivated in roller bottles to allow transient expression of
the fusion protein, which is secreted into the culture medium via
the CD30 signal peptide. The CD30/Fc fusion protein was purified by
affinity chromatography. Briefly, one liter of culture supernatant
containing the CD30/Fc fusion protein was purified by filtering the
supernatants (e.g., in a 0.45.mu. filter) and applying the filtrate
to a protein G affinity column (Schleicher and Schuell, Keene,
N.H.) according to manufacturer's instructions. The Fc portion of
the fusion protein is bound by the Protein G on the column. Bound
fusion protein was eluted from the column and the purity confirmed
on a silver stained SDS gel.
Example 2
Screening of Cell Lines for Binding of CD30
[0117] This example describes screening of certain cell lines for
the ability to bind a CD30/Fc fusion protein. Those cell lines
found to be capable of binding CD30/Fc were considered to be
candidates for use as nucleic acid sources in the attempt to clone
CD30-L.
Biotinylation of CD30/Fc Fusion Proteins
[0118] The purified CD30/Fc fusion protein prepared in Example 1
was labeled with biotin for use in screening cell lines. CD30/Fc or
control human IL-4R/Fc were biotinylated as follows: 50 .mu.g
protein (200-500 .mu.g/ml in 0.1M NaHCO.sub.3 pH 8.3) was incubated
with 2 .mu.g (1 mg/ml in DMSO) Biotin-X-N-hydroxysuccinimide (N-HS,
Calbiochem, La Jolla, Calif.) for 30 min at room temperature. At
the end of the incubation period, the reaction mixture was
microfuged through a 1 ml Sephadex G-25 (Pharmacia) desalting
column and the eluate adjusted to 100 .mu.g/ml in PBS plus 0.02%
NaN.sub.3. Protein concentration of biotinylated CD30/Fc and
hIL-4R/Fc was determined by micro-BCA assay (Pierce, Rockford,
Ill.) with ultrapure bovine serum albumin as standard.
Flow Cytometric Staining with Biotinylated Fc Fusion Proteins
[0119] Cell lines such as those identified below are screened for
binding of biotinylated CD30/Fc by the following procedure.
Staining of 1.times.10.sup.6 cells was carried out in
round-bottomed 96-well microtiter plates in a volume of 20 .mu.l.
Cells were pre-incubated for 30 min at 4.degree. C. with 50 .mu.l
blocking solution consisting of 100 .mu.g/ml human IgG1+2% goat
serum in PBS+azide to prevent non-specific binding of labeled
fusion proteins to Fc receptors. 150 .mu.L PBS+azide was then added
to the wells and cells were pelleted by centrifugation for 4 min at
1200 rpm. Pellets were resuspended in 20 .mu.l of 5 .mu.g/ml
biotinylated CD30/Fc or biotinylated hIL-4R/Fc (as a specificity
control) diluted in blocking solution. After 30-45 min incubation
at 4.degree. C., cells were washed .times.2 in PBS+azide and
resuspended in 20 .mu.l streptavidin-phycoerythrin (Becton
Dickinson) diluted 1:5 in PBS+azide. After an additional 30 min,
cells are washed x2 and are ready for analysis. If necessary,
stained cells can be fixed in 1% formaldehyde, 1% fetal bovine
serum in PBS+azide and stored at 4.degree. C. in the dark for
analysis at a later time.
[0120] Streptavidin binds to the biotin molecule which was attached
to the CD30/Fc protein. Phycoerythrin is a fluorescent
phycobiliprotein which serves as a detectable label. The level of
fluorescence signal was then measured for each cell type using a
FACScan.RTM. flow cytometer (Becton Dickinson).
Cell Lines to be Screened for CD30/Fc Binding
[0121] Sheep red blood cell (SRBC)-specific helper T-cell lines
designated 7C2 (TH1), 7B9 (TH0) and SBE11 (TH2) were derived by
limiting dilution from primary antigen-induced cultures of murine
C57BL/6 spleen cells. TH phenotypes of these clones were determined
by their ability to secrete IL-2 and/or IL-4 in response to
stimulation with the mitogen concanavalin A (ConA).
[0122] Human peripheral blood T-cells were stimulated for 16 hours
with 10 .mu.g/ml of an anti-CD3 monoclonal antibody immobilized on
plastic, prior to assay for CD30/Fc binding. The anti-CD3 MAb
stimulates the T-cells through the CD3-T-cell receptor (TCR)
complex.
Biotinylated CD30/Fc Binding
[0123] Murine T-cell lines 7C2, 7B9 and SBE11 showed significant
binding of biotinylated CD30/Fc over that seen with control
IL-4R/Fc, after stimulation for 18 hours with 3 .mu.g/ml Con A. 7C2
cells were also assayed after 6 hours stimulation with Con A, and
specific binding of labeled CD30/Fc was seen. The anti-CD3 MAb
activated human T-cells showed significant binding of biotinylated
CD30/Fc. Binding of biotinylated CD30/Fc was not detected on any of
these cell lines in the absence of stimulation.
[0124] Any of the cell lines that demonstrated binding of CD30/Fc
may be used as a source of nucleic acid in an attempt to isolate a
CD30-L-encoding DNA sequence. A cDNA library may be prepared from
any of the three Con A stimulated murine T-cell lines or the
activated human peripheral blood T-cells, and screened to identity
CD30-L cDNA using the direct expression cloning strategy described
below, for example. Other types of activated T-cells may be
screened for CD30 binding to identify additional suitable nucleic
acid sources. The cells may be derived from human, murine, or other
mammalian sources, including but not limited to rat, bovine,
porcine, or various primate cells. Further, the T-cells may be
stimulated with mitogens other than ConA or otherwise activated by
conventional techniques. It is to be noted that human CD30/Fc was
successfully employed to screen both human and murine cell lines in
the foregoing assay (i.e., human CD30/Fc binds to a ligand on both
the human and the murine cell lines tested).
Example 3
Preparation of cDNA Library Derived from Activated Murine Helper
T-Cells
[0125] This example describes preparation of a cDNA library for
expression cloning of murine CD30-L. The library was prepared from
the murine helper T-cell line designated 7B9 (described above and
in Mosley et al., Cell 59:335, 1989), which was stimulated for 6
hours with 3 .mu.g/ml Con A. The library construction technique was
substantially similar to that described by Ausubel et al., eds.,
Current Protocols In Molecular Biology, Vol. 1, (1987). Briefly,
total RNA was extracted from the 7B9 cell line and poly(A).sup.+
mRNA was isolated by oligo dT cellulose chromatography.
Double-stranded cDNA was made substantially as described by Gubler
et al., Gene 25:263, 1983. Poly(A).sup.+ mRNA fragments were
converted to RNA-cDNA hybrids by reverse transcriptase using random
hexanucleotides as primers. The RNA-cDNA hybrids were then
converted into double-stranded cDNA fragments using RNAase H in
combination with DNA polymerase I. The resulting double-stranded
cDNA was blunt-ended with T4 DNA polymerase.
[0126] Unkinased (i.e. unphosphorylated) BglII adaptors:
TABLE-US-00003 5'-GATCTGGCAACGAAGGTACCATGG-3' (SEQ ID NO: 11)
ACCGTTGCTTCCATGGTACC-5' (SEQ ID NO: 12)
were ligated to 5' ends of the resulting blunt-ended cDNA, using
the adaptor cloning method described in Haymerle et al., Nucleic
Acids Res. 14:8615, 1986. Only the 24-mer oligonucleotide (top
strand) will covalently bond to the cDNA during the ligation
reaction. Non-covalently bound adaptors (including the 20-mer
oligonucleotide above) were removed by gel filtration
chromatography at 68.degree. C. This left 24 nucleotide
non-self-complementary overhangs on cDNA. The cDNA was inserted
into pDC202, a mammalian expression vector that also replicates in
E. coli. pDC202 is derived from pDC201 (Sims et al., Nature
241:585, 1988). The plasmid pCD201 was assembled from (i) the SV40
origin of replication, enhancer, and early and late promoters; (ii)
the adenovirus-2 major late promoter and tripartite leader; (iii)
SV40 polyadenylation and transcription termination signals; (iv)
adenovirus-2 virus-associated RNA genes (VAI and VAII); and (v)
pMSLV (Cosman et al., Nature 312:768, 1984). The multiple cloning
site contains recognition sites for Kpn I, Sma I, and Bgl II.
Certain extraneous vector sequences bordering the VA genes were
excised from pDC201 to create pDC202. Each of the above-named
features of pDC201 is present in pDC202 as well.
[0127] pDC202 was digested with BglII and Bgl II adaptors were
ligated thereto as described for the cDNA above, except that the
bottom strand of the adaptor (the 20-mer) is covalently bound to
the vector, rather than the 24-mer ligated to the cDNA. A
single-stranded extension complementary to that added to the cDNA
thus was added to the BglII-digested vector. The 5' ends of the
adaptored vector and cDNA were phosphorylated and the two DNA
species were then ligated in the presence of T4 polynucleotide
kinase. Dialyzed ligation mixtures were electroporated into E. coli
strain DH5.alpha. and transformants selected on ampicillin
plates.
[0128] To create an expression cloning library, the recombinant
vectors containing 7B9-derived cDNA were transferred from E. coli
to mammalian host cells. Plasmid DNA was isolated from pools of
transformed E. coli and transfected into a sub-confluent layer of
COS-7 cells using standard techniques. The transfected cells were
cultured for two to three days on chambered glass slides (Lab-Tek)
to permit transient expression of the inserted DNA sequences.
Example 4
Isolation of Murine CD30-L cDNA
[0129] This example describes screening of the expression cloning
library made in Example 3 with a labeled CD30/Fc fusion protein.
The purified CD30/Fc fusion protein prepared in Example 1 was
radioiodinated with .sup.125I using a commercially available solid
phase agent (IODO-GEN, Pierce). In this procedure, 5 .mu.g of
IODO-GEN were plated at the bottom of a 10.times.75 mm glass tube
and incubated for twenty minutes at 4.degree. C. with 75111 of 0.1
M sodium phosphate, pH 7.4 and 20 .mu.l (2 mCi) Na.sup.125I. The
solution was then transferred to a second glass tube containing 5
.mu.g of CD30/Fc in 45 .mu.l PBS and this reaction mixture was
incubated for twenty minutes at 4.degree. C. The reaction mixture
was fractionated by gel filtration on a 2 ml bed volume of
Sephadex.RTM. G-25 (Sigma), and then equilibrated in RPMI 1640
medium containing 2.5% (v/v) bovine serum albumin (BSA), 0.2% (v/v)
sodium azide and 20 mM Hepes, pH 7.4 binding medium. The final pool
of .sup.125I CD30/Fc was diluted to a working stock solution of
1.times.10.sup.-7 M in binding medium, which may be stored for up
to one month at 4.degree. C. without detectable loss of receptor
binding activity.
[0130] Monolayers of transfected COS-7 cells made in Example 3 were
assayed by slide autoradiography for expression of CD30-L using the
radioiodinated CD30/Fc fusion protein. The slide autoradiographic
technique was essentially as described by Gearing et al., EMBO J.
8:3667, 1989. Briefly, transfected COS-7 cells were washed once
with binding medium (RPMI 1640 containing 25 mg/ml bovine serum
albumin (BSA), 2 mg/ml sodium azide, 20 mM Hepes pH 7.2, and 50
mg/ml nonfat dry milk) and incubated for 2 hours at 4.degree. C. in
binding medium containing 1.times.10.sup.-9 M .sup.125I-CD30/Fc
fusion protein. After incubation, cells in the chambered slides
were washed three times with binding buffer, followed by two washes
with PBS, (pH 7.3) to remove unbound radiolabeled fusion
protein.
[0131] The cells were fixed by incubating in 10% gluteraldehyde in
PBS (30 minutes at room temperature), washed twice in PBS and
air-dried. The slides were dipped in Kodak GTNB-2 photographic
emulsion (5.times. dilution in water) and exposed in the dark for
two to four days at room temperature in a light-proof box. The
slides were developed in Kodak D19 developer, rinsed in water and
fixed in Agfa G433C fixer. The slides were individually examined
under a microscope at 25-40.times. magnification. Positive slides
showing cells expressing CD30-L were identified by the presence of
autoradiographic silver grains against a light background.
[0132] Eight pools, each containing approximately 2000 individual
clones, were identified as positive for binding the CD30/Fc fusion
protein. Two pools were titered and plated to provide plates
containing approximately 200 colonies each. A replica of each
breakdown pool was made and the cells were scraped to provide
pooled plasmid DNA for transfection into COS-7 cells. The smaller
pools were screened by slide autoradiography as described
previously. Several of the breakdown pools contained clones that
were positive for CD30-L as indicated by the presence of an
expressed gene product capable of binding to the CD30/Fc fusion
protein.
[0133] Individual colonies from two of the breakdown pools were
picked from the replicas and inoculated into culture medium in
individual wells of 96-well plates. Cultures were mixed by pooling
rows and columns and the mixed cultures were used to prepare DNA
for a final round of transfection and screening. An intersection of
a positive row and a positive column identified the positive
colony. DNA from the pure clone was isolated, retransfected and
rescreened.
[0134] The recombinant plasmid containing murine CD30-L cDNA was
recovered from the pure clone (COS-7 host cells) and transformed
into E. coli strain DH5.alpha.. The mammalian expression vector
pDC202 containing murine CD30-L cDNA (designated pDC202-mCD30-L)
was deposited in E. coli strain DH5.alpha. host cells with the
American Type Culture Collection, Rockville, Md. (ATCC) on May 28,
1992, under accession number ATCC 69004. The deposit was made under
the terms of the Budapest Treaty.
[0135] A DNA sequence for the coding region of the cDNA insert of
clone pDC202-mCD30-L is presented in SEQ ID NO:18, and, the encoded
amino acid sequence is presented in SEQ ID NO:19. The protein
comprises an N-terminal cytoplasmic domain (amino acids 1-27), a
transmembrane region (amino acids 28-48), and an extracellular,
i.e., receptor-binding domain (amino acids 49-220). This protein
lacks a signal peptide.
[0136] Six amino acid triplets constituting N-linked glycosylation
sites are found at amino acids 56-58, 67-69, 95-97, 139-141,
175-177, and 187-189 of SEQ ID NO:19. The protein comprises no KEX2
protease processing sites.
[0137] In this particular vector construction, an ATG codon located
in the Bgl II adaptors (see Example 3) is in the same reading frame
as the CD30-L cDNA insert. Thus, a percentage of the transcripts
may comprise the following DNA sequence upstream of the sequence of
SEQ ID NO:18. The encoded amino acids are also shown, and would be
fused to the N-terminus of the SEQ ID NO:19 sequence, but are not
CD30-L-specific amino acids.
TABLE-US-00004 (SEQ ID NO: 13) ATG GGC TGT GGG GCT CCT TCC CCT GAC
CCA GCC (SEQ ID NO:14) Met Gly Cys Gly Ala Pro Ser Pro Asp Pro
Ala
Example 5
Monoclonal Antibodies Directed Against CD30-L
[0138] This example illustrates the preparation of monoclonal
antibodies to CD30-L. CD30-L is expressed in mammalian host cells
such as COS-7 or CV1-EBNA cells and purified using CD30/Fc affinity
chromatography as described herein. Purified CD30-L can be used to
generate monoclonal antibodies against CD30-L using conventional
techniques, for example, those techniques described in U.S. Pat.
No. 4,411,993. The immunogen may comprise a protein (or fragment
thereof, such as the extracellular domain) fused to the peptide
Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys (DYKDDDDK) (SEQ ID NO:15) (Hopp et
al., Bio/Technology 6:1204, 1988 and U.S. Pat. No. 5,011,912) or
fused to the Fc portion of an antibody, as described above.
[0139] Briefly, mice are immunized with CD30-L as an immunogen
emulsified in complete Freund's adjuvant, and injected in amounts
ranging from 10-100 .mu.g subcutaneously or intraperitoneally. Ten
to twelve days later, the immunized animals are boosted with
additional CD30-L emulsified in incomplete Freund's adjuvant. Mice
are periodically boosted thereafter on a weekly to bi-weekly
immunization schedule. Serum samples are periodically taken by
retro-orbital bleeding or tail-tip excision for testing by dot blot
assay or ELISA (Enzyme-Linked Immunosorbent Assay), for CD30-L
antibodies.
[0140] Following detection of an appropriate antibody titer,
positive animals are provided one last intravenous injection of
CD30-L in saline. Three to four days later, the animals are
sacrificed, spleen cells harvested, and spleen cells are fused to a
murine myeloma cell line (e.g., NS1 or Ag 8.653). The latter
myeloma cell line is available from the American Type Culture
Collection as P3x63AG8.653 (ATCC CRL 1580). Fusions generate
hybridoma cells, which are plated in multiple microtiter plates in
a HAT (hypoxanthine, aminopterin and thymidine) selective medium to
inhibit proliferation of non-fused cells, myeloma hybrids, and
spleen cell hybrids.
[0141] The hybridoma cells are screened by ELISA for reactivity
against purified CD30-L by adaptations of the techniques disclosed
in Engvall et al., Immunochem. 8:871, 1971 and in U.S. Pat. No.
4,703,004. A preferred screening technique is the antibody capture
technique described in Beckmann et al., (J. Immunol. 144:4212,
1990). Positive hybridoma cells can be injected intraperitoneally
into syngeneic BALB/c mice to produce ascites containing high
concentrations of anti-CD30-L monoclonal antibodies. Alternatively,
hybridoma cells can be grown in vitro in flasks or roller bottles
by various techniques. Monoclonal antibodies produced in mouse
ascites can be purified by ammonium sulfate precipitation, followed
by gel exclusion chromatography. Alternatively, affinity
chromatography based upon binding of antibody to protein A or
protein G can also be used, as can affinity chromatography based
upon binding to CD30-L.
Example 6
Isolation of Human CD30-L cDNA
[0142] This example illustrates a cross-species hybridization
technique which was used to isolate a human CD30-L cDNA using a
probe derived from the sequence of murine CD30-L. A murine CD30-L
probe was produced by excising the entire cDNA insert from murine
clone pDC202-mCD30-L (ATCC 69004, described in Example 4) by Bgl II
digestion, and .sup.32P-labeling the fragment using random primers
(Boehringer-Mannheim).
[0143] A human peripheral blood lymphocyte (PBL) cDNA library was
constructed in a phage vector (.lamda.gt10). The PBL cells were
obtained from normal human volunteers and treated with 10 ng/ml of
OKT3 (an anti-CD3 antibody), and 10 ng/ml of human IL-2 (Immunex,
Seattle, Wash.) for six days. The PBL cells were washed and
stimulated with 500 ng/ml ionomycin (Calbiochem) and 10 ng/ml PMA
(Sigma) for four hours. Messenger RNA was isolated from the
stimulated PBL cells. cDNA synthesized on the mRNA template was
packaged into .lamda.gt10 phage vectors (Gigapak.RTM., Stratagene,
San Diego, Calif.) according to manufacturer's instructions.
Recombinant phage were then plated on E. coli strain KW251 and
screened using standard plaque hybridization techniques.
[0144] The murine probe was hybridized to phage cDNA in the
following hybridization buffer at 37.degree. C. overnight: [0145]
50% Formamide [0146] 20 mM Pipes (pH 6.4) [0147] 0.8 M NaC.sub.1-2
[0148] mM EDTA [0149] 0.5% SDS [0150] 0.1 mg/ml salmon sperm
DNA
[0151] Hybridization was followed by washing with 2.times.SSC, 0.1%
SDS at 50.degree. C. Positive (hybridizing) plaques were visualized
by autoradiography.
[0152] Six of the positive plaques were purified and the inserts
were isolated by PCR amplification using oligonucleotides that
flank the cloning site. A partial amino acid sequence for human
CD30-L was derived by determining the nucleotide sequence of a
portion of one of these inserts (clone #9, about 2.0 kb in length).
This partial amino acid sequence is presented in SEQ ID NO:20. The
transmembrane region comprises amino acids 27-48 of SEQ ID NO:20.
The amino acid represented by Xaa at position 6 is most likely a
methionine residue encoded by an initiation codon. This partial
human sequence exhibits significant homology to an N-terminal
fragment of murine CD30-L, a preliminary amino acid sequence for
which is presented as SEQ ID NO:21.
[0153] The DNA sequence of the entire coding region of the human
CD30-L clone was determined and is presented in SEQ ID NO:22 and
the encoded amino acid sequence is shown in SEQ ID NO:23. The
N-terminal cytoplasmic domain (amino acids 1 to 21) is followed by
a transmembrane region (amino acids 22 to 43) which is followed by
the extracellular, i.e., receptor-binding domain (amino acids
44-215). This protein lacks a signal peptide. Where the partial
human CD30-L of SEQ ID NO:20 differs from the full length human
CD30-L amino acid sequence presented in SEQ ID NO:23, the SEQ ID
NO:23 sequence is considered to be accurate. Comparison of the
murine SEQ ID NO:19 and human (SEQ ID NO:23) CD30-L amino acid
sequences using the above-described GAP computer program reveals
73% identity and 83% similarity between the two sequences.
[0154] Amino acid triplets that constitute potential N-linked
glycosylation sites are found at positions 62-64, 90-92, 134-136,
170-172, and 182-184 in SEQ ID NO:23. A KEX2 protease processing
site is found at amino acids 72-73. If desired, these
N-glycosylation processing sites may be inactivated to preclude
glycosylation as described above. The KEX2 sites may be inactivated
to reduce proteolysis when the CD30-L protein is expressed in yeast
cells, as described above.
[0155] The products of the above-described PCR reaction (by which
the cDNA insert of the positive clone was amplified) were digested
with EcoRI and ligated into an EcoRI-digested vector designated
pGEMBL. Plasmid pGEMBL is a derivative of the standard cloning
vector pBR322 and contains a polylinker having a unique EcoRI site
along with several other unique restriction sites. The plasmid also
comprises an ampicillin resistance gene. An exemplary vector of
this type is described by Dente et al., (Nucl. Acids Res. 11: 1645,
1983).
[0156] E. coli strain DH5.alpha. was transformed with the ligation
mixture and transformants containing the desired recombinant
plasmid were identified. Samples of E. coli DH5.alpha. containing
plasmid hCD30-L/pGEMBL were deposited with the American Type
Culture Collection, Rockville, Md. (ATCC) on Jun. 24, 1992, under
accession number ATCC 69020. The deposit was made under the terms
of the Budapest Treaty. The deposited recombinant plasmid contains
human CD30-L DNA that includes the complete coding region shown in
SEQ ID NO:22.
Example 7
Isolation of Murine and Human CD30-L DNA Encoding Additional
N-Terminal Amino Acids
[0157] Because the CD30-L clones isolated in examples 4 and 6 had
relatively short 5' noncoding regions and lacked stop codons
upstream of the first initiation codon, isolation of CD30-L DNA
comprising additional 5' sequences was attempted. An anchored PCR
technique was employed, generally as described by Loh et al.,
Science 243:217 (1989) and Carrier et al., Gene 116:173 (1992),
both of which are hereby incorporated by reference. The same
procedures were employed for isolating murine and human clones,
except as noted.
[0158] First strand cDNA was synthesized using a Superscript.RTM.
cDNA kit (GIBCO/BRL, Gaithersburg, Md.) on the following mRNA
templates: [0159] murine: 5 .mu.g total RNA from 7B9 cell line
described in Example 3. [0160] human: 2 .mu.g poly A.sup.+ RNA from
human peripheral blood T-cells (the stimulated PBLs described in
Example 6)
[0161] The primers employed in the cDNA synthesis (referred to as
primers #1 hereinafter) were:
TABLE-US-00005 murine: 5' AGATGCTTTGACACTTG 3' (SEQ ID NO: 16)
human: 5' ATCACCAGATTCCCATC 3' (SEQ ID NO: 17)
[0162] Murine primer #1 is complementary to nucleotides 265-281 of
SEQ ID NO:18. Human primer #1 is complementary to nucleotides
325-341 of SEQ ID NO:22.
[0163] The reaction mixture was treated with RNAse H, then purified
over a Sephadex G50 spin column (Sigma). After drying, the cDNA was
resuspended in: 10 .mu.l H.sub.2O, 4 .mu.l 5.times. terminal
deoxynucleotidyl transferase (TdT) buffer (as specified by
GIBCO/BRL, Gaithersburg, Md.), 4 .mu.l 1 mM dATP, and 1 .mu.l TdT
(15 units/.mu.l). This reaction mixture was incubated at 37.degree.
C. for 10 minutes to add a poly-A tail to the 3' end of the cDNA.
The reaction was stopped by heating at 68.degree. C. for 15
minutes, and the mixture was applied to a Sephadex G50 spin column.
The eluate was diluted to 250 .mu.l with 10 mM Tris (pH 7.5), 1 mM
EDTA. A first PCR reaction mixture was prepared by combining the
first strand cDNA (tailed with adenines) with three primers in a
conventional PCR reaction mixture. The primers were a first
anchoring primer, a second anchoring primer, and a primer #2
(antisense).
[0164] The following reaction conditions (temperature cycles) were
employed for this first PCR, and each of the PCRs described
below:
TABLE-US-00006 94.degree. C. 5 minutes 1X 94.degree. C. 0.5 minutes
55.degree. C. 1.5 minutes {close oversize bracket} 30X 72.degree.
C. 2.5 minutes 72.degree. C. 5 minutes 1X
[0165] The first anchoring primer contains a poly T segment that
will anneal to the poly A tail added to the cDNA. This primer also
inserts a NotI restriction site into the amplified DNA. The second
anchoring primer, which lacks the poly T segment but is otherwise
identical to the first anchoring primer, anneals (in later cycles
of the reaction) to the NotI site-containing sequence inserted into
the amplified DNA via the first anchoring primer.
[0166] The murine primer #2 is complementary to nucleotides 206-222
of SEQ ID NO:18. The human primer #2 is complementary to
nucleotides 108-124 of SEQ ID NO:22.
[0167] A second PCR reaction mixture contained the products of the
first PCR reaction, the 2nd anchoring primer, and primer #2. A
third PCR reaction mixture contained the products of the second PCR
reaction, the 2nd anchoring primer, and primer #3. The murine
primer #3 contains a segment complementary to nucleotides 49-66 of
SEQ ID NO:18. Human primer #3 contains a segment complementary to
nucleotides 80-94 of SEQ ID NO:22. Each primer #3 also contains a
segment that introduces a SalI restriction site into the amplified
DNA.
[0168] PCR reaction products (from PCR reaction no. 2 for human and
no. 3 for murine) were separated by electrophoresis on a 1% NuSieve
agarose gel (FMC Bioproducts, Rockland, Me.). A PCR band comprising
DNA of about 300 bp was isolated for both murine and human. The
CD30-L DNA was further amplified in another PCR reaction. The
reaction mixture comprised:
TABLE-US-00007 5 .mu.l band from gel (melted at 68.degree. C.) 10
.mu.l 10X buffer 2 .mu.l 2nd anchoring primer 2 .mu.l primer #3 1
.mu.l Taq DNA polymerase 0.8 .mu.l 25 mM dNTP's 79.2 .mu.l
dH.sub.2O 100.0 .mu.l TOTAL
[0169] The nucleotide sequence of the reaction products was
determined. The reaction products may be sequenced directly or
subcloned by digesting with NotI/SalI prior to sequencing.
Sequencing revealed additional DNA at the 5' end, compared to the
clones of examples 4 and 6, including DNA encoding an additional 19
N-terminal amino acids for both murine and human CD30-L. DNA and
encoded amino acid sequences for the coding region of CD30-L DNA
comprising this additional 5' coding sequence are shown in SEQ ID
NO:5 and SEQ ID NO:6 (murine) and SEQ ID NO:7 and SEQ ID NO:8
(human). The additional N-terminal amino acids comprise no
N-glycosylation or KEX2 protease processing sites.
[0170] The murine and human CD30-L DNAs isolated in this example
were expressed in CV1-EBNA cells. The molecular weight of the
expressed protein, analyzed by non-reducing SDS-PAGE, was about
26,519 daltons for murine and 26,017 daltons for human CD30-L.
[0171] Although the murine and human CD30-L proteins encoded by the
clones of examples 4 and 6, respectively, are truncated at the
N-terminus, the encoded proteins are biologically active in that
they bind to CD30. Thus, CD30-L proteins lacking from one to all of
the first 19 N-terminal amino acids shown in SEQ ID NOS:6 or 8 are
biologically active CD30-L proteins of the present invention.
Deletion of the first 19 amino acids of SEQ ID NOS:6 and 8 yields
an amino acid sequence identical to that presented in SEQ ID NOS:19
and 23, respectively.
Example 8
Analysis of Biological Activities of CD30-L
[0172] Cells on which CD30 expression has been previously observed
were screened for a response to the recombinant CD30 ligand.
Response to monoclonal antibodies that bind CD30 was also analyzed.
The human cell types screened included activated T cells, three
Hodgkin's lymphoma lines resembling H-RS cells with primitive B or
T cell-like phenotypes, and a non-Hodgkin's lymphoma line of the
large cell anaplastic lymphoma (LCAL) type.
[0173] Peripheral blood T-lymphocyte (PBT) cells were isolated by
centrifugation over Histopaque (Sigma Chemical Co., St. Louis, Mo.)
and rosetting with 2-amino-ethylisothiouronium bromide
(AET)-treated sheep erythrocytes as described (Armitage et al.,
Int. Immunol. 2:1039 (1990)). The purified PBT were then cultured
for 5 days in the presence of immobilized CD3 antibody and a
titration of fixed CV1/EBNA cells expressing full length
(membrane-bound) recombinant human CD30 ligand. In contrast to
control cells transfected with vector alone, cells expressing
CD30-L induced proliferation of the stimulated T-cells in a
dose-dependent manner, with a maximal response observed with
2.5.times.10.sup.4 CV1/EBNA cells/well. This enhanced proliferation
(and other activities described below) could be blocked by the
inclusion of 10 .mu.g/ml of soluble CD30/Fc. Proliferation of
CD3-activated T cells was also seen in the presence of immobilized
anti-CD30 monoclonal antibody M44, suggesting the bivalent antibody
mimics ligand-induced receptor cross linking. The M44 monoclonal
antibody is a mouse IgG1 generated with purified CD30-Fc as
immunogen, as described further in example 12. No response to
CD30-L was seen in the absence of CD3 co-stimulation.
[0174] The biological activity of CD30-L on human lymphoma cell
lines known to express CD30 was investigated. The CD30.sup.+ human
lymphoma lines tested included HDLM-2, KM-H2, L-428, and Karpas 299
cells. Culture conditions for these four cell lines are published
(Drexler et al., Leuk. Res. 10:487 (1986); Gruss et al., Cancer
Res. 52:3353 (1992)).
[0175] The HD-derived cell line HDLM-2 was established from a
malignant pleural effusion of a 74-year-old male with endstage IVB
HD (Drexler et al., 1986, supra; Gruss et al., 1992, supra). HDLM-2
is phenotypically T-cell-like (Gruss et al., 1992, supra). KM-H2
and L-428 are B cell-like, HD-derived lymphoma lines. The human
Karpas 299 cell line was established from blast cells in the
peripheral blood of a 25-year-old white male with the diagnosis of
a large cell anaplastic lymphoma (Ki-1 positive high-grade human
lymphoma). The peripheral blast cells with pleomorphic nuclei
resembled primitive histiocytes, which bear the surface markers
CD4, CD5, HLA-DR and CD30. The Karpas 299 cell line possesses the
same cytochemical, immunologic, and chromosomal profile with a 2.5
translocation as the original peripheral blood blast cells of the
patient (Fischer et al., Blood 72:234 (1988)).
[0176] The addition of CV1/EBNA cells (10,000 cells/well)
expressing recombinant human CD30-L to the HD-derived cell line
HDLM-2 (50,000 cells/well) resulted in enhanced proliferation,
whereas addition of control CV1/EBNA cells transfected with vector
alone had minimal effect. The CD30-L-induced stimulation of HDLM-2
cell proliferation was time-dependent, with a maximal 3-4-fold
enhancement observed at 72 hours. Similar results were obtained
using immobilized M44 antibody, and the effect was dose-dependent.
Cells cultured with an isotype-matched control monoclonal antibody
showed no response. Maximal enhancement of proliferation, a
five-fold increase over control cultures, was detected after
stimulation with 10 .mu.g/ml of M44 for 72 hours. Here again, the
M44 CD30 monoclonal antibody has agonist characteristics and mimics
properties of the ligand. In contrast to the above results, no
effects of CD30-L on proliferation or viability of the KM-H2 or
L-428 cells were detected, even though both lines were confirmed to
be CD30.sup.+ by flow cytometry with M44.
[0177] A clear and dramatically different response to CD30-L was
seen with the CD30.sup.+ non-Hodgkin lymphoma (LCAL) line Karpas
299. The addition of either CV1/EBNA cells expressing the CD30-L or
M44 antibody to Karpas 299 cells (5.times.10.sup.3 cells/well)
decreased the proliferation eight-fold. This effect was further
analyzed with cytotoxic assays measuring .sup.51Cr-release. Both
CV1/EBNA cells expressing CD30-L and M44 antibody induced specific
.sup.51Cr release from these cells in a time and dose-dependent
manner. At 18 hours, the specific release in response to CD30-L or
M44 was 29.4% and 30.8%, respectively. The addition of CV1/EBNA
cells transfected with vector alone, or of an isotype-matched
control antibody, had no effect. Thus, in contrast to the enhanced
proliferative response of the Hodgkin's lymphoma-derived HDLM-2,
the response of the Karpas 299 non-Hodgkin's lymphoma line to
CD30-L is cell death.
Example 9
Northern Analysis of Murine and Human CD30-L Transcripts
[0178] Various types of cells were analyzed by Northern blotting to
detect CD30-L transcripts (mRNA).
[0179] Human Cells
[0180] Human PBT cells, induced with a calcium ionophore, uninduced
tonsillar T cells and LPS-induced monocytes all expressed a single
hybridizing transcript migrating between 18 and 28 S ribosomal RNA.
IL-7-treated PBT cells, PMA treated tonsillar B cells, uninduced
Jurkat or LPS activated THP-1 macrophage, and GM-CSF treated
monocytes did not express CD30-L. IL-1.beta. induced low levels of
CD30-L in monocytes. In addition, placental tissue, the
promyelocytic HL60 line and two Burkitt's lymphoma B cell lines
(Daudi and Raji) were also negative for expression of CD30-L
transcripts. The HD-derived cell lines HDLM-2, KM-H2, and L-428,
described in example 8, did not express CD30-L mRNA constitutively,
or after stimulation with TPA for 24 to 72 hours or with 100 ng/mL
IL-2 and TNF-.alpha. for 48 hours. Thus human CD30-L expression was
detected on specifically induced T cells and
monocytes/macrophages.
[0181] Murine Cells
[0182] The results on human cells are mirrored in the murine
system. LPS stimulated bone marrow-derived macrophage, Con A
activated 7F9 T cells (similar to the 7B9 murine helper T-cell line
described in examples 2 and 3) and an LPS stimulated subclone of
the murine thymoma EL4 (EL4 6.1) all express a single CD30-L
transcript. Unstimulated EL4 6.1 and 7F9 cells, a bone
marrow-derived stromal line D11 and a thymic stromal line F4, do
not express CD30-L.
Example 10
Characterization of Recombinant CD30-L
[0183] Biochemical characteristics of the recombinant, full-length
cell surface forms of murine and human CD30-L were assessed by
surface radioiodinating cells transiently expressing the
recombinant ligands, then immunoprecipitating the ligands with
CD30/Fc (and protein G) from lysates of detergent solubilized
cells. Iodoacetamide (20 mM) was included in lysing and
immunoprecipitation buffers to inhibit potential disulfide
interchange. Washed precipitates were then displayed by SDS-PAGE
with phosphorimaging. Cells transfected with vector only, or cells
expressing recombinant ligand but immunoprecipitated with an
isotype matched control (huIgG1), showed no bands. Under reducing
conditions, the dominant product for both human and murine
recombinant CD30-L is a diffuse 40 kd band. As the CD30-L protein
molecular weight is 26,000 Kd, extensive use of the multiple
N-linked glycosylation sites in the extracellular domains seems
clear. Disulfide-linked dimers of human CD30-L appear under
non-reducing conditions, and even higher oligomers, apparently
disulfide-linked, are seen with murine CD30-L. Most, but not all of
these are converted to monomers upon reduction. The fact that not
all oligomers were converted to monomers may reflect either
differential glycosylation and/or inefficient reduction.
Example 11
Production of a Soluble Human CD30-L Fusion Protein
[0184] A soluble fusion protein comprising an antibody Fc region
polypeptide joined through a peptide linker to the N-terminus of a
fragment of the human CD30-L extracellular domain was produced and
tested for biological activity as follows. DNA encoding a soluble
human CD30-L polypeptide comprising amino acids 47 (Asp) to 215
(Asp) of SEQ ID NO:23 was isolated and amplified by PCR. The PCR
was conducted by conventional procedures, using as the 5' primer an
oligonucleotide comprising nucleotides 139-153 of SEQ ID NO:22 and
a sequence containing a recognition site for BspE1. The 3' primer
spanned the termination codon of CD30-L and contained the
recognition sequence for Not I.
[0185] The PCR products were digested with Bsp E1 and Not I and the
desired fragment was ligated into an expression vector designated
pDC408, which is a derivative of the pDC406 vector described above.
pDC408 had been modified to contain DNA encoding (in order)
5'-murine IL-7 leader sequence--FLAG.RTM.-human IgG1 Fc
domain-peptide linker.
[0186] The murine IL-7 leader sequence is described in U.S. Pat.
No. 4,965,195 and the FLAG.RTM. octapeptide is described above. The
Fc polypeptide is described in example 1. A peptide linker of the
sequence Gly4SerGly5Ser was employed, and the soluble CD30-L
encoding DNA was inserted immediately downstream of the peptide
linker, in the same reading frame. 293 cells (ATCC CRL 1573; a
transformed primary human embryonal kidney cell line) were
transfected with the recombinant expression vector and cultured to
permit expression and secretion of the fusion protein. The
expressed protein was purified on a protein A column.
[0187] The activity of the expressed protein was measured using an
inhibition assay in which the binding of .sup.125I-labeled CD30/Fc
protein to CD30-L expressed on the surface of transformed CV1/EBNA
cells was measured. The soluble CD30-L-containing fusion protein
was shown to be capable of inhibiting this binding, thus indicating
its ability to bind to CD30/Fc. The measured affinity of the
soluble ligand for CD30/Fc was roughly equivalent to that of
CD30/Fc for the cell-bound ligand.
[0188] Alternatively, an expression vector is constructed that
encodes a murine IL-7 leader sequence-FLAG.RTM.-soluble CD30-L
fusion protein. The Fc polypeptide and peptide linker-encoding DNAs
are omitted from this vector. Omitting the Fc polypeptide is
advantageous in that aggregate formation is reduced. Dimers of
CD30-L proteins without Fc moieties have been detected, as
described in example 10. Including an Fc polypeptide may promote
formation of undesirable aggregates of oligomers of CD30-L/Fc
proteins.
Example 12
Antibodies that Bind CD30
[0189] To generate monoclonal antibodies against the human CD30
antigen, CB6F1 mice (purchased from Jackson Laboratories, Bar
Harbor, Me.) were boosted twice intradermally with 10 .mu.g CD30/Fc
in Ribi adjuvant (Ribi Immunochem Research, Hamilton, Mont.). The
soluble human CD30/Fc fusion protein employed as the immunogen was
produced as described in example 1. One week after the second
boost, peroxidase dot blot assays using CD30/Fc showed a
significant (> 1/100) titer of anti-CD30 antibody in the serum.
One week later, animals were boosted intravenously (IV) with 3
.mu.g CD30/Fc into the tail vein. Three days later, spleen was
removed and spleen cells were fused to the X63-AG8.653 mouse
myeloma cell line (Kearney et al., J. Immunol. 123:1548, 1979) by
standard methods using a 50% polyethylene glycol/dimethyl sulfoxide
solution (Sigma). Hybridoma cultures were established in 96-well
plates (Costar, Cambridge, Mass.). Ten days later, culture
supernatants were screened by an antigen capture assay using
.sup.125I-CD30/Fc. Ninety-six-well plates were coated overnight
with goat-antimouse serum (Zymed, San Francisco, Calif.) and
blocked with 3% bovine serum albumin (BSA; Sigma); 50 .mu.L of
culture supernatant was incubated for 1 hour at room temperature.
After three washes with phosphate-buffered saline (PBS), plates
were incubated with .sup.125I-CD30/Fc for 1 hour and then washed
with PBS again before being placed on film for overnight exposure.
Positive wells were checked for reactivity with huIgG by performing
an anti-brotin complex assay. Hybridoma cell lines reactive with
HuIgG:horseradish peroxidase-CD30 were cloned. Positive
supernatants were also tested by flow cytometry using
CD30-expressing cells or CD30-transfected CV-1/EBNA cells.
[0190] Two human anti-CD30 monoclonal antibodies designated M44 and
M67 (mouse IgG.sub.1 isotype) were purified from spent bulk culture
supernatants from two hybridoma cell lines produced above and grown
in roller bottles. Antibodies were purified on a protein A affinity
matrix using an automated purification system (BioRad MAPS system,
Hercules, Calif.). Antibody concentration was determined by
absorbance at 280 nm and purity assessed by sodium dodecyl sulfate
(SDS) polyacrylamide gel electrophoresis and silver staining.
Antibody concentrations were adjusted to 1 mg/mL and alliquots of
purified antibody were stored frozen at -20.degree. C. in 0.05
mol/L citrate buffer (pH 7.0).
Example 13
Analysis of Biological Activities of CD30-L
[0191] Further studies of the response of cells expressing CD30 to
the recombinant CD30 ligand were conducted. Response to monoclonal
antibodies reactive with CD30 was also analyzed. These studies are
similar to those described in example 8, but include additional
cell lines and antibodies. The human cell types screened included
activated T cells, four Hodgkin's lymphoma lines resembling H-RS
cells with primitive B or T cell-like phenotypes, non-Hodgkin's
lymphoma lines of the large cell anaplastic lymphoma (LCAL) type,
and a T-cell leukemia (T-ALL) line.
Activated T-Cells.
[0192] Peripheral blood T-lymphocyte (PBT) cells were isolated from
normal healthy human donors by centrifugation over Histopaque
(Sigma Chemical Co., St. Louis, Mo.) and rosetting with
2-aminoethylisothiouronium bromide (AET)-treated sheep erythrocytes
as described (Armitage et al., Int. Immunol. 2:1039 (1990)).
Contaminating monocytes were removed by plastic adherence for 1
hour at 37.degree. C. The resulting T-cell preparations were
greater than 98% CD3.sup.+, as determined by flow cytometric
analysis. For activation of T-cells to induce CD30 expression,
96-well plates were coated with 10 .mu.g/mL OKT3 (an
anti-CD3-antibody; ATCC-CRL8001) in 50 mmol/L Tris buffer (pH 8.5)
and washed twice with PBS. The purified T-cells (1.times.10.sup.5
cells/well) were then cultured for 72 hours in the presence of the
immobilized anti-CD3 antibody and one of the following: a titration
of fixed CV1/EBNA cells expressing full length (membrane-bound)
recombinant human CD30 ligand; a titration of CV1/EBNA cells
transformed with the empty expression vector alone; medium alone; a
titration of immobilized anti-CD30 monoclonal antibody M44 or M67
(described in example 12); or a titration of an immobilized
isotype-matched control antibody. The CV1/EBNA cells employed in
the assay were transfected using the diethyl aminoethyl
(DEAE)/Dextran method with either vector alone or a CD30L cDNA
containing expression vector (CV-1/CD30L), and then fixed at 2 days
posttransfection with 1% paraformaldehyde for 5 minutes at
25.degree. C. The transformed CV1/EBNA cells were employed in the
assay at 5.times.10.sup.4 cells/well; the antibodies at a
concentration of 10 .mu.g/ml.
[0193] Cultures were pulsed with 1 .mu.Ci/well .sup.3H-thymidine
(.sup.3H.TdR; 25 Ci/mmol: Amersham, Arlington Heights, Ill.) for
the final 12 hours of culture. Cells were harvested and
incorporated cpm determined by tritium-sensitive avalanche gas
ionization detection on a Matrix 96 Beta Counter (Packard, Meriden,
Conn.).
[0194] Cells expressing murine or human CD30-L induced
proliferation of the stimulated T-cells whereas no proliferative
response was induced by medium or CV1/EBNA cells transformed with
the empty vector. Proliferation of CD3-activated T-cells was also
induced by the immobilized anti-CD30 monoclonal antibodies M44 and
M67, suggesting the bivalent antibody mimics ligand-induced
receptor cross linking. The activated T-cells did not respond to
the irrelevant control antibody.
Lymphoma Cell Lines
[0195] The biological activity of CD30-L and anti-CD30 antibodies
on human lymphoma cell lines known to express CD30 was
investigated. The CD30.sup.+ EBV-human lymphoma lines tested
included the Hodgkins Disease (HD) derived lines HDLM-2, KM-H2,
L-428, and L-540, and several LCAL-type non-Hodgkins' lymphoma
lines. These cell lines and appropriate culture conditions are
described in Drexler et al., Leuk. Res. 10:487 (1986); Gruss et
al., Cancer Res. 52:3353 (1992); Kamesaki et al., Blood 68:285
(1986); Schaadt et al., Int. J. Cancer 26:723 (1980); and Diehl et
al., J. Cancer Res. Clin. Oncol. 101:111 (1981).
[0196] The HD-derived cell line HDLM-2 was established from a
malignant pleural effusion of a 74-year-old male with endstage IVB
nodular sclerosis (NS) HD (Drexler et al., 1986, supra; Gruss et
al., 1992, supra) and is phenotypically T-cell-like (Gruss et al.,
1992, supra). KM-H2 and L-428 are B cell-like, HD-derived lymphoma
lines. The L-428 cell line was derived from a malignant pleural
effusion of a 37-year-old woman with endstage IVB NS HD; the KM-H2
cell line from a malignant pleural effusion of a 37-year-old man
with stage 1V mixed cellularity (MC) HD. The L-540 cell line, which
is phenotypically T-cell-like, was derived from the bone marrow of
a 20-year-old woman with stage IVB NS HD.
[0197] The human large cell anaplastic lymphoma cell line Karpas
299 was established from blast cells in the peripheral blood of a
25-year-old white male with the diagnosis of CD30.sup.+ high-grade
LCAL. The peripheral blast cells with pleomorphic nuclei resembled
primitive histiocytes, which bear the surface markers CD4, CD5,
epithelial membrane antigen (EMA), HLA-DR and CD30. The Karpas 299
cell line possesses the same cytochemical, immunologic, morphologic
and chromosomal profile with a 2.5 translocation as the original
peripheral blood blast cells of the patient (Fischer et al., Blood
72:234 (1988)). Seven additional permanent LCAL cell lines employed
in the study were established from primary CD30.sup.+ LCAL tumors,
and resemble the malignant lymphoma clone of the primary LCAL
patients.
[0198] Proliferative responses of the cell lines to CD30-L and
anti-CD30 MAbs was analyzed in a thymidine incorporation assay
similar to that described in example 8, as follows. A total of
5.times.10.sup.4 HDLM-2, L-540, L-428, KM-H2 or LCAL (e.g., Karpas
299) cells were cultured for 72 hours with 1.times.10.sup.4
CV-1/EBNA cells transfected with empty vector, with human or murine
CD30-L encoding vectors, or with 10 .mu.g/mL immobilized anti-CD30
MAbs M44, M67, and Ki-1 or isotype control MAb. The Ki-1 MAb
(included in all but the assay on LCAL cells) was purchased from
Dako Corporation, Santa Barbara, Calif. Tritiated-thymidine
incorporation was determined after 72 hours.
[0199] No effects of CD30-L, M44, M67, or Ki-1 on proliferation or
viability of the "B-cell-like" KM-H2 or L-428 cells were detected,
even though both lines were confirmed to be CD30.sup.+ by flow
cytometry with anti-CD30 MAbs. In contrast, proliferation of the
"T-cell-like" HD-derived cell lines HDLM-2 and L-540 was enhanced
after addition of CD30-L or anti-CD30 MoAbs M44 and M67. Both
murine and human CD30-L, expressed on CV-1 EBNA cells, induced a
twofold to fivefold enhancement of .sup.3H-thymidine uptake by
HDLM-2 and L-540H-RS cells compared with cells cultured with medium
or CV-1/EBNA cells containing only the empty vector. Also,
immobilized anti-CD30 MAbs M44 and M67 enhanced proliferation of
HDLM-2 and L-540 cells threefold to eightfold. In contrast, the
anti-CD30 MAb Ki-1 did not induce proliferation of HDLM-2 and L-540
cells above that induced by isotype-matched control antibody.
[0200] The CD30-L- and M44/M67-induced stimulation of HDLM-2 and
L-540 cell proliferation was time- and dose-dependent. CD30-L
induced maximal proliferation after 72 hours of culture. The MAbs
M44 and M67 had maximal effects at concentrations of 10 .mu.g/mL
for a culture period of 48 to 72 hours. The enhanced proliferation
effect of the CD30-L or the agonistic MAbs appeared to be specific
because it could be blocked by the addition of 50-fold excess of
soluble CD30/Fc protein. Here again, the M44 and M67 anti-CD30
monoclonal antibodies have agonist characteristics and mimic
properties of the ligand.
[0201] A different response to CD30-L, M44 and M67 was seen with
the CD30.sup.+ non-Hodgkin lymphoma (LCAL) line Karpas 299. The
addition of either CV1/EBNA cells expressing the CD30-L, or the M44
or M67 antibodies to Karpas 299 cells resulted in a threefold to
sixfold reduction in proliferation in comparison to cells cultured
with CV-1/EBNA cells transfected with the vector alone,
isotype-matched control MAb, or medium. A significant reduction of
.sup.3H-thymidine uptake by Karpas 299 cells is measurable after 24
hours in culture with CD30-L, M44, or M67. The reduction of
proliferation was time-dependent (being minimal 72 hours after
initiation of the cultures), dose-dependent, and could be almost
completely reversed by the addition of a 50-fold excess of soluble
CD30/Fc. Only one of the seven additional LCAL cell lines did not
show an alteration of proliferation after the addition of
membrane-expressed CD30-L or anti-CD30 MAbs M44 and M67. A 30% to
70% reduction of proliferation in response to CD30-L, M44, and M67,
in comparison to the controls, was seen for the other LCAL
lines.
T-Cell Leukemia Cell Line
[0202] The proliferative response of an adult T-cell leukemia
(T-ALL) cell line designated KE-37 to CD30-L (human only) and
antibodies M44 and M67 was analyzed in the above-described
thymidine incorporation assay. The recombinant CD30-L and both
anti-CD30 antibodies induced enhanced proliferation of the KE-37
cells. No proliferative response was seen for any of the controls
(including the antibody Ki-1).
Sequence CWU 1
1
* * * * *