U.S. patent application number 11/977653 was filed with the patent office on 2009-10-15 for ngr receptor and methods of identifying tumor homing molecules that home to angiogenic vasculature using same.
This patent application is currently assigned to The Burnham Institute. Invention is credited to Renata Pasqualini, Erkki Ruoslahti.
Application Number | 20090257951 11/977653 |
Document ID | / |
Family ID | 22488357 |
Filed Date | 2009-10-15 |
United States Patent
Application |
20090257951 |
Kind Code |
A1 |
Ruoslahti; Erkki ; et
al. |
October 15, 2009 |
NGR receptor and methods of identifying tumor homing molecules that
home to angiogenic vasculature using same
Abstract
The present invention provides a method of identifying a tumor
homing molecule that homes to angiogenic vasculature by contacting
a substantially purified NGR receptor with one or more molecules
and determining specific binding of a molecule to the NGR receptor,
where the presence of specific binding identifies the molecule as a
tumor homing molecule that homes to angiogenic vasculature. The
invention also provides a method of directing a moiety to
angiogenic vasculature in a subject by administering to the subject
a conjugate including a moiety linked to a tumor homing molecule
that exhibits specific binding to an NGR receptor, whereby the
moiety is directed to angiogenic vasculature. In addition, the
invention provides a method of imaging the angiogenic vasculature
of a tumor in a subject by administering to the subject a conjugate
having a detectable moiety linked to a tumor homing molecule that
exhibits specific binding to an NGR receptor and detecting the
conjugate.
Inventors: |
Ruoslahti; Erkki; (Rancho
Santa Fe, CA) ; Pasqualini; Renata; (Solana Beach,
CA) |
Correspondence
Address: |
MCDERMOTT, WILL & EMERY
11682 EL CAMINO REAL, SUITE 400
SAN DIEGO
CA
92130-2047
US
|
Assignee: |
The Burnham Institute
La Jolla
CA
|
Family ID: |
22488357 |
Appl. No.: |
11/977653 |
Filed: |
October 24, 2007 |
Related U.S. Patent Documents
|
|
|
|
|
|
Application
Number |
Filing Date |
Patent Number |
|
|
10264374 |
Oct 3, 2002 |
|
|
|
11977653 |
|
|
|
|
09659786 |
Sep 11, 2000 |
6491894 |
|
|
10264374 |
|
|
|
|
09139802 |
Aug 25, 1998 |
6180084 |
|
|
09659786 |
|
|
|
|
Current U.S.
Class: |
424/1.69 ;
424/1.11; 514/1.1; 514/2.4; 514/34 |
Current CPC
Class: |
G01N 2333/70546
20130101; G01N 33/57492 20130101; G01N 33/5011 20130101; G01N
2333/948 20130101 |
Class at
Publication: |
424/1.69 ; 514/8;
424/1.11; 514/34 |
International
Class: |
A61K 51/08 20060101
A61K051/08; A61K 38/14 20060101 A61K038/14; A61K 51/02 20060101
A61K051/02; A61K 31/704 20060101 A61K031/704 |
Goverment Interests
[0002] This invention was made with government support under CA
42507, CA 62042, CA74238-01 and Cancer Center Support Grant CA
30199 awarded by the National Institutes of Health. The government
has certain rights in this invention.
Claims
1-25. (canceled)
26. A method of inhibiting angiogenesis in a tumor of a subject,
comprising administering to the subject a conjugate comprising a
moiety linked to a tumor homing molecule that exhibits specific
binding to an NGR receptor, whereby the moiety is directed to
angiogenic vasculature.
27. The method of claim 26, wherein said tumor homing molecule is a
peptide containing the sequence NGR.
28. The method of claim 27, wherein said moiety is a cytotoxic
agent.
29. The method of claim 27, wherein said moiety is a drug.
30. The method of claim 29, wherein said drug is a cancer
chemotherapeutic agent.
31. The method of claim 30, wherein said cancer chemotherapeutic
agent is doxorubicin.
32. The method of claim 27, wherein said tumor homing peptide
comprises a sequence selected from the group consisting of
CNGRCVSGCAGRC (SEQ ID NO:3), NGRAHA (SEQ ID NO:6), CVLNGRMEC (SEQ
ID NO:7), and CNGRC (SEQ ID NO:8).
33. The method of claim 32, wherein said moiety is a cytotoxic
agent.
34. The method of claim 32, wherein said moiety is a drug.
35. The method of claim 34, wherein said drug is a cancer
chemotherapeutic agent.
36. The method of claim 35, wherein said cancer chemotherapeutic
agent is doxorubicin.
37. The method of claim 26, wherein said tumor homing molecule is
an inhibitor of a CD13-like aminopeptidase.
38. The method of claim 37, wherein said inhibitor is selected from
the group consisting of bestatin, actinonin and
o-phenanthroline.
39. The method of claim 37, wherein said moiety is a cytotoxic
agent.
40. The method of claim 37, wherein said moiety is a drug.
41. The method of claim 40, wherein said drug is a cancer
chemotherapeutic agent.
42. The method of claim 41, wherein said cancer chemotherapeutic
agent is doxorubicin.
43. A method of imaging the angiogenic vasculature of a tumor in a
subject, comprising: (a) administering to the subject a conjugate
comprising a detectable moiety linked to a tumor homing molecule
that exhibits specific binding to an NGR receptor, whereby said
conjugate specifically binds said angiogenic vasculature; and (b)
detecting said conjugate.
44. The method of claim 43, wherein said detectable moiety is a
radionuclide.
45. The method of claim 43, wherein said tumor homing molecule is a
peptide containing the sequence NGR.
46. The method of claim 45, wherein said tumor homing peptide
comprises a sequence selected from the group consisting of
CNGRCVSGCAGRC (SEQ ID NO:3), NGRAHA (SEQ ID NO:6), CVLNGRMEC (SEQ
ID NO:7), and CNGRC (SEQ ID NO:8).
47. The method of claim 46, wherein said detectable moiety is a
radionuclide.
48. The method of claim 47, wherein said radionuclide is selected
from the group consisting of indium-111, technitium-99, carbon-11
and carbon-13.
49. The method of claim 43, wherein said tumor homing molecule is
an inhibitor of a CD13-like aminopeptidase.
50. The method of claim 49, wherein said inhibitor is selected from
the group consisting of bestatin, actinonin and
o-phenanthroline.
51. The method of claim 49, wherein said detectable moiety is a
radionuclide.
52. The method of claim 51, wherein said radionuclide is selected
from the group consisting of indium-1, technitium-99, carbon-11 and
carbon-13.
53. A substantially purified target molecule, comprising an NGR
receptor that binds a peptide comprising the sequence NGR, provided
that said NGR receptor does not have the amino acid sequence of
CD13/aminopeptidase N (SEQ ID NO:201).
Description
[0001] This application is a continuation of U.S. application Ser.
No. 10/264,374, filed Oct. 3, 2002, which is a divisional of U.S.
application Ser. No. 09/659,786, filed Sep. 11, 2000, which is a
continuation of U.S. application Ser. No. 09/139,802, filed Aug.
25, 1998, the entire contents of which are incorporated herein by
reference.
BACKGROUND OF THE INVENTION
[0003] 1. Field of the Invention
[0004] The present invention relates generally to the fields of
cancer biology and drug delivery and, more specifically, to
peptides that selectively home to a tumor, particularly a malignant
tumor, to compositions comprising an agent such as a therapeutic
agent conjugated to such tumor homing molecules, and to methods of
using such molecules to target an agent to a tumor.
[0005] 2. Background Information
[0006] Continuous developments over the past quarter century have
resulted in substantial improvements in the ability of a physician
to diagnose a cancer in a patient. For example, antibody based
assays such as that for prostate specific antigen now allow early
diagnosis of cancers such as prostate cancer. More recently,
methods of genetic screening are becoming available to identify
persons that may be particularly susceptible to developing a
cancer. Genetic screening methods are based on the identification
of one or more mutations in a gene that correlates with the
development of a cancer. For example, the identification of genes
such as BRCA1 and BRCA2 allowed the further identification of
mutations in these genes that, in some cases, can correlate with
susceptibility to developing breast cancer.
[0007] Unfortunately, methods for treating cancer have not kept
pace with those for diagnosing the disease. Thus, while the death
rate from various cancers has decreased due to the ability of a
physician to detect the disease at an earlier stage, the ability to
treat patients presenting with more advanced disease has advanced
only minimally.
[0008] A major hurdle to advances in treating cancer is the
relative lack of agents that can selectively target the cancer,
while sparing normal tissue. For example, radiation therapy and
surgery, which generally are localized treatments, can cause
substantial damage to normal tissue in the treatment field,
resulting in scarring and, in severe cases, loss of function of the
normal tissue. Chemotherapy, in comparison, which generally is
administered systemically, can cause substantial damage to organs
such as bone marrow, mucosae, skin and the small intestine, which
undergo rapid cell turnover and continuous cell division. As a
result, undesirable side effects such as nausea, loss of hair and
drop in blood cell count occur as a result of systemically treating
a cancer patient with chemotherapeutic agents. Such undesirable
side effects often limit the amount of a treatment that can be
administered. Thus, cancer remains a leading cause of patient
morbidity and death.
[0009] Efforts have been made to increase the target specificity of
various drugs. For example, where a unique cell surface marker is
expressed by a population of cells making up a tumor, an antibody
can be raised against the unique marker and a drug can be linked to
the antibody. Upon administration of the drug/antibody complex to
the patient, the binding of the antibody to the marker results in
the delivery of a relatively high concentration of the drug to the
tumor. Similar methods can be used where a particular cancer cell
or the supporting cell or matrix expresses a unique cell surface
receptor or a ligand for a particular receptor. In these cases, the
drug can be linked to the specific ligand or to the receptor,
respectively, thus providing a means to deliver a relatively high
concentration of the drug to the tumor.
[0010] Tumors are characterized, in part, by a relatively high
level of active angiogenesis, resulting in the continual formation
of new blood vessels to support the growing tumor. Such angiogenic
blood vessels are distinguishable from mature vasculature. One of
the distinguishing features of angiogenic vasculature is that
unique endothelial cell surface markers are expressed. Thus, the
blood vessels in a tumor provide a potential target for directing a
chemotherapeutic agent to the tumor, thereby reducing the
likelihood that the agent will kill sensitive normal tissues.
Furthermore, if agents that target the angiogenic blood vessels in
a tumor can be identified, there is a likelihood that the agents
can be useful against a variety of different types of tumors, since
it is the target molecules in the angiogenic vessels that are
recognized by such agents and not receptors specific for the tumor
cells. However, the use of molecules that can bind specifically to
tumor vasculature and target a chemotherapeutic agent to the tumor
has not been demonstrated.
[0011] While linking a drug to a molecule that homes to a tumor can
provide significant advantages for treatment over the use of a
drug, alone, use of this method is severely limited by the scarcity
of useful cell surface markers expressed in a tumor. Thus, a need
exists to identify molecules that can selectively home to a tumor,
particularly to the vasculature supporting the tumor. The present
invention satisfies this need and provides related advantages as
well.
SUMMARY OF THE INVENTION
[0012] The present invention provides a method of identifying a
tumor homing molecule that homes to angiogenic vasculature of a
tumor. The method includes the steps of contacting a substantially
purified NGR receptor with one or more molecules and determining
specific binding of a molecule to the NGR receptor, where the
presence of specific binding identifies the molecule as a tumor
homing molecule that homes to angiogenic vasculature of a tumor. In
a method of the invention, the substantially purified NGR receptor
can be, for example, CD13/aminopeptidase N. If desired, the
substantially purified NGR receptor can be immobilized on a support
such as a plate or a bead.
[0013] The invention also provides a method of identifying a homing
molecule that homes to angiogenic vasculature using substantially
purified NGR receptor. The method includes the steps of contacting
a substantially purified NGR receptor with one or more molecules
and determining specific binding of a molecule to the NGR receptor,
where presence of specific binding identifies the molecule as a
homing molecule that homes to angiogenic vasculature. The invention
provides homing molecules that home to non-tumor angiogenic
vasculature.
[0014] The present invention also provides a method of directing a
moiety to angiogenic vasculature of a tumor in a subject by
administering to the subject a conjugate including a moiety linked
to a tumor homing molecule that exhibits specific binding to an NGR
receptor, whereby the moiety is directed to angiogenic vasculature
of a tumor. In a method of the invention, the tumor homing molecule
can be, for example, a peptide containing the sequence NGR, and, if
desired, can be part of a conjugate in which the moiety is a
cytotoxic agent, drug or cancer therapeutic agent, for example,
doxorubicin. A tumor homing peptide containing the sequence NGR can
have, for example, the sequence CNGRCVSGCAGRC (SEQ ID NO:3), NGRAHA
(SEQ ID NO:6), CVLNGRMEC (SEQ ID NO:7) or CNGRC (SEQ ID NO:8). In a
method of the invention for directing a moiety to angiogenic
vasculature of a tumor in a subject, the tumor homing molecule also
can be, for example, an aminopeptidase inhibitor such as bestatin,
o-phenanthroline, actinonin, amastatin, 2,2'-dipyridyl or
fumagillin and can be linked, if desired, to a drug moiety.
[0015] Further provided herein is a method of imaging the
angiogenic vasculature of a tumor in a subject by administering to
the subject a conjugate having a detectable moiety linked to a
tumor homing molecule that exhibits specific binding to an NGR
receptor, whereby the conjugate selectively binds the angiogenic
vasculature, and detecting the conjugate. A detectable moiety for
imaging angiogenic vasculature can be, for example, a radionuclide.
A useful tumor homing molecule for imaging angiogenic vasculature
can be, for example, a peptide containing the sequence NGR, such as
a peptide containing the sequence CNGRCVSGCAGRC (SEQ ID NO:3),
NGRAHA (SEQ ID NO:6), CVLNGRMEC (SEQ ID NO:7) or CNGRC (SEQ ID
NO:8). A tumor homing molecule for imaging angiogenic vasculature
also can be, for example, an aminopeptidase inhibitor such as
bestatin, o-phenanthroline, actinonin, amastatin, 2,2'-dipyridyl,
fumagillin or another molecule that inhibits an aminopeptidase.
[0016] The invention also provides inhibitors of angiogenesis that
are NGR receptor binding molecules. Such inhibitors can be, for
example, an NGR receptor antibody or an aminopeptidase inhibitor
such as bestatin, o-phenanthroline, actinonin, amastatin,
2,2'-dipyridyl or fumagillin, or a conjugate of such angiogenesis
inhibitors to a drug or toxin.
BRIEF DESCRIPTION OF THE DRAWINGS
[0017] FIG. 1 shows inhibition of in vivo phage homing by synthetic
peptides. Recovery of phage displaying tumor homing peptides from
breast carcinoma xenografts was measured after injection of phage
or coinjection of the phage with various peptides. (A) Left panel:
Recovery of phage expressing the NGR tumor homing peptide,
CNGRCVSGCAGRC (SEQ ID NO:3; "NGR phage") from tumor (filled bars)
and brain (striped bars), and inhibition of the tumor homing by the
soluble peptide CNGRC (SEQ ID NO:8). Middle panel: Recovery of
CGSLVRC-phage and inhibition of the tumor homing by the soluble
peptide CGSLVRC. Right panel: Recovery of RGD-4C phage (positive
control; the peptide insert in the RGD-4C phage is CDCRGDCFC; SEQ
ID NO:1) and unselected phage library mix (negative control). (B)
Left panel: Increasing amounts of the RGD-4C soluble peptide were
injected with the CNGRCVSGCAGRC-phage. Right panel: Increasing
amounts of the CNGRC soluble peptide were injected with the RGD-4C
phage.
[0018] FIG. 2 shows the specificity of tumor homing by the NGR
phage relative to the positive control (RGD-4C) and negative
control (fd-tet) phage.
[0019] FIGS. 3A to 3V show the immunohistochemical staining of the
NGR phage in tumors and normal tissues following intravenous
injection into nude mice bearing a human breast carcinoma or a
human Kaposi's sarcoma. Samples were taken 4 min (FIGS. 3E, 3G, 3H
and 3J) or 24 hr (FIGS. 3A to 3D, 3F, 3I, and 3K to 3V) after
administration of the phage. FIGS. 3A, 3C, 3G and 3J are from mice
receiving insertless phage (control phage) and FIGS. 3B, 3D, 3E,
3F, 3H, 3I and 3K to 3V are from mice receiving NGR phage. FIGS.
3A, 3B, 3E, 3F and 3G are breast tumor samples; FIGS. 3C, 3D, 3H,
3I and 3J are Kaposi's sarcoma samples; FIG. 3K is brain; FIG. 3L
is lymph node; FIG. 3M is kidney; FIG. 3N is pancreas; FIG. 3O is
uterus; FIG. 3P is mammary fat pad; FIG. 3Q is lung; FIG. 3R is
intestine; FIG. 3S is skin; FIG. 3T is skeletal muscle; FIG. 3U is
heart and FIG. 3V is urinary tract epithelium. Magnification: FIGS.
3A to 3D, 40.times.; FIGS. 3E to 3V, 200.times..
[0020] FIG. 4 shows isolation of CD13/aminopeptidase N (APN) and
CNGRC-phage binding to CD13/APN. (A) Aminopeptidase enzymatic
activity in immuno-isolated CD13 detected by using the CD13
substrates Ala-pNA or Leu-pNA. (B) Phage binding to immuno-isolated
CD13 from a Kaposi's sarcoma tumor cell octylglucoside extract.
Phage carrying the indicated peptides were tested for binding to
CD13 that was immobilized using an anti-CD13 antibody WM15 coated
on microtiter wells. (C) Inhibition of NGR-phage binding to CD13 by
an NGR-containing cyclic peptide (CNGRC; SEQ ID NO:8) but not by an
RGD-containing cyclic peptide or by an unrelated peptide.
[0021] FIG. 5 shows binding of phage expressing an NGR containing
peptide to cells transfected with CD13. CNGRC-phage binding to
control Molt-4 cells and to Molt-4 cells transfected with CD13 and
inhibition of the binding by the CNGRC cyclic peptide.
[0022] FIG. 6 shows affinity purification of CD13 from HL-60 cell
extracts using an NGR peptide column and elution with CNGRC
peptide. CD13 was detected in the fractions by using the WM15
monoclonal antibody, and normal mouse IgG was used as a negative
control. Samples of each fraction were analyzed for aminopeptidase
enzymatic activity by using Ala-PNA, and for matrix metalloprotease
(MMP) activity by using an MMP substrate.
[0023] FIG. 7 shows upregulation of CD13 in cultured cells by
angiogenic factors. Upregulation of CD13 by angiogenic factors in
human umbilical cord endothelial cells (HUVEC).
[0024] FIG. 8 shows CD13-dependent cytotoxic activity of
doxorubicin/CNGRC (CNGRC-dox) in vitro. (A) CD13-dependent
cytotoxic activity of CNGRC-doxorubicin in vitro in activated
HUVECs. (B) CD13-dependent activity of CNGRC-doxorubicin in vitro
in CD13 transfected MDA-MB-435 breast carcinoma cells.
[0025] FIG. 9 shows recovery of CNGRC phage, RGD-4C phage, and
control phage (insertless fd) from breast carcinoma xenografts,
normal retina and angiogenic retina. (A) The experimental design is
shown. (B) The ratio of recovered tetracycline-resistant to
ampicillin-resistant phage is shown.
[0026] FIG. 10 shows the suppression of bFGF-induced angiogenesis
in chicken chorioallantoic membrane and inhibition of tumor growth
by CD13 antagonists. (A) CD13 antagonists, anti-CD13 antibody,
bestatin and actinonin, suppress bFGF-induced angiogenesis. (B)
Inhibition of the growth of 435 breast carcinoma tumors upon
injection of a CD13 antagonist antibody.
[0027] FIG. 11 shows treatment of mice bearing MDA-MB-435-derived
breast carcinomas and Hodgkin's lymphoma with doxorubicin-CNGRC
peptide conjugate. Mice with size-matched tumors (.about.1000
mm.sup.3) were randomized into four treatment groups (six animals
per group): vehicle only, free doxorubicin (dox),
doxorubicin-control peptide (dox-ctrl pep), and doxorubicin-CNGRC
(dox-CNGRC). (A) Mice were treated at 5 .mu.g/mouse/week of
doxorubicin-equivalent. Difference in tumor volumes between day 1
and day 28 are shown. (B) A Kaplan-Meier survival curve of the mice
in Panel A is shown. C) Mice bearing large (.about.5000 mm.sup.3)
MDA-MB-435 breast carcinomas (four animals per group) were
randomized to receive a single-dose of free doxorubicin or
doxorubicin-CNGRC conjugate at 200 .mu.g/mouse of doxorubicin
equivalent. A Kaplan-Meier survival curve is shown. (D) Mice
bearing large (.about.5000 mm.sup.3) Hodgkin's lymphoma (eight
animals per group) were randomized to receive two doses of free
doxorubicin plus unconjugated CNGRC peptide or doxorubicin-CNGRC
conjugate at 40 .mu.g/mouse of doxorubicin equivalent. A
Kaplan-Meier survival curve is shown.
[0028] FIG. 12 shows the nucleotide and amino acid sequences of
CD13/aminopeptidase N (SEQ ID NOS:200 and 201, respectively).
DETAILED DESCRIPTION OF THE INVENTION
[0029] The present invention relates to the identification of a
target molecule responsible for the homing of molecules to
angiogenic vasculature. The identified target molecule can act as a
receptor, for example, for tumor homing molecules that home to the
angiogenic vasculature of a tumor. As disclosed herein, various
tumor homing molecules were isolated using in vivo panning; a core
binding motif present in several of the tumor homing peptides was
identified as the sequence NGR (see Example IV). In particular,
phage expressing the peptides CNGRCVSGCAGRC (SEQ ID NO:3), NGRAHA
(SEQ ID NO:6) and CVLNGRMEC (SEQ ID NO:7) homed to human breast
carcinomas, human Kaposi's sarcomas and mouse melanomas in mice
bearing these tumors. Furthermore, such homing was competitively
inhibited in vivo by the NGR containing peptide CNGRC (SEQ ID NO:8)
but not by an unrelated peptide. Thus, the results disclosed herein
indicate that a tumor homing peptide containing NGR can home to and
specifically bind tumors of different types and species origin.
[0030] As further disclosed herein, a receptor that specifically
binds tumor homing molecules containing the NGR motif has been
identified (see Examples IX and X). Characterization of the NGR
receptor revealed that this molecule immunoreacts with CD13
antibodies and that the isolated receptor specifically binds the
NGR motif. Furthermore, the NGR receptor was expressed in
angiogenic vasculature, including tumor vasculature, and is
functionally important in angiogenesis. The identification of a
target molecule such as the NGR receptor that is expressed in
angiogenic vasculature can be advantageously used in vitro to
identify new homing molecules, including high affinity ligands of
the NGR receptor, as well as to target a tumor homing molecule and
a linked moiety, such as a drug, to the angiogenic vasculature of a
tumor in vivo.
[0031] Thus, the present invention provides a method of identifying
a tumor homing molecule that homes to angiogenic vasculature of a
tumor by using a substantially purified NGR receptor to identify
the molecule. The method includes the steps of contacting a
substantially purified NGR receptor with one or more molecules and
determining specific binding of a molecule to the NGR receptor,
where the presence of specific binding identifies the molecule as a
tumor homing molecule that homes to angiogenic vasculature of a
tumor. A method of the invention directed to identifying a tumor
homing molecule that homes to angiogenic vasculature of a tumor can
additionally include the steps of administering an NGR binding
molecule in vivo and determining binding of the NGR binding
molecule to angiogenic vasculature. If desired, the substantially
purified NGR receptor can be immobilized on a support such as a
plate or a bead.
[0032] In a method of the invention, the substantially purified NGR
receptor can be, for example, CD13/aminopeptidase N (FIG. 12; see,
also, Look et al., J. Clin. Invest. 83:1299-1307 (1989), which is
incorporated herein by reference). This highly conserved
transmembrane glycoprotein of about 150 kDa is incorporated into
the cell membrane through an N-terminal hydrophobic segment (Look
et al., supra, 1989; Xu et al., Exp. Hematol. 25:521-529 (1997),
which is incorporated herein by reference). The large extracellular
carboxy-terminal domain contains a pentapeptide that is
characteristic of many zinc-dependent metalloproteases (Look et
al., supra, 1989). Homologs of CD13 from several different species
are well conserved (Look et al., supra, 1989; Xu et al., supra,
1997; Turner et al., in Mammalian Ectoenzymes, Kenny and Turner,
eds., Elsevier Scientific Publishing Co., Amsterdam, p. 211
(1987)).
[0033] CD13 is expressed in normal and malignant cells of the
myeloid lineage (Amoscato et al., J. Immunol. 142:1245-1252 (1989);
Favaloro et al., Br. J. Haematol. 69:163-171 (1988); Makrynikola et
al., Exp. Hematol. 23:1173-1179 (1995)) as well as in many
epithelial, endothelial, and tumor cell types (Amoscato et al.,
Biochem. Biophys. Acta 1041:317-319 (1990); Rawlings and Barret,
Biochem. J. 290:205-218 (1993); Mechtersheimer and Moller, Am. J.
Pathol. 137:1215-1222 (1990); Menrad et al., Cancer Res.
53:1450-1455 (1993); Riemann et al., J. Immunol. 158:3425-3432
(1997)). CD13 can function differently depending on its location.
In synaptic membranes, CD13 metabolizes enkephalins and endorphins
(Matsas et al., FEBS Lett. 175:124-128 (1984)); in the intestinal
brush border, it degrades regulatory peptides and scavenges amino
acids (Turner et al., supra, 1997; Rawlings and Barret, supra,
1993); in lymphocytes, the cell surface activity of CD13 is
associated with mitotic activation, antigen processing (Mouritsen
et al., J. Immunol. 149:1987-1993 (1992); Falk et al.,
Immunogenetics 39:230-242 (1994)), cell adhesion, and migration
(Menrad et al., supra, 1993; Saiki et al., Int. J. Cancer
54:137-143 (1993); Koch et al., Am. J. Pathol. 138:165-173 (1991)).
In addition, CD13 has also been implicated in tumor invasion (Saiki
et al., supra, 1993; Fujii et al., Clin. Exp. Metastasis 13:337-344
(1995)), signal transduction (O'Connell et al., Transplant. Proc.
21:3826-3827 (1989)), cell cycle control and differentiation
(Makrynikola et al., supra, 1995; Riemann et al., supra, 1997), and
as a receptor for viruses (Delmas et al., Nature 357:417-420
(1992); Yeager et al., Nature 357:420-422 (1992)).
[0034] The expression levels and enzymatic activity of CD13 can be
physiologically regulated, with the activity and substrate
specificity of CD13 correlating with conformational changes and
induced by various stimuli such as proliferative signals to cells.
Studies using monoclonal antibodies also have indicated that CD13
undergoes regulatory intramolecular alterations that can result in
the exposure of cryptic sites and can regulate enzyme activity. The
presence of certain epitopes has also been related to prognosis of
acute myeloid leukemia (Xu et al., supra, 1997; Favaloro et al.,
supra, 1988; Makrynikola et al., supra, 1995).
[0035] Cell-surface CD13/aminopeptidase N enzymatic activity can be
potently blocked by bestatin, o-phenanthroline and actinonin
(Taylor, FASEB J. 7:290-298 (1993); Rawlings and Barret, supra,
1993; Saiki et al., supra, 1993). Moreover, bestatin has been shown
to possess immunomodulatory effects, and administration of high
doses of bestatin results in marked suppression of experimental and
spontaneous metastasis and inhibition of tumor cell invasion
(Bruley-Rosset et al. Immunol. 38:75-83 (1979); van Hal et al., J.
Immunol. 153:2718-2728 (1994); Saiki et al., supra, 1993; Fujii et
al., supra, 1995)). Although CD13 is expressed outside the vascular
system, the results disclosed herein indicate that an NGR receptor
having immunoreactivity with an anti-CD13 antibody is only exposed
to the circulation in tumor vessels (see Example XII).
[0036] As used herein, the term "NGR receptor" means a target
molecule that is expressed in angiogenic vasculature and that
specifically binds an NGR motif. As described below and in Examples
IX and X, an NGR receptor has been substantially purified and
demonstrated to specifically bind several NGR containing peptides
but not unrelated control peptides. The NGR receptor disclosed
herein exhibits characteristics of a highly conserved transmembrane
aminopeptidase designated CD13/aminopeptidase N (CD13/APN). As
disclosed herein, an NGR receptor can be a transmembrane receptor.
An NGR receptor also can be a molecule that immunoreacts with an
anti-CD13 monoclonal antibody and that has aminopeptidase activity.
An NGR receptor can have, for example, an amino acid sequence that
is substantially similar to the amino acid sequence of CD13/APN
(SEQ ID NO:201). Such an NGR receptor can have an amino acid
sequence identical to the sequence of CD13/APN (SEQ ID NO:201) or
can have one or more modifications, such as deletions, insertions
or substitutions, including conservative and non-conservative amino
acid substitutions, as long as the receptor remains expressed in
angiogenic vasculature and retains specific NGR binding activity.
The term "NGR receptor" also is intended to include polypeptides
encompassing, for example, modified forms of naturally occurring
amino acids such as D-stereoisomers, non-naturally occurring amino
acids, amino acid analogues and mimetics, so long as such
polypeptides retain functional activity as defined above.
[0037] A functional fragment of an NGR receptor also can be useful
in the methods of the invention, for example, for identifying tumor
homing molecules that home to angiogenic vasculature of a tumor. As
used herein, the term "functional fragment," when used in reference
to an NGR receptor, refers to a portion of an NGR receptor that
retains some or all binding activity to a homing molecule. Such a
functional fragment can be, for example, a domain that binds an NGR
motif, such as the extracellular domain of an NGR receptor or an
epitope specifically reactive with an antibody. A functional
fragment of an NGR receptor useful in identifying a tumor homing
molecule can be, for example, the extracellular carboxy-terminal
domain of CD13/aminopeptidase N (Look et al., supra, 1989).
[0038] As used herein, the term "specific binding" means binding
that is measurably different from a non-specific interaction.
Specific binding can be measured, for example, by determining
binding of a molecule compared to binding of a control molecule,
which generally is a molecule of similar structure that does not
have binding activity, for example, a peptide of similar size that
lacks NGR. In this case, specific binding is indicated if the
molecule has measurably higher affinity for the NGR receptor than
the control molecule. Specificity of binding can be determined, for
example, by competition with a control molecule that is known to
bind to a target. For example, specific binding of an NGR peptide
can be demonstrated by competing for binding with the same NGR
peptide or a different peptide containing an NGR motif. In this
case, specific binding is indicated if the binding of a molecule is
competitively inhibited by the second NGR containing peptide.
[0039] The term "specific binding," as used herein, includes both
low and high affinity specific binding. Specific binding can be
exhibited, for example, by a low affinity homing molecule having a
Kd of at least about 10.sup.-4 M. For example, if the receptor for
a homing molecule has more than one binding site, a homing molecule
having low affinity can be useful for targeting angiogenic
vasculature. Specific binding also can be exhibited by a high
affinity homing molecule, for example, a homing molecule having a
Kd of at least about of 10.sup.-7 M, at least about 10.sup.-8 M, at
least about 10.sup.-9 M, at least about 10.sup.-10 M, or can have a
Kd of at least about 10.sup.-11 M or 10.sup.-12 M or greater. Both
low and high affinity homing molecules are useful for targeting
angiogenic vasculature.
[0040] The vasculature within a tumor generally undergoes active
angiogenesis, resulting in the continual formation of new blood
vessels to support the growing tumor. Such angiogenic blood vessels
are distinguishable from mature vasculature in that angiogenic
vasculature expresses unique endothelial cell surface markers,
including the .alpha..sub.v.beta..sub.3 integrin (Brooks, Cell
79:1157-1164 (1994), which is incorporated herein by reference); WO
95/14714, Int. Filing Date Nov. 22, 1994) and receptors for
angiogenic growth factors (Mustonen and Alitalo, J. Cell Biol.
129:895-898 (1995); Lappi, Semin. Cancer Biol. 6:279-288 (1995)).
Moreover, tumor vasculature is histologically distinguishable from
blood vessel in general in that tumor vasculature is fenestrated
(Folkman, Nature Med. 1:27-31 (1995); Rak et al., Anticancer Drugs
6:3-18 (1995)). Thus, angiogenic vasculature is a particularly
attractive target for targeting a tumor homing molecule. Such a
tumor homing molecule can be useful for directing an agent such as
a chemotherapeutic drug to a tumor, while reducing the likelihood
the agent will have a toxic effect on normal, healthy organs or
tissues (Examples VIII and XV). Moreover, a molecule that homes
selectively to angiogenic vasculature also may have use in
targeting other types of neovasculature such as that present in
inflammatory, regenerating or wounded tissues. As used herein, the
term "tumor homing molecule that homes to angiogenic vasculature of
a tumor" means a molecule that can bind specifically to a target
molecule expressed in angiogenic vasculature of a tumor. Similarly,
the term "homing molecule that homes to angiogenic vasculature"
means a molecule that can bind specifically to a target molecule
expressed in angiogenic vasculature. It is understood that a homing
molecule can be a tumor homing molecule.
[0041] A homing molecule can bind to angiogenic vasculature in a
tumor or in non-tumor tissue. A homing molecule that binds to both
tumor and non-tumor angiogenic vasculature also can exhibit
preferential binding to tumor or non-tumor tissues. For example, a
tumor homing peptide such as an NGR peptide can accumulate
preferentially in angiogenic vasculature of tumors as compared to
non-tumor angiogenic vasculature.
[0042] The invention also provides a method of identifying a homing
molecule that homes to angiogenic vasculature using substantially
purified NGR receptor. The method includes the steps of contacting
a substantially purified NGR receptor with one or more molecules
and determining specific binding of a molecule to the NGR receptor,
where the presence of specific binding identifies the molecule as a
homing molecule that homes to angiogenic vasculature.
[0043] A method of the invention for identifying a homing molecule
also can include the steps of administering an NGR binding molecule
in vivo and determining binding of the NGR binding molecule to
angiogenic vasculature. Thus, the invention provides methods for
identifying homing molecules that bind to angiogenic vasculature in
non-tumor tissue as well as homing molecules that home to
angiogenic vasculature of a tumor. As disclosed herein, a
substantially purified NGR receptor can be used to identify homing
molecules that home to non-tumor neovascularized tissues of a
subject, as well as to identify tumor homing molecules.
[0044] A homing molecule that homes to angiogenic vasculature or a
tumor homing molecule that homes to angiogenic vasculature of a
tumor is identified by screening one or more molecules, for
example, a library of molecules. As used herein, the term "library"
means a collection of molecules. A library can contain a few or a
large number of different molecules, varying from about ten
molecules to several billion molecules or more. If desired, a
molecule can be linked to a tag, which can facilitate recovery or
identification of the molecule. As disclosed herein, a homing
molecule that homes to angiogenic vasculature can be identified by
in vitro screening against a substantially purified NGR
receptor.
[0045] As used herein, the term "molecule" is used broadly to mean
an organic chemical such as a drug; a nucleic acid molecule such as
an RNA, a cDNA or an oligonucleotide; a peptide, including a
variant or modified peptide or peptide-like molecules, referred to
herein as peptidomimetics, which mimic the activity of a peptide;
or a protein such as an antibody or a growth factor receptor or a
fragment thereof such as an Fv, single chain Fv(scFv), Fd or Fab
fragment of an antibody, which contains a binding domain. For
convenience, the term "peptide" is used broadly herein to mean
peptides, proteins, fragments of proteins and the like, which can
have, for example, a cyclic or linear conformation. A molecule also
can be a non-naturally occurring molecule, which does not occur in
nature, but is produced as a result of in vitro methods, or can be
a naturally occurring molecule such as a protein or fragment
thereof expressed from a cDNA library or a peptidomimetic.
[0046] A molecule to be screened against a substantially purified
NGR receptor according to a method of the invention can be a
"peptidomimetic," which is used broadly to mean a peptide-like
molecule that has the binding activity of a tumor homing peptide,
such as a peptidomimetic analog of an NGR peptide. Thus,
peptidomimetics, including chemically modified peptides,
peptide-like molecules containing non-naturally occurring amino
acids, peptoids and the like, and, in particular, peptidomimetics
of an NGR containing peptide, can be screened for the ability to
specifically bind an NGR receptor, and thus, for activity in homing
to angiogenic vasculature (see, for example, "Burger's Medicinal
Chemistry and Drug Discovery" 5th ed., vols. 1 to 3 (ed. M. E.
Wolff; Wiley Interscience 1995), which is incorporated herein by
reference). Peptidomimetics provide various advantages over a
peptide, for example, increased stability during passage through
the digestive tract and, therefore, are advantageously used for
oral administration.
[0047] Collections or libraries of peptidomimetics are well known
in the art, for example, databases that contain libraries of
potential peptidomimetics. For example, the Cambridge Structural
Database contains a collection of greater than 300,000 compounds
that have known crystal structures (Allen et al., Acta Crystallogr.
Section B, 35:2331 (1979)). This structural depository is
continually updated as new crystal structures are determined and
can be screened for compounds having suitable shapes, for example,
the same shape as a tumor homing molecule such as an NGR peptide,
as well as potential geometrical and chemical complementarity to a
target molecule bound by a tumor homing peptide. Where no crystal
structure of a tumor homing peptide or a target molecule, which
binds the tumor homing molecule, is available, a structure can be
generated using, for example, the program CONCORD (Rusinko et al.,
J. Chem. Inf. Comput. Sci. 29:251 (1989)). Another database, the
Available Chemicals Directory (Molecular Design Limited,
Informations Systems; San Leandro Calif.), contains about 100,000
compounds that are commercially available and can be screened to
identify a tumor homing molecule or a homing molecule that homes to
angiogenic vasculature according to a method of the invention.
[0048] Methods for preparing libraries containing diverse
populations of various types of molecules such as peptides,
peptoids and peptidomimetics are well known in the art and various
libraries are commercially available (see, for example, Ecker and
Crooke, Biotechnology 13:351-360 (1995), and Blondelle et al.,
Trends Anal. Chem. 14:83-92 (1995), and the references cited
therein, each of which is incorporated herein by reference; see,
also, Goodman and Ro, Peptidomimetics for Drug Design, in "Burger's
Medicinal Chemistry and Drug Discovery" Vol. 1 (ed. M. E. Wolff;
John Wiley & Sons 1995), pages 803-861, and Gordon et al., J.
Med. Chem. 37:1385-1401 (1994), each of which is incorporated
herein by reference). Where a molecule is a peptide, protein or
fragment thereof, the molecule can be produced in vitro directly or
can be expressed from a nucleic acid, which can be produced in
vitro. Methods of synthetic peptide and nucleic acid chemistry are
well known in the art.
[0049] A library of molecules also can be produced, for example, by
constructing a cDNA expression library from mRNA collected from a
cell, tissue, organ or organism of interest. Methods for producing
such libraries are well known in the art (see, for example,
Sambrook et al., Molecular Cloning: A laboratory manual (Cold
Spring Harbor Laboratory Press 1989), which is incorporated herein
by reference). Preferably, a peptide encoded by the cDNA is
expressed on the surface of a cell or a virus containing the cDNA.
For example, cDNA can be cloned into a phage vector such as fuse 5
(Example I), wherein, upon expression, the encoded peptide is
expressed as a fusion protein on the surface of the phage.
[0050] In addition, a library of molecules can comprise a library
of nucleic acid molecules, which can be DNA or RNA or an analog
thereof. Nucleic acid molecules that bind, for example, to a cell
surface receptor are well known (see, for example, O'Connell et
al., Proc. Natl. Acad. Sci., USA 93:5883-5887 (1996); Tuerk and
Gold, Science 249:505-510 (1990); Gold et al., Ann. Rev. Biochem.
64:763-797 (1995), each of which is incorporated herein by
reference). Thus, a library of nucleic acid molecules can be
contacted with a substantially purified NGR receptor to identify a
tumor homing molecule or a homing molecule that homes to angiogenic
vasculature. If desired, the nucleic acid molecules can be nucleic
acid analogs that, for example, are less susceptible to attack by
nucleases (see, for example, Jelinek et al., Biochemistry
34:11363-11372 (1995); Latham et al., Nucl. Acids Res. 22:2817-2822
(1994); Tam et al., Nucl. Acids Res. 22:977-986 (1994); Reed et
al., Cancer Res. 59:6565-6570 (1990), each of which is incorporated
herein by reference).
[0051] Particularly useful libraries of molecules to be screened
for specific binding to an NGR receptor and, therefore, for
activity in homing to angiogenic vasculature, include phage display
libraries. Such phage display libraries of molecules include
secondary libraries expressing NGR in various contexts, including
cyclic phage display peptide libraries such as X.sub.2CNGRCX.sub.2
(SEQ ID NO:222), CX.sub.2(C/X) NGR(C/X)X.sub.2C (SEQ ID NO:223),
and CNGRCX.sub.6 (SEQ ID NO:224) (where "C" is cysteine and "X" is
any amino acid; see Example X). A library of molecules to be
screened also can be a library of antibodies or antibody fragments
such as Fv, single chain Fv or Fab fragments; as disclosed in
Example X, such a library can be, for example, a combinatorial scFv
library prepared from rabbits immunized with human tumor
xenografts. Such antibodies can bind to the same epitope recognized
by the anti-CD13 antibodies F23 and MY7, or can bind to a different
epitope.
[0052] One skilled in the art understands that a molecule that
specifically binds a substantially purified NGR receptor can bind
and modulate the activity of the NGR receptor, or can be inert with
respect to its ability to affect the activity of an NGR receptor.
As disclosed herein, for example, an NGR receptor is functionally
important in angiogenesis. A molecule that specifically binds a
substantially purified NGR receptor can be an agonist or an
inhibitor of the receptor and, thus, can enhance or inhibit
angiogenesis.
[0053] An inhibitor of an NGR receptor can be highly specific for
the NGR receptor. For example, a specific inhibitor can be an
antibody that binds with high specificity to an NGR receptor. The
antibody can have the inherent property of inhibiting NGR receptor
activity upon binding of the antibody. Alternatively, an antibody
that is not inhibitory but binds specifically to an NGR receptor
can be conjugated to a drug or target to generate a specific
inhibitor. The antibody can be a monoclonal or polyclonal antibody
or can be a functional antibody fragment such as a Fv, single chain
Fv or Fab fragment.
[0054] Accordingly, monoclonal or polyclonal antibodies exhibiting
specific binding to an NGR receptor can be generated by methods
well known to those skilled in the art (Harlow and Lane,
Antibodies: A laboratory manual (Cold Spring Harbor Laboratory
Press 1988), which is incorporated herein by reference).
Alternatively, libraries of functional antibody fragments, which
can bind to an NGR receptor, can also be screened to identify a
homing molecule that binds to an NGR receptor. For example, a
combinatorial scFv library generated by immunizing with human tumor
xenografts or a substantially purified NGR receptor can be screened
for binding to an NGR receptor (see Example X).
[0055] In addition to inhibitors that are highly specific for an
NGR receptor, inhibitors also can exhibit inhibitory activity to
other molecules related but not identical to an NGR receptor. For
example, aminopeptidase inhibitors can exhibit activity specific
for an aminopeptidase or can exhibit inhibitory activity to several
aminopeptidases. A homing molecule that binds to an NGR receptor
and is an aminopeptidase inhibitor is particularly useful if the
inhibitor exhibits preferential binding to an NGR receptor in a
target neovascularized tissue.
[0056] Accordingly, libraries of molecules to be screened for
activity in specifically binding a substantially purified NGR
receptor include structural analogs of natural substrates of
aminopeptidase as well as structural analogs of aminopeptidase
inhibitors. Such libraries can include structural analogs of
substrates such as Ala-PNA; Leu enkephalin; Met enkephalin or
tuftsin (Xu et al., Experimental Hematology 25:521-529 (1997),
which is incorporated herein by reference). Such libraries also can
include structural analogs of aminopeptidase inhibitors, such as
actinonin; amastatin; bestatin; 1,10-phenanthroline or
o-phenanthroline; or 2,2'-dipyridyl; or analogs of Phe-Leu (Xu et
al., supra, 1997). Such libraries can additionally include
structural analogs of fumagillin (Sin et al., Proc. Natl. Acad.
Sci. USA 94:6099-6103 (1997), which is incorporated herein by
reference). From the above, it is understood that a molecule that
specifically binds a substantially purified NGR receptor can be a
naturally or non-naturally occurring structural analog of
Phe-Leu.
[0057] In addition to screening phage and DNA libraries as
described above, combinatorial chemistry libraries also can be
screened in vitro using a substantially purified NGR receptor
according to a method of the invention. Methods for generating
combinatorial libraries are well known in the art as described, for
example, in Gordon et al., J. Med. Chem. 37:1385-1401 (1994);
Gallop et al., J. Med. Chem. 37:1203-1251 (1994); and Wilson and
Czarnik, eds., Combinatorial Chemistry John Wiley & Sons, New
York (1997), each of which is incorporated herein by
reference).
[0058] The presence of a tumor homing molecule or a homing molecule
that specifically binds an NGR receptor within a library of
molecules can be identified using various methods well known in the
art. Generally, the compounds in a library can be tested
individually, for example, using high throughput screening. If
desired, the individual compounds can be tagged to facilitate
recovery or identification of the molecule. Such tagged libraries
are useful for in vivo and in vitro screening.
[0059] As used herein, the term "tag" means a physical, chemical or
biological moiety such as a plastic microbead, an oligonucleotide
or a bacteriophage, respectively, that is linked to a molecule of
the library. Methods for tagging a molecule are well known in the
art (Hermanson, Bioconjugate Techniques (Academic Press 1996),
which is incorporated herein by reference). A specific tag can be
particularly useful in the methods of the invention for identifying
a tumor homing molecule or a homing molecule that homes to
angiogenic vasculature. As used herein, the term "specific tag"
means a physical, chemical or biological tag that is linked to a
particular molecule in a library and is unique for that particular
molecule. A specific tag is particularly useful if it is readily
identifiable. A nucleotide sequence that is unique for a particular
molecule of a library is an example of a specific tag. For example,
the method of synthesizing peptides tagged with a unique nucleotide
sequence provides a library of molecules, each containing a
specific tag, such that upon determining the nucleotide sequence,
the identity of the peptide is known (see Brenner and Lerner, Proc.
Natl. Acad. Sci., USA 89:5381-5383 (1992), which is incorporated
herein by reference). The use of a nucleotide sequence as a
specific tag for a peptide or other type of molecule provides a
simple means to identify the presence of the molecule in a sample
because an extremely sensitive method such as PCR can be used to
determine the nucleotide sequence of the specific tag, thereby
identifying the sequence of the molecule linked thereto. Similarly,
the nucleic acid sequence encoding a peptide expressed on a phage
is another example of a specific tag, since sequencing of the
specific tag identifies the amino acid sequence of the expressed
peptide.
[0060] Identified tumor homing molecules are useful, for example,
for targeting a desired moiety such as a drug, a toxin or a
detectable label, which can be linked to the molecule, to a tumor.
In addition, a tumor homing molecule is useful for identifying the
target molecule, to which the homing molecule binds in the tumor.
Once a target molecule has been identified, for example, an NGR
receptor as disclosed herein, the target molecule can be used to
identify additional tumor homing molecules.
[0061] The present invention also provides a method of directing a
moiety to angiogenic vasculature of a tumor in a subject by
administering to the subject a conjugate including a moiety linked
to a tumor homing molecule that exhibits specific binding to an NGR
receptor, whereby the conjugate is directed to angiogenic
vasculature of a tumor. In a method of the invention, the tumor
homing molecule can be, for example, a peptide containing the
sequence NGR, and, if desired, can be part of a conjugate in which
the moiety is a cytotoxic agent, drug or chemotherapeutic agent,
for example, doxorubicin. A tumor homing peptide containing the
sequence NGR can have, for example, the sequence CNGRCVSGCAGRC (SEQ
ID NO:3), NGRAHA (SEQ ID NO:6), CVLNGRMEC (SEQ ID NO:7) or CNGRC
(SEQ ID NO:8). In a method of the invention for directing a moiety
to angiogenic vasculature of a tumor in a subject, the tumor homing
molecule also can be, for example, an aminopeptidase inhibitor such
as bestatin, o-phenanthroline, actinonin, amastatin, 2,2'-dipyridyl
or fumagillin and can be linked, if desired, to a doxorubicin
moiety.
[0062] The present invention additionally provides a method of
inhibiting angiogenesis in a tumor of a subject by administering to
the subject a conjugate including a moiety linked to a tumor homing
molecule that exhibits specific binding to an NGR receptor, whereby
the conjugate is directed to angiogenic vasculature of a tumor. In
a method of the invention, the tumor homing molecule can be, for
example, a peptide containing the sequence NGR, and, if desired,
can be part of a conjugate in which the moiety is a cytotoxic
agent, drug or chemotherapeutic agent, for example, doxorubicin. A
tumor homing peptide containing the sequence NGR can have, for
example, the sequence CNGRCVSGCAGRC (SEQ ID NO:3), NGRAHA (SEQ ID
NO:6), CVLNGRMEC (SEQ ID NO:7) or CNGRC (SEQ ID NO:8). In a method
of the invention for directing a moiety to angiogenic vasculature
of a tumor in a subject, the tumor homing molecule also can be, for
example, an aminopeptidase inhibitor such as bestatin,
o-phenanthroline, actinonin, amastatin, 2,2'-dipyridyl or
fumagillin and can be linked, if desired, to a doxorubicin
moiety.
[0063] The invention also provides a method of inhibiting
angiogenesis in a non-tumor tissue. The method includes
administering a conjugate including a moiety linked to a homing
molecule that exhibits specific binding to an NGR receptor, whereby
the conjugate is directed to angiogenic vasculature of a non-tumor
tissue. Inhibiting angiogenesis in a non-tumor tissue is useful,
for example, for treating diseases involving neovascularized tissue
such as retinal neovascularization in macular degeneration and
diabetes and neovascularization in rheumatoid arthritis
synovium.
[0064] As disclosed, tumor homing molecules can be conjugated to
moieties such as a drug or toxin in order to target the drug or
toxin to a tumor. A tumor homing molecule such as one of the NGR
containing peptides CNGRCVSGCAGRC (SEQ ID NO:3), NGRAHA (SEQ ID
NO:6), CVLNGRMEC (SEQ ID NO:7), or CNGRC (SEQ ID NO:8) can be used
to direct a moiety to angiogenic vasculature. Additional tumor
homing molecules that bind to the NGR receptor identified in vivo
or in vitro as described above also can be used to direct a moiety
to the angiogenic vasculature of a tumor.
[0065] In addition to tumor homing molecules that contain NGR,
other tumor homing molecules that specifically bind to the NGR
receptor are also useful for targeting angiogenic vasculature. As
described below, the NGR receptor exhibits aminopeptidase activity,
and the aminopeptidase activity can be inhibited by known
inhibitors such as bestatin, o-phenanthroline and actinonin.
Therefore, in addition to NGR containing peptides, other molecules
that bind to the NGR receptor can also function as tumor homing
molecules. For example, a molecule that functions as an
aminopeptidase inhibitor such as bestatin, o-phenanthroline,
actinonin, amastatin, 2,2'-dipyridyl or fumagillin can be used as
conjugates with a drug or toxin to home to angiogenic
vasculature.
[0066] The invention additionally provides a method of directing a
moiety to angiogenic vasculature in a subject by administering to
the subject a conjugate comprising a moiety linked to a homing
molecule that exhibits specific binding to an NGR receptor, where
the moiety is directed to angiogenic vasculature. Thus, the
invention provides a method of directing a conjugate, for example,
of a drug or toxin, to angiogenic vasculature of non-tumor tissue.
The targeting of a conjugate to angiogenic vasculature of non-tumor
tissue is useful, for example, for treating diseases involving
neovascularized tissue such as retinal neovascularization in
macular degeneration and diabetes and neovascularization in
rheumatoid arthritis synovium.
[0067] A variety of moieties can be directed to angiogenic
vasculature in a method of the invention. As used herein, the term
"moiety" is used broadly to mean a physical, chemical, or
biological material that is linked to a tumor homing molecule for
the purpose of being targeted in vivo to a tumor or to angiogenic
vasculature expressing a target molecule recognized by the tumor
homing molecule. In particular, a moiety is a biologically useful
moiety such as therapeutic moiety, a diagnostic moiety or a drug
delivery vehicle. Thus, a moiety can be a therapeutic agent, for
example, a cancer chemotherapeutic agent such as doxorubicin,
which, when linked to a tumor homing molecule, provides a conjugate
useful for treating a cancer in a subject. In addition, a moiety
can be a drug delivery vehicle such as a chambered microdevice, a
cell, a liposome or a virus, which can contain an agent such as a
drug or a nucleic acid.
[0068] A moiety also can be a molecule such as a polypeptide or
nucleic acid, to which a tumor homing molecule is grafted for the
purpose of directing the polypeptide or nucleic acid to a selected
tumor (Smith et al., J. Biol. Chem. 269:32788-32795 (1994); Goldman
et al., Cancer Res. 15:1447-1451 (1997), each of which is
incorporated herein by reference). For example, a peptide tumor
homing molecule can be expressed as a fusion protein with a desired
polypeptide such that the peptide targets the grafted polypeptide
to a selected tumor. Such a desired polypeptide, which is grafted
to the tumor homing peptide, can be a polypeptide involved in
initiating a cell death pathway, for example, caspase 8, thus
providing a means to direct caspase 8 to a tumor, where it can
induce apoptosis of the tumor cells or of the vasculature supplying
the tumor. A tumor homing peptide also can be grafted to a
polypeptide expressed by a virus, for example, the adenovirus
penton base coat protein, thus providing a means to target a virus
to a tumor (Wickham et al., Gene Ther. 2:750-756 (1995); Weitzman
et al., In: "Gene Therapy and Vector Systems" 2:17-25 (1997), each
of which is incorporated herein by reference; see, also, Example
III). Such a grafted virus can contain an exogenous gene useful in
a method of gene therapy. Accordingly, the invention provides
compositions of matter comprising a tumor homing molecule/moiety
conjugate.
[0069] A moiety can be a detectable label such a radiolabel or can
be a cytotoxic agent, including a toxin such as ricin or a drug
such as a chemotherapeutic agent or can be a physical, chemical or
biological material such as a liposome, microcapsule, micropump or
other chambered microdevice, which can be used, for example, as a
drug delivery system. Generally, such microdevices, should be
nontoxic and, if desired, biodegradable. Various moieties,
including microcapsules, which can contain an agent, and methods
for linking a moiety, including a chambered microdevice, to a
molecule of the invention are well known in the art and
commercially available (see, for example, "Remington's
Pharmaceutical Sciences" 18th ed. (Mack Publishing Co. 1990),
chapters 89-91; Harlow and Lane, Antibodies: A laboratory manual
(Cold Spring Harbor Laboratory Press 1988), each of which is
incorporated herein by reference; see, also, Hermanson, supra,
1996).
[0070] As disclosed herein, a moiety can be, for example, a cancer
chemotherapeutic agent linked to a tumor homing molecule to produce
a tumor homing molecule/moiety conjugate. Cytotoxic chemotherapy is
the basis of the systemic treatment of disseminated malignant
tumors. However, a major limitation of the currently used
chemotherapeutic agents is that these drugs have the narrowest
therapeutic index in all of medicine. As such, the dose of cancer
chemotherapeutic agents generally is limited by undesirable
toxicity to the patient being treated. Thus, the ability of tumor
homing peptides of the invention to target drugs into tumors was
examined. As disclosed herein, the linking of a cancer
chemotherapeutic agent, doxorubicin, to a tumor homing molecule
reduced the systemic toxicity of the doxorubicin and enhanced
anti-tumor activity of the agent (see Examples VIII and XV).
[0071] A conjugate of the invention is exemplified herein by
doxorubicin linked to various tumor homing peptides (see Examples
VII and VIII). In view of the exemplified method of linking
doxorubicin to various tumor homing peptides and the disclosed
efficacy of such conjugates of the invention, the skilled artisan
will recognize that various other chemotherapeutic agents also can
be linked to a tumor homing molecule to make a conjugate of the
invention. Cancer chemotherapeutic agents have been linked to
antibodies, for example, for the purpose of targeting the agents to
cells such as tumor cells that express the antigen recognized by
the antibodies. In addition, in such antibody/drug conjugates, the
agent can maintain its therapeutic function and the antibody can
maintain its antigen binding specificity. For example, the
anthracyclin, doxorubicin, has been linked to antibodies and the
antibody/doxorubicin conjugates have been therapeutically effective
in treating tumors (Sivam et al., Cancer Res. 55:2352-2356 (1995);
Lau et al., Bioorg. Med. Chem. 3:1299-1304 (1995); Shih et al.,
Cancer Immunol. Immunother. 38:92-98 (1994)). Similarly, other
anthracyclins, including idarubicin and daunorubicin, have been
chemically conjugated to antibodies, which have delivered effective
doses of the agents to tumors (Rowland et al., Cancer Immunol.
Immunother. 37:195-202 (1993); Aboud-Pirak et al., Biochem.
Pharmacol. 38:641-648 (1989)).
[0072] In addition to the anthracyclins, alkylating agents such as
melphalan and chlorambucil have been linked to antibodies to
produce therapeutically effective conjugates (Rowland et al.,
supra, 1994; Smyth et al., Immunol. Cell Biol. 65:315-321 (1987)),
as have vinca alkaloids such as vindesine and vinblastine
(Aboud-Pirak et al., supra, 1989; Starling et al., Bioconj. Chem.
3:315-322 (1992)). Similarly, conjugates of antibodies and
antimetabolites such as 5-fluorouracil, 5-fluorouridine and
derivatives thereof have been effective in treating tumors (Krauer
et al., Cancer Res. 52:132-137 (1992); Henn et al., J. Med. Chem.
36:1570-1579 (1993)). Other chemotherapeutic agents, including
cis-platinum (Schechter et al., Int. J. Cancer 48:167-172 (1991)),
methotrexate (Shawler et al., J. Biol. Resp. Mod. 7:608-618 (1988);
Fitzpatrick and Garnett, Anticancer Drug Des. 10:11-24 (1995)) and
mitomycin-C (Dillman et al., Mol. Biother. 1:250-255 (1989)) also
are therapeutically effective when administered as conjugates with
various different antibodies.
[0073] The results obtained using antibody/drug conjugates
demonstrate that a chemotherapeutic agent can be linked to an
antibody to produce a conjugate that maintains the antigen binding
specificity of the antibody and the therapeutic function of the
agent. As disclosed herein, a conjugate comprising doxorubicin and
a tumor homing peptide maintains the tumor homing specificity of
the tumor homing peptide as well as the therapeutic efficacy of the
chemotherapeutic agent (see Examples VIII and XV). Such results are
remarkable, since, in the doxorubicin/CNGRC (SEQ ID NO:8)
conjugate, for example, the doxorubicin component has only a
slightly lower molecular weight than the peptide and comprises
about 46% of the molecular weight of the conjugate.
[0074] Since the moiety component of a tumor homing molecule/moiety
conjugate can comprise a substantial portion of the conjugate
without adversely affecting the ability of the tumor homing
molecule to home to a tumor, additional components can be included
as part of the conjugate, if desired. For example, in some cases,
it can be desirable to utilize an oligopeptide spacer between a
tumor homing peptide and the moiety (Fitzpatrick and Garnett,
Anticancer Drug Des. 10:1-9 (1995)). In this way, panels of
moiety/spacer complexes can be constructed, in which a common
spacer is linked to various different moieties. Such panels of
moiety/spacer conjugates can facilitate linkage of the moiety to a
tumor homing molecule such as a tumor homing peptide of choice.
[0075] Doxorubicin is one of the most commonly used cancer
chemotherapeutic agents and, particularly, is used for treating
breast cancer (Stewart and Ratain, In: "Cancer: Principles and
practice of oncology" 5th ed., chap. 19 (eds. DeVita, Jr., et al.;
J.P. Lippincott 1997); Harris et al., In "Cancer: Principles and
practice of oncology," supra, 1997). In addition, doxorubicin has
anti-angiogenic activity (Folkman, supra, 1997; Steiner, In
"Angiogenesis: Key principles-Science, technology and medicine,"
pp. 449-454 (eds. Steiner et al.; Birkhauser Verlag, 1992)), which
can contribute to its effectiveness in treating cancer. Thus,
treatment of human breast cancer xenografts in mice using
doxorubicin was selected as a model for exemplifying the present
invention.
[0076] As used herein, the term "tumor" means a mass of cells that
are characterized, at least in part, by containing angiogenic
vasculature. The term "tumor" is used broadly to include the tumor
parenchymal cells as well as the supporting stroma, including the
angiogenic blood vessels that infiltrate the tumor parenchymal cell
mass. Although a tumor generally is a malignant tumor, i.e., a
"cancer," a tumor also can be nonmalignant, provided that
neovascularization is associated with the tumor. The term "normal"
or "nontumor" tissue is used to refer to tissue that is not a
"tumor." As disclosed herein, a tumor homing molecule can be
identified based on its ability to home a tumor, but not to a
corresponding nontumor tissue.
[0077] As used herein, the term "corresponding," when used in
reference to tumors or tissues or both, means that two or more
tumors, or two or more tissues, or a tumor and a tissue are of the
same histologic type. The skilled artisan will recognize that the
histologic type of a tissue is a function of the cells comprising
the tissue. Thus, the artisan will recognize, for example, that a
nontumor tissue corresponding to a breast tumor is normal breast
tissue, whereas a nontumor tissue corresponding to a melanoma is
skin, which contains melanocytes. Furthermore, for purposes of the
invention, it is recognized that a tumor homing molecule can bind
specifically to a target molecule expressed by the vasculature in a
tumor, which generally contains blood vessels undergoing
neovascularization, in which case a tissue corresponding to the
tumor would comprise nontumor tissue containing blood vessels that
are not undergoing active angiogenesis.
[0078] The term "corresponding" also is used herein in reference to
the evolutionarily conserved nature of target molecules, which are
expressed in a tumor, for example, in a mouse as compared to a
human. Thus, reference to the corresponding target molecules in
mouse tumor vasculature as compared, for example, to human
vasculature, means target molecules having a similar function,
particularly the ability to specifically bind a tumor homing
molecule.
[0079] Further provided herein is a method of imaging the
angiogenic vasculature of a tumor or other pathological tissue in a
subject by administering to the subject a conjugate having a
detectable moiety linked to a molecule that exhibits specific
binding to an NGR receptor, whereby the conjugate selectively binds
the angiogenic vasculature, and detecting the conjugate. A
detectable moiety for imaging angiogenic vasculature can be, for
example, a radionuclide. A useful homing molecule for imaging
angiogenic vasculature can be, for example, a peptide containing
the sequence NGR, such as a peptide containing the sequence
CNGRCVSGCAGRC (SEQ ID NO:3), NGRAHA (SEQ ID NO:6), CVLNGRMEC (SEQ
ID NO:7) or CNGRC (SEQ ID NO:8). A tumor homing molecule for
imaging angiogenic vasculature also can be, for example, an
aminopeptidase inhibitor such as bestatin, o-phenanthroline,
actinonin, amastatin, 2,2'-dipyridyl or fumagillin. Methods for
coupling detectable moieties to a tumor homing molecule are
described below. Thus, the identification of tumor homing molecules
that bind an NGR receptor as described herein provides reagents
useful for imaging tumors for diagnostic and prognostic
purposes.
[0080] The invention also provides a substantially purified target
molecule, comprising an NGR receptor that binds a peptide
comprising the sequence NGR, provided that the NGR receptor does
not have the amino acid sequence of CD13/aminopeptidase N (SEQ ID
NO:201). Accordingly, an NGR receptor that has one or more
modifications of amino acids relative to the sequence of
CD13/aminopeptidase (SEQ ID NO:201), for example, deletions,
insertions or substitutions, including conservative and
non-conservative amino acid substitutions, and that specifically
binds the sequence NGR is provided by the invention.
[0081] The present invention relates to molecules that selectively
home to tumors. For example, the invention provides tumor homing
peptides such as the peptides CGRECPRLCQSSC (SEQ ID NO:2) and
CNGRCVSGCAGRC (SEQ ID NO:3), which were identified based on their
ability to home to a breast carcinoma, and the peptide CLSGSLSC
(SEQ ID NO:4, which was identified based on its ability to home to
a melanoma. Such tumor homing peptides were identified using in
vivo panning (see U.S. Pat. No. 5,622,699, issued Apr. 22, 1997;
Pasqualini and Ruoslahti, Nature 380:364-366 (1996), each of which
is incorporated herein by reference).
[0082] The disclosed tumor homing peptides were identified based on
their homing to various particular tumors. For example, in vivo
panning was performed using a mouse bearing a human breast
carcinoma xenograft and peptides that homed to the breast tumor
were identified. However, as disclosed herein, such tumor homing
peptides generally homed to other types of tumors, including a
mouse melanoma and a human Kaposi's sarcoma. Thus, while the tumor
homing peptide CNGRCVSGCAGRC (SEQ ID NO:3) was identified by its
ability to home in vivo to a breast tumor, this peptide also homed
in vivo to a melanoma and to a Kaposi's sarcoma, but not to
nontumor tissues.
[0083] Similarly, the tumor homing peptide CLSGSLSC (SEQ ID NO:4)
was identified based on its homing to melanoma. However, further
examination of this peptide revealed that it also homed to a breast
tumor and to Kaposi's sarcoma. Immunohistological analysis revealed
that such tumor homing peptides initially are associated with the
vasculature of the various tumors, although at later time the
molecules are associated with tumor parenchymal cells. Thus, the
general tumor homing ability of a tumor homing molecule of the
invention is due, at least in part, to the ability of the tumor
homing molecules to target angiogenic vasculature associated with a
tumor. These results indicate that specific target molecules are
expressed by the cells comprising the vasculature in a tumor as
compared to the cell surface molecule expressed by vasculature in
nontumor tissues. Using methods as disclosed herein, the artisan
readily can determine whether a tumor homing molecule homes
generally to the angiogenic vasculature associated with a tumor or
homes specifically to a particular type of tumor cell.
[0084] Identified tumor homing molecules are useful, for example,
for targeting a desired moiety such as a drug, a toxin or a
detectable label, which can be linked to the molecule, to a tumor.
Thus, the invention provides tumor homing molecule/moiety
conjugates, which are useful for targeting the moiety to a tumor.
Accordingly, the invention also provides methods of targeting a
moiety to a tumor and, therefore, methods of reducing the severity
of a tumor and of treating a subject having a cancer (see Examples
VIII and XV). In addition, a tumor homing molecule is useful for
identifying the target molecule, to which the homing molecule binds
in the tumor.
[0085] Methods for identifying a tumor homing molecule within a
library of molecules have been described hereinabove. Generally,
the presence of a tumor homing molecule in a tumor is identified
based on one or more characteristics common to the molecules
present in the library, then the structure of a particular tumor
homing molecule is identified. For example, a highly sensitive
detection method such as mass spectrometry, either alone or in
combination with a method such as gas chromatography, can be used
to identify tumor homing molecules in a tumor. Thus, where a
library comprises diverse molecules based generally on the
structure of an organic molecule such as a drug, a tumor homing
molecule can be identified by determining the presence of a parent
peak for the particular molecule.
[0086] If desired, the tumor can be collected, then processed using
a method such as HPLC, which can provide a fraction enriched in
molecules having a defined range of molecular weights or polar or
nonpolar characteristics or the like, depending, for example, on
the general characteristics of the molecules comprising the
library. Conditions for HPLC will depend on the chemistry of the
particular molecule and are well known to those skilled in the art.
Similarly, methods for bulk removal of potentially interfering
cellular materials such as DNA, RNA, proteins, lipids or
carbohydrates are well known in the art, as are methods for
enriching a fraction containing an organic molecule using, for
example, methods of selective extraction. Where a library comprises
a population of diverse organic chemical molecules, each linked to
a specific oligonucleotide tag, such that the specific molecule can
be identified by determining the oligonucleotide sequence using
polymerase chain reaction (PCR), genomic DNA can be removed from
the sample of the collected tumor in order to reduce the potential
for background PCR reactions. In addition, a library can comprise a
population of diverse molecules such as organic chemical molecules,
each linked to a common, shared tag. Based on the presence and
properties of the shared tag, molecules of the library that
selectively home to a tumor can be substantially isolated from a
sample of the tumor. These and other methods can be useful for
enriching a sample of a collected tumor for the particular tumor
homing molecule, thereby removing potentially contaminating
materials from the collected tumor sample and increasing the
sensitivity of detecting a molecule.
[0087] Evidence provided herein indicates that a sufficient number
of tumor homing molecules selectively homes to a tumor during in
vivo panning such that the molecules readily can be identified. For
example, various independent phage expressing the same peptide were
identified in tumors formed from implanted human breast cancer
cells (Table 1), from mouse melanoma cells (Table 2) or from human
Kaposi's sarcoma cells (Table 3).
[0088] Although a substantial fraction of the identified tumor
homing molecules have the same structure, the peptide inserts of
only a small number of isolated phage were determined. It should be
recognized, however, that hundreds of thousands to millions of
phage expressing organ homing peptides have been recovered
following in vivo pannings for organ homing molecules (see, for
example, U.S. Pat. No. 5,622,699; Pasqualini and Ruoslahti, supra,
1996). These results indicate that specific tumor homing molecules
will be present in substantial numbers in a tumor following in vivo
homing, thereby increasing the ease with which the molecules can be
identified.
[0089] Ease of identification of a tumor homing molecule,
particularly an untagged molecule, depends on various factors,
including the presence of potentially contaminating background
cellular material. Thus, where the tumor homing molecule is an
untagged peptide, a larger number must home to the tumor in order
to identify the specific peptides against the background of
cellular protein. In contrast, a much smaller number of an untagged
organic chemical homing molecule such as a drug is identifiable
because such molecules normally are absent from or present in only
small numbers in the body. In such a case, a highly sensitive
method such as mass spectrometry can be used to identify a tumor
homing molecule. The skilled artisan will recognize that the method
of identifying a molecule will depend, in part, on the chemistry of
the particular molecule.
[0090] Several rounds of in vivo homing can be performed with
partial purification of the library molecule by extracting the
target tissue between rounds of screening. To ensure the recovery
of an adequate number of homing molecules after the final round of
screening, material can be pooled from several animals used in an
earlier round of screening and injected into a smaller number of
animals in the subsequent rounds of screening. Alternatively, a
larger animal can be used in the earlier rounds than in the
subsequent rounds of screening. The feasibility of screening
without intervening steps has been demonstrated with phage.
[0091] Where a tumor homing molecule is a nucleic acid or is tagged
with a nucleic acid, an assay such as PCR can be particularly
useful for identifying the presence of the molecule because, in
principle, PCR can detect the presence of a single nucleic acid
molecule (see, for example, Erlich, PCR Technology: Principles and
Applications for DNA Amplification (Stockton Press 1989), which is
incorporated herein by reference). Preliminary studies have
demonstrated that, following intravenous injection of 10 ng of an
approximately 6000 base pair plasmid into a mouse and 2 minutes in
the circulation, the plasmid was detectable by PCR in a sample of
lung. These results indicate that nucleic acids are sufficiently
stable when administered into the circulation such that in vivo
panning can be used to identify nucleic acid molecules that
selectively home to a tumor.
[0092] The molecules of a library can be tagged, which can
facilitate recovery or identification of the molecule. As used
herein, the term "tag" means a physical, chemical or biological
moiety such as a plastic microbead, an oligonucleotide or a
bacteriophage, respectively, that is linked to a molecule of the
library. Methods for tagging a molecule are well known in the art
(Hermanson, supra (1996)), which is incorporated herein by
reference).
[0093] A tag, which can be a shared tag or a specific tag, can be
useful for identifying the presence or structure of a tumor homing
molecule of a library. As used herein, the term "shared tag" means
a physical, chemical or biological moiety that is common to each
molecule in a library. Biotin, for example, can be a shared tag
that is linked to each molecule in a library. A shared tag can be
useful to identify the presence of a molecule of the library in a
sample and also can be useful to substantially isolate the
molecules from a sample. For example, where the shared tag is
biotin, the biotin-tagged molecules in a library can be
substantially isolated by binding to streptavidin or their presence
can be identified by binding with a labeled streptavidin. Where a
library is a phage display library, the phage that express the
peptides are another example of a shared tag, since each peptide of
the library is linked to a phage. In addition, a peptide such as
the hemaglutinin antigen can be a shared tag that is linked to each
molecule in a library, thereby allowing the use of an antibody
specific for the hemaglutinin antigen to substantially isolate
molecules of the library from a sample of a selected tumor.
[0094] A shared tag also can be a nucleic acid sequence that can be
useful to identify the presence of molecules of the library in a
sample or to substantially isolate molecules of a library from a
sample. For example, each of the molecules of a library can be
linked to the same selected nucleotide sequence, which constitutes
the shared tag. An affinity column containing a nucleotide sequence
that is complementary to the shared tag then can be used to
hybridize molecules of the library containing the shared tag, thus
substantially isolating the molecules from a tumor sample. A
nucleotide sequence complementary to a portion of the shared
nucleotide sequence tag also can be used as a PCR primer such that
the presence of molecules containing the shared tag can be
identified in a sample by PCR.
[0095] The molecules of a library can be tagged, which can
facilitate recovery or identification of the molecule. As used
herein, the term "tag" means a physical, chemical or biological
moiety such as a plastic microbead, an oligonucleotide or a
bacteriophage, respectively, that is linked to a molecule of the
library. Methods for tagging a molecule are well known in the art
(Hermanson, Bioconjugate Techniques (Academic Press 1996), which is
incorporated herein by reference).
[0096] A specific tag can be particularly useful in the methods of
the invention for identifying a tumor homing molecule that homes to
angiogenic vasculature. As used herein, the term "specific tag"
means a physical, chemical or biological tag that is linked to a
particular molecule in a library and is unique for that particular
molecule. A specific tag is particularly useful if it is readily
identifiable. A nucleotide sequence that is unique for a particular
molecule of a library is an example of a specific tag. For example,
the method of synthesizing peptides tagged with a unique nucleotide
sequence provides a library of molecules, each containing a
specific tag, such that upon determining the nucleotide sequence,
the identity of the peptide is known (see Brenner and Lerner, supra
(1992), which is incorporated herein by reference). The use of a
nucleotide sequence as a specific tag for a peptide or other type
of molecule provides a simple means to identify the presence of the
molecule in a sample because an extremely sensitive method such as
PCR can be used to determine the nucleotide sequence of the
specific tag, thereby identifying the sequence of the molecule
linked thereto. Similarly, the nucleic acid sequence encoding a
peptide expressed on a phage is another example of a specific tag,
since sequencing of the specific tag identifies the amino acid
sequence of the expressed peptide.
[0097] The presence of a shared tag or a specific tag can provide a
means to identify or recover a tumor homing molecule of the
invention following in vivo panning. In addition, the combination
of a shared tag and specific tag can be particularly useful for
identifying a tumor homing molecule. For example, a library of
peptides can be prepared such that each is linked to a specific
nucleotide sequence tag (see, for example, Brenner and Lerner,
supra, 1992), wherein each specific nucleotide sequence tag has
incorporated therein a shared tag such as biotin. Upon homing to a
tumor, the particular tumor homing peptides can be substantially
isolated from a sample of the tumor based on the shared tag and the
specific peptides can be identified, for example, by PCR of the
specific tag (see Erlich, supra, 1989).
[0098] A tag also can serve as a support. As used herein, the term
"support" means a tag having a defined surface to which a molecule
can be attached. In general, a tag useful as a support is a shared
tag. For example, a support can be a biological tag such as a virus
or virus-like particle such as a bacteriophage ("phage"); a
bacterium such as E. coli; or a eukaryotic cell such as a yeast,
insect or mammalian cell; or can be a physical tag such as a
liposome or a microbead, which can be composed of a plastic,
agarose, gelatin or other biological or inert material. If desired,
a shared tag useful as a support can have linked thereto a specific
tag. Thus, the phage display libraries used in the exemplified
methods can be considered to consist of the phage, which is a
shared tag that also is a support, and the nucleic acid sequence
encoding the expressed peptide, the nucleic acid sequence being a
specific tag.
[0099] In general, a support should have a diameter less than about
10 .mu.m to about 50 .mu.m in its shortest dimension, such that the
support can pass relatively unhindered through the capillary beds
present in the subject and not occlude circulation. In addition, a
support can be nontoxic, so that it does not perturb the normal
expression of cell surface molecules or normal physiology of the
subject, and biodegradable, particularly where the subject used for
in vivo panning is not sacrificed to collect a selected tumor.
[0100] Where a molecule is linked to a support, the tagged molecule
comprises the molecule attached to the surface of the support, such
that the part of the molecule suspected of being able to interact
with a target molecule in a cell in the subject is positioned so as
to be able to participate in the interaction. For example, where
the tumor homing molecule is suspected of being a ligand for a
growth factor receptor, the binding portion of the molecule
attached to a support is positioned so it can interact with the
growth factor receptor on a cell in the tumor. If desired, an
appropriate spacer molecule can be positioned between the molecule
and the support such that the ability of the potential tumor homing
molecule to interact with the target molecule is not hindered. A
spacer molecule also can contain a reactive group, which provides a
convenient and efficient means of linking a molecule to a support
and, if desired, can contain a tag, which can facilitate recovery
or identification of the molecule (see Hermanson, supra, 1996).
[0101] As exemplified herein, a peptide suspected of being able to
home to a selected tumor such as a breast carcinoma or a melanoma
was expressed as the N-terminus of a fusion protein, wherein the
C-terminus consisted of a phage coat protein. Upon expression of
the fusion protein, the C-terminal coat protein linked the fusion
protein to the surface of a phage such that the N-terminal peptide
was in a position to interact with a target molecule in the tumor.
Thus, a molecule having a shared tag was formed by the linking of a
peptide to a phage, wherein the phage provided a biological
support, the peptide molecule was linked as a fusion protein, the
phage-encoded portion of the fusion protein acted as a spacer
molecule, and the nucleic acid encoding the peptide provided a
specific tag allowing identification of a tumor homing peptide.
[0102] As used herein, the term "in vivo panning," when used in
reference to the identification of a tumor homing molecule, means a
method of screening a library by administering the library to a
subject and identifying a molecule that selectively homes to a
tumor in the subject (see U.S. Pat. No. 5,622,699). The term
"administering to a subject", when used in referring to a library
of molecules or a portion of such a library, is used in its
broadest sense to mean that the library is delivered to a tumor in
the subject, which, generally, is a vertebrate, particularly a
mammal such as a human.
[0103] A library can be administered to a subject, for example, by
injecting the library into the circulation of the subject such that
the molecules pass through the tumor; after an appropriate period
of time, circulation is terminated by sacrificing the subject or by
removing a sample of the tumor (Example I; see, also, U.S. Pat. No.
5,622,699; Pasqualini and Ruoslahti, supra, 1996). Alternatively, a
cannula can be inserted into a blood vessel in the subject, such
that the library is administered by perfusion for an appropriate
period of time, after which the library can be removed from the
circulation through the cannula or the subject can be sacrificed to
collect the tumor, or the tumor can be sampled, to terminate
circulation. Similarly, a library can be shunted through one or a
few organs, including the tumor, by cannulation of the appropriate
blood vessels in the subject. It is recognized that a library also
can be administered to an isolated perfused tumor. Such panning in
an isolated perfused tumor can be useful to identify molecules that
bind to the tumor and, if desired, can be used as an initial
screening of a library.
[0104] The use of in vivo panning to identify tumor homing
molecules is exemplified herein by screening a phage peptide
display library in tumor-bearing mice and identifying specific
peptides that selectively homed to a breast tumor or to a melanoma
tumor (Example I). However, phage libraries that display protein
receptor molecules, including, for example, an antibody or an
antigen binding fragment of an antibody such an Fv, Fd or Fab
fragment; a hormone receptor such as a growth factor receptor; or a
cell adhesion receptor such as an integrin or a selectin also can
be used to practice the invention. Variants of such molecules can
be constructed using well known methods such as random,
site-directed or codon based mutagenesis (see Huse, U.S. Pat. No.
5,264,563, issued Nov. 23, 1993, which is incorporated herein by
reference) and, if desired, peptides can be chemically modified
following expression of the phage but prior to administration to
the subject. Thus, various types of phage display libraries can be
screened by in vivo panning.
[0105] Phage display technology provides a means for expressing a
diverse population of random or selectively randomized peptides.
Various methods of phage display and methods for producing diverse
populations of peptides are well known in the art. For example,
Ladner et al. (U.S. Pat. No. 5,223,409, issued Jun. 29, 1993, which
is incorporated herein by reference) describe methods for preparing
diverse populations of binding domains on the surface of a phage.
In particular, Ladner et al. describe phage vectors useful for
producing a phage display library, as well as methods for selecting
potential binding domains and producing randomly or selectively
mutated binding domains.
[0106] Similarly, Smith and Scott (Meth. Enzymol. 217:228-257
(1993); see, also, Scott and Smith, Science 249: 386-390 (1990),
each of which is incorporated herein by reference) describe methods
of producing phage peptide display libraries, including vectors and
methods of diversifying the population of peptides that are
expressed (see, also, Huse, WO 91/07141 and WO 91/07149, each of
which is incorporated herein by reference; see, also, Example I).
Phage display technology can be particularly powerful when used,
for example, with a codon based mutagenesis method, which can be
used to produce random peptides or randomly or desirably biased
peptides (Huse, U.S. Pat. No. 5,264,563, supra, 1993). These or
other well known methods can be used to produce a phage display
library, which can be subjected to the in vivo panning method of
the invention in order to identify a peptide that homes to a
tumor.
[0107] In addition to screening a phage display library, in vivo
panning can be used to screen various other types of libraries,
including, for example, an RNA or DNA library or a chemical
library. If desired, the tumor homing molecule can be tagged, which
can facilitate recovery of the molecule from the tumor or
identification of the molecule in the tumor. For example, where a
library of organic molecules, each containing a shared tag, is
screened, the tag can be a moiety such as biotin, which can be
linked directly to the molecule or can be linked to a support
containing the molecules. Biotin provides a shared tag useful for
recovering the molecule from a selected tumor sample using an
avidin or streptavidin affinity matrix. In addition, a molecule or
a support containing a molecule can be linked to a hapten such as
4-ethoxy-methylene-2-phenyl-2-oxazoline-5-one (phOx), which can be
bound by an anti-phOx antibody linked to a magnetic bead as a means
to recover the molecule. Methods for purifying biotin or phOx
labeled conjugates are known in the art and the materials for
performing these procedures are commercially available (e.g.,
Invitrogen, La Jolla Calif.; and Promega Corp., Madison Wis.). In
the case where a phage library is screened, the phage can be
recovered using methods as disclosed in Example I.
[0108] In vivo panning provides a method for directly identifying
molecules that can selectively home to a tumor. As used herein, the
term "home" or "selectively home" means that a particular molecule
binds relatively specifically to a target molecule present in the
tumor following administration to a subject. In general, selective
homing is characterized, in part, by detecting at least a two-fold
(2.times.) greater specific binding of the molecule to the tumor as
compared to a control organ or tissue.
[0109] It should be recognized that, in some cases, a molecule can
localize nonspecifically to an organ or tissue containing a tumor.
For example, in vivo panning of a phage display library can result
in high background in organs such as liver and spleen, which
contain a marked component of the reticuloendothelial system (RES).
Thus, where a tumor is present, for example, in the liver,
nonspecific binding of molecules due to uptake by the RES can make
identifying a tumor homing molecule more difficult.
[0110] Selective homing can be distinguished from nonspecific
binding, however, by detecting differences in the abilities of
different individual phage to home to a tumor. For example,
selective homing can be identified by combining a putative tumor
homing molecule such as a peptide expressed on a phage with a large
excess of non-infective phage or with about a five-fold excess of
phage expressing unselected peptides, injecting the mixture into a
subject and collecting a sample of the tumor. In the latter case,
for example, provided the number of injected phage expressing tumor
homing peptide is sufficiently low so as to be nonsaturating for
the target molecule, a determination that greater than about 20% of
the phage in the tumor express the putative tumor homing molecule
is demonstrative evidence that the peptide expressed by the phage
is a specific tumor homing molecule. In addition, nonspecific
localization can be distinguished from selective homing by
performing competition experiments using, for example, phage
expressing a putative tumor homing peptide in combination with an
excess amount of the "free" peptide (Example V).
[0111] In addition, various methods can be used to prevent
nonspecific binding of a molecule to an organ containing a
component of the RES. For example, a molecule that homes
selectively to a tumor present in an organ containing a component
of the RES can be obtained by first blocking the RES using, for
example, polystyrene latex particles or dextran sulfate (see Kalin
et al., Nucl. Med. Biol. 20:171-174 (1993); Illum et al., J. Pharm.
Sci. 75:16-22 (1986); Takeya et al., J. Gen. Microbiol. 100:373-379
(1977), each of which is incorporated herein by reference), then
administering the library to the subject. For example,
pre-administration of dextran sulfate 500 or polystyrene
microspheres prior to administration of a test substance has been
used to block nonspecific uptake of the test substance by Kupffer
cells, which are the RES component of the liver (Illum et al.,
supra, 1986). Similarly, nonspecific uptake of agents by the RES
has been blocked using carbon particles or silica (Takeya et al.,
supra, 1977) or a gelatine colloid (Kalin et al., supra, 1993).
Thus, various agents useful for blocking nonspecific uptake by the
RES are known and routinely used.
[0112] Nonspecific binding of phage to RES or to other sites also
can be prevented by coinjecting, for example, mice with a specific
phage display library together with the same phage made
noninfective (Smith et al., supra, 1990, 1993). In addition, a
peptide that homes to tumor in an organ containing an RES component
can be identified by preparing a phage display library using phage
that exhibit low background binding to the particular organ. For
example, Merrill et al. (Proc. Natl. Acad. Sci., USA 93:3188-3192
(1996), which is incorporated herein by reference) selected
lambda-type phage that are not taken up by the RES and, as a
result, remain in the circulation for a prolonged period of time. A
filamentous phage variant, for example, can be selected using
similar methods.
[0113] Selective homing can be demonstrated by determining the
specificity of a tumor homing molecule for the tumor as compared to
a control organ or tissue. Selective homing also can be
demonstrated by showing that molecules that home to a tumor, as
identified by one round of in vivo panning, are enriched for tumor
homing molecules in a subsequent round of in vivo panning. For
example, phage expressing peptides that selectively home to a
melanoma tumor were isolated by in vivo panning, then were
subjected to additional rounds of in vivo panning. Following a
second round of screening, phage recovered from the tumor showed a
3-fold enrichment in homing to the tumor as compared to brain.
Phage recovered from the tumor after a third round of screening
showed an average of 10-fold enrichment in homing to the tumor as
compared to brain. Selective homing also can be demonstrated by
showing that molecules that home to a selected tumor, as identified
by one round of in vivo panning, are enriched for tumor homing
molecules in a subsequent round of in vivo panning.
[0114] Tumor homing molecules can be identified by in vivo panning
using, for example, a mouse containing a transplanted tumor. Such a
transplanted tumor can be, for example, a human tumor that is
transplanted into immunodeficient mice such as nude mice or a
murine tumor that is maintained by passage in tissue culture or in
mice. Due to the conserved nature of cellular receptors and of
ligands that bind a particular receptor, it is expected that
angiogenic vasculature and histologically similar tumor cells in
various species can share common cell surface markers useful as
target molecules for a tumor homing molecule. Thus, the skilled
artisan would recognize that a tumor homing molecule identified
using, for example, in vivo panning in a mouse having a murine
tumor of a defined histological type such as a melanoma also would
bind to the corresponding target molecule in a tumor in a human or
other species. Similarly, tumors growing in experimental animals
require associated neovascularization, just as that required for a
tumor growing in a human or other species. Thus, a tumor homing
molecule that binds a target molecule present in the vasculature in
a tumor grown in a mouse likely also can bind to the corresponding
target molecule in the vasculature of a tumor in a human or other
mammalian subject. The general ability of a tumor homing molecule
identified, for example, by homing to a human breast tumor, also to
home to a human Kaposi's sarcoma or to a mouse melanoma indicates
that the target molecules are shared by many tumors. Indeed, the
results disclosed herein demonstrate that the target molecules are
expressed in the neovasculature, which is host tissue (see Examples
V and VIII).
[0115] A tumor homing molecule identified using in vivo panning in
an experimental animal such as a mouse readily can be examined for
the ability to bind to a corresponding tumor in a human patient by
demonstrating, for example, that the molecule also can bind
specifically to a sample of the tumor obtained from the patient.
For example, the RGD-4C(CDCRGDCFC; SEQ ID NO:1) phage and NGR
peptides have been shown to bind to blood vessels in microscopic
sections of human tumors, whereas little or no binding occurs in
the blood vessels of nontumor tissues. Thus, routine methods can be
used to confirm that a tumor homing molecule identified using in
vivo panning in an experimental animal also can bind the target
molecule in a human tumor.
[0116] The steps of administering the library to the subject,
collecting a selected tumor and identifying the molecules that home
to the tumor, comprise a single round of in vivo panning. Although
not required, one or more additional rounds of in vivo panning
generally are performed. Where an additional round of in vivo
panning is performed, the molecules recovered from the tumor in the
previous round are administered to a subject, which can be the same
subject used in the previous round, where only a part of the tumor
was collected.
[0117] By performing a second round of in vivo panning, the
relative binding selectivity of the molecules recovered from the
first round can be determined by administering the identified
molecules to a subject, collecting the tumor, and determining
whether more phage is recovered from the tumor following the second
round of screening as compared to those recovered following the
first round. Although not required, a control organ or tissue also
can be collected and the molecules recovered from the tumor can be
compared with those recovered from the control organ. Ideally, no
molecules are recovered from a control organ or tissue following a
second or subsequent round of in vivo panning. Generally, however,
a proportion of the molecules also will be present in a control
organ or tissue. In this case, the ratio of molecules in the
selected tumor as compared to the control organ (selected:control)
can be determined. For example, phage that homed to melanoma
following a first round of in vivo panning demonstrated a 3.times.
enrichment in homing to the selected tumor as compared to the
control organ, brain, following two additional rounds of panning
(Example VI).
[0118] Additional rounds of in vivo panning can be used to
determine whether a particular molecule homes only to the selected
tumor or can recognize a target on the tumor that also is expressed
in one or more normal organs or tissues in a subject or is
sufficiently similar to the target molecule on the tumor. It is
unlikely that a tumor homing molecule also will home to a
corresponding normal tissue because the method of in vivo panning
selects only those molecules that home to the tumor, which is
selected. Where a tumor homing molecule also directs homing to one
or more normal organs or tissues in addition to the tumor, the
organs or tissues are considered to constitute a family of selected
organs or tissues. Using the method of in vivo panning, molecules
that home to only the selected tumor can be distinguished from
molecules that also home to one or more selected organs or tissues.
Such identification is expedited by collecting various organs or
tissues during subsequent rounds of in vivo panning.
[0119] The term "control organ or tissue" is used to mean an organ
or tissue other than the tumor for which the identification of a
tumor homing molecule is desired. A control organ or tissue is
characterized in that a tumor homing molecule does not selectively
home to the control organ. A control organ or tissue can be
collected, for example, to identify nonspecific binding of the
molecule or to determine the selectivity of homing of the molecule.
In addition, nonspecific binding can be identified by
administering, for example, a control molecule, which is known not
to home to a tumor but is chemically similar to a potential tumor
homing molecule. Alternatively, where the administered molecules
are linked to a support, administration of the supports, alone,
also can be used to identify nonspecific binding. For example, a
phage that expresses the gene III protein, alone, but that does not
contain a peptide fusion protein, can be studied by in vivo panning
to determine the level of nonspecific binding of the phage
support.
[0120] As disclosed herein, specific homing of a tumor homing
molecule readily can be identified by examining the selected tumor
tissue as compared to a corresponding nontumor tissue, as well as
to control organs or tissues. For example, immunohistological
analysis can be performed on a tumor tissue and corresponding
nontumor tissue using an antibody specific for a phage used to
display tumor homing peptides (see Example V). Alternatively, an
antibody can be used that is specific for a shared tag that
expressed with the peptide, for example, a FLAG epitope or the
like, such detection systems being commercially available.
[0121] In general, a library of molecules, which contains a diverse
population of random or selectively randomized molecules of
interest, is prepared, then administered to a subject. At a
selected time after administration, the subject is sacrificed and
the tumor is collected such that the molecules present in the tumor
can be identified (see Example I). If desired, one or more control
organs or tissues or a part of a control organ or tissue can be
sampled. For example, mice bearing a breast tumor or a melanoma
tumor were injected with a phage peptide display library, then,
after about 1 to 5 minutes, the mice were anesthetized, either
frozen in liquid nitrogen or, preferably, are perfused through the
heart to terminate circulation of the phage, the tumor and one or
more control organs were collected from each, phage present in the
tumor and the control organs were recovered and peptides that
selectively homed to the respective tumors were identified (see
Examples I, II and VI).
[0122] In the examples provided, the animals were sacrificed to
collect the selected tumor and control organ or tissue. It should
be recognized, however, that only a part of a tumor need be
collected to recover a support containing a molecule that homes to
that tumor and, similarly, only part of an organ or tissue need be
collected as a control. Thus, a part of a tumor, for example, can
be collected by biopsy, such that a molecule such as a peptide
expressed by a phage can be administered to the same subject a
second time or more, as desired. Where the molecule that is to be
administered a second time to the same subject is tagged or linked,
for example, to a support, the tag or support should be nontoxic
and biodegradable, so as not to interfere with subsequent rounds of
screening.
[0123] In vitro screening of phage libraries previously has been
used to identify peptides that bind to antibodies or to cell
surface receptors (Smith and Scott, supra, 1993). For example, in
vitro screening of phage peptide display libraries has been used to
identify novel peptides that specifically bound to integrin
adhesion receptors (Koivunen et al., J. Cell Biol. 124:373-380
(1994a), which is incorporated herein by reference) and to the
human urokinase receptor (Goodson et al., Proc. Natl. Acad. Sci.,
USA 91:7129-7133 (1994)). However, such in vitro studies provide no
insight as to whether a peptide that can specifically bind to a
selected receptor in vitro also will bind the receptor in vivo or
whether the binding peptide or the receptor are unique to a
specific organ in the body. Furthermore, the in vitro methods are
performed using defined, well-characterized target molecules in an
artificial system. For example, Goodson et al. (supra, 1994)
utilized cells expressing a recombinant urokinase receptor.
However, such in vitro methods are limited in that they require
prior knowledge of the target molecule and yield little if any
information regarding in vivo utility.
[0124] In vitro panning against cells in culture also has been used
to identify molecules that can specifically bind to a receptor
expressed by the cells (Barry et al., Nature Med. 2:299-305 (1996),
which is incorporated herein by reference). However, the cell
surface molecules that are expressed by a cell in vivo often change
when the cell is grown in culture. Thus, in vitro panning methods
using cells in culture also are limited in that there is no
guarantee a molecule that is identified due to its binding to a
cell in culture will have the same binding ability in vivo.
Furthermore, it is not possible using in vitro panning to
distinguish molecules that home only to the tumor cells used in the
screening, but not to other cell types.
[0125] In contrast, in vivo panning requires no prior knowledge or
availability of a target molecule and identifies molecules that
bind to cell surface target molecules that are expressed in vivo.
Also, since the "nontargeted" tissues are present during the
screening, the probability of isolating tumor homing molecules that
lack specificity of homing is greatly reduced. Furthermore, in
obtaining tumor homing molecules by in vivo panning, any molecules
that may be particularly susceptible to degradation in the
circulation in vivo due, for example, to a metabolic activity, are
not recovered. Thus, in vivo panning provides significant
advantages over previous methods by identifying molecules that
selectively home in vivo and the target molecule present in a
tumor.
[0126] Once a target molecule has been identified, however, in
vitro screening methods are useful for identifying additional tumor
homing molecules. For example, the NGR receptor described herein is
a target molecule that is useful for identifying additional tumor
homing molecules that home to angiogenic vasculature. Methods of in
vitro screening are well known in the art. For example, an NGR
receptor can be contacted with a library of molecules and screened
for binding in vitro. If desired, the NGR receptor can be
immobilized, for example, to a solid support such as a bead or
plate. An NGR receptor can be directly bound to the support,
through covalent or non-covalent interactions, or can be
immobilized indirectly through a molecule that binds to the NGR
receptor. For example, an antibody that binds to an NGR receptor
can be used to immobilize an NGR receptor (see Example X). The
library is contacted with the NGR receptor in vitro and screened
for binding activity. A library with tagged molecules are
particularly useful for identifying molecules that bind to an NGR
receptor.
[0127] Once additional molecules that bind to the target molecule
are identified, these additional molecules can be tested in vivo to
determine if the newly identified molecules can bind to the target
molecule and home to angiogenic vasculature in vivo. For example, a
newly identified molecule that binds to an NGR receptor can be
further characterized by screening the molecule in vivo using the
methods described herein and determining if the newly identified
molecule can home to angiogenic vasculature. Thus, the
identification of a target molecule such as an NGR receptor can be
advantageously used to identify molecules that bind to an NGR
receptor and home to angiogenic vasculature.
[0128] Although mechanisms by which the disclosed method of in vivo
panning works have not been fully defined, one possibility is that
a molecule such as a peptide expressed on a phage recognizes and
binds to a target molecule present on endothelial cells lining the
blood vessels in a tumor. Evidence indicates, for example, that the
vascular tissues in various organs differ from one another and that
such differences can be involved in regulating cellular trafficking
in the body. For example, lymphocytes home to lymph nodes or other
lymphoid tissues due, in part, to the expression of specific
"address" molecules by the endothelial cells in those tissues
(Salmi et al., Proc. Natl. Acad. Sci., USA 89:11436-11440 (1992);
Springer, Cell 76:301-314 (1994)). Similarly, various leukocytes
can recognize sites of inflammation due, in part, to the expression
of endothelial cell markers induced by inflammatory signals (see
Butcher and Picker, Science 272:60-66 (1996); Springer, supra,
1994). Thus, endothelial cell markers provide a potential target
for directing, for example, a drug, which can be linked to a tumor
homing molecule, to a tumor in a subject.
[0129] In some cases, the metastasis of cancer cells to specific
organs also can be due to recognition by the tumor cell of an organ
specific marker, including organ specific endothelial cell markers
(Fidler and Hart, Science 217:998-1003 (1982)). The pattern of
metastasis of many cancers can be explained by assuming that
circulating tumor cells are preferentially trapped in the first
vascular bed encountered. Thus, the lungs and the liver are the
most frequent sites of cancer metastasis. However, some cancers
show patterns of metastasis that are not explained by circulatory
routing. Metastasis of such cancers may be due to the presence of
selectively expressed address molecules such as endothelial cell
surface molecules expressed in the organ to which the cancer
metastasizes (see Goetz et al., Int. J. Cancer 65:192-199 (1996);
Zhu et al., Proc. Natl. Acad. Sci., USA 88:9568-9572 (1991); Pauli
et al., Cancer Metast. Rev. 9:175-189 (1990); Nicolson, Biochim.
Biophys. Acta 948:175-224 (1988)). The identification of molecules
that bind to such organ-specific endothelial cell markers can
provide a means to prevent tumor cell metastasis to the particular
organ.
[0130] Using in vivo panning to a breast carcinoma, a melanoma and
a Kaposi's sarcoma, phage expressing various peptides that
selectively homed to tumors were identified (see Tables 1, 2 and 3,
respectively). Due to the large size of the phage (900-1000 nm) and
the short time the phage were allowed to circulate (3 to 5 min), it
is unlikely that a substantial number of phage would have exited
the circulatory system, particularly in the brain and kidney.
Tissue staining studies indicated that the tumor homing molecules
that were identified primarily homed to and bound endothelial cell
surface markers, which likely are expressed in an organ-specific
manner. These results indicate that in vivo panning can be used to
identify and analyze endothelial cell specificities. Such an
analysis is not possible using endothelial cells in culture because
the cultured cells tend to lose their tissue-specific differences
(Pauli and Lee, Lab. Invest. 58:379-387 (1988)).
[0131] Although the conditions under which the in vivo pannings
were performed identified tumor homing peptides that generally bind
to endothelial cell markers, the specific presence of phage
expressing tumor homing peptides also was observed in tumor
parenchyma, particularly at later times after administration of the
peptides (Example V). These results demonstrate that phage
expressing peptides can pass through the blood vessels in the
tumor, possibly due to the fenestrated nature of the blood vessels,
and indicate that the in vivo panning method can be useful for
identifying target molecules expressed by tumor cells, as well as
target molecules expressed by endothelial cells.
[0132] Phage peptide display libraries were constructed essentially
as described by Smith and Scott (supra, 1993; see, also, Koivunen
et al., Biotechnology 13:265-270 (1995); Koivunen et al., Meth.
Enzymol. 245:346-369 (1994b), each of which is incorporated herein
by reference). Oligonucleotides encoding peptides having
substantially random amino acid sequences were synthesized based on
an "NNK" codon, wherein "N" is A, T, C or G and "K" is G or T.
"NNK" encodes 32 triplets, which encode the twenty amino acids and
an amber STOP codon (Scott and Smith, supra, 1990). In some
libraries, at least one codon encoding cysteine also was included
in each oligonucleotide so that cyclic peptides could be formed
through disulfide linkages (Example I). The oligonucleotides were
inserted in frame with the sequence encoding the gene III protein
(gIII) in the vector fuse 5 such that a peptide-gIII fusion protein
can be expressed. Following expression, the fusion protein is
expressed on the surface of the phage containing the vector
(Koivunen et al., supra, 1994b; Smith and Scott, supra, 1993).
[0133] Following in vivo panning, the phage isolated based on their
ability to selectively home to human breast carcinoma, mouse
melanoma or human Kaposi's sarcoma tumors displayed only a few
different peptide sequences (see Tables 1, 2 and 3, respectively).
One of the screenings revealed peptide sequences that contained the
arginine-glycine-aspartic acid (RGD) integrin recognition sequence
(Ruoslahti, Ann. Rev. Cell Devel. Biol. 12:697 (1996)) in the
context of a peptide previously demonstrated to bind selectively to
.alpha..sub.v-containing integrins (Koivunen et al., supra, 1995;
WO 95/14714). The sequences of most of the remaining tumor homing
peptides did not reveal any significant similarities with known
ligands for endothelial cell receptors. However, one of the tumor
homing peptides contained the asparagine-glycine-arginine (NGR)
motif, which is a weak integrin binding motif similar to the motifs
present in integrin-binding peptides (Ruoslahti et al., U.S. Pat.
No. 5,536,814, issued Jul. 16, 1996, which is incorporated herein
by reference; see, also, Koivunen et al., supra, 1994a). Other
screenings have revealed numerous NGR-containing peptides (see
Table 1). Despite the weak integrin binding ability of NGR
peptides, an integrin receptor may not be the target molecule
recognized by the NGR tumor homing peptides exemplified herein
(Example VIII). As used herein, the term "integrin" means a
heterodimeric cell surface adhesion receptor.
[0134] The peptides expressed by the phage that homed to the breast
tumor included the peptides CGRECPRLCQSSC (SEQ ID NO:2) and
CNGRCVSGCAGRC (SEQ ID NO:3; see Table 1; Example II). Similarly,
tumor homing peptides, including the peptides CDCRGDCFC (SEQ ID
NO:1) and CGSLVRC (SEQ ID NO:5), were identified from two other
phage libraries administered to breast tumor bearing mice (Table
1). Some of these motifs, as well as novel one, also were isolated
in the screen with mouse melanoma and human Kaposi's sarcoma (see
Tables 2 and 3). These results demonstrated that tumor homing
molecules can be identified using in vivo panning.
[0135] Three main tumor homing motifs emerged. As discussed above,
one motif contained the sequence RGD (Ruoslahti, supra, 1996)
embedded in the peptide structure, CDCRGDCFC (SEQ ID NO:1), which
is known to bind selectively to .alpha..sub.v integrins (Koivunen
et al., supra, 1995; WO 95/14714). Since the
.alpha..sub.v.beta..sub.3 and .alpha..sub.v.beta..sub.5 integrins
are markers of angiogenic vessels (Brooks et al., supra, 1994;
Friedlander et al., Science 270:1500 (1995)), a phage expressing
the peptide CDCRGDCFC (SEQ ID NO:1) (designated RGD-4C) was
examined for tumor targeting and, as disclosed herein, homed to
tumors in a highly selective manner (see Example III). Furthermore,
homing by the RGD-4C (CDCRGDCFC; SEQ ID NO:1) phage was inhibited
by coadministration of the free CDCRGDCFC (SEQ ID NO:1)
peptide.
[0136] Another breast tumor homing peptide had the sequence
CNGRCVSGCAGRC (SEQ ID NO:3), which contains the NGR motif
previously shown to have weak integrin binding activity (Koivunen
et al., J. Biol. Chem. 268:20205-20210 (1993), which is
incorporated herein by reference); Koivunen et al., supra, 1994a;
WO 95/14714). Since an NGR containing peptide was identified, two
additional peptides, the linear peptide, NGRAHA (SEQ ID NO:6), and
the cyclic peptide, CVLNGRMEC (SEQ ID NO:7), each of which contains
the NGR motif, were examined for tumor homing. Like the phage
expressing CNGRCVSGCAGRC (SEQ ID NO:3), phage expressing NGRAHA
(SEQ ID NO:6) or CVLNGRMEC (SEQ ID NO:7) homed to the tumors.
Furthermore, tumor homing was not dependent on the tumor type or on
species, as the phage accumulated selectively in human breast
carcinoma, as well as in the tumors of mice bearing a mouse
melanoma and mice bearing a human Kaposi's sarcoma xenograft.
[0137] The various peptides, including RGD- and NGR-containing
peptides, generally were bound to the tumor blood vessels. The
minimal cyclic NGR peptide, CNGRC (SEQ ID NO:8), was synthesized
based on the CNGRCVSGCAGRC (SEQ ID NO:3) sequence. When the CNGRC
(SEQ ID NO:8) peptide was co-injected with phage expressing either
CNGRCVSGCAGRC (SEQ ID NO:3), NGRAHA (SEQ ID NO:6) or CVLNGRMEC (SEQ
ID NO:7), accumulation of the phage in the breast carcinoma
xenografts was inhibited. However, the CNGRC (SEQ ID NO:8) peptide
did not inhibit the homing of phage expressing the RGD-4C
(CDCRGDCFC; SEQ ID NO:1) peptide, even when administered in amounts
up to ten times higher than those that inhibited the homing of the
NGR phage. In comparison, the RGD-4C (CDCRGDCFC; SEQ ID NO:1)
peptide partially inhibited the homing of the NGR phage, although
the amount needed was 5 to 10 fold higher than that of the CNGRC
peptide (SEQ ID NO:8). These results indicate that NGR peptides and
RGD peptides bind to different receptor sites in tumor
vasculature.
[0138] A third motif, GSL (glycine-serine-leucine), also was
identified following in vivo panning in mice bearing breast
carcinoma, malignant melanoma or Kaposi's sarcoma. Homing of phage
expressing the GSL peptide, CGSLVRC (SEQ ID NO:5), was inhibited by
coadministration of the free CGSLVRC (SEQ ID NO:5) peptide. Like
the RGD and NGR peptides, phage expressing GSL peptides also bound
to blood vessels of tumors. In view of the identification of the
conserved RGD, NGR and GSL motifs present in tumor homing peptides,
as disclosed herein, it will be recognized that peptides containing
such motifs can be useful as tumor homing peptides and, in
particular, for forming conjugates that can target a moiety such as
a cancer chemotherapeutic agent or a diagnostic agent to a
tumor.
[0139] Various peptide libraries containing up to 13 amino acids
were constructed and the NGR peptide, CNGRCVSGCAGRC (SEQ ID NO:3),
was obtained as a result of in vivo panning against a breast tumor.
This NGR peptide, which was obtained by screening a random peptide
library, was a tumor homing peptide (see Example VIII). In
addition, when a peptide library was constructed based on the
formula CXXXNGRXX (SEQ ID NO:13) or CXXCNGRCX (SEQ ID NO:14), each
of which is biased toward NGR sequences, and used for in vivo
panning against a breast tumor, numerous NGR peptides were obtained
(see Table 1).
[0140] These results indicate that a tumor homing peptide of the
invention can comprise the amino acid sequence RGD or NGR or GSL.
Such tumor peptides can be as small as five amino acids, such as
CNGRC (SEQ ID NO:8). Such tumor homing peptides also can be not
only at least 13 amino acids in length, which is the largest
peptide exemplified herein, but can be up to 20 amino acids, or 30
amino acids, or 50 to 100 amino acids in length, as desired. A
tumor homing peptide of the invention conveniently is produced by
chemical synthesis.
[0141] Immunohistochemical analysis was performed by comparing
tissue staining for phage allowed to circulate for about four
minutes, followed by perfusion through the heart of the mice, or
with tissues analyzed 24 hours after phage injection (see FIG. 3).
At 24 hours following administration, essentially no phage remain
in the circulation and, therefore, perfusion is not required
(Pasqualini et al., supra, 1997). Strong phage staining was
observed in tumor vasculature, but not in normal endothelium, in
samples examined four minutes after administration of the
CNGRCVSGCAGRC (SEQ ID NO:3) phage (Example V; compare FIGS. 3E, 3G,
3H and 3J). In comparison, staining of the tumor was strong at 24
hours and appeared to have spread outside the blood vessels into
the tumor parenchyma (compare FIGS. 3A to 3D and 3F (tumor) with
FIGS. 3I and 3K to 3V (nontumor)). The NGRAHA (SEQ ID NO:6) and
CVLNGRMEC (SEQ ID NO:7) phage showed similar staining patterns
(Example V). In contrast, the control organs and tissues showed
little or no immunostaining, confirming the specificity of the NGR
motifs for tumor vessels. Spleen and liver, however, captured
phage, as expected, since uptake by the reticuloendothelial system
is a general property of phage particles, independent of the
presence of peptide expression by the phage (Pasqualini et al.,
supra, 1997).
[0142] Immunostaining also was observed following administration of
phage expressing the GSL motif containing peptide, CLSGSLSC (SEQ ID
NO:4), and, like that of the NGR peptides, was localized to the
blood vessels, in this case, within a melanoma tumor (see below;
see, also, Examples V and VI). Similarly, immunostaining following
administration of phage expressing the RGD motif containing
peptide, RGD-4C (CDCRGDCFC; SEQ ID NO:1), to breast tumor bearing
mice was localized to the blood vessels in the tumor, but was not
observed in brain, kidney or various other nontumor tissues (see
Examples III and V; see, also, Pasqualini et al., supra, 1997).
These results demonstrate that the various tumor homing peptides
generally home to tumor vasculature.
[0143] The general applicability of the in vivo panning method for
identifying molecules that home to a tumor was examined by
injecting mice bearing a syngeneic melanoma with phage expressing a
diverse population of peptides (Example VI). The B16 mouse melanoma
model was selected for these studies because the tumors that form
are highly vascularized and because the biology of this tumor line
has been thoroughly characterized (see Miner et al., Cancer Res.
42:4631-4638 (1982)). Furthermore, because the B16 melanoma cells
are of mouse origin, species differences between the host and the
tumor cell donor will not affect, for example, the distribution of
phage into the tumor as compared to into normal organs. As
disclosed herein, in vivo panning against B16 melanoma cells
revealed tumor homing peptides, including, for example, the GSL
moiety containing peptide CLSGSLSC (SEQ ID NO:4; see, also, Table
2) and immunohistochemical staining of the tumor and other organs
using an anti-phage antibody demonstrated that the CLSGSLSC (SEQ ID
NO:4) expressing phage resulted in immunostaining in the melanoma,
but essentially no staining in skin, kidney or other control organs
(Example VI). The staining pattern generally followed the blood
vessels within the melanoma, but was not strictly confined to the
blood vessels.
[0144] Although in vivo panning was performed in mice, at least the
peptides comprising an NGR, RGD or GSL motif also likely can target
human vasculature. The NGR phage binds to blood vessels in the
transplanted human breast tumor, but not to blood vessels in normal
tissues, indicating that this motif can be particularly useful for
tumor targeting in patients. The CDCRGDCFC (SEQ ID NO:1) peptide
binds to human .alpha..sub.v-integrins (Koivunen et al., supra,
1995), which are selectively expressed in tumor blood vessels of
human patients (Max et al., Int. J. Cancer 71:320 (1997); Max et
al., Int. J. Cancer 72:706 (1997)). Use of a moiety/CDCRGDCFC (SEQ
ID NO:1) conjugate to target the moiety to a tumor also provides
the additional advantage that the moiety will be targeted to tumor
cells, themselves, because breast carcinoma cells, for example, can
express the .alpha..sub.v.beta..sub.3 integrin (Pasqualini et al.,
supra, 1997). In fact, many human tumors express this integrin,
which may be involved in the progression of certain tumors such as
malignant melanomas (Albelda et al., Cancer Res. 50:6757-6764
(1990); Danen et al., Int. J. Cancer 61:491-496 (1995);
Felding-Habermann et al., J. Clin. Invest. 89:2018-2022 (1992);
Sanders et al., Cold Spring Harb. Symp. Quant. Biol. 58:233-240
(1992); Mitjans et al., J. Cell. Sci. 108:3067-3078 (1995)). Unlike
the RGD-4C (CDCRGDCFC; SEQ ID NO:1) peptide, the NGR peptides do
not appear to bind to MDA-MD-435 breast carcinoma cells. However,
NGR peptides were able to deliver a therapeutically effective
amount of doxorubicin to breast tumors (Examples VIII and XV),
indicating that, even where a tumor homing molecule homes only to
tumor vasculature, i.e., not directly to the tumor cells, such
vasculature targeting in sufficient to confer the effect of the
moiety linked to the molecule.
[0145] Since the .alpha..sub.v.beta..sub.3 integrin is expressed by
endothelial cells in angiogenic vasculature, experiments were
performed to determine whether tumor vasculature that is undergoing
angiogenesis can be targeted in vivo using methods as disclosed
herein. Phage expressing the peptide, RGD-4C (CDCRGDCFC; SEQ ID
NO:1; see, Koivunen et al., supra, 1995), which is known to bind to
the .alpha..sub.v.beta..sub.3 integrin, were injected into mice
bearing tumors formed from human breast carcinoma cells, mouse
melanoma cells or human Kaposi's sarcoma cells (see Example V). The
RGD-4C (CDCRGDCFC; SEQ ID NO:1) phage selectively homed to each of
the tumors, whereas such homing did not occur with control phage.
For example, in mice bearing tumors formed by implantation of human
breast carcinoma cells, a twenty- to eighty-fold greater number of
the RGD-4C (CDCRGDCFC; SEQ ID NO:1) phage, as compared to
unselected control phage, accumulated in the tumor.
[0146] Tissue staining for the phage showed accumulation of the
RGD-4C (CDCRGDCFC; SEQ ID NO:1) phage in the blood vessels within
the tumor, whereas no staining was observed in brain, kidney or
other control organs. Specificity of tumor homing by the RGD-4C
(CDCRGDCFC; SEQ ID NO:1) phage was demonstrated by competition
experiments, in which coinjection of the free RGD-4C (CDCRGDCFC;
SEQ ID NO:1) peptide greatly reduced tumor homing of the RGD phage,
whereas coinjection of a non-RGD-containing control peptide had no
effect on homing of the RGD phage (see Example III). These results
demonstrate that the .alpha..sub.v.beta..sub.3 target molecule is
expressed on the luminal surface of endothelial cells in a tumor
and that a peptide that binds to an .alpha..sub.v-containing
integrin can bind selectively to this integrin and, therefore, to
vasculature undergoing angiogenesis.
[0147] The results of these studies indicate that tumor homing
molecules can be identified by in vivo panning and that, in some
cases, a tumor homing molecule can home to vascular tissue in the
tumor as well as to tumor parenchyma, probably due to the
fenestrated nature of the blood vessels permitting ready exit of
the phage from the circulatory system. Due to the ability of such
tumor homing molecules to home to tumors, the molecules are useful
for targeting a linked moiety to tumors. Thus, the invention
provides conjugates comprising a tumor homing molecule linked to a
moiety, such conjugates being useful for targeting the moiety to
tumor cells.
[0148] The ability of a molecule that homes to a particular tumor
to selectively home to another tumor of the same or a similar
histologic type can be determined using, for example, human tumors
grown in nude mice or mouse tumors grown in syngeneic mice for
these experiments. For example, various human breast cancer cell
lines, including MDA-MB-435 breast carcinoma (Price et al., Cancer
Res. 50:717-721 (1990)), SKBR-1-II and SK-BR-3 (Fogh et al., J.
Natl. Cancer Inst. 59:221-226 (1975)), and mouse mammary tumor
lines, including EMT6 (Rosen et al., Int. J. Cancer 57:706-714
(1994)) and C3-L5 (Lala and Parhar, Int. J. Cancer 54:677-684
(1993)), are readily available and commonly used as models for
human breast cancer. Using such breast tumor models, for example,
information relating to the specificity of an identified breast
tumor homing molecule for diverse breast tumors can be obtained and
molecules that home to a broad range of different breast tumors or
provide the most favorable specificity profiles can be identified.
In addition, such analyses can yield new information, for example,
about tumor stroma, since stromal cell gene expression, like that
of endothelial cells, can be modified by the tumor in ways that
cannot be reproduced in vitro.
[0149] Selective homing of a molecule such as a peptide or protein
to a tumor can be due to specific recognition by the peptide of a
particular cell target molecule such as a cell surface receptor
present on a cell in the tumor. Selectivity of homing is dependent
on the particular target molecule being expressed on only one or a
few different cell types, such that the molecule homes primarily to
the tumor. As discussed above, the identified tumor homing
peptides, at least in part, can recognize endothelial cell surface
markers in the blood vessels present in the tumors. However, most
cell types, particularly cell types that are unique to an organ or
tissue, can express unique target molecules. Thus, in vivo panning
can be used to identify molecules that selectively home to a
particular type of tumor cell such as a breast cancer cell and
specific homing can be demonstrated by performing the appropriate
competition experiments.
[0150] Treatment of human breast cancer xenografts in mice using
doxorubicin was selected as a model for exemplifying the present
invention. CDCRGDCFC (SEQ ID NO:1) and CNGRC (SEQ ID NO:8) were
coupled to doxorubicin (Example VII) and the peptide/doxorubicin
conjugates were used to treat mice bearing tumors derived from
human MDA-MB-435 breast carcinoma cells (Examples VIII and XV).
Mice were treated with 5 .mu.g/week of doxorubicin equivalent
(i.e., either free doxorubicin or the doxorubicin component of the
peptide/doxorubicin conjugate), as compared to the more commonly
used 50-200 .mu.g/mouse used in tumor bearing mice (Berger et al.,
In "The Nude Mouse in Oncology Research" (CRC Press 1991)). The
lower dose was selected because it was expected that the conjugate
would be more effective than the free drug.
[0151] MDA-MB-435 tumor-bearing mice treated with the
doxorubicin/RGD-4C (CDCRGDCFC; SEQ ID NO:1) conjugate had
significantly smaller tumors, less spread to regional lymph nodes,
and fewer pulmonary metastasis than mice treated with free
doxorubicin (see Example VIII). All of the mice treated with the
doxorubicin/RGD-4C (CDCRGDCFC; SEQ ID NO:1) conjugate survived
beyond the time when all of the mice treated with free doxorubicin
had died from widespread disease. In a dose-escalation experiment,
the tumor bearing mice were treated with the doxorubicin/RGD-4C
(CDCRGDCFC; SEQ ID NO:1) conjugate at 30 .mu.g/mouse every three
weeks for three cycles, then were observed, without further
treatment, for an extended period of time. The conjugate treated
mice all remained alive more than 6 months after the control,
doxorubicin treated mice had died (Example VIII). These results
indicate that primary tumor growth and metastasis significantly
were inhibited in mice treated with the conjugate and that cures
may have occurred.
[0152] Many of the mice that received doxorubicin/RGD-4C
(CDCRGDCFC; SEQ ID NO:1) conjugate presented marked skin ulceration
and tumor necrosis; no such signs were observed in mice treated
with free doxorubicin or with doxorubicin conjugated to an
unrelated peptide (Example VIII). Histopathological analysis
disclosed a pronounced destruction of the vasculature in the tumors
treated with conjugate as compared to mice treated with free
doxorubicin. Furthermore, when tumors were removed from the mice
and the tumor cells plated in culture, viability of cells from the
tumors of mice receiving the doxorubicin/RGD-4C (CDCRGDCFC; SEQ ID
NO:1) conjugate was about 3 fold less than cells from tumors of
mice treated with the free doxorubicin (see Example VIII). These
results demonstrate that administration to a tumor bearing mouse of
a conjugate comprising a chemotherapeutic agent linked to a tumor
homing molecule is more efficacious than administration of the
agent, alone, in treating a tumor.
[0153] Toxicity was determined by administration of 200
.mu.g/doxorubicin equivalent in mice with very large, size matched
breast tumors. All of the mice treated with the doxorubicin/RGD-4C
(CDCRGDCFC; SEQ ID NO:1) conjugate survived more than a week, while
all of the mice treated with free doxorubicin died within 48 hours
of the administration of the drug (Example VIII). These results
indicate that accumulation of the tumor homing peptide/doxorubicin
conjugate in the large tumors can reduce systemic toxicity of the
agent.
[0154] Similar toxicity and treatment efficacy results were
obtained when breast tumor bearing mice were treated using a
doxorubicin/CNGRC (SEQ ID NO:8) conjugate. Tumors in the mice
treated with the CNGRC (SEQ ID NO:8) conjugate were significantly
smaller than in the control groups; the conjugate suppressed tumor
growth almost completely. A strong effect on survival also
occurred. Free doxorubicin or doxorubicin conjugated to an
unrelated peptide, at the dose used, had little if any effect on
tumor growth relative to vehicle alone.
[0155] Cytotoxic activity of free doxorubicin and the
doxorubicin/peptide conjugates was compared in vitro using
MDA-MB-435 cells. When cells were exposed to free doxorubicin,
doxorubicin/RGD-4C (CDCRGDCFC; SEQ ID NO:1) or doxorubicin
conjugated to an unrelated peptide for 30 minutes, cell death
occurred only in the cultures treated with the doxorubicin/RGD-4C
(CDCRGDCFC; SEQ ID NO:1) conjugate. In comparison, cells were
killed by all of the treatments after 24 hours of exposure. These
results indicate that enhanced cellular uptake of the
doxorubicin/RGD-4C (CDCRGDCFC; SEQ ID NO:1) conjugate occurs.
[0156] As disclosed herein, tumor homing molecules of the invention
can bind to the endothelial lining of small blood vessels of
tumors. The vasculature within tumors is distinct, presumably due
to the continual neovascularization, resulting in the formation of
new blood vessels required for tumor growth. The distinct
properties of the angiogenic neovasculature within tumors are
reflected in the presence of specific markers in endothelial cells
and pericytes (Folkman, Nature Biotechnol. 15:510 (1997); Risau,
FASEB J. 9:926-933 (1995); Brooks et al., supra, 1994); these
markers likely are being targeted by the tumor homing molecules of
the invention.
[0157] The ability of a tumor homing molecule to target the blood
vessels in a tumor provides substantial advantages over methods of
systemic treatment or methods that directly target the tumor cells.
For example, tumor cells depend on a vascular supply for survival
and the endothelial lining of blood vessels is readily accessible
to a circulating probe. Conversely, in order to reach solid tumor
cells, a chemotherapeutic agent must overcome potentially long
diffusion distances, closely packed tumor cells, and a dense
fibrous stroma with a high interstitial pressure that impedes
extravasation (Burrows and Thorpe, Pharmacol. Ther. 64:155-174
(1994)).
[0158] In addition, where the tumor vasculature is targeted, the
killing of all target cells may not be required, since partial
denudation of the endothelium can lead to the formation of an
occlusive thrombus halting the blood flow through the entirety of
the affected tumor vessel (Burrows and Thorpe, supra, 1994).
Furthermore, unlike direct tumor targeting, there is an intrinsic
amplification mechanism in tumor vasculature targeting. A single
capillary loop can supply nutrients to up to 100 tumor cells, each
of which is critically dependent on the blood supply (Denekamp,
Cancer Metast. Rev. 9:267-282 (1990); Folkman, supra, 1997).
[0159] Endothelial cells in a tumor also are unlikely to lose a
cell surface target receptor or develop a drug resistance
phenotype, as can develop through mutation and clonal evolution of
tumor cells, because endothelial cells are genetically stable
despite their high proliferation rates (Burrows and Thorpe, supra,
1994; Folkman, supra, 1995; Folkman, supra, 1997). In this regard,
it has been long recognized by medical oncologists that, while
tumors treated with chemotherapeutic agents commonly develop drug
resistance, normal tissues such as bone marrow do not develop such
resistance. Thus, toxicity to normal tissues such as chemotherapy
induced myelosuppression continues to occur during a treatment,
even after tumor cells have become drug resistant. Since the
endothelial cells in blood vessels supplying a tumor are nontumor
cells, it is expected that they will not develop resistance to
chemotherapeutic agents, in a manner analogous to bone marrow
cells. In fact, drug resistance has not been observed during long
term anti-angiogenic therapy in either experimental animals or in
clinical trials (Folkman, supra, 1997).
[0160] Linking of a moiety larger than an agent such as a drug or
other organic or biologic molecule to a tumor homing molecule for
the purpose of directing homing of the moiety to the selected tumor
is exemplified by expressing an RGD-containing peptide on a phage,
wherein the peptide directed homing of the phage to breast tumor
vasculature (Example V). These results indicate that a tumor homing
molecule of the invention can be linked to other moieties
including, for example, a chambered microdevice or a liposome or a
cell such as a white blood cell (WBC), which can be a cytotoxic T
cell or a killer cell, wherein upon administration of the tumor
homing molecule/WBC conjugate, the molecule directs homing of the
WBC to the tumor, where the WBC can exert its effector
function.
[0161] The linking of a moiety to a tumor homing molecule can
result in the molecule directing homing of the linked moiety to a
tumor. For example, the linking of a brain homing peptide to a RBC
directed homing of the RBC to brain (see U.S. Pat. No. 5,622,699;
Pasqualini and Ruoslahti, supra, 1996). This result indicates that
a tumor homing molecule of the invention also can be linked to cell
type or to a physical, chemical or biological delivery system such
as a liposome or other encapsulating device, which can contain an
agent such as drug, in order to direct the cell type or the
delivery system to a selected tumor. For example, a tumor homing
molecule identified by in vivo panning can be linked to a white
blood cell (WBC) such as a cytotoxic T cell or a killer cell,
wherein upon administration of the tumor homing molecule/WBC
conjugate, the molecule directs homing of the WBC to the tumor,
where the WBC can exert its effector function. Similarly, a tumor
homing molecule can be linked to a liposome or to a chambered
microdevice comprising, for example, a permeable or semipermeable
membrane, wherein an agent such as a drug to be delivered to a
selected tumor is contained within the liposome or microdevice.
Such compositions also can be useful, for example, for delivering a
nucleic acid molecule to a tumor cells, thereby providing a means
for performing in vivo targeted gene therapy.
[0162] In one embodiment, a tumor homing molecule is linked to a
moiety that is detectable external to the subject, thereby
providing a composition useful to perform an in vivo diagnostic
imaging study. For example, in vivo imaging using a detectably
labeled tumor homing peptide can identify the presence of a tumor
in a subject. For such studies, a moiety such as a gamma ray
emitting radionuclide, for example, indium-111 or technitium-99,
can be linked to the tumor homing molecule and, following
administration to a subject, can be detected using a solid
scintillation detector. Similarly, a positron emitting radionuclide
such as carbon-11 or a paramagnetic spin label such as carbon-13
can be linked to the molecule and, following administration to a
subject, the localization of the moiety/molecule can be detected
using positron emission transaxial tomography or magnetic resonance
imaging, respectively. Such methods can identify a primary tumor as
well as a metastatic lesion, which may not be detectable using
other methods. Having identified the presence of a cancer in a
subject, in another embodiment of the invention, the tumor homing
molecule is linked to a cytotoxic agent such as ricin or a cancer
chemotherapeutic agent such as doxorubicin in order to direct the
moiety to the tumor or can be linked to a chambered microdevice,
which can contain a chemotherapeutic drug or other cytotoxic agent.
Use of such a composition provides a means to selectively killing
of the tumor, while substantially sparing normal tissues in a
cancer patient and, therefore, the conjugates of the invention
provide useful medicaments for diagnosing or treating a cancer
patient.
[0163] The skilled artisan would recognize that various tumor
homing molecules can selectively home only to a tumor or can
selectively home to a tumor and to a family of selected organs,
including, in some cases, the normal tissue counterpart to the
tumor. Thus, the artisan would select a tumor homing peptide for
administration to a subject based on the procedure being performed.
For example, a tumor homing molecule that homes only to a tumor can
be useful for directing a therapy to the tumor. In comparison, a
tumor homing molecule that selectively homes not only to the tumor,
but also to one or more normal organs or tissues, can be used in an
imaging method, whereby homing to an organ or tissue other than the
tumor provides an internal imaging control. Such an internal
control can be useful, for example, for detecting a change in the
size of a tumor in response to a treatment, since the normal organ
is not expected to change in size and, therefore, can be compared
with the tumor size.
[0164] Tumor homing peptides, which are identified by in vivo
panning, can be synthesized in required quantities using routine
methods of solid state peptide synthesis or can be purchased from
commercial sources (for example, Anaspec; San Jose Calif.) and a
desired moiety can be linked to the molecule. Several methods
useful for linking a moiety to a molecule are known in the art,
depending on the particular chemical characteristics of the
molecule. For example, methods of linking haptens to carrier
proteins as used routinely in the field of applied immunology (see,
for example, Harlow and Lane, supra, 1988; Hermanson, supra,
1996).
[0165] It is recognized that, in some cases, a drug can lose
cytotoxic efficacy upon conjugation or derivatization depending,
for example, on the conjugation procedure or the chemical group
utilized (Hurwitz et al., Cancer Res. 35:1175-1181 (1975); Trail et
al., Science 261; 212-215 (1993); Nagy et al., Proc. Natl. Acad.
Sci., USA 93:7269-7273 (1996)). Moreover, it is recognized that a
phage that yields a tumor homing peptide of the invention displays
as many as five of the peptides. Thus, there is a possibility that
the affinity of an individual peptide is too low for effective
tumor homing and that multivalent, rather than univalent, peptide
conjugates must be used. However, as disclosed herein, doxorubicin
maintained cytotoxic activity when used as a conjugate with tumor
homing peptides (see Examples VIII and XV), thus allaying the
potential concerns discussed above.
[0166] A moiety such as a therapeutic or diagnostic agent can be
conjugated to a tumor homing peptide using, for example,
carbodiimide conjugation (Bauminger and Wilchek, Meth. Enzymol.
70:151-159 (1980), which is incorporated herein by reference)(see
Example VII). Alternatively, a moiety can be coupled to a homing
molecule as described by Nagy et al., Proc. Natl. Acad. Sci. USA
93:7269-7273 (1996); and Nagy et al., Proc. Natl. Acad. Sci. USA
95:1794-1799 (1998), each of which is incorporated herein by
reference.
[0167] Carbodiimides comprise a group of compounds that have the
general formula R--N.dbd.C.dbd.N--R', where R and R' can be
aliphatic or aromatic, and are used for synthesis of peptide bonds.
The preparative procedure is simple, relatively fast, and is
carried out under mild conditions. Carbodiimide compounds attack
carboxylic groups to change them into reactive sites for free amino
groups. Carbodiimide conjugation has been used to conjugate a
variety of compounds to carriers for the production of
antibodies.
[0168] The water soluble carbodiimide,
1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC) is
particularly useful for conjugating a moiety to a tumor homing
peptide and was used to conjugate doxorubicin to tumor homing
peptides (Example VII). The conjugation of doxorubicin and a tumor
homing peptide requires the presence of an amino group, which is
provided by doxorubicin, and a carboxyl group, which is provided by
the peptide. EDC coupling of doxorubicin to the CNGRC (SEQ ID NO:
8) peptide was performed using a 1:1 molar ratio of the peptide
(carboxyl groups) to obtain a doxorubicin/CNGRC (SEQ ID NO:8; see
Example VII).
[0169] In addition to using carbodiimides for the direct formation
of peptide bonds, EDC also can be used to prepare active esters
such as N-hydroxysuccinimide (NHS) ester. The NHS ester, which
binds only to amino groups, then can be used to induce the
formation of an amide bond with the single amino group of the
doxorubicin. The use of EDC and NHS in combination is commonly used
for conjugation in order to increase yield of conjugate formation
(Bauminger and Wilchek, supra, 1980).
[0170] Other methods for conjugating a moiety to a tumor homing
molecule also can be used. For example, sodium periodate oxidation
followed by reductive alkylation of appropriate reactants can be
used, as can glutaraldehyde crosslinking. However, it is recognized
that, regardless of which method of producing a conjugate of the
invention is selected, a determination must be made that the tumor
homing molecule maintains its targeting ability and that the moiety
maintains its relevant function. Methods as disclosed in Examples
VIII and XV or otherwise known in the art can confirm the activity
of the moiety/tumor homing molecule conjugate.
[0171] The yield of moiety/tumor homing molecule conjugate formed
is determined using routine methods. For example, HPLC or capillary
electrophoresis or other qualitative or quantitative method can be
used (see, for example, Liu et al., J. Chromatogr. 735:357-366
(1996); Rose et al., J. Chromatogr. 425:419-412 (1988), each of
which is incorporated herein by reference; see, also, Example VII).
In particular, the skilled artisan will recognize that the choice
of a method for determining yield of a conjugation reaction
depends, in part, on the physical and chemical characteristics of
the specific moiety and tumor homing molecule. Following
conjugation, the reaction products are desalted to remove any free
peptide and free drug.
[0172] When administered to a subject, the tumor homing
molecule/moiety conjugate is administered as a pharmaceutical
composition containing, for example, the conjugate and a
pharmaceutically acceptable carrier. Pharmaceutically acceptable
carriers are well known in the art and include, for example,
aqueous solutions such as water or physiologically buffered saline
or other solvents or vehicles such as glycols, glycerol, oils such
as olive oil or injectable organic esters.
[0173] A pharmaceutically acceptable carrier can contain
physiologically acceptable compounds that act, for example, to
stabilize or to increase the absorption of the conjugate. Such
physiologically acceptable compounds include, for example,
carbohydrates, such as glucose, sucrose or dextrans, antioxidants,
such as ascorbic acid or glutathione, chelating agents, low
molecular weight proteins or other stabilizers or excipients. One
skilled in the art would know that the choice of a pharmaceutically
acceptable carrier, including a physiologically acceptable
compound, depends, for example, on the route of administration of
the composition. The pharmaceutical composition also can contain an
agent such as a cancer therapeutic agent.
[0174] One skilled in the art would know that a pharmaceutical
composition containing a tumor homing molecule can be administered
to a subject by various routes including, for example, orally or
parenterally, such as intravenously. The composition can be
administered by injection or by intubation. The pharmaceutical
composition also can be a tumor homing molecule linked to liposomes
or other polymer matrices, which can have incorporated therein, for
example, a drug such as a chemotherapeutic agent (Gregoriadis,
Liposome Technology, Vol. 1 (CRC Press, Boca Raton, Fla. 1984),
which is incorporated herein by reference). Liposomes, for example,
which consist of phospholipids or other lipids, are nontoxic,
physiologically acceptable and metabolizable carriers that are
relatively simple to make and administer.
[0175] For the diagnostic or therapeutic methods disclosed herein,
an effective amount of the tumor homing molecule/moiety conjugate
must be administered to the subject. As used herein, the term
"effective amount" means the amount of the conjugate that produces
the desired effect. An effective amount often will depend on the
moiety linked to the tumor homing molecule. Thus, a lesser amount
of a radiolabeled molecule can be required for imaging as compared
to the amount of a drug/molecule conjugate administered for
therapeutic purposes. An effective amount of a particular
molecule/moiety for a specific purpose can be determined using
methods well known to those in the art.
[0176] The route of administration of a tumor homing molecule will
depend, in part, on the chemical structure of the molecule.
Peptides, for example, are not particularly useful when
administered orally because they can be degraded in the digestive
tract. However, methods for chemically modifying peptides to render
them less susceptible to degradation by endogenous proteases or
more absorbable through the alimentary tract are well known (see,
for example, Blondelle et al., supra, 1995; Ecker and Crooke,
supra, 1995; Goodman and Ro, supra, 1995). Such modifications can
be performed on peptides identified by in vivo panning. In
addition, methods for preparing libraries of peptidomimetics, which
can contain D-amino acids, other non-naturally occurring amino
acids, or chemically modified amino acids; or can be organic
molecules that mimic the structure of peptide; or can be peptoids
such as vinylogous peptoids, are known in the art and can be used
to identify molecules that home to a tumor and are stable for oral
administration.
[0177] Tumor homing molecules obtained using the methods disclosed
herein also can be useful for identifying a target molecule such as
a cell surface receptor or a ligand for a receptor, which is
recognized by the tumor homing peptide, or for substantially
isolating the target molecule. For example, a tumor homing peptide
can be linked to a solid support such as a chromatography matrix.
The linked peptide then can be used for affinity chromatography by
passing an appropriately processed sample of a tumor over the
column in order to bind a particular target molecule. The target
molecule, which forms a complex with the tumor homing molecule,
then can be eluted from the column and collected in a substantially
isolated form. The substantially isolated target molecule then can
be characterized using well known methods. A tumor homing peptide
also can be linked to a detectable moiety such as a radionuclide, a
fluorescent molecule, an enzyme or biotin and can be used, for
example, to screen a sample in order to detect the presence of the
target molecule in a tumor or to follow the target molecule during
various isolation steps.
[0178] It follows that, upon identifying the presence of a target
molecule in a tumor sample, the skilled artisan readily can obtain
the target molecule in a substantially isolated form. For example,
the sample containing the target molecule can be passed over a
column containing attached thereto the relevant tumor homing
molecule, thereby providing a means to obtain the target molecule
in substantially isolated form (see Example X). Thus, the invention
further provides a substantially isolated target molecule, which
specifically binds a tumor homing molecule and which can be
obtained using the methods disclosed herein.
[0179] The methods of the present invention were used to identify
tumor homing peptides, which can selectively home to various
tumors. It should be recognized that cysteine residues were
included in some peptides such that cyclization of the peptides
could be effected. In fact, the peptides containing at least two
cysteine residues cyclize spontaneously. However, such cyclic
peptides also can be active when present in a linear form (see, for
example, Koivunen et al., supra, 1993) and, as disclosed herein, a
linear peptide, NGRAHA (SEQ ID NO:6), also was useful as tumor
homing molecule (Example VIII; see, also, Table 1). Thus, in some
cases one or more cysteine residues in the peptides disclosed
herein or otherwise identified as tumor homing peptides can be
deleted without significantly affecting the tumor homing activity
of the peptide. Methods for determining the necessity of a cysteine
residue or of amino acid residues N-terminal or C-terminal to a
cysteine residue for tumor homing activity of a peptide of the
invention are routine and well known in the art.
[0180] A tumor homing peptide is useful, for example, for targeting
a desired moiety to the selected tumor as discussed above. In
addition, a tumor homing peptide can be used to identify the
presence of a target molecule in a sample. As used herein, the term
"sample" is used in its broadest sense to mean a cell, tissue,
organ or portion thereof, including a tumor, that is isolated from
the body. A sample can be, for example, a histologic section or a
specimen obtained by biopsy or cells that are placed in or adapted
to tissue culture. If desired, a sample can be processed, for
example, by homogenization, which can be an initial step for
isolating the target molecule to which a tumor homing molecule
binds.
[0181] A tumor homing peptide such as a breast tumor homing peptide
can be used to identify the target molecule expressed in a breast
tumor. For example, a breast tumor homing peptide can be attached
to a matrix such as a chromatography matrix to produce a peptide
affinity matrix. A homogenized sample of a breast tumor can be
applied to the peptide-affinity matrix under conditions that allow
specific binding of the target molecule to the tumor homing peptide
(see, for example, Deutshcer, Meth. Enzymol., Guide to Protein
Purification (Academic Press, Inc., ed. M. P. Deutscher, 1990),
Vol. 182, which is incorporated herein by reference; see, for
example, pages 357-379). Unbound and nonspecifically bound material
can be removed and the specifically bound breast tumor-derived
target molecule can be isolated in substantially purified form. The
presence or absence of the target molecule in normal breast tissue
also can be determined. Such an analysis can provide insight into
methods of treating the tumor.
[0182] As disclosed herein, a target molecule, which specifically
binds a tumor homing molecule, can be identified by contacting a
sample of a tumor with such a tumor homing molecule and identifying
a target molecule bound by the tumor homing molecule. In parallel,
the tumor homing molecule is contacted with a sample of a nontumor
tissue corresponding to the tumor. The presence of the target
molecule in the tumor sample can be identified by determining that
the tumor homing molecule does not bind to a component of the
corresponding nontumor tissue sample. Thus, the invention provides
methods for identifying the presence of a target molecule, which is
expressed in a tumor and specifically bound by a tumor homing
molecule.
[0183] Since numerous tumor homing peptides containing the NGR
motif have been identified, for example, a tumor homing peptide
comprising an NGR sequence can be used to isolate the NGR receptor.
Thus, an NGR tumor homing peptide can be linked to a solid matrix
and an appropriately processed sample of a tumor, which
specifically binds the NGR peptide, can be passed over the NGR
peptide-matrix. The NGR receptor, which is the target molecule for
the NGR tumor homing peptide, then can be obtained in a
substantially isolated form, as described in Example X. When used
in reference to a target molecule, the term "substantially
isolated" means that the target molecule comprises at least 30% of
the total protein present, although the target molecule can
comprise at least 50% of the total protein, or 80% of the total
protein, or 90% or 95% of the total protein, or more. A method such
as gel electrophoresis and silver staining can be used to determine
the relative amount of a target molecule in a sample, following a
purification protocol, and, therefore, can be used to identify a
substantially isolated target molecule.
[0184] The skilled artisan will recognize that a substantially
isolated target molecule can be used as an immunogen to obtain
antibodies that specifically bind the target molecule. As used
herein, the term "antibody" is used in its broadest sense to
include polyclonal and monoclonal antibodies, as well as antigen
binding fragments of such antibodies. With regard to an antibody of
the invention, which specifically binds a target molecule targeted
by a tumor homing molecule, the term "antigen" means the target
molecule polypeptide or peptide portion thereof. An antibody or
antigen binding fragment of an antibody that binds a target
molecule is characterized by having specific binding activity for
the target molecule or a peptide portion thereof of at least about
1.times.10.sup.5 M.sup.-1, preferably at least about
1.times.10.sup.6 M.sup.-1, and more preferably at least about
1.times.10.sup.8 M.sup.-1. Thus, Fab, F(ab').sub.2, Fd and Fv
fragments of the antibody, which retain specific binding activity
for a target molecule, which is expressed by angiogenic
vasculature, are included within the definition of an antibody.
[0185] In addition, the term "antibody" as used herein includes
naturally occurring antibodies as well as non-naturally occurring
antibodies, including, for example, single chain antibodies,
chimeric, bifunctional and humanized antibodies, as well as
antigen-binding fragments thereof. Such non-naturally occurring
antibodies can be constructed using solid phase peptide synthesis,
can be produced recombinantly or can be obtained, for example, by
screening combinatorial libraries consisting of variable heavy
chains and variable light chains as described by Huse et al.,
Science 246:1275-1281 (1989), which is incorporated herein by
reference. These and other methods of making, for example,
chimeric, humanized, CDR-grafted, single chain, and bifunctional
antibodies are well known to those skilled in the art (Winter and
Harris, Immunol. Today 14:243-246 (1993); Ward et al., Nature
341:544-546 (1989); Hilyard et al., Protein Engineering: A
practical approach (IRL Press 1992); Borrabeck, Antibody
Engineering, 2d ed. (Oxford University Press 1995); each of which
is incorporated herein by reference; see, also, Harlow and Lane,
supra, 1988).
[0186] Antibodies that specifically bind a target molecule of the
invention can be raised using as an immunogen a substantially
isolated target molecule, which can be obtained as disclosed
herein, or a peptide portion of the target molecule, which can be
obtained, for example, by enzymatic degradation of the target
molecule and gel purification. A non-immunogenic peptide portion of
a target molecule can be made immunogenic by coupling the hapten to
a carrier molecule such as bovine serum albumin (BSA) or keyhole
limpet hemocyanin (KLH). Various other carrier molecules and
methods for coupling a hapten to a carrier molecule are well known
in the art and described, for example, by Harlow and Lane, supra,
1988).
[0187] Particularly useful antibodies of the invention are those
that bind to the tumor homing molecule binding site on the target
molecule, such antibodies being readily identifiable by detecting
competitive inhibition of binding of the antibody and the
particular tumor homing molecule that binds to the target molecule.
Conversely, antibodies that bind to an epitope of the target
molecule that is not involved in binding the tumor homing molecule
also are valuable, since such antibodies, which, themselves, can be
"tumor homing molecules," can be bind to target molecules having
another tumor homing molecule bound thereto.
[0188] An antibody that specifically binds a target molecule, for
example, the NGR receptor, is useful for determining the presence
or level of the target molecule in a tissue sample, which can be a
lysate or a histological section. The identification of the
presence or level of the target molecule in the sample can be made
using well known immunoassay and immunohistochemical methods
(Harlow and Lane, supra, 1988). An antibody specific for a target
molecule also can be used to substantially isolate the target
molecule from a sample. In addition, an antibody of the invention
can be used in a screening assay to identify, for example,
peptidomimetics of a tumor homing molecule that bind to the target
molecule or as a tool for tumor targeting.
[0189] Upon obtaining a target molecule, which, due to the nature
of a tumor homing molecule, is expressed in angiogenic vasculature,
for example, the angiogenic vasculature in a tumor, the naturally
occurring ligand for the target molecule, where it exists, can be
identified. Methods for identifying a ligand for such a target
molecule, which is akin to an "orphan receptor," are well known in
the art and include, for example, screening biological samples to
identify the ligand. A convenient screening assay to identify a
natural ligand for the target molecule can utilize the ability of a
putative natural ligand to competitively inhibit the binding to the
target molecule of a tumor homing molecule that specifically binds
the target molecule, for example, the tumor homing peptide used to
obtain the substantially isolated target molecule.
[0190] A screening assay comprising a competitive binding assay for
the target molecule and, for example, the natural ligand for the
target molecule or a tumor homing peptide that specifically binds
the target molecule, also provides a means to identify
peptidomimetics of a tumor homing molecule. As discussed above,
such peptidomimetics can provide advantages over tumor homing
peptides in that they can be small, relatively stable for storage,
conveniently produced in suitable quantities, and capable of being
administered orally. A peptidomimetic of a tumor homing peptide can
be identified by screening libraries of peptidomimetics in a
competitive binding assay as described above.
[0191] The disclosed in vivo panning method can be used to detect
four different kinds of target molecules in tumors. First, because
tumor vasculature undergoes active angiogenesis, target molecules
that are characteristic of angiogenic vasculature, in general, or
angiogenic tumor vasculature, in particular, can be identified.
Second, vascular target molecules that are characteristic of the
tissue of origin of the tumor can be identified. Third, target
molecules that are expressed in the vasculature of a particular
type of tumor can be identified. Fourth, tumor stroma or tumor cell
target molecules can be identified due to the fenestrated nature of
tumor vasculature, which allows the potential tumor homing
molecules to leave the circulation and contact the tumor
parenchyma.
[0192] As further disclosed herein, some, but not all, tumor homing
molecules also can home to angiogenic vasculature that is not
contained within a tumor. For example, tumor homing molecules
containing either the RGD motif or the GSL motif also homed
effectively to retinal neovasculature (Smith et al., Invest.
Ophthamol. Vis. Sci. 35:101-111 (1994), which is incorporated
herein by reference), whereas tumor homing peptides containing the
NGR motif accumulated to a lesser extent in retinal neovasculature
than in tumor vasculature. Thus, the present invention also
provides peptides that home to nontumor angiogenic vasculature as
well as peptides that home preferentially to tumor vasculature
compared to non-tumor neovasculature. Furthermore, these results
indicate that tumor vasculature express target molecules that are
not substantially expressed by other kinds of angiogenic
vasculature. Thus, the present invention provides a means to
identify target molecules expressed specifically by angiogenic
vasculature present in a tumor, as well as for target molecules
expressed by angiogenic vasculature not associated with a tumor.
Methods as disclosed herein can be used to distinguish such homing
peptides and to isolate the various target molecules.
[0193] As an alternative to using a tumor sample to obtain the
target molecule, extracts of cultured tumor cells or endothelial
cells, depending on which cell type expresses the target molecule,
can be used as the starting material in order to enhance the
concentration of the target molecule in the sample. It is
recognized, however, that the characteristics of such cells can
change upon adaptation to tissue culture. Thus, care must be
exercised if such a preselection step is attempted. The presence of
the target molecule can be established, for example, by using phage
binding and cell attachment assays (see, for example, Barry et al.,
supra, 1996).
[0194] A cell line expressing a particular target molecule can be
identified and surface iodination of the cells can be used to label
the target molecule. The cells then can be extracted, for example,
with octylglucoside and the extract can be fractionated by affinity
chromatography using a tumor homing peptide (see Tables 1 and 2)
coupled to a matrix such as SEPHAROSE (see Hermanson, supra, 1996).
The purified target molecule can be microsequenced and antibodies
can be prepared. If desired, oligonucleotide probes can be prepared
and used to isolate cDNA clones encoding the target molecule.
Alternatively, an anti-target molecule antibody can be used to
isolate a cDNA clone from an expression library (see Argraves et
al., J. Cell Biol. 105:1183-1190 (1987), which is incorporated
herein by reference).
[0195] As an alternative to isolating the target molecule, a
nucleic acid encoding the target molecule can be isolated using a
mammalian cell expression cloning system such as the COS cell
system. An appropriate library can be prepared, for example, using
mRNA from primary tumor cells. The nucleic acids can be cloned into
the pcDNAIII vector (Invitrogen), for example. Cells expressing a
cDNA for the target molecule can be selected by binding to the
tumor homing peptide. Purified phage can be used as the carrier of
the peptide and can be attached to magnetic beads coated, for
example, with anti-M13 antibodies (Pharmacia Biotech; Piscataway
N.J.). Cells that bind to the peptide coating can be recovered
using a magnet and the plasmids can be isolated. The recovered
plasmid preparations then can be divided into pools and examined in
COS cell transfections. The procedure can be repeated until single
plasmids are obtained that can confer upon the COS cells the
ability to bind the tumor homing peptide.
[0196] The following examples are intended to illustrate but not
limit the present invention.
Example I
In Vivo Panning
[0197] This example demonstrates methods for preparing a phage
library and screening the library using in vivo panning to identify
phage expressing peptides that home to a tumor.
A. Preparation of Phage Libraries:
[0198] Phage display libraries were constructed using the fuse 5
vector as described by Koivunen et al. (supra, 1995; Koivunen et
al., supra, 1994b). Libraries encoding peptides designated
CX.sub.5C (SEQ ID NO:9), CX.sub.6C (SEQ ID NO:10), CX.sub.7C (SEQ
ID NO:11) and CX.sub.3CX.sub.3CX.sub.3C (SEQ ID NO:12) were
prepared, where "C" indicates cysteine and "X.sub.N" indicates the
given number of individually selected amino acids. These libraries
can display cyclic peptides when at least two cysteine residues are
present in the peptide. In addition, a library that did not contain
defined cysteine residues also was constructed. Such a library
results in the production primarily of linear peptides, although
cyclic peptides also can occur due to random probability.
[0199] A biased library based on the sequence CXXXNGRXX (SEQ ID
NO:13) also was constructed. Furthermore, in some cases the
CXXXNGRXX (SEQ ID NO:13) library was further biased by the
incorporation of cysteine residues flanking the NGR sequence, i.e.,
CXXCNGRCX (SEQ ID NO:14; see Table 1).
[0200] The libraries containing the defined cysteine residues were
generated using oligonucleotides constructed such that "C" was
encoded by the codon TGT and "X.sub.N" was encoded by NNK, where
"N" is equal molar mixtures of A, C, G and T, and where "K" is
equal molar mixtures of G and T. Thus, the peptide represented by
CX.sub.5C (SEQ ID NO:9) can be represented by an oligonucleotide
having the sequence TGT(NNK).sub.5TGT (SEQ ID NO:14).
Oligonucleotides were made double stranded by 3 cycles of PCR
amplification, purified and ligated to the nucleic acid encoding
the gene III protein in the fuse 5 vector such that, upon
expression, the peptide is present as a fusion protein at the
N-terminus of the gene III protein.
[0201] The vectors were transfected by electroporation into MC1061
cells. Bacteria were cultured for 24 hr in the presence of 20
.mu.g/ml tetracycline, then phage were collected from the
supernatant by precipitation twice using polyethylene glycol. Each
library contained about 5.times.10.sup.9 to 5.times.10.sup.14
transducing units (TU; individual recombinant phage).
B. In Vivo Panning of Phage:
[0202] Tumors were transplanted into mice as described in Examples
II and III, below. A mixture of phage libraries containing
1.times.10.sup.9 to 1.times.10.sup.14 TU was diluted in 200 .mu.l
DMEM and injected into the tail vein of anesthetized mice (AVERTIN
(0.015 ml/g); see U.S. Pat. No. 5,622,699; Pasqualini and
Ruoslahti, supra, 1996). After 1-4 minutes, mice were snap frozen
in liquid nitrogen. To recover the phage, carcasses were partially
thawed at room temperature for 1 hr, tumors and control organs were
collected and weighed, then were ground in 1 ml DMEM-PI (DMEM
containing protease inhibitors (PI); phenylmethylsulfonyl fluoride
(PMSF; 1 mM), aprotinin (20 .mu.g/ml), leupeptin (1 .mu.g/ml)).
[0203] Alternatively, following introduction of a library into a
mouse, circulation of the library is terminated by perfusion
through the heart. Briefly, mice were anesthetized with AVERTIN,
then the heart was exposed and a 0.4 mm needle connected through a
0.5 mm cannula to a 10 cc syringe was inserted into the left
ventricle. An incision was made on the right atrium and 5 to 10 ml
of DMEM was slowly administered, perfusing the whole body over
about a 5 to 10 min period. Efficiency of the perfusion was
monitored directly by histologic analysis.
[0204] Tumor and organ samples were washed 3 times with ice cold
DMEM-PI containing 1% bovine serum albumin (BSA), then directly
incubated with 1 ml K91-kan bacteria for 1 hr. Ten ml NZY medium
containing 0.2 .mu.g/ml tetracycline (NZY/tet) was added to the
bacterial culture, the mixture was incubated in a 37.degree. C.
shaker for 1 hr, then 10 .mu.l or 100 .mu.l aliquots were plated in
agar plates containing 12.5 .mu.g/ml tetracycline (tet/agar).
[0205] Individual colonies containing phage recovered from a tumor
were grown for 16 hr in 5 ml NZY/tet. The bacterial cultures
obtained from the individual colonies were pooled and the phage
were purified and re-injected into mice as described above for a
second round of in vivo panning. In general, a third round of
panning also was performed. Phage DNA was purified from individual
bacterial colonies obtained from the final round of in vivo panning
and the DNA sequences encoding the peptides expressed by selected
phage were determined (see Koivunen et al., supra, 1994b).
Example II
Identification of Tumor Homing Peptides by In Vivo Panning Against
a Breast Tumor
[0206] This example demonstrates that in vivo panning can be
performed against a breast tumor to identify tumor homing peptides
that home to various tumors.
[0207] Human 435 breast carcinoma cells (Price et al., supra
(1990)) were inoculated into the mammary fat pad of nude mice. When
the tumors attained a diameter of about 1 cm, either a phage
targeting experiment was performed, in which phage expressing a
specific peptide were administered to the tumor bearing mouse, or
in vivo panning was performed.
[0208] The breast tumor bearing mice were injected with
1.times.10.sup.9 phage expressing a library of
CX.sub.3CX.sub.3CX.sub.3C (SEQ ID NO:12) peptides, where X.sub.3
indicates three groups of independently selected, random amino
acids. The phage were allowed to circulate for 4 min, then the mice
were anesthetized, snap frozen in liquid nitrogen while under
anesthesia, and the tumor was removed. Phage were isolated from the
tumor and subjected to two additional rounds of in vivo
panning.
[0209] Following the third round of panning, phage were quantitated
and the peptide sequences expressed by the cloned phage were
determined. The cloned phage expressed various different peptides,
including those shown in Table 1. Similarly, CX.sub.7C (SEQ ID
NO:11) and CX.sub.5C (SEQ ID NO:9) libraries were screened and
breast tumor homing peptides were identified (Table 1). These
results demonstrate that in vivo panning against a breast tumor can
identify tumor homing molecules.
TABLE-US-00001 TABLE 1 PEPTIDES FROM PHAGE RECOVERED FROM HUMAN
BREAST CANCER CGRECPRLCQSSC (2*) CNGRCVSGCAGRC (3) CGEACGGQCALPC
(20) IWSGYGVYW (21) PSCAYMCIT (22) WESLYFPRE (23) SKVLYYNWE (24)
CGLMCQGACFDVC (25) CERACRNLCREGC (26) CPRGCLAVCVSQC (27) CKVCNGRCCG
(28) CEMCNGRCMG (29) CPLCNGRCAL (30) CPTCNGRCVR (31) CGVCNGRCGL
(32) CEQCNGRCGQ (33) CRNCNGRCEG (34) CVLCNGRCWS (35) CVTCNGRCRV
(36) CTECNGRCQL (37) CRTCNGRCLE (38) CETCNGRCVG (39) CAVCNGRCGF
(40) CRDLNGRKVM (41) CSCCNGRCGD (42) CWGCNGRCRM (43) CPLCNGRCAR
(44) CKSCNGRCLA (45) CVPCNGRCHE (46) CQSCNGRCVR (47) CRTCNGRCQV
(48) CVQCNGRCAL (49) CRCCNGRCSP (50) CASNNGRVVL (51) CGRCNGRCLL
(52) CWLCNGRCGR (53) CSKCNGRCGH (54) CVWCNGRCGL (55) CIRCNGRCSV
(56) CGECNGRCVE (57) CEGVNGRRLR (58) CLSCNGRCPS (59) CEVCNGRCAL
(60) CGSLVRC (5) GRSQMQI (61) HHTRFVS (62) SKGLRHR (63) VASVSVA
(64) WRVLAAF (65) KMGPKVW (66) IFSGSRE (67) SPGSWTW (68) NPRWFWD
(69) GRWYKWA (70) IKARASP (71) SGWCYRC (72) ALVGLMR (73) LWAEMTG
(74) CWSGVDC (75) DTLRLRI (76) SKSSGVS (77) IVADYQR (78) VWRTGHL
(79) VVDRFPD (80) LSMFTRP (81) GLPVKWS (82) IMYPGWL (83) CVMVRDGDC
(84) CVRIRPC (85) CQLAAVC (86) CGVGSSC (87) CVSGPRC (88) CGLSDSC
(89) CGEGHPC (90) CYTADPC (91) CELSLISKC (92) CPEHRSLVC (93)
CLVVHEAAC (94) CYVELHC (95) CWRKFYC (96) CFWPNRC (97) CYSYFLAC (98)
CPRGSRC (99) CRLGIAC (100) CDDSWKC (101) CAQLLQVSC (102) CYPADPC
(103) CKALSQAC (104) CTDYVRC (105) CGETMRC (106) *numbers in
parentheses indicate SEQ ID NO:.
Example III
In Vivo Targeting of a Phage Expressing an RGD Peptide to a
Tumor
[0210] Human 435 breast carcinoma cells were inoculated into the
mammary fat pad of nude mice. When the tumors attained a diameter
of about 1 cm, phage expressing a specific RGD-containing peptide
were administered to the tumor bearing mouse. Similar results to
those discussed below also were obtained with nude mice bearing
tumors formed by implantation of human melanoma C8161 cells or by
implantation of mouse B16 melanoma cells.
[0211] 1.times.10.sup.9 phage expressing the RGD-containing
peptide, RGD-4C (CDCRGDCFC; SEQ ID NO:1; see, Koivunen et al.,
supra, 1995) or control (insertless) phage were injected
intravenously (iv) into the mice and allowed to circulate for 4
min. The mice then were snap frozen or perfused through the heart
while under anesthesia, and various organs, including tumor, brain
and kidney, were removed and the phage present in the organs was
quantitated (see U.S. Pat. No. 5,622,699; Pasqualini and Ruoslahti,
supra, 1996).
[0212] Approximately 2-3 times more phage expressing the RGD-4C
(CDCRGDCFC; SEQ ID NO:1) peptide were detected in the breast tumor
as compared to brain and kidney, indicating the CDCRGDCFC (SEQ ID
NO:1; RGD-4C phage) peptide resulted in selective homing of the
phage to the breast tumor. In a parallel study, unselected phage,
which express various, diverse peptides, were injected into
tumor-bearing mice and various organs were examined for the
presence of phage. Far more phage were present in kidney and, to a
lesser extent, brain, as compared to the tumor. Thus, the 80-fold
more RGD-expressing phage than unselected phage concentrated in the
tumor. These results indicate that phage expressing the
RGD-containing peptide home to a tumor, possibly due to the
expression of the .alpha..sub.v.beta..sub.3 integrin on blood
vessels forming in the tumor.
[0213] Specificity of the breast tumor homing peptide was
demonstrated by competition experiments, in which coinjection of
500 .mu.g free peptide, ACDCRGDCFCG (SEQ ID NO:16; see Pasqualini
et al., supra, 1997) with the phage expressing the tumor homing
peptide reduced the amount of phage in the tumor by about tenfold,
whereas coinjection with the inactive control peptide, GRGESP (SEQ
ID NO:17) essentially had no effect. These results demonstrate that
phage displaying a peptide that can bind to an integrin expressed
on angiogenic vasculature can selectively home in vivo to an organ
or tissue such as a tumor containing such vasculature.
Example IV
In Vivo Targeting of Phage Expressing Tumor Homing Peptides
[0214] This example describes in vivo targeting of phage expressing
peptides that home to tumors.
[0215] One of the peptides that accumulated in tumors was derived
from a library with the structure CX.sub.3CX.sub.3CX.sub.3C (Arap
et al., Science 279:377-380 (1998), which is incorporated herein by
reference). This peptide, CNGRCVSGCAGRC (SEQ ID NO:3), contained
the sequence NGR (asparagine-glycine-arginine), which has been
identified previously as a weak cell adhesion motif (Koivunen et
al., J. Biol. Chem. 268:20205-20210 (1993); Healy et al., Biochem.
34:3948-3955 (1995), each of which is incorporated herein by
reference). Two other peptides that contain the NGR motif, but are
otherwise entirely different from the CNGRCVSGCAGRC (SEQ ID NO:3)
peptide, were tested for the ability to home to various tumors in
vivo. One of them is a linear peptide, NGRAHA (SEQ ID NO:6)
(Koivunen et al. supra (1993) and the other a cyclic one,
CVLNGRMEC.
[0216] Phage displaying tumor homing peptides were recovered from
breast carcinoma xenografts. Briefly, phage were injected at
10.sup.9 transducing units (TU) into the tail vein of mice bearing
size-matched MDA-MB-435 derived tumors (.about.1000 mm.sup.3) and
recovered after perfusion.
[0217] The mean number of phage recovered from the tumor or control
tissue (brain) and the standard error of the mean (SEM) from
triplicate platings are shown in FIG. 1. FIG. 1A, left panel, shows
recovery of CNGRCVSGCAGRC (SEQ ID NO:3) phage from tumor (filled
bars) and brain (striped bars). The minimal cyclic NGR peptide from
the CNGRCVSGCAGRC (SEQ ID NO:3) phage (CNGRC) was synthesized, and,
when 500 .mu.g of CNGRC (SEQ ID NO:8) peptide was co-injected with
the phage, the peptide inhibited the accumulation of CNGRCVSGCAGRC
(SEQ ID NO:3) phage as shown in FIG. 1B. The CNGRC (SEQ ID NO:8)
peptide also inhibited the accumulation of the two other
NGR-displaying phage in breast carcinoma xenografts. FIG. 1A,
middle panel, shows recovery of CGSLVRC (SEQ ID NO:5) phage and
inhibition of tumor homing by the soluble peptide CGSLVRC (SEQ ID
NO:5) (500 .mu.g). FIG. 1A, right panel, shows recovery of RGD-4C
(CDCRGDCFC; SEQ ID NO:1) phage (positive control) and unselected
phage library mix (negative control).
[0218] In FIG. 1B, left panel, increasing amounts of the RGD-4C
(CDCRGDCFC; SEQ ID NO:1) soluble peptide were injected with the
CNGRCVSGCAGRC (SEQ ID NO:3) phage. In FIG. 1B, right panel,
increasing amounts of the CNGRC (SEQ ID NO:8) soluble peptide were
injected with the RGD-4C (CDCRGDCFC; SEQ ID NO:1) phage. Inhibition
of the CNGRCVSGCAGRC (SEQ ID NO:3) phage homing by the CNGRC (SEQ
ID NO:8) peptide is shown in FIG. 1A. Inhibition of the RGD-4C
(CDCRGDCFC; SEQ ID NO:1) phage by the RGD-4C (CDCRGDCFC; SEQ ID
NO:1) peptide is described above.
[0219] As shown in FIG. 1, the CNGRCVSGCAGRC (SEQ ID NO:3) phage
homed specifically to the xenografted human breast carcinomas.
Similar results were obtained with the other NGR-displaying phage.
The tumor homing was not dependent on the tumor type or on the
species of the tumor: the phage accumulated selectively in the
human breast carcinoma used in the selection as shown in FIG. 1A,
as well as in a human Kaposi's sarcoma and in a mouse melanoma
(data not shown).
[0220] As shown in FIG. 1B, left panel, the RGD-4C (CDCRGDCFC; SEQ
ID NO:1) phage homes selectively to the breast cancer tumor, and
its homing is readily inhibited by free RGD-4C peptide (see above).
However, the tumor homing of RGD-4C phage was not inhibited by the
CNGRC peptide (FIG. 1B, left panel), even when the peptide was used
in amounts higher than those that inhibited the homing of the NGR
phage (FIG. 1A, left panel). As shown in FIG. 1B, right panel, the
tumor homing of the NGR phage was partially inhibited by the RGD-4C
(CDCRGDCFC; SEQ ID NO:1) peptide, but this peptide was 5-10 times
less potent than the CNGRC peptide. An unrelated cyclic peptide,
GACVFSIAHECGA (SEQ ID NO:19), had no effect in the tumor homing
ability of either phage (data not shown). In sum, these results
indicate that the two peptides displaying RGD and NGR bind to
different receptor sites in tumor vasculature, although the RGD and
NGR receptor sites can be related.
[0221] To further characterize and quantitate the tumor homing
ability of phage expressing peptides, CNGRC (SEQ ID NO:8), RGD-4C
(CDCRGDCFC; SEQ ID NO:1), and control phage (insertless fd-amp and
fd-tet) were injected at 10.sup.9 transducing units (TU) into the
tail vein of mice bearing size-matched, MDA-MB-435-derived tumors
(.about.1000 mm.sup.3) and recovered from tumors and brain tissue
after perfusion. An insertless phage with a different selective
marker (ampicillin instead of tetracycline) was co-injected with
the NGR phage at the same input to assess specificity within the
same tumor-bearing animal. The ratios were calculated using the
number of co-injected control ampicillin-resistant phage recovered
from the same tissues. The phage were quantitated from triplicate
platings on tetracycline (the homing phage) or ampicillin (control
phage) selective plates. Various additional control phage were
injected separately into tumor-bearing mice. These controls
included: fd-tet phage without insert; unselected phage library
mixtures; phage selected and shown to home to other normal vascular
beds; and phage displaying peptides that were unrelated to NGR. The
RGD-4C (CDCRGDCFC; SEQ ID NO:1) phage served as a positive
control.
[0222] Over 10-fold more NGR phage than control
ampicillin-resistant phage accumulated in the tumor in the
co-injection experiments (FIG. 2). The RGD-4C (CDCRGDCFC; SEQ ID
NO:1) phage also bound selectively to the tumors. In contrast, more
ampicillin phage than NGR phage were recovered from brain (FIG. 2)
and other control organs tested. Moreover, co-injection of the
NGR-phage with a 10-fold excess of phage particles engineered to be
non-infective did not affect tumor homing. The inclusion of excess
non-infective phage particles did decrease the trapping of phage in
organs containing reticuloendothelial tissue such as the spleen and
the liver.
Example V
Immunohistochemical Analysis of Tumor Homing Peptides
[0223] This example provides a method of identifying the
localization of tumor homing molecules by immunohistochemical
examination.
[0224] Localization of phage expressing a tumor homing peptide was
identified by immunochemical methods in histologic sections
obtained either 5 min or 24 hr after administration of phage
expressing a tumor homing peptide ("peptide-phage") to a tumor
bearing mouse (FIG. 3). For samples obtained 5 min following
administration of the peptide-phage, mice were perfused with DMEM
and various organs, including the tumor, were removed and fixed in
Bouin's solution. For samples obtained at 24 hr, no peptide-phage
remains in the circulation and, therefore, perfusion was not
required. Histologic sections were prepared and reacted with
anti-M13 (phage) antibodies (Pharmacia Biotech; see U.S. Pat. No.
5,622,699; Pasqualini and Ruoslahti, supra, 1996). Visualization of
the bound anti-M13 antibody was performed using a
peroxidase-conjugated second antibody (Sigma; St. Louis Mo.)
according to the manufacturer's instructions.
[0225] As discussed in Example III, phage expressing the tumor
homing peptide, RGD-4C (CDCRGDCFC; SEQ ID NO:1; also designated
"RGD phage"), were administered intravenously to mice bearing the
breast tumor. In addition, the RGD phage were administered to mice
bearing a mouse melanoma or a human Kaposi's sarcoma. Circulation
of the phage was terminated and mice were sacrificed as described
above and samples of the tumor and of skin adjacent to the tumor,
brain, kidney, lung and liver were collected. Immunohistochemical
staining for the phage showed accumulation of the RGD phage in the
blood vessels present in the breast tumor as well as in the
melanoma and the Kaposi's sarcoma, whereas little or no staining
was observed in the control organs.
[0226] Similar experiments were performed using phage expressing
the tumor homing peptide, CNGRCVSGCAGRC (SEQ ID NO:3; "NGR phage"),
which was identified by in vivo panning against a tumor formed by
the MDA-MB-435 breast carcinoma. In these experiments, NGR phage or
control phage, which do not express a peptide, were administered to
mice bearing tumors formed by the MDA-MB-435 breast carcinoma or by
a human SLK Kaposi's sarcoma xenograft, then the mice were
sacrificed as described above and tumors were collected as well as
control organs, including brain, lymph node, kidney, pancreas,
uterus, mammary fat pad, lung, intestine, skin, skeletal muscle,
heart and epithelium of the renal calices, bladder and ureter (see
FIG. 3). Histological samples were prepared and examined by
immunostaining as described above.
[0227] In samples obtained from mice sacrificed 4 min after
administration of the NGR phage, immunostaining of the vasculature
of both the breast tumor (FIG. 3E) and the Kaposi's sarcoma (FIG.
3H) was observed. Very little or no staining was observed in the
endothelium of the these tumors in mice administered an insertless
control phage (FIGS. 3G and 3J, respectively). In the samples
obtained from mice sacrificed 24 hr after administration of the NGR
phage, staining of the tumor samples appeared to have spread
outside of the vessels, into the breast tumor parenchyma (FIGS. 3B
and 3F) and the Kaposi's sarcoma parenchyma (FIGS. 3D and 3I).
Again, little or no staining was observed in samples prepared from
these tumors in mice administered the insertless control phage
(FIGS. 3A and 3C, respectively). In addition, little or no staining
was observed in various control organs in mice administered the NGR
phage (FIGS. 3K to 3V).
[0228] In other experiments, similar results were obtained
following administration of phage expressing the NGR tumor homing
peptides, NGRAHA (SEQ ID NO:6) or CVLNGRMEC (SEQ ID NO:7), to tumor
bearing mice. Also, as discussed below, similar results were
obtained using phage expressing the GSL tumor homing peptide,
CLSGSLSC (SEQ ID NO:4), which was identified by in vivo panning of
a melanoma (see Example VI, below).
[0229] These results demonstrate that tumor homing peptides
selectively home to tumors, particularly to the vasculature in the
tumors and that tumor homing peptides identified, for example, by
in vivo panning against a breast carcinoma also selectively home to
other tumors, including Kaposi's sarcoma and melanoma. In addition,
these results demonstrate that immunohistochemical analysis
provides a convenient assay for identifying the localization of
phage expressing tumor homing peptides.
Example VI
Identification of Tumor Homing Peptides by In Vivo Panning Against
a Melanoma Tumor
[0230] The general applicability of the in vivo panning method to
identify tumor homing peptides was examined by performing in vivo
panning against an implanted mouse melanoma tumor.
[0231] Mice bearing a melanoma were produced by implantation of
B16B15b mouse melanoma cells, which produce highly vascularized
tumors. B16B5b mouse melanoma cells were injected subcutaneously
into the mammary fat pad of nude mice (2 months old) and tumors
were allowed to grow until the diameter was about 1 cm. In vivo
panning was performed as disclosed above. Approximately
1.times.10.sup.12 transducing units of phage expressing the
CX.sub.5C (SEQ ID NO:9), CX.sub.6C (SEQ ID NO:10) or CX.sub.7C (SEQ
ID NO:11) library were injected, iv, and allowed to circulate for 4
min. Mice then were snap frozen in liquid nitrogen or perfused
through the heart while under anesthesia, tumor tissue and brain
(control organ) were removed, and phage were isolated as described
above. Three rounds of in vivo panning were performed.
[0232] The amino acid sequences were determined for the inserts in
89 cloned phage recovered from the B16B15b tumors. The peptides
expressed by these phage were represented by two predominant
sequences, CLSGSLSC (SEQ ID NO:4; 52% of the clones sequenced) and
WGTGLC (SEQ ID NO:18; 25% of the clones; see Table 2). Reinfection
of phage expressing one of the selected peptides resulted in
approximately three-fold enrichment of phage homing to the tumor
relative to brain.
TABLE-US-00002 TABLE 2 PEPTIDES FROM PHAGE RECOVERED FROM MOUSE
B16B15b MELANOMA CLSGSLSC (4*) GICKDDWCQ (107) TSCDPSLCE (108)
KGCGTRQCW (109) YRCREVLCQ (110) CWGTGLC (111) WSCADRTCM (112)
AGCRLKSCA (113) SRCKTGLCQ (114) PICEVSRCW (115) WTCRASWCS (116)
GRCLLMQCR (117) TECDMSRCM (118) ARCRVDPCV (119) CIEGVLGGC (120)
CSVANSC (121) CSSTMRC (122) SIDSTTF (123) GPSRVGG (124) WWSGLEA
(125) LGTDVRQ (126) LVGVRLL (127) GRPGDIW (128) TVWNPVG (129)
GLLLVVP (130) FAATSAE (131) WCCRQFN (132) VGFGKAL (133) DSSLRLP
(134) KLWCAMS (135) SLVSFLG (136) GSFAFLV (137) IASVRWA (138)
TWGHLRA (139) QYREGLV (140) QSADRSV (141) YMFWTSR (142) LVRRWYL
(143) TARGSSR (144) TTREKNL (145) PKWLLFS (146) LRTNVVH (147)
AVMGLAA (148) VRNSLRN (149) *numbers in parentheses indicate SEQ ID
NO:.
[0233] Localization of the phage expressing a tumor homing peptide
in the mouse organs also was examined by immunohistochemical
staining of the tumor and various other tissues (see Example V). In
these experiments, 1.times.10.sup.9 pfu of a control (insertless)
phage or a phage expressing the tumor homing peptide, CLSGSLSC (SEQ
ID NO:4), were injected, iv, into tumor bearing mice and allowed to
circulate for 4 min.
[0234] Immunostaining was evident in the melanoma obtained from a
mouse injected with phage expressing the CLSGSLSC (SEQ ID NO:4)
tumor homing peptide. Staining of the melanoma generally was
localized to the blood vessels within the tumor, although some
staining also was present in the tumor parenchyma. Essentially no
staining was observed in a tumor obtained from a mouse injected
with the insertless control phage or in skin or in kidney samples
obtained from mice injected with either phage. However,
immunostaining was detected in the liver sinusoids and in spleen,
indicating that phage can be trapped nonspecifically in organs
containing RES.
[0235] Using similar methods, in vivo panning was performed in mice
bearing a SLK human Kaposi's sarcoma. Tumor homing peptides were
identified and are disclosed in Table 3. Together, these results
demonstrate that the in vivo panning method is a generally
applicable method for screening a phage library to identify phage
expressing tumor homing peptides.
TABLE-US-00003 TABLE 3 PEPTIDES FROM PHAGE RECOVERED FROM HUMAN
KAPOSI'S SARCOMA TDCTPSRCT (150*) SWCQFEKCL (151) VPCRFKQCW (152)
CTAMRNTDC (153) CRESLKNC (154) CMEMGVKC (155) VTCRSLMCQ (156)
CNNVGSYC (157) CGTRVDHC (158) CISLDRSC (159) CAMVSMED (160)
CYLGVSNC (161) CYLVNVDC (162) CIRSAVSC (163) LVCLPPSCE (164)
RHCFSQWCS (165) FYCPGVGCR (166) ISCAVDACL (167) EACEMAGCL (168)
PRCESQLCP (169) RSCIKHQCP (170) QWCSRRWCT (171) MFCRMRSCD (172)
GICKDLWCQ (173) NACESAICG (174) APCGLLACI (175) NRCRGVSCT (176)
FPCEGKKCL (177) ADCRQKPCL (178) FGCVMASCR (179) AGCINGLCG (180)
RSCAEPWCY (181) DTCRALRCN (182) KGCGTRQCW (109) GRCVDGGCT (183)
YRCIARECE (184) KRCSSSLCA (185) ICLLAHCA (186) QACPMLLCM (187)
LDCLSELCS (188) AGCRVESC (189) HTCLVALCA (190) IYCPGQECE (191)
RLCSLYGCV (192) RKCEVPGCQ (193) EDCTSRFCS (194) LECVVDSCR (195)
EICVDGLCV (196) RWCREKSCW (197) FRCLERVCT (198) RPCGDQACE (199)
CNKTDGDEGVTC (15) *numbers in parentheses indicate SEQ ID NO:.
Example VII
Preparation and Characterization of Tumor Homing
Peptide/Doxorubicin Conjugates
[0236] This example provides methods for conjugating a moiety such
as the chemotherapeutic agent, doxorubicin, to a tumor homing
peptide and for characterizing the conjugation product.
[0237] The peptides CNGRC (SEQ ID NO:8), CDCRGDCFC (SEQ ID NO:1;
RGD-4C; Koivunen et al., supra, 1995; Pasqualini et al., supra,
1997), CGSLVRC (SEQ ID NO:5) and GACVFSIAHECGA (SEQ ID NO:19) were
synthesized, cyclized under high dilution and purified to
homogeneity by HPLC. Conjugation of the peptides to doxorubicin
(Aldrich; Milwaukee Wis.) was performed using
1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC;
Sigma; St. Louis Mo.) and N-hydroxysuccinimide (NHS; Sigma) as
described (Bauminger and Wilchek, supra, 1980; Harlow and Lane,
supra, 1988; Hurwitz et al., supra, 1975). Unreacted doxorubicin
and peptide were removed from the doxorubicin/peptide conjugates by
SEPHADEX G25 column chromatography using phosphate buffered saline.
The conjugates were lyophilized for storage and were resuspended in
sterile water prior to use.
[0238] Doxorubicin concentration of the conjugates (see Example VI)
was determined by measuring the optical absorbance of the solution
at 490 nm in a standard spectrophotometer; this wavelength detects
only the doxorubicin, not the peptides. A calibration curve for
doxorubicin was generated and used to calculate the concentration
prior to use. Conjugation of doxorubicin to the various peptides
did not affect this curve. This procedure ensures that each of the
administered conjugates contained the same amounts of doxorubicin
equivalent.
[0239] HPLC, mass spectrometry, capillary electrophoresis and NMR
analyses were performed to characterize the conjugates.
HPLC-fluorescence was performed using an INTERSIL ODS-2 column
(4.6.times.150 mm) and a mobile phase composed of 0.08%
triethanolamine/0.02% phosphoric acid (85%)/27% acetonitrile at 1
ml/min. Fluorescence detection was performed with excitation at 490
nm and emission at 560 nm wavelength and the retention time (RT)
and the area under the curves (AUC) for doxorubicin (dox) and for
the major peaks was determined. Each of the conjugates has a unique
retention time, depending on the peptide, as follows:
doxorubicin/CDCRGDCFC (SEQ ID NO:1), RT 7.4 min, AUC 26%;
doxorubicin/CNGRC (SEQ ID NO:8), RT 4.7 min, AUC 56%; and
doxorubicin/GACVFSIAHECGA (SEQ ID NO:19), RT 7.7 min, AUC 43%. In
comparison, the retention time of doxorubicin is 10.6 min and, in
the various reactions, the AUC was about 5%.
[0240] Capillary electrophoresis (CE; Liu et al., supra, 1996) was
performed in uncoated fused-silica capillaries with 75 .mu.m
internal diameter and an effective separation length of 50 cm. The
CE detection system was equipped with an UV absorbance detector and
an argon laser emitting at 488 nm. The laser beam is transmitted
via a fiber optic cable to the detector and illuminates the
capillary window and the fluorescence signal is collected through
an emission filter. Conjugation of doxorubicin to the peptides
changed the electrophoretic characteristics of each of the
conjugates, indicating that this method can be used as a fast
screening method to identify progress of the conjugation
reaction.
[0241] An alternative method of conjugating doxorubicin to peptides
was also used (Nagy et al., supra 1996; Nagy et al., supra 1998).
The doxorubicin/CNGRC conjugate prepared by this method was found
to be homogeneous by HPLC. Mass spectrometry showed that the
doxorubicin/CNGRC (SEQ ID NO:8) conjugate had one predominant mass
number (1192.6), which agreed with the mass predicted from the
coupling chemistry (predicted mass 1192.2). Similar results were
obtained when the RGD-4C (CDCRGDCFC; SEQ ID NO:1) peptide was
coupled to doxorubicin.
[0242] One dimensional NMR analysis of the doxorubicin/CNGRC
conjugate revealed no evidence of resonances arising from free
doxorubicin. Two dimension NMR analysis can allow a determination
of the precise molecular structure of the doxorubicin-peptide
species.
[0243] These results demonstrate that a moiety such as the cancer
chemotherapeutic agent, doxorubicin, can be efficiently linked to
tumor homing peptides of the invention to produce homogeneous
doxorubicin/tumor homing peptide conjugates.
Example VIII
Tumor Therapy Using Doxorubicin/Tumor Homing Peptide Conjugates
[0244] This example demonstrates that doxorubicin/tumor homing
peptide conjugates provide a therapeutic advantage over the use of
doxorubicin, alone, for treating tumors.
[0245] Doxorubicin concentration of the conjugates (see Example VI)
was determined by measuring the optical absorbance of the solution
at 490 nm in a standard spectrophotometer; this wavelength detects
only the doxorubicin, not the peptides. A calibration curve for
doxorubicin was generated and used to calculate the concentration
prior to use. Conjugation of doxorubicin to the various peptides
did not affect this curve. This procedure ensures that each of the
administered conjugates contained the same amounts of doxorubicin
equivalent.
[0246] In addition, the viability of tumor cells obtained from
tumors of mice treated with a tumor homing peptide/doxorubicin
conjugate was compared to that of tumors from mice treated with
free doxorubicin. In these experiments, breast tumor bearing mice
were size matched with regard to the tumors, then treated
intravenously with 30 .mu.g equivalent of doxorubicin/RGD-4C
(CDCRGDCFC; SEQ ID NO:1) or of free doxorubicin. Five days after
treatment, the mice were euthanized and the tumors were removed.
The tumor pairs were weighed and ground and the cell suspensions
were plated (2 g tumor tissue per 150 mm plate).
[0247] Cell numbers were determined at 24 hours and 7 days after
plating. Viability of tumor cells from the tumors of mice receiving
the doxorubicin/RGD-4C (CDCRGDCFC; SEQ ID NO:1) conjugate was about
3 fold less than cells from tumors of mice treated with the free
doxorubicin. These results demonstrate that administration to a
tumor bearing mouse of a conjugate comprising a chemotherapeutic
agent linked to a tumor homing molecule is more efficacious than
administration of the agent, alone, in reducing the viability of
tumor cells.
A. In Vitro Characterization of Cytotoxicity:
[0248] MDA-MB-435 human breast carcinoma cells were plated at
1.times.10.sup.5 cells/well in 96 well plates. Cells were incubated
with increasing amounts of doxorubicin, the doxorubicin/RGD-4C
(CDCRGDCFC; SEQ ID NO:1) conjugate, or the
doxorubicin/GACVFSIAHECGA (SEQ ID NO:19; control) conjugate (0.1 to
10 .mu.g/well of doxorubicin-equivalent) for either 30 min or
overnight. Following incubation, the agents were removed by
extensive washing with PBS, then fresh medium added and incubation
was continued. The number of surviving cells was determined at 24
hours with crystal violet staining (see Koivunen et al., supra,
1994).
[0249] In cells exposed to free doxorubicin, the doxorubicin/RGD-4C
(CDCRGDCFC; SEQ ID NO:1) conjugate, or the
doxorubicin/GACVFSIAHECGA (SEQ ID NO:19) for 30 min, cell death was
present only in the cultures treated with the doxorubicin/RGD-4C
(CDCRGDCFC; SEQ ID NO:1) conjugate. However, if the agents were not
removed after 30 min, the cells were killed by all of the
treatments after 24 hr. These results indicate that enhanced
cellular uptake occurs for the doxorubicin/RGD-4C (CDCRGDCFC; SEQ
ID NO:1) conjugate.
B. In Vivo Characterization of Doxorubicin/Tumor Homing Peptide
Conjugates:
[0250] Female 2-month old Balb c nu/nu mice (Harlan Sprague Dawley;
San Diego Calif.) were used for these studies and were cared for
according to the Burnham Institute animal facility guidelines.
MDA-MB-435 breast carcinoma cells (Price et al., supra (1993)) were
injected in the mammary fat pad of the nude mice and tumor growth
was monitored (Pasqualini et al., supra, 1997). Tumors were allowed
to grow to a size of about 1 cm.sup.3 (about 5% of the mouse's body
weight) before starting the treatment experiments, except for the
toxicity experiments as discussed below.
[0251] Weekly doxorubicin/peptide conjugate or control treatments
(5 .mu.g/mouse/week of doxorubicin-equivalent) were administered
intravenously. In some experiments, as indicated, a dose of 30
.mu.g/mouse was administered every 3 weeks. Treatment with
doxorubicin, alone, is referred to as "dox control" and treatment
with doxorubicin conjugated to the non-tumor homing control
peptide, GACVFSIAHECGA (SEQ ID NO:19), is referred to as "conjugate
control." The results obtained in the doxorubicin control groups as
compared to the conjugate control groups were not significantly
different. As an additional control, in some experiments the tumor
homing peptide was mixed with doxorubicin, without linking, and the
mixture was administered to tumor bearing mice. Such treatment
produced results that were not statistically different from those
obtained with the above described doxorubicin controls.
[0252] Mice were anesthetized with a tribromoethanol-based
anesthetic mixture (AVERTIN; Papaioannou and Fox, Lab. Anim.
43:189-192 (1993)) before each treatment. Anesthetization
facilitated the tail vein injections (final volume, 200 .mu.l) and
allowed precise serial three dimensional tumor size measurements.
Tumor volume calculations were based on the equation for the volume
of an ovaloid: V=4/3(.pi.abc), where a, b, and c are 1/2 of the
measured diameters in each of the three dimensions.
[0253] At necropsy, MDA-MB-435 tumor-bearing mice treated with the
doxorubicin/RGD-4C (CDCRGDCFC; SEQ ID NO:1) conjugate had
significantly smaller tumors (t test, p=0.02), less spread to
regional lymph nodes (t test, p<0.0001), a lower incidence of
pulmonary metastasis and fewer metastatic lesions (t test,
p<0.0001) than the doxorubicin control treated mice. All of the
mice treated with the doxorubicin/RGD-4C (CDCRGDCFC; SEQ ID NO:1)
conjugate survived beyond the time when the doxorubicin control and
conjugate control mice had died (Log-Rank test, p<0.0001;
Wilcoxon test, p=0.0007). Essentially the same results were
obtained in five separate experiments. These results indicate that
a doxorubicin/tumor homing peptide provides a therapeutic advantage
over doxorubicin, alone, in reducing the growth of a primary tumor
and preventing metastasis of the tumor.
[0254] Gross and histopathologic examination was performed on the
mice. Many of the tumors in the mice treated with 5 .mu.g
doxorubicin equivalent of doxorubicin/RGD-4C (CDCRGDCFC; SEQ ID
NO:1) presented marked skin ulceration and tumor necrosis, whereas
no such signs were observed in doxorubicin control group or
conjugate control group. Histopathological analysis disclosed a
pronounced destruction of the vasculature in the tumors treated
with doxorubicin/RGD-4C (CDCRGDCFC; SEQ ID NO:1) conjugate as
compared to the doxorubicin control group.
[0255] In a dose escalation experiment, tumor bearing mice were
treated with the doxorubicin/RGD-4C (CDCRGDCFC; SEQ ID NO:1) at 30
.mu.g/mouse every three weeks for three cycles and were observed,
without further treatment, for an extended period of time. The
doxorubicin/RGD-4C (CDCRGDCFC; SEQ ID NO:1) treated mice all
remained alive more than 6 months after the doxorubicin control and
conjugate control mice had died. The results indicate that
treatment with a doxorubicin/tumor homing peptide conjugate can
have a curative effect.
[0256] Acute toxicity studies also were performed. In these
experiments, mice bearing extremely large tumors (about 25% of body
weight) were treated with 200 .mu.g/mouse doxorubicin or
doxorubicin/RGD-4C (CDCRGDCFC; SEQ ID NO:1) conjugate. All of the
mice treated with the doxorubicin/RGD-4C (CDCRGDCFC; SEQ ID NO:1)
conjugate survived for longer than one week, whereas all of the
doxorubicin control mice had died within 48 hr of treatment. These
results suggest that accumulation of the doxorubicin/RGD-4C
(CDCRGDCFC; SEQ ID NO:1) conjugate in the large tumors reduced the
circulating level of the conjugated doxorubicin, thus reducing its
toxicity.
[0257] Similar results were obtained using the doxorubicin/CNGRC
(SEQ ID NO:8) conjugate. In each of three series of experiments,
tumors in the mice treated with doxorubicin/CNGRC (SEQ ID NO:8)
were significantly smaller than tumor is the doxorubicin control
and conjugate control groups. Treatment with the doxorubicin/CNGRC
(SEQ ID NO:8) conjugate almost completely suppressed tumor growth,
whereas free doxorubicin and doxorubicin conjugated to the control
peptide had essentially no effect on tumor growth relative to
treatment with the vehicle, alone. A marked effect on survival also
was observed and some of the doxorubicin/CNGRC (SEQ ID NO: 8)
treated animals survived for extended periods of time (Log-Rank
test, p=0.0064; Wilcoxon test, p=0.0343). In addition, the
doxorubicin/CNGRC (SEQ ID NO:8) conjugate was less toxic than free
doxorubicin. These results confirm that conjugates comprising a
chemotherapeutic agent and a tumor homing molecule provide a
therapeutic advantage in treating cancer.
Example IX
Interaction of CD13/APN with NGR Ligands
[0258] This example describes the interaction of CD13/APN with NGR
containing peptides.
[0259] The use of phage display peptide libraries to isolate
minimal receptor sequences that bind to fibronectin and
RGD-containing fibronectin fragments in affinity panning is
described in Pasqualini et al., J. Cell Biol. 130:1189-1196 (1995),
which is incorporated herein by reference. A predominant motif,
CWDD(G/L)WLC was obtained and shown to be a structural mimic of an
RGD-binding site on integrins (Pasqualini et al., supra, 1995). By
searching the protein database for sequences homologous to the
W(D/N)DGWL sequence (an RGD-binding peptide, Pasqualini et al.,
supra, 1995), an identical peptide sequence, except for the
flanking cysteines, was found in aminopeptidases. The W(D/N)DGWL
sequence was highly conserved in aminopeptidases from bacteria to
humans, indicating that this motif represents a functionally
relevant domain (Favaloro et al., supra (1988); Rawlings and
Barret, Biochem J. 290:205-218 (1993), each of which is
incorporated herein by reference). CD13/Aminopeptidase N contains
the closely related WNDGWL sequence (Look et al., supra (1989);
Chen et al., J. Immunol. 157:2593-2600 (1996), each of which is
incorporated herein by reference).
Binding of CNGRC-Phage to Immobilized CD13/APN
[0260] Given that the NGR sequence closely resembles a reverse RGD
sequence, NGR-containing phage were tested to determine whether
they would bind to CD13/aminopeptidase (CD13/APN). Kaposi's sarcoma
tumor cell octylglucoside extracts were used as a source of
CD13/APN. Aminopeptidase enzymatic activity was measured in these
extracts utilizing Ala-pNA or Leu-pNA as substrates by monitoring
the absorbance of the samples at 405 nm (Look et al., supra (1989);
Taylor, supra (1993); Amoscato et al., supra (1989), each of which
is incorporated herein by reference). The specificity was confirmed
by demonstrating inhibition by o-phenanthroline, a specific
inhibitor of aminopeptidase N.
[0261] FIG. 4A shows that aminopeptidase activity from the Kaposi's
sarcoma cell extracts binds specifically to microtiter wells coated
with the CD13 antibody, but not to wells coated with BSA. The CD13
antibody alone had no aminopeptidase activity. Moreover, the
aminopeptidase N inhibitor, o-phenanthroline, inhibited the
activity from the tumor extracts captured by the antibody.
[0262] In FIG. 4B, NGR-containing phage were assayed for the
ability to bind CD13. CD13 from Kaposi's sarcoma tumor cell
octylglucoside extract was bound to microtiter wells precoated with
the anti-CD13 antibody WM15 (Pharmingen; San Diego Calif.)(Favaloro
et al., Br. J. Heamatol. 69:163-171 (1988), which is incorporated
herein by reference). Various phage were added to the wells at
2.times.10.sup.9 transducing units (TU) per well. The bound phage
were quantitated by infection of bacteria as described (Koivunen et
al., supra (1993); Pasqualini et al., supra, 1995). The data were
expressed as means and standard errors from triplicate wells. As
shown in FIG. 4B, three different phage, each of which displays the
NGR motif in a different context, showed strong and selective
binding to the immobilized CD13. Two RGD phage showed no
significant binding (FIG. 4B), and various unrelated control phage
also did not bind. These results indicate that CD13 recognizes the
NGR motif better than RGD.
[0263] To confirm the specificity of NGR binding by CD13, the
ability of NGR soluble peptides to inhibit the interaction was
studied. Either CNGRC (SEQ ID NO:8), CRGDGWC (SEQ ID NO:220), or
GACVFSIAHECGA (SEQ ID NO:19) (unrelated control) peptides were
added at 200 .mu.g/well to the phage binding assay, and the bound
phage quantitated by infection of bacteria. The data shown were
expressed as means and standard errors from triplicate wells.
[0264] As shown in FIG. 4C, the NGR cyclic peptide, but not the RGD
or the unrelated peptide, blocked the NGR phage binding. These
results demonstrate that phage expressing the peptide sequence NGR
and NGR peptides bind specifically to a CD13 related molecule.
Phage Binding Assays with CD13/APN-Transfected Cells
[0265] The CNGRC phage binds specifically to cells transfected with
CD13. Two cell lines that do not express endogenous CD13, the
Molt-4 human T cell leukemia and MDA-MB-435 breast carcinoma cell
lines, were used to assay CNGRC (SEQ ID NO:8) phage binding to
cells transfected with CD13. Briefly, mock transfected Molt-4 cells
("Molt-4/mock") and cells transfected with CD13 ("Molt-4/CD13")
were incubated with CNGRC (SEQ ID NO:8) phage or with control Fd
phage lacking an insert (2.times.10.sup.9 transducing units (TU)
per sample). Synthetic peptides, CNGRC (SEQ ID NO:8) or the
negative control CARAC (SEQ ID NO:221), were pre-incubated with the
cells at 250 and 500 .mu.g/ml. After extensive washing, bound phage
were quantitated by infection of bacteria as described above. As
shown in FIG. 5, CNGRC phage were found to bind to Molt-4/CD13 and
to MDA-MB-435/CD13 transfected cells, but not to parental cell
lines transfected with an empty control vector. Furthermore, the
binding was blocked by the CNGRC (SEQ ID NO:8) peptide, but not by
control peptides, demonstrating that the CNGRC (SEQ ID NO:8)
binding was specific (FIG. 5). These results indicate that CD13
gene transfer confers to cells the ability to bind NGR phage.
Example X
Affinity Purification of an NGR Receptor and Screening for High
Affinity Ligands
[0266] This example describes affinity purification of an NGR
receptor and screening for high affinity ligands of an NGR
receptor.
Affinity Chromatography of Extracts from CD13/APN Positive Cells on
Immobilized CNGRC Peptide Yields CD13/APN
[0267] To further characterize the interaction of CD13/APN with the
NGR peptide, affinity chromatography on the CNGRC peptide was
performed. The column was prepared by coupling the CNGRC peptide to
SEPHAROSE (Pharmacia; Piscataway N.J.). Elution was effected with
soluble CNGRC peptide. Experiments were performed using HL-60 cell
extracts because they are known to express CD13/APN without other
proteases that could interfere in the APN assay (Xu et al., supra
(1997)). Thus, in HL-60 cell extracts, all detectable cell surface
enzymatic activity is inhibitable by anti-CD13 blocking antibodies,
assuring specificity. Extracts of Molt-4 and MDA-MB-435 cells
transfected with CD13/APN were also characterized by using affinity
chromatography, with extracts of the mock transfected counterparts
used as negative controls.
[0268] Briefly, CD13 was detected by testing aliquots of each
fraction for the presence of CD13 immunoreactivity in ELISA with
the anti-CD13 monoclonal antibody WM15, using normal mouse IgG as a
negative control. The fractions were also analyzed for CD13
enzymatic activity using AlapNA as the substrate. In all cases,
using Molt-4/CD13, MDA-MB-435/CD13 or HL-60 cell extracts, elution
of the CNGRC-column with the CNGRC peptide yielded fractions
containing functional CD13/APN (FIG. 6). No CD13 immunoreactivity
was observed in the control samples using IgG, and no enzymatic
activity was found employing a MMP-specific substrate. Moreover,
affinity chromatography on a control peptide (CARAC; SEQ ID NO:221)
yielded no CD13/APN, and the CARAC peptide did not elute any
activity from the CNGRC column. Furthermore, no CD13 activity was
recovered from the CNGRC column when the extract fractionated was
derived from CD13-negative cells (see FIG. 6).
Isolation of Endothelial NGR Receptors by Affinity
Chromatography
[0269] Protocols based on those developed for the isolation of
certain integrins are used to isolate an NGR receptor using
affinity chromatography. Tumor extracts and cultured endothelial
cells treated with TNF.alpha., a known angiogenic stimulator,
prepared by extraction with octylglucoside are used as the source
of the receptor. The presence of the receptor is confirmed using a
phage binding assay and immunoblot analysis as described above. The
specific phage show more binding to the activated endothelial cells
than control phage. Cell binding assays with phage are performed as
described previously (Barry et al., supra (1996), which is
incorporated herein by reference).
[0270] The extract is run over a column of the peptide, coupled to
SEPHAROSE, and bound material is eluted with the soluble peptide at
1 mg/ml. High affinity peptides isolated during the screening of
secondary NGR libraries, described above, are used. Cells that do
not bind the NGR-containing phage are used to make a control
extract, and control elution from the peptide column is carried out
with an unrelated cyclic peptide. The eluates are probed with
anti-CD13 and the anti-NGR receptor phage antibodies. If desired,
anti-NGR receptor antibodies are used for affinity chromatography
alternatively or consecutively with the peptide affinity
chromatography. The NGR receptor preparations obtained by NGR
peptide affinity isolation contain an NGR reactive fragment and are
reactive with CD13 antibodies.
Screening of Secondary NGR Libraries to Identify High Affinity
Ligands for the NGR Receptor
[0271] In order to identify additional high affinity ligands for
the NGR receptor, secondary NGR libraries are constructed. Three
such libraries, X.sub.2CNGRCX.sub.2 (SEQ ID NO:222), CX.sub.2(C/X)
NGR(C/X)X.sub.2C (SEQ ID NO:223), and CNGRCX.sub.6 (SEQ ID NO:224)
(where "C" is cysteine and "X" is any amino acid), were prepared.
In these secondary libraries, the NGR sequence is represented in
different contexts which allows for multiple folding arrangements.
Because higher affinities can be achieved with cyclic peptides, the
libraries feature the NGR tripeptide in different cyclic
configurations. The secondary libraries are screened against the
target receptor in order to select the best-fit
sequence/conformation for the ligand. This has been empirically
demonstrated in a number of systems (Sparks et al., Methods
Enzymol. 255:498-509 (1995); Martens et al., J. Biol. Chem.
270:21129-21136 (1995); Wrighton et al., Science 273:458-464
(1996), each of which is incorporated herein be reference).
[0272] The secondary NGR phage peptide libraries are constructed as
follows. Phage display libraries are made as described in Smith and
Scott, Science 228:1315-1317 (1985); Smith and Scott, Methods
Enzymol. 21:228-257 (1993); and Koivunen et al., Methods Enzymol.
245:346-349 (1994), each of which is incorporated by reference).
Briefly, FUSE 5 plasmid is isolated from transfected MC1061 cells
using Qiagen Maxi-prep 500 columns (Qiagen; Chatsworth Calif.). The
plasmid is cleaved to remove the 14 bp "stuffer" using SfiI
restriction enzyme (New England Biolabs; Beverly Mass.) and
purified with QIAquick PCR purification columns (Qiagen). The
oligonucleotides encoding the peptides which are to be displayed by
the phage are purchased commercially and converted into double
stranded DNA utilizing a library primer (5'-TTCTGCCCCAGCGGCCCC-3';
SEQ ID NO:225). Two .mu.g of the oligonucleotide and 4 .mu.g of the
primer are annealed in a volume of 10 .mu.l at 65.degree. C. for 2
min and cooled to room temperature. Primer extension is performed
with SEQUENASE 2.0 DNA polymerase (United States Biochemical) for
60 min at 37.degree. C. in a reaction volume of 50 .mu.l containing
10 mM, and 5 mM dithiothreitol, and the double stranded
oligonucleotides are purified using the QIAquick nucleotide removal
kit (Qiagen). The oligonucleotide is subsequently digested with
BglI (Boehringer Mannheim; Indianapolis Ind.) overnight at
37.degree. C., purified as described above, and ligated to the FUSE
5 vector with T4 DNA Ligase (Gibco-BRL; Gaithersburg Md.). The
plasmid is then transfected into MC1061 bacteria utilizing the
Cell-Porator apparatus (Gibco-BRL). Approximately 25 .mu.l of
bacteria and 100 ng of plasmid are shocked with 2.5 kV and
immediately transferred to S.O.C. medium. A total of 100-200
electroporations are performed in order to achieve .about.10.sup.9
clones. For preparation of a CX.sub.2CNGRCX.sub.2 (SEQ ID NO:222)
secondary library, the primer
TABLE-US-00004 (SEQ ID NO: 202) 5'-CACTCGGCCGACGGGGCTTGTNNY
NNYTGTAATGGTAGGTGTNNYNNYGGGGCCGCTGGGGCAGAA-3'
is used, where N is any nucleotide and Y is T or C. For preparation
of a CX.sub.2(C/X) NGR(C/X)X.sub.2C (SEQ ID NO:223) secondary
library, the primer
TABLE-US-00005 (SEQ ID NO: 203) 5'-CACTCGGCCGACGGGGCTTGTNNYNNYNNY
AATGGGAGGNNYNNYNNYGGGGCCGCTGGGGCAGAA-3'
is used. For preparation of a CNGRCX.sub.6 (SEQ ID NO: 224)
secondary library, primer
TABLE-US-00006 (SEQ ID NO: 204) 5'-CACTCGGCCGACGGGGCTTGTAATGGGAGA
TGTNNYNNYNNYNNYNNYNNYGGGGCCGCTGGGGCAGAA-3'
is used. The secondary NGR phage libraries are screened for the
ability to bind immobilized CD13 or against CD13 transfected cells
as described above, and binding ligands are identified. The
secondary NGR libraries can also be screened for homing to tumor or
other angiogenic vasculature. Screening of Combinatorial scFv
Libraries from Rabbits Immunized with Human Tumor Xenografts
[0273] In order to identify additional high affinity ligands for
the NGR receptor, combinatorial scFv libraries are prepared from
rabbits immunized with human tumor xenografts. The tumor xenografts
are established as described in Pasqualini et al., supra, 1997, and
Arap, supra, 1998. The tumors are homogenized in PBS for
immunization and injected subcutaneously into rabbits every two
weeks. At least four injections are given; the immune response of
the rabbits is evaluated by immunostaining of tumor tissue sections
after the second and third immunization. Antibodies from sera of
immunized rabbits are tested for binding to immobilized CD13, and
to human integrins .alpha..sub.v.beta..sub.3 and
.alpha..sub.v.beta..sub.5 as positive controls. Spleen and bone
marrow from the immunized rabbits are harvested, and tissues from
identically treated rabbits are pooled and used for total RNA
preparation with TRI reagent (Molecular Research Center; Cincinnati
Ohio). Reverse transcription of total RNA is performed with the 1st
Strand cDNA Synthesis Kit for RT PCR (AMV; Boehringer Mannheim).
Using the PCR primers listed below, V.sub.k (nine primer
combinations), V.sub.l (one primer combination), and V.sub.g (four
primer combinations) encoding sequences are amplified from the
first strand cDNA. In pilot studies, all combinations gave rise to
PCR products in the range of 350 bp. Using the overlap extension
PCR primers listed below, scFv encoding sequences are assembled by
fusing V.sub.k and V.sub.l, respectively, with V.sub.g following
SfiI cloning of the scFv encoding sequences into the phagemid
vector pComb3H. Selection of the resulting scFv libraries against
immobilized CD13 is performed.
[0274] The following primers are used for V.sub.k amplification
(F=forward primer, B=backward primer; sequences in 5' to 3'
direction; M=A/C, R=A/G, W=A/T, S.dbd.C/G, Y.dbd.C/T, K=G/T,
V=A/C/G, H=A/C/T, D=A/G/T, B=C/G/T, N=A/C/G/T):
TABLE-US-00007 RSCVK1-F (GGGCCCAGGCGGCCGAGCTCGTGMTGACCCAGACTCCA;
SEQ ID NO: 205); RSCVK2-F (GGGCCCAGGCGGCCGAGCTCGATMTGACCCAGACTCCA;
SEQ ID NO: 206); RSCVK3-F (GGGCCCAGGCGGCCGAGCTCGTGATGACCCAGACTGAA;
SEQ ID NO: 207); RKB9J0-B
(GGAAGATCTAGAGGAACCACCTTTGATTTCCACATTGGTGCC; SEQ ID NO: 208);
RKB9J10-B (GGAAGATCTAGAGGAACCACCTTTGATTTCCACATTGGTGCC; SEQ ID NO:
209); and RKB42J0-B (GGAAGATCTAGAGGAACCACCTTGACSACCACCTCGGTCCC; SEQ
ID NO: 210).
[0275] The following primers are used for V.sub.l
amplification:
TABLE-US-00008 RSC.lamda.1 (GGGCCCAGGCGGCCGAGCTC
GTGCTGACTCAGTCGCCCTC; SEQ ID NO: 211) and RJ.lamda.0-B
(GGAAGATCTAGAGGAACCACCGCCTGTGACGGTCAGCTGGGTCCC; SEQ ID NO:
212).
[0276] The following primers are used for V.sub.g
amplification:
TABLE-US-00009 RSCVH01 (GGTGGTTCCTCTAGATCTTCCCAGTCGGTGGAGGAGTCCRGG;
SEQ ID NO: 213); RSCVH02
(GGTGGTTCCTCTAGATCTTCCCAGTCGGTGAAGGAGTCCGAG; SEQ ID NO: 214);
RSCVH03 (GGTGGTTCCTCTAGATCTTCCCAGTCGYTGGAGGAGTCCGGG; SEQ ID NO:
215); RSCVH04 (GGTGGTTCCTCTAGATCTTCCCAGSAGCAGCTGRTGGAGTCCGG; SEQ ID
NO: 216); and RSCG-B
(CCTGGCCGGCCTGGCCACTAGTGACTGAYGGAGCCTTAGGTTGCCC; SEQ ID NO:
217).
[0277] The followings primers are used to prepare the scFv
fusion:
TABLE-US-00010 RSC-F (GAGGAGGAGGAGGAGGAGGCGGGGCCCAGGCGGCCGAGCTC;
SEQ ID NO: 218) and RSC-B
(GAGGAGGAGGAGGAGGAGCCTGGCCGGCCTGGCCACTAGTG; SEQ ID NO: 219).
Example XI
Selective Cytotoxicity of Doxorubicin-CNGRC conjugate administered
to CD13/APN-Positive Cells
[0278] An in vitro bioassay was developed to measure receptor
binding of CNGRC-doxorubicin (CNGRC-dox) (CNGRC; SEQ ID NO:8)
conjugates to cells. Endothelial cells activated with TNF.alpha.
were used. Alternatively, the test cells were transfected with
CD13/APN. This assay is based on the fact that, after a brief
incubation period, drug that has not bound to the cells can be
removed by washing. There is a quantifiable difference in the
cytotoxic effect of the doxorubicin conjugate compared to
doxorubicin alone or doxorubicin coupled to a control peptide after
washing, because the drug remains bound to the cells if the
receptor for the conjugated peptide is present.
[0279] This system was used with activated endothelial cells
because CD13 expression has been shown to be upregulated when
endothelial cells such as human umbilical vein endothelial cells
(HUVEC) are stimulated (see FIG. 7). It was observed that CD13 was
induced upon stimulation of endothelial cells with growth factors
such as bFGF, VEGF and TNF.alpha., known endothelial cell activator
cytokines.
[0280] Briefly, to study the upregulation of CD13 by angiogenic
factors, endothelial cells were cultured in different conditions,
as indicated in FIG. 7, and the cell surface was stained for CD13
with the anti-CD13 monoclonal antibody, WM15. The percentage of
CD13 expression was calculated based on the levels detected in
cells growing in normal tissue culture medium with 10% FCS.
[0281] In vitro cytotoxicity of doxorubicin and targeted
doxorubicin was evaluated using activated HUVECs (FIG. 8A) or CD-13
transfected 435-breast carcinoma cells (FIG. 8B). These cell lines
are sensitive to doxorubicin. Cell monolayers were incubated with
doxorubicin or a doxorubicin-peptide conjugate of RGD-4C
(CDCRGDCFC; SEQ ID NO:1), CNGRC (SEQ ID NO:8), or CARAC (SEQ ID
NO:221) at a concentration of 1 .mu.g/well for 20 minutes in two
sets of triplicates. One set of triplicates was washed three times
with DMEM to remove unbound drug 20 min after drug addition
(right). Untreated monolayers were used as controls. After 24
hours, attached cells were fixed and quantified by Crystal
Violet.
[0282] The CNGRC-doxorubicin conjugate was more effective on the
CD13-expressing cells than the control cells (see FIG. 8). These
results demonstrate that CNGRC-doxorubicin has CD13-dependent
cytotoxic activity in vitro and that the CNGRC (SEQ ID NO:8)
peptide can guide a toxic moiety such as doxorubicin to
CD13-positive cells.
Example XII
CD13 Expression 1N Mouse and Human Angiogenic Vasculature
[0283] These experiments demonstrate that CD13 is expressed in
angiogenic vasculature but is not detected in normal
vasculature.
[0284] As described above, NGR-containing phage injected
intravenously home to tumor vasculature, but not to normal vessels
in other tissues. To determine binding of CNGRC (SEQ ID NO:8) phage
to tissues using a different technique and to analyze human tissue,
immunohistochemical staining of CNGRC (SEQ ID NO:8) phage and Fd
control phage in tissue sections was performed. Phage displaying
the peptide CNGRC (SEQ ID NO:8) or control phage with no insert
were incubated with human breast carcinoma and normal breast
tissue. An antibody against M-13 phage (Pharmacia) was used for the
staining. The results indicated that the CNGRC-phage binds to human
tumor vessels in tissue sections, but not to normal vessels. A
phage with no insert (fd phage), used as a negative control, did
not bind to normal or to tumor tissue sections.
[0285] As shown in Table 4, CD13 was expressed in a number of tumor
cells and HUVECs. However, CD13 was not detected in the vasculature
of normal organs (Table 5). Thus, based on the analysis of CD13
expression in the vasculature in murine and human tissues, CD13 is
expressed in angiogenic vessels, but cannot be detected in normal
vessels.
TABLE-US-00011 TABLE 4 Expression of CD13/APN on cell lines
anti-CD13 monoclonals WM15 1H4 MDA-MB-435 - - (Breast carcinoma)
KS1767 ++++ +++ (Kaposi's sarcoma) C8161 ++++ ++++ (melanoma)
SKOV3-ip + + (ovarian carcinoma) HUVECs -/++/++++ -/+++
(endothelial cells) HDM-ZW +++++ ++++ (Hodgkin's lymphoma) Molt-4 -
- (T cell leukemia) HL-60 +++ +++ (acute myeloid leukemia)
[0286] Immunostainings were performed using two monoclonal
antibodies against CD13, WM15 and 1H4.
TABLE-US-00012 TABLE 5 Expression of CD13/APN in normal and tumor
vasculature Anti-CD13 monoclonals WM15 1H4 ab blood vessels in
normal organs brain - -/+ kidney - - skin - - liver - - lung - -
spleen - - intestine - - heart - - retina - - spinal cord +/- +/-
tumor vasculature* endothelial cells ++++ ++++ pericytes ++++ +++
*Human tumors tested: breast, colon, gastric, and esophageal
carcinomas. Analysis of normal mouse tissues and tumors (MDA-MB-435
and Kaposi's sarcoma) with anti-mouse anti-CD13 antibodies (R3-63
and 2M7) showed similar results.
[0287] Confocal microscopy was performed to study the cellular
localization of CD13 in tumor vasculature. Confocal microscopy was
used to detect immunofluorescent staining of CD13 in tumor vessels.
The images were obtained by superimposing the immunofluorescent and
differential interference contrast (DIC) images, to reveal tissue
morphology, or by direct immunofluorescence. Human breast carcinoma
tissue sections were incubated with an anti-CD13 antibody (WM15) or
control IgG A FITC-conjugated secondary antibody against mouse IgG
was used to reveal anti-CD13 localization. The negative control
omitted the primary antibodies. Human breast carcinoma serial
sections, gastric adenocarcinoma and colon carcinoma tissue
sections were stained with anti-CD13 antibody. An antibody against
APA, a known pericyte marker, was used for localization
purposes.
[0288] Autofluorescence of fixed red blood cells (RBC) was visible.
In tissue sections incubated with the anti-CD13 monoclonal
antibody, only endothelial cells on small tumor vessels showed
specific immunoreactivity. CD13 expression was confined to the
endothelial cells and pericytes in multiple tumor types including
breast, colorectal, and gastric carcinoma. Similar staining
patterns were obtained with the NGR phage. In each case, reactivity
could be detected in the vasculature of the tumors, but not in the
vasculature of normal tissues (see Table 5). As expected, APA was
not detected in endothelial cells but was present in pericytes
located in tumor blood vessels. These results demonstrate that CD13
is expressed in angiogenic vasculature but is not detected in
normal vasculature.
Example XIII
NGR Phage Home Preferentially to Tumor Vasculature Over Retinal
Neovasculature
[0289] These results demonstrate that NGR phage preferentially home
to tumor vasculature compared to retinal vasculature.
[0290] One experimental model of angiogenesis, oxygen-induced
angiogenesis, was used to evaluate the role of CD13 in angiogenesis
(Pierce et al., Proc. Natl. Acad. Sci. USA 92:905-909 (1995); Smith
et al., Invest. Opthalmol. Vis. Sci. 35:101-111 (1994), each of
which is incorporated herein by reference). NGR phage bound to
angiogenic retinal neovasculature induced by oxygen, giving results
similar to those obtained with RGD-4C (CDCRGDCFC; SEQ ID NO:1)
phage. CNGRC, RGD-4C (CDCRGDCFC; SEQ ID NO:1), and control fd phage
lacking an insert were recovered from breast carcinoma xenografts,
normal retina or angiogenic retina. Briefly, 10.sup.6 transducing
units (TU) of phage were injected into the tail vein of mice
bearing size-matched MDA-MB-435 derived tumors (.about.1000
mm.sup.3) or p17 mice that had been exposed to oxygen (Pierce et
al., supra, 1995; Smith et al., supra, 1994). The same number of
transducing units of an ampicillin control phage was co-injected in
order to assess specificity of the different tetracycline phage. In
each case, phage were recovered after perfusion. The ratios were
calculated using the mean number of phage recovered from the
tissues after triplicate plating on ampicillin selective and
tetracycline selective plates.
[0291] Mice that were not exposed to oxygen did not develop retinal
angiogenic vessels (control) and were also injected to evaluate
phage homing to normal retina. One-week-old C57BL/6J mice were
exposed to a 75% oxygen atmosphere for five days, and then kept in
room air for another five days (FIG. 9A). The proliferative
neovascular response was quantified by counting the nuclei of new
vessels extending from the retina into the vitreous in 6 .mu.m
cross-sections. This model was used to assess the binding of phage
injected intravenously to the newly formed angiogenic vessels. To
test phage homing in this system, phage displaying the RGD-4C
(CDCRGDCFC; SEQ ID NO:1) peptide (which binds selectively to
.alpha..sub.v integrins) or CNGRC-phage were injected intravenously
prior to immunohistochemical analysis. The .alpha..sub.v integrins
have been shown to be upregulated in these vessels. Phage staining
was seen with the RGD-4C (CDCRGDCFC; SEQ ID NO:1) and CNGRC phage
in the neovascular formations, whereas the normal vessels were
negative.
[0292] Side by side comparison of the RGD-4C (CDCRGDCFC; SEQ ID
NO:1) and the CNGRC-phage homing in angiogenic vasculature of
retina or tumors indicated that the two phage have opposite homing
preferences: more RGD-4C (CDCRGDCFC; SEQ ID NO:1) phage were
recovered from the retina than CNGRC-phage, whereas more
CNGRC-phage were recovered from tumors (FIG. 9B). The homing of
each phage also was inhibited by the appropriate cognate peptide,
and this inhibition was not observed with control phage (FIG. 9B).
These results indicate that expression of the NGR receptor can be
higher during tumor angiogenesis than in other types of
angiogenesis.
Example XIV
Role of CD13 in Angiogenesis
[0293] These experiments demonstrate that CD13 is functionally
important in angiogenesis.
[0294] Several experimental models involving cytokine-induced
angiogenesis (Brooks et al., Cell 79:1157-1164 (1994) and
tumor-induced angiogenesis (Folkman, supra (1995); Arap et al.,
supra (1998), each of which is incorporated herein by reference)
were used to evaluate the role of CD13 in angiogenesis.
[0295] A functional role for CD13 in angiogenesis was demonstrated
by using CD13 antagonists. Specifically, the CD13 inhibitor
bestatin, as well as monoclonal antibodies that block CD13
enzymatic activity, were tested in several angiogenesis assays.
These assays included cytokine-induced angiogenesis in the CAM,
oxygen-induced retinal neovascularization, and tumor-induced
angiogenesis.
[0296] Oxygen-induced angiogenesis in the retina was inhibited by
treating the animals with antagonists of CD13. Briefly, inhibition
of oxygen-induced retinal neovascularization was determined upon
injection of CD13 antagonists. One-week-old C57BL/6J mice were
exposed to a 75% oxygen atmosphere for five days, and then kept in
room air for one week. In the control mice, which were treated with
PBS or rat IgG, a proliferative neovascular response resulted and
was quantified as described above. Anti-mouse CD13 inhibitory
antibodies R3-63 and 2M7 (250 .mu.g/mouse/day) or bestatin (200
.mu.g/mouse/day) were injected intraperitoneally, and the
inhibitory effect determined. Animals treated with the CD13
antagonist antibodies and bestatin showed only 20-30% of the
angiogenic response observed in the mice treated with controls (IgG
and vehicle).
[0297] The CD13 antagonists also suppressed bFGF-induced
angiogenesis in the CAM. Briefly, angiogenesis was induced in CAMs
from 10-day chicken embryos by bFGF filters implanted onto regions
that were previously avascular. Various treatments were applied
topically, and, after 3 days, the filters and surrounding CAMs were
resected and fixed in formalin.
[0298] FIG. 10A shows the number of blood vessels entering the disk
within the focal plane of the CAM, counted under a stereomicroscope
by two observers in a double-blind fashion. Each bar represents the
mean number of vessels and standard errors from 8 CAMs on each
group. There were significantly fewer vessels entering the disks
treated with inhibitors of CD13 enzymatic activity (p<0.05).
These results also demonstrate that the inhibitory antibody used in
the anti-angiogenic treatments recognizes chicken CD13 and that
CD13 is expressed in CAM angiogenic vasculature.
[0299] The effects of anti-mouse CD13 agonists were also studied in
tumor-bearing mice. Mice bearing size-matched 435 breast carcinoma
tumors were divided in three groups (five mice per group).
Anti-mouse CD13 inhibitory antibodies R3-63 and 2M7 (500
.mu.g/mouse/day) or bestatin (200 .mu.g/mouse/day) were injected
intraperitoneally. In the control groups, mice were treated with
PBS or rat IgG. As shown in FIG. 10B, tumor growth was retarded in
comparison with the tumor growth seen in mice that received control
rat IgG or injections of vehicle only. Treatment with bestatin
produced similar results to those observed with the anti-CD13
antibodies (p<0.05).
[0300] These results indicate that CD13 is a new marker of tumor
vasculature that serves as a specific receptor for NGR ligands and
plays a functional role in angiogenesis.
Example XV
Tumor Therapy Using Doxorubicin/Tumor Homing NGR Peptide
Conjugates
[0301] This example describes in vivo tumor therapy with NGR
peptide conjugated to doxorubicin.
[0302] The drug conjugates made with RGD-4C (CDCRGDCFC; SEQ ID
NO:1) and CNGRC were found to be more effective and less toxic than
the free drug (Arap et al., supra (1998), which is incorporated
herein by reference). Similar results were observed when mice
bearing multiple tumor types were treated with the drug-conjugates.
Specifically, mice bearing MDA-MB-435-derived breast carcinomas and
Hodgkin's lymphoma were treated with doxorubicin-CNGRC peptide
conjugate as follows.
[0303] Briefly, mice with size-matched tumors (.about.1000
mm.sup.3) were randomized into four treatment groups (six animals
per group): vehicle only, free doxorubicin, doxorubicin-control
peptide, and doxorubicin-CNGRC (SEQ ID NO:8). Mice were treated at
5 .mu.g/mouse/week of doxorubicin-equivalent, and the difference in
tumor volumes between day 1 and day 28 determined (FIG. 11A). FIG.
11B shows a Kaplan-Meier survival curve of the mice in FIG.
11A.
[0304] To test toxicity of the CNGRC conjugate, mice bearing large
(.about.5000 mm.sup.3) MDA-MB-435 breast carcinomas (four animals
per group) were randomized to receive a single-dose of free
doxorubicin or doxorubicin-CNGRC conjugate at 200 .mu.g/mouse of
doxorubicin equivalent. The data are shown as a Kaplan-Meier
survival curve in FIG. 11C.
[0305] Mice bearing large (.about.5000 mm.sup.3) Hodgkin's lymphoma
(eight animals per group) were randomized to receive two doses of
free doxorubicin plus unconjugated CNGRC peptide or
doxorubicin-CNGRC (SEQ ID NO:8) conjugate at 40 .mu.g/mouse of
doxorubicin equivalent. The data are shown as a Kaplan-Meier
survival curve in FIG. 11D.
[0306] The experiments show the effect of doxorubicin-CNGRC
conjugate on mice bearing breast carcinomas (FIGS. 11A, 11B and
11C) (Arap et al., supra, 1998), and Hodgkin's lymphomas (FIG.
11D). Tumor-bearing mice treated with doxorubicin-CNGRC (SEQ ID
NO:8) lived longer than those treated with the unconjugated peptide
doxorubicin mixture or doxorubicin alone (FIGS. 11B, 11C and 11D)
(Arap et al., supra, 1998). Cures were also observed, which was not
seen with the control treatments. Similar results were obtained
when the doxorubicin-CNGRC (SEQ ID NO:8) conjugate was tested in
melanoma and Kaposi's sarcoma xenografts. Furthermore, the
targeting of the CNGRC-phage and the anti-tumor effect of the
doxorubicin-CNGRC (SEQ ID NO:8) conjugate in vivo was equally
efficient, whether or not the tumor cells expressed CD13/NGR
receptor as in the case of Hodgkin's lymphoma, C8161 melanoma, and
Kaposi's sarcoma or did not express CD13 as in MDA-MD-435 breast
carcinoma.
[0307] These results demonstrate that it is possible to target a
chemotherapeutic drug to angiogenic vasculature, a common feature
in all solid tumors, using an NGR tumor homing peptide that homes
to an NGR receptor.
[0308] Although the invention has been described with reference to
the disclosed examples, it should be understood that various
modifications can be made without departing from the spirit of the
invention. Accordingly, the invention is limited only by the
following claims.
Sequence CWU 1
1
22619PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 1Cys Asp Cys Arg Gly Asp Cys Phe Cys1
5213PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 2Cys Gly Arg Glu Cys Pro Arg Leu Cys Gln Ser Ser
Cys1 5 10313PRTArtificial SequenceDescription of Artificial
Sequence Synthetic Peptide 3Cys Asn Gly Arg Cys Val Ser Gly Cys Ala
Gly Arg Cys1 5 1048PRTArtificial SequenceDescription of Artificial
Sequence Synthetic Peptide 4Cys Leu Ser Gly Ser Leu Ser Cys1
557PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 5Cys Gly Ser Leu Val Arg Cys1 566PRTArtificial
SequenceDescription of Artificial Sequence Synthetic Peptide 6Asn
Gly Arg Ala His Ala1 579PRTArtificial SequenceDescription of
Artificial Sequence Synthetic Peptide 7Cys Val Leu Asn Gly Arg Met
Glu Cys1 585PRTArtificial SequenceDescription of Artificial
Sequence Synthetic Peptide 8Cys Asn Gly Arg Cys1 597PRTArtificial
SequenceDescription of Artificial Sequence Synthetic Peptide 9Cys
Xaa Xaa Xaa Xaa Xaa Cys1 5108PRTArtificial SequenceDescription of
Artificial Sequence Synthetic Peptide 10Cys Xaa Xaa Xaa Xaa Xaa Xaa
Cys1 5119PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 11Cys Xaa Xaa Xaa Xaa Xaa Xaa Xaa Cys1
51213PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 12Cys Xaa Xaa Xaa Cys Xaa Xaa Xaa Cys Xaa Xaa Xaa
Cys1 5 10139PRTArtificial SequenceDescription of Artificial
Sequence Synthetic Peptide 13Cys Xaa Xaa Xaa Asn Gly Arg Xaa Xaa1
5149PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 14Cys Xaa Xaa Cys Asn Gly Arg Cys Xaa1
51512PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 15Cys Asn Lys Thr Asp Gly Asp Glu Gly Val Thr
Cys1 5 101611PRTArtificial SequenceDescription of Artificial
Sequence Synthetic Peptide 16Ala Cys Asp Cys Arg Gly Asp Cys Phe
Cys Gly1 5 10176PRTArtificial SequenceDescription of Artificial
Sequence Synthetic Peptide 17Gly Arg Gly Glu Ser Pro1
5186PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 18Trp Gly Thr Gly Leu Cys1 51913PRTArtificial
SequenceDescription of Artificial Sequence Synthetic Peptide 19Gly
Ala Cys Val Phe Ser Ile Ala His Glu Cys Gly Ala1 5
102013PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 20Cys Gly Glu Ala Cys Gly Gly Gln Cys Ala Leu Pro
Cys1 5 10219PRTArtificial SequenceDescription of Artificial
Sequence Synthetic Peptide 21Ile Trp Ser Gly Tyr Gly Val Tyr Trp1
5229PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 22Pro Ser Cys Ala Tyr Met Cys Ile Thr1
5239PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 23Trp Glu Ser Leu Tyr Phe Pro Arg Glu1
5249PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 24Ser Lys Val Leu Tyr Tyr Asn Trp Glu1
52513PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 25Cys Gly Leu Met Cys Gln Gly Ala Cys Phe Asp Val
Cys1 5 102613PRTArtificial SequenceDescription of Artificial
Sequence Synthetic Peptide 26Cys Glu Arg Ala Cys Arg Asn Leu Cys
Arg Glu Gly Cys1 5 102713PRTArtificial SequenceDescription of
Artificial Sequence Synthetic Peptide 27Cys Pro Arg Gly Cys Leu Ala
Val Cys Val Ser Gln Cys1 5 102810PRTArtificial SequenceDescription
of Artificial Sequence Synthetic Peptide 28Cys Lys Val Cys Asn Gly
Arg Cys Cys Gly1 5 102910PRTArtificial SequenceDescription of
Artificial Sequence Synthetic Peptide 29Cys Glu Met Cys Asn Gly Arg
Cys Met Gly1 5 103010PRTArtificial SequenceDescription of
Artificial Sequence Synthetic Peptide 30Cys Pro Leu Cys Asn Gly Arg
Cys Ala Leu1 5 103110PRTArtificial SequenceDescription of
Artificial Sequence Synthetic Peptide 31Cys Pro Thr Cys Asn Gly Arg
Cys Val Arg1 5 103210PRTArtificial SequenceDescription of
Artificial Sequence Synthetic Peptide 32Cys Gly Val Cys Asn Gly Arg
Cys Gly Leu1 5 103310PRTArtificial SequenceDescription of
Artificial Sequence Synthetic Peptide 33Cys Glu Gln Cys Asn Gly Arg
Cys Gly Gln1 5 103410PRTArtificial SequenceDescription of
Artificial Sequence Synthetic Peptide 34Cys Arg Asn Cys Asn Gly Arg
Cys Glu Gly1 5 103510PRTArtificial SequenceDescription of
Artificial Sequence Synthetic Peptide 35Cys Val Leu Cys Asn Gly Arg
Cys Trp Ser1 5 103610PRTArtificial SequenceDescription of
Artificial Sequence Synthetic Peptide 36Cys Val Thr Cys Asn Gly Arg
Cys Arg Val1 5 103710PRTArtificial SequenceDescription of
Artificial Sequence Synthetic Peptide 37Cys Thr Glu Cys Asn Gly Arg
Cys Gln Leu1 5 103810PRTArtificial SequenceDescription of
Artificial Sequence Synthetic Peptide 38Cys Arg Thr Cys Asn Gly Arg
Cys Leu Glu1 5 103910PRTArtificial SequenceDescription of
Artificial Sequence Synthetic Peptide 39Cys Glu Thr Cys Asn Gly Arg
Cys Val Gly1 5 104010PRTArtificial SequenceDescription of
Artificial Sequence Synthetic Peptide 40Cys Ala Val Cys Asn Gly Arg
Cys Gly Phe1 5 104110PRTArtificial SequenceDescription of
Artificial Sequence Synthetic Peptide 41Cys Arg Asp Leu Asn Gly Arg
Lys Val Met1 5 104210PRTArtificial SequenceDescription of
Artificial Sequence Synthetic Peptide 42Cys Ser Cys Cys Asn Gly Arg
Cys Gly Asp1 5 104310PRTArtificial SequenceDescription of
Artificial Sequence Synthetic Peptide 43Cys Trp Gly Cys Asn Gly Arg
Cys Arg Met1 5 104410PRTArtificial SequenceDescription of
Artificial Sequence Synthetic Peptide 44Cys Pro Leu Cys Asn Gly Arg
Cys Ala Arg1 5 104510PRTArtificial SequenceDescription of
Artificial Sequence Synthetic Peptide 45Cys Lys Ser Cys Asn Gly Arg
Cys Leu Ala1 5 104610PRTArtificial SequenceDescription of
Artificial Sequence Synthetic Peptide 46Cys Val Pro Cys Asn Gly Arg
Cys His Glu1 5 104710PRTArtificial SequenceDescription of
Artificial Sequence Synthetic Peptide 47Cys Gln Ser Cys Asn Gly Arg
Cys Val Arg1 5 104810PRTArtificial SequenceDescription of
Artificial Sequence Synthetic Peptide 48Cys Arg Thr Cys Asn Gly Arg
Cys Gln Val1 5 104910PRTArtificial SequenceDescription of
Artificial Sequence Synthetic Peptide 49Cys Val Gln Cys Asn Gly Arg
Cys Ala Leu1 5 105010PRTArtificial SequenceDescription of
Artificial Sequence Synthetic Peptide 50Cys Arg Cys Cys Asn Gly Arg
Cys Ser Pro1 5 105110PRTArtificial SequenceDescription of
Artificial Sequence Synthetic Peptide 51Cys Ala Ser Asn Asn Gly Arg
Val Val Leu1 5 105210PRTArtificial SequenceDescription of
Artificial Sequence Synthetic Peptide 52Cys Gly Arg Cys Asn Gly Arg
Cys Leu Leu1 5 105310PRTArtificial SequenceDescription of
Artificial Sequence Synthetic Peptide 53Cys Trp Leu Cys Asn Gly Arg
Cys Gly Arg1 5 105410PRTArtificial SequenceDescription of
Artificial Sequence Synthetic Peptide 54Cys Ser Lys Cys Asn Gly Arg
Cys Gly His1 5 105510PRTArtificial SequenceDescription of
Artificial Sequence Synthetic Peptide 55Cys Val Trp Cys Asn Gly Arg
Cys Gly Leu1 5 105610PRTArtificial SequenceDescription of
Artificial Sequence Synthetic Peptide 56Cys Ile Arg Cys Asn Gly Arg
Cys Ser Val1 5 105710PRTArtificial SequenceDescription of
Artificial Sequence Synthetic Peptide 57Cys Gly Glu Cys Asn Gly Arg
Cys Val Glu1 5 105810PRTArtificial SequenceDescription of
Artificial Sequence Synthetic Peptide 58Cys Glu Gly Val Asn Gly Arg
Arg Leu Arg1 5 105910PRTArtificial SequenceDescription of
Artificial Sequence Synthetic Peptide 59Cys Leu Ser Cys Asn Gly Arg
Cys Pro Ser1 5 106010PRTArtificial SequenceDescription of
Artificial Sequence Synthetic Peptide 60Cys Glu Val Cys Asn Gly Arg
Cys Ala Leu1 5 10617PRTArtificial SequenceDescription of Artificial
Sequence Synthetic Peptide 61Gly Arg Ser Gln Met Gln Ile1
5627PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 62His His Thr Arg Phe Val Ser1 5637PRTArtificial
SequenceDescription of Artificial Sequence Synthetic Peptide 63Ser
Lys Gly Leu Arg His Arg1 5647PRTArtificial SequenceDescription of
Artificial Sequence Synthetic Peptide 64Val Ala Ser Val Ser Val
Ala1 5657PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 65Trp Arg Val Leu Ala Ala Phe1 5667PRTArtificial
SequenceDescription of Artificial Sequence Synthetic Peptide 66Lys
Met Gly Pro Lys Val Trp1 5677PRTArtificial SequenceDescription of
Artificial Sequence Synthetic Peptide 67Ile Phe Ser Gly Ser Arg
Glu1 5687PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 68Ser Pro Gly Ser Trp Thr Trp1 5697PRTArtificial
SequenceDescription of Artificial Sequence Synthetic Peptide 69Asn
Pro Arg Trp Phe Trp Asp1 5707PRTArtificial SequenceDescription of
Artificial Sequence Synthetic Peptide 70Gly Arg Trp Tyr Lys Trp
Ala1 5717PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 71Ile Lys Ala Arg Ala Ser Pro1 5727PRTArtificial
SequenceDescription of Artificial Sequence Synthetic Peptide 72Ser
Gly Trp Cys Tyr Arg Cys1 5737PRTArtificial SequenceDescription of
Artificial Sequence Synthetic Peptide 73Ala Leu Val Gly Leu Met
Arg1 5747PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 74Leu Trp Ala Glu Met Thr Gly1 5757PRTArtificial
SequenceDescription of Artificial Sequence Synthetic Peptide 75Cys
Trp Ser Gly Val Asp Cys1 5767PRTArtificial SequenceDescription of
Artificial Sequence Synthetic Peptide 76Asp Thr Leu Arg Leu Arg
Ile1 5777PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 77Ser Lys Ser Ser Gly Val Ser1 5787PRTArtificial
SequenceDescription of Artificial Sequence Synthetic Peptide 78Ile
Val Ala Asp Tyr Gln Arg1 5797PRTArtificial SequenceDescription of
Artificial Sequence Synthetic Peptide 79Val Trp Arg Thr Gly His
Leu1 5807PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 80Val Val Asp Arg Phe Pro Asp1 5817PRTArtificial
SequenceDescription of Artificial Sequence Synthetic Peptide 81Leu
Ser Met Phe Thr Arg Pro1 5827PRTArtificial SequenceDescription of
Artificial Sequence Synthetic Peptide 82Gly Leu Pro Val Lys Trp
Ser1 5837PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 83Ile Met Tyr Pro Gly Trp Leu1 5849PRTArtificial
SequenceDescription of Artificial Sequence Synthetic Peptide 84Cys
Val Met Val Arg Asp Gly Asp Cys1 5857PRTArtificial
SequenceDescription of Artificial Sequence Synthetic Peptide 85Cys
Val Arg Ile Arg Pro Cys1 5867PRTArtificial SequenceDescription of
Artificial Sequence Synthetic Peptide 86Cys Gln Leu Ala Ala Val
Cys1 5877PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 87Cys Gly Val Gly Ser Ser Cys1 5887PRTArtificial
SequenceDescription of Artificial Sequence Synthetic Peptide 88Cys
Val Ser Gly Pro Arg Cys1 5897PRTArtificial SequenceDescription of
Artificial Sequence Synthetic Peptide 89Cys Gly Leu Ser Asp Ser
Cys1 5907PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 90Cys Gly Glu Gly His Pro Cys1 5917PRTArtificial
SequenceDescription of Artificial Sequence Synthetic Peptide 91Cys
Tyr Thr Ala Asp Pro Cys1 5929PRTArtificial SequenceDescription of
Artificial Sequence Synthetic Peptide 92Cys Glu Leu Ser Leu Ile Ser
Lys Cys1 5939PRTArtificial SequenceDescription of Artificial
Sequence Synthetic Peptide 93Cys Pro Glu His Arg Ser Leu Val Cys1
5949PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 94Cys Leu Val Val His Glu Ala Ala Cys1
5957PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 95Cys Tyr Val Glu Leu His Cys1 5967PRTArtificial
SequenceDescription of Artificial Sequence Synthetic Peptide 96Cys
Trp Arg Lys Phe Tyr Cys1 5977PRTArtificial SequenceDescription of
Artificial Sequence Synthetic Peptide 97Cys Phe Trp Pro Asn Arg
Cys1 5988PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 98Cys Tyr Ser Tyr Phe Leu Ala Cys1
5997PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 99Cys Pro Arg Gly Ser Arg Cys1 51007PRTArtificial
SequenceDescription of Artificial Sequence Synthetic Peptide 100Cys
Arg Leu Gly Ile Ala Cys1 51017PRTArtificial SequenceDescription of
Artificial Sequence Synthetic Peptide 101Cys Asp Asp Ser Trp Lys
Cys1 51029PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 102Cys Ala Gln Leu Leu Gln Val Ser Cys1
51037PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 103Cys Tyr Pro Ala Asp Pro Cys1
51048PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 104Cys Lys Ala Leu Ser Gln Ala Cys1
51057PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 105Cys Thr Asp Tyr Val Arg Cys1
51067PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 106Cys Gly Glu Thr Met Arg Cys1
51079PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 107Gly Ile Cys Lys Asp Asp Trp Cys Gln1
51089PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 108Thr Ser Cys Asp Pro Ser Leu Cys Glu1
51099PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 109Lys Gly Cys Gly Thr Arg Gln Cys Trp1
51109PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 110Tyr Arg Cys Arg Glu Val Leu Cys Gln1
51117PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 111Cys Trp Gly Thr Gly Leu Cys1
51129PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 112Trp Ser Cys Ala Asp Arg Thr Cys Met1
51139PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 113Ala Gly Cys Arg Leu Lys Ser Cys Ala1
51149PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 114Ser Arg Cys Lys Thr Gly Leu Cys Gln1
51159PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 115Pro Ile Cys Glu Val Ser Arg Cys Trp1
51169PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 116Trp Thr Cys Arg Ala Ser Trp Cys Ser1
51179PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 117Gly Arg Cys Leu Leu Met Gln Cys Arg1
51189PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 118Thr Glu Cys Asp Met Ser Arg Cys Met1
51199PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 119Ala
Arg Cys Arg Val Asp Pro Cys Val1 51209PRTArtificial
SequenceDescription of Artificial Sequence Synthetic Peptide 120Cys
Ile Glu Gly Val Leu Gly Gly Cys1 51217PRTArtificial
SequenceDescription of Artificial Sequence Synthetic Peptide 121Cys
Ser Val Ala Asn Ser Cys1 51227PRTArtificial SequenceDescription of
Artificial Sequence Synthetic Peptide 122Cys Ser Ser Thr Met Arg
Cys1 51237PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 123Ser Ile Asp Ser Thr Thr Phe1
51247PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 124Gly Pro Ser Arg Val Gly Gly1
51257PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 125Trp Trp Ser Gly Leu Glu Ala1
51267PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 126Leu Gly Thr Asp Val Arg Gln1
51277PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 127Leu Val Gly Val Arg Leu Leu1
51287PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 128Gly Arg Pro Gly Asp Ile Trp1
51297PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 129Thr Val Trp Asn Pro Val Gly1
51307PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 130Gly Leu Leu Leu Val Val Pro1
51317PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 131Phe Ala Ala Thr Ser Ala Glu1
51327PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 132Trp Cys Cys Arg Gln Phe Asn1
51337PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 133Val Gly Phe Gly Lys Ala Leu1
51347PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 134Asp Ser Ser Leu Arg Leu Pro1
51357PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 135Lys Leu Trp Cys Ala Met Ser1
51367PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 136Ser Leu Val Ser Phe Leu Gly1
51377PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 137Gly Ser Phe Ala Phe Leu Val1
51387PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 138Ile Ala Ser Val Arg Trp Ala1
51397PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 139Thr Trp Gly His Leu Arg Ala1
51407PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 140Gln Tyr Arg Glu Gly Leu Val1
51417PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 141Gln Ser Ala Asp Arg Ser Val1
51427PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 142Tyr Met Phe Trp Thr Ser Arg1
51437PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 143Leu Val Arg Arg Trp Tyr Leu1
51447PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 144Thr Ala Arg Gly Ser Ser Arg1
51457PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 145Thr Thr Arg Glu Lys Asn Leu1
51467PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 146Pro Lys Trp Leu Leu Phe Ser1
51477PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 147Leu Arg Thr Asn Val Val His1
51487PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 148Ala Val Met Gly Leu Ala Ala1
51497PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 149Val Arg Asn Ser Leu Arg Asn1
51509PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 150Thr Asp Cys Thr Pro Ser Arg Cys Thr1
51519PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 151Ser Trp Cys Gln Phe Glu Lys Cys Leu1
51529PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 152Val Pro Cys Arg Phe Lys Gln Cys Trp1
51539PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 153Cys Thr Ala Met Arg Asn Thr Asp Cys1
51548PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 154Cys Arg Glu Ser Leu Lys Asn Cys1
51558PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 155Cys Met Glu Met Gly Val Lys Cys1
51569PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 156Val Thr Cys Arg Ser Leu Met Cys Gln1
51578PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 157Cys Asn Asn Val Gly Ser Tyr Cys1
51588PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 158Cys Gly Thr Arg Val Asp His Cys1
51598PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 159Cys Ile Ser Leu Asp Arg Ser Cys1
51608PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 160Cys Ala Met Val Ser Met Glu Asp1
51618PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 161Cys Tyr Leu Gly Val Ser Asn Cys1
51628PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 162Cys Tyr Leu Val Asn Val Asp Cys1
51638PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 163Cys Ile Arg Ser Ala Val Ser Cys1
51649PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 164Leu Val Cys Leu Pro Pro Ser Cys Glu1
51659PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 165Arg His Cys Phe Ser Gln Trp Cys Ser1
51669PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 166Phe Tyr Cys Pro Gly Val Gly Cys Arg1
51679PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 167Ile Ser Cys Ala Val Asp Ala Cys Leu1
51689PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 168Glu Ala Cys Glu Met Ala Gly Cys Leu1
51699PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 169Pro Arg Cys Glu Ser Gln Leu Cys Pro1
51709PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 170Arg Ser Cys Ile Lys His Gln Cys Pro1
51719PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 171Gln Trp Cys Ser Arg Arg Trp Cys Thr1
51729PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 172Met Phe Cys Arg Met Arg Ser Cys Asp1
51739PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 173Gly Ile Cys Lys Asp Leu Trp Cys Gln1
51749PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 174Asn Ala Cys Glu Ser Ala Ile Cys Gly1
51759PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 175Ala Pro Cys Gly Leu Leu Ala Cys Ile1
51769PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 176Asn Arg Cys Arg Gly Val Ser Cys Thr1
51779PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 177Phe Pro Cys Glu Gly Lys Lys Cys Leu1
51789PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 178Ala Asp Cys Arg Gln Lys Pro Cys Leu1
51799PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 179Phe Gly Cys Val Met Ala Ser Cys Arg1
51809PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 180Ala Gly Cys Ile Asn Gly Leu Cys Gly1
51819PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 181Arg Ser Cys Ala Glu Pro Trp Cys Tyr1
51829PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 182Asp Thr Cys Arg Ala Leu Arg Cys Asn1
51839PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 183Gly Arg Cys Val Asp Gly Gly Cys Thr1
51849PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 184Tyr Arg Cys Ile Ala Arg Glu Cys Glu1
51859PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 185Lys Arg Cys Ser Ser Ser Leu Cys Ala1
51868PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 186Ile Cys Leu Leu Ala His Cys Ala1
51879PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 187Gln Ala Cys Pro Met Leu Leu Cys Met1
51889PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 188Leu Asp Cys Leu Ser Glu Leu Cys Ser1
51898PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 189Ala Gly Cys Arg Val Glu Ser Cys1
51909PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 190His Thr Cys Leu Val Ala Leu Cys Ala1
51919PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 191Ile Tyr Cys Pro Gly Gln Glu Cys Glu1
51929PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 192Arg Leu Cys Ser Leu Tyr Gly Cys Val1
51939PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 193Arg Lys Cys Glu Val Pro Gly Cys Gln1
51949PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 194Glu Asp Cys Thr Ser Arg Phe Cys Ser1
51959PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 195Leu Glu Cys Val Val Asp Ser Cys Arg1
51969PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 196Glu Ile Cys Val Asp Gly Leu Cys Val1
51979PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 197Arg Trp Cys Arg Glu Lys Ser Cys Trp1
51989PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 198Phe Arg Cys Leu Glu Arg Val Cys Thr1
51999PRTArtificial SequenceDescription of Artificial Sequence
Synthetic Peptide 199Arg Pro Cys Gly Asp Gln Ala Cys Glu1
52003494DNAHomo sapiensCDS(121)..(3024) 200taatttttgc ccagtctgcc
tgttgtgggg ctcctcccct ttggggatat aagcccggcc 60tggggctgct ccgttctctg
cctggcctga ggctccctga gccgcctccc caccatcacc 120atg gcc aag ggc ttc
tat att tcc aag tcc ctg ggc atc ctg ggg atc 168Met Ala Lys Gly Phe
Tyr Ile Ser Lys Ser Leu Gly Ile Leu Gly Ile1 5 10 15ctc ctg ggc gtg
gca gcc gtg tgc aca atc atc gca ctg tca gtg gtg 216Leu Leu Gly Val
Ala Ala Val Cys Thr Ile Ile Ala Leu Ser Val Val 20 25 30tac tcc cag
gag aag aac aag aac gcc aac agc tcc ccc gtg gcc tcc 264Tyr Ser Gln
Glu Lys Asn Lys Asn Ala Asn Ser Ser Pro Val Ala Ser 35 40 45acc acc
ccg tcc gcc tca gcc acc acc aac ccc gcc tcg gcc acc acc 312Thr Thr
Pro Ser Ala Ser Ala Thr Thr Asn Pro Ala Ser Ala Thr Thr 50 55 60ttg
gac caa agt aaa gcg tgg aat cgt tac cgc ctc ccc aac acg ctg 360Leu
Asp Gln Ser Lys Ala Trp Asn Arg Tyr Arg Leu Pro Asn Thr Leu65 70 75
80aaa ccc gat tcc tac cag gtg acg ctg aga ccg tac ctc acc ccc aat
408Lys Pro Asp Ser Tyr Gln Val Thr Leu Arg Pro Tyr Leu Thr Pro Asn
85 90 95gac agg ggc ctg tac gtt ttt aag ggc tcc agc acc gtc cgt ttc
acc 456Asp Arg Gly Leu Tyr Val Phe Lys Gly Ser Ser Thr Val Arg Phe
Thr 100 105 110tgc aag gag gcc act gac gtc atc atc atc cac agc aag
aag ctc aac 504Cys Lys Glu Ala Thr Asp Val Ile Ile Ile His Ser Lys
Lys Leu Asn 115 120 125tac acc ctc agc cag ggg cac agg gtg gtc ctg
cgt ggt gtg gga ggc 552Tyr Thr Leu Ser Gln Gly His Arg Val Val Leu
Arg Gly Val Gly Gly 130 135 140tcc cag ccc ccc gac att gac aag act
gag ctg gtg gag ccc acc gag 600Ser Gln Pro Pro Asp Ile Asp Lys Thr
Glu Leu Val Glu Pro Thr Glu145 150 155 160tac ctg gtg gtg cac ctc
aag ggc tcc ctg gtg aag gac agc cag tat 648Tyr Leu Val Val His Leu
Lys Gly Ser Leu Val Lys Asp Ser Gln Tyr 165 170 175gag atg gac agc
gag ttc gag ggg gag ttg gca gat gac ctg gcg ggc 696Glu Met Asp Ser
Glu Phe Glu Gly Glu Leu Ala Asp Asp Leu Ala Gly 180 185 190ttc tac
cgc agc gag tac atg gag ggc aat gtc aga aag gtg gtg gcc 744Phe Tyr
Arg Ser Glu Tyr Met Glu Gly Asn Val Arg Lys Val Val Ala 195 200
205act aca cag atg cag gct gca gat gcc cgg aag tcc ttc cca tgc ttc
792Thr Thr Gln Met Gln Ala Ala Asp Ala Arg Lys Ser Phe Pro Cys Phe
210 215 220gat gag ccg gcc atg aag gcc gag ttc aac atc acg ctt atc
cac ccc 840Asp Glu Pro Ala Met Lys Ala Glu Phe Asn Ile Thr Leu Ile
His Pro225 230 235 240aag gac ctg aca gcc ctg tcc aac atg ctt ccc
aaa ggt ccc agc acc 888Lys Asp Leu Thr Ala Leu Ser Asn Met Leu Pro
Lys Gly Pro Ser Thr 245 250 255cca ctt cca gaa gac ccc aac tgg aat
gtc act gag ttc cac acc acg 936Pro Leu Pro Glu Asp Pro Asn Trp Asn
Val Thr Glu Phe His Thr Thr 260 265 270ccc aag atg tcc acg tac ttg
ctg gcc ttc att gtc agt gag ttc gac 984Pro Lys Met Ser Thr Tyr Leu
Leu Ala Phe Ile Val Ser Glu Phe Asp 275 280 285tac gtg gag aag cag
gca tcc aat ggt gtc ttg atc cgg atc tgg gcc 1032Tyr Val Glu Lys Gln
Ala Ser Asn Gly Val Leu Ile Arg Ile Trp Ala 290 295 300cgg ccc agt
gcc att gcg gcg ggc cac ggc gat tat gcc ctg aac gtg 1080Arg Pro Ser
Ala Ile Ala Ala Gly His Gly Asp Tyr Ala Leu Asn Val305 310 315
320acg ggc ccc atc ctt aac ttc ttt gct ggt cat tat gac aca ccc tac
1128Thr Gly Pro Ile Leu Asn Phe Phe Ala Gly His Tyr Asp Thr Pro Tyr
325 330 335cca ctc cca aaa tca gac cag att ggc ctg cca gac ttc aac
gcc ggc 1176Pro Leu Pro Lys Ser Asp Gln Ile Gly Leu Pro Asp Phe Asn
Ala Gly 340 345 350gcc atg gag aac tgg gga ctg gtg acc tac cgg gag
aac tcc ctg ctg 1224Ala Met Glu Asn Trp Gly Leu Val Thr Tyr Arg Glu
Asn Ser Leu Leu 355 360 365ttc gac ccc ctg tcc tcc tcc agc agc aac
aag gag cgg gtg gtc act 1272Phe Asp Pro Leu Ser Ser Ser Ser Ser Asn
Lys Glu Arg Val Val Thr 370 375 380gtg att gct cat gag ctg gcc cac
cag tgg ttc ggg aac ctg gtg acc 1320Val Ile Ala His Glu Leu Ala His
Gln Trp Phe Gly Asn Leu Val Thr385 390 395 400ata gag tgg tgg aat
gac ctg tgg ctg aac gag ggc ttc gcc tcc tac 1368Ile Glu Trp Trp Asn
Asp Leu Trp Leu Asn Glu Gly Phe Ala Ser Tyr 405 410 415gtg gag tac
ctg ggt gct gac tat gcg gag ccc acc tgg aac ttg aaa 1416Val Glu Tyr
Leu Gly Ala Asp Tyr Ala Glu Pro Thr Trp Asn Leu Lys 420 425 430gac
ctc atg gtg ctg aat gat gtg tac cgc gtg atg gca gtg gat gca 1464Asp
Leu Met Val Leu Asn Asp Val Tyr Arg Val Met Ala Val Asp Ala 435 440
445ctg gcc tcc tcc cac ccg ctg tcc aca ccc gcc tcg gag atc aac acg
1512Leu Ala Ser Ser His Pro Leu Ser Thr Pro Ala Ser Glu Ile Asn Thr
450 455 460ccg gcc cag atc agt gag ctg ttt gac gcc atc tcc tac agc
aag ggc 1560Pro Ala Gln Ile Ser Glu Leu Phe Asp Ala Ile Ser Tyr Ser
Lys Gly465 470 475 480gcc tca gtc ctc agg atg ctc tcc agc ttc ctg
tcc gag gac gta ttc 1608Ala Ser Val Leu Arg Met Leu Ser Ser Phe Leu
Ser Glu Asp Val Phe 485 490 495aag cag ggc ctg gcg tcc tac ctc cac
acc ttt gcc tac cag aac acc 1656Lys Gln Gly Leu Ala Ser Tyr Leu His
Thr Phe Ala Tyr Gln Asn Thr 500 505 510atc tac ctg aac ctg tgg gac
cac ctg cag gag gct gtg aac aac cgg 1704Ile Tyr Leu Asn Leu Trp Asp
His Leu Gln Glu Ala Val Asn Asn Arg 515 520 525tcc atc caa ctc ccc
acc acc gtg cgg gac atc atg aac cgc tgg acc 1752Ser Ile Gln Leu Pro
Thr Thr Val Arg Asp Ile Met Asn Arg
Trp Thr 530 535 540ctg cag atg ggc ttc ccg gtc atc acg gtg gat acc
agc acg ggg acc 1800Leu Gln Met Gly Phe Pro Val Ile Thr Val Asp Thr
Ser Thr Gly Thr545 550 555 560ctt tcc cag gag cac ttc ctc ctt gac
ccc gat tcc aat gtt acc cgc 1848Leu Ser Gln Glu His Phe Leu Leu Asp
Pro Asp Ser Asn Val Thr Arg 565 570 575ccc tca gaa ttc aac tac gtg
tgg att gtg ccc atc aca tcc atc aga 1896Pro Ser Glu Phe Asn Tyr Val
Trp Ile Val Pro Ile Thr Ser Ile Arg 580 585 590gat ggc aga cag cag
cag gac tac tgg ctg ata gat gta aga gcc cag 1944Asp Gly Arg Gln Gln
Gln Asp Tyr Trp Leu Ile Asp Val Arg Ala Gln 595 600 605aac gat ctc
ttc agc aca tca ggc aat gag tgg gtc ctg ctg aac ctc 1992Asn Asp Leu
Phe Ser Thr Ser Gly Asn Glu Trp Val Leu Leu Asn Leu 610 615 620aat
gtg acg ggc tat tac cgg gtg aac tac gac gaa gag aac tgg agg 2040Asn
Val Thr Gly Tyr Tyr Arg Val Asn Tyr Asp Glu Glu Asn Trp Arg625 630
635 640aag att cag act cag ctg cag aga gac cac tcg gcc atc cct gtc
atc 2088Lys Ile Gln Thr Gln Leu Gln Arg Asp His Ser Ala Ile Pro Val
Ile 645 650 655aat cgg gca cag atc att aat gac gcc ttc aac ctg gcc
agt gcc cat 2136Asn Arg Ala Gln Ile Ile Asn Asp Ala Phe Asn Leu Ala
Ser Ala His 660 665 670aag gtc cct gtc act ctg gcg ctg aac aac acc
ctc ttc ctg att gaa 2184Lys Val Pro Val Thr Leu Ala Leu Asn Asn Thr
Leu Phe Leu Ile Glu 675 680 685gag aga cag tac atg ccc tgg gag gcc
gcc ctg agc agc ctg agc tac 2232Glu Arg Gln Tyr Met Pro Trp Glu Ala
Ala Leu Ser Ser Leu Ser Tyr 690 695 700ttc aag ctc atg ttt gac cgc
tcc gag gtc tat ggc ccc atg aag aac 2280Phe Lys Leu Met Phe Asp Arg
Ser Glu Val Tyr Gly Pro Met Lys Asn705 710 715 720tac ctg aag aag
cag gtc aca ccc ctc ttc att cac ttc aga aat aat 2328Tyr Leu Lys Lys
Gln Val Thr Pro Leu Phe Ile His Phe Arg Asn Asn 725 730 735acc aac
aac tgg agg gag atc cca gaa aac ctg atg gac cag tac agc 2376Thr Asn
Asn Trp Arg Glu Ile Pro Glu Asn Leu Met Asp Gln Tyr Ser 740 745
750gag gtt aat gcc atc agc acc gcc tgc tcc aac gga gtt cca gag tgt
2424Glu Val Asn Ala Ile Ser Thr Ala Cys Ser Asn Gly Val Pro Glu Cys
755 760 765gag gag atg gtc tct ggc ctt ttc aag cag tgg atg gag aac
ccc aat 2472Glu Glu Met Val Ser Gly Leu Phe Lys Gln Trp Met Glu Asn
Pro Asn 770 775 780aat aac ccg atc cac ccc aac ctg cgg tcc acc gtc
tac tgc aac gct 2520Asn Asn Pro Ile His Pro Asn Leu Arg Ser Thr Val
Tyr Cys Asn Ala785 790 795 800atc gcc cag ggc ggg gag gag gag tgg
gac ttc gcc tgg gag cag ttc 2568Ile Ala Gln Gly Gly Glu Glu Glu Trp
Asp Phe Ala Trp Glu Gln Phe 805 810 815cga aat gcc aca ctg gtc aat
gag gct gac aag ctc cgg gca gcc ctg 2616Arg Asn Ala Thr Leu Val Asn
Glu Ala Asp Lys Leu Arg Ala Ala Leu 820 825 830gcc tgc agc aaa gag
ttg tgg atc ctg aac agg tac ctg agc tac acc 2664Ala Cys Ser Lys Glu
Leu Trp Ile Leu Asn Arg Tyr Leu Ser Tyr Thr 835 840 845ctg aac ccg
gac tta atc cgg aag cag gac gcc acc tct acc atc atc 2712Leu Asn Pro
Asp Leu Ile Arg Lys Gln Asp Ala Thr Ser Thr Ile Ile 850 855 860agc
att acc aac aac gtc att ggg caa ggt ctg gtc tgg gac ttt gtc 2760Ser
Ile Thr Asn Asn Val Ile Gly Gln Gly Leu Val Trp Asp Phe Val865 870
875 880cag agc aac tgg aag aag ctt ttt aac gat tat ggt ggt ggc tcg
ttc 2808Gln Ser Asn Trp Lys Lys Leu Phe Asn Asp Tyr Gly Gly Gly Ser
Phe 885 890 895tcc ttc tcc aac ctc atc cag gca gtg aca cga cga ttc
tcc acc gag 2856Ser Phe Ser Asn Leu Ile Gln Ala Val Thr Arg Arg Phe
Ser Thr Glu 900 905 910tat gag ctg cag cag ctg gag cag ttc aag aag
gac aac gag gaa aca 2904Tyr Glu Leu Gln Gln Leu Glu Gln Phe Lys Lys
Asp Asn Glu Glu Thr 915 920 925ggc ttc ggc tca ggc acc cgg gcc ctg
gag caa gcc ctg gag aag acg 2952Gly Phe Gly Ser Gly Thr Arg Ala Leu
Glu Gln Ala Leu Glu Lys Thr 930 935 940aaa gcc aac atc aag tgg gtg
aag gag aac aag gag gtg gtg ctc cag 3000Lys Ala Asn Ile Lys Trp Val
Lys Glu Asn Lys Glu Val Val Leu Gln945 950 955 960tgg ttc aca gaa
aac agc aaa tag tccccagccc ttgaagtcac ccggccccga 3054Trp Phe Thr
Glu Asn Ser Lys 965tgcaaggtgc ccacatgtgt ccatcccagc ggctggtgca
gggcctccat tcctggagcc 3114cgaggcacca gtgtcctccc ctcaaggaca
aagtctccag cccacgttct ctctgcctgt 3174gagccagtct agttcctgat
gacccaggct gcctgagcac ctcccagccc ctgcccctca 3234tgccaacccc
gccctaggcc tggcatggca cctgtcgccc agtgccctgg ggctgatctc
3294agggaagccc agctccaggg ccagatgagc agaagctctc gatggacaat
gaacggcctt 3354gctgggggcc gccctgtacc ctctttcacc tttccctaaa
gaccctaaat ctgaggaatc 3414aacagggcag cagatctgta tatttttttc
taagagaaaa tgtaaataaa ggatttctag 3474atgaaaaaaa aaaaaaaaaa
3494201967PRTHomo sapiens 201Met Ala Lys Gly Phe Tyr Ile Ser Lys
Ser Leu Gly Ile Leu Gly Ile1 5 10 15Leu Leu Gly Val Ala Ala Val Cys
Thr Ile Ile Ala Leu Ser Val Val 20 25 30Tyr Ser Gln Glu Lys Asn Lys
Asn Ala Asn Ser Ser Pro Val Ala Ser 35 40 45Thr Thr Pro Ser Ala Ser
Ala Thr Thr Asn Pro Ala Ser Ala Thr Thr 50 55 60Leu Asp Gln Ser Lys
Ala Trp Asn Arg Tyr Arg Leu Pro Asn Thr Leu65 70 75 80Lys Pro Asp
Ser Tyr Gln Val Thr Leu Arg Pro Tyr Leu Thr Pro Asn 85 90 95Asp Arg
Gly Leu Tyr Val Phe Lys Gly Ser Ser Thr Val Arg Phe Thr 100 105
110Cys Lys Glu Ala Thr Asp Val Ile Ile Ile His Ser Lys Lys Leu Asn
115 120 125Tyr Thr Leu Ser Gln Gly His Arg Val Val Leu Arg Gly Val
Gly Gly 130 135 140Ser Gln Pro Pro Asp Ile Asp Lys Thr Glu Leu Val
Glu Pro Thr Glu145 150 155 160Tyr Leu Val Val His Leu Lys Gly Ser
Leu Val Lys Asp Ser Gln Tyr 165 170 175Glu Met Asp Ser Glu Phe Glu
Gly Glu Leu Ala Asp Asp Leu Ala Gly 180 185 190Phe Tyr Arg Ser Glu
Tyr Met Glu Gly Asn Val Arg Lys Val Val Ala 195 200 205Thr Thr Gln
Met Gln Ala Ala Asp Ala Arg Lys Ser Phe Pro Cys Phe 210 215 220Asp
Glu Pro Ala Met Lys Ala Glu Phe Asn Ile Thr Leu Ile His Pro225 230
235 240Lys Asp Leu Thr Ala Leu Ser Asn Met Leu Pro Lys Gly Pro Ser
Thr 245 250 255Pro Leu Pro Glu Asp Pro Asn Trp Asn Val Thr Glu Phe
His Thr Thr 260 265 270Pro Lys Met Ser Thr Tyr Leu Leu Ala Phe Ile
Val Ser Glu Phe Asp 275 280 285Tyr Val Glu Lys Gln Ala Ser Asn Gly
Val Leu Ile Arg Ile Trp Ala 290 295 300Arg Pro Ser Ala Ile Ala Ala
Gly His Gly Asp Tyr Ala Leu Asn Val305 310 315 320Thr Gly Pro Ile
Leu Asn Phe Phe Ala Gly His Tyr Asp Thr Pro Tyr 325 330 335Pro Leu
Pro Lys Ser Asp Gln Ile Gly Leu Pro Asp Phe Asn Ala Gly 340 345
350Ala Met Glu Asn Trp Gly Leu Val Thr Tyr Arg Glu Asn Ser Leu Leu
355 360 365Phe Asp Pro Leu Ser Ser Ser Ser Ser Asn Lys Glu Arg Val
Val Thr 370 375 380Val Ile Ala His Glu Leu Ala His Gln Trp Phe Gly
Asn Leu Val Thr385 390 395 400Ile Glu Trp Trp Asn Asp Leu Trp Leu
Asn Glu Gly Phe Ala Ser Tyr 405 410 415Val Glu Tyr Leu Gly Ala Asp
Tyr Ala Glu Pro Thr Trp Asn Leu Lys 420 425 430Asp Leu Met Val Leu
Asn Asp Val Tyr Arg Val Met Ala Val Asp Ala 435 440 445Leu Ala Ser
Ser His Pro Leu Ser Thr Pro Ala Ser Glu Ile Asn Thr 450 455 460Pro
Ala Gln Ile Ser Glu Leu Phe Asp Ala Ile Ser Tyr Ser Lys Gly465 470
475 480Ala Ser Val Leu Arg Met Leu Ser Ser Phe Leu Ser Glu Asp Val
Phe 485 490 495Lys Gln Gly Leu Ala Ser Tyr Leu His Thr Phe Ala Tyr
Gln Asn Thr 500 505 510Ile Tyr Leu Asn Leu Trp Asp His Leu Gln Glu
Ala Val Asn Asn Arg 515 520 525Ser Ile Gln Leu Pro Thr Thr Val Arg
Asp Ile Met Asn Arg Trp Thr 530 535 540Leu Gln Met Gly Phe Pro Val
Ile Thr Val Asp Thr Ser Thr Gly Thr545 550 555 560Leu Ser Gln Glu
His Phe Leu Leu Asp Pro Asp Ser Asn Val Thr Arg 565 570 575Pro Ser
Glu Phe Asn Tyr Val Trp Ile Val Pro Ile Thr Ser Ile Arg 580 585
590Asp Gly Arg Gln Gln Gln Asp Tyr Trp Leu Ile Asp Val Arg Ala Gln
595 600 605Asn Asp Leu Phe Ser Thr Ser Gly Asn Glu Trp Val Leu Leu
Asn Leu 610 615 620Asn Val Thr Gly Tyr Tyr Arg Val Asn Tyr Asp Glu
Glu Asn Trp Arg625 630 635 640Lys Ile Gln Thr Gln Leu Gln Arg Asp
His Ser Ala Ile Pro Val Ile 645 650 655Asn Arg Ala Gln Ile Ile Asn
Asp Ala Phe Asn Leu Ala Ser Ala His 660 665 670Lys Val Pro Val Thr
Leu Ala Leu Asn Asn Thr Leu Phe Leu Ile Glu 675 680 685Glu Arg Gln
Tyr Met Pro Trp Glu Ala Ala Leu Ser Ser Leu Ser Tyr 690 695 700Phe
Lys Leu Met Phe Asp Arg Ser Glu Val Tyr Gly Pro Met Lys Asn705 710
715 720Tyr Leu Lys Lys Gln Val Thr Pro Leu Phe Ile His Phe Arg Asn
Asn 725 730 735Thr Asn Asn Trp Arg Glu Ile Pro Glu Asn Leu Met Asp
Gln Tyr Ser 740 745 750Glu Val Asn Ala Ile Ser Thr Ala Cys Ser Asn
Gly Val Pro Glu Cys 755 760 765Glu Glu Met Val Ser Gly Leu Phe Lys
Gln Trp Met Glu Asn Pro Asn 770 775 780Asn Asn Pro Ile His Pro Asn
Leu Arg Ser Thr Val Tyr Cys Asn Ala785 790 795 800Ile Ala Gln Gly
Gly Glu Glu Glu Trp Asp Phe Ala Trp Glu Gln Phe 805 810 815Arg Asn
Ala Thr Leu Val Asn Glu Ala Asp Lys Leu Arg Ala Ala Leu 820 825
830Ala Cys Ser Lys Glu Leu Trp Ile Leu Asn Arg Tyr Leu Ser Tyr Thr
835 840 845Leu Asn Pro Asp Leu Ile Arg Lys Gln Asp Ala Thr Ser Thr
Ile Ile 850 855 860Ser Ile Thr Asn Asn Val Ile Gly Gln Gly Leu Val
Trp Asp Phe Val865 870 875 880Gln Ser Asn Trp Lys Lys Leu Phe Asn
Asp Tyr Gly Gly Gly Ser Phe 885 890 895Ser Phe Ser Asn Leu Ile Gln
Ala Val Thr Arg Arg Phe Ser Thr Glu 900 905 910Tyr Glu Leu Gln Gln
Leu Glu Gln Phe Lys Lys Asp Asn Glu Glu Thr 915 920 925Gly Phe Gly
Ser Gly Thr Arg Ala Leu Glu Gln Ala Leu Glu Lys Thr 930 935 940Lys
Ala Asn Ile Lys Trp Val Lys Glu Asn Lys Glu Val Val Leu Gln945 950
955 960Trp Phe Thr Glu Asn Ser Lys 96520266DNAArtificial
Sequenceunsure(22)..(23)any 202cactcggccg acggggcttg tnnynnytgt
aatggtaggt gtnnynnygg ggccgctggg 60gcagaa 6620366DNAArtificial
Sequenceunsure(22)..(23)any 203cactcggccg acggggcttg tnnynnynny
aatgggaggn nynnynnygg ggccgctggg 60gcagaa 6620469DNAArtificial
Sequenceunsure(40)..(41)any 204cactcggccg acggggcttg taatgggaga
tgtnnynnyn nynnynnynn yggggccgct 60ggggcagaa 6920538DNAOryctanthus
occidentalisunsure(34)..(35)any 205gggcccaggc ggccgagctc gtgmtgaccc
agactcca 3820638DNAOryctanthus occidentalisDescription of
Artificial Sequencesynthetic 206gggcccaggc ggccgagctc gatmtgaccc
agactcca 3820738DNAOryctanthus occidentalis 207gggcccaggc
ggccgagctc gtgatgaccc agactgaa 3820842DNAOryctanthus occidentalis
208ggaagatcta gaggaaccac ctttgatttc cacattggtg cc
4220942DNAOryctanthus occidentalis 209ggaagatcta gaggaaccac
ctttgatttc cacattggtg cc 4221041DNAOryctanthus occidentalis
210ggaagatcta gaggaaccac cttgacsacc acctcggtcc c
4121140DNAOryctanthus occidentalis 211gggcccaggc ggccgagctc
gtgctgactc agtcgccctc 4021245DNAOryctanthus occidentalis
212ggaagatcta gaggaaccac cgcctgtgac ggtcagctgg gtccc
4521342DNAOryctanthus occidentalis 213ggtggttcct ctagatcttc
ccagtcggtg gaggagtccr gg 4221442DNAOryctanthus occidentalis
214ggtggttcct ctagatcttc ccagtcggtg aaggagtccg ag
4221542DNAOryctanthus occidentalis 215ggtggttcct ctagatcttc
ccagtcgytg gaggagtccg gg 4221644DNAOryctanthus occidentalis
216ggtggttcct ctagatcttc ccagsagcag ctgrtggagt ccgg
4421746DNAOryctanthus occidentalis 217cctggccggc ctggccacta
gtgactgayg gagccttagg ttgccc 4621841DNAOryctanthus occidentalis
218gaggaggagg aggaggaggc ggggcccagg cggccgagct c
4121941DNAOryctanthus occidentalis 219gaggaggagg aggaggagcc
tggccggcct ggccactagt g 412207PRTArtificial SequenceDescription of
Artificial Sequence Synthetic 220Cys Arg Gly Asp Gly Trp Cys1
52215PRTArtificial SequenceDescription of Artificial Sequence
Synthetic 221Cys Ala Arg Ala Cys1 52229PRTArtificial
SequenceUNSURE(1)..(2)any amino acid encoded by nny 222Xaa Xaa Cys
Asn Gly Arg Cys Xaa Xaa1 522311PRTArtificial
SequenceUNSURE(2)..(3)any amino acid encoded by nny 223Cys Xaa Xaa
Xaa Asn Gly Arg Xaa Xaa Xaa Cys1 5 1022411PRTArtificial
SequenceUNSURE(6)..(11)any amino acid by nny 224Cys Asn Gly Arg Cys
Xaa Xaa Xaa Xaa Xaa Xaa1 5 1022518DNAArtificial
SequenceUNSURE(6)..(11)any amino acid encoded by nny 225ttctgcccca
gcggcccc 1822621DNAArtificial SequenceDescription of Artificial
Sequencesynthetic 226tgtnnknnkn nknnknnktg t 21
* * * * *