U.S. patent application number 12/027223 was filed with the patent office on 2009-10-22 for nucleic acids encoding multimeric fusion proteins of tnf superfamily ligands.
This patent application is currently assigned to THE REGENTS OF THE UNIVERSITY OF CALIFORNIA. Invention is credited to Richard S. Kornbluth.
Application Number | 20090263348 12/027223 |
Document ID | / |
Family ID | 23803798 |
Filed Date | 2009-10-22 |
United States Patent
Application |
20090263348 |
Kind Code |
A1 |
Kornbluth; Richard S. |
October 22, 2009 |
Nucleic Acids Encoding Multimeric Fusion Proteins of TNF
Superfamily Ligands
Abstract
A method for constructing stable bioactive fusion proteins of
the difficult to express turn or necrosis factor superfamily
(TNFSF), and particularly members CD40L (CD 154) and RANKL/TRANCE,
with collecting, particularly pulmonary surfactant protein D (SPD)
is described. Single trimers of these proteins lack the full
stimulatory efficacy of the natural membrane forms of these
proteins in many cases. The multimeric nature of these soluble
fusion proteins enables them to engage multiple receptors on the
responding cells, thereby, mimicking the effects of the membrane
forms of these ligands. For CD40L-SPD, the resulting protein
stimulates B cells, macrophages, and dendritic cells, indicating
its potential usefulness as a vaccine adjuvant. The large size of
these fusion proteins makes them less likely to diffuse into the
circulation, thereby limiting their potential systemic toxicity.
This property may be especially useful when these proteins are
injected locally as a vaccine adjuvant or tumor immunotherapy agent
to prevent them from diffusing away. In addition, these and other
TNFSF-collectin fusion proteins present new possibilities for the
expression of highly active, multimeric, soluble TNFSF members.
Inventors: |
Kornbluth; Richard S.; (La
Jolla, CA) |
Correspondence
Address: |
DLA PIPER LLP (US)
4365 EXECUTIVE DRIVE, SUITE 1100
SAN DIEGO
CA
92121-2133
US
|
Assignee: |
THE REGENTS OF THE UNIVERSITY OF
CALIFORNIA
|
Family ID: |
23803798 |
Appl. No.: |
12/027223 |
Filed: |
February 6, 2008 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
11087348 |
Mar 22, 2005 |
7332298 |
|
|
12027223 |
|
|
|
|
09454223 |
Dec 9, 1999 |
7300774 |
|
|
11087348 |
|
|
|
|
60111471 |
Dec 9, 1998 |
|
|
|
Current U.S.
Class: |
424/85.1 ;
435/69.5; 530/351 |
Current CPC
Class: |
C07K 14/70575 20130101;
C07K 2319/00 20130101; A61K 39/00 20130101; C07K 14/525
20130101 |
Class at
Publication: |
424/85.1 ;
435/69.5; 530/351 |
International
Class: |
A61K 38/19 20060101
A61K038/19; C12P 21/02 20060101 C12P021/02; C07K 14/525 20060101
C07K014/525 |
Claims
1. A method of stimulating a biological response in a subject in
need thereof, comprising administering to the subject a composition
comprising a multimeric polypeptide of trimer units or a
polynucleotide encoding the multimeric polypeptide, each unit
comprising: a collectin family scaffold operably linked to an
extracellular domain of a tumor necrosis factor superfamily (TNFSF)
polypeptide to form a polypeptide trimer wherein the multimeric
polypeptide is at least a dimer of trimer units, thereby
stimulating a biological response in the subject.
2. The method of claim 1, wherein the subject in need thereof has a
tumor.
3. The method of claim 1, wherein the subject in need thereof has
HIV positive cells.
Description
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application is a divisional application of U.S.
application Ser. No. 11/087,348 filed Mar. 22, 2005, now issued as
U.S. Pat. No. 7,332,298; which is a continuation application of
U.S. application Ser. No. 09/454,223 filed Dec. 9, 1999, now issued
as U.S. Pat. No. 7,300,774; which claims the benefit under 35 USC
.sctn. 119(e) to U.S. application Ser. No. 60/111,471 filed Dec. 9,
1998, now abandoned. The disclosure of each of the prior
applications is considered part of and is incorporated by reference
in the disclosure of this application.
BACKGROUND OF THE INVENTION
[0002] 1. Field of the Invention
[0003] The present invention relates to a method for preparing
soluble multimeric proteins consisting of more than three
iterations of the same bioactive molecule using recombinant DNA
technology.
[0004] The present invention particularly concerns a new method of
producing multimeric fusion proteins involving the TNF superfamily
(TNFSF) members as fusion proteins with SPD, and more specifically,
CD40L-SPD fusion proteins and useful modifications thereof.
[0005] 2. Description of Related Art
[0006] Numerous proteins can be made using modern molecular biology
techniques and used in diagnostic and therapeutic applications.
Using recombinant DNA techniques, the DNA encoding a single amino
acid chain is constructed and then introduced into a cell which
manufactures the final protein. Some cells, especially bacteria
like E. coli, lack the ability to properly fold the amino acid
chains into the proper quaternary structure and they often fail to
apply the necessary modifications (e.g., glycosylation and
disulfide bond formation) that are needed for the protein to be
bioactive and resistant to degradation in vivo. While most of these
challenges can be met by expressing the amino acid chain in
eukaryotic cells like yeast or mammalian cells in vitro, it is not
always straightforward to express proteins that consist of two or
more amino acid chains. In general, for multichain proteins, the
single amino acid chains must associate together in some way either
within the producer cell or subsequently after the monomers are
secreted from the producer cell. For artificially constructed
molecules, the introduction into a single amino acid chain of an
amino acid sequence which causes this chain-to-chain association
can be an important step in producing multichain proteins.
[0007] One of the most widely used methods of causing two amino
acid chains to associate is to conjoin, at the DNA coding level,
segments from the protein of interest and a segment from a
spontaneously dimerizing protein. The best example is to conjoin or
fuse a protein with the Fc portion of immunoglobulin, creating a
dimeric Fc fusion protein (Fanslow et al., J. Immunol. 136:4099,
1986). A protein of this type can be formed from the extracellular
domain of a tumor necrosis factor (TNF) receptor fused to Fc
(termed etanercept and marketed as ENBREL.RTM.), which is effective
in the treatment of rheumatoid arthritis. A second example is the
construction of a fusion protein between the dimerizing
extracellular portion of CD8 with the extracellular portion of
CD40L (Hollenbaugh et al., EMBO J. 11:4313, 1992). Here, the
dimerizing CD8 portion of the fusion protein helps to maintain the
CD40L portion in the trimeric form needed for its bioactivity. A
more recent example is the addition of an isoleucine zipper motif
to CD40L, which permits the production of trimeric soluble CD40L
molecules (Morris et al., J. Biol. Chem. 274:418, 1999).
[0008] The TNF superfamily (TNFSF) consists of an expanding number
of proteins (see Table I) which are crucial for the development and
functioning of the immune, hematological, and skeletal systems.
TNFSF proteins are ligands for a corresponding set of receptors of
the TNF receptor superfamily (TNFRSF). All TNFSF members are
expressed as Type II membrane proteins, with the exception of
lymphotoxin-alpha which is produced as a secreted protein. However,
soluble forms of several TNFSF proteins can be released from the
cell surface by proteolytic cleavage, usually by specific
metalloproteinases.
[0009] The production of soluble forms of TNFSF proteins has been
an important step in the study of these proteins. Soluble TNFSF
ligands can be used to study the activities of these proteins in
vitro without the complexities in interpretation that result when
cells or cellular membranes expressing TNFSF proteins are added. In
addition, soluble forms of several TNFSF proteins have potential as
therapeutic agents for human diseases. In particular, TNF-? has
been extensively studied for the treatment of cancer and soluble
CD40L is currently undergoing clinical trials to assess its
antitumor effects.
[0010] To produce soluble forms of TNFSF proteins, either the
membrane protein is expressed in a cell line possessing a protease
capable of separating the TNFSF extracellular domain from the
transmembrane domain or a truncated form of the TNFSF protein is
produced which consists solely of the extracellular domain plus a
signal sequence. In either case, certain soluble forms of TNFSF
proteins are unstable in solution as simple homotrimers composed
solely of the extracellular domain. For example, naturally
solubilized TNF-? is labile under physiological conditions
[Schuchmann, 1995 #129]. To solve this stability problem, chimeric
proteins have been constructed according to one of four different
design principles: (1) The extracellular portion of the TNFSF
protein has been expressed fused to the dimeric portion of the
immunoglobulin Fc fragment U.S. Pat. No. 5,155,027, Oct. 13, 1992,
issued to, Andrzej Z. Sledziewski, et al. In the case of CD40L and
OX40L, this yields a soluble molecule which is significantly less
active than the native membrane form of this protein. (2) The
extracellular portion of the TNFSF protein has been expressed with
an antigenic tag (usually the FLAG motif) fused to its N-terminus
[Mariani, 1996]. The addition of an antibody to the tag (e.g.,
anti-FLAG antibody) aggregates these proteins into a multimeric
form. Crosslinking enhances activity on B cells. (3) The
extracellular portion of the TNFSF protein has been expressed fused
to the spontaneously dimerizing extracellular portion of the CD8
molecule [Hollenbaugh, 1992]. In the case of CD40L, this creates a
hexameric molecule [Pullen, 1999] which is likely formed by two
CD40L trimers attached to three CD8 dimeric stalks. Despite this,
the addition of an anti-CD8 antibody to crosslink the CD40L-CD8
fusion protein yields a further enhancement of CD40L activity on B
cells. (4) The extracellular portion of the TNFSF protein has been
expressed fused to a trimerizing isoleucine zipper which maintains
the overall trimeric structure of the protein [U.S. Pat. No.
5,716,805, Feb. 10, 1998, issued to Subashini Srinivasan et al.
This soluble CD40L trimer or `sCD40LT` is the form of that protein
now being clinically tested in humans for its anti-tumor
effects.
[0011] Compounding the difficulties in producing stable forms of
soluble TNFSF proteins are compromises in bioactivity. As
exemplified by FasL, TNF, and CD40L, many of the soluble forms of
these proteins lack the full range of stimulatory activities
displayed by the membrane forms of these molecules. For FasL,
several groups have reported that naturally produced soluble FasL
(generated by proteolytic cleavage from the membrane form) has a
spectrum of activities that is distinctly different from the
membrane form. Soluble FasL induces apoptosis in activated CD4+ T
cells but not fresh, resting CD4+ T cells. In contrast, both types
of CD4+ T cells are killed by membrane FasL or a recombinant
soluble form of FasL (WX1) that spontaneously aggregates into
oligomers larger than a decamer. For TNF, T cell activation through
stimulation of TNFR II, the 80 kDa receptor for TNF, is much
greater with membrane TNF' than soluble TNF. However, if soluble
TNF is produced as a tagged protein and crosslinked with an
antibody against the tag, then it completely mimics the activities
of membrane TNF [Schneider, 1998]. Finally, for CD40L, the
stimulatory effects of a soluble form of this TNFSF protein are
enhanced by crosslinking [Kehry, 1994] and yields an activity
similar to membrane CD40L. For example, soluble CD40L-CD8 fusion
protein requires crosslinking with a antibody to CD8 in order to
drive resting B cells to proliferate to a degree similar to
membrane-bound CD40L.). Even more strikingly, although
membrane-bound CD40L expressed on baculovirus-transduced SF9 insect
cells is a strong B cell stimulus, small vesicles (10-1,500 nm)
prepared from the membranes of these cells are less stimulatory.
However, ultracentrifugation of these vesicles creates aggregates
which have the full activity of the original membrane CD40L
protein. This indicates that B cells are more highly stimulated by
a large surface of CD40L than they are by a smaller surface
expressing this membrane ligand.
[0012] Taken together, the above reports suggest that, for some
TNFSF/TNFRSF ligand/receptor pairs at least, it is essential to
cluster receptors together for full signaling activity. By this
interpretation, the efficacy of the membrane forms of FasL, TNF,
and CD40L occurs because these ligands can move in the plane of the
membrane toward the contact zone with a receptor-bearing responding
cell, thereby clustering ligated receptors to form a receptor-dense
region of the membrane. This interpretation is further supported by
experiments where crosslinking of a soluble TNFSF protein
effectively mimics the activity of the membrane form of the protein
[Scheider, 1998].
[0013] In all of the above examples, no more than three amino acid
chains have been caused to associate together. There is a need to
produce multimeric protein molecules where more than three amino
acid chains are caused to associate into a single soluble molecular
complex. An important example comes from studies of CD40L (also
called CD 154 or TNFSF5), which is a member of the TNF family of
molecules that are normally expressed as insoluble, cell membrane
proteins. It has been shown that soluble homotrimers composed of
the extracellular regions of CD40L, TNF, and FasL are not potently
active on resting cells that bear receptors for these proteins.
However, if these proteins are expressed with a tag on their ends
(e.g., the FLAG peptide sequence) and then the trimers are
extensively crosslinked using an antibody to FLAG, full activity
appears (Schneider et al., J. Exp. Med. 187:1205, 1998). From this,
it can be inferred that the soluble single-trimer forms of these
molecules does not duplicate the multivalent interactions that
normally occur when a receptor-bearing cell comes in contact with
the membrane of a cell expressing numerous ligand trimers on its
surface. This distinction may be due to a need for receptor
clustering for full signaling (Bazzoni and Beutler, N. Engl. J.
Med. 334:1717, 1996), which in turn is only possible with a
multimeric ligand engaging many receptors at the same time in a
localized region of the cell membrane.
SUMMARY OF THE INVENTION
[0014] The present invention contemplates a method of preparing
soluble, multimeric mammalian proteins by culturing a host cell
transformed or transfected with an expression vector encoding a
fusion protein comprising the hub, body, and neck region of a
collectin molecule and a heterologous mammalian protein.
[0015] In one embodiment, the heterologous mammalian protein
comprises an extra cellular domain of a mammalian transmembrane
protein; the resulting fusion protein forms a multimer.
[0016] In another embodiment, the heterologous mammalian protein
comprises a soluble protein such as a cytokine; the resulting
fusion protein forms a multimer.
[0017] In another embodiment, sites of proteolytic degradation are
included or removed from the fusion protein; the resulting fusion
protein forms a multimer from which are cleaved single units at a
rate made variable by the nature of the proteolytic digestion sites
either included or excluded.
[0018] In yet another embodiment, special attention is given to the
immunogenicity of the fusion protein by altering the junction
between the two naturally occurring proteins from which it is made;
the resulting fusion protein may be less or more able to elicit an
immune response against itself, which could lengthen its
persistence or contribute to it immunological effectiveness.
[0019] A hybrid nucleotide sequence of no more than 1528 base pairs
including a sequence defining a structural gene expressing a
conjoined single strand of a multimeric TNFSF-SPD fusion protein,
said structural gene having a nucleotide base sequence selected
from members of the group consisting of SEQ ID NO 1, SEQ ID NO 3
and SEQ ID NO 5 is disclosed by this invention. In one embodiment,
the DNA segment the structural gene has a sequence expressing a
single hybrid amino acid chain of TNFSF-SPD, the segment having a
first SPD nucleotide base sequence of SEQ ID NO 1, from base 32 to
base 799, and a second sequence, expressing a portion of TNFSF
stalk, selected from members of the group consisting of SEQ ID NO
1, from base 800 to base 1444, SEQ ID NO 3, from base 800 to base
1528, and SEQ ID NO 5, from base 800 to base 1441.
[0020] In another embodiment, a recombinant DNA molecule has vector
operatively linked to an exogenous DNA segment defining a
structural gene expressing a single amino acid chain of TNFSF-SPD.
This structural gene has a nucleotide base sequence selected from
members of the group consisting of SEQ ID NO 1, SEQ ID NO 3 and SEQ
ID NO 5, any functional equivalents and modifications thereof There
is also attached an appropriate promoter for driving the expression
of said structural gene in a compatible host organism. The organism
can be E. coli, a yeast, a higher plant or animal.
[0021] Yet another embodiment contemplated by the invention is
multimeric TNFSF-SPD fusion protein having a plurality of
polypeptide trimers, a first trimer consisting of peptide strands
of members of the TNF superfamily (TNFSF) of ligands, and a second
trimer strand from a collectin molecule, each first trimer
conjoined to a second polypeptide trimer strand from a collectin
molecule, wherein said ligand strand is substituted for native
carbohydrate recognition domains (CRD) of the collectin molecules.
The conjoined collectin strands are covalently bound in parallel to
each other, forming a multimeric fusion protein comprising a
plurality of trimeric hybrid polypeptide strands radiating from a
covalently bound center hub of the molecule. The free end of each
trimeric radiating strand has a TNFSF moiety attached. The TNFSF
moiety is one selected from the group consisting of ligands LTA,
TNF, LTB, and TNFSF4 to TNFSF 18 as shown in Table II, and their
functional equivalents, and modifications thereof.
[0022] The invention also contemplates a method for preparing a
CD40-SPD multimeric fusion polypeptide, including the steps of
initiating a culture, in a nutrient medium, of procaryotic or
eucaryotic host cells transformed with a recombinant DNA molecule
including an expression vector, appropriate for the cells,
operatively linked to an exogenous DNA segment defining a
structural gene for CD40-SPD ligand. The structural gene has a
nucleotide base sequence of SEQ ID NO 1 from about base 32 to about
base 1444. Thereafter, the culture is maintained for a time period
sufficient for the cells to express the multimeric molecule.
[0023] Also contemplated is a method of producing a secreted, very
large, biologically active, multimeric tumor necrosis factor
superfamily ligand fusion protein chimera that is highly
immunogenic and not readily diffusable. The steps for this method
are as follows:
[0024] 1. introducing into a host cell a first chimeric DNA
construct including a transcriptional promoter operatively linked
to a first secretory signal sequence, followed downstream by, and
in proper reading frame with a first DNA sequence encoding a
polypeptide chain of a first TNFSF ligand requiring multimerization
for biological activity. This sequence is joined to a second DNA
sequence encoding a collectin polypeptide at the site where the
collectin's CRD was purposefully removed.
[0025] 2. introducing into the host cell, a second DNA construct
including a transcriptional promoter operably linked to a second
secretory signal sequence followed downstream by, and in proper
reading frame with, a third DNA sequence encoding a second
polypeptide chain of a second TNFSF ligand joined to a fourth DNA
sequence encoding a collectin polypeptide, wherein the collectin's
CRD was purposefully removed, and then,
[0026] 3. growing the host cell in an appropriate growth medium
under physiological conditions to allow the secretion of a large
multimerized polypeptide fusion protein, wherein the first
polypeptide chain of a TNFSF-SPD protein is bound by parallel
bonding of the respective collectin domain trimer to the second
polypeptide chain of a different TNFSF-SPD polypeptide trimer, and
wherein the multimerized polypeptide fusion protein exhibits
biological activity characteristic of both membrane-attached
TNFSFs, and
[0027] 4. isolating the biologically active, multimerized TNFSF-SPD
polypeptide fusion from said host cell. The chimeric reactant
compounds are humanized to guard against destruction by a potential
human recipient's immune system.
[0028] A final method of preparing a multimeric TNFSF-SPD ligand
fusion protein contemplated requires a) preparing a first DNA
segment coding for a strand of an exposed extracellular portion of
TNFSF; b) preparing a second DNA segment coding for a collectin
polypeptide strand, wherein the collectin's CRD domain of the
strand has been removed; c) conjoining the first and second DNAs in
proper reading frame, thereby creating a TNFSF-collectin DNA
construct; d) inserting the construct into an expression vector
system; e) introducing the vector system into an appropriate cell
in culture under suitable conditions; f) harvesting and purifying
spent medium from the culture; and finally g) assaying for presence
of multimeric TNFSF-collectin fusion protein.
[0029] A method for stimulating the immune response in potentially
immonocompetent cells using multimeric TNFSF fusion proteins by
contacting the cells with the multimeric TNFSF fusion proteins,
causing the cells to proliferate, is also contemplated. The cells
used may be resting B cells. There is also a method for increasing
antigenicity of cells by contacting the cells with the multimeric
TNFSF fusion proteins. In this case, the cells may be tumor cells
or HIV positive cells.
[0030] Other preferred embodiments contemplate the methods of
preparation described above, wherein the host transformed is either
a prokaryote, such as E. coli, a eukaryote, for example yeast, such
as S. cerevisiae or a higher plant, such as alfalfa or tobacco.
[0031] Still further embodiments and advantages of the invention
will become apparent to those skilled in the art upon reading the
entire disclosure contained herein.
BRIEF DESCRIPTION OF THE DRAWINGS
[0032] FIG. 1. Structure of the CD40L-SPD fusion protein. The
extracellular portion of the CD40L homotrimer, including its
membrane-proximal stalk, was fused to the body of SPD. The
N-terminus of SPD contains two cysteines which link the homopolymer
together by disulfide bonds forming a hub. The trimeric collagenous
stalk extend from the hub as a cruciate structure and end in a
spontaneously trimerizing neck region. The amino acid domains in a
single chain of the CD40L-SPD are shown at the top. At the bottom
is the tetrameric (four CD40L trimers) which is expected to form.
In addition, the hub region of SPD can participate in stacking up
to 8 or more cruciate forms into higher order aggregates.
[0033] FIG. 2. Ion-exchange chromatography of murine CD40L-SPD. CHO
cells expressing murine CD40L-SPD were grown in serum-free media,
concentrated using a 100 kDa cutoff ultrafiltration membrane, and
diafiltered into 50 mM bicine, pH 9.0, 1 mM EDTA. Using an FPLC
system, the protein from 400 mL of media was applied to a Fractogel
SO.sub.3 650M column and eluted with a linear salt gradient. 3 mL
samples were collected. Shown are curves for protein concentration
(OD.sub.280), conductivity as % 1 M NaCl in the buffer, and
ELISA-detectable CD40L-SPD assayed at 1:100 dilution.
[0034] FIG. 3. Size fractionation of murine CD40L-SPD by
ultrafiltration. CD40L-SPD is a 471 amino acid protein with a
predicted molecular weight of 49,012 for each of the twelve
component chains in the dodecamer (composed of four trimeric
subunits). This does not include added carbohydrates. Therefore,
the full dodecamer will have a molecular weight in excess of
600,000. However, from the literature on recombinant surfactant
protein D made in CHO cells, it appears that some of the product
will be in the form of trimers that are not part of a
cruciate-formed dodecamer. To determine what percentage of
CD40L-SPD was produced in a multimeric form, supernatant from the
transfected CHO cells were passed through filters of different
porosities (rated for their ability to retard globular proteins).
An ELISA was used to detect the amount of CD40L-SPD (measured at
multiple dilutions) that passed through the filter. As shown, about
90% of the protein is retained by a 300,000 kDa cut-off filter.
This indicates that most of the protein is in the dodecameric form.
In addition, the cruciate dodecamers of surfactant protein D can
also stack on top of each other into even higher molecular weight
forms. This is the likely explanation for the small fraction of
CD40L-SPD that is retained by the 1,000 kDa cut-off filter.
[0035] FIG. 4. Activation of human B cells by human CD40L-SPD.
Conditioned media from CHO cells expressing human CD40L-SPD was
added to human B cells along with IL-4. In the left panel, the
cells were stained with CyChrome-labeled anti-CD19 to identify B
cells and PE-labeled anti-CD3 to identify T cells. As shown, most
of the cells proliferating in the culture were CD 19+CD3-B cells.
In the right panel, the cells were stained with CyChrome-labeled
anti-CD19 to identify B cells and PE-labeled anti-CD80 (B7-1) to
identify this co-stimulatory molecule. As shown, almost all of the
B cells were induced by CD40L-SPD to express CD80.
[0036] FIG. 5. Activation of murine B cells by murine CD40L-SPD.
Murine CD40L-SPD was added to resting murine splenic B cells for a
two day culture period. For the final 4 hours, the cultures were
pulsed with .sup.3H-thymidine, following which the cells were
harvested and DNA synthesis was measured by scintillation counting.
As shown, CD40L-SPD is nearly as effective as anti-IgM in promoting
the proliferation of resting B cells.
[0037] FIG. 6. CD40L-SPD stimulation of macrophage chemokine
production. Conditioned media from CHO cells expressing human
CD40L-SPD, an inactive mutant of human CD40L-SPD (T147N-CD40L-SPD),
or murine CD40L-SPD (mCD40L-SPD) were added to cultures of human
monocyte-derived macrophages. As a negative control, this media was
heat-inactivated at 60.degree. C. for 30 minutes. Also shown is a
form of soluble CD40L (sCD40L) consisting of 149 amino acids from
the extracellular domain of human CD40L (Peprotech) added at 1 ?
g/mL. 24 hours later, supernatants were collected and assay for
MIP-1? by ELISA (R & D Systems). The weak activity of soluble
single-trimer CD40L (sCD40L) is apparent. In contrast, native human
and murine CD40L-SPD strongly activated the macrophages to produce
MIP-1?. In contrast, heat-inactivated CD40L-SPD was inactive. As
expected, the inactive mutant, T147N-CD40L-SPD, also failed to
stimulate macrophages, demonstrating that the CD40L portion and not
the SPD portion of the protein was responsible for stimulating the
macrophages.
[0038] FIG. 7. Expression of RANKL/TRANCE-SPD production from CHO
cells detected by ELISA. Antibodies against RANKL/TRANCE were used
to construct an ELISA capable of detecting the RANKL/TRANCE
protein. As shown, there was no background with the media control.
Using a fusion protein between CD70 (CD27L or TNFSF7) and SPD,
there was also no signal, indicating the specificity of the ELISA.
However, using CHO cells transfected with an expression plasmid for
CD70-SPD, immunoreactive secreted protein was clearly detectable.
This demonstrates the generalizability of the method for expressing
TNFSF members as fusion proteins with collectins such as SPD.
DESCRIPTION OF THE PREFERRED EMBODIMENT
1. Definition of Terms
[0039] Multimeric: As used herein the term multimeric refers to a
multimer of a polypeptide that is itself a trimer (i.e., a
plurality of trimers).
[0040] Functional Equivalent: Herein refers to a sequence of a
peptide or polypeptide that has substantial structural similarity
and functional similarity to another such sequence.
[0041] Modifications: Herein refers to point changes involving
single amino acids, wherein the functionality is altered, without
appreciably altering the primary sequence or primary structure of a
peptide or polypeptide.
[0042] Amino Acid: All amino acid residues identified herein are in
the natural L-configuration. In keeping with standard polypeptide
nomenclature, J. Biol. Chem. 243:3557-59, (1969), abbreviations for
amino acid residues are as shown in the following Table of
Correspondence:
TABLE-US-00001 TABLE OF CORRESPONDENCE SYMBOL 1-Letter 3-Letter
AMINO ACID Y Tyr L-tyrosine G Gly glycine F Phe L-phenylalanine M
Met L-methionine A Ala L-alanine S Ser L-serine L lie L-isoleucine
L Leu L-leucine T Thr L-threonine V Val L-valine P Pro L-proline K
Lys L-lysine H His L-histidine Q Gin L-glutamine E Glu L-glutamic
acid W Trp L-tryptophan R Arg L-arginine D Asp L-aspartic acid N
Asn L-asparagin C Cys L-cysteine
[0043] It should be noted that all amino acid residue sequences are
represented herein by formulae whose left to right orientation is
in the conventional direction of amino-terminus to
carboxy-terminus. Furthermore, it should be noted that a dash at
the beginning or end of an amino acid residue sequence indicates a
bond to a radical such as H and OH (hydrogen and hydroxyl) at the
amino- and carboxy-termini, respectively, or a further sequence of
one or more amino acid residues up to a total of about fifty
residues in the polypeptide chain.
[0044] Base Pair (bp): A partnership of adenine (A) with thymine
(T), or of cytosine (C) with guanine (G) in a doable stranded DNA
molecule.
[0045] Constitutive promoter: A promoter where the rate of RNA
polymerase binding and initiation is approximately constant and
relatively independent of external stimuli. Examples of
constitutive promoters include the cauliflower mosaic virus 35S and
19S promoters described by Poszkowski et al., EMBO J., 3:2719
(1989) and Odell et al., Nature, 313:810 (1985).
[0046] DNA: Deoxyribonucleic acid.
[0047] Enzyme: A protein, polypeptide, peptide RNA molecule, or
multimeric protein capable of accelerating or producing by
catalytic action some change in a substrate for which it is often
specific.
[0048] Expression vector: A DNA sequence that forms control
elements that regulate expression of structural genes when
operatively linked to those genes.
[0049] Expression: The combination of intracellular processes,
including transcription and translation undergone by a structural
gene to produce a polypeptide.
[0050] Insert: A DNA sequence foreign to the rDNA, consisting of a
structural gene and optionally additional DNA sequences.
[0051] Nucleotide: A monomeric unit of DNA or RNA consisting of a
sugar moiety (pentose), a phosphate, and a nitrogenous heterocyclic
base. The base is linked to the sugar moiety via the glycosidic
carbon (1' carbon of the pentose) and that combination of base and
sugar is a nucleoside. When the nucleoside contains a phosphate
group bonded to the 3' or 5' position of the pentose it is referred
to as a nucleotide.
[0052] Operatively linked or inserted: A structural gene is
covalently bonded in correct reading frame to another DNA (or RNA
as appropriate) segment, such as to an expression vector so that
the structural gene is under the control of the expression
vector.
[0053] Polypeptide and peptide: A linear series of amino acid
residues connected one to the other by peptide bonds between the
alpha-amino and carboxy groups of adjacent residues.
[0054] Promoter: A recognition site on a DNA sequence or group of
DNA sequences that provide an expression control element for a gene
and to which RNA polymerase specifically binds and initiates RNA
synthesis (transcription) of that gene.
[0055] Inducible promoter: A promoter where the rate of RNA
polymerase binding and initiation is modulated by external stimuli.
Such stimuli include light, heat, anaerobic stress, alteration in
nutrient conditions, presence or absence of a metabolite, presence
of a ligand, microbial attack, wounding and the like.
[0056] Spatially regulated promoter: A promoter where the rate of
RNA polymerase binding and initiation is modulated in a specific
structure of the organism such as the leaf, stem or root. Examples
of spatially regulated promoters are given in Chua et al., Science,
244:174-181 (1989).
[0057] Spatiotemporally regulated promoter: A promoter where the
rate of RNA polymerase binding and initiation is modulated in a
specific structure of the organism at a specific time during
development. A typical spatiotemporally regulated promoter is the
EPSP synthase-35S promoter described by Chua et al., Science,
244:174-181 (1989).
[0058] Temporally regulated promoter: A promoter where the rate of
RNA polymerase binding and initiation is modulated at a specific
time during development. Examples of temporally regulated promoters
are given in Chua et al., Science, 244:174-181 (1989).
[0059] Protein: A linear series of greater than about 50 amino acid
residues connected one to the other as in a polypeptide.
[0060] Recombinant DNA molecule: A hybrid DNA sequence comprising
at least two nucleotide sequences not normally found together in
nature.
[0061] RNA: Ribonucleic acid.
[0062] Selective Genetic marker: A DNA sequence coding for a
phenotypical trait by means of which transformed cells can be
selected from untransformed cells.
[0063] Structural gene: A DNA sequence that is expressed as a
polypeptide, i.e., an amino acid residue sequence.
[0064] Synthetic promoter: A promoter that was chemically
synthesized rather than biologically derived. Usually synthetic
promoters incorporate sequence changes that optimize the efficiency
of RNA polymerase initiation.
2. Introduction
[0065] This invention discloses the production of TNFSF proteins as
multimeric (i.e., many trimers) ligands fused onto a trimeric,
branched protein backbone. Collectin molecules are ideal for this
purpose because they are formed from many trimeric, collagenous
arms linked to a central hub by disulfide bonds. Of the collecting,
pulmonary surfactant protein D (SPD) was chosen initially because
it is a homopolymer encoded by a single gene, unlike Clq and
surfactant protein A, which are composed of two different protein
subunits. In addition, recombinant SPD has been successfully
expressed in vitro in reasonable yield [Crouch, 1994], and a
peptide containing the "neck" region of SPD was shown to
spontaneously trimerize in solution [Hoppe, 1994]. Consequently,
extracellular domains of human and murine CD40L were substituted
for the carbohydrate recognition domain of pulmonary surfactant D
(SPD) to create a four-armed molecule (three peptide chains per
arm) with CD40L at the end of each arm. This molecule is named
CD40L-SPD. In addition, because SPD tends to stack into higher
order aggregates with up to 8 molecules associated at the hub
[Crouch], even greater degree of multimerization can occur [Lu,
1993]. CD40L-SPD therefore mimics the expression of CD40L by an
activated T cell in that it presents a multivalent complex similar
to membrane-bound CD40L. While remaining soluble, CD40L-SPD equals
membrane CD40L in its range of activities.
3. Construction of Expression Plasmids for CD40L-SPD.
[0066] cDNAs of exposed human and murine CD40L, removed from cell
membranes, were cloned by PCR by well-known methods. Murine
surfactant protein D was cloned by hemi-nested PCR from murine lung
mRNA (Clonetech). cDNA was prepared using Superscript II reverse
transcriptase (Life Technologies, Gaithersburg, Md.) and random
hexamers as primers. PCR primer sequences (SEQ ID NOS 7 through 15)
were as follows (the underlined bases indicate restriction
endonuclease sites for cloning into the vector):
TABLE-US-00002 mSPD5: 5'-CTGACATGCTGCCCTTTCTCTCCATGC-3' mSPD3ext:
5'-GGAGGCCAGCTGTCCTCCAGCCTGC-3' mSPD5:
5'GGGG'CTAGCGAATTCCACCAGGAAGCAATCTGACATGCTGCCCTTTC TCTCCATGC-3'
CD40L/SPD3: 5'-CTATCITGTCCAACCITCTATG/GCCATCAGGGAACAATGCAGCTTT C-3'
SPD/CD40L5: 5'-AAAGCTGCATTGTTCCCTGATGGC/CATAGAAGGTTGGACAAGATAG
AAG-3' CD40L3: 5'-GGGCTCGAGGTACCAGTTCTACATGCCTTGGAGTGTATAAT-3'
SPD/mCD40L5: 5'-GAAAGCTGCATTGTTCCCTGATGGC/CATAGAAGATTGGATAAGGTC
GAAG-3' mCD40L/SPD3:
5'-CTTCGACCTTATCCAATCTTCTATG/GCCATCAGGGAACAATGCAGC TTTC-3' mCD40L3:
5'-GGGGGGTACCCTGCTGCAGCCTAGGACAGCGCAC-3'
[0067] Because the murine SPD sequence of the 5' untranslated
region containing the ribosomal binding site was unknown when this
work was started [Motwani, 1995], a primer (rmSPD5) was designed
based on the available rat sequence [Shimizu, 1992] which extended
the 5' end with rat sequence (shown in bold) along with an added
Nhe I site (underlined).
4. Creation of the CD40L-SPD Fusions.
[0068] To create the CD40L-SPD fusions, overlap PCR was used.
Murine SPD was amplified by nested PCR using mSPD5 and mSPD3ext for
the first round of 30 cycles. The product was diluted 1:1,000 and 1
.quadrature.L was amplified for another 30 cycles using rmSPD5 and
CD40L/SPD3, where the 3' half of CD40L/SPD3 is a reverse primer for
SPD C-terminal to the neck region (deleting the CRD) and the 5'
half of CD40L/SPD3 contains bases from the N-terminus of the
extracellular portion of CD40L (immediately adjacent to the
transmembrane region). Similarly, the CD40L plasmid was amplified
with SPD/CD40L5 and CD40L3, which contains a Kpn I site
(underlined). All of these PCRs were performed with Pfu cloned
polymerase (Stratagene,) using hot start (Ampliwax, Perkin-Elmer)
and the thermocycling program: 94.degree. C. for 2.5 min; then 30
cycles of 94.degree. C. for 10 sec, 43.degree. C. for 30 sec, and
75.degree. C. for 7 min.
[0069] To form the chimeric construct, 1 .mu.L of a 1:1,000
dilution of gel-purified products from the above reactions was
combined and amplified with rmSPD5 and CD40L3. Because Pfu
polymerase did not consistently yield the expected 1.62 kb overlap
product, AccuTaq LA DNA polymerase (Sigma) was used for this PCR,
using the thermocycling program: 94.degree. C. for 2.5 min; then 30
cycles of 98.degree. C. for 20 sec, 43.degree. C. for 30, and
68.degree. C. for 10 min. The resulting product was digested with
Nhe I and Kpn I, gel-purified, and ligated into the Nhe I and Kpn I
sites in the expression plasmid, pcDNA3.1(+) (Invitrogen, Carlsbad,
Calif.). DH5 E. coli were transformed with the construct and
plasmid DNA was purified either by double banding in ethidium
bromide-CsCl gradients or by anion exchange resin (QIAgen). To form
the T147N-CD40L-SPD construct, the same approach was used except
that the CD40L coding region was taken from the expression plasmid
for T147N-CD40L [Kombluth]. The amino acid sequence at the junction
between SPD and CD40L is . . . KAALFPDG/HRRLDKIE . . . (SEQ ID
NO:16), where the C-terminal portion begins the sequence for CD40L.
To form mCD40L-SPD, a similar approach was taken except that
primers SPD/mCD40L5, mCD40L/SPD3, and MCD40L3 were used for
amplifications involving murine CD40L is . . . KAALFPDG/HRRLDKVE .
. . (SEQ ID NO:17), where the C-terminal portion begins the
sequence for murine CD40L. Both DNA strands of each construct were
sequenced to confirm that the constructs were correct. In other
experiments, an entirely humanized construct, consisting of human
CD40L fused to human SPD, was constructed (data not shown).
[0070] Spleen cells from C3H/HeJ mice were stimulated with 5
.mu.g/ml concanavalin A and 10 mg/ml IL-2 (Sigma) for 8 hours (31).
mRNA was isolated using the Micro FastTrack kit (Invitrogen). cDNA
was prepared using Superscript II reverse transcriptase (Life
Technologies) and random hexamers as primers. PCR primers sequences
(SEQ ID NOS 18 through 21) were as follows (where the underlined
bases indicate restriction endonuclease sites for cloning into the
vector):
TABLE-US-00003 5mRANKL-ext: 5'-CATGTTCCTGGCCCTCCTC-3'` 3mRANKL-ext:
5'-GTACAGGCTCAAGAGAGAGGGC-3' 5mRANKL-int:
5'-ATACTCGAGCGCAGATGGATCCTAAC-3' 3mRANKL-int:
5'-GGGGTTTAGCGGCCGCTAATGTTCCACGAAATGAGTTC-3
5. Construction of Expression Plasmid for Murine RANKL/TRANCE
(TNFSF 11).
[0071] The extracellular portion of RANKL/TRANCE was cloned by
nested PCR. In the first round of PCR, 5mRANKL-ext and 3MRANKL-ext
were used with Pfu cloned polymerase (Stragene) using the
thermocycling program: 94.degree. C. for 2.5 min; then 30 cycles of
94.degree. C. for 10 sec, 50.degree. C. for 30 sec, and 75.degree.
C. for 2 min. The product was diluted 1:1,000 and 1 .mu.L was
amplified for another 30 cycles using 5mRANKL-int and 3mRANK-int,
which contain an Xho I site and a Not I site respectively. The
resulting product was digested with Xho I, blunt-ended with T4 DNA
polymerase, then digested with Not I and gel-purified. The
CD40L-SPD expression plasmid described above was digested with Msc
I an Not I and gel purified. Then the RANKL/TRANCE sequence was
ligated into this vector in frame with the SPD coding sequence. The
amino acid sequence at the junction between SPD and RANKL/TRANCE is
. . . KAALFPDG/RAQMDPNR . . . (SEQ ID NO:22), where the N-terminal
portion is from SPD and the C-terminal portion is the extracellular
sequence of RANKL/TRANCE. Both DNA strands of each construct were
sequenced to confirm that the constructs were correct.
6. Stable Transfection of DHFR-Deficient CHO Cells and
Amplification.
[0072] DG44 (a line of CH0-K1 cells deficient in dihydrofolate
reductase (DHFR)) (32) and pCHIP (a plasmid containing the hamster
DHFR minigene) (33) were gifts from Dr. Lawrence Chasin, Columbia
University, New York, N.Y. DG44 cells were cultured in .alpha.-MEM
consisting of ribo- and deoxynucleoside-free .alpha.-MEM
(BioWhittaker, Walkersville, Md.) supplemented with 200 .mu.M
L-glutamine, 10% fetal bovine serum (FBS) and 10 .mu.g/ml each of
adenosine, deoxyadenosine, and thymidine (Sigma). All cell cultures
described were negative in a mycoplasma rRNA assay (Gen-Probe, San
Diego). DG44 cells in six-well plates were transfected by the
method of Okayama and Chen ((34) with 10 .mu.g of expression
plasmid and 0.05 .mu.g of pCHIP (200:1 ratio). After two days, the
transfected DG44 were trypsinized and transferred to 100 mm plates.
At this point, the media was switched to .alpha.-MEM which differs
from a-MEM in that dialyzed FBS (HyClone Systems, Logan, Utah) was
used and no nucleoside supplements were added. Only cells
containing the DHFR minigene were able to grow in .alpha.-MEM, and
colonies were selected after 10 days, cloned using cloning rings,
and transferred to 12.5 cm.sup.2 flasks. Clones were selected for
expansion using an ELISA to screen for the production of either
raurine or human CD40L (see below). Using the method described by
Kingston et al. (35), escalating doses of methotrexate were used to
amplify the transfected genes over a period of 6-14 months until
the cells grew well in 80 .mu.M methotrexate. Each expressing clone
was re-cloned once or twice more in order to select the highest
expressing cells.
7. Preparation of Human and Murine CD40L-SPD in Serum-Free
Media.
[0073] Selected clones were adapted for growth in nucleoside-free
UltraCHO media (BioWhittaker) supplemented with 50-100 .mu.g/mL
ascorbic acid and 50 .mu.M methotrexate (Sigma). The non-adherent
population was further adapted for suspension growth in roller
bottles. In some experiments, the cells were adapted from
.alpha.-MEM to CHO-S-SFM II media (Life Technologies) supplemented
with ascorbic acid and 50 .mu.g/mL L-proline.
8. ELTSA Assay for Human and Murine CD40L-SPD.
[0074] To assay for correctly folded CD40L, wells of a MaxiSorb
96-well plate (Nunc) were coated overnight at 4.degree. C. with 50
.mu.L of carbonate-bicarbonate, pH 9.40 buffer containing 0.5
.mu.g/mL 24-31 anti-human CD40L MAb (Ancell) or MR1 anti-murine MAb
(Bioexpress, Lebanon, N.H.). Wells were blocked with 3% bovine
serum albumin (BSA) in PBS. 100 .mu.L samples were added to the
wells either neat or diluted in a dilution buffer consisting of 1%
BSA, 0.9% NaCl, 50 mM Tris pH 7.40, and 0.1% peroxide-free Tween 20
(Sigma). After shaking for 2 h at 600 RPM, a plate washer was used
to wash the plate four times with 0.9% NaCl, 50 mM Tris pH 7.40,
and 0.1% peroxide-free Tween 20. Then, 100 .mu.L of diluent buffer
containing 1 .mu.g/mL biotinylated 24-31 anti-human CD40L Mab
(Ancell) or MR1 anti-murine CD40L Mab (Pharmingen, San Diego,
Calif.) was added to each well and again shaken for 2 h. Following
another four washer, 100 .mu.L of diluent buffer containing 1
.mu.g/mL of streptavidin-alkaline phosphatase (Jackson) was added
to each well and the plate was shaken for 1 hour. Lastly, after
another four washes, color was developed for 10-20 min using 100
.mu.L/well of BluePhos (Kierkegaard & Perry), stop solution was
added, and the wells were read at 650 .mu.m in a plate reader.
9. Purification of Human and Murine CD40L-SPD.
[0075] Conditioned UltraCHO media was filtered using a 0.2.mu. PES
filter unit (Nalgene) and stored at 4.degree. C. for up to 3
months. A preliminary size fractionation was performed by
ultrafiltration through a 100 kDa-cutoff 76 mm membrane (YM-100,
Millipore) in a 400 mL stirred cell at 10 lbs/sq. inch pressure of
argon. Media was concentrated to about 10 mL, diluted to 100 mL
with buffer, and again concentrated to 10 mL for a total of 3
cycles of ultrafiltration and buffer exchange. Buffer was 50 mM
Bicine (Calbiochem), adjusted to pH 9.0 with NaOH (about 32 mM Na),
and 1 mM EDTA to prevent the activity of any metalloproteinase.
Using FPLC equipment (Amersham-Pharmacia), the concentrate was
filtered through a 0.45.mu. filter, placed into a 10 mL superloop,
applied to a 10.times.30 mm column (HR10/30, Amersham-Pharmacia)
packed with Fractogel SO.sub.3 650M (EM Biosciences), and eluted at
0.5 mL/min at 4.degree. C. with a linear gradient of 0-500 mM NaCl
in buffer. As described by the manufacturer, the resolution of
proteins on Fractogel SO.sub.3 is enhanced by using a long, thin
column geometry. Fractions were collected and screened for human or
murine CD40L by ELISA. Positive fractions were pooled, concentrated
by ultrafiltration (CentriPrep-30, Millipore), filtered through a
0.45.mu. filter, and applied to a Superose 6 column
(Amersham-Pharmacia) in phosphate-buffered saline.
10. Murine B Cell Cultures.
[0076] C3H/HeJ mice were euthanized by CO.sub.2 inhalation under a
protocol approved by the Animal Subjects Committee of the San Diego
VA Healthcare System. Splenocytes were isolated by centrifugation
over Lympholyte-M (Accurate Chemical & Scientific Corp.,
Westbury, N.Y.) and B cells were isolated by negative selection
using anti-CD43 immunomagnetic beads (Miltenyi Biotec Inc., Auburn,
Calif.). The resting B cells were suspended in Dulbecco's MEM with
10% FBS at a concentration of 1.times.10.sup.6/mL, and 100 .mu.L
was added to the wells of 96-well flat-bottomed plates. 100 .mu.L
of dilutions of murine CD40L-SPD in media or media alone were added
to the wells, which were incubated in 8.5% CO.sub.2 at 37.degree.
C. for 48 hours. Then, 0.5 .mu.Ci/well of .sup.3H-thymidine was
added to each well, and the cells were collected 4 h later onto
glass fiber filters using an automated cell harvester. A
scintillation counter was used to determine the incorporated
radioactivity.
11. Human B Cell Cultures.
[0077] Venous blood from consenting subjects was used as a source
of human B cells under a protocol approved by the UCSD
Institutional Review Board. Blood was collected into syringes
containing 5 U/mL heparin and peripheral blood mononuclear cells
(PBMC) were isolated by centrifugation over Ficoll-hypaque. The
cells were suspended at 2.times.10.sup.5/mL in RPMI 1640 containing
200 .mu.M L-glutamine, 10% FBS, 0.832 .mu.M cyclosporin A (Sigma),
and 25 ng/mL human IL-4 (R & D Systems) and incubated in 5%
CO.sub.2 at 37.degree. C. as described by Schultze et al. (36). At
intervals, the cells were stained with CyChrome-conjugated
anti-CD19 and PE-conjugated anti-CD80 (B7-1) monoclonal antibodies
(Pharmingen) and analyzed by flow cytometry.
12. Human Monocyte-Derived Macrophage and Dendritic Cell
Cultures.
[0078] As previously described [Kombluth], monocytes were isolated
from PBMC by adherence to fibronectin-coated plates, plated into
48-well plates, and then cultured in RPMI1640 containing 200 .mu.M
L-glutamine and 10% autologous serum for 7-10 days. Monolayers of
the matured cells (about 2.times.10.sup.5/well), termed
monocyte-derived macrophages or MDM, were then washed in media and
cultured in 1 mL/well RPMI1640 containing 200 .mu.M L-glutamine and
10% heat-inactivated FBS. Alternatively, dendritic cells (DC) were
formed from monocytes by adding GM-CSF and IL-4 to the culture
media, and the resulting DC were used 6 days later. Preparations of
CD40L-SPD were added to the wells as indicated. As a positive
control, 100 ng/mL bacterial lipopolysaccharide (LPS) from E. coli
0111:B4 (Calbiochem) was added. Supernatants were collected 24 h
later and analyzed for cytokine content using ELISA (R & D
Systems).
EXAMPLE 1
Design Principles in Constructing Collectin-TNFSF Member Fusion
Proteins
[0079] To express CD40L and other TNFSF members as stable,
multimeric proteins, the coding region of the extracellular,
C-terminal portion of CD40L was joined in-frame to the collectin,
surfactant protein D (SPD). The N-terminus of SPD contains two
cysteines which form the disulfide bonds necessary for the 4-armed
cruciate structure of the overall molecule [Brown-Augsburger,
1996]. C-terminal to these cysteines in SPD is a long
triple-helical collagenous "stalk" which ends in the "neck" region
that promotes the trimerization of each arm of the structure.
Immediately after this neck region, the coding sequence for the
extracellular portion of CD40L was added, in place of the
carbohydrate recognition domain (CRD) of SPD. The collectins were
chosen as the framework for the multimeric construct because of
their multi-subunit structure and the trimeric nature of their
stalk regions. Appropriateness of replacing the CRD of a collectin
with the extracellular region of a TNFSF member is further
supported by structural studies of the two protein families. An
analysis of the CRD crystal structure of another collectin, ACRP30,
indicated that it was structurally superimposable upon the crystal
structures of the extracellular regions of CD40L, TNF, and Fas
[Shapiro, 1998]. The successful expression of the collectin-TNFSF
fusion protein, CD40L-SPD, indicates that other TNFSF members
(Table I) could be conjoined to SPD in a similar manner and that
other collectins besides SPD (Table II) could be used as a protein
framework instead of SPD. Because these molecules are formed
entirely from naturally occurring proteins, the production of an
immune response (e.g., antibodies) to these fusion proteins is
minimized. By deleting portions of the stalk region of the TNFSF
proteins, additional constructs can be made which may be even less
immunogenic.
EXAMPLE 2
Expression of Human and Murine CD40L-SPD in CHO Cells
[0080] The coding regions for the extracellular portion of human
CD40L, human T147N-CD40L, an inactive mutant of CD40L, or murine
CD40L were joined to the neck region of murine SPD, replacing the
SPD CRD (FIG. 1). A CMV-driven expression plasmid for the construct
was co-transfected with a DHFR minigene into DNFR-deficient CHO
cells. Following selection in nucleoside-free media, expressing CHO
clones were amplified by culture in ascending doses of
methotrexate. The resulting clones produced about 1-10 .mu.g/mL of
the fusion protein over a 3 day period in media containing FBS.
[0081] Clones were adapted for growth as suspension cells in two
types of sertim-firee media. Murine CHO-SPD produced in UltraCHO
(BioWhittaker) was largely retained (about 60% as determined by
ELISA) by a 1,000 kDa cutoff ultrafiltration membrane (Pall Corp.,
Port Washington, N.Y.), consistent with a large multimeric complex
formed by the stacking of the SPD portion of the molecule. However,
in CHO-S-SFM II (Life Technologies), nearly all ELISA-detectable
murine CHO-SPD passed through a 100 kDa cutoff ultrafiltration
membrane (Millipore), suggesting that the protein was either
folding incorrectly in this media or was being degraded by
proteolysis. Consequently, the purification method was optimized
for the spent UltraCHO media.
EXAMPLE 3
Purification of Human and Murine CD40L-SPD
[0082] Purification procedures were developed for murine CD40L-SPD,
but the same methods could be applied to human CD40L-SPD with minor
modifications. Murine CD40L-SPD has a predicted m.w. of 49 kDa per
chain, or about 600 kDa per 12-chain, cruciate molecule, the amino
acid sequence predicts a pI of 9.10. Accordingly, conditioned media
was concentrated by ultrafiltration through a 100 kDa cutoff
filter, which also fractionates the sample on a size basis. After
diafiltration into 50 mM bicine, pH 9.00 (also containing 1 mM EDTA
added to inhibit metalloproteinases), the sample was applied to a
variety of cationic exchange resins. Using Source 30S
(Amersham-Pharmacia), most of the ELISA-detectable protein did not
bind and was recovered in the flow-through. However, as reported by
Morris et al. {Morris}, Fractogel SO.sub.3 650M retained the
protein. The retention by this tentacular resin and not by Source
30S suggests binding to positively charged residues that are not on
the protein surface. Using a linear NaCl gradient, ELISA-detectable
protein elutes at between 0.15-0.30 M NaCl under these conditions
(FIG. 2). In selected experiments, the protein was further purified
using a Superose 6 sizing column. Most of the ELISA-detectable
protein eluted in the excluded volume, indicating an apparent m.w.
of greater than 1,000 kDa (FIG. 3).
EXAMPLE 4
Active of CD40L-SPD on Human B Cells
[0083] Schultze et al. described a system using CD40L-expressing
cells plus IL-4 and cyclosporin A (to inhibit T cell growth) as a
means to grow very large numbers of B cells from a small sample of
blood. Because CD40L activates these B cells to express high levels
of B7 molecules (CD80 and CD86), the proliferating B cells were
effective in presenting peptide antigens and rival non-dividing
dendritic cells as antigen-presenting cells (APCs) (36). To
determine if the CD40L-SPD fusion protein could replace
CD40L-expressing cells in this system, PBMC were cultured with
CD40L-SPD in addition to IL-4 and cyclosporin A. Under these
conditions the cells grew to saturation density every three days.
After three weeks, the cultures were almost entirely CD 19+ B cells
which express high levels of CD80 (FIG. 4). This indicates that
CD40L-SPD can be used in ex vivo systems where a soluble yet
effective form of CD40L is needed to stimulate cells for
immunotherapeutic applications.
EXAMPLE 5
Activity of CD40L-SPD on Murine B Cells
[0084] Resting murine B cells are particularly difficult to
stimulate with most soluble forms of CD40L. Even with murine
CD40L-CD8 fusion proteins, it is necessary to crosslink the protein
with antibodies against CD8 in order to achieve maximal
proliferation in culture [Klauss, 1999]. Accordingly, resting
murine B cells were negatively selected with immunomagnetic beads.
As shown in FIG. 5, murine CD40L-SPD was as effective as anti-IgM
antibody in driving B cells to proliferate. This indicates that
CD40L-SPD can mimic the multivalent interactions that occur when a
responding cell comes in contact with CD40L-bearing activating
cells.
EXAMPLE 6
Activity of CD40L-SPD on Human Macrophages and Dendritic Cells
[0085] CD40L is a powerful stimulant for macrophages (reviewed in
(28)) and dendritic cells (40). Accordingly, preparations of
CD40L-SPD were added to monocyte-derived macrophages and the
production of MIP-1 .quadrature. was used as a measure of
stimulation. As shown in FIG. 6, both human and murine CD40L-SPD
were able to stimulate macrophages, whereas the T147N-CD40L-SPD
mutant was inactive as expected.
DISCUSSION
[0086] These examples define a new method of producing multimeric
(i.e., many trimers) of CD40L as a fusion protein with SPD. Also
prepared and expressed were similar fusion proteins between raurine
RANKL/TRANCE (TNFSF 11) or murine CD27L/CD70 (TNFSF7) joined to
murine SPD (data not shown). This suggests that virtually all TNFSF
members could be successfully produced as fusion proteins with SPD.
Furthermore, it is also likely that other collectins besides SPD
could be used in these fusions, given the strong structural
homologies between the CRDs of the collectins and the extracellular
domains of TNFSF members [Shapiro] which can be substituted for
these CRDs. Given the 17 known TNFSF members and 9 known
collecting, at least 153 fusion protein combinations are
possible.
[0087] SPD was selected for initially because it is a soluble
homopolymer. Other collecting, such as surfactant protein A, have
strong binding affinities to lipids and specific cell receptors.
Although removal of the CRD abrogates much of this binding, it may
be partially mediated by the neck region sequence, which the fusion
proteins retain. Accordingly, it would be expected that collectins
other than SPD might confer different cell-binding and
pharmacokinetic behaviors upon a fusion protein. For example,
macrophages are known to take up and degrade whole SPD [Dong,
1998]. If a fusion protein other than SPD were used, the
disposition of the fusion protein in vivo might be altered.
Additionally, metalloproteinases are known to degrade the
collectin, Clq, so that a fusion with Clq may alter the degradation
of the fusion protein. For example, because CD40L activates
macrophages and other cells to produce metalloproteinases, which
could potentially degrade the collagenous portion of SPD and other
collecting. Cleavage of the collagenous stalk would then be
expected to release single-trimers of CD40L, which could diffuse
away from the original parent molecule, much like a slow-release
formulation of a drug. Also, the membrane-proximal portion of CD40L
has been retained in CD40L-SPD. This sequence also contains
protease-susceptible amino acid sequences, which can be eliminated
by mutagenesis to retard the cleavage of CD40L from the fusion
protein. Mutations in such proteinase cleavage site(s) would delay
such cleavage and favor the local persistence of the CD40L
stimulus.
[0088] CD40L-SPD is a large macromolecule (>1,000 kDa), and the
other TNFSF-collectin fusion proteins would be expected to be
similarly large. For native SPD, the aggregates that spontaneously
form measure 100 nm in diameter. When injected into tissue, this
large a complex would be expected to remain at the injection site
for a prolonged period. Localization of the TNFSF-containing
protein would also be expected to reduce any systemic toxicity
caused by the release of free single-trimers into the circulation.
For example, soluble CD40L in blood has been linked to disease
activity in lupus, and this smaller molecule may even cross the
glomerulus to cause damage to renal tubules [Kato and Kipps, J.
Clin. Invest. November 1999]. On the other hand, because CD40L
induces the production of chemokines which attract immune cells
[Kombluth], T cells, monocytes, and dendritic cells would be
expected migrate to the site where CD40L-SPD was injected. This
might be advantageous if CD40L-SPD were used as a vaccine adjuvant.
In mice, soluble CD40L (sCD40LT) stimulates IgGl production but not
cytotoxic T lymphocytes (CTLs) [Wong, 1999]. Interestingly, the
same protein that is expressed from an injected plasmid stimulates
both a strong antibody and CTL response [Gurunathan, 1998]. In the
latter case, the plasmid would be expected to deliver a localized
supply of CD40L, whereas the sCD40LT protein is free to diffuse
away. Support for the localized use of CD40L in an adjuvant
formulation is provided by a study using a plasmid expressing
full-length membrane CD40L, which was very effective in stimulating
both humoral and CTL immune responses [Mendoza, 1997]. Similarly,
injection of adenovirus expressing membrane CD40L has potent
antitumor activity in mice [Kikuchi, 1999]. Similar considerations
would likely apply to other fusion proteins between the TNFSF and
collectins.
[0089] Finally, for immunostimulatory proteins, it is particularly
important that the protein not be antigenic if repeated injections
are needed. For example, vaccination with TNF-.mu. modified by the
addition of short peptide sequences was able to induce the
production of disease-modifying anti-TNF-.mu. autoantibodies
[Dalum, 1999]. Because CD40L-SPD and other TNFSF-collectin fusion
proteins are formed from endogenous protein sequences (with the
possible exception of the peptide sequence at the junction), the
production of antibodies might not limit the effectiveness of
repeated injections.
[0090] In conclusion, fusions between TNFSF members and collectins
offer a novel means of generating large protein complexes which can
provide localized stimulation at an injection site. Because of the
multimeric nature of the collectin backbone, such fusion proteins
may mimic the multivalent ligand surface presented by the membrane
forms of TNFSF members to TNFRSF-bearing responding cells.
Moreover, by limiting systemic toxicity while maintaining localized
efficacy, such fusion proteins may have a role as vaccine adjuvants
against infectious agents and tumors.
TABLE-US-00004 TABLE I Ligands of the TNF Superfamily* New Ligand
Symbol Other Names Genbank ID LTA Lymphotoxin-, TNF-a, TNFSF1
X01393 TNF TNF-a, TNFSF2 X02910 LTB Lymphotoxin-, TNFSF3 L11016
TNFSF4 OX-40L D90224 TNFSF5 CD40L, CD154, Gp39, T-BAM X67878 TNFSF6
FasL U11821 TNFSF7 CD27L, CD70 L08096 TNFSF8 CD30L L09753 TNFSF9
4-1BBL U03398 TNFSF10 TRAIL, Apo-2L U37518 TNFSF11 RANKL, TRANCE,
OPGL, ODF AF013171 TNFSF12 TWEAK, Apo-3L AF030099 TNFSF13 APRIL
NM_003808 TNFSF13B BAFF, THANK, BLYS AF136293 TNFSF14 LIGHT, HVEM-L
AF036581 TNFSF15 VEGI AF039390 TNFSF16 Unidentified TNFSF17
Unidentified TNFSF18 AITRL, GITRL AF125303 *(as of Nov. 1, 1999)
Known members of ligands in the TNF superfamily, taken from the
Human Gene Nomenclature Committee
TABLE-US-00005 TABLE II The Collectin Superfamily Clq Pulmonary
surfactant Mannose-binding protein, protein D MBL1 conglutinin
Mannose-binding protein, collectin-43 MBL2 CL-L1 Pulmonary
surfactant ACRP30 protein A Hib27
[0091] All collectins are formed as multimers of trimeric subunits,
each containing a collagenous domain. The C-terminus of each
collectin contains a CRD which binds carbohydrates and other
ligands. Because of the tight similarities between the known CRD
structures and the extracellular domains of TNFSF members, it is
likely that the CRD of any collectin could be replaced with the
extracellular domain of any TNFSF member in a structurally
compatible manner.
[0092] While the present invention has now been described in terms
of certain preferred embodiments, and exemplified with respect
thereto, one skilled in the art will readily appreciate that
various modifications, changes, omissions and substitutions may be
made without departing from the spirit thereof. It is intended,
therefore, that the present invention be limited solely by the
scope of the following claims.
REFERENCES
[0093] Banchereau, J., and R. M. Steinman. 1998. Dendritic cells
and the control of immunity. Nature 392:245-252.
[0094] Bazzoni, F., and B. Beutler. 1996. The tumor necrosis factor
ligand and receptor families. New England Journal of Medicine
334:1717-1725.
[0095] Brown-Augsburger, P., K. Hartshorn, D. Chang, K. Rust, C.
Fliszar, H. G. Welgus, and E. C. Crouch. 1996. Site-directed
mutagenesis of Cys-15 and Cys-20 of pulmonary surfactant protein D.
Expression of a trimeric protein with altered anti-viral
properties. Journal of Biological Chemistry 271:13724-13730.
[0096] Chen, C. A., and H. Okayama. 1988. Calcium
phosphate-mediated gene transfer: a highly efficient transfection
system for stably transforming cells with plasmid DNA.
Biotechniques 6:632-638.
[0097] Crouch, E., A. Persson, D. Chang, and J. Heuser. 1994.
Molecular structure of pulmonary surfactant protein D (SP-D).
Journal of Biological Chemistry 269:17311-17319.
[0098] Crouch, E., D. Chang, K. Rust, A. Persson, and J. Heuser.
1994. Recombinant pulmonary surfactant protein D.
Post-translational modification and molecular assembly. Journal of
Biological Chemistry 269:15808-15813.
[0099] Crouch, E. C. 1998. Structure, biologic properties, and
expression of surfactant protein D (SP-D). Biockimica et Biophysica
Acta 1408:278-289.
[0100] Dalum, I, D. M. Butler, M. R. Jensen, P. Hindersson, L.
Steinaa, A. M. Waterston, S. N. Grell, M. Feldmann, H. I. Eisner,
and S. Mouritsen. 1999. Therapeutic antibodies elicited by
immunization against TNF-alpha. Nature Biotechnology
17:666-669.
[0101] Dhodapkar, M. V., R. M. Steinman, M. Sapp, H. Desai, C.
Fossella, J. Krasovsky, S. M. Donahoe, P. R. Dunbar, V. Cerundolo,
D. F. Nixon, and N. Bhardwaj. 1999. Rapid generation of broad
T-cell immunity in humans after a single injection of mature
dendritic cells. Journal of Clinical Investigation 104:173-180.
[0102] Dong, Q., and J. R. Wright. 1998. Degradation of surfactant
protein D by alveolar macrophages. American Journal of Physiology
274:L97-105.
[0103] Fanslow, W. C., S. Srinivasan, R. Paxton, M. G. Gibson, M.
K. Spriggs, and R. J. Armitage. 1994. Structural characteristics of
CD40 ligand that determine biological function. Seminars in
Immunology 6:267-278.
[0104] Grell, M., E. Douni, H. Wajant, M. Lohden, M. Clauss, B.
Maxeiner, S. Georgopoulos, W. Lesslauer, G. Kollias, K.
Pfizenmaier, and et al. 1995. The transmembrane form of tumor
necrosis factor is the prime activating ligand of the 80 kDa tumor
necrosis factor receptor. Cell 83:793-802.
[0105] Gruss, H. J., and S. K. Dower. 1995. Tumor necrosis factor
ligand superfamily: involvement in the pathology of malignant
lymphomas. Blood 85:3378-3404.
[0106] Gurunathan, S., K. R. Irvine, C. Y. Wu, J. I. Cohen, E.
Thomas, C. Prussin, N. P. Restifo, and R. A. Seder. 1998. CD40
ligand/trimer DNA enhances both humoral and cellular immune
responses and induces protective immunity to infectious and tumor
challenge. Journal of Immunology 161:4563-4571.
[0107] Higgins, L. M., S. A. McDonald, N. Whittle, N. Crockett, J.
G. Shields, and T. T. MacDonald. 1999. Regulation of T cell
activation in vitro and in vivo by targeting the OX40-OX40 ligand
interaction: amelioration of ongoing inflammatory bowel disease
with an OX40-IgG fusion protein, but not with an OX40 Hgand-IgG
fusion protein. Journal of Immunology 162:486-493.
[0108] Hollenbaugh, D., N. J. Chalupny, and A. Aruffo. 1992.
Recombinant globulins: novel research tools and possible
pharmaceuticals. Current Opinion in Immunology 4:216-219.
[0109] Hoppe, H. J., and K. B. Reid. 1994. Collectins-soluble
proteins containing collagenous regions and lectin domains--and
their roles in innate immunity. Protein Science 3:1143-1158.
[0110] Hoppe, H. J., P. N. Barlow, and K. B. Reid. 1994. A parallel
three stranded alpha-helical bundle at the nucleation site of
collagen triple-helix formation. Febs Letters 344:191-195.
[0111] Kato, K., E. Santana-Sahagun, L. Rassenti, M. Weisman, N.
Tamura, S. Kobayashi, H. Hashimoto, and T. Kipps. 1999. The soluble
CD40 ligand sCD154 in systemic lupus erythematosus. J. Clin.
Invest. 104:947-955.
[0112] Kehry, M., B. Castle, and P. Hodgkin. 1992. B-cell
activation mediated by interactions with membranes from helper T
cells. In Mechanisms of Lymphocyte Activation and Immune Regulation
IV: Cellular Communications, vol. 323. S. Gupta and T. Waldmann,
editors. Plenum Press, New York. 139.
[0113] Kehry, M. R., and B. E. Castle. 1994. Regulation of CD40
ligand expression and use of recombinant CD40 ligand for studying B
cell growth and differentiation. Seminars in Immunology
6:287-294.
[0114] Kikuchi, T., and R. G. Crystal. 1999. Anti-tumor immunity
induced by in vivo adenovirus vector-mediated expression of CD40
ligand in tumor cells. Human Gene Therapy 10:1375-1387.
[0115] Kingston, R., R. Kaufman, C. Bebbington, and M. Rolfe. 1999.
Amplification using CHO expression vectors. In Current Protocols in
Molecular Biology, vol. 3. F. Ausubel, R. Brent, R. Kingston, D.
Moore, J. Seidman, J. Smithe and K. Struhl, editors. 4 vols. John
Wiley & Sons, Inc., New York. 16.14.11-16.14.13.
[0116] Klaus, G. G., M. Holman, C. Johnson-Leger, J. R.
Christenson, and M. R. Kehry. 1999. Interaction of B cells with
activated T cells reduces the threshold for CD40-mediated B cell
activation. International Immunology 11:71-79.
[0117] Kombluth, R. S., K. Kee, and D. D. Richman. 1998. CD40
ligand (CD154) stimulation of macrophages to produce
HIV-1-suppressive beta-chemokines. Proceedings of the National
Academy of Sciences of the United States of America
95:5205-5210.
[0118] Kuroki, Y., and D. R. Voelker. 1994. Pulmonary surfactant
proteins. Journal of Biological Chemistry 269:25943-25946.
[0119] Kwon, B., B. S. Youn, and B. S. Kwon. 1999. Functions of
newly identified members of the tumor necrosis factor
receptor/ligand superfamilies in lymphocytes. Current Opinion in
Immunology 11.340-345.
[0120] Lane, P., T. Brocker, S. Hubele, E. Padovan, A.
Lanzavecchia, and F. McConnell. 1993. Soluble CD40 ligand can
replace the normal T cell-derived CD40 ligand signal to B cells in
T cell-dependent activation. Journal of Experimental Medicine
177:1209-1213.
[0121] Lu, J., H. Wiedemann, U. Holmskov, S. Thiel, R. Timpl, and
K. B. Reid. 1993. Structural similarity between lung surfactant
protein D and conglutinin. Two distinct, C-type lectins containing
collagen-like sequences. European Journal of Biochemistry
215:793-799.
[0122] Mach, F., U. Schonbeck, J. Y. Bonnefoy, J. S. Pober, and P.
Libby. 1997. Activation of monocyte/macrophage functions related to
acute atheroma complication by ligation of CD40: induction of
collagenase, stromelysin, and tissue factor. Circulation
96:396-399.
[0123] Malik, N., B. W. Greenfield, A. F. Wahl, and P. A. Kiener.
1996. Activation of human monocytes through CD40 induces matrix
metalloproteinases. Journal of Immunology 156:3952-3960.
[0124] Mariani, S. M., B. Matiba, T. Sparna, and P. H. Krammer.
1996. Expression of biologically active mouse and human
CD95/APO-1/Fas ligand in the baculovirus system. Journal of
Immunological Methods 193:63-70.
[0125] Mendoza, R. B., M. J. Cantwell, and T. J. Kipps. 1997.
Immunostimulatory effects of a plasmid expressing CD40 ligand (CD
154) on gene immunization. Journal of Immunology 159:5777-5781.
[0126] Morris, A. E., R. L. Remmele, Jr., R. Klinke, B. M. Macduff,
W. C. Fanslow, and R. J. Armitage. 1999. Incorporation of an
isoleucine zipper motif enhances the biological activity of soluble
CD40L (CD154). Journal of Biological Chemistry 274:418-423.
[0127] Motwani, M., R. A. White, N. Guo, L. L. Dowler, A. I.
Tauber, and K. N. Sastry. 1995. Mouse surfactant protein-D. cDNA
cloning, characterization, and gene localization to chromosome 14.
Journal of Immunology 155:5671-5677.
[0128] Oyaizu, N., N. Kayagaki, H. Yagita, S. Pahwa, and Y. Dcawa.
1997. Requirement of cell-cell contact in the induction of Jurkat T
cell apoptosis: the membrane-anchored but not soluble form of FasL
can trigger anti-CD3-induced apoptosis in Jurkat T cells.
Biochemical and Biophysical Research Communications
238:670-675.
[0129] Pietravalle, F., S. Lecoanet-Henchoz, J. P. Aubry, G. Elson,
J. Y. Bonnefoy, and J. F. Gauchat. 1996. Cleavage of membrane-bound
CD40 ligand is not required for inducing B cell proliferation and
differentiation. European Journal of Immunology 26:725-728.
[0130] Pullen, S. S., M. E. Labadia, R. H. Ingraham, S. M.
McWhirter, D. S. Everdeen, T. Alber, J. J. Crute, and M. R. Kehry.
1999. High-affinity interactions of tumor necrosis factor
receptor-associated factors (TRAFs) and CD40 require TRAF
trimerization and CD40 multimerization. Biochemistry
38:10168-10177.
[0131] Ruiz, S., A. H. Henschen-Edman, H. Nagase, and A. J. Tenner.
1999. Digestion of Clq collagen-like domain with MMPs-1,-2,-3, and
-9 further defines the sequence involved in the stimulation of
neutrophil superoxide production. Journal of Leukocyte Biology
66:416-422.
[0132] Schneider, P., N. Holler, J. L,. Bodmer, M. Hahne, K. Frei,
A. Fontana, and J. Tschopp. 1998. Conversion of membrane-bound
Fas(CD95) ligand to its soluble form is associated with
downregulation of its proapoptotic activity and loss of liver
toxicity. Journal of Experimental Medicine 187:1205-1213.
[0133] Schuchmann, M., S. Hess, P. Bufler, C. Brakebusch, D.
Wallach, A. Porter, G. Riethmuller, and H. Engelmann. 1995.
Functional discrepancies between tumor necrosis factor and
lymphotoxin alpha explained by trimer stability and distinct
receptor interactions. European Journal of Immunology
25:2183-2189.
[0134] Schultze, J. L., S. Michalak, M. J. Seamon, G. Dranoff, K.
Jung, J. Daley, J. C. Delgado, J. G. Gribben, and L. M. Nadler.
1997. CD40-activated human B cells: an alternative source of highly
efficient antigen presenting cells to generate autologous
antigen-specific T cells for adoptive immunotherapy. Journal of
Clinical Investigation 100:2757-2765.
[0135] Seyama, K., S. Nonoyama, I. Gangsaas, D. Hollenbaugh, H. F.
Pabst, A. Aruffo, and H. D. Ochs. 1998. Mutations of the CD40 Hgand
gene and its effect on CD40 Hgand expression in patients with
X-linked hyper IgM syndrome. Blood 92:2421-2434.
[0136] Shapiro, L., and P. E. Scherer. 1998. The crystal structure
of a complement-1q family protein suggests an evolutionary link to
tumor necrosis factor. Current Biology 8:335-338.
[0137] Shimizu, H., J. H. Fisher, P. Papst, B. Benson, K. Lau, R.
J. Mason, and D. R. Voelker. 1992. Primary structure of rat
pulmonary surfactant protein D. cDNA and deduced amino acid
sequence. Journal of Biological Chemistry 267:1853-1857.
[0138] Smith, C. A., T. Farrah, and R. G. Goodwin. 1994. The TNF
receptor superfamily of cellular and viral proteins: activation,
costimulation, and death. Cell 76:959-962.
[0139] Suda, T., H. Hashimoto, M. Tanaka, T. Ochi, and S. Nagata.
1997. Membrane Fas Hgand kills human peripheral blood T
lymphocytes, and soluble Fas Hgand blocks the killing. Journal of
Experimental Medicine 186:2045-2050.
[0140] Tesselaar, K., L. A. Gravestein, G. M. van Schijndel, J.
Borst, and R. A. van Lier. 1997. Characterization of murine CD70,
the Hgand of the TNF receptor family member CD27. Journal of
Immunology 159:4959-4965.
[0141] Urlaub, G., E. Kas, A. M. Carothers, and L. A. Chasin. 1983.
Deletion of the diploid dihydrofolate reductase locus from cultured
mammalian cells. Cell 33:405-412.
[0142] Venolia, L., G. Urlaub, and L.A. Chasin. 1987.
Polyadenylation of Chinese hamster dihydrofolate reductase genomic
genes and minigenes after gene transfer. Somatic Cell and Molecular
Genetics 13:491-504.
[0143] Wong, B. R., R. Josien, S. Y. Lee, B. Sauter, H. L. Li, R.
M. Steinman, and Y. Choi. 1997. TRANCE (tumor necrosis factor
[TNF]-related activation-induced cytokine), a new TNF family member
predominantly expressed in T cells, is a dendritic cell-specific
survival factor. Journal of Experimental Medicine
186:2075-2080.
[0144] Wong, C. P., C. Y. Okada, and R. Levy. 1999. TCR vaccines
against T cell lymphoma: QS-21 and IL-12 adjuvants induce a
protective CD8+ T cell response. Journal of Immunology
162:2251-2258.
[0145] Zipp, F., R. Martin, R. Lichtenfels, W. Roth, J. Dichgans,
P. H. Krammer, and M. Weller. 1997. Human autoreactive and foreign
antigen-specific T cells resist apoptosis induced by soluble
recombinant CD95 ligand. Journal of Immunology 159:2108-2115.
Sequence CWU 1
1
2211552DNAArtificial SequenceMurine surfactant protein D (without
the CRD) fused to the extracellular portion of human CD40L
1gctagcgaat tccaccagga agcaatctga c atg ctg ccc ttt ctc tcc atg
52Met Leu Pro Phe Leu Ser Met1 5ctt gtc ttg ctt gta cag ccc ctg gga
aat ctg gga gca gaa atg aag 100Leu Val Leu Leu Val Gln Pro Leu Gly
Asn Leu Gly Ala Glu Met Lys 10 15 20agc ctc tcg cag aga tca gta ccc
aac acc tgc acc cta gtc atg tgt 148Ser Leu Ser Gln Arg Ser Val Pro
Asn Thr Cys Thr Leu Val Met Cys 25 30 35agc cca aca gag aat ggc ctg
cct ggt cgt gat gga cgg gat ggg aga 196Ser Pro Thr Glu Asn Gly Leu
Pro Gly Arg Asp Gly Arg Asp Gly Arg40 45 50 55gaa ggt cca cgg ggt
gag aag ggt gat cca ggt ttg cca gga cct atg 244Glu Gly Pro Arg Gly
Glu Lys Gly Asp Pro Gly Leu Pro Gly Pro Met 60 65 70ggg ctc tca ggg
ttg cag ggc cct aca ggt cca gtt gga ccc aaa gga 292Gly Leu Ser Gly
Leu Gln Gly Pro Thr Gly Pro Val Gly Pro Lys Gly 75 80 85gag aat ggc
tct gct ggc gaa cct gga cca aag gga gaa cgt gga cta 340Glu Asn Gly
Ser Ala Gly Glu Pro Gly Pro Lys Gly Glu Arg Gly Leu 90 95 100agt
gga cct cca gga ctt cca ggt att cct ggt cca gct ggg aaa gaa 388Ser
Gly Pro Pro Gly Leu Pro Gly Ile Pro Gly Pro Ala Gly Lys Glu 105 110
115ggt ccc tct ggg aag cag ggg aac ata gga cct caa ggc aaa cca ggt
436Gly Pro Ser Gly Lys Gln Gly Asn Ile Gly Pro Gln Gly Lys Pro
Gly120 125 130 135cct aaa gga gag gct ggg ccc aaa gga gaa gta ggt
gct cct ggc atg 484Pro Lys Gly Glu Ala Gly Pro Lys Gly Glu Val Gly
Ala Pro Gly Met 140 145 150caa gga tct aca ggg gca aaa ggc tcc aca
ggc ccc aag gga gaa aga 532Gln Gly Ser Thr Gly Ala Lys Gly Ser Thr
Gly Pro Lys Gly Glu Arg 155 160 165ggt gcc cct ggt gtg caa gga gcc
cca ggg aat gct gga gca gca gga 580Gly Ala Pro Gly Val Gln Gly Ala
Pro Gly Asn Ala Gly Ala Ala Gly 170 175 180cct gcc gga cct gcc ggt
cca cag gga gct cca ggt tcc agg ggg ccc 628Pro Ala Gly Pro Ala Gly
Pro Gln Gly Ala Pro Gly Ser Arg Gly Pro 185 190 195cca gga ctc aag
ggg gac aga ggt gtt cct gga gac aga gga atc aaa 676Pro Gly Leu Lys
Gly Asp Arg Gly Val Pro Gly Asp Arg Gly Ile Lys200 205 210 215ggt
gaa agc ggg ctt cca gac agt gct gct ctg agg cag cag atg gag 724Gly
Glu Ser Gly Leu Pro Asp Ser Ala Ala Leu Arg Gln Gln Met Glu 220 225
230gcc tta aaa gga aaa cta cag cgt cta gag gtt gcc ttc tcc cac tat
772Ala Leu Lys Gly Lys Leu Gln Arg Leu Glu Val Ala Phe Ser His Tyr
235 240 245cag aaa gct gca ttg ttc cct gat ggc cat aga agg ttg gac
aag ata 820Gln Lys Ala Ala Leu Phe Pro Asp Gly His Arg Arg Leu Asp
Lys Ile 250 255 260gaa gat gaa agg aat ctt cat gaa gat ttt gta ttc
atg aaa acg ata 868Glu Asp Glu Arg Asn Leu His Glu Asp Phe Val Phe
Met Lys Thr Ile 265 270 275cag aga tgc aac aca gga gaa aga tcc tta
tcc tta ctg aac tgt gag 916Gln Arg Cys Asn Thr Gly Glu Arg Ser Leu
Ser Leu Leu Asn Cys Glu280 285 290 295gag att aaa agc cag ttt gaa
ggc ttt gtg aag gat ata atg tta aac 964Glu Ile Lys Ser Gln Phe Glu
Gly Phe Val Lys Asp Ile Met Leu Asn 300 305 310aaa gag gag acg aag
aaa gaa aac agc ttt gaa atg caa aaa ggt gat 1012Lys Glu Glu Thr Lys
Lys Glu Asn Ser Phe Glu Met Gln Lys Gly Asp 315 320 325cag aat cct
caa att gcg gca cat gtc ata agt gag gcc agc agt aaa 1060Gln Asn Pro
Gln Ile Ala Ala His Val Ile Ser Glu Ala Ser Ser Lys 330 335 340aca
aca tct gtg tta cag tgg gct gaa aaa gga tac tac acc atg agc 1108Thr
Thr Ser Val Leu Gln Trp Ala Glu Lys Gly Tyr Tyr Thr Met Ser 345 350
355aac aac ttg gta acc ctg gaa aat ggg aaa cag ctg acc gtt aaa aga
1156Asn Asn Leu Val Thr Leu Glu Asn Gly Lys Gln Leu Thr Val Lys
Arg360 365 370 375caa gga ctc tat tat atc tat gcc caa gtc acc ttc
tgt tcc aat cgg 1204Gln Gly Leu Tyr Tyr Ile Tyr Ala Gln Val Thr Phe
Cys Ser Asn Arg 380 385 390gaa gct tcg agt caa gct cca ttt ata gcc
agc ctc tgc cta aag tcc 1252Glu Ala Ser Ser Gln Ala Pro Phe Ile Ala
Ser Leu Cys Leu Lys Ser 395 400 405ccc ggt aga ttc gag aga atc tta
ctc aga gct gca aat acc cac agt 1300Pro Gly Arg Phe Glu Arg Ile Leu
Leu Arg Ala Ala Asn Thr His Ser 410 415 420tcc gcc aaa cct tgc ggg
caa caa tcc att cac ttg gga gga gta ttt 1348Ser Ala Lys Pro Cys Gly
Gln Gln Ser Ile His Leu Gly Gly Val Phe 425 430 435gaa ttg caa cca
ggt gct tcg gtg ttt gtc aat gtg act gat cca agc 1396Glu Leu Gln Pro
Gly Ala Ser Val Phe Val Asn Val Thr Asp Pro Ser440 445 450 455caa
gtg agc cat ggc act ggc ttc acg tcc ttt ggc tta ctc aaa ctc 1444Gln
Val Ser His Gly Thr Gly Phe Thr Ser Phe Gly Leu Leu Lys Leu 460 465
470tgaacagtgt caccttgcag gctgtggtgg agctgacgct gggagtcttc
ataatacagc 1504acaggcttaa gcccaattat acactccaag gcatgtagaa ctggtacc
15522471PRTArtificial SequenceSynthetic Construct 2Met Leu Pro Phe
Leu Ser Met Leu Val Leu Leu Val Gln Pro Leu Gly1 5 10 15Asn Leu Gly
Ala Glu Met Lys Ser Leu Ser Gln Arg Ser Val Pro Asn 20 25 30Thr Cys
Thr Leu Val Met Cys Ser Pro Thr Glu Asn Gly Leu Pro Gly 35 40 45Arg
Asp Gly Arg Asp Gly Arg Glu Gly Pro Arg Gly Glu Lys Gly Asp 50 55
60Pro Gly Leu Pro Gly Pro Met Gly Leu Ser Gly Leu Gln Gly Pro Thr65
70 75 80Gly Pro Val Gly Pro Lys Gly Glu Asn Gly Ser Ala Gly Glu Pro
Gly 85 90 95Pro Lys Gly Glu Arg Gly Leu Ser Gly Pro Pro Gly Leu Pro
Gly Ile 100 105 110Pro Gly Pro Ala Gly Lys Glu Gly Pro Ser Gly Lys
Gln Gly Asn Ile 115 120 125Gly Pro Gln Gly Lys Pro Gly Pro Lys Gly
Glu Ala Gly Pro Lys Gly 130 135 140Glu Val Gly Ala Pro Gly Met Gln
Gly Ser Thr Gly Ala Lys Gly Ser145 150 155 160Thr Gly Pro Lys Gly
Glu Arg Gly Ala Pro Gly Val Gln Gly Ala Pro 165 170 175Gly Asn Ala
Gly Ala Ala Gly Pro Ala Gly Pro Ala Gly Pro Gln Gly 180 185 190Ala
Pro Gly Ser Arg Gly Pro Pro Gly Leu Lys Gly Asp Arg Gly Val 195 200
205Pro Gly Asp Arg Gly Ile Lys Gly Glu Ser Gly Leu Pro Asp Ser Ala
210 215 220Ala Leu Arg Gln Gln Met Glu Ala Leu Lys Gly Lys Leu Gln
Arg Leu225 230 235 240Glu Val Ala Phe Ser His Tyr Gln Lys Ala Ala
Leu Phe Pro Asp Gly 245 250 255His Arg Arg Leu Asp Lys Ile Glu Asp
Glu Arg Asn Leu His Glu Asp 260 265 270Phe Val Phe Met Lys Thr Ile
Gln Arg Cys Asn Thr Gly Glu Arg Ser 275 280 285Leu Ser Leu Leu Asn
Cys Glu Glu Ile Lys Ser Gln Phe Glu Gly Phe 290 295 300Val Lys Asp
Ile Met Leu Asn Lys Glu Glu Thr Lys Lys Glu Asn Ser305 310 315
320Phe Glu Met Gln Lys Gly Asp Gln Asn Pro Gln Ile Ala Ala His Val
325 330 335Ile Ser Glu Ala Ser Ser Lys Thr Thr Ser Val Leu Gln Trp
Ala Glu 340 345 350Lys Gly Tyr Tyr Thr Met Ser Asn Asn Leu Val Thr
Leu Glu Asn Gly 355 360 365Lys Gln Leu Thr Val Lys Arg Gln Gly Leu
Tyr Tyr Ile Tyr Ala Gln 370 375 380Val Thr Phe Cys Ser Asn Arg Glu
Ala Ser Ser Gln Ala Pro Phe Ile385 390 395 400Ala Ser Leu Cys Leu
Lys Ser Pro Gly Arg Phe Glu Arg Ile Leu Leu 405 410 415Arg Ala Ala
Asn Thr His Ser Ser Ala Lys Pro Cys Gly Gln Gln Ser 420 425 430Ile
His Leu Gly Gly Val Phe Glu Leu Gln Pro Gly Ala Ser Val Phe 435 440
445Val Asn Val Thr Asp Pro Ser Gln Val Ser His Gly Thr Gly Phe Thr
450 455 460Ser Phe Gly Leu Leu Lys Leu465 47031574DNAArtificial
SequenceMurine surfactant protein D (except CRD) fused to the
extracellular domain of murine RANKL/TRANCE 3gctagcgaat tccaccagga
agcaatctga c atg ctg ccc ttt ctc tcc atg 52Met Leu Pro Phe Leu Ser
Met1 5ctt gtc ttg ctt gta cag ccc ctg gga aat ctg gga gca gaa atg
aag 100Leu Val Leu Leu Val Gln Pro Leu Gly Asn Leu Gly Ala Glu Met
Lys 10 15 20agc ctc tcg cag aga tca gta ccc aac acc tgc acc cta gtc
atg tgt 148Ser Leu Ser Gln Arg Ser Val Pro Asn Thr Cys Thr Leu Val
Met Cys 25 30 35agc cca aca gag aat ggc ctg cct ggt cgt gat gga cgg
gat ggg aga 196Ser Pro Thr Glu Asn Gly Leu Pro Gly Arg Asp Gly Arg
Asp Gly Arg40 45 50 55gaa ggt cca cgg ggt gag aag ggt gat cca ggt
ttg cca gga cct atg 244Glu Gly Pro Arg Gly Glu Lys Gly Asp Pro Gly
Leu Pro Gly Pro Met 60 65 70ggg ctc tca ggg ttg cag ggc cct aca ggt
cca gtt gga ccc aaa gga 292Gly Leu Ser Gly Leu Gln Gly Pro Thr Gly
Pro Val Gly Pro Lys Gly 75 80 85gag aat ggc tct gct ggc gaa cct gga
cca aag gga gaa cgt gga cta 340Glu Asn Gly Ser Ala Gly Glu Pro Gly
Pro Lys Gly Glu Arg Gly Leu 90 95 100agt gga cct cca gga ctt cca
ggt att cct ggt cca gct ggg aaa gaa 388Ser Gly Pro Pro Gly Leu Pro
Gly Ile Pro Gly Pro Ala Gly Lys Glu 105 110 115ggt ccc tct ggg aag
cag ggg aac ata gga cct caa ggc aaa cca ggt 436Gly Pro Ser Gly Lys
Gln Gly Asn Ile Gly Pro Gln Gly Lys Pro Gly120 125 130 135cct aaa
gga gag gct ggg ccc aaa gga gaa gta ggt gct cct ggc atg 484Pro Lys
Gly Glu Ala Gly Pro Lys Gly Glu Val Gly Ala Pro Gly Met 140 145
150caa gga tct aca ggg gca aaa ggc tcc aca ggc ccc aag gga gaa aga
532Gln Gly Ser Thr Gly Ala Lys Gly Ser Thr Gly Pro Lys Gly Glu Arg
155 160 165ggt gcc cct ggt gtg caa gga gcc cca ggg aat gct gga gca
gca gga 580Gly Ala Pro Gly Val Gln Gly Ala Pro Gly Asn Ala Gly Ala
Ala Gly 170 175 180cct gcc gga cct gcc ggt cca cag gga gct cca ggt
tcc agg ggg ccc 628Pro Ala Gly Pro Ala Gly Pro Gln Gly Ala Pro Gly
Ser Arg Gly Pro 185 190 195cca gga ctc aag ggg gac aga ggt gtt cct
gga gac aga gga atc aaa 676Pro Gly Leu Lys Gly Asp Arg Gly Val Pro
Gly Asp Arg Gly Ile Lys200 205 210 215ggt gaa agc ggg ctt cca gac
agt gct gct ctg agg cag cag atg gag 724Gly Glu Ser Gly Leu Pro Asp
Ser Ala Ala Leu Arg Gln Gln Met Glu 220 225 230gcc tta aaa gga aaa
cta cag cgt cta gag gtt gcc ttc tcc cac tat 772Ala Leu Lys Gly Lys
Leu Gln Arg Leu Glu Val Ala Phe Ser His Tyr 235 240 245cag aaa gct
gca ttg ttc cct gat gga cga gcg cag atg gat cct aac 820Gln Lys Ala
Ala Leu Phe Pro Asp Gly Arg Ala Gln Met Asp Pro Asn 250 255 260aga
ata tca gaa gac agc act cac tgc ttt tat aga atc ctg aga ctc 868Arg
Ile Ser Glu Asp Ser Thr His Cys Phe Tyr Arg Ile Leu Arg Leu 265 270
275cat gaa aac gca ggt ttg cag gac tcg act ctg gag agt gaa gac aca
916His Glu Asn Ala Gly Leu Gln Asp Ser Thr Leu Glu Ser Glu Asp
Thr280 285 290 295cta cct gac tcc tgc agg agg atg aaa caa gcc ttt
cag ggg gcc gtg 964Leu Pro Asp Ser Cys Arg Arg Met Lys Gln Ala Phe
Gln Gly Ala Val 300 305 310cag aag gaa ctg caa cac att gtg ggg cca
cag cgc ttc tca gga gct 1012Gln Lys Glu Leu Gln His Ile Val Gly Pro
Gln Arg Phe Ser Gly Ala 315 320 325cca gct atg atg gaa ggc tca tgg
ttg gat gtg gcc cag cga ggc aag 1060Pro Ala Met Met Glu Gly Ser Trp
Leu Asp Val Ala Gln Arg Gly Lys 330 335 340cct gag gcc cag cca ttt
gca cac ctc acc atc aat gct gcc agc atc 1108Pro Glu Ala Gln Pro Phe
Ala His Leu Thr Ile Asn Ala Ala Ser Ile 345 350 355cca tcg ggt tcc
cat aaa gtc act ctg tcc tct tgg tac cac gat cga 1156Pro Ser Gly Ser
His Lys Val Thr Leu Ser Ser Trp Tyr His Asp Arg360 365 370 375ggc
tgg gcc aag atc tct aac atg acg tta agc aac gga aaa cta agg 1204Gly
Trp Ala Lys Ile Ser Asn Met Thr Leu Ser Asn Gly Lys Leu Arg 380 385
390gtt aac caa gat ggc ttc tat tac ctg tac gcc aac att tgc ttt cgg
1252Val Asn Gln Asp Gly Phe Tyr Tyr Leu Tyr Ala Asn Ile Cys Phe Arg
395 400 405cat cat gaa aca tcg gga agc gta cct aca gac tat ctt cag
ctg atg 1300His His Glu Thr Ser Gly Ser Val Pro Thr Asp Tyr Leu Gln
Leu Met 410 415 420gtg tat gtc gtt aaa acc agc atc aaa atc cca agt
tct cat aac ctg 1348Val Tyr Val Val Lys Thr Ser Ile Lys Ile Pro Ser
Ser His Asn Leu 425 430 435atg aaa gga ggg agc acg aaa aac tgg tcg
ggc aat tct gaa ttc cac 1396Met Lys Gly Gly Ser Thr Lys Asn Trp Ser
Gly Asn Ser Glu Phe His440 445 450 455ttt tat tcc ata aat gtt ggg
gga ttt ttc aag ctc cga gct ggt gaa 1444Phe Tyr Ser Ile Asn Val Gly
Gly Phe Phe Lys Leu Arg Ala Gly Glu 460 465 470gaa att agc att cag
gtg tcc aac cct tcc ctg ctg gat ccg gat caa 1492Glu Ile Ser Ile Gln
Val Ser Asn Pro Ser Leu Leu Asp Pro Asp Gln 475 480 485gat gcg acg
tac ttt ggg gct ttc aaa gtt cag gac ata gac 1534Asp Ala Thr Tyr Phe
Gly Ala Phe Lys Val Gln Asp Ile Asp 490 495 500tgagactcat
ttcgtggaac attagcggcc gctaaactat 15744501PRTArtificial
SequenceSynthetic Construct 4Met Leu Pro Phe Leu Ser Met Leu Val
Leu Leu Val Gln Pro Leu Gly1 5 10 15Asn Leu Gly Ala Glu Met Lys Ser
Leu Ser Gln Arg Ser Val Pro Asn 20 25 30Thr Cys Thr Leu Val Met Cys
Ser Pro Thr Glu Asn Gly Leu Pro Gly 35 40 45Arg Asp Gly Arg Asp Gly
Arg Glu Gly Pro Arg Gly Glu Lys Gly Asp 50 55 60Pro Gly Leu Pro Gly
Pro Met Gly Leu Ser Gly Leu Gln Gly Pro Thr65 70 75 80Gly Pro Val
Gly Pro Lys Gly Glu Asn Gly Ser Ala Gly Glu Pro Gly 85 90 95Pro Lys
Gly Glu Arg Gly Leu Ser Gly Pro Pro Gly Leu Pro Gly Ile 100 105
110Pro Gly Pro Ala Gly Lys Glu Gly Pro Ser Gly Lys Gln Gly Asn Ile
115 120 125Gly Pro Gln Gly Lys Pro Gly Pro Lys Gly Glu Ala Gly Pro
Lys Gly 130 135 140Glu Val Gly Ala Pro Gly Met Gln Gly Ser Thr Gly
Ala Lys Gly Ser145 150 155 160Thr Gly Pro Lys Gly Glu Arg Gly Ala
Pro Gly Val Gln Gly Ala Pro 165 170 175Gly Asn Ala Gly Ala Ala Gly
Pro Ala Gly Pro Ala Gly Pro Gln Gly 180 185 190Ala Pro Gly Ser Arg
Gly Pro Pro Gly Leu Lys Gly Asp Arg Gly Val 195 200 205Pro Gly Asp
Arg Gly Ile Lys Gly Glu Ser Gly Leu Pro Asp Ser Ala 210 215 220Ala
Leu Arg Gln Gln Met Glu Ala Leu Lys Gly Lys Leu Gln Arg Leu225 230
235 240Glu Val Ala Phe Ser His Tyr Gln Lys Ala Ala Leu Phe Pro Asp
Gly 245 250 255Arg Ala Gln Met Asp Pro Asn Arg Ile Ser Glu Asp Ser
Thr His Cys 260 265 270Phe Tyr Arg Ile Leu Arg Leu His Glu Asn Ala
Gly Leu Gln Asp Ser 275 280 285Thr Leu Glu Ser Glu Asp Thr Leu Pro
Asp Ser Cys Arg Arg Met Lys 290 295 300Gln Ala Phe Gln Gly Ala Val
Gln Lys Glu Leu Gln His Ile Val Gly305 310 315 320Pro Gln Arg Phe
Ser Gly Ala Pro Ala Met Met Glu Gly Ser Trp Leu 325 330 335Asp Val
Ala Gln Arg Gly Lys Pro Glu Ala Gln Pro Phe Ala His Leu 340 345
350Thr Ile Asn Ala Ala Ser Ile Pro Ser Gly Ser His Lys Val Thr Leu
355 360 365Ser Ser Trp Tyr His Asp Arg Gly Trp Ala Lys Ile Ser Asn
Met Thr 370 375 380Leu Ser Asn Gly Lys Leu Arg Val Asn Gln Asp Gly
Phe Tyr Tyr Leu385 390 395 400Tyr Ala Asn Ile Cys Phe Arg His His
Glu Thr Ser Gly Ser Val Pro 405 410 415Thr Asp Tyr Leu Gln Leu Met
Val Tyr Val Val Lys Thr Ser Ile Lys 420 425 430Ile Pro Ser Ser His
Asn Leu Met Lys Gly Gly Ser Thr Lys Asn Trp 435 440 445Ser Gly Asn
Ser Glu Phe His Phe Tyr Ser Ile Asn Val Gly Gly Phe 450 455 460Phe
Lys Leu Arg Ala Gly Glu Glu Ile Ser Ile Gln Val Ser Asn Pro465 470
475 480Ser Leu Leu Asp Pro Asp Gln Asp Ala Thr Tyr Phe Gly Ala Phe
Lys 485 490 495Val Gln Asp Ile Asp 50051477DNAArtificial
SequenceMurine surfactant protein D (except CRD) fused to the
extracellular domain of murine CD40 ligand 5gctagcgaat tccaccagga
agcaatctga c atg ctg ccc ttt ctc tcc atg 52Met Leu Pro Phe Leu Ser
Met1 5ctt gtc ttg ctt gta cag ccc ctg gga aat ctg gga gca gaa atg
aag 100Leu Val Leu Leu Val Gln Pro Leu Gly Asn Leu Gly Ala Glu Met
Lys 10 15 20agc ctc tcg cag aga tca gta ccc aac acc tgc acc cta gtc
atg tgt 148Ser Leu Ser Gln Arg Ser Val Pro Asn Thr Cys Thr Leu Val
Met Cys 25 30 35agc cca aca gag aat ggc ctg cct ggt cgt gat gga cgg
gat ggg aga 196Ser Pro Thr Glu Asn Gly Leu Pro Gly Arg Asp Gly Arg
Asp Gly Arg40 45 50 55gaa ggt cca cgg ggt gag aag ggt gat cca ggt
ttg cca gga cct atg 244Glu Gly Pro Arg Gly Glu Lys Gly Asp Pro Gly
Leu Pro Gly Pro Met 60 65 70ggg ctc tca ggg ttg cag ggc cct aca ggt
cca gtt gga ccc aaa gga 292Gly Leu Ser Gly Leu Gln Gly Pro Thr Gly
Pro Val Gly Pro Lys Gly 75 80 85gag aat ggc tct gct ggc gaa cct gga
cca aag gga gaa cgt gga cta 340Glu Asn Gly Ser Ala Gly Glu Pro Gly
Pro Lys Gly Glu Arg Gly Leu 90 95 100agt gga cct cca gga ctt cca
ggt att cct ggt cca gct ggg aaa gaa 388Ser Gly Pro Pro Gly Leu Pro
Gly Ile Pro Gly Pro Ala Gly Lys Glu 105 110 115ggt ccc tct ggg aag
cag ggg aac ata gga cct caa ggc aaa cca ggt 436Gly Pro Ser Gly Lys
Gln Gly Asn Ile Gly Pro Gln Gly Lys Pro Gly120 125 130 135cct aaa
gga gag gct ggg ccc aaa gga gaa gta ggt gct cct ggc atg 484Pro Lys
Gly Glu Ala Gly Pro Lys Gly Glu Val Gly Ala Pro Gly Met 140 145
150caa gga tct aca ggg gca aaa ggc tcc aca ggc ccc aag gga gaa aga
532Gln Gly Ser Thr Gly Ala Lys Gly Ser Thr Gly Pro Lys Gly Glu Arg
155 160 165ggt gcc cct ggt gtg caa gga gcc cca ggg aat gct gga gca
gca gga 580Gly Ala Pro Gly Val Gln Gly Ala Pro Gly Asn Ala Gly Ala
Ala Gly 170 175 180cct gcc gga cct gcc ggt cca cag gga gct cca ggt
tcc agg ggg ccc 628Pro Ala Gly Pro Ala Gly Pro Gln Gly Ala Pro Gly
Ser Arg Gly Pro 185 190 195cca gga ctc aag ggg gac aga ggt gtt cct
gga gac aga gga atc aaa 676Pro Gly Leu Lys Gly Asp Arg Gly Val Pro
Gly Asp Arg Gly Ile Lys200 205 210 215ggt gaa agc ggg ctt cca gac
agt gct gct ctg agg cag cag atg gag 724Gly Glu Ser Gly Leu Pro Asp
Ser Ala Ala Leu Arg Gln Gln Met Glu 220 225 230gcc tta aaa gga aaa
cta cag cgt cta gag gtt gcc ttc tcc cac tat 772Ala Leu Lys Gly Lys
Leu Gln Arg Leu Glu Val Ala Phe Ser His Tyr 235 240 245cag aaa gct
gca ttg ttc cct gat ggc cat aga aga ttg gat aag gtc 820Gln Lys Ala
Ala Leu Phe Pro Asp Gly His Arg Arg Leu Asp Lys Val 250 255 260gaa
gag gaa gta aac ctt cat gaa gat ttt gta ttc ata aaa aag cta 868Glu
Glu Glu Val Asn Leu His Glu Asp Phe Val Phe Ile Lys Lys Leu 265 270
275aag aga tgc aac aaa gga gaa gga tct tta tcc ttg ctg aac tgt gag
916Lys Arg Cys Asn Lys Gly Glu Gly Ser Leu Ser Leu Leu Asn Cys
Glu280 285 290 295gag atg aga agg caa ttt gaa gac ctt gtc aag gat
ata acg tta aac 964Glu Met Arg Arg Gln Phe Glu Asp Leu Val Lys Asp
Ile Thr Leu Asn 300 305 310aaa gaa gag aaa aaa gaa aac agc ttt gaa
atg caa aga ggt gat gag 1012Lys Glu Glu Lys Lys Glu Asn Ser Phe Glu
Met Gln Arg Gly Asp Glu 315 320 325gat cct caa att gca gca cac gtt
gta agc gaa gcc aac agt aat gca 1060Asp Pro Gln Ile Ala Ala His Val
Val Ser Glu Ala Asn Ser Asn Ala 330 335 340gca tcc gtt cta cag tgg
gcc aag aaa gga tat tat acc atg aaa agc 1108Ala Ser Val Leu Gln Trp
Ala Lys Lys Gly Tyr Tyr Thr Met Lys Ser 345 350 355aac ttg gta atg
ctt gaa aat ggg aaa cag ctg acg gtt aaa aga gaa 1156Asn Leu Val Met
Leu Glu Asn Gly Lys Gln Leu Thr Val Lys Arg Glu360 365 370 375gga
ctc tat tat gtc tac act caa gtc acc ttc tgc tct aat cgg gag 1204Gly
Leu Tyr Tyr Val Tyr Thr Gln Val Thr Phe Cys Ser Asn Arg Glu 380 385
390cct tcg agt caa cgc cca ttc atc gtc ggc ctc tgg ctg aag ccc agc
1252Pro Ser Ser Gln Arg Pro Phe Ile Val Gly Leu Trp Leu Lys Pro Ser
395 400 405att gga tct gag aga atc tta ctc aag gcg gca aat acc cac
agt tcc 1300Ile Gly Ser Glu Arg Ile Leu Leu Lys Ala Ala Asn Thr His
Ser Ser 410 415 420tcc cag ctt tgc gag cag cag tct gtt cac ttg ggc
gga gtg ttt gaa 1348Ser Gln Leu Cys Glu Gln Gln Ser Val His Leu Gly
Gly Val Phe Glu 425 430 435tta caa gct ggt gct tct gtg ttt gtc aac
gtg act gaa gca agc caa 1396Leu Gln Ala Gly Ala Ser Val Phe Val Asn
Val Thr Glu Ala Ser Gln440 445 450 455gtg atc cac aga gtt ggc ttc
tca tct ttt ggc tta ctc aaa ctc 1441Val Ile His Arg Val Gly Phe Ser
Ser Phe Gly Leu Leu Lys Leu 460 465 470tgaacagtgc gctgtcctag
gctgcagcag ggtacc 14776470PRTArtificial SequenceSynthetic Construct
6Met Leu Pro Phe Leu Ser Met Leu Val Leu Leu Val Gln Pro Leu Gly1 5
10 15Asn Leu Gly Ala Glu Met Lys Ser Leu Ser Gln Arg Ser Val Pro
Asn 20 25 30Thr Cys Thr Leu Val Met Cys Ser Pro Thr Glu Asn Gly Leu
Pro Gly 35 40 45Arg Asp Gly Arg Asp Gly Arg Glu Gly Pro Arg Gly Glu
Lys Gly Asp 50 55 60Pro Gly Leu Pro Gly Pro Met Gly Leu Ser Gly Leu
Gln Gly Pro Thr65 70 75 80Gly Pro Val Gly Pro Lys Gly Glu Asn Gly
Ser Ala Gly Glu Pro Gly 85 90 95Pro Lys Gly Glu Arg Gly Leu Ser Gly
Pro Pro Gly Leu Pro Gly Ile 100 105 110Pro Gly Pro Ala Gly Lys Glu
Gly Pro Ser Gly Lys Gln Gly Asn Ile 115 120 125Gly Pro Gln Gly Lys
Pro Gly Pro Lys Gly Glu Ala Gly Pro Lys Gly 130 135 140Glu Val Gly
Ala Pro Gly Met Gln Gly Ser Thr Gly Ala Lys Gly Ser145 150 155
160Thr Gly Pro Lys Gly Glu Arg Gly Ala Pro Gly Val Gln Gly Ala Pro
165 170 175Gly Asn Ala Gly Ala Ala Gly Pro Ala Gly Pro Ala Gly Pro
Gln Gly 180 185 190Ala Pro Gly Ser Arg Gly Pro Pro Gly Leu Lys Gly
Asp Arg Gly Val 195 200 205Pro Gly Asp Arg Gly Ile Lys Gly Glu Ser
Gly Leu Pro Asp Ser Ala 210 215 220Ala Leu Arg Gln Gln Met Glu Ala
Leu Lys Gly Lys Leu Gln Arg Leu225 230 235 240Glu Val Ala Phe Ser
His Tyr Gln Lys Ala Ala Leu Phe Pro Asp Gly 245 250 255His Arg Arg
Leu Asp Lys Val Glu Glu Glu Val Asn Leu His Glu Asp 260 265 270Phe
Val Phe Ile Lys Lys Leu Lys Arg Cys Asn Lys Gly Glu Gly Ser 275 280
285Leu Ser Leu Leu Asn Cys Glu Glu Met Arg Arg Gln Phe Glu Asp Leu
290 295 300Val Lys Asp Ile Thr Leu Asn Lys Glu Glu Lys Lys Glu Asn
Ser Phe305 310 315 320Glu Met Gln Arg Gly Asp Glu Asp Pro Gln Ile
Ala Ala His Val Val 325 330 335Ser Glu Ala Asn Ser Asn Ala Ala Ser
Val Leu Gln Trp Ala Lys Lys 340 345 350Gly Tyr Tyr Thr Met Lys Ser
Asn Leu Val Met Leu Glu Asn Gly Lys 355 360 365Gln Leu Thr Val Lys
Arg Glu Gly Leu Tyr Tyr Val Tyr Thr Gln Val 370 375 380Thr Phe Cys
Ser Asn Arg Glu Pro Ser Ser Gln Arg Pro Phe Ile Val385 390 395
400Gly Leu Trp Leu Lys Pro Ser Ile Gly Ser Glu Arg Ile Leu Leu Lys
405 410 415Ala Ala Asn Thr His Ser Ser Ser Gln Leu Cys Glu Gln Gln
Ser Val 420 425 430His Leu Gly Gly Val Phe Glu Leu Gln Ala Gly Ala
Ser Val Phe Val 435 440 445Asn Val Thr Glu Ala Ser Gln Val Ile His
Arg Val Gly Phe Ser Ser 450 455 460Phe Gly Leu Leu Lys Leu465
470727DNAArtificial sequencePCR primer 7ctgacatgct gccctttctc
tccatgc 27829DNAArtificial sequencePCR primer 8ggaggccagc
tgtcctccag cctgtttgc 29956DNAArtificial sequencePCR primer
9ggggctagcg aattccacca ggaagcaatc tgacatgctg ccctttctct ccatgc
561048DNAArtificial sequencePCR primer 10tctatcttgt ccaaccttct
atggccatca gggaacaatg cagctttc 481149DNAArtificial sequencePCR
primer 11aaagctgcat tgttccctga tggccataga aggttggaca agatagaag
491241DNAArtificial sequencePCR primer 12gggctcgagg taccagttct
acatgccttg gagtgtataa t 411350DNAArtificial sequencePCR primer
13gaaagctgca ttgttccctg atggccatag aagattggat aaggtcgaag
501450DNAArtificial sequencePCR primer 14cttcgacctt atccaatctt
ctatggccat cagggaacaa tgcagctttc 501534DNAArtificial sequencePCR
primer 15ggggggtacc ctgctgcagc ctaggacagc gcac 341616PRTArtificial
sequenceFusion segment of SPD and CD40L sequence region 16Lys Ala
Ala Leu Phe Pro Asp Gly His Arg Arg Leu Asp Lys Ile Glu1 5 10
151716PRTArtificial sequenceFusion segment of SPD and murine CD40L
sequence region 17Lys Ala Ala Leu Phe Pro Asp Gly His Arg Arg Leu
Asp Lys Val Glu1 5 10 151819DNAArtificial sequencePCR primer
18catgttcctg gccctcctc 191922DNAArtificial sequencePCR primer
19gtacaggctc aagagagagg gc 222026DNAArtificial sequencePCR primer
20atactcgagc gcagatggat cctaac 262138DNAArtificial sequencePCR
primer 21ggggtttagc ggccgctaat gttccacgaa atgagttc
382216PRTArtificial sequenceFusion sequence of SPD and RANKL/TRANCE
sequence region 22Lys Ala Ala Leu Phe Pro Asp Gly Arg Ala Gln Met
Asp Pro Asn Arg1 5 10 15
* * * * *