U.S. patent application number 11/953532 was filed with the patent office on 2009-10-22 for alpha-amylase mutants.
This patent application is currently assigned to Novozymes A/S. Invention is credited to Carsten Andersen, Torben Vedel Borchert, Soren Kjaerulff, Bjarne Nielsen, Torben Lauesgaard Nissen, Allan Svendsen.
Application Number | 20090263881 11/953532 |
Document ID | / |
Family ID | 55701615 |
Filed Date | 2009-10-22 |
United States Patent
Application |
20090263881 |
Kind Code |
A1 |
Borchert; Torben Vedel ; et
al. |
October 22, 2009 |
Alpha-Amylase Mutants
Abstract
The invention relates to a variant of a parent Termamyl-like
.alpha.-amylase, which exhibits an alteration in at least one of
the following properties relative to said parent .alpha.-amylase:
i) improved pH stability at a pH from 8 to 10.5; and/or ii)
improved Ca.sup.2+ stability at pH 8 to 10.5, and/or iii) increased
specific activity at temperatures from 10 to 60.degree. C.
Inventors: |
Borchert; Torben Vedel;
(Copenhagen O, DK) ; Svendsen; Allan; (Birkerod,
DK) ; Andersen; Carsten; (Vaerloese, DK) ;
Nielsen; Bjarne; (Virum, DK) ; Nissen; Torben
Lauesgaard; (Frederiksberg, DK) ; Kjaerulff;
Soren; (Vanlose, DK) |
Correspondence
Address: |
NOVOZYMES NORTH AMERICA, INC.
500 FIFTH AVENUE, SUITE 1600
NEW YORK
NY
10110
US
|
Assignee: |
Novozymes A/S
Bagsvaerd
DK
|
Family ID: |
55701615 |
Appl. No.: |
11/953532 |
Filed: |
December 10, 2007 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10980923 |
Nov 4, 2004 |
|
|
|
11953532 |
|
|
|
|
10665667 |
Sep 19, 2003 |
|
|
|
10980923 |
|
|
|
|
09769864 |
Jan 25, 2001 |
6673589 |
|
|
10665667 |
|
|
|
|
09183412 |
Oct 30, 1998 |
6204232 |
|
|
09769864 |
|
|
|
|
60064662 |
Nov 6, 1997 |
|
|
|
60093234 |
Jul 17, 1998 |
|
|
|
Current U.S.
Class: |
435/201 |
Current CPC
Class: |
C11D 3/386 20130101;
C12Y 302/01001 20130101; C07K 14/32 20130101; C12N 9/2417 20130101;
C11D 3/38636 20130101; C11D 3/38609 20130101 |
Class at
Publication: |
435/201 |
International
Class: |
C12N 9/26 20060101
C12N009/26 |
Foreign Application Data
Date |
Code |
Application Number |
Oct 30, 1997 |
DK |
1240/97 |
Jul 14, 1998 |
DK |
1998 00936 |
Claims
1-39. (canceled)
40. A variant alpha-amylase, which variant has alpha-amylase
activity, has at least 90% homology with the amino acid sequence
shown in SEQ ID. NO. 3, and which comprises one or more of the
following substitutions (using SEQ SD NO:3 for numbering):
TABLE-US-00047 (a) R179A, D, N, C, E, Q, G, H, I, L, K, M, F, P, S,
T, W, Y, or V; (b) G180A, D, R, N, C, E, Q, H, I, L, K, M, F, P, S,
T, W, Y, or V; (c) I181A, R, N, C, E, Q, G, H, L, K, M, F, P, S, T,
W, Y, or V; (d) G182A, R, D, N, C, E, Q, H, I, L, K, M, F, P, S, T,
W, Y, or V.
41. A variant alpha-amylase, which variant has alpha-amylase
activity, has at least 95% homology with the amino acid sequence
shown in SEQ ID. NO. 3, and which comprises one or more of the
following substitutions (using SEQ ID NO:3 for numbering):
TABLE-US-00048 (a) R179A, D, N, C, E, Q, G, H, I, L, K, M, F, P, S,
T, W, Y, or v; (b) G180A, D, R, N, C, E, Q, H, I, L, K, M, F, P, S,
T, W, Y, or V; (c) I181A, R, N, C, E, Q, G, H, L, K, M, F, P, S, T,
W, Y, or V; (d) G182A, R, D, N, C, E, Q, H, I, L, K, M, F, P, S, T,
W, Y, or V.
42. The variant of claim 40, wherein the variant comprises a
substitution of R179A,D,N,C,E,Q,G,H,I,L,K,M,F,P,S,T,W,Y, or V.
43. The variant of claim 40, wherein the variant comprises a
substitution of G180A,D,R,N,C,E,Q,H,I,L,K,M,F,P,S,T,W,Y, or V.
44. The variant of claim 40, wherein the variant comprises a
substitution of I181A,R,N,C,E,Q,G,H,L,K,M,F,P,S,T,W,Y, or V.
45. The variant of claim 40, wherein the variant comprises a
substitution of G182A,R,D,N,C,E,Q,H,I,L,K,M,F,P,S,T,W,Y, or V.
46. The variant of claim 41, wherein the variant comprises a
substitution of R179A,D,N,C,E,Q,G,H,I,L,K,M,F,P,S,TlW,Y, or V.
47. The variant of claim 41, wherein the variant comprises a
substitution of G180A,D,R,N,C,E,Q,H,I,L,K,M,F,P,S,T,W,Y, or V.
48. The variant of claim 41, wherein the variant comprises a
substitution of I181A,R,N,C,E,Q,G,H,L,K,M,F,P,S,T,W,Y,or V.
49. The variant of claim 41, wherein the variant comprises a
substitution of G182A,R,D,N,C,E,Q,H,I,L,K,M,F,P,S,T,W,Y, or V.
Description
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a divisional of U.S. application Ser.
No. 10/980,923, filed Nov. 4, 2004 which is a continuation of U.S.
application no, 10/665,667, filed Sep. 19, 2003, which is a
divisional of U.S. application Ser. No. 09/769,864, filed on Jan.
25, 2001, which is a divisional of U.S. application Ser. No.
09/183,412, filed on Oct. 30, 1998, and claims priority under 35
U.S.C. 119 of Danish application no. 1240/97, filed on Oct. 30,
1997, Danish application no. PA 1998 00936, filed on Jul. 14, 1998,
U.S. provisional application No. 60/064,662, filed on Nov. 6, 1997
and U.S. provisional application No. 60/093,234, filed on Jul. 17,
1998, the contents of which are fully incorporated herein by
reference.
FIELD OP THE INVENTION
[0002] The present invention relates to variants (mutants) of
parent Termamyl-like .alpha.-amylases with higher activity at
medium temperatures and/or high pH.
BACKGROUND OP THE INVENTION
[0003] .alpha.-Amylases (.alpha.-1,4-glucan-4-glucanohydrolases, EC
3.2.1.1) constitute a group of enzymes which catalyze hydrolysis of
starch and other linear and branched 1,4-glucosidic oligo- and
polysaccharides.
[0004] There is a very extensive body of patent and scientific
literature relating to this industrially very important class of
enzymes. A number of .alpha.-amylases such as Termamyl-like
.alpha.-amylases variants are known from e.g. WO 90/11352, WO
95/10603, WO 95/26397, WO 96/23873 and WO 96/23874.
[0005] Among more recent disclosures relating to .alpha.-amylases,
WO 96/23874 provides three-dimensional, X-ray crystal structural
data for a Termamyl-like .alpha.-amylase which consists of the 300
N-terminal amino acid residues of the B. amyloliquefaciens
.alpha.-amylase (BAN.TM.) and amino acids 301-483 of the C-terminal
end of the B. licheniformis .alpha.-amylase comprising the amino
acid sequence (the latter being available commercially under the
tradename Termamyl.TM.), and which is thus closely related to the
industrially important Bacillus .alpha.-amylases (which in the
present context are embraced within the meaning of the term
"Termamyl-like .alpha.-amylases", and which include, inter alia,
the B. licheniformis, B. amyloliquefaciens (BAN.TM.) and B.
stearothermophilus (BSG.TM.) .alpha.-amylases). WO 96/23874 further
describes methodology for designing, on the basis of an analysis of
the structure of a parent Termamyl-like .alpha.-amylase, variants
of the parent Termamyl-like .alpha.-amylase which exhibit altered
properties relative to the parent.
BRIEF DISCLOSURE OF THE INVENTION
[0006] The present invention relates to novel .alpha.-amylolytic
variants (mutants) of a Termamyl-like .alpha.-amylase which exhibit
improved wash performance (relative to the parent .alpha.-amaylase)
at high pH and at a medium temperature.
[0007] The term "medium temperature" means in the context of the
invention a temperature from 10.degree. C. to 60.degree. C.,
preferably 20.degree. C. to 50.degree. C., especially 30-40.degree.
C.
[0008] The term "high pH" means the alkaline pH which today are
used for washing, more specifically from about pH 8 to 10.5.
[0009] In the context of the invention a "low temperature
.alpha.-amylase" means an .alpha.-amylase which has an relative
optimum activity in the temperature range from 0-30.degree. C.
[0010] In the context of the invention a "medium temperature
.alpha.-amylase" means an .alpha.-amylase which has an optimum
activity in the temperature range from 30-60.degree. C. For
instance, SP690 and SP722 .alpha.-amylases, respectively, are
"medium temperature .alpha.-amylases.
[0011] In the context of the invention a "high temperature
.alpha.-amylase" is an .alpha.-amylase having the optimum activity
in the temperature range from 60-110.degree. C. For instance,
Termamyl is a "high temperature .alpha.-amylase.
[0012] Alterations in properties which may be achieved in variants
(mutants) of the invention are alterations in:
the stability of the Termamyl-like .alpha.-amylase at a pH from 8
to 10.5, and/or the Ca.sup.2+ stability at pH 8 to 10.5, and/or the
specific activity at temperatures from 10 to 60.degree. C.,
preferably 20-50.degree. C., especially 30-40.degree. C.
[0013] It should be noted that the relative temperature optimum
often is dependent on the specific pH used. In other words the
relative temperature optimum determined at, e.g., pH 8 may be
substantially different from the relative temperature optimum
determined at, e.g., pH 10.
The Temperature's Influence on the Enzymatic Activity
[0014] The dynamics in the active site and surroundings are
dependent on the temperature and the amino acid composition and of
strong importance for the relative temperature optimum of an
enzyme. By comparing the dynamics of medium and high temperature
.alpha.-amylases, regions of importance for the function of high
temperature .alpha.-amylases at medium temperatures can be
determined. The temperature activity profile of the SP722
.alpha.-amaylase (SEQ ID NO: 2) and the B. licheniformis
.alpha.-amylase (available from Novo Nordisk as Termamyl.RTM.) (SEQ
ID NO: 4) are shown in FIG. 2.
[0015] The relative temperature optimum of SP722 in absolute
activities are shown to be higher at medium range temperatures
(30-60.degree. C.) than the homologous B. licheniformis
.alpha.-amylase, which have an optimum activity around.
60-100.degree. C. The profiles are mainly dependent on the
temperature stability and the dynamics of the active site residues
and their surroundings. Further, the activity profiles are
dependent on the pH used and the pKa of the active site
residues.
[0016] In the first aspect the invention relates to a variant of a
parent Termamyl-like .alpha.-amylase, which variant has
.alpha.-amylase activity, said variant comprises one or more
mutations corresponding to the following mutations in the amino
acid sequence shown in SEQ ID NO: 2:
T141, K142, F143, D144, F145, P146, G147, R148, G149,
Q174, R181, G182, D183, G184, K185, A186, W189, S193, N195,
H107, K108, G109, D166, W167, D168, Q169, S170, R171, Q172,
F173,
F267, W268, K269, N270, D271, L272, G273, A274, L275, K311,
E346,
F385, G456, N457, K458, P459, G460, T461, V462, T463.
[0017] A variant of the invention have one or more of the following
substitutions or deletions:
TABLE-US-00001 T141A, D, R, N, C, E, Q, G, H, I, L, K, M, F, P, S,
W, Y, V K142A, D, R, N, C, E, Q, G, H, I, L, M, F, P, S, T, W, Y,
V; F143A, D, R, N, C, E, Q, G, H, I, L, K, M, P, S, T, W, Y, V;
D144A, R, N, C, E, Q, G, H, I, L, K, M, F, P, S, T, W, Y, V; F145A,
D, R, N, C, E, Q, G, H, I, L, K, M, P, S, T, W, Y, V; P146A, D, R,
N, C, E, Q, G, H, I, L, K, M, F, S, T, W, Y, V; G147A, D, R, N, C,
E, Q, H, I, L, K, M, F, P, S, T, W, Y, V; R148A, D, N, C, E, Q, G,
H, I, L, K, M, F, P, S, T, W, Y, V; G149A, D, R, N, C, E, Q, H, I,
L, K, M, F, P, S, T, W, Y, V; R181*, A, D, N, C, E, Q, G, H, I, L,
K, M, F, P, S, T, W, Y, V; G182*, A, D, R, N, C, E, Q, H, I, L, K,
M, F, P, S, T, W, Y, V; D183*, A, R, N, C, E, Q, G, H, I, L, K, M,
F, P, S, T, W, Y, V; G184*, A, R, D, N, C, E, Q, H, I, L, K, M, F,
P, S, T, W, Y, V; K185A, D, R, N, C, E, Q, G, H, I, L, M, F, P, S,
T, W, Y, V; A186D, R, N, C, E, Q, G, H, I, L, K, M, F, P, S, T, W,
Y, V; W189A, D, R, N, C, E, Q, G, H, I, L, K, M, F, P, S, T, Y, V;
S193A, D, R, N, C, E, Q, G, H, I, L, K, M, F, P, T, W, Y, V; N195A,
D, R, C, E, Q, G, H, I, L, K, M, F, P, S, T, W, Y, V; H107A, D, R,
N, C, E, Q, G, I, L, K, M, F, P, S, T, W, Y, V; K108A, D, R, N, C,
E, Q, H, I, L, K, M, F, P, S, T, W, Y, V; G109A, D, R, N, C, E, Q,
H, I, L, K, M, F, P, S, T, W, Y, V; D166A, R, N, C, E, Q, G, H, I,
L, K, M, F, P, S, T, W, Y, V; W167A, D, R, N, C, E, Q, G, H, I, L,
K, M, F, P, S, T, Y, V; D168A, R, N, C, E, Q, G, H, I, L, K, M, F,
P, S, T, W, Y, V; Q169A, D, R, N, C, E, G, H, I, L, K, M, F, P, S,
T, W, Y, V; S170A, D, R, N, C, E, Q, G, H, I, L, K, M, F, P, T, W,
Y, V; R171A, D, N, C, E, Q, G, H, I, L, K, M, F, P, S, T, W, Y, V;
Q172A, D, R, N, C, E, G, H, I, L, K, M, F, P, S, T, W, Y, V; F173A,
D, R, N, C, E, Q, G, H, I, L, K, M, P, S, T, W, Y, V; Q174*, A, D,
R, N, C, E, G, H, I, L, K, M, F, P, S, T, W, Y, V; F267A, D, R, N,
C, E, Q, G, H, I, L, K, M, P, S, T, W, Y, V; W268A, D, R, N, C, E,
Q, G, H, I, L, K, M, F, P, S, T, Y, V; K269A, D, R, N, C, E, Q, G,
H, I, L, M, F, P, S, T, W, Y, V; N270A, D, R, C, E, Q, G, H, I, L,
K, M, F, P, S, T, W, Y, V; D271A, R, N, C, E, Q, G, H, I, L, K, M,
F, P, S, T, W, Y, V; L272A, D, R, N, C, E, Q, G, H, I, K, M, F, P,
S, T, W, Y, V; G273A, D, R, N, C, E, Q, H, I, L, K, M, F, P, S, T,
W, Y, V; A274D, R, N, C, E, Q, G, H, I, L, K, M, F, P, S, T, W, Y,
V; L275A, D, R, N, C, E, Q, G, H, I, K, M, F, P, S, T, W, Y, V;
K311A, D, R, N, C, E, Q, G, H, I, L, M, F, P, S, T, W, Y, V; E346A,
D, R, N, C, Q, G, H, I, K, L, M, F, P, S, T, W, Y, V; K385A, D, R,
N, C, E, Q, G, H, I, L, M, F, P, S, T, W, Y, V; G456A, D, R, N, C,
E, Q, H, I, L, K, M, F, P, S, T, W, Y, V; N457A, D, R, C, E, Q, G,
H, I, L, K, M, F, P, S, T, W, Y, V; K458A, D, R, N, C, E, Q, G, H,
I, L, M, F, P, S, T, W, Y, V; P459A, D, R, N, C, E, Q, G, H, I, L,
K, M, F, S, T, W, Y, V; G460A, D, R, N, C, E, Q, H, I, L, K, M, F,
P, S, T, W, Y, V; T461A, D, R, N, C, E, Q, G, H, I, L, K, M, F, P,
S, W, Y, V; V462A, D, R, N, C, E, Q, G, H, I, L, K, M, F, P, S, T,
W, Y; T463A, D, R, N, C, E, Q, G, H, I, L, K, M, F, P, S, W, Y,
V.
[0018] Preferred are variants having one or more of the following
substitutions or deletions:
K142R; S193P; R195F; K269R,Q; N270Y,R,D; K311R; E346Q; K385R;
K458R; P459T; T461P; Q174*; R181Q,N,S; G182T,S,N; D183*; G184*;
K185A,R,D,C,E,Q,G,H,I,L,M,N,F,P,S,T,W,Y,V; A186T,S,N,I,V,R;
W189T,S,N,Q.
[0019] Especially preferred are variants having a deletion in
positions D183 and G184 and further one or more of the following
substitutions or deletions;
K142R; S193P; N195F; K269R,Q; N270Y,R,D; K311R; E346Q; K385R;
K458R; P459T; T461P; Q174*; R181Q,N,S; G182T,S,N;
K185A,R,D,C,E,Q,G,H,I,L,M,N,F,P,S,T,W,Y,V; A186T,S,N,I,V,R;
W189T,S,N,Q.
[0020] The variants of the invention mentioned above exhibits an
alteration in at least one of the following properties relative to
the parent .alpha.-amylase:
i) improved pH stability at a pH from 8 to 10.5; and/or ii)
improved Ca.sup.2+ stability at pH 8 to 10.5, and/or iii) increased
specific activity at temperatures from 10 to 60.degree. C.,
preferably 20-50.degree. C., especially 30-40.degree. C. Further,
details will be described below.
[0021] The invention further relates to DNA constructs encoding
variants of the invention; to methods for preparing variants of the
invention; and to the use of variants of the invention, alone or in
combination with other enzymes, in various industrial products or
processes, e.g., in detergents or for starch liquefaction.
[0022] In a final aspect the invention relates to a method of
providing .alpha.-amylases with altered pH optimum, and/or altered
temperature optimum, and/or improved stability,
Nomenclature
[0023] In the present, description and claims, the conventional
one-letter and three-letter codes for amino acid residues are used.
For ease of reference, .alpha.-amylase variants of the invention
are described by use of the following nomenclature:
Original amino acid(s):position(s):substituted amino acid is)
[0024] According to this nomenclature, for instance the
substitution of alanine for asparagine in position 30 is shown
as:
[0025] Ala30Asn or A30N
a deletion of alanine in the same position is shown as:
[0026] Ala30*or A30*
and insertion of an additional amino acid residue, such as lysine,
is shown as:
[0027] Ala30AlaLys or A3 OAK
[0028] A deletion of a consecutive stretch of amino acid residues,
such as amino acid residues 30-33, is indicated as (30-33)* or
.DELTA.(A30-N33).
[0029] Where a specific .alpha.-amylase contains a "deletion" in
comparison with other .alpha.-amylases and an insertion is made in
such a position this is indicated as:
[0030] *36Asp or *36D
for insertion of an aspartic acid in position 36 Multiple mutations
are separated by plus signs, i.e.:
[0031] Ala30Asp+ Glu34Ser or A30N+E34S
representing mutations in positions 30 and 34 substituting alanine
and glutamic acid for asparagine and serine, respectively.
[0032] When one or more alternative amino acid residues may be
inserted in a given position it is indicated as
[0033] A30N,E or
[0034] A30N or A30E
[0035] Furthermore, when a position suitable for modification is
identified herein without any specific modification being
suggested, it is to be understood that any amino acid residue may
be substituted for the amino acid residue present in the
position.
[0036] Thus, for instance, when a modification of an alanine in
position 30 is mentioned, but not specified, it is to be understood
that the alanine may be deleted or substituted for any other amino
acid, i.e., any one of:
R,N,D,A,C,Q,E,G,H,I,L,K,M,F,P,S,T,W,Y,V.
BRIEF DESCRIPTION OF THE DRAWING
[0037] FIG. 1 is an alignment of the amino acid sequences of six
parent Termamyl-like .alpha.-amylases. The numbers on the extreme
left designate the respective amino acid sequences as follows;
1: SEQ ID NO: 2
2: Kaoamyl
3: SEQ ID NO: 1
4: SEQ ID NO; 5
5: SEQ ID NO: 4
6: SEQ ID NO: 3.
[0038] FIG. 2 shows the temperature activity profile of SP722 (SEQ
ID NO: 2) (at pH 9) and B. licheniformis .alpha.-amylase (SEQ ID
NO: 4) (at pH 7.3).
[0039] FIG. 3 shows the temperature profile for SP690 (SEQ ID NO:
1), SP722 (SEQ ID NO: 2), B. licheniformis .alpha.-amylase (SEQ ID
NO: 4) at pH 10.
[0040] FIG. 4 is an alignment of the amino acid sequences of five
.alpha.-amylases. The numbers on the extreme left designate the
respective amino acid sequences as follows:
1; amyp_mouse 2: amyp_rat 3: amyp_pig porcine pancreatic
alpha-amylase (PPA) 4: amyp_human 5: amy_altha A. haloplanctis
alpha-amylase (AHA)
DETAILED DISCLOSURE OF THE INVENTION
The Termamyl-Like .alpha.-Amylase
[0041] It is well known that a number of .alpha.-amylases produced
by Bacillus spp. are highly homologous on the amino acid level. For
instance, the B. licheniformis .alpha.-amylase comprising the amino
acid sequence shown in SEQ ID NO: 4 (commercially available as
Termamyl.TM.) has been found to be about 89% homologous with the B.
amyloliquefaciens .alpha.-amylase comprising the amino acid
sequence shown in SEQ ID NO: 5 and about 79% homologous with the B.
stearothermophilus .alpha.-amylase comprising the amino acid
sequence shown in SEQ ID NO: 3. Further homologous .alpha.-amylases
include an .alpha.-amylase derived from a strain of the Bacillus
Bp. NCIB 12289, NCIB 12512, NCIB 12513 or DSM 9375, all of which
are described in detail in WO 95/26397, and the .alpha.-amylase
described by Tsukamoto et al., Biochemical and Biophysical Research
Communications, 151 (1988), pp. 25-31, (see SEQ ID NO: 6).
[0042] Still further homologous .alpha.-amylases include the
.alpha.-amylase produced by the B. licheniformis strain described
in BP 0252666 (ATCC 27811), and the .alpha.-amylases identified in
WO 91/00353 and WO 94/18314. Other commercial Termamyl-like B.
licheniformis .alpha.-amylases are comprised in the products
Optitherm.TM. and Takatherm.TM. (available from Solvay),
Maxamyl.TM. (available from Gist-brocades/Genencor), Spezyro AA.TM.
and Spezyme Delta AA.TM. (available from Genencor), and
Keistase.TM. (available from Daiwa).
[0043] Because of the substantial homology found between these
.alpha.-amylases, they are considered to belong to the same class
of .alpha.-amylases, namely the class of "Termamyl-like
.alpha.-amylases".
[0044] Accordingly, in the present context, the term "Termamyl-like
a amylase" is intended to indicate an .alpha.-amylase which, at the
amino acid level, exhibits a substantial homology to Termamyl.TM.,
i.e., the B. licheniformis .alpha.-amylase having the amino acid
sequence shown in SEQ ID NO:4 herein. In other words, all the
following .alpha.-amylases which has the amino acid sequences shown
in SEQ ID NOS: 1, 2, 3, 4, 5, 6, 7 or 8 herein, or the amino acid
sequence shown in SEQ ID NO: 1 of WO 95/26397 (the same as the
amino acid sequence shown as SEQ ID NO: 7 herein) or in SEQ ID NO:
2 of WO 95/26397 (the same as the amino acid sequence shown as SEQ
ID NO: 8 herein) or in Tsukamoto et al., 1988, (which amino acid
sequence is shown in SEQ ID NO: 6 herein) are considered to be
"Termamyl-like .alpha.-amylase". Other Termamyl-like
.alpha.-amylases are .alpha.-amylases i) which displays at least
60%, such as at least 70%, e.g., at least 75%, or at least 80%,
e.g., at least 85%, at least 90% or at least 95% homology with at
least one of said amino acid sequences shown in SEQ ID NOS: 1-8
and/or ii) displays immunological cross-reactivity with an antibody
raised against at least one of said .alpha.-amylases, and/or iii)
is encoded by a DMA sequence which hybridizes to the DNA sequences
encoding the above-specified a amylases which are apparent from SEQ
ID NOS: 9, 10, 11, or 12 of the present application (which encoding
sequences encode the amino acid sequences shown in SEQ ID NOS: 1,
2, 3, 4 and 5 herein, respectively), from SEQ ID NO: 4 of WO
95/26397 (which DNA sequence, together with the stop codon TAA, is
shown in SEQ ID NO: 13 herein and encodes the amino acid sequence
shown in SEQ ID NO; 8 herein) and from SEQ ID NO: 5 of WO 95/26397
(shown in SEQ ID NO: 14 herein), respectively.
[0045] In connection with property i), the "homology" may be
determined by use of any conventional algorithm, preferably by use
of the GAP progamme from the GCG package version 7.3 (June 1993)
using default values for GAP penalties, which is a GAP creation
penalty of 3.0 and GAP extension penalty of 0.1, (Genetic Computer
Group (1991) Programme Manual for the GCG Package, version 7, 575
Science Drive, Madison, Wis., USA 53711).
[0046] A structural alignment between Termamyl (SEQ ID NO: 4) and a
Termamyl-like .alpha.-amylase may be used to identify
equivalent/corresponding positions in other Termamyl-like
.alpha.-amylases. One method of obtaining said structural alignment
is to use the Pile Up programme from the GCG package using default
values of gap penalties, i.e., a gap creation penalty of 3.0 and
gap extension penalty of 0.1. Other structural alignment methods
include the hydrophobic cluster analysis (Gaboriaud et al., (1987),
FSBS LETTERS 224, pp. 149-155) and reverse threading (Huber, T;
Torda, A E, PROTEIN SCIENCE Vol. 7, No. 1 pp. 142-149 (1998).
[0047] Property ii) of the .alpha.-amylase, i.e., the immunological
cross reactivity, may be assayed using an antibody raised against,
or reactive with, at least one epitope of the relevant
Termamyl-like .alpha.-amylase. The antibody, which may either be
monoclonal or polyclonal, may be produced by methods known in the
art, e.g., as described by Hudson et al., Practical Immunology,
Third edition (1989), Blackwell Scientific Publications. The
immunological cross-reactivity may be determined using assays known
in the art, examples of which are Western Blotting or radial
immunodiffusion assay, e.g., as described by Hudson et al., 1989.
In this respect, immunological cross-reactivity between the
.alpha.-amylases having the amino acid sequences SEQ ID NOS: 1, 2,
3, 4, 5, 6, 7, or 8, respectively, has been found.
[0048] The oligonucleotide probe used in the characterisation of
the Termamyl-like .alpha.-amylase in accordance with property iii)
above may suitably be prepared on the basis of the full or partial
nucleotide or amino acid sequence of the .alpha.-amylase in
question.
[0049] Suitable conditions for testing hybridisation involve
pre-soaking in 5.times.SSC and prehybridising for 1 hour at
-40.degree. C. in a solution of 20% formamide, 5.times.Denhardt's
solution, 50 mM sodium phosphate, pH 6.8, and 50 mg of denatured
sonicated calf thymus DNA, followed by hybridisation in the same
solution supplemented with 100 mM ATP for 18 hours at -40.degree.
C., followed by three times washing of the filter in 2.times.SSC,
0.2% SDS at 40.degree. C. for 30 minutes (low stringency),
preferred at 50.degree. C. (medium stringency), more preferably at
65.degree. C. (high stringency), even more preferably at
.about.75.degree. C. (very high stringency). More details about the
hybridisation method can be found in Sambrook et al., Molecular
Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor,
1989.
[0050] In the present context, "derived from" is intended not only
to indicate an .alpha.-amylase produced or producible by a strain
of the organism in question, but also an .alpha.-amylase encoded by
a DNA sequence isolated from such strain and produced in a host
organism transformed with said DNA sequence. Finally, the term is
intended to indicate an .alpha.-amylase which is encoded by a DNA
sequence of synthetic and/or cDNA origin and which has the
identifying characteristics of the .alpha.-amylase in question. The
term is also intended to indicate that the parent .alpha.-amylase
may be a variant of a naturally occurring .alpha.-amylase, i.e. a
variant which is the result of a modification (insertion,
substitution, deletion) of one or more amino acid residues of the
naturally occurring .alpha.-amylase.
Parent Hybrid .alpha.-Amylases
[0051] The parent .alpha.-amylase (i.e., backbone .alpha.-amylase)
may be a hybrid .alpha.-amylase, i.e., an .alpha.-amylase which
comprises a combination of partial amino acid sequences derived
from at least two .alpha.-amylases.
[0052] The parent hybrid .alpha.-amylase may be one which on the
basis of amino acid homology and/or immunological cross-reactivity
and/or DNA hybridisation (as defined above) can be determined to
belong to the Termamyl-like .alpha.-amylase family. In this case,
the hybrid .alpha.-amylase is typically composed of at least one
part of a Termamyl-like .alpha.-amylase and part(s) of one or more
other .alpha.-amylases selected from Termamyl-like .alpha.-amylases
or non-Termamyl-like .alpha.-amylases of microbial (bacterial or
fungal) and/or mammalian origin.
[0053] Thus, the parent hybrid .alpha.-amylase may comprise a
combination of partial amino acid sequences deriving from at least
two Termamyl-like .alpha.-amylases, or from at least one
Termamyl-like and at least one non-Termamyl-like bacterial
.alpha.-amylase, or from at least one Termamyl-like and at least
one fungal .alpha.-amylase. The Termamyl-like .alpha.-amylase from
which a partial amino acid sequence derives may, e.g., be any of
those specific Termamyl-like .alpha.-amylase referred to
herein.
[0054] For instance, the parent .alpha.-amylase may comprise a
C-terminal part: of an .alpha.-amylase derived from a strain of B.
licheniformis, and a N-terminal part of an .alpha.-amylase derived
from a strain of B. amyloliquefaciens or from a strain of B.
stearothermophilus. For instance, the parent .alpha.-amylase may
comprise at least 430 amino acid residues of the C-terminal part of
the B. licheniformis .alpha.-amylase, and may, e.g., comprise a) an
amino acid segment corresponding to the 37 N-terminal amino acid
residues of the B. amyloliquefaciens .alpha.-amylase having the
amino acid sequence shown in SEQ ID NO: 5 and an amino acid segment
corresponding to the 445 C-terminal amino acid residues of the B.
licheniformis .alpha.-amylase having the amino acid sequence shown
in SEQ ID NO: 4, or a hybrid Termamyl-like .alpha.-amylase being
identical to the Termamyl sequence, i.e., the Bacillus
licheniformis .alpha.-amylase shown in SEQ ID NO: 4, except that
the N-terminal 35 amino acid residues (of the mature protein) has
been replaced by the N-terminal 33 residues of BAN (mature
protein), i.e., the Bacillus amyloliquefaciens .alpha.-amylase
shown in SEQ ID NO: 5; or b) an amino acid, segment corresponding
to the 68 N-terminal amino acid residues of the B.
stearothermophilus .alpha.-amylase having the amino acid sequence
shown in SEQ ID NO: 3 and an amino acid segment corresponding to
the 415 C-terminal amino acid residues of the B. licheniformis
.alpha.-amylase having the amino acid sequence shown in SEQ ID NO:
4.
[0055] Another suitable parent hybrid .alpha.-amylase is the one
previously described in WO 96/23374 (from Novo Nordisk)
constituting the N-terminus of BAN, Bacillus amyloliquefaciens
.alpha.-amylase (amino acids 1-300 of the mature protein) and the
C-terminus from Termamyl (amino acids 301-483 of the mature
protein). Increased activity was achieved by substituting one or
more of the following positions of the above hybrid .alpha.-amylase
(BAN:1-300/Termamyl:301-483); Q360, F290, and N.sub.102.
Particularly interesting substitutions are one or more of the
following substitutions: Q360E,D; F290A, C, D, E, G, H, I, K, L, M,
N, P,Q, R,S,T; N.sub.102D, E;
[0056] The corresponding positions in the SP722 .alpha.-amylase
shown in SEQ ID NO: 2 are one or more of: S365, Y2 95, N106.
Corresponding substitutions of particular interest in said
.alpha.-amylase shown in SEQ ID NO: 2 are one or more of: S365D,E;
Y295A,C,D,E,G,H,I,K,L,M,N,P,Q,R,S,T; and N106D,E.
[0057] The corresponding positions in the SP690 .alpha.-amylase
shown in SEQ ID NO: 1 are one or more of: S365, Y295, N.sub.106.
The corresponding substitutions of particular interest are one or
more of: S365D,E; Y295 A,C,D,E,G,H,I,K,L,M,N,P,Q,R,S,T;
N106D.E.
[0058] The above mentioned non-Termamyl-like .alpha.-amylase may,
e.g., be a fungal .alpha.-amylase, a mammalian or a plant
.alpha.-amylase or a bacterial .alpha.-amylase (different from a
Termamyl-like .alpha.-amylase). Specific examples of such
.alpha.-amylases include the Aspergillus oryzae TAKA
.alpha.-amylase, the A. niger acid .alpha.-amylase, the Bacillus
subtilis .alpha.-amylase, the porcine pancreatic .alpha.-amylase
and a barley .alpha.-amylase. All of these .alpha.-amylases have
elucidated structures which are markedly different from the
structure of a typical Termamyl-like .alpha.-amylase as referred to
herein.
[0059] The fungal .alpha.-amylases mentioned above, i.e., derived
from A. niger and A. oryzae, are highly homologous on the amino
acid level and generally considered to belong to the same family of
.alpha.-amylases. The fungal .alpha.-amylase derived from
Aspergillus oryzae is commercially available under the tradename
Fungamyl.TM..
[0060] Furthermore, when a particular variant of a Termamyl-like
.alpha.-amylase (variant of the invention) is referred to--in a
conventional manner--by reference to modification (e.g., deletion
or substitution) of specific amino acid residues in the amino acid
sequence of a specific Termamyl-like .alpha.-amylase, it is to be
understood that variants of another Termamyl-like .alpha.-amylase
modified in the equivalent position(s) (as determined from the best
possible amino acid sequence alignment between the respective amino
acid sequences) are encompassed thereby.
[0061] In a preferred embodiment of the invention the
.alpha.-amylase backbone is derived from B. licheniformis (as the
parent Termamyl-like .alpha.-amylase), e.g., one of those referred
to above, such as the B. licheniformis .alpha.-amylase having the
amino acid sequence shown in SEQ ID NO: 4.
Altered Properties of Variants of the Invention
[0062] The following discusses the relationship between mutations
which are present in variants of the invention, and desirable
alterations in properties (relative to those a parent Termamyl-like
.alpha.-amylase) which may result therefrom.
Improved Stability at pH 8-10.5
[0063] In the context of the present invention, mutations
(including amino acid substitutions) of importance with respect to
achieving improved stability at high pH (i.e., pH 8-10.5) include
mutations corresponding to mutations in one or more of the
following positions in SP722 .alpha.-amylase (having the amino acid
sequence shown in SEQ ID NO: 2): T141, K142, F143, D144, F145,
P146, G147, R148, G149, R181, A186, S193, N195, K269, N270, K311,
K458, P459, T461.
[0064] The variant of the invention have one or more of the
following substitutions (using the SEQ ID NO: 2 numbering):
TABLE-US-00002 T141A, D, R, N, C, E, Q, G, H, I, L, K, M, F, P, S,
W, Y, V; K142A, D, R, N, C, E, Q, G, H, I, L, M, F, P, S, T, W, Y,
V; F143A, D, R, N, C, E, Q, G, H, I, L, K, M, P, S, T, W, Y, V;
D144A, R, N, C, E, Q, G, H, I, L, K, M, F, P, S, T, W, Y, V; F145A,
D, R, N, C, E, Q, G, H, I, L, K, M, P, S, T, W, Y, V; P146A, D, R,
N, C, E, Q, G, H, I, L, K, M, F, S, T, W, Y, V; G147A, D, R, N, C,
E, Q, H, I, L, K, M, F, P, S, T, W, Y, V; R148A, D, N, C, E, Q, G,
H, I, L, K, M, F, P, S, T, W, Y, V; G149A, D, R, N, C, E, Q, H, I,
L, K, M, F, P, S, T, W, Y, V; K181A, D, R, N, C, E, Q, G, H, I, L,
M, F, P, S, T, W, Y, V; A186D, R, N, C, E, Q, G, H, I, L, P, K, M,
F, S, T, W, Y, V; S193A, D, R, N, C, E, Q, G, H, I, L, K, M, F, P,
T, W, Y, V; N195A, D, R, C, E, Q, G, H, I, L, K, M, F, P, S, T, W,
Y, V; K269A, D, R, N, C, E, Q, G, H, I, L, M, F, P, S, T, W, Y, V;
N270A, D, R, C, E, Q, G, H, I, L, K, M, F, P, S, T, W, Y, V; K311A,
D, R, N, C, E, Q, G, H, I, L, M, F, P, S, T, W, Y, V; K458A, D, R,
N, C, E, Q, G, H, I, L, M, F, P, S, T, W, Y, V; P459A, D, R, N, C,
E, Q, G, H, I, L, K, M, F, S, T, W, Y, V; T461A, D, R, N, C, E, Q,
G, H, I, L, K, M, F, P, S, W, Y, V.
[0065] Preferred, high pH stability variants include one or more of
the following substitutions in the SP722 .alpha.-amylase (having
the amino acid sequence shown in SEQ ID NO: 2):
K142R, R1813, A186T, S193P, N195F, K269R, N270Y, K311R, K458R,
P459T and T461P.
[0066] In specific embodiments the Bacillus strain NCIB 12512
.alpha.-amylase having the sequence shown in SEQ ID NO: 1, or the
B. stearothermophilus .alpha.-amylase having the sequence shown in
SEQ ID NO: 3, or the B. licheniformis .alpha.-amylase having the
sequence shown in SEQ ID NO: 4, or the S, amyloliquefaciens
.alpha.-amylase having the sequence shown in SEQ ID NO: 5 is used
as the backbone, i.e., parent Termamyl-like .alpha.-amylase, for
these mutations.
[0067] As can been seen from the alignment in FIG. 1 the B.
stearothermophilus .alpha.-amylase already has a Tyrosine at
position corresponding to N270 in SP722. Further, the Bacillus
strain NCIB 12512 .alpha.-amylase, the B. stearothermophilus
.alpha.-amylase, the B. licheniformis .alpha.-amylase and the B.
amyloliquefaciens .alpha.-amylase already have Arginine at position
corresponding to K458 in SP722. Furthermore, the B. licheniformis
.alpha.-amylase already has a Proline at position corresponding to
T461 in SP722. Therefore, for said .alpha.-amylases these
substitutions are not relevant.
[0068] .alpha.-amylase variants with improved stability at high pH
can be constructed by making substitutions in the regions found
using the molecular dynamics simulation mentioned in Example 2. The
simulation depicts the region(s) that has a higher flexibility or
mobility at high pH (i.e., pH 8-10.5) when compared to medium
pH.
[0069] By using the structure of any bacterial alpha-amylase with
homology (as defined below) to the Termamyl-like .alpha.-amylase
(BA2), of which the 3D structure is disclosed in Appendix 1 of WO
96/23874 (from Novo Nordisk), it is possible to model build the
structure of such alpha-amylase and to subject it to molecular
dynamics simulations. The homology of said bacterial
.alpha.-amylase may be at least 60%, preferably be more than 70%,
more preferably more than 80%, most preferably more than 90%
homologous to the above mentioned Termamyl-like .alpha.-amylase
(BA2), measured using the UWGCG GAP program from the GCG package
version 7.3 (June 1993) using default values for GAP penalties
[Genetic Computer Group (1991) Programme Manual for the GCG
Package, version 7, 575 Science Drive, Madison, Wis., USA 53711],
Substitution of the unfavorable residue for another would be
applicable.
Improved Ca.sup.2+ Stability at pH 8-10.5.
[0070] Improved Ca stability means the stability of the enzyme
under Ca.sup.+ depletion has been improved. In the context of the
present invention, mutations (including amino acid substitutions)
of importance with respect to achieving improved Ca.sup.2+
stability at high pH include mutation or deletion in one or more
positions corresponding to the following positions in the SP722
.alpha.-amylase having the amino acid sequence shown in SEQ ID NO;
2: R181, G182, D183, G184, K185, A18S, W189, M195, N270, E346,
K385, K458, P459.
[0071] A variant of the invention have one or more of the following
substitutions or deletions:
TABLE-US-00003 R181*, A, D, N, C, E, Q, G, H, I, L, K, M, F, P, S,
T, W, Y, V; G182*, A, D, R, N, C, E, Q, H, I, L, K, M, F, P, S, T,
W, Y, V; D183*, A, R, N, C, E, Q, G, H, I, L, K, M, F, P, S, T, W,
Y, V; G184*, A, R, D, N, C, E, Q, H, I, L, K, M, F, P, S, T, W, Y,
V; K185A, D, R, N, C, E, Q, G, H, I, L, M, F, P, S, T, W, Y, V;
A186D, R, N, C, E, Q, G, H, I, L, K, M, F, P, S, T, W, Y, V; W189A,
D, R, N, C, E, Q, G, H, I, L, K, M, F, P, S, T, Y, V; N195A, D, R,
C, E, Q, G, H, I, L, K, M, F, P, S, T, W, Y, V; N270A, R, D, N, C,
E, Q, H, I, L, K, M, F, P, S, T, W, Y, V; E346A, R, D, N, C, Q, G,
H, I, L, K, M, F, P, S, T, W, Y, V; K385A, R, D, N, C, E, Q, G, H,
I, L, M, F, P, S, T, W, Y, V; K458A, R, D, N, C, E, Q, G, H, I, L,
M, F, P, S, T, W, Y, V; P459A, R, D, N, C, E, Q, G, H, I, L, K, M,
F, S, T, W, Y, V.
[0072] Preferred are variants having one or more of the following
substitutions or deletions:
R181Q,N; G182T,S,N; D183*; G184*;
K185A,R,D,C,E,Q,G,H,I,L,F,P,S,T,W,Y,V; A186T,S,N,I,V;
W189T,S,N,Q; N195F, N27GR,D; E346Q; K385R; K458R; P459T.
[0073] In specific embodiments the Bacillus strain NCIB 12512
.alpha.-amylase having the sequence shown in SEQ ID NO: 1, or the
B. amyloliquefaciens .alpha.-amylase having the sequence shown in
SEQ ID NO: 5, or the B. licheniformis .alpha.-amylase having the
sequence shown in SEQ ID NO: 4 are used as the backbone for these
mutations.
[0074] As can been seen from the alignment in FIG. 1 the B.
licheniformis .alpha.-amylase does not have the positions
corresponding to D183 and G184 in SP722. Therefore for said
.alpha.-amylases these deletions are not relevant.
[0075] In a preferred embodiment the variant is the Bacillus strain
NCTB 12512 .alpha.-amylase with deletions in D183 and G184 and
further one of the following substitutions: R181Q,N and/or
G182T,S,N and/or D183*; G184* and/or
K185A,R, D, C, E, Q, G, H,I,L,M,N,F,P,S,T,W,Y,V and/or
A186T,S,N,I,V and/or W189T,S,N,Q and/or N195F and/or N270R,D and/or
E346Q and/or F385R and/or K458R and/or P459T,
Increased Specific Activity at Medium Temperature
[0076] In a further aspect of the present invention, important
mutations with respect to obtaining variants exhibiting increased
specific activity at temperatures from 10-60.degree. C., preferably
20-50.degree. C., especially 30-40.degree. C., include mutations
corresponding to one or more of the following positions in the
SP722 .alpha.-amylase having the amino acid sequence shown in SEQ
ID NO: 2:
H107, K108, G109, D166, W167, D168, Q169, S170, R171, Q172, F173,
Q174, D183, G184, N195, F267, W268, K269, N270, D271, L272, G273,
A274, L275, G456, N457, K458, P459, G460, T461, V462, T463.
[0077] The variant, of the invention have one or more of the
following substitutions:
TABLE-US-00004 H107A, D, R, N, C, E, Q, G, I, L, K, M, F, P, S, T,
W, Y, V; K108A, D, R, N, C, E, Q, G, H, I, L, M, F, P, S, T, W, Y,
V; G109A, D, R, N, C, E, Q, H, I, L, K, M, F, P, S, T, W, Y, V;
D166A, R, N, C, E, Q, G, H, I, L, K, M, F, P, S, T, W, Y, V; W167A,
D, R, N, C, E, Q, G, H, I, L, K, M, F, P, S, T, Y, V; D168A, R, N,
C, E, Q, G, H, I, L, K, M, F, P, S, T, W, Y, V; Q169A, D, R, N, C,
E, G, H, I, L, K, M, F, P, S, T, W, Y, V; S170A, D, R, N, C, E, Q,
G, H, I, L, K, M, F, P, T, W, Y, V; R171A, D, N, C, E, Q, G, H, I,
L, K, M, F, P, S, T, W, Y, V; Q172A, D, R, N, C, E, G, H, I, L, K,
M, F, P, S, T, W, Y, V; F173A, D, R, N, C, E, Q, G, H, I, L, K, M,
P, S, T, W, Y, V; Q174*, A, D, R, N, C, E, G, H, I, L, K, M, F, P,
S, T, W, Y, V; D183*, A, D, R, N, C, E, Q, G, H, I, L, K, M, F, P,
S, W, Y, V; G184*, A, R, N, C, E, Q, G, H, I, L, K, M, F, P, S, T,
W, Y, V; N195A, D, R, C, E, Q, G, H, I, L, K, M, F, P, S, T, W, Y,
V; F267A, D, R, N, C, E, Q, G, H, I, L, K, M, P, S, T, W, Y, V;
W268A, D, R, N, C, E, Q, G, H, I, L, K, M, F, P, S, T, Y, V; K269A,
D, R, N, C, E, Q, G, H, I, L, M, F, P, S, T, W, Y, V; N270A, D, R,
C, E, Q, G, H, I, L, K, M, F, P, S, T, W, Y, V; D271A, R, N, C, E,
Q, G, H, I, L, K, M, F, P, S, T, W, Y, V; L272A, D, R, N, C, E, Q,
G, H, I, K, M, F, P, S, T, W, Y, V; G273A, D, R, N, C, E, Q, H, I,
L, K, M, F, P, S, T, W, Y, V; A274D, R, N, C, E, Q, G, H, I, L, K,
M, F, P, S, T, W, Y, V; L275A, D, R, N, C, E, Q, G, H, I, K, M, F,
P, S, T, W, Y, V; G456A, D, R, N, C, E, Q, H, I, L, K, M, F, P, S,
T, W, Y, V; N457A, D, R, C, E, Q, G, H, I, L, K, M, F, P, S, T, W,
Y, V; K458A, D, R, N, C, E, Q, G, H, I, L, M, F, P, S, T, W, Y, V;
P459A, D, R, N, C, E, Q, G, H, I, L, K, M, F, S, T, W, Y, V; G460A,
D, R, N, C, E, Q, H, I, L, K, M, F, P, S, T, W, Y, V; T461A, D, R,
N, C, E, Q, G, H, I, L, K, M, F, P, S, W, Y, V; V462A, D, R, N, C,
E, Q, G, H, I, L, K, M, F, P, S, T, W, Y; T463A, D, R, N, C, E, Q,
G, H, I, L, K, M, F, P, S, W, Y, V.
[0078] Preferred variants has one or more of the following
substitutions or deletions: .quadrature.174*, D183*, G184*,
K269S.
[0079] In a specific embodiment the B. licheniformis
.alpha.-amylase having the sequence shown in SEQ ID NO: 4 is used
as the backbone for these mutations.
General Mutations in Variants Invention: Increased Specific
Activity at Medium Temperatures
[0080] The particularly interesting amino acid substitution are
those that increase the mobility around the active site of the
enzyme. This is accomplished by changes that disrupt stabilizing
interaction in the vicinity of the active site, i.e., within
preferably 10 .ANG. or 8 .ANG. or 6 .ANG. or 4 .ANG. from any of
the residues constituting the active site.
[0081] Examples are mutations that reduce the size of side chains,
such as
Ala to Gly,
Val to Ala or Gly,
Ile or Leu to Val, Ala, or Gly
Thr to Ser
[0082] Such mutations are expected to cause increased flexibility
in the active site region either by the introduction of cavities or
by the structural rearrangements that fill the space left by the
mutation.
[0083] It may be preferred that a variant of the invention
comprises one or more modifications in addition to those outlined
above. Thus, it may be advantageous that one or more Proline
residues present in the part of the .alpha.-amylase variant which
is modified is/are replaced with a non-Proline residue which may be
any of the possible, naturally occurring non-Proline residues, and
which preferably is an Alanine, Glycine, Serine, Threonine, Valine
or Leucine.
[0084] Analogously, it may be preferred that one or more Cysteine
residues present among the amino acid residues with which the
parent .alpha.-amylase is modified is/are replaced with a
non-Cysteine residue such as Serine, Alanine, Threonine, Glycine,
Valine or Leucine.
[0085] Furthermore, a variant of the invention may--either as the
only modification or in combination with any of the above outlined
modifications--be modified so that one or more Asp and/or Glu
present in an amino acid fragment corresponding to the amino acid
fragment 185-209 of SEQ ID NO: 4 is replaced by an Asn and/or Gln,
respectively. Also of interest is the replacement, in the
Termamyl-like .alpha.-amylase, of one or more of the Lys residues
present in an amino acid fragment corresponding to the amino acid
fragment 185-209 of SEQ ID NO: 4 by an Arg.
[0086] It will be understood that the present invention encompasses
variants incorporating two or more of the above outlined
modifications.
[0087] Furthermore, it may be advantageous to introduce
point-mutations in any of the variants described herein.
.alpha.-Amylase Variants Having Increased Mobility Around the
Active Site:
[0088] The mobility of .alpha.-amylase variants of the invention
may be increased by replacing one or more amino acid residue at one
or more positions close to the substrate site. These positions are
(using the SP722 .alpha.-amylase (SEQ ID NO: 2) numbering): V56,
K108, D168, Q169, Q172, L201, K269, L272, L275, K446, P45S.
[0089] Therefore, in an aspect the invention relates to variants
being mutated in one or more of the above mentioned positions.
[0090] Preferred substitutions are one or more of the
following:
TABLE-US-00005 V56A, G, S, T; K108A, D, E, Q, G, H, I, L, M, N, S,
T, V; D168A, G, I, V, N, S, T; Q169A, D, G, H, I, L, M, N, S, T, V;
Q172A, D, G, H, I, L, M, N, S, T, V; L201A, G, I, V, S, T; K269A,
D, E, Q, G, H, I, L, M, N, S, T, V; L272A, G, I, V, S, T; L275A, G,
I, V, S, T; Y295A, D, E, Q, G, H, I, L, M, N, F, S, T, V; K446A, D,
E, Q, G, H, I, L, M, N, S, T, V; P459A, G, I, L, S, T, V.
[0091] In specific embodiments of the invention the Bacillus strain
NCIB 12512 .alpha.-amylase having the sequence shown in SEQ ID NO:
1, or the B. stearothermophilus ex-amylase having the sequence
shown in SEQ ID NO: 3, or the B. licheniformis .alpha.-amylase
having the sequence shown in SEQ ID NO; 4, or the B.
amyloliquefaciens .alpha.-amylase having the sequence shown in SEQ
ID NO: 5 are used as the backbone for these mutations.
[0092] As can been seen from the alignment in FIG. 1 the B.
licheniformis .alpha.-amylase and the B. amyloliquefaciens
.alpha.-amylase have a Glut amine at position corresponding to K269
in SP722. Further, the B. stearothermophilus .alpha.-amylase has a
Serine at position corresponding to K269 in SP722Therefore, for
said .alpha.-amylases these substitutions are not relevant.
[0093] Furthermore, as can been seen from the alignment in FIG. 1
the B. amyloliquefaciens .alpha.-amylase has an Alanine at position
corresponding to L272 in SP722, and the B. stearothermophilus
.alpha.-amylase has a Isoleucine at the position corresponding to
L272 in SP722. Therefore, for said .alpha.-amylases these
substitutions are not relevant.
[0094] As can been seen from the alignment in FIG. 1, the Bacillus
strain 12512 .alpha.-amylase has a Isoleucine at position
corresponding to L275 in SP722. Therefore for said .alpha.-amylase
this substitution is not relevant.
[0095] As can been seen from the alignment in FIG. 1 the B.
amyloliquefaciens .alpha.-amylase has a Phenylalanine at position
corresponding to 295 in SP722. Further, the B. stearothermophilus
.alpha.-amylase has an Asparagine at position corresponding to Y295
in SP722. Therefore, for said .alpha.-amylases these substitutions
are not relevant.
[0096] As can been seen from the alignment in FIG. 1 the B.
licheniformis .alpha.-amylase and the B. amyloliquefaciens
.alpha.-amylase have a Asparagine at position corresponding to K446
in SP722. Further, the B. stearothermophilus .alpha.-amylase has a
Histidine at position corresponding to K446 in SP722. Therefore,
for said a-amylases these substitutions are not relevant.
[0097] As can been seen from the alignment in FIG. 1 the B.
licheniformis .alpha.-amylase, the B. amyloliquefaciens
.alpha.-amylase and the B. stearothermophilus .alpha.-amylase have
a Serine at position corresponding to P459 in SP722. Further, the
Bacillus strain 12512.alpha.-amylase has a Threonine at position
corresponding to P459 in SP722. Therefore, for said
.alpha.-amylases these substitutions are not relevant.
Stabilization of Enzymes Having High Activity at Medium
Temperatures.
[0098] In a further embodiment, the invention relates to improving
the stability of low temperature .alpha.-amylases (e.g.,
Alteromonas haloplanctis (Feller et al., (1994), Eur. J. Biochem
222:441-447), and medium temperature .alpha.-amylases (e.g., SP722
and SP690) possessing medium temperature activity, i.e., commonly
known as psychrophilic enzymes and mesophilic enzymes. The
stability can for this particular enzyme class be understood either
as thermostability or the stability at Calcium depletion
conditions.
[0099] Typically, enzymes displaying the high activity at medium
temperatures also display severe problems under conditions that
stress the enzyme, such as temperature or Calcium depletion.
[0100] Consequently, the objective is to provide enzymes that at
the same time display the desired high activity at medium
temperatures without loosing their activity under slightly stressed
conditions.
[0101] The activity of the stabilized variant measured at medium
temperatures should preferably be between 100% or more and 50%, and
more preferably between 100% or more and 70%, and most preferably
between 100% or more and 85% of the original activity at that
specific temperature before stabilization of the enzyme and the
resulting enzyme should withstand longer incubation at stressed
condition than the wild type enzyme.
[0102] Contemplated enzymes include .alpha.-amylases of, e.g.,
bacterial or fungal origin.
[0103] An example of such a low temperature .alpha.-amylase is the
one isolated from Alteromonas haloplanctis (Feller et. al., (1994),
Eur. J. Biochem 222:441-447). The crystal structure of this
alpha-amylase has been solved (Aghajari et al., (1998), Protein
Science 7:564-572).
[0104] The A. haloplanctis alpha-amylase (5 in alignment shown in
FIG. 4) has a homology of approximately 66% to porcine pancreatic
alpha-amylase (PPA) (3 in the alignment shown in FIG. 4). The PPA
3D structure is known, and can be obtained from Brookhaven database
under the name 1OSE or 1DHK. Based on the homology to other mare
stable alpha amylases, stabilization of "the low temperature highly
active enzyme" from Alteromonas haloplanctis alpha-amylase, can be
obtained and at the same time retaining the desired high activity
at medium temperatures.
[0105] FIG. 4 shown a multiple sequence alignments of five
.alpha.-amylases, including the AHA and the PPA .alpha.-amylase.
Specific mutations giving increased stability in Alteromoxias
haloplantis alpha-amylase:
T66P, Q69P, R155P, Q177R, A205P, A232P, L243R, V295P, S315R.
Methods for Preparing .alpha.-Amylase Variants
[0106] Several methods for introducing mutations into genes are
known in the art. After a brief discussion of the cloning of
.alpha.-amylase-encoding DNA sequences, methods for generating
mutations at specific sites within the .alpha.-amylase-encoding
sequence will be discussed.
Cloning a DNA Sequence Encoding an .alpha.-AmylaseCloning a DMA,
Sequence Encoding an a-AmylaseCloning a DNA Sequence Encoding an
a-AmylaseCloning a DNA Sequence Encoding an a-AmylaseCloning a DNA
Sequence Encoding an a-AmylaseCloning a DNA Sequence Encoding an
a-AmylaseCloning a DNA Sequence Encoding an a-AmylaseCloning a DNA
Sequence Encoding an a-AmylaseCloning a DNA Sequence Encoding an
a-Amylase
[0107] The DNA sequence encoding a parent .alpha.-amylase may be
isolated from any cell or microorganism producing the
.alpha.-amylase in question, using various methods well known in
the art. First, a genomic DNA and/or cDNA library should be
constructed using chromosomal DNA or messenger RNA from the
organism that produces the .alpha.-amylase to be studied. Then, if
the amino acid sequence of the .alpha.-amylase is known,
homologous, labeled oligonucleotide probes may be synthesized and
used to identify .alpha.-amylase-encoding clones from a genomic
library prepared from the organism in question. Alternatively, a
labeled oligonucleotide probe containing sequences homologous to a
known .alpha.-amylase gene could be used as a probe to identify
.alpha.-amylase-encoding clones, using hybridisation and washing
conditions of lower stringency.
[0108] Yet another method for identifying .alpha.-amylase-encoding
clones would involve inserting fragments of genomic DNA into an
expression vector, such as a plasmid, transforming
.alpha.-amylase-negative bacteria with the resulting genomic DMA
library, and then plating the transformed bacteria onto agar
containing a substrate for .alpha.-amylase, thereby allowing clones
expressing the .alpha.-amylase to be identified.
[0109] Alternatively, the DNA sequence encoding the enzyme may be
prepared synthetically by established standard methods, e.g., the
phosphoroamidite method described by S. L. Beaucage and M. H.
Caruthers (1981) or the method described by Matthes et al. (1984).
In the phosphoroamidite method, oligonucleotides are synthesized,
e.g., in an automatic DMA synthesizer, purified, annealed, ligated
and cloned in appropriate vectors.
[0110] Finally, the DNA sequence may be of mixed genomic and
synthetic origin, mixed synthetic and cDNA origin or mixed genomic
and cDNA origin, prepared by ligating fragments of synthetic,
genomic or cDNA origin (as appropriate, the fragments corresponding
to various parts of the entire DNA sequence), in accordance with
standard techniques. The DNA sequence may also be prepared by
polymerase chain reaction (PCR) using specific primers, for
instance as described in U.S. Pat. No. 4,683,202 or R. K. Saiki et
al. (1988).
Expression of .alpha.-Amylase Variants
[0111] According to the invention, a DNA sequence encoding the
variant produced by methods described above, or by any alternative
methods known in the art, can be expressed, in enzyme form, using
an expression vector which typically includes control sequences
encoding a promoter, operator, ribosome binding site, translation
initiation signal, and, optionally, a repressor gene or various
activator genes.
[0112] The recombinant expression vector carrying the DNA sequence
encoding an .alpha.-amylase variant of the invention may be any
vector which may conveniently be subjected to recombinant DNA
procedures, and the choice of vector will often depend on the host
cell into which it is to be introduced. Thus, the vector may be an
autonomously replicating vector, i.e., a vector which exists as an
extrachromosomal entity, the replication of which is independent of
chromosomal replication, e.g., a plasmid, a bacteriophage or an
extrachromosomal element, minichromosome or an artificial
chromosome. Alternatively, the vector may be one which, when
introduced into a host cell, is integrated into the host cell
genome and replicated together with the chromosome(s) into which it
has been integrated.
[0113] In the vector, the DNA sequence should be operably connected
to a suitable promoter sequence. The promoter may be any DNA
sequence which shows transcriptional activity in the host cell of
choice and may be derived from genes encoding proteins either
homologous or heterologous to the host cell. Examples of suitable
promoters for directing the transcription of the DNA sequence
encoding an .alpha.-amylase variant of the invention, especially in
a bacterial host, are the promoter of the lac operon of E. coli,
the Streptomyces coelicolor agarase gene dagA promoters, the
promoters of the Bacillus licheniformis .alpha.-amylase gene
(amyL), the promoters of the Bacillus stearothermophilus maltogenic
amylase gene (amyM), the promoters of the Bacillus
amyloliquefaciens .alpha.-amylase (amyQ), the promoters of the
Bacillus subtilis xylA and xylB genes etc. For transcription in a
fungal host, examples of useful promoters are those derived from
the gene encoding A, oryzae TAKA amylase, Rhizomucor miehei
aspartie proteinase, A. niger neutral .alpha.-amylase, A. niger
acid stable .alpha.-amylase, A. niger glucoamylase, Rhizomucor
miehei lipase, A. oryzae alkaline protease, A. oryzae triose
phosphate isomerase or A. nidulans acetamidase.
[0114] The expression vector of the invention may also comprise a
suitable transcription terminator and, in eukaryotes,
poly-adenylation sequences operably connected to the DNA sequence
encoding the .alpha.-amylase variant, of the invention. Termination
and polyadenyiation sequences may suitably be derived from the same
sources as the promoter.
[0115] The vector may further comprise a DNA sequence enabling the
vector to replicate in the host cell in question. Examples of such
sequences are the origins of replication of plasmids pUC19,
pACYC177, pUB110, pE194, pAMB1 and pJJ702.
[0116] The vector may also comprise a selectable marker, e.g. a
gene the product of which complements a defect in the host cell,
such as the dal genes from B. subtilis or B. licheniformis, or one
which confers antibiotic resistance such as ampicillin, kanamycin,
chloramphenicol or tetracyclin resistance. Furthermore, the vector
may comprise Aspergillus selection markers such as amdS, argB, niaD
and sC, a marker giving rise to hygromycin resistance, or the
selection may be accomplished by cotransformation, e.g., as
described in WO 91/17243.
[0117] While intracellular expression may be advantageous in some
respects, e.g., when using certain bacteria as host cells, it is
generally preferred that the expression is extracellular. In
general, the Bacillus .alpha.-amylases mentioned herein comprise a
pre-region permitting secretion of the expressed protease into the
culture medium. If desirable, this preregion may be replaced by a
different preregion or signal sequence, conveniently accomplished
by substitution of the DNA sequences encoding the respective
preregions.
[0118] The procedures used to ligate the DNA construct of the
invention encoding an .alpha.-amylase variant, the promoter,
terminator and other elements, respectively, and to insert, them
into suitable vectors containing the information necessary for
replication, are well known to persons skilled in the art (cf., for
instance, Sambrook et al., Molecular Cloning: A Laboratory Manual,
2nd Ed., Cold Spring Harbor, 1989).
[0119] The cell of the invention, either comprising a DNA construct
or an expression vector of the invention as defined above, is
advantageously used as a host cell in the recombinant production of
an .alpha.-amylase variant of the invention. The cell may be
transformed with the DNA construct of the invention encoding the
variant, conveniently by integrating the DMA construct (in one or
more copies) in the host chromosome. This integration is generally
considered to be an advantage as the DNA sequence is more likely to
be stably maintained in the cell. Integration of the DNA constructs
into the host chromosome may be performed according to conventional
methods, e.g., by homologous or heterologous recombination.
Alternatively, the cell may be transformed with an expression
vector as described above in connection with the different types of
host cells.
[0120] The cell of the invention may be a cell of a higher organism
such as a mammal or an insect, but is preferably a microbial cell,
e.g. a bacterial or a fungal (including yeast) cell.
[0121] Examples of suitable bacteria are Gram positive bacteria
such as Bacillus subtilis, Bacillus licheniformis, Bacillus lentus,
Bacillus brevis, Bacillus stearothermophilus, Bacillus
alkalo-philus, Bacillus amyloliquefaciens, Bacillus coagulans,
Bacillus circulans, Bacillus lautus, Bacillus megaterium, Bacillus
thuringiensis, or Streptomyces lividans or Streptomyces murinus, or
gramnegative bacteria such as E. coli. The transformation of the
bacteria may, for instance, be effected by protoplast
transformation or by using competent cells in a manner known per
se.
[0122] The yeast organism may favorably be selected from a species
of Saccharomyces or Schizosaccharomyces, e.g. Saccharomyces
cerevisiae. The filamentous fungus may advantageously belong to a
species of Aspergillus, e.g., Aspergillus oryzae or Aspergillus
niger. Fungal cells may be transformed by a process involving
protoplast formation and transformation of the protoplasts followed
by regeneration of the cell wall in a manner known per se. A
suitable procedure for transformation of Aspergillus host cells is
described in EP 238 023.
[0123] In a yet further aspect, the present invention relates to a
method of producing an .alpha.-amylase variant of the invention,
which method comprises cultivating a host cell as described above
under conditions conducive to the production of the variant and
recovering the variant from the cells and/or culture medium.
[0124] The medium used to cultivate the cells may be any
conventional medium suitable for growing the host, cell in question
and obtaining expression of the .alpha.-amylase variant of the
invention. Suitable media are available from commercial suppliers
or may be prepared according to published recipes (e.g. as
described in catalogues of the American Type Culture
Collection).
[0125] The .alpha.-amylase variant secreted from the host cells may
conveniently be recovered from the culture medium by well-known
procedures, including separating the cells from the medium by
centrifugation or filtration, and precipitating proteinaceous
components of the medium by means of a salt such as ammonium
sulphate, followed by the use of chromatographic procedures such as
ion exchange chromatography, affinity chromatography, or the
like.
INDUSTRIAL APPLICATIONS
[0126] The .alpha.-amylase variants of this invention possesses
valuable properties allowing for a variety of industrial
applications. In particular, enzyme variants of the invention are
applicable as a component in washing, dishwashing and hard-surface
cleaning detergent compositions.
[0127] Numerous variants are particularly useful in the production
of sweeteners and ethanol from starch, and/or for textile desizing.
Conditions for conventional starch-conversion processes, including
starch liquefaction and/or saccharification processes, are
described in, e.g., U.S. Pat. No. 3,912,590 and in BP patent
publications Nos. 252,730 and 63,909,
Detergent Compositions
[0128] As mentioned above, variants of the invention may suitably
be incorporated in detergent, compositions. Reference is made, for
example, to WO 96/23874 and WO 97/07202 for further details
concerning relevant ingredients of detergent compositions (such as
laundry or dishwashing detergents), appropriate methods of
formulating the variants in such detergent compositions, and for
examples of relevant types of detergent compositions.
[0129] Detergent compositions comprising a variant of the invention
may additionally comprise one or more other enzymes, such as a
lipase, cutinase, protease, cellulase, peroxidase or laccase,
and/or another .alpha.-amylase.
[0130] .alpha.-amylase variants of the invention may be
incorporated in detergents at conventionally employed
concentrations. It is at present contemplated that a variant of the
invention may be incorporated in an amount corresponding to
0.00001-1 mg (calculated as pure, active enzyme protein) of
.alpha.-amylase per liter of wash/dishwash liquor using
conventional dosing levels of detergent.
[0131] The invention also relates to a method of providing
.alpha.-amylases with 1) altered pH optimum, and/or 2) altered
temperature optimum, and/or 3) improved stability, comprising the
following steps:
i) identifying (a) target position(s) and/or region(s) for mutation
of the .alpha.-amylase by comparing the molecular dynamics of two
or more .alpha.-amylase 3D structures having substantially
different pH, temperature and/or stability profiles, ii)
substituting, adding and/or deleting one or more amino acids in the
identified position(s) and/or region(s).
[0132] In embodiment of the invention a medium temperature
.alpha.-amylase is compared with a high temperature
.alpha.-amylase. In another embodiment a low temperature
.alpha.-amylase is compared with either a medium or a high
temperature .alpha.-amylase.
[0133] The .alpha.-amylases compared should preferably be at least
70%, preferably 80%, up to 90%, such as up to 95%, especially 95%
homologous with each other.
[0134] The .alpha.-amylases compared may be Termamyl-like
.alpha.-amylases as defined above. In specific embodiment the
.alpha.-amylases compared are the .alpha.-amylases shown in SEQ ID
NO; 1 to SEQ ID NO: 8.
[0135] In another embodiment the stability profile of the
.alpha.-amylases in question compared are the Ca.sup.2+ dependency
profile.
Materials and Methods
Enzymes:
[0136] SP722: (SEQ ID NO: 2, available from Novo Nordisk)
Termamyl.TM. (SEQ ID NO: 4, available from Novo Nordisk) SP690:
(SEQ ID NO: 1, available from Novo Nordisk) Bacillus subtilis
SHA273: see WO 95/10603
Plasmids
[0137] pJE1 contains the gene encoding a variant of SP722
.alpha.-amylase (SEQ ID NO: 2): vis. deletion of 6 nucleotides
corresponding to amino acids D183-G184 in the mature protein.
Transcription of the JE1 gene is directed from the amyL promoter.
The plasmid further more contains the origin of replication and
cat-gene conferring resistance towards kanamycin obtained from
plasmid pUB110 (Gryczan, T J et al. (1978), J. Bact.
134:318-329).
Methods:
[0138] Construction of Library Vector pDorK101
[0139] The E. coli/Bacillus shuttle vector pDorK101 (described
below) can be used to introduce mutations without expression of
.alpha.-amylase in E. coli and then be modified in such way that
the .alpha.-amylase is active in Bacillus. The vector was
constructed as follows: The JE1 encoding gene (SP722 with the
deletion of D183-G184) was inactivated in pJE1 by gene interruption
in the PstI site in the 5'coding region of the SEQ ID NO: 2: SP722
by a 1.2 kb fragment containing an E. coli origin of replication.
This fragment was PCR amplified from the pUC19 (GenBank Accession
#:X02514) using the forward primer: 5'-gacctgcagtcaggcaacta-3' and
the reverse primer: 5'-tagagtcgacctgcaggcat-3'. The PCR amplicon
and the pJE1 vector were digested with PstI at 37.degree. C. for 2
hours. The pJE1 vector fragment and the PCR fragment were ligated
at room temperature, for 1 hour and transformed in E. coli by
electrotransformation. The resulting vector is designated
pDorK101.
Filter Screening Assays
[0140] The assay can be used to screening of Termamyl-like
.alpha.-amylase variants having an improved stability at high pH
compared to the parent enzyme and Termamyl-like .alpha.-amylase
variants having an improved stability at high pH and medium
temperatures compared to the parent enzyme depending of the
screening temperature setting
High pH Filter Assay
[0141] Bacillus libraries are plated on a sandwich of cellulose
acetate (OE 67, Schleicher & Sehuell, Dassel, Germany)--and
nitrocellulose filters (Protran-Ba 85, Schleicher & Sehuell,
Dassel, Germany) on TY agar plates with 10 .mu.g/ml kanamycin at
37.degree. C. for at least 21 hours. The cellulose acetate layer is
located on the TY agar plate.
[0142] Each filter sandwich is specifically marked with a needle
after plating, but before incubation in order to be able to
localize positive variants on the filter and the nitrocellulose
filter with bound variants is transferred to a container with
glycin-NaOH buffer, pH 8.6-10.6 and incubated at room temperature
(can be altered from 10.degree.-60.degree. C.) for 15 min. The
cellulose acetate filters with colonies are stored on the TY-plates
at room temperature until use. After incubation, residual activity
is detected on plates containing 1% agarose, 0.2% starch in
glycin-NaOH buffer, pH 8.6-10.6. The assay plates with
nitrocellulose filters are marked the same way as the filter
sandwich and incubated for 2 hours, at room temperature. After
removal of the filters the assay plates are stained with 10% Lugol
solution. Starch degrading variants are detected as white spots on
dark blue background and then identified on the storage plates.
Positive variants are rescreened twice under the same conditions as
the first screen.
Low Calcium Filter Assay
[0143] The Bacillus library are plated on a sandwich of cellulose
acetate (OE 67, Schleicher & Schuell, Dassel, Germany)--and
nitrocellulose filters (Protran-Ba 85, Schleicher & Schuell,
Dassel, Germany) on TY agar plates with a relevant antibiotic,
e.g., kanatnycin or chloramphenicol, at 37.degree. C. for at least
21 hours. The cellulose acetate layer is located on the TY agar
plate.
[0144] Each filter sandwich is specifically marked with a needle
after plating, but before incubation in order to be able to
localize positive variants on the filter and the nitrocellulose
filter with bound variants is transferred to a container with
carbonate/bicarbonate buffer pH 8.5-10 and with different EDTA
concentrations (0.001 mM-100 mM). The filters are incubated at room
temperature for 1 hour. The cellulose acetate filters with colonies
are stored on the TY-plates at room temperature until use. After
incubation, residual activity is detected on plates containing 1%
agarose, 0.2% starch in carbonate/bicarbonate buffer pH 8.5-10. The
assay plates with nitrocellulose filters are marked the same way as
the filter sandwich and incubated for 2 hours, at room temperature.
After removal of the filters the assay plates are stained with 10%
Lugol solution. Starch degrading variants are detected as white
spots on dark blue background and then identified on the storage
plates. Positive variants are rescreened twice under the same
conditions as the first screen.
Method to Obtaining the Regions of Interest:
[0145] There are three known 3D structures of bacterial
.alpha.-amylases. Two of B. licheniformis .alpha.-amylase,
Brookhaven database 1BPL (Machius et al. (1995), J. Mol. Biol. 246,
p. 545-559) and 1VJS (Song et al. (1996), Enzymes for Carbohydrate
163 Engineering (Prog. Biotechnol. V 12). These two structures are
lacking an important piece of the structure from the so-called
B-domain, in the area around the two Calcium ions and one Sodium
ion binding sites. We have therefore used a 3D structure of an
.alpha.-amylase BA2 (WO 96/23874 which are a hybrid between BAN.TM.
(SEQ ID NO, 5) and B. licheniformis .alpha.-amylase (SEQ ID NO. 4).
On basis of the structure a model of B. licheniformis alpha amylase
and the SP722.alpha.-amylase has been build.
Fermentation and Purification of .alpha.-amylase Variants
[0146] Fermentation and purification may be performed by methods
well known in the art.
Stability Determination
[0147] All stability trials are made using the same set up. The
method are:
The enzyme is incubated under the relevant conditions (1-4).
Samples are taken at various time points, e.g., after 0, 5, 10, 15
and 30 minutes and diluted 2 5 times (same dilution for all taken
samples) in assay buffer (0.1M 50 mM Britton buffer pH 7.3) and the
activity is measured using the Phadebas assay (Pharmacia) under
standard conditions pH 7.3, 37.degree. C.
[0148] The activity measured before incubation (0 minutes) is used
as reference (100%). The decline in percent is calculated as a
function of the incubation time. The table shows the residual
activity after, e.g., 30 minutes of incubation.
Specific Activity Determination
[0149] The specific activity is determined using the Phadebas assay
(Pharmacia) as activity/mg enzyme. The manufactures instructions
are followed (see also below under "Assay for .alpha.-amylase
activity).
Assays for .alpha.-Amylase Activity
1. Phadebas Assay
[0150] .alpha.-amylase activity is determined by a method employing
Phadebas.RTM. tablets as substrate. Phadebas tablets (Phadebas.RTM.
Amylase Test, supplied by Pharmacia Diagnostic) contain a
cross-linked insoluble blue-colored starch polymer which has been
mixed with bovine serum albumin and a buffer substance and
tabletted.
[0151] For every single measurement one tablet is suspended in a
tube containing 5 ml 50 mM Britton-Robinson buffer (50 mM acetic
acid, 50 mM phosphoric acid, 50 mM boric acid, 0.1 mM CaCl.sub.2,
pH adjusted to the value of interest with NaOH). The test is
performed in a water bath at the temperature of interest. The
.alpha.-amylase to be tested is diluted in x ml of 50 mM
Britton-Robinson buffer. 1 ml of this .alpha.-amylase solution is
added to the 5 ml 50 mM Britton-Robinson buffer. The starch is
hydrolyzed by the .alpha.-amylase giving soluble blue fragments.
The absorbance of the resulting blue solution, measured
spectrophotometrically at 620 nm, is a function of the
.alpha.-amylase activity.
[0152] It is important that the measured 620 nm absorbance after
10or 15 minutes of incubation (testing time) is in the range of 0.2
to 2.0 absorbance units at 620 nm. In this absorbance range there
is linearity between activity and absorbance (Lambert-Beer law).
The dilution of the enzyme must therefore be adjusted to fit this
criterion. Under a specified set of conditions (temp., pH, reaction
time, buffer conditions) 1 trig of a given .alpha.-amylase will
hydrolyze a certain amount of substrate and a blue colour will be
produced. The colour intensity is measured at 620 nm. The measured
absorbance is directly proportional to the specific activity
(activity/mg of pure .alpha.-amylase protein) of the
.alpha.-amylase in question under the given set of conditions.
2. Alternative Method
[0153] .alpha.-amylase activity is determined by a method employing
the PNP-G7 substrate. PNP-G7 which is a abbreviation for p
nitrophenyl-.alpha.,D-maltoheptaoside is a blocked oligosaccharide
which can be cleaved by an endo-amylase. Following the cleavage,
the .alpha.-Glucosidase included in the kit digest the substrate to
liberate a free PNP molecule which has a yellow colour and thus can
be measured by visible spectophometry at .lamda.=405 nm. (400-420
nm.). Kits containing PNP-G7 substrate and .alpha.-Glucosidase is
manufactured by Boehringer-Mannheim, (cat.No. 1054635).
[0154] To prepare the substrate one bottle of substrate (BM
1442309) is added to 5 ml buffer (BM1442309). To prepare the
.alpha.-Glucosidase one bottle of .alpha.-Glueosidase (BM 1462309)
is added to 45 ml buffer (BM1442309). The working solution is made
by mixing 5 ml .alpha.-Glucosidase solution with 0.5 ml
substrate.
[0155] The assay is performed by transforming 20 .mu.l enzyme
solution to a 96 well microtitre plate and incubating at 25.degree.
C. 200 .mu.l working solution, 25.degree. C. is added. The solution
is mixed and pre-incubated 1 minute and absorption is measured
every 15 sec. over 3 minutes at OD 405 nm.
[0156] The slope of the time dependent absorption-curve is directly
proportional to the specific activity (activity per rag enzyme) of
the .alpha.-amylase in question under the given set of
conditions.
General Method for Random Mutagenesis by Use of the DOPE
Program
[0157] The random mutagenesis may be carried out by the following
steps:
1. Select regions of interest for modification in the parent enzyme
2. Decide on mutation sites and non-mutated sites in the selected
region 3. Decide on which kind of mutations should be carried out,
e.g. with respect to the desired stability and/or performance of
the variant to be constructed 4. Select structurally reasonable
mutations. 5. Adjust the residues selected by step 3 with regard to
step 4. 6. Analyze by use of a suitable dope algorithm the
nucleotide distribution. 7. If necessary, adjust the wanted
residues to genetic code realism (e.g., taking into account
constraints resulting from the genetic code (e.g. in order to avoid
introduction of stop codons))(the skilled person will be aware that
some codon combinations cannot be used in practice and will need to
be adapted) 8. Make primers 9. Perform random mutagenesis by use of
the primers 10. Select resulting .alpha.-amylase variants by
screening for the desired improved properties.
[0158] Suitable dope algorithms for use in step 6 are well known in
the art. One algorithm is described by Tomandl, D, et al., Journal
of Computer-Aided Molecular Design, 11 (1997), pp. 29-38). Another
algorithm, DOPE, is described in the following:
The Dope Program
[0159] The "DOPE" program is a computer algorithm useful to
optimize the nucleotide composition of a codon triplet in such a
way that it encodes an amino acid distribution which resembles most
the wanted amino acid distribution. In order to assess which of the
possible distributions is the most similar to the wanted amino acid
distribution, a scoring function is needed. In the "Dope" program
the following function was found to be suited:
s .ident. i = 1 N ( x i yi ( 1 - x i ) 1 - y i y i yi ( 1 - y i ) 1
- y i ) w i , ##EQU00001##
where the x.sub.i's are the obtained amounts of amino acids and
groups of amino acids as calculated by the program, y.sub.i's are
the wanted amounts of amino acids and groups of amino acids as
defined by the user of the program (e.g. specify which of the 20
amino acids or stop codons are wanted to be introduced, e.g. with a
certain percentage (e.g. 90% Ala, 3% Ile, 7% Val), and w.sub.i's
are assigned weight factors as defined by the user of the program
(e.g., depending on the importance of having a specific amino acid
residue inserted into the position in question). N is 21 plus the
number of amino acid groups as defined by the user of the program.
For purposes of this function 0.degree. is defined as being 1.
[0160] A Monte-Carlo algorithm (one example being the one described
by Valleau, J. P. & Whittington, S. G. (1977) A guide to Mont
Carlo for statistical mechanics; 1 Highways. In "Stastistieal
Mechanics, Part A" Equilibrium Techniqeues ed. B. J. Berne, New
York: Plenum) is used for finding the maximum value of this
function. In each Iteration the following steps are performed:
[0161] 1. A new random nucleotide composition is chosen for each
base, where the absolute difference between the current and the new
composition is smaller than or equal to d for each of the four
nucleotides G,A,T,C in all three positions of the codon (see below
for definition of d). [0162] 2. The scores of the new composition
and the current composition are compared by the use of the function
s as described above. If the new score is higher or equal to the
score of the current composition, the new composition is kept and
the current composition is changed to the new one. If the new score
is smaller, the probability of keeping the new composition is
exp(1000)(new_score-current_score)).
[0163] A cycle normally consists of 1000 Iterations as described
above in which d is decreasing linearly from 1 to 0. One hundred or
more cycles are performed in an optimization process. The
nucleotide composition resulting in the highest score is finally
presented.
EXAMPLES
Example 1
Example on Homology Building of Termamyl.TM.
[0164] The overall homology of the B. licheniformis .alpha.-amylase
(in the following referred to as Termamyl.TM.) to other
Termamyl-like .alpha.-amylases is high and the percent similarity
is extremely high. The similarity calculated for Termamyl.TM. to
BSG (the B. stearothermophilus .alpha.-amylase having SEQ ID NO:
3), and BAN (the B. amyloliquefaciens .alpha.-amylase having SEQ ID
NO: 5) using the University of Wisconsin Genetics Computer Group's
program GCG gave 89% and 78%, respectively. TERM has a deletion of
2 residues between residue G180 and K181 compared to BAN.TM. and
BSG. BSG has a deletion of 3 residues between G371 and 1372 in
comparison with BAN.TM. and Termamyl.TM.. Further BSG has a
C-terminal extension of more than 20 residues compared to BAN.TM.
and Termamyl.TM.. BAN.TM. has 2 residues less and Termamyl has one
residue less in the N-terminal compared to BSG.
[0165] The structure of the B. licheniformis (Termamyl.TM.) and of
the B. amyloliquefaciens .alpha.-amylase (BAN.TM.), respectively,
was model built on the structure disclosed in Appendix 1 of WO
96/23974. The structure of other Termamyl-like .alpha.-amylases
(e.g. those disclosed herein) may be built analogously.
[0166] In comparison with the .alpha.-amylase used for elucidating
the present structure, Termamyl.TM. differs in that it lacks two
residues around 178-182. In order to compensate for this in the
model structure, the HOMOLOGY program from BIOSYM was used to
substitute the residues in equivalent positions in the structure
(not only structurally conserved regions) except for the deletion
point. A peptide bond was established between G179(G177) and
K180(K180) in Termamyl.TM. (BAN.TM.), The close structural
relationship between the solved structure and the model structure
(and thus the validity of the latter) is indicated by the presence
of only very few atoms found to be too close together in the
model.
[0167] To this very rough structure of Termamyl.TM.was then added
all waters (605) and ions (4 Calcium and 1 Sodium) from the solved
structure (See Appendix 1 of WO 96/23874) at the same coordinates
as for said solved structure using the INSIGHT program. This could
be done with only few overlaps--in other words with a very nice
fit. This model structure were then minimized using 200 steps of
Steepest descent and 600 steps of Conjugated gradient (see Brooks
et al 1983, J. Computational Chemistry 4, p. 187-217). The
minimized structure was then subjected to molecular dynamics, Bps
heating followed by up to 200 ps equilibration but more than 3 Bps.
The dynamics as run with the Verlet algorithm and the
e-quilibration temperature 300K were kept using the Behrendsen
coupling to a water bath (Berendsen et. al., 1984, J. Chemical
Physics 81, p. 3684-3690). Rotations and translations were removed
every pico second.
Example 2
Method of Extracting Important Regions for Identifying
.alpha.-Amylase Variants with Improved pH Stability and Altered
Temperature Activity
[0168] The X-ray structure and/or the model build structure of the
enzyme of interest, here SP722 and Termamyl.TM. are subjected to
molecular dynamics simulations. The molecular dynamics simulation
are made using the CHARMM (from Molecular simulations (MSI))
program or other suited program like, e.g., DISCOVER (from MSI).
The molecular dynamic analysis is made in vacuum, or more preferred
including crystal waters, or with the enzyme embedded in water,
e.g., a water sphere or a water box. The simulation are run for 300
pico seconds (ps) or more, e.g., 300-1200 ps. The isotropic
fluctuations are extracted for the CA carbons of the structures and
compared between the structures. Where the sequence has deletions
and/or insertions the isotropic fluctuations from the other
structure are inserted thus giving 0 as difference in isotropic
fluctuation. For explanation of isotropic fluctuations see the
CHARMM manual (obtainable from MSI).
[0169] The molecular dynamics simulation can be done using standard
charges on the chargeable amino acids. This is Asp and Glu are
negatively charged and Lys and Arg are positively charged. This
condition resembles the medium pH of approximately 7. To analyze a
higher or lower pH, titration of the molecule can be done to obtain
the altered pKa's of the standard titrateable residues normally
within pH 2-10; Lys, Arg, Asp, Glu, Tyr and His. Also Ser, Thr and
Cys are titrateable but are not taking into account here. Here the
altered charges due to the pH has been described as both Asp and
Glu are negative at high pH, and both Arg and Lys are uncharged.
This imitates a pH around 10 to 11 where the titration of Lys and
Arg starts, as the normal pKa of these residues are around
9-11.
[0170] 1. The approach used for extracting important regions for
identifying .alpha.-amylase variants with high pH stability:
[0171] The important regions for constructing variants with
improved pH stability are the regions which at the extreme pH
display the highest mobility, i.e., regions having the highest
isotropic fluctuations.
[0172] Such regions are identified by carrying out two molecular
dynamics simulations; i) a high pH run at which the basic amino
acids, Lys and Arg, are seen as neutral (i.e. not protonated) and
the acidic amino acids, Asp and Glu, have the charge (-1) and ii) a
neutral pH run with the basic amino acids, Lys and Arg, having the
net charge of (+1) and the acidic amino acids having a charge of
(-1).
[0173] The two run are compared and regions displaying the
relatively higher mobility at high pH compared to neutral pH
analysis were identified.
[0174] Introduction of residues improving general stability, e.g.,
hydrogen bonding, making the region more rigid (by mutations such
as Proline substitutions or replacement of Glycine residues), or
improving the charges or their interaction, improves the high pH
stability of the enzyme.
[0175] 2. The approach used for extracting regions for identifying
.alpha.-amylase variants with increased activity at medium
temperatures:
[0176] The important regions for constructing variants with
increased activity at medium temperature was found as the
difference between the isotropic fluctuations in SP722 and
Termamyl, i.e., SP722 minus Termamyl CA isotrophic fluctuations,
The regions with the highest mobility in the isotrophic
fluctuations were selected. These regions and there residues were
expected to increase the activity at medium temperatures. The
activity of an alpha-amylase is only expressed if the correct
mobility of certain residues are present. If the mobility of the
residues is too low the activity is decreased or abandoned.
Example 3
Construction, by Localized Random, Doped Mutagenesis, of
Termamyl-Like .alpha.-Amylase Variants having an Improved Ca2+
Stability at Medium Temperatures Compared to the Parent Enzymes
[0177] To improve the stability at low calcium concentration of
.alpha.-amylases random mutagenesis in pre-selected region was
performed.
Region: Residue:
SAT: R181-W189
[0178] The DOPE software (see Materials and Methods) was used to
determine spiked codons for each suggested change in the SA1 region
minimizing the amount of stop codons (see table 1). The exact,
distribution of nucleotides was calculated in the three positions
of the codon to give the suggested population of amino acid
changes. The doped regions were doped specifically in the indicated
positions to have a high chance of getting the desired residues,
but still allow other possibilities.
TABLE-US-00006 TABLE 1 Distribution of amino acid residues for each
position R181: 72% R, 2% N, 7% Q, 4% H, 4% K, 11% S G182: 73% G,
13% A, 12% S, 2% T K185: 95% K, 5% R A186: 50% A, 4% N, 6% D, 1% E,
1% G, 1% K, 5% S, 31% T W187: 100% W D188: 100% D W189: 92% W, 8%
S
[0179] The resulting doped oligonucleotide strand is shown in table
2 as sense strand: with the wild type nucleotide and amino acid
sequences and the distribution of nucleotides for each doped
position.
TABLE-US-00007 TABLE 2 Position 181 182 185 186 187 188 189 Amino
acid seq. Arg Gly Lys Ala Thr Asp Thr Wt nuc. seq. cga ggt aaa gct
tgg gat tgg Forward primer: (SEQ ID NO: 15) FSA: 5'-caa aat cgt atc
tac aaa ttc 123 456 a7g 8910 tgg gat t11g gaa gta gat tcg gaa
aat-3' Distribution of nucleotides for each doped Position 1: 35%
A, 65% C 2: 83% G, 17% A 3: 63% G, 37% T 4: 86% G, 14% A 5: 85% G,
15% C 6: 50% T, 50% C 7: 95% A, 5%G 8: 58% G, 37% A, 5% T 9: 86% C,
13% A, 1% G 10: 33% T, 17% G 11: 92% G, 8% C Reverse primer: (SEQ
ID NO: 16) RSA: 5'-gaa ttt gta gat acg att ttg-3'
Random Mutagenesis
[0180] The spiked oligonucleotides apparent from Table 2 (which by
a common term is designated FSA) and reverse primers RSA for the
SA1 region and specific SEQ ID NO: 2: SP722 primers covering the
SacII and the Drain sites are used to generate
PGR-library-fragments by the overlap extension method (Horton et
al., Gene, 77 (1989), pp. 61-68) with an overlap of 21 base pairs.
Plasmid pJE1 is template for the Polymerase Chain Reaction. The PGR
fragments are cloned in the E. coli/Bacillus shuttle vector
pDork101 (see Materials and Methods) enabling mutagenesis in E.
coli and immediate expression in Bacillus subtilis preventing
lethal accumulation of amylases in E. coli. After establishing the
cloned PCR fragments in E. coli, a modified pUC19 fragment is
digested out of the plasmid and the promoter and the mutated
Termamyl gene is physically connected and expression can take place
in Bacillus.
Screening
[0181] The library may be screened in the low calcium filter assays
described in the "Material and Methods" section above.
Example 4
Construction of Variants of Amylase SEQ ID NO: 1 (SP690)
[0182] The gene encoding the amylase from SEQ ID NO; 1 is located
in a plasmid pTVB106 described in WO96/23873. The amylase is
expressed from the amyL promoter in this construct in Bacillus
subtilis.
[0183] A variant of the protein is delta(T183-G184)+Y243F+Q3
91E+K444Q. Construction of this variant is described in
WO96/23873.
[0184] Construction of delta(T183-G184)+N195F by the mega-primer
method as described by Sarkar and Sommer, (1990), BioTechniques 8:
404-407.
[0185] Gene specific primer B1 (SEQ ID NO: 17) and mutagenic primer
101458 (SEQ ID NO: 19) were used to amplify by PCR an approximately
645 bp DNA fragment from a pTVB106-like plasmid (with the
delta(T183-G184) mutations in the gene encoding the amylase from
SEQ ID NO: 1).
[0186] The 645 bp fragment was purified from an agarose gel and
used as a mega-primer together with primer Y2 (SEQ ID NO: 18) in a
second PCR carried out on the same template.
[0187] The resulting approximately 1080 bp fragment was digested
with restriction enzymes BstEII and AflIII and the resulting
approximately 510 bp DNA fragment was purified and ligated with the
pTVB106-like plasmid (with the delta (T183-G184) mutations in the
gene encoding the amylase from SEQ ID NO: 1) digested with the same
enzymes. Competent Bacillus subtilis SHA273 (amylase and protease
low) cells were transformed with the ligation and Chlorampenicol
resistant transformants and was checked by DNA sequencing to verify
the presence of the correct mutations on the plasmid.
TABLE-US-00008 primer B1: (SEQ ID NO: 17) 5' CGA TTG CTG ACG CTG
TTA TTT GCG 3' primer Y2: (SEQ ID NO: 18) 5' CTT GTT CCC TTG TCA
GAA CCA ATG 3' primer 101458 (SEQ ID NO: 19): 5' GT CAT AGT TGC CGA
AAT CTG TAT CGA CTT C 3'
[0188] The construction of variant: delta(T183-G184)+K185R+A186T
was carried out in a similar way except that mutagenic primer
101638 was used.
TABLE-US-00009 primer 101638: (SEQ ID NO: 20) 5' CC CAG TCC CAC GTA
CGT CCC CTG AAT TTA TAT ATT TTG 3'
[0189] Variants: delta(T183-G184)+A186T, delta(T183-G184)+A186I,
delta(T183-G184)+A186S, delta(T183-G184)+A186N are constructed by a
similar method except that pTVB106-like plasmid (carrying variant
delta(T183-G184)+K185R+A186T) is used as template and as the vector
for the cloning purpose. The mutagenic oligonucleotide (Oligo 1)
is:
TABLE-US-00010 (SEQ ID NO: 21) 5' CC CAG TCC CAG NTCTTT CCC CTG AAT
TTA TAT ATT TTG 3'
[0190] N represents a mixture of the four bases: A, C, G, and T
used in the synthesis of the mutagenicoli-gonucleotide.
Sequencing of Transformants Identifies the Correct Codon for Amino
Acid Position 186 in the Mature Amylase.
[0191] variant: delta(T183-G184)+K185R+A186T+N195F is constructed
as follows:
PGR is carried out with primer x2 (SEQ ID NO: 22) and primer 101458
(SEQ ID NO: 19) on pTVB106-like plasmid (with mutations
delta(T183-G184)+K185R+A186T). The resulting DNA fragment is used
as a mega-primer together with primer Y2 (SEQ ID NO: 18) in a PGR
on pTVB106-like plasmid (with mutations delta(T183-G184)+N195). The
product of the second PGR is digested with restriction
endonucleases Acc651 and AflIII and cloned into pTVB106 like
plasmid (delta(T183-G184)+N195F) digested with the same
enzymes.
TABLE-US-00011 primer x2: (SEQ ID NO: 22) 5' GCG TGG ACA AAG TTT
GAT TTT CCT G 3'
[0192] Variant:
delta(T183-G184)+K185R+A186T+N195F+Y243F+Q391E+K444Q is constructed
as follows:
[0193] PGR is carried out with primer x2 and primer 101458 on
pTVB106-like plasmid (with mutations delta(T183-G184)+K185R+A186T).
The resulting DNA fragment is used as a mega-primer together with
primer Y2 in a PGR on pTVB106 like plasmid (with mutations
delta(T183-G184)+Y243F+Q39TE+K444Q). The product of the second PGR
is digested with restriction endonucleases Acc65I and AflIII and
cloned into pTVB106 like plasmid
(delta(T183-G184)+Y243F+Q391E+K444Q) digested with the same
enzymes.
Example 5
Construction of Site-Directed .alpha.-Amylase Variants in the
Parent SP722 .alpha.-Amylase (SEQ ID NO: 2)
[0194] Construction of variants of amylase SEQ ID NO: 2 (SP722) is
carried out as described below.
[0195] The gene encoding the amylase from SEQ ID NO: 2 is located
in a plasmid pTVB112 described in WO 96/23873. The amylase is
expressed from the amyL promoter in this construct in Bacillus
subtilis.
[0196] Construction of delta(D183-G184)+V56I by the mega-primer
method as described by Sarkar and Sommer, 1990 (BioTechniques 8:
404-407).
[0197] Gene specific primer DAQ3 and mutagenic primer DA07 are used
to amplify by PGR an approximately 820 bp DNA fragment from a
pTVB112-like plasmid (with the delta(D183-G184) mutations in the
gene encoding the .alpha.-amylase shown in SEQ ID NO: 2.
[0198] The 820 bp fragment is purified from an agarose gel and used
as a mega-primer together with primer DA01 in a second PGR carried
out on the same template.
[0199] The resulting approximately 920 bp fragment is digested with
restriction enzymes NgoM I and Aat II and the resulting
approximately 170 bp DNA fragment is purified and ligated with the
pTVB112-like plasmid (with the delta(D183-G184) mutations in the
gene encoding the amylase shown in SEQ ID NO: 2) digested with the
same enzymes. Competent Bacillus subtilis SHA273 (amylase and
protease low) cells are transformed with the ligation and
Chlorampenicol resistant transformants are checked by DNA
sequencing to verify the presence of the correct mutations on the
plasmid.
TABLE-US-00012 primer DA01: (SEQ ID NO: 22) 5'
CCTAATGATGGGAATCACTGG 3' primer DA03: (SEQ ID NO: 24) 5'
GCATTGGATGCTTTTGAACAACCG 3' primer DA07 (SEQ ID NO: 25): 5'
CGCAAAATGATATCGGGTATGGAGCC 3'
Variants: delta(D183-G184)+K108L, delta(D183-G184)+K108Q,
delta(D183-G184)+K108E, delta(D183-G184)+K108V, were constructed by
the mega-primer method as described by Sarkar and Sommer, 1990
(BioTechniques 8; 404-407):
[0200] PCR is carried out with primer DA03 and mutagenesis primer
DA20 on pTVB112-like plasmid (with mutations delta(D183-G184)). The
resulting DNA fragment is used as a mega-primer together with
primer DA01 in a PCR on pTVB112-like plasmid (with mutations
delta(D183-G184)). The approximately 920 bp product of the second
PCR is digested with restriction endonucleases Aat II and Mlu I and
cloned into pTVB112-like plasmid (delta(D183-G1845) digested with
the same enzymes,
TABLE-US-00013 primer DA20 (SQ ID NO: 26): 5'
GTGATGAACCACSWAGGTGGAGCTGATGC 3'
[0201] S represents a mixture of the two bases: C and G used in the
synthesis of the mutagenic oligonucleotide and W represents a
mixture of the two bases: A and T used in the synthesis of the
mutagenic oligonucleotide.
[0202] Sequencing of transformants identifies the correct codon for
amino acid position 108 in the mature amylase.
[0203] Construction of the variants; delta(D183-G184)+D168A,
delta(D183-G184)+D168I, delta(D183-G184)+D168V,
delta(D183-G184)+D168T is carried out in a similar way except that
mutagenic primer DA14 is used.
TABLE-US-00014 primer DA14 (SEQ ID NO: 27): 5'
GATGGTGTATGGRYCAATCACGACAATTCC 3'
[0204] R represents a mixture of the two bases; A and G used in the
synthesis of the mutagenic oligonucleotide and Y represents a
mixture of the two bases; C and T used in the synthesis of the
mutagenic oligonucleotide.
[0205] Sequencing of transformants identifies the correct codon for
amino acid position 168 in the mature amylase.
[0206] Construction of the variant: delta(D183-G184)+Q169N is
carried out in a similar way except that mutagenic primer DA15 is
used.
TABLE-US-00015 primer DA15 (SEQ ID NO: 28): 5'
GGTGTATGGGATAACTCACGACAATTCC 3'
[0207] Construction of the variant; delta(D183-G184)+Q169L is
carried out in a similar way except that mutagenic primer DA16 is
used.
TABLE-US-00016 primer DA16 (SEQ ID NO: 29): 5'
GGTGTATGGGATCTCTCACGACAATTCC 3'
[0208] Construction of the variant; delta(D183-G184)+Q172N is
carried out in a similar way except that mutagenic primer DA17 is
used.
TABLE-US-00017 primer DA17 (SEQ ID NO: 30): 5'
GGGATCAATCACGAAATTTCCAAAATCGTATC 3'
[0209] Construction of the variant: delta(D183-G184)+Q172L is
carried out in a similar way except that mutagenic primer DAIS is
used.
TABLE-US-00018 primer DA18 (SEQ ID NO: 31): 5'
GGGATCAATCACGACTCTTCCAAAATCGTATC 3'
[0210] Construction of the variant: delta(D183-G184)+L201I is
carried out in a similar way except that mutagenic primer DA06 is
used.
TABLE-US-00019 primer DA06 (SEQ ID NO: 32): 5'
GGAAATTATGATTATATCATGTATGCAGATGTAG 3'
[0211] Construction of the variant: delta(D183-G184)+K269S is
carried out in a similar way except that mutagenic primer DA09 is
used.
TABLE-US-00020 primer DA09 (SEQ ID NO: 33): 5'
GCTGAATTTTGGTCGAATGATTTAGGTGCC 3'
[0212] Construction of the variant; delta(D183-G184)+K269Q is
carried out in a similar way except that mutagenic primer DA11 is
used.
TABLE-US-00021 primer DA11 (SEQ ID NO: 34): 5'
GCTGAATTTTGGTCGAATGATTTAGGTGCC 3'
[0213] Construction of the variant; delta(D183-G184)+N270Y is
carried out in a similar way except that mutagenic primer DA21 is
used.
TABLE-US-00022 primer DA21 (SEQ ID NO: 35): 5'
GAATTTTGGAAGTACGATTTAGGTCGG 3'
[0214] Construction of the variants: delta(D183-G184)+L272A,
delta(D183-G184)+L272I, delta(D183-G184)+L272V,
delta(D183-G184)+L272T is carried out in a similar way except that
mutagenic primer DA12 is used,
TABLE-US-00023 primer DA12 (SEQ ID NO: 36): 5'
GGAAAAACGATRYCGGTGCCTTGGAGAAC 3'
R represents a mixture of the two bases: A and G used in the
synthesis of the mutagenic oligonucleotide and Y represents a
mixture of the two bases: C and T used in the synthesis of the
mutagenic oligonucleotide. Sequencing of transformants identifies
the correct codon for amino acid position 272 in the mature
amylase.
[0215] Construction of the variants: delta(D183-G184)+L275A,
delta(D183-G184)+L275I, delta(D183-G184)+L275V,
delta(D183-G184)+L275T is carried out in a similar way except that
mutagenic primer DA13 is used.
TABLE-US-00024 primer DA13 (SEQ ID NO: 37): 5'
GATTTAGGTGCCTRYCAGAACTATTTA 3'
R represents a mixture of the two bases; A and G used in the
synthesis of the mutagenic oligonucleotide and Y represents a
mixture of the two bases; C and T used in the synthesis of the
mutagenic oligonucleotide. Sequencing of transformants identifies
the correct codon for amino acid position 275 in the mature
amylase.
[0216] Construction of the variant: delta(D183-G184)+Y295E is
carried out In a similar way except that mutagenic primer DA08 is
used.
TABLE-US-00025 primer DA08 (SEQ ID NO: 38): 5'
CCCCCTTCATGAGAATCTTTATAACG 3'
[0217] Construction of delta(D183-G184)+K446Q by the mega-primer
method as described by Sarkar and Sommer, 1990 (BioTechniques 8:
404-407):
[0218] Gene specific primer DA04, annealing 214-231 bp downstream
relative to the STOP-codon and mutagenic primer DA10 were used to
amplify by PGR an approximately 350 bp DNA fragment from a
pTVB112-like plasmid (with the delta(D183-G184) mutations in the
gene encoding the amylase depicted in SEQ ID NO: 2).
[0219] The resulting DNA fragment is used as a mega-primer together
with primer DA05 in a PGR on pTVB112 like plasmid (with mutations
delta(D183-G184)). The app. 460 bp product of the second PGR is
digested with restriction endonucleases SnaB I and Not I and cloned
into pTVB112 like plasmid (delta(D183-G184)) digested with the same
enzymes,
TABLE-US-00026 primer DA04 (SEQ ID NO: 39): 5'
GAATCCGAACCTCATTACACATTCG 3' primer DA05 (SEQ ID NO: 40) 5'
CGGATGGACTCGAGAAGGAAATACCACG 3' primer DA10 (SEQ ID NO: 41): 5'
CGTAGGGCAAAATCAGGCCGGTCAAGTTTGG 3'
[0220] Construction of the variants: delta(D183-G184)+K458R is
carried out in a similar way except that mutagenic primer DA22 is
used.
TABLE-US-00027 primer DA22 (SEQ ID NO: 42): 5'
CATAACTGGAAATCGCCCGGGAACAGTTACG 3'
[0221] Construction of the variants: delta(D183-G184)+P459S and
delta(D183-G184)+P459T is carried out in a similar way except that
mutagenic primer DA19 is used.
TABLE-US-00028 primer DA19 (SEQ ID NO: 43): 5'
CTGGAAATAAAWCCGGAACAGTTACG 3'
W represents a mixture of the two bases: A and T used in the
synthesis of the mutagenic oligonucleotide. Sequencing of
transformants identifies the correct codon for amino acid position
459 in the mature amylase.
[0222] Construction of the variants: delta(D183-G184)+T461P is
carried out in a similar way except that mutagenic primer DA23 is
used.
TABLE-US-00029 primer DA23 (SEQ ID NO: 44): 5'
GGAAATAAACCAGGACCCGTTACGATCAATGC 3'
[0223] Construction of the variant: delta(D183-G184)+K142R is
carried out in a similar way except that mutagenic primer DA32 is
used.
TABLE-US-00030 Primer DA32 (SEQ ID NO: 45): 5'
GAGGCTTGGACTAGGTTTGATTTTCCAG 3'
[0224] Construction of the variant; delta(D183-G184)+K269R is
carried out in a similar way except that mutagenic primer DA31 is
used.
TABLE-US-00031 Primer DA31 (SEQ ID NO: 46): 5'
GCTGAATTTTGGCGCAATGATTTAGGTGCC 3'
Example 6
Construction of Site-Directed .alpha.-Amylase Variants in the
Parent Termamyl .alpha.-Amylase (SEQ ID NO: 4)
[0225] The amyL gene, encoding the Termamyl .alpha.-amylase is
located in plasmid pDN1528 described in WO 95/10603 (Novo Nordisk).
Variants with substitutions N265R and N265D, respectively, of said
parent, .alpha.-amylase are constructed by methods described in WO
97/41213 or by the "megaprimer" approach described above.
Mutagenic Oligonucleotides are:
[0226] Primer b11 for the N265R substitution:
TABLE-US-00032 (SEQ ID NO: 56) 5' PCC AGC GCG CCT AGG TCA CGC TGC
CAA TAT TCA G
Primer b12 for the N265D substitution;
TABLE-US-00033 (SEQ ID NO: 57) 5' PCC AGC GCG CCT AGG TCA TCC TGC
CAA TAT TCA G
P represents a phosphate group.
Example 7
Determination of pH Stability at Alkaline pH of Variants of the
Parent .alpha.-Amylase having the Amino Acid Sequence Shown in SEQ
ID NO: 2
[0227] In this series of analysis purified enzyme samples were
used. The measurements were made using solutions of the respective
variants in 100 mM CAPS buffer adjusted to pH 10.5. The solutions
were incubated at 75.degree. C.
[0228] After incubation for 20 and 30 min the residual activity was
measured using the PNP-G7 assay (described in the "Materials and
Methods" section above). The residual activity in the samples was
measured using Britton Robinson buffer pH 7.3. The decline in
residual activity was measured relative to a corresponding
reference solution of the same enzyme at 0 minutes, which has not
been incubated at high pH and 75.degree. C.
[0229] The percentage of the initial activity as a function is
shown in the table below for the parent enzyme (SEQ ID NO; 2) and
for the variants in question.
TABLE-US-00034 Residual activity Residual activity Variant after 20
min after 30 min .DELTA.(D183-G184) + M323L 56% 44%
.DELTA.(D183-G184) + M323L + R181S 67% 55% .DELTA.(D183-G184) +
M323L + A186T 62% 50%
[0230] In an other series of analysis culture supernatants were
used. The measurements were made using solutions of the respective
variants in 100 mM CAPS buffer adjusted to pH 10.5. The solutions
were incubated at 80.degree. C.
[0231] After incubation for 30 minutes the residual activity was
measured using the Phadebas assay (described in the "Materials and
Method" section above. The residual activity in the samples was
measured using Britton Robinson buffer pH 7.3. The decline in
residual activity was measured relative to a corresponding
reference solution of the same enzyme at 0 minutes, which has not
been incubated at high pH and 80.degree. C.
[0232] The percentage of the initial activity as a function is
shown in the table below for the parent enzyme (SEQ ID NO: 2) and
for the variants in question,
TABLE-US-00035 Variant Residual activity after 30 min
.DELTA.(D183-G184) 4% .DELTA.(D183-G184) + P459T 25%
.DELTA.(D183-G184) + K458R 31% .DELTA.(D183-G184) + K311R 10%
Example 8
Determination of Calcium Stability at Alkaline pH of Variants of
the Parent .alpha.-Amylase having the Amino Acid Sequence Shown in
SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:4
A: Calcium Stability of Variants of the Sequence in SEQ ID NO:
1
[0233] The measurement were made using solutions of the respective
variants in 100 mM CAPS buffer adjusted to pH 10.5 to which
polyphosphate was added (at time t=0) to give a final concentration
of 2400 ppm. The solutions were incubated at 50.degree. C.
[0234] After incubation for 20 and 30 minutes the residual activity
was measured using the PNP-G7 assay (described above). The residual
activity in the samples was measured using Britton Robinson buffer
pH 7.3, The decline in residual activity was measured relative to a
corresponding reference solution of the same enzyme at 0 minutes,
which has not been incubated at high pH and 50.degree. C.
[0235] The percentage of the initial activity as a function is
shown in the table below for the parent enzyme (SEQ ID NO: 1) and
for the variants in question,
TABLE-US-00036 Residual activity Residual activity Variant after 20
min after 30 min .DELTA.(T183-G184) 32% 19% .DELTA.(T183-G184) +
A186T 36% 23% .DELTA.(T183-G184) + K185R + A186T 45% 29%
.DELTA.(T183-G184) + A186I 35% 20% .DELTA.(T183-G184) + N195F 44%
n.d. n.d. = Not determinated
B: Calcium Stability of Variants of the Sequence in SEQ ID NO:
2
[0236] In this series of analysis purified samples of enzymes were
used. The measurement were made using solutions of the respective
variants in 100 mM CAPS buffer adjusted to pH 10.5 to which
polyphosphate was added (at time t=0) to give a final concentration
of 2400 ppm. The solutions were incubated at 50.degree. C.
[0237] After incubation for 20 and 30 minutes the residual activity
was measured using the PNP-G7 assay (described above). The residual
activity in the samples was measured using Britton Robinson buffer
pH 7.3. The decline in residual activity was measured relative to a
corresponding reference solution of the same enzyme at 0 minutes,
which has not been incubated at high pH and 50.degree. C.
[0238] The percentage of the initial activity as a function is
shown in the table below for the parent enzyme (SEQ ID NO: 2) and
for the variants in question.
TABLE-US-00037 Residual activity Residual activity Variant after 20
min after 30 min .DELTA.(D183-G184) + M323L 21% 13%
.DELTA.(D183-G184) + M323L + R181S 32% 19% .DELTA.(D183-G184) +
M323L + A186T 28% 17% .DELTA.(D183-G184) + M323L + A186R 30% 18%
.DELTA.(D183-G184) 30% 20% .DELTA.(D183-G184) + N195F 55% 44%
[0239] In this series of analysis culture supernatants were used.
The measurement were made using solutions of the respective
variants in 100 mM CAPS buffer adjusted to pH 10.5 to which
polyphosphate was added (at time t=0) to give a final concentration
of 2400 ppm. The solutions were Incubated at 50.degree. C.
[0240] After incubation for 30 minutes the residual activity was
measured using the Phadebas assay as described above. The residual
activity in the samples was measured using Britton Robinson buffer
pH 7.3. The decline in residual activity was measured relative to a
corresponding reference solution of the same enzyme at 0 minutes,
which has not been incubated at high pH and 50.degree. C.
[0241] The percentage of the initial activity as a function is
shown in the table below for the parent enzyme (SEQ ID NO: 2) and
for the variants in question.
TABLE-US-00038 Variant Residual activity after 30 min
.DELTA.(D183-G184) 0% .DELTA.(D183-G184) + P459T 19%
.DELTA.(D183-G184) + K458R 18% .DELTA.(D183-G184) + T461P 13%
.DELTA.(D183-G184) + E346Q + K385R 4%
C: Calcium Stability of Variants of the Sequence in SEQ ID NO:
4
[0242] The measurement were made using solutions of the respective
variants in 100 mM CAPS buffer adjusted to pH 10.5 to which
polyphosphate was added (at time t0) to give a final concentration
of 2400 ppm. The solutions were incubated at 60.degree. C. for 20
minutes.
[0243] After incubation for 20 minutes the residual activity was
measured using the PNP-G7 assay (described above). The residual
activity in the samples was measured using Britton Robinson buffer
pH 7.3. The decline in residual activity was measured relative to a
corresponding reference solution of the same enzyme at 0 minutes,
which has not been incubated at high pH and 60.degree. C.
[0244] The percentage of the initial activity as a function is
shown in the table below for the parent enzyme (SEQ ID NO: 4) and
for the variants in question,
TABLE-US-00039 Residual activity after Variant 20 min Termamyl (SEQ
ID NO: 4) 17% N265R 28% N265D 25%
Example 9
Activity Measurement at Medium Temperature of .alpha.-Amylases
having the Amino Acid Sequence Shown in SEQ ID NO: 1.
[0245] A: .alpha.-Amylase activity of Variants of the Sequence in
SEQ ID NO: 1
[0246] The measurement were made using solutions of the respective
variants in 50 mM Britton Robinson buffer adjusted to pH 7.3 and
using the Phadebas assay described above. The activity in the
samples was measured at 37.degree. C. using 50 mM Britton Robinson
buffer pH 7.3 and at 25.degree. C. using 50 mM CAPS buffer pH
10.5.
[0247] The temperature dependent activity and the percentage of the
activity at 25.degree. C. relative to the activity at 37.degree. C.
is shown in the table below for the parent enzyme (SEQ ID NO: 1)
and for the variants in question.
TABLE-US-00040 NU(25.degree. C.)/ Variant NU/mg 25.degree. C. NU/mg
37.degree. C. NU(37.degree. C.) SP690 1440 35000 4.1%
.DELTA.(T183-G184) 2900 40000 7.3% .DELTA.(T183-G184) + K269S 1860
12000 15.5% .DELTA.(Q174) 3830 38000 7.9%
Another measurement was made using solutions of the respective
variants in 50 mM Britton Robinson buffer adjusted to pH 7.3 and
using the Phadebas assay described above. The activity in the
samples was measured at 37.degree. C. and 50.degree. C. using 50 mM
Britton Robinson buffer pH 7.3.
[0248] The temperature dependent activity and the percentage of the
activity at 37.degree. C. relative to the activity at 50.degree. C.
is shown in the table below for the parent enzyme (SEQ ID NO: 1)
and for the variants in question.
TABLE-US-00041 NU(37.degree. C.)/ Variant NU/mg 37.degree. C. NU/mg
50.degree. C. NU(50.degree. C.) SP690 (seq ID NO: 1) 13090 21669
60% K269Q 7804 10063 78%
B: .alpha.Amylase Activity of Variants of the Sequence in SEQ ID
NO:2
[0249] The measurement were made using solutions of the respective
variants in 50 mM Britton Robinson buffer adjusted to pH 7.3 and
using the Phadebas assay described above. The activity in the
samples was measured at both 25.degree. C. and 37.degree. C. using
50 mM Britton Robinson buffer pH 7.3.
[0250] The temperature dependent activity and the percentage of the
activity at 25.degree. C. relative to the activity at 37.degree. C.
Is shown in the table below for the parent enzyme (SEQ ID NO: 2)
and for the variants in question.
TABLE-US-00042 NU/mg NU/mg NU(25.degree. C.)/ Variant 25.degree. C.
37.degree. C. NU(37.degree. C.) .DELTA.(D183-G184) + M323L 3049
10202 30% .DELTA.(D183-G184) + M323L + R181S 18695 36436 51%
C: .alpha.-Amylase Activity of Variants of the Sequence in SEQ ID
NO:4
[0251] The measurement were made using solutions of the respective
variants in 50 mM Britton Robinson buffer adjusted to pH 7.3 and
using the Phadebas assay described above. The activity in the
samples was measured at both 37.degree. C. using 50 mM Britton
Robinson buffer pH 7.3 and at 60.degree. C. using 50 mM CAPS buffer
pH 10.5.
[0252] The temperature dependent activity and the percentage of the
activity at 37.degree. C. relative to the activity at 60.degree. C.
is shown in the table below for the parent enzyme (SEQ ID NO: 4)
and for the variants in question.
TABLE-US-00043 Variant NU/mg 37.degree. C. NU/mg 60.degree. C.
NU(37.degree. C.)/NU(60.degree. C.) Termamyl 7400 4350 170% Q264S
10000 4650 215%
Example 10
Construction of Variants of Parent Hybrid
BAN:1-300/Termamyl:301-483 .alpha.-Amylase
[0253] Plasmid pTVB191 contains the gene encoding hybrid
.alpha.-amylase BAN:1-300/Termamyl:301-483 as well as an origin of
replication functional in Bacillus subtilis and the cat gene
conferring chloramphenicol resistance.
[0254] Variant BM4 (F290E) was constructed using the megaprimer
approach (Sarkar and Sommer, 1990) with plasmid pTVB191 as
template.
[0255] Primer p1 (SEQ ID NO; 52) and mutagenic oligonucleotide bm4
(SEQ ID NO: 47) were used to amplify a 444 bp fragment with
polymerase chain reaction (PCR) under standard conditions. This
fragment was purified from an agarose gel and used as `Megaprimer`
in a second PCR with primer p2 (SEQ ID NO: 5.3) resulting in a 531
bp fragment. This fragment was digested with restriction
endonucleases HinDIII and Tth111I. The 389 bp fragment produced by
this was ligated into plasmid pTVB191 that had been cleaved with
the same two enzymes. The resulting plasmid was transformed into S.
subtilis SHA273. Chloramphenicol resistant clones were selected by
growing the transformants on plates containing chloramphenicol as
well as insoluble starch. Clones expressing an active
.alpha.-amylase were isolated by selecting clones that formed halos
after staining the plates with iodine vapour. The identity of the
introduced mutations was confirmed by DNA sequencing.
[0256] Variants BM5(F290K), BM6(F290A), BM8(Q360E) and BM11(N102D)
were constructed in a similar way. Details of their construction
are given below.
Variant: BM5(F290K)
[0257] mutagenic oligonucleotide: bm5 (SEQ ID NO: 48)
Primer (1st PGR); p1 (SEQ ID NO; 52)
[0258] Size of resulting fragment: 444 bp
Primer (2nd PCR): p2 (SEQ ID NO: 53)
[0259] Restriction endonucleases: HinDIII, Tth111I Size of cleaved
fragment: 389 bp
Variant: BM6(F290A)
[0260] mutagenic oligonucleotide; bm6 (SEQ ID NO: 49)
Primer (1st PGR): p1 (SEQ ID NO: 52)
[0261] Size of resulting fragment: 444 bp
Primer (2nd PGR): p2 (SEQ ID NO: 53)
[0262] Restriction endonucleases: HinDIII, Tth111I Size of cleaved
fragment: 389 bp
Variant: BM8(Q360E)
[0263] mutagenic oligonucleotide; bm8 (SEQ ID NO: 50)
Primer (1st PGR): p1 (SEQ ID NO: 52)
[0264] Size of resulting fragment; 230 bp
Primer (2nd PGR); p2 (SEQ ID NO; 53)
[0265] Restriction endonucleases: HinDIII, Tth111I Size of cleaved
fragment: 389 bp
Variant: BM11(N102D)
[0266] mutagenic oligonucleotide; bm11 (SEQ ID NO; 51)
Primer (1st PGR): p3 (SEQ ID NO: 54)
[0267] Size of resulting fragment; 577
Primer (2nd PGR): p4 (SEQ ID NO: 55)
[0268] Restriction endonucleases: HinDIII, PvuI Size of cleaved
fragment: 576
Mutagenic Oligonucleotides:
TABLE-US-00044 [0269] bm4 (SEQ ID NO: 47): F290E primer 5' GTG TTT
GAC GTC CCG CTT CAT GAG AAT TTA CAG G bm5 (SEQ ID NO: 48): F290K
primer 5' GTG TTT GAC GTC CCG CTT CAT AAG AAT TTA CAG G bm6 (SEQ ID
NO: 49): F290A primer 5' GTG TTT GAC GTC CCG CTT CAT GCC AAT TTA
CAG G bm8 (SEQ ID NO: 50): Q360E primer 5' AGG GAA TCC GGA TAC CCT
GAG GTT TTC TAC GG bm11 (SEQ ID NO: 51): N102D primer 5' GAT GTG
GTT TTG GAT CAT AAG GCC GGC GCT GAT G
Other Primers:
TABLE-US-00045 [0270] (SEQ ID N0: 52) p1: 5' CTG TTA TTA ATG CCG
CCA AAC C (SEQ ID NO: 53) p2: 5' G GAA AAG AAA TGT TTA CGG TTG CG
(SEQ ID NO: 54) p3: 5' G AAA TGA AGC GGA ACA TCA AAC ACG (SEQ ID
NO: 55) p4: 5' GTA TGA TTT AGG AGA ATT CC
Example 11
.alpha.-Amylase Activity at Alkaline pH of Variants of
BAN:1-300/Termamyl:301-483 Hybrid .alpha.-Amylase
[0271] The measurements were made using solutions for the
respective enzymes and utilizing the Phadebas assay (described
above). The activity was measured after incubating for 15 minutes
at 30.degree. C. in 50 mM Britton-Robinson buffer adjusted to the
indicated pH by NaOH,
TABLE-US-00046 NU/mg enzyme pH wt Q360E F290A F290K F290E N102D 8.0
5300 7800 8300 4200 6600 6200 9.0 1600 2700 3400 2100 1900 1900
REFERENCES CITED
[0272] Klein, C, et al., Biochemistry 1992, 31, 8740-8746, [0273]
Mizuno, H., et al., J. Mol. Biol. (1993) 234, 1282-1283, [0274]
Chang, C, et al, J. Mol. Biol. (1993) 229, 235-238, [0275] Larson,
S. B., J. Mol. Biol. (1994) 235, 1560-1584, [0276] Lawson, C. L.,
J. Mol. Biol. (1994) 236, 590-600, [0277] Qian, M., et al., J. Mol.
Biol. (1993) 231, 785-799, [0278] Brady, R. L., et al. Acta
Crystallogr. sect. B, 47, 527-535, [0279] Swift, H. J., et al.,
Acta Crystallogr. sect. B, 47, 535-544 [0280] A. Kadziola, Ph.D.
Thesis: "An alpha-amylase from Barley and its Complex with a
Substrate Analogue Inhibitor Studied by X-ray Crystallography",
Department of Chemistry University of Copenhagen 1993 [0281]
MacGregor, E. A., Food Hydrocolloids, 1987, Vol. 1, No. 5-6, p.
[0282] B. Diderichsen and L. Christiansen, Cloning of a maltogenic
.alpha.-amylase from Bacillus stearothermophilus, FEMS Microbiol.
letters: 56: pp. 53-60 (1988) [0283] Hudson et al., Practical
Immunology, Third edition (1989), Blackwell Scientific
Publications, [0284] Sambrook et al., Molecular Cloning: A
Laboratory Manual, 2nd Ed., Cold Spring Harbor, 1989 [0285] S. L.
Beaucage and M. H. Caruthers, Tetrahedron Letters 22, 1981, pp.
1859-1869 [0286] Matthes et al., The EMBO J. 3, 1984, pp. 801-805.
[0287] R. K. Saiki et al., Science 239, 1988, pp. 487-491, [0288]
Morinaga et al., (1984, Biotechnology 2:646-639) [0289] Nelson and
Long, Analytical Biochemistry 180, 1989, pp. 147-151 [0290]
Hunkapiller et al., 1984, Nature 310:105-111 [0291] R. Higuchi, B.
Krummel, and R. K. Saiki (1988). A general method of in vitro
preparation and specific mutagenesis of DNA fragments; study of
protein and DNA interactions. Nucl. Acids Res. 16:7351-7367. [0292]
Dubnau et al., 1971, J. Mol. Biol. 56, pp. 209-221. [0293] Gryczan
et al., 1978, J. Bacteriol. 134, pp. 318-329. [0294] S. D. Erlich,
1977, Proc. Natl. Acad. Sci. 74, pp. 1680-1682. [0295] Boel et al.,
1990, Biochemistry 29, pp. 6244-6249.
Sequence CWU 1
1
581485PRTBacillus 1His His Asn Gly Thr Asn Gly Thr Met Met Gln Tyr
Phe Glu Trp Tyr 1 5 10 15Leu Pro Asn Asp Gly Asn His Trp Asn Arg
Leu Arg Asp Asp Ala Ala 20 25 30Asn Leu Lys Ser Lys Gly Ile Thr Ala
Val Trp Ile Pro Pro Ala Trp 35 40 45Lys Gly Thr Ser Gln Asn Asp Val
Gly Tyr Gly Ala Tyr Asp Leu Tyr 50 55 60Asp Leu Gly Glu Phe Asn Gln
Lys Gly Thr Val Arg Thr Lys Tyr Gly65 70 75 80Thr Arg Asn Gln Leu
Gln Ala Ala Val Thr Ser Leu Lys Asn Asn Gly 85 90 95Ile Gln Val Tyr
Gly Asp Val Val Met Asn His Lys Gly Gly Ala Asp 100 105 110Gly Thr
Glu Ile Val Asn Ala Val Glu Val Asn Arg Ser Asn Arg Asn 115 120
125Gln Glu Thr Ser Gly Glu Tyr Ala Ile Glu Ala Trp Thr Lys Phe Asp
130 135 140Phe Pro Gly Arg Gly Asn Asn His Ser Ser Phe Lys Trp Arg
Trp Tyr145 150 155 160His Phe Asp Gly Thr Asp Trp Asp Gln Ser Arg
Gln Leu Gln Asn Lys 165 170 175Ile Tyr Lys Phe Arg Gly Thr Gly Lys
Ala Trp Asp Trp Glu Val Asp 180 185 190Thr Glu Asn Gly Asn Tyr Asp
Tyr Leu Met Tyr Ala Asp Val Asp Met 195 200 205Asp His Pro Glu Val
Ile His Glu Leu Arg Asn Trp Gly Val Trp Tyr 210 215 220Thr Asn Thr
Leu Asn Leu Asp Gly Phe Arg Ile Asp Ala Val Lys His225 230 235
240Ile Lys Tyr Ser Phe Thr Arg Asp Trp Leu Thr His Val Arg Asn Thr
245 250 255Thr Gly Lys Pro Met Phe Ala Val Ala Glu Phe Trp Lys Asn
Asp Leu 260 265 270Gly Ala Ile Glu Asn Tyr Leu Asn Lys Thr Ser Trp
Asn His Ser Val 275 280 285Phe Asp Val Pro Leu His Tyr Asn Leu Tyr
Asn Ala Ser Asn Ser Gly 290 295 300Gly Tyr Tyr Asp Met Arg Asn Ile
Leu Asn Gly Ser Val Val Gln Lys305 310 315 320His Pro Thr His Ala
Val Thr Phe Val Asp Asn His Asp Ser Gln Pro 325 330 335Gly Glu Ala
Leu Glu Ser Phe Val Gln Gln Trp Phe Lys Pro Leu Ala 340 345 350Tyr
Ala Leu Val Leu Thr Arg Glu Gln Gly Tyr Pro Ser Val Phe Tyr 355 360
365Gly Asp Tyr Tyr Gly Ile Pro Thr His Gly Val Pro Ala Met Lys Ser
370 375 380Lys Ile Asp Pro Leu Leu Gln Ala Arg Gln Thr Phe Ala Tyr
Gly Thr385 390 395 400Gln His Asp Tyr Phe Asp His His Asp Ile Ile
Gly Trp Thr Arg Glu 405 410 415Gly Asn Ser Ser His Pro Asn Ser Gly
Leu Ala Thr Ile Met Ser Asp 420 425 430Gly Pro Gly Gly Asn Lys Trp
Met Tyr Val Gly Lys Asn Lys Ala Gly 435 440 445Gln Val Trp Arg Asp
Ile Thr Gly Asn Arg Thr Gly Thr Val Thr Ile 450 455 460Asn Ala Asp
Gly Trp Gly Asn Phe Ser Val Asn Gly Gly Ser Val Ser465 470 475
480Val Trp Val Lys Gln 4852485PRTBacillus sp. 2His His Asn Gly Thr
Asn Gly Thr Met Met Gln Tyr Phe Glu Trp His 1 5 10 15Leu Pro Asn
Asp Gly Asn His Trp Asn Arg Leu Arg Asp Asp Ala Ser 20 25 30Asn Leu
Arg Asn Arg Gly Ile Thr Ala Ile Trp Ile Pro Pro Ala Trp 35 40 45Lys
Gly Thr Ser Gln Asn Asp Val Gly Tyr Gly Ala Tyr Asp Leu Tyr 50 55
60Asp Leu Gly Glu Phe Asn Gln Lys Gly Thr Val Arg Thr Lys Tyr Gly65
70 75 80Thr Arg Ser Gln Leu Glu Ser Ala Ile His Ala Leu Lys Asn Asn
Gly 85 90 95Val Gln Val Tyr Gly Asp Val Val Met Asn His Lys Gly Gly
Ala Asp 100 105 110Ala Thr Glu Asn Val Leu Ala Val Glu Val Asn Pro
Asn Asn Arg Asn 115 120 125Gln Glu Ile Ser Gly Asp Tyr Thr Ile Glu
Ala Trp Thr Lys Phe Asp 130 135 140Phe Pro Gly Arg Gly Asn Thr Tyr
Ser Asp Phe Lys Trp Arg Trp Tyr145 150 155 160His Phe Asp Gly Val
Asp Trp Asp Gln Ser Arg Gln Phe Gln Asn Arg 165 170 175Ile Tyr Lys
Phe Arg Gly Asp Gly Lys Ala Trp Asp Trp Glu Val Asp 180 185 190Ser
Glu Asn Gly Asn Tyr Asp Tyr Leu Met Tyr Ala Asp Val Asp Met 195 200
205Asp His Pro Glu Val Val Asn Glu Leu Arg Arg Trp Gly Glu Trp Tyr
210 215 220Thr Asn Thr Leu Asn Leu Asp Gly Phe Arg Ile Asp Ala Val
Lys His225 230 235 240Ile Lys Tyr Ser Phe Thr Arg Asp Trp Leu Thr
His Val Arg Asn Ala 245 250 255Thr Gly Lys Glu Met Phe Ala Val Ala
Glu Phe Trp Lys Asn Asp Leu 260 265 270Gly Ala Leu Glu Asn Tyr Leu
Asn Lys Thr Asn Trp Asn His Ser Val 275 280 285Phe Asp Val Pro Leu
His Tyr Asn Leu Tyr Asn Ala Ser Asn Ser Gly 290 295 300Gly Asn Tyr
Asp Met Ala Lys Leu Leu Asn Gly Thr Val Val Gln Lys305 310 315
320His Pro Met His Ala Val Thr Phe Val Asp Asn His Asp Ser Gln Pro
325 330 335Gly Glu Ser Leu Glu Ser Phe Val Gln Glu Trp Phe Lys Pro
Leu Ala 340 345 350Tyr Ala Leu Ile Leu Thr Arg Glu Gln Gly Tyr Pro
Ser Val Phe Tyr 355 360 365Gly Asp Tyr Tyr Gly Ile Pro Thr His Ser
Val Pro Ala Met Lys Ala 370 375 380Lys Ile Asp Pro Ile Leu Glu Ala
Arg Gln Asn Phe Ala Tyr Gly Thr385 390 395 400Gln His Asp Tyr Phe
Asp His His Asn Ile Ile Gly Trp Thr Arg Glu 405 410 415Gly Asn Thr
Thr His Pro Asn Ser Gly Leu Ala Thr Ile Met Ser Asp 420 425 430Gly
Pro Gly Gly Glu Lys Trp Met Tyr Val Gly Gln Asn Lys Ala Gly 435 440
445Gln Val Trp His Asp Ile Thr Gly Asn Lys Pro Gly Thr Val Thr Ile
450 455 460Asn Ala Asp Gly Trp Ala Asn Phe Ser Val Asn Gly Gly Ser
Val Ser465 470 475 480Ile Trp Val Lys Arg 4853514PRTBacillus
stearothermophilus 3Ala Ala Pro Phe Asn Gly Thr Met Met Gln Tyr Phe
Glu Trp Tyr Leu 1 5 10 15Pro Asp Asp Gly Thr Leu Trp Thr Lys Val
Ala Asn Glu Ala Asn Asn 20 25 30Leu Ser Ser Leu Gly Ile Thr Ala Leu
Trp Leu Pro Pro Ala Tyr Lys 35 40 45Gly Thr Ser Arg Ser Asp Val Gly
Tyr Gly Val Tyr Asp Leu Tyr Asp 50 55 60Leu Gly Glu Phe Asn Gln Lys
Gly Ala Val Arg Thr Lys Tyr Gly Thr65 70 75 80Lys Ala Gln Tyr Leu
Gln Ala Ile Gln Ala Ala His Ala Ala Gly Met 85 90 95Gln Val Tyr Ala
Asp Val Val Phe Asp His Lys Gly Gly Ala Asp Gly 100 105 110Thr Glu
Trp Val Asp Ala Val Glu Val Asn Pro Ser Asp Arg Asn Gln 115 120
125Glu Ile Ser Gly Thr Tyr Gln Ile Gln Ala Trp Thr Lys Phe Asp Phe
130 135 140Pro Gly Arg Gly Asn Thr Tyr Ser Ser Phe Lys Trp Arg Trp
Tyr His145 150 155 160Phe Asp Gly Val Asp Trp Asp Glu Ser Arg Lys
Leu Ser Arg Ile Tyr 165 170 175Lys Phe Arg Gly Ile Gly Lys Ala Trp
Asp Trp Glu Val Asp Thr Glu 180 185 190Asn Gly Asn Tyr Asp Tyr Leu
Met Tyr Ala Asp Leu Asp Met Asp His 195 200 205Pro Glu Val Val Thr
Glu Leu Lys Ser Trp Gly Lys Trp Tyr Val Asn 210 215 220Thr Thr Asn
Ile Asp Gly Phe Arg Leu Asp Ala Val Lys His Ile Lys225 230 235
240Phe Ser Phe Phe Pro Asp Trp Leu Ser Asp Val Arg Ser Gln Thr Gly
245 250 255Lys Pro Leu Phe Thr Val Gly Glu Tyr Trp Ser Tyr Asp Ile
Asn Lys 260 265 270Leu His Asn Tyr Ile Met Lys Thr Asn Gly Thr Met
Ser Leu Phe Asp 275 280 285Ala Pro Leu His Asn Lys Phe Tyr Thr Ala
Ser Lys Ser Gly Gly Thr 290 295 300Phe Asp Met Arg Thr Leu Met Thr
Asn Thr Leu Met Lys Asp Gln Pro305 310 315 320Thr Leu Ala Val Thr
Phe Val Asp Asn His Asp Thr Glu Pro Gly Gln 325 330 335Ala Leu Gln
Ser Trp Val Asp Pro Trp Phe Lys Pro Leu Ala Tyr Ala 340 345 350Phe
Ile Leu Thr Arg Gln Glu Gly Tyr Pro Cys Val Phe Tyr Gly Asp 355 360
365Tyr Tyr Gly Ile Pro Gln Tyr Asn Ile Pro Ser Leu Lys Ser Lys Ile
370 375 380Asp Pro Leu Leu Ile Ala Arg Arg Asp Tyr Ala Tyr Gly Thr
Gln His385 390 395 400Asp Tyr Leu Asp His Ser Asp Ile Ile Gly Trp
Thr Arg Glu Gly Val 405 410 415Thr Glu Lys Pro Gly Ser Gly Leu Ala
Ala Leu Ile Thr Asp Gly Pro 420 425 430Gly Gly Ser Lys Trp Met Tyr
Val Gly Lys Gln His Ala Gly Lys Val 435 440 445Phe Tyr Asp Leu Thr
Gly Asn Arg Ser Asp Thr Val Thr Ile Asn Ser 450 455 460Asp Gly Trp
Gly Glu Phe Lys Val Asn Gly Gly Ser Val Ser Val Trp465 470 475
480Val Pro Arg Lys Thr Thr Val Ser Thr Ile Ala Trp Ser Ile Thr Thr
485 490 495Arg Pro Trp Thr Asp Glu Phe Val Arg Trp Thr Glu Pro Arg
Leu Val 500 505 510Ala Trp4483PRTBacillus licheniformis 4Ala Asn
Leu Asn Gly Thr Leu Met Gln Tyr Phe Glu Trp Tyr Met Pro 1 5 10
15Asn Asp Gly Gln His Trp Arg Arg Leu Gln Asn Asp Ser Ala Tyr Leu
20 25 30Ala Glu His Gly Ile Thr Ala Val Trp Ile Pro Pro Ala Tyr Lys
Gly 35 40 45Thr Ser Gln Ala Asp Val Gly Tyr Gly Ala Tyr Asp Leu Tyr
Asp Leu 50 55 60Gly Glu Phe His Gln Lys Gly Thr Val Arg Thr Lys Tyr
Gly Thr Lys65 70 75 80Gly Glu Leu Gln Ser Ala Ile Lys Ser Leu His
Ser Arg Asp Ile Asn 85 90 95Val Tyr Gly Asp Val Val Ile Asn His Lys
Gly Gly Ala Asp Ala Thr 100 105 110Glu Asp Val Thr Ala Val Glu Val
Asp Pro Ala Asp Arg Asn Arg Val 115 120 125Ile Ser Gly Glu His Leu
Ile Lys Ala Trp Thr His Phe His Phe Pro 130 135 140Gly Arg Gly Ser
Thr Tyr Ser Asp Phe Lys Trp His Trp Tyr His Phe145 150 155 160Asp
Gly Thr Asp Trp Asp Glu Ser Arg Lys Leu Asn Arg Ile Tyr Lys 165 170
175Phe Gln Gly Lys Ala Trp Asp Trp Glu Val Ser Asn Glu Asn Gly Asn
180 185 190Tyr Asp Tyr Leu Met Tyr Ala Asp Ile Asp Tyr Asp His Pro
Asp Val 195 200 205Ala Ala Glu Ile Lys Arg Trp Gly Thr Trp Tyr Ala
Asn Glu Leu Gln 210 215 220Leu Asp Gly Phe Arg Leu Asp Ala Val Lys
His Ile Lys Phe Ser Phe225 230 235 240Leu Arg Asp Trp Val Asn His
Val Arg Glu Lys Thr Gly Lys Glu Met 245 250 255Phe Thr Val Ala Glu
Tyr Trp Gln Asn Asp Leu Gly Ala Leu Glu Asn 260 265 270Tyr Leu Asn
Lys Thr Asn Phe Asn His Ser Val Phe Asp Val Pro Leu 275 280 285His
Tyr Gln Phe His Ala Ala Ser Thr Gln Gly Gly Gly Tyr Asp Met 290 295
300Arg Lys Leu Leu Asn Gly Thr Val Val Ser Lys His Pro Leu Lys
Ser305 310 315 320Val Thr Phe Val Asp Asn His Asp Thr Gln Pro Gly
Gln Ser Leu Glu 325 330 335Ser Thr Val Gln Thr Trp Phe Lys Pro Leu
Ala Tyr Ala Phe Ile Leu 340 345 350Thr Arg Glu Ser Gly Tyr Pro Gln
Val Phe Tyr Gly Asp Met Tyr Gly 355 360 365Thr Lys Gly Asp Ser Gln
Arg Glu Ile Pro Ala Leu Lys His Lys Ile 370 375 380Glu Pro Ile Leu
Lys Ala Arg Lys Gln Tyr Ala Tyr Gly Ala Gln His385 390 395 400Asp
Tyr Phe Asp His His Asp Ile Val Gly Trp Thr Arg Glu Gly Asp 405 410
415Ser Ser Val Ala Asn Ser Gly Leu Ala Ala Leu Ile Thr Asp Gly Pro
420 425 430Gly Gly Ala Lys Arg Met Tyr Val Gly Arg Gln Asn Ala Gly
Glu Thr 435 440 445Trp His Asp Ile Thr Gly Asn Arg Ser Glu Pro Val
Val Ile Asn Ser 450 455 460Glu Gly Trp Gly Glu Phe His Val Asn Gly
Gly Ser Val Ser Ile Tyr465 470 475 480Val Gln Arg5480PRTBacillus
amyloliqufaciens 5Val Asn Gly Thr Leu Met Gln Tyr Phe Glu Trp Tyr
Thr Pro Asn Asp 1 5 10 15Gly Gln His Trp Lys Arg Leu Gln Asn Asp
Ala Glu His Leu Ser Asp 20 25 30Ile Gly Ile Thr Ala Val Trp Ile Pro
Pro Ala Tyr Lys Gly Leu Ser 35 40 45Gln Ser Asp Asn Gly Tyr Gly Pro
Tyr Asp Leu Tyr Asp Leu Gly Glu 50 55 60Phe Gln Gln Lys Gly Thr Val
Arg Thr Lys Tyr Gly Thr Lys Ser Glu65 70 75 80Leu Gln Asp Ala Ile
Gly Ser Leu His Ser Arg Asn Val Gln Val Tyr 85 90 95Gly Asp Val Val
Leu Asn His Lys Ala Gly Ala Asp Ala Thr Glu Asp 100 105 110Val Thr
Ala Val Glu Val Asn Pro Ala Asn Arg Asn Gln Glu Thr Ser 115 120
125Glu Glu Tyr Gln Ile Lys Ala Trp Thr Asp Phe Arg Phe Pro Gly Arg
130 135 140Gly Asn Thr Tyr Ser Asp Phe Lys Trp His Trp Tyr His Phe
Asp Gly145 150 155 160Ala Asp Trp Asp Glu Ser Arg Lys Ile Ser Arg
Ile Phe Lys Phe Arg 165 170 175Gly Glu Gly Lys Ala Trp Asp Trp Glu
Val Ser Ser Glu Asn Gly Asn 180 185 190Tyr Asp Tyr Leu Met Tyr Ala
Asp Val Asp Tyr Asp His Pro Asp Val 195 200 205Val Ala Glu Thr Lys
Lys Trp Gly Ile Trp Tyr Ala Asn Glu Leu Ser 210 215 220Leu Asp Gly
Phe Arg Ile Asp Ala Ala Lys His Ile Lys Phe Ser Phe225 230 235
240Leu Arg Asp Trp Val Gln Ala Val Arg Gln Ala Thr Gly Lys Glu Met
245 250 255Phe Thr Val Ala Glu Tyr Trp Gln Asn Asn Ala Gly Lys Leu
Glu Asn 260 265 270Tyr Leu Asn Lys Thr Ser Phe Asn Gln Ser Val Phe
Asp Val Pro Leu 275 280 285His Phe Asn Leu Gln Ala Ala Ser Ser Gln
Gly Gly Gly Tyr Asp Met 290 295 300Arg Arg Leu Leu Asp Gly Thr Val
Val Ser Arg His Pro Glu Lys Ala305 310 315 320Val Thr Phe Val Glu
Asn His Asp Thr Gln Pro Gly Gln Ser Leu Glu 325 330 335Ser Thr Val
Gln Thr Trp Phe Lys Pro Leu Ala Tyr Ala Phe Ile Leu 340 345 350Thr
Arg Glu Ser Gly Tyr Pro Gln Val Phe Tyr Gly Asp Met Tyr Gly 355 360
365Thr Lys Gly Thr Ser Pro Lys Glu Ile Pro Ser Leu Lys Asp Asn Ile
370 375 380Glu Pro Ile Leu Lys Ala Arg Lys Glu Tyr Ala Tyr Gly Pro
Gln His385 390 395 400Asp Tyr Ile Asp His Pro Asp Val Ile Gly Trp
Thr Arg Glu Gly Asp 405 410 415Ser Ser Ala Ala Lys Ser Gly Leu Ala
Ala Leu Ile Thr Asp Gly Pro 420 425 430Gly Gly Ser Lys Arg Met Tyr
Ala Gly Leu Lys Asn Ala Gly Glu Thr 435 440 445Trp Tyr Asp Ile Thr
Gly Asn Arg Ser Asp Thr Val Lys Ile Gly Ser 450 455 460Asp Gly Trp
Gly Glu Phe His Val Asn Asp Gly Ser Val Ser Ile Tyr465 470 475
4806485PRTBacillus sp. 6His His Asn Gly Thr Asn Gly Thr Met Met Gln
Tyr
Phe Glu Trp Tyr 1 5 10 15Leu Pro Asn Asp Gly Asn His Trp Asn Arg
Leu Asn Ser Asp Ala Ser 20 25 30Asn Leu Lys Ser Lys Gly Ile Thr Ala
Val Trp Ile Pro Pro Ala Trp 35 40 45Lys Gly Ala Ser Gln Asn Asp Val
Gly Tyr Gly Ala Tyr Asp Leu Tyr 50 55 60Asp Leu Gly Glu Phe Asn Gln
Lys Gly Thr Val Arg Thr Lys Tyr Gly65 70 75 80Thr Arg Ser Gln Leu
Gln Ala Ala Val Thr Ser Leu Lys Asn Asn Gly 85 90 95Ile Gln Val Tyr
Gly Asp Val Val Met Asn His Lys Gly Gly Ala Asp 100 105 110Ala Thr
Glu Met Val Arg Ala Val Glu Val Asn Pro Asn Asn Arg Asn 115 120
125Gln Glu Val Thr Gly Glu Tyr Thr Ile Glu Ala Trp Thr Arg Phe Asp
130 135 140Phe Pro Gly Arg Gly Asn Thr His Ser Ser Phe Lys Trp Arg
Trp Tyr145 150 155 160His Phe Asp Gly Val Asp Trp Asp Gln Ser Arg
Arg Leu Asn Asn Arg 165 170 175Ile Tyr Lys Phe Arg Gly His Gly Lys
Ala Trp Asp Trp Glu Val Asp 180 185 190Thr Glu Asn Gly Asn Tyr Asp
Tyr Leu Met Tyr Ala Asp Ile Asp Met 195 200 205Asp His Pro Glu Val
Val Asn Glu Leu Arg Asn Trp Gly Val Trp Tyr 210 215 220Thr Asn Thr
Leu Gly Leu Asp Gly Phe Arg Ile Asp Ala Val Lys His225 230 235
240Ile Lys Tyr Ser Phe Thr Arg Asp Trp Ile Asn His Val Arg Ser Ala
245 250 255Thr Gly Lys Asn Met Phe Ala Val Ala Glu Phe Trp Lys Asn
Asp Leu 260 265 270Gly Ala Ile Glu Asn Tyr Leu Gln Lys Thr Asn Trp
Asn His Ser Val 275 280 285Phe Asp Val Pro Leu His Tyr Asn Leu Tyr
Asn Ala Ser Lys Ser Gly 290 295 300Gly Asn Tyr Asp Met Arg Asn Ile
Phe Asn Gly Thr Val Val Gln Arg305 310 315 320His Pro Ser His Ala
Val Thr Phe Val Asp Asn His Asp Ser Gln Pro 325 330 335Glu Glu Ala
Leu Glu Ser Phe Val Glu Glu Trp Phe Lys Pro Leu Ala 340 345 350Tyr
Ala Leu Thr Leu Thr Arg Glu Gln Gly Tyr Pro Ser Val Phe Tyr 355 360
365Gly Asp Tyr Tyr Gly Ile Pro Thr His Gly Val Pro Ala Met Arg Ser
370 375 380Lys Ile Asp Pro Ile Leu Glu Ala Arg Gln Lys Tyr Ala Tyr
Gly Lys385 390 395 400Gln Asn Asp Tyr Leu Asp His His Asn Ile Ile
Gly Trp Thr Arg Glu 405 410 415Gly Asn Thr Ala His Pro Asn Ser Gly
Leu Ala Thr Ile Met Ser Asp 420 425 430Gly Ala Gly Gly Ser Lys Trp
Met Phe Val Gly Arg Asn Lys Ala Gly 435 440 445Gln Val Trp Ser Asp
Ile Thr Gly Asn Arg Thr Gly Thr Val Thr Ile 450 455 460Asn Ala Asp
Gly Trp Gly Asn Phe Ser Val Asn Gly Gly Ser Val Ser465 470 475
480Ile Trp Val Asn Lys 4857485PRTBacillus sp. 7His His Asn Gly Thr
Asn Gly Thr Met Met Gln Tyr Phe Glu Trp Tyr 1 5 10 15Leu Pro Asn
Asp Gly Asn His Trp Asn Arg Leu Arg Asp Asp Ala Ala 20 25 30Asn Leu
Lys Ser Lys Gly Ile Thr Ala Val Trp Ile Pro Pro Ala Trp 35 40 45Lys
Gly Thr Ser Gln Asn Asp Val Gly Tyr Gly Ala Tyr Asp Leu Tyr 50 55
60Asp Leu Gly Glu Phe Asn Gln Lys Gly Thr Val Arg Thr Lys Tyr Gly65
70 75 80Thr Arg Asn Gln Leu Gln Ala Ala Val Thr Ser Leu Lys Asn Asn
Gly 85 90 95Ile Gln Val Tyr Gly Asp Val Val Met Asn His Lys Gly Gly
Ala Asp 100 105 110Gly Thr Glu Ile Val Asn Ala Val Glu Val Asn Arg
Ser Asn Arg Asn 115 120 125Gln Glu Thr Ser Gly Glu Tyr Ala Ile Glu
Ala Trp Thr Lys Phe Asp 130 135 140Phe Pro Gly Arg Gly Asn Asn His
Ser Ser Phe Lys Trp Arg Trp Tyr145 150 155 160His Phe Asp Gly Thr
Asp Trp Asp Gln Ser Arg Gln Leu Gln Asn Lys 165 170 175Ile Tyr Lys
Phe Arg Gly Thr Gly Lys Ala Trp Asp Trp Glu Val Asp 180 185 190Thr
Glu Asn Gly Asn Tyr Asp Tyr Leu Met Tyr Ala Asp Val Asp Met 195 200
205Asp His Pro Glu Val Ile His Glu Leu Arg Asn Trp Gly Val Trp Tyr
210 215 220Thr Asn Thr Leu Asn Leu Asp Gly Phe Arg Ile Asp Ala Val
Lys His225 230 235 240Ile Lys Tyr Ser Phe Thr Arg Asp Trp Leu Thr
His Val Arg Asn Thr 245 250 255Thr Gly Lys Pro Met Phe Ala Val Ala
Glu Phe Trp Lys Asn Asp Leu 260 265 270Gly Ala Ile Glu Asn Tyr Leu
Asn Lys Thr Ser Trp Asn His Ser Val 275 280 285Phe Asp Val Pro Leu
His Tyr Asn Leu Tyr Asn Ala Ser Asn Ser Gly 290 295 300Gly Tyr Tyr
Asp Met Arg Asn Ile Leu Asn Gly Ser Val Val Gln Lys305 310 315
320His Pro Thr His Ala Val Thr Phe Val Asp Asn His Asp Ser Gln Pro
325 330 335Gly Glu Ala Leu Glu Ser Phe Val Gln Gln Trp Phe Lys Pro
Leu Ala 340 345 350Tyr Ala Leu Val Leu Thr Arg Glu Gln Gly Tyr Pro
Ser Val Phe Tyr 355 360 365Gly Asp Tyr Tyr Gly Ile Pro Thr His Gly
Val Pro Ala Met Lys Ser 370 375 380Lys Ile Asp Pro Leu Leu Gln Ala
Arg Gln Thr Phe Ala Tyr Gly Thr385 390 395 400Gln His Asp Tyr Phe
Asp His His Asp Ile Ile Gly Trp Thr Arg Glu 405 410 415Gly Asn Ser
Ser His Pro Asn Ser Gly Leu Ala Thr Ile Met Ser Asp 420 425 430Gly
Pro Gly Gly Asn Lys Trp Met Tyr Val Gly Lys Asn Lys Ala Gly 435 440
445Gln Val Trp Arg Asp Ile Thr Gly Asn Arg Thr Gly Thr Val Thr Ile
450 455 460Asn Ala Asp Gly Trp Gly Asn Phe Ser Val Asn Gly Gly Ser
Val Ser465 470 475 480Val Trp Val Lys Gln 4858485PRTBacillus sp.
8His His Asn Gly Thr Asn Gly Thr Met Met Gln Tyr Phe Glu Trp His 1
5 10 15Leu Pro Asn Asp Gly Asn His Trp Asn Arg Leu Arg Asp Asp Ala
Ser 20 25 30Asn Leu Arg Asn Arg Gly Ile Thr Ala Ile Trp Ile Pro Pro
Ala Trp 35 40 45Lys Gly Thr Ser Gln Asn Asp Val Gly Tyr Gly Ala Tyr
Asp Leu Tyr 50 55 60Asp Leu Gly Glu Phe Asn Gln Lys Gly Thr Val Arg
Thr Lys Tyr Gly65 70 75 80Thr Arg Ser Gln Leu Glu Ser Ala Ile His
Ala Leu Lys Asn Asn Gly 85 90 95Val Gln Val Tyr Gly Asp Val Val Met
Asn His Lys Gly Gly Ala Asp 100 105 110Ala Thr Glu Asn Val Leu Ala
Val Glu Val Asn Pro Asn Asn Arg Asn 115 120 125Gln Glu Ile Ser Gly
Asp Tyr Thr Ile Glu Ala Trp Thr Lys Phe Asp 130 135 140Phe Pro Gly
Arg Gly Asn Thr Tyr Ser Asp Phe Lys Trp Arg Trp Tyr145 150 155
160His Phe Asp Gly Val Asp Trp Asp Gln Ser Arg Gln Phe Gln Asn Arg
165 170 175Ile Tyr Lys Phe Arg Gly Asp Gly Lys Ala Trp Asp Trp Glu
Val Asp 180 185 190Ser Glu Asn Gly Asn Tyr Asp Tyr Leu Met Tyr Ala
Asp Val Asp Met 195 200 205Asp His Pro Glu Val Val Asn Glu Leu Arg
Arg Trp Gly Glu Trp Tyr 210 215 220Thr Asn Thr Leu Asn Leu Asp Gly
Phe Arg Ile Asp Ala Val Lys His225 230 235 240Ile Lys Tyr Ser Phe
Thr Arg Asp Trp Leu Thr His Val Arg Asn Ala 245 250 255Thr Gly Lys
Glu Met Phe Ala Val Ala Glu Phe Trp Lys Asn Asp Leu 260 265 270Gly
Ala Leu Glu Asn Tyr Leu Asn Lys Thr Asn Trp Asn His Ser Val 275 280
285Phe Asp Val Pro Leu His Tyr Asn Leu Tyr Asn Ala Ser Asn Ser Gly
290 295 300Gly Asn Tyr Asp Met Ala Lys Leu Leu Asn Gly Thr Val Val
Gln Lys305 310 315 320His Pro Met His Ala Val Thr Phe Val Asp Asn
His Asp Ser Gln Pro 325 330 335Gly Glu Ser Leu Glu Ser Phe Val Gln
Glu Trp Phe Lys Pro Leu Ala 340 345 350Tyr Ala Leu Ile Leu Thr Arg
Glu Gln Gly Tyr Pro Ser Val Phe Tyr 355 360 365Gly Asp Tyr Tyr Gly
Ile Pro Thr His Ser Val Pro Ala Met Lys Ala 370 375 380Lys Ile Asp
Pro Ile Leu Glu Ala Arg Gln Asn Phe Ala Tyr Gly Thr385 390 395
400Gln His Asp Tyr Phe Asp His His Asn Ile Ile Gly Trp Thr Arg Glu
405 410 415Gly Asn Thr Thr His Pro Asn Ser Gly Leu Ala Thr Ile Met
Ser Asp 420 425 430Gly Pro Gly Gly Glu Lys Trp Met Tyr Val Gly Gln
Asn Lys Ala Gly 435 440 445Gln Val Trp His Asp Ile Thr Gly Asn Lys
Pro Gly Thr Val Thr Ile 450 455 460Asn Ala Asp Gly Trp Ala Asn Phe
Ser Val Asn Gly Gly Ser Val Ser465 470 475 480Ile Trp Val Lys Arg
48591455DNABacillus 9catcataatg gaacaaatgg tactatgatg caatatttcg
aatggtattt gccaaatgac 60gggaatcatt ggaacaggtt gagggatgac gcagctaact
taaagagtaa agggataaca 120gctgtatgga tcccacctgc atggaagggg
acttcccaga atgatgtagg ttatggagcc 180tatgatttat atgatcttgg
agagtttaac cagaagggga cggttcgtac aaaatatgga 240acacgcaacc
agctacaggc tgcggtgacc tctttaaaaa ataacggcat tcaggtatat
300ggtgatgtcg tcatgaatca taaaggtgga gcagatggta cggaaattgt
aaatgcggta 360gaagtgaatc ggagcaaccg aaaccaggaa acctcaggag
agtatgcaat agaagcgtgg 420acaaagtttg attttcctgg aagaggaaat
aaccattcca gctttaagtg gcgctggtat 480cattttgatg ggacagattg
ggatcagtca cgccagcttc aaaacaaaat atataaattc 540aggggaacag
gcaaggcctg ggactgggaa gtcgatacag agaatggcaa ctatgactat
600cttatgtatg cagacgtgga tatggatcac ccagaagtaa tacatgaact
tagaaactgg 660ggagtgtggt atacgaatac actgaacctt gatggattta
gaatagatgc agtgaaacat 720ataaaatata gctttacgag agattggctt
acacatgtgc gtaacaccac aggtaaacca 780atgtttgcag tggctgagtt
ttggaaaaat gaccttggtg caattgaaaa ctatttgaat 840aaaacaagtt
ggaatcactc ggtgtttgat gttcctctcc actataattt gtacaatgca
900tctaatagcg gtggttatta tgatatgaga aatattttaa atggttctgt
ggtgcaaaaa 960catccaacac atgccgttac ttttgttgat aaccatgatt
ctcagcccgg ggaagcattg 1020gaatcctttg ttcaacaatg gtttaaacca
cttgcatatg cattggttct gacaagggaa 1080caaggttatc cttccgtatt
ttatggggat tactacggta tcccaaccca tggtgttccg 1140gctatgaaat
ctaaaataga ccctcttctg caggcacgtc aaacttttgc ctatggtacg
1200cagcatgatt actttgatca tcatgatatt atcggttgga caagagaggg
aaatagctcc 1260catccaaatt caggccttgc caccattatg tcagatggtc
caggtggtaa caaatggatg 1320tatgtgggga aaaataaagc gggacaagtt
tggagagata ttaccggaaa taggacaggc 1380accgtcacaa ttaatgcaga
cggatggggt aatttctctg ttaatggagg gtccgtttcg 1440gtttgggtga agcaa
1455101455DNABacillus sp. 10catcataatg ggacaaatgg gacgatgatg
caatactttg aatggcactt gcctaatgat 60gggaatcact ggaatagatt aagagatgat
gctagtaatc taagaaatag aggtataacc 120gctatttgga ttccgcctgc
ctggaaaggg acttcgcaaa atgatgtggg gtatggagcc 180tatgatcttt
atgatttagg ggaatttaat caaaagggga cggttcgtac taagtatggg
240acacgtagtc aattggagtc tgccatccat gctttaaaga ataatggcgt
tcaagtttat 300ggggatgtag tgatgaacca taaaggagga gctgatgcta
cagaaaacgt tcttgctgtc 360gaggtgaatc caaataaccg gaatcaagaa
atatctgggg actacacaat tgaggcttgg 420actaagtttg attttccagg
gaggggtaat acatactcag actttaaatg gcgttggtat 480catttcgatg
gtgtagattg ggatcaatca cgacaattcc aaaatcgtat ctacaaattc
540cgaggtgatg gtaaggcatg ggattgggaa gtagattcgg aaaatggaaa
ttatgattat 600ttaatgtatg cagatgtaga tatggatcat ccggaggtag
taaatgagct tagaagatgg 660ggagaatggt atacaaatac attaaatctt
gatggattta ggatcgatgc ggtgaagcat 720attaaatata gctttacacg
tgattggttg acccatgtaa gaaacgcaac gggaaaagaa 780atgtttgctg
ttgctgaatt ttggaaaaat gatttaggtg ccttggagaa ctatttaaat
840aaaacaaact ggaatcattc tgtctttgat gtcccccttc attataatct
ttataacgcg 900tcaaatagtg gaggcaacta tgacatggca aaacttctta
atggaacggt tgttcaaaag 960catccaatgc atgccgtaac ttttgtggat
aatcacgatt ctcaacctgg ggaatcatta 1020gaatcatttg tacaagaatg
gtttaagcca cttgcttatg cgcttatttt aacaagagaa 1080caaggctatc
cctctgtctt ctatggtgac tactatggaa ttccaacaca tagtgtccca
1140gcaatgaaag ccaagattga tccaatctta gaggcgcgtc aaaattttgc
atatggaaca 1200caacatgatt attttgacca tcataatata atcggatgga
cacgtgaagg aaataccacg 1260catcccaatt caggacttgc gactatcatg
tcggatgggc cagggggaga gaaatggatg 1320tacgtagggc aaaataaagc
aggtcaagtt tggcatgaca taactggaaa taaaccagga 1380acagttacga
tcaatgcaga tggatgggct aatttttcag taaatggagg atctgtttcc
1440atttgggtga aacga 1455111548DNABacillus stearothermophilus
11gccgcaccgt ttaacggcac catgatgcag tattttgaat ggtacttgcc ggatgatggc
60acgttatgga ccaaagtggc caatgaagcc aacaacttat ccagccttgg catcaccgct
120ctttggctgc cgcccgctta caaaggaaca agccgcagcg acgtagggta
cggagtatac 180gacttgtatg acctcggcga attcaatcaa aaagggaccg
tccgcacaaa atacggaaca 240aaagctcaat atcttcaagc cattcaagcc
gcccacgccg ctggaatgca agtgtacgcc 300gatgtcgtgt tcgaccataa
aggcggcgct gacggcacgg aatgggtgga cgccgtcgaa 360gtcaatccgt
ccgaccgcaa ccaagaaatc tcgggcacct atcaaatcca agcatggacg
420aaatttgatt ttcccgggcg gggcaacacc tactccagct ttaagtggcg
ctggtaccat 480tttgacggcg ttgattggga cgaaagccga aaattgagcc
gcatttacaa attccgcggc 540atcggcaaag cgtgggattg ggaagtagac
acggaaaacg gaaactatga ctacttaatg 600tatgccgacc ttgatatgga
tcatcccgaa gtcgtgaccg agctgaaaaa ctgggggaaa 660tggtatgtca
acacaacgaa cattgatggg ttccggcttg atgccgtcaa gcatattaag
720ttcagttttt ttcctgattg gttgtcgtat gtgcgttctc agactggcaa
gccgctattt 780accgtcgggg aatattggag ctatgacatc aacaagttgc
acaattacat tacgaaaaca 840gacggaacga tgtctttgtt tgatgccccg
ttacacaaca aattttatac cgcttccaaa 900tcagggggcg catttgatat
gcgcacgtta atgaccaata ctctcatgaa agatcaaccg 960acattggccg
tcaccttcgt tgataatcat gacaccgaac ccggccaagc gctgcagtca
1020tgggtcgacc catggttcaa accgttggct tacgccttta ttctaactcg
gcaggaagga 1080tacccgtgcg tcttttatgg tgactattat ggcattccac
aatataacat tccttcgctg 1140aaaagcaaaa tcgatccgct cctcatcgcg
cgcagggatt atgcttacgg aacgcaacat 1200gattatcttg atcactccga
catcatcggg tggacaaggg aagggggcac tgaaaaacca 1260ggatccggac
tggccgcact gatcaccgat gggccgggag gaagcaaatg gatgtacgtt
1320ggcaaacaac acgctggaaa agtgttctat gaccttaccg gcaaccggag
tgacaccgtc 1380accatcaaca gtgatggatg gggggaattc aaagtcaatg
gcggttcggt ttcggtttgg 1440gttcctagaa aaacgaccgt ttctaccatc
gctcggccga tcacaacccg accgtggact 1500ggtgaattcg tccgttggac
cgaaccacgg ttggtggcat ggccttga 1548121920DNABacillus
licheniformisCDS(421)...(1872) 12cggaagattg gaagtacaaa aataagcaaa
agattgtcaa tcatgtcatg agccatgcgg 60gagacggaaa aatcgtctta atgcacgata
tttatgcaac gttcgcagat gctgctgaag 120agattattaa aaagctgaaa
gcaaaaggct atcaattggt aactgtatct cagcttgaag 180aagtgaagaa
gcagagaggc tattgaataa atgagtagaa gcgccatatc ggcgcttttc
240ttttggaaga aaatataggg aaaatggtac ttgttaaaaa ttcggaatat
ttatacaaca 300tcatatgttt cacattgaaa ggggaggaga atcatgaaac
aacaaaaacg gctttacgcc 360cgattgctga cgctgttatt tgcgctcatc
ttcttgctgc ctcattctgc agcagcggcg 420gca aat ctt aat ggg acg ctg atg
cag tat ttt gaa tgg tac atg ccc 468Ala Asn Leu Asn Gly Thr Leu Met
Gln Tyr Phe Glu Trp Tyr Met Pro 1 5 10 15aat gac ggc caa cat tgg
agg cgt ttg caa aac gac tcg gca tat ttg 516Asn Asp Gly Gln His Trp
Arg Arg Leu Gln Asn Asp Ser Ala Tyr Leu 20 25 30gct gaa cac ggt att
act gcc gtc tgg att ccc ccg gca tat aag gga 564Ala Glu His Gly Ile
Thr Ala Val Trp Ile Pro Pro Ala Tyr Lys Gly 35 40 45acg agc caa gcg
gat gtg ggc tac ggt gct tac gac ctt tat gat tta 612Thr Ser Gln Ala
Asp Val Gly Tyr Gly Ala Tyr Asp Leu Tyr Asp Leu 50 55 60ggg gag ttt
cat caa aaa ggg acg gtt cgg aca aag tac ggc aca aaa 660Gly Glu Phe
His Gln Lys Gly Thr Val Arg Thr Lys Tyr Gly Thr Lys 65 70 75 80gga
gag ctg caa tct gcg atc aaa agt ctt cat tcc cgc gac att aac 708Gly
Glu Leu Gln Ser Ala Ile Lys Ser Leu His Ser Arg Asp Ile Asn 85 90
95gtt tac ggg gat gtg gtc atc aac cac aaa ggc ggc gct gat gcg acc
756Val Tyr Gly Asp Val Val Ile Asn His Lys Gly Gly Ala Asp Ala Thr
100 105
110gaa gat gta acc gcg gtt gaa gtc gat ccc gct gac cgc aac cgc gta
804Glu Asp Val Thr Ala Val Glu Val Asp Pro Ala Asp Arg Asn Arg Val
115 120 125att tca gga gaa cac cta att aaa gcc tgg aca cat ttt cat
ttt ccg 852Ile Ser Gly Glu His Leu Ile Lys Ala Trp Thr His Phe His
Phe Pro 130 135 140ggg cgc ggc agc aca tac agc gat ttt aaa tgg cat
tgg tac cat ttt 900Gly Arg Gly Ser Thr Tyr Ser Asp Phe Lys Trp His
Trp Tyr His Phe145 150 155 160gac gga acc gat tgg gac gag tcc cga
aag ctg aac cgc atc tat aag 948Asp Gly Thr Asp Trp Asp Glu Ser Arg
Lys Leu Asn Arg Ile Tyr Lys 165 170 175ttt caa gga aag gct tgg gat
tgg gaa gtt tcc aat gaa aac ggc aac 996Phe Gln Gly Lys Ala Trp Asp
Trp Glu Val Ser Asn Glu Asn Gly Asn 180 185 190tat gat tat ttg atg
tat gcc gac atc gat tat gac cat cct gat gtc 1044Tyr Asp Tyr Leu Met
Tyr Ala Asp Ile Asp Tyr Asp His Pro Asp Val 195 200 205gca gca gaa
att aag aga tgg ggc act tgg tat gcc aat gaa ctg caa 1092Ala Ala Glu
Ile Lys Arg Trp Gly Thr Trp Tyr Ala Asn Glu Leu Gln 210 215 220ttg
gac ggt ttc cgt ctt gat gct gtc aaa cac att aaa ttt tct ttt 1140Leu
Asp Gly Phe Arg Leu Asp Ala Val Lys His Ile Lys Phe Ser Phe225 230
235 240ttg cgg gat tgg gtt aat cat gtc agg gaa aaa acg ggg aag gaa
atg 1188Leu Arg Asp Trp Val Asn His Val Arg Glu Lys Thr Gly Lys Glu
Met 245 250 255ttt acg gta gct gaa tat tgg cag aat gac ttg ggc gcg
ctg gaa aac 1236Phe Thr Val Ala Glu Tyr Trp Gln Asn Asp Leu Gly Ala
Leu Glu Asn 260 265 270tat ttg aac aaa aca aat ttt aat cat tca gtg
ttt gac gtg ccg ctt 1284Tyr Leu Asn Lys Thr Asn Phe Asn His Ser Val
Phe Asp Val Pro Leu 275 280 285cat tat cag ttc cat gct gca tcg aca
cag gga ggc ggc tat gat atg 1332His Tyr Gln Phe His Ala Ala Ser Thr
Gln Gly Gly Gly Tyr Asp Met 290 295 300agg aaa ttg ctg aac ggt acg
gtc gtt tcc aag cat ccg ttg aaa tcg 1380Arg Lys Leu Leu Asn Gly Thr
Val Val Ser Lys His Pro Leu Lys Ser305 310 315 320gtt aca ttt gtc
gat aac cat gat aca cag ccg ggg caa tcg ctt gag 1428Val Thr Phe Val
Asp Asn His Asp Thr Gln Pro Gly Gln Ser Leu Glu 325 330 335tcg act
gtc caa aca tgg ttt aag ccg ctt gct tac gct ttt att ctc 1476Ser Thr
Val Gln Thr Trp Phe Lys Pro Leu Ala Tyr Ala Phe Ile Leu 340 345
350aca agg gaa tct gga tac cct cag gtt ttc tac ggg gat atg tac ggg
1524Thr Arg Glu Ser Gly Tyr Pro Gln Val Phe Tyr Gly Asp Met Tyr Gly
355 360 365acg aaa gga gac tcc cag cgc gaa att cct gcc ttg aaa cac
aaa att 1572Thr Lys Gly Asp Ser Gln Arg Glu Ile Pro Ala Leu Lys His
Lys Ile 370 375 380gaa ccg atc tta aaa gcg aga aaa cag tat gcg tac
gga gca cag cat 1620Glu Pro Ile Leu Lys Ala Arg Lys Gln Tyr Ala Tyr
Gly Ala Gln His385 390 395 400gat tat ttc gac cac cat gac att gtc
ggc tgg aca agg gaa ggc gac 1668Asp Tyr Phe Asp His His Asp Ile Val
Gly Trp Thr Arg Glu Gly Asp 405 410 415agc tcg gtt gca aat tca ggt
ttg gcg gca tta ata aca gac gga ccc 1716Ser Ser Val Ala Asn Ser Gly
Leu Ala Ala Leu Ile Thr Asp Gly Pro 420 425 430ggt ggg gca aag cga
atg tat gtc ggc cgg caa aac gcc ggt gag aca 1764Gly Gly Ala Lys Arg
Met Tyr Val Gly Arg Gln Asn Ala Gly Glu Thr 435 440 445tgg cat gac
att acc gga aac cgt tcg gag ccg gtt gtc atc aat tcg 1812Trp His Asp
Ile Thr Gly Asn Arg Ser Glu Pro Val Val Ile Asn Ser 450 455 460gaa
ggc tgg gga gag ttt cac gta aac ggc ggg tcg gtt tca att tat 1860Glu
Gly Trp Gly Glu Phe His Val Asn Gly Gly Ser Val Ser Ile Tyr465 470
475 480gtt caa aga tag aagagcagag aggacggatt tcctgaagga aatccgtttt
1912Val Gln Arg *tttatttt 1920131455DNABacillus sp. 13catcataatg
gaacaaatgg tactatgatg caatatttcg aatggtattt gccaaatgac 60gggaatcatt
ggaacaggtt gagggatgac gcagctaact taaagagtaa agggataaca
120gctgtatgga tcccacctgc atggaagggg acttcccaga atgatgtagg
ttatggagcc 180tatgatttat atgatcttgg agagtttaac cagaagggga
cggttcgtac aaaatatgga 240acacgcaacc agctacaggc tgcggtgacc
tctttaaaaa ataacggcat tcaggtatat 300ggtgatgtcg tcatgaatca
taaaggtgga gcagatggta cggaaattgt aaatgcggta 360gaagtgaatc
ggagcaaccg aaaccaggaa acctcaggag agtatgcaat agaagcgtgg
420acaaagtttg attttcctgg aagaggaaat aaccattcca gctttaagtg
gcgctggtat 480cattttgatg ggacagattg ggatcagtca cgccagcttc
aaaacaaaat atataaattc 540aggggaacag gcaaggcctg ggactgggaa
gtcgatacag agaatggcaa ctatgactat 600cttatgtatg cagacgtgga
tatggatcac ccagaagtaa tacatgaact tagaaactgg 660ggagtgtggt
atacgaatac actgaacctt gatggattta gaatagatgc agtgaaacat
720ataaaatata gctttacgag agattggctt acacatgtgc gtaacaccac
aggtaaacca 780atgtttgcag tggctgagtt ttggaaaaat gaccttggtg
caattgaaaa ctatttgaat 840aaaacaagtt ggaatcactc ggtgtttgat
gttcctctcc actataattt gtacaatgca 900tctaatagcg gtggttatta
tgatatgaga aatattttaa atggttctgt ggtgcaaaaa 960catccaacac
atgccgttac ttttgttgat aaccatgatt ctcagcccgg ggaagcattg
1020gaatcctttg ttcaacaatg gtttaaacca cttgcatatg cattggttct
gacaagggaa 1080caaggttatc cttccgtatt ttatggggat tactacggta
tcccaaccca tggtgttccg 1140gctatgaaat ctaaaataga ccctcttctg
caggcacgtc aaacttttgc ctatggtacg 1200cagcatgatt actttgatca
tcatgatatt atcggttgga caagagaggg aaatagctcc 1260catccaaatt
caggccttgc caccattatg tcagatggtc caggtggtaa caaatggatg
1320tatgtgggga aaaataaagc gggacaagtt tggagagata ttaccggaaa
taggacaggc 1380accgtcacaa ttaatgcaga cggatggggt aatttctctg
ttaatggagg gtccgtttcg 1440gtttgggtga agcaa 1455141455DNABacillus
sp. 14catcataatg ggacaaatgg gacgatgatg caatactttg aatggcactt
gcctaatgat 60gggaatcact ggaatagatt aagagatgat gctagtaatc taagaaatag
aggtataacc 120gctatttgga ttccgcctgc ctggaaaggg acttcgcaaa
atgatgtggg gtatggagcc 180tatgatcttt atgatttagg ggaatttaat
caaaagggga cggttcgtac taagtatggg 240acacgtagtc aattggagtc
tgccatccat gctttaaaga ataatggcgt tcaagtttat 300ggggatgtag
tgatgaacca taaaggagga gctgatgcta cagaaaacgt tcttgctgtc
360gaggtgaatc caaataaccg gaatcaagaa atatctgggg actacacaat
tgaggcttgg 420actaagtttg attttccagg gaggggtaat acatactcag
actttaaatg gcgttggtat 480catttcgatg gtgtagattg ggatcaatca
cgacaattcc aaaatcgtat ctacaaattc 540cgaggtgatg gtaaggcatg
ggattgggaa gtagattcgg aaaatggaaa ttatgattat 600ttaatgtatg
cagatgtaga tatggatcat ccggaggtag taaatgagct tagaagatgg
660ggagaatggt atacaaatac attaaatctt gatggattta ggatcgatgc
ggtgaagcat 720attaaatata gctttacacg tgattggttg acccatgtaa
gaaacgcaac gggaaaagaa 780atgtttgctg ttgctgaatt ttggaaaaat
gatttaggtg ccttggagaa ctatttaaat 840aaaacaaact ggaatcattc
tgtctttgat gtcccccttc attataatct ttataacgcg 900tcaaatagtg
gaggcaacta tgacatggca aaacttctta atggaacggt tgttcaaaag
960catccaatgc atgccgtaac ttttgtggat aatcacgatt ctcaacctgg
ggaatcatta 1020gaatcatttg tacaagaatg gtttaagcca cttgcttatg
cgcttatttt aacaagagaa 1080caaggctatc cctctgtctt ctatggtgac
tactatggaa ttccaacaca tagtgtccca 1140gcaatgaaag ccaagattga
tccaatctta gaggcgcgtc aaaattttgc atatggaaca 1200caacatgatt
attttgacca tcataatata atcggatgga cacgtgaagg aaataccacg
1260catcccaatt caggacttgc gactatcatg tcggatgggc cagggggaga
gaaatggatg 1320tacgtagggc aaaataaagc aggtcaagtt tggcatgaca
taactggaaa taaaccagga 1380acagttacga tcaatgcaga tggatgggct
aatttttcag taaatggagg atctgtttcc 1440atttgggtga aacga
14551560DNAArtifiicial sequenceprimer 15caaaatcgta tctacaaatt
cmrkrsyarg dvktgggatt sggaagtaga ttcggaaaat 601621DNAArtificial
SequencePrimer 16gaatttgtag atacgatttt g 211724DNAArtificial
SequencePrimer 17cgattgctga cgctgttatt tgcg 241824DNAArtificial
SequencePrimer 18cttgttccct tgtcagaacc aatg 241930DNAArtificial
SequencePrimer 19gtcatagttg ccgaaatctg tatcgacttc
302038DNAArtificial SequencePrimer 20cccagtccca cgtacgtccc
ctgaatttat atattttg 382138DNAArtificial
Sequencemisc_feature(0)...(0)n on position 12 is 25% A, 25% C, 25%
G, 25% T Primer 21cccagtccca gntctttccc ctgaatttat atattttg
382225DNAArtificial SequencePrimer 22gcgtggacaa agtttgattt tcctg
252321DNAArtificial SequencePrimer 23cctaatgatg ggaatcactg g
212424DNAArtificial SequencePrimer 24gcattggatg cttttgaaca accg
242526DNAArtificial SequencePrimer 25cgcaaaatga tatcgggtat ggagcc
262629DNAArtificial SequencePrimer 26gtgatgaacc acswaggtgg
agctgatgc 292730DNAArtificial SequencePrimer 27gatggtgtat
ggrycaatca cgacaattcc 302828DNAArtificial SequencePrimer
28ggtgtatggg ataactcacg acaattcc 282928DNAArtificial SequencePrimer
29ggtgtatggg atctctcacg acaattcc 283032DNAArtificial SequencePrimer
30gggatcaatc acgaaatttc caaaatcgta tc 323132DNAArtificial
SequencePrimer 31gggatcaatc acgactcttc caaaatcgta tc
323234DNAArtificial SequencePrimer 32ggaaattatg attatatcat
gtatgcagat gtag 343330DNAArtificial SequencePrimer 33gctgaatttt
ggtcgaatga tttaggtgcc 303430DNAArtificial SequencePrimer
34gctgaatttt ggtcgaatga tttaggtgcc 303527DNAArtificial
SequencePrimer 35gaattttgga agtacgattt aggtcgg 273629DNAArtificial
SequencePrimer 36ggaaaaacga trycggtgcc ttggagaac
293727DNAArtificial SequencePrimer 37gatttaggtg cctrycagaa ctattta
273826DNAArtificial SequencePrimer 38cccccttcat gagaatcttt ataacg
263925DNAArtificial SequencePrimer 39gaatccgaac ctcattacac attcg
254028DNAArtificial SequencePrimer 40cggatggact cgagaaggaa ataccacg
284131DNAArtificial SequencePrimer 41cgtagggcaa aatcaggccg
gtcaagtttg g 314231DNAArtificial SequencePrimer 42cataactgga
aatcgcccgg gaacagttac g 314326DNAArtificial SequencePrimer
43ctggaaataa awccggaaca gttacg 264432DNAArtificial SequencePrimer
44ggaaataaac caggacccgt tacgatcaat gc 324528DNAArtificial
SequencePrimer 45gaggcttgga ctaggtttga ttttccag 284630DNAArtificial
SequencePrimer 46gctgaatttt ggcgcaatga tttaggtgcc
304734DNAArtificial SequencePrimer 47gtgtttgacg tcccgcttca
tgagaattta cagg 344834DNAArtificial SequencePrimer 48gtgtttgacg
tcccgcttca taagaattta cagg 344934DNAArtificial SequencePrimer
49gtgtttgacg tcccgcttca tgccaattta cagg 345032DNAArtificial
SequencePrimer 50agggaatccg gataccctga ggttttctac gg
325134DNAArtificial SequencePrimer 51gatgtggttt tggatcataa
ggccggcgct gatg 345222DNAArtificial SequencePrimer 52ctgttattaa
tgccgccaaa cc 225324DNAArtificial SequencePrimer 53ggaaaagaaa
tgtttacggt tgcg 245425DNAArtificial SequencePrimer 54gaaatgaagc
ggaacatcaa acacg 255520DNAArtificial SequencePrimer 55gtatgattta
ggagaattcc 205633DNAArtificial SequencePrimer 56ccagcgcgcc
taggtcacgc tgccaatatt cag 335733DNAArtificial SequencePrimer
57ccagcgcgcc taggtcatcc tgccaatatt cag 33582084DNABacillus
amyloliquefaciensCDS(343)...(1794) 58gccccgcaca tacgaaaaga
ctggctgaaa acattgagcc tttgatgact gatgatttgg 60ctgaagaagt ggatcgattg
tttgagaaaa gaagaagacc ataaaaatac cttgtctgtc 120atcagacagg
gtatttttta tgctgtccag actgtccgct gtgtaaaaat aaggaataaa
180ggggggttgt tattatttta ctgatatgta aaatataatt tgtataagaa
aatgagaggg 240agaggaaaca tgattcaaaa acgaaagcgg acagtttcgt
tcagacttgt gcttatgtgc 300acgctgttat ttgtcagttt gccgattaca
aaaacatcag cc gta aat ggc acg 354Val Asn Gly Thr 1ctg atg cag tat
ttt gaa tgg tat acg ccg aac gac ggc cag cat tgg 402Leu Met Gln Tyr
Phe Glu Trp Tyr Thr Pro Asn Asp Gly Gln His Trp 5 10 15 20aaa cga
ttg cag aat gat gcg gaa cat tta tcg gat atc gga atc act 450Lys Arg
Leu Gln Asn Asp Ala Glu His Leu Ser Asp Ile Gly Ile Thr 25 30 35gcc
gtc tgg att cct ccc gca tac aaa gga ttg agc caa tcc gat aac 498Ala
Val Trp Ile Pro Pro Ala Tyr Lys Gly Leu Ser Gln Ser Asp Asn 40 45
50gga tac gga cct tat gat ttg tat gat tta gga gaa ttc cag caa aaa
546Gly Tyr Gly Pro Tyr Asp Leu Tyr Asp Leu Gly Glu Phe Gln Gln Lys
55 60 65ggg acg gtc aga acg aaa tac ggc aca aaa tca gag ctt caa gat
gcg 594Gly Thr Val Arg Thr Lys Tyr Gly Thr Lys Ser Glu Leu Gln Asp
Ala 70 75 80atc ggc tca ctg cat tcc cgg aac gtc caa gta tac gga gat
gtg gtt 642Ile Gly Ser Leu His Ser Arg Asn Val Gln Val Tyr Gly Asp
Val Val 85 90 95 100ttg aat cat aag gct ggt gct gat gca aca gaa gat
gta act gcc gtc 690Leu Asn His Lys Ala Gly Ala Asp Ala Thr Glu Asp
Val Thr Ala Val 105 110 115gaa gtc aat ccg gcc aat aga aat cag gaa
act tcg gag gaa tat caa 738Glu Val Asn Pro Ala Asn Arg Asn Gln Glu
Thr Ser Glu Glu Tyr Gln 120 125 130atc aaa gcg tgg acg gat ttt cgt
ttt ccg ggc cgt gga aac acg tac 786Ile Lys Ala Trp Thr Asp Phe Arg
Phe Pro Gly Arg Gly Asn Thr Tyr 135 140 145agt gat ttt aaa tgg cat
tgg tat cat ttc gac gga gcg gac tgg gat 834Ser Asp Phe Lys Trp His
Trp Tyr His Phe Asp Gly Ala Asp Trp Asp 150 155 160gaa tcc cgg aag
atc agc cgc atc ttt aag ttt cgt ggg gaa gga aaa 882Glu Ser Arg Lys
Ile Ser Arg Ile Phe Lys Phe Arg Gly Glu Gly Lys165 170 175 180gcg
tgg gat tgg gaa gta tca agt gaa aac ggc aac tat gac tat tta 930Ala
Trp Asp Trp Glu Val Ser Ser Glu Asn Gly Asn Tyr Asp Tyr Leu 185 190
195atg tat gct gat gtt gac tac gac cac cct gat gtc gtg gca gag aca
978Met Tyr Ala Asp Val Asp Tyr Asp His Pro Asp Val Val Ala Glu Thr
200 205 210aaa aaa tgg ggt atc tgg tat gcg aat gaa ctg tca tta gac
ggc ttc 1026Lys Lys Trp Gly Ile Trp Tyr Ala Asn Glu Leu Ser Leu Asp
Gly Phe 215 220 225cgt att gat gcc gcc aaa cat att aaa ttt tca ttt
ctg cgt gat tgg 1074Arg Ile Asp Ala Ala Lys His Ile Lys Phe Ser Phe
Leu Arg Asp Trp 230 235 240gtt cag gcg gtc aga cag gcg acg gga aaa
gaa atg ttt acg gtt gcg 1122Val Gln Ala Val Arg Gln Ala Thr Gly Lys
Glu Met Phe Thr Val Ala245 250 255 260gag tat tgg cag aat aat gcc
ggg aaa ctc gaa aac tac ttg aat aaa 1170Glu Tyr Trp Gln Asn Asn Ala
Gly Lys Leu Glu Asn Tyr Leu Asn Lys 265 270 275aca agc ttt aat caa
tcc gtg ttt gat gtt ccg ctt cat ttc aat tta 1218Thr Ser Phe Asn Gln
Ser Val Phe Asp Val Pro Leu His Phe Asn Leu 280 285 290cag gcg gct
tcc tca caa gga ggc gga tat gat atg agg cgt ttg ctg 1266Gln Ala Ala
Ser Ser Gln Gly Gly Gly Tyr Asp Met Arg Arg Leu Leu 295 300 305gac
ggt acc gtt gtg tcc agg cat ccg gaa aag gcg gtt aca ttt gtt 1314Asp
Gly Thr Val Val Ser Arg His Pro Glu Lys Ala Val Thr Phe Val 310 315
320gaa aat cat gac aca cag ccg gga cag tca ttg gaa tcg aca gtc caa
1362Glu Asn His Asp Thr Gln Pro Gly Gln Ser Leu Glu Ser Thr Val
Gln325 330 335 340act tgg ttt aaa ccg ctt gca tac gcc ttt att ttg
aca aga gaa tcc 1410Thr Trp Phe Lys Pro Leu Ala Tyr Ala Phe Ile Leu
Thr Arg Glu Ser 345 350 355ggt tat cct cag gtg ttc tat ggg gat atg
tac ggg aca aaa ggg aca 1458Gly Tyr Pro Gln Val Phe Tyr Gly Asp Met
Tyr Gly Thr Lys Gly Thr 360 365 370tcg cca aag gaa att ccc tca ctg
aaa gat aat ata gag ccg att tta 1506Ser Pro Lys Glu Ile Pro Ser Leu
Lys Asp Asn Ile Glu Pro Ile Leu 375 380 385aaa gcg cgt aag gag tac
gca tac ggg ccc cag cac gat tat att gac 1554Lys Ala Arg Lys Glu Tyr
Ala Tyr Gly Pro Gln His Asp Tyr Ile Asp 390 395 400cac ccg gat gtg
atc gga tgg acg agg gaa ggt
gac agc tcc gcc gcc 1602His Pro Asp Val Ile Gly Trp Thr Arg Glu Gly
Asp Ser Ser Ala Ala405 410 415 420aaa tca ggt ttg gcc gct tta atc
acg gac gga ccc ggc gga tca aag 1650Lys Ser Gly Leu Ala Ala Leu Ile
Thr Asp Gly Pro Gly Gly Ser Lys 425 430 435cgg atg tat gcc ggc ctg
aaa aat gcc ggc gag aca tgg tat gac ata 1698Arg Met Tyr Ala Gly Leu
Lys Asn Ala Gly Glu Thr Trp Tyr Asp Ile 440 445 450acg ggc aac cgt
tca gat act gta aaa atc gga tct gac ggc tgg gga 1746Thr Gly Asn Arg
Ser Asp Thr Val Lys Ile Gly Ser Asp Gly Trp Gly 455 460 465gag ttt
cat gta aac gat ggg tcc gtc tcc att tat gtt cag aaa taa 1794Glu Phe
His Val Asn Asp Gly Ser Val Ser Ile Tyr Val Gln Lys 470 475
480ggtaataaaa aaacacctcc aagctgagtg cgggtatcag cttggaggtg
cgtttatttt 1854ttcagccgta tgacaaggtc ggcatcaggt gtgacaaata
cggtatgctg gctgtcatag 1914gtgacaaatc cgggttttgc gccgtttggc
tttttcacat gtctgatttt tgtataatca 1974acaggcacgg agccggaatc
tttcgccttg gaaaaataag cggcgatcgt agctgcttcc 2034aatatggatt
gttcatcggg atcgctgctt ttaatcacaa cgtgggatcc 2084
* * * * *