Chimeric immunoreceptor useful in treating human cancers

Abstract

The present invention relates to chimeric transmembrane immunoreceptors, named "zetakines," comprised of an extracellular domain comprising a soluble receptor ligand linked to a support region capable of tethering the extracellular domain to a cell surface, a transmembrane region and an intracellular signalling domain. Zetakines, when expressed on the surface of T lymphocytes, direct T cell activity to those specific cells expressing a receptor for which the soluble receptor ligand is specific. Zetakine chimeric immunoreceptors represent a novel extension of antibody-based immunoreceptors for redirecting the antigen specificity of T cells, with application to treatment of a variety of cancers, particularly via the autocrin/paracrine cytokine systems utilized by human malignancy. In a preferred embodiment is a glioma-specific immunoreceptor comprising the extracellular targetting domain of the IL-13R.alpha.2-specific IL-13 mutant IL-13(E13Y) linked to the Fc region of IgG, the transmembrane domain of human CD4, and the human CD3 zeta chain.

Description

[0001] This application is a continuation-in-part of prior co-pending application U.S. Ser. No. 11/274,344, filed Nov. 16, 2005, which is a continuation-in-part of application U.S. Ser. No. 10/134,645, filed Apr. 30, 2002, now abandoned, which claims the benefit of application U.S. 60/286,981, filed Apr. 30, 2001. This application also claims the benefit of application U.S. 61/091,915, filed Aug. 26, 2008. The disclosures of all of the above applications are hereby incorporated by reference in their entirety.

TECHNICAL FIELD

[0003] The invention relates to the field of biomedicine and specifically methods useful for cancer therapy. In particular, embodiments of the invention relate to methods for specific CTL immunotherapeutic strategies for cancer including the use of genetically-modified T lymphocytes expressing chimeric immunoreceptors in the treatment of human brain tumors and other cancers.

BACKGROUND OF THE INVENTION

[0004] Primary brain tumors are the third leading contributor to cancer-related mortality in young adults, are the second leading contributor in children, and appear to be increasing in incidence both in the pediatric and geriatric population.sup.1-4. Gliomas are the most common type of primary brain tumors; 20,000 cases are diagnosed and 14,000 glioma-related deaths occur annually in the United States.sup.5-8. Gliomas are heterogeneous with respect to their malignant behavior and, in their most common and aggressive forms, anaplastic astrocytoma (AA-grade III) and glioblastoma multiforme (GBM-grade IV), are rapidly progressive and nearly uniformly lethal.sup.9; 10. Currently available therapeutic modalities have minimal curative potential for these high-grade tumors and often exacerbate the already severe morbidities imposed by their location in the central nervous system. Thus patients with malignant glioma are often struck in the most productive period of their lives; frequent deterioration of mental faculties and a high case:fatality ratio contribute to the unique personal and social impact of these tumors.

[0005] The cornerstones of oncologic management of malignant glioma are resection and radiation therapy.sup.11-16. With modern surgical and radiotherapeutic techniques the mean duration of survival has increased to 82 weeks for glioblastoma multiforme and 275 weeks for anaplastic astrocytoma, although 5-year survival rates have only increased from 3 to 6% for glioblastoma multiforme and 12.1% for anaplastic astrocytoma.sup.6-8. The major prognostic indicators for prolonged survival are younger age (<40 yrs) and performance status (KPS score >70).sup.17. Resections of >90% of bulky tumors are usually attempted provided that vital functional anatomy is spared. When used in conjunction with post-operative radiation therapy, the impact of extent of resection on duration of survival is less clear.sup.18; 19. The addition of chemotherapy to resection and radiation provides only marginal survival advantage to patients with anaplastic astrocytoma or glioblastoma multiforme.sup.20-23. Nitrosureas alone or in combination with procarbazine and vincristine are the conventional drugs used in the community and appear to improve the 1-year and 2-year survival rates by 15% without impacting on the overall median survival.sup.24; 25. More aggressive regimens incorporating platinum-based drugs and topoisomerase inhibitors are under investigation.sup.26. The role of high-dose chemotherapy with stem cell rescue has not been substantiated to date.sup.27-29.

[0006] Approximately 80% of recurrent tumors arise from radiographically enhancing remnants of the original incompletely resected tumor.sup.10; 30; 31. Provided recurrences are unifocal and amenable in their location to aggressive re-resection, this approach can extend survival duration, particularly for patients with anaplastic astrocytoma and those glioblastoma multiforme patients with a KPS>70..sup.10 The median survival of recurrent glioblastoma multiforme patients treated with re-resection is 36 weeks.sup.10; 30; 31. Radiation therapy in the form of either brachytherapy or stereotactic radiosurgery may extend the duration of survival in re-resected recurrent glioblastoma multiforme patients by only 10-12 weeks.sup.32. The use of chemotherapy in the setting of recurrent disease should be in the context of available clinical trials, as its efficacy in this patient population is unsubstantiated.

[0007] The continued dismal prognosis of malignant glioma has prompted the clinical investigation of novel therapeutic entities, including, but not limited to: gene therapy (TK-suicide, antisense inhibition of tumor growth factor receptors, conditionally lethal viral vectors), immunotherapy (antibody, tumor cell vaccines, immunotoxins, adoptive transfer of activated lymphocytes), and anti-angiogenesis approaches.sup.33-40. The multiplicity of challenges faced in the development of effective adjuvant therapies for malignant glioma include the extensive infiltrative growth of tumor cells into normal brain parenchyma, the capacity of soluble factors elaborated from these tumors to attenuate the development of immune responses, and the difficulty of establishing clinically meaningful therapeutic ratios when administering therapeutics into the central nervous system (CNS). Early clinical evaluation of novel therapeutics is clearly indicated in this patient population.

[0008] Recently, receptors for transferrin and growth factors have been the subject of experimental glioma therapeutics utilizing ligands for these receptors conjugated to toxins or radionucleotides as a delivery system.sup.41. The specificity of this approach relies on the unique expression or over-expression of targeted receptors on glioma cells compared to normal brain. Interestingly, some receptor complexes for interleukins utilized by the immune system are expressed by gliomas, in particular high-affinity IL-13 receptors.sup.42-48. Unlike the IL-13 receptor trimolecular complex utilized by the immune system, which consists of the IL-13R.alpha.1, the IL-4R.beta., and .gamma.c, glioma cells overexpress a unique IL-13R.alpha.2 chain capable of binding IL-13 independently of the requirement for IL-4R.beta. or .gamma.c.sup.44; 49; 50. Like its homologue IL-4, IL-13 has pleotrophic immunoregulatory activity outside the CNS.sup.51-53. Both cytokines stimulate IgE production by B lymphocytes and suppress pro-inflammatory cytokine production by macrophages. The immunobiology of IL-13 within the CNS is largely unknown.

[0009] Detailed studies by Debinski et al. using autoradiography with radiolabeled IL-13 have demonstrated abundant IL-13 binding on nearly all malignant glioma tissues studied.sup.42; 45; 46; 48. Moreover, the binding is highly homogeneous within tumor sections and from single cell analysis.sup.46; 48. Scatchard analyses of IL-13 binding to human glioma cell lines reveals on average 17,000-28,000 binding sites/cell.sup.45. Molecular analysis using probes specific for IL-13R.alpha.2 mRNA fail to demonstrate expression of the glioma-specific receptor by normal brain elements in all CNS anatomic locations.sup.42; 43. Furthermore, autoradiography with radiolabeled IL-13 failed to demonstrate detectable specific IL-13 binding in the CNS, suggesting that the shared IL13R.alpha.1/IL-4.beta./.gamma.c receptor is also not expressed at detectable levels in the CNS.sup.46. These findings were independently verified using immunohistochemical techniques on non-pathologic brain sections with antibodies specific for IL-13R.alpha.1 and IL-4.beta..sup.54. Thus IL-13R.alpha.2 stands as the most specific and ubiquitously expressed cell-surface target for glioma described to date.

[0010] As a strategy to exploit the glioma-specific expression of IL-13R.alpha.2 in the CNS, molecular constructs of the IL-13 cytokine have been described that fuse various cytotoxins (Pseudomonas exotoxin and Diptheria toxin) to its carboxyl terminal.sup.55-58. Internalization of these toxins upon binding to IL-13 receptors is the basis of the selective toxicity of these fusion proteins. These toxins display potent cytotoxicity towards glioma cells in vitro at picomolar concentrations.sup.55. Human intracranial glioma xenografts in immunodeficient mice can be eliminated by intratumor injection of the IL-13-toxin fusion protein without observed toxicities.sup.55. These studies support the initiation of clinical investigation utilizing IL-13-directed immunotoxins loco-regionally for malignant glioma.

[0011] However, the binding of IL-13-based cytotoxins to the broadly expressed IL-13R.alpha.1/IL-4.beta./.gamma.c receptor complex has the potential of mediating untoward toxicities to normal tissues outside the CNS, and thus limits the systemic administration of these agents. IL-13 has been extensively dissected at the molecular level: structural domains of this cytokine that are important for associating with individual receptor subunits have been mapped.sup.55; 58 Consequently, selected amino acid substitutions in IL-13 have predictable effects on the association of this cytokine with its receptor subunits. Amino acid substitutions in IL-13's alpha helix A, in particular at amino acid 13, disrupt its ability to associate with IL-4.beta., thereby selectively reducing the affinity of IL-13 to the IL-13R.alpha.1/IL-4.beta./.gamma.c receptor by a factor of five.sup.55; 57; 58 Surprisingly, binding of mutant IL-13(E13Y) to IL-13R.alpha.2 was not only preserved but increased relative to wild-type IL-13 by 50-fold. Thus, minimally altered IL-13 analogs can simultaneously increase IL-13's specificity and affinity for glioma cells via selective binding to IL-13R.alpha.2 relative to normal tissues bearing IL-13R.alpha.1/IL-4.beta./.gamma.c receptors.

[0012] Malignant gliomas represent a clinical entity that is highly attractive for immunotherapeutic intervention since 1) most patients with resection and radiation therapy achieve a state of minimal disease burden and 2) the anatomic location of these tumors within the confines of the CNS make direct loco-regional administration of effector cells possible. At least two pathologic studies have demonstrated that the extent of perivascular lymphocytic infiltration in malignant gliomas correlates with an improved prognosis.sup.59-61. Animal model systems have established that glioma-specific T cells, but not lymphokine-activated killer (LAK) cells, can mediate the regression of intracerebrally implanted gliomas.sup.62-71. T cells, unlike LAK cells, have the capacity to infiltrate into brain parenchyma and thus can target infiltrating tumor cells that may be distant from the primary tumor. Despite these findings, there is a substantial body of evidence that gliomas actively subvert immune destruction, primarily by the elaboration of immunosuppressive cytokines (TGF-.beta.2) and prostaglandins, which, inhibit the induction/amplification of glioma-reactive T cell responses.sup.72-74. These findings have prompted the evaluation of ex vivo expanded anti-glioma effector cells for adoptive therapy as a strategy to overcome tumor-mediated limitations of generating responses in vivo.

[0013] At least ten pilot studies involving the administration of ex vivo activated lymphocytes to malignant glioma resection cavities have been reported to date.sup.75-85. Despite the variety of effector cell types (LAK, TILs, alloreactive CTLs), their heterogeneous composition/variability of composition from patient to patient, and the often modest in vitro reactivity of these effector cells towards glioma targets, these studies, in aggregate, report an approximate 50% response rate in patients with recurrent/refractory disease with anecdotal long-term survivors. These studies support the premise that a superior clinical effect of cellular immunotherapy for glioma might be expected with homogenous highly potent effector cells.

[0014] These pilot studies also report on the safety and tolerability of direct administration of ex vivo activated lymphocytes and interleukin-2 (IL-2), a T cell growth factor, into the resection cavity of patients with malignant glioma.sup.75; 76; 78; 82; 86-92 Even at large individual cell doses (>10.sup.9 cells/dose), as well as high cumulative cell doses (>27.times.10.sup.9 cells), toxicities are modest, and typically consist of grade II or less transient headache, nausea, vomiting and fever. As noted above, these studies also employed the co-administration of rhIL-2 to support the in vivo survival of transferred lymphocytes. Multiple doses given either concurrently with lymphocytes or sequentially after lymphocyte administration were tolerated at doses as high as 1.2.times.10.sup.6 IU/dose for 12-dose courses of IL-2 delivered every 48-hours.

[0015] Based on the findings outlined above, strategies to improve the anti-tumor potency of lymphocyte effector cells used in glioma immunotherapy are under development. One approach utilizes bi-specific antibodies capable of co-localizing and activating T lymphocytes via an anti-CD3 domain with glioma targets utilizing an epidermal growth factor receptor (EGFR) binding domain.sup.93-96. Preliminary clinical experience with this bi-specific antibody in combination with autologous lymphocytes suggests that T cells are activated in situ in the resection cavity. Targeting infiltrating tumor cells within the brain parenchyma, however, is a potentially significant limitation of this approach. T cells might have significantly increased anti-glioma activity if they are specific for target antigens expressed by gliomas. A growing number of human genes encoding tumor antigens to which T lymphocytes are reactive have been cloned, including the SART-1 gene, which appears to be expressed by nearly 75% of high-grade gliomas.sup.97. Both dendritic cell-based in vitro cell culture techniques, as well as tetramer-based T cell selection technologies are making feasible the isolation of antigen-specific T cells for adoptive therapy. Since antigens like SART-1 are recognized by T cells in the context of restricting HLA alleles, antigen-specific approaches will require substantial expansion in the number of antigens and restricting HLA alleles capable of presenting these antigens to be broadly applicable to the general population of glioma patients.

[0016] Chimeric antigen receptors engineered to consist of an extracellular single chain antibody (scFvFc) fused to the intracellular signaling domain of the T cell antigen receptor complex zeta chain (scFvFc:.zeta.) have the ability, when expressed in T cells, to redirect antigen recognition based on the monoclonal antibody's specificity.sup.98. The design of scFvFc:.zeta. receptors with target specificities for tumor cell-surface epitopes is a conceptually attractive strategy to generate antitumor immune effector cells for adoptive therapy as it does not rely on pre-existing anti-tumor immunity. These receptors are "universal" in that they bind antigen in a MHC independent fashion, thus, one receptor construct can be used to treat a population of patients with antigen-positive tumors. Several constructs for targeting human tumors have been described in the literature including receptors with specificities for Her2/Neu, CEA, ERRB-2, CD44v6, and epitopes selectively expressed on renal cell carcinoma.sup.98-104. These epitopes all share the common characteristic of being cell-surface moieties accessible to scFv binding by the chimeric T cell receptor. In vitro studies have demonstrated that both CD4+ and CD8+ T cell effector functions can be triggered via these receptors. Moreover, animal models have demonstrated the capacity of adoptively transferred scFvFc:.zeta. expressing T cells to eradicate established tumors.sup.105. The function of primary human T cells expressing tumor-specific scFvFc:.zeta. receptors have been evaluated in vitro; these cells specifically lyse tumor targets and secrete an array of pro-inflammatory cytokines including IL-2, TNF, IFN-.gamma., and GM-CSF.sup.104. Phase I pilot adoptive therapy studies are underway utilizing autologous scFvFc:.zeta.-expressing T cells specific for HIV gp120 in HIV infected individuals and autologous scFvFc:.zeta.-expressing T cells with specificity for TAG-72 expressed on a variety of adenocarcinomas, including breast and colorectal adenocarcinoma.

[0017] Investigators at City of Hope have engineered a CD20-specific scFvFc:.zeta. receptor construct for the purpose of targeting CD20+B-cell malignancy and an L1-CAM-specific chimeric immunoreceptor for targeting neuroblastoma.sup.106. Preclinical laboratory studies have demonstrated the feasibility of isolating and expanding from healthy individuals and lymphoma patients CD8+ CTL clones that contain a single copy of unrearranged chromosomally integrated vector DNA and express the CD20-specific scFvFc:.zeta. receptor.sup.107. To accomplish this, purified linear plasmid DNA containing the chimeric receptor sequence under the transcriptional control of the CMV immediate/early promoter and the NeoR gene under the transcriptional control of the SV40 early promoter was introduced into activated human peripheral blood mononuclear cells by exposure of cells and DNA to a brief electrical current, a procedure called electroporation. Utilizing selection, cloning, and expansion methods currently employed in FDA-approved clinical trials at the Fred Hutchinson Cancer Research Center, Seattle, Wash., gene modified CD8+ CTL clones with CD20-specific cytolytic activity have been generated from each of six healthy volunteers in 15 separate electroporation procedures. These clones when co-cultured with a panel of human CD20+ lymphoma cell lines proliferate, specifically lyse target cells, and are stimulated to produce cytokines.

SUMMARY OF THE INVENTION

[0018] The present invention relates to chimeric transmembrane immunoreceptors, named "zetakines," comprised of an extracellular domain comprising a soluble receptor ligand linked to a support region capable of tethering the extracellular domain to a cell surface, a transmembrane region and an intracellular signaling domain. Zetakines, when expressed on the surface of T lymphocytes, direct T cell activity to those cells expressing a receptor for which the soluble receptor ligand is specific. Zetakine chimeric immunoreceptors represent a novel extension of antibody-based immunoreceptors for redirecting the antigen specificity of T cells, with application to treatment of a variety of cancers, particularly via the autocrine/paracrine cytokine systems utilized by human malignancy.

[0019] In one preferred embodiment exploiting the tumor-restricted expression of IL-13R.alpha.2 by malignant glioma and renal cell carcinoma as a target for cellular immunotherapy, a mutant of the IL-13 cytokine, IL-13(E13Y), having selective high-affinity binding to IL-13R.alpha.2 has been converted into a type I transmembrane chimeric immunoreceptor capable of redirecting T cell antigen specificity to IL-13R.alpha.2-expressing tumor cells. This embodiment of the zetakine consists of extracellular IL-13(E13Y) fused to human IgG4 Fc, transmembrane CD4, and intracellular T cell antigen receptor CD3 complex zeta chain. Analogous immunoreceptors can be created that are specific to any of a variety of cancer cell types that selectively express receptors on their cell surfaces, for which selective ligands are known or can be engineered.

[0020] Bulk lines and clones of human T cells stably transformed to express such an immunoreceptor display redirected cytolysis of the cancer cell type to which they are specific, while showing negligible toxicity towards non-target cells. Such engineered T cells are a potent and selective therapy for malignancies, including difficult to treat cancers such as glioma.

BRIEF DESCRIPTION OF THE FIGURES

[0021] FIG. 1: Results of a Western Blot showing that the IL13zetakine Chimeric Immunoreceptor is expressed as an intact glycosylated protein in Jurkat T cells.

[0022] FIG. 2: Results of flow cytometric analysis showing that expressed IL13zetakine chimeric immunoreceptor trafficks to the cell-surface as a type I transmembrane protein.

[0023] FIG. 3: Results of flow cytometric analysis showing the cell surface phenotype of a representative primary human IL13zetakine.sup.+ CTL clone.

[0024] FIG. 4: Results of chromium release assays. FIG. 4A shows that the IL13zetakine.sup.+ CTL clone acquired glioma-specific re-directed cytolytic activity, and FIG. 4B shows the profile of anti-glioma cytolytic activity by primary human IL13zetakine.sup.+ CD8.sup.+ CTL clones was observed in glioma cells generally.

[0025] FIG. 5: Results of in vitro stimulation of cytokine production, showing that IL13zetakine.sup.+ CTL clones are activated for cytokine production by glioma stimulator cells.

[0026] FIG. 6: Results of in vitro stimulation of cytokine production (FIG. 6A, IFN.gamma.; FIG. 6B, TNF.alpha.; FIG. 6C, GM-CSF), showing the specific inhibition of IL13zetakine.sup.+ CTL activation for cytokine production by anti-IL13R Mab and rhIL13.

[0027] FIG. 7: Results of growth studies. FIG. 7A shows that IL13zetakine.sup.+ CD8.sup.+ CTL cells proliferate upon co-culture with glioma stimulators, and FIG. 7B shows the inhibition of glioma-stimulated proliferation of IL13zetakine.sup.+ CD8.sup.+ CTL cells by rhIL-13.

[0028] FIG. 8: Flow chart of the construction of IL13zetakine/HyTK-pMG (FIG. 8A, construction fo hsp-IL13-IgG4 (SmP)-hinge-Fe-Zeta; FIG. 8B, construction of IL13-Fc;.zeta.3pMB Pac; FIG. 8C, construction of Il13/HyTK-pMG).

[0029] FIG. 9: Plasmid map of IL13zetakine/HyTK-pMG.

[0030] FIG. 10: Plasmid map of alternative IL13zetakine/HyTK-pMG.

[0031] FIG. 11: Schematic diagram showing structure of IL13 zetakine insert.

[0032] FIG. 12: Nucleic acid sequence of a plasmid DNA vector (upper strand: SEQ ID NO:14; lower strand:SEQ ID NO:16) and the corresponding amino acid sequence of IL13zetakine (SEQ ID NO:17) and HyTK (SEQ ID NO:18).

[0033] FIG. 13: Nucleic acid sequence of an alternate plasmid DNA vector (upper strand: SEQ ID NO:19; lower strand:SEQ ID NO:20) and the corresponding amino acid sequence of IL13zetakine (SEQ ID NO:21) and HyTK (SEQ ID NO:22).

[0034] FIG. 14: Nucleic acid sequence of an alternate plasmid DNA vector (SEQ ID NO:23).

DETAILED DESCRIPTION

[0035] An ideal cell-surface epitope for tumor targeting with genetically-engineered re-directed T cells would be expressed solely on tumor cells in a homogeneous fashion and on all tumors within a population of patients with the same diagnosis. Modulation and/or shedding of the target molecule from the tumor cell membrane may also impact on the utility of a particular target epitope for re-directed T cell recognition. To date few "ideal" tumor-specific epitopes have been defined and secondary epitopes have been targeted based on either lack of expression on critical normal tissues or relative over-expression on tumors. In the case of malignant glioma, the intracavitary administration of T cells for the treatment of this cancer permits the expansion of target epitopes to those expressed on tumor cells but not normal CNS with less stringency on expression by other tissues outside the CNS. The concern regarding toxicity from cross-reactivity of tissues outside the CNS is mitigated by a) the sequestration of cells in the CNS based on the intracavitary route of administration and b) the low cell numbers administered in comparison to cell doses typically administered systemically.

[0036] The IL-13R.alpha.2 receptor stands out as the most ubiquitous and specific cell-surface target for malignant glioma.sup.47. Sensitive autoradiographic and immunohistochemical studies fail to detect IL-13 receptors in the CNS.sup.46; 48. Moreover, mutation of the IL-13 cytokine to selectively bind the glioma-restricted IL-13R.alpha.2 receptor is a further safeguard against untoward reactivity of IL-13-directed therapeutics against IL-13R.alpha.1/IL-4.beta.+normal tissues outside the CNS.sup.55; 57. The potential utility of targeting glioma IL-13R.alpha.2 the design and testing of a novel engineered chimeric immunoreceptor for re-directing the specificity of T cells that consists of an extracellular IL-13 mutant cytokine (E13Y) tethered to the plasma membrane by human IgG4 Fc which, in turn, is fused to CD4.TM. and the cytoplasmic tail of CD3 zeta. This chimeric immunoreceptor has been given the designation of "IL-13 zetakine." The IL-13R.alpha.2 receptor/IL-13(E13Y) receptor-ligand pair is an excellent guide for understanding and assessing the suitability of receptor-ligand pairs generally for use in zetakines. An ideal zetakine comprises an extracellular soluble receptor ligand having the properties of IL-13(E13Y) (specificity for a unique cancer cell surface receptor, in vivo stability due to it being derived from a naturally-occurring soluble cell signal molecule, low immunogenicity for the same reason). The use of soluble receptor ligands as distinct advantages over the prior art use of antibody fragments (such as the scFvFc immunoreceptors) or cell adhesion molecules, in that soluble receptor ligands are more likely to be stable in the extracellular environment, non-antigenic, and more selective.

[0037] Chimeric immunoreceptors according to the present invention comprise an extracellular domain comprised of a soluble receptor ligand linked to an extracellular support region that tethers the ligand to the cell surface via a transmembrane domain, in turn linked to an intracellular receptor signaling domain. Examples of suitable soluble receptor ligands include autocrine and paracrine growth factors, chemokines, cytokines, hormones, and engineered artificial small molecule ligands that exhibit the required specificity. Natural ligand sequences can also be engineered to increase their specificity for a particular target cell. Selection of a soluble receptor ligand for use in a particular zetakine is governed by the nature of the target cell, and the qualities discussed above with regard to the IL-13(E13Y) molecule, a preferred ligand for use against glioma. Examples of suitable support regions include the constant (Fc) regions of immunoglobins, human CD8.alpha., and artificial linkers that serve to move the targeting moiety away from the cell surface for improved access to receptor binding on target cells. A preferred support region is the Fc region of an IgG (such as IgG4). Examples of suitable transmembrane domains include the transmembrane domains of the leukocyte CD markers, preferably that of CD8. Examples of intracellular receptor signaling domains are those of the T cell antigen receptor complex, preferably the zeta chain of CD3 also Fc.gamma. RIII costimulatory signaling domains, CD28, DAP10, CD2, alone or in a series with CD3zeta.

[0038] In the IL-13 zetakine embodiment, the human IL-13 cDNA having the E13Y amino acid substitution was synthesized by PCR splice overlap extension. A full length IL-13 zetakine construct was assembled by PCR splice overlap extension and consists of the human GM-CSF receptor alpha chain leader peptide, IL-13(E13Y)-Gly-Gly-Gly, human IgG4 Fc, human CD4.TM., and human cytoplasmic zeta chain. This cDNA construct was ligated into the multiple cloning site of a modified pMG plasmid under the transcriptional control of the human Elongation Factor-1alpha promoter (Invivogen, San Diego). This expression vector co-expresses the HyTK cDNA encoding the fusion protein HyTK that combines in a single molecule hygromycin phosphotransferase activity for in vitro selection of transfectants and HSV thymidine kinase activity for in vivo ablation of cells with ganciclovir from the CMV immediate/early promoter. Western blot of whole cell Jurkat lysates pre-incubated with tunicamycin, an inhibitor of glycosylation, with an anti-zeta antibody probe demonstrated that the expected intact 56-kDa chimeric receptor protein is expressed. This receptor is heavily glycosylated consistent with post-translational modification of the native IL-13 cytokine.sup.108. Flow cytometric analysis of IL-13 zetakine+ Jurkat cells with anti-human IL-13 and anti-human Fc specific antibodies confirmed the cell-surface expression of the IL-13 zetakine as a type I transmembrane protein.

[0039] Using established human T cell genetic modification methods developed at City of Hope.sup.107, primary human T cell clones expressing the IL-13 zetakine chimeric immunoreceptor have been generated for pre-clinical functional characterization. IL-13 zetakine+ CD8+ CTL clones display robust proliferative activity in ex vivo expansion cultures. Expanded clones display re-directed cytolytic activity in 4-hr chromium release assays against human IL-13R.alpha.2+ glioblastoma cell lines. The level of cytolytic activity correlates with levels of zetakine expression on T cells and IL-13R.alpha.2 receptor density on glioma target cells. In addition to killing, IL-13 zetakine+ clones are activated for cytokine secretion (IFN-.gamma., TNF-.alpha., GM-CSF). Activation was specifically mediated by the interaction of the IL-13 zetakine with the IL-13R.alpha.2 receptor on glioma cells since CTL clones expressing an irrelevant chimeric immunoreceptor do not respond to glioma cells, and, since activation can be inhibited in a dose-dependent manner by the addition to culture of soluble IL-13 or blocking antibodies against IL-13 on T cell transfectants and IL-13R.alpha.2 on glioma target cells. Lastly, IL-13 zetakine-expressing CD8+ CTL clones proliferate when stimulated by glioma cells in culture. IL-13 zetakine+ CTL clones having potent anti-glioma effector activity will have significant clinical activity against malignant gliomas with limited collateral damage to normal CNS.

[0040] An immunoreceptor according to the present invention can be produced by any means known in the art, though preferably it is produced using recombinant DNA techniques. A nucleic acid sequence encoding the several regions of the chimeric receptor can prepared and assembled into a complete coding sequence by standard techniques of molecular cloning (genomic library screening, PCR, primer-assisted ligation, site-directed mutagenesis, etc.). The resulting coding region is preferably inserted into an expression vector and used to transform a suitable expression host cell line, preferably a T lymphocyte cell line, and most preferably an autologous T lymphocyte cell line. A third party derived T cell line/clone, a transformed humor or xerogenic immunologic effector cell line, for expression of the immunoreceptor. NK cells, macrophages, neutrophils, LAK cells, LIK cells, and stem cells that differentiate into these cells, can also be used. In a preferred embodiment, lymphocytes are obtained from a patient by leukopharesis, and the autologous T cells are transduced to express the zetakine and administered back to the patient by any clinically acceptable means, to achieve anti-cancer therapy.

[0041] Suitable doses for a therapeutic effect would be between about 10.sup.6 and about 10.sup.9 cells per dose, preferably in a series of dosing cycles. A preferred dosing regimen consists of four one-week dosing cycles of escalating doses, starting at about 10.sup.7 cells on Day 0, increasing incrementally up to a target dose of about 10.sup.8 cells by Day 5. Suitable modes of administration include intravenous, subcutaneous, intracavitary (for example by reservoir-access device), intraperitoneal, and direct injection into a tumor mass.

[0042] The following examples are solely for the purpose of illustrating one embodiment of the invention.

Example 1

Construction of an Immunoreceptor Coding Sequence

[0043] The coding sequence for an immunoreceptor according to the present invention was constructed by de novo synthesis of the IL13(E13Y) coding sequence using the following primers (see FIG. 8 for a flow chart showing the construction of the immunoreceptor coding sequence and expression vector):

TABLE-US-00001 IL13P1: EcoRI (SEQ ID NO. 1) TATGAATTCATGGCGCTTTTGTTGACCACGGTCATTGCTCTCACTTGCCT TGGCGGCTTTGCCTCCCCAGGCCCTGTGCCTCCCTCTACAGCCCTCAGGT AC IL13P2: (SEQ ID NO. 2) GTTGATGCTCCATACCATGCTGCCATTGCAGAGCGGAGCCTTCTGGTTCT GGGTGATGTTGACCAGCTCCTCAATGAGGTACCTGAGGGCTGTAGAGGG AG IL13P3: (SEQ ID NO. 3) CTCTGGGTCTTCTCGATGGCACTGCAGCCTGACACGTTGATCAGGGATTC CAGGGCTGCACAGTACATGCCAGCTGTCAGGTTGATGCTCCATACCATGC IL13P4: (SEQ ID NO. 4) CCTCGATTTTGGTGTCTCGGACATGCAAGCTGGAAAACTGCCCAGCTGAG ACCTTGTGCGGGCAGAATCCGCTCAGCATCCTCTGGGTCTTCTCGATGGC IL13P5: BamHI (SEQ ID NO. 5) TCGGATCCTCAGTTGAACCGTCCCTCGCGAAAAAGTTTCTTTAAATGTAA GAGCAGGTCCTTTACAAACTGGGCCACCTCGATTTTGGTGTCTCGG

[0044] The final sequence (417 bp) was end-digested with EcoRI-BamHI, and ligated into the plasmid pSK (stratagene, LaJolla, Calif.) as ligation 312#3. Ligation 312#3 was mutagenized (stratagene kit, per manufacturer's instructions) to fix a deleted nucleotide using the primers 5': IL13 312#3 mut5-3 (CAACCTGACAGCTGGCATGTACTGTGCAGCCCTGGAATC (SEQ ID NO. 6)) and 3':IL13 312#3 mut3-5 (GATTCCAGGGCTGCACAGTACATGCCAGCTGTCAGGTTG (SEQ ID NO. 7)), and ligation 312#3 as a template, to form ligation 348#1 (IL13zetakine/pSK).

[0045] The coding Human GM-CSFR alpha chain Signal Peptide (hsp) coding sequence was fused to the 5' end of IL13(E13Y) by standard PCR splice overlap extension. The hsp sequence (101 bp) was obtained from the template ligation 301 #10 (hsp/pSK) (human GCSF receptor .alpha.-chain leader sequence from human T cell cDNA), using the primers 5':19hsp5' (ATCTCTAGAGCCGCCACCATGCTTCTCCTGGTGACAAGCCTTC (SEQ ID NO. 8)) (XbaI site highlighted in bold), and 3': hsp-IL13FR (GAGGGAGGCACAGGGCCTGGGATCAGGAGGAATG (SEQ ID NO. 9)). The IL-13 sequence (371 bp) was obtained using the primers 5': hsp-IL13FF (CATTCCTCCTGATCCCAGGCCCTGTGCCTCCCTC (SEQ ID NO. 10)) and 3': IL13-IgG4FR (GGGACCATATTTGGACTCGTTGAACCGTCCCTCGC (SEQ ID NO. 11)), and ligation 312#3 as template. Fusion was achieved using the 101 bp hsp sequence and 371 bp IL13 sequence thus obtained, and the primers 5': 19hsp5' and 3': IL13-IgG4FR, to yield a 438 bp fusion hsp-IL13 sequence.

[0046] A sequence encoding the IgG4 Fc region IgG4m:zeta was fused to the 3' end of the hsp-IL13 fusion sequence using the same methods. The IgG4m:zeta sequence (1119 bp) was obtained using the primers 5': IL13-IgG4FF (GCGAGGGACGGTTCAACGAGTCCAAATATGGTCCC (SEQ ID NO. 12)) and 3': ZetaN3' (ATGCGGCCGCTCAGCGAGGGGGCAGG (SEQ ID NO. 13)) (NotI site highlighted in bold), using the sequence R9.10 (IgG4mZeta/pSK) as template. The 1119 bp IgG4m:zeta sequence was fused to the hsp-IL13 fusion sequence using the respective sequences as templates, and the primers 5': 19hsp5' and 3': ZetaN3', to yield a 1522 bp hsp-IL13-IgG4m:zeta fusion sequence. The ends were digested with XbaI-NotI, and ligated into pSK as ligation 351#7, to create the plasmid IL13zetakine/pSK (4464 bp).

Example 2

Construction of Expression Vector

[0047] An expression vector containing the IL13 zetakine coding sequence was created by digesting the IL13zetakine/pSK of Example 1 with XbaI-NotI, and creating blunt ends with Klenow, and ligating the resulting fragment into the plasmid pMG Pac (Invirogen) (first prepared by opening with SgrAI, blunting with Klenow, and dephosphorylation with SAP), to yield the plasmid IL13zetakine/pMG. See FIG. 8. The hygromycin resistance region of IL13zetakine/pMG was removed by digestion with NotI-NheI, and replaced by the selection/suicide fusion HyTK, obtained from plasmid CE7RIHyTK-pMG (Jensen, City of Hope) by digestion with NotI-NheI, to create the expression vector IL13zetakine/HyTK-pMG (6785 bp). This plasmid comprises the Human Elongation Factor-1.alpha. promoter (hEF1p) at bases 6-549, the IL13zetakine coding sequence at bases 692-2185, the Simian Virus 40 Late polyadenylation signal (Late SV40pAN) at bases 2232-2500, a minimal E. coli origin of replication (Ori ColE1) at bases 2501-3247, a synthetic poly A and Pause site (SpAN) at bases 3248-3434, the Immeate-early CMV enhancer/promoter (h CMV-1Aprom) at bases 3455-4077, the Hygromycin resistance-Thymidine kinase coding region fusion (HyTK) at bases 4259-6334, and the bovine growth hormone polyadenylation signal and a transcription pause (BGh pAn) at bases 6335-6633. The plasmid has a PacI linearization site at bases 3235-3242. The hEF1p and IL13zetakine elements derived from IL13zetakine/pMG, and the remaining elements derived from CE7R/HyTk-pMG (and with the exception of the HyTK element, ultimately from the parent plasmid pMGAPac). In sum, IL13zetakine/HyTK-pMG is a modified pMG backbone, expressing the IL13zetakine gene from the hEF1 promoter, and the HyTK fusion from the h CMV-1A promoter. A map of the plasmid IL13zetakine/HyTK-pMG appears in FIG. 9. The full nucleic acid sequence of the plasmid is shown in FIG. 12. The sequence of an IL13zetakine insert is given as SEQ ID NO:15, below. See also FIG. 11.

TABLE-US-00002 (SEQ ID NO: 15) atgcttctcctggtgacaagccttctgctctgtgagttaccacacccagc attcctcctgatcccaggccctgtgcctccctctacagccctcaggtacc tcattgaggagctggtcaacatcacccagaaccagaaggctccgctctgc aatggcagcatggtatggagcatcaacctgacagctggcatgtactgtgc agccctggaatccctgatcaacgtgtcaggctgcagtgccatcgagaaga cccagaggatgctgagcggattctgcccgcacaaggtotcagctgggcag ttttccagcttgcatgtccgagacaccaaaatcgaggtggcccagtttgt aaaggacctgctcttacatttaaagaaactttttcgcgagggacggttca acgagtccaaatatggtcccccatgcccaccatgcccagcacctgagttc ctggggggaccatcagtcttcctgttccccccaaaacccaaggacactct catgatctcccggacccctgaggtcacgtgcgtggtggtggacgtgagcc aggaagaccccgaggtccagttcaactggtacgtggatggcgtggaggtg cataatgccaagacaaagccgcgggaggagcagttcaacagcacgtaccg tgtggtcagcgtcctcaccgtcctgcaccaggactggctgaacggcaagg agtacaagtgcaaggtctccaacaaaggcctcccgtcctccatcgagaaa accatctccaaagccaaagggcagccccgagagccacaggtgtacaccct gcccccatcccaggaggagatgaccaagaaccaggtcagcctgacctgcc tggtcaaaggcttctaccccagcgacatcgccgtggagtgggagagcaat gggcagccggagaacaactacaagaccacgcctcccgtgctggactccga cggctccttcttcctctacagcaggctaaccgtggacaagagcaggtggc aggaggggaatgtcttctcatgctccgtgatgcatgaggctctgcacaac cactacacacagaagagcctctccctgtccctaggtaaaatggccctgat tgtgctggggggcgtcgccggcctcctgcttttcattgggctaggcatct tcttcagagtgaagttcagcaggagcgcagacgcccccgcgtaccagcag ggccagaaccagctctataacgagctcaatctaggacgaagagaggagta cgatgttttggacaagagacgtggccgggaccctgagatggggggaaagc cgagaaggaagaaccctcaggaaggcctgtacaatgaactgcagaaagat aagatggcggaggcctacagtgagattgggatgaaaggcgagcgccggag gggcaaggggcacgatggcctttaccagggtctcagtacagccaccaagg acacctacgacgcccttcacatgcaggccctgccccctcgc.

Example 3

Expression of the Immunoreceptor

[0048] Assessment of the integrity of the expressed construct was first delineated by Wester blot probed with an anti-zeta antibody of whole cell lysates derived from Jurkat T cell stable transfectants.sup.107 cocultured in the presence or absence of tunicamycin, an inhibitor of glycosylation. FIG. 1. Jurkat T cell stable transfectants (Jurkat-IL13-pMG bulk line) were obtained by electroporating Jurkat T cells with the IL13zetakine/HyTK-pMG expression vector, followed by selection and expansion of positive transfectants. 2.times.10.sup.6 cells from the Jurkat-IL13-pMG bulk line were plated per well in a 24-well plate with or without 5 .mu.g/ml, 10 .mu.g/ml, or 20 .mu.g/ml Tunicamycin. The plate was incubated at 37.degree. C. for 22 hrs. Cells were harvested from each well, and each sample was washed with PBS and resuspended in 50 .mu.l RIPA buffer (PBS, 1% NP40, 0.5% sodium deoxycholate, 0.1% SDS) containing 1 tablet/10ml Complete Protease Inhibitor Cocktail (Boehringer Mannheim, Indianapolis, Ind.). Samples were incubated on ice for 30 minutes then disrupted by aspiration with syringe with 21 gauge needle then incubated on ice for an additional 30 minutes before being centrifuged at 4.degree. C. for 20 minutes at 14,000 rpm. Samples of centrifuged lysate supernatant were harvested and boiled in an equal volume of sample buffer under reducing conditions, then subjected to SDS-PAGE electrophoresis on a 12% acrylamide gel. Following transfer to nitrocellulose, membrane was allowed to dry O/N at 4.degree. C. Next morning, membrane was blocked in a Blotto solution containing 0.04 gm/ml non-fat dried milk in T-TBS (0.02% Tween 20 in Tris buffered saline pH 8.0) for 1 hour. Membrane was then incubated with primary mouse anti-human CD3.zeta. monoclonal antibody (Pharmingen, San Diego, Calif.) at a concentration of 1 .mu.g/ml for 2 hours, washed, and then incubated with a 1:3000 dilution (in Blotto solution) of goat anti-mouse IgG alkaline phosphatase conjugated secondary antibody (Bio-Rad ImmunoStar Kit, Hercules, Calif.) for 1 hour. Prior to developing, membrane was washed 4 additional times in T-TBS, and then incubated with 3 ml of phosphatase substrate solution (Biorad ImmunoStar Kit, Hercules, Calif.) for 5 minutes at room temperature. Membrane was then covered with plastic, and exposed to x-ray film. Consistant with the known glycosylation pattern of wild-type human IL-13, the electrophoretic mobility of expressed IL-13(E13Y) zetakine is demonstrative of a heavily glycosylated protein which, when expressed in the presence of tunicamycin, is reduced to an amino acid backbone of approximately 54 kDa.

[0049] The IL-13(E13Y) zetakine traffics to the cell surface as a homodimeric type I transmembrane protein, as evidenced by flow cytometric analysis of transfectants with a phycoerythrin (PE)-conjugated anti human-IL13 monoclonal antibody and a fluorescein isothiocyanate (FITC)-conjugated mouse anti-human Fc (gamma) fragment-specific F(ab').sub.2 antibody. FIG. 2. Jurkat IL13zetakine-pMG transfectants were stained with anti-human Fc(FITC) antibody (Jackson ImmunoResearch, West Grove, Pa.), recombinant human IL13R.alpha.2/human IgG1 chimera (R&D Systems, Minneapolis, Minn.) followed by FITC-conjugated anti human-IgG1 monoclonal antibody (Sigma, St. Louis, Mo.), and an anti-IL13(PE) antibody (Becton Dickinson, San Jose, Calif.) for analysis of cell surface chimeric receptor expression. Healthy donor primary cells were also stained with FITC-conjugated anti-CD4, anti-CD8, anti-TCR, and isotype control monoclonal antibodies (Becton Dickinson, San Jose, Calif.) to assess cell surface phenotype. For each stain, 10.sup.6 cells were washed and resuspended in 100 .mu.l of PBS containing 2% FCS, 0.2 mg/ml NaN.sub.3, and 5 .mu.l of stock antibody. Following a 30 minute incubation at 4.degree. C., cells were washed twice and either stained with a secondary antibody, or resuspended in PBS containing 1% paraformaldehyde and analyzed on a FACSCaliber cytometer.

Example 4

Binding of IL13(E13Y) Zetakine to IL13R.alpha.2 Receptor

[0050] IL-13(E13Y), tethered to the cell membrane by human IgG4 Fc (i.e., IL13(E13Y) zetakine), is capable of binding to its target IL13R.alpha.2 receptor as assessed by flow cytometric analysis using soluble IL13R.alpha.2-Fc fusion protein. FIG. 3. Cloned human PBMC IL13zetakine-pMG transfectants were obtained by electroporating PBMC with the IL13zetakine/HyTK-pMG expression vector, followed by selection and expansion of positive transfectants.sup.107. IL13zetakine.sup.+ CTL clonal cells were stained with a fluorescein isothiocyanate (FITC)-conjugated mouse anti-human Fc (gamma) fragment-specific F(ab').sub.2 (Jackson ImmunoResearch, West Grove, Pa.), recombinant human IL13R.alpha.2/human IgG1 chimera (R&D Systems, Minneapolis, Minn.) followed by FITC-conjugated anti human-IgG1 monoclonal antibody (Sigma, St. Louis, Mo.), and a phycoerythrin (PE)-conjugated anti human-IL13 monoclonal antibody (Becton Dickinson, San Jose, Calif.) for analysis of cell surface chimeric receptor expression. Healthy donor primary cells were also stained with FITC-conjugated anti-CD4, anti-CD8, anti-TCR, and isotype control monoclonal antibodies (Becton Dickinson, San Jose, Calif.) to assess cell surface phenotype. For each stain, 10.sup.6 cells were washed and resuspended in 100 .mu.l of PBS containing 2% FCS, 0.2 mg/ml NaN.sub.3, and 5 .mu.l of antibody. Following a 30 minute incubation at 4.degree. C., cells were washed twice and either stained with a secondary antibody, or resuspended in PBS containing 1% paraformaldehyde and analyzed on a FACSCaliber cytometer.

[0051] Next, the immunobiology of the IL-13(E13Y) zetakine as a surrogate antigen receptor for primary human T cells was evaluated. Primary human T cells were electroporated with the plasmid expression vector. Positive transformants were selected with hygromycin, cloned in limiting dilution, then expanded by recursive stimulation cycles with OKT3, IL-2 and irradiated feeder cells. Clones demonstrating IL 13zetakine expression by Western blot and FACS were then subjected to functional evaluation in 4-hr chromium release assays against a variety of IL-13.alpha.2.sup.+/CD20.sup.- glioma cell lines (U251, SN-B19, U138), and the IL-13.alpha..sup.-/CD20.sup.+ B cell lymphocyte line Daudi). These tests showed that IL13zetakine conferred cytolytic activity that was specific for glioma cells (FIG. 4a), and that this specific cytolytic activity is present for glioma cells as a class (FIG. 4b). The cytolytic activity of MJ-IL13-pMG clones was assayed by employing .sup.51Cr-labeled SN-B19, U251, and U138 glioma cell lines (IL13.alpha.2+/CD20-) and Daudi (CD20+/IL13.alpha.2-) as targets. MJ-IL13 effectors were assayed 8-12 days following stimulation. Effectors were harvested, washed, and resuspended in assay media: 2.5.times.10.sup.5, 1.25.times.10.sup.5, 2.5.times.10.sup.4, and 5.times.10.sup.3 effectors were cultured in triplicate at 37.degree. C. for 4 hours with 5.times.10.sup.3 target cells in 96-well V-bottom microtiter plates. After incubation, 100 .mu.l aliquots of cell-free supernatant were harvested and .sup.51Cr in the supernatants was assayed with a .gamma.-counter. Percent specific cytolysis was calculated as follows:

( Experimental 51 Cr release ) - ( control 51 Cr release ) ( Maximum 51 Cr release ) - ( control 51 Cr release ) .times. 100 ##EQU00001##

Control wells contained target cells incubated in the presence of target cells alone. Maximum .sup.51Cr release was determined by measuring the .sup.51Cr released by labeled target cells in the presence of 2% SDS. Bulk lines of stabley transfected human T cells consisting of approximately 40% IL-13(E13Y) zetakine.sup.+ TCR.alpha./.beta..sup.+ lymphocytes displayed re-directed cytolysis specific for 13R.alpha.2.sup.+ glioma targets in 4-hr chromium release assays (>50% specific lysis at E:T ratios of 25:1), with negligable acitivity against IL-13R.alpha.2-targets (<8% specific lysis at E:T ratios of 25:1). IL-13(E13Y) zetakine.sup.+CD8.sup.+TCR.alpha./.beta..sup.+ CTL clones selected on the basis of high-level binding to anti-IL-13 antibody also display redirected IL13R.alpha.2-specific glioma cell killing. FIG. 4b.

[0052] IL-13 zetakine-expressing CD8.sup.+ CTL clones are activated and proliferate when stimulated by glioma cells in culture. FIGS. 5-7. MJ-IL13-pMG Cl. F2 responder cells expressing the IL13 zetakine were evaluated for receptor-mediated triggering of IFN.gamma., GM-CSF, and TNF.alpha. production in vitro. 2.times.10.sup.6 responder cells were co-cultured in 24-well tissue culture plates with 2.times.10.sup.5 irradiated stimulator cells (Daudi, Fibroblasts, Neuroblastoma 10HTB, and glioblastoma U251) in 2 ml total. Blocking rat anti-human-IL13 monoclonal antibody (Pharmingen, San Diego, Calif.), recombinant human IL13 (R&D Systems, Minneapolis, Minn.), and IL13R.alpha.2-specific goat IgG (R&D Systems, Minneapolis, Minn.) were added to aliquots of U251 stimulator cells (2.times.10.sup.5/ml) at concentrations of 1 ng/ml, 10 ng/ml, 100 ng/ml, and 1 .mu.g/ml, 30 minutes prior to the addition of responder cells. Plates were incubated for 72 hours at 37.degree. C., after which time culture supernatants were harvested, aliquoted, and stored at -70.degree. C. ELISA assays for IFN.gamma., GM-CSF, and TNF.alpha. were carried out using the R&D Systems (Minneapolis, Minn.) kit per manufacturer's instructions. Samples were tested in duplicate wells undiluted or diluted at 1:5 or 1:10. The developed ELISA plate was evaluated on a microplate reader and cytokine concentrations determined by extrapolation from a standard curve. Results are reported as picograms/ml, and show strong activation for cytokine production by glioma stimulator cells. FIG. 5, FIG. 6.

[0053] Lastly, IL-2 independent proliferation of IL13zetakine.sup.+ CD8.sup.+ CTL was observed upon co-cultivation with glioma stimulators (FIG. 7a), but not with IL13 R.alpha.2 stimulators. Proliferation was inhibited by the addition of rhIL-13 antibody (FIG. 7b), showing that the observed proliferation was dependant on binding of zetakine to the IL-13R.alpha.2 glioma cell-specific receptor.

Example 5

Preparation of IL-13 zetakine.sup.+ T Cells Suitable for Therapeutic Use

[0054] The mononuclear cells are separated from heparinized whole blood by centrifugation over clinical grade Ficoll (Pharmacia, Uppsula, Sweden). PBMC are washed twice in sterile phosphate buffered saline (Irvine Scientific) and suspended in culture media consisting of RPMI 1640 HEPES, 10% heat inactivated FCS, and 4 mM L-glutamine. T cells present in patient PBMC are polyclonally activated by addition to culture of Orthoclone OKT3 (30 ng/ml). Cell cultures are then incubated in vented T75 tissue culture flasks in the study subject's designated incubator. Twenty-four hours after initiation of culture rhIL-2 is added at 25 U/ml.

[0055] Three days after the initiation of culture PBMC are harvested, centrifuged, and resuspended in hypotonic electroporation buffer (Eppendorf) at 20.times.10.sup.6 cells/ml. 25 .mu.g of the plasmid IL13zetakine/HyTK-pMG of Example 3, together with 400 .mu.l of cell suspension, are added to a sterile 0.2 cm electroporation cuvette. Each cuvette is subjected to a single electrical pulse of 250V/40 .mu.s and again incubated for ten minutes at RT. Surviving cells are harvested from cuvettes, pooled, and resuspended in culture media containing 25 U/ml rhIL-2. Flasks are placed in the patient's designated tissue culture incubator. Three days following electroporation hygromycin is added to cells at a final concentration of 0.2 mg/ml. Electroporated PBMC are cultured for a total of 14 days with media and IL-2 supplementation every 48-hours.

[0056] The cloning of hygromycin-resistant CD8+ CTL from electroporated OKT3-activated patient PBMC is initiated on day 14 of culture. Briefly, viable patient PBMC are added to a mixture of 100.times.10.sup.6 cyropreserved irradiated feeder PBMC and 20.times.10.sup.6 irradiated TM-LCL in a volume of 200 ml of culture media containing 30 ng/ml OKT3 and 50 U/ml rhIL-2. This mastermix is plated into ten 96-well cloning plates with each well receiving 0.2 ml. Plates are wrapped in aluminum foil to decrease evaporative loss and placed in the patient's designated tissue culture incubator. On day 19 of culture each well receives hygromycin for a final concentration of 0.2 mg/ml. Wells are inspected for cellular outgrowth by visualization on an inverted microscope at Day 30 and positive wells are marked for restimulation.

[0057] The contents of each cloning well with cell growth are individually transferred to T25 flasks containing 50.times.10.sup.6 irradiated PBMC, 10.times.10.sup.6 irradiated LCL, and 30 ng/mlOKT3 in 25 mls of tissue culture media. On days 1,3,5,7,9,11, and 13 after restimulation flasks receive 50 U/ml rhIL-2 and 15 mls of fresh media. On day 5 of the stimulation cycle flasks are also supplemented with hygromycin 0.2 mg/ml. Fourteen days after seeding cells are harvested, counted, and restimulated in T75 flasks containing 150.times.10.sup.6 irradiated PBMC, 30.times.10.sup.6 irradiated TM-LCL and 30 ng/ml OKT3 in 50 mls of tissue culture media. Flasks receive additions to culture of rhIL-2 and hygromycin as outlined above.

[0058] CTL selected for expansion for possible use in therapy are analyzed by immunofluorescence on a FACSCalibur housed in CRB-3006 using FITC-conjugated monoclonal antibodies WT/31 (a.beta.TCR), Leu 2a (CD8), and OKT4 (CD4) to confirm the requisite phenotype of clones (.alpha..beta.TCR+, CD4-, CD8+, and IL13+). Criteria for selection of clones for clinical use include uniform TCR .alpha..beta.+, CD4-, CD8+ and IL13+ as compared to isotype control FITC/PE-conjugated antibody. A single site of plasmid vector chromosomal integration is confirmed by Southern blot analysis. DNA from genetically modified T cell clones will be screened with a DNA probe specific for the plasmid vector. Probe DNA specific for the HyTK in the plasmid vector is synthesized by random priming with fluorescein-conjugated dUTP per the manufacture's instructions (Amersham, Arlington Hts, Ill.). T cell genomic DNA is isolated per standard technique. Ten micrograms of genomic DNA from T cell clones is digested overnight at 37.degree. C. then electrophoretically separated on a 0.85% agarose gel. DNA is then transferred to nylon filters (BioRad, Hercules, Calif.) using an alkaline capillary transfer method. Filters are hybridized overnight with probe in 0.5 M Na.sub.2PO.sub.4, pH 7.2, 7% SDS, containing 10 .mu.g/ml salmon sperm DNA (Sigma) at 65.degree. C. Filters are then washed four times in 40 mM Na.sub.2PO.sub.4, pH 7.2, 1% SDS at 65.degree. C. and then visualized using a chemiluminescence AP-conjugated anti-florescein antibody (Amersham, Arlington Hts, Ill.). Criteria for clone selection is a single band unique vector band.

[0059] Expression of the IL-13 zetakine is determined by Western blot procedure in which chimeric receptor protein is detected with an anti-zeta antibody. Whole cell lysates of transfected T cell clones are generated by lysis of 2.times.10.sup.7 washed cells in 1 ml of RIPA buffer (PBS, 1% NP40, 0.5% sodium deoxycholate, 0.1% SDS) containing 1 tablet/10 ml Complete Protease Inhibitor Cocktail (Boehringer Mannheim). After an eighty minute incubation on ice, aliquots of centrifuged whole cell lysate supernatant are harvested and boiled in an equal volume of loading buffer under reducing conditions then subjected to SDS-PAGE electrophoresis on a precast 12% acrylamide gel (BioRad). Following transfer to nitrocellulose, membranes are blocked in blotto solution containing 0.07 gm/ml non-fat dried milk for 2 hours. Membranes are washed in T-TBS (0.05% Tween 20 in Tris buffered saline pH 8.0) then incubated with primary mouse anti-human CD3.zeta. monoclonal antibody 8D3 (Pharmingen, San Diego, Calif.) at a concentration of 1 .mu.g/ml for 2 hours. Following an additional four washes in T-TBS, membranes are incubated with a 1:500 dilution of goat anti-mouse IgG alkaline phosphatase-conjugated secondary antibody for 1 hour. Prior to developing, membranes are rinsed in T-TBS then developed with 30 ml of "AKP" solution (Promega, Madison, Wis.) per the manufacturer's instructions. Criteria for clone selection is the presence of a chimeric zeta band.

[0060] CD8+ cytotoxic T cell clones expressing the IL-13 zetakine chimeric immunoreceptor recognize and lyse human glioblastoma target cells following interaction of the chimeric receptor with the cell surface target epitope in a HLA-unrestricted fashion. The requirements for target IL-13R.alpha.2 epitope expression and class I MHC independent recognition will be confirmed by assaying each a.beta.TCR+, CD8+, CD4-, IL-13 zetakine+ CTL clones against IL-13R.alpha.2+ Daudi cell transfectants and IL-13R.alpha.2- Daudi cells. T cell effectors are assayed 12-14 days following stimulation with OKT3. Effectors are harvested, washed, and resuspended in assay media; and Daudi cell transfectants expressing IL-13R.alpha.2. 2.5.times.10.sup.5, 1.25.times.10.sup.5, 0.25.times.10.sup.5, and 0.05.times.10.sup.5 effectors are plated in triplicate at 37.degree. C. for 4 hours with 5.times.10.sup.3 target cells in V-bottom microtiter plates (Costar, Cambridge, Mass.). After centrifugation and incubation, 100 .mu.L aliquots of cell-free supernatant is harvested and counted. Percent specific cytolysis is calculated as:

( Experimental 51 Cr release ) - ( control 51 Cr release ) ( Maximum 51 Cr release ) - ( control 51 Cr release ) .times. 100 ##EQU00002##

Control wells contain target cells incubated in assay media. Maximum .sup.51Cr release is determined by measuring the .sup.51Cr content of target cells lysed with 2% SDS. Criteria for clone selection is >25% specific lysis of IL-13R.alpha.2+ Daudi transfectants at an E:T ratio of 5:1 and a <10% lysis of parental Daudi at the same E:T ratio.

Example 6

Treatment of Human Glioma Using IL-13 Zetakine-Expressing T Cells

[0061] T cell clones genetically modified according to Example 5 to express the IL-13R zetakine chimeric immunoreceptor and HyTK are selected for: [0062] a. TCR.alpha./.beta..sup.+, CD4.sup.-, CD8.sup.+, IL-13.sup.+ cell surface phenotype as determined by flow cytometry. [0063] b. Presence of a single copy of chromosomally integrated plasmid vector DNA as evidenced by Southern blot. [0064] c. Expression of the IL-13 zetakine protein as detected by Western blot. [0065] d. Specific lysis of human IL-13R.alpha.2.sup.+ targets in 4-hr chromium release assays. [0066] e. Dependence on exogenous IL-2 for in vitro growth. [0067] f. Mycoplasma, fungal, bacterial sterility and endotoxin levels <5 EU/ml. [0068] g. In vitro sensitivity of clones to ganciclovir.

[0069] Peripheral blood mononuclear cells are obtained from the patient by leukapheresis, preferably following recovery from initial resection surgery and at a time at least three weeks from tapering off steroids and/or their most recent systemic chemotherapy. The target leukapheresis mononuclear cell yield is 5.times.10.sup.9 and the target number of hygromycin-resistant cytolytic T cell clones is 25 with the expectation that at least five clones will be identified that meet all quality control parameters for ex-vivo expansion. Clones are cryopreserved and patients monitored by serial radiographic and clinical examinations. When recurrence of progression of disease is documented, patients undergo a re-resection and/or placement of a reservoir-access device (Omaya reservoir) for delivering T cells to the tumor resection cavity. Following recovery from surgery and tapering of steroids, if applicable, the patient commences with T cell therapy.

[0070] The patient receives a target of at least four one-week cycles of therapy. During the first cycle, cell dose escalation proceeds from an initial dose on Day 0 of 10.sup.7 cells, followed by 5.times.10.sup.7 cells on Day 3 to the target-dose of 10.sup.8 cells on Day 5. Cycle 2 commences as early as one week from commencement of cycle 1. Those patients demonstrating tumor regression with residual disease on MRI may have additional courses of therapy beginning no earlier than Week 7 consisting of repetition of Cycles 3 and 4 followed by one week of rest/restaging provided these treatments are well tolerated (max. toxicities <grade 3) until such time that disease progression or a CR is achieved based on radiographic evaluation.

[0071] Cell doses are at least a log less than doses given in studies employing intracavitary LAK cells (individual cell doses of up to 10.sup.9 and cumulative cell numbers as high as 2.75.times.10.sup.10 have been safety administered), ex vivo expanded TILs (up to 10.sup.9 cells/dose reported with minimal toxicity) and allo-reactive lymphocyte (starting cell dose 10.sup.8 with cumulative cell doses up to 51.5.times.10.sup.8) delivered to a similar patient population.sup.75-85. The rationale for the lower cell doses as proposed in this protocol is based on the increased in vitro reactivity/anti-tumor potency of IL-13 zetakine+ CTL clones compared to the modest reactivity profile of previously utilized effector cell populations. Low-dose repetitive dosing is favored to avoid potentially dangerous inflammatory responses that might occur with single large cell number instillations. Each infusion will consist of a single T cell clone. The same clone will be administered throughout a patient's treatment course. On the days of T cell administration, expanded clones are aseptically processed by washing twice in 50 cc of PBS then resuspended in pharmaceutical preservative-free normal saline in a volume that results in the cell dose for patient delivery in 2 mls. T cells are instilled over 5-10 minutes. A 2 ml PFNS flush will be administered over 5 minutes following T cells. Response to therapy is assessed by brain MRI+/-gandolinium, with spectroscopy.

[0072] Expected side-effects of administration of T cells into glioma resection cavities typically consist of self-limited nausea and vomiting, fever, and transient worsening of existing neurological deficits. These toxicities can be attributed to both the local inflammation/edema in the tumor bed mediated by T cells in combination with the action of secreted cytokines. These side-effects typically are transient and less than grade II in severity. Should patients experience more severe toxicities it is expected that decadron alone or in combination with ganciclovir will attenuate the inflammatory process and ablate the infused cells. The inadvertent infusion of a cell product that is contaminated with bacteria or fungus has the potential of mediating serious or life-threatening toxicities. Extensive pre-infusion culturing of the cell product is conducted to identify contaminated tissue culture flasks and minimize this possibility. On the day of re-infusion, gram stains of culture fluids, as well as, endotoxin levels are performed.

[0073] Extensive molecular analysis for expression of IL-13R.alpha.2 has demonstrated that this molecule is tumor-specific in the context of the CNS.sup.44; 46; 48; 54 Furthermore, the only human tissue with demonstrable IL-13R.alpha.2 expression appears to be the testis.sup.42. This tumor-testis restrictive pattern of expression is reminiscent of the growing number of tumor antigens (i.e. MAGE, BAGE, GAGE) expressed by a variety of human cancers, most notably melanoma and renal cell carcinoma.sup.109-111. Clinical experience with vaccine and adoptive T cell therapy has demonstrated that this class of antigens can be exploited for systemic tumor immunotherapy without concurrent autoimmune attack of the testis.sup.112-114. Presumably this selectively reflects the effect of an intact blood-testis barrier and an immunologically privileged environment within the testis. Despite the exquisite specificity of the mutant IL-13 targeting moiety, toxicities are theoretically possible if cells egress into the systemic circulation in sufficient numbers and recognize tissues expressing the IL-13R.alpha.1/IL-4.beta. receptor. In light of this remote risk, as well as the possibility that instilled T cells in some patients may mediate an overly exuberant inflammatory response in the tumor bed, clones are equipped with the HyTK gene which renders T cells susceptible to in vivo ablation with ganciclovir.sup.115-118. Ganciclovir-suicide, in combination with an intra-patient T cell dose escalation strategy, helps minimize the potential risk to research participants.

[0074] Side effects associated with therapy (headache, fever, chills, nausea, etc.) are managed using established treatments appropriate for the condition. The patient receives ganciclovir if any new grade 3 or any grade 4 treatment-related toxicity is observed that, in the opinion of the treating physician, puts that patient at significant medical danger. Parentally administered ganciclovir is dosed at 10 mg/kg/day divided every 12 hours. A 14-day course will be prescribed but may be extended should symptomatic resolution not be achieved in that time interval. Treatment with ganciclovir leads to the ablation of IL-13 zetakine.sup.+ HyTK.sup.+ CD8.sup.+ CTL clones. Patients should be hospitalized for the first 72 hours of ganciclovir therapy for monitoring purposes. If symptoms do not respond to ganciclovir within 48 hours additional immunosuppressive agents including but not limited to corticosteroids and cyclosporin may be added at the discretion of the treating physician. If toxicities are severe, decadron and/or other immunosuppressive drugs along with ganciclovir are used earlier at the discretion of the treating physician.

Example 7

Additional Preferred DNA Vectors

[0075] Additional DNA vectors are shown in FIGS. 13 and 14. Table I, below contains further information concerning the sequence of FIG. 13. See FIG. 10 for a map of this vector.

TABLE-US-00003 TABLE I Plasmid DNA Vector Sequence Contents for SEQ ID NO: 19. Plasmid Location Element Description (bases) hEF1p Human Elongation Factor-1.alpha. Promoter 6-549 IL13zetakine IL13 cytokine fused to Fc: .zeta. 690-2183 Late SV40pAn Simian Virus 40 Late polyadenylation 2230-2498 signal Ori ColE1 A minimal E. coli origin of replication 2499-3245 SpAn A synthetic poly A and Pause site 3246-3432 hCMV-1Aprom Immediate-early CMV enhancer/promoter 3433-4075 HyTK Genetic fusion of the Hygromycin 4244-6319 Resistance and Thymidine Kinase coding regions BGh pAn Bovine growth hormone polyadenylation 6320-6618 signal and a transcriptional pause

REFERENCES

[0076] 1. Davis F G, McCarthy B J. Epidemiology of brain tumors. Curr Opin Neurol. 2000; 13:635-640. [0077] 2. Davis F G, Malinski N, Haenszel W, et al. Primary brain tumor incidence rates in four United States regions, 1985-1989: a pilot study. Neuroepidemiology. 1996; 15:103-112. [0078] 3. Smith M A, Freidlin B, Ries L A, Simon R. Increased incidence rates but no space-time clustering of childhood astrocytoma in Sweden, 1973-1992: a population-based study of pediatric brain tumors. Cancer. 2000; 88:1492-1493. [0079] 4. Ahsan H, Neugut A I, Bruce J N. Trends in incidence of primary malignant brain tumors in USA, 1981-1990. Int J. Epidemiol. 1995; 24:1078-1085. [0080] 5. Ashby L S, Obbens E A, Shapiro W R. Brain tumors. Cancer Chemother Biol Response Modif. 1999; 18:498-549. [0081] 6. Davis F G, Freels S, Grutsch J, Barlas S, Brem S. Survival rates in patients with primary malignant brain tumors stratified by patient age and tumor histological type: an analysis based on Surveillance, Epidemiology, and End Results (SEER) data, 1973-1991. J. Neurosurg. 1998; 88:1-10. [0082] 7. Duffner P K, Cohen M E, Myers M H, Heise H W. Survival of children with brain tumors: SEER Program, 1973-1980. Neurology. 1986; 36:597-601. [0083] 8. Davis F G, Freels S, Grutsch J, Barlas S, Brem S. Survival rates in patients with primary malignant brain tumors stratified by patient age and tumor histological type: an analysis based on Surveillance, Epidemiology, and End Results (SEER) data, 1973-1991. J. Neurosurg. 1998; 88:1-10. [0084] 9. Kolles H, Niedermayer I, Feiden W. Grading of astrocytomas and oligodendrogliomas. Pathologe. 1998; 19:259-268. [0085] 10. Huncharek M, Muscat J. Treatment of recurrent high grade astrocytoma; results of a systematic review of 1,415 patients. Anticancer Res. 1998; 18:1303-1311. [0086] 11. Loiseau H, Kantor G. The role of surgery in the treatment of glial tumors. Cancer Radiother. 2000; 4 Suppl 1:48s-52s. [0087] 12. Palma L. Trends in surgical management of astrocytomas and other brain gliomas. Forum (Genova).1998; 8:272-281. [0088] 13. Azizi S A, Miyamoto C. Principles of treatment of malignant gliomas in adults: an overview. J. Neurovirol. 1998; 4:204-216. [0089] 14. Shapiro W R, Shapiro J R. Biology and treatment of malignant, glioma. Oncology (Huntingt). 1998; 12:233-240. [0090] 15. Chamberlain M C, Kormanik P A. Practical guidelines for the treatment of malignant gliomas. West J. Med. 1998; 168:114-120. [0091] 16. Ushio Y. Treatment of gliomas in adults. Curr Opin Oncol. 1991; 3:467-475. [0092] 17. Scott J N, Rewcastle N B, Brasher P M, et al. Long-term glioblastoma multiforme survivors: a population-based study. Can J Neurol Sci. 1998; 25:197-201. [0093] 18. Finlay J L, Wisoff J H. The impact of extent of resection in the management of malignant gliomas of childhood. Childs Nerv Syst. 1999; 15:786-788. [0094] 19. Hess K R. Extent of resection as a prognostic variable in the treatment of gliomas. J. Neurooncol. 1999; 42:227-231. [0095] 20. van den Bent M J. Chemotherapy in adult malignant glioma. Front Radiat Ther Oncol. 1999; 33:174-191. [0096] 21. DeAngelis L M, Burger P C, Green S B, Cairncross J G. Malignant glioma: who benefits from adjuvant chemotherapy? Ann Neurol. 1998; 44:691-695. [0097] 22. Armstrong T S, Gilbert M R. Chemotherapy of astrocytomas: an overview. Semin Oncol Nurs. 1998; 14:18-25. [0098] 23. Prados M D, Russo C. Chemotherapy of brain tumors. Semin Surg Oncol. 1998; 14:88-95. [0099] 24. Prados M D, Scott C, Curran W J, Nelson D F, Leibel S, Kramer S. Procarbazine, lomustine, and vincristine (PCV) chemotherapy for anaplastic astrocytoma: A retrospective review of radiation therapy oncology group protocols comparing survival with carmustine or PCV adjuvant chemotherapy. J Clin Oncol. 1999; 17:3389-3395. [0100] 25. Fine H A, Dear K B, Loeffler J S, Black P M, Canellos G P. Meta-analysis of radiation therapy with and without adjuvant chemotherapy for malignant gliomas in adults. Cancer. 1993; 71:2585-2597. [0101] 26. Mahaley M S, Gillespie G Y. New therapeutic approaches to treatment of malignant gliomas: chemotherapy and immunotherapy. Clin Neurosurg. 1983; 31:456-469. [0102] 27. Millot F, Delval O, Giraud C, et al. High-dose chemotherapy with hematopoietic stem cell transplantation in adults with bone marrow relapse of medulloblastoma: report of two cases. Bone Marrow Transplant. 1999; 24:1347-1349. [0103] 28. Kalifa C, Valteau D, Pizer B, Vassal G, Grill J, Hartmann O. High-dose chemotherapy in childhood brain tumours. Childs Nerv Syst. 1999; 15:498-505. [0104] 29. Finlay J L. The role of high-dose chemotherapy and stem cell rescue in the treatment of malignant brain tumors. Bone Marrow Transplant. 1996; 18 Suppl 3:S1-S5. [0105] 30. Brandes A A, Vastola F, Monfardini S. Reoperation in recurrent high-grade gliomas: literature review of prognostic factors and outcome. Am J Clin Oncol. 1999; 22:387-390. [0106] 31. Miyagi K, Ingram M, Techy G B, Jacques D B, Freshwater D B, Sheldon H. Immunohistochemical detection and correlation between MHC antigen and cell-mediated immune system in recurrent glioma by APAAP method. Neurol Med Chir (Tokyo). 1990; 30:649-655. [0107] 32. Bauman G S, Sneed P K, Wara W M, et al. Reirradiation of primary CNS tumors. Int Radiat Oncol Biol Phys. 1996; 36:433-441. [0108] 33. Fine H A. Novel biologic therapies for malignant gliomas. Antiangiogenesis, immunotherapy, and gene therapy. Neurol Clin. 1995; 13:827-846. [0109] 34. Brandes A A, Pasetto L M. New therapeutic agents in the treatment of recurrent high-grade gliomas. Forum (Genova). 2000; 10:121-131. [0110] 35. Pollack I F, Okada H, Chambers W H. Exploitation of immune mechanisms in the treatment of central nervous system cancer. Semin Pediatr Neurol. 2000; 7:131-143. [0111] 36. Black K L, Pikul B K. Gliomas--past, present, and future. Clin Neurosurg. 1999; 45:160-163. [0112] 37. Riva P, Franceschi G, Arista A, et al. Local application of radiolabeled monoclonal antibodies in the treatment of high grade malignant gliomas: a six-year clinical experience. Cancer. 1997; 80:2733-2742. [0113] 38. Liang B C, Weil M. Locoregional approaches to therapy with gliomas as the paradigm. Curr Opin Oncol. 1998; 10:201-206. [0114] 39. Yu J S, Wei M X, Chiocca E A, Martuza R L, Tepper R I. Treatment of glioma by engineered interleukin 4-secreting cells. Cancer Res. 1993; 53:3125-3128. [0115] 40. Alavi J B, Eck S L. Gene therapy for malignant gliomas. Hematol Oncol Clin North Am. 1998; 12:617-629. [0116] 41. Debinski W. Recombinant cytotoxins specific for cancer cells. Ann N Y Acad. Sci. 1999; 886:297-299. [0117] 42. Debinski W, Gibo D M. Molecular expression analysis of restrictive receptor for interleukin 13, a brain tumor-associated cancer/testis antigen. Mol. Med. 2000; 6:440-449. [0118] 43. Mintz A, Debinski W. Cancer genetics/epigenetics and the X chromosome: possible new links for malignant glioma pathogenesis and immune-based therapies. Crit. Rev Oncog. 2000; 11:77-95. [0119] 44. Joshi B H, Plautz G E, Puri R K. Interleukin-13 receptor alpha chain: a novel tumor-associated transmembrane protein in primary explants of human malignant gliomas. Cancer Res. 2000; 60:1168-1172. [0120] 45. Debinski W, Obiri N I, Powers S K, Pastan I, Puri R K. Human glioma cells overexpress receptors for interleukin 13 and are extremely sensitive to a novel chimeric protein composed of interleukin 13 and pseudomonas exotoxin. Clin Cancer Res. 1995; 1:1253-1258. [0121] 46. Debinski W, Gibo D M, Hulet S W, Connor J R, Gillespie G Y. Receptor for interleukin 13 is a marker and therapeutic target for human high-grade gliomas. Clin Cancer Res. 1999; 5:985-990. [0122] 47. Debinski W. An immune regulatory cytokine receptor and glioblastoma multiforme: an unexpected link. Crit. Rev Oncog. 1998; 9:255-268. [0123] 48. Debinski W, Slagle B, Gibo D M, Powers S K, Gillespie G Y. Expression of a restrictive receptor for interleukin 13 is associated with glial transformation. J. Neurooncol. 2000; 48:103-111. [0124] 49. Debinski W, Miner R, Leland P, Obiri N I, Puri R K. Receptor for interleukin (IL) 13 does not interact with IL4 but receptor for IL4 interacts with IL13 on human glioma cells. J Biol. Chem. 1996; 271:22428-22433. [0125] 50. Murata T, Obiri N I, Debinski W, Puri R K. Structure of IL-13 receptor: analysis of subunit composition in cancer and immune cells. Biochem Biophys Res Commun. 1997; 238:90-94. [0126] 51. Opal S M, DePalo V A. Anti-inflammatory cytokines. Chest. 2000; 117:1162-1172. [0127] 52. Romagnani S. T-cell subsets (Th1 versus Th2). Ann Allergy Asthma Immunol. 2000; 85:9-18. [0128] 53. Spellberg B, Edwards J E, Jr. Type 1/Type 2 immunity in infectious diseases. Clin Infect Dis. 2001; 32:76-102. [0129] 54. Liu H, Jacobs B S, Liu J, et al. Interleukin-13 sensitivity and receptor phenotypes of human glial cell lines: non-neoplastic glia and low-grade astrocytoma differ from malignant glioma. Cancer Immunol Immunother. 2000; 49:319-324. [0130] 55. Debinski W, Gibo D M, Obiri N I, Kealiher A, Puri R K. Novel anti-brain tumor cytotoxins specific for cancer cells. Nat. Biotechnol. 1998; 16:449-453. [0131] 56. Debinski W, Gibo D M, Puri R K. Novel way to increase targeting specificity to a human glioblastoma-associated receptor for interleukin 13. Int J. Cancer. 1998; 76:547-551. [0132] 57. Debinski W, Thompson J P. Retargeting interleukin 13 for radioimmunodetection and radioimmunotherapy of human high-grade gliomas. Clin Cancer Res. 1999; 5:3143s-3147s. [0133] 58. Thompson J P, Debinski W. Mutants of interleukin 13 with altered reactivity toward interleukin 13 receptors. J Biol. Chem. 1999; 274:29944-29950. [0134] 59. Brooks W H, Netsky M G, Levine J E. Immunity and tumors of the nervous system. Surg Neurol. 1975; 3:184-186. [0135] 60. Bullard D E, Gillespie G Y, Mahaley M S, Bigner D D. Immunobiology of human gliomas. Semin Oncol. 1986; 13:94-109. [0136] 61. Coakham H B. Immunology of human brain tumors. Eur J Cancer Clin Oncol. 1984; 20:145-149. [0137] 62. Holladay F P, Heitz T, Wood G W. Antitumor activity against established intracerebral gliomas exhibited by cytotoxic T lymphocytes, but not by lymphokine-activated killer cells. J. Neurosurg. 1992; 77:757-762. [0138] 63. Holladay F P, Heitz T, Chen Y L, Chiga M, Wood G W. Successful treatment of a malignant rat glioma with cytotoxic T lymphocytes. Neurosurgery. 1992; 31:528-533. [0139] 64. Kruse C A, Lillehei K O, Mitchell D H, Kleinschmidt-DeMasters B, Bellgrau D. Analysis of interleukin 2 and various effector cell populations in adoptive immunotherapy of 9L rat gliosarcoma: allogeneic cytotoxic T lymphocytes prevent tumor take. Proc Natl Acad Sci USA. 1990; 87:9577-9581. [0140] 65. Miyatake S, Nishihara K, Kikuchi H, et al. Efficient tumor suppression by glioma-specific murine cytotoxic T lymphocytes transfected with interferon-gamma gene. J Natl Cancer Inst. 1990; 82:217-220. [0141] 66. Plautz G E, Touhalisky J E, Shu S. Treatment of murine gliomas by adoptive transfer of ex vivo activated tumor-draining lymph node cells. Cell Immunol. 1997; 178:101-107. [0142] 67. Saris S C, Spiess P, Lieberman D M, Lin S, Walbridge S, Oldfield E H. Treatment of murine primary brain tumors with systemic interleukin-2 and tumor-infiltrating lymphocytes. J. Neurosurg. 1992; 76:513-519. [0143] 68. Tzeng J J, Barth R F, Clendenon N R, Gordon W A. Adoptive immunotherapy of a rat glioma using lymphokine-activated killer cells and interleukin 2. Cancer Res. 1990; 50:4338-4343. [0144] 69. Yamasaki T, Kikuchi H. An experimental approach to specific adoptive immunotherapy for malignant brain tumors. Nippon Geka Hokan. 1989; 58:485-492. [0145] 70. Yamasaki T, Handa H, Yamashita J, Watanabe Y, Namba Y, Hanaoka M. Specific adoptive immunotherapy with tumor-specific cytotoxic T-lymphocyte clone for murine malignant gliomas. Cancer Res. 1984; 44:1776-1783. [0146] 71. Yamasaki T, Handa H, Yamashita J, Watanabe Y, Namba Y, Hanaoka M. Specific adoptive immunotherapy of malignant glioma with long-term cytotoxic T lymphocyte line expanded in T-cell growth factor. Experimental study and future prospects. Neurosurg Rev. 1984; 7:37-54. [0147] 72. Kikuchi K, Neuwelt E A. Presence of immunosuppressive factors in brain-tumor cyst fluid. J. Neurosurg. 1983; 59:790-799. [0148] 73. Yamanaka R, Tanaka R, Yoshida S, Saitoh T, Fujita K, Naganuma H. Suppression of TGF-beta1 in human gliomas by retroviral gene transfection enhances susceptibility to LAK cells. J. Neurooncol. 1999; 43:27-34. [0149] 74. Kuppner M C, Hamou M F, Bodmer S, Fontana A, de Tribolet N. The glioblastoma-derived T-cell suppressor factor/transforming growth factor beta 2 inhibits the generation of lymphokine-activated killer (LAK) cells. Int J. Cancer. 1988; 42:562-567. [0150] 75. Hayes R L. The cellular immunotherapy of primary brain tumors. Rev Neurol (Paris). 1992; 148:454-466. [0151] 76. Ingram M, Buckwalter J G, Jacques D B, et al. Immunotherapy for recurrent malignant glioma: an interim report on survival. Neurol Res. 1990; 12:265-273. [0152] 77. Jaeckle K A. Immunotherapy of malignant gliomas. Semin Oncol. 1994; 21:249-259. [0153] 78. Kruse C A, Cepeda L, Owens B, Johnson S D, Stears J, Lillehei K O. Treatment of recurrent glioma with intracavitary alloreactive cytotoxic T lymphocytes and interleukin-2. Cancer Immunol Immunother. 1997; 45:77-87. [0154] 79. Merchant R E, Baldwin N G, Rice C D, Bear H D. Adoptive immunotherapy of malignant glioma using tumor-sensitized T lymphocytes. Neurol Res. 1997; 19:145-152. [0155] 80. Nakagawa K, Kamezaki T, Shibata Y, Tsunoda T, Meguro K, Nose T. Effect of lymphokine-activated killer cells with or without radiation therapy against malignant brain tumors. Neurol Med Chir (Tokyo). 1995; 35:22-27. [0156] 81. Plautz G E, Barnett G H, Miller D W, et al. Systemic T cell adoptive immunotherapy of malignant gliomas. J. Neurosurg. 1998; 89:42-51. [0157] 82. Sankhla S K, Nadkarni J S, Bhagwati S N. Adoptive immunotherapy using lymphokine-activated killer (LAK) cells and interleukin-2 for recurrent malignant primary brain tumors. J. Neurooncol. 1996; 27:133-140. [0158] 83. Sawamura Y, de Tribolet N. Immunotherapy of brain tumors. J Neurosurg Sci. 1990; 34:265-278. [0159] 84. Thomas C, Schober R, Lenard H G, Lumenta C B, Jacques D B, Wechsler W. Immunotherapy with stimulated autologous lymphocytes in a case of a juvenile anaplastic glioma. Neuropediatrics. 1992; 23:123-125. [0160] 85. Tsurushima H, Liu S Q, Tuboi K, et al. Reduction of end-stage malignant glioma by injection with autologous cytotoxic T lymphocytes. Jpn J Cancer Res. 1999; 90:536-545. [0161] 86. Barba D, Saris S C, Holder C, Rosenberg S A, Oldfield E H. Intratumoral LAK cell and interleukin-2 therapy of human gliomas. J. Neurosurg. 1989; 70:175-182. [0162] 87. Hayes R L, Koslow M, Hiesiger E M, et al. Improved long term survival after intracavitary interleukin-2 and lymphokine-activated killer cells for adults with recurrent malignant glioma. Cancer. 1995; 76:840-852.

[0163] 88. Ingram M, Jacques S, Freshwater D B, Techy G B, Shelden C H, Helsper J T. Salvage immunotherapy of malignant glioma. Arch Surg. 1987; 122:1483-1486. [0164] 89. Jacobs S K, Wilson D J, Kornblith P L, Grimm E A. Interleukin-2 or autologous lymphokine-activated killer cell treatment of malignant glioma: phase I trial. Cancer Res. 1986; 46:2101-2104. [0165] 90. Jeffes E W, III, Beamer Y B, Jacques S, et al. Therapy of recurrent high-grade gliomas with surgery, autologous mitogen-activated IL-2-stimulated (MAK) killer lymphocytes, and rIL-2: II. Correlation of survival with MAK cell tumor necrosis factor production in vitro. Lymphokine Cytokine Res. 1991; 10:89-94. [0166] 91. Merchant R E, McVicar D W, Merchant L H, Young H F. Treatment of recurrent malignant glioma by repeated intracerebral injections of human recombinant interleukin-2 alone or in combination with systemic interferon-alpha. Results of a phase I clinical trial. J. Neurooncol. 1992; 12:75-83. [0167] 92. Yoshida S, Takai N, Saito T, Tanaka R. Adoptive immunotherapy in patients with malignant glioma. Gan To Kagaku Ryoho. 1987; 14:1930-1932. [0168] 93. Davico B L, De Monte L B, Spagnoli G C, et al. Bispecific monoclonal antibody anti-CD3 x anti-tenascin: an immunotherapeutic agent for human glioma. Int J. Cancer. 1995; 61:509-515. [0169] 94. Jung G, Brandl M, Eisner W, et al. Local immunotherapy of glioma patients with a combination of 2 bispecific antibody fragments and resting autologous lymphocytes: evidence for in situ t-cell activation and therapeutic efficacy. Int J.Cancer. 2001; 91:225-230. [0170] 95. Pfosser A, Brandl M, Salih H, Grosse-Hovest L, Jung G. Role of target antigen in bispecific-antibody-mediated killing of human glioblastoma cells: a pre-clinical study. Int J. Cancer. 1999; 80:612-616. [0171] 96. Yoshida J, Takaoka T, Mizuno M, Momota H, Okada H. Cytolysis of malignant glioma cells by lymphokine-activated killer cells combined with anti-CD3/antiglioma bifunctional antibody and tumor necrosis factor-alpha. J Surg Oncol. 1996; 62:177-182. [0172] 97. Imaizumi T, Kuramoto T, Matsunaga K, et al. Expression of the tumor-rejection antigen SART1 in brain tumors. Int J. Cancer. 1999; 83:760-764. [0173] 98. Eshhar Z, Waks T, Gross G, Schindler D G. Specific activation and targeting of cytotoxic lymphocytes through chimeric single chains consisting of antibody-binding domains and the gamma or zeta subunits of the immunoglobulin and T-cell receptors. Proc Natl Acad Sci USA. 1993; 90:720-724. [0174] 99. Haynes N M, Snook M B, Trapani J A, et al. Redirecting mouse CTL against colon carcinoma: superior signaling efficacy of single-chain variable domain chimeras containing TCR-zeta vs Fc epsilon RI-gamma. J. Immunol. 2001; 166:182-187. [0175] 100. Hombach A, Heuser C, Sircar R, et al. An anti-CD30 chimeric receptor that mediates CD3-zeta-independent T-cell activation against Hodgkin's lymphoma cells in the presence of soluble CD30. Cancer Res. 1998; 58:1116-1119. [0176] 101. Hombach A, Schneider C, Sent D, et al. An entirely humanized CD3 zeta-chain signaling receptor that directs peripheral blood t cells to specific lysis of carcinoembryonic antigen-positive tumor cells. Int J. Cancer. 2000; 88:115-120. [0177] 102. Hombach A, Sircar R, Heuser C, et al. Chimeric anti-TAG72 receptors with immunoglobulin constant Fc domains and gamma or zeta signalling chains. Int J Mol. Med. 1998; 2:99-103. [0178] 103. Moritz D, Wels W, Mattern J, Groner B. Cytotoxic T lymphocytes with a grafted recognition specificity for ERBB2-expressing tumor cells. Proc Natl Acad Sci USA. 1994; 91:4318-4322. [0179] 104. Weijtens M E, Willemsen R A, Valerio D, Stam K, Bolhuis R L. Single chain Ig/gamma gene-redirected human T lymphocytes produce cytokines, specifically lyse tumor cells, and recycle lytic capacity. J. Immunol. 1996; 157:836-843. [0180] 105. Altenschmidt U, Klundt E, Groner B. Adoptive transfer of in vitro-targeted, activated T lymphocytes results in total tumor regression. J. Immunol. 1997; 159:5509-5515. [0181] 106. Jensen M, Tan G, Forman S, Wu A M, Raubitschek A. CD20 is a molecular target for scFvFc:zeta receptor redirected T cells: implications for cellular immunotherapy of CD20+ malignancy. Biol Blood Marrow Transplant. 1998; 4:75-83. [0182] 107. Jensen M C, Clarke P, Tan G, et al. Human T lymphocyte genetic modification with naked DNA. Mol. Ther. 2000; 1:49-55. [0183] 108. Minty A, Chalon P, Derocq J M, et al. Interleukin-13 is a new human lymphokine regulating inflammatory and immune responses. Nature. 1993; 362:248-250. [0184] 109. Boon T, Cerottini J C, Van den E B, van der B P, Van Pel A. Tumor antigens recognized by T lymphocytes. Annu Rev Immunol. 1994; 12:337-365. [0185] 110. Castelli C, Rivoltini L, Andreola G, Carrabba M, Renkvist N. Parmiani G. T-cell recognition of melanoma-associated antigens. J Cell Physiol. 2000; 182:323-331. [0186] 111. Chi D D, Merchant R E, R and R, et al. Molecular detection of tumor-associated antigens shared by human cutaneous melanomas and gliomas. Am J. Pathol. 1997; 150:2143-2152. [0187] 112. Boon T, Coulie P, Marchand M, Weynants P, Wolfel T, Brichard V. Genes coding for tumor rejection antigens: perspectives for specific immunotherapy. Important Adv Oncol. 1994;53-69. [0188] 113. Cebon J, MacGregor D, Scott A, DeBoer R. Immunotherapy of melanoma: targeting defined antigens. Australas J. Dermatol. 1997; 38 Suppl 1:S66-S72. [0189] 114. Greenberg P D, Riddell S R. Tumor-specific T-cell immunity: ready for prime time? J Natl Cancer Inst. 1992; 84:1059-1061. [0190] 115. Cohen J L, Saron M F, Boyer O, et al. Preservation of graft-versus-infection effects after suicide gene therapy for prevention of graft-versus-host disease. Hum Gene Ther. 2000; 11:2473-2481. [0191] 116. Drobyski W R, Morse H C, III, Burns W H, Casper J T, Sandford G. Protection from lethal murine graft-versus-host disease without compromise of alloengraftment using transgenic donor T cells expressing a thymidine kinase suicide gene. Blood. 2001; 97:2506-2513. [0192] 117. Link C J, Jr., Traynor A, Seregina T, Burt R K. Adoptive immunotherapy for leukemia: donor lymphocytes transduced with the herpes simplex thymidine kinase gene. Cancer Treat Res. 1999; 101:369-375. [0193] 118. Spencer D M. Developments in suicide genes for preclinical and clinical applications. Curr Opin Mol. Ther. 2000; 2:433-440.

Sequence CWU 1

1

181102DNAHomo sapiensmisc_feature(4)..(9)EcoRI restriction site 1tatgaattca tggcgctttt gttgaccacg gtcattgctc tcacttgcct tggcggcttt 60gcctccccag gccctgtgcc tccctctaca gccctcaggt ac 1022101DNAHomo sapiens 2gttgatgctc cataccatgc tgccattgca gagcggagcc ttctggttct gggtgatgtt 60gaccagctcc tcaatgaggt acctgagggc tgtagaggga g 1013100DNAHomo sapiens 3ctctgggtct tctcgatggc actgcagcct gacacgttga tcagggattc cagggctgca 60cagtacatgc cagctgtcag gttgatgctc cataccatgc 1004100DNAHomo sapiens 4cctcgatttt ggtgtctcgg acatgcaagc tggaaaactg cccagctgag accttgtgcg 60ggcagaatcc gctcagcatc ctctgggtct tctcgatggc 100596DNAHomo sapiensmisc_feature(3)..(8)BamHI restriction site 5tcggatcctc agttgaaccg tccctcgcga aaaagtttct ttaaatgtaa gagcaggtcc 60tttacaaact gggccacctc gattttggtg tctcgg 96639DNAHomo sapiens 6caacctgaca gctggcatgt actgtgcagc cctggaatc 39739DNAHomo sapiens 7gattccaggg ctgcacagta catgccagct gtcaggttg 39843DNAHomo sapiensmisc_feature(4)..(9)XbaI restriction site 8atctctagag ccgccaccat gcttctcctg gtgacaagcc ttc 43934DNAHomo sapiens 9gagggaggca cagggcctgg gatcaggagg aatg 341034DNAHomo sapiens 10cattcctcct gatcccaggc cctgtgcctc cctc 341135DNAHomo sapiens 11gggaccatat ttggactcgt tgaaccgtcc ctcgc 351235DNAHomo sapiens 12gcgagggacg gttcaacgag tccaaatatg gtccc 351326DNAHomo sapiensmisc_feature(3)..(10)NotI restriction site 13atgcggccgc tcagcgaggg ggcagg 26146783DNAArtificial Sequenceplasmid DNA vector incorporating human, simian virus 40, E. coli,cytomegalovirus and bovine sequences 14tcgaaggatc tgcgatcgct ccggtgcccg tcagtgggca gagcgcacat cgcccacagt 60ccccgagaag ttggggggag gggtcggcaa ttgaaccggt gcctagagaa ggtggcgcgg 120ggtaaactgg gaaagtgatg tcgtgtactg gctccgcctt tttcccgagg gtgggggaga 180accgtatata agtgcagtag tcgccgtgaa cgttcttttt cgcaacgggt ttgccgccag 240aacacagctg aagcttcgag gggctcgcat ctctccttca cgcgcccgcc gccctacctg 300aggccgccat ccacgccggt tgagtcgcgt tctgccgcct cccgcctgtg gtgcctcctg 360aactgcgtcc gccgtctagg taagtttaaa gctcaggtcg agaccgggcc tttgtccggc 420gctcccttgg agcctaccta gactcagccg gctctccacg ctttgcctga ccctgcttgc 480tcaactctac gtctttgttt cgttttctgt tctgcgccgt tacagatcca agctgtgacc 540ggcgcctacg taagtgatat ctactagatt tatcaaaaag agtgttgact tgtgagcgct 600cacaattgat acggattcat cgagagggac acgtcgacta ctaaccttct tctctttcct 660acagctgaga tcaccctaga gccgccacca tgcttctcct ggtgacaagc cttctgctct 720gtgagttacc acacccagca ttcctcctga tcccaggccc tgtgcctccc tctacagccc 780tcaggtacct cattgaggag ctggtcaaca tcacccagaa ccagaaggct ccgctctgca 840atggcagcat ggtatggagc atcaacctga cagctggcat gtactgtgca gccctggaat 900ccctgatcaa cgtgtcaggc tgcagtgcca tcgagaagac ccagaggatg ctgagcggat 960tctgcccgca caaggtctca gctgggcagt tttccagctt gcatgtccga gacaccaaaa 1020tcgaggtggc ccagtttgta aaggacctgc tcttacattt aaagaaactt tttcgcgagg 1080gacggttcaa cgagtccaaa tatggtcccc catgcccacc atgcccagca cctgagttcc 1140tggggggacc atcagtcttc ctgttccccc caaaacccaa ggacactctc atgatctccc 1200ggacccctga ggtcacgtgc gtggtggtgg acgtgagcca ggaagacccc gaggtccagt 1260tcaactggta cgtggatggc gtggaggtgc ataatgccaa gacaaagccg cgggaggagc 1320agttcaacag cacgtaccgt gtggtcagcg tcctcaccgt cctgcaccag gactggctga 1380acggcaagga gtacaagtgc aaggtctcca acaaaggcct cccgtcctcc atcgagaaaa 1440ccatctccaa agccaaaggg cagccccgag agccacaggt gtacaccctg cccccatccc 1500aggaggagat gaccaagaac caggtcagcc tgacctgcct ggtcaaaggc ttctacccca 1560gcgacatcgc cgtggagtgg gagagcaatg ggcagccgga gaacaactac aagaccacgc 1620ctcccgtgct ggactccgac ggctccttct tcctctacag caggctaacc gtggacaaga 1680gcaggtggca ggaggggaat gtcttctcat gctccgtgat gcatgaggct ctgcacaacc 1740actacacaca gaagagcctc tccctgtccc taggtaaaat ggccctgatt gtgctggggg 1800gcgtcgccgg cctcctgctt ttcattgggc taggcatctt cttcagagtg aagttcagca 1860ggagcgcaga cgcccccgcg taccagcagg gccagaacca gctctataac gagctcaatc 1920taggacgaag agaggagtac gatgttttgg acaagagacg tggccgggac cctgagatgg 1980ggggaaagcc gagaaggaag aaccctcagg aaggcctgta caatgaactg cagaaagata 2040agatggcgga ggcctacagt gagattggga tgaaaggcga gcgccggagg ggcaaggggc 2100acgatggcct ttaccagggt ctcagtacag ccaccaagga cacctacgac gcccttcaca 2160tgcaggccct gccccctcgc tgagcggccg gcgaaggagg cctagatcta tcgattgtac 2220agctagctcg acatgataag atacattgat gagtttggac aaaccacaac tagaatgcag 2280tgaaaaaaat gctttatttg tgaaatttgt gatgctattg ctttatttgt gaaatttgtg 2340atgctattgc tttatttgta accattataa gctgcaataa acaagttaac aacaacaatt 2400gcattcattt tatgtttcag gttcaggggg aggtgtggga ggttttttaa agcaagtaaa 2460acctctacaa atgtggtaga tccatttaaa tgttagcgaa gaacatgtga gcaaaaggcc 2520agcaaaaggc caggaaccgt aaaaaggccg cgttgctggc gtttttccat aggctccgcc 2580cccctgacga gcatcacaaa aatcgacgct caagtcagag gtggcgaaac ccgacaggac 2640tataaagata ccaggcgttt ccccctggaa gctccctcgt gcgctctcct gttccgaccc 2700tgccgcttac cggatacctg tccgcctttc tcccttcggg aagcgtggcg ctttctcaat 2760gctcacgctg taggtatctc agttcggtgt aggtcgttcg ctccaagctg ggctgtgtgc 2820acgaaccccc cgttcagccc gaccgctgcg ccttatccgg taactatcgt cttgagtcca 2880acccggtaag acacgactta tcgccactgg cagcagccac tggtaacagg attagcagag 2940cgaggtatgt aggcggtgct acagagttct tgaagtggtg gcctaactac ggctacacta 3000gaagaacagt atttggtatc tgcgctctgc tgaagccagt taccttcgga aaaagagttg 3060gtagctcttg atccggcaaa caaaccaccg ctggtagcgg tggttttttt gtttgcaagc 3120agcagattac gcgcagaaaa aaaggatctc aagaagatcc tttgatcttt tctacggggt 3180ctgacgctca gtggaacgaa aactcacgtt aagggatttt ggtcatggct agttaattaa 3240gctgcaataa acaatcatta ttttcattgg atctgtgtgt tggttttttg tgtgggcttg 3300ggggaggggg aggccagaat gactccaaga gctacaggaa ggcaggtcag agaccccact 3360ggacaaacag tggctggact ctgcaccata acacacaatc aacaggggag tgagctggat 3420cgagctagag tccgttacat aacttacggt aaatggcccg cctggctgac cgcccaacga 3480cccccgccca ttgacgtcaa taatgacgta tgttcccata gtaacgccaa tagggacttt 3540ccattgacgt caatgggtgg agtatttacg gtaaactgcc cacttggcag tacatcaagt 3600gtatcatatg ccaagtacgc cccctattga cgtcaatgac ggtaaatggc ccgcctggca 3660ttatgcccag tacatgacct tatgggactt tcctacttgg cagtacatct acgtattagt 3720catcgctatt accatggtga tgcggttttg gcagtacatc aatgggcgtg gatagcggtt 3780tgactcacgg ggatttccaa gtctccaccc cattgacgtc aatgggagtt tgttttggca 3840ccaaaatcaa cgggactttc caaaatgtcg taacaactcc gccccattga cgcaaatggg 3900cggtaggcgt gtacggtggg aggtctatat aagcagagct cgtttagtga accgtcagat 3960cgcctggaga cgccatccac gctgttttga cctccataga agacaccggg accgatccag 4020cctccgcggc cgggaacggt gcattggaac gcggattccc cgtgccaaga gtgacgtaag 4080taccgcctat agagtctata ggcccaccta gttgtgaccg gcgcctagtg ttgacaatta 4140atcatcggca tagtatatcg gcatagtata atacgactca ctataggagg gccaccatgt 4200cgactactaa ccttcttctc tttcctacag ctgagatcac cggtaggagg gccatcatga 4260aaaagcctga actcaccgcg acgtctgtcg cgaagtttct gatcgaaaag ttcgacagcg 4320tctccgacct gatgcagctc tcggagggcg aagaatctcg tgctttcagc ttcgatgtag 4380gagggcgtgg atatgtcctg cgggtaaata gctgcgccga tggtttctac aaagatcgtt 4440atgtttatcg gcactttgca tcggccgcgc tcccgattcc ggaagtgctt gacattgggg 4500aattcagcga gagcctgacc tattgcatct cccgccgtgc acagggtgtc acgttgcaag 4560acctgcctga aaccgaactg cccgctgttc tgcaacccgt cgcggagctc atggatgcga 4620tcgctgcggc cgatcttagc cagacgagcg ggttcggccc attcggaccg caaggaatcg 4680gtcaatacac tacatggcgt gatttcatat gcgcgattgc tgatccccat gtgtatcact 4740ggcaaactgt gatggacgac accgtcagtg cgtccgtcgc gcaggctctc gatgagctga 4800tgctttgggc cgaggactgc cccgaagtcc ggcacctcgt gcacgcggat ttcggctcca 4860acaatgtcct gacggacaat ggccgcataa cagcggtcat tgactggagc gaggcgatgt 4920tcggggattc ccaatacgag gtcgccaaca tcttcttctg gaggccgtgg ttggcttgta 4980tggagcagca gacgcgctac ttcgagcgga ggcatccgga gcttgcagga tcgccgcggc 5040tccgggcgta tatgctccgc attggtcttg accaactcta tcagagcttg gttgacggca 5100atttcgatga tgcagcttgg gcgcagggtc gatgcgacgc aatcgtccga tccggagccg 5160ggactgtcgg gcgtacacaa atcgcccgca gaagcgcggc cgtctggacc gatggctgtg 5220tagaagtcgc gtctgcgttc gaccaggctg cgcgttctcg cggccatagc aaccgacgta 5280cggcgttgcg ccctcgccgg cagcaagaag ccacggaagt ccgcccggag cagaaaatgc 5340ccacgctact gcgggtttat atagacggtc cccacgggat ggggaaaacc accaccacgc 5400aactgctggt ggccctgggt tcgcgcgacg atatcgtcta cgtacccgag ccgatgactt 5460actggcgggt gctgggggct tccgagacaa tcgcgaacat ctacaccaca caacaccgcc 5520tcgaccaggg tgagatatcg gccggggacg cggcggtggt aatgacaagc gcccagataa 5580caatgggcat gccttatgcc gtgaccgacg ccgttctggc tcctcatatc gggggggagg 5640ctgggagctc acatgccccg cccccggccc tcaccctcat cttcgaccgc catcccatcg 5700ccgccctcct gtgctacccg gccgcgcggt accttatggg cagcatgacc ccccaggccg 5760tgctggcgtt cgtggccctc atcccgccga ccttgcccgg caccaacatc gtgcttgggg 5820cccttccgga ggacagacac atcgaccgcc tggccaaacg ccagcgcccc ggcgagcggc 5880tggacctggc tatgctggct gcgattcgcc gcgtttacgg gctacttgcc aatacggtgc 5940ggtatctgca gtgcggcggg tcgtggcggg aggactgggg acagctttcg gggacggccg 6000tgccgcccca gggtgccgag ccccagagca acgcgggccc acgaccccat atcggggaca 6060cgttatttac cctgtttcgg gcccccgagt tgctggcccc caacggcgac ctgtataacg 6120tgtttgcctg ggccttggac gtcttggcca aacgcctccg ttccatgcac gtctttatcc 6180tggattacga ccaatcgccc gccggctgcc gggacgccct gctgcaactt acctccggga 6240tggtccagac ccacgtcacc acccccggct ccataccgac gatatgcgac ctggcgcgca 6300cgtttgcccg ggagatgggg gaggctaact gagtcgagaa ttcgctagag ggccctattc 6360tatagtgtca cctaaatgct agagctcgct gatcagcctc gactgtgcct tctagttgcc 6420agccatctgt tgtttgcccc tcccccgtgc cttccttgac cctggaaggt gccactccca 6480ctgtcctttc ctaataaaat gaggaaattg catcgcattg tctgagtagg tgtcattcta 6540ttctgggggg tggggtgggg caggacagca agggggagga ttgggaagac aatagcaggc 6600atgcgcaggg cccaattgct cgagcggccg caataaaata tctttatttt cattacatct 6660gtgtgttggt tttttgtgtg aatcgtaact aacatacgct ctccatcaaa acaaaacgaa 6720acaaaacaaa ctagcaaaat aggctgtccc cagtgcaagt gcaggtgcca gaacatttct 6780cta 6783151491DNAHomo sapiens 15atgcttctcc tggtgacaag ccttctgctc tgtgagttac cacacccagc attcctcctg 60atcccaggcc ctgtgcctcc ctctacagcc ctcaggtacc tcattgagga gctggtcaac 120atcacccaga accagaaggc tccgctctgc aatggcagca tggtatggag catcaacctg 180acagctggca tgtactgtgc agccctggaa tccctgatca acgtgtcagg ctgcagtgcc 240atcgagaaga cccagaggat gctgagcgga ttctgcccgc acaaggtctc agctgggcag 300ttttccagct tgcatgtccg agacaccaaa atcgaggtgg cccagtttgt aaaggacctg 360ctcttacatt taaagaaact ttttcgcgag ggacggttca acgagtccaa atatggtccc 420ccatgcccac catgcccagc acctgagttc ctggggggac catcagtctt cctgttcccc 480ccaaaaccca aggacactct catgatctcc cggacccctg aggtcacgtg cgtggtggtg 540gacgtgagcc aggaagaccc cgaggtccag ttcaactggt acgtggatgg cgtggaggtg 600cataatgcca agacaaagcc gcgggaggag cagttcaaca gcacgtaccg tgtggtcagc 660gtcctcaccg tcctgcacca ggactggctg aacggcaagg agtacaagtg caaggtctcc 720aacaaaggcc tcccgtcctc catcgagaaa accatctcca aagccaaagg gcagccccga 780gagccacagg tgtacaccct gcccccatcc caggaggaga tgaccaagaa ccaggtcagc 840ctgacctgcc tggtcaaagg cttctacccc agcgacatcg ccgtggagtg ggagagcaat 900gggcagccgg agaacaacta caagaccacg cctcccgtgc tggactccga cggctccttc 960ttcctctaca gcaggctaac cgtggacaag agcaggtggc aggaggggaa tgtcttctca 1020tgctccgtga tgcatgaggc tctgcacaac cactacacac agaagagcct ctccctgtct 1080ctgggtaaaa tggccctgat tgtgctgggg ggcgtcgccg gcctcctgct tttcattggg 1140ctaggcatct tcttcagagt gaagttcagc aggagcgcag acgcccccgc gtaccagcag 1200ggccagaacc agctctataa cgagctcaat ctaggacgaa gagaggagta cgatgttttg 1260gacaagagac gtggccggga ccctgagatg gggggaaagc cgagaaggaa gaaccctcag 1320gaaggcctgt acaatgaact gcagaaagat aagatggcgg aggcctacag tgagattggg 1380atgaaaggcg agcgccggag gggcaagggg cacgatggcc tttaccaggg tctcagtaca 1440gccaccaagg acacctacga cgcccttcac atgcaggccc tgccccctcg c 1491166783DNAArtificial Sequenceplasmid DNA vector incorporating human, simian virus 40, E. coli, cytomegalovirus and bovine sequences 16tagagaaatg ttctggcacc tgcacttgca ctggggacag cctattttgc tagtttgttt 60tgtttcgttt tgttttgatg gagagcgtat gttagttacg attcacacaa aaaaccaaca 120cacagatgta atgaaaataa agatatttta ttgcggccgc tcgagcaatt gggccctgcg 180catgcctgct attgtcttcc caatcctccc ccttgctgtc ctgccccacc ccacccccca 240gaatagaatg acacctactc agacaatgcg atgcaatttc ctcattttat taggaaagga 300cagtgggagt ggcaccttcc agggtcaagg aaggcacggg ggaggggcaa acaacagatg 360gctggcaact agaaggcaca gtcgaggctg atcagcgagc tctagcattt aggtgacact 420atagaatagg gccctctagc gaattctcga ctcagttagc ctcccccatc tcccgggcaa 480acgtgcgcgc caggtcgcat atcgtcggta tggagccggg ggtggtgacg tgggtctgga 540ccatcccgga ggtaagttgc agcagggcgt cccggcagcc ggcgggcgat tggtcgtaat 600ccaggataaa gacgtgcatg gaacggaggc gtttggccaa gacgtccaag gcccaggcaa 660acacgttata caggtcgccg ttgggggcca gcaactcggg ggcccgaaac agggtaaata 720acgtgtcccc gatatggggt cgtgggcccg cgttgctctg gggctcggca ccctggggcg 780gcacggccgt ccccgaaagc tgtccccagt cctcccgcca cgacccgccg cactgcagat 840accgcaccgt attggcaagt agcccgtaaa cgcggcgaat cgcagccagc atagccaggt 900ccagccgctc gccggggcgc tggcgtttgg ccaggcggtc gatgtgtctg tcctccggaa 960gggccccaag cacgatgttg gtgccgggca aggtcggcgg gatgagggcc acgaacgcca 1020gcacggcctg gggggtcatg ctgcccataa ggtaccgcgc ggccgggtag cacaggaggg 1080cggcgatggg atggcggtcg aagatgaggg tgagggccgg gggcggggca tgtgagctcc 1140cagcctcccc cccgatatga ggagccagaa cggcgtcggt cacggcataa ggcatgccca 1200ttgttatctg ggcgcttgtc attaccaccg ccgcgtcccc ggccgatatc tcaccctggt 1260cgaggcggtg ttgtgtggtg tagatgttcg cgattgtctc ggaagccccc agcacccgcc 1320agtaagtcat cggctcgggt acgtagacga tatcgtcgcg cgaacccagg gccaccagca 1380gttgcgtggt ggtggttttc cccatcccgt ggggaccgtc tatataaacc cgcagtagcg 1440tgggcatttt ctgctccggg cggacttccg tggcttcttg ctgccggcga gggcgcaacg 1500ccgtacgtcg gttgctatgg ccgcgagaac gcgcagcctg gtcgaacgca gacgcgactt 1560ctacacagcc atcggtccag acggccgcgc ttctgcgggc gatttgtgta cgcccgacag 1620tcccggctcc ggatcggacg attgcgtcgc atcgaccctg cgcccaagct gcatcatcga 1680aattgccgtc aaccaagctc tgatagagtt ggtcaagacc aatgcggagc atatacgccc 1740ggagccgcgg cgatcctgca agctccggat gcctccgctc gaagtagcgc gtctgctgct 1800ccatacaagc caaccacggc ctccagaaga agatgttggc gacctcgtat tgggaatccc 1860cgaacatcgc ctcgctccag tcaatgaccg ctgttatgcg gccattgtcc gtcaggacat 1920tgttggagcc gaaatccgcg tgcacgaggt gccggacttc ggggcagtcc tcggcccaaa 1980gcatcagctc atcgagagcc tgcgcgacgg acgcactgac ggtgtcgtcc atcacagttt 2040gccagtgata cacatgggga tcagcaatcg cgcatatgaa atcacgccat gtagtgtatt 2100gaccgattcc ttgcggtccg aatgggccga acccgctcgt ctggctaaga tcggccgcag 2160cgatcgcatc catgagctcc gcgacgggtt gcagaacagc gggcagttcg gtttcaggca 2220ggtcttgcaa cgtgacaccc tgtgcacggc gggagatgca ataggtcagg ctctcgctga 2280attccccaat gtcaagcact tccggaatcg ggagcgcggc cgatgcaaag tgccgataaa 2340cataacgatc tttgtagaaa ccatcggcgc agctatttac ccgcaggaca tatccacgcc 2400ctcctacatc gaagctgaaa gcacgagatt cttcgccctc cgagagctgc atcaggtcgg 2460agacgctgtc gaacttttcg atcagaaact tcgcgacaga cgtcgcggtg agttcaggct 2520ttttcatgat ggccctccta ccggtgatct cagctgtagg aaagagaaga aggttagtag 2580tcgacatggt ggccctccta tagtgagtcg tattatacta tgccgatata ctatgccgat 2640gattaattgt caacactagg cgccggtcac aactaggtgg gcctatagac tctataggcg 2700gtacttacgt cactcttggc acggggaatc cgcgttccaa tgcaccgttc ccggccgcgg 2760aggctggatc ggtcccggtg tcttctatgg aggtcaaaac agcgtggatg gcgtctccag 2820gcgatctgac ggttcactaa acgagctctg cttatataga cctcccaccg tacacgccta 2880ccgcccattt gcgtcaatgg ggcggagttg ttacgacatt ttggaaagtc ccgttgattt 2940tggtgccaaa acaaactccc attgacgtca atggggtgga gacttggaaa tccccgtgag 3000tcaaaccgct atccacgccc attgatgtac tgccaaaacc gcatcaccat ggtaatagcg 3060atgactaata cgtagatgta ctgccaagta ggaaagtccc ataaggtcat gtactgggca 3120taatgccagg cgggccattt accgtcattg acgtcaatag ggggcgtact tggcatatga 3180tacacttgat gtactgccaa gtgggcagtt taccgtaaat actccaccca ttgacgtcaa 3240tggaaagtcc ctattggcgt tactatggga acatacgtca ttattgacgt caatgggcgg 3300gggtcgttgg gcggtcagcc aggcgggcca tttaccgtaa gttatgtaac ggactctagc 3360tcgatccagc tcactcccct gttgattgtg tgttatggtg cagagtccag ccactgtttg 3420tccagtgggg tctctgacct gccttcctgt agctcttgga gtcattctgg cctccccctc 3480ccccaagccc acacaaaaaa ccaacacaca gatccaatga aaataatgat tgtttattgc 3540agcttaatta actagccatg accaaaatcc cttaacgtga gttttcgttc cactgagcgt 3600cagaccccgt agaaaagatc aaaggatctt cttgagatcc tttttttctg cgcgtaatct 3660gctgcttgca aacaaaaaaa ccaccgctac cagcggtggt ttgtttgccg gatcaagagc 3720taccaactct ttttccgaag gtaactggct tcagcagagc gcagatacca aatactgttc 3780ttctagtgta gccgtagtta ggccaccact tcaagaactc tgtagcaccg cctacatacc 3840tcgctctgct aatcctgtta ccagtggctg ctgccagtgg cgataagtcg tgtcttaccg 3900ggttggactc aagacgatag ttaccggata aggcgcagcg gtcgggctga acggggggtt 3960cgtgcacaca gcccagcttg gagcgaacga cctacaccga actgagatac ctacagcgtg 4020agcattgaga aagcgccacg cttcccgaag ggagaaaggc ggacaggtat ccggtaagcg 4080gcagggtcgg aacaggagag cgcacgaggg agcttccagg gggaaacgcc tggtatcttt 4140atagtcctgt cgggtttcgc cacctctgac ttgagcgtcg atttttgtga tgctcgtcag 4200gggggcggag cctatggaaa aacgccagca acgcggcctt tttacggttc ctggcctttt 4260gctggccttt tgctcacatg ttcttcgcta acatttaaat ggatctacca catttgtaga 4320ggttttactt gctttaaaaa acctcccaca cctccccctg aacctgaaac ataaaatgaa 4380tgcaattgtt gttgttaact tgtttattgc agcttataat ggttacaaat aaagcaatag 4440catcacaaat ttcacaaata aagcaatagc atcacaaatt tcacaaataa agcatttttt 4500tcactgcatt ctagttgtgg tttgtccaaa ctcatcaatg tatcttatca tgtcgagcta 4560gctgtacaat cgatagatct aggcctcctt cgccggccgc tcagcgaggg ggcagggcct 4620gcatgtgaag ggcgtcgtag gtgtccttgg tggctgtact gagaccctgg taaaggccat 4680cgtgcccctt gcccctccgg cgctcgcctt tcatcccaat ctcactgtag gcctccgcca 4740tcttatcttt ctgcagttca ttgtacaggc cttcctgagg gttcttcctt ctcggctttc 4800cccccatctc agggtcccgg ccacgtctct tgtccaaaac atcgtactcc tctcttcgtc 4860ctagattgag ctcgttatag agctggttct ggccctgctg gtacgcgggg gcgtctgcgc 4920tcctgctgaa cttcactctg aagaagatgc

ctagcccaat gaaaagcagg aggccggcga 4980cgccccccag cacaatcagg gccattttac ctagggacag ggagaggctc ttctgtgtgt 5040agtggttgtg cagagcctca tgcatcacgg agcatgagaa gacattcccc tcctgccacc 5100tgctcttgtc cacggttagc ctgctgtaga ggaagaagga gccgtcggag tccagcacgg 5160gaggcgtggt cttgtagttg ttctccggct gcccattgct ctcccactcc acggcgatgt 5220cgctggggta gaagcctttg accaggcagg tcaggctgac ctggttcttg gtcatctcct 5280cctgggatgg gggcagggtg tacacctgtg gctctcgggg ctgccctttg gctttggaga 5340tggttttctc gatggaggac gggaggcctt tgttggagac cttgcacttg tactccttgc 5400cgttcagcca gtcctggtgc aggacggtga ggacgctgac cacacggtac gtgctgttga 5460actgctcctc ccgcggcttt gtcttggcat tatgcacctc cacgccatcc acgtaccagt 5520tgaactggac ctcggggtct tcctggctca cgtccaccac cacgcacgtg acctcagggg 5580tccgggagat catgagagtg tccttgggtt ttggggggaa caggaagact gatggtcccc 5640ccaggaactc aggtgctggg catggtgggc atgggggacc atatttggac tcgttgaacc 5700gtccctcgcg aaaaagtttc tttaaatgta agagcaggtc ctttacaaac tgggccacct 5760cgattttggt gtctcggaca tgcaagctgg aaaactgccc agctgagacc ttgtgcgggc 5820agaatccgct cagcatcctc tgggtcttct cgatggcact gcagcctgac acgttgatca 5880gggattccag ggctgcacag tacatgccag ctgtcaggtt gatgctccat accatgctgc 5940cattgcagag cggagccttc tggttctggg tgatgttgac cagctcctca atgaggtacc 6000tgagggctgt agagggaggc acagggcctg ggatcaggag gaatgctggg tgtggtaact 6060cacagagcag aaggcttgtc accaggagaa gcatggtggc ggctctaggg tgatctcagc 6120tgtaggaaag agaagaaggt tagtagtcga cgtgtccctc tcgatgaatc cgtatcaatt 6180gtgagcgctc acaagtcaac actctttttg ataaatctag tagatatcac ttacgtaggc 6240gccggtcaca gcttggatct gtaacggcgc agaacagaaa acgaaacaaa gacgtagagt 6300tgagcaagca gggtcaggca aagcgtggag agccggctga gtctaggtag gctccaaggg 6360agcgccggac aaaggcccgg tctcgacctg agctttaaac ttacctagac ggcggacgca 6420gttcaggagg caccacaggc gggaggcggc agaacgcgac tcaaccggcg tggatggcgg 6480cctcaggtag ggcggcgggc gcgtgaagga gagatgcgag cccctcgaag cttcagctgt 6540gttctggcgg caaacccgtt gcgaaaaaga acgttcacgg cgactactgc acttatatac 6600ggttctcccc caccctcggg aaaaaggcgg agccagtaca cgacatcact ttcccagttt 6660accccgcgcc accttctcta ggcaccggtt caattgccga cccctccccc caacttctcg 6720gggactgtgg gcgatgtgcg ctctgcccac tgacgggcac cggagcgatc gcagatcctt 6780cga 678317497PRTHomo sapiens 17Met Leu Leu Leu Val Thr Ser Leu Leu Leu Cys Glu Leu Pro His Pro1 5 10 15Ala Phe Leu Leu Ile Pro Gly Pro Val Pro Pro Ser Thr Ala Leu Arg 20 25 30Tyr Leu Ile Glu Glu Leu Val Asn Ile Thr Gln Asn Gln Lys Ala Pro 35 40 45Leu Cys Asn Gly Ser Met Val Trp Ser Ile Asn Leu Thr Ala Gly Met 50 55 60Tyr Cys Ala Ala Leu Glu Ser Leu Ile Asn Val Ser Gly Cys Ser Ala65 70 75 80Ile Glu Lys Thr Gln Arg Met Leu Ser Gly Phe Cys Pro His Lys Val 85 90 95Ser Ala Gly Gln Phe Ser Ser Leu His Val Arg Asp Thr Lys Ile Glu 100 105 110Val Ala Gln Phe Val Lys Asp Leu Leu Leu His Leu Lys Lys Leu Phe 115 120 125Arg Glu Gly Arg Phe Asn Glu Ser Lys Tyr Gly Pro Pro Cys Pro Pro 130 135 140Cys Pro Ala Pro Glu Phe Leu Gly Gly Pro Ser Val Phe Leu Phe Pro145 150 155 160Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr 165 170 175Cys Val Val Val Asp Val Ser Gln Glu Asp Pro Glu Val Gln Phe Asn 180 185 190Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg 195 200 205Glu Glu Gln Phe Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val 210 215 220Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser225 230 235 240Asn Lys Gly Leu Pro Ser Ser Ile Glu Lys Thr Ile Ser Lys Ala Lys 245 250 255Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Gln Glu 260 265 270Glu Met Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe 275 280 285Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu 290 295 300Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe305 310 315 320Phe Leu Tyr Ser Arg Leu Thr Val Asp Lys Ser Arg Trp Gln Glu Gly 325 330 335Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr 340 345 350Thr Gln Lys Ser Leu Ser Leu Ser Leu Gly Lys Met Ala Leu Ile Val 355 360 365Leu Gly Gly Val Ala Gly Leu Leu Leu Phe Ile Gly Leu Gly Ile Phe 370 375 380Phe Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr Gln Gln385 390 395 400Gly Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg Glu Glu 405 410 415Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu Met Gly Gly 420 425 430Lys Pro Arg Arg Lys Asn Pro Gln Glu Gly Leu Tyr Asn Glu Leu Gln 435 440 445Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile Gly Met Lys Gly Glu 450 455 460Arg Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gln Gly Leu Ser Thr465 470 475 480Ala Thr Lys Asp Thr Tyr Asp Ala Leu His Met Gln Ala Leu Pro Pro 485 490 495Arg18691PRTArtificial Sequenceselection/ suicide fusion coding region containing herpes simplexvirus and E.coli sequences 18Met Lys Lys Pro Glu Leu Thr Ala Thr Ser Val Ala Lys Phe Leu Ile1 5 10 15Glu Lys Phe Asp Ser Val Ser Asp Leu Met Gln Leu Ser Glu Gly Glu 20 25 30Glu Ser Arg Ala Phe Ser Phe Asp Val Gly Gly Arg Gly Tyr Val Leu 35 40 45Arg Val Asn Ser Cys Ala Asp Gly Phe Tyr Lys Asp Arg Tyr Val Tyr 50 55 60Arg His Phe Ala Ser Ala Ala Leu Pro Ile Pro Glu Val Leu Asp Ile65 70 75 80Gly Glu Phe Ser Glu Ser Leu Thr Tyr Cys Ile Ser Arg Arg Ala Gln 85 90 95Gly Val Thr Leu Gln Asp Leu Pro Glu Thr Glu Leu Pro Ala Val Leu 100 105 110Gln Pro Val Ala Glu Leu Met Asp Ala Ile Ala Ala Ala Asp Leu Ser 115 120 125Gln Thr Ser Gly Phe Gly Pro Phe Gly Pro Gln Gly Ile Gly Gln Tyr 130 135 140Thr Thr Trp Arg Asp Phe Ile Cys Ala Ile Ala Asp Pro His Val Tyr145 150 155 160His Trp Gln Thr Val Met Asp Asp Thr Val Ser Ala Ser Val Ala Gln 165 170 175Ala Leu Asp Glu Leu Met Leu Trp Ala Glu Asp Cys Pro Glu Val Arg 180 185 190His Leu Val His Ala Asp Phe Gly Ser Asn Asn Val Leu Thr Asp Asn 195 200 205Gly Arg Ile Thr Ala Val Ile Asp Trp Ser Glu Ala Met Phe Gly Asp 210 215 220Ser Gln Tyr Glu Val Ala Asn Ile Phe Phe Trp Arg Pro Trp Leu Ala225 230 235 240Cys Met Glu Gln Gln Thr Arg Tyr Phe Glu Arg Arg His Pro Glu Leu 245 250 255Ala Gly Ser Pro Arg Leu Arg Ala Tyr Met Leu Arg Ile Gly Leu Asp 260 265 270Gln Leu Tyr Gln Ser Leu Val Asp Gly Asn Phe Asp Asp Ala Ala Trp 275 280 285Ala Gln Gly Arg Cys Asp Ala Ile Val Arg Ser Gly Ala Gly Thr Val 290 295 300Gly Arg Thr Gln Ile Ala Arg Arg Ser Ala Ala Val Trp Thr Asp Gly305 310 315 320Cys Val Glu Val Ala Ser Ala Phe Asp Gln Ala Ala Arg Ser Arg Gly 325 330 335His Ser Asn Arg Arg Thr Ala Leu Arg Pro Arg Arg Gln Gln Glu Ala 340 345 350Thr Glu Val Arg Pro Glu Gln Lys Met Pro Thr Leu Leu Arg Val Tyr 355 360 365Ile Asp Gly Pro His Gly Met Gly Lys Thr Thr Thr Thr Gln Leu Leu 370 375 380Val Ala Leu Gly Ser Arg Asp Asp Ile Val Tyr Val Pro Glu Pro Met385 390 395 400Thr Tyr Trp Arg Val Leu Gly Ala Ser Glu Thr Ile Ala Asn Ile Tyr 405 410 415Thr Thr Gln His Arg Leu Asp Gln Gly Glu Ile Ser Ala Gly Asp Ala 420 425 430Ala Val Val Met Thr Ser Ala Gln Ile Thr Met Gly Met Pro Tyr Ala 435 440 445Val Thr Asp Ala Val Leu Ala Pro His Ile Gly Gly Glu Ala Gly Ser 450 455 460Ser His Ala Pro Pro Pro Ala Leu Thr Leu Ile Phe Asp Arg His Pro465 470 475 480Ile Ala Ala Leu Leu Cys Tyr Pro Ala Ala Arg Tyr Leu Met Gly Ser 485 490 495Met Thr Pro Gln Ala Val Leu Ala Phe Val Ala Leu Ile Pro Pro Thr 500 505 510Leu Pro Gly Thr Asn Ile Val Leu Gly Ala Leu Pro Glu Asp Arg His 515 520 525Ile Asp Arg Leu Ala Lys Arg Gln Arg Pro Gly Glu Arg Leu Asp Leu 530 535 540Ala Met Leu Ala Ala Ile Arg Arg Val Tyr Gly Leu Leu Ala Asn Thr545 550 555 560Val Arg Tyr Leu Gln Cys Gly Gly Ser Trp Arg Glu Asp Trp Gly Gln 565 570 575Leu Ser Gly Thr Ala Val Pro Pro Gln Gly Ala Glu Pro Gln Ser Asn 580 585 590Ala Gly Pro Arg Pro His Ile Gly Asp Thr Leu Phe Thr Leu Phe Arg 595 600 605Ala Pro Glu Leu Leu Ala Pro Asn Gly Asp Leu Tyr Asn Val Phe Ala 610 615 620Trp Ala Leu Asp Val Leu Ala Lys Arg Leu Arg Ser Met His Val Phe625 630 635 640Ile Leu Asp Tyr Asp Gln Ser Pro Ala Gly Cys Arg Asp Ala Leu Leu 645 650 655Gln Leu Thr Ser Gly Met Val Gln Thr His Val Thr Thr Pro Gly Ser 660 665 670Ile Pro Thr Ile Cys Asp Leu Ala Arg Thr Phe Ala Arg Glu Met Gly 675 680 685Glu Ala Asn 690

Claims

1. A chimeric immunoreceptor comprising SEQ ID NO:22.

2. A chimeric immunoreceptor encoded by a nucleic acid sequence comprising SEQ ID NO:19 or SEQ ID NO:23.

3. A method for treating human cancer, comprising administering to a human suffering from a glioma that overexpresses IL13.alpha.2 receptor a plurality of T lymphocyte cells expressing an immunoreceptor of claim 1 or claim 2.

4. A vector which comprises a nucleic acid comprising SEQ ID NO: 19 or SEQ ID NO:23.

5. The vector which consists essentially of SEQ ID NO:19.

6. The vector which consists essentially of SEQ ID NO:23.