U.S. patent application number 12/429865 was filed with the patent office on 2009-10-22 for recombinant parainfluenza virus expression systems and vaccines comprising heterologous antigens derived from respiratory syncytial virus.
This patent application is currently assigned to MEDIMMUNE, LLC. Invention is credited to Kathleen Coelingh, Aurelia Haller.
Application Number | 20090263883 12/429865 |
Document ID | / |
Family ID | 27766025 |
Filed Date | 2009-10-22 |
United States Patent
Application |
20090263883 |
Kind Code |
A1 |
Haller; Aurelia ; et
al. |
October 22, 2009 |
Recombinant Parainfluenza Virus Expression Systems And Vaccines
Comprising Heterologous Antigens Derived From Respiratory Syncytial
Virus
Abstract
The present invention relates to recombinant bovine
parainfluenza virus (bPIV) cDNA or RNA which may be used to express
heterologous gene products in appropriate host cell systems and/or
to rescue negative strand RNA recombinant viruses that express,
package, and/or present the heterologous gene product. In
particular, the heterologous gene products include gene product of
another species of PIV or from another negative strand RNA virus,
including but not limited to, influenza virus, respiratory
syncytial virus, human metapneumovirus and avian pneumovirus. The
chimeric viruses and expression products may advantageously be used
in vaccine formulations including vaccines against a broad range of
pathogens and antigens.
Inventors: |
Haller; Aurelia; (Boulder,
CO) ; Coelingh; Kathleen; (Seattle, WA) |
Correspondence
Address: |
MEDIMMUNE, LLC;Patrick Scott Alban
ONE MEDIMMUNE WAY
GAITHERSBURG
MD
20878
US
|
Assignee: |
MEDIMMUNE, LLC
Gaithersburg
MD
|
Family ID: |
27766025 |
Appl. No.: |
12/429865 |
Filed: |
April 24, 2009 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11762814 |
Jun 14, 2007 |
|
|
|
12429865 |
|
|
|
|
10373567 |
Feb 21, 2003 |
|
|
|
11762814 |
|
|
|
|
60358934 |
Feb 21, 2002 |
|
|
|
Current U.S.
Class: |
435/235.1 |
Current CPC
Class: |
A61P 31/14 20180101;
C12Q 1/701 20130101; C12N 2710/22034 20130101; C12N 2760/18522
20130101; G01N 33/502 20130101; C12N 2760/18343 20130101; A61P
11/06 20180101; C12N 2760/18321 20130101; C12N 2760/18643 20130101;
A61K 2039/70 20130101; G01N 33/5008 20130101; A61K 39/12 20130101;
A61P 31/12 20180101; A61P 11/00 20180101; A61K 2039/545 20130101;
A61P 37/04 20180101; A61P 19/00 20180101; C12N 15/86 20130101; G01N
2333/08 20130101; A61P 7/00 20180101; G01N 33/56983 20130101; C12N
2760/18334 20130101; C12N 2760/18622 20130101; A61K 2039/5256
20130101; C12N 2760/18634 20130101; A61P 31/16 20180101; C07K
14/005 20130101; C12N 2760/18534 20130101; A61P 13/12 20180101;
A61P 37/00 20180101; C07K 16/1027 20130101; A61K 2039/552 20130101;
A61P 35/00 20180101; C12N 2840/203 20130101; G01N 33/5088 20130101;
A61K 39/155 20130101; G01N 33/5011 20130101; Y02A 90/10 20180101;
A61P 35/02 20180101; C12N 2760/18621 20130101; A61K 2039/5254
20130101; A61K 2039/58 20130101; A61P 37/02 20180101; C12N
2760/18322 20130101; C12N 7/00 20130101; C12Q 2600/158 20130101;
A61K 2123/00 20130101 |
Class at
Publication: |
435/235.1 |
International
Class: |
C12N 7/01 20060101
C12N007/01 |
Claims
1-48. (canceled)
49. A recombinant parainfluenza virus (PIV) comprising: a
recombinant bovine PIV type 3 (bPIV3) genome, wherein the bPIV3
genome comprises: bPIV3 nucleotide sequences encoding nucleoprotein
(N), phosphoprotein (P), matrix (M), and large protein (L)
proteins; human PIV type 3 (hPIV3) nucleotide sequences encoding
fusion (F) and hemagglutinin-neuraminidase glycoprotein (HN)
proteins; and a nucleic acid sequence encoding a respiratory
syncytial virus (RSV) F protein, wherein the nucleic acid sequence
encoding the RSV F protein is inserted at nucleotide position 1774
of the bPIV3 genome.
50. The recombinant PIV of claim 49 wherein the hPIV3 is
hPIV3/Tex/12084/1983.
51. The recombinant PIV of claim 49 wherein the bPIV3 is
Kansas-strain bPIV3.
52. The recombinant PIV of claim 49 wherein the RSV F protein
comprises the amino acid sequence shown in SEQ ID NO:7.
Description
[0001] This application claims priority to U.S. Provisional Patent
Application No. 60/358,934, filed Feb. 21, 2002, which is
incorporated by reference herein in its entirety.
[0002] Copending and co-assigned U.S. patent application Ser. No.
______, filed on even date herewith, listing Ronaldus Fouchier,
Bernadetta van den Hoogen, Albertus Osterhaus, Aurelia Haller, and
Roderick Tang as Inventors, entitled "METAPNEUMOVIRUS STRAINS AND
THEIR USE IN VACCINE FORMULATIONS AND AS VECTORS FOR EXPRESSION OF
ANTIGENIC SEQUENCES", is incorporated herein by reference in its
entirety.
1. INTRODUCTION
[0003] The present invention relates to recombinant parainfluenza
virus (PIV) cDNA or RNA that may be used to express heterologous
gene products in appropriate host cell systems and/or to rescue
negative strand RNA recombinant viruses that express, package,
and/or present the heterologous gene product. In particular, the
present invention encompasses vaccine preparations comprising
chimeric PIV expressing a heterologous gene product, wherein the
heterologous gene product is preferably an antigenic peptide or
polypeptide. In one embodiment, the PIV vector of the invention
expresses one, two, or three heterologous gene products that may be
encoded by the same or different viruses. In a preferred
embodiment, the heterologous sequence encodes a heterologous gene
product that is an antigenic polypeptide from another species of
PIV or from another negative strand RNA virus, including but not
limited to, influenza virus, respiratory syncytial virus (RSV),
mammalian metapneumovirus, and avian pneumovirus. The vaccine
preparations of the invention encompass multivalent vaccines,
including bivalent and trivalent vaccine preparations. The
multivalent vaccines of the invention may be administered in the
form of one PIV vector expressing each heterologous antigenic
sequence or two or more PIV vectors each encoding different
heterologous antigenic sequences. The vaccine preparations of the
invention can be administered alone or in combination with other
vaccines, prophylactic agents, or therapeutic agents.
2. BACKGROUND OF THE INVENTION
[0004] Parainfluenza viral infection results in serious respiratory
tract disease in infants and children. (Tao et al., 1999, Vaccine
17: 1100-08). Infectious parainfluenza viral infections account for
approximately 20% of all hospitalizations of pediatric patients
that suffer from respiratory tract infections worldwide. Id. An
effective antiviral therapy is not available to treat PIV related
diseases, and a vaccine to prevent PIV infection has not yet been
approved.
[0005] PIV is a member of the genus respirovirus (PIV1, PIV3) or
rubulavirus (PIV2, PIV4) of the paramyxoviridae family. PIV is made
up of two structural modules: (1) an internal ribonucleoprotein
core, or nucleocapsid, containing the viral genome, and (2) an
outer, roughly spherical lipoprotein envelope. Its genome consists
of a single strand of negative sense RNA, that is approximately
15,456 nucleotides in length and encodes at least eight
polypeptides. These proteins include the nucleocapsid structural
protein (NP, NC, or N depending on the genera), the phosphoprotein
(P), the matrix protein (M), the fusion glycoprotein (F), the
hemagglutinin-neuraminidase glycoprotein (HN), the large polymerase
protein (L), and the C and D proteins of unknown function. Id.
[0006] The parainfluenza nucleocapsid protein (NP, NC, or N)
contains two domains within each protein unit. These domains
include: an amino-terminal domain, that comprises nearly two-thirds
of the molecule and interacts directly with the RNA, and a
carboxyl-terminal domain, that lies on the surface of the assembled
nucleocapsid. A hinge is thought to exist at the junction of these
two domains, thereby imparting some flexibility on this protein
(see Fields et al. (ed.), 1991, FUNDAMENTAL VIROLOGY, 2.sup.nd ed,
Raven Press, New York, incorporated by reference herein in its
entirety). The matrix protein (M) is apparently involved in viral
assembly, and it interacts with both the viral membrane and the
nucleocapsid proteins. The phosphoprotein (P) is subject to
phosphorylation and has been implicated in transcription
regulation, methylation, phosphorylation and polyadenylation.
Produced initially as an inactive precursor, the fusion
glycoprotein (F) is cleaved upon translation to produce two
disulfide linked polypeptides. The active F protein interacts with
the viral membrane where it facilitates penetration of the
parainfluenza virion into host cells by promoting the fusion of the
viral envelope with the host cell plasma membrane. Id. The
glycoprotein, hemagglutinin-neuraminidase (HN) protrudes from the
envelope and imparts hemagglutinin and neuraminidase activities on
the virus. HN has a strongly hydrophobic amino terminus that
functions to anchor the HN protein into the lipid bilayer. Id.
Finally, the large polymerase protein (L) plays an important role
in both transcription and replication. Id.
[0007] Bovine parainfluenza virus was first isolated in 1959 from
calves showing signs of shipping fever. It has since been isolated
from normal cattle, aborted fetuses, and cattle exhibiting signs of
respiratory disease (Breker-Klassen et al., 1996, Can. J. Vet. Res.
60: 228-236. See also Shibuta, 1977, Microbiol. Immunol. 23 (7),
617-628). Human and bovine PIV3 share neutralizing epitopes but
show distinct antigenic properties. Significant differences exist
between the human and bovine viral strains in the HN protein. In
fact, a bovine strain induces some neutralizing antibodies to hPIV
infection while a human strain seems to induce a wider spectrum of
neutralizing antibodies against human PIV3 (Van Wyke Coelingh et
al., 1990, J. Virol. 64:3833-3843).
[0008] The replication of all negative-strand RNA viruses,
including PIV, is complicated by the absence of the cellular
machinery that is required to replicate RNA. Additionally, the
negative-strand genome must be transcribed into a positive-strand
(mRNA) copy before translation can occur. Consequently, the genomic
RNA alone cannot synthesize the required RNA-dependent RNA
polymerase upon entry into the cell. The L, P and N proteins must
enter the host cell along with the genomic RNA.
[0009] It is hypothesized that most or all of the viral proteins
that transcribe PIV mRNA also carry out the replication of the
genome. The mechanism that regulates the alternative uses (i.e.,
transcription or replication) of the same complement of proteins
has not been clearly identified, but the process appears to involve
the abundance of free forms of one or more of the nucleocapsid
proteins. Directly following penetration of the virus,
transcription is initiated by the L protein using the
negative-sense RNA in the nucleocapsid as a template. Viral RNA
synthesis is regulated such that it produces monocistronic mRNAs
during transcription.
[0010] Following transcription, virus genome replication is the
second essential event in infection by negative-strand RNA viruses.
As with other negative-strand RNA viruses, virus genome replication
in PIV is mediated by virus-specified proteins. The first products
of replicative RNA synthesis are complementary copies (i.e.,
plus-polarity) of the PIV genomic RNA (cRNA). These plus-stranded
copies (anti-genomes) differ from the plus-stranded mRNA
transcripts in the structure of their termini. Unlike the mRNA
transcripts, the anti-genomic cRNAs are not capped or methylated at
the 5' termini, and they are not truncated nor polyadenylated at
the 3' termini. The cRNAs are coterminal with their negative strand
templates and contain all the genetic information in the
complementary form. The cRNAs serve as templates for the synthesis
of PIV negative-strand viral genomes (vRNAs).
[0011] The bPIV negative strand genomes (vRNAs) and antigenomes
(cRNAs) are encapsidated by nucleocapsid proteins; the only
unencapsidated RNA species are viral mRNAs. Replication and
transcription of bPIV RNA occurs in the cytoplasm of the host cell.
Assembly of the viral components appears to take place at the host
cell plasma membrane where the mature virus is released by
budding.
[0012] 2.1. Paramyxovirus
[0013] Classically, as devastating agents of disease,
paramyxoviruses account for many animal and human deaths worldwide
each year. The Paramyxoviridae form a family within the order of
Mononegavirales (negative-sense single stranded RNA viruses),
consisting of the sub-families Paramyxovirinae and Pneumovirinae.
The latter sub-family is at present taxonomically divided in the
genera Pneumovirus and Metapneumovirus (Pringle, 1999, Arch. Virol.
144/2, 2065-2070). Human respiratory syiicytial virus (hRSV), a
species of the Pneumovirus genus, is the single most important
cause of lower respiratory tract infections during infancy and
early childhood worldwide (Domachowske, & Rosenberg, 1999,
Clin. Microbio. Rev 12(2): 298-309). Other members of the
Pneumovirus genus include the bovine and ovine respiratory
syncytial viruses and pneumonia virus of mice (PVM).
[0014] In the past decades several etiological agents of mammalian
disease, in particular of respiratory tract illnesses (RTI), in
particular of humans, have been identified (Evans, In: Viral
Infections of Humans, Epidemiology and Control. 3th ed. (ed. Evans,
A. S) 22-28 (Plenum Publishing Corporation, New York, 1989)).
Classical etiological agents of RTI with mammals are respiratory
syncytial viruses belonging to the genus Pneumovirus found with
humans (hRSV) and ruminants such as cattle or sheep (bRSV and/or
oRSV). In human RSV differences in reciprocal cross neutralization
assays, reactivity of the G proteins in immunological assays and
nucleotide sequences of the G gene are used to define two hRSV
antigenic subgroups. Within the subgroups the amino acid sequences
show 94% (subgroup A) or 98% (subgroup B) identity, while only 53%
amino acid sequence identity is found between the subgroups.
Additional variability is observed within subgroups based on
monoclonal antibodies, RT-PCR assays and RNAse protection assays.
Viruses from both subgroups have a worldwide distribution and may
occur during a single season. Infection may occur in the presence
of pre-existing immunity and the antigenic variation is not
strictly required to allow re-infection. See, for example
Sullender, 2000, Clinical Microbiology Reviews 13(1): 1-15; Collins
et al. Fields Virology, ed. B. N. Knipe, Howley, P. M. 1996,
Philadelphia: Lippencott-Raven. 1313-1351; Johnson et al., 1987,
(Proc Natl Acad Sci USA, 84(16): 5625-9; Collins, in The
Paramyxoviruses, D. W. Kingsbury, Editor. 1991, Plenum Press: New
York p. 103-153.
[0015] Another classical Pneumovirus is the pneumonia virus of mice
(PVM), in general only found with laboratory mice. However, a
proportion of the illnesses observed among mammals can still not be
attributed to known pathogens.
[0016] 2.2. RSV Infections
[0017] Respiratory syncytial virus (RSV) is the leading cause of
serious lower respiratory tract disease in infants and children
(Feigen et al., eds., 1987, In: Textbook of Pediatric Infectious
Diseases, W B Saunders, Philadelphia at pages 1653-1675; New
Vaccine Development, Establishing Priorities, Vol. 1, 1985,
National Academy Press, Washington D.C. at pages 397-409; and
Ruuskanen et al., 1993, Curr. Probl. Pediatr. 23:50-79). The yearly
epidemic nature of RSV infection is evident worldwide, but the
incidence and severity of RSV disease in a given season vary by
region (Hall, 1993, Contemp. Pediatr. 10:92-110). In temperate
regions of the northern hemisphere, it usually begins in late fall
and ends in late spring. Primary RSV infection occurs most often in
children from 6 weeks to 2 years of age and uncommonly in the first
4 weeks of life during nosocomial epidemics (Hall et al., 1979, New
Engl. J. Med. 300:393-396). Children at increased risk for RSV
infection include, but are not limited to, preterm infants (Hall et
al., 1979, New Engl. J. Med. 300:393-396) and children with
bronchopulmonary dysplasia (Groothuis et al., 1988, Pediatrics
82:199-203), congenital heart disease (MacDonald et al., New Engl.
S. Med. 307:397-400), congenital or acquired immunodeficiency (Ogra
et al., 1988, Pediatr. Infect. Dis. J. 7:246-249; and Pohl et al.,
1992, J. Infect. Dis. 165:166-169), and cystic fibrosis (Abman et
al., 1988, J. Pediatr. 113:826-830). The fatality rate in infants
with heart or lung disease who are hospitalized with RSV infection
is 3%-4% (Navas et al., 1992, J. Pediatr. 121:348-354).
[0018] RSV infects adults as well as infants and children. In
healthy adults, RSV causes predominantly upper respiratory tract
disease. It has recently become evident that some adults,
especially the elderly, have symptomatic RSV infections more
frequently than had been previously reported (Evans, A. S., eds.,
1989, Viral Infections of Humans. Epidemiology and Control, 3rd
ed., Plenum Medical Book, New York at pages 525-544). Several
epidemics also have been reported among nursing home patients and
institutionalized young adults (Falsey, A. R., 1991, Infect.
Control Hosp. Epidemiol. 12:602-608; and Garvie et al., 1980, Br.
Med. J. 281:1253-1254). Finally, RSV may cause serious disease in
immunosuppressed persons, particularly bone marrow transplant
patients (Hertz et al., 1989, Medicine 68:269-281).
[0019] Treatment options for established RSV disease are limited.
Severe RSV disease of the lower respiratory tract often requires
considerable supportive care, including administration of
humidified oxygen and respiratory assistance (Fields et al., eds,
1990, Fields Virology, 2nd ed., Vol. 1, Raven Press, New York at
pages 1045-1072).
[0020] While a vaccine might prevent RSV infection, and/or
RSV-related disease, no vaccine is yet licensed for this
indication. A major obstacle to vaccine development is safety. A
formalin-inactivated vaccine, though immunogenic, unexpectedly
caused a higher and more severe incidence of lower respiratory
tract disease due to RSV in immunized infants than in infants
immunized with a similarly prepared trivalent parainfluenza vaccine
(Kim et al., 1969, Am. J. Epidemiol. 89:422-434; and Kapikian et
al., 1969, Am. J. Epidemiol. 89:405-421). Several candidate RSV
vaccines have been abandoned and others are under development
(Murphy et al., 1994, Virus Res. 32:13-36), but even if safety
issues are resolved, vaccine efficacy must also be improved. A
number of problems remain to be solved. Immunization would be
required in the immediate neonatal period since the peak incidence
of lower respiratory tract disease occurs at 2-5 months of age. The
immaturity of the neonatal immune response together with high
titers of maternally acquired RSV antibody may be expected to
reduce vaccine immunogenicity in the neonatal period (Murphy et
al., 1988, J. Virol. 62:3907-3910; and Murphy et al., 1991, Vaccine
9:185-189). Finally, primary RSV infection and disease do not
protect well against subsequent RSV disease (Henderson et al.,
1979, New Engl. J. Med. 300:530-534).
[0021] Currently, the only approved approach to prophylaxis of RSV
disease is passive immunization. Initial evidence suggesting a
protective role for IgG was obtained from observations involving
maternal antibody in ferrets (Prince, G. A., Ph.D. diss.,
University of California, Los Angeles, 1975) and humans (Lambrecht
et al, 1976, J. Infect. Dis. 134:211-217; and Glezen et al., 1981,
J. Pediatr. 98:708-715). Hemming et al. (Morell et al., eds.,
1-986, Clinical Use of Intravenous Immunoglobulins, Academic Press,
London at pages 285-294) recognized the possible utility of RSV
antibody in treatment or prevention of RSV infection during studies
involving the pharmacokinetics of an intravenous immune globulin
(IVIG) in newborns suspected of having neonatal sepsis. In this
study, it was noted that one infant, whose respiratory secretions
yielded RSV, recovered rapidly after IVIG infusion. Subsequent
analysis of the IVIG lot revealed an unusually high titer of RSV
neutralizing antibody. This same group of investigators then
examined the ability of hyperimmune serum or immune globulin,
enriched for RSV neutralizing antibody, to protect cotton rats and
primates against RSV infection (Prince et al., 1985, Virus Res.
3:193-206; Prince et al., 1990, J. Virol. 64:3091-3092; Hemming et
al., 1985, J. Infect. Dis. 152:1083-1087; Prince et al., 1983,
Infect. Immun. 42:81-87; and Prince et al., 1985, J. Virol.
55:517-520). Results of these studies indicate that IVIG may be
used to prevent RSV infection, in addition to treating or
preventing RSV-related disorders.
[0022] Recent clinical studies have demonstrated the ability of
this passively administered RSV hyperimmune globulin (RSV IVIG) to
protect at risk children from severe lower respiratory infection by
RSV (Groothius et al., 1993, New Engl. J. Med. 329:1524-1530; and
The PREVENT Study Group, 1997, Pediatrics 99:93-99). While this is
a major advance in preventing RSV infection, this treatment poses
certain limitations in its widespread use. First, RSV IVIG must be
infused intravenously over several hours to achieve an effective
dose. Second, the concentrations of active material in hyperimmune
globulins are insufficient to treat adults at risk or most children
with comprised cardiopulmonary function. Third, intravenous
infusion necessitates monthly hospital visits during the RSV
season. Finally, it may prove difficult to select sufficient donors
to produce a hyperimmune globulin for RSV to meet the demand for
this product. Currently, only approximately 8% of normal donors
have RSV neutralizing antibody titers high enough to qualify for
the production of hyperimmune globulin.
[0023] One way to improve the specific activity of the
immunoglobulin would be to develop one or more highly potent RSV
neutralizing monoclonal antibodies (MAbs). Such MAbs should be
human or humanized in order to retain favorable pharmacokinetics
and to avoid generating a human anti-mouse antibody response, as
repeat dosing would be required throughout the RSV season. Two
glycoproteins, F and G, on the surface of RSV have been shown to be
targets of neutralizing antibodies (Fields et al., 1990, supra; and
Murphy et al., 1994, supra).
[0024] A humanized antibody directed to an epitope in the A
antigenic site of the F protein of RSV, SYNAGIS.RTM., is approved
for intramuscular administration to pediatric patients for
prevention of serious lower respiratory tract disease caused by RSV
at recommended monthly doses of 15 mg/kg of body weight throughout
the RSV season (November through April in the northern hemisphere).
SYNAGIS.RTM. is a composite of human (95%) and murine (5%) antibody
sequences. See, Johnson et al., 1997, J. Infect. Diseases
176:1215-1224 and U.S. Pat. No. 5,824,307, the entire contents of
which are incorporated herein by reference. The human heavy chain
sequence was derived from the constant domains of human IgG1 and
the variable framework regions of the VH genes of Cor (Press et
al., 1970, Biochem. J. 117:641-660) and Cess (Takashi et al., 1984,
Proc. Natl. Acad. Sci. USA 81:194-198). The human light chain
sequence was derived from the constant domain of C and the variable
framework regions of the VL gene K104 with J-4 (Bentley et al.,
1980, Nature 288:5194-5198). The murine sequences derived from a
murine monoclonal antibody, Mab 1129 (Beeler et al., 1989, J.
Virology 63:2941-2950), in a process which involved the grafting of
the murine complementarity determining regions into the human
antibody frameworks.
[0025] 2.3. AVIAN Pneumoviruses
[0026] Respiratory disease caused by an avian pneumovirus (APV) was
first described in South Africa in the late 1970s (Buys et al.,
1980, Turkey 28:36-46) where it had a devastating effect on the
turkey industry. The disease in turkeys was characterized by
sinusitis and rhinitis and was called turkey rhinotracheitis (TRT).
The European isolates of APV have also been strongly implicated as
factors in swollen head syndrome (SHS) in chickens (O'Brien, 1985,
Vet. Rec. 117:619-620). Originally, the disease appeared in broiler
chicken flocks infected with Newcastle disease virus (NDV) and was
assumed to be a secondary problem associated with Newcastle disease
(ND). Antibody against European APV was detected in affected
chickens after the onset of SHS (Cook et al., 1988, Avian Pathol.
17:403-410), thus implicating APV as the cause.
[0027] Avian pneumovirus (APV) also known as turkey rhinotracheitis
virus (TRTV), the aetiological agent of avian rhinotracheitis, an
upper respiratory tract infection of turkeys (Giraud et al., 1986,
Vet. Res. 119:606-607), is the sole member of the recently assigned
Metapneumovirus genus, which, as said was until now not associated
with infections, or what is more, with disease of mammals.
Serological subgroups of APV can be differentiated on the basis of
nucleotide or amino acid sequences of the G glycoprotein and
neutralization tests using monoclonal antibodies that also
recognize the G glycoprotein. However, other differences in the
nucleotide and amino acid sequences can be used to distinguish
serological subgroups of APV. Within subgroups A, B and D, the G
protein shows 98.5 to 99.7% aa sequence identity within subgroups
while between the subgroups only 31.2-38% aa identity is observed.
See for example Collins et al., 1993, Avian Pathology, 22: p.
469-479; Cook et al., 1993, Avian Pathology, 22: 257-273;
Bayon-Auboyer et al., J Gen Virol, 81(Pt 11): 2723-33; Seal, 1998,
Virus Res, 58(1-2): 45-52; Bayon-Auboyer et al., 1999, Arch Virol,
144(6): 91-109; Juhasz, et al., 1994, J Gen Virol, 75(Pt 11):
2873-80.
[0028] A further serotype of APV is provided in WO00/20600,
incorporated by reference herein, which describes the Colorado
isolate of APV and compared it to known APV or TRT strains with in
vitro serum neutralization tests. First, the Colorado isolate was
tested against monospecific polyclonal antisera to recognized TRT
isolates. The Colorado isolate was not neutralized by monospecific
antisera to any of the TRT strains. It was, however, neutralized by
a hyperimmune antiserum raised against a subgroup A strain. This
antiserum neutralized the homologous virus to a titre of 1:400 and
the Colorado isolate to a titer of 1:80. Using the above method,
the Colorado isolate was then tested against TRT monoclonal
antibodies. In each case, the reciprocal neutralization titer was
<10. Monospecific antiserum raised to the Colorado isolate was
also tested against TRT strains of both subgroups. None of the TRT
strains tested were neutralized by the antiserum to the Colorado
isolate.
[0029] The Colorado strain of APV does not protect SPF chicks
against challenge with either a subgroup A or a subgroup B strain
of TRT virus. These results suggest that the Colorado isolate may
be the first example of a further serotype of avian pneumovirus
(See, Bayon-Auboyer et al., 2000, J. Ger. Vir. 81:2723-2733).
[0030] The avian pneumovirus is a single stranded, non-segmented
RNA virus that belongs to the sub-family Pneumovirinae of the
family Paramyxoviridae, genus metapneumovirus (Cavanagh and
Barrett, 1988, Virus Res. 11:241-256; Ling et al., 1992, J. Gen.
Virol. 73:1709-1715; Yu et al., 1992, J. Gen. Virol. 73:1355-1363).
The Paramyxoviridae family is divided into two sub-families: the
Paramyxovirinae and Pneumovirinae. The subfamily Paramyxovirinae
includes, but is not limited to, the genera: Paramyxovirus,
Rubulavirus, and Morbillivirus. Recently, the sub-family
Pneumovirinae was divided into two genera based on gene order, and
sequence homology, i.e. pneumovirus and metapneumovirus (Naylor et
al., 1998, J. Gen. Virol., 79:1393-1398; Pringle, 1998, Arch.
Virol. 143:1449-1159). The pneumovirus genus includes, but is not
limited to, human respiratory syncytial virus (hRSV), bovine
respiratory syncytial virus (bRSV), ovine respiratory syncytial
virus, and mouse pneumovirus. The metapneumovirus genus includes,
but is not limited to, European avian pneumovirus (subgroups A and
B), which is distinguished from hRSV, the type species for the
genus pneumovirus (Naylor et al., 1998, J. Gen. Virol.,
79:1393-1398; Pringle, 1998, Arch. Virol. 143:1449-1159). The US
isolate of APV represents a third subgroup (subgroup C) within
metapneumovirus genus because it has been found to be antigenically
and genetically different from European isolates (Seal, 1998, Virus
Res. 58:45-52; Senne et al., 1998, In: Proc. 47th WPDC, California,
pp. 67-68).
[0031] Electron microscopic examination of negatively stained APV
reveals pleomorphic, sometimes spherical, virions ranging from 80
to 200 nm in diameter with long filaments ranging from 1000 to 2000
nm in length (Collins and Gough, 1988, J. Gen. Virol. 69:909-916).
The envelope is made of a membrane studded with spikes 13 to 15 nm
in length. The nucleocapsid is helical, 14 nm in diameter and has 7
nm pitch. The nucleocapsid diameter is smaller than that of the
genera Paramyxovirus and Morbillivirus, which usually have
diameters of about 18 nm.
[0032] Avian pneumovirus infection is an emerging disease in the
USA despite its presence elsewhere in the world in poultry for many
years. In May 1996, a highly contagious respiratory disease of
turkeys appeared in Colorado, and an APV was subsequently isolated
at the National Veterinary Services Laboratory (NVSL) in Ames, Iowa
(Senne et al., 1997, Proc. 134th Ann. Mtg., AVMA, pp. 190). Prior
to this time, the United States and Canada were considered free of
avian pneumovirus (Pearson et al., 1993, In: Newly Emerging and
Re-emerging Avian Diseases: Applied Research and Practical
Applications for Diagnosis and Control, pp. 78-83; Hecker and
Myers, 1993, Vet. Rec. 132:172). Early in 1997, the presence of APV
was detected serologically in turkeys in Minnesota. By the time the
first confirmed diagnosis was made, APV infections had already
spread to many farms. The disease is associated with clinical signs
in the upper respiratory tract: foamy eyes, nasal discharge and
swelling of the sinuses. It is exacerbated by secondary infections.
Morbidity in infected birds can be as high as 100%. The mortality
can range from 1 to 90% and is highest in six to twelve week old
poults.
[0033] Avian pneumovirus is transmitted by contact. Nasal
discharge, movement of affected birds, contaminated water,
contaminated equipment; contaminated feed trucks and load-out
activities can contribute to the transmission of the virus.
Recovered turkeys are thought to be carriers. Because the virus is
shown to infect the epithelium of the oviduct of laying turkeys and
because APV has been detected in young poults, egg transmission is
considered a possibility.
[0034] A significant portion of human respiratory disease is caused
by members of the viral sub-families Paramyxovirinae and
Pneumovirinae, there still remains a need for an effective vaccine
to confer protection against a variety of viruses that result in
respiratory tract infection.
[0035] Citation or discussion of a reference herein shall not be
construed as an admission that such is prior art to the present
invention.
3. SUMMARY OF THE INVENTION
[0036] The present invention relates to recombinant parainfluenza
virus cDNA and RNA that may be engineered to express heterologous
or non-native gene products, in particular, to express antigenic
polypeptides and peptides. In one embodiment, the present invention
relates to recombinant bovine or human parainfluenza viruses which
are engineered to express heterologous antigens or immunogenic
and/or antigenic fragments of heterologous antigens. In another
embodiment of the invention, the recombinant bovine or human
parainfluenza viruses are engineered to express sequences that are
non-native to the PIV genome, including mutated PIV nucleotide
sequences. In particular, the invention relates to recombinant
Kansas-strain bovine parainfluenza type 3 virus as well as cDNA and
RNA molecules coding for the same. The present invention also
relates to recombinant PIV that contain modifications that result
in chimeric viruses with phenotypes more suitable for use in
vaccine formulations.
[0037] The present invention provides for the first time a chimeric
PIV formulated as a vaccine that is able to confer protection
against various viral infections, in particular, viruses that
result in respiratory tract infections. In a specific embodiment,
the present invention provides a vaccine that is able to confer
protection against parainfluenza, influenza, or respiratory
syncytial viral infection. The present invention provides for the
first time a vaccine that is able to confer protection against
metapneumovirus infection in a mammalian host.
[0038] In accordance with the present invention, a recombinant
virus is one derived from a bovine parainfluenza virus or a human
parainfluenza virus that is encoded by endogenous or native genomic
sequences or non-native genomic sequences. In accordance with the
invention, a non-native sequence is one that is different from the
native or endogenous genomic sequence due to one or more mutations,
including, but not limited to, point mutations, rearrangements,
insertions, deletions, etc. to the genomic sequence that may or may
not result in a phenotypic change.
[0039] In accordance with the present invention, a chimeric virus
of the invention is a recombinant bPIV or hPIV which further
comprises one or more heterologous nucleotide sequences. In
accordance with the invention, a chimeric virus may be encoded by a
nucleotide sequence in which heterologous nucleotide sequences have
been added to the genome or in which nucleotide sequences have been
replaced with heterologous nucleotide sequences.
[0040] The present invention also relates to engineered recombinant
parainfluenza viruses and viral vectors that encode combinations of
heterologous sequences which encode gene products, including but
not limited to, genes from different strains of PIV, influenza
virus, respiratory syncytial virus, mammalian metapneumovirus
(e.g., human metapneumovirus), avian pneumovirus, measles, mumps,
other viruses, pathogens, cellular genes, tumor antigens, or
combinations thereof. Furthermore, the invention relates to
engineered recombinant parainfluenza viruses that contain a
nucleotide sequence derived from a metapneumovirus in combination
with a nucleotide sequence derived from a respiratory syncytial
virus, and further in combination with a nucleotide sequence
derived from a human parainfluenza virus. The invention also
encompasses recombinant parainfluenza vectors and viruses that are
engineered to encode genes from different species and strains of
the parainfluenza virus, including the F and HN genes of human
PIV3.
[0041] In one embodiment, the PIV vector of the invention is
engineered to express one or more heterologous sequences, wherein
the heterologous sequences encode gene products that are preferably
antigenic gene products. In a preferred embodiment, the PIV vector
of the invention expresses one, two or three heterologous sequences
that encode antigenic polypeptides and peptides. In some
embodiments, the heterologous sequences are derived from the same
virus or from different viruses. In a preferred embodiment, the
heterologous sequences encode heterologous gene products that are
antigenic polypeptides from another species of PIV, such as a human
PIV, a mutant strain of PIV, or from another negative strand RNA
virus, including but not limited to, influenza virus, respiratory
syncytial virus (RSV), mammalian metapneumovirus (e.g., human
metapneumovirus (hMPV)), and avian pneumovirus. In one embodiment,
the heterologous sequence encodes an immunogenic and/or antigenic
fragment of a heterologous gene product.
[0042] In a preferred embodiment, the recombinant PIV is a bovine
PIV type 3, or an attenuated human PIV type 3. In one embodiment,
the sequences encoding fusion (F) protein, hemagglutinin (HN)
glycoprotein, or other non-essential genes of the PIV genome are
deleted and are substituted by heterologous antigenic sequences. In
yet another embodiment, the PIV genome contains mutations or
modifications, in addition to the heterologous nucleotide
sequences, that result in a chimeric virus having a phenotype that
is more suitable for use in vaccine formulations, e.g., an
attenuated phenotype or a phenotype with enhanced antigenicity.
[0043] In a specific embodiment, the heterologous nucleotide
sequence to be inserted into the PIV genome is derived from the
nucleotide sequences encoding a F protein, a G protein or an HN
protein. In certain embodiments, the nucleotide sequence to be
inserted encodes a chimeric F protein, a chimeric G protein or a
chimeric HN protein. In a specific embodiment, the F protein
comprises an ectodomain of a F protein of a metapneumovirus, a
transmembrane domain of a F protein of a parainfluenza virus, and a
luminal domain of a F protein of a parainfluenza virus. In certain
embodiments, the nucleotide sequence to be inserted encodes a F
protein, wherein the transmembrane domain of the F protein is
deleted so that a soluble F protein is expressed.
[0044] In another specific embodiment, the invention provides a
chimeric virus comprising a PIV genome comprising a heterologous
nucleotide sequence derived from a metapneumovirus. In a specific
embodiment, the PIV virus is a Kansas-strain bovine parainfluenza
type 3 virus. In other embodiments, the PIV virus is a human
parainfluenza virus with an attenuated phenotype. In yet other
embodiments, the invention provides a chimeric bovine parainfluenza
virus type 3/human parainfluenza virus engineered to contain human
parainfluenza F and HN genes in a bovine parainfluenza backbone.
The chimeric virus may further comprise a heterologous nucleotide
sequence derived from a metapneumovirus, and/or further comprise a
heterologous nucleotide sequence derived from a respiratory
syncytial virus.
[0045] In certain embodiments, the virus of the invention comprises
heterologous nucleotide sequences derived from at least two
different genes of a metapneumovirus. In a specific embodiment, the
heterologous sequence is derived from a metapneumovirus, e.g.,
avian pneumovirus and human metapneumovirus. More specifically, the
heterologous sequence is derived from an avian pneumovirus,
including avian pneumovirus type A, B, C or D, preferably C.
[0046] The present invention also provides vaccine preparations and
immunogenic compositions comprising chimeric PIV expressing one or
more heterologous antigenic sequences. In a specific embodiment,
the present invention provides multivalent vaccines, including
bivalent and trivalent vaccines. The multivalent vaccines of the
invention may be administered in the form of one PIV vector
expressing each heterologous antigenic sequence or two or more PIV
vectors each encoding different heterologous antigenic sequences.
In one embodiment, the vaccine preparation of the invention
comprises chimeric PIV expressing one, two or three heterologous
polypeptides, wherein the heterologous polypeptides can be encoded
by sequences derived from one strain of the same virus, different
strains of the same virus, or different viruses. Preferably, the
heterologous antigenic sequences are derived from a negative strand
RNA virus, including but not limited to, influenza virus,
parainfluenza virus, respiratory syncytial virus (RSV), mammalian
metapneumovirus (e.g., human metapneumovirus (hMPV)), and avian
pneumovirus (APV). The heterologous antigenic sequences include,
but are not limited to, sequences that encode human parainfluenza
virus F or HN protein, F protein of RSV, HA protein of influenza
virus type A, B, and C, and F protein of human MPV and avian
pneumovirus. More preferably, the vaccine preparation of the
invention comprises attenuated chimeric viruses that are viable and
infectious. In a preferred embodiment, the recombinant PIV is a
bovine PIV type 3, or an attenuated strain of human PIV.
[0047] In one embodiment, the vaccine preparation comprises the
chimeric virus of the present invention, wherein the F, HN, or some
other nonessential genes of the PIV genome have been substituted or
deleted. In a preferred embodiment, the vaccine preparation of the
present invention is prepared by engineering a strain of PIV with
an attenuated phenotype in an intended host. In another preferred
embodiment, the vaccine preparation of the present invention is
prepared by engineering an attenuated strain of PIV.
[0048] In another embodiment, the heterologous nucleotide sequence
is added to the complete PIV genome. In certain embodiments, the
PIV genome is engineered so that the heterologous sequences are
inserted at position one, two, three, four, five or six, so that
the heterologous sequences are expressed as the first, second,
third, fourth, fifth, or sixth gene of the viral genome. In
specific embodiments, the heterologous sequence is inserted at
position one, two, or three of the viral genome. In certain
embodiments, the intergenic region between the end of the coding
sequence of an inserted heterologous gene and the start of the
coding sequence of the downstream gene is altered to a desirable
length, resulting in enhanced expression of the heterologous
sequence or enhanced growth of the chimeric virus. Alternatively,
the intergenic region is altered to a desirable length, with a
potential to alter the expression of the heterologous sequence or
growth of the recombinant or chimeric virus, e.g., attenuated
phenotype. In some embodiments, both the position of the insertion
and the length of the intergenic region flanking a heterologous
nucleotide sequence are engineered to select a recombinant or
chimeric virus with desirable levels of expression of the
heterologous sequence and desirable viral growth
characteristics.
[0049] In certain embodiments, the invention provides a vaccine
formulation comprising the recombinant or chimeric virus of the
invention and a pharmaceutically acceptable excipient. In specific
embodiments, the vaccine formulation of the invention is used to
modulate the immune response of a subject, such as a human, a
primate, a horse, a cow, a sheep, a pig, a goat, a dog, a cat, a
rodent or a subject of avian species. In a more specific
embodiment, the vaccine is used to modulate the immune response of
a human infant or a child. In another embodiment, the present
invention relates to vaccine formulations for veterinary uses. The
vaccine preparation of the invention can be administered alone or
in combination with other vaccines or other prophylactic or
therapeutic agents.
3.1. Conventions and Abbreviations
[0050] cDNA complementary DNA [0051] CPE cytopathic effects [0052]
L large protein [0053] M matrix protein (lines inside of envelope)
[0054] F fusion glycoprotein [0055] HN hemagglutinin-neuraminidase
glycoprotein [0056] N, NP or NC nucleoprotein (associated with RNA
and required for polymerase activity) [0057] P phosphoprotein
[0058] MOI multiplicity of infection [0059] NA neuraminidase
(envelope glycoprotein) [0060] PIV parainfluenza virus [0061] bPIV
bovine parainfluenza virus [0062] bPIV3 bovine parainfluenza virus
type 3 [0063] hPIV human parainfluenza virus [0064] hPIV3 human
parainfluenza virus type 3 [0065] bPIV/hPIV or recombinant bPIV
with hPIV sequences [0066] b/h PIV [0067] b/h PIV3 or recombinant
bPIV type 3 with hPIV type 3 sequences [0068] bPIV3/hPIV3 [0069] nt
nucleotide [0070] RNP ribonucleoprotein [0071] rRNP recombinant RNP
[0072] vRNA genomic virus RNA [0073] cRNA antigenomic virus RNA
[0074] hMPV human metapneumovirus [0075] APV avian pneumovirus
[0076] position when position is used regarding engineering any
virus, it refers to the position of the gene of the viral genome to
be transcribed. For example, if a gene is located at position one,
it is the first gene of the viral genome to be transcribe; if a
gene is located at position two, it is the second gene of the viral
genome to be transcribed. [0077] position 1 of nucleotide position
104 of the genome, or alternatively, bPIV3, b/h the position of the
first gene of the viral genome to be PIV3 and transcribed
derivatives thereof [0078] position. 2 of nucleotide position 1774
of the genome, or alternatively bPIV3, b/h the position between the
first and the second open PIV3 and reading frame of the native
parainfluenza virus, or derivatives alternatively, the position of
the second gene of the viral thereof genome to be transcribed
[0079] position 3 of nucleotide position 3724 of the genome, or
alternatively bPIV3, b/h the position between the second and the
third open PIV3 and reading frame of the native parainfluenza
virus, or derivatives alternatively, the position of the third gene
of the viral thereof genome to be transcribed. [0080] position 4 of
nucleotide position 5042 of the genome, or alternatively bPIV3, b/h
the position between the third and the fourth open PIV3 and reading
frame of the native parainfluenza virus, or derivatives
alternatively, the position of the fourth gene of the viral thereof
genome to be transcribed. [0081] position 5 of nucleotide position
6790 of the genome, or alternatively bPIV3, b/h the position
between the fourth and the fifth open PIV3 and reading frame of the
native parainfluenza virus, or derivatives alternatively, the
position of the fifth gene of the viral thereof genome to be
transcribed. [0082] position 6 of nucleotide position 8631 of the
genome, or alternatively bPIV3, b/h the position between the fifth
and the sixth open PIV3 and reading frame of the native
parainfluenza virus, or derivatives alternatively, the position of
the sixth gene of the viral thereof genome to be transcribed.
4. DESCRIPTION OF FIGURES
[0083] FIG. 1. Pairwise alignments of the amino acid sequence of
the F protein of the human metapneumovirus with different F
proteins from different avian pneumoviruses. Identical amino acids
between the two sequences are indicated by the one-letter-symbol
for the amino acid. Conserved amino acid exchanges between the two
amino acid sequences are indicated by a "+" sign, and a space
indicates a non-conserved amino acid exchange. A) Alignment of the
human metapneumoviral F protein with the F protein of an avian
pneumovirus isolated from Mallard Duck (85.6% identity in the
ectodomain). B) Alignment of the human metapneumoviral F protein
with the F protein of an avian pneumovirus isolated from Turkey
(subgroup B; 75% identity in the ectodomain).
[0084] FIG. 2. PCR fragments from nt 5255 to nt 6255 derived from
three different isolates of the b/h PIV3 chimeric virus were
amplified. The resulting 1 kb DNA fragments were digested with
enzymes specific for the F gene of human PIV3. These enzymes do not
cut in the corresponding fragment of bovine PIV3. The 1% agarose
gel shows the undigested fragment (lanes 2, 5, and 6) and the Sac1
or BgIII digested fragments (lanes 4, 6 and lanes 9, 10, and 11,
respectively). The sample in lane 10 is undigested, however, upon a
repeat of digestion with BgIII, this sample was cut (data not
shown). Lanes 1 and 8 show a DNA size marker.
[0085] FIG. 3. PCR fragments from nt 9075 to nt 10469 derived from
three different isolates of the b/h PIV3 chimeric virus were
amplified. The resulting 1.4 kb DNA fragments were digested with
enzymes specific for the L gene of bovine PIV3. These enzymes do
not cut in the corresponding fragment of human PIV3. The 1% agarose
gel shows the undigested 1.4 kb fragment (lanes 2, 5, and 8). The
smaller DNA fragments produced by digestion with BamH1 and PvuII
are shown in lanes 3, 4, 6, 7, 9, and 10). Lane 1 shows a DNA size
marker.
[0086] FIG. 4. Six constructs, including the bPIV3/hPIV3 vector and
b/h PIV3 vectored RSV F or G cDNA, are demonstrated. The bovine
PIV3 F gene and HN gene are deleted and replaced with human PIV3 F
and HN gene respectively. The RSV F or G genes are cloned into
either position 1 or position 2. All RSV genes are linked to the
bPIV3 N-P intergenic region with the exception of RSV F1* (N-N),
which is followed by the shorter bPIV3 N gene stop/N gene start
sequences.
[0087] FIG. 5. b/h PIV3 vectored RSV F or G gene displayed a
positional effect. (A) is a Western blot analysis of chimeric
virus-infected cell lysates. F protein was detected using
monoclonal antibodies (MAbs) against the RSV F protein, and G
protein was detected using polyclonal antibodies (PAbs) against the
RSV G protein. A 50 kDa band representing the F.sub.1 fragment was
detected in cells infected with all chimeric viruses as well as
wild-type RSV. There was a greater accumulation of a 20 kDa F
fragment in infected cell lysates of chimeric viruses compared to
wild-type RSV. The experiment was done at MOI of 0.1, except that
in lane 1, b/h PIV3 vectored RSV F1* N-N infections were repeated
at a higher MOI of 1.0. Both the immature and glycosylated forms of
RSV G protein that migrated at approximately 50 kDa and 90 kDa were
detected. (B) is a Northern blot analysis, which showed that the
mRNA transcription correlated with the result of the protein
expression demonstrated in FIG. 5A. Equal amounts of total RNA were
separated on 1% agarose gels containing 1% formaldehyde and
transferred to nylon membranes. The blots were hybridized with
digoxigenin (DIG)-UTP-labeled riboprobes synthesized by in vitro
transcription using a DIG RNA labeling kit. (C) is growth curves of
chimeric viruses comprising b/h PIV3 vectored RSV F or G protein in
Vero cells. Vero cells were grown to 90% confluence and infected at
an MOI of 0.01. The infected monolayers were incubated at
37.degree. C. Virus titers for each time point harvest were
determined by TCID.sub.50 assays, which were performed by
inspecting visually for CPE following incubation at 37.degree. C.
for 6 days.
[0088] FIG. 6. The b/h PIV3 vectored enhanced green fluorescence
protein (eGFP) constructs. The eGFP gene is introduced into the b/h
PIV3 vector sequentially between all genes of PIV3 (only position
1, 2, 3, and 4 are shown here). The eGFP gene was linked to the
bPIV3 N-P intergenic region. The b/h GFP 1 construct harbors the
eGFP gene cassette in the 3' most proximal position of the b/h PIV3
genome. The b/h GFP 2 construct contains the eGFP gene cassette
between the N and P genes. The b/h GFP 3 construct contains the
eGFP gene cassette between the P and M gene, and the b/h GFP4
construct contains the eGFP gene between M and F of b/h PIV3.
[0089] FIG. 7. Positional effect of enhanced green fluorescence
protein (eGFP) insertions in the b/h PIV3 genome. (A) shows the
amount of green cells produced upon infecting Vero cells with b/h
PIV3 vectored eGFP 1, 2, and 3 at MOI 0.1 and MOI 0.01 for 20
hours. The green cells were visualized by using a fluorescent
microscope. (B) is a Western blot analysis of infected cell
lysates. The blots were probed with a GFP MAb as well as a PIV3
PAb. PIV3 antibody was also used to show that the blots had same
volume loading. (C) is growth curves of b/h PIV3 vectored GFP
constructs (at position 1, 2, and 3) in Vero cells.
[0090] FIG. 8. Constructs of b/h PUV3 vectored RSV F gene with
different intergenic regions. The three constructs, RSV F1* N-N,
RSV F2 N-P, and RSV F1 N-P are the same as the RSV F* (N-N), RSV
F2, and RSV F1 in FIG. 4 respectively. The distance between the N
gene start sequence and the N gene translation start codon in RSV
F1* N-N is only 10 nucleotides (nts) long. In contrast, this
distance is 86 nts long in RSV F2 construct. RSV F1* N-N also uses
the N gene start sequence rather than the P gene start sequence as
is done in RSV F2 construct.
[0091] FIG. 9. The length and/or nature of the intergenic region
downstream of the inserted RSV gene has an effect on virus
replication. (A) Western blot analysis of RSV F protein expression
in chimeric viruses. Blots were probed with monoclonal antibodies
against the RSV F protein. F1 protein levels expressed by RSV F1
construct and measured at 24 and 48 hours post-infection were close
to the levels observed for RSV F2 construct, but much higher than
those of RSV F1* N-N construct. (B) is multicycle growth curves
comparing the kinetics of virus replication of RSV F1, RSV F1*N-N
and RSV F2 constructs in Vero cells at an MOI of 0.1. Virus titers
for each time point harvest were determined by plaque assays, which
were performed by immunostaining with RSV polyclonal antisera for
quantification after 5 days of incubation.
[0092] FIG. 10. Constructs of trivalent b/h PIV3 vectored RSV F and
hMPV F. Two virus genomes, each comprising a chimeric b/h PIV3
vector and a first heterologous sequences derived from a
metapneumovirus F gene and a second heterologous sequence derived
from respiratory syncytial virus F gene, are shown here Virus with
either of the constructs has been amplified in Vero cells. The
engineered virus as described can be used as a trivalent vaccine
against the parainfluenza virus infection, metapneumovirus
infection and the respiratory syncytial virus infection.
[0093] FIG. 11. A construct harboring two RSV F genes. This
construct can be used to determine virus growth kinetics, for RSV F
protein production, and replication and immunogenicity in
hamsters.
[0094] FIG. 12. The chimeric b/h PIV3 vectored hMPV F constructs.
The F gene of human metapneumovirus (hMPV) was inserted in position
1 or position 2 of the b/h PIV3 genome. The hMPV F gene cassette
harbored the bPIV3 N-P intergenic region.
[0095] FIG. 13. Immunoprecipitation and replication assays of b/h
PIV3 vectored hMPV F gene (at position 2). (A) shows the
immunoprecipitation of hMPV F protein using guinea pig or human
anti-hMPV antiserum. A specific band migrating at approximately 80
kDa was observed in the lysates of b/h PIV3 vectored hMPV F2. This
size corresponds to the F precursor protein, F.sub.0. Non-specific
bands of different sizes were also observed in the b/h PIV3 and
mock control lanes. (B) shows growth curves that were performed to
determine the kinetics of virus replication of b/h PIV3/hMPV F2 and
compare it to those observed for b/h PIV3 and b/h PIV3/RSV F2 in
Vero cells at an MOI of 0.1. (C) is growth curves that were
performed to determine the kinetics of virus replication of b/h
PIV3/hMPV F1 and compare it to those observed for b/h PIV3/hMPV F2
and b/h PIV3 in Vero cells at an MOI of 0.01.
[0096] FIG. 14. A chimeric b/h PIV3 vectored soluble RSV F gene
construct. This construct comprises a single copy of the soluble
RSV F gene, a version of the RSV F gene lacking the transmembrane
and cytosolic domains. The advantage of this construct would be the
inability of the soluble RSV F to be incorporated into the virion
genome.
[0097] FIG. 15. Immunostained b/h PIV3/hMPV F1 and b/h PIV3/hMPV
F2. (A) the b/h PIV3/hMPV F1 virus were diluted and used to infect
subconfluent Vero cells. Infected cells were overlayed with optiMEM
media containing gentamycin and incubated at 35.degree. C. for 5
days. Cells were fixed and immunostained with guinea pig anti-hMPV
sera. Expression of hMPV F is visualized by specific color
development in the presence of the AEC substrate system. (B) the
b/h PIV3/hMPV F2 virus were diluted and used to infect Vero cells.
Infected cells were overlayed with 1% methyl cellulose in EMEM/L-15
medium (JRH Biosciences; Lenexa, Kans.). Cells were incubated,
fixed and then immunostained with anti-hMPV guinea pig sera. The
anti-hMPV guinea pig serum is specific for hMPV 001 protein.
[0098] FIG. 16. Virion fractionation of b/h PIV3 vectored RSV genes
on sucrose gradients. These series experiments investigate whether
the RSV proteins were incorporated into the b/h PIV3 virion. (A)
shows control gradient of free RSV F (generated in baculovirus and
C-terminally truncated). Majority of free RSV F was present in
fractions 3, 4, 5, and 6. (B) shows that the biggest concentration
of RSV virions was observed in fractions 10, 11 and 12. The RSV
fractions were probed with RSV polyclonal antiserum as well as RSV
F MAb. The fractions that contained the greatest amounts of RSV
virions also showed the strongest signal for RSV F, suggesting that
the RSV F protein co-migrated and associated with RSV virion. The
last figure on (B) also shows that the fractions 10, 11 and 12
displayed the highest virus titer by plaque assay. (C) The b/h PIV3
virions may be more pleiomorphic and thus the spread of the peak
fractions containing b/h PIV3 virions was more broad. (D) Sucrose
gradient fractions of b/h PIV3/RSV F2 were analyzed with both a PIV
polyclonal antiserum and an RSV F MAb. The fractions containing
most of the virions were fractions 11, 12, 13 and 14, as shown by
Western using the PIV3 antiserum. Correspondingly, these were also
the fractions that displayed the highest amounts of RSV F protein.
Some free RSV F was also present in fractions 5 and 6. Fractions
11, 12, 13 and 14 displayed the peak virus titers. (E) The
fractions containing the most virions of b/h PIV3/RSV G2 (9, 10, 11
and 12) also showed the strongest signal for RSV G protein. Again,
these were the fractions with the highest virus titers.
5. DESCRIPTION OF THE INVENTION
[0099] The present invention relates to recombinant parainfluenza
cDNA and RNA constructs, including but not limited to, recombinant
bovine and human PIV cDNA and RNA constructs, that may be used to
express heterologous or non-native sequences.
[0100] In accordance with the present invention, a recombinant
virus is one derived from a bovine parainfluenza virus or a human
parainfluenza virus that is encoded by endogenous or native genomic
sequences or non-native genomic sequences. In accordance with the
invention, a non-native sequence is one that is different from the
native or endogenous genomic sequence due to one or more mutations,
including, but not limited to, point mutations, rearrangements,
insertions, deletions, etc. to the genomic sequence that may or may
not result in a phenotypic change.
[0101] In accordance with the present invention, a chimeric virus
of the invention is a recombinant bPIV or hPIV which further
comprises one or more heterologous nucleotide sequences. In
accordance with the invention, a chimeric virus may be encoded by a
nucleotide sequence in which heterologous nucleotide sequences have
been added to the genome or in which nucleotide sequences have been
replaced with heterologous nucleotide sequences. These recombinant
and chimeric viruses and expression products may be used as
vaccines suitable for administration to humans or animals. For
example, the chimeric viruses of the invention may be used in
vaccine formulations to confer protection against pneumovirus,
respiratory syncytial virus, parainfluenza virus, or influenza
virus infection.
[0102] In one embodiment, the invention relates to PIV cDNA and RNA
constructs that are derived from human or bovine PIV variants and
are engineered to express one, two, or three heterologous
sequences, preferably heterologous genes encoding foreign antigens
and other products from a variety of pathogens, cellular genes,
tumor antigens, and viruses. In particular, the heterologous
sequences are derived from morbillivrus or a negative strand RNA
virus, including but not limited to, influenza virus, respiratory
syncytial virus (RSV), mammalian metapneumovirus (e.g., human
metapneumovirus variants A1, A2, B1, and B2), and avian pneumovirus
subgroups A, B, C and D. The mammalian MPVs can be a variant A1,
A2, B1 or B2 mammalian MPV. However, the mammalian MPVs of the
present invention may encompass additional variants of MPV yet to
be identified, and are not limited to variants A1, A2, B1, or B2.
In another embodiment of the invention, the heterologous sequences
are non-native PIV sequences, including mutated PIV sequences. In
some embodiments, the heterologous sequences are derived from the
same or from different viruses.
[0103] In a specific embodiment, the virus of the invention is a
recombinant PIV comprising heterologous nucleotide sequences
derived from human metapneumovirus or avian pneumovirus. The
heterologous sequences to be inserted into the PIV genome include,
but are not limited to, the sequences encoding the F, G and HN
genes of human metapneumovirus variants A1, A2, B1 or B2, sequences
encoding the F, G and HN genes of avian pneumovirus type A, B, C or
D, and immunogenic and/or antigenic fragments thereof.
[0104] In certain embodiments, the heterologous nucleotide sequence
is added to the viral genome. In alternative embodiments, the
heterologous nucleotide sequence is exchanged for an endogenous
nucleotide sequence. The heterologous nucleotide sequence may be
added or inserted at various positions of the PIV genome, e.g., at
position 1, 2, 3, 4, 5, or 6. In a preferred embodiment, the
heterologous nucleotide sequence is added or inserted at position
1. In another preferred embodiment, the heterologous nucleotide
sequence is added or inserted at position 2. In even another
preferred embodiment, the heterologous nucleotide sequence is added
or inserted at position 3. Inserting or adding heterologous
nucleotide sequences at the lower-numbered positions of the virus
generally results in stronger expression of the heterologous
nucleotide sequence compared to insertion at higher-numbered
positions. This is due to a transcriptional gradient that occurs
across the genome of the virus. However, virus replication
efficiency must also be considered. For example, in the b/h PIV3
chimeric virus of the invention, insertion of a heterologous gene
at position 1 delays replication kinetics in vitro and to a lesser
degree also in vivo (see section 8, example 3 and FIG. 5 as well as
section 26, example 21). Therefore, inserting heterologous
nucleotide sequences at lower-numbered positions is the preferred
embodiment of the invention if strong expression of the
heterologous nucleotide sequence is desired. Most preferably, a
heterologous sequence is inserted at position 2 of a b/h PIV3
genome if strong expression of the heterologous sequence is
desired. (See section 5.1.2. infra and section 8, example 3).
[0105] In some other embodiments, the recombinant or chimeric PIV
genome is engineered such that the intergenic region between the
end of the coding sequence of the heterologous gene and the start
of the coding sequence of the downstream gene is altered. In yet
some other embodiments, the virus of the invention comprises a
recombinant or chimeric PIV genome engineered such that the
heterologous nucleotide sequence is inserted at a position selected
from the group consisting of positions 1, 2, 3, 4, 5, and 6, and
the intergenic region between the heterologous nucleotide sequence
and the next downstream gene is altered. Appropriate assays may be
used to determine the best mode of insertion (i.e., which position
to insert, and the length of the intergenic region) to achieve
appropriate levels of gene expression and viral growth
characteristics. For detail, see Section 5.1.2., infra.
[0106] In certain embodiments, the chimeric virus of the invention
contains two different heterologous nucleotide sequences. The
different heterologous nucleotide sequences may be inserted at
various positions of the PIV genome. In a preferred embodiment, one
heterologous nucleotide sequence is inserted at position 1 and
another heterologous nucleotide sequence is added or inserted at
position 2 or 3. In other embodiments of the invention, additional
heterologous nucleotide sequences are inserted at higher-numbered
positions of the PIV genome. In accordance with the present
invention, the position of the heterologous sequence refers to the
order in which the sequences are transcribed from the viral genome,
e.g., a heterologous sequence at position 1 is the first gene
sequence to be transcribed from the genome.
[0107] In certain embodiments of the invention, the heterologous
nucleotide sequence to be inserted into the genome of the virus of
the invention is derived from a negative strand RNA virus,
including but not limited to, influenza virus, parainfluenza virus,
respiratory syncytial virus, mammalian inetapneumovirus, and avian
pneumovirus. In a specific embodiment of the invention, the
heterologous nucleotide sequence is derived from a human
metapneumovirus. In another specific embodiment, the heterologous
nucleotide sequence is derived from an avian pneumovirus. More
specifically, the heterologous nucleotide sequence of the invention
encodes a F, G or SH gene or a portion thereof of a human or avian
metapneumovirus. In specific embodiments, a heterologous nucleotide
sequences can be any one of SEQ ID NO:1 through SEQ ID NO:5, SEQ ID
NO:14, and SEQ ID NO:15 (see Table 16). In certain specific
embodiments, the nucleotide sequence encodes a protein of any one
of SEQ ID NO:6 through SEQ ID NO:13, SEQ ID NO:16, and SEQ ID NO:17
(see Table 16). In certain specific embodiments, the nucleotide
sequence encodes a protein of any one of SEQ ID NO: 314 through
389.
[0108] In specific embodiments of the invention, a heterologous
nucleotide sequence of the invention is derived from a type A avian
pneumovirus. In other specific embodiments of the invention, a
heterologous nucleotide sequence of the invention is derived from a
type B avian pneumovirus. In even other specific embodiments of the
invention, a heterologous nucleotide sequence of the invention is
derived from a type C avian pneumovirus. Phylogenetic analyses show
that type A and type B are more closely related to each other than
they are to type C (Seal, 2000, Animal Health Res. Rev.
1(1):67-72). Type A and type B are found in Europe whereas type C
was first isolated in the U.S.
[0109] In another embodiment of the invention, the heterologous
nucleotide sequence encodes a chimeric polypeptide, wherein the
ectodomain contains antigenic sequences derived from a virus other
than the strain of PIV from which the vector backbone is derived,
and the trans membrane and luminal domains are derived from PIV
sequences. The resulting chimeric virus would impart antigenicity
of the negative strand RNA virus of choice and would have an
attenuated phenotype.
[0110] In a specific embodiment of the invention, the heterologous
nucleotide sequence encodes a chimeric F protein. Particularly, the
ectodomain of the chimeric F protein is the ectodomain of a
metapneumovirus, so that a human metapneumovirus or avian
pneumovirus, and the transmembrane domain as well as the luminal
domain are the transmembrane and luminal domains of a parainfluenza
virus, such as a human or a bovine parainfluenza virus. While not
bound by any theory, insertion of a chimeric F protein may further
attenuate the virus in an intended host but retain the antigenicity
of the F protein attributed by its ectodomain.
[0111] The chimeric viruses of the invention may be used in vaccine
formulations to confer protection against various infections,
including but not limited to, pneumovirus infection, respiratory
syncytial virus infection, parainfluenza virus infection, influenza
virus infection, or a combination thereof. The present invention
provides vaccine preparations comprising chimeric PIV expressing
one or more heterologous antigenic sequences, including bivalent
and trivalent vaccines. The bivalent and trivalent vaccines of the
invention may be administered in the form of one PIV vector
expressing each heterologous antigenic sequences or two or more PIV
vectors each encoding different heterologous antigenic sequences.
Preferably, the heterologous antigenic sequences are derived from a
negative strand RNA virus, including but not limited to, influenza
virus, parainfluenza virus, respiratory syncytial virus (RSV),
mammalian metapneumovirus (e.g., human metapneumovirus) and avian
pneumovirus. Thus, the chimeric virions of the present invention
may be engineered to create, e.g., anti-human influenza vaccine,
anti-human parainfluenza vaccine, anti-human RSV vaccine, and
anti-human metapneumovirus vaccine. Preferably, the vaccine
preparation of the invention comprises attenuated chimeric viruses
that are viable and infectious. The vaccine preparation of the
invention can be administered alone or in combination with other
vaccines or other prophylactic or therapeutic agents.
[0112] The present invention also relates to the use of viral
vectors and chimeric viruses to formulate vaccines against a broad
range of viruses and/or antigens including tumor antigens. The
viral vectors and chimeric viruses of the present invention may be
used to modulate a subject's immune system by stimulating a humoral
immune response, a cellular immune response or by stimulating
tolerance to an antigen. As used herein, a subject refers to a
human, a primate, a horse, a cow, a sheep, a pig, a goat, a dog, a
cat, a rodent and a member of avian species. When delivering tumor
antigens, the invention may be used to treat subjects having
disease amenable to immune response mediated rejection, such as
non-solid tumors or solid tumors of small size. It is also
contemplated that delivery of tumor antigens by the viral vectors
and chimeric viruses described herein will be useful for treatment
subsequent to removal of large solid tumors. The invention may also
be used to treat subjects who are suspected of having cancer.
[0113] The invention may be divided into the following stages
solely for the purpose of description and not by way of limitation:
(a) construction of recombinant cDNA and RNA templates; (b)
expression of heterologous gene products using recombinant cDNA and
RNA templates; and (c) rescue of the heterologous genes in
recombinant virus particles.
[0114] 5.1. Construction of the Recombinant cDNA and RNA
[0115] The present invention encompasses recombinant or chimeric
viruses encoded by viral vectors derived from the genomes of
parainfluenza virus, including both bovine parainfluenza virus and
mammalian parainfluenza virus. In accordance with the present
invention, a recombinant virus is one derived from a bovine
parainfluenza virus or a mammalian parainfluenza virus that is
encoded by endogenous or native genomic sequences or non-native
genomic sequences. In accordance with the invention, a non-native
sequence is one that is different from the native or endogenous
genomic sequence due to one or more mutations, including, but not
limited to, point mutations, rearrangements, insertions, deletions
etc. to the genomic sequence that may or may not result a
phenotypic change. The recombinant viruses of the invention
encompass those viruses encoded by viral vectors derived from the
genomes of parainfluenza virus, including both bovine and mammalian
parainfluenza virus, and may or may not, include nucleic acids that
are non-native to the viral genome. In accordance with the present
invention, a viral vector which is derived from the genome of a
parainfluenza virus is one that contains a nucleic acid sequence
that encodes at least a part of one ORF of a parainfluenza
virus.
[0116] The present invention also encompasses recombinant viruses
comprising a viral vector derived from a bovine and/or mammalian
PIV genome which contains sequences which result in a virus having
a phenotype more suitable for use in vaccine formulations, e.g.,
attenuated phenotype or enhanced antigenicity. The mutations and
modifications can be in coding regions, in intergenic regions and
in the leader and trailer sequences of the virus.
[0117] In accordance with the present invention, the viral vectors
of the invention are derived from the genome of a mammalian
parainfluenza virus, in particular a human parainfluenza virus
(hPIV). In particular embodiments of the invention, the viral
vector is derived from the genome of a human parainfluenza virus
type 3. In accordance with the present invention, these viral
vectors may or may not include nucleic acids that are non-native to
the viral genome.
[0118] In accordance with the present invention, the viral vectors
of the inventions are derived from the genome of a bovine
parainfluenza virus (bPIV). In particular embodiments of the
invention, the viral vector is derived from the genome of bovine
parainfluenza virus type 3. In accordance to the present invention,
these viral vectors may or may include nucleic acids that are
non-native to the viral genome.
[0119] In accordance with the invention, a chimeric virus is a
recombinant bPIV or hPIV which further comprises a heterologous
nucleotide sequence. In accordance with the invention, a chimeric
virus may be encoded by a nucleotide sequence in which heterologous
nucleotide sequence have been added to the genome or in which
endogenous or native nucleotide sequence have been replaced with
heterologous nucleotide sequence. In accordance with the invention,
the chimeric viruses are encoded by the viral vectors of the
invention which further comprise a heterologous nucleotide
sequence. In accordance with the present invention, a chimeric
virus is encoded by a viral vector that may or may not include
nucleic acids that are non-native to the viral genorne. In
accordance with the invention, a chimeric virus is encoded by a
viral vector to which heterologous nucleotide sequences have been
added, inserted or substituted for native or non-native
sequences.
[0120] A chimeric virus may be of particular use for the generation
of recombinant vaccines protecting against two or more viruses (Tao
et al., J. Virol. 72, 2955-2961; Durbin et al., 2000, J. Virol. 74,
6821-6831; Skiadopoulos et al., 1998, J. Virol. 72, 1762-1768
(1998); Teng et al., 2000, J. Virol. 74, 9317-9321). For example,
it can be envisaged that a hPIV or bPIV virus vector expressing one
or more proteins of another negative strand RNA virus, e.g., MPV,
or a RSV vector expressing one or more proteins of MPV will protect
individuals vaccinated with such vector against both virus
infections. A similar approach can be envisaged for other
paramyxoviruses. Attenuated and replication-defective viruses may
be of use for vaccination purposes with live vaccines as has been
suggested for other viruses. (See, PCT WO 02/057302, at pp. 6 and
23, incorporated by reference herein).
[0121] In accordance with the present invention the heterologous to
be incorporated into the viral vectors encoding the recombinant or
chimeric viruses of the invention include sequences obtained or
derived from different strains of metapneumovirus, strains of avian
pneumovirus, and other negative strand RNA viruses, including, but
not limited to, RSV, PIV, influenza virus and other viruses,
including morbillivirus.
[0122] In certain embodiments of the invention, the chimeric or
recombinant viruses of the invention are encoded by viral vectors
derived from viral genomes wherein one or more sequences,
intergenic regions, termini sequences, or portions or entire ORF
have been substituted with a heterologous or non-native sequence.
In certain embodiments of the invention, the chimeric viruses of
the invention are encoded by viral vectors derived from viral
genomes wherein one or more heterologous sequences have been added
to the vector.
[0123] A specific embodiment of the present invention is a chimeric
virus comprising a backbone encoded by nucleotide sequences derived
from a parainfluenza virus genome. In a preferred embodiment, the
PIV genome is derived from bovine PIV, such as the Kansas strain of
bPIV3, or from human PIV. In a preferred embodiment, the PIV genome
is derived from the Kansas strain of bPIV3, in which bovine
parainfluenza virus nucleotide sequences have been substituted with
heterologous sequences or in which heterologous sequences have been
added to the complete bPIV genome. A further specific embodiment of
the present invention is a chimeric virus comprising a backbone
encoded by nucleotide sequences derived from human
parainfluenza-virus type 3 genome, in which human parainfluenza
virus nucleotide sequences have been substituted with heterologous
sequences or in which heterologous sequences have been added to the
complete hPIV genome. An additional specific embodiment of the
present invention is a chimeric virus comprising a backbone encoded
by nucleotide sequences derived from bovine parainfluenza virus
genome, such as the Kansas strain of bPIV3, in which (a) the bovine
parainfluenza virus F gene and HN gene have been substituted with
the F gene and the HN gene of the human parainfluenza virus
(bPIV/hPIV), and in which (b) heterologous sequences have been
added to the complete bPIV genome.
[0124] The present invention also encompasses chimeric viruses
comprising a backbone encoded by nucleotide sequences derived from
the bPIV, the hPIV, or the bPIV/hPIV genome containing mutations or
modifications, in addition to heterologous sequences, that result
in a chimeric virus having a phenotype more suitable for use in
vaccine formulations, e.g., attenuated phenotype or enhanced
antigenicity. In accordance with this particular embodiment of the
invention, a heterologous sequence in the context of a bovine PIV3
backbone may be any sequence heterologous to bPIV3.
[0125] Another specific embodiment of the present invention is a
chimeric virus comprising a backbone encoded by nucleotide
sequences derived from human PIV 1, 2, or 3 in which hPIV
nucleotide sequences have been substituted with heterologous
sequences or in which heterologous sequences have been added to the
complete hPIV genome, with the proviso that the resulting chimeric
virus is not a chimeric hPIV3 in which the
hemagglutinin-neuraminidase and fusion glycoproteins have been
replaced by those of hPIV1. The present invention also encompasses
chimeric viruses, comprising a backbone encoded by nucleotide
sequences derived from a hPIV genome, containing mutations or
modifications, in addition to heterologous sequences, that result
in a chimeric virus having a phenotype more suitable for use in
vaccine formulations, e.g., attenuated phenotype or enhanced
antigenicity.
[0126] Heterologous gene coding sequences flanked by the complement
of the viral polymerase binding site/promoter, e.g., the complement
of 3'-PIV virus terminus of the present invention, or the
complements of both the 3'- and 5'-PIV virus termini may be
constructed using techniques known in the art. The resulting RNA
templates may be of the negative-polarity and can contain
appropriate terminal sequences that enable the viral
RNA-synthesizing apparatus to recognize the template.
Alternatively, positive-polarity RNA templates, that contain
appropriate terminal sequences which enable the viral
RNA-synthesizing apparatus to recognize the template, may also be
used. Recombinant DNA molecules containing these hybrid sequences
can be cloned and transcribed by a DNA-directed RNA polymerase,
such as bacteriophage T7 polymerase, T3 polymerase, the SP6
polymerase or a eukaryotic polymerase such as polymerase I and the
like, for the in vitro or in vivo production of recombinant RNA
templates that possess the appropriate viral sequences and that
allow for viral polymerase recognition and activity.
[0127] In one embodiment, the PIV vector of the invention expresses
one, two, or three heterologous sequences, encoding antigenic
pqlypeptides and peptides. In some embodiments, the heterologous
sequences are derived from the same virus or from different
viruses. In certain embodiments, more than one copy of the same
heterologous nucleotide sequences are inserted in the genome of a
bovine parainfluenza virus, human parainfluenza virus, or bPIV/hPIV
chimeric vector. In a preferred embodiment, two copies of the same
heterologous nucleotide sequences are inserted to the genome of the
virus of the invention. In some embodiments, the heterologous
nucleotide sequence is derived from a metapneumovirus, such as
human metapneumovirus or an avian pneumovirus. In specific
embodiments, the heterologous nucleotide sequence derived from a
metapneumovirus is a F gene of the metapneumovirus. In other
specific embodiments, the heterologous nucleotide sequence derived
from a metapneumovirus is a G gene of the metapneumovirus. In some
other embodiments, the heterologous nucleotide sequence is derived
from a respiratory syncytial virus. In specific embodiments, the
heterologous nucleotide sequence derived from respiratory syncytial
virus is a F gene of the respiratory syncytial virus. In other
specific embodiments, the heterologous nucleotide sequence derived
from respiratory syncytial virus is a G gene of the respiratory
syncytial virus. When one or more heterologous nucleotide sequences
are inserted, the position of the insertion and the length of the
intergenic region of each inserted copy can be manipulated and
determined by different assays according to section 5.1.2.
infra.
[0128] In certain embodiments, rescue of the chimeric virus or
expression products may be achieved by reverse genetics in host
cell systems where the host cells are transfected with chimeric
cDNA or RNA constructs. The RNA templates of the present invention
are prepared by transcription of appropriate DNA sequences with a
DNA-directed RNA polymerase. The RNA templates of the present
invention may be prepared either in vitro or in vivo by
transcription of appropriate DNA sequences using a DNA-directed RNA
polymerase such as bacteriophage T7 polymerase, T3 polymerase, the
SP6 polymerase, or a eukaryotic polymerase such as polymerase I. In
certain embodiments, the RNA templates of the present invention may
be prepared either in vitro or in vivo by transcription of
appropriate DNA sequences using a plasmid-based expression system
as described in Hoffmann et al., 2000, Proc. Natl. Acad. Sci. USA
97:6108-6113 or the unidirectional RNA polymerase I-polymerase II
transcription system as described in Hoffmann and Webster, 2000, J.
Gen. Virol. 81:2843-2847. The resulting RNA templates of
negative-polarity would contain appropriate terminal sequences that
would enable the viral RNA-synthesizing apparatus to recognize the
template. Alternatively, positive-polarity RNA templates that
contain appropriate terminal sequences and enable the viral
RNA-synthesizing apparatus to recognize the template may also be
used. Expression from positive polarity RNA templates may be
achieved by transfection of plasmids having promoters that are
recognized by the DNA-dependent RNA polymerase. For example,
plasmid DNA, encoding positive RNA templates under the control of a
T7 promoter, can be used in combination with the vaccinia virus or
fowlpox T7 system.
[0129] Bicistronic mRNAs can be constructed to permit internal
initiation of translation of viral sequences and to allow for the
expression of foreign protein coding sequences from the regular
terminal initiation site, or vice versa. Alternatively, a foreign
protein may be expressed from an internal transcriptional unit in
which the transcriptional unit has an initiation site and
polyadenylation site. In another embodiment, the foreign gene is
inserted into a PIV gene such that the resulting expressed protein
is a fusion protein.
[0130] In certain embodiments, the invention relates to trivalent
vaccines comprising a virus of the invention. In specific
embodiments, the virus used for a trivalent vaccine is a chimeric
bovine parainfluenza type 3/human parainfluenza type 3 virus
containing a first heterologous nucleotide sequence derived from a
metapneumovirus, such as human metapneumovirus or avian
pneumovirus, and a second heterologous nucleotide sequence derived
from respiratory syncytial virus. In an exemplary embodiment, such
a trivalent vaccine would be specific to (a) the gene products of
the F gene and the HN gene of the human parainfluenza virus; (b)
the protein encoded by the heterologous nucleotide sequence derived
from a metapneumovirus; and (c) the protein encoded by the
heterologous nucleotide sequence derived from a respiratory
syncytial virus. In a specific embodiment, the first heterologous
nucleotide sequence is the F gene of the respiratory syncytial
virus and is inserted in position 1, and the second heterologous
nucleotide sequence is the F gene of the human metapneumovirus and
is inserted in position 3. Many more combinations are encompassed
by the present invention and some are shown by way of example in
Table 1. For other combinations the F or G gene of an avian
pneumovirus could be used. Further, nucleotide sequences encoding
chimeric F proteins could be used (see supra). In some less
preferred embodiments, the heterologous nucleotide sequence can be
inserted at higher-numbered positions of the viral genome.
TABLE-US-00001 TABLE 1 Exemplary arrangements of heterologous
nucleotide sequences in the viruses used for trivalent vaccines.
Combination Position 1 Position 2 Position 3 1 F-gene of hMPV
F-gene of RSV -- 2 F-gene of RSV F-gene of hMPV -- 3 -- F-gene of
hMPV F-gene of RSV 4 -- F-gene of RSV F-gene of hMPV 5 F-gene of
hMPV -- F-gene of RSV 6 F-gene of RSV -- F-gene of hMPV 7 G-gene of
hMPV G-gene of RSV -- 8 G-gene of RSV G-gene of hMPV -- 9 -- G-gene
of hMPV G-gene of RSV 10 -- G-gene of RSV G-gene of hMPV 11 G-gene
of hMPV -- G-gene of RSV 12 G-gene of RSV -- G-gene of hMPV 13
F-gene of hMPV G-gene of RSV -- 14 G-gene of RSV F-gene of hMPV --
15 -- F-gene of hMPV G-gene of RSV 16 -- G-gene of RSV F-gene of
hMPV 17 F-gene of hMPV -- G-gene of RSV 18 G-gene of RSV -- F-gene
of hMPV 19 G-gene of hMPV F-gene of RSV -- 20 F-gene of RSV G-gene
of hMPV -- 21 -- G-gene of hMPV F-gene of RSV 22 -- F-gene of RSV
G-gene of hMPV 23 G-gene of hMPV -- F-gene of RSV 24 F-gene of RSV
-- G-gene of hMPV
[0131] In some other embodiments, the intergenic region between a
heterologous sequence and the start of the coding sequence of the
downstream gene can be altered. For example, each gene listed on
Table 1 may have a desirable length of the intergenic region. In an
exemplary embodiment, a trivalent vaccine comprises a b/h PIV3
vector with a F gene of respiratory syncytial virus inserted at
position 1, an altered intergenic region of 177 nucleotides
(originally 75 nucleotides to the downstream N gene start codon
AUG), and a F gene of human metapneumovirus inserted at position 3
with its natural intergenic region. Many more combinations are
encompassed by the present invention, as each insertion of a
heterologous nucleotide sequence may be manipulated according to
section 5.1.2., infra.
[0132] In a broader embodiment, the expression products and
chimeric virions of the present invention may be engineered to
create vaccines against a broad range of pathogens, including viral
antigens, tumor antigens and auto antigens involved in autoimmune
disorders. One way to achieve this goal involves modifying existing
PIV genes to contain foreign sequences in their respective external
domains. Where the heterologous sequences are epitopes or antigens
of pathogens, these chimeric viruses may be used to induce a
protective immune response against the disease agent from which
these determinants are derived.
[0133] One approach for constructing these hybrid molecules is to
insert the heterologous nucleotide sequence into a DNA complement
of a PIV genome, e.g., a hpIV, a bPIV, or a bPIV/hPIV, so that the
heterologous sequence is flanked by the viral sequences required
for viral polymerase activity; i.e., the viral polymerase binding
site/promoter, hereinafter referred to as the viral polymerase
binding site, and a polyadenylation site. In a preferred
embodiment, the heterologous coding sequence is flanked by the
viral sequences that comprise the replication promoters of the 5'
and 3' termini, the gene start and gene end sequences, and the
packaging signals that are found in the 5' and/or the 3' termini.
In an alternative approach, oligonucleotides encoding the viral
polymerase binding site, e.g., the complement of the 3'-terminus or
both termini of the virus genomic segment can be ligated to the
heterologous coding sequence to construct the hybrid molecule. The
placement of a foreign gene or segment of a foreign gene within a
target sequence was formerly dictated by the presence of
appropriate restriction enzyme sites within the target sequence.
However, recent advances in molecular biology have lessened this
problem greatly. Restriction enzyme sites can readily be placed
anywhere within a target sequence through the use of site-directed
mutagenesis (e.g., see, for example, the techniques described by
Kunkel, 1985, Proc. Natl. Acad. Sci. U.S.A. 82; 488). Variations in
polymerase chain reaction (PCR) technology, described infra, also
allow for the specific insertion of sequences (i.e., restriction
enzyme sites) and also allow for the facile construction of hybrid
molecules. Alternatively, PCR reactions could be used to prepare
recombinant templates without the need of cloning. For example, PCR
reactions could be used to prepare double-stranded DNA molecules
containing a DNA-directed RNA polymerase promoter (e.g.,
bacteriophage T3, T7 or SP6) and the hybrid sequence containing the
heterologous gene and the PIV polymerase binding site. RNA
templates could then be transcribed directly from this recombinant
DNA. In yet another embodiment, the recombinant RNA templates may
be prepared by ligating RNAs specifying the negative polarity of
the heterologous gene and the viral polymerase binding site using
an RNA ligase.
[0134] In addition, one or more nucleotides can be added at the 3'
end of the HN gene in the untranslated region to adhere to the
"Rule of Six" which may be important in successful virus rescue.
The "Rule of Six" applies to many paramyxoviruses and requires that
the number of nucleotides of an RNA genome be a factor of six to be
functional. The addition of nucleotides can be accomplished by
techniques known in the art such as using a commercial mutagenesis
kits like the QuikChange mutagenesis kit (Stratagene). After
addition of the appropriate number of nucleotides, the correct DNA
fragment, for example, a DNA fragment of the hPIV3 F and HN gene,
can then be isolated upon digestion with the appropriate
restriction enzyme and gel purification. Sequence requirements for
viral polymerase activity and constructs that may be used in
accordance with the invention are described in the subsections
below.
[0135] Without being bound by theory, several parameters affect the
rate of replication of the recombinant virus and the level of
expression of the heterologous sequence. In particular, the
position of the heterologous sequence in bPIV, hPIV, b/h PIV and
the length of the intergenic region that flanks the heterologous
sequence determine rate of replication and expression level of the
heterologous sequence.
[0136] In certain embodiments, the leader and or trailer sequence
of the virus are modified relative to the wild type virus. In
certain more specific embodiments, the lengths of the leader and/or
trailer are altered. In other embodiments, the sequence(s) of the
leader and/or trailer are mutated relative to the wild type
virus.
[0137] The production of a recombinant virus of the invention
relies on the replication of a partial or full-length copy of the
negative sense viral RNA (vRNA) genome or a complementary copy
thereof (cRNA). This vRNA or cRNA can be isolated from infectious
virus, produced upon in-vitro transcription, or produced in cells
upon transfection of nucleic acids. Second, the production of
recombinant negative strand virus relies on a functional polymerase
complex. Typically, the polymerase complex of pneumoviruses
consists of N, P, L and possibly M2 proteins, but is not
necessarily limited thereto.
[0138] Polymerase complexes or components thereof can be isolated
from virus particles, isolated from cells expressing one or more of
the components, or produced upon transfection of specific
expression vectors.
[0139] Infectious copies of MPV can be obtained when the above
mentioned vRNA, cRNA, or vectors expressing these RNAs are
replicated by the above mentioned polymerase complex 16 (Schnell et
al., 1994, EMBO J 13: 4195-4203; Collins et al., 1995, PNAS 92:
11563-11567; Hoffmann et al., 2000, PNAS 97: 6108-6113; Bridgen et
al., 1996, PNAS 93: 15400-15404; Palese et al., 1996, PNAS 93:
11354-11358; Peeters et al., 1999, J. Virol. 73: 5001-5009; Durbin
et al., 1997, Virology 235: 323-332).
[0140] The invention provides a host cell comprising a nucleic acid
or a vector according to the invention. Plasmid or viral vectors
containing the polymerase components of PIV (presumably N, P, L and
M2, but not necessarily limited thereto) are generated in
prokaryotic cells for the expression of the components in relevant
cell types (bacteria, insect cells, eukaryotic cells). Plasmid or
viral vectors containing full-length or partial copies of the PIV
genome will be generated in prokaryotic cells for the expression of
viral nucleic acids in vitro or in vivo. The latter vectors may
contain other viral sequences for the generation of chimeric
viruses or chimeric virus proteins, may lack parts of the viral
genome for the generation of replication defective virus, and may
contain mutations, deletions or insertions for the generation of
attenuated viruses.
[0141] Infectious copies of PIV (being wild type, attenuated,
replication-defective or chimeric) can be produced upon
co-expression of the polymerase components according to the
state-of-the-art technologies described above.
[0142] In addition, eukaryotic cells, transiently or stably
expressing one or more full-length or partial PIV proteins can be
used. Such cells can be made by transfection (proteins or nucleic
acid vectors), infection (viral vectors) or transduction (viral
vectors) and may be useful for complementation of mentioned wild
type, attenuated, replication-defective or chimeric viruses.
[0143] 5.1.1. Heterologous Gene Sequences to be Inserted
[0144] The present invention encompass engineering recombinant
bovine or human parainfluenza viruses to express one or more
heterologous sequences, wherein the heterologous sequences encode
gene products or fragments of gene products that are preferably
antigenic and/or immunogenic. As used herein, the term "antigenic"
refers to the ability of a molecule to bind antibody or MHC
molecules. The term "immunogenic" refers to the ability of a
molecule to generate immune response in a host.
[0145] In a preferred embodiment, the heterologous nucleotide
sequence to be inserted is derived from a negative strand RNA
virus, including but not limited to, influenza virus, parainfluenza
virus, respiratory syncytial virus, mammalian metapneumovirus (e.g.
human metapneumovirus) and avian pneumovirus. In a preferred
embodiment, the heterologous sequence to be inserted includes, but
is not limited to, a sequence that encodes a F or HN gene of human
PIV, a F gene of RSV, a HA gene of influenza virus type A, B, or C,
a F gene of human MPV, a F gene of avian pneumovirus, or an
immunogenic and/or antigenic fragment thereof.
[0146] In some embodiments, the heterologous nucleotide sequence to
be inserted is derived from a human metapneumovirus and/or an avian
pneumovirus. In certain embodiments, the heterologous nucleotide
sequence to be inserted is derived from (a) a human metapneumovirus
and a respiratory syncytial virus; and/or (b) an avian pneumovirus
and a respiratory syncyti al virus.
[0147] In certain preferred embodiments of the invention, the
heterologous nucleotide sequence to be inserted is derived from a F
gene from a human metapneumovirus and/or an avian pneumovirus. In
certain embodiments, the F gene is derived from (a) a human
metapneumovirus and a respiratory syncytial virus; and/or (b) an
avian pneumovirus and a respiratory syncytial virus.
[0148] In certain embodiments of the invention, the heterologous
nucleotide sequence to be inserted is a G gene derived from a human
metapneumovirus and/or an avian pneumovirus. In certain
embodiments, the G gene is derived from (a) a human metapneumovirus
and a respiratory syncytial virus; and/or (b) an avian pneumovirus
and a respiratory syncytial virus.
[0149] In certain embodiments, any combination of different F genes
and/or different G genes derived from human metapneumovirus, avian
pneumovirus, and respiratory syncytial virus can be inserted into
the virus of the invention with the proviso that in all embodiments
at least one heterologous sequence derived from either human
metapneumovirus or avian pneumovirus is present in the recombinant
parainfluenza virus of the invention.
[0150] In certain embodiments, the nucleotide sequence to be
inserted is a nucleotide sequence encoding a F protein derived from
a human metapneumovirus. In certain other embodiments, the
nucleotide sequence to be inserted is a nucleotide sequence
encoding a G protein derived from a human metapneumovirus. In yet
other embodiments, the nucleotide sequence to be inserted is a
nucleotide sequence encoding a F protein derived from an avian
pneumovirus. In yet other embodiments, the nucleotide sequence to
be inserted is a nucleotide sequence encoding a G protein derived
from an avian pneumovirus. With the proviso that in all embodiments
of the invention at least one heterologous nucleotide sequence is
derived from a metapneumovirus, the heterologous nucleotide
sequence to be inserted encodes a F protein or a G protein of a
respiratory syncytial virus.
[0151] In certain embodiments, the nucleotide sequence to be
inserted encodes a chimeric F protein or a chimeric G protein. A
chimeric F protein comprises parts of F proteins from different
viruses, such as a human metapneumovirus, avian pneumovirus and/or
respiratory syncytial virus. A chimeric G protein comprises parts
of G proteins from different viruses, such as a human
metapneumovirus, avian pneumovirus and/or respiratory syncytial
virus. In a specific embodiment, the F protein comprises an
ectodomain of a F protein of a metapneumovirus, a transmembrane
domain of a F protein of a parainfluenza virus, and luminal domain
of a F protein of a parainfluenza virus. In certain embodiments,
the nucleic acid to be inserted encodes a F protein, wherein the
transmembrane domain of the F protein is deleted so that a soluble
F protein is expressed.
[0152] In certain specific embodiments, the heterologous nucleotide
sequence of the invention is any one of SEQ ID NO:1 through SEQ ID
NO:5, SEQ ID NO:14, and SEQ ID NO:15 (see Table 16). In certain
specific embodiments, the nucleotide sequence encodes a protein of
any one of SEQ ID NO:6 through SEQ ID NO:13, SEQ ID NO:16, and SEQ
ID NO: 17 (see Table 16). In certain specific embodiments, the
nucleotide sequence encodes a protein of any one of SEQ ID NO. 314
to 389.
[0153] For heterologous nucleotide sequences derived from
respiratory syncytial virus see, e.g., PCT/US98/20230, which is
hereby incorporated by reference in its entirety.
[0154] In a preferred embodiment, heterologous gene sequences that
can be expressed into the chimeric viruses of the invention include
but are not limited to those encoding antigenic epitopes and
glycoproteins of viruses, such as influenza glycoproteins, in
particular hemagglutinin H5, H7, respiratory syncytial virus
epitopes, New Castle Disease virus epitopes, Sendai virus and
infectious Laryngotracheitis virus (ILV), that result in
respiratory disease. In a most preferred embodiment, the
heterologous nucleotide sequences are derived from a
metapneumovirus, such as human metapneumovirus and/or avian
pneumovirus. In yet another embodiment of the invention,
heterologous gene sequences that can be engineered into the
chimeric viruses of the invention include, but are not limited to,
those encoding viral epitopes and glycoproteins of viruses, such as
hepatitis B virus surface antigen, hepatitis A or C virus surface
glycoproteins of Epstein Barr virus, glycoproteins of human
papilloma virus, simian virus 5 or mumps virus, West Nile virus,
Dengue virus, glycoproteins of herpesviruses, VPI of poliovirus,
and sequences derived from a human immunodeficiency virus (HIV),
preferably type 1 or type 2. In yet another embodiment,
heterologous gene sequences that can be engineered into chimeric
viruses of the invention include, but are not limited to, those
encoding Marek's Disease virus (MDV) epitopes, epitopes of
infectious Bursal Disease virus (IBDV), epitopes of Chicken Anemia
virus, infectious laryngotracheitis virus (ILV), Avian Influenza
virus (AIV), rabies, feline leukemia virus, canine distemper virus,
vesicular stomatitis virus, and swinepox virus (see Fields et al.
(ed.), 1991, FUNDAMENTAL VIROLOGY, Second Edition, Raven Press, New
York, incorporated by reference herein in its entirety).
[0155] Other heterologous sequences of the present invention
include those encoding antigens that are characteristic of
autoimmune diseases. These antigens will typically be derived from
the cell surface, cytoplasm, nucleus, mitochondria and the like of
mammalian tissues, including antigens characteristic of diabetes
mellitus, multiple sclerosis, systemic lupus erythematosus,
rheumatoid arthritis, pernicious anemia, Addison's disease,
scleroderma, autoimmune atrophic gastritis, juvenile diabetes, and
discoid lupus erythromatosus.
[0156] Antigens that are allergens generally include proteins or
glycoproteins, including antigens derived from pollens, dust,
molds, spores, dander, insects and foods. In addition, antigens
that are characteristic of tumor antigens typically will be derived
from the cell surface, cytoplasm, nucleus, organelles and the like
of cells of tumor tissue. Examples include antigens characteristic
of tumor proteins, including proteins encoded by mutated oncogenes;
viral proteins associated with tumors; and glycoproteins. Tumors
include, but are not limited to, those derived from the types of
cancer: lip, nasopharynx, pharynx and oral cavity, esophagus,
stomach, colon, rectum, liver, gall bladder, pancreas, larynx, lung
and bronchus, melanoma of skin, breast, cervix, uterine, ovary,
bladder, kidney, uterus, brain and other parts of the nervous
system, thyroid, prostate, testes, Hodgkin's disease, non-Hodgkin's
lymphoma, multiple myeloma and leukemia.
[0157] In one specific embodiment of the invention, the
heterologous sequences are derived from the genome of human
immunodeficiency virus (HIV), preferably hunian immunodeficiency
virus-1 or human immunodeficiency virus-2. In another embodiment of
the invention, the heterologous coding sequences may be inserted
within a PIV gene coding sequence such that a chimeric gene
product, that contains the heterologous peptide sequence within the
PIV viral protein, is expressed. In such an embodiment of the
invention, the heterologous sequences may also be derived from the
genome of a human immunodeficiency virus, preferably of human
immunodeficiency virus-1 or human immunodeficiency virus-2.
[0158] In instances whereby the heterologous sequences are
HIV-derived, such sequences may include, but are not limited to
sequences derived from the env gene (i.e., sequences encoding all
or part of gp160, gp120, and/or gp41), the pol gene (i.e.,
sequences encoding all or part of reverse transcriptase,
endonuclease, protease, and/or integrase), the gag gene (i.e.,
sequences encoding all or part of p7, p6, p55, p17/18, p24/25) tat,
rev, nef, vif, vpu, vpr, and/or vpx.
[0159] In another embodiment, heterologous gene sequences that can
be engineered into the chimeric viruses include those that encode
proteins with immunopotentiating activities. Examples of
immunopotentiating proteins include, but are not limited to,
cytokines, interferon type 1, gamma interferon, colony stimulating
factors, and interleukin-1, -2, -4, -5, -6, -12.
[0160] In addition, other heterologous gene sequences that may be
engineered into the chimeric viruses include those encoding
antigens derived from bacteria such as bacterial surface
glycoproteins, antigens derived from fungi, and antigens derived
from a variety of other pathogens and parasites. Examples of
heterologous gene sequences derived from bacterial pathogens
include, but are not limited to, those encoding antigens derived
from species of the following genera: Salmonella, Shigella,
Chlamydia, Helicobacter, Yersinia, Bordatella, Pseudomonas,
Neisseria, Vibrio, Haemophilus, Mycoplasma, Streptomyces,
Treponema, Coxiella, Ehrlichia, Brucella, Streptobacillus,
Fusospirocheta, Spirillum, Ureaplasma, Spirochaeta, Mycoplasma,
Actinomycetes, Borrelia, Bacteroides, Trichonioras, Branhamella,
Pasteurella, Clostridium, Corynebacterium, Listeria, Bacillus,
Erysipelothrix, Rhodococcus, Escherichia, Klebsiella, Pseudomanas,
Enterobacter, Serratia, Staphylococcus, Streptococcus, Legionella,
Mycobacterium, Proteus, Campylobacter, Enterococcus, Acinetobacter,
Morganella, Moraxella, Citrobacter, Rickettsia, Rochlimeae, as well
as bacterial species such as: P. aeruginosa; E. coli, P. cepacia,
S. epidermis, E. faecalis, S. pneumonias, S. aureus, N.
meningitidis, S. pyogenes, Pasteurella multocida, Treponema
pallidum, and P. mirabilis.
[0161] Examples of heterologous gene sequences derived from
pathogenic fungi, include, but are not limited to, those encoding
antigens derived from fungi such as Cryptococcus neoformans;
Blastomyces dermatitidis; Aiellomyces dermatitidis; Histoplasma
capsulatum; Coccidioides immitis; Candida species, including C.
albicans, C. tropicalis, C. parapsilosis, C. guilliermondii and C.
krusei, Aspergillus species, including A. fumigatus, A. flavus and
A. niger, Rhizopus species; Rhizomucor species; Cunninghammella
species; Apophysomyces species, including A. saksenaea, A. mucor
and A. absidia; Sporothrix schenckii, Paracoccidioides
brasiliensis; Pseidallescheria boydii, Torulopsis glabrata;
Trichophyton species, Microsporum species and Dermatophyres
species, as well as any other yeast or fungus now known or later
identified to be pathogenic.
[0162] Finally, examples of heterologous gene sequences derived
from parasites include, but are not limited to, those encoding
antigens derived from members of the Apicomplexa phylum such as,
for example, Babesia, Toxoplasma, Plasmodiun, Eimeria, Isospora,
Atoxoplasma, Cystoisospora, Hammondia, Besniotia, Sarcocystis,
Frenkelia, Haemoproteus, Leucocytozoon, Theileria, Perkinsus and
Gregarina spp.; Pneumocystis carinii; members of the Microspora
phylum such as, for example, Nosema, Enterocytozoon,
Encephalitozoon, Septata, Mrazekia, Amblyospora, Ameson, Glugea,
Pleistophora and Microsporidiun spp.; and members of the
Ascetospora phylum such as, for example, Haplosporidium spp., as
well as species including Plasmodium falciparum, P. vivax, P.
ovale, P. malaria; Toxoplasma gondii; Leishmania mexicana, L.
tropica, L. major, L. aethiopica, L. donovani, Trypanosoma cruzi, T
brucei, Schistosoma niansoni, S. haematobium, S. japonium;
Trichinella spiralis; Wuchereria bancrofti; Brugia malayli;
Entamoeba histolytica; Enterobius vermiculoarus; Taenia solium, T.
saginata, Trichomnonas vaginatis, T hominis, T tenax; Giardia
lamblia; Cryptosporidium parvum; Pneumocytis carinii, Babesia
bovis, B. divergens, B. microti, Isospora belli, L hominis;
Dientamoebafragilis; Onchocerca volvulus; Ascaris lumbricoides;
Necator americanis; Ancylostoma duodenale; Strongyloides
stercoralis; Capillaria philippinensis; Angiostrongylus
cantonensis; Hymenolepis nana; Diphyllobothrium latum; Echinococcus
granulosus, E. multilocularis; Paragonimus westermani, P.
caliensis; Chionorchis sinensis; Opisthorchis felineas, G.
Viverini, Fasciola hepatica, Sarcoptes scabiei, Pediculus humanus;
Phthirlus pubis; and Dermatobia hominis, as well as any other
parasite now known or later identified to be pathogenic.
[0163] 5.1.2. Metapneumoviral Sequences to be Inserted
[0164] proteins of a mammalian MPV. The invention further relates
to nucleic acid sequences encoding fusion proteins, wherein the
fusion protein contains a protein of a mammalian MPV or a fragment
thereof and one or more peptides or proteins that are not derived
from mammalian MPV. In a specific embodiment, a fusion protein of
the invention contains a protein of a mammalian MPV or a fragment
thereof and a peptide tag, such as, but not limited to a
polyhistidine tag. The invention further relates to fusion
proteins, wherein the fusion protein contains a protein of a
mammalian MPV or a fragment thereof and one or more peptides or
proteins that are not derived from mammalian MPV. The invention
also relates to derivatives of nucleic acids encoding a protein of
a mammlian MPV. The invention also relates to derivatives of
proteins of a mammalian MPV. A derivative can be, but is not
limited to, mutant forms of the protein, such as, but not limited
to, additions, deletions, truncations, substitutions, and
inversions. A derivative can further be a chimeric form of the
protein of the mammalian MPV, wherein at least one domain of the
protein is derived from a different protein. A derivative can also
be a form of a protein of a mammalian MPV that is covalently or
non-covalently linked to another molecule, such as, e.g., a
drug.
[0165] The viral isolate termed NL/1/00 (also 00-1) is a mammalian
MPV of variant A1 and its genomic sequence is shown in SEQ ID
NO:95. The viral isolate termed NL/17/00 is a mammalian MPV of
variant A2 and its genomic sequence is shown in SEQ ID NO:96. The
viral isolate termed NL/1/99 (also 99-1) is a mammalian MPV of
variant B1 and its genomic sequence is shown in SEQ ID NO:94. The
viral isolate termed NL/1/94 is a mammalian MPV of variant B2 and
its genomic sequence is shown in SEQ ID NO:97. A list of sequences
disclosed in the present application and the corresponding SEQ ID
Nos is set forth in Table 16.
[0166] The protein of a mammalian MPV can be a an N protein, a P
protein, a M protein, a F protein, a M2-1 protein or a M2-2 protein
or a fragment thereof. A fragment of a protein of a mammlian MPV
can be can be at least 25 amino acids, at least 50 amino acids, at
least 75 amino acids, at least 100 amino acids, at least 125 amino
acids, at least 150 amino acids, at least 175 amino acids, at least
200 amino acids, at least 225 amino acids, at least 250 amino
acids, at least 275 amino acids, at least 300 amino acids, at least
325 amino acids, at least 350 amino acids, at least 375 amino
acids, at least 400 amino acids, at least 425 amino acids, at least
450 amino acids, at least 475 amino acids, at least 500 amino
acids, at least 750 amino acids, at least 1000 amino acids, at
least 1250 amino acids, at least 1500 amino acids, at least 1750
amino acids, at least 2000 amino acids or at least 2250 amino acids
in length. A fragment of a protein of a mammlian MPV can be can be
at most 25 amino acids, at most 50 amino acids, at most 75 amino
acids, at most 100 amino acids, at most 125 amino acids, at most
150 amino acids, at most 175 amino acids, at most 200 amino acids,
at most 225 amino acids, at most 250 amino acids, at most 275 amino
acids, at most 3.00 amino acids, at most 325 amino acids, at most
350 amino acids, at most 375 amino acids, at most 400 amino acids,
at most 425 amino acids, at most 450 amino acids, at most 475 amino
acids, at most 500 amino acids, at most 750 amino acids, at most
1000 amino acids, at most 1250 amino acids, at most 1500 amino
acids, at most 1750 amino acids, at most 2000 amino acids or at
most 2250 amino acids in length.
[0167] In certain embodiments of the invention, the protein of a
mammalian MPV is a N protein, wherein the N protein is
phylogenetically closer related to a N protein of a mammalian MPV,
such as the N protein encoded by, e.g., the viral genome of SEQ ID
NO:94, SEQ ID NO:95, SEQ ID NO:96, or SEQ ID NO:97, (see also Table
16 for a description of the SEQ ID Nos) than it is related to the N
protein of APV type C. In certain embodiments of the invention, the
protein of a mammalian MPV is a P protein, wherein the protein is
phylogenetically closer related to a P protein of a mammalian MPV,
such as the protein encoded by, e.g., the viral genome of SEQ ID
NO:NO:94, SEQ ID NO:95, SEQ ID NO:96, or SEQ ID NO:97, than it is
related to the N protein of APV type C. In certain embodiments of
the invention, the protein of a mammalian MPV is a M protein,
wherein the M protein is closer related to a M protein of a
mammalian MPV, such as the M protein encoded by, e.g., the viral
genome of SEQ ID NO:94, SEQ ID NO:95, SEQ ID NO:96, or SEQ ID
NO:97, than it is related to the M protein of APV type C. In
certain embodiments of the invention, the protein of a mammalian
MPV is a F protein, wherein the F protein is phylogenetically
closer related to a F protein of a mammalian MPV, such as the F
protein encoded by, e.g., the viral genome of SEQ ID NO:94, SEQ ID
NO:95, SEQ ID NO:96, or SEQ ID NO:97, than it is related to the F
protein of APV type C. In certain embodiments of the invention, the
protein of a mammalian MPV is a M2-1 protein, wherein the M2-1
protein is phylogenetically closer related to a M2-1 protein of a
mammalian MPV, such as the M2-1 protein encoded by, e.g., the viral
genome of SEQ ID. NO:94, SEQ ID NO:95, SEQ ID NO:96, or SEQ ID
NO:97, than it is related to the M2-1 protein of APV type C. In
certain embodiments of the invention, the protein of a mammalian
MPV is a M2-2 protein, wherein the M2-2 protein is phylogenetically
closer related to a M2-2 protein of a mammalian MPV, such as the
M2-2 protein encoded by, e.g., the viral genome of SEQ ID NO:94,
SEQ ID NO:95, SEQ ID NO:96, or SEQ ID NO:97, than it is related to
the M2-2 protein of APV type C. In certain embodiments of the
invention, the protein of a mammalian MPV is a G protein, wherein
the G protein is phylogenetically closer related to a G protein of
a mammalian MPV, such as the G protein encoded by, e.g., the viral
genome of SEQ ID NO:94, SEQ ID NO:95, SEQ ID NO:96, or SEQ ID
NO:97, than it is related to any protein of APV type C. In certain
embodiments of the invention, the protein of a mammalian MPV is a
SH protein, wherein the SH protein is phylogenetically closer
related to a SH protein of a mammalian MPV, such as the SH protein
encoded by, e.g., the viral genome of SEQ ID NO:94, SEQ ID NO:95,
SEQ ID NO:96, or SEQ ID NO:97, than it is related to any protein of
APV type C. In certain embodiments of the invention, the protein of
a mammalian MPV is a L protein, wherein the L protein is
phylogenetically closer related to a L protein of a mammalian MPV,
such as the SH protein encoded by, e.g., the viral genome of SEQ ID
NO:94, SEQ ID NO:95, SEQ ID NO:96, or SEQ ID NO:97, than it is
related to any protein of APV type C.
[0168] In certain embodiments of the invention, the protein of a
mammalian MPV is a N protein, wherein the N protein is at least
60%, at least 65%, at least 70%, at least 75%, at least 80%, at
least 85%, at least 90%, at least 95%, at least 98%, at least 99%,
or at least 99.5% identical to the amino acid sequence of a N
protein encoded by the viral genome of SEQ ID NO:94, SEQ ID NO:95,
SEQ ID NO:96, or SEQ ID NO:97 (the amino acid sequences of the
respective N proteins are disclosed in SEQ ID NO:366-369; see also
Table 16). In certain embodiments of the invention, the protein of
a mammalian MPV is a N protein, wherein the P protein is at least
60%, at least 65%, at least 70%, at least 75%, at least 80%, at
least 85%, at least 90%, at least 95%, at least 98%, at least 99%,
or at least 99.5% identical to the amino acid sequence of a P
protein encoded by the viral genome of SEQ ID NO:94, SEQ ID NO:95,
SEQ ID NO:96, or SEQ ID NO:97 (the amino acid sequences of the
respective P proteins are disclosed in SEQ ID NO:78-85; see also
Table 16). In certain embodiments of the invention, the protein of
a mammalian MPV is a M protein, wherein the M protein is at least
60%, at least 65%, at least 70%, at least 75%, at least 80%, at
least 85%, at least 90%, at least 95%, at least 98%, at least 99%,
or at least 99.5% identical to the amino acid sequence of a M
protein encoded by the viral genome of SEQ ID NO:94, SEQ ID NO:95,
SEQ ID NO:96, or SEQ ID NO:97 (the amino acid sequences of the
respective M proteins are disclosed in SEQ ID NO:358-361; see also
Table 16). In certain embodiments of the invention, the protein of
a mammalian MPV is a F protein, wherein the F protein is at least
60%, at least 65%, at least 70%, at least 75%, at least 80%, at
least 85%, at least 90%, at least 95%, at least 98%, at least 99%,
or at least 99.5% identical to the amino acid sequence of a F
protein encoded by the viral genome of SEQ ID NO:94, SEQ ID NO:95,
SEQ ID NO:96, or SEQ ID NO:97 (the amino acid sequences of the
respective F proteins are disclosed in SEQ ID NO:18-25; see also
Table 16). In certain embodiments of the invention, the protein of
a mammalian MPV is a M2-1 protein, wherein the M2-1 protein is at
least 60%, at least 65%, at least 70%, at least 75%, at least 80%,
at least 85%, at least 90%, at least 95%, at least 98%, at least
99%, or at least 99.5% identical to the amino acid sequence of a
M2-1 protein encoded by the viral genome of SEQ ID NO:94, SEQ ID
NO:95, SEQ ID NO:96, or SEQ ID NO:97 (the amino acid sequences of
the respective M2-1 proteins are disclosed in SEQ ID NO:42-49; see
also Table 16). In certain embodiments of the invention, the
protein of a mammalian MPV is a M2-2 protein, wherein the M2-2
protein is at least 60%, at least 65%, at least 70%, at least 75%,
at least 80%, at least 85%, at least 90%, at least 95%, at least
98%, at least 99%, or at least 99.5% identical to the amino acid
sequence of a M2-2 protein encoded by the viral genome of SEQ ID
NO:94, SEQ ID NO:95, SEQ ID NO:96, or SEQ ID NO:97 (the amino acid
sequences of the respective M2-2 proteins are disclosed in SEQ ID
NO:50-57; see also Table 16). In certain embodiments of the
invention, the protein of a mammalian MPV is a G protein, wherein
the G protein is at least 60%, at least 65%, at least 70%, at least
75%, at least 80%, at least 85%, at least 90%, at least 95%, at
least 98%, at least 99%, or at least 99.5% identical to the amino
acid sequence of a G protein encoded by the viral genome of SEQ ID
NO:94, SEQ ID NO:95, SEQ ID NO:96, or SEQ ID NO:97 (the amino acid
sequences of the respective G proteins are disclosed in SEQ ID
NO:26-33; see also Table 16). In certain embodiments of the
invention, the protein of a mammalian MPV is a SH protein, wherein
the SH protein is at least 60%, at least 65%, at least 70%, at
least 75%, at least 80%, at least 85%, at least 90%, at least 95%,
at least 98%, at least 99%, or at least 99.5% identical to the
amino acid sequence of a SH protein encoded by the viral genome of
SEQ ID NO:94, SEQ ID NO:95, SEQ ID NO:96, or SEQ ID NO:97 (the
amino acid sequences of the respective SH proteins are disclosed in
SEQ ID NO:86-93; see also Table 16). In certain embodiments of the
invention, the protein of a mammalian MPV is a L protein, wherein
the L protein is at least 60%, at least 65%, at least 70%, at least
75%, at least 80%, at least 85%, at least 90%, at least 95%, at
least 98%, at least 99%, or at least 99.5% identical to the amino
acid sequence of a L protein encoded by the viral genome of SEQ ID
NO:94, SEQ ID NO:95, SEQ ID NO:96, or SEQ ID NO:97 (the amino acid
sequences of the respective L proteins are disclosed in SEQ ID
NO:34-41; see also Table 16).
[0169] A fragment of a protein of mammalian MPV is at least 60%, at
least 65%, at least 70%, at least 75%, at least 80%, at least 85%,
at least 90%, at least 95%, at least 98%, at least 99%, or at least
99.5% identical to the homologous protein encoded by the virus of
SEQ ID NO:94, SEQ ID NO:95, SEQ ID NO:96, or SEQ ID NO:97 over the
portion of the protein that is homologous to the fragment. In a
specific, illustrative embodiment, the invention provides a
fragment of the F protein of a mammalian MPV that contains the
ectodomain of the F protein and homologs thereof. The homolog of
the fragment of the F protein that contains the ectodomain is at
least 60%, at least 65%, at least 70%, at least 75%, at least 80%,
at least 85%, at least 90%, at least 95%, at least 98%, at least
99%, or at least 99.5% identical to the corresponding fragment
containing the ectodomain of the F protein encoded by a virus of
SEQ ID NO:94, SEQ ID NO:95, SEQ ID NO:96, or SEQ ID NO:97 (the
amino acid sequences of the respective F proteins are disclosed in
SEQ ID NO:18-25; see also Table 16).
[0170] In certain embodiments, the invention provides a protein of
a mammalian MPV of subgroup A and fragments thereof. The invention
provides a N protein of a mammalian MPV of subgroup A, wherein the
N protein is phylogenetically closer related to the N protein
encoded by a virus of SEQ ID NO:95 or SEQ ID NO:96 than it is
related to the N protein encoded by a virus encoded by SEQ ID NO:94
or SEQ ID NO:97. The invention provides a G protein of a mammalian
MPV of subgroup A, wherein the G protein is phylogenetically closer
related to the G protein encoded by a virus of SEQ ID NO:95 or SEQ
ID NO:96 than it is related to the G protein encoded by a virus
encoded by SEQ ID NO:94 or SEQ ID NO:97. The invention provides a P
protein of a mammalian MPV of subgroup A, wherein the P protein is
phylogenetically closer related to the P protein encoded by a virus
of SEQ ID NO:95 or SEQ ID NO:96 than it is related to the P protein
encoded by a virus encoded by SEQ ID NO:94 or SEQ ID NO:97. The
invention provides a M protein of a mammalian MPV of subgroup A,
wherein the M protein is phylogenetically closer related to the M
protein encoded by a virus of SEQ ID NO:95 or SEQ ID NO:96 than it
is related to the M protein encoded by a virus encoded by SEQ ID
NO:94 or SEQ ID NO:97. The invention provides a N protein of a
mammalian MPV of subgroup A, wherein the F protein is
phylogenetically closer related to the F protein encoded by a virus
of SEQ ID NO:95 or SEQ ID NO:96 than it is related to the F protein
encoded by a virus encoded by SEQ ID NO:94 or SEQ ID NO:97. The
invention provides a M2-1 protein of a mammalian MPV of subgroup A,
wherein the M2-1 protein is phylogenetically closer related to the
M2-1 protein encoded by a virus of SEQ ID NO:95 or SEQ ID NO:96
than it is related to the M2-1 protein encoded by a virus encoded
by SEQ ID NO:94 or SEQ ID NO:97. The invention provides a M2-2
protein of a mammalian MPV of subgroup A, wherein the M2-2 protein
is phylogenetically closer related to the M2-2 protein encoded by a
virus of SEQ ID NO:95 or SEQ ID NO:96 than it is related to the
M2-2 protein encoded by a virus encoded by SEQ ID NO:94 or SEQ ID
NO:97. The invention provides a SH protein of a mammalian MPV of
subgroup A, wherein the SH protein is phylogenetically closer
related to the SH protein encoded by a virus of SEQ ID NO:95 or SEQ
ID NO:96 than it is related to the SH protein encoded by a virus
encoded by SEQ ID NO:94 or SEQ ID NO:97. The invention provides a L
protein of a mammalian MPV of subgroup A, wherein the L protein is
phylogenetically closer related to the L protein encoded by a virus
of SEQ ID NO:95 or SEQ ID NO:96 than it is related to the L protein
encoded by a virus encoded by SEQ ID NO:94 or SEQ ID NO:97.
[0171] In other embodiments, the invention provides a protein of a
mammalian MPV of subgroup B or fragments thereof. The invention
provides a N protein of a mammalian MPV of subgroup B, wherein the
N protein is phylogenetically closer related to the N protein
encoded by a virus of SEQ ID NO:94 or SEQ ID NO:97 than it is
related to the N protein encoded by a virus encoded by SEQ ID NO:95
or SEQ ID NO:96. The invention provides a G protein of a mammalian
MPV of subgroup A, wherein the G protein is phylogenetically closer
related to the G protein encoded by a virus of SEQ ID NO:94 or SEQ
ID NO:97 than it is related to the G protein encoded by a virus
encoded by SEQ ID NO:95 or SEQ ID NO:96. The invention provides a P
protein of a mammalian MPV of subgroup A, wherein the P protein is
phylogenetically closer related to the P protein encoded by a virus
of SEQ ID NO:94 or SEQ ID NO:97 than it is related to the P protein
encoded by a virus encoded by SEQ ID NO:95 or SEQ ID NO:96. The
invention provides a M protein of a mammalian MPV of subgroup A,
wherein the M protein is phylogenetically closer related to the M
protein encoded by a virus of SEQ ID NO:94 or SEQ ID NO:97 than it
is related to the M protein encoded by a virus encoded by SEQ ID
NO:95 or SEQ ID NO:96. The invention provides a N protein of a
mammalian MPV of subgroup A, wherein the F protein is
phylogenetically closer related to the F protein encoded by a virus
of SEQ ID NO:94 or SEQ ID NO:97 than it is related to the F protein
encoded by a virus encoded by SEQ ID NO:95 or SEQ ID NO:96. The
invention provides a M2-1 protein of a mammalian MPV of subgroup A,
wherein the M2-1 protein is phylogenetically closer related to the
M2-1 protein encoded by a virus of SEQ ID NO:94 or SEQ ID NO:97
than it is related to the M2-1 protein encoded by a virus encoded
by SEQ ID NO:95 or SEQ ID NO:96. The invention provides a M2-2
protein of a mammalian MPV of subgroup A, wherein the M2-2 protein
is phylogenetically closer related to the M2-2 protein encoded by a
virus of SEQ ID NO:94' or SEQ ID NO:97 than it is related to the
M2-2 protein encoded by a virus encoded by SEQ ID NO:95 or SEQ ID
NO:96. The invention provides a SH protein of a mammalian MPV of
subgroup A, wherein the SH protein is phylogenetically closer
related to the SH protein encoded by a virus of SEQ ID NO:94 or SEQ
ID NO:97 than it is related to the SH protein encoded by a virus
encoded by SEQ ID NO:95 or SEQ ID NO:96. The invention provides a L
protein of a mammalian MPV of subgroup A, wherein the L protein is
phylogenetically closer related to the L protein encoded by a virus
of SEQ ID NO:94 or SEQ ID NO:97 than it is related. to the L
protein encoded by a virus encoded by SEQ ID NO:95 or SEQ ID
NO:96.
[0172] The invention provides a G protein of a mammalian MPV
variant B1, wherein the G protein of a mammalian MPV variant B1 is
phylogenetically closer related to the G protein of the prototype
of variant B1, isolate NL/1/99, than it is related to the G protein
of the prototype of variant A1, isolate NL/1/00, the G protein of
the prototype of A2, isolate NL/17/00, or the G protein of the
prototype of B2, isolate NL/1/94. The invention provides a G
protein of a mammalian MPV variant B1, wherein the amino acid
sequence of the G protein is at least 66%, at least 70%, at least
75%, at least 80%, at least 85%, at least 90%, at least 95%, at
least 98%, or at least 99% or at least 99.5% identical to the G
protein of a mammalian MPV variant B1 as represented by the
prototype NL//99 (SEQ ID NO:28). In a specific embodiment, the G
protein of a mammalian MPV has the amino acid sequence of SEQ ID
NO:119-153. The invention provides a N protein of a mammalian MPV
variant B1, wherein the N protein of a mammalian MPV variant B1 is
phylogenetically closer related to the N protein of the prototype
of variant B1, isolate NL/1/99, than it is related to the N protein
of the prototype of variant A1, isolate NL/1/00, the N protein of
the prototype of A2, isolate NL/17/00, or the N protein of the
prototype of B2, isolate NL/1/94. The invention provides a N
protein of a mammalian MPV variant B2, wherein the amino acid
sequence of the N protein is at least 98.5% or at least 99% or at
least 99.5% identical to the N protein of a mammalian MPV variant
B1 as represented by the prototype NL/1/99 (SEQ ID NO:72). The
invention provides a protein of a mammalian MPV variant B1, wherein
the P protein of a mammalian MPV variant B1 is phylogenetically
closer related to the P protein of the prototype of variant B1,
isolate NL/1/99, than it is related to the P protein of the
prototype of variant A1, isolate NL/1/00, the P protein of the
prototype of A2, isolate NL/17/00, or the P protein of the
prototype of B2, isolate NL/1/94. The invention provides a P
protein of a mammalian MPV variant B1, wherein the amino acid
sequence of the P protein is at least 96%, at least 98%, or at
least 99% or at least 99.5% identical the P protein of a mammalian
MPV variant B1 as represented by the prototype NL/1/99 (SEQ ID
NO:80). The invention provides a M protein of a mammalian MPV
variant B1, wherein the M protein of a mammalian MPV variant B1 is
phylogenetically closer related to the M protein of the prototype
of variant B1, isolate NL/1/99, than it is related to the M protein
of the prototype of variant A1, isolate NL/1/00, the M protein of
the prototype of A2, isolate NL/17/00, or the M protein of the
prototype of B2, isolate NL/1/94. The invention provides a M
protein of a mammalian MPV variant B1, wherein the amino acid
sequence of the M protein is identical to the M protein of a
mammalian MPV variant B1 as represented by the prototype NL/1/99
(SEQ ID NO:64). The invention provides a F protein of a mammalian
MPV variant B1, wherein the F protein of a mammalian MPV variant B1
is phylogenetically closer related to the F protein of variant B1,
isolate NL/1/99, than it is related to the F protein of variant A1,
isolate NL/1/00, the F protein of prototype A2, isolate NL/17/00,
or the F protein of the prototype of B2, isolate NL/1/94. The
invention provides a F protein of mammalian MPV variant B1, wherein
the amino acid sequence of the F protein is identical at least 99%
identical, to the F protein of a mammalian MPV variant B1 as
represented by the prototype NL/1/99 (SEQ ID NO:20). In a specific
embodiment, the F protein of a mammalian MPV has the amino acid
sequence of SEQ ID NO: 248-327. The invention provides a M2-1
protein of a mammalian MPV variant B1, wherein the M2-1 protein of
a mammalian MPV variant B1 is phylogenetically closer related to
the M2-1 protein of the prototype of variant B1, isolate NL/1/99,
than it is related to the M2-1 protein of the prototype of variant
A1, isolate NL/1/00, the M2-1 protein of the prototype of A2,
isolate NL/17/00, or the M2-1 protein of the prototype of B2,
isolate NL/1/94. The invention provides a M2-1 protein of a
mammalian MPV variant B1, wherein the amino acid sequence of the
M2-1 protein is at least 98% or at least 99% or at least 99.5%
identical the M2-1 protein of a mammalian MPV variant B1 as
represented by the prototype NL/1/99 (SEQ ID NO:44). The invention
provides a M2-2 protein of a mammalian MPV variant B1, wherein the
M2-2 protein of a mammalian MPV variant B1 is phylogenetically
closer related to the M2-2 protein of the prototype of variant B1,
isolate NL/1/99, than it is related to the M2-2 protein of the
prototype of variant A1, isolate NL/1/00, the M2-2 protein of the
prototype of A2, isolate NL/17/00, or the M2-2 protein of the
prototype of B2, isolate NL/1/94. The invention provides a M2-2
protein of a mammalian MPV variant B1, wherein the amino acid
sequence of the M2-2 protein is at least 99% or at least 99.5%
identical the M2-2 protein of a mammalian MPV variant B1 as
represented by the prototype NL/199 (SEQ ID NO:52). The invention
provides a SH protein of a mammalian MPV variant B1, wherein the SH
protein of a mammalian MPV variant B1 is phylogenetically closer
related to the SH protein of the prototype of variant B1, isolate
NL/1/99, than it is related to the SH protein of the prototype of
variant A1, isolate NL/1/00, the SH protein of the prototype of A2,
isolate NL/17/00, or the SH protein of the prototype of B2, isolate
NL/1/94. The invention provides a SH protein of a mammalian MPV
variant B1, wherein the amino acid sequence of the SH protein is at
least 83%, at least 85%, at least 90%, at least 95%, at least 98%,
or at least 99% or at least 99.5% identical the SH protein of a
mammalian MPV variant B1 as represented by the prototype NL/1/99
(SEQ ID NO:88). The invention provides a L protein of a mammalian
MPV variant B1, wherein the L protein of a mammalian MPV variant B1
is phylogenetically closer related to the L protein of the
prototype of variant B1, isolate NL/1/99, than it is related to the
L protein of the prototype of variant A1, isolate NL/1/00, the L
protein of the prototype of A2, isolate NL/17/00, or the L protein
of the prototype of B2, isolate NL/1/94. The invention provides a L
protein of a mammalian MPV variant B1, wherein the amino acid
sequence of the L protein is at least 99% or at least 99.5%
identical the L protein a mammalian MPV variant B1 as represented
by the prototype NL/1/99 (SEQ ID NO:36).
[0173] The invention provides a G protein of a mammalian MPV
variant A1, wherein the G protein of a mammalian MPV variant A1 is
phylogenetically closer related to the G protein of the prototype
of variant A1, isolate NL/1/00, than it is related to the G protein
of the prototype of variant B1, isolate NL/1/99, the G protein of
the prototype of A2, isolate NL/17/00, or the G protein of the
prototype of B2, isolate NL/1/94. The invention provides a G
protein of a mammalian MPV variant A1, wherein the amino acid
sequence of the G protein is at least 66%, at least 70%, at least
75%, at least 80%, at least 85%, at least 90%, at least 95%, at
least 98%, or at least 99% or at least 99.5% identical to the G
protein of a mammalian MPV variant A1 as represented by the
prototype NL/1/00 (SEQ ID NO:26). The invention provides a N
protein of a mammalian MPV variant A1, wherein the N protein of a
mammalian MPV variant A1 is phylogenetically closer related to the
N protein of the prototype of variant A1, isolate NL/1/00, than it
is related to the N protein of the prototype of variant B1, isolate
NL/1/99, the N protein of the prototype of A2, isolate NL/17/00, or
the N protein of the prototype of B2, isolate NL/1/94. The
invention provides a N protein of a mammalian MPV variant A1,
wherein the amino acid sequence of the N protein is at least 99.5%
identical to the N protein of a mammalian MPV variant A1 as
represented by the prototype NL/1/00 (SEQ ID NO:70). The invention
provides a P protein of a mammalian MPV variant A1, wherein the P
protein of a mammalian MPV variant A1 is phylogenetically closer
related to the P protein of the prototype of variant A1, isolate
NL/1/00, than it is related to the P protein of the prototype of
variant B1, isolate NL/1/99, the P protein of the prototype of A2,
isolate NL/17/00, or the P protein of the prototype of B2, isolate
NL/1/94. The invention provides a P protein of a mammalian MPV
variant A1, wherein the amino acid sequence of the P protein is at
least 96%, at least 98%, or at least 99% or at least 99.5%
identical to the P protein of a mammalian MPV variant A1 as
represented by the prototype NL/1/00 (SEQ ID NO:78). The invention
provides a M protein of a mammalian MPV variant A1, wherein the M
protein of a mammalian MPV variant A1 is phylogenetically closer
related to the M protein of the prototype of variant A1, isolate
NL/1/00, than it is related to the M protein of the prototype of
variant B1, isolate NL/1/99, the M protein of the prototype of A2,
isolate NL/17/00, or the M protein of the prototype of B2, isolate
NL/1/94. The invention provides a M protein of a mammalian MPV
variant A1, wherein the amino acid sequence of the M protein is at
least 99% or at least 99.5% identical to the M protein of a
mammalian MPV variant A1 as represented by the prototype NL/1/00
(SEQ ID NO:62). The invention provides a F protein of a mammalian
MPV variant A1, wherein the F protein of a mammalian MPV variant A1
is phylogenetically closer related to the F protein of the
prototype of variant A1, isolate NL/1/00, than it is related to the
F protein of the prototype of variant B1, isolate NL/1/99, the F
protein of the prototype of A2, isolate NL/17/00, or the F protein
of the prototype of B2, isolate NL/1/94. The invention provides a F
protein of a mammalian MPV variant A1, wherein the amino acid
sequence of the F protein is at least 98% or at least 99% or at
least 99.5% identical to the F protein of a mammalian MPV variant
A1 as represented by the prototype NL/1/00 (SEQ ID NO:18). The
invention provides a M2-1 protein of a mammalian MPV variant A1,
wherein the M2-1 protein of a mammalian MPV variant A1 is
phylogenetically closer related to the M2-1 protein of the
prototype of variant A1, isolate NL/1/00, than it is related to the
M2-1 protein of the prototype of variant B1, isolate NL/1/99, the
M2-1 protein of the prototype of A2, isolate NL/17/00, or the M2-1
protein of the prototype of B2, isolate NL/1/94. The invention
provides a M2-1 protein of a mammalian MPV variant A1, wherein the
amino acid sequence of the M2-1 protein is at least 99% or at least
99.5% identical to the M2-1 protein of a mammalian MPV variant A1
as represented by the prototype NL1/00 (SEQ ID NO:42). The
invention provides a M2-2 protein of a mammalian MPV variant A1,
wherein the M2-2 protein of a mammalian MPV variant A1 is
phylogenetically closer related to the M2-2 protein of the
prototype of variant A1, isolate NL/1/00, than it is related to the
M2-2 protein of the prototype of variant B1, isolate NL/1/99, the
M2-2 protein of the prototype of A2, isolate NL/17/00, or the M2-2
protein of the prototype of B2, isolate NL/1/94. The invention
provides a M2-2 protein of a mammalian MPV variant A1, wherein the
amino acid sequence of the M2-2 protein is at least 96% or at least
99% or at least 99.5% identical to the M2-2 protein of a mammalian
MPV variant A1 as represented by the prototype NL/1/00 (SEQ ID
NO:50). The invention provides a SH protein of a mammalian MPV
variant A1, wherein the SH protein of a mammalian MPV variant A1 is
phylogenetically closer related to the SH protein of the prototype
of variant A1, isolate NL/1/00, than it is related to the SH
protein of the prototype of variant B1, isolate NL/1/99, the SH
protein of the prototype of A2, isolate NL/17/00, or the SH protein
of the prototype of B2, isolate NL/1/94. The invention provides a
SH protein of a mammalian MPV variant A1, wherein the amino acid
sequence of the SH protein is at least 84%, at least 90%, at least
95%, at least 98%, or at least 99% or at least 99.5% identical to
the SH protein of a mammalian MPV variant A1 as represented by the
prototype NL/1/00 (SEQ ID NO:86). The invention provides a L
protein of a mammalian MPV variant A1, wherein the L protein of a
mammalian MPV variant A1 is phylogenetically closer related to the
L protein of the prototype of variant A1, isolate NL/1/00, than it
is related to the L protein of the prototype of variant B1, isolate
NL/1/99, the L protein of the prototype of A2, isolate NL/17/00, or
the L protein of the prototype of B2, isolate NL/1/94. The
invention provides a L protein of a mammalian MPV variant A1,
wherein the amino acid sequence of the L protein is at least 99% or
at least 99.5% identical to the L protein of a virus of a mammalian
MPV variant A1 as represented by the prototype NL/1/00 (SEQ ID
NO:34).
[0174] The invention provides a G protein of a mammalian MPV
variant A2, wherein the G protein of a mammalian MPV variant A2 is
phylogenetically closer related to the G protein of the prototype
of variant A2, isolate NL17/00, than it is related to the G protein
of the prototype of variant B1, isolate NL/1/99, the G protein of
the prototype of A1, isolate NL/1/00, or the G protein of the
prototype of B2, isolate NL/1/94. The invention provides a G
protein of a mammalian MPV variant A2, wherein the amino acid
sequence of the G protein is at least 66%, at least 70%, at least
75%, at least 80%, at least 85%, at least 90%, at least 95%, at
least 98%, at least 99% or at least 99.5% identical to the G
protein of a mammalian MPV variant A2 as represented by the
prototype NL/17/00 (SEQ ID NO:27). The invention provides a N
protein of a mammalian MPV variant A2, wherein the N protein of a
mammalian MPV variant A2 is phylogenetically closer related to the
N protein of the prototype of variant A2, isolate NL/17/00, than it
is related to the N protein of the prototype of variant B1, isolate
NL/1/99, the N protein of the prototype of A1, isolate NL/1/00, or
the N protein of the prototype of B2, isolate NL/1/94. The
invention provides a N protein of a mammalian MPV variant A2,
wherein the amino acid sequence of the N protein at least 99.5%
identical to the N protein of a mammalian MPV variant A2 as
represented by the prototype NL/17/00 (SEQ ID NO:71). The invention
provides a P protein of a mammalian MPV variant A2, wherein the P
protein of a mammalian MPV variant A2 is phylogenetically closer
related to the P protein of the prototype of variant A2, isolate
NL/17/00, than it is related to the P protein of the prototype of
variant B1, isolate NL/1/99, the P protein of the prototype of A1,
isolate NL/1/00, or the P protein of the prototype of B2, isolate
NL/1/94. The invention provides a protein of a mammalian MPV
variant A2, wherein the amino acid sequence of the P protein is at
least 96%, at least 98%, at least 99% or at least 99.5% identical
to the P protein of a mammalian MPV variant A2 as represented by
the prototype NL/17/00 (SEQ ID NO:79). The invention provides a M
protein of a mammalian MPV variant A2, wherein the M protein of a
mammalian MPV variant A2 is phylogenetically closer related to the
M protein of the prototype of variant A2, isolate NL/17/00, than it
is related to the M protein of the prototype of variant B1, isolate
NL/1/99, the M protein of the prototype of A1, isolate NL/1/00, or
the M protein of the prototype of B2, isolate NL/1/94. The
invention provides a M protein of a mammalian MPV variant A2,
wherein the amino acid sequence of the M protein is at least 99%,
or at least 99.5% identical to the M protein of a mammalian MPV
variant A2 as represented by the prototype NL/17/00 (SEQ ID NO:63).
The invention provides a F protein of a mammalian MPV variant A2,
wherein the F protein of a mammalian MPV variant A2 is
phylogenetically closer related to the F protein of the prototype
of variant A2, isolate NL/17/00, than it is related to the F
protein of the prototype of variant B1, isolate NL/1/99, the F
protein of the prototype of A1, isolate NL/1/00, or the F protein
of the prototype of B2, isolate NL/1/94. The invention provides a F
protein of a mammalian MPV variant A2, wherein the amino acid
sequence of the F protein is at least 98%, at least 99% or at least
99.5% identical to the F protein of a mammalian MPV variant A2 as
represented by the prototype NL/17/00 (SEQ ID NO:19). The invention
provides a M2-1 protein of a mammalian MPV variant A2, wherein the
M2-1 protein of a mammalian MPV variant A2 is phylogenetically
closer related to the M2-1 protein of the prototype of variant A2,
isolate NL/17/00, than it is related to the M2-1 protein of the
prototype of variant B1, isolate NL/1/99, the M2-1 protein of the
prototype of A1, isolate NL/1/00, or the M2-1 protein of the
prototype of B2, isolate NL/1/94. The invention provides a M2-1
protein of a mammalian MPV variant A2, wherein the amino acid
sequence of the M2-1 protein is at least 99%, or at least 99.5%
identical to the M2-1 protein of a mammalian MPV variant A2 as
represented by the prototype NL/17/00 (SEQ ID NO: 43). The
invention provides a M2-2 protein of a mammalian MPV variant A2,
wherein the M2-2 protein of a mammalian MPV variant A2 is
phylogenetically closer related to the M2-2 protein of the
prototype of variant A2, isolate NL/17/00, than it is related to
the M2-2 protein of the prototype of variant B1, isolate NL/1/99,
the M2-2 protein of the prototype of A1, isolate NL/1/00, or the
M2-2 protein of the prototype of B2, isolate NL/1/94. The invention
provides a M2-2 protein of a mammalian MPV variant A2, wherein the
amino acid sequence of the M2-2 protein is at least 96%, at least
98%, at least 99% or at least 99.5% identical to the M2-2 protein
of a mammalian MPV variant A2 as represented by the prototype
NL/7/00 (SEQ ID NO:51). The invention provides a SH protein of a
mammalian MPV variant A2, wherein the SH protein of a mammalian MPV
variant A2 is phylogenetically closer related to the SH protein of
the prototype of variant A2, isolate NL/17/00, than it is related
to the SH protein of the prototype of variant B1, isolate NL/1/99,
the SH protein of the prototype of A1, isolate NL/1/00, or the SH
protein of the prototype of B2, isolate NL/1/94. The invention
provides a SH protein of a mammalian MPV variant A2, wherein the
amino acid sequence of the SH protein is at least 84%, at least
85%, at least 90%, at least 95%, at least 98%, at least 99% or at
least 99.5% identical to the SH protein of a mammalian MPV variant
A2 as represented by the prototype NL/17/00 (SEQ ID NO:87). The
invention provides a L protein of a mammalian MPV variant A2,
wherein the L protein of a mammalian MPV variant A2 is
phylogenetically closer related to the L protein of the prototype
of variant A2, isolate NL/17/00, than it is related to the L
protein of the prototype of variant B1; isolate NL/1/99, the L
protein of the prototype of A1, isolate NL/1/00, or the L protein
of the prototype of B2, isolate NL/1/94. The invention provides a L
protein of a mammalian MPV variant A2, wherein the amino acid
sequence of the L protein is at least 99% or at least 99.5%
identical to the L protein of a mammalian MPV variant A2 as
represented by the prototype NL/17/00 (SEQ ID NO:35).
[0175] The invention provides a G protein of a mammalian MPV
variant B2, wherein the G protein of a mammalian MPV variant B2 is
phylogenetically closer related to the G protein of the prototype
of variant B2, isolate NL1/94, than it is related to the G protein
of the prototype of variant B1, isolate NL/1/99, the G protein of
the prototype of A1, isolate NL/1/00, or the G protein of the
prototype of A2, isolate NL/17/00. The invention provides a G
protein of a mammalian MPV variant B2, wherein the amino acid
sequence of the G protein is at least 66%, at least 70%, at least
75%, at least 80%, at least 85%, at least 90%, at least 95%, at
least 98%, or at least 99% or at least 99.5% identical to the G
protein of a mammalian MPV variant B2 as represented by the
prototype NL/1/94 (SEQ ID NO:29). The invention provides a N
protein of a mammalian MPV variant B2, wherein the N protein of a
mammalian MPV variant B2 is phylogenetically closer related to the
N protein of the prototype of variant B2, isolate NL/1/94, than it
is related to the N protein of the prototype of variant B1, isolate
NL/1/99, the N protein of the prototype of A1, isolate NL/1/00, or
the N protein of the prototype of A2, isolate NL/17/00. The
invention provides a N protein of a mammalian MPV variant B2,
wherein the amino acid sequence of the N protein is at least 99% or
at least 99.5% identical to the N protein of a mammalian MPV
variant B2 as represented by the prototype NL1/94 (SEQ ID NO:73).
The invention provides a P protein of a mammalian MPV variant B2,
wherein the P protein of a mammalian MPV variant B2 is
phylogenetically closer related to the P protein of the prototype
of variant B2, isolate NL/1/94, than it is related to the P protein
of the prototype of variant B1, isolate NL1/99, the P protein of
the prototype of A1, isolate NL/1/00, or the P protein of the
prototype of A2, isolate NL17/00. The invention provides a P
protein of a mammalian MPV variant B2, wherein the amino acid
sequence of the P protein is at least 96%, at least 98%, or at
least 99% or at least 99.5% identical to the P protein of a
mammalian MPV variant B2 as represented by the prototype NL/1/94
(SEQ ID NO:81). The invention provides a M protein of a mammalian
MPV variant B2, wherein the M protein of a mammalian MPV variant B2
is phylogenetically closer related to the M protein of the
prototype of variant B2, isolate NL/1/94, than it is related to the
M protein of the prototype of variant B13, isolate NL/1/99, the M
protein of the prototype of A1, isolate NL/1/00, or the M protein
of the prototype of A2, isolate NL/17/00. The invention provides a
M protein of a mammalian MPV variant B2, wherein the amino acid
sequence of its M protein is identical to the M protein of a
mammalian MPV variant B2 as represented by the prototype NL/1/94
(SEQ ID NO:65). The invention provides a F protein of a mammalian
MPV variant B2, wherein the F protein of a mammalian MPV variant B2
is phylogenetically closer related to the F protein of the
prototype of variant B2, isolate NL/1/94, than it is related to the
F protein of the prototype of variant B1, isolate NL/1/99, the F
protein of the prototype of A1, isolate NL/1/00, or the F protein
of the prototype of A2, isolate NL/17/00. The invention provides a
F protein of a mammalian MPV variant B2, wherein the amino acid
sequence of the F protein is at least 99% or at least 99.5%
identical to the F protein of a mammalian MPV variant B2 as
represented by the prototype NL/1/94 (SEQ ID NO:21). The invention
provides a M2-1 protein of a mammalian MPV variant B2, wherein the
M2-1 protein of a mammalian MPV variant B2 is phylogenetically
closer related to the M2-1 protein of the prototype of variant B2,
isolate NL/1/94, than it is related to the M2-1 protein of the
prototype of variant B1, isolate NL/1/99, the M2-1 protein of the
prototype of A1, isolate NL1/00, or the M2-1 protein of the
prototype of A2, isolate NL/17/00. The invention provides a M2-1
protein of a mammalian MPV variant B2, wherein the amino acid
sequence of the M2-1 protein is at least 98% or at least 99% or at
least 99.5% identical to the M2-1 protein of a mammalian MPV
variant B2 as represented by the prototype NL/1/94 (SEQ ID NO:45).
The invention provides a M2-2 protein of a mammalian MPV variant
B2, wherein the M2-2 protein of a mammalian MPV variant B2 is
phylogenetically closer related to the M2-2 protein of the
prototype of variant B2, isolate NL/1/94, than it is related to the
M2-2 protein of the prototype of variant B1, isolate NL/1/99, the
M2-2 protein of the prototype of A1, isolate NL/1/00, or the M2-2
protein of the prototype of A2, isolate NL/17/00. The invention
provides a M2-2 protein of a mammalian MPV variant B2, wherein the
amino acid sequence is at least 99% or at least 99.5% identical to
the M2-2 protein of a mammalian MPV variant B2 as represented by
the prototype NL/1/94 (SEQ ID NO:53). The invention provides a SH
protein of a mammalian MPV variant B2, wherein the SH protein of a
mammalian MPV variant B2 is phylogenetically closer related to the
SH protein of the prototype of variant B2, isolate NL/1/94, than it
is related to the SH protein of the prototype of variant B1,
isolate NL/1/99, the SH protein of the prototype of A1, isolate
NL1/00, or the SH protein of the prototype of A2, isolate NL/17/00.
The invention provides a SH protein of a mammalian MPV variant B2,
wherein the amino acid sequence of the SH protein is at least 84%,
at least 85%, at least 90%, at least 95%, at least 98%, or at least
99% or at least 99.5% identical to the SH protein of a mammalian
MPV variant B2 as represented by the prototype NL/1/94 (SEQ ID
NO:89). The invention provides a L protein of a mammalian MPV
variant B2, wherein the L protein of a mammalian MPV variant B2 is
phylogenetically closer related to the L protein of the prototype
of variant B2, isolate NL/1/94, than it is related to the L protein
of the prototype of variant B1, isolate NL/1/99, the L protein of
the prototype of A1, isolate NL/1/00, or the Lprotein of the
prototype of A2, isolate NL/17/00. The invention provides a L
protein of a mammalian MPV variant B2, wherein the and/or if the
amino acid sequence of the L protein is at least 99% or at least
99.5% identical to the L protein of a mammalian MPV variant B2 as
represented by the prototype NL/1/94 (SEQ ID NO:37).
[0176] In certain embodiments, the percentage of sequence identity
is based on an alignment of the full length proteins. In other
embodiments, the percentage of sequence identity is based on an
alignment of contiguous amino acid sequences of the proteins,
wherein the amino acid sequences can be 25 amino acids, 50 amino
acids, 75 amino acids, 100 amino acids, 125 amino acids, 150 amino
acids, 175 amino acids, 200 amino acids, 225 amino acids, 250 amino
acids, 275 amino acids, 300 amino acids, 325 amino acids, 350 amino
acids, 375 amino acids, 400 amino acids, 425 amino acids, 450 amino
acids, 475 amino acids, 500 amino acids, 750 amino acids, 1000
amino acids, 1250 amino acids, 1500 amino acids, 1750 amino acids,
2000 amino acids or 2250 amino acids in length.
[0177] The invention further provides nucleic acid sequences
derived from a mammalian MPV. The invention also provides
derivatives of nucleic acid sequences derived from a mammalian MPV.
In certain specific embodiments the nucleic acids are modified.
[0178] In certain embodiments, a nucleic acid of the invention
encodes a G protein, a N protein, a P protein, a M protein, a F
protein, a M2-1 protein, a M2-2 protein, a SH protein, or a L
protein of a mammalian MPV as defined above. In certain
embodiments, a nucleic acid of the invention encodes a G protein, a
N protein, a P protein, a M protein, a F protein, a M2-1 protein, a
M2-2 protein, a SH protein, or a L protein of subgroup A of a
mammalian MPV as defined above. In a specific embodiment, the G
gene of a mammalian MPV has the nucleotide sequence of SEQ ID
NO:98-132. In a specific embodiment, the F gene of a mammalian MPV
has the nucleotide sequence of SEQ ID NO:168-247. In certain
embodiments, a nucleic acid of the invention encodes a G protein, a
N protein, a P protein, a M protein, a F protein, a M2-1 protein, a
M2-2 protein, a SH protein, or a L protein of subgroup B of a
mammalian MPV as defined above. In certain embodiments, a nucleic
acid of the invention encodes a G protein, a N protein, a P
protein, a M protein, a F protein, a M2-1 protein, a M2-2 protein,
a SH protein, or a L protein of variant A1 of a mammalian MPV as
defined above. In certain embodiments, a nucleic acid of the
invention encodes a G protein, a N protein, a P protein, a M
protein, a F protein, a M2-1 protein, a M2-2 protein, a SH protein,
or a L protein of variant A2 of a mammalian MPV as defined above.
In certain embodiments, a nucleic acid of the invention encodes a G
protein, a N protein, a P protein, a M protein, a F protein, a M2-1
protein, a M2-2 protein, a SH protein, or a L protein of variant B1
of a mammalian MPV as defined above. In certain embodiments, a
nucleic acid of the invention encodes a G protein, a N protein, a P
protein, a M protein, a F protein, a M2-1 protein, a M2-2 protein,
a SH protein, or a L protein of variant B2 of a mammalian MPV as
defined above.
[0179] In certain embodiments, the invention provides a nucleotide
sequence that is at least 50%, at least 55%, at least 60%, at least
65%, at least 70%, at least 75%, at least 75%, at least 80%, at
least 85%, at least 90%, at least 95%, at least 98%, at least 99%,
or at least 99.5% identical to the nucleotide sequence of SEQ ID
NO:94, SEQ ID NO:95, SEQ ID NO:96, or SEQ ID NO:97. In certain
embodiments, the nucleic acid sequence of the invention, is at
least 50%, at least 55%, at least 60%, at least 65%, at least 70%,
at least 75%, at least 75%, at least 80%, at least 85%, at least
90%, at least 95%, at least 98%, at least 99%, or at least 99.5%
identical to a fragment of the nucleotide sequence of SEQ ID NO:94,
SEQ ID NO:95, SEQ ID NO:96, or SEQ ID NO:97, wherein the fragment
is at least 25 nucleotides, at least 50 nucleotides, at least 75
nucleotides, at least 100 nucleotides, at least 150 nucleotides, at
least 200 nucleotides, at least 250 nucleotides, at least 300
nucleotides, at least 400 nucleotides, at least 500 nucleotides, at
least 750 nucleotides, at least 1,000 nucleotides, at least 1,250
nucleotides, at least 1,500 nucleotides, at least 1,750
nucleotides, at least 2,000 nucleotides, at least 2,00 nucleotides,
at least 3,000 nucleotides, at least 4,000 nucleotides, at least
5,000 nucleotides, at least 7,500 nucleotides, at least 10,000
nucleotides, at least 12,500 nucleotides, or at least 15,000
nucleotides in length. In a specific embodiment, the nucleic acid
sequence of the invention is at least 50%, at least 55%, at least
60%, at least 65%, at least 70%, at least 75%, at least 75%, at
least 80%, at least 85%, at least 90%, at least 95%, at least 98%,
at least 99%, or at least 99.5% or 100% identical to one of the
nucleotide sequences of SEQ ID NO:98-132; SEQ ID NO:168-247; SEQ ID
NO:22-25; SEQ ID NO:30-33; SEQ ID NO:38-41; SEQ ID NO:46-49; SEQ ID
NO:54-57; SEQ ID NO:58-61; SEQ ID NO:66-69; SEQ ID NO:74-77; SEQ ID
NO:82-85; or SEQ ID NO:90-93.
[0180] In specific embodiments of the invention, a nucleic acid
sequence of the invention is capable of hybridizing under low
stringency, medium stringency or high stringency conditions to one
of the nucleic acid sequences of SEQ ID NO:94, SEQ ID NO:95, SEQ ID
NO:96, or SEQ ID NO:97. In specific embodiments of the invention, a
nucleic acid sequence of the invention is capable of hybridizing
under low stringency, medium stringency or high stringency
conditions to one of the nucleic acid sequences of SEQ ID
NO:98-132; SEQ ID NO:168-247; SEQ ID NO:22-25; SEQ ID NO:30-33; SEQ
ID NO:38-41; SEQ ID NO:46-49; SEQ ID NO:54-57; SEQ ID NO:58-61; SEQ
ID NO:66-69; SEQ ID NO:74-77; SEQ ID NO:82-85; or SEQ ID NO:90-93.
In certain embodiments, a nucleic acid hybridizes over a length of
at least 25 nucleotides, at least 50 nucleotides, at least 75
nucleotides, at least 100 nucleotides, at least 150 nucleotides, at
least 200 nucleotides, at least 250 nucleotides, at least 300
nucleotides, at least 400 nucleotides, at least 500 nucleotides, at
least 750 nucleotides, at least 1,000 nucleotides, at least 1,250
nucleotides, at least 1,500 nucleotides, at least 1,750
nucleotides, at least 2,000 nucleotides, at least 2,00 nucleotides,
at least 3,000 nucleotides, at least 4,000 nucleotides, at least
5,000 nucleotides, at least 7,500 nucleotides, at least 10,000
nucleotides, at least 12,500 nucleotides, or at least 15,000
nucleotides with the nucleotide sequence of SEQ ID NO:94, SEQ ID
NO:95, SEQ ID NO:96, or SEQ ID NO:97.
[0181] The invention further provides antibodies and
antigen-binding fragments that bind specifically to a protein of a
mammalian MPV. An antibody of the invention binds specifically to a
G protein, a N protein, a P protein, a M protein, a F protein, a
M2-1 protein, a M2-2 protein, a SH protein, or a L protein of a
mammalian MPV. In specific embodiments, the antibody is a human
antibody or a humanized antibody. In certain embodiments, an
antibody of the invention binds specifically to a G protein, a N
protein, a P protein, a M protein, a F protein, a M2-1 protein, a
M2-2 protein, a SH protein, or a L protein of a virus of subgroup A
of a mammalian MPV. In certain other embodiments, an antibody of
the invention binds specifically to a G protein, a N protein, a P
protein, a M protein, a F protein, a M2-1 protein, a M2-2 protein,
a SH protein, or a L protein of a virus of subgroup B of a
mammalian MPV. In certain, more specific, embodiments, an antibody
of the invention binds specifically to a G protein, a N protein, a
P protein, a M protein, a F protein, a M2-1 protein, a M2-2
protein, a SH protein, or a L protein of a virus of variant A1 of a
mammalian MPV. In other embodiments, the antibody of the invention
binds specifically to a G protein, a N protein, a P protein, a M
protein, a F protein, a M2-1 protein, a M2-2 protein, a SH protein,
or a L protein of a virus of subgroup A2 of a mammalian MPV. In
certain embodiments, an antibody of the invention binds
specifically to a G protein, a N protein, a P protein, a M protein,
a F protein, a M2-1 protein, a M2-2 protein, a SH protein, or a L
protein of a virus of subgroup B1 of a mammalian MPV. In certain
other embodiments, an antibody of the invention binds specifically
to a G protein, a N protein, a P protein, a M protein, a F protein,
a M2-1 protein, a M2-2 protein, a SH protein, or a L protein of a
virus of subgroup B2 of a mammalian MPV.
[0182] 5.1.3. Insertion of the Heterologous Gene Sequence
[0183] Insertion of a foreign gene sequence into a viral vector of
the invention can be accomplished by either a complete replacement
of a viral coding region with a heterologous sequence, or by a
partial replacement of the same, or by adding the heterologous
nucleotide sequence to the viral genome. Complete replacement would
probably best be accomplished through the use of PCR-directed
mutagenesis. Briefly, PCR-primer A would contain, from the 5' to 3'
end: a unique restriction enzyme site, such as a class IIS
restriction enzyme site (i.e., a "shifter" enzyme; that recognizes
a specific sequence but cleaves the DNA either upstream or
downstream of that sequence); a stretch of nucleotides
complementary to a region of the PIV gene; and a stretch of
nucleotides complementary to the carboxy-terminus coding portion of
the heterologous sequence PCR-primer B would contain from the 5' to
3' end: a unique restriction enzyme site; a stretch of nucleotides
complementary to a PIV gene; and a stretch of nucleotides
corresponding to the 5' coding portion of the foreign gene. After a
PCR reaction using these primers with a cloned copy of the foreign
gene, the product may be excised and cloned using the unique
restriction sites. Digestion with the class IIS enzyme and
transcription with the purified phage polymerase would generate an
RNA molecule containing the exact untranslated ends of the PIV gene
with a foreign gene insertion. In an alternate embodiment,
PCR-primed reactions could be used to prepare double-stranded DNA
containing the bacteriophage promoter sequence, and the hybrid gene
sequence so that RNA templates can be transcribed directly without
cloning.
[0184] A heterologous nucleotide sequence can be added or inserted
at various positions of the virus of the invention. In one
embodiment, the heterologous nucleotide sequence is added or
inserted at position 1. In another embodiment, the heterologous
nucleotide sequence is added or inserted at position 2. In another
embodiment, the heterologous nucleotide sequence is added or
inserted at position 3. In another embodiment, the heterologous
nucleotide sequence is added or inserted at position 4. In another
embodiment, the heterologous nucleotide sequence is added or
inserted at position 5. In yet another embodiment, the heterologous
nucleotide sequence is added or inserted at position 6. As used
herein, the term "position" refers to the position of the
heterologous nucleotide sequence on the viral genome to be
transcribed, e.g., position 1 means that it is the first gene to be
transcribed, and position 2 means that it is the second gene to be
transcribed. Inserting heterologous nucleotide sequences at the
lower-numbered positions of the virus generally results in stronger
expression of the heterologous nucleotide sequence compared to
insertion at higher-numbered positions due to a transcriptional
gradient that occurs across the genome of the virus. However, the
transcriptional gradient also yields specific ratios of viral
mRNAs. Insertion of foreign genes will perturb these ratios and
result in the synthesis of different amounts of viral proteins that
may influence virus replication. Thus, both the transcriptional
gradient and the replication kinetics must be considered when
choosing an insertion site. For example, insertion of heterologous
nucleotide sequence at position 2 of the b/h PIV3 vector results in
the best replication rate and expression level of the heterologous
gene. Inserting heterologous nucleotide sequences at lower-numbered
positions is the preferred embodiment of the invention if strong
expression of the heterologous nucleotide sequence is desired. In a
preferred embodiment, the heterologous sequence is added or
inserted at position 1, 2 or 3.
[0185] When inserting a heterologous nucleotide sequence into the
virus of the invention, the intergenic region between the end of
the coding sequence of the heterologous gene and the start of the
coding sequence of the downstream gene can be altered to achieve a
desired effect. As used herein, the term "intergenic region" refers
to nucleotide sequence between the stop signal of one gene and the
start codon (e.g. AUG) of the coding sequence of the next
downstream open reading frame. An intergenic region may comprise a
non-coding region of a gene, i.e., between the transcription start
site and the start of the coding sequence (AUG) of the gene. This
non-coding region occurs naturally in bPIV3 mRNAs and other viral
genes, which is illustrated as non-limiting examples in Table
2:
TABLE-US-00002 TABLE 2 Lengths of Non-coding Regions for bPIV3
mRNAs . . . CTT [Gene Start] . . . AUG . . . N 45 nucleotides P 68
nucleotides M 21 nucleotides F 201 nucleotides HN 62 nucleotides L
12 nucleotides b/h RSV F1 10 nucleotides b/h RSV F2 86 nucleotides
b/h RSV F1 NP--P 83 nucleotides
[0186] In various embodiments, the intergenic region between the
heterologous nucleotide sequence and the downstream gene can be
engineered, independently from each other, to be at least 10 nt in
length, at least 20 nt in length, at least 30 nt in length, at
least 50 nt in length, at least 75 nt in length, at least 100 nt in
length, at least 125 nt in length, at least 150 nt in length, at
least 175 nt in length or at least 200 nt in length. In certain
embodiments, the intergenic region between the heterologous
nucleotide sequence and the downstream gene can be engineered,
independently from each other, to be at most 10 nt in length, at
most 20 nt in length, at most 30 nt in length, at most 50 nt in
length, at most 75 nt in length, at most 100 nt in length, at most
125 nt in length, at most 150 nt in length, at most 175 nt in
length or at most 200 nt in length. In various embodiments, the
non-coding region of a desired gene in a virus genome can also be
engineered, independently from each other, to be at least 10 nt in
length, at least 20 nt in length, at least 30 nt in length, at
least 50 nt in length, at least 75 nt in length, at least 100 nt in
length, at least 125 nt in length, at least 150 nt in length, at
least 175 nt in length or at least 200 nt in length. In certain
embodiments, the non-coding region of a desired gene in a virus
genome can also be engineered, independently from each other, to be
at most 10 nt in length, at most 20 nt in length, at most 30 nt in
length, at most 50 nt in length, at most 75 nt in length, at most
100 nt in length, at most 125 nt in length, at most 150 nt in
length, at most 175 nt in length or at most 200 nt in length.
[0187] When inserting a heterologous nucleotide sequence, the
positional effect and the intergenic region manipulation can be
used in combination to achieve a desirable effect. For example, the
heterologous nucleotide sequence can be added or inserted at a
position selected from the group consisting of position 1, 2, 3, 4,
5, and 6, and the intergenic region between the heterologous
nucleotide sequence and the next downstream gene can be altered
(see Table 3). In an exemplary embodiment, hRSV F gene is inserted
at position 1 of a b/h PIV3 vector, and the intergenic region
between F gene and N gene (i.e., the next downstream gene of F) is
altered to 177 nucleotides. Many more combinations are encompassed
by the present invention and some are shown by way of example in
Table 3.
TABLE-US-00003 TABLE 3 Examples of mode of insertion of
heterologous nucleotide sequences Position Position Position
Position Position Position 1 2 3 4 5 6 IGR.sup.a 10-20 10-20 10-20
10-20 10-20 10-20 IGR 21-40 21-40 21-40 21-40 21-40 21-40 IGR 41-60
41-60 41-60 41-60 41-60 41-60 IGR 61-80 61-80 61-80 61-80 61-80
61-80 IGR 81-100 81-100 81-100 81-100 81-100 81-100 IGR 101-120
101-120 101-120 101-120 101-120 101-120 IGR 121-140 121-140 121-140
121-140 121-140 121-140 IGR 141-160 141-160 141-160 141-160 141-160
141-160 IGR 161-180 161-180 161-180 161-180 161-180 161-180 IGR
181-200 181-200 181-200 181-200 181-200 181-200 IGR 201-220 201-220
201-220 201-220 201-220 201-220 IGR 221-240 221-240 221-240 221-240
221-240 221-240 IGR 241-260 241-260 241-260 241-260 241-260 241-260
IGR 261-280 261-280 261-280 261-280 261-280 261-280 IGR 281-300
281-300 281-300 781-300 781-300 281-300 .sup.aIntergenic Region,
measured in nucleotide.
[0188] Depending on the purpose (e.g., to have strong
immunogenicity) of the inserted heterologous nucleotide sequence,
the position of the insertion and the length of the intergenic
region of the inserted heterologous nucleotide sequence can be
determined by various indexes including, but not limited to,
replication kinetics and protein or mRNA expression levels,
measured by following non-limiting examples of assays: plaque
assay, fluorescent-focus assay, infectious center assay,
transformation assay, endpoint dilution assay, efficiency of
plating, electron microscopy, hemagglutination, measurement of
viral enzyme activity, viral neutralization, hemagglutination
inhibition, complement fixation, immunostaining,
immunoprecipitation and immunoblotting, enzyme-linked immunosorbent
assay, nucleic acid detection (e.g., Southern blot analysis,
Northern blot analysis, Western blot analysis), growth curve,
employment of a reporter gene (e.g., using a reporter gene, such as
Green Fluorescence Protein (GFP) or enhanced Green Fluorescence
Protein (eGFP), integrated to the viral genome the same fashion as
the interested heterologous gene to observe the protein
expression), or a combination thereof. Procedures of performing
these assays are well known in the art (see, e.g., Flint et al.,
PRINCIPLES OF VIROLOGY, MOLECULAR BIOLOGY, PATHOGENESIS, AND
CONTROL, 2000, ASM Press pp 25-56, the entire text is incorporated
herein by reference), and non-limiting examples are given in the
Example sections, infra.
[0189] For example, expression levels can be determined by
infecting cells in culture with a virus of the invention and
subsequently measuring the level of protein expression by, e.g.,
Western blot analysis or ELISA using antibodies specific to the
gene product of the heterologous sequence, or measuring the level
of RNA expression by, e.g., Northern blot analysis using probes
specific to the heterologous sequence. Similarly, expression levels
of the heterologous sequence can be determined by infecting an
animal model and measuring the level of protein expressed from the
heterologous sequence of the recombinant virus of the invention in
the animal model. The protein level can be measured by obtaining a
tissue sample from the infected animal and then subjecting the
tissue sample to Western blot analysis or ELISA, using antibodies
specific to the gene product of the heterologous sequence. Further,
if an animal model is used, the titer of antibodies produced by the
animal against the gene product of the heterologous sequence can be
determined by any technique known to the skilled artisan, including
but not limited to, ELISA.
[0190] As the heterologous sequences can be homologous to a
nucleotide sequence in the genome of the virus, care should be
taken that the probes and the antibodies are indeed specific to the
heterologous sequence or its gene product.
[0191] In certain specific embodiments, expression levels of
F-protein of RSV or hMPV from chimeric b/h PIV3 RSV or b/h PIV3
hMPV or b/h PIV3 RSV F and hMPV F can be determined by any
technique known to the skilled artisan. Expression levels of the
F-protein can be determined by infecting cells in a culture with
the chimeric virus of the invention and measuring the level of
protein expression by, e.g., Western blot analysis or ELISA using
antibodies specific to the F-protein and/or the G-protein of hMPV,
or measuring the level of RNA expression by, e.g., Northern blot
analysis using probes specific to the F-gene and/or the G-gene of
human metapneumovirus. Similarly, expression levels of the
heterologous sequence can be determined using an animal model by
infecting an animal and measuring the level of F-protein and/or
G-protein in the animal model. The protein level can be measured by
obtaining a tissue sample from the infected animal and then
subjecting the tissue sample to Western blot analysis or ELISA
using antibodies specific to F-protein and/or G-protein of the
heterologous sequence. Further, if an animal model is used, the
titer of antibodies produced by the animal against F-protein and/or
G-protein can be determined by any technique known to the skilled
artisan, including but not limited to, ELISA.
[0192] The rate of replication of a recombinant virus of the
invention can be determined by any technique known to the skilled
artisan.
[0193] In certain embodiments, to facilitate the identification of
the optimal position of the heterologous sequence in the viral
genome and the optimal length of the intergenic region, the
heterologous sequence encodes a reporter gene. Once the optimal
parameters are determined, the reporter gene is replaced by a
heterologous nucleotide sequence encoding an antigen of choice. Any
reporter gene known to the skilled artisan can be used with the
methods of the invention. For more detail, see section 5.5.
[0194] The rate of replication of the recombinant virus can be
determined by any standard technique known to the skilled artisan.
The rate of replication is represented by the growth rate of the
virus and can be determined by plotting the viral titer over the
time post infection. The viral titer can be measured by any
technique known to the skilled artisan. In certain embodiments, a
suspension containing the virus is incubated with cells that are
susceptible to infection by the virus. Cell types that can be used
with the methods of the invention include, but are not limited to,
Vero cells, LLC-MK-2 cells, Hep-2 cells, LF 1043 (HEL) cells, MRC-5
cells, WI-38 cells, 293 T cells, QT 6 cells, QT 35 cells, chicken
embryo fibroblast (CEF), or tMK cells. Subsequent to the incubation
of the virus with the cells, the number of infected cells is
determined. In certain specific embodiments, the virus comprises a
reporter gene. Thus, the number of cells expressing the reporter
gene is representative of the number of infected cells. In a
specific embodiment, the virus comprises a heterologous nucleotide
sequence encoding for eGFP, and the number of cells expressing
eGFP, i.e., the number of cells infected with the virus, is
determined using FACS.
[0195] In certain embodiments, the replication rate of the
recombinant virus of the invention is at most 20% of the
replication rate of the wild type virus from which the recombinant
virus is derived under the same conditions. The same conditions
refer to the same initial titer of virus, the same strain of cells,
the same incubation temperature, growth medium, number of cells and
other test conditions that may affect the replication rate. For
example, the replication rate of b/h PIV3 with RSV's F gene in
position 1 is at most 20% of the replication rate of bPIV3.
[0196] In certain embodiments, the replication rate of the
recombinant virus of the invention is at most 5%, at most 10%, at
most 20%, at most 30%, at most 40%, at most 50%, at most 75%, at
most 80%, at most 90% of the replication rate of the wild type
virus from which the recombinant virus is derived under the same
conditions. In certain embodiments, the replication rate of the
recombinant virus of the invention is at least 5%, at least 10%, at
least 20%, at least 30%, at least 40%, at least 50%, at least 75%,
at least 80%, at least 90% of the replication rate of the wild type
virus from which the recombinant virus is derived under the same
conditions. In certain embodiments, the replication rate of the
recombinant virus of the invention is between 5% and 20%, between
10% and 40%, between 25% and 50%, between 40% and 75%, between 50%
and 80%, or between 75% and 90% of the replication rate of the wild
type virus from which the recombinant virus is derived under the
same conditions.
[0197] In certain embodiments, the expression level of the
heterologous sequence in the recombinant virus of the invention is
at most 20% of the expression level of the F-protein of the wild
type virus from which the recombinant virus is derived under the
same conditions. The same conditions refer to the same initial
titer of virus, the same strain of cells, the same incubation
temperature, growth medium, number of cells and other test
conditions that may affect the replication rate. For example, the
expression level of the heterologous sequence of the F-protein of
MPV in position 1 of bPIV3 is at most 20% of the expression level
of the bovine F-protein of bPIV3.
[0198] In certain embodiments, the expression level of the
heterologous sequence in the recombinant virus of the invention is
at most 5%, at most 10%, at most 20%, at most 30%, at most 40%, at
most 50%, at most 75%, at most 80%, at most 90% of the expression
level of the F-protein of the wild type virus from which the
recombinant virus is derived under the same conditions. In certain
embodiments, the expression level of the heterologous sequence in
the recombinant virus of the invention is at least 5%, at least
10%, at least 20%, at least 30%, at least 40%, at least 50%, at
least 75%, at least 80%, at least 90% of the expression level of
the F-protein of the wild type virus from which the recombinant
virus is derived under the same conditions. In certain embodiments,
the expression level of the heterologous sequence in the
recombinant virus of the invention is between 5% and 20%, between
10% and 40%, between 25% and 50%, between 40% and 75%, between 50%
and 80%, or between 75% and 90% of the expression level of the
F-protein of the wild type virus from which the recombinant virus
is derived under the same conditions.
[0199] 5.1.4. Insertion of the Heterologous Gene Sequence into the
HN Gene
[0200] The protein responsible for the hemagglutinin and
neuraminidase activities of PIV are coded for by a single gene, HN.
The HN protein is a major surface glycoprotein of the virus. For a
variety of viruses, such as parainfluenza, the hemagglutinin and
neuraminidase proteins have been shown to contain a number of
antigenic sites. Consequently, this protein is a potential target
for the humoral immune response after infection. Therefore,
substitution of antigenic sites of HN with a portion of a foreign
protein may provide for a vigorous humoral response against this
foreign peptide. If a sequence is inserted within the HN molecule,
and it is expressed on the outside surface of the HN, it will be
immunogenic. For example, a peptide derived from gp160 of HIV could
replace an antigenic site of the HN protein, resulting in a humoral
immune response to both gp160 and the HN protein. In a different
approach, the foreign peptide sequence may be inserted within the
antigenic site without deleting any viral sequences. Expression
products of such constructs may be useful in vaccines against the
foreign antigen, and may indeed circumvent a problem discussed
earlier, that of propagation of the recombinant virus in the
vaccinated host. An intact HN molecule with a substitution only in
antigenic sites may allow for HN function and thus allow for the
construction of a viable virus. Therefore, this virus can be grown
without the need for additional helper functions. The virus may
also be attenuated in other ways to avoid any danger of accidental
escape.
[0201] Other hybrid constructions may be made to express proteins
on the cell surface or enable them to be released from the cell. As
a surface glycoprotein, HN has an amino-terminal cleavable signal
sequence necessary for transport to the cell surface, and a
carboxy-terminal sequence necessary for membrane anchoring. In
order to express an intact foreign protein on the cell surface, it
may be necessary to use these HN signals to create a hybrid
protein. In this case, the fusion protein may be expressed as a
separate fusion protein from an additional internal promoter.
Alternatively, if only the transport signals are present and the
membrane anchoring domain is absent, the protein may be secreted
out of the cell.
[0202] 5.1.5. Construction of Bicistronic RNA.
[0203] Bicistronic mRNA could be constructed to permit internal
initiation of translation of viral sequences and allow for the
expression of foreign protein coding sequences from the regular
terminal initiation site. Alternatively, a bicistronic mRNA
sequence may be constructed wherein the viral sequence is
translated from the regular terminal open reading frame, while the
foreign sequence is initiated from an internal site. Certain
internal ribosome entry site (IRES) sequences may be utilized. The
IRS sequences that are chosen should be short enough to avoid
interference with parainfluenza packaging limitations. Thus, it is
preferable that the IRES chosen for such a bicistronic approach be
no more than 500 nucleotides in length, with less than 250
nucleotides being of ideal length. In a specific embodiment, the
IRES is derived from a picornavirus and does not include any
additional picornaviral sequences. Preferred IRES elements include,
but are not limited to; the mammalian BiP IRES and the hepatitis C
virus IRES.
[0204] Alternatively, a foreign protein may be expressed from a new
internal transcriptional unit in which the transcriptional unit has
an initiation site and polyadenylation site. In another embodiment,
the foreign gene is inserted into a PIV gene such that the
resulting expressed protein is a fusion protein.
[0205] 5.2. Expression of Heterologous Gene Products Using
Recombinant cDNA and RNA Templates
[0206] The recombinant templates prepared as described above can be
used in a variety of ways to express the heterologous gene products
in appropriate host cells or to create chimeric viruses that
express the heterologous gene products. In one embodiment, the
recombinant cDNA can be used to transfect appropriate host cells
and the resulting RNA may direct the expression of the heterologous
gene product at high levels. Host cell systems which provide for
high levels of expression include continuous cell lines that supply
viral functions such as cell lines superinfected with PIV, cell
lines engineered to complement PIV functions, etc.
[0207] In an alternate embodiment of the invention, the recombinant
templates may be used to transfect cell lines that express a viral
polymerase protein in order to achieve expression of the
heterologous gene product. To this end, transformed cell lines that
express a polymerase protein such as the L protein may be utilized
as appropriate host cells. Host cells may be similarly engineered
to provide other viral functions or additional functions such as
HN, NP or N.
[0208] In another embodiment, a helper virus may provide the RNA
polymerase protein utilized by the cells in order to achieve
expression of the heterologous gene product. In yet another
embodiment, cells may be transfected with vectors encoding viral
proteins such as the N or NP, P, M2-1 and L proteins.
[0209] Different technique may be used to detect the expression of
heterologous gene products (see, e.g., Flint et al., PRINCIPLES OF
VIROLOGY, MOLECULAR BIOLOGY, PATHOGENESIS, AND CONTROL, 2000, ASM
Press pp 25-56, the entire text is incorporated herein by
reference). In an exemplary assay, cells infected with the virus
are permeabilized with methanol or acetone and incubated with an
antibody raised against the heterologous gene products. A second
antibody that recognizes the first antibody is then added. This
second antibody is usually conjugated to an indicator so that the
expression of heterologous gene products may be visualized or
detected.
[0210] 5.3. Rescue of Recombinant Virus Particles
[0211] In order to prepare chimeric virus, modified cDNAs, virus
RNAs, or RNA coding for the PIV genome and/or foreign proteins in
the plus or minus sense may be used to transfect cells that provide
viral proteins and functions required for replication and rescue.
Alternatively, cells may be transfected with helper virus before,
during, or after transfection by the DNA or RNA molecule coding for
the PIV genome and/or foreign proteins. The synthetic recombinant
plasmid PIV DNAs and RNAs can be replicated and rescued into
infectious virus particles by any number of techniques known in the
art, as described in U.S. Pat. No. 5,166,057 issued Nov. 24, 1992;
in U.S. Pat. No. 5,854,037 issued Dec. 29, 1998; in European Patent
Publication EP 0702085A1, published Feb. 20, 1996; in U.S. patent
application Ser. No. 09/152,845; in International Patent
Publications PCT WO97/12032 published Apr. 3, 1997; WO96/34625
published Nov. 7, 1996; in European Patent Publication EP-A780475;
WO 99/02657 published Jan. 21, 1999; WO 98/53078 published Nov. 26,
1998; WO 98/02530 published Jan. 22, 1998; WO 99/15672 published
Apr. 1, 1999; WO 98/13501 published Apr. 2, 1998; WO 97/06270
published Feb. 20, 1997; and EPO 780 47SA1 published Jun. 25, 1997,
each of which is incorporated by reference herein in its
entirety.
[0212] In one embodiment of the present invention, synthetic
recombinant viral RNAs that contain the non-coding regions of the
negative strand virus RNA essential for the recognition by viral
polymerases and for packaging signals necessary to generate a
mature virion, may be prepared. There are a number of different
approaches that may be used to apply the reverse genetics approach
to rescue negative strand RNA viruses. First, the recombinant RNAs
are synthesized from a recombinant DNA template and reconstituted
in vitro with purified viral polymerase complex to form recombinant
ribonucleoproteins (RNPs) that can be used to transfect cells. In
another approach, a more efficient transfection is achieved if the
viral polymerase proteins are present during transcription of the
synthetic RNAs either in vitro or in vivo. With this approach the
synthetic RNAs may be transcribed from cDNA plasmids that are
either co-transcribed in vitro with cDNA plasmids encoding the
polymerase proteins, or transcribed in vivo in the presence of
polymerase proteins, i.e., in cells which transiently or
constitutively express the polymerase proteins.
[0213] In additional approaches described herein, the production of
infectious chimeric virus may be replicated in host cell systems
that express a PIV viral polymerase protein (e.g., in virus/host
cell expression systems; transformed cell lines engineered to
express a polymerase protein, etc.), so that infectious chimeric
viruses are rescued. In this instance, helper virus need not be
utilized since this function is provided by the viral polymerase
proteins expressed.
[0214] In accordance with the present invention, any technique
known to those of skill in the art may be used to achieve
replication and rescue of recombinant and chimeric viruses. One
approach involves supplying viral proteins and functions required
for replication in vitro prior to transfecting host cells. In such
an embodiment, viral proteins may be supplied in the form of wild
type virus, helper virus, purified viral proteins or recombinantly
expressed viral proteins. The viral proteins may be supplied prior
to, during or post transcription of the synthetic cDNAs or RNAs
encoding the chimeric virus. The entire mixture may be used to
transfect host cells. In another approach, viral proteins and
functions required for replication may be supplied prior to or
during transcription of the synthetic cDNAs or RNAs encoding the
chimeric virus. In such an embodiment, viral proteins and functions
required for replication are supplied in the form of wild type
virus, helper virus, viral extracts, synthetic cDNAs or RNAs that
express the viral proteins are introduced into the host cell via
infection or transfection. This infection/transfection takes place
prior to or simultaneous to the introduction of the synthetic cDNAs
or RNAs encoding the chimeric virus.
[0215] In a particularly desirable approach, cells engineered to
express all viral genes of the recombinant or chimeric virus of the
invention may result in the production of infectious chimeric virus
that contain the desired genotype; thus eliminating the need for a
selection system. Theoretically, one can replace any one of the six
genes or part of any one of the six genes encoding structural
proteins of PIV with a foreign sequence. However, a necessary part
of this equation is the ability to propagate the defective virus
(defective because a normal viral gene product is missing or
altered). A number of possible approaches are available to
circumvent this problem. In one approach, a virus having a mutant
protein can be grown in cell lines that are constructed to
constitutively express the wild type version of the same protein.
By this way, the cell line complements the mutation in the virus.
Similar techniques may be used to construct transformed cell lines
that constitutively express any of the PIV genes. These cell lines
which are made to express the viral protein may be used to
complement the defect in the recombinant virus and thereby
propagate it. Alternatively, certain natural host range systems may
be available to propagate recombinant virus.
[0216] In yet another embodiment, viral proteins and functions
required for replication may be supplied as genetic material in the
form of synthetic cDNAs or RNAs so that they are co-transcribed
with the synthetic cDNAs or RNAs encoding the chimeric virus. In a
particularly desirable approach, plasmids that express the chimeric
virus and the viral polymerase and/or other viral functions are
co-transfected into host cells. For example, plasmids encoding the
genomic or antigenomic PIV RNA, either wild type or modified, may
be co-transfected into host cells with plasmids encoding the PIV
viral polymerase proteins NP or N, P, M2-1 or L. Alternatively,
rescue of chimeric b/h PIV3 virus may be accomplished by the use of
Modified Vaccinia Virus Ankara (MVA) encoding T7 RNA polymerase, or
a combination of MVA and plasmids encoding the polymerase proteins
(N, P, and L). For example, MVA-T7 or Fowl Pox-T7 can be infected
into Vero cells, LLC-MK-2 cells, Hep-2 cells, LF 1043 (HEL) cells,
tMK cells, LLC-MK2, HUT 292, FRH12 (rhesus), FCL-1 (green monkey),
WI-38 (human), MRC-5 (human) cells, 293 T cells, QT 6 cells, QT 35
cells and CEF cells. After infection with MVA-T7 or Fow Pox-T7, a
full length antigenomic b/h PIV3 cDNA may be transfected into the
HeLa or Vero cells together with the NP, P, M2-1 and L encoding
expression plasmids. Alternatively, the polymerase may be provided
by plasmid transfection. The cells and cell supernatant can
subsequently be harvested and subjected to a single freeze-thaw
cycle. The resulting cell lysate may then be used to infect a fresh
HeLa or Vero cell monolayer in the presence of
1-beta-D-arabinofuranosylcytosine (ara C), a replication inhibitor
of vaccinia virus, to generate a virus stock. The supernatant and
cells from these plates can then be harvested, freeze-thawed once,
and the presence of bPIV3 virus particles detected by
immunostaining of virus plaques using PIV3-specific antiserum.
[0217] Another approach to propagating the recombinant virus
involves co-cultivation with wild-type virus. This could be done by
simply taking recombinant virus and co-infecting cells with this
and another wild-type virus (preferably a vaccine strain). The
wild-type virus should complement for the defective virus gene
product and allow growth of both the wild-type and recombinant
virus. Alternatively, a helper virus may be used to support
propagation of the recombinant virus.
[0218] In another approach, synthetic templates may be replicated
in cells co-infected with recombinant viruses that express the PIV
virus polymerase protein. In fact, this method may be used to
rescue recombinant infectious virus in accordance with the
invention. To this end, the PIV polymerase protein may be expressed
in any expression vector/host cell system, including but not
limited to viral expression vectors (e.g., vaccinia virus,
adenovirus, baculovirus, etc.) or cell lines that express a
polymerase protein (e.g., see Krystal et al., 1986, Proc Natl.
Acad. Sci. USA 83: 2709-2713). Moreover, infection of host cells
expressing all six PIV proteins may result in the production of
infectious chimeric virus particles. It should be noted that it may
be possible to construct a recombinant virus without altering virus
viability. These altered viruses would then be growth competent and
would not need helper functions to replicate.
[0219] 5.4. Attenuation of Recombinant Viruses
[0220] The recombinant viruses of the invention can be further
genetically engineered to exhibit an attenuated phenotype. In
particular, the recombinant viruses of the invention exhibit an
attenuated phenotype in a subject to which the virus is
administered as a vaccine. Attenuation can be achieved by any
method known to a skilled artisan. Without being bound by theory,
the attenuated phenotype of the recombinant virus can be caused,
e.g., by using a virus that naturally does not replicate well in an
intended host (e.g., using a bovine PIV3 vector in human), by
reduced replication of the viral genome, by reduced ability of the
virus to infect a host cell, or by reduced ability of the viral
proteins to assemble to an infectious viral particle relative to
the wild type strain of the virus. The viability of certain
sequences of the virus, such as the leader and the trailer sequence
can be tested using a minigenome assay (see section 5.5.1).
[0221] The attenuated phenotypes of a recombinant virus of the
invention can be tested by any method known to the artisan (see,
e.g., section 5.5). A candidate virus can, for example, be tested
for its ability to infect a host or for the rate of replication in
a cell culture system. In certain embodiments, a mini-genome system
is used to test the attenuated virus when the gene that is altered
is N, P, L, M2 or a combination thereof. In certain embodiments,
growth curves at different temperatures are used to test the
attenuated phenotype of the virus. For example, an attenuated virus
is able to grow at 35.degree. C., but not at 39.degree. C. or
40.degree. C. In certain embodiments, different cell lines can be
used to evaluate the attenuated phenotype of the virus. For
example, an attenuated virus may only be able to grow in monkey
cell lines but not the human cell lines, or the achievable virus
titers in different cell lines are different for the attenuated
virus. In certain embodiments, viral replication in the respiratory
tract of a small animal model, including but not limited to,
hamsters, cotton rats, mice and guinea pigs, is used to evaluate
the attenuated phenotypes of the virus. In other embodiments, the
immune response induced by the virus, including but not limited to,
the antibody titers (e.g., assayed by plaque reduction
neutralization assay or ELISA) is used to evaluate the attenuated
phenotypes of the virus. In a specific embodiment, the plaque
reduction neutralization assay or ELISA is carried out at a low
dose. In certain embodiments, the ability of the recombinant virus
to elicit pathological symptoms in an animal model can be tested. A
reduced ability of the virus to elicit pathological symptoms in an
animal model system is indicative of its attenuated phenotype. In a
specific embodiment, the candidate viruses are tested in a monkey
model for nasal infection, indicated by mucous production.
[0222] The viruses of the invention can be attenuated such that one
or more of the functional characteristics of the virus are
impaired. In certain embodiments, attenuation is measured in
comparison to the wild type strain of the virus from which the
attenuated virus is derived. In other embodiments, attenuation is
determined by comparing the growth of an attenuated virus in
different host systems. Thus, for a non-limiting example, a bovine
PIV3 is said to be attenuated when grown in a human host if the
growth of the bovine PIV3 in the human host is reduced compared to
the growth of the bovine PIV3 in a bovine host.
[0223] In certain embodiments, the attenuated virus of the
invention is capable of infecting a host, is capable of replicating
in a host such that infectious viral particles are produced. In
comparison to the wild type strain, however, the attenuated strain
grows to lower titers or grows more slowly. Any technique known to
the skilled artisan can be used to determine the growth curve of
the attenuated virus and compare it to the growth curve of the wild
type virus. For exemplary methods see Example section, infra. In a
specific embodiment, the attenuated virus grows to a titer of less
than 10.sup.5 pfu/ml, of less than 10.sup.4 pfu/ml, of less than
10.sup.3 pfu/ml, or of less than 10.sup.2 pfu/ml in Vero cells
under conditions as described.
[0224] In certain embodiments, the attenuated virus of the
invention (e.g., a chimeric PIV3) cannot replicate in human cells
as well as the wild type virus (e.g., wild type PIV3) does.
However, the attenuated virus can replicate well in a cell line
that lack interferon functions, such as Vero cells.
[0225] In other embodiments, the attenuated virus of the invention
is capable of infecting a host, of replicating in the host, and of
causing proteins of the virus of the invention to be inserted into
the cytoplasmic membrane, but the attenuated virus does not cause
the host to produce new infectious viral particles. In certain
embodiments, the attenuated virus infects the host, replicates in
the host, and causes viral proteins to be inserted in the
cytoplasmic membrane of the host with the same efficiency as the
wild type mammalian virus. In other embodiments, the ability of the
attenuated virus to cause viral proteins to be inserted into the
cytoplasmic membrane into the host cell is reduced compared to the
wild type virus. In certain embodiments, the ability of the
attenuated mammalian virus to replicate in the host is reduced
compared to the wild type virus. Any technique known to the skilled
artisan can be used to determine whether a virus is capable of
infecting a mammalian cell, of replicating within the host, and of
causing viral proteins to be inserted into the cytoplasmic membrane
of the host. For illustrative methods see section 5.5.
[0226] In certain embodiments, the attenuated virus of the
invention is capable of infecting a host. In contrast to a wild
type PIV, however, the attenuated PIV cannot be replicated in the
host. In a specific embodiment, the attenuated virus can infect a
host and can cause the host to insert viral proteins in its
cytoplasmic membranes, but the attenuated virus is incapable of
being replicated in the host. Any method known to the skilled
artisan can be used to test whether the attenuated virus has
infected the host and has caused the host to insert viral proteins
in its cytoplasmic membranes.
[0227] In certain embodiments, the ability of the attenuated
mammalian virus to infect a host is reduced compared to the ability
of the wild type virus to infect the same host. Any technique known
to the skilled artisan can be used to determine whether a virus is
capable of infecting a host. For illustrative methods see section
5.5.
[0228] In certain embodiments, mutations (e.g., missense mutations)
are introduced into the genome of the virus to generated a virus
with an attenuated phenotype. Mutations (e.g., missense mutations)
can be introduced into the N-gene, the P-gene, the F-gene, the
M2-gene, the M2-1-gene, the M2-2-gene, the SH-gene, the G-gene or
the L-gene of the recombinant virus. Mutations can be additions,
substitutions, deletions, or combinations thereof. In specific
embodiments, a single amino acid deletion mutation for the N, P, L
or M2 proteins are introduced, which can be screened for
functionality in the mini-genome assay system and be evaluated for
predicted functionality in the virus. In more specific embodiments,
the missense mutation is a cold-sensitive mutation. In other
embodiments, the missense mutation is a heat-sensitive mutation. In
one embodiment, major phosphorylation sites of P protein of the
virus is removed. In another embodiment, a mutation or mutations
are introduced into the L gene of the virus to generate a
temperature sensitive strain. In yet another embodiment, the
cleavage site of the F gene is mutated in such a way that cleavage
does not occur or occurs at very low efficiency.
[0229] In other embodiments, deletions are introduced into the
genome of the recombinant virus. In more specific embodiments, a
deletion can be introduced into the N-gene, the P-gene, the F-gene,
the M2-gene, the M2-1-gene, the M2-2-gene, the SH-gene, the G-gene
or the L-gene of the recombinant virus. In specific embodiments,
the deletion is in the M2-gene of the recombinant virus of the
present invention. In other specific embodiments, the deletion is
in the SH-gene of the recombinant virus of the present invention.
In yet another specific embodiment, both the M2-gene and the
SH-gene are deleted.
[0230] In certain embodiments, the intergenic region of the
recombinant virus is altered. In one embodiment, the length of the
intergenic region is altered. See Section 5.1.2. for illustrative
examples. In another embodiment, the intergenic regions are
shuffled from 5' to 3' end of the viral genome.
[0231] In other embodiments, the genome position of a gene or genes
of the recombinant virus is changed. In one embodiment, the F or G
gene is moved to the 3' end of the genome. In another embodiment,
the N gene is moved to the 5' end of the genome.
[0232] In certain embodiments, attenuation of the virus is achieved
by replacing a gene of the wild type virus with a gene of a virus
of a different species. In illustrative embodiments, the N-gene,
the P-gene, the F-gene, the M2-gene, the M2-1-gene, the M2-2-gene,
the SH-gene, the HN-gene or the L-gene of bPIV3 is replaced with
the N-gene, the P-gene, the F-gene, the M2-gene, the M2-1-gene, the
M2-2-gene, the SH-gene, the HN-gene or the L-gene, respectively, of
hPIV3. In other illustrative embodiments, the N-gene, the P-gene,
the F-gene, the M2-gene, the M2-1-gene, the M2-2-gene, the SH-gene,
the HN-gene or the L-gene of hPIV3 is replaced with the N-gene, the
P-gene, the F-gene, the M2-gene, the M2-1-gene, the M2-2-gene, the
SH-gene, the HN-gene or the L-gene, respectively, of bPIV3. In a
preferred embodiment, attenuation of the virus is achieved by
replacing one or more polymerase associated genes (e.g., N, P, L or
M2) with genes of a virus of a different species.
[0233] In certain embodiments, attenuation of the virus is achieved
by replacing or deleting one or more specific domains of a protein
of the wild type virus with domains derived from the corresponding
protein of a virus of a different species. In an illustrative
embodiment, the ectodomain of a F protein of bPIV3 is replaced with
an ectodomain of a F protein of a metapneumovirus. In a preferred
embodiment, one or more specific domains of L, N, or P protein are
replaced with domains derived from corresponding proteins of a
virus of a different species. In another illustrative embodiment,
the transmembrane domain of the F protein is deleted so that a
soluble F protein is expressed.
[0234] In certain embodiments of the invention, the leader and/or
trailer sequence of the recombinant virus of the invention can be
modified to achieve an attenuated phenotype. In certain, more
specific embodiments, the leader and/or trailer sequence is reduced
in length relative to the wild type virus by at least 1 nucleotide,
at least 2 nucleotides, at least 3 nucleotides, at least 4
nucleotides, at least 5 nucleotides or at least 6 nucleotides. In
certain other, more specific embodiments, the sequence of the
leader and/or trailer of the recombinant virus is mutated. In a
specific embodiment, the leader and the trailer sequence are 100%
complementary to each other. In other embodiments, 1 nucleotide, 2
nucleotides, 3 nucleotides, 4 nucleotides, 5 nucleotides, 6
nucleotides, 7 nucleotides, 8 nucleotides, 9 nucleotides, or 10
nucleotides are not complementary to each other where the remaining
nucleotides of the leader and the trailer sequences are
complementary to each other. In certain embodiments, the
non-complementary nucleotides are identical to each other. In
certain other embodiments, the non-complementary nucleotides are
different from each other. In other embodiments, if the
non-complementary nucleotide in the trailer is purine, the
corresponding nucleotide in the leader sequence is also a purine.
In other embodiments, if the non-complementary nucleotide in the
trailer is pyrimidine, the corresponding nucleotide in the leader
sequence is also a purine.
[0235] When a live attenuated vaccine is used, its safety must also
be considered. The vaccine must not cause disease. Any techniques
known in the art that can make a vaccine safe may be used in the
present invention. In addition to attenuation techniques, other
techniques may be used. One non-limiting example is to use a
soluble heterologous gene that cannot be incorporated into the
virion membrane. For example, a single copy of the soluble RSV F
gene, a version of the RSV gene lacking the transmembrane and
cytosolic domains, can be used. Since it cannot be incorporated
into the virion membrane, the virus tropism is not expected to
change.
[0236] Various assays can be used to test the safety of a vaccine.
See section 5.5., infra. Particularly, sucrose gradients and
neutralization assays can be used. A sucrose gradient assay can be
used to determine whether a heterologous protein is inserted in a
virion. If the heterologous protein is inserted in the virion, the
virion should be tested for its ability to cause symptoms even if
the parental strain does not cause symptoms. Without bound by
theory, if the heterologous protein is incorporated in the virion,
the virus may have acquired new, possibly pathological,
properties.
[0237] 5.5. Measurement of Viral Titer, Expression of Antigenic
Sequences, Immunogenicity and Other Characteristics of Chimeric
Viruses
[0238] A number of assays may be employed in accordance with the
present invention in order to determine the rate of growth of a
chimeric or recombinant virus in a cell culture system, an animal
model system or in a subject. A number of assays may also be
employed in accordance with the present invention in order to
determine the requirements of the chimeric and recombinant viruses
to achieve infection, replication and packaging of virions.
[0239] The assays described herein may be used to assay viral titre
over time to determine the growth characteristics of the virus. In
a specific embodiment, the viral titre is determined by obtaining a
sample from the infected cells or the infected subject, preparing a
serial dilution of the sample and infecting a monolayer of cells
that are susceptible to infection with the virus at a dilution of
the virus that allows for the emergence of single plaques. The
plaques can then be counted and the viral titre express as plaque
forming units per milliliter of sample. In a specific embodiment of
the invention, the growth rate of a virus of the invention in a
subject is estimated by the titer of antibodies against the virus
in the subject. Without being bound by theory, the antibody titer
in the subject reflects not only the viral titer in the subject but
also the antigenicity. If the antigenicity of the virus is
constant, the increase of the antibody titer in the subject can be
used to determine the growth curve of the virus in the subject. In
a preferred embodiment, the growth rate of the virus in animals or
humans is best tested by sampling biological fluids of a host at
multiple time points post-infection and measuring viral titer.
[0240] The expression of heterologous gene sequence in a cell
culture system or in a subject can be determined by any technique
known to the skilled artisan. In certain embodiments, the
expression of the heterologous gene is measured by quantifying the
level of the transcript. The level of the transcript can be
measured by Northern blot analysis or by RT-PCR using probes or
primers, respectively, that are specific for the transcript. The
transcript can be distinguished from the genome of the virus
because the virus is in the antisense orientation whereas the
transcript is in the sense orientation. In certain embodiments, the
expression of the heterologous gene is measured by quantifying the
level of the protein product of the heterologous gene. The level of
the protein can be measured by Western blot analysis using
antibodies that are specific to the protein.
[0241] In a specific embodiment, the heterologous gene is tagged
with a peptide tag. The peptide tag can be detected using
antibodies against the peptide tag. The level of peptide tag
detected is representative for the level of protein expressed from
the heterologous gene. Alternatively, the protein expressed from
the heterologous gene can be isolated by virtue of the peptide tag.
The amount of the purified protein correlates with the expression
level of the heterologous gene. Such peptide tags and methods for
the isolation of proteins fused to such a peptide tag are well
known in the art. A variety of peptide tags known in the art may be
used in the modification of the heterologous gene, such as, but not
limited to, the immunoglobulin constant regions, polyhistidine
sequence (Petty, 1996, Metal-chelate affinity chromatography, in
Current Protocols in Molecular Biology, volume 1-3 (1994-1998). Ed.
by Ausubel, F. M., Brent, R., Kunston, R. E., Moore, D. D.,
Seidman, J. G., Smith, J. A. and Struhl, K. Published by John Wiley
and sons, Inc., USA, Greene Publish. Assoc. & Wiley
Interscience), glutathione S-transferase (GST; Smith, 1993, Methods
Mol. Cell Bio. 4:220-229), the E. coli maltose binding protein
(Guan et al., 1987, Gene 67:21-30), various cellulose binding
domains (U.S. Pat. Nos. 5,496,934; 5,202,247; 5,137,819; Tomme et
al., 1994, Protein Eng. 7:117-123), and the FLAG epitope (Short
Protocols in Molecular Biology, 1999, Ed. Ausubel et al., John
Wiley & Sons, Inc., Unit 10.11) etc. Other peptide tags are
recognized by specific binding partners and thus facilitate
isolation by affinity binding to the binding partner, which is
preferably immobilized and/or on a solid support. As will be
appreciated by those skilled in the art, many methods can be used
to obtain the coding region of the above-mentioned peptide tags,
including but not limited to, DNA cloning, DNA amplification, and
synthetic methods. Some of the peptide tags and reagents for their
detection and isolation are available commercially.
[0242] Samples from a subject can be obtained by any method known
to the skilled artisan. In certain embodiments, the sample consists
of nasal aspirate, throat swab, sputum or broncho-alveolar
lavage.
[0243] 5.5.1. Minigenome Constructs
[0244] Minireplicon constructs can be generated to contain an
antisense reporter gene. Any reporter gene known to the skilled
artisan can be used with the invention. In a specific embodiment,
the reporter gene is CAT. In certain embodiments, the reporter gene
can be flanked by the negative-sense bPIV or hPIV leader linked to
the hepatitis delta ribozyme (Hep-d Ribo) and T7 polymerase
termination (T-T7) signals, and the bPIV or hPIV trailer sequence
preceded by the T7 RNA polymerase promoter.
[0245] In certain embodiments, the plasmid encoding the
minireplicon is transfected into a host cell. The host cell
expresses T7 RNA polymerase, the N gene, the P gene, the L gene,
and the M2.1 gene. In certain embodiments, the host cell is
transfected with plasmids encoding T7 RNA polymerase, the N gene,
the P gene, the L gene, and the M2.1 gene. In other embodiments,
the plasmid encoding the minireplicon is transfected into a host
cell and the host cell is infected with a helper virus.
[0246] The expression level of the reporter gene and/or its
activity can be assayed by any method known to the skilled artisan,
such as, but not limited to, the methods described in section
5.5.6.
[0247] In certain, more specific, embodiments, the minireplicon
comprises the following elements, in the order listed: T7 RNA
Polymerase or RNA polymerase I, leader sequence, gene start, GFP,
trailer sequence, Hepatitis delta ribozyme sequence or RNA
polymerase I termination sequence. If T7 is used as RNA polymerase,
Hepatitis delta ribozyme sequence should be used as termination
sequence. If RNA polymerase I is used, RNA polymerase I termination
sequence may be used as a termination signal. Dependent on the
rescue system, the sequence of the minireplicon can be in the sense
or antisense orientation. In certain embodiments, the leader
sequence can be modified relative to the wild type leader sequence
of the virus of the invention. The leader sequence can optionally
be preceded by an AC. The T7 promoter sequence can be with or
without a G-doublet or triplet, where the G-doublet or triplet
provides for increased transcription.
[0248] In a specific embodiment, a cell is infected with a virus of
the invention at TO. 24 hours later, at T24, the cell is
transfected with a minireplicon construct. 48 hours after T0 and 72
hours after T0, the cells are tested for the expression of the
reporter gene. If a fluorescent reporter gene product is used
(e.g., GFP), the expression of the reporter gene can be tested
using FACS.
[0249] In another embodiment, a cell is transfected with six
plasmids at T=0 hours. Cells are then harvested at T=40 hours and
T=60 hours and analyzed for CAT or GFP expression.
[0250] In another specific embodiment, a cell is infected with
MVA-T7 at T0. 1 hour later, at T1, the cell is transfected with a
minireplicon construct. 24 hours after T0, the cell is infected
with a virus of the invention. 72 hours after T0, the cells are
tested for the expression of the reporter gene. If a fluorescent
reporter gene product is used (e.g., GFP), the expression of the
reporter gene can be tested using FACS.
[0251] 5.5.2. Measurement of Incidence of Infection Rate
[0252] The incidence of infection can be determined by any method
well-known in the art, including but not limited to, the testing of
clinical samples (e.g., nasal swabs) for the presence of an
infection, e.g., hMPV, RSV, hPIV, or bPIV/hPIV components can be
detected by immunofluorescence assay (IFA) using an
anti-hMPV-antigen antibody, an anti-RSV-antigen antibody, an
anti-hPIV-antigen antibody, and/or an antibody that is specific to
the gene product of the heterologous nucleotide sequence,
respectively.
[0253] In certain embodiments, samples containing intact cells can
be directly processed, whereas isolates without intact cells should
first be cultured on a permissive cell line (e.g. HEp-2 cells). In
an illustrative embodiment, cultured cell suspensions are cleared
by centrifugation at, e.g., 300.times.g for 5 minutes at room
temperature, followed by a PBS, pH 7.4 (Ca++ and Mg++ free) wash
under the same conditions. Cell pellets are resuspended in a small
volume of PBS for analysis. Primary clinical isolates containing
intact cells are mixed with PBS and centrifuged at 300.times.g for
5 minutes at room temperature. Mucus is removed from the interface
with a sterile pipette tip and cell pellets are washed once more
with PBS under the same conditions. Pellets are then resuspended in
a small volume of PBS for analysis. Five to ten microliters of each
cell suspension are spotted per 5 mm well on acetone washed 12-well
HTC supercured glass slides and allowed to air dry. Slides are
fixed in cold (-20.degree. C.) acetone for 10 minutes. Reactions
are blocked by adding PBS -1% BSA to each well followed by a 10
minute incubation at room temperature. Slides are washed three
times in PBS -0.1% Tween-20 and air dried, Ten microliters of each
primary antibody reagent diluted to 250 ng/ml in blocking buffer is
spotted per well and reactions are incubated in a humidified
37.degree. C. environment for 30 minutes. Slides are then washed
extensively in three changes of PBS -0.1% Tween-20 and air dried.
Ten microliters of appropriate secondary conjugated antibody
reagent diluted to 250 ng/ml in blocking buffer are spotted per
respective well and reactions are incubated in a humidified
37.degree. C. environment for an additional 30 minutes. Slides are
then washed in three changes of PBS -0.1% Tween-20. Five
microliters of PBS-50% glycerol-10 mM Tris pH 8.0-1 mM EDTA are
spotted per reaction well and slides are mounted with cover slips.
Each reaction well is subsequently analyzed by fluorescence
microscopy at 200.times. power using a B-2A filter (EX 450-490 nm).
Positive reactions are scored against an autofluorescent background
obtained from unstained cells or cells stained with secondary
reagent alone. RSV positive reactions are characterized by bright
fluorescence punctuated with small inclusions in the cytoplasm of
infected cells.
[0254] 5.5.3. Measurement of Serum Titer
[0255] Antibody serum titer can be determined by any method
well-known in the art, for example, but not limited to, the amount
of antibody or antibody fragment in serum samples can be
quantitated by a sandwich ELISA. Briefly, the ELISA consists of
coating microtiter plates overnight at 4.degree. C. with an
antibody that recognizes the antibody or antibody fragment in the
serum. The plates are then blocked for approximately 30 minutes at
room temperature with PBS-Tween-0.5% BSA. Standard curves are
constructed using purified antibody or antibody fragment diluted in
PBS-BSA-BSA, and samples are diluted in PBS-BSA. The samples and
standards are added to duplicate wells of the assay plate and are
incubated for approximately 1 hour at room temperature. Next, the
non-bound antibody is washed away with PBS-TWEEN and the bound
antibody is treated with a labeled secondary antibody (e.g.,
horseradish peroxidase conjugated goat-anti-human IgG) for
approximately 1 hour at room temperature. Binding of the labeled
antibody is detected by adding a chromogenic substrate specific for
the label and measuring the rate of substrate turnover, e.g., by a
spectrophotometer. The concentration of antibody or antibody
fragment levels in the serum is determined by comparison of the
rate of substrate turnover for the samples to the rate of substrate
turnover for the standard curve.
[0256] 5.5.4. Challenge Studies
[0257] This assay is used to determine the ability of the
recombinant viruses of the invention and of the vaccines of the
invention to prevent lower respiratory tract viral infection in an
animal model system, including but not limited to, cotton rats,
Syrian Golden hamsters, and Balb/c mice. The recombinant virus
and/or the vaccine can be administered by intravenous (IV) route,
by intramuscular (IM) route or by intranasal route (IN). The
recombinant virus and/or the vaccine can be administered by any
technique well-known to the skilled artisan. This assay is also
used to correlate the serum concentration of antibodies with a
reduction in lung titer of the virus to which the antibodies
bind.
[0258] On day 0, groups of animals, including but not limited to,
cotton rats (Sigmodon hispidis, average weight 100 g) and hamsters
(e.g., Syrian Golden hamsters) are inoculated with the recombinant
virus or the vaccine of interest or BSA by intramuscular injection,
by intravenous injection, or by intranasal route. Prior to,
concurrently with, or subsequent to administration of the
recombinant virus or the vaccine of the invention, the animals are
infected with wild type virus wherein the wild type virus is the
virus against which the vaccine was generated. In certain
embodiments, the animals are infected with the wild type virus at
least 1 day, at least 2 days, at least 3 days, at least 4 days, at
least 5 days, at least 6 days, at least 1 week, at least 2 weeks,
at least 3 weeks or at least 4 weeks subsequent to the
administration of the recombinant virus and/or the vaccine of the
invention. In a preferred embodiment, the animals are infected with
the wild type virus 21 days subsequent to the administration of the
recombinant virus and/or the vaccine of the invention. In another
preferred embodiment, the animals are infected with the wild type
virus 28 days subsequent to the administration of the recombinant
virus and/or the vaccine of the invention.
[0259] After the infection, the animals are sacrificed, and their
nasal turbinate tissue and/or lung tissue are harvested and virus
titers are determined by appropriate assays, e.g., plaque assay and
TCID.sub.50 assay. Bovine serum albumin (BSA) 10 mg/kg can be used
as a negative control. Antibody concentrations in the serum at the
time of challenge can be determined using a sandwich ELISA.
[0260] 5.5.5. Clinical Trials
[0261] Vaccines of the invention or fragments thereof that have
been tested in in vitro assays and animal models may be further
evaluated for safety, tolerance, immunogenicity, infectivity and
pharmacokinetics in groups of normal healthy human volunteers,
including all age groups. In a preferred embodiment, the healthy
human volunteers are infants at about 6 weeks of age or older,
children and adults. The volunteers are administered intranasally,
intramuscularly, intravenously or by a pulmonary delivery system in
a single dose of a recombinant virus of the invention and/or a
vaccine of the invention. Multiple doses of virus and/or vaccine of
the invention may be required in seronegative children 6 to 60
months of age. Multiple doses of virus and/or vaccine of the
invention may also be required in the first six months of life to
stimulate local and systemic immunity and to overcome
neutralization by maternal antibody. In a preferred embodiment, a
primary dosing regimen at 2, 4, and 6 months of age and a booster
dose at the beginning of the second year of life are used. A
recombinant virus of the invention and/or a vaccine of the
invention can be administered alone or concurrently with pediatric
vaccines recommended at the corresponding ages.
[0262] In a preferred embodiment, double-blind randomized,
placebo-controlled clinical trials are used. In a specific
embodiment, a computer generated randomization schedule is used.
For example, each subject in the study will be enrolled as a single
unit and assigned a unique case number. Multiple subjects within a
single family will be treated as individuals for the purpose of
enrollment. Parent/guardian, subjects, and investigators will
remain blinded to which treatment group subjects have been assigned
for the duration of the study. Serologic and virologic studies will
be performed by laboratory personnel blinded to treatment group
assignment. However, it is expected that isolation of the vaccine
virus from nasal wash fluid obtained after vaccination will
identify likely vaccinees to the virology laboratory staff. The
serologic and virologic staff are separate and the serology group
will be prevented from acquiring any knowledge of the culture
results.
[0263] Each volunteer is preferably monitored for at least 12 hours
prior to receiving the recombinant virus of the invention and/or a
vaccine of the invention, and each volunteer will be monitored for
at least fifteen minutes after receiving the dose at a clinical
site. Then volunteers are monitored as outpatients on days 1-14,
21, 28, 35, 42, 49, and 56 postdose. In a preferred embodiment, the
volunteers are monitored for the first month after each vaccination
as outpatients. All vaccine related serious adverse events will be
reported for the entire duration of the trial. A serious adverse
event is defined as an event that 1) results in death, 2) is
immediately life threatening, 3) results in permanent or
substantial disability, 4) results in or prolongs an existing
in-patient hospitalization, 5) results in a congenital anomaly, 6)
is a cancer, or 7) is the result of an overdose of the study
vaccine. Serious adverse events that are not vaccine related will
be reported beginning on the day of the first vaccination (Day 0)
and continue for 30 days following the last vaccination.
Non-vaccine related serious adverse events will not be reported for
5 to 8 months after the 30 day reporting period following the last
vaccination. A dose of vaccine/placebo will not be given if a child
has a vaccine-related serous adverse event following the previous
dose. Any adverse event that is not considered vaccine related, but
which is of concern, will be discussed by the clinical study
monitor and the medical monitor before the decision to give another
dose is made.
[0264] Blood samples are collected via an indwelling catheter or
direct venipuncture (e.g., by using 10 ml red-top Vacutainer tubes)
at the following intervals: (1) prior to administering the dose of
the recombinant virus of the invention and/or a vaccine of the
invention; (2) during the administration of the dose of the
recombinant virus of the invention and/or a vaccine of the
invention; (3) 5 minutes, 10 minutes, 15 minutes, 20 minutes, 30
minutes, 1 hour, 2 hours, 4 hours, 8 hours, 12 hours, 24 hours, and
48 hours after administering the dose of the recombinant virus of
the invention and/or a vaccine of the invention; and (4) 3 days, 7
days 14 days, 21 days, 28 days, 35 days, 42 days, 49 days, and 56
days after administering the dose of the recombinant virus of the
invention and/or a vaccine of the invention. In a specific
embodiment, a total of 5 blood draws (3-5 ml each) are obtained,
each just prior to the first, third and booster doses and
approximately one month following the third dose and booster dose
of administration of the vaccine or placebo. Samples are allowed to
clot at room temperature and the serum is collected after
centrifugation.
[0265] Sera are tested for strain-specific serum hemaglutination
inhibition (HAI) antibody levels against the virus of the
invention. Other indicators of immunogenicity such as IgG, IgA, or
neutralizing antibodies are also tested. Serum antibody responses
to one or more of the other vaccines given concurrently may be
measured. The amount of antibodies generated against the
recombinant virus of the invention and/or a vaccine of the
invention in the samples from the patients can be quantitated by
ELISA.
[0266] The concentration of antibody levels in the serum of
volunteers are corrected by subtracting the predose serum level
(background level) from the serum levels at each collection
interval after administration of the dose of recombinant virus of
the invention and/or a vaccine of the invention. For each volunteer
the pharmacokinetic parameters are computed according to the
model-independent approach (Gibaldi et al., eds., 1982,
Pharmacokinetics, 2.sup.nd edition, Marcel Dekker, New York) from
the corrected serum antibody or antibody fragment
concentrations.
[0267] Nasal washes obtained approximately 2, 3, 4, 5, 6, 7 or 8
days after each doses of vaccine/placebo will be cultured to detect
shedding of the vaccine virus of the invention. In a preferred
embodiment, nasal washes obtained 7 days after each doses of
vaccine/placebo are cultured. A nasopharyngeal swab, a throat swab,
or a nasal wash is also used to determine the presence of other
viruses in volunteers with medically attended febrile illness
(rectal temperature greater than or equal to 102.degree. F.) and/or
croup, bronchiolitis, or pneumonia at any time during the study.
Samples are shipped on dry ice to designated site for study. Assays
for isolation and quantitation of the vaccine virus of the
invention and immunostaining assays using MAb to identify the
vaccine virus of the invention are used (examples of such assays
are given in the Example sections, infra). Nasal wash specimens may
be tested for other viruses and immune responses including IgG,
IgA, and neutralizing antibody.
[0268] 5.5.6. Reporter Genes
[0269] In certain embodiments, assays for measurement of reporter
gene expression in tissue culture or in animal models can be used
with the methods of the invention. The nucleotide sequence of the
reporter gene is cloned into the virus, such as bPIV, hPIV, or
b/hPIV3, wherein (i) the position of the reporter gene is changed
and (ii) the length of the intergenic regions flanking the reporter
gene are varied. Different combinations are tested to determine the
optimal rate of expression of the reporter gene and the optimal
replication rate of the virus comprising the reporter gene.
[0270] In certain embodiments, minigenome constructs are generated
to include a reporter gene. The construction of minigenome
constructs is described in section 5.5.1.
[0271] The abundance of the reporter gene product can be determined
by any technique known to the skilled artisan. Such techniques
include, but are not limited to, Northern blot analysis or Western
blot analysis using probes or antibodies, respectively, that are
specific to the reporter gene.
[0272] In certain embodiments, the reporter gene emits a
fluorescent signal that can be detected in a FACS. FACS can be used
to detect cells in which the reporter gene is expressed.
[0273] Techniques for practicing the specific aspect of this
invention will employ, unless otherwise indicated, conventional
techniques of molecular biology, microbiology, and recombinant DNA
manipulation and production, which are routinely practiced by one
of skill in the art. See, e.g., Sambrook, 1989, Molecular Cloning,
A Laboratory Manual, Second Edition; DNA Cloning, Volumes I and II
(Glover, Ed. 1985); and Transcription and Translation (Hames &
Higgins, Eds. 1984).
[0274] The biochemical activity of the reporter gene product
represents the expression level of the reporter gene. The total
level of reporter gene activity depends also on the replication
rate of the recombinant virus of the invention. Thus, to determine
the true expression level of the reporter gene from the recombinant
virus, the total expression level should be divided by the titer of
the recombinant virus in the cell culture or the animal model.
[0275] Reporter genes that can be used with the methods of
invention include, but are not limited to, the genes listed in the
Table 4 below:
TABLE-US-00004 TABLE 4 Reporter genes and the biochemical
properties of the respective reporter gene products Reporter Gene
Protein Activity & Measurement CAT (chloramphenicol Transfers
radioactive acetyl groups to acetyltransferase) chloramphenicol or
detection by thin layer chromatography and autoradiography GAL
(b-galactosidase) Hydrolyzes colorless galactosides to yield
colored products. GUS (b-glucuronidase) Hydrolyzes colorless
glucuronides to yield colored products. LUC (luciferase) Oxidizes
luciferin, emitting photons GFP (green fluorescent fluorescent
protein without substrate protein) SEAP (secreted alkaline
luminescence reaction with suitable phosphatase) substrates or with
substrates that generate chromophores HRP (horseradish in the
presence of hydrogen oxide, oxidation peroxidase) of
3,3',5,5'-tetramethylbenzidine to form a colored complex AP
(alkaline phosphatase) luminescence reaction with suitable
substrates or with substrates that generate chromophores
[0276] The abundance of the reporter gene can be measured by, inter
alia, Western blot analysis or Northern blot analysis or any other
technique used for the quantification of transcription of a
nucleotide sequence, the abundance of its mRNA its protein (see
Short Protocols in Molecular Biology, Ausubel et al. (editors),
John Wiley & Sons, Inc., 4.sup.th edition, 1999). In certain
embodiments, the activity of the reporter gene product is measured
as a readout of reporter gene expression from the recombinant
virus. For the quantification of the activity of the reporter gene
product, biochemical characteristics of the reporter gene product
can be investigated (see Table 1). The methods for measuring the
biochemical activity of the reporter gene products are well-known
to the skilled artisan. A more detailed description of illustrative
reporter genes that can be used with the methods of the invention
is set forth below.
[0277] Luciferase
[0278] Luciferases are enzymes that emit light in the presence of
oxygen and a substrate (luciferin) and which have been used for
real-time, low-light imaging of gene expression in cell cultures,
individual cells, whole organisms, and transgenic organisms
(reviewed by Greer & Szalay, 2002, Luminescence
17(1):43-74).
[0279] As used herein, the term "luciferase" as used in relation to
the invention is intended to embrace all luciferases, or
recombinant enzymes derived from luciferases that have luciferase
activity. The luciferase genes from fireflies have been well
characterized, for example, from the Photinus and Luciola species
(see, e.g., International Patent Publication No. WO 95/25798 for
Photinus pyralis, European Patent Application No. EP 0 524 448 for
Luciola cruciata and Luciola lateralis, and Devine et al., 1993,
Biochim. Biophys. Acta 1173(2):121-132 for Luciola mingrelica.
Other eucaryotic luciferase genes include, but are not limited to,
the sea panzy (Renilla reiformis, see, e.g., Lorenz et al., 1991,
Proc Natl Acad Sci U.S.A. 88(10):4438-4442), and the glow worm
(Lampyris noctiluca, see e.g., Sula-Newby et al., 1996, Biochem J.
313:761-767). Bacterial luciferin-luciferase systems include, but
are not limited to, the bacterial lux genes of terrestrial
Photorhabdus luminescens (see, e.g., Manukhov et al., 2000,
Genetika 36(3):322-30) and marine bacteria Vibrio fischeri and
Vibrio harveyi (see, e.g., Miyamoto et al., 1988, J Biol Chem.
263(26):13393-9, and Cohn et al., 1983, Proc Natl Acad Sci USA.,
80(1):120-3, respectively). The luciferases encompassed by the
present invention also includes the mutant luciferases described in
U.S. Pat. No. 6,265,177 to Squirrell et al., which is hereby
incorporated by reference in its entirety.
[0280] Green Fluorescent Protein
[0281] Green fluorescent protein ("GFP") is a 238 amino acid
protein with amino acids 65 to 67 involved in the formation of the
chromophore that does not require additional substrates or
cofactors to fluoresce (see, e.g., Prasher et al., 1992, Gene
111:229-233; Yang et al., 1996, Nature Biotechnol. 14:1252-1256;
and Cody et al., 1993, Biochemistry 32:1212-1218).
[0282] As used herein, the term "green fluorescent protein" or
"GFP" as used in relation to the invention is intended to embrace
all GFPs (including the various forms of GFPs that exhibit colors
other than green), or recombinant enzymes derived from GFPs that
have GFP activity. The native gene for GFP was cloned from the
bioluminescent jellyfish Aequorea Victoria (see, e.g., Morin et
al., 1972, J. Cell Physiol. 77:313-318). Wild type GFP has a major
excitation peak at 395 nm and a minor excitation peak at 470 nm.
The absorption peak at 470 nm allows the monitoring of GFP levels
using standard fluorescein isothiocyanate (FITC) filter sets.
Mutants of the GFP gene have been found useful to enhance
expression and to modify excitation and fluorescence. For example,
mutant GFPs with alanine, glycine, isoleucine, or threonine
substituted for serine at position 65 result in mutant GFPs with
shifts in excitation maxima and greater fluorescence than wild type
protein when excited at 488 nm (see, e.g., Heim et al., 1995,
Nature 373:663-664); U.S. Pat. No. 5,625,048; Delagrave et al.,
1995, Biotechnology 13:151-154; Cormack et al., 1996, Gene
173:33-38; and Cramer et al., 1996, Nature Biotechnol. 14:315-319).
The ability to excite GFP at 488 nm permits the use of GFP with
standard fluorescence activated cell sorting ("FACS") equipment. In
another embodiment, GFPs are isolated from organisms other than the
jellyfish, such as, but not limited to, the sea pansy, Renilla
reriformis.
[0283] EGFP is a red-shifted variant of wild-type GFP (3-5) which
has been optimized for brighter fluorescence and higher expression
in mammalian cells. (Excitation maximum=488 nm; emission
maximum=507 nm.) EGFP encodes the GFPmutl variant which contains
the double-amino-acid substitution of Phe-64 to Leu and Ser-65 to
Thr. The coding sequence of the EGFP gene contains more than 190
silent base changes which correspond to human codon-usage
preferences.
[0284] Beta Galactosidase
[0285] Beta galactosidase (".beta.-gal") is an enzyme that
catalyzes the hydrolysis of b-galactosides, including lactose, and
the galactoside analogs o-nitrophenyl-.beta.-D-galactopyranoside
("ONPG") and chlorophenol red-b-D-galactopyranoside ("CPRG") (see,
e.g., Nielsen et al., 1983 Proc Natl Acad Sci USA 80(17):5198-5202;
Eustice et al., 1991, Biotechniques 11:739-742; and Henderson et
al., 1986, Clin. Chem. 32:1637-1641). The .beta.-gal gene functions
well as a reporter gene because the protein product is extremely
stable, resistant to proteolytic degradation in cellular lysates,
and easily assayed. When ONPG is used as the substrate, .beta.-gal
activity can be quantitated with a spectrophotometer or a
microplate reader.
[0286] As used herein, the term "beta galactosidase" or
".beta.-gal" as used in relation to the invention is intended to
embrace all b-gals, including lacZ gene products, or recombinant
enzymes derived from b-gals which have b-gal activity. The b-gal
gene functions well as a reporter gene because the protein product
is extremely stable, resistant to proteolytic degradation in
cellular lysates, and easily assayed. In an embodiment where ONPG
is the substrate, b-gal activity can be quantitated with a
spectrophotometer or microplate reader to determine the amount of
ONPG converted at 420 nm. In an embodiment when CPRG is the
substrate, b-gal activity can be quantitated with a
spectrophotometer or microplate reader to determine the amount of
CPRG converted at 570 to 595 nm.
[0287] Chloramphenicol Acetyltransferase
[0288] Chloramphenicol acetyl transferase ("CAT") is commonly used
as a reporter gene in mammalian cell systems because mammalian
cells do not have detectable levels of CAT activity. The assay for
CAT involves incubating cellular extracts with radiolabeled
chloramphenicol and appropriate co-factors, separating the starting
materials from the product by, for example, thin layer
chromatography ("TLC"), followed by scintillation counting (see,
e.g., U.S. Pat. No. 5,726,041, which is hereby incorporated by
reference in its entirety).
[0289] As used herein, the term "chloramphenicol acetyltransferase"
or "CAT" as used in relation to the invention is intended to
embrace all CATs, or recombinant enzymes derived from CAT which
have CAT activity. While it is preferable that a reporter system
which does not require cell processing, radioisotopes, and
chromatographic separations would be more amenable to high
through-put screening, CAT as a reporter gene may be preferable in
situations when stability of the reporter gene is important. For
example, the CAT reporter protein has an in vivo half life of about
50 hours, which is advantageous when an accumulative versus a
dynamic change type of result is desired.
[0290] Secreted Alkaline Phosphatase
[0291] The secreted alkaline phosphatase ("SEAP") enzyme is a
truncated form of alkaline phosphatase, in which the cleavage of
the transmembrane domain of the protein allows it to be secreted
from the cells into the surrounding media.
[0292] As used herein, the term "secreted alkaline phosphatase" or
"SEAP" as used in relation to the invention is intended to embrace
all SEAP or recombinant enzymes derived from SEAP which have
alkaline phosphatase activity. SEAP activity can be detected by a
variety of methods including, but not limited to, measurement of
catalysis of a fluorescent substrate, immunoprecipitation, HPLC,
and radiometric detection. The luminescent method is preferred due
to its increased sensitivity over calorimetric detection methods.
The advantages of using SEAP is that a cell lysis step is not
required since the SEAP protein is secreted out of the cell, which
facilitates the automation of sampling and assay procedures. A
cell-based assay using SEAP for use in cell-based assessment of
inhibitors of the Hepatitis C virus protease is described in U.S.
Pat. No. 6,280,940 to Potts et al. which is hereby incorporated by
reference in its entirety.
[0293] 5.5.7. Cell Culture Systems, Embryonated Eggs, and Animal
Models
[0294] Cell culture systems known in the art can be used to
propagate or test activities of the viruses of the present
invention. (See e.g., Flint et al., PRINCIPLES OF VIROLOGY,
MOLECULAR BIOLOGY, PATHOGENESIS, AND CONTROL, 2000, ASM Press pp
25-29, the entire text is incorporated herein by reference).
Examples of such cell culture systems include, but are not limited
to, primary cell culture that are prepared from animal tissues
(e.g., cell cultures derived from monkey kidney, human embryonic
amnion, kidney, and foreskin, and chicken or mouse embryos);
diploid cell strains that consist of a homogeneous population of a
single type and can divide up to 100 times before dying (e.g., cell
culture derived from human embryos, such as the WI-38 strain
derived from human embryonic lung); and continuous cell lines
consist of a single cell type that can be propagated indefinitely
in culture (e.g., HEp-2 cells, Hela cells, Vero cells, L and 3T3
cells, and BHK-21 cells).
[0295] Viruses of the invention can also be propagated in
embryonated chicken eggs. At 5 to 14 days after fertilization, a
hole is drilled in the shell and virus is injected into the site
appropriate for its replication.
[0296] Any animal models known in the art can be used in the
present invention to accomplish various purposes, such as to
determine the effectiveness and safeness of vaccines of the
invention. Examples of such animal models include, but are not
limited to, cotton rats (Sigmodon hispidis), hamsters, mice,
monkeys, and chimpanzees. In a preferred embodiment, Syrian Golden
hamsters are used.
[0297] 5.5.8. Neutralization Assay
[0298] Neutralization assays can be carried out to address the
important safety issue of whether the heterologous surface
glycoproteins are incorporated into the virion which may result in
an altered virus tropism phenotype. As used herein, the term
"tropism" refers to the affinity of a virus for a particular cell
type. Tropism is usually determined by the presence of cell
receptors on specific cells which allow a virus to enter that and
only that particular cell type. A neutralization assay is performed
by using either MAbs of the heterologous surface glycoprotein
(non-limiting example is the F protein of a negative strand RNA
virus) or polyclonal antiserum comprising antibodies against the
heterologous surface glycoprotein. Different dilution of the
antibodies are tested to see whether the chimeric virus of the
invention can be neutralized. The heterologous surface glycoprotein
should not be present on the virion surface in an amount sufficient
to result in antibody binding and neutralization.
[0299] 5.5.9. Sucrose Gradient Assay
[0300] The question of whether the heterologous proteins are
incorporated into the virion can be further investigated by use of
a biochemical assay. Infected cell lysates can be fractionated in
20-60% sucrose gradients, various fractions are collected and
analyzed for the presence and distribution of heterologous proteins
and the vector proteins by Western blot. The fractions and the
virus proteins can also be assayed for peak virus titers by plaque
assay. Examples of sucrose gradient assay are given in section 23,
infra. When the heterologous proteins are associated with the
virion, they will co-migrate with the virion.
[0301] 5.6. Vaccine Formulations Using the Chimeric Viruses
[0302] The invention encompasses vaccine formulations comprising
the engineered negative strand RNA virus of the present invention.
The recombinant PIV viruses of the present invention may be used as
a vehicle to express foreign epitopes that induce a protective
response to any of a variety of pathogens. In a specific
embodiment, the invention encompasses the use of recombinant bPIV
viruses or attenuated hPIV that have been modified in vaccine
formulations to confer protection against hPIV infection.
[0303] The vaccine preparations of the invention encompass
multivalent vaccines, including bivalent and trivalent vaccine
preparations. The bivalent and trivalent vaccines of the invention
may be administered in the form of one PIV vector expressing each
heterologous antigenic sequence or two or more PIV vectors each
encoding different heterologous antigenic sequences. For example, a
first chimeric PIV expressing one or more heterologous antigenic
sequences can be administered in combination with a second chimeric
PIV expressing one or more heterologous antigenic sequences,
wherein the heterologous antigenic sequences in the second chimeric
PIV are different from the heterologous antigenic sequences in the
first chimeric PIV. The heterologous antigenic sequences in the
first and the second chimeric PIV can be derived from the same
virus but encode different proteins, or derived from different
viruses. In a preferred embodiment, the heterologous antigenic
sequences in the first chimeric PIV are derived from respiratory
syncytial virus, and the heterologous antigenic sequences in the
second chimeric PIV are derived from human metapneumovirus. In
another preferred embodiment, the heterologous antigenic sequences
in the first chimeric PIV are derived from respiratory syncytial
virus, and the heterologous antigenic sequences in the second
chimeric PIV are derived from avian pneumovirus. In certain
preferred embodiments, the vaccine formulation of the invention is
used to protect against infections caused by a negative strand RNA
virus, including but not limited to, influenza virus, parainfluenza
virus, respiratory syncytial virus, and mammalian metapneumovirus
(e.g., human metapneumovirus). More specifically, the vaccine
formulation of the invention is used to protect against infections
by a human metapneumovirus and/or an avian pneumovirus. In certain
embodiments, the vaccine formulation of the invention is used to
protect against infections by (a) a human metapneumovirus and a
respiratory syncytial virus; and/or (b) an avian pneumovirus and a
respiratory syncytial virus.
[0304] In a preferred embodiment, the invention provides a
proteinaceous molecule or metapneumovirus-specific viral protein or
functional fragment thereof encoded by a nucleic acid according to
the invention. Useful proteinaceous molecules are for example
derived from any of the genes or genomic fragments derivable from a
virus according to the invention. Particularly useful are the F, SH
and/or G protein or antigenic fragments thereof for inclusion as
antigen or subunit immunogen, but inactivated whole virus can also
be used. Particularly useful are also those proteinaceous
substances that are encoded by recombinant nucleic acid fragments
that are identified for phylogenetic analyses, of course preferred
are those that are within the preferred bounds and metes of ORFs
useful in phylogenetic analyses, in particular for eliciting MPV
specific antibody or T cell responses, whether in vivo (e.g. for
protective purposes or for providing diagnostic antibodies) or in
vitro (e.g. by phage display technology or another technique useful
for generating synthetic antibodies).
[0305] A pharmaceutical composition comprising a virus, a nucleic
acid, a proteinaceous molecule or fragment thereof, an antigen
and/or an antibody according to the invention can for example be
used in a method for the treatment or prevention of a MPV infection
and/or a respiratory illness comprising providing an individual
with a pharmaceutical composition according to the invention. This
is most useful when said individual is a human, specifically when
said human is below 5 years of age, since such infants and young
children are most likely to be infected by a human MPV as provided
herein. Generally, in the acute phase patients will suffer from
upper respiratory symptoms predisposing for other respiratory and
other diseases. Also lower respiratory illnesses may occur,
predisposing for more and other serious conditions. The
compositions of the invention can be used for the treatment of
immuno-compromised individuals including cancer patients,
transplant recipients and the elderly.
[0306] The invention also provides methods to obtain an antiviral
agent useful in the treatment of respiratory tract illness
comprising establishing a cell culture or experimental animal
comprising a virus according to the invention, treating said
culture or animal with an candidate antiviral agent, and
determining the effect of said agent on said virus or its infection
of said culture or animal. The invention also provides use of an
antiviral agent according to the invention for the preparation of a
pharmaceutical composition, in particular for the preparation of a
pharmaceutical composition for the treatment of respiratory tract
illness, specifically when caused by an MPV infection or related
disease, and provides a pharmaceutical composition comprising an
antiviral agent according to the invention, useful in a method for
the treatment or prevention of an MPV infection or respiratory
illness, said method comprising providing an individual with such a
pharmaceutical composition.
[0307] In certain embodiments of the invention, the vaccine of the
invention comprises mammalian metapneumovirus. In certain, more
specific embodiments, the mammalian metapneumovirus is a human
metapneumovirus. In a preferred embodiment, the mammalian
metapneumovirus to be used in a vaccine formulation has an
attenuated phenotype. For methods to achieve an attenuated
phenotype, see section 5.4.
[0308] The invention provides vaccine formulations for the
prevention and treatment of infections with PIV, RSV, APV, and/or
hMPV. In certain embodiments, the vaccine of the invention
comprises recombinant and chimeric viruses of the invention. In
certain embodiments, the virus is attenuated.
[0309] In a specific embodiment, the vaccine comprises APV and the
vaccine is used for the prevention and treatment for hMPV
infections in humans. Without being bound by theory, because of the
high degree of homology of the F protein of APV with the F protein
of hMPV, infection with APV will result in the production of
antibodies in the host that will cross-react with hMPV and protect
the host from infection with hMPV and related diseases.
[0310] In another specific embodiment, the vaccine comprises hMPV
and the vaccine is used for the prevention and treatment for APV
infection in birds, such as, but not limited to, in turkeys.
Without being bound by theory, because of the high degree of
homology of the F protein of APV with the F protein of hMPV,
infection with hMPV will result in the production of antibodies in
the host that will cross-react with APV and protect the host from
infection with APV and related diseases.
[0311] In certain embodiments, the vaccine formulation of the
invention is used to protect against infections by (a) a human
metapneumovirus and a human parainfluenza virus; and/or (b) an
avian pneumovirus and a human parainfluenza virus and related
diseases.
[0312] In certain embodiments, the vaccine formulation of the
invention is used to protect against infections by (a) a human
metapneumovirus, a respiratory syncytial virus, and a human
parainfluenza virus; and/or (b) an avian pneumovirus, a respiratory
syncytial virus, and a human parainfluenza virus and related
diseases.
[0313] In certain embodiments, the vaccine formulation of the
invention is used to protect against infections by a human
metapneumovirus, a respiratory syncytial virus, and a human
parainfluenza virus. In certain other embodiments, the vaccine
formulation of the invention is used to protect against infections
by an avian pneumovirus, a respiratory syncytial virus, and a human
parainfluenza virus, and related diseases.
[0314] Due to the high degree of homology among the F proteins of
different viral species, for exemplary amino acid sequence
comparisons see FIG. 1, the vaccine formulations of the invention
can be used for protection from viruses different from the one from
which the heterologous nucleotide sequence encoding the F protein
was derived. In a specific exemplary embodiment, a vaccine
formulation contains a virus comprising a heterologous nucleotide
sequence derived from an avian pneumovirus type A, and the vaccine
formulation is used to protect from infection by avian pneumovirus
type A and avian pneumovirus type B. In another specific exemplary
embodiment, a vaccine formulation contains a virus comprising a
heterologous nucleotide sequence derived from an avian pneumovirus
subgroup C, and the vaccine formulation is used to protect from
infection by avian pneumovirus subgroup C and avian pneumovirus
subgroup D.
[0315] The invention encompasses vaccine formulations to be
administered to humans and animals that are useful to protect
against PIV, hMPV, APV (including APV C and APV D), influenza, RSV,
Sendai virus, mumps, laryngotracheitis virus, simianvirus 5, human
papillomavirus, as well as other viruses, pathogens and related
diseases. The invention further encompasses vaccine formulations to
be administered to humans and animals that are useful to protect
against human metapneumovirus infections, avian pneumovirus
infections, and related diseases.
[0316] In one embodiment, the invention encompasses vaccine
formulations that are useful against domestic animal disease
causing agents including rabies virus, feline leukemia virus (FLV)
and canine distemper virus. In yet another embodiment, the
invention encompasses vaccine formulations that are useful to
protect livestock against vesicular stomatitis virus, rabies virus,
rinderpest virus, swinepox virus, and further, to protect wild
animals against rabies virus.
[0317] Attenuated viruses generated by the reverse genetics
approach can be used in the vaccine and pharmaceutical formulations
described herein. Reverse genetics techniques can also be used to
engineer additional mutations to other viral genes important for
vaccine production. For example, mutations in the 5' non-coding
region may affect mRNA translation, mutations in capsid proteins
are believed to influence viral assembly, and temperature-sensitive
and cold-adapted mutants are often less pathogenic than the
parental virus. (see, e.g., Flint et al., PRINCIPLES OF VIROLOGY,
MOLECULAR BIOLOGY, PATHOGENESIS, AND CONTROL, 2000, ASM Press pp
670-683, the entire text is incorporated herein by reference). The
epitopes of useful vaccine strain variants can be engineered into
the attenuated virus. Alternatively, completely foreign epitopes,
including antigens derived from other viral or non-viral pathogens
can be engineered into the attenuated strain. For example, antigens
of non-related viruses such as HIV (gp160, gp120, gp41), parasite
antigens (e.g., malaria), bacterial or fungal antigens, or tumor
antigens can be engineered into the attenuated strain.
Alternatively, epitopes which alter the tropism of the virus in
vivo can be engineered into the chimeric attenuated viruses of the
invention.
[0318] Virtually any heterologous gene sequence may be constructed
into the chimeric viruses of the invention for use in vaccines.
Preferably, moieties and peptides that act as biological response
modifiers are constructed into the chimeric viruses of the
invention for use in vaccines. Preferably, epitopes that induce a
protective immune response to any of a variety of pathogens, or
antigens that bind neutralizing antibodies may be expressed by or
as part of the chimeric viruses. For example, heterologous gene
sequences that can be constructed into the chimeric viruses of the
invention include, but are not limited to influenza and
parainfluenza hemagglutinin neuraminidase and fusion glycoproteins
such as the HN and F genes of human PUV3. In yet another
embodiment, heterologous gene sequences that can be engineered into
the chimeric viruses include those that encode proteins with
immunomodulating activities. Examples of immunomodulating proteins
include, but are not limited to, cytokines, interferon type 1,
gamma interferon, colony stimulating factors, interleukin-1, -2,
-4, -5, -6, -12, and antagonists of these agents.
[0319] In addition, heterologous gene sequences that can be
constructed into the chimeric viruses of the invention for use in
vaccines include but are not limited to sequences derived from a
human immunodeficiency virus (HIV), preferably type 1 or type 2. In
a preferred embodiment, an immunogenic HIV-derived peptide that may
be the source of an antigen may be constructed into a chimeric PIV
that may then be used to elicit a vertebrate immune response. Such
HIV-derived peptides may include, but are not limited to, sequences
derived from the env gene (i.e., sequences encoding all or part of
gp160, gp120, and/or gp41), the pol gene (i.e., sequences encoding
all or part of reverse transcriptase, endonuclease, protease,
and/or integrase), the gag gene (i.e., sequences encoding all or
part of p7, p6, p55, p17/18, p24/25), tat, rev, nef, vif, vpu, vpr,
and/or vpx.
[0320] Other heterologous sequences may be derived from hepatitis B
virus surface antigen (HBsAg); hepatitis A or C virus surface
antigens, the glycoproteins of Epstein Barr virus; the
glycoproteins of human papillomavirus; the glycoproteins of
respiratory syncytial virus, parainfluenza virus, Sendai virus,
simianvirus 5 or mumps virus; the glycoproteins of influenza virus;
the glycoproteins of herpesviruses; VP1 of poliovirus; antigenic
determinants of non-viral pathogens such as bacteria and parasites,
to name but a few. In another embodiment, all or portions of
immunoglobulin genes may be expressed. For example, variable
regions of anti-idiotypic immunoglobulins that mimic such epitopes
may be constructed into the chimeric viruses of the invention.
[0321] Other heterologous sequences may be derived from tumor
antigens, and the resulting chimeric viruses can be used to
generate an immune response against the tumor cells leading to
tumor regression in vivo. These vaccines may be used in combination
with other therapeutic regimens, including but not limited to,
chemotherapy, radiation therapy, surgery, bone marrow
transplantation, etc. for the treatment of tumors. In accordance
with the present invention, recombinant viruses may be engineered
to express tumor-associated antigens (TAAs), including but not
limited to, human tumor antigens recognized by T cells (Robbins and
Kawakami, 1996, Curr. Opin. Immunol. 8:628-636, incorporated herein
by reference in its entirety), melanocyte lineage proteins,
including gp100, MART-1/MelanA, TRP-1 (gp75), tyrosinase;
Tumor-specific widely shared antigens, MAGE-1, MAGE-3, BAGE,
GAGE-1, GAGE-1, N-acetylglucosaminyltransferase-V, p15;
Tumor-specific mutated antigens, .beta.-catenin, MUM-1, CDK4;
Nonmelanoma antigens for breast, ovarian, cervical and pancreatic
carcinoma, HER-2/neu, human papillomavirus-E6, -E7, MUC-1.
[0322] In even other embodiments, a heterologous nucleotide
sequence is derived from a metapneumovirus, such as human
metapneumovirus and/or avian pneumovirus. In even other
embodiments, the virus of the invention contains two different
heterologous nucleotide sequences wherein one is derived from a
metapneumovirus, such as human metapneumovirus and/or avian
pneumovirus, and the other one is derived from a respiratory
syncytial virus. The heterologous nucleotide sequence encodes a F
protein or a G protein of the respective virus. In a specific
embodiment, a heterologous nucleotide sequences encodes a chimeric
F protein, wherein the chimeric F protein contains the ectodomain
of a F protein of a metapneumovirus and the transmembrane domain as
well as the luminal domain of a F protein of a parainfluenza
virus.
[0323] Either a live recombinant viral vaccine or an inactivated
recombinant viral vaccine can be formulated. A live vaccine may be
preferred because multiplication in the host leads to a prolonged
stimulus of similar kind and magnitude to that occurring in natural
infections, and therefore, confers substantial, long-lasting
immunity. Production of such live recombinant virus vaccine
formulations may be accomplished using conventional methods
involving propagation of the virus in cell culture or in the
allantois of the chick embryo followed by purification.
Additionally, as bPIV has been demonstrated to be non-pathogenic in
humans, this virus is highly suited for use as a live vaccine.
[0324] In this regard, the use of genetically engineered PIV
(vectors) for vaccine purposes may desire the presence of
attenuation characteristics in these strains. The introduction of
appropriate mutations (e.g., deletions) into the templates used for
transfection may provide the novel viruses with attenuation
characteristics. For example, specific missense mutations that are
associated with temperature sensitivity or cold adaption can be
made into deletion mutations. These mutations should be more stable
than the point mutations associated with cold or temperature
sensitive mutants and reversion frequencies should be extremely
low.
[0325] Alternatively, chimeric viruses with "suicide"
characteristics may be constructed. Such viruses would go through
only one or a few rounds of replication within the host. When used
as a vaccine, the recombinant virus would go through limited
replication cycle(s) and induce a sufficient level of immune
response but it would not go further in the human host and cause
disease. Recombinant viruses lacking one or more of the PIV genes
or possessing mutated PUV genes would not be able to undergo
successive rounds of replication. Defective viruses can be produced
in cell lines which permanently express such a gene(s). Viruses
lacking an essential gene(s) would be replicated in these cell
lines, however, when administered to the human host, they would not
be able to complete a round of replication. Such preparations may
transcribe and translate--in this abortive cycle--a sufficient
number of genes to induce an immune response. Alternatively, larger
quantities of the strains could be administered, so that these
preparations serve as inactivated (killed) virus vaccines. For
inactivated vaccines, it is preferred that the heterologous gene
product be expressed as a viral component, so that the gene product
is associated with the virion. The advantage of such preparations
is that they contain native proteins and do not undergo
inactivation by treatment with formalin or other agents used in the
manufacturing of killed virus vaccines. Alternatively, mutated PIV
made from cDNA may be highly attenuated so that it replicates for
only a few rounds.
[0326] In certain embodiments, the vaccine of the invention
comprises an attenuated virus. Without being bound by theory, the
attenuated virus can be effective as a vaccine even if the
attenuated virus is incapable of causing a cell to generate new
infectious viral particles because the viral proteins are inserted
in the cytoplasmic membrane of the host thus stimulating an immune
response.
[0327] In another embodiment of this aspect of the invention,
inactivated vaccine formulations may be prepared using conventional
techniques to "kill" the chimeric viruses. Inactivated vaccines are
"dead" in the sense that their infectivity has been destroyed.
Ideally, the infectivity of the virus is destroyed without
affecting its immunogenicity. In order to prepare inactivated
vaccines, the chimeric virus may be grown in cell culture or in the
allantois of the chick embryo, purified by zonal
ultracentrifugation, inactivated by formaldehyde or
.beta.-propiolactone, and pooled. The resulting vaccine is usually
inoculated intramuscularly.
[0328] Inactivated viruses may be formulated with a suitable
adjuvant in order to enhance the immunological response. Such
adjuvants may include but are not limited to mineral gels, e.g.,
aluminum hydroxide; surface active substances such as lysolecithin,
pluronic polyols, polyanions; peptides; oil emulsions; and
potentially useful human adjuvants such as BCG, Corynebacterium
parvum, ISCOMS, and virosomes.
[0329] Many methods may be used to introduce the vaccine
formulations described above, these include but are not limited to
oral, intradermal, intramuscular, intraperitoneal, intravenous,
subcutaneous, percutaneous, and intranasal and inhalation routes.
It may be preferable to introduce the chimeric virus vaccine
formulation via the natural route of infection of the pathogen for
which the vaccine is designed.
[0330] In certain embodiments, the invention relates to immunogenic
compositions. The immunogenic compositions comprise a chimeric PIV.
In certain embodiments, the immunogenic composition comprises an
attenuated chimeric PIV. In certain embodiments, the immunogenic
composition further comprises a pharmaceutically acceptable
carrier.
[0331] Various techniques may be used to evaluate the effectiveness
and safeness of a vaccine according to the present invention. An
effective vaccine is a vaccine that protects vaccinated individuals
from illness due to pathogens, by invoking proper innate, cellular,
and humoral responses with minimal side effect. The vaccine must
not cause disease. Any techniques that are able to measure the
replication of the virus and the immune response of the vaccinated
subject may be used to evaluate the vaccine. Non-limiting examples
are given in the Example sections, infra.
[0332] 5.6.1. Dosage Regimens and Administration of the Vaccines or
Immunogenic Preparations of the Invention
[0333] The present invention provides vaccines and immunogenic
preparations comprising chimeric PIV expressing one or more
heterologous or non-native antigenic sequences. The vaccines or
immunogenic preparations of the invention encompass single or
multivalent vaccines, including bivalent and trivalent vaccines.
The vaccines or immunogenic formulations of the invention are
useful in providing protections against various viral infections.
Particularly, the vaccines or immunogenic formulations of the
invention provide protection against respiratory tract infections
in a host.
[0334] A recombinant virus and/or a vaccine or immunogenic
formulation of the invention can be administered alone or in
combination with other vaccines. Preferably, a vaccine or
immunogenic formulation of the invention is administered in
combination with other vaccines or immunogenic formulations that
provide protection against respiratory tract diseases, such as but
not limited to, respiratory syncytial virus vaccines, influenza
vaccines, measles vaccines, mumps vaccines, rubella vaccines,
pneumococcal vaccines, rickettsia vaccines, staphylococcus
vaccines, whooping cough vaccines or vaccines against respiratory
tract cancers. In a preferred embodiment, the virus and/or vaccine
of the invention is administered concurrently with pediatric
vaccines recommended at the corresponding ages. For example, at
two, four or six months of age, the virus and/or vaccine of the
invention can be administered concurrently with DtaP (IM), Hib
(IM), Polio (IPV or OPV) and Hepatitis B (IM). At twelve or fifteen
months of age, the virus and/or vaccine of the invention can be
administered concurrently with Hib (IM), Polio (IPV or OPV),
MMRII.RTM. (SubQ); Varivax.RTM. (SubQ), and hepatitis B (IM). The
vaccines that can be used with the methods of invention are
reviewed in various publications, e.g., The Jordan Report 2000,
Division of Microbiology and Infectious Diseases, National
Institute of Allergy and Infectious Diseases, National Institutes
of Health, United States, the content of which is incorporated
herein by reference in its entirety.
[0335] A vaccine or immunogenic formulation of the invention may be
administered to a subject per se or in the form of a pharmaceutical
or therapeutic composition. Pharmaceutical compositions comprising
an adjuvant and an immunogenic antigen of the invention (e.g., a
virus, a chimeric virus, a mutated virus) may be manufactured by
means of conventional mixing, dissolving, granulating,
dragee-making, levigating, emulsifying, encapsulating, entrapping
or lyophilizing processes. Pharmaceutical compositions may be
formulated in conventional manner using one or more physiologically
acceptable carriers, diluents, excipients or auxiliaries which
facilitate processing of the immunogenic antigen of the invention
into preparations which can be used pharmaceutically. Proper
formulation is, or amongst others, dependent upon the route of
administration chosen.
[0336] When a vaccine or immunogenic composition of the invention
comprises adjuvants or is administered together with one or more
adjuvants, the adjuvants that can be used include, but are not
limited to, mineral salt adjuvants or mineral salt gel adjuvants,
particulate adjuvants, microparticulate adjuvants, mucosal
adjuvants, and immunostimulatory adjuvants. Examples of adjuvants
include, but are not limited to, aluminum hydroxide, aluminum
phosphate gel, Freund's Complete Adjuvant, Freund's Incomplete
Adjuvant, squalene or squalane oil-in-water adjuvant formulations,
biodegradable and biocompatible polyesters, polymerized liposomes,
triterpenoid glycosides or saponins (e.g., QuilA and QS-21, also
sold under the trademark STIMULON, ISCOPREP),
N-acetyl-muramyl-L-threonyl-D-isoglutamine (Threonyl-MDP, sold
under the trademark TERMURTIDE), LPS, monophosphoryl Lipid A
(3D-MLAsold under the trademark MPL).
[0337] The subject to which the vaccine or an immunogenic
composition of the invention is administered is preferably a
mammal, most preferably a human, but can also be a non-human
animal, including but not limited to, primates, cows, horses,
sheep, pigs, fowl (e.g., chickens, turkeys), goats, cats, dogs,
hamsters, mice and rodents.
[0338] Many methods may be used to introduce the vaccine or the
immunogenic composition of the invention, including but not limited
to, oral, intradermal, intramuscular, intraperitoneal, intravenous,
subcutaneous, percutaneous, intranasal and inhalation routes, and
via scarification (scratching through the top layers of skin, e.g.,
using a bifurcated needle).
[0339] For topical administration, the vaccine or immunogenic
preparations of the invention may be formulated as solutions, gels,
ointments, creams, suspensions, etc. as are well-known in the
art.
[0340] For administration intranasally or by inhalation, the
preparation for use according to the present invention can be
conveniently delivered in the form of an aerosol spray presentation
from pressurized packs or a nebulizer, with the use of a suitable
propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane,
dichlorotetrafluoroethane, carbon dioxide or other suitable gas. In
the case of a pressurized aerosol the dosage unit may be determined
by providing a valve to deliver a metered amount. Capsules and
cartridges of, e.g., gelatin for use in an inhaler or insufflator
may be formulated containing a powder mix of the compound and a
suitable powder base such as lactose or starch.
[0341] For injection, the vaccine or immunogenic preparations may
be formulated in aqueous solutions, preferably in physiologically
compatible buffers such as Hanks's solution, Ringer's solution, or
physiological saline buffer. The solution may contain formulatory
agents such as suspending, stabilizing and/or dispersing agents.
Alternatively, the proteins may be in powder form for constitution
with a suitable vehicle, e.g., sterile pyrogen-free water, before
use.
[0342] Determination of an effective amount of the vaccine or
immunogenic formulation for administration is well within the
capabilities of those skilled in the art, especially in light of
the detailed disclosure provided herein.
[0343] An effective dose can be estimated initially from in vitro
assays. For example, a dose can be formulated in animal models to
achieve an induction of an immunity response using techniques that
are well known in the art. One having ordinary skill in the art
could readily optimize administration to all animal species based
on results described herein. Dosage amount and interval may be
adjusted individually. For example, when used as an immunogenic
composition, a suitable dose is an amount of the composition that
when administered as described above, is capable of eliciting an
antibody response. When used as a vaccine, the vaccine or
immunogenic formulations of the invention may be administered in
about 1 to 3 doses for a 1-36 week period. Preferably, 1 or 2 doses
are administered, at intervals of about 2 weeks to about 4 months,
and booster vaccinations may be given periodically thereafter.
Alternate protocols may be appropriate for individual animals. A
suitable dose is an amount of the vaccine formulation that, when
administered as described above, is capable of raising an immunity
response in an immunized animal sufficient to protect the animal
from an infection for at least 4 to 12 months. In general, the
amount of the antigen present in a dose ranges from about 1 pg to
about 100 mg per kg of host, typically from about 10 pg to about 1
mg, and preferably from about 100 pg to about 1 .mu.g. Suitable
dose range will vary with the route of injection and the size of
the patient, but will typically range from about 0.1 mL to about 5
mL.
[0344] In a specific embodiment, the viruses and/or vaccines of the
invention are administered at a starting single dose of at least
10.sup.3 TCID.sub.50, at least 10.sup.4 TCID.sub.50, at least
10.sup.5 TCID.sub.50, at least 10.sup.6 TCID.sub.50. In another
specific embodiment, the virus and/or vaccines of the invention are
administered at multiple doses. In a preferred embodiment, a
primary dosing regimen at 2, 4, and 6 months of age and a booster
dose at the beginning of the second year of life are used. More
preferably, each dose of at least 10.sup.5 TCID.sub.50, or at least
106 TCID.sub.50 is given in a multiple dosing regimen. The
replication rate of a virus can be used as an index to adjust the
dosage of a vaccine in a clinical trial. For example, assays to
test the replication rate of a virus (e.g., a growth curve, see
Section 5.5. for available assays) can be used to compare the
replication rate of the viruses and/or vaccines of the invention to
that of the bPIV3, which was demonstrated in previous studies (see
Clements et al., J. Clin. Microbiol. 29:1175-82 (1991); Karron et
al., J. Infect. Dis. 171:1107-14 (1995); Karron et al., Ped. Inf.
Dis. J. 5:650-654 (1996). These studies showed that a bovine PIV3
vaccine is generally safe and well tolerated by healthy human
volunteers, including adults, children 6-60 months of age, and
infants 2-6 months of age. In these studies, subjects have received
at least a single dose of bPIV3 vaccine from 10.sup.3 TCID.sub.50
to 10.sup.6 TCID.sub.50 Twelve children received two doses of
10.sup.5 TCID.sub.50 PIV3 vaccine instead of one dose without
untoward effects.). A comparable replication rate as to bPIV3
suggests that a comparable dosage may be used in a clinical trial.
A lower replication rate compared to that of bPIV3 suggests that a
higher dosage can be used.
[0345] 5.6.1.1. Challenge Studies
[0346] This assay is used to determine the ability of the
recombinant viruses of the invention and of the vaccines of the
invention to prevent lower respiratory tract viral infection in an
animal model system, such as, but not limited to, cotton rats or
hamsters. The recombinant virus and/or the vaccine can be
administered by intravenous (IV) route, by intramuscular (IM) route
or by intranasal route (IN). The recombinant virus and/or the
vaccine can be administered by any technique well-known to the
skilled artisan. This assay is also used to correlate the serum
concentration of antibodies with a reduction in lung titer of the
virus to which the antibodies bind.
[0347] On day 0, groups of animals, such as, but not limited to,
cotton rats (Sigmodon hispidis, average weight 100 g) cynomolgous
macacques (average weight 2.0 kg) are administered the recombinant
or chimeric virus or the vaccine of interest or BSA by
intramuscular injection, by intravenous injection, or by intranasal
route. Prior to, concurrently with, or subsequent to administration
of the recombinant virus or the vaccine of the invention, the
animals are infected with wild type virus wherein the wild type
virus is the virus against which the vaccine was generated. In
certain embodiments, the animals are infected with the wild type
virus at least 1 day, at least 2 days, at least 3 days, at least 4
days, at least 5 days, at least 6 days, 1 week or 1 or more months
subsequent to the administration of the recombinant virus and/or
the vaccine of the invention.
[0348] After the infection, cotton rats are sacrificed, and their
lung tissue is harvested and pulmonary virus titers are determined
by plaque titration. Bovine serum albumin (BSA) 10 mg/kg is used as
a negative control. Antibody concentrations in the serum at the
time of challenge are determined using a sandwich ELISA. Similarly,
in macacques, virus titers in nasal and lung lavages can be
measured.
[0349] 5.6.1.2. Target Populations
[0350] In certain embodiments of the invention, the target
population for the therapeutic and diagnostic methods of the
invention is defined by age. In certain embodiments, the target
population for the therapeutic and/or diagnostic methods of the
invention is characterized by a disease or disorder in addition to
a respiratory tract infection.
[0351] In a specific embodiment, the target population encompasses
young children, below 2 years of age. In a more specific
embodiment, the children below the age of 2 years do not suffer
from illnesses other than respiratory tract infection.
[0352] In other embodiments, the target population encompasses
patients above 5 years of age. In a more specific embodiment, the
patients above the age of 5 years suffer from an additional disease
or disorder including cystic fibrosis, leukaemia, and non-Hodgkin
lymphoma, or recently received bone marrow or kidney
transplantation.
[0353] In a specific embodiment of the invention, the target
population encompasses subjects in which the hMPV infection is
associated with immunosuppression of the hosts. In a specific
embodiment, the subject is an immunocompromised individual.
[0354] In certain embodiments, the target population for the
methods of the invention encompasses the elderly.
[0355] In a specific embodiment, the subject to be treated with the
methods of the invention was infected with hMPV in the winter
months.
[0356] 5.6.1.3. Clinical Trials
[0357] Vaccines of the invention or fragments thereof tested in in
vitro assays and animal models may be further evaluated for safety,
tolerance and pharmacokinetics in groups of normal healthy adult
volunteers. The volunteers are administered intramuscularly,
intravenously or by a pulmonary delivery system a single dose of a
recombinant virus of the invention and/or a vaccine of the
invention. Each volunteer is monitored at least 24 hours prior to
receiving the single dose of the recombinant virus of the invention
and/or a vaccine of the invention and each volunteer will be
monitored for at least 48 hours after receiving the dose at a
clinical site. Then volunteers are monitored as outpatients on days
3, 7, 14, 21, 28, 35, 42, 49, and 56 postdose.
[0358] Blood samples are collected via an indwelling catheter or
direct venipuncture using 10 ml red-top Vacutainer tubes at the
following intervals: (1) prior to administering the dose of the
recombinant virus of the invention and/or a vaccine of the
invention; (2) during the administration of the dose of the
recombinant virus of the invention and/or a vaccine of the
invention; (3) 5 minutes, 10 minutes, 15 minutes, 20 minutes, 30
minutes, 1 hour, 2 hours, 4 hours, 8 hours, 12 hours, 24 hours, and
48 hours after administering the dose of the recombinant virus of
the invention and/or a vaccine of the invention; and (4) 3 days, 7
days 14 days, 21 days, 28 days, 35 days, 42 days, 49 days, and 56
days after administering the dose of the recombinant virus of the
invention and/or a vaccine of the invention. Samples are allowed to
clot at room temperature and serum will be collected after
centrifugation.
[0359] The amount of antibodies generated against the recombinant
virus of the invention and/or a vaccine of the invention in the
samples from the patients can be quantitated by ELISA. T-cell
immunity (cytotoxic and helper responses) in PBMC and lung and
nasal lavages can also be monitored.
[0360] The concentration of antibody levels in the serum of
volunteers are corrected by subtracting the predose serum level
(background level) from the serum levels at each collection
interval after administration of the dose of recombinant virus of
the invention and/or a vaccine of the invention. For each volunteer
the pharmacokinetic parameters are computed according to the
model-independent approach (Gibaldi et al., eds., 1982,
Pharmacokinetics, 2nd edition, Marcel Dekker, New York) from the
corrected serum antibody or antibody fragment concentrations.
[0361] The following examples are illustrative, but not limiting,
of the present invention. Cells and Viruses used in the examples
are maintained as follows: the RSV A2 strain and the bovine
parainfluenza type 3/human parainfluenza type 3 vectored RSV
viruses (bPIV3hPIV3/RSV viruses) were grown in Vero cells in
Opti-MEM (Gibco/BRL) in the presence of gentamycin. The modified
vaccinia virus Ankara (MVA-T7) or fowl-pox-T7 (FP-T7) which
expressed the phage T7 RNA polymerase were grown in chicken
embryonic kidney cells (SPAFAS). Vero, HeLa and Hep-2 cells were
maintained in MEM (JRH Biosciences) supplemented with 10% fetal
bovine serum (FBS), 2 mM L-glutamine, non-essential amino acids,
and antibiotics.
6. EXAMPLE 1
Construction and Cloning of Chimeric Bovine Parainfluenza 3/Human
Parainfluenza 3 cDNA
[0362] In order to substitute the F and HN genes of bPIV3 with
those of hPIV3, additional restriction enzyme sites were introduced
into the infectious bPIV3 cDNA. Using site-directed mutagenesis, a
unique Nhe I site was introduced at nucleotide position 5041 and a
Sal I site was introduced at nt 8529 of the bPIV3 cDNA. The
modified full-length bPIV3 cDNA was treated with Nhe I and Sal I
restriction enzymes and a .about.14 kb DNA fragment encompassing
all of the viral bPIV3 sequences except the F and HN genes, was
isolated by gel purification.
[0363] To obtain the hPIV3 F and HN gene sequences, a 10 cm dish of
confluent Vero cells was infected with a strain of hPIV3
(hPIV3/Tex/12084/1983). After 3 days of incubation at 37.degree.
C., the cells were harvested and total RNA was isolated using RNA
STAT-LS 50 (Tel-Test Inc.). Viral cDNA was generated by reverse
transcription using a hPIV3 specific oligo annealing at position
4828 of the hPIV3 genome. The hPIV3 F and HN genes were amplified
by PCR (polymerase chain reaction) using Taq polymerase. The PCR
product was cloned into the pT/A TOPO cloning vector (Invitrogen)
and from two clones (#11 and #14) the hPIV3 F and HN genes were
sequenced. Sequence analysis revealed that for clone #11, the F
gene was correct, but the HN gene contained aberrant sequences; for
clone #14, the HN gene was correct, but the F gene contained
aberrant stop codons. Thus, a plasmid, containing functional hPIV3
F and HN genes, was constructed by combining the correct F gene of
#11 with the correct HN gene of #14 in the following manner. Both
hPIV3 plasmids (#11 and #14) were digested with Nhe1 and EcoR1. A
1.6 kb fragment harboring the correct F gene was isolated from
clone #11 and a 8.5 kb fragment containing the correct HN gene and
plasmid sequences, was isolated from clone #14. The two fragments
were ligated to produce the intact hPIV3 F and HN genes-containing
plasmid. The correct sequence was confirmed by DNA sequence
analysis. Finally, a single nucleotide was added at the 3' end of
the HN gene in the untranslated region to satisfy the "Rule of
Six." The addition of the single nucleotide was accomplished by
using the QuikChange mutagenesis kit (Stratagene) and was confirmed
by DNA sequencing. The correct hPIV3 F and HN gene DNA fragment was
then isolated by digestion with Nhe 1 and Sal 1 and a 3.5 kb DNA
fragment was gel purified.
[0364] The full-length b/h PIV3 chimeric cDNA was constructed by
ligating the 14.5 kb DNA fragment harboring bPIV3 sequences
described above and the 3.5 kb DNA fragment containing the hPIV3 F
and HN genes (see FIG. 3). The full-length chimeric plasmid DNA was
confirmed by extensive restriction enzyme mapping. In addition, the
M/F and HN/L gene junctions of the chimeric construct were
confirmed by DNA sequencing to both contain bPIV3 and hPIV3
sequences as well as a Nhe 1 and a Sal 1 restriction enzyme site,
respectively.
7. EXAMPLE 2
Construction and Cloning of Chimeric Bovine Parainfluenza 3/Human
Parainfluenza 3 Vectored Respiratory Syncytial Virus F or G
cDNAs
[0365] In order to determine the effects of RSV antigen insertions
in position 1 or 2 of the b/h PIV3 genome on virus replication,
respiratory syncytial virus (RSV) F and G genes were cloned into
different positions of the chimeric bovine parainfluenza 3/human
parainfluenza 3 vector (b/h PIV3 vector). See FIG. 4.
[0366] In order to insert foreign genes into the bovine/human (b/h)
PIV3 cDNA, AvrII restriction enzyme sites were introduced in the
b/h PIV3 cDNA plasmid (Haller et al., 2000; 2001, this is the same
construct as in Example 6) by site-directed mutagenesis using the
QuickChange kit (Stratagene). One AvrII site was introduced at
nucleotide (nt) 104 in the b/h PIV3 genome altering four
nucleotides using the following oligo 5'GAA ATC CTA AGA CCC TAG GCA
TGT TGA GTC3' and its complement. This restriction enzyme site was
used to insert the RSV genes in the first (most 3') position of the
viral genome. Another AvrII site was introduced in the N-P
intergenic region at nt 1774 changing two nucleotides using the
following oligo 5'CCACAACTCAATCAACCTAGGATTCATGGAAGACAATG 3' and its
complement. This restriction site was used to insert the RSV genes
in the second position between the N and P genes of b/h PIV3 (FIG.
4). Full-length b/h PIV3 cDNAs harboring the AvrII sites at nts 104
and 1774 were tested for functionality by recovering viruses by
reverse genetics.
[0367] Construction of RSV G cassette (N-P gene stop/start): A DNA
fragment was generated that contained the bPIV3 N-P intergenic
region as well as the 3' end sequences of the RSV G gene, using the
b/h PIV3 cDNA as PCR template. This fragment was generated by PCR
using the following oligos: 5'CCCAACACACCACGCCAGTAGTCACAA
AGAGATGACCACTATCAC3' and 5'CCCAAGCTTCCTAGGTGAATCTTTG
GTTGATTGAGTTGTGG3'. This fragment was then used to carry out
overlapping PCR to add the bPIV3 N-P intergenic region to the RSV G
gene. For the second PCR reaction, a plasmid containing the RSV G
and F gene was used as a DNA template, the oligo
5'CAGCGGATCCTAGGGGAGAAAAGTGTCGAAGAAAAATGTCC3' and an oligo
generated from the short PCR fragment above were used as primers.
The resulting PCR fragment containing the RSV G gene linked to the
bPIV3 N-P intergenic region and flanking AvrII restriction enzyme
sites, was cloned into pGEM3. The RSV G gene was sequenced to
confirm the presence of an intact open reading frame and the
predicted amino acid sequences. The DNA fragments harboring the RSV
G gene were inserted into the first or second position using the
AvrII restriction enzyme sites into a subclone harboring only the
first 5200 nucleotides of the bPIV3 (1-5 bPIV3) genome that was
linearized with AvrII. As used herein and other Examples, 1-5 bPIV3
refers to the nucleotide 1 to 5196 (or 5200) of bovine PIV3 genome.
There is a BstB1 site at this location.
[0368] Construction of RSV F cassette (N-P gene start/stop): The
RSV F gene fragment was isolated by PCR from a full-length
bPIV3/RSV F+G cDNA plasmid using oligos that added AvrII sites at
the 5' and 3' end of the RSV F gene, and introduced into the 1-5
bPIV3 plasmid harboring the AvrII site at nt 1774, which was
linearized with AvrII. The bPIV3 N-P intergenic region was isolated
by PCR using 1-5 bPIV3/RSV G2 as a template. The oligo
5'GACGCGTCGACCACAAAGAGATGACCACTATCACC 3' and an oligo annealing in
the bPIV3 F gene were used to generate a PCR fragment containing
the bPIV3 N-P intergenic region, AvrII site, and bPIV3 sequences up
to nt 5200. The PCR fragment was digested with SalI and NheI, and
added to the 1-5 bPIV3 plasmid harboring the RSV F gene in position
2, which was treated with SalI and NheI. To introduce the RSV F
gene containing the N-P intergenic region into position 1, the 1.8
kb RSV F cassette was excised using AvrII, and ligated into 1-5
bPIV3 containing the AvrII site at nt 104, which was linearized
with AvrII.
[0369] Construction of the RSV F cassette with a short intergenic
region (N stop/N start):
[0370] The generation of the RSV F gene with the short N-N
intergenic region was accomplished by performing a PCR reaction
using 1-5 bPIV3/RSV F2 as a template, the oligo
5'GCGCGTCGACCAAGTAAGAAAAACTTAGGATTAAAGAACCCTAGGACTGTA3', and an
oligo annealing upstream of the 5' end of the RSV F gene
encompassing the AvrII restriction enzyme site. The PCR product
containing the RSV F gene and the short N-N intergenic region, was
digested with AvrII and introduced into 1-5 bPIV3 nt 104 which was
linearized with AvrII.
[0371] After confirming proper orientation by restriction enzyme
mapping, the plasmids harboring the RSV genes in the first position
were digested with SphI and BssHII and 4 kb (1-5 bPIV3/RSV G1) or
4.8 kb (1-5 bPIV3/RSV F1) DNA fragments were isolated. In a second
cloning step, the remainder of the b/h PIV3 genome was added as a
SphI-BssHII 15.1 kb DNA fragment, yielding full-length cDNAs. The
bPIV3 subclones, harboring the RSV genes in the second position,
were cut with SphI and NheI, and 5.8 kb (bPIV3/RSV G2) and a 6.5 kb
(bPIV3/RSV F2) DNA fragments were isolated. In a second cloning
step, the rest of the b/h PIV3 genome was added as an NheI-SphI DNA
fragment of 14 kb in size. The full-length chimeric b/h PIV3/RSV
plasmids were propagated in STBL-2 cells (Gibco/BRL) that provided
high yields of full-length virus cDNA plasmids.
8. EXAMPLE 3
Bovine Parainfluenza 3/Human Parainfluenza 3 Vectored Respiratory
Syncytial Virus F or G Displayed a Positional Effect with Regards
to mRNA production and protein expression as Well as Virus
Replication In Vitro
[0372] Three experiments were performed to confirm the effective
expression of the RSV F or G gene in the constructs of Example 2,
and to determine positional effects of gene insertions in the PIV3
genome.
[0373] First, in order to demonstrate RSV protein expression by the
chimeric viruses, a Western blot of chimeric virus-infected cell
lysates was carried out and probed with RSV-specific antisera. See
FIG. 5A. Western blots were performed as follows: Chimeric viruses
were used to infect (70-80%) subconfluent Vero cells at a MOI of
0.1 or 1.0. Forty-eight hours post infection the media overlay was
removed and infected monolayers were washed once with 1 ml of PBS.
The cells were subsequently lysed in 400 ml of Laemmli buffer
(Bio-Rad) containing 0.05% b-Mercaptoethanol (Sigma). 15 ml of each
sample was separated on 12% Tris-HCl Ready Gel (Bio-Rad) and
transferred to nylon membranes using a semi-dry transfer cell
(Bio-Rad). Nylon membranes were rinsed in PBS [pH 7.6] containing
0.5% (v/v) Tween-20 (Sigma) (PBST) and blocked with PBST containing
5% (w/v) dry milk (PBST-M) for 20-30 minutes at room temperature.
Membranes were incubated with either a mixture of RSV F monoclonal
antibodies (WHO 1269, 1200, 1153, 1112, 1243, 1107) at a 1:1000
dilution in PBST-M or RSV G 10181 polyclonal antibody (Orbigen) at
a 1:2000 dilution in PBST-M for 1 hour at room temperature.
Following four washes with PBST, the membranes were incubated with
a secondary horseradish peroxidase-conjugated goat anti-mouse
antibody (Dako) at a 1:2000 dilution in PBST-M for 1 hour at room
temperature. Membranes were washed 4 times with PBST and developed
using a chemiluminescence substrate (Amersham Pharmacia) and
exposed to Biomax Light Film (Kodak) for visualization of protein
bands.
[0374] Consistent with the reduced replication efficiency of
b/h/RSV F1*N-N in Vero cells (FIG. 5C, see below), the amount of
RSV F.sub.1 detected at 48 hours post infection was about 10 times
less than that present in b/h PIV3/RSV F2 or wild-type RSV A2
infected cells (compare lanes 2, 3, and 4, FIG. 5A). A 50 kDa band
representing the F.sub.1 fragment was detected in cells infected
with all chimeric viruses as well as wild-type RSV. However, there
was greater accumulation of a 20 kDa F fragment in infected cell
lysates of chimeric viruses compared to wild-type RSV. When b/h
PIV3/RSV F1*N-N infections were repeated at a higher MOI of 1.0
(FIG. 5A, lane 1), the F.sub.1 fragment in b/h PIV3/RSV F1 infected
cells accumulated to wild-type RSV levels at 48 hours
post-infection. The relative amount of the 50 kDa and 20 kDa
F.sub.1 fragments in b/h PIV3/RSV F1 or b/h PIV3/RSV F2 infected
cells was approximately 1:5. No F.sub.0 was detected in cells
infected with chimeric viruses indicating that the F.sub.0
precursors were efficiently processed during b/h PIV3/RSV F1 and
b/h PIV3/RSV F2 infections as was also observed in wild-type RSV
infections.
[0375] The relative expression of RSV G in b/h PIV3/RSV G1, b/h
PIV3/RSV G2 and wild-type RSV infected cells is shown in FIG. 5A.
Both the immature and glycosylated forms of RSV G that migrated at
approximately 50 kDa and 90 kDa, respectively, were detected. b/h
PIV3/RSV G1 infected cells showed levels of RSV G expression
similar to that seen in wild-type RSV infected cells (lanes 1 and
3, FIG. 5A). However, in b/h PIV3/RSV G2 infected cells, the
accumulation of RSV G was about 2-3 times more than that present in
wild-type RSV infected cells (lanes 2 and 3, FIG. 5A).
Collectively, these data showed that the chimeric b/h PIV3/RSV
efficiently expressed the RSV proteins in either position 1 or 2.
However, the viruses harboring the RSV genes in position 2
expressed higher levels of RSV proteins.
[0376] Next, Northern blot analysis showed that the mRNA
transcription correlated with the result of the protein expression
demonstrated by the Western blot, see FIG. 5B. Northern blot was
performed as follows: total cellular RNA was prepared from
virus-infected cells using Trizol LS (Life Technologies). The RNA
was further purified by one phenol-chloroform extraction and
precipitated with ethanol. RNA pellets were resuspended in diethyl
pyrocarbonate-treated water and stored at -80.degree. C. Equal
amounts of total RNA were separated on 1% agarose gels containing
1% formaldehyde and transferred to nylon membranes (Amersham
Pharmacia Biotech) using a Turboblotter apparatus (Schleicher &
Schuell). The blots were hybridized with digoxigenin
(DIG)-UTP-labeled riboprobes synthesized by in vitro transcription
using a DIG RNA labeling kit (Roche Molecular Biochemicals).
Hybridization was carried out at 68.degree. C. for 12 h in Express
Hyb solution (Clontech). The blots were washed at 68.degree. C.
twice with 2.times.SSC (1.times.SSC contained 0.015 M NaCl with
0.015 M sodium citrate)-0.1% sodium dodecyl sulfate (SDS) followed
by one wash with 0.5.times.SSC-0.1% SDS and a final wash with
0.1.times.SSC-0.1% SDS. Signals from the hybridized probes were
detected by using a DIG-Luminescent detection kit (Roche Molecular
Biochemicals) and visualized by exposure to BioMax ML film
(Kodak).
[0377] Northern analysis of b/h PIV3/RSV F1*N-N, b/h PIV3/RSV F2,
b/h PIV3/RSV G1 and b/h PIV3/RSV G2 showed that the viral mRNA
levels for RSV F or RSV G correlated well with the RSV protein
levels observed (FIG. 5B). The lowest levels of RSV F mRNAs were
observed for b/h PIV3/RSV F1*N-N which also displayed the least
amount of RSV F protein produced. b/h PIV3/RSV G1 produced less RSV
G mRNAs resulting in lower RSV G protein levels than was observed
for b/h PIV3/RSV G2.
[0378] Finally, growth of different virus (with RSV F or G gene at
either position 1 or position 2) correlates with the results of the
protein expression and the RNA transcription. The growth curve
showed in FIG. 5C was obtained as follows: Vero cells were grown to
90% confluence and infected at an MOI of 0.01 or 0.1 with b/h PIV3,
b/h PIV3 RSV F1, b/h PIV3 RSV G1, b/h PIV3 RSV F2, and b/h PIV3 RSV
G2. The infected monolayers were incubated at 37.degree. C. At 0,
24, 48, 72, 96 and 120 hours post-infection, cells and media were
harvested together and stored at -70.degree. C. Virus titers for
each time point harvest were determined by TCID.sub.50 or plaque
assays in Vero cells. TCID.sub.50 assays were inspected visually
for CPE following incubation at 37.degree. C. for 6 days, while
plaque assays were immunostained with RSV polyclonal antisera for
quantification after 5 days of incubation.
[0379] At an MOI of 0.01 in Vero cells, the chimeric viruses
harboring the RSV G or F genes in the first position (b/h PIV3 RSV
G1 and b/h PIV3 RSV F1*N-N) replicated at a slower rate, yielded
lower peak titers, and exhibited a greater lag phase than the
viruses that contained the RSV genes in the second position. Peak
titers of b/h PIV3/RSV F1*N-N and b/h PIV3/RSV G1 at 96 hours
post-infection were 10.sup.6.7 and 10.sup.5.5 TCID.sub.50/ml,
respectively (FIG. 5C). In contrast, peak titers of b/h PIV3/RSV F2
and b/h PIV3/RSV G2 were 10.sup.8.0 and 10.sup.7.4 at 72 and 96
hours post-infection, respectively (FIG. 5C). The b/h PIV3 control
virus displayed peak titers of 10.sup.8.0 TCID50/ml, respectively
(FIG. 5C). The b/h PIV3/RSV F2 yielded 1.3 log.sub.10 higher titers
than b/h PIV3/RSV F1*N-N. The b/h PIV3/RSV G2 replicated to 1.9
log.sub.10 higher titers than b/h PIV3/RSV G1. The results
indicated that the chimeric viruses harboring the RSV genes in the
first position were delayed in onset for replication in vitro
compared to chimeric viruses containing the RSV genes in the second
position.
[0380] To determine whether higher titers of b/h PIV3/RSV F1*N-N
and b/h PIV3/RSV G1 could be achieved at all, the growth curves
were repeated at a higher MOI of 0.1. At an MOI of 0.1, the peak
titers of b/h PIV3/RSV F1*N-N and b/h PIV3/RSV G1 increased by 0.5
to 1.3 log.sub.10 (data not shown). The lag phases of these viruses
were reduced and peak titers were achieved earlier during the
growth cycle.
9. EXAMPLE 4
Positional Effect of eGFP Insertions in the Bovine Parainfluenza
3/Human Parainfluenza 3 Genome on Virus Replication
[0381] The effect of gene insertions into the bovine/human PIV3
vector backbone was assessed systematically by introducing the eGFP
gene sequentially between all genes of PIV3 and observing the
effect on virus replication and eGFP expression (FIG. 6). This type
of assay investigates the importance of the transcriptional
gradient observed for paramyxoviruses that yields specific ratios
of viral mRNAs. Insertion of foreign genes will perturb these
ratios and result in the synthesis of different amounts of viral
proteins which may influence virus replication. The eGFP gene was
chosen for this assay since it will not be incorporated into the
virion membrane, and therefore should not interfere with viral
processes such as packaging, budding, entry, etc. The eGFP gene was
inserted into four positions of the b/h PIV3 genome, three of which
were characterized for eGFP expression and virus replication. The
eGFP gene cassette was linked to the bPIV3 N-P intergenic region.
b/h GFP1 harbored the eGFP gene cassette in the 3' most proximal
position of the b/h PIV3 genome. b/h PIV3/GFP2 contained the eGFP
gene cassette between the N and P genes of the b/h PIV3 genome. b/h
PIV3/GFP3 was located between P and M, and b/h PIV3/GFP4 had the
eGFP gene between M and F of b/h PIV3 (FIG. 6).
[0382] Construction of the eGFP gene cassette: the template of the
eGFP gene is commercially available, e.g., it can be purchased from
BD Biosciences (pIRES2-EGFP) or Clontech (pEGFP-N1). See Hoffmann
et al., Virology 267:310-317 (2000). The eGFP gene was isolated by
PCR and the bPIV3 N-P intergenic region was added by employing the
overlapping PCR method, using the following oligos:
5'ATTCCTAGGATGGTGAGCAAG GGCG3',
5'GGACGAGCTGTACAAGTAAAAAAATAGCACCTAATCATG3', and
5'CTACCTAGGTGAATCTTTGGTTG3'. The eGFP cassette was inserted into
pCR2.1, sequenced, and adherence to the rule-of-six was confirmed.
Then the eGFP cassette was digested with AvrII, gel purified, and
inserted into positions 1, 2, 3, and 4 of b/h PIV3 as described
below.
[0383] Generation of full-length cDNAs harboring the eGFP gene in
positions 1 and 2: the eGFP gene cassette was inserted into the 1-5
bPIV3 plasmids which contained bPIV3 sequences from nts 1-5200 and
an AvrII restriction enzyme site either at nt 104 (position 1) or
nt 1774 (position 2). After confirming proper orientation by
restriction enzyme mapping, the plasmid harboring the eGFP gene in
the first position was digested with SphI and BssHII and 4 kb (1-5
eGFP1) DNA fragments were isolated. Next, the rest of the b/h PIV3
genome was added as a SphI-BssHII 15.1 kb DNA fragment, yielding
full-length cDNAs. For generation of full-length cDNA comprising
the eGFP in position 2, the bPIV3 subclones harboring the eGFP
genes in the second position were cut with SphI and NheI, and 5.8
kb (1-5 eGFP2) DNA fragments were isolated. Next, the rest of the
b/h PIV3 genome was added as an NheI-SphI DNA fragment of 14 kb in
size. The full-length chimeric b/h PIV3/eGFP plasmids were
propagated in STBL-2 cells (Gibco/BRL) that provided high yields of
full-length virus cDNA plasmids.
[0384] Generation of full-length cDNAs harboring the eGFP gene in
positions 3 and 4: in order to insert the eGFP cassette into
position 3 of the b/h PIV3 genome, an AvrII restriction enzyme site
was introduced at nt 3730 in the P-M intergenic region of a
subclone containing nts 1-5200 of bPIV3, altering two nucleotides.
The following oligo and its complement were used in a QuickChange
PCR reaction to introduce the AvrII site:
5'GGACTAATCAATCCTAGGAAACAATGAGCATCACC3'. The eGFP cassette was
digested with AvrII and ligated into the AvrII linearized 1-5 bPIV3
subclone harboring the AvrII site at nt 3730. A 5.5 kb DNA fragment
from SphI to NheI was isolated from the GFP containing subclone and
introduced into the b/h PIV3 cDNA digested with SphI and NheI to
produce a full-length plasmid. In order to add the eGFP gene
cassette into position 4 of the b/h PIV3 genome, a subclone
containing b/h PIV3 sequences from nts 1-8500 was generated. This
subclone was linearized with NheI (nt 5042), and the eGFP cassette
containing compatible AvrII ends was inserted. Then the subclone
harboring the eGFP cassette was digested with SphI and XhoI and a
7.1 kb DNA fragment was isolated. The b/h PIV3 plasmid was treated
with SphI and XhoI and a 11 kb fragment was produced. These two DNA
fragments were ligated to generate b/h PIV3/GFP4.
[0385] The amount of eGFP produced by b/h PIV3/GFP1, 2, and 3 was
assessed in two ways. First, the amount of green cells produced
upon infecting Vero cells with b/h PIV3 GFP1, 2, and 3 at MOIs of
0.1 and 0.01 for 20 hours, was determined using a fluorescent
microscope (FIG. 7A). b/h PIV3/GFP3 produced strikingly fewer green
cells than b/h PIV3/GFP1 or 2.
[0386] Secondly, western analysis was performed on infected cells
and the blots were probed with a GFP MAb as well as a PIV3 PAb. The
initial observation that b/h PIV3/GFP3 produced dramatically less
eGFP protein, was confirmed (FIG. 7B). b/h PIV3 GFP1 and GFP2
produced similar amounts of eGFP protein. The western blots methods
controlled for same volume loading by probing with a PIV3 antibody
(FIG. 7B). Interestingly, all three viruses showed similar amounts
of PIV3 proteins (the HN protein is the most prominent band)
produced. These results suggested that b/h PIV3/GFP3 transcribed
less GFP in RNAs in position 3 as compared to positions 1 and 2.
This data confirmed the presence of a transcriptional gradient of
viral mRNAs in paramyxoviruses. The level of production of the PIV3
HN protein was not affected by the eGFP gene insertions (FIG.
7B).
[0387] In order to determine whether the GFP gene insertions had an
effect on the kinetics of virus replication of b/h PIV3/GFP1, 2,
and 3, multicycle growth curves in Vero cells were carried out
(FIG. 7C). The growth curves showed that b/h PUV3/GFP1 had a
delayed onset of virus replication at 24 and 48 hours
post-infection than b/h PIV3/GFP2 or GFP3. However, the final peak
titers obtained were similar for all three viruses. The kinetics of
replication for b/h PIV3/GFP2 and GFP3 were nearly identical (FIG.
7C). Interestingly, the altered ratios of viral mRNAs did not
appear to effect virus replication significantly.
10. EXAMPLE 5
Construction and Cloning of Chimeric Bovine Parainfluenza 3/Human
Parainfluenza 3 Vectored Respiratory Syncytial Virus F with
Different Intergenic Regions
[0388] Three different constructs were used to determine the effect
of intergenic region (nucleotides between each mRNA, e.g.,
nucleotides between the F gene and the N gene) on protein
expression and viral replication. See FIG. 8. The first construct
was b/h PIV3 vectored RSV F1* N-N in position 1, which bad a
shorter bPIV N gene stop/N gene start sequence (RSV F1* N-N in FIG.
4); the second construct was b/h PIV3 vectored RSV F at position 1
(RSV F2 in FIG. 4); and the last one was b/h PIV3 vectored RSV at
position 1 (RSV F1 in FIG. 4). All three constructs were generated
according to the cloning strategies described in section 7, Example
2.
[0389] The most dramatic difference between the two cassettes is
the distance between the N gene start sequence and the N
translation start codon in b/h PIV3/RSV F1*N-N which was only 10
nts long. In contrast, this distance is 86 nts long in b/h PIV3/RSV
F2. The other difference is the use of the N gene start sequence in
b/h PIV3/RSV F1*N-N rather than the P gene start sequence as was
done in b/h PIV3/RSV F2. In order to determine whether the distance
between the transcription gene start and the translation start of a
viral transcription unit has an effect on virus replication, the
b/h PIV3/RSV F1 construct was generated that contained the
identical RSV F gene cassette as was used for b/h PIV3/RSV F2.
11. EXAMPLE 6
The Length and/or Nature of the Intergenic Region Downstream of the
Respiratory Syncytial Virus Gene has an Effect on Virus
Replication
[0390] The three constructs in Example 5 were used in the following
experiments to determine the effects of the intergenic region on
viral protein expression and viral replication. See FIG. 9.
[0391] First, RSV F protein expression for b/h PIV3/RSV F1, b/h
PIV3/RSV F1*N-N, and b/h PIV3/RSV F2 was compared at 24 and 48 hrs
post-infection at an MOI of 0.1 in Vero cells using Western blots.
Western blots were performed as follows: Chimeric viruses were used
to infect (70-80%) subconfluent Vero cells at a MOI of 0.1.
Twenty-four hours and forty-eight hours post infection the media
overlay was removed and infected monolayers were washed once with 1
ml of PBS. The cells were subsequently lysed in 400 ml of Laemmli
buffer (Bio-Rad) containing 0.05% b-Mercaptoethanol (Sigma). 15 ml
of each sample was separated on 12% Tris-HCl Ready Gel (Bio-Rad)
and transferred to nylon membranes using a semi-dry transfer cell
(Bio-Rad). Nylon membranes were rinsed in PBS (pH 7.6) containing
0.5% (v/v) Tween-20 (Sigma) (PBST) and blocked with PBST containing
5% (w/v) dry milk (PBST-M) for 20-30 minutes at room temperature.
Membranes were incubated with either a mixture of RSV F monoclonal
antibodies (WHO 1269, 1200, 1153, 1112, 1243, 1107) at a 1:1000
dilution in PBST-M in PBST-M for 1 hour at room temperature.
Following 4 washes with PBST, the membranes were incubated with a
secondary horseradish peroxidase-conjugated goat anti-mouse
antibody (Dako) at a 1:2000 dilution in PBST-M for 1 hour at room
temperature. Membranes were washed 4 times with PBST and developed
using a chemiluminescence substrate (Amersham Pharmacia) and
exposed to Biomax Light Film (Kodak) for visualization of protein
bands.
[0392] b/h PIV3/RSV F1 expressed RSV F.sub.1 protein levels at 24
and 48 hrs post-infection close to the levels observed for b/h
PIV3/RSV F2 but much higher than those of b/h PIV3/RSV F1*N-N.
Therefore, the spacing between the gene start element and the
translation start codon may be critical for virus replication. The
N gene start sequences were changed to P gene start sequences,
however this change only incurred the alteration of a single
nucleotide. Either of these factors may be responsible for rescuing
the RSV F protein expression phenotype.
[0393] Next, multicycle growth curves were carried out to compare
the kinetics of virus replication of b/h PIV3/RSV F1, b/h PIV3/RSV
F1*N-N, and b/h PIV3/RSV F2 in Vero cells at an MOI of 0.1 (see
FIG. 9B), which was performed as follows: Vero cells were grown to
90% confluence and infected at an MOI of 0.1 with b/h PIV3, b/h
PIV3/RSV F1*N-N, b/h PIV3/RSV F1, and b/h PIV3/RSV F2. The infected
monolayers were incubated at 37.degree. C. At 0, 24, 48, 72, and 96
hours post-infection, cells and media were harvested together and
stored at -70.degree. C. Virus titers for each time point harvest
were determined by plaque assays in Vero cells. The plaque assays
were immunostained with RSV polyclonal antisera for quantification
after 5 days of incubation.
[0394] As was shown on FIG. 9B, the onset of replication of b/h
PIV3/RSV F1*N-N was delayed and peak titers were lower than those
of b/h PIV3/RSV F2, In contrast, b/h PIV3/RSV F1 displayed a growth
curve that was nearly identical to that observed for b/h PIV3/RSV
F2.
12. EXAMPLE 7
Cloning of Trivalent Bovine Parainfluenza 3/Human Parainfluenza 3
Vectored Constructs
[0395] The following examples relate to the generation of trivalent
vaccines that harbor the surface glycoproteins (F and HN) of hPIV3,
RSV F, and hMPV F to protect children from disease caused by RSV,
hMPV and hPIV3 using a single live attenuated virus vaccine. These
trivalent viruses were recovered by reverse genetics.
[0396] The construction of two virus genomes, each comprising a
chimeric b/h PIV3 backbone with two additional heterologous
sequence insertions, wherein one heterologous nucleotide sequence
is derived from a metapneumovirus F gene and another heterologous
nucleotide sequence is derived from a respiratory syncytial virus F
gene, were done as follows (see FIG. 10): plasmids b/h PIV3/RSV F2
or b/h PIV3/hMPV F2 was digested with SphI and NheI, and a 6.5 kb
fragment was isolated. The full-length cDNA for b/h PIV3 RSV F1 or
b/h PIV3/hMPV F1 was digested with SphI and NheI and a 14.8 kb DNA
fragment was isolated and ligated with the 6.5 kb DNA fragment
derived from plasmid b/h PIV3/RSV F2 or b/h PIV3/hMPV F2 to
generate full-length viral cDNAs.
[0397] Virus with the above described constructs has been amplified
in Vero cells. The engineered virus as described herein can be used
as a trivalent vaccine against the parainfluenza virus infection,
metapneumovirus infection, and the respiratory syncytial virus
infection.
13. EXAMPLE 8
Cloning of Two Respiratory Syncytial Virus F to the Bovine
Parainfluenza 3/Human Parainfluenza 3 Vector
[0398] Chimeric viruses that carry two copies of the RSV F gene
were designed in order to determine whether more RSV protein
produced by the chimeric virus will result in an improved
immunogenicity. This virus was rescued by reverse genetics,
biologically cloned and amplified in Vero cells to yield a virus
stock with a titer of 1.times.10.sup.6 pfu/ml. This virus, b/h
PIV3/RSV F1F2, can be used to assess for virus growth kinetics, for
RSV F protein production, and for replication and immunogenicity in
hamsters.
[0399] The constructs were generated in the following manner (see
FIG. 11): the 1-5 RSV F2 plasmid was digested with SphI and NheI,
and a 6.5 kb fragment was isolated. The full-length cDNA for b/h
PIV3 RSV F1 was digested with SphI and NheI and a 14.8 kb DNA
fragment was isolated and ligated with the 6.5 kb DNA fragment
derived from 1-5 bPIV3/RSV F2 to generate full-length viral
cDNAs.
14. EXAMPLE 9
Construction and Cloning of Bovine Parainfluenza 3/Human
Parainfluenza 3 Vectored Human Metapneumovirus F cDNA
[0400] The F gene of human metapneumovirus (hMPV) was inserted in
positions 1 and 2 of the b/h PIV3 genome (FIG. 12). The hMPV F gene
cassette harbored the bPIV3 N-P intergenic region. The hMPV F gene
plasmid (pRF515) was used, and a single nucleotide mutation in the
hMPV F gene was corrected (i.e., nucleotide 3352 was corrected from
C to T (wild type)), generating pRF515-M4. The bPIV3 N-P intergenic
region was added at the 3' end of the hMPV F gene using overlapping
PCR. For hMPV F, the overlapping PCR oligo was
5'GGCTTCATACCACATAATTAGAAAAATAGCA CCTAATCATGTTCTTACAATGGTCGACC 3'.
During this cloning step, oligos were used at the 5' end
(5'GCAGCCTAGGCCGCAATAACAATGTCTTGGAAAGTGGTG ATC 3') and at the 3'
end of the hMPV F gene cassette (5'CTACCTAGGTGAATCTT TGGT TG 3') in
the PCR reaction that contained AvrII restriction enzyme sites. The
hMPV F gene cassette was adjusted to conform to the rule of six
using QuickChange mutagenesis kit and the following oligos
(5'CCTAGGCCGCAATAGACAATGT CTTGG 3', 5'CCAAGACATT GTCTATTGCGGCCTAGG
3'). Full-length b/h PIV3/hMPV F1 (position 1) and F2 (position 2)
cDNA plasmids were generated in the same fashion as described in
section 9, Example 4, supra, for b/h PIV3/eGFP1 and eGFP2.
15. EXAMPLE 10
Immunoprecipitation and Replication Assays of Bovine Parainfluenza
3/Human Parainfluenza 3 Vectored Human Metapneumovirus F
[0401] To confirm that the F protein was expressed in the b/h PIV3
vectored human metapneumovirus F at position 2 (hMPV F2), guinea
pig or human antiserum were used to immunoprecipitate the hMPV F
protein (see FIG. 13A). For immunoprecipitation of the hMPV F
protein expressed by b/h PIV3, Vero cells were infected with b/h
PIV3 or b/h PIV3/hMPV F2 at an MOI of 0.1 or 0.05. Twenty-four
hours post-infection, the cells were washed once with DME without
cysteine and minus methionine (ICN) and incubated in the same media
for 30 min. The media was removed and 0.5 ml DME lacking cysteine
and methionine containing 100 .mu.Ci of [.sup.35S]-Pro=Mix.
(Amersham) was added to the cells. The infected cells were
incubated in the presence of .sup.35S-isotopes for 5 hours at
37.degree. C. Media was removed and the infected cells were lysed
in 0.3 M RIPA buffer containing protease inhibitors. The cell
lysate was incubated with hMPV guinea pig or human polyclonal
antisera and bound to IgG-agarose (Sigma). After washing three
times with 0.5 M RIPA buffer, the samples were fractionated on a
10% protein gel. The gel was dried and exposed to X-ray film.
[0402] The expression of hMPV F protein by b/h PIV3/hMPV F2 was
shown by immunoprecipitation using the gp and human anti-hMPV
antisera (FIG. 13A). Interestingly, a specific band migrating at
approximately 80 kDa was observed in the lysates of b/h PIV3/hMPV
F2. This size corresponded to the F precursor protein, F.sub.0.
Non-specific bands of different sizes were also observed in the b/h
PIV3 and mock control lanes (FIG. 13). This data suggested that the
b/h PIV3/hMPV F2 expressed the hMPV F protein. However, the hMPV
antibody reagents available are limited and these antisera interact
only with the precursor of the hMPV F protein. It could also be
possible that the cleaved F1 is unstable and thus not easily
visualized using this method.
[0403] Growth curves were performed to determine the kinetics of
virus replication of b/h PIV3/hMPV F2 and compare them to those
observed for b/h PIV3 and b/h PIV3/RSV F2 in Vero cells at an MOI
of 0.1 (FIG. 13B). The data showed that b/h PIV3/hMPV F2 displayed
a delayed onset of replication at 24 hours post-infection compared
to b/h PIV3/RSV F2. However, at 48 hours post-infection and beyond,
a difference in replication was no longer observed.
[0404] Growth curves were also performed to determine the kinetics
of viral replication of b/h PIV3/hMPV F1 and compare them to those
observed for b/h PIV3/hMPV F2 and b/h PIV3 in Vero cells at an MOI
of 0.01 (FIG. 13C). The data showed that b/h PIV/hMPV F1 had a
delayed onset of replication and yields lower peak titers compared
to b/h PIV3/hMPV F2 or b/h PIV3. The plaque size of b/h hMPV F1 is
also smaller compared to b/h hMPV F2.
[0405] The chimeric viruses, b/h PIV3/hMPV F1 and F2 were also
assessed for their ability to infect and replicate in Syrian Golden
hamsters (Table 5). The results showed that b/h PIV3/hMPV F1 and F2
replicated in the nasal turbinates and lungs of hamsters to levels
observed for b/h PIV3. Even hMPV replicated to titers of 5.3 and
3.6 log.sub.10 TCID.sub.50/g tissue in the upper and lower
respiratory tracts of hamsters. These data showed that b/h
PIV3/hMPV F1 and F2 could efficiently infect and replicate in the
respiratory tract of hamsters, demonstrating thereby that hamsters
represent a suitable small animal model to determine immunogenicity
of hMPV as well as utilize this animal model to evaluate hMPV
vaccine candidates.
TABLE-US-00005 TABLE 5 Replication of b/h PIV3 Expressing the hMPV
F Protein in Positions 1 or 2 in Hamsters Mean virus titer on day 4
post-infection (log.sub.10TCID.sub.50/g tissue .+-. S.E.).sup.b
Virus.sup.a Nasal turbinates Lungs b/h PIV3 4.8 .+-. 0.2 5.6 .+-.
0.6 b/h hMPV F1 5.3 .+-. 0.5 5.7 .+-. 0.4 b/h hMPV F2 5.7 .+-. 0.5
4.6 .+-. 0.3 hMPV 5.3 .+-. 0.1 3.6 .+-. 0.3 .sup.aGroups of six
hamster were inoculated intranasally with 1 .times. 10.sup.6 pfu of
indicated virus. .sup.bStandard error Note: TCID.sub.50 assays were
read for CPE on Day 10.
16. EXAMPLE 11
Cloning of the Soluble Respiratory Syncytial Virus F Gene
Construct
[0406] A construct containing a single copy of the soluble RSV F
gene, a version of the RSV F gene lacking the transmembrane and
cytosolic domains, was also generated (FIG. 14). This construct can
be used to test for immunogenicity. Its advantage would be the
inability of the soluble RSV F to be incorporated into the virion
membrane. Therefore this virus may be viewed as a safer chimeric
virus since its virus tropism is not expected to change. The cDNA
plasmid for b/h PIV3/sol RSV F can be rescued by reverse
genetics.
[0407] The plasmid 1-5/RSV F2 (described previously) was used as a
DNA template for PCR. The oligo RSV f.2 (5'GCTGTAACAGAATTGCAGTTGC
3') (which anneals at nt 5946 of RSV) and the oligo
5'CGTGGTCGACCATTGTAAGAACATGATTAGGTGCTAT
TTTTATTTAATTTGTGGTGGATTTACCGGC3' were employed to remove the
transmembrane and cytoplasmic domains of RSV F, deleting 150
nucleotides. The resulting PCR fragment was digested with HpaI and
SalI and introduced into 1-5 RSV F2 treated with HpaI and SalI to
yield 1-5 bPIV3/sol RSV F. This plasmid was digested with SphI and
NheI and the resulting fragment was introduced into a b/h PIV3 cDNA
digested with SpbI and NheI to generate a full-length cDNA.
17. EXAMPLE 12
Expression of Human Metapneumovirus F In Cells Infected with Bovine
Parainfluenza 3/Human Parainfluenza 3 Vectored Human
Metapneumovirus F
[0408] The b/h 104 hMPV F virus stocks were serially diluted 10
fold and used to infect subconfluent Vero cells. Infected cells
were overlayed with optiMEM media containing gentamycin and
incubated at 35.degree. C. for 5 days. Cells were fixed with 100%
methanol and immunostained with 1:1000 dilution of anti-hMPV001
guinea pig sera followed by 1:1000 dilution of anti-guinea pig HRP
conjugated antibodies. Expression of hMPV F is visualized by
specific color development in the presence of the AEC substrate
system (DAKO corporation). See FIG. 15A.
[0409] The b/h NP-P hMPV F virus stocks were serially diluted 10
fold and used to infect subconfluent Vero cells. Infected cells
were overlayed with 1% methyl cellulose in EMEM/L-15 medium (JRH
Biosciences; Lenexa, Kans.) supplemented with 1.times.L15-MEM media
containing penicillin/streptomycin, L-glutamine and fetal bovine
serum. Infected cells were incubated at 35.degree. C. for 5 days,
fixed with 100% methanol and immunostained with 1:1000 dilution of
anti-hMPV001 guinea pig sera followed by 1:1000 dilution of
anti-guinea pig HRP conjugated antibodies. (See FIG. 15B). The anti
hMPV001 guinea pig serum is specific for hMPV001 proteins and do
not bind to b/h PIV3 proteins.
18. EXAMPLE 13
Rescue of Chimeric Bovine Parainfluenza Type 3/Human Parainfluenza
Type 3 Virus in Hela Cells and Vero Cells
[0410] Rescue of the chimeric b/h PIV3 virus was done using a
similar procedure as for bPIV3 rescue. Rescue of b/h PIV3 chimeric
virus by reverse genetics was carried out in HeLa cells using
LipofecTACE (Gibco/BRL). The 80% confluent HeLa cells, Hep-2 cells,
or Vero cells were infected with MVA at an MOI of 4. One hour
post-infection, the full-length anti-genomic b/h PIV3 cDNA (4
.mu.g) was transfected into the infected HeLa or Vero cells
together with the NP (0.4 .mu.g), P (0.4 .mu.g), and L/pCITE (0.2
.mu.g) expression plasmids. Forty hours post-transfection, the
cells and the cell supernatant were harvested (P0) and subjected to
a single freeze-thaw cycle. The resulting cell lysate was then used
to infect a fresh Vero cell monolayer in the presence of
1-beta-D-arabinofuranosylcytosine (ara C), a replication inhibitor
of vaccinia virus, to generate a P1 virus stock. The supernatant
and cells from these plates were harvested, freeze-thawed once and
the presence of bPIV3 virus particles was assayed for by
immunostaining of virus plaques using PIV3-specific antiserum. The
cell lysates of the P1 harvest resulted in complete CPE of the Vero
cell monolayers and immunostaining indicated the presence of an
extensive virus infection.
19. EXAMPLE 14
Rescue of Bovine Parainfluenza Type 3/Human Parainfluenza Type 3
Vectored Human Metapneumovirus F Viruses
[0411] The b/h PIV3 viruses expressing hMPV F at position one (b/h
104 hMPV F) or position two (b/h NP-P hMPV F) were obtained as
follows. HEp-2 or Vero cells at 80-90% confluency in 6 well dishes
were infected with Fowlpox-T7 at a multiplicity of infection
(m.o.i) of 0.1 to 0.3. Following infection with Fowlpox-T7, cells
were washed once with PBS and transfected with the following
amounts of plasmid DNA: full length b/h 104 hMPV F or b/h NP-P hMPV
F cDNA 2.0 .mu.g, pCite N 0.4 .mu.g, pCite P 0.4 .mu.g, pCite L 0.2
.mu.g. (The pCite plasmids have a T7 promoter followed by the IRES
element derived from the encephalomyocarditis virus (EMCV)).
Transfection was performed in the presence of Lipofectamine 2000
(Invitrogen) according to manufacturer's instruction. The
transfection reaction was incubated at 33.degree. C. for 5 to 12
hours following which the media containing lipofectamine 2000 was
replaced with 2 ml of fresh OptiMEM containing gentamicin. The
transfected cells were further incubated at 33.degree. C. for two
days. Cells were stabilized with SPG and lyzed by one freeze-thaw
cycle at -80.degree. C. The crude cell lysate was used to infect a
new Vero monolayer in order to amplify rescued viruses.
20. EXAMPLE 15
Rescue of Bovine Parainfluenza Type 3/Human Parainfluenza Type 3
Vectored Respiratory Syncytial Virus Genes by Reverse Genetics
[0412] Infectious virus was recovered by reverse genetics in HeLa
or HEp-2 cells using transfection methods described previously (see
Example 13). Briefly, HEp-2 or Vero cells at 80-90% confluency in 6
well tissue culture dishes were infected with FP-T7 or MVA-T7 at a
multiplicity of infection (m.o.i.) of 0.1-0.3 or 1-5 respectively.
Following infection with FP-T7 or MVA-T7, cells were washed once
with PBS and transfected with the following amounts of plasmid DNA
(2.0 .mu.g full-length b/h PIV3 RSV F or G cDNA, 0.4 .mu.g pCITE/N,
0.4 .mu.g pCITE/P, 0.2 .mu.g pCITE/L). Transfections were performed
in the presence of Lipofectamine2000 (Invitrogen) according to
manufacturer's instruction. The transfection reactions were
incubated at 33.degree. C. for 5 to 12 hours following which the
media containing Lipofectamine 2000 was replaced with 2 ml of fresh
OptiMEM containing gentamicin. The transfected cells were incubated
further at 33.degree. C. for two days. Cells were stabilized with
SPG and lysed with one freeze-thaw cycle at -80.degree. C. The
crude cell lysate was used to infect a new Vero cell monolayer in
order to amplify rescued viruses. The chimeric viruses were
purified by limiting dilutions in Vero cells and high titer virus
stocks of 10.sup.6-10.sup.8 PFU/ml were generated. The RSV genes of
the chimeric viruses were isolated by RT-PCR and the sequences were
confirmed. Expression of the RSV proteins was confirmed by
immunostaining of infected Vero cell monolayers with RSV goat
polyclonal antiserum (Biogenesis).
21. EXAMPLE 16
Confirmation of Chimeric Bovine Parainfluenza Type 3/Human
Parainfluenza Type 3 Virus Rescue by RT-PCR
[0413] To ascertain that the rescued virus is chimeric in nature,
i.e. the virus contains hPIV3 F and HN gene sequences in a bPIV3
backbone, the viral RNA genome was analyzed further by RT-PCR. Vero
cells, infected with the P1 virus stock of three independently
derived isolates of b/h PIV3 were harvested and total RNA was
isolated. The viral RNA was amplified using an oligo that anneals
at position 4757 of bPIV3. A viral region from nt 5255 to 6255 was
amplified by PCR. The resulting 1 kb PCR fragment should contain
hPIV3 sequences. This was confirmed by digestion with enzymes (Sac1
and Bgl II) specific for hPIV3 and that do not cut in the
complementary region of bPIV3 (see FIG. 2). As expected, Sac1 and
Bgl II cut the PCR fragment into smaller fragments confirming that
the isolated sequences are derived from hPIV3 (see lanes 3, 5, 7).
In addition, a region in the polymerase L gene from nt 9075 to nt
10469 was amplified by PCR. This region should contain bPIV3
sequences. Again the resulting 1.4 kb PCR fragment was digested
using enzyme specific for bPIV3 (PvuII and BamH1H) that do not cut
in the equivalent region of hPIV3 (FIG. 3). The 1.4 kb fragment was
indeed digested by both PvuII and BamH1 confirming that the
polymerase gene is bPIV3 in origin (see lanes 3, 4, 6, 7, 9 and 10
of FIG. 3). In summary, the RT-PCR analysis shows that the rescued
b/h PIV3 virus is chimeric in nature. It contains hPIV3 F and HN
genes in a bPIV3 genetic backbone.
22. EXAMPLE 17
Genetic Stability of Bovine Parainfluenza Type 3/Human
Parainfluenza Type 3 Vectored Respiratory Syncytial Virus Genes
[0414] In order to demonstrate that the b/h PIV3/RSV chimeric
viruses are genetically stable and maintain the introduced RSV gene
cassettes, infected cell lysates were serially blind passaged ten
times in Vero cells. Sub-confluent Vero cells in T25 flasks were
infected with b/h PIV3/RSV at an MOI of 0.1 and incubated for 4
days at 33.degree. C. or until CPE was visible. At the end of the
incubation period the infected cells and media were harvested,
frozen and thawed two times, and the resulting cell lysate was used
to infect a new T25 flask of Vero cells. This cycle was repeated
ten times. All cell lysates from P1 to P10 were analyzed by plaque
assay and immunostaining with RSV polyclonal antisera for
expression of RSV proteins and virus titers. At passage 10, the RSV
gene cassettes were isolated by RT-PCR and the RSV gene sequences
were verified by DNA sequence analysis (to identify possible
nucleotide alterations). All of the isolates maintained the RSV
gene cassettes and RSV protein expression for the 10 passages
analyzed (data not shown):
23. EXAMPLE 18
Virion Fractionation of Bovine Parainfluenza Type 3/Human
Parainfluenza Type 3 Vectored Respiratory Syncytial Virus Genes on
Sucrose Gradients
[0415] The question of whether the RSV proteins were incorporated
into the b/h PIV3 virion was investigated further by use of a
biochemical assay. Vero cells were inoculated with each of the
chimeric b/h PIV3/RSV viruses at an MOI of 0.1. When maximum CPE
was visible, the infected monolayers were frozen, thawed, and spun
for 10 minutes at 2000 rpm. The clarified supernatants were spun
through a 20% sucrose cushion at 100,000.times.g for 90 minutes.
The pellet was then resuspended in PBS and layered gently on top of
a 20-66% sucrose gradient. The gradients were spun at
100,000.times.g for 20 hours to achieve equilibrium. Eighteen 2 ml
fractions were harvested starting from the top of the gradient. 0.4
ml of each fraction was removed for virus titer determination. Each
fraction was resuspended in 2 volumes of 20% PBS and concentrated
by spinning at 100,000.times.g for 1 hour. The pellet was then
resuspended in 0.05 ml Laemmli buffer (Biorad) and analyzed for RSV
and PIV3 proteins by Western blot, using an RSV F MAb (NuMax
L1FR-S28R), RSV (Biogenesis) and bPIV3 (VMRD) polyclonal antisera.
C-terminally truncated RSV F protein expressed in baculovirus that
was purified to homogeneity, was also analyzed on a sucrose
gradients.
[0416] The fractions were also analyzed for peak virus titers by
plaque assay. Control gradients of free RSV F (generated in
baculovirus and C-terminally truncated), RSV A2, and b/h PIV3 were
carried out initially. The majority of free RSV F was present in
fractions 3, 4, 5, and 6 in the top portion of the gradient (FIG.
16A). The biggest concentration of RSV virions was observed in
fractions 10, 11 and 12 (FIG. 16B). The RSV fractions were probed
with RSV polyclonal antiserum as well as with RSV F MAb. The
fractions that contained the greatest amounts of RSV virions also
showed the strongest signal for RSV F, suggesting that the RSV F
protein co-migrated and associated with RSV virions (FIG. 16B).
These fractions also displayed the highest virus titers (FIG. 16B).
The b/h PIV3 virions may be more pleiomorphic and thus the spread
of the peak fractions containing b/h PIV3 virions was more broad.
b/h PIV3 virions were present in fractions 9, 10, 11, 12, and 13
(FIG. 16C). Again the fractions harboring the most amounts of
virions, also displayed the highest virus titers by plaque assay
(FIG. 16C). Sucrose gradient fractions of b/h PIV3/RSV F2 were
analyzed with both a PIV3 polyclonal antiserum and an RSV F MAb
(FIG. 16D). The fractions containing most of the virions were
fractions 11, 12, 13, and 14 as was shown by western using the PIV3
antiserum. Correspondingly, these were also the fractions that
displayed the highest amounts of RSV F protein. However, some free
RSV F was also present in fractions 5 and 6. Fractions 11, 12, 13
and 14 displayed the peak virus titers (FIG. 16D). Similarly, the
fractions containing the most virions of b/h PIV3/RSV G2 (fractions
9, 10, 11, and 12) also showed the strongest signal for RSV G
protein (FIG. 16E). Again these were the fractions with the highest
virus titers (FIG. 16E). Collectively these data suggested that the
majority of the RSV F and G proteins co-migrated and associated
with the b/h PIV3 virions. However, some free RSV proteins were
also present in the top fractions of the gradients.
24. EXAMPLE 19
The Chimeric Bovine Parainfluenza Type 3/Human Parainfluenza Type 3
Vectored Respiratory Syncytial Virus (RSV) could not be Neutralized
with RSV Antisera
[0417] In order to address the important safety question of whether
the RSV surface glycoproteins incorporated into the b/h PIV3 virion
resulted in an altered virus tropism phenotype, neutralization
assays were carried out (Tables 6 and 7). RSV F MAbs (WHO 1200 MAb)
neutralized 50% of wildtype RSV A2 at a 1:2000 dilution (Table 6).
In contrast, even a dilution of 1:25 did not neutralize any of the
chimeric b/h PIV3/RSV. Similarly, a dilution of 1:400 of the
polyclonal RSV antiserum (Biogenesis) neutralized 50% of RSV A2,
but even a dilution of 1:15.6 did not neutralize b/hPIV3 RSV (Table
6).
TABLE-US-00006 TABLE 6 The b/h PIV3 RSV Chimeric Viruses are not
Neutralized by RSV Antibodies Reciprocal 50% Virus used
neutralizing in neutralization antibody dilution assay RSV F MAb
RSV Ab RSV 2000 400.0 b/h PIV3 <25 <15.6 b/h RSV F1*N--N
<25 <15.6 b/h RSV F2 <25 <15.6 b/h RSV G1 ND <15.6
b/h RSV G2 ND <15.6
[0418] hPIV3 F MAb C191/9 neutralized 50% of b/h PIV3 as well as
the b/h PIV3/RSV at a dilution of 1:500 (Table 7). An hPIV3 HN MAb
68/2 neutralized b/h PIV3 at a dilution of 1:16,000, and the b/h
PIV3/RSV at a dilution of 1:32,000 (Table 7).
TABLE-US-00007 TABLE 7 The b/h PIV3 RSV Chimeric Viruses are
Neutralized by hPIV3 Mabs Virus used Reciprocal 50% in
neutralization neutralizing antibody dilution assay hPIV3 F MAb
hPIV3 HN MAb RSV 62.5 <500 b/h PIV3 500 16000 b/h RSV F1*N--N
500 32000 b/h RSV F2 500 32000 b/h RSV G1 ND.sup.d 32000 b/h RSV G2
ND 32000 .sup.dnot determined.
25. EXAMPLE 20
The Chimeric Bovine PIV Demonstrate Attenuated Phenotypes and
Elicit Strong Protective Responses when Administered In Vivo
[0419] Five week old Syrian Golden hamsters were infected with
5.times.10.sup.5 pfu of wildtype bPIV3, recombinant bPIV3, hPIV3,
human/bovine PIV3, and placebo. The five different animal groups
were kept separate in micro-isolator cages. Four days
post-infection, the animals were sacrificed. The nasal turbinates
and lungs of the animals were homogenized and stored at -80.degree.
C. Virus present in the tissues was determined by TCID.sub.50
assays in MDBK cells at 37.degree. C. Virus infection was confirmed
by hemabsorption with guinea pig red blood cells. Table 8 shows the
replication titers of the different PIV3 strains in hamsters in the
lungs and nasal turbinates. Note that recombinant bPIV3 and the b/h
PIV3 chimeric viruses are attenuated in the lungs of the
hamsters:
TABLE-US-00008 TABLE 8 Replication of PIV3 Viruses in Syrian Golden
Hamsters in the Nasal Turbinates and Lungs. Replication of bPIV3,
r-bPIV3, r-bPIV3(1), hPIV3 and Bovine/Human PIV3(1) in the Upper
and Lower Respiratory Tract of Hamsters Mean virus titer on day 4
postinfection (log.sub.10 TCID.sub.50/g tissue = S.E.).sup.b
Virus.sup.a Nasal turbinates Lungs bPIV3 5.3 .+-. 0.3 5.3 .+-. 0.2
r-bPIV3 5.0 .+-. 0.3 3.5 .+-. 0.2 r-bPIV3(1) 5.5 .+-. 0.2 5.4 .+-.
0.2 hPIV3 4.9 .+-. 0.2 5.4 .+-. 0.2 Bovine/human PIV3(1) 4.9 .+-.
0.2 4.5 .+-. 0.2 .sup.aGroups of four hamsters were inoculated
intranasally with 5 .times. 10.sup.5 PFU of indicated virus.
.sup.bStandard error.
[0420] Furthermore, serum samples collected from the hamsters prior
to infection and at day 21 post-infection were analyzed in a
hemagglutination inhibition assay. The serum samples were treated
with receptor destroying enzyme (RDE, DENKA Seiken Co.) and
non-specific agglutinins were removed by incubation with guinea pig
red blood cells for 1 hour on ice. Wildtype bPIV3 and hPIV3 were
added to two-fold serially diluted hamster serum samples. Finally,
guinea pig red blood cells (0.5%) were added, and hemagglutination
was allowed to occur at room temperature. Table 9 shows the
antibody response generated in the hamsters upon being infected
with the different PIV3 strains. Note that the b/h PIV3 chimeric
virus generates as strong an antibody response against hPIV3 as
does wild type hPIV3, far exceeding the response generated by the
recombinant or wildtype bPIV3:
TABLE-US-00009 TABLE 9 Hemaglutination Inhibition Assay Using Serum
from Hamsters Infected with Different PIV3 Viruses. Hamster Virus
Used for Serum Titers for Inoculation of the Hamsters wt bPIV3
HPIV3 Recombinant bPIV3 1:16 1:16 Wt bPIV3 1:16 1:8 Wt hPIV3 1:4
1:128 b/h PIV3 chimeric virus 1:8 1:128 Placebo <1:4 <1.4
[0421] These results demonstrate the properties of b/h PIV3
chimeric viruses of the present invention which make these
recombinants suitable for use in vaccine formulations. Not only do
the b/h PIV3 chimeric viruses demonstrate an attenuated phenotype
when administered in vivo, but they also generate as strong an
antibody response as the wildtype hPIV3. Thus, because the chimeric
viruses of the present invention have a unique combination of
having an attenuated phenotype and eliciting as strong an immune
response as a wildtype hPIV, these chimeric viruses have the
characteristics necessary for successful use in humans to inhibit
and/or protect against infection with PIV.
26. EXAMPLE 21
Replication of Bovine Parainfluenza 3/Human Parainfluenza 3
Vectored Respiratory Syncytial Virus G or F Protein in the Upper
and Lower Respiratory Tract of Hamsters
[0422] Five week old Syrian Golden hamsters (six animals per group)
were infected intranasally with 1.times.10.sup.6 pfu or
1.times.10.sup.4 PFU of b/h PIV3, b/h PIV3/RSV, RSV A2, or placebo
medium in a 100 ml volume. The different groups were maintained
separately in micro-isolator cages. Four days post-infection, the
nasal turbinates and lungs of the animals were harvested,
homogenized and stored at -70.degree. C. The titers of virus
present in the tissues were determined by TCID.sub.5. assays in
Vero cells. For the challenge assays, the animals were inoculated
on day 28 intranasally with 1.times.10.sup.6 pfu/ml of hPIV3 or RSV
A2. Four days post-challenge, the nasal turbinates and lungs of the
animals were isolated and assayed for challenge virus replication
by plaque assays on Vero cells that were immunostained for
quantification. Table 10 shows the replication titers of the
different strains in hamsters in the lungs and nasal
turbinates.
TABLE-US-00010 TABLE 10 Replication of bovine/human PIV3 Expressing
the RSV G or F proteins in the Upper and Lower Respiratory Tract of
Hamsters. Mean virus titer on day 4 postinfection (log.sub.10
TCID.sub.50/g tissue = S.E.).sup.b Virus.sup.a Nasal turbinates
Lungs b/h PIV3 4.8 .+-. 0.4 4.4 .+-. 0.3 RSV A2 3.4 .+-. 0.5 3.3
.+-. 0.5 b/h RSV G1 4.2 .+-. 0.7 2.9 .+-. 0.7 b/h RSV F1 3.9 .+-.
0.4 2.7 .+-. 0.2 b/h RSV F1 N--P 4.6 .+-. 0.4 3.5 .+-. 0.2 b/h RSV
G2 4.2 .+-. 0.9 4.3 .+-. 0.2 b/h RSV F2 4.6 .+-. 0.6 4.4 .+-. 0.5
.sup.aGroups of four hamsters were inoculated intranaselly with 5
.times. 10.sup.6 PFU of indicated virus. .sup.bStandard error.
[0423] Syrian Golden hamsters represent a suitable small animal
model to evaluate replication and immunogenicity of recombinant
bPIV3 and hPIV3 genetically engineered viruses. It was expected
that the introduction of the RSV antigens would not alter the
ability of the chimeric b/h PIV3 to replicate in hamsters. The
results showed that all of the chimeric viruses replicated to
levels similar to those of b/h PIV3 in the nasal turbinates of
hamsters (Table 10). In contrast, the chimeric viruses harboring
the RSV genes in the first position displayed 1-1.5 log.sub.10
reduced titers in the lungs of hamsters compared to b/h PIV3 (Table
10). The chimeric viruses containing the RSV genes in the second
position replicated to similar titers observed for b/h PIV3 in the
lower respiratory tract of hamsters (Table 10).
27. EXAMPLE 22
Bovine Parainfluenza 3/Human Parainfluenza 3 Vectored Respiratory
Syncytial Virus Immunized Hamsters were Protected Upon Challenge
with Human Parainfluenza 3 and Respiratory Syncytial Virus A2
[0424] On Day 28 post-immunization, the hamsters were challenged
with 1.times.10.sup.6 PFU of either RSV A2 or hPIV3 to evaluate the
immunogenicity induced by the b/h PIV3/RSV. Animals that received
the b/h PIV3/RSV were protected completely from RSV as well as
hPIV3 (Table 11). Only the animals that were administered the
placebo medium displayed high titers of challenge virus in the
lower and upper respiratory tracts. This assay also showed that
animals immunized with RSV, were not protected from challenge with
hPIV3. Similarly, animals vaccinated with hPIV3 displayed high
titers of the RSV challenge virus (Table 11).
TABLE-US-00011 TABLE 11 b/h PIV3/RSV Immunized Hamsters were
Protected Upon Challenge with hPIV3 and RSV A2 hPIV3 RSV A2 Mean
Virus Titer on Mean Virus Titer on Day 4 Day 4 Post- Post-challenge
challenge (log.sub.10TCID.sub.50/g (log.sub.10 pfu/g tissue .+-.
Challenge tissue .+-. S.E.).sup.b.c S.E.).sup.b Virus: Nasal Nasal
Immunizing Virus.sup.a turbinates Lungs Turbinates Lungs b/h PIV3
<1.2 .+-. 0.0 <1.0 .+-. 0.1 ND ND b/h RSV G1 <1.2 .+-. 0.1
<1.1 .+-. 0.1 <1.0 .+-. 0.3 <0.7 .+-. 0.1 b/h RSV F1
<1.2 .+-. 0.2 <1.0 .+-. 0.0 <1.1 .+-. 0.5 <0.6 .+-. 0.0
b/h RSV F1 NP--P <1.0 .+-. 0.0 <1.0 .+-. 0.0 <0.8 .+-. 0.1
<0.5 .+-. 0.0 b/h RSV G2 <1.2 .+-. 0.2 <1.1 .+-. 0.2
<0.8 .+-. 0.1 <0.8 .+-. 0.3 b/h RSV F2 <1.2 .+-. 0.1
<1.0 .+-. 0.1 <1.3 .+-. 0.6 <1.6 .+-. 1.0 RSV A2 4.5 .+-.
0.6 4.8 .+-. 0.6 <0.6 .+-. 0.2 <0.6 .+-. 0.1 Placebo 4.4 .+-.
0.1 4.1 .+-. 0.1 3.6 .+-. 0.8 3.1 .+-. 0.7 .sup.aVirus used to
immunize groups of six hamsters on day 0. .sup.bOn day 28, the
hamsters were challenged with 10.sup.6 pfu of hPIV3 or RSV A2. Four
days post-challenge, the lungs and nasal turbinates of the animals
were harvested. .sup.cStandard error.
28. EXAMPLE 23
Vaccination of Hamsters with Bovine Parainfluenza 3/Human
Parainfluenza 3 Vectored Respiratory Syncytial Virus Induces Serum
HAI and Neutralizing Antibodies
[0425] Prior to the challenge, serum samples were obtained on Day
28 from the immunized animals. The hamster sera were analyzed for
the presence or RSV neutralizing antibodies using a 50% plaque
reduction assay, and for PIV3 HAI serum antibodies by carrying out
hemagglutination inhibition (HAI) assays (Table 8). 50% plaque
reduction assay (neutralization assay) was carried out as follows:
the hamster sera were two-fold serially diluted, and incubated with
100 PFU of RSV A2 for one hour. Then the virus-serum mixtures were
transferred to Vero cell monolayers and overlaid with
methylcellulose. After 5 days of incubation at 35.degree. C., the
monolayers were immunostained using RSV polyclonal antiserum for
quantification. Hemagglutination-inhibition (HAI) assays were
performed by incubating serial two-fold dilutions of Day 28 hamster
sera at 25.degree. C. for 30 min with hPIV3 in V-bottom 96-well
plates. Subsequently, guinea pig erythrocytes were added to each
well, incubation was continued for an additional 90 min, and the
presence or absence of hemagglutination in each well was
recorded.
[0426] The results showed that the viruses expressing the RSV F
protein displayed RSV neutralizing antibody titers nearly as high
as those observed with serum obtained from animals vaccinated with
wildtype RSV (Table 12). In contrast, the viruses expressing the
RSV G protein showed much lower levels of RSV neutralizing
antibodies (Table 12). All of the chimeric b/h PIV3/RSV hamster
sera showed levels of HAI serum antibodies that were close to the
levels observed for b/h PIV3 (Table 12). The results showed that
the chimeric b/h PIV3 can infect and replicate efficiently in
hamsters and elicit a protective immune response.
TABLE-US-00012 TABLE 12 Vaccination of Hamsters with b/h PIV3/RSV
Induces Serum HAI and Neutralizing Antibodies Neutralizing antibody
response to HAI antibody response RSV.sup.b,c (mean to hPIV3.sup.c
(mean reciprocal Virus.sup.a reciprocal log.sub.2 .+-. SE)
log.sub.2 .+-. SE) RSV 7.9 .+-. 1.00 ND b/h RSV F1* N--N 7.8 .+-.
0.85 6.6 .+-. 0.5 b/h RSV F1 5.5 .+-. 0.53 5.5 .+-. 0.5 b/h RSV G1
3.4 .+-. 0.50 6.6 .+-. 0.7 b/h RSV F2 6.9 .+-. 0.65 6.7 .+-. 0.8
b/h RSV G2 3.4 .+-. 0.50 5.2 .+-. 0.4 b/h PIV3 ND 7.2 .+-. 0.5
.sup.aViruses used to immunize hamsters. .sup.bThe neutralizing
antibody titers were determined by a 50% plaque reduction assay.
.sup.cThe neutralizing antibody titers of hamster pre-serum were
<1.0 and the HAI antibody titers were <4.0.
29. EXAMPLE 24
Vaccination Of Hamsters with Low Dose of Bovine Parainfluenza
3/Human Parainfluenza 3 Vectored Respiratory Syncytial Virus
Protected Hamsters from Challenge with Respiratory Syncytial Virus
A2, and Induces Serum HAI and Neutralizing Antibodies
[0427] In order to identify the best vaccine candidate, low dose
virus with different constructs (see Example 2) were used to
immunize hamsters. The results of the challenging experiments are
summarized in Table 13.
TABLE-US-00013 TABLE 13 b/h PIV3/RSV-Low Dose Immunized Hamsters
are Protected From Challenge with RSV A2 Replication Challenge with
RSV Mean Virus Titer A2 Mean Virus on Day 4 Titer on Day 4
Post-vaccination Post-challenge (log.sub.10TCID.sub.50/g
(log.sub.10 pfu/g tissue .+-. S.E.).sup.b,c tissue .+-. S.E.).sup.b
Nasal Nasal Immunizing Virus.sup.a turbinates Lungs Turbinates
Lungs b/h PIV3 4.9 .+-. 0.5 4.8 .+-. 1.0 ND ND b/h RSV G1 3.0 .+-.
0.8 3.1 .+-. 0.5 <0.9 .+-. 0.5 <0.7 .+-. 0.4 b/h RSV F1* N--N
3.4 .+-. 0.1 3.5 .+-. 0.1 <1.4 .+-. 0.7 <0.5 .+-. 0.0 b/h RSV
G2 4.1 .+-. 0.6 3.8 .+-. 0.4 <0.8 .+-. 0.0 <0.5 .+-. 0.1 b/h
RSV F2 5.2 .+-. 0.6 3.9 .+-. 0.4 <0.7 .+-. 0.1 <0.5 .+-. 0.1
RSV A2 2.8 .+-. 0.3 2.7 .+-. 0.6 <0.8 .+-. 0.1 <0.5 .+-. 0.0
Placebo ND.sup.d ND 3.0 .+-. 0.8 3.2 .+-. 0.9 .sup.aVirus used to
immunize groups of six hamsters on day 0 with a low dose of
10.sup.4 PFU/ml. .sup.bOn day 28, the hamsters were challenged with
10.sup.6 pfu of RSV A2. Four days post-challenge, the lungs and
nasal turbinates of the animals were harvested. .sup.cStandard
error. .sup.dnot determined.
[0428] Next, the neutralizing antibody titers were determined by a
50% plaque reduction assay (neutralization assay). Neutralization
assays were performed for b/h PIV3, b/h PIV3/RSV chimeric viruses
or RSV using Vero cells. Serial two-fold dilutions of RSV
polyclonal antiserum (Biogenesis; Poole, England), an RSV F MAb
(WHO 1200 MAb) obtained from Medimmune or hPIV3 F (C191/9) and HN
(68/2) MAbs, were incubated with approximately 100 PFU of either
b/h PIV3, b/h PIV3/RSV chimeric viruses or RSV in 0.5 ml OptiMEM at
RT for 60 min. Following the incubation, virus-serum mixtures were
transferred to Vero cell monolayers, incubated at 35.degree. C. for
1 hour, overlaid with 1% methyl cellulose in EMEM/L-15 medium (JRH
Biosciences; Lenexa, Kans.) and incubated at 35.degree. C. Six days
post-inoculation, the infected cell monolayers were immunostained.
Neutralization titers were expressed as the reciprocal of the
highest serum dilution that inhibited 50% of viral plaques.
Neutralization assays were also carried out for serum obtained on
Day 28 post-infection from hamsters immunized with b/h PIV3, b/h
PIV3/RSV chimeric viruses, or RSV A2. The hamster sera were
two-fold serially diluted, and incubated with 100 PFU of RSV A2 for
one hour. Then the virus-serum mixtures were transferred to Vero
cell monolayers and overlaid with methylcellulose. After 5 days of
incubation at 35.degree. C. the monolayers were immunostained using
RSV polyclonal antiserum for quantification. The neutralizing
antibody titers of hamster pre-serum were <1.0 and the HAI
antibody titers were <4.0. Hemagglutination-inhibition (HAI)
assays were performed by incubating serial two-fold dilutions of
Day 28 hamster sera at 25.degree. C. for 30 min with hPIV3 in
V-bottom 96-well plates. Subsequently, guinea pig erythrocytes were
added to each well, incubation was continued for an additional 90
min, and the presence or absence of hemagglutination in each well
was recorded. Table 14 summarizes the results:
TABLE-US-00014 TABLE 14 Vaccination of Hamsters with Lower Doses of
b/h PIV3/RSV Induces Serum HAI and Neutralizing Antibodies HAI
antibody response Neutralizing antibody to hPIV3.sup.c response to
RSV.sup.b,c (mean reciprocal Virus.sup.a (mean reciprocal log.sub.2
.+-. SE) log.sub.2 .+-. SE) RSV 6.5 .+-. 0.7 ND b/h RSV F1* N--N
2.5 .+-. 0.7 5.7 .+-. 0.6 b/h RSV G1 2.0 .+-. 0.0 6.0 .+-. 0.0 b/h
RSV F2 3.8 .+-. 1.5 6.7 .+-. 0.6 b/h RSV G2 3.8 .+-. 1.3 5.5 .+-.
0.6 b/h PIV3 ND 6.5 .+-. 0.7 .sup.aViruses used to immunize
hamsters at a low dose of 10.sup.4 pfu/ml. .sup.bThe neutralizing
antibody titers were determined by a 50% plaque reduction assay.
.sup.cThe neutralizing antibody titers of hamster pre-serum were
<1.0 and the HAI antibody titers were <4.0.
[0429] The restricted replication phenotype of the chimeric viruses
possessing RSV genes in the first position was exacerbated when the
inoculation dose was reduced to 1.times.10.sup.4 PFU per animal.
b/h PIV3/RSV F1 and G1 replicated in the upper respiratory tracts
of hamsters to titers that were reduced by 1.0-2.0 log.sub.10
compared to those of b/h PIV3 (Table 13). In contrast, b/h PIV3/RSV
with the RSV genes in position 2, replicated in the upper
respiratory tract to levels observed for b/h PIV3. Replication in
the lungs of hamsters was also more restricted for the b/h PIV3/RSV
harboring RSV genes in the first position (Table 13). In contrast,
b/h PIV3/RSV F2 still replicated to high titers of 10.sup.5.2 and
10.sup.3.9 in the nasal turbinates and lungs, respectively (Table
13). The vaccinated hamsters were challenged on Day 28 with
1.times.10.sup.6 pfu of RSV A2 (Table 13). Despite the low levels
of replication observed in the respiratory tracts of hamsters, the
animals were protected in both the lower and upper respiratory
tract from challenge with RSV (Table 13). The degree of protection
was as good as was observed for animals vaccinated with wt RSV.
Only the animals that received placebo medium showed high virus
titers in the nasal turbinates and lungs (Table 13). Serum was
collected from the immunized hamsters on Day 28, and analyzed for
the presence of RSV neutralizing and PIV3 HAI serum antibodies
(Table 14). An approximately 50% drop in RSV neutralizing antibody
titers was observed in sera obtained from hamsters immunized with
b/h PIV3/RSV as compared to the titers observed for wt RSV sera
(Table 14). But the sera obtained from animals that had received
b/h PIV3 harboring the RSV genes in position 2, still displayed
higher RSV neutralization antibody titers than was observed for
sera from b/h PIV3/RSV with the RSV genes in position 1. The PIV3
HAI serum antibody titers were also slightly reduced compared to
the b/h PIV3 sera (Table 14).
30. EXAMPLE 25
Bovine Parainfluenza 3/Human Parainfluenza 3 Vectored Human
Metapneumovirus F Immunized Hamsters were Protected Upon Challenge
with Human Parainfluenza Virus 3 or Human Metapneumovirus
NL/001
[0430] Five groups of Syrian Golden Hamsters (each group had six
hamsters) were immunized with b/h PIV3, b/h hMPV F1, b/h hMPV F2,
hMPV or placebo receptively. The five different animal groups were
kept separate in micro-isolator cages. On Day 28 post-immunization,
the hamsters were challenged with 1.times.10.sup.6 PFU of either
hPIV3 or hMPV (NL/001 strain) to evaluate the immunogenicity
induced by the b/h PIV3/hMPV F. Four days post-challenge, the
animals were sacrificed. The nasal turbinates and lungs of the
animals were homogenized and stored at -80.degree. C. Virus present
in the tissues was determined by TCID.sub.50 assays in MDBK cells
at 37.degree. C. Virus infection was confirmed by hemabsorption
with guinea pig red blood cells. Table 15 shows the replication
titers of the PIV3 strain and the MPV strain in hamsters in the
lungs and nasal turbinates.
TABLE-US-00015 TABLE 15 b/h PIV3/hMPV F-Immunized Hamsters were
Protected Upon Challenge with hPIV3 or hMPV/NL/001 hPIV3 hMPV Mean
virus titer Mean virus titer on day 4 post- on day 4 post-
challenge challenge (log.sub.10TCID.sub.50/g (log.sub.10 PFU/g
tissue .+-. S.E).sup.b tissue .+-. S.E).sup.b Challenge virus:
Nasal Nasal Immunizing virus.sup.a Turbinates Lungs Turbinates
Lungs b/h PIV3 <1.3 .+-. 0.2 <1.1 .+-. 0.1 ND b/h hMPV F1
<1.3 .+-. 0.1 <1.1 .+-. 0.1 3.5 .+-. 0.8 <0.5 .+-. 0.2 b/h
hMPV F2 <1.2 .+-. 0.1 <1.2 .+-. 0.1 <0.9 .+-. 0.4 <0.5
.+-. 0.1 hMPV ND <0.8 .+-. 0.3 <0.4 .+-. 0.0 Placebo 4.3 .+-.
0.3 4.5 .+-. 0.5 6.0 .+-. 0.3 4.5 .+-. 1.3 .sup.aVirus used to
immunize groups of six hamsters on day 0. .sup.bOn day 28, the
hamsters were challenged with 10.sup.6 pfu of hPIV3 or hMPV. Four
days post-challenge, the lungs and nasal turbinates of the animals
were harvested. ND = not determined.
[0431] The results showed that animals that received the b/h
PIV3/hMPV F2 (F at position two) were protected completely from
hMPV as well as hPIV3 (Table 15). However, b/h PIV3/hMPV F1(F at
position one) only reduced the titers of infected hMPV in the upper
respiratory tract (e.g., nasal turbinates) by 2.5 logs, while it
provided complete protection in the lower respiratory tract (e.g.,
the lung) from both hMPV and hPIV3 infection (Table 15). The
animals that were administered the placebo medium displayed high
titers of challenge virus in the lower and upper respiratory tracts
(Table 15).
[0432] The present invention is not to be limited in scope by the
specific described embodiments that are intended as single
illustrations of individual aspects of the invention, and any
constructs, viruses or enzymes that are functionally equivalent are
within the scope of this invention. Indeed, various modifications
of the invention in addition to those shown and described herein
will become apparent to those skilled in the art from the foregoing
description and accompanying drawings. Such modifications are
intended to fall within the scope of the appended claims.
[0433] Various publications are cited herein, the disclosures of
which are incorporated by reference in their entireties.
TABLE-US-00016 TABLE 16 LEGEND FOR SEQUENCE LISTING SEQ ID NO: 1
Human metapneumovirus isolate 00-1 matrix protein (M) and fusion
protein (F) genes SEQ ID NO: 2 Avian pneumovirus fusion protein
gene, partial cds SEQ ID NO: 3 Avian pneumovirus isolate 1b fusion
protein mRNA, complete cds SEQ ID NO: 4 Turkey rhinotracheitis
virus gene for fusion protein (F1 and F2 subunits), complete cds
SEQ ID NO: 5 Avian pneumovirus matrix protein (M) gene, partial cds
and Avian pneumovirus fusion glycoprotein (F) gene, complete cds
SEQ ID NO: 6 paramyxovirus F protein hRSV B SEQ ID NO: 7
paramyxovirus F protein hRSV A2 SEQ ID NO: 8 human metapneumovirus
01-71 (partial sequence) SEQ ID NO: 9 Human metapneumovirus isolate
00-1 matrix protein(M) and fusion protein (F) genes SEQ ID NO: 10
Avian pneumovirus fusion protein gene, partial cds SEQ ID NO: 11
Avian pneumovirus isolate 1b fusion protein mRNA, complete cds SEQ
ID NO: 12 Turkey rhinotracheitis virus gene for fusion protein (F1
and F2 subunits), complete cds SEQ ID NO: 13 Avian pneumovirus
fusion glycoprotein (F) gene, complete cds SEQ ID NO: 14 Turkey
rhinotracheitis virus (strain CVL14/1)attachment protien (G) mRNA,
complete cds SEQ ID NO: 15 Turkey rhinotracheitis virus (strain
6574)attachment protein (G), complete cds SEQ ID NO: 16 Turkey
rhinotracheitis virus (strain CVL14/1)attachment protein (G) mRNA,
complete cds SEQ ID NO: 17 Turkey rhinotracheitis virus (strain
6574)attachment protein (G), complete cds SEQ ID NO: 18 F protein
sequence for HMPV isolate NL/1/00 SEQ ID NO: 19 F protein sequence
for HMPV isolate NL/17/00 SEQ ID NO: 20 F protein sequence for HMPV
isolate NL/1/99 SEQ ID NO: 21 F protein sequence for HMPV isolate
NL/1/94 SEQ ID NO: 22 F-gene sequence for HMPV isolate NL/1/00 SEQ
ID NO: 23 F-gene sequence for HMPV isolate NL/17/00 SEQ ID NO: 24
F-gene sequence for HMPV isolate NL/1/99 SEQ ID NO: 25 F-gene
sequence for HMPV isolate NL/1/94 SEQ ID NO: 26 G protein sequence
for HMPV isolate NL/1/00 SEQ ID NO: 27 G protein sequence for HMPV
isolate NL/17/00 SEQ ID NO: 28 G protein sequence for HMPV isolate
NL/1/99 SEQ ID NO: 29 G protein sequence for HMPV isolate NL/1/94
SEQ ID NO: 30 G-gene sequence for HMPV isolate NL/1/00 SEQ ID NO:
31 G-gene sequence for HMPV isolate NL/17/00 SEQ ID NO: 32 G-gene
sequence for HMPV isolate NL/1/99 SEQ ID NO: 33 G-gene sequence for
HMPV isolate NL/1/94 SEQ ID NO: 34 L protein sequence for HMPV
isolate NL/1/00 SEQ ID NO: 35 L protein sequence for HMPV isolate
NL/17/00 SEQ ID NO: 36 L protein sequence for HMPV isolate NL/1/99
SEQ ID NO: 37 L protein sequence for HMPV isolate NL/1/94 SEQ ID
NO: 38 L-gene sequence for HMPV isolate NL/1/00 SEQ ID NO: 39
L-gene sequence for HMPV isolate NL/17/00 SEQ ID NO: 40 L-gene
sequence for HMPV isolate NL/1/99 SEQ ID NO: 41 L-gene sequence for
HMPV isolate NL/1/94 SEQ ID NO: 42 M2-1 protein sequence for HMPV
isolate NL/1/00 SEQ ID NO: 43 M2-1 protein sequence for HMPV
isolate NL/17/00 SEQ ID NO: 44 M2-1 protein sequence for HMPV
isolate NL/1/99 SEQ ID NO: 45 M2-1 protein sequence for HMPV
isolate NL/1/94 SEQ ID NO: 46 M2-1 gene sequence for HMPV isolate
NL/1/00 SEQ ID NO: 47 M2-1 gene sequence for HMPV isolate NL/17/00
SEQ ID NO: 48 M2-1 gene sequence for HMPV isolate NL/1/99 SEQ ID
NO: 49 M2-1 gene sequence for HMPV isolate NL/1/94 SEQ ID NO: 50
M2-2 protein sequence for HMPV isolate NL/1/00 SEQ ID NO: 51 M2-2
protein sequence for HMPV isolate NL/17/00 SEQ ID NO: 52 M2-2
protein sequence for HMPV isolate NL/1/99 SEQ ID NO: 53 M2-2
protein sequence for HMPV isolate NL/1/94 SEQ ID NO: 54 M2-2 gene
sequence for HMPV isolate NL/1/00 SEQ ID NO: 55 M2-2 gene sequence
for HMPV isolate NL/17/00 SEQ ID NO: 56 M2-2 gene sequence for HMPV
isolate NL/1/99 SEQ ID NO: 57 M2-2 gene sequence for HMPV isolate
NL/1/94 SEQ ID NO: 58 M2 gene sequence for HMPV isolate NL/1/00 SEQ
ID NO: 59 M2 gene sequence for HMPV isolate NL/17/00 SEQ ID NO: 60
M2 gene sequence for HMPV isolate NL/1/99 SEQ ID NO: 61 M2 gene
sequence for HMPV isolate NL/1/94 SEQ ID NO: 62 M protein sequence
for HMPV isolate NL/1/00 SEQ ID NO: 63 M protein sequence for HMPV
isolate NL/17/00 SEQ ID NO: 64 M protein sequence for HMPV isolate
NL/1/99 SEQ ID NO: 65 M protein sequence for HMPV isolate NL/1/94
SEQ ID NO: 66 M gene sequence for HMPV isolate NL/1/00 SEQ ID NO:
67 M gene sequence for HMPV isolate NL/17/00 SEQ ID NO: 68 M gene
sequence for HMPV isolate NL/1/99 SEQ ID NO: 69 M gene sequence for
HMPV isolate NL/1/94 SEQ ID NO: 70 N protein sequence for HMPV
isolate NL/1/00 SEQ ID NO: 71 N protein sequence for HMPV isolate
NL/17/00 SEQ ID NO: 72 N protein sequence for HMPV isolate NL/1/99
SEQ ID NO: 73 N protein sequence for HMPV isolate NL/1/94 SEQ ID
NO: 74 N gene sequence for HMPV isolate NL/1/00 SEQ ID NO: 75 N
gene sequence for HMPV isolate NL/17/00 SEQ ID NO: 76 N gene
sequence for HMPV isolate NL/1/99 SEQ ID NO: 77 N gene sequence for
HMPV isolate NL/1/94 SEQ ID NO: 78 P protein sequence for HMPV
isolate NL/1/00 SEQ ID NO: 79 P protein sequence for HMPV isolate
NL/17/00 SEQ ID NO: 80 P protein sequence for HMPV isolate NL/1/99
SEQ ID NO: 81 P protein sequence for HMPV isolate NL/1/94 SEQ ID
NO: 82 P gene sequence for HMPV isolate NL/1/00 SEQ ID NO: 83 P
gene sequence for HMPV isolate NL/17/00 SEQ ID NO: 84 P gene
sequence for HMPV isolate NL/1/99 SEQ ID NO: 85 P gene sequence for
HMPV isolate NL/1/94 SEQ ID NO: 86 SH protein sequence for HMPV
isolate NL/1/00 SEQ ID NO: 87 SH protein sequence for HMPV isolate
NL/17/00 SEQ ID NO: 88 SH protein sequence for HMPV isolate NL/1/99
SEQ ID NO: 89 SH protein sequence for HMPV isolate NL/1/94 SEQ ID
NO: 90 SH gene sequence for HMPV isolate NL/1/00 SEQ ID NO: 91 SH
gene sequence for HMPV isolate NL/17/00 SEQ ID NO: 92 SH gene
sequence for HMPV isolate NL/1/99 SEQ ID NO: 93 SH gene sequence
for HMPV isolate NL/1/94 SEQ ID NO: 94 isolate NL/1/99 (99-1) HMPV
(Human Metapneumovirus)cDNA sequence SEQ ID NO: 95 isolate NL/1/00
(00-1) HMPV cDNA sequence SEQ ID NO: 96 isolate NL/17/00 HMPV cDNA
sequence SEQ ID NO: 97 isolate NL/1/94 HMPV cDNA sequence SEQ ID
NO: 98 G-gene coding sequence for isolate NL/1/00 (A1) SEQ ID NO:
99 G-gene coding sequence for isolate BR/2/01 (A1) SEQ ID NO: 100
G-gene coding sequence for isolate FL/4/01 (A1) SEQ ID NO: 101
G-gene coding sequence for isolate FL/3/01 (A1) SEQ ID NO: 102
G-gene coding sequence for isolate FL/8/01 (A1) SEQ ID NO: 103
G-gene coding sequence for isolate FL/10/01 (A1) SEQ ID NO: 104
G-gene coding sequence for isolate NL/10/01 (A1) SEQ ID NO: 105
G-gene coding sequence for isolate NL/2/02 (A1) SEQ ID NO: 106
G-gene coding sequence for isolate NL/17/00 (A2) SEQ ID NO: 107
G-gene coding sequence for isolate NL/1/81 (A2) SEQ ID NO: 108
G-gene coding sequence for isolate NL/1/93 (A2) SEQ ID NO: 109
G-gene coding sequence for isolate NL/2/93 (A2) SEQ ID NO: 110
G-gene coding sequence for isolate NL/3/93 (A2) SEQ ID NO: 111
G-gene coding sequence for isolate NL/1/95 (A2) SEQ ID NO: 112
G-gene coding sequence for isolate NL/2/96 (A2) SEQ ID NO: 113
G-gene coding sequence for isolate NL/3/96 (A2) SEQ ID NO: 114
G-gene coding sequence for isolate NL/22/01 (A2) SEQ ID NO: 115
G-gene coding sequence for isolate NL/24/01 (A2) SEQ ID NO: 116
G-gene coding sequence for isolate NL/23/01 (A2) SEQ ID NO: 117
G-gene coding sequence for isolate NL/29/01 (A2) SEQ ID NO: 118
G-gene coding sequence for isolate NL/3/02 (A2) SEQ ID NO: 119
G-gene coding sequence for isolate NL/1/99 (B1) SEQ ID NO: 120
G-gene coding sequence for isolate NL/11/00 (B1) SEQ ID NO: 121
G-gene coding sequence for isolate NL/12/00 (B1) SEQ ID NO: 122
G-gene coding sequence for isolate NL/5/01 (B1) SEQ ID NO: 123
G-gene coding sequence for isolate NL/9/01 (B1) SEQ ID NO: 124
G-gene coding sequence for isolate NL/21/01 (B1) SEQ ID NO: 125
G-gene coding sequence for isolate NL/1/94 (B2) SEQ ID NO: 126
G-gene coding sequence for isolate NL/1/82 (B2) SEQ ID NO: 127
G-gene coding sequence for isolate NL/1/96 (B2) SEQ ID NO: 128
G-gene coding sequence for isolate NL/6/97 (B2) SEQ ID NO: 129
G-gene coding sequence for isolate NL/9/00 (B2) SEQ ID NO: 130
G-gene coding sequence for isolate NL/3/01 (B2) SEQ ID NO: 131
G-gene coding sequence for isolate NL/4/01 (B2) SEQ ID NO: 132
G-gene coding sequence for isolate UK/5/01 (B2) SEQ ID NO: 133
G-protein sequence for isolate NL/1/00 (A1) SEQ ID NO: 134
G-protein sequence for isolate BR/2/01 (A1) SEQ ID NO: 135
G-protein sequence for isolate FL/4/01 (A1) SEQ ID NO: 136
G-protein sequence for isolate FL/3/01 (A1) SEQ ID NO: 137
G-protein sequence for isolate FL/8/01 (A1) SEQ ID NO: 138
G-protein sequence for isolate FL/10/01 (A1) SEQ ID NO: 139
G-protein sequence for isolate NL/10/01 (A1) SEQ ID NO: 140
G-protein sequence for isolate NL/2/02 (A1) SEQ ID NO: 141
G-protein sequence for isolate NL/17/00 (A2) SEQ ID NO: 142
G-protein sequence for isolate NL/1/81 (A2) SEQ ID NO: 143
G-protein sequence for isolate NL/1/93 (A2) SEQ ID NO: 144
G-protein sequence for isolate NL/2/93 (A2) SEQ ID NO: 145
G-protein sequence for isolate NL/3/93 (A2) SEQ ID NO: 146
G-protein sequence for isolate NL/1/95 (A2) SEQ ID NO: 147
G-protein sequence for isolate NL/2/96 (A2) SEQ ID NO: 148
G-protein sequence for isolate NL/3/96 (A2) SEQ ID NO: 149
G-protein sequence for isolate NL/22/01 (A2) SEQ ID NO: 150
G-protein sequence for isolate NL/24/01 (A2) SEQ ID NO: 151
G-protein sequence for isolate NL/23/01 (A2) SEQ ID NO: 152
G-protein sequence for isolate NL/29/01 (A2) SEQ ID NO: 153
G-protein sequence for isolate NL/3/02 (A2) SEQ ID NO: 154
G-protein sequence for isolate NL/1/99 (B1) SEQ ID NO: 155
G-protein sequence for isolate NL/11/00 (B1) SEQ ID NO: 156
G-protein sequence for isolate NL/12/00 (B1) SEQ ID NO: 157
G-protein sequence for isolate NL/5/01 (B1) SEQ ID NO: 158
G-protein sequence for isolate NL/9/01 (B1) SEQ ID NO: 159
G-protein sequence for isolate NL/21/01 (B1) SEQ ID NO: 160
G-protein sequence for isolate NL/1/94 (B2) SEQ ID NO: 161
G-protein sequence for isolate NL/1/82 (B2) SEQ ID NO: 162
G-protein sequence for isolate NL/1/96 (B2) SEQ ID NO: 163
G-protein sequence for isolate NL/6/97 (B2) SEQ ID NO: 164
G-protein sequence for isolate NL/9/00 (B2) SEQ ID NO: 165
G-protein sequence for isolate NL/3/01 (B2) SEQ ID NO: 166
G-protein sequence for isolate NL/4/01 (B2) SEQ ID NO: 167
G-protein sequence for isolate NL/5/01 (B2) SEQ ID NO: 168 F-gene
coding sequence for isolate NL/1/00 SEQ ID NO: 169 F-gene coding
sequence for isolate UK/1/00 SEQ ID NO: 170 F-gene coding sequence
for isolate NL/2/00 SEQ ID NO: 171 F-gene coding sequence for
isolate NL/13/00 SEQ ID NO: 172 F-gene coding sequence for isolate
NL/14/00 SEQ ID NO: 173 F-gene coding sequence for isolate FL/3/01
SEQ ID NO: 174 F-gene coding sequence for isolate FL/4/01 SEQ ID
NO: 175 F-gene coding sequence for isolate FL/8/01 SEQ ID NO: 176
F-gene coding sequence for isolate UK/1/01 SEQ ID NO: 177 F-gene
coding sequence for isolate UK/7/01 SEQ ID NO: 178 F-gene coding
sequence for isolate FL/10/01 SEQ ID NO: 179 F-gene coding sequence
for isolate NL/6/01 SEQ ID NO: 180 F-gene coding sequence for
isolate NL/8/01 SEQ ID NO: 181 F-gene coding sequence for isolate
NL/10/01 SEQ ID NO: 182 F-gene coding sequence for isolate NL/14/01
SEQ ID NO: 183 F-gene coding sequence for isolate NL/20/01 SEQ ID
NO: 184 F-gene coding sequence for isolate NL/25/01 SEQ ID NO: 185
F-gene coding sequence for isolate NL/26/01 SEQ ID NO: 186 F-gene
coding sequence for isolate NL/28/01 SEQ ID NO: 187 F-gene coding
sequence for isolate NL/30/01 SEQ ID NO: 188 F-gene coding sequence
for isolate BR/2/01 SEQ ID NO: 189 F-gene coding sequence for
isolate BR/3/01 SEQ ID NO: 190 F-gene coding sequence for isolate
NL/2/02 SEQ ID NO: 191 F-gene coding sequence for isolate NL/4/02
SEQ ID NO: 192 F-gene coding sequence for isolate NL/5/02 SEQ ID
NO: 193 F-gene coding sequence for isolate NL/6/02 SEQ ID NO: 194
F-gene coding sequence for isolate NL/7/02 SEQ ID NO: 195 F-gene
coding sequence for isolate NL/9/02 SEQ ID NO: 196 F-gene coding
sequence for isolate FL/1/02 SEQ ID NO: 197 F-gene coding sequence
for isolate NL/1/81 SEQ ID NO: 198 F-gene coding sequence for
isolate NL/1/93 SEQ ID NO: 199 F-gene coding sequence for isolate
NL/2/93 SEQ ID NO: 200 F-gene coding sequence for isolate NL/4/93
SEQ ID NO: 201 F-gene coding sequence for isolate NL/1/95 SEQ ID
NO: 202 F-gene coding sequence for isolate NL/2/96 SEQ ID NO: 203
F-gene coding sequence for isolate NL/3/96 SEQ ID NO: 204 F-gene
coding sequence for isolate NL/1/98 SEQ ID NO: 205 F-gene coding
sequence for isolate NL/17/00 SEQ ID NO: 206 F-gene coding sequence
for isolate NL/22/01 SEQ ID NO: 207 F-gene coding sequence for
isolate NL/29/01 SEQ ID NO: 208 F-gene coding sequence for isolate
NL/23/01 SEQ ID NO: 209 F-gene coding sequence for isolate NL/17/01
SEQ ID NO: 210 F-gene coding sequence for isolate NL/24/01 SEQ ID
NO: 211 F-gene coding sequence for isolate NL/3/02 SEQ ID NO: 212
F-gene coding sequence for isolate NL/3/98 SEQ ID NO: 213 F-gene
coding sequence for isolate NL/1/99 SEQ ID NO: 214 F-gene coding
sequence for isolate NL/2/99 SEQ ID NO: 215 F-gene coding sequence
for isolate NL/3/99 SEQ ID NO: 216 F-gene coding sequence for
isolate NL/11/00 SEQ ID NO: 217 F-gene coding sequence for isolate
NL/12/00 SEQ ID NO: 218 F-gene coding sequence for isolate NL/1/01
SEQ ID NO: 219 F-gene coding sequence for isolate NL/5/01 SEQ ID
NO: 220 F-gene coding sequence for isolate NL/9/01 SEQ ID NO: 221
F-gene coding sequence for isolate NL/19/01 SEQ ID NO: 222 F-gene
coding sequence for isolate NL/21/01 SEQ ID NO: 223 F-gene coding
sequence for isolate UK/11/01 SEQ ID NO: 224 F-gene coding sequence
for isolate FL/1/01 SEQ ID NO: 225 F-gene coding sequence for
isolate FL/2/01 SEQ ID NO: 226 F-gene coding sequence for isolate
FL/5/01 SEQ ID NO: 227 F-gene coding sequence for isolate FL/7/01
SEQ ID NO: 228 F-gene coding sequence for isolate FL/9/01
SEQ ID NO: 229 F-gene coding sequence for isolate UK/10/01 SEQ ID
NO: 230 F-gene coding sequence for isolate NL/1/02 SEQ ID NO: 231
F-gene coding sequence for isolate NL/1/94 SEQ ID NO: 232 F-gene
coding sequence for isolate NL/1/96 SEQ ID NO: 233 F-gene coding
sequence for isolate NL/6/97 SEQ ID NO: 234 F-gene coding sequence
for isolate NL/7/00 SEQ ID NO: 235 F-gene coding sequence for
isolate NL/9/00 SEQ ID NO: 236 F-gene coding sequence for isolate
NL/19/00 SEQ ID NO: 237 F-gene coding sequence for isolate NL/28/00
SEQ ID NO: 238 F-gene coding sequence for isolate NL/3/01 SEQ ID
NO: 239 F-gene coding sequence for isolate NL/4/01 SEQ ID NO: 240
F-gene coding sequence for isolate NL/11/01 SEQ ID NO: 241 F-gene
coding sequence for isolate NL/15/01 SEQ ID NO: 242 F-gene coding
sequence for isolate NL/18/01 SEQ ID NO: 243 F-gene coding sequence
for isolate FL/6/01 SEQ ID NO: 244 F-gene coding sequence for
isolate UK/5/01 SEQ ID NO: 245 F-gene coding sequence for isolate
UK/8/01 SEQ ID NO: 246 F-gene coding sequence for isolate NL/12/02
SEQ ID NO: 247 F-gene coding sequence for isolate HK/1/02 SEQ ID
NO: 248 F-protein sequence for isolate NL/1/00 SEQ ID NO: 249
F-protein sequence for isolate UK/1/00 SEQ ID NO: 250 F-protein
sequence for isolate NL/2/00 SEQ ID NO: 251 F-protein sequence for
isolate NL/13/00 SEQ ID NO: 252 F-protein sequence for isolate
NL/14/00 SEQ ID NO: 253 F-protein sequence for isolate FL/3/01 SEQ
ID NO: 254 F-protein sequence for isolate FL/4/01 SEQ ID NO: 255
F-protein sequence for isolate FL/8/01 SEQ ID NO: 256 F-protein
sequence for isolate UK/1/01 SEQ ID NO: 257 F-protein sequence for
isolate UK/7/01 SEQ ID NO: 258 F-protein sequence for isolate
FL/10/01 SEQ ID NO: 259 F-protein sequence for isolate NL/6/01 SEQ
ID NO: 260 F-protein sequence for isolate NL/8/01 SEQ ID NO: 261
F-protein sequence for isolate NL/10/01 SEQ ID NO: 262 F-protein
sequence for isolate NL/14/01 SEQ ID NO: 263 F-protein sequence for
isolate NL/20/01 SEQ ID NO: 264 F-protein sequence for isolate
NL/25/01 SEQ ID NO: 265 F-protein sequence for isolate NL/26/01 SEQ
ID NO: 266 F-protein sequence for isolate NL/28/01 SEQ ID NO: 267
F-protein sequence for isolate NL/30/01 SEQ ID NO: 268 F-protein
sequence for isolate BR/2/01 SEQ ID NO: 269 F-protein sequence for
isolate BR/3/01 SEQ ID NO: 270 F-protein sequence for isolate
NL/2/02 SEQ ID NO: 271 F-protein sequence for isolate NL/4/02 SEQ
ID NO: 272 F-protein sequence for isolate NL/5/02 SEQ ID NO: 273
F-protein sequence for isolate NL/6/02 SEQ ID NO: 274 F-protein
sequence for isolate NL/7/02 SEQ ID NO: 275 F-protein sequence for
isolate NL/9/02 SEQ ID NO: 276 F-protein sequence for isolate
FL/1/02 SEQ ID NO: 277 F-protein sequence for isolate NL/1/81 SEQ
ID NO: 278 F-protein sequence for isolate NL/1/93 SEQ ID NO: 279
F-protein sequence for isolate NL/2/93 SEQ ID NO: 280 F-protein
sequence for isolate NL/4/93 SEQ ID NO: 281 F-protein sequence for
isolate NL/1/95 SEQ ID NO: 282 F-protein sequence for isolate
NL/2/96 SEQ ID NO: 283 F-protein sequence for isolate NL/3/96 SEQ
ID NO: 284 F-protein sequence for isolate NL/1/98 SEQ ID NO: 285
F-protein sequence for isolate NL/17/00 SEQ ID NO: 286 F-protein
sequence for isolate NL/22/01 SEQ ID NO: 287 F-protein sequence for
isolate NL/29/01 SEQ ID NO: 288 F-protein sequence for isolate
NL/23/01 SEQ ID NO: 289 F-protein sequence for isolate NL/17/01 SEQ
ID NO: 290 F-protein sequence for isolate NL/24/01 SEQ ID NO: 291
F-protein sequence for isolate NL/3/02 SEQ ID NO: 292 F-protein
sequence for isolate NL/3/98 SEQ ID NO: 293 F-protein sequence for
isolate NL/1/99 SEQ ID NO: 294 F-protein sequence for isolate
NL/2/99 SEQ ID NO: 295 F-protein sequence for isolate NL/3/99 SEQ
ID NO: 296 F-protein sequence for isolate NL/11/00 SEQ ID NO: 297
F-protein sequence for isolate NL/12/00 SEQ ID NO: 298 F-protein
sequence for isolate NL/1/01 SEQ ID NO: 299 F-protein sequence for
isolate NL/5/01 SEQ ID NO: 300 F-protein sequence for isolate
NL/9/01 SEQ ID NO: 301 F-protein sequence for isolate NL/19/01 SEQ
ID NO: 302 F-protein sequence for isolate NL/21/01 SEQ ID NO: 303
F-protein sequence for isolate UK/11/01 SEQ ID NO: 304 F-protein
sequence for isolate FL/1/01 SEQ ID NO: 305 F-protein sequence for
isolate FL/2/01 SEQ ID NO: 306 F-protein sequence for isolate
FL/5/01 SEQ ID NO: 307 F-protein sequence for isolate FL/7/01 SEQ
ID NO: 308 F-protein sequence for isolate FL/9/01 SEQ ID NO: 309
F-protein sequence for isolate UK/10/01 SEQ ID NO: 310 F-protein
sequence for isolate NL/1/02 SEQ ID NO: 311 F-protein sequence for
isolate NL/1/94 SEQ ID NO: 312 F-protein sequence for isolate
NL/1/96 SEQ ID NO: 313 F-protein sequence for isolate NL/6/97 SEQ
ID NO: 314 F-protein sequence for isolate NL/7/00 SEQ ID NO: 315
F-protein sequence for isolate NL/9/00 SEQ ID NO: 316 F-protein
sequence for isolate NL/19/00 SEQ ID NO: 317 F-protein sequence for
isolate NL/28/00 SEQ ID NO: 318 F-protein sequence for isolate
NL/3/01 SEQ ID NO: 319 F-protein sequence for isolate NL/4/01 SEQ
ID NO: 320 F-protein sequence for isolate NL/11/01 SEQ ID NO: 321
F-protein sequence for isolate NL/15/01 SEQ ID NO: 322 F-protein
sequence for isolate NL/18/01 SEQ ID NO: 323 F-protein sequence for
isolate FL/6/01 SEQ ID NO: 324 F-protein sequence for isolate
UK/5/01 SEQ ID NO: 325 F-protein sequence for isolate UK/8/01 SEQ
ID NO: 326 F-protein sequence for isolate NL/12/02 SEQ ID NO: 327
F-protein sequence for isolate HK/1/02
Sequence CWU 0 SQTB SEQUENCE LISTING The patent application
contains a lengthy "Sequence Listing" section. A copy of the
"Sequence Listing" is available in electronic form from the USPTO
web site
(http://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US20090263883A1).
An electronic copy of the "Sequence Listing" will also be available
from the USPTO upon request and payment of the fee set forth in 37
CFR 1.19(b)(3).
0 SQTB SEQUENCE LISTING The patent application contains a lengthy
"Sequence Listing" section. A copy of the "Sequence Listing" is
available in electronic form from the USPTO web site
(http://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US20090263883A1).
An electronic copy of the "Sequence Listing" will also be available
from the USPTO upon request and payment of the fee set forth in 37
CFR 1.19(b)(3).
* * * * *
References