Sequence Analysis Of The Tetravalent Rotavirus Vaccine

Abstract

Isolated nucleic acid molecules comprising a gene segment from a rhesus rotavirus (RRV) or from one of three rhesus:human reassortant viruses are disclosed, including isolated nucleic acid molecules having a sequence selected from the group consisting of: SEQ ID NO: 1-14, inclusive, and isolated nucleic acid molecules encoding a protein having a sequence selected from the group consisting of SEQ ID NO: 15-28, inclusive, as well as variants of the isolated nucleic acid molecules.

Description

RELATED APPLICATION

[0001] This application claims the benefit of U.S. Application No. 60/359,960, filed Feb. 27, 2002. The entire teachings of the above application are incorporated herein by reference.

BACKGROUND OF THE INVENTION

[0002] Rotavirus is a segmented, double-stranded RNA virus that is the major cause of severe gastroenteritis in infants and young children. Profound fluid and electrolyte loss often leads to hospitalization for life-saving rehydration therapy. Where access to medical care is limited or unavailable, volume depletion, shock and death can occur. Annually, nearly one million childhood deaths in developing countries have been ascribed to inadequately treated rotavirus gastroenteritis. In the industrialized world, more than 30% of the children admitted to hospitals with acute gastroenteritis have rotavirus infections.

SUMMARY OF THE INVENTION

[0003] The invention is drawn to isolated nucleic acid molecules comprising a gene segment from a rhesus rotavirus (RRV) or from one of three rhesus:human reassortant viruses. In one embodiment, the isolated nucleic acid molecule has a sequence selected from the group consisting of: SEQ ID NO: 1-14, inclusive. In another embodiment, the isolated nucleic acid molecule encodes a protein having a sequence selected from the group consisting of: SEQ ID NO: 15-28, inclusive. In yet another embodiment, the isolated nucleic acid molecule is a variant of SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 10, 11, 12, or 14, such as one of the following: a nucleic acid molecule having the sequence of SEQ ID NO: 1 (gene 1) and having a nucleotide change to a G at nucleotide 2120; a nucleic acid molecule having the sequence of SEQ ID NO: 2 (gene 2) and having one or more of the following nucleotide changes: a C at nucleotide 493, and a T at nucleotide 947; a nucleic acid molecule having the sequence of SEQ ID NO:3 (gene 3) and having one or more of the following nucleotide changes: an A at nucleotide 169, a C at nucleotide 283, a C at nucleotide 448, a C at nucleotide 874, a C at nucleotide 1306, and a C at nucleotide 2388; a nucleic acid molecule having the sequence of SEQ ID NO:4 (gene 4) and having one or more of the following nucleotide changes: a C at nucleotide 119, a G at nucleotide 417, a G at nucleotide 809, a C at nucleotide 977, an A at nucleotide 1463, a C at nucleotide 1481, a C at nucleotide 1608, a C at nucleotide 1755, and an A at nucleotide 1953; a nucleic acid molecule having the sequence of SEQ ID NO:5 (gene 5) and having one or more of the following nucleotide changes: an A at nucleotide 75, a T at nucleotide 84, a C at nucleotide 347, a T at nucleotide 667, a C at nucleotide 1186, a G at nucleotide 1219, and an A at nucleotide 1204; a nucleic acid molecule having the sequence of SEQ ID NO: 6 (gene 6) and having one or more of the following nucleotide changes: a C at nucleotide 376, an A at nucleotide 756, an A at nucleotide 1008, and a G at nucleotide 1041; a nucleic acid molecule having the sequence of SEQ ID NO: 7 (gene 7) and having a nucleotide change to a G at nucleotide 387; a nucleic acid molecule having the sequence of SEQ ID NO:10 (gene 10) and having one or more of the following nucleotide changes: an A at nucleotide 92, an A at nucleotide 174, and a G at nucleotide 218; a nucleic acid molecule having the sequence of SEQ ID NO: 11 (gene 11) and having a nucleotide change to A at nucleotide 180; a nucleic acid molecule having the sequence of SEQ ID NO: 12 (DxRRV (serotype 1)) and having a nucleotide change to an A at nucleotide 556; and a nucleic acid molecule having the sequence of SEQ ID NO: 14 (ST3xRRV (serotype 4)) and having a nucleotide change to a G at nucleotide 263. Each gene variant can have one, more than one, or all of the nucleotide changes enumerated for that particular genie. Other variants of any one of nucleic acid molecules having SEQ ID NO:1-14, or encoding a polypeptide of SEQ ID NO: 15-28, are also included.

DETAILED DESCRIPTION OF THE INVENTION

[0004] Human rotavirus serotypes G1-G4 are the major causes of diarrheal gastroenteritis in humans (Gentsch, et al., 1995). The serotypes are determined by epitopic differences in the outer capsid of the virus particle encoded by the VP7 gene. The ROTAMUNE.TM. (ROTASHIELD.TM.) vaccine is a live virus vaccine comprised of four different rotaviruses, each containing the outer capsid protein, VP7, of one of the major serotypes G1-G4 known to cause disease in humans. The foundation of this vaccine is a virus isolated from a rhesus macaque, rhesus rotavirus (RRV). The virus is sufficiently similar to human strains to permit limited replication in human intestinal tracts and thereby elicit protective immune responses to human rotaviruses. The ROTAMUNE.TM. vaccine includes RRV (serotype G3, for which VP7 is 96% homologous to VP7 from human serotype 3 viruses); and three rhesus:human reassortant viruses (serotypes G1, G2 and G4). The reassortants are comprised of the rhesus virus genetic background (10 gene segments), but replace the gene segment encoding VP7 with the corresponding gene segments from the human serotype 1 (D strain), 2 (DS 1 strain) or 4 (ST3 strain) viruses. Applicants have, for the first time, identified the nucleic acid sequence of all 11 gene segments of each of the four virus strains, including the 10 common gene segments and the four independent gene segments (VP7 gene), for a total of 14 gene segments.

Nucleic Acids of the Invention

[0005] Accordingly, the invention pertains to an isolated nucleic acid molecule comprising a gene segment from the rhesus rotavirus (RRV) or from one of the three rhesus:human reassortant viruses. The term, "gene segment," as used herein, refers to a nucleotide sequence, preferably which encodes a polypeptide or protein, and preferably which contains regulatory, non-coding nucleotide sequence(s) present at the 3' and/or 5' end of each gene segment. In a preferred embodiment, the gene segment is selected from the group consisting of the nucleotide sequences shown in SEQ ID NO:1-14, inclusive, as described in Table 1, below.

TABLE-US-00001 TABLE 1 SEQ ID NO: 1-14, Nucleic Acids of the Invention SEQ ID NO: Description 1 Gene 1 (RRV) - VP1 2 Gene 2 (RRV) - VP2 3 Gene 3 (RRV) - VP3 4 Gene 4 (RRV) - VP4 5 Gene 5 (RRV) - NSP1 6 Gene 6 (RRV) - VP6 7 Gene 7 (RRV) - NSP3 8 Gene 8 (RRV) - NSP2 9 Gene 9 (RRV) (Serotype 3) - VP7 10 Gene 10 (RRV) - NSP4 11 Gene 11 (RRV) - NSP5 12 Gene 9 (DxRRV) (Serotype 1) - VP7 13 Gene 9 (DS1xRRV) (Serotype 2) - VP7 14 Gene 9 (ST3xRRV) (Serotype 4) - VP7

[0006] Due to differences in electrophoretic mobility, numerical gene assignments differ among RRV and the reassortant viruses. These differences involve only genes 7, 8 and 9. For the purpose of comparison and discussion, segment 7 is designated as the segment coding for NSP3, segment 8 as the segment coding for NSP2 and segment 9 as the segment coding for outer capsid viral protein 7 (VP7).

[0007] The isolated nucleic acid molecules of the present invention can be RNA, for example, mRNA, or DNA, such as cDNA. The RNA or DNA molecules can be double-stranded or single-stranded; single stranded RNA or DNA can be either the coding, or sense, strand or the non-coding, or antisense, strand. The nucleic acid molecule can include all or a portion of the coding sequence of the gene segment and can further comprise additional non-coding sequences such as non-coding. 3' and 5' sequences (including regulatory sequences, for example). Additionally, the nucleic acid molecule can be fused to a marker sequence, for example, a sequence that encodes a polypeptide to assist in isolation or purification of the protein. Such sequences include, but are not limited to, those which encode a glutathione-S-transferase (GST) fusion protein and those which encode a hemagglutinin A (HA) polypeptide marker from influenza.

[0008] An "isolated" nucleic acid molecule, as used herein, is one that is separated from nucleic acids which normally flank the gene or nucleotide sequence and/or has been completely or partially purified from other transcribed sequences (e.g., as in an RNA library). For example, an isolated nucleic acid of the invention may be substantially isolated with respect to the complex cellular milieu (e.g., the virus) in which it naturally occurs, or culture medium when produced by recombinant techniques, or chemical precursors or other chemicals when chemically synthesized. In some instances, the isolated material will form part of a composition (for example, a crude extract containing other substances), buffer system or reagent mix. In other circumstances, the material may be purified to essential homogeneity, for example as determined by PAGE or column chromatography such as HPLC.

[0009] Preferably, an isolated nucleic acid molecule comprises at least about 50, 80 or 90% (on a molar basis) of all macromolecular species present.

[0010] The nucleic acid molecule can be fused to other coding or regulatory sequences and still be considered isolated. Thus, recombinant nucleic acid contained in a vector is included in the definition of "isolated" as used herein. Also, isolated nucleic acid molecules include recombinant nucleic acid molecules in heterologous host cells, as well as partially or substantially purified nucleic acid molecules in solution. "Isolated" nucleic acid molecules also encompass in vivo and in vitro RNA transcripts (e.g., of cDNA) of the present invention. An isolated nucleic acid molecule or nucleotide sequence can include a nucleic acid molecule or nucleotide sequence which is synthesized chemically or by recombinant means. Therefore, recombinant nucleic acids contained in a vector are included in the definition of "isolated" as used herein. Also, isolated nucleotide sequences include recombinant nucleic acid molecules in heterologous organisms, as well as partially or substantially purified nucleic acid molecules in solution. In vivo and in vitro RNA transcripts of the DNA molecules (e.g., cDNA) of the present invention are also encompassed by "isolated" nucleotide sequences. Such isolated nucleotide sequences are useful in the manufacture of the encoded protein, to raise anti-protein antibodies using DNA immunization techniques, and as an antigen to raise anti-DNA antibodies or elicit immune responses, or for detecting expression of the gene in tissue (e.g., human tissue), such as by Northern blot analysis, indicating the presence of infection.

[0011] The present invention also pertains to nucleic acid molecules which are not necessarily found in nature but which encode a protein described herein. Thus, for example, nucleic acid molecules which comprise a sequence that is different from the naturally-occurring nucleotide sequence but which, due to the degeneracy of the genetic code, encode a protein that is the same as a protein encoded by a gene segment of the present invention, are also the subject of this invention (e.g., a nucleic acid molecule that encodes a protein having as a sequence any one of SEQ ID NO:15-28, as described in Table 2, below).

TABLE-US-00002 TABLE 2 SEQ ID NO: 15-28, Proteins Encoded by Nucleic Acids of the Invention SEQ ID Illustrative Nucleic Acid NO: Description Encoding the Protein 15 Protein 1 (RRV) - VP1 1 16 Protein 2 (RRV) - VP2 2 17 Protein 3 (RRV) - VP3 3 18 Protein 4 (RRV) - VP4 4 19 Protein 5 (RRV) - NSP1 5 20 Protein 6 (RRV) - VP6 6 21 Protein 7 (RRV) - NSP3 7 22 Protein 8 (RRV) - NSP2 8 23 Protein 9 (RRV) (Serotype 3) - 9 VP7 24 Protein 10 (RRV) - NSP4 10 25 Protein 11 (RRV) - NSP5 11 26 Protein 9 (DxRRV) (Serotype 1) - 12 VP7 27 Protein 9 (DS1xRRV) (Serotype 13 2) - VP7 28 Protein 9 (ST3xRRV) (Serotype 14 4) - VP7

[0012] The invention also encompasses variants of certain nucleotide sequences of the invention. For example, in one embodiment, the variant nucleotide sequences of the invention comprise the nucleotide differences set forth in Table 4 or Table 8, below.

[0013] That is, representative valiant embodiments include: a nucleic acid molecule having the sequence of SEQ ID NO: 1 (gene 1) and having a nucleotide change to a G at nucleotide 2120; a nucleic acid molecule having the sequence of SEQ ID NO: 2 (gene 2) and having one or more of the following nucleotide changes: a C at nucleotide 493, and a T at nucleotide 947; a nucleic acid molecule having the sequence of SEQ ID NO:3 (gene 3) and having one or more of the following nucleotide changes: an A at nucleotide 169, a C at nucleotide 283, a C at nucleotide 448, a C at nucleotide 874, a C at nucleotide 1306, and a C at nucleotide 2388; a nucleic acid molecule having the sequence of SEQ ID NO:4 (gene 4) and having one or more of the following nucleotide changes: a C at nucleotide 119, a G at nucleotide 417, a G at nucleotide 809, a C at nucleotide 977, an A at nucleotide 1463, a C at nucleotide 1481, a C at nucleotide 1608, a C at nucleotide 1755, and an A at nucleotide 1953; a nucleic acid molecule having the sequence of SEQ ID NO:5 (gene 5) and having one or more of the following nucleotide changes: an A at nucleotide 75, a T at nucleotide 84, a C at nucleotide 347, a T at nucleotide 667, a C at nucleotide 1186, a G at nucleotide 1219, and an A at nucleotide 1204; a nucleic acid molecule having the sequence of SEQ ID NO: 6 (gene 6) and having one or more of the following nucleotide changes: a C at nucleotide 376, an A at nucleotide 756, an A at nucleotide 1008, and a G at nucleotide 1041; a nucleic acid molecule having the sequence of SEQ ID NO: 7 (gene 7) and having a nucleotide change to a G at nucleotide 387; a nucleic acid molecule having the sequence of SEQ ID NO:10 (gene 10) and having one or more of the following nucleotide changes: an A at nucleotide 92, an A at nucleotide 174, and a G at nucleotide 218; a nucleic acid molecule having the sequence of SEQ ID NO: 11 (gene 11) and having a nucleotide change to A at nucleotide 180; a nucleic acid molecule having the sequence of SEQ ID NO: 12 (DxRRV (serotype 1)) and having a nucleotide change to an A at nucleotide 556; and a nucleic acid molecule having the sequence of SEQ ID NO: 14 (ST3xRRV (serotype 4)) and having a nucleotide change to a G at nucleotide 263. Each gene variant can have one of the nucleotide changes, or can have more than one, or all, of the nucleotide changes enumerated for that particular gene.

[0014] Such variants can be naturally-occurring, such as in the case of allelic variation or base substitution in a clinical isolate, or non-naturally-occurring, such as those induced by various mutagens and mutagenic processes. Other intended variations can also be included in any one of the isolated nucleic acids of the invention (e.g., in any one of SEQ ID NO: 1-14 or in a nucleic acid molecule encoding a polypeptide of any one of SEQ ID NO:15-28); such intended variations include, but are not limited to, addition, deletion and substitution of one or more nucleotides which can result in conservative or non-conservative amino acid changes, including additions and deletions. Preferably the nucleotide (and/or resultant amino acid) changes are silent or conserved; that is, they do not alter the characteristics or activity of protein encoded by the gene segment of the invention.

[0015] Other alterations of the nucleic acid molecules of the invention can include, for example, labeling, methylation, internucleotide modifications such as uncharged linkages (e.g., methyl phosphonates, phosphotriesters, phosphoamidates, carbamates), charged linkages (e.g., phosphorothioates, phosphorodithioates), pendent moieties (e.g., polypeptides), intercalators (e.g., acridine, psoralen), chelators, alkylators, and modified linkages (e.g., alpha anomeric nucleic acids). Also included are synthetic molecules that mimic nucleic acid molecules in the ability to bind to designated sequences via hydrogen bonding and other chemical interactions. Such molecules include, for example, those in which peptide linkages substitute for phosphate linkages in the backbone of the molecule.

[0016] In a related aspect, the nucleic acid molecules of the invention are used as probes or primers in assays. "Probes" are oligonucleotides that hybridize in a base-specific manner to a complementary strand of nucleic acid molecules. Such probes include polypeptide nucleic acids, as described in Nielsen et al., Science, 254, 1497-1500 (1991). Typically, a probe comprises a region of nucleotide sequence that hybridizes under highly stringent conditions to at least about 15, typically about 20-25, and more typically about 40, 50 or 75, consecutive nucleotides of a nucleic acid molecule comprising a nucleotide sequence selected from SEQ ID NO: 1-14, and the complement of SEQ ID NO: 1-14. More typically, the probe further comprises a label, e.g., radioisotope, fluorescent compound, enzyme, or enzyme co-factor.

[0017] As used herein, the term "primer" refers to a single-stranded oligonucleotide which acts as a point of initiation of template-directed DNA synthesis using well-known methods (e.g., PCR, LCR) including, but not limited to those described herein. The appropriate length of the primer depends on the particular use, but typically ranges from about 15 to 30 nucleotides.

[0018] The nucleic acid molecules of the invention such as those described above can be identified and isolated using standard molecular biology techniques and the sequence information provided in SEQ ID NO: 1-14. For example, nucleic acid molecules can be amplified and isolated by the polymerase chain reaction using synthetic oligonucleotide primers designed based on one or more of the sequences provided in SEQ ID NO: 1-14 and/or the complement of SEQ ID NO: 1-14. See generally PCR Technology: Principles and Applications for DNA Amplification (ed. H. A. Erlich, Freeman Press, NY, N.Y., 1992); PCR Protocols: A Guide to Methods and Applications (Eds. Innis, et al., Academic Press, San Diego, Calif., 1990); Mattila et al., Nucleic Acids Res., 19:4967 (1991); Eckert et al., PCR Methods and Applications, 1:17 (1991); PCR (eds. McPherson et al., IRL Press, Oxford); and U.S. Pat. No. 4,683,202. The nucleic acid molecules can be amplified using cDNA, RNA, or mRNA as a template, cloned into an appropriate vector and characterized by DNA sequence analysis.

[0019] Other suitable amplification methods include the ligase chain reaction (LCR) (see Wu and Wallace, Genomics, 4:560 (1989), Landegren et al., Science, 241:1077 (1988), transcription amplification (Kwoh et al., Proc. Natl. Acad. Sci. USA, 86:1173 (1989)), and self-sustained sequence replication (Guatelli et al., Proc. Nat. Acad. Sci. USA, 87:1874 (1990)) and nucleic acid based sequence amplification (NASBA). The latter two amplification methods involve isothermal reactions based on isothermal transcription, which produce both single stranded RNA (ssRNA) and double stranded DNA (dsDNA) as the amplification products in a ratio of about 30 or 100 to 1, respectively.

[0020] Antisense nucleic acid molecules of the invention can be designed using the nucleotide sequences of SEQ ID NO: 1-14 and/or the complement of SEQ ID NO: 1-14, or a portion of the nucleotide sequence of SEQ ID NO: 1-14 and/or the complements thereof, and constructed using chemical synthesis and enzymatic ligation reactions using procedures known in the art. For example, an antisense nucleic acid molecule (e.g., an antisense oligonucleotide) can be chemically synthesized using naturally occurring nucleotides or variously modified nucleotides designed to increase the biological stability of the molecules or to increase the physical stability of the duplex formed between the antisense and sense nucleic acids, e.g., phosphorothioate derivatives and acridine substituted nucleotides call be used. Alternatively, the antisense nucleic acid molecule can be produced biologically using an expression vector into which a nucleic acid molecule has been subcloned in an antisense orientation (i.e., RNA transcribed from the inserted nucleic acid molecule will be of an antisense orientation to a target nucleic acid of interest).

[0021] Another aspect of the invention pertains to nucleic acid constructs containing a nucleic acid molecule selected from the group consisting of SEQ ID NO: 1-14 and the complement of SEQ ID NO: 1-14 (or a portion thereof). The constructs comprise a vector (e.g., an expression vector) into which a sequence of the invention has been inserted hi a sense or antisense orientation. As used herein, the term "vector" refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. One type of vector is a "plasmid", which refers to a circular double stranded DNA loop into which additional DNA segments can be ligated. Another type of vector is a viral vector, wherein additional DNA segments can be ligated into the viral genome. Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). In general, expression vectors of utility in recombinant DNA techniques are often in the form of plasmids. However, the invention is intended to include such other forms of expression vectors, such as viral vectors (e.g., replication defective retroviruses, adenoviruses and adeno-associated viruses, negative strand RNA virus vectors, VEE vectors) that serve equivalent functions.

[0022] Preferred recombinant expression vectors of the invention comprise a nucleic acid molecule of the invention in a form suitable for expression of the nucleic acid molecule in a host cell. This means that the recombinant expression vectors include one or more regulatory sequences, selected on the basis of the host cells to be used for expression, which is operably linked to the nucleic acid sequence to be expressed. Within a recombinant expression vector, "operably linked" is intended to mean that the nucleotide sequence of interest is linked to the regulatory sequence(s) in a manner which allows for expression of the nucleotide sequence (e.g., in an in vitro transcription/translation system or in a host cell when the vector is introduced into the host cell). The term "regulatory sequence" is intended to include promoters, enhancers and other expression control elements (e.g., polyadenylation signals). Such regulatory sequences are described, for example, in Goeddel, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, Calif. (1990). Regulatory sequences include those which direct constitutive expression of a nucleotide sequence in many types of host cell and those which direct expression of the nucleotide sequence only in certain host cells (e.g., tissue-specific regulatory sequences). It will be appreciated by those skilled in the art that the design of the expression vector can depend on such factors as the choice of the host cell to be transformed and the level of expression of protein desired. The expression vectors of the invention can be introduced into host cells to thereby produce proteins, including fusion proteins, encoded by nucleic acid molecules as described herein.

[0023] The recombinant expression vectors of the invention can be designed for expression of a protein described herein, in prokaryotic or eukaryotic cells, e.g., bacterial cells such as E. coli, insect cells (using baculovirus expression vectors), yeast cells or mammalian cells. Suitable host cells are discussed further in Goeddel, supra. Alternatively, the recombinant expression vector can be transcribed and translated in Vitro, for example using T7 promoter regulatory sequences and T7 polymerase.

[0024] Another aspect of the invention pertains to host cells into which a recombinant expression vector of the invention has been introduced. The terms "host cell" and "recombinant host cell" are used interchangeably herein. It is understood that such terms refer not only to the particular subject cell but also to the progeny or potential progeny of such a cell. Because certain modifications may occur in succeeding generations due to either mutation or environmental influences, such progeny may not, in fact, be identical to the parent cell, but are still included within the scope of the term as used herein.

[0025] A host cell can be any prokaryotic or eukaryotic cell. For example, a nucleic acid molecule of the invention can be expressed in bacterial cells (e.g., E. coli), insect cells, yeast or mammalian cells (such as Chinese hamster ovary cells (CHO) or COS cells). Other suitable host cells are known to those skilled in the art.

[0026] Vector DNA can be introduced into prokaryotic or eukaryotic cells via conventional transformation or transfection techniques. As used herein, the terms "transformation" and "transfection" are intended to refer to a variety of art-recognized techniques for introducing a foreign nucleic acid molecule (e.g., DNA) into a host cell, including calcium phosphate or calcium chloride co-precipitation, DEAE-dextran-mediated transfection, lipofection, or electroporation. Suitable methods for transforming or transfecting host cells can be found in Sambrook, et al. (supra), and other laboratory manuals.

[0027] For stable transfection of mammalian cells, it is known that, depending upon the expression vector and transfection technique used, only a small fraction of cells may integrate the foreign DNA into their genome. In order to identify and select these integrants, a gene that encodes a selectable marker (e.g., for resistance to antibiotics) is generally introduced into the host cells along with the gene of interest. Preferred selectable markers include those that confer resistance to drugs, such as G418, hygromycin and methotrexate. Nucleic acid molecules encoding a selectable marker can be introduced into a host cell on the same vector as the nucleic acid molecule of the invention or can be introduced on a separate vector. Cells stably transfected with the introduced nucleic acid molecule can be identified by drug selection (e.g., cells that have incorporated the selectable marker gene will survive, while the other cells die).

[0028] A host cell of the invention, such as a prokaryotic or eukaryotic host cell in culture, can be used to produce (i.e., express) a protein described herein. Accordingly, the invention further provides methods for producing a protein using the host cells of the invention. In one embodiment, the method comprises culturing the host cell of the invention (into which a recombinant expression vector encoding a protein described herein has been introduced) in a suitable medium such that the protein is produced. In another embodiment, the method further comprises isolating the protein from the medium or the host cell.

[0029] The invention will be further described by the following non-limiting examples. The teachings of all publications cited herein are incorporated herein by reference in their entirety.

EXAMPLES

Example 1

Consensus Sequencing Materials and Methods

[0030] Viral Stocks

[0031] A rotavirus seed bank system was developed for the ROTAMUNE.TM. vaccine consisting of a Master Virus Seed (MVS) Bank, a Primary Virus Seed (PVS) Bank and a Manufacturer's Working Virus Seed (MWVS) Bank. The nucleotide sequence of all 11 gene segments of each of the four strains comprising the commercial virus seed (MWVS-5, 6, 7 and 8) were identified and the sequence identity (genetic equivalence) between the commercial virus seeds and the clinical virus seeds (MWVS-1, 2, 3, and 4) were demonstrated.

[0032] A subset of Manufacturer's Working Virus Seed (WVS), representing clinical lots (MWVS 1-4) and commercial lots (MWVS 5-8), was used. The strains used in this study are:

TABLE-US-00003 1) D .times. RRV Lot MWVS-5 Type-1 2) DS1 .times. RRV Lot MWVS-6 Type-2 3) RRV Lot MWVS-7 Type-3 4) ST3 .times. RRV Lot MWVS-8 Type-4 5) RRV Lot MWVS-1 6) DS1 .times. RRV Lot MWVS-2 7) D .times. RRV Lot MWVS-3 8) ST3 .times. RRV Lot MWVS-4

[0033] RNA Isolation

[0034] Genomic RNAs from the aliquots of each MWVS were extracted using Trizol-LS.TM. reagent (Life Technologies, Grand Island, N.Y.). RNA was resuspended in RNase-free water and used for all genomic amplifications.

[0035] Reverse Transcription-Polymerase Chain Reaction (RT-PCR) Amplification RT-PCR amplifications spanning individual full length RNA gene segments of the rotavirus genome were performed by using the GeneAmp XL RNA PCR Kit (Perkin-Elmer) and primer pairs specific to each individual rotavirus gene segment. Common RRV primers were used for all segments of the three reassortants, except for gene 9 where primers specific to gene 9 of the rhesus or of the different human rotavirus sequences (RRV, HRV-D, HRV-DS1 and GRV-ST3) were used. Primers are shown in Table 3A.

TABLE-US-00004 TABLE 3A Primers Used For Amplification of Genomic Fragments SEQ Gene Primer Name Nucleotide Sequence 5' .fwdarw. 3' ID 1 RRV-101 1-27 GGCTATTAAAGCTGTACAATGGGGAAG 29 RRV-102 3265-3294 CTAAGCGTTCTAATCTTGAAAGAAGTTTGC 30 2 RRV-201 1-27 GGCTATTAAAGGCTCAATGGCGTACAG 31 RRV-202 2683-2708 GGTCATATCTCCACAATGGGGTTGGC 32 3 *RRV-301A 1-25 GGCTATTAAAGCAGTACGAGTAGTG 33 *RRV-302A 2571-2591 GGTCACATCATGACTAGTGTG 34 4 RRV-401 1-21 GGCTATAAAATGGCTTCGCTC 35 RRV-402 2341-2362 GGTCACATCCTCTGGAAATTGC 36 5 *RRV-501A 1-29 GGCTTTTTTTTGAAATGTCTTGTGTTAGC 37 *RRV-502A 1576-1599 GGTCACAGTTTTTGCTGGCTAGGC 38 6 RRV-601 1-26 GGCTTTTAAACGAAGTCTTCAACATG 39 RRV-602 1332-1356 GGTCACATCCTCTCACTATACCATC 40 7 RRV-701 1-25 GGCATTTAATGCTTTTCAGTGGTTG 41 RRV-702 1056-1077 GGTCACATAACGCCCCTATAGC 42 8 RRV-801 1-29 GGCTTTTAAAGCGTCTCAGTCGCCGTTCG 43 RRV-802 1037-1059 GGTCACATAAGCGCTTTCTATTC 44 9 **RRV-901 1-24 GGCTTTAAAAGCGAGAATTTCCGT 45 RRV-902 1041-1062 GGTCACATCATACATTTCTAAC 46 D-RRV-902 1036-1062 GGTCACATCGAACAATTCTAATCTAAG 47 DS1-RRV-902 1035-1062 GGTCACATCGAACAATTCTGACCAAATC 48 ST3-RRV-902 1036-1062 GGTCACATCATACATTTCTATTTTAGG 49 10 RRV-1001 1-27 GGCTTTTTAAAAGTTCTGTTCCGAGAG 50 RRV-1002 728-750 GGTCACATTAAGACCGTTCCTTC 51 11 RRV-1101 1-24 GGCTTTTAAAGCGCTACAGTGATG 52 RRV-1102 644-667 GGTGACATAACTGGAGTGGGGAGC 53 Primers named . . . 01 are (+) sense and primers named . . . 02 are (-) sense. *Primers 301A, 302A, 501A, and 502A reflect the actual termini sequence as determined. **Primer 901 was used to amp1ify all four serotypes, while primer 902 was designed specifically for each.

[0036] RT-PCR amplification steps were as follows:

[0037] RT Reaction

TABLE-US-00005 RNA (RNA + water) 10 .mu.l RNase-free water -- 5X XL RT buffer 4 .mu.l dNTP mix (2.5 mM each dNTP) 1.6 .mu.l rTth polymerase 2.5 .mu.l 25 mM Mn(OAc2) 0.88 .mu.l RT (downstream) primer (20 pmoles/.mu.l) 1 .mu.l TOTAL: 20 .mu.l

[0038] RNA (100-500 ng per reaction) was mixed with water and 5.times.SL RT buffer in a Gene-amp tube. The mixture was denatured at 96.degree. C. for 5-6 minutes in a pre-heated thermal cycler, and then placed on ice immediately for 3 minutes to quick cool. Samples were pulse-spun in microfuge to remove any condensation on caps, and the remaining ingredients were added. A drop of mineral oil was added to each tube, and samples were placed in pre-heated thermal cycler at 40.degree. C. The RT thermal cycle was 40.degree. C. for 60 minutes, followed by 45.degree. C. for 60 minutes and then 4.degree. C., soak. If several different fragments from the same RNA template were amplified, the entire reaction was scaled up in one tube, eliminating only the primer from the mix. One .mu.l of the RT (+sense) primer was added to each reaction tube, and then 19 .mu.l of the scaled-up RT mix were added.

[0039] PCR Reaction

TABLE-US-00006 RNase-free water 58.8 .mu.l 5X XL Chelating Buffer 16 .mu.l 25 mM Mg(OAc2) 3.2 .mu.l PCR (upstream) primer (20 pmoles/.mu.l) 1.5 .mu.l RT (downstream) primer (20 pmoles/.mu.l) 0.5 .mu.l TOTAL 80 .mu.l.

[0040] The reagents were mixed for each sample; 80 .mu.l PCR mix were added to the 20 .mu.l RT reaction under the oil, and mixed by pipetting up and down several times. The samples were placed in pre-heated thermal cycler (hot-start) at 94.degree. C. and cycled as follows: 94.degree. C. denaturation for 3 minutes, followed by 40 cycles of denaturation at 94.degree. C. for 1 minute, primer annealing at 40.degree. C. for 30 seconds, and extension at 70.degree. C. for five minutes. A final extension step was run at 70.degree. C. for 10 minutes, followed by a soak cycle at 4.degree. C.

[0041] Ten .mu.l of reaction were run on agarose gel. Products were purified using Promega's Wizard PCR preps DNA purification system (Madison Wis.) either directly or using gel purification from low-melting agarose.

[0042] RNA Ligation RT-PCR to Determine Consensus Nucleotide sequence of the Gene Termini

[0043] The nucleotide sequence of the absolute 3' and 5' termini of the eleven RNA gene segments of the rotavirus vaccine strains was determined using an RNA ligation reverse transcription-PCR protocol modified from Sidhu et al. (Virology 193:66-72, 1993) for use on double-stranded RNA. Genomic RNA was extracted using Trizol-LS.TM. reagent (Life Technologies) and 2-3 .mu.g was treated with Tobacco Acid Pyrophosphatase (TAP) at 37.degree. C. for 1 hour in a 40 .mu.l volume according to the manufacturer's directions (Epicentre Technologies). This step was used to remove the CAP structure on the 5' end of the plus strand of the genomic RNA segments, and leave behind a 5' monophosphate that was used for RNA ligation. The TAP-treated RNA was extracted with phenol/chloroform/isoamyl alcohol (25:24:1) and ethanol-precipitated. The RNA pellet was air-dried and resuspended in 13.7 .mu.L of RNase-free water. The double-stranded RNA was then denatured at 96.degree. C. for 4 minutes and quick-chilled on ice for 2 minutes. The reagents required for RNA ligation in at 20 .mu.l volume were then added. The final ligation reaction conditions were 1.times.RNA ligase buffer (New England Biolabs), 10% DMSO (Sigma D-2650), 20 U Promega RNasin, and 36 U NEB T4 RNA ligase. Ligation was performed at 16.degree. C. overnight (approximately 16 hours). The ligated RNA was phenol extracted and ethanol precipitated as described above, and the RNA pellet was resuspended in 15 .mu.l of water. One .mu.l of ligated RNA was seeded into each of 11 RT-PCR reactions containing rotavirus gene-specific primers (shown in Table 3B) designed to amplify across the ligated RNA junction.

TABLE-US-00007 TABLE 3B Rotavirus Primers Used to Amplify across Ligated RNA Junctions (Gene Termini) Gene Primer Nucleotide Sequence 5' .fwdarw. 3' SEQ ID 1 RRV-101T 206-229 CCCAAGCTTGTGTGGCATTCTCTATAACATCGC 54 RRV-102T 3163-3186 CCCGGATCCGGCTCATGGATAAGCTTATTCTGC 55 RRV-103T 301-324 CCCAAGCTTCAAATCTGCTTCTAGCGGCTTACC 56 RRV-104T 3084-3107 CCCGGATCCTAAAGGAAAGATACCAGCTGTCAC 57 2 RRV-201T 147-170 CCCAAGCTTCCTTTTGAGATAGCACTTTCTCTG 58 RRV-202T 2524-2547 CCCGGATCCACCACAACAATTTGATTTTAGAGC 59 RRV-203T 270-293 CTTCTTTTTGATGTTCTTCCTTAG 60 RRV-204T 2470-2493 TGTAGCGAATTATGACTGGGTTCG 61 3 RRV-301T 128-151 CCCAAGCTTAAGAAATGCATTCTCGTAACTGTC 62 RRV-302T 2415-2438 CCCGGATCCGTCAATCTAGAATGTTTATTCCAC 63 RRV-303T 227-250 TTGAATCTCAACAGCTGCAATTCC 64 RRV-304T 2344-2367 AAACGTTAGTGGAGTTCTAGCGAC 65 4 RRV-401T 137-160 CCCAAGCTTCCCAGTTAACTGGAGCATAACCTG 66 RRV-402T 2145-2168 CCCGGATCCAACTGACTCTCCGGTCATCTCAGC 67 RRV-403T 208-231 GAACGTTGTTGGTTGATAAGGACC 68 RRV-404T 2049-2072 AGTCTTTGAAGCGGGAACAGATGG 69 5 RRV-501T 155-178 CCCAAGCTTATTGACAACACTCAATGCACCACC 70 RRV-502T 1396-1419 CCCGGATCCGAATTAGATCACTTGCCGTTATGC 71 RRV-503T 214-237 GATGCACCACTGACAAACATGAGC 72 RRV-504T 1302-1325 GATACTGGAAACCGAGGCTCTTCC 73 6 RRV-601T 166-189 CCCAAGCTTTCGGCAGATTACCAATTCCTCCAG 74 RRV-602T 1170-1193 CCCGGATCCCAGCGTGTATTTACAGTGGCTTCC 75 RRV-603T 246-269 ACGGGCCGTTTCGACATAGTTAGC 76 RRV-604T 1076-1099 AGAATACGCGATACCAGTTGGACC 77 7 RRV-705T 94-117 CCCAAGCTTTCAAGAGTAGAAGTTGCAGCAACC 78 RRV-706T 923-946 CCCGGATCCAAAGGATTATTGCAGCAATGCAAC 79 RRV-703T 146-169 ACTCTTTACTCTAGTATATACCTC 80 RRV-704T 800-823 AAATCAGACATTGAACAACAGCTG 81 RRV-707T 285-311 TAGCTACAGTTCGAGAGTCAGTCATCC 82 RRV-708T 756-782 CAATAGAATGGTATCTAAGATCGATGG 83 8 RRV-801T 194-217 CCCAAGCTTGAATTGTGGCGGTGGTGCGATACC 84 RRV-802T 920-943 CCCGGATCCAAAATGAAGCGGGAAAGTAATCCG 85 RRV-803T 284-307 CGCTTCACAAATTAACACCGCCAC 86 RRV-804T 847-870 GAACTGGTATGCGTTTACATCCTC 87 9 (RRV) RRV-901T 227-250 CCCAAGCTTCGTATGCAGTGTCCATTGAACCAG 88 RRV-902T 905-928 CCCGGATCCGCATTAATTGGAAGAAATGGTGGC 89 RRV-903T 304-327 TATTTCTGTTGCAGCTTCAGTTGG 90 RRV-904T 835-858 GTTGGAGGTTCTGATGTTCTCGAC 91 9 (DSI) DS1-901T 134-157 CCCAAGCTTACCTGAAAATTATGTAGTCCATCG 92 DS1-902T 882-905 CCCGGATCCCCCACAAGTTCAAAGAATCATGCG 93 DS1-903T 220-243 AGCGTCTAGTGACCCCGTTATTGG 94 DS1-904T 828-851 AATTCAAGTTGGTGGACCGAACGC 95 9 (D) D-901T 122-145 CCCAAGCTTTGTAGTCCATTATTCGAGTCACTG 96 D-902T 886-909 CCCGGATCCCAAACTGAGAGAATGATGAGAGTG 97 D-903T 220-243 AGCGTCCATTGATCCTGTTATTGG 98 D-904T 819-842 TGTAGCTGTAATACAAGTTGGTGG 99 9 (ST3) ST3-901T 219-242 CCCAAGCTTGTATCCATAGATCCAGTAATTGGC 100 ST3-902T 920-943 CCCGGATCCAATGGTGGCAAGTATTCTACACTG 101 ST3-903T 304-327 AATTTGAGTTGGAGCTTCTGATGG 102 ST3-904T 861-884 AACAGCTGATCCCACAACTTCTCC 103 10 RRV-1005T 141-168 GTACAGTTAGGACAGAAGCAATGTATGG 104 RRV-1006T 628-655 ATCGGACCTGATGACTGGTTGAGAAGCC 105 RRV-1007T 359-386 CTTATCAATCATTTCCAGCTGACGTCTC 184 RRV-1008T 533-559 TCCATATGAACCAAAAGAGGTGACTGC 185 11 RRV-1101T 124-147 CCCAAGCTTTGAAACGTACTGTTCACTCCTACC 106 RRV-1102T 470-493 CCCGGATCCTTGAAGCAGATTCCGATTCAGACG 107 RRV-1103T 205-228 CCCAAGCTTGTCGTTTGAAGCAGAATCAGATGG 108 RRV-1104T 403-426 CCCGGATCCGTATCAACAGTTTCCAAGAAGGAG 109 Odd numbered primers are negative sense; Even numbered primers are positive sense. Primers ending with 03, 04 or 07, 08 (genes 7 and 10) are used for reverse transcription and first round PCR. Primers ending with 01, 02 or 05, 06 (genes 7 and 10) are used for second round (nested) PCR and sequencing. Primers ending with 01 and 103T, 1103T, 705T contain 9 nucleotides at the 5' end that include a HindIII site. Primers ending with 02 and 104T, 1104T, 706T contain 9 nucleotides at the 5' end that include a BamHI site.

The RT step and the first round of PCR was done using the Perkin-Elmer GeneAmp Thermostable rTth Reverse Transcriptase RNA PCR Kit (catalog #N808-0069) as per the manufacturer's specifications with modification.

[0044] RT mix for one reaction (multiply .mu.l volumes by number of reactions needed)

TABLE-US-00008 10X RT buffer 2 2.5 mM dNTP mix* 1.6 10 mM MnCl2 2 rTth DNA polymerase (2.5 U/.mu.l) 2 RNase-free water 7.4 TOTAL: 15 .mu.l *prepared by mixing equal volumes of each 10 mM dNTP stock (dATP, dGTP, dCTP, dTTP).

Fifteen .mu.l of RT mix were combined with 2 .mu.l of upstream and 2 .mu.l of downstream first round PCR primers (each are 20 pmoles/.mu.l) and 1 .mu.l of ligated RNA in a 0.5 ml thin-walled GeneAmp tube and overlaid with 2 drops of Sigma mineral oil. Since both plus and minus RNA strands of the genome have been ligated, each of the first round PCR primers could be used for cDNA synthesis during reverse transcription. For each different primer pair used, a negative control was set up that contained 1 .mu.l of water in place of the ligated RNA. The 0.5 ml reaction tubes were loaded in the PE thermal cycler 480 at 4.degree. C. and the cycler was quickly ramped to 80.degree. C. and then ramped back to 45.degree. C. RT was performed at 45.degree. C. for 30 minutes, followed by 50.degree. C. for 30 minutes. Following RT, 80 .mu.l of first-round PCR mix was added to each RT reaction over the oil and the tubes were pulse spun in a microcentrifuge.

[0045] First Round PCR Mix for one reaction (multiply III volumes by the number of reactions needed):

TABLE-US-00009 2.5 mM dNTP mix 2.4 25 mM MgCl2 9 10x chelating buffer 8 RNase-free water 60.0 TOTAL 80 .mu.l

Thermal cycling profile was as follows: 94.degree. C. for 2 minutes; 40 cycles of 94.degree. C. for 1 minute, 45.degree. C. for 1 minute, 72.degree. C. for 1 minute; 72.degree. C., for 10 minutes; and 4.degree. C., soak. Following each first round PCR, a second round (nested) PCR amplification was performed using Perkin-Elmer reagents and AmpliTaq Gold.TM. DNA polymerase (catalog #N808-0241).

[0046] Second Round (nested) PCR mix for one reaction (multiply .mu.l volumes by the number of reactions needed)

TABLE-US-00010 10x PCR buffer II (catalog #N808-0010) 10 25 mM MgCl2 8 2.5 mM dNTP mix 8 AmpliTaq Gold DNA polymerase (5 U/.mu.l) 0.5 RNase-free water 65.5 TOTAL: 92 .mu.l

The second round PCR mix (92 .mu.l) was combined with 2 .mu.l of upstream and 2 .mu.l of downstream second round PCR primers (each are 20 pmoles/.mu.l) and 4 .mu.l of the first round PCR reaction (including negative controls). The reactions were overlaid with 2 drops of Sigma mineral oil and pulse spun. The thermal cycling profile was the same as for the first round PCR except the initial step at 94.degree. C. for 2 minutes was extended to 12 minutes to activate the AmpliTaq Gold.TM. DNAP.

[0047] Second round PCR products (10 .mu.l) were analyzed by agarose gel electrophoresis with ethidium bromide. The ligation PCR products were gel-purified using the Promega Wizard.TM. PCR preps DNA purification system. A consensus sequence for the PCR amplified products was determined. If necessary to resolve nucleotide sequence ambiguities, the PCR products were cloned using pGEM-T Easy Vector System I Promega, Madison, Wis.) and multiple clones were sequenced.

[0048] DNA Sequencing

[0049] A consensus sequence for the PCR amplified products was generated by using the Applied Biosystems-PRISM fluorescent dye terminator cycle sequencing kit with AmpliTaq DNA Polymerase-FS, and the Applied Biosystems 377 DNA sequencer (ABI-Perkin-Elmer). Over 100 primers spaced approximately 200 nucleotides apart on each strand were used for sequencing both strands of the PCR products. When needed, gel purified PCR products were cloned by using pGEM-T Easy Vector System I (Promega, Madison, Wis.). Positive clones were selected by T7/SP6 primer-specific PCR screening and the amplified PCR products of the positive clones were directly sequenced as described above. Sequences were analyzed by using MacVector gene analysis program (Oxford Molecular, Oxford, UK).

[0050] Results

[0051] Eleven full length gene segments were amplified for each virus strain using high fidelity RNA-PCR amplification reactions as described above. Both strands of the amplified products were sequenced directly by using RRV-specific primers, except for gene segment 9, for which strain specific primers were used. The sequences for each of the eleven RRV (MWVS-7) genes are SEQ ID NO: 1-11, respectively as shown in Table 1 above. Gene segment 9 sequences for the three reassortants are SEQ ID NO:12 (DxRRV (MWVS-5)), SEQ ID NO:13 (DS1xRRV (MWVS-6)), and SEQ ID NO: 14 (ST3xRRV (MWVS-8)). The putative protein sequences for each of these are SEQ ID NO: 15-28, respectively, as shown in Table 2 above.

[0052] Table 4 lists nucleotide differences identified between the parent RRV (MWVS-7) strain and the three reassortant viruses D.times.RRV (MWVS-5), DS1.times.RRV (MWVS-6), and ST3.times.RRV (MWVS-8). These nucleotide differences were common to both clinical (MWVS 1-4) and commercial (MWVS 5-8) seeds.

TABLE-US-00011 TABLE 4 List of nucleotide changes identified in the gene segments of the three reassortants as compared to the progenitor RRV strain MWVS-5 MWVS-6 & MWVS-8 & MWVS- MWVS-2 & MWVS- Nucleotide 3 (D .times. (DS1 .times. 4 (ST3 .times. Amino Gene Position RRV) RRV) RRV) Acid 1 2120 A.fwdarw.G -- -- Lys.fwdarw.Arg 2 493* -- -- A.fwdarw.C silent 947 C.fwdarw.T -- -- Leu.fwdarw.Phe 4 119 T.fwdarw.C T.fwdarw.C -- Leu.fwdarw.Pro 809 A.fwdarw.G A.fwdarw.G -- Tyr.fwdarw.Cys 977 T.fwdarw.C -- -- Met.fwdarw.Thr 1463 -- -- C.fwdarw.A Thr.fwdarw.Asn 1755 T.fwdarw.C -- -- silent 5 84 C.fwdarw.T -- -- silent 347 -- T.fwdarw.C -- Leu.fwdarw.Ser 6 376 -- -- A.fwdarw.C Lys.fwdarw.Thr 756 G.fwdarw.A G.fwdarw.A G.fwdarw.A Ala.fwdarw.Thr 1008 G.fwdarw.A -- -- Ala.fwdarw.Thr 1041 A.fwdarw.G -- -- Lys.fwdarw.Glu 7 387 -- A.fwdarw.G A.fwdarw.G Asn.fwdarw.Ser 10 174 G/A mix.dagger. -- G/A mix.dagger. Ala/Thr mix 218 A.fwdarw.G -- -- silent 11 180 G.fwdarw.A -- -- silent -- Identical to RRV. .dagger.Position 174 is an `A` in RRV (MWVS-1 and MWVS-7).

Example 2

Clonal Analysis

[0053] Materials and Methods

[0054] Viral Stocks

[0055] Viral stocks were from the Wyeth Laboratories, Inc., in Marietta, Pa., USA, rotavirus seed bank system. The strains used in this study are:

Working virus seeds for commercial vaccine production:

TABLE-US-00012 1) D .times. RRV Lot MWVS-5 Type-1, Serotype G1 2) DS1 .times. RRV Lot MWVS-6 Type-2, Serotype G1 3) RRV Lot MWVS-7 Type-3, Serotype G3 4) ST3 .times. RRV Lot MWVS-8 Type-4, Serotype G4

Working virus seeds for clinical vaccine production:

TABLE-US-00013 5) RRV Lot MWVS-1 (ST3), Serotype G3 6) DS1 .times. RRV Lot MWVS-2 (TS2), Serotype G2 7) D .times. RRV Lot MWVS-3 (ST1), Serotype G1 8) ST3 .times. RRV Lot MWVS-4 (ST4), Serotype G4

Commercial vaccine lots used in clonal analysis were as follows:

Serotype G1: I973020, I973017, I983003, I983026

Serotype G2: I973030, I973029, I983008, I983037

Serotype G3: I973026, I983021, I983032

Serotype G4: I97003, I973040, I983030, I973034.

[0056] All clinical isolates were plaque purified three times, except for isolates 37 and 38 (purified twice).

[0057] Serotype G1 clinical isolates: clones 1, 16, 22 and 29

[0058] Serotype G2 clinical isolates: clones 3, 4, 8, 9 and 19

[0059] Serotype G3 clinical isolates: clones 5, 6, 10, 11, 12, 20, 21 and 25

[0060] Serotype G4 clinical isolates: clones 37 and 38.

[0061] RNA Isolation

[0062] Total RNA was extracted from clinical samples, aliquots of virus seed or aliquots of vaccine virus using Trizol-LS.TM. reagent (Life Technologies, Grand Island, N.Y.). RNA was resuspended in nuclease-free water and used for all RT/PCR amplifications.

[0063] Reverse Transcription-Polymerase Chain Reaction (RT-PCR) Amplification

[0064] Clonal analysis was carried out to determine the following: 1) the micro-heterogeneity in MWVS-1, 2, 3 and 4 at the 7 nucleotide positions (position 2388 in gene 3, positions 1674 and 1953 in gene 4, positions 75, 667 and 1204 in gene 5, and position 556 in gene 9) which were found to differ from consensus sequence in more than one clinical isolate; 2) the micro-heterogeneity in the four seed strains (MWVS-1, 2, 3 and 4) at position 174 in gene 10, found to contain a base mixture in serotypes G1 and G4 by consensus sequencing; and 3) the micro-heterogeneity in genes 3 and 10 at nucleotide positions 2388 and 174, respectively, in the commercial vaccine lots and their seeds (MWVS-5, 6, 7 and 8).

[0065] A portion of each gene spanning the nucleotide position(s) of interest was amplified by RT-PCR using the GeneAmp XL RNA PCR Kit (Perkin-Elmer) and primer pairs listed in Table 5.

TABLE-US-00014 TABLE 5 Primer Pairs Used in RT/PCR Amplification of Clinical and Commercial Seeds for Clonal Analysis Nucleotide Primer Primer Sequence SEQ Gene Of Interest Name (5' -> 3') ID 3 2388 RRV-307 GCTGATATAGAAGGTGGAAAG 110 RRV-302A GGTCACATCATGACTAGTGTG 111 4 1674 RRV-406 GAGCACCATAGATGCAGCT 112 RRV-409 CTGACAGATGAAGAAACATC 113 1953 RRV-406 GAGCACCATAGATGCAGCT 114 RRV-408 GAGTCAGTTACTAGATCTGC 115 5 75, 667, RRV-501A GGCTTTTTTTTGAAATGTCT 116 1204 TGTGTTAGC RRV-507 GTGCATAACGGCAAGTGATC 117 9 (G1) 556 RRV-901 GGCTTTAAAAGCGAGAATTT 118 CCGT DxRRV- GGTCACATCGAACAATTCTA 119 902 ATCTAAG 10 174 RRV-1001 GGCTTTTAAAAGTTCTGTTC 120 CGAGAG RRV-1002 GGTCACATTAAGACCGTTCC 121 TTC

Primers common to all four serotypes were used for RT-PCR amplification of fragments from all genes except gene 9 where primers specific to gene 9 of human rotavirus serotype G1 (HRV-D) were used. RT-PCR amplification was carried out as follows:

[0066] RT Reaction

TABLE-US-00015 RNA (RNA + water) 10 .mu.l RNase-free water -- 5X XL RT buffer 4 .mu.l dNTP mix (2.5 mM each dNTP) 1.6 .mu.l rTth polymerase 2.5 .mu.l 25 mM Mn (OAc2) 0.88 .mu.l RT (downstream) primer (20 pmoles/.mu.l) 1 .mu.l TOTAL: 20 .mu.l

RNA (100-500 ng per reaction) was mixed with water and 5.times. SL RT buffer in a Gene-amp tube. The mixture was denatured at 96.degree. C. for 4 minutes in a preheated thermal cycler, and then placed on ice immediately for 3 minutes to quick cool. Samples were pulse-spun in microfuge to remove any condensation on caps, and the remaining ingredients were added. A drop of mineral oil was added to each tube, and samples were placed in pre-heated thermal cycler at 40.degree. C. The RT thermal cycle was 40.degree. C. for 60 minutes, followed by 45.degree. C. for 60 minutes and then 4.degree. C., soak. If several different fragments from the same RNA template were amplified, the entire reaction was scaled up in one tube, eliminating only the primer from the mix. One .mu.l of the RT (+sense) primer was added to each reaction tube, and then 19 .mu.l of the scaled-up RT mix were added.

[0067] PCR Reaction

TABLE-US-00016 RNase-free water 58.8 .mu.l 5X XL Chelating Buffer 16 .mu.l 25 mM Mg (OAc2) 3.2 .mu.l PCR (upstream) primer (20 pmoles/.mu.l) 1.5 .mu.l RT (downstream) primer (20 pmoles/.mu.l) 0.5 .mu.l TOTAL 80 .mu.l.

The reagents were mixed for each sample; 80 .mu.l PCR mix were added to the 20 .mu.l RT reaction under the oil, and mixed by pipetting up and down several times. The samples were placed in pre-heated thermal cycler (hot-start) at 94.degree. C. and cycled as follows: 94.degree. C. denaturation for 3 minutes, followed by 40 cycles of denaturation at 94.degree. C. for 1 minutes primer annealing at 40.degree. C. for 30 seconds, and extension at 70.degree. C. for two minutes. A final extension step was run at 70.degree. C. for 10 minutes, followed by a soak cycle at 4.degree. C.

[0068] Ten .mu.l of reaction were run on 1% agarose gel. Products were purified using Promega's Wizard PCR preps DNA purification system (Madison Wis.) either directly or using gel purification from low-melting agarose.

[0069] Cloning of RT-PCR Products

[0070] The RT-PCR products from genes 3, 4, 5, 9 and 10 of MWVS-1, 2, 3 and 4 were cloned into the appropriate restriction endonuclease sites of either pGEM-3Zf(+).TM., pGEM-5Zf(+).TM., or pGEM T-Easy.TM. (T/A cloning) plasmid vectors using standard cloning methods.

[0071] Screening for Positive Clones

[0072] Approximately 40-100 colonies from each plasmid construct were screened for the presence of cloned RRV sequences by PCR using primers specific to the SP6 and T7 promoter sequences (SP6:5'TATTTAGGTGACACTATAG3') (SEQ ID NO.: 122) (T7:5'TAATACGACTCACTATAGGG3') (SEQ ID NO.: 123) flanking the cloning sites of each vector as follows: a single colony was transferred to 10 .mu.l of water in a 0.5 ml Gene-Amp.RTM. tube using a sterile inoculating needle, and overlaid with a drop of mineral oil. The tubes were placed in a pre-heated thermal cycler at 96.degree. C. for 10 minutes to lyse bacterial cells, and cooled to 4.degree. C. for 3-4 minutes. Then, 40 .mu.l PCR mix was added to each tube underneath the oil and pipetted several times to mix the sample.

[0073] PCR MIX (50 reactions):

TABLE-US-00017 10X PCR buffer with MgCl.sub.2 (Perkin-Elmer) 200 .mu.l dNTP mix (2.5 mM each dNTP) (Perkin-Elmer) 250 .mu.l SP6 promoter primer (20 pmole/.mu.l) 50 .mu.l T7 promoter primer (20 pmole/.mu.l) 50 .mu.l Nuclease-free water 1438 .mu.l Taq DNA polymerase (Perkin-Elmer) 5 U/.mu.l 12 .mu.l TOTAL 2000 .mu.l

The mixture was placed in a pre-heated thermal cycler (hot-start) at 94.degree. C. and cycled as follows: initial 94.degree. C. denaturation for 3 minutes, followed by 40 cycles of denaturation at 94.degree. C. for 1 minute, primer annealing at 42.degree. C. for 1 minute, and extension at 72.degree. C. for 2 minutes, terminating with a soak file at 4.degree. C. Each PCR product (10 .mu.l) was run on a 1% agarose gel to confirm the presence of an insert of the appropriate size.

[0074] Sequence Determination of Positive Clones

[0075] PCR products from 25-30 positive clones were directly purified from the PCR reaction using the PCR Preps Kit (Promega) and eluted in 25 .mu.l nuclease-free water. Three .mu.l of the purified product were then sequenced using Taq Cycle Sequencing terminator mix, FS (ABI) and primers specific for the SP6 and T7 promoters which flank the MCS of each plasmid vector.

[0076] Sequence Configuration of Clinical Virus Isolates

[0077] RNA was extracted from 400 .mu.l of each clinical virus isolate as previously described. For each virus, a fragment containing the nucleotide position(s) of interest was amplified from 200-600 ng of RNA using the GeneAmp XL RNA PCR Kit (Perkin-Elmer) and primer pairs shown in Table 6. Consensus sequence of the resulting RT/PCR product, including the nucleotide of interest, was determined using Taq cycle sequencing and the ABI 377 DNA sequencer with primers denoted in Table 6.

TABLE-US-00018 TABLE 6 Primers Used for RT/PCR Amplification and Sequence Confirmation of Clinical Virus Isolates Gene Clone # # (Serotype) NT # Primer Pairs For RT/PCR and Sequencing 3 3 (G2) 283 301A .fwdarw. GGCTATTAAAGCAGTACGAGTAGTGTG SID 313 .fwdarw. CGTGCTATCGGTAAAGAAGTAGT SID 4 (G2) 2288 307 .fwdarw. GCTGATATAGAAGGTGGAAAG 124 302A .fwdarw. GGTCACATCATGACTAGTGTG 125 5 (G3) 1306 305 .fwdarw. GACTGCTATGGATTTAGAGC 126 311 .fwdarw. GATAATGCGTATAATGCCAC 127 6 (G3) 169 301A .fwdarw. GGCTATTAAAGCAGTACGAGTAGTGTG 128 314 .fwdarw. CTCAACAGCTGCAATTCCTG 129 9 (G2) 2388 307 .fwdarw. GCTGATATAGAAGGTGGAAAG 130 302A .fwdarw. GGTCACATCATGACTAGTGTG 131 21 (G3) 2388 307 .fwdarw. GCTGATATAGAAGGTGGAAAG 132 302A .fwdarw. GGTCACATCATGACTAGTGTG 133 25 (G3) 308 301A .fwdarw. GGCTATTAAAGCAGTACGAGTAGTGTG 134 313 .fwdarw. CGTGCTATCGGTAAAGAAGTAGT 135 29 (G1) 874 304 .fwdarw. GTCTCAGTTGGACATTGGAC 136 312 .fwdarw. GAATATGGAGTGTCAAGTGGGTC 137 38 (G4) 448 301A .fwdarw. GGCTATTAAAGCAGTACGAGTAGTGTG 138 313 .fwdarw. CGTGCTATCGGTAAAGAAGTAGT 139 4 1 (G1) 1953 406 .fwdarw. GAGCACCATAGATGCAGCT 140 408 .fwdarw. GAGTCAGTTACTAGATCTGC 141 6 (G3) 1608 405 .fwdarw. CAGTAATGACTGGCGGAGCAGT 142 409 .fwdarw. CTGACAGATGAAGAAACATC 143 11 (G3) 417 401 .fwdarw. GGCTATAAAATGGCTTCGCTC 144 412 .fwdarw. GTCACAAAATGCTGTCATG 145 12 (G3) 1481 405 .fwdarw. CAGTAATGACTGGCGGAGCAGT 146 409 .fwdarw. CTGACAGATGAAGAAACATC 147 16 (G1) 1953 406 .fwdarw. GAGCACCATAGATGCAGCT 148 408 .fwdarw. GAGTCAGTTACTAGATCTGC 149 19 (G2) 1674 405 .fwdarw. CAGTAATGACTGGCGGAGCAGT 150 409 .fwdarw. CTGACAGATGAAGAAACATC 151 20 (G3) 1674 405 .fwdarw. CAGTAATGACTGGCGGAGCAGT 152 402 .fwdarw. GGTCACATCCTCTGGAAATTGG 153 5 6 (G3) 75 501A .fwdarw. GGCTTTTTTTTGAAATGTCTTGTGTTAGC 154 509 .fwdarw. GTCTATATGGCAAATCTATGC 155 20 (G3) 75 501A .fwdarw. GGCTTTTTTTTGAAATGTCTTGTGTTAGC 156 509 .fwdarw. GTCTATATGGCAAATCTATGC 157 3 (G2) 1204 504 .fwdarw. CTCAAACTGATTTACATCATG 158 507 .fwdarw. GTGCATAACGGCAAGTGATC 159 4 (G2) 1204 504 .fwdarw. CTCAAACTGATTTACATCATG 160 507 .fwdarw. GTGCATAACGGCAAGTGATC 161 5 (G3) 394 501A .fwdarw. GGCTTTTTTTTGAAATGTCTTGTGTTAGC 162 509 .fwdarw. GTCTATATGGCAAATCTATGC 163 8 (G2) 667 503 .fwdarw. CAGAGGAAATGTAGAAATGAG 164 508 .fwdarw. CAATCCATGTCTCTGAATGC 165 9 (G2) 667 503 .fwdarw. CAGAGGAAATGTAGAAATGAG 166 508 .fwdarw. CAATCCATGTCTCTGAATGC 167 10 (G3) 1186 504 .fwdarw. CTCAAACTGATTTACATCATG 168 507 .fwdarw. GTGCATAACGGCAAGTGATC 169 29 (G1) 1219 504 .fwdarw. CTCAAACTGATTTACATCATG 170 507 .fwdarw. GTGCATAACGGCAAGTGATC 171 9 22 (G1) 556 901 .fwdarw. GGCTTTAAAAGCGAGAATTTCCGT 172 D-902 .fwdarw. GGTCACATCGAACAATTCTAATCTAAG 173 29 (G1) 556 901 .fwdarw. GGCTTTAAAAGCGAGAATTTCCGT 174 D-902 .fwdarw. GGTCACATCGAACAATTCTAATCTAAG 175 37 (G4) 263 901 .fwdarw. GGGTTTAAAAGCGAGAATTTCCGT 176 ST3-905 .fwdarw. GTACATGATGATCCCATTGA 177 10 22 (G1) 92 1001 .fwdarw. GGCTTTTTAAAAGTTCTGTTCCGAGAG 178 1002 .fwdarw. GGTCACATTAAGACCGTTCCTTC 179 22 (G1) 174 1001 .fwdarw. GGCTTTTTAAAAGTTCTGTTCCGAGAG 180 1002 .fwdarw. GGTCACATTAAGACCGTTCCTTC 181 22 (G1) 218 1001 .fwdarw. GGCTTTTTAAAAGTTCTGTTCCGAGAG 182 1002 .fwdarw. GGTCACATTAAGACCGTTCCTTC 183

Results

[0078] Analysis of Micro-Heterogeneity in Clinical Virus Seeds (MWVS-1, 2, 3 and 4)

[0079] Sequence analysis of genes 3, 4, 5, 9 and 10 of the 19 clinical viral isolates obtained from the stools of ROTAMUNE.TM. recipients had heterogeneity at 24 nucleotide positions when compared to consensus sequence of the clinical seeds (MWVS-1, 2, 3 and 4). One of these sites, nucleotide position 174 of gene 10, contains a base mixture in the serotype G1 and G4 viruses. In addition, 7 of the 24 nucleotide base substitutions identified in the clinical virus isolates (i.e., position 2388 in gene 3; positions 1674 and 1953 in gene 4; positions 75, 667 and 1204 in gene 5; and position 556 in gene 9) were observed in more than one virus sample. To establish the precise level of microheterogeneity present at nucleotide position 174 of gene 10, as well as to determine whether the seven nucleotide base substitutions found in more than one clinical virus isolate were the result of sequence micro-heterogeneity in the clinical virus seeds, clonal analysis was carried out on each of the four seeds at these eight nucleotide positions.

[0080] The clonal analysis revealed micro-heterogeneity at position 2388 in gene 3 of the G2 clinical seed (MWVS-2), and at position 174 in gene 10 of the G1, G21 and G4 virus seeds (MWVS-3, 2 and 4, respectively). Twenty-six percent of the viral genomes in the G2 clinical seed were found to contain minor species C at position 2388 of gene 3, while the remaining 74% of the genomes contained T at this position. As predicted by consensus sequence, heterogeneity (i.e., G>A) was observed for position 174 of gene 10 in the G1 (MWVS-3) and G4 (MWVS-4) clinical seeds, where the minor species A was found in 12% and 7% of the genomes, respectively. In contrast, the genomes of the RRV parental strain contained solely A at this position. The analysis also revealed a minor population of 5% G at the same position in the G2 virus seed (MWVS-2) which was not detected by consensus sequencing.

[0081] The remainder of the nucleotide substitutions which occur in more than one of the clinical isolates (i.e., positions 1674 and 1953 of gene 4; positions 75, 667 and 1204 of gene 5; and position 556 of gene 9) apparently do not result from measurable sequence micro-heterogeneity within the virus seeds, since mixtures of bases were not found at these positions by clonal analysis. Table 7 summarizes the micro-heterogeneity found in the clinical virus seeds (MWVS-1, 2, 3 and 4) at the variable nucleotide positions. The micro-heterogeneity at these positions may exist at levels below the detection limits, or the substitutions observed in the clinical isolates may represent adaption within the human gastrointestinal tract.

[0082] Sequence Confirmation of Clinical Virus Isolates

[0083] The sequence of the clinical virus isolates at each of the 24 nucleotide positions where the sequence had been found to diverge from consensus was re-examined. Table 8 lists the 24 nucleotide positions of heterogeneity.

[0084] Analysis of the Genetic Stability of RRV at Positions 2388 and 174 in Genes 3 and 10, Respectively

[0085] Consensus sequencing of the commercial seeds (MWVS-5, 6, 7 and 8) revealed heterogeneity at positions 2388 and 174 in genes 3 and 10, respectively. To compare the precise levels of micro-heterogeneity in the clinical and commercial virus seeds at these positions, as well as to analyze the genetic stability of these nucleotide positions during vaccine manufacture, clonal analysis of these positions was carried out in the commercial virus seeds and several vaccine lots generated from them.

[0086] The data showed that a similar level of micro-heterogeneity existed in the commercial (MWVS-5, 6, 7 and 8) and clinical (WVS-1, 2, 3 and 4) vaccine seeds at positions 2388 and 174 in genes 3 and 10, respectively. By clonal analysis, 15% of the minor species (C) was observed at nucleotide position 2388 in the G2 commercial virus seed (MWVS-2), compared to 26% C in the G2 clinical virus seed (MWVS-2), as

Serotype 1-MWVS-3=DxRRV; Serotype 2=MWVS-2=DS1xRRV; Serotype 3=MWVS-1=RRV; Serotype 4=MWVS-4=ST3xRRV

TABLE-US-00019 TABLE 7 Micro-Heterogeneity within clinical virus seeds (MWVS 1, 2, 3 and 4) Nucleotide Nucleotide Representing Representing Genomic Consensus Minor Number of Serotype Nucleotide (% Variant (% Clones Gene (Virus Seed) Position population) population) Sequenced 3 1 (MWVS-3) 2388 T (100%) C (0%) 28 2 (MWVS-2) T (74%) C (26%) 27 3 (MWVS-1) T (100%) C (0%) 60 4 (MWVS-4) T (100%) C (0%) 26 4 1 (MWVS-3) 1674 A (100%) G (0%) 26 2 (MWVS-2) A (100%) G (0%) 24 3 (MWVS-1) A (100%) G (0%) 33 4 (MWVS-4) A (100%) G (0%) 31 1 (MWVS-3) 1953 C (100%) A (0%) 28 5 1 (MWVS-3) 75 C (100%) A (0%) 25 2 (MWVS-2) C (100%) A (0%) 20 3 (MWVS-1) C (100%) A (0%) 20 4 (MWVS-4) C (100%) A (0%) 20 1 (MWVS-3) 667 C (100%) T (0%) 26 2 (MWVS-2) C (100%) T (0%) 19 3 (MWVS-1) C (100%) T (0%) 20 4 (MWVS-4) C (100%) T (0%) 20 1 (MWVS-3) 1204 G (100%) A (0%) 26 2 (MWVS-2) G (100%) A (0%) 20 3 (MWVS-1) G (100%) A (0%) 20 4 (MWVS-4) G (100%) A (0%) 21 9 1 (MWVS-3) 556 G (100%) A (0%) 41 10 1 (MWVS-3) 174 *G (88%) *A (12%) 26 2 (MWVS-2) A (95%) G (5%) 22 3 (MWVS-1) A (100%) G (0%) 21 4 (MWVS-4) *G (93%) *A (7%) 28 *Mixed base depicted in MWVS-3 and MWVS-4 by consensus sequencing (see Table 4).

TABLE-US-00020 TABLE 8 Nucleotide Sequence Differences Between Clinical Virus Isolates and Consensus Sequence of MWVS. Clone # Gene # (Serotype) NT # NT Change AA # AA Change Gene 3 3 (G2) 283 TGC (TGT).sup.1 4 (G2) 2288 No change.sup.3 747 5 (G3) 1306 AGC (AGT) 6 (G3) 169 ACA (ACG) 9 (G2) 2388 TCA (TTA) 780 Phe (Leu).sup.2 21 (G3) 2388 No change 780 25 (G3) 308 No change 87 29 (G1) 874 TTC (TTA) 38 (G4) 448 GAC (GAT) Gene 4 1 (G1) 1953 TCA (TCC) 6 (G3) 1608 GGC (GGT) 11 (G3) 417 ACG (ACA) 12 (G3) 1481 ACA (AGA) 501 Thr (Arg) 16 (G1) 1953 TCA (TCC) 19 (G2) 1674 No change 20 (G3) 1674 No change Gene 5 6 (G3) 75 AAA (ACA) 22 Lys (Thr) 20 (G3) 75 AAA (ACA) 22 ys (Thr) 3 (G2) 1204 GAA (GAG) 4 (G2) 1204 GAA (GAG) 5 (G3) 394 No change 8 (G2) 667 TTT (TTC) 9 (G2) 667 TTT (TTC) 10 (G3) 1186 TAC (TAT) 29 (G1) 1219 ACG (ACA) Gene 9 22 (G1) 556 ATA (GTA) 170 Ile (Val) 29 (G1) 556 ATA (GTA) 170 Ile (Val) 37 (G4) 263 CGA (CAA) 72 Arg (Gln) Gene 10 22 (G1) 92 ATA (ATG) 17 Ile (Met) 22 (G1) 174 ACA (GCA) 45 Thr (Ala) 22 (G1) 218 AAG (AAA) .sup.1Underlined nucleotide is different in the clinical isolate when compared to the Manufacture's Working Virus Seed (MWVS). Triplet in parentheses is the consensus sequence of MWVS. .sup.2Amino acid (aa) in parentheses is present in the relevant MWVS. .sup.3Initial clonal sequence analysis had indicated heterogeneity at the positions listed as "No change". Conseusus sequence analysis of these isolates revealed sequence identity with the corresponding MWVS. Boldface type indicates that the nucleotide change was identified in more than one clinical isolate.

shown in Table 9. Analysis of the micro-heterogeneity present in the commercial seeds at nucleotide position 174 in gene 10 revealed 25% and 23% of the minor species (A) in the G1 and G4 viruses, respectively, as shown in Table 10; these were similar to the levels observed in the clinical virus seed bank (12% and 7% respectively). As observed in the clinical seeds, the RRV G3 commercial seed strain (MWVS-7) contained solely A at nucleotide position 174. The G2 strain of the commercial seed bank (MWVS-6), however, did not retain the same minor population observed in the G2 clinical strain (5% G), but instead, resembled the G3 RRV strain at this position, harboring 100% A at this site by clonal analysis.

[0087] Determination of the heterogeneity at nucleotides 2388 and 174 of genes 3 and 10, respectively, in several vaccine lots produced from the commercial manufacturer's working virus seed allowed the monitoring of the genetic stability of these positions after passage in vitro. Four vaccine lots of each serotype, generated from the commercial virus seeds (MWVS-5, 6, 7 and 8) were analyzed by clonal analysis. Four G2 vaccine lots (I973029, I983008, I983037 and I973030) were analyzed for heterogeneity at nucleotide position 2388 in gene 3, and in each case, the level of the minor variant (4%, 8%, 8% and 16% C) was found to be similar to the 15% observed in the G2 commercial seed (MWVS-6) (Table 9). For nucleotide 174 in gene 10, each of the four G1 and G4 vaccine lots contained the minor species (A) at a level similar to that seen in its corresponding commercial seed. The four G1 vaccine lots (I973020, I973017, I983026 and I983003) contained 22%, 6%, 33% and 4% A, respectively, at nucleotide position 174 compared to the 25% A observed in the G1 commercial (MWVS-5) seed. Likewise, the G4 vaccine lots (I973034, I973004, I973030 and I983030) retained 9%, 14%, 19% and 23% A, respectively, at this position, similar to the 23% A found in the G4 (MWVS-8) seed (Table 10). These data indicate that conditions used in the vaccine manufacturing process preserve the identity of the four RRV vaccine strains as reflected in their genomic nucleotide sequence.

TABLE-US-00021 TABLE 9 Base Composition at Nucleotide 2388 in Gene 3 for Serotype 2 Manufacturer's Working Virus Seed and Vaccine Concentrates Nucleotide representing consensus/variant (% population) Manufacturer's Working Virus Seed - Commercial RRV Commercial Vaccine Concentrates and Harvests Serotype (MWVS-6) Lot #I973030 Lot #I973029 Lot #I983008 Lot #I983037 2 T/C (85/15) T/C (84/16) T/C (96/4) T/C (92/8) T/C (92/8)

TABLE-US-00022 TABLE 10 Base Composition at Nucleotide 174 in Gene 10 for Manufacturer's Working Virus Seeds and Vaccine Concentrates Nucleotide Representing Consensus/Variant (% Population) Manufacturer's Working Virus Serotype Seeds RRV Commercial Vaccine Concentrates and Harvests* 1 G/A (75/25).sup.24 G/A (78/22).sup.23 G/A (94/6).sup.32 G/A (67/33).sup.24 G/A (96/4).sup.24 2 A/G (100/0).sup.29 A/G (100/0).sup.26 A/G (100/0).sup.21 A/G (100/0).sup.21 A/G (100/0).sup.24 3 A/G (100/0).sup.30 A/G (100/0).sup.43 A/G (100/0).sup.23 A/G (100/0).sup.37 Not Determined 4 G/A (77/23).sup.30 G/A (91/9).sup.23 G/A (86/14).sup.28 G/A (81/19).sup.21 G/A (77/23).sup.71 Manufacturer's Working Virus Seeds = MWVS-5, 6, 7 and 8 for Serotypes 1, 2, 3 and 4, respectively. *Vaccine Concentrates and Harvests: Serotype 1 - Lot # I973020, I973017, I983026 and I983003, respectively. Serotype 2 - Lot # I973030, I973029, I983008 and I983037, respectively. Serotype 3 - Lot # I973026, I983021 and I983032, respectively. Serotype 4 - Lot # I973034, I973004, I973040 and I983030, respectively. Superscripts denote the number of clones sequenced for each virus lot

Example 3

Mutant Analysis by PCR and Restriction Enzyme Cleavage (MAPREC)

[0088] A sensitive and direct method to monitor the levels of micro-heterogeneity at nucleotide 2388 of gene 3, Mutant Analysis by PCR and Restriction Enzyme Cleavage (MAPREC), was developed.

[0089] Materials

[0090] The following materials were used: Life Technologies (Gibco-BRL) SuperScript.TM. Preamplification for First Strand cDNA Synthesis kit; RNase-free water; RRV Serotype 2 total RNA; Gene 3 nucleotide 2388 100% T DNA control template (1/30 dilution of stock); Gene 3 nucleotide 2388 100% C DNA control template (1/30 dilution of stock); Perkin Elmer Thermal Cycler PE 480; primer RRV-G3-EcoRI (20 pmole/.mu.l); primer RRV-302A-flourescein (20 pmole/.mu.l); Perkin-Elmer Taq DNA polymerase; mineral oil (Sigma), molecular biology grade 5; Perkin-Elmer 0.5 ml Gene-Amp reaction tubes; Pharmacia G-40 AutoSeq spin columns; restriction endonuclease Eco RI (10 U/.mu.l) (Roche Molecular Biochemicals); glycerol; bromophenol blue; xylene cyanol; Bio-Rad 40% acrylamide:bis-acrylamide (38:2) liquid; distilled water; 10.times.TBE (Gibco-BRL); TEMED; ammonium persulfate; two 20.times.20 cm vertical polyacrylamide gel electrophoresis apparatus with 0.75 mm, 20-well combs and 0.75 mm spacers; flat head gel loading pipet tips; Molecular Dynamics Flourimager 595.

[0091] Reverse Transcription

[0092] For each sample, 500-1000 ng RNA and water were added to a 0.5 .mu.l microfuge tube for a final volume of 11 .mu.l. It was preferable to use 1000 ng RNA per reaction if the RNA is concentrated enough; however, 500 ng per reaction was usually sufficient to generate product. The RNA and water mixture was heated in a preheated thermal cycler at 96.degree. C. for 4 minutes, and then immediately placed on ice for 2-3 minutes. During that time, the RT mix was made as follows:

TABLE-US-00023 10X PCR Buffer (Superscript II kit) 2 .mu.l 25 mM Magnesium chloride (Superscript II kit) 2 .mu.l 10 mM dNTP mix (Superscript II kit) 1 .mu.l 0.1 M DTT (Superscript II kit) 2 .mu.l RV-302A-Flouroscein primer (20 pmole/.mu.l) 1 .mu.l TOTAL: 8 .mu.l.

[0093] After cooling, the chilled RNA and water mixture was briefly centrifuged to spin down any condensation on the tube cap. Then 8 .mu.l RT mix (above) was added to each tube of RNA and water mixture, and mixed by pipeting up and down several times. A drop of mineral oil was overlaid in the reaction tube, and the tube was then incubated in a pre-heated thermal cycler at 50.degree. C. for 5 minutes. Subsequently, 1 .mu.l Superscript II Reverse Transcriptase 200 U/.mu.l (kit) was added to each reaction tube underneath the oil layer. The reverse transcription process was allowed to proceed at 50.degree. C., for 60 minutes, followed by 70.degree. C. for 15 minutes to inactivate the RT; the mixture was then soaked at 4.degree. C. One .mu.l RNase H (Superscript II kit) was added to each reaction underneath the oil, and the reaction was incubated in a thermal cycler at 37.degree. C. for 20 minutes. The first-strand cDNA resulting from this procedure could either be transferred to 4.degree. C. and used directly in the PCR reaction, or stored at -20.degree. C.

[0094] PCR Step

[0095] It should be noted that in addition to the vaccine samples, each assay must be accompanied by two DNA control reactions containing either 100% T or 100% C DNA templates, to validate each assay.

[0096] PCR mix was prepared as follows:

TABLE-US-00024 10X PCR Buffer (Superscript II kit) 5 .mu.l 25 mM magnesium chloride (Superscript II kit) 3 .mu.l 10 mM dNTP mix (Superscript II kit) 1 .mu.l RRV-302A-Flouroscein primer (20 pmole/.mu.l) 1.5 .mu.l RRV-G3-EcoRI primer (20 pmole/.mu.l) 1.5 .mu.l Taq DNA polymerase (Perkin-Elmer) 0.5 .mu.l Nuclease-free water 35 .mu.l TOTAL: 47.5 .mu.l.

[0097] The PCR mix was aliquoted to a fresh 0.5 ml tube for each sample. Three .mu.l of the first strand cDNA (from the RT reaction), 3 .mu.l of 1/30 dilution of 100% T DNA, or 3 .mu.l of 1/40 dilution of 100% C DNA were added to each PCR reaction as a template, and the reaction was then overlaid with a drop of mineral oil. The reaction was placed in a pre-heated thermal cycler, and cycled for 94.degree. C. for 1 minutes (1 cycle), followed by 94.degree. C. for 30 seconds and 60.degree. C. for 3 minutes (40 cycles), and then a 4.degree. C. soak.

[0098] Since the PCR products being generated are fluorescent, their exposure to light should be minimized by placing a piece of aluminum foil over the thermal cycler cover during cycling. Storage of the PCR products should always be in light tight containers.

[0099] Purification and Digestion of PCR Products

[0100] A Pharmacia G-40 spin column was prepared for use in the purification of each PCR product. Each column was vortexed for 2-3 seconds to thoroughly resuspend the Sephadex beads; the screw cap was loosened one-half turn; the bottom of the column was snapped off and discarded, and then the screw cap was removed and discarded as well. Each column was placed in an empty 1.5 ml Eppendorf tube and spun in an Eppendorf microfuge at 3200 rpm (approximately 200.times.g) for 1 minute. Columns were then used immediately to avoid drying of the resin. The PCR reaction described above was removed from each tube, being careful to transfer as little oil as possible. The G-50 spin column was removed from its tube, and the entire 50 .mu.l PCR reaction was slowly loaded onto the center of the angled resin in the column. The loaded column was then placed into a fresh, labeled 1.5 ml Eppendorf microfuge tube. The tubes were spun at 3200 rpm for 1 minute to collect the effluent containing the purified PCR product, and column was discarded. This purification step allows subsequent digestion of the PCR product with EcoRI to take place in a proper restriction enzyme buffer, as digestion with EcoRI in other buffers results in non-specific digestion of PCR products. Eight .mu.l of each purified PCR reaction was removed to a new 0.5 ml Gene-amp tube, and 1 .mu.l of Restriction Buffer H (Roche Mol. Biochemicals) provided with the EcoRI enzyme was added. One .mu.l of EcoRI restriction enzyme (10 U/.mu.l) was added to each sample and pipetted up and down several times to thoroughly mix reaction contents. The reaction tubes were then placed in a thermal cycler at 37.degree. C. for 3-4 hours. The reactions were spun down by pulsing in microfuge to spin down any condensation on the tube cap, and 2 .mu.l of 6.times. loading dye (40% glycerol, 0.05% Bromophenol Blue, 0.05% Xylene Cyanol) were added to each digested sample, and then the samples were stored at 4.degree. C. in light tight containers until loaded onto the gel.

[0101] Polyacrylamide Gel Electrophoresis of Digested PCR Products

[0102] During the final hour of the digestion step (above), polyacrylamide gels were prepared for analyses of the digested PCR products. Gel plates were washed with Alconox detergent, followed by a final rinse with ethanol, and allowed to air dry. The plates were assembled, and a 6% non-denaturing polyacrylamide gel mixture was prepared as follows:

TABLE-US-00025 Distilled water 45 ml 10X TBE 6 ml 40% acrylamide:bis (38:2) 9 ml TOTAL: 60 ml

(This gel recipe was sufficient to pour two 20.times.20 cm gels; each gel accommodated nine samples.)

[0103] For polymerization, 50 .mu.l TEMED and 500 .mu.l freshly prepared 10% ammonium persulfate were added to the gel mixture, swirling gently to mix reagents. The gel was immediately poured, the comb inserted, and clamps placed on the wells. Polymerization was allowed to occur for approximately one hour, after which the comb was removed and the wells rinsed with 1.times.TBE. The bottom buffer chamber was filled with 1.times.TBE. An entire 12 .mu.l of each sample was loaded onto the gel, and the gel was run at 200-220 volts until the xylene cyanol was approximately 2 cm from the bottom of the gel (approximately 3 hours).

[0104] Quantitation of Undigested and Digested Band Density by Flourimaging

[0105] The gels were transferred to an overhead transparency, and then to a glass sample plate on the Flourimager. The gel was scanned on the Flourimager with the following settings: voltage (PMI)=600; filter 1=530 dF30 agarose; wavelength=488 in. Once the gel was scanned, the image could be modified and quantitated using ImageQuant2 software. The percent C at nucleotide 2388 was then calculated: [0106] a) Corrected volume of undigested product (CU)=undigested band volume-background volume. [0107] b) Corrected volume of digested product (CD)=digested band volume-background volume. [0108] c) Percent 2388 "C"=[CD/(CD+CU)].times.100. To ensure validity of each individual determination, all of the following conditions were met: 1) the value of % 2388 C in the 100% C DNA control sample must have been .gtoreq.905; 2) the value of % 2388 C in the 100% T DNA control sample must have been less than 1.5%; and 3) the total bands of fluorescence (indicated by the volume) present in the undigested and digested bands must have been .gtoreq.500,000.

Results

[0109] RNA was extracted as described above from each of 15 serotype G2 commercial vaccine lots, and for each vaccine lot, 5 individual determinations of the level of variant "C" at nucleotide position 2388 were carried out. The RNA from each virus sample was used to synthesize first strand cDNA (reverse transcription) in two independent experiments carried out on separate days. Three independent determinations of % C at nucleotide position 2388 were made using cDNA derived from the first reverse transcription reaction as PCR template, while the remaining two independent determinations were carried out using cDNA derived from the second reverse transcription reaction. For each sample, the Mean and Standard Deviation of the five determinations was calculated.

[0110] Following the protocols described above, a short region of gene 3 of RRV serotype G2 virus, encompassing nucleotide position 2388, was amplified by RT/PCR using the Superscript Pre-amplification System for First Strand cDNA synthesis (Life Technologies, Rockville, Md.). One of the primers used for amplification was homologous to the sequence immediately upstream of nucleotide 2388 and was designed to create an Eco RI restriction enzyme site if a cytosine residue was present at position 2388 (RRV-G3-EcoRI primer, GTTAGTGGAGTTCTAGCGACATATTTTAAAATGTAGAAT (SEQ ID NO: 186), corresponding to plus sense nucleotides 2347-2386). The second primer (RRV-302A-5'Flourescein, GGTCACATCATGACTAGTGTG (SEQ ID NO: 187), corresponding to negative sense nucleotides 2571-2591) was labeled with Flourescein (at the 5' end), enabling the resulting PCR product to be visualized and quantitated using polyacrylamide gel electrophoresis and flourimaging techniques.

[0111] Following amplification, the PCR product was purified and digested. PCR products derived from genomes containing cytidine (C) at nucleotide position 2388 were digested, resulting in 34 and 207 bp digested fragments; of these two fragments, only the 207 bp fragment retains the flourescein tag and was detected by PAGE). Those genomes containing thymidine (T) at nucleotide position 2388 did not generate an EcoRI site, and thus yielded a 244 bp uncleaved product. The products were separated on a 6% polyacrylamide gel, and the relative densities of bands representing the undigested and digested products were quantitated using the Flourimager 595 (Molecular Dynamics), and a measurement of background fluorescence was taken. The percentage of viral genomes in the sample containing "C" at nucleotide 2388 was then calculated.

[0112] Base mixtures at nucleotide position 2388 in gene 3 and nucleotide position 174 in gene 10 were consistently detected in vaccine virus at the master working virus seed (MWVS) and vaccine monopool bulk concentrate stages. Thus, measurement of the inherent heterogeneity at these positions in the vaccine virus lots can be used as the foundation for a product consistency assay. The MAPREC analysis was used to determine the base composition at nucleotide 2388. The low level of variation observed in the fifteen G2 commercial vaccine lots at this nucleotide position demonstrates, not only the stability of the subpopulation containing C at nucleotide, but also the consistency of the vaccine manufacturing process. The average percentage of C at nucleotide position 2388 ranged from 2/75% to 6.68%, resulting in a variation of no more than 3.92% when any of the fifteen vaccine lots were compared (Table 11). The first three MAPREC determinations, revealed slightly higher levels of the minor species (C) compared to the remaining twelve G2 vaccine lots. However, three additional determinations carried out from a new RT reaction yielded levels of C consistent with those observed in the other twelve lots. Reanalyzing the data to exclude the first three MAPREC determinations, the range of variation observed for the fifteen vaccine lots was significantly reduced (i.e., a low of 2.76% and a high of 4.90%, equivalent to a variation of just 2.14%). In each case, excluding the three aberrant determinations, the standard deviation observed across five MAPREC determinations of the percentage C at nucleotide position 2388 of gene 3 in the commercial vaccine lots fell well below 1%, with over 50% of the samples resulting in standard deviations less than 0.5%. Taking into account that the variation observed was nearly 4 times greater by clonal analyses

TABLE-US-00026 TABLE 11 MAPREC Analysis of % C at Nucleotide Position 2388 in RRV Gene 3 Sample Standard Name Trial#1 Trial#2 Trial#3 Trial#4 {circumflex over ( )}Trial#5 *Trial#5B {circumflex over ( )}Trial#6 Average Duration 100% T- 1.13 1.04 0.85 0.47 0.86 0.87 0.25 DNA Control 100% C- 92.24 93.38 93.85 93.94 93.33 93.35 0.68 DNA Control Serotype 3.60 4.16 3.56 4.88 4.20 3.12 3.11 3.80 0.64 2-I97328 Serotype 3.38 3.08 4.16 5.20 4.97 3.39 3.17 3.91 0.88 2-I973029 Serotype 4.06 3.11 4.72 3.38 4.62 4.04 3.38 3.90 0.63 2-I973030 Serotype 4.16 4.60 3.82 3.32 3.23 2.58 3.76 3.64 0.66 2-I973032 Serotype 7.69 5.38 12.31 4.97 5.41 4.34 6.68 2.98 2-I983005 Serotype 6.67 4.33 9.00 4.12 5.25 5.11 5.75 1.83 2-I983006 Serotype 6.68 5.20 6.11 4.14 4.04 4.31 5.08 1.11 2-I983007 Serotype 2.97 3.97 3.46 2.79 2.85 3.65 3.28 0.48 2-I983008 Serotype 3.76 3.72 3.63 3.06 3.46 3.60 3.54 0.26 2-I983009 Serotype 3.65 4.36 3.83 4.01 4.13 3.81 3.97 0.26 2-I983011 Serotype 3.14 3.52 3.30 2.82 2.95 2.76 3.08 0.29 2-I983012 Serotype 3.32 3.99 3.55 3.48 2.55 3.72 3.44 0.49 2-I983013 Serotype 3.36 3.35 3.82 3.83 3.97 3.67 0.29 2-I983037 Serotype 4.16 4.67 4.76 4.05 4.56 4.44 0.32 2-I983038 Serotype 4.88 3.75 3.84 3.38 4.49 4.07 0.61 2-I983039 *A second digestion sample taken from the PCR rxn generated in trial 5. (A digestion duplicate) {circumflex over ( )}Trials 5 and 6 were PCR rxns. seeded from the same RT rxn. and carried out on the same day.

than was found using MAPREC (8% vs 2.14%, respectively), the levels of the minor species (C) in the G2 vaccine pools as measured by either method are comparable (average of 4% for MAPREC vs 8% for clonal analysis). These data indicate that MAPREC analyses of base composition at nucleotide 2388 in gene 3 of RRV were both accurate and reproducible.

[0113] While this invention has been particularly shown and described with reference to preferred embodiments thereof, it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the appended claims.

Sequence CWU 1

1

18713302DNARotavirus 1ggctattaaa gctatacaat ggggaagtat aatctaatct tgtcagaata tttatcattc 60atatataact cacaatccgc agttcaaatt ccaatttact attcttccaa tagtgaatta 120gagaatagat gtattgaatt tcattctaaa tgcttagaaa actcaaagaa tggactatca 180ttgaaaaagc tctttgttga atatagcgat gttatagaga atgccacact gttgtcaata 240ttatcgtact cttatgataa atataacgct gttgaaagga aattagtaaa atatgcaaaa 300ggtaagccgc tagaagcaga tttgacagtg aatgagttgg attatgaaaa taacaagata 360acatctgaac tattcccaac ggcagaggaa tatactgatt tattgatgga tccagcaatt 420ttaacttcat tatcatcgaa tttaaatgca gttatgttct ggttggaaaa acatgaaaat 480gacgttgctg aaaaactcaa aatttacaaa aggagattag acttatttac tatagtagct 540tcaacagtaa ataaatatgg tgtaccaagg cacaatgcga aatatagata tgaatatgaa 600gtaatgaaag ataagccgta ctacttggtg acatgggcaa attcttcaat tgaaatgctg 660atgtcagttt tttctcatga agattattta attgcgagag aactgatagt actgtcatat 720tctaatagat cgactctggc aaaactggtg tcatcaccaa tgtcaattct ggtagcttta 780gtggatataa acggaacgtt cattacgaat gaagaactag agctagagtt ttcaaacaaa 840tatgtacgag caatagttcc tgaccaaaca tttgatgaat taaaacaaat gcttgacaat 900atgagaaaag ctgggttaac tgacatacct aagatgatac aggactggtt ggtcgattgc 960tctattgaaa aatttccatt gatggctaaa atatattcgt ggtcatttca tgtcggattc 1020aggaaacaga aaatgttgga cgccgcacta gatcaattga aaactgagta tacagaagat 1080gtagatgacg aaatgtatcg agaatacaca atgctaataa gagatgaagt tgtgaaaatg 1140cttgaggaac cagtaaagca tgatgaccat ttgttacagg attctgaatt agctggttta 1200ctatcaatgt catcagcgtc gaatggtgaa tcaagacaac taaaatttgg tagaaagaca 1260attttttcga ctaaaaagaa tatgcatgta atggatgaca tggctaatgg aagatacacg 1320ccaggcataa taccaccagt gaatgtcgat aaaccgatac cattaggaag gagagatgta 1380ccaggaagac ggactagaat aatatttatt ttaccatatg aatatttcat agcacaacat 1440gctgtagttg aaaaaatgct aatttatgcg aaacatacta gagaatatgc tgaattctac 1500tcacagtcaa atcagttatt gtcttatggt gatgttacac gctttttatc taataactct 1560atggtactat atacagacgt gtcccagtgg gactcatctc aacacaatac gcagccattt 1620aggaaaggga taattatggg attggacatg ctagccaata tgactaatga tgctagagtt 1680atacagacgc taaacttgta taaacagacg caaattaatc taatggattc atacgttcaa 1740ataccagatg gtaatgttat taagaagata caatatgggg ctgtagcgtc aggagagaaa 1800cagacgaaag cagcgaattc aatagcaaat ttagcactga ttaaaacggt tttatcacgc 1860atttctaaca aatattcatt cgcgacgaag ataataagag ttgacggaga tgacaattac 1920gcagtattgc aattcaatac agaagtaact aaacaaatgg ttcaagatgt gtcaaacgac 1980gtgagagaaa catatgcgcg aatgaatact aaagttaaag ccttagtatc tacagtggga 2040atagaaatag ctaaaaggta tattgcaggt gggaaaatat tctttagggc tggaataaat 2100ttactgaata atgaaaaaaa aggacaaagc acacagtggg accaagcagc tgtcctatat 2160tcgaactata ttgtgaatag acttcgagga tttgaaactg acagagagtt cattttaact 2220aaaataatgc aaatgacgtc agttgctatt accggatcgc taagactctt tccttctgaa 2280cgcgtgttaa ccacgaactc tacatttaaa gtatttgact cggaggactt tattatagag 2340tatgggacaa ctgacgatga agtatacata caaagagcgt tcatgtcttt atctagtcag 2400aagtcaggaa tagctgatga gatagctgca tcatcgacgt ttaagaatta tgtgtctaga 2460ttatctgagc agctgttgtt ttcaaagaat aatatagtgt ctagaggaat agcattgact 2520gaaaaggcaa agttgaactc atacgcacca atatcacttg agaaaagacg tgcgcaaata 2580tcagctttgc tgactatgct acaaaaaccg gttactttta aatcaagtaa aataacaata 2640aatgatatac ttagagatat aaagccattt ttcactgtaa acgaagcaca tttgccgata 2700caatatcaaa aatttatgcc aactttacca gacaatgtgc agtatataat tcagtgtata 2760ggatccagaa cctaccaaat tgaagacgac ggttcaaagt cagcaatatc tcgactaata 2820tcaaagtatt cagtttacaa accgtcaatc gaagagttat acaaagtaat ttcactacac 2880gagaatgaaa tacaactata tttgatctca ctaggcatac cgaaaataga cgctgatacg 2940tacgtcggat cgaaaattta ttctcaagat aaatacagga tattagagtc gtatgtatat 3000aacttattat ctattaatta tggatgttat caactattcg actttaattc accagatcta 3060gaaaagttga tcagaatacc gtttaaagga aagataccag ctgtcacttt tatattgcat 3120ttatacgcta agctagaagt tataaatcat gccatcaaaa atggctcatg gataagctta 3180ttctgcaact acccaaaatc agaaatgata aaattatgga agaaaatgtg gaacattaca 3240tcactacgtt caccgtatac caatgcaaac ttctttcaag attagagcgc ttagatgtga 3300cc 330222708DNARotavirus 2ggctattaaa ggctcaatgg cgtacagaaa gcgtggagcg cgtcgtgaga cgaatttaaa 60acaagatgat cgaatgcaag aaaaagaaga aaataaaaac gtaaatacta atagtgaaaa 120taaaaatgct acaaaacctc aattatcaga gaaagtgcta tctcaaaagg aagaggtgat 180tacagataat caagaagaaa ttaaaatagc tgatgaagtt aaaaaatcta ataaagagga 240atcaaaacaa ctattagagg ttctaaaaac taaggaagaa catcaaaaag aagttcaata 300cgaaatacta cagaaaacaa tacctacttt tgaaccaaaa gaatctatac taaagaaatt 360agaagatatt aaaccagagc aagttaaaaa gcaaaccaaa ttattcagaa tatttgaacc 420taggcaacta ccagtataca gagcaaacgg agagaaagaa ctacgcaaca gatggtattg 480gaagttaaaa cgagacacct tgcccgatgg agattatgat gtgagagaat attttttaaa 540tttgtatgat caagtactaa ctgaaatgcc agattattta ctacttaaag acatggctgt 600tgaaaacaag aattctagag atgcaggcaa agttgttgac tctgaaactg cagccatttg 660cgatgcgatt ttccaagatg aagaaaccga aggtgtagta agaagattca tagcagaaat 720gaggcaaaga gtacaagctg atcgaaatgt agttaattac ccatcaatat tgcatccaat 780tgatcatgcc tttaatgagt attttttaca gcatcagtta gttgaaccat tgaataatga 840tataatattc aattacatac ctgaaagaat acggaatgac gtaaactata tactgaacat 900ggatcgaaat ttaccttcaa cagctagata cattagacca aatttacttc aagatagact 960caatttgcat gataacttcg aatccttatg ggatactata actacatcaa actacatctt 1020agctagatca gttgtgccag accttaagga actagtgtcc accgaggctc aaatacaaaa 1080aatgtcacag gatttgcaat tagaggcgct gacaattcaa tcagaaacac aatttttaac 1140aggtatcaat tcacaggcag ctaatgactg ctttaagacg ttaattgccg ctatgcttag 1200tcaacgtact atgtctttag atttcgtcac tacaaactac atgtcattaa tttcagggat 1260gtggttatta acagttgtac ctaatgatat gttcatacgt gaatccctag tagcatgtca 1320attggcaata attaatacca tcatatatcc agcctttgga atgcagagaa tgcattacag 1380aaatggtgac ccccaaactc cttttcagat cgctgaacaa caaattcaga actttcaggt 1440ggccaattgg ctacattttg ttaacaataa tcaatttaga caagtagtaa ttgatggagt 1500attaaaccaa gttctgaatg ataatataag aaatggacat gtagttaatc aattgatgga 1560agctttaatg caattgtcac gacaacaatt cccaaccatg ccagtagatt ataaaagatc 1620aatacagaga ggaatattac ttctatcgaa tagattagga caattggttg acctaactag 1680gctattggca tataattatg aaactctgat ggcgtgcatt accatgaaca tgcaacatgt 1740acaaactcta actactgaaa agttgcaatt aacatcagtt acttccttat gtatgttaat 1800aggaaatgct acagttatac caagtccaca aacattattt cattattata acgtcaacgt 1860caattttcat tcaaattaca atgaaagaat aaatgacgca gtagcaatca taaccgccgc 1920aaatagattg aatttgtatc agaaaaagat gaagtcgata gttgaagatt tcttaaagag 1980actacaaata ttcgacattt ctagagttcc agatgatcaa atgtacagac tcagggatag 2040attgagatta ctcccagttg aaattagaag attagatata tttaatttaa tattgatgaa 2100tatggagcag attgaacgcg catcggataa aattgcccag ggagtgatta tagcttatag 2160agacatgcag ttagagagag atgaaatgta tggctacgtt aacatagctc gtaatttaga 2220cggttttcag cagataaatt tagaggagtt gatgagaacg ggagattatg cacaaattac 2280taatatgcta ctaaataatc agccagtggc attagtagga gcactaccat ttataacaga 2340ctcatcagtt atctcattgg tagctaaatt agacgctact gtctttgcac aaattgttaa 2400gctcaggaag gttgatactt taaagccaat cctgtataaa ataaattctg attcaaatga 2460tttttatctt gtagcgaatt atgactgggt tccaacgtct acaacaaaag tttataaaca 2520aataccacaa caatttgatt ttagagcatc tatgcatatg ttaacgtcta atttgacttt 2580cactgtatat tccgaccttc ttgcattcgt ttcagcagac actgttgaac caattaatgc 2640tgttgcattt gacaatatgc gcatcatgaa cgaactgtaa acgccaaccc cactgtggag 2700atatgacc 270832591DNARotavirus 3ggctattaaa gcagtacgag tagtgtgttt tacctctaat ggtgtaaaca tgaaagtact 60agctttaaga cacggtgtgg ctcaggtgta tgcagacacc caaatctata ctcatgatga 120tactaaagac agttacgaga atgcatttct tatatctaat cttacaacgc ataacatctt 180atatttaaat tacagtatca aaacgcttga aatattgaat aaatcaggaa ttgcagctgt 240tgagattcaa tctcttgaag aattattcac tttaattaga tgtaatttta cttatgatta 300tgaaaacaat ataatttact tgcatgacta ctcatactac actaataatg aaataagaac 360tgatcaacat tgggttacaa agactgatat tgaggaatac ttgttaccag gatggaaatt 420aacatacgta ggatataatg ggagtgatac tagaggacat tataacttct cattcacatg 480ccagaatgct gcaaccgatg atgacttaat aatagaatac atttattccg aagcattgga 540ctttcagaat ttcatgttaa agaaaattaa agaaagaatg actacttctt taccgatagc 600acgtttatca aatagagttt ttagagataa attatttcca ttactaagtg aaaaacatca 660gcgtatagtg aacattggac cgagaaatga atcaatgttt accttcttaa attttccatc 720aattaagcaa ttttcaaatg gaccatattt agttaaagat actattaaat tgaagcaaga 780aagatggttg gggaaaagag tgtctcagtt cgacattgga caatacaaga acatgatgaa 840cgtcataaca actgtatatt attattataa cttatatcag aaaaaaccta ttatatatat 900ggttggttca gctccttcat actggattta tgatgtcaaa caatattctg attttatgtt 960tgagacttgg gacccacttg acactccata ttcatcagtg catcataaag aattattttt 1020tgagaaggac ataactagat taaaggatga ttcaatattg tatattgata tcaggactga 1080tcgtggaaac acggattgga aagaatggag gaaaatagtt gaggcgcaaa ctattagtaa 1140ccttaaactt gcataccgat acttatctgg tggtaagtcg aaggtatgtt gtgttaaaat 1200gactgctatg gatttagagc ttcccatatc tgcaaagtta ttgcatcatc caactactga 1260aatccgatca gagttttatc ttcttctgga catctgggac attagtaatg tcaaaagatt 1320tattccaaag ggagtattat attcattcat aaataacgtt actactgaaa atgtattcat 1380acaaccgccg ttcaaaatca aaccgtttaa gaatgattat attgtggcat tatacgcatt 1440atcaaatgat tttaatgata gaacggatgt aattaactta attaacaatc agaaacaatc 1500gctcattact gtaagaatta ataacacatt taaagatgaa ccaaaggtag ggtttaagaa 1560tatatatgat tggacctttc taccaacaga ttttactaca actgatgcca taataacctc 1620atacgatgga tgtttaggta tatttggatt atcaatatcc ttagcttcaa agcctacggg 1680aaataatcac ttgtttatct taaatggaac cgataagtat tataaattgg atcaattcgc 1740aaaccatact ggcatttcca gaagatcaca ccaaattaga ttttcagaat ccgcaacatc 1800gtattcagga tacatattca gagatttatc taacaacaat tttaacttga ttgggacaaa 1860tgtagaaaat tcagtttcag gacatgtata taatgcgtta atttattata gatataacta 1920ctcttttgac ttaaaaagat ggatatactt acactcgata gaaaaagctg atatagaagg 1980tggaaagtat tatgaacatg ctccgataga attgatttat gcctgtagat cagcaaaaga 2040attcgcttta ttacaagatg atcttactgt attacgttat gctaatgaaa tcgagagcta 2100tataaataaa gtatatagta taacatatgc agatgatcca aattacttta taggtattaa 2160attcagacac attccctatg aatatgatgt taaaattcca catttgacat ttggagtatt 2220atttatttca gataatatga ttccagatgt agtggagatc atgaaaatta tgaaaaagga 2280attatttgaa atggatataa ccactagtta cacatatatg ttatctgatg gaatatatgt 2340agcaaacgtt agtggagttc tagcgacata ttttaaaatg tataatttat tttataagag 2400tcagattaca ttcggtcaat ctagaatgtt tattccacat ataacactaa gttttagtaa 2460taataaaaca gtaagaatag aaagtactag gttaaagatt agctcaatat atttaagaaa 2520gattaaagga gatacggtgt ttgatatgtc tgagtgagct agaaacttaa cacactagtc 2580atgatgtgac c 259142362DNARotavirus 4ggctataaaa tggcttcgct catttataga caattgctta caaattcata taccgttgac 60ttatctgatg aaatacaaga aattggatct acaaaaacgc aaaatgtcac tattaatcta 120ggtccttttg ctcaaacagg ttatgctcca gttaactggg gtcctggtga aactaatgat 180tctactactg tagaaccggt acttgatggt ccttatcaac caacaacgtt caatccacca 240gtagattatt ggatgctatt agcacctaca gcagctggag tagtagtaga aggtactaat 300aatacagacc gatggctagc tacaatttta gttgagccaa acgtaacatc agaaaccaga 360agttatacgc tatttggaac gcaagagcaa attacaatag ctaatgcttc ccaaacacaa 420tggaaattta ttgatgtcgt taaaactaca caaaatggaa gctattcaca atacggacca 480ttacaatcta ctccaaaact ctatgccgtg atgaaacata atggtaaaat ttatacatat 540aatggagaaa ctccgaatgt gaccactaag tactactcaa ctacaaatta tgattcagta 600aacatgacag cattttgtga cttttatatt atacctagag aagaagaatc aacatgtacc 660gagtacatta ataacgggtt acctccgatt cagaatacac gaaacattgt tccattggcg 720ctttcagcta gaaatataat atcacataga gctcaagcga atgaagatat cgttgtgtca 780aagacatcac tttggaaaga gatgcaatac aatagagaca tcacaattcg atttaaattc 840gcaagttcaa ttgttaaatc cggtgggcta ggttataaat ggtcagagat ttcatttaaa 900ccagcaaact atcaatatac gtatacacga gatggagagg aggtgacagc tcacacgacg 960tgctccgtaa acggaatgaa cgattttaat ttcaatgggg gatcgttacc aacggatttt 1020gtaatatcaa gatatgaagt aattaaagag aattcttatg tttatgttga ttactgggat 1080gattcacaag ccttcaggaa catggtttat gtaaggtcat tagctgctaa tttaaactct 1140gttatatgta ctgggggtga ttatagcttt gcattaccgg ttggtcaatg gccagtaatg 1200actggcggag cagtgtcatt gcattcagct ggtgttacgc tatccacaca gttcacagat 1260tttgtatcat taaattcttt aaggttcagg tttagactaa ctgttgaaga gccatcattc 1320tcgatcacca gaactagagt tagtagattg tatgggttac ctgcagctaa cccaaataat 1380ggaaaagaat attatgaagt ggctggcaga ttctcactaa tatcattggt accatctaat 1440gacgattacc agacaccaat aactaattca gttacagtca gacaagattt agaacgacag 1500ttgggtgaac ttagagaaga attcaacgct ctctcacaag agatagccat gtcgcagcta 1560attgatttgg cattacttcc attggatatg ttttcgatgt tttccggtat taagagcacc 1620atagatgcag ctaaatcaat ggctactagt gtaatgaaga aatttaagaa atcaggttta 1680gctaactctg tatctacatt aacagactca ctgtccgacg cagcttcttc aatttcaaga 1740ggagcatcta ttcgttcagt tggatcatca gcatcagcat ggacggatgt ctcaacacaa 1800atcactgatg tttcttcatc tgtcagttcg atctcgacac agacttcaac tattagtaga 1860cggctacgac taaaagaaat ggctacgcaa acagaaggga tgaatttcga tgatatatct 1920gctgcagtat tgaagactaa aattgatcga tccactcaaa tatctccaaa cacattacca 1980gatatagtca ctgaagcttc agagaagttc attcctaata gagcgtacag agtaataaat 2040aatgatgaag tctttgaagc gggaacagat ggaagatttt ttgcgtatcg tgttgaaacg 2100ttcgatgaaa taccttttga tgtgcaaaag tttgcagatc tagtaactga ctctccggtc 2160atctcagcca taatagactt taagacacta aagaatctaa acgacaatta tggtattagt 2220aggcaacaag catttaatct gctaagatcc gatccaagag tattacgtga atttatcaat 2280caagacaatc caataattcg taacagaatt gaacagttaa taatgcagtg tagactgtaa 2340gcaatttcta gaggatgtga cc 236251599DNARotavirus 5ggcttttttt tgaaaagtct tgtgttagcc atggcaacct ttaaggatgc ttgctttcat 60tatagaaggg ttacaaaact aaacagagaa ttgctgagaa ttggagcaaa ttcagtatgg 120actccagtct cttcgaataa aattaaaatt aaagggtggt gcattgagtg ttgtcaatta 180actggattga ctttttgtca cggatgttcg ctagctcatg tttgtcagtg gtgcatccaa 240aacaaacgtt gcttcttgga caatgaacca catcttttaa aattaagaac ttttgaatct 300ccaataacga aggaaaaatt acaatgcatt attaatttat atgaattact atttccaatt 360aatcatgggg ttatcaataa atttaaaaaa acaataaaac agaggaaatg tagaaatgag 420tttgacaaat catggtataa tcagctactg cttccaatta ctttaaatgc tgcagttttc 480aagtttcact caagggatgt ttatgttttt ggattttatg aaggatcatc accatgcata 540gatttgccat atagacttgt aaattgcatt gatttatatg ataaactatt gttagatcaa 600gtaaactttg aaaggatgag ttctcttcca gataatttac aatccatcta tgcaaacaaa 660tacttcaaat taagtagact tccttcaatg aagctaaaac gaatctatta ctcagatttc 720tccaaacaga atttgattaa taagtacaag actaaaagtc gcatagttct taggaatctt 780actgaattca cctgggattc tcaaactgat ttacatcatg atctgattaa tgataaagat 840aaaatacttg ccgcattatc aacatcatca ttaaaacaat ttgaaacaca tgatttaaat 900ttggggagaa taaaagctga catttttgaa cttggacatc actgcaaacc aaattacatc 960tcatcaaatc attggcaacc agcatcaaaa atttctaaat gtaaatggtg taatgtaaaa 1020tatgcattca gagacatgga ttggaagatg gaatcaatgt acaatgaact tttaagcttt 1080atccaatctt gctataaaag taatgttaat gtaggacatt gtagttcaat tgaaaaagct 1140tatccattag ttaaagatat actttggcat tcaattactg aatatattga tcaaactgtt 1200gagaaattgt ttaatacaat gaatccagtg caagtaaatg aacagcaggt aataaagttc 1260tgttggcaaa tagatatcgc attatatatg cacattaaaa tgatactgga aaccgaggct 1320cttccattta ctttcacatt gaatcagttc aattctataa ttaaagggat tgtgaaccaa 1380tggtgtgatg ttgctgaatt agatcacttg ccgttatgca ctgaacagac tgatgcattg 1440gttaaattgg aagaagaagg aaaactatct gaagaatatg agcttctgat ctcggactct 1500gaagatgacg actaatgatt gaattaacta tcaccacagt ttttgccatc acaagacctt 1560ctggactaga gtagcgccta gccagcaaaa actgtgacc 159961356DNARotavirus 6ggcttttaaa cgaagtcttc aacatggatg tcctgtactc cttgtcaaaa actcttaaag 60atgctagaga caaaattgtc gaaggcacat tatactccaa tgtaagtgat ctaattcaac 120aatttaatca aatgataatt actatgaatg gaaatgaatt tcaaactgga ggaattggta 180atctgccgat tagaaattgg aattttgatt ttggattact tggaacaact ctactaaatt 240tagatgctaa ctatgtcgaa acggcccgta atacaattga ttattttgta gattttgtag 300ataatgtatg catggacgaa atggttagag aatcacaaag aaatggaatt gcaccacaat 360cagactcact tagaaagttg tcaggcatta aatttaaaag aataaatttt gacaattcat 420cagaatacat tgagaactgg aatttgcaaa acagaagaca aagaacgggt tttacatttc 480ataaaccaaa cattttccct tattcagctt cattcacact gaacagatca caaccggctc 540atgataactt gatgggtacg atgtggctca atgcgggatc agaaattcag gtcgctggat 600tcgactattc atgtgcaata aatgcgccag ctaatataca acaatttgag catattgtac 660agcttcgaag ggtgttgact acagctacaa taactcttct accagatgca gaaagattta 720gttttccaag agtgattaat tcagctgacg gagcggctac atggtacttt aatccagtga 780ttcttagacc aaataacgtt gaagtagaat ttctactaaa cgggcagata ataaatactt 840accaagcaag atttggaacg ataatagcca gaaattttga tacaattaga ttgtcatttc 900agttaatgag accaccaaat atgacaccag cggtagcggc gttatttcca aatgcgcaac 960catttgaaca tcatgcaaca gtaggactca cgcttagaat cgaatctgca gtttgtgaat 1020cagtacttgc cgacgcaagc aaaacaatgc tagcgaacgt gacatctgtt agacaagaat 1080acgcgatacc agttggacca gtttttccac caggtatgaa ttggactgat ttgatcacta 1140actattcacc atctagagag gataacttgc agcgtgtatt tacagtggct tccattagaa 1200gcatgcttgt caaatgagga ccaagctaac cacttggtat ccgactttga tgagtatgta 1260gcttcgtcaa gctgtttgaa ctctgtaagt aaggatgcgt ccacgtattc gctacacaga 1320gtaatcactc agatgacgta gtgagaggat gtgacc 135671078DNARotavirus 7ggcatttaat gcttttcagt ggttgatgct caagatggag tctactcagc agatggcttc 60ttctattatt aattcttcat ttgaagctgc agtggttgct gcaacttcta ctcttgaatt 120gatgggtatt caatatgact acaatgaggt atatactaga gtaaagagta aatttgattt 180agttatggat gattctggtg taaaaaataa cttaataggt aaagcaatta ctattgatca 240agctttgaat ggaaaattta gttcagcgat taggaataga aattggatga ctgactctcg 300aactgtagct aaattagatg aggatgtaaa taaactaaga attatgctat catcaaaagg 360aatcgatcag aaaatgagag tgcttaatgc ttgttttagt gtcaagagaa tacctgggaa 420atcatcatct atagttaaat gtactagact gatgaaagac aaattagaac gtggtgaagt 480tgaagttgat gattcctttg ttgaagagaa aatggaagta gatacaattg attggaaatc 540aagatatgaa cagttagaaa agagatttga gtcactgaaa catcgggtta atgagaagta 600taatcattgg gttcttaaag ctagaaaggt aaatgaaaat atgaattctc ttcaaaatgt 660gatttctcaa caacaagcac acattaatga actacaaatg tataataata aattagaacg 720tgatttgcaa tccaaaattg gatctgttgt gtcatcaata

gaatggtatc taagatcgat 780ggaattatct gatgatgtaa aatcagacat tgaacaacag ctgaattcaa tagatcaatt 840aaatccagtt aatgcaatag atgattttga atcaatactt cgcaatttaa tttctgatta 900tgataggcta tttataatgt ttaaaggatt attgcagcaa tgcaactaca cttatactta 960tgagtaattg aatgaacaat tcaatactat taccatctac acgtaaccct ctatgagcac 1020aatagttaaa agctaacact gtcaaaaacc taaatggcta taggggcgtt atgtgacc 107881059DNARotavirus 8ggcttttaaa gcgtctcagt cgccgtttga gccttgcggt gtagccatgg ctgagctagc 60ttgcttttgt tatccccatt tggagaacga tagctataga ttcattccat tcaatagttt 120ggctataaaa tgtatgttga cagcaaaagt agataaaaaa gatcaggata aattttacaa 180ttcaataatt tatggtatcg caccaccgcc acaattcaaa aaacgttata acacaaatga 240caattcaaga ggaatgaatt atgaaactcc aatgtttaat aaagtggcgg tgttaatttg 300tgaagcgttg aattcaatta aagttactca atctgatgtt gcgaatgtac tttcaaaagt 360agtttctgta agacatctag agaatttggt actgagaaga gagaatcatc aggacgtgct 420ttttcattca aaagagttgt tgctgaaatc agtactaata gctattggtc actcaaaaga 480aattgaaaca actgccaccg ctgaaggagg ggaaatagtt tttcaaaatg cagcttttac 540aatgtggaaa ttgacatacc tggaacatag actaatgcca attttggatc aaaattttat 600tgaatataaa ataacagtga atgaagataa accgatttca gaatcacatg ttaaagaact 660cattgctgag ttgcggtggc aatacaacaa atttgcagta attacacatg gtaaaggtca 720ctacagagtt gtaaaatatt catcagttgc gaatcatgca gatagagttt acgctacttt 780caagagcaat aataagaatg gtaatgtgct agagtttaat ctacttgatc aaagagtaat 840atggcagaac tggtatgcgt ttacatcctc aatgaaacaa ggtaacactc ttgaaatatg 900caagaaacta ctgttccaaa aaatgaagcg ggaaagtaat ccgtttaagg gactgtcaac 960tgatagaaag atggatgagg tttctcaaat aggaatttaa ttcgttatca atttgagagt 1020gggtatgaca aagtaagaat agaaagcgct tatgtgacc 105991062DNARotavirus 9ggctttaaaa gcgagaattt ccgtttggct agcggttagc tccttttaat gtatggtatt 60gaatatacca cagttctaac ctttctgata tcgctcattt tattgaatta tattttaaaa 120tctttgacta gaatgatgga ctttattatt tacagatttc tttttattgt agttattttg 180tcaccattac taaaagccca aaattatgga attaatctac caattactgg ttcaatggac 240actgcatacg ctaactctac acaggaagag acttttctca catctacttt gtgtctatat 300tatccaactg aagctgcaac agaaataaat gataattcgt ggaaggatac actctcacaa 360ttattcttga ctaaaggatg gccaactgga tcagtttatt ttaaagaata cacggatatt 420gcttcctttt cagttgatcc acaactatat tgtgattata acgtggtact aatgaaatat 480gatgcgactt tgcagctgga catgtctgaa ctagctgatt taatactgaa tgaatggctg 540tgcaatccaa tggatattac tctatattat tatcaacaaa cagacgaagc taacaaatgg 600atttctatgg gatcttcctg tacaataaaa gtatgtccac ttaatacaca gactcttgga 660attgggtgtt tgactactga tacggcaaca tttgaagaag tcgctacagc tgaaaaactg 720gtgattactg acgttgtcga tggtgtgaat cataaacttg atgttacaac tgctacttgc 780actatcagaa actgcaaaaa attaggacca agggaaaatg tagcagtaat tcaagttgga 840ggttctgatg ttctcgacat aacggctgat ccaaccacag caccacaaac tgaacgaatg 900atgcgcatta attggaagaa atggtggcaa gttttttata ccgtagtcga ctatgtgaat 960caaataattc aagcaatgtc caaaagatca cgatcactta actctgctgc attctattat 1020agaatatagg tatagctttg gttagaattg tatgatgtga cc 106210750DNARotavirus 10ggcttttaaa agttctgttc cgagagagcg cgtgcggaaa gatggaaaag cttaccgacc 60tcaactacac attgagtgta gtcactctca tgaatgatac tttacatacc ataatggagg 120atcctggaat ggcgtatttt ccatacattg cttctgtcct aactgtacta tttacattac 180ataaggcctc ggttccaacc atgaagattg ctcttaaaac gtcaaagtgt tcatataaag 240taatcaaata ctgcattgtg tcaattttta acactctatt gaaactggct ggatataaag 300aacaaattac tactaaagat gaaattgaaa ggcaaatgga cagagttgta aaagaaatga 360gacgtcagct ggaaatgatt gataagctaa ccactagaga gattgagcaa gtcgaactac 420ttaaacgaat tcatgatatg ttgataatta aaccagttga caaaattgat atgtcacaag 480aatttaatca gaaatatttc aaaacgctaa atgattgggc tgaaggtgaa aatccatatg 540aaccaaaaga ggtgactgca tcattgtgag aggttgagct gccgtcgtct gtctgcggaa 600gcggcggagt tcttaacagt aagccccatc ggacctgatg actggttgag aagccacaac 660cagtcatatc gcgtgtgact cagtcttaat cccgtttaac caatccagcc agcgctggac 720gttaatggaa ggaacggtct taatgtgacc 75011667DNARotavirus 11ggcttttaaa gcgctacagt gatgtctctc agtattgacg tgacaagtct tccatctatt 60tcctccagca tttataaaca tgaatcatct tcaacgacgt caactctttc tggaaaatct 120attggtagga gtgaacagta cgtttcacca gatgcagaag cattcaataa gtacatgttg 180tcgaagtctc cagaggatat tggaccatct gattctgctt caaacgaccc actcaccagt 240ttttcgatta gatcgaatgc agttaagaca aatgcagacg ctggcgtgtc tatggattca 300tcgacacaat cacgaccttc aagtaacgtt ggatgcgatc aagtggattt ctccttaagt 360aaaggcatta aagtaaacgc taatttagat tcatctattt cagtatcaac agtttccaag 420aaggagaaat ccaaatcaga tcataaaaat aggaaacact acccgagaat tgaagcagat 480tccgattcag acgaatatgt acttgatgat tcagatagtg atgatggtaa gtgtaaaaac 540tgtaaatata agaaaaagta tttcgcactt agaatgagaa tgaagcaagt cgcaatgcag 600ttgattgaag atttgtaagt ctaacctgag gactcactag gaagctcccc acttccgttt 660tgtgacc 667121062DNARotavirus 12ggctttaaaa gagagaattt ccgtctggct aacggttagc tccttttaat gtatggtatt 60gaatatacca caattctaat ctttttgata tcaatcattc tactcaacta tatattaaaa 120tcagtgactc gaataatgga ctacattata tatagatttt tgttgattac tgtagcatta 180tttgctttga caagagctca gaattatgga cttaacttac caataacagg atcaatggac 240gctgtatata ctaactctac tcaagaagaa gtgtttctaa cttctacgtt atgtctgtat 300tatccaactg aagcaagtac tcaaatcaat gatggtgact ggaaagactc attgtcgcaa 360atgtttctta caaagggttg gccaacagga tctgtttact ttaaagagta ctcaagtatt 420gttgattttt ctgttgaccc acagctgtat tgtgactata atttagtact tatgaaatat 480gaccaaagtc ttgaattaga tatgtcggag ttagctgatt taatattgaa tgaatggtta 540tgtaacccaa tggatgtaac attatactat tatcaacaat cgggagaatc aaataagtgg 600atatcgatgg gatcatcatg taccgtgaaa gtgtgtccgc taaatacaca aacgttaggg 660ataggttgtc aaacaacaaa cgtagactca tttgaaatga ttgctgagaa tgagaaatta 720gctatagtgg atgtcgttga tgggataaat cataaaataa atttaacaac tacgacatgt 780actattcgaa attgtaagaa attaggtcca agagaaaatg tagctgtaat acaagttggt 840ggttctaatg tattagacat aacagcagat ccaacaacta atccacaaac tgagagaatg 900atgagagtga attggaaaaa gtggtggcaa gtattttata ctatagtaga ttatattaat 960caaattgtac aggtaatgtc caagagatca agatcattaa attctgcagc tttttattat 1020agagtataga tatatcttag attagaattg ttcgatgtga cc 1062131062DNARotavirus 13ggctttaaaa acgagaattt ccgtctggct agcggttagc tctttttaat gtatggtatt 60gaatatacca caattctgac cattttaata tctatcatat tattgaatta tatattaaaa 120actataacta atacgatgga ctacataatt ttcaggtttt tactactcat tgctttaata 180tcaccatttg taaggacaca aaattatggt atgtatttac caataacggg gtcactagac 240gctgtatata cgaattcgac tagtggagag ccatttttaa cttcgacgct atgtttatac 300tatccagcag aagctaaaaa tgagatttca gatgatgaat gggaaaatac tctatcacaa 360ttatttttaa ctaaaggatg gccaattgga tcagtttatt ttaaagacta caatgatatt 420aacacatttt ctgtgaatcc acaactgtat tgtgattata atgtagtatt gatgagatat 480gacaatacat ctgaattaga tgcatcagag ttagcagatc ttatattgaa tgaatggctg 540tgcaatccta tggacatatc actttactat tatcaacaaa gtagcgaatc aaataaatgg 600atatcgatgg gaacagactg cacggtaaaa gtttgtccac tcaatacaca aaccttaggg 660attggatgca aaactacgga cgtaaacaca tttgagattg ttgcgtcgtc tgaaaaatta 720gtaattactg acgttgtaaa tggtgttaat cataagataa atatttcaat aaatacgtgc 780actatacgta actgtaataa attaggacca cgagaaaatg ttgctataat tcaagttggt 840ggaccgaacg cattagatat cactgctgat ccaacaacag tcccacaagt tcaaagaatc 900atgcgaataa attggaaaaa atggtggcaa gtattttata cagtagttga ctatattaac 960caagttatac aagtcatgtc caaacgatca agatcattag acgcagctgc tttttattat 1020agaatttaga tatagatttg gtcagatttg tatgatgtga cc 1062141062DNARotavirus 14ggctttaaaa gagagaattt ccgtttggct agcggatagc tccttttaat gtatggtatt 60gaatatacca cagttctatt ttatttgata tcgttcgttc ttgtgagtta tattctgaaa 120accataataa agataatgga ctatattatt tatagaataa catttgtaat tgtagtatta 180tcagtattat cgaatgcaca aaattatgga ataaatttgc caattactgg atctatggat 240acagcatatg ctaactcaac acaagacaat aattttttat tttcaacttt atgtctatat 300tatccatcag aagctccaac tcaaattagt gacactgaat ggaaagatac actatctcag 360ctgtttttaa ccaaaggatg gccgacaggt tcagtttatt ttaatgaata ttcaaacgtt 420ttagaatttt ccatcgaccc aaagctatac tgtgattata atgttgtgct aattagattc 480gtttctggtg aggagttgga catatctgaa ttagctgatc taatactgaa tgagtggtta 540tgtaatccaa tggatataac attatattat taccaacaaa ctggagaggc aaacaaatgg 600atatcaatgg gatcatcatg taccgttaaa gtgtgtccat taaatactca gacattagga 660attggatgtc aaacgacaaa tacagctact tttgaaacag ttgctgatag cgaaaaattg 720gcaataattg atgttgtcga cagcgtaaat cataaattaa atatcacatc tactacatgt 780acaatacgga attgtaataa actaggaccg agagaaaatg tggctataat acaggttggc 840ggttctaata tattagatat aacagctgat cccacaactt ctccacaaac agaacgaatg 900atgcgcgtaa actggaaaaa atggtggcaa gtattctaca ctgtagttga ttacattgat 960cagatagtac aagtaatgtc caaaagatca agatcgttag atttgtcatc tttctattat 1020agagtgtaga tatatcctaa aatagaactg tttgatgtga cc 1062151078PRTRotavirus 15Met Gly Lys Tyr Asn Leu Ile Leu Ser Glu Tyr Leu Ser Phe Ile Tyr 1 5 10 15Asn Ser Gln Ser Ala Val Gln Ile Pro Ile Tyr Tyr Ser Ser Asn Ser 20 25 30Glu Leu Glu Asn Arg Cys Ile Glu Phe His Ser Lys Cys Leu Glu Asn 35 40 45Ser Lys Asn Gly Leu Ser Leu Lys Lys Leu Phe Val Glu Tyr Ser Asp 50 55 60Val Ile Glu Asn Ala Thr Leu Leu Ser Ile Leu Ser Tyr Ser Tyr Asp65 70 75 80Lys Tyr Asn Ala Val Glu Arg Lys Leu Val Lys Tyr Ala Lys Gly Lys 85 90 95Pro Leu Glu Ala Asp Leu Thr Val Asn Glu Leu Asp Tyr Glu Asn Asn 100 105 110Lys Ile Thr Ser Glu Leu Phe Pro Thr Ala Glu Glu Tyr Thr Asp Leu 115 120 125Leu Met Asp Pro Ala Ile Leu Thr Ser Leu Ser Ser Asn Leu Asn Ala 130 135 140Val Met Phe Trp Leu Glu Lys His Glu Asn Asp Val Ala Glu Lys Leu145 150 155 160Lys Ile Tyr Lys Arg Arg Leu Asp Leu Phe Thr Ile Val Ala Ser Thr 165 170 175Val Asn Lys Tyr Gly Val Pro Arg His Asn Ala Lys Tyr Arg Tyr Glu 180 185 190Tyr Glu Val Met Lys Asp Lys Pro Tyr Tyr Leu Val Thr Trp Ala Asn 195 200 205Ser Ser Ile Glu Met Leu Met Ser Val Phe Ser His Glu Asp Tyr Leu 210 215 220Ile Ala Arg Glu Leu Ile Val Leu Ser Tyr Ser Asn Arg Ser Thr Leu225 230 235 240Ala Lys Leu Val Ser Ser Pro Met Ser Ile Leu Val Val Asp Ile Asn 245 250 255Gly Thr Phe Ile Thr Asn Glu Glu Leu Glu Leu Glu Phe Ser Asn Lys 260 265 270Tyr Val Arg Ala Ile Val Pro Asp Gln Thr Phe Asp Glu Leu Lys Gln 275 280 285Met Leu Asp Asn Met Arg Lys Ala Gly Leu Thr Asp Ile Pro Lys Met 290 295 300Ile Gln Asp Trp Leu Val Asp Cys Ser Ile Glu Lys Phe Pro Leu Met305 310 315 320Ala Lys Ile Tyr Ser Trp Ser Phe His Val Gly Phe Arg Lys Gln Lys 325 330 335Met Leu Asp Ala Ala Leu Asp Gln Leu Lys Thr Glu Tyr Thr Glu Asp 340 345 350Val Asp Asp Glu Met Tyr Arg Glu Tyr Thr Met Leu Ile Arg Asp Glu 355 360 365Val Val Lys Met Leu Glu Glu Pro Val Lys His Asp Asp His Leu Leu 370 375 380Gln Asp Ser Glu Leu Ala Gly Leu Leu Ser Met Ser Ser Asn Gly Glu385 390 395 400Ser Arg Gln Leu Lys Phe Gly Arg Lys Thr Ile Phe Ser Thr Lys Lys 405 410 415Asn Met His Val Met Asp Asp Met Ala Asn Gly Arg Tyr Thr Pro Gly 420 425 430Ile Ile Pro Pro Val Asn Val Asp Lys Pro Ile Pro Leu Gly Arg Arg 435 440 445Asp Val Pro Gly Arg Arg Thr Arg Ile Ile Phe Ile Leu Pro Tyr Glu 450 455 460Tyr Phe Ile Ala Gln His Ala Val Val Glu Lys Met Leu Ile Tyr Ala465 470 475 480Lys His Thr Arg Glu Tyr Ala Glu Phe Tyr Ser Gln Ser Asn Gln Leu 485 490 495Leu Ser Tyr Gly Asp Val Thr Arg Phe Leu Ser Asn Asn Ser Met Val 500 505 510Leu Tyr Thr Asp Val Ser Gln Trp Asp Ser Ser Gln His Asn Thr Gln 515 520 525Pro Phe Arg Lys Gly Ile Ile Met Gly Leu Asp Met Leu Ala Asn Met 530 535 540Thr Asn Asp Ala Arg Val Ile Gln Thr Leu Asn Leu Tyr Lys Gln Thr545 550 555 560Gln Ile Asn Leu Met Asp Ser Tyr Val Gln Ile Pro Asp Gly Asn Val 565 570 575Ile Lys Lys Ile Gln Tyr Gly Ala Val Ala Ser Gly Glu Lys Gln Thr 580 585 590Lys Ala Ala Asn Ser Ile Ala Asn Leu Ala Leu Ile Lys Thr Val Leu 595 600 605Ser Arg Ile Ser Asn Lys Tyr Ser Phe Ala Thr Lys Ile Ile Arg Val 610 615 620Asp Gly Asp Asp Asn Tyr Ala Val Leu Gln Phe Asn Thr Glu Val Thr625 630 635 640Lys Gln Met Val Gln Asp Val Ser Asn Asp Val Arg Glu Thr Tyr Ala 645 650 655Arg Met Asn Thr Lys Val Lys Ala Leu Val Ser Thr Val Gly Ile Glu 660 665 670Ile Ala Lys Arg Tyr Ile Ala Gly Gly Lys Ile Phe Phe Arg Ala Gly 675 680 685Ile Asn Leu Leu Asn Asn Glu Lys Lys Gly Gln Ser Thr Gln Trp Asp 690 695 700Gln Ala Ala Val Lys Asn Tyr Ile Val Asn Arg Leu Arg Gly Phe Glu705 710 715 720Thr Asp Arg Glu Phe Ile Leu Thr Lys Ile Met Gln Met Thr Ser Val 725 730 735Ala Ile Thr Gly Ser Leu Arg Leu Phe Pro Ser Val Leu Thr Thr Asn 740 745 750Ser Thr Phe Lys Val Phe Asp Ser Glu Asp Phe Ile Ile Glu Tyr Gly 755 760 765Thr Thr Asp Asp Glu Val Tyr Ile Gln Arg Ala Phe Met Ser Leu Ser 770 775 780Ser Gln Lys Ser Gly Ile Ala Asp Glu Ile Ala Ala Ser Ser Thr Phe785 790 795 800Lys Asn Tyr Val Ser Arg Leu Ser Glu Gln Leu Leu Phe Ser Lys Asn 805 810 815Asn Ile Val Ser Arg Gly Ile Ala Leu Thr Glu Lys Ala Lys Leu Asn 820 825 830Ser Tyr Ala Pro Ile Ser Leu Glu Lys Arg Arg Ala Gln Ile Ser Ala 835 840 845Leu Leu Thr Met Leu Gln Lys Pro Val Thr Phe Lys Ser Ser Lys Ile 850 855 860Thr Ile Asn Asp Ile Leu Arg Asp Ile Lys Pro Phe Phe Thr Val Asn865 870 875 880Glu Ala His Leu Pro Ile Gln Tyr Gln Lys Phe Met Pro Thr Leu Pro 885 890 895Asp Asn Val Gln Tyr Ile Ile Gln Cys Ile Gly Ser Arg Thr Tyr Gln 900 905 910Ile Glu Asp Asp Gly Ser Lys Ser Ala Ile Ser Arg Leu Ile Ser Lys 915 920 925Tyr Ser Val Tyr Lys Pro Ser Ile Glu Glu Leu Tyr Lys Val Ile Ser 930 935 940Leu His Glu Asn Glu Ile Gln Leu Tyr Leu Ile Ser Leu Gly Ile Pro945 950 955 960Lys Ile Asp Ala Asp Thr Tyr Val Gly Ser Lys Ile Tyr Ser Gln Asp 965 970 975Lys Tyr Arg Ile Ser Tyr Val Tyr Asn Leu Leu Ser Ile Asn Tyr Gly 980 985 990Cys Tyr Gln Leu Phe Asp Phe Asn Ser Pro Asp Leu Glu Lys Leu Ile 995 1000 1005Arg Ile Pro Phe Lys Gly Lys Ile Pro Ala Val Thr Phe Ile Leu His 1010 1015 1020Leu Tyr Ala Lys Leu Glu Val Ile Asn His Ala Ile Lys Asn Gly Ser1025 1030 1035 1040Trp Ile Ser Leu Phe Cys Asn Tyr Pro Lys Ser Glu Met Ile Lys Leu 1045 1050 1055Trp Lys Lys Met Trp Asn Ile Thr Ser Leu Arg Ser Pro Tyr Thr Asn 1060 1065 1070Ala Asn Phe Phe Gln Asp 107516885PRTRotavirus 16Met Ala Tyr Arg Lys Arg Gly Ala Arg Arg Glu Thr Asn Leu Lys Gln 1 5 10 15Asp Asp Arg Met Gln Glu Lys Glu Glu Asn Lys Asn Val Asn Thr Asn 20 25 30Ser Glu Asn Lys Asn Ala Thr Lys Pro Gln Leu Ser Glu Lys Val Leu 35 40 45Ser Gln Lys Glu Glu Val Ile Thr Asp Asn Gln Glu Glu Ile Lys Ile 50 55 60Ala Asp Glu Val Lys Lys Ser Asn Lys Glu Glu Ser Lys Gln Leu Leu65 70 75 80Glu Val Leu Lys Thr Lys Glu Glu His Gln Lys Glu Val Gln Tyr Glu 85 90 95Ile Leu Gln Lys Thr Ile Pro Thr Phe Glu Pro Lys Glu Ser Ile Leu 100 105 110Lys Lys Leu Glu Asp Ile Lys Pro Glu Gln Val Lys Lys Gln Thr Lys 115 120 125Leu Phe Arg Ile Phe Glu Pro Arg Gln Leu Pro Val Tyr Arg Ala Asn 130 135 140Gly Glu Lys Glu Leu Arg Asn Arg Trp Tyr Trp Lys Leu Lys Arg Asp145 150 155 160Thr Leu Pro Asp Gly Asp Tyr Asp Val Arg Glu Tyr Phe Leu Asn Leu 165 170 175Tyr Asp Gln Val Leu Thr Glu Met Pro Asp

Tyr Leu Leu Leu Lys Asp 180 185 190Met Ala Val Glu Asn Lys Asn Ser Arg Asp Ala Gly Lys Val Val Asp 195 200 205Ser Glu Thr Ala Ala Ile Cys Asp Ala Ile Phe Gln Asp Glu Glu Thr 210 215 220Glu Gly Val Val Arg Arg Phe Ile Ala Glu Met Arg Gln Arg Val Gln225 230 235 240Ala Asp Arg Asn Val Val Asn Tyr Pro Ser Ile Leu His Pro Ile Asp 245 250 255His Ala Phe Asn Glu Tyr Phe Leu Gln His Gln Leu Val Glu Pro Leu 260 265 270Asn Asn Asp Ile Ile Phe Asn Tyr Ile Pro Glu Arg Ile Arg Asn Asp 275 280 285Val Asn Tyr Ile Leu Asn Met Asp Arg Asn Leu Pro Ser Thr Ala Arg 290 295 300Tyr Ile Arg Pro Asn Leu Leu Gln Asp Arg Leu Asn Leu His Asp Asn305 310 315 320Phe Glu Ser Leu Trp Asp Thr Ile Thr Thr Ser Asn Tyr Ile Leu Ala 325 330 335Arg Ser Val Val Pro Asp Leu Lys Glu Leu Val Ser Thr Glu Ala Gln 340 345 350Ile Gln Lys Met Ser Gln Asp Leu Gln Leu Glu Ala Leu Thr Ile Gln 355 360 365Ser Glu Thr Gln Phe Leu Thr Gly Ile Asn Ser Gln Ala Ala Asn Asp 370 375 380Cys Phe Lys Thr Leu Ile Ala Ala Met Leu Ser Gln Arg Thr Met Ser385 390 395 400Leu Asp Phe Val Thr Thr Asn Tyr Met Ser Leu Ile Ser Gly Met Trp 405 410 415Leu Leu Thr Val Val Pro Asn Asp Met Phe Ile Arg Glu Ser Leu Val 420 425 430Ala Cys Gln Leu Ala Ile Ile Asn Thr Ile Ile Tyr Pro Ala Phe Gly 435 440 445Met Gln Arg Met His Tyr Arg Asn Gly Asp Pro Gln Thr Pro Phe Gln 450 455 460Ile Ala Glu Gln Gln Ile Gln Asn Phe Gln Val Ala Asn Trp Leu His465 470 475 480Phe Val Asn Asn Asn Gln Phe Arg Gln Val Val Ile Asp Gly Val Leu 485 490 495Asn Gln Val Leu Asn Asp Asn Ile Arg Asn Gly His Val Val Asn Gln 500 505 510Leu Met Glu Ala Leu Met Gln Leu Ser Arg Gln Gln Phe Pro Thr Met 515 520 525Pro Val Asp Tyr Lys Arg Ser Ile Gln Arg Gly Ile Leu Leu Leu Ser 530 535 540Asn Arg Leu Gly Gln Leu Val Asp Leu Thr Arg Leu Leu Ala Tyr Asn545 550 555 560Tyr Glu Thr Leu Met Ala Cys Ile Thr Met Asn Met Gln His Val Gln 565 570 575Thr Leu Thr Thr Glu Lys Leu Gln Leu Thr Ser Val Thr Ser Leu Cys 580 585 590Met Leu Ile Gly Asn Ala Thr Val Ile Pro Ser Pro Gln Thr Leu Phe 595 600 605His Tyr Tyr Asn Val Asn Val Asn Phe His Ser Asn Tyr Asn Glu Arg 610 615 620Ile Asn Asp Ala Val Ala Ile Ile Thr Ala Ala Asn Arg Leu Asn Leu625 630 635 640Tyr Gln Lys Lys Met Lys Ser Ile Val Glu Asp Phe Leu Lys Arg Leu 645 650 655Gln Ile Phe Asp Ile Ser Arg Val Pro Asp Asp Gln Met Tyr Arg Leu 660 665 670Arg Asp Arg Leu Arg Leu Leu Pro Val Glu Ile Arg Arg Leu Asp Ile 675 680 685Phe Asn Leu Ile Leu Met Asn Met Glu Gln Ile Glu Arg Ala Ser Asp 690 695 700Lys Ile Ala Gln Gly Val Ile Ile Ala Tyr Arg Asp Met Gln Leu Glu705 710 715 720Arg Asp Glu Met Tyr Gly Tyr Val Asn Ile Ala Arg Asn Leu Asp Gly 725 730 735Phe Gln Gln Ile Asn Leu Glu Glu Leu Met Arg Thr Gly Asp Tyr Ala 740 745 750Gln Ile Thr Asn Met Leu Leu Asn Asn Gln Pro Val Val Gly Ala Leu 755 760 765Pro Phe Ile Thr Asp Ser Ser Val Ile Ser Leu Val Ala Lys Leu Asp 770 775 780Ala Thr Val Phe Ala Gln Ile Val Lys Leu Arg Lys Val Asp Thr Leu785 790 795 800Lys Pro Ile Leu Tyr Lys Ile Asn Ser Asp Ser Asn Asp Phe Tyr Leu 805 810 815Val Ala Asn Tyr Asp Trp Val Pro Thr Ser Thr Thr Lys Val Tyr Lys 820 825 830Gln Ile Pro Gln Gln Phe Asp Phe Arg Ala Ser Met His Met Leu Thr 835 840 845Ser Asn Leu Thr Phe Thr Val Tyr Ser Asp Leu Leu Ala Phe Val Ser 850 855 860Ala Asp Thr Val Glu Pro Ile Asn Ala Val Ala Phe Asp Asn Met Arg865 870 875 880Ile Met Asn Glu Leu 88517831PRTRotavirus 17Met Lys Val Leu Ala Leu Arg His Gly Val Ala Gln Val Tyr Ala Asp 1 5 10 15Thr Gln Ile Tyr Thr His Asp Asp Thr Lys Asp Ser Tyr Glu Asn Ala 20 25 30Phe Leu Ile Ser Asn Leu Thr Thr His Asn Ile Leu Tyr Leu Asn Tyr 35 40 45Ser Ile Lys Thr Leu Glu Ile Leu Asn Lys Ser Gly Ile Ala Ala Val 50 55 60Glu Ile Gln Ser Leu Glu Glu Leu Phe Thr Leu Ile Arg Cys Asn Phe65 70 75 80Thr Tyr Asp Tyr Glu Asn Asn Ile Ile Tyr Leu His Asp Tyr Ser Tyr 85 90 95Tyr Thr Asn Asn Glu Ile Arg Thr Asp Gln His Trp Val Thr Lys Thr 100 105 110Asp Ile Glu Glu Tyr Leu Leu Pro Gly Trp Lys Leu Thr Tyr Val Gly 115 120 125Tyr Asn Gly Ser Asp Thr Arg Gly His Tyr Asn Phe Ser Phe Thr Cys 130 135 140Gln Asn Ala Ala Thr Asp Asp Asp Leu Ile Ile Glu Tyr Ile Tyr Ser145 150 155 160Glu Ala Leu Asp Phe Gln Asn Phe Met Leu Lys Lys Ile Lys Glu Arg 165 170 175Met Thr Thr Ser Leu Pro Ile Ala Arg Leu Ser Asn Arg Val Phe Arg 180 185 190Asp Lys Leu Phe Pro Leu Leu Ser Glu Lys His Gln Arg Ile Val Asn 195 200 205Ile Gly Pro Arg Asn Glu Ser Met Phe Thr Phe Leu Asn Phe Pro Ser 210 215 220Ile Lys Gln Phe Ser Asn Gly Pro Tyr Leu Val Lys Asp Thr Ile Lys225 230 235 240Leu Lys Gln Glu Arg Trp Leu Gly Lys Arg Val Ser Gln Phe Asp Ile 245 250 255Gly Gln Tyr Lys Asn Met Met Asn Val Ile Thr Thr Val Tyr Tyr Tyr 260 265 270Tyr Asn Leu Tyr Gln Lys Lys Pro Ile Ile Tyr Met Val Gly Ser Ala 275 280 285Pro Ser Tyr Trp Ile Tyr Asp Val Lys Gln Tyr Ser Asp Phe Met Phe 290 295 300Glu Thr Trp Asp Pro Leu Asp Thr Pro Tyr Ser Ser Val His His Lys305 310 315 320Glu Leu Phe Phe Glu Lys Asp Ile Thr Arg Leu Lys Asp Asp Ser Ile 325 330 335Leu Tyr Ile Asp Ile Arg Thr Asp Arg Gly Asn Thr Asp Trp Lys Glu 340 345 350Trp Arg Lys Ile Val Glu Ala Gln Thr Ile Ser Asn Leu Lys Leu Ala 355 360 365Tyr Arg Tyr Leu Ser Gly Gly Lys Ser Lys Val Cys Cys Val Lys Met 370 375 380Thr Ala Met Asp Leu Glu Leu Pro Ile Ser Ala Lys Leu Leu His His385 390 395 400Pro Thr Thr Glu Ile Arg Ser Glu Phe Tyr Leu Leu Leu Asp Ile Trp 405 410 415Asp Ile Ser Asn Val Lys Arg Phe Ile Pro Lys Gly Val Lys Phe Ile 420 425 430Asn Asn Val Thr Thr Glu Asn Val Phe Ile Gln Pro Pro Phe Lys Ile 435 440 445Lys Pro Phe Lys Asn Asp Tyr Ile Val Tyr Ala Leu Ser Asn Asp Phe 450 455 460Asn Asp Arg Thr Asp Val Ile Asn Leu Ile Asn Asn Gln Lys Gln Ser465 470 475 480Leu Ile Thr Val Arg Ile Asn Asn Thr Phe Lys Asp Glu Pro Lys Val 485 490 495Gly Phe Lys Asn Ile Tyr Asp Trp Thr Phe Leu Pro Thr Asp Phe Thr 500 505 510Thr Thr Asp Ala Ile Ile Thr Ser Tyr Asp Gly Cys Leu Gly Ile Phe 515 520 525Gly Leu Ser Ile Ser Leu Ala Ser Lys Pro Thr Gly Asn Asn His Leu 530 535 540Phe Ile Leu Asn Gly Thr Asp Lys Tyr Tyr Lys Leu Asp Gln Phe Ala545 550 555 560Asn His Thr Gly Ile Ser Arg Arg Ser His Gln Ile Arg Phe Ser Glu 565 570 575Ser Ala Thr Ser Tyr Ser Gly Tyr Ile Phe Arg Asp Leu Ser Asn Asn 580 585 590Asn Phe Asn Leu Ile Gly Thr Asn Val Glu Asn Ser Val Ser Gly His 595 600 605Val Tyr Asn Ala Leu Ile Tyr Tyr Arg Tyr Asn Tyr Ser Phe Asp Leu 610 615 620Lys Arg Trp Ile Tyr Leu His Ser Ile Glu Lys Ala Asp Ile Glu Gly625 630 635 640Gly Lys Tyr Tyr Glu His Ala Pro Ile Glu Leu Ile Tyr Ala Cys Arg 645 650 655Ser Ala Lys Glu Phe Ala Leu Leu Gln Asp Asp Leu Thr Val Leu Arg 660 665 670Tyr Ala Asn Glu Ile Glu Ser Tyr Ile Asn Lys Val Tyr Ser Ile Thr 675 680 685Tyr Ala Asp Asp Pro Asn Tyr Phe Ile Gly Ile Lys Phe Arg His Ile 690 695 700Pro Tyr Glu Tyr Asp Val Lys Ile Pro His Leu Thr Phe Gly Val Leu705 710 715 720Phe Ile Ser Asp Asn Met Ile Pro Asp Val Val Glu Ile Met Lys Ile 725 730 735Met Lys Lys Glu Leu Phe Glu Met Asp Ile Thr Thr Ser Tyr Thr Tyr 740 745 750Met Leu Ser Asp Gly Ile Tyr Val Ala Asn Val Ser Gly Val Leu Ala 755 760 765Thr Tyr Phe Lys Met Tyr Asn Leu Phe Tyr Lys Ser Gln Ile Thr Phe 770 775 780Gly Gln Ser Arg Met Phe Ile Pro His Ile Thr Leu Ser Phe Ser Asn785 790 795 800Asn Lys Thr Val Arg Ile Glu Ser Thr Arg Leu Lys Ile Ser Ser Ile 805 810 815Tyr Leu Arg Lys Ile Lys Gly Asp Thr Val Phe Asp Met Ser Glu 820 825 83018776PRTRotavirus 18Met Ala Ser Leu Ile Tyr Arg Gln Leu Leu Thr Asn Ser Tyr Thr Val 1 5 10 15Asp Leu Ser Asp Glu Ile Gln Glu Ile Gly Ser Thr Lys Thr Gln Asn 20 25 30Val Thr Ile Asn Leu Gly Pro Phe Ala Gln Thr Gly Tyr Ala Pro Val 35 40 45Asn Trp Gly Pro Gly Glu Thr Asn Asp Ser Thr Thr Val Glu Pro Val 50 55 60Leu Asp Gly Pro Tyr Gln Pro Thr Thr Phe Asn Pro Pro Val Asp Tyr65 70 75 80Trp Met Leu Leu Ala Pro Thr Ala Ala Gly Val Val Val Glu Gly Thr 85 90 95Asn Asn Thr Asp Arg Trp Leu Ala Thr Ile Leu Val Glu Pro Asn Val 100 105 110Thr Ser Glu Thr Arg Ser Tyr Thr Leu Phe Gly Thr Gln Glu Gln Ile 115 120 125Thr Ile Ala Asn Ala Ser Gln Thr Gln Trp Lys Phe Ile Asp Val Val 130 135 140Lys Thr Thr Gln Asn Gly Ser Tyr Ser Gln Tyr Gly Pro Leu Gln Ser145 150 155 160Thr Pro Lys Leu Tyr Ala Val Met Lys His Asn Gly Lys Ile Tyr Thr 165 170 175Tyr Asn Gly Glu Thr Pro Asn Val Thr Thr Lys Tyr Tyr Ser Thr Thr 180 185 190Asn Tyr Asp Ser Val Asn Met Thr Ala Phe Cys Asp Phe Tyr Ile Ile 195 200 205Pro Arg Glu Glu Glu Ser Thr Cys Thr Glu Tyr Ile Asn Asn Gly Leu 210 215 220Pro Pro Ile Gln Asn Thr Arg Asn Ile Val Pro Leu Ala Leu Ser Ala225 230 235 240Arg Asn Ile Ile Ser His Arg Ala Gln Ala Asn Glu Asp Ile Val Val 245 250 255Ser Lys Thr Ser Leu Trp Lys Glu Met Gln Tyr Asn Arg Asp Ile Thr 260 265 270Ile Arg Phe Lys Phe Ala Ser Ser Ile Val Lys Ser Gly Gly Leu Gly 275 280 285Tyr Lys Trp Ser Glu Ile Ser Phe Lys Pro Ala Asn Tyr Gln Tyr Thr 290 295 300Tyr Thr Arg Asp Gly Glu Glu Val Thr Ala His Thr Thr Cys Ser Val305 310 315 320Asn Gly Met Asn Asp Phe Asn Phe Asn Gly Gly Ser Leu Pro Thr Asp 325 330 335Phe Val Ile Ser Arg Tyr Glu Val Ile Lys Glu Asn Ser Tyr Val Tyr 340 345 350Val Asp Tyr Trp Asp Asp Ser Gln Ala Phe Arg Asn Met Val Tyr Val 355 360 365Arg Ser Leu Ala Ala Asn Leu Asn Ser Val Ile Cys Thr Gly Gly Asp 370 375 380Tyr Ser Phe Ala Leu Pro Val Gly Gln Trp Pro Val Met Thr Gly Gly385 390 395 400Ala Val Ser Leu His Ser Ala Gly Val Thr Leu Ser Thr Gln Phe Thr 405 410 415Asp Phe Val Ser Leu Asn Ser Leu Arg Phe Arg Phe Arg Leu Thr Val 420 425 430Glu Glu Pro Ser Phe Ser Ile Thr Arg Thr Arg Val Ser Arg Leu Tyr 435 440 445Gly Leu Pro Ala Ala Asn Pro Asn Asn Gly Lys Glu Tyr Tyr Glu Val 450 455 460Ala Gly Arg Phe Ser Leu Ile Ser Leu Val Pro Ser Asn Asp Asp Tyr465 470 475 480Gln Thr Pro Ile Thr Asn Ser Val Thr Val Arg Gln Asp Leu Glu Arg 485 490 495Gln Leu Gly Glu Leu Arg Glu Glu Phe Asn Ala Leu Ser Gln Glu Ile 500 505 510Ala Met Ser Gln Leu Ile Asp Leu Ala Leu Leu Pro Leu Asp Met Phe 515 520 525Ser Met Phe Ser Gly Ile Lys Ser Thr Ile Asp Ala Ala Lys Ser Met 530 535 540Ala Thr Ser Val Met Lys Lys Phe Lys Lys Ser Gly Leu Ala Asn Ser545 550 555 560Val Ser Thr Leu Thr Asp Ser Leu Ser Asp Ala Ala Ser Ser Ile Ser 565 570 575Arg Gly Ala Ser Ile Arg Ser Val Gly Ser Ser Ala Ser Ala Trp Thr 580 585 590Asp Val Ser Thr Gln Ile Thr Asp Val Ser Ser Ser Val Ser Ser Ile 595 600 605Ser Thr Gln Thr Ser Thr Ile Ser Arg Arg Leu Arg Leu Lys Glu Met 610 615 620Ala Thr Gln Thr Glu Gly Met Asn Phe Asp Asp Ile Ser Ala Ala Val625 630 635 640Leu Lys Thr Lys Ile Asp Arg Ser Thr Gln Ile Ser Pro Asn Thr Leu 645 650 655Pro Asp Ile Val Thr Glu Ala Ser Glu Lys Phe Ile Pro Asn Arg Ala 660 665 670Tyr Arg Val Ile Asn Asn Asp Glu Val Phe Glu Ala Gly Thr Asp Gly 675 680 685Arg Phe Phe Ala Tyr Arg Val Glu Thr Phe Asp Glu Ile Pro Phe Asp 690 695 700Val Gln Lys Phe Ala Asp Leu Val Thr Asp Ser Pro Val Ile Ser Ala705 710 715 720Ile Ile Asp Phe Lys Thr Leu Lys Asn Leu Asn Asp Asn Tyr Gly Ile 725 730 735Ser Arg Gln Gln Ala Phe Asn Leu Leu Arg Ser Asp Pro Arg Val Leu 740 745 750Arg Glu Phe Ile Asn Gln Asp Asn Pro Ile Ile Arg Asn Arg Ile Glu 755 760 765Gln Leu Ile Met Gln Cys Arg Leu 770 77519492PRTRotavirus 19Met Ala Thr Phe Lys Asp Ala Cys Phe His Tyr Arg Arg Val Thr Lys 1 5 10 15Leu Asn Arg Glu Leu Leu Arg Ile Gly Ala Asn Ser Val Trp Thr Pro 20 25 30Val Ser Ser Asn Lys Ile Lys Ile Lys Gly Trp Cys Ile Glu Cys Cys 35 40 45Gln Leu Thr Gly Leu Thr Phe Cys His Gly Cys Ser Leu Ala His Val 50 55 60Cys Gln Trp Cys Ile Gln Asn Lys Arg Cys Phe Leu Asp Asn Glu Pro65 70 75 80His Leu Leu Lys Leu Arg Thr Phe Glu Ser Pro Ile Thr Lys Glu Lys 85 90 95Leu Gln Cys Ile Ile Asn Leu Tyr Glu Leu Leu Phe Pro Ile Asn His 100 105 110Gly Val Ile Asn Lys Phe Lys Lys Thr Ile Lys Gln Arg Lys Cys Arg 115 120 125Asn Glu Phe Asp Lys Ser Trp Tyr Asn Gln Leu Leu Leu Pro Ile Thr 130 135 140Leu Asn Ala Ala Val Phe Lys Phe His Ser Arg Asp Val Tyr Val Phe145 150

155 160Gly Phe Tyr Glu Gly Ser Ser Pro Cys Ile Asp Leu Pro Tyr Arg Leu 165 170 175Val Asn Cys Ile Asp Leu Tyr Asp Lys Leu Leu Leu Asp Gln Val Asn 180 185 190Phe Glu Arg Met Ser Ser Leu Pro Asp Asn Leu Gln Ser Ile Tyr Ala 195 200 205Asn Lys Tyr Phe Lys Leu Ser Arg Leu Pro Ser Met Lys Leu Lys Arg 210 215 220Ile Tyr Tyr Ser Asp Phe Ser Lys Gln Asn Leu Ile Asn Lys Tyr Lys225 230 235 240Thr Lys Ser Arg Ile Val Leu Arg Asn Leu Thr Glu Phe Thr Trp Asp 245 250 255Ser Gln Thr Asp Leu His His Asp Leu Ile Asn Asp Lys Asp Lys Ile 260 265 270Leu Ala Ala Leu Ser Thr Ser Ser Leu Lys Gln Phe Glu Thr His Asp 275 280 285Leu Asn Leu Gly Arg Ile Lys Ala Asp Ile Phe Glu Leu Gly His His 290 295 300Cys Lys Pro Asn Tyr Ile Ser Ser Asn His Trp Gln Pro Ala Ser Lys305 310 315 320Ile Ser Lys Cys Lys Trp Cys Asn Val Lys Tyr Ala Phe Arg Asp Met 325 330 335Asp Trp Lys Met Glu Ser Met Tyr Asn Glu Leu Leu Ser Phe Ile Gln 340 345 350Ser Cys Tyr Lys Ser Asn Val Asn Val Gly His Cys Ser Ser Ile Glu 355 360 365Lys Ala Tyr Pro Leu Val Lys Asp Ile Leu Trp His Ser Ile Thr Glu 370 375 380Tyr Ile Asp Gln Thr Val Glu Lys Leu Phe Asn Thr Met Asn Pro Val385 390 395 400Gln Val Asn Glu Gln Gln Val Ile Lys Phe Cys Trp Gln Ile Asp Ile 405 410 415Ala Leu Tyr Met His Ile Lys Met Ile Thr Glu Ala Leu Pro Phe Thr 420 425 430Phe Thr Leu Asn Gln Phe Asn Ser Ile Ile Lys Gly Ile Val Asn Gln 435 440 445Trp Cys Asp Val Ala Glu Leu Asp His Leu Pro Leu Cys Thr Glu Gln 450 455 460Thr Asp Ala Leu Val Lys Leu Glu Glu Glu Gly Lys Leu Ser Glu Glu465 470 475 480Tyr Glu Leu Leu Ile Ser Asp Ser Glu Asp Asp Asp 485 49020393PRTRotavirus 20Met Asp Val Lys Leu Ser Lys Thr Leu Lys Asp Ala Arg Asp Lys Ile 1 5 10 15Val Glu Gly Thr Lys Asn Val Ser Asp Leu Ile Gln Gln Phe Asn Gln 20 25 30Met Ile Ile Thr Met Asn Gly Asn Glu Phe Gln Thr Gly Gly Ile Gly 35 40 45Asn Leu Pro Ile Arg Asn Trp Asn Phe Asp Phe Gly Leu Leu Gly Thr 50 55 60Thr Leu Leu Asn Leu Asp Ala Asn Tyr Val Glu Thr Ala Arg Asn Thr65 70 75 80Ile Asp Tyr Phe Val Asp Phe Val Asp Asn Val Cys Met Asp Glu Met 85 90 95Val Arg Glu Ser Gln Arg Asn Gly Ile Ala Pro Gln Ser Asp Ser Leu 100 105 110Arg Lys Leu Ser Gly Ile Lys Phe Lys Arg Ile Asn Phe Asp Asn Ser 115 120 125Ser Glu Tyr Ile Glu Asn Trp Asn Leu Gln Asn Arg Arg Gln Arg Thr 130 135 140Gly Phe Thr Phe His Lys Pro Asn Ile Phe Pro Tyr Ser Ala Ser Phe145 150 155 160Thr Leu Asn Arg Ser Gln Pro Ala His Asp Asn Leu Met Gly Thr Met 165 170 175Trp Leu Asn Ala Gly Ser Glu Ile Gln Val Ala Gly Phe Asp Tyr Ser 180 185 190Cys Ala Ile Asn Ala Pro Ala Asn Ile Gln Gln Phe Glu His Ile Val 195 200 205Gln Leu Arg Arg Val Leu Thr Thr Ala Thr Ile Thr Leu Leu Pro Asp 210 215 220Ala Glu Arg Phe Ser Phe Pro Arg Val Ile Asn Ser Ala Asp Gly Ala225 230 235 240Ala Thr Trp Tyr Phe Asn Pro Val Ile Leu Arg Pro Asn Asn Val Glu 245 250 255Val Glu Phe Leu Leu Asn Gly Gln Ile Ile Asn Thr Tyr Gln Ala Arg 260 265 270Phe Gly Thr Ile Ile Ala Arg Asn Phe Asp Thr Ile Arg Leu Ser Phe 275 280 285Gln Leu Met Arg Pro Pro Asn Met Thr Pro Ala Val Ala Ala Leu Phe 290 295 300Pro Asn Ala Gln Pro Phe Glu His His Ala Thr Val Gly Leu Thr Leu305 310 315 320Arg Ile Glu Ser Ala Val Cys Glu Ser Val Leu Ala Asp Ala Ser Lys 325 330 335Thr Met Leu Ala Asn Val Thr Ser Val Arg Gln Glu Tyr Ala Ile Pro 340 345 350Val Gly Pro Val Phe Pro Pro Gly Met Asn Trp Thr Asp Leu Ile Thr 355 360 365Asn Tyr Ser Pro Ser Arg Glu Asp Asn Leu Gln Arg Val Phe Thr Val 370 375 380Ala Ser Ile Arg Ser Met Leu Val Lys385 39021313PRTRotavirus 21Met Leu Lys Met Glu Ser Thr Gln Gln Met Ala Ser Ser Ile Ile Asn 1 5 10 15Ser Ser Phe Glu Ala Ala Val Val Ala Ala Thr Ser Thr Leu Glu Leu 20 25 30Met Gly Ile Gln Tyr Asp Tyr Asn Glu Val Tyr Thr Arg Val Lys Ser 35 40 45Lys Phe Asp Leu Val Met Asp Asp Ser Gly Val Lys Asn Asn Leu Ile 50 55 60Gly Lys Ala Ile Thr Ile Asp Gln Ala Leu Asn Gly Lys Phe Ser Ser65 70 75 80Ala Ile Arg Asn Arg Asn Trp Met Thr Asp Ser Arg Thr Val Ala Lys 85 90 95Leu Asp Glu Asp Val Asn Lys Leu Arg Ile Met Leu Ser Ser Lys Gly 100 105 110Ile Asp Gln Lys Met Arg Val Leu Asn Ala Cys Phe Ser Val Lys Arg 115 120 125Ile Pro Gly Lys Ser Ser Ser Ile Val Lys Cys Thr Arg Leu Met Lys 130 135 140Asp Lys Leu Glu Arg Gly Glu Val Glu Val Asp Asp Ser Phe Val Glu145 150 155 160Glu Lys Met Glu Val Asp Thr Ile Asp Trp Lys Ser Arg Tyr Glu Gln 165 170 175Leu Glu Lys Arg Phe Glu Ser Leu Lys His Arg Val Asn Glu Lys Tyr 180 185 190Asn His Trp Val Leu Lys Ala Arg Lys Val Asn Glu Asn Met Asn Ser 195 200 205Leu Gln Asn Val Ile Ser Gln Gln Gln Ala His Ile Asn Glu Leu Gln 210 215 220Met Tyr Asn Asn Lys Leu Glu Arg Asp Leu Gln Ser Lys Ile Gly Ser225 230 235 240Val Val Ser Ser Ile Glu Trp Tyr Leu Arg Ser Met Glu Leu Ser Asp 245 250 255Asp Val Lys Ser Asp Ile Glu Gln Gln Leu Asn Ser Ile Asp Gln Leu 260 265 270Asn Pro Val Asn Ala Ile Asp Asp Phe Glu Ser Ile Leu Arg Asn Leu 275 280 285Ile Ser Asp Tyr Asp Arg Leu Phe Ile Met Phe Lys Gly Leu Leu Gln 290 295 300Gln Cys Asn Tyr Thr Tyr Thr Tyr Glu305 31022317PRTRotavirus 22Met Ala Glu Leu Ala Cys Phe Cys Tyr Pro His Leu Glu Asn Asp Ser 1 5 10 15Tyr Arg Phe Ile Pro Phe Asn Ser Leu Ala Ile Lys Cys Met Leu Thr 20 25 30Ala Lys Val Asp Lys Lys Asp Gln Asp Lys Phe Tyr Asn Ser Ile Ile 35 40 45Tyr Gly Ile Ala Pro Pro Pro Gln Phe Lys Lys Arg Tyr Asn Thr Asn 50 55 60Asp Asn Ser Arg Gly Met Asn Tyr Glu Thr Pro Met Phe Asn Lys Val65 70 75 80Ala Val Leu Ile Cys Glu Ala Leu Asn Ser Ile Lys Val Thr Gln Ser 85 90 95Asp Val Ala Asn Val Leu Ser Lys Val Val Ser Val Arg His Leu Glu 100 105 110Asn Leu Val Leu Arg Arg Glu Asn His Gln Asp Val Leu Phe His Ser 115 120 125Lys Glu Leu Leu Leu Lys Ser Val Leu Ile Ala Ile Gly His Ser Lys 130 135 140Glu Ile Glu Thr Thr Ala Thr Ala Glu Gly Gly Glu Ile Val Phe Gln145 150 155 160Asn Ala Ala Phe Thr Met Trp Lys Leu Thr Tyr Leu Glu His Arg Leu 165 170 175Met Pro Ile Leu Asp Gln Asn Phe Ile Glu Tyr Lys Ile Thr Val Asn 180 185 190Glu Asp Lys Pro Ile Ser Glu Ser His Val Lys Glu Leu Ile Ala Glu 195 200 205Leu Arg Trp Gln Tyr Asn Lys Phe Ala Val Ile Thr His Gly Lys Gly 210 215 220His Tyr Arg Val Val Lys Tyr Ser Ser Val Ala Asn His Ala Asp Arg225 230 235 240Val Tyr Ala Thr Phe Lys Ser Asn Asn Lys Asn Gly Asn Val Leu Glu 245 250 255Phe Asn Leu Leu Asp Gln Arg Val Ile Trp Gln Asn Trp Tyr Ala Phe 260 265 270Thr Ser Ser Met Lys Gln Gly Asn Thr Leu Glu Ile Cys Lys Lys Leu 275 280 285Leu Phe Gln Lys Met Lys Arg Glu Ser Asn Pro Phe Lys Gly Leu Ser 290 295 300Thr Asp Arg Lys Met Asp Glu Val Ser Gln Ile Gly Ile305 310 31523326PRTRotavirus 23Met Tyr Gly Ile Glu Tyr Thr Thr Val Leu Thr Phe Leu Ile Ser Leu 1 5 10 15Ile Leu Leu Asn Tyr Ile Leu Lys Ser Leu Thr Arg Met Met Asp Phe 20 25 30Ile Ile Tyr Arg Phe Leu Phe Ile Val Val Ile Leu Ser Pro Leu Leu 35 40 45Lys Ala Gln Asn Tyr Gly Ile Asn Leu Pro Ile Thr Gly Ser Met Asp 50 55 60Thr Ala Tyr Ala Asn Ser Thr Gln Glu Glu Thr Phe Leu Thr Ser Thr65 70 75 80Leu Cys Leu Tyr Tyr Pro Thr Glu Ala Ala Thr Glu Ile Asn Asp Asn 85 90 95Ser Trp Lys Asp Thr Leu Ser Gln Leu Phe Leu Thr Lys Gly Trp Pro 100 105 110Thr Gly Ser Val Tyr Phe Lys Glu Tyr Thr Asp Ile Ala Ser Phe Ser 115 120 125Val Asp Pro Gln Leu Tyr Cys Asp Tyr Asn Val Val Leu Met Lys Tyr 130 135 140Asp Ala Thr Leu Gln Leu Asp Met Ser Glu Leu Ala Asp Leu Ile Leu145 150 155 160Asn Glu Trp Leu Cys Asn Pro Met Asp Ile Thr Leu Tyr Tyr Tyr Gln 165 170 175Gln Thr Asp Glu Ala Asn Lys Trp Ile Ser Met Gly Ser Ser Cys Thr 180 185 190Ile Lys Val Cys Pro Leu Asn Thr Gln Thr Leu Gly Ile Gly Cys Leu 195 200 205Thr Thr Asp Thr Ala Thr Phe Glu Glu Val Ala Thr Ala Glu Lys Leu 210 215 220Val Ile Thr Asp Val Val Asp Gly Val Asn His Lys Leu Asp Val Thr225 230 235 240Thr Ala Thr Cys Thr Ile Arg Asn Cys Lys Lys Leu Gly Pro Arg Glu 245 250 255Asn Val Ala Val Ile Gln Val Gly Gly Ser Asp Val Leu Asp Ile Thr 260 265 270Ala Asp Pro Thr Thr Ala Pro Gln Thr Glu Arg Met Met Arg Ile Asn 275 280 285Trp Lys Lys Trp Trp Gln Val Phe Tyr Thr Val Val Asp Tyr Val Asn 290 295 300Gln Ile Ile Gln Ala Met Ser Lys Arg Ser Arg Ser Leu Asn Ser Ala305 310 315 320Ala Phe Tyr Tyr Arg Ile 32524175PRTRotavirus 24Met Glu Lys Leu Thr Asp Leu Asn Tyr Thr Leu Ser Val Val Thr Leu 1 5 10 15Met Asn Asp Thr Leu His Thr Ile Met Glu Asp Pro Gly Met Ala Tyr 20 25 30Phe Pro Tyr Ile Ala Ser Val Leu Thr Val Leu Phe Thr Leu His Lys 35 40 45Ala Ser Val Pro Thr Met Lys Ile Ala Leu Lys Thr Ser Lys Cys Ser 50 55 60Tyr Lys Val Ile Lys Tyr Cys Ile Val Ser Ile Phe Asn Thr Leu Leu65 70 75 80Lys Leu Ala Gly Tyr Lys Glu Gln Ile Thr Thr Lys Asp Glu Ile Glu 85 90 95Arg Gln Met Asp Arg Val Val Lys Glu Met Arg Arg Gln Leu Glu Met 100 105 110Ile Asp Lys Leu Thr Thr Arg Glu Ile Glu Gln Val Glu Leu Leu Lys 115 120 125Arg Ile His Asp Met Leu Ile Ile Lys Pro Val Asp Lys Ile Asp Met 130 135 140Ser Gln Glu Phe Asn Gln Lys Tyr Phe Lys Thr Leu Asn Asp Trp Ala145 150 155 160Glu Gly Glu Asn Pro Tyr Glu Pro Lys Glu Val Thr Ala Ser Leu 165 170 17525196PRTRotavirus 25Met Ser Leu Ser Ile Asp Val Thr Ser Leu Pro Ser Ile Ser Ser Ser 1 5 10 15Ile Tyr Lys His Glu Ser Ser Ser Thr Thr Ser Thr Leu Ser Gly Lys 20 25 30Ser Ile Gly Arg Ser Glu Gln Tyr Val Ser Pro Asp Ala Glu Ala Phe 35 40 45Asn Lys Tyr Met Leu Ser Lys Ser Pro Glu Asp Ile Gly Pro Ser Asp 50 55 60Ser Asn Asp Pro Leu Thr Ser Phe Ser Ile Arg Ser Asn Ala Val Lys65 70 75 80Thr Asn Ala Asp Ala Gly Val Ser Met Asp Ser Ser Thr Gln Ser Arg 85 90 95Pro Ser Ser Asn Val Gly Cys Asp Gln Val Asp Phe Ser Leu Ser Lys 100 105 110Gly Ile Lys Val Asn Ala Asn Leu Asp Ser Ser Ile Ser Val Ser Thr 115 120 125Val Ser Lys Lys Glu Lys Ser Lys Ser Asp His Lys Asn Arg Lys His 130 135 140Tyr Pro Arg Ile Glu Ala Asp Ser Asp Ser Asp Glu Tyr Val Leu Asp145 150 155 160Asp Ser Asp Ser Asp Asp Gly Lys Cys Lys Asn Cys Lys Tyr Lys Lys 165 170 175Lys Tyr Phe Ala Leu Arg Met Arg Met Lys Gln Val Ala Met Gln Leu 180 185 190Ile Glu Asp Leu 19526322PRTRotavirus 26Met Tyr Gly Ile Glu Tyr Thr Thr Ile Leu Ile Phe Leu Ile Ser Ile 1 5 10 15Ile Leu Leu Asn Tyr Ile Leu Lys Ser Val Thr Arg Ile Met Asp Tyr 20 25 30Ile Ile Tyr Arg Phe Leu Leu Ile Thr Val Phe Ala Leu Thr Arg Ala 35 40 45Gln Asn Tyr Gln Leu Pro Ile Thr Gly Ser Met Asp Ala Val Tyr Thr 50 55 60Asn Ser Thr Gln Glu Glu Val Phe Leu Thr Ser Thr Leu Cys Leu Tyr65 70 75 80Tyr Pro Thr Glu Ala Ser Thr Gln Ile Asn Asp Gly Asp Trp Lys Asp 85 90 95Ser Leu Ser Gln Met Phe Leu Thr Lys Gly Trp Pro Thr Gly Ser Val 100 105 110Tyr Phe Lys Glu Tyr Ser Ser Ile Val Asp Phe Ser Val Asp Pro Gln 115 120 125Leu Tyr Cys Asp Tyr Asn Leu Val Leu Met Lys Tyr Asp Gln Ser Leu 130 135 140Glu Leu Asp Met Ser Glu Leu Ala Asp Leu Ile Leu Asn Glu Trp Leu145 150 155 160Cys Asn Pro Met Asp Val Thr Leu Tyr Tyr Tyr Gln Gln Ser Gly Glu 165 170 175Ser Asn Lys Trp Ile Ser Met Gly Ser Ser Cys Thr Val Lys Val Cys 180 185 190Pro Leu Asn Thr Gln Thr Leu Gly Ile Gly Cys Gln Thr Thr Asn Val 195 200 205Asp Ser Phe Glu Met Ile Ala Glu Asn Glu Lys Leu Ala Ile Val Asp 210 215 220Val Val Asp Gly Ile Asn His Lys Ile Asn Leu Thr Thr Thr Thr Cys225 230 235 240Thr Ile Arg Asn Cys Lys Lys Leu Gly Pro Arg Glu Asn Val Ala Val 245 250 255Ile Gln Val Gly Gly Ser Asn Val Leu Asp Ile Thr Ala Asp Pro Thr 260 265 270Thr Asn Pro Gln Thr Glu Arg Met Met Arg Val Asn Trp Lys Lys Trp 275 280 285Trp Gln Val Phe Tyr Thr Ile Val Asp Tyr Ile Asn Gln Ile Val Gln 290 295 300Val Met Ser Lys Arg Ser Arg Ser Leu Asn Ser Ala Ala Phe Tyr Tyr305 310 315 320Arg Val27326PRTRotavirus 27Met Tyr Gly Ile Glu Tyr Thr Thr Ile Leu Thr Ile Leu Ile Ser Ile 1 5 10 15Ile Leu Leu Asn Tyr Ile Leu Lys Thr Ile Thr Asn Thr Met Asp Tyr 20 25 30Ile Ile Phe Arg Phe Leu Leu Leu Ile Ala Leu Ile Ser Pro Phe Val 35 40 45Arg Thr Gln Asn Tyr Gly Met Tyr Leu Pro Ile Thr Gly Ser Leu Asp 50 55 60Ala Val Tyr Thr Asn Ser Thr Ser Gly Glu Pro Phe Leu Thr Ser Thr65 70 75 80Leu Cys Leu Tyr Tyr

Pro Ala Glu Ala Lys Asn Glu Ile Ser Asp Asp 85 90 95Glu Trp Glu Asn Thr Leu Ser Gln Leu Phe Leu Thr Lys Gly Trp Pro 100 105 110Ile Gly Ser Val Tyr Phe Lys Asp Tyr Asn Asp Ile Asn Thr Phe Ser 115 120 125Val Asn Pro Gln Leu Tyr Cys Asp Tyr Asn Val Val Leu Met Arg Tyr 130 135 140Asp Asn Thr Ser Glu Leu Asp Ala Ser Glu Leu Ala Asp Leu Ile Leu145 150 155 160Asn Glu Trp Leu Cys Asn Pro Met Asp Ile Ser Leu Tyr Tyr Tyr Gln 165 170 175Gln Ser Ser Glu Ser Asn Lys Trp Ile Ser Met Gly Thr Asp Cys Thr 180 185 190Val Lys Val Cys Pro Leu Asn Thr Gln Thr Leu Gly Ile Gly Cys Lys 195 200 205Thr Thr Asp Val Asn Thr Phe Glu Ile Val Ala Ser Ser Glu Lys Leu 210 215 220Val Ile Thr Asp Val Val Asn Gly Val Asn His Lys Ile Asn Ile Ser225 230 235 240Ile Asn Thr Cys Thr Ile Arg Asn Cys Asn Lys Leu Gly Pro Arg Glu 245 250 255Asn Val Ala Ile Ile Gln Val Gly Gly Pro Asn Ala Leu Asp Ile Thr 260 265 270Ala Asp Pro Thr Thr Val Pro Gln Val Gln Arg Ile Met Arg Ile Asn 275 280 285Trp Lys Lys Trp Trp Gln Val Phe Tyr Thr Val Val Asp Tyr Ile Asn 290 295 300Gln Val Ile Gln Val Met Ser Lys Arg Ser Arg Ser Leu Asp Ala Ala305 310 315 320Ala Phe Tyr Tyr Arg Ile 32528326PRTRotavirus 28Met Tyr Gly Ile Glu Tyr Thr Thr Val Leu Phe Tyr Leu Ile Ser Phe 1 5 10 15Val Leu Val Ser Tyr Ile Leu Lys Thr Ile Ile Lys Ile Met Asp Tyr 20 25 30Ile Ile Tyr Arg Ile Thr Phe Val Ile Val Val Leu Ser Val Leu Ser 35 40 45Asn Ala Gln Asn Tyr Gly Ile Asn Leu Pro Ile Thr Gly Ser Met Asp 50 55 60Thr Ala Tyr Ala Asn Ser Thr Gln Asp Asn Asn Phe Leu Phe Ser Thr65 70 75 80Leu Cys Leu Tyr Tyr Pro Ser Glu Ala Pro Thr Gln Ile Ser Asp Thr 85 90 95Glu Trp Lys Asp Thr Leu Ser Gln Leu Phe Leu Thr Lys Gly Trp Pro 100 105 110Thr Gly Ser Val Tyr Phe Asn Glu Tyr Ser Asn Val Leu Glu Phe Ser 115 120 125Ile Asp Pro Lys Leu Tyr Cys Asp Tyr Asn Val Val Leu Ile Arg Phe 130 135 140Val Ser Gly Glu Glu Leu Asp Ile Ser Glu Leu Ala Asp Leu Ile Leu145 150 155 160Asn Glu Trp Leu Cys Asn Pro Met Asp Ile Thr Leu Tyr Tyr Tyr Gln 165 170 175Gln Thr Gly Glu Ala Asn Lys Trp Ile Ser Met Gly Ser Ser Cys Thr 180 185 190Val Lys Val Cys Pro Leu Asn Thr Gln Thr Leu Gly Ile Gly Cys Gln 195 200 205Thr Thr Asn Thr Ala Thr Phe Glu Thr Val Ala Asp Ser Glu Lys Leu 210 215 220Ala Ile Ile Asp Val Val Asp Ser Val Asn His Lys Leu Asn Ile Thr225 230 235 240Ser Thr Thr Cys Thr Ile Arg Asn Cys Asn Lys Leu Gly Pro Arg Glu 245 250 255Asn Val Ala Ile Ile Gln Val Gly Gly Ser Asn Ile Leu Asp Ile Thr 260 265 270Ala Asp Pro Thr Thr Ser Pro Gln Thr Glu Arg Met Met Arg Val Asn 275 280 285Trp Lys Lys Trp Trp Gln Val Phe Tyr Thr Val Val Asp Tyr Ile Asp 290 295 300Gln Ile Val Gln Val Met Ser Lys Arg Ser Arg Ser Leu Asp Leu Ser305 310 315 320Ser Phe Tyr Tyr Arg Val 3252927DNAArtificial SequencePrimer 29ggctattaaa gctgtacaat ggggaag 273030DNAArtificial SequencePrimer 30ctaagcgttc taatcttgaa agaagtttgc 303127DNAArtificial SequencePrimer 31ggctattaaa ggctcaatgg cgtacag 273226DNAArtificial SequencePrimer 32ggtcatatct ccacaatggg gttggc 263325DNAArtificial SequencePrimer 33ggctattaaa gcagtacgag tagtg 253421DNAArtificial SequencePrimer 34ggtcacatca tgactagtgt g 213521DNAArtificial SequencePrimer 35ggctataaaa tggcttcgct c 213622DNAArtificial SequencePrimer 36ggtcacatcc tctggaaatt gc 223729DNAArtificial SequencePrimer 37ggcttttttt tgaaatgtct tgtgttagc 293824DNAArtificial SequencePrimer 38ggtcacagtt tttgctggct aggc 243926DNAArtificial SequencePrimer 39ggcttttaaa cgaagtcttc aacatg 264025DNAArtificial SequencePrimer 40ggtcacatcc tctcactata ccatc 254125DNAArtificial SequencePrimer 41ggcatttaat gcttttcagt ggttg 254222DNAArtificial SequencePrimer 42ggtcacataa cgcccctata gc 224329DNAArtificial SequencePrimer 43ggcttttaaa gcgtctcagt cgccgttcg 294423DNAArtificial SequencePrimer 44ggtcacataa gcgctttcta ttc 234524DNAArtificial SequencePrimer 45ggctttaaaa gcgagaattt ccgt 244622DNAArtificial SequencePrimer 46ggtcacatca tacatttcta ac 224727DNAArtificial SequencePrimer 47ggtcacatcg aacaattcta atctaag 274828DNAArtificial SequencePrimer 48ggtcacatcg aacaattctg accaaatc 284927DNAArtificial SequencePrimer 49ggtcacatca tacatttcta ttttagg 275027DNAArtificial SequencePrimer 50ggctttttaa aagttctgtt ccgagag 275123DNAArtificial SequencePrimer 51ggtcacatta agaccgttcc ttc 235224DNAArtificial SequencePrimer 52ggcttttaaa gcgctacagt gatg 245324DNAArtificial SequencePrimer 53ggtcacataa ctggagtggg gagc 245433DNAArtificial SequencePrimer 54cccaagcttg tgtggcattc tctataacat cgc 335533DNAArtificial SequencePrimer 55cccggatccg gctcatggat aagcttattc tgc 335633DNAArtificial SequencePrimer 56cccaagcttc aaatctgctt ctagcggctt acc 335733DNAArtificial SequencePrimer 57cccggatcct aaaggaaaga taccagctgt cac 335833DNAArtificial SequencePrimer 58cccaagcttc cttttgagat agcactttct ctg 335933DNAArtificial SequencePrimer 59cccggatcca ccacaacaat ttgattttag agc 336024DNAArtificial SequencePrimer 60cttctttttg atgttcttcc ttag 246124DNAArtificial SequencePrimer 61tgtagcgaat tatgactggg ttcc 246233DNAArtificial SequencePrimer 62cccaagctta agaaatgcat tctcgtaact gtc 336333DNAArtificial SequencePrimer 63cccggatccg tcaatctaga atgtttattc cac 336424DNAArtificial SequencePrimer 64ttgaatctca acagctgcaa ttcc 246524DNAArtificial SequencePrimer 65aaacgttagt ggagttctag cgac 246633DNAArtificial SequencePrimer 66cccaagcttc ccagttaact ggagcataac ctg 336733DNAArtificial SequencePrimer 67cccggatcca actgactctc cggtcatctc agc 336824DNAArtificial SequencePrimer 68gaacgttgtt ggttgataag gacc 246924DNAArtificial SequencePrimer 69agtctttgaa gcgggaacag atgg 247033DNAArtificial SequencePrimer 70cccaagctta ttgacaacac tcaatgcacc acc 337133DNAArtificial SequencePrimer 71cccggatccg aattagatca cttgccgtta tgc 337224DNAArtificial SequencePrimer 72gatgcaccac tgacaaacat gagc 247324DNAArtificial SequencePrimer 73gatactggaa accgaggctc ttcc 247433DNAArtificial SequencePrimer 74cccaagcttt cggcagatta ccaattcctc cag 337533DNAArtificial SequencePrimer 75cccggatccc agcgtgtatt tacagtggct tcc 337624DNAArtificial SequencePrimer 76acgggccgtt tcgacatagt tagc 247724DNAArtificial SequencePrimer 77agaatacgcg ataccagttg gacc 247833DNAArtificial SequencePrimer 78cccaagcttt caagagtaga agttgcagca acc 337933DNAArtificial SequencePrimer 79cccggatcca aaggattatt gcagcaatgc aac 338024DNAArtificial SequencePrimer 80actctttact ctagtatata cctc 248124DNAArtificial SequencePrimer 81aaatcagaca ttgaacaaca gctg 248227DNAArtificial SequencePrimer 82tagctacagt tcgagagtca gtcatcc 278327DNAArtificial SequencePrimer 83caatagaatg gtatctaaga tcgatgg 278433DNAArtificial SequencePrimer 84cccaagcttg aattgtggcg gtggtgcgat acc 338533DNAArtificial SequencePrimer 85cccggatcca aaatgaagcg ggaaagtaat ccg 338624DNAArtificial SequencePrimer 86cgcttcacaa attaacaccg ccac 248724DNAArtificial SequencePrimer 87gaactggtat gcgtttacat cctc 248833DNAArtificial SequencePrimer 88cccaagcttc gtatgcagtg tccattgaac cag 338933DNAArtificial SequencePrimer 89cccggatccg cattaattgg aagaaatggt ggc 339024DNAArtificial SequencePrimer 90tatttctgtt gcagcttcag ttgg 249124DNAArtificial SequencePrimer 91gttggaggtt ctgatgttct cgac 249233DNAArtificial SequencePrimer 92cccaagctta cctgaaaatt atgtagtcca tcg 339333DNAArtificial SequencePrimer 93cccggatccc ccacaagttc aaagaatcat gcg 339424DNAArtificial SequencePrimer 94agcgtctagt gaccccgtta ttgg 249524DNAArtificial SequencePrimer 95aattcaagtt ggtggaccga acgc 249633DNAArtificial SequencePrimer 96cccaagcttt gtagtccatt attcgagtca ctg 339733DNAArtificial SequencePrimer 97cccggatccc aaactgagag aatgatgaga gtg 339824DNAArtificial SequencePrimer 98agcgtccatt gatcctgtta ttgg 249924DNAArtificial SequencePrimer 99tgtagctgta atacaagttg gtgg 2410033DNAArtificial SequencePrimer 100cccaagcttg tatccataga tccagtaatt ggc 3310133DNAArtificial SequencePrimer 101cccggatcca atggtggcaa gtattctaca ctg 3310224DNAArtificial SequencePrimer 102aatttgagtt ggagcttctg atgg 2410324DNAArtificial SequencePrimer 103aacagctgat cccacaactt ctcc 2410428DNAArtificial SequencePrimer 104gtacagttag gacagaagca atgtatgg 2810528DNAArtificial SequencePrimer 105atcggacctg atgactggtt gagaagcc 2810633DNAArtificial SequencePrimer 106cccaagcttt gaaacgtact gttcactcct acc 3310733DNAArtificial SequencePrimer 107cccggatcct tgaagcagat tccgattcag acg 3310833DNAArtificial SequencePrimer 108cccaagcttg tcgtttgaag cagaatcaga tgg 3310933DNAArtificial SequencePrimer 109cccggatccg tatcaacagt ttccaagaag gag 3311021DNAArtificial SequencePrimer 110gctgatatag aaggtggaaa g 2111121DNAArtificial SequencePrimer 111ggtcacatca tgactagtgt g 2111219DNAArtificial SequencePrimer 112gagcaccata gatgcagct 1911320DNAArtificial SequencePrimer 113ctgacagatg aagaaacatc 2011419DNAArtificial SequencePrimer 114gagcaccata gatgcagct 1911520DNAArtificial SequencePrimer 115gagtcagtta ctagatctgc 2011629DNAArtificial SequencePrimer 116ggcttttttt tgaaatgtct tgtgttagc 2911720DNAArtificial SequencePrimer 117gtgcataacg gcaagtgatc 2011824DNAArtificial SequencePrimer 118ggctttaaaa gcgagaattt ccgt 2411927DNAArtificial SequencePrimer 119ggtcacatcg aacaattcta atctaag 2712026DNAArtificial SequencePrimer 120ggcttttaaa agttctgttc cgagag 2612123DNAArtificial SequencePrimer 121ggtcacatta agaccgttcc ttc 2312219DNAArtificial SequencePrimer 122tatttaggtg acactatag 1912320DNAArtificial SequencePrimer 123taatacgact cactataggg 2012421DNAArtificial SequencePrimer 124gctgatatag aaggtggaaa g 2112521DNAArtificial SequencePrimer 125ggtcacatca tgactagtgt g 2112620DNAArtificial SequencePrimer 126gactgctatg gatttagagc 2012720DNAArtificial SequencePrimer 127gataatgcgt ataatgccac 2012827DNAArtificial SequencePrimer 128ggctattaaa gcagtacgag tagtgtg 2712920DNAArtificial SequencePrimer 129ctcaacagct gcaattcctg 2013021DNAArtificial SequencePrimer 130gctgatatag aaggtggaaa g 2113121DNAArtificial SequencePrimer 131ggtcacatca tgactagtgt g 2113221DNAArtificial SequencePrimer 132gctgatatag aaggtggaaa g 2113321DNAArtificial SequencePrimer 133ggtcacatca tgactagtgt g 2113427DNAArtificial SequencePrimer 134ggctattaaa gcagtacgag tagtgtg 2713523DNAArtificial SequencePrimer 135cgtgctatcg gtaaagaagt agt 2313620DNAArtificial SequencePrimer 136gtctcagttc gacattggac 2013723DNAArtificial SequencePrimer 137gaatatggag tgtcaagtgg gtc 2313827DNAArtificial SequencePrimer 138ggctattaaa gcagtacgag tagtgtg 2713923DNAArtificial SequencePrimer 139cgtgctatcg gtaaagaagt agt 2314019DNAArtificial SequencePrimer 140gagcaccata gatgcagct 1914120DNAArtificial SequencePrimer 141gagtcagtta ctagatctgc 2014222DNAArtificial SequencePrimer 142cagtaatgac tggcggagca gt 2214320DNAArtificial SequencePrimer 143ctgacagatg aagaaacatc 2014421DNAArtificial SequencePrimer 144ggctataaaa tggcttcgct c 2114519DNAArtificial SequencePrimer 145gtcacaaaat gctgtcatg 1914622DNAArtificial SequencePrimer 146cagtaatgac tggcggagca gt 2214720DNAArtificial SequencePrimer 147ctgacagatg aagaaacatc 2014819DNAArtificial SequencePrimer 148gagcaccata gatgcagct 1914920DNAArtificial SequencePrimer 149gagtcagtta ctagatctgc 2015022DNAArtificial SequencePrimer 150cagtaatgac tggcggagca gt 2215120DNAArtificial SequencePrimer 151ctgacagatg aagaaacatc 2015222DNAArtificial SequencePrimer 152cagtaatgac tggcggagca gt 2215322DNAArtificial SequencePrimer 153ggtcacatcc tctggaaatt gc 2215429DNAArtificial SequencePrimer 154ggcttttttt tgaaatgtct tgtgttagc 2915521DNAArtificial SequencePrimer 155gtctatatgg caaatctatg c 2115629DNAArtificial SequencePrimer 156ggcttttttt tgaaatgtct tgtgttagc 2915721DNAArtificial SequencePrimer 157gtctatatgg caaatctatg c

2115821DNAArtificial SequencePrimer 158ctcaaactga tttacatcat g 2115920DNAArtificial SequencePrimer 159gtgcataacg gcaagtgatc 2016021DNAArtificial SequencePrimer 160ctcaaactga tttacatcat g 2116120DNAArtificial SequencePrimer 161gtgcataacg gcaagtgatc 2016229DNAArtificial SequencePrimer 162ggcttttttt tgaaatgtct tgtgttagc 2916321DNAArtificial SequencePrimer 163gtctatatgg caaatctatg c 2116421DNAArtificial SequencePrimer 164cagaggaaat gtagaaatga g 2116520DNAArtificial SequencePrimer 165caatccatgt ctctgaatgc 2016621DNAArtificial SequencePrimer 166cagaggaaat gtagaaatga g 2116720DNAArtificial SequencePrimer 167caatccatgt ctctgaatgc 2016821DNAArtificial SequencePrimer 168ctcaaactga tttacatcat g 2116920DNAArtificial SequencePrimer 169gtgcataacg gcaagtgatc 2017021DNAArtificial SequencePrimer 170ctcaaactga tttacatcat g 2117120DNAArtificial SequencePrimer 171gtgcataacg gcaagtgatc 2017224DNAArtificial SequencePrimer 172ggctttaaaa gcgagaattt ccgt 2417327DNAArtificial SequencePrimer 173ggtcacatcg aacaattcta atctaag 2717424DNAArtificial SequencePrimer 174ggctttaaaa gcgagaattt ccgt 2417527DNAArtificial SequencePrimer 175ggtcacatcg aacaattcta atctaag 2717624DNAArtificial SequencePrimer 176ggctttaaaa gcgagaattt ccgt 2417720DNAArtificial SequencePrimer 177gtacatgatg atcccattga 2017827DNAArtificial SequencePrimer 178ggctttttaa aagttctgtt ccgagag 2717923DNAArtificial SequencePrimer 179ggtcacatta agaccgttcc ttc 2318027DNAArtificial SequencePrimer 180ggctttttaa aagttctgtt ccgagag 2718123DNAArtificial SequencePrimer 181ggtcacatta agaccgttcc ttc 2318227DNAArtificial SequencePrimer 182ggctttttaa aagttctgtt ccgagag 2718323DNAArtificial SequencePrimer 183ggtcacatta agaccgttcc ttc 2318428DNAArtificial SequencePrimer 184cttatcaatc atttccagct gacgtctc 2818527DNAArtificial SequencePrimer 185tccatatgaa ccaaaagagg tgactgc 2718639DNAArtificial SequencePrimer 186gttagtggag ttctagcgac atattttaaa atgtagaat 3918721DNAArtificial SequencePrimer 187ggtcacatca tgactagtgt g 21

Claims

1. An isolated nucleic acid molecule having a sequence selected from the group consisting of: SEQ ID NO:1-14, inclusive.

2. An isolated nucleic acid molecule encoding a polypeptide having a sequence selected from the group consisting of: SEQ ID NO: 15-28, inclusive.

3. An isolated nucleic acid molecule having the sequence of SEQ ID NO: 1 and having a nucleotide change to a G at nucleotide 2120

4. An isolated nucleic acid molecule having the sequence of SEQ ID NO: 2 and having one or more of the following nucleotide changes: a C at nucleotide 493, and a T at nucleotide 947.

5. An isolated nucleic acid molecule having the sequence of SEQ ID NO:3 and having one or more of the following nucleotide changes: an A at nucleotide 169, a C at nucleotide 283, a C at nucleotide 448, a C at nucleotide 874, a C at nucleotide 1306, and a C at nucleotide 2388.

6. An isolated nucleic acid molecule having the sequence of SEQ ID NO:4 and having one or more of the following nucleotide changes: a C at nucleotide 119, a G at nucleotide 417, a G at nucleotide 809, a C at nucleotide 977, an A at nucleotide 1463, a C at nucleotide 1481, a C at nucleotide 1608, a C at nucleotide 1755, and an A at nucleotide 1953.

7. An isolated nucleic acid molecule having the sequence of SEQ ID NO:5 and having one or more of the following nucleotide changes: an A at nucleotide 75, a T at nucleotide 84, a C at nucleotide 347, a T at nucleotide 667, a C at nucleotide 1186, a G at nucleotide 1219, and an A at nucleotide 1204.

8. An isolated nucleic acid molecule having the sequence of SEQ ID NO: 6 and having one or more of the following nucleotide changes: a C at nucleotide 376, an A at nucleotide 756, an A at nucleotide 1008, and a G at nucleotide 1041.

9. An isolated nucleic acid molecule having the sequence of SEQ ID NO: 7 and having a nucleotide change to a G at nucleotide 387.

10. An isolated nucleic acid molecule having the sequence of SEQ ID NO:10 and having one or more of the following nucleotide changes: an A at nucleotide 92, an A at nucleotide 174, and a G at nucleotide 218.

11. An isolated nucleic acid molecule having the sequence of SEQ ID NO: 11 and having a nucleotide change to A at nucleotide 180.

12. An isolated nucleic acid molecule having the sequence of SEQ ID NO: 12 and having a nucleotide change to an A at nucleotide 556.

13. An isolated nucleic acid molecule having the sequence of SEQ ID NO: 14 and having a nucleotide change to a G at nucleotide 263.

14. A vector comprising an isolated nucleic acid molecule of claim 1.

15. A recombinant host cell comprising a vector of claim 14.

16. A method for producing a polypeptide encoded by an isolated nucleic acid molecule, comprising culturing the recombinant host cell of claim 15 under conditions suitable for expression of said nucleic acid molecule.